Citation
Stable allelic lineages of Mhc class II genes within the genus Mus

Material Information

Title:
Stable allelic lineages of Mhc class II genes within the genus Mus
Creator:
Lu, Cheng-Chan, 1953-
Publication Date:
Language:
English

Subjects

Subjects / Keywords:
Alleles ( jstor )
Antigens ( jstor )
DNA ( jstor )
Genetic loci ( jstor )
Introns ( jstor )
Mice ( jstor )
Molecules ( jstor )
Retrotransposons ( jstor )
Sine function ( jstor )
Species ( jstor )

Record Information

Source Institution:
University of Florida
Holding Location:
University of Florida
Rights Management:
The University of Florida George A. Smathers Libraries respect the intellectual property rights of others and do not claim any copyright interest in this item. This item may be protected by copyright but is made available here under a claim of fair use (17 U.S.C. §107) for non-profit research and educational purposes. Users of this work have responsibility for determining copyright status prior to reusing, publishing or reproducing this item for purposes other than what is allowed by fair use or other copyright exemptions. Any reuse of this item in excess of fair use or other copyright exemptions requires permission of the copyright holder. The Smathers Libraries would like to learn more about this item and invite individuals or organizations to contact the RDS coordinator (ufdissertations@uflib.ufl.edu) with any additional information they can provide.
Resource Identifier:
23257667 ( ALEPH )
25072911 ( OCLC )

Downloads

This item has the following downloads:


Full Text











STABLE ALLELIC LINEAGES OF MHC CLASS II GENES
WITHIN THE GENUS MUS



















By

CHENG-CHAN LU


















A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 1990
























This dissertation is dedicated to the members of our family as a token of my appreciation for the love, support and encouragement they have provided over the years.














ACKNOWLEDGEMENTS


The intellectual environment provided by Dr. Edward K. Wakeland has been the single most important factor in the enrichment of my evolution as a researcher; to him I am deeply indebted. It is my privilege to express my sincere gratitude to him for his patient guidance as well as constant infusion of encouragement and inspiration, and for allowing me to exercise thoughtful freedom to proceed with this work.

I thank the members of my supervisory committee, Drs. Kuo-Jang Kao, Harry S. Nick, Ammon B. Peck and William E. Winter, for their advice and assistance throughout. The timely help and attention of my colleague Richard McIndoe during the preparation of the present work needs a special mention.

I acknowledge Drs. Wayne Potts, Murali, Jin-Xion She and William Wang for their technical help and guidance.

I would like to thank the people in the department for what they have done and provided for me to make the completion and success of my graduate study possible.

My appreciation is extended to Dr. Linda Smith for her friendship and hospitality through the years.

My sincere thanks are extended to Dr. Ahmad N. Ali and Charles C. Brown for providing free cloning vector,



iii








PbluescriptSK(+) and PbluescriptKS(+) and for their technical advice.

My sincere appreciation is extended to Vickie Henson, Thomas McConnell, Roy Tarnuzzer, Judith Nutkins, Stefen Boehme, Ivan Chang, Ying Ye, Mary Yu, Karen Wright, Julio Mas, Kristy Myrisk, Jerome and Xemena for their lively company, loving support and constant encouragement.







































iv















TABLE OF CONTENTS


Page

ACKNOWLEDGEMENTS .................. iii

LIST OF FIGURES .................. viii

ABSTRACT . . . . . . xi

CHAPTERS

1 INTRODUCTION ............... 1

2 GENOMIC ORGANIZATION OF MAJOR HISTOCOMPATIBILITY COMPLEX. ........... 4

H-2 Complex . .......... 5
Three Classes of Mhc Genes ..... 5 Organization of Mouse Mhc ....... 6 Genetic Organization of the I region 16 Linkage Relationship of Class II Genes 19 Biochemistry of Class II Molecules 23
Analysis of the Structure-Function
Relationship of Class II Molecule 27 Functional Role of Mhc Gene ...... 39 Genetic Polymorphism of Mhc Genes . 42 Recombination Within the Mhc ... 61 Definition of Evolutionary Lineage. .... 65
Structure and Evolution of Retroposon . 66
Structure of Alu and "Alu-like" family. 67 Mechanisms of Retroposition ..... 68 Function Attributable to SINE ..... 74
Evolution of Intron. ........... .. 76
Wild Mice As a Useful Genetic Tool ..... 81

3 MATERIALS AND METHODS. ........... 92

Wild Mice. . . . . 92
Soure of Mouse Tissues and Preparation of DNA 92
Restriction Enzyme Digestion and Agarose Gel
Electrophoresis ........... 95
Probes . ... .. ..... .. 96
Capillary Transfer and Hybridization ... 96 Genomic Restriction Mapping ....... 100

v








Page

Nucleotide Sequencing. ........ 100
Data Analysis. .. ..... 101
RFLP Patterns of Ab Alleles and Their
Phylogenetic Relationships ... 101
Computer Programs . . . 104
Polymerase Chain Reaction(PCR) Amplification 105
Enzymatic Amplification of Genomic DNA 105
Amplification of Central Fragment for
DNA Hybridization. ........ 109

4 SEQUENCE ANALYSIS OF LINEAGE 3 ALLELES . 114

Restriction Enzyme Analysis of Lineage 3
Alleles ........ ........... 114
Restriction-Site Polymorphism of Lineage
3 Alleles. . . . 114
Distinct Intron Size Between Lineage 2
and 3 Alleles .......... 122
DNA Sequence of Lineage 3 Intron ...... 122 Lineage 3 Derived from Lineage 2 ..... 125 Ab Genes Can Be Divided Into 4 Lineages. 141
Defining Evolutionary Lineage 2B. .... 141 4 Evolutionary Lineages of Ab Genes 156

5 EVOLUTION OF MHC CLASS II GENE POLYMORPHISM. 159

RFLP Analysis of Ab Genes Within the Genus
Mus . . . . 159
Lineage Distribution of Ab Alleles Within the
Genus Mus ............... 177
Phylogenetic Relationships of 86 Ab Alleles
in the Genus Mus ........... 180

6 DISCUSSION . . . . 193

Function of Mhc Genes ...... .. 193
Features of Mhc Polymorphism . ... 194
Mechanism of Generating Ab Gene Polymorphisms 195 Mhc Genes Evolve via Trans-species Mode 196
Possible Impact of Retroposon on Ab Gene
Expression . . .. ... 198
Linkage Disequilibrium Among Restriction
Sites ... ....... . 199
Maintenance of Mhc Polymorphism ...... 201
Overdominant Slection for Mhc
Polymorphism ........... 203
Divergent Allele Advantage ...... 204
Alu-like Repetitive Elements in A Genes 205
SINE as Evolutionary and Genetic Tags 205


vi








Pace

539 bp Retroposon: a Newly Arisen
Repetitive Family ...... ... 207
Transposition of Middle Repetitive Elements 208
Preferential Site of Integration . 208 Possible Transposition Mechanism . 209
Phylogenetic Relationship of Ab Genes . 210

REFERENCE LIST ................. 213

BIOGRAPHICAL SKETCH ... ... . . . 236









































vii















LIST OF FIGURES
Page


Figure 2-1 Location of genes in the Mhc of the BALB/c
mouse . . . . ... .. 8

Figure 2-2 Genomic structures of Mhc class I molecules. 12 Figure 2-3 Genomic structures of Mhc class II a and P
chain . . . . . 22

Figure 2-4 Location of Mhc class I and class II genes
within H-2 complex ........... . 25

Figure 2-5 A model of the antigen-binding site of the
Mhc class II I-A molecules . . . 29

Figure 2-6 Recombinatorial association and expression
of a and P chain of Mhc class II molecules ..... 37 Figure 2-7 Segmental exchange of Mhc class II Ab
genes . . . . . 48

Figure 2-8 Illustration of the evolutionary origins
of the three lineages of Ab alleles ....... 52 Figure 2-9 Analysis of the sequence homology of
bd(lineage 1) and Abb(lineage 2). ........ 55

Figure 2-10 Location of Recombinational hot spot(RHS)
within the H-2 complex ............. 64

Figure 2-11 A proposed mechanism for SINE retroposition 71 Figure 2-12 Proposed sequence of events that a group II
intron could mutate into a classical intron . 81 Figure 2-13 Geographical distribution of four separate
subspecies of Mus musculus complex ....... 85 Figure 2-14 Geographical distribution of four separate
species of genus Mus. .............. 88

Figure 2-15 Phylogenetic relationships within the genus
Mus and Rattus. . . . . 91

viii








Page

Figure 3-1 The genomic restriction map of Abd probe 98 Figure 3-2 The partial restriction map of Abk and the
sequencing strategy ............... 103

Figure 3-3 The sequences flanking the target site
(GATTCTGATACA) for the "Alu-like"(Bl) element 107 Figure 3-4 Location of two insertional events in a
lineage 3 allele(Ab) .............. 111

Figure 3-5 The nucleotide sequence of 539 bp insert 113 Figure 4-1 Restriction mapping performed by double
digest experiment ................ 116

Figure 4-2 Restriction mapping carried out by double
digest experiment. ................. 118

Figure 4-3 Restricion maps of seven lineage 3 Ab
alleles . . . . .. .. 121

Figure 4-4 Comparison of restriction maps of a
representative lineage 2 and 3 alleles. ..... 124 Figure 4-5 The 3735 bp of nucleotide sequence of Abk. 127 Figure 4-6 Partial nucleotide sequence of intron 2
from Ab"k . . . . . 130

Figure 4-7 Location of two inserts in a lineage 3(Abk)
allele . . . . . 132

Figure 4-8 Sequence identity between the retroposon
sequence in linage 2(Ab) and 3(Abk) alleles . 135 Figure 4-9 Sequence identity among 3 Ab alleles . 137 Figure 4-10 Sequence alignment among three B1 repeats 139 Figure 4-11 Southern blot experiments with Abd and
235bp non-repetitive element probe ....... 143 Figure 4-12 Blot hybridization experiment with 235 bp
non-repetitive probe . . . ... 145

Figure 4-13 PCR amplification of DNA samples from 12
species and subspecies of genus Mus ....... 148



ix








Pae

Figure 4-14 PCR amplification of DNA samples from
lineage 3 alleles and recombinant inbred strains. 150 Figure 4-15 A typical RFLP analysis and restriction
mapping . . . . ... .. 153

Figure 4-16 Restriction analysis of PCR-amplified
products. . . . . .. 155

Figure 4-17 Summary of the evolutionary relationship
among four lineage Ab alleles. ... ... 158 Figure 5-1 Restriction maps of 86 Ab alleles derived
from Table 5-1 ................. 170

Figure 5-2 Diagram illustrating the evolutionary
origins of the 4 lineages of Ab alleles assayed 179 Figure 5-3 Example of a restriction site allele used
for parsimony analysis. ............. 183

Figure 5-4 Phylogenetic relationships of 86 Ab alleles
derived from 12 species and subspecies of genus
Mus . . . . . . . 189

Figure 5-5 Phylogenetic relationships of 86 Ab alleles
from 12 species and subspecies of Mus ...... 192























x














Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy

STABLE ALLELIC LINEAGES OF MHC CLASS II GENES WITHIN THE GENUS MUS


By

Cheng-Chan Lu

December, 1990


Chairperson: Dr. Edward K. Wakeland Major Department: Pathology and Laboratory Medicine

Previous studies have organized alleles of the Mhc class II Ab gene into 3 evolutionary lineages based on genomic structures. The major distinction between lineage 1 and 2 is an 861 bp retroposon in the intron separating the A#, and A2 exons in lineage 2 alleles. By using this retroposon as an evolutionary tag, we have extended our molecular genetic studies of Ab to include 115 independently derived H-2 haplotypes from 12 separate species and subspecies of genus Mus. Ab alleles from lineage 1 and 2 were found in all 3 aboriginal species (Mus spretus, Mus spiceligus, and Mus spretoides) and in Mus caroli, indicating that these two lineages of Ab alleles diverged a minimum of 2.5 million years ago. Parsimony analysis of 86 Ab alleles, using restriction site as a character state, indicated that lineage 3 alleles


xi








are evolutionarily more closely related to lineage 2 than to lineage 1. DNA sequence of intron 2 from an evolutionary lineage 3 allele was determined. The data indicated that lineage 3 was derived from a lineage 2 allele by two additional insertional events in the intron 2. One insertion, composed of Alu-like(Bl) repeat, occurred 508 bp 3' of A.1 exon. By using the polymerase chain reaction and restriction analysis, a lineage 2 allele from Mus m. musculus, was identified to carry that B1 insert, thus defining new lineage, 2B. The other insertion, occurring in the lineage 2 retroposon, starts 1141 bp 3' of the Ao, exon. This latter insertion is 539 bp in length and is composed of Alu-like repetitive elements and unique sequence. In summary, the murine Ab genes can be divided into 4 distinct evolutionary lineages, 1, 2A, 2B, and 3, which are produced by 3 independent retroposon insertions. Lineage 3 alleles were found in Mus m. musculus and Mus m. domesticus, indicating that lineage 3 as well as 2A and 2B diverged a minimum of 0.5 millions years ago. These results indicate that all 4 lineages of Ab have persisted through several speciation events in the genus Mus.











xii














CHAPTER 1
INTRODUCTION





The I region of the murine major histocompatibility complex (H-2) contains a tightly-linked cluster of highly polymorphic genes (class II) that control immune responsiveness. Two major hypotheses have been proposed to account for the origin of this polymorphism, which is believed to be essential for the function of the class II proteins in immune protection of host. The first was that hypermutational mechanisms (gene conversion or segmental exchange) promote the rapid generation of diversity in Mhc genes. The alternative was that polymorphism arose from the steady accumulation of mutations over long evolutionary periods, and that multiple specific alleles commonly survived speciation event (transspecies evolution or ancestral polymorphism). In a previous study, McConnell et al. (1988) used restriction fragment length polymorphism (RFLP) and sequence analysis to seek evidence of "segmental exchange" and/or "trans-species evolution" in the class II genes of the genus Mus by a molecular genetic analysis of Ab alleles. This study detected 31 Ab alleles in a collection of 49 H-2 haplotypes derived


1








2

from 5 separate species and subspecies in the genus Mus. These alleles were organized into 3 evolutionary lineages on the basis of retroposon polymorphisms occurring in the intron (intron 2) separating the exons which encode the pl and 82 domains of Ab. By using this retroposon sequence as an evolutionary tag, they demonstrated that the AP alleles in two of these lineages diverged at least 0.5 million years ago and that alleles from both lineages survived the speciation events leading to several modern Mus species. These findings indicate that class II gene polymorphisms are evolving in a trans-species manner, suggesting that the extensive diversity of Mhc class II genes predominantly reflects the steady accumulation of mutations in distinct lineages of alleles which are selectively maintained in natural populations for long evolutionary periods.

In this dissertation, we address two additional issues concerning the evolution of Ab in Mus. The first issue concerns the evolutionary origin of lineage 3. What is the nature of the retroposon polymorphism in lineage 3 alleles and was lineage 3 derived from lineage 1 or lineage 2 ? If so, what kind of evolutioanry mechanism generated lineage 3 ? We have addressed this issue by sequencing a 3.8 kb DNA segment containing intron 2 from a prototypic lineage 3 allele. The results clearly indicate the lineage 3 alleles are derived from lineage 2 allele by two additional independent retroposon insertions in intron 2. The second issue concerns the








3

distribution of various Ab lineages within the genus Mus and how long these Ab lineage have persisted in the genus Mus. We have addressed this issue by expanding the RFLP analysis to include 115 independently-derived H-2 haplotypes derived from 12 separate species and subspecies of genus Mus. A total of 86 Ab alleles was identified from this analysis. Parsimony analysis, using restriction site as a character state, was also exploited to construct the evolutionary trees of Ab alleles to determine their phylogenetic relationships. DNA sequence and restriction enzyme analysis indicate that Ab genes can be divided into 4 distinct evolutionary lineages, which are generated from three independent insertional events. The presence of various lineages in different species and subspecies of Mus further the idea that the Mhc genes evolved in a trans-species fashion and they have persisted over long evolutionary timespans in genus Mus.














CHAPTER 2
GENOMIC ORGANIZATION OF MAJOR HISTOCOMPATIBILITY COMPLEX




In the past decade our understanding of the major histocompatibillity complex has advanced dramatically because of the application of both monoclonal antibody techniques and recombinant DNA technology. Biologists are now able to characterize one of the most fundamental phenomena of eukaryotic biology--the ability of organisms to discriminate between self and nonself in molecular terms. Even the most primitive of metazoa, the sponges, display cell surface recognition systems capable of discerning and destroying nonself, probably to maintain the integrity of individuals surviving in densely populated environments (Hildemann et al. 1981). There are three fundamental features about this self/nonself recogntion systems---cell-surface recognition structures, effector mechanisms that result in the destruction of nonself, and a high degree of genetic variability in the recognition structures (Hood et al. 1983).

In mammalian genetic systems, a chromosomal region termed the Mhc encodes the self/nonself recognition system with similar features. Although all vertebrates appear to posses a homologous Mhc, it has been most extensively studied in


4








5

mouse (H-2) and in man (HLA) (Gotze et al. 1977). The Mhc was first identified in mice (H-2) because of the availability of inbred and congenic strains of mice. By grafting of tumors or skins between such strains of mice and following rejection or acceptance of the graft, Gorer and others (Gorer et al. 1938, 1948) were able to map the rejection phenomena to a region on chromosome 17, which was then denoted the Mhc. In mouse at least 60 traits, most of which are associated with the immune response, have been mapped to Mhc using the classic genetic techniques (Klein 1975).



H-2 Complex



Mhc is defined as a group of genes coding for molecules that provide the context for the recognition of foreign antigens by T lymphocytes (Klein 1983). "Context" implies that T cells do not recognize antigen alone; but instead recognizes antigen in the context of Mhc molecules on the surface of antigen-presenting cells. Thus far, Mhc genes have been found only in vertebrates. It is not known whether all vertebrates possess Mhc, but so far it has been identified in twenty vertebrate species (Klein 1986).



Three Classes of Mhc Genes

Traditionally, the Mhc genes can be divided into three classes, I, II and III. Class I molecules are involved in








6

transplantation rejection and T -cell-mediated cytotoxic killing. Class II molecules serve as restriction elements during the presentation and processing of foreign antigen to regulate the immune response. Certain complement components, e.g. C3 and C4, are encoded by class III genes within the Mhc complex. However, no significant homology can be shown between Mhc genes and complement genes, and although the C4 genes is closely linked to Mhc in many species, the C3 genes are only loosely linked to some species, but not in other species (Alper 1981). Klein et al. (1983) have argued against the inclusion of the complement genes as a class of Mhc genes.



Organization of Mouse Mhc

The H-2 complex of the laboratory mouse is the only Mhc in which nearly all of the loci have been identified and their position determined. For example, the molecular map of Mhc genes of C57BL/10 (Weiss et al. 1984) and BALB/c (Steinmetz et al. 1982a; Winoto et al. 1983) haplotypes have been extensively characterized. From the centromeric part of the Mhc of the BALB/c mouse, a 600 Kb segment cluster has been cloned containing two class I (K and K2) and seven class II genes (Pb(A3) to Ea) (Steinmetz et al. 1986) (Figure 2-1).


















4 (1) a) 0 00
0 >4


0g



it N







4 1 U) c SU





-1 a ) I 4) E1 4







0 $ *HO 'I
*H04C
-4 PQM r









8

O
Co




F-F
4-C















-0
a O







/- o








/ ) 0I












-o






z 0c m U O. w : w .)
n" m C''.5 I)








9

Following a gap of about 170 kb, a second gene cluster of 330 kb in length has been cloned from the S region containing (C4, SlP, Bf, C2) coding for complement or related components and two homologous genes (21-OHA and 21-OHB), one of which encodes for steroid 21-hydroxylase (Muller et al. 1987). A third gene cluster covering 500 kb of DNA has been isolated from the D and Qa regions and localizes the positions of 13 class I genes(D to 01-10) (Stephan et al. 1986), the TNF-a and .- genes coding for cytotoxins (Muller et al. 1987b). From the Tla region, a total of 19 class I genes are distributed in 3 gene clusters. In summary, the Mhc complex of the BALB/c mouse contains 50 loci, of which 34 loci are class I and 7 are class II genes (Steinmetz & Uimatsu 1987). Whereas in the Mhc of C57BL/10 mouse, 26 class I genes have been identified, of which 10 genes are in the Qa2.3 regions and 13 genes in the TL region (Flavell et al. 1985). Among 3 H-2 haplotypes (b, d and k) analyzed thus far (b, d and k), the K and the class II regions show no large differences in organization (Klein & Figueroa 1986).



Genetic loci of class I gene

There are two class I genes (H-2K and H-2K1) at the centromeric end of the H-2 region; all the remaining genes are at the telomeric end. The class I loci can be divided into two subclasses: I-a, consisting of loci with a known function (H-2K, H-2D, H-2L) and I-b, consisting of the remaining loci








10

whose functions are largely unknown. The class II loci and a group of unrelated loci including genes coding for complement components are inserted between two H-2K loci and the rest of class I loci (Figure 2-1). The class I loci can be assigned to one of four regions: K5, _, Qa and Tla, depending on their position, this division only in part reflects the evolutionary relationships among the individual loci (Klein & Figueroa 1986). Class I transplantation antigen are found on virtually all nucleated cells of the mouse. The cell surface antigens encoded in Oa-2.3 and Tla region can be further distinguished from classical class I antigen because they are less polymorphic and more limited in tissue distribution than K or D-encoded antigens (Flaherty et al. 1980).



Class I gene structure. The exon-intron organization of class I genes are remarkably similar to each other. Each class I gene is composed of 8 exons, which correlates precisely with the domain structure of class I polypeptide (Figure 2-2) (Steinmetz et al. 1981; Nathenson et al. 1981). The first exon encodes the leader peptide, the second, third, and fourth exons encode the al, a2 and a3 domains. The fifth exon encodes the transmembrane region, and the sixth, seventh, and eighth exons encode the cytoplasmic domain and 3' untranslated region (Figure 2-2).




















Q) M

O
- 1


0.


UO4
0t









C.)O
4
oH r 0 *p2








O. u k
-C r



'
m t






u-OC# Or









km M













12

















r c
















1 0~

CE "0
oc























I'



N5 0 I 0E C.G





-cu








13

Class I polypeptide. Class I protein has a mol. wt. of 45,000 daltons and is a transmembrane glycoprotein noncovalently associated with P2-microglobulin (p2m), a 12,000-dalton polypeptide encoded by a gene located on chromosome 2 in the mouse (Goding et al. 1981; Michaelson et al. 1981; Robinson et al. 1981). Amino acid sequence analyses have demonstrated that class I antigen can be divided into 5 domains (Coligan et al. 1981). The three external domains, al,a2 and a3, are each about 90 residues in length. The transmembrane portion is about 40 residues and the cytoplasmic region is about 30 residues long. The a2 and a3 domains have a centrally placed disulfide bridge spanning about 60 residues and up to three N-linked glycosyl units bound to these domains (Maloy et al. 1982). Amino acid sequence analyses also suggest that the a3 domain (Strominger et al. 1980) and #2microglobulin (Peterson et al. 1972) show strong sequence homology to the constant region domains of immunoglobulins. Binding studies from class I molecules with peptide fragments have shown that the #2m subunit associated with the a3 domain (Yokoyama et al. 1983).



Three dimensional model of class I molecules. Recently, a three dimensional structure of human class I molecule HLAA2 was studied by X-ray crystallographic analysis (Bjorkman et al. 1987a, b). Soluble HLA-A2 was purified and crystallized after papain digestion of plasma membranes from








14

a homozygous human lymphoblastoid cell line. Papain treatment yields a molecule composed of al, a2, a3 and $2m. This class I molecule consists of two pairs of structurally similar domains: al has the same tertiary fold as a2 likewise a3 has the same tertiary fold as #2m. The a3 and #2m both have Psandwich structures composed of two antiparallel P-plated sheets, one with four P-strands and one with three 1-strands, connected by a disulphide bond. The same tertiary structure has been shown for constant region of immunoglobulin and is consistent with high degree of sequence homology between c3, #2m and constant region. The structurally similar al and r2 domains are paired, with the four 1-strands from each domain forming a single antiparallel 1-sheet with eight strands. This particular intramolecular "dimeric interaction" (McLachian et al. 1980) seen between al and a2, involving the creation of a single P-sheet from two domains, has been observed in many inter-molecular dimers, and has been proposed to be preserved in an intermolecular dimer, such as Mhc class II molecules (Bjorkman et al. 1987b).



Antigen binding site of class I molecule. Several observations suggest that the groove between al and a2 helices is the antigen binding site (ABS) (Bjorkman et al. 1987b). It is located in a position, distal from the membrane end of the molecule, capable of being recognized by receptors of another cells. The site, -25 A long by 10 A wide by 11 A








15

deep, has a size and shape consistent with the expectation. By analogy with class II molecules, class I molecules bind processed antigen in a form of peptides. Synthetic peptides have been shown to bind to purified murine class II molecules, presumably mimicking processed antigen (Guillet et al. 1986). Because class I and class II molecules have homologous structures (Kaufman et al. 1984) and T cells specific for either class I or II molecules use the same receptors (Rupp et al. 1985; Marrack & Kappler 1986), the type of interaction described between peptides and class II molecule is assumed to apply to peptides and class I molecules. Electron density representing an unknown molecule, possibly a bound peptide antigen, is found in the site of two crystal forms of HLA-A2 class I molecules (Bjorkman et al. 1987b). An a-helical conformation has been proposed for bound peptide (Berkower et al. 1986; Allen et al. 1987). Thus, one face of a peptide ahelix is envisioned to contact the class II molecule, the other to be contacted by T cell receptor. Many of the polymorphic residues that are responsible for recognition by T cells and haplotype-specific association with antigens are located in this site where they could serve as ligands to a processed antigen. This is further evidence that this region functions as antigen binding site (Bjorkman et al. 1987b). Most of non-conserved residues are located in and around the ABS site, suggesting that most variable residues in class I molecules have been selected to generate an ability to present








16

many different peptides. It is also noted that some of conserved amino acid residues are located in the ABS, suggesting that they may recognize a constant feature of processed antigens, consistent with the previous suggestions.



Genetic Organization of the I Region

In the past the I region had been divided into five subregions by serological and functional analysis of recombinant H-2 haplotypes; these are: I-A, I-B, I-J, I-E and I-C (Murphy 1981; Klein et al. 1981; Klein et al. 1983). The subregions are defined by crossover positions in H-2 recombinant strains. However, so far only four I regionassociated (Ia) products have been identified by both serological and biochemical analysis (Jones 1977; Uhr et al. 1979). Failure to identify gene products encoded by I-B, IJ, and I-C subregions was further explained as follows:



I-B subregion

The existence of a separate I-B subregion was initially proposed by Lieberman and coworkers (1972) to explain the genetic control of antibody response to a myeloma protein. The involvement of the I-B subregion was later postulated for immune responses to at least five other antigens: lactate dehydrogenase B (LDHB) (Melchers et al. 1973), staphylococcus nuclease (Lozner et al. 1974), oxazolone (Fachet et al. 1977), the male-specific antigen (Hurme et al. 1978), and








17

trinitrophenylated mouse serum albumin (Urba et al. 1978). In all these cases the mapping of genes controlling the immune response centered around the four critical H-2 haplotypes,i.e. B10 (A) (H-2") C57BL/10 (H-j) Bl0.A(4R) (H-2h) and B10.A(5R) (H-_25), used by Lieberman and her co-workers. However, further analysis by Baxemanis et al. (1981) of the response to LDH, and to myeloma protein MOPC173 revealed the involvement of Th and T, cells in response to these antigens, making the postulate of a separate I-B subregion unnecessary.



I-J subregion

This locus was originally defined serologically and mapped between I-A and I-E by reciprocal alloantisera raised between strains BlO.A(3R) and B1O.A(5R), which are inbred congenic recombinant strains with a crossover between I-A and I-E subregions (Murphy et al. 1978a, 1978b). Alloantisera and monoclonal antibodies raised against I-J-encoded molecules react with determinants expressed on suppressor T cells, and the soluble suppressor T cell factors released by these cell lines (Krupen et al. 1982). There is a lot of experimental data available supporting the existence of I-J locus (Murphy et al. 1978a; Waltenbaugh et al. 1981). However, its true identity and chromosomal location remain elusive. By using restriction fragment polymorphisms (RFLP) to map the crossover points among inbred congenic mouse strains that have recombination events between I-A and I-E loci, I-J subregion








18

was mapped to a 3.4 kb segment of DNA between I-A and I-E, including 3' half of Eb gene (Steinmetz et al. 1982). Molecular cloning of this 3.4 Kb region from ten parental and intra-I recombinant inbred strains have narrowed the distance between cross points separating I-A and I-E to 2.0 kb, contained entirely within the intron between 41-E42 and 42 exon of Eb gene (Kobori et al. 1984). Although a lot of explanations have been put forth to account for the apparent paradox of I-J, all of them are refuted by experiments showing that cloned DNA of this region fails to hybridize to mRNA isolated from I-J+ suppressor T cell lines (Kronenberg et al. 1983).


I-C subregion

This subregion was defined by the Ia.6 specificity, detected as a cytotoxic antibody present in B10.A(4R) (H-2h2) anti-BlOA(2R) (H-2h4) antiserum (Sandrin et al. 1981). These antisera containing purported anti-I-C antibodies were shown to react with a suppressor factor generated in a mixed lymphocyte reaction (MLR) (Rich et al. 1979; Rich et al. 1979). A MLR that is generated in congenic strain combination differing at the I-C subregion can be inhibited by the addition of anti-I-C antisera (Okuda et al. 1978). Mapping by classic genetic methods has suggested a locus in the I-C subregion between Ea and the gene coding for the C4 complement components. Although this segment of DNA has not been








19

characterized using molecular techniques, the data available do not lend support for the existence of I-C. Others have never been able to demonstrate any activity in I-C-defining H-2h2 anti H-2h4 combination by serological methods, MLR, graft-versus-host reaction, or cell-mediated lymphocytotoxicity (CML) assays (Juretic et al. 1981; Livnat et al. 1973).



Linkage Relationship of Class II Genes Class II gene loci

Chromosomal walking through the I region by the ordering of overlapping cosmid clones (Steinmetz et al. 1982a) as well as genetic mapping of restriction fragment length polymorphisms (Mathis et al. 1983; Hood et al. 1983), has allowed the chromosomal localization of the loci encoding the four functional defined class II genes. A continuous stretch of about 500 kb of DNA encompassing the I region was first isolated by screening a BALB/c sperm cosmid library with a human Mhc class II DRA cDNA probe (Steinmetz et al. 1982a). This 500 kb region of DNA includes the right end of I region, as the complement component C4 gene mapping into the S region can be identified (Figure 2-1). C4 gene is located a few hundred kb distal to the Ea gene and was identified by a synthetic oligonucleotide probe specific for the aminoterminal of C4a subunit. Five class II genes, Aa, Ab, Eb, Eb2, and Ea extending over a 90 kb region of DNA, have been








20

identified. Ab, Aa and Ea were identified by DNA sequence analysis, and Eb was identified by a specific oligonucleotide probe. Eb2 was identified by cross-hybridization with a human DRA cDNA probe and mouse Eb gene. The identity of Eb gene was confirmed by comapping via RFLP analysis which localizes a serologically defined Eb recombinant in the middle of Eb gene (reviewed by Hood et al. 1983). Southern blot analysis of mouse genomic DNA with class II probes suggested that class II genes are single copy and that there are no more than two a genes and six p genes in the mouse genome (Steinmetz et al. 1982a; Devlin et al. 1984). All the known class II loci are contained in a tightly-linked cluster, inserted between the H-2K and C4 genes. This cluster contains 4 functional genes and 4 pseudogenes, which are further divided into two subclasses, I-A and I-E. The eight class II genes, Pb (A03), Ob (AP2), Ab, Aa, Eb, Eb2, Ea, and Eb3, are arranged in this order from the centromeric towards the telomeric end (Steinmetz et al. 1982a; Davis et al. 1984; Larhammar et al. 1983; Widera et al. 1985) (Figure 2-1 & Figure 2-3). Out of the eight genes, only four are have been shown to encode gene products, A coupled with A# to form I-A molecules, E, with Eg to form I-E molecules (Jones et al. 1978; Uhr et al. 1979). The Ob and Eb2 genes are reported to be transcribed, but at very low levels and have no detectable protein product (Wake & Flavell 1986). The Pb gene is a pseudogene, at least in the b and k haplotypes, as it has a deletion of eight nucleotides























O )
4 U0







4
co


H
0 4

0 .







me
O4
H0 04










o HC






0




4) s
k ?








-0 0


00 O
- .0 H 0 c4 o
I g
N 4) to14





:1 (L) ON X a-oi 0 >4 44 IQ ts 0









22










mm


5











z .










818
CO
/m mm






Ci) C ,,





0 03








23

and a termination codon in its sequence. The Eb3 thus far has been found only in the H-2b haplotype, but probably also exists in other haplotypes (Flavell et al. 1985b). All haplotypes studied thus far contain these class II genes. The distances between these genes are, with a few exceptions, approximately the same in different haplotypes.



Biochemistry of Class II Molecules

Up to now only four I region-associated (Ia) products have been identified by both serological and biochemical methods. The I-A subregion contains 3 loci that encode three serologically detectable polypeptides: Ap, A4, and E (Jones et al. 1978). I-E subregion contains a locus that encodes a fourth class II polypeptide chain, E (Uhr et al. 1979).



Structure of class II ploypeptides

The two class II molecules encoded in the I-A and I-E subregions are both heterodimeric glycoproteins composed of one heavy (a) and one light (P) chains (Figure 2-3 and Figure 2-4). The a chains range in molecular weight from 30,000 to 33,000 and the P chains range in molecular weight from 27,000 to 29,000. The difference in molecular weight of a and P chain is due to an extra N-linked glycosyl unit attached to a chain (reviewed by Klein et al. 1983). The structure of the class II polypeptides have been determined in a number of






















H 44 O~r



0 0
0
0o
g *0 r.4



C 4

H



0
HH *

ap

4 H 04( 04

H

mwo


$# 0 -H1

X) C 0 -)
0
Olg











oJ 0
re4 prOr












geW 0 .
(.)l -H












O ) 00

.) 0
P

4G g I ,C













op 4 14 I0















ONN
-H I I N4 w0








25












u















CC
-0






8














0 <,,








26

studies (McNicholas et al. 1982; Mathis et al. 1983a; Malissen et al. 1984; Benoist et al. 1983; Larhammar et al. 1983; Estess et al. 1986). The sequence data available suggest that the mouse I-A and I-E molecules are homologous to human pQ and DR class II genes, respectively (McNicholas et al. 1982; Malissen et al. 1983a; Larhammar et al. 1983). Each class II molecule consists of two extracellular domains, al and a2 or P1 and P2, each about 90 residues in length, a transmembrane region of about 30 residues, and a cytoplasmic tail of about 10-15 residues. Three of the four extracellular domains (a2, 1l and P2) have a centrally placed disulfide bridge spanning about 60 amino acid residues, while the al does not. The membrane proximal domains of both a and P, like that of class I molecules, show strong homology to immunoglobulin constantregion domains. In this respect, the class I and class II molecules are very similar to each other in overall organization and domain structure. For each of the two polypeptide chains of class II molecules, a and P chains, the polymorphic residues are concentrated in the al and P1 aminoterminal domains (Benoist et al. 1983; Larhammar et al. 1983). These domains are responsible for binding peptides in what appears to be a single site. By aligning the sequences of class II a and 6 chains with the class I heavy chain by matching the al and 1l domains of class II with the al and a2 of class I, a hypothetical tertiary structure for class II molecules has been proposed (Brown et al. 1987) (Figure








27

2-5). The folding of the class II molecule resembles that of class I, in that two a helices are supported by an array of eight -plated sheets (Brown et al. 1988). The recent results of Perkins et al. (1989) showing that peptides presented by class I molecules can be presented by class II molecules, and vice versa, support the notion that the structures of peptidebinding sites are similar in class I and class II.



Structures of class II genes

There is a striking correlation between the gene organization and domain structure of Mhc class II molecules (Figure 2-4). Both a and P genes begin with leader-encoding exons that contains 3-6 residues of the mature proteins. Exon 2 and 3 encode al or pr and a2 or P2 domains, respectively. P genes have three exons encoding TM, CY, and 3'UT region, while a genes have TM, CY, and the beginning of 3'UT regions in exon 4, and the rest of 3'UT region in exon 5 (Larhammar et al. 1983; Estess et al. 1986).



Analysis of the Structure-Function Relationship of Class II

Molecule

The application of DNA-mediated gene transfer (DMGT) has been a major advancement in the analysis of structure and function relationships of Mhc gene products. Particularly,






















H
H

I







r-4





0 a)






4J




.-4















44
0
-4

4)

0













IH r-4



0



















00 f-4


4 :
*U
LA
IfU,
0)0 $.f

-4

























29



























































ar ~







r
r










iC
r-, 'lr~L V8








I


















:i:


















I I I










I r
I


:
I



~

r
I



















iii' I








30

DMGT has provided insight into the actual biochemical bases of immune recognition and regulation, which are highly dependent on the fine structure of Mhc-encoded products and T cell receptors with which they interact.



Regulation of class II gene expression

The expression of class II genes is normally limited to a number of tissues (Klein 1986). Cell surface expression of class II is positively regulated by the addition of gamma interferon (King & Jones 1983). Gamma interferon can increase both class I and class II gene expression (King & Jones 1983). It appears to act at the level of transcription, since the surface expression is correlated with the level of specific mRNA (Nakamura et al. 1984). Initial studies on class II gene expression following transfection were performed using cells that either constitutively expressed (B lymphoma) or were inducible (macrophage cell lines) for endogenous class II genes (reviewed by Germain & Malissen 1986). Introduction of the genomic copies of mouse class-II genes into B-lymphomas resulted in high levels of gene transcription and the expression of gene products of the transfected genes on the cell surface (Ben-Nun et al. 1984). However, it was difficult to assign the observed effect in serologic or T cell restriction element to the introduced gene products. The assembly of a variety of class II molecules following the introduction of a and/or P chains, prevented the dissection








31

of which introduced chain caused the phenotypic traits. Iamouse fibroblast L cell lines derived from the original L-cell line of C3H fibroblasts have been used for a variety of gene transfer studies. Using cosmid clones containing the complete DRA and DRB genes, L cells were first demonstrated to express the class II molecules by Rabourdin-Combe & Mach (1983). No expression was seen when either DRA gene or DRB gene was introduced separately. This is consistent with the suggestion that a:P pairing is required for the efficient cell-surface expression of Mhc class II, although one recombinant, A.TFR5 (I-Af, Eak) has been suggested to express a free E. chain on the cell surface (Begovich et al. 1985). Their observations were confirmed by studies of Malissen and coworkers (1984) and Norcross et al. (1985) with mouse class II genes. In both studies, transfection of either a or P chain gene alone failed to lead to the membrane expression, whereas the cotransfection of the &:A$ pairs derived from the same haplotypes (e.g. A'd d,kk) resulted in significant surface expression. These results agree with those obtained using Ia' recipient cells, in that the independent transfer of a or P chain genes result in the expression only through pairing with the endogenous complementary class II gene products (Ben-Nun et al. 1984). However, one should be cautious about the view that a:p heterodimers are required for the surface expression, as most of the monoclonal antibodies used for the detection of membrane molecules have not been








32

shown to react with single a or P chains, which presumably would assume a different configuration as single chains from when paired with the other complementary chain. Thus, the surface expression of isolated a or P chain might be undetectable using standard reagents. However, additional experiments are also consistent with a lack of surface expression of free a or P chains. McCluskey et al. (1985) compared the surface expression of Ae chain gene in L cells to membrane expression of a chimeric classII:classI gene. The latter chimeric molecule is composed of A ik domain covalently linked to the a3, TM and CY portion of class-I-Dd molecule. Following transfection, the expression of the chimeric gene can be detected with both anti-I-Ak and anti-a3 (Dd) monoclonal antibodies. The same anti-I-Ak antibodies failed to detect the surface expression of L cells transfected only with the native A$sk chain gene and shown to contain the high level of Abk mRNA. This pair of cells was also analyzed using rabbit anti-I-A heteroantiserum, which has been shown to precipitate free A$ chain from a reticulocyte lysate in vitro translation product (Robinson et al. 1983) and to detect both A. and As polypeptides in western blots (Germain & Malissen 1986). Again, the cells containing the chimeric gene stained, but the cells containing the native Ak gene alone did not. These results indicate that single a or P chain do not reach cell surface efficiently and further imply that the A41 domain per se does not prevent surface expression.








33

Dispensability of I-E molecules

It has been estimated that some 20% of wild mouse populations do not express I-E molecules (Gotze et al. 1981). Laboratory inbred mouse strains of b, s, f, and q haplotypes fail to express serologically detectable I-E molecules (Jones et al. 1981). The defect in mice of b and s haplotypes is due to a deficiency of E. chains; E. polypeptide is undetectable in the cytoplasm while the normal amount of cytoplasmic E chains can be visualized by 2-D gels (Jones et al. 1981). The expression defect of these strains can be complemented by crossing b or s haplotypes with Ea-expressing strains, which results in normal expression of hybrid I-E molecules in F1 hybrids (Jones et al. 1981). However, neither E, nor E4 chain can be detected in cytoplasm of f- and q-haplotype mice, because of defective processing of both Ea and Eb mRNA (Mathis et al. 1983; Tacchini-Cottier et al. 1988).



Combinatorial association

L cells have also been used to examine the issue of allelic control of a:P pairing and restriction on crossisotype a:P assembly. Initial studies by Fathman & Kimoto (1981) and Silver et al.(1980) suggested that Ia+ cells from heterozygous individuals contain a mixture of Ia molecules derived from the free assortment of allelic a and P chains of a single isotype in all possible combinations. Thus, in (H2b x H-2k)F1 mice, one would find &bAb, bAk kA_ and kAkbkk








34

heterodimer in approximately equivalent proportions. Such aand #- chain mixing within an isotype did not seem to occur between distinct isotypes (i.e. A:&). However, during attempts to develop cell lines expressing only Fl-type Ia molecules (e.g. dA4k), it was found that although haplotypematched e:A4 pairs yield high expression in primary transfectants, cotransfection of haplotype-mismatched pairs gave little or no expression (Germain et al. 1985). This was true even though the genes used for the matched or mismatched gene pairs were identical, and despite the presence of detectable Aa and Ab mRNA in the nonexpressing cells. Additional experiments revealed that for genes of b, d and k haplotypes, cis-chromosomal a:p pairs (e.g. LAkAsk) always gave better expression than trans-pairs (e.g. Ak Ab); experiments also indicated that the expression of the latter varied over a wide range, depending on the particular allelic forms of a and P employed. Furthermore, AbAk and AkAb molecules, the basis for previous suggested "free pairing", are the best expressed haplotype-mismatched mixes, whereas AkAd has never been detected. In order to map the region of the AB molecules controlling the preferential pairing, recombinant A# molecule involving the b, d and k alleles were constructed. The entire A#, domain was exchanged between different alleles, or the amino-half of A4 was covalently linked to the carboxyl-half of A#, and various A2, TM and CY regions. These "domain and hemi-domain shuffled" Ab genes








35

were independently cotransfected with Aab,'d'rk into L cells. Their results indicate that the most important portion of Ab with respect to a:P pairing is in the amino-half of A1, in that molecules containing this region from a given allele expressed best with cis-matched Aa and at levels similar to wild type Ab, irrespective of the origin of the remainder Ab gene. However, when isotype-different a:# pairs were cotransfected into L cells, the results were quite unexpected. Although introduction of Abk and Eaa/k yield no surface Ia detectable with either anti-Ab or anti-E antibodies, Abd did pair with Ea to produce membrane molecules reactive with antiI-Abd and anti-I-Ea antibodies. Immunoprecipitation studies showed that these molecules existed as noncovalently associated dimers (Germain & Quill 1985). These data support the view that Aa and Ab genes located on the same chromosome actually coevolve for best "fit", such that cis-pairs form more efficiently than trans-pairs (Figure 2-6). This view is further supported by the studies of McNicholas et al. (1982), showing that an 8-10 fold preference of EaU:E4u assembly over Ea:E4k in cells of (B1O.A(4R) x B1O.PL) F, mice. The data on cross-isotype molecules indicate control of a:P pairing is strongly influenced by the highly polymorphic amino termini. To evaluate the relative efficiency of inter- versus intraisotypic Ia dimer expression, L cells were sequentially transfected with multiple class II a and P chain genes (Germain & Sant 1989). Then individual clones were analyzed




























0





*4
0
0

C










*4
0
-'
4J


C1
Og 0l





OH
-,H

r-4W




37




1
liii Sii li Ii' i I i Ii

1* iwi
.








38

both for the level mRNA expression produced by transfected genes and for their expression of inter- and intra-dimer at the surface. In three gene transfection system (e.g., Ab, Ea, and Eb), it was found that isotype-matched E dimer was expressed at 3-5 times the efficiency of the isotypemismatched E dimer based on the amounts of each P chain required to drive cell surface expression for the limited amount of EI. When A and Ea were compared their coexpression with relative excess A, the efficiency advantage of isotypematched ( Ag) versus isotype-mismatched (EA4) is about 3 to 4 fold. Additional experiments employing transfectants expressing Abd, Aad, Ebd, and Ea showed that in clones expressing mRNA ratios similar to B cells, only the isotypematched dimers were expressed. In clones that expressed high levels of AOd, in addition to isotype-matched dAd and EdE there was a significant amount of Ed at the cell surface. These data indicate that the asymmetry chain production in individual chain levels can lead to the expression of less favored isotype-mismatched dimers. In a recent report, recombinant mouse strains and transgenic mice with defective Eb genes, but with normal Ea genes, were examined for surface expression of E molecules (Anderson & David 1989). E molecules were shown to be expressed in B10.RFB2 (Abf, Aaf, Eb Eak) and B1O.RQB3 (Abq, Aaq, Ebq, Eak) by cell surface staining with anti-_E monoclonal antibody (14-4-4) in flow cytometry analysis. It has been proposed that these E.








39

molecules in fact may be hybrid Ia dimers formed by E:A pairing, as they can not be stained by E4-specific antibodies and can be detected in H-2q mice with the Eak transgene. This finding is further supported by the demonstration of E d'_d as a major class II molecule at the cell surface of a BALB/c B cell lymphoma (Spencer & Kubo 1989). Furthermore, although the hybrid EAg can not be isolated by immunoprecipitation, it can function in vivo leading to the clonal deletion of two eV TcR subsets, V06 and V811 (Anderson & David 1989), which have been shown to interact with the I-E molecule during the thymic selection (Kappler et al. 1987).



Functional Role of Mhc Gene



One of the most distinguishing features of gene products of Mhc is their extensive genetic diversity. One of the most important breakthroughs in cellular immunology was the discovery that the influence of gene products of the Mhc on immune response stemmed mainly from the critical role they played in the activation of regulatory T lymphocytes (Benacerraf 1981; Heber-Katz et al. 1982, 1983). Immune T cells are clonally specific and only recognize foreign antigens in the context of appropriate Mhc molecules. The discovery of this Mhc-restriction was possible only because Mhc molecules are polymorphic and T cells selected by an antigen in the context of one polymorphic variant can be








40

activated only by the same combination of foreign and Mhc molecules (reviewed by Parham 1984). T cells must corecognize antigen in association with one of these Mhc-encoded molecules in order for activation to occur. Cytotoxic T cells prefer class I molecules whereas inducer T cells prefer class II molecules. However, the relationship between the antigenspecific and Mhc-specific recognition component of T-cell receptor remained speculative until the advent of T-cell cloning. Kappler et al. (1981) fused two T-cell clones with different specificities and asked whether the antigen- and Mhc-specific component could segregate independently. A hybridoma specific for ovalbumin (OVA) in association with the I-Ak molecules was fused to a normal T-cell line specific for keyhole limpet hemocyanin (KLH) in the context of I-Af molecules. The resulting cloned somatic hybrid could be stimulated to secret interleukin-2 by either original pair of antigen and Ia molecule, but not by OVA in association with I-Af or KLH with I-Ak. These results indicated that T cell recognition of antigen was dependent on recognition of the Ia molecules. The first convincing evidence that indicated that Ia molecules and antigen interact with each other during the T-cell activation process came from the studies of B10.A mice immunized with pigeon cytochrome c (Heber-Katz et al. 1982). In defining the specificity of the response by using different species of cytochrome c, it was noted that the moth cytochrome c and its C-terminal fragment always elicited a heteroclitic








41

response, i.e. it was more potent on a molar basis than the immunogen, pigeon cytochrome c. Although most of the B1O.A (E k:Ek) T-cell hybridomas specific for pigeon cytochrome c could be stimulated by moth cytochrome c in association with B1O.A(5R) hybrid I-E (E b:Ek) antigen-presenting cells, they could not be stimulated by pigeon cytochrome c in the context of hybrid I-E. No other antigen presenting cells (APCs) carrying disparate H-2 haplotypes, e.g., APCs from B10 and B1O.A(4R) mice (neither strain express I-E molecule), gave any stimulation. Thus, these T-cell clones were able to recognize moth cytochrome c associated with either pk:_k or b:Ek Ia molecules. Other experimental evidence also suggested that antigen recognition by cytotoxic T cells was fundamentally similar to that of helper T cells (Hunig & Bevan 1982). Using Ia-containing planar membrane as antigen presenting particles together with defined synthetic peptides, it was demonstrated that Ia and "processed" antigen are the only requirement for T cell recognition. That Ia and processed antigen interact specifically prior to T cell recognition was supported by the observation that antigens could compete with one another at the level of antigen presentation in the absence of T cells (reviewed by Buus et al. 1987). The first direct biochemical evidence of a specific antigen/Mhc interaction came from equilibrium dialysis studies using affinity purified Mhc molecules and labeled synthetic peptide (Babbitt et al. 1985). They








42

demonstrated that hen egg lysozyme (HEL) 46-61 [HEL(46-61)] bound to I-Ak, but not to I-Ad. This binding study correlated with the finding that T cells specific for HEL (46-61) from high responder H-2 k mice are restricted by I-Ak whereas H2d mice are low responders. These results demonstrated a correlation between immunogenic peptide-Ia interaction and Mhc restriction (Babbitt et al. 1985). Furthermore, it was shown that the failure of pigeon cytochrome c to be recognized in the context of the hybrid I-E molecule was due to the fact that hybrid I-E molecule was unable to interact with pigeon cytochrome c-derived synthetic peptides (Buus et al. 1987). Each Mhc molecule binds many different peptides, using a single binding site and probably through the recognition of broadly defined motifs (Buus et al. 1987). This concept of single antigen binding site is compatible with the recently described X-ray crystallographic structure of human class I molecules (Bjorkman et al. 1987a, 1987b).



Genetic Polymorphism of Mhc Genes

There are five distinguishing features of H-2 polymorphism in wild mice that have been the subject of considerable investigation. 1) there is a large number of alleles encoded by each genetic locus. The most polymorphic genetic loci known in the mouse are located within the H-2 complex. Although at least 50 alleles have been detected for the H-2K and for the H-2D genes, it is estimated that at least 100








43

alleles may exist in each of these genes (Gotze et al. 1980; Klein & Figueroa 1981, 1986). There are other genes within the H-2 complex are also highly polymorphic, but they tend to be less polymorphic than the H-2K and H-2D genes. 2) most if not all wild mice are heterozygous with respect to H-2 class I and class II genes (Duncan et al. 1979; Nadeau et al. 1981). This high level of heterozygosity is unprecedented in the mouse and is mainly, if not entirely, a result of the presence of a large number of alleles in wild mouse populations. It was estimated that over 90-95% of the wild mice are heterozygous at both K and D loci and at least 85% are heterozygous at the Ab and Eb loci (Duncan et al. 1979; Nadeau et al. 1981). These figures concur with the high H-2 polymorphism estimated from the antigen and gene frequencies (Klein 1986). 3) H-2 polymorphism occurs as a family of closely related alleles. Both amino acid and DNA sequence analysis demonstrates that the similarity between H-2 genes and proteins is discontinuous (Wakeland et al. 1986). 4) both sequence and amino acid analysis of serologically and biochemically indistinguishable class II molecules derived from different subspecies suggest that they are identical (Arden et al. 1980; Arden & Klein 1982). 5) there is a high percentage of nucleotide difference between alleles from the same locus. The nucleotide sequence variation can go up as high as 5-10%, including the coding region (Benoist et al. 1983; Estess et al. 1986)








44

Mechanisms Qenerating polymorphism of Mhc genes

Mutation. It is generally believed that ultimate source of genetic variation is mutation (Nei 1987b). There is no evidence suggesting that the extensive diversity of Mhc is generated by high mutation rate (Hayashida & Miyata 1983; Klein 1987). Serologic typing of class II genes of wild mice in global populations suggested class II molecules can be arranged into families of alleles, based on the antigenic similarity and tryptic peptide fingerprints of I-A molecules (Wakeland & Klein 1979; Wakeland & Klein 1983). Each family consists of a cluster of closely related alleles. Tryptic peptide fingerprinting comparisons of alleles within the same family revealed that the contemporary Aa and Ab alleles arose from common ancestors by multiple independent mutational events (Wakeland & Darby 1983). Furthermore, radiochemical sequence analysis of structural variants within the family indicates that these I-A variants have diversified by accumulating discreet mutations within the al and pl domains of I-A molecules (Wakeland et al. 1985). Similar conclusions have been drawn from the studies of human class II molecules (Gustafsson et al. 1984).


Gene conversion. Gene conversion (hypermutational mechanism or segmental exchange) is a process whereby the nonreciprocal exchange of genetic information between two genes occurs (Baltimore 1981). It differs from unequal crossing








45

over in that neither gene gains or loses genetic material. Classically, it has been studied in allelic genes of fungi due to the ease of tetrad analysis. However, a growing amount of evidence suggests its existence in mammalian genomes (reviewed by Hansen et al. 1984). Analysis of the murine class I mutants has provided compelling evidence for the occurrence of gene conversion-like events in Mhc gene. Nathenson and his coworkers have undertaken the painstaking structural analysis of a series of mutant Kb molecules (Geliebter et al. 1987) Four antigenically important regions within the al and a2 domains of Kb molecules are revealed from the analysis. Alterations in these regions result in the formation of new epitopes which are detectable by graft rejection in vivo and CTL in vitro. The result of their analysis suggests that micro-recombinations between Kb and other class I genes may be responsible for the generation of diversity of class I gene. In most, if not all, mutants analyzed, the non-classical H-2 genes, i.e. Qa and Tla region gene are identified to be donor genes that can recombine into and "mutate" H-2 genes. There is evidence showing that the gene conversion is operating in H-2 class II genes as well (Mengle-Gaw et al. 1984). A B6.CH-bm12 (bm 12) mouse is Mh class II Abb mutant, derived by spontaneous mutation from a (BALB/c x B6)F1 parent. The bml2 mutant and its B6 parent show reciprocal skin graft and twoway mixed lymphocyte reaction (MLR). Genetic studies and tryptic peptide mapping studies have concluded that Abbl2 gene








46

from bml2 mutant differ only 3 nucleotide from its B6 parent Abb gene. By T cell proliferation assay and monoclonal antibody-blocking studies, alloreactive T cell clones are shown to recognize the Ek Eb and &bA bm12. Comparison of sequences among Abn12, Abb and Ebb indicates that the bml2 DNA sequence is identical to the Ebb sequence in the region where it differs from Abb. Furthermore, this region is flanked by a stretch of identical DNA sequence between Abb and Ebb. These results suggest that the bml2 mutation arose by gene conversion of this region of Ebb into the corresponding region of Abb. The maximum extent of sequence transfer between Ebb and Abb is estimated to be 44 nucleotides, but could be as little as 14 nucleotides. Evidence of segmental exchange has also been provided by analyzing the exon sequences of eight Ab alleles (McConnell et al. 1988). In an attempt to analyze the association between exon and intron sequences, it was noted that most alleles of exons evolve in association with their associated intron sequence polymorphisms with the exception of two alleles, Abb and Abnod (Figure 2-7). These two alleles appear to be the products of intragenic segmental exchange (McConnell et al. 1988).





















0 0 .O
-I/ U)i b Q4J 0 .4 4 A


.H 0 Cr




0H E






0 0 r
S.0 W1 o m











0 O0



- 0.
(k O U) o r43 r 4) P
O r" *4 0






*Og@ ,C t o O ) V

0 m O







48






cqI
09
w









t'0


_ 0) c-





0 C CD






C








49

Trans-specific evolution. The evolutionary rate of Mhc loci is not higher than that of any other loci (Hayashida & Miyata 1983). Although the presumed rapid diversification within species can be explained by mechanisms such as gene conversion, an alternative hypothesis has been proposed by Klein et al. (1980, 1987). According to this hypothesis, the evolution of Mhc polymorphism is via a trans-species mode, starting with a number of major alleles that are passed on in phylogeny from one species to another. During the evolutionary process the alleles accumulate the mutations, which result in the extensive diversity of Mhc genes. There is mounting evidence supporting this hypothesis. McConnell et al. (1988) assembled a collection of 49 H-2 haplotypes derived from five Mus species, including Mus m. musculus, Mus m. domesticus, Mus m. castaneus, Mus spicilequs, Mus spretus. A total of 31 Ab alleles was defined by RFLP analysis. Based on the degree of sequence divergence, 31 alleles defined by restriction fragment length polymorphism (RFLP) can be divided into three distinct evolutionary lineages. Most of these alleles (28 out of 31) were in either lineage 1 or 2, both of which consisted of alleles derived from 4 separate Mus species (Table 2-1 and Figure 2-8). These findings are consistent with the trans-species evolution of Ab gene and contrast with data obtained when other nuclear genes or mitochondrial DNA (mtDNA) polymorphisms were analyzed in mice from the same populations. Genomic sequence comparisons of Abd and Abb show










50







0 0
.,H






O( o
0- WON 0 0) 04 04- 0 0 00 0









rl.l H 4











.u r C a) 0 0 0



> 0 r
44*









0
4J)
H -H



-1'4



C 0 Ha











O r-4 wco >>




I 0
4 -H 0

















0 o w O C Hw .) aP 4) 0 4 ) IA P 4 M r-". ) 0 Per, M






0 pO .) ,H oQ *H

QO S








rd .d o l ,0 o U OU4




0 U 0 ( ~4J


0OU OM 9 000 0





















0 *4 U4 -4 # t0 i 0 0




H H N) *-4 4'r 414









52













c1




C.
s




CLL


'3~ Ol











aa








53

that the region of highest divergence between these alleles occurs in the intron separating the pl and P2 exons (Figure 2-9). Abb contains an additional 861 bp of inserted sequences, which are composed of SINE (short interspersed repetitive elements), commonly named retroposon. The relationship of this retroposon polymorphism to the evolutionary lineage defined was tested by genomic restriction mapping of Ab genes from both lineages, 1 and 2. The results indicated the 861 bp retroposon insertion is characteristic of lineage 2 alleles. Using the SINE sequence as an evolutionary tag, it is estimated that the Ab alleles in these two lineages diverged at least 0.4 million years ago and have survived the speciation events leading to several Mus musculus subspecies.

Their studies are further supported by the works of Figueroa et al. (1988). They showed that the molecules encoded by alleles of Ab locus fall into two groups defined by their reactions with monoclonal antibodies. One group reacts with antibodies specific for the antigenic determinant H-2A.m25; the other with antibodies specific for determinant H-2A.m27. This serological reactivity pattern correlates with a specific structural feature of the proteins of Ab genes. Sequence comparison of Ab genes derived from inbred and wild strains has revealed that m27-positive proteins have two amino acids deleted at positions 65 and 67 in the pi exon, while m25 antibodies react with Ab chains that do not have deletions.















' 0M Q4 ) C OP4,% 2o ~ U O4 W 4o0) 4 4JW 04o.J WQ ) n

X 0 mC 0 O($ a) tn *MM4) r O


. mH 4 *HM ri 4 0
.) 40)


.C 44 C O ,C O 4 a) o i 0)0)



0O; 0)H O 4 0 H 4J r 4 n ) W -. 0 -' o apf '
OO ) UN
* u A 0 X 4 C 42


N H0 a 0 *


0 1l*H .. 0 ) "" (0 t ) 0)




0m0 0 0O




0 0) 4 -4 42 CA > o 0 0 0 4






Q U>
0 -Hqc6 42)U) H* 0 10 ro ,1 0 4










55













in (D
I- 00 4
w

0 mn "0
< .0
-I


Oc'o
QL 1~ co 133






Sli
I I c m m.



T"I



0)
0i S







a:
90

CO0) Cl
cc 0

0L






IAI
U) 0
LL

-j CL






v, co
0-0
0) 0.c. I







II
(I)u
0P _h ~ C
Q.0








56

But no Ab molecules were ever detected to be positive ornegative for both antibodies simultaneously. The perfect correlation between the serological pattern and the presence or absence of the two deletions have been confirmed by testing a panel of Ab in Northern blot analysis (Figueroa et al. 1988). The same deletion polymorphisms also exist in other species distantly related to M. musculus complex such as M. caroli and M. pahari, which is estimated to be separated from M. musculus complex 1.7 and 4.8 million years ago, respectively. Furthermore, the non-deleted and deleted forms of Ab genes are also shown to be present in inbred strains of rat, which is another rodent genus closely related to the genus Mus. They conclude that the codon deletion polymorphisms are shared not only by different species of the same genus but also by different genera of the same order.

Comparisons of class I Mhc alleles in two closely relatedly species: humans (Homo sapiens) and chimpanzees (Pan troglodytes) have also indicated the trans-species mode of evolution in this family of genes (Lawlor et al. 1988; Mayer et al. 1988). There are no features that distinguish human alleles from chimpanzees. Individual HLA-A or B alleles are more closely related to individual chimpanzee alleles than to other HLA-A or B alleles. These studies support the notion that a considerable proportion of contemporary HLA-A and B polymorphisms existed before divergence of the chimpanzee and human lines. A recent report indicates that as high as 30%








57

of asian wild mice (e.g. Mus m. musculus, Mus m. domesticus, Mus m. castaneus) carry a H-2KE antigen detected by an alloantiserum specific for H-2 class I gene (Sagai et al. 1989). H-2Kf antigen is further characterized by a panel of monoclonal antibodies and restriction enzyme analysis with a H-2K locus-specific probe for 3' end of H-2K. A characteristic RFLP pattern was always found to be associated with a monoclonal antibody reactivity pattern. The concordance between the presence of antigenic determinant and a particular RFLP pattern is observed not only in Mus musculus subspecies, but also in M. spretus. Their results indicated that the antigenic determinant reactive with monoclonal antibodies is an ancient polymorphic structure which has survived speciation in the Mus genus, and is closely associated with a stable DNA segment at the 3' end of H-2K gene.



Intra-exonic recombination. A recent study of Mhc class II Ab genes indicated that another mechanism was mainly responsible for the genetic diversity of Mhc genes (She et al. 1990b). A panel of 52 different alleles derived from laboratory inbred mice as well as various species of mice and rats was analyzed for their A2 nucleotide sequence. Examination of the patterns of sequence polymorphisms revealed that the majority of sequence diversity was localized in five subdomains. Each of these subdomains have several








58

polymorphic sequence motifs. On the basis of the hypothetical three-dimensional structural model of class II molecules (Brown et al. 1988), these polymorphic sequence motifs are located in the regions encoding the ABS. With respect to the whole A2 exon, it was found that a specific sequence motif could associate with several different motifs from other subdomains to form an allele. This observation indicated that the diversification of A2 exons resulted from intraexonic recombinations which shuffled these motifs into various combinations (Wakeland et al. 1990a; She et al. 1990b)



Mechanisms that maintain Mhc polymorphisms

Although a variety of data indicate that Mhc polymorphism is maintained by some type of balancing selection, the precise mechanisms involved have remained controversial. Two forms of balancing selections, overdominance and frequency-dependent selection, have been proposed to account for the unprecedented genetic diversity of Mhc genes.



Overdominant selection(heterozygous advantage). The maintenance of Mhc polymorphism by overdominant selection was first proposed by Doherty and Zinkernagel (Doherty & Zinkernagel 1975). It is based on the well-established experimental observation that Mhc-linked responsiveness is a dominant (or codominant) genetic trait (Benaceraf & Germain 1978). Mhc heterozygotes are capable of responding to any








59

antigens recognized by either parental Mhc haplotypes, since Mhc molecules encoded by both Mhc haplotypes are coexpressed on the surfaces of antigen-presenting cells (Benaceraf & Germain 1978). Hughes & Nei (1988) examined the pattern of nucleotide substitution in the region of ABS, involving the 57 polymorphic amino acid residues and other regions of Mhc class I alleles of both human and mice. Their study is based on the theoretical prediction that in the presence of overdominant selection the rate of codon substitution is increased compared with that for neutral alleles and only nonsynonymous substitution would be subject to overdominant selection as synonymous substitutions are more or less neutral (Maruyama & Nei 1981). This increase in rate of codon substitution is due to the selective advantage of heterozygotes carrying the new mutant allele. Their results indicate that in the ABS the rate of nonsynonymous substitution is higher than that of synonymous substitution, whereas in other region the reverse is true. In a later study (Hughes & Nei 1989), the same type of analysis is extended to class II Mhc genes. It is concluded that the unusually high degree of polymorphism at class II Mhc loci is caused mainly by overdominant selection operating in the ABS. Therefore, the biological basis of overdominant selection for class II Mhc loci seems to be similar to that for class I Mhc loci. A mathematical study of overdominant selection model also indicates that it can maintain polymorphic allelic lineages








60

for a long time and thus it has sufficient explanation for the trans-species evolution of Mhc gene (Takahata & Nei 1990).



Frequency-dependent selection. Initially it was speculated that Mhc alleles generate heterozygote disadvantage in association with infectious diseases and that some kind of frequency-dependent selection is required to maintain the high degree of polymorphism (Bodmer 1972). Pathogen adaptation model was suggested as one form of frequency-dependent selection (Snell 1968; Bodmer 1972). This model is based on the assumption that host individuals carrying new antigens, which have arisen recently by mutation, will be at an advantage because pathogens will not have had the time to adapt to infecting the cells with new antigens. Therefore, this will generate a new form of frequency-dependent selection, in which a new Mhc allele initially has a selective advantage compared with an old allele, but gradually declines with time. This model also suggests that in the presence of pathogen adaptation the average heterozygosity, the number of alleles, and the rate of codon substitution will increase compared with those for neutral alleles.



Rare allele advantage. Another model of frequency dependent selection is rare allele advantage. This hypothesis is based on the notion that endemic pathogens, which evolve much more rapidly than their vertebrate hosts, will tend to








61

adapt their antigenicity to minimize immune recognition by the most prevalent Mhc genotypes in a population. Consequently, new or rare Mhc alleles will have a selective advantage due to increased resistance to prevalent pathogens. This model predicts cyclic fluctuations in the frequencies of Mhc alleles as pathogens are driven to evolve antigenicity, evading the immune responsiveness of a series of new "prevalent" alleles. This model can explain the maintenance and long persistence of polymorphic alleles by rescuing the rare alleles from distinction (Wakeland et al. 1990).



Recombination Within the Mhc



Recombinational hot spot within I region

The genetic material is a dynamic structure that reorganizes during evolution and differentiation. Nucleotide sequences are rearranged by recombination between homologous or non-homologous sequence. While homologous equal recombination breaks and rejoins chromosomes at precisely the same position, unequal recombination between homologous sequences in different positions leads to duplication and deletions. Over the last ten years recombinant mouse strains have been analyzed by RFLP analysis and DNA sequencing to map the crossover in the I region (Steinmetz et al. 1982a). These studies have shown that recombination within the I region is not random, but localized to specific sites. These sites








62

have been termed recombination hot spots (RHS) (Steinmetz et al. 1982a). A first such RHS, localized with the intron between the second and third exons of Eb gene, was identified from analysis of six intra-I region recombinant mouse strains (Kobori et al. 1984). Since then, additional three RHS's have been identified within the Mhc, including K/Pb, Pb/Ob (Steinmetz et al. 1986; Uematsu et al. 1986) and Ea (Lafuse & David, 1986) (Figure 2-10). RFLP analysis indicates that recombination within the Pb/Ob, Eb and Ea is reciprocal (Steinmetz et al. 1982a; Steinmetz et al. 1987; Lafuse & David 1987). Analysis of secondary recombinant strains indicates that chromosomes that have recently undergone a recombinant event are unstable and quite likely to undergo a second recombination in the next generation (Lafuse & David 1987).



Molecular basis of recombinational hotspots

In the human genome, recombinational hotspots mainly occur in regions containing hypervariable minisatellite sequences. These minisatellite sequences are composed of tandem repeats and occur at multiple locations. The repeat unit contains a common 16-bp core sequence, GGAGGTGGGCAGGARG. DNA sequence searchs for the Pb/Ob and Eb recombinational hotspots have found that short repeated sequences with some homology to the recombination signal Chi (GCTGGTGG) of phage lambda: (CAGA)6 in the PEb/Ob hotspot and (CAGG)7_9 in the Eb hotspot (Steinmetz et al. 1986). The CAGG repeated sequence






















r-i

.E
4


to








0 0
O


4
4-)







* 0 O







-0-4
-4


t3)
.r
44ni








64


.0




-(to
ON
o









0
cm

















0
C, U



0
IfP"





o O
0






i
a c
CO








65

identified in the Eb hotspot exhibiting significant homology to the human minisatellite core sequence, and thus may represent a murine minisatellite (Steinmetz et al. 1987). Recently, a female-specific recombination hotspot has been mapped to a 1 kb region of DNA between the Pb and Ob genes (Shiroishi et al. 1990). This hotspot predominantly occurs in crosses between Japanese wild mice Mus musculus molossinus and laboratory haplotypes. Its location overlaps with a sexindependent hotspot previously identified in the Mus musculus castaneus CAS3 haplotype. Sequence comparisons between DNA surrounding this hotspot and corresponding regions from other strains, including B1O.A, C57BL/10, CAS3 and C57BL/6, revealed no significant difference. However, sequence analysis of this Pb/Ob hotspot with a hotspot in Eb indicated that both have a very similar molecular structure. Each hotspot is composed of two elements, mouse middle repetitive MT family and the tetrameric repeated sequence, both are separated by 1 kb of DNA (Shiroishi et al. 1990).



Definition of Evolutionary Lineage

The evolutionary lineage of Ab was initially defined by RFLP analysis of 31 Ab alleles from 5 different Mus species (McConnell et al. 1988). These 31 alleles were ordered into three distinct lineages based on calculating the fraction of restriction fragments (F) (Nei & Li 1979) and sites shared

(S), which is used to estimate the genomic sequence divergence








66

(Table 2-1). Sequence comparisons of lineage 1 (Abd) and lineage 2 (Abb) alleles indicated that the major DNA sequence polymorphism between these two lineages occur in the intron 2 between pr and 82 exons (Figure 2-9). The sequence homology in this intron is <90%, and Abb gene contains an extra 861 bp of retroposon, flanked by 13 bp direct repeats (ATGTATGCTGTTT). The host-derived nature of this direct repeat sequence indicates that the 861 bp retroposon was inserted into this position as a random event during the evolutionary divergence Ab genes. Inspection of genomic restriction maps of alleles derived from separate Mus species indicate that the retroposon insertion is characteristic of lineage 2 alleles (McConnell et al. 1988). These results indicate the evolutionary lineages defined by RFLP analysis reflect alleles with different retroposon polymorphisms.



