Citation
HIV-1 maternal transmission and pediatric disease occur in the absence of detectable infection in CD14+ monocytes and in direct association with proviral copy number in CD4+ T lymphocytes

Material Information

Title:
HIV-1 maternal transmission and pediatric disease occur in the absence of detectable infection in CD14+ monocytes and in direct association with proviral copy number in CD4+ T lymphocytes
Creator:
Aleixo, Lucia Fernandes
Publication Date:
Language:
English
Physical Description:
vii, 171 leaves : ill. ; 29 cm.

Subjects

Subjects / Keywords:
AIDS ( jstor )
Blood ( jstor )
Diseases ( jstor )
DNA ( jstor )
HIV ( jstor )
HIV 1 ( jstor )
Infants ( jstor )
Infections ( jstor )
Monocytes ( jstor )
T lymphocytes ( jstor )
Antigens, CD14 ( mesh )
CD4-Positive T-Lymphocytes ( mesh )
Department of Pathology and Laboratory Medicine thesis Ph.D ( mesh )
Disease Reservoirs ( mesh )
Disease Transmission, Vertical ( mesh )
Dissertations, Academic -- College of Medicine -- Department of Pathology and Laboratory Medicine -- UF ( mesh )
HIV Infections ( mesh )
HIV Infections -- etiology ( mesh )
HIV Infections -- transmission ( mesh )
HIV-1 -- pathogenicity ( mesh )
Infant ( mesh )
Monocytes ( mesh )
Pregnancy ( mesh )
Zidovudine -- pharmacology ( mesh )
Zidovudine -- therapeutic use ( mesh )
Genre:
bibliography ( marcgt )
theses ( marcgt )
non-fiction ( marcgt )

Notes

Thesis:
Thesis (Ph. D.)--University of Florida, 1996.
Bibliography:
Includes bibliographical references (leaves 143-170).
Additional Physical Form:
Also available online.
General Note:
Typescript.
General Note:
Vita.
Statement of Responsibility:
by Lucia Fernandes Aleixo.

Record Information

Source Institution:
University of Florida
Holding Location:
University of Florida
Rights Management:
The University of Florida George A. Smathers Libraries respect the intellectual property rights of others and do not claim any copyright interest in this item. This item may be protected by copyright but is made available here under a claim of fair use (17 U.S.C. §107) for non-profit research and educational purposes. Users of this work have responsibility for determining copyright status prior to reusing, publishing or reproducing this item for purposes other than what is allowed by fair use or other copyright exemptions. Any reuse of this item in excess of fair use or other copyright exemptions requires permission of the copyright holder. The Smathers Libraries would like to learn more about this item and invite individuals or organizations to contact the RDS coordinator (ufdissertations@uflib.ufl.edu) with any additional information they can provide.
Resource Identifier:
028245642 ( ALEPH )
48632008 ( OCLC )

Downloads

This item has the following downloads:


Full Text













HIV-1 MATERNAL TRANSMISSION AND PEDIATRIC DISEASE
OCCUR IN THE ABSENCE OF DETECTABLE INFECTION IN
CD14+ MONOCYTES AND IN DIRECT ASSOCIATION WITH
PROVIRAL COPY NUMBER IN CD4+ T LYMPHOCYTES


















By

LUCIA FERNANDES ALEIXO



















A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY

UNIVERSITY OF FLORIDA

1996



































I dedicate this thesis to my dear parents, Zelia and

Mauricio Aleixo.















ACKNOWLEDGMENTS


First, I would like to thank my husband Stephen A. Hogg,

who gave up many things, including his life by the ocean, to

move to Gainesville, FL, and stay by my side as I worked on my

PhD. I am very grateful to my parents for all the support

provided since the begining of this journey. I also would like

to thank my sister, Ursula A. Hoffmaster. It meant very much

to know that she was just a couple of hours away from me.

I am thankful to Dr. Maureen M. Goodenow, my advisor and

friend, who provided great support and orientation throughout

my study; Dr. John W. Sleasman, for his bright ideas and good

advice; Drs. John Aris, Saeed Khan, and James Zucali,

reassuring members of my committee. I would like to thank all

the members of the Goodenow's lab, who made it fun to go to

work; specially, I am thankful to Mabel Rojas, for without her

technical help it would have been hard to accomplish

everything that I did.

Also, I would like to thank Dr. Jos6 Renan C. Mello, for

professional guidance, and my sponsor CNPq, Conselho Nacional

de Desenvolvimento Cientifico e Tecnol6gico, from Brazil.

Finally, I am grateful to my dogs Feia, Casper, and Ruga,

for their unconditional love.



iii
















TABLE OF CONTENTS


ACKNOWLEDGEMENTS . . . . . . . . . .iii

ABSTRACT . . . . . . . . . . . . vi

CHAPTERS

1 INTRODUCTION . . . . . . . .. . 1

The HIV-1 Virion . . . . . . . . 2
Immunopathogenesis of HIV-1 Infection . . .. 13
Monocyte Infection of HIV-1 . . . . .. 20
Vertical Transmission of HIV-1 . . . . .. 23
Pediatric HIV-1 Infection . . . . . .. 27

2 MONOCYTE SELECTION TECHNIQUE . . . . .. 30

Introduction . . ..... . . . . 30
Materials and Methods . . . . . . .. 31
Results . . . . . . . . . . 38
Discussion . . . . . . . . . 52

3 VERTICAL TRANSMISSION OF HIV-1 . . . . .. 56

Introduction . . . . . . . . ... 56
Materials and Methods . . . . . . .. 58
Results . . . . . . . . . . 63
Discussion . . . . . . . . . 76

4 PEDIATRIC HIV-1 INFECTION OF MONOCYTES AND CD4+ T
LYMPHOCYTES . . . . . . . . . 80

Introduction . . . . . . . . . 80
Materials and Methods . . . . . . .. 82
Results . . . . . . . . . . 96
Discussion . . . . . . . . . 123

5 CONCLUSION . . . . . . . . . 131

Maternal transmission of HIV-1 . . . . 132
HIV-1 infection of blood monocytes and CD4 T
lymphocytes . . . . . . . . ... 137



iv












REFERENCE LIST . . . . . . . . 143

BIOGRAPHICAL SKETCH . . . . . ... .171




























































v
















Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy

HIV-1 MATERNAL TRANSMISSION AND PEDIATRIC DISEASE
OCCUR IN THE ABSENCE OF DETECTABLE INFECTION IN
CD14+ MONOCYTES AND IN DIRECT ASSOCIATION WITH
PROVIRAL COPY NUMBER IN CD4+ T LYMPHOCYTES


By

L6cia Fernandes Aleixo

August, 1996

Chairperson: Maureen M. Goodenow
Major Department: Pathology and Laboratory Medicine

Pediatric HIV infection is a serious health problem in

the world today. Most children are infected through their

mothers. However, not all infants born to HIV positive mothers

become infected. Furthermore, vertical transmission varies in

different geographical regions. Why some mothers transmit the

virus and others do not, is not well understood. Multiple

factors are associated with mother-to-child transmission,

including disease stage of the mother, virus phenotype, levels

of maternal virus and obstetrical factors. Hypothesizing that

characteristics of the maternal virus are critical for

pediatric infection, peripheral blood mononuclear cells (PBMC)

from mothers and infants were examined to determine: 1. main

target cell of HIV-1 (CD4' T cells or monocytes); 2.



vi









association of cell-associated proviral levels with

transmission (mothers treated with zidovudive [ZDV] versus

untreated mothers); and 3. association of pediatric proviral

levels with timing of infection (in utero versus perinatal)

and progression of disease. The conclusions of this study are

as follows: 1. Blood monocytes are not a virus reservoir in

vivo, and CD4' T lymphocytes are the main cell type infected

in mothers and infants; 2. Virus with macrophage-tropic

characteristics are detected in PBMC cultures; 3. Levels of

maternal virus in CD4+ T cells can predict vertical

transmission in the absence of ZDV; 4. ZDV does not reduce

transmission by lowering maternal proviral burden; 5. Levels

of infected CD4+T cells in infants are associated directly

with acute and chronic stage disease; 6. In infants, memory

and naive CD4+ T cells are equally infected by HIV-1, while in

children >2 years of age, the memory T cell subtype is

preferentially infected. These findings will contribute to the

understanding of the immunopathogenesis of HIV-1 pediatric

infection and maternal-infant transmission, critical to the

development of drugs and better therapeutic strategies.













vii















CHAPTER 1
INTRODUCTION


The human immunodeficiency virus (HIV) was first

described as the causative agent of AIDS (acquired immune

deficiency syndrome) in 1983 by a group leaded by L.

Montagnier, at the Pasteur Institute in France (10). Since

then, HIV has been intensively studied for several research

groups worldwide. It is not known whether HIV is a virus

recently transmitted to humans or if it has been present in

man for many generations. HIV is spread by different routes

including sexual contact, exposure to infected blood products

and maternal transmission to the child (40).

By the end of 1992, it was estimated by the World Health

Organization (WHO) that 13 million persons, including 1

million children, were infected with HIV in the world. Of all

cases in children reported in the United States at that time,

90% were attributable to vertical transmission (210). The

astonishing figures in the rapid increase of HIV disease in

the world urge the scientific community to develop means of

stopping this epidemics. With this in mind, my studies were

oriented towards understanding clinical and virological

factors in maternal-infant transmission of HIV type 1.




1









2

The HIV-1 Virion


Classification. HIV-1 is a lentivirus member of the

family of Retroviridae (retrovirus), which also includes

oncogenic retroviruses and spumaviruses. Retroviruses are

characterized by the presence of reverse transcriptase in the

virions. Lentiviruses exist in different species and include

visna and maedi viruses of the sheep, equine infectious anemia

virus (EIAV), caprine arthritis-encephalitis virus, bovine

immune deficiency virus, feline immune deficiency virus and

simian immune deficiency virus, besides human immune

deficiency viruses types 1 and 2 (54) (Fig. 1.1).

This subfamily of retroviruses causes slowly developing

disease, characterized by a long incubation period and

extended course. A factor in the protracted course of HIV

disease could be the high mutability of the HIV-1 genome.

Structure. By electron microscopy, the HIV-1 virion has

an icosahedral structure (75) containing 72 spikes in its

surface, the envelope glycoproteins (gp) (59, 204). These

proteins are cleaved from a common precursor gpl60 by a

cellular protease, into an external surface protein gpl20 and

a transmembrane protein gp41 (120), which bind in a

noncovalent way (90). The envelope gpl20 is comprised of 5

hypervariable regions, V1-V5. A small site within gpl20,

consisting of 24 amino acids localized in the third variable

region (V3), is HIV's principal neutralizing domain (71, 212).

The binding site for the cellular receptor CD4 is localized in









3









Oncoviruses

Rous sarcoma virus (chickens)
Feline leukemia virus (FeLV)
Bovine leukemia virus (BLV)
Human T-leukemia virus, Type I (HTLV-I)
Human T-leukemia virus, Type II (HTLV-II)


Spumaviruses

Simian foamy virus (SFV)
Bovine syncytial virus (BSV)
Feline syncytium-forming virus (FSFV)
Human nasopharyngeal carcinoma virus (NPCV)


Lentiviruses

Equine infectious anemia virus (EIAV)
Caprine arthritis encephalitis virus (CAEV)
Visna virus (sheeps)
Bovine immunodeficiency virus (BIV)
Feline immunodeficiency virus (FIV)
Human immunodeficiency virus (HIV)
Simian immunodeficiency virus (SIV)
Chimpanzee immunodeficiency virus (CIV)



Figure 1.1. RNA viruses. Animal RNA viruses are classified
into 3 families: oncoviruses, or transforming viruses, cause
cancer; spumaviruses, also called "foamy" viruses because of
the appearance they induce in cells they infect; and









4

gpl20, in a region between V4 and V5 (206). The envelope

protein gp41 seems to be responsible for the fusion of viral

and cellular membranes (112). The core is cone-shaped and the

4 nucleocapsid (NC) proteins are proteolytically cleaved from

a 55 kDa precursor by the HIV-1 protease (PR) into p24, p17,

p9, and p7 (89). The p24 Gag protein is the main component of

the inner NC. Inside the core there are 2 identical copies of

single stranded RNA. The viral enzymes reverse transcriptase

(RT), integrase (IN) and PR are cleaved from the Pol precursor

(189), and together with the NC proteins p9 and p7, they are

found closely associated to the RNA. RT acts to form a double-

stranded DNA copy of the virus RNA and IN is involved in viral

integration. The NC p17 protein associates with the inner

surface of the lipid bilayer to stabilize the virion (82). A

diagram of the HIV-1 virion is shown in Fig. 1.2.

Genomic organization. Lentiviruses are distinguished from

other retroviruses by the presence of a complex genome. Most

oncogenic retroviruses that are capable of replication contain

only 3 genes (gag, pol, and env) (197). However, HIV-1

contains not only these 3 essential genes but also at least 6

additional genes (tat, rev, nef, vif, vpr, and vpu) (82) (Fig.

1.3).

The HIV-1 genome is approximately 9.8 Kb. It has a 5' and

a 3' long terminal repeat (LTR), composed of U3, R, and U5

regions, which contain regulatory sequences recognized by

various cellular transcription factors. The TATA box homology











5













Internal envelope
(p17) Envelope
RNA

External envelope
glycoprotein
(gp1 20)
Reverse
transcriptase

Transmembrane
glycoprotein
(gp41) Protease





Core protein
(p24)
Integrase









Figure 1.2. Diagram of the HIV-1 virion. Envelope (gpl20 and
gp41) and nucleocapsid (p17 and p24) proteins are identified.
Also shown are viral enzymes reverse transcriptase, protease,
and integrase, and the virus diploid RNA genome (Modified from
ref. 3).









6















5' LTR TAT 3' LTR
GAG VIF REV NEF

I PL1 0
POL EL U3

I/ ENV
R U5 VPR VPU R U5



Figure 1.3. Genomic structure of HIV-1. Represented are the 5'
and 3' long terminal repeats (LTRs), structural (gag, pol,
env), regulatory (tat, rev) and accessory (nef, vif, vpr, vpu)
genes (Modified from ref. 133).









7

is an essential element for trans-activation and serves as the

binding site for the TATA box DNA-binding protein TFIID,

functioning in transcription initiation. Immediately upstream

the TATA box are 3 G-C-rich sequences which bind the cellular

transcription factor SP1. Within the enhancer element is the

consensus recognition sequence for the DNA-binding protein

nuclear factor kappa B (NFKB). Additional DNA-binding proteins

are nuclear factor of activated T cells (NFTA-1), activation

protein-1 (AP-1), and the negative regulatory element (NRE).

DNA-binding proteins which bind to the leader region include

CTF/NF-1 and leader-binding protein (LBP-1). The trans-

activation response sequence (TAR)-binding protein UBP-1 binds

directly to the TATA box homology (187).

Protein products have been identified from 10 open

reading frames in the HIV-1 genome. The primary transcript of

HIV-1, Gag-Pol precursor p160, is translated into Gag

precursor p55 which gives rise to 5 structural proteins, and

the Pol precursor protein which is cleaved into the viral

replication enzymes. Splicing events producing many subgenomic

mRNA are important for the synthesis of other viral proteins.

The rev gene appears to determine the amount of unspliced to

singly and multiply spliced mRNA. The envelope glycoproteins

gpl20 and gp41 are made from a precursor gpl60, a single-

spliced message from the full-length viral mRNA.

Gene products of other spliced mRNAs give rise to at

least 6 regulatory and accessory proteins, namely tat and rev









8

(regulatory) (53, 153), and nef, vif, vpr, and vpu (accessory)

(16, 37, 73, 79, 194). Major functions of the protein products

are: Tat, transactivation; Rev, regulation of viral protein

expression; Nef, virus suppression, signal transduction, and

cell activation; Vif, increases virus infectivity and cell-to-

cell transmission; Vpr, helps in virus replication; and Vpu,

helps in virus release.

Heterogeneity of HIV. Two major types of AIDS viruses,

HIV-1 and HIV-2, can be identified. HIV-2 differs by more than

55% from HIV-1, the major difference residing in the envelope

glycoproteins (85). Antibodies to HIV-2 generally cross-react

with Gag and Pol proteins of HIV-1, but envelope proteins may

not be detected (76). HIV-2 glycoproteins seem to cross-react

with envelope proteins from SIV, and because of the marked

similarities in their sequences, it appears that HIV-2 was

derived from SIV (115). Individuals infected with HIV-2

survive longer than with HIV-1 infection, suggesting that HIV-

2 is less pathogenic to humans (205).

Based on the viral envelope sequences, 9 subtypes of HIV-

1 (A to I) have been identified in the world (134) (Fig. 1.4).

The clades differ from each other by at least 20% in the amino

acid composition of the envelope region, and 15% in the Gag

region. Within each clade, the differences in Env can be up to

10%, and up to 8% in the Gag region (133). Clade A is found in

Central Africa, B in North and South America and in Europe,

subtype C in South Africa and India, subtype D in Central









9
B
D
LAI MN SF2 JY ELI
ELU
Z2Z6


C D760
D747 TN243 E

BRA7944 F
Z321
U455
A
A SF170




SIVCPZ















ANT70

MVP5180
0
O

Figure 1.4. A neighbor-joining tree showing the classification
of HIV-1 sequences into 6 clusters, A through F, based upon
envelope coding sequences. A chimpanzee virus sequence
(SIVCPZ) and 2 highly divergent Cameroonian sequences
designated O (for "outlying"), are also shown. The sequence
subtypes A through F are each 30% different from one another
and about 50% different from the O group sequences (Modified
from ref. 106).









10

Africa, subtype E in Thailand, and F in Brazil (107, 129) and

Romania (57). G, H, and I are clades recently found in Africa,

Russia, and Taiwan (133).

Viruses recovered from one individual have several

conserved restriction enzyme sites, which identify the virus

as coming from the same person (86). Viruses from the same

patient form a heterogenous population, referred to as

quasispecies (80), and the diversity within an individual

usually ranges up to no more than 7% (133). At least 6% of the

viral genome can differ among strains from different

individuals. Isolates can vary in both synonymous (mutations

that do not affect amino acid expression) and nonsynonymous

(mutations that affect amino acid expression) sequence

changes. Up to 40% nonsynonymous mutations can be observed in

regulatory and envelope gene products (132). The viral RT

appears to be responsible to changes in the genome, since up

to 10 base changes may occur per replicative cycle (147).

Life cycle. HIV-1 infects cells expressing at their

surface the CD4 protein, which acts as the viral receptor. The

55 kDa CD4 molecule has 2 important functions in immune

responses; it serves as a cell-cell adhesion molecule and it

also functions as a signal transducer (1). The major cellular

targets for HIV-1 in vivo are the CD4 T lymphocyte and tissue

macrophages. The HIV-1 envelope protein gpl20 binds to CD4,

while gp41 causes its fusion to the cell membrane. A diagram

of the life cycle of HIV-1 is shown in Fig. 1.5.


































,8
111





















Figure 1.5. HIV-1 life cycle. The steps are as follows: 1,
attachment; 2, uncoating; 3, reverse transcription; 4,
circularization; 5, integration; 6, transcription; 7,
translation; 8, core assembly; 9, final assembly and virus
budding. (- RNA; ----, DNA) (Modified from ref. 106).









12

After internalization, the viral RNA still associated

with the core proteins is reverse transcribed, eventually

forming double-stranded DNA. Binding of the tRNA primer starts

the process. Synthesis of DNA to the end of the 5' R region

(minus-strand strong stop DNA), template switching and

elongation to complete the minus strand up to the primer

binding site (PBS) follow. Synthesis of the 5' LTR is

initiated from the 3' end of the minus-strand DNA (plus-strand

strong stop). A second template-switching occurs and synthesis

of double-stranded DNA molecule is completed (198). The first-

strand DNA copy of the viral RNA is mediated by the virus RT.

Second-strand DNA synthesis, also mediated by RT, initiates

after partial degradation of the RNA by viral ribonuclease H

(82). The DNA copies are transported to the nucleus as a

preintegration complex with core and IN proteins, where the

viral DNA integrates into the host genome. The integration

process is essential for virus replication and it appears to

be random (78), although recent reports suggest that HIV-1 may

integrate preferentially into L1Hs (human L1 elements)

repetitive elements in the human genome (188).

The HIV-1 LTR is the virus promoter region. Cellular

transcription factors seem to be of utmost importance in the

initiation of early mRNA transcription and include NF-KB, AP-1

and SP-1, among others (192).

Following integration, double-spliced transcripts

encoding the genes tat, rev, and nef, are the earliest mRNA









13

species produced (99). In the late stages, structural and

enzymatic proteins encoded by gag-pol and env are produced,

and the transition between the synthesis of early-regulatory

and late-structural products appears to be dependent on Rev

(153).

Assembly of the HIV-1 virion involves aggregation of the

core in the cytoplasm, which contains the viral RNA, Gag and

Pol proteins. The assembled virion buds through the plasma

membrane, when it acquires the lipid bilayer and env gene

products (128).


Immunopathogenesis of HIV-1 Infection


Natural history. HIV-1 disease causes a variety of

symptoms, from apparently silent infection to clinical

disease. A main feature of the immunopathogenesis of HIV-1 is

the depletion of CD4' T lymphocytes, eventually leading to

immune deficiency and AIDS. A diagram of events that happen

during HIV-1 infection is shown in Fig. 1.6.

In the initial days following acute infection, high

levels of virus replication take place in the activated

lymphocytes in the lymph nodes. Up to 5 X 106 virions/ml of

plasma can be detected during this stage (145), the extent of

virus production most likely reflecting the susceptibility of

the individual's PBMC to the virus. During this stage the

numbers of CD8+ T cells rise, as seen in other viral

infections (14). The high viremia is a transitory process and









14











4- ----

p .. in b o s.o. S s.








Acute Asymptomatic ARC AIDS
Infection Carrier




Figure 1.6. Diagram of events occuring after HIV-1 infection.
High levels of virus (-) can be detected in the blood during
acute phase of infection, before seroconversion. Subsequently
this viremia is reduced to lower levels (phase 1). With the
onset of clinical symptoms-AIDS, high levels of viremia are
detected once again (phase 2). The CD4r T cell number (...)
decreases during acute infection, returns to a level somewhat
bellow normal, then starts a slow decrease over time. A marked
decrease in CD4' T cell counts can be observed in some
individuals as they develop symptoms. The number of CD8( T
cells (---) rises during primary infection, to return to
values just above normal, staying elevated until the final
stages of disease. However, the CD8 cell anti-HIV responses
(-...-) begin to decrease around the time of symptoms, to
decrease steadly as disease progression occurs. ARC, Aids
related complex (Modified from ref. 106).









15

within weeks after acute infection, viral burden is

downregulated as an effective immune response develops, which

includes antibodies and cytotoxic T cells (144). Cellular

immune responses are probably the first effective antiviral

activity produced, since CD8' T cell anti-HIV responses have

been noted even prior to seroconversion (110). However,

despite declines of viral load early in the course of disease,

HIV replication does not stop and tends to increase over time

(91). Germinal centers in the lymph nodes contain large

amounts of HIV-1 in the early and intermediate stages of

infection (70).

Three to 4 months after the primary infection, CD4 T

cells rise to near normal values, before they start a steady

decrease, estimated to be 25-60 cells/Al per year (102). The

major cause of CD4 T cell death during this stage may be

apoptosis, since at this phase of infection the predominant

virus detected is the noncytopathic macrophage-tropic strain

(130). During this period, CD8+ T cell number remains slightly

elevated. Virus replication continues, particularly in the

lymphoid tissues (142).

When the individual starts to show symptoms of disease,

CD4 T cells have usually dropped to around 200 cells/jl

(adults) and levels of virus in peripheral blood and lymph

nodes rise again. A reduction in cytotoxic CD8+ T cell

responses can also be demonstrated at this stage (110).









16

Progression to disease. Following infection of HIV-1 the

majority of patients experience a long asymptomatic period

prior to the development of AIDS, while some individuals

become immunosuppressed and develop opportunistic infections

rapidly (8). The average time from the onset of HIV-1

infection to clinical AIDS usually ranges from 7 to 10 years.

A small group of patients (5%), however, remains clinically

asymptomatic despite prolonged infection, and is called long-

term nonprogressors. Long-term survivors is a broader

definition and includes both asymptomatic and symptomatic

patients who generally have been infected for over 10 years.

Long-term nonprogressors have lower levels of

intracellular and plasma virus, compared to symptomatic

individuals. The virus strain identified is relatively

nonvirulent, noncytopathic, macrophage-tropic, and does not

replicate in established T-cell lines. Neutralizing antibodies

are detected in the blood of these individuals. PBMC from

these patients produce type 1 cytokines (interleukin-2 [IL-2]

and interferon-S [IFN-0]) and CD8 T cell responses (cytotoxic

and suppressing) (152), which are depressed in AIDS patients,

remain strong in this group (178). A shift from TH-1 to TH-2

type cytokines (IL-4 and IL-10) occurs with progresion to

disease (106).

Dynamics of HIV-1 infection. Recently a model of HIV-1

dynamics estimated that in patients with CD4 counts of up to

500, 107 to 109 virions are produced per day, resulting in









17

peripheral blood viremia of 104 to 107 RNA molecules/ml (91,

201). It was also calculated that 2 X 109 CD4 T cells are

destroyed per day and that > 98% of the plasma virus is

produced within recently infected cells (<1 day). Chronically

or latently infected cells do not seem to play a major role in

the virus turnover, according to this model.

Although such model may be correct for late stage

disease, it is yet to be demonstrated if the same holds true

for populations of patients with early-stage and asymptomatic

disease (121).

Factors in the immune pathogenesis of HIV-1. Multiple

factors are responsible for immune deficiency in HIV-1

infection. Genetic background of the host, which determines

susceptibility of the cells to HIV replication and the

effectiveness of immune response, is important in disease

progression. Direct infection of CD4' cells, alteration in

cytokine production and in immune responses (antibody-

dependent cell-mediated cytotoxicity [ADCC], cytolytic T

lymphocytes [CTL], autoantibodies, and apoptosis), can all

play a role in pathogenicity.

Maintenance of an asymptomatic state appears to depend on

an adequate production by CD4' cells of cytokines such as IL-

2, needed for CD8+ T cell antiviral activity. The CD8 T cells

will cause suppression of HIV replication and consequently

normal CD4' T cell formation.









18

The importance of humoral immune responses is uncertain.

Neutralizing antibodies are found throughout the entire course

of HIV-1 infection. Antibodies would seem to be more useful

during the initial phase of infection, when destruction of

virus-infected cells (via ADCC) could prevent HIV spread.

The type of virus present in the individual is another

important aspect of HIV-1 pathogenesis. Syncytium-inducing

(SI) and non-syncytium-inducing (NSI) viruses have been

described. The SI phenotype produces cytopathology with

formation of multinucleated giant cells or syncytia in PBMC,

and can be grown in T lymphoblastoid cell lines. In contrast,

NSI viruses do not form syncytia in PBMC, cannot be grown in

T lymphoblastoid cell lines, and usually (but not always) grow

more slowly than SI variants. Virus isolated from individuals

shortly after seroconversion and during asymptomatic infection

is predominantly macrophage-tropic and NSI in vitro. SI

phenotypes are associated with a more advanced clinical stage

of HIV disease and with faster depletion of CD4' T cells than

viruses of the NSI phenotypes (17, 38, 162, 191).

Animal models of HIV-1 disease. Animal models can be

used in the study of the pathogenesis of lentivirus infection

and AIDS, in the investigation of perinatal transmission of

HIV (159), in the development of vaccines for HIV, and in the

assessment of the antiretroviral activity of new drugs.

However, an ideal model -- one in which HIV-1 infects an









19

inexpensive and easily available animal, and produces a

disease analogous to AIDS still does not exist (104).

HIV has been experimentally transmitted to chimpanzees,

resulting in a specific antibody response, but these animals

do not develop signs of disease. Attempts to produce HIV

infection in small animal species (mouse) have been

unsuccessful (104).

Lentivirus infection in sheep, goats, horses, cattle, and

cats are similar to HIV infection in humans. These viruses are

genetically analogous to HIV and share several clinical and

imunologic features (105). However, the lentivirus with the

most similarities to HIV is the simian immunodeficiency virus

(SIV). SIV infection of rhesus monkeys is considered to be the

best model for HIV-1 infection of humans (47). The viral

genomes of HIV-1 and SIV are closely related, and both viruses

infect similar target cells. In addition, SIV disease in

rhesus macaques is comparable to human AIDS; SIV infection of

adult macaques results in high levels of virus replication,

CD4' T cell depletion, and immunosuppression (7, 104).

The severe combined immunodeficient mouse (SCID)

transplanted with human peripheral blood lymphocytes has

provided a useful model for the study of HIV infection in

human T cells in an in vivo environment (122). Although these

animals do not develop clinical signs of AIDS, the human cells

can be infected with HIV, providing a useful model for









20

quantitation of HIV infection and in the screening of

antiretroviral drugs.


Monocyte Infection by HIV-1


Although the main targets of HIV-1 in vivo are the CD4

T lymphocytes and tissue macrophages, blood monocytes also

express the CD4 surface molecule, consisting of potential

targets to the virus. Monocytes are precursors of tissue

macrophages, and together with neutrophils, these cells are

the main "professional phagocytes" in the body. Monocytes

travel unidirectionally from the bone marrow to the tissues,

where they differentiate into the long-lived macrophages. In

the peripheral blood, monocytes consist of a small fraction of

total mononuclear cells (PBMC), usually between 5 and 10% of

this population. Infection of these cells could serve as a

mechanism of disease dissemination to the tissues, as well as

of transmission of HIV-1.

CD14, a 53 to 55 kDa glycoprotein is highly expressed on

the surface of mature monocytes, in trace amounts on

granulocytes, but not on other hematopoietic cells, including

monocyte precursors (179). Differential expression of CD14 is

observed in tissue macrophages. Peritoneal macrophages show

strong CD14 expression, while alveolar macrophages show weak

expression of this molecule (216). CD14, a member of the

family of leucine-rich proteins (66), is attached to the cell

membrane by a glycosylphosphatidylinositol (GPI) anchor (87)









21

and it functions as a receptor for lipopolysaccharide (LPS)

and LPS binding protein (211).

Monocytes/macrophages can serve as a virus reservoir

during both early and late stages of HIV-1 disease (96).

Macrophage-tropic variants, which are viruses that

preferentially infect macrophages over T-cell lines in

culture, seem to be transmitted more readily than T-cell

tropic viruses in both sexual and vertical transmissions (131,

196). Cord blood monocytes and placental macrophages are more

susceptible than adult monocytes to HIV-1 infection in culture

(98, 150, 185). Finally, in vitro studies suggest that

monocytes only become susceptible to HIV-1 during their

differentiation into macrophages (173).

However, infection of blood monocytes, in vivo, is

controversial. Several studies have shown only low levels of

HIV-1 present in these cells (123, 125, 169), although one

group reported similar levels of infection in monocytes and

CD4' T cells by an in situ polymerase chain reaction (PCR)

assay (9). Many reasons could account for the controversial

results. Monocytes comprise a small population of PBMC and

selection techniques frequently do not yield highly enriched

cell populations. Besides, monocytes differentiate rapidly

into macrophages once in culture. Therefore, detection of

virus in monocyte populations could be reflecting infection of

"contaminating" CD4 T lymphocyte, infection of mature

macrophages, or a true monocyte infection (4). Another









22

confounding factor is that infection of bone marrow stem

cells, which are the progenitors of all blood cells including

monocytes, is a controversial issue (42, 136, 186).

A previous report demonstrated that nonproliferating

quiescent CD4 T lymphocytes are susceptible to virus entry,

and that viral DNA synthesis is initiated in these cells with

essentially the same efficiency as in stimulated cells, with

the difference that only incomplete DNA species are produced

in absence of stimulation (214). In this study, spliced RNA

transcripts were only detected in stimulated cells, while

strong-stop DNA, which is the first region of the HIV-1 genome

to be reverse transcribed in the R-U5 region of the LTR, was

always demonstrated in quiescent T cells, indicating the

presence of input virion. Studies in monocytes derived

macrophages (MDM) have subsequently shown that the activation

state that coincides with the G1/S phase of the cell cycle,

and not DNA synthesis or mitosis itself, is required for

establishment of productive HIV-1 infection of these cells.

The MDM fraction that lacks proliferative capacity is

susceptible to virus entry, although virus does not replicate

at this stage (171).

The above results suggest that if blood monocytes are not

productively infected, these cells can still be susceptible to

viral entry and latent infection, until subjected to mitogen

stimulation and consequent proliferation.









23


Vertical Transmission of HIV-1


The first cases of AIDS in children were described in

1982, approximately a year after the description of AIDS in

adults, and a clear connection with maternal infection was

then detected (27, 157). The majority of children acquire HIV-

1 infection from their seropositive mothers, although

infection through contaminated blood products and sexual abuse

have also been reported. The highest seroprevalence rates in

women are among those who are intravenous drug users or who

are sex partners of an HIV-infected man. In the United States,

African-American and Hispanic women are at higher risk than

Caucasians for infection.

Not all infected pregnant women, however, will transmit

HIV-1 to their children. Transmission varies in different

parts of the world. In the absence of anti-retroviral therapy,

transmission can be as high as 50% to 60% in certain regions

of Africa (19, 41, 161), while in Europe it is lower, at 11%

to 15% (63, 119). In the United States, 25% to 30% of infants

of HIV-1 infected mothers will acquire the infection (52, 160,

209).

HIV-1 may be transmitted to an infant in utero (detection

of virus in fetuses as early as 15 weeks old (20), in

placentas (98, 175) and in cord blood (185), close to the time

of birth or postnatally (breast feeding) (158, 195). Perinatal

infection occurs through contact with amniotic fluid, genital









24

secretions or maternal blood (51). From 30% to 50% of infants

are HIV-1 positive by PCR or culture soon after birth,

suggesting in utero transmission at some point during

gestation (58, 156). Diagnosis of HIV-1 infection in infants

cannot be made by detection of HIV antibodies because of

placental crossing and persistence of maternal antibodies in

the child for up to 18 months. Therefore, ELISA and Western

blot tests used for diagnosis in adults are not applicable for

children, in whom diagnosis is made by virus culture and/or by

PCR.

Maternal transmission of HIV-1 is multifactorial and can

be influenced by clinical, obstetrical and virological

aspects. Advanced disease stage of the mother (clinical AIDS)

with altered immune status, particularly low CD4 count (<200

cells/pl) or CD4-to-CD8 ratio, is associated with increased

risk for transmission (12, 13, 163). Although the presence of

sexually transmitted diseases increases the risk of a woman to

become infected by HIV-1, only syphilis and chorioamnionitis

were found to be related with higher perinatal transmission

rates (163). Mothers who have neutralizing antibodies to HIV-1

seem to be at a reduced risk of infecting their children (95,

100, 165). Macrophage-tropic viruses were reported to be

preferentially transmitted to the child (95, 98, 140, 150).

Reports have shown maternal transmission of either multiple

(81) or selected (2, 207) genotypes. Most likely,

heterogeneity of the virus transmitted will depend on the









25

diversity, viability and tropism of the maternal virus, and

susceptibility of neonatal cells.

Studies on the association of levels of plasma p24

antigen (Ag) and transmission are inconsistent. Some reports

show that antigenemia correlates with transmission, while

others claim that p24 is unrelated to vertical transmission

(65, 97, 143, 163). High levels of maternal plasma HIV-1 RNA

are associated with increased transmission (49, 64, 95), and

the few studies on the association of maternal cell-associated

virus levels and vertical transmission suggest a correlation

of these factors (45, 155, 202). Because it seems like

vertical transmission can occur through both cell free and

cell asociated HIV-1, it is important to consider viral load

in both compartments when analyzing neonatal infectivity risk.

Obstetrical factors are also associated with mother-to-

child transmission of the virus. Children born by Caesarean

section are at a lower risk to become infected by HIV-1 (55,

63), while birth weight (61, 135) and gestational age (61, 63)

also seem to influence the outcome of the children. Pre- and

post-term infants have more chances to become infected.

Furthermore, studies performed in twins have shown that the

first born child is at an increased risk for infection (55,

77).

A large scale, randomized trial, was conducted to

evaluate both the efficacy and safety of the antiretroviral

drug zidovudine (ZDV) in reducing the risk of maternal-infant









26

HIV-1 transmission. ZDV, which readily crosses the placenta,

is a deoxythimidine analogue that acts by termination of viral

DNA production and competition for nucleotides used by the

viral RT (106). Infected pregnant women with CD4 counts above

200 cells/l were enrolled in the ACTG (AIDS Clinical Trials

Group) protocol 076 between 14 and 34 weeks of gestation.

Women either received placebo or oral ZDV during gestation and

intravenous intrapartum ZDV, and infants of the treated women

received oral ZDV for the first 6 weeks of life. A 67.5%

reduction in transmission was detected when comparing

transmission in the untreated group (25.5%) to transmission in

treated mother-child pairs (8.3%). Hemoglobin levels in

infants in the treated group were significantly lower at

birth, but by 12 weeks the levels were similar in the 2 groups

(36). Although ZDV therapy is efficient in reducing vertical

transmission of HIV-1, it is not known which arm of the

treatment is responsible for the beneficial effect.

Women with CD4 counts below 200 cells/ll, not included in

the original ACTG 076 trial, were analyzed in posterior

studies. The efficacy of ZDV did not seem to depend on CD4'

lymphocyte level, suggesting that women with severe immune

depression, who are at highest risk of transmitting, may also

benefit from ZDV (117).









27

Pediatric HIV-1 Infection


As mentioned above, HIV-1 infection in infants occurs

mainly through vertical transmission from infected mothers;

therefore, the increase in pediatric AIDS cases is due to the

growth in the number of HIV-1 infected women of childbearing

age (33). Diagnosis of HIV-1 infection in infants can only be

made by direct detection of virus in the child. Maternal

antibodies are passively acquired by the child and nonspecific

signs and symptoms of HIV-1 infection are usually seen at this

age. PCR is the most frequently used diagnostic method for its

sensitivity and specificity (44, 154). Viral culture and acid-

dissociated plasma p24 Ag are also acceptable methods for the

diagnosis of HIV-1 in infants (15, 22). Procedures used to

detect IgA (113, 114) and IgG (6) HIV-1 specific antibodies in

children born to seropositive mothers have been developed, but

none guarantees high sensitivity or specificity before 3 to 6

months of age.

Different than in adults, progression to disease is

faster in vertically infected infants. HIV-1 infected children

show a high incidence of Pnemocystis carinii pneumonia (PCP)

and encephalopathies. PCP is the most common HIV-associated

opportunistic infection in children with AIDS, and according

to a 1991 report from the Centers for Disease Control (CDC),

50% of children with AIDS develop PCP at some point of their

illness (29) Mortality from PCP, specially in the first

months of life is very high, therefore, therapeutic









28

prophylaxis is essential. In the other hand, although children

are prone to develop HIV encephalopathies and myelopathies,

pediatric patients rarely present with opportunistic

infections of the central nervous system (CNS)(21).

Factors associated with this rapid outcome include the

presence of high viral load in children (48, 56), the

incompletely developed immunity at this age (109), the timing

of HIV-1 transmission (in utero, at birth or postpartum),

phenotype/genotype of the transmitted virus, and the absence

of neutralizing antibodies. Infants who are infected in utero

(HIV-1 PCR or culture positive at birth) usually develop a

more rapid increase in viral load, faster loss of CD4 T

cells, and earlier progression to AIDS, when compared to

children who become infected at birth (48).

Low CD4 counts per age are the most commonly used markers

of immune deficiency, indicators of risk of developing

opportunistic infections, and response to therapeutic

intervention. Lymphocyte subsets vary with age in childhood.

In normal children (46) and in uninfected children born to

HIV-1 positive mothers (62), median CD4+ T cell counts are

3200/mm3 during the first 6 months of life, 3100/mm3 between 7-

12 months of age, declining to 2600/mm3 between 13-24 months

of age, and 1700/mm3 by 2-6 years of age. Median adult levels

of 800-1000 cells/mm3 are reached towards the end of

adolescence (46, 62, 94).









29

CD4' T cells can be further divided into "naive" and

"memory" cell populations, phenotypically divided by reaction

with monoclonal antibodies (MAbs) directed against certain

cell surface molecules as the CD45RA+ and CD45RO+ subsets,

respectively (164). In normal neonates, more than 90% of CD4

T cells in the peripheral blood express CD45RA and less than

10% express the memory phenotype, declining to around 37% in

adults (94). In adults, HIV-1 preferentially infects the

CD45RO memory T cells (168). In children >2 years of age the

memory subtype is also preferentially infected, while in

infants, both cell types seem to be susceptible to HIV-1

(181).

My project was aimed into a better understanding of the

immunopathogenesis of HIV-1 maternal transmission and

pediatric infection, specially during the first months of

life, as infants progress from acute to chronic HIV-1 disease.

The specific aims were: 1. To determine the main target cell

of HIV-1 in mother and child infection; 2. To determine an

association among pediatric HIV-1 proviral copy number, timing

of infection and progression of disease; and 3. To evaluate

the correlation between maternal HIV-1 proviral copy number

and transmission, in the absence or presence of ZDV therapy.

This study should add valuable information for

therapeutic approaches and drug development strategies.
















CHAPTER 2
MONOCYTE SELECTION TECHNIQUE


Introduction


Monocytes traffic unidirectionally from the bone marrow

through the blood to tissues, where the cells differentiate

into macrophages. Peripheral monocytes are frequently targeted

for studies of human cells of the monocyte/nacrophage lineage

because of their accessibility through blood sampling. The

techniques developed to isolate monocytes from other

peripheral blood mononuclear cells (PBMC) rely on the adherent

characteristics of monocytes in culture, their size

differences from other PBMC, or their expression of monocyte-

restricted cell surface proteins such as CD14 (43, 200, 213,

215, 216). Physical methods used for monocyte selection

require large volumes (50 ml or more) of blood, which hinder

their application in pediatric studies involving infants and

young children. Monocytes compose only 5 to 20% of total PBMC

in contrast to lymphocytes, which constitute the major

population of PBMC. Adherence or elutriation is generally

efficient in depleting monocytes from PBMC but often does not

generate an enriched monocyte population significantly

depleted of lymphocytes (93,200).



30









31

We developed a technique that utilizes magnetic

microspheres, or beads, in combination with monoclonal

antibodies (MAbs) targeted at CD14 or CD4 to select highly

enriched populations of monocytes and CD4 T cells. CD14, a

receptor for lipopolysaccharide, is a surface glycoprotein

with a size of 55 kDa expressed on cells of

monocyte/macrophage lineage (24, 87, 179, 211, 216). CD4 is

expressed on both T helper cells and monocytes. A sensitive

molecular strategy based on PCR amplification and detection of

T-cell receptor (TCR) gene rearrangements demonstrated the

effectiveness and reproducibility of the technique to yield

viable monocyte populations which contain fewer than 2%

contaminating T lymphocytes. The technique is effective even

when isolating cells from small volumes of blood.


