Citation
Role of a conserved 3'NTR sequence and poly(A) tail length in poliovirus RNA replication

Material Information

Title:
Role of a conserved 3'NTR sequence and poly(A) tail length in poliovirus RNA replication
Creator:
Silvestri, Lynn Shiels, 1972-
Publication Date:
Language:
English
Physical Description:
xi, 123 leaves : ill. ; 29 cm.

Subjects

Subjects / Keywords:
Gels ( jstor )
Genetic mutation ( jstor )
In vitro fertilization ( jstor )
Nucleotides ( jstor )
Point mutation ( jstor )
Poliovirus ( jstor )
Property reversion ( jstor )
RNA ( jstor )
RNA stability ( jstor )
Transfection ( jstor )
: Dissertations, Academic -- College of Medicine -- Department of Molecular Genetics and Microbiology -- UF ( mesh )
: Molecular Genetics and Microbiology thesis Ph.D ( mesh )
Conserved Sequence ( mesh )
Mutagenesis, Site-Directed ( mesh )
Polioviruses ( mesh )
RNA, Messenger -- biosynthesis ( mesh )
Sequence Deletion ( mesh )
Virus Replication ( mesh )
Genre:
bibliography ( marcgt )
theses ( marcgt )
non-fiction ( marcgt )

Notes

Thesis:
Thesis (Ph. D.)--University of Florida, 2001.
Bibliography:
Includes bibliographical references (leaves 116-122).
Additional Physical Form:
Also available online.
General Note:
Typescript.
General Note:
Vita.
Statement of Responsibility:
by Lynn Shiels Silvestri.

Record Information

Source Institution:
University of Florida
Holding Location:
University of Florida
Rights Management:
The University of Florida George A. Smathers Libraries respect the intellectual property rights of others and do not claim any copyright interest in this item. This item may be protected by copyright but is made available here under a claim of fair use (17 U.S.C. §107) for non-profit research and educational purposes. Users of this work have responsibility for determining copyright status prior to reusing, publishing or reproducing this item for purposes other than what is allowed by fair use or other copyright exemptions. Any reuse of this item in excess of fair use or other copyright exemptions requires permission of the copyright holder. The Smathers Libraries would like to learn more about this item and invite individuals or organizations to contact the RDS coordinator (ufdissertations@uflib.ufl.edu) with any additional information they can provide.
Resource Identifier:
026576070 ( ALEPH )
52305449 ( OCLC )

Downloads

This item has the following downloads:


Full Text










ROLE OF A CONSERVED 3'NTR SEQUENCE AND POLY(A) TAIL LENGTH
IN POLIOVIRUS RNA REPLICATION















By

LYNN SHIELS SILVESTRI
















A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2001


























I dedicate this study to my parents, Thomas and Jean Shiels. for the caring support and encouragement they have given me throughout my personal and academic life. I feel truly blessed to be their daughter, and I will always be grateful for their loving guidance.















ACKNOWLEDGEMENTS

I would like to thank Dr. James Bert Flanegan for his guidance and advice

throughout the course of my doctoral training. The time he spent was immeasurably helpful to me and is greatly appreciated. I feel fortunate to have had such a caring mentor.

I would like to extend thanks to the members of my committee: Dr. Al Lewin, Dr. Sue Moyer, and Dr. Tom O'Brien. For kindly serving as my outside examiner, I thank Dr. Casey Morrow. Their knowledge of experimental design and insightful analysis of the data strengthened this work.

For performing the many initial experiments that evolved into this project, I thank Dr. Virginia Chow. My experience in the laboratory would not have been so rich had it not been for the helpful discussions and friendship of Joan Morasco, Dr. Sushma Abraham Ogram, Brian O'Donnell. Dr. Nidhi Sharma and Christy Jurgens. I would also like to thank both Joan Morasco and Dr. Dave Barton for teaching me experimental techniques and methods. I thank Dr. Lucia Eisner Smerage for her friendship and useful advice.

I offer thanks to Jesseca Parilla, who provided excellent technical assistance, and to Joyce Connors for much-needed administrative guidance. They are sincerely appreciated. Finally, I thank my husband, Dennis Silvestri, for his loving encouragement and tremendous support during this study.




..Ill
















TABLE OF CONTENTS

page

ACKNOW LEDGEM ENTS ................................ ........... ............................

LIST OF TABLES ......................................................................................................... vii

LIST OF FIGURES ....................................................................................................... v iii

ABSTRACT ........................................................................................................................ x

CHAPTER 1. BACKGROUND AND SIGNIFICANCE.................. .............

3'NTR Sequences and Structures ................................ ..................................... 3
The Poly(A) Tail ........................................................................................................... 10

CHAPTER 2. M ETHODOLOGY ................................................ .................................. 15

Plasmid Construction.................................................................................................... 15
Primer-Based M utagenesis by One-Step PCR................................... ...... .. 15
3'NTR M utagenesis by Two-Step PCR................................ ..... ............. 16
Poly(A) Tail M utagenesis ...................................................................................... 19
Restriction Digestion ................................................................................................ 20
Vector Preparation and Ligation............................................. 21
Transformation of the Mutated Plasmids...................... ........... 21
Cycle Sequencing.......................................................................................................... 22
Plasmid DNA Preparation.......................................................24
In Vitro Transcriptions................................................................................................. 25
Unlabeled Transcripts ............................................................................................... 25
Labeled Transcripts................................................................................................... 25
Preparation of HeLa Cellular Extracts ........................................ .......................... ..... 26
S 10 Extracts .............................................................................................................. 26
Initiation Factors ....................................................................................................... 27
Preparation of Dialysis Tubing ..................................................................................... 28
In Vitro Translation/Replication in HeLa Cell Extracts ....................................... 29
RNA Stability Assay........................................... .................................................... 30
CH3HgOH Agarose Gel Electrophoresis .................................................................... 31
TCA Precipitation .................................................... ............................................... 32
Proteins ..................................................................................................................... 32
RNAs...................................... ........................................................................... 32
10% Polyacrylamide Gel Electrophoresis ..................................... ............. 33

iv










Fluorography .................... ....................................................................................... 33
D M SO -PPO ................................. ............................ ........................................... 33
A m plify ................................................................................................... 34
Cell M aintenance ................................................................................................ 34
H eLa C ells ........................................................... ............................................. 34
BSC-40 Cells ................. ................................................ 34
Transfection of RN A ............................................................................................... 34
Determination of RNA Infectivity ..................................... ..... ................. 35
Preparation of Primary Virus Stocks .......................................... ............... 35
Determination of Plaque Morphology .............................................................. 36
Plaque Purification and Amplification............................................................. 36
R T-PC R ......................................................................................................................... 37

CHAPTER 3. EFFECT OF DELETIONS IN THE 3'NTR SINGLE-STRANDED REG ION ....................................................................................................................39

Plaque M orphology....................................................................................................... 39
Stability of RNA Containing a Complete Deletion of the Conserved Region ............. 42
Effect of 3'NTR Deletion Mutations on Translation and Polyprotein Processing ....... 44 The Conserved Region is Important for Negative-Strand RNA Synthesis................ 44
Temperature Sensitivity of AA2 ......................................................... 50

CHAPTER 4. CHARACTERIZATION OF AUA3 REVERTANTS .............................56

Revertants of AUA3 Contain Insertions in the Deletion Site ..................................... 56
Full or Partial Restoration of the Single-Stranded Region Increases Replication........ 59 AUA3 Revertants Are Not Produced In Vitro ...................................... ......... 64

CHAPTER 5. MODEL FOR REVERSION OF AUA3 RNA BASED ON POLYMERASE SLIPPAGE AND RECOMBINATION .......................................66

Description of the Polymerase Slippage/Recombination Model ............................... 66
Testing the Polymerase Slippage/Recombination Model .................................... 71

CHAPTER 6. INVESTIGATION OF A POLYMERASE SLIPPAGE/POINT MUTATION MODEL FOR THE REVERSION OF AUA3 RNA .................................76

Description of the Polymerase Slippage/Point Mutation Model ............................... 76
Support for a Polymerase Slippage/Point Mutation Model of Reversion..................... 79

CHAPTER 7. THE LENGTH OF THE POLY(A) TAIL HAS A DIRECT EFFECT ON INITIATION OF NEGATIVE-STRAND RNA SYNTHESIS .....................................85

Relationship Between Poly(A) Tail Length and Initiation of Negative-Strand RNA
Synthesis .. ................................................................................................... 85
Translation and Polyprotein Processing in Short Poly(A) Tail RNAs ...................... 88
Effect of Poly(A) Tail Length on RNA Stability ................................................. 92


V










Relationship Between RNA Infectivity and Poly(A) Tail Length............................ 95

CHAPTER 8. DISCUSSION ..................................................................................... 99

The Conserved Single-Stranded Sequence in the 3'NTR is Required for Efficient
Negative-Strand RNA Synthesis............................................................. 99
Investigation of the Reversion Mechanism for AUA3 RNA.................................... 104
Poly(A) Tail Length Affects Initiation of Negative-Strand RNA Synthesis ........ 110 C onclusion .................................................................................................................. 115

LIST OF REFERENCES ............................................................. 116

BIOGRAPHICAL SKETCH .......................................................... ...................... 123








































vi















LIST OF TABLES



Table Page

1: Prim ers used in this study ........................................... ................................................. 18

2: Virus titers resulting from infection at three temperatures (PFU/ml) ................................53

3: Length and sequence of the single-stranded region affect replication ............................64

4: Revertant vRNA sequences obtained from AUA3/U7430C RNA transfection ..............74

5: Revertant vRNA sequences observed after UUU RNA transfection......................... 84

6: Virus titers obtained from transfection of poly(A) tail length variants...........................95




























vii
















LIST OF FIGURES



Figure Page

1-1: The poliovirus genome. ............................................ ................................................. 2

1-2: M odel of the 3'NTR tertiary structure ................................................................... 4

1-3: Features of transcript RNAs containing 3'NTR deletion mutations. .............................9

3-1: Comparison of plaque morphologies between 3'NTR deletion mutant virus stocks.....40 3-2: Deletion of the conserved single-stranded region does not affect RNA stability ...........43

3-3: Translation of wildtype, AA2 and AGUA3 RNAs .........................45

3-4: Translation of wildtype, AG and AUA3 RNAs. ............................................. ...46

3-5: AGUA3 and AA2 RNAs are significantly inhibited for negative-strand RNA
synthesis ................ .........................................................................................47

3-6: Deletion of a single nucleotide from the conserved region negatively affects
replication ...................................................................49

3-7: AA2 RNA is temperature-sensitive in vitro. .............................................51

3-8: AA2 virus yields large-plaque revertants. ......................................... .......52

3-9: AA2 virus is temperature-sensitive in vivo ..............................................54

4-1: Confirmation of revertant plaque phenotypes in the reconstructed revertants of
AU A 3. ........................... ................................... ...............................................57

4-2: Plaque phenotype of UUU virus.................................................................................. 58

4-3: Translation is unaffected in the reconstructed revertants compared to wildtype. ..........60

4-4: Revertants of AUA3 show an increase in negative-strand RNA synthesis ..................61

4-5: UUU RNA does not replicate to detectable levels in vitro..................................62



viii










4-6: UUU RNA translates and processes the viral polyprotein normally ...........................63

5-1: 3'NTR structure showing the proposed locations of the AUA3 revertant sequences ....67 5-2: Polymerase slippage/recombination model of reversion ................................................70

5-3: Positions of marker mutations used to investigate the polymerase
slippage/recombination model. .......................................................72

6-1: Polymerase slippage/point mutation model of reversion.............................................78

6-2: Predicted structure of the UUU revertant RNA intermediate..................... .....80

6-3: Comparison of two revertants with UUUC insertions supports the polymerase
slippage/point mutation model of reversion. .....................................................83

7-1: Effect of poly(A) tail length on negative-strand RNA synthesis .................................87

7-2: Determination of the minimal poly(A) tail length required for efficient negativestrand RNA synthesis.............................................................................89

7-3: Effect of poly(A) tail length on negative-strand RNA synthesis ...............................90

7-4: Translation is not affected by poly(A) tail length ........................................................91

7-5: Poly(A)12 RNA is as stable as poly(A)so RNA ..............................................93

7-6: Poly(A)io RNA is less stable than poly(A)so RNA......................................................94

7-7: RNA infectivity increases with increasing poly(A) tail length .......................................96

7-8: Relationship between RNA infectivity and poly(A) tail length. .................................97

8-1: Model for initiation of negative-strand RNA synthesis............................ 113



















ix















Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy

ROLE OF A CONSERVED 3'NTR SEQUENCE AND POLY(A) TAIL LENGTH IN POLIOVIRUS RNA REPLICATION By

Lynn Shiels Silvestri

May 2001


Chairman: James B. Flanegan.
Major Department: Molecular Genetics and Microbiology

The poly(A) tail and an absolutely conserved, single-stranded sequence in the poliovirus 3'non-translated region (3'NTR) were examined to determine their roles in RNA replication. Mutagenesis of the conserved region revealed that small alterations of its length and sequence had a dramatic effect on the initiation of negative-strand RNA synthesis. In contrast, a significant portion of the poly(A) tail could be deleted before deleterious effects on replication were observed.

RNAs containing deletions in the sequence 7418GUAAA were made and tested in a cell-free system. RNA translation and stability were normal. However, deletion of one nucleotide, 7422A, reduced negative-strand RNA synthesis to 13% of wildtype levels. This detrimental effect was amplified by the deletion of two nucleotides (A7421AA), resulting in 1% replication compared to wildtype. Accumulation of negative-strand RNA




x









from transcripts with larger deletions, A7419UAAA or A7418GUAAA, was not measurable under the conditions tested.

Virus created through transfection of A7421AA RNA was temperature sensitive, and wildtype revertants were observed. Transfection of A7419UAAA RNA led to revertant virus that contained insertions of three or four differing nucleotides in the deletion site. Both the length and the sequence of the single-stranded region were important for negative-strand RNA synthesis. Two reversion models for A7419UAAA were proposed and tested. The results supported a reversion mechanism of polymerase slippage followed by point mutation.

The effect of poly(A) tail length on viral replication was investigated using RNAs with poly(A) sequences that varied from 12 to 80 nucleotides long. Translation and RNA stability were normal. Negative-strand synthesis rapidly increased and then reached maximum levels when the poly(A) tail was increased in length from 13 to 20 nucleotides. The sharp increase in replication over this narrow size range most likely reflects the ability of the viral RNA to bind at least one molecule of poly(A) binding protein (PABP) and suggests that PABP plays an essential role in the initiation of viral RNA synthesis. These results significantly extend our understanding of the molecular mechanisms involved in the replication of RNA viruses and will facilitate the design of new approaches to control the replication of related viruses and their associated diseases.











xi














CHAPTER 1
BACKGROUND AND SIGNIFICANCE



Poliovirus provides an excellent model for the study of replication mechanisms common to members of the picornavirus family. The organizational simplicity of the poliovirus genome and the development of a powerful in vitro system (2,3,5,14) have facilitated the study of precise events that occur during replication. This in vitro system provides for accurate translation, polyprotein processing, 3DP"' transcription and packaging of the RNA genome to yield infectious virus.

The poliovirus genome (Figure 1-lA) is 7.5 kb in length and consists of a single open reading frame (ORF) flanked on the 5' and 3' ends by non-translated regions (NTRs). The RNA is polyadenylated at the 3' end. The ORF is organized with P1 at the 5' end, followed by P2 and P3. The P1 region encodes the coat protein precursor, and P2 and P3 encode non-structural proteins. Complete cleavage of P1 results in VP4, VP2. VP3 and VPI. VPO is a precursor to both VP4 and VP2. Processing of P2 yields 2Apro 2B, and 2C, while P3 processing leads to the release of 3A, 3B (VPg), 3CPro, and 3DPO'. The open reading frame encodes a surprisingly large number of proteins, as some of the protein precursor proteins, such as VPO, 3AB, 3CDpro, and 2BC, have unique functions in replication.

The 5'NTR and 3'NTR contain cis-active sequences that control translation and replication of the genome. The 5'NTR consists of a cloverleaf structure followed by the internal ribosome entry site (IRES). The cloverleaf has been shown to be important for


1







2


A NTR

NTR


5' vYgpupu 3'



GA U U G G B U G U G
A U A C
G A C U U A
G C
A U
C G
Y u u U U CG
A U
U A
C G
C G 7418 C ( /

U A G A A A AA 5'--UUUU I UUUCUUU AAAA AAAAAAGAGGCU A CU A S X *
A
A
A
AA
Poly(A)80_00




Figure 1-1: The poliovirus genome. A. Schematic diagram of the organization of the
poliovirus virion RNA, with the non-translated regions (NTRs) and other features
indicated. B. Predicted secondary structure of the 3'NTR. Stem-loop structures X and Y
are labeled, and the absolutely-conserved nucleotides between them are shown in red.
Nucleotides involved in the kissing interaction between the loop regions of X and Y are
marked with asterisks. Formation of Region S by the poly(A) tail is illustrated.







3


maintaining stability of the genome and plays a role in regulating the initiation of negative-strand RNA synthesis (7). The 3'NTR (Figure 1-1 B) is the site of replication initiation, and consists of structures and sequences upon which the replication complex is formed. The focus of this study is to determine to what extent the conserved singlestranded 7418GUAAA 3'NTR sequence and poly(A) tail are involved in the replication of the poliovirus genomic RNA.



3'NTR Sequences and Structures

Translation of viral proteins and replication of the viral RNA depend on cis-active sequences located in the 5' and 3'NTRs. The 3'NTR of poliovirus contains stem and loop structures (Figure 1-1 B) that interact with each other to form a higher-order structure critical for the initiation of negative-strand RNA synthesis (Figure 1-2) (37,42,43). Although it is not yet known how these stem and loop structures function in relation to the replication complex, numerous studies have demonstrated that the presence of these elements, as well as the formation of the correct 3'NTR tertiary structure, are critical for efficient replication (35,43,49,51,59). Todd et al. deleted the entire 3'NTR of poliovirus and found that replication was reduced to extremely low levels (56). While this observation led to the suggestion that structures within the 3'NTR are not essential for the initiation of negative-strand RNA synthesis (56), the very low level of replication observed and the generation of revertants indicated that, in fact, the 3'NTR is very important for replication.

Nucleotides in the loops of two phylogenetically conserved and computerpredicted stem-loop structures in the poliovirus 3'NTR, Stems X and Y (43), have been proposed to form a tertiary structure through base-pairing with each other in a "kissing






4








Y
UU
GGAUG GUCAUACUGG CCCUAC CAGU G AG CU U
A G
A U U U A A G A G A A G 5' UUUU UUUCUU-A A UU
AAAA AAAAAGAG -S X


Poly(A) tail "kissing" interaction










Figure 1-2: Model of the 3'NTR tertiary structure. The 7418GUA3 sequence is red, and other absolutely conserved sequences are shown in orange. Stems X, Y and S, and the helical region formed by the kissing interaction are labeled. The poly(A) tail is green. This model is a modification of the structure described in Pilipenko et al., 1996.






5


interaction" (Figure 1-2) (35,43,59). Sequences in the loop of Y have also been implicated in the formation of a pseudoknot by pairing with single-stranded sequences in the 3DP1l coding region (27). Formation of pseudoknot structures in the 3'NTRs of the positive-stranded bamboo mosaic virus and turnip yellow mosaic virus has recently been shown to be important for their replication (11,58). Enzymatic and chemical probing studies of enteroviruses can support both of the proposed interactions (27,43), although there is some controversy over which of these possible structures carries the most significance in terms of enterovirus replication (27,35,43,51). The majority of the available data, however, supports the idea that the formation of the kissing interaction is most important for efficient replication of the viral RNA.

Pilipenko et al. found that disruption of the nucleotides involved in the formation of the proposed pseudoknot structure in poliovirus RNA (27) did not lead to a significant decrease in RNA synthesis when compared to wildtype in dot hybridization assays (43). In addition, Pierangeli et al. were able to insert a 30 bp HAV-derived fragment between the 3D"' coding region and the poliovirus 3'NTR with no ill effect on plaque size, titer, or replication (42). In contrast, mutational analyses have shown that mutations or deletions in the enteroviral 3'NTR that affect the formation of the kissing interaction greatly inhibit replication, and can lead to temperature-sensitive and lethal phenotypes (35,37,42,43,51,59). Revertants of mutants harboring such point mutations in the loop regions of X or Y were found to fully or partially restore the binding between the loops, with a corresponding increase in plaque size and replication (35,37,43). This phenotype was achieved either by true reversion, or by the introduction of second-site mutations in the unmutagenized loop involved in the kissing interaction. RNAs with second-site






6


mutations that restored the kissing interaction replicated almost as well as wildtype RNA (35,37). This indicated that the formation of the tertiary interaction was more important for replication than the preservation of the specific nucleotide sequence involved (35,37), as has been suggested to be so for the pseudoknot structure in the turnip yellow mosaic virus 3'NTR (11). This idea was confirmed by Wang et al., who found that a complete switch of all of the nucleotides involved in the kissing interaction from one stem-loop structure to the other yielded a mutant RNA with a wildtype phenotype (59). Although these studies have shown that disruptions in the kissing interaction inhibit replication, the RNAs were not affected for translation (35,43,56) and were still infectious (43). It is clear that the kissing interaction has functional significance in the initiation of negativestrand RNA synthesis.

The interactions that ultimately result in the formation of the required 3'NTR tertiary structure are likely to exist in other enteroviruses as well. All of the enteroviral 3'NTRs have been predicted to contain comparable secondary structures, and all have the potential to form a kissing interaction of either 5 or 6 base pairs (35,37,59). This observation may help to explain the fact that the poliovirus 3'NTR can be successfully exchanged with foreign enteroviral 3'NTRs, leading to chimeric viruses that are capable of replication (49). Successful replication of these chimeras suggests that the proteins comprising the replication complex are not absolutely specific for their corresponding 3'NTR. For instance, replacing the complete poliovirus 3'NTR with that of Coxsackie B4, HRV14 or bovine enterovirus yielded RNAs that were still infectious and able to replicate to varying degrees (49). Coxsackie A9, B3 and B4 3'NTRs fold into tertiary structures similar to poliovirus, and the Coxsackie A9 and B3 3'NTRs have been shown






7


experimentally to support a kissing interaction that was essential for replication (35,37,59). The ability of the replication complex to initiate negative-strand RNA synthesis on a foreign enteroviral 3'NTR may be explained by the presence of general tertiary structures that are conserved between them. The conservation of specific secondary structures among the enteroviral 3'NTRs, and the potential to form comparable tertiary interactions through kissing interactions between nucleotides within these structures indicate that they are biologically important.

However, replication of chimeric poliovirus RNA containing the HRV14 3'NTR, which has only one stem-loop structure (55) and therefore does not form a kissing interaction, are more difficult to explain. Although there are no predicted tertiary forms that involve the HRV14 3'NTR stem-loop, it is important for replication, as deletions that affect the stem-loop structure result in decreased replication and deficient growth in vivo (49,55). It may be that due to structural dissimilarities, the assembly or composition of the poliovirus replication complex formed on the 3'NTR of HRV14 differs in some respects from a complex that forms on a poliovirus 3'NTR (35,49,54). The altered complex may be able to recognize unique initiation signals in the HRV14 3'NTR, or host proteins associated with it, in a manner sufficient to initiate negative-strand synthesis (35,49). The poliovirus replication proteins may not be able to form such an altered complex in all cases, however, as substitution of the HAV 3'NTR for the poliovirus 3'NTR led to a complete lack of RNA synthesis in dot blot hybridization assays after transfection of the cDNA (42). Substitution of the poliovirus 3'NTR with that of bovine enterovirus also leads to deficient replication (49). This is surprising, given the fact that






8


the bovine enterovirus 3'NTR is proposed to fold into a tertiary structure similar to poliovirus (37).

In addition to sharing similar 3'NTR higher-order structures, alignment of the 3'NTR sequences of all human enteroviruses revealed that they each contain an invariable region of eight nucleotides (Ann Palmenberg, personal communication). In the poliovirus 3'NTR this absolutely-conserved sequence, 7417GGUAAAUU7424, extends from the 3' side of the base of Stem Y to the 5' side of Stem X (Figure 1-1B and 1-2). Computer-generated structural models and enzymatic probing studies of the poliovirus 3'NTR suggest that five of these conserved nucleotides, 741sGUAAA, form a singlestranded region between Stem Y and Stem X (Figure 1-1) (37,43). It has been suggested that the presence of a single-stranded region between Stem X and Stem Y allows the conformational bending of the RNA needed for the required kissing interaction to occur (37,43) (Figure 1-2). The retention of this specific sequence also indicates that it is critical to the virus life cycle. Despite these observations, no studies to date have focused specifically on the conserved single-stranded region and its significance in replication of the viral RNA.

In this study, the function of the single-stranded region in translation and

initiation of poliovirus replication was investigated. The effects of deletions in this conserved region were characterized by testing the ability of mutant transcript RNAs to initiate negative-strand RNA synthesis in a HeLa cell-free system, and by evaluating the in vivo growth properties of virus stocks generated through transfection of the mutated RNAs. Five deletion constructs were tested: AGUA3, AUA3, AA2, AA, and AG (Figure 13). Revertants were observed after transfection with RNAs containing deletions 7421A2






9












5'NTR 3'NTR

pppGpG (A),CGCG AGUA 3:


AUA3: (


AA 2: (tA


AA: (AIAA


AG: _AAA













Figure 1-3: Features of transcript RNAs containing 3'NTR deletion mutations. All deletion constructs begin with pppGpG at the 5' end and end with a portion of the Mlul restriction site following a poly(A)so tail, as shown. The entire open reading frame for protein synthesis is present. The sequence of the conserved single-stranded region in the 3'NTR is depicted in red letters in the top diagram. The five deletions created in this region are listed, with the remaining nucleotides in red.






10


and 7419UA3. These revertants contained insertions in the deletion site, which fully or partially restored the single-stranded region. Two reversion models were proposed. Testing of the models revealed that a model based on polymerase slippage and point mutation could account for the generation of all of the observed revertants.



The Polv(A) Tail

All enteroviruses encode a poly(A) tail proximal to the 3'NTR. As with the

single-stranded region, the poly(A) tail may contribute to the formation of the required tertiary structure of the 3'NTR. Nucleotides in the poly(A) tail are thought to form a double-stranded region (S) with the last four uracil residues of the 3DpO' coding region, giving the tertiary structure more stability through helical stacking with Stem X and the kissing interaction (Figure 1-2) (35,43). There is the potential to form the S region in both the poliovirus-like and Coxsackie-like 3'NTRs. The poly(A) tail does not form a corresponding S region in the HRV14 3'NTR, which does not support a kissing interaction (55). Since the kissing interaction is required for efficient replication of poliovirus, the ability of the poly(A) tail to create the S region is probably an important factor.

That the length of the poly(A) tail has an effect on poliovirus replication at the level of negative-strand RNA synthesis was demonstrated by experiments conducted in vitro with poliovirus RNA transcripts containing short or long poly(A) tails (5). The tail in the short poly(A) tail construct utilized by Barton et al. (5) has recently been confirmed to be 11 nucleotides in length. Transcripts with these poly(A)it tails were greatly inhibited for initiation of negative-strand synthesis compared to poly(A)so RNAs. According to current models for the establishment of Stem X and Region S in the






11


poliovirus 3'NTR, a minimum poly(A) tail of nine nucleotides is needed (43). Therefore, the low level of replication obtained with poly(A)ii RNA can not be readily attributed to the lack of proper formation of required 3'NTR structures.

The poly(A) tail has been found to be important in other aspects of the viral life cycle, which may be a reflection of the ability to form the above interactions. It is known that the length of the poly(A) tail is important in the infectivity of poliovirus genomic RNA, with a 20-fold reduction in infectivity of RNAs treated with RNaseH in the presence of oligo(dT) (53). Samow has shown that poly(A)12 tails are 10% as infectious as poly(A)-10oo tails (50). When RNAs with shortened poly(A) tails were used to infect HeLa cells, the progeny virus contained wildtype tail length RNA (53). In vivo lengthening of short poly(A) tails has also been observed for Sindbis virus, and Sindbis virus RNAs lacking poly(A) tails had reduced infectivity (48). Bovine coronavirus RNA with shortened poly(A) tails exhibited delayed replication in vivo, and the resulting progeny virus had increased poly(A) tail length that correlated to the increase in replication (52). These observations indicated that the length of the poly(A) tail has important roles in infectivity and replication. These results also led to the hypothesis that RNAs with short tails might be less stable than RNAs with longer tails, or that the short tails caused translation deficiency (50).

It is known that the poly(A) tails of eukaryotic mRNAs serve a regulation

function in the translation process (19,36). In eukaryotic mRNAs, eukaryotic initiation factor eIF4E binds to the cap structure present at the 5' end of the RNA. eIF4E also binds the amino terminus of elF4G, a scaffold protein that also binds eIF4A at its carboxy terminus (19). Together, eIF4A, elF4E, and eIF4G form the eIF4F holoenzyme complex






12


(19,36). The middle portion of the eIF4G scaffold protein associates with elF3 (19), which in turn interacts with the 40S ribosomal subunit. Thus, translation initiation depends on the formation of the eIF4F complex to bring the 40S ribosomal subunit (bound by eIF3) to the cap (bound by eIF4E) (19). An interaction between the abundant cytoplasmic poly(A) binding protein (PABP) (20) and eIF4G has also been shown (24). Binding of PABP to elF4G increases binding of PABP to poly(A) (30). These observations led to the formation of a closed-loop model of translation initiation for eukaryotic capped mRNAs. Atomic force microscopy provided direct evidence of mRNA circularization (63).

All of the translation factors required for initiation of translation on capped

mRNAs are purported to be required for initiation of RNAs containing IRESs, except for eIF4E (19). The elF4F complex is able to bind to the IRES in the absence of a cap structure, and may recruit ribosomes to the RNA (41). As in capped mRNAs, communication between the 5' and 3'NTRs has been proposed for rotavirus RNA. The interaction is believed to occur via the binding of the non-structural viral protein NSP3 to the 3'NTR (46) and its association with eIF4G at the 5' end (44). Patton et al. have also suggested that direct interactions between sequences in the 3'NTR and 5'NTR result in the formation of a secondary structure that enhances replication (39). Evidence for the existence of a closed-loop structure has also recently been described for poliovirus (7). It was found that the insertion or deletion of four nucleotides from the 5' cloverleaf destabilized the RNAs and led to a significant decrease in the level of negative-strand RNA synthesis, an event initiated at the 3'NTR. Stability was restored by the addition of a cap structure, but the level of negative-strand RNA synthesis was not increased. These






13


results indicated that poliovirus RNA forms a circular complex that regulates stability and replication. This complex may be formed by interaction of PABP at the 3'NTR and poly(rC) binding protein (PCBP) at the 5'NTR (7,16). No significant increase in translation of viral proteins was observed upon stabilization of the 5'cloverleaf mutants with a cap structure (7), suggesting that the closed-loop complex, which enhances the translation of capped eukaryotic mRNAs, does not serve the same role in poliovirus RNAs. However, interaction of the 5' and 3'NTRs may be an important regulator of the switch between translation and the initiation of negative-strand RNA synthesis (7).

In agreement with these data, comparison of translation levels between poliovirus poly(A)11 and poly(A)so RNA in vitro demonstrated that the short poly(A) 1 RNA was not inhibited for translation (5). This result suggested that the poly(A) tail in the IREScontaining poliovirus RNA does not play a significant role in the stimulation of translation, unlike the poly(A) tails of capped eukaryotic mRNAs. The effect of the poly(A) tail on translation of RNAs containing IRES sequences in lieu of a cap structure was recently examined using recombinant RNA expressing the HIV capsid protein p24 driven by the encephalomyocarditis virus (EMCV) IRES (36). It was found that such RNAs with and without poly(A) tails reached similar levels of translation after 90 min at 300C in standard rabbit reticulocyte lysates (36).

It remained possible that the low level of negative-strand RNA synthesis of poliovirus poly(A)li RNA (5) was due to a lack of stability as compared to poly(A)so RNA. Since the majority of proteins were made within the, first 2 h of incubation, and replication was assayed after 4 h (5), it is possible that RNA degradation occurred after 2 h that could cause a significant overall decrease in negative-strand RNA synthesis. The






14


PABP present in eukaryotic cells serves a stabilizing function when bound to the poly(A) tract by preventing the activity of 3' exonucleases (8,60) (for review see (9)). While it was theoretically possible that PABP could bind the short tail RNA to stabilize it, formal assessment of the stability of the poly(A) 1 RNA has not yet been made.

To examine the function of the poly(A) tail in poliovirus RNA replication,

transcripts with poly(A) tails of various lengths were tested for stability, translation, and initiation of negative-strand RNA synthesis. The data presented in this study describe in detail the relationship between tail length and the initiation of negative-strand RNA synthesis. These results were correlated to RNA infectivity. Results obtained in stability assays of short poly(A) tail RNA suggest a role for PABP and support a model of initiation of negative-strand RNA synthesis that requires the viral protein VPg. Finally, while the data show that the length of the poliovirus poly(A) tail is not a factor in translation, it may function to help form a circular complex important for the initiation of negative-strand RNA synthesis. These results will form the basis for future experiments to better define the function of the poly(A) tail in replication initiation and its possible significance in bringing the 3'NTR and 5'NTR together into a circular complex.














CHAPTER 2
METHODOLOGY



Plasmid Construction

Primer-Based Mutagenesis by One-Step PCR

One mutagenesis approach that was attempted in the creation of the various 3'NTR deletion clones utilized touchdown PCR to insert a unique EcoRI site in the poly(A)so tail of the wildtype clone. The resulting clone contained the EcoRI site immediately after the first 12 nt of the poly(A) tail, which was followed by an additional 72 A residues. The EcoR1 site was positioned such that it would provide a convenient restriction site for mutagenesis of the 3'NTR. Mutagenesis could thus be accomplished by a single PCR reaction using a mutagenic primer which spanned the EcoR1 site of the template DNA and a second primer which annealed upstream of a second unique restriction site. The resulting PCR fragment would then be cut at both restriction sites and ligated back into the vector fragment derived from the original EcoRl clone.

The initial EcoRl clone, containing the EcoRI site in the poly(A) tail and a

wildtype 3'NTR, was tested. Transcripts containing wildtype poly(A) tails or interrupted tails translated and synthesized negative-strand RNA equally in vitro (data not shown). This indicated that small numbers of nucleotide changes, which disrupt the absolute homopolymeric sequence of the poly(A) tail, do not diminish the ability of the RNA to replicate. Cells transfected with EcoR1 RNA yielded virus with plaque morphology identical to virus derived from (A)so RNA transfection (data not shown). Attempts to


15






16


determine the sequence of the poly(A) tail in EcoR1-derived virus through RT-PCR and cycle sequencing were not successful.

Although presence of the EcoR1 sequence was not detrimental in initial experiments, a two-step PCR approach was finally used to introduce the desired mutations into the single-stranded region. The advantage of the two-step PCR approach was that the final 3'NTR mutant clones contained uninterrupted poly(A) tails. This eliminated any questions as to the effect of the presence of the EcoRI sequence on the experimental results, especially in conjunction with a range of different deletion mutations and sequence changes in the single-stranded region.



3'NTR Mutapenesis by Two-Step PCR

A "two-step" PCR method was employed to create mutations in the 3'NTR of PVI(A)80. In this discussion, "X" in the primer name refers to the name of the mutation created by that primer. The specific mutagenic primer sets used to create the various clones can be found in Table 1.

First PCR step. Two DNA fragments, named 5' and 3', were generated for each desired clone. Both fragments contained the desired 3'NTR mutation. To create the 5' fragments, primer BRL-6782 and mutagenic primer "X-R" were used in PCR reactions with PVI(A)so as template. The 50 1l reactions contained lx PCR buffer (20 mM TrisHCI (pH 8.4), 50 mM KCI), 200 gtM each dATP, dGTP, dCTP, and dTTP, 1.5 mM MgCl2, 100 pmol each BRL-6782 and primer "X-R", 50 ng PVI(A)80, and 2.5 U Taq DNA polymerase. The 5' fragments spanned nt6782 in the 3DPO coding region to the end of the 3'NTR. The reaction mixtures to make the 3' fragments were the same as for the 5' fragments, except primer BRL-7625 and mutagenic primer "X" were used. The 3'






17

fragments included sequences from nt7407 in the 3'NTR to nt7625 in the vector of PV 1

(A)80. Each reaction set was subjected to 30 cycles of 940C for 30 sec, 500C for 45 sec, and 720C for 30 sec in a GeneAmp PCR System 2400 thermocycler (The Perkin-Elmer Corporation, Norwalk, CT). Incubation at 720C for 10 min completed the cycling profile.