Structure and Evolution of Retroposon



Before cloning of DNA became a major tool of studying gene structure and function, chromosome renaturation experiments showed that most organisms possess short stretches of moderately repeated DNA (mrDNA) separated by longer sequences of low copy number (Davidson and Britten 1979). For mammals, most of the mrDNA is composed of retroposons, some of which are thought to represent mobile genetic elements using RNA intermediates in their replication (Jagadeeswaran








67

et al. 1981). These mrDNA belong to different sequence families in different mammalian orders(reviewed by Rogers 1985). The majority of mammalian interspersed repeated DNA falls into two families, referred to as short and long interspersed nucleotide elements, SINEs and LINEs, respectively (Singer 1982). The "generic" SINE sequence contains an internal RNA polymerase III promoter, an A-rich 3'end and flanking direct repeats. The size of SINEs typically range from 75 to as much as 500 bp in length. All nonviral retroposons correspond to a partial or complete DNA copy of a cellular RNA species. With a few exceptions, nonviral retroposons are derived from fully processed RNAs (reviewed by Weiner et al. 1986).



Structure of Alu and "Alu-like" Family

The first well-characterized and the most abundant repeated DNA family in primates is the Alu family which constitute most of the dispersed, repeated DNA (Houck et al. 1979). The 500,000 Alu elements in the human constitute 5-6% of the genome by size, occurring on average every 5-9 kb and differing on average by 13% from the consensus sequences (Schmid & Jelinek 1982; Rinehart et al. 1981). Other SINE families are referred to as "Alu-like" or "Alu-equivalent" families. Mice, rats, and hamsters all contain two abundant "Alu-like" families, B1 and B2 (Kramerove et al. 1979; Krayev et al. 1980; Haynes et al. 1981). The Alu elements,








68

approximately 300 bp long, were so named because they contain a distinctive Alu I cleavage site. Regions of direct internal repetition within Alu sequences indicate that the Alu element is composed of two incompletely homologous arms, an approximately 130 bp left arm and a right arm which differs from the other by an insertion of 31 bp (reviewed by Doolittle 1985). Although human Alu sequences are dimeric, the homologous rodent sequences (the Bl superfamily) are monomeric. It is believed that both Alu and B1 sequences are derived independently from 7SL RNA as 7SL RNA gene has about 150 bp in the middle that is not found in the Alu family (Ullu et al. 1985; Weiner et al. 1986). 7SL RNA is a component of signal recognition particle, required for cotranslational secretion of proteins into the lumen of rough endoplasmic reticulum (Walter & Blobel 1982), and is highly conserved throughout evolution. Alu-like sequences, and retroposons in general, have a strong tendency to insert into each others'

(A)-rich tails. This has apparently generated composites which are themselves propagated as single retroposons (Jagadeeswaran et al. 1981; Haynes et al. 1981).



Mechanisms of Retroposition

Transcription by polymerase III

The basic model for retroposition of SINEs involves RNA polymerase III transcription of genes, reverse transcription of the RNA, and integration into the genome (Figure 2-11).








69

All SINEs contain an internal RNA polymerase III split promotor (Galli et al. 1981). In vitro transcription experiments have shown that the 5' end of the SINE transcripts have coincided exactly with the left end of the repeated DNA sequence. These results have led to the proposal that the SINEs propagate via RNA-mediated retroposition (Jagadeeswaran et al. 1982). SINE family members are able to produce in vivo transcripts, their transcription is regulated in a tissuespecific manner. The homogeneous size of Alu transcripts indicates that one or a few identical family members are transcribed (Watson & Sutfliffe 1987). The transcription of 7SL RNA gene requires a specific 37-bp upstream sequence in addition to its internal promoter (Ullu & Weiner 1985). Since the Alu family has evolved from 7SL RNA, its promotor may similarly depend on such upstream sequences. A critical step in promoting an efficient SINE retroposition may be mutations that render the promotor independent of flanking sequence. However, the established chromatin structure and environment into which the SINE member is situated may have a regulatory effect on the transcription of SINE family members. In transfection assays, it was found that the introduced SINE member is transcriptionally active in transient assay, but is silent in long-term transformants. These results also support the concept that the internal promotor is not sufficient by itself in vivo (reviewed by Deninger 1990).














Figure 2-11. A proposed mechanism for SINE retroposition. The first step is transcription of the repeated DNA sequence. The repeat is represented by a heavy line, its flanking sequence by thinner lines, an the transcript by a wavy line. Transcription initiates at the beginning of the repeat, adjacent to the flanking direct repeat (double solid arrows), continues through the entire repeat, and terminates in flanking sequence. This transcript is suggested to be capable of self-priming reverse transcription by priming with its terminal U residues on the 3' A-rich region of the repeat transcript. Removal of the RNA will then leave a singlestranded cDNA copy of the entire repeat with no falanking sequences. This cDNA must tehn integrate into a genomic site with staggered nicks. It is hypothesized that an A richness at the nikc site may interact with the T-rich cDNA end to stabilized the interaction. Repair synthiesis at the junctions will then result in formation of a newly integrated repeated DNA family member with a different flanking direct repeat(double hollow adrrows). Many of these steps are hypothetical and a number of alternatives are possible. Adapted from Deininger (1989).










71












Transcription "AAAAA 3' i shh~lr4PJAAA TTT










target site AAA

3'- 5'
SINE cDNA
Integration




AA
3.

Repair Synthesis


AA...
__. 0








72

Termination of transcription

Most SINEs do not contain the termination signal for RNA polymerase III (Fuhrman et al. 1981). Transcription starts from the 5' end of SINE, runs through the entire repeat, and terminates at the flanking sequence by chance as the consensus sequence for termination contains four or more T's in a row (Bogenhagen et al. 1980). Most in vivo SINE transcripts appear to be polyadenylated (Deininger 1990).



Reverse transcription

Since the transcripts of SINE family members normally possess a poly(A) tract, they may be able to self-prime their reverse transcription (Jagadeeswaran et al. 1981). Moreover, the RNA polymerase III transcripts should have three or more U's at their 3' end, which may fold back and prime reverse transcription (Bogenhagen et al. 1980). Reverse transcription could also be primed by an intermolecular interaction, for instance, using the 3'end of another transcript through the

(A)-rich region (VanArsdell et al. 1981). The source of reverse transcriptase, which must be active in germ line, is unknown. One possible source is from the intracisternal A particles (IAP), which produce particles containing reverse transcriptase (Wilson & Kuff 1972) and are active in early embryos (Kelly and Condamine 1982). Or it may be provided during retroviral infections or from endogenous retroviral sequences (Martin et al. 1981). Small RNA molecules can be








73

packaged into retroviral particles and be reverse transcribed (Linial et al. 1978). Packaging should facilitate the reverse transcription and may account for the high efficiency of SINE retropositon. Packaging may also promote an "infection-like" process facilitating RNA made in somatic cell to enter the germ line (Vanin 1984).



Integration

To facilitate the integration process, the genome must be nicked to allow the entry of new sequences, followed by repair synthesis to make direct repeats at the integration sites. Direct repeats generated are generally rich in A residues and vary widely in length, suggesting that SINE do not use specific integration enzymes but instead take advantage of nicks generated by other nonspecific enzymes. Topoisomerases, enzymes that relax the genome during replication and transcription, have been shown to have nicking activity in a SINE family member in vitro (Perez-Stable et al. 1984). Although topoisomerase I is generally thought to be nonspecific in its nicking activity, hot spots for DNA cleavage have been reported (Busk et al. 1987). These sites are A rich and at least partially resemble the 3' terminus and direct repeats of SINEs. Not only are the integration sites of SINEs A rich, but the A richness is predominantly at the left end of the direct repeat (Daniels & Deininger 1985; Rogers et al. 1986) These findings have several








74

ramifications. First, it shows that the integration is not random. Second, since the 3' ends of the SINE families are generally A rich, when they integrate into a new site they generally make that site even more A rich. Therefore, the 3' end of SINEs are improved integration sites for more SINE copies, resulting in a tendency to form perfect tandem dimers (reviewed by Rogers 1985). In several examples, it appears that the integration of one element abutting another form a composite so that they could retropose as a single unit (Daniels & Deininger 1983).



Functions Attributable to SINE

It is assumed that the broad genomic distribution and high copy number may serve an important cellular function. It has also been argued that these repetitive elements are selfish DNA whose self-propagation provides no benefit to their hosts (Doolittle and Sapienza 1980; Orgel and Crick 1980). SINEs have been involved in a number of effects on genome structure and evolution. For example, SINEs may promote deletion or facilitate recombination (Lehrman et al 1987), act as limits to gene conversion (Hess et al. 1983) and move unrelated DNA segments throughout the genome either via retroposition of sequences adjacent to SINEs (Zelnick et al. 1987). They may just affect the long-terms adaptability of the species.








75

Recombination

Recombination involving the Alu repeats have resulted in phenotypic changes. For example, at least two different forms of globin gene defects occur in a pair of inverted Alu repeats, which result in a deletion of gene. The LDL receptor gene has a number of Alu dispersed repeats in its intron, 3' noncoding region, and flanking region. Five naturally occurring insertion/deletion mutants of this gene have produced defective receptors, four of which involve Alu-Alu recombination (Horsthemke et al. 1987).


Suppression of gene conversion

Examination of regions of globin genes have provided evidence that SINE can help to limit gene conversion events (Hess et al. 1983; Schimenti & Duncan 1984). The globin genes consist of a multigene family whose members start to evolve after duplication. By limiting the degree of gene conversion, the SINE sequences may promote gene diversification and the evolution of new functions(Deininger 1990).



Mobilization of DNA sequence

Several composite SINE families are formed by fusing new sequences with a SINE to become a functionally-transposing unit, indicating that SINE has a potential to mobilize other sequences (reviewed by Weiner et al. 1986). There is one example of genomic non-repetitive sequence that lay between








76

two artiodactyl SINEs retroposed with them as a unit, resulting in the duplication within the cow haploid genome (Zelnick et al. 1987).

In vitro transfection experiments also indicated that SINEs might repress or activate transcription initiated by adjacent RNA polymerase II promotor (McKinnon et al. 1986). Another function conferred by certain SINEs is to encode portion of polypeptides. Alu dispersed repeats constitute for 32 codons of 3' portion of genes for decay-accelerating factor and for a B-cell growth factor (Caras et al. 1987; Sharma et al. 1987). The CCAAT box of the 6-globin gene in primates is part of an Alu repeat sequence (Kim et al. 1989). Some SINEs are found in the 3' noncoding exons and provided polyadenylation signal (Krane & Hardison. 1990). Thus, functional sequences provided by SINE include promotor, RNA processing and protein-coding sequences.



Evolution of Introns


Mammalian genes are discontinuous, broken up along the DNA into alternating regions: coding sequence or exons, which are interspaced with other noncoding sequences or introns that will be spliced out of the primary transcript. An intriguing question regarding the introns is what advantages or functions are provided to the cell by them. There has been ample speculation about the origin and maintenance of introns in








77

eukaryotic genomes. Gilbert (1978, 1985) proposed "exon shuffling" hypothesis which states that introns provide an evolutionary advantage by allowing recombination within intron sequences, and that introns in modern genomes were remnants of the recombination process that speed up evolution. The observations that the exons often correlated with functional domains and that the homologous exons can be found in different genes have been used to support this idea.

Examinations of genes coding for certain ubiquitous enzymes, such as triosephosphate isomerase, whose sequence is highly conserved across species, have revealed that the intron positions are not random and that all of these introns were in place before the division of plants and animals (Gilbert et al. 1986), the introns were lost from prokaryotes as their genomes became streamlined for rapid DNA replication (Doolittle 1978). After the discovery of introns, a number of authors have suggested that intron might represent the vestiges of transposable elements which had been inserted into the genes (Cavalier-Smith 1985; Hickey & Benkel 1986). Although there is evidence that many, if not all, introns are dispensable (Ng et al. 1985), there is also evidence that the internal sequences of introns are important for splicing (Rautmann & Breatnach 1985). Cech (1986) has suggested that all RNA splicing reactions are evolutionarily related, with the exception of those involving some pre-tRNA. This evolutionary link between different intron classes implies








78

that the introns of nuclear protein-coding genes were also capable of replicative transposition at some stage in their evolutionary history. Hickey & Benkel (1986) have suggested a model to account for the evolutionary origin of introns. The main points of this model are summarized as follows: (i) Most present day introns are the relics of retrotransposons;

(ii) copies of transposable sequence were contained within the RNA primary transcript; (iii) RNA splicing activity encoded by the transposable elements processed the transcripts into exon and intron sequences; (iv) the exons were then available for translated into gene product; (v) the spliced intron were able to be reversed-transcribed into DNA and reinserted into else where in the genome. Although Doolittle (1978) argued that the de novo insertion of introns into functional genes would disrupt normal gene expression and thus would be strongly selected against at the organismic level, it was proposed that the RNA splicing might function solely to counteract the potential negative effect of introns (Hickey & Benkel 1986). A common property shared by all introns is their removal from primary transcripts by splicing. Numerous evidences have indicated that the splicing activity is controlled by introns themselves. For instances, some fungal mitochondrial group I and II introns can undergo self-splicing which depends on the structure of RNA transcripts and can propagate themselves by insertion into genes (reviewed by Lambowitz 1989). Genetic analysis of mitochondrial system








79

also indicated that in vivo self-splicing depends on socalled maturase, some of which are encoded by the intron themselves. All characterized maturase function only in splicing the intron in which they are encoded or closely related intron. It has been proposed that the nuclear premRNA intron have evolved from self-inserted group II intron (Roger 1989) (Figure 2-12). Once an intron is inserted, it might take only a single base change to convert the group II intron into classical intron. Now both types of introns have similar consensus sequences.



Wild Mice As a Useful Genetic Tool



Part of the goal of this dissertation is to determine the distribution of evolutionary lineages of the class II Ab gene in the genus Mus and to determine how long these lineages have persisted in Mus during the evolution of Ab genes. Previous studies of the evolution of Mhc class II genes were limited in the number of species examined and limited in the number of strains tested. In this dissertation, we have extended the previous study by including twelve species and subspecies of genus Mus and the 115 H-2 haplotypes extracted from them.

The "house mouse", has become the most studied animal of laboratory research probably because its habitat is closest to that of man. It has been known for some time that the major laboratory inbred strains are derived from common














Figure 2-12. Proposed sequence of events that a group II intron could mutate into a classical intron. Adapted from Roger (1989).








81













Reverse DNA insertion of
"-h.or Group II intron GT AT


Autonomous NMutation GT AG


YRNA splicing








82

ancestors (Morse 1978). Study of mitochondrial DNA has indicated that most laboratory inbred strains belong to the Mus musculus domesticus type (Ferris et al. 1982). On the contrary, using a Y-specific DNA probe has revealed that the Y chromosomes of most of laboratory inbred strains, except SJL, is of M. m. musculus origin (Bishop et al. 1985). Thus the pool of segregating genes in laboratory mice is fairly limited and probably does not reflect the mouse species as it is in the wild (Guenet 1986). In fact, had it not been for wild mice, the analysis of certain genetic loci, e.g., Mta, a maternally transmitted histocompatibility antigen, would have suffered premature termination (Lindahl 1986). Depending on the degree of association with humans, wild mice can be distinguished into three groups. These are aboriginal, commensal and feral. Aboriginal mice live primarily independently of human construction. Commensal mice live in close association with man-made structure, and feral mice have resumed an aboriginal mode of life from the commensal stage (reviewed by Sage 1981). The aboriginal species include Mus spretus, M. spretoides (M. macedonicus; M. abbotti), M. spicilequs (M. hortulanus). All introduced populations of M. domesticus in the New World and in Australia, which live in native vegetation, are considered feral forms derived from commensal ancestors. Based on genetic variability of wild mice, using both DNA and biochemical markers, the Mus genus can be divided into the complex species Mus musculus and at








83

least eight other species, including Mus spretus, M. spretoides, M. spicilegeus, M. cooki, M. cervicolor, M. pahari, M. platythrix (Bonhomme et al. 1984; Bonhomme, 1986; Avner et al. 1988). Mus musculus complex species itself consists of four main biochemical groups Mus musculus musculus, Mus musculus domesticus, Mus musculus castaneus, and Mus musculus bactrianus, all of which are considered as subspecies.

M. m. domesticus is present in Western Europe, the Mediterranean basin, Africa, Arabia, Middle East and has been transported by ship to the New World, Australia and southeastern Africa, leaving few regions of the earth without house mice. M. m. musculus occurs in Eastern Europe, extending to Japan across USSR and North China. M. m. bacitrianus is distributed from Eastern Europe to Pakistan and India. The distribution of M. m. castaneus ranges from Ceylon to South East Asia through the Indo-Malayan archipelago (Figure 2-13). Even though these four subspecies are quite biochemically differentiated, they may exchange genes wherever they come into contact (Bonhomme et al. 1984). One of the best understood cases is that between M. m. musculus and M. m. castaneus in Japan (Yonekawa et al. 1986; Yonekawa et al. 1988). The Japanese mouse, M. m. molossinus, has long been considered an independent subspecies of the house mouse. However, the restriction enzyme analysis of mitochondrial DNA (mt DNA) indicated that M. m. molossinus has two main maternal


















0

a)
q.r
U
0)





$.4


0



0
44-t


t
o ) 4-O


U)
ON


S,















m
0 "PmD
*H0 Ex S










85

























UU
a







U~cU .i.
Ill~

~U
Y~i~z~U
rrU


~ifiRM1IIU~ ~~ ~~m,





Un








86

lineages. One lineage is closely related to the mtDNA of the European subspecies M. m. musculus, the other is closely related to the mtDNA of the Asiatic subspecies M. m. castaneus.

The three aboriginal species, namely, M. spretus, M. spretoid, and M. spicilegus, may be found in sympatry with M. musculus subspecies. M. spretoides and M. spicileus probably represent the best case of sibling species thus far discovered in mammals. They are very similar morphologically and biochemically. Yet under the laboratory conditions they can not interbreed (Bonhomme 1986). The mound-building species, M. spicilequs, is found in steppe grasslands of the Carpathian basin and the Ukraine. The distribution of short-tailed M. spretoides is limited to southeastern Europe and Asia Minor (mainly eastern Mediterranean). M. spretus is found existent in the western Mediterranean, from France to Libya (Figure 2-14).

Europe is not the homeland of the genus Mus. All of the Mus species and subspecies that presently inhabit the continent seem to have entered it with man (Bonhomme 1986). Certain members of genus Mus have apparently inhabited India and Southeast Asia since their origins. Three strictly oriental species, M. caroli, M. cervicolor, and M. cooki, form a monophyletic group according to single copy nuclear DNA (scn DNA) hybridization and mtDNA data. Protein electrophoretic data also suggest that these three Asian species have speciated almost simultaneously (She et al. 1990).
























Om
I!
rl


4-)

4
G





4'

04 4)



40
ql.


4







44W
0





.
*








0
40
0



w.

iii
O













W.
CO




O
*Hp











0
M



O~O








0 0)
40





0 o UJ 0 f 0 r OO
i









88










fe






in@i
a












U I(





11
4


















IP








Erar O z




Full Text
Lineage h-2
h
Bg
%
3 k
90
92
%
1
89
83
H
^2 TM CY
CY+3UT
S B
89
S B
1 Kb
137


74
ramifications. First, it shows that the integration is not
random. Second, since the 3' ends of the SINE families are
generally A rich, when they integrate into a new site they
generally make that site even more A rich. Therefore, the 3'
end of SINEs are improved integration sites for more SINE
copies, resulting in a tendency to form perfect tandem dimers
(reviewed by Rogers 1985). In several examples, it appears
that the integration of one element abutting another form a
composite so that they could retropose as a single unit
(Daniels & Deininger 1983).
Functions Attributable to SINE
It is assumed that the broad genomic distribution and
high copy number may serve an important cellular function.
It has also been argued that these repetitive elements are
selfish DNA whose self-propagation provides no benefit to
their hosts (Doolittle and Sapienza 1980; Orgel and Crick
1980). SINEs have been involved in a number of effects on
genome structure and evolution. For example, SINEs may
promote deletion or facilitate recombination (Lehrman et al
1987) act as limits to gene conversion (Hess et al. 1983) and
move unrelated DNA segments throughout the genome either via
retroposition of seguences adjacent to SINEs (Zelnick et al.
1987). They may just affect the long-terms adaptability of
the species.



PAGE 1

STABLE ALLELIC LINEAGES OF MHC CLASS II GENES WITHIN THE GENUS MUS By CHENG-CHAN LU A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 1990

PAGE 2

This dissertation is dedicated to the members of our family as a token of my appreciation for the love, support and encouragement they have provided over the years.

PAGE 3

ACKNOWLEDGEMENTS The intellectual environment provided by Dr. Edward K. Wakeland has been the single most important factor in the enrichment of my evolution as a researcher; to him I am deeply indebted. It is my privilege to express my sincere gratitude to him for his patient guidance as well as constant infusion of encouragement and inspiration, and for allowing me to exercise thoughtful freedom to proceed with this work. I thank the members of my supervisory committee, Drs. Kuo-Jang Kao, Harry S. Nick, Ammon B. Peck and William E. Winter, for their advice and assistance throughout. The timely help and attention of my colleague Richard Mclndoe during the preparation of the present work needs a special mention. I acknowledge Drs. Wayne Potts, Murali, Jin-Xion She and William Wang for their technical help and guidance. I would like to thank the people in the department for what they have done and provided for me to make the completion and success of my graduate study possible. My appreciation is extended to Dr. Linda Smith for her friendship and hospitality through the years. My sincere thanks are extended to Dr. Ahmad N. Ali and Charles C. Brown for providing free cloning vector, /. iii ....

PAGE 4

PbluescriptSK(+) and PbluescriptKS (+) and for their technical advice. My sincere appreciation is extended to Vickie Henson, Thomas McConnell, Roy Tarnuzzer, Judith Nutkins, Stefen Boehme, Ivan Chang, Ying Ye, Mary Yu, Karen Wright, Julio Mas, Kristy Myrisk, Jerome and Xemena for their lively company, loving support and constant encouragement. iv

PAGE 5

TABLE OF CONTENTS Page ACKNOWLEDGEMENTS iii LIST OF FIGURES viii ABSTRACT xi CHAPTERS 1 INTRODUCTION 1 2 GENOMIC ORGANIZATION OF MAJOR HISTOCOMPATIBILITY COMPLEX 4 H-2 Complex 5 Three Classes of Mhc Genes 5 Organization of Mouse Mhc 6 Genetic Organization of the I region 16 Linkage Relationship of Class II Genes 19 Biochemistry of Class II Molecules ... 23 Analysis of the Structure-Function Relationship of Class II Molecule 27 Functional Role of Mhc Gene 39 Genetic Polymorphism of Mhc Genes .... 42 Recombination Within the Mhc 61 Definition of Evolutionary Lineage. ... 65 Structure and Evolution of Retroposon .... 66 Structure of Alu and "Alu-like" family. 67 Mechanisms of Retroposition 68 Function Attributable to SINE 74 Evolution of Intron 76 Wild Mice As a Useful Genetic Tool 81 3 MATERIALS AND METHODS 92 Wild Mice 92 Soure of Mouse Tissues and Preparation of DNA 92 Restriction Enzyme Digestion and Agarose Gel Electrophoresis 95 Probes 96 Capillary Transfer and Hybridization 96 Genomic Restriction Mapping 100 V

PAGE 6

Page Nucleotide Sequencing 100 Data Analysis 101 RFLP Patterns of Ab Alleles and Their Phylogenetic Relationships 101 Computer Programs 104 Polymerase Chain Reaction (PCR) Amplification 105 Enzymatic Amplification of Genomic DNA 105 Amplification of Central Fragment for DNA Hybridization 109 4 SEQUENCE ANALYSIS OF LINEAGE 3 ALLELES .... 114 Restriction Enzyme Analysis of Lineage 3 Alleles 114 Restriction-Site Polymorphism of Lineage 3 Alleles 114 Distinct Intron Size Between Lineage 2 and 3 Alleles 122 DNA Sequence of Lineage 3 Intron 122 Lineage 3 Derived from Lineage 2 125 Ab Genes Can Be Divided Into 4 Lineages. ... 141 Defining Evolutionary Lineage 2B 141 4 Evolutionary Lineages of Ab Genes 156 5 EVOLUTION OF MHC CLASS II GENE POLYMORPHISM. 159 RFLP Analysis of Ab Genes Within the Genus Mus 159 Lineage Distribution of Ab Alleles Within the Genus Mus 177 Phylogenetic Relationships of 86 Ab Alleles in the Genus Mus 180 6 DISCUSSION 193 Function of Mhc Genes 193 Features of Mhc Polymorphism 194 Mechanism of Generating Ab Gene Polymorphisms 195 Mhc Genes Evolve via Trans-species Mode 196 Possible Impact of Retroposon on Ab Gene Expression 198 Linkage Disequilibrium Among Restriction Sites 199 Maintenance of Mhc Polymorphism 201 Overdominant Slection for Mhc Polymorphism 203 Divergent Allele Advantage 2 04 Alu-like Repetitive Elements in A^ Genes 205 SINE as Evolutionary and Genetic Tags .205 vi

PAGE 7

Page 539 bp Retroposon: a Newly Arisen Repetitive Family 207 Transposition of Middle Repetitive Elements 208 Preferential Site of Integration .... 208 Possible Transposition Mechanism .... 209 Phylogenetic Relationship of Ab Genes .... 210 REFERENCE LIST 213 BIOGRAPHICAL SKETCH 236 vii

PAGE 8

LIST OF FIGURES Page Figure 2-1 Location of genes in the Mhc of the BALB/c mouse 8 Figure 2-2 Genomic structures of Mhc class I molecules. 12 Figure 2-3 Genomic structures of Mhc class II a and P chain 22 Figure 2-4 Location of Mhc class I and class II genes within H-2 complex 25 Figure 2-5 A model of the antigen-binding site of the Mhc class II I -A molecules 29 Figure 2-6 Recombinatorial association and expression of a and /3 chain of Mhc class II molecules 37 Figure 2-7 Segmental exchange of Mhc class II Ab genes 48 Figure 2-8 Illustration of the evolutionary origins of the three lineages of Ab alleles 52 Figure 2-9 Analysis of the sequence homology of Ab'^(lineage 1) and Ab''(lineage 2) 55 Figure 2-10 Location of Recombinational hot spot(RHS) within the H-2 complex 64 Figure 2-11 A proposed mechanism for SINE retroposition 71 Figure 2-12 Proposed sequence of events that a group II intron could mutate into a classical intron .... 81 Figure 2-13 Geographical distribution of four separate subspecies of Mus musculus complex 85 Figure 2-14 Geographical distribution of four separate species of genus Mus 88 Figure 2-15 Phylogenetic relationships within the genus Mus and Rattus 91 viii

PAGE 9

Page Figure 3-1 The genomic restriction map of Ab '^ probe 98 Figure 3-2 The partial restriction map of Ab*" and the sequencing strategy 103 Figure 3-3 The sequences flanking the target site (GATTCTGATACA) for the "Alu-like" (Bl) element 107 Figure 3-4 Location of two insertional events in a lineage 3 allele (Ab*") Ill Figure 3-5 The nucleotide sequence of 539 bp insert 113 Figure 4-1 Restriction mapping performed by double digest experiment 116 Figure 4-2 Restriction mapping carried out by double digest experiment 118 Figure 4-3 Restricion maps of seven lineage 3 Ab alleles 121 Figure 4-4 Comparison of restriction maps of a representative lineage 2 and 3 alleles 124 Figure 4-5 The 3735 bp of nucleotide sequence of Ab*". 127 Figure 4-6 Partial nucleotide sequence of intron 2 from Ab*" 130 Figure 4-7 Location of two inserts in a lineage 3 (Ab'') allele 132 Figure 4-8 Sequence identity between the retroposon sequence in linage 2 (Ab ) and 3 (Ab*") alleles .... 135 Figure 4-9 Sequence identity among 3 Ab alleles .... 137 Figure 4-10 Sequence alignment among three Bl repeats 139 Figure 4-11 Southern blot experiments with Ab** and 235bp non-repetitive element probe 143 Figure 4-12 Blot hybridization experiment with 235 bp non-repetitive probe 145 Figure 4-13 PGR amplification of DNA samples from 12 species and subspecies of genus Mus 148 ix

PAGE 10

Page Figure 4-14 PGR amplification of DNA samples from lineage 3 alleles and recombinant inbred strains. 150 Figure 4-15 A typical RFLP analysis and restriction mapping 153 Figure 4-16 Restriction analysis of PCR-amplif ied products 155 Figure 4-17 Summary of the evolutionary relationship among four lineage Ab alleles 158 Figure 5-1 Restriction maps of 86 Ab alleles derived from Table 5-1 170 Figure 5-2 Diagram illustrating the evolutionary origins of the 4 lineages of Ab alleles assayed 179 Figure 5-3 Example of a restriction site allele used for parsimony analysis 183 Figure 5-4 Phylogenetic relationships of 86 Ab alleles derived from 12 species and subspecies of genus Mus 189 Figure 5-5 Phylogenetic relationships of 86 Ab alleles from 12 species and subspecies of Mus 192 X

PAGE 11

Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy STABLE ALLELIC LINEAGES OF MHC CLASS II GENES WITHIN THE GENUS MUS By Cheng-Chan Lu December, 1990 Chairperson: Dr. Edward K. Wakeland Major Department: Pathology and Laboratory Medicine Previous studies have organized alleles of the Mhc class II Ab gene into 3 evolutionary lineages based on genomic structures. The major distinction between lineage 1 and 2 is an 861 bp retroposon in the intron separating the A^^ and A^2 exons in lineage 2 alleles. By using this retroposon as an evolutionary tag, we have extended our molecular genetic studies of Ab to include 115 independently derived H-2 haplotypes from 12 separate species and subspecies of genus Mus Ab alleles from lineage 1 and 2 were found in all 3 aboriginal species ( Mus spretus Mus spiceligus and Mus spretoides ) and in Mus carol i indicating that these two lineages of Ab alleles diverged a minimum of 2.5 million years ago. Parsimony analysis of 86 Ab alleles, using restriction site as a character state, indicated that lineage 3 alleles xi

PAGE 12

are evolutionarily more closely related to lineage 2 than to lineage 1. DNA sequence of intron 2 from an evolutionary lineage 3 allele was determined. The data indicated that lineage 3 was derived from a lineage 2 allele by two additional insertional events in the intron 2. One insertion, composed of Alu-like(Bl) repeat, occurred 508 bp 3 of A^, exon. By using the polymerase chain reaction and restriction analysis, a lineage 2 allele from Mus m. musculus was identified to carry that Bl insert, thus defining new lineage, 2B. The other insertion, occurring in the lineage 2 retroposon, starts 1141 bp 3 of the A^, exon. This latter insertion is 539 bp in length and is composed of Alu-like repetitive elements and unique sequence. In summary, the murine Ab genes can be divided into 4 distinct evolutionary lineages, 1, 2A, 2B, and 3, which are produced by 3 independent retroposon insertions. Lineage 3 alleles were found in Mus m. musculus and Mus m. domesticus indicating that lineage 3 as well as 2A and 2B diverged a minimum of 0.5 millions years ago. These results indicate that all 4 lineages of Ab have persisted through several speciation events in the genus Mus xii

PAGE 13

CHAPTER 1 INTRODUCTION The I region of the murine major histocompatibility complex ( H-2 ) contains a tightly-linked cluster of highly polymorphic genes (class II) that control immune responsiveness. Two major hypotheses have been proposed to account for the origin of this polymorphism, which is believed to be essential for the function of the class II proteins in immune protection of host. The first was that hypermutational mechanisms (gene conversion or segmental exchange) promote the rapid generation of diversity in Mhc genes. The alternative was that polymorphism arose from the steady accumulation of mutations over long evolutionary periods, and that multiple specific alleles commonly survived speciation event (transspecies evolution or ancestral polymorphism) In a previous study, McConnell et al. (1988) used restriction fragment length polymorphism (RFLP) and sequence analysis to seek evidence of "segmental exchange" and/or "trans-species evolution" in the class II genes of the genus Mus by a molecular genetic analysis of Ab alleles. This study detected 31 Ab alleles in a collection of 49 H-2 haplotypes derived

PAGE 14

2 from 5 separate species and subspecies in the genus Mus. These alleles were organized into 3 evolutionary lineages on the basis of retroposon polymorphisms occurring in the intron (intron 2) separating the exons which encode the pi and )82 domains of Ab. By using this retroposon sequence as an evolutionary tag, they demonstrated that the h/S alleles in two of these lineages diverged at least 0.5 million years ago and that alleles from both lineages survived the speciation events leading to several modern Mus species. These findings indicate that class II gene polymorphisms are evolving in a trans-species manner, suggesting that the extensive diversity of Mhc class II genes predominantly reflects the steady accumulation of mutations in distinct lineages of alleles which are selectively maintained in natural populations for long evolutionary periods. In this dissertation, we address two additional issues concerning the evolution of Ab in Mus The first issue concerns the evolutionary origin of lineage 3. What is the nature of the retroposon polymorphism in lineage 3 alleles and was lineage 3 derived from lineage 1 or lineage 2 ? If so, what kind of evolutioanry mechanism generated lineage 3 ? We have addressed this issue by sequencing a 3.8 kb DNA segment containing intron 2 from a prototypic lineage 3 allele. The results clearly indicate the lineage 3 alleles are derived from lineage 2 allele by two additional independent retroposon insertions in intron 2 The second issue concerns the

PAGE 15

distribution of various Ab lineages within the genus Mus and how long these ^ lineage have persisted in the genus Mus We have addressed this issue by expanding the RFLP analysis to include 115 independently-derived H-2 haplotypes derived from 12 separate species and subspecies of genus Mus A total of 86 Ab alleles was identified from this analysis. Parsimony analysis, using restriction site as a character state, was also exploited to construct the evolutionary trees of Ab alleles to determine their phylogenetic relationships. DNA sequence and restriction enzyme analysis indicate that Ab genes can be divided into 4 distinct evolutionary lineages, which are generated from three independent insert ional events. The presence of various lineages in different species and subspecies of Mus further the idea that the Mhc genes evolved in a trans-species fashion and they have persisted over long evolutionary timespans in genus Mus

PAGE 16

CHAPTER 2 GENOMIC ORGANIZATION OF MAJOR HISTOCOMPATIBILITY COMPLEX In the past decade our understanding of the major histocompatibillity complex has advanced dramatically because of the application of both monoclonal antibody techniques and recombinant DNA technology. Biologists are now able to characterize one of the most fundamental phenomena of eukaryotic biology — the ability of organisms to discriminate between self and nonself in molecular terms. Even the most primitive of metazoa, the sponges, display cell surface recognition systems capable of discerning and destroying nonself, probably to maintain the integrity of individuals surviving in densely populated environments (Hildemann et al 1981) There are three fundamental features about this self/nonself recogntion systems cell-surface recognition structures, effector mechanisms that result in the destruction of nonself, and a high degree of genetic variability in the recognition structures (Hood et al. 1983) In mammalian genetic systems, a chromosomal region termed the Mhc encodes the self/nonself recognition system with similar features. Although all vertebrates appear to posses a homologous Mhc, it has been most extensively studied in 4

PAGE 17

mouse ( H-2 ) and in man (HLA) (Gotze et al. 1977) The Mhc was first identified in mice ( H-2 ) because of the availability of inbred and congenic strains of mice. By grafting of tumors or skins between such strains of mice and following rejection or acceptance of the graft, Gorer and others (Gorer et al. 1938, 1948) were able to map the rejection phenomena to a region on chromosome 17, which was then denoted the Mhc. In mouse at least 60 traits, most of which are associated with the immune response, have been mapped to Mhc using the classic genetic techniques (Klein 1975) H-2 Complex Mhc is defined as a group of genes coding for molecules that provide the context for the recognition of foreign antigens by T lymphocytes (Klein 1983) "Context" implies that T cells do not recognize antigen alone; but instead recognizes antigen in the context of Mhc molecules on the surface of antigen-presenting cells. Thus far, Mhc genes have been found only in vertebrates. It is not known whether all vertebrates possess Mhc, but so far it has been identified in twenty vertebrate species (Klein 1986) Three Classes of Mhc Genes Traditionally, the Mhc genes can be divided into three classes, I, II and III. Class I molecules are involved in

PAGE 18

transplantation rejection and T -cell-mediated cytotoxic killing. Class II molecules serve as restriction elements during the presentation and processing of foreign antigen to regulate the immune response. Certain complement components, e.g. C3 and C4, are encoded by class III genes within the Mhc complex. However, no significant homology can be shown between Mhc genes and complement genes, and although the C4 genes is closely linked to Mhc in many species, the C3 genes are only loosely linked to some species, but not in other species (Alper 1981). Klein et al. (1983) have argued against the inclusion of the complement genes as a class of Mhc genes. Organization of Mouse Mhc The H-2 complex of the laboratory mouse is the only Mhc in which nearly all of the loci have been identified and their position determined. For example, the molecular map of Mhc genes of C57BL/10 (Weiss et al. 1984) and BALB/c (Steinmetz et al. 1982a; Winoto et al. 1983) haplotypes have been extensively characterized. From the centromeric part of the Mhc of the BALB/c mouse, a 600 Kb segment cluster has been cloned containing two class I (K and K2) and seven class II genes (Pb(A^3) to Ea) (Steinmetz et al. 1986) (Figure 2-1)

PAGE 19

0) -O 0) 0) 45 •rH Cn <4-| <*-! 0) 0) o C T3 0) c 0) 0) o u Q) CO o 0) > (0 CM 2 o ^ 0) (1) c +J H ft o J (0 t3 ft< o c O c 0) o o •H p (0 -p c Q) •H M U -H o c o 0) -p c H M S 0) O (0 o 0) W EH 4J -P H I 73 CM OJ P 0) (d o H CP 0) ^^ 00 U H 8 w C u •H ft c (0 Q) •H C •-'I 0)1 N o i£: -p i3 -P CO

PAGE 20

8 CO O LU 41/? 1 to 9 o o CM O O O CvJ O O lO o o o UJ \ < --/> UJ < o o ^ CD m LU 3 DC CQ --2 CO LLI z LU o o o in o LU CO

PAGE 21

9 Following a gap of about 170 kb, a second gene cluster of 330 kb in length has been cloned from the S region containing ( C4 Sip Bf C2) coding for complement or related components and two homologous genes ( 21-OHA and 21-OHB ) one of which encodes for steroid 21-hydroxylase (Muller et al. 1987) A third gene cluster covering 500 kb of DNA has been isolated from the D and Qa regions and localizes the positions of 13 class I genes (D to 01-10 ) (Stephan et al. 1986) the TNF-a and -/3 genes coding for cytotoxins (Muller et al. 1987b) From the Tla region, a total of 19 class I genes are distributed in 3 gene clusters. In summary, the Mhc complex of the BALB/c mouse contains 50 loci, of which 34 loci are class I and 7 are class II genes (Steinmetz & Uimatsu 1987) Whereas in the Mhc of C57BL/10 mouse, 26 class I genes have been identified, of which 10 genes are in the Qa2 ^ 3 regions and 13 genes in the TL region (Flavell et al. 1985) Among 3 H-2 haplotypes (b, d and k) analyzed thus far (b, d and k) the K and the class II regions show no large differences in organization (Klein & Figueroa 1986) Genetic loci of class I gene There are two class I genes ( H-2K and H-2K1 ) at the centromeric end of the H-2 region; all the remaining genes are at the telomeric end. The class I loci can be divided into two subclasses: I-a, consisting of loci with a known function ( H-2K H-2D H-2L ) and I-b, consisting of the remaining loci

PAGE 22

10 whose functions are largely unknown. The class II loci and a group of unrelated loci including genes coding for complement components are inserted between two H-2K loci and the rest of class I loci (Figure 2-1) The class I loci can be assigned to one of four regions: K, D, Qa and Tla, depending on their position, this division only in part reflects the evolutionary relationships among the individual loci (Klein & Figueroa 1986) Class I transplantation antigen are found on virtually all nucleated cells of the mouse. The cell surface antigens encoded in Oa-2 3 and Tla region can be further distinguished from classical class I antigen because they are less polymorphic and more limited in tissue distribution than K or D-encoded antigens (Flaherty et al. 1980) Class I gene structure The exon-intron organization of class I genes are remarkably similar to each other. Each class I gene is composed of 8 exons, which correlates precisely with the domain structure of class I polypeptide (Figure 2-2) (Steinmetz et al. 1981; Nathenson et al. 1981). The first exon encodes the leader peptide, the second, third, and fourth exons encode the al, a2 and a3 domains. The fifth exon encodes the transmembrane region, and the sixth, seventh, and eighth exons encode the cytoplasmic domain and 3 • untranslated region (Figure 2-2)

PAGE 23

CO T)
PAGE 25

13 Class I polypeptide Class I protein has a mol. wt. of 45,000 daltons and is a transmembrane glycoprotein noncovalently associated with ^2~roicroglobulin (/32m) a 12 000-dalton polypeptide encoded by a gene located on chromosome 2 in the mouse (Coding et al. 1981; Michaelson et al. 1981; Robinson et al. 1981) Amino acid sequence analyses have demonstrated that class I antigen can be divided into 5 domains (Coligan et al. 1981) The three external domains, al,a2 and a3, are each about 90 residues in length. The transmembrane portion is about 4 0 residues and the cytoplasmic region is about 3 0 residues long. The a2 and a3 domains have a centrally placed disulfide bridge spanning about 60 residues and up to three N-linked glycosyl units bound to these domains (Maloy et al. 1982) Amino acid sequence analyses also suggest that the a3 domain (Strominger et al. 1980) and /32microglobulin (Peterson et al. 1972) show strong sequence homology to the constant region domains of immunoglobulins. Binding studies from class I molecules with peptide fragments have shown that the /32m subunit associated with the a3 domain (Yokoyama et al. 1983) Three dimensional model of class I molecules Recently, a three dimensional structure of human class I molecule HLAA2 was studied by X-ray crystallographic analysis (Bjorkman et al. 1987a, b) Soluble HLA-A2 was purified and crystallized after papain digestion of plasma membranes from

PAGE 26

14 a homozygous human lymphoblastoid cell line. Papain treatment yields a molecule composed of otl, a2 a2 and )02m. This class I molecule consists of two pairs of structurally similar domains: al has the same tertiary fold as a2 likewise a3 has the same tertiary fold as /32m. The a3 and )32m both have )3sandwich structures composed of two antiparallel /3-plated sheets, one with four j0-strands and one with three )8-strands, connected by a disulphide bond. The same tertiary structure has been shown for constant region of immunoglobulin and is consistent with high degree of sequence homology between a3, /32m and constant region. The structurally similar al and a2 domains are paired, with the four /8-strands from each domain forming a single antiparallel /3-sheet with eight strands. This particular intramolecular "dimeric interaction" (McLachian et al. 1980) seen between al and a2, involving the creation of a single )9-sheet from two domains, has been observed in many inter-molecular dimers, and has been proposed to be preserved in an intermolecular dimer, such as Mhc class II molecules (Bjorkman et al. 1987b) Antigen binding site of class I molecule Several observations suggest that the groove between al and a2 helices is the antigen binding site (ABS) (Bjorkman et al. 1987b) It is located in a position, distal from the membrane end of the molecule, capable of being recognized by receptors of another cells. The site, -25 A long by 10 A wide by 11 A

PAGE 27

15 deep, has a size and shape consistent with the expectation. By analogy with class II molecules, class I molecules bind processed antigen in a form of peptides. Synthetic peptides have been shown to bind to purified murine class II molecules, presumably mimicking processed antigen (Guillet et al. 1986) Because class I and class II molecules have homologous structures (Kaufman et al. 1984) and T cells specific for either class I or II molecules use the same receptors (Rupp et al. 1985; Marrack & Kappler 1986), the type of interaction described between peptides and class II molecule is assumed to apply to peptides and class I molecules. Electron density representing an unknown molecule, possibly a bound peptide antigen, is found in the site of two crystal forms of HLA-A2 class I molecules (Bjorkman et al. 1987b) An a-helical conformation has been proposed for bound peptide (Berkower et al. 1986; Allen et al. 1987) Thus, one face of a peptide ahelix is envisioned to contact the class II molecule, the other to be contacted by T cell receptor. Many of the polymorphic residues that are responsible for recognition by T cells and haplotype-specif ic association with antigens are located in this site where they could serve as ligands to a processed antigen. This is further evidence that this region functions as antigen binding site (Bjorkman et al. 1987b) Most of non-conserved residues are located in and around the ABS site, suggesting that most variable residues in class I molecules have been selected to generate an ability to present

PAGE 28

16 many different peptides. It is also noted that some of conserved amino acid residues are located in the ABS, suggesting that they may recognize a constant feature of processed antigens, consistent with the previous suggestions. Genetic Organization of the I Region In the past the I region had been divided into five subregions by serological and functional analysis of recombinant H-2 haplotypes; these are: I-A I-B I-J I-E and I-C (Murphy 1981; Klein et al. 1981; Klein et al. 1983). The subregions are defined by crossover positions in H-2 recombinant strains. However, so far only four I regionassociated (la) products have been identified by both serological and biochemical analysis (Jones 1977; Uhr et al 1979) Failure to identify gene products encoded by I-B IJ, and I-C subregions was further explained as follows: I-B subregion The existence of a separate I-B subregion was initially proposed by Lieberman and coworkers (1972) to explain the genetic control of antibody response to a myeloma protein. The involvement of the I-B subregion was later postulated for immune responses to at least five other antigens: lactate dehydrogenase B (LDHg) (Melchers et al. 1973) staphylococcus nuclease (Lozner et al. 1974) oxazolone (Fachet et al. 1977) the male-specific antigen (Hurme et al. 1978) and

PAGE 29

17 trinitrophenylated mouse serum albumin (Urba et al. 1978) In all these cases the mapping of genes controlling the immune response centered around the four critical H-2 haplotypes, i.e. BIO(A) fH-2') C57BL/10 B10.A(4R) and B10.A(5R) ( H-2 ") used by Lieberman and her co-workers. However, further analysis by Baxemanis et al. (1981) of the response to LDHg and to myeloma protein MOPC173 revealed the involvement of and cells in response to these antigens, making the postulate of a separate I-B subregion unnecessary. I-J subregion This locus was originally defined serologically and mapped between I -A and I-E by reciprocal alloantisera raised between strains B10.A(3R) and B10.A(5R), which are inbred congenic recombinant strains with a crossover between I -A and I-E subregions (Murphy et al. 1978a, 1978b) Alloantisera and monoclonal antibodies raised against I-J -encoded molecules react with determinants expressed on suppressor T cells, and the soluble suppressor T cell factors released by these cell lines (Krupen et al. 1982) There is a lot of experimental data available supporting the existence of I-J locus (Murphy et al. 1978a; Waltenbaugh et al. 1981) However, its true identity and chromosomal location remain elusive. By using restriction fragment polymorphisms (RFLP) to map the crossover points among inbred congenic mouse strains that have recombination events between I -A and I-E loci, I-J subregion

PAGE 30

18 was mapped to a 3.4 kb segment of DNA between I -A and I-E including 3' half of Eb gene (Steinmetz et al. 1982). Molecular cloning of this 3.4 Kb region from ten parental and intra-I recombinant inbred strains have narrowed the distance between cross points separating I -A and I-E to 2.0 kb, contained entirely within the intron between E^i-E^2 ^^'^ ^pz exon of Eb gene (Kobori et al. 1984) Although a lot of explanations have been put forth to account for the apparent paradox of I-J all of them are refuted by experiments showing that cloned DNA of this region fails to hybridize to mRNA isolated from I-J ^ suppressor T cell lines (Kronenberg et al 1983) I-C subreqion This subregion was defined by the la. 6 specificity, detected as a cytotoxic antibody present in B10.A(4R) ( H-2 '^^) anti-B10A(2R) ( H-2 ^'') antiserum (Sandrin et al. 1981). These antisera containing purported antiI-C antibodies were shown to react with a suppressor factor generated in a mixed lymphocyte reaction (MLR) (Rich et al. 1979; Rich et al. 1979) A MLR that is generated in congenic strain combination differing at the I-C subregion can be inhibited by the addition of antiI-C antisera (Okuda et al. 1978) Mapping by classic genetic methods has suggested a locus in the I-C subregion between Ea and the gene coding for the C4 complement components. Although this segment of DNA has not been

PAGE 31

19 characterized using molecular techniques, the data available do not lend support for the existence of I-C Others have never been able to demonstrate any activity in I-C -def ininq anti combination by serological methods, MLR, graft-versus-host reaction, or cell-mediated lymphocytotoxicity (CML) assays (Juretic et al. 1981; Livnat et al. 19V3). > Linkage Relationship of Class II Genes Class II gene loci Chromosomal walking through the I region by the ordering of overlapping cosmid clones (Steinmetz et al. 1982a) as well as genetic mapping of restriction fragment length polymorphisms (Mathis et al. 1983; Hood et al. 1983), has allowed the chromosomal localization of the loci encoding the four functional defined class II genes. A continuous stretch of about 500 kb of DNA encompassing the I region was first isolated by screening a BALB/c sperm cosmid library with a human Mhc class II DRA cDNA probe (Steinmetz et al. 1982a) This 500 kb region of DNA includes the right end of I region, as the complement component C4 gene mapping into the S region can be identified (Figure 2-1) C4 gene is located a few hundred kb distal to the Ea gene and was identified by a synthetic oligonucleotide probe specific for the aminoterminal of C4a subunit. Five class II genes, Aa, Ab, Eb, Eb2, and Ea extending over a 90 kb region of DNA, have been

PAGE 32

identified. Ab, Aa and Ea were identified by DNA sequence analysis, and Eb was identified by a specific oligonucleotide probe. Eb2 was identified by cross-hybridization with a human DRA cDNA probe and mouse Eb gene. The identity of Eb gene was confirmed by comapping via RFLP analysis which localizes a serologically defined Eb recombinant in the middle of Eb gene (reviewed by Hood et al. 1983) Southern blot analysis of mouse genomic DNA with class II probes suggested that class II genes are single copy and that there are no more than two a genes and six ^ genes in the mouse genome (Steinmetz et al. 1982a; Devlin et al. 1984) All the known class II loci are contained in a tightly-linked cluster, inserted between the H-2K and C4 genes. This cluster contains 4 functional genes and 4 pseudogenes, which are further divided into two subclasses, I -A and I-E The eight class II genes, Pb (A^j) Qh (A^2) r Ab, Aa, Eb, Eb2, Ea, and Eb3 are arranged in this order from the centromeric towards the telomeric end (Steinmetz et al. 1982a; Davis et al. 1984; Larhammar et al. 1983; Widera et al. 1985) (Figure 2-1 & Figure 2-3). Out of the eight genes, only four are have been shown to encode gene products, Aa coupled with to form I -A molecules, E^ with E^ to form I-E molecules (Jones et al. 1978; Uhr et al. 1979). The Ob and Eb2 genes are reported to be transcribed, but at very low levels and have no detectable protein product (Wake & Flavell 1986) The Pb gene is a pseudogene, at least in the b and k haplotypes, as it has a deletion of eight nucleotides

PAGE 33

o as r-i PQ T3 U •H -P 0) t/1 C •H (0 O r T3 C (tl H H U) Ul (0 H o o o 0) P 0 3 +J o •H o c Q) O Q) 0) C (d 0) e 10 c -p is: n I 0) 3 0) P O u cu >1 T3 0) TJ O O c 0) m c o X 0) Q) XI -P
PAGE 34

22

PAGE 35

23 and a termination codon in its sequence. The Eb3 thus far has been found only in the haplotype, but probably also exists in other haplotypes (Flavell et al. 1985b) All haplotypes studied thus far contain these class II genes. The distances between these genes are, with a few exceptions, approximately the same in different haplotypes. Biochemistry of Class II Molecules Up to now only four I region-associated (la) products have been identified by both serological and biochemical methods. The I -A subregion contains 3 loci that encode three serologically detectable polypeptides: A^, A^, and (Jones et al. 1978) I-E subregion contains a locus that encodes a fourth class II polypeptide chain, (Uhr et al. 1979) Structure of class II ploypeptides The two class II molecules encoded in the I -A and I-E subregions are both heterodimeric glycoproteins composed of one heavy (a) and one light ()3) chains (Figure 2-3 and Figure 2-4). The a chains range in molecular weight from 30,000 to 33,000 and the ^ chains range in molecular weight from 27,000 to 29,000. The difference in molecular weight of a and (3 chain is due to an extra N-linked glycosyl unit attached to a chain (reviewed by Klein et al. 1983) The structure of the class II polypeptides have been determined in a number of

PAGE 36

c <0 rH x: ( -p 3 • •H > +j TJ •H C o o 5 C O (1) -H (0 (0 (0 (1) H +J (0 w o W -H (0 T> rH C U -H O CM •H I Ul 0) c

PAGE 37

25

PAGE 38

26 studies (McNicholas et al. 1982; Mathis et al. 1983a; Malissen et al. 1984; Benoist et al. 1983; Larhaitunar et al. 1983; Estess et al. 1986) The sequence data available suggest that the mouse I -A and I-E molecules are homologous to human DQ and PR class II genes, respectively (McNicholas et al. 1982; Malissen et al. 1983a; Larhammar et al. 1983) Each class II molecule consists of two extracellular domains, al and a2 or 131 and /32, each about 90 residues in length, a transmembrane region of about 3 0 residues, and a cytoplasmic tail of about 10-15 residues. Three of the four extracellular domains (a2, )91 and )82) have a centrally placed disulfide bridge spanning about 60 amino acid residues, while the al does not. The membrane proximal domains of both a and /3, like that of class I molecules, show strong homology to immunoglobulin constantregion domains. In this respect, the class I and class II molecules are very similar to each other in overall organization and domain structure. For each of the two polypeptide chains of class II molecules, a and 13 chains, the polymorphic residues are concentrated in the al and )91 aminoterminal domains (Benoist et al. 1983; Larhammar et al. 1983). These domains are responsible for binding peptides in what appears to be a single site. By aligning the sequences of class II a and )3 chains with the class I heavy chain by matching the al and 131 domains of class II with the al and a2 of class I, a hypothetical tertiary structure for class II molecules has been proposed (Brown et al. 1987) (Figure

PAGE 39

27 2-5) The folding of the class II molecule resembles that of class I, in that two a helices are supported by an array of eight /3-plated sheets (Brown et al. 1988) The recent results of Perkins et al. (1989) showing that peptides presented by class I molecules can be presented by class II molecules, and vice versa, support the notion that the structures of peptidebinding sites are similar in class I and class II. Structures of class II genes There is a striking correlation between the gene organization and domain structure of Mhc class II molecules (Figure 2-4) Both a and /3 genes begin with leader-encoding exons that contains 3-6 residues of the mature proteins. Exon 2 and 3 encode al or )31 and a2 or /32 domains, respectively. p genes have three exons encoding TM, CY, and 3'UT region, while a genes have TM, CY, and the beginning of 3'UT regions in exon 4, and the rest of 3'UT region in exon 5 (Larhammar et al. 1983; Estess et al. 1986). Analysis of the Structure-Function Relationship of Class II Molecule The application of DNA-mediated gene transfer (DMGT) has been a major advancement in the analysis of structure and function relationships of Mhc gene products. Particularly,

PAGE 40

u o o 0) Si -p <4-l o -p •rH Ul Cn •H c c 0) cn -H 4-> C (0 0) -P o 0) o • Ul in Q) I rH rg d O 0) Q) 3 Q •H

PAGE 41

29

PAGE 42

30 DMGT has provided insight into the actual biochemical bases of immune recognition and regulation, which are highly dependent on the fine structure of Mhc-encoded products and T cell receptors with which they interact. Regulation of class II gene expression The expression of class II genes is normally limited to a number of tissues (Klein 1986) Cell surface expression of class II is positively regulated by the addition of gamma interferon (King & Jones 1983) Gamma interferon can increase both class I and class II gene expression (King & Jones 1983) It appears to act at the level of transcription, since the surface expression is correlated with the level of specific mRNA (Nakamura et al. 1984) Initial studies on class II gene expression following transfection were performed using cells that either constitutively expressed (B lymphoma) or were inducible (macrophage cell lines) for endogenous class II genes (reviewed by Germain & Malissen 1986) Introduction of the genomic copies of mouse class-II genes into B-lymphomas resulted in high levels of gene transcription and the expression of gene products of the transfected genes on the cell surface (Ben-Nun et al. 1984) However, it was difficult to assign the observed effect in serologic or T cell restriction element to the introduced gene products. The assembly of a variety of class II molecules following the introduction of a and/or )S chains, prevented the dissection

PAGE 43

31 of which introduced chain caused the phenotypic traits. la' mouse fibroblast L cell lines derived from the original L-cell line of C3H fibroblasts have been used for a variety of gene transfer studies. Using cosmid clones containing the complete DRA and DRB genes, L cells were first demonstrated to express the class II molecules by Rabourdin-Combe & Mach (1983) No expression was seen when either DRA gene or DRB gene was introduced separately. This is consistent with the suggestion that a:^ pairing is required for the efficient cell-surface expression of Mhc class II, although one recombinant, A.TFR5 ( I-A ^. Ea*") has been suggested to express a free chain on the cell surface (Begovich et al. 1985) Their observations were confirmed by studies of Malissen and coworkers (1984) and Norcross et al. (1985) with mouse class II genes. In both studies, transfection of either a or ^ chain gene alone failed to lead to the membrane expression, whereas the cotransfection of the A^iA^ pairs derived from the same haplotypes (e.g. A^'^A^'', A^'^A^'') resulted in significant surface expression. These results agree with those obtained using la* recipient cells, in that the independent transfer of a or /3 chain genes result in the expression only through pairing with the endogenous complementary class II gene products (Ben-Nun et al. 1984) However, one should be cautious about the view that a: 13 heterodimers are required for the surface expression, as most of the monoclonal antibodies used for the detection of membrane molecules have not been

PAGE 44

32 shown to react with single a or /3 chains, which presumably would assume a different configuration as single chains from when paired with the other complementary chain. Thus, the surface expression of isolated a or /3 chain might be undetectable using standard reagents. However, additional experiments are also consistent with a lack of surface expression of free a or ^ chains. McCluskey et al (1985) compared the surface expression of AB ^ chain gene in L cells to membrane expression of a chimeric classll : classi gene. The latter chimeric molecule is composed of A^^'' domain covalently linked to the a3, TM and CY portion of class-I-D'' molecule. Following transf ection, the expression of the chimeric gene can be detected with both antiI-A *' and anti-a3 (D*^) monoclonal antibodies. The same antiI-A *' antibodies failed to detect the surface expression of L cells transfected only with the native A^*^ chain gene and shown to contain the high level of Ab* ^ mRNA. This pair of cells was also analyzed using rabbit antiI-A heteroantiserum, which has been shown to precipitate free A^ chain from a reticulocyte lysate in vitro translation product (Robinson et al. 1983) and to detect both A^, and A^ polypeptides in western blots (Germain & Malissen 1986) Again, the cells containing the chimeric gene stained, but the cells containing the native A^*" gene alone did not. These results indicate that single a or B chain do not reach cell surface efficiently and further imply that the A^^ domain per se does not prevent surface expression.

PAGE 45

33 Dispensability of I-E molecules It has been estimated that some 2 0% of wild mouse populations do not express I-E molecules (Gotze et al. 1981) Laboratory inbred mouse strains of b, s, f, and q haplotypes fail to express serologically detectable I-E molecules (Jones et al. 1981) The defect in mice of b and s haplotypes is due to a deficiency of £<, chains; E<, polypeptide is undetectable in the cytoplasm while the normal amount of cytoplasmic E^ chains can be visualized by 2-D gels (Jones et al. 1981) The expression defect of these strains can be complemented by crossing b or s haplotypes with Ea-expressing strains, which results in normal expression of hybrid I-E molecules in Fl hybrids (Jones et al. 1981) However, neither E^, nor E^ chain can be detected in cytoplasm of fand q-haplotype mice, because of defective processing of both Ea and Eb mRNA (Mathis et al. 1983; Tacchini-Cottier et al. 1988). Combinatorial association L cells have also been used to examine the issue of allelic control of a: (3 pairing and restriction on crossisotype a: ft assembly. Initial studies by Fathman & Kimoto (1981) and Silver et al. (1980) suggested that la* cells from heterozygous individuals contain a mixture of la molecules derived from the free assortment of allelic a and ^ chains of a single isotype in all possible combinations. Thus, in ( H2" x Hzl*^)?! mice, one would find A%\ 4.%% A^^^ ^^d A^'^A^''

PAGE 46

heterodimer in approximately equivalent proportions. Such aand pchain mixing within an isotype did not seem to occur between distinct isotypes (i.e. A^iE^) However, during attempts to develop cell lines expressing only Fl-type la molecules (e.g. A^'^A^'') it was found that although haplotypematched A^rA^ pairs yield high expression in primary transfectants, cotransf ection of haplotype-mismatched pairs gave little or no expression (Germain et al. 1985) This was true even though the genes used for the matched or mismatched gene pairs were identical, and despite the presence of detectable Aa and Ab mRNA in the nonexpressing cells. Additional experiments revealed that for genes of b, d and k haplotypes, cis-chromosomal a:)8 pairs (e.g. ha^Ap") always gave better expression than trans-pairs (e.g. A^'^A^'*) ; experiments also indicated that the expression of the latter varied over a wide range, depending on the particular allelic forms of a and )3 employed. Furthermore, Aj'Afiand A^'^A^'' molecules, the basis for previous suggested "free pairing", are the best expressed haplotype-mismatched mixes, whereas ha^h/ has never been detected. In order to map the region of the A^ molecules controlling the preferential pairing, recombinant A^ molecule involving the b, d and k alleles were constructed. The entire A^^ domain was exchanged between different alleles, or the amino-half of A^^ was covalently linked to the carboxyl-half of A^^ and various A^2/ ™ and CY regions. These "domain and hemi-domain shuffled" Ab genes

PAGE 47

35 were independently cotransfected with Aa^''^'"'^ ^ into L cells. Their results indicate that the most important portion of Ab with respect to az^ pairing is in the amino-half of A^^, in that molecules containing this region from a given allele expressed best with cis-matched Aa and at levels similar to wild type Ab, irrespective of the origin of the remainder Ab gene. However, when isotype-dif ferent a:)9 pairs were cotransfected into L cells, the results were quite unexpected. Although introduction of Ab *" and Ea^"' yield no surface la detectable with either anti-Ab or anti-E antibodies, Ab ** did pair with Ea to produce membrane molecules reactive with antiI-Ab ** and antiI-Ea antibodies. Immunoprecipitation studies showed that these molecules existed as noncovalently associated dimers (Germain & Quill 1985) These data support the view that Aa and Ab genes located on the same chromosome actually coevolve for best "fit", such that cis-pairs form more efficiently than trans-pairs (Figure 2-6) This view is further supported by the studies of McNicholas et al. (1982), showing that an 8-10 fold preference of E^":!^" assembly over Ea":E^'' in cells of (B10.A(4R) x BIO. PL) mice. The data on cross-isotype molecules indicate control of a: 13 pairing is strongly influenced by the highly polymorphic amino termini. To evaluate the relative efficiency of interversus intraisotypic la dimer expression, L cells were sequentially transfected with multiple class II a and ^ chain genes (Germain & Sant 1989) Then individual clones were analyzed

PAGE 48

e •H 0 a 0 c 0 •H Ul rn \u w o. >^ 0) rW TJ (0 c 0 -H 4-> (0 •H 0 o Q) iH in :3 3 0 0) rH (0 O •rH 0 H p H (0 c U) H Ul X) (0 o 0 0 O • VO <(-| I O CM c 3 X! O •H 1X4 09.