Materials and Methods


Cell samples. Peripheral blood (5 to 10 ml, maximum of 2

ml/Kg of body weight) from 17 children and adult volunteer

blood donors was collected in heparinized tubes according to

a protocol approved by the Institutional Review Board of the

University of Florida. Samples were diluted 2 to 1 (vol/vol)

in Hank's balanced salt solution (HBSS) without calcium and

magnesium (GIBCO BRL, Grand Island, NY) plus 20% fetal bovine

serum (FBS) (GIBCO BRL). PBMC were collected by Ficoll-Hypaque

density centrifugation (Histopaque 1077; Sigma Diagnostics,

St. Louis, MO), as previously described (183). The mononuclear









32

cells were collected and washed twice in HBSS plus 20% FBS.

All cell counts were carried out by using a hemocytometer.

Cell viability was always >98%, as determined by trypan blue

exclusion. The cell lines used for control experiments

included Jurkat, a human T-cell line (203), and HeLa, a human

nonlymphoid cell line (167). The cell lines were obtained from

the AIDS Research and Reference Reagent Program: HeLa from

Richard Axel and Jurkat clone E6-1 from the American Type

Culture Collection.

Immunomagnetic separation. PBMC (107 cells per ml of HBSS

plus 20% FBS) were incubated at 40C for 30 min with an anti-

CD14 mouse MAb, MY4 (125 pg/ml) (Coulter Immunology, Hialeah,

FL), diluted 1 to 100. PBMC were also incubated with a mouse

immunoglobulin G (IgG) antibody, MsIgG (1,000 Ag/ml) (Coulter

Immunology), or with no antibody at a similar dilution. The

cells were washed twice with cold phosphate-buffered saline

(PBS) plus 10% FBS (GIBCO BRL) and resuspended at the original

concentration.

Immunomagnetic microspheres, or beads, coated with sheep

anti-mouse IgG (Dynabeads M450; Dynal, Oslo, Norway) were

washed in PBS, counted by using a hemocytometer, and

resuspended in PBS plus 10% FBS at a final volume equal to

that of the target cells. The number of beads added to deplete

the PBMC of monocytes was calculated by using a ratio of 10

beads per target cell. The estimated frequency of CD14 cells









33

was based on the subjects' complete blood counts with

differentials as determined by a Coulter Counter.

Beads and antibody-coated mononuclear cells were mixed in

polypropylene round-bottom tubes (12 by 75 mm, Falcon 2005;

Becton Dickson Labware, Lincoln Park, NJ) and incubated with

gentle rotation at 40C for 30 min. Monocytes with beads were

separated from the CD14-negative fraction by placing the

polypropylene tubes containing the cell suspension in the

presence of a Dynal MPC-1 magnet. Cells bound to beads adhered

to the tube in the magnetic field while nonadherent cells were

gently removed by pipetting. Immunomagnetic selection and

washing were repeated four to five times or until, as

determined by light microscopy, all beads were removed from

the suspension.

CD4+ T cells were selected from the CD14-depleted

fraction (resuspended at 107 cells per ml) by incubation with

an anti-CD4 mouse MAb, T4 (500 Ag/ml) (Coulter Immunology), at

a 1 to 100 dilution. Immunomagnetic beads were used at a ratio

of 10 beads per target cell, estimated as 50% of the CD14-

depleted cells.

Monocyte selection by adherence to plastic. PBMC (4 X 106

to 6 X 106 cells per ml) were resuspended in RPMI 1640 medium

(GIBCO BRL) supplemented with 20% FBS, 1 mM sodium pyruvate,

2 mM L-glutamine, 50 U of penicillin per ml, 50 mg of

streptomycin per ml, and 10% freshly pooled human serotype AB

serum. Cell suspensions were incubated for 1 h at 370C under









34

5% CO2 in 100 cm2 tissue culture plates (Falcon 3003; Becton

Dickson Labware). Non-adherent cells were removed by

aspiration with a Pasteur pipette. Adherent cells were washed

three times with cold medium and dislodged from the plates

with a plastic cell scraper (Costar, Cambridge, MA.)

Flow cvtometry analysis. Unfractionated PBMC and aliquots

of cells remaining after immunomagnetic selection were

prepared for one- and for two-color flow cytometry analysis as

previously described (183). The cells were stained with

fluorescein isothiocyanate (FITC)-conjugated mouse MAbs (anti-

CD3, Leu-4, 100 Ag/ml; anti-CD4, Leu-3a, 3 Ag/ml; anti-CD14,

Leu-M3, 25 Ag/ml; anti-CD19, Leu-12, 25 Ag/ml; and anti-CD8,

Leu-2a, 12.5 jg/ml [Becton Dickinson Immunocytometry Systems,

San Jose, CA]). The numbers and percentages of CD3+CD4+ T

cells and CD4+CD14+ monocytes within the unfractionated PBMC

were determined by two-color analysis with phycoerythrin-

conjugated Leu-3a (10 Ag/ml) and FITC-conjugated Leu-M3 and

Leu-4 (Becton Dickinson Immunocytometry Systems) Cell samples

were incubated with the MAbs at 40C for 30 min in the dark.

For two-color staining, the cells were first incubated with

the FITC-conjugated MAb, washed, and then incubated at 40C for

30 min with the phycoerythrin-conjugated MAb. Controls

consisted of cells stained with isotype-matched phycoerythrin-

or FITC-conjugated mouse IgG (50 Ag/ml) (Becton Dickinson

Immunocytometry Systems). Cells were washed (0.01 M PBS, 0.02%

sodium azide, 10% fetal calf serum), fixed (0.01 M PBS, 0.02%









35

sodium azide, 1% paraformaldehyde), and stored at 40C in the

dark until analysis. Cell fluorescence was analyzed by using

a Becton Dickinson FACScan flow cytometer. Lymphocyte and

monocyte populations were defined on the basis of differences

in forward angle and side scatter of the two populations, as

previously described (74, 183). Dual-color analysis was

carried out by using a compensation network. The fluorescence

from 104 cells per sample was quantified.

DNA extraction. Cells were resuspended in 1 ml of lysis

buffer (10 mM Tris [pH 8.0], 100 mM NaCl, 1 mM EDTA, 2% sodium

dodecyl sulfate [SDS], 100 Ag of proteinase K per ml). After

overnight incubation at 370C, DNA was extracted by using the

G NOME DNA isolation kit (BIO 101, Inc., La Jolla, CA)

according to the manufacturer's protocol. The DNA

concentration was calculated from spectrophotometric readings

of the samples with a Beckman model DU 640 spectrophotometer.

PCR. Primers specific for the V,8 family of TCR were V,8-

forward (5'-AACGTTCCGATAGATGATTCAGGGATGCCC-3') and J1 .2-

reverse (5'-TACAACGGTTAACCTGGT-3'), as previously described

(182). Oligonucleotide primers were synthesized on an Applied

Biosystems DNA synthesizer in the DNA synthesis core facility

of the Interdisciplinary Center for Biotechnology Research at

the University of Florida. The amplified products were 180 bp

in length. 3-Actin sequences were amplified with a forward

primer (5'-GAAACTACCTTCAACTCCATCATG-3') and a reverse primer

(5'-CTAGAAGCATTTGCGGTGGAC-3') (Clontech, Palo Alto, CA). The









36

products amplified with the 3-actin primers were 350 bp in

length.

Amplifications were performed in a total volume of 50 ~l

containing 0.1 and 1 ng of DNA for O-actin reactions or 0.1,

1, 10, 50, and 100 ng DNA for V,8-J,1.2 reactions, 200 pM each

deoxynucleoside triphosphate, PCR buffer (50 mM KC1, 1.75 mM

MgCl2, 100 pg of nuclease-free bovine serum albumin [BSA], 20

mM Tris [pH 8.4]), 1 4M each primer, and 2.5 U of Taq DNA

polymerase (Pharmacia). The samples were covered with mineral

oil, and amplification was carried out in a 48-well automated

thermal cycler (Perkin Elmer Cetus).

V.8-Jl.2 amplification involved 1 cycle of denaturation

(940C for 5 min), 35 cycles of amplification (denaturation for

1 min at 940C, annealing for 1 min at 450C, and extension for

2 min at 720C), and 1 cycle of extension (720C for 10 min). 3-

Actin amplification involved 1 cycle of denaturation (940C for

5 min), 25 cycles of amplification (940C for 30s, 600C for 30s,

and 720C for 30s), and 1 cycle of extension (720C for 10 min).

Southern blot analysis. Amplification products in a

volume of 10 il were electrophoresed in 1.2% agarose gels and

transferred to Nytran membranes (Schleicher & Schuell, Keene,

NH), according to the method of Southern (184). Double-

stranded DNA probes used to detect TCR recombinants, and f-

actin sequences (182) were labelled by random priming with

[32P]dATP (Du Pont, Boston, MA) to a specific activity of at

least 109 cpm/pg of DNA and placed over a Sephadex G-50









37

(Pharmacia, Uppsala, Sweden) spun column to retain the free

nucleotides. Filters were prehybridized for 2 h in

hybridization buffer (1 mM EDTA [pH 8.0], 0.5 M NaPO4 [pH

7.2], 7% SDS, 1% BSA), hybridized for 16 h with 106 cpm of

radiolabelled probe per ml of buffer, and washed for lh, as

previously described (83, 182). Hybridization and washes were

carried at 550C for 0-actin and at 500C for V,8 analysis.

Membranes were exposed at -800C to Fuji medical X-ray film.

Electron microscopy and histologic analysis of monocytes.

Samples (105 cells per sample) were centrifuged in a cytospin

centrifuge (model SCA-0031; Shandon Southern Products Ltd.,

Runcorn, Cheshire, England) and fixed in citrate-acetone-

formaldehyde fixative (Sigma Diagnostics). Cells were then

stained with a-naphthyl butyrate esterase (Sigma Diagnostics),

according to the manufacturer's instructions.

Cells (2 X 106 cells per sample) were pelleted and fixed

in 2% glutaraldehyde in PBS (pH 7.3) for 1 h. All subsequent

steps were performed at the electron microscopy core

laboratory of the Interdisciplinary Center for Biotechnology

Research at the University of Florida. Briefly, cells were

washed in buffer, postfixed for 30 min in 1% OsO4, dehydrated

in an ethanol series, and embedded in Spurr's epoxy resin.

Thin sections were stained with uranyl acetate and lead

citrate and examined by using a Hitachi model SH-7000 electron

microscope.









38

Statistical analysis. Statistical analysis of cell yields

from blood volumes of less than 6 ml compared with blood

volumes of more than 6 ml was carried out by using the Student

t test. Values are expressed as the means + standard

deviations.


Results


Cell yield and efficiency by flow cytometry analysis.

PBMC were isolated from blood samples, with volumes ranging

from 3 to 20 ml. The number of PBMC collected from the 17

individuals studied ranged from fewer than 1 X 106 to 10 X 106

cells per ml depending on the age of the subject. Dual-color

flow cytometry analysis of PBMC indicated that more than 85%

of CD14* blood monocytes also express CD4 (data not shown).

Therefore, CD14' cells were selected before isolation of the

CD4 T lymphocytes (Fig. 2.1). Monocytes were selected from

the total PBMC by using an anti-CD14 MAb (MY4) and magnetic

beads. Control experiments consisted of PBMC incubated with

MsIgG or without murine antibody. Immunoaffinity magnetic

beads were then added as described in Materials and Methods.

CD4+ T lymphocytes were selected from the CD14-depleted

fraction with an anti-CD4 MAb (T4) and magnetic beads.

Cell yields from the selected fractions were calculated

on the basis of flow cytometric analysis of the number of

monocytes or CD4 T cells in unfractionated PBMC (Table 2.1).

The number of cells obtained by immunomagnetic bead selection




























Figure 2.1. Schematic representation of the PBMC separation
procedure steps to select CD4 T lymphocytes and CD14
monocytes. PBMC were separated from heparinized blood samples
by Ficoll-Hypaque density gradient centrifugation. CD14'
monocytes were selected by incubating the cells first with an
anti-CD14 MAb and then with magnetic beads conjugated to a
sheep anti-mouse antibody. The CD14 cells were separated from
the CD14-negative cells by placing the cell mixture in the
presence of a magnetic field. The washed, positively selected
cells were placed in lysis buffer for DNA extraction followed
by PCR amplification with TCR and actin primer pairs. The
CD14-negativecell fraction was incubated with an anti-CD4 MAb
and then with magnetic beads conjugated with sheep anti-mouse
antibodies. The CD4 cells were selected in the presence of a
magnet and washed, and the DNA was extracted and amplified
with TCR and actin primers.








40




PERIPHERAL BLOOD
S Ficoll Hypaque
Gradient Centrlfugatlon

PBMC

Anti CD14 mAb
+
Magnetic Beads




CD14 (+) CELLS CD14 (-) CELLS
Anti CD4 mAb
+
Magnetic Beads




CD4 (+) CELLS CD4 (-) CELLS




DNA EXTRACTION DNA EXTRACTION



PCR PCR













Table 2.1. Average cell yield of CD14 monocytes and CD4 T cells from different blood
volumesa


Blood No. of Avg. no. Avg. no. of CD14' cells Avg. no. of CD4+T cells
vol (ml) samples of PBMC/ % Yieldd % Yieldd
ml of blood
Expectedb Selectedc Expectedb Selectedc

<6 8 (4.8 + 3.4) (8.0 2.5) (6.0 3.0) 75.6 + (16.7 8.9) (6.7 3.6) 41.1
X 106 X 105 X 105 5.1 X 105 X 105 14.2

6 9 (3.2 + 2.6) (6.1 3.8) (4.3 2.4) 80.5 (9.7 5.5) (4.2 4.3) 36.1
X 106 X 105 X 105 2.9 X 105 X 105 15.9



a Values represent the means standard deviations for the individual blood samples examined

b Average number of CD14+ monocytes or CD4+ T cells per milliliter of blood as determined by
fluorescence-activated cell sorter analysis

c Average number of cells of each type selected per milliliter of blood by using
immunomagnetic beads

d Percent yield is calculated from the number of selected cells/number of expected cells X
100 for each experiment; when the yields were compared on the basis of blood volumes for each
cell type, the results were not statistically significant (p>0.05)









42

was determined with a hemocytometer to count the cell-bead

aggregates. The results of flow cytometry analysis of

unfractionated PBMC indicated an average of (8.0 2.5) X 105

CD14+ monocytes per ml of blood from samples containing less

than 6 ml of blood. Following immunomagnetic selection, (6.0

3.0) X 105 monocytes per ml were recovered, a number which

represents an average yield of 75.6% of the peripheral

monocytes expressing CD14. CD14+ monocytes selected from 6 to

20 ml of blood resulted in a recovery of 80.5% of the

potential blood monocytes. The recovery of monocytes from

blood volumes less than 6 ml was as efficient as monocyte

recovery from larger volumes of blood (a6 ml). There was no

evidence of cell-bead aggregates when the PBMC incubated with

MsIgG or the controls with no antibody were examined by light

microscopy. These results indicate that the use of an anti-

CD14 MAb is required for immunomagnetic selection of

monocytes. Nonspecific binding of the control antibody to

monocytes did not result in significant binding of the beads.

The overall yield of the selection of CD4' T cells from

PBMC was 41.1% for small blood volumes and 36.6% for blood

volumes of more than 6 ml. The efficiency of selection of CD4

T cells from the CD14-depleted cell fraction was greater than

75% (data not shown). The loss of CD4' T cells appears to be

a result of the extensive manipulation and cell washes

required for the two rounds of bead selection, because cell

losses within the CD19+ B cells and CD8 T cells in the CD4-









43

depleted cell fraction were similar (data not shown). The

yields of CD14' monocytes or CD4' T cells were not

statistically different when small and large blood volumes

were used.

On the basis of the sensitivity of flow cytometry

analysis of the depleted fractions, greater than 95% of the

monocytes were depleted from the PBMC fractions following

immunomagnetic bead selection with the CD14 MAb (Fig. 2.2).

There was no evidence of monocyte depletion following

incubation of PBMC with MsIgG or beads alone (data not shown).

Fewer than 5% residual CD4' T cells were detected following

selection with the anti-CD4 MAb (Fig. 2.2).

Electron microscopy evaluation of CD14 monocyte and CD4

T-cell enrichment. Morphologic analysis of unfractionated PBMC

and immunoselected CD14+ monocytes or CD4 T lymphocytes by

light microscopy indicated greater than 99% enrichment for the

selected cell type (data not shown). No contaminating

lymphocytes, either B cells or T cells, were detectable within

the CD14 cell fraction. Furthermore, by cytospin

centrifugation and staining with a-naphthyl butyrate esterase,

the bead-selected CD14 cell population showed a monocyte

morphology. However, the esterase staining pattern of the

bead-selected cells was atypical compared with that of the

stained monocytes within the PBMC (data not shown).

To more precisely examine the CD14+ cells, electron

microscopy was chosen as an additional method of monocyte














mAb FITC

CD14 CD3 CD4
CELLS

PBMC

--------a-i _HI|I-1---1



I I I W


z 1CD14






DEPLETED
AI--




CD4

f6 I ip 1 s


FLUORESCENCE INTENSITY




Figure 2.2. Flow cytometry analysis of CD14*, CD3*, or CD4+ PBMC populations stained with
FITC-conjugated mouse MAb anti-CD14 (Leu-M3), anti-CD3 (Leu-4), or anti-CD4 (Leu-3a),
respectively.









45

identification. CD14+ monocytes and CD4+ T cells within

unfractionated PBMC were easily distinguishable by electron

microscopy on the basis of their morphologies (data not

shown). Following magnetic selection, the CD4+ T-cell fraction

was enriched for lymphocytes with magnetic beads attached to

the surface of these cells (Fig. 2.3C). The selected CD14

fraction was highly enriched for monocytes with no evidence of

contaminating lymphocytes. Magnetic beads appeared mostly

internalized within the monocytes rather than on the surface,

which indicates active phagocytosis of the CD14-magnetic bead

complex (Fig. 2.3A and B). Assessment of cell viability by

trypan blue exclusion after 24 h of culture indicated that

phagocytosis of the beads did not impair viability.

Assessment of monocyte enrichment by molecular analysis.

A primary goal of the selection strategy was to achieve a

monocyte population with more than 99% depletion of T

lymphocytes, which is beyond the detection sensitivity of

morphologic or flow cytometric analysis. A more sensitive

method by using PCR was developed to assess the extent of

residual T lymphocytes within the CD14' monocyte fraction. DNA

from both CD14+ and CD4+ cell fractions was amplified by using

TCR primers to detect recombination of variable, diversity,

and joining gene segments which occur exclusively in T

lymphocytes. The TCR V08 family was used as a marker for T

cells for two reasons: (1) V.8 is involved in 3 to 26% of TCR

variable, diversity, and joining gene segment recombinations































Figure 2.3. Transmission electron microscopy of monocytes and
CD4' T cells selected from PBMC by using immunomagnetic beads.
Monocytes coated with an anti-CD14 MAb, MY4, were selected
after incubation with magnetic beads. The beads can be seen
within the cells (A and B). (C) An anti-CD4 MAb, T4, was added
to the CD14-depleted cells, and CD4 T cells were selected
following incubation with magnetic beads. The beads are seen
attached to the surface of the cells. Magnifications X 10,000
(A), X 3,750 (B), and X 15,000 (C).










47














10m











sA pm
IA









48

in CD4+ T lymphocytes and represents one of the more

frequently rearranged TCR gene families in peripheral blood T

cells (84, 148), and (2) there is a T-cell line, Jurkat, with

a rearranged V.8-Jl.2 TCR, which provides an important

positive control for quantitation.

The sensitivity of the primers to detect small numbers of

rearranged TCRs within cellular DNA was determined in control

experiments using serial dilutions of DNA from Jurkat cells.

The 180-bp V08 TCR product was consistently detected at the

level of a single Jurkat T cell (0.01 ng of input DNA) (Fig.

2.4A). The amount of template DNA was verified by

amplification of serial dilutions of Jurkat DNA with primer

pairs for 0-actin, which also detected a single cell (Fig.

2.4B). The sensitivity for detection of a single cell by

amplification was the same when serial 10-fold dilutions of

Jurkat cells were mixed with reciprocal dilutions of HeLa

cells, a nonlymphoid cell line without TCR rearrangements,

prior to DNA extraction (data not shown). On the basis of the

results of these experiments, each subsequent PCR

amplification included a standard curve by using serial

dilutions of Jurkat DNA.

The frequency of V,8 T cells within the monocyte fraction

was compared with the number of CD4 T cells which had V,8

rearrangements within the CD4+ T-cell fraction from the same

individual. Equivalent amounts of template DNA from the

different populations were verified by amplification with









49









CELL NO. 103 102 10 1 <1 0
A
DNA (ng) 10 1 .1 .01 .001 0


180 bp -




CELL NO. 100 10 1 <1 0
B
DNA (ng) 1 .1 .01 .001 o


350 bp -






Figure 2.4. Amplification of serial dilutions of DNA obtained
from Jurkat T cells. The number of cells equivalent to the
amount of input DNA was determined in preliminary experiments.
Serial dilutions of Jurkat DNA, equivalent to 103 to less than
1 cell, were amplified by using forward and reverse primers
for either V.8 and J.l.2 TCR sequences (A) or 3-actin (B) The
amplified products were electrophoresed in 1.2% agarose gels
and transferred to Nytran membranes. Double-stranded probes to
detect the 180 bp TCR product or the 350 bp actin product were
labelled by random priming with ["2P] dATP, washed, and exposed
to X-ray film.









50

primers for 3-actin (Fig. 2.5). When the amplified products of

serial dilutions of DNA from CD4 T cells were analyzed, V08

sequences were detected in the equivalent of 102 T cells (Fig.

2.5A). The intensity of the product was equivalent to the

signal from 10 cells in the standard curve (Fig. 2.4A)

(densitometric analysis not shown). The results indicate that

approximately 10% of the T cells in this individual had

rearranged V,8 TCR genes. When 5,000 CD14+ cells were

examined, 1 cell with a VO8 TCR rearrangement was detected

(Fig. 2.5A). If V08 T cells represent 10% of the total T cells

in this individual, then there are about 10 residual T cells

per 5,000 CD14+ monocytes, which indicates 99.8% purity of the

monocytes. In a second individual, approximately 10 rearranged

V08 TCR genes were detectable in 1,000 CD4+ T cells (Fig.

2.5B), indicating that V.8 T cells represent about 1% of the

CD4+ T cells in this individual. In contrast, T cells with a

rearranged V,8 TCR were not detected in DNA from 5 X 103

monocytes (Fig. 2.5B). If as many as 100 T cells were present

in 5,000 monocytes (2%), the selected monocytes were 98%

enriched for CD14' cells. Cell separations from 17 different

individuals consistently produced CD14 monocyte populations

which contained as few as 0.2% and no more than 2% detectable

T lymphocytes, even when small volumes of peripheral blood

were used.

Immunomagnetic selection of monocytes was compared with

selection of monocytes by adherence to plastic. Both








51




V,8 8I-ACTIN


CELL NO. 5x103 103 102 10 0 10



CD14+

CD4+



CD14+
B
CD4 4



c ADHERENT *
C CELLS W



Figure 2.5. Amplification of DNA obtained from PBMC selected
by either immunomagnetic beads or adherence to plastic. (A and
B) Serial dilutions of DNA equivalent to 5 X 103 cells were
obtained from CD14' monocytes and CD4' T lymphocytes selected
from 2 separate individuals by using immunoaffinity magnetic
beads. (C) Amplification of DNA from serial dilutions of
monocytes collected by adherence to plastic. DNA from each
cell type was amplified with V.8 and J1l.2 TCR primer pairs.
The products were electrophoresed in 1.2% agarose gels and
transferred to Nytran membranes. The DNA equivalent of 10
cells (0.1 ng of DNA) from each cell type was amplified with
primers for 3-actin. DNA was amplified by using the V,8
forward and reverse primer pairs. Double-stranded probes to









52

techniques effectively depleted monocytes from the larger

population of PBMC as determined by flow cytometry analysis

(data not shown). However, the level of detectable T cells in

monocytes collected by adherence was at least 10-fold higher

than in monocytes selected by immunomagnetic techniques (Fig.

2.5C).


Discussion


Studies of human monocyte/macrophage lineage cells have

been hampered by a lack of techniques to verify the relative

purity of highly enriched blood monocyte populations. This is

a particular problem in pediatric studies that are restricted

to using small volumes of blood. Assays of monocyte-macrophage

function, tropism studies of infectious pathogens such as

human immunodeficiency virus, and immunologic assessment of

CD4' T cell-to-monocyte interactions would benefit from a

simple technique which physically separates the two PBMC

populations without affecting viability. Methods used to

separate CD4 T cells and monocytes must compensate for

expression of the CD4 molecule on both cell types. Our

selection scheme results in highly enriched populations of

monocytes and CD4 T cells depleted of other contaminating

cell types.

Immunomagnetic monocyte selection results in a highly

enriched population of CD14+ monocytes with more than 98%

depletion of T cells. Compared with other methods for monocyte









53

selection, such as adherence to plastic, the immunomagnetic

selection method reduces the number of residual T cells more

than 10-fold. Immunomagnetic selection is effective for

depletion or for enrichment of targeted lymphocyte populations

from human blood and bone marrow (74, 103). Using this

procedure, we were able to obtain more than 75% of the

expected monocyte population, even from blood volumes of less

than 6 ml. However, the extensive manipulations required for

each selection step result in cell loss. When this technique

is used, the selection strategy should consider the targeted

cell population in order to optimize cell yields.

Techniques to verify the extent of enrichment for cell

populations that are selected by the immunomagnetic bead

method have limitations. Strategies are available to

dissociate the magnetic beads from lymphocyte populations

(149), although antibody binding to the differentiation marker

on the surface of the selected target cell hinders subsequent

analysis by flow cytometry. The dissociation of beads can not

be applied to immunoselected CD14 monocytes because we found

that the CD14-antibody-bead complex becomes internalized

within minutes of binding to the cell. Verification of

monocyte purity by flow cytometry techniques is further

hampered by changes in the light scatter of the monocytes

containing the bead complex. Morphologic analysis using light

or electron microscopy can be useful to ensure monocyte









54

enrichment but is not a sufficiently sensitive method to

determine the depletion of contaminating T cells.

The PCR-based strategy proved to be a sensitive and

reproducible method to determine the level of residual T cells

within the monocyte fraction. The effectiveness of the

molecular assay is enhanced by several factors. First, the

detection of the rearranged TCR can be standardized and the

number of TCR rearrangement can be quantified. TCR

rearrangements in DNA provide a direct assessment of the

number of T cells and minimize variability from determining

expression of V.8 TCR in RNA of blood T cells from different

individuals (190, 199). Second, rearrangements in V,8 are

found frequently in circulating blood T cells in most

individuals (84, 148). The comparison of the amplification of

V#8 TCR from monocyte DNA and DNA from T cells from the same

individual served as an internal control for sensitivity.

Amplified V.8 TCR sequences were at least 100-fold higher in

the CD4' T-cell fractions than in the corresponding monocyte

population.

Internalization of the CD14-bead complex does not affect

monocyte viability. In addition, MAbs directed at CD14 can

result in monocyte activation (174). Our results indicate that

anti-CD14 antibody is required for binding and phagocytosis.

Whether internalization of the magnetic bead complex would

limit the application of the immunomagnetic selection

technique to some studies of macrophage function needs to be









55

evaluated. We have found thar bead-selected monocytes can be

used for studies of human immunodeficiency virus type 1.

Immunomagnetic selection for monocytes in conjunction with a

sensitive molecular assay for detection of residual T

lymphocytes provide a strategy for obtaining cells of the

monocyte/macrophage lineage from children and adults.















CHAPTER 3
VERTICAL TRANSMISSION OF HIV-1


Introduction


In the absence of antiviral intervention, about 25% to

30% of HIV-1 infected pregnant women in the United States

transmits the virus to her infant. Multiple factors increase

the risk of HIV-1 transmission from mother-to-child (151).

Maternal immunity, biological characteristics of the infecting

virus, obstetrical factors related to the delivery, and levels

of maternal viral load can influence the probability that an

infant born to an HIV-infected mother will ultimately become

infected (12, 35, 49, 64, 77, 100, 119, 163). The precise

contribution by each factor or combinations of factors to

ultimate maternal-infant HIV-1 transmission is not clear,

although maternal viral factors are important (52). For

example, a number of studies demonstrate a direct association

between levels of maternal virus, as measured by p24

antigenemia, quantitative viral culture, viral DNA, or

quantitative viral RNA, and an increased probability for

infection of the infant (49, 65, 95, 97, 202). In addition,

drug therapy targeted at the virus produces a significant

decrease in vertical transmission of HIV-1. A large scale,

blinded, randomized, placebo-controlled clinical trial (ACTG

56









57

protocol 076) demonstrated that pediatric HIV-1 infection can

be reduced by as much as 67% when HIV-infected mothers and

their infants were treated with zidovudine (ZDV) (36).

Although the reduction in perinatal HIV-1 infection by

ZDV treatment is striking, the mechanism by which ZDV reduces

maternal transmission is unknown. Both cell-free and cell-

associated virus have been implicated in maternal-infant

transmission of HIV-1 (155, 163), so one possibility is that

ZDV administered according to the ACTG 076 protocol reduces

maternal plasma virus levels. However, preliminary reports

suggest that ZDV-associated reduction in transmission may be

independent of levels of maternal viremia (64). ZDV treatment

reduces levels of HIV-1 provirus in peripheral blood cells in

approximately 50% of infected adults (108), which raises an

alternative possibility that the ZDV effect on maternal

transmission could be reduction of cell-associated virus in

mothers. We and others have shown a close genetic relationship

between viruses within peripheral blood mononuclear cells

(PBMC) of mothers and their newborns, suggesting that

transmission of cell-associated virus is one mechanism for

pediatric infection and a potential target for the effects of

antiviral drugs (81, 207).

We tested this hypothesis by measuring HIV-1 DNA copies

within PBMC of a group of untreated HIV-infected pregnant

women and a group of infected pregnant women who received ZDV

to reduce transmission. The two groups of women were similar









58

with respect to age, race, disease stage, blood CD4+ T cell

counts, and mode of delivery. Transmission was reduced to 10%

among infants in the ZDV-treated group, indicating that

antiviral therapy was effective. However, there was no

difference between groups of treated and untreated women in

levels of HIV-1 DNA copies in CD4 T cells. Our results

provide evidence that the mechanism by which ZDV reduces

pediatric HIV-1 infection is independent of maternal cell

associated virus levels. It is possible that ZDV therapy

alters the infectivity of the transmitted virus or alters

infectibility of susceptible pediatric cells.


Materials and Methods


Subjects. Study subjects were 42, HIV-infected pregnant

women who were enrollled between October, 1989 and December,

1995 in an ongoing study of HIV-1 genetic variability

according to a protocol approved by the Institutional Review

Board of the University of Florida. Forty-one women were

enrolled at the University of Florida (UF) in Gainesville, FL

and one at the University of South Florida (USF) at Tampa, FL.

Nineteen of these women in the study and their neonates

received ZDV according to ACTG protocol 076, which was

initiated in February, 1994 (36). Twenty-three women received

no form of antiretroviral therapy, including 3 women who were

offered but refused ZDV therapy. Blood samples were obtained

within 24 hours of delivery, except for 2 samples obtained









59

from untreated mothers which were drawn about 3 months after

delivery. Informed consent was obtained from each subject

enrolled. Clinical data collected prospectively included the

age, race, mode of delivery, obstetrical complications, weight

and gestational age of the child, maternal blood CD4* T cell

counts, CD4 to CD8 T cell ratio, and CDC (Centers for Disease

Control) stage of maternal HIV infections (30). T-cell subsets

were determined by flow cytometry analysis at the Clinical

Laboratory at Shands Hospital, at the University of Florida.

Transmission status of the mother was determined based on

results of subsequent evaluations of the infants. Mothers were

classified as transmitting if HIV-1 was detected by polymerase

chain reaction (PCR) amplification of PBMC DNA obtained from

the infant on at least 2 occasions by 6 months of age (180).

Mothers were classified as non-transmitters if results of the

PCR analysis of the infant's PBMC DNA was negative at 6 months

of age and the child seroreverted to an HIV antibody negative

status.

Lymphocyte isolation. Ten milliliters of maternal

peripheral blood were collected in acid citrate dextran (ACD)

tubes and processed within 24 hours. Following separation of

the blood samples into cell and plasma fractions, PBMC were

isolated using Ficoll-Hypaque (Histopaque 1077; Sigma

Diagnostics, St. Louis, MO) density centrifugation.

CD4+ T cells were separated from the PBMC using

immunoaffinity magnetic microspheres (Dynabeads M450; Dynal,









60

Oslo, Norway) according to our previously described methods

(4). Cells were resuspended in 1 ml lysis buffer (10 mM Tris

at pH 8.0, 100 mM NaCl, 1 mM EDTA, 2% SDS, 100 pg proteinase

K), and incubated at 370C overnight. DNA was extracted using

the G NOME DNA isolation kit (BIO 101, Inc., La Jolla, CA), as

suggested by the manufacturer. DNA concentration was

calculated by spectrophotometric reading (Beckman DU 640).

PCR analysis. Oligonucleotide primers for amplification

of env region were forward (5'-GCCACACATGCCTGTGTACCCACA-3')

and reverse (5'-CTTCTCCAATTGTCCCTCATA-3'), located at

nucleotides 6464 to 6486 and 7693 to 7713, respectively, in

the HIVLAI genome. A second set of primers was located in the

gag-pol region and consisted of forward (5'-

GACCAGCAGCTACACTAGAAGA-3') and reverse (5'-TGCGGGATGTGGTATTC-

3') primers located at nucleotides 1802 to 1823 and 2863 to

2879, respectively. Primers were synthesized on an Applied

Biosystems DNA synthesizer in the DNA synthesis core facility

of the Interdisciplinary Center for Biotechnology Research at

the University of Florida. 0-actin primers were obtained from

Clontech, Palo Alto, CA. Sensitivity of each set of primers

was at the level of 1 to 5 copies (4, 181).

DNA concentrations were 1 and 10 ng for actin

amplifications and 100 to 1500 ng of patient DNA for env and

gag-pol amplifications. DNA from the 8E5 cell line, a human T-

cell line which contains a single integrated copy of HIV-1 DNA

(68), was used in serial 5-fold dilutions ranging from 0.01 ng









61

to 1 ng, the equivalent of 1 to 100 cells. PCR reactions were

carried out in 50 Al, containing the appropriate DNA

concentration, 200 AM each deoxynucleoside triphosphate, PCR

buffer (50 mM KC1, 1.75 mM MgCl2, 100 Ag nuclease-free bovine

serum albumin [BSA], 20 mM Tris [pH 8.4]), 1 AM each primer,

and 2.5 U Taq DNA polymerase (Pharmacia). Reactions were

carried in a 48-well automated Perkin Elmer Cetus thermal

cycler.

3-actin amplifications involved 1 cycle of denaturation

(940C for 30 sec, 600C for 30 sec, and 720C for 30 sec), and 1

cycle of extension (720C for 10 min). Amplifications using env

or gag-pol primers were carried out with 1 cycle of

denaturation (950C for 10 min), 35 cycles of amplification

(950C for 1 min, 550C for 1 min, and 720C for 2 min), and 1

cycle of extension (720C for 10 min). Negative controls using

uninfected human DNA and reagent controls without DNA were

included in every experiment.

Amplified products were analyzed by electrophoresis in

agarose gels, transfer to Nytran membranes (Schleicher &

Schuell, Keene, NH), and hybridization with double-stranded

DNA probes, which were random labelled with c [32P]dATP (Du

Pont, Boston, MA) and specific for actin, env or gag-pol

sequences. Hybridizations were performed for 16 hours with 106

cpm of radiolabelled probe per ml of buffer, and washed for 1

hour (83). Hybridizations and washes were carried at 55C for









62

0-actin, and at 600C for both env and gag-pol. Membranes were

exposed to Fuji medical X-ray film at -800C.

Proviral load calculations were done by comparison of the

results of PCR amplifications of serial dilutions of patient

samples to the serial dilutions of the 8E5 DNA standard curve

using densitometry (4, 155). Amplifications carried out with

O-actin primers and serial dilutions from subject and 8E5 DNA

served as internal controls to assure equivalent amounts of

input DNA. Proviral load was calculated in DNA from purified

CD4 T cells and PBMC obtained from 18 HIV-infected mothers.

We, and others, have determined that similar viral load

results can be obtained when quantitation is performed using

either DNA from separated CD4' T lymphocytes or from total

PBMC, corrected to CD4+ T cells based on flow cytometry

analysis of blood T cell subsets (208).

HIV-1 p24 antigen assay. HIV-1 antigenemia was determined

by measuring the level of p24 antigen in maternal plasma after

acid dissociation of immune complexes using an ELISA assay

(Coulter, Hialeah, FL).

Statistical analysis. Paired statistical analysis of the

results were carried out using Sigma Stat software (Jandel

Scientific, San Rafaelo, CA). Comparison of viral load in CD4

T lymphocytes and total PBMC in treated versus untreated,

transmitting versus non-transmitting mothers, was performed

using the Mann-Whitney rank sum test. Comparisons of CD4 T

cell counts, CD4 to CD8 ratios, and age within the study









63

populations were performed using Student t test. Fisher's

exact was applied to compare each of the following: p24

antigenemia, mode of delivery, race, and CDC disease stage in

the transmitting and non-transmitting groups, and in the

treated and untreated groups. The rate of transmission in

treated and untreated mothers was compared using a Fisher's

exact test.


Results


Characteristics of study population. Clinical and

demographic characteristics of the individual women enrolled

in the study are shown in table 3.1. Forty-two HIV-1 infected

pregnant women were enrolled prospectively. Women who had

received antiretroviral therapy prior to their pregnancy were

excluded. Most women (85.4%) gave birth by vaginal delivery.

None of the infants were breast fed. The study group ranged in

age from 14 to 37 years with a mean of 25.6 ( 5) years and

were predominantly African American (77.5%). The clinical and

immunological status of the study population at the time of

delivery was highly variable. Ten of 42 women (23.8%) were

symptomatic (CDC stage B or C). CD4' T cell counts ranged from

as low as 7 to as high as 1046 per microliter, with a mean

CD4+ T cell count of 477 ( 294) cells per microliter.

Clinical, immunological and virological characteristics

of mothers not treated with ZDV. Within the study population

23 women received no antiretroviral therapy during pregnancy.











64

Table 3.1. Clinical data for the cohort of HIV-1 mothers




Patienta Age Raceb Transmission CDC Mode of p24 CD4+ T CD4:CD8
statusc stage Deliveryd Age cells/pl ratio


Untreated


564 23 B T Al VD 882 1.03
184 23 B T Al VD 750 0.67
211 17 B T Al VD + 396 0.43
567 19 W T Al VD 550 0.54
051 27 B T C3 VD + 296 0.28
250 29 B T C3 VD + 39 0.07
1400 31 H T A2 VD + 68 0.07
402 30 B T C3 CS + 7 0.03
559 32 B T C3 CS + 133 0.12
313 26 B T C3 VD + 102 0.12
179 29 B T C3 VD 38 0.01
566 23 B NT Al VD 995 1.33
369 17 B NT Al VD 590 0.57
1147 23 B NT Al VD 824 0.80
570 25 B NT Al VD + 370 1.00
590 37 B NT Al VD 539 1.53
541 23 B NT A3 VD 175 0.79
395 27 W NT A2 VD 586 0.40
319 26 B NT Al VD 808 0.70
1314 14 B NT Al VD 925 0.49
503 NA NA NT Al NA NA 650 NA
352 24 B NT Al VD 588 0.65
1005 28 B NT A2 VD 305 0.36


ZDV Treated


1322 27 W T Al CS 678 1.22
1211 29 NA T B2 VD 105 0.17
1427 18 W NT Al VD 1046 0.83
1412 23 B NT Al VD + 800 NA
1222 28 B NT Al VD 612 0.81
1384 18 B NT Al VD 421 0.77
1391 18 B NT Al VD 432 0.33
1260 28 B NT Al VD 846 NA
1388 26 B NT A2 VD 357 0.47
1248 29 H NT Al VD 671 NA
1089 27 B NT Al CS 806 0.64
1149 37 B NT Al CS 519 NA
1462 24 B NT Al VD + 430 NA
1401 28 W NT Al VD 466 0.84
1310 21 W NT B2 VD + 357 NA
1161 27 B NT Al VD 501 0.45
1360 34 B NT A2 VD 223 0.17
1107 19 B NT B3 VD + 123 0.12
1116 28 W NT B3 CS + 47 0.12









65

Table 3.1 continued...


a designated by numbers

b B, African-American; H, Hispanic; C, Caucasian

c T, transmitting; NT, non-transmitting

d CS, Caesarean section; VD, vaginal delivery

e +, detected; VD, vaginal delivery

NA, not available









66

Neither were their newborns treated with ZDV. The untreated

population was predominantly African American (86.4%) with an

average age of 25 ( 5) years at the time of delivery (Table

3.2). Among the untreated mothers, 11 (48%) transmitted HIV-1

to their children while 12 mothers did not transmit the virus.

Transmission in this cohort was higher than the 25% to 30%

that is usually observed in our geographic region (39). A

likely explanation for the transmission rate in our cohort was

that universal HIV-1 screening of pregnant women was not in

place at our study sites when enrollment began. Consequently,

women with more symptomatic HIV disease and lower CD4 T cell

counts, who were at greater risk for transmission, were more

likely to be identified during pregnancy and, therefore, were

overrepresented in our untreated group. Because of this

potential bias, we compared the rate of transmission between

ZDV treated and untreated women with CD4' T cell counts of

greater than 200 cells per microliter. These women were more

similar to the population of mothers enrolled in the ACTG

protocol 076 (36). As shown in figure 3.1, the rate of

transmission in women with CD4+ T cell counts greater than 200

cells per microliter in the untreated group was 31.3%,

compared to 6.3% in the ZDV treated group (p=0.083). Overall,

only 2 mothers (10.5%) in the ZDV treated group had infected

infants, which was significantly different from transmission

by untreated mothers (p=0.017). The results indicate that ZDV



















Table 3.2. Clinical and virological characteristics of untreated mothersa



Transmission Number Age in Raceb CD4+ T CD4:CD8 p24 HIV-1 copies/
status years cells/pl ratio Agc 106 CD4+ T cells


Transmitters 11 26 ( 4.9) 82% 296 ( 309) 0.3 (0.3) 64% 2063 ( 4901)

Non-transmitters 12 24 ( 6) 91% 613 ( 249) 0.8 ( 0.4) 9% 67 ( 97)

p value 0.5 0.6 0.01 0.005 0.01 0.003



a Results are expressed as mean ( standard deviation)

b Percent African-American

c Percent positive











































Figure 3.1. CD4+ T cell counts in HIV-infected pregnant women.
The number of CD4+ T cells per microliter of blood is shown on
the y axis. Untreated mothers received no ZDV therapy during
their pregnancy. The treated mothers and their infants
received ZDV according to ACTG protocol 076. Open circles
indicate mothers who did not transmit HIV-1 to their infants
while the closed circles represent mothers who gave birth to
infected children.