Purification of first step PCR fragments. The expected fragment sizes of 650 bp for the 5' fragments and 200 bp for the 3' fragments were verified by electrophoresis on a 1% agarose (Life Technologies, Grand Island, NY) TAE gel and visualized with UV light after staining with ethidium bromide in lx TAE buffer (40 mM Tris, 20 mM acetic acid, 2 mM Na2EDTA*2H20). The fragments were purified using Quantum Prep PCR Kleen Spin columns (Bio-Rad Laboratories, Hercules, CA) according to manufacturer's instruction. PCR reactions in which multiple fragments were generated were phenol:chloroform:iso-amyl alcohol (IAA) (25:24:1) extracted once, and the desired fragment purified from a 3.5% NuSieve GTG (FMC Bio-Products, Rockland, ME) TAE gel using the Geneclean Spin kit (Bioll0, Vista, CA). Isolated fragments were analyzed for purity and quantity by electrophoresis on a 1% agarose gel in lx TAE buffer as above.

Second PCR step. The purified 5' and 3' fragments were used in PCR to create a single "insert" fragment (approximately 840 bp) containing the desired 3'NTR mutation. These reactions contained approximately 25 ng each of the purified 5' and 3' fragments in lx PCR buffer (20 mM Tris-HCI (pH 8.4), 50 mM KCI) containing 1.5 mM MgC12, 100 pmol BRL-6782, 100 pmol BRL-7625, 200 IiM each dATP, dCTP, dGTP, and dTTP, and 2.5 U Taq DNA polymerase in 100 .l total volume. Primers BRL-6782 and BRL-7625 were included to amplify the product yield. The reactions were subjected to the same cycling profile as described for the generation of the individual 5' and 3'






18




Table 1: Primers used in this study

Primer Name: Sequence: 5'- 3'* BRL-6782 GACTACCTAAACCACTCACACCACC BRL-7625 CAGGGTTATTGTCTCATGAGCGGATAC BF 118 AGCTAAAATCAGGAGTGTGCC BRL-AA CTGTTGTAGGGGTAAATTTTTCTTTAATTCGG BRL-AA (R) CCGAATTAAAGAAAAAATTACCCCTACAACAG BRL-AG CTGTTGTAGGGATAAATTTTTCTTTAATTCGG BRL-AG (R) CCGAATTAAAGAAAAATTTAACCCTACAACAG BF 114 (AA2) GTTGTAGGGGTAATTTTTCTTTAATTCG BRL-AA2 (R) CGAATTAAAGAAAAAATACCCCTACAAC BF98 (AUA3) CTGTTGTAGGGGATTTTTCTTTAATTCGG BRL-AUA3 (R) CCGAATTAAAGAAAAAAACCCCTACAACAG BRL-UUU GGGGTTTTTTTTCTTTAATTCGGAG BRL-UUU (R) CTCCGAATTAAAGAAAAAAAACCCC
BRL-UUC CTGTTGTAGGGGTTCTTTTTCTTTAATTCGG
BRL-UUC (R) CCGAATTAAAGAAAAAGAACCCCTACAACAG
BRL-UUA CTGTTGTAGGGGTTATTTTTCTTTAATTCGG
BRL-UUA (R) CCGAATTAAAGAAAAATAACCCCTACAACAG BRL-UUUA CTGTTGTAGGGGTTTATTTTTCTTTAATTCGG
BRL-UUUA (R) CCGAATTAAAGAAAAATAAACCCCTACAACAG
BF113 (AGUA3) CTGTTGTAGGG^ATTITTCTTAATTCGG
BRL-AGUA3 (R) CCGAATTAAAGAAAAAACCCTACAACAG
BRL-U7427A GGGGATTTTACTTTAATTCGGAG BRL-U7427A (R) CTCCGAATTAAAGTAAAAACCCC BRL-U7430C GGGGATT TTCTCTAATTCGGAG BRL-U7430C (R) CTCCGAATTAGAGAAAAA CCCC
BRL-AI2 CCCCGAAAAGTGCCACCTGACGCG(TTT)4CTCCG BRL-A13 CCCCGAAAAGTGCCACCTGACGCG(TTT)4TCTCCG BRL-A15 CCCCGAAAAGTGCCACCTGACGCG(TTT)5CTCCG
BRL-A20 CCCCGAAAAGTGCCACCTGACGCG(TTT)6TTCTCCG



Note: A indicates the location of the named deletion with respect to the wildtype genomic RNA. Clones U7427A and U7430C were made in the AUA3 background.






19


fragments. The size of the completed inserts was verified on a 1% agarose TAE gel as described. The insert DNA was purified on Quantum Prep PCR Kleen Spin columns. In reactions with more than one product, the appropriate DNA fragment was gel-purified using the Geneclean Spin kit according to manufacturer's instructions.



Polv(A) Tail Mutagenesis

Shortened poly(A) tails were introduced initially by Taq polymerase error and later by PCR mutagenesis. PVI(A)80 was cut with PvulI and the ends of the small fragment (containing the vector and the 3'NTR) were ligated together to create a PV1(A)so0 subclone with one PvuII site. Site-directed mutagenesis of the 3'NTR to create the deletions described above was originally attempted using this subclone with the Transformer Site Directed Mutagenesis kit (Clontech, Palo Alto, CA). However, cyclesequencing of the resulting plasmids revealed that the 3'NTRs were not mutagenized, and that in many cases the poly(A) tail was shortened. Subclones with short tails, poly(A)37 and poly(A)29, were chosen. Plasmid preparations were made, and the DNA was linearized with PvullI. The linearized subclones were treated with shrimp alkaline phosphatase (SAP) (Roche, Indianapolis, IN) for 1 h at 370C. The SAP was inactivated at 700C for 15 min. The treated fragments were gel-purified, then ligated back into PV1(A)80 at the PvuII sites to create full-length plasmids with the indicated short poly(A) tail lengths. The PV 1(A)29 clone served as a template to create clones with even shorter poly(A) tail lengths by PCR mutagenesis.

Primers were designed which spanned the Mlul site and contained various tail lengths (Table 1). PCR reactions (100 pl total volume) containing lx PCR buffer (20 mM Tris-HCI (pH 8.4), 50 mM KCl), 1.5 mM MgC12, 200 pmol BRL-6782, 200 pmol






20


BRL-(A)n, 200 pM each dATP, dCTP, dGTP, and dTTP, and 2.5U Taq DNA polymerase were assembled. Template DNA (100 ng) was added to each reaction. The template varied according to the size of the poly(A) deletion required. The cycling profile consisted of 30 cycles of 940C for 30 sec, 540C for 45 sec, and 720C for 30 sec. Fragments were finished by incubation at 720C for 10 min. Completed PCR fragments were purified using the Quantum Prep PCR Kleen Spin columns. Full-length plasmids were then constructed as outlined in the following sections.



Restriction Digestion

Purified insert DNA fragments containing the 3'NTR or poly(A) tail mutations were digested with PvuII and Mlul in preparation for cloning. The column-purified inserts were first restricted with PvuII (Promega, Madison, WI) in 125 1l reactions containing lx reaction buffer (6 mM Tris-HCI (pH 7.5), 50 mM NaCI, 6 mM MgCl2, 1 mM dithiothreitol (DTT)). The reactions were incubated at 370C for 2 h. The buffer conditions were adjusted to 50 mM Tris-HC1, 100 mM NaCI, 10 mM MgC2 and 1 mM DTT prior to the addition of Mlul (New England BioLabs, Beverly, MA), for a total volume of 150 .l. Incubation was continued at 370C for 2 h. Complete digestion was confirmed after electrophoresis on a 1% agarose TAE gel. The digested DNA inserts were phenol:chloroform:IAA extracted once, then loaded directly on a 3.5% NuSieve GTG gel and electrophoresed. Inserts were extracted from the gel matrix using the Geneclean Spin kit.






21


Vector Preparation and Ligation

Purified DNA inserts were quantitated by comparison to 0.5 jig 100 bp DNA

ladder (New England BioLabs) on 1% agarose TAE gels. To make the 3'NTR mutation constructs and poly(A) tail clones (except where described under "Poly(A) Tail Mutagenesis"), the following procedure was followed. The insert fragments were ligated into the PvulI and MluI sites contained in a cDNA clone derived from PV1(A)80 (LRS3). LRS3 contained a unique PvuII site within the poliovirus coding region at nt7053, due to mutation of a PvuII site at nt9744 in the plasmid vector sequence. Vector DNA was prepared by restriction of LRS3 with PvulI and Mlul. 5 U SAP was added to the vector DNA and incubated for 1 h at 370C, then inactivated at 700C for 15 min. The large fragment was purified from a 1% GTG agarose (SeaKem, FMC Bio-Products) TAE gel using the Geneclean Spin kit.

A 1:3 to 1:6 ratio of vector to insert (for a total of between 230 to 260 ng

DNA/reaction) was used in 20 pll reactions containing lx T4 DNA ligase buffer (30 mM Tris-HC1 (pH 7.8), 10 mM MgCl2, 10 mM DTT, 1 mM ATP) and 1 U T4 DNA ligase (Promega). Ligation was performed at 40C for 15 to 20 h. An additional 1 U T4 ligase was added and incubation was continued at room temperature for a minimum of 4 h.



Transformation of the Mutated Plasmids

After ligation, the full-length, mutagenized plasmids were transformed into

Epicurian Coli SURE competent cells (Stratagene, La Jolla, CA). SURE cells (20 jil) were thawed on ice, gently resuspended and incubated on ice for 10 min in 25 mM 2mercaptoethanol (BME). The cells were gently resuspended every 2 min. Plasmid PVI(A)80 (1 ng) or 20 ng of mutagenized, ligated DNA were then added and the






22


incubation continued on ice undisturbed for 30 min. The cells were heat-shocked at 420C for exactly 45 sec and returned to ice for 2 min before the addition of 180 1l 370C SOC media (20g/L tryptone, 5g/L yeast extract, 10 mM MgC12, 10 mM MgSO4, 8.5 mM NaC1, 2 mM glucose). Transformed cells were incubated at 370C with shaking at 220 rpm for 1 h, then plated using sterile techniques on LB-amp agar plates (20 g/L LB, 15 g/L BactoAgar (Difco, Detroit, MI), 50 pig/ml ampicillin). Plates were incubated overnight at 370C.



Cycle Sequencing

Cycle Sequencing was used in an initial screening process to verify the presence of the desired 3'NTR or poly(A) tail mutations in newly constructed clones. Isolated SURE cell colonies were used to inoculate 5 ml LB-amp (20 g/L LB powder, 50 jig/ ampicillin) liquid cultures. The cultures were incubated at 370C for a minimum 12 h with shaking at 220 rpm. Plasmid DNA was isolated using the RPM Kit (Rapid Pure Miniprep, Bioll01).

The dsDNA Cycle Sequencing System (Life Technologies) was used with primer BF118 to screen plasmid DNA for the desired mutations. BF118 was treated with T4 kinase in the presence of [y-32P]ATP (Amersham Pharmacia, Piscataway, NJ) for 30 min at 370C. To sequence 4 NTPs per plasmid preparation, a master kinase reaction was made which contained 1 pmol BF118, 10 gCi [y-32P]ATP (3,000 Ci/mmol), 1 U T4 kinase and lx kinase buffer (60 mM Tris-HCI (pH 7.8), 10'mM MgCl2, 200 mM KCI) in

5 pl total volume. Reactions were inactivated at 550C for 5 min and placed on ice.

A master sequencing reaction was then prepared which contained 5 jtl 10x

sequencing buffer (300 mM Tris-HCI (pH 9.0), 50 mM MgC12, 300 mM KC1, .5% w/v






23


W-1), the entire kinase reaction (5 [l), and 1 U Taq DNA polymerase in 15 pl total volume. Thin-walled PCR tubes were prepared by adding 3 p of the master sequencing reaction and 2 pl of the desired nucleotide termination mix (50 pCM each dATP, dCTP, dTTP, and 7-deaza-dGTP, plus one of the following: 2 mM ddATP, 2 mM ddTTP, 1 mM ddCTP, or 200 pM ddGTP) to each tube. Approximately 50 ng of plasmid DNA was added for a total of 10 pl per tube. The reactions were subjected to 950C for 3 min, followed by 20 cycles of 950C for 30 sec, 550C for 30 sec and 700C for 1 min. The reactions were completed by 10 cycles of 950C for 30 sec and 700C for 1 min. Upon completion, 5 pl stop solution (95% v/v formamide, 10 mM EDTA (pH 8.0), 0.1% w/v bromophenol blue, 0.1% w/v xylene cyanol) was added and the reactions stored at -200C.

Labeled PCR products were analyzed on 0.35 mm thick denaturing 6.5% acrylamide gels. Gels were prepared by adding 10.4 ml of a 20% acrylamide/bisacrylamide (19:1, Life Technologies) solution containing 7M urea and lx TBE (89 mM Tris, 89 mM boric acid, 2 mM EDTA (pH 8.0)) to 21.6 ml 7M urea in lx TBE. 240 pl 10% ammonium persulfate (APS, Life Technologies) and 24 pl TEMED (Fisher Scientific, Pittsburgh, PA) were added. The PCR samples were heated to 95C for 5 min before loading. Gels were run in lx TBE at 25 mAmp, then transferred to chromatography paper (Fisher Scientific) and dried for 25 min at 800C.

After verification of the presence of the correct mutation and poly(A) tail length by sequencing, plasmid DNA was prepared according to the Qiagen Midiprep protocol. The entire insert fragment contained within each new full-length plasmid was sequenced through the junction sites at the DNA Sequencing Core Laboratory (Interdisciplinary Center for Biotechnology Research, University of Florida).






24

Plasmid DNA Preparation

Plasmid DNA preparations were made using the Plasmid Midi Kit (Qiagen Inc., Valencia, CA). Cells containing plasmids with the correct mutation and tail length were grown in 250 ml LB-amp liquid cultures at 370C with shaking at 220 rpm. Bacterial cells in the liquid cultures were pelleted at 6,000 x g for 15 min at 40C. Cell pellets were resuspended in 5 ml resuspension buffer (50 mM Tris-HCI (pH 8.0), 10 mM EDTA, 100 4ig/ml RNase A) and transferred to 30 ml polycarbonite Oakridge tubes (Beckman, Fullerton, CA) with screw caps. Lysis buffer (5 ml) (200 mM NaOH, 1% SDS) was added and the tubes gently inverted several times. Cells were incubated at room temperature for 5 min before the addition of 5 ml neutralization buffer (3M KCH3CO2, pH 5.5). Reactions were inverted to mix and placed on ice for 15 min.

Cellular debris was pelleted by centrifugation at 20,000 x g for 30 min at 40C. Supernatants were filtered and loaded onto equilibrated Qiagen columns as directed. Columns were rinsed with wash buffer (lM NaC1, 50 mM MOPs (pH 7.0), 15% isopropanol) and the DNA eluted with buffer (1.25M NaCI, 50 mM Tris-HCI (pH 8.5), 15% isopropanol). Eluted DNA was precipitated from solution by the addition of 0.7 volumes room temperature isopropanol and centrifuged at 15,000 x g for 30 min at 40C. The DNA pellets were washed with chilled 70% ethanol and re-centrifuged for 10 min. Air-dried DNA pellets were resuspended in lx TE buffer (10 mM Tris-HCI (pH 8.0), 1 mM EDTA) and brought to a final concentration of 0.5 pg/l. Plasmid preparations were stored at -200C.







25

In Vitro Transcriptions

Unlabeled Transcripts

Plasmids containing either wildtype poliovirus sequence or the described

mutations were linearized by MluI restriction and transcribed in a T7 RNA polymerase in vitro transcription system. Transcription of plasmids was achieved by incubating 2 pg Mlul-linearized plasmid in 125 pl reactions containing lx SP6 buffer (40 mM Tris-HCI (pH 7.9), 6 mM MgCI2, 2 mM spermidine), 10 mM DTT, 40 U RNasin (Promega), and 1 mM ATP, CTP, GTP and UTP at 370C for 2 h in the presence of T7 RNA polymerase. Transcription reactions were stopped by addition of 200 pLl 0.5% SDS buffer (100 mM NaCI, 10 mM Tris-HCI (pH 7.5), 1 mM EDTA, 0.5% sodium dodecyl sulfate). The RNAs were extracted with phenol:chloroform:IAA and chloroform:IAA three times each. The transcripts were precipitated by addition of 3 volumes of ethanol overnight at 40C. RNA was recovered by centrifugation at 15,000 x g at 40C for 15 min. The RNA transcripts were then resuspended in 50 pl sterile H20 and fractionated over Sephadex G50 (Amersham Pharmacia) columns to remove unincorporated nucleotides. Each fraction was analyzed for the presence of RNA by scanning spectrophotometry. The fractions containing purified RNA transcripts were then re-precipitated. RNA was quantitated by spectrophotometry prior to use.



Labeled Transcripts

Labeled transcripts for use in the RNA stability assay were generated as above with the exception that 1.5 pg Mlul digested plasmid DNA was used in 100 l reactions containing 50 pCi [ac-32P]CTP (400 Ci/mmol, Amersham Pharmacia). The RNAs were phenol:chloroform:IAA extracted, ethanol precipitated as described above and desalted as






26


described for unlabeled transcripts. Before use in the stability assay, the labeled RNA fractions were ethanol precipitated as described and quantitated by scanning spectrophotometry and trichloroacetic acid (TCA) precipitation.



Preparation of HeLa Cellular Extracts

S10 Extracts

HeLa cells in log phase growth were pelleted from suspension cultures by

centrifugation at 1250 rpm in a Beckman JS-4.2 rotor at 40C for 5 min. Approximately 109 cells were used for each preparation. The cell pellets were washed with 2 L isotonic buffer (35 mM HEPES-KOH (pH 7.4), 146 mM NaCl, 11 mM glucose) and transferred to a 50 ml conical tube on ice. The volume of the final pellet was noted. Cells were resuspended in 1.5 volumes hypotonic buffer (20 mM HEPES-KOH (pH 7.4), 10 mM KC1, 1.5 mM Mg(CH3CO2)2, 1 mM DTT) and incubated on ice for 10 min with brief vortexing every 3 to 4 min. The cells were poured into a chilled 15 ml dounce homogenizer (Wheaton, Millville, NJ). 25 strokes of a tight-fitting pestle (size A) lysed the cells.

The lysate was returned to the 50 ml conical on ice and 1/10 volume 10x S10

buffer (200 mM HEPES-KOH (pH 7.4), 1.2M KCH3CO2, 40 mM Mg(CH3CO2)2, 50 mM DTT) was added. The lysate was then centrifuged at 2,000 rpm in a JS-4.2 rotor for 10 min at 40C. The supernatant was poured off the pelleted nuclei into a 30 ml siliconized Corex tube and centrifuged at 10,000 rpm in a Beckman JA-20 rotor for 15 min at 40C. The supernatant was transferred to a fresh, chilled 50 ml conical tube and brought to 1 mM CaC12 by the addition of 1/100 volume 100 mM CaCl2. Micrococcal nuclease (1 mg/ml, Sigma, St. Louis, MO) was added to the supernatant for a final concentration of 5






27


pg/ml, and the mixture was incubated at 200C for 15 min. EGTA (100 mM, pH 7.5) was added for a final concentration of 2 mM to halt the nuclease reaction.

The treated cytoplasmic extract was transferred to a 30 ml siliconized Corex tube and centrifuged at 10,000 rpm at 40C for 15 min in a JA-20 rotor. The supernatant was removed into a 50 ml conical tube on ice. A small portion of the extract (1:100 dilution) was scanned in a spectrophotometer to determine the OD. When needed, hypotonic buffer was added to the extract to obtain an OD reading between 80 and 90 A260 units/ml. The extract was stored in aliquots of 50 pl to 200 ,pl in Eppendorf microfuge tubes at

-700C.



Initiation Factors

Preparations of HeLa Initiation Factors were made from approximately 109 HeLa cells in log phase growth pelleted from suspension culture by centrifugation at 1250 rpm in a JS-4.2 rotor. The cell pellets were rinsed with isotonic buffer as described for preparation of HeLa S 10 extracts, transferred to a 50 ml conical tube and placed on ice. The volume of the pellet was noted and 2 volumes hypotonic buffer was added. The cells were incubated on ice for 10 min and vortexed every 3 to 4 min. The cells were homogenized by 30 strokes of a tight-fitting pestle (size A) in a chilled dounce homogenizer.

The cell homogenate was poured back into the 50 ml conical tube and centrifuged at 2,000 rpm for 10 min at 40C in a JS-4.2 rotor. The supernatant was transferred into a siliconized 30 ml Corex tube and centrifuged at 10,000 rpm in a JA-20 rotor for 15 min at 40C to pellet nuclei. The supernatant was then moved to a 10 ml blackcap Ti-70.1






28


ultracentrifuge tube (Beckman). Ribosomes were pelleted by centrifugation at 60,000 rpm for 1 h at 40C in a Beckman Ti-70.1 rotor.

The ribosomal pellet was resuspended in 1.5 ml hypotonic buffer by stirring with a micro stir bar at 40C for 30 min, or until completely resuspended. The concentration was determined by spectrophotometric analysis of a 1:250 dilution of the ribosomal suspension. An OD of 250 A260 units/ml was ideal. The volume was noted and 4M KC1 was added to make a final concentration of 0.5M KC1. The ribosomes were stirred for 15 min at 40C. The stir bar was removed and the ribosomes were centrifuged at 60,000 rpm for I h at 40C as before.

The supernatant was carefully removed from the ultracentrifuge tube, transferred to a short length of dialysis tubing and secured with Spectra/Por closures (Fisher Scientific). The tubing was placed in a beaker at 40C with cold dialysis buffer (5 mM Tris-HCI (pH 7.5), 100 mM KC1, 50pM EDTA, 1 mM DTT, 5% glycerol) and stirred moderately for 2 h. The dialyzed supernatant was stored in aliquots of 50 [l at -700C.



Preparation of Dialysis Tubing

Tubing was prepared in advance by boiling short lengths of 16 mm Spectra/Por 2 dialysis tubing (Fisher Scientific) in 150 to 400 ml of 25 mM EDTA for 15 min in a beaker. The EDTA was exchanged for fresh 25 mM EDTA and the tubing brought to a second boil for 15 min. Finally, nanopure H20 was added and boiled with the tubing for 15 min longer. Tubing was covered with sterile H20 and stored at 40C in a wide-mouth bottle.






29


In Vitro Translation/Replication in HeLa Cell Extracts

This assay was first described by Barton et al. (5) and was utilized in this study with some modification. Positive-sense transcript RNAs contain two non-viral G residues at the 5'end. Negative-strand RNAs copied from transcripts containing these extra nucleotides are blocked for initiation of positive-strand RNA. Therefore only negative-strand RNAs are synthesized in these reactions (5,6). Transcript RNA (5 glg) was added to 50 tl HeLa S10 extract, 20 pl HeLa cell initiation factors, 10 il 10X reaction mix (10 mM ATP, 2.5 mM GTP, 2.5 mM UTP, 600 mM KCH3CO2, 155 mM HEPES-KOH (pH 7.4), creatine kinase (4 mg/ml), 300 mM creatine phosphate) and 2 mM guanidine-HCI (Gu-HCI) in a final volume of 100 l. In the presence of the reversible 2C inhibitor Gu-HC1, pre-initiation replication complexes (PIRCs) form but initiation of negative-strand RNA synthesis is halted (4). To monitor protein synthesis, 12 l from each reaction was removed to a separate tube, and 15 tCi [35S]methionine (1200 Ci/mmol, Amersham Pharmacia) was added. The unlabeled reactions and the [35S]methionine-labeled reactions were incubated at 340C for a total of 4 h.

During the 340C incubation, duplicate 1 pl samples were removed from the

labeled translation reactions at each indicated time point. These samples were added to 100 pl 3% casamino acids (3% casamino acids in 0.IN KOH), then TCA-precipitated and counted in a scintillation counter. TCA precipitations were not begun until all time points were taken. In addition, 2.5 pl of the [35S]methionine-labeled reactions were removed into 50 pl Laemmli Sample Buffer (20% v/v glycerol, 2% v/v SDS, 62.5 mM Tris-HCI (pH 6.8), 72 mM BME, and 0.1% Bromo-phenol blue) at each time point for analysis by 10% SDS-polyacrylamide gel electrophoresis.






30


After incubation at 340C for 4 h, the PIRCs present in the unlabeled reactions were pelleted at 40C at 15,000 x g for 15 min. The supernatants containing the GuHCI were removed. The pellets were resuspended in 50 tl label mix containing 50% lx S10 buffer (40 mM Hepes-KOH (pH 7.4), 120 mM KCH3CO2, 5.5 mM Mg(CH3CO2)2, 10 mM KC1, 6 mM DTT, 1 mM CaC12, and 2 mM EGTA), 20% 10X reaction mix, 5 jtM non-radiolabeled CTP and 25 gCi [a-32P]CTP (400 Ci/mmol, Amersham Pharmacia). The resuspended pellets were incubated at 37C for 45 min unless otherwise noted. 350 p.l 0.5% SDS buffer was added to stop the reaction. The radiolabeled negative-strand RNA products were phenol:chloroform:IAA and chloroform:IAA extracted three times each and ethanol precipitated at 40C overnight. The purified RNAs were analyzed by methylmercury hydroxide (CH3HgOH) agarose gel electrophoresis and autoradiography (see below).



RNA Stability Assay

To measure RNA stability in HeLa cellular extracts, labeled transcript RNAs (6 pg) were incubated in 120 pl reactions that contained 50% HeLa S10 extract, 20% HeLa initiation factors, 10% 10X reaction mix and 2 mM Gu-HC1. RNAs were quantitated prior to use by spectrophotometry and TCA precipitation. The reactions were incubated at 340C for a total of 4 h. Samples were taken at 0, 0.5, 1, 2, and 4 h. At each time point, 20 jil from each reaction was removed into 400 jil 0.5% SDS buffer and vortexed.

To measure RNA stability by TCA precipitation, diiplicate 50 [l aliquots were taken from the RNA-0.5% SDS buffer mixtures and added to 1 ml chilled stop mix (7% TCA, 45 mM Na4P207" 10H20) with 5 jl yeast tRNA (10 mg/ml, Sigma). These samples were placed on ice and approximately 3 ml 5% TCA was added. Standard TCA






31


precipitations were performed using filters pre-soaked in stop mix. TCA precipitations were not begun until all time points were taken.

The remainder of the RNA-0.5% SDS buffer samples were extracted with

phenol:chloroform:IAA and chloroform:IAA three times each and ethanol precipitated overnight at 40C. The amount of RNA remaining at each time point was determined after electrophoresis of the RNA on a CH3HgOH agarose gel and by phosphorimager analysis.



CHHgOH Agarose Gel Electrophoresis

RNAs were recovered from ethanol by centrifugation at 15,000 x g for 15 min at 40C, dried briefly and resuspended in 10 tl 1.5x methylmercury hydroxide buffer (75 mM Boric acid, 7.5 mM Na2B40710 H20, 15 mM Na2SO4, 1.5 mM Na2EDTA). After the RNA pellets resuspended completely, 5 glI of 150 mM CH3HgOH (Alfa Aesar, Ward Hill, MA) was added and the RNAs incubated at room temperature for 5 min. 15 gl sample buffer (750 gM CH3HgOH buffer, bromophenol blue/glycerol, 60 mM CH3HgOH) was added and the RNAs were loaded on a vertical (Hoefer apparatus) 3 mm 1% agarose gel containing 5 mM CH3HgOH in a fume hood. Gels were run at constant amperage (72 mAmp) in lx CH3HgOH buffer (50 mM Boric acid, 5 mM Na2B40710 H20, 10 mM Na2SO4, 1 mM Na2EDTA) with buffer re-circulation. Re-circulation was stopped when the dye front reached mid way through the gel. Upon completion, the gels were stained with ethidium bromide in 0.5M ammonium acetate (NH4CH3CO2) for 5 min and the RNAs visualized by UV light. The gels were photographed and then dried on chromatography paper. Gels were exposed to X-Omat Blue XB-1 film (Kodak, Rochester, NY) with a Biomax intensifying screen (Kodak) at -700C.






32


TCA Precipitation

Proteins

The amount of acid-precipitable protein made in the in vitro translation reactions was determined by TCA precipitation. As described above, 1 pl samples were taken in duplicate at 0 and 4 h and added to 100 p1l 3% casamino acids in 0.1N KOH. Approximately 3 ml of 5% TCA was added to each sample in borosilicate tubes (Fisher Scientific) and vortexed. The tubes were incubated on ice for 15 min. Type HA linch filters (Millipore, Bedford, MA) were pre-soaked in chilled 5% TCA prior to use. Next, each sample tube was filled with chilled 5% TCA and vacuum-filtered. Tubes were rinsed 2x each with 5% TCA and the rinses passed over the filter. Filters were removed from the vacuum apparatus and placed in scintillation vials. 5 ml CytoScint ES scintillation fluid (ICN, Costa Mesa, CA) was added and the acid-precipitable proteins were counted with a Beckman LS5801 scintillation counter.



RNAs

RNA stability was measured in part by quantitation of acid-precipitable RNA present at each time point tested in the RNA stability assay. As described in the "RNA Stability Assay" section, duplicate 50 p1 aliquots from the RNA-0.5% SDS buffer mixtures were added to 1 ml stop mix with 5 pld yeast tRNA. Approximately 3 ml chilled 5% TCA was added and the samples were incubated on ice for 15 min. Samples were then precipitated by the method described for protein precipitation, except filters were pre-soaked in chilled stop mix prior to use.






33


10% Polyacrylamide Gel Electrophoresis

Protein products from in vitro translation/replication assays were resolved by 10% SDS-PAGE. 0.75 mm polyacrylamide gels (10% acrylamide/bisacrylamide (29:1), 187 mM Tris-HCI (pH 8.8), 0.1% SDS, 0.05% APS, 0.005% TEMED) were prepared in a vertical apparatus (Hoefer), and covered with 1 ml water-saturated butanol until polymerized. The butanol was washed away and a 4% stacking gel (4% acrylamide/bisacrylamide (29:1), 62.5 mM Tris-HCI (pH 6.8), 0.1% SDS, 0.05% APS,

0.005% TEMED) was poured. Protein samples in lx Laemmli sample buffer were heated to 1000C for 3 min before loading. 20 [tl of each 50 l protein sample was loaded per well and electrophoresed at constant amperage (12.5 mAmp) until the dye front passed through the stacking gel. Amperage was then increased to 20 mAmp until the dye front ran off the gel. The gels were fluorographed, transferred to chromatography paper, and dried at 80oC for 45 min. Dried gels were exposed to X-Omat Blue XB-1 film at 700C.



Fluorography

Polyacrylamide protein gels were fluorographed before drying. Two methods were used interchangeably in this study.

DMSO-PPO

Gels were soaked in 50% TCA for a minimum of 30 min at room temperature to fix the proteins. The TCA was removed and 100 ml DMSO added. The DMSO was exchanged for fresh DMSO every 10 min for 30 min total. The gels were then rocked in a 22% DMSO-PPO solution (2,5-Diphenyloxazole) for 25 min. The DMSO-PPO was rinsed away with running water for 1 h.






34




Amplify

Gels were rocked in lx Fix (40% CH30H, 10% CA3COOH) for 30 min at room temperature. The solution was removed and Amplify Fluorographic Reagent (Amersham Pharmacia) was added to cover the gels. Gels were then rocked for 20 min at room temperature and transferred to chromatography paper.



Cell Maintenance

HeLa Cells

HeLa S3 cells were maintained in suspension cultures containing Joklik's

modified Minimal Essential Medium (Life Technologies) supplemented with 5% bovine calf serum (Life Technologies) and 2% fetal clone (Hyclone Laboratories, Logan, UT). Cells were kept from 2 x 105 to 4 x 105 cells/ml at 370C and passed daily.



BSC-40 Cells

Monolayers of BSC-40 cells were maintained in Eagle's Minimal Essential

Medium (EMEM, Life Technologies) supplemented with 10% fetal clone. Cells were split 1:10 two times per week and kept at 370C.



Transfection of RNA

RNAs were transfected by the DEAE-dextran (Amersham Pharmacia) method. Choice of plates (six-centimeter or six-well) and cell type (HeLa or BSC-40) depended upon whether new virus stocks were desired or whether the infectivity of the RNA was to be determined. A solution of phosphate-buffered saline (PBS, pH 7.4) (2.6 mM KCI, 1.5 mM KH2P04, 137 mM NaCl, 8.6 mM Na2HPO4) was made which contained 0.1 mg/ml






35


MgCI2 and CaCI2. DEAE-dextran (10 mg/ml) was added to 475 pl of this solution to make a final concentration of 0.5 mg/ml. The appropriate amount of transcript RNA for the purpose was then added as indicated in the relevant sections below. When using sixwell dishes, 200 ll RNA mixtures were used. Cells were rinsed with the PBS/MgC12/CaCI2 solution without DEAE and the transcript RNA mixture was applied. Cells were rocked every 12 min for a total of 45 min. The DEAE-dextran solution was aspirated and the cells were rinsed with the PBS/MgCl2/CaCl2 solution without DEAE. Media was then added to the cells. The type of media added was determined by the purpose of the transfection. The dishes were incubated at 370C unless otherwise noted.



Determination of RNA Infectivity

BSC-40 cells in six-well dishes were transfected with RNA transcripts as

described. Between 15 ng and 125 ng of RNA were used. lx Methylcellulose overlay (EMEM with 5% fetal clone, 1% methylcellulose) was added after the final rinse with the PBS/MgC12/CaCI2 solution lacking DEAE. The transfected cells were incubated at 370C for 3 days and stained with lx crystal violet. Infectivity was expressed as the number of plaque forming units (PFU)/tg RNA transcript.



Preparation of Primary Virus Stocks

HeLa cells in six-centimeter dishes were transfected with 3 to 5 gg of the

appropriate transcript RNAs by the DEAE-dextran transfection protocol. 5 ml EMEM was added to each dish. The dishes were incubated at 370C until complete cytopathic effect (CPE) was reached, or up to 5 days. The newly prepared virus stocks were frozen and thawed three times, transferred to 15 ml conical tubes and centrifuged at 2,000 rpm






36


for 5 min in a JS-4.2 rotor. Cleared supernatants were transferred to fresh 15 ml conicals and stored at -200C.



Determination of Plaque Morphology

Serial dilutions of each primary virus stock were prepared by diluting 50 pl. of each virus stock into 450 lI PBS (pH 7.4) until the desired dilutions were obtained. Monolayers of BSC-40 cells in six-well dishes were infected with 200 tld of each dilution per well as described in the figure legends. 200 l PBS (pH 7.4) was used for mock infections. Cells were incubated at 370C (unless otherwise noted) and rocked every 10 min to keep the cells from drying. lx methylcellulose overlay was then added to each well. The dishes were incubated at the indicated temperatures for 2 to 3 days as noted. The methylcellulose overlay was removed and the plaques were stained with lx crystal violet.



Plaque Purification and Amplification

Monolayers of BSC-40 cells in six-well dishes were infected with 200 pl of

appropriately diluted primary virus stocks. The cells were covered by 3 ml agar overlay (Ix EMEM supplemented with 5% fetal clone, 1% Bacto-Agar, 0.008% Phenol Red solution (Life Technologies)) and incubated at 370C. Individual plaques were picked with a sterile Pasteur pipette into 400 pl EMEM (lacking fetal calf serum) 2 days postinfection. To amplify the purified virus, HeLa cell monolayers (4 x 106 HeLa cells) in T25 flasks were infected with the virus plugs. After adsorption of the virus for 30 min at 37C (with rocking every 10 min), 5 ml EMEM was added and the incubation was continued until complete CPE was observed. The dishes containing infected cells in






37


EMEM were freeze-thawed three times. The media was transferred to a 15 ml conical tube and cellular debris was removed by centrifugation at 2,000 rpm for 5 min in a JS-4.2 rotor. Supernatants were stored at -200C.



RT-PCR

2.5 ml of the appropriate virus stocks were transferred to blackcap ultracentrifuge tubes (Beckman). The volume in each tube was increased to about 6 ml by the addition of sterile PBS. Balanced tubes were centrifuged at 40,000 rpm for 2 h at room temperature in a Ti-70 rotor to pellet virus. The supernatants were discarded and 100 pl

0.5%SDS buffer was added to each pellet. The virus pellets were resuspended by stirring with a micro stir bar for a minimum of 30 min. Resuspended virus particles were transferred to Eppendorf microfuge tubes with sterile Pasteur pipettes. The capsid proteins were disrupted by six phenol:chloroform:IAA extractions. Traces of phenol were removed by an equal number of chloroform:IAA extractions. The liberated viral RNAs were ethanol precipitated at -200C overnight.