PAGE 49

37

PAGE 50

38 both for the level mRNA expression produced by transfected genes and for their expression of interand intra-dimer at the surface. In three gene transfection system (e.g., Ab, Ea, and Eb) it was found that isotype-matched E^E^ dimer was expressed at 3-5 times the efficiency of the isotypemismatched E^A^ dimer based on the amounts of each )3 chain required to drive cell surface expression for the limited amount of E^. When A^ and E^, were compared their coexpression with relative excess A^, the efficiency advantage of isotypematched (A<^) versus isotype-mismatched (E^A^) is about 3 to 4 fold. Additional experiments employing transf ectants expressing Ab**, Aa**/ Eb**, and Ea showed that in clones expressing mRNA ratios similar to B cells, only the isotypematched dimers were expressed. In clones that expressed high levels of A^*^, in addition to isotype-matched A^'^A^'^ and E^'^E^'^, there was a significant amount of EaA^** at the cell surface. These data indicate that the asymmetry chain production in individual chain levels can lead to the expression of less favored isotype-mismatched dimers. In a recent report, recombinant mouse strains and transgenic mice with defective Eb genes, but with normal Ea genes, were examined for surface expression of E molecules (Anderson & David 1989) molecules were shown to be expressed in B10.RFB2 (Ab*, Aa*. Eb*, Ea'') and B10.RQB3 (Ab", Aa'', Eb", Ea*") by cell surface staining with anti-E^ monoclonal antibody (14-4-4) in flow cytometry analysis. It has been proposed that these E^

PAGE 51

39 molecules in fact may be hybrid la dimers formed by E^tA^ pairing, as they can not be stained by E^-specific antibodies and can be detected in H-2 '' mice with the Ea ^ transgene. This finding is further supported by the demonstration of E^'^A^'* as a major class II molecule at the cell surface of a BALB/c B cell lymphoma (Spencer & Kubo 1989) Furthermore, although the hybrid E^A^ can not be isolated by immunoprecipitation, it can function in vivo leading to the clonal deletion of two V£ TcR subsets, VB6 and ViBll (Anderson & David 1989) which have been shown to interact with the I-E molecule during the thymic selection (Kappler et al. 1987) Functional Role of Mhc Gene One of the most distinguishing features of gene products of Mhc is their extensive genetic diversity. One of the most important breakthroughs in cellular immunology was the discovery that the influence of gene products of the Mhc on immune response stemmed mainly from the critical role they played in the activation of regulatory T lymphocytes (Benacerraf 1981; Heber-Katz et al. 1982, 1983). Immune T cells are clonally specific and only recognize foreign antigens in the context of appropriate Mhc molecules. The discovery of this Mhc-restriction was possible only because Mhc molecules are polymorphic and T cells selected by an antigen in the context of one polymorphic variant can be

PAGE 52

40 activated only by the same combination of foreign and Mhc molecules (reviewed by Parham 1984) T cells must corecognize antigen in association with one of these Mhc-encoded molecules in order for activation to occur. Cytotoxic T cells prefer class I molecules whereas inducer T cells prefer class II molecules. However, the relationship between the antigenspecific and Mhc-specific recognition component of T-cell receptor remained speculative until the advent of T-cell cloning. Kappler et al. (1981) fused two T-cell clones with different specificities and asked whether the antigenand Mhc-specific component could segregate independently. A hybridoma specific for ovalbumin (OVA) in association with the I-A *" molecules was fused to a normal T-cell line specific for keyhole limpet hemocyanin (KLH) in the context of I-A ^ molecules. The resulting cloned somatic hybrid could be stimulated to secret interleukin-2 by either original pair of antigen and la molecule, but not by OVA in association with I-A ^ or KLH with I -A *'. These results indicated that T cell recognition of antigen was dependent on recognition of the la molecules. The first convincing evidence that indicated that la molecules and antigen interact with each other during the T-cell activation process came from the studies of BIO. A mice immunized with pigeon cytochrome c (Heber-Katz et al. 1982) In defining the specificity of the response by using different species of cytochrome c, it was noted that the moth cytochrome c and its C-terminal fragment always elicited a heteroclitic

PAGE 53

41 response, i.e. it was more potent on a molar basis than the immunogen, pigeon cytochrome c. Although most of the BIO. A (E/'E/) T-cell hybridomas specific for pigeon cytochrome c could be stimulated by moth cytochrome c in association with B10.A(5R) hybrid I-E (Efi'iEa^) antigen-presenting cells, they could not be stimulated by pigeon cytochrome c in the context of hybrid I-E No other antigen presenting cells (APCs) carrying disparate H-2 haplotypes, e.g., APCs from BIO and B10.A(4R) mice (neither strain express I-E molecule) gave any stimulation. Thus, these T-cell clones were able to recognize moth cytochrome c associated with either E^'^iE^'' or Efi'iEj' la molecules. Other experimental evidence also suggested that antigen recognition by cytotoxic T cells was fundamentally similar to that of helper T cells (Hunig & Bevan 1982) Using la-containing planar membrane as antigen presenting particles together with defined synthetic peptides, it was demonstrated that la and "processed" antigen are the only requirement for T cell recognition. That la and processed antigen interact specifically prior to T cell recognition was supported by the observation that antigens could compete with one another at the level of antigen presentation in the absence of T cells (reviewed by Buus et al. 1987) The first direct biochemical evidence of a specific antigen/Mhc interaction came from equilibrium dialysis studies using affinity purified Mhc molecules and labeled synthetic peptide (Babbitt et al. 1985) They

PAGE 54

42 demonstrated that hen egg lysozyme (HEL) 46-61 [HEL(46-61) ] bound to I-A *^. but not to I-A *^. This binding study correlated with the finding that T cells specific for HEL (46-61) from high responder H-2 '' mice are restricted by I-A *" whereas Hz. 2^ mice are low responders. These results demonstrated a correlation between immunogenic peptide-Ia interaction and Mhc restriction (Babbitt et al. 1985) Furthermore, it was shown that the failure of pigeon cytochrome c to be recognized in the context of the hybrid I-E molecule was due to the fact that hybrid I-E molecule was unable to interact with pigeon cytochrome c-derived synthetic peptides (Buus et al. 1987) Each Mhc molecule binds many different peptides, using a single binding site and probably through the recognition of broadly defined motifs (Buus et al. 1987) This concept of single antigen binding site is compatible with the recently described X-ray crystal lographic structure of human class I molecules (Bjorkman et al. 1987a, 1987b) Genetic Polymorphism of Mhc Genes There are five distinguishing features of H-2 polymorphism in wild mice that have been the subject of considerable investigation. 1) there is a large number of alleles encoded by each genetic locus. The most polymorphic genetic loci known in the mouse are located within the H-2 complex. Although at least 50 alleles have been detected for the H-2K and for the H-2D genes, it is estimated that at least 100

PAGE 55

43 alleles may exist in each of these genes (Gotze et al. 1980; Klein & Figueroa 1981, 1986) There are other genes within the H-2 complex are also highly polymorphic, but they tend to be less polymorphic than the H-2K and H-2D genes. 2) most if not all wild mice are heterozygous with respect to H-2 class I and class II genes (Duncan et al. 1979; Nadeau et al. 1981) This high level of heterozygosity is unprecedented in the mouse and is mainly, if not entirely, a result of the presence of a large number of alleles in wild mouse populations. It was estimated that over 90-95% of the wild mice are heterozygous at both K and D loci and at least 85% are heterozygous at the Ab and Eb loci (Duncan et al. 1979; Nadeau et al. 1981) These figures concur with the high H-2 polymorphism estimated from the antigen and gene freguencies (Klein 1986) 3) H-2 polymorphism occurs as a family of closely related alleles. Both amino acid and DNA sequence analysis demonstrates that the similarity between H-2 genes and proteins is discontinuous (Wakeland et al. 1986) 4) both sequence and amino acid analysis of serologically and biochemically indistinguishable class II molecules derived from different subspecies suggest that they are identical (Arden et al. 1980; Arden & Klein 1982). 5) there is a high percentage of nucleotide difference between alleles from the same locus. The nucleotide sequence variation can go up as high as 5-10%, including the coding region (Benoist et al. 1983; Estess et al. 1986)

PAGE 56

44 Mechanisms generating polymorphism of Mhc genes Mutation It is generally believed that ultimate source of genetic variation is mutation (Nei 1987b) There is no evidence suggesting that the extensive diversity of Mhc is generated by high mutation rate (Hayashida & Miyata 1983; Klein 1987) Serologic typing of class II genes of wild mice in global populations suggested class II molecules can be arranged into families of alleles, based on the antigenic similarity and tryptic peptide fingerprints of I -A molecules (Wakeland & Klein 1979; Wakeland & Klein 1983). Each family consists of a cluster of closely related alleles. Tryptic peptide fingerprinting comparisons of alleles within the same family revealed that the contemporary Aa and Ab alleles arose from common ancestors by multiple independent mutational events (Wakeland & Darby 1983) Furthermore, radiochemical sequence analysis of structural variants within the family indicates that these I -A variants have diversified by accumulating discreet mutations within the al and )S1 domains of I -A molecules (Wakeland et al. 1985) Similar conclusions have been drawn from the studies of human class II molecules (Gustafsson et al. 1984). Gene conversion Gene conversion (hypermutational mechanism or segmental exchange) is a process whereby the nonreciprocal exchange of genetic information between two genes occurs (Baltimore 1981) It differs from unequal crossing

PAGE 57

45 over in that neither gene gains or loses genetic material. Classically, it has been studied in allelic genes of fungi due to the ease of tetrad analysis. However, a growing amount of evidence suggests its existence in mammalian genomes (reviewed by Hansen et al. 1984) Analysis of the murine class I mutants has provided compelling evidence for the occurrence of gene conversion-like events in Mhc gene. Nathenson and his coworkers have undertaken the painstaking structural analysis of a series of mutant K*" molecules (Geliebter et al. 1987) Four antigenically important regions within the al and a2 domains of K*' molecules are revealed from the analysis. Alterations in these regions result in the formation of new epitopes which are detectable by graft rejection in vivo and CTL in vitro The result of their analysis suggests that micro-recombinations between K*" and other class I genes may be responsible for the generation of diversity of class I gene. In most, if not all, mutants analyzed, the non-classical H-2 genes, i.e. Qa and Tla region gene are identified to be donor genes that can recombine into and "mutate" H-2 genes. There is evidence showing that the gene conversion is operating in H-2 class II genes as well (Mengle-Gaw et al. 1984). A B6.CH-2'""^^ (bm 12) mouse is Mhc class II Ab*" mutant, derived by spontaneous mutation from a (BALB/c x B6)Fi parent. The bml2 mutant and its B6 parent show reciprocal skin graft and twoway mixed lymphocyte reaction (MLR) Genetic studies and tryptic peptide mapping studies have concluded that Ab*"^^ gene

PAGE 58

46 from bml2 mutant differ only 3 nucleotide from its B6 parent Ab '' gene. By T cell proliferation assay and monoclonal antibody-blocking studies, alloreactive T cell clones are shown to recognize the E^'^e/ and hj'hfi'"'^^. Comparison of sequences among Ab*""^^, Ab*" and Eb'' indicates that the bml2 DNA sequence is identical to the Eb'' sequence in the region where it differs from P^i' Furthermore, this region is flanked by a stretch of identical DNA sequence between Ab*" and Eb*". These results suggest that the bml2 mutation arose by gene conversion of this region of Eb'' into the corresponding region of Ab*". The maximum extent of sequence transfer between Eb'' and Ab*" is estimated to be 44 nucleotides, but could be as little as 14 nucleotides. Evidence of segmental exchange has also been provided by analyzing the exon sequences of eight Ab alleles (McConnell et al. 1988) In an attempt to analyze the association between exon and intron sequences, it was noted that most alleles of exons evolve in association with their associated intron sequence polymorphisms with the exception of two alleles, Ab'' and Ab""'' (Figure 2-7) These two alleles appear to be the products of intragenic segmental exchange (McConnell et al. 1988)

PAGE 59

O u wo 3 < (0 0) a) 0) as 0) .c c •H (0 en (0 H 0 o £! o c (0 X! 0 Q) •H U O ft 5 o 2 H ^3 0) O c 0) (0 <(-i H o c (U 0) o 0) o c & Q) 10 c o >! 0) 0) > e Q) o a o -p 0) -p H -C 0) •H X! (0 -p c 0) Q> (0 o c 0) CP (0 p c -H >i x> T3 0) o -o o a c 0) 0) X5 0) > (0 o p u 0) ft ft (0

PAGE 60

48 LU O QCL X LU CO § o C CD — CO c O 03 CD CD CD 5 2 0)0 CD X CO CD CD SI ot5 CO CD O) CC CD C C\J CO

PAGE 61

49 Trans-specific evolution The evolutionary rate of Mhc loci is not higher than that of any other loci (Hayashida & Miyata 1983) Although the presumed rapid diversification within species can be explained by mechanisms such as gene conversion, an alternative hypothesis has been proposed by Klein et al. (1980, 1987). According to this hypothesis, the evolution of Mhc polymorphism is via a trans-species mode, starting with a number of major alleles that are passed on in phylogeny from one species to another. During the evolutionary process the alleles accumulate the mutations, which result in the extensive diversity of Mhc genes. There is mounting evidence supporting this hypothesis. McConnell et al (1988) assembled a collection of 49 H-2 haplotypes derived from five Mus species, including Mus m. musculus Mus m. domesticus Mus m. castaneus Mus spicileaus Mus spretus A total of 31 Ab alleles was defined by RFLP analysis. Based on the degree of sequence divergence, 31 alleles defined by restriction fragment length polymorphism (RFLP) can be divided into three distinct evolutionary lineages. Most of these alleles (28 out of 31) were in either lineage 1 or 2 both of which consisted of alleles derived from 4 separate Mus species (Table 2-1 and Figure 2-8) These findings are consistent with the trans-species evolution of Ab gene and contrast with data obtained when other nuclear genes or mitochondrial DNA (mtDNA) polymorphisms were analyzed in mice from the same populations. Genomic sequence comparisons of Ab"^ and Ab'' show

PAGE 62

K 0) > •H 4J 04 >1 0 H (0 o 0 c •H •H +J j3 4J H •H 0 > M n i (U rH Q (0 s >i u • (0 H c 1 o •H 0) -P CT 0) fO rH a) ^ 0 c (0 > •H H Vi CO 3 rH rH 3 0 0 10 0) Ui P rH •rH CO 0 • •H • 0 a) to rH •H (0 (0 0 (/) (0 •H 0 u 0 0 •H (U •H (0 •H -P -p -p U) (0 (0 0) -p 0) (0 0) 0 (0 0 -p o T3 o T3 • 0 • u in in n rH H • • • o o o in • • o o o rH rH CO rH CM n

PAGE 63

0) u 4J 0) P <4-l o 0) U) CP-P (0 c C 0) O -P O ^^ o a 0) 0) u u 0) 0) M ^-1 in 0) 0) (0 0) Q> c H u (0 c o en c D> > H 0) O W P c Q) CO -p 3 u (0 c o •rH -P H O > a) +J <4-l o c o •H +J (0 U iH iH H CO s c •rH o c 0) o •H -P (0 Q) -P rg (U (0 0) rH o > 0) 0) M ^H o o <4-l <4-l 0) •* rH (fl 13 o •H P Ul 0) o -d (0 o 0) O •H x: 0) •rH -H (0 •rH >1 u (0 c o •H P rH o > 0) 0) ^ ?Eh 0) c (d c o •H P •H T3 -O (0 O P >i rH H Q) -H (I) tj >, 2 (0 p W ,0 (d w w 0) (d •H > o 0) x: a o Ul m o c o H P Q* 0) O C Q) XI P O 4J -P 0) 0) 10 (0

PAGE 64

52

PAGE 65

53 that the region of highest divergence between these alleles occurs in the intron separating the )31 and )82 exons (Figure 2-9) Ab** contains an additional 861 bp of inserted sequences, which are composed of SINE (short interspersed repetitive elements) commonly named retroposon. The relationship of this retroposon polymorphism to the evolutionary lineage defined was tested by genomic restriction mapping of Ab genes from both lineages, 1 and 2. The results indicated the 861 bp retroposon insertion is characteristic of lineage 2 alleles. Using the SINE sequence as an evolutionary tag, it is estimated that the Ab alleles in these two lineages diverged at least 0.4 million years ago and have survived the speciation events leading to several Mus musculus subspecies Their studies are further supported by the works of Figueroa et al. (1988) They showed that the molecules encoded by alleles of Ab locus fall into two groups defined by their reactions with monoclonal antibodies. One group reacts with antibodies specific for the antigenic determinant H-2A .m25 ; the other with antibodies specific for determinant H-2A .m27 This serological reactivity pattern correlates with a specific structural feature of the proteins of Ab genes. Sequence comparison of Ab genes derived from inbred and wild strains has revealed that m27-positive proteins have two amino acids deleted at positions 65 and 67 in the 131 exon, while m25 antibodies react with Ab chains that do not have deletions.

PAGE 67

55 CO CO >O CM UJ m — CO 0> CD OB •S o ^ CD OC CD CO co UJ lO 8j HI Q. o o o c e 3 -L w .t; ^5 Q. (D cr E 8 cc 3 •= CO 3 < 0> e o c o 3 cr a> CO > a o cc 0) 3 o .t; 3 D" CD 13 o CD CO I in < <

PAGE 68

56 But no Ab molecules were ever detected to be positive ornegative for both antibodies simultaneously. The perfect correlation between the serological pattern and the presence or absence of the two deletions have been confirmed by testing a panel of Ab in Northern blot analysis (Figueroa et al. 1988) The same deletion polymorphisms also exist in other species distantly related to M. musculus complex such as M, carol i and M. pahari which is estimated to be separated from M. musculus complex 1.7 and 4.8 million years ago, respectively. Furthermore, the non-deleted and deleted forms of Ab genes are also shown to be present in inbred strains of rat, which is another rodent genus closely related to the genus Mus They conclude that the codon deletion polymorphisms are shared not only by different species of the same genus but also by different genera of the same order. Comparisons of class I Mhc alleles in two closely relatedly species: humans ( Homo sapiens ) and chimpanzees ( Pan troglodytes ) have also indicated the trans-species mode of evolution in this family of genes (Lawlor et al. 1988; Mayer et al. 1988) There are no features that distinguish human alleles from chimpanzees. Individual HLA -A or B alleles are more closely related to individual chimpanzee alleles than to other HLA-A or B alleles. These studies support the notion that a considerable proportion of contemporary HLA-A and B polymorphisms existed before divergence of the chimpanzee and human lines. A recent report indicates that as high as 30%

PAGE 69

57 of asian wild mice (e.g. Mus m. musculus Mus m. domesticus Mus m. castaneus ) carry a H-2K ^ antigen detected by an alloantiserum specific for H-2 class I gene (Sagai et al. 1989) H-2K ^ antigen is further characterized by a panel of monoclonal antibodies and restriction enzyme analysis with a H-2K locus-specific probe for 3' end of H-2K A characteristic RFLP pattern was always found to be associated with a monoclonal antibody reactivity pattern. The concordance between the presence of antigenic determinant and a particular RFLP pattern is observed not only in Mus musculus subspecies, but also in M. spretus Their results indicated that the antigenic determinant reactive with monoclonal antibodies is an ancient polymorphic structure which has survived speciation in the Mus genus, and is closely associated with a stable DNA segment at the 3 end of H-2K gene. Intra-exonic recombination A recent study of Mhc class II Ab genes indicated that another mechanism was mainly responsible for the genetic diversity of Mhc genes (She et al. 1990b) A panel of 52 different alleles derived from laboratory inbred mice as well as various species of mice and rats was analyzed for their A^2 nucleotide sequence. Examination of the patterns of sequence polymorphisms revealed that the majority of sequence diversity was localized in five subdomains. Each of these subdomains have several

PAGE 70

58 polymorphic sequence motifs. On the basis of the hypothetical three-dimensional structural model of class II molecules (Brown et al. 1988) these polymorphic sequence motifs are located in the regions encoding the ABS. With respect to the whole Afi2 exon, it was found that a specific sequence motif could associate with several different motifs from other subdomains to form an allele. This observation indicated that the diversification of A^2 exons resulted from intraexonic recombinations which shuffled these motifs into various combinations (Wakeland et al. 1990a; She et al. 1990b) Mechanisms that maintain Mhc polymorphisms Although a variety of data indicate that Mhc polymorphism is maintained by some type of balancing selection, the precise mechanisms involved have remained controversial. Two forms of balancing selections, overdominance and frequency-dependent selection, have been proposed to account for the unprecedented genetic diversity of Mhc genes. Overdominant selection (heterozygous advantage) The maintenance of Mhc polymorphism by overdominant selection was first proposed by Doherty and Zinkernagel (Doherty & Zinkernagel 1975). It is based on the well-established experimental observation that Mhc-1 inked responsiveness is a dominant (or codominant) genetic trait (Benaceraf & Germain 1978) Mhc heterozygotes are capable of responding to any

PAGE 71

59 antigens recognized by either parental Mhc haplotypes, since Mho molecules encoded by both Mhc haplotypes are coexpressed on the surfaces of antigen-presenting cells (Benaceraf & Germain 1978). Hughes & Nei (1988) examined the pattern of nucleotide substitution in the region of ABS, involving the 57 polymorphic amino acid residues and other regions of Mhc class I alleles of both human and mice. Their study is based on the theoretical prediction that in the presence of overdominant selection the rate of codon substitution is increased compared with that for neutral alleles and only nonsynonymous substitution would be subject to overdominant selection as synonymous substitutions are more or less neutral (Maruyama & Nei 1981) This increase in rate of codon substitution is due to the selective advantage of heterozygotes carrying the new mutant allele. Their results indicate that in the ABS the rate of nonsynonymous substitution is higher than that of synonymous substitution, whereas in other region the reverse is true. In a later study (Hughes & Nei 1989), the same type of analysis is extended to class II Mhc genes. It is concluded that the unusually high degree of polymorphism at class II Mhc loci is caused mainly by overdominant selection operating in the ABS. Therefore, the biological basis of overdominant selection for class II Mhc loci seems to be similar to that for class I Mhc loci. A mathematical study of overdominant selection model also indicates that it can maintain polymorphic allelic lineages

PAGE 72

60 for a long time and thus it has sufficient explanation for the trans-species evolution of Mhc gene (Takahata & Nei 1990) Frequency-dependent selection Initially it was speculated that Mhc alleles generate heterozygote disadvantage in association with infectious diseases and that some kind of frequency-dependent selection is required to maintain the high degree of polymorphism (Bodmer 1972) Pathogen adaptation model was suggested as one form of frequency-dependent selection (Snell 1968; Bodmer 1972). This model is based on the assumption that host individuals carrying new antigens, which have arisen recently by mutation, will be at an advantage because pathogens will not have had the time to adapt to infecting the cells with new antigens. Therefore, this will generate a new form of frequency-dependent selection, in which a new Mhc allele initially has a selective advantage compared with an old allele, but gradually declines with time. This model also suggests that in the presence of pathogen adaptation the average heterozygosity, the number of alleles, and the rate of codon substitution will increase compared with those for neutral alleles. Rare allele advantage Another model of frequency dependent selection is rare allele advantage. This hypothesis is based on the notion that endemic pathogens, which evolve much more rapidly than their vertebrate hosts, will tend to

PAGE 73

61 adapt their antigenicity to minimize immune recognition by the most prevalent Mhc genotypes in a population. Consequently, new or rare Mhc alleles will have a selective advantage due to increased resistance to prevalent pathogens. This model predicts cyclic fluctuations in the frequencies of Mhc alleles as pathogens are driven to evolve antigenicity, evading the immune responsiveness of a series of new "prevalent" alleles. This model can explain the maintenance and long persistence of polymorphic alleles by rescuing the rare alleles from distinction (Wakeland et al. 1990) Recombination Within the Mhc Recombinational hot spot within I region The genetic material is a dynamic structure that reorganizes during evolution and differentiation. Nucleotide sequences are rearranged by recombination between homologous or non-homologous sequence. While homologous equal recombination breaks and rejoins chromosomes at precisely the same position, unequal recombination between homologous sequences in different positions leads to duplication and deletions. Over the last ten years recombinant mouse strains have been analyzed by RFLP analysis and DNA sequencing to map the crossover in the I region (Steinmetz et al. 1982a) These studies have shown that recombination within the I region is not random, but localized to specific sites. These sites

PAGE 74

62 have been termed recombination hot spots (RHS) (Steinmetz et al 1982a) A first such RHS, localized with the intron between the second and third exons of jEb gene, was identified from analysis of six intra-I region recombinant mouse strains (Kobori et al. 1984) Since then, additional three RHS's have been identified within the Mhc, including K/Pb, Pb/Ob (Steinmetz et al. 1986; Uematsu et al. 1986) and Ea (Lafuse & David, 1986) (Figure 2-10) RFLP analysis indicates that recombination within the Pb/Ob. Eb and Ea is reciprocal (Steinmetz et al. 1982a; Steinmetz et al. 1987; Lafuse & David 1987) Analysis of secondary recombinant strains indicates that chromosomes that have recently undergone a recombinant event are unstable and quite likely to undergo a second recombination in the next generation (Lafuse & David 1987) Molecular basis of recombinational hotspots In the human genome, recombinational hotspots mainly occur in regions containing hypervariable minisatellite sequences. These minisatellite sequences are composed of tandem repeats and occur at multiple locations. The repeat unit contains a common 16-bp core sequence, GGAGGTGGGCAGGARG DNA sequence searchs for the Pb/Ob and Eb recombinational hotspots have found that short repeated sequences with some homology to the recombination signal Chi (GCTGGTGG) of phage lambda: (CAGA)6 in the Pb/Ob hotspot and (CAGG)7.9 in the Eb hotspot (Steinmetz et al. 1986). The CAGG repeated sequence

PAGE 75

lie Kl-H 0) -d xi 0) p > c o •H > J3 c +J -rH •H > (fl 01

PAGE 76

64

PAGE 77

65 identified in the Eb hotspot exhibiting significant homology to the human minisatellite core sequence, and thus may represent a murine minisatellite (Steinmetz et al. 1987) Recently, a female-specific recombination hotspot has been mapped to a 1 kb region of DNA between the Pb and Ob genes (Shiroishi et al. 1990) This hotspot predominantly occurs in crosses between Japanese wild mice Mus musculus molossinus and laboratory haplotypes. Its location overlaps with a sexindependent hotspot previously identified in the Mus musculus castaneus CAS3 haplotype. Sequence comparisons between DNA surrounding this hotspot and corresponding regions from other strains, including BIO. A, C57BL/10, CAS3 and C57BL/6, revealed no significant difference. However, sequence analysis of this Pb/Ob hotspot with a hotspot in Eb indicated that both have a very similar molecular structure. Each hotspot is composed of two elements, mouse middle repetitive MT family and the tetrameric repeated sequence, both are separated by 1 kb of DNA (Shiroishi et al. 1990) Definition of Evolutionary Lineage The evolutionary lineage of Ab was initially defined by RFLP analysis of 31 Ab alleles from 5 different Mus species (McConnell et al. 1988) These 31 alleles were ordered into three distinct lineages based on calculating the fraction of restriction fragments (F) (Nei & Li 1979) and sites shared (S) which is used to estimate the genomic sequence divergence

PAGE 78

66 (Table 2-1) Sequence comparisons of lineage 1 (Ab*^) and lineage 2 (Ab'') alleles indicated that the major DNA sequence polymorphism between these two lineages occur in the intron 2 between /31 and /32 exons (Figure 2-9) The sequence homology in this intron is <90%, and Ab'' gene contains an extra 861 bp of retroposon, flanked by 13 bp direct repeats (ATGTATGCTGTTT) The host-derived nature of this direct repeat sequence indicates that the 861 bp retroposon was inserted into this position as a random event during the evolutionary divergence Ab genes. Inspection of genomic restriction maps of alleles derived from separate Mus species indicate that the retroposon insertion is characteristic of lineage 2 alleles (McConnell et al. 1988) These results indicate the evolutionary lineages defined by RFLP analysis reflect alleles with different retroposon polymorphisms. Structure and Evolution of Retroposon Before cloning of DNA became a major tool of studying gene structure and function, chromosome renaturation experiments showed that most organisms possess short stretches of moderately repeated DNA (mrDNA) separated by longer sequences of low copy number (Davidson and Britten 1979) For mammals, most of the mrDNA is composed of retroposons, some of which are thought to represent mobile genetic elements using RNA intermediates in their replication ( Jagadeeswaran

PAGE 79

67 et al. 1981) These mrDNA belong to different sequence families in different mammalian orders (reviewed by Rogers 1985) The majority of mammalian interspersed repeated DNA falls into two families, referred to as short and long interspersed nucleotide elements, SINEs and LINEs, respectively (Singer 1982) The "generic" SINE sequence contains an internal RNA polymerase III promoter, an A-rich 3 'end and flanking direct repeats. The size of SINEs typically range from 75 to as much as 500 bp in length. All nonviral retroposons correspond to a partial or complete DNA copy of a cellular RNA species. With a few exceptions, nonviral retroposons are derived from fully processed RNAs (reviewed by Weiner et al. 1986) Structure of Alu and "Alu-like" Family The first well-characterized and the most abundant repeated DNA family in primates is the Alu family which constitute most of the dispersed, repeated DNA (Houck et al. 1979). The 500,000 Alu elements in the human constitute 5-6% of the genome by size, occurring on average every 5-9 kb and differing on average by 13% from the consensus sequences (Schmid & Jelinek 1982; Rinehart et al. 1981). Other SINE families are referred to as "Alu-like" or "Alu-equivalent" families. Mice, rats, and hamsters all contain two abundant "Alu-like" families, Bl and B2 (Kramerove et al. 1979; Krayev et al. 1980; Haynes et al. 1981). The Alu elements.

PAGE 80

68 approximately 300 bp long, were so named because they contain a distinctive Alu I cleavage site. Regions of direct internal repetition within Alu sequences indicate that the Alu element is composed of two incompletely homologous arms, an approximately 130 bp left arm and a right arm which differs from the other by an insertion of 31 bp (reviewed by Doolittle 1985) Although human Alu sequences are dimeric, the homologous rodent sequences (the Bl superfamily) are monomer ic. It is believed that both Alu and Bl sequences are derived independently from 7SL RNA as 7SL RNA gene has about 150 bp in the middle that is not found in the Alu family (Ullu et al. 1985; Weiner et al. 1986). 7SL RNA is a component of signal recognition particle, required for cotranslational secretion of proteins into the lumen of rough endoplasmic reticulum (Walter & Blobel 1982), and is highly conserved throughout evolution. Alu-like sequences, and retroposons in general, have a strong tendency to insert into each others' (A) -rich tails. This has apparently generated composites which are themselves propagated as single retroposons (Jagadeeswaran et al. 1981; Haynes et al. 1981). Mechanisms of Retroposition Transcription by polymerase III The basic model for retroposition of SINEs involves RNA polymerase III transcription of genes, reverse transcription of the RNA, and integration into the genome (Figure 2-11)

PAGE 81

69 All SINES contain an internal RNA polymerase III split promotor (Galli et al. 1981) In vitro transcription experiments have shown that the 5 end of the SINE transcripts have coincided exactly with the left end of the repeated DNA sequence. These results have led to the proposal that the SINEs propagate via RNA-mediated retroposition ( Jagadeeswaran et al. 1982) SINE family members are able to produce in vivo transcripts, their transcription is regulated in a tissuespecific manner. The homogeneous size of Alu transcripts indicates that one or a few identical family members are transcribed (Watson & Sutfliffe 1987) The transcription of 7SL RNA gene requires a specific 3 7 -bp upstream sequence in addition to its internal promoter (Ullu & Weiner 1985) Since the Alu family has evolved from 7SL RNA, its promotor may similarly depend on such upstream sequences. A critical step in promoting an efficient SINE retroposition may be mutations that render the promotor independent of flanking sequence. However, the established chromatin structure and environment into which the SINE member is situated may have a regulatory effect on the transcription of SINE family members. In transfection assays, it was found that the introduced SINE member is transcriptionally active in transient assay, but is silent in long-term transformants These results also support the concept that the internal promotor is not sufficient by itself in vivo (reviewed by Deninger 1990)

PAGE 82

Figure 2-11. A proposed mechanism for SINE retroposition. The first step is transcription of the repeated DNA sequence. The repeat is represented by a heavy line, its flanking sequence by thinner lines, an the transcript by a wavy line. Transcription initiates at the beginning of the repeat, adjacent to the flanking direct repeat (double solid arrows) continues through the entire repeat, and terminates in flanking sequence. This transcript is suggested to be capable of self-priming reverse transcription by priming with its terminal U residues on the 3 A-rich region of the repeat transcript. Removal of the RNA will then leave a singlestranded cDNA copy of the entire repeat with no falanking sequences. This cDNA must tehn integrate into a genomic site with staggered nicks. It is hypothesized that an A richness at the nikc site may interact with the T-rich cDNA end to stabilized the interaction. Repair synthiesis at the junctions will then result in formation of a newly integrated repeated DNA family member with a different flanking direct repeat (double hollow adrrows) Many of these steps are hypothetical and a number of alternatives are possible. Adapted from Deininger (1989)

PAGE 83

71 Transcription S" 3' It AAAAAnTTTTT^ -AAAARvr Transcription ITTTUUU •AAAAA iRapalr Synthesis targat sita AA>W

PAGE 84

72 Termination of transcription Most SINEs do not contain the termination signal for RNA polymerase III (Fuhrman et al. 1981) Transcription starts from the 5' end of SINE, runs through the entire repeat, and terminates at the flanking sequence by chance as the consensus sequence for termination contains four or more T's in a row (Bogenhagen et al. 1980) Most in vivo SINE transcripts appear to be polyadenylated (Deininger 1990) Reverse transcription Since the transcripts of SINE family members normally possess a poly (A) tract, they may be able to self-prime their reverse transcription ( Jagadeeswaran et al. 1981) Moreover, the RNA polymerase III transcripts should have three or more U's at their 3' end, which may fold back and prime reverse transcription (Bogenhagen et al. 1980) Reverse transcription could also be primed by an intermolecular interaction, for instance, using the 3 'end of another transcript through the (A) -rich region (VanArsdell et al. 1981). The source of reverse transcriptase, which must be active in germ line, is unknown. One possible source is from the intracisternal A particles (lAP) which produce particles containing reverse transcriptase (Wilson & Kuff 1972) and are active in early embryos (Kelly and Condamine 1982) Or it may be provided during retroviral infections or from endogenous retroviral sequences (Martin et al. 1981) Small RNA molecules can be

PAGE 85

73 packaged into retroviral particles and be reverse transcribed (Linial et al. 1978) Packaging should facilitate the reverse transcription and may account for the high efficiency of SINE retropositon. Packaging may also promote an "infection-like" process facilitating RNA made in somatic cell to enter the germ line (Vanin 1984) Integration To facilitate the integration process, the genome must be nicked to allow the entry of new sequences, followed by repair synthesis to make direct repeats at the integration sites. Direct repeats generated are generally rich in A residues and vary widely in length, suggesting that SINE do not use specific integration enzymes but instead take advantage of nicks generated by other nonspecific enzymes. Topoisomerases, enzymes that relax the genome during replication and transcription, have been shown to have nicking activity in a SINE family member in vitro (Perez-Stable et al. 1984) Although topoisomerase I is generally thought to be nonspecific in its nicking activity, hot spots for DNA cleavage have been reported (Busk et al. 1987) These sites are A rich and at least partially resemble the 3' terminus and direct repeats of SINEs. Not only are the integration sites of SINEs A rich, but the A richness is predominantly at the left end of the direct repeat (Daniels & Deininger 1985; Rogers et al. 1986) These findings have several

PAGE 86

74 ramifications. First, it shows that the integration is not random. Second, since the 3' ends of the SINE families are generally A rich, when they integrate into a new site they generally make that site even more A rich. Therefore, the 3' end of SINEs are improved integration sites for more SINE copies, resulting in a tendency to form perfect tandem dimers (reviewed by Rogers 1985) In several examples, it appears that the integration of one element abutting another form a composite so that they could retropose as a single unit (Daniels & Deininger 1983) Functions Attributable to SINE It is assumed that the broad genomic distribution and high copy number may serve an important cellular function. It has also been argued that these repetitive elements are selfish DNA whose self -propagation provides no benefit to their hosts (Doolittle and Sapienza 1980; Orgel and Crick 1980) SINEs have been involved in a number of effects on genome structure and evolution. For example, SINEs may promote deletion or facilitate recombination (Lehrman et al 1987), act as limits to gene conversion (Hess et al. 1983) and move unrelated DNA segments throughout the genome either via retroposition of sequences adjacent to SINEs (Zelnick et al. 1987) They may just affect the long-terms adaptability of the species.

PAGE 87

75 Recombination Recombination involving the Alu repeats have resulted in phenotypic changes. For example, at least two different forms of globin gene defects occur in a pair of inverted Alu repeats, which result in a deletion of gene. The LDL receptor gene has a number of Alu dispersed repeats in its intron, 3' noncoding region, and flanking region. Five naturally occurring insertion/deletion mutants of this gene have produced defective receptors, four of which involve Alu-Alu recombination (Horsthemke et al. 1987) Suppression of gene conversion Examination of regions of globin genes have provided evidence that SINE can help to limit gene conversion events (Hess et al. 1983; Schimenti & Duncan 1984) The globin genes consist of a multigene family whose members start to evolve after duplication. By limiting the degree of gene conversion, the SINE sequences may promote gene diversification and the evolution of new functions (Deininger 1990). Mobilization of DNA sequence Several composite SINE families are formed by fusing new sequences with a SINE to become a functionally-transposing unit, indicating that SINE has a potential to mobilize other sequences (reviewed by Weiner et al. 1986) There is one example of genomic non-repetitive sequence that lay between

PAGE 88

76 two artiodactyl SINEs retroposed with them as a unit, resulting in the duplication within the cow haploid genome (Zelnick et al. 1987). In vitro transfection experiments also indicated that SINEs might repress or activate transcription initiated by adjacent RNA polymerase II promoter (McKinnon et al. 1986) Another function conferred by certain SINEs is to encode portion of polypeptides. Alu dispersed repeats constitute for 32 codons of 3' portion of genes for decay-accelerating factor and for a B-cell growth factor (Caras et al. 1987; Sharma et al. 1987) The CCAAT box of the e-globin gene in primates is part of an Alu repeat sequence (Kim et al. 1989) Some SINEs are found in the 3 noncoding exons and provided polyadenylation signal (Krane & Hardison. 1990) Thus, functional sequences provided by SINE include promoter, RNA processing and protein-coding sequences. Evolution of Introns ^ .... -'<( Mammalian genes are discontinuous, broken up along the DNA into alternating regions: coding sequence or exons, which are interspaced with other noncoding secfuences or introns that will be spliced out of the primary transcript. An intriguing question regarding the introns is what advantages or functions are provided to the cell by them. There has been ample speculation about the origin and maintenance of introns in

PAGE 89

77 eukaryotic genomes. Gilbert (1978, 1985) proposed "exon shuffling" hypothesis which states that introns provide an evolutionary advantage by allowing recombination within intron sequences, and that introns in modern genomes were remnants of the recombination process that speed up evolution. The observations that the exons often correlated with functional domains and that the homologous exons can be found in different genes have been used to support this idea. Examinations of genes coding for certain ubiquitous enzymes, such as triosephosphate isomerase, whose sequence is highly conserved across species, have revealed that the intron positions are not random and that all of these introns were in place before the division of plants and animals (Gilbert et al. 1986) the introns were lost from prokaryotes as their genomes became streamlined for rapid DNA replication (Doolittle 1978) After the discovery of introns, a number of authors have suggested that intron might represent the vestiges of transposable elements which had been inserted into the genes (Cavalier-Smith 1985; Hickey & Benkel 1986). Although there is evidence that many, if not all, introns are dispensable (Ng et al. 1985) there is also evidence that the internal sequences of introns are important for splicing (Rautmann & Breatnach 1985) Cech (1986) has suggested that all RNA splicing reactions are evolutionarily related, with the exception of those involving some pre-tRNA. This evolutionary link between different intron classes implies

PAGE 90

78 that the introns of nuclear protein-coding genes were also capable of replicative transposition at some stage in their evolutionary history. Hickey & Benkel (1986) have suggested a model to account for the evolutionary origin of introns. The main points of this model are summarized as follows: (i) Most present day introns are the relics of retrotransposons ; (ii) copies of transposable sequence were contained within the RNA primary transcript; (iii) RNA splicing activity encoded by the transposable elements processed the transcripts into exon and intron sequences; (iv) the exons were then available for translated into gene product; (v) the spliced intron were able to be reversed-transcribed into DNA and reinserted into else where in the genome. Although Doolittle (1978) argued that the de novo insertion of introns into functional genes would disrupt normal gene expression and thus would be strongly selected against at the organismic level, it was proposed that the RNA splicing might function solely to counteract the potential negative effect of introns (Hickey & Benkel 1986) A common property shared by all introns is their removal from primary transcripts by splicing. Numerous evidences have indicated that the splicing activity is controlled by introns themselves. For instances, some fungal mitochondrial group I and II introns can undergo self-splicing which depends on the structure of RNA transcripts and can propagate themselves by insertion into genes (reviewed by Lambowitz 1989) Genetic analysis of mitochondrial system

PAGE 91

79 also indicated that in vivo self -splicing depends on socalled maturase, some of which are encoded by the intron themselves. All characterized maturase function only in splicing the intron in which they are encoded or closely related intron. It has been proposed that the nuclear premRNA intron have evolved from selfinserted group II intron (Roger 1989) (Figure 2-12) Once an intron is inserted, it might take only a single base change to convert the group II intron into classical intron. Now both types of introns have similar consensus sequences. Wild Mice As a Useful Genetic Tool Part of the goal of this dissertation is to determine the distribution of evolutionary lineages of the class II Ab gene in the genus Mus and to determine how long these lineages have persisted in Mus during the evolution of Ab genes. Previous studies of the evolution of Mhc class II genes were limited in the number of species examined and limited in the number of strains tested. In this dissertation, we have extended the previous study by including twelve species and subspecies of genus Mus and the 115 H-2 haplotypes extracted from them. The "house mouse", has become the most studied animal of laboratory research probably because its habitat is closest to that of man. It has been known for some time that the major laboratory inbred strains are derived from common

PAGE 92

Figure 2-12. Proposed sequence of events that a group II intron could mutate into a classical intron. Adapted from Roger (1989)

PAGE 94

82 ancestors (Morse 1978) Study of mitochondrial DNA has indicated that most laboratory inbred strains belong to the Mus musculus domesticus type (Ferris et al. 1982) On the contrary, using a Y-specific DNA probe has revealed that the Y chromosomes of most of laboratory inbred strains, except SJL, is of M. m. musculus origin (Bishop et al. 1985) Thus the pool of segregating genes in laboratory mice is fairly limited and probably does not reflect the mouse species as it is in the wild (Guenet 1986) In fact, had it not been for wild mice, the analysis of certain genetic loci, e.g., Mta, a maternally transmitted histocompatibility antigen, would have suffered premature termination (Lindahl 1986) Depending on the degree of association with humans, wild mice can be distinguished into three groups. These are aboriginal, commensal and feral. Aboriginal mice live primarily independently of human construction. Commensal mice live in close association with man-made structure, and feral mice have resumed an aboriginal mode of life from the commensal stage (reviewed by Sage 1981) The aboriginal species include Mus spretus M. spretoides ( M. macedonicus ; M. abbotti ) M. spicilequs ( M. hortulanus ) All introduced populations of M. domesticus in the New World and in Australia, which live in native vegetation, are considered feral forms derived from commensal ancestors. Based on genetic variability of wild mice, using both DNA and biochemical markers, the Mus genus can be divided into the complex species Mus musculus and at

PAGE 95

83 least eight other species, including Mus spretus M. spretoides M. spicileqeus M. cooki M. cervicolor y M. pahari M. platythrix (Bonhoinine et al. 1984; Bonhomme, 1986; Avner et al. 1988) Mus musculus complex species itself consists of four main biochemical groups Mus musculus musculus, Mus musculus domesticus Mus musculus castaneus and Mus musculus bactrianus all of which are considered as subspecies. M. m. domesticus is present in Western Europe, the Mediterranean basin, Africa, Arabia, Middle East and has been transported by ship to the New World, Australia and southeastern Africa, leaving few regions of the earth without house mice. M. m. musculus occurs in Eastern Europe, extending to Japan across USSR and North China. M. m. bacitrianus is distributed from Eastern Europe to Pakistan and India. The distribution of M. m. castaneus ranges from Ceylon to South East Asia through the Indo-Malayan archipelago (Figure 2-13) Even though these four subspecies are quite biochemically differentiated, they may exchange genes wherever they come into contact (Bonhomme et al. 1984) One of the best understood cases is that between M. m. musculus and M. m. castaneus in Japan (Yonekawa et al. 1986; Yonekawa et al. 1988) The Japanese mouse, M. m. molossinus ^ has long been considered an independent subspecies of the house mouse. However, the restriction enzyme analysis of mitochondrial DNA (mt DNA) indicated that M. m. molossinus has two main maternal

PAGE 96

o (0 Q) •H S o 0) XI ^ o (1) p (0 (0 a e (/) o
PAGE 97

85

PAGE 98

86 lineages. One lineage is closely related to the mtDNA of the European subspecies M. m. musculus the other is closely related to the mtDNA of the Asiatic subspecies M. m. castaneus The three aboriginal species, namely, M. spretus M. spretoid and M. spicilequs may be found in sympatry with M. musculus subspecies. M. spretoides and M. spicilegus probably represent the best case of sibling species thus far discovered in mammals. They are very similar morphologically and biochemically. Yet under the laboratory conditions they can not interbreed (Bonhomme 1986) The mound-building species, M. spicilegus is found in steppe grasslands of the Carpathian basin and the Ukraine. The distribution of short-tailed M. spretoides is limited to southeastern Europe and Asia Minor (mainly eastern Mediterranean) M. spretus is found existent in the western Mediterranean, from France to Libya (Figure 2-14) Europe is not the homeland of the genus Mus. All of the Mus species and subspecies that presently inhabit the continent seem to have entered it with man (Bonhomme 1986) Certain members of genus Mus have apparently inhabited India and Southeast Asia since their origins. Three strictly oriental species, M. carol i M. cervicolor and M. cooki form a monophyletic group according to single copy nuclear DNA (sen DNA) hybridization and mtDNA data. Protein electrophoretic data also suggest that these three Asian species have speciated almost simultaneously (She et al. 1990)

PAGE 99

G m P (0 a) o (0 o o <4-l 0 c o -H +J -P w 3 0) •5 ^ •H o +J (0 (U (0 )!:^ tn (0 o c • 0) 0) s o 0^ <4-l o I CM CO 0 (0 0) 0) -H o o 0) Q) -H Mao P (0 (0 •H 3 bus

PAGE 100

88 i I

PAGE 101

89 In the past, M. fPyromys) platythrix and M. (Coelomys) pahari are considered as subgenera of Mus based on their morphology. They are not more related to Mus than they are to other well defined Murid genera. The large, spiny M. platythrix occur in India. The large, shrew-like Mus pahari is present from Sikkim to Thailand. The phylogenetic relationships deduced from DNA-DNA hybridization studies among 9 species and 5 subspecies within the genus Mus are presented in Figure 2-15. The % DNA divergence detected between the various species is shown on the left axis, the estimated time interval since genetic separation of their gene pools (speciation) is listed on the right. Similar phylogenetic relationships are obtained when these species are compared by other techniques, such as, protein polymorphisms, mitochondria DNA sequence divergence (She et al. 1989) However, estimates of the genetic distance among Mus species will vary depending on the techniques employed (She et al. 1989) There are seven levels of divergence among these species, ranging from 0.3 to 10 million years (Luckett & Hartenbege 1985)

PAGE 102

* Ui +J (0 Pi T( C (0 (0 Ul c 0) 0) J3 c p •H I/] •H x: (0 c 0 • •H +J (0 o rH 1 ^ Xi • E If) 0 H 1 fM T3 0)
PAGE 103

91 r IIOJBo > CVJ n T in o TTTCVJ i s 5 > Q ? J-J

PAGE 104

CHAPTER 3 MATERIAL AND METHOD Wild Mice The wild mouse strains used in this study are listed in Table 3-1 and were kindly provided by Dr. Franciose Bonhoimne. Geographic origins of these mouse strains are also included. The distribution patterns of these wild mice indicate that they are representative of the global mouse population. Source of Mouse Tissues and Preparations of DNA Tissue samples, such as livers and kidneys, were used for the isolation of genomic DNA. Tissue samples from different mouse strains were minced and preserved in 75% ethyl alcohol, according to the method described by Smith et al. (1987) Genomic DNA was isolated from tissues by the proteins K/sodium dodecyl sulfate (SDS) as detailed in Sambrook et al. (1988) Minced tissues are washed with PBS once, transferred to a liquid nitrogen-cooled mortar containing liquid nitrogen, and ground into fine powder. The frozen powder was added to TES buffer (lOmM Tris-HCl, PH 7.5; 5 mM ethylenediaminetetraacetic 92

PAGE 105

93 Table 3-1. Geographic Origin and Distribution of Mouse Strains STRAIN SPECIES GEOGRAPHIC ORIGIN MAI MBB MBK MBS MBT MDL MDS MPW MYL MOL CAS SEI SEG SPE SET SFM SMA STF XBJ XBS ZBN ZRU ZYD ZYP Mus musculus Mus m. m. Mus III. m. Mus m. m. Mus m. m. Mus m. m. Mus m. in. Mus iti. m. Mus m. m. musculus Mus musculus Mus musculus Mus spretus Mus spretus Mus spretus Mus spretus Mus spretus Mus spretus Mus spretus Mus spretoides Mus spretoides Mus spicilegus Mus spicilegus Mus spicilegus Mus spicilegus molossinus castaneus Austria Bulgaria Bulgaria Bulgaria Bulgaria Denmark Denmark Poland Yugoslavia Japan Thailand Spain Spain Spain Spain France Monaco Tunisia Bulgaria Bulgaria Bulgaria U.S.S.R. Yugoslavia Yugoslavia KAR COK CRV CRP PAH PTX Mus carol i Mus cookii Mus cervicolor Mus cericolor Mus pahari Mus platythrix cervicolor popaeus Thailand Thailand Thailand Thailand Thailand India

PAGE 106

94 acid (EDTA) lOOmM NaCl) with 1% SDS and 0.4 mg/ml proteinase K, which inactivates and digests the proteins, facilitating the isolation of DNA. This solution was incubated at 65C overnight. The digested DNA solution was extracted three times with Tris equilibrated phenol (PH 7.5), twice with chroloform/amyl alcohol (24:1) and precipitated with an equal volume of isopropyl alcohol. The DNA was fished out by a pasteur pipet and resuspended in TE (lOmM Tris (hydroxy Imethyl) aminomethane-HCl PH 7.5, ImM EDTA). The resulting DNA solution was quantitated by spectrophotometry and electrophoreses on 0.7% agarose gels to confirm their high molecular weight. Alternatively, genomic DNA was isolated using an automated Nucleic Acid Extractor (Applied Biosystems 340A) following manufacture s instruction. Briefly, ground fine tissue powders were suspended in 3 ml of lysis buffer (Applied Biosystems), and 0.3 ml of Proteinase K (Applied Biosystems) was added. The digested tissue was extracted with phenol/chloroform (50/50, v/v) to remove the digested proteins. The DNA was precipitated from the solution by adding sodium acetate (to a final concentration 300 mM) and 2 volumes of ethanol (95%) Precipitated DNA was air-dried and resupended in TE buffer.

PAGE 107

95 Restriction Enzyme Digestion and Agarose Gel Electrophoresis Restriction enzymes (Bgl II, BamH I, Eco RI, Hind III, Pst I, Pvu II, SSt I) were obtained from Bethesda Research Laboratories (BRL) Restriction enzyme digestions were carried out for about 18 hr. in a volume of 90 or 180 ul (microliter) containing 20 ug of DNA and 4 units of enzymes per ug (microgram) of DNA, under the conditions specified by the supplier (Bethesda Research Laboratories, Bethesda, Maryland) Completeness of digestions was monitored by using Lambda DNA coincubated with aliquots of the DNA samples. Briefly, 0.5 ug of lambda DNA was added to one-tenth volume of reaction mixture and at the end of incubation period was electrophoresed on a agarose gel. Characteristic restriction patterns of lambda DNA and a homogenous smear of genomic DNA are indicative of complete digestion. In the case of double digestion, the digestion was first performed with enzymes requiring low concentration of salt. After the completeness of first digestion, the digests were adjusted for the content of salt, subsequently, the buffer necessary for the second enzyme and enzyme were added. For convenience, the volume of double digestion were reduced by alcohol precipitation before loading into the gel. Briefly, one-tenth volume of 3 M sodium acetate was added to the digest, subsequently, 2 vol. of 95% alcohol were added, and stored at -70 C for 30 min. The precipitate was recovered by spinning at 12,000 x g in

PAGE 108

96 microfuge for 20 min. and washed with 70% cold ethyl alcohol. Later, the precipitate was dried and resuspended in 80 ul of TE. The digests were subjected to electrophoresis in 0.7% agarose gels for 16 hours at 3 V/cm in a water-cooled electrophoresis apparatus (International Biotechnologies Incorporated, New Heaven, Conneticut) Probes A 5.8 kb Eco RI fragment containing Ab ** genomic probe was kindly provided by Dr. Leroy Hood. A 369 bp Eco RI-Hind III fragment and a 911 bp Hind III-Eco RI fragments of DNA were generated from 5' and 3' regions, respectively, of Ab** genomic probe and subcloned into pUC19 (Figure 3-1) Capillary Transfer and Hybridization The restriction enzyme digested DNA was transferred from gel to Zetabind membrane (Microf iltration Products Division, Meriden, Conneticut) by Southern blotting (1975) according to manufacturer's instruction. The agarose gel was denatured in 0.2N NaOH, 0.6M NaCl for 30 min at room temperature and then neutralized by 0.5M Tris pH 7.5, 1.5M NaCl for 30 min at the same temperature. After blotting, the membranes were washed with 2 X SSC (1 X SSC = 0.15 M NaCl, 0.015 M NaCgH^Og) to remove agarose residue and then washed in O.IX SSC, 0.5% SDS

PAGE 109

10 0) X o X c as 0) 0) 0) 0) • X! O H XI O u c •H (0 <(-i o o -o 512-H (0 c o -H -p o •H u +J 0) o g o c 0) CP 0) X! -P c 0) p o u (0 i3 ^ 0) p (0 o •H •rH o (0 ( (0 0) X5 O ft (U X! P <4-l o m c o -H cr> TS C (0 o w 0) i3 ID 00 c o 0) Q) a) :2 o 0) XI ft 0) I 0) (C u o •H C 0) C 5 C O lO iH ft 0) W XI M u •H x: -p XI

PAGE 110

98 O) OQ Si CO CD CL I X LU OQ CO CQ — L lO CM Q o

PAGE 111

99 for 1 hr at 65C shaking water bath to reduce the background. Subsequently, the membranes are either dried in a 80 C vacuum oven for 3 hours or at room temperature until further use. A Hindi I I -cut Lambda DNA was included on every gel for use as a molecular-weight standard. Prehybridization and hybridization of the membranes are carried out as instructed by manufacturer (AMF, Meriden, CT) The blots were hybridized with ^^P-labeled DNA probe with a specificity of approximately 2 X 10 dpm/ug by primer extension (Bethesda Research Laboratory, Bethesda, MD) for overnight at 42C. Nonspecif ically bound probe was removed by two successive washes in 0.1 x SSC/0.1 % SDS at 65 C shaking water bath. The blots were then exposed to XAR-5 X-ray film (Kodar, Rochester, NY) using Cronex Lightening-Plus intensifying screens (Dupont, Wilmington, Delaware) Alternatively, the DNA was blotted to GeneScreen membrane (Du Pont, NEN Product, Boston, MA) Using this membrane, the gel was depurinated in 0.25N HCl for lOmin and then denatured in 0.2N NaOH, 0.6M NaCl before blotting. After the DNA was transferred onto the membrane, the membrane was dipped in 0.4N NaOH for 30-60 seconds to insure the complete denaturation of DNA. Then, the membrane was neutralized in 2X SSC adjusted with Tris buffer (PH 6.0) for 30-60 seconds. Subsequently, the DNA was UV cross-linked to the membrane for 1.5 min. The pre-hybridization and hybridization was carried out in solution containing 1%

PAGE 112

100 crystalline grade bovine serum albuinin/0.5 mM EDTA/0.5 M NaHPOi, pH 1.2/1% SDS (Church & Gilbert 1984). Genomic Restriction Mapping To construct the restriction map, after autoradiography, the blots were stripped of the genomic Ab** probe by washing in 0.1 X SSC and 0.1% SDS at 80 C for 20 min. and rehybridized with labeled 5' and 3' regions of Ab *^ probe, respectively. The fragments obtained from each region of hybridization were used to orient the restriction sites. All unique alleles were characterized by double digestion to confirm the results of restriction mapping by the above method. In some cases, the fragment sizes were assigned to either allele in Ab heterozygotes according to restriction patterns of known alleles. To facilitate comparisons among different alleles, a prototypical allele, BIO.D (d haplotype, lineage 1), C57BL/10 (b haplotype, lineage 2), BIO. BR (k haplotype, lineage 3) from each lineage was included on each gel of restriction analysis. Nucleotide Sequencing A recombinant plasmid pI-Ab'^-gpt-l containing the entire Ab*" gene plus flanking sequence was kindly supplied by Dr. Ronald N. Germain. A 9.3 kb Hind III-Eco RI fragment from

PAGE 113

101 this plasmid was subcloned in PUC 19 (PUC-K-9.3). Subsequently, both the 1.9 kb Pvu Il-Sst I and the 1.7 kb Sst I fragments (derived from PUC-K-9.3) covering the 5' and 3' portions of intron 2 of Ab*" gene were subcloned in PUC19, M13mpl8 and M13mpl9, respectively (Figure 3-2). As the 1.9 kb Pvu Il-Sst I fragment cloned into M13 was frequently deleted for various lengths due to the repetitive elements, it was cloned into Pbluescript SK(+) and Pbluescript KS(+) as well. The nucleotide sequences of both 1.9 kb PvuII-SstI and 1.7 kb SstI fragments were determined by Sanger's dideoxynucleotide termination method in both orientations using Sequenase (United States Biochemical Corporation, Cleveland, Ohio) according to manufacture's instruction without modification. Ambiguities were eliminated either by substituting dGTP with 7-deaza-dGTP or by using Tag DNA polymerase (United States Biochemical Corporation, Cleveland, Ohio) which is performed at elevated temperature (labelling reaction at 45C, termination reaction at 70C) to eliminate gel compression. Data Analysis RFLP Patterns of Ab Alleles and Their Phvloaenetic Relationships To investigate the evolutionary relationships of Ab genes assembled from 12 different Mus species and subspecies, their

PAGE 114

tn o C -P •H C O -H c Q) "O 3 Q) 0) o 0) -p c 3 0) > •H P o Q> Ok ID 0) ((-I o Q 4-1 o (0 e c o •rH o P (/} 0) u rH -H •H C (0 0^ 0) o w -p 0) T3 o x: -p c o •H p (0 c 0) 4J 0) T) •rH p o 0) rH o c >1 o 0) T3 •rH 0) >1 0) CD p (0 o CP Xi T3 0) N •H U) 0) X! -p c >1 '•H CO ta 0) 15 o u •rH c 3 •rH 3

PAGE 115

103

PAGE 116

104 restriction maps were analyzed by parsimony analysis. A total of 86 Ab alleles, which were obtained separately from this dissertation, McConnell et al. (1986, 1988), and Ying Ye are included in this analysis. Restriction site polymorphisms were used to derive the best fit of the most parsimonious network that contains the minimum numbers of character state changes necessary to account for the phylogenetic relationship among the genes. Computer Programs The computer programs used were all from the package distributed by J. Felsenstein under the name PHYLIP 3.0. These programs generate phylogenetic trees and many of them use algorithm that are designed to identify the tree(s) that incorporate minimal convergent change. However, the programs used are to some extent dependent on the input order of the character sets, and subsequently must be run repeatedly with the set input in a different order. As evolutionary trees were constructed by the parsimony method, only the most parsimonious network requiring the minimum number of character state changes were displayed. It is noted that the phylogenetic trees constructed by this program is unrooted. This analysis is based on 41 variable sites recognized by the 7 different restriction enzymes, of which 29 were phylogenetically informative.

PAGE 117

105 Polymerase Chain Reaction (PGR) Amplification Enzymatic Amplification of Genomic DNA Polymerase chain reactions (PGR) was performed with a Geneamp kit (Cetus) using the recommended buffer formulas and modified conditions. Samples were first heat-denatured at 94 G for 1.5 minutes, then cooled down to 0 G. Subsequently, DNA were subjected to 3 5 cycles of PGR, each consisting of 1 minute of denaturation at 94 C, 2 minutes of annealing at 62 G, and 3 minutes of polymerization at 72 G with 3 units of Tag polymerase. A typical PGR reaction consisting of 0.51 ug target DNA resuspended in 100 ul reaction mixture containing 10 ul of lOX buffer (lOx buffer= 500mM KGl lOOmM Tris-Gl, PH8.3, 15mM MgG12, 0.15 (w/v) ) 10 ul of dNTPs mix (2.0mM for each dNTP) 100 pm of each primer, 5 ul of dimethyl sulfoxide (DMSO) and 3 units of Tag polymerase. Finally, the reaction mixtures were overlaid with approximately 60 ul of sterile mineral oil to prevent evaporation. After PGR amplification One-tenth of reaction mixtures were electrophoresed in TBE buffer and visualized on ethidium bromide-stained 4 % Nusieve agarose gel. 5 'and 3' oligonucleotide primers (Figure 3-3) complementary to conserved regions flanking the 174 bps small insert were used to amplify 106 H-2 haplotypes in our collection. For restriction enzyme analysis, the amplified products were

PAGE 118

< < < O U EH EH < U O P o OJ Q) Q (0 u C Q) o •H x: o rH +J pt; cm 4J +J -H n •H u -P T3 g 0) (0 -P •rH (0 ^^1 (C H P (1) P -p o •H T) C •rH (0 0) 0) c C o Eh Eh U U in 0) o w ^ E H W -P *^ (0 -O X m • 0) ^ <"^^ c ^ • ^ ^H n C O Q> (w y -H ^ u cn •rH c <0 rH <4H (0 0) O c 0) (0 0) x: EH c 0) B (1) rH (0 U (U o SI' 0) 0) EH I 0) x; 0) Eh (0 0) -H rH I 3 (0 •H £1 Pn -P (0 (U rH 0) o (0 (tH u 2 (0 X3 >i ^ < 4-) EH -H -O c < rH C S -P o ^ •H tn 0) 0) c O (1) 3 •H Vh ^ ^ (0 +J '"^ ^ £! 5^ c 0) CP •r" o u c (0 +J rH C (0 W t, -H T3 O ^H o Q) H C •rH Q) (TL O MO O O ^ ft-H
PAGE 119

107 < < u u o o o o 33 o o u u u u u o < < o o Eh Eh U U O O U U O O o o Eh Eh U U U U O O Eh fH u u o o Eh Eh Eh Eh Eh Eh O O Eh Eh U U < O O O O O < < Eh Eh IT) O O Eh Eh Eh Eh U U Eh Eh O O H EH Eh Eh O O O O U U < < u u u u o o o o o o < < o o EH Eh EH Eh u u u u Eh Eh U < O Eh Eh U Eh O Eh U < < o o o < o Eh U Eh U Eh Eh O U Eh U U Eh E4 Eh Eh < U Eh O H U < u Eh 1 U U 1 U U 1 U U j CJ u j 1 Eh Eh j Kt: V O O Eh Eh •K O U U U U U Eh Eh U U < < < < u u H < 1 H U 1 o o o < < •rl u u u u H EH EH EH EH EH O O Eh U U U EH EH Eh Eh H Eh < < O U EH EH U U o o < < o o H EH U U O EH o c 0) 0) a "S •H <)-l •H H I < < U U Eh Eh U U Eh Eh U U U U O O < < < < u u T3 Si T3 JQ T3 ^

PAGE 120

108 o E-i U Eh O Eh Eh O O U < U u o o o < o Eh U U U Eh u U U H O U Eh U U Eh EH Eh Eh Eh O EH U < u Eh U o I Si o o o| o c o u o o o tl o o u >< u o o tl o o o •< u o o o *< o u Eh < o tl o tH tl xC o o o o u o o u o u u u Eh U < a o < u u Eh Eh Eh O U H H Eh EH < U Eh U < U Eh U Eh U U O < < u u u u u < Eh V < o in 5 on c 0) i g. n

PAGE 121

109 concentrated by ethanol precipitation. Precipitates were resuspended in TE buffer and digested under appropriate condition. Amplification of Central Fracnnent for DNA Hybridization To characterize the genetic nature of the central fragment bounded by two members of the Bl family in the 53 9 bp insert in lineage 3 alleles, 5' and 3' oligonucleotide primers flanking this region of DNA was designed and used to amplify the plasmid PUC-K-1.9 encompassing this region of DNA (Figure 3-4 & Figure 3-5) The amplified DNA products were estimated to be 235 bp in length and subsequently, purified from 6% polyacrylamide gel. The isolated 230 bp DNA fragments were radiolabelled by primer extension and used to hybridize the blots. ^

PAGE 122

0) 0) 0) > (U (0 c o •H p u 0 c o -p i fa ^ 00 •H T3

PAGE 124

Figure 3-5. The nucleotide sequence of 539 bp insert. Shaded areas indicate the direct repeats bordering the insert. The two Bl family repeats at the left and right ends of the insert are underlined and the central fragment bound by two Bl elements is double underlined. The 5 (GCCCCTTTAACTTTTAATAT) and 3 • (TGCTCCCAGTCCCAAGGCTTT) oligomers used for PGR amplification is shown by the dash line over the oligomer sequences. The amplified product is 235 bp long.

PAGE 125

113 a!!g!gCg AGACAG(5<5T1?TCTCT<5TGTAGCTCTGGCTGTCCTGGAACTCACTTTGTAGACCAG direct repeat GCTGGCCTCGAACTCAGAAATCCGACTGCCTCTGCCTCCCAAGTGCTGGGATTAAAGGCA "Alu-like" repeat (Bl) >5/ TGAACCACCACGCCCGGCCCCTTTAACTTTTAATATCCTCTTTGTCTTAAGATGAGTCCA Non-repetitive element GGCTGGCCTCCGTTCTCCACAATGCCCCTGCCTCAGCCTCTCATGCTCTCCACAGCAAAG CCTATATCCTTTTATGTGAAACATAGGTATATAGTTTAATGTGTTTATTACCTGCAATGG 3/< CTGGGAATGGAACCCAACCAAGGCTTCAAGGCCTCCTTCGGCCAATCTGCTCCCAGTCCC AAGGCTTTTTTTTTTTTTTTTTTTTTTCAAGACAGGGTTTCTCTGTATAGCCCTGGCTAT "Alu-like" repeat (Bl) CCTGGAACTCACTTTGTAGACCATGCTGGCCTCCAACTCAGAAATCTGCCTGCCTCTGCC TCCCGAGTGCTGGGATTAAAGCATGCGCCACCATGCCCGGCTACTTAAATTTTTTTGTTT GTTTGTTTGTTTGTCTGTTTGTTTCGAGACAGGGTTTCTCTGY direct repeat

PAGE 126

CHAPTER 4 SEQUENCE ANALYSIS OF LINEAGE 3 ALLELES Restriction Enzyme Analysis of Lineage 3 Alleles Restriction-Site Polymorphism of Lineage 3 Alleles In a previous study of Ab genes of genus Mus by RFLP analysis (McConnell et al. 1988) using the seven six-cutter enzymes: including Eco RI, Bam HI, Sac I (Sst I), Hind III, Pst I, Bgl II, Pvu II, the Ab genes were grouped into three distinct evolutionary lineages based on the extent of sequence divergence. Lineage 3 consists of four Ab alleles, BIO. BR (k haplotype) BIO. PL (u) NZW (z) and B10.CHA2 (w26) The genomic restriction mapping of these alleles was first carried out using single restriction enzyme digestion, followed by hybridization with 5' and 3' regions of Ab probe, respectively. To confirm the restriction mapping, double digest experiments was performed as exemplified in Figure 4-1 and Figure 4-2. In this study, three additional lineage 3 alleles, MDLII, DBVII, and DFCII, were revealed by RFLP analysis using the same seven restriction enzymes. The RFLP patterns and restriction maps of these seven lineage 3 alleles are shown in Table 4-1 and Figure 4-3. In both BIO. PL and NZW, there is one small insertion-deletion site (indicated by solid 114

PAGE 127

Figure 4-1. Restriction mapping performed by double digest experiment. The restriction analysis of closely related alleles was compared side by side.

PAGE 128

116 H-2 k BS S^B SB^E B S n ii ^ I II II S SB E B S J 'I I iT II Ikb. KKKKUKKKKKKKKU ^p^ss s s P^B^BBSH^^ E^BgBgE

PAGE 129

Figure 4-2. Restriction mapping carried out by double digest experiment.

PAGE 131

119 Table 4-1. RFLP Patterns of Lineage 3 Ab Alleles Strain Pst I Eco RI Bam HI Pvu II Sst I Bgl II Hind III BIO. BR 4.4 15 8.1 4.55 7.8 13 15 2.6 2.75 4.6 2.06 1.7 B10.CHA2 4.4 20 8.4 4.55 7.8 13 15 2.6 2.75 4.6 2.06 1.7 BIO. PL 4.4 15 5.4 4.55 5.2 13 8.5 2.6 2.75 4.6 7.5 2.06 2.65 1.7 MDL-2 4.4 15 8.4 4.55 7.8 13 15 2.6 2.75 4.6 2.06 1.7 NZW 4.4 15 5.4 4.55 5.2 13 8.5 2.6 2.75 4.6 7.5 2.06 2.65 1.7 DBV2 4.4 15 8.4 4.55 4.6 13 8.5 2.0 1.85 2.65 7.5 1.7 DFC 2 4.4 15 8.4 4.55 4.6 13 8.5 2.0 1.85 2.65 7.5 1.7

PAGE 132

I n o n s § •H •H a n

PAGE 133

121 I CO m Q. CO cvi a> (0 X m CO CO CO X m c ~3=co CQ ^ CO CO X CO CO m CO 1^ CO — m Eco OQ CD O o m Q. d Q

PAGE 134

122 triangle in Figure 4-3) estimated to be about 100 bp in length. Size changes smaller than this were undetected. A few lineage-specific restriction sites, denoted by encircled letters, were also revealed from restriction analysis (Figure 4-3) Distinct Intron Size Between Lineage 2 and 3 Alleles A comparison of genomic structure of one prototypic lineage 2 (b haplotype) and lineage 3 (k haplotype) alleles is shown in Figure 4-4. Among other differences, the major characteristic distinguishing lineage 2 and 3 alleles resides in the intron separating A^^ and A^2 exons. The size difference between these two introns was estimated to be 0.75 kb by comparing PvuII fragments from Ab** (3.79 kb) and Ab*" (4.6 kb) DNA Sequence of Lineage 3 Intron To clearly define the nature of the lineage 3 allele intron between A^^ and A^^ exons and the evolutionary relationships among different lineage alleles, DNA sequence analysis was performed. A recombinant plasmid PI-Ab''-gpt-l containing Ab *" gene was subcloned and relevant regions were sequenced by Sanger's dideoxynucleotide teirmination method (Sanger et al. 1980). A total of 3,735 bp of DNA sequence spanning the intron between A^^ and A^2/ through A^2

PAGE 135

0) m &> Q) as X 0) > P (0 -p c 0) u U P +j (0 0) 4J o ^ C 0) X o 0) p a 0) 00 P o ;a (0 (0 -H l/l 0) (0 (0 o (0 a (0 c o -H 4J O •H -P IQ 0) ^ O c o Ul H u (0 a
PAGE 136

124 CO CO > UJ Q. CO CO CM QO. i CO CO CO CD CD n CO > CL CQ > CL > CL CL LU O) CQ > CL m CO CD CO CQ c o > UJ CD 03 0 c CD LO O CM CD O CO

PAGE 137

125 If exon and the transmembrane region of a lineage 3 (Ab ) allele was determined. The sequencing strategy and the 3,735 bp of nucleotide sequence determined was shown in Figure 3-2 and Figure 4-5, respectively. Lineage 3 Derived from Lineage 2 The evolutionary relationships among these 3 lineages were assessed by comparing the published nucleotide sequences of lineage 1 (Ab'^) and lineage 2 (Ab^) obtained from GenBank with the lineage 3 (Ab*^) sequence determined. Several notable features about lineage 3 intron were revealed from this sequence analysis (Figure 4-6 & Figure 4-7) There are two additional inserted DNA sequences present in lineage 3 allele, and absent in lineages 1 and 2. One of these two inserted sequences is 174 bp long and its integration site starts 508 bp downstream of the A^^ exon of Ab *^ and ends at nucleotide position 681. This small insert was flanked by 11 bp direct repeats (ATTCTGATACA) The other inserted element is 539 bp in length, and its integration site started at 1141 bp 3 of A^, exon and ended at 1679 bp and was flanked by 22 bp direct repeats (TTTCGAGACAGGGTTTCTCTGT) Of great interest was that this large insert was interposed in the 861 bp retroposon, distinguishing lineage 2 from lineage 1 alleles. Probably as a result of this insertional event, there is a deletion of 130 bp in the 861 bps retroposon. The 618 bp of retroposon which

PAGE 138

0) 0) u c C (0 Q) M 0) 0) c (0 +J (0 (0 o >^ o (0 c o O X C 0) Q) ^ 0) o (U X! EH SI o ^^ 0) +J •H (/3 C (0 03 ^ aw 03 in -o 0) -P (0 C (0 •H T3 0) (U •H 0) C (in (0

PAGE 139

127 o O O o o o o o o o o o O o O O o CO o CO o VD CO o fM H n vo CO o CM n in CO as o H H H H H H CM u o U EH H U U U H Eh U U H O U < U O

PAGE 140

128 o O O O O O O O O o o o O o VO 00 O CM CO O CM vo CO o (N sf If) VO CO O pH (N "a* CM CM (N c o o I I I IT) I 0) -H < O O O O i< O < U < o < u o u < o u OHO H O U o o u u < <

PAGE 141

u 0) Xi g c a) 0) ^ O as o u <4-l og C o u -p c •H o 0) u c <0 0) Ul -H +J o a) H o •H 0) c p (0 0) Q< • c o O 0) X u 0) -rH o c < CM <0 0) c •H >1 u C O •rH P H O > u (0 0) -p o p u u 0} •H (U h V4 c I 3 0) C •H rH 0) c 3

PAGE 142

130

PAGE 143

< 0) p (0 •H c >i a) p a(0 g irH Xi „ o .5 (0 O T3 •H C >. 4J CM H VO CO 0 Ul in 0) o X ft o o Xi c •H (0 0) (0 0) (0 0) > H c *^ (0 p c 0) in 0) ft 0) u •H rH o >1 >1 H Q) ft-p W (0 o -p o c o (0 -p ^ o o I •H T( (0 0) X O Si T3 0) jC O +J (0 X3 0) U CO d ft -H O +J o •H 73 (0 o ~ ft (0 0) 0) X £1 o p ja u (0 0) (0 tn -p u Q) (0 C •H o p (1) 4J

PAGE 144

<

PAGE 145

133 are retained in lineage 3 allele share 89% sequence identity with the retroposon sequence of lineage 2 (Figure 4-8) indicating that lineage 3 allele is derived from lineage 2. The nature of retroposon insertion as shown by the generation of a direct repeat bordering the inserted sequence demonstrates again that the lineage 3 allele is generated from lineage 2. The result of this sequence analysis including the relative location of various retroposon insertions and the percentage of nucleotide sequence homology from corresponding region, is summarized and shown in Figure 4-9. Bl family repeats in lineage 3 alleles A comparison of the 174 bp inserted sequence with DNA sequences from GenBank indicates that it is highly homologous to the Bl family of Alu-like repeat of rodent (Krayev et al. 1980). It is characterized by an A-rich tract at its 3' end and contains putative RNA polymerase III promoters as indicated by box (Figure 4-6 and Figure 4-10) A consensus RNA pol III promoter sequence compiled by Galli et al. (1981) from functional tRNA and ribosomal RNA genes is shown on the top of the box. There are also another two members of Bl family, identified by sequence analysis, at both the left and the right ends of the large 539 bp insert. However, these two Bl family repeats do not have terminal direct repeats. Interestingly, the first 16 residues of left end Bl repeat also form part of direct repeat flanking this large insert.