69



1,200


0
1,000 o

0
o 0
o

800 0 00

* 0
O 0
3 *

4 600 o000

P- O
0 0

400 00
+ 0 00




0
200
0




0


01 ----1----------------1
Untreated ZDV Treated

Treatment Status









70

therapy administered to mothers and neonates in our cohort was

effective in reducing the rate of transmission by 78%.

Mothers who transmitted HIV-1 did not differ

significantly from the non-transmitting mothers with respect

to mode of delivery, age (26 4.9 compared to 24 6 years)

(p=0.5), or race (p=0.6) (Table 3.2). However, significant

differences in both immunological and virological parameters

between transmitting and non-transmitting mothers were

identified. Mothers whose infants became infected had fewer

CD4+ T cells, lower CD4 to CD8 ratios, and more advanced HIV

disease than mothers whose infants were not infected. Six of

11 transmitting women (54.5%) were CDC stage C3. The group of

11 transmitting women had an average CD4+ T cell count of 296

( 309) cells per microliter and a mean CD4 to CD8 ratio of

0.3 ( 0.3). In contrast, the 12 non-transmitting mothers were

asymptomatic (CDC stage Al to A3) with mean CD4' T cell counts

of 613 ( 249) cells per microliter, which was significantly

greater than the CD4 T lymphocyte count in the untreated

transmitting group (p=0.01). Mean CD4 to CD8 ratio, 0.8 (

0.4), in the non-transmitting group was also significantly

greater than in the transmitting group of women (p=0.005).

Within the group of non-treated women, plasma virus was

detected in 63.6% of transmitting mothers, but only in 9.1% of

non-transmitting mothers (p=0.01). In addition, the

differences existed between non-transmitting and transmitting

mothers in mean numbers of HIV-1 DNA copies per 106 CD4 T









71

cells was 67 ( 97) and 2063 ( 4901) respectively, which was

significant (p=0.003).

Clinical, immunologic, and virologic parameters of ZDV-

treated infected women. Nineteen HIV-1 infected women and

their neonates received ZDV according to the ACTG protocol

076. To rule out the possibility that factors other than ZDV

could account for reduced transmission among the women in our

group, paired analysis of multiple parameters were examined

between the untreated and treated groups of women (Table 3.3)

(55, 63, 135). ZDV-treated women were the same age as the

untreated group and there were similar numbers of symptomatic

women, 21% versus 26% respectively (p=0.7). Although the ZDV-

treated group had more deliveries by Caesarean section (21%

versus 9% in untreated subjects), and included fewer African

Americans (67% versus 86%), the differences between the

treated and untreated groups in our study did not reach

statistical signigicance.

When immunological parameters were examined, the ZDV-

treated group was virtually identical to the untreated group

of women in CD4+ T cell numbers, 462 ( 317) and 497 ( 270)

respectively (p=0.7), and CD4 to CD8 ratio (p=0.9) (Table

3.3). Virological parameters were also similar between the

ZDV-treated and untreated groups of women. Five of 19 ZDV-

treated women (26%) had detectable p24 antigen, which was not

significantly different from the untreated group in which

antigenemia was detected in 8 of 22 women (36%) (p=0.2).

















Table 3.3. Clinical and virological characteristics of ZDV-treated versus untreated
mothersa



Treatment Number Age in Raceb CD4 T CD4:CD8 p24 Transmission HIV-1 copies/
status years cells/pl ratio Age 106 CD4+ T cells


Treated 19 26 ( 5) 67% 462 (+ 317) 0.5 ( 0.4) 26% 10.5% 1022 ( 3458)

Untreated 23 25 ( 5) 86% 497 ( 270) 0.5 ( 0.4) 36% 48% 1172 ( 4568)

p value 0.7 0.3 0.7 0.9 0.2 0.02 0.3


a Results are expressed as mean ( standard deviation)

b Percent African-American

c Percent positive










*~j









73

CD4' T lymphocytes and HIV-1 infection in individual

untreated and ZDV-treated women. Numbers of infected maternal

peripheral blood lymphocytes within both the ZDV-treated and

untreated groups ranged from 13 to 20,000 per 106 CD41 T cells

(Fig. 3.2). Among the total of 42 women in our population, 29

did not transmit the virus. When the 17 ZDV-treated and the 12

untreated women who did not transmit the virus to their

children were analyzed, no significant differences in clinical

or virological parameters were detected between the 2 groups.

In addition, the mean HIV-1 DNA copy number per 106 CD4+ T

cells in the treated women, 1022 ( 3458), was similar to the

untreated group, 1172 ( 4568) (p=0.3).

Among untreated mothers with fewer than 100 copies of

HIV-1 per 106 CD4+ T cells, 3 of 13 (23%) transmitted. In the

ZDV-treated group, two of 15 mothers (13.3%) with fewer than

100 copies per 106 CD4+ T cells transmitted HIV-1 to their

infants. The difference in transmission between the ZDV-

treated and untreated mothers with this low level of cell

associated virus in CD4 T cells was not significant (p=0.6).

A difference in maternal transmission became apparent

among women who had greater than 100 copies of HIV-1 per 106

CD4' T cells (Fig. 3.2). Among 10 untreated mothers with > 100

HIV-1 copies (range 150 to 16,665) per 106 CD4 T cells, eight

(80%) transmitted. In contrast, none of the 4 ZDV-treated

mothers with > 100 (range 270 to 20,000) copies of HIV-1 per

million CD4' T cells transmitted the virus. There was no































Figure 3.2. HIV-1 copies in peripheral CD4' T cells in women
who were untreated or ZDV-treated. Open circles indicate women
who did not transmit HIV-1 to their children. Closed circles
represent women whose infants became HIV-1 infected. Among the
untreated group, 3 mothers (184, 211 and 564), who had <102
HIV-1 copies per million CD4' T cells, transmitted; 2 mothers
(352 and 1005) with >102 HIV-1 copies per million CD4' T cells
did not transmit. Among the ZDV-treated group, 4 mothers
(1360, 1161, 1107 and 1116) with >102 HIV-1 copies did not
transmit to their infants.







75






a, 5
1 I0

0 10 4
+

Q 4l

S10
10
0 *


o*, oo
0 2
10 o
O **0 0 0
o *0o
e 0 *oo oo O oo
o00o0 0o000
;0 1 0
0 10



Untreated ZDV Treated
Treatment Status









76

significant difference in mean levels of HIV-1 DNA copies in

CD4+ T cells between the 2 groups (2311 5096 versus 5450

9711 in untreated and treated, respectively; p>0.1). Yet, the

difference in transmission between untreated and ZDV-treated

mothers and neonates was significant (p=0.015).


Discussion


In the absence of antiviral therapy for HIV-1 infected

mothers and their infants, a significant relationship between

maternal immunological and virological parameters and risk of

HIV-1 infection for the infant was detected in our study. An

increased likelihood for transmission within our cohort of

untreated HIV-1 infected women was inversely related to

maternal CD4 T cell counts and CD4 to CD8 ratios, and

directly associated with levels of HIV-1 DNA copies found in

CD4 T cells in maternal peripheral blood.

A positive relationship between pediatric infection and

levels of maternal virus was found in other studies based on

evaluation of HIV-1 either in plasma, by p24 or RNA PCR, or in

cells, primarily by culture (64, 65, 97, 155, 202). We relied

on 2 measurements of HIV-1 infection in the mothers,

specifically p24 plasma antigenemia and HIV-1 DNA copies

within PBMC. Most untreated women in our population were

enrolled prior to widespread use of plasma RNA levels as a

clinical test, so for consistency p24 antigen was evaluated

for all women in our study population. Most likely the number









77

of mothers with detectable plasma viremia was underestimated

in our study because measurements of plasma viremia by p24

antigen capture are less sensitive than quantitative viral RNA

assays (25). Nonetheless, there was general concordance

between detectable plasma viremia and transmission among the

mothers in our study. Amplification of HIV-1 DNA was sensitive

enough in our assays to detect one copy of HIV-1 in DNA from

150,000 cells. The level of HIV-1 provirus per million

peripheral CD4' T lymphocytes ranged from 13 to 20,000 among

the women in our population, which is comparable to levels of

HIV-1 infection in adults determined by similar methodology

(34, 139, 208).

Our study population was comprised of non-randomized

subjects and included untreated mothers who were equally

divided between transmitters and non-transmitters. However,

ZDV treatement administered according to ACTG protocol 076 to

the mothers and neonates in our population, resulted in about

10% pediatric infection, which is similar to the results from

the original trial (36). The impact of ZDV treatment on

maternal viremia or cell-associated virus was not evaluated as

part of the original ACTG protocol 076. In our study, ZDV

treatment significantly reduced HIV-1 infection among the

infants, but the effect was independent of maternal

immunological or virological parameters. In fact, the two ZDV-

treated women who transmitted in our population had fewer than

100 HIV-1 copies per million CD4' T cells and undetectable









78

plasma viremia. ZDV-resistant virus was detected in one

treated mother, which could account for transmission in that

case, and suggests that even relatively low levels of

resistant virus increases the risk for pediatric infection

(69).

Transmission also occured in the absence of ZDV treatment

among 3 mothers with fewer than 100 HIV-1 copies per million

CD4+ T cells. No other confounding clinical factors that would

account for transmission were readily discernible among these

mothers or their infants. Viral phenotype was not evaluated

prospectively as part of these particular studies. However,

viral characteristics, such as macrophage tropism or syncytium

formation in culture, have been implicated as factors in

maternal transmission (92, 111, 140, 150, 166, 175, 196).

Based on our results, ZDV appears to exert its greatest

effect on reducing maternal transmission among women with high

proviral load. These results raise a question as to how ZDV

administered to mother and neonate reduces HIV-1 infection. If

the effect is not on levels of virus in the mother, then other

mechanisms must account for the success of ZDV therapy. For

example, ZDV may reduce infectivity of maternal virus by

selection of viruses with increasing resistance to the drug.

Multiple amino acid substitutions in reverse transcriptase

(RT) are required for high level ZDV resistance of the virus.

Intermediate amino acid changes can result in reduced drug

sensitivity and altered virus viability (101). Alternatively,









79

ZDV may have an impact on the target cells in the neonate that

are susceptible to infection. The effect of ZDV on nucleic

acid elongation is not restricted to DNA synthesis by HIV-1

reverse transcriptase (72). Replication of host cell

mitochondrial and chromosomal DNA is also impacted by

nucleoside analogues such as ZDV. ZDV produces a transient

suppressive effect on neonatal hematopoiesis (36, 177). It has

also been shown to reduce the proliferative response of

lymphocytes in vitro (88). A clearer understanding of the

factors which enable ZDV to reduce HIV-1 infection in neonates

is essential to develop more effective therapeutic strategies

that will essentially eliminate pediatric HIV-1 infection by

maternal transmission.















CHAPTER 4
PEDIATRIC HIV-1 INFECTION OF MONOCYTES
AND CD4+ T LYMPHOCYTES


Introduction


Mother-to-child transmission of HIV-1 accounts for most

infections in the pediatric population. Different than adult

individuals infected with the virus, vertically infected

children usually present a more rapid progression to disease.

Multiple factors can have an impact on the disease outcome in

children including timing of maternal transmission of HIV-1 to

the infant, immaturity of the neonatal immune system (109),

and increased susceptibility of neonatal monocytes-macrophages

to HIV-1 infection (185).

Children who have virus detected in their peripheral

blood by PCR (polymerase chain reaction) or culture at birth

are defined as being infected in utero, and seem to develop

symptoms faster than children who acquire HIV later during

gestation (PCR or culture negative at birth) (48). Also,

because young children have significantly fewer memory

(CD45RO) CD4' T cells than adults (22% in normal children in

the first 2 years of life versus 63% in adults) (94),

immunological funtions such as T cell proliferation in

response to antigens and production of antigen-specific IL-2


80









81

and y-interferon, could be more depressed in infected children

than in adults.

The role of monocytes and macrophages in the

immunopathogenesis of HIV infection is not completely clear.

In contrast to the decline in CD4+ T lymphocytes that occurs

during HIV infection, changes in monocyte-macrophage number

are minimal even in late stage disease (126, 127). Monocyte-

macrophage function in HIV-1 infected individuals has been

described to be impaired by some, but not by other authors.

Reports concerning oxidative burst, candidacidal activity,

chemotaxis and phagocytic function of monocytes-macrophages

are controversial (18, 26, 67, 138, 146). Possible reasons for

the contradictory reports could be that (1) HIV-l-infected

peripheral blood monocytes have been identified in only a

small proportion of infected individuals (169), and (2)

infected cells of this lineage are not necessarily killed by

the virus (32, 126, 170, 172). It is thought that the infected

cells may function as a reservoir of virus in different

organs, particularly the brain and lung. Incidence of HIV-1-

related central nervous system (CNS) disease in infants and

children is greater than in adults, and it is estimated to

affect 30-40% of symptomatic children (21, 23). HIV-infected

monocytes-macrophages may also be involved in the spread of

virus to CD4+ T cells, and infection of placental macrophages

could play a role in the vertical transmission of HIV-1 (118,

175).









82

The goals for this part of our study were (1) to define

the role of blood monocytes in the immunopathogenesis of HIV-1

infection in children, and in the vertical transmission of the

virus, and (2) to compare progression of disease in a

pediatric population, with diverse outcome during the first

year of life. Children 0-13 years of age were studied

longitudinally or cross-sectionally. First, because infection

of blood monocytes is a controversial subject, it was very

important to characterize extensively the presence of virus in

these cells. A technique of monocyte isolation was developed

for this purpose which yields monocytes that can be 98-99%

depleted of T lymphocytes (4). The great advantage of this

technique over others described is the ability to verify the

presence of residual T lymphocytes among the selected monocyte

population, essential to avoid misleading results (4). Second,

characteristics of virus replication in children who were

infected early versus late during pregnancy, and in slow and

rapid progressors, were compared using a PCR based assay. To

understand with more details the behavior of the virus in

pediatric HIV, infection of naive (CD45RA) and memory (CD45RO)

subsets of CD4 T cells was then analyzed.


Materials and Methods


Patients. HIV-1 infected individuals were enrolled in

this study at the Pediatric Immunology Clinic at the

University of Florida, Gainesville, FL, from June of 1989









83

through April of 1996. Signed informed consent was obtained

from all mothers.

Thirteen HIV-1 vertically infected children were followed

prospectively from birth, with a total of 92 blood samples

analyzed from these individuals (Table 4.1). Five of these

children were HIV PCR positive at birth (determined within 24

hours of birth), while 8 children did not have virus detected

in PBMC (peripheral blood mononuclear cells) by PCR at that

time. None of these infants were breast-fed. A group of 3 HIV-

1 infected children 2 to 12 years old was also followed

prospectively, with a total of 20 blood samples analyzed

(Table 4.2). One of these children (MIST) was infected by

contaminated blood product at birth, while the 2 other were

vertically infected by their HIV-1 positive mothers. Status of

infection was not determined in these 2 children at the time

of birth. Cross-sectional analysis included blood samples from

9 HIV-1 children 1 to 13 years of age (Tables 4.1 and 4.2).

One child (NIHI) was infected by contaminated blood product at

birth, while the other 8 acquired HIV-1 from their infected

mothers. Clinical information regarding PCR results at birth

was not available for these children. None of the vertically

infected children in this study was treated with zidovudine

(ZDV) according to the ACTG 076 protocol, to prevent maternal

transmission of HIV-1.

Virological and clinical data collected from these

children included gestational age at birth, race, CD4 and CD8











84

Table 4.1. Characteristics of HIV-1 infected children followed
longitudinally from birth, classified according to pattern of
disease progressiona



Patientb Age in CD4 T CD4:CD8 CDC HIV-1 copies/106
months cells/il ratio stage CD4+ T cells



Slow progressors


MEST 131 4.5 3969 1.8 N1 29
160 7.0 3969 1.8 Al 82
189 9.0 3969 1.8 Al 122
299 14.4 1889 0.9 Al 188
400 28.0 972 0.3 B2 125
461 31.0 972 0.3 B2 400
513 37.0 544 0.3 B2 235
1281 61.0 440 0.3 B3 125
1481 69.0 317 0.3 B3 89
1555 72.0 388 0.2 B3 200

KAAH 49 0.3 2312 3.0 E ND
83 3.0 2312 3.0 N1 167
113 8.3 1155 2.0 A2 104
166 13.3 1155 2.0 A2 375
280 28.0 1466 2.3 A2 87
383 34.0 1499 2.3 B2 43
539 46.0 1268 2.2 B2 53
1082 58.0 647 1.8 B2 48
1290 69.0 682 1.4 B2 54
1399 73.0 630 1.4 B2 52
1428 74.0 630 1.4 B2 20
1503 77.0 648 1.0 B2 20

DEWA 1056 8.5 2003 1.0 N1 25000
1101 11.0 1490 0.6 Al 30000
1133 12.8 2145 0.7 Al 8000
1164 14.3 767 0.4 A2 1180
1221 17.0 677 0.3 A2 670
1297 21.5 1214 0.5 A2 1000
1362 25.0 1214 0.5 A2 300
1443 28.0 539 0.4 A2 40
1532 30.0 1130 0.4 B2 100

DIKA 1069 9.5 1633 1.6 Al 10000
1180 15.0 1455 1.0 Al 1480

JOSH 1242 8.3 4236 1.7 Al 100
1256 9.0 3632 1.9 Al 37
1414 15.5 1720 1.1 Al 334
1470 18.0 1976 0.7 Al 33
1536 20.0 2755 0.7 Al 1400

TEWIc 1547 18.0 1085 1.5 N1 160











85

Table 4.1 continued...



Patientb Age in CD4+ T CD4:CD8 CDC HIV-1 copies/106
months cells/il ratio stage CD4 T cells



Rapid progressors


JOFO 1492 0.9 1789 1.5 N1 2325
1516 1.8 1171 1.2 N1 1200
1542 2.8 977 0.4 N2 12500

SAFR 1016 8.3 502 0.4 C3 8000
1039 9.5 498 0.3 C3 10000
1068 11.8 484 0.3 C3 8000
1132 15.0 412 0.4 C3 3350
1197 17.8 277 0.4 C3 1880
1232 20.5 128 0.2 C3 500
1296 24.0 126 0.3 C3 1430
1356 27.0 126 0.3 C3 1143
1440 30.0 126 0.3 C3 571
1530 33.0 45 0.05 C3 700

JERO 576 1.0 1176 0.6 C2 10000
1029 5.0 722 0.7 C2 30000
1076 8.0 862 0.8 C2 25000
1199 14.0 588 0.7 C2 1880
1284 19.3 454 1.1 C2 300
1426 25.0 664 0.7 C3 273
1448 26.0 664 0.7 C3 91
1537 29.0 1000 0.85 C3 1200

JALA 1004 1.5 3045 1.4 N1 1150
1007 2.0 3045 1.4 Al 30000
1038 4.5 1784 1.9 B1 50000
1084 7.0 1784 1.9 B1 2000
1120 9.0 1784 1.9 C1 425
1201 12.5 902 0.7 C2 270
1246 16.0 619 1.0 C2 10
1268 17.0 619 1.0 C2 13
1342 21.0 143 0.4 C3 5
1415 23.0 96 0.2 C3 5

SHFI 413 1.0 2546 2.4 Al 10000
458 3.8 1603 1.1 Al 2000
588 17.0 62 0.1 C3 1000
1225 30.5 385 0.2 C3 60
1279 34.0 601 0.6 C3 100
1346 36.0 485 0.06 C3 167
1376 37.0 485 0.06 C3 167
1447 41.0 238 0.4 C3 2667
1539 44.0 428 0.4 C3 100

SHJO 480 0.03 1835 1.6 N1 95
494 1.3 2394 1.6 Al 10000
530 5.8 1597 1.9 Al 5000
1162 22.0 1134 0.6 Al 140
1271 28.0 924 0.9 Al 29










86

Table 4.1 continued...


Patientb Age in CD4+ T CD4:CD8 CDC HIV-1copies/106
months cells/pl ratio stage CD4+ T cells


Rapid progressors


1331 32.0 857 0.9 Al 29
1471 36.0 704 0.9 A2 29

MEBEc 1308 12.0 48 0.9 C3 2857



Indetermined


NIBA 1474 3.0 4111 0.7 N1 130
1498 3.8 4111 0.7 N1 130
1508 4.0 2083 0.8 N1 194
1518 4.3 2359 0.7 N1 2000

REGR 1259 0.03 2059 1.5 E ND
1278 1.0 3338 2.4 N1 1000
1443 7.5 1665 1.1 Al 20


a samples from two patients who were class E at the time, were
not included in the statistical analysis

b designated by initials

c patients analyzed at one time point only, not included in
the statistical analysis

ND, not detected










87

Table 4.2. Characteristics of HIV-1 infected children 2-13
years of age



Patienta Age in CD4+T CD4:CD8 CDC HIV-1 copies/
years cells/pl ratio stage 106 CD4+T cells


MISTb 22 5.8 1059 0.4 Al 182
246 7.9 64 0.4 Al 250
407 8.9 591 0.2 A2 615
535 9.8 795 0.3 A2 235
1072 10.7 884 0.3 A2 300
1229 11.4 728 0.2 A2 90

CHST 122 2.7 1329 0.9 B1 1540
196 3.0 1012 0.8 B1 1548
387 4.5 1131 0.7 B1 1290
527 5.3 812 1.1 B1 1250
1042 6.3 938 0.7 B1 1935
1224 7.1 620 0.9 B1 150
1335 7.6 765 1.0 B1 1360
1431 7.8 800 0.6 B1 100

JOST 158 2.4 933 0.6 B1 148
307 3.0 933 0.6 B1 222
399 4.2 578 0.2 B2 182
556 5.3 558 0.3 B2 223
1282 7.0 246 0.2 B3 200
1438 7.5 224 0.2 B3 20

NIHIb 1551 12.0 638 0.9 B1 10

MEMO 1112 8.8 913 1.2 Al 200

ALGA 504 7.7 11 0.03 C3 220

JOLE 432 5.1 386 0.5 C2 150
1254 7.6 210 0.3 C2 500

JASM 1169 7.7 270 0.6 C3 100
1194 7.8 357 0.8 C3 300



a designated by initials

b patients infected by contaminated blood product at birth









88

T lymphocyte counts, p24 antigenemia, percent monocytes,

percent HLA-DR+ T lymphocytes, use of antiretroviral therapy,

and disease stage according to the 1994 classification system

by the Centers for Disease Control (CDC), as follows:

immunologic categories 1 (no evidence of suppression); 2

(evidence of moderate suppression); and 3 (severe

suppression). Clinical categories E (HIV status not

confirmed); N (no signs/symptoms); A (mild signs/symptoms); B

(moderate signs/symptoms); and C (severe signs/symptoms) (31).

Children <18 months of age were defined as infected if they

had virus detected by PCR on at least two occasions. Children

>18 months of age were defined as infected if they had a

positive PCR and/or ELISA, and confirmed by Western blotting.

Cross-sectional analysis of blood samples from 16 HIV-1

mothers was also performed. Among these women there were 11

mothers who did not receive ZDV to prevent vertical

transmission of HIV-1, 7 of whom transmitted the virus to

their children. The other 5 women received ZDV according to

the ACTG 076 protocol. There were no transmitting mothers in

this group (Table 4.3).

Virologic and clinical data collected from the adult

patients included age, race, CD4 and CD8 T lymphocyte counts,

p24 antigenemia, percent monocytes, disease stage according to

the CDC classification (194), status of transmission to the

child, and use of antiretroviral therapy to prevent vertical

transmission of HIV-1.










89

Table 4.3. Detection of V,8 and HIV-1 sequences in DNA from
CD14+ monocytes and CD4+ T lymphocytes of infected mothers


Patienta V 8/104 cells HIV-1/104 cells % CD14
cellsb

CD4' T CD14 CD4+ T CD14+



Transmitting


CODI 1015 50 20 2 <1 7.0
1106 6 3 0.2 <1c 7.0

TEBU 1014 50 2 5 1 11.5

MARA 578 ND ND 4 <1 5.0

LOWA 1102 ND ND 100 <1 NA

CABR 1096 8 2 0.2
ROMO 1111 ND ND 70 <1 9.0

HAST 433 4 1 4 0.6 12.0


Non-transmitting


ELHU 1033 20 6 0.2 <1 7.0

DERU 1000 ND ND 0.4 <1 NA

CHWA 1052 ND ND 1 <1 3.0

LAOW 1147 ND ND 0.1 <1d NA


076 non-transmitting


PAEL 1152 12 <1 0.7
LIWA 1089 ND ND 0.3 <1 7.6









90

Table 4.3 continued...


Patienta V08/104 cells HIV-1/104 cells % CD14*
cellsb

CD4+ T CD14+ CD4+ T CD14



076 non-transmitting


JAWI 1116 ND ND 200 <1 4.0

DICO 1215 ND ND 0.5 <1 6.6

DERO 1222 20 5 0.2 <1C 3.0



a designated by initials

b percent of total PBMC according to flow cytometryanalysis

c less than 1 copy of HIV-1 detected in 5 X 104 cells

d less than 1 copy of HIV-1 detected in 7.5 X 104 cells

e less than 1 copy of HIV-1 detected in 1.5 X 104 cells

ND, not done; bold letters, samples also amplified with M667-
AA55 primers









91

Cell lines. Cell lines used for control experiments were

Jurkat, a human T-cell line which has rearranged V,8-Jl.2 T

cell receptor (TCR) (203), and 8E5, a human T-cell line which

contains a single integrated copy of HIV-1 DNA in each cell

(68). The cell lines were obtained from the NIAID AIDS

Research and Reference Program.

CD14 monocytes, CD4' T lymphocytes and CD4'

CD45RA/CD45RO selection technique. Three to five milliliters

of peripheral blood from children <2 years of age to up to 10

ml of blood from older children and adults, were collected in

acid citrate dextran (ACD) tubes. All samples were processed

within 24 hours after collection, as previously described (4).

Briefly, plasma was separated from total blood and PBMC were

collected after Ficoll-Hypaque density centrifugation

(Histopaque-1007; Sigma Diagnostics, St. Louis, MO) CD14

monocytes were selected from total PBMC after incubation of

the cells with a mouse monoclonal antibody (MAb) anti-CD14,

MY4 (125 Ag/ml) (Coulter Immunology, Hialeah, FL), followed by

incubation with immunomagnetic beads coated with sheep anti-

mouse immunoglobulin G (IgG) (Dynabeads M450; Dynal, Oslo,

Norway). Monocytes with beads were separated from the CD14-

negative fraction using an MPC-1 Dynal magnet. CD4 T

lymphocytes were selected from the CD14-depleted cell fraction

after incubation with a MAb anti-CD4, T4 (500 pg/ml) (Coulter

Immunology) and immunomagnetic beads.









92

After depletion of CD14+ monocytes the CD4+ T lymphocytes

were selected from the remaining PBMC using a MAb anti-CD4

linked to a detachable magnetic bead (DETACHaBEAD, Dynal), as

previously described (181). After beads were detached from the

CD4 T lymphocytes, CD45RO cells were selected by incubation

with UCHL1 mouse MAb (277 ug/ml) (Dako Corporation,

Carpinteria, CA), and magnetic microspheres. CD45RA cell

fraction was selected from the CD45RO-depleted CD4+ T cells,

using MAb Leu-18 (25 ig/ml) (Becton Dickinson Immunocytometry

Systems, San Jose,CA) and immunoaffinity beads.

Cell lysis and DNA extraction. Cells were resuspended in

1 ml lysis buffer (10 mM Tris [pH 8.0], 100 mM NaC1, 1 mM

EDTA, 2% sodium dodecyl sulfate [SDS], 100 Ag proteinase K per

ml) and incubated overnight at 370C. DNA was extracted using

the G NOME DNA isolation kit (Bio 101, Inc., La Jolla, CA),

according to the manufacturer. DNA concentration was

calculated by spectrophotometric reading using a Beckman DU

640 instrument.

Alternatively, cells were lysed in K buffer (50 mM KC1,

10 mM Tris-HCl [pH 8.3], 2.5 mM MgC2,, 0.5% Tween 20 and 100

pg of proteinase K per milliliter of buffer), at a final

concentration of 50 ng of DNA (5,000 cells) per microliter of

K buffer.

PCR amplification. Primers used for amplification of HIV-

1 were directed to the env region, forward LV15 (5'-

GCCACACATGCCTGTGTACCCACA-3') and reverse 194G (5'-









93

CTTCTCCAATTGTCCCTCATA-3'), located at nucleotides 6464 to 6487

and 7693 to 7713, and to gag-pol sequences, forward Gagi (5'-

GACCAGCAGCTACACTAGAAGA-3') and reverse Pol2 (5'-

TGCGGGATGTGGTATTC-3'), located at nucleotides 1802 to 1823 and

2863 to 2879, in the HIV-1LAI genome as previously described

(5). A third set of primers was used to amplify long terminal

repeat (LTR) sequences of the virus, M667, forward (5'-

GGCTAACTAGGGAACCCACTG-3'), corresponding to nucleotide

positions 496 to 516, and AA55, reverse (5'-

CTGCTAGGAATTTTCCACACTGAC-3'), corresponding to nucleotides 612

to 635 (214). Primers specific for the V,8 family of TCR were

forward V,8 (5'-GTTCCGATAGATGATTCAGGGATGCCC-3') and reverse

J0l.2 (5'-TACAACGGTTAACCTGGT-3'), as previously described,

yielding a 180 bp fragment (4). Amplifications of V,8

sequences were performed to evaluate the level of enrichment

of CD14 monocytes, in relation to the presence of residual T

cells. Oligonucleotide primers were synthesized on an Applied

Biosystems DNA synthesizer in the DNA synthesis core facility

of the Interdisciplinary Center for Biotechnology Research at

the University of Florida. f-Actin sequences were amplified

with a forward primer (5'-GAAACTACCTTCAACTCCATCATG-3') and a

reverse primer (5'-CTAGAAGCATTTGCGGTGGAC-3') (Clontech, Palo

Alto, CA). Amplified products were 350 bp. 3-Actin

amplifications were always performed to assure analysis of

similar amounts of input DNA among individuals, and also




Full Text
xml version 1.0 encoding UTF-8
REPORT xmlns http:www.fcla.edudlsmddaitss xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.fcla.edudlsmddaitssdaitssReport.xsd
INGEST IEID EQRT1T188_DN080I INGEST_TIME 2015-01-06T22:10:03Z PACKAGE AA00026564_00001
AGREEMENT_INFO ACCOUNT UF PROJECT UFDC
FILES



PAGE 1

HIV-1 MATERNAL TRANSMISSION AND PEDIATRIC DISEASE OCCUR IN THE ABSENCE OF DETECTABLE INFECTION IN CD14+ MONOCYTES AND IN DIRECT ASSOCIATION WITH PROVIRAL COPY NUMBER IN CD4+ T LYMPHOCYTES By LUCIA FERNANDES ALEIXO A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 1996

PAGE 2

I dedicate this thesis to my dear parents, Zelia and Mauricio Aleixo.

PAGE 3

ACKNOWLEDGMENTS First, I would like to thank my husband Stephen A. Hogg, who gave up many things, including his life by the ocean, to move to Gainesville, FL, and stay by my side as I worked on my PhD. I am very grateful to my parents for all the support provided since the begining of this journey. I also would like to thank my sister, Ursula A. Hoffmaster. It meant very much to know that she was just a couple of hours away from me. I am thankful to Dr. Maureen M. Goodenow, my advisor and friend, who provided great support and orientation throughout my study; Dr. John W. Sleasman, for his bright ideas and good advice; Drs John Aris, Saeed Khan, and James Zucali, reassuring members of my committee. I would like to thank all the members of the Goodenow' s lab, who made it fun to go to work; specially, I am thankful to Mabel Rojas, for without her technical help it would have been hard to accomplish everything that I did. Also, I would like to thank Dr. Jose Renan C. Mello, for professional guidance, and my sponsor CNPq, Conselho Nacional de Desenvolvimento Cientifico e Tecnologico, from Brazil. Finally, I am grateful to my dogs Feia, Casper, and Ruga, for their unconditional love.

PAGE 4

TABLE OF CONTENTS ACKNOWLEDGEMENTS iii ABSTRACT vi CHAPTERS 1 INTRODUCTION 1 The HIV-1 Virion 2 Immunopathogenesis of HIV-1 Infection 13 Monocyte Infection of HIV-1 20 Vertical Transmission of HIV-1 23 Pediatric HIV-1 Infection 27 2 MONOCYTE SELECTION TECHNIQUE 3 0 Introduction 30 Materials and Methods 31 Results 38 Discussion 52 3 VERTICAL TRANSMISSION OF HIV-1 56 Introduction 56 Materials and Methods 58 Results 63 Discussion 76 4 PEDIATRIC HIV-1 INFECTION OF MONOCYTES AND CD4"' T LYMPHOCYTES 80 Introduction 80 Materials and Methods 82 Results 96 Discussion 123 5 CONCLUSION 131 Maternal transmission of HIV-1 132 HIV-1 infection of blood monocytes and CD4"^ T lymphocytes 137 iv

PAGE 5

REFERENCE LIST BIOGRAPHICAL SKETCH

PAGE 6

Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy HIV-1 MATERNAL TRANSMISSION AND PEDIATRIC DISEASE OCCUR IN THE ABSENCE OF DETECTABLE INFECTION IN CD14+ MONOCYTES AND IN DIRECT ASSOCIATION WITH PROVIRAL COPY NUMBER IN CD4+ T LYMPHOCYTES By Lucia Fernandes Aleixo August, 1996 Chairperson: Maureen M. Goodenow Major Department: Pathology and Laboratory Medicine Pediatric HIV infection is a serious health problem in the world today. Most children are infected through their mothers. However, not all infants born to HIV positive mothers become infected. Furthermore, vertical transmission varies in different geographical regions. Why some mothers transmit the virus and others do not, is not well understood. Multiple factors are associated with mother-to-child transmission, including disease stage of the mother, virus phenotype, levels of maternal virus and obstetrical factors. Hypothesizing that characteristics of the maternal virus are critical for pediatric infection, peripheral blood mononuclear cells (PBMC) from mothers and infants were examined to determine: 1. main target cell of HIV-1 (CD4"^ T cells or monocytes); 2. vi

PAGE 7

association of cell-associated proviral levels with transmission (mothers treated with zidovudive [ZDV] versus untreated mothers); and 3. association of pediatric proviral levels with timing of infection (in utero versus perinatal) and progression of disease. The conclusions of this study are as follows: 1. Blood monocytes are not a virus reservoir in vivo, and CD4"^ T lymphocytes are the main cell type infected in mothers and infants; 2. Virus with macrophage -tropic characteristics are detected in PBMC cultures; 3. Levels of maternal virus in CD4"^ T cells can predict vertical transmission in the absence of ZDV; 4. ZDV does not reduce transmission by lowering maternal proviral burden; 5. Levels of infected CD4^T cells in infants are associated directly with acute and chronic stage disease; 6. In infants, memory and naive CD4"^ T cells are equally infected by HIV-1, while in children >2 years of age, the memory T cell subtype is preferentially infected. These findings will contribute to the understanding of the immunopathogenesis of HIV-1 pediatric infection and maternal -infant transmission, critical to the development of drugs and better therapeutic strategies. vii

PAGE 8

CHAPTER 1 INTRODUCTION The human immunodeficiency virus (HIV) was first described as the causative agent of AIDS (acquired immune deficiency syndrome) in 1983 by a group leaded by L. Montagnier, at the Pasteur Institute in France (10) Since then, HIV has been intensively studied for several research groups worldwide. It is not known whether HIV is a virus recently transmitted to humans or if it has been present in man for many generations. HIV is spread by different routes including sexual contact, exposure to infected blood products and maternal transmission to the child (40) By the end of 1992, it was estimated by the World Health Organization (WHO) that 13 million persons, including 1 million children, were infected with HIV in the world. Of all cases in children reported in the United States at that time, 90% were attributable to vertical transmission (210) The astonishing figures in the rapid increase of HIV disease in the world urge the scientific community to develop means of stopping this epidemics. With this in mind, my studies were oriented towards understanding clinical and virological factors in maternal infant transmission of HIV type 1. 1

PAGE 9

2 The HIV-1 Virion Classification HIV-1 is a lentivirus member of the family of Retroviridae (retrovirus) which also includes oncogenic retroviruses and spumaviruses Retroviruses are characterized by the presence of reverse transcriptase in the virions. Lentiviruses exist in different species and include visna and maedi viruses of the sheep, equine infectious anemia virus (EIAV) caprine arthritis-encephalitis virus, bovine immune deficiency virus, feline immune deficiency virus and simian immune deficiency virus, besides human immune deficiency viruses types 1 and 2 (54) (Fig. 1.1) This subfamily of retroviruses causes slowly developing disease, characterized by a long incubation period and extended course A factor in the protracted course of HIV disease could be the high mutability of the HIV-1 genome. Structure By electron microscopy, the HIV-1 virion has an icosahedral structure (75) containing 72 spikes in its surface, the envelope glycoproteins (gp) (59, 204) These proteins are cleaved from a common precursor gpl60 by a cellular protease, into an external surface protein gpl20 and a transmembrane protein gp41 (12 0) which bind in a noncovalent way (90) The envelope gpl20 is comprised of 5 hypervariable regions, VI -V5. A small site within gpl20, consisting of 24 amino acids localized in the third variable region (V3) is HIV s principal neutralizing domain (71, 212) The binding site for the cellular receptor CD4 is localized in

PAGE 10

3 Oncoviruses Rous sarcoma virus (chickens) Feline leukemia virus (FeLV) Bovine leukemia virus (BLV) Human Tleukemia virus, Type I (HTLV-I) Human Tleukemia virus, Type II (HTLV-II) Spumaviruses Simian foamy virus (SFV) Bovine syncytial virus (BSV) Feline syncytiumforming virus (FSFV) Human nasopharyngeal carcinoma virus (NPCV) Lent iviruses Equine infectious anemia virus (EIAV) Caprine arthritis encephalitis virus (CAEV) Visna virus (sheeps) Bovine immunodeficiency virus (BIV) Feline immunodeficiency virus (FIV) Human immunodeficiency virus (HIV) Simian immunodeficiency virus (SIV) Chimpanzee immunodeficiency virus (CIV) i '• i Figure 1.1. RNA viruses. Animal RNA viruses are classified into 3 families: oncoviruses, or transforming viruses, cause cancer; spumaviruses, also called "foamy" viruses because of the appearance they induce in cells they infect; and

PAGE 11

4 gpl20, in a region between V4 and V5 (206) The envelope protein gp41 seems to be responsible for the fusion of viral and cellular membranes (112) The core is cone-shaped and the 4 nucleocapsid (NC) proteins are proteolytically cleaved from a 55 kDa precursor by the HIV-1 protease (PR) into p24, pl7, p9, and p7 (89) The p24 Gag protein is the main component of the inner NC. Inside the core there are 2 identical copies of ^ single stranded RNA. The viral enzymes reverse transcriptase (RT) integrase (IN) and PR are cleaved from the Pol precursor (189) and together with the NC proteins p9 and p7, they are found closely associated to the RNA. RT acts to form a doublestranded DNA copy of the virus RNA and IN is involved in viral integration. The NC pl7 protein associates with the inner surface of the lipid bilayer to stabilize the virion (82) A diagram of the HIV-1 virion is shown in Fig. 1.2. Genomic organization Lentiviruses are distinguished from other retroviruses by the presence of a complex genome. Most oncogenic retroviruses that are capable of replication contain only 3 genes {gag, pol and env) (197) However, HIV-1 contains not only these 3 essential genes but also at least 6 additional genes (tat, rev, nef, vif, vpr, and vpu) (82) (Fig. 1.3) The HIV-1 genome is approximately 9.8 Kb. It has a 5' and a 3' long terminal repeat (LTR) composed of U3 R, and U5 regions, which contain regulatory sequences recognized by various cellular transcription factors. The TATA box homology

PAGE 12

5 Figure 1.2. Diagram of the HIV-1 virion. Envelope (gpl20 and gp41) and nucleocapsid (pl7 and p24) proteins are identified. Also shown are viral enzymes reverse transcriptase, protease, and integrase, and the virus diploid RNA genome (Modified from ref 3)

PAGE 13

6 5' LTR U3 R U5 GAG VIF TAT^ REV POL / VPR VPU D 3' LTR NEF n lusi I ENV R U5 Figure 1.3. Genomic structure of HIV-1. Represented are the 5' and 3' long terminal repeats (LTRs) structural igag, pol env) regulatory (tat, rev) and accessory {nef vif, vpr, vpu) genes (Modified from ref 133)

PAGE 14

7 is an essential element for trans-activation and serves as the binding site for the TATA box DNA-binding protein TFIID, functioning in transcription initiation. Immediately upstream the TATA box are 3 G-C-rich sequences which bind the cellular transcription factor SPl Within the enhancer element is the consensus recognition sequence for the DNA-binding protein nuclear factor kappa B (NFkB) Additional DNA-binding proteins are nuclear factor of activated T cells (NFTA-1) activation protein-1 (AP-1) and the negative regulatory element (NRE) DNA-binding proteins which bind to the leader region include CTF/NF-1 and leader-binding protein (LBP-1) The transactivation response sequence (TAR) -binding protein UBP-1 binds directly to the TATA box homology (187) Protein products have been identified from 10 open reading frames in the HIV-1 genome. The primary transcript of HIV-1, Gag-Pol precursor pl60, is translated into Gag precursor p55 which gives rise to 5 structural proteins, and the Pol precursor protein which is cleaved into the viral replication enzymes. Splicing events producing many subgenomic mRNA are important for the synthesis of other viral proteins. The rev gene appears to determine the amount of unspliced to singly and multiply spliced mRNA. The envelope glycoproteins gpl20 and gp41 are made from a precursor gpl60, a singlespliced message from the full-length viral mRNA. Gene products of other spliced mRNAs give rise to at least 6 regulatory and accessory proteins, namely tat and rev

PAGE 15

8 (regulatory) (53, 153), and nef, vif, vpr, and vpu (accessory) (16, 37, 73, 79, 194) Major functions of the protein products are: Tat, transactivation; Rev, regulation of viral protein expression; Nef, virus suppression, signal transduction, and cell activation; Vif, increases virus infectivity and cell-tocell transmission; Vpr, helps in virus replication; and Vpu, helps in virus release. Heterogeneity of HIV Two major types of AIDS viruses, HIV-1 and HIV-2, can be identified. HIV-2 differs by more than 55% from HIV-1, the major difference residing in the envelope glycoproteins (85) Antibodies to HIV-2 generally cross-react with Gag and Pol proteins of HIV-1, but envelope proteins may not be detected (76) HIV-2 glycoproteins seem to cross-react with envelope proteins from SIV, and because of the marked similarities in their sequences, it appears that HIV-2 was derived from SIV (115) Individuals infected with HIV-2 survive longer than with HIV-1 infection, suggesting that HIV2 is less pathogenic to humans (205) Based on the viral envelope sequences, 9 subtypes of HIV1 (A to I) have been identified in the world (134) (Fig. 1.4) The clades differ from each other by at least 20% in the amino acid composition of the envelope region, and 15% in the Gag region. Within each clade, the differences in Env can be up to 10%, and up to 8% in the Gag region (133) Clade A is found in Central Africa, B in North and South America and in Europe, subtype C in South Africa and India, subtype D in Central

PAGE 16

Figure 1.4. A neighborjoining tree showing the classification of HIV-1 sequences into 6 clusters, A through F, based upon envelope coding sequences A chimpanzee virus sequence (SIVCPZ) and 2 highly divergent Cameroonian sequences designated 0 (for "outlying"), are also shown. The sequence subtypes A through F are each 30% different from one another and about 50% different from the 0 group sequences (Modified from ref 106)

PAGE 17

10 Africa, subtype E in Thailand, and F in Brazil (107, 129) and Romania (57) G, H, and I are clades recently found in Africa, Russia, and Taiwan (133) Viruses recovered from one individual have several conserved restriction enzyme sites, which identify the virus as coming from the same person (86) Viruses from the same patient form a heterogenous population, referred to as quasispecies (80) and the diversity within an individual usually ranges up to no more than 7% (133) At least 6% of the viral genome can differ among strains from different individuals. Isolates can vary in both synonymous (mutations that do not affect amino acid expression) and nonsynonymous (mutations that affect amino acid expression) sequence changes. Up to 40% nonsynonymous mutations can be observed in regulatory and envelope gene products (132) The viral RT appears to be responsible to changes in the genome, since up to 10 base changes may occur per replicative cycle (147) Life cycle HIV-1 infects cells expressing at their surface the CD4 protein, which acts as the viral receptor. The 55 kDa CD4 molecule has 2 important functions in immune responses; it serves as a cell-cell adhesion molecule and it also functions as a signal transducer (1) The major cellular targets for HIV-1 in vivo are the CDA'^ T lymphocyte and tissue macrophages. The HIV-1 envelope protein gpl20 binds to CD4 while gp41 causes its fusion to the cell membrane. A diagram of the life cycle of HIV-1 is shown in Fig. 1.5.