RNAs were pelleted by centrifugation at 15,000 x g for 15 min at 40C. The

pellets were dried briefly and resuspended in 20 pl sterile H20. The Titan One-Tube RTPCR System (Roche) was used according to the manufacturer's instructions. The RT cycling profile consisted of 490C for 30 min, followed by 940C for 1.5 min. Then the reactions were subjected to 10 cycles of 940C for 30 sec, 520C for 30 sec and 680C for 1 min. Next, 15 cycles of 94C for 30 sec, 520C for 30 sec and 680C for 1 min + 5 sec/cycle were performed. The reactions were completed by incubation at 680C for 7 min. The DNA products were checked on a 1% agarose gel for size. The DNA was






38


purified on Quantum Prep PCR Kleen Spin columns and sent to the DNA Sequencing Core Laboratory for sequencing of the 3'NTR.














CHAPTER 3
EFFECT OF DELETIONS IN THE 3'NTR SINGLE-STRANDED REGION



To examine the relationship between the 7418GUAAA sequence and events that occur during viral replication, various mutations in this conserved single-stranded region were created. The deletion mutant RNAs utilized were A7418G, A7422A, A7421A2, A7419UA3, and A7418GUA3 (Figure 1-3). These mutations were made in the wildtype, poly(A)8o background and will be referred to simply as AG, AA, AA2, AUA3, and AGUA3. Virus derived from transcript RNA was tested in vivo for plaque morphology and reversion. RNA transcripts containing the deletions were also tested in vitro to determine their ability to translate and initiate negative-strand RNA synthesis.



Plaque Morphology

Transcript RNAs containing deletions in the conserved region were transfected into BSC-40 cells and virus stocks were prepared as described in Chapter 2. The virus stocks were then used to infect BSC-40 monolayers at 370C. Infected plates were stained with crystal violet after three days to visualize plaques. Plaque phenotypes are depicted in Figure 3-1.

In previous work, RNA containing the AGUA3 deletion in a short poly(A) 11 background was transfected into cells to create a virus stock (V. Chow, unpublished results). Upon infection with this virus stock, minute-sized plaques were detectable.




39






40








WT AGUA3










AUA3 AA2









AA AG











Figure 3-1: Comparison of plaque morphologies between 3'NTR deletion mutant virus stocks. 3 pg of each RNA were transfected into HeLa cells and incubated at 37oC with liquid EMEM until CPE was reached, or up to 5 days. The resulting virus stocks were diluted as shown and used to infect BSC-40 monolayers at 370C. Plates were stained with crystal violet after 3 days.






41


Because the plaques were very small, the genomic RNA was isolated from the virus stock and sequenced. The results showed that the 7418GUA3 deletion was still present and no other changes had occurred in the 3'NTR sequence (V. Chow, unpublished results). After multiple passages of the virus stock, the plaque morphology remained unchanged (V. Chow, unpublished results), a further indication that this deletion was severe. In the present study, the AGUA3 mutation was created in a long poly(A)so background. RNA transcribed from the AGUA3/(A)so0 construct was used to create virus stocks, which were used to infect BSC-40 monolayers as described. As observed previously, only minutesized plaques were detected (Figure 3-1), indicating the loss of an important viral function for growth.

Revertant virus was readily produced in cells transfected with AUA3 RNA (Figure 3-1). These revertants were characterized, and all were found to contain an increased or completely restored single-stranded region. The AUA3 revertants are discussed in detail in Chapter 4. Upon infection with virus stock made from transfection of AA2 RNA, a background of small plaques was seen and the presence of large plaque revertants was clear. Revertants were purified from isolated plaques and amplified once in cells with liquid media. Genomic RNA was isolated from the plaque-purified virus and sequenced. All revertants contained the wildtype 7418GUAAA single-stranded sequence. Infection with virus stocks of AG and AA virus was also performed. Plaques of similar size were produced from these infections. The plaques produced had a similar plaque phenotype to wildtype virus, and revertants were not discernable. The results obtained from these in vivo studies indicate that the conserved region carries out a function that is needed for efficient virus growth. The RNAs were also tested in vitro to determine whether the






42


deletions in the single-stranded region affected RNA stability, translation, or initiation of negative-strand RNA synthesis.



Stability of RNA Containing a Complete Deletion of the Conserved Region

Deletions in the single-stranded region may disturb the tertiary structure of the 3'NTR as a whole, and as a result lead to a loss of RNA stability. Wildtype RNA and RNA with a complete deletion of the single-stranded region (AGUA3) were therefore tested in vitro for stability as described. Briefly, [32P]-labeled RNA transcripts were incubated in HeLa S10 translation/replication reactions at 340C for 4 h. At each time point, 20 pl samples were removed and mixed with 0.5% SDS buffer, phenol:chloroform extracted, and ethanol precipitated. The recovered RNAs were then characterized by CH3HgOH agarose gel electrophoresis (Figure 3-2A), and the amount of labeled fulllength RNA remaining at 4 h was compared to the total amount of each RNA present at

0 h by phosphorimager analysis of the gel. After 4 h, 33% of wildtype RNA remained intact, and 30% of the AGUA3 RNA remained (Figure 3-2A, compare lanes I and 5, and lanes 6 and 10). These results agree with the amount of labeled RNA recovered by TCA precipitation of samples taken over the 4 h incubation period at 340C (Figure 3-2B). Approximately 30% of the labeled RNA remained after 4 h for both the wildtype and AGUA3 RNAs. Therefore, there was no significant difference in the stability of AGUA3 RNA and wildtype RNA in the HeLa S10 translation/replication reactions. These results suggest that RNAs with smaller deletions in the single-stranded region would also be stable.






43
A

WT AGUA3 Time (h) 0 .5 1 2 4 0 .5 1 2 4 Full-lengthRNA






1 2 3 4 5 6 7 8 9 10


B
RNA Stability 100
90 WT
80 -U- AGUA3

$; 70
o
60
50
40
30

20 10
0 I I I
0 .5 1 2 4 Time (h)


Figure 3-2: Deletion of the conserved single-stranded region does not affect RNA
stability. A. 6 glg of [a-32P]CTP-labeled RNA transcripts were incubated in HeLa S10
translation/replication reactions at 340C. 20 l samples were removed into 0.5% SDS buffer at the indicated time points as described and resolved by CH3HgOH agarose gel
electrophoresis. Full-length RNA is marked. B. Graph of TCA precipitable RNA
remaining at each time point. Each point represents the average of two samples.






44


Effect of 3'NTR Deletion Mutations on Translation and Polyprotein Processing

Each transcript RNA was tested for translation activity using a cell-free system as described (5). Each transcript RNA was incubated at 340C in HeLa S10 translation reactions containing [35S]methionine for 4 h. Samples were taken at 0 h and 4 h. The amount of labeled viral protein synthesized in each reaction was determined by TCA precipitation (data not shown) and 10% SDS-PAGE (Figures 3-3 and 3-4). There was no significant difference in the translation of the mutant RNAs compared to wildtype RNA. The rate of protein synthesis from RNAs with 3'NTR deletions was normal (data not shown). SDS-PAGE revealed that proteolytic processing of the viral polyprotein was unaffected by the 3'NTR deletions.



The Conserved Region is Important for Negative-Strand RNA Synthesis

Transcript RNAs containing the various deletions in the single-stranded region

were tested in vitro for negative-strand RNA synthesis as described. Although RNA with a complete deletion of the conserved single-stranded region, AGUA3, was stable and supported wildtype levels of translation, detectable accumulation of negative-strands for AGUA3 RNA was not observed after 45 min at 370C (Figure 3-5, compare lanes 2 and 4). These results, when compared to the small plaque phenotype obtained after infection of cells with the AGUA3 virus stock, indicated that negative-strand RNA synthesis was not completely inhibited by the AGUA3 mutation but that it was below the limits of detection in the in vitro assay. RNA containing a slightly smaller deletion, AUA3, was also tested in vitro for negative-strand RNA synthesis as compared to wildtype. Following translation, the RNAs were assayed for replication after 1.5 h incubation at 370C (Figure 3-6). Loss






45






Mock WT AA2 AGUA3 Time (h) 0 4 0 4 0 4 0 4








SP3
S 3CD

S P2

-i 3DPol

2BC


88 -VP 0

3 2C
SVPI


1W VP3


1 2 3 4 5 6 7 8






Figure 3-3: Translation of wildtype, AA2 and AGUA3 RNAs. 5 pLg of each transcript RNA was incubated in 100 ll HeLa S10 translation reactions at 340C in the presence of [35S]methionine. 2.5 l samples were removed at 0 and 4 h and analyzed by 10% SDSPAGE. The positions of specific viral proteins are indicated to the right.






46





Mock WT AUA3 AG Time (h) 0 4 0 4 0 4 0 4





/P1 P3
-3CD
9 P2
-3DPol
-2BC



-VPO
-VPI


-VP3


1 2 3 4 5 6 7 8








Figure 3-4: Translation of wildtype, AG and AUA3 RNAs. 5 pg of each transcript RNA was incubated in 100 pl HeLa S 10 translation reactions at 340C in the presence of [35S]methionine. 2.5 pl samples were removed at 0 and 4 h and analyzed by 10% SDSPAGE. The positions of specific viral proteins are indicated to the right.






47









WT AA2 AGUA3 GuHCl added +

Full-lengthRNA







1 2 3 4





















Figure 3-5: AGUA3 and AA2 RNAs are significantly inhibited for negative-strand RNA synthesis. 5 pg of transcript RNAs were incubated for 4 h at 340C in HeLa S10 translation/replication reactions. PIRCs were resuspended in [ct-32P]CTP labeling buffer and incubated for 45 min at 370C. Reactions were resolved by CH3HgOH agarose gel electrophoresis. Full-length negative-strand RNA is indicated.






48


of four nucleotides from the conserved region again resulted in a severe defect in negative-strand RNA synthesis; the amount of RNA synthesis for AUA3 was below detectable levels (Figure 3-6, compare lanes 1 and 2). Lack of detectable replication of the AUA3 RNA showed that the remaining G7418 in the single-stranded region was not sufficient to support efficient RNA synthesis.

RNA with a deletion of two nucleotides, AA2, was also tested in comparison to wildtype. The RNAs were incubated for 45 min at 370C as described. The defect in negative-strand RNA synthesis was still very pronounced for AA2, which replicated to about 1% of the wildtype level (Figure 3-5, compare lanes 2 and 3).

RNAs containing shorter nucleotide deletions were tested in vitro for negativestrand RNA synthesis. These experiments showed that removal of just one nucleotide from the single-stranded region significantly affected the RNA's ability to replicate. Two RNAs with different single-nucleotide deletions were tested: AG and AA (Figures 3-6 and 3-7A, respectively). The different deletions in these RNAs affected negative-strand RNA replication similarly. Mutant AG RNA replicated at 19% of the level observed with wildtype RNA after 1.5 h at 370C (Figure 3-6, compare lanes I and 3). AA RNA replicated at 13% of its wildtype control after incubation at 370C for 2 h (Figure 3-7A, compare lanes 4 and 5). Plaques observed after infection with AA and AG virus stocks were similar in size (Figure 3-1).

Overall, the in vitro assays demonstrated that replication was increasingly

diminished as the length of the single-stranded region was reduced. Revertants of RNAs that contained deletions 7419UA3 or 7421A2 in the single-stranded region revealed full or partial restoration of the single-stranded region. No effect on RNA stability or translation






49














WT AUA3 AG


Full-length
RNA






2 3
















Figure 3-6: Deletion of a single nucleotide from the conserved region negatively affects replication. AUA3 and AG RNAs were incubated in HeLa S10 translation/ replication reactions for 4 h at 340C for the formation of PIRCs. The PIRCs were resuspended in buffer containing [ca-32P]CTP and incubated at 370C for 1.5 h. Labeled negative-strand RNAs were electrophoresed on a CH3HgOH agarose gel.






50


was observed in the deletion mutant RNAs. These results indicate that the singlestranded region serves an important role in replication of the RNA at the level of negative-strand RNA synthesis.



Temperature Sensitivity of AA

RNAs AA and AA2 were utilized to study the effect of subtle differences in the length of the single-stranded region on replication at various temperatures. Previous work suggested that virus derived from transfection of RNA containing the AA2 mutation in a short poly(A)12 tail background was temperature-sensitive in vivo (V. Chow, unpublished results). To determine if this effect could be reproduced in vitro, RNAs containing the indicated deletions in the poly(A)so background were tested. The poly(A)so background was chosen over the poly(A)12 background because of the significant increase in replication observed in vitro with the longer poly(A) tail (5). The RNAs were translated in HeLa cellular extracts for 4 h at 340C, and then incubated at three different temperatures (32.50C, 370C, and 39.50C) to allow synthesis of negativestrand RNA (Figure 3-7). After 2 h at the indicated temperatures, the amount of RNA synthesis was determined by phosphorimager analysis of the electrophoresed RNAs. The single-nucleotide deletion, AA, decreased synthesis of full-length negative-strand RNA to 13% of wildtype levels at 32.50C and 37oC, and to 5% of wildtype at 39.50C (Figure 3-7, compare lanes 1-2, 4-5, and 7-8, respectively). However, the single nucleotide deletion was not as detrimental to replication as deletion of two nucleotides from the singlestranded region. As observed previously (Figure 3-5), RNA containing the 7421A2 deletion was greatly impaired and replicated to less than 1% of wildtype RNA levels at






51



A 32.50C 370C 39.50C





Full-length
RNA






1 2 3 4 5 6 7 8 9


B

Negative-Strand RNA Synthesis AA2 Negative-Strand RNA Synthesis
200000 1000 WT
180000- 900 160000-AA 800 3 140000 700 y 120000- 600 S S CE 100000 'a 500 o 0 80000- 400
60000 30040000- 200 20000 100
0" 0 t a 1
32.5 37 39.5 32.5 37 39.5 Temperature (oC) Temperature (oC) Figure 3-7: AA2 RNA is temperature-sensitive in vitro. A. CH3HgOH agarose gel of
negative-strand RNA synthesized in vitro at 32.50C, 370C, or 3905 C. PIRCs were
formed at 340C for 4 h, pelleted, and resuspended in labeling buffer. Reactions were split
and incubated for 2 h at the temperatures shown. The position of the full-length product RNA is indicated. B. Results of phosphorimager analysis of the labeled RNA products shown in Panel A. Results are plotted as the amount of full-length negative-strand RNA
present (in PI units) at each temperature. For clarity, results for AA2 RNA are also shown
plotted against a smaller scale in the graph to the right.






52



370C 39.50C




WT




10-6 10-5 AA




10-5 10-4










10-4 10-3 Figure 3-8: AA2 virus yields large-plaque revertants. 5 ptg of WT, AA, and AA2 RNAs were transfected into HeLa cells at 32.50C to create virus stocks. These stocks were diluted as shown and used to infect BSC-40 monolayers at 32.50C, 370C, and 39.50C. Selected wells from plates infected at 370C and 39.50C are depicted.






53


both 32.5oC and 370C (Figure 3-7, compare lanes 1 and 3, 4 and 6). At 39.5oC, no RNA synthesis for AA2 was detectable (Figure 3-7, lane 9). The results are depicted graphically in Figure 3-7B. Analysis of each individual RNA between the three temperatures revealed that wildtype levels of replication decreased by 33% at 32.50C compared to 370C, and that AA decreased by 26% at the lower temperature. There was no apparent difference in the level of replication of AA2 at either 32.50C or 37oC, and the sharp decrease in replication at 39.5oC is evident. Both wildtype and AA were inhibited at 39.50C compared to 37C, decreasing by 39% and 76%, respectively.




Table 2: Virus titers resulting from infection at three temperatures (PFU/ml) 32.50C 370C 39.50C WT 5.5 x 107 1.05 x 10' 6.0 x 107 AA 9.2 x 107 4.5 x 107 2.9 x 107 AA2 4.25 x 107 1.4 x 107 <1 x 103
AA2 Revertants --- 2.5 x 105 2.75 x 10'


To determine whether the in vitro results that indicated temperature-sensitivity were reflective of the in vivo situation for both AA and AA2 RNAs, the RNAs were transfected into cells and virus stocks were generated at 32.50C. These stocks were plaqued at 32.50C, 37oC, and 39.50C (Figure 3-8). Only the relevant plates are shown. Virus titers for all temperatures and RNAs are presented in Table 2 and Figure 3-9. In general, wildtype virus replicated to the highest level at 370C, with a relatively small decrease in viral titer at the low and high temperatures. The trend for AA virus replication showed a decrease in titer when the temperature was raised from 32.50C to 370C, and another slight






54









Virus Titers 109
--+- WT

108 AA
---- AA2

107


106


105


104 103
32.5 37 39.5
Temperature (oC)









Figure 3-9: AA2 virus is temperature-sensitive in vivo. Plot of virus titers resulting from infection of BSC-40 cells with WT, AA, and AA2 virus stocks at 32.50C, 370C, and 39.50C. Titers used to create this graph are listed in Table 2. The value plotted for AA2 at 39.50C does not include the titer of AA2 revertants.






55


decrease as the temperature increased from 370C to 39.50C. Indications of temperature sensitivity were again observed for AA2 virus. This virus stock contained large-plaque revertants that were detected at 370C (Figure 3-8). Sequencing of plaques isolated at 39.5oC revealed that they contained an addition of two A residues which restored the single-stranded region sequence to wildtype. The titer of the wildtype revertants at 370C was 2.5 x 105 PFU/ml (Table 2). Therefore, the vast majority of plaques observed at 39.50C (titer 2.75 x 105 PFU/ml) for this virus stock were most likely wildtype revertants. The plaque phenotype of wildtype virus matched that of the AA2 virus stock at 39.50C (Figure 3-8). The drastic decrease in virus titer seen at the higher temperature (Table 2 and Figure 3-9), strongly supported a temperature sensitive phenotype of AA2 RNA.














CHAPTER 4
CHARACTERIZATION OF AUA3 REVERTANTS



Revertants of AUA3 Contain Insertions in the Deletion Site

Analysis of AUA3 RNA replication in vitro showed that this deletion in the singlestranded region reduced the generation of negative-strand RNA to below detectable levels. Transfection of AUA3 RNA led to the production of revertant virus with intermediate to large plaque phenotypes (Figure 3-1). Previous experiments conducted in this laboratory resulted in the isolation of these revertants, and determination of the revertant sequences was made (V. Chow, unpublished results). The revertants contained nucleotide insertions in the original deletion site. Four different revertant sequences were found after multiple transfections. They were 7419UUUA, 7419UUA, 7419UUC and 7419JUU. Revertant UUUA restored the single-stranded region to its natural size of five nucleotides. The others lengthened the single-stranded region to four nucleotides. No other changes in the 3'NTRs of the revertants were found.

To prove that these insertions were responsible for the observed phenotypes, the revertant sequences were reconstructed by two-step PCR in a wildtype poly(A)so background. Cells were transfected with the reconstructed revertant RNA transcripts to generate virus stocks. The plaque morphologies of stocks generated from UUUA, UUA, and UUC RNAs were identical to those of the original plaque-purified revertant viruses (Figure 4-1). These viruses maintained their plaque phenotypes after multiple passages,




56






57
WT AUA3














UUUA








UUA








UUC




Purified Virus Reconstructed Figure 4-1: Confirmation of revertant plaque phenotypes in the reconstructed revertants of AUA3. Virus stocks of plaque-purified revertants (left) are compared to virus stocks created by transfection of RNAs containing the indicated sequences in the single-stranded region (right). Plates were incubated at 370C. Infections with WT and AUA3 are shown at the top for reference.






58













WT UUU






























Figure 4-2: Plaque phenotype of UUU virus. Virus stocks were made by transfection of WT or UUU RNA at 370C, and used to infect BSC-40 monolayers at 370C. Plaques were stained after 3 days.






59


unlike revertant UUU. Transfection of UUU RNA led to the immediate production of a mixed plaque population in the resulting virus stock (Figure 4-2). This result parallels previous observations of UUU virus, which reverted after two passages from a smallplaque to a large-plaque phenotype (V. Chow, unpublished results). Revertants of UUU RNA are discussed in Chapter 6.



Full or Partial Restoration of the Single-Stranded Region Increases Replication

Transcripts of the reconstructed RNAs were assayed in vitro for translation and replication as described. The RNAs were incubated at 340C to allow translation and formation of PIRCs to occur. Translation levels and polyprotein processing were normal for each of the revertants tested (Figure 4-3). After 4 h at 340C, the pelleted PIRCs were resuspended in labeling buffer and incubated for 45 min at 370C. The level of full-length negative-strand RNA synthesis was then determined by phosphorimager analysis (Figure 4-4). UUUA RNA only replicated to 11% of wildtype, UUA to 6%, and UUC to about 1% (Figure 4-4, compare lane 2 to lanes 4, 6 and 5, respectively). As observed previously, RNA synthesis for the parent RNA, AUA3, was below detectable levels (Figure 4-4, lane 3). In a separate experiment, replication was undetectable for UUU RNA after 45 min at 370C (Figure 4-5, lane 3). As expected, the level of negative-strand RNA synthesis for AUA3 was also undetectable (Figure 4-5, lane 2). Replication of UUA in this experiment was 6% of wildtype (Figure 4-5, compare lanes 1 and 4), which matched previous results with this RNA. Translation and polyprotein processing were not affected by the UUU sequence (Figure 4-6). A summary of these results is presented in Table 3.






60





AUA3 Revertants

Mock WT AUA3 UUUA UUC UUA Time (h) 4 0 4 0 4 0 4 0 4 0 4


P3
--3CD
P 2
3DPo




-vPO




W g W-VP3



1 2 3 4 5 6 7 8 9 10 11











Figure 4-3: Translation is unaffected in the reconstructed revertants compared to
wildtype. 5 gg of each transcript RNA was incubated in 100 pl HeLa S 10 translation
reactions at 340C in the presence of [35S]methionine. 2.5 pl samples were removed at 0
and 4 h and analyzed by 10% SDS-PAGE. The positions of specific viral proteins are
indicated on the right.






61






AUA3 Revertants

WT AUA3 UUUA UUC UUA GuHC1 added + Full-length *
RNA







2 3 4 5 6

















Figure 4-4: Revertants of AUA3 show an increase in negative-strand RNA synthesis.
5 pg of the indicated transcript RNAs were incubated for 4 h at 340C in HeLa S 10
translation/replication reactions. PIRCs were then resuspended in buffer containing
[a-32P]CTP and incubated for 45 min at 370C. GuHCI was added to one WT reaction as a negative control. RNAs were resolved by CH3HgOH agarose gel electrophoresis. Fulllength negative-strand RNA is marked.






62










AUA3 Revertants
WT AUA3 UUU UUA


Full-length
RNA





1 2 3 4



















Figure 4-5: UUU RNA does not replicate to detectable levels in vitro. 5 gtg of each
transcript RNA was incubated for 4 h at 340C in HeLa S 10 translation/replication
reactions to form PIRCs. PIRC pellets were resuspended in labeling buffer containing
[a-32P]CTP and incubated for 45 min at 370C. RNAs were resolved by CH3HgOH
agarose gel electrophoresis. Full-length negative-strand RNA is indicated.






63






AUA3 Revertants

Mock WT AUA3 UUU UUA Time (h) 0 4 0 4 0 4 0 4 0 4


P1 mn 3CD

P2
3DPOl

2BC






l VP3


1 2 3 4 5 6 7 8 9 10









Figure 4-6: UUU RNA translates and processes the viral polyprotein normally. Translation was monitored as a control for the replication reaction described in Figure 45. 5 pg of each transcript RNA was incubated in 100 pl HeLa S10 translation reactions containing [35S]methionine at 340C. 2.5 pl samples were removed at 0 and 4 h and analyzed by 10% SDS-PAGE. Specific viral proteins are identified to the right.






64


Thus, with the exception of UUU RNA, the sequences present in the singlestranded region of the revertants increased their ability to replicate as compared to AUA3 RNA. Reversion of AUA3 indicates that the single-stranded region is important for replication. The undetectable level of RNA synthesis observed with UUU RNA in vitro also supports the idea that the single-stranded region is needed for efficient initiation of negative-strand RNA synthesis. The insertion of UUU in the deletion site most likely does not produce a single-stranded region due to the potential formation of base pairs between the inserted sequence and the poly(A) tail (Figures 1-1 and 6-2).




Table 3: Length and sequence of the single-stranded region affect replication

RNA Sequence Number of Bases % Replication
WT GUAAA 5 100
Revertant UUIUA GUUUA 5 11
AG UAAA 4 19 AA GUAA 4 13
Revertant UUA GUUA 4 6 Revertant UUC GUUC 4 1
Revertant UUU GUUU 4 Undetectable
AA2 GUA 3 1
AUA3 G 1 Undetectable AGUA3 0 Undetectable



AUAi Revertants Are Not Produced In Vitro

Rz/AUA3 transcript RNA was tested for its ability to produce virus in HeLa S10 translation reactions to explore the viability of performing experiments designed to test the polymerase slippage/ recombination model of reversion (Chapter 5) under these






65


conditions in vitro. The Rz/AUA3 RNA contains a ribozyme that removes two G residues from the 5' end of the positive-sense transcript RNA, yielding an authentic 5' end. This allows for the synthesis of both negative and positive-strand RNA. Wildtype ribozyme RNA, without a deletion in the 3'NTR, has been shown to produce virus in HeLa extracts after 24 h at 340C (unpublished results).

To test for the ability of Rz/AUA3 RNA to make virus in vitro, transcripts were

incubated in HeLa S 10 translation reactions for 24 and 48 h. The reactions were RNaseA and TI nuclease treated and used to infect HeLa cells. The reaction containing wildtype virus (derived from the wildtype ribozyme RNA) induced complete CPE in 24 h with liquid media. However, no CPE was observed 6 days post-infection with either of the Rz/AUA3 reactions. As expected, the wildtype virus stock produced plaques upon infection (titer: 6.5 x 106 PFU/ml), but neither of the Rz/AUA3 stocks produced plaques. In a parallel experiment, Rz/AUA3 transcript RNA and wildtype ribozyme transcript RNA were incubated in cell extracts containing [35S]methionine. The RNAs translated equally after 24 h as measured by TCA precipitation of [35S]methionine-labeled proteins (data not shown). These data suggest that the reversion mechanism utilized by AUA3 RNA which is easily induced in vivo, is significantly inhibited in vitro.














CHAPTER 5
MODEL FOR REVERSION OF AUA3 RNA BASED ON POLYMERASE SLIPPAGE AND RECOMBINATION



Revertants obtained from transfection of AUA3 RNA contained insertions of sequences UUUA, UUA, UUC and UUU in the deletion site. These nucleotide sequences were shown to be responsible for the observed revertant phenotypes as described in Chapter 4. The level of replication of these revertants was increased by the full or partial restoration of the length of the single-stranded region. A model based on polymerase slippage and recombination was proposed to explain the reversion mechanism. This model was tested by the use of marker mutations in the AUA3 RNA. A description of the model and results from the marker mutation analysis follows.



Description of the Polymerase Slippage/Recombination Model

Examination of the sequences found in revertants of AUA3 RNA revealed that each of the four groups of nucleotides inserted in the deletion site was found 3' of the deletion site (Figure 5-1). Based on this observation, a polymerase slippage/ recombination model was proposed to explain the generation of these revertants. Generation of revertant UUU can be explained by a single polymerase slippage event as the polymerase copies the positive strand template into negative strand RNA. In this case, the polymerase pauses at the G7418 residue without copying it, slips back three nucleotides, and then copies the UUU sequence a second time. The polymerase then



66







67






A U U
G G U G U G A U A C G A c U U A
G C
A U
C G
U U U U AUARevertants C G
A U IJUUA U A
C G UUA C G
AC G C U UUU G 7418 A A A 5' UUUU UUUUJLCUUU
AAAAA AAAAAGAGGCU
A A

A
A
AA
Poly(A)00













Figure 5-1: 3'NTR structure showing the proposed locations of the AUA3 revertant sequences. This observation formed the basis for the polymerase slippage/recombination model of reversion. Deletion of 7419UA3 is depicted by red dashes. Revertant sequences are color-coded according to their suggested origins 3' to the deletion site.






68


copies the G7418 and continues to elongate along the template strand normally. The resulting negative-strand RNA is used as a template for the synthesis of positive-sense RNAs containing the UUU insertion.

The other revertants, UUUA, UUA, and UUC, contained sequences that were not located directly next to the deletion site. The model to explain the generation of these particular revertants had two variations, depending on the template source of the inserted nucleotides. The formation of revertants containing nucleotide insertions derived from the same template strand may have been the result of the polymerase slipping and/or "jumping" along the same template RNA (Figure 5-2). Consideration that the sequences may instead be obtained from a secondary template strand suggested that the polymerase switched templates during negative-strand synthesis.

To generate the revertants that contained insertions of nucleotides non-adjacent to the AUA3 deletion site, the polymerase must successfully insert a small number of bases into the site without also inserting the intervening nucleotides. This model is depicted in Figure 5-2. This model suggests that the required events take place as the negative strand is copied, because poliovirus recombination by a copy-choice mechanism occurs during negative strand synthesis (28). The polymerase initiates the negative-strand RNA at the 3' end of the template, and synthesizes the RNA until it reaches the remaining G7418 residue of the conserved region (Figure 5-2, A-B). The polymerase pauses at the base of the stem-loop structure, without copying the G7418 nucleotide. The polymerase, with the nascent negative-strand RNA, then slips back along the template strand (toward the 3' end) and copies a short stretch of nucleotides (Figure 5-2, C). To avoid incorporation of the bases that lie between the deletion site and the insertion sequence, the polymerase
























Figure 5-2: Polymerase slippage/recombination model of reversion. In this figure, the polymerase may either remain associated with the same RNA molecule upon which negative-strand RNA synthesis was initiated, or the polymerase and nascent strand may strand-switch to a second RNA molecule as described below. A. Negative-strand RNA synthesis is initiated at the 3' end of the positive-strand template by the polymerase (active site is represented by the green circle). B. The polymerase reaches the G7418 (red) and pauses, without copying it into the nascent strand. C. The polymerase and the nascent strand slip back on the template RNA, or a strand-switching event occurs such that the polymerase and the nascent strand associate with a second RNA molecule 3' to the deletion site. A short stretch of nucleotides (UUUA, in this example) is copied a second time. D. The polymerase slips forward on the template RNA to the G7418 without copying the intervening sequence. The G7418 is copied and synthesis of the negativestrand RNA continues normally. E. Positive-strand RNA synthesis is initiated from the 5' end of the negative-strand template. F. Many positive-strand RNAs are synthesized which contain the inserted sequence (UUUA) in the original deletion site.






70




3DP01 Active Site A 5'< --------(
UUUUUCt I 'AAUUCGGAGAAAAAAAAAAAAA
Poly(A)o0oo (+)


UU
GCC U U U A A CU UU(-) B 5'< AAAAAGAAUU
UUUUUCt I\ AAUUCGGAGAAAAAAAAAAAAA
Poly(A)8o-oo (+)


UUU
G U UU U A AA CU U C 5'< -AAAAGAA UU U
UUUUUCtI 1. AAUUCGGAGAAAAAAAAAAAAA
Poly(A)8so. (+)



CC U G cc U A A CU UUUUUUU
AAAAAGAA A UU A CUU D 5'< U A A A A AA A AA A
UUUUUCt LI ,\AUUCGGAGAAAAAAAAAAAAA
Poly(A)80oloo (+)



(+) CAAA
E 3'< ......... p 5'A(-)

1

F 5'< 3'(+






71


must slip forward along the template (toward the 5' end) until it again reaches the G7418 residue. Nucleotide G7418 is then copied, and synthesis of the negative strand continues normally (Figure 5-2,D). The newly synthesized negative-strand RNA molecule contains nucleotide insertions in the deletion site, which were observed upon synthesis of positivestrand RNA (Figure 5-2, E-F). As an alternative to the idea of a single RNA template involved in reversion, nucleotides located on a second RNA template may be inserted into the deletion site during negative-strand synthesis as the result of a strand switching event. In this case, the polymerase and the nascent strand disengage the first template strand and associate with a second template RNA 3' to the deletion site (Figure 5-2, C). Of course, one can imagine that the polymerase performs a combination of the movements described in this model.



Testing the Polymerase Slippage/Recombination Model

An overview of the polymerase slippage/recombination model is depicted in Figure 5-2. To determine whether sequences 3' of the 7419UA3 deletion site served as templates for the inserted revertant sequences, marker mutations U7427A and U7430C were introduced separately into AUA3 transcript RNA (Figure 5-3). The markers were engineered into specific nucleotide sequences suspected of being copied by the polymerase during reversion of AUA3 RNA (Figure 5-1). The RNAs containing the marker mutations were transfected into HeLa cells using the DEAE-dextran method and virus stocks were created. These stocks were used to infect BSC-40 cells in order to determine plaque morphology.






72


AUA3 RNA :



5'NTR
A pppGpG 5NTR A
U
AAAAA AAAAAGAGG C U AA A A Poly(A)s8


AUA3 + marker A:



5'NTR
B pppGpG ; A A UUUU CU U U
U
AAAA AAAAAGAGGC U
A A
A A A Poly(A)s8


AUA3 + marker C:



5'NTR
C pppGpG 5 AA UUUU U C U C U
U
AAAAA AAAAAGAGG C U AA A A Poly(A)s8








Figure 5-3: Positions of marker mutations used to investigate the polymerase slippage/recombination model. A. AUA3 transcript RNA. Nucleotides copied during the generation of the observed revertants (according to the model) are color-coded. B. RNA containing marker mutation U7427A. The arrow indicates the mutation, and the nucleotide bulge is illustrated. C. RNA with marker mutation U7430C. The mutation is marked with an arrow. Other important features of the RNAs are labeled.






73


The presence of marker mutation U7427A disrupted the proposed UUC template sequence (Figure 5-1), resulting in a 7426UUC-*7426UAC change (Figure 5-3). The marker mutation U7427A greatly inhibited viral RNA replication. In multiple attempts, cells transfected with this RNA did not exhibit significant signs of cytopathic effect, and virus stocks made from these transfections had very low titers and minute plaque phenotypes. The formation of the nucleotide bulge created by this marker mutation and the change in the pyrimidine composition of Stem X in addition to the original 7419UA3 deletion severely inhibited viral RNA replication and prevented the formation of largeplaque revertants.

Marker mutation U7430C altered the nucleotides thought to be the source for insertion of 7430UUA and 7429UUUA sequences into the deletion site (Figure 5-3). This marker mutation preserved the base pairing of Stem X as well as its pyrimidine composition. The plaque morphology of virus stocks created by transfection of U7430C mutant RNA was mixed, and the titers were significantly higher than U7427A virus stock titers. These virus stocks were used to infect BSC-40 cells and an agar overlay was applied. Isolated revertant plaques were picked after 2 days, purified virus stocks were prepared, and the vRNA isolated by phenol extraction and ethanol precipitation. The 3'NTR sequence from each revertant was determined after RT-PCR amplification. The results are summarized in Table 4. All but three of twenty-five purified viruses contained insertions of three or four nucleotides in the original deletion site. The three viruses that did not contain insertions retained the original 3'NTR deletion, suggesting the presence of second-site mutations. These vRNAs were not sequenced further to determine the locations of the reversions.






74


Possible insertion of the C7430 marker mutation into the deletion site was observed only in one of the revertants, which contained an addition of UCU. However, three different revertant sequences were generated that conflicted directly with the basic arguments of the polymerase slippage/recombination model. In one revertant, the presence of the sequence UUUA was observed in the deletion site. Eight revertants from three separate virus stocks contained UUA in the single-stranded region. The presence of the C7430 marker in these revertants was verified by sequencing. This marker mutation was designed to specifically disrupt the template for UUUA and UUA, making it impossible for those nucleotides to be copied directly into the deletion site as required by the polymerase slippage/recombination model.




Table 4: Revertant vRNA sequences obtained from AUA3/U7430C RNA transfection Inserted Nucleotide Sequence

UUUA UUUC UUA UUC UAU UCU AUA3 # of Revertants 1 2 8 7 3 1 3

Virus Stock(s) 1 1 1,5, 6 1 1 1 1,2




Further evidence that was inconsistent with the polymerase slippage/

recombination model came from the isolation of revertants that contained UAU in the single-stranded region. This novel sequence is not found in the sequence that is 3' of the deletion site in the AUA3 RNA. Based on the sequences of revertants generated in the






75


presence of marker C7430, an alternate model of reversion was proposed and tested as described in Chapter 6.














CHAPTER 6
INVESTIGATION OF A POLYMERASE SLIPPAGE/POINT MUTATION MODEL FOR THE REVERSION OF AUA3 RNA



The mechanism of reversion for AUA3 RNA could not be explained by the

polymerase slippage/recombination model described in Chapter 5. Results obtained from the use of marker mutations in AUA3 RNA contradicted that model, but led to the development of a second reversion model. In the new model, a polymerase slippage event during negative strand synthesis is followed by point mutation to produce the observed revertant sequences. An explanation of the second model and description of the experiments designed to test it are discussed below.