PAGE 146

0) (0 tJ^ u
0) (M c
PAGE 147

Ab^ 135 Limits: 5190-5789 Ab Limits: 1702-2301 5190 ATAGCCCTGGCTGTCCTGGAACTCACTCGGTAGACCAGGCTGGCCTCGAACTCAGAAATC I !!!! I !'!!!!!!!!! MM M I I I i i i i i i i i i i i i i i i mm irmimiJL M M M I MM I M M M I MM ATAGCCCTGGCTGTCCTGGAACTCACTCGGTAGA CA GATGGCCTC AACTCAG AATC 1702 CACCTACCTCTGCCTCCCGAGTGCTGGGAGTAAAGGTGTGCACCACCACTGCCCGGCGAA I I I I I I I I I I I ! ! > < M m m m m m i m i i I M M^l I I M I I Ml M M M M M M I Ml II CACCTGCCTCTGACTCCCAAGAGCTAGGATTAAAGGTGTGCACCATCACCACCCGGCTAA ACATTTTAATAGATATTTTCTTCATTTACATTTCAAATGCTATCCCAAAAGTCCCCTATA I I I I I I I I I !!!!!!!!!!!!!!!!!'< < ii ii ii ii i ii ii ii M I I II M M II II II II II I II II II I I II II I II II I II II II I II II I ATTTTTTATTAGATATTTTCTTCATTTACATTTCAAATGCTATCCCAAAAGTCCCCTATA CCCTCCTCCCCCGCACCGCCCTGCTCCCCCTACCCACCCACTCCCACTTTTTGGCCCTAG M I II II II II I I I II II II II II II II M I III II II II II I I M II I I I I II II I I I I M I I I I I I CCCAC CCACCCTGCT CCCCTACCCACCCACTCCCGCTTCTTGGCCCTGG CGTTCCCCTGTACTGGGGCATATAAAGTTTACAAGACCAAGGGGCCTCTCTCCCCAATGA j I I I I I I I I I !'!!!!!!!!!!! M II I i ii i ii i ii i ii ii ii ii i Ml I I Ml I II II II I MM II II II CATTCCCCTGTACTGGGGCATATAAAGTTTACAAGACCAA GGGCCTCTCTCCCCAATGA TGGC TGACTAGGCCATCTTCTGCTACATATGCAGCTAGAGACACGAGCT CTGGGGGTA I'll I I I I I 11 I I I I I !!!!!!!!!!! I I > m ii i i ii i i i mm m l/lJLi^JL-i il M 11 II II II II II I 11 II I I II II II II II II I I I I II II II TGGCTTGACT GGTCATCTTCTGCTACATATGCAACTAGAGACACGAGCTCCTGGGGATA CTCGTTAGTTCATATTGTTGTTCCACCTATATGGTTGTAGACCCCTTCAGCTCCTTGGGT !!!!!' I M I II II II II II I II II I I I II II I I II I II I I II I II II II II II II I I I II II II II I I I II II II I I I I I TTGATTAGTTTATATTGTTGTTCCACCTATAGAGTTGCAGACCCCTTCAGCTCCTTGGGT ACTTTCTCTAACTCCTCCATTGGGGGCCCTGTGTTCTATCCTATAGATGACTGTGAGCAT I I I I I I I I I I I I I I I I I I 11 11 II M I! M M I M II I I I I I MM II II II II I II I I I II II II II II I II II II II II II I II I II I II I I II II II ACTTTCTCTAACTCCTCCATTGGGGGCCCTGTGTTCCATCCTATAGATGACTGTGAGCAT CCATTTCTGTATTTGCCAGGCACTGGCATAGCCTCA CAGGGTCC M II II II II I I I I II II I I II II I I II II I M I M I I I "'"Mill II I I I II I I I I I I I I I CCACTTCTGTATTTGCCAGGTA TTGCATAGCCTCACAAGAGACAGTTATATCAGGGTCC TTTCAGCATAATTTTGCTGGCATATGCAATAGTGTCTGCGTTTGGTGGCTGATTATGGGA I I I i i I I I I I I I I I I I I I I I I I! M !! I M I M M II II I II II II I II I I II I II II II JLii '"''''''' II II II I I M M II II I I I II II I I II I II I II II II I I TTTCAGCATAATTTTGCTGGCATATGCAATAGTGTCTGCGTTTGGTGGCTGATTATGGG^ TGGATCCCCGGGTGGGGC II M II II II II I I II I I M I I I I II II II II II II TGGATCCCCGGGTGGGGC Matches = 548 Mismatches = 34 Unmatched = 36 Length = 618 Matches/ length = 88.7 percent

PAGE 148

U <<-i •H O p e o O 0) W 0) > •H rH +J i£, -H i -p o +j o u e a 0) It M
PAGE 149

137

PAGE 150

C o O (0 fM (0 c Ul
PAGE 151

139 (Tl ID H o -tn o u EH o O u E-i H < < u o Eh I u u Eh I o o o o o o o o U Eh U I O 1 1 1 << 1 1 1 U 1 1 1 < 1 1 1 U Eh 1 Eh < 1 1 1 Eh I 1 1 U 1 1 1 O 1 1 1 U 1 < 1 O 1 1 1 << 1 1 1 O 1 1 1 U 1 1 1 O 1 1 1 < 1 1 1 U 1 1 H < 1 1 1 O 1 1 1 O 1 1 1 < 1 1 1 U 1 1 1 O 1 1 1 Eh I 1 1 Eh I 1 1 O 1 1 1 < 1 1 1 O 1 1 Eh I O 1 1 1 i< 1 o < < < U 1 ^ I 1 i j j U 1 H 1 O 1 U 1 H 1 U 1 1 < U 1 O 1 <: 1 u O 1 u U 1 O 1 O 1 < 1 o O 1 u U 1 1 o EH Eh I H H 1 O O 1 0
PAGE 152

140 Sequence data also indicates that the putative RNA polymerase III split promoters can be recognized in these two members of Bl family (Figure 4-10) It is worth noting that the transcriptional direction of the latter two Bl family repeats is opposite to that of Ab'' gene (Figure 4-7) An alignment of these three Bl family repeats identified in these two inserted sequences with the Bl family consensus sequence (Kalb et al. 1983; King et al. 1986) is shown in Figure 4-10. The sequence homology ranges from 97% to 93%, with the Bl member in the small insert having the highest (97%) and Bl member of the right end of the large insert being the lowest (93%) Most of the sequence divergence is due to single base substitution. Mismatches between the putative RNA PolII split promoter and consensus sequences are designated by asterisks (Figure 4-10; Galli et al. 1981) The structure and sequence of the 539 bp insert was analyzed in further detail The 539 bp insert defines a new family of murine repeat In order to understand the genetic nature of the central fragment of this 539 bp inserted element, an extensive computer search of DNA sequence library of GenBank was undertaken. No homologous sequences have been found. To determine the genomic distribution of the core portion of the 539 bp insert, a DNA fragment of 235 bp confined within the middle portion of the insert was amplified by PGR and hybridized to restriction enzyme digested genomic DNA. The

PAGE 153

141 pair of oligomers (5' GAAATCCGACTGCCTCTGCC 3', 5' TGCTCCCAGTTCCCAAGGCTTT 3') used to amplify and the resultant length of amplified products as well as it nucleotide seguence are shown in Figure 3-4. The results of the Southern analysis are shown in Figure 4-11 and Figure 4-12. Surprisingly, the hybridization of the isolated 2 35 bp fragment gave a distinct band pattern in all of strains studied. As expected, the size of one of the two bands in lineage 3 alleles, e.g. BIOPL, NZW was consistent with their genomic restriction maps. To locate their positions in genomic structure, the same membrane hybridized with a Ab** probe was also included for clarity (Figure 4-11) It is worth mentioning that the hybridized bands are polymorphic among all three lineage alleles studied (Figure 4-11) This result suggests that this 539 bps inserted seguence belongs to a new family of repeated seguences. Since the core portion did not display evidence of integration, it is likely that the core portion and its adjacent Bl family repeats transpose as a single unit, and the 22 bp host-derived repeats are generated as a conseguence of this insertion event. Ab Genes Can Be Divided into 4 Lineages Defining Evolutionary Lineage 23 Although the DNA seguence analysis of lineage 3 allele (Ab*") clearly indicates that lineage 3 is derived from

PAGE 154

ID TJ fvj N •H (0 ^ ^1 •H +J C 0) •H (0 IS < Q 0 •H o c 0) <]> 0) +J C w O ^ -H (0 ? • 0) iH U 0) (0 S -9 0) o 0) W Q) •o > Q) ••H 4J H -H O I +)-H Q) Q) -H M U 0 I £! CP C -P -H O -H Cm C

PAGE 155

143 dao AdO Xld qNVd 2 PNVd sax naz dAZ QAZ 13S rax san dao AdO Xld QNVd X z PNVd sax naz dAZ QAZ 13S rax lAkN saiN t I ) ) 11 B B I I ~ a> (6 CO O cvi c\i "O CO. < CO in o E CO c o c

PAGE 156

I c o c a 0) Si X! If) -p •H (0 P c 0) •H (I) X 0) X! -P (1) Q. N •H .. •H ^ o (0 o (0 w c o •H -p (0 N •H T( •H X! I D -o 0) -p en 0) CP •rH o u 0) o w 0) rH XI o Q WW C (U 0) rH 0) > •rH -P -H P 0) 0) o 0) > H H P rH u •H Q) 0)

PAGE 158

146 lineage 2 by two additional insertional events, it is unlikely that these events occurred in the same region simultaneously. As one of the inserted sequenced (Bl repeat) is only 174 bp in length, it is tempting to speculate that its insertion is beyond detection on a 0.7 % agarose gel. To examine this possibility, PGR technique is exploited to amplify the genomic DNA using a pair of synthetic oligomers ( 5 • CCTTGAGGGCCACGGTTGTC 3 5 GATACCCCCAGAGCCTCTCA 3 ) (Figure 3-3) The rationale for this PGR experiment is as follows: any allele that contains this 174 bp Bl family repeat will be amplified as 375 bp fragment, while, alleles without this insert will display a 192 bp fragment (Figure 3-3) A total of 106 H-2 haplotypes were tested by PGR amplification. A panel of DNA samples representing the different species and subspecies of genus Mus amplified by PGR were run on a 4% Nusieve agarose gel (Figure 4-13) The results of these experiments can be summarized as follows: First, as expected, all lineage 3 alleles, including BIO. BR, AKR, B10.GHA2, BIO. PL, NZW, MDLII, DFGII DBVII amplify a band around 375 bp on a 4% Nusieve agarose gel (Figure 4-14) Gertain recombinant inbred strains, e.g. BIO.MBR, B10A(4R) BIO.TL exhibit a 375 bp band as well (Figure 4-14) The outcome of these recombinant inbred strains is not unexpected as these recombinants contain I -A subregion derived from lineage 3 alleles, specifically from k haplotype. All lineage 1 and 2 alleles, with the exception of one allele, MBBII, exhibit a

PAGE 159

Figure 4-13. PGR amplification of DNA samples from 12 species and subspecies of Mus. H: lambda Hind-digested lambda markers, P: Pst I-digested lambda markers, Kb: kiolbase markers, m. dom. : M. m. domesticus m. mus.: M. m. musculus spretus: M. spretus sptd: M. spretoid spic: M. spicilegus caroli: M. caroli cooki: M. cooki cerv: M. cervicolor cervicolor cerp: M. cervicolor popeaus pahari: M. pahari plat: M. platyhrix

PAGE 160

148 •D D-O O O ^ rr 03 CD (D O ^ spi 3 3 a CD a — • f f' O Q. tus lUS. ohn. rn n n r — 1 n 1 PPCCCKZZXXSSMMMBBNN TARROARBBBEEBBDZNOO -rXX XHPVKRUNSJGI SBLOCNDdK^PH ,506 396 344 298 220 200 154 142 75 4% Nusieve agarose gel

PAGE 161

Figure 4-14. PCR amplification of DNA samples from lineage 3 alleles and recombinant inbred strains. V

PAGE 162

150 564 506 396 344 298 220 200 154 142

PAGE 163

151 amplified DNA fragment of approximate 192 bp. Unexpectedly, MBB II is a lineage 2 allele identified by RFLP, and yet it apparently contains the 174 bp insert (Bl repeat) in the corresponding region as lineage 3 alleles does. In fact, before the PGR experiments were ever completed, the Southern blot analysis and the restriction mapping already indicated the unusual SStI restriction fragment of MBBII (2.3 kb vs 2.1 kb) (Figure 4-15 & Table 5-1) To confirm that this lineage 2 allele (MBBII) contains this Bl family repeat, the PCRamplified product was isolated and subjected to restriction enzyme analysis. The results of this restriction analysis are shown in Figure 4-16. Four DNA samples, k haplotype (lineage 3), d haplotype (lineage 1), MBB, MBS, crucial to this analysis were included in this experiment. MBB DNA sample was heterozygous with respect to lineage 1 and lineage 2, and MBS heterozygous for lineage 1 and 3 (Figure 4-15 & Table 5-1) A conserved Hinc II site found in lineage 1 and 2 but not in lineage 3, would display two bands, 90 bp and 100 bp, respectively, upon digestion (Figure 3-3). However, the restriction analysis clearly point to the absence of HInc II in MBBII allele. Moreover, the Hinf I site conserved in all three lineages is also identified in MBB II allele as shown by the production of two fragments, 12 0 bp and 255 bp, in length upon digestion. Taken together, the findings of this analysis demonstrate that although MBBII allele belongs to lineage 2, it does contain the 174 bp insert in the

PAGE 164

c •H 10 m 0) x> o u Q> rH o X! +J -H •H ^ W >i.5 c o •H +J o H P m 0) T3 c (0 73 XI • (U o ^ u 0) a a -P 0) -p < 0) u o CO c o H CP •H U in H I c o •H +J o 0) -H 3 -p •H 0) n c (0 in (0

PAGE 165

153 1 O < CO 1 w • 5 O -J t 2 > -1 % o • a 2 Q CO 2 Q -1 a. T3 < 1 CO 2 OQ K 2 DQ CO • 2 QQ ^ • ^ m CO j 1 1 ^iiiiiiimigiiiiiiiiii o a < in

PAGE 166

Figure 4-16. Restriction analysis of PCR-amplif ied products. Letter designationa are as follows: d: lineage 1 (Ab ) k: lineage 3 (Ab'^) MBB and MBS are heterozygous: lineage 1, 2 and lineage 2, 3, respectively. H: Hind Ill-digested lambda markers, P: Pst I-digested lambda markers, Kb Ladder: kilobase markers

PAGE 167

155 Hinc II I 1 M M B B d S B Hint I I 1 M M B B S B K 1 1 • • 3 2 M M B B S B K d iQ. Q. 0 A A P H 506 396 344 298 220 200 154 142 75 4% Nusieve agarose gel

PAGE 168

156 corresponding region of lineage 3 allele. As a consequence of these finding, the MBB II allele is assigned to lineage 2B, which consists of a MBBII allele only. And the original lineage 2 is now designated as lineage 2A. ^ 4 Evolutionary Lineages of Ab Genes The evolutionary relationships of these four lineages of Ab genes in the genus Mus is exhibited in Figure 4-17. In summary, the major characteristic distinction among four evolutionary lineages resides in intron 2 separating the A^^ and A^2 exons. Lineage 2A allele was derived from a lineage 1 allele by an 861 bp retroposon insertion. Subsequently, another Bl family repeat insertion, composed of 174 bp, occurred at intron 2 in a lineage 2A allele, thus generating lineage 2B. Eventually, a newly arisen family repeat, consisting of 539 bp, integrates into a lineage 2B allele, thus producing lineage 3. It is noteworthy that these four distinct lineages can be identified in wild mouse populations. However, all lineages except lineage 2B were found to be present in laboratory inbred strains. The unusual scarcity of lineage 2B alleles is illustrated by the fact that MBB II is the only 2B allele of 44 lineage 2 alleles in our collection.

PAGE 169

(0 0) 0) 0) p -p

PAGE 170

158 OQ LU X o M O a 2 c % .2 Q.
PAGE 171

CHAPTER 5 EVOLUTION OF MHC CLASS II GENE POLYMORPHISMS RFLP Analysis of Ab Genes Within Genus Mus One of the goals of this dissertation is to find out the distribution of Ab lineages among the various species and subspecies in the genus Mus and to determine how long these Ab lineages have persisted in the genus Mus Mouse is an excellent system in which to measure the time of divergence as the phylogenetic relationships of various species and subspecies have been studied extensively by various techniques (She et al. 1990a) Previously, McConnell et al (1988) have shown that Mhc class II Ab genes can be grouped into three evolutionary lineages on the basis of retroposon polymorphisms. However, the number of species and subspecies of Mus included in their analysis was limited in scope. The results of their analyses in terms of lineage distribution of Ab genes in various species and subspecies are shown in Table 2-1 and Figure 2-8. In this dissertation, by Southern blot hybridization, DNA sequence analysis and PCR amplification, 115 Ab genes have been analyzed and reorganized into four distinct lineages. Furthermore, this analysis expands the molecular genetic study of Ab genes to 12 separate species 159

PAGE 172

160 and subspecies in the genus Mus. The mouse strains and their geographic origins included in this study are listed in Table 3-1. The mouse genomic DNAs were digested with seven restriction enzymes (Eco RI, Bam HI, Hind III, Bgl II, Pst I, Pvu II, SSt I) and analyzed by Southern blot hybridization with a genomic Ab'' probe. The orientation of restriction fragments was determined by stripping and hybridizing with 5' and 3' regions of Ab probe, respectively. A typical mapping experiment is shown in Figure 4-15. In each case, the restriction mapping of Ab alleles was further confirmed by double digestion experiments. With regards to DNA samples being heterozygous for Ab gene, the assignment of RFLP pattern to individual allele was made possible by comparing restriction fragments with other known alleles. The RFLP patterns of individual Ab alleles and their corresponding restriction maps are shown in Table 5-1 and Figure 5-1. Close inspection of restriction maps of these Ab alleles indicate that the majority of these restriction site polymorphisms are due to insertion/deletion and point mutations, resulting in the creation or loss of restriction sites. It is evident from restriction analysis that there is no correlation between restriction site allele and the distribution of species or subspecies. A total of 86 Ab alleles is revealed from the analysis of 115 H-2 haplotypes (Table 5-1 & Figure 5-1). Only unique Ab alleles are listed in Table 5-1. Even so, similar or closely-related alleles were frequently found present in

PAGE 173

161 Table 5-1. RFLP Patterns of Ab Alleles From 12 Species and Subspecies of Genus Mus. Strain Pst I EcoRI BamHI Pvu II Sac I Bgl II Hind III MAI 4.80 MBB-1 3.89 MBB-2 4.80 MBK 3.89 MBS-1 3.89 (same as MBK) MBS-2 4.80 MBT 4.80 MDL I 4.80 MDL II 4.40 MDS 4.80 MPW 4.80 >12.0 7.6 2.12* 2.0* >12.0 9.0* 2.6* 6.38 7.6§ 2.12* 5.4 9.0* 2.6* 5.4 9.0* 2.6* 6.38 7.6 2.12* 6.38 7.6 2.6* 2.06* 6.38 7.6 2.12* 2.0* >12 8.4 2.6* 2 06* 6.38 7.6 2.6* 2.12* 6.38 7.6 2.6* 2.12* 3.79* 5.2@ 2.75@ 3.5* 2.1 1.58 2.89* 5.2@ 2.75@ 3.8* 2.65 4.83* 6.7§ 2.75@ 4.6* 2.3 1.8 2.89* 7.8§ 2.75e 3.8* 2.89* 7.8@ 2.75@ 3.8* 3.79* 5.2@ 2.75@ 3.8* 2.1 1.58 3.59* 7.3@ 2.65@ 4.5* 1.58 3.79* 7.3§ 2.75§ 3.5* 1.58 4.6* 7.8§ 2.75§ 4.6* 1.7 4.83* 7.3§ 2.75@ 3.8* 4.83* 5.2§ 2.75@ 3.8* 2.1 1.58 9.0* 8.0§ 3.62§ 4.5* 12. 2§ 5.5§ 1.8 13. 6@ 8.6@ 7.2* 12. 2§ 6.2* 5.5@ 1.7 12. 2@ 6.2* 5.5@ 1.7 12.2 8.0@ 3.62@ 6.6* 9.2 8.0*§ 3.62§ 9.0 8.0 3.62§ 4.5* 13. 0@ 15.0* 10.0 8.6* 3.62§ 8.0 1.58 12.2 8.0 3.62@ 6.4*

PAGE 174

162 Table 5-1. continued Strain Pst I Eco RI Bam HI Pvu II Sst I Bgl II Hind III MYL 4.80 6.38 TTs 3.79* 8.3§ oTs sTo 2.6* 3.69* 7.3@ 9.0 7.8* *.:,-5 r 2.12* 2.75@ 4.5* 3.62@ 4.5* 2.0* 3.5* 1.58 MOL 4.80 6.38 7.6 4.83* 7.3§ 10.0 8.0 2.6* 2.75§ 3.8* 3.62@ 6.4* 2.12* 1.58 CAS 3.89 5.4 9.0 3.17* 5.6^ 11. 0@ 9.0* 2.5* 2.89@ 3.7* 2.5 2.3* 1.7 SEI 4.80 6.38 9.7*@ 3.79* 5.2@ 12.6* 8.0@ 2.0* 2.75@ 4.1* 7.6* 2.1 1.58 SEG I 4.8 6.38 7.6@ 3.91* 5.2 12.2* 8.0 2.2* 2.75§ 3.5* 3.62 4.5* 2.0* 2.1 1.58 SEG II 4.8 6.38 5.4§ 3.79* 4.8 7.6* 7.6§ (same as SPE) 2.6* 2.75@ 3.8* 3.5 7.3* 2.06* 1.58 SPE 4.8 6.38 5.4§ 3.79* 4.8 9.3* 7.6@ 2.6* 2.75@ 3.8* 3.5 7.3* 2.06* 1.58 SET I 4.8 6.38 7.6 3.79* 7.3@ 12.2 6.3 2.12* 2.75 3.8* 3.62 5.4 2.0* 1.58 SET II 4.8 6.38 5.4 3.79* 5.26 13.0 4.5 4.3* 2.75 3.8* 3.5 2.6* 1.58 SFM I 3.89 (6.40) 9.0*@ 2.89* 5.2@ 12.2 5.5@ 2.6* 2.75§ 3.8* 1.7 2.65 SFM II 4.8 6.38 7.6§ 3.79* 5.2@ 7.0 8.0@ 2.12* 2.75@ 3.5* 3.62 4.5 2.0* 2.1 1.58

PAGE 175

163 Table 5-1. continued Strain Pst I Eco RI Bam HI Pvu II Sst I Bgl II Hind III SMA I 4.8 6.38 9.7* 3.79* 7.3§ 9.0* 8.0* 3.3* 2.75 4.1* 3.62 6.9* 1.58 5.5 3.7 SMA II 4.8 6.38 7.6 3.79* 5.2§ 9.0* 2.2* 2.75 3.4* 3.62 2.06* 2.1 1.58 STF I 3.89 5.4 9.0*@ 2.89* 5.26 12.2* 6.2* 2.6* 2.75@ 3.8* 5.5@ 2.65 1.7 STF II 4.8 6.38 7.6@ 3.79* 7.3 9.0* 8.0@ 2.12* 2.75§ 3.5* 3.62 4.5* 2.0* 1.58 XBJ 3.89 5.40 8.7* 2.89* 7.8@ 12.2 6.2 >10.0 4.4 2.75 3.5* 9.0 5.5§ 2.4* 2.0* XBS 3.89 >10.0 9.0* 2.89* 7.8 9.0 6.2 2.0* 2.75 3.5* 5.5@ 1.7 ZBNl 3.89 5.4 9.0* 2.89* 7.8@ 9.30 6.2* 2.6* 2.75 4.5* 5.5@ 1.7 ZRU I 4.8 6.38 7.6 3.79* 7.3@ 9.0 8.0 3.1* 2.75@ 2.9* 3.62 11 2.12* 1.58 ZRUII 4.8 6.38 7.6 3.79* 7.8 9.0 8.0 3.1* 2.75@ 4.2* 3.62 10.0 2.12* ZYD I 3.89 5.4 9.0 2.89* 7.8 9.2* 6.2* 2.6* 2.75@ 4.5* 5.5@ 1.7 ZYD II 4.8 6.38 7.6 3.79* 7.3 8.4* 8.0§ 2.2* 2.75@ 3.6* 3.62 2.0* 1.58

PAGE 176

164 Table 5-1. continued Strain Pst I Eco RI Bam HI Pvu II Sst I Bgl II Hind III ZYP I 3 .89 5.4 9.0*§ 3.1* 2.89* 2.75@ 7.8e 3.5* 9.2* 6.2 5.5§ 1.7 ZYP II 4.8 6.38 7.6@ 2.2* 2.0* 3 .79* 2.75@ 7.3§ 2.9* 1.58 9.0* 3.62 8.0@ 9.4 KAR I 3 .89 7.2 10.0* 4.4 2.89* 1.85 0.9§ 4.1* 3.8 11.7 6.2* 5.5 1.7 KAR II 4.8 7.2 7.6 2.3* 4.2* 7.3@ 4.1* 1.58 11.7 8.0 4.5* COK 3 89 6.4 5.4@ 3.6* 2.6* 2.89* 2.75§ 5.2@ 3.8* 2.9 12.2 6.6 5.5§ 1.7 CRV 3.89 9.8 5.4 3.6* 2.6* 2.89* 2.75§ 5.2@ 4.6* 2.65 12.2 7.0 5. 6§ 1.7 CRP I 3.89 6.4 5.4@ 3.6* 2.5* 2.89* 2.75 5.2e 3.8* 2.9 2.65 12.2 9.0 6.6 5.5§ 1.7 CRPII 3.89 >10.0 5.4@ 3.6* 2.5* 2.89* 2.75 3.8* 2.90 (9.0) 6.6 5.5@ 1.7 PAH 3.39 >10.0 9.0§ 4.2* 2.89§ 2.75 5.2@ 3.8* 2.2 8.8* 6.5 10.8 PTX 4.14 3.68 >10.0 5.4§ 3.6* 2.5* 5.7*@ 5.7@ 3.65@ 3.5* 2 65 12.2 11.7 6.7* 5.9* 1.7 @ indicates restriction fragments that hybridize to 5' region of Ab probe. indicates restriction fragments that hybridize to 3 region of Ab probe. indicates restriction fragments that have double dosage.

PAGE 177

165 Table 5-1. continued Strain Pst 1 Eco Rl Bam HI Pvu II Sst 1 Bgl II Hind III B10.D2 3.89 574 97o 2.89 sTl 12 2 672 2.6 1.85 3.8 2.5 0.9 2.65 1.7 BIO.F 3.89 5.4 5.4 2.89 5.2 11.7 10 3.6 2.75 3.8 5.5 2.6 2.65 1.7 BIO.Q 3.89 5.4 5.4 2.89 5.2 11.7 10 3.6 2.75 3.8 5.5 2.6 2.65 1.7 BIO.RIII 3.89 5.4 9.0 2.89 5.2 12.2 6.2 2.6 2.75 3.8 5.5 2.65 1.7 BIO.SM 3.89 18 9.0 2.89 5.2 12.7 8.5 2.6 2.75 3.8 5.5 2.65 1.7 B10.SAA48 3.89 chk 9.0 2.89 7.8 12.7 6.2 2.6 2.75 3.8 5.5 1.7 B10.KEA5 3.89 5.4 5.4 2.89 5.2 11.7 10 3.6 2.75 3.8 5.5 2.6 2.65 B10.CAA2 3.89 5.4 5.4 2.89 5.2 11.7 10 3.6 2.75 3.8 5.5 2.6 2.65 B10.STC77 3.89 5.4 5.4 2.89 5.2 11.7 10 3.6 2.75 3.8 5.5 2.6 2.65 B10.BUA16 3.89 5.4 9.0 2.89 5.2 11.7 6.2 2.6 1.85 3.8 5.5 0.9 2.65 1.7* METKOVICl 3.89 5.4 9.0 2.89 5.2 12.2 6.2 2.6 2.75 3.8 5.5 2.65 1.7 METK0VIC2 3.89 5.4 5.4 2.89 5.2 11.7 8.5 3.6 2.75 3.8 5.5 2.6 2.65 1.7

PAGE 178

166 Table 5-1. continued Strain Pst I Eco RI Bam HI Pvu II Sst I Bgl II Hind III t"^ 3.89 5.4 9.0 2.89 5.2 12.7 6.2 2.6 2.75 3.8 5.5 2.65 1.7 t"^ 3.89 18 5.4 2.89 5.2 12.2 10 3.6 2.75 3.8 5.5 2.6 2.65 1.7 tw32 3.89 18 5.4 2.89 5.2 12.2 10 3.6 2.75 3.8 5.5 2.6 2.65 1.7 BELGRADEl 3.89 5.4 9.0 2.89 7.8 12.2 6.2 8.0 2.75 3.8 5.5 1.7 BRN02 3.89 5.4 n.d. 2.89 5.2 11.7 n.d. 2.75 3.8 2.65 VIB0RG5 3.89 5.4 5.4 2.89 5.2 11.7 8.5 3.6 2.75 3.8 5.5 2.6 2.65 1.7 VIB0RG8 3.89 5.4 5.4 2.89 5.2 11.7 8.5 3.6 2.75 3.8 5.5 2.6 2.65 1.7 B10.CAS2 3.89 5.4 9.0 2.89 5.2 11.7 6.2 2.6 2.75 3.8 5.5 2.65 1.7 THONBURIl 3.89 5.4 11 2.89 5.5 12.7 11 2.6 2.75 3.8 2.5 2.3 1.7 TH0NBURI2 3.89 5.4 11.0 2.89 5.2 11.7 11 2.6 2.75 3.8 2.5 2.3 1.7 PANCEVO-d 3.89 5.4 9.0 2.89 7.8 12.2 6.2 2.0 2.75 3.5 5.5 1.7 BIO 4.80 6.38 7.6 3.79 7.3 9.0 8.0 2.12 2.75 3.5 3.62 4.5 2.0 1.58

PAGE 179

167 Table 5-1. continued Strain Pst I Eco RI Bam HI Pvu II Sst I Bgl II Hind III BIO.M 4.80 6.38 7.6 4.83 7.3 10 8.0 2.12 2.75 3.8 3.62 6.6 2.0 1.58 BIO.WB 4.80 6.38 7.6 4.83 7.3 11 8.0 2.12 2.75 3.8 3.62 6.6 2.0 1.58 BIO.S 4.80 17 7.6 2. 12 2.0 3.79 2.75 5.2 3.8 2.1 1.58 9.5 3.62 8.0 7.4 B10.STC90 4.80 6.38 9.7 3.79 2.0 2.75 7.3 3.8 1.58 9.0 3.62 8.0 4.5 W12A STU AZROUl 4.80 6.38 9.7 2.0 4.8 6.38 9.7 2.0 4.80 6.38 7.6 2.12 2.0 FAIYUM3 4.80 6.38 7.6 2.12 2.0 FAIYUM4 4.80 *6.38 9.7 2.0 FAIYUM5 4.80 *6.38 12.2 2.12 JERUSALEM3 4.80 chk 7.6 2.12 2.0 3.79 2.75 3.79 2.75 3.79 2.75 3.79 2.75 3.79 2.75 3.79 2.75 3 79 2.75 5.2 3.8 2 1 1.58 5.2 3.8 2.1 1.58 7.3 3.5 1.58 7.3 3.8 1.58 5.2 3.8 2 1 1.58 12.6 5, 3, 2, 1, 7, 3. 1. 2 8 1 58 3 5 58 12.6 9.0 3.62 10.0 3.62 12.6 12.6 9.0 3.62 8.0 7.4 8.0 7.4 8.0 4.5 8.0 6.6 8.0 7.0 8.0 7.0 8.0 4.5

PAGE 180

168 Table 5-1. continued Strain Pst I Eco RI Bam HI Pvu II Sst I Bgl II Hind III JERUSALEM4 4.80 6.38 7.6 4.83 7.3 11.0 8.0 2.12 2.75 3.8 3.62 6.6 2.0 1.58 METK0VIC3 4.80 12.0 7.6 3.79 5.2 9.5 8.0 2.12 2.75 3.8 3.62 7.4 2.0 2.1 1.58 t"^2 4.80 6.38 9.7 4.83 7.3 13.6 8.0 2.0 2.75 3.8 7.0 1.58 TT6 4.80 6.38 9.7 4.83 7.3 13.6 8.0 2.0 2.75 3.8 6.6 1.58 BRNOl 4.80 6.38 7.6 4.83 5.2 11.1 8.0 2.12 2.75 3.8 3.62 7.4 2.0 2.1 1.58 i"^' 4.80 6.38 9.7 4.83 7.3 13.6 8.0 2.0 2.75 3.8 7.0 1.58 t"^ 4.80 6.38 7.6 3.79 7.3 9.0 8.0 2.12 2.75 3.5 3.62 4.5 2.0 1.58 f. CADIZl 4.80 6.38 9.7 3.79 5.2 9.5 8.0 ... 2.38 2.75 3.8 3.62 7.3 W 2.1 1.58 PANCEVO-b 4.80 6.38 7.6 3.79 7.3 n.d. 8.0 2.92 2.75 2.8 1.58 n.d.tdata is not available.

PAGE 181

H I in s u > •H M 0) O (0 0) H 0) CO o 10 {X (0 e c o •rH -P o -H ^ •P U) 0) I in 0) CP

PAGE 182

170 B10.D2 MBBI MBK CAS SFMI STF I BS Bg PvE r 1 1 1 1 II III I /^SPvH 1 III 1 III II /"Pv B S H Bg II II II BS H Bg Pv III ^1 |_J 1 LJ S PvH SJ III ill 1 >v E B S Bg L_ 1 1 1 BS H Bg P\€ II 1 M 1 — 1 1 1 — 1 1 P PvH 1 1 1 J 1 I 1 B E B S H Bg II II II BS Bg P\e II ^11 SPvH S III 1 >v E B S Bg 1 II 1 BS H Bg Pv III ^1 SPvH S III 1 1 >v B S Bg 1 1 1 BS H Bg PvE III ^ M S PvH Si Ml 1 ^E B S H Bg \\\ II II XBJI XBJ II XBS ZBNI ZBN II ZYD I ZYP I BS H P>€ PVH S p-H Pv E B S BS H Pv L PVH S p H ] Pv 0 BS BS H Bg Pv PvH S i Pv B B H H HBg BS 1 1 H 1 PvE 1 1 > PvH 1 1 R ^H B B 1 S 1 H 1 B 1 Pv > Pv P' S r B v B s BS 1 1 H 1 P\€ 1 1 PvH 1 1 r' I"' B 1 -ni PvH 1 1 •1 111 >v E SB H 1 H

PAGE 183

Figure 5-1. continued 171 KARI COK CRV CRPI BgPv Bg BS H EiPv Bg BS H E Pv B S H Bg HBg B ES I 1_ H Bg 1l Bg BS H E Pv BS PvH SJj II II li B S HBg BS H ^SPv CRPII III II BSPvH B S H PAH PTX I BS H Pv Skv S. HS B B S Pv BS H S Pu"Pv B BS PTX II U P^Hpv Pv BS H sjr ^ _j u \ JL BS 1 kb BS H Bg^PvE B S PvH SJl riE B10.F U_J 1 M I I I II II III n C.. B S Bg B10.RIII BS H Bg^P\E J 1 I I B10.SM BS H Bg^P\E B S HBg B S Bg H H BS H Bg^P\E B 1 0.SAA4aJ I 111 S PyJH SJj riE B S H Bg LAJ ILiU M II \ I 3'E site 5.0 Kb past H BS Bg^PvE B1Q.BUA I I 111 Pv, S P\H riE B S H Bg BS Bg^P\E MET-2 U I i I Pv fP^^ S P^4^ SJ| ^E B S H Bg

PAGE 184

Figure 5-1. continued 172 BS B10.D2 Bg PvE^ TW5 TW8 BS H Bg P\E BS H Bg PyJE LLJ ^ I I BS H Bg PvE BEL1 L1_J ^ I I B S H Bg B S H Bg B S Bg S u 3'H&E 3.2,6.6 Kb past Bg S H Bg B BS H Bg PME B1 O.CAS S I I ^11 S PvH S J| B S B S Bg PvE THON 2.5 Kb BS H Bg P\€ PANCE p g I BIK/g BS H Bg Pv 38CH III ^1 SPvH S 1| HBg S PvH S J rtE H S B dmaU l)VKb BS H Bg P\E BEP-1 III ^11 Bg PvE^ ^ M Pv /^rPv / ^ s PvH s ir ^E SB^ B S H Bg p^H SSPvH "^^l^E S B Bg BS H Bg P\e DSD-1 II I ^11 PsU"PV BS PvH S J ^E B S J HBg H 1 Kb

PAGE 185

Figure 5-1. continued 173 C57BL/10J E B P^HP^' BS H B^Y P S S^^r ri E B S H Bg MAI BS H B^v P s P>Bg J^J LJ_J I I I B P SHPv dE B S H Bg SB H B^y p S Pv S MBB II 1 B P Sh Pv BE MBS II MBT MDS MPW MYLII MOL SEI SEGI SEGII SPE 1 Kb g or BS H B^y p s P>BgS*' ij( JJ \ Llij I II 1 1 ill BP?" BE BS H B^Y p P\BgS LLJ LLU L E BP BS H B^y p P\Bgs Sh Pv BE B S BS H B^y p s P>BgS B P 1 Sh Pv BE B S ShPv B^y P P\8gs B P SHPv B BS H B^y p P\Bgs B P 5t Sh Pv BE B S E pfHPv BS H Py P S Pv S S b( E B S LLJ llJ LJ \ ill ill I I B H B^y p S PxBgS B P ShPv 1^ H BS I I I Bg E Py p PvBgs B P ShPv H3g H Bg S^Pv bIe b S Bg Bg H H Bg E BP BS H BsPy p PvBgs SClK ^E B S H Bg MYLI _LJ_j ill! I I ll ill ill B S BgH H Bg _LJ Bg H E B S H Bg B S Bg H H BS Bg E Py p PvBgs B P ShPv 5 EE B S BgH

PAGE 186

Figure 5-1. continued 174 B BgPv p PvBg s B P ShPv E B S H SET I SET II SFM II SMAI SMAII ZRUI ShPv B BgPv P B PvBg s s^ J iLLJ ^ BE B S H Bg Bg I ShPv BS H BgPv P S PvBg S EE B S H BS BgPv P PvBg S s^ J III ^1 ShPv r BS _1l Bg H Bg J I BS BgPv E BP P S PvBg S E B S ShPv BS H BgPv P PvBg S J LLJ, S B BgH Bg SB H BgPv ZRU II P PvBg S B P ShPv E E B S Bg E B BS H BgPv P PvBg s ZYDfl II 1 1 1 1 1 1 1 ShPv i E B S Bg BS H BgPv ZYP II KAR II P PvBg s B P ShPv BE BS Bg H BS H B P ShPv Bg p pv s s^'^ B E S H Bg

PAGE 187

Figure 5-1. continued 175 Bs H BgPv C57BL/1(1"^ ^ ^ B P ShPv P PvBg Si sY 4 — BJJ^-fllW E B S H Bg BS H BgPvE p PvBg S B P SH B10.M C3H.JK B10.S B E Pv B S B s H BgPvE p PvBg s B P SH BE Pv B S B s H BgPvE p s PvBQ S B pS"Pv B B S B10.STC90J B s H BgPvE p PvBg S S p ShPv B W12A FAI-3 FAI-4 MET-3 B s H BgP\£ P s Pv S p ShPv BE B S BS H BgP\E p PvBg S B pSHPv BE B S BS H BgP\E P s Pv S s U \ I I I I I I I ^ p ShPv BE B S B S H BgPv P S PvBg S B P ShPv B B S Sh H Bg H Bg BgH E 4.1 Kb E B S H Bg Bg H H Bg Bg H BgH AV 4.1 Kb BS H BgPv tw12 III i 1 P Pv S s^ 1 11^ f B E Pv B S HBg II 1 1 1 M BS H BgPv TT6 III II E P P Pv S s^ 1 11^ Sh ^ B E Pv B S H Bg Mill 1 1 BS H BgPv BRNO-1 III II E P S PvBg S B P Sh f B E Pv B s H Bg II 1 1 1 II 1 B S H BgPv CADIZ-1 Ml II E P P S PvBg S s"| >HPv f ^E B s BgH ill II II i BS H BgPv PANCEB III II : 1 P PvBg s 1 Ml A B P M >HPv ^ E SB Bg II II 1

PAGE 188

Figure 5-1. continued 176 BNC DBP DGD DOT BIB-2 BEP-2 DJO-2 DSD-2 BS H BgPy p C57BL/1^ BFM B P ShPv BS H BgPy p PvBg S B pSHPv BS H BgPy p Pv S B P SH BE Pv BS H BgPv p s PvBg S B pS Pv B E BP BS H BgPv, p s PvBg S| S^ Bgs BE Pv BS H BgPv Pv S B P SH B E Pv Bg HBg H H Bg J

PAGE 189

177 different species and subspecies. For example, lineage 2A alleles, C57BL/10 and SEGl, restriction maps of which resemble to each other, are found in M. m. domesticus and M. spretus respectively. Likewise, MET2 and CRPl, both of which are lineage 1 alleles, are identified to in M. m. domesticus and M. cervicolor indicating that Mhc genes evolve in a transspecies fashion. Lineage Distribution of Ab Alleles Within the Genus Mus As the Ab genes derived from different species and subspecies of genus Mus were classified into evolutionary lineages (i.e. 1, 2A, 2B and 3), the distribution patterns of those different lineages of Ab genes in Mus were determined. Figure 5-2 presents a phylogenetic tree which was built on the basis of evolutionary relationships of these separate lineages of Ab genes in various species and subspecies of Mus. Several additional features of trans-species evolution of these Ab lineages are revealed from this analysis. This study has expanded the analysis of M. spretus M. spretoides M. spicilequs to include a total of 20 H-2 haplotypes. Ab alleles from lineages 1 and 2A were found in all three of these aboriginal mouse species. Ab alleles from both lineages are present in M. caroli indicating that alleles in these two lineages diverged at least 2.5 million year ago. The emergence of lineage 2B and 3 must be very recent events as

PAGE 190

t -P 15 H C Q) 13 (0 (0 0) ^ (0 w (0 6 M O C 0) T3 a ^ 4-> ui a> nt o c4 H g (0 C o •H 3 o > (0 (0 0) Ul •H Q) rH o in (0 0) X! P CP c 0) X3 • c dj d) (0 H (0 (0 (0 • 0) c -p 3 0) U rH trirH (0 (0 (0 •H 0) a -Ql |<|((H o Mh o e o (0 -P Q) O (0 43 "i • rH •-' Q) O tJ( w io c C rH o 0) 0) v. --^ y ^ Q) H O to +J O (0 (0 in -p u 01 o o\ o o o ft 6 •H ^H O J3 O o o ^ w o s to X! (0 ft

PAGE 192

180 both are found only in subspecies of M. musculus complex, which are estimated to diverge at least 0.4 million years ago. It is worth noting that although lineage 3 alleles are found in both M. m. musculus and M. m. domesticus lineage 2B allele is only found in M. m. musculus However, as shown before, lineage 3 alleles are derived from lineage 2B allele. The failure to identify lineage 2B allele in M. m. domesticus may indicate that it has been lost from the natural populations, or may be due to the low number of sampled alleles in our collection. On the basis of distribution pattern of individual lineage of Ab gene, it was concluded that the lineage 1, 2A, 23 and 3 alleles had persisted through at least five, three, and one speciation events, respectively, during the course of Ab gene evolution. Phyloqenetic Relationships of 86 Ab Genes in the Genus Mus Restriction mapping and DNA sequencing enabled us to determine not only the quantity of DNA sequence variation but also the nature of this variation. Phylogenetic analysis, based on the restriction map and sequence data, can provide a huge amount of information concerning the origins of different sequence types. To investigate the phylogenetic relationships among Ab genes of genus Mus, we analyzed the restriction map data by

PAGE 193

181 the parsimony method. A 16-kilobase region around the Ab gene in each allele was examined with seven restriction endonucleases (Bam HI, Eco RI, Hind III, Pvu II, Pst I, Bgl II, Sst I ). As expected, the gain and loss of restriction sites accounts for most of the polymorphism observed (Nei 1987) In addition, several major insertions, which have been used to delineate the evolutionary lineages, were also detected. A total of 86 alleles was identified from 115 H-2 haplotypes on the basis of restriction site polymorphisms and 3 different sizes of retroposon insertions. Using restriction site polymorphism as a character state, it became possible to reconstruct the phylogenetic relationships from restriction map data. The phylogenetic trees can be constructed in many different ways, often with slightly different results. (Felsenstein 1982) The method used in this analysis is named "mixed parsimony", supplied by Felsenstein • s PHYLIP package. This algorithm does not produce a rooted tree. Among 41 polymorphic restriction sites recognized by 7 restriction enzymes, 29 were informative for phylogeny analysis (that is, polymorphic restriction sites were present in at least two alleles each.). A typical restriction site allele exemplified by B10.D2 is shown in Figure 5-3. The full restriction site character set of 86 Ab alleles is shown in Table 5-2. Each allele is composed of restriction map variants shown in 5 • to 3 with respect to order of each

PAGE 194

>1 •H P o <]> in u 0) •H I o •H o Q) in -H •H c Q) b (0 M

PAGE 195

183 CO LU OQ 0> CQ 3H-|lSd • O ^•Q-Idoog # T6 0-linAd • 19Z e-||nAd • Tl.'9-llBa # o S9 G-I|6a • O 2-9-lllpuiH • 1^ 9>IIIPU!H • O Z'HIIPUIH • 1B 9-2-lllpuiH • TW 9 2-|||pU!H • To > UJ n 8Z-||IPU!H • 8 e-iiss • "^2 9 C-IJSS • O B S*'' 8 2-llSS • O 8 2 2-llSS • O C ^ 99'HISS • Tw £L ^ l'Z-\\SS • O CO S ^ r3-Rss • o d > w 9-S-llSS • 1CD \ O 8>uss • O c / 0 T UJ J 8 z-iiss • ^ 8? 3: ^ d) 9 2-IHLUBg • ^ o> i 0 2-IHLUBa • O ^ ^ g g e-IHi^Bg # o fr-9-IHLUBg • O .2 9 Z-IHLUBg # ^ (0 E Q Q CO o o X —

PAGE 196

184 Table 5-2 Restriction Site Character Set of Ab Alleles 10 20 29 B10.D2 00001011001000101110100111110 BIO.F 01001011001000100110000110110 BIO.RIII 00001011001000100110100110110 BIO.SM 00001011001000100110000110100 B10.SAA48 00001010001000100110100110100 BIO.BUA 00001011001000100110100111110 MET-2 01001011001000100110000110110 TW5 00001011001000100110100110110 TW8 01001011001000100110000110100 BELl 00000010001000100110100110110 10 B10.CAS2 00001011001000100110100110110 THONl 00001010001000111110000110110 PAN D 0001?010001001?00110100110110 BIK/g 00000011001000101110100111110 38CH 00000011001000000110000110010 DMA 00001001001000101110100111110 BEP-1 000010110011???10110000110110 DSD-1 01001011001000100110100110110 MBB-1 00001011001000100110000110010 MBK 00001010001000100110100110110 20 CAS 00001010001000111110000110110 SFM-1 00001011001000100110000110??0 STF-1 00001011001000100110100110010 XBJ-1 0001?010001001?00110100111110 XBJ-2 00001010001001?00110100111??0 XBS 0001?010001001?001101001100?0 ZBN-1 00001010000000000110100110110 KAR-1 00000000000000001110100111??0 COK 01001011001000100110000110010 CRV 01001011001000000110000110000 30 CRP-1 01001011001000100110000110010 CRP-2 010010110000000001 10000110??0 ZYD-1 00001010001000000110100110110 ZYP-1 00000110001001700110100110110 K 00101010010000000000000110011 U \, 10101011010000000010000110011 MDL-2 00101010010000000000000110011 DBV-2 00100001010000000010000011771 C57BL/10 00110010011001000011710110110 BIO.M 00110010011000100010010100110 40 C3H. JK 00110010011000100010010100110 BIO.S 00110010111000100010010110100 B10.STC90 00010010011000100011710110110 W12A 00010010111000100010000110110 FAI-3 00110010011000100010010110110 FAI-4 00010010111000100010000110110 MET-3 00110010111000100010010110100 twl2 00010010011000100010000100110

PAGE 197

185 Table 5-2. continued 10 20 29 TT6 00010010011000100010000100110 BRNO-1 00110010111000100010010100110 50 CADIZ-1 00000010111000100010010110110 PAN-B 0010011001101??00010010110110 BFM 00010010011000100010000110110 BNC 00101010011000000010010110110 DBP 001010100111???00010011110110 DGD 00101010011000100010000100110 DOT 00100010011000000010010110110 BIB-2 00100010011000100010000100110 BEP-2 00100010111000100000011110100 DJO-2 00100010111000100010010100110 60 DSD-2 00100010011000100010000100110 MAI 00110010111000100011710110010 MBB-2 00100000010000000010000100110 MBS-2 00100010111000100010010100110 MBT 00101010011000000010010110110 MDS 00111010011000100010010100110 MPW 00101010111000100010010100110 MYL-1 00110010011001000011710110110 MYL-2 00101000011000000010010110110 MOL 00101010011000100010010100110 70 SEI 00010010111000000010010110110 SEG-1 00110010111001000011010110110 SPE 10101070011000100010010110110 SET-1 00110010011000100011710110110 SFM-2 00110010111001000011010110110 SMA-1 00000010011000000010010110110 SMA-2 00110010111001000010010110110 ZRU-1 00100110011017700010010110110 ZRU-2 00100100011000000010010110110 ZYD-2 00110010011001000010010110110 80 Zyp-2 00110010011017700010010110110 KAR-2 00100010011000000011700010010 Character set derived from Figure 5-1 and Table 5-1 The numbers on the top of column indicate the character number described in Table 5-2, 1: indicates the presence of the specified restriction site, 0: indicates the absence of restriction site, 7: indicates the restriction site is undetermined.

PAGE 198

186 restriction enzymes. "+" and "-" indicate the presence, and absence, respectively, of a given restriction site. The character state of Ab allele is explained in Table 5-3 As the computer program supplied by Felsenstein' s package has a limited capacity to analyze all the alleles at a time, each lineage of alleles were analyzed first (data not shown) to find out the phylogenetic relationship of closely related alleles. Then, the different lineage alleles were pooled and analyzed altogether. The parsimonious network of the 86 Ab alleles constructed is shown in Figure 5-4. This phylogenetic tree requires 96 mutational steps. The bar(s) between the alleles indicate the character state change. Branch lengths are proportional to the number of character changes. The distance between the different alleles is proportional to their DNA sequence divergence, which is reflected by the numbers of character change between them. Those alleles that are encircled by solid lines are different alleles which are shown to be phylogenetically identical by parsimony analysis. The Mhc class II Ab genes have been divided into four evolutionary lineages based on retroposon polymorphisms. A remarkable feature about this Ab phylogenetic tree is that its main branches correspond very closely to the evolutionary lineages defined before. It is evident from this phylogenetic tree that lineage 3 alleles are evolutionarily more closely related to lineage 2 than to lineage 1 (Figure 5-4) In light of the fact that each Ab lineage is derived from other lineage

PAGE 199

187 Table 5-3. Coding of Restriction Site Data of Ab Alleles. Character Feature Character Feature number number 1 Bam HI-5.4 16 Sst 1-2.3 2 Bam HI-3.6 17 Hind III-2.5 3 Bam HI-2. 1 18 Hind III-2.5 4 Bam HI-2.0 19 Hind III-1.7 5 Bam HI-2 6 20 Hind III-4.5 6 Bam HI-3.1 21 Hind III-5.2 7 Sst 1-7.8 22 Bgl II-3.62 8 Sst 1-2.6 23 Bgl II-5.1 9 Sst 1-2.1 24 Pvu II-2.75 10 Sst 1-2.1 25 Pvu II-3.75 11 Sst 1-1.65 26 Pvu II-0.9 12 Sst 1-2.2 27 Eco RI-5.4 13 Sst 1-2.8 28 Eco RI-5.4 14 Sst 1-3.5 29 Pst 1-1.2 15 Sst 1-3.8 The data are derived from restriction map of Figure 5-1.

PAGE 200

o u <4-l T) > •H u 0) T3 (0 0) H 0) 0) 0) g -p > <1) 43 U 0)2 as H 0) o -p 0) c o w rH O 0) 0) ftrH I in (U •H 3 n3 0) P •H c o •H +J u w H -P as Ui u (U p m rH o >H o O in (0

PAGE 202

190 by retroposon insertion, it is obvious that the divergence of alleles within each lineage occurs by the accumulation of mutational events, mainly due to base substitution. The phylogenetic tree shown in Figure 5-5 suggests that each lineage contains a few meaningful sublineages (designated by circle broken lines) These sublineages each contain a cluster of closely related alleles. In some sublineages, the cluster of alleles are derived from different Mus species, for example, MYLl, C57BL/10, SEGl, SFMl, suggesting the transspecies mode of evolution operating on the Ab gene. Occasionally, clusters of alleles are derived from the same subspecies, e.g., CAS and THONl, both of which belong to M. m. castaneus.

PAGE 203

(N 0) H g S (0 o ^ 0) <(-i X3 P T3 0) 0) > ^ •H nJ 0) 0) 0) (0 (0 0) CO C -l w o 0) o -p 0) c 9 w (0 0) +J o T3 C •H (1) o •H O T3 0) P P O Q U 0) £! P O in •H 0) o 0) p rH 0) O H 0) 0) ttrH M rH If) If) u & to •H 3 (0 0) -P -H Ul c o -rH +J 0 0) u o H O (0 0) rH 0) -p 10 (a o -p (0 rH o

PAGE 204

192

PAGE 205

CHAPTER 6 DISCUSSION Function of Mhc Genes The function of Mhc molecules is to present antigen to T cell receptors on thymus-derived lymphocytes (reviewed by Klein 1986) T cell responses to antigen have a dual specificity-one for the protein antigen itself and another dictated by the allelic form of the Mhc molecules (reviewed by Schwartz 1985) The molecular basis of this "Mhcrestricted recognition" is explained by the remarkable finding that Mhc molecules are actually peptide carriers or receptors. The physical complex of peptide fragments and Mhc molecules is what interacts with T cell (Buus et al. 1987; Allen et al 1987) X-ray crystallographic studies of three-dimensional structure of Mhc class I revealed a putative peptide-binding groove lined with the most polymorphic residues of Mhc polypeptides (Bjorkman et al. 1987a, 1987b) These observations suggest that the majority of class II gene polymorphisms may dictate the binding specificity of class II molecules for antigenic peptides. 193

PAGE 206

194 Features of Mhc polyinorphisin The unusual genetic features of Mhc genes suggest that novel evolutionary mechanisms must operate on these genes. Analysis of the unprecedented genetic diversity of Mhc loci has indicated four important properties of Mhc genes (reviewed by Potts & Wakeland 1990) First, selective neutrality is inconsistent with the observations made from population data, suggesting some forms of balancing selection is operating on Mhc loci. Second, the population analysis indicate that selection is operating in contemporary populations and is not episodic with long intervening periods of neutrality. Third, diversifying selection is operating directly on the ABS. Fourth, selection my be strong enough, at least for species like Mus, to measure directly in population studies. As many of the polymorphic amino acid residues of class II molecules occur within the ABS, these allelic molecules may have different binding properties. Subsequently, these variations may alter the immune response of individuals to foreign antigen. Although a wealth of information regarding the functional and structural properties is currently available, little is known about the significance of Mhc polymorphism. The selective forces involved remain elusive (Klitz et al. 1986; Potts et al. 1988).

PAGE 207

195 Mechanism of Generation of Ab Gene Polymorph isms Mutational changes in DNA can be classified as four types: substitution, deletion, insertion and inversion. RFLP analysis is able to detect all four types of DNA changes, although it is most efficient in detecting deletions, insertions and inversions. Substitutions are detectable only when point mutations occur which alter the recognition sequences of restriction enzymes. Therefore, RFLP analysis tends to underestimate the degree of substitution in comparison with insertion, deletion and inversion. For the seven restriction enzymes used in our analysis, the segment of genomic DNA assayed by the Ab gene probe spanned about 16 kb. Therefore, the polymorphic restriction sites revealed in this study are distributed over a fairly large segment of DNA. As the Ab gene is encoded by 700 bps of exonic DNA, the majority of DNA examined by RFLP analysis is the noncoding regions of DNA such as introns and flanking regions. Thus, the restriction site polymorphisms detected reflect DNA sequence variations in the non-coding regions. Inspection of restriction maps of 86 Ab alleles in our analysis indicated that in addition to three distinct insertion events which constitute the basis of evolutionary lineages, most restriction site polymorphisms are caused by point mutations.

PAGE 208

196 Mhc Genes Evolve via Trans-species Mode If Mhc polymorphism arose exclusively after the initiation of speciation, then one would expect Mhc alleles in a given species to be more closely related to each other than they are to those in other species. However, if the Mhc evolves in a trans-specific manner, some Mhc alleles from one species would be expected to resemble those from other species more closely than they do to each other. A number of studies exploring the genetic diversity of Mhc class I and II genes indicate that a considerable proportion of the polymorphisms of contemporary alleles predated speciation events, i.e. the Mhc genes evolve in a trans-species manner, and during the course of gene evolution, they diverge by slowly accumulating point mutations (McConnell et al. 1988; Figueroa et al. 1988; Lawlor et al. 1988; Mayer et al. 1988) Previously, McConnell et al (1988) demonstrated that alleles of Mhc class II Ab gene can be organized into 3 evolutionary lineages based on their genomic structures. The evolutionary relationship between lineages 1 and 2 is that lineage 2 alleles are produced from lineage 1 alleles by an 861 bp retroposon insertion in the intron separating A^^ and A^2 exons. The evolutionary relationships among these lineages of alleles were first elucidated by determining the DNA sequence of intron 2 from a lineage 3 allele (k haplotype) This sequence analysis has provided some unique

PAGE 209

197 insight into the mechanism (s) of generating Ab gene polymorphism. On the basis of sequence data, PGR enzymatic amplification and restriction analysis, the Ab genes were reorganized into four evolutionary lineages, 1, 2A, 2B and 3. The result of this analysis clearly indicated that four Ab lineage alleles were derived from three independent successive retroposon insertions in the intron between A^^ and A^j exons. Lineage 2B allele was generated from lineage 2A allele by an insertion of Bl family repeat. Subsequently, another new family of retroposon, composed of 539 bp of nucleotides, integrated into a lineage 2B allele, thus generating lineage 3 allele. Lineage 1 alleles are present in all species and subspecies of genus Mus examined so far, suggesting probably it is the most ancient lineage of Ab genes. Lineage 2A alleles are identified in one Asian species, Mus carol i three aboriginal species, Mus spicilegus Mus spretoides Mus spretus as well as Mus m. musculus and Mus m. domesticus Lineage 2B alleles are only found in M. m. musculus to date. However, lineage 3 alleles are present in M. m. musculus and M. m. domesticus Simultaneously, during the course of Ab gene evolution, the progenitor alleles thus generated from retroposon insertion accumulate mutational changes, leading to the formation of cluster(s) of alleles closely related to each other.

PAGE 210

198 Possible Impact of Retroposons on Ab Gene Expression Since retroposons are dispersed through the host DNA by duplicative retroposition, it is likely that they have a major impact on genomes. The most obvious is their mutagenic potential due to the disruption of sequences at the site of integration (Chao et al. 1983) Retroposon integrations in exons and other regulatory regions would result in null alleles and might be selected against even in heterozygous states. However, retroposon insertions in introns and intergenic regions are more likely to be neutral (reviewed by Deininger 1990) In addition, there are several examples of SINE elements found in noncoding and coding regions of numerous genes without deleterious effects. The insertions of SINE elements have been used as a signal for polyadenylation, portion of coding sequence, and termination signal. In addition, SINEs have been implicated in recombination (Lehrman et al. 1987) act as limits to gene conversions (Hess et al. 1983) and mobilize unrelated DNA sequences throughout the genome either via retroposition of sequences adjacent to SINEs (Zelnick et al. 1987) or by facilitating recombination. The SINE elements and repetitive family member identified in various Ab lineages are all positioned in intron 2. Presumably, these retroposons may not have any drastic impact on Ab gene function as this intron has 5' splice site with GT dinucleotide and 3' splice site

PAGE 211

199 with AG dinucleotides. Subsequently, these inserted sequences would be removed from primary transcripts by RNA processing. However, in studies of Ab gene expression using DNAase I hypersensitivity (DH) assay, it has been shown that DH sites unique to transcriptionally active tissues were mapped into SINE elements (Mclndoe et al. 1990) These data suggest that the retroposon insertions in the gene may have a subtle unrecognized effect on the expression of Ab genes. The influence of these retroposon insertions on Ab gene expression may be significant in light of the fact that numerous studies have shown the level of la antigen expression is critical to the efficiency of antigen-presentation to T cells (Matis et al. 1983; Janeway et al. 1984). Moreover, the exceptionally high abundance of SINEs in the intron may reflect a more open chromatin structure associated with such genes in the germ line (Slagel et al. 1987) Linkage Disequilibria Among Restriction Sites Among the 115 H-2 haplotypes studied in this dissertation, a total of 86 Ab alleles was identified by RFLP analysis. Close inspection of their restriction maps revealed one unusual feature of restriction-site polymorphism, that is, there is strong nonrandom association of polymorphic restriction sites among themselves. This nonrandom association or linkage disequilibrium occurs mainly because

PAGE 212

200 association or linkage disequilibrium occurs mainly because restriction sites and their neighboring genetic loci are tightly linked (Nei 1987b) During the construction of phylogenetic tree of Ab genes, 29 informative sites were uncovered and used for parsimony analysis. Therefore, one would predict that 2^^ > 52 x 10^ different alleles will be generated if random combination of restriction sites occurs. However, our global sampling of mouse H-2 haplotypes came up with the number much lower than that. Clearly, this is a strong case of linkage disequilibrium. The surveys of distribution and frequencies of Mhc class I and class II genes in natural populations of mouse indicate that H-2 polymorphism is not as extensive as would be predicted if the diversity of these gene is unlimited (Wakeland & Nadeau 1980) Studies of H-2 and allozyme polymorphisms with respect to geographical and temporal distribution in wild mice have indicated that Rz 2 polymorphisms were more uniformly distributed than allozymes (Nadeau et al. 1988) Taken together, these data indicate that some alleles are selectively maintained in many populations as suggested previously (Wakeland & Nadeau 1980) If the only selective pressure operating on H-2 genes is random diversification, then natural populations should contain a virtually unlimited number of H-2 alleles. However, the analysis of class I and class II genes suggests that they are present at appreciable frequencies in different natural populations of mice and are more uniformly distributed than

PAGE 213

201 indicated that similar or identical H-2 genes can be identified in both laboratory inbred strains and wild mice. These observations can be interpreted as evidence that selective pressures are operating to restrict the polymorphism of H-2 genes (Wakeland & Nadeau 1980) Maintenance of Mhc Polymorphism Although there are numerous mechanisms that could contribute to the maintenance of polymorphism, only a few are likely to apply to the Mhc. These are overdominance selection, high mutation rates, neutrality, frequency dependent selection, variation in pathogen assemblages across space and time, mating preferences, and transmission distortion favoring Mhc heterozygotes. The mutation rate at the Mhc loci is not particularly high as shown by Hayashida & Miyata (1983). The allelic frequencies of HLA are too regular to be compatible with neutrality expectations (Hedrick & Thomson 1983) and neutrality is too weak a force to account for the degree of H-2 polymorphisms in local population of Mus (Potts et al. 1987) Frequency dependent selection favoring rare alleles is a more potent mechanism to maintain polymorphism than heterozygote advantage (Herick 1972) It is theoretically appealing because the rare Mhc alleles might enjoy an advantage in the molecular arms race against pathogens (Bodmer

PAGE 214

202 1972) However, it is difficult to demonstrate frequency dependent selection caused by pathogen evolution as it requires long term studies to observe cycles due to pathogen evolution. If pathogen assemblages vary in space and time, and specific Mhc alleles are more effective against one subset of pathogens than others, then natural selection would favor different subsets of Mhc alleles according to the current pathogen assemblages. This type of selection would contribute to the maintenance of Mhc polymorphism because different alleles would be maintained in different populations. Unfortunately, the data available concerning pathogens are not sufficient to test this hypothesis. Disassortative mating according to Mhc genotypes would contribute to the maintenance of polymorphisms. This mechanism involves olfaction and the genes responsible have been mapped to Mhc loci (Yamazaki 1976; Boyce et al. 1983). Transmission distortion, proposed by Clarke and Kirby (1966) also favors the production of Mhc heterozygotes. On the surface, both mating preferences and transmission distortion resemble heterozygote advantage in that they result in an excess proportion of heterozygotes. However, they are more effective at maintaining polymorphism because rare alleles have an advantage in all genotypes, whereas under heterozygote advantage, rare alleles enjoy an advantage only in the heterozygote condition (reviewed by Potts et al. 1988)

PAGE 215

203 Overdominant Selection for Mhc Polymorph ism The extraordinary polymorphism of Mhc genes set them apart from all other known genetic loci. It is generally believed that the Mhc loci have been molded by special forces not acting, or at least not to the same degree, on other loci (Klein & Figueroa 1986; Klein et al. 1989). On one hand, there is no doubt that Mhc loci are subject to negative purifying selection which eradicates functionally unfit variants as can be judged from the fact that the diversity of these genes is not unlimited. But this type of selection probably also acts on most other functional loci. On the other hand, one wonders whether Mhc loci are also subject to positive selection which, for example, provides an advantage to individuals heterozygous at Mhc genes? Although some observations indicate that Mhc loci of certain species are not polymorphic or at least not highly polymorphic (Figueroa et al. 1986; Watkins et al. 1988), there is some evidence suggesting that positive selection are operating to drive the diversification of Mhc genes. Hughes and Nei's (1988, 1989) analysis of the pattern of nucleotide substitution at synonymous and nonsynonymous positions in the codons of ABS provided one of the most convincing argument for positive Darwinian selection. Their approach was to compare the nucleotides constituting the ABS with those coding the rest of the genes. The role of positive selection implicated in enhancing the diversity is indicated by the fact that the rate

PAGE 216

204 enhancing the diversity is indicated by the fact that the rate of nonsynonymous substitutions in the ABS is higher than would be expected if the substitutions are neutral. In the rest of molecule, nonsynonymous substitutions are lower than expected, indicating the negative selection is acting on the corresponding portions of the genes. Positive selection may act via heterozygous advantage (overdominant selection) in which the superior ability of Mhc heterozygotes to bind and present antigen will enhance their resistance to infectious diseases ,thus increasing their relative fitness in the population. Overdominant selection is also known to enhance the rate of amino acid substitution and increase the heterozygosity and persistence of polymorphic alleles enormously compared with those of neutral alleles (Maruyama & Nei 1981; Nei 1987b). The conservation of evolutionary lineages over long periods can also be explained by assuming that positive selection has been acting on the functional Mhc genes through overdominant selection. Divergent Allele Advantage Although overdominant selection alone may explain the number of Mhc alleles prevalent in natural populations and the retention of ancestral polymorphisms, the extensive sequence diversity between alleles in A^^ exons indicates that another selective mechanism specifically enhancing diversification must also be operative (Wakeland et al. 1990a) This type of

PAGE 217

205 the other two forms of balancing selection (i.e. overdominant and rare allele advantage) commonly thought to operate on Mhc genes (Bodmer 1972; Zinkernagel & Doherty 1974). All three types of selection would contribute to the maintenance of Mhc polymorphism of highly divergent alleles within population (Wakeland et al. 1990b) Alu-like Repetitive Elements in Genes SINE as Evolutionary and Genetic Tags Interspersed repetitive DNA sequences have been discovered in the genomes of all vertebrate species studied to date (Schmid & Jelinek 1982; Jelinek & Schmid 1982). Many of these repetitive DNA families are present in extremely high copy numbers. On the average, Alu elements appear every 5 kb, so it is not surprising that the intron between A^^ and h^^ exons of Ab genes contains three different sizes of retroposon inserts in various lineage alleles. Moreover, these three retroposon insertions were produced from three successive independent insertional events resulting in the formation of four evolutionary lineages. Alu elements in specific locations have been used as markers to study gene and genome evolution (Barsh et al. 1983; Ruffner et al. 1987). Previously, McConnell et al. (1988) proposed that SINE retroposons can be used as evolutionary tags for Mhc class II genes. In this dissertation, two additional SINE retroposons

PAGE 218

206 were identified and used to further dissect the evolutionary course of Ab genes. On the basis of divergence time estimated from studies of different species and subspecies of Mus, these evolutionary tags can be used as a molecular clock to estimate the time of divergence of different lineages of Ab alleles. Recently, Pozzo and his coworkers (1990) utilized the presence of an Alu repeat in the 5 • flanking region of DQ genes to infer the phylogenetic relationship of DQA l and D0A 2 It is generally accepted that transposition of repetitive elements is a demonstrated fact over evolutionary times. Yet it is very difficult, in higher eukaryotes, to demonstrate the transposition of a family repeat in contemporary populations. The insertion of Alu-like repeats has been shown to result in intraspecies polymorphisms within the genus Mus (Kominami et al. 1983) and Rattus (Schuler et al. 1983) Consistent with these observations is the finding that lineage 2B allele, distinguished from lineage 2A by an additional Bl family repeat, is only found in one subspecies of M. musculus complex, in contrast to lineage 2 A which is found in three subspecies of M. musculus complex. Likewise, the lineage 3 alleles, derived from lineage 23 alleles by an 539 bp insertional event, is identified in two subspecies of M. musculus complex. In summary, the different retroposon inserts have created both intraand inter-species polymorphisms

PAGE 219

207 Retroposons have been found in organisms as diverse as bacteria and humans. These observations have supported the view that they are a major evolutionary force contributing to sequence duplications, dispersions and rearrangements that maintain the fluidity of eukaryotic genomes. Because retroposons have generated many families of pseudogenes and transposable elements that impose no apparent advantage to the host, it has been proposed that nonviral retroposons could be thought of as "selfish DNA" that infest that the genome but barely confer a selective advantage on host (Orgel & Crick 1980; Doolittle & Sapienza 1980). 539 bp Retroposon: a Newly Arisen Repetitive Family DNA sequence analysis of this 539 bp repeat revealed that it is composed of a core element of 235 nucleotides, bounded by two flanking Bl family repeats. A search of GenBank with the sequence of the core element revealed no homology with known sequences, suggesting that it is unique. Blot hybridization experiment using the sequence of core element as a probe has confirmed this observation. Taken together, these data indicated that this 539 bp repeat transposed recently in the evolution of Ab genes. This is consistent with the fact that the lineage 3 alleles containing this repeat are found exclusively in M. m. domesticus and M. m. musculus The molecular mechansims leading to the dispersal of this type of retroposon is unclear. Although the core

PAGE 220

208 element does not contain the putative RNA polymerase III promoter, presumably, the internal RNA polymerase III promotors contained within both Bl repetitive elements would cotranscribe adjacent sequence (Rogers 1985) and therefore spread through the genome via RNA-mediated transposition ( Jagadeeswaran et al. 1981) Transposition of Middle Repetitive Elements Preferential Site of Integration The close similarities in the structure of SINE elements suggest that they are spread throughout the genome by a common mechanism (Schmid & Shen 1986) The majority of these SINEs have a precisely defined 5' terminus and a variable oligo dArich 3' terminus, flanked by terminal direct repeats. It has been shown that the 5 end of the direct repeats is abundant in dA residues. Similarly, the 5' flanking region adjacent to the 5' direct repeat is strongly biased for d(A+T)-rich sequences. Thus, it was concluded that regions of the genome that are rich in d(A+T) residues are likely to be preferred integration sites (Daniels & Deininger 1985) In keeping with this finding, the Bl repeat found in both lineage 2B and lineage 3 alleles is found to insert into the region rich in dA residues (Figure 4-6) In fact, there are numerous examples of SINEs integrating adjacent to each other, sharing a set of direct repeats,

PAGE 221

209 indicating that they might transpose as a single unit (Roger 1985) What is interesting is that the 539 bp repetitive elements identified in intron 2 of lineage 3 alleles is integrated into a Bl family repeat of lineage 2A alleles. This is consistent with observations made by others (Roger 1985) Possible Transposition Mechanism Structural analysis of the 539 bp repetitive element reveals that it is composed of two Alu-like elements plus some unique DNA sequences in between. This structural feature strongly suggests that this combined unit may transpose in a manner suggested above. The transposition mechanism involved the transcription of sequence into RNA. This RNA transcript is initiated from the 5* Alu-like repeat by the internal RNA polymerase III promoter. Termination occurs at some point 3' to the second Alu-like sequence as Alu-like repeat does not contain termination sequence of transcription. The obvious non-repetitive sequence bound by the flanking 5 and 3 Alulike repeats may have been cotranscribed into an RNA transposition intermediate by readthrough synthesis from the adjacent Alu-like repeat promoter. The RNA molecule thus made can be converted into DNA by reverse transcriptase The cDNA consisting of two Alu-like repeats flanking a non-repetitive internal fragment could then be inserted into a novel genomic location. Although both the Alu-like elements involved are

PAGE 222

210 not flanked by terminal direct repeats, yet it is not uncommon to find Alu family member without direct repeats. It is worth mentioning that this new repetitive element is integrated into a Bl family repeat. Phyloqenetic Relationship of Ab Genes To analyze the distribution of various mutational events in the evolutionary history of the 86 Ab alleles in our collection, we have conducted phylogenetic analysis by parsimony analysis. A remarkable feature of the Ab phylogenetic tree is that its main branches correspond very closely to the 4 evolutionary lineages, 1, 2A, 2B and 3 defined both by sequence analysis and restriction mapping. It is noteworthy that the phylogenetic tree (gene tree) constructed from Ab gene locus does not agree with the phylogenetic relationship of the species involved (species tree) One of the predominant factors that lead to such a difference is the genetic polymorphism in the ancestral species as indicated by Pamilo & Nei (1988) The results from Figure 5-4 demonstrated that all 86 Ab alleles we analyzed can be grouped into at least three major clusters of alleles, which correspond to three evolutionary lineages, 1, 2A, 23 and 3 defined previously. Moreover, each cluster of alleles is composed of alleles derived from different species and subspecies of genus Mus, supporting the idea that Mhc alleles

PAGE 223

211 evolve in a trans-species manner. Trans-specific evolution, the occurrence of polymorphisms predates the origin of the species, have been proposed as the explanation for the existence of identical alleles in multiple subspecies. The distribution patterns of Ab alleles in the phylogenetic analysis suggest that alleles harboring transposable elements are not subjected to deleterious selection. The number of alleles related by descent keep proliferating as evidenced by the clustering of alleles within each lineage. This finding is in direct contrast to a neutrality model suggested by Golding et al (1986) that haplotypes carrying the transposable elements are selectively deleterious as they are located at the tips of phylogenetic trees. However, a quantitative population genetic model proposed by Hickey (1982) suggested that the spread of transposable genetic elements in natural populations depends on sexual reproduction of the host. These self-replicative transposable elements do not have to be selectively neutral at the organismal level; they can generate major deleterious effects on the host and still spread through the population. This analysis has allowed us to construct an evolutionary trees whereby the different alleles currently distributed throughout the natural populations are generated by stepwise divergence from various lineage progenitor alleles. The presence of different sizes of retroposon insertions in the intron 2 between the A„. and A^, exons of Ab alleles has served

PAGE 224

212 as evolutionary tags in deciphering the phylogenetic relationships of these alleles. The restriction map data, DNA sequence analysis, and phylogenetic analysis are consistent with the idea that the Mhc class II genes are evolving in a trans-species mode. Each lineage of Ab gene, consisting of alleles closely related to each other, are composed of alleles belonging to different species and subspecies of genus Mus.