PAGE 18

11 Figure 1.5. HIV-1 life cycle. The steps are as follows: 1, attachment; 2, uncoating; 3, reverse transcription; 4, circularization; 5, integration; 6, transcription; 7, translation; 8, core assembly; 9, final assembly and virus budding. ( RNA; DNA) (Modified from ref 106).

PAGE 19

12 After internalization, the viral RNA still associated with the core proteins is reverse transcribed, eventually forming double -stranded DNA. Binding of the tRNA primer starts the process. Synthesis of DNA to the end of the 5' R region (minus -strand strong stop DNA) template switching and elongation to complete the minus strand up to the primer binding site (PBS) follow. Synthesis of the 5' LTR is initiated from the 3' end of the minus-strand DNA (plus-strand strong stop) A second template-switching occurs and synthesis of double-stranded DNA molecule is completed (198) The firststrand DNA copy of the viral RNA is mediated by the virus RT. Second-strand DNA synthesis, also mediated by RT, initiates after partial degradation of the RNA by viral ribonuclease H (82) The DNA copies are transported to the nucleus as a preintegration complex with core and IN proteins, where the viral DNA integrates into the host genome. The integration process is essential for virus replication and it appears to be random (78) although recent reports suggest that HIV-1 may integrate preferentially into LlHs (human LI elements) repetitive elements in the human genome (188) The HIV-1 LTR is the virus promoter region. Cellular transcription factors seem to be of utmost importance in the initiation of early mRNA transcription and include NF-kB, AP-1 and SP-1, among others (192) Following integration, double-spliced transcripts encoding the genes tat, rev, and nef, are the earliest mRNA

PAGE 20

13 species produced (99) In the late stages, structural and enzymatic proteins encoded by gag-pol and env are produced, and the transition between the synthesis of early-regulatory and late-structural products appears to be dependent on Rev (153) Assembly of the HIV-1 virion involves aggregation of the core in the cytoplasm, which contains the viral RNA, Gag and Pol proteins. The assembled virion buds through the plasma membrane, when it acquires the lipid bilayer and env gene products (128) Immunopathocrenesis of HIV-1 Infection Natural history HIV-1 disease causes a variety of symptoms, from apparently silent infection to clinical disease. A main feature of the immunopathogenesis of HIV-1 is the depletion of CD4"^ T lymphocytes, eventually leading to immune deficiency and AIDS. A diagram of events that happen during HIV-1 infection is shown in Fig. 1.6. In the initial days following acute infection, high levels of virus replication take place in the activated lymphocytes in the lymph nodes. Up to 5 X 10^ virions/ml of plasma can be detected during this stage (145) the extent of virus production most likely reflecting the susceptibility of the individual's PBMC to the virus. During this stage the numbers of CD8^ T cells rise, as seen in other viral infections (14) The high viremia is a transitory process and

PAGE 21

14 Acute Asymptomatic ARC AIDS Infection Carrier Time after HIV infection Figure 1.6. Diagram of events occuring after HIV-1 infection. High levels of virus ( ) can be detected in the blood during acute phase of infection, before seroconversion. Subsequently this viremia is reduced to lower levels (phase 1) With the onset of clinical symptoms -AIDS high levels of viremia are detected once again (phase 2). The CD4"^ T cell number (...) decreases during acute infection, returns to a level somewhat bellow normal, then starts a slow decrease over time. A marked decrease in CD4"^ T cell counts can be observed in some individuals as they develop symptoms. The number of CDS"^ T cells ( ) rises during primary infection, to return to values just above normal, staying elevated until the final stages of disease. However, the CDS"" cell anti-HIV responses (-...-) begin to decrease around the time of symptoms, to decrease steadly as disease progression occurs. ARC, Aids related complex (Modified from ref. 106).

PAGE 22

15 within weeks after acute infection, viral burden is downregulated as an effective immune response develops, which includes antibodies and cytotoxic T cells (144) Cellular immune responses are probably the first effective antiviral activity produced, since CD8^ T cell anti-HIV responses have been noted even prior to seroconversion (110) However, despite declines of viral load early in the course of disease, HIV replication does not stop and tends to increase over time (91) Germinal centers in the lymph nodes contain large amounts of HIV-1 in the early and intermediate stages of infection (70) Three to 4 months after the primary infection, 004"^ T cells rise to near normal values, before they start a steady decrease, estimated to be 25-60 cells//xl per year (102) The major cause of CD4"^ T cell death during this stage may be apoptosis, since at this phase of infection the predominant virus detected is the noncytopathic macrophagetropic strain (130) During this period, CD8'^ T cell number remains slightly elevated. Virus replication continues, particularly in the lymphoid tissues (142). When the individual starts to show symptoms of disease, CD4'*' T cells have usually dropped to around 200 cells//xl (adults) and levels of virus in peripheral blood and lymph nodes rise again. A reduction in cytotoxic CDS"^ T cell responses can also be demonstrated at this stage (110)

PAGE 23

16 Progression to disease Following infection of HIV-1 the majority of patients experience a long asymptomatic period prior to the development of AIDS, while some individuals become immunosuppressed and develop opportunistic infections rapidly (8) The average time from the onset of HIV-1 infection to clinical AIDS usually ranges from 7 to 10 years. A small group of patients (5%) however, remains clinically asymptomatic despite prolonged infection, and is called longterm nonprogressors Long-term survivors is a broader definition and includes both asymptomatic and symptomatic patients who generally have been infected for over 10 years. Long-term nonprogressors have lower levels of intracellular and plasma virus, compared to symptomatic individuals. The virus strain identified is relatively nonvirulent, noncytopathic macrophagetropic and does not replicate in established T-cell lines. Neutralizing antibodies are detected in the blood of these individuals. PBMC from these patients produce type 1 cytokines (interleukin-2 [IL-2] and interferon-/? [IFN-(8] ) and CDS"^ T cell responses (cytotoxic and suppressing) (152) which are depressed in AIDS patients, remain strong in this group (178) A shift from TH-1 to TH-2 type cytokines (IL-4 and IL-10) occurs with progresion to disease (106) Dynamics of HIV-1 infection Recently a model of HIV-1 dynamics estimated that in patients with CD4 counts of up to 500, lO' to 10^ virions are produced per day, resulting in

PAGE 24

17 peripheral blood viremia of 10"* to 10^ RNA molecules /ml (91, 201) It was also calculated that 2 X 10^ CD4+ T cells are destroyed per day and that > 98% of the plasma virus is produced within recently infected cells (<1 day) Chronically or latently infected cells do not seem to play a major role in the virus turnover, according to this model. Although such model may be correct for late stage disease, it is yet to be demonstrated if the same holds true for populations of patients with early-stage and asymptomatic disease (121) Factors in the immune pathogenesis of HIV-1 Multiple factors are responsible for immune deficiency in HIV-1 infection. Genetic background of the host, which determines susceptibility of the cells to HIV replication and the effectiveness of immune response, is important in disease progression. Direct infection of CD4'^ cells, alteration in cytokine production and in immune responses (antibodydependent cell -mediated cytotoxicity [ADCC] cytolytic T lymphocytes [CTL] autoantibodies, and apoptosis) can all play a role in pathogenicity. Maintenance of an asymptomatic state appears to depend on an adequate production by 004"^ cells of cytokines such as IL2, needed for CDS"^ T cell antiviral activity. The CD8"^ T cells will cause suppression of HIV replication and consequently normal CD4'*" T cell formation.

PAGE 25

18 The importance of humoral immune responses is uncertain. Neutralizing antibodies are found throughout the entire course of HIV-1 infection. Antibodies would seem to be more useful during the initial phase of infection, when destruction of virusinfected cells (via ADCC) could prevent HIV spread. The type of virus present in the individual is another important aspect of HIV-1 pathogenesis. Syncytiuminducing (SI) and nonsyncytiuminducing (NSI) viruses have been described. The SI phenotype produces cytopathology with formation of multinucleated giant cells or syncytia in PBMC, and can be grown in T lymphoblastoid cell lines. In contrast, NSI viruses do not form syncytia in PBMC, cannot be grown in T lymphoblastoid cell lines, and usually (but not always) grow more slowly than SI variants. Virus isolated from individuals shortly after seroconversion and during asymptomatic infection is predominantly macrophagetropic and NSI in vitro. SI phenotypes are associated with a more advanced clinical stage of HIV disease and with faster depletion of CD4'^ T cells than viruses of the NSI phenotypes (17, 38, 162, 191) Animal models of HIV-1 disease Animal models can be used in the study of the pathogenesis of lentivirus infection and AIDS, in the investigation of perinatal transmission of HIV (159) in the development of vaccines for HIV, and in the assessment of the antiretroviral activity of new drugs. However, an ideal model -one in which HIV-1 infects an

PAGE 26

19 inexpensive and easily available animal, and produces a disease analogous to AIDS still does not exist (104) HIV has been experimentally transmitted to chimpanzees, resulting in a specific antibody response, but these animals do not develop signs of disease. Attempts to produce HIV infection in small animal species (mouse) have been unsuccessful (104) Lentivirus infection in sheep, goats, horses, cattle, and cats are similar to HIV infection in humans. These viruses are genetically analogous to HIV and share several clinical and imunologic features (105) However, the lentivirus with the most similarities to HIV is the simian immunodeficiency virus (SIV) SIV infection of rhesus monkeys is considered to be the best model for HIV-1 infection of humans (47) The viral genomes of HIV-1 and SIV are closely related, and both viruses infect similar target cells. In addition, SIV disease in rhesus macaques is comparable to human AIDS; SIV infection of adult macaques results in high levels of virus replication, CD4'*' T cell depletion, and immunosuppression (7, 104). The severe combined immunodef icient mouse (SCID) transplanted with human peripheral blood lymphocytes has provided a useful model for the study of HIV infection in human T cells in an in vivo environment (122) Although these animals do not develop clinical signs of AIDS, the human cells can be infected with HIV, providing a useful model for

PAGE 27

20 quantitation of HIV infection and in the screening of antiretroviral drugs. Monocyte Infection by HIV-1 Although the main targets of HIV-1 in vivo are the CD4"^ T lymphocytes and tissue macrophages, blood monocytes also express the CD4 surface molecule, consisting of potential targets to the virus. Monocytes are precursors of tissue macrophages, and together with neutrophils, these cells are the main "professional phagocytes" in the body. Monocytes travel unidirectionally from the bone marrow to the tissues, where they differentiate into the long-lived macrophages. In the peripheral blood, monocytes consist of a small fraction of total mononuclear cells (PBMC) usually between 5 and 10% of this population. Infection of these cells could serve as a mechanism of disease dissemination to the tissues, as well as of transmission of HIV-1. CD14, a 53 to 55 kDa glycoprotein is highly expressed on the surface of mature monocytes, in trace amounts on granulocytes, but not on other hematopoietic cells, including monocyte precursors (179) Differential expression of CD14 is observed in tissue macrophages. Peritoneal macrophages show strong CD14 expression, while alveolar macrophages show weak expression of this molecule (216) CD14 a member of the family of leucine-rich proteins (66) is attached to the cell membrane by a glycosylphosphat idylinositol (GPI) anchor (87)

PAGE 28

21 and it functions as a receptor for lipopolysaccharide (LPS) and LPS binding protein (211) Monocytes/macrophages can serve as a virus reservoir during both early and late stages of HIV-1 disease (96) Macrophage -tropic variants, which are viruses that preferentially infect macrophages over T-cell lines in culture, seem to be transmitted more readily than T-cell tropic viruses in both sexual and vertical transmissions (131, 196) Cord blood monocytes and placental macrophages are more susceptible than adult monocytes to HIV-1 infection in culture (98, 150, 185). Finally, in vitro studies suggest that monocytes only become susceptible to HIV-1 during their differentiation into macrophages (173) However, infection of blood monocytes, in vivo, is controversial. Several studies have shown only low levels of HIV-1 present in these cells (123, 125, 169), although one group reported similar levels of infection in monocytes and CD4"^ T cells by an in situ polymerase chain reaction (PGR) assay (9) Many reasons could account for the controversial results. Monocytes comprise a small population of PBMC and selection techniques frequently do not yield highly enriched cell populations. Besides, monocytes differentiate rapidly into macrophages once in culture. Therefore, detection of virus in monocyte populations could be reflecting infection of "contaminating" CD4+ T lymphocyte, infection of mature macrophages, or a true monocyte infection (4) Another

PAGE 29

22 confounding factor is that infection of bone marrow stem cells, which are the progenitors of all blood cells including monocytes, is a controversial issue (42, 136, 186). A previous report demonstrated that nonprolif erating quiescent CD4"^ T lymphocytes are susceptible to virus entry, and that viral DNA synthesis is initiated in these cells with essentially the same efficiency as in stimulated cells, with the difference that only incomplete DNA species are produced in absence of stimulation (214) In this study, spliced RNA transcripts were only detected in stimulated cells, while strong-stop DNA, which is the first region of the HIV-1 genome to be reverse transcribed in the R-U5 region of the LTR, was always demonstrated in quiescent T cells, indicating the presence of input virion. Studies in monocytes derived macrophages (MDM) have subsequently shown that the activation state that coincides with the Gl/S phase of the cell cycle, and not DNA synthesis or mitosis itself, is required for establishment of productive HIV-1 infection of these cells. The MDM fraction that lacks proliferative capacity is susceptible to virus entry, although virus does not replicate at this stage (171) The above results suggest that if blood monocytes are not productively infected, these cells can still be susceptible to viral entry and latent infection, until subjected to mitogen stimulation and consequent proliferation.

PAGE 30

23 Vertical Transmission of HIV-1 The first cases of AIDS in children were described in 1982, approximately a year after the description of AIDS in adults, and a clear connection with maternal infection was then detected (27, 157) The majority of children acquire HIV1 infection from their seropositive mothers, although infection through contaminated blood products and sexual abuse have also been reported. The highest seroprevalence rates in women are among those who are intravenous drug users or who are sex partners of an HIV-infected man. In the United States, African-American and Hispanic women are at higher risk than Caucasians for infection. Not all infected pregnant women, however, will transmit HIV-1 to their children. Transmission varies in different parts of the world. In the absence of anti-retroviral therapy, transmission can be as high as 50% to 60% in certain regions of Africa (19, 41, 161) while in Europe it is lower, at 11% to 15% (63, 119) In the United States, 25% to 30% of infants of HIV-1 infected mothers will acquire the infection (52, 160, 209) HIV-1 may be transmitted to an infant in utero (detection of virus in fetuses as early as 15 weeks old (20) in placentas (98, 175) and in cord blood (185), close to the time of birth or postnatally (breast feeding) (158, 195) Perinatal infection occurs through contact with amniotic fluid, genital

PAGE 31

24 secretions or maternal blood (51) From 30% to 50% of infants are HIV-1 positive by PGR or culture soon after birth, suggesting in utero transmission at some point during gestation (58, 156). Diagnosis of HIV-1 infection in infants cannot be made by detection of HIV antibodies because of placental crossing and persistence of maternal antibodies in the child for up to 18 months. Therefore, ELISA and Western blot tests used for diagnosis in adults are not applicable for children, in whom diagnosis is made by virus culture and/or by PGR. Maternal transmission of HIV-1 is multifactorial and can be influenced by clinical, obstetrical and virological aspects. Advanced disease stage of the mother (clinical AIDS) with altered immune status, particularly low GD4 count (<200 cells//xl) or GD4-to-CD8 ratio, is associated with increased risk for transmission (12, 13, 163) Although the presence of sexually transmitted diseases increases the risk of a woman to become infected by HIV-1, only syphilis and chorioamnionitis were found to be related with higher perinatal transmission rates (163) Mothers who have neutralizing antibodies to HIV-1 seem to be at a reduced risk of infecting their children (95, 100, 165) Macrophagetropic viruses were reported to be preferentially transmitted to the child (95, 98, 140, 150). Reports have shown maternal transmission of either multiple (81) or selected (2, 207) genotypes. Most likely, heterogeneity of the virus transmitted will depend on the

PAGE 32

25 diversity, viability and tropism of the maternal virus, and susceptibility of neonatal cells. Studies on the association of levels of plasma p24 antigen (Ag) and transmission are inconsistent. Some reports show that antigenemia correlates with transmission, while others claim that p24 is unrelated to vertical transmission (65, 97, 143, 163). High levels of maternal plasma HIV-1 RNA are associated with increased transmission (49, 64, 95), and the few studies on the association of maternal cell-associated virus levels and vertical transmission suggest a correlation of these factors (45, 155, 202). Because it seems like vertical transmission can occur through both cell free and cell asociated HIV-1, it is important to consider viral load in both compartments when analyzing neonatal infectivity risk. Obstetrical factors are also associated with mother-tochild transmission of the virus. Children born by Caesarean section are at a lower risk to become infected by HIV-1 (55, 63) while birth weight (61, 135) and gestational age (61, 63) also seem to influence the outcome of the children. Preand post-term infants have more chances to become infected. Furthermore, studies performed in twins have shown that the first born child is at an increased risk for infection (55, 77) A large scale, randomized trial, was conducted to evaluate both the efficacy and safety of the antiretroviral drug zidovudine (ZDV) in reducing the risk of maternal -infant

PAGE 33

26 HIV-1 transmission. ZDV, which readily crosses the placenta, is a deoxythimidine analogue that acts by termination of viral DNA production and competition for nucleotides used by the viral RT (106) Infected pregnant women with CD4 counts above 200 cells//xl were enrolled in the ACTG (AIDS Clinical Trials Group) protocol 076 between 14 and 34 weeks of gestation. Women either received placebo or oral ZDV during gestation and intravenous intrapartum ZDV, and infants of the treated women received oral ZDV for the first 6 weeks of life. A 67.5% reduction in transmission was detected when comparing transmission in the untreated group (25.5%) to transmission in treated mother-child pairs (8.3%). Hemoglobin levels in infants in the treated group were significantly lower at birth, but by 12 weeks the levels were similar in the 2 groups (36) Although ZDV therapy is efficient in reducing vertical transmission of HIV-1, it is not known which arm of the treatment is responsible for the beneficial effect. Women with CD4 counts below 200 cells/pil, not included in the original ACTG 076 trial, were analyzed in posterior studies. The efficacy of ZDV did not seem to depend on CD4'^ lymphocyte level, suggesting that women with severe immune depression, who are at highest risk of transmitting, may also benefit from ZDV (117)

PAGE 34

27 Pediatric HIV-1 Infection As mentioned above, HIV-1 infection in infants occurs mainly through vertical transmission from infected mothers; therefore, the increase in pediatric AIDS cases is due to the growth in the number of HIV-1 infected women of childbearing age (33) Diagnosis of HIV-1 infection in infants can only be made by direct detection of virus in the child. Maternal antibodies are passively acquired by the child and nonspecific signs and symptoms of HIV-1 infection are usually seen at this age. PGR is the most frequently used diagnostic method for its sensitivity and specificity (44, 154) Viral culture and aciddissociated plasma p24 Ag are also acceptable methods for the diagnosis of HIV-1 in infants (15, 22) Procedures used to detect IgA (113, 114) and IgG (6) HIV-1 specific antibodies in children born to seropositive mothers have been developed, but none guarantees high sensitivity or specificity before 3 to 6 months of age. Different than in adults, progression to disease is faster in vertically infected infants. HIV-1 infected children show a high incidence of Pnemocystis carinii pneumonia (PCP) and encephalopathies. PCP is the most common HIV-associated opportunistic infection in children with AIDS, and according to a 1991 report from the Centers for Disease Control (CDC) 50% of children with AIDS develop PCP at some point of their illness (29) Mortality from PCP, specially in the first months of life is very high, therefore, therapeutic

PAGE 35

28 prophylaxis is essential. In the other hand, although children are prone to develop HIV encephalopathies and myelopathies, pediatric patients rarely present with opportunistic infections of the central nervous system (CNS) (21) Factors associated with this rapid outcome include the presence of high viral load in children (48, 56) the incompletely developed immunity at this age (109) the timing of HIV-1 transmission (in utero, at birth or postpartum), pheno type /genotype of the transmitted virus, and the absence of neutralizing antibodies. Infants who are infected in utero (HIV-1 PGR or culture positive at birth) usually develop a more rapid increase in viral load, faster loss of CD4'^ T cells, and earlier progression to AIDS, when compared to children who become infected at birth (48) Low CD4 counts per age are the most commonly used markers of immune deficiency, indicators of risk of developing opportunistic infections, and response to therapeutic intervention. Lymphocyte subsets vary with age in childhood. In normal children (46) and in uninfected children born to HIV-1 positive mothers (62), median 004"^ T cell counts are 3200/mm^ during the first 6 months of life, 3100/mm^ between 712 months of age, declining to 2600/mm^ between 13-24 months of age, and 1700/mm^ by 2-6 years of age. Median adult levels of 800-1000 cells/mm-' are reached towards the end of adolescence (46, 62, 94).

PAGE 36

29 CD4"^ T cells can be further divided into "naive" and "memory" cell populations, phenotypically divided by reaction with monoclonal antibodies (MAbs) directed against certain cell surface molecules as the CD45RA'^ and CD45RO"^ subsets, respectively (164) In normal neonates, more than 90% of CD4"^ T cells in the peripheral blood express CD45RA and less than 10% express the memory phenotype, declining to around 37% in adults (94) In adults, HIV-1 preferentially infects the CD45RO memory T cells (168) In children >2 years of age the memory subtype is also preferentially infected, while in infants, both cell types seem to be susceptible to HIV-1 (181) My project was aimed into a better understanding of the immunopathogenesis of HIV-1 maternal transmission and pediatric infection, specially during the first months of life, as infants progress from acute to chronic HIV-1 disease. The specific aims were: 1. To determine the main target cell of HIV-1 in mother and child infection; 2. To determine an association among pediatric HIV-1 proviral copy number, timing of infection and progression of disease; and 3. To evaluate the correlation between maternal HIV-1 proviral copy number and transmission, in the absence or presence of ZDV therapy. This study should add valuable information for therapeutic approaches and drug development strategies. i •

PAGE 37

CHAPTER 2 MONOCYTE SELECTION TECHNIQUE Introduction i. Monocytes traffic unidirectionally from the bone marrow through the blood to tissues, where the cells differentiate into macrophages. Peripheral monocytes are frequently targeted for studies of human cells of the monocyte/nacrophage lineage because of their accessibility through blood sampling. The techniques developed to isolate monocytes from other peripheral blood mononuclear cells (PBMC) rely on the adherent characteristics of monocytes in culture, their size differences from other PBMC, or their expression of monocyterestricted cell surface proteins such as CD14 (43, 200, 213, 215, 216). Physical methods used for monocyte selection require large volumes (50 ml or more) of blood, which hinder their application in pediatric studies involving infants and young children. Monocytes compose only 5 to 20% of total PBMC in contrast to lymphocytes, which constitute the major population of PBMC. Adherence or elutriation is generally efficient in depleting monocytes from PBMC but often does not generate an enriched monocyte population significantly depleted of lymphocytes (93,200). 30

PAGE 38

31 We developed a technique that utilizes magnetic microspheres, or beads, in combination with monoclonal antibodies (MAbs) targeted at CD14 or CD4 to select highlyenriched populations of monocytes and CD4"^ T cells. CD14 a receptor for lipopolysaccharide is a surface glycoprotein with a size of 55 kDa expressed on cells of monocyte/macrophage lineage (24, 87, 179, 211, 216). CD4 is expressed on both T helper cells and monocytes. A sensitive molecular strategy based on PGR amplification and detection of T-cell receptor (TCR) gene rearrangements demonstrated the effectiveness and reproducibility of the technique to yield viable monocyte populations which contain fewer than 2% contaminating T lymphocytes. The technique is effective even when isolating cells from small volumes of blood. Materials and Methods Cell samples Peripheral blood (5 to 10 ml, maximum of 2 ml/Kg of body weight) from 17 children and adult volunteer blood donors was collected in heparinized tubes according to a protocol approved by the Institutional Review Board of the University of Florida. Samples were diluted 2 to 1 (vol/vol) in Hank's balanced salt solution (HBSS) without calcium and magnesium (GIBCO BRL, Grand Island, NY) plus 20% fetal bovine serum (FBS) (GIBGO BRL) PBMC were collected by Ficoll -Hypaque density centrif ugation (Histopaque 1077; Sigma Diagnostics, St. Louis, MO) as previously described (183) The mononuclear

PAGE 39

32 cells were collected and washed twice in HBSS plus 20% FBS All cell counts were carried out by using a hemocytometer Cell viability was always >98%, as determined by trypan blue exclusion. The cell lines used for control experiments included Jurkat, a human T-cell line (203) and HeLa, a human nonlymphoid cell line (167) The cell lines were obtained from the AIDS Research and Reference Reagent Program: HeLa from Richard Axel and Jurkat clone E6-1 from the American Type Culture Collection. Immunomaqnetic separation PBMC (10^ cells per ml of HBSS plus 20% FBS) were incubated at 4''C for 30 min with an antiCD14 mouse MAb, MY4 (125 /xg/ml) (Coulter Immunology, Hialeah, PL), diluted 1 to 100. PBMC were also incubated with a mouse immunoglobulin G (IgG) antibody, MsIgG (1,000 /ig/ml) (Coulter Immunology) or with no antibody at a similar dilution. The cells were washed twice with cold phosphate-buffered saline (PBS) plus 10% FBS (GIBCO BRL) and resuspended at the original concentration Immunomagnetic microspheres, or beads, coated with sheep anti-mouse IgG (Dynabeads M450; Dynal, Oslo, Norway) were washed in PBS, counted by using a hemocytometer, and resuspended in PBS plus 10% FBS at a final volume equal to that of the target cells. The number of beads added to deplete the PBMC of monocytes was calculated by using a ratio of 10 beads per target cell. The estimated frequency of CD14"^ cells

PAGE 40

33 was based on the subjects' complete blood counts with differentials as determined by a Coulter Counter. Beads and antibodycoated mononuclear cells were mixed in polypropylene round-bottom tubes (12 by 75 mm, Falcon 2005; Becton Dickson Labware, Lincoln Park, NJ) and incubated with gentle rotation at 4C for 3 0 min. Monocytes with beads were separated from the CD14 -negative fraction by placing the polypropylene tubes containing the cell suspension in the presence of a Dynal MPC-1 magnet. Cells bound to beads adhered to the tube in the magnetic field while nonadherent cells were gently removed by pipetting. Immunomagnetic selection and washing were repeated four to five times or until, as determined by light microscopy, all beads were removed from the suspension. CD4"^ T cells were selected from the CD14 -depleted fraction (resuspended at 10^ cells per ml) by incubation with an anti-CD4 mouse MAb, T4 (5 00 /xg/ml) (Coulter Immunology) at a 1 to 100 dilution. Immunomagnetic beads were used at a ratio of 10 beads per target cell, estimated as 50% of the CD14depleted cells. Monocyte selection by adherence to plastic PBMC (4 X 10^ to 6 X 10^ cells per ml) were resuspended in RPMI 1640 medium (GIBCO BRL) supplemented with 2 0% FBS, 1 mM sodium pyruvate, 2 mM L-glutamine, 50 U of penicillin per ml, 50 mg of streptomycin per ml, and 10% freshly pooled human serotype AB serum. Cell suspensions were incubated for 1 h at BV^C under

PAGE 41

34 5% COj in 100 cm^ tissue culture plates (Falcon 3003; Becton Dickson Labware) Non-adherent cells were removed by aspiration with a Pasteur pipette. Adherent cells were washed three times with cold medium and dislodged from the plates with a plastic cell scraper (Costar, Cambridge, MA.) Flow cytometry analysis Unf ractionated PBMC and aliquots of cells remaining after immunomagnet ic selection were prepared for oneand for two-color flow cytometry analysis as previously described (183) The cells were stained with fluorescein isothiocyanate (FITC) -conjugated mouse MAbs (antiCD3, Leu-4, 100 /ig/ml ; anti-CD4, Leu-3a, 3 /xg/ml; anti-CD14, Leu-M3, 25 /xg/ml; anti-CD19, Leu-12, 25 /xg/ml; and anti-CD8, Leu-2a, 12.5 /xg/ml [Becton Dickinson Immunocytometry Systems, San Jose, CA] ) The numbers and percentages of CD3'^CD4"^ T cells and CD4'^CD14"^ monocytes within the unf ractionated PBMC were determined by two-color analysis with phycoerythrinconjugated Leu-3a (10 /xg/ml) and FITC-conjugated Leu-M3 and Leu-4 (Becton Dickinson Immunocytometry Systems) Cell samples were incubated with the MAbs at 4*'C for 3 0 min in the dark. For two-color staining, the cells were first incubated with the FITC-conjugated MAb, washed, and then incubated at 4C for 30 min with the phycoerythrinconjugated MAb. Controls consisted of cells stained with isotype-matched phycoerythrinor FITC-conjugated mouse IgG (50 /xg/ml) (Becton Dickinson Immunocytometry Systems) Cells were washed (0.01 M PBS, 0.02% sodium azide, 10% fetal calf serum), fixed (0.01 M PBS, 0.02%

PAGE 42

sodium azide, 1% paraformaldehyde) and stored at 4"C in the dark until analysis. Cell fluorescence was analyzed by using a Becton Dickinson FACScan flow cytometer. Lymphocyte and monocyte populations were defined on the basis of differences in forward angle and side scatter of the two populations, as previously described (74, 183). Dual-color analysis was carried out by using a compensation network. The fluorescence from 10"* cells per sample was quantified. DNA extraction Cells were resuspended in 1 ml of lysis buffer (10 mM Tris [pH 8.0] 100 mM NaCl 1 mM EDTA, 2% sodium dodecyl sulfate [SDS] 100 ^xg of proteinase K per ml) After overnight incubation at 37"c, DNA was extracted by using the G NOME DNA isolation kit (BIO 101, Inc., La Jolla, CA) according to the manufacturer's protocol. The DNA concentration was calculated from spectrophotometric readings of the samples with a Beckman model DU 64 0 spectrophotometer. PGR Primers specific for the ^38 family of TCR were V^8f orward ( 5 AACGTTCCGATAGATGATTCAGGGATGCCC 3 ) and J^l 2 reverse ( 5 TACAACGGTTAACCTGGT 3 ) as previously described (182) Oligonucleotide primers were synthesized on an Applied Biosystems DNA synthesizer in the DNA synthesis core facility of the Interdisciplinary Center for Biotechnology Research at the University of Florida. The amplified products were 180 bp in length. |3-Actin sequences were amplified with a forward primer (5' -GAAACTACCTTCAACTCCATCATG-3 ) and a reverse primer (5' -CTAGAAGCATTTGCGGTGGAC-3' ) (Clontech, Palo Alto, CA) The

PAGE 43

36 products amplified with the |S-actin primers were 350 bp in length Amplifications were performed in a total volume of 50 /il containing 0.1 and 1 ng of DNA for |8-actin reactions or 0.1, 1, 10, 50, and 100 ng DNA for ^08-3^1.2 reactions, 200 /xM each deoxynucleoside triphosphate, PGR buffer (50 mM KCl, 1.75 mM MgClj, 100 /ig of nuclease-f ree bovine serum albumin [BSA] 20 mM Tris [pH 8.4]), 1 /xM each primer, and 2.5 U of Tag DNA polymerase (Pharmacia) The samples were covered with mineral oil, and amplification was carried out in a 48 -well automated thermal cycler (Perkin Elmer Cetus) Vpd-Jpl .2 amplification involved 1 cycle of denaturation {9A^C for 5 min) 35 cycles of amplification (denaturation for 1 min at 94C, annealing for 1 min at 45C, and extension for 2 min at 72C) and 1 cycle of extension (72C for 10 min) j3Actin amplification involved 1 cycle of denaturation (94''C for 5 min) 25 cycles of amplification (94C for 30s, 60"C for 30s, and 72C for 30s) and 1 cycle of extension (72''C for 10 min) Southern blot analysis Amplification products in a volume of 10 were electrophoresed in 1.2% agarose gels and transferred to Nytran membranes (Schleicher & Schuell, Keene, NH) according to the method of Southern (184) Doublestranded DNA probes used to detect TCR recombinants, and jSactin sequences (182) were labelled by random priming with [^^P]dATP (Du Pont, Boston, MA) to a specific activity of at least 10^ cpm//xg of DNA and placed over a Sephadex G-50

PAGE 44

37 (Pharmacia, Uppsala, Sweden) spun column to retain the free nucleotides. Filters were prehybridized for 2 h in hybridization buffer (1 mM EDTA [pH 8.0], 0.5 M NaP04 [pH 7.2], 7% SDS, 1% BSA) hybridized for 16 h with 10^ cpm of radiolabelled probe per ml of buffer, and washed for Ih, as previously described (83, 182) Hybridization and washes were carried at SB^C for |3-actin and at SO'^C for V^8 analysis. Membranes were exposed at -8 0''C to Fuji medical X-ray film. Electron microscopy and histologic analysis of monocytes Samples (10^ cells per sample) were centrifuged in a cytospin centrifuge (model SCA-0031; Shandon Southern Products Ltd., Runcorn, Cheshire, England) and fixed in citrate-acetoneformaldehyde fixative (Sigma Diagnostics) Cells were then stained with a-naphthyl butyrate esterase (Sigma Diagnostics) according to the manufacturer's instructions. Cells (2 X 10^ cells per sample) were pelleted and fixed in 2% glutaraldehyde in PBS (pH 7.3) for 1 h. All subsequent steps were performed at the electron microscopy core laboratory of the Interdisciplinary Center for Biotechnology Research at the University of Florida. Briefly, cells were washed in buffer, post fixed for 3 0 min in 1% OSO4, dehydrated in an ethanol series, and embedded in Spurr's epoxy resin. Thin sections were stained with uranyl acetate and lead citrate and examined by using a Hitachi model SH-7000 electron microscope

PAGE 45

38 Statistical analysis Statistical analysis of cell yields from blood volumes of less than 6 ml compared with blood volumes of more than 6 ml was carried out by using the Student t test. Values are expressed as the means standard deviations. Results Cell yield and efficiency by flow cytometry analysis PBMC were isolated from blood samples, with volumes ranging from 3 to 20 ml. The number of PBMC collected from the 17 individuals studied ranged from fewer than 1 X 10^ to 10 X 10^ cells per ml depending on the age of the subject. Dual-color flow cytometry analysis of PBMC indicated that more than 85% of CD14'^ blood monocytes also express CD4 (data not shown) Therefore, CD14'^ cells were selected before isolation of the CD4* T lymphocytes (Fig. 2.1). Monocytes were selected from the total PBMC by using an anti-CD14 MAb (MY4) and magnetic beads. Control experiments consisted of PBMC incubated with MsIgG or without murine antibody. Immunoaf f inity magnetic beads were then added as described in Materials and Methods. CD4* T lymphocytes were selected from the CD14 -depleted fraction with an anti-CD4 MAb (T4) and magnetic beads. Cell yields from the selected fractions were calculated on the basis of flow cytometric analysis of the number of monocytes or CD4"^ T cells in unf ractionated PBMC (Table 2.1) The number of cells obtained by immunomagnetic bead selection

PAGE 46

Figure 2.1. Schematic representation of the PBMC separation procedure steps to select CD4"^ T lymphocytes and 0014"^ monocytes. PBMC were separated from heparinized blood samples by Ficoll-Hypaque density gradient centrif ugat ion CD14* monocytes were selected by incubating the cells first with an anti-CD14 MAb and then with magnetic beads conjugated to a sheep anti-mouse antibody. The CD14"^ cells were separated from the CD14-negative cells by placing the cell mixture in the presence of a magnetic field. The washed, positively selected cells were placed in lysis buffer for DNA extraction followed by PGR amplification with TCR and actin primer pairs. The CD14 -negative cell fraction was incubated with an anti-CD4 MAb and then with magnetic beads conjugated with sheep anti-mouse antibodies. The CD4'*' cells were selected in the presence of a magnet and washed, and the DNA was extracted and amplified with TCR and actin primers.

PAGE 47

40 PERIPHERAL BLOOD CD14 (+) CELLS t i FIcoll Hypaque Gradient Centrlfugatlon PBMC Anti-CD14mAb + Magnetic Beads CD14 (-) CELLS Anti CD4 mAb + Magnetic Beads CD4 (+) CELLS CD4 (-) CELLS t DNA EXTRACTION DNA EXTRACTION t t PCR PCR

PAGE 48

O O rH X! u sn 0) U Q) 4-1 M-l -H o U 4-1 CO 0) U P u a fO 0} OJ 4J >i u o c o 6 + H p u 4-1 o Ti iH (U H (U u QJ tn 0) rH ;:! (C O B > 0) -H U H + P U 0 > H (U H 0) Q u M-l o o 01 > ft. 0) u 0) H 0) 4-> U (U a u 0) rH 0) w 0) 4J U 0) a 13 • \ o O U 0 C! S rH PQ Xi O) CD M-l > in O << O tn O rH O (0 2; tn O o H rH CQ O > n ^ o +1 H CO X 43 H +1 ID +1 in M o +1 H fM X 'J' in rcri +1 o 00 X o o o +1 H +1 H o X n X 43 1" m 00 +1^ o X H X 00 lil 43 o O +1 H +1 H CO X O) X n CO cri (1) C -H 6 m X Q) CQ (U rH e CQ O O V Hi Td •H > H Xi a -H U o 4H CQ a o -H m •H > (U T! Ti u c 4J CQ +1 CQ rC (!) 4-) a (U CQ 0) u CQ (D d rH > >1 0) u QJ 4J QJ Ti CQ tC5 T! O O XI X! 4H o u 0) 4-) Vh OJ CO QJ U ^ CQ + -H ^ CQ P >^ U rH m >H a O 13 CQ Jh 0) QJ JJ -U U u o O CQ a O rH e rH Q) + u H P QJ U 4H > 0 -H 1 ^3 0) QJ ^ tn QJ u CQ QJ u CD •H CQ 13 X5 4H 0 ) — 1 M u QJ 4J rH rH •r~i rH rH •H e u QJ T! Q) 4J U OJ rH OJ CQ -ype u m QJ of CQ rH rH QJ U 4H 0 CQ TS u QJ QJ X! X! e u -H a 4-) QJ QJ a tn CD fO e u 0 QJ > < 6 E •H X x: o W CO rH QJ rH QJ U u o 4-1 ^ i QJ R X QJ 0 > o o ^ X( QJ XI 4-1 0 CQ "1 \-H O CQ CQ • rH n3 o rH X A r^ JJ 4J d S U O U Q) r^ -H IH 08" ^ ^ >^ QJ QJ rH e Q) :3 3 ^ CQ J-l QJ Ti m X5 rH -H 4J QJ 4J iH fO B >>^ O 0^ 4H -IJ U O QJ jJ Q) d 3 fO QJ ;H "^ dj QJ ^
PAGE 49

42 was determined with a hemocytometer to count the cell -bead aggregates. The results of flow cytometry analysis of unf ractionated PBMC indicated an average of (8.0 2.5) X 10^ 0014"^ monocytes per ml of blood from samples containing less than 6 ml of blood. Following immunoraagnetic selection, (6.0 3.0) X 10^ monocytes per ml were recovered, a number which represents an average yield of 75.6% of the peripheral monocytes expressing CD14 CD14"^ monocytes selected from 6 to 20 ml of blood resulted in a recovery of 80.5% of the potential blood monocytes. The recovery of monocytes from blood volumes less than 6 ml was as efficient as monocyte recovery from larger volumes of blood (>6 ml) There was no evidence of cell -bead aggregates when the PBMC incubated with MsIgG or the controls with no antibody were examined by light microscopy. These results indicate that the use of an antiCD14 MAb is required for immunomagnetic selection of monocytes. Nonspecific binding of the control antibody to monocytes did not result in significant binding of the beads. The overall yield of the selection of CD4"^ T cells from PBMC was 41.1% for small blood volumes and 36.6% for blood volumes of more than 6 ml. The efficiency of selection of CD4"^ T cells from the CD14 -depleted cell fraction was greater than 75% (data not shown) The loss of CD4"^ T cells appears to be a result of the extensive manipulation and cell washes required for the two rounds of bead selection, because cell losses within the Cols'" B cells and CDS'" T cells in the CD4-

PAGE 50

depleted cell fraction were similar (data not shown) The yields of CD14"^ monocytes or CDA'*' T cells were not statistically different when small and large blood volumes were used. On the basis of the sensitivity of flow cytometry analysis of the depleted fractions, greater than 95% of the monocytes were depleted from the PBMC fractions following immunomagnetic bead selection with the CD14 MAb (Fig. 2.2). There was no evidence of monocyte depletion following incubation of PBMC with MsIgG or beads alone (data not shown) Fewer than 5% residual CDA'^ T cells were detected following selection with the anti-CD4 MAb (Fig. 2.2). Electron microscopy evaluation of CD14"^ monocyte and CD4"^ T-cell enrichment Morphologic analysis of unf ractionated PBMC and immunoselected CD14"^ monocytes or CD4'^ T lymphocytes by light microscopy indicated greater than 99% enrichment for the selected cell type (data not shown) No contaminating lymphocytes, either B cells or T cells, were detectable within the CD14"^ cell fraction. Furthermore, by cytospin centrif ugation and staining with a-naphthyl butyrate esterase, the bead-selected CD14"^ cell population showed a monocyte morphology. However, the esterase staining pattern of the bead-selected cells was atypical compared with that of the stained monocytes within the PBMC (data not shown) To more precisely examine the CD14"^ cells, electron microscopy was chosen as an additional method of monocyte

PAGE 51

(DUO tJlE-i CQ •H M (U

PAGE 52

45 identification. CD14"*" monocytes and CDA'^ T cells within unf ract ionated PBMC were easily distinguishable by electron microscopy on the basis of their morphologies (data not shown) Following magnetic selection, the CD4"^ T-cell fraction was enriched for lymphocytes with magnetic beads attached to the surface of these cells (Fig. 2.3C). The selected CD14'^ fraction was highly enriched for monocytes with no evidence of contaminating lymphocytes. Magnetic beads appeared mostly internalized within the monocytes rather than on the surface, which indicates active phagocytosis of the CD14 -magnet ic bead complex (Fig. 2 3A and B) Assessment of cell viability by trypan blue exclusion after 24 h of culture indicated that phagocytosis of the beads did not impair viability. Assessment of monocyte enrichment by molecular analysis A primary goal of the selection strategy was to achieve a monocyte population with more than 99% depletion of T lymphocytes, which is beyond the detection sensitivity of morphologic or flow cytometric analysis. A more sensitive method by using PGR was developed to assess the extent of residual T lymphocytes within the CD14* monocyte fraction. DNA from both CD14"^ and CDA'^ cell fractions was amplified by using TCR primers to detect recombination of variable, diversity, and joining gene segments which occur exclusively in T lymphocytes. The TCR V^8 family was used as a marker for T cells for two reasons: (1) V^8 is involved in 3 to 26% of TCR variable, diversity, and joining gene segment recombinations

PAGE 53

Figure 2.3. Transmission electron microscopy of monocytes and CD4"^ T cells selected from PBMC by using immunomagnet ic beads. Monocytes coated with an anti-CD14 MAb, MY4 were selected after incubation with magnetic beads. The beads can be seen within the cells (A and B) (C) An anti-CD4 MAb, T4 was added to the CD14 -depleted cells, and CD4"^ T cells were selected following incubation with magnetic beads. The beads are seen attached to the surface of the cells. Magnifications X 10,000 (A) X 3,750 (B) and X 15,000 (C)

PAGE 55

48 in CD4"^ T lymphocytes and represents one of the more frequently rearranged TCR gene families in peripheral blood T cells (84, 148) and (2) there is a T-cell line, Jurkat with a rearranged V^8-Jj3l.2 TCR, which provides an important positive control for quantitation. The sensitivity of the primers to detect small numbers of rearranged TCRs within cellular DNA was determined in control experiments using serial dilutions of DNA from Jurkat cells. The 180 -bp V^8 TCR product was consistently detected at the level of a single Jurkat T cell (0.01 ng of input DNA) (Fig. 2.4A) The amount of template DNA was verified by amplification of serial dilutions of Jurkat DNA with primer pairs for j3-actin, which also detected a single cell (Fig. 2.4B). The sensitivity for detection of a single cell by amplification was the same when serial 10-fold dilutions of Jurkat cells were mixed with reciprocal dilutions of HeLa cells, a nonlymphoid cell line without TCR rearrangements, prior to DNA extraction (data not shown) On the basis of the results of these experiments, each subsequent PCR amplification included a standard curve by using serial dilutions of Jurkat DNA. The frequency of V^8 T cells within the monocyte fraction was compared with the number of CD4+ T cells which had V^8 rearrangements within the CD4+ T-cell fraction from the same individual Equivalent amounts of template DNA from the different populations were verified by amplification with

PAGE 56

49 B CELL NO. DNA (ng) 350 bp 100 10 1 <1 0 1 .1 .01 .001 0 Figure 2.4. Amplification of serial dilutions of DNA obtained from Jurkat T cells. The number of cells equivalent to the amount of input DNA was determined in preliminary experiments. Serial dilutions of Jurkat DNA, equivalent to 10^ to less than 1 cell, were amplified by using forward and reverse primers for either V^8 and J^l 2 TCR sequences (A) or (8-actin (B) The amplified products were electrophoresed in 1.2% agarose gels and transferred to Nytran membranes. Double -stranded probes to detect the 180 bp TCR product or the 350 bp actin product were labelled by random priming with [^^P] dATP, washed, and exposed to X-ray film.