Description of the Polymerase Slippage/Point Mutation Model

In this second reversion model, the observed AUA3 revertant sequences are produced by a polymerase slippage event followed by point mutation of the inserted nucleotides (Figure 6-1). As in the first model, the polymerase initiates negative-strand RNA synthesis on the AUA3 RNA, then pauses at the G7418 without copying it (Figure 61, A-B). The polymerase then slips back on the template and copies a stretch of three or four U residues from the 7423UUUUU sequence adjacent to the deletion site (Figure 6-1, C). Then the polymerase continues synthesis of the nascent strand normally (Figure 6-1, D). According to this model, the insertion of the UUU or UUUU complementary sequence into the deletion site results in a negative-strand RNA intermediate. This



76




























Figure 6-1: Polymerase slippage/point mutation model of reversion. A. The polymerase (active site is represented by the green circle) initiates negative-strand RNA synthesis at the 3' end of the positive-strand RNA template. B. The polymerase pauses on the G7418 without copying it into the nascent strand. C. After pausing briefly, the polymerase and the nascent strand slip back on the template and copy a short stretch of nucleotides from the poly(U) region immediately adjacent to the deletion site. D. The G7418 is copied and negative-strand RNA synthesis continues. E. Positive-strand RNA synthesis of the intermediate negative-strand RNA is completed, yielding positive-strand RNAs with insertion of three to four U's in the deletion site. F. On a second round of replication, the intermediate positive-strand UUU RNA is copied into new negative-strand RNA molecules. Point mutations occur in some cases, as shown. G. The negative-strand RNAs are copied into many positive-strand RNAs. In this example, UUC is the final sequence in the single-stranded region.






78



3DPOI Active Site

A 5'<-------- (-)
UUUUUCUUUAAUUCGGAGAAAAAAAAAAAAA
Poly(A)801oo (+)



GCC U UUU
A CU
SA A CUU B 5'< AAAAAGA
IEDTIJUUCUUUAAUUCGGAGAAAAAAAAAAAAA
Poly(A)80-10 (+)


CCU UUUUUUUU() A AA CU C 5'< OAAA AGAA UU
C 5'1<- ---- A
lt'tUUUCUUUAAUUCGGAGAAAAAAAAAAAAA
Poly(A)80-10 (+)

3(') u
CC UUU
GC U U A AA CUUUUUUU A AAAAAGAA UU
D 5'< CAA
U1t!tUUCUUUAAUUCGGAGAAAAAAAAAAAAA
SPoly(A)8o-oo (-+)

(+)
3' CAAA5'()
E5
5' < ....0U0uu 3'(+)




F 5' < ..UUU 3'(+)
(+')-3' CAAG 5'(-)


5' < G UUC
.........3' (+ )






79


intermediate negative-sense RNA is copied into positive-strand RNA (Figure 6-1, E). To complete the reversion process, the polymerase must make a point mutation within the poly(U) stretch during a second round of negative-strand RNA synthesis. The polymerase, upon transcribing the UUU positive-strand RNA intermediates into negativestrand RNA, may create in some a successful point mutation in the U stretch (Figure 6-1, F). These RNAs would serve as templates for the synthesis of many positive-strand RNA molecules containing the advantageous point mutation (Figure 6-1, G). While this model suggests that the polymerase slippage and point mutation events occur during synthesis of the negative strand, it is possible that they also occur during elongation of positive strand RNA.

As described above, this model suggests that an intermediate RNA is formed which is altered by point mutation. The U nucleotides which were copied during the synthesis of the intermediate positive-strand RNA (Figure 6-1, C-E) have the potential to form base-pair interactions with residues in the poly(A) tail. The effect is the extension of Stem X, instead of the production of a single-stranded region (Figure 6-2). A point mutation is required to disrupt the extended Stem X so that a single-stranded region is released. It is possible that in some cases, a point mutation will occur as the U nucleotides of the intermediate are copied (Figure 6-1, C).



Support for a Polymerase Slippage/Point Mutation Model of Reversion

Determination that the polymerase slippage/recombination model could not

explain the generation of all of the revertants necessitated further examination of the data. One of the revertants observed after transfection of AUA3 RNA contained UUU in the deletion site. Virus containing UUU in the deletion site reverted after two passages in






80













UUU Revertant:



VPg-pUpU 5'NTR C A A UUUI I CUUU
U
AAAAAAAA AGAGGC U
AAA Poly(A)soo




















Figure 6-2: Predicted structure of the UUU revertant RNA intermediate. The vRNA from the UUU revertant is not predicted to contain a single-stranded region due to interactions with the poly(A) tail. Wildtype U residues normally found in Stem X are colored in light blue. Those copied by the polymerase by a slippage event are colored dark blue. The G7418 is shown in red. The other major features of the RNA are labeled.






81


vivo to a larger-plaque phenotype (V. Chow, unpublished results). Revertants of AUA3 RNA and AUA3/U7430C RNA that fully or partially restored the single-stranded region invariably began with a U residue. Thus, it was hypothesized that insertion of UUU or UUUU into the deletion site may be an intermediate step in the reversion process for AUA3 RNA. Based on this idea, the polymerase slippage/recombination model was proposed (Figure 6-1) and tested.

First, sequence data from revertants obtained during testing of the polymerase slippage/recombination model was reviewed. Revertants obtained from transfection of AUA3/U7430C RNA (Chapter 5, Table 4) that could not be explained by the polymerase slippage/recombination model could be easily explained within the definitions of the polymerase slippage/point mutation model. This is because the marker mutation U7430C did not alter the poly(U) stretch located immediately adjacent to the UA3 deletion site. It is this poly(U) sequence which is hypothesized to be the template for U additions in the intermediate revertant RNAs. For example, generation of the single-strand sequences UUUA and UUA in the presence of the U7430C marker mutation (Chapter 5, Table 4) is explained as the result of insertion of three to four U residues into the UA3 deletion site, followed by a single point mutation during a subsequent round of replication. Insertion of the novel UAU sequence was interpreted as the result of point mutation of the second inserted U residue to an A.

Interestingly, a comparison of the two UUUC revertants isolated from

transfection of AUA3/U7430C RNA (Chapter 5, Table 4) resulted in an observation that further supported the point mutation model. While one of these revertants still contained the five wildtype U residues adjacent to the single-stranded region, the other revertant






82


(UUUC#2) had only four (Figure 6-3). Shortening of Stem X as was observed in this revertant could result from a situation in which only three U residues were initially inserted into the deletion site. When the point mutation occurred in this particular intermediate, the U residues which were copied into the deletion site were not altered; rather, the transition of the UUU intermediate RNA to the UUUC revertant sequence in this case probably occurred by point mutation of the first wildtype nucleotide of the original poly(U) region. This event would lead to restoration of the single-stranded region, and a Stem X that was one base-pair shorter than wildtype.

The polymerase slippage/point mutation model suggests that a UUU intermediate RNA leads to the observed revertant sequences. To determine whether the point mutation model could account for the various revertant sequences that were observed after transfection of AUA3 RNA, transcripts containing a single-stranded region with the proposed reversion intermediate sequence 7418GUUU was transfected into cells and virus stocks were prepared. The virus stocks prepared in three separate experiments contained viruses with mixed plaque morphologies (Figure 4-2). Revertant viruses were isolated from individual plaques and used to prepare first passage virus stocks. The virion RNA was isolated and sequenced. All of the revertants contained point mutations in the singlestranded region. The revertant RNA sequences obtained were UUA, UUC, UUUA, and UUUC (Table 5).

The revertant sequences UUA and UUC are clearly explained by the occurrence of single point mutations. The sequence UUUA in the single-stranded region arose in each of the three revertant virus stocks. Four of twelve revertants contained this sequence. Each of the revertants contained the wildtype number of nucleotides in Stem






83





A
Revertant UUUC #1: 5 U's after the A site


5'NTR
VPgpUpU 5'NTR u
U
C AA I I I ICUCU
U
AAAAA- AAAAAGAGGC U AAA A Poly(A).


B
Revertant UUUC #2: 4 U's after the A site


VPgpUpU 5'NTR

( AA t I t ICUCU
AAAAA-AAAAGAGGC U AA A A Poly(A).








Figure 6-3: Comparison of two revertants with UUUC insertions supports the polymerase slippage/point mutation model of reversion. AUA3/U7430C RNA was used to create virus stocks as described in the text. Two isolated revertants contained UUUC insertions. A. The first UUUC revertant. The G7418 is red. Inserted nucleotides are shown in dark blue. The marker mutation was present (green). As in wildtype RNA, five U residues (light blue) are located at the base of Stem X. B. UUUC#2 revertant. Colors are as described in "A". Only four U nucleotides (light blue) are found at the base of Stem X. The C7422 nucleotide in the single-stranded region is probably the result of point mutation of one of the original five U residues, and is therefore colored light blue.






84


X. These UUUA revertants fit the point mutation model if one considers the possibility that during negative-strand synthesis of the transfected UUU intermediate RNA, the polymerase slipped on the poly(U) tract, and copied an additional U into the deletion site.




Table 5: Revertant vRNA sequences observed after UUU RNA transfection Inserted Nucleotide Sequence

UUUA UUUC UUA UUC # of Revertants 4 2 2 4

Virus Stock(s) 1, 2, 3 3 1,3 1,2


The mutation of UUUU-UUUA would then occur during a subsequent round of negative-strand RNA synthesis. The sequence UUUC (Table 5), which was only found in one virus stock, could have been created in this manner as well. In conclusion, all of the revertants generated from UUU RNA, AUA3 RNA, and AUA3/U7430C RNA can be explained by the point mutation model of reversion.














CHAPTER 7
THE LENGTH OF THE POLY(A) TAIL HAS A DIRECT EFFECT ON INITIATION OF NEGATIVE-STRAND RNA SYNTHESIS



The poly(A) tail of poliovirus RNA plays an important role in RNA infectivity

and replication (50,53). The length of the poly(A) tail is critical for efficient initiation of negative-strand RNA synthesis. RNA transcripts with a poly(A)so tail replicate more efficiently than RNAs with a poly(A) i tail (5). It is unknown, however, if this difference in replication is a direct effect of poly(A) tail length on initiation, or if it is due to an underlying effect of the short poly(A) tail on RNA stability or translation. Wildtype RNA transcripts encoding a range of poly(A) tail lengths were tested in vitro to determine whether the difference in replicative ability between these RNAs was due to a deficiency in translation levels, polyprotein processing, or a loss of RNA stability. The RNAs were also tested in vitro to determine the relationship between tail length and the amount of negative-strand RNA synthesis. Infectivity of the different RNAs was also analyzed.



Relationship Between Polv(A) Tail Length and Initiation of Negative-Strand RNA Synthesis

It is known that the level of negative-strand RNA synthesis observed in vitro

decreases dramatically when the length of the poly(A) tail decreases from (A)80 to (A) 1

(5). However, it is not known if the relationship between poly(A) tail length and RNA synthesis is linear, or if there is a narrow range over which negative-strand RNA synthesis increases. To achieve a more detailed analysis of the effect of poly(A) tail


85






86


length on negative-strand synthesis, clones were engineered in the wildtype background that contained poly(A) tails of varying lengths. RNAs with poly(A)37 and poly(A)29 tails were compared against RNAs with poly(A)8so and poly(A)11 tails for synthesis of fulllength negative-strand RNA in vitro. The RNAs were incubated at 370C for 45 min, then phenol:chloroform extracted and resolved on a CH3HgOH agarose gel (Figure 7-1). Very little replication of the poly(A)11 RNA (Figure 7-1, lane 4) was observed. In fact, the poly(A) 1 RNA replicated to less than 1% of the poly(A)so RNA. In contrast, poly(A)37 and poly(A)29 RNAs replicated at levels similar to that observed with poly(A)so RNA (Figure 7-1, compare lanes 1, 2 and 3). These results suggested that the minimum poly(A) tail length that was required for efficient initiation of negative-strand synthesis was between 11 and 29 nucleotides.

Next, poly(A)29 RNA and poly(A)2o RNA were tested for negative-strand RNA synthesis in vitro. The results showed that decreasing the poly(A) tail length from (A)80 to (A)20 had only a small effect on the RNAs' ability to initiate negative-strand synthesis (data not shown). Therefore, additional cDNA clones were constructed as outlined in Chapter 2 which upon transcription yielded RNAs with a range of poly(A) tail lengths from 12 to 20 nucleotides long. Transcript RNAs made from these clones contained

(A)20, (A)15, (A)14, (A)13, and (A)12 tails. Use of these RNAs allowed for a detailed investigation of the minimum poly(A) tail length required for efficient initiation of negative-strand RNA synthesis.

The RNAs were tested in vitro against poly(A)so RNA for synthesis of negativestrand RNA as described (Figure 7-2). The amount of negative-strand synthesis observed






87











(A)80 (A)37 (A)29 (A)11

Full-length
RNA









1 2 3 4













Figure 7-1: Effect of poly(A) tail length on negative-strand RNA synthesis. 5 gg of each transcript RNA was incubated at 340C in HeLa S 10 translation/replication reactions for 4 h. PIRCs were pelleted and resuspended in [a-32P]CTP labeling buffer and incubated for
45 min at 37C. RNAs were characterized by electrophoresis on a CH3HgOH agarose
gel. The position of full-length negative-strand RNA is indicated.






88


with the poly(A)12 RNA was less than 1% of the amount observed with poly(A)so0 RNA (Figure 7-2, lane 6). In contrast, a significant amount of labeled negative-strand RNA was synthesized in the poly(A)13 RNA reaction (Figure 7-2, lane 5) as compared to the reaction containing poly(A)12 RNA (Figure 7-2, lane 6). Negative-strand RNA synthesis increased dramatically with each increase in poly(A) tail length from (A)14 to (A)20 (Figure 7-2, lanes 2-4). Figure 7-3 depicts the amount of negative-strand RNA synthesis as a function of poly(A) tail length. These results demonstrated that significant amounts of negative-strand synthesis were first detected in reactions containing poly(A)i3 RNA, and that replication continued to increase sharply as the poly(A) tail was lengthened in small increments.



Translation and Polyprotein Processing in Short Poly(A) Tail RNAs

Transcripts of wildtype RNAs with poly(A)so tails were tested in vitro for

translation against RNAs with poly(A) tails covering a range of sizes from (A)12 to (A)20. The RNAs were incubated in HeLa cytoplasmic extracts at 340C for 4 h. Gu-HCI prevented initiation of negative-strand RNA. After incubation, the protein products were analyzed by 10% SDS-PAGE and TCA precipitation in duplicate (Figure 7-4). Incorporation of [35S]methionine revealed that translation was not inhibited by the presence of poly(A)12 tails as compared to (A)80 RNA. Polyprotein processing was also unaffected in the RNAs with short tails. Therefore, the low level of negative-strand synthesis obtained with poly(A)12 RNA (Figure 7-2, lane 6) cannot be explained by a deficiency in the synthesis of viral replication proteins.






89












(A)80 (A)20 (A)15 (A)14 (A)13 (A)12

Full-length
RNA






2 3 4 5 6



















Figure 7-2: Determination of the minimal poly(A) tail length required for efficient
negative-strand RNA synthesis. 5 glg of the indicated transcript RNAs were incubated
for 4 h at 340C in HeLa S 10 translation/replication reactions. PIRCs were resuspended in
assay buffer containing [a-32P]CTP and incubated for 45 min at 370C. Reactions were
resolved by CH3HgOH agarose gel electrophoresis.




Full Text

PAGE 1

ROLE OF A CONSERVED 3'NTR SEQUENCE AND POLY(A) TAIL LENGTH IN POLIOVIRUS RNA REPLICATION By LYNN SHIELS SILVESTRI A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTL\L FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2001

PAGE 2

I dedicate this study to my parents, Thomas and Jean Shiels. for the caring support and encouragement they have given me throughout my personal and academic life. I feel truly blessed to be their daughter, and I will always be grateful for their loving guidance.

PAGE 3

ACKNOWLEDGEMENTS I would like to thank Dr. James Bert Flanegan for his guidance and advice throughout the course of my doctoral training. The time he spent was immeasurably helpful to me and is greatly appreciated. I feel fortunate to have had such a caring mentor. I would like to extend thanks to the members of my committee: Dr. Al Lewin, Dr. Sue Moyer, and Dr. Tom O'Brien. For kindly serving as my outside examiner, I thank Dr. Casey Morrow. Their knowledge of experimental design and insightftil analysis of the data strengthened this work. For performing the many initial experiments that evolved into this project, I thank Dr. Virginia Chow. My experience in the laboratory would not have been so rich had it not been for the helpful discussions and friendship of Joan Morasco. Dr. Sushma Abraham Ogram. Brian O'Donnell. Dr. Nidhi Sharma and Christy Jurgens. I would also like to thank both Joan Morasco and Dr. Dave Barton for teaching me experimental techniques and methods. I thank Dr. Lucia Eisner Smerage for her friendship and useftil advice. I offer thanks to Jesseca Parilla, who provided excellent technical assistance, and to Joyce Connors for much-needed administrative guidance. They are sincerely appreciated. Finally, I thank my husband, Dennis Silvestri, for his loving encouragement and tremendous support during this study. iii

PAGE 4

TABLE OF CONTENTS gage ACKNOWLEDGEMENTS "i LIST OF TABLES '^^ LIST OF FIGURES '^i" ABSTRACT ^ CHAPTER L BACKGROUND AND SIGNIFICANCE 1 3'NTR Sequences and Structures 3 ThePoly(A) Tail 10 CHAPTER 2. METHODOLOGY 15 Plasmid Construction 15 Primer-Based Mutagenesis by One-Step PCR 15 3'NTR Mutagenesis by Two-Step PCR 16 Poly(A) Tail Mutagenesis 19 Restriction Digestion 20 Vector Preparation and Ligation 21 Transformation of the Mutated Plasmids 21 Cycle Sequencing 22 Plasmid DNA Preparation 24 In Vitro Transcriptions 25 Unlabeled Transcripts 25 Labeled Transcripts 25 Preparation of HeLa Cellular Extracts 26 SIO Extracts 26 Initiation Factors 27 Preparation of Dialysis Tubing 28 In Vitro Translation/Replication in HeLa Cell Extracts 29 RNA Stability Assay 30 CHsHgOH Agarose Gel Electrophoresis 3 1 TCA Precipitation 32 Proteins 32 RNAs 32 10% Polyacrylamide Gel Electrophoresis 33 iv

PAGE 5

Fluorography 33 DMSO-PPO 33 Amplify 34 Cell Maintenance 34 HeLa Cells 34 BSC-40 Cells 34 Transfection of RNA 34 Determination of RNA Infectivity 35 Preparation of Primary Virus Stocks 35 Determination of Plaque Morphology 36 Plaque Purification and Amplification 36 RT-PCR 37 CHAPTER 3. EFFECT OF DELETIONS IN THE 3'NTR SINGLE-STRANDED REGION 39 Plaque Morphology 39 Stability of RNA Containing a Complete Deletion of the Conserved Region 42 Effect of 3'NTR Deletion Mutations on Translation and Polyprotein Processing 44 The Conserved Region is Important for NegativeStrand RNA Synthesis 44 Temperature Sensitivity of AA2 50 CHAPTER 4. CHARACTERIZATION OF AUA3 REVERTANTS 56 Revertants of AUA3 Contain Insertions in the Deletion Site 56 Full or Partial Restoration of the Single-Stranded Region Increases Replication 59 AUA3 Revertants Are Not Produced In Vitro 64 CHAPTER 5. MODEL FOR REVERSION OF AUA3 RNA BASED ON POLYMERASE SLIPPAGE AND RECOMBINATION 66 Description of the Polymerase Slippage/Recombination Model 66 Testing the Polymerase Slippage/Recombination Model 71 CHAPTER 6. INVESTIGATION OF A POLYMERASE SLIPPAGE/POINT MUTATION MODEL FOR THE REVERSION OF AUA3 RNA 76 Description of the Polymerase Slippage/Point Mutation Model 76 Support for a Polymerase Slippage/Point Mutation Model of Reversion 79 CHAPTER 7. THE LENGTH OF THE POLY(A) TAIL HAS A DIRECT EFFECT ON INITIATION OF NEGATIVE-STRAND RNA SYNTHESIS 85 Relationship Between Poly(A) Tail Length and Initiation of Negative-Strand RNA Synthesis 85 Translation and Polyprotein Processing in Short Poly(A) Tail RNAs 88 Effect of Poly(A) Tail Length on RNA Stability 92 V

PAGE 6

Relationship Between RNA Infectivity and Poly(A) Tail Length 95 CHAPTER 8. DISCUSSION 99 The Conserved SingleStranded Sequence in the 3'NTR is Required for Efficient Negative-Strand RNA Synthesis 99 Investigation of the Reversion Mechanism for AUA3 RNA 104 Poly(A) Tail Length Affects Initiation of Negative-Strand RNA Synthesis 110 Conclusion 115 LIST OF REFERENCES 116 BIOGRAPHICAL SKETCH 123 vi

PAGE 7

LIST OF TABLES Table Page 1 : Primers used in this study 18 2: Virus titers resulting from infection at three temperatures (PFU/ml) 53 3: Length and sequence of the single-stranded region affect replication 64 4: Revertant vRNA sequences obtained from AUA3/U7430C RNA transfection 74 5: Revertant vRNA sequences observed after UUU RNA transfection 84 6: Virus titers obtained from transfection of poly(A) tail length variants 95 vii

PAGE 8

LIST OF FIGURES Figure Eag? 1-1: The poliovirus genome 2 1-2: Model of the 3'NTR tertiary structure 4 1-3: Features of transcript RNAs containing 3"NTR deletion mutations 9 3-1 : Comparison of plaque morphologies between 3'NTR deletion mutant virus stocks 40 3-2: Deletion of the conserved single-stranded region does not affect RNA stability 43 3-3: Translation of wiWtype, AA2 and AGUA3 RNAs 45 3-4: Translation of wildtype, AG and AUA3 RNAs 46 3-5: AGUA3 and AA2 RNAs are significantly inhibited for negative-strand RNA synthesis 47 3-6: Deletion of a single nucleotide from the conserved region negatively affects replication 49 3-7: AA2 RNA is temperature-sensitive in vitro 51 3-8: AA2 virus yields large-plaque revertants 52 39: AA2 virus is temperature-sensitive in vivo 54 41 : Confirmation of revertant plaque phenotypes in the reconstructed revertants of AUA3 57 4-2: Plaque phenotype of UUU virus 58 4-3: Translation is unaffected in the reconstructed revertants compared to wildtype 60 4-4: Revertants of AUA3 show an increase in negative-strand RNA synthesis 61 4-5: UUU RNA does not replicate to detectable levels in vitro 62 viii

PAGE 9

46: UUU RNA translates and processes the viral polyprotein normally 63 51: 3'NTR structure showing the proposed locations of the AUA3 revertant sequences 67 5-2: Polymerase slippage/recombination model of reversion 70 53: Positions of marker mutations used to investigate the polymerase slippage/recombination model 72 61: Polymerase slippage/point mutation model of reversion 78 6-2: Predicted structure of the UUU revertant RNA intermediate 80 63: Comparison of two revertants with UUUC insertions supports the polymerase slippage/point mutation model of reversion 83 71: Effect of poly(A) tail length on negative-strand RNA synthesis 87 7-2: Determination of the minimal poly(A) tail length required for efficient negativestrand RNA synthesis 89 7-3: Effect of poly(A) tail length on negative-strand RNA synthesis 90 7-4: Translation is not affected by poly(A) tail length 91 7-5: Poly(A)i2 RNA is as stable as poly(A)8o RNA 93 7-6: Poly(A)io RNA is less stable than poly(A)8o RNA 94 7-7: RNA infectivity increases with increasing poly(A) tail length 96 78: Relationship between RNA infectivity and poly(A) tail length 97 81: Model for initiation of negative-strand RNA synthesis 113 ix

PAGE 10

Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy ROLE OF A CONSERVED 3'NTR SEQUENCE AND POLY(A) TAIL LENGTH IN POLIOVIRUS RNA REPLICATION By Lynn Shiels Silvestri May 2001 Chairman: James B. Flanegan. Major Department: Molecular Genetics and Microbiology The poly(A) tail and an absolutely conserved, single-stranded sequence in the poliovirus 3 'non-translated region (3'NTR) were examined to determine their roles in RNA replication. Mutagenesis of the conserved region revealed that small alterations of its length and sequence had a dramatic effect on the initiation of negative-strand RNA synthesis. In contrast, a significant portion of the poly(A) tail could be deleted before deleterious effects on replication were observed. RNAs containing deletions in the sequence 7418GUAAA were made and tested in a cell-free system. RNA translation and stability were normal. However, deletion of one nucleotide, 7422A, reduced negative-strand RNA synthesis to 13% of wdldtype levels. This detrimental effect was amplified by the deletion of two nucleotides (A7421AA), resulting in 1% replication compared to wildtype. Accumulation of negative-strand RNA X

PAGE 11

from transcripts with larger deletions, A7419UAAA or A7418GUAAA, was not measurable imder the conditions tested. Virus created through transfection of A7421AA RNA was temperature sensitive, and wildtype revertants were observed. Transfection of A7419UAAA RNA led to revertant virus that contained insertions of three or four differing nucleotides in the deletion site. Both the length and the sequence of the single-stranded region were important for negative-strand RNA synthesis. Two reversion models for A7419UAAA were proposed and tested. The results supported a reversion mechanism of polymerase slippage followed by point mutation. The effect of poly(A) tail length on viral replication was investigated using RNAs with poly(A) sequences that varied from 12 to 80 nucleotides long. Translation and RNA stability were normal. Negative-strand synthesis rapidly increased and then reached maximum levels when the poly(A) tail was increased in length from 13 to 20 nucleotides. The sharp increase in replication over this narrow size range most likely reflects the ability of the viral RNA to bind at least one molecule of poly(A) binding protein (PABP) and suggests that PABP plays an essential role in the initiation of viral RNA synthesis. These results significantly extend our understanding of the molecular mechanisms involved in the replication of RNA viruses and will facilitate the design of new approaches to control the replication of related viruses and their associated diseases. xi

PAGE 12

CHAPTER 1 BACKGROUND AND SIGNIFICANCE Poliovirus provides an excellent model for the study of replication mechanisms common to members of the picomavirus family. The organizational simplicity of the poliovirus genome and the development of a powerful in vitro system (2,3,5,14) have facilitated the study of precise events that occur during replication. This in vitro system provides for accurate translation, polyprotein processing, 3D^^ transcription and packaging of the RNA genome to yield infectious virus. The poliovirus genome (Figure 1-1 A) is 7.5 kb in length and consists of a single open reading frame (ORE) flanked on the 5' and 3' ends by non-translated regions (NTRs). The RNA is polyadenylated at the 3' end. The ORE is organized with PI at the 5' end, followed by P2 and P3. The PI region encodes the coat protein precursor, and P2 and P3 encode non-structural proteins. Complete cleavage of PI results in VP4, VP2. VP3 and VPl VPO is a precursor to both VP4 and VP2. Processing of P2 yields 2A'", 2B, and 2C, while P3 processing leads to the release of 3 A, 3B (VPg), 3C'", and 3D^\ The open reading frame encodes a surprisingly large number of proteins, as some of the protein precursor proteins, such as VPO, 3AB, 3CD''"', and 2BC, have unique functions in replication. The 5'NTR and 3'NTR contain c/'.s-active sequences that control translation and replication of the genome. The 5"NTR consists of a cloverleaf structure followed by the internal ribosome entry site (IRES). The cloverleaf has been shown to be important for 1

PAGE 13

2 NTR NTR 5' VPgpUpU P1/P2/P3 3' G G B U G U G A U A C G A C u U A G C A U C G Y U U u u C G A U U A C G C G 7418 A^ U A G A AAA 5— UUUU UUUUUCUUU u A A A A AAAAAGAGG y ^ S X A A A A A Poly(A)go.,oo Figvire 1-1 : The poliovirus genome. A. Schematic diagram of the organization of the poliovirus virion RNA, with the non-translated regions (NTRs) and other features indicated. B. Predicted secondary structure of the 3 'NTR. Stem-loop structures X and Y are labeled, and the absolutely-conserved nucleotides between them are shown in red. Nucleotides involved in the kissing interaction between the loop regions of X and Y are marked with asterisks. Formation of Region S by the poly(A) tail is illustrated.

PAGE 14

3 maintaining stability of the genome and plays a role in regulating the initiation of negative-strand RNA synthesis (7). The 3'NTR (Figure 1-lB) is the site of replication initiation, and consists of structures and sequences upon which the replication complex is formed. The focus of this study is to determine to what extent the conserved singlestranded 7418GUAAA 3'NTR sequence and poly(A) tail are involved in the replication of the poliovirus genomic RNA. 3'NTR Sequences and Structures Translation of viral proteins and replication of the viral RNA depend on cis-active sequences located in the 5' and 3'NTRs. The 3'NTR of poliovirus contains stem and loop structures (Figure 1 -1 B) that interact with each other to form a higher-order structure critical for the initiation of negative-strand RNA synthesis (Figure 1-2) (37,42,43). Although it is not yet known how these stem and loop structures function in relation to the replication complex, numerous studies have demonstrated that the presence of these elements, as well as the formation of the correct 3'NTR tertiary structure, are critical for efficient replication (35,43,49,51.59). Todd et al. deleted the entire 3'NTR of poliovirus and found that replication was reduced to extremely low levels (56). While this observation led to the suggestion that structures within the 3'NTR are not essential for the initiation of negative-strand RNA synthesis (56), the very low level of replication observed and the generation of revertants indicated that, in fact, the 3'NTR is very important for replication. Nucleotides in the loops of two phylogenetically conserved and computerpredicted stem-loop structures in the poliovirus 3"NTR, Stems X and Y (43), have been proposed to form a tertiary structure through base-pairing with each other in a "kissing

PAGE 15

4 5' — uuuu AAAA A G A U U A G A A A uu rGGGAUG CCCUAC CAGU CU GUCAUACUGG G uuuuucuu AAAAAGAG X Poly(A) tail ''kissing" interaction Figvire 1-2: Model of the 3'NTR tertiary structure. The 7418GUA3 sequence is red, and other absolutely conserved sequences are shown in orange. Stems X, Y and S, and the helical region formed by the kissing interaction are labeled. The poly(A) tail is green. This model is a modification of the structure described in Pilipenko et al., 1996.

PAGE 16

5 interaction" (Figure 1-2) (35,43,59). Sequences in the loop of Y have also been implicated in the formation of a pseudoknot by pairing with single-stranded sequences in the 30"^' coding region (27). Formation of pseudoknot structures in the 3'NTRs of the positive-stranded bamboo mosaic virus and turnip yellow mosaic virus has recently been shown to be important for their replication (1 1,58). Enzymatic and chemical probing studies of enteroviruses can support both of the proposed interactions (27,43), although there is some controversy over which of these possible structures carries the most significance in terms of enterovirus replication (27,35,43,5 1). The majority of the available data, however, supports the idea that the formation of the kissing interaction is most important for efficient replication of the viral RNA. Pilipenko et al. found that disruption of the nucleotides involved in the formation of the proposed pseudoknot structure in poliovirus RNA (27) did not lead to a significant decrease in RNA synthesis when compared to wildtype in dot hybridization assays (43). In addition, Pierangeli et al. were able to insert a 30 bp HAV-derived firagment between the 30"^' coding region and the poliovirus 3'NTR with no ill effect on plaque size, titer, or replication (42). In contrast, mutational analyses have shown that mutations or deletions in the entero viral 3'NTR that affect the formation of the kissing interaction greatly inhibit replication, and can lead to temperature-sensitive and lethal phenotypes (35,37,42,43,51,59). Revertants of mutants harboring such point mutations in the loop regions of X or Y were found to fully or partially restore the binding between the loops, with a corresponding increase in plaque size and replication (35,37,43). This phenotype was achieved either by true reversion, or by the introduction of second-site mutations in the unmutagenized loop involved in the kissing interaction. RNAs with second-site

PAGE 17

6 mutations that restored the kissing interaction replicated almost as well as wildtype RNA (35,37). This indicated that the formation of the tertiary interaction was more important for replication than the preservation of the specific nucleotide sequence involved (35,37), as has been suggested to be so for the pseudoknot structure in the turnip yellow mosaic virus 3'NTR (11). This idea was confirmed by Wang et al., who found that a complete switch of all of the nucleotides involved in the kissing interaction from one stem-loop structure to the other yielded a mutant RNA with a wildtype phenotype (59). Although these studies have shown that disruptions in the kissing interaction inhibit replication, the RNAs were not affected for translation (35,43,56) and were still infectious (43). It is clear that the kissing interaction has functional significance in the initiation of negativestrand RNA synthesis. The interactions that ultimately result in the formation of the required 3'NTR tertiary structure are likely to exist in other enteroviruses as well. All of the enteroviral 3'NTRs have been predicted to contain comparable secondary structures, and all have the potential to form a kissing interaction of either 5 or 6 base pairs (35,37,59). This observation may help to explain the fact that the poliovirus 3'NTR can be successfully exchanged with foreign enteroviral 3'NTRs, leading to chimeric viruses that are capable of replication (49). Successful replication of these chimeras suggests that the proteins comprising the replication complex are not absolutely specific for their corresponding 3'NTR. For instance, replacing the complete poliovirus 3'NTR with that of Coxsackie B4, HRV14 or bovine enterovirus yielded RNAs that were still infectious and able to replicate to varying degrees (49). Coxsackie A9, B3 and B4 3'NTRs fold into tertiary structures similar to poliovirus, and the Coxsackie A9 and 33 3'NTRs have been shown

PAGE 18

7 experimentally to support a kissing interaction that was essential for replication (35,37,59). The ability of the replication complex to initiate negative-strand RNA synthesis on a foreign enteroviral 3'NTR may be explained by the presence of general tertiary structures that are conserved between them. The conservation of specific secondary structures among the enteroviral 3'NTRs, and the potential to form comparable tertiary interactions through kissing interactions between nucleotides within these structures indicate that they are biologically important. However, replication of chimeric poliovirus RNA containing the HRV14 3'NTR, which has only one stem-loop structure (55) and therefore does not form a kissing mteraction, are more difficult to explain. Although there are no predicted tertiary forms that involve the HRV14 3'NTR stem-loop, it is important for replication, as deletions that affect the stem-loop structure result in decreased replication and deficient growth in vivo (49,55). It may be that due to structural dissimilarities, the assembly or composition of the poliovirus replication complex formed on the 3'NTR of HRV14 differs in some respects from a complex that forms on a poliovirus 3'NTR (35,49,54). The altered complex may be able to recognize unique initiation signals in the HRV14 3'NTR, or host proteins associated with it. in a manner sufficient to initiate negative-strand synthesis (35,49). The poliovirus replication proteins may not be able to form such an altered complex in all cases, however, as substitution of the HAV 3'NTR for the poliovirus 3'NTR led to a complete lack of RNA synthesis in dot blot hybridization assays after transfection of the cDNA (42). Substitution of the poliovirus 3'NTR with that of bovine enterovirus also leads to deficient replication (49). This is surprising, given the fact that

PAGE 19

8 the bovine enterovirus 3'NTR is proposed to fold into a tertiary structure similar to poliovirus (37). In addition to sharing similar 3'NTR higher-order structures, alignment of the 3'NTR sequences of all human enteroviruses revealed that they each contain an invariable region of eight nucleotides (Ann Palmenberg, personal communication). In the poliovirus 3'NTR this absolutely-conserved sequence, 7417GGUAAAUU7424, extends from the 3' side of the base of Stem Y to the 5' side of Stem X (Figure 1IB and 1-2). Computer-generated structural models and enzymatic probing studies of the poliovirus 3'NTR suggest that five of these conserved nucleotides, 7418GUAAA, form a singlestranded region between Stem Y and Stem X (Figure 1-1) (37,43). It has been suggested that the presence of a single-stranded region between Stem X and Stem Y allows the conformational bending of the RNA needed for the required kissing interaction to occur (37,43) (Figure 1-2). The retention of this specific sequence also indicates that it is critical to the virus life cycle. Despite these observations, no studies to date have focused specifically on the conserved single-stranded region and its significance in replication of the viral RNA. In this study, the function of the single-stranded region in translation and initiation of poliovirus replication was investigated. The effects of deletions in this conserved region were characterized by testing the ability of mutant transcript RNAs to initiate negative-strand RNA synthesis in a HeLa cell-free system, and by evaluating the in vivo growth properties of virus stocks generated througlj transfection of the mutated RNAs. Five deletion constructs were tested: AGUA3, AUA3, AA2, AA, and AG (Figure 13). Revertants were observed after transfection with RNAs containing deletions 7421A2

PAGE 20

9 5'NTR 3'NTR pppGpG GUAAA (A)8oCGCG AQUA 3: AUA 3: G AA 2: GUA AA: GUAA AG: UAAA Figure 1-3: Features of transcript RNAs containing 3'NTR deletion mutations. All deletion constructs begin with pppGpG at the 5' end and end with a portion of the Mlul restriction site following a poly(A)8o tail, as shown. The entire open reading frame for protein synthesis is present. The sequence of the conserved single-stranded region in the 3'NTR is depicted in red letters in the top diagram. The five deletions created in this region are listed, with the remaining nucleotides in red.