PAGE 225

REFERENCE LIST Allen, P. M. Matsueda, G. R. Evans, R. J., Dunbar, J. B. Marshall, G. R. and Unanue, E. R. 1987. Identification of the T-cell and la contact residues of a T-cell antigenic epitope. Nature (London) 327: 713. Alper, C. 1981. Complement and the MHC. In Dorf, M. (ed.). The Role of the Manor Histocompatibility Complex in Immunobioloqy pp. 173-220, Garland STPM, New York. Anderson, G. D. and David, C. S. 1989. In vivo expression and function of hybrid la dimers (Eahfi) in recombinant and transgenic mice. J. Exp. Med. 170: 1003. Arden, B. Wakeland, E. K. and Klein, J. Structural comparisons of serologically indistinguishable H-2K -encoded antigens from inbred and wild mice. 1980. J. Immunol. 125: 2424. Arden, B. and Klein, J. 1982. Biochemical comparison of major histocompatibility complex molecules from different subspecies of Mus musculus : evidence for trans-specific evolution of alleles. Proc. Natl. Acad. Sci. U. S. A. 79: 2342. Avner, P., Amar, L. Dandolo, L. and Guenet, J. L. 1988. Genetic analysis of the mouse using interspecific crosses. T. I. G. 4: 18. Babbitt, B., Allen, P. M. Matsueda, G. Haber, E., Unanue, E. 1985. Binding of immunogenic peptides to la histocompatibility molecules. Nature (London) 317: 359. Baltimore, D. 1981. Gene conversion: some implications for immunoglobulin genes. Cell 24: 592. Barsh, G. S., Seeburg, P. H. and Gelinas, R. E. 1983. The human growth hormone gene family: structure and evolution of the chromosomal locus. Nucleic Acids Res. 11: 3939. 213

PAGE 226

214 Baxevanis, C. N., Nagy, Z. A., Klein, J. 1981. A novel type of T-T cell interaction removes the requirement for I-B region in the H-2 complex. Proc. Natl. Acad. Sci U. S. A 78: 3809. Begovich, A. B. and Jones, P. P. 1985. Free la Ea chain expression in the Ea*:E^ recombinant strain A.TFR5. Immunoqenetics 22: 523. Benaceraf, B. 1981. Role of MHC gene products in immune regulation. Science 212: 1229. Bennaceraf, B. and Germain, R. N. 1978. The immune response genes of the major histocompatibility complex. Immunological Reviews 38: 70. Ben-Nun, A., Glimcher, L. H. Weiss, J., Seidmam, J. G. 1984 1984. Functional expression of a cloned l-A ^p gene in B lymphoma cells. Science 223: 825. Benoist, C. O. Mathis, D. J., Kanter, M. R. William II, V. E. and McDevitt, H. O. 1983. Regions of allelic hypervariability in the murine Aa immune response gene. Cell 34: 169. Berkower, I., Buckenmeyer, G. K and Berzofsky, J. A. 1986. Molecular mapping of a histocompatibility-restricted immunodominant T cell epitope with synthetic and natural peptides: Implications for T cell antigenic structure. J. Immunol 136: 2498. Bishop, C. E., Boursot, P., Baron, B. Bonhomme, F. and Hatat, D. 1985. Most classical Mus musculus domesticus laboratory mouse strains carry a Mus musculus musculus Y chromosome. Nature (London) 315: 70. Bjorkman, P. J., Saper, M. A., Samraoui, B. Bennett, W. S., Strominger, J. L. & Wiley, D. C. (1987a) Structure of the human class I histocompatibility antigen, HLA-A2 Nature (London) 329: 506. Bjorkman, P. J., Saper, M. A., Samraoui, B. Bennett, W. S., Strominger, J. L. and Wiley, D. C. (1987b). The foreign antigen binding site and T cell recognition regions of class I histocompatibility antigens. Natured (London) 329: 512. Bodmer, W. F. 1972. Evolutionary significance of the HL-A system. Nature (London) 237: 139.

PAGE 227

215 Bogenhagen, D. F. Sakonju, S. and Brown, D. D. 1980. A control region in the center of the 5S RNA gene directs specific initiation of transcription. II. The 3' border of the region. Cell 19: 27. Bonhoinine, F. 1986. The evolutionary relationships in the genus Mus In Potter, M. Nadeau, J. H. and Cancro, M. P., (eds.). The Wild Mice in Immunology Curr. Top. Microbiol, and Immunol 127: 19. Bono, M. R. Strominger, J. L. 1982. Direct evidence of homology between human DC-1 antigen and murine I -A molecules. Nature (London) 299: 836. Boyce, E. A., Beauchamp, G. K. Yamazaki, K. 1983. The sensory perception of genotypic polymorphism of the major histocompatibility complex and other genes: some physiological and phylogenetic implication. Human Immunogenetics 6: 177. Braunstein, N. S., and German, R. N. 1987. Allele-specif ic control of I molecule surface expression and conformation: Implications for a gereral model of la stucturefunction relationships. Proc. Natl. Acad. Sci. U. S. A 84. 2921. Breathnach, R. Benoist, C. O'hare, K. Gannon, F. and Chambon, P. 1978. Ovalbumin gene: Evidence for a leader sequence in mRNA and DNA sequence at the exon-intron boundaries. Proc. Natl. Acad. Sci. U. S. A. 75: 4853. Britten, R. J., & Kohne, D. E. 1968. Repeated sequences in DNA. Science. 161: 529. Brown, J. H., Jardetzky, T., Saper, M. A., Samraoui, B. Bjorkman, P. J., and Wiley, D. C. 1988. A hypothetical model of the foreign antigen binding site of class II histocompatibility molecules. Nature (London) 332: 845 Busk, H., Thomsen, B. Bonven, B. J., Kjeldsen, E., Nielsen, 0. F., and Westergaard, 0. 1987. Preferential relaxation of supercoiled DNA containing a hexadecameric recognition sequence for topoisomerase I. Nature (London) 327: 638. Buus, S., Sette, A., Colon, S. M. Miles, C. and Grey, H. M. 1987. The relation between major histocompatibility complex (MHC) restriction and the capacity of la to bind immunogenic peptides. Science. 235: 13 53. Caras I. W. Davitz, M. A., Rhee, L. Weddell, G., Martin, D. W. and Nussenzweig, V. 1987. Cloning of decayaccelerating factor suggests novel use of splicing to generated two proteins. Nature (London) 325: 545.

PAGE 228

216 Cavalier-Smith, T. 1985. Selfish DNA and the origin of introns. Nature (London) 315: 283. Cech, T. R. 1986. The generality of self -splicing RNA: relationhip of nuclear RNA mRNA splicing. Cell 44: 207. Chao, L. Vargas, C, Spear, B. B. and Cox, E. C. 1983. Transposable elements as mutator genes in evolution. Nature (London) 303: 633. Church, G. M. and Gilbert, W. Genomic sequencing. 1984. Proc. Natl. Acad. Sci. U. S. A. 81: 1991. Coligan, J. E., Kindt, T. J., Uehara, H. Martinko, J., and Nathenson, S. G. 1981. Primary structure of a murine transplantation antigen. Nature (London) 291: 35. Costantini, F. D. Britten, R. J., and Davidson, E. H. 1980. Message sequences and short repetitive sequences are interspersed in sea urchin egg poly (A) RNAs. Nature (London) 111: 287. Crick, F. H. C. 1979. Split gene and RNA splicing. Science 204: 264. Daniels, G. R. and Deininger, P. L. 1985. Integration site preferences of the Alu family and similar repetitive DNA sequences. Nucleic Acids Res. 13: 8939. Davidson, E. H. and Britten, R. J. 1979. Regulation of gene expression: possible role of repetitive sequences. Science 204: 1052. Davis, M. M., Cohen, D. I., Nielsen, E. A., Steinmetz, M. Paul, W. E., and Hood, L. 1984. Cell-type-specific cDNA probes and the murine I region: the localization and orientation of A''^. Proc. Natl. Acad. Sci. U. S. A. 81: 2194. Deininger, P. L. 1989. SINEs: Short interspersed repeated DNA elements in higher eukaryotes. In Berg, D. E. and Howe, M. M. (eds.). Mobile DNA pp. 619, Am. Soc. Microbiol .. Washington, D. C. Deininger, P. L. and Schmid, C. W. 1979. A study of the evolution of repeated DNA sequences in primate and the existence of a new class of repetitive sequences in primates. J. Mol. Biol. 127: 437.

PAGE 229

217 Devlin, J. J., Wake, C. T. Allen, H., Widera, G. Mellor, A. L. 1984. The major histocompatibility complex of the C57BL/10 mouse: Gene organization and function. In Sercarz. E., Cantor, H. and Chess, L. (eds.). Regulation of the immune system (UCLA symposia on Molecular and Cellular Biology, New Series), vol.18 Doolittle, W. F. Genes in pieces: were they ever together. 1978. Nature (London) 272: 581. Doolittle, W. F., and Sapienza, C. 1980. Selfish genes, the phenotype paradigm and genome evolution. Nature (London) 284: 601. Duncan, W. R. Wakeland, E. K. and Klein, J. 1979. Heterozygosity of H-2 loci in wild mice. Nature (London) 281 : 603. Estess, P., Begovich, A. B. Koo, M. Jones, P. P., and McDevitt, H. O. 1986. Sequence analysis and structurefunction correlations of murine g, k, u, s, and f haplotypes I-A;^ cDNA clones. Proc. Natl. Acad. Sci. USA 83: 3594. Fachet, J., Ando, I. 1977. Genetic control of contact sensitivity to oxazolone in inbred, H-2 congenic and intraH-2recombinant strains of mice. Eur. J. Immunol. 7: 223. Fathman, C. G. and Kimoto, M. 1981. Studies utilizing murine T cell clones: Ir genes, la antigens, and MLR stimulating determinant. Immunol Rev 54: 57. Felsenstein, J. 1982. Numerical methods for inferring evolutionary trees. Q. Rev. Biol. 57: 379. Ferris, S. D. Sage, R. D. Wison A. C. 1982. Evidence from mt DNA sequence that common laboratory strains of inbred mice are descended from a single female. Nature (London) 295: 163. Figueroa, F., Tichy, H., Berry, R. J. and Klein, J. 1986. Mhc polymorphism in island populations of mice. Curr. Top. Microbiol. Immunol 127: 100. Figueroa, F. Gunther, E., and Klein, J. 1988. MHC polymorphism pre-dating speciation. Nature (London) 335: 265. Flavell, R.A., Burkly, L.C., Wake, C. and Widera, G., Structure and expression of class II gene of murine MHC, 4th MHC Clonging Worshop, (Abstr.), 1985a.

PAGE 230

218 Flavell, R. A., Allen, H. Ruber, B. Wake, C. and Widera, G. 1985b. Organization and expression of the MHC of the C57Black/10 Mouse. Immunological Reviews. 84: 29. Flaherty, L. 1980. The Tla region antigens. In Dorf, M. E.(ed.) The role of the major histocompatibility complex in immunobioloqy pp. 33-58, Garland STPM, New York. Fowlkes, D. M. and Shenk, T. 1980. Transcriptional control regions of adenovirus VAI RNA gene. Cell 22:405 Fuhrman, S. A., Deininger, P. L. LaPorte, P., Friedmann, T. and Geiduschek, E. P. 1981. Analysis of transcription of the human Alu family ubiquitous repeating elements by eukaryotic RNA polymerase III. Nucleic Acids Res. 9: 6439. Fuhrman, S. A., Deininger, P. L. LaPorte, P., Friedmann, T., & Geiduschek, E. P. 1981. Analysis of transcription of the human Alu family ubiquitous repeating elements by eukaryotic RNA polymerse III. Nucleic Acids Res 9: 6439. Galli, G., Hofstetter, H. and Birnstiel, M. L. 1981. Two conserved sequence blocks within eukaryotic tRNA genes are major promoter elements. Nature (London) 294: 626. Geliebter, J., Zeff, R. A., Spathis, R. Pfaffenbach, G. Nakagawa, M. Mcgue, B. Mashimo, H. Kesari, K. Hemmi, S., Hasenkrug, K. Borriello, F., Kumar, P. A. and Nathenson, S. G. 1987. The anaysis of H-2 mutants: Molecuar genetics and structure/ function relationships. In David, C. S. (ed.), H2 Antigens; Genes, molecules, function pp. 169-176, Plenum Press, New York and London. Germain, R. N. Bentley, D. M. and Quill, H. 1985. Influence of allelic polymorphism on the assembly and surface expression of class II MHC (la) molecules. Cell 43: 233. Germain, R.N., Quill, H. 1985. Unexpected expression a unique mixed-isotype class II MHC molecule by transfected L cells. Nature (London) 320: 72. Germain, R. and Malissen, B. 1986. Analysis of the expression and function of class-II major histocompatibility complex-encoded molecules by DNA -mediated gene transfer. Ann. Rev. Immunol 4: 281. Gilbert, W. 1978. Why genes in pieces. Nature (London) 271: 501. Gilbert, W. 1985. Genes-in-pieces revisited. Science 228: 823

PAGE 231

219 Gilbert, W. Marchionni, and McKnight, G. 1986. On the antiquity of intron. Cell 46: 151. Goding, J. W. Evidence for linkage of murine /32microglobulin to H-3 and Ly-4 1981. J Immunol 126:1644. Gorer, P. A. 1938. The antigenic basis of tumour transplantation J. Pathol. Bacteriol 47:231. Gorer, P.A. Lyman, S., Snell, G.D. 1948. Studies on the genetic and antigenic basis of tumour transplantation: lingkage between a histocompatibility gene and "fused" in mice. Proc. R. Soc. London. B 135:499. Gotze, D. ed. 1977. The Major Histocompatibility System in Man and Animals. Berlin: Springer-Verlag. Gotze, D. Nadeau, J., Wakeland, E. K. Berry, R. J., Bonhomme, F. Egorov, I. K. Hjorth, J. P., Hoogstraal, H. Vives, J., Winking, H. and Klein, J. 1980. Histocompatibility-2 system in wild mice X. Frequencies of H-2 and la antigens in wild mice from Europe and Africa. J. Immunol 124: 2675. Guenet J. L. 1985. Do non-linked genes really reassert at random? Ann. Inst. Pasteur Immunol 136c: 85 Guillet, J. G., Lai, M.-Z., Briner, T. J., Smith, J. A., & Gefter, M. L. 1986. Interaction of peptide antigens and class II major histocompatibility complex antigens. Nature (London) 324: 260. Gustafsson, K. Wiman, K. Emmoth, E., Larhammar, O. Bohme, J., Hyldig-Nielsen, J. J., Ronne, H. Peterson, P. and Rask, L. 1984. Mutations and selection in the generation of class II histocompatibility antigen polymorphism. EMBO J 3: 1665. Hansen, T. H. Spinella, D. G. Lee, D. R. and Shreffler, D. C. 1984. The immunogenetics of the mouse major histocompatibility gene complex. Ann Rev Genet 18: 99. Hayashida, H. and Miyata, T. 1983. Unusual evolutionary conservation and frequent DNA segment exchange in class I genes of the major histocompatibility complex. Proc. Natl. Acad. Sci. U. S. A. 80: 2671. Haynes, S. R.,and Jelinek, W. R. Low molecular weight RNAs transcribed in vitro by RNA polymerase III from Alu-type dispersed repeats in Chinese hamster DNA also found in vivo. 1981. Proc. Natl. Acad. Sci. U. S. A. 78: 6130.

PAGE 232

220 Haynes, S. R. Toomey, P., Leinwand, L. & Jelinek, W. R. 1981. The Chinese hamster Alu-equivalent sequence: a conserved, highly reptitious, interspersed deoxynucleotide acid sequence in mammals has a structure suggestive of a transposable element. Mol. Cell. Biol 1: 573. Heber-Katz, E., Hansburg, D. and Schwartz, R. H. 1983. The la molecule of the antigen-presenting cell play a critical role in immune response gene regulation of T cell activation. J. Mol. Cell. Immunol 1: 3. Heber-Katz, E., Schwartz, R. H. Matis, L. A., Hannum, C, Fairwell, T. Appella, E., Hansburg, D. 1982. Contribution of antigen-presenting cell major histocompatibility complex gene products to the specificity of antigen-induced T cell activation. J Exp Med 155: 1086. Hedrick, P. W. and Thomson, G. 1983. Evidence for balancing selection at HLA. Genetics 104: 449. Hess, J. F. Fox, G. M. Schmid, C. and Shen, C.-K. J. 1983. Molecular evolution of the human adult a-like globin gene region: insertion and deletion of Alu family repeats and non-Alu DNA sequences. Proc. Natl. Acad. Sci. U. S. A. 80: 5970. Hickey, D. A. 1982. Selfish DNA: A sexually-transmitted nuclear parasite. Genetics 101: 519. Hickey, D. A. and Benkel, B. 1986. Introns as relict retrotransposons: implication for the evolutionary origin of eukaryotic mRNA splicing mechanisms. J. Theor. Biol 121: 283. Hildemann, W.H., Clark, F.A., Raison, R.L. 1981. Comprehensive Immunoqenetics New York: Elsevier. Hood, L. Steinmetz, M. Malisson, B. 1983. Genes of the major histocompatibility complex of the mouse. Ann Rev Immunol. 1: 529. Houck, C. M. Rinehart, F. P., & Schmid, C. W. 1979. A ubiquitous family of repeated DNA sequences in the human genome. J. Mol. Biol 132: 289. Hughes, A. and Nei, M. 1988. Pattern of nucleotide substitution at major histocompatibility complex class I loci reveals overdominant selection. Nature ( London ) 335: 167.

PAGE 233

221 Hughes, A. and Nei, M. 1989. Nucleotide substitution at major histocompatibility complex class II loci: Evidence for overdominant selection. Proc. Natl. Acad. Sci. U. S. A. 86: 958. Hunig, T. R. Bevan, M. J. 1982. Antigen recognition by cloned cytotoxic T lymphocytes follows rules predicted by altered-self hypothesis. J Exp Med 155: 111. Hurme, M. Chandler, P.R., Heterington, CM., Simpson, E. 1978. Cytotoxic T-cell responses to H-Y: Correlation with the rejection of syngeneic male skin grafts. J. Exp. Med. 147: 768 • • v Jagadeeswaran, P., Forget, B. G. and Weissman, S. M. 1981. Short, interspersed repetitive DNA elements in eukaryotes: transposable DNA elements generated by reversed transcription of RNA pol III transcripts? Cell 26: 141. Janeway, C. A., Bottomly, K. Babich, J., Conrad, P., Conzen, S., Jones, B. Kaye, J., Katz, M. McVay, L. Murphy, D. B. and Tite, J. 1984. Quantitative variation in la antigen expression plays a central role in immune regulation. Immunol Today 5: 99. Jelinek, W.R. and Schmid, C.W. 1982. Repetitive sequences in eukaryotic DNA and their expression. Ann. Rev. Biochem. 51: 813 Jones, P. 1977. Analysis of H-2 and la molecules by twodimensional gel electrophoresis. J. Exp. Med 146: 1261. Jones, P. P., Murphy, D. B. and McDevitt, H. O. 1978. Two gene control of the expression of a murine la antigen. J. Exp. Med 148: 925. Juretic, A., Nagy, Z. A. and Llein, J. 1981. Detetection of CML determinants associated with H-2 controlled E£ and Ea chains. Nature (London) 298: 308. Kalb, V. F. Glasser, S., King, and Lingrel, J. B. 1983. A cluster of repetitive elements within a 700 base pair region in the mouse genome. Nucleic Acids Res 11: 2177. Kappler, J. W. Skidmore, B. White, J. and Marrack, P. 1981. Antigen-inducible H-restricted, interleukin-2producing T cell hybridoma. Lack of independent antigen and H-2 recognition. J Exp Med 153: 1198.

PAGE 234

5 222 Kappler, J. W. Wade, T. White, J., Kushnir, E., Blackman, M., Bill, J., Roehm, N. and Marrack, P. 1987. A T-cell receptor V§_ segment that imparts reactivity to a class II major histocompatibility complex product. Cell 49: 263. Kaufman, J. F. Auffray, C. Korman, A. J., Shackelford, D. A. and Strominger, J. L. 1984. The class II molecules of the human and murine major histocompatibility complex. Cell 36: 1. Kelly, F., and Condamine, H. 1982. Tumor viruses and early mouse embryos. Biochim. Biophys. Acta 651: 105. Kim, J.-H., Yu, C.-Y. Bailey, A., Hardison, R. and Shen, CK. J. 1989. Unique sequence organization and erythroid cellspecific nuclear factor-binding of mammalian 9 1 globin promoters. Nucleic Acids Res 17: 5687. King, D. P. and Jones, P. P. 1983. Induction of la H-2 antigens on a macrophage cell line by immune interferon. Jj. Immunol. 131: 315. King, D. Snider, L. D., and Lingrel, J. 1986. Polymorphism in an Androgen-Regulated Mouse Gene is the result of the insertion of a Bl repetitive element into the transcription unit. Mol. Cell. Biol 6: 209. Klein, J. 1975. Biology of the Mouse Histocompatibility Complex. Berlin: Springer-Verlag, New York. Klein, J. 1978. H-2 mutations: Their genetics and effect on immune function. 1978. Adv. Immunol 26: 55. Klein, J. 1980. Generation of diversity at MHC loci: Implication for T-cell receptor repertoires. In Fougereau, M. and Dausset, J.(eds.), Immunology 80, pp. 239. London, Academic Press. Klein, J. 1986. Natural history of major histocompatibility complex, John Wiley, New York. Klein, J. 1987. Origin of major histocompatibility complex polymorphism: The transpecies hypothesis. Human Immunology. 19: 155. Klein, J., and Figueroa, F. 1981. Polymorphism of the mouse H-2 loci. Immunol. Rev. 60: 23. Klein, J., and Figueroa, F. 1986. Evolution of the major histocompatibility complex. CRC crit. Rev. Immunol 6: 295.

PAGE 235

223 Klein, J., Figueroa, F., and Nagy, Z. A. 1983. Genetics of the major histocompatibility complex: the final act. Ann. Rev. Immunol 1: 119. Klein, J., Juretic, A., Baxevanis, C. N. and Nagy, Z. A. 1981. The traditional and a new version of the mouse H-2 complex. Nature (London) 291: 455. Klitz, W., Thomson, G. and Baur, M. P. 1986. Contrasting evolutionary histories among tightly linked HLA loci. Am. J. Hum. Genetics 39: 340. Kobori, J. A., Sinoto, A., McNicholas, J., Hood, L. 1984. Molecular characterization of the recombination region of six murine major histocompatibility complex (MHC) I region recombinants. J. Mol. Cell. Immunol 1: 125. Kominami, R. M. Muramatsu, M. and Moriwaki, K. 1983. A mouse type 2 Alu Seguence (M2) is mobile in the genome. Nature (London) 301: 87. Kramerov, D. A., Grigoryan, A. A., Ryskov, A. P., Georgier, G. P. 1979. Long double-stranded seguences (ds RNA B) of nuclear pre-mRNA consist of a few highly abundant classes of seguences: evidence from DNA cloning experiments. Nucleic Acids Res 6: 697. Krane, D. E., and Hardison, R. C. 1990. Short interspersed repeats in rabbit DNA can provide functional polyadenylation signals. Mol Biol Evol 7: 1. Krayev, A. S., D. A. Kramerov, K. G. Skryabin, A. P. Dyskov, A. A. Bayev, and G. P. Georgiev. 1980. The nucleotide seguence of the ubiguitous repetitive DNA seguence Bl complementary to the most abundant class of mouse fold-back RNA. Nucleic Acids Res 8: 1201. Kress, M. Barra, Y. Seidman, J. G. Khoury, G. and Jay, G. 1984. Functional insertion of an Alu-type 2 (B2 SINE) repetitive sequence in murinre class I genes. Science 226: 974. Kronenberg, M. Steinmeta, M. Kobori, T. Kaig, E., Kapp, J. A., Pierce, C. W. Sorensen, C. M. Suzuki, G. Tada, T. and Hood, L. 1983. RNA transcipts for IJ polypeptides are apparently not encoded between the I -A and I-E subregions of the murine major histocompatibility complex. Proc. Natl. Acad. Sci. U. S. A. 80: 5074.

PAGE 236

224 Krupen, K. Araneo, B. A., Brink, L. Kapp, J. A., Stein, S., Wieder, K. J. and Webb, D. R. 1982. Purification and characterization of a monoclonal T-Cell suppressor factor specific for polyCLGlu*" LAla^ LTyr") Proc. Natl. Acad. Sci. U. S. A. 79: 1254. Lafuse, W. and David, C. S. 1988. Recombination sites within the I region of the mouse H-2 complex. In David, C. S. (ed.), H-2 Antigens: Genes, molecules, function pp. 41-47, Plenum Press, New York. Lambowitz, A. M. 1989. Infectious introns. Cell 56: 323. Larhammar, D. Hammerling, U. Denaro, M. Lund, T. Flavell, R. A., Rask, L. and Peterson, P. A. 1983. Structure of the murine immune response l-Ap locus: sequence of the I-Ayq gene and an adjacent ^-chain second domain exon. Cell 34: 179. Lawlor, D. A., Ward, F. E., Ennis, P. D. Jackson, A. P. and Parham, P. 1988. HLA-A and B polymorphisms predate the divergence of humans and chimpanzees. 1988. Nature (London) 335: 268. Lehrman, M. A., Goldstein, J. L. Russel, D. W. and Brown, M. S. 1987. Duplication of seven exons in LDL receptor gene casued by Alu-Alu recombination in a subject with familial hypercholesterolemia. Cell 48: 827. Lieberman, R. Paul, W.E., Humphrey, W. Jr. Stimpfing, J.H. 1972. H-2linked immune response (Ir) genes Independent loci for Ir-IqG and Ir-IqA genes. J Exp Med 136: 1231. Lindahl, K. F. 1986. Genetic variants of histocompatibility antigens from wild mice. In Potter, M. Nadeau, J. H. and Cancro, M. P. (eds.) The Wild Mouse in Immunology Curr Top. Microbiol. Immunol 127: 272. Linial, M. Medeiros, E. and Hayward, W. S. 1978. An avian oncovirus mutant (SE21Q16) deficient in genomic RNA: biological and biochemical characterization. Cell 15: 1371. Livnat, S., Llein, J., Bach, F.H. 197 3. Graft versus host reaction in strains of mice identical for H-2K and H-2D antigens. Nature (London) 243: 42. Lozner, E.C., Sachs, D.H., Shearer, G.M. 1974. Genetic control of the immune response to staphylococcal nuclease. I. Ir-Nase: Control of the antibody response to nuclease by the Ir region of the mouse H-2 complex. J Exp Med 139: 1204.

PAGE 237

225 Luckett, W. P. and Hartenberger J. L. 1985. Evolutionary relationships among rodents. A multi-disciplinary analysis. Plenum Press, New York. Malissen, B. Peele-Price, M. Goverman, J. M. McMillan, M., white, J., Kappler, J., Marrack, P., Pierres, F. Pierres, M. Hood, L. 1984. Gene transfer of H-2 class II genes: Antigen presentation by mouse fibroblast and hamster B cell lines. Cell 36: 319. Maloy, W. L. Coligan, J. E. 1982. Primary structure of 2Dh alloantigen II. Additional amino acid sequence information, location of a third site of glycosylation and evidence for K and D region specific sequences. Immunoqenetics 16: 11. Marrack, P. and Kappler, F. 1986. The antigen-specific, major histocompatibility complex-restricted receptor on T cells. Adv. Immunol 38: 1. Marshall, J. T. Taxonomy. 1981. In Foster, H. L. Small, J. D. Fox, J. G. (eds.). The Mouse in Biomedical Research vol. I, pp. 17-25, Academic Press, Inc., New York, N.Y. Martin, M. A., Bryan, T. Rasheed, S. and Khan, A. S. 1981. Identif icastion and cloning of endogenous retroviral sequences present in human DNA. Proc. Natl. Acad. Sci. U. S. A. 78: 4892. Maruyama, T., and Nei, M. 1981. Genetic variability maintained by mutation and overdominant selection in finite populations. Genetics 98: 441. Mathis, D.J., Benoist, C. O. Williams, V. E. II, Kanter, M. R. McDevitt, H. O. 1983a. The murine E^ immune response gene. Cell 32: 745. Mathis, D. J., Benoist, C. William II, V. E., Kanter, M. and McDevitt, H. 0. 1983b. Several mechanisms can account for defective E gene expression in different mouse haplotypes. Proc. Natl. Acad. Sci. U. S. A. 80: 237. Mayer, W. E., Jonker, M. Klein, D. Ivanyi, P., Seventer G. v., and Klein J. 1988. Nucleotide sequence of chimpanzee MHC class I alleles: evidence for trans-species mode of evolution. EMBO J. 7(9): 2765. McCluskey, J., Germain, R. N. Margulies, D. H. 1985. Cell surface expression of an in vitro recombinant classll/class I major histocompatibility complex gene product. Cell 40: 247.

PAGE 238

McConnell, T. J., Talbot, W. S., Mclndoe, R. A. and Wakeland, E. K. 1988. The origin of MHC class II gene polymorphism within the genus Mus. Nature (London) 332: 651. McKinnon, R. D. Shinnick T. M. and Sutcliffe, J. G. 1986. The neuronal identifier element is a cis-acting positive regulator of gene expression. Proc. Natl. Acad. Sci. U. S. A. 83: 3751. McLachian, A. D. 1980. In Jaenicke, R.(ed.) Protein Folding pp. 79-99, Elsevier, North Holland. ^.^ McNicholas, J. M. Murphy, D. B. Matis, L. A., Schwartz, R. H., Lerner, E. A., Janeway, C. A. Jr., Jones, P. P. 1982. Immune response gene function correlates with the expression of an la antigen. I. Preferential association of certain Ae and Ea chains results in a quantitative deficiency in expression of an Ae^M complex. J. Exp. Med 155: 490. Melchers, I., Rajkewsky, K. Shreffler, D.C. 1973. IrLDHB:Map postion and functional analysis. Eur. J. Immunol. 3: 754. Mellor, A. L. Golden, L. Weiss, E. Bullman, H. Hurst, J., Simpson, E., James, R. Townsend, A. R. M. Taylor, P. M. Schmidt, W. Ferluga, J., Leben, L. Santamaria, M. Atfield, G., Festenstein, H. and Flavell, R. A. 1982. Expression of the murine H-2K ^ histocompatibility antigen in cells transformed with cloned H-2 genes. Nature (London) 298: 529. Mengle-Gaw, L. Conner, S., McDecitt, H. 0. and Fathman, C. G. 1984. Gene conversion between murine class I major histocompatibility complex loci. Functional and molecular evidence from the bml2 mutant. J Exp Med 160: 1184. Michaelson, J. Genetic polymorphism of /32 -microglobulin (B2m) maps the H-3 region of chromosome 2. 1981. Immunoqenetics 13: 167. Morse H. C. 1978. Origins of Inbred Mice Academic Press NewYork. Muller, U., Jongeneel C. V., Nedospasov, S. A., Fischer Lindahl, K. and Steinmetz, M. 1987a. Tumor necrosis factor and lymphotoxin genes map close to H-2D in the mouse major histocompatibility complex. Nature (London) 325: 265. Muller, U. Stephan, D. Philippsen, P., and Steinmetz, M. 1987b. Orientation and molecular map position of the complement genes in the mouse MHC. EMBO J 6: 369.

PAGE 239

227 Murphy, D. B. 1978. The I-J subregion of the murine H-2 gene complex. Springer Sem. Iitununopathol 1: 111. Murphy, D. B. 1981. Genetic fine structure of the H-2 gene complex. In Dorf, M. E. (ed.) The Role of the Manor Histocompatibility Complex in Immunobiologv Garland STPM, New York. Murphy, D.B., Herzenberg, L. A., Okumura, K. Herzenberg, L. A., McDevitt, H. O. 1976. A new I subregion ( I-J ) marked by a locus (Ia-4) controlling surface determinants on suppressor T lymphocytes. J Exp Med 144: 699. Nadeau, J. H. Wakeland, E. K. Gotze, D. and Klein J. 1981. The population genetics of the H-2 polymorphism in European and North African populations of the house mouse ( Mus musculus L. ) Genet. Res 37: 17. Nakamura, M. Manser, T. Pearson, G. D. N. Daley, M. J., Gefter, M. L. 1984. Effect of IFN-gamma on the immune response in vivo and on gene expression in vitro. Nature (London) 307: 381. Nathenson, S. G., Uehara, H. Errenstein, B. M. Kindt, T. J., Coligan, J. E. 1981. Primary structural analysis of the transplantation antigens of the murine H-2 major histocompatibility complex. Ann. Rev. Biochem. 50: 1025. Nei, M., Li, W.-H. 1979. Mathematical model for studying genetic variation in terms of restriction endonucleases Proc. Natl. Acad. Sci. USA 76: 5269. Nei, M. 1987a. In Molecular Evolutionary Genetics Columbia University Press, New York. Nei, M. 1987b. Relative roles of mutation and selection in the maintenance of genetic variability. Phil. Trans. R. Soc. Lond. B319: 615. Ng, R. Domdey, H. Lorson, G. Rossi, J. J., and Abelson, J. 1985. A test for intron function in the yeast actin gene. Nature (London) 314: 183. Norcross, M. A., Raghupathy, R. Strominger, J. L. Germain, R. N. 1986. Transfected human B lymphoblastoid cells express the mouse A''^-chain in association with DRv J Immunol 137: 1714. Okuda, K. David, C. S. 1978. A new lymphocyte-activating determinant locus expressed on T cells, and mapping in I-C subregions. J Exp Med 147: 1028.

PAGE 240

228 Orgel, L. E., and Crick, F. H. C. 1980. Selfish DNA: the ultimate parasite. Nature (London) 284: 604. Pamilo, P. and Nei, M. 1988. Relationships between gene trees and species trees. Mol. Biol. Evol 5: 568. Pan, J., Elder, J.T., Duncan, C.H., Weissman, S.M. 1981. Structural analysis of interspersed repetitive RNA polymerase III transcription units in human DNA. Nucleic Acids Res 9: 1151. Parham, P. 1984. A repulsive view of MHC-restriction. Immunol Today 5: 89. Perez-Stable, C, Ayres, T. M. and Shen, C. K. J. 1984. Distinctive sequence organization and functional programming of an Alu repeat promoter. Proc. Natl. Acad. Sci. U. S. A. 81: 5291. Perkins, D. L. Lai, M.-Z., Smith, J. A., and Gefter, M. L. 1989. Identical peptides recognized by MHC class Iand IIrestricted T cells. J. Exp. Med. 170: 279. Peterson, P. A., Cunninghan, B. A., Berggard, I., Edelman, G. M. 1972. )02-microglobulin-A free immunoglobulin domain. Proc. Natl. Acad. Sci. U. S. A. 69: 1697. Potts, W. K., Manning, C. J., Peck, A. B. Price-LaFace, M and Wakeland, E. K. 1988. Can heterozygotes advantage account for the maintenance of H-2 polymorphism ? In David, C. S.(ed.), H-2 antigens: Genes. Molecules. Function pp89102, Plenum Press, New York and London. Potts, W. K. and Wakeland, E. K. 1990. Evolution of diversity at the major histocompatibility complex. T. I. E. E. 5: 181. Pozzo, G. D. & Guardiola, J. 1990. A SINE insertion provides information on the divergence of the HLA-DQA l and HLA-D0A 2 genes. Immonoqenetics 31: 229. Rabourdin-Combe, C. Mach, B. 1983. Expression of HLA-DR antigens at the surface of mouse L cells cotransfected with cloned human genes. Nature (London) 303: 670. Rautmann, G. and Breatnach, R. 1985. A role for branch points in splicing in vitro. Nature (London) 315: 430. Rich, S. S., David, C. S., Rich, R. R. 1979a. Regulatory mechanisms in cell-mediated immune response VII. Presence of I-C subregion determinants on mixed leukocyte reaction suppressor factor. J Exp Med 149: 114.

PAGE 241

229 Rich, R. R., Sdeberry, D. A., Kastner, D. L. Chu, L. 1979b Primary in vitro cytotoxic response of NZB spleen cells to Qa-l''-associated antigenic determinants. J Exp Med 150: 1555. Rinehart, F. P., Ritch, T. G. Deininger, P. L. and Schmid, C. W. 1981. Renaturnation rate studies of a single family of interspersed repeated sequences in human deoxynucleic acid. Biochemistry 20: 3003. Robinson, R. R. Germain, R. N., McKean, D. J., Mescher, M. Seidman, J. G. 1983. Extensive polymorphism surrounding the murine la M chain gene. J Immunol 131: 2025. Robinson, P. J., Lundin, L. Sege, K. Graf, L. Wigzell, H., Peterson, P. A. Location of the mouse /32-microglobulin gene B2m determined by linkage analysis. 1981. Immunoaenetics 14: 449. Roger, J. H. 1985. The origin and evolution of retroposons. Int. Rev. Cvtol 93: 187. Roger, J. H. 1989. How were introns inserted into nuclear genes. T. I. G. 5: 213. Ruffner, D. E., Sprung, C. N. Minghetti, P. P., Gibbs, P. E. M. and Dugaiczyk, A. 1987. Invasion of the human albumin-a-fetoprotein gene family by Alu, Kpn, and two novel repetitive DNA elements. Mol. Biol. Evol 4: 1-9. Rupp, P., Acha-Orbea, H. Hengartner, H. Zinkernagel, R. and Joho, R. 1985. Identical T-cell receptor genes used in alloreactive cytotoxic and antigen plus I -A specific helper T cells. Nature (London) 315: 425. Sagai, T. Sakaizumi, M. Miyashita, N. Bonhomme, F., Petras, M. L. Nielsen, J. T., Shiroishi, T. and Moriwaki, K. 1989. New evidence for trans-species evolution of the H-2 class I polymorphism. Immunoqenetics 30: 89. Sage, R. D. 1981. Wild mice. In H. L. Foster, J. D. Small and Fox, J. G. (eds.), The Mouse in Biomedical Research pp. 39-99, Academic Press, New York. Sambrook, J., Fritsch, E. F. and Maniatis, T. 1989. Isolation of high-molecular-weight DNA from mammalian cells pp. In Molecular cloning a laboratory manual pp, 9.149.19, 2nd ed. Cold Spring Harbor Laboratory Press, New York. Sandrin, M. S., McKenzie, I. "F. C.1981. Production of a cytotoxic anti-la. 6 antibody. Immunoqenetics 14: 345.

PAGE 242

230 Sanger, F., Nicklen, S., and Coulson, A. R. 1977. DNA sequencing with chain terminating inhibitors. Proc. Natl. Acad. Sci. U. S. A. 74: 5463. Sant, A. J. and Germain, R. N. 1989. Intracellular competition for component chains determines class II MHC cell surface phenotype. Cell 57: 797. Schmid, C. W. & Deininger, P. L. 1975. Sequence organization of human genome. Cell 6: 345. Schmid, C. W. and Jelinek, W. R. 1982. Sequence organization of human genome. Science 216: 1065. Schmid, C. W. and Shen, C.-K. J. The evolution of interspersed repetitive DNA sequences in mammals and other vertebrates. 1985. In Maclntyre, R. J. (ed) : Molecular Evolutionary Genetics pp. 323-352, Plenum Press, New York. Schuler, L. A., Weber, J. L. and Gorski, J. 1983. Polymorphism near the rat prolactin gene caused by insertion of an Alu-like element. Nature (Londond) 305: 159. Sharma, S., Metha, S, Morgan, J. and Maizel, A. 1987. Molecular cloning and expression of a human B-cell growth factor gene in Escherichia coli. Science 235: 1489. Sharp, P. A. 1983. Conversion of RNA to DNA in mammals: Alulike elements and pseudogenes. Nature (London) 301: 471. She, J. X., Bonhomme, F. Boursot, P., Thaler, L. and Catzeflis, F. 1990a. Molecular phylogenies in the genus Mus : Comparative analysis of electrophoretic, scnDNA hybridization and mtDNA RFLP data. Biol. J. Linn. Soc 41: 83. She, J. X., Boehme, S., Wang, T. W. Bonhomme, F. and Wakeland, E. K. 1990b. The generation of MHC class II gene polymorphism in the genus Mus. Biol. J. Linn. Soc 41: 141. Shiroishi, T. Hanzawa, N., Sagai, T. Ishiura, M. Gojobori, T., Steinmetz, M. and Moriwaki, K. 1990. Recombinational hotspot specific to female meiosis in the mouse major histocompatibility complex. Immunoqenetics 31: 79. Silver, J., Swain, S. L. Hubert, J. J. 1980. Small subunit of I-A subregion antigen determines the allospecif icity recognized by monoclonal antibody. Nature (Londlon) 286: 272.

PAGE 243

231 Singer, M. F. 1982. Highly repeated sequences in mammalian genomes. Int. Rev. Cvtol 76: 67. Slagel, V., Flemington, E. Traina-Dorge, V., Bradshaw, H., Deininger, P. 1987. Clustering and subfamily relationships of the Alu family in the human genome. Mol. Biol. Evol 4: 19. Smith, L. J., Braylan, R. C. Nutkis, J. E. Edmundson, K. B. Downing, J. R. and Wakeland, E. K. 1987. Extraction of cellular DNA from human cells and tissues fixed in ethanol. Anal. Biochem 160: 135. Southern, E. 1975. Detection of specific sequences among DNA fragments separated by gel electrophoresis. J. Mol. Biol 98: 503. Snell, G. D. 1968. The H-2 locus of the mouse, observation and speculations concerning its comparative genetics and its polymorphisms. Folia Biol 14: 335. Spencer, J. S. and Kubo, R. 1989. Mixed isotype class II antigen expression. A novel class II molecule is expressed on a murine B cell lymphoma. J Exp Med 169: 625. Steeg, P. S., Moore, R. N. Oppenheim, J. J. 1980. Regulation of murine macrophage la-antigen expression by products of activated spleen cells. J Exp Med 152: 1734. Steinmetz, M. Malissen, M, Hood, L. Orn, A., Maki, R. A., Dastoormikoo, G. R. Stephan, D. Gibb, E. and Romaniuk, R. 1984. Tracts of high or low swquence divergence in the mouse major histocompatibility complex. EMBO J 3: 2995. Steinmetz, M. Minard, K. Horvath, S., McNicholas, J., Frelinger, J, Wake, C, Long, E., Mcah, B. and Hood, L. 1982a. A molecular map of the immune response region from the major histocompatibility complex of the mouse. Nature (London) 300: 35. Steinmetz, M. Moore, F. K. W. Frelinger, J. G., Sher, B. T. Shen, F.-W., Boyse, E. A. and Hood, L. 1981. A pseudogene homologous to mouse transplanation antigens : Transplantation antigen are encoded by eitht exons that correlate with protein domains. Cell 25: 683. Steinmetz, M. Stephan, D. and Fischer-Lindahl K. 1986. Gene organization and recombinational hotspots in the murine major histocompatibility complex. Cell 44: 895.

PAGE 244

Steinmetz, M. and Uematsu, Y. 1987a. The major histocompatibility complex of the BALB/C mouse: gene organization and recombination. In David, C. S. (ed.): H-2 Antigens: Genes, molecules, function pp. 31-39. Plenum Press, New York. Steinmetz, M. Uematsu, Y., and Lindahl K. F. 1987b. Hotspots of homologous recombination in mammalian genomes. T. I. G 3: 7. Steinmetz, M. Winoto, A., Minard, K. and Hood, L. 1982b. Cluster of genes encoding mouse transplantation antigens. Cell 28: 489. Stephan, D. Sun, H. Fischer Lindahl, K. Meyer, E. Hammerling, G., Hood, L. and Steinmetz, M. 1986. Organization and evoluiton of D region class I genes in the major histocompatibililty complex. J Exp Med 163: 1227. Strominger, J. L. Orr, H. T., Parham, P., Ploegh, H. L. Mann, D. L. 1980. An evaluation of the significance of amino-acid sequence homologies in human histocompatibility antigen ( HLA-A and HLA-B ) with immunoglobulins and other proteins, using relative short sequences. Scand. J. Immunol 11: 573. Tacchini-Cottier, F. M. and Jones, P. P. 1988. Defective E; expression in three mouse H-2 haplotypes results from aberrant RNA splicing. J. Immunol 141: 3647. Uematsu, Y,, Kiefer, H. Schulze, R. Fischer Lindahl, K. and Steinmetz, M. 1986. Molecular characterization of a meiotic recombinational hotspot enhancing homologous equal cross-over. EMBO J 5: 2123. Uhr, J.W., Capra, J.D., Citetta, E.S.,Cook, R.G. 1979. Organization of the immune response genes. Science 206: 292 Ullu, E., and Weiner, A. M. 1985. Upstream sequences modulate the internal promoter of the human 7SL RNA gene. Nature (London) 318: 371. Unanue, E. R. and Allen, P. M. 1987. The basis for the immunoregulatory role of macrophages and other accessory cells. Science 236: 551. Urba, W. J., Hildemann, W. H. 1978. H-2 -linked recessive Ir gene regulation of high antibody responsiveness to TNP hapten conjugated to autologous albumin. Immunoqenetics 6: 433.

PAGE 245

233 VanArsdell, S. W. R. A. Denison, L. B. Bernstein, A. M. Weiner, T, Manser, and R. F. Gesteland. 1981. Direct repeats flank three small nuclear RNA pseudogenes in the human genome. Cell 11. Vanin, E. 1984. Processed pseudogenes: characteristica and evolution. Biochim Biophys. Acta 782: 2 31. Wake, C. T. and Flavell, R. A. 1985. Multiple mechanisms regulate the expression of murine immune response genes. Cell 42: 623. Wakeland, E. K. Boehme, S., She, J. X. The generation and maintenance of MHC Class II gene polymorphism in rodents. 1990a. Immunological Rev. 113: 207. Wakeland, E. K. Boehme, S., She, J. X., Lu, C.-C, Mclndoe, R. A., Cheng, I., Ye, Y and Potts, W. K. 1990b. Ancestral polymorphisms of MHC Class II genes: Divergent Allele Advantage Immunological Research. Wakeland, E. and Darby, B. 1983. Recombination and mutation of class II histocompatibility genes in wild mice. Immunol 131: 3052. Wakeland, E. K. Darby, B. and Coligan, J. E. 1985. ^ Localization of stuctural variations distinguishing I-A related molecules to the al and /31 domains. J. Immunol. 135; 391. Wakeland, E. K. Klein, J. 1979. Structural comparisons of serologically identical lA and IE-encoded antigens from inbred and wild mice. Immunogenetics 9: 535. Wakeland, E. and Klein, J. 1983. Evidence for minor structural variations of class II genes in wild and inbred mice. J Immunol 130: 1280. Wakeland, E. K. and J. H. Nadeau. 1980. Immune responsiveness polymorphism of the major histocompatibility complex: an interpretation. In Sercarz, E. I and Cunningham, A. J. (eds.). Strategies of Immune Regulation pp. 149-156, Academic Press, New York. Watson, J. B. and Sutcliffe, J. G. 1987. Primate brainspecific cytoplasmic transcript of the Alu repeat family. Mol. Cell. Biol. 7: 3324. Waltenbaugh, C. 1981. Regulation of immu e response by IJ gene products. I. Production and characterization of antiI-J monoclonal antibodies. J Exp Med 154: 1570.

PAGE 246

234 Walter, P., and Blobel, G. 1982. Signal recognition particle contains a 7S RNA essential for protein translocation across the endoplasmic reticulum. Nature (London) 299: 691. Watkins, D. I., Hodi, F. S., Letvin, N. L. 1988. A primate sepcies with limited major histocompatibility complex class I polymorphism. Proc. Natl. Acad. Sci. U. S. A 85: 7714. Widera, G. and Flavell, R. A. 1985. The I-region of the C57BL/10 mouse: characterization and linkae to H-2K of a novel SB/3-like class II pseudogene A/93. Proc. Na tl. Acad. Sci. U. S. A 82: 5500. Weiner, A. M. P. L. Deininiger, and A. Ef stratiadis. 1986. Nonviral retroposons: genes, pseudogenes, and transposable elements generated by the dreversed flow of genetic information. Annu. Rev. Biochem. 55: 631. Weiss, E. H., Golden, L. Fahrner, K. Mellor, A. L. Devlin, J. J., Bullman, H. Tiddens, H. Bud, H. and Flavell, R. A. 1984. Organization and evolution of the class I gene family in the major histocompatibility complex of the C57BL/10 mouse. Nature (London) 310: 650. Wilson, S. H. and Kuff, E. D. 1972. A novel DNA polymerase activity found in association with intracisternal A-type particles. Proc. Natl. Acad. Sci. U. S. A 69: 1531. Winoto, A., Steinmetz, M. and Hood, L. 1983. Genetic mapping in the mouse major histocompatibility complex by restriction enzyme polymorphisms: most mouse class I genes maps to the Tla complex. Proc. Natl. Acad. Sci.U. S. A. 80: 3425. Yamazaki, K. Boyse, E. A., Mike, V., Thaler, H. T. Mathieson, B. J., Abbott, Boyse, J. Zayas, Z. A., Thomas, L. 1976. Control of mating preferences in mice by genes in the major histocompatibility complex. J Exp Med 144: 1324. Yokoyama, K. Nathenson, S. G. 1983. Intramolecular organization of class I H-2 MHC antigens; localization of the alloantigenic determinants and the )92m binding site to different regions of the H-2 K*" glycoprotein. J Immunol 130: 1419. Yonekawa, H., Moriwaki, K. Gotoh, O. Miyashita, N., Matsushima, Y., Shi, L. Cho, W. S., Zhen, X.-L. and Tagashira, Y. 1988. Hybrid origin of Japanese mice" Mus musculus molossinus Evidence from restriction analysis of mitochondria DNA. Mol. Biol. Evol. 5: 63.

PAGE 247

Zelnick, C. R. D. J. Burks, and C. H. Duncan. 1987. A composite transposon 3' to the cow fetal globin gene binds a sequence specific factor. Nucleic Acids Res. 15: 10437. Zinkernagel, R. M. and Doherty, P. C. 1974. Immunological surveilance against altered self components by sensitized T lymphocytes in lymphocyte choriomeningitis. Nature (London) 251: 547.

PAGE 248

BIOGRAPHICAL SKETCH Cheng-Chan Lu was born in Taiwan, Republic of China, on November 16, 1953. He grew up in Tainan, a historical city in South Taiwan. As a child he enjoyed many extracurricular activities, but enjoyed playing baseball the most. While attending medical school of National Taiwan University, he cultivated an interest in many sports. His favorites were fencing, ping-pong, baseball and tennis. After graduating from National Taiwan University, he served two years in the army at a general hospital in Taiwan, and then he started thinking of pursuing advanced education to satisfy his desire for knowledge. Although he had previously performed research with Dr. Czau-Siung Yang during his years in medical school, he now sought more challenging bench work. Consequently, he went to National Yang-Ming Medical College to work with Dr. Wu-Tse Liu. There he spent two years working as a research and teaching assistant before coming to Florida to pursue a Ph.D. He first studied at the University of South Florida and then transferred to University of Florida. He received his Doctor of Philosophy degree from the Department of Pathology and Laboratory Medicine at the University of Florida in 1990. 236

PAGE 249

I certify that I have read this study and that in my opinion it conforms to acceptable standards of scholarly presentation and is fully adequate, in scope and quality, as a dissertation for the degree of Doctor of Philosophy. Edward K. Wakeland, Chair Professor of Pathology and Laboratory Medicine I certify that I have read this study and that in my opinion it conforms to acceptable standards of scholarly presentation and is fully adequate, in scope and quality, as a dissertation for the degree of Doctor of Philosophy. Kuo-Jang Kao Associate Professor of Pathology and Laboratory Medicine I certify that I have read this study and that in my opinion it conforms to acceptable standards of scholarly presentation and is fully adequate, in scope and quality, as a dissertation for the degree of Doctor of Philosophy. Harry S/jNick Associate Professor of Biochemistry and Molecular Biology I certify that I have read this study and that in my opinion it conforms to acceptable standards of scholarly presentation and is fully adequate, in scope and quality, as a dissertation for the degree of Doctor of Philosophy. AmmOn B. Peck Associate Professor of Pathology and Laboratory Medicine

PAGE 250

I certify that I have read this study and that in my opinion it conforms to acceptable standards of scholarly presentation and is fully adequate, in scope and quality, as a dissertation for the deqree of Doctor of Philosophy. William E. Winter Associate Professor of Pathology and Laboratory Medicine This dissertation was submitted to the Graduate Faculty of the College of Medicine and to the Graduate School and was accepted as partial fulfillment of^ the requirements for the degree of Doctor of Philosophy. // ^ December 1990 Dean, College of Medicine Dean, G^duate School


Figure 3-1. The genomic restriction map of Abd probe. The blank boxes
indicate the exons encoded by protein domains. The region of gene
spanned by the 5.8 kb Eco RI fragment is illustrated by the thick line
below the map. The 5' and 3' regions of the probe are also indicated
by thick lines below.


20
identified. Ab, Aa and Ea were identified by DNA sequence
analysis, and Eb was identified by a specific oligonucleotide
probe. Eb2 was identified by cross-hybridization with a human
DRA cDNA probe and mouse Eb gene. The identity of Eb gene was
confirmed by comapping via RFLP analysis which localizes a
serologically defined Eb recombinant in the middle of Eb gene
(reviewed by Hood et al. 1983). Southern blot analysis of
mouse genomic DNA with class II probes suggested that class
II genes are single copy and that there are no more than two
a genes and six /3 genes in the mouse genome (Steinmetz et al.
1982a; Devlin et aJL. 1984) All the known class II loci are
contained in a tightly-linked cluster, inserted between the
H-2K and C4 genes. This cluster contains 4 functional genes
and 4 pseudogenes, which are further divided into two
subclasses, I-A and I-E. The eight class II genes, Pb (A^) ,
Ob (A^) Ab, Aa, Eb, Eb2. Ea, and Eb3. are arranged in this
order from the centromeric towards the telomeric end
(Steinmetz et al. 1982a; Davis et al. 1984; Larhammar et al.
1983; Widera et al. 1985) (Figure 2-1 & Figure 2-3). Out of
the eight genes, only four are have been shown to encode gene
products, Aa coupled with A^ to form I-A molecules, E with
to form I-E molecules (Jones et al. 1978; Uhr et al. 1979).
The Ob and Eb2 genes are reported to be transcribed, but at
very low levels and have no detectable protein product (Wake
& Flavell 1986). The Pb gene is a pseudogene, at least in the
b and k haplotypes, as it has a deletion of eight nucleotides


146
lineage 2 by two additional insertional events, it is
unlikelythat these events occurred in the same region
simultaneously. As one of the inserted sequenced (B1 repeat)
is only 174 bp in length, it is tempting to speculate that its
insertion is beyond detection on a 0.7 % agarose gel. To
examine this possibility, PCR technique is exploited to
amplify the genomic DNA using a pair of synthetic oligomers
(5 CCTTGAGGGCCACGGTTGTC 3 5 GATACCCCCAGAGCCTCTCA 3 )
(Figure 3-3). The rationale for this PCR experiment is as
follows: any allele that contains this 174 bp B1 family repeat
will be amplified as 375 bp fragment, while, alleles without
this insert will display a 192 bp fragment (Figure 3-3). A
total of 106 H-2 haplotypes were tested by PCR amplification.
A panel of DNA samples representing the different species and
subspecies of genus Mus amplified by PCR were run on a 4%
Nusieve agarose gel (Figure 4-13). The results of these
experiments can be summarized as follows: First, as expected,
all lineage 3 alleles, including B10.BR, AKR, B10.CHA2,
BIO.PL, NZW, MDLII, DFCII, DBVII amplify a band around 375 bp
on a 4% Nusieve agarose gel (Figure 4-14). Certain
recombinant inbred strains, e.g. B10.MBR, B10A(4R), B10.TL
exhibit a 375 bp band as well (Figure 4-14). The outcome of
these recombinant inbred strains is not unexpected as these
recombinants contain I-A subregion derived from lineage 3
alleles, specifically from k haplotype. All lineage 1 and 2
alleles, with the exception of one allele, MBBII, exhibit a


34
heterodimer in approximately equivalent proportions. Such a-
and p- chain mixing within an isotype did not seem to occur
between distinct isotypes (i.e. A^E*) However, during
attempts to develop cell lines expressing only Fl-type la
molecules (e.g. a/a^) it was found that although haplotype-
matched A^A^ pairs yield high expression in primary
transfectants, cotransfection of haplotype-mismatched pairs
gave little or no expression (Germain et al. 1985). This was
true even though the genes used for the matched or mismatched
gene pairs were identical, and despite the presence of
detectable Aa and Ab mRNA in the nonexpressing cells.
Additional experiments revealed that for genes of b, d and k
haplotypes, cis-chromosomal a:/3 pairs (e.g. hfhfi*) always
gave better expression than trans-pairs (e.g. AakApb) ;
experiments also indicated that the expression of the latter
varied over a wide range, depending on the particular allelic
forms of a and p employed. Furthermore, AaV and AakA^b
molecules, the basis for previous suggested "free pairing",
are the best expressed haplotype-mismatched mixes, whereas
A^Apd has never been detected. In order to map the region of
the Ap molecules controlling the preferential pairing,
recombinant Ap molecule involving the b, d and k alleles were
constructed. The entire A^ domain was exchanged between
different alleles, or the amino-half of Awas covalently
linked to the carboxyl-half of A^ and various Ap2, TM and CY
regions. These "domain and hemi-domain shuffled" Ab genes


CLASS II (GENE
CLASS II aGENE
$2 TM CY 3UT
to
to
3UT
TM/CY


61
adapt their antigenicity to minimize immune recognition by the
most prevalent Mhc genotypes in a population. Consequently,
new or rare Mhc alleles will have a selective advantage due
to increased resistance to prevalent pathogens. This model
predicts cyclic fluctuations in the frequencies of Mhc alleles
as pathogens are driven to evolve antigenicity, evading the
immune responsiveness of a series of new "prevalent" alleles.
This model can explain the maintenance and long persistence
of polymorphic alleles by rescuing the rare alleles from
distinction (Wakeland et al. 1990).
Recombination Within the Mhc
Recombinational hot spot within I region
The genetic material is a dynamic structure that
reorganizes during evolution and differentiation. Nucleotide
sequences are rearranged by recombination between homologous
or non-homologous sequence. While homologous equal
recombination breaks and rejoins chromosomes at precisely the
same position, unequal recombination between homologous
sequences in different positions leads to duplication and
deletions. Over the last ten years recombinant mouse strains
have been analyzed by RFLP analysis and DNA sequencing to map
the crossover in the I region (Steinmetz et al. 1982a) These
studies have shown that recombination within the I region is
not random, but localized to specific sites. These sites


199
with AG dinucleotides. Subsequently, these inserted sequences
would be removed from primary transcripts by RNA processing.
However, in studies of Ab gene expression using DNAase I
hypersensitivity (DH) assay, it has been shown that DH sites
unique to transcriptionally active tissues were mapped into
SINE elements (Mclndoe et al. 1990). These data suggest that
the retroposon insertions in the gene may have a subtle
unrecognized effect on the expression of Ab genes. The
influence of these retroposon insertions on Ab gene expression
may be significant in light of the fact that numerous studies
have shown the level of la antigen expression is critical to
the efficiency of antigen-presentation to T cells (Matis et
al. 1983; Janeway et al. 1984). Moreover, the exceptionally
high abundance of SINEs in the intron may reflect a more open
chromatin structure associated with such genes in the germ
line (Slagel et al. 1987)
Linkage Diseauilibria Among Restriction Sites
Among the 115 H-2 haplotypes studied in this
dissertation, a total of 86 Ab alleles was identified by RFLP
analysis. Close inspection of their restriction maps revealed
one unusual feature of restriction-site polymorphism, that is,
there is strong nonrandom association of polymorphic
restriction sites among themselves. This nonrandom
association or linkage disequilibrium occurs mainly because


Restriction Site Allele (A^)
CD'COt-OCOt-
h ID CO CM CM CM CO
L m m
XXXXIII^^cvi
EEEEEEEI
CO
in
in
h-
in
CM
T-
3
CM
CO
in
CO
CO
1
CM
CM
1
T

t
in
CM
CD
T-
CM
CM
i
CM
CM
2
CO
CM
CO
in
1
1
i
1
1
1
1
CJ
u
u
U
o
o
to
to
M
c/>
to
to
*M
c/>
to
-M
C/>
c
c
c
c
c
c
D)
O)
CO
CO
CO
CO
CO
CO
CO
CO
X
X
X
X
X
X
CD
CD
m
N-
o>
o
i
"5
£
't
2 9 CV1
CC CC v
0 0^3
0 0(0
LU LU D_
Example:
B10.D2 1 000010101001000100111010011110
1: presence, 0: absence of restriction site
B10.D2


S.H S.E 118P.B S.B E.Bg
I 1 I 1 I 1 l 1 I 1
KUZKU ZUKZKU ZKUZ


62
have been termed recombination hot spots (RHS) (Steinmetz et
al. 1982a). A first such RHS, localized with the intron
between the second and third exons of Eb gene, was identified
from analysis of six intra-I region recombinant mouse strains
(Kobori et al. 1984) Since then, additional three RHS's have
been identified within the Mhc, including K/Pb, Pb/Ob
(Steinmetz et al. 1986; Uematsu et al. 1986) and Ea (Lafuse
& David, 1986) (Figure 2-10). RFLP analysis indicates that
recombination within the Pb/Ob, Eb and Ea is reciprocal
(Steinmetz et al. 1982a; Steinmetz et al. 1987; Lafuse & David
1987). Analysis of secondary recombinant strains indicates
that chromosomes that have recently undergone a recombinant
event are unstable and quite likely to undergo a second
recombination in the next generation (Lafuse & David 1987).
Molecular basis of recombinational hotspots
In the human genome, recombinational hotspots mainly
occur in regions containing hypervariable minisatellite
sequences. These minisatellite sequences are composed of
tandem repeats and occur at multiple locations. The repeat
unit contains a common 16-bp core sequence, GGAGGTGGGCAGGARG.
DNA sequence searchs for the Pb/Ob and Eb recombinational
hotspots have found that short repeated sequences with some
homology to the recombination signal Chi (GCTGGTGG) of phage
lambda: (CAGA)6 in the Pb/Ob hotspot and (CAGG)7_9 in the Eb
hotspot (Steinmetz et al. 1986). The CAGG repeated sequence


170
B10.D2
MBB I
MBK
CAS
SFM I
STF I
XBJ I
XBJ II
XBS
ZBN I
ZBN II
ZYD I
ZYP I
BS Bg P\
II ""l I I
p
Pv S PvH S
3 u
I-
>V
E B S H Bg
1 II II
BS H Bg Pv
III "1 1
S PvH S
1 1 1
3 u
r-
>v
E B S Bg
1 II 1
BS H Bg P\
III "111
P *
P
PvH S
1 1 1
S u
B
1
5v
E B S H Bg
1 II II
BS b9 P>
II "III
P
Pv
SPvH S
II 1 1
5 h
yr
B
I
5v
E B S Bg H
1 III 1
BS H B^Pv
III II
P A
P
S PvH S
III 1
3 u
1/f
B
1
>v
B S Bg
1 1 1
BS H Bg PvE
III "ill
P
PN
S PvH s
1 1 1
3 u
ii
*v
E B S H Bg
1 II II
BS H P't
J 1 II
3 P!
/Pv Si
1 1 1
rH-
B
1
>v
E B S H
III 1
BS H Pv
ll 1 1
p
PV PvH S
5 H
I-
>v
BS H
1 1 1
Bs H Bg Pv
III II
0
p
PVH S ;
1 1
SH
A
B
>v B
E s H Bg
r i ii
BS H P\
III II
Px
PvH
1 1
rHf
B
>v
E B S H
1 III
B Pv
1 1
3
Px
Pv S
k
F
B
1
>v
B S
1 1
BS H P\
III II
3 5
p
PvH S .j
A
B
1
>v
E B S H
1 III
BS H PME
U 1 LL
P" S1
> h
L*
>v
E SB H 1 Kb
J U I


Figure 4-5 continued
GGATATTGAT TAGTTTATAT TGTTGTTCCA
TGGGTACTTT CTCTAACTCC TCCATTGGGG
AGCATCCACT TCTGTATTTG CCAGGTATTG
GTCCTTTCAG CATAATTTTG CTGGCATATG
GGGATGGATC CCCGGGTGGG GCATGTATGC
GGCAAGAAGG CTTCTGAGGT AGTGGGCACA
GTCTGTGCAC AACAGTCTGA GGGATGAAGG
TCCCCCCCCC AAATTATTAA CTTGAAATCG
CTTTATAAAG ACAATTTATT TTTGTACTTA
AATTAAATAC ACAGCGGGTT TACAAAGAAG
TTGTGCTATA GGCCAGGCTG GCCTTGAACT
AGTGTACCAC CACCTCCTGG CTTCTTTTGT
GGCCACACTG TTATTTTCCC AGTGAGTTAA
CTGTTAGAAC CTAGGCATTC ATTCCCACCC
CTCACATTTC ACTCACTGTC TTTTCTGTCA
TGTCCAGGAC AGAGGCCCTC AACCACCACA
ACCCAGCCAA GATCAAAGTG CGCTGGTTCC
CGTCCACACA GCTTATTAGG AATGGGGACT
TGACCCCTCG GCGGGGAGAG GTCTACACCT
CCATCACCGT GGAGTGGCGT AAGGGAATTT
ATTTTAGGTG TTATTATCCC ATCCCTCCAA
ATCTGCTTCC TCTACTGAGC TGAGACCTAC
GGCATCAGGA GAGCCCTGAC CTATCTTCTC
CTGGGGCCCT GAAACTTGTC CCTAATATCC
CTTAGCTCTA TTCCCCAGGG GCACAGTCCG
TCGGTGGCTG CGTGCTTGGG GTGATCTTCC
GTCAGAAAGG TGAGGAGCTA TGGAGAACTG
AAATGAAGGT CCCAGGAGAG ACACTGGGAT
AGCCATGGTG GAGCTC 3735
CCTATAGAGT TGCAGACCCC TTCAGCTCCT
GCCCTGTGTT CCATCCTATA GATGACTGTG
CATAGCCTCA CAAGAGACAG TTATATCAGG
CAATAGTGTC TGCGTTTGGT GGCTGATTAT
TGTTTTCAAC TTGAAGGGAT AACAGCACTT
ATATATCAAA GTCAGTCGAG AAACACTTGT
AAGGATGTCG TACTGCAGTT ATTTTTGCAA
AAATCAGTTT TCTTTTGTCT TGTTTGTTTG
GTTTAAATAA AAATATTTTA TTTACACATA
GTTTGTGTCA AGTCCTGGCT GTCCTAGACC
CATAAGAGAT CCTCCTGGCT CTACCTCCTG
CTTACTACAT TTCACATTGT ATGGGAACAG
GTTTGTATTT GTGGAGTTAT TCTTCATTCA
TGCCTCTTCC CAGGGGAGTC TCCACATGGC
CCCTAGAACA GCCCAGTGTC GTCATCTCCC
ACACGCTGGT CTGCTCAGTG ACAGATTTCT
GGAATGGCCA GGAGGAGACG GTGGGGGTCT
GGACCTTCCA GGTCCTGGTC ATGCTGGAGA
GCCATGTGGA GCATCCCAGC CTGAAGAGTC
TATTTCACTG TGGGCCCCAC ATGACATGGG
TGTCACCCAC CCCATCATTT GTCCTATATG
AGGAAATCAT ATCTCTCACC TCATAGTCAG
AGACAGCAGT TCTGGAGATC ACTACATACA
AGAGGAATTG GCTGAAGTAG ATTGTAGACA
AGTCTGCCCG GAGCAAGATG TTGAGCGGCA
TCGGGCTTGG CCTTTTCATC CGTCACAGGA
GGGGTGGTGG GCTGTGCTGC AGGTGGGAGG
CTGATTTTGC TGGTTATGTG ACCGCCACAG
2160
2280
2400
2520
2640
2760
2880
3000
3120
3240
3360
3480
3600
3720
128


CHAPTER 1
INTRODUCTION
The I region of the murine major histocompatibility
complex (H-2) contains a tightly-linked cluster of highly
polymorphic genes (class II) that control immune
responsiveness. Two major hypotheses have been proposed to
account for the origin of this polymorphism, which is believed
to be essential for the function of the class II proteins in
immune protection of host. The first was that hypermutational
mechanisms (gene conversion or segmental exchange) promote the
rapid generation of diversity in Mhc genes. The alternative
was that polymorphism arose from the steady accumulation of
mutations over long evolutionary periods, and that multiple
specific alleles commonly survived speciation event (trans
species evolution or ancestral polymorphism). In a previous
study, McConnell et aJL. (1988) used restriction fragment
length polymorphism (RFLP) and sequence analysis to seek
evidence of "segmental exchange" and/or "trans-species
evolution" in the class II genes of the genus Mus by a
molecular genetic analysis of Ab alleles. This study detected
31 Ab alleles in a collection of 49 H-2 haplotypes derived
1


122
triangle in Figure 4-3), estimated to be about 100 bp in
length. Size changes smaller than this were undetected. A
few lineage-specific restriction sites, denoted by encircled
letters, were also revealed from restriction analysis (Figure
4-3) .
Distinct Intron Size Between Lineage 2 and 3 Alleles
A comparison of genomic structure of one prototypic
lineage 2 (b haplotype) and lineage 3 (k haplotype) alleles
is shown in Figure 4-4. Among other differences, the major
characteristic distinguishing lineage 2 and 3 alleles resides
in the intron separating A^ and A^2 exons. The size
difference between these two introns was estimated to be 0.75
kb by comparing PvuII fragments from Abb (3.79 kb) and Abk(4.6
kb) .
DNA Sequence of Lineage 3 Intron
To clearly define the nature of the lineage 3 allele
intron between A^ and A^ exons and the evolutionary
relationships among different lineage alleles, DNA sequence
analysis was performed. A recombinant plasmid PI-Abk-gpt-l
containing Abk gene was subcloned and relevant regions were
sequenced by Sanger's dideoxynucleotide termination method
(Sanger et al. 1980). A total of 3,735 bp of DNA sequence
spanning the intron between A^ and A2, through A2


A/?
Lineage Allele
1
d,q
s,f
k,u
P 1
Exon
nod
intron
insertions
P 2
Exon
intragenic
segmental
exchange


Page
Nucleotide Sequencing 100
Data Analysis 101
RFLP Patterns of Ab Alleles and Their
Phylogenetic Relationships 101
Computer Programs 104
Polymerase Chain Reaction(PCR) Amplification 105
Enzymatic Amplification of Genomic DNA 105
Amplification of Central Fragment for
DNA Hybridization 109
4 SEQUENCE ANALYSIS OF LINEAGE 3 ALLELES .... 114
Restriction Enzyme Analysis of Lineage 3
Alleles 114
Restriction-Site Polymorphism of Lineage
3 Alleles 114
Distinct Intron Size Between Lineage 2
and 3 Alleles 122
DNA Sequence of Lineage 3 Intron 122
Lineage 3 Derived from Lineage 2 125
Ab Genes Can Be Divided Into 4 Lineages. ... 141
Defining Evolutionary Lineage 2B 141
4 Evolutionary Lineages of Ab Genes . 156
5 EVOLUTION OF MHC CLASS II GENE POLYMORPHISM. 159
RFLP Analysis of Ab Genes Within the Genus
Mus 159
Lineage Distribution of Ab Alleles Within the
Genus Mus 177
Phylogenetic Relationships of 86 Ab Alleles
in the Genus Mus 180
6 DISCUSSION 193
Function of Mhc Genes 193
Features of Mhc Polymorphism 194
Mechanism of Generating Ab Gene Polymorphisms 195
Mhc Genes Evolve via Trans-species Mode . 196
Possible Impact of Retroposon on Ab Gene
Expression 198
Linkage Disequilibrium Among Restriction
Sites 199
Maintenance of Mhc Polymorphism 201
Overdominant Slection for Mhc
Polymorphism 203
Divergent Allele Advantage 204
Alu-like Repetitive Elements in Ap Genes . 205
SINE as Evolutionary and Genetic Tags . 205
vi


Figure 5-5. Phylogenetic relationships of 86 Ab alleles derived from 12
Mus species and subspecies. Thin circle indicates alleles have the same
restriction site allele by parsimony analysis. Dotted circle indicate
cluster of alleles closedly related to each other.