PAGE 57

50 primers for /3-actin (Fig. 2.5) When the amplified products of serial dilutions of DNA from 004"^ T cells were analyzed, V^8 sequences were detected in the equivalent of 10^ T cells (Fig. 2 5A) The intensity of the product was equivalent to the signal from 10 cells in the standard curve (Fig. 2.4A) (densitometric analysis not shown) The results indicate that approximately 10% of the T cells in this individual had rearranged V^S TCR genes. When 5,000 CD14"^ cells were examined, 1 cell with a V^8 TCR rearrangement was detected (Fig. 2.5A) If V^8 T cells represent 10% of the total T cells in this individual, then there are about 10 residual T cells per 5,000 CD14"^ monocytes, which indicates 99.8% purity of the monocytes. In a second individual, approximately 10 rearranged V^8 TCR genes were detectable in 1,000 CD4"^ T cells (Fig. 2.5B), indicating that V^8 T cells represent about 1% of the CD4'^ T cells in this individual. In contrast, T cells with a rearranged V^8 TCR were not detected in DNA from 5 X lO'' monocytes (Fig. 2.5B) If as many as 100 T cells were present in 5,000 monocytes (2%), the selected monocytes were 98% enriched for CD14'^ cells. Cell separations from 17 different individuals consistently produced CD14'*' monocyte populations which contained as few as 0.2% and no more than 2% detectable T lymphocytes, even when small volumes of peripheral blood were used. Immunomagnetic selection of monocytes was compared with selection of monocytes by adherence to plastic. Both

PAGE 58

51 V8 /?-ACTIN CELL NO. 5x10^ 10^ 10^ 10 0 10 Figure 2.5. Amplification of DNA obtained from PBMC selected by either immunomagnetic beads or adherence to plastic. (A and B) Serial dilutions of DNA equivalent to 5 X 10^ cells were obtained from CD14'' monocytes and CD4* T lymphocytes selected from 2 separate individuals by using immunoaf f inity magnetic beads. (C) Amplification of DNA from serial dilutions of monocytes collected by adherence to plastic. DNA from each cell type was amplified with V^8 and J^l 2 TCR primer pairs. The products were electrophoresed in 1.2% agarose gels and transferred to Nytran membranes. The DNA equivalent of 10 cells (0.1 ng of DNA) from each cell type was amplified with primers for (S-actin. DNA was amplified by using the V^8 forward and reverse primer pairs. Double-stranded probes to

PAGE 59

52 techniques effectively depleted monocytes from the larger population of PBMC as determined by flow cytometry analysis (data not shown) However, the level of detectable T cells in monocytes collected by adherence was at least 10 -fold higher than in monocytes selected by immunomagnet ic techniques (Fig. 2 5C) Discussion Studies of human monocyte /macrophage lineage cells have been hampered by a lack of techniques to verify the relative purity of highly enriched blood monocyte populations. This is a particular problem in pediatric studies that are restricted to using small volumes of blood. Assays of monocyte -macrophage function, tropism studies of infectious pathogens such as human immunodeficiency virus, and immunologic assessment of CD4"^ T cell-to-monocyte interactions would benefit from a simple technique which physically separates the two PBMC populations without affecting viability. Methods used to separate 004"^ T cells and monocytes must compensate for expression of the CD4 molecule on both cell types. Our selection scheme results in highly enriched populations of monocytes and CD4"*" T cells depleted of other contaminating cell types. Immunomagnetic monocyte selection results in a highly enriched population of 0014"^ monocytes with more than 98% depletion of T cells. Compared with other methods for monocyte

PAGE 60

53 selection, such as adherence to plastic, the immunomagnetic selection method reduces the number of residual T cells more than 10-fold. Immunomagnetic selection is effective for depletion or for enrichment of targeted lymphocyte populations from human blood and bone marrow (74, 103). Using this procedure, we were able to obtain more than 75% of the expected monocyte population, even from blood volumes of less than 6 ml. However, the extensive manipulations required for each selection step result in cell loss. When this technique is used, the selection strategy should consider the targeted cell population in order to optimize cell yields. Techniques to verify the extent of enrichment for cell populations that are selected by the immunomagnetic bead method have limitations. Strategies are available to dissociate the magnetic beads from lymphocyte populations (149) although antibody binding to the differentiation marker on the surface of the selected target cell hinders subsequent analysis by flow cytometry. The dissociation of beads can not be applied to immunoselected CD14"^ monocytes because we found that the CD14 -antibody-bead complex becomes internalized within minutes of binding to the cell. Verification of monocyte purity by flow cytometry techniques is further hampered by changes in the light scatter of the monocytes containing the bead complex. Morphologic analysis using light or electron microscopy can be useful to ensure monocyte

PAGE 61

54 enrichment but is not a sufficiently sensitive method to determine the depletion of contaminating T cells. The PCR-based strategy proved to be a sensitive and reproducible method to determine the level of residual T cells within the monocyte fraction. The effectiveness of the molecular assay is enhanced by several factors. First, the detection of the rearranged TCR can be standardized and the number of TCR rearrangement can be quantified. TCR rearrangements in DNA provide a direct assessment of the number of T cells and minimize variability from determining expression of V^8 TCR in RNA of blood T cells from different individuals (190, 199) Second, rearrangements in V^8 are found frequently in circulating blood T cells in most individuals (84, 148) The comparison of the amplification of V^8 TCR from monocyte DNA and DNA from T cells from the same individual served as an internal control for sensitivity. Amplified V^8 TCR sequences were at least 100-fold higher in the CD4'^ T-cell fractions than in the corresponding monocyte population Internalization of the CD14-bead complex does not affect monocyte viability. In addition, MAbs directed at CD14 can result in monocyte activation (174) Our results indicate that anti-CD14 antibody is required for binding and phagocytosis. Whether internalization of the magnetic bead complex would limit the application of the immunomagnetic selection technique to some studies of macrophage function needs to be

PAGE 62

55 evaluated. We have found thar beadselected monocytes can be used for studies of human immunodeficiency virus type 1. Immunomagnetic selection for monocytes in conjunction with a sensitive molecular assay for detection of residual T lymphocytes provide a strategy for obtaining cells of the monocyte/macrophage lineage from children and adults.

PAGE 63

CHAPTER 3 VERTICAL TRANSMISSION OF HIV-1 Introduction In the absence of antiviral intervention, about 25% to 30% of HIV-1 infected pregnant women in the United States transmits the virus to her infant. Multiple factors increase the risk of HIV-1 transmission from mother-to-child (151). Maternal immunity, biological characteristics of the infecting virus, obstetrical factors related to the delivery, and levels of maternal viral load can influence the probability that an infant born to an HIV-infected mother will ultimately become infected (12, 35, 49, 64, 77, 100, 119, 163) The precise contribution by each factor or combinations of factors to ultimate maternal -infant HIV-1 transmission is not clear, although maternal viral factors are important (52) For example, a number of studies demonstrate a direct association between levels of maternal virus, as measured by p24 antigenemia, quantitative viral culture, viral DNA, or quantitative viral RNA, and an increased probability for infection of the infant (49, 65, 95, 97, 202) In addition, drug therapy targeted at the virus produces a significant decrease in vertical transmission of HIV-1. A large scale, blinded, randomized, placebo-controlled clinical trial (ACTG 56

PAGE 64

57 protocol 076) demonstrated that pediatric HIV-1 infection can be reduced by as much as 67% when HIV-infected mothers and their infants were treated with zidovudine (ZDV) (36) Although the reduction in perinatal HIV-1 infection by ZDV treatment is striking, the mechanism by which ZDV reduces maternal transmission is unknown. Both cell-free and cellassociated virus have been implicated in maternal infant transmission of HIV-1 (155, 163), so one possibility is that ZDV administered according to the ACTG 076 protocol reduces maternal plasma virus levels. However, preliminary reports suggest that ZDV-associated reduction in transmission may be independent of levels of maternal viremia (64) ZDV treatment reduces levels of HIV-1 provirus in peripheral blood cells in approximately 50% of infected adults (108) which raises an alternative possibility that the ZDV effect on maternal transmission could be reduction of cell -associated virus in mothers. We and others have shown a close genetic relationship between viruses within peripheral blood mononuclear cells (PBMC) of mothers and their newborns, suggesting that transmission of cell-associated virus is one mechanism for pediatric infection and a potential target for the effects of antiviral drugs (81, 207) We tested this hypothesis by measuring HIV-1 DNA copies within PBMC of a group of untreated HIV-infected pregnant women and a group of infected pregnant women who received ZDV to reduce transmission. The two groups of women were similar

PAGE 65

with respect to age, race, disease stage, blood CDA'^ T cell counts, and mode of delivery. Transmission was reduced to 10% among infants in the ZDVtreated group, indicating that antiviral therapy was effective. However, there was no difference between groups of treated and untreated women in levels of HIV-1 DNA copies in CD4"^ T cells. Our results provide evidence that the mechanism by which ZDV reduces pediatric HIV-1 infection is independent of maternal cell associated virus levels. It is possible that ZDV therapy alters the infectivity of the transmitted virus or alters inf ectibility of susceptible pediatric cells. Materials and Methods Subjects. Study subjects were 42, HIV-infected pregnant women who were enrollled between October, 1989 and December, 1995 in an ongoing study of HIV-1 genetic variability according to a protocol approved by the Institutional Review Board of the University of Florida. Forty-one women were enrolled at the University of Florida (UF) in Gainesville, FL and one at the University of South Florida (USF) at Tampa, FL. Nineteen of these women in the study and their neonates received ZDV according to ACTG protocol 076, which was initiated in February, 1994 (36) Twenty-three women received no form of antiretroviral therapy, including 3 women who were offered but refused ZDV therapy. Blood samples were obtained within 24 hours of delivery, except for 2 samples obtained

PAGE 66

59 from untreated mothers which were drawn about 3 months after delivery. Informed consent was obtained from each subject enrolled. Clinical data collected prospectively included the age, race, mode of delivery, obstetrical complications, weight and gestational age of the child, maternal blood CD4'*" T cell counts, CD4 to CDS T cell ratio, and CDC (Centers for Disease Control) stage of maternal HIV infections (30) T-cell subsets were determined by flow cytometry analysis at the Clinical Laboratory at Shands Hospital, at the University of Florida. Transmission status of the mother was determined based on results of subsequent evaluations of the infants. Mothers were classified as transmitting if HIV-1 was detected by polymerase chain reaction (PCR) amplification of PBMC DNA obtained from the infant on at least 2 occasions by 6 months of age (180) Mothers were classified as non-transmitters if results of the PCR analysis of the infant's PBMC DNA was negative at 6 months of age and the child seroreverted to an HIV antibody negative status Lymphocyte isolation Ten milliliters of maternal peripheral blood were collected in acid citrate dextran (ACD) tubes and processed within 24 hours. Following separation of the blood samples into cell and plasma fractions, PBMC were isolated using Ficoll-Hypaque (Histopaque 1077; Sigma Diagnostics, St. Louis, MO) density centrif ugat ion CD4"^ T cells were separated from the PBMC using immunoaf f inity magnetic microspheres (Dynabeads M450; Dynal,

PAGE 67

60 Oslo, Norway) according to our previously described methods (4) Cells were resuspended in 1 ml lysis buffer (10 mM Tris at pH 8.0, 100 mM NaCl 1 mM EDTA, 2% SDS, 100 fig proteinase K) and incubated at 3 7C overnight. DNA was extracted using the G NOME DNA isolation kit (BIO 101, Inc., La Jolla, CA) as suggested by the manufacturer. DNA concentration was calculated by spectrophotometric reading (Beckman DU 640) PGR analysis Oligonucleotide primers for amplification of env region were forward ( 5 -GCCAGAGATGGCTGTGTACCGAGA-3 ) and reverse (5 -GTTCTGGAATTGTGGGTGATA-3 ) located at nucleotides 6464 to 6486 and 7693 to 7713, respectively, in the HIVlai genome. A second set of primers was located in the gag-pol region and consisted of forward (5'GAGGAGGAGGTACACTAGAAGA-3 ) and reverse ( 5 TGCGGGATGTGGTATTG 3') primers located at nucleotides 1802 to 1823 and 2863 to 2879, respectively. Primers were synthesized on an Applied Biosystems DNA synthesizer in the DNA synthesis core facility of the Interdisciplinary Genter for Biotechnology Research at the University of Florida. jS-actin primers were obtained from Glontech, Palo Alto, GA. Sensitivity of each set of primers was at the level of 1 to 5 copies (4, 181) DNA concentrations were 1 and 10 ng for actin amplifications and 100 to 1500 ng of patient DNA for env and gag-pol amplifications. DNA from the 8E5 cell line, a human Tcell line which contains a single integrated copy of HIV-1 DNA (68) was used in serial 5-fold dilutions ranging from 0.01 ng

PAGE 68

61 to 1 ng, the equivalent of 1 to 100 cells. PGR reactions were carried out in 50 /xl, containing the appropriate DNA concentration, 200 /xM each deoxynucleoside triphosphate, PGR buffer (50 mM KGl 1.75 mM MgGlz, 100 /xg nuclease-f ree bovine serum albumin [BSA] 20 mM Tris [pH 8.4]), 1 /xM each primer, and 2.5 U Tag DNA polymerase (Pharmacia). Reactions were carried in a 48 -well automated Perkin Elmer Cetus thermal cycler. jS-actin amplifications involved 1 cycle of denaturation (94''G for 30 sec, SO^C for 30 sec, and 72''G for 30 sec) and 1 cycle of extension (72G for 10 min) Amplifications using env or gag-pol primers were carried out with 1 cycle of denaturation (95*'G for 10 min) 35 cycles of amplification (95G for 1 min, 55''G for 1 min, and 72G for 2 min) and 1 cycle of extension (72''G for 10 min) Negative controls using uninfected human DNA and reagent controls without DNA were included in every experiment Amplified products were analyzed by electrophoresis in agarose gels, transfer to Nytran membranes (Schleicher & Schuell, Keene, NH) and hybridization with double -stranded DNA probes, which were random labelled with a [^^P] dATP (Du Pont, Boston, MA) and specific for actin, env or gag-pol sequences. Hybridizations were performed for 16 hours with 10^ cpm of radiolabelled probe per ml of buffer, and washed for 1 hour (83) Hybridizations and washes were carried at 55G for

PAGE 69

62 )3-actin, and at 60C for both env and gag-pol Membranes were exposed to Fuji medical X-ray film at -SO^C. Proviral load calculations were done by comparison of the results of PGR amplifications of serial dilutions of patient samples to the serial dilutions of the 8E5 DNA standard curve using densitometry (4, 155) Amplifications carried out with iS-actin primers and serial dilutions from subject and 8E5 DNA served as internal controls to assure equivalent amounts of input DNA. Proviral load was calculated in DNA from purified CD4+ T cells and PBMC obtained from 18 HIV-infected mothers. We, and others, have determined that similar viral load results can be obtained when quantitation is performed using either DNA from separated 004"^ T lymphocytes or from total PBMC, corrected to CD4+ T cells based on flow cytometry analysis of blood T cell subsets (208) HIV-1 p24 antigen assay HIV-1 antigenemia was determined by measuring the level of p24 antigen in maternal plasma after acid dissociation of immune complexes using an ELISA assay (Coulter, Hialeah, FL) Statistical analysis Paired statistical analysis of the results were carried out using Sigma Stat software (Jandel Scientific, San Rafaelo, CA) Comparison of viral load in CD4"^ T lymphocytes and total PBMC in treated versus untreated, transmitting versus nontransmitting mothers, was performed using the Mann-Whitney rank sum test. Comparisons of CD4"^ T cell counts, CD4 to CDS ratios, and age within the study

PAGE 70

63 populations were performed using Student t test. Fisher's exact was applied to compare each of the following: p24 antigenemia, mode of delivery, race, and CDC disease stage in the transmitting and nontransmitting groups, and in the treated and untreated groups. The rate of transmission in treated and untreated mothers was compared using a Fisher's exact test. Results Characteristics of study population Clinical and demographic characteristics of the individual women enrolled in the study are shown in table 3.1. Forty-two HIV-1 infected pregnant women were enrolled prospectively. Women who had received antiretroviral therapy prior to their pregnancy were excluded. Most women (85.4%) gave birth by vaginal delivery. None of the infants were breast fed. The study group ranged in age from 14 to 37 years with a mean of 25.6 ( 5) years and were predominantly African American (77.5%) The clinical and immunological status of the study population at the time of delivery was highly variable. Ten of 42 women (23.8%) were symptomatic (CDC stage B or C) CD4+ T cell counts ranged from as low as 7 to as high as 1046 per microliter, with a mean CD4"' T cell count of 477 ( 294) cells per microliter. Clinical, immunological and viroloaical characteristics of mothers not treated with ZDV Within the study population 23 women received no antiretroviral therapy during pregnancy.

PAGE 71

64 Table 3.1. Clinical data for the cohort of HIV-1 mothers Patient' Age Race'' Transmission CDC Mode of p24 CD4'^ T CD4:CD8 status'^ stage Delivery^ Ag= cells//il ratio Untreated 564 23 B T Al VD o o ^ 1 03 184 23 B T Al VD 750 0 67 211 17 B T Al VD + 0 43 567 19 W T Al VD 550 0. 54 051 27 B T C3 VD + 296 0. 28 250 29 B T C3 V i-J + Q 0 07 1400 31 H T A2 VD + 68 0 07 402 30 B T C3 cs 7 0 03 559 32 B T C3 cs X o o 0 12 313 26 B T C3 VD 102 0. 12 179 29 B T C3 VD 38 0. 01 566 23 B NT Al VD 995 1 33 369 17 B NT Al VD R Q n 3 J U 0. 57 1147 23 B NT Al VD O ^ 0 80 570 25 B NT Al VD -J / u 1 00 590 37 B NT Al VD R T Q O J 27 1 53 541 23 B NT J. / D 0 79 395 27 W NT A2 VD -5 O D 0. 40 319 26 B NT Al vn V U Q n Q O U C3 0 70 1314 14 IN J. Al \Tr\ V u Q o c 0 49 503 NA IN J. A 1 £r c A D b U NA 352 24 IN J. A 1 vU coo boo 0. 65 1005 R IN 1 A O V JJ 1 A IT 3 Ub 0 36 1 Treated 1322 27 w T Al CS 678 1 22 1211 29 NA T B2 VD 105 0 17 1427 18 W NT Al VD 1046 0 83 1412 23 B NT Al VD + 800 NA 1222 28 B NT Al VD 612 0. 81 1384 18 B NT Al VD 421 0 77 1391 18 B NT Al VD 432 0. 33 1260 28 B NT Al VD 846 NA 1388 26 B NT A2 VD 357 0 47 1248 29 H NT Al VD 671 NA 1089 27 B NT Al CS 806 0 64 1149 37 B NT Al CS 519 NA 1462 24 B NT Al VD + 430 NA 1401 28 W NT Al VD 466 0 84 1310 21 W NT B2 VD + 357 NA 1161 27 B NT Al VD 501 0 45 1360 34 B NT A2 VD 223 0. 17 1107 19 B NT B3 VD + 123 0. 12 1116 28 W NT B3 CS + 47 0. 12

PAGE 72

Table 3.1 continued... designated by numbers B, African-American; H, Hispanic; C, Caucasian T, transmitting; NT, nontransmitting CS, Caesarean section; VD, vaginal delivery ^ +, detected; VD, vaginal delivery NA, not available

PAGE 73

66 Neither were their newborns treated with ZDV. The untreated population was predominantly African American (86.4%) with an average age of 25 (5) years at the time of delivery (Table 3.2) Among the untreated mothers, 11 (48%) transmitted HIV-1 to their children while 12 mothers did not transmit the virus. Transmission in this cohort was higher than the 25% to 30% that is usually observed in our geographic region (39) A likely explanation for the transmission rate in our cohort was that universal HIV-1 screening of pregnant women was not in place at our study sites when enrollment began. Consequently, women with more symptomatic HIV disease and lower 004"^ T cell counts, who were at greater risk for transmission, were more likely to be identified during pregnancy and, therefore, were overrepresented in our untreated group. Because of this potential bias, we compared the rate of transmission between ZDV treated and untreated women with 004"*" T cell counts of greater than 200 cells per microliter. These women were more similar to the population of mothers enrolled in the ACTG protocol 076 (36). As shown in figure 3.1, the rate of transmission in women with CDA* T cell counts greater than 200 cells per microliter in the untreated group was 31.3%, compared to 6.3% in the ZDV treated group (p=0.083) Overall, only 2 mothers (10.5%) in the ZDV treated group had infected infants, which was significantly different from transmission by untreated mothers (p=0.017) The results indicate that ZDV

PAGE 74

67 <• CD U 0) X! 4J i 0) V (d a >H 0 (D O -H 4J (0 -H U H> 4J o ns >^ a) o (0 o o H O u -H > a n) o •H a -H u ro J3 o H Q CTl o n o o in +1 +1 o o n 00 o o o o +1 +1 O O U) m en H (N vo KO (N H 00 CTl O U) +1 in +1 o CN m 4-1 C tn 4-) 0 u •H •H 0) e [Q 4-> tn CQ U 4J •H H 0) 0) E 4-) e in CQ m to 4-> l-l c c n) 0} (S a > 0 Eh (-1 0 •H 4-' n< (0 ri i> r7-< n u n$ a 4-) m -H a 0) e CQ n5 ns CJ Ti H 0) Sh CQ QJ CQ 0) 1 U 1 (U (h > X (13 -H 0) U JJ •H -H 0) ^ CQ u 4-1 0 fO <: CQ 4-) 4J 4J a c; iH 0) (U ^3 u CQ u 0) CD 0) Pi di n

PAGE 75

Figure 3.1. CD4"^ T cell counts in HIV-infected pregnant women. The number of CD4"^ T cells per microliter of blood is shown on the y axis. Untreated mothers received no ZDV therapy during their pregnancy. The treated mothers and their infants received ZDV according to ACTG protocol 076. Open circles indicate mothers who did not transmit HIV-1 to their infants while the closed circles represent mothers who gave birth to infected children.

PAGE 76

69 1,200 o u 1,000 800 o o o o o o oo u H + Q u 600 400 200 0 o ooo o • o •o o o o o oOo oo Untreated ZDV Treated Treatment Status

PAGE 77

70 therapy administered to mothers and neonates in our cohort was effective in reducing the rate of transmission by 78%. Mothers who transmitted HIV-1 did not differ significantly from the nontransmitting mothers with respect to mode of delivery, age (26 + 4.9 compared to 24 6 years) (p=0.5), or race (p=0.6) (Table 3.2). However, significant differences in both immunological and virological parameters between transmitting and non-transmitting mothers were identified. Mothers whose infants became infected had fewer CD4+ T cells, lower CD4 to CDS ratios, and more advanced HIV disease than mothers whose infants were not infected. Six of 11 transmitting women (54.5%) were CDC stage C3 The group of 11 transmitting women had an average CD4'^ T cell count of 296 ( 309) cells per microliter and a mean CD4 to CDS ratio of 0.3 ( 0.3) In contrast, the 12 nontransmitting mothers were asymptomatic (CDC stage Al to A3) with mean CD4"' T cell counts of 613 (+ 249) cells per microliter, which was significantly greater than the CD4"' T lymphocyte count in the untreated transmitting group (p=0.01). Mean CD4 to CDS ratio, O.S ( 0.4), in the nontransmitting group was also significantly greater than in the transmitting group of women (p=0.005). Within the group of non-treated women, plasma virus was detected in 63.6% of transmitting mothers, but only in 9.1% of non-transmitting mothers (p=0.01). In addition, the differences existed between nontransmitting and transmitting mothers in mean numbers of HIV-1 DNA copies per 10^ CD4'^ T

PAGE 78

cells was 67 ( 97) and 2063 ( 4901) respectively, which was significant (p=0.003). Clinical, immunologic, and virologic parameters of ZDVtreated infected women Nineteen HIV-1 infected women and their neonates received ZDV according to the ACTG protocol 076. To rule out the possibility that factors other than ZDV could account for reduced transmission among the women in our group, paired analysis of multiple parameters were examined between the untreated and treated groups of women (Table 3.3) (55, 63, 135). ZDV-treated women were the same age as the untreated group and there were similar numbers of symptomatic women, 21% versus 26% respectively (p=0.7) Although the ZDVtreated group had more deliveries by Caesarean section (21% versus 9% in untreated subjects) and included fewer African Americans (67% versus 86%) the differences between the treated and untreated groups in our study did not reach statistical signigicance When immunological parameters were examined, the ZDVtreated group was virtually identical to the untreated group of women in CD4'' T cell numbers, 462 ( 317) and 497 ( 270) respectively (p=0.7), and CD4 to CDS ratio (p=0.9) (Table 3.3). Virological parameters were also similar between the ZDV-treated and untreated groups of women. Five of 19 ZDVtreated women (26%) had detectable p24 antigen, which was not significantly different from the untreated group in which antigenemia was detected in 8 of 22 women (36%) (p=0.2).

PAGE 79

n 0) 4J (0 (D u jj a :3 m ^3 CO M QJ > T5 (D jJ fO 0) U 4J I > Q Nl 4-1 o CO u •H 4-> CQ -H ^ wo H C! 0 •H CQ CQ -H 6 CQ C3 72 CO in o CO LT) +1 (N Ln (N CO O o H O (AO 1*0 (N (N cn U) (N o CO Q 0 o o U -H CTl •• 4J +1 +1 ^ (C O Q ^ U in in o o r~ o H H r-n fN + CO +1 +1 'l* H O Q rH U 0) (N U CTl (U . o <; in CN 4J •a C QJ 0) cn 4J 0) E 0) tS 4J 4-) H n) ^ 4-) (1) JJ > u tn E-i ft (H 0 H 1 1 --1 Si • u f! (IS 4J m +1 c (0 i to a rC tC V Ti H QJ ^H CQ QJ CQ 0) 1 1 (D a > X (0 H (U u 4J -H -H (1) u CQ ^1 MH 0 nJ a. 0} 4-) 4J jJ a rH 0) 0) :3 u u CQ in Sh (U OJ

PAGE 80

73 CD4"^ T lymphocytes and HIV-1 infection in individual untreated and ZDVtreated women Numbers of infected maternal peripheral blood lymphocytes within both the ZDV-treated and untreated groups ranged from 13 to 20,000 per 10^ 004"^ T cells (Fig. 3.2) Among the total of 4 2 women in our population, 2 9 did not transmit the virus. When the 17 ZDV-treated and the 12 untreated women who did not transmit the virus to their children were analyzed, no significant differences in clinical or virological parameters were detected between the 2 groups. In addition, the mean HIV-1 DNA copy number per 10^ 004"^ T cells in the treated women, 1022 ( 3458) was similar to the untreated group, 1172 ( 4568) (p=0.3). Among untreated mothers with fewer than 100 copies of HIV-1 per 10^ CD4-^ T cells, 3 of 13 (23%) transmitted. In the ZDV-treated group, two of 15 mothers (13.3%) with fewer than 100 copies per lO*" CD4+ T cells transmitted HIV-1 to their infants. The difference in transmission between the ZDVtreated and untreated mothers with this low level of cell associated virus in CD4+ T cells was not significant (p=0.6) A difference in maternal transmission became apparent among women who had greater than 100 copies of HIV-1 per 10^ CD4+ T cells (Fig. 3.2) Among 10 untreated mothers with > 100 HIV-1 copies (range 150 to 16,665) per 10^ CD4+ T cells, eight (80%) transmitted. In contrast, none of the 4 ZDV-treated mothers with > 100 (range 270 to 20,000) copies of HIV-1 per million CD4'^ T cells transmitted the virus. There was no

PAGE 81

Figure 3.2. HIV-1 copies in peripheral CD4'^ T cells in women who were untreated or ZDVtreated. Open circles indicate women who did not transmit HIV-1 to their children. Closed circles represent women whose infants became HIV-1 infected. Among the untreated group, 3 mothers (184, 211 and 564), who had <10^ HIV-1 copies per million CD4"^ T cells, transmitted; 2 mothers (352 and 1005) with >10^ HIV-1 copies per million CD4"^ T cells did not transmit. Among the ZDV-treated group, 4 mothers (1360, 1161, 1107 and 1116) with >10^ HIV-1 copies did not transmit to their infants. • •

PAGE 82

75 1/3 H + U 10 o § 2 > o 10 5' o o OOqOO^ o o o o • o o^oOoOq o#Ooo o Untreated ZDV Treated Treatment Status

PAGE 83

76 significant difference in mean levels of HIV-1 DNA copies in CD4'^ T cells between the 2 groups (2311 + 5096 versus 5450 9711 in untreated and treated, respectively; p>0.1) Yet, the difference in transmission between untreated and ZDV-treated mothers and neonates was significant (p=0.015). Discussion In the absence of antiviral therapy for HIV-1 infected mothers and their infants, a significant relationship between maternal immunological and virological parameters and risk of HIV-1 infection for the infant was detected in our study. An increased likelihood for transmission within our cohort of untreated HIV-1 infected women was inversely related to maternal CD4+ T cell counts and CD4 to CDS ratios, and directly associated with levels of HIV-1 DNA copies found in 004"^ T cells in maternal peripheral blood. A positive relationship between pediatric infection and levels of maternal virus was found in other studies based on evaluation of HIV-1 either in plasma, by p24 or RNA PGR, or in cells, primarily by culture (64, 65, 97, 155, 202) We relied on 2 measurements of HIV-1 infection in the mothers, specifically p24 plasma antigenemia and HIV-1 DNA copies within PBMC. Most untreated women in our population were enrolled prior to widespread use of plasma RNA levels as a clinical test, so for consistency p24 antigen was evaluated for all women in our study population. Most likely the number

PAGE 84

77 of mothers with detectable plasma viremia was underestimated in our study because measurements of plasma viremia by p24 antigen capture are less sensitive than quantitative viral RNA assays (25) Nonetheless, there was general concordance between detectable plasma viremia and transmission among the mothers in our study. Amplification of HIV-1 DNA was sensitive enough in our assays to detect one copy of HIV-1 in DNA from 150,000 cells. The level of HIV-1 provirus per million peripheral CD4+ T lymphocytes ranged from 13 to 20,000 among the women in our population, which is comparable to levels of HIV-1 infection in adults determined by similar methodology (34, 139, 208) Our study population was comprised of nonrandomized subjects and included untreated mothers who were equally divided between transmitters and nontransmitters However, ZDV treatement administered according to ACTG protocol 076 to the mothers and neonates in our population, resulted in about 10% pediatric infection, which is similar to the results from the original trial (36) The impact of ZDV treatment on maternal viremia or cell-associated virus was not evaluated as part of the original ACTG protocol 076. In our study, ZDV treatment significantly reduced HIV-1 infection among the infants, but the effect was independent of maternal immunological or virological parameters. In fact, the two ZDVtreated women who transmitted in our population had fewer than 100 HIV-1 copies per million CD4^ T cells and undetectable

PAGE 85

78 plasma viremia. ZDV-resistant virus was detected in one treated mother, which could account for transmission in that case, and suggests that even relatively low levels of resistant virus increases the risk for pediatric infection (69) Transmission also occured in the absence of ZDV treatment among 3 mothers with fewer than 100 HIV-1 copies per million CD4+ T cells. No other confounding clinical factors that would account for transmission were readily discernible among these mothers or their infants. Viral phenotype was not evaluated prospectively as part of these particular studies. However, viral characteristics, such as macrophage tropism or syncytium formation in culture, have been implicated as factors in maternal transmission (92, 111, 140, 150, 166, 175, 196) Based on our results, ZDV appears to exert its greatest effect on reducing maternal transmission among women with high proviral load. These results raise a question as to how ZDV administered to mother and neonate reduces HIV-1 infection. If the effect is not on levels of virus in the mother, then other mechanisms must account for the success of ZDV therapy. For example, ZDV may reduce infectivity of maternal virus by selection of viruses with increasing resistance to the drug. Multiple amino acid substitutions in reverse transcriptase (RT) are required for high level ZDV resistance of the virus. Intermediate amino acid changes can result in reduced drug sensitivity and altered virus viability (101) Alternatively,

PAGE 86

79 ZDV may have an impact on the target cells in the neonate that are susceptible to infection. The effect of ZDV on nucleic acid elongation is not restricted to DNA synthesis by HIV-1 reverse transcriptase (72) Replication of host cell mitochondrial and chromosomal DNA is also impacted by nucleoside analogues such as ZDV. ZDV produces a transient suppressive effect on neonatal hematopoiesis (36, 177) It has also been shown to reduce the proliferative response of lymphocytes in vitro (88) A clearer understanding of the factors which enable ZDV to reduce HIV-1 infection in neonates is essential to develop more effective therapeutic strategies that will essentially eliminate pediatric HIV-1 infection by maternal transmission.