PAGE 21

10 and 7419UA3. These revertants contained insertions in the deletion site, which fully or partially restored the single-stranded region. Two reversion models were proposed. Testmg of the models revealed that a model based on polymerase slippage and point mutation could account for the generation of all of the observed revertants. The Polv(A) Tail All enteroviruses encode a poly(A) tail proximal to the 3'NTR. As with the single-stranded region, the poly(A) tail may contribute to the formation of the required tertiary structure of the 3'NTR. Nucleotides in the poly(A) tail are thought to form a double-stranded region (S) with the last four uracil residues of the BD*^' coding region, giving the tertiary structure more stability through helical stacking with Stem X and the kissing interaction (Figure 1-2) (35,43). There is the potential to form the S region in both the poliovirus-like and Coxsackie-like 3'NTRs. The poly(A) tail does not form a corresponding S region in the HRV14 3'NTR, which does not support a kissing mteraction (55). Since the kissing interaction is required for efficient replication of poliovirus, the ability of the poly(A) tail to create the S region is probably an important factor. That the length of the poly(A) tail has an effect on poliovirus replication at the level of negative-strand RNA synthesis was demonstrated by experiments conducted in vitro with poliovirus RNA transcripts containing short or long poly(A) tails (5). The tail in the short poly(A) tail construct utilized by Barton et al. (5) has recently been confirmed to be 1 1 nucleotides in length. Transcripts with these poly(A)i 1 tails were greatly inhibited for initiation of negative-strand synthesis compared to poly(A)8o RNAs. According to current models for the establishment of Stem X and Region S ui the

PAGE 22

11 poliovinis 3'NTR, a minimum poly(A) tail of nine nucleotides is needed (43). Therefore, the low level of replication obtained with poly(A)i i RNA can not be readily attributed to the lack of proper formation of required 3'NTR strucUires. The poly(A) tail has been found to be important in other aspects of the viral life cycle, which may be a reflection of the ability to form the above interactions. It is knovra that the length of the poly(A) tail is important in the infectivity of poliovinis genomic RNA, with a 20-fold reduction in infectivity of RNAs treated with RNaseH in the presence of oligo(dT) (53). Samow has shown that poly(A)i2 tails are 10% as infectious as poly(A)n~ioo tails (50). When RNAs with shortened poly(A) tails were used to infect HeLa cells, the progeny virus contained wildtype tail length RNA (53). In vivo lengthening of short poly(A) tails has also been observed for Sindbis virus, and Sindbis virus RNAs lacking poly(A) tails had reduced infectivity (48). Bovine coronavirus RNA with shortened poly(A) tails exhibited delayed replication in vivo, and the resulting progeny virus had increased poly(A) tail length that correlated to the increase in replication (52). These observations indicated that the length of the poly(A) tail has important roles in infectivity and replication. These results also led to the hypothesis that RNAs with short tails might be less stable than RNAs with longer tails, or that the short tails caused translation deficiency (50). It is known that the poly(A) tails of eukaryotic mRNAs serve a regulation fimction in the translation process (19,36). In eukaryotic mRNAs, eukaryotic initiation factor eIF4E binds to the cap structure present at the 5' end of the RNA. elF4E also binds the amino terminus of elF4G, a scaffold protein that also binds eIF4A at its carboxy terminus (19). Together, elF4A, eIF4E, and eIF4G form the elF4F holoenzyme complex

PAGE 23

12 (19,36). The middle portion of the eIF4G scaffold protein associates with eIF3 (19), which in turn interacts with the 40S ribosomal subunit. Thus, translation initiation depends on the formation of the eIF4F complex to bring the 40S ribosomal subunit (bound by elF3) to the cap (bound by eIF4E) (19). An interaction between the abundant cytoplasmic poly(A) binding protein (PABP) (20) and eIF4G has also been shown (24). Binding of PABP to eIF4G increases binding of PABP to poly(A) (30). These observations led to the formation of a closed-loop model of translation initiation for eukaryotic capped mRNAs. Atomic force microscopy provided direct evidence of mRNA circularization (63). All of the translation factors required for initiation of translation on capped mRNAs are purported to be required for initiation of RNAs containing IRESs, except for eIF4E (19). The eIF4F complex is able to bind to the IRES in the absence of a cap structure, and may recruit ribosomes to the RNA (41). As in capped mRNAs, communication between the 5' and 3'NTRs has been proposed for rotavirus RNA. The interaction is believed to occur via the binding of the non-structural viral protein NSP3 to the 3'NTR (46) and its association with elF4G at the 5' end (44). Patton et al. have also suggested that direct interactions between sequences in the 3'NTR and 5'NTR result in the formation of a secondary structure that enhances replication (39). Evidence for the existence of a closed-loop structure has also recently been described for poliovirus (7). It was foimd that the insertion or deletion of four nucleotides from the 5' cloverleaf destabilized the RNAs and led to a significant decrease in the level of negative-strand RNA synthesis, an event initiated at the 3'NTR. Stability was restored by the addition of a cap structure, but the level of negative-strand RNA synthesis was not increased. These

PAGE 24

13 results indicated that poliovirus RNA forms a circular complex that regulates stability and replication. This complex may be formed by interaction of PABP at the 3'NTR and poly(rC) binding protein (PCBP) at the 5"NTR (7,16). No significant increase in translation of viral proteins was observed upon stabilization of the 5'cloverleaf mutants with a cap structure (7), suggesting that the closed-loop complex, which enhances the translation of capped eukaryotic mRNAs, does not serve the same role in poliovirus RNAs. However, interaction of the 5' and 3'NTRs may be an important regulator of the switch between translation and the initiation of negative-strand RNA synthesis (7). In agreement with these data, comparison of translation levels between poliovirus poly(A)ii and poly(A)8o RNA in vitro demonstrated that the short poly(A)ii RNA was not inhibited for translation (5). This result suggested that the poIy(A) tail in the IREScontaining poliovirus RNA does not play a significant role in the stimulation of translation, unlike the poly(A) tails of capped eukaryotic mRNAs. The effect of the poly(A) tail on translation of RNAs containing IRES sequences in lieu of a cap structure was recently examined using recombinant RNA expressing the HTV capsid protein p24 driven by the encephaiomyocarditis virus (EMCV) IRES (36). It was found that such RNAs with and without poly(A) tails reached similar levels of translation after 90 min at 30C in standard rabbit reticulocyte lysates (36). It remained possible that the low level of negative-strand RNA synthesis of poliovirus poly(A)i i RNA (5) was due to a lack of stability as compared to poly(A)8o RNA. Since the majority of proteins were made within the, first 2 h of incubation, and replication was assayed after 4 h (5), it is possible that RNA degradation occurred after 2 h that could cause a significant overall decrease in negative-strand RNA synthesis. The

PAGE 25

14 PABP present in eukaryotic cells serves a stabilizing function when bound to the poly(A) tract by preventing the activity of 3' exonucleases (8,60) (for review see (9)). While it was theoretically possible that PABP could bind the short tail RNA to stabilize it, formal assessment of the stability of the poly(A)i i RNA has not yet been made. To examine the function of the poly(A) tail in poliovirus RNA replication, transcripts with poly(A) tails of various lengths were tested for stability, translation, and initiation of negative-strand RNA synthesis. The data presented in this study describe in detail the relationship between tail length and the initiation of negative-strand RNA synthesis. These results were correlated to RNA infectivity. Results obtained in stability assays of short poly(A) tail RNA suggest a role for PABP and support a model of initiation of negative-strand RNA synthesis that requires the viral protein VPg. Finally, while the data show that the length of the poliovirus poly(A) tail is not a factor in translation, it may function to help form a circular complex important for the initiation of negative-strand RNA synthesis. These results will form the basis for future experiments to better define the function of the poly(A) tail in replication initiation and its possible significance in bringing the 3'NTR and 5'NTR together into a circular complex.

PAGE 26

CHAPTER 2 METHODOLOGY Plasmid Construction Primer-Based Mutagenesis by One-Step PCR One mutagenesis approach that was attempted in the creation of the various 3'NTR deletion clones utilized touchdown PCR to insert a unique EcoRl site in the poly(A)8o tail of the wildtype clone. The resulting clone contained the EcoRl site immediately after the first 12 nt of the poly(A) tail, which was followed by an additional 72 A residues. The EcoRl site was positioned such that it would provide a convenient restriction site for mutagenesis of the 3'NTR. Mutagenesis could thus be accomplished by a single PCR reaction using a mutagenic primer which spanned the EcoRl site of the template DNA and a second primer which annealed upstream of a second unique restriction site. The resulting PCR fragment would then be cut at both restriction sites and ligated back into the vector fragment derived from the original EcoRl clone. The initial EcoRl clone, containing the EcoRl site in the poly(A) tail and a wildtype 3'NTR, was tested. Transcripts containing wildtype poly(A) tails or interrupted tails translated and synthesized negative-strand RNA equally in vitro (data not shown). This indicated that small numbers of nucleotide changes, which disrupt the absolute homopolymeric sequence of the poly(A) tail, do not diminish the ability of the RNA to replicate. Cells fransfected with EcoRl RNA yielded virus with plaque morphology identical to virus derived from (A)8o RNA transfection (data not shown). Attempts to 15

PAGE 27

16 deteraiine the sequence of the poly(A) tail in EcoRl -derived virus through RT-PCR and cycle sequencing were not successful. Although presence of the EcoRl sequence was not detrimental in initial experiments, a two-step PGR approach was finally used to introduce the desired mutations into the single-stranded region. The advantage of the two-step PGR approach was that the final 3'NTR mutant clones contained uninterrupted poly(A) tails. This eliminated any questions as to the effect of the presence of the EcoRl sequence on the experimental results, especially in conjunction with a range of different deletion mutations and sequence changes in the single-stranded region. 3'NTR Mutagenesis by Two-Step PGR A "two-step" PGR method was employed to create mutations in the 3'NTR of PVl(A)8o. hi this discussion, "X" in the primer name refers to the name of the mutation created by that primer. The specific mutagenic primer sets used to create the various clones can be found in Table 1 First PGR step. Two DNA fragments, named 5' and 3', were generated for each desired clone. Both fragments contained the desired 3'NTR mutation. To create the 5' fragments, primer BRL-6782 and mutagenic primer "X-R" were used in PGR reactions with PVl(A)8o as template. The 50 ^il reactions contained Ix PGR buffer (20 mM TrisHGl (pH 8.4), 50 mM KGl), 200 ^iM each dATP, dGTP, dGTP, and dTTP, 1.5 mM MgCl2, 100 pmol each BRL-6782 and primer "X-R", 50 ng PVl(A)8o, and 2.5 U Taq DNA polymerase. The 5' fragments spaimed nt6782 in the 3D^^ coding region to the end of the 3'NTR. The reaction mixtures to make the 3' fragments were the same as for the 5' fragments, except primer BRL-7625 and mutagenic primer "X" were used. The 3'

PAGE 28

17 fragments included sequences from nt7407 in the 3'NTR to nt7625 in the vector of PVl (A)8o. Each reaction set was subjected to 30 cycles of 94C for 30 sec, 50C for 45 sec, and for 30 sec in a Gene Amp PCR System 2400 thermocycier (The Perkin-Elmer Corporation, Norwalk, CT). Incubation at 72''C for 10 min completed the cycling profile. Purification of first step PCR fragments. The expected fragment sizes of 650 bp for the 5' fragments and 200 bp for the 3' fragments were verified by electrophoresis on a 1% agarose (Life Technologies. Grand Island, NY) TAE gel and visualized with UV light after staining with ethidium bromide in Ix TAE buffer (40 mM Tris, 20 mM acetic acid, 2 mM Na2EDTA-2H20). The fragments were purified using Quantum Prep PCR Kleen Spin columns (Bio-Rad Laboratories, Hercules, CA) according to manufacturer's instruction. PCR reactions in which multiple fragments were generated were phenol:chloroform:iso-amyl alcohol (lAA) (25:24:1) extracted once, and the desired fragment purified from a 3.5% NuSieve GTG (FMC Bio-Products, Rockland, ME) TAE gel using the Geneclean Spin kit (BiolOl, Vista, CA). Isolated fragments were analyzed for purity and quantity by electrophoresis on a 1% agarose gel in Ix TAE buffer as above. Second PCR step The purified 5' and 3' fragments were used in PCR to create a single "insert" fragment (approximately 840 bp) containing the desired 3'NTR mutation. These reactions contained approximately 25 ng each of the purified 5' and 3' fragments in Ix PCR buffer (20 mM Tris-HCl (pH 8.4), 50 mM KCl) containing 1 .5 mM MgCb, 100 pmol BRL-6782, 100 pmol BRL-7625, 200 ^M each dATP, dCTP, dGTP, and dTTP, and 2.5 U Taq DNA polymerase in 100 )nl total volume. Primers BRL-6782 and BRL-7625 were included to amplify the product yield. The reactions were subjected to the same cyclmg profile as described for the generation of the individual 5' and 3'

PAGE 29

18 Table 1 : Primers used in this study Primpr Name" Sequence: 5'^ 3'* BRL-6782 GACTACCTAAACCACTCACACCACC BRL-7625 CAGGGTTATTGTCTCATGAGCGGATAC BF118 AGCTAAAATCAGGAGTGTGCC BRL-AA CTGTTGTAGGGGTAA^TTTTTCTTTAATTCGG RRT -AA (R) CCGAATTAAAGAAAAA'^TTACCCCTACAACAG RRT -Afl DiSA-i'lAKJ rTGTTGTAGGG'^TAAATTTTTCTTTAATTCGG DDT An /V\ rrn A ATT A a AG a a a a ATTTA'^rrCTAr a AC AG Br 1 14 (AA2) /""TT/^X A nrmriT A'^TTTTTPTTTA ATTPn BRL-AA2 (R) z^/^" A A TT AAA/^AAAAA '^T A f^f^CCT A P A A P LGAA 1 1 AAAGAAAAA 1 AUL-i^i^ 1 AC AAL. BF98 (AUA3) CTGTTGTAGGGG TTTTTCTT 1 AA 1 1 COG BRL-AUA3 (R) CCGAA FT AAAGAAAAA CCCC 1 AC AALAG r\ r\ T T TT TT T BRL-UUU GGGGl lllllllCll lAAl H^UUALi DOT T TT TT T iT>\ dKL-UUU (K) nTnC^C, A A TT AAA^AAAAAAAA CCCC C 1 UUVjAA 1 1 AAAVJAAAAAA/\AV^I_.I^V^ RDT T TT m PTnTTnTAnGGGTTr'TTTTTrTTTA ATTCGG 1 VJ 1 1 \J 1 /\vJ VJvJ vJ liv^lllllv^iii rvrv 1 1 VJ VJ RRT -IITir (R^ rCGAATTAAAGAAAAAGAACCCCTACAACAG V_^\_/ \ J i X / X X i \_i X^ XXJ L X^ V/ V J X^ X ^ U m V_> V — V_> X J X j X^ XX^ J X BRI -IIIJA CTGTTGTAGGGGTTATTTTTCTTTAATTCGG BRI -lJUA (R) CCGAATTAAAGAAAAATAACCCCTACAACAG BRL-UUUA CTGTTGTAGGGGTTTATTTTTCTTTAATTCGG BRL-UUUA (R) CCGAATTAAAGAAAAATAAACCCCTACAACAG BF113 ^AGUA^^ CTGTTGTAGGG'^TTTTTCTTTAATTCGG \^ X XwJ X X XXX x^ Xhh' X X X X X X X X J x_A XX X x^ BRL-AGUA3 (R) CCGAATTAAAGAAAAA'^CCCTACAACAG BRL-U7427A GGGG'^TTTTACTTTAATTCGGAG BRL-U7427A (R) CTCCGAATTAAAGTAAAA'^CCCC BRL-U7430C GGGG^TTTTTCTCTAATTCGGAG BRL-U7430C (R) CTCCGAATTAGAGAAAAA'^CCCC BRL-A,2 CCCCGAAAAGTGCCACCTGACGCG(TTT)4CTCCG BRL-A13 CCCCGAAAAGTGCCACCTGACGCG(TTT)4TCTCCG BRL-A,5 CCCCGAAAAGTGCCACCTGACGCG(TTT)5CTCCG BRL-A20 CCCCGAAAAGTGCCACCTGACGCG(TTT)6TTCTCCG Note: A indicates the location of the named deletion with respect to the wildtype genomic RNA. Clones U7427A and U7430C were made in the AUA3 background.

PAGE 30

19 fragments. The size of the completed inserts was verified on a 1% agarose TAE gel as described. The insert DNA was purified on Quantum Prep PGR Kleen Spin columns. In reactions with more than one product, the appropriate DNA fragment was gel-purified using the Geneclean Spin kit according to manufacturer's instructions. PolyfA) Tail Mutagenesis Shortened poly(A) tails were introduced initially by Taq polymerase error and later by PGR mutagenesis. PVl(A)8o was cut with Pvull and the ends of the small fragment (containing the vector and the 3'NTR) were ligated together to create a PVl(A)8o subclone with one Pvull site. Site-directed mutagenesis of the 3'NTR to create the deletions described above was originally attempted using this subclone with the Transformer Site Directed Mutagenesis kit (Clontech, Palo Alto, CA). However, cyclesequencing of the resulting plasmids revealed that the 3'NTRs were not mutagenized, and that in many cases the poly(A) tail was shortened. Subclones with short tails, poly(A)37 and poly(A)29, were chosen. Plasmid preparations were made, and the DNA was linearized with Pvull. The linearized subclones were treated with shrimp alkaline phosphatase (SAP) (Roche, Indianapolis, IN) for 1 h at 37G. The SAP was inactivated at 70G for 15 min. The treated fragments were gel-purified, then ligated back into PVl(A)8o at the Pvull sites to create fiill-length plasmids with the indicated short poly(A) tail lengths. The PV1(A)29 clone served as a template to create clones with even shorter poly(A) tail lengths by PGR mutagenesis. Primers were designed which spanned the Mlul site and contained various tail lengths (Table 1). PGR reactions (100 ^il total volume) containing Ix PGR buffer (20 mM Tris-HGl (pH 8.4), 50 mM KGl), 1.5 mM MgGb, 200 pmol BRL-6782, 200 pmol

PAGE 31

20 BRL-(A)n, 200 ^M each dATP. dCTP, dGTP, and dTTP, and 2.5U Taq DNA polymerase were assembled. Template DNA (100 ng) was added to each reaction. The template varied according to the size of the poly(A) deletion required. The cycling profile consisted of 30 cycles of 94"C for 30 sec, 54''C for 45 sec, and 12C for 30 sec. Fragments were finished by incubation at ll^C for 10 min. Completed PCR fiagments were purified using the Quantum Prep PCR Kleen Spin columns. Full-length plasmids were then constructed as outlined in the following sections. Restriction Digestion Purified insert DNA fi-agments containing the 3'NTR or poly(A) tail mutations were digested with PvuII and Mlul in preparation for cloning. The column-purified inserts were first restricted with PvuII (Promega, Madison. WI) in 1 25 ^1 reactions containing Ix reaction buffer (6 mM Tris-HCl (pH 7.5), 50 mM NaCl, 6 mM MgCb, 1 mM dithiothreitol (DTT)). The reactions were incubated at 37*'C for 2 h. The buffer conditions were adjusted to 50 mM Tris-HCl, 100 mM NaCl, 10 mM MgCb and 1 mM DTT prior to the addition of Mlul (New England BioLabs. Beverly, MA), for a total volume of 150 jii. Incubation was continued at 37*'C for 2 h. Complete digestion was confirmed after electrophoresis on a 1% agarose TAE gel. The digested DNA inserts were phenol:chloroform:IAA extracted once, then loaded directly on a 3.5% NuSieve GTG gel and electrophoresed. Inserts were extracted from the gel matrix using the Geneclean Spin kit.

PAGE 32

21 Vector Preparation and Ligation Purified DNA inserts were quantitated by comparison to 0.5 100 bp DNA ladder (New England BioLabs) on 1% agarose TAE gels. To make the 3'NTR mutation constructs and poly(A) tail clones (except where described under "Poly(A) Tail Mutagenesis"), the following procedure was followed. The insert fragments were iigated into the Pvull and Mlul sites contained in a cDNA clone derived from PVl(A)8o (LRS3). LRS3 contained a unique PvuII site within the poliovirus coding region at nt7053, due to mutation of a PvuII site at nt9744 in the plasmid vector sequence. Vector DNA was prepared by restriction of LRS3 with PvuII and Mlul 5 U SAP was added to the vector DNA and incubated for 1 h at 3TC, then inactivated at 70"C for 15 min. The large fragment was purified from a 1% GTG agarose (SeaKem, FMC Bio-Products) TAE gel using the Geneclean Spin kit. A 1:3 to 1:6 ratio of vector to insert (for a total of between 230 to 260 ng DNA/reaction) was used in 20 |il reactions containing Ix T4 DNA ligase buffer (30 mM Tris-HCl (pH 7.8), 10 mM MgCb, 10 mM DTT, 1 mM ATP) and 1 U T4 DNA ligase (Promega). Ligation was performed at 4C for 1 5 to 20 h. An additional 1 U T4 ligase was added and incubation was continued at room temperature for a minimum of 4 h. Transformation of the Mutated Plasmids After ligation, the full-length, mutagenized plasmids were transformed into Epicurian Coli SURE competent cells (Stratagene, La Jolla, CA). SURE cells (20 ^1) were thawed on ice, gently resuspended and incubated on ice for 1 0 min in 25 mM 2mercaptoethanol (BME). The cells were gently resusjjended every 2 min. Plasmid PVl(A)8o (1 ng) or 20 ng of mutagenized, Iigated DNA were then added and the

PAGE 33

22 incubation continued on ice undistiirbed for 30 min. The cells were heat-shocked at 42C for exactly 45 sec and returned to ice for 2 min before the addition of 180 ^l 3TC SOC media (20g/L tryptone. 5g/L yeast extract. 10 mM MgCb, 10 mM MgS04, 8.5 mM NaCl, 2 mM glucose). Transformed cells were incubated at 37*'C with shaking at 220 rpm for 1 h, then plated using sterile techniques on LB-amp agar plates (20 g/L LB, 15 g/L BactoAgar (Difco, Detroit, MI), 50 |ig/ml ampicillin). Plates were incubated overnight at arc. Cycle Sequencing Cycle Sequencing was used in an initial screening process to verify the presence of the desired 3'NTR or poly(A) tail mutations in newly constructed clones. Isolated SURE cell colonies were used to inoculate 5 ml LB-amp (20 g/L LB powder, 50 ng/ ampicillin) liquid cultures. The cultures were incubated at 37C for a minimum 12 h with shaking at 220 rpm. Plasmid DNA was isolated using the RPM Kit (Rapid Pure Miniprep, Biol 01). The dsDNA Cycle Sequencing System (Life Technologies) was used with primer BFl 1 8 to screen plasmid DNA for the desired mutations. BFl 1 8 was treated with T4 kmase in the presence of [yP]ATP (Amersham Pharmacia, Piscataway, NJ) for 30 min at 37*^C. To sequence 4 NTPs per plasmid preparation, a master kinase reaction was made which contained 1 pmol BFl 18, 10 ^iCi [y-^^P]ATP (3,000 Ci/mmol), 1 U T4 kinase and Ix kinase buffer (60 mM Tris-HCl (pH 7.8), lO'mM MgCb, 200 mM KCl) in 5 |a1 total volume. Reactions were inactivated at 55''C for 5 min and placed on ice. A master sequencing reaction was then prepared which contained 5 yd lOx sequencing buffer (300 mM Tris-HCl (pH 9.0), 50 mM MgCb, 300 mM KCl, .5% w/v

PAGE 34

23 W-1), the entire kinase reaction (5 ^1), and 1 U Taq DNA polymerase in 15 |al total volume. Thin-walled PCR tubes were prepared by adding 3 )al of the master sequencing reaction and 2 |il of the desired nucleotide termination mix (50 \M each dATP, dCTP, dTTP, and 7-deaza-dGTP, plus one of the following: 2 mM ddATP, 2 mM ddTTP, 1 mM ddCTP. or 200 [iM ddGTP) to each tube. Approximately 50 ng of plasmid DNA was added for a total of 10 ^1 per tube. The reactions were subjected to 95C for 3 min, followed by 20 cycles of 95T for 30 sec, 55C for 30 sec and TO^C for 1 min. The reactions were completed by 10 cycles of 95C for 30 sec and 70'*C for 1 min. Upon completion, 5 jal stop solution (95% v/v formamide, 10 mM EDTA (pH 8.0), 0.1% w/v bromophenol blue, 0.1% w/v xylene cyanol) was added and the reactions stored at -20C. Labeled PCR products were analyzed on 0.35 mm thick denaturing 6.5% acrylamide gels. Gels were prepared by adding 10.4 ml of a 20% acrylamide/bisacrylamide (19:1, Life Technologies) solution containing 7M urea and Ix TBE (89 mM Tris. 89 mM boric acid, 2 mM EDTA (pH 8.0)) to 21.6 ml 7M urea in Ix TBE. 240 ^1 10% ammonium persulfate (APS. Life Technologies) and 24 ^l TEMED (Fisher Scientific. Pittsburgh, PA) were added. The PCR samples were heated to 95*'C for 5 min before loading. Gels were run in Ix TBE at 25 mAmp, then transferred to chromatography paper (Fisher Scientific) and dried for 25 min at 80"C. After verification of the presence of the correct mutation and poly(A) tail length by sequencing, plasmid DNA was prepared according to the Qiagen Midiprep protocol. The entire insert fragment contained within each new fiill-length plasmid was sequenced through the junction sites at the DNA Sequencing Core Laboratory (hiterdisciplinary Center for Biotechnology Research, University of Florida).

PAGE 35

24 Plasmid DNA Preparation Plasmid DNA preparations were made using the Plasmid Midi Kit (Qiagen Inc., Valencia, CA). Cells containing plasmids with the correct mutation and tail length were grown in 250 ml LB-amp liquid cultures at 7>TC with shaking at 220 rpm. Bacterial cells in the liquid cultures were pelleted at 6,000 x g for 15 min at 4C. Cell pellets were resuspended in 5 ml resuspension buffer (50 mM Tris-HCl (pH 8.0), 10 mM EDTA, 100 ^g/ml RNase A) and transferred to 30 ml polycarbonite Oakridge tubes (Beckman, Fullerton, CA) with screw caps. Lysis buffer (5 mi) (200 mM NaOH, 1% SDS) was added and the mbes gently inverted several times. Cells were incubated at room temperature for 5 min before the addition of 5 ml neutralization buffer (3M KCH3CO2, pH 5.5). Reactions were inverted to mix and placed on ice for 15 min. Cellular debris was pelleted by centrifugation at 20,000 x g for 30 min at 4C. Supematants were filtered and loaded onto equilibrated Qiagen columns as directed. Columns were rinsed with wash buffer (IM NaCl, 50 mM MOPs (pH 7.0), 15% isopropanol) and the DNA eluted with buffer (1.25M NaCl. 50 mM Tris-HCl (pH 8.5), 15% isopropanol). Eluted DNA was precipitated from solution by the addition of 0.7 volumes room temperature isopropanol and centrifiiged at 15.000 x g for 30 min at 4C. The DNA pellets were washed with chilled 70% ethanol and re-centrifuged for 10 min. Air-dried DNA pellets were resuspended in Ix TE buffer (10 mM Tris-HCl (pH 8.0), 1 mM EDTA) and brought to a final concentration of 0.5 fig/^il. Plasmid preparations were stored at -20''C. i

PAGE 36

25 In Vitro Transcriptions Unlabeled Transcripts Plasmids containing either wildtype poliovirus sequence or the described mutations were linearized by Mlul restriction and transcribed in a T7 RNA polymerase in vitro transcription system. Transcription of plasmids was achieved by incubating 2 ^g Mlul -linearized plasmid in 125 ^il reactions containing Ix SP6 buffer (40 mM Tris-HCl (pH 7.9), 6 mM MgCb, 2 mM spermidine), 10 mM DTT, 40 U RNasin (Promega), and 1 mM ATP, CTP, GTP and UTP at iTC for 2 h in the presence of T7 RNA polymerase. Transcription reactions were stopped by addition of 200 \x\ 0.5% SDS buffer (100 mM NaCl, 10 mM Tris-HCl (pH 7.5), 1 mM EDTA, 0.5% sodium dodecyl sulfate). The RNAs were extracted with phenol:chloroform:IAA and chloroform:IAA three times each. The transcripts were precipitated by addition of 3 volumes of ethanol overnight at 4C. RNA was recovered by centrifugation at 15,000 x g at 4C for 15 min. The RNA transcripts were then resuspended in 50 jaI sterile H2O and fractionated over Sephadex G50 (Amersham Pharmacia) columns to remove unincorporated nucleotides. Each fraction was analyzed for the presence of RNA by scanning spectrophotometry. The fractions containing purified RNA transcripts were then re-precipitated. RNA was quantitated by spectrophotometry prior to use. Labeled Transcripts Labeled transcripts for use in the RNA stability assay were generated as above with the exception that 1.5 ^g Mlul digested plasmid DNA was used in 100 [i\ reactions containing 50 |iCi [a-^^P]CTP (400 Ci/mmol, Amersham Pharmacia). The RNAs were phenoI:chloroform:IAA extracted, ethanol precipitated as described above and desalted as

PAGE 37

26 described for unlabeled transcripts. Before use in the stability assay, the labeled RNA fractions were ethanol precipitated as described and quantitated by scanning spectrophotometry and trichloroacetic acid (TCA) precipitation. Preparation of HeLa Cellular Extracts SIO Extracts HeLa cells in log phase growth were pelleted from suspension cultures by centrifiigation at 1250 rpm in a Beckman JS-4.2 rotor at 4C for 5 min. Approximately 10^ cells were used for each preparation. The cell pellets were washed with 2 L isotonic buffer (35 mM HEPES-KOH (pH 7.4), 146 mM NaCl, 1 1 mM glucose) and transferred to a 50 ml conical tube on ice. The volume of the final pellet was noted. Cells were resuspended in 1.5 volumes hypotonic buffer (20 mM HEPES-KOH (pH 7.4), 10 mM KCl. 1.5 mM Mg(CH3C02)2, 1 mM DTT) and incubated on ice for 10 min with brief vortexing every 3 to 4 min. The cells were poured into a chilled 15 ml dounce homogenizer (Wheaton, Millville, NJ). 25 strokes of a tight-fitting pestle (size A) lysed the cells. The lysate was returned to the 50 ml conical on ice and 1/10 volume lOx SIO buffer (200 mM HEPES-KOH (pH 7.4), 1.2M KCH3CO2, 40 mM Mg(CH3C02)2, 50 mM DTT) was added. The lysate was then centrifuged at 2,000 rpm in a JS-4.2 rotor for 10 min at 4C. The supernatant was poured off the pelleted nuclei into a 30 ml siliconized Corex tube and centrifuged at 1 0,000 rpm in a Beckman JA-20 rotor for 1 5 min at 4''C. The supernatant was transferred to a fresh, chilled 50 ml conical mbe and brought to 1 mM CaCh by the addition of 1/100 volume 100 mM CaCb. Micrococcal nuclease (1 mg/ml, Sigma, St. Louis, MO) was added to the supernatant for a final concentration of 5

PAGE 38

27 ^g/ml, and the mixture was incubated at 20C for 15 min. EGTA (100 mM, pH 7.5) was added for a final concentration of 2 mM to halt the nuclease reaction. The treated cytoplasmic extract was transferred to a 30 ml siliconized Corex tube and centrifuged at 10.000 rpm at 4C for 15 min in a JA-20 rotor. The supernatant was removed into a 50 ml conical tube on ice. A small portion of the extract ( 1 : 1 00 dilution) was scanned in a spectrophotometer to determine the OD. When needed, hypotonic buffer was added to the extract to obtain an OD reading between 80 and 90 A260 units/ml. The extract was stored in aliquots of 50 |al to 200 |al in Eppendorf microftige tubes at -70C. Initiation Factors Preparations of HeLa hiitiation Factors were made from approximately 10^ HeLa cells in log phase growth pelleted from suspension culture by centrifugation at 1250 rpm in a JS-4.2 rotor. The cell pellets were rinsed with isotonic buffer as described for preparation of HeLa SIO extracts, transferred to a 50 ml conical tube and placed on ice. The volume of the pellet was noted and 2 volumes hypotonic buffer was added. The cells were incubated on ice for 10 min and vortexed every 3 to 4 min. The cells were homogenized by 30 strokes of a tight-fitting pestle (size A) in a chilled dounce homogenizer. The cell homogenate was poured back into the 50 ml conical tube and centrifiiged at 2,000 rpm for 10 min at 4C in a JS-4.2 rotor. The supernatant was transferred into a siliconized 30 ml Corex tube and centrifuged at 10,000 rpm in a JA-20 rotor for 1 5 min at AC to pellet nuclei. The supernatant was then moved to a 10 ml blackcap Ti-70.1

PAGE 39

28 ultracentrifuge tube (Beckman). Ribosomes were pelleted by centrifligation at 60,000 rpm for 1 h at 4C in a Beckman Ti-70.1 rotor. The ribosomal pellet was resuspended in 1 .5 ml hypotonic buffer by stirring with a micro stir bar at 4C for 30 min, or until completely resuspended. The concentration was determined by spectrophotometric analysis of a 1:250 dilution of the ribosomal suspension. An OD of 250 A260 units/ml was ideal. The volume was noted and 4M KCl was added to make a final concentration of 0.5M KCl. The ribosomes were stirred for 15 min at 4C. The stir bar was removed and the ribosomes were centrifuged at 60,000 rpm fori hat 4C as before. \r. The supernatant was carefully removed from the ultracentrifuge tube, transferred to a short length of dialysis tubing and secured with Spectra/Por closures (Fisher Scientific). The tubing was placed in a beaker at 4^C with cold dialysis buffer (5 mM Tris-HCl (pH 7.5), 100 mM KCl, 50nM EDTA, 1 mM DTT, 5% glycerol) and stirred moderately for 2 h. The dialyzed supernatant was stored in aliquots of 50 |il at -70C. Preparation of Dialysis Tubing Tubing was prepared in advance by boiling short lengths of 16 mm Spectra/Por 2 dialysis tubing (Fisher Scientific) in 150 to 400 ml of 25 mM EDTA for 15 min in a beaker. The EDTA was exchanged for fresh 25 mM EDTA and the tubing brought to a second boil for 1 5 min. Finally, nanopure H2O was added and boiled with the tubing for 15 min longer. Tubing was covered with sterile H2O and stored at 4''C in a wide-mouth bottle.

PAGE 40

29 In Vitro Translation/Replication in HeLa Cell Extracts This assay was first described by Barton et al. (5) and was utilized in this study with some modification. Positive-sense transcript RNAs contain two nonviral G residues at the 5 'end. Negative-strand RNAs copied from transcripts containing these extra nucleotides are blocked for initiation of positive-strand RNA. Therefore only negative-strand RNAs are synthesized in these reactions (5,6). Transcript RNA (5 \xg) was added to 50 |il HeLa SIO extract, 20 [il HeLa cell initiation factors. 10 ullOX reaction mix (10 mM ATP, 2.5 mM GTP, 2.5 mM UTP, 600 mM KCH3CO2, 155 mM HEPES-KOH (pH 7.4), creatine kinase (4 mg/ml), 300 mM creatine phosphate) and 2 mM guanidine-HCl (Gu-HCl) in a final volume of 100 }al. In the presence of the reversible 2C inhibitor Gu-HCl, pre-initiation replication complexes (PIRCs) form but initiation of negative-strand RNA synthesis is halted (4). To monitor protein synthesis, 12 |il from each reaction was removed to a separate tube, and 15 ^Ci [^^SJmethionine (1200 Ci/mmol, Amersham Pharmacia) was added. The unlabeled reactions and the [^^S]methionine-labeled reactions were incubated at 34''C for a total of 4 h. During the 34''C incubation, duplicate 1 \il samples were removed from the labeled translation reactions at each indicated time point. These samples were added to 100 ^l 3% casamino acids (3% casamino acids in 0.1 N KOH), then TCA-precipitated and counted in a scintillation counter. TCA precipitations were not begun until all time points were taken. In addition, 2.5 jal of the [^^S]methionine-labeled reactions were removed into 50 ^l Laemmli Sample Buffer (20% v/v glycerol. 2% v/v SDS, 62.5 mM Tris-HCl (pH 6.8), 72 mM BME, and 0.1% Bromo-phenol blue) at each time point for analysis by 10% SDS-polyacrylamide gel electrophoresis.