141
pair of oligomers (5' GAAATCCGACTGCCTCTGCC 3', 5'
TGCTCCCAGTTCCCAAGGCTTT 3') used to amplify and the resultant
length of amplified products as well as it nucleotide sequence
are shown in Figure 3-4. The results of the Southern analysis
are shown in Figure 4-11 and Figure 4-12. Surprisingly, the
hybridization of the isolated 235 bp fragment gave a distinct
band pattern in all of strains studied. As expected, the size
of one of the two bands in lineage 3 alleles, e.g. B10PL, NZW
was consistent with their genomic restriction maps. To locate
their positions in genomic structure, the same membrane
hybridized with a Abd probe was also included for clarity
(Figure 4-11). It is worth mentioning that the hybridized
bands are polymorphic among all three lineage alleles studied
(Figure 4-11) This result suggests that this 539 bps
inserted sequence belongs to a new family of repeated
sequences. Since the core portion did not display evidence
of integration, it is likely that the core portion and its
adjacent B1 family repeats transpose as a single unit, and the
22 bp host-derived repeats are generated as a consequence of
this insertion event.
Ab Genes Can Be Divided into 4 Lineages
Defining Evolutionary Lineage 2B
Although the DNA sequence analysis of lineage 3 allele
(Abk) clearly indicates that lineage 3 is derived from


Figure 2-12. Proposed sequence of events that a group II
intron could mutate into a classical intron. Adapted from
Roger (1989).


mouse
strain H-2
B10.BR k
B10.CHA2 w26
NZW
MDLII
DBVII
DFCII
Pv
BS H
Bg
p
Pv
i
I
oil J
cm
R B Pv
S (g)PS
Pv
B
BS H b9
Pv
PS
E B
L 1
S b9
B Pv
Mi i llr ^
E B
Bg
B Pv
Bg
' L
S
'PS
B10.PL
u
s H
l I
P SPv
B Pv
E B
S
S H
B Pv
Bg
3 H site 2.8 Kb past
B
P SPv
PS
B Pv
H
E B
S ehjh
Pv
BS H b9
w L
S
*0PS
P Pv
CL.
3 H site 2.8 Kb past
B Pv
E B
S b9
Pv
B H b9 P SPv
B BPv
S (£PS
Ol
S BgH
Pv
B H Bg F S Pv
3 H site 2.8 Kb past!
d B Pv
s b(e>s /
S B9h
d
3 H site 2.8 Kb past
1 Kb
121


1 Kb
L h E
% H 97.2 95.5 89.9
87.4 95.7 94.4 95.6 84.1
E
13 bp Repeat
II
Mouse IAP LTR
13 bp Repeat
3'
"Alu-like Repetitve
Sequence "8" Family Repetitive Sequence
ui
"Ubiquitous" Repetitive Sequences
100bp


B1 consensus
1(B1 repeat)
2(left end)
3(right end)
B1 consensus
1(B1 repeat)
2(left end)
3(right end)
CCGGGC GTG(
-T
-TTT-
T-
ITGGCNNAGTGG
****
OTGGCGCACGCC rTTAATCCCAGCACTCGGGAGGCAGAGGCAGGCGGATT 59
-T-
-T-
TCTG
GGTTCGANNCC
*
AGTTCGAGGCC
\GCCTGGTCTACAGAGTGAGTTCCAGGACAGCCAGGGCTACACAG
G
A A T T
B1 consensus AGAAACCCTGTCT 132
1(B1 repeat)
2(left end)
3(right end)
139


Figure 4-3. Restriction maps of seven lineage 3 Ab alleles.


60
for a long time and thus it has sufficient explanation for the
trans-species evolution of Mhc gene (Takahata & Nei 1990).
Frequency-dependent selection. Initially it was
speculated that Mhc alleles generate heterozygote disadvantage
in association with infectious diseases and that some kind of
freguency-dependent selection is reguired to maintain the high
degree of polymorphism (Bodmer 1972) Pathogen adaptation
model was suggested as one form of freguency-dependent
selection (Snell 1968; Bodmer 1972). This model is based on
the assumption that host individuals carrying new antigens,
which have arisen recently by mutation, will be at an
advantage because pathogens will not have had the time to
adapt to infecting the cells with new antigens. Therefore,
this will generate a new form of freguency-dependent
selection, in which a new Mhc allele initially has a selective
advantage compared with an old allele, but gradually declines
with time. This model also suggests that in the presence of
pathogen adaptation the average heterozygosity, the number of
alleles, and the rate of codon substitution will increase
compared with those for neutral alleles.
Rare allele advantage. Another model of freguency
dependent selection is rare allele advantage. This hypothesis
is based on the notion that endemic pathogens, which evolve
much more rapidly than their vertebrate hosts, will tend to


140
Sequence data also indicates that the putative RNA polymerase
III split promoters can be recognized in these two members of
B1 family (Figure 4-10). It is worth noting that the
transcriptional direction of the latter two B1 family repeats
is opposite to that of Abk gene (Figure 4-7) .
An alignment of these three B1 family repeats identified
in these two inserted sequences with the B1 family consensus
sequence (Kalb et al. 1983; King et al. 1986) is shown in
Figure 4-10. The sequence homology ranges from 97% to 93%,
with the B1 member in the small insert having the highest
(97%) and B1 member of the right end of the large insert being
the lowest (93%). Most of the sequence divergence is due to
single base substitution. Mismatches between the putative RNA
PolII split promoter and consensus sequences are designated
by asterisks (Figure 4-10; Galli et al. 1981). The structure
and sequence of the 539 bp insert was analyzed in further
detail.
The 539 bp insert defines a new family of murine repeat
In order to understand the genetic nature of the central
fragment of this 539 bp inserted element, an extensive
computer search of DNA sequence library of GenBank was
undertaken. No homologous sequences have been found. To
determine the genomic distribution of the core portion of the
539 bp insert, a DNA fragment of 235 bp confined within the
middle portion of the insert was amplified by PCR and
hybridized to restriction enzyme digested genomic DNA. The


53
that the region of highest divergence between these alleles
occurs in the intron separating the /31 and /32 exons (Figure
2-9) Abb contains an additional 861 bp of inserted
sequences, which are composed of SINE (short interspersed
repetitive elements), commonly named retroposon. The
relationship of this retroposon polymorphism to the
evolutionary lineage defined was tested by genomic restriction
mapping of Ab genes from both lineages, 1 and 2. The results
indicated the 861 bp retroposon insertion is characteristic
of lineage 2 alleles. Using the SINE sequence as an
evolutionary tag, it is estimated that the Ab alleles in these
two lineages diverged at least 0.4 million years ago and have
survived the speciation events leading to several Mus musculus
subspecies.
Their studies are further supported by the works of
Figueroa et al. (1988). They showed that the molecules
encoded by alleles of Ab locus fall into two groups defined
by their reactions with monoclonal antibodies. One group
reacts with antibodies specific for the antigenic determinant
H-2A.m25; the other with antibodies specific for determinant
H-2A.m27. This serological reactivity pattern correlates with
a specific structural feature of the proteins of Ab genes.
Sequence comparison of Ab genes derived from inbred and wild
strains has revealed that m27-positive proteins have two amino
acids deleted at positions 65 and 67 in the /? 1 exon, while m25
antibodies react with Ab chains that do not have deletions.


96
microfuge for 20 min. and washed with 70% cold ethyl alcohol.
Later, the precipitate was dried and resuspended in 80 ul of
TE. The digests were subjected to electrophoresis in 0.7%
agarose gels for 16 hours at 3 V/cm in a water-cooled
electrophoresis apparatus (International Biotechnologies
Incorporated, New Heaven, Conneticut).
Probes
A 5.8 kb Eco RI fragment containing Abd genomic probe was
kindly provided by Dr. Leroy Hood. A 369 bp Eco RI-Hind III
fragment and a 911 bp Hind III-Eco RI fragments of DNA were
generated from 5' and 3' regions, respectively, of Abd genomic
probe and subcloned into pUC19 (Figure 3-1).
Capillary Transfer and Hybridization
The restriction enzyme digested DNA was transferred from
gel to Zetabind membrane (Microfiltration Products Division,
Meriden, Conneticut) by Southern blotting (1975) according to
manufacturer's instruction. The agarose gel was denatured in
0.2N NaOH, 0.6M NaCl for 30 min at room temperature and then
neutralized by 0.5M Tris pH 7.5, 1.5M NaCl for 30 min at the
same temperature. After blotting, the membranes were washed
with 2 X SSC (1 X SSC = 0.15 M NaCl, 0.015 M NaC6H706) to
remove agarose residue and then washed in 0.1X SSC, 0.5% SDS


229
Rich, R. R., Sdeberry, D. A., Kastner, D. L., Chu, L. 1979b
Primary in vitro cytotoxic response of NZB spleen cells to
Qa-lb-associated antigenic determinants. J. Exp. Med. 150:
1555.
Rinehart, F. P., Ritch, T. G., Deininger, P. L., and Schmid,
C. W. 1981. Renaturnation rate studies of a single family of
interspersed repeated sequences in human deoxynucleic acid.
Biochemistry. 20: 3003.
Robinson, R. R., Germain, R. N., McKean, D. J., Mescher, M.,
Seidman, J. G. 1983. Extensive polymorphism surrounding the
murine la A£ chain gene. J. Immunol. 131: 2025.
Robinson, P. J., Lundin, L., Sege, K., Graf, L., Wigzell,
H., Peterson, P. A. Location of the mouse /32-microglobulin
gene B2m determined by linkage analysis. 1981.
Immunocfenetics 14: 449.
Roger, J. H. 1985. The origin and evolution of retroposons.
Int. Rev. Cvtol. 93: 187.
Roger, J. H. 1989. How were introns inserted into nuclear
genes. T. I. G. 5: 213.
Ruffner, D. E., Sprung, C. N., Minghetti, P. P., Gibbs, P.
E. M. and Dugaiczyk, A. 1987. Invasion of the human
albumin-a-fetoprotein gene family by Alu, Kpn, and two novel
repetitive DNA elements. Mol. Biol. Evol. 4: 1-9.
Rupp, F., Acha-Orbea, H., Hengartner, H., Zinkernagel, R.,
and Joho, R. 1985. Identical Vp T-cell receptor genes used
in alloreactive cytotoxic and antigen plus I-A specific
helper T cells. Nature (London) 315: 425.
Sagai, T., Sakaizumi, M., Miyashita, N., Bonhomme, F.,
Petras, M. L., Nielsen, J. T., Shiroishi, T., and Moriwaki,
K. 1989. New evidence for trans-species evolution of the H-2
class I polymorphism. Immunogenetics 30: 89.
Sage, R. D. 1981. Wild mice. In H. L. Foster, J. D. Small
and Fox, J. G. (eds.), The Mouse in Biomedical Research, pp.
39-99, Academic Press, New York.
Sambrook, J., Fritsch, E. F., and Maniatis, T. 1989.
Isolation of high-molecular-weight DNA from mammalian cells
pp. In Molecular cloning, a laboratory manual. pp, 9.14-
9.19, 2nd ed. Cold Spring Harbor Laboratory Press, New York.
Sandrin, M. S., McKenzie, I. "F. C.1981. Production of a
cytotoxic anti-la.6 antibody. Immunogenetics 14: 345.


2
from 5 separate species and subspecies in the genus Mus.
These alleles were organized into 3 evolutionary lineages on
the basis of retroposon polymorphisms occurring in the intron
(intron 2) separating the exons which encode the ¡31 and /32
domains of Ab. By using this retroposon sequence as an
evolutionary tag, they demonstrated that the A/3 alleles in two
of these lineages diverged at least 0.5 million years ago and
that alleles from both lineages survived the speciation events
leading to several modern Mus species. These findings
indicate that class II gene polymorphisms are evolving in a
trans-species manner, suggesting that the extensive diversity
of Mhc class II genes predominantly reflects the steady
accumulation of mutations in distinct lineages of alleles
which are selectively maintained in natural populations for
long evolutionary periods.
In this dissertation, we address two additional issues
concerning the evolution of Ab in Mus. The first issue
concerns the evolutionary origin of lineage 3. What is the
nature of the retroposon polymorphism in lineage 3 alleles and
was lineage 3 derived from lineage 1 or lineage 2 ? If so,
what kind of evolutioanry mechanism generated lineage 3 ? We
have addressed this issue by sequencing a 3.8 kb DNA segment
containing intron 2 from a prototypic lineage 3 allele. The
results clearly indicate the lineage 3 alleles are derived
from lineage 2 allele by two additional independent retroposon
insertions in intron 2. The second issue concerns the


Figure 4-14. PCR amplification of DNA samples from lineage 3
alleles and recombinant inbred strains.


TABLE OF CONTENTS
Page
ACKNOWLEDGEMENTS iii
LIST OF FIGURES viii
ABSTRACT xi
CHAPTERS
1 INTRODUCTION 1
2 GENOMIC ORGANIZATION OF MAJOR HISTOCOMPATI
BILITY COMPLEX 4
H-2 Complex 5
Three Classes of Mhc Genes 5
Organization of Mouse Mhc 6
Genetic Organization of the I region . 16
Linkage Relationship of Class II Genes 19
Biochemistry of Class II Molecules ... 23
Analysis of the Structure-Function
Relationship of Class II Molecule 27
Functional Role of Mhc Gene 39
Genetic Polymorphism of Mhc Genes .... 42
Recombination Within the Mhc 61
Definition of Evolutionary Lineage. ... 65
Structure and Evolution of Retroposon .... 66
Structure of Alu and "Alu-like" family. 67
Mechanisms of Retroposition 68
Function Attributable to SINE 74
Evolution of Intron 76
Wild Mice As a Useful Genetic Tool 81
3MATERIALS AND METHODS 92
Wild Mice 92
Soure of Mouse Tissues and Preparation of DNA 92
Restriction Enzyme Digestion and Agarose Gel
Electrophoresis 95
Probes 96
Capillary Transfer and Hybridization 96
Genomic Restriction Mapping 100
v


5
mouse (n2) and in man (HLA) (Gotze et al. 1977). The Mhc was
first identified in mice (H-2) because of the availability of
inbred and congenie strains of mice. By grafting of tumors
or skins between such strains of mice and following rejection
or acceptance of the graft, Gorer and others (Gorer et al.
1938, 1948) were able to map the rejection phenomena to a
region on chromosome 17, which was then denoted the Mhc. In
mouse at least 60 traits, most of which are associated with
the immune response, have been mapped to Mhc using the classic
genetic techniques (Klein 1975).
H-2 Complex
Mhc is defined as a group of genes coding for molecules
that provide the context for the recognition of foreign
antigens by T lymphocytes (Klein 1983). "Context" implies
that T cells do not recognize antigen alone; but instead
recognizes antigen in the context of Mhc molecules on the
surface of antigen-presenting cells. Thus far, Mhc genes have
been found only in vertebrates. It is not known whether all
vertebrates possess Mhc, but so far it has been identified in
twenty vertebrate species (Klein 1986).
Three Classes of Mhc Genes
Traditionally, the Mhc genes can be divided into three
classes, I, II and III. Class I molecules are involved in


STABLE ALLELIC LINEAGES OF MHC CLASS II GENES
WITHIN THE GENUS MUS
By
CHENG-CHAN LU
A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY
UNIVERSITY OF FLORIDA
1990


187
Table 5-3. Coding of Restriction Site Data of Ab Alleles.
Character
number
Feature
Character
number
Feature
1
Bam
HI-5.4
16
Sst 1-2.3
2
Bam
HI-3.6
17
Hind III-2.5
3
Bam
HI-2.1
18
Hind III-2.5
4
Bam
HI-2.0
19
Hind III-1.7
5
Bam
HI-2.6
20
Hind III-4.5
6
Bam
HI-3.1
21
Hind III-5.2
7
Sst
1-7.8
22
Bgl II-3.62
8
Sst
1-2.6
23
Bgl II-5.1
9
Sst
1-2.1
24
Pvu II-2.75
10
Sst
1-2.1
25
Pvu II-3.75
11
Sst
1-1.65
26
Pvu II-0.9
12
Sst
1-2.2
27
Eco RI-5.4
13
Sst
1-2.8
28
ECO RI-5.4
14
Sst
1-3.5
29
Pst 1-1.2
15
Sst
1-3.8
The data are derived from restriction map of Figure 5-1


Figure 5-1. continued
172
BS
Bg PvEX
B10.D2
TW5
TW8
BEL1
Pv
S PvH S
Su
P H
Pv
BiE
B S
H Bg
I
BS H Bg Pve
III "J I I
p;
S PvH SI
III 1
5H
k F
B
1
>v
E B S H Bg
1 II II
I
BS H Bg Pve
LJ I LLL
p-
BS PvH SI
II 1 1 1
> H
k F
B
L
>v
B S Bg
LJ 1
Ps
L/Vv
BS H
Bg Pve
PvH Si
B
E
S H Bg B
U ..1.
"J 1 1
II 1
l
i
1 1 1 1
BS H Bg PvE
B10.CAS2 I 1 I I
S PvH S
I I l
Su
p H,
i
Pv
BE
B S
HBg
TlL
v1
B S Bg Pve
THON 1_vJ I I I
3
R
SPvH S
III 1
VH
B
1
v
E BS Bg H
1 1' 1 1 1
2.5 Kb I
BS H Bg P\
PANCE D | | 111
p-
PvH
5 h
k F
B
1
*v
E B S H Bg
J 1 1 LJ
BS Bg Pve
BIK/g || ^ M
3
xPv S PvH S i
lili I
3 U
k f
B
I
>v
E S H Bg b
I I III
BS H Bg Pv
38CH III ll
P
R,
S PvH Si
III I
3 h
B
v
E H SB^
ii ir i
v
SB Bg P\E
dmaLU 1 1 1
3
/Pv s PvH S J
lili I
k f
B
l
>v
E B S H Bg
I II II
1 .i Kb
BS H Bg P\E
BEP-1 U I I I I
P
P
SSPvH SJ
LLi L i
>u
k F
B
L
>v
E s B Bg
J LJ I
BS H Bg P\E
DSD-1 II l "111
BS PvH S
PSH,
i
1/ Pv
BE
B S
Li L
HBg
ir
H
1 Kb


203
Overdominant Selection for Mhc Polymorphism
The extraordinary polymorphism of Mhc genes set them
apart from all other known genetic loci. It is generally
believed that the Mhc loci have been molded by special forces
not acting, or at least not to the same degree, on other loci
(Klein & Figueroa 1986; Klein et al. 1989). On one hand,
there is no doubt that Mhc loci are subject to negative
purifying selection which eradicates functionally unfit
variants as can be judged from the fact that the diversity of
these genes is not unlimited. But this type of selection
probably also acts on most other functional loci. On the
other hand, one wonders whether Mhc loci are also subject to
positive selection which, for example, provides an advantage
to individuals heterozygous at Mhc genes? Although some
observations indicate that Mhc loci of certain species are
not polymorphic or at least not highly polymorphic (Figueroa
et al. 1986; Watkins et al. 1988), there is some evidence
suggesting that positive selection are operating to drive the
diversification of Mhc genes. Hughes and Nei's (1988, 1989)
analysis of the pattern of nucleotide substitution at
synonymous and nonsynonymous positions in the codons of ABS
provided one of the most convincing argument for positive
Darwinian selection. Their approach was to compare the
nucleotides constituting the ABS with those coding the rest
of the genes. The role of positive selection implicated in
enhancing the diversity is indicated by the fact that the rate


14
a homozygous human lymphoblastoid cell line. Papain treatment
yields a molecule composed of al, a.2, a3 and /32m. This class
I molecule consists of two pairs of structurally similar
domains: al has the same tertiary fold as a2 likewise a3 has
the same tertiary fold as /32m. The a3 and )32m both have /3-
sandwich structures composed of two antiparallel /3-plated
sheets, one with four /3-strands and one with three /3-strands,
connected by a disulphide bond. The same tertiary structure
has been shown for constant region of immunoglobulin and is
consistent with high degree of seguence homology between a3,
/32m and constant region. The structurally similar al and a2
domains are paired, with the four /3-strands from each domain
forming a single antiparallel /3-sheet with eight strands.
This particular intramolecular "dimeric interaction"
(McLachian et al. 1980) seen between al and a2, involving the
creation of a single /3-sheet from two domains, has been
observed in many inter-molecular dimers, and has been proposed
to be preserved in an intermolecular dimer, such as Mhc class
II molecules (Bjorkman et al. 1987b).
Antigen binding site of class I molecule. Several
observations suggest that the groove between al and a2 helices
is the antigen binding site (ABS) (Bjorkman et al. 1987b).
It is located in a position, distal from the membrane end of
the molecule, capable of being recognized by receptors of
another cells. The site, -25 A long by 10 A wide by 11 A


Page
539 bp Retroposon: a Newly Arisen
Repetitive Family 207
Transposition of Middle Repetitive Elements 208
Preferential Site of Integration .... 208
Possible Transposition Mechanism .... 209
Phylogenetic Relationship of Ab Genes . .210
REFERENCE LIST 213
BIOGRAPHICAL SKETCH 236
vii


Figure 5-1. continued
175
BS
C57BL/1
B10.M
C3H.JK
B10.S
0
B10.STC90L
W12A
FAI-3
FAI-4
MET-3
tw 12
TT6
CADIZ-1
PANCE B
SHPv
_ j B E
-Mm dIi'e
E B P
H BgPv p PvBg S| sJlL BE B S H Bg
B g H BgPvE p PvBg S
B P
SH
B E Pv B S
BS H BgPvE p PvBg s
B P
SH
B E Pv B S
BS H BgPv p s PvBg S s
J INI 1
sHPv
BE B S
BS H BgPv p PvBg S
B P
SHPv
J
BE s B
H Bg
H Bg
BS H BgPvE p s PvBg S
JJ 1 Mil 1 Ll L
3 P
N
i?
>v
B S BgH E
II I I vv I
p
BS H BgPvE p PvBg S SN
III lili III 1
> HF
/ B
1
>v 4.1
E B S H Bg
I III I
P
BS H BgP\E P s Pv S s']
U 1 LLU U 1 U
5 HF
h
>v
E B S Bg H
III II
0 3 H BgPvE P PvBg S
JJ 1 LLU U L
3 P
i?
>v
E B S H Bg
p 5
0 3 H BgPvE p s Pv S S^l
JJ 1 LLU LL J 1
HF
B
>v
E B S Bg H
III II
BS H BgPv
III II
E
p s PvBg s
U lili
B P
si
1
Shi
E
=v
B S BgH
II I I vv I
BS H BgPv
JJ 1 LL
E P
P Pv S SN
1 1 1 1
SH 4.1 Kb
BE pv B S HBg
II I I I II
BS H BgPv
JJ 1 1 1
E P
P Pv S SN
U 1 1 'I
fH
f B E pv B S H Bg
II I I I II
BS H BgPv
JJ 1 LL
E
P s PvBg S
U 1 1 1
B P
si
i
5H
B E pv B S H Bg
_LL I I I II
BgH
Bg


CHAPTER 4
SEQUENCE ANALYSIS OF LINEAGE 3 ALLELES
Restriction Enzvme Analysis of Lineage 3 Alleles
Restriction-Site Polymorphism of Lineage 3 Alleles
In a previous study of Ab genes of genus Mus by RFLP
analysis (McConnell et al. 1988) using the seven six-cutter
enzymes: including Eco RI, Bam HI, Sac I (Sst I), Hind III,
Pst I, Bgl II, Pvu II, the Ab genes were grouped into three
distinct evolutionary lineages based on the extent of sequence
divergence. Lineage 3 consists of four Ab alleles, B10.BR (k
haplotype), BIO.PL (u) NZW (z) and B10.CHA2 (w26). The
genomic restriction mapping of these alleles was first carried
out using single restriction enzyme digestion, followed by
hybridization with 5' and 3' regions of Ab probe,
respectively. To confirm the restriction mapping, double
digest experiments was performed as exemplified in Figure
4-1 and Figure 4-2. In this study, three additional lineage
3 alleles, MDLII, DBVII, and DFCII, were revealed by RFLP
analysis using the same seven restriction enzymes. The RFLP
patterns and restriction maps of these seven lineage 3 alleles
are shown in Table 4-1 and Figure 4-3. In both BIO.PL and NZW,
there is one small insertion-deletion site (indicated by solid
114


Table 5-1. continued
165
Strain
B10.D2
B10.F
B10.Q
B10.RIII
B10.SM
B10.SAA48
B10.KEA5
B10.CAA2
B10.STC77
B10.BUA16
METKOVIC1
Pst 1
3.89
3.89
3.89
3.89
3.89
3.89
3.89
3.89
3.89
3.89
3.89
Eco R1 Bam HI Pvu II
5.4
9.0
2.89
2.6
1.85
0.9
5.4
5.4
2.89
3.6
2.6
2.75
5.4
5.4
2.89
3.6
2.6
2.75
5.4
9.0
2.89
2.6
2.75
18
9.0
2.89
2.6
2.75
chk
9.0
2.89
2.6
2.75
5.4
5.4
2.89
3.6
2.6
2.75
5.4
5.4
2.89
3.6
2.6
2.75
5.4
5.4
2.89
3.6
2.6
2.75
5.4
9.0
2.89
2.6
1.85
0.9
5.4
9.0
2.89
2.6
2.75
5.4
5.4
2.89
3.6
2.6
2.75
Sst 1 Bgl II Hind III
5.2
12.2
6.2
3.8
2.5
2.65
1.7
5.2
11.7
10
3.8
5.5
2.65
1.7
5.2
11.7
10
3.8
5.5
2.65
1.7
5.2
12.2
6.2
3.8
5.5
2.65
1.7
5.2
12.7
8.5
3.8
5.5
2.65
1.7
7.8
12.7
6.2
3.8
5.5
1.7
5.2
11.7
10
3.8
2.65
5.5
5.2
11.7
10
3.8
2.65
5.5
5.2
11.7
10
3.8
2.65
5.5
5.2
11.7
6.2
3.8
5.5
2.65
1.7*
5.2
12.2
6.2
3.8
5.5
2.65
1.7
5.2
11.7
8.5
3.8
5.5
2.65
1.7
METKOVIC2 3.89


23
and a termination codon in its sequence. The Eb3 thus far has
been found only in the H-2b haplotype, but probably also
exists in other haplotypes (Flavell et al. 1985b). All
haplotypes studied thus far contain these class II genes. The
distances between these genes are, with a few exceptions,
approximately the same in different haplotypes.
Biochemistry of Class II Molecules
Up to now only four I region-associated (la) products
have been identified by both serological and biochemical
methods. The I-A subregion contains 3 loci that encode three
serologically detectable polypeptides: A*, Aa, and (Jones
et al. 1978). I-E subregion contains a locus that encodes a
fourth class II polypeptide chain, E^ (Uhr et al. 1979).
Structure of class II ploypeptides
The two class II molecules encoded in the I-A and I-E
subregions are both heterodimeric glycoproteins composed of
one heavy (a) and one light (/?) chains (Figure 2-3 and Figure
2-4). The a chains range in molecular weight from 30,000 to
33,000 and the (3 chains range in molecular weight from 27,000
to 29,000. The difference in molecular weight of a and ¡3
chain is due to an extra N-linked glycosyl unit attached to
a chain (reviewed by Klein et al. 1983) The structure of the
class II polypeptides have been determined in a number of


Figure 3-3. The sequences flanking the target site(GATTCTGATACA) for
the "Alu-like"(Bl) element. A. a lineage 1 (Abd) and a lineage 2 (Abb)
alleles, B. a lineage 3 (Abk) The shaded areas indicate the target site
for the Bl insert. The oligomers at the left (5' CCTTGAGGGCCACGGTTGTC
3') and right (5 GATACCCCCAGAGCCTCTCA 3') ends used for PCR
amplification is underlined. The direction of extension from the
oligomers are shown as indicated by dotted arrow. The restriction sites
used for restriction analysis is also underlined. The amplified
sequence lengths are estimated to be 192 bp for lineage 1, 2 and 375
bp for lineage 3.


MMMM MMM MMC MMMM MMM MMC MMMM MMM MMC
B B B B K D D P b Y O A d B B B B K D D P b Y O A d B B B B K D D P b Y O A d
BKST LSW LLS BKST LSW LLS BKST LSW LLS
probe
Whole A^d
probe
'i' a d
3 /3
probe
153


235 bps
(non-repetitive
element)
ro ro
co
4^ O) CD
v
4^ ~nI A.
>
TO CL
r,. ..., I
'
i

i
MAI
MBS

MDL
f
MYL
XBJ
jM
SET
r
ZYD
V
ZYP
ZRU
i
XBS
*
PANd

<
Z
.
K
4
#
PANb
PTX
CRV
m
S
CRP
1
* i
.
* *
MAI

1
r <
f C
U.
MBS

MDL
9*
MYL
1
(
XBJ

9 '9
SET
f
t-4
ZYD

ZYP
* ( |
9

ZRU
C
XBS
(
PANd

1C
Z

(
K
1
PANb
PTX

i
CRV
CRP
en


186
restriction enzymes. "+" and indicate the presence, and
absence, respectively, of a given restriction site. The
character state of Ab allele is explained in Table 5-3. As
the computer program supplied by Felsenstein1s package has a
limited capacity to analyze all the alleles at a time, each
lineage of alleles were analyzed first (data not shown) to
find out the phylogenetic relationship of closely related
alleles. Then, the different lineage alleles were pooled and
analyzed altogether. The parsimonious network of the 86 Ab
alleles constructed is shown in Figure 5-4. This phylogenetic
tree reguires 96 mutational steps. The bar(s) between the
alleles indicate the character state change. Branch lengths
are proportional to the number of character changes. The
distance between the different alleles is proportional to
their DNA sequence divergence, which is reflected by the
numbers of character change between them. Those alleles that
are encircled by solid lines are different alleles which are
shown to be phylogenetically identical by parsimony analysis.
The Mhc class II Ab genes have been divided into four
evolutionary lineages based on retroposon polymorphisms. A
remarkable feature about this Ab phylogenetic tree is that its
main branches correspond very closely to the evolutionary
lineages defined before. It is evident from this phylogenetic
tree that lineage 3 alleles are evolutionarily more closely
related to lineage 2 than to lineage 1 (Figure 5-4) In light
of the fact that each Ab lineage is derived from other lineage


A.
*
> 5.
d CCTTGAGGGCCACGGTTGTCTTGTGAGGACTGTTTGCTGCCTGGCGCTGACCCGAAGGCA
b CCTTGAGGGCCACGGTTGTCTTGTGAGGGCTGTTTGCTGCCTGGCGCTGACCCGAAGGCA
*
d TCACTGTCATTTTCCTCGTTCTCTGAGGGAGACTGTGTTGACTT-GGGCCACACT-AAAG
b TCACTGTCATTTCCCTCGTTCTCTGAGGGAGACTGTGTTGACTTGGGGCCACACTAAAAG
Hindi
* * 3 <
d TTTCTGATACAAAAGCTGAGGAACTCATTTCTGTTTCCAGCACACACTCCGTGATACCCC
b ATTCTGATACAAAATCTGAGGAACTCATTTCCGTTTCCAGCACACTCCCTGATACCCC
Hinfl
d CAGAGCCTCTCA
b CAGAGCCTCTCA
Amplified sequence length: 192 bp
107


41
response, i.e. it was more potent on a molar basis than the
immunogen, pigeon cytochrome c. Although most of the BIO.A
(E^k:E^k) T-cell hybridomas specific for pigeon cytochrome c
could be stimulated by moth cytochrome c in association with
BIO.A(5R) hybrid I-E (E^b:Eak) antigen-presenting cells, they
could not be stimulated by pigeon cytochrome c in the context
of hybrid I-E. No other antigen presenting cells (APCs)
carrying disparate H-2 haplotypes, e.g., APCs from BIO and
BIO.A(4R) mice (neither strain express I-E molecule), gave
any stimulation. Thus, these T-cell clones were able to
recognize moth cytochrome c associated with either Ek: E^ or
la molecules. Other experimental evidence also
suggested that antigen recognition by cytotoxic T cells was
fundamentally similar to that of helper T cells (Hunig & Bevan
1982) Using la-containing planar membrane as antigen
presenting particles together with defined synthetic peptides,
it was demonstrated that la and "processed" antigen are the
only requirement for T cell recognition. That la and
processed antigen interact specifically prior to T cell
recognition was supported by the observation that antigens
could compete with one another at the level of antigen
presentation in the absence of T cells (reviewed by Buus et
al. 1987). The first direct biochemical evidence of a
specific antigen/Mhc interaction came from equilibrium
dialysis studies using affinity purified Mhc molecules and
labeled synthetic peptide (Babbitt et ajL. 1985) They


STABLE ALLELIC LINEAGES OF MHC CLASS II GENES
WITHIN THE GENUS MUS
By
CHENG-CHAN LU
A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY
UNIVERSITY OF FLORIDA
1990

This dissertation is dedicated to
the members of our family as a token
of my appreciation for the love,
support and encouragement they have
provided over the years.

ACKNOWLEDGEMENTS
The intellectual environment provided by Dr. Edward K.
Wakeland has been the single most important factor in the
enrichment of my evolution as a researcher; to him I am deeply
indebted. It is my privilege to express my sincere gratitude
to him for his patient guidance as well as constant infusion
of encouragement and inspiration, and for allowing me to
exercise thoughtful freedom to proceed with this work.
I thank the members of my supervisory committee, Drs.
Kuo-Jang Kao, Harry S. Nick, Ammon B. Peck and William E.
Winter, for their advice and assistance throughout. The timely
help and attention of my colleague Richard Mclndoe during the
preparation of the present work needs a special mention.
I acknowledge Drs. Wayne Potts, Murali, Jin-Xion She and
William Wang for their technical help and guidance.
I would like to thank the people in the department for
what they have done and provided for me to make the completion
and success of my graduate study possible.
My appreciation is extended to Dr. Linda Smith for her
friendship and hospitality through the years.
My sincere thanks are extended to Dr. Ahmad N. Ali and
Charles C. Brown for providing free cloning vector,
iii

PbluescriptSK( + ) and PbluescriptKS ( + ) and for their technical
advice.
My sincere appreciation is extended to Vickie Henson,
Thomas McConnell, Roy Tarnuzzer, Judith Nutkins, Stefen
Boehme, Ivan Chang, Ying Ye, Mary Yu, Karen Wright, Julio Mas,
Kristy Myrisk, Jerome and Xemena for their lively company,
loving support and constant encouragement.
iv

TABLE OF CONTENTS
Page
ACKNOWLEDGEMENTS iii
LIST OF FIGURES viii
ABSTRACT xi
CHAPTERS
1 INTRODUCTION 1
2 GENOMIC ORGANIZATION OF MAJOR HISTOCOMPATI
BILITY COMPLEX 4
H-2 Complex 5
Three Classes of Mhc Genes 5
Organization of Mouse Mhc 6
Genetic Organization of the I region . 16
Linkage Relationship of Class II Genes 19
Biochemistry of Class II Molecules ... 23
Analysis of the Structure-Function
Relationship of Class II Molecule 27
Functional Role of Mhc Gene 39
Genetic Polymorphism of Mhc Genes .... 42
Recombination Within the Mhc 61
Definition of Evolutionary Lineage. ... 65
Structure and Evolution of Retroposon .... 66
Structure of Alu and "Alu-like" family. 67
Mechanisms of Retroposition 68
Function Attributable to SINE 74
Evolution of Intron 76
Wild Mice As a Useful Genetic Tool 81
3MATERIALS AND METHODS 92
Wild Mice 92
Soure of Mouse Tissues and Preparation of DNA 92
Restriction Enzyme Digestion and Agarose Gel
Electrophoresis 95
Probes 96
Capillary Transfer and Hybridization 96
Genomic Restriction Mapping 100
v

Page
Nucleotide Sequencing 100
Data Analysis 101
RFLP Patterns of Ab Alleles and Their
Phylogenetic Relationships 101
Computer Programs 104
Polymerase Chain Reaction(PCR) Amplification 105
Enzymatic Amplification of Genomic DNA 105
Amplification of Central Fragment for
DNA Hybridization 109
4 SEQUENCE ANALYSIS OF LINEAGE 3 ALLELES .... 114
Restriction Enzyme Analysis of Lineage 3
Alleles 114
Restriction-Site Polymorphism of Lineage
3 Alleles 114
Distinct Intron Size Between Lineage 2
and 3 Alleles 122
DNA Sequence of Lineage 3 Intron 122
Lineage 3 Derived from Lineage 2 125
Ab Genes Can Be Divided Into 4 Lineages. ... 141
Defining Evolutionary Lineage 2B 141
4 Evolutionary Lineages of Ab Genes . 156
5 EVOLUTION OF MHC CLASS II GENE POLYMORPHISM. 159
RFLP Analysis of Ab Genes Within the Genus
Mus 159
Lineage Distribution of Ab Alleles Within the
Genus Mus 177
Phylogenetic Relationships of 86 Ab Alleles
in the Genus Mus 180
6 DISCUSSION 193
Function of Mhc Genes 193
Features of Mhc Polymorphism 194
Mechanism of Generating Ab Gene Polymorphisms 195
Mhc Genes Evolve via Trans-species Mode . 196
Possible Impact of Retroposon on Ab Gene
Expression 198
Linkage Disequilibrium Among Restriction
Sites 199
Maintenance of Mhc Polymorphism 201
Overdominant Slection for Mhc
Polymorphism 203
Divergent Allele Advantage 204
Alu-like Repetitive Elements in Ap Genes . 205
SINE as Evolutionary and Genetic Tags . 205
vi

Page
539 bp Retroposon: a Newly Arisen
Repetitive Family 207
Transposition of Middle Repetitive Elements 208
Preferential Site of Integration .... 208
Possible Transposition Mechanism .... 209
Phylogenetic Relationship of Ab Genes . .210
REFERENCE LIST 213
BIOGRAPHICAL SKETCH 236
vii

LIST OF FIGURES
Page
Figure 2-1 Location of genes in the Mhc of the BALB/c
mouse 8
Figure 2-2 Genomic structures of Mhc class I molecules. 12
Figure 2-3 Genomic structures of Mhc class II a and (3
chain 22
Figure 2-4 Location of Mhc class I and class II genes
within H-2 complex 25
Figure 2-5 A model of the antigen-binding site of the
Mhc class II I-A molecules 29
Figure 2-6 Recombinatorial association and expression
of a and /3 chain of Mhc class II molecules 37
Figure 2-7 Segmental exchange of Mhc class II Ab
genes 48
Figure 2-8 Illustration of the evolutionary origins
of the three lineages of Ab alleles 52
Figure 2-9 Analysis of the sequence homology of
Abd(lineage 1) and Abb(lineage 2) 55
Figure 2-10 Location of Recombinational hot spot(RHS)
within the H-2 complex 64
Figure 2-11 A proposed mechanism for SINE retroposition 71
Figure 2-12 Proposed sequence of events that a group II
intron could mutate into a classical intron .... 81
Figure 2-13 Geographical distribution of four separate
subspecies of Mus musculus complex 85
Figure 2-14 Geographical distribution of four separate
species of genus Mus 88
Figure 2-15 Phylogenetic relationships within the genus
Mus and Rattus 91
viii

Page
Figure 3-1 The genomic restriction map of Abd probe . 98
Figure 3-2 The partial restriction map of Abk and the
sequencing strategy 103
Figure 3-3 The sequences flanking the target site
(GATTCTGATACA) for the "Alu-like"(Bl) element . 107
Figure 3-4 Location of two insertional events in a
lineage 3 allele(Abk) Ill
Figure 3-5 The nucleotide sequence of 539 bp insert . 113
Figure 4-1 Restriction mapping performed by double
digest experiment 116
Figure 4-2 Restriction mapping carried out by double
digest experiment 118
Figure 4-3 Restricion maps of seven lineage 3 Ab
alleles 121
Figure 4-4 Comparison of restriction maps of a
representative lineage 2 and 3 alleles 124
Figure 4-5 The 3735 bp of nucleotide sequence of Abk. 127
Figure 4-6 Partial nucleotide sequence of intron 2
from Abk 130
Figure 4-7 Location of two inserts in a lineage 3(Abk)
allele 132
Figure 4-8 Sequence identity between the retroposon
sequence in linage 2 (Ab6) and 3 (Abk) alleles .... 135
Figure 4-9 Sequence identity among 3 Ab alleles .... 137
Figure 4-10 Sequence alignment among three Bl repeats 139
Figure 4-11 Southern blot experiments with Abd and
235bp non-repetitive element probe 143
Figure 4-12 Blot hybridization experiment with 235 bp
non-repetitive probe 145
Figure 4-13 PCR amplification of DNA samples from 12
species and subspecies of genus Mus 148
ix

Page
Figure 4-14 PCR amplification of DNA samples from
lineage 3 alleles and recombinant inbred strains. 150
Figure 4-15 A typical RFLP analysis and restriction
mapping 153
Figure 4-16 Restriction analysis of PCR-amplified
products 155
Figure 4-17 Summary of the evolutionary relationship
among four lineage Ab alleles 158
Figure 5-1 Restriction maps of 86 Ab alleles derived
from Table 5-1 170
Figure 5-2 Diagram illustrating the evolutionary
origins of the 4 lineages of Ab alleles assayed . 179
Figure 5-3 Example of a restriction site allele used
for parsimony analysis 183
Figure 5-4 Phylogenetic relationships of 86 Ab alleles
derived from 12 species and subspecies of genus
Mus 189
Figure 5-5 Phylogenetic relationships of 86 Ab alleles
from 12 species and subspecies of Mus 192
x

Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy
STABLE ALLELIC LINEAGES OF MHC CLASS II GENES
WITHIN THE GENUS MUS
By
Cheng-Chan Lu
December, 1990
Chairperson: Dr. Edward K. Wakeland
Major Department: Pathology and Laboratory Medicine
Previous studies have organized alleles of the Mhc class
II Ab gene into 3 evolutionary lineages based on genomic
structures. The major distinction between lineage 1 and 2 is
an 861 bp retroposon in the intron separating the A^ and Ap2
exons in lineage 2 alleles. By using this retroposon as an
evolutionary tag, we have extended our molecular genetic
studies of Ab to include 115 independently derived H-2
haplotypes from 12 separate species and subspecies of genus
Mus. Ab alleles from lineage 1 and 2 were found in all 3
aboriginal species (Mus spretus. Mus spicelious. and Mus
spretoides) and in Mus caroli. indicating that these two
lineages of Ab alleles diverged a minimum of 2.5 million years
ago. Parsimony analysis of 86 Ab alleles, using restriction
site as a character state, indicated that lineage 3 alleles
xi

are evolutionarily more closely related to lineage 2 than to
lineage 1. DNA sequence of intron 2 from an evolutionary
lineage 3 allele was determined. The data indicated that
lineage 3 was derived from a lineage 2 allele by two
additional insertional events in the intron 2. One insertion,
composed of Alu-like(Bl) repeat, occurred 508 bp 3' of A/J1
exon. By using the polymerase chain reaction and restriction
analysis, a lineage 2 allele from Mus m. musculus. was
identified to carry that B1 insert, thus defining new lineage,
2B. The other insertion, occurring in the lineage 2
retroposon, starts 1141 bp 31 of the A^ exon. This latter
insertion is 539 bp in length and is composed of Alu-like
repetitive elements and unique sequence. In summary, the
murine Ab genes can be divided into 4 distinct evolutionary
lineages, 1, 2A, 2B, and 3, which are produced by 3
independent retroposon insertions. Lineage 3 alleles were
found in Mus m. musculus and Mus m. domesticus. indicating
that lineage 3 as well as 2A and 2B diverged a minimum of 0.5
millions years ago. These results indicate that all 4
lineages of Ab have persisted through several speciation
events in the genus Mus.
Xll

CHAPTER 1
INTRODUCTION
The I region of the murine major histocompatibility
complex (H-2) contains a tightly-linked cluster of highly
polymorphic genes (class II) that control immune
responsiveness. Two major hypotheses have been proposed to
account for the origin of this polymorphism, which is believed
to be essential for the function of the class II proteins in
immune protection of host. The first was that hypermutational
mechanisms (gene conversion or segmental exchange) promote the
rapid generation of diversity in Mhc genes. The alternative
was that polymorphism arose from the steady accumulation of
mutations over long evolutionary periods, and that multiple
specific alleles commonly survived speciation event (trans
species evolution or ancestral polymorphism). In a previous
study, McConnell et aJL. (1988) used restriction fragment
length polymorphism (RFLP) and sequence analysis to seek
evidence of "segmental exchange" and/or "trans-species
evolution" in the class II genes of the genus Mus by a
molecular genetic analysis of Ab alleles. This study detected
31 Ab alleles in a collection of 49 H-2 haplotypes derived
1

2
from 5 separate species and subspecies in the genus Mus.
These alleles were organized into 3 evolutionary lineages on
the basis of retroposon polymorphisms occurring in the intron
(intron 2) separating the exons which encode the ¡31 and /32
domains of Ab. By using this retroposon sequence as an
evolutionary tag, they demonstrated that the A/3 alleles in two
of these lineages diverged at least 0.5 million years ago and
that alleles from both lineages survived the speciation events
leading to several modern Mus species. These findings
indicate that class II gene polymorphisms are evolving in a
trans-species manner, suggesting that the extensive diversity
of Mhc class II genes predominantly reflects the steady
accumulation of mutations in distinct lineages of alleles
which are selectively maintained in natural populations for
long evolutionary periods.
In this dissertation, we address two additional issues
concerning the evolution of Ab in Mus. The first issue
concerns the evolutionary origin of lineage 3. What is the
nature of the retroposon polymorphism in lineage 3 alleles and
was lineage 3 derived from lineage 1 or lineage 2 ? If so,
what kind of evolutioanry mechanism generated lineage 3 ? We
have addressed this issue by sequencing a 3.8 kb DNA segment
containing intron 2 from a prototypic lineage 3 allele. The
results clearly indicate the lineage 3 alleles are derived
from lineage 2 allele by two additional independent retroposon
insertions in intron 2. The second issue concerns the

3
distribution of various Ab lineages within the genus Mus and
how long these Ab lineage have persisted in the genus Mus.
We have addressed this issue by expanding the RFLP analysis
to include 115 independently-derived H-2 haplotypes derived
from 12 separate species and subspecies of genus Mus. A total
of 86 Ab alleles was identified from this analysis. Parsimony
analysis, using restriction site as a character state, was
also exploited to construct the evolutionary trees of Ab
alleles to determine their phylogenetic relationships. DNA
sequence and restriction enzyme analysis indicate that Ab
genes can be divided into 4 distinct evolutionary lineages,
which are generated from three independent insertional events.
The presence of various lineages in different species and
subspecies of Mus further the idea that the Mhc genes evolved
in a trans-species fashion and they have persisted over long
evolutionary timespans in genus Mus.

CHAPTER 2
GENOMIC ORGANIZATION OF MAJOR HISTOCOMPATIBILITY COMPLEX
In the past decade our understanding of the major
histocompatibillity complex has advanced dramatically because
of the application of both monoclonal antibody techniques and
recombinant DNA technology. Biologists are now able to
characterize one of the most fundamental phenomena of
eukaryotic biologythe ability of organisms to discriminate
between self and nonself in molecular terms. Even the most
primitive of metazoa, the sponges, display cell surface
recognition systems capable of discerning and destroying
nonself, probably to maintain the integrity of individuals
surviving in densely populated environments (Hildemann et al.
1981). There are three fundamental features about this
self/nonself recogntion systems cell-surface recognition
structures, effector mechanisms that result in the destruction
of nonself, and a high degree of genetic variability in the
recognition structures (Hood et al. 1983).
In mammalian genetic systems, a chromosomal region termed
the Mhc encodes the self/nonself recognition system with
similar features. Although all vertebrates appear to posses
a homologous Mhc, it has been most extensively studied in
4

5
mouse (n2) and in man (HLA) (Gotze et al. 1977). The Mhc was
first identified in mice (H-2) because of the availability of
inbred and congenie strains of mice. By grafting of tumors
or skins between such strains of mice and following rejection
or acceptance of the graft, Gorer and others (Gorer et al.
1938, 1948) were able to map the rejection phenomena to a
region on chromosome 17, which was then denoted the Mhc. In
mouse at least 60 traits, most of which are associated with
the immune response, have been mapped to Mhc using the classic
genetic techniques (Klein 1975).
H-2 Complex
Mhc is defined as a group of genes coding for molecules
that provide the context for the recognition of foreign
antigens by T lymphocytes (Klein 1983). "Context" implies
that T cells do not recognize antigen alone; but instead
recognizes antigen in the context of Mhc molecules on the
surface of antigen-presenting cells. Thus far, Mhc genes have
been found only in vertebrates. It is not known whether all
vertebrates possess Mhc, but so far it has been identified in
twenty vertebrate species (Klein 1986).
Three Classes of Mhc Genes
Traditionally, the Mhc genes can be divided into three
classes, I, II and III. Class I molecules are involved in

6
transplantation rejection and T -cell-mediated cytotoxic
killing. Class II molecules serve as restriction elements
during the presentation and processing of foreign antigen to
regulate the immune response. Certain complement components,
e.g. C3 and C4, are encoded by class III genes within the Mhc
complex. However, no significant homology can be shown
between Mhc genes and complement genes, and although the C4
genes is closely linked to Mhc in many species, the C3 genes
are only loosely linked to some species, but not in other
species (Alper 1981). Klein et al. (1983) have argued against
the inclusion of the complement genes as a class of Mhc genes.
Organization of Mouse Mhc
The H-2 complex of the laboratory mouse is the only Mhc
in which nearly all of the loci have been identified and
their position determined. For example, the molecular map of
Mhc genes of C57BL/10 (Weiss et al. 1984) and BALB/c
(Steinmetz et al. 1982a; Winoto et al. 1983) haplotypes have
been extensively characterized. From the centromeric part of
the Mhc of the BALB/c mouse, a 600 Kb segment cluster has been
cloned containing two class I (K and K2) and seven class II
genes (Pb(A^3) to Ea) (Steinmetz et al. 1986) (Figure 2-1) .

Figure 2-1. Location of genes in the Mhc of the BALB/c mouse. Genes are
indicated by vertical bars on six gene clusters that have been defined
by overlapping cosmid clones. The order, orientation and spacing of the
three gene clusters in the Tla region is not known. Adapted from
Steinmetz et al. (1987a).

K
S
I
REGION I 'I ~T
l-A l-E
BUBREGION i 1
k a^3
GENES h i H+t+t
1(2 / J >
6 S 62
SCALE i¡iiii
kb 0 500
21-OHB 21-OHA Bf
I I \
C4 Sip C2
I I
1000
D
Tla
TNF
TNF|J
-tt-
Qa2
Tla
1 I III I I I
till! lit
Tla-1.2
I I
1500
i i
i i
2000
2500
00

9
Following a gap of about 170 kb, a second gene cluster of
330 kb in length has been cloned from the S region containing
(C4, Sip. Bf. C2) coding for complement or related components
and two homologous genes (21-OHA and 21-OHB), one of which
encodes for steroid 21-hydroxylase (Muller et al. 1987). A
third gene cluster covering 500 kb of DNA has been isolated
from the D and Qa regions and localizes the positions of 13
class I genes(D to 01-10) (Stephan et al. 1986), the TNF-a and
-B genes coding for cytotoxins (Muller et al. 1987b). From
the Tla region, a total of 19 class I genes are distributed
in 3 gene clusters. In summary, the Mhc complex of the BALB/c
mouse contains 50 loci, of which 34 loci are class I and 7 are
class II genes (Steinmetz & Uimatsu 1987) Whereas in the Mhc
of C57BL/10 mouse, 26 class I genes have been identified, of
which 10 genes are in the 0a2,3 regions and 13 genes in the
TL region (Flavell et al. 1985). Among 3 H-2 haplotypes (b,
d and k) analyzed thus far (b, d and k), the K and the class
II regions show no large differences in organization (Klein
& Figueroa 1986).
Genetic loci of class I gene
There are two class I genes (H-2K and H-2K1) at the
centromeric end of the H-2 region; all the remaining genes are
at the telomeric end. The class I loci can be divided into
two subclasses: I-a, consisting of loci with a known function
(H-2K, H-2D. H-2L) and I-b, consisting of the remaining loci

10
whose functions are largely unknown. The class II loci and
a group of unrelated loci including genes coding for
complement components are inserted between two H-2K loci and
the rest of class I loci (Figure 2-1). The class I loci can
be assigned to one of four regions: K, D, Qa and Tla.
depending on their position, this division only in part
reflects the evolutionary relationships among the individual
loci (Klein & Figueroa 1986). Class I transplantation
antigen are found on virtually all nucleated cells of the
mouse. The cell surface antigens encoded in Oa-2.3 and Tla
region can be further distinguished from classical class I
antigen because they are less polymorphic and more limited in
tissue distribution than K or D-encoded antigens (Flaherty et
al. 1980).
Class I gene structure. The exon-intron organization of
class I genes are remarkably similar to each other. Each
class I gene is composed of 8 exons, which correlates
precisely with the domain structure of class I polypeptide
(Figure 2-2) (Steinmetz et al. 1981; Nathenson et al. 1981).
The first exon encodes the leader peptide, the second, third,
and fourth exons encode the al, a2 and a3 domains. The fifth
exon encodes the transmembrane region, and the sixth, seventh,
and eighth exons encode the cytoplasmic domain and 31
untranslated region (Figure 2-2).

Figure 2-2. Genomic structure of Mhc class I molecules. Black boxes
indicate the exons encoded by protein domains, introns are illustrated
by blank boxes. Shaded area is the 3' untranslated region.

r~
o
i
3
)
4
5.7kb
Signol
First Second
esternal external
Third Trans-
externol membrane Cytoplasmic 3' Untranslated
to

13
Class I polypeptide. Class I protein has a mol. wt. of
45,000 daltons and is a transmembrane glycoprotein
noncovalently associated with 02-microglobulin (02m) a
12,000-dalton polypeptide encoded by a gene located on
chromosome 2 in the mouse (Goding et al. 1981; Michaelson et
al. 1981; Robinson et al. 1981). Amino acid sequence analyses
have demonstrated that class I antigen can be divided into 5
domains (Coligan et al. 1981). The three external domains,
al,a2 and a3, are each about 90 residues in length. The
transmembrane portion is about 40 residues and the cytoplasmic
region is about 30 residues long. The a2 and a3 domains have
a centrally placed disulfide bridge spanning about 60 residues
and up to three N-linked glycosyl units bound to these domains
(Maloy et al. 1982) Amino acid sequence analyses also
suggest that the a3 domain (Strominger et al. 1980) and 02-
microglobulin (Peterson et al. 1972) show strong sequence
homology to the constant region domains of immunoglobulins.
Binding studies from class I molecules with peptide fragments
have shown that the 02m subunit associated with the a3 domain
(Yokoyama et al. 1983).
Three dimensional model of class I molecules. Recently,
a three dimensional structure of human class I molecule HLA-
A2 was studied by X-ray crystallographic analysis (Bjorkman
et al. 1987a, b) Soluble HLA-A2 was purified and
crystallized after papain digestion of plasma membranes from

14
a homozygous human lymphoblastoid cell line. Papain treatment
yields a molecule composed of al, a.2, a3 and /32m. This class
I molecule consists of two pairs of structurally similar
domains: al has the same tertiary fold as a2 likewise a3 has
the same tertiary fold as /32m. The a3 and )32m both have /3-
sandwich structures composed of two antiparallel /3-plated
sheets, one with four /3-strands and one with three /3-strands,
connected by a disulphide bond. The same tertiary structure
has been shown for constant region of immunoglobulin and is
consistent with high degree of seguence homology between a3,
/32m and constant region. The structurally similar al and a2
domains are paired, with the four /3-strands from each domain
forming a single antiparallel /3-sheet with eight strands.
This particular intramolecular "dimeric interaction"
(McLachian et al. 1980) seen between al and a2, involving the
creation of a single /3-sheet from two domains, has been
observed in many inter-molecular dimers, and has been proposed
to be preserved in an intermolecular dimer, such as Mhc class
II molecules (Bjorkman et al. 1987b).
Antigen binding site of class I molecule. Several
observations suggest that the groove between al and a2 helices
is the antigen binding site (ABS) (Bjorkman et al. 1987b).
It is located in a position, distal from the membrane end of
the molecule, capable of being recognized by receptors of
another cells. The site, -25 A long by 10 A wide by 11 A

15
deep, has a size and shape consistent with the expectation.
By analogy with class II molecules, class I molecules bind
processed antigen in a form of peptides. Synthetic peptides
have been shown to bind to purified murine class II molecules,
presumably mimicking processed antigen (Guillet et al. 1986).
Because class I and class II molecules have homologous
structures (Kaufman et al. 1984) and T cells specific for
either class I or II molecules use the same receptors (Rupp
et al. 1985; Marrack & Kappler 1986), the type of interaction
described between peptides and class II molecule is assumed
to apply to peptides and class I molecules. Electron density
representing an unknown molecule, possibly a bound peptide
antigen, is found in the site of two crystal forms of HLA-A2
class I molecules (Bjorkman et al. 1987b). An a-helical
conformation has been proposed for bound peptide (Berkower et
al. 1986; Allen et al. 1987). Thus, one face of a peptide a-
helix is envisioned to contact the class II molecule, the
other to be contacted by T cell receptor. Many of the
polymorphic residues that are responsible for recognition by
T cells and haplotype-specific association with antigens are
located in this site where they could serve as ligands to a
processed antigen. This is further evidence that this region
functions as antigen binding site (Bjorkman et al. 1987b).
Most of non-conserved residues are located in and around the
ABS site, suggesting that most variable residues in class I
molecules have been selected to generate an ability to present

16
many different peptides. It is also noted that some of
conserved amino acid residues are located in the ABS,
suggesting that they may recognize a constant feature of
processed antigens, consistent with the previous suggestions.
Genetic Organization of the I Region
In the past the I region had been divided into five
subregions by serological and functional analysis of
recombinant H-2 haplotypes; these are: I-A. I-B. I-J. I-E and
I-C (Murphy 1981; Klein et al. 1981; Klein et al. 1983). The
subregions are defined by crossover positions in H-2
recombinant strains. However, so far only four I region-
associated (la) products have been identified by both
serological and biochemical analysis (Jones 1977; Uhr et al.
1979). Failure to identify gene products encoded by I-B. I-
J, and I-C subregions was further explained as follows:
I-B subregion
The existence of a separate I-B subregion was initially
proposed by Lieberman and coworkers (1972) to explain the
genetic control of antibody response to a myeloma protein.
The involvement of the I-B subregion was later postulated for
immune responses to at least five other antigens: lactate
dehydrogenase B (LDHB) (Melchers et al. 1973), staphylococcus
nuclease (Lozner et al. 1974), oxazolone (Fachet et al. 1977),
the male-specific antigen (Hurme et al. 1978) and

17
trinitrophenylated mouse serum albumin (Urba et al. 1978).
In all these cases the mapping of genes controlling the immune
response centered around the four critical H-2 haplotypes,i.e.
BIO (A) (H-2a) C57BL/10 (H-2bl B10.A(4R) (H-2h4) and
BIO.A(5R) (H-215) used by Lieberman and her co-workers.
However, further analysis by Baxemanis et al. (1981) of the
response to LDHB and to myeloma protein MOPC173 revealed the
involvement of Th and Ts cells in response to these antigens,
making the postulate of a separate I-B subregion unnecessary.
I-J subregion
This locus was originally defined serologically and
mapped between I-A and I-E by reciprocal alloantisera raised
between strains B10.A(3R) and B10.A(5R), which are inbred
congenie recombinant strains with a crossover between I-A and
I-E subregions (Murphy et al. 1978a, 1978b). Alloantisera and
monoclonal antibodies raised against I-J-encoded molecules
react with determinants expressed on suppressor T cells, and
the soluble suppressor T cell factors released by these cell
lines (Krupen et al. 1982). There is a lot of experimental
data available supporting the existence of I-J locus (Murphy
et al. 1978a; Waltenbaugh et al. 1981) However, its true
identity and chromosomal location remain elusive. By using
restriction fragment polymorphisms (RFLP) to map the crossover
points among inbred congenie mouse strains that have
recombination events between I-A and I-E loci, I-J subregion

18
was mapped to a 3.4 kb segment of DNA between I-A and I-E.
including 3' half of Eb gene (Steinmetz et al. 1982).
Molecular cloning of this 3.4 Kb region from ten parental and
intra-I recombinant inbred strains have narrowed the distance
between cross points separating I-A and I-E to 2.0 kb,
contained entirely within the intron between E^-E^ and Ep2
exon of Eb gene (Kobori et al. 1984) Although a lot of
explanations have been put forth to account for the apparent
paradox of I-J. all of them are refuted by experiments
showing that cloned DNA of this region fails to hybridize to
mRNA isolated from I-J'1' suppressor T cell lines (Kronenberg
et al. 1983).
I-C subregion
This subregion was defined by the la. 6 specificity,
detected as a cytotoxic antibody present in B10.A(4R) (H-2h2)
anti-B10A(2R) (H-2h4) antiserum (Sandrin et al. 1981) These
antisera containing purported anti-I-C antibodies were shown
to react with a suppressor factor generated in a mixed
lymphocyte reaction (MLR) (Rich et al. 1979; Rich et al.
1979). A MLR that is generated in congenie strain combination
differing at the I-C subregion can be inhibited by the
addition of anti-I-C antisera (Okuda et al. 1978). Mapping
by classic genetic methods has suggested a locus in the I-C
subregion between Ea and the gene coding for the C4 complement
components. Although this segment of DNA has not been

19
characterized using molecular techniques, the data available
do not lend support for the existence of I-C. Others have
never been able to demonstrate any activity in I-C-defininq
H-2h2 anti H-2hA combination by serological methods, MLR,
graft-versus-host reaction, or cell-mediated lympho-
cytotoxicity (CML) assays (Juretic et al. 1981; Livnat et al.
1973).
Linkage Relationship of Class II Genes
Class II gene loci
Chromosomal walking through the I region by the ordering
of overlapping cosmid clones (Steinmetz et al. 1982a) as well
as genetic mapping of restriction fragment length
polymorphisms (Mathis et al. 1983; Hood et al. 1983), has
allowed the chromosomal localization of the loci encoding the
four functional defined class II genes. A continuous stretch
of about 500 kb of DNA encompassing the I region was first
isolated by screening a BALB/c sperm cosmid library with a
human Mhc class II DRA cDNA probe (Steinmetz et al. 1982a).
This 500 kb region of DNA includes the right end of I region,
as the complement component C4 gene mapping into the S region
, can be identified (Figure 2-1). C4 gene is located a few
hundred kb distal to the Ea gene and was identified by a
synthetic oligonucleotide probe specific for the amino-
terminal of C4a subunit. Five class II genes, Aa, Ab, Eb,
Eb2, and Ea extending over a 90 kb region of DNA, have been

20
identified. Ab, Aa and Ea were identified by DNA sequence
analysis, and Eb was identified by a specific oligonucleotide
probe. Eb2 was identified by cross-hybridization with a human
DRA cDNA probe and mouse Eb gene. The identity of Eb gene was
confirmed by comapping via RFLP analysis which localizes a
serologically defined Eb recombinant in the middle of Eb gene
(reviewed by Hood et al. 1983). Southern blot analysis of
mouse genomic DNA with class II probes suggested that class
II genes are single copy and that there are no more than two
a genes and six /3 genes in the mouse genome (Steinmetz et al.
1982a; Devlin et aJL. 1984) All the known class II loci are
contained in a tightly-linked cluster, inserted between the
H-2K and C4 genes. This cluster contains 4 functional genes
and 4 pseudogenes, which are further divided into two
subclasses, I-A and I-E. The eight class II genes, Pb (A^) ,
Ob (A^) Ab, Aa, Eb, Eb2. Ea, and Eb3. are arranged in this
order from the centromeric towards the telomeric end
(Steinmetz et al. 1982a; Davis et al. 1984; Larhammar et al.
1983; Widera et al. 1985) (Figure 2-1 & Figure 2-3). Out of
the eight genes, only four are have been shown to encode gene
products, Aa coupled with A^ to form I-A molecules, E with
to form I-E molecules (Jones et al. 1978; Uhr et al. 1979).
The Ob and Eb2 genes are reported to be transcribed, but at
very low levels and have no detectable protein product (Wake
& Flavell 1986). The Pb gene is a pseudogene, at least in the
b and k haplotypes, as it has a deletion of eight nucleotides

Figure 2-3. Genomic structure of Mhc class II a and ¡3 chains. Black
boxes denote the exons encoded by protein domains. L: leader peptide,
al, at2, pi, >32: extracellular domains, TM: transmembrane region, CY:
cytoplasmic domain, 3'UT:3' untranslated region.

CLASS II (GENE
CLASS II aGENE
$2 TM CY 3UT
to
to
3UT
TM/CY

23
and a termination codon in its sequence. The Eb3 thus far has
been found only in the H-2b haplotype, but probably also
exists in other haplotypes (Flavell et al. 1985b). All
haplotypes studied thus far contain these class II genes. The
distances between these genes are, with a few exceptions,
approximately the same in different haplotypes.
Biochemistry of Class II Molecules
Up to now only four I region-associated (la) products
have been identified by both serological and biochemical
methods. The I-A subregion contains 3 loci that encode three
serologically detectable polypeptides: A*, Aa, and (Jones
et al. 1978). I-E subregion contains a locus that encodes a
fourth class II polypeptide chain, E^ (Uhr et al. 1979).
Structure of class II ploypeptides
The two class II molecules encoded in the I-A and I-E
subregions are both heterodimeric glycoproteins composed of
one heavy (a) and one light (/?) chains (Figure 2-3 and Figure
2-4). The a chains range in molecular weight from 30,000 to
33,000 and the (3 chains range in molecular weight from 27,000
to 29,000. The difference in molecular weight of a and ¡3
chain is due to an extra N-linked glycosyl unit attached to
a chain (reviewed by Klein et al. 1983) The structure of the
class II polypeptides have been determined in a number of

Figure 2-4. The location of Mhc class I and class II genes within the
H-2 complex. The solid boxes indicate the positions of individual
genes, the arrows indicate the transcriptional orientation of genes.

K2 K
SCALE, p-
0 100
200
Aft Ap Aa Ep E$2Ea
300
400
500kb

26
studies (McNicholas et al. 1982; Mathis et al. 1983a; Malissen
et al. 1984; Benoist et al. 1983; Larhammar et al. 1983;
Estess et al. 1986). The sequence data available suggest that
the mouse I-A and I-E molecules are homologous to human DQ and
DR class II genes, respectively (McNicholas et al. 1982;
Malissen et al. 1983a; Larhammar et al. 1983) Each class II
molecule consists of two extracellular domains, al and a2 or
pi and /?2, each about 90 residues in length, a transmembrane
region of about 30 residues, and a cytoplasmic tail of about
10-15 residues. Three of the four extracellular domains (a2,
pi and p2) have a centrally placed disulfide bridge spanning
about 60 amino acid residues, while the al does not. The
membrane proximal domains of both a and p, like that of class
I molecules, show strong homology to immunoglobulin constant-
region domains. In this respect, the class I and class II
molecules are very similar to each other in overall
organization and domain structure. For each of the two
polypeptide chains of class II molecules, a and p chains, the
polymorphic residues are concentrated in the al and pi amino-
terminal domains (Benoist et al. 1983; Larhammar et al. 1983).
These domains are responsible for binding peptides in what
appears to be a single site. By aligning the sequences of
class II a and p chains with the class I heavy chain by
matching the al and pi domains of class II with the al and
a2 of class I, a hypothetical tertiary structure for class II
molecules has been proposed (Brown et al. 1987) (Figure

27
2-5). The folding of the class II molecule resembles that of
class I, in that two a helices are supported by an array of
eight 0-plated sheets (Brown et al. 1988). The recent results
of Perkins et al. (1989) showing that peptides presented by
class I molecules can be presented by class II molecules, and
vice versa, support the notion that the structures of peptide
binding sites are similar in class I and class II.
Structures of class II genes
There is a striking correlation between the gene
organization and domain structure of Mhc class II molecules
(Figure 2-4) Both a and p genes begin with leader-encoding
exons that contains 3-6 residues of the mature proteins. Exon
2 and 3 encode al or pi and a2 or ¡32 domains, respectively.
P genes have three exons encoding TM, CY, and 3'UT region,
while a genes have TM, CY, and the beginning of 3'UT regions
in exon 4, and the rest of 3'UT region in exon 5 (Larhammar
et al. 1983; Estess et al. 1986).
Analysis of the Structure-Function Relationship of Class II
Molecule
The application of DNA-mediated gene transfer (DMGT) has
been a major advancement in the analysis of structure and
function relationships of Mhc gene products. Particularly,

Figure 2-5. A model of the antigen-binding site of the Mhc class II 1^
A molecules.