PAGE 87

CHAPTER 4 PEDIATRIC HIV-1 INFECTION OF MONOCYTES AND CD4+ T LYMPHOCYTES Introduction Mother-to-child transmission of HIV-1 accounts for most infections in the pediatric population. Different than adult individuals infected with the virus, vertically infected children usually present a more rapid progression to disease. Multiple factors can have an impact on the disease outcome in children including timing of maternal transmission of HIV-1 to the infant, immaturity of the neonatal immune system (109) and increased susceptibility of neonatal monocytes -macrophages to HIV-1 infection (185) Children who have virus detected in their peripheral blood by PCR (polymerase chain reaction) or culture at birth are defined as being infected in utero, and seem to develop symptoms faster than children who acquire HIV later during gestation (PCR or culture negative at birth) (48) Also, because young children have significantly fewer memory (CD45R0) CD4+ T cells than adults (22% in normal children in the first 2 years of life versus 63% in adults) (94), immunological funtions such as T cell proliferation in response to antigens and production of antigen-specific IL-2 80

PAGE 88

81 and 7interferon, could be more depressed in infected children than in adults The role of monocytes and macrophages in the immunopathogenesis of HIV infection is not completely clear. In contrast to the decline in 004"^ T lymphocytes that occurs during HIV infection, changes in monocyte -macrophage number are minimal even in late stage disease (126, 127) Monocytemacrophage function in HIV-1 infected individuals has been described to be impaired by some, but not by other authors. Reports concerning oxidative burst, candidacidal activity, chemotaxis and phagocytic function of monocytes -macrophages are controversial (18, 26, 67, 138, 146) Possible reasons for the contradictory reports could be that (1) HIV-l-inf ected peripheral blood monocytes have been identified in only a small proportion of infected individuals (169) and (2) infected cells of this lineage are not necessarily killed by the virus (32, 126, 170, 172) It is thought that the infected cells may function as a reservoir of virus in different organs, particularly the brain and lung. Incidence of HIV-1related central nervous system (CNS) disease in infants and children is greater than in adults, and it is estimated to affect 30-40% of symptomatic children (21, 23) HIV-infected monocytes -macrophages may also be involved in the spread of virus to CD4+ T cells, and infection of placental macrophages could play a role in the vertical transmission of HIV-1 (118, 175)

PAGE 89

82 The goals for this part of our study were (1) to define the role of blood monocytes in the immunopathogenesis of HIV-1 infection in children, and in the vertical transmission of the virus, and (2) to compare progression of disease in a pediatric population, with diverse outcome during the first year of life. Children 0-13 years of age were studied longitudinally or cross-sectionally First, because infection of blood monocytes is a controversial subject, it was very important to characterize extensively the presence of virus in these cells. A technique of monocyte isolation was developed for this purpose which yields monocytes that can be 98-99% depleted of T lymphocytes (4) The great advantage of this technique over others described is the ability to verify the presence of residual T lymphocytes among the selected monocyte population, essential to avoid misleading results (4) Second, characteristics of virus replication in children who were infected early versus late during pregnancy, and in slow and rapid progressors, were compared using a PGR based assay. To understand with more details the behavior of the virus in pediatric HIV, infection of naive (CD45RA) and memory (CD45R0) subsets of CDA* T cells was then analyzed. Materials and Methods Patients HIV-1 infected individuals were enrolled in this study at the Pediatric Immunology Clinic at the University of Florida, Gainesville, FL, from June of 1989

PAGE 90

83 through April of 1996. Signed informed consent was obtained from all mothers. Thirteen HIV-1 vertically infected children were followed prospectively from birth, with a total of 92 blood samples analyzed from these individuals (Table 4.1) Five of these children were HIV PGR positive at birth (determined within 24 hours of birth) while 8 children did not have virus detected in PBMC (peripheral blood mononuclear cells) by PGR at that time. None of these infants were breast-fed. A group of 3 HIV1 infected children 2 to 12 years old was also followed prospectively, with a total of 20 blood samples analyzed (Table 4.2). One of these children (MIST) was infected by contaminated blood product at birth, while the 2 other were vertically infected by their HIV-1 positive mothers. Status of infection was not determined in these 2 children at the time of birth. Cross-sectional analysis included blood samples from 9 HIV-1 children 1 to 13 years of age (Tables 4.1 and 4.2). One child (NIHI) was infected by contaminated blood product at birth, while the other 8 acquired HIV-1 from their infected mothers. Glinical information regarding PGR results at birth was not available for these children. None of the vertically infected children in this study was treated with zidovudine (ZDV) according to the AGTG 076 protocol, to prevent maternal transmission of HIV-1. Virological and clinical data collected from these children included gestational age at birth, race, GD4 and GD8

PAGE 91

84 Table 4.1. Characteristics of longitudinally from birth, cl disease progression" Patient'' Age in CD4'*' T months cells//xl Slow progressors MEST 131 4.5 3969 160 7.0 3969 189 9.0 3969 299 14.4 1889 400 28.0 972 461 31.0 972 513 37.0 544 1281 61.0 440 1481 69.0 317 1555 72.0 388 KAAH 49 0.3 2312 83 3.0 2312 113 8.3 1155 166 13.3 1155 280 28.0 1466 383 34.0 1499 539 46.0 1268 1082 58.0 647 1290 69.0 682 1399 73.0 630 1428 74.0 630 1503 77.0 648 DEWA 1056 8.5 2003 1101 11.0 1490 1133 12.8 2145 1164 14.3 767 1221 17.0 677 1297 21.5 1214 1362 25.0 1214 1443 28.0 539 1532 30.0 1130 DIKA 1069 9.5 1633 1180 15.0 1455 JOSH 1242 8.3 4236 1256 9.0 3632 1414 15.5 1720 1470 18.0 1976 1536 20.0 2755 TEWI'^ 1547 18.0 1085 -1 infected children followed ified according to pattern of CD4:CD8 CDC HIV-1 copies/lO^ ratio stage CD4'^ T cells 1 8 Nl 29 1.8 Al 82 1.8 Al 122 0.9 Al 188 0.3 B2 125 0.3 B2 400 0.3 B2 235 0.3 33 125 0.3 B3 89 0.2 B3 200 3.0 E ND 3.0 Nl 167 2 0 A2 104 2.0 A2 375 2.3 A2 87 2.3 B2 43 2.2 B2 53 1.8 B2 48 1.4 B2 54 1.4 B2 52 1.4 B2 20 1.0 B2 20 1.0 Nl 25000 0.6 Al 30000 0.7 Al 8000 0.4 A2 1180 0.3 A2 670 0.5 A2 1000 0.5 A2 300 0.4 A2 40 0.4 B2 100 1.6 Al 10000 1.0 Al 1480 1.7 Al 100 1.9 Al 37 1.1 Al 334 0.7 Al 33 0.7 Al 1400 1.5 Nl 160

PAGE 92

? :.; 85 Table 4.1 continued... Patient'' Age in 004+ T CD4:CD8 CDC HIV-1 copies/lO* months cells/^1 ratio stage CD4'*' T cells Rapid progressors JOFO 1492 0 9 1789 1 5 Nl 2325 1516 1 8 1171 1 2 Nl 1200 o o 3 11 0 4 N2 12500 SAFR 1016 8 3 502 0 4 C3 8000 1039 9 5 498 0 3 C3 10000 1068 11 8 484 0 3 C3 8000 1132 15 0 412 0 4 C3 3350 1197 17 8 277 0 4 C3 1880 1232 20 5 128 0 2 C3 500 1296 24 0 126 0 3 C3 1430 1356 27 0 126 0 3 C3 1143 1440 30 0 126 0 3 C3 571 153 0 33 0 45 0 05 C3 700 JERO 576 1 0 1176 0 6 C2 10000 1029 5 0 722 0 7 C2 30000 1076 8 0 862 0 8 C2 25000 1199 14 0 588 0 7 C2 1880 1284 19 3 454 1 1 C2 300 1426 25 0 664 0 7 C3 273 1448 26 0 664 0 7 C3 91 1537 29 0 1000 0 85 C3 1200 JALA 1004 1 5 3045 1 4 Nl 1150 1007 2 0 3045 1 4 Al 30000 1038 4 5 1784 1 9 Bl 50000 1084 7 0 1784 1 9 Bl 2000 1120 9 0 1784 1 9 CI 425 1201 12 5 902 0 7 C2 270 1246 16 0 619 1 0 C2 10 1268 17 0 619 1 0 C2 13 1342 21 0 143 0 4 C3 St 1415 23 0 96 0 2 C3 5 SHFI 413 1 0 2546 2 4 Al 10000 458 3 8 1603 1 1 Al 2000 588 17 0 62 0 1 C3 1000 1225 30 5 385 0 2 C3 60 1279 34 0 601 0 6 C3 100 1346 36 0 485 0 06 C3 167 1376 37 0 485 0 06 C3 167 1447 41 0 238 0 4 C3 2667 1539 44 0 428 0 4 C3 100 SHJO 480 0 03 1835 1 6 Nl 95 494 1 3 2394 1 6 Al 10000 530 5 8 1597 1 9 Al 5000 1162 22 0 1134 0 6 Al 140 1271 28 0 924 0 9 Al 29

PAGE 93

86 Table 4.1 continued. Patient'' Age in CD4+ T CD4:CD8 months cells//xl ratio CDC HIV-1 copies/10* stage CD4'*" T cells Rapid progressors "J 1331 1471 MEBE'^ 13 08 32.0 36.0 12.0 857 704 48 0 9 0 9 0.9 M C3 29 29 2857 Indetermined NIBA REGR 1474 3 0 4111 • 0.7 Nl 130 1498 3 .8 4111 0 7 Nl 130 1508 4 0 2083 0 8 Nl 194 1518 4 3 2359 0 7 Nl 2000 1259 0. 03 2059 1 5 E ND 1278 1. 0 3338 2.4 Nl 1000 1443 7 5 1665 1 1 Al 20 ^ samples from two patients who were class E at the time, were not included in the statistical analysis designated by initials patients analyzed at one time point only, not included in the statistical analysis ND, not detected

PAGE 94

87 Table 4.2. Characteristics of HIV-1 infected children 2-13 years of age Patient" Age in CD4'"T CD4:CD8 CDC HIV-1 copies/ years cells/^1 ratio stage 10^ CD4+T cells MIST" 22 246 407 535 1072 10 1229 11 5 8 7 9 8 9 1059 64 591 795 884 728 0 0 0 0 0 0 Al Al A2 A2 A2 A2 182 250 615 235 300 90 CHST 122 196 387 527 1042 1224 1335 1431 2 3 4 5 6 7 7 7 1329 1012 1131 812 938 620 765 800 0 9 0 8 0.7 1 7 9 0 6 Bl Bl Bl Bl Bl Bl Bl Bl 1540 1548 1290 1250 1935 150 1360 100 JOST 158 307 399 556 1282 1438 2 3 4 5 7 7 933 933 578 558 246 224 0 0 0 0 0 0 Bl Bl B2 B2 B3 B3 148 222 182 223 200 20 NIHI" 1551 12 0 MEMO 1112 8.8 ALGA 504 7.7 638 913 11 0 9 1.2 0 03 Bl Al C3 10 200 220 JOLE 4 32 1254 5 1 7 6 386 210 0 5 0.3 C2 C2 150 500 JASM 1169 1194 7 7 7 8 270 357 0 6 0 8 C3 C3 100 300 designated by initials patients infected by contaminated blood product at birth

PAGE 95

88 T lymphocyte counts, p24 antigenemia, percent monocytes, percent HLA-DR'*' T lymphocytes, use of antiretroviral therapy, and disease stage according to the 1994 classification system by the Centers for Disease Control (CDC), as follows: immunologic categories 1 (no evidence of suppression) ; 2 (evidence of moderate suppression) ; and 3 (severe suppression) Clinical categories E (HIV status not confirmed) ; N (no s igns/ symptoms ) ; A (mild s igns/ symptoms ) ; B (moderate signs /symptoms) ; and C (severe signs /symptoms) (31) Children <18 months of age were defined as infected if they had virus detected by PCR on at least two occasions. Children >18 months of age were defined as infected if they had a positive PCR and/or ELISA, and confirmed by Western blotting. Cross-sectional analysis of blood samples from 16 HIV-1 mothers was also performed. Among these women there were 11 mothers who did not receive ZDV to prevent vertical transmission of HIV-1, 7 of whom transmitted the virus to their children. The other 5 women received ZDV according to the ACTG 076 protocol There were no transmitting mothers in this group (Table 4.3). Virologic and clinical data collected from the adult patients included age, race, CD4 and CDS T lymphocyte counts, p24 antigenemia, percent monocytes, disease stage according to the CDC classification (194), status of transmission to the child, and use of antiretroviral therapy to prevent vertical transmission of HIV-1.

PAGE 96

Table 4.3. Detection of V^8 and HIV-1 sequences in DNA from CD14'^ monocytes and CD4"^ T lymphocytes of infected mothers Patient^ V^8/l0'* cells HIV-l/lO'' cells % CD14 + cells'' CD4+ T CD14+ CD4+ T CD14'" Transmitting COD I 1015 1106 50 6 A U 3 Z 0 2 < "7 n / u 7.0 TEBU 1014 50 2 5 1 11.5 MARA 578 ND ND 4 <1 5 0 LOWA 1102 ND ND 100 <1 NA CABR 1096 8 2 0.2 <1^ 14.5 ROMO 1111 ND ND 70 <1 9 0 HAST 433 4 1 4 0 6 12 0 Nontransmitting ELHU 1033 20 6 0.2 • <1 < 7.0 DERU 1000 ND ND 0.4 <1 NA CHWA 1052 ND ND 1 <1 3 0 LAOW 1147 ND ND 0 1 <1'' ^ NA 076 nontransmitting PAEL 1152 12 <1 0.7 <1* NA LIWA 1089 ND ND 0 3 <1 7.6

PAGE 97

90 Table 4.3 continued. Patient^ V^S/lO" cells CD4"' T CD14 + HIV-l/lO" cells 004"" T CD14 + % CD14+ cells'' 076 nontransmitting JAWI 1116 ND ND DICO 1215 ND ND DERO 1222 20 5 200 0 5 0.2 <1 <1 4 0 6 6 3 0 designated by initials percent of total PBMC according to flow cytometry analysis less than 1 copy of HIV-1 detected in 5 X 10"* cells less than 1 copy of HIV-1 detected in 7.5 X 10"* cells ^ less than 1 copy of HIV-1 detected in 1.5 X 10"* cells ND, not done; bold letters, samples also amplified with M667AA55 primers ^ M -. •

PAGE 98

91 Cell lines Cell lines used for control experiments were Jurkat, a human T-cell line which has rearranged Y^S-J^l .2 T cell receptor (TCR) (203), and 8E5, a human T-cell line which contains a single integrated copy of HIV-1 DNA in each cell (68) The cell lines were obtained from the NIAID AIDS Research and Reference Program. CD14"^ monocytes, CD4'*" T lYmphocytes and CD4'^ CD45RA/CD45RO selection technique Three to five milliliters of peripheral blood from children <2 years of age to up to 10 ml of blood from older children and adults, were collected in acid citrate dextran (ACD) tubes. All samples were processed within 24 hours after collection, as previously described (4) Briefly, plasma was separated from total blood and PBMC were collected after Ficoll -Hypaque density centrif ugation (Histopaque-1007; Sigma Diagnostics, St. Louis, MO). CD14'^ monocytes were selected from total PBMC after incubation of the cells with a mouse monoclonal antibody (MAb) anti-CD14, MY4 (125 /ig/ml) (Coulter Immunology, Hialeah, FL) followed by incubation with immunomagnet ic beads coated with sheep antimouse immunoglobulin G (IgG) (Dynabeads M450; Dynal, Oslo, Norway) Monocytes with beads were separated from the CD14negative fraction using an MPC-1 Dynal magnet. CD4'^ T lymphocytes were selected from the CD14 -depleted cell fraction after incubation with a MAb anti-CD4, T4 (500 jug/ml) (Coulter Immunology) and immunomagnet ic beads.

PAGE 99

92 After depletion of CD14"^ monocytes the CD4"^ T lymphocytes were selected from the remaining PBMC using a MAb anti-CD4 linked to a detachable magnetic bead (DETACHaBEAD, Dynal) as previously described (181) After beads were detached from the CD4"^ T lymphocytes, CD4 5RO cells were selected by incubation with UCHLl mouse MAb (277 /xg/ml) (Dako Corporation, Carpinteria, CA) and magnetic microspheres. CD45RA cell fraction was selected from the CD45RO-depleted 004"^ T cells, using MAb Leu-18 (25 ^g/ml) (Becton Dickinson Immunocytometry Systems, San Jose,CA) and immunoaf f inity beads. Cell lysis and DNA extraction Cells were resuspended in 1 ml lysis buffer (10 mM Tris [pH 8.0], 100 mM NaCl 1 mM EDTA, 2% sodium dodecyl sulfate [SDS] 100 /xg proteinase K per ml) and incubated overnight at 3 7'^C. DNA was extracted using the G NOME DNA isolation kit (Bio 101, Inc., La Jolla, CA) according to the manufacturer. DNA concentration was calculated by spectrophotometric reading using a Beckman DU 640 instrument. Alternatively, cells were lysed in K buffer (50 mM KCl, 10 mM Tris-HCl [pH 8.3], 2 5 mM MgCl2, 0.5% Tween 20 and 100 fjLg of proteinase K per milliliter of buffer) at a final concentration of 50 ng of DNA (5,000 cells) per microliter of K buffer. PCR amplification Primers used for amplification of HIV1 were directed to the env region, forward LV15 (5'GCCACACATGCCTGTGTACCCACA-3 ) and reverse 194G (5'-

PAGE 100

93 CTTCTCCAATTGTCCCTCATA-3 ) located at nucleotides 6464 to 6487 and 7693 to 7713, and to gag-pol sequences, forward Gagl (5'GACCAGCAGCTACACTAGAAGA-3 ) and reverse Pol2 (5'TGCGGGATGTGGTATTC-3 ) located at nucleotides 1802 to 1823 and 2863 to 2879, in the HIV-Ilai genome as previously described (5) A third set of primers was used to amplify long terminal repeat (LTR) sequences of the virus, M667, forward (5'GGCTAACTAGGGAACCCACTG-3 ) corresponding to nucleotide positions 496 to 516, and AA55, reverse (5'CTGCTAGGAATTTTCCACACTGAC-3 ) corresponding to nucleotides 612 to 635 (214) Primers specific for the V^8 family of TCR were forward V^8 ( 5 -GTTCCGATAGATGATTCAGGGATGCCC-3 ) and reverse J^l.2 (5 -TACAACGGTTAACCTGGT-3 ) as previously described, yielding a 180 bp fragment (4) Amplifications of V^S sequences were performed to evaluate the level of enrichment of CD14"^ monocytes, in relation to the presence of residual T cells. Oligonucleotide primers were synthesized on an Applied Biosystems DNA synthesizer in the DNA synthesis core facility of the Interdisciplinary Center for Biotechnology Research at the University of Florida. jS-Actin sequences were amplified with a forward primer (5 -GAAACTACCTTCAACTCCATCATG-3 ) and a reverse primer (5 -CTAGAAGCATTTGCGGTGGAC-3 ) (Clontech, Palo Alto, CA) Amplified products were 350 bp. jS-Actin amplifications were always performed to assure analysis of similar amounts of input DNA among individuals, and also

PAGE 101

94 within the same individual when several PBMC subsets were evaluated for the presence of HIV-1. All amplifications were performed in a total volume of 50 111. Concentrations of patient DNA used for amplifications were 0.1 and 1 ng for |8-actin, 50 and 100 ng for V^8 50 to 1,000 ng for env and gag-pol, and 25, 50 and 100 ng for LTR (strongstop DNA) DNA from Jurkat and 8E5 cell lines was used in 5fold serial dilutions at concentrations that ranged from 0.01 to 1 ng (1 to 100 cells) Reactions also contained 200 /xM of each deoxynucleoside triphosphate (dTP) PGR buffer (50 mM KCl, 1.75 mM MgClj 100 /xg of bovine serum albumin [BSA] 20 mM Tris [ph 8.4]), 1 /zM each primer, and 2.5 U of Taq DNA polymerase (Pharmacia) For amplification of LTR sequences, 5 mM MgClj were used instead (214) Amplifications were performed in a 48 -well automated Perkin-Elmer Cetus thermal cycler /J-Actin was amplified by 1 cycle of denaturation (94*'C for 5 min) 25 cycles of amplification (94C for 30s, 60C for 30s, and 12^C for 30s) and 1 cycle of extension (72*'C for 10 min) V^8-J^1.2 amplifications were performed with 1 cycle of denaturation (94''C for 5 min) 35 cycles of amplification (denaturation for 1 min at 94C, annealing for 1 min at 45^0, and extension for 2 min at 72^0 and 1 cycle of extension (72^0 for 10 min) Amplifications using the env and gag-pol primers were done with 1 cycle of denaturation (95''C for 10 min) 35 cycles of amplification (95C for 1 min, 55C for 1

PAGE 102

95 min, and 12^C for 2 min) and 1 cycle of extension (72C for 10 min) LTR (strong-stop) sequences were amplified by 1 cycle of denaturation (95''C for 10 min) 25 cycles of amplification Ol^C for 1 min, and 65C for 2 min) and 1 cycle of extension {12C for 10 min) (214) PGR products were electrophoresed in agarose gels and transferred to Nytran membranes (Schleicher & Schuell, Keene, NH) Double -stranded DNA probes specific for actin, V^8, gagpol and env sequences were random labelled with a [^^P] dATP (Du Pont, Boston, MA) to a specific activity of 1-3 X lO' cpm//ig DNA, and hybridized to the appropriate products. Hybridizations were carried out for 16 hours with 10^ cpm of radiolabelled probe per ml of phosphate hybridization buffer (500 mM NaP04 [pH 7.2], 1 mM EDTA [pH 8.0], 7% SDS, 1% BSA) and washes were performed for 1 hour in 4 0 mM NaP04 with 0.1% SDS, at 55C for jS-actin, at 50C for V^B and at 60"C for gagpol and env analysis. M667-AA55 products (strong-stop DNA) were hybridized to an oligonucleotide probe, located at positions 561 to 582, radiolabelled with 7[^^P]ATP (Amersham Corporation, Arlington Heights, IL) Probe labelling was performed in a 25 /xl reaction containing 1:10 volume of 10 X kinase buffer (50 mM Tris-HCl [pH 8.2] 10 mM MgClz, and 5 mM dithiothreitol) 10 pmol oligonucleotide probe, 7[^^P]ATP (6,000 Ci/mmol) T4 polynucleotide kinase (10 U//xl) Membranes were placed in hybridization solution (6 X SSC, 10 mM EDTA [pH 7.5] 2 X Denhardt's solution, 100 /xg/ml salmon sperm DNA, and

PAGE 103

96 0.5% SDS) for 16 hours at 55''C with 4 X 10*^ cpm of radiolabelled probe per ml of buffer, and washed for 1 hour (20 X SSC, and 10% SDS), at 55^C Hybridized filters were exposed to Fuji medical X-ray film at -SO^C. Sensitivity of |3actin, V^8, gag-pol and env primers was at the level of 1 to 5 cells. Level of detection of M667-AA55 primers was 50 cells. Calculations of cell -associated viral load were performed by comparing results of patient DNA amplifications to amplification of an 8E5 DNA standard curve, which was included in every experiment. Intensity of hybridization was determined by densitometry (129) Statistical analysis Analysis were performed using a software program (Sigma Stat, Jandel Scientific, San Rafaelo, CA) Mann-Whitney rank sum test was used for viral load comparisons, t test was applied for comparisons of CD4'^, and CD8"^ T cell counts, CD4 to CDS ratios, monocyte percentages and HLA-DR"^ T lymphocyte percentages. CDC disease stage was compared by Fisher's exact test. Results Cell selection and enrichment of CD14"^ monocytes The initial step in analyzing infection by HIV-1 of pediatric PBMC was to determine which cell populations harbored the virus. Using immunoaf f inity magnetic beads, CD14'^ monocytes were selected from total PBMC, followed by selection of CD4'^ T lymphocytes from the CD14 -depleted cell fraction. According to

PAGE 104

97 a technique previously described (4) we can select blood monocytes as much as 98 to 99% depleted of CD4* T cells. This method is based on the detection of TCR rearrangements in the separated cells by PGR amplification of V^8 sequences, a family of TCR detected in 3-26% of peripheral blood T lymphocytes (84, 148) Verification of monocyte enrichment was important when HIV-1 sequences were detected in these cells, to exclude the possibility that infected CDA'^ T lymphocytes were responsible for viral amplification in monocytes. A total of 66 blood samples were analyzed (Tables 4.3, 4.4, and 4.5) Serial dilutions of patient DNA from both 0014"*" monocytes and CD4"^ T lymphocytes, ranging from 50 to 750 ng, were amplified with gag-pol (20 samples) env (34 samples) or with both primers (12 samples) Actin amplification performed in all samples demonstrated equal amounts of input DNA. V^B sequences were amplified in 26 of the 66 samples. Monocytes a 90% free of T cells were obtained in 13/26 cell separations. In 10 occasions (CODI [both samples], CABR, HAST, ELHU, DERO, MEST [31.0 mo], JERO [19.3 mo], JALA [2.0 mo] and JOLE [5.1 yo] ) unsatisfactory monocyte selection was performed, yielding cells <80% enriched. Many of these samples were manipulated during initial optimization of the technique, and slight differences in the cell selection process could account for the inferior results. Fortunately, in most cases the quality of the selection technique did not affect interpretation of the assays (see below)

PAGE 105

98 Table 4.4. Detection of V^S and HIV-1 sequences in DNA from CD14"^ monocytes and CBA'^ T lymphocytes of infected children followed longitudinally from birth Patienf" Age in months V^8/10'* cells HIV-l/lO" cells % CD14' cells'" CD4+ T CD14 + CD4'' T CD14 + MEST 461 31 0 8 2 4 2 13 7 1070 50 0 ND ND s250'= 1 5 0 1555 72 0 ND ND 2 <1'' 5 0 DEWA 1056 8 5 20 1 250 <1 3 0 1101 11 0 10 2 300 1 9 0 1297 21 5 ND ND 10 1 9 0 1443 28 0 ND ND 0.4 <1 7.0 1532 30 0 ND ND 1 <1^ 10 0 DIKA 1069 9 5 10 2 100 2 13 0 JOSH 1242 8 3 ND ND 1 <1'* 3.0 1414 15 5 ND ND 3.3 <1 5 0 1536 20 0 ND ND 14 0 4 6 0 TEWI 1547 18 0 ND ND 1 6 <1'' 16 0 JOFO 1516 1 8 ND ND 12
PAGE 106

99 Table 4.4 continued... Patient" Age in months 8 / 1 U cells TTTT7 ^^ /Tr\4 HIV1/10 cells s CD14 cells'' CD4+ T CD14 + CD4+ T CD14 + SHFI 588 17 0 10 1 10 <1 4.0 1279 34 0 ND ND 1 <1'' 8 0 1539 44 0 ND ND 1 0.4 6.0 SHJO 530 5 8 40 1 50 <1 7.0 1162 22 0 ND ND 1.4 <1" 6 0 NIBA 1518 4 3 ND ND 20 1 5.0 REGR 1278 1. 0 ND ND 10 <1 3 0 1443 7. 5 6 1 0.2 12.0 designated by initials percent of total PBMC according to flow cytometry analysis '^not in the linear range less than 1 copy of HIV-1 detected in 2.5 X 10'* cells ^ less than 1 copy of HIV-1 detected in 5 X 10'* cells ND, not done; NA, not available; bold letters, samples also amplified with M667-AA55 primers

PAGE 107

100 Table 4.5. Detection of V^8 and HIV-1 sequences in DNA from CD14"^ monocytes and CD4'^ T lymphocytes of infected children 213 years of age Patient^" Age in V^B/lO" cells HIV-l/lO" cells % CD14 + years cells'* CD4+ T 0014-*" CD4+ T CD14 + MIST'1072 10 7 ND ND 3 <1 8 0 CHST 1224 7.1 12 <1 1.5 <1"' 8. 0 JOST 1438 7 5 ND ND 0.2 <1'' 11 0 NIHI' 1103 10 8 ND ND slOO' <1 9 0 1551 12 0 ND ND 0 1 250" <1 6 0 TRGR 1117 3 5 ND ND alOOO' <1 2 0 ^ designated by initials percent of total PBMC according to flow cytometry analysis patients infected by contaminated blood product at birth less than 1 copy of HIV-1 detected in 2.5 X 10"* cells ^ not in the linear range less than 1 copy of HIV-1 detected in 5 X 10"* cells ND, not done; bold letters, samples also amplified with M667AA55 primers

PAGE 108

101 HIV-1 infection of peripheral blood monocytes Results from analysis of 37 blood samples, from 12 vertically infected children followed longitudinally from birth, and from a sample of an 18 months old child (TEWI) are shown in Table 4.4. Four samples belonged to neonates (<2 months old) In 16 out of 38 cases, patients were asymptomatic (CDC class N-A) Except for TEWI, from whom information was not available, 5 children had virus detected in their PBMC by PCR at the time of birth, suggesting in utero infection. Eleven samples belonged to children who had not been followed from birth (Table 4.5). Other than 2 patients who were infected at birth by contaminated blood product, all others acquired HIV-1 from their infected mothers. There was only 1 sample in this group from an asymptomatic patient (MIST) We also analyzed 17 blood samples from infected adults, transmitting and nontransmitting mothers (Table 4.3) Among the nontransmitters 5 received zidovudine (ZDV) to prevent vertical transmission of HIV-1, according to the ACTG protocol 076. Maternal samples were used as a positive control of virus detection, and for comparison of viral tropism between the mother-child pair. Three of the 5 mothers presenting clinical evidence of HIV-1 infection, transmitted the virus to their children. Overall, the extensive analysis performed was insufficient to demonstrate unequivocally the presence of HIV1 gag-pol or env sequences in blood monocytes of children (and adults) of any age, or disease stage. Representative data is

PAGE 109

102 shown in figure 4.1. When viral sequences were detected in the monocyte population (21/66 samples) 2-300 times more copies of HIV-1 were detected in the CD4"^ T lymphocytes selected from the same blood sample (Tables 4.3-4.5). The presence of contaminating T cells, represented by detection of V^8 products, could account for the detection of HIV-1 in monocytes in 13/21 cases (TEBU, HAST, MEST [31.0 mo], DEWA [11.0 mo], DIKA [9.5 mo], SAFR [8.3, 9.5, and 11.8 mo], JERO [1.0, 5.9, and 8 0 mo] JALA [2 0 mo] and JASM [7.8 yo] ) V^8 amplification was not performed in the remaining 8 cases, due to insufficient DNA availability, however, <1 copy of HIV-1 was detected per 10'' monocytes. However, based on the results of V^8 analysis, viral amplification in these 8 cases could very likely be due to infection of contaminating CD4'*' T lymphocytes An important factor is the distribution of family of TCR in HIV-1 infected individuals. In the normal population, V^8 rearrangements are detected in 3-26% of peripheral T lymphocytes, with similar occurence in both CDA'^ and CD8* T cells (84, 148) It has been reported that HIV-1 infects preferentially CD4"^ T cells expressing rearranged V^12 TCR (179) We noticed that V^8 rearrangements comprised only 0.080.8% of the 004"^ T cell population in our cohort. Detection of these cells in the monocyte population at a level that could explain the presence of amplified virus, strenghtens the

PAGE 110

103 gag -pol P-ACTIN CELL NO. 5x1 0^ 10^ 102 10 CD14^ CD4^ CD14^ CD4+ 102 10 1 <1 10 8E5 Figure 4.1. HIV-1 DNA in PBMC. Serial dilutions of DNA equivalent to 5 X 10^ to 10^ cells were obtained from CDIA* monocytes and CD4* T lymphocytes selected from 2 separate individuals by using immunoaf f inity magnetic beads (upper pannel) Serial dilutions of DNA equivalent to 10^ to <1 cell were obtained from 8E5 T cell line (lower pannel) DNA from each cell type was amplified with gag-pol primers. Products were electrophoresed in 1.0% agarose gels and transferred to Nytran membranes. The DNA equivalent of 10 cells from each cell type was also amplified with primers for /3-actin. Doublestranded DNA probes to detect envelope and actin sequences were labelled by random priming with Q![^^P]dATP, washed, and exposed to X-ray film.

PAGE 111

104 results that CD14"^ cells do not comprise a major virus reservoir If it were true that macrophagetropic variants initiate HIV-1 infection after vertical transmission (196) we would expect to detect virus in monocytes at least during the acute phase of infection. During acute HIV-1 disease, high levels of virus replication take place and peak levels of viremia are reached during this stage. As an efficient immune response develops, viral burden is downregulated The acute phase of infection lasts 3-6 months in adult individuals (106) Vertically infected neonates/inf ants are a good model for acute infection, since a neonate can not be infected for longer than 9 months. Frequently infection occurs later during gestation, close to the time of birth (negative HIV-1 PGR at birth) Four neonates (s 2 months of age) 3 of whom were HIV1 PCR-positive at birth, had samples analyzed. In 2 cases, there was <1 copy of HIV-1 per 10'* or 5 X 10'* monocytes (REGR, JOFO) while in the other 2, 75-100 times more copies of HIV-1 were detected in the CD4+ T cells than in the monocytes (JALA, JERO) Furthermore, V^^S sequences were detected in the monocytes at a level that could explain the presence of HIV-1 in the monocyte population. Interestingly, previous experiments performed in our laboratory were able to show HIV1 in monocytes from 2 neonates, SHFI and SHJO V^8 sequences were not detected at the level of lO"* 0014"" cells. One copy of HIV-1 per 10 CD4'' T cells and l/lO^ monocytes were identified

PAGE 112

105 in SHFI's sample; SHJO had equally infected CD4'" T cells and monocytes, at l/lO^. Unf ortunatelly, there is no DNA available from these patients at that time, and the experiment could not be repeated. When 2 later samples from each patient were analyzed, virus was not detected in 10** to 5 X lO" monocytes; in a sample from SHFI at 44 months of age, there was 0.4 copy of HIV-1 per 10'* monocytes. Although V^8 amplification was not performed in this specific sample, the low level of detection could be attributed to contaminating infected CD4"^T cells with other TCR rearrangements. The 2 previous results in which virus was detected in monocytes, could represent a brief window of time when high levels of virus replication occurs in these cells, before decreasing abruptly to basicaly undetectable levels. Otherwise, it is possible that these patients had low levels of rearranged V^8 TCR at that time, and that the absence of detection of this family in monocytes did not represent a good marker for monocyte purity. Maybe virus was not detected in monocytes because of a low level of cell associated HIV-1 in these individuals. This could not explain our results because even when as much as 3% of patient CDA'^ T lymphocytes were infected, monocytes only contained 0.01 to 0.04% of detectable viral sequences, a fact that could be explained by the presence of T cells in this population. Because viral DNA could not be dected in maternal blood samples either, we excluded the possibility that this finding was specific to the pediatric population.

PAGE 113

106 Finally, it is possible that the HIV-1 patients we studied presented severe monocytopenia, which could explain why virus was not detected in their cells. This hypothesis could not be confirmed because HIV-infected children of all ages had normal numbers of monocytes in their peripheral blood, 7.6% ( 4.4) in children 0-2 years of age, and 8.4% ( 4.2) in children older than 2 years of age. Strongstop DNA Peripheral blood monocytes have few to none detectable HIV-1 gag-pol or env DNA sequences. We reasoned that if monocytes were susceptible to HIV-1 infection but virus replication only occurred after cells started the differentiation process into macrophages, this could explain why we did not detect HIV-1 DNA in these cells. Previous reports showed partial DNA products of reverse transcriptase in quiescent peripheral blood lymphocytes, whereas full reverse transcription did not occur until mitogenic stimulation (214) It has also been shown that in culture incomplete DNA species are detected in non-proliferating monocytes (171) Using an adaptation of the technique described by Zack (214) 25 to 100 ng DNA of CD14+ monocytes and CD4"^ T lymphocytes from 8 patients were PGR amplified with M667-AA55 primers, directed towards the strong-stop sequence of HIV-1 LTR (Fig. 4.2) The difference in our assay was the use of a radiolabelled oligonucleotide probe instead of radiolabelling the amplification primers.

PAGE 114

107 M667 AA55 R U5 m U3 R gag pol env Figure 4.2. Oligonucleotide primers specific for LTR strong-stop DNA. Location and orientation of primers M667 (nucleotides 496516) and AA55 (nucleotides 612-635) are shown in relation to HIV-1 RNA genome. Open boxes represent the LTRs and the solid circle represents the primer binding site (PBS) located in nucleotides 637-651. tRNA primer binds to PBS to start minusstrand polymerization to the end of the R region. R-U5 DNA is made, which will hybridize to the R region of the 3' RNA LTR. The R-U5 RNA is degraded by reverse transcriptase, which has RNAse H activity, during the reverse transcription process (Modified from Ref. 214).

PAGE 115

108 Seven of the 8 patients from whom samples were amplified with these primers are shown in Tables 4.3-4.5. The eighth patient was a 3 month-old infant from whom only strong-stop DNA amplification was performed, therefore not included in the tables. Among the 4 children <2 years of age, 2 demonstrated no signs of clinical disease (REGR and CAHA) There were 2 older children, both with symptomatic disease (class B-C) and 2 mothers, 1 transmitter and 1 nontransmitting Although virus sequences were always detectable in the CD4"^ T lymphocytes, monocytes from these individuals did not harbor partial reverse transcripts. Therefore, the conclusion from these series of experiments is that peripheral blood monocytes do not serve as a major reservoir of HIV-1 infection. HIV-1 cultures and genotvping Preliminary data from our laboratory show that macrophage -tropic variants are detectable in PBMC samples from patients of our cohort. Briefly, the assay consists of cocultivating patient's PBMC with uninfected PBMC, and the virus stock produced is used to infect primary monocyte -derived-macrophages (MDM) Macrophage -tropic virus was detected in a sample from a transmitting mother (TEBU) Interestingly, her child (SAFR) did not present viruses with such characteristics. The same was true for 2 other children, CHST and MEST. More samples need to be analyzed for further conclusions

PAGE 116

i : '' ; 109 Genotyping, to determine if viral sequences with characteristics of macrophage-tropism are found in the blood of our patients, is currently being done in our laboratory. These experiments will be important to elucidate why viral DNA is not detected in our cohort at significant levels. Either these patients do not have macrophagetropic viruses or blood monocytes are truely not infected, which we believe to be the most likely explanation. Infection of CD4"^ T lymphocytes in longitudinal and cross-sectional analysis of HIV-1 infected children Since blood monocytes in the population of children we studied in most cases harbored no detectable HIV-1, we analyzed the pattern of infection in the CD4"^ T lymphocytes from these individuals. A total of 121 blood samples were studied, 92 of which belonged to 13 vertically infected children who were followed longitudinally from birth (Table 4.1) There were 20 blood samples from 3 children >2 years of age, who were also followed longitudinally, and 9 samples from children 1-13 years of age, which were analyzed cross-sectionally (Tables 4.1 and 4.2) After immunomagnet ic selection of CD4'^ T lymphocytes from total PBMC, DNA from these cells was PGR amplified with gag-pol and env primers Cell-associated viral load was calculated by comparison of results to an 8E5 DNA standard curve. In approximately 50% of the cases, DNA from total PBMC was amplified instead and the number of infected

PAGE 117

110 CDA'^ T cells was calculated according to flow cytometry results of T cell subset analysis. The 13 children who were followed longitudinally were divided into 3 groups for purpose of analysis, slow progressors, rapid progressors, and indetermined (Table 4.1) Criteria used for classification of patients included result of PGR at the time of birth, clinical and immunological status of the child, and timing when peak levels of cell -associated virus were reached. Groups clustered according to progression of disease were further divided into age groups 0-6 months, 712 months, 13-24 months, and 25-72 months, for statistical analysis Gomparison was performed among children within the same age range, with either slow or rapid development of disease. One time point samples were obtained from patients TEWI and MEBE (Table 4.1), not included in the statistical analysis. Representative data is shown in figures 4 3A (slow progressors) and 4.3B (rapid progressors). The 5 slow progressors (Table 4.6) were HIV-1 PGR negative at birth and asymptomatic (GDG class N-A) until 24 months of age. Peak levels of cell -associated virus were reached around 12 months of age (12.7 [ 2.5]). Among the 6 rapid progressors (Table 4.7), 5 had a positive PGR at birth and by 6 months of age, only 1 patient was still asymptomatic, without signs of immunosuppression (SHJO) Excluding the patient from whom we did not have an earlier sample (SAFR) peak levels of cell -associated virus in this group were

PAGE 118

Figure 4.3. HIV-1 proviral copy number and CD4* T cell count in vertically infected children. Longitudinal analysis performed in a slow progressor (A) and in a rapid progressor (B)

PAGE 119

Figure 4.3 continued. 112 B Age in Months

PAGE 120

113 a -H •O 4J H cn o rH TJ 0) o 0 H-l CJ 0) -o rH -H J3 O 0) o d -H 1 > o O CO ^ m 4J to U 0 CQ CD (U u o u ^ -H Si Q) M 6 X) O fO iH H 4-1 K o + Pi to Q rH I rH K E-i 00 Q O U -H •• 4J Q >H u C W H J3 4-> n H r~ H 00 0) U Di <* *= <*" Q (0 o o O rH U 4J o o O (N CO H H H in in VD CTl H +1 +1 +1 ^0 CN in H n H o +1 +1 +1 H o in in O (N o 00 + w o in o ro CTl CO rH in H O a\ in cr\ Q rH H H (N H U (U +1 +1 +1 +1 u H Eh ^ (N rH (N n (N H + m H tri (N H in H 'i' rH H H VD H in IJ3 CO Q rH n (N H 00 U 0) +1 +1 +1 +1 o CTl (N Ol H Hi 0) T3 •0 -H > rW 'O -rl rl n3 a T) •H C (0 U 4J -H CQ 4J m -H e 0 4-) e 0) £ n CQ (U a CQ N (0 >i ^-^ rH 0 Tf (U c CQ (C d CQ 0) 0) CQ u Q) rH 0) ><; Qa ft
PAGE 121

114 as a •H •o 3 JJ •H Cn C o •o (U o rH O >l-l a 0) •o rH -H o •0 0) JJ o 0) u -H tn u o CD to dJ m ^ > o I > M !i! CU M-i n5 O CU to u -IJ u ^-^ •H CQ u ^ X5 o m u 0 ^ > WO (I) U 01 O (B U 4J to a; c cn o CTl in H to o O vo o tn CO H H +1 +1 +1 +1 o CO m CO 00 CN H O CO o + p; to H o Q r-i in H H 1 rH +1 +1 +1 +1 Eh o O cn cn H H H H CO Q 0 1^ n U -rH in in • 4J O o o o 0! H o o o Q ^1 +1 +1 +1 +1 u rH H a. H o 00 + to n CN (N CTl in 00 iH m n n o n CO CN Q rH H H H U 0) +1 +1 +1 +1 o rH H ^ CO o r+ 0) CN CO 00 H in CTl rH CN in CO n H CN Q rH 00 CTl n in U 0) H +1 +1 +1 +1 U CN fN H 1 CN in H (N 1 CQ CQ fC rH CJ Q o CQ rH -H S -rH T) Pj H 0 H u 4J H Itf jj > £ 0 4J fli rH (C CQ cr< (li c 4J n CQ Cj ri n 1 +1 CI) r! 1 r^ f^J n. (11 C c: T3 frt 10 (D rn CO N frt 1 1 1 r\ U U frt (-1 P rn frt rH QJ Sh CQ rH QJ 13 U CQ E a
PAGE 122

reached at 3 (+1.8) months. Rapid progressors were initiated in antiretroviral therapy at an earlier age than slow progressors, 5.6 { 3.3) months of age versus 15.4 (+ 2.6) months of age (p=0.003). At this time, 2 patients are still indetermined in respect to disease progression (Table 4.4). Both indetermined children had a negative PGR at the time of birth. For purposes of statistical analysis, these children were not included. Results of statistical analysis comparing slow versus rapid progressors are shown in Table 4.8. Rapid progressors always had lower CD4 counts than slow progressors, suggesting that these children showed signs of immunosupression early in life, at or shortly after birth, which persisted until 6 years of age, when analysis was interrupted. Children who were infected close to the time of birth (PGR negative at birth) seemed to have a greater potential to combat the virus, leading to slower development of disease. Likely, these patients had a more developed immune system by the time of the first encounter with the virus. Similar levels of cytotoxic T lymphocytes were detected in both groups, independent of the degree of immunosuppression, except for children 13-24 months of age, when rapid progressors had significantly lower GD8 counts (p=0.002) Also at this age, decrease in GD4 counts was most pronounced in rapid progressors, when compared to slow progressors. CDS decline probaby followed as a consequence of the marked reduction in GD4 counts. Inversion of CD4 to CDS

PAGE 123

0 116 02 0) iH (0 0 ^ K o H tn o H o VD n o o O o m -d o 0) •H (0 >i iH Id a 0) 0) u Cn Q (0 U -1-1 w + Q -H o o o o V o o o o V CO (N O 0) CN H in u o o O o o -H 4-) GQ H 4-> ns 4J O o Q) CQ CQ U (C 0 X! CQ CQ CQ 0) Cn 0 > H CO CQ 0) Hi rH CQ to (1) Eh > 00 Q 0 00 (N u -H CO CO H 4-) o O H O Q o O O O u + m CO iH Q M CJ 0) u H X 0) c tn 0 < e a m u -rH a •H CQ Ti rH O

PAGE 124

117 ratio usually occured between 13 and 24 months of age in both groups Signs and symptoms of HIV disease did not show in either group until patients were 6 months old. Between 7 and 24 months of age, however, most rapid progressors presented symptomatic HIV infection while all slow progressors were still asymptomatic (p<0.0001) It was not until 2 years of age when slow progressors started showing symptoms Curiously, there was no difference in the level of infected CD4^ T lymphocytes in children 0-6 years of age. There was a striking difference in viral load between the groups of slow and rapid progressors at 0-6 months of age (98 [+ 98] versus 12636 [ 15049] ) However, the difference was not statistically significant by Mann-Whitney rank sum test (p=0.0507) The small number of slow progressors (2 versus 13) could in part explain these results. Although peak levels of cell -associated virus were detected earlier in rapid progressors than in slow progressors (3 and 12 months, respectively) levels of viremia were still similar between the 2 groups. At 1 year of age, viral load was still relatively high in rapid progressors, in the process of declining, before entering a stable, low level phase of viremia There was also no difference in the level of activation of total T lymphocytes among patients from both groups, measured through detection of HLA-DR marker by flow cytometry

PAGE 125

118 analysis. The similar results detected in both slow and rapid progressors suggest that lymphocyte activation of either CD4"^ or CDS"^ T cells is not a factor in development of disease. We then analyzed patients >2 years of age, who had not been followed from birth (Table 4.2). This analysis included 3 patients who were followed longitudinally, and 5 patients from whom only 1 or 2 blood samples were examined. Because in most cases PGR result at birth, timing of peak viremia and disease stage throughout the first year of life were unknown, these children were classified into asymptomatic (CDC class A) or symptomatic (CDC class B-C) categories, according to the time when first sample was obtained. Children 2-6 years of age, A or B-C, did not differ in respect to CD4 or CDS counts, or in the level of infected CD4"*' T cells (Table 4.9). This result is different from what we found in slow and rapid progressors 2-6 years of age, CD4 counts being significantly lower in rapid progressors. We expected asymptomatic patients to be similar to slow progressors in most aspects. The small sample number in the asymptomatic group 2-6 years of age could explain the difference. Children 6-13 years of age were similar in respect to the number of activated (HLA-DR+) T cells and there was no difference in the level of infected CD4+ T lymphocytes. However, CD4'' and CD8"^ T cell counts continued to be higher in asymptomatic patients, even at this older age (Table 4.9)

PAGE 126

119 4-1 -H m (U CO QJ CN a u u T! 0) 4-) U 0) 4-1 4-1 ^ m "5 (D U O -IJ ^ Cn • C ^ -H 0) ^ rH O XI U m u ^ 0) 05 '~\ ft u ^ PJ 01 Q rH 00 Q O O -H •• 4J (C Q >4 U (U u cn Q (0 O 4-1 01 00 n in r(N vo H in (N VD 00 +1 +1 +1 H 0 0 00 O) in (N 00 P> (N +1 o H 0\ nS 4-1 o 01 u 4> +1 in IM o 03 U (S 0) >1 H +1 CO CN ro in • in • o o o +1 rH Eh 3. 0 CN cn H cn 0 CN 0 + to 00 rn 0 H 0 0 00 1-H rin VD m H cn 0 D r-t H 0 CN 00 U 0) -H +1 +1 0 u \ OJ rH XI > 4J o a

PAGE 127

120 HIV-1 infection of CD45RA and CD45RO subpopulat ions of CD4"^ T lymphocytes Previous reports showed that in adults the memory CD45RO subtype of CD4'*' T lymphocytes is preferentially infected over the naive CD45RA cells (168) Functional abnormalities seen in infected individuals, as for example a defect in the ability to respond to soluble antigens, could be a direct consequence of the preferential infection of memory T cells. To investigate infection of CD4"^ T cell subtypes in the pediatric population, 11 blood samples from 10 children were analyzed (Table 4.10) Using immunomagnetic beads, CD14"^ monocytes were selected initially from total PBMC, because besides coexpressing the CD4 surface antigen, a subpopulation of monocytes also expresses the CD45RO ligand (1) C'DA'^ T lymphocytes were selected with detachable immunoaf f inity beads from the CD14 -depleted fraction. Cells of the memory (CD45RO) and naive (CD45RA) phenotypes 95% enriched according to flow cytometry analysis, were obtained by immunomagnetic selection from CD4"^ T lymphocytes. PGR amplification with env primers was performed in equal concentrations of DNA from both CD45RA and CD45RO cells, ranging from 100 to 1,000 ng within the same blood sample Quantitation of HIV DNA in T cell subsets from 4 children 2 to 9 years old, revealed 4to 10 -fold more HIV-1 DNA within the CD4+ memory T cells than in the naive lymphocytes. Only the oldest patient in this group (MIST) who was infected at birth by contaminated blood product, was still asymptomatic.