PAGE 41

30 After incubation at 34C for 4 h, the PIRCs present in the unlabeled reactions were pelleted at 4C at 15,000 x g for 15 min. The supematants containing the GuHCl were removed. The pellets were resuspended in 50 \i\ label mix containing 50% Ix SIO buffer (40 mM Hepes-KOH (pH 7.4), 120 mM KCH3CO2, 5.5 mM Mg(CH3C02)2, 10 mM KCl, 6 mM DTT. 1 mM CaCb, and 2 mM EGTA), 20% lOX reaction mix, 5 ^M non-radiolabeled CTP and 25 ^iCi [a-^^P]CTP (400 Ci/mmol, Amersham Pharmacia). The resuspended pellets were incubated at 37C for 45 min imless otherwise noted. 350 1^1 0.5% SDS buffer was added to stop the reaction. The radiolabeled negative-strand RNA products were phenol:chloroform:IAA and chloroform:IAA extracted three times each and ethanol precipitated at 4C overnight. The purified RNAs were analyzed by methylmercuiy hydroxide (CHaHgOH) agarose gel electrophoresis and autoradiography (see below). RNA Stability Assav To measure RNA stability in HeLa cellular extracts, labeled transcript RNAs (6 \xg) were incubated in 120 |al reactions that contained 50% HeLa SIO extract. 20% HeLa initiation factors, 10% lOX reaction mix and 2 mM Gu-HCl. RNAs were quantitated prior to use by spectrophotometry and TC A precipitation. The reactions were incubated at 34"C for a total of 4 h. Samples were taken at 0, 0.5, 1, 2, and 4 h. At each time point, 20 ^1 from each reaction was removed into 400 )li1 0.5% SDS buffer and vortexed. To measure RNA stability by TCA precipitation, duplicate 50 i^l aliquots were taken from the RNA-0.5% SDS buffer mixtures and added to 1 ml chilled stop mix (7% TCA, 45 mM Na4P2O7T0H2O) with 5 ^1 yeast tRNA (10 mg/ml, Sigma). These samples were placed on ice and approximately 3 ml 5% TCA was added. Standard TCA

PAGE 42

31 precipitations were performed using filters pre-soaked in stop mix. TCA precipitations were not begun until all time points were taken. The remainder of the RNA-0.5% SDS buffer samples were extracted with phenol:chloroform:IAA and chloroform:IAA three times each and ethanol precipitated overnight at 4^0 The amount of RNA remaining at each time point was determined after electrophoresis of the RNA on a CHaHgOH agarose gel and by phosphorimager analysis. CH2HgOH Agarose Gel Electrophoresis RNAs were recovered from ethanol by centrifugation at 15,000 x g for 15 min at 4''C, dried briefly and resuspended in 10 |al 1.5x methylmercury hydroxide buffer (75 mM Boric acid. 7.5 mM Na2B4O7-10 H2O, 15 mM Na2S04, 1.5 mM Na2EDTA). After the RNA pellets resuspended completely, 5 ^il of 150 mM CHaHgOH (Alfa Aesar, Ward Hill, MA) was added and the RNAs incubated at room temperature for 5 min. 1 5 ^1 sample buffer (750 |xM CHsHgOH buffer, bromophenol blue/glycerol, 60 mM CHsHgOH) was added and the RNAs were loaded on a vertical (Hoefer apparatus) 3 mm 1% agarose gel containing 5 mM CHsHgOH in a fume hood. Gels were run at constant amperage (72 mAmp) in Ix CHsHgOH buffer (50 mM Boric acid, 5 mM Na2B4O7-10 H20, 10 mM Na2S04, 1 mM Na2EDTA) with buffer re-circulation. Re-circulation was stopped when the dye front reached mid way through the gel. Upon completion, the gels were stained with ethidium bromide in 0.5M ammonium acetate (NH4CH3CO2) for 5 min and the RNAs visualized by UV light. The gels were photographed and then dried on chromatography paper. Gels were exposed to X-Omat Blue XB-1 film (Kodak, Rochester, NY) with a Biomax intensifying screen (Kodak) at -70''C.

PAGE 43

32 TCA Precipitation Proteins The amount of acid-precipitable protein made in tlie in vitro translation reactions was determined by TCA precipitation. As described above, 1 \il samples were taken in duplicate at 0 and 4 h and added to 100 ^1 3% casamino acids in O.IN KOH. Approximately 3 ml of 5% TCA was added to each sample in borosilicate tubes (Fisher Scientific) and vortexed. The tubes were incubated on ice for 15 min. Type HA linch filters (Millipore, Bedford. MA) were pre-soaked in chilled 5% TCA prior to use. Next, each sample tube was filled with chilled 5% TCA and vacuum-filtered. Tubes were rinsed 2x each with 5% TCA and the rinses passed over the filter. Filters were removed fi-om the vacuum apparatus and placed in scintillation vials. 5 ml CytoScint ES scintillation fluid (ICN, Costa Mesa, CA) was added and the acid-precipitable proteins were counted with a Beckman LS5801 scintillation coimter. RNAs RNA stability was measured in part by quantitation of acid-precipitable RNA present at each time point tested in the RNA stability assay. As described in the "RNA Stability Assay" section, duplicate 50 |xl aliquots from the RNA-0.5% SDS buffer mixtures were added to 1 ml stop mix with 5 |al yeast tRNA. Approximately 3 ml chilled 5% TCA was added and the samples were incubated on ice for 15 min. Samples were then precipitated by the method described for protein precipitation, except filters were pre-soaked in chilled stop mix prior to use.

PAGE 44

33 10% Polyacrylamide Gel Electrophoresis Protein products from in vitro translation/replication assays were resolved by 10% SDS-PAGE. 0.75 mm polyacrylamide gels (10% acrylamide/bisacrylamide (29:1), 187 mM Tris-HCl (pH 8.8), 0.1% SDS, 0.05% APS, 0.005% TEMED) were prepared in a vertical apparatus (Hoefer), and covered with 1 ml water-saturated butanol until polymerized. The butanol was washed away and a 4% stacking gel (4% acrylamide/bisacrylamide (29:1), 62.5 mM Tris-HCl (pH 6.8), 0.1% SDS. 0.05% APS. 0.005% TEMED) was poured. Protein samples in Ix Laemmli sample buffer were heated to lOO^^C for 3 min before loading. 20 nl of each 50 ^1 protein sample was loaded per well and electrophoresed at constant amperage (12.5 mAmp) imtil the dye front passed through the stacking gel. Amperage was then increased to 20 mAmp until the dye front ran off the gel. The gels were fluorographed, transferred to chromatography paper, and dried at 80'*C for 45 min. Dried gels were exposed to X-Omat Blue XB-1 film at 70C. Fluorography Polyacrylamide protein gels were fluorographed before drying. Two methods were used interchangeably in this study. DMSO-PPO Gels were soaked in 50% TCA for a minimum of 30 min at room temperature to fix the proteins. The TCA was removed and 100 ml DMSO added. The DMSO was exchanged for fresh DMSO every 10 min for 30 min total. The gels were then rocked in a 22% DMSO-PPO solution (2,5-DiphenyIoxazole) for 25 min. The DMSO-PPO was rinsed away with nmning water for 1 h.

PAGE 45

34 Amplify Gels were rocked in Ix Fix (40% CH3OH, 10% CA3COOH) for 30 min at room temperature. The solution was removed and Amplify Fluorographic Reagent (Amersham Pharmacia) was added to cover the gels. Gels were then rocked for 20 min at room temperature and transferred to chromatography paper. Cell Maintenance HeLa Cells HeLa S3 cells were maintained in suspension cultures containing Joklik's modified Minimal Essential Medium (Life Technologies) supplemented with 5% bovine calf serum (Life Technologies) and 2% fetal clone (Hyclone Laboratories, Logan, UT). Cells were kept from 2 x 10^ to 4 x 10^ cells/ml at 37*'C and passed daily. BSC-40 Cells Monolayers of BSC-40 cells were maintained in Eagle's Minimal Essential Medium (EMEM, Life Technologies) supplemented with 10% fetal clone. Cells were split 1:10 two times per week and kept at 37C. Transfection of RNA RNAs were transfected by the DEAE-dextran (Amersham Pharmacia) method. Choice of plates (six-centimeter or six-well) and cell type (HeLa or BSC-40) depended upon whether new virus stocks were desired or whether the infectivity of the RNA was to be determined. A solution of phosphate-buffered saline (PBS, pH 7.4) (2.6 mM KCl, 1.5 mM KH2PO4, 137 mM NaCl, 8.6 mM Na2HP04) was made which contained 0.1 mg/ml

PAGE 46

35 MgCb and CaCb. DEAE-dextran (10 mg/ml) was added to 475 |il of this solution to make a final concentration of 0.5 mg/ml. The appropriate amount of transcript RNA for the purpose was then added as indicated in the relevant sections below. When using sixwell dishes. 200 ^1 RNA mixtures were used. Cells were rinsed with the PBS/MgC^/CaCb solution without DEAE and the transcript RNA mixture was applied. Cells were rocked every 12 min for a total of 45 min. The DEAE-dextran solution was aspirated and the cells were rinsed with the PBS/MgC^/CaCb solution without DEAE. Media was then added to the cells. The type of media added was determined by the purpose of the transfection. The dishes were incubated at 1>TC unless otherwise noted. Determination of RNA Infectivity BSC-40 cells in six-well dishes were transfected with RNA transcripts as described. Between 15 ng and 125 ng of RNA were used. Ix Methylcellulose overlay (EMEM with 5% fetal clone, 1% methylcellulose) was added after the final rinse with the PBS/MgCb/CaCh solution lacking DEAE. The transfected cells were incubated at ST^C for 3 days and stained with 1 x crystal violet. Infectivity was expressed as the number of plaque forming units (PFU)/^g RNA transcript. Preparation of Primarv Virus Stocks HeLa cells in six-centimeter dishes were transfected with 3 to 5 ^ig of the appropriate transcript RNAs by the DEAE-dextran transfection protocol. 5 ml EMEM was added to each dish. The dishes were incubated at 37C until complete cytopathic effect (CPE) was reached, or up to 5 days. The newly prepared virus stocks were firozen and thawed three times, transferred to 15 ml conical tubes and centrifiiged at 2,000 rpm

PAGE 47

36 for 5 min in a JS-4.2 rotor. Cleared supematants were transferred to fresh 15 ml corneals and stored at -20C. Determination of Plaque Morphology Serial dilutions of each primary virus stock were prepared by diluting 50 ^1 of each virus stock into 450 ^1 PBS (pH 7.4) until the desired dilutions were obtained. Monolayers of BSC-40 cells in six-well dishes were infected with 200 ^l of each dilution per well as described in the figure legends. 200 ^1 PBS (pH 7.4) was used for mock infections. Cells were incubated at 37"C (unless otherwise noted) and rocked every 10 min to keep the cells from drying. Ix methylcellulose overlay was then added to each well. The dishes were incubated at the indicated temperatures for 2 to 3 days as noted. The methylcellulose overlay was removed and the plaques were stained with Ix crystal violet. Plaque Purification and Amplification Monolayers of BSC-40 cells in six-well dishes were infected with 200 [il of appropriately diluted primary virus stocks. The cells were covered by 3 ml agar overlay (Ix EMEM supplemented with 5% fetal clone, 1% Bacto-Agar, 0.008% Phenol Red solution (Life Technologies)) and incubated at 37C. Individual plaques were picked with a sterile Pasteur pipette into 400 ^1 EMEM (lacking fetal calf serum) 2 days postinfection. To amplify the purified virus, HeLa cell monolayers (4x10^ HeLa cells) in T25 flasks were infected with the virus plugs. After adsorption of the virus for 30 min at 37"C (with rocking every 10 min), 5 ml EMEM was added and the incubation was continued until complete CPE was observed. The dishes containing infected cells in

PAGE 48

37 EMEM were freeze-thawed three times. The media was transferred to a 15 ml conical tube and cellular debris was removed by centrifugation at 2,000 rpm for 5 min in a JS-4.2 rotor. Supematants were stored at -20C. RT-PCR 2.5 ml of the appropriate virus stocks were transferred to blackcap ultracentrifuge tubes (Beckman). The volume in each tube was increased to about 6 ml by the addition of sterile PBS. Balanced tubes were centrifuged at 40,000 rpm for 2 h at room temperature in a Ti-70 rotor to pellet virus. The supematants were discarded and 100 ^1 0.5%SDS buffer was added to each pellet. The virus pellets were resuspended by stirring with a micro stir bar for a minimum of 30 min. Resuspended virus particles were transferred to Eppendorf microfuge tubes with sterile Pasteur pipettes. The capsid proteins were disrupted by six phenol:chloroform:IAA extractions. Traces of phenol were removed by an equal number of chloroform :IAA extractions. The liberated viral RNAs were ethanol precipitated at -20C overnight. RNAs were pelleted by centrifugation at 15,000 x g for 15 min at 4"C. The pellets were dried briefly and resuspended in 20 ^1 sterile H2O. The Titan One-Tube RTPCR System (Roche) was used according to the manufacturer's instructions. The RT cycling profile consisted of for 30 min, followed by 94C for 1 .5 min. Then the reactions were subjected to 10 cycles of 94C for 30 sec, 52C for 30 sec and 68''C for 1 min. Next, 15 cycles of 94T for 30 sec, 52C for 30 sec and 68C for 1 min + 5 sec/cycle were performed. The reactions were completed by incubation at 68''C for 7 min. The DNA products were checked on a 1% agarose gel for size. The DNA was

PAGE 49

38 purified on Quantum Prep PGR Kleen Spin columns and sent to the DNA Sequencing Core Laboratory for sequencing of the 3'NTR.

PAGE 50

CHAPTER 3 EFFECT OF DELETIONS IN THE 3'NTR SINGLE-STRANDED REGION To examine the relationship between the 7418GUAAA sequence and events that occur during viral replication, various mutations in this conserved single-stranded region were created. The deletion mutant RNAs utilized were A7418G, A7422A, A7421 A2, A7419UA3, and A7418GUA3 (Figure 1-3). These mutations were made in the wildtype, poly(A)8o background and will be referred to simply as AG, AA, AA2, AUA3, and AGUA3. Virus derived from transcript RNA was tested in vivo for plaque morphology and reversion. RNA transcripts containing the deletions were also tested in vitro to determine their ability to translate and initiate negative-strand RNA synthesis. Plaque Morphology Transcript RNAs containing deletions in the conserved region were transfected into BSC-40 cells and virus stocks were prepared as described in Chapter 2. The virus stocks were then used to infect BSC-40 monolayers at 37C. Infected plates were stained with crystal violet after three days to visualize plaques. Plaque phenotypes are depicted in Figure 3-1. In previous work, RNA containing the AGUA3 deletion in a short poly(A)ii background was transfected into cells to create a virus stock (V. Chow, unpublished results). Upon infection with this virus stock, minute-sized plaques were detectable. 39

PAGE 51

40 Figure 3-1 : Comparison of plaque morphologies between 3'NTR deletion mutant virus stocks. 3 ^g of each RNA were transfected into HeLa cells and incubated at 37C with liquid EMEM until CPE was reached, or up to 5 days. The resulting virus stocks were diluted as shown and used to infect BSC-40 monolayers at 37"C. Plates were stained with crystal violet after 3 days.

PAGE 52

41 Because the plaques were very small, the genomic RNA was isolated from the virus stock and sequenced. The results showed that the 7418GUA3 deletion was still present and no other changes had occurred in the 3'NTR sequence (V. Chow, unpublished results). After multiple passages of the virus stock, the plaque morphology remained unchanged (V. Chow, impublished results), a fiirther indication that this deletion was severe. In the present study, the AGUA3 mutation was created in a long poly(A)8o background. RNA transcribed from the AGUA3/(A)8o construct was used to create virus stocks, which were used to infect BSC-40 monolayers as described. As observed previously, only minutesized plaques were detected (Figure 3-1), indicating the loss of an important viral fiinction for growth. Revertant virus was readily produced in cells transfected with AUA3 RNA (Figure 3-1). These revertants were characterized, and all were foimd to contain an increased or completely restored single-stranded region. The AUA3 revertants are discussed in detail in Chapter 4. Upon infection with virus stock made from transfection of AA2 RNA, a background of small plaques was seen and the presence of large plaque revertants was clear. Revertants were purified from isolated plaques and amplified once in cells with liquid media. Genomic RNA was isolated from the plaque-purified virus and sequenced. All revertants contained the wildtype 7418GUAAA single-stranded sequence. Infection with virus stocks of AG and AA virus was also performed. Plaques of similar size were produced from these infections. The plaques produced had a similar plaque phenotype to wildtype virus, and revertants were not discemable. The results obtained from these in vivo studies indicate that the conserved region carries out a fiinction that is needed for efficient virus growth. The RNAs were also tested in vitro to determine whether the

PAGE 53

42 deletions in the single-stranded region affected RNA stability, translation, or initiation of negative-strand RNA synthesis. Stability of RNA Containing a Complete Deletion of the Conserved Region Deletions in the single-stranded region may disturb the tertiary structure of the 3'NTR as a whole, and as a result lead to a loss of RNA stability. Wildtype RNA and RNA with a complete deletion of the single-stranded region (AGUA3) were therefore tested in vitro for stability as described. Briefly, [ P] -labeled RNA transcripts were incubated in HeLa SIO translation/replication reactions at 34C for 4 h. At each time point, 20 nl samples were removed and mixed with 0.5% SDS buffer, phenolxhloroform extracted, and ethanol precipitated. The recovered RNAs were then characterized by CHaHgOH agarose gel electrophoresis (Figure 3 -2 A), and the amount of labeled fulllength RNA remaining at 4 h was compared to the total amoimt of each RNA present at 0 h by phosphorimager analysis of the gel. After 4 h, 33% of wildtype RNA remained intact, and 30% of the AGUA3 RNA remained (Figure 3 -2 A, compare lanes 1 and 5, and lanes 6 and 1 0). These results agree with the amount of labeled RNA recovered by TCA precipitation of samples taken over the 4 h incubation period at 34C (Figure 3-2B). Approximately 30% of the labeled RNA remained after 4 h for both the wildtype and AGUA3 RNAs. Therefore, there was no significant difference in the stability of AGUA3 RNA and wildtype RNA in the HeLa SIO translation/replication reactions. These results suggest that RNAs with smaller deletions in the single-stranded region would also be stable.

PAGE 54

Figure 3-2: Deletion of the conserved single-stranded region does not alTect RNA stability. A. 6 ^ig of [a-^^P]CTP-labeled RNA transcripts were incubated in HeLa SIO translation/replication reactions at 34C. 20 |al samples were removed into 0.5% SDS buffer at the indicated time points as described and resolved by CHaHgOH agarose gel electrophoresis. Full-length RNA is marked. B. Graph of TCA precipitable RNA remaining at each time point. Each point represents the average of two samples.

PAGE 55

44 Effect of 3'NTR Deletion Mutations on Translation and Polyprotein Processing Each transcript RNA was tested for translation activity using a cell-free system as described (5). Each transcript RNA was incubated at 34C in HeLa SIO translation reactions containing [ S]methionine for 4 h. Samples were taken at 0 h and 4 h. The amount of labeled viral protein synthesized in each reaction was determined by TCA precipitation (data not shown) and 10% SDS-PAGE (Figures 3-3 and 3-4). There was no significant difference in the translation of the mutant RNAs compared to wildtype RNA. The rate of protein synthesis from RNAs with 3'NTR deletions was normal (data not shown). SDS-PAGE revealed that proteolytic processing of the viral polyprotein was unaffected by the 3'NTR deletions. The Conserved Region is Important for Negative-Strand RNA Synthesis Transcript RNAs containing the various deletions in the single-stranded region were tested in vitro for negative-strand RNA synthesis as described. Although RNA with a complete deletion of the conserved smgle-stranded region, AGUA3, was stable and supported wildtype levels of translation, detectable accumulation of negative-strands for AGUA3 RNA was not observed after 45 min at 37C (Figure 3-5, compare lanes 2 and 4). These results, when compared to the small plaque phenotype obtained after infection of cells with the AGUA3 virus stock, indicated that negative-strand RNA synthesis was not completely inhibited by the AGUA3 mutation but that it was below the limits of detection in the in vitro assay. RNA containing a slightly smaller deletion, AUA3, was also tested in vitro for negative-strand RNA synthesis as compared to wildtype. Following translation, the RNAs were assayed for replication after 1 .5 h incubation at 37C (Figure 3-6). Loss

PAGE 56

45 Mock WT AA2 AGUA3 Time(h) 0 4 0 4 0 4 0 4 • • I PI P3 3CD P2 3DPol 2BC VPO 2C VPl VPS 12 3 4 5 6 7 8 Figure 3-3: Translation of wildtype, AA2 and AGUA3 RNAs. 5 i^g of each transcript RNA was incubated in 100 f^l HeLa SIO translation reactions at 34C in the presence of [^^S]methionine. 2.5 \i\ samples were removed at 0 and 4 h and analyzed by 10% SDSPAGE. The positions of specific viral proteins are indicated to the right.

PAGE 57

46 Mock WT AUA3 AG Time(h) 04040404 Figure 3-4: Translation of wildtype, AG and AUA3 RNAs. 5 |ag of each transcript RNA was incubated in 100 ^1 HeLa SIO translation reactions at 34C in the presence of [ S]methionine. 2.5 |xl samples were removed at 0 and 4 h and analyzed by 10% SDSPAGE. The positions of specific viral proteins are indicated to the right.

PAGE 58

Figure 3-5: AGUA3 and AA2 RNAs are significantly inhibited for negative-strand RNA synthesis. 5 of transcript RNAs were incubated for 4 h at 34C in HeLa SIO translation/replication reactions. PIRCs were resuspended in [a-^^P]CTP labeling buffer and incubated for 45 min at 37C. Reactions were resolved by CHsHgOH agarose gel electrophoresis. Full-length negative-strand RNA is indicated.

PAGE 59

48 of four nucleotides from the conserved region again resulted in a severe defect in negative-strand RNA synthesis; the amount of RNA synthesis for AUA3 was below detectable levels (Figure 3-6, compare lanes 1 and 2). Lack of detectable replication of the AUA3 RNA showed that the remaining G7418 in the single-stranded region was not sufficient to support efficient RNA synthesis. RNA with a deletion of two nucleotides, AA2, was also tested in comparison to wildtype. The RNAs were incubated for 45 min at 37C as described. The defect in negative-strand RNA synthesis was still very pronounced for AA2, which replicated to about 1% of the wildtype level (Figure 3-5, compare lanes 2 and 3). RNAs containing shorter nucleotide deletions were tested in vitro for negativestrand RNA synthesis. These experiments showed that removal of just one nucleotide from the single-stranded region significantly affected the RNA's ability to replicate. Two RNAs with different single-nucleotide deletions were tested: AG and AA (Figures 3-6 and 3-7 A, respectively). The different deletions in these RNAs affected negative-strand RNA replication similarly. Mutant AG RNA replicated at 19% of the level observed with wildtype RNA after 1 .5 h at 37C (Figure 3-6, compare lanes 1 and 3). AA RNA replicated at 13% of its wildtype control after incubation at 37C for 2 h (Figure 3-7A, compare lanes 4 and 5). Plaques observed after infection with AA and AG virus stocks were similar in size (Figure 3-1). Overall, the in vitro assays demonstrated that replication was increasingly diminished as the length of the single-stranded region was reduced. Revertants of RNAs that contained deletions 7419UA3 or 7421A2 in the single-stranded region revealed fiill or partial restoration of the single-stranded region. No effect on RNA stability or translation

PAGE 60

49 WT AUAi AG Full-length RNA 1 2 3 Figure 3-6: Deletion of a single nucleotide from the conserved region negatively affects replication. AUA3 and AG RNAs were incubated in HeLa SIO translation/ replication reactions for 4 h at 34C for the formation of PIRCs. The PIRCs were resuspended in buffer containing [a-^^P]CTP and incubated at 37C for 1.5 h. Labeled negative-strand RNAs were electrophoresed on a CHsHgOH agarose gel.

PAGE 61

50 was observed in the deletion mutant RNAs. These resuhs indicate that the singlestranded region serves an important role in replication of the RNA at the level of negative-strand RNA synthesis. Temperature Sensitivity of AA? RNAs AA and AA2 were utilized to study the effect of subtle differences in the length of the single-stranded region on replication at various temperatures. Previous work suggested that virus derived from transfection of RNA containing the AA2 mutation in a short poly(A)i2 tail background was temperature-sensitive in vivo (V. Chow, xmpublished results). To determine if this effect could be reproduced in vitro, RNAs containing the indicated deletions in the poly(A)8o background were tested. The poly(A)8o background was chosen over the poly(A)i2 background because of the significant increase in replication observed in vitro with the longer poly(A) tail (5). The RNAs were translated in HeLa cellular extracts for 4 h at 34C, and then incubated at three different temperatures (32.5C, 37C, and 39.5C) to allow synthesis of negativestrand RNA (Figure 3-7). After 2 h at the indicated temperatures, the amount of RNA synthesis was determined by phosphorimager analysis of the electrophoresed RNAs. The single-nucleotide deletion, AA, decreased synthesis of fiill-length negative-strand RNA to 13% of wildtype levels at 32.5C and 37C, and to 5% of wildtype at 39.5C (Figure 3-7, compare lanes 1-2, 4-5, and 7-8, respectively). However, the single nucleotide deletion was not as detrimental to replication as deletion of two nucleotides from the singlestranded region. As observed previously (Figure 3-5), RNA containing the 7421A2 deletion was greatly impaired and replicated to less than 1% of wildtype RNA levels at

PAGE 62

51 32.5C 37C 39.5C Full-length RNA ^ < ^ ^ <
PAGE 63

52 39.50C 10-4 10-3 Figure 3-8: AA2 virus yields large-plaque revertants. 5 |Lig of WT, AA, and AA2 RNAs were transfected into HeLa cells at 32.5C to create virus stocks. These stocks were diluted as shown and used to infect BSC-40 monolayers at 32.5T, 37C, and 39.5C. Selected wells from plates infected at 37C and 39.5C are depicted.

PAGE 64

53 both 32.5C and 37C (Figure 3-7, compare lanes 1 and 3, 4 and 6). At 39.5C, no RNA synthesis for AA2 was detectable (Figure 3-7, lane 9). The results are depicted graphically in Figure 3-7B. Analysis of each individual RNA between the three temperatures revealed that wildtype levels of replication decreased by 33% at 32.5C compared to 37C, and that AA decreased by 26% at the lower temperature. There was no apparent difference in the level of replication of AA2 at either 32.5C or 37C, and the sharp decrease in replication at 39.5C is evident. Both wildtype and AA were inhibited at 39.5C compared to 37C, decreasing by 39% and 76%, respectively. Table 2: Virus titers resulting from infection at three temperatures (PFU/ml) 32.5C 37C 39.5C WT 5.5 X 10^ 1.05 X 10^ 6.0 X 10^ AA 9.2 X 10^ 4.5 X 10^ 2.9 X 10^ AA2 4.25 X 10^ 1.4 X 10^ <1 X 10^ AA2 Revertants 2.5 X 10^ 2.75 X 10' To determine whether the in vitro results that indicated temperature-sensitivity were reflective of the in vivo situation for both AA and AA2 RNAs, the RNAs were transfected into cells and virus stocks were generated at 32.5 C. These stocks were plaqued at 32.5C, 37C, and 39.5C (Figure 3-8). Only the relevant plates are shown. Virus titers for all temperatures and RNAs are presented in Table 2 and Figure 3-9. In general, wildtype virus replicated to the highest level at 37C, with a relatively small decrease in viral titer at the low and high temperatures. The trend for AA virus replication showed a decrease in titer when the temperature was raised from 32.5C to 37C, and another slight

PAGE 65

54 Figure 3-9: AA2 virus is temperature-sensitive in vivo. Plot of virus titers resulting from infection of BSC-40 cells with WT, AA, and AA2 virus stocks at 32.5C, 37"C, and 39.5C. Titers used to create this graph are listed in Table 2. The value plotted for AA2 at 39.5C does not include the titer of AA2 revertants.

PAGE 66

55 decrease as the temperature increased from 37C to 39.5C. Indications of temperature sensitivity were again observed for AA2 virus. This virus stock contained large-plaque revertants that were detected at 37C (Figure 3-8). Sequencing of plaques isolated at 39.5C revealed that they contained an addition of two A residues which restored the single-stranded region sequence to wildtype. The titer of the wildtype revertants at 37C was 2.5 X 10' PFU/ml (Table 2). Therefore, the vast majority of plaques observed at 39.5C (titer 2.75 x 10^ PFU/ml) for this virus stock were most likely wildtype revertants. The plaque phenotype of wildtype virus matched that of the AA2 virus stock at 39.5 C (Figure 3-8). The drastic decrease in virus titer seen at the higher temperature (Table 2 and Figure 3-9), strongly supported a temperatxire sensitive phenotype of AA2 RNA.

PAGE 67

CHAPTER 4 CHARACTERIZATION OF AUA3 REVERTANTS Revertants of AUA^ Contain Insertions in the Deletion Site Analysis of AUA3 RNA replication in vitro showed that this deletion in the singlestranded region reduced the generation of negative-strand RNA to below detectable levels. Transfection of AUA3 RNA led to the production of revertant virus with intermediate to large plaque phenotypes (Figure 3-1). Previous experiments conducted in this laboratory resulted in the isolation of these revertants, and determination of the revertant sequences was made (V. Chow, unpublished results). The revertants contained nucleotide insertions in the original deletion site. Four different revertant sequences were found after multiple transfections. They were 7419UUUA, 7419UUA, 7419UUC and 7419UUU. Revertant UUUA restored the single-stranded region to its natural size of five nucleotides. The others lengthened the single-stranded region to four nucleotides. No other changes in the 3'NTRs of the revertants were foimd. To prove that these insertions were responsible for the observed phenotypes, the revertant sequences were reconstructed by two-step PCR in a wildtype poly(A)8o background. Cells were transfected with the reconstructed revertant RNA transcripts to generate virus stocks. The plaque morphologies of stocks generated from UUUA, UUA, and UUC RNAs were identical to those of the original plaque-purified revertant viruses (Figure 4-1). These viruses maintained their plaque phenotypes after multiple passages, 56

PAGE 68

57 WT AUA3 Purified Virus Figure 4-1 : Confirmation of revertant plaque phenotypes in the reconstructed revertants of AUA3. Virus stocks of plaque-purified revertants (left) are compared to virus stocks created by transfection of RNAs containing the indicated sequences in the single-stranded region (right). Plates were incubated at 37*'C. Infections with WT and AUA3 are shown at the top for reference.

PAGE 69

58 Figure 4-2: Plaque phenotype of UUU virus. Virus stocks were made by transfection of WT or UUU RNA at 37C, and used to infect BSC-40 monolayers at 37C. Plaques were stained after 3 days.

PAGE 70

59 unlike revertant UUU. Transfection of UUU RNA led to the immediate production of a mixed plaque population in the resulting virus stock (Figure 4-2). This result parallels previous observations of UUU virus, which reverted after two passages from a smallplaque to a large-plaque phenotype (V. Chow, unpublished results). Revertants of UUU RNA are discussed in Chapter 6. Full or Partial Restoration of the Single-Stranded Region Increases Replication Transcripts of the reconstructed RNAs were assayed in vitro for translation and replication as described. The RNAs were incubated at 34C to allow translation and formation of PIRCs to occur. Translation levels and polyprotein processing were normal for each of the revertants tested (Figure 4-3). After 4 h at 34C, the pelleted PIRCs were resuspended in labeling buffer and incubated for 45 min at 37C. The level of fiill-length negative-strand RNA synthesis was then determined by phosphorimager analysis (Figure 4-4). UUUA RNA only replicated to 11% of wildtype, UUA to 6%, and UUC to about 1% (Figure 4-4, compare lane 2 to lanes 4, 6 and 5, respectively). As observed previously, RNA synthesis for the parent RNA, AUA3, was below detectable levels (Figure 4-4, lane 3). In a separate experiment, replication was undetectable for UUU RNA after 45 min at 37C (Figure 4-5, lane 3). As expected, the level of negative-strand RNA synthesis for AUA3 was also undetectable (Figure 4-5, lane 2). Replication of UUA in this experiment was 6% of wildtype (Figure 4-5, compare lanes 1 and 4), which matched previous results with this RNA. Translation and polyprotein processing were not affected by the UUU sequence (Figure 4-6). A summary of these results is presented in Table 3.

PAGE 71

60 AUA3 Revertants Mock WT AUA3 UUUA UUC UUA Time(h) 4 0 404040404 12345 6789 10 11 Figure 4-3: Translation is unaffected in the reconstructed revertants compared to wildtype. 5 (ig of each transcript RNA was incubated in 100 ^l HeLa SIO translation reactions at 34C in the presence of [^^S]methionine. 2.5 ^1 samples were removed at 0 and 4 h and analyzed by 10% SDS-PAGE. The positions of specific viral proteins are indicated on the right.

PAGE 72

61 AUA3 Revertants WT AUA3 UUUA UUC UUA GuHCl added Full-length RNA Figure 4-4: Revertants of AUA3 show an increase in negative-strand RNA synthesis. 5 ng of the indicated transcript RNAs were incubated for 4 h at 34C in HeLa SIO translation/replication reactions. PlRCs were then resuspended in buffer containing [a-^]CTP and incubated for 45 min at 3TC. GuHCl was added to one WT reaction as a negative control. RNAs were resolved by CHsHgOH agarose gel electrophoresis. Fulllength negative-strand RNA is marked.

PAGE 73

62 AUA3 Revertants Full-length RNA 12 3 4 Figure 4-5: UUU RNA does not replicate to detectable levels in vitro. 5 fig of each transcript RNA was incubated for 4 h at 34C in HeLa SIO translation/replication reactions to form PIRCs. PIRC pellets were resuspended in labeling buffer containing [a-^^P]CTP and incubated for 45 min at 37C. RNAs were resolved by CHsHgOH agarose gel electrophoresis. Full-length negative-strand RNA is indicated.

PAGE 74

63 AUAj Revertants Mock WT AUA3 UUU UUA Time(h) 04 04 04 04 04 I S = 12 34 56789 10 Figure 4-6: UUU RNA translates and processes the viral polyprotein normally. Translation was monitored as a control for the replication reaction described in Figure 45. 5 }xg of each transcript RNA was incubated in 100 |al HeLa SIO translation reactions containing [^^SJmethionine at 34C. 2.5 |j,l samples were removed at 0 and 4 h and analyzed by 10% SDS-PAGE. Specific viral proteins are identified to the right.

PAGE 75

64 Thus, with the exception of UUU RNA, the sequences present in the singlestranded region of the revertants increased their ability to replicate as compared to AUA3 RNA. Reversion of AUA3 indicates that the single-stranded region is important for replication. The undetectable level of RNA synthesis observed with UUU RNA in vitro also supports the idea that the single-stranded region is needed for efficient initiation of negative-strand RNA synthesis. The insertion of UUU in the deletion site most likely does not produce a single-stranded region due to the potential formation of base pairs between the inserted sequence and the poly(A) tail (Figures 1-1 and 6-2). Table 3: Length and sequence of the single-stranded region affect replication RNA Sequence Number of Bases % Replication WT GUAAA 5 100 Revertant UUUA GUUUA 5 11 AG _UAAA 4 19 AA GUAA 4 13 Revertant UUA GUUA 4 6 Revertant UUC GUUC 4 1 Revertant UUU GUUU 4 Undetectable AA2 GUA 3 1 AUA3 G 1 Undetectable AGUA3 0 Undetectable AUA3 Revertants Are Not Produced In Vitro RZ/AUA3 transcript RNA was tested for its ability to produce virus in HeLa SIO translation reactions to explore the viability of performing experiments designed to test the polymerase slippage/ recombination model of reversion (Chapter 5) under these

PAGE 76

65 conditions in vitro. The Rz/AUAs RNA contains a ribozyme that removes two G residues from the 5' end of the positive-sense transcript RNA, yielding an authentic 5' end. This allows for the synthesis of both negative and positive-strand RNA. Wildtype ribozyme RNA, without a deletion in the 3'NTR, has been shown to produce virus in HeLa extracts after 24 h at 34C (unpublished results). To test for the ability of Rz/AUAs RNA to make virus in vitro, transcripts were incubated in HeLa SIO translation reactions for 24 and 48 h. The reactions were RNaseA and Tl nuclease treated and used to infect HeLa cells. The reaction containing wildtype virus (derived from the wildtype ribozyme RNA) induced complete CPE in 24 h with liquid media. However, no CPE was observed 6 days post-infection with either of the Rz/AUAs reactions. As expected, the wildtype virus stock produced plaques upon infection (titer: 6.5 x 10^ PFU/ml), but neither of the Rz/AUAs stocks produced plaques. In a parallel experiment, Rz/AUAa transcript RNA and wildtype ribozyme transcript RNA were incubated in cell extracts containing [^'SJmethionine. The RNAs translated equally after 24 h as measured by TCA precipitation of [^"^SJmethionine-labeled proteins (data not shown). These data suggest that the reversion mechanism utilized by AUA3 RNA which is easily induced in vivo, is significantly inhibited in vitro.