29

30
DMGT has provided insight into the actual biochemical bases
of immune recognition and regulation, which are highly
dependent on the fine structure of Mhc-encoded products and
T cell receptors with which they interact.
Regulation of class II gene expression
The expression of class II genes is normally limited to
a number of tissues (Klein 1986). Cell surface expression of
class II is positively regulated by the addition of gamma
interferon (King & Jones 1983). Gamma interferon can increase
both class I and class II gene expression (King & Jones 1983).
It appears to act at the level of transcription, since the
surface expression is correlated with the level of specific
mRNA (Nakamura et al. 1984) Initial studies on class II gene
expression following transfection were performed using cells
that either constitutively expressed (B lymphoma) or were
inducible (macrophage cell lines) for endogenous class II
genes (reviewed by Germain & Malissen 1986). Introduction of
the genomic copies of mouse class-II genes into B-lymphomas
resulted in high levels of gene transcription and the
expression of gene products of the transfected genes on the
cell surface (Ben-Nun et al. 1984) However, it was difficult
to assign the observed effect in serologic or T cell
restriction element to the introduced gene products. The
assembly of a variety of class II molecules following the
introduction of a and/or (3 chains, prevented the dissection

31
of which introduced chain caused the phenotypic traits. Ia'
mouse fibroblast L cell lines derived from the original L-cell
line of C3H fibroblasts have been used for a variety of gene
transfer studies. Using cosmid clones containing the complete
DRA and DRB genes, L cells were first demonstrated to express
the class II molecules by Rabourdin-Combe & Mach (1983). No
expression was seen when either DRA gene or DRB gene was
introduced separately. This is consistent with the
suggestion that a:)3 pairing is required for the efficient
cell-surface expression of Mhc class II, although one
recombinant, A.TFR5 (I-Af. Eak) has been suggested to express
a free E, chain on the cell surface (Begovich et al. 1985) .
Their observations were confirmed by studies of Malissen and
coworkers (1984) and Norcross et al. (1985) with mouse class
II genes. In both studies, transfection of either a or /3
chain gene alone failed to lead to the membrane expression,
whereas the cotransfection of the A,,:^ pairs derived from the
same haplotypes (e.g. A^a/, AkA/) resulted in significant
surface expression. These results agree with those obtained
using Ia+ recipient cells, in that the independent transfer of
a or /3 chain genes result in the expression only through
pairing with the endogenous complementary class II gene
products (Ben-Nun et a^. 1984). However, one should be
cautious about the view that a:/3 heterodimers are required for
the surface expression, as most of the monoclonal antibodies
used for the detection of membrane molecules have not been

32
shown to react with single a or /? chains, which presumably
would assume a different configuration as single chains from
when paired with the other complementary chain. Thus, the
surface expression of isolated a or /? chain might be
undetectable using standard reagents. However, additional
experiments are also consistent with a lack of surface
expression of free a or /3 chains. McCluskey et al. (1985)
compared the surface expression of ABk chain gene in L cells
to membrane expression of a chimeric classll:classl gene. The
latter chimeric molecule is composed of domain covalently
linked to the a3, TM and CY portion of class-I-Dd molecule.
Following transfection, the expression of the chimeric gene
can be detected with both anti-I-Ak and anti-a3 (Dd) monoclonal
antibodies. The same anti-I-Ak antibodies failed to detect
the surface expression of L cells transfected only with the
native A^k chain gene and shown to contain the high level of
Abk mRNA. This pair of cells was also analyzed using rabbit
anti-I-A heteroantiserum, which has been shown to precipitate
free A* chain from a reticulocyte lysate in vitro translation
product (Robinson et al. 1983) and to detect both A*, and
polypeptides in western blots (Germain & Malissen 1986).
Again, the cells containing the chimeric gene stained, but the
cells containing the native A^k gene alone did not. These
results indicate that single a or p chain do not reach cell
surface efficiently and further imply that the A^ domain per
se does not prevent surface expression.

33
Dispensability of I-E molecules
It has been estimated that some 2 0% of wild mouse
populations do not express I-E molecules (Gotze et al. 1981).
Laboratory inbred mouse strains of b, s, f, and q haplotypes
fail to express serologically detectable I-E molecules (Jones
et al. 1981) The defect in mice of b and s haplotypes is due
to a deficiency of E,, chains; E^ polypeptide is undetectable
in the cytoplasm while the normal amount of cytoplasmic E^
chains can be visualized by 2-D gels (Jones et al. 1981) The
expression defect of these strains can be complemented by
crossing b or s haplotypes with Ea-expressing strains, which
results in normal expression of hybrid I-E molecules in FI
hybrids (Jones et al. 1981) However, neither E nor E* chain
can be detected in cytoplasm of f- and q-haplotype mice,
because of defective processing of both Ea and Eb mRNA (Mathis
et al. 1983; Tacchini-Cottier et al. 1988).
Combinatorial association
L cells have also been used to examine the issue of
allelic control of a:/3 pairing and restriction on cross
isotype a:p assembly. Initial studies by Fathman & Kimoto
(1981) and Silver et al.(1980) suggested that la* cells from
heterozygous individuals contain a mixture of la. molecules
derived from the free assortment of allelic a and /? chains of
a single isotype in all possible combinations. Thus, in (H-
2b x H-2k) Ft mice, one would find A^A^, A^A^, AakA^b and A^A/

34
heterodimer in approximately equivalent proportions. Such a-
and p- chain mixing within an isotype did not seem to occur
between distinct isotypes (i.e. A^E*) However, during
attempts to develop cell lines expressing only Fl-type la
molecules (e.g. a/a^) it was found that although haplotype-
matched A^A^ pairs yield high expression in primary
transfectants, cotransfection of haplotype-mismatched pairs
gave little or no expression (Germain et al. 1985). This was
true even though the genes used for the matched or mismatched
gene pairs were identical, and despite the presence of
detectable Aa and Ab mRNA in the nonexpressing cells.
Additional experiments revealed that for genes of b, d and k
haplotypes, cis-chromosomal a:/3 pairs (e.g. hfhfi*) always
gave better expression than trans-pairs (e.g. AakApb) ;
experiments also indicated that the expression of the latter
varied over a wide range, depending on the particular allelic
forms of a and p employed. Furthermore, AaV and AakA^b
molecules, the basis for previous suggested "free pairing",
are the best expressed haplotype-mismatched mixes, whereas
A^Apd has never been detected. In order to map the region of
the Ap molecules controlling the preferential pairing,
recombinant Ap molecule involving the b, d and k alleles were
constructed. The entire A^ domain was exchanged between
different alleles, or the amino-half of Awas covalently
linked to the carboxyl-half of A^ and various Ap2, TM and CY
regions. These "domain and hemi-domain shuffled" Ab genes

35
were independently cotransfected with Aab,d,or k into L cells.
Their results indicate that the most important portion of Ab
with respect to a:(3 pairing is in the amino-half of A^, in
that molecules containing this region from a given allele
expressed best with cis-matched Aa and at levels similar to
wild type Ab, irrespective of the origin of the remainder Ab
gene. However, when isotype-different a:/3 pairs were
cotransfected into L cells, the results were quite unexpected.
Although introduction of Abk and Eaa/k yield no surface la
detectable with either anti-Ab or anti-E antibodies, Abd did
pair with Ea to produce membrane molecules reactive with anti-
I-Abd and anti-I-Ea antibodies. Immunoprecipitation studies
showed that these molecules existed as noncovalently
associated dimers (Germain & Quill 1985). These data support
the view that Aa and Ab genes located on the same chromosome
actually coevolve for best "fit", such that cis-pairs form
more efficiently than trans-pairs (Figure 2-6). This view is
further supported by the studies of McNicholas et al. (1982),
showing that an 8-10 fold preference of Eau:E/5u assembly over
Eu:E0k in cells of (B10.A(4R) x BIO. PL) F: mice. The data on
cross-isotype molecules indicate control of a:/3 pairing is
strongly influenced by the highly polymorphic amino termini.
To evaluate the relative efficiency of inter- versus
intraisotypic la dimer expression, L cells were sequentially
transfected with multiple class II a and ¡3 chain genes
(Germain & Sant 1989). Then individual clones were analyzed

Figure 2 6. Recombinatorial association and expression of a chain and
/3 chain of Mhc class II molecules.

A

38
both for the level mRNA expression produced by transfected
genes and for their expression of inter- and intra-dimer at
the surface. In three gene transfection system (e.g., Ab, Ea,
and Eb) it was found that isotype-matched E^E^ dimer was
expressed at 3-5 times the efficiency of the isotype-
mismatched EA^ dimer based on the amounts of each /3 chain
required to drive cell surface expression for the limited
amount of E^. When A,, and E*, were compared their coexpression
with relative excess hpr the efficiency advantage of isotype-
matched (A,, Ap) versus isotype-mismatched (E^A^) is about 3 to
4 fold. Additional experiments employing transfectants
expressing Abd, Aad. Ebd. and Ea showed that in clones
expressing mRNA ratios similar to B cells, only the isotype-
matched dimers were expressed. In clones that expressed high
levels of Apd, in addition to isotype-matched h/h/' and e/e/,
there was a significant amount of E^Apd at the cell surface.
These data indicate that the asymmetry chain production in
individual chain levels can lead to the expression of less
favored isotype-mismatched dimers. In a recent report,
recombinant mouse strains and transgenic mice with defective
Eb genes, but with normal Ea genes, were examined for surface
expression of E molecules (Anderson & David 1989) E^,
molecules were shown to be expressed in B10.RFB2 (Abf, Aaf,
Ebf, Eak) and B10.RQB3 (Abq. Aaq. Ebq, Eak) by cell surface
staining with anti-E^ monoclonal antibody (14-4-4) in flow
cytometry analysis. It has been proposed that these

39
molecules in fact may be hybrid la dimers formed by E^rA^
pairing, as they can not be stained by E^-specific antibodies
and can be detected in H-2q mice with the Eak transgene. This
finding is further supported by the demonstration of E^A^ as
a major class II molecule at the cell surface of a BALB/c B
cell lymphoma (Spencer & Kubo 1989). Furthermore, although
the hybrid E^A^ can not be isolated by immunoprecipitation, it
can function in vivo leading to the clonal deletion of two V£
TcR subsets, Vfl6 and Vffll (Anderson & David 1989) which have
been shown to interact with the I-E molecule during the thymic
selection (Kappler et al. 1987) .
Functional Role of Mhc Gene
One of the most distinguishing features of gene products
of Mhc is their extensive genetic diversity. One of the most
important breakthroughs in cellular immunology was the
discovery that the influence of gene products of the Mhc on
immune response stemmed mainly from the critical role they
played in the activation of regulatory T lymphocytes
(Benacerraf 1981; Heber-Katz et al. 1982, 1983). Immune T
cells are clonally specific and only recognize foreign
antigens in the context of appropriate Mhc molecules. The
discovery of this Mhc-restriction was possible only because
Mhc molecules are polymorphic and T cells selected by an
antigen in the context of one polymorphic variant can be

40
activated only by the same combination of foreign and Mhc
molecules (reviewed by Parham 1984). T cells must corecognize
antigen in association with one of these Mhc-encoded molecules
in order for activation to occur. Cytotoxic T cells prefer
class I molecules whereas inducer T cells prefer class II
molecules. However, the relationship between the antigen-
specific and Mhc-specific recognition component of T-cell
receptor remained speculative until the advent of T-cell
cloning. Kappler et al. (1981) fused two T-cell clones with
different specificities and asked whether the antigen- and
Mhc-specific component could segregate independently. A
hybridoma specific for ovalbumin (OVA) in association with the
I-Ak molecules was fused to a normal T-cell line specific for
keyhole limpet hemocyanin (KLH) in the context of I-Af
molecules. The resulting cloned somatic hybrid could be
stimulated to secret interleukin-2 by either original pair of
antigen and la molecule, but not by OVA in association with
I-Af or KLH with I-Ak. These results indicated that T cell
recognition of antigen was dependent on recognition of the la
molecules. The first convincing evidence that indicated that
la molecules and antigen interact with each other during the
T-cell activation process came from the studies of BIO.A mice
immunized with pigeon cytochrome c (Heber-Katz et a. 1982).
In defining the specificity of the response by using different
species of cytochrome c, it was noted that the moth cytochrome
c and its C-terminal fragment always elicited a heteroclitic

41
response, i.e. it was more potent on a molar basis than the
immunogen, pigeon cytochrome c. Although most of the BIO.A
(E^k:E^k) T-cell hybridomas specific for pigeon cytochrome c
could be stimulated by moth cytochrome c in association with
BIO.A(5R) hybrid I-E (E^b:Eak) antigen-presenting cells, they
could not be stimulated by pigeon cytochrome c in the context
of hybrid I-E. No other antigen presenting cells (APCs)
carrying disparate H-2 haplotypes, e.g., APCs from BIO and
BIO.A(4R) mice (neither strain express I-E molecule), gave
any stimulation. Thus, these T-cell clones were able to
recognize moth cytochrome c associated with either Ek: E^ or
la molecules. Other experimental evidence also
suggested that antigen recognition by cytotoxic T cells was
fundamentally similar to that of helper T cells (Hunig & Bevan
1982) Using la-containing planar membrane as antigen
presenting particles together with defined synthetic peptides,
it was demonstrated that la and "processed" antigen are the
only requirement for T cell recognition. That la and
processed antigen interact specifically prior to T cell
recognition was supported by the observation that antigens
could compete with one another at the level of antigen
presentation in the absence of T cells (reviewed by Buus et
al. 1987). The first direct biochemical evidence of a
specific antigen/Mhc interaction came from equilibrium
dialysis studies using affinity purified Mhc molecules and
labeled synthetic peptide (Babbitt et ajL. 1985) They

42
demonstrated that hen egg lysozyme (HEL) 46-61 [HEL(46-61)]
bound to IAk. but not to I-Ad. This binding study correlated
with the finding that T cells specific for HEL (46-61) from
high responder H-2k mice are restricted by I-Ak whereas
2.d mice are low responders. These results demonstrated a
correlation between immunogenic peptide-la interaction and Mhc
restriction (Babbitt et al. 1985). Furthermore, it was shown
that the failure of pigeon cytochrome c to be recognized in
the context of the hybrid I-E molecule was due to the fact
that hybrid I-E molecule was unable to interact with pigeon
cytochrome c-derived synthetic peptides (Buus et al. 1987).
Each Mhc molecule binds many different peptides, using a
single binding site and probably through the recognition of
broadly defined motifs (Buus et al. 1987). This concept of
single antigen binding site is compatible with the recently
described X-ray crystallographic structure of human class I
molecules (Bjorkman et al. 1987a, 1987b).
Genetic Polymorphism of Mhc Genes
There are five distinguishing features of H-2 polymorphism
in wild mice that have been the subject of considerable
investigation. 1) there is a large number of alleles encoded
by each genetic locus. The most polymorphic genetic loci
known in the mouse are located within the H-2 complex.
Although at least 50 alleles have been detected for the H-2K
and for the H-2D genes, it is estimated that at least 100

43
alleles may exist in each of these genes (Gotze et al. 1980;
Klein & Figueroa 1981, 1986). There are other genes within
the H-2 complex are also highly polymorphic, but they tend to
be less polymorphic than the H-2K and H-2D genes. 2) most if
not all wild mice are heterozygous with respect to H-2 class
I and class II genes (Duncan et al. 1979; Nadeau et al. 1981).
This high level of heterozygosity is unprecedented in the
mouse and is mainly, if not entirely, a result of the presence
of a large number of alleles in wild mouse populations. It
was estimated that over 90-95% of the wild mice are
heterozygous at both K and D loci and at least 85% are
heterozygous at the Ab and Eb loci (Duncan et al. 1979;
Nadeau et al. 1981). These figures concur with the high H-2
polymorphism estimated from the antigen and gene frequencies
(Klein 1986). 3) H-2 polymorphism occurs as a family of
closely related alleles. Both amino acid and DNA sequence
analysis demonstrates that the similarity between H-2 genes
and proteins is discontinuous (Wakeland et aJL. 1986) 4) both
sequence and amino acid analysis of serologically and
biochemically indistinguishable class II molecules derived
from different subspecies suggest that they are identical
(Arden et al. 1980; Arden & Klein 1982). 5) there is a high
percentage of nucleotide difference between alleles from the
same locus. The nucleotide sequence variation can go up as
high as 5-10%, including the coding region (Benoist et al.
1983; Estess et al. 1986)

44
Mechanisms generating polymorphism of Mhc genes
Mutation. It is generally believed that ultimate source
of genetic variation is mutation (Nei 1987b). There is no
evidence suggesting that the extensive diversity of Mhc is
generated by high mutation rate (Hayashida & Miyata 1983;
Klein 1987) Serologic typing of class II genes of wild mice
in global populations suggested class II molecules can be
arranged into families of alleles, based on the antigenic
similarity and tryptic peptide fingerprints of I-A molecules
(Wakeland & Klein 1979; Wakeland & Klein 1983). Each family
consists of a cluster of closely related alleles. Tryptic
peptide fingerprinting comparisons of alleles within the same
family revealed that the contemporary Aa and Ab alleles arose
from common ancestors by multiple independent mutational
events (Wakeland & Darby 1983). Furthermore, radiochemical
sequence analysis of structural variants within the family
indicates that these I-A variants have diversified by
accumulating discreet mutations within the al and ¡31 domains
of I-A molecules (Wakeland et al. 1985). Similar conclusions
have been drawn from the studies of human class II molecules
(Gustafsson et al. 1984).
Gene conversion. Gene conversion (hypermutational
mechanism or segmental exchange) is a process whereby the non
reciprocal exchange of genetic information between two genes
occurs (Baltimore 1981). It differs from unequal crossing

45
over in that neither gene gains or loses genetic material.
Classically, it has been studied in allelic genes of fungi due
to the ease of tetrad analysis. However, a growing amount of
evidence suggests its existence in mammalian genomes (reviewed
by Hansen et al. 1984) Analysis of the murine class I
mutants has provided compelling evidence for the occurrence
of gene conversion-like events in Mhc gene. Nathenson and his
coworkers have undertaken the painstaking structural analysis
of a series of mutant Kb molecules (Geliebter et al. 1987)
Four antigenically important regions within the al and a2
domains of Kb molecules are revealed from the analysis.
Alterations in these regions result in the formation of new
epitopes which are detectable by graft rejection in vivo and
CTL in vitro. The result of their analysis suggests that
micro-recombinations between Kb and other class I genes may be
responsible for the generation of diversity of class I gene.
In most, if not all, mutants analyzed, the non-classical H-2
genes, i.e. £a and Tla region gene are identified to be donor
genes that can recombine into and "mutate" H-2 genes. There
is evidence showing that the gene conversion is operating in
H-2 class II genes as well (Mengle-Gaw et al. 1984) A B6.C-
H 2bmi2 12) mouse is Mhc class II Abb mutant, derived by
spontaneous mutation from a (BALB/c x B^ parent. The bml2
mutant and its B6 parent show reciprocal skin graft and two-
way mixed lymphocyte reaction (MLR). Genetic studies and
tryptic peptide mapping studies have concluded that Ab112 gene

46
from bml2 mutant differ only 3 nucleotide from its B6 parent
Abb gene. By T cell proliferation assay and monoclonal
antibody-blocking studies, alloreactive T cell clones are
shown to recognize the EakE^b and AabA0bni12. Comparison of
sequences among Abbm12. Abb and Ebb indicates that the bml2 DNA
sequence is identical to the Ebb sequence in the region where
it differs from Abb. Furthermore, this region is flanked by
a stretch of identical DNA sequence between Abb and Ebb. These
results suggest that the bml2 mutation arose by gene
conversion of this region of Ebb into the corresponding region
of Abb. The maximum extent of sequence transfer between Ebb
and Abb is estimated to be 44 nucleotides, but could be as
little as 14 nucleotides. Evidence of segmental exchange has
also been provided by analyzing the exon sequences of eight
Ab alleles (McConnell et al. 1988). In an attempt to analyze
the association between exon and intron sequences, it was
noted that most alleles of exons evolve in association with
their associated intron sequence polymorphisms with the
exception of two alleles, Abb and Abnod (Figure 2-7) These
two alleles appear to be the products of intragenic segmental
exchange (McConnell et al. 1988).

Figure 2-7. Segmental exchange of Mhc class II Ab genes. A summary of
the relationships of the sequence polymorphisms in the pi and (32 exons
with the retroposon polymorphism which occur in the intron between them.
Six of eight Ab alleles have exon sequence polymorphisms that are
associated with the retroposon polymorphism. The remaining two alleles
appear to have been produced by intragenic segmental exchange.

A/?
Lineage Allele
1
d,q
s,f
k,u
P 1
Exon
nod
intron
insertions
P 2
Exon
intragenic
segmental
exchange

49
Trans-specific evolution. The evolutionary rate of Mhc
loci is not higher than that of any other loci (Hayashida &
Miyata 1983). Although the presumed rapid diversification
within species can be explained by mechanisms such as gene
conversion, an alternative hypothesis has been proposed by
Klein et al. (1980, 1987) According to this hypothesis, the
evolution of Mhc polymorphism is via a trans-species mode,
starting with a number of major alleles that are passed on in
phylogeny from one species to another. During the
evolutionary process the alleles accumulate the mutations,
which result in the extensive diversity of Mhc genes. There
is mounting evidence supporting this hypothesis. McConnell
et al. (1988) assembled a collection of 49 H-2 haplotypes
derived from five Mus species, including Mus m. musculus. Mus
m. domesticus. Mus m. castaneus. Mus spicilequs. Mus spretus.
A total of 31 Ab alleles was defined by RFLP analysis. Based
on the degree of sequence divergence, 31 alleles defined by
restriction fragment length polymorphism (RFLP) can be divided
into three distinct evolutionary lineages. Most of these
alleles (28 out of 31) were in either lineage 1 or 2, both of
which consisted of alleles derived from 4 separate Mus species
(Table 2-1 and Figure 2-8). These findings are consistent
with the trans-species evolution of Ab gene and contrast with
data obtained when other nuclear genes or mitochondrial DNA
(mtDNA) polymorphisms were analyzed in mice from the same
populations. Genomic sequence comparisons of Abd and Abb show

Table 2-1. Definition of 3 Evolutionary Lineages of Ab Alleles by Quantitative RFLP
Analysis
Evolutionary No. of Ab F Values Mus species
Lineage Alleles Within Group Between Group
1
14
0.65
0.15
m. domesticus, m. musculus,
m. castaneus, soicilecrus.
2
14
0.66
0.15
m. domesticus, m. musculus,
soretus, soicilecrus
3
3
0.66
0.13
m. domesticus

Figure 2-8. Illustration of the evolutionary origins of the three
lineages of Ab alleles. The solid line represents evolutionary lineage
1 which was the earliest form of Ab in Mus. The open line represents
evolutionary lineage 2 which was formed by an 861 bp retroposon
insertion into a lineage 1 allele before the separation of 5 separate
Mus species assayed. The hatched line represents evolutionary lineage
3 which was formed by two additional insertions in a lineage 2 allele
subsequent to the inception of Mus m. domesticus.

Ancestral Mu
Group 1

53
that the region of highest divergence between these alleles
occurs in the intron separating the /31 and /32 exons (Figure
2-9) Abb contains an additional 861 bp of inserted
sequences, which are composed of SINE (short interspersed
repetitive elements), commonly named retroposon. The
relationship of this retroposon polymorphism to the
evolutionary lineage defined was tested by genomic restriction
mapping of Ab genes from both lineages, 1 and 2. The results
indicated the 861 bp retroposon insertion is characteristic
of lineage 2 alleles. Using the SINE sequence as an
evolutionary tag, it is estimated that the Ab alleles in these
two lineages diverged at least 0.4 million years ago and have
survived the speciation events leading to several Mus musculus
subspecies.
Their studies are further supported by the works of
Figueroa et al. (1988). They showed that the molecules
encoded by alleles of Ab locus fall into two groups defined
by their reactions with monoclonal antibodies. One group
reacts with antibodies specific for the antigenic determinant
H-2A.m25; the other with antibodies specific for determinant
H-2A.m27. This serological reactivity pattern correlates with
a specific structural feature of the proteins of Ab genes.
Sequence comparison of Ab genes derived from inbred and wild
strains has revealed that m27-positive proteins have two amino
acids deleted at positions 65 and 67 in the /? 1 exon, while m25
antibodies react with Ab chains that do not have deletions.

Figure 2-9. Analysis of the sequence homology of Abd (lineage 1) and
Abb (lineage 2) Comparison of sequence identity from sequences
available in the Genetic Sequences Data Bank (Genbank). The exons of
each gene are identified by open boxes and labelled on the basis of the
protein domains they encode. The hatched box in Abb represents an 861
bp sequence which was absent in Abd. An expanded version this inserted
sequence is presented below Ab^. The 13 bp host-derived direct
repeatwhich flank the inserted sequence are presented on either side of
the insert. A search for homologies in Genbank with the inserted
sequence revealed that it consisted entirely of short interspersed
nucleotide elements (SINEs). The regions which are homologous to
various SINEs are labelled beneath the insert.

1 Kb
L h E
% H 97.2 95.5 89.9
87.4 95.7 94.4 95.6 84.1
E
13 bp Repeat
II
Mouse IAP LTR
13 bp Repeat
3'
"Alu-like Repetitve
Sequence "8" Family Repetitive Sequence
ui
"Ubiquitous" Repetitive Sequences
100bp

56
But no Ab molecules were ever detected to be positive
ornegative for both antibodies simultaneously. The perfect
correlation between the serological pattern and the presence
or absence of the two deletions have been confirmed by testing
a panel of Ab in Northern blot analysis (Figueroa et al.
1988). The same deletion polymorphisms also exist in other
species distantly related to M. musculus complex such as M.
caroli and M. pahari. which is estimated to be separated from
M. musculus complex 1.7 and 4.8 million years ago,
respectively. Furthermore, the non-deleted and deleted forms
of Ab genes are also shown to be present in inbred strains of
rat, which is another rodent genus closely related to the
genus Mus. They conclude that the codon deletion polymorphisms
are shared not only by different species of the same genus but
also by different genera of the same order.
Comparisons of class I Mhc alleles in two closely
relatedly species: humans (Homo sapiens) and chimpanzees (Pan
troglodytes) have also indicated the trans-species mode of
evolution in this family of genes (Lawlor et al. 1988; Mayer
et al. 1988). There are no features that distinguish human
alleles from chimpanzees. Individual HLA-A or B alleles are
more closely related to individual chimpanzee alleles than to
other HLA-A or B alleles. These studies support the notion
that a considerable proportion of contemporary HLA-A and B
polymorphisms existed before divergence of the chimpanzee and
human lines. A recent report indicates that as high as 30%

57
of asan wild mice (e.g. Mus m. musculus. Mus m. domesticus.
Mus m. castaneus) carry a H-2Kf antigen detected by an
alloantiserum specific for H-2 class I gene (Sagai et al.
1989). H-2Kf antigen is further characterized by a panel of
monoclonal antibodies and restriction enzyme analysis with
a H-2K locus-specific probe for 3' end of H-2K. A
characteristic RFLP pattern was always found to be associated
with a monoclonal antibody reactivity pattern. The
concordance between the presence of antigenic determinant and
a particular RFLP pattern is observed not only in Mus musculus
subspecies, but also in M. spretus. Their results indicated
that the antigenic determinant reactive with monoclonal
antibodies is an ancient polymorphic structure which has
survived speciation in the Mus genus, and is closely
associated with a stable DNA segment at the 3' end of H-2K
gene.
Intra-exonic recombination. A recent study of Mhc class
II Ab genes indicated that another mechanism was mainly
responsible for the genetic diversity of Mhc genes (She et al.
1990b). A panel of 52 different alleles derived from
laboratory inbred mice as well as various species of mice and
rats was analyzed for their A^2 nucleotide sequence.
Examination of the patterns of sequence polymorphisms revealed
that the majority of sequence diversity was localized in five
subdomains. Each of these subdomains have several

58
polymorphic sequence motifs. On the basis of the hypothetical
three-dimensional structural model of class II molecules
(Brown et al. 1988), these polymorphic sequence motifs are
located in the regions encoding the ABS. With respect to the
whole Afi2 exon, it was found that a specific sequence motif
could associate with several different motifs from other
subdomains to form an allele. This observation indicated that
the diversification of Afi2 exons resulted from intraexonic
recombinations which shuffled these motifs into various
combinations (Wakeland et al. 1990a; She et al. 1990b)
Mechanisms that maintain Mhc polymorphisms
Although a variety of data indicate that Mhc polymorphism
is maintained by some type of balancing selection, the precise
mechanisms involved have remained controversial. Two forms
of balancing selections, overdominance and frequency-dependent
selection, have been proposed to account for the unprecedented
genetic diversity of Mhc genes.
Overdominant selection(heterozygous advantaged. The
maintenance of Mhc polymorphism by overdominant selection was
first proposed by Doherty and Zinkernagel (Doherty &
Zinkernagel 1975). It is based on the well-established
experimental observation that Mhc-1inked responsiveness is a
dominant (or codominant) genetic trait (Benaceraf & Germain
1978). Mhc heterozygotes are capable of responding to any

59
antigens recognized by either parental Mhc haplotypes, since
Mhc molecules encoded by both Mhc haplotypes are coexpressed
on the surfaces of antigen-presenting cells (Benaceraf &
Germain 1978) Hughes & Nei (1988) examined the pattern of
nucleotide substitution in the region of ABS, involving the
57 polymorphic amino acid residues and other regions of Mhc
class I alleles of both human and mice. Their study is based
on the theoretical prediction that in the presence of
overdominant selection the rate of codon substitution is
increased compared with that for neutral alleles and only
nonsynonymous substitution would be subject to overdominant
selection as synonymous substitutions are more or less neutral
(Maruyama & Nei 1981) This increase in rate of codon
substitution is due to the selective advantage of
heterozygotes carrying the new mutant allele. Their results
indicate that in the ABS the rate of nonsynonymous
substitution is higher than that of synonymous substitution,
whereas in other region the reverse is true. In a later study
(Hughes & Nei 1989), the same type of analysis is extended to
class II Mhc genes. It is concluded that the unusually high
degree of polymorphism at class II Mhc loci is caused mainly
by overdominant selection operating in the ABS. Therefore,
the biological basis of overdominant selection for class II
Mhc loci seems to be similar to that for class I Mhc loci.
A mathematical study of overdominant selection model also
indicates that it can maintain polymorphic allelic lineages

60
for a long time and thus it has sufficient explanation for the
trans-species evolution of Mhc gene (Takahata & Nei 1990).
Frequency-dependent selection. Initially it was
speculated that Mhc alleles generate heterozygote disadvantage
in association with infectious diseases and that some kind of
freguency-dependent selection is reguired to maintain the high
degree of polymorphism (Bodmer 1972) Pathogen adaptation
model was suggested as one form of freguency-dependent
selection (Snell 1968; Bodmer 1972). This model is based on
the assumption that host individuals carrying new antigens,
which have arisen recently by mutation, will be at an
advantage because pathogens will not have had the time to
adapt to infecting the cells with new antigens. Therefore,
this will generate a new form of freguency-dependent
selection, in which a new Mhc allele initially has a selective
advantage compared with an old allele, but gradually declines
with time. This model also suggests that in the presence of
pathogen adaptation the average heterozygosity, the number of
alleles, and the rate of codon substitution will increase
compared with those for neutral alleles.
Rare allele advantage. Another model of freguency
dependent selection is rare allele advantage. This hypothesis
is based on the notion that endemic pathogens, which evolve
much more rapidly than their vertebrate hosts, will tend to

61
adapt their antigenicity to minimize immune recognition by the
most prevalent Mhc genotypes in a population. Consequently,
new or rare Mhc alleles will have a selective advantage due
to increased resistance to prevalent pathogens. This model
predicts cyclic fluctuations in the frequencies of Mhc alleles
as pathogens are driven to evolve antigenicity, evading the
immune responsiveness of a series of new "prevalent" alleles.
This model can explain the maintenance and long persistence
of polymorphic alleles by rescuing the rare alleles from
distinction (Wakeland et al. 1990).
Recombination Within the Mhc
Recombinational hot spot within I region
The genetic material is a dynamic structure that
reorganizes during evolution and differentiation. Nucleotide
sequences are rearranged by recombination between homologous
or non-homologous sequence. While homologous equal
recombination breaks and rejoins chromosomes at precisely the
same position, unequal recombination between homologous
sequences in different positions leads to duplication and
deletions. Over the last ten years recombinant mouse strains
have been analyzed by RFLP analysis and DNA sequencing to map
the crossover in the I region (Steinmetz et al. 1982a) These
studies have shown that recombination within the I region is
not random, but localized to specific sites. These sites

62
have been termed recombination hot spots (RHS) (Steinmetz et
al. 1982a). A first such RHS, localized with the intron
between the second and third exons of Eb gene, was identified
from analysis of six intra-I region recombinant mouse strains
(Kobori et al. 1984) Since then, additional three RHS's have
been identified within the Mhc, including K/Pb, Pb/Ob
(Steinmetz et al. 1986; Uematsu et al. 1986) and Ea (Lafuse
& David, 1986) (Figure 2-10). RFLP analysis indicates that
recombination within the Pb/Ob, Eb and Ea is reciprocal
(Steinmetz et al. 1982a; Steinmetz et al. 1987; Lafuse & David
1987). Analysis of secondary recombinant strains indicates
that chromosomes that have recently undergone a recombinant
event are unstable and quite likely to undergo a second
recombination in the next generation (Lafuse & David 1987).
Molecular basis of recombinational hotspots
In the human genome, recombinational hotspots mainly
occur in regions containing hypervariable minisatellite
sequences. These minisatellite sequences are composed of
tandem repeats and occur at multiple locations. The repeat
unit contains a common 16-bp core sequence, GGAGGTGGGCAGGARG.
DNA sequence searchs for the Pb/Ob and Eb recombinational
hotspots have found that short repeated sequences with some
homology to the recombination signal Chi (GCTGGTGG) of phage
lambda: (CAGA)6 in the Pb/Ob hotspot and (CAGG)7_9 in the Eb
hotspot (Steinmetz et al. 1986). The CAGG repeated sequence

Figure 2-10. Location of recombinational hotspots (RHS) within the
2 complex. Arrows indicate the specific region of DNA's involved in
recombination. Adapted from Steinmetz et al. (1987b)

SCALE
O
GENES
K2 K
RECOMBINATION AL HOTSPOTS
300 400 500kb
Aj?2 Aj Aa Ej? Eji2Ea
I
A
11
AA A

65
identified in the Eb hotspot exhibiting significant homology
to the human minisatellite core sequence, and thus may
represent a murine minisatellite (Steinmetz et al. 1987).
Recently, a female-specific recombination hotspot has been
mapped to a 1 kb region of DNA between the Pb and Ob genes
(Shiroishi et al. 1990) This hotspot predominantly occurs
in crosses between Japanese wild mice Mus musculus molossinus
and laboratory haplotypes. Its location overlaps with a sex-
independent hotspot previously identified in the Mus musculus
castaneus CAS3 haplotype. Sequence comparisons between DNA
surrounding this hotspot and corresponding regions from other
strains, including BIO.A, C57BL/10, CAS3 and C57BL/6, revealed
no significant difference. However, sequence analysis of this
Pb/Ob hotspot with a hotspot in Eb indicated that both have
a very similar molecular structure. Each hotspot is composed
of two elements, mouse middle repetitive MT family and the
tetrameric repeated sequence, both are separated by 1 kb of
DNA (Shiroishi et al. 1990).
Definition of Evolutionary Lineage
The evolutionary lineage of Ab was initially defined by
RFLP analysis of 31 Ab alleles from 5 different Mus species
(McConnell et al. 1988). These 31 alleles were ordered into
three distinct lineages based on calculating the fraction of
restriction fragments (F) (Nei & Li 1979) and sites shared
(S) which is used to estimate the genomic sequence divergence

66
(Table 2-1). Sequence comparisons of lineage 1 (Abd) and
lineage 2 (Abb) alleles indicated that the major DNA sequence
polymorphism between these two lineages occur in the intron
2 between 01 and 02 exons (Figure 2-9) The sequence homology
in this intron is <90%, and Abb gene contains an extra 861 bp
of retroposon, flanked by 13 bp direct repeats
(ATGTATGCTGTTT). The host-derived nature of this direct
repeat sequence indicates that the 861 bp retroposon was
inserted into this position as a random event during the
evolutionary divergence Ab genes. Inspection of genomic
restriction maps of alleles derived from separate Mus species
indicate that the retroposon insertion is characteristic of
lineage 2 alleles (McConnell et al. 1988). These results
indicate the evolutionary lineages defined by RFLP analysis
reflect alleles with different retroposon polymorphisms.
Structure and Evolution of Retroposon
Before cloning of DNA became a major tool of studying
gene structure and function, chromosome renaturation
experiments showed that most organisms possess short stretches
of moderately repeated DNA (mrDNA) separated by longer
sequences of low copy number (Davidson and Britten 1979). For
mammals, most of the mrDNA is composed of retroposons, some
of which are thought to represent mobile genetic elements
using RNA intermediates in their replication (Jagadeeswaran

67
et al. 1981). These mrDNA belong to different sequence
families in different mammalian orders(reviewed by Rogers
1985). The majority of mammalian interspersed repeated DNA
falls into two families, referred to as short and long
interspersed nucleotide elements, SINEs and LINES,
respectively (Singer 1982). The "generic SINE sequence
contains an internal RNA polymerase III promoter, an A-rich
3'end and flanking direct repeats. The size of SINEs
typically range from 75 to as much as 500 bp in length. All
nonviral retroposons correspond to a partial or complete DNA
copy of a cellular RNA species. With a few exceptions,
nonviral retroposons are derived from fully processed RNAs
(reviewed by Weiner et al. 1986).
Structure of Alu and "Alu-like" Family
The first well-characterized and the most abundant
repeated DNA family in primates is the Alu family which
constitute most of the dispersed, repeated DNA (Houck et al.
1979). The 500,000 Alu elements in the human constitute 5-6%
of the genome by size, occurring on average every 5-9 kb and
differing on average by 13% from the consensus sequences
(Schmid & Jelinek 1982; Rinehart et al. 1981). Other SINE
families are referred to as "Alu-like" or "Alu-equivalent"
families. Mice, rats, and hamsters all contain two abundant
"Alu-like" families, B1 and B2 (Kramerove et al. 1979; Krayev
et al. 1980; Haynes et al. 1981). The Alu elements,

68
approximately 300 bp long, were so named because they contain
a distinctive Alu I cleavage site. Regions of direct internal
repetition within Alu seguences indicate that the Alu element
is composed of two incompletely homologous arms, an
approximately 130 bp left arm and a right arm which differs
from the other by an insertion of 31 bp (reviewed by Doolittle
1985). Although human Alu sequences are dimeric, the
homologous rodent sequences (the B1 superfamily) are
monomeric. It is believed that both Alu and B1 sequences are
derived independently from 7SL RNA as 7SL RNA gene has about
150 bp in the middle that is not found in the Alu family (Ullu
et al. 1985; Weiner et al. 1986). 7SL RNA is a component of
signal recognition particle, required for cotranslational
secretion of proteins into the lumen of rough endoplasmic
reticulum (Walter & Blobel 1982), and is highly conserved
throughout evolution. Alu-like sequences, and retroposons in
general, have a strong tendency to insert into each others'
(A)-rich tails. This has apparently generated composites
which are themselves propagated as single retroposons
(Jagadeeswaran et al. 1981; Haynes et al. 1981).
Mechanisms of Retroposition
Transcription by polymerase III
The basic model for retroposition of SINEs involves RNA
polymerase III transcription of genes, reverse transcription
of the RNA, and integration into the genome (Figure 2-11) .

69
All SINEs contain an internal RNA polymerase III split
promotor (Galli et al. 1981). In vitro transcription
experiments have shown that the 5' end of the SINE transcripts
have coincided exactly with the left end of the repeated DNA
sequence. These results have led to the proposal that the
SINEs propagate via RNA-mediated retroposition (Jagadeeswaran
et al. 1982) SINE family members are able to produce in vivo
transcripts, their transcription is regulated in a tissue-
specific manner. The homogeneous size of Alu transcripts
indicates that one or a few identical family members are
transcribed (Watson & Sutfliffe 1987). The transcription of
7SL RNA gene requires a specific 37-bp upstream sequence in
addition to its internal promoter (Ullu & Weiner 1985). Since
the Alu family has evolved from 7SL RNA, its promotor may
similarly depend on such upstream sequences. A critical step
in promoting an efficient SINE retroposition may be mutations
that render the promotor independent of flanking sequence.
However, the established chromatin structure and environment
into which the SINE member is situated may have a regulatory
effect on the transcription of SINE family members. In
transfection assays, it was found that the introduced SINE
member is transcriptionally active in transient assay, but is
silent in long-term transformants. These results also support
the concept that the internal promotor is not sufficient by
itself in vivo (reviewed by Deninger 1990) .

Figure 2-11. A proposed mechanism for SINE retroposition.
The first step is transcription of the repeated DNA sequence.
The repeat is represented by a heavy line, its flanking
sequence by thinner lines, an the transcript by a wavy line.
Transcription initiates at the beginning of the repeat,
adjacent to the flanking direct repeat (double solid arrows),
continues through the entire repeat, and terminates in
flanking sequence. This transcript is suggested to be capable
of self-priming reverse transcription by priming with its
terminal U residues on the 3' A-rich region of the repeat
transcript. Removal of the RNA will then leave a single-
stranded cDNA copy of the entire repeat with no falanking
sequences. This cDNA must tehn integrate into a genomic site
with staggered nicks. It is hypothesized that an A richness
at the nikc site may interact with the T-rich cDNA end to
stabilized the interaction. Repair synthiesis at the junctions
will then result in formation of a newly integrated repeated
DNA family member with a different flanking direct
repeat(double hollow adrrows). Many of these steps are
hypothetical and a number of alternatives are possible.
Adapted from Deininger (1989).

71
Transcription
3'
AAAAA1 w- -AIU
AAAAA ii "i-TTTT-
IfTTTT" AAAA
mbmut
IRapair Synthasis
'

72
Termination of transcription
Most SINEs do not contain the termination signal for RNA
polymerase III (Fuhrman et al. 1981). Transcription starts
from the 5' end of SINE, runs through the entire repeat, and
terminates at the flanking sequence by chance as the consensus
sequence for termination contains four or more T's in a row
(Bogenhagen et al. 1980). Most in vivo SINE transcripts appear
to be polyadenylated (Deininger 1990).
Reverse transcription
Since the transcripts of SINE family members normally
possess a poly(A) tract, they may be able to self-prime their
reverse transcription (Jagadeeswaran et al. 1981) Moreover,
the RNA polymerase III transcripts should have three or more
U's at their 3* end, which may fold back and prime reverse
transcription (Bogenhagen et al. 1980). Reverse transcription
could also be primed by an intermolecular interaction, for
instance, using the 3*end of another transcript through the
(A)-rich region (VanArsdell et al. 1981). The source of
reverse transcriptase, which must be active in germ line, is
unknown. One possible source is from the intracisternal A
particles (IAP), which produce particles containing reverse
transcriptase (Wilson & Kuff 1972) and are active in early
embryos (Kelly and Condamine 1982) Or it may be provided
during retroviral infections or from endogenous retroviral
sequences (Martin et al. 1981). Small RNA molecules can be

73
packaged into retroviral particles and be reverse transcribed
(Linial et aJL. 1978) Packaging should facilitate the reverse
transcription and may account for the high efficiency of SINE
retropositon. Packaging may also promote an "infection-like"
process facilitating RNA made in somatic cell to enter the
germ line (Vanin 1984).
Integration
To facilitate the integration process, the genome must
be nicked to allow the entry of new sequences, followed by
repair synthesis to make direct repeats at the integration
sites. Direct repeats generated are generally rich in A
residues and vary widely in length, suggesting that SINE do
not use specific integration enzymes but instead take
advantage of nicks generated by other nonspecific enzymes.
Topoisomerases, enzymes that relax the genome during
replication and transcription, have been shown to have nicking
activity in a SINE family member in vitro (Perez-Stable et al.
1984). Although topoisomerase I is generally thought to be
nonspecific in its nicking activity, hot spots for DNA
cleavage have been reported (Busk et al. 1987) These sites
are A rich and at least partially resemble the 3' terminus and
direct repeats of SINEs. Not only are the integration sites
of SINEs A rich, but the A richness is predominantly at the
left end of the direct repeat (Daniels & Deininger 1985;
Rogers et al. 1986) These findings have several

74
ramifications. First, it shows that the integration is not
random. Second, since the 3' ends of the SINE families are
generally A rich, when they integrate into a new site they
generally make that site even more A rich. Therefore, the 3'
end of SINEs are improved integration sites for more SINE
copies, resulting in a tendency to form perfect tandem dimers
(reviewed by Rogers 1985). In several examples, it appears
that the integration of one element abutting another form a
composite so that they could retropose as a single unit
(Daniels & Deininger 1983).
Functions Attributable to SINE
It is assumed that the broad genomic distribution and
high copy number may serve an important cellular function.
It has also been argued that these repetitive elements are
selfish DNA whose self-propagation provides no benefit to
their hosts (Doolittle and Sapienza 1980; Orgel and Crick
1980). SINEs have been involved in a number of effects on
genome structure and evolution. For example, SINEs may
promote deletion or facilitate recombination (Lehrman et al
1987) act as limits to gene conversion (Hess et al. 1983) and
move unrelated DNA segments throughout the genome either via
retroposition of seguences adjacent to SINEs (Zelnick et al.
1987). They may just affect the long-terms adaptability of
the species.

75
Recombination
Recombination involving the Alu repeats have resulted in
phenotypic changes. For example, at least two different forms
of globin gene defects occur in a pair of inverted Alu
repeats, which result in a deletion of gene. The LDL receptor
gene has a number of Alu dispersed repeats in its intron, 3'
noncoding region, and flanking region. Five naturally
occurring insertion/deletion mutants of this gene have
produced defective receptors, four of which involve Alu-Alu
recombination (Horsthemke et al. 1987).
Suppression of gene conversion
Examination of regions of globin genes have provided
evidence that SINE can help to limit gene conversion events
(Hess et al. 1983; Schimenti & Duncan 1984) The globin genes
consist of a multigene family whose members start to evolve
after duplication. By limiting the degree of gene conversion,
the SINE sequences may promote gene diversification and the
evolution of new functions(Deininger 1990).
Mobilization of DNA sequence
Several composite SINE families are formed by fusing new
sequences with a SINE to become a functionally-transposing
unit, indicating that SINE has a potential to mobilize other
sequences (reviewed by Weiner et al. 1986). There is one
example of genomic non-repetitive sequence that lay between

76
two artiodactyl SINEs retroposed with them as a unit,
resulting in the duplication within the cow haploid genome
(Zelnick et al. 1987).
In vitro transfection experiments also indicated that
SINEs might repress or activate transcription initiated by
adjacent RNA polymerase II promotor (McKinnon et al. 1986).
Another function conferred by certain SINEs is to encode
portion of polypeptides. Alu dispersed repeats constitute for
32 codons of 3' portion of genes for decay-accelerating factor
and for a B-cell growth factor (Caras et al. 1987; Sharma et
al. 1987). The CCAAT box of the 0-globin gene in primates is
part of an Alu repeat sequence (Kim et al. 1989). Some SINEs
are found in the 31 noncoding exons and provided
polyadenylation signal (Krane & Hardison. 1990). Thus,
functional sequences provided by SINE include promotor, RNA
processing and protein-coding sequences.
Evolution of Introns
Mammalian genes are discontinuous, broken up along the
DNA into alternating regions: coding sequence or exons, which
are interspaced with other noncoding sequences or introns that
will be spliced out of the primary transcript. An intriguing
question regarding the introns is what advantages or functions
are provided to the cell by them. There has been ample
speculation about the origin and maintenance of introns in

77
eukaryotic genomes. Gilbert (1978, 1985) proposed "exon
shuffling" hypothesis which states that introns provide an
evolutionary advantage by allowing recombination within intron
sequences, and that introns in modern genomes were remnants
of the recombination process that speed up evolution. The
observations that the exons often correlated with functional
domains and that the homologous exons can be found in
different genes have been used to support this idea.
Examinations of genes coding for certain ubiquitous
enzymes, such as triosephosphate isomerase, whose sequence is
highly conserved across species, have revealed that the intron
positions are not random and that all of these introns were
in place before the division of plants and animals (Gilbert
et al. 1986), the introns were lost from prokaryotes as their
genomes became streamlined for rapid DNA replication
(Doolittle 1978) After the discovery of introns, a number
of authors have suggested that intron might represent the
vestiges of transposable elements which had been inserted into
the genes (Cavalier-Smith 1985; Hickey & Benkel 1986).
Although there is evidence that many, if not all, introns are
dispensable (Ng et al. 1985), there is also evidence that the
internal sequences of introns are important for splicing
(Rautmann & Breatnach 1985). Cech (1986) has suggested that
all RNA splicing reactions are evolutionarily related, with
the exception of those involving some pre-tRNA. This
evolutionary link between different intron classes implies

78
that the introns of nuclear protein-coding genes were also
capable of replicative transposition at some stage in their
evolutionary history. Hickey & Benkel (1986) have suggested
a model to account for the evolutionary origin of introns.
The main points of this model are summarized as follows: (i)
Most present day introns are the relics of retrotransposons;
(ii) copies of transposable sequence were contained within the
RNA primary transcript; (iii) RNA splicing activity encoded
by the transposable elements processed the transcripts into
exon and intron sequences; (iv) the exons were then available
for translated into gene product; (v) the spliced intron were
able to be reversed-transcribed into DNA and reinserted into
else where in the genome. Although Doolittle (1978) argued
that the de novo insertion of introns into functional genes
would disrupt normal gene expression and thus would be
strongly selected against at the organismic level, it was
proposed that the RNA splicing might function solely to
counteract the potential negative effect of introns (Hickey
& Benkel 1986). A common property shared by all introns is
their removal from primary transcripts by splicing. Numerous
evidences have indicated that the splicing activity is
controlled by introns themselves. For instances, some fungal
mitochondrial group I and II introns can undergo self-splicing
which depends on the structure of RNA transcripts and can
propagate themselves by insertion into genes (reviewed by
Lambowitz 1989). Genetic analysis of mitochondrial system

79
also indicated that in vivo self-splicing depends on so-
called maturase, some of which are encoded by the intron
themselves. All characterized maturase function only in
splicing the intron in which they are encoded or closely
related intron. It has been proposed that the nuclear pre-
mRNA intron have evolved from self-inserted group II intron
(Roger 1989) (Figure 2-12). Once an intron is inserted, it
might take only a single base change to convert the group II
intron into classical intron. Now both types of introns have
similar consensus sequences.
Wild Mice As a Useful Genetic Tool
Part of the goal of this dissertation is to determine the
distribution of evolutionary lineages of the class II Ab gene
in the genus Mus and to determine how long these lineages have
persisted in Mus during the evolution of Ab genes. Previous
studies of the evolution of Mhc class II genes were limited
in the number of species examined and limited in the number
of strains tested. In this dissertation, we have extended
the previous study by including twelve species and subspecies
of genus Mus and the 115 H-2 haplotypes extracted from them.
The "house mouse", has become the most studied animal of
laboratory research probably because its habitat is closest
to that of man. It has been known for some time that the
major laboratory inbred strains are derived from common

Figure 2-12. Proposed sequence of events that a group II
intron could mutate into a classical intron. Adapted from
Roger (1989).

81
DNA insertion of
Group II intron
Mutation
T
21 A<

82
ancestors (Morse 1978). Study of mitochondrial DNA has
indicated that most laboratory inbred strains belong to the
Mus musculus domesticus type (Ferris et al. 1982) On the
contrary, using a Y-specific DNA probe has revealed that the
Y chromosomes of most of laboratory inbred strains, except
SJL, is of M. m. musculus origin (Bishop et al. 1985). Thus
the pool of segregating genes in laboratory mice is fairly
limited and probably does not reflect the mouse species as it
is in the wild (Guenet 1986) In fact, had it not been for
wild mice, the analysis of certain genetic loci, e.g., Mta,
a maternally transmitted histocompatibility antigen, would
have suffered premature termination (Lindahl 1986). Depending
on the degree of association with humans, wild mice can be
distinguished into three groups. These are aboriginal,
commensal and feral. Aboriginal mice live primarily
independently of human construction. Commensal mice live in
close association with man-made structure, and feral mice have
resumed an aboriginal mode of life from the commensal stage
(reviewed by Sage 1981). The aboriginal species include Mus
spretus. M. spretoides (M. macedonicus; M. abbotti), M.
spicilequs (M. hortulanus). All introduced populations of M.
domesticus in the New World and in Australia, which live in
native vegetation, are considered feral forms derived from
commensal ancestors. Based on genetic variability of wild
mice, using both DNA and biochemical markers, the Mus genus
can be divided into the complex species Mus musculus and at

83
least eight other species, including Mus spretus. M.
spretoides. M. spicileaeus. M. cooki. M. cervicolor. M.
pahari. M. platvthrix (Bonhomme et al. 1984; Bonhomme, 1986;
Avner et al. 1988) Mus musculus complex species itself
consists of four main biochemical groups Mus musculus
musculus. Mus musculus domesticus. Mus musculus castaneus. and
Mus musculus bactrianus. all of which are considered as
subspecies.
M. m. domesticus is present in Western Europe, the
Mediterranean basin, Africa, Arabia, Middle East and has been
transported by ship to the New World, Australia and
southeastern Africa, leaving few regions of the earth without
house mice. M. m. musculus occurs in Eastern Europe,
extending to Japan across USSR and North China. M. m.
bacitrianus is distributed from Eastern Europe to Pakistan and
India. The distribution of M. m. castaneus ranges from Ceylon
to South East Asia through the Indo-Malayan archipelago
(Figure 2-13). Even though these four subspecies are quite
biochemically differentiated, they may exchange genes wherever
they come into contact (Bonhomme et al. 1984) One of the
best understood cases is that between M. m. musculus and M.
m. castaneus in Japan (Yonekawa et al. 1986; Yonekawa et al.
1988). The Japanese mouse, M. m. molossinus. has long been
considered an independent subspecies of the house mouse.
However, the restriction enzyme analysis of mitochondrial DNA
(mt DNA) indicated that M. m. molossinus has two main maternal

Figure 2-13. Geographical distribution of four separate subspecies of
Mus musculus complex. M. m. domesticus. M. m. musculus, M. m.
bactrianus. M. m. castaneus.

M. a. auaculut
M. a. bactrianua M. a. castancua

86
lineages. One lineage is closely related to the mtDNA of the
European subspecies M. m. musculus. the other is closely
related to the mtDNA of the Asiatic subspecies M. m.
castaneus.
The three aboriginal species, namely, M. spretus. M.
spretoid. and M. spicilequs. may be found in sympatry with M.
musculus subspecies. M. spretoides and M. spicilequs probably
represent the best case of sibling species thus far discovered
in mammals. They are very similar morphologically and
biochemically. Yet under the laboratory conditions they can
not interbreed (Bonhomme 1986). The mound-building species,
M, spicilequs. is found in steppe grasslands of the Carpathian
basin and the Ukraine. The distribution of short-tailed M.
spretoides is limited to southeastern Europe and Asia Minor
(mainly eastern Mediterranean). M. spretus is found existent
in the western Mediterranean, from France to Libya (Figure
2-14).
Europe is not the homeland of the genus Mus. All of the
Mus species and subspecies that presently inhabit the
continent seem to have entered it with man (Bonhomme 1986).
Certain members of genus Mus have apparently inhabited India
and Southeast Asia since their origins. Three strictly
oriental species, M. caroli. M. cervicolor. and M. cooki. form
a monophyletic group according to single copy nuclear DNA (sen
DNA) hybridization and mtDNA data. Protein electrophoretic
data also suggest that these three Asian species have
speciated almost simultaneously (She et al. 1990).

Figure 2-14. Geographical distribution of four separate species and
subspecies of genus Mus. M. m. domesticus. M. m. musculus. M. spretus.
M. spicileaus. M. spretoides.

00
00

89
In the past, M. (Pvromvs) platvthrix and M. (Coelomvs)
pahari are considered as subgenera of Mus based on their
morphology. They are not more related to Mus than they are to
other well defined Murid genera. The large, spiny M.
platvthrix occur in India. The large, shrew-like Mus pahari
is present from Sikkim to Thailand. The phylogenetic
relationships deduced from DNA-DNA hybridization studies among
9 species and 5 subspecies within the genus Mus are presented
in Figure 2-15. The % DNA divergence detected between the
various species is shown on the left axis, the estimated time
interval since genetic separation of their gene pools
(speciation) is listed on the right. Similar phylogenetic
relationships are obtained when these species are compared by
other techniques, such as, protein polymorphisms, mitochondria
DNA sequence divergence (She et al. 1989). However, estimates
of the genetic distance among Mus species will vary depending
on the techniques employed (She et al. 1989) There are seven
levels of divergence among these species, ranging from 0.3 to
10 million years (Luckett & Hartenbege 1985).

Figure 2-15. Phylogentic relationships within the genus Mus and Rattus.
Adapted from She et al. (1990a).

i
$ § I
3
3 i
£ £
LL
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19 -
20 -
/
29 -
30 L
% DNA
Divergence
JJ
CO
o>
5
£
-9
o
8-
s
s-
V
O
O
?
8
O
IIOJBo
P'atythrix
6
VD
Million
Years

CHAPTER 3
MATERIAL AND METHOD
Wild Mice
The wild mouse strains used in this study are listed in
Table 3-1 and were kindly provided by Dr. Franciose Bonhomme.
Geographic origins of these mouse strains are also included.
The distribution patterns of these wild mice indicate that
they are representative of the global mouse population.
Source of Mouse Tissues and Preparations of DNA
Tissue samples, such as livers and kidneys, were used for
the isolation of genomic DNA. Tissue samples from different
mouse strains were minced and preserved in 75% ethyl alcohol,
according to the method described by Smith et al. (1987).
Genomic DNA was isolated from tissues by the proteins K/sodium
dodecyl sulfate (SDS) as detailed in Sambrook et al. (1988).
Minced tissues are washed with PBS once, transferred to a
liquid nitrogen-cooled mortar containing liquid nitrogen, and
ground into fine powder. The frozen powder was added to TES
buffer (lOmM Tris-HCl, PH 7.5; 5 mM ethylenediaminetetraacetic
92

93
Table 3-1. Geographic Origin and Distribution of Mouse Strains
STRAIN
SPECIES
GEOGRAPHIC
ORIGIN
MAI
Mus musculus musculus
Austria
MBB
Mus m. m.
Bulgaria
MBK
Mus m. m.
Bulgaria
MBS
Mus m. m.
Bulgaria
MBT
Mus m. m.
Bulgaria
MDL
Mus m. m.
Denmark
MDS
Mus m. m.
Denmark
MPW
Mus m. m.
Poland
MYL
Mus m. m.
Yugoslavia
MOL
Mus musculus molossinus
Japan
CAS
Mus musculus castaneus
Thailand
SEI
Mus spretus
Spain
SEG
Mus spretus
Spain
SPE
Mus spretus
Spain
SET
Mus spretus
Spain
SFM
Mus spretus
France
SMA
Mus spretus
Monaco
STF
Mus spretus
Tunisia
XBJ
Mus spretoides
Bulgaria
XBS
Mus spretoides
Bulgaria
ZBN
Mus spicilegus
Bulgaria
ZRU
Mus spicilegus
U.S.S.R.
ZYD
Mus spicilegus
Yugoslavia
ZYP
Mus spicilegus
Yugoslavia
KAR
Mus
caroli
Thailand
COK
Mus
cookii
Thailand
CRV
Mus
cervicolor
cervicolor
Thailand
CRP
Mus
cericolor
popaeus
Thailand
PAH
Mus
pahari
Thailand
PTX
Mus
platythrix
India

94
acid (EDTA), lOOmM NaCl) with 1% SDS and 0.4 mg/ml proteinase
K, which inactivates and digests the proteins, facilitating
the isolation of DNA. This solution was incubated at 65C
overnight. The digested DNA solution was extracted three
times with Tris equilibrated phenol (PH 7.5), twice with
chroloform/amyl alcohol (24:1) and precipitated with an equal
volume of isopropyl alcohol. The DNA was fished out by a
pasteur pipet and resuspended in TE (lOmM Tris (hydroxylmethyl)
aminomethane-HCl, PH 7.5, ImM EDTA). The resulting DNA
solution was quantitated by spectrophotometry and
electrophoreses on 0.7% agarose gels to confirm their high
molecular weight. Alternatively, genomic DNA was isolated
using an automated Nucleic Acid Extractor (Applied Biosystems
340A), following manufacture's instruction. Briefly, ground
fine tissue powders were suspended in 3 ml of lysis buffer
(Applied Biosystems), and 0.3 ml of Proteinase K (Applied
Biosystems) was added. The digested tissue was extracted with
phenol/chloroform (50/50, v/v) to remove the digested
proteins. The DNA was precipitated from the solution by
adding sodium acetate (to a final concentration 300 mM) and
2 volumes of ethanol (95%). Precipitated DNA was air-dried
and resupended in TE buffer.

95
Restriction Enzyme Digestion and Agarose Gel Electrophoresis
Restriction enzymes (Bgl II, BamH I, Eco RI, Hind III,
Pst I, Pvu II, SSt I) were obtained from Bethesda Research
Laboratories (BRL) Restriction enzyme digestions were carried
out for about 18 hr. in a volume of 90 or 180 ul (microliter)
containing 20 ug of DNA and 4 units of enzymes per ug
(microgram) of DNA, under the conditions specified by the
supplier (Bethesda Research Laboratories, Bethesda, Maryland) .
Completeness of digestions was monitored by using Lambda DNA
coincubated with aliquots of the DNA samples. Briefly, 0.5
ug of lambda DNA was added to one-tenth volume of reaction
mixture and at the end of incubation period was
electrophoresed on a agarose gel. Characteristic restriction
patterns of lambda DNA and a homogenous smear of genomic DNA
are indicative of complete digestion. In the case of double
digestion, the digestion was first performed with enzymes
requiring low concentration of salt. After the completeness
of first digestion, the digests were adjusted for the content
of salt, subsequently, the buffer necessary for the second
enzyme and enzyme were added. For convenience, the volume of
double digestion were reduced by alcohol precipitation before
loading into the gel. Briefly, one-tenth volume of 3 M sodium
acetate was added to the digest, subsequently, 2 vol. of 95%
alcohol were added, and stored at -70 C for 30 min. The
precipitate was recovered by spinning at 12,000 x g in

96
microfuge for 20 min. and washed with 70% cold ethyl alcohol.
Later, the precipitate was dried and resuspended in 80 ul of
TE. The digests were subjected to electrophoresis in 0.7%
agarose gels for 16 hours at 3 V/cm in a water-cooled
electrophoresis apparatus (International Biotechnologies
Incorporated, New Heaven, Conneticut).
Probes
A 5.8 kb Eco RI fragment containing Abd genomic probe was
kindly provided by Dr. Leroy Hood. A 369 bp Eco RI-Hind III
fragment and a 911 bp Hind III-Eco RI fragments of DNA were
generated from 5' and 3' regions, respectively, of Abd genomic
probe and subcloned into pUC19 (Figure 3-1).
Capillary Transfer and Hybridization
The restriction enzyme digested DNA was transferred from
gel to Zetabind membrane (Microfiltration Products Division,
Meriden, Conneticut) by Southern blotting (1975) according to
manufacturer's instruction. The agarose gel was denatured in
0.2N NaOH, 0.6M NaCl for 30 min at room temperature and then
neutralized by 0.5M Tris pH 7.5, 1.5M NaCl for 30 min at the
same temperature. After blotting, the membranes were washed
with 2 X SSC (1 X SSC = 0.15 M NaCl, 0.015 M NaC6H706) to
remove agarose residue and then washed in 0.1X SSC, 0.5% SDS

Figure 3-1. The genomic restriction map of Abd probe. The blank boxes
indicate the exons encoded by protein domains. The region of gene
spanned by the 5.8 kb Eco RI fragment is illustrated by the thick line
below the map. The 5' and 3' regions of the probe are also indicated
by thick lines below.

B10.D2
BS
H P
SPv H
\
1 Kb

99
for 1 hr at 65C shaking water bath to reduce the background.
Subsequently, the membranes are either dried in a 80 C vacuum
oven for 3 hours or at room temperature until further use.
A HindIII-cut Lambda DNA was included on every gel for use as
a molecular-weight standard. Prehybridization and
hybridization of the membranes are carried out as instructed
by manufacturer (AMF, Meriden, CT). The blots were hybridized
with 32P-labeled DNA probe with a specificity of approximately
2 x 108 dpm/ug by primer extension (Bethesda Research
Laboratory, Bethesda, MD) for overnight at 42C.
Nonspecifically bound probe was removed by two successive
washes in 0.1 x SSC/0.1 % SDS at 65 C shaking water bath. The
blots were then exposed to XAR-5 X-ray film (Kodar, Rochester,
NY) using Cronex Lightening-Plus intensifying screens (Dupont,
Wilmington, Delaware). Alternatively, the DNA was blotted to
GeneScreen membrane (Du Pont, NEN Product, Boston, MA). Using
this membrane, the gel was depurinated in 0.25N HC1 for lOmin
and then denatured in 0.2N NaOH, 0.6M NaCl before blotting.
After the DNA was transferred onto the membrane, the membrane
was dipped in 0.4N NaOH for 30-60 seconds to insure the
complete denaturation of DNA. Then, the membrane was
neutralized in 2X SSC adjusted with Tris buffer (PH 6.0) for
30-60 seconds. Subsequently, the DNA was UV cross-linked to
the membrane for 1.5 min. The pre-hybridization and
hybridization was carried out in solution containing 1%

100
crystalline grade bovine serum albumin/0.5 mM EDTA/0.5 M
NaHPO*, pH 7.2/7% SDS (Church & Gilbert 1984).
Genomic Restriction Mapping
To construct the restriction map, after autoradiography,
the blots were stripped of the genomic Abd probe by washing
in 0.1 x SSC and 0.1% SDS at 80 C for 20 min. and re
hybridized with labeled 5' and 3' regions of Abd probe,
respectively. The fragments obtained from each region of
hybridization were used to orient the restriction sites. All
unique alleles were characterized by double digestion to
confirm the results of restriction mapping by the above
method. In some cases, the fragment sizes were assigned to
either allele in Ab heterozygotes according to restriction
patterns of known alleles. To facilitate comparisons among
different alleles, a prototypical allele, B10.D (d haplotype,
lineage 1), C57BL/10 (b haplotype, lineage 2), B10.BR (k
haplotype, lineage 3), from each lineage was included on each
gel of restriction analysis.
Nucleotide Sequencing
A recombinant plasmid pI-Abk-gpt-l containing the entire
Abk gene plus flanking sequence was kindly supplied by Dr.
Ronald N. Germain. A 9.3 kb Hind III-Eco RI fragment from

101
this plasmid was subcloned in PUC 19 (PUC-K-9.3).
Subsequently, both the 1.9 kb Pvu II-Sst I and the 1.7 kb
Sst I fragments (derived from PUC-K-9.3) covering the 5' and
3' portions of intron 2 of Abk gene were subcloned in PUC19,
M13mpl8 and M13mpl9, respectively (Figure 3-2). As the 1.9
kb Pvu II-Sst I fragment cloned into M13 was frequently
deleted for various lengths due to the repetitive elements,
it was cloned into Pbluescript SK(+) and Pbluescript KS(+) as
well. The nucleotide sequences of both 1.9 kb PvuII-SstI and
1.7 kb SstI fragments were determined by Sanger's
dideoxynucleotide termination method in both orientations
using Sequenase (United States Biochemical Corporation,
Cleveland, Ohio) according to manufacture's instruction
without modification. Ambiguities were eliminated either by
substituting dGTP with 7-deaza-dGTP or by using Taq DNA
polymerase (United States Biochemical Corporation, Cleveland,
Ohio), which is performed at elevated temperature (labelling
reaction at 45C, termination reaction at 70C) to eliminate
gel compression.
Data Analysis
RFLP Patterns of Ab Alleles and Their Phylogenetic
Relationships
To investigate the evolutionary relationships of Ab genes
assembled from 12 different Mus species and subspecies, their

Figure 3-2. The partial restriction map of Abk and the sequencing
strategy. The arrows indicated the segment of DNA that were cloned into
PUC 18, M13, PbluescriptSK(+) and PbluescriptKS(+), respectively. The
arrowheads illustrated the size and orientation of nucleotide sequence.
The sequencing was performed by dideoxynucleotide termination method
using universal and synthesized oligomers.

1 Kb
B1
103

104
restriction maps were analyzed by parsimony analysis. A
total of 86 Ab alleles, which were obtained separately from
this dissertation, McConnell et al.(1986, 1988), and Ying Ye
are included in this analysis. Restriction site polymorphisms
were used to derive the best fit of the most parsimonious
network that contains the minimum numbers of character state
changes necessary to account for the phylogenetic relationship
among the genes.
Computer Programs
The computer programs used were all from the package
distributed by J. Felsenstein under the name PHYLIP 3.0.
These programs generate phylogenetic trees and many of them
use algorithm that are designed to identify the tree(s) that
incorporate minimal convergent change. However, the programs
used are to some extent dependent on the input order of the
character sets, and subsequently must be run repeatedly with
the set input in a different order. As evolutionary trees
were constructed by the parsimony method, only the most
parsimonious network requiring the minimum number of character
state changes were displayed. It is noted that the
phylogenetic trees constructed by this program is unrooted.
This analysis is based on 41 variable sites recognized by the
7 different restriction enzymes, of which 29 were
phylogenetically informative.

105
Polymerase Chain Reaction (PCR) Amplification
Enzymatic Amplification of Genomic DNA
Polymerase chain reactions (PCR) was performed with a
Geneamp kit (Cetus), using the recommended buffer formulas and
modified conditions. Samples were first heat-denatured at 94
C for 1.5 minutes, then cooled down to 0 C. Subsequently,
DNA were subjected to 35 cycles of PCR, each consisting of 1
minute of denaturation at 94 C, 2 minutes of annealing at
62 C, and 3 minutes of polymerization at 72 C with 3 units
of Taq polymerase. A typical PCR reaction consisting of 0.5-
1 ug target DNA resuspended in 100 ul reaction mixture
containing 10 ul of 10X buffer(lOx buffer= 500mM KC1, lOOmM
Tris-Cl, PH8.3, 15mM MgC12, 0.15 (w/v)), 10 ul of dNTPs mix
(2.0mM for each dNTP), 100 pm of each primer, 5 ul of dimethyl
sulfoxide (DMSO) and 3 units of Taq polymerase. Finally, the
reaction mixtures were overlaid with approximately 60 ul of
sterile mineral oil to prevent evaporation. After PCR
amplification One-tenth of reaction mixtures were
electrophoresed in TBE buffer and visualized on ethidium
bromide-stained 4 % Nusieve agarose gel. 5'and 3'
oligonucleotide primers (Figure 3-3) complementary to
conserved regions flanking the 174 bps small insert were used
to amplify 106 H-2 haplotypes in our collection. For
restriction enzyme analysis, the amplified products were

Figure 3-3. The sequences flanking the target site(GATTCTGATACA) for
the "Alu-like"(Bl) element. A. a lineage 1 (Abd) and a lineage 2 (Abb)
alleles, B. a lineage 3 (Abk) The shaded areas indicate the target site
for the Bl insert. The oligomers at the left (5' CCTTGAGGGCCACGGTTGTC
3') and right (5 GATACCCCCAGAGCCTCTCA 3') ends used for PCR
amplification is underlined. The direction of extension from the
oligomers are shown as indicated by dotted arrow. The restriction sites
used for restriction analysis is also underlined. The amplified
sequence lengths are estimated to be 192 bp for lineage 1, 2 and 375
bp for lineage 3.