PAGE 128

121 Table 4.10. HIV-1 infected CD45RA and CD45RO CD4+ T cells Patient Age in months Infected cells/10^ CD45RA CD4 5RO 0-2 years of age REGR 12 78 SHJO 4 94 JOFO 1516 NIBA 1518 JOSH 1414 1536 TEWI 1547 1 1 1 4 15 20 0 18 0 2-6 years of age JERO 153 7 MEST 1555 29 0 72 0 6-13 years of age <1 80 30 30 70 10 20 <1' 100 40 160 <1^ 70
PAGE 129

These results are in agreement with the published data in infected adult individuals (168) Children younger than 2 years of age can have up to 8 0% of the CD4"^ T cells comprised of the naive phenotype (94) The 6 patients analyzed in this group acquired HIV-1 from their infected mothers and presented no symptoms (CDC class N-A) at the time. Among the 3 neonates (<2 months of age) studied, 2 had >10-fold more virus detected in the CD45RO population. The third child (JOFO) had 2 -fold more HIV-1 DNA present in the CD45RA naive T cells than in the CD45RO lymphocytes. This patient was infected in utero, according to a positive HIV-1 PGR result at the time of birth. However, timing of maternal transmission did not seem to associate with preferential infection of naive T cells, since this phenomenon was not true for the patient SHJO who also had a positive PCR at birth. The other 3 infants were infected perinatally and did not differ from each other in respect to their clinical characteristics. Only 1 patient (NIBA) had greater viral load in the memory T cells; in the other 2 children, equal amounts to >10-fold more virus were present in the naive cells. From this section of the study we concluded that in children >2 years of age, CD4+ memory T cells are the main subpopulation infected by HIV-1, as seen in adults. However, in younger children either lymphocyte subtype can harbor the virus. This finding does not seem to correlate to timing of infection or clinical symptomatology. It will be interesting

PAGE 130

123 to determine if viruses that replicate during acute and initial stage of chronic infection are genotypically different from viruses present during the established chronic phase of HIV-disease. There could be a correlation between preferential CD45RA or CD45RO infection, and progression of disease. Discussion HIV-1 DNA in blood monocytes It is well established that HIV-1 can replicate in tissue macrophages, and that the virus strain most commonly found in these long-lived cells is not cytopathic, therefore, macrophages can serve the function of HIV-1 reservoir. Infection of macrophages has also been held responsible for CNS pathogenesis. A topic less well agreed upon concerns the presence of HIV-1 in the macrophage precursor cells, namely, blood monocytes. Some authors have reported undectable to low level infection of these cells in adults (116, 124) although others claim that virus is present in approximately 75% of cells (9) In many instances, it is unclear how pure was the population of monocytes assayed; residual infected CD4"^ T lymphocytes could account for detection of HIV-1 in selected monocytes (11) Furthermore, although several researchers approached infection of monocytes in adult individuals with a variety of symptoms and under different therapeutic regimens, the field is still open in respect to monocyte infection in the pediatric population. Most studies involving children assayed susceptibility of cord

PAGE 131

blood or neonatal monocytes to HIV-1 infection in culture (98, 185) In view of the contradictory reports regarding monocyte infection and the unexplored issue about the presence of HIV-1 in pediatric monocytes, we performed an extensive analysis to elucidate this subject. For most instances, significant levels of HIV-1 DNA could not be detected in monocytes from our cohort. These results are in agreement with Massari et al (116) who detected HIV sequences by PGR only in 2 out of 53 adult blood samples analyzed, in contrast to 53/53 PCR-positive T lymphocytes. The isolation technique used and most important, the ability to check for T cell contamination in the monocyte fraction, provide strength to our data. The technique we used to separate monocytes was based on the expression of CD14 surface antigen by these cells. If this molecule is downregulated by HIV-1 infection, a possible explanation for our results would be a biased selection of uninfected cells. This does not seem to be the case. Previous work showed that in the contrary, expression of membrane -bound CD14 on peripheral blood monocytes was significantly increased during the course of HIV infection, and in all stages of disease (137) Data from our laboratory showed no difference of CD14 expression in monocytes from infected versus uninfected individuals, by flow cytometry analysis. Some studies have reported a variation in the detection of HIV-1 by gag and env primers, and inefficiency to amplify

PAGE 132

125 LTR sequences in monocytes (96, 124). Our PGR assay is sensitive to the level of detection of 1-5 copies of HIV-1 with both env and gag-pol primers. Two sets of primers were employed for amplification in 12/66 samples (18.2%), and either gag-pol (20/66, 30.3%) or env (34/66, 51.5%) primers were used randomly in the remaining cases. In addition, in 8/66 (12%) samples a third set of primers was used which would detect strong-stop DNA, in case of latent infection of these cells An important issue to deal with is the fact that in 21/66 samples analyzed,
PAGE 133

immediately after collection, and rarely within a maximum of 24 hours, previously the samples were not processed within this time frame. Sometimes, 2-3 days would elapse before sample processing started. One could argue that the differentiation process could have initiated in these monocytes as blood waited to be separated, therefore causing these cells to become susceptible and eventually infected by HIV-1 Inconclusive results were attributable to other samples, when viral load in monocytes was only 2-10 fold lower than in CD4+ T lymphocytes. Samples from MEST at 31 months of age and HAST (mother) were processed during the same time as the samples from 2 neonates who had detectable virus in monocytes. Although contamination of monocytes by 004"^ T lymphocytes could account for viral amplification, same reasoning as for the 2 neonates would apply. V^8 analysis could not be performed in the samples from DEWA at 21.5 months of age, and JOLE 7.6 years old. Therefore, the possibility of T cell contamination could not be ruled out. Samples from the same patients analyzed before and after this date indicated that their monocytes do not harbor HIV. Blood sample from SHFI at 44 months of age was not analyzed for TCR sequences. Two previous samples from the same patient had undetectable HIV-1 DNA in monocytes, which would suggest the likeliness of uninfected cells. However, this is one of the two patients who previously had virus detected in monocytes as a neonate. A

PAGE 134

definite conclusion, therefore, can not be made at this time about infection of this patients' monocytes. In the case of JASM at 7.8 years of age and TEBU (mother), detection of V^8 sequences in their monocytes and inability to amplify strongstop DNA in the same samples, suggest that these cells are not infected. It is relevant to mention that preliminary studies in our laboratory were able to detect macrophagetropic viruses in a fraction of patients from this cohort. Although still premature to make final conclusions, it appears that virus with this phenotypic characteristic is present in CDA'^ T lymphocytes, and can exist in the absence of peripheral blood monocyte infection. In conclusion, based on the strong evidence from this study, we conclude that peripheral blood monocytes are not a main reservoir of HIV-1 in the pediatric population and their mothers. These results are important for therapeutic and vaccine development, in the respect that 004"^ T lymphocytes are the major infected cell type and virus reservoir in PBMC, and should be the main target in the combat of HIV-1. Infection of CD4"^ T lymphocytes We performed detailed studies in HIV-1 infected children prospectively followed from birth or analyzed cross-sectionally We noticed two patterns of disease development in vertically infected children followed from birth. In one group peak levels of viremia were reached in the first few months of life (around 3 months of

PAGE 135

128 age) while the other infants did not reach peak vireraia until close to 1 year of age. Peak levels of viremia could be as high in the slow as in the rapid progressors. Peak viremia was reached abruptly, was of short duration, and also dropped abruptly in rapid progressors. The same fast decline was observed in slow progressors, however, we can not comment on the pattern of the slope before reaching the peak, since these children many times returned to our clinic only around 6-8 months of age. Passed the acute phase of infection, levels of cell -associated virus were downmodulated to similar extent in both groups. Interestingly, comparison of viral burden in CDA'*' T lymphocytes between patients of the same age, did not differ among the groups, whether slow or rapid progressors, or symptomatic or nonsymptomatic (children who were evaluated cross-secionally) These results differ from a previous study, where symptomatic children had an average 20-fold higher frequency of infected CD4'^ T cells (48) It is possible that the new therapeutic approaches, including the use of protease inhibitors, combination antiviral drugs, and early start of treatment, could account for the low level of intracellular viral load in sicker children. We also did not see a different pattern of detection of free virus in the plasma of these patients, according to p24 antigen measurement. Different than viral burden, children with rapid development of disease always had significantly lower CD4 counts, from birth to 6 years of age. Although signs of

PAGE 136

immunosuppression were detected soon after birth in these patients, they were asymptomatic during the first 6 months of life, like the slow progressors. Symptoms usually developed before 1 year of age in the rapid progressors, while children in the other group were asymptomatic until they turned 2 years old. From 2-6 years of age, the 2 groups were similar in this respect The 5 slow progressors were PGR negative at the time of birth, while 5/6 rapid progressors were infected in utero. Timing of infection, therefore, correlated to the pattern of disease progression. A likely explanation is that children infected perinatally have a more mature and competent immune system, resulting in better control of infection. CD4 counts were also lower in symptomatic children between 6 and 13 years of age; no difference was detected between children 2 to 6 years of age, who were analyzed cross-sectionally We expected to find similar results in this group to the observed in patients followed longitudinally from birth, of the same age. Because there was only 1 sample from asymptomatic children in the cross-sectional analysis, this result may not reflect a good representation of the group. Although we can not draw any conclusion about the degree of CTL (cytotoxic T lymphocyte) response in these patients, CDS counts were similar in both slow and rapid progressors throughout this study, except for the period of 13-24 months, when CD8s were lower in rapid progressors. When symptomatic and nonsymptomatic children 6-

PAGE 137

130 13 years of age were compared, a significant difference was detected in the levels of CDS cells. These results are similar to what is observed in infected adults in respect to disease development, where a decrease in CDS cells is only apparent during the final stages of disease. We extended our analysis into determining which subpopulation of CD4'^ T lymphocytes is preferentially infected in pediatric patients. As seen in adult individuals (168) the CD45RO memory T cells consist the main virus reservoir in children older than 2 years of age. However, CD45RA and CD45RO may be equally infected in infants. At this age, around 80% of the lymphocytes belong to the naive subtype. Furthermore, high levels of viral replication are taking place in these children, before they enter the chronic stage of disease. An association of these factors could explain why naive cells, even if less susceptible to HIV-1, may still be infected to the same extent as the CD45RO lymphocytes.

PAGE 138

CHAPTER 5 CONCLUSION V • < : 'f \:The AIDS epidemic represents one of the greatest medical challenges in human history and still, education is the onlymeans to effectively control the disease. Although the threat that HIV imposes to women's health is high, the impact of HIV infection on the female population is perhaps the most inadequately studied aspect of the epidemic. In sub-Saharan Africa, women comprise 50% of the AIDS cases, and in the United States, infection among women shows the greatest increase in reported cases of AIDS (60) Relatively little has been published about the medical, psychological, and social consequences of HIV disease in women. Small numbers of HIVinfected women have been involved in clinical trials. The risks and benefits of therapeutic interventions are mainly concluded from studies in the male population, and may not be applicable to women. Most HIV-infected women are of childbearing age, and the number of children affected by this disease continues to grow, to an estimated number of 10 million cases worldwide by the year 2000. The aims of my study were to analyze with precision specific aspects of mother and child HIV-1 disease, including the role of blood monocytes in maternal-fetal HIV-1 infection.

PAGE 139

132 and effect of cell-associated viral load in transmission and development of pediatric disease. Maternal transmission of HIV-1 Approximately 85% of women with AIDS are at childbearing age (28) therefore, as the number of HIV infection in women rises, so does the number of infected infants. Multiple factors are associated with vertical transmission of the virus, of both maternal and fetal origin. A clear relationship exists between transmission and immunological state of the mother, biological characteristics of the virus, and obstetrical factors. Immunological status is altered bypregnancy, reflected by a change in lymphocyte response to antigens and in a decrease in both relative and absolute CD4"^ T cell counts. It is not entirely clear, however, in what manner T cell function is compromised in pregnancy. Factors that may contribute to the immunosuppression of pregnancy are increased levels of total steroids and other pregnancy specific hormones, like human chorionic gonadotrophin. Although it has not been demonstrated, these effects could potentially lead to a faster progression of disease in the pregnant woman. However, nowadays most infected pregnant women are asymptomatic and they learn about their HIV status as part of routine pregnancy screening tests. Besides, the majority of infected mothers receive treatment to prevent transmission. These factors could explain why exacerbation of disease during

PAGE 140

133 pregnancy is not noticeable, when compared to non-pregnant infected women. This study addressed several aspects of maternal and fetal clinical and virological status, and their association with vertical transmission of HIV-1. Influence of maternal age, race, mode of delivery, levels of CD4+T lymphocytes and CD4 to CDS ratios in transmission were analyzed. Study of these characteristics in the absence of antiviral therapy revealed results concordant to previously published data, where lower CD4 counts were associated with increased risk of transmission. We further extended our analysis into examining the effect of viral load in transmission. Few studies have addressed this issue. Maternal plasma RNA levels, measured by quantitative competitive PGR, are significantly related to the chances of an infected woman transmit HIV-1 to her child, according to one group's report (64) Another group, using the same assay, reported no effect of high viral load in transmission (95) Studies on the influence of plasma viremia according to levels of maternal p24 antigen, have shown contradictory results (95, 119, 163) In our analysis, there was a significant positive relationship between transmission and detectable levels of antigenemia. Our analysis revealed a direct association between cell-associated viral load and transmission of HIV-1 to the child. Similar results were also obtained in studies performed by another group (155) These results are important because it has not yet been established

PAGE 141

134 how maternal transmission to the child takes place, if through cell-free or cell -associated virus, or by both means. Our study establishes that the major factors in vertical transmission of HIV-1 are, without doubt, maternal viral load and CD4 counts. As reported by the ACTG protocol 076 study group (36) in our cohort there was a similar reduction in maternal -infant transmission of HIV-1 with the use of ZDV. Because it is unclear how ZDV causes such an impact in maternal transmission of HIV-1, we evaluated the effect of ant iretroviral therapy in maternal proviral load, and its correlation with vertical transmission. We expected to find that ZDV associated decrease in transmission was a consequence of the reduction in viral load. Surprisingly, this was not the case. In treated mothers, transmission occured independent of the the level of maternal virus This study defines several aspects of the pathogenesis of mother-to-child transmission of HIV-1, and it can have a major impact in prevention of transmission. Maternal proviral load should be used as a marker of risk of transmission in the absence of therapy. This is very important in third world countries, where ZDV therapy is not readily available to the general population. Pregnant women with high proviral load should preferentially receive treatment, since the risk of transmission in this group (80%) is significantly higher than

PAGE 142

135 in women with less than 100 proviral copies per million CD4"^ T cells (23%) It was also clear from this work that ZDV does not affect the level of viremia in infected pregnant women. It is a crucial issue to determine how the drug acts so that more efficient therapy regimens can be available. Many issues are still unresolved in maternal -fetal transmission of HIV-1. So much is known about HIV but still the most important points, which include prevention of transmission and cure of infection, stay a puzzle. Future directions This work does not stop here. At the completion of my PhD I will return to Brazil and continue research in this field. Among the "unsolved mysteries" of vertical transmission of HIV-1, there is a question concerning transmission in poor countries, where factors like protein deficiency, parasitic infections and tropical diseases, could play a role in the risk of a mother transmitting infection to her child. Although some studies have been conducted in African countries, very little is known of this subject in South America, specifically in Brazil. Importance of studying the population of infected women in Brazil is as follows: (1) Brazil is a large country, about the size of the United States, and it ranks second in the total number of AIDS cases in the world. (2) The principal viral subtype detected in Brazil, clade B, although the same as the primary American subtype, is different in amino acid

PAGE 143

136 sequences of the V3 loop, the major neutralizing domain. Another subtype is also detected in Brazil, clade F, which is also present only in Romania. How the changes in the amino acid sequence of subtype B, and subtype F affect the risk of vertical transmission of HIV-1 has not been studied. (3) Because in the United States and Europe most infected pregnant women take ZDV according to the ACTG 076 protocol to prevent transmission to the child, trials can not be conducted to determine which one of the 3 arms of the therapy affects maternal transmission. In countries like Brazil, the high price of intravenous ZDV makes the drug inaccessible to the general population, and variations of ZDV therapy are begining to be put in place. Results of these trials will be important for identifying the mechanism of action of ZDV in the reduction of vertical transmission. (4) Infection of the child can occur through breast-feeding. Although it is recommended that HIV-infected mothers do not breast-feed their infants in the United States and Europe, in third world countries the issue is not so easy to deal with. Mortality for non-breastfed infants is 2 to 5 times higher than for breast-fed infants in developing countries Therefore, suppressing breast-feeding for all infants born to HIV-l-seropositive mothers could cause a marked increase in overall infant mortality. Undoubtedly, this additional factor in vertical transmission of HIV-1 in Brazil will be important to be investigated.

PAGE 144

HIV-1 Infection of Blood CD14"^ Monocytes and CD4"^ T Lymphocytes The second part of this study foccused on clinical and virological markers of progression of pediatric HIV-1 infection. Early recognition and treatment of pediatric HIV infection has affected its clinical course. Although the onset of clinical manifestations of HIV in vertically infected children varies, it is estimated that in over 80% of cases these children will have signs of disease before 36 months of age (61, 141) Children who acquire the infection from their HIV-positive mothers seem to fall into two distinct categories, according to progression of disease. One group will have early presentation of HIV disease, quick progress, and opportunistic infections are the major cause of death in this population. An earlier study (1989) reported that the median survival time for children in whom symptoms of clinical disease appeared before 1 year of age was 24.8 months, while in children who were asymptomatic, the median survival was 6 years (176) A more recent study detected a median survival of 8 years in asymptomatic children (193) We followed longitudinally from birth children who were vertically infected with HIV-1, to evaluate factors that affected development of disease in view of the more aggressive therapeutic intervention that is being used nowadays. Our first goal was to determine with certainty the role of blood monocytes in acute infection and in disease outcome. We

PAGE 145

138 developed a highly sensitive method to determine the level of purity of selected monocytes. This step was crucial in our investigation because of the highly controversial issue of monocyte susceptibility to HIV-1 infection. After extensive and detailed analysis we determined that monocytes do not comprise a major virus reservoir at any stage of disease in vertically infected children or in their mothers. These results have important implications in the immunopathogenesis of HIV transmission and disease evolution. Until now, monocytes were believed to be the primary cells involved in maternal fetal transmission of HIV-1, based on in vitro experiments which showed cord blood and neonatal monocytes as more susceptible to infection than both adult cells and the child's T cells (98, 185) This finding helps to clarify the issue of monocyte infection and establishes that 004"^ T lymphocyte should be the main target in the combat of HIV-1 transmission, since the role of blood monocytes, if any, is not significant. We also studied the pattern of disease development in these children. Most studies detected a direct correlation between the severity of disease presentation and the status of the child at birth, determined by HIV-1 culture or PGR. We classified our population primarily based on progression of disease, because sensitivity of PGR can vary in different laboratories. For example, we reclassified 2 children as PGR

PAGE 146

' '139 positive at birth, different from the clinical laboratory where no virus was detected in their blood at the same date. Five of the 6 rapid progressors had a positive PGR at birth, and all 5 slow progressors were negative by PGR when they were born. Rapid progressors showed signs of immunosuppression and disease symptoms early on, usually before the first year of life, in contrast to the group which was asymptomatic until 2 years of age. From 2 to 6 years of age, there was no difference in the stage of disease between the rapid and slow progressor groups. These results are extremely important because they demonstrate that although rapid progressors are more prone to acquire infections and develop AIDS faster, the improved therapeutic regimens are expanding the life span of these children significantly, to the extent that when they reach 2 years of age the outcome is equal in both groups. Therapy is very effective in sicker patients. However, it can not be concluded from this study that if treatment were to be started early in the slow progressors, even in the absence of symptoms, disease development and expectancy of life would improve in these children. In our study population, only one patient, a rapid progressor, deceased while being followed. The study in older children comprised of cross -sectional and longitudinal observations in patients not followed from birth. In the group of children 6-13 years of age, there were only 2 asymptomatic children. One of these children was

PAGE 147

140 infected with contaminated blood product at birth while the other one, who was vertically infected, was a long-term survivor whose mother was also classified this way. These results suggest that the majority of children £ 6 years of age present symptoms, independent of disease progression during the first 2 years of life. Since survival in infected children has improved dramatically during infancy, our goal should be to expand the life span of children who are entering adolescence. Perhaps with early therapeutic intervention, not only for symptomatic children but also in pediatric patients still free of signs of disease, the goal of providing both groups with longer and better life could be reached. Future directions We have shown that blood monocytes are not a main reservoir of HIV-1. However, to exclude the possibility that our population was different from patients enrolled in other studies, where researchers detected significant levels of virus in monocytes, additional analysis is being performed in our laboratory. Viruses from several individuals of different age and disease stage are being cultured and phenotyped. Preliminary results suggest that macrophage -tropism is a characteristic present in virus from some of our patients. The number of individuals analyzed so far is small for a definitive conclusion. However, we can conclude that macrophage-tropism is a characteristic which can be observed even in the absence of monocyte infection in vivo.

PAGE 148

141 Cell-tropism has been linked to the envelope region of HIV-1. To further analyze this aspect, amplification products of the env gene will be cloned and sequenced. Because we detected viruses with the macrophagetropic phenotype in our population, we also expect to identify clones which genotypically express these traits. Although we did not exam tissue samples from these patients, it is well established that macrophages are infectable. Chronically infected macrophages release only low levels of mature virus progeny in vitro, and these cells are relatively resistant to HIV-1 -induced cytopathic effects. The ability to sustain low-level persistent infection while harboring large numbers of virus particles has led many researchers to suggest that macrophages serve as virus reservoirs for the persistence and dissemination of HIV in vivo. Development of antiviral therapy formulated to target cells of the macrophage lineage should be a primary goal of drug industries. The impact on life span of HIV-1 infected individuals should be immense. • Follow up of children longitudinally characterized in this study will continue, to evaluate with more precision disease outcome later in childhood. Life expectancy in view of improved current therapy will be evaluated. Another aspect that should be investigated in infected children involves the study of V^ families of T cell receptors (TCR) We used the V^8 family as a way to identify T cell

PAGE 149

142 contamination within selected monocytes, because in the normal population this family is highly represented in peripheral blood (53, 194). Unexpectedly, V^8 frequently corresponded to <1% of the total CD4+ T cells of HIV-1 infected children. Recently it was reported that HIV-1 DNA is found specifically concentrated in a small subset (l%-2%) of CD4 T cells in many infected patients (50) This subset expressed T cell antigen receptors using the V^12 gene segment. In addition, HIV-1 replication occured preferentially in V^12 T cells, as compared with 11 other V^ subsets, including V^8, from normal fresh peripheral blood mononuclear cells. Both genetic background and the environment can modulate V^ gene expression. In children vertically infected with HIV-1, encounter of thymocytes with the viral antigen occurs early in the developmental stage, which could impact T cell receptor expression. It will be interesting to determine in children if specific V^ families are preferentially infected by HIV-1, and how an early viral exposure (in utero) would affect expression of Vg subsets V y I. „ -t

PAGE 150

REFERENCE LIST 1. Abbas, A. K., A. H. Lichtman, and J. S. Pober. 1991. Molecular basis of T cell antigen recognition and activation. In Abbas, A. K. A. H. Lichtman, and J. S. Pober (eds) Cellular and molecular immunology, W. B. Saunders Company, Philadelphia, PA. 2. Ahmad, N. B. M. Baroudy, R. C. Baker, and C. Chappey. 1995. Genetic analysis of human immunodeficiency virus type 1 envelope V3 region isolates from mothers and infants after perinatal transmission. J. Virol. 69:10011012 3. AIDS 90 siiinmary. A practical synopsis of the VI international conference. June 20-24, 1990, San Francisco. Philadelphia Sciences Group, Richmond, VA. 4. Aleixo, L. F., M. M. Goodenow, and J. W. Sleasman, 1995. Molecular analysis of highly enriched populations of Tcell -depleted monocytes. Clin. Diagn. Lab. Immunol. 2:733-739. 5. Aleixo, L. F., M. M. Goodenow, and J. W. Sleasman. 1996. Zidovudine administered to HIV-1 infected women and their neonates reduces pediatric infection independent of an effect on levels of maternal virus. Submitted. 6. Amadori, A., A. De Rossi, C. Giaquinto, G. FaulknerValle, F. Zacchello, and L. Chieco-Bianchi 1988. In vitro production of HIVspecific antibody in children at risk of AIDS. Lancet 11:852-854. 7. Baba, T. W. Y. S. Jeong, D. Penninck, R. Bronson, M. F. greene, and R. M. Ruprecht. 1995. Pathogenicity of live, attenuated SIV after mucosal infection of neonatal macaques. Science 267:1820-1825. 143

PAGE 151

144 8. Bacchetti, P., and A. R. Moss. 1989. Incubation period of AIDS in San francisco. Nature 338:251-253. 9. Bagasra, O., and R. J. Pomerantz. 1993. Human immunodeficiency virus type 1 provirus is demonstrated in peripheral blood monocytes in vivo: a study utilizing an in situ polymerase chain reaction. AIDS Res. Hum. Retroviruses 9:69-76. 10. Barre-Sinoussi, F., J.-C. Chermami, F. Rey, M. T. Nugeyre, S. Chamaret, C. Dauguet, C. Axler-Blin, F. Vezinet-Brun, C. Rouzioux, W. Rozer)a\am, and L. Montagnier. 1983. Isolation of a T-lymphotropic retrovirus from a patient at risk for acquired immune deficiency syndrome (AIDS). Science 220:868-871. 11. Bennett, S., and S. N. Breit. 1994. Variables in the isolation and culture of human monocytes that are of particular relevance to studies of HIV. J. Leukoc Biol. 56:236-240. 12. Blanche, S., M.-J. Mayaux, C. Rouzioux, J. -P. Teglas, G. Firtion, F. Monpoux, N. Ciraru-Vigneron, F. Meier, J. Tricoire, C. Courpotin, E. Vilmer, C. Griscelli, J.-F. Delfraissy, and the French Pediatric HIV Infection Study Group. 1994. Relation of the course of HIV infection in children to the severity of the disease in their mothers at delivery. N. Engl. J. Med. 330:308-312. 13. Blanche, S., C. Rouzioux, M.-L. G. Moscato, F. Veber, M.~ J. Mayaux, C. Jacomet, J. Tricoire, A. Deville, M. Vial, G. Firtion, A. de Crepy, D. Douard, M. Robin, C. Courpotin, N. Ciraru-Vigneron, F. le Deist, C. Griscelli, and the HIV Infection in Newborns French Collaborative Study Group. 1989. A prospective study of infants born to women seropositive for human immunodeficiency virus type 1. N. Engl. J. Med. 320:1643-1648. 14. Blomberg, R. S., and R. T. Schooley. 1985. Lymphocyte markers in infectious diseases. Semin. Hematol 22:81114 15 Borkowsky, W. K. Krasinski, H. Pollack, W. Hoover, A. Kaul, and T. Ilmet-Moore 1992. Early diagnosis of human immunodeficiency virus infection in children <6 months of

PAGE 152

145 age: comparison of polymerase chain reaction, culture, and plasma antigen capture techniques. J. Infect. Dis. 166 : 616-619 16. Bour, S., U. Schubert, and K. Strebel. 1995. The human immunodeficiency virus type 1 Vpu protein specifically binds to the cytoplasmic domain of CD4 : implications for the mechanism of degradation. J. Virol. 69:1510-1520. 17. Bozzette, S. A., J. A. McCutchan, S. A. spector, B. Wright, and D. D. Richman. 1993. A cross-sectional comparison of persons with syncytiumand non-syncytiuminducing human immunodeficiency virus. 168:13 74-13 79. 18. Braun, D. P., H. Kessler, L. Falk, D. Paul, J. E. Harris, B. Blaauw, and A. Landlay. 1988. Monocyte functional studies in asymptomatic, human immunodeficiency virus (HIV) -infected individuals J. Clin. Immunol. 8:486-494. 19. Bredberg-Raden, U. W. Urassa, E. Urassa, E. Lyamuya, G. Msemo, G. Kawo, T. Kazimoto, A. Massawe, O. Grankvist, E. Mbena, K. Karlsson, F. Mhalu, and G. Biberfeld. 1995. Predictive markers for mother-to-child transmission of HIV-1 in Dar es Salaam, Tanzania. J. Acquir. Immune Defic. Syndr. Hum. Retrovirol 8:182-187. 20. Brossard, Y., J.-T. Aubin, L. Mandelbrot, C. Bignozzi, D. Brand, A. Chaput, J. Roume, N. Mulliez, F. Mallet, H. Agut, F. Bar in, C. Brechot, A. Goudeau, J.-M. Huraux, J. Barrat, P. Blot, J. Chavinie, N. Ciraru-Vigneron, P. Engelman, F. Herve, E. Papiernik, and R. Henrion. 1995. Frequency of early in utero HIV-1 infection: a blind DNA polymerase chain reaction study on 100 fetal thymuses. AIDS 9:359-3120. t.^ • "' n 21. Brustle, 0., H. Spiegel, S. L. Leib, T. Finn, H. Stein, P. Kleihues, and O. D. Wiestler. 1992. Distribution of human immunodeficiency virus (HIV) in the CNS of children with severe HIV encephalopathy. Acta Neuropathol 84:2431 22. Burgard, M., M.-J. Mayaux, S. Blanche, A. Ferroni, M.-L. Guihard-Moscato, M.-C. Allemon, N. Ciraru-Vigneron, G. Firtion, C. Floch, F. Guillot, E. Lachassine, M. Vial, C. Griscelli, C. Rouzioux, and the HIV Infection in Newborns

PAGE 153

146 French Collaborative Study Group. 1992. The use of viral culture and p24 antigen testing to diagnose human immunodeficiency virus infection in neonates N. Engl. J. Med. 327:1192-1197. 23. Butler, K. M., R. N. Husson, F. M. Balis, P. Brouwers, J. Eddy, D. el-Amin, J. Gress, M. Hawkins, P. Jarosinski, H. Moss, D. Poplack, S. Santacroce, D. Venzon, L. Wiener, P. Wolters, and P. A. Pizzo. 1991. Dideoxyinosine (ddl) in symptomatic HIV-infected children: a phase I-II study. N. Engl. J. Med. 324:137-144. 24. Calvo, F., P. M. Martin, N. Jabrane, P. De Cremoux, and H. Magdelenat. 1987. Human breast cancer cells share antigens with the myeloid monocyte lineage. Br. J. Cancer 56:15-19. 25. Cao, Y.,D. D. Ho, J. Todd, R. Kokka, M. Urdea, J. D. Lifson, M. Piatak, Jr., S. Chen, B. H. Hahn, M. S. Saag, and G. M. Shaw. 1995. Clinical evaluation of branched DNA signal amplification for quantifying HIV type 1 in human plasma. AIDS Res. Hum. Retroviruses 11:353-361. 26. Capsoni, F., F. Minonzio, A. M. Ongari, G. P. Rizzardi, A. Lazzarin, and C. Zanussi. 1992. Monocyte -derived macrophage function in HIV-infected subjects: in vitro modulation by rIFN-7 and rGM-CSF. Clin. Immunol. Immunopathol 62:176-182. 27. Centers for Disease Control. 1982. Unexplained immunodeficiency and opportunistic infections in infants: New York, New Jersey, California. MMWR 31:665-667. 28. Centers for Disease Control. 19 90. AIDS in women. MMWR 39:845-846 29. Centers for Disease Control. 1991. Guidelines for prophylaxis against Pneumocystis carinii pneumonia for children infected with human immunodeficiency virus. JAMA 265:1637-1644 30. Centers for Disease Control 1992. Revised classification system for HIV infection and expanded surveillance case

PAGE 154

147 definition for AIDS among adolescents and adults. MMWR 41:1-19 31. Centers for Disease Control. 1994. 1994 Revised classification system for human immunodeficiency virus infection in children less than 13 years of age. MMWR 43 :1-10 32. Cheng-Mayer, C, M. Quiroga, J. W. Tiing, D. Dina, and J. A. Levy. 1990. Viral determinants of human immunodeficiency virus type 1 T-cell or macrophage tropism, cytopathogenicity and CD4 antigen modulation. J. Virol. 64:4390-4398. 33. Chin, J. 1990. Current and future dimension of the HIV/AIDS pandemic in women and children. Lancet 336:221224 */'.' -4;" 34. Clark, A. G., M. Holodniy, D. H. Schwartz, D. A. Katzenstein, and T. C. Merigan. 1992. Decrease in HIV provirus in peripheral blood mononuclear cells during zidovudine and human rIL-2 administration. J. Acquir. Immune Def. Syndr. 5:52-59. 35. Clerici, M. A. V. Sison, J. A. Berzofsky, T. A. Rakusan, C. D. Brandt, M. Ellaurie, M. L. Villa, C. Colie, D. J. Venzon, J. L. Sever, and G. M. Shearer. 1993. Cellular immune factors associated with mother-to-child transmission of HIV. AIDS 7:1427-1433. 36. Connor, E. M., R. S. Sperling, R. Gelber, P. Kiselev, G. Scott, M. J. O' Sullivan, R. VanDyke, M. Bey, W. Shearer, R. L. Jacobson, E. Jimenez, E. O'Neill, B. Bazin, J.-F. Delfraissy, M. Culnane, R. Coombs, M. Elkins, J. Moye, P. Stratton, and J. Balsley, for the Pediatric AIDS Clinical Trials Group Protocol 076 Study Group. 1994. Reduction of maternal -infant transmission of human immunodeficiency virus type 1 with zidovudine treatment. N. Engl. J. Med. 331:1173-1180. 37. Connor, R. I., B. K. Chen, S. Choe, and N. R. Landau. 1995. Vpr is required for efficient replication of human immunodeficiency virus type-1 in mononuclear phagocytes. Virology 206:935-944.

PAGE 155

148 38. Connor, R. I., and D. D. Ho. 1994. Human immunodeficiency virus type 1 variants with increased replicative capacity develop during the asymptomatic stage before disease progression. J. Virol. 68:4400-4408. 39. Conti, L., S. Lieb, T. Spradling, and J. J. Witte. 1993. AIDS epidemic among Florida women. J. Fla. Med. Assoc. 80:246-249 40. Curran, J. F., H. W. Jaffe, A. M. Hardy, W. M. Morgan, R. M. Selik, and T. J. Dondero. 1988. Epidemiology of HIV infection and AIDS in the United States. Science 239:610616 41. Datta, P., J. E. Embree, J. K. Kreiss, J. 0. NdinyaAchola, M. Braddick, M. Temmerman, N. J. D. Nagelkerke, G. Maltha, K. K. Holmes, P. Plot, H. O. Pamba, and F. A. Plummer. 1994. Mother-to-child transmission of human immunodeficiency virus type 1: report from the Nairobi study. J. Infect. Dis. 170:1134-1140. 42. Davis, B. R., D. H. Schwartz, J. C. Marx, C. E. Johnson, J. M. Berry, J. Lyding, T. C. Merigan, and A. Zander. 1991. Absent or rare human immunodeficiency virus infection of bone marrow stem/progenitor cells in vivo. J. Virol. 65:1985-1990. 43. De Mulder, P. H. M., J. M. C. Wessels, D. A. Rosenbrand, J. B. J. M. Smeuders, D. J. T. Wagener, and C. Haanen. 1981. Monocyte purification with counterflow centrif ugation monitored by continuous flow cytometry. J. Immunol. Methods 47:31-38. 44. De Rossi, A., L. Ometto, C. Zanotto, F. Salvatori, S. Masiero, F. Mammano, andL. Chieco-Bianchi 1994. Motherto-child HIV-1 transmission: quantitative assessment of viral burden as a diagnostic tool and prognostic parameter in HIV-l-inf ected children. Acta Paediatr. Suppl. 400:25-28. 45. De Rossi, A., M. Pasti, F. Mammano, L. Ometto, C. Giaquinto, and L. Chieco-Bianchi. 1991. Perinatal infection by human immunodeficiency virus type 1 (HIV-1) : relationship between proviral copy number in vivo, viral

PAGE 156

149 properties in vitro, and clinical outcome. J. Med. Virol. 35:283-289 46. Dennny, T., R. Yogev, R. Gelman, C. Skuza, J. Oleske, E. Chadwick, S.-C. Cheng, and E. Connor. 1992. Lymphocyte subsets in healthy children during the first 5 years of life. JAMA 267 : 1484-1488 47. Desrosiers, R. C. 1990. The simian immunodeficiency viruses. Annu. Rev. Immunol. 8:557-578. 48. Dickover, R. E., M. Dillon, S. G. Gillette, A. Deveikis, M. Keller, S. Plaeger-Marshall I. Chen, A. Diagne, E. R. Stiehm, and Y. Bryson. 1994. Rapid increases in load of human immunodeficiency virus correlate with early disease progression and loss of CD4 cells in vertically infected infants. J. Infect. Dis 170:1279-1284. 49. Dickover, R. E., E. M. Garratty, S. A. Herman, M.-S. Sim, S. Plaeger, P. J. Boyer, M. Keller, A. Deveikis, E. R. Stiehm, and Y. J. Bryson. 1996. Identification of levels of maternal HIV-1 RNA associated with risk of perinatal transmission. Effect of maternal zidovudine treatment on viral load. JAMA 275:533-605. 50. Dobrescu, D., S. Kabak, K. Mehta, C. H. Suh, A. Asch, P. U. Cameron, A. S. Hodtsev, andD. N. Posnett. 1995. HIV-1 reservoir in CD4+ T cells is restricted to certain V^ subsets. Proc. Natl. Acad. Sci USA 92:5563-5567. 51. Douglas, G. D., and B. F. King. 1992. Maternal fetal transmission of human immunodeficiency virus: a review of possible routes and cellular mechanisms of infection. Clin. Infect. Dis. 15:678-691. 52. Douglas, S. D. 1994. Immunological and virological clues for mother-to-child transmission of HIV-1 and HIV-2. JAMA 272 :487-488 53. Duan, L., J. W. Oakes, A. Ferraro, O. Basgara, and R. J. Pomerantz. 1994. Tat and Rev differentially affect restricted replication of human immunodeficiency virus type 1. Virology 199:474-478.

PAGE 157

150 54. Dulbecco, R. 1988. Oncogenic viruses II: RNA-containing viruses (retroviruses) In Dulbecco, R. and H. S. Ginsberg (eds) Virology, 2nd ed. J. B. Lippincott Company, Philadelphia, PA. 55. Duliege, A.M., C. I. Amos, S. Felton, R. J. Biggar, the International Registry of HIV-Exposed Twins, and J. J. Goedert. 1995. Birth order, delivery route, and concordance in the transmission of human immunodeficiency virus type 1 from mothers to twins. J. Pediatr. 126:625632 56. Duliege, A. M., A. Messiah, S. Blanche, M. Tardieu, C. Griscelli, and A. Spira. 1992. Natural history of human immunodeficiency virus type 1 infection in children: prognostic value of laboratory tests on the bimodal progression of the disease. Pediatr. Infect. Dis 11:630635 57. Diomitrescu, 0., M. L. Kalish, S. C. Kliks, C. I. Bandeas, and J. A. Levy. 1994. Characterization of HIV-1 strains isolated from children in Romania: identification of a new envelope subtype. J. Infect. Dis. 369:283-288. 58. Dunn, D. T., C. D. Brandt, A. Krivine, S. A. Cassol, P. Roques, W. Borkowsky, A. De Rossi, E. Denamur, A. Ehrnst, C. Loveday, J. -A. Harris, K. Mcintosh, A. M. Comeau, T. Rakusan, M.-L. Newell, and C. S. Peckham. 1995. The sensitivity of HIV-1 DNA polymerase chain reaction in the neonatal period and the relative contributions of intrauterine and intra-partum transmission. AIDS 9:F7-F11. 59. Earl, P.L., R. W. Doms, and B. Moss. 1992. Multimeric CD4 binding exhibited by human and simian immunodeficiency virus envelope proteins dimers J. Virol. 66:5610-5614. 60. Ellerbrock, T., and M. Rogers. 1990. Epidemiology of human immunodeficiency virus infection in women in the United States. Obstet Gynecol. Clin. North Am. 17:523544 61. European Collaborative Study. 1991. Children born to women with HIV-1 infection: natural history and risk of transmission. Lancet 337:253-260.