PAGE 77

CHAPTER 5 MODEL FOR REVERSION OF AUA3 RNA BASED ON POLYMERASE SLIPPAGE AND RECOMBINATION Revertants obtained from transfection of AUA3 RNA contained insertions of sequences UUUA, UUA, UUC and UUU in the deletion site. These nucleotide sequences were shown to be responsible for the observed revertant phenotypes as described in Chapter 4. The level of replication of these revertants was increased by the full or partial restoration of the length of the single-stranded region. A model based on polymerase slippage and recombination was proposed to explain the reversion mechanism. This model was tested by the use of marker mutations in the AUA3 RNA. A description of the model and results from the marker mutation analysis follows. • Description of the Polymerase Slippage/Recombination Model Examination of the sequences found in revertants of AUA3 RNA revealed that each of the four groups of nucleotides inserted in the deletion site was found 3' of the deletion site (Figure 5-1). Based on this observation, a polymerase slippage/ recombination model was proposed to explain the generation of these revertants. Generation of revertant UUU can be explained by a single polymerase slippage event as the polymerase copies the positive strand template into negative sfrand RNA. In this case, the polymerase pauses at the G7418 residue without copying it, slips back three nucleotides, and then copies the UUU sequence a second time. The polymerase then 66

PAGE 78

67 G G ^ G U G A U A C G A C U U A G C A U C G U U U U AUA, Revertants C G A U UUUA A U U A C G C G ,C G^ / 7418 UUA uuc uuu 5'— G ^ A A uuuu uuuuucuuu ^ ^ A A A A AAAAAGAGG^ jj A A A Figure 5-1 : 3'NTR structure showing the proposed locations of the AUA3 revertant sequences. This observation formed the basis for the polymerase slippage/recombination model of reversion. Deletion of 7419UA3 is depicted by red dashes. Revertant sequences are color-coded according to their suggested origins 3' to the deletion site.

PAGE 79

68 copies the G7418 and continues to elongate along the template strand normally. The resulting negative-strand RNA is used as a template for the synthesis of positive-sense RNAs containing the UUU insertion. The other revertants, UUUA, UUA, and UUC, contained sequences that were not located directly next to the deletion site. The model to explain the generation of these particular revertants had two variations, depending on the template source of the inserted nucleotides. The formation of revertants containing nucleotide insertions derived from the same template strand may have been the result of the polymerase slipping and/or "jumping" along the same template RNA (Figure 5-2). Consideration that the sequences may instead be obtained from a secondary template strand suggested that the polymerase switched templates during negative-strand synthesis. To generate the revertants that contained insertions of nucleotides non-adjacent to the AUA3 deletion site, the polymerase must successfriUy insert a small number of bases into the site without also inserting the intervening nucleotides. This model is depicted in Figure 5-2. This model suggests that the required events take place as the negative strand is copied, because poliovirus recombination by a copy-choice mechanism occurs during negative strand synthesis (28). The polymerase initiates the negative-strand RNA at the 3' end of the template, and synthesizes the RNA until it reaches the remaining G7418 residue of the conserved region (Figure 5-2, A-B). The polymerase pauses at the base of the stem-loop structure, without copying the G7418 nucleotide. The polymerase, with the nascent negative-strand RNA, then slips back along the template strand (toward the 3' end) and copies a short stretch of nucleotides (Figure 5-2, C). To avoid incorporation of the bases that lie between the deletion site and the insertion sequence, the polymerase

PAGE 80

Figure 5-2: Polymerase slippage/recombination model of reversion. In this figure, the polymerase may either remain associated with the same RNA molecule upon which negative-strand RNA synthesis was initiated, or the polymerase and nascent strand may strand-switch to a second RNA molecule as described below. A. Negative-strand RNA synthesis is initiated at the 3' end of the positive-strand template by the polymerase (active site is represented by the green circle). B. The polymerase reaches the G7418 (red) and pauses, without copying it into the nascent strand. C. The polymerase and the nascent strand slip back on the template RNA, or a strand-switching event occurs such that the polymerase and the nascent strand associate with a second RNA molecule 3' to the deletion site. A short stretch of nucleotides (UUUA, in this example) is copied a second time. D. The polymerase slips forward on the template RNA to the 67418 without copying the intervening sequence. The G7418 is copied and synthesis of the negativestrand RNA continues normally. E. Positive-strand RNA synthesis is initiated from the 5' end of the negative-strand template. F. Many positive-strand RNAs are synthesized which contain the inserted sequence (UUUA) in the original deletion site.

PAGE 81

70 A 5'< B 5 < C 5 < D 5'< E 3'< F 5 (+) 3DH Active Site -(-) UUUUUCUUUAAUUCGGAGAAAAAAAAAAAAA Poly(A)go.,oo (+) u u c c G U 'a A A A A G A A aA uu Cu' uu (-) UUUUUCUUIIAAUUCGGAGAAAAAAAAAAAAA Po'y(A)8o.,oo (+) c c G U II A A aAaAgaA uu C U u UUUUUCUDUAAUUCGGAGAAAAAAAAAAAAA Poly(A)oo.,oo(+) c c G^ U # A A aA A AgaA^ Uu"^ CA A C u Uu u u (-). Uu u (1 UUUUUClllJllAAUUCGGAGAAAAAAAAAAAAA Poly(A)8o.,oo(+) i CAAAU 1 i GUUUA •5'(-) 3'(+)

PAGE 82

71 must slip forward along the template (toward the 5' end) until it again reaches the 67418 residue. Nucleotide G7418 is then copied, and synthesis of the negative strand continues normally (Figure 5-2,D). The newly synthesized negative-strand RNA molecule contains nucleotide insertions in the deletion site, which were observed upon synthesis of positivestrand RNA (Figure 5-2, E-F). As an alternative to the idea of a single RNA template involved in reversion, nucleotides located on a second RNA template may be inserted into the deletion site during negative-strand synthesis as the result of a strand switching event. In this case, the polymerase and the nascent strand disengage the first template strand and associate with a second template RNA 3' to the deletion site (Figure 5-2, C). Of course, one can imagine that the polymerase performs a combination of the movements described in this model. Testing the Polymerase Slippage/Recombination Model An overview of the polymerase slippage/recombination model is depicted in Figure 5-2. To determine whether sequences 3' of the 7419UA3 deletion site served as templates for the inserted revertant sequences, marker mutations U7427A and U7430C were introduced separately into AUA3 transcript RNA (Figure 5-3). The markers were engineered into specific nucleotide sequences suspected of being copied by the polymerase during reversion of AUA3 RNA (Figure 5-1). The RNAs containing the marker mutations were transfected into HeLa cells using the DEAE-dextran method and virus stocks were created. These stocks were used to infect BSC-40 cells in order to determine plaque morphology.

PAGE 83

72 AUAj RNA A pppGpG 5'NTR P1/P2/P3 uuuuucu u u u A A A^A AA AAAAAGAGG^U PoIy(A), 80 AUA3 + marker A: B pppGpG 5'NTR A A A Auuuu cuuu AAA A ^ G AGG ^ U u AAA Poly(A) '80 AUA3 + marker C: PPPGpG 5'NTR i uuuuucucu u A A A A-AAAAAGAGG^ U AAA Poly(A) '80 Figure 5-3: Positions of marker mutations used to investigate the polymerase slippage/recombination model. A. AUA3 transcript RNA. Nucleotides copied during the generation of the observed revertants (according to the model) are color-coded. B. RNA containing marker mutation U7427A. The arrow indicates the mutation, and the nucleotide bulge is illustrated. C. RNA with marker mutation U7430C. The mutation is marked with an arrow. Other important features of the RNAs are labeled.

PAGE 84

73 The presence of marker mutation U7427A disrupted the proposed UUC template sequence (Figure 5-1), resulting in a 7426UUC— 7426UAC change (Figure 5-3). The marker mutation U7427A greatly inhibited viral RNA replication. In multiple attempts, cells transfected with this RNA did not exhibit significant signs of cytopathic effect, and virus stocks made from these transfections had very low titers and minute plaque phenotypes. The formation of the nucleotide bulge created by this marker mutation and the change in the pyrimidine composition of Stem X in addition to the original 7419UA3 deletion severely inhibited viral RNA replication and prevented the formation of largeplaque revertants. Marker mutation U7430C altered the nucleotides thought to be the source for insertion of 7430UUA and 7429UUUA sequences into the deletion site (Figure 5-3). This marker mutation preserved the base pairing of Stem X as well as its pyrimidine composition. The plaque morphology of virus stocks created by transfection of U7430C mutant RNA was mixed, and the titers were significantly higher than U7427A virus stock titers. These virus stocks were used to infect BSC-40 cells and an agar overlay was applied. Isolated revertant plaques were picked after 2 days, purified virus stocks were prepared, and the vRNA isolated by phenol extraction and ethanol precipitation. The 3'NTR sequence fi-om each revertant was determined after RT-PCR amplification. The results are summarized in Table 4. All but three of twenty-five purified viruses contained insertions of three or four nucleotides in the original deletion site. The three viruses that did not contain insertions retained the original 3'NTR deletion, suggesting the presence of second-site mutations. These vRNAs were not sequenced fiirther to determine the locations of the reversions.

PAGE 85

74 Possible insertion of the C7430 marker mutation into the deletion site was observed only in one of the revertants, which contained an addition of UCU. However, three different revertant sequences were generated that conflicted directly with the basic arguments of the polymerase slippage/recombination model. In one revertant, the presence of the sequence UUUA was observed in the deletion site. Eight revertants from three separate virus stocks contained UUA in the single-stranded region. The presence of the C7430 marker in these revertants was verified by sequencing. This marker mutation was designed to specifically disrupt the template for UUUA and UUA, making it impossible for those nucleotides to be copied directly into the deletion site as required by the polymerase slippage/recombination model. Table 4: Revertant vRNA sequences obtained from AUA3/U743OC RNA transfection Inserted Nucleotide Sequence UUUA UUUC UUA UUC UAU UCU AUA3 # of Revertants 1 2 8 7 3 1 3 Virus Stock(s) 1 1 1,5,6 1 1 1 1,2 Further evidence that was inconsistent with the polymerase slippage/ recombination model came from the isolation of revertants that contained UAU in the single-stranded region. This novel sequence is not found in the sequence that is 3' of the deletion site in the AUA3 RNA. Based on the sequences of revertants generated in the

PAGE 86

75 presence of marker C7430, an alternate model of reversion was proposed and tested as described in Chapter 6.

PAGE 87

CHAPTER 6 INVESTIGATION OF A POLYMERASE SLIPPAGE/POINT MUTATION MODEL FOR THE REVERSION OF AUA3 RNA The mechanism of reversion for AUA3 RNA could not be explained by the polymerase slippage/recombination model described in Chapter 5. Results obtained from the use of marker mutations in AUA3 RNA contradicted that model, but led to the development of a second reversion model. In the new model, a polymerase slippage event during negative strand synthesis is followed by point mutation to produce the observed revertant sequences. An explanation of the second model and description of the experiments designed to test it are discussed below. Description of the Polymerase Slippage/Point Mutation Model In this second reversion model, the observed AUA3 revertant sequences are produced by a polymerase slippage event followed by point mutation of the inserted nucleotides (Figure 6-1). As in the first model, the polymerase initiates negative-strand RNA synthesis on the AUA3 RNA, then pauses at the G7418 without copying it (Figure 61, A-B). The polymerase then slips back on the template and copies a stretch of three or four U residues from the 7423UUUUU sequence adjacent to the deletion site (Figure 6-1, C) Then the polymerase continues synthesis of the nascent strand normally (Figure 6-1, D) According to this model, the insertion of the UUU or UUUU complementary sequence into the deletion site results in a negative-strand RNA intermediate. This 76

PAGE 88

Figure 6-1: Polymerase slippage/point mutation model of reversion. A. The polymerase (active site is represented by the green circle) initiates negative-strand RNA synthesis at the 3' end of the positive-strand RNA template. B. The polymerase pauses on the G7418 without copying it into the nascent strand. C. After pausing briefly, the polymerase and the nascent strand slip back on the template and copy a short stretch of nucleotides from the poly(U) region immediately adjacent to the deletion site. D. The G7418 is copied and negative-strand RNA synthesis continues. E. Positive-strand RNA synthesis of the intermediate negative-strand RNA is completed, yielding positive-strand RNAs with insertion of three to four U's in the deletion site. F. On a second round of replication, the intermediate positive-strand UUU RNA is copied into new negative-strand RNA molecules. Point mutations occur in some cases, as shown. G. The negative-strand RNAs are copied into many positive-strand RNAs. In this example, UUC is the final sequence in the single-stranded region.

PAGE 89

A 5'< B 5'< C 5'
PAGE 90

79 intermediate negative-sense RNA is copied into positive-strand RNA (Figure 6-1, E). To complete the reversion process, the polymerase must make a point mutation within the poly(U) stretch during a second round of negative-strand RNA synthesis. The polymerase, upon transcribing the UUU positive-strand RNA intermediates into negativestrand RNA, may create in some a successful point mutation in the U stretch (Figure 6-1, F). These RNAs would serve as templates for the synthesis of many positive-strand RNA molecules containing the advantageous point mutation (Figure 6-1, G). While this model suggests that the polymerase slippage and point mutation events occur during synthesis of the negative strand, it is possible that they also occur during elongation of positive strand RNA. As described above, this model suggests that an intermediate RNA is formed which is altered by point mutation. The U nucleotides which were copied during the synthesis of the intermediate positive-strand RNA (Figure 6-1, C-E) have the potential to form base-pair interactions with residues in the poly(A) tail. The effect is the extension of Stem X, instead of the production of a single-stranded region (Figure 6-2). A point mutation is required to disrupt the extended Stem X so that a single-stranded region is released. It is possible that in some cases, a point mutation will occur as the U nucleotides of the intermediate are copied (Figure 6-1, C). Su pport for a Polvmerase Slippage/Point Mutation Model of Reversion Determination that the polymerase slippage/recombination model could not explain the generation of all of the revertants necessitated further examination of the data. One of the revertants observed after transfection of AUA3 RNA contained UUU in the deletion site. Virus containing UUU in the deletion site reverted afler two passages in

PAGE 91

80 UUU Revertant: VPg-pUpL> 5'NTR P1/P2/P3 UUUUUIJIJUCUUU u ^AAAAAAAA AGAGG^ U 'AAA PoIy(A), 80-100 Figure 6-2: Predicted structure of the UUU revertant RNA intermediate. The vRNA from the UUU revertant is not predicted to contain a single-stranded region due to interactions with the poiy(A) tail. Wildtype U residues normally found in Stem X are colored in light blue. Those copied by the polymerase by a slippage event are colored dark blue. The G7418 is shown in red. The other major features of the RNA are labeled.

PAGE 92

81 vivo to a larger-plaque phenotype (V. Chow, unpublished results). Revertants of AUA3 RNA and AUA3/U7430C RNA that fully or partially restored the single-stranded region invariably began with a U residue. Thus, it was hypothesized that insertion of UUU or UUUU into the deletion site may be an intermediate step in the reversion process for AUA3 RNA. Based on this idea, the polymerase slippage/recombination model was proposed (Figure 6-1) and tested. First, sequence data from revertants obtained during testing of the polymerase slippage/recombination model was reviewed. Revertants obtained from transfection of AUA3/U743OC RNA (Chapter 5, Table 4) that could not be explained by the polymerase slippage/recombination model could be easily explained within the defmitions of the polymerase slippage/point mutation model. This is because the marker mutation U7430C did not alter the poly(U) stretch located immediately adjacent to the UA3 deletion site. It is this poly(U) sequence which is hypothesized to be the template for U additions in the intermediate revertant RNAs. For example, generation of the single-strand sequences UUUA and UUA in the presence of the U7430C marker mutation (Chapter 5, Table 4) is explained as the result of insertion of three to four U residues into the UA3 deletion site, followed by a single point mutation during a subsequent round of replication. Insertion of the novel UAU sequence was interpreted as the result of point mutation of the second inserted U residue to an A. Interestingly, a comparison of the two UUUC revertants isolated from transfection of AUA3/U7430C RNA (Chapter 5, Table 4) resulted in an observation that fiirther supported the point mutation model. While one of these revertants still contained the five wildtype U residues adjacent to the single-stranded region, the other revertant

PAGE 93

82 (UUUC#2) had only four (Figure 6-3). Shortening of Stem X as was observed in this revertant could result from a situation in which only three U residues were initially inserted into the deletion site. When the point mutation occurred in this particular intermediate, the U residues which were copied into the deletion site were not altered; rather, the transition of the UUU mtermediate RNA to the UUUC revertant sequence in this case probably occurred by point mutation of the first wildtype nucleotide of the original poly(U) region. This event would lead to restoration of the single-stranded region, and a Stem X that was one base-pair shorter than wildtype. The polymerase slippage/point mutation model suggests that a UUU mtermediate RNA leads to the observed revertant sequences. To determine whether the point mutation model could account for the various revertant sequences that were observed after transfection of AUA3 RNA, transcripts containing a single-stranded region with the proposed reversion intermediate sequence 7418GUUU was transfected into cells and virus stocks were prepared. The virus stocks prepared in three separate experiments contained viruses with mixed plaque morphologies (Figure 4-2). Revertant viruses were isolated from individual plaques and used to prepare first passage virus stocks. The virion RNA was isolated and sequenced. All of the revertants contained point mutations in the singlestranded region. The revertant RNA sequences obtained were UUA, UUC, UUUA, and UUUC (Table 5). The revertant sequences UUA and UUC are clearly explained by the occurrence of single point mutations. The sequence UUUA in the single-stranded region arose in each of the three revertant virus stocks. Four of twelve revertants contained this sequence. Each of the revertants contained the wildtype number of nucleotides in Stem

PAGE 94

83 Revertant UUUC #1: 5 U's after the A site VPgpUpU 5'NTR P1/P2/P3 Ll I I I I 11 11 C U C U u AAA A AG AGG U Poly(A), 80 B Revertant UUUC #2: 4 U's after the A site VPgpUpU 5'NTR I Pl/P2/Py U IJ II 11 c u c u u A A A AAAAAGAGG(U AAA Poly(A), 80 Figure 6-3: Comparison of two revertants with UUUC insertions supports the polymerase sHppage/point mutation model of reversion. AUA3/U7430C RNA was used to create virus stocks as described in the text. Two isolated revertants contained UUUC insertions. A. The first UUUC revertant. The G7418 is red. hiserted nucleotides are shown in dark blue. The marker mutation was present (green). As in wildtype RNA, five U residues (light blue) are located at the base of Stem X. B. UUUC#2 revertant. Colors are as described in "A". Only four U nucleotides (light blue) are found at the base of Stem X. The C7422 nucleotide in the single-stranded region is probably the result of point mutation of one of the original five U residues, and is therefore colored light blue.

PAGE 95

84 X. These UUUA revertants fit the point mutation model if one considers the possibiUty that during negative-strand synthesis of the transfected UUU intermediate RNA, the polymerase slipped on the poly(U) tract, and copied an additional U into the deletion site. Table 5: Revertant vRNA sequences observed after UUU RNA transfection Inserted Nucleotide Sequence UUUA UUUC UUA uuc # of Revertants 4 2 2 4 Virus Stock(s) 1,2,3 3 1,3 1,2 The mutation of UUUU— >UUUA would then occur during a subsequent round of negative-strand RNA synthesis. The sequence UUUC (Table 5), which was only found in one virus stock, could have been created in this manner as well, hi conclusion, all of the revertants generated fi-om UUU RNA, AUA3 RNA, and AUA3/U743OC RNA can be explained by the point mutation model of reversion.

PAGE 96

CHAPTER 7 THE LENGTH OF THE POLY(A) TAIL HAS A DIRECT EFFECT ON INITL\TION OF NEGATIVE-STRAND RNA SYNTHESIS The poiy(A) tail of poliovirus RNA plays an important role in RNA infectivity and replication (50,53). The length of the poly(A) tail is critical for efficient initiation of negative-strand RNA synthesis. RNA transcripts with a poly(A)8o tail replicate more efficiently than RNAs with a poly(A)i i tail (5). It is unknown, however, if this difference in replication is a direct effect of poly(A) tail length on initiation, or if it is due to an underlying effect of the short poly(A) tail on RNA stability or translation. Wildtype RNA transcripts encoding a range of poly(A) tail lengths were tested in vitro to determine whether the difference in replicative ability between these RNAs was due to a deficiency in translation levels, polyprotein processing, or a loss of RNA stability. The RNAs were also tested in vitro to determine the relationship between tail length and the amount of negative-strand RNA synthesis. Infectivity of the different RNAs was also analyzed. Relationship Between Polv(A) Tail Length and Initiation of Negative-Strand RNA Synthesis It is known that the level of negative-strand RNA synthesis observed in vitro decreases dramatically when the length of the poly(A) tail decreases fi-om (A)8o to (A)ii (5). However, it is not known if the relationship between poly(A) tail length and RNA synthesis is linear, or if there is a narrow range over which negative-strand RNA synthesis increases. To achieve a more detailed analysis of the effect of poly(A) tail 85

PAGE 97

119 length on negative-strand synthesis, clones were engineered in the wildtype background that contained poly(A) tails of varying lengths. RNAs with poly(A)37 and poly(A)29 tails were compared against RNAs with poly(A)8o and poly(A)ii tails for synthesis of fulllength negative-strand RNA in vitro. The RNAs were incubated at 37C for 45 min, then phenohchloroform extracted and resolved on a CHsHgOH agarose gel (Figure 7-1). Very little replication of the poly(A)ii RNA (Figure 7-1, lane 4) was observed. In fact, the poly(A)ii RNA replicated to less than 1% of the poly(A)8o RNA. hi contrast, poly(A)37 and poly(A)29 RNAs replicated at levels similar to that observed with poly(A)8o RNA (Figure 7-1, compare lanes 1, 2 and 3). These results suggested that the mmimum poly(A) tail length that was required for efficient initiation of negative-strand synthesis was between 1 1 and 29 nucleotides. Next, poly(A)29 RNA and poly(A)2o RNA were tested for negative-strand RNA synthesis in vitro. The results showed that decreasing the poly(A) tail length from (A)8o to (A)2o had only a small effect on the RNAs' ability to initiate negative-strand synthesis (data not shown). Therefore, additional cDNA clones were constructed as outlined in Chapter 2 which upon transcription yielded RNAs with a range of poly(A) tail lengths from 12 to 20 nucleotides long. Transcript RNAs made from these clones contained (A)2o, (A)i5, (A)i4, (A)i3, and (A)i2 tails. Use of these RNAs allowed for a detailed investigation of the minimum poly(A) tail length required for efficient initiation of negative-strand RNA synthesis. The RNAs were tested in vitro against poly(A)8o RNA for synthesis of negativestrand RNA as described (Figure 7-2). The amount of negative-strand synthesis observed

PAGE 98

87 Full-length RNA (A)8o (A)37 (A)29 (A)n Figure 7-1 : Effect of poly(A) tail length on negative-strand RNA synthesis. 5 )ag of each transcript RNA was incubated at 34^0 in HeLa SIO translation/replication reactions for 4 h. PIRCs were pelleted and resuspended in [a-^^P]CTP labeling buffer and incubated for 45 min at ?>TC. RNAs were characterized by electrophoresis on a CHsHgOH agarose gel. The position of full-length negative-strand RNA is indicated.

PAGE 99

88 with the poly(A)i2 RNA was less than 1% of the amount observed with poly(A)8o RNA (Figure 7-2, lane 6). In contrast, a significant amount of labeled negative-strand RNA was synthesized in the poly(A)i3 RNA reaction (Figure 7-2, lane 5) as compared to the reaction containing poly(A)i2 RNA (Figure 7-2, lane 6). Negative-strand RNA synthesis increased dramatically with each increase in poly(A) tail length from (A)i4 to (A)2o (Figure 7-2, lanes 2-4). Figure 7-3 depicts the amount of negative-strand RNA synthesis as a function of poly(A) tail length. These results demonstrated that significant amounts of negative-strand synthesis were first detected in reactions containing poly(A)i3 RNA, and that replication continued to increase sharply as the poly(A) tail was lengthened in small increments. Translation and Polyprotein Processing in Short Polv(A) Tail RNAs Transcripts of wildtype RNAs with poly(A)8o tails were tested in vitro for translation against RNAs with poly(A) tails covering a range of sizes from (A) 12 to (A)2o. The RNAs were incubated in HeLa cytoplasmic extracts at 34C for 4 h. Gu-HCl prevented initiation of negative-strand RNA. After incubation, the protein products were analyzed by 1 0% SDS-PAGE and TCA precipitation in duplicate (Figure 7-4). Incorporation of [^^SJmethionine revealed that franslation was not inhibited by the presence of poly(A)i2 tails as compared to (A)8o RNA. Polyprotein processing was also unaffected in the RNAs with short tails. Therefore, the low level of negative-sfrand synthesis obtained with poly(A)i2 RNA (Figure 7-2, lane 6) cannot be explained by a deficiency in the synthesis of viral replication proteins.

PAGE 100

89 (A)80 (A)20 (A)i5 (A)l4 (A)i3 (A)i2 Full-length RNA Figure 7-2: Determination of the minimal poly(A) tail length required for efficient negative-strand RNA synthesis. 5 \ig of the indicated transcript RNAs were incubated for 4 h at 34C in HeLa SIO translation/replication reactions. PIRCs were resuspended assay buffer containing [a-^'^PJCTP and incubated for 45 min at 37C. Reactions were resolved by CHaHgOH agarose gel electrophoresis.

PAGE 101

90 Figure 7-3: Effect of poly(A) tail length on negative-strand RNA synthesis. Phosphorimager data from duplicate experiments was averaged and plotted as a fiinction of tail length. Poly(A)8o RNA replication was set at 100%.

PAGE 102

91 Mock (A)80 (A)2o (A)i5 Time(h) 4 0 4 0 4 0 4 ill • 1 2 3 4 5 6 7 (A)l4 (A)i3 (A)i2 0 4 0 4 0 4 8 9 10 11 12 13 Figure 7-4: Translation is not affected by poly(A) tail length. 5 |ig of each transcript RNA was incubated at 34C in 100 ^1 HeLa SIO translation reactions containing [^^S]methionine. 2.5 [il samples were removed at 0 and 4 h and analyzed by 10% SDSPAGE. Specific viral proteins are identified.

PAGE 103

92 Effect of Polv(A) Tail Length on RNA Stability It was theoretically possible that the inhibition of negative-strand RNA synthesis observed with poly(A)i2 transcripts in vitro was a result of RNA degradation. Stability assays were therefore performed on poly(A)8o and poly(A)i2 transcripts in the HeLa SIO translation/replication reactions (Figure 7-5). [^^P]-labeled RNA transcripts were incubated in reactions containing Gu-HCl at 34C. Samples were taken at the indicated timepoints as described. The results indicated that poly(A)i2 RNA was as stable as poly(A)8o RNA (Figure 7-5 A, compare lanes 5 and 10). Quantitation of the labeled input RNAs demonstrated that 31% of the poly(A)8o RNA remained at 4 h, compared to 26% remaining for the poly(A)i2 RNA (Figure 7-5 A, compare lanes 1 and 5, and lanes 6 and 10). These results agree with data obtained by TCA precipitation of the labeled input RNAs, which showed that at 28% of poly(A)go RNA and 25% of poly(A)i2 RNA was recovered at 4 h (Figure 7-5B). These results, and those obtained from the translation experiment, demonstrated that the inhibition of negative-strand RNA synthesis of observed with poly(A)i2 RNA was not due to a decrease in RNA stability or translation. RNA stability assays on poly(A)io and poly(A)8o RNAs were also performed. The poly(A)io RNA showed a decrease in stability after 4 h at 34C compared to poly(A)8o RNA. Analysis of the gel indicated that the amount of full-length poly(A)8o RNA and poly(A)io RNA remaining after 4 h was 35% and 14%, respectively (Figure 76A, compare lanes 5 and 10). A difference in RNA stability was also seen by TCA precipitation of the labeled input RNAs, with 33% of the poly(A)8o and 21% of the poly(A)io RNA being recovered at 4 h (Figure 7-6B). hi contrast to the results obtained

PAGE 104

93 Poly(A)8o RNA Poly(A)i2RNA Time (h) 0 .5 1 2 4 Full-length RNA 1 2 3 4 5 0 .5 1 2 4 ft** Ml******* 6 7 8 9 10 B RNA Stability •a u > o o 100 70 60 50 40 30 1 1 (A)80 -^(A)i2 1 1 1 1 1 : Time (h) Figure 7-5: Poly(A)i2 RNA is as stable as poly(A)8o RNA. 6 |ag of [^]CTP-labeled RNA transcripts were incubated in HeLa cellular extracts at 34C. 20 ^1 samples were removed into 0.5% SDS buffer at the indicated time points as described and resolved by CHsHgOH agarose gel electrophoresis. Full-length RNA remaining at each time point is shown. B. Graph of TCAprecipitable RNA remaining at each time point. Each point represents two samples.

PAGE 105

94 Figure 7-6: Poly(A),o RNA is less stable than poly(A)8o RNA. [^^P]CTP-labeled RNA transcripts were incubated in HeLa SIO translation/replication reactions at 34C. Samples were removed at the indicated times and analyzed by CHaHgOH agarose gel electrophoresis. The position of fiill-length poliovirus RNA in the gel is shown. B. Graph of TCA precipitable labeled RNA remaining at each time point. Each point represents the average of two samples.

PAGE 106

95 with poly(A)i2 RNA, there was a small but measurable decrease in the stability of the poly(A)io RNA between 2 and 4 h in these in vitro assays. Together, the results indicated that RNA stability was not affected as the poly(A) tail was shortened from 80 to 12 nucleotides, but that decreasing the poly(A) tail length from 12 to 10 nucleotides negatively impacted the stability of the RNA. Relationship Between RNA Infectivity and Poly(A) Tail Length It has been shown previously that the length of the poly(A) tail affects the infectivity of poliovirus RNA (50,53). Since the results in this study showed that poly(A) tail length had a direct effect on negative-strand RNA synthesis, the relationship between poly(A) tail length and infectivity of the RNA was explored in greater detail. Poly(A)8o, (A)i5, (A)i4, (A)i3, and (A)i2 RNAs were transfected into cells using the DEAE-dextran transfection method. Representative plaques are shown in Figure 7-7. Plaques obtained from the poly(A)i2 RNA transfection were smaller than those obtained from transfection of RNAs with poly(A) tails of 1 3 or more nucleotides in length. Virus titers were determined for each RNA (Table 6). *, j i ^ • ^< • Table 6: Virus titers obtained from transfection of poly(A) tail length variants RNA PFU/^ig (A)80 1.67 X 10^ (A),5 1.5 X 10^ (A),4 5.17x 10^ (A),3 3.0 X 10^ (A),2 0.76 X 10^

PAGE 107

96 Figure 7-7: RNA infectivity increases with increasing poly(A) tail length. The indicated amounts of RNA for each poly(A) tail variant were used to transfect BSC-40 cell monolayers in duplicate. Transfected cells were overlaid with methylcellulosecontaining media. After 3 days at 37C, the cells were stained with crystal violet. Representative wells for each RNA are shown.

PAGE 108

97 RNA Infectivity 1.25 O 00 0.75 0.25 Poly(A) Tail Length Figure 7-8: Relationship between RNA infectivity and poly(A) tail length. Infectivity of each poly(A) tail length variant was determined as described in Figure 7-7 and Chapter 2. Poly(A) tail length was plotted against the virus titer obtained after transfection of each RNA (Table 6).

PAGE 109

98 The results showed that there was a dramatic increase in the infectivity of the RNA as the poly(A) tail increased from 12 to 15 nucleotides in length (Figure 7-8). The virus titers and plaque sizes observed after transfection of these RNAs correlated with their ability to synthesize negative-strand RNA as observed in the vitro assay (Figure 72). Therefore, the increase in infectivity with increasing poly(A) tail length appears to be primarily a result of an increase in negative-strand RNA synthesis.

PAGE 110

CHAPTER 8 DISCUSSION The Conserved Single-Stranded Sequence in the 3'NTR is Required for Efficient Negative-Strand RNA Synthesis The results described in Chapters 3 and 4 indicate that the conserved 7418GUA3 sequence in the 3'NTR is needed for efficient negative-strand RNA synthesis. For the initiation of negative-strand RNA synthesis, a replication complex must assemble on the 3'NTR of poliovirus RNA. The stem and loop structures present in the 3'NTR and the tertiary interactions between them are likely to comprise a scaffold upon which the replication complex forms. Predictions of the structure formed by the tertiary kissing interaction suggest that the single-stranded 7418GUA3 sequence makes up a "bridge" between the two helices, X and Y (37,43) (Figure 1-2). Mutations that changed the composition or length of this sequence had no effect on translation but had a significant inhibitory effect on negative-strand RNA synthesis. These findings are in agreement with other studies that found that alterations in the kissing interaction inhibited replication, but not translation (35,43,56). When the GUAAA sequence was partially (AUA3) or completely deleted (AGUA3), the level of negative-strand RNA synthesis was reduced below detectable levels. AGUA3 RNA was just as stable as wildtype RNA when directly tested for stability in vitro. Thus, the inability to achieve a detectable amount of negative-strand RNA synthesis was a direct consequence of the deletion, and was not due to RNA instability or lack of translation. 99

PAGE 111

100 When just one (AA, AG) or two (AA2) nucleotides were deleted from the conserved region, replication dropped to 13-19% and 1% of wildtype levels, respectively. These results suggested that the length of the region was an important factor for replication. It is likely that the observed decrease in replication was a result of a disruption of the tertiary structure of the 3'NTR. If the 7418GUA3 sequence is required for the formation and correct aligrunent of the two stacked helical regions (Figure 1-2), then deleting nucleotides from this sequence may significantly alter the tertiary structure of the 3'NTR. It is interesting to note that the single-stranded 7418GUA3 sequence and the single-stranded sequence opposite to it (7371 AGUAA) are the same length. This is consistent with the idea that, together, they have a role in maintaining spatial relationships within a higher-order structure. The effect of length of the single-stranded region versus its sequence was examined by comparing the replication ability of revertants of AUA3 RNA. These revertants contained various nucleotide insertions in the deletion site that restored the length of the single-stranded region to either four or five nucleotides. All of the revertants that contained a restored single-stranded region supported increased levels of negative-strand RNA synthesis compared to AUA3 RNA, even though the inserted sequences were not wildtype. This argued that the increased length of the single-stranded region was an important factor in restoring the ability to initiate negative-strand RNA synthesis. While the inserted nucleotides differed among the revertants, two of the sequences were very similar to each other. Revertants UUUA and UUA restored the length of the single-stranded region to five and four nucleotides, respectively. UUUA RNA replicated twice as well as UUA RNA in vitro. The primary advantage that UUUA

PAGE 112

101 ''V, RNA had over UUA RNA is likely a result of its containing a single-stranded region of wildtype length. Another indication that the length of the single-stranded region plays a significant role in replication is that revertants of AUA3 RNA containing only one or two nucleotide insertions, or revertants containing more than four nucleotide insertions, were not found. This was either because they were formed less frequently, or more likely because their ability to replicate was not significantly different from the original AUA3 RNA. Because deletion of more than one nucleotide from the conserved sequence severely inhibited replication, and all characterized revertants restored the region to at least four nucleotides in length, it seems that four nucleotides is the minimum length requirement for the singlestranded region for efficient replication. However, two revertants of AUA3/U743OC mutant RNA were observed that contained UAU and UCU in the single-stranded region. The ftinctional length of the single-stranded region in these revertants is probably only three nucleotides, since the 3' U in the UAU or UCU sequence has the potential to form a base pair with an A in the poly(A) tail that would extend the length of Stem X by one base pair. It is possible that this additional length of Stem X can compensate for the shorter single-sfranded region. Melchers et al. foimd that for Coxsackie virus B3 basepair deletions in Stem X or insertions in Stem Y led to a reduction in virus replication. This suggested that the spatial conformation of the 3'NTR loops was important (34). The deficiency in replication of the mutant RNAs was attributed to a misalignment of the nucleotides involved in the kissing interaction, as replication could be fully restored by equal insertions or deletions in the opposing stem (34). Furthermore, single base-pair insertions in Stem X alone were not found to result in phenotypic changes in virus

PAGE 113

102 replication (34). These observations from Coxsackie virus B3 may be extrapolated to help explain why poliovirus revertants such as UAU and UCU, with a single base-pair extension of Stem X and a shorter single-stranded region were successful in initiating measurable levels of negative-strand synthesis. The sequence of the single-stranded region is absolutely conserved among the human enteroviruses. This indicates that the sequence itself is an important factor for replication. The insertion of 7419UUUA in the deletion site of AUA3 RNA restored the length of the single-stranded region to five nucleotides, yet this RNA only replicated at 1 1% of the level observed with wildtype RNA. While the revertants UUA and UUC contained insertions of three nucleotides in the deletion site, they replicated to 6% and 1% of wildtype levels in vitro, respectively. These revertant RNAs supported lower levels of negative-strand synthesis than AG RNA and AA RNA, which replicated to 1319% of the levels observed with wildtype RNA. Therefore, while these four RNAs all contained single-stranded regions four nucleotides long, the RNAs that retained a greater number of wildtype nucleotides were more effective in initiating negative-strand RNA synthesis. It has been demonstrated that it is possible to create poliovirus 3'NTR chimeras that are infectious and competent for replication (49). Studies with these chimeras are consistent with the idea that the single-stranded sequence is important for efficient replication. Interestingly, exchange of the entire poliovirus 3'NTR with that of Coxsackie virus B4 resulted in only a slight reduction in RNA replication, but a polio:bovine enterovirus chimera replicated at a significantly lower level (49). While the Coxsackie B4 3'NTR has one extra stem-loop structure that is not found in poliovirus RNA, it

PAGE 114

103 contains the conserved GUAAA sequence and folds into a similar tertiary structure that involves the kissing interaction that is essential for RNA replication (35,37,59). BEV also contains a 3TSfTR that is predicted to support a kissing interaction (37), but it does not contain the conserved GUAAA sequence found in the human enteroviruses. The comparable single-stranded region in bovine enterovirus is CCUAA. Lack of the conserved GUAAA sequence may account for some of the difference in replication ability observed with these constructs. The sequence requirement in the single-stranded region suggests that it may be part of a binding site for proteins of the replication complex. Wimmer et al. have shown that proteins 3CD and 3AB bind to the 3'NTR of poliovirus RNA (22), although the exact binding site within the 3'NTR is not known. Suggestion that the sequence of the singlestranded region may be part of a protein binding site also comes from mutational analysis of Stem Y in the poliovirus 3'NTR (42). The 7415GGG7417 sequence at the base of the stem is highly conserved among the himian enteroviruses, and absolutely conserved among the polioviruses. When these nucleotides were mutated to 7415CCC7417, and the compensatory mutations were made to preserve the stability of Stem Y, there was no detectable synthesis of RNA in dot-blot hybridization assays after transfection of the cDNA (42). Because the integrity of Stem Y was preserved and no other changes were made, it is unlikely that the kissing interaction was affected, and therefore cannot account for the observed decrease in replication. These nucleotides must therefore serve some other purpose in addition to stabilization of Stem Y. The conserved nucleotides at the base of Y form a contiguous region with the conserved single-stranded region, and together may form a necessary binding site for viral or cellular replication proteins.