PAGE 158

151 62. European Collaborative Study. 1992. Age-related standards for T lymphocyte subsets based on uninfected children born to human immunodeficiency virus 1infected women. Pediatr. Infect. Dis. J. 11:1018-1026. 63. European Collaborative Study. 1992. Risk factors for mother-to-child transmission of HIV-1. Lancet 339:10071012 64. Fang, G., H. Burger, R. Grimson, P. Tropper, S. Nachman, D. Mayers, O. Weislow, R. Moore, C. Reyelt, N. Hutcheon, D. Baker, and B. Weiser. 1995. Maternal plasma human immunodeficiency virus type 1 RNA level: A determinant and projected threshold for mother-to-child transmission. Proc. Natl. Acad. Sci. USA 92:12100-12104. 65. Farley, J. J., G. Bauer, J. P. Johnson, and G. A. Cole. 1994. Phytohemagglutinininducible p24 in peripheral blood mononuclear cells as a predictor of human immunodeficiency virus type 1 vertical transmission and infant clinical status. Pediatr. Infect. Dis. J. 13:10791082 66. Ferrero, E., C.-L. Hsieh, U. Francke, and S. M. Goyert. 1990. CD14 is a member of the family of leucine-rich proteins and is encoded by a gene syntenic with multiple receptor genes. J. Immunol. 145:331-336. 67. Flo, R. W. A. Naess, A. Nielsen, S. Harthug, and C. O. Solberg. 1994. A longitudinal study of phagocyte function in HIV-infected patients. AIDS 8:771-777. 68. Folks, T. M., D. Powell, M. Lightfoote, S. Koenig, A. S. Fauci, S. Benn, A. Rabson, D. Daugherty, H. E. Gendelman, M. D. Hoggan, S. Venkatesan, and M. A. Martin. 1986. Biological and biochemical characterization of a cloned Leu-3-cell surviving infection with the acquired immune deficiency syndrome retrovirus. J. Exp. Med. 164:280-290. 69. Frenkel, L. M., L. E. Wagner II, L. M. Demeter, S. Dewhurst, R. W. Coombs, B. L. Murante, and R. C. Reichman. 1995. Effects of zidovudine use during pregnancy on resistance and vertical transmission of

PAGE 159

152 human immunodeficiency virus type 1. Clin. Infect. Dis. 20:1321-1326 70. Frost, S. D. W. and A. R. McLean. 1994. Germinal centre destruction as a major pathway of HIV pathogenesis. J. AIDS 7:236-244. 71. Fung, M. S. C, C. R. Y. Sun, W. L. Gordon, R.-S. Liou, T. W. Chang, W. N. C. Sun, E. S. Daar, and D. D. Ho. 1992. Identification and characterization of a neutralization site within the second variable region of human immunodeficiency virus type 1 gpl20. J. Virol. 66 :848-856 72. Funnan, P. A., and D. W. Barry. 1988. Spectrum of antiviral activity and mechanism of action of zidovudine. Am. J. Med. 85 (Suppl 2A):176-181. 73. Gabuzda, D. H., H. Li, K. Lawrence, B. S. Vasir, K. Crawford, and E. Langhoff. 1994. Essential role of vif in establishing productive HIV-1 infection in peripheral blood T lymphocytes and monocytes/macrophages. J. Acquir. Immune Def Syndr. 7:908-915. 74. Gee, A. P., C. Lee, J. W. Sleasman, M. Madden, J. Ugelstad, and D. J. Barrett. 1987. T lymphocyte depletion of human peripheral blood and bone marrow using monoclonal antibodies and magnetic microspheres. Bone Marrow Transplant. 2:155-163. 75. Gelderblon, H. R., M. Ozel, E. H. S. Hausmann, T. Winkel, G. Pauli, and M. A. Koch. 1988. Fine structure of human immunodeficiency virus (HIV) immunolocalization of structural proteins and virus-cell relation. Micron. Microscop. 19:41-60. 76. Gnann, J. W. Jr., J. B. McCormick, S. Mitchell, J. A. Nelson, and M. B. A. Oldstone. 1987. Synthetic peptide immunoassay distinguishes HIV type 1 and HIV type 2 infections. Science 237:1346-1349. 77. Goedert, J. J., A.-M. Duliege, C. I. Amos, S. Felton, R. J. Biggar, and the International Registry of HIV-Exposed

PAGE 160

153 Twins. 1991. High risk of HIV-1 infection for first-born twins. Lancet 338:1471-1475. 78. Goff, S. P. 1990. Integration of retroviral DNA into the genome of the infected cell. Cancer Cells 2:172-178. 79. Goldsmith, M. A., M. T. Warmerdan, R. E. Atchison, M. D. Miller, and W. C. Greene. 1995. Dissociation of the CD4 downregulation and viral infectivity enhancement functions of human immunodeficiency virus type 1 Nef J. Virol. 69:4112-4121. 80. Goodenow, M., T. Huet, W. Saurin, S. Kwok, J. Sninsky, and S. Wain-Hobson. 1989. HIV-1 isolates are rapidly evolving quasispecies : evidence for viral mixtures and preferred nucleotide substitutions. J. Acquir. Immune Defic. Syndr. 2:344-352. 81. Goodenow, M. M. J. W. Sleasman, and S. L. Lamers 1993. Persistence of multiple maternal HIV-1 genotypes in infants infected by perinatal transmission. Vaccines 93 :125-129 82. Greene, W. C. 1991. The molecular biology of human immunodeficiency virus type 1 infection. N. Engl. J. Med. 324:308-317. 83. Grimes, H. L., B. E. Szente, and M. M. Goodenow. 1992. Cski cDNAs are encoded by eight exons, six of which are closely linked within the chicken genome. Nucleic Acid Res. 20:1511-1516. 84. Grunewald, J., C. H. Janson, and H. Wigzell 1991. Biased expression of individual T-cell receptor V gene segments in CD4"^ and CD8'^ human peripheral blood T lymphocytes. Eur. J. Immunol. 21:819-822. 85. Guyader, M., M. Emerman, P. Sonigo, F. Clavel, L. Montagnier, and M. Alizon. 1987. Genome organization and transactivat ion of the human immunodeficiency virus type 2. Nature 326:662-669.

PAGE 161

154 86. Hahn, B. H., G. M. Shaw, M. E. Taylor, R. R. Redfield, P. D. Markham, S. Z. Salahuddin, F. Wong-Staal, R. C. Gallo, E. S. Parks, and W. P. Parks. 1986. Genetic variation in HTLV-III/LAV over time in patients with AIDS or at risk for AIDS. Science 232:1548-1553. 87. Haziot, A., S. Chen, E. Ferrero, M. G. Low, R. Silber, and S. M. Goyert. 1988. The monocyte differentiation antigen, CD14, is anchored to the cell membrane by a phosphat idylinositol linkage. J. Immunol. 141:547-552. 88. Heagy, W. C. Crumpacker, P. A. Lopez, and R. W. Finberg. 1991. Inhibition of immune functions by antiviral drugs. J. Clin Invest. 87:1916-1924. 89. Henderson, L. E., M. A. Bowers, R. C. Sowder II, S. A. Serabyn, D. G. Johnson, J. W. Bess, Jr., L. O. Arthur, D. K. Bryant, and C. Fenselau. 1992. Gag proteins of the highly replicative MN strain of human immunodeficiency virus type 1: posttranslat ional modifications, proteolytic processings, and complete amino acid sequences. J. Virol. 66:1856-1865. 90. Helseth, E., U. Olshevsky, C. Furman, and J. Sodroski. 1991. Human immunodeficiency virus type 1 gpl20 envelope glycoprotein regions important for association with the gp41 transmembrane glycoprotein. J. Virol. 65:2119-2123. 91. Ho, D. D., A. U. Neumann, A. S. Perelson, W. Chen, J. M. Leonard, and M. Markowitz. 1995. Rapid turnover of plasma virions and CD4 lymphocytes in HIV-1 infection. Nature 373:123-373 92. Ho, W.-Z., J. Lioy, L. Song, J. R. Cutilli, R. A. Polin, and S. D. Douglas. 1992. Infection of cord blood monocyte -derived macrophages with human immunodeficiency virus type 1. J. Virol. 66:573-579. 93. Holtrop, S., G. P. M. Ri jke-Schilder W. P. M. Tcunboer, R. A. P. Koene, and W. J. M. Tax. 1992. Removal of monocytes from cell suspensions with anti-CD14 antibody and carbonyl iron, using FcyR-dependent accessory function as a sensitive measure of monocyte presence. J. Immunol. Methods 156:217-222.

PAGE 162

155 94. Hulstaert, F., I. Hannet, V. Deneys, V. Munhyeshuli, T. Reichert, M. De Bruyere, and K. Strauss. 1994. Agerelated changes in human blood lymphocyte subpopulations II. Varying kinetics of percentage and absolute count measurements. Clin. Immunol. Immunopathol 70:152-158. 95. Husson, R. N., Y. Lan, E. Kojima, D. Venzon, H. Mitsuya, and K. Mcintosh. 1995. Vertical transmission of human immunodeficiency virus type 1: autologous neutralizing antibody, virus load, and virus phenotype J. Pediatr. 126:865-871. 96. Innocenti, P., M. Ottmann, P. Morand, P. Leclercq, and J.-M. Seigneurin. 1992. HIV-1 in blood monocytes: frequency of detection of proviral DNA using PGR and comparison with the total CD4 count. AIDS Res. Hum. Retroviruses 8:261-268. 97. Jackson, J. B., P. Kataaha, D. L. Horn, F. Mmiro, L. Guay, C. Ndugwa, L. Marum, E. Piwowar, K. Brewer, G. Toedter, D. Hofheinz, and K. Olness. 1993. jSj-microglobulin, HIV-1 p24 antibody and acid-dissociated HIV-1 p24 antigen levels: predictive markers for vertical transmission of HIV-1 in pregnant Ugandan women. AIDS 7:1475-1479. 98. Kesson, A. M. W. R. Fear, F. Kazazi, J.-M. Mathijs, J. Chang, N. J. C. King, and A. L. Cunningham. 1993. Human immunodeficiency virus type 1 infection of placental macrophages in vitro. J. Infect. Dis. 168:571-579. 99. Kim, S., R. Byrn, J. Groopman, and D. Baltimore. 1989. Temporal aspects of DNA and RNA synthesis during human immunodeficiency virus infection: evidence for differential gene expression. J. Virol. 63:3708-13. 100. Kliks, S. C, D. W. Wara, D. V. Landers, and J. A. Levy. 1994. Features of HIV-1 that could influence maternalchild transmission. JAMA 272:467-474. 101. Lander, B., and S. C. Kemp. 1989. Multiple mutations in HIV-1 reverse transcriptase confer high-level resistance to zidovudine (AZT) Science 246:1155-1158.

PAGE 163

156 102. Lang, W. H. Perkins, R. E. Anderson, R. Royce, N. Jewell, and W. Winkelstein, Jr. 1989. Patterns of T lymphocyte changes with human immunodeficiency virus infection: from seroconversion to the development of AIDS. J. Acquir. Immune Defic. Syndr. 2:63-69. 103. Lea, T., E. Smeland, S. Funderud, F. Vartdal, C. Davies, K. Beiske, and J. Ugelstad. 1986. Characterization of human mononuclear cells after positive selection with immunomagnetic particles. Scand J. Immunol. 23:509-519. 104. Letvin, N. L. 1990. Animal models for AIDS. Immunol. Today 11:322-326. 105. Letvin, N. L., and N. W. King. 1991. Naturally occuring animal models of the acquired immune deficiency syndrome. Am. J. Physiol. Imaging 6:1-15. 106. Levy, J. A. 1994. Antiviral approaches and Overall fetures of HIV pathogenesis; prognosis for long-term survival. In Levy, J. A. (ed) HIV and the pathogenesis of AIDS, ASM Press, Washington, DC. 107. Louwagie, J., E. L. Delwart, J. I. Mullins, F. E. McCutchan, G. Eddy, and D. S. Burke. 1994. Genetic analysis of HIV-1 isolates from Brazil reveals presence of two distinct genetic subtypes. AIDS Res. Hum. Retroviruses. 10:561-567. 108. Luque, F., A. Caruz, J. A. Pineda, Y. Torres, B. Larder, and M. Leal. 1994. Proviral load changes in untreated and zidovudine-treated human immunodeficiency virus type 1infected patients. J. Infect. Dis 169:267-73. 109. Luzuriaga, K., D. Holmes, A. Hereema, J. Wong, D. L. Panicali, and J. L. Sullivan. 1995. HIV-l-specif ic cytotoxic T lymphocyte responses in the first year of life. J. Immunol. 154:433-443. 110. Mackevicz, C, and J. A. Levy. 1992. CDS"" cell anti-HIV activity: non-lytic suppression of virus replication. AIDS Res. Hum. Retroviruses 8:1039-1050.

PAGE 164

157 111. Mammano, F., F. Salvatori, L. Ometto, M. Panozzo, L. Chieco-Bianchi, and A. De Rossi. 1995. Relationship between the V3 loop and the phenotypes of human immunodeficiency virus type 1 (HIV-1) isolates from children perinatally infected with HIV-1. J. Virol. 69:82-92. ^1 112. Marcon, L., and J. Sodroski 1994. gpl2 0Independent ; fusion mediated by the human immunodeficiency virus type • 1 gp41 envelope glycoprotein: a reassessment. J. Virol. 68:1977-1982 113. Martin, N. L., J. A. Levy, H. Legg, P. S. Weintriib, M. J. Cowan, and D. W. Wara. 1991. Detection of infection with human immunodeficiency virus (HIV) type 1 in infants by an anti-HIV immunoglobulin A assay using recombinant proteins. J. Pediatr. 118:354-358. 114. Martin, N. L., J. Rautonen, W. Crombleholme, N. Rautonen, and D. W. Wara. 1992. A screening test for the detection of anti-HIV-1 IgA in young infants. Immunol. Invest. 21:65-70 115. Marx, P. A., Y. Li, N. W. Lerche, S. Sutjipto, A. Gettie, J. A. Yee, B. H. Brotman, A. M. Prince, A. Hanson, R. G. Webster, and R. C. Desrosiers. 1991. Isolation of a simian immunodeficiency virus related to human immunodeficiency virus type 2 from a West African pet sooty mangabey. J. Virol. 65:4480-4485. 116. Massari, F. E., G. Poli, S. M. Schnittman, M. C. Psallidopoulos, V. Davey, and A. S. Fauci. 1990. In vivo T lymphocyte origin of macrophagetropic strains of HIV. Role of monocytes during in vitro isolation and in vivo infection. J. Immunol. 144:4628-4632. 117. Matheson, P. B., E. J. Abrams, P. A. Thomas, M. A. Hernan, D. M. Thea, G. Lambert, K. Krasinski, M. Bamji, M. F. Rogers, M. Heagarty, and the New York City Perinatal HIV Transmission Collaborative Study Group. 1995. Efficacy of antenatal zidovudine in reducing perinatal transmission of human immunodeficiency virus type 1. J. Infect. Dis. 172:353-358.

PAGE 165

158 118. Maury, W. B. J. Potts, and A. B. Rabson. 1989. HIV-1 infection of first-trimester and term human placental tissue: a possible mode of maternal fetal transmission. J. Infect. Dis. 160:583-588. 119. Mayaux, M.-J., S. Blanche, C. Rouzioux, J. Le Chenadec, V. Chambrin, G. Firtion, M.-C. Allemon, E. Vilmer, N. C. Vigneron, J. Tricoire, F. Guillot, C. Courpotin, and the French Pediatric HIV Infection Study Group. 1995. Maternal factors associated with perinatal HIV-1 transmission: the French cohort study: 7 years of followup observation. J. Acquir. Immune Defic. Syndr. Hum. Retrovirol. 8:188-194. 120. McClure, M. 0., M. Marsh, and R. A. Weiss. 1988. Human immunodeficiency virus infection of CD4 -bearing cells occurs by a pHindependent mechanism. EMBO J. 7:513-518. 121. McCune, J. M. Viral latency in HIV disease. 1995. Cell 82:183-188 122. McCvine, J., H. Kaneshima, J. Krowka, R. Namikawa, H. Outzen, B. Peault, L. Rabin, C. C. Shih, E. Yee, M. Lieberman, I. Weissman, and L. Shultz. 1991. The SCID-hu mouse: a small animal model for HIV infection and pathogenesis. Annu. Rev. Immunol. 9:399-429. 123. McElrath, M. J., J. E. Pruett, and Z. A. Cohn. 1989. Mononuclear phagocytes of blood and bone marrow: comparative roles as viral reservoirs in human immunodeficiency virus type 1 infections. Proc Natl. Acad. Sci. USA 86:675-679. 124. McElrath, M. J., R. M. Steimnan, and Z. A. Cohn. 1991. Latent HIV-1 infection in enriched populations of blood monocytes and T cells from seropositive patients. J. Clin. Invest. 87:27-30. 12 5. Mcllroy, D., B. Autran, R. Cheynier, S. Wain-Hobson, J.P. Claulel, E. Oksenhendler P. Debre, and A. Hosmalin. 1995. Infection frequency of dendritic cells and CD4"^ T lymphocytes in spleens of human immunodeficiency virus positive patients. J. Virol. 69:4737-4745.

PAGE 166

159 126. Meltzer, M. S., D. R. Skillman, P. J. Gomatos, D. C. Kalter, and H. E. Gendelman. 1990. Role of mononuclear phagocytes in the pathogenesis of human immunodeficiency virus infection. Annu. Rev. Immunol. 8:169-194. 127. Meltzer, M. S., D. R. Skillman, D. H. Hoover, B. D. Hanson, J. A. Turpln, D. C. Kalter, and H. E. Gendelman. 1990. HIV and the immune system. Macrophages and the human immunodeficiency virus. Immunol. Today 11:217-223. 128. Mesnard, J.-M., and C. Carriere. 1995. Comparison of packaging strategy in retroviruses and paraenteroviruses Virology 213:1-6. 129. Morgado, M. G., E. C. Sabino, E. G. Shpaer, V. Bongertz, L. Brigido, M. D. C. Guimaraes, E. A. Castilho, B. Galvao-Castro, J. M. Mullins, R. M. Hendry, and A. Mayer. 1994. V3 region polymorphisms in HIV-1 from Brazil: prevalence of subtype B strains divergent from North American/European prototype and detection of subtype F. AIDS Res. Hum. Retroviruses 10:569-576. 130. Mosier, D. E., R. J. Gulizia, P. D. Maclsaac, B. E. Torbett, and J. A. Levy. 1993. Rapid loss of CD4+ cells in human-PBL-SCID mice by noncytopathic HIV isolates. Science 260:689-692. 131. Mosier, D. and H. Sieburg. 1994. Macrophagetropic HIV: critical for AIDS pathogenesis? Immunol. Today 15:332339 132. Myers, G. 1991. Analysis. Protein information summary. In G. Myers, J. A. Berzofsky, B. Korber, R. F. Smith, and G. Pavlakis (ed.). Human retroviruses and AIDS 1991. A compilation and analysis of nucleic acid and amino acid sequences. Theoretical Biology and Biophysics, Los Alamos National Laboratory, Los Alamos, N.M. 133. Myers, G., B. Korber, S. Wain-Hobson, R. F. Smith, and G. N. Pavlakis. 1993. Human retroviruses and AIDS 1993, I-V. A compilation and analysis of nucleic acid and amino acid sequences. Los Alamos National Laboratory, Los Alamos, N.M.

PAGE 167

134. Myers, G., K. Maclnnes, and B. Korber. 1992. The emergence of simian/human immunodeficiency viruses AIDS Res. Hum. Retroviruses 8:373-386. 135. Nair, P., L. Alger, S. Hines, S. Seiden, R. Hebel, and J. P. Johnson. 1993. Maternal and neonatal characteristics associated with HIV infection in infants of seropositive women. J. Acquir. Immune Def Syndr. 6:298-302. 136. Neal, T. F., H. K. Holland, C. M. Baum, F. Villinger, A. A. Ansari, R. Saral, J. R. Wingard, and W. H. Fleming. 1995. CD34"^ progenitor cells from asymptomatic patients are not a major reservoir for human immunodeficiency virus-1. Blood 86:1749-1756. 137. Nockher, W. A., L. Bergmann, and J. E. Scherberich. 1994. Increased soluble CD14 serum levels and altered CD14 expression of peripheral blood monocytes in HIV-infected patients. Clin. Exp. Immunol. 98:369-374. 138. Nottet, H. S. L. M. L. de Graaf, N. M. de Vos, L. J. Bakker, J. A. G. van Strijp, M. R. Visser, and J. Verhoef. 1993. Phagocytic function of monocyte -derived macrophages is not affected by human immunodeficiency virus type 1 infection. J. Infect. Dis. 168:84-91. 139. Oka, S., K. Urayama, Y. Hirabayashi, K. Ohnishi, H. Goto, K. Mitamura, S. Kimura, and K. Shimada. 1991. Quantitative estimation of human immunodeficiency virus type-1 provirus in CD4"^ T lymphocytes using the polymerase chain reaction. Mol Cell. Probes. 5:137-142. 140. Ometto, L., C. Zanotto, A. Maccabriini, D. Caselli, D. Truscia, C. Giaquinto, E. Ruga, L. Chieco-Bianchi, and A. De Rossi. 1995. Viral phenotype and host-cell susceptibility to HIV-1 infection as risk factors for mother-to-child HIV-1 transmission. AIDS 9:427-434. 141. Oxtoby, M. J. 1991. Perinatally acquired HIV infection. In Pizzo, P. A., and C. M. Wilfert (eds) Pediatric AIDS: The challenge of HIV infection in infants, children and adolescents. Williams & Wilkins, Baltimore, MD.

PAGE 168

161 142. Pantaleo, G., C. Graziosi, J. F. Demarest, 0. J. Cohen, M. Vaccarezza, K. Gantt, C. Muro-Cacho, and A. S. Fauci. 1994. Role of lymphoid organs in the pathogenesis of human immunodeficiency virus (HIV) infection. Immunol. Rev. 140:105-130. 143. Papaevangelou, V., T. Moore, V. Nagara j K. Krasinski, and W. Borkowsky. 1992. Lack of predictive value of maternal human immunodeficiency virus p24 antigen for transmission of infection to their children. Pediatr. Infect. Dis. J. 11:851-855. 144. Paul, W. E. 1995. Can the immune response control HIV infection? Cell 82:177-182. 14 5. Piatak, M., Jr., S. Saag, L. C. Yang, J. C. Kappes, K.-C. Luk, B. H. Hahn, G. M. Shaw, and J. D. Lifson. 1993. High levels of HIV-1 in plasma during all stages of infection determined by competitive PCR. Science 259:1749-1754. 146. Pittis, M. G., G. Sternik, L. Sen, R. A. Diez, N. Planes, D. Pirola, and M. E. Estevez. 1993. Impaired phagolysosomal fusion of peripheral blood monocytes from HIV-infected subjects. Scand J. Immunol. 38:423-427. 147. Preston, B. D., B. J. Poiesz, and L. A. Loeb. 1988. Fidelity of HIV-1 reverse transcriptase. Science 242 :1168-1171 148. Rcunakrishnan, N. S., J. Grunewald, C. H. Janson, and H. Wigzell. 1992. Nearly identical T-cell receptor V-gene usage at birth in two cohorts of distinctly different ethnic origin: influence of environment in the final maturation in the adult. Scand. J. Immunol. 36:71-78. 149. Rasmussen, A.-M., E. B. Smeland, B. K. Erikstein, L. Caignault, and S. Funderud. 1992. A new method for detachment of Dynabeads from positively selected B lymphocytes. J. Immunol. Methods 146:195-202. 15 0. Reinhardt, P. P., B. Reinhardt, J. L. La they, and S. A. Spector. 1995. Human cord blood mononuclear cells are preferentially infected by non-syncytium inducing,

PAGE 169

162 macrophage -tropic human immunodeficiency virus type 1 isolates. J. Clin. Microbiol. 33:292-297. 151. Report of a consensus workshop, Siena, Italy, January 1718, 1992. 1992. Maternal factors involved in mother-tochild transmission of HIV-1. J. Acquir. Immune Defic. Syndr. 5:1019-1029. 152. Rinaldo, C, X.-L. Huang, Z. Fan, M. Ding, L. Beltz, A. Logar, D. Panicali, G. Mazzara, J. Liebmann, M. Cottrill, and P. Gupta. 1995. High levels of anti-human immunodeficiency virus type 1 (HIV-1) memory cytotoxic Tlymphocyte activity and low viral load are associated with lack of disease in HIV-1 infected long-term nonprogressors J. Virol. 69:5838-5842. 153. Robert-Gurof f M., M. Popovic, S. Gartner, P. Markham, R. C. Gallo, and M. S. Reitz. 1990. Structure and expression of tat-, rev-, and nef-specif ic transcripts of human immunodeficiency virus type 1 in infected lymphocytes and macrophages. J. Virol. 64:3391-3398. 154. Rogers, M. F., C.-Y. Ou, M. Rayfield, P. A. Thomas, E. E. Schoenbaum, E. Abreims, K. Krasinski, P. A. Selwyn, J. Moore, A. Kaul, K. T. Grinrni, M. Bamji, G. Schochetman, and the New York City Collaborative Study of Maternal HIV Transmission and Montefiore Medical Center HIV Perinatal Transmission Study Group. 1989. Use of polymerase chain reaction for early detection of the proviral sequences of human immunodeficiency virus in infants born to seropositive mothers. N. Engl. J. Med. 320:1649-1654. 155. Roques, P., D. Marce, C. Courpotin, F. P. Mathieu, F. Herve, F.-D. Boussin, R. Narwa, M.-C. Meyohas, C. Dollfus, and D. Dormont 1993. Correlation between HIV provirus burden and in utero transmission. AIDS 7 (suppl 2) :S39-S43 156. Rouzioux, C, D. Costagliola, M. Burgard, S. Blanche, M.J. Mayaux, C. Griscelli, A. -J. Valleron, and the HIV Infection in Newborns French Collaborative Study Group. 1993. Timing of mother-to-child HIV-1 transmission depends on maternal status. AIDS 7(suppl 2):S49-S52.

PAGE 170

163 157. Rubinstein, A., M. Sicklick, A. Gupta, L. Bernstein, N. Klein, E. Rubinstein, I. Spigland, L. Fruchter, N. Litman, H. Lee, and M. Hollander. 1983. Acquired immunodeficiency with reversed T4/T8 ratios in infants born to promiscuous and drug-addicted mothers. JAMA 249:2350-2356. 158. Ruff, A. J., J. Coberly, N. A. Halsey, R. Boulos, J. Desormeaux, A. Burnley, D. J. Joseph, M. McBrien, T. Quinn, P. Losikoff, K. L. O'Brien, M. A. Louis, and H. Farzadegan. 1993. Prevalence of HIV-1 DNA and p24 antigen in breast milk and correlation with maternal factors. J. AIDS 7:68-73. 159. Ruprecht, R. M., C. Fratazzi, P. L. Sharma, M. F. Greene, D. Penninck, and M. Wyand. 1993. Animal models for perinatal transmission of pathogenic viruses. Ann. N. Y. Acad. Sci. 693:213-228. 160. Ryder, R. W. and F. Behets. 1994. Reasons for the wide variation in reported rates of mother-to-child transmission of HIV-1. AIDS 8:1495-1497. 161. Ryder, R. W. W. Nsa, S. E. Hassig, F. Behets, M. Rayfield, B. Ekungola, A. M. Nelson, U. Mulenda, H. Francis, K. Mwandagalirwa, F. Davachi, M. Rogers, N. Nzilambi, A. Greenberg, J. Mann, T. C. Quinn, P. Piot., and J. Curran. 1989. Perinatal transmission of the human immunodeficiency virus type 1 to infants of seropositive women in Zaire. N. Engl. J. Med. 320:1637-1642. 162. Saag, M. S. 1994. Evolving understanding of the immunopathogenesis of HIV. AIDS Res. Hum. Retroviruses. 10:887-892 163. St. Louis, M.E., M. Kamenga, C. Brown, A. M. Nelson, T. Manzila, V. Batter, F. Behets, U. Kabagabo, R. W. Ryder, M. Oxtoby, T. C. Quinn, W. L. Heyward. 1993. Risk for perinatal HIV-1 transmission according to maternal immunologic, virologic, and placental factors. JAMA 269 :2853-2859 164. Sanders, M. E., M. W. Makgoba, and S. Shaw. 1988. Human naive and memory T cells: reinterpretat ion of helper-

PAGE 171

164 inducer and suppressorinducer subsets. Immunol. Today 9:195-199. 165. Scarlatti, G., J. Albert, P. Rossi, V. Hodara, P. Biraghi, L. Muggiasca, and E. M. Fenyo. 1993. Mother-tochild transmission of human immunodeficiency virus type 1: correlation with neutralizing antibodies against primary isolates. J. Infect. Dis. 168:207-210. 166. Scarlatti, G., V. Hodara, P. Rossi, L. Muggiasca, A. Bucceri, J. Albert, and E. M. Fenyo. 1993. Transmission of human immunodeficiency virus type 1 (HIV-1) from mother to child correlates with viral phenotype Virology 197:624-629. 167. Scherer, W. F., J. T. Syverton, and G. 0. Gey. 1953. Studies on the propagation in vitro of poliomyelitis viruses. IV. Viral multiplication in a stable strain of human malignant epithelial cells (strain HeLa) derived from an epidermoid carcinoma of the cervix. J. Exp. Med. 97 :695-708 168. Schnittman, S. M., H. C. Lane, J. Greenhouse, J. S. Justement, M. Baseler, and A. S. Fauci. 1990. Preferential infection of CD4'*" memory T cells by human immunodeficiency virus type 1: evidence for a role in the selective T-cell functional defects observed in infected individuals. Proc Natl. Acad. Sci. USA. 87:6058-6062. 16 9. Schnittman, S. M., M. C. Psallidopoulos H. C. Lane, L. Thompson, M. Baseler, F. Massari, C. H. Fox, N. P. r Salzman, and A. S. Fauci. 1989. The reservoir for HIV-1 in human peripheral blood is a T cell that maintains expression of CD4 Science 245:305-308. 170. Schuitemaker, H., M. Koot, N. A. Kootstra, M. W. Dercksen, R. E. Y. de Goede, R. P. van Steenwijk, J. M. A. Lange, J. K. M. E. Schattenkerk, F. Miedema, and M. Tersmette. 1992. Biological phenotype of human immunodeficiency virus type 1 clones at different stages of infection: progression of disease is associated with a shift from monocytotropic to T-cell -tropic virus populations. J. Virol. 66:1354-1360.

PAGE 172

165 171. Schuitemaker H., N. A. Kootstra, R. A. M. Fouchier, B. Hooibrink, and F. Miedema. 1994. Productive HIV-1 infection of macrophages restricted to the cell fraction with proliferative capacity. EMBO J. 13:5929-5936. 172. Schuitemaker, H., N. A. Kootstra, R. E. Y. de Goede, F. de Wolf, F. Miedema, and M. Tersmette. 1991. Monocytotropic human immunodeficiency virus type 1 (HIV1) variants detectable in all stages of HIV-1 infection lack T-cell line tropism and syncytiuminducing ability in primary T-cell culture. J. Virol. 65:356-363. 173. Schuitemaker, H., N. A. Kootstra, M. H. G. M. Koppelman, S. M. Bruisten, H. G. Huisman, M. Tersmette, and F. Miedema. 1992. Proliferation-dependent HIV-1 infection of monocytes occurs during differentiation into macrophages. J. Clin Invest. 89:1154-1160. 174. Schutt, C, B. Ringel, M. Nausch, V. Horejsi, P. Neels, H. Walzel, L. Jonas, E. Siegl, and H. Friemel. 1988. Human monocyte activation induced by an anti-CD14 monoclonal antibody. Immunol. Lett. 4:321-327. 175. Schwartz, D. H. U. K. Sharma, E. J. Perlman, and K. Blakemore. 1995. Adherence of human immunodeficiency virus-infected lymphocytes to fetal placental cells: A model of maternal fetal transmission. Proc Natl. Acad. Sci. USA 92:978-982. 176. Scott, G. B., C. Hutto, R. W. Makuch, M. T. Mastrucci, T. O'Connor, C. D. Mitchell, E. J. Trapido, and W. P. Parks. 1989. Survival in children with perinatally acquired HIV1. N. Engl. J. Med. 321:1791-1796. 177. Shah, M. M., Y. Li, and R. D. Christensen. Effects of perinatal zidovudine (AZT) on hematopoiesis : a comparison of effects on progenitors from human fetuses vs. mothers. Submitted 178. Sheppard, H. W. W. Lang, M. S. Ascher, E. Vittinghoff, and W. Winkelstein. 1993. The characterization of nonprogressors: long-term HIV-1 infection with stable CD4'^ T-cell levels. AIDS 7:1159-1166.

PAGE 173

166 179. Simmons, D.L., S. Tan, D. G. Tenen, A. Nicholson-Weller and B. Seed. 1989. Monocyte antigen CD14 is a phospholipid anchored membrane protein. Blood 73:284-289. 180. Sleasman, J. W. 1995. Pediatric HIV infection. In Scott, G. B., and J. W. Sleasman (eds) A guide for primary health care providers. University of Florida Press, Gainesville, FL. 181. Sleasman, J. W. L. F. Aleixo, A. Morton, S. Skoda-Smith, and M. M. Goodenow. 1996. 004"^ memory T cells are the predominant population of HIV-1 infected lymphocytes in neonates and children. Submitted. 182. Sleasman, J. W. T. 0. Harville, G. B. White, J. F. George, D. J. Barrett, and M. M. Goodenow. 1994. Arrested rearrangement of T cell receptor Vj3 genes in thymocytes from children with X-linked severe combined immunodeficiency disease. J. Immunol. 153:442-448. 183. Sleasman J. W. M. Henderson, and D. J. Barrett. 1991. Con Ainduced suppressor cell function depends on the activation of the 004"" CD45RA inducer T cell subpopulation Cell. Immunol. 133:367-378. 184. Southern, E. M. 1975. Detection of specific sequences among DNA fragments separated by gel electrophoresis. J. Mol. Biol. 98:503-517. 185. Sperduto, A. R., Y. J. Bryson, and I. S. Y. Chen. 1993. Increased susceptibility of neonatal monocyte/macrophages to HIV-1 infection. AIDS Res. Hum. Retroviruses. 9: 12771285 186. Stanley, S. K., S. W. Kessler, J. S. Justement, S. M. Schnittman, J. J. Greenhouse, C. C. Brown, L. Musongela, K. Musey, B. Kapita, and A. S. Fauci. 1992. CD34^ bone i marrow cells are infected with HIV in a subset of seropositive individuals. J. Immunol. 149:689-697. 187. Steffy, K., and F. Wong-Staal. 1991. Genetic regulation of human immunodeficiency virus. Microbiol. Rev. 55:193205

PAGE 174

167 188. Stevens, S. W. and J. D. Griffith. 1994. Human immunodeficiency virus type 1 may preferentially integrate into chromatin occupied by LlHs repetitive elements. Proc Natl. Acad. Sci USA 91:5557-5561. 189. Stevenson, M., M. Bukrinsky, andS. Haggerty. 1992. HIV-1 replication and potential targets for intervention. AIDS Res. Hum. Retroviruses 8:107-113. 190. Strominger, J. L. 1989. Developmental biology of T cell receptors. Science 244:943-950. 191. Tersmette, M., R. E. Y. de Goede, B. J. M. al I. N. Winkel, R. A. Gruters, H. T. Cuypers, H. G. Huisman, and F. Miedema. 1988. Differential syncytiuminducing capacity of human immunodeficiency virus isolates: frequent detection of syncytiuminducing isolates in patients with acquired immunodeficiency syndrome (AIDS) and AIDS-related complex. J. Virol. 62:2026-2032. 192. Tong-Starksen, S., and B. M. Peterlin. 1990. Mechanisms of retroviral transcriptional activation. Semin. Virol. 1:215-227. 193. Tovo, P. A., M. de Martino, C. Gabiano, N. Cappelo, R. D'Elia, A. Loy, A. Plebani, G. V. Zuccotti, P. Dallacasa, G. Ferraris, D. Caselli, C. Fundaro, P. D'Argenio, L. Galli, N. Principi, M. Stegagno, E. Ruga, and E. Palomba. 1992. Prognostic factors and survival in children with perinatal HIV-1 infection. Lancet 339:1249-1253. 194. Trono, D. 1995. HIV accessory proteins : leading roles for the supporting cast. Cell 82:189-192. 195. Van de Perre, P., A. Simonon, P. Msellati, D.-G. Hitimana, D. Vaira, A. Baziibagira, C. Van Goethem, A.-M. Stevens, E. Karita, D. Sondag-Thull, F. Dabis, and P. Lepage. 1991. Postnatal transmission of human immunodeficiency virus type 1 from mother to infant. N. Engl. J. Med. 325:593-598. 196. van't Wout, A. B., N. A. Koostra, G. A. Mulder -Kampinga, N. A.-v Lent, H. J. Scherpbier, J. Veenstra, K. Boer, R.

PAGE 175

168 A. Coutinho, F. Miedema, and H. Schuitemaker 1994. Macrophagetropic variants initiate human immunodeficiency virus type 1 infection after sexual, parenteral, and vertical transmission. J. Clin. Invest. 94:2060-2067. 197. Varmus, H. 1988. Retroviruses. Science 240:1427-1435. 198. Varmus, H. E., and R. Swanstrom. 1984. Replication of retroviruses. In Weiss, R., N. Teich, H. Varmus, and J. Coffin (eds) RNA tumor viruses, Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. 199. von Boehmer, H. 1990. Developmental biology of T cells in T cell -receptor transgenic mice. Annu. Rev. Immunol. 8:531-556 200. Wahl, L. M., I. M. Katona, R. L. Wilder, C. C. Winter, B. Haraoui, I. Scher, and S. M. Wahl. 1984. Isolation of human mononuclear cell subsets by counterf low centrifugal elutriation (CCE) Cell. Immunol. 85:373-383. 201. Wei, Xiping, S. K. Ghosh, M. E. taylor, V. A. Johnson, E. A. Emini, P. Deutsch, J. D. Lifson, S. Bonhoeffer, M. A. Nowak, B. H. Hahn, M. S. saag, and G. M. Shaw. 1995. Viral dynamics in human immunodeficiency virus type 1 infection. 373:117-122. 202. Weiser, B., S. Nachman, P. Tropper, K. H. Viscosi, R. Grimson, G. Baxter, G. Fang, C. Reyelt, N. Hutcheon, and H. Burger. 1994. Quantitation of human immunodeficiency virus type 1 during pregnancy: relationship of viral titer to mother-to-child transmission and stability of viral load. Proc Natl. Acad. Sci USA 91:8037-8041. 203. Weiss, A. L., R. L. Wiskocil, and J. D. Stobo. 1984. The role of T3 surface molecules in the activation of the human T cells: a two-stimulus requirement for IL-2 production reflects events occuring at a pretranslational level. J. Immunol. 133:123-128. 204. Weiss, C. D., J. A. Levy, and J. M. White. 1990. Oligomeric organization of gpl20 on infectious human

PAGE 176

169 immunodeficiency virus type 1 particles. J. Virol. 64:5674-5677. 205. Whittle, H., A. Egboga, J. Todd, T. Corrah, A. Wilkins, E. Demba, G. Morgan, M. Rolfe, N. Berry, and R. Tedder. 1992. Clinical and laboratory predictors of survival in Gambian patients with symptomatic HIV-1 and HIV-2 infection. AIDS 6:685-689. 206. Willey R. L., J. S. Bonifacino, B. J. Potts, M. A. Martin, and R. D. Klausner. 1988. Biosynthesis, cleavage, and degradation of the human immunodeficiency virus 1 envelope glycoprotein gpl6 0. Proc Natl. Acad. Sci. USA 85:9580-9584 207. Wolinsky, S. M. C. M. Wike, B. T. M. Korber, C. Hutto, W. P. Parks, L. L. Rosenblijm, K. J. Kunstman, M. R. Furtado, and J. L. Munoz 1992. Selective transmission of human immunodeficiency virus type-1 variants from mothers to infants. Science 255:1134-1137. 208. Wood, R., H. Dong, D. A. Katzenstein, and T. C. Merigan. 1993. Quantification and comparison of HIV-1 proviral load in peripheral blood mononuclear cells and isolated CD4"^ T cells. J. Acquir. Immune Defic. Syndr. 6:237-240. 209. The Working Group on Motherto-Child Transmission of HIV. 1995. Rates of mother-to-child transmission of HIV-1 in Africa, America, and Europe: results from 13 perinatal studies. J. Acquir. Immune Defic. Syndr. Hum. Retrovirol. 8:506-510 210. World Health Organization Global Programme on AIDS. 1993. HIV/AIDS Summary. 211. Wright, S. D., R. A. Ramos, P. S. Tobias, R. J. Ulevitch, and J. C. Mathison. 1990. CD14 a receptor for complexes of lipopolysaccharide (LPS) and LPS binding protein. Science 249:1431-1433. 212. Wyatt, R., N. Sullivan, M. Thali, H. Repke, D. Ho, J. Robinson, M. Posner, and J, Sodroski. 1993. Functional and immunological characterization of human

PAGE 177

170 immunodeficiency virus type 1 envelope glycoproteins containing deletions of the major variable regions. J. Virol. 67:4557-4565. 213. Wysocki, L. J., and V. L. Sato. 1978. "Panning" for lymphocytes: a method for cell selection. Proc Natl. Acad. Sci. USA 75:2844-2848. 214. Zack, J. A., S. J. Arrigo, S. R. Weitsman, A. S. Go, A. Haislip, and I. S. Y. Chen. 1990. HIV-1 entry into quiescent primary lymphocytes: molecular analysis reveals a labile, latent viral structure. Cell 61:213-222. 215. Ziegler-Heitbrock, H. W. L., B. Passlick, and D. Flieger. 1988. The monoclonal antimonocyte antibody MY4 stains B lymphocytes and two distinct monocyte subsets in human peripheral blood. Hybridoma 7:521-527. 216. Ziegler-Heitbrock, H. W. L., and R. J. Ulevitch. 1993. CD14 : cell surface receptor and differentiation marker. Immunol. Today 14:121-125.

PAGE 178

BIOGRAPHICAL SKETCH I was born and raised in Belo Horizonte, MG, Brazil, a large city located in the mountains of my country. The first child of a family of 3 I started attending school at 3.5 years of age. I still remember that the priority of my parents was to give us the best education available. As I was growing up I attended several courses, including languages, sports, music and arts. English and swimming were the two I enjoyed the most. During high school I went to a Catholic school where mathematics was the strongest field, almost causing me to become a mathematician. Also during high school, in 1977, I spent 6 months as an exchange student in Port St. Joe, FL, where I met my husband Steve. Although inclined to follow my father's career as a lawyer, I decided to become a physician. I attended the Federal University of Minas Gerais (UFMG) where I obtained a Medical degree in July of 1985, and specialized in Anesthesiology at Hospital das Clinicas, UFMG. In 1991 I came to Gainesville, FL, and worked for a year as a visiting researcher in the Dept. of Anesthesiology at Shands Hospital. I joined the Deptartment of Pathology and Laboratory Medicine at UF in 1992, as a Ph.D. student. At the conclusion of my degree I will return to Belo Horizonte and work in HIV-1 research, as well as with anesthesiology. 171

PAGE 179

I certify that I have read this study and that in my opinion it conforms to acceptable standards of scholarly presentation and is fully adequate, in scope and quality, as a dissertation for the degree of Doctor of Philosophy. Maur^n M. t?bodenow, "Onair Associate Professor of Pathology and Laboratory Medicine I certify that I have read this study and that in my opinion it conforms to acceptable standards of scholarly presentation and is fully adequate, in scope and quality, as a dissertation for the degree of Doctor of Philosophy. Jotin W. Sleasman Associate Professor of Pediatrics I certify that I have read this study and that in my opinion it conforms to acceptable standards of scholarly presentation and is fully adequate, in scope and quality, as a dissertation for the degree of Doctor of Philosophy. A h Saeed R. Khan Associate Professor of Pathology and Laboratory Medicine I certify that I have read this study and that in my opinion it conforms to acceptable standards of scholarly presentation and is fully adequate, in scope and quality, as a dissertation for the degree of Docitor of Philosophy. fames R. Zu
PAGE 180

This dissertation was submitted to the Graduate Faculty of the College of Medicine and to the Graduate School and was accepted as partial fulfillment of the requirements for the degree of Doctor of Philosophy. August, 1996 k /Dean, College of Medicine Dean, Graduate School