PAGE 115

104 Finally, the conserved single-stranded region may be necessary for an RNA-RNA interaction essential to the initiation of negative-strand synthesis. Recent observations from this laboratory strongly support a model for the initiation of negative-strand RNA synthesis that depends upon communication between the 5' and 3' NTRs (7). Bringing the 5'NTR and the 3'NTR together into a complex raises the question as to whether subsequent 5'NTR and 3'NTR RNA interactions occur. No single-stranded region in the 5'NTR complementary to the 7418GUA3 sequence has been found. Although specific RNA interactions have not been identified, the significant secondary structure of the 5'NTR, and the tertiary folding that surely results, leaves open the possibility for an RNA-RNA interaction between sequences otherwise spaced apart from each other. Studies that focus on locating the 3'NTR binding sites for the viral and cellular proteins involved in RNA replication, and a better understanding of the role of the circular RNP complex in RNA replication may help to answer some of these questions. Investigation of the Reversion Mechanism for AUA^ RNA As mentioned previously, fransfection of AUA3 RNA led to the isolation of revertant viruses that contained nucleotide insertions UUU, UUA, UUC, and UUUA in the deletion site. Interestingly, each of these revertant sequences could be found 3' to the single-sfranded region (Figure 5-1). A polymerase slippage/ recombination model was initially proposed to explain the mechanism by which these nucleotides were introduced (Figure 5-2). In summary, this model suggests that three to four nucleotides from the sequence 3' to the deletion site are copied and inserted into the site. To accomplish this, the polymerase must slip back along the positive-strand RNA template and re-copy a short sequence. Then a recombination event with another RNA occurs or the polymerase

PAGE 116

105 "jumps" forward on the same RNA strand back to the deletion site and continues synthesis of the nascent strand. Although this model suggests that the polymerase performs these actions during synthesis of the negative strand, it is also possible that these events occur during elongation of the positive strand. For example, the structure of the emerging nascent strand may cause the polymerase to pause after Stem Y is copied. In prokaryotes, an intrinsic terminator consists of a stem-loop structure with a GC rich region at its base, followed by a short poly(U) stretch (31). It is thought that the poly(U) region in the context of such a stem-loop structure signals the polymerase to pause. In the case of poliovirus, these sequences and structures are present in the positive-strand RNA. However, the experiments performed in this study cannot determine whether the pausing and slippage events occurred during negative-strand or positive strand RNA synthesis. By engineering a U7430C marker mutation into AUA3 RNA the polymerase slippage/ recombination model was directly tested. This marker mutation did not significantly affect viral RNA replication or the generation of revertants from AUA3 RNA. This may be attributed to the fact that the introduction of U7430C did not change the pyrimidine content of Stem X, and the opposing G7438 in the stem allowed base pairing to occur that preserved the integrity of the stem structure. Comparison to other enteroviruses by sequence alignment shows that BEV, Echol 1, and CA9 encode a C at the site analogous to nucleotide 7430 in poliovirus. Three of the revertants obtained after transfection with AUA3/U743OC RNA could not be explained by the polymerase slippage/recombination model. The sequences of two revertants obtained from AUA3AJ743OC mutant RNA and characterization of UUU

PAGE 117

106 revertant virus led to the formation of a second model to describe the mechanism used to restore the deleted single-stranded region (Figure 6-1). In this model, the polymerase reaches the G7418 in the positive-strand RNA template and pauses. The polymerase then slips back and copies three to four U's from the poly(U)5 sequence 3' into the deletion site. Synthesis continues normally for the rest of the nascent strand. This negative-strand RNA is thought to be an intermediate in the reversion process, since the newly inserted U residues are likely to only extend Stem X via base-pairing with the poly(A) tail (Figure 62). During a subsequent round of negative-strand synthesis, this model suggests that a point mutation is made in the poly(U) tract that disrupts one of the U/A base pairs in Stem X. A point mutation that successfully disrupts the Stem X extension is essential to the reversion process because it results in the re-creation of a single-stranded region. Two revertants that were sequenced in the process of testing the validity of the polymerase slippage/recombination model support a reversion model based on polymerase slippage and point mutation. These revertants were purified from virus stocks generated from transfection of AUA3/U743OC RNA. One contained the sequence UUUC in the conserved region, and Stem X was shortened by one base pair. Comparison of the remaining sequence to wildtype indicated that the missing base pair was one of the five A/U pairs located at the 5' base of Stem X. The revertant could therefore be explained as the result of the initial insertion of UUU in the deletion site by polymerase slippage, followed by a point mutation. The shortening of Stem X is most likely the result of a point mutation in the nucleotide immediately adjacent to the deletion site, U7423C. The second revertant contained UAU in the deletion site. The polymerase slippage/point mutation model would predict that the introduction of this non-templated

PAGE 118

107 sequence was mediated by the insertion of UUU followed by point mutation of the second U to an A. RNA with the sequence 7418GUUU was constructed to test this model. As explained above, this sequence was thought to be an intermediate in the reversion process. The goal, therefore, was to determine whether RNA with a UUU insertion was capable of reverting to the sequences previously observed in revertants of AUA3 RNA. Virus stocks were made from transfection of this RNA, and revertants were isolated and sequenced. Twelve revertants picked from three virus stocks contained single-stranded regions with the sequence 74i8GUU(A/C) or 74i8GUUU(A/C). The polymerase slippage/point mutation model can successfiiUy account for the generation of these sequences. In the case of the UUA or UUC revertants, the model predicts that the third U residue in the initial GUUU sequence was changed by a point mutation to A or C. Presumably, the polymerase also made other changes in the region that were not conducive to replication. For example, the sequence 7418GUUG was never found, another indication of the importance of sequence in the single-stranded region. The RNA used to create the virus stocks contained only three U's in the single-stranded region. Infroduction of the additional nucleotide in the 74i8GUUU(A/C) revertants can be explained by a polymerase slippage event in which the polymerase copied one of the U residues in the poly(U) tract. Then a point mutation occurred in a subsequent round of replication that led to the observed sequence. The poliovirus polymerase, SD"^', is capable of forming polymerase-polymerase interactions that occur as a result of association of specific regions of the proteins (23). One region is required for RNA binding and the other is needed to form catalytic sites.

PAGE 119

108 These interactions support the idea that 3D^ forms a higher-order structure important for the function of the polymerase. For example, the oligomerization of the polymerase may help stabilize the RNA within the replication complex (23) or prepare the RNA for replication. Other studies with SD"^' have demonstrated that the error frequency during elongation in vivo is between 9x10"* and 5x10'^. These rates were calculated for specific nucleotides at different locations along the genomic RNA (62). The model presented in this work requires that a point mutation occur within a stretch of three U residues in order to produce the observed revertants. Given the error frequency of the polymerase at specific sites, it is likely that the polymerase was able to produce the observed revertants by point mutation during replication in vivo. This model, like the polymerase slippage/recombination model, suggests that the polymerase pauses at nucleotide G7418. Regions of sfrong secondary structure can cause RNA polymerases to pause during replication and detach from the template (29,57). Nucleotide G7418 is impaired and is located at the base of a stable stem-loop structure, which may cause the polymerase to pause. The polymerase, after pausing, may slip back three or four nucleotides toward the 3' end on the poly(U) sequence, and then continue to elongate and copy the RNA template. RNA with a 7418GUA3 deletion replicated very poorly and large plaque revertants were never recovered from cells fransfected with this RNA. It appears that the loss of nucleotide G7418 in addition to the 7419UA3 deletion may have affected the ability of the polymerase pausing and slippage mechanism to generate viable revertants at this deletion site. Therefore, it is clear that viable revertants cannot be generated at all multi-nucleotide deletion sites by this simple mechanism.

PAGE 120

109 Analysis of different potyvirus coat protein sequences has led to indirect evidence of RNA-dependent RNA polymerase slippage events in the evolution of the potyvirus family (21), and may also account for observed non-tandem repeats in the D-arm replacement loops of certain tRNAs (33). Polymerase slippage has been observed v^th the vaccinia virus RNA polymerase (12) and for the T7 and T3 DNA-dependent RNA polymerases (32). When either T7 or T3 polymerase reached a poly(A) tract on the DNA template strand, slippage on the sequence occurred which resulted in U tracts of variable lengths. The data suggested that the polymerases were able to slide in either direction relative to the initiation site, as products with insertions and deletions were observed (32). Slippage has also been observed during T7 polymerase initiation (25). Reiterative copying is the mechanism by which the poly(A) tail of influenza virus is synthesized (47). When the polymerase reaches a U tract of five to seven nucleotides near the 5' end of the negative-strand template, it stalls and continuously copies the sequence (47). This results in the addition of a poly(A) tail to the nascent strand. This mechanism must involve small movements of the polymerase on the U tract to produce the long poly(A) tails. Polymerase slippage was subsequently shown to be a vital aspect of this mechanism, because RNAs with U tracts interrupted by other nucleotides were inhibited for polyadenylation. The inhibition was presumably caused by an interference of the re-alignment of the nascent strand to the template (47). It is interesting to note that the minimum required length of the poly(U) tract in influenza virus polyadenylation is five nucleotides, the same length as the U tract proposed to be the source of U additions in this poliovirus reversion model. Reiterative copying of three or four nucleotides of the poly(U)5 sequence as suggested by the polymerase slippage/point mutation model of

PAGE 121

110 reversion is possible to achieve, while still maintaining alignment of one or two A-U pairs between the nascent strand and the template RNA (Figiire 6-l,C). Polv(A) Tail Length Affects hiitiation of Negative-Strand RNA Svnthesis In addition to the 7418GUAAA 3'NTR sequence, the poly(A) tail is also required for efficient initiation of negative-strand RNA synthesis. The data presented here show that the low level of replication observed with poly(A)i2 RNA is not a result of decreased stability or translation of the RNA, but is a direct effect of the length of the poly(A) tail on negative-strand RNA synthesis. RNAs with varying poly(A) tail lengths were tested in vitro to determine the relationship between poly(A) tail length and negative-strand synthesis. RNA with a poly(A)i2 tail replicated very poorly in PIRC reactions, while poly(A)2o RNA replicated at near wildtype levels. These two RNAs supported negative-strand RNA synthesis at 1% and 86% of wildtype levels, respectively. Interestingly, a significant increase in the amount of negative-strand RNA synthesis was observed as the length of the poly(A) tail increased in length from (A) 12 to (A) 13. These levels rose sharply with the addition of each additional nucleotide to the poly(A) tail. These results showed that a large portion of the poly(A) tail could be removed before a drop in replication was observed. The dramatic inhibition of negative-strand RNA synthesis with poly(A)i2 RNA was interesting because it pointed to a role of the poly(A) tail in the initiation event itself The RNA degradation pathway in eukaryotic cells for some RNAs involves the deadenylation of the poly(A) tail, followed by decapping of the RNA (10). The poly(A)specific exonuclease DAN has recently been shown to interact with the cap structure, an association that is stimulated by the presence of poly(A) (17). A mechanism to protect

PAGE 122

Ill cellular RNAs against premature degradation by such exonucleases is the binding of the cellular protein, PABP (poly(A) binding protein). When bound to the poly(A) tail, the mRNAs are protected against 3'-5' exonuclease activity (8,13,60). Surprisingly, there is some evidence from studies on a-globin mRNA that binding of PABP can also indirectly inhibit the activity of an endonuclease (61). Binding of PABP to the poly(A) tail of poliovirus RNA is likely to have a significant role in protecting the RNA from the activity of 3' poly(A)-specific exonucleases. PABP monomers are spaced approximately 25-30 nucleotides apart in cellular mRNAs (20), and require a minimum of 1 1 nucleotides to bind (13,26,60). This minimum binding requirement was determined by competition binding assays using PABP and poly(A) RNAs of differing lengths, and is supported by the co-crystal structure of PABP (60). Considering this, poliovirus poly(A)i2 RNA is too short to support the binding of more than a single monomer of PABP. Yet, this RNA is as stable as poly(A)8o RNA, which has a poly(A) tail length sufficient to bind two to three monomers of PABP. These observations suggest that the binding of one PABP is sufficient to confer stability to poly(A)i2 RNA. That poly(A)io RNA was less stable than poly(A)8o RNA suggested that the inability to bind PABP significantly lowered the level of protection against 3' exonucleases. Aside from its role in stability, the ability to bind PABP to the poly(A) tail may directly determine whether initiation will occur. Results from Barton et al. indicated that a circular complex is formed by the interaction of the 5' and 3'NTRs, and that it regulates stability and replication of the poliovirus RNA (7,16). PABP and poly(rC) binding protein (PCBP), a protein that binds to a cytosine-rich element in the 5' cloverleaf, bind

PAGE 123

112 to each other in an RNA dependent manner (7). It is possible that successful interaction between PABP at the 3'NTR and PCBP at the 5'NTR, is required to bring the ends of the RNA together into a circular complex (7,16). RNAs with poly(A) tails too short to bind PABP may not replicate because the circular complex fails to form. Lack of replication observed with RNAs containing very short poly(A) tails may be a reflection of a malformed replication complex. A long poly(A) region may be needed for the correct positioning of 30''' in the complex relative to other proteins and structures. The polymerase may be sterically hindered by other replication proteins bound to the 3'NTR when attempting to initiate on a short poly(A). Alternatively, the end of the short tail may be obscured by the other replication proteins, hiding it from the polymerase. If 1 1 nucleotides are used for the binding of PABP, only one nucleotide remains available for the initiation event. It is interesting to note that an increase in negative-strand synthesis was observed when the poly(A) tail was lengthened from 12 to 13 nucleotides. One model for the initiation of negative-strand RNA synthesis is that VPg-pUpU primes the initiation event (2,18,40). The poly(A)i3 RNA could bind PABP, leaving two adenine residues accessible for priming by uridylylated VPg. Alternatively, non-uridylylated VPg may provide a signal required for the polymerase to initiate negative-strand synthesis. In this scenario, the two exposed adenine residues in the poly(A) tail of the poly(A)i3 RNA are the template for 3D'*' (Figure 8-1). Protein 3 AB has been shown to bind to the 3'NTR (22). Binding of 3 AB may serve to deliver VPg (3B) to the replication complex in its non-uridylylated form. One possibility is that VPg may interact with PABP in such a way that VPg is positioned correctly for initiation to occur at the end of the poly(A) tail (Figure 8-1 A). This model

PAGE 124

113 Figure 8-1 : Model for initiation of negative-strand RNA synthesis. Relevant structures and proteins are labeled. A. PABP binds to 1 1 nucleotides of the poly(A) tail, and VPg is associated with its 3' end. B. 3CD is cleaved to provide the polymerase, 3D^\ which initiates RNA synthesis using VPg.

PAGE 125

114 suggests that the polymerase utilizes the first adenine as a template for the uridylylation of VPg within the replication complex, and then elongates the nascent strand (Figure 8IB). VPg is a virally encoded protein that is covalently attached to the 5' end of the positive-stranded virion RNA (15,38). Upon entry into a cell, VPg is removed by a cellular enzyme (1,38). Sedimentation rates of the VPg precursor, 3AB, in glycerol gradients suggest that it forms a complex with 3D'"'' (45). In vitro, and in the presence of poly(A), VPg is uridylylated by 3D''' to become VPg-pUpU, but a mutation in the polymerase, M394T, results in a decrease in uridylylation activity (40). In vitro experiments have supported a role for VPg in replication (2). In translation/replication reactions using proteinase K-treated virion RNA as the template, anti-VPg antibody was added at various times during 6 h incubation in the absence of radiolabel. Then the reactions were pulse-labeled for 2 h. Anti-VPg antibody added at 0 h or 2 h completely inhibited replication of the template RNA, but antibody added at later times had less effect on replication (2). These results indicated that the replication complexes formed in the absence of VPg were unable to support initiation of the negative-strand RNA product, since no labeled RNAs were detected after the 2 h pulse label. When the complexes were allowed to form for 4 h before the addition of antibody, labeled product RNA was detectable (2). That the anti-VPg antibody had less effect when added at later times suggests that proper complexes were already formed at the time of its addition (2). While these experiments did not distinguish between uridylylated and non-uridylylated VPg, the results indicate that VPg is required for the formation of a replication-competent replication complex.

PAGE 126

115 The increase in negative-strand RNA synthesis observed with poly(A)i3 RNA compared to poly(A)i2 RNA fits with these previously observed results. The data support a model for initiation of negative-strand RNA synthesis that requires a monomer of PABP bound to the poly(A) tail for stability of the template RNA. After PABP is bound to the poly(A) tail, a minimum of two additional A residues are required to enable the priming event by VPg-pUpU, or by non-uridylylated VPg. Conclusion The 7418GUAAA sequence in the 3'NTR plays a direct role in the initiation of negative-strand RNA synthesis. Further, the data suggest that the length and sequence of the conserved single-stranded region are determining factors for the efficient initiation of negative-strand synthesis. The length of the poly(A) tail is unportant for RNA stability and initiation of negative-strand RNA synthesis. Poly(A)i3 was determined to be the minimum length needed to carry out these functions. This size requirement suggests that RNA stability is mediated by the ability of the poly(A) tail to bind PABP, and that initiation of negative-strand RNA synthesis depends upon PABP bmding, and an additional two adenine residues for priming by VPg-pUpU, or for use as a template for SD*^' to uridylylate VPg within the replication complex.

PAGE 127

LIST OF REFERENCES 1. Ambros, V., R. F. Pettersson, and D. Baltimore. 1978. An enzymatic activity in uninfected cells that cleaves the linkage between poliovirion RNA and the 5' terminal protein. Cell 15:1439-1446. 2. Barton, D. J., E. P. Black, and J. B. Flanegan. 1995. Complete replication of poliovirus in vitro: preinitiation RNA replication complexes require soluble cellular factors for the synthesis of VPg-linked RNA. J. Virol. 69:5516-5527. 3. Barton, D. J. and J. B. Flanegan. 1993. Coupled translation and replication of poliovirus RNA in vitro: synthesis of functional 3D polymerase and infectious virus. J. Virol. 67:822-831. 4. Barton, D. J. and J. B. Flanegan. 1997. Synchronous replication of poliovirus RNA: initiation of negativestrand RNA synthesis requires the guanidine-inhibited activity of protein 2C. J. Virol. 71:8482-8489. 5. Barton, D. J., B. J. Morasco, and J. B. Flanegan. 1996. Assays for poliovirus polymerase, 3D(Pol), and authentic RNA replication in HeLa SIO extracts. Methods Enzymol. 275:35-57. 6. Barton, D. J., B. J. Morasco, and J. B. Flanegan. 1999. Translating ribosomes inhibit poliovirus negative-strand RNA synthesis. J. Virol. 73:10104-10112. 7. Barton, D. J., B. J. O'Donnell, and J. B. Flanegan. EMBO J., in press. 8. Bernstein, P., S. W. Peltz, and J. Ross. 1989. The poly(A)-poly(A)-binding protein complex is a major determinant of mRNA stability in vitro. Mol. Cell Biol. 9:659-670. 9. Bernstein, P. and J. Ross. 1989. Poly(A), poly(A) binding protein and the regulation of mRNA stability. Trends Biochem. Sci. 14:373-377. 116

PAGE 128

117 10. Decker, C. J. and R. Parker. 1994. Mechanisms of mRNA degradation in eukaryotes. Trends Biochem. Sci. 19:336-340. 1 1 Deiman, B. A., R. M. Kortlever, and C. W. Pleij. 1997. The role of the pseudoknot at the 3' end of turnip yellow mosaic virus RNA in minus-strand synthesis by the viral RNA-dependent RNA polymerase. J. Virol. 71:5990-5996. 12. Deng, L. and S. Shuman. 1997. Elongation properties of vaccinia virus RNA polymerase: pausing, slippage, 3' end addition, and termination site choice. Biochemistry 36: 1 5892-1 5899. 13. Deo, R. C, J. B. Bonanno, N. Sonenberg, and S. K. Burley. 1999. Recognition of polyadenylate RNA by the poly(A)-binding protein. Cell 98:835-845. 14. Domer, A. J., B. L. Semler, R. J. Jackson, R. Hanecak, E. Duprey, and E. Wimmer. 1984. In vitro translation of poliovirus RNA: utilization of internal initiation sites in reticulocyte lysate. J. Virol. 50:507-514. 15. Flanegan, J. B., R. F. Petterson, V. Ambros, N. J. Hewlett, and D. Baltimore. 1977. Covalent linkage of a protein to a defined nucleotide sequence at the 5'terminus of virion and replicative intermediate RNAs of poliovirus. Proc. Natl. Acad. Sci. U. S. A 74:961-965. 16. Gamarnik, A. V. and R. Andino. 2000. Interactions of viral protein 3CD and Poly(rC) binding protein with the 5' untranslated region of the poliovirus genome. J. Virol. 74:2219-2226. 1 7. Gao, M., D. T. Fritz, L. P. Ford, and J. Wilusz. 2000. Interaction between a poly(A)-specific ribonuclease and the 5' cap influences mRNA deadenylation rates in vitro. Mol. Cell 5:479-488. 18. Giachetti, C. and B. L. Semler. 1991. Role of a viral membrane polypeptide in strand-specific initiation of poliovirus RNA synthesis. J. Virol. 65:2647-2654. 19. Gingras, A. C, B. Raught, and N. Sonenberg. 1999. eIF4 initiation factors: effectors of mRNA recruitment to ribosomes and regulators of translation. Annu. Rev. Biochem. 68:913-963.

PAGE 129

118 20. Gorlach, M., C. G. Burd, and G. Dreyfuss. 1994. The mRNA poly(A)-binding protein: localization, abundance, and RNAbinding specificity. Exp. Cell Res. 211:400-407. 21 Hancock, J. M., W. Chaleeprom, W. Chaleeprom, J. Dale, and A. Gibbs. 1995. Replication slippage in the evolution of potyviruses. J. Gen. Virol. 76 ( Pt 12):3229-3232. 22. Harris, K. S., W. Xiang, L. Alexander, W. S. Lane, A. V. Paul, and E. Wimmer. 1994. Interaction of poliovirus polypeptide SCDpro with the 5' and 3' termini of the poliovirus genome. Identification of viral and cellular cofactors needed for efficient binding. J. Biol. Chem. 269:27004-27014. 23. Hobson, S. D., E. S. Rosenblum, O. C. Richards, K. Richmond, K. Kirkegaard, and S. C. Schultz. 2001. Oligomeric structures of poliovuois polymerase are important for function. EMBO J. 20:1 153-1 163. 24. Imataka, H., A. Gradi, and N. Sonenberg. 1998. A newly identified N-terminal amino acid sequence of human eIF4G binds poly(A)-binding protein and functions in poly(A)-dependent translation. EMBO J. 17:7480-7489. 25. Imburgio, D., M. Rong, K. Ma, and W. T. McAllister. 2000. Studies of promoter recognition and start site selection by T7 RNA polymerase using a comprehensive collection of promoter variants. Biochemistry 39:10419-10430. 26. Jacobson, A. and S. W. Peltz. 1996. Interrelationships of the pathways of mRNA decay and translation in eukaryotic cells. Annu. Rev. Biochem. 65:693-739. 27. Jacobson, S. J., D. A. Konings, and P. Samow. 1993. Biochemical and genetic evidence for a pseudoknot structure at the 3' terminus of the poliovirus RNA genome and its role in viral RNA amplification. J. Virol. 67:2961-2971. 28. Kirkegaard, K. and D. Baltimore. 1986. The mechanism of RNA recombination in poliovirus. Cell 47:433-443. 29. Lai, M. M. 1992. RNA recombination in animal and plant viruses. Microbiol. Rev. 56:61-79.

PAGE 130

119 30. Le, H., R. L. Tanguay, M. L. Balasta, C. C. Wei, K. S. Browning, A. M. Metz, D. J. Goss, and D. R. Gallic. 1997. Translation initiation factors eIF-iso4G and eIF-4B interact with the poly(A)-binding protein and increase its RNA binding activity. J. Biol. Chem. 272:16247-16255. 3 1 Lewin, B. 1 994. Control by RNA structure: termination and antitermination., p. 457-489. In B. Lewin (ed.). Genes V. Oxford University Press, Inc., New York. 32. Macdonald, L. E., Y. Zhou, and W. T. McAllister. 1993. Termination and slippage by bacteriophage T7 RNA polymerase. J. Mol. Biol. 232:1030-1047. 33. Macey, J. R., A. Larson, N. B. Ananjeva, and T. J. Papenfuss. 1997. Replication slippage may cause parallel evolution in the secondary structures of mitochondrial transfer RNAs. Mol. Biol. Evol. 14:30-39. 34. Melchers, W. J., J. M. Bakkers, H. J. Bruins Slot, J. M. Galama, V. I. Agol, and E. V. Pilipenko. 2000. Cross-talk between orientation-dependent recognition determinants of a complex control RNA element, the enterovirus oriR. RNA. 6:976987. 35. Melchers, W. J., J. G. Hoenderop, H. J. Bruins Slot, C. W. Pleij, E. V. Pilipenko, V. L Agol, and J. M. Galama. 1997. Kissing of the two predominant hairpin loops in the coxsackie B virus 3' untranslated region is the essential structural feature of the origin of replication required for negative-strand RNA synthesis. J. Virol. 71:686-696. 36. Michel, Y. M., D. Poncct, M. Piron, K. M. Kean, and A. M. Borman. 2000. Cap-Poly(A) synergy in manmialian cell-free extracts. Investigation of therequirements for poly(A)-mediated stimulationof translation initiation. J. Biol. Chem. 275:32268-32276. 37. Mirmomeni, M. H., P. J. Hughes, and G. Stanway. 1997. An RNA tertiary structure in the 3' unfranslated region of enteroviruses is necessary for efficient repHcation. J. Virol. 71:2363-2370. 38. Nomoto, A., N. Kitamura, F. Golini, and E. Wimmer. 1977. The 5'-terminal structures of poliovirion RNA and poliovirus mRNA differ only in the genomelinked protein VPg. Proc. Natl. Acad. Sci. U. S. A 74:5345-5349.

PAGE 131

120 39. Patton, J. T., M. Wentz, J. Xiaobo, and R. F. Ramig. 1996. cisActing signals that promote genome replication in rotavirus mRNA. J. Virol. 70:3961-3971. 40. Paul, A. v., J. H. van Boom, D. Filippov, and E. Wimmer. 1998. Protein-primed RNA synthesis by purified poliovirus RNA polymerase. Nature 393:280-284. 41. Pestova, T. V., C. U. Hellen, and I. N. Shatsl^. 1996. Canonical eukaryotic initiation factors determine initiation of translation by internal ribosomal entry. Mol. Cell Biol. 16:6859-6869. 42. Pierangeli A., M.Bucci, P.Pagnotti, Anna M.Degener, and Perez Bercoff. 1995. Mutational analysis of the 3'-terminal extra-cistronic region of poliovirus RNA: secondary structure is not the only requirement for minus-strand RNA replication. FEBS Letters 374:327-332. 43. Pilipenko, E. V., K. V. Poperechny, S. V. Maslova, W. J. Melchers, H. J. Slot, and V. I. Agol. 1996. Cis-element, oriR, involved in the initiation of (-) strand poliovirus RNA: a quasi-globular multi-domain RNA structure maintained by tertiary ('kissing') interactions. EMBO J. 15:5428-5436. 44. Piron, M., P. Vende, J. Cohen, and D. Poncet. 1998. Rotavirus RNA-binding protein NSP3 interacts with eIF4GI and evicts the poly(A) binding protein from eIF4F. EMBO J. 17:581 1-5821. 45. Plotch, S. J. and O. Palant. 1995. Poliovirus protein 3AB forms a complex with and stimulates the activity of the viral RNA polymerase, 3Dpol. J. Virol. 69:71697179. 46. Poncet, D., C. Aponte, and J. Cohen .1993. Rotavirus protein NSP3 (NS34) is bound to the 3' end consensus sequence of viral mRNAs in infected cells. J. Virol. 67:3159-3165. 47. Poon, L. L., D. C. Pritlove, E. Fodor, and G. G. Brownlee. 1999. Direct evidence that the poly(A) tail of influenza A virus mRNA is synthesized by reiterative copying of a U track in the virion RNA template. J. Virol. 73:3473-3476. 48. Raju, R., M. Hajjou, K. R. Hill, V. Botta, and S. Botta. 1999. In vivo addition of poly(A) tail and AU-rich sequences to the 3' terminus of the Sindbis virus RNA genome: a novel 3'-end repair pathway. J. Virol. 73:2410-2419.

PAGE 132

121 49. Rohll, J. B., D. H. Moon, D. J. Evans, and J. W. Almond. 1995. The 3' untranslated region of picomavirus RNA: featiires required for efficient genome replication. J. Virol. 69:7835-7844. 50. Sarnow, P. 1989. Role of 3'-end sequences in infectivity of poliovirus transcripts made in vitro. J. Virol. 63:467-470. 51. Sarnow, P., H. D. Bernstein, and D. Baltimore. 1986. A poliovirus temperaturesensitive RNA synthesis mutant located in a noncoding region of the genome. Proc, Natl. Acad. Sci. U. S. A 83:571-575. 52. Spagnolo, J. F. and B. G. Hogue. 2000. Host protein interactions with the 3' end of bovine coronavirus RNA and the requirement of the poly(A) tail for coronavirus defective genome replication. J. Virol. 74:5053-5065. 53. Specter, D. H. and D. Baltimore. 1974. Requirement of 3 '-terminal poly(adenylic acid) for the infectivity of poliovirus RNA. Proc. Natl. Acad. Sci. U. S. A 71:29832987. 54. Todd, S., J. H. Nguyen, and B. L. Semler. 1995. RNA-protein interactions directed by the 3' end of human rhinovirus genomic RNA. J. Virol. 69:3605-3614. 55. Todd, S. and B. L. Semler. 1996. Structure-infectivity analysis of the human rhinovirus genomic RNA 3' non-coding region. Nucleic Acids Res. 24:2133-2142. 56. Todd, S., J. S. Towner, D. M. Brown, and B. L. Semler. 1997. Replicationcompetent picomaviruses with complete genomic RNA 3' noncoding region deletions. J. Virol. 71:8868-8874. 57. Tolskaya, E. A., L. I. Romanova, V. M. Blinov, E. G. Viktorova, A. N. Sinyakov, M. S. Kolesnikova, and V. I. Agol. 1987. Studies on the recombination between RNA genomes of poliovirus: the primary structure and nonrandom distribution of crossover regions in the genomes of intertypic poliovirus recombinants. Virology 161:54-61. 58. Tsai, C. H., C. P. Cheng, C. W. Peng, B. Y. Lin, N. S. Lin, and Y. H. Hsu. 1999. Sufficient length of a poly(A) tail for the formation of a potential pseudoknot is required for efficient replication of bamboo mosaic potexvirus RNA. J. Virol. 73:2703-2709.

PAGE 133

122 59. Wang, J., J. M. Bakkers, J. M. Galama, H. J. Bruins Slot, E. V. Pilipenko, V. I. Agol, and W. J. Melchers. 1999. Structural requirements of the higher order RNA kissing element in the enteroviral 3'UTR. Nucleic Acids Res. 27:485-490. 60. Wang, Z., N. Day, P. TrifiUis, and M. Kiledjian. 1 999. An mRNA stability complex functions with poly(A)-binding protein to stabilize mRNA in vitro. Mol. Cell Biol. 19:4552-4560. 61 Wang, Z. and M. Kiledjian. 2000. The poly(A)-binding protein and an mRNA stability protein jointly regulate an endoribonuclease activity. Mol. Cell Biol. 20:6334-6341. 62. Ward, C. Direct measurement of the poliovirus RNA polymerase error frequency both in vitro and in vivo. p. 47-75. 1990. University of Florida. 1990. Ref Type: Thesis/Dissertation 63 Wells, S. E., P. E. Hillner, R. D. Vale, and A. B. Sachs. 1 998. Circularization of mRNA by eukaryotic translation initiation factors. Mol. Cell 2:135-140.

PAGE 134

BIOGRAPHICAL SKETCH Lynn Shiels Silvestri was bom in Dover, Delaware, in 1972. She has a younger brother, Thomas, and an older sister, Kimberly. She graduated with honors from Dover High School in 1990. She continued her education at Wake Forest University in Winston-Salem, North Carolina, where she studied a major in biology and a minor in chemistry. She received a Bachelor of Science degree cum laude in biology in 1994. At that time, she accepted a position as a laboratory technician in the Environmental and Molecular Toxicology Division of Research and Development at R.J. Reynolds Tobacco Company. In 1995, she moved to Gainesville, Florida, to pursue a doctorate degree in the Department of Molecular Genetics and Microbiology at the University of Florida. While in Gainesville, Lynn met Dennis Silvestri of New York. They married two years later in 1998. Lynn will continue her career at the National Institutes of Health, where she will study the packaging signals in rotavirus RNAs. 123

PAGE 135

I certify that I have read this study and that in my opinion it conforms to acceptable standards of scholarly presentation and is fully adequate, in scope and quality, as a dissertation for the degree of Doctor of Philosophy. les B. Flanegan, Chair Professor of Molecular Genetics and Microbiology I certify that 1 have read this study and that in my opinion it conforms to acceptable standards of scholarly presentation and is fiilly adequate, in scope and quality, as a dissertation for the degree of Doctor of Philosoph Alfred S/ liewin' Professor of Molecular Genetics and Microbiology I certify that I have read this study and that in my opinion it conforms to acceptable standards of scholarly presentation and is fully adequate, in scope and quality, as a dissertation for the degree of Doctor of Philosophy. Sue A. Moyer. Q Professor of Molecular Genetics and Microbiology I certify that I have read this study and that in my opinion it conforms to acceptable standards of scholarly presentation and is fully adequate, in scope and quality, as a dissertation for the degree of Doctor of Philosophy. Thomas W. O'Brien Professor of Biochemistry and Molecular Biology This dissertation was submitted to the Graduate Faculty of the College of Medicine and to the Graduate School and was accepted as partial fulfillment of the requirements for the degree of Doctor of Philosophy. May 2001 Dean, College of Medicine cMool


xml version 1.0 encoding UTF-8
REPORT xmlns http:www.fcla.edudlsmddaitss xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.fcla.edudlsmddaitssdaitssReport.xsd
INGEST IEID ELAVASM61_VLJQIN INGEST_TIME 2014-12-23T18:21:45Z PACKAGE AA00026538_00001
AGREEMENT_INFO ACCOUNT UF PROJECT UFDC
FILES