A.
*
> 5.
d CCTTGAGGGCCACGGTTGTCTTGTGAGGACTGTTTGCTGCCTGGCGCTGACCCGAAGGCA
b CCTTGAGGGCCACGGTTGTCTTGTGAGGGCTGTTTGCTGCCTGGCGCTGACCCGAAGGCA
*
d TCACTGTCATTTTCCTCGTTCTCTGAGGGAGACTGTGTTGACTT-GGGCCACACT-AAAG
b TCACTGTCATTTCCCTCGTTCTCTGAGGGAGACTGTGTTGACTTGGGGCCACACTAAAAG
Hindi
* * 3 <
d TTTCTGATACAAAAGCTGAGGAACTCATTTCTGTTTCCAGCACACACTCCGTGATACCCC
b ATTCTGATACAAAATCTGAGGAACTCATTTCCGTTTCCAGCACACTCCCTGATACCCC
Hinfl
d CAGAGCCTCTCA
b CAGAGCCTCTCA
Amplified sequence length: 192 bp
107

B.
>5.
k CGTGTCCCTTGAGGGCCACGGTTGTCTTGTGAGGGCTGTTTGCTGCCTGGCGCTAACCCA
k AAGGCCTCACTGTAATTTTCCTCGTTCTCCGAGGTAGACTGTGTTTACTTGGGCCACACT
k AAAAGATTCTGATACAAGCTGGGCGTGGTGGCGCACGCCTTTAATCCCAGCACTCGGGAG
Hinfl
k GCAGAGGCAGGTGGATTTCTGAGTTCGAGGCCAGCCTGGTCTACAAAGTGAGTTCCAGGA
k CAGCCAGGGCTATACAGAGAAACCCTGTCTCAAAAGAACAAACAAAACAAAACAAAACAA
k aacaaaacaaaattctgatacaaaatctgaggaactcattttcgtttccagcacactccc
3 <
k CGATACCCCCAGAGCCTCTCA
Amplified sequence length: 375 bp
108

109
concentrated by ethanol precipitation. Precipitates were
resuspended in TE buffer and digested under appropriate
condition.
Amplification of Central Fragment for DNA Hybridization
To characterize the genetic nature of the central
fragment bounded by two members of the B1 family in the 539
bp insert in lineage 3 alleles, 5' and 3' oligonucleotide
primers flanking this region of DNA was designed and used to
amplify the plasmid PUC-K-1.9 encompassing this region of DNA
(Figure 3-4 & Figure 3-5). The amplified DNA products were
estimated to be 235 bp in length and subsequently, purified
from 6% polyacrylamide gel. The isolated 230 bp DNA fragments
were radiolabelled by primer extension and used to hybridize
the blots.

Figure 3-4. Location of two insertional events in a lineage 3 allele
(Abk) Exons are indicated by blank boxes, hatched boxes indicate the
861 bp retroposon in lineage 2 and the two inserted elements are
indicated by solid boxes.

"Alu-like" Repetitive
Element
Non-repetitive
Element
"Alu-like" Repetitive
Element
100 bp
111

Figure 3-5. The nucleotide sequence of 539 bp insert. Shaded
areas indicate the direct repeats bordering the insert. The
two B1 family repeats at the left and right ends of the insert
are underlined and the central fragment bound by two B1
elements is double underlined. The 5'(GCCCCTTTAACTTTTAATAT)
and 3'(TGCTCCCAGTCCCAAGGCTTT) oligomers used for PCR
amplification is shown by the dash line over the oligomer
sequences. The amplified product is 235 bp long.

113
TTTCGAGACAGGGTTTCTCTGTGTAGCTCTGGCTGTCCTGGAACTCACTTTGTAGACCAG
direct repeat
GCTGGCCTCGAACTCAGAAATCCGACTGCCTCTGCCTCCCAAGTGCTGGGATTAAAGGCA
"Alu-like" repeat(Bl)
>5/
TGAACCACCACGCCCGGCCCCTTTAACTTTTAATATCCTCTTTGTCTTAAGATGAGTCCA
Non-repetitive element
GGCTGGCCTCCGTTCTCCACAATGCCCCTGCCTCAGCCTCTCATGCTCTCCACAGCAAAG
CCTATATCCTTTTATGTGAAACATAGGTATATAGTTTAATGTGTTTATTACCTGCAATGG
3 '<
CTGGGAATGGAACCCAACCAAGGCTTCAAGGCCTCCTTCGGCCAATCTGCTCCCAGTCCC
AAGGCTTTTTTTTTTTTTTTTTTTTTTCAAGACAGGGTTTCTCTGTATAGCCCTGGCTAT
"Alu-like" repeat(Bl)
CCTGGAACTCACTTTGTAGACCATGCTGGCCTCCAACTCAGAAATCTGCCTGCCTCTGCC
TCCCGAGTGCTGGGATTAAAGCATGCGCCACCATGCCCGGCTACTTAAATTTTTTTGTTT
GTTTGTTTGTTTGTCTGTTTGTTTCGAGACAGGGTTTCTCTGT
direct repeat

CHAPTER 4
SEQUENCE ANALYSIS OF LINEAGE 3 ALLELES
Restriction Enzvme Analysis of Lineage 3 Alleles
Restriction-Site Polymorphism of Lineage 3 Alleles
In a previous study of Ab genes of genus Mus by RFLP
analysis (McConnell et al. 1988) using the seven six-cutter
enzymes: including Eco RI, Bam HI, Sac I (Sst I), Hind III,
Pst I, Bgl II, Pvu II, the Ab genes were grouped into three
distinct evolutionary lineages based on the extent of sequence
divergence. Lineage 3 consists of four Ab alleles, B10.BR (k
haplotype), BIO.PL (u) NZW (z) and B10.CHA2 (w26). The
genomic restriction mapping of these alleles was first carried
out using single restriction enzyme digestion, followed by
hybridization with 5' and 3' regions of Ab probe,
respectively. To confirm the restriction mapping, double
digest experiments was performed as exemplified in Figure
4-1 and Figure 4-2. In this study, three additional lineage
3 alleles, MDLII, DBVII, and DFCII, were revealed by RFLP
analysis using the same seven restriction enzymes. The RFLP
patterns and restriction maps of these seven lineage 3 alleles
are shown in Table 4-1 and Figure 4-3. In both BIO.PL and NZW,
there is one small insertion-deletion site (indicated by solid
114

Figure 4-1. Restriction mapping performed by double digest
experiment. The restriction analysis of closely related
alleles was compared side by side.

116
H-2
k
BS
II
81
P
B2
S^B SBE
i i n ii
B
1
S
|
u
U
S
B
s
S B S B E
B
s
u
1
1
i
ii i ir
i
1
1 *-
KKKKUKKKKKKKK U
SPSSSSES
PPBbBBSHHE EBgB9E

Figure 4-2. Restriction mapping carried out by double digest
experiment.

S.H S.E 118P.B S.B E.Bg
I 1 I 1 I 1 l 1 I 1
KUZKU ZUKZKU ZKUZ

119
Table 4-1
Strain
B10.BR
B10.CHA2
BIO.PL
MDL-2
NZW
DBV2
. RFLP Patterns of Lineage 3 Ab Alleles
Pst I Eco RI Bam HI Pvu II Sst I Bgl II Hind III
15
8.1
4.55
7.8
13
15
2.6
2.75
4.6
2.06
1.7
20
8.4
4.55
7.8
13
15
2.6
2.75
4.6
2.06
1.7
15
5.4
4.55
5.2
13
8.5
2.6
2.75
4.6
7.5
2.06
2.65
1.7
15
8.4
4.55
7.8
13
15
2.6
2.75
4.6
2.06
1.7
15
5.4
4.55
5.2
13
8.5
2.6
2.75
4.6
7.5
2.06
2.65
1.7
15
8.4
4.55
4.6
13
8.5
2.0
1.85
2.65
1.7
7.5
15
8.4
4.55
4.6
13
8.5
2.0
1.85
2.65
7.5
1.7
DFC 2
4.4

Figure 4-3. Restriction maps of seven lineage 3 Ab alleles.

mouse
strain H-2
B10.BR k
B10.CHA2 w26
NZW
MDLII
DBVII
DFCII
Pv
BS H
Bg
p
Pv
i
I
oil J
cm
R B Pv
S (g)PS
Pv
B
BS H b9
Pv
PS
E B
L 1
S b9
B Pv
Mi i llr ^
E B
Bg
B Pv
Bg
' L
S
'PS
B10.PL
u
s H
l I
P SPv
B Pv
E B
S
S H
B Pv
Bg
3 H site 2.8 Kb past
B
P SPv
PS
B Pv
H
E B
S ehjh
Pv
BS H b9
w L
S
*0PS
P Pv
CL.
3 H site 2.8 Kb past
B Pv
E B
S b9
Pv
B H b9 P SPv
B BPv
S (£PS
Ol
S BgH
Pv
B H Bg F S Pv
3 H site 2.8 Kb past!
d B Pv
s b(e>s /
S B9h
d
3 H site 2.8 Kb past
1 Kb
121

122
triangle in Figure 4-3), estimated to be about 100 bp in
length. Size changes smaller than this were undetected. A
few lineage-specific restriction sites, denoted by encircled
letters, were also revealed from restriction analysis (Figure
4-3) .
Distinct Intron Size Between Lineage 2 and 3 Alleles
A comparison of genomic structure of one prototypic
lineage 2 (b haplotype) and lineage 3 (k haplotype) alleles
is shown in Figure 4-4. Among other differences, the major
characteristic distinguishing lineage 2 and 3 alleles resides
in the intron separating A^ and A^2 exons. The size
difference between these two introns was estimated to be 0.75
kb by comparing PvuII fragments from Abb (3.79 kb) and Abk(4.6
kb) .
DNA Sequence of Lineage 3 Intron
To clearly define the nature of the lineage 3 allele
intron between A^ and A^ exons and the evolutionary
relationships among different lineage alleles, DNA sequence
analysis was performed. A recombinant plasmid PI-Abk-gpt-l
containing Abk gene was subcloned and relevant regions were
sequenced by Sanger's dideoxynucleotide termination method
(Sanger et al. 1980). A total of 3,735 bp of DNA sequence
spanning the intron between A^ and A2, through A2

Figure 4-4. Comparison of restriction maps of a representative lineage
2 and 3 alleles. Exons are indicated by empty boxes, filled boxes
illustrate the location of retroposon. This comparison indicates that
the intron size difference between these two lineages is about 0.8 kb.

Evolutionary
Lineage
Pv
2
C57BL/10
B S H
Bg
E P
Pv
bs H Bg
P
3
B10.BR
Pv
B
Pv
Pv
4.6 Kb
3.79 Kb
BS h
B S
1 Kb
124

125
k
exon and the transmembrane region of a lineage 3 (Ab ) allele
was determined. The sequencing strategy and the 3,735 bp of
nucleotide sequence determined was shown in Figure 3-2 and
Figure 4-5, respectively.
Lineage 3 Derived from Lineage 2
The evolutionary relationships among these 3 lineages
were assessed by comparing the published nucleotide sequences
of lineage 1 (Abd) and lineage 2 (Abb) obtained from GenBank
with the lineage 3 (Abk) sequence determined. Several notable
features about lineage 3 intron were revealed from this
sequence analysis (Figure 4-6 & Figure 4-7). There are two
additional inserted DNA sequences present in lineage 3 allele,
and absent in lineages 1 and 2. One of these two inserted
sequences is 174 bp long and its integration site starts 508
bp downstream of the A^ exon of Abk and ends at nucleotide
position 681. This small insert was flanked by 11 bp direct
repeats (ATTCTGATACA). The other inserted element is 539 bp
in length, and its integration site started at 1141 bp 31 of
A^., exon and ended at 1679 bp and was flanked by 22 bp direct
repeats (TTTCGAGACAGGGTTTCTCTGT). Of great interest was that
this large insert was interposed in the 861 bp retroposon,
distinguishing lineage 2 from lineage 1 alleles. Probably as
a result of this insertional event, there is a deletion of 130
bp in the 861 bps retroposon. The 618 bp of retroposon which

Figure 4-5. The 3735 bp of nucleotide sequence of Abk. The sequence
determined spans from the first base 3 of ¡31 exon across transmembrane
and ends at Sst I site.

TGAGCGCGGC GGTCCCGGGA GCGCGCGGGC
TGAGGAGCTG CATGGCCTCC TTCCTCCCGT
GTCTCCCTCC TGTCTCACCT CTGCCCTCTG
CTCTGCCCAT GAGGCCAGCT GCCCTCTGAC
TCAGCGCCAG GGAGGCTAAG CAGGGGAGAG
AGAAGCGGTT TAGCGCGGTA GCTCTGGCGT
CTGATTTCCT CGTGTCCCTT GAGGGCCACG
CGCTAACCCA AAGGCCTCAC TGTAATTTTC
GGGCCACACT AAAAGATTCT GATACAAGCT
GCACTCGGGA GGCAGAGGCA GGTGGATTTC
GAGTTCCAGG ACAGCCAGGG CTATACAGAG
AAACAAAACA AAACAAAACA AAATTCTGAT
AGCACACTCC CCGATACCCC CAGAGCCTCT
TAGGCATCAT ATTCAGATTT AATCTCCTAC
CTTAAGTTTT CCCTTCTTGC TTTCTGGGTG
CCTCACAGCA AGGGAACAGT GATGGCCACC
ACAACCAAAA ACCCAAAAAA CCAACCAAAA
ACAAGTTAAG TATGTATGCT GTTTTCTTCC
CCTTCCTTCC TTTCTTTCTT TTTTTTTTTC
TGTAGCTCTG GCTGTCCTGG AACTCACTTT
CCGACTGCCT CTGCCTCCCA AGTGCTGGGA
TTTAACTTTT AATATCCTCT TTGTCTTAAG
ATGCCCCTGC CTCAGCCTCT CATGCTCTCC
CATAGGTATA TAGTTTAATG TGTTTATTAC
GGCTTCAAGG CCTCCTTCGG CCAATCTGCT
TTTTTTCAAG ACAGGGTTTC TCTGTATAGC
CATGCTGGCC TCCAACTCAG AAATCTGCCT
CATGCGCCAC CATGCCCGGC TACTTAAATT
TTTCGAGACA GGGTTTCTCT GTATAGCCCT
TGGCCTCAAC TCAGAATCCA CCTGCCTCTG
CCATCACCAC CCGGCTAAAT TTTTTATTAG
TCCCAAAAGT CCCCTATACC CACCCACCCT
GCCCTGGCAT TCCCCTGTAC TGGGGCATAT
CAATGATGGC TTGACTGGTC ATCTTCTGCT
CGTGAGGGGA CGCGGAGCAG AGTTCCCGCG
CTGCCCTGCA CCACCTAGCG CCTCCTTGGA
CCCTCTGCCC TCTGCCCTCT GCCCTCTGCC
CCCTGGCTCT GCTGTGACCT CAGGCCCCTG
GGCGCCCGGG TGAGCGGCCA GGGTCGTGTC
CCTGTGGTTT CTCCCCGCCA TTCTGTTTTC
GTTGTCTTGT GAGGGCTGTT TGCTGCCTGG
CTCGTTCTCC GAGGTAGACT GTGTTTACTT
GGGCGTGGTG GGCGCACGCC TTTAATCCCA
TGAGTTCGAG GCCAGCCTGG TCTACAAAGT
AAACCCTGTC TCAAAAGAAC AAACAAAACA
ACAAAATCTG AGGAACTCAT TTTCGTTTCC
CACCCGTCGA TGCCAATTAA AACGGTCGGT
ATTAGGACTA ACGCTTAACT CCAAAGGTTG
GCCTTGTTAT TCAACTGTTC GCAACCGATT
AGGAATTAAT AGTCTTGACT GTGGAGGAAA
CAGTTGTAGA GAGTAGAAAA CAAACATTAA
TTCCTTCCTT CCTTCCTTCC TTCCTTCCTT
TTTTGGGTTT TTCGAGACAG GGTTTCTCTG
GTAGACCAGG CTGGCCTCGA ACTCAGAAAT
TTAAAGGCAT GAACCACCAC GCCCGGCCCC
ATGAGTCCAG GCTGGCCTCC GTTCTCCACA
ACAGCAAAGC CTATATCCTT TTATGTGAAA
CTGCAATGGC TGGGAATGGA ACCCAACCAA
CCCAGTCCCA AGGCTTTTTT TTTTTTTTTT
CCTGGCTATC CTGGAACTCA CTTTGTAGAC
GCCTCTGCCT CCCGAGTGCT GGGATTAAAG
TTTTTGTTTG TTTGTTTGTT TGTCTGTTTG
GGCTGTCCTG GAACTCACTC GGTAGACAGA
ACTCCCAAGA GCTAGGATTA AAGGTGTGCA
ATATTTTCTT CATTTACATT TCAAATGCTA
GCTCCCCTAC CCACCCACTC CCGCTTCTTG
AAAGTTTACA AGACCAAGGG CCTCTCTCCC
ACATATGCAA CTAGAGACAC GAGCTCCTGG
120
240
360
480
600
720
840
960
1080
1200
1320
1440
1560
1680
1800
1920
2040
127

Figure 4-5 continued
GGATATTGAT TAGTTTATAT TGTTGTTCCA
TGGGTACTTT CTCTAACTCC TCCATTGGGG
AGCATCCACT TCTGTATTTG CCAGGTATTG
GTCCTTTCAG CATAATTTTG CTGGCATATG
GGGATGGATC CCCGGGTGGG GCATGTATGC
GGCAAGAAGG CTTCTGAGGT AGTGGGCACA
GTCTGTGCAC AACAGTCTGA GGGATGAAGG
TCCCCCCCCC AAATTATTAA CTTGAAATCG
CTTTATAAAG ACAATTTATT TTTGTACTTA
AATTAAATAC ACAGCGGGTT TACAAAGAAG
TTGTGCTATA GGCCAGGCTG GCCTTGAACT
AGTGTACCAC CACCTCCTGG CTTCTTTTGT
GGCCACACTG TTATTTTCCC AGTGAGTTAA
CTGTTAGAAC CTAGGCATTC ATTCCCACCC
CTCACATTTC ACTCACTGTC TTTTCTGTCA
TGTCCAGGAC AGAGGCCCTC AACCACCACA
ACCCAGCCAA GATCAAAGTG CGCTGGTTCC
CGTCCACACA GCTTATTAGG AATGGGGACT
TGACCCCTCG GCGGGGAGAG GTCTACACCT
CCATCACCGT GGAGTGGCGT AAGGGAATTT
ATTTTAGGTG TTATTATCCC ATCCCTCCAA
ATCTGCTTCC TCTACTGAGC TGAGACCTAC
GGCATCAGGA GAGCCCTGAC CTATCTTCTC
CTGGGGCCCT GAAACTTGTC CCTAATATCC
CTTAGCTCTA TTCCCCAGGG GCACAGTCCG
TCGGTGGCTG CGTGCTTGGG GTGATCTTCC
GTCAGAAAGG TGAGGAGCTA TGGAGAACTG
AAATGAAGGT CCCAGGAGAG ACACTGGGAT
AGCCATGGTG GAGCTC 3735
CCTATAGAGT TGCAGACCCC TTCAGCTCCT
GCCCTGTGTT CCATCCTATA GATGACTGTG
CATAGCCTCA CAAGAGACAG TTATATCAGG
CAATAGTGTC TGCGTTTGGT GGCTGATTAT
TGTTTTCAAC TTGAAGGGAT AACAGCACTT
ATATATCAAA GTCAGTCGAG AAACACTTGT
AAGGATGTCG TACTGCAGTT ATTTTTGCAA
AAATCAGTTT TCTTTTGTCT TGTTTGTTTG
GTTTAAATAA AAATATTTTA TTTACACATA
GTTTGTGTCA AGTCCTGGCT GTCCTAGACC
CATAAGAGAT CCTCCTGGCT CTACCTCCTG
CTTACTACAT TTCACATTGT ATGGGAACAG
GTTTGTATTT GTGGAGTTAT TCTTCATTCA
TGCCTCTTCC CAGGGGAGTC TCCACATGGC
CCCTAGAACA GCCCAGTGTC GTCATCTCCC
ACACGCTGGT CTGCTCAGTG ACAGATTTCT
GGAATGGCCA GGAGGAGACG GTGGGGGTCT
GGACCTTCCA GGTCCTGGTC ATGCTGGAGA
GCCATGTGGA GCATCCCAGC CTGAAGAGTC
TATTTCACTG TGGGCCCCAC ATGACATGGG
TGTCACCCAC CCCATCATTT GTCCTATATG
AGGAAATCAT ATCTCTCACC TCATAGTCAG
AGACAGCAGT TCTGGAGATC ACTACATACA
AGAGGAATTG GCTGAAGTAG ATTGTAGACA
AGTCTGCCCG GAGCAAGATG TTGAGCGGCA
TCGGGCTTGG CCTTTTCATC CGTCACAGGA
GGGGTGGTGG GCTGTGCTGC AGGTGGGAGG
CTGATTTTGC TGGTTATGTG ACCGCCACAG
2160
2280
2400
2520
2640
2760
2880
3000
3120
3240
3360
3480
3600
3720
128

Figure 4-6. Partial nucleotide sequence of intron 2 from Abk. The number
refers to the number of base pairs 3' of A^1 exon. The two inserts are
underlined and shown in bold face, dr: the direct repeats(underlined);
IIA, IIB and III: evolutionary lineage 2A, 2B, and 3.

371 CGTGTCCCTT GAGGGCCACG GTTGTCTTGT GAGGGCTGTT TGCTGCCTGG CGCTAACCCA AAGGCCTCAC TGTAATTTTC CTCGTTCTCC GAGGTAGACT GTGTTTACTT GGGCCACACT 490
AAAAGATTCT GATACAAGCT GGGCGTGGTG GCGCACGCCT TTAATCCCAG CACTCGGGAG GCAGAGGCAG GTGGATTTCT GAGTTCGAGG CCAGCCTGGT CTACAAAGTG AGTTCCAG6A 610
(drIIB) 'Alu-like' repetitive element (Bl)
CAGCCAGGGC TATACAGAGA AACCCTGTCT CAAAAGAACA AACAAAACAA AACAAAACAA AACAAAACAA AATTCTGATA CAAAATCTGA GGAACTCATT TTCGTTTCCA GCACACTCCC 730
dr(lIB)
CGATACCCCC AGAGCCTCTC ACCCGTCGAT GCCAATTAAA ACGGTCGGTT AGGCATCATA TTCAGATTTA ATCTCCTACA TTAGGACTAA CGCTTAACTC CAAAGGTTGC TTAAGTTTTC 850
CCTTCTTGCT TTCTGGGTGG CCTTGTTATT CAACTGTTCG CAACCGATTC CTCACAGCAA GGGAACAGTG ATGGCCACCA GGAATTAATA GTCTTGACTG TGGAGGAAAA CAACCAAAAA 970
CCCAAAAAAC CAACCAAAAC AGTTGTAGAG AGTAGAAAAC AAACATTAAA CAAGTTAAGT ATGTATGCTG TTTTCTTCCT TCCTTCCTTC CTTCCTTCCT TCCTTCCTTC CTTCCTTCCT 1090
drillA)
TTCTTTCTTT TTTTTTTTCT TTTGGGTTTT TCGAGACAGG GTTTCTCTGT GTAGCTCTGG CTGTCCTGGA ACTCACTTTG TAGACCAGGC TGGCCTCGAA CTCAGAAATC CGACTGCCTC 1210
dr(III) mAhi-likem repetitive element (Bl)
TGCCTCCCAA GTGCTGGGAT TAAAGGCATG AACCACCACG CCCGGCCCCT TTAACTTTTA ATATCCTCTT TGTCTTAAGA TGAGTCCAGG CTGGCCTCCG TTCTCCACAA TGCCCCTGCC 1330
TCAGCCTCTC ATGCTCTCCA CAGCAAAGCC TATATCCTTT TATGTGAAAC ATAGGTATAT AGTTTAATGT GTTTATTACC TGCAATGGCT GGGAATGGAA CCCAACCAAG GCTTCAAGGC 1450
CTCCTTCGGC CAATCTGCTC CCAGTCCCAA GGCTTTTTTT TTTTTTTTTT TTTTTCAAGA CAGGGTTTCT CTGTATAGCC CTGGCTATCC TGGAACTCAC TTTGTAGACC ATGCTGGCCT 1570
*Aht-like" repetitive element(Bl)
CCAACTCAGA AATCTGCCTG CCTCTGCCTC CCGAGTGCTG GGATTAAAGC ATGCGCCACC ATGCCCGGCT ACTTAAATTT TTTTGTTTGT TTGTTTGTTT GTCTGTTTGT TTCGAGACAG 1690
¡¡Hill)
GGTTTCTCTG TATAGCCCTG GCTGTCCTGG AACTCACTCG GTAGACAGAT GGCCTCAACT CAGAATCCAC CTGCCTCTGA CTCCCAAGAG CTAGGATTAA AGGTGTGCAC CATCACCACC 1810
CGGCTAAATT TTTTATTAGA TATTTTCTTC ATTTACATTT CAAATGCTAT CCCAAAAGTC CCCTATACCC ACCCACCCTG CTCCCCTACC CACCCACTCC CGCTTCTTGG CCCTGGCATT 1930
CCCCTGTACT GGGGCATATA AAGTTTACAA GACCAAGGGC CTCTCTCCCC AATGATGGCT TGACTGGTCA TCTTCTGCTA CATATGCAAC TAGAGACACG AGCTCCTGGG GATATTGATT 2050
Sst I
AGTTTATATT GTTGTTCCAC CTATAGAGTT GCAGACCCCT TCAGCTCCTT GGGTACTTTC TCTAACTCCT CCATTGGGGG CCCTGTGTTC CATCCTATAG ATGACTGTGA GCATCCACTT 2170
CTGTATTTGC CAGGTATTGC ATAGCCTCAC AAGAGACAGT TATATCAGGG TCCTTTCAGC ATAATTTTGC TGGCATATGC AATAGTGTCT GCGTTTGGTG GCTGATTATG GGATGGATCC 2290
BamHI
CCGGGTGGGG CATGTATGCT GTTTTCAACT 2320
dr(llA)
130

Figure 4-7. Location of two inserts in a typical lineage 3 (Abk) A
comparison between a representative lineage 2 and 3 alleles to indicate
the position of two inserts in lineage 3. Exons are indicated by empty
boxes, double hatched boxes display the retroposon (861 bp) in lineage
2, the two inserts are illustrated by solid boxes.

B1
B2
B10.BR
11 bp repeat
"Alu-like" Repetitive
Element
11 bp repeat
100 bp
22 bp repeat
22 bp repeat
1 Kb
11 bp repeat =
TTTCGAGACAGGGTTTCTCTGT
I I
TTTCGAGACAGGGTTTCTCTGT
i i
1 1
ATTCTGATACA
"Alu-like" Repetitive
Non-repetitive
"Alu-like" Repetitive 100bp
Element
Element
Element
132

133
are retained in lineage 3 allele share 89% sequence identity
with the retroposon sequence of lineage 2 (Figure 4-8) ,
indicating that lineage 3 allele is derived from lineage 2.
The nature of retroposon insertion as shown by the generation
of a direct repeat bordering the inserted sequence
demonstrates again that the lineage 3 allele is generated from
lineage 2. The result of this sequence analysis including
the relative location of various retroposon insertions and the
percentage of nucleotide sequence homology from corresponding
region, is summarized and shown in Figure 4-9.
B1 family repeats in lineage 3 alleles
A comparison of the 174 bp inserted sequence with DNA
sequences from GenBank indicates that it is highly homologous
to the B1 family of Alu-like repeat of rodent (Krayev et al.
1980). It is characterized by an A-rich tract at its 3' end
and contains putative RNA polymerase III promotors as
indicated by box (Figure 4-6 and Figure 4-10). A consensus
RNA pol III promotor sequence compiled by Galli et al. (1981)
from functional tRNA and ribosomal RNA genes is shown on the
top of the box. There are also another two members of B1
family, identified by sequence analysis, at both the left and
the right ends of the large 539 bp insert. However, these two
B1 family repeats do not have terminal direct repeats.
Interestingly, the first 16 residues of left end B1 repeat
also form part of direct repeat flanking this large insert.

Figure 4-8. Sequence identity between the retroposn sequences in lineage
2 (Abb) and lineage 3 (Abk) alleles. The number in lineage 2 (Abb) refers
to the number of base pair from the first base pair of published
sequence available from the Genbank, the number in lineage 3 refers to
the number of base pairs 3' of A(J1 exon.

Ab
Abk
135
Limits: 5190-5789
Limits: 1702-2301
5190
ATAGCCCTGGCTGTCCTGGAACTCACTCGGTAGACCAGGCTGGCCTCGAACTCAGAAATC
i i i i i i l l l l l l l l l I l l I l I l l i i i l i i i l i i i M i i i i i i i i i i M i i i i i M
i i i i i i i l i l l l l l i l i i i i i i i i i i i i i i i i i i M i i i l i i i i i i i i i i i i i i i
ATAGCCCTGGCTGTCCTGGAACTCACTCGGTAGA CA GATGGCCTC AACTCAG AATC
1702
CACCTACCTCTGCCTCCCGAGTGCTGGGAGTAAAGGTGTGCACCACCACTGCCCGGCGAA
l l l l l l l i i i i
i l i l l l l l i l l
i i l l l
i i i i i
l l
i l
III l l l l l i l l l l l l l l l
III III l l l l i l l l ll l l i li
l l
l l l
l l l l l l ll
i i i l l l ll
CACCTGCCTCTGACTCCCAAGAGCTAGGATTAAAGGTGTGCACCATCACCACCCGGCTAA
ACATTTTAATAGATATTTTCTTCATTTACATTTCAAATGCTATCCCAAAAGTCCCCTATA
i i i i i i i i i i i l l l l i i l l l l l l l i i ll i l l i i i i i l i i i l i i i i i i i l l i l l l i i
l l l i i i i l i l i l l l l l l l l l l l l l l l I l l l l l l l i i i i i l i i i l l i i i i l l
i i i l l
ATTTTTTATTAGATATTTTCTTCATTTACATTTCAAATGCTATCCCAAAAGTCCCCTATA
CCCTCCTCCCCCGCACCGCCCTGCTCCCCCTACCCACCCACTCCCACTTTTTGGCCCTAG
mi i
CCCAC
ll l l l i i i i
l l l l l i l l l l l l l l l l l i l
l i i l l i l l l l I i l i l l l i l
l l l
i i i
ll l l l l l l
l I ll i l ll
i
CCACCCTGCT CCCCTACCCACCCACTCCCGCTTCTTGGCCCTGG
CGTTCCCCTGTACTGGGGCATATAAAGTTTACAAGACCAAGGGGCCTCTCTCCCCAATGA
l l l l l l I l l l l l l l l l l l l I I l l l I l l I I
l l l l l I I I I I l I I I I l l l I I I I l I l I I I I I
I l l l I I I
I I I I I I
II I l l l I l I I I l l i i l i l l
I I l l I I I l I I I l I I I I I l l
CATTCCCCTGTACTGGGGCATATAAAGTTTACAAGACCAA GGGCCTCTCTCCCCAATGA
TGGC TGACTAGGCCATCTTCTGCTACATATGCAGCTAGAGACACGAGCT CTGGGGGTA
i l l i i i i i i
i i i i l i l l i
l i
i i
l l l i i l i l i l l l l l l l l i l i
i l ll l l l l l i i i i i l i i i i i
l l i l l i i i i i i l l i l
l l ll l l l i l i l l l i l
i i l i l l
i l l l i i
i i
TGGCTTGACT GGTCATCTTCTGCTACATATGCAACTAGAGACACGAGCTCCTGGGGATA
CTCGTTAGTTCATATTGTTGTTCCACCTATATGGTTGTAGACCCCTTCAGCTCCTTGGGT
l l l l I l l l l l l l l i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i
l i i i l l i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i
TTGATTAGTTTATATTGTTGTTCCACCTATAGAGTTGCAGACCCCTTCAGCTCCTTGGGT
ACTTTCTCTAACTCCTCCATTGGGGGCCCTGTGTTCTATCCTATAGATGACTGTGAGCAT
l l l ll i l i l l i i i i l l l l l l I l i i l l l l i i l l i i i i i i i i i i i i i i i i ii i i i i i i i i i
i i i i i i l i i i i i l l i i i i l l l l l l I i l i i l l l l l l l i l l l i i i i i i i i i i i i i i i i i i i
ACTTTCTCTAACTCCTCCATTGGGGGCCCTGTGTTCCATCCTATAGATGACTGTGAGCAT
CCATTTCTGTATTTGCCAGGCACTGGCATAGCCTCA CAGGGTCC
ill l l l l l l l l l l l l i i i i i i i i i i i i i i i i i l l l l l i l l
Ml i i i i i i i i i i i i i i i i i i i i i i i i i i i i i l i l i l l l i
CCACTTCTGTATTTGCCAGGTA TTGCATAGCCTCACAAGAGACAGTTATATCAGGGTCC
TTTCAGCATAATTTTGCTGGCATATGCAATAGTGTCTGCGTTTGGTGGCTGATTATGGGA
!!!!i i i i i i i i i i ti ti i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i
I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I
TTTCAGCATAATTTTGCTGGCATATGCAATAGTGTCTGCGTTTGGTGGCTGATTATGGGA
TGGATCCCCGGGTGGGGC
I I I I I l I I l l l l i i l l l i
l I l I I I I I l l I I i l l I I I
TGGATCCCCGGGTGGGGC
Matches = 548 Mismatches = 34 Unmatched = 36
Length = 618 Matches/length = 88.7 percent

Figure 4-9 Sequence identity among among three Ab alleles. Schematic
diagram shows the sequence homology(%) among the respective region of
three prototypic lineage 1 (d), 2 (b) and 3 (k) allele.

Lineage h-2
h
Bg
%
3 k
90
92
%
1
89
83
H
^2 TM CY
CY+3UT
S B
89
S B
1 Kb
137

Figure 4-10. Sequence alignment among three B1 repeats. An alignment
of three B1 family repeats identified in two inserts of lineage 3 (k)
allele. Putative RNA polymerase III split promotors are boxed.
Asterisk (*) indicates the sequence mismatched, dash line() indicates
sequence identity. 1: B1 repeat contained within the 175 bp insert, 2,
3: B1 repeats at the left and right ends of the 539 bp repeat.

B1 consensus
1(B1 repeat)
2(left end)
3(right end)
B1 consensus
1(B1 repeat)
2(left end)
3(right end)
CCGGGC GTG(
-T
-TTT-
T-
ITGGCNNAGTGG
****
OTGGCGCACGCC rTTAATCCCAGCACTCGGGAGGCAGAGGCAGGCGGATT 59
-T-
-T-
TCTG
GGTTCGANNCC
*
AGTTCGAGGCC
\GCCTGGTCTACAGAGTGAGTTCCAGGACAGCCAGGGCTACACAG
G
A A T T
B1 consensus AGAAACCCTGTCT 132
1(B1 repeat)
2(left end)
3(right end)
139

140
Sequence data also indicates that the putative RNA polymerase
III split promoters can be recognized in these two members of
B1 family (Figure 4-10). It is worth noting that the
transcriptional direction of the latter two B1 family repeats
is opposite to that of Abk gene (Figure 4-7) .
An alignment of these three B1 family repeats identified
in these two inserted sequences with the B1 family consensus
sequence (Kalb et al. 1983; King et al. 1986) is shown in
Figure 4-10. The sequence homology ranges from 97% to 93%,
with the B1 member in the small insert having the highest
(97%) and B1 member of the right end of the large insert being
the lowest (93%). Most of the sequence divergence is due to
single base substitution. Mismatches between the putative RNA
PolII split promoter and consensus sequences are designated
by asterisks (Figure 4-10; Galli et al. 1981). The structure
and sequence of the 539 bp insert was analyzed in further
detail.
The 539 bp insert defines a new family of murine repeat
In order to understand the genetic nature of the central
fragment of this 539 bp inserted element, an extensive
computer search of DNA sequence library of GenBank was
undertaken. No homologous sequences have been found. To
determine the genomic distribution of the core portion of the
539 bp insert, a DNA fragment of 235 bp confined within the
middle portion of the insert was amplified by PCR and
hybridized to restriction enzyme digested genomic DNA. The

141
pair of oligomers (5' GAAATCCGACTGCCTCTGCC 3', 5'
TGCTCCCAGTTCCCAAGGCTTT 3') used to amplify and the resultant
length of amplified products as well as it nucleotide sequence
are shown in Figure 3-4. The results of the Southern analysis
are shown in Figure 4-11 and Figure 4-12. Surprisingly, the
hybridization of the isolated 235 bp fragment gave a distinct
band pattern in all of strains studied. As expected, the size
of one of the two bands in lineage 3 alleles, e.g. B10PL, NZW
was consistent with their genomic restriction maps. To locate
their positions in genomic structure, the same membrane
hybridized with a Abd probe was also included for clarity
(Figure 4-11). It is worth mentioning that the hybridized
bands are polymorphic among all three lineage alleles studied
(Figure 4-11) This result suggests that this 539 bps
inserted sequence belongs to a new family of repeated
sequences. Since the core portion did not display evidence
of integration, it is likely that the core portion and its
adjacent B1 family repeats transpose as a single unit, and the
22 bp host-derived repeats are generated as a consequence of
this insertion event.
Ab Genes Can Be Divided into 4 Lineages
Defining Evolutionary Lineage 2B
Although the DNA sequence analysis of lineage 3 allele
(Abk) clearly indicates that lineage 3 is derived from

Figure 4-11. Southern blot hybridization experiments with Abd and 235
non-repetitive element probe. Sst I-digested genomic DNA was hybridized
with indicated probes.

235 bps
(non-repetitive
element)
ro ro
co
4^ O) CD
v
4^ ~nI A.
>
TO CL
r,. ..., I
'
i

i
MAI
MBS

MDL
f
MYL
XBJ
jM
SET
r
ZYD
V
ZYP
ZRU
i
XBS
*
PANd

<
Z
.
K
4
#
PANb
PTX
CRV
m
S
CRP
1
* i
.
* *
MAI

1
r <
f C
U.
MBS

MDL
9*
MYL
1
(
XBJ

9 '9
SET
f
t-4
ZYD

ZYP
* ( |
9

ZRU
C
XBS
(
PANd

1C
Z

(
K
1
PANb
PTX

i
CRV
CRP
en

Figure 4-12. Southern blot hybridization experiments with 235 bp non-
repetitive elements. Double-digested DNA was hybridized with the non-
repetitive probe. S:Sst I, H: Hind III, E: Eco RI, P: Pst I, B: Bam HI,
Bg: Bgl II.

145
S.H S.E P.B S.B E.Bg
I 1 l 1 l 1 l 1 1 1
KUZKUZ UKZKUZKUZ
-4.5
Â¥
m "2.8
235 bp (non-reptitive element)

146
lineage 2 by two additional insertional events, it is
unlikelythat these events occurred in the same region
simultaneously. As one of the inserted sequenced (B1 repeat)
is only 174 bp in length, it is tempting to speculate that its
insertion is beyond detection on a 0.7 % agarose gel. To
examine this possibility, PCR technique is exploited to
amplify the genomic DNA using a pair of synthetic oligomers
(5 CCTTGAGGGCCACGGTTGTC 3 5 GATACCCCCAGAGCCTCTCA 3 )
(Figure 3-3). The rationale for this PCR experiment is as
follows: any allele that contains this 174 bp B1 family repeat
will be amplified as 375 bp fragment, while, alleles without
this insert will display a 192 bp fragment (Figure 3-3). A
total of 106 H-2 haplotypes were tested by PCR amplification.
A panel of DNA samples representing the different species and
subspecies of genus Mus amplified by PCR were run on a 4%
Nusieve agarose gel (Figure 4-13). The results of these
experiments can be summarized as follows: First, as expected,
all lineage 3 alleles, including B10.BR, AKR, B10.CHA2,
BIO.PL, NZW, MDLII, DFCII, DBVII amplify a band around 375 bp
on a 4% Nusieve agarose gel (Figure 4-14). Certain
recombinant inbred strains, e.g. B10.MBR, B10A(4R), B10.TL
exhibit a 375 bp band as well (Figure 4-14). The outcome of
these recombinant inbred strains is not unexpected as these
recombinants contain I-A subregion derived from lineage 3
alleles, specifically from k haplotype. All lineage 1 and 2
alleles, with the exception of one allele, MBBII, exhibit a

Figure 4-13. PCR amplification of DNA samples from 12 species
and subspecies of Mus. H: lambda Hind-digested lambda
markers, P: Pst I-digested lambda markers, Kb: kiolbase
markers, m. dom.: M. m. domesticus. m. mus.: M. m. musculus.
spretus: M. spretus. sptd: M. spretoid. spic: M. spicilegus,
caroli: M. caroli. cooki: M. cooki. cerv: M. cervicolor
cervicolor. cerp: M. cervicolor popeaus. pahari: M. pahari,
plat: M. platyhrix.

148
CD O O
O =r O O O ^
rr CD CD O O 3
w -7 t-u_
~ - < <-="
(/>
-O
3

3

CO
in
o
3
o.
-O
o'
TD
Q.
rf
C
(f)
c
c/>

o
3

m
rn
m
1 1
n
P PCCCK Z ZXX S SMMMBB NN j
TARROARBBBEEBBDZN00 *AA
XHPVKRUNSJG I S B LOC NDd K^P H ..
4% Nusieve agarose gel

Figure 4-14. PCR amplification of DNA samples from lineage 3
alleles and recombinant inbred strains.

150
_

151
amplified DNA fragment of approximate 192 bp. Unexpectedly,
MBB II is a lineage 2 allele identified by RFLP, and yet it
apparently contains the 174 bp insert (B1 repeat) in the
corresponding region as lineage 3 alleles does. In fact,
before the PCR experiments were ever completed, the Southern
blot analysis and the restriction mapping already indicated
the unusual SStI restriction fragment of MBBII (2.3 kb vs 2.1
kb) (Figure 4-15 & Table 5-1). To confirm that this lineage
2 allele (MBBII) contains this B1 family repeat, the PCR-
amplified product was isolated and subjected to restriction
enzyme analysis. The results of this restriction analysis are
shown in Figure 4-16. Four DNA samples, k haplotype (lineage
3) d haplotype (lineage 1) MBB, MBS, crucial to this
analysis were included in this experiment. MBB DNA sample was
heterozygous with respect to lineage 1 and lineage 2, and MBS
heterozygous for lineage 1 and 3 (Figure 4-15 & Table 5-1).
A conserved Hie II site ,found in lineage 1 and 2 but not in
lineage 3, would display two bands, 90 bp and 100 bp,
respectively, upon digestion (Figure 3-3). However, the
restriction analysis clearly point to the absence of HInc II
in MBBII allele. Moreover, the Hinf I site conserved in all
three lineages is also identified in MBB II allele as shown
by the production of two fragments, 12 0 bp and 255 bp, in
length upon digestion. Taken together, the findings of this
analysis demonstrate that although MBBII allele belongs to
lineage 2, it does contain the 174 bp insert in the

Figure 4-15. A typical RFLP analysis and restriction mapping.
Restriction digested DNAs were hybridized with whole Ab probes as well
as 5' and 3' regions of Ab probes.

MMMM MMM MMC MMMM MMM MMC MMMM MMM MMC
B B B B K D D P b Y O A d B B B B K D D P b Y O A d B B B B K D D P b Y O A d
BKST LSW LLS BKST LSW LLS BKST LSW LLS
probe
Whole A^d
probe
'i' a d
3 /3
probe
153

Figure 4-16. Restriction analysis of PCR-amplified products.
Letter designationa are as follows: d: lineage 1 (Abd) k:
lineage 3 (Abk) MBB and MBS are heterozygous: lineage 1, 2
and lineage 2, 3, respectively. H: Hind Ill-digested lambda
markers, P: Pst I-digested lambda markers, Kb Ladder: kilobase
markers.

155
Hinc
II
Hint
1
1

1

*
r
"1
r
1
3
2
cr
M
M
M
M
M
M
1
0)
B
B
H
B
B
B
B
Q.
Q.
S
B
S
B
K
S
B K
-j (0
d -i
A A
P H
4% Nusieve agarose gel

156
corresponding region of lineage 3 allele. As a consequence
of these finding, the MBB II allele is assigned to lineage 2B,
which consists of a MBBII allele only. And the original
lineage 2 is now designated as lineage 2A.
4 Evolutionary Lineages of Ab Genes
The evolutionary relationships of these four lineages of
Ab genes in the genus Mus is exhibited in Figure 4-17. In
summary, the major characteristic distinction among four
evolutionary lineages resides in intron 2 separating the A^1
and Kpz exons. Lineage 2A allele was derived from a lineage
1 allele by an 861 bp retroposon insertion. Subsequently,
another B1 family repeat insertion, composed of 174 bp,
occurred at intron 2 in a lineage 2A allele, thus generating
lineage 2B. Eventually, a newly arisen family repeat,
consisting of 539 bp, integrates into a lineage 2B allele,
thus producing lineage 3. It is noteworthy that these four
distinct lineages can be identified in wild mouse populations.
However, all lineages except lineage 2B were found to be
present in laboratory inbred strains. The unusual scarcity
of lineage 2B alleles is illustrated by the fact that MBB II
is the only 2B allele of 44 lineage 2 alleles in our
collection.

Figure 4-17. Summary of the evolutionary relationship among four lineage
Ab alleles. Diagram illustrates that the four evolutionary lineages of
Ab genes are generated by three independent successive insertional
events. Blank boxes indicate the exons, the double-hatched boxes
indicate the retroposon (861bp), and the small and large solid boxes
indicate the 175bp and 539 bp insert, respectively.

Lineage Alleles
B1
1
d,p,q,r,v
H EHPv S H
H E S B9
2A b,s,fj J LjLn
H
2B
MBB 2
B2
HE B S
t4-b
i
861 bp retroposon
insertion
BS
175 bp "Alu-like"(B 1)
Y insertion
SB H E Pv
f
539 bp retroposon
insertion/deletion
158

CHAPTER 5
EVOLUTION OF MHC CLASS II GENE POLYMORPHISMS
RFLP Analysis of Ab Genes Within Genus Mus
One of the goals of this dissertation is to find out the
distribution of Ab lineages among the various species and
subspecies in the genus Mus and to determine how long these
Ab lineages have persisted in the genus Mus. Mouse is an
excellent system in which to measure the time of divergence
as the phylogenetic relationships of various species and
subspecies have been studied extensively by various techniques
(She et al. 1990a). Previously, McConnell et al (1988) have
shown that Mhc class II Ab genes can be grouped into three
evolutionary lineages on the basis of retroposon
polymorphisms. However, the number of species and subspecies
of Mus included in their analysis was limited in scope. The
results of their analyses in terms of lineage distribution of
Ab genes in various species and subspecies are shown in Table
2-1 and Figure 2-8. In this dissertation, by Southern blot
hybridization, DNA sequence analysis and PCR amplification,
115 Ab genes have been analyzed and reorganized into four
distinct lineages. Furthermore, this analysis expands the
molecular genetic study of Ab genes to 12 separate species
159

160
and subspecies in the genus Mus. The mouse strains and their
geographic origins included in this study are listed in Table
3-1. The mouse genomic DNAs were digested with seven
restriction enzymes (Eco RI, Bam HI, Hind III, Bgl II, Pst I,
Pvu II, SSt I) and analyzed by Southern blot hybridization
with a genomic Abd probe. The orientation of restriction
fragments was determined by stripping and hybridizing with 5'
and 3' regions of Ab probe, respectively. A typical mapping
experiment is shown in Figure 4-15. In each case, the
restriction mapping of Ab alleles was further confirmed by
double digestion experiments. With regards to DNA samples
being heterozygous for Ab gene, the assignment of RFLP pattern
to individual allele was made possible by comparing
restriction fragments with other known alleles. The RFLP
patterns of individual Ab alleles and their corresponding
restriction maps are shown in Table 5-1 and Figure 5-1. Close
inspection of restriction maps of these Ab alleles indicate
that the majority of these restriction site polymorphisms are
due to insertion/deletion and point mutations, resulting in
the creation or loss of restriction sites. It is evident from
restriction analysis that there is no correlation between
restriction site allele and the distribution of species or
subspecies. A total of 86 Ab alleles is revealed from the
analysis of 115 H-2 haplotypes(Table 5-1 & Figure 5-1). Only
unigue Ab alleles are listed in Table 5-1. Even so, similar
or closely-related alleles were frequently found present in

161
Table 5-1. RFLP Patterns of Ab Alleles From 12 Species and
Subspecies of Genus Mus.
Strain
Pst I
EcoRI
BamHI
Pvu II
Sac I
Bgl II
Hind
MAI
4.80
>12.0
7.6
2.12*
2.0*
3.79*
2.750
5.20
3.5*
2.1
1.58
9.0*
3.620
8.0@
4.5*
MBB-1
3.89
>12.0
9.0*
2.6*
2.89*
2.75@
5.26
3.8*
2.65
12.2@
5.50
1.8
MBB-2
4.80
6.38
7.6@
2.12*
4.83*
2.75@
6.7@
4.6*
2.3
1.8
13.60
8.6@
7.2*
MBK
3.89
5.4
9.0*
2.6*
2.89*
2.750
7.8@
3.8*
12.20
6.2*
5.5@
1.7
MBS-1
(same
3.89
as MBK)
5.4
9.0*
2.6*
2.89*
2.75@
7.80
3.8*
12.20
6.2*
5.5@
1.7
MBS-2
4.80
6.38
7.6
2.12*
3.79*
2.75@
5.20
3.8*
2.1
1.58
12.2
3.62@
8.0@
6.6*
MBT
4.80
6.38
7.6
2.6*
2.06*
3.59*
2.65@
7.3@
4.5*
1.58
9.2
3.62@
8.0*0
MDL I
4.80
6.38
7.6
2.12*
2.0*
3.79*
2.75@
7.3@
3.5*
1.58
9.0
3.620
8.0
4.5*
MDL II
4.40
>12
8.4
2.6*
2.06*
4.6*
2.75@
7.8@
4.6*
1.7
13.0@
15.0*
MDS
4.80
6.38
7.6
2.6*
2.12*
4.83*
2.75@
7.3@
3.8*
10.0
3.62@
1.58
8.6*
8.0
MPW
4.80
6.38
7.6
2.6*
2.12*
4.83*
2.750
5.2@
3.8*
2.1
1.58
12.2
3.62@
8.0
6.4*

Table 5-1. continued
162
Strain
Pst I
Eco RI
Bam HI
Pvu II
Sst I
Bgl II
Hind
MYL
4.80
6.38
7.6
3.79*
8.3@
9.5
8.0
2.6*
3.69*
7.3@
9.0
7.8*
2.12*
2.750
4.5*
3.620
4.5*
2.0*
3.5*
1.58
MOL
4.80
6.38
7.6
4.83*
7.3@
10.0
8.0
2.6*
2.750
3.8*
3.62@
6.4*
2.12*
1.58
CAS
3.89
5.4
9.0
3.17*
5.6@
11.0@
9.0*
2.5*
2.890
3.7*
2.5
2.3*
1.7
SEI
4.80
6.38
9.7*@
3.79*
5.20
12.6*
8.0@
2.0*
2.75@
4.1*
7.6*
2.1
1.58
SEG I
4.8
6.38
7.6@
3.91*
5.2
12.2*
8.0@
2.2*
2.750
3.5*
3.62
4.5*
2.0*
2.1
1.58
SEG II
4.8
6.38
5.4@
3.79*
4.8
7.6*
7.6@
(same ,
as SPE)
2.6*
2.75@
3.8*
3.5
7.3*
2.06*
1.58
SPE
4.8
6.38
5.4@
3.79*
4.8
9.3*
7.6@
2.6*
2.75@
3.8*
3.5
7.3*
2.06*
1.58
SET I
4.8
6.38
7.6
3.79*
7.3@
12.2
6.3
2.12*
2.75
3.8*
3.62
5.4
2.0*
1.58
SET II
4.8
6.38
5.4
3.79*
5.20
13.0
4.5
4.3*
2.75
3.8*
3.5
2.6*
1.58
SFM I
3.89
(6.40)
9.0*§
2.89*
5.2@
12.2
5.5@
2.6*
2.75@
3.8*
1.7
2.65
SFM II
4.8
6.38
7.6@
3.79*
5.2@
7.0
8.0@
2.12*
2.75@
3.5*
3.62
4.5
2.0*
2.1
1.58

163
Table 5-1. continued
Strain
Pst I
ECO RI
Bam HI
Pvu II
Sst I
Bgl II
Hind
SMA I
4.8
6.38
9.7*
3.79*
7.3@
9.0*
8.0*
3.3*
2.75
4.1*
3.62
6.9*
1.58
5.5
3.7
SMA II
4.8
6.38
7.6
3.79*
5.2@
9.0*
2.2*
2.75
3.4*
3.62
2.06*
2.1
1.58
STF I
3.89
5.4
9.0*@
2.89*
5.2§
12.2*
6.2*
2.6*
2.75@
3.8*
5.5@
2.65
1.7
STF II
4.8
6.38
7.6@
3.79*
7.3
9.0*
8.0@
2.12*
2.75@
3.5*
3.62
4.5*
2.0*
1.58
XBJ
3.89
5.40
8.7*
2.89*
7.8@
12.2
6.2
>10.0
4.4
2.75
3.5*
9.0
5.5@
2.4*
2.0*
XBS
3.89
>10.0
9.0*
2.89*
7.8
9.0
6.2
2.0*
2.75
3.5*
5.5@
1.7
ZBN1
3.89
5.4
9.0*
2.89*
7.8@
9.30
6.2*
2.6*
2.75
4.5*
5.5@
1.7
ZRU I
4.8
6.38
7.6
3.79*
7.3@
9.0
8.0
3.1*
2.75@
2.9*
3.62
11
2.12*
1.58
ZRUII
4.8
6.38
7.6
3.79*
7.8
9.0
8.0
3.1*
2.12*
2.75@
4.2*
3.62
10.0
ZYD I
3.89
5.4
9.0
2.89*
7.8
9.2*
6.2*
2.6*
2.75@
4.5*
5.5@
1.7
ZYD II
4.8
6.38
7.6
3.79*
7.3
8.4*

o

CO
2.2*
2.75@
3.6*
3.62
2.0*
1.58

Table 5-1. continued
164
Strain
Pst I
Eco RI
Bam HI
Pvu II
Sst I
Bgl II
Hind III
ZYP I
3.89
5.4
9.0*@
2.89*
7.80
9.2*
6.2
3.1*
2.75@
3.5*
5.5@
1.7
ZYP II
4.8
6.38
7.6@
3.79*
7.3 @
9.0*
8.0@
2.2*
2.75@
2.9*
3.62
9.4
2.0*
1.58
KAR I
3.89
7.2
10.0*
2.89*
4.1*
11.7
6.2*
4.4
1.85
3.8
5.5
0.90
1.7
KAR II
4.8
7.2
7.6
4.2*
7.3@
11.7
8.0
2.3*
4.1*
1.58
4.5*
COK
3.89
6.4
5.4 §
2.89*
5.2@
12.2
6.6
3.6*
2.75@
3.8*
5.5@
2.6*
2.9
1.7
CRV
3.89
9.8
5.4
2.89*
5.2@
12.2
7.0
3.6*
2.75@
4.6*
5.6§
2.6*
2.65
1.7
CRP I
3.89
6.4
5.4@
2.89*
5.2@
12.2
6.6
3.6*
2.75
3.8*
9.0
5.50
2.5*
2.9
2.65
1.7
CRPII
3.89
>10.0
5.4@
2.89*
3.8*
(9.0)
6.6
3.6*
2.75
2.90
5.5@
2.5*
1.7
PAH
3.39
>10.0
9.0@
2.89@
5.20
8.8*
10.8
4.2*
2.75
3.8*
2.2
6.5
PTX
4.14
>10.0
5.4@
5.7*@
5.7@
12.2
6.7*
3.68
3.6*
3.65@
11.7
5.9*
2.5*
3.5*
2.65
1.7
§ indicates restriction fragments that hybridize to 5' region
of Abd probe.
* indicates restriction fragments that hybridize to 3' region
of Abd probe.
indicates restriction fragments that have double dosage.

Table 5-1. continued
165
Strain
B10.D2
B10.F
B10.Q
B10.RIII
B10.SM
B10.SAA48
B10.KEA5
B10.CAA2
B10.STC77
B10.BUA16
METKOVIC1
Pst 1
3.89
3.89
3.89
3.89
3.89
3.89
3.89
3.89
3.89
3.89
3.89
Eco R1 Bam HI Pvu II
5.4
9.0
2.89
2.6
1.85
0.9
5.4
5.4
2.89
3.6
2.6
2.75
5.4
5.4
2.89
3.6
2.6
2.75
5.4
9.0
2.89
2.6
2.75
18
9.0
2.89
2.6
2.75
chk
9.0
2.89
2.6
2.75
5.4
5.4
2.89
3.6
2.6
2.75
5.4
5.4
2.89
3.6
2.6
2.75
5.4
5.4
2.89
3.6
2.6
2.75
5.4
9.0
2.89
2.6
1.85
0.9
5.4
9.0
2.89
2.6
2.75
5.4
5.4
2.89
3.6
2.6
2.75
Sst 1 Bgl II Hind III
5.2
12.2
6.2
3.8
2.5
2.65
1.7
5.2
11.7
10
3.8
5.5
2.65
1.7
5.2
11.7
10
3.8
5.5
2.65
1.7
5.2
12.2
6.2
3.8
5.5
2.65
1.7
5.2
12.7
8.5
3.8
5.5
2.65
1.7
7.8
12.7
6.2
3.8
5.5
1.7
5.2
11.7
10
3.8
2.65
5.5
5.2
11.7
10
3.8
2.65
5.5
5.2
11.7
10
3.8
2.65
5.5
5.2
11.7
6.2
3.8
5.5
2.65
1.7*
5.2
12.2
6.2
3.8
5.5
2.65
1.7
5.2
11.7
8.5
3.8
5.5
2.65
1.7
METKOVIC2 3.89

Table 5-1. continued
166
Strain
Pst I
Eco RI
Bam HI
Pvu II
Sst I
Bgl II
Hind III
tw5
3.89
5.4
9.0
2.89
5.2
12.7
6.2
2.6
2.75
3.8
5.5
2.65
1.7
tw8
3.89
18
5.4
2.89
5.2
12.2
10
3.6
2.75
3.8
5.5
2.6
2.65
1.7
tw32
3.89
18
5.4
2.89
5.2
12.2
10
3.6
2.75
3.8
5.5
2.6
2.65
1.7
BELGRADE1
3.89
5.4
9.0
2.89
7.8
12.2
6.2
8.0
2.75
3.8
5.5
1.7
BRNO 2
3.89
5.4
n. d.
2.89
5.2
11.7
n.d.
2.75
3.8
2.65
VIBORG5
3.89
5.4
5.4
2.89
5.2
11.7
8.5
3.6
2.75
3.8
5.5
2.6
2.65
1.7
VIBORG8
3.89
5.4
5.4
2.89
5.2
11.7
8.5
3.6
2.75
3.8
5.5
2.6
2.65
1.7
B10.CAS2
3.89
5.4
9.0
2.89
5.2
11.7
6.2
2.6
2.75
3.8
5.5
2.65
1.7
THONBURI1
3.89
5.4
11
2.89
5.5
12.7
11
2.6
2.75
3.8
2.5
2.3
1.7
THONBURI2
3.89
5.4
11.0
2.89
5.2
11.7
11
2.6
2.75
3.8
2.5
2.3
1.7
PANCEVO-d
3.89
5.4
9.0
2.89
7.8
12.2
6.2
2.0
2.75
3.5
5.5
1.7
BIO
4.80
6.38
7.6
3.79
7.3
9.0
8.0
2.12
2.75
3.5
3.62
4.5
2.0
1.58

Table 5-1. continued
167
Strain
Pst I
Eco RI
Bam HI
Pvu II
Sst I
Bgl II
Hind
B10.M
4.80
6.38
7.6
4.83
7.3
10
8.0
2.12
2.75
3.8
3.62
6.6
2.0
1.58
B10.WB
4.80
6.38
7.6
4.83
7.3
11
8.0
2.12
2.75
3.8
3.62
6.6
2.0
1.58
B10.S
4.80
17
7.6
3.79
5.2
9.5
8.0
2.12
2.75
3.8
3.62
7.4
2.0
2.1
1.58
B10.STC90
4.80
6.38
9.7
3.79
7.3
9.0
8.0
2.0
2.75
3.8
3.62
4.5
1.58
W12A
4.80
6.38
9.7
3.79
5.2
12.6
8.0
2.0
2.75
3.8
7.4
2.1
1.58
STU
4.8
6.38
9.7
3.79
5.2
12.6
8.0
2.0
2.75
3.8
7.4
2.1
1.58
AZROU1
4.80
6.38
7.6
3.79
7.3
9.0
8.0
2.12
2.75
3.5
3.62
4.5
2.0
1.58
FAIYUM3
4.80
6.38
7.6
3.79
7.3
10.0
8.0
2.12
2.75
3.8
3.62
6.6
2.0
1.58
FAIYUM4
4.80
*6.38
9.7
3.79
5.2
12.6
8.0
2.0
2.75
3.8
7.0
2.1
1.58
FAIYUM5
4.80
*6.38
12.2
3.79
5.2
12.6
8.0
2.12
2.75
3.8
7.0
2.1
1.58
JERUSALEM3
4.80
chk
7.6
3.79
7.3
9.0
8.0
2.12
2.75
3.5
3.62
4.5
2.0
1.58

Table 5-1. continued
168
Strain
Pst I
Eco RI
Bain HI
Pvu II
Sst I
Bgl II
Hind
JERUSALEM4
4.80
6.38
7.6
4.83
7.3
11.0
8.0
2.12
2.75
3.8
3.62
6.6
2.0
1.58
METKOVIC3
4.80
12.0
7.6
3.79
5.2
9.5
8.0
2.12
2.75
3.8
3.62
7.4
2.0
2.1
1.58
tw12
4.80
6.38
9.7
4.83
7.3
13.6
8.0
2.0
2.75
3.8
1.58
7.0
TT6
4.80
6.38
9.7
4.83
7.3
13.6
8.0
2.0
2.75
3.8
1.58
6.6
BRN01
4.80
6.38
7.6
4.83
5.2
11.1
8.0
2.12
2.75
3.8
3.62
7.4
2.0
2.1
1.58
tw71
4.80
6.38
9.7
4.83
7.3
13.6
8.0
2.0
2.75
3.8
1.58
7.0
tw75
4.80
6.38
7.6
3.79
7.3
9.0
8.0
2.12
2.75
3.5
3.62
4.5
2.0
1.58
CADIZ1
4.80
6.38
9.7
3.79
5.2
9.5
8.0
2.38
2.75
3.8
2.1
1.58
3.62
7.3
PANCEVO-b
4.80
6.38
7.6
3.79
7.3
n. d.
8.0
2.92
2.75
2.8
1.58
n.d.idata is not available

Figure 5-1. Restriction maps of 86 Ab alleles derived from Table 5-1.

170
B10.D2
MBB I
MBK
CAS
SFM I
STF I
XBJ I
XBJ II
XBS
ZBN I
ZBN II
ZYD I
ZYP I
BS Bg P\
II ""l I I
p
Pv S PvH S
3 u
I-
>V
E B S H Bg
1 II II
BS H Bg Pv
III "1 1
S PvH S
1 1 1
3 u
r-
>v
E B S Bg
1 II 1
BS H Bg P\
III "111
P *
P
PvH S
1 1 1
S u
B
1
5v
E B S H Bg
1 II II
BS b9 P>
II "III
P
Pv
SPvH S
II 1 1
5 h
yr
B
I
5v
E B S Bg H
1 III 1
BS H B^Pv
III II
P A
P
S PvH S
III 1
3 u
1/f
B
1
>v
B S Bg
1 1 1
BS H Bg PvE
III "ill
P
PN
S PvH s
1 1 1
3 u
ii
*v
E B S H Bg
1 II II
BS H P't
J 1 II
3 P!
/Pv Si
1 1 1
rH-
B
1
>v
E B S H
III 1
BS H Pv
ll 1 1
p
PV PvH S
5 H
I-
>v
BS H
1 1 1
Bs H Bg Pv
III II
0
p
PVH S ;
1 1
SH
A
B
>v B
E s H Bg
r i ii
BS H P\
III II
Px
PvH
1 1
rHf
B
>v
E B S H
1 III
B Pv
1 1
3
Px
Pv S
k
F
B
1
>v
B S
1 1
BS H P\
III II
3 5
p
PvH S .j
A
B
1
>v
E B S H
1 III
BS H PME
U 1 LL
P" S1
> h
L*
>v
E SB H 1 Kb
J U I

Figure 5-1. continued
171
H
BgPv
Pv
P\H
Ps^Pv
H Bg
Bg
BS H E Pv
COK | [ | I I
r r
BSP>H Sx
II 1 1
B
|
v
E B S HBg
1 II II
B<
BS H E
CRV MI 1
3
Pv
Ll
r p.
BSPvH S
II II
> U
fl

v
BES H Bg
1 1 'll
CRPI
BS H B9Pv
B S
B
HBg
S H
BS H
PAH MI
Pv
1
S
Sbv
III
<
si
Pv
f
B S
PTXI 1 1
Pv
1
BS
II
H
1
s
s
B
1
>v
BS
II
SxB
PTX II 1
Pv
J
BS
II-
H
I

5h
B
I
>v
BS 1 kb
u
I
BS H Bg P\E
B10.F III 111
B S PvH SP1
Mil I
>v
E B S Bg |
J LL
P o'
5h_
BS H Ba P\E
B10.RUI II 111
S PvH SR
I I I
:
5v
E B S H Bg
1 II II
BS H Bg P\E
B10.SMU I III
p-
S PvH SJ
M
L
V
BS Bg H
1 1 II
BS H Bg P\E
B10.SAA481 I 111
p Su 3E site 5.0 Kb past H
Rl/Pv
SPvH SJ re B S H Bg
i i i Lu i j ii
BS Bg P\E
B10.BUAI I III
s p!
/Pv S PvH S J
l I II I
B
1
v
E B S H Bg
1 II II
H
BS Bg P\E
MET-2 U 1 I I
* P1
/PvSPvH SJ
1 L LL J
> (i
A
E
i
v
E B S H Bg
i...- .. IJ LL

Figure 5-1. continued
172
BS
Bg PvEX
B10.D2
TW5
TW8
BEL1
Pv
S PvH S
Su
P H
Pv
BiE
B S
H Bg
I
BS H Bg Pve
III "J I I
p;
S PvH SI
III 1
5H
k F
B
1
>v
E B S H Bg
1 II II
I
BS H Bg Pve
LJ I LLL
p-
BS PvH SI
II 1 1 1
> H
k F
B
L
>v
B S Bg
LJ 1
Ps
L/Vv
BS H
Bg Pve
PvH Si
B
E
S H Bg B
U ..1.
"J 1 1
II 1
l
i
1 1 1 1
BS H Bg PvE
B10.CAS2 I 1 I I
S PvH S
I I l
Su
p H,
i
Pv
BE
B S
HBg
TlL
v1
B S Bg Pve
THON 1_vJ I I I
3
R
SPvH S
III 1
VH
B
1
v
E BS Bg H
1 1' 1 1 1
2.5 Kb I
BS H Bg P\
PANCE D | | 111
p-
PvH
5 h
k F
B
1
*v
E B S H Bg
J 1 1 LJ
BS Bg Pve
BIK/g || ^ M
3
xPv S PvH S i
lili I
3 U
k f
B
I
>v
E S H Bg b
I I III
BS H Bg Pv
38CH III ll
P
R,
S PvH Si
III I
3 h
B
v
E H SB^
ii ir i
v
SB Bg P\E
dmaLU 1 1 1
3
/Pv s PvH S J
lili I
k f
B
l
>v
E B S H Bg
I II II
1 .i Kb
BS H Bg P\E
BEP-1 U I I I I
P
P
SSPvH SJ
LLi L i
>u
k F
B
L
>v
E s B Bg
J LJ I
BS H Bg P\E
DSD-1 II l "111
BS PvH S
PSH,
i
1/ Pv
BE
B S
Li L
HBg
ir
H
1 Kb

Figure 5-1. continued
173
BS H Bcpv
C57BL/10I II II
E
P PvBg S
oLl^
B P
ni
ShPv
/ BE B S H Bg
i lilt] III 1
BS H B MAI JJ I M I | M L
B P
M
J
SHPv
' E B S H Bg
Jm i i L
SB H B MBBII | I | ||
E
P S Pv S
I I lg I
B P
N
Sh
' BE
1 1
9V
s g
i 11
w
1 Kb
BS H Bcpv
MBS II MI ||
E
p s P>Bgs
i lili
B P
S
Sh f
>v
S H B
1
BS H Bcpv
MBT i,, ||
E
P PvBg S
I III
3 P^
s
9V
E B S Bg
I 1 1 L
BS H Bcpv
MDS MI ||
E
' P PvBg S
I III
B P
M
sh f
'be
i i
>v
B S Bg H
II II
BS H Bcpv
MPW U I I I
E
p s P'Bgs
i lili
B P
M
sh f
' BE
1 1
Jv
B S H B
LJ 1
BS H Bcpvi
MYLI | | | ||
E
P PvBg s
I III
B P
M
HPv
E B S H Bg
JL i i i i
Bcpv
MYLII | | |
E
P PvBg S
I III
B P
M
SHI
'b
1
9v
E B s b9h
1 II II
BS H Bcpv
mol 111 II
E
P PvBg S
I I I I
p
L5
fH P
fe
V
B S H Bg
L 1 1 1
BS H Pv
SEI III I
E P?HF
P S Pv S si B
i i!? MI i
*v
E B S Bg H
III II
B H BcPy
SEGI JJ I!
E
P S PvBg S
I I II I
3 P
s
?
>v
E B S H Bg
1 III 1
B
H BS
SEGII I III
9
Py
L
E
P PvBg S
I I I I
3 P
Shf
h
>v
E B S Bg H
1 III 1
B
H BS
SPE I LL
9
E B P '
" P PvBg Si Si
J M il I
shf
'b
>v
E B S BgH
1 II II

Figure 5-1. continued
174
SET I
SETII
SFM II
SMA I
SMA II
ZRU I
ZRU II
ZYD II
ZYP II
B
E
BgPv p
PvBg s
Li
B P
sHPv
S'llf BE
J l
B S H
Bg
B
E
BgPv p
INI
sHPv
B PvBg S
In i
B E
B S H
Bg
BS H
E
BgPv p
I I 1 I
S PvBg S
B P
J
sHPv
B E
B S H
Bg
sHPv
BS BgPv
II II
P PvBg S S
1 Li J^
B
1
E BS H Bg
1 'll II
BS BgPv
II II
E
p S PvBg S
1 1 1 1 1
B P
s'!
"1
HF
'a
I
v
E B S Bg H
III II
BS H BgPv
JJ I LL
E
P PvBg S
J U L
B P
s']
shf
B
l
v
E S B Bg
J U L
SB H BgPv
II 1 II
E
p PvBg S
1 III
B P
L5
*Hf
7b
L
Jv
E B S B9
J 1 1 1
BS H BgPv
U 1 LL
E
P PvBg S
1 III
B P
L
*HPv
e(E B S Bg
i i i
BS H BgPv
JJ 1 LL
E
p PvBg S
1 1 1
B P
s
7 B
I
v
^ b9
E BS
1 II 1
E
BS H Bg p py s
JJ 1 J 1 1 1
B P
--
HF
" B
J
E S H Bg
J u 1
H
KAR II

Figure 5-1. continued
175
BS
C57BL/1
B10.M
C3H.JK
B10.S
0
B10.STC90L
W12A
FAI-3
FAI-4
MET-3
tw 12
TT6
CADIZ-1
PANCE B
SHPv
_ j B E
-Mm dIi'e
E B P
H BgPv p PvBg S| sJlL BE B S H Bg
B g H BgPvE p PvBg S
B P
SH
B E Pv B S
BS H BgPvE p PvBg s
B P
SH
B E Pv B S
BS H BgPv p s PvBg S s
J INI 1
sHPv
BE B S
BS H BgPv p PvBg S
B P
SHPv
J
BE s B
H Bg
H Bg
BS H BgPvE p s PvBg S
JJ 1 Mil 1 Ll L
3 P
N
i?
>v
B S BgH E
II I I vv I
p
BS H BgPvE p PvBg S SN
III lili III 1
> HF
/ B
1
>v 4.1
E B S H Bg
I III I
P
BS H BgP\E P s Pv S s']
U 1 LLU U 1 U
5 HF
h
>v
E B S Bg H
III II
0 3 H BgPvE P PvBg S
JJ 1 LLU U L
3 P
i?
>v
E B S H Bg
p 5
0 3 H BgPvE p s Pv S S^l
JJ 1 LLU LL J 1
HF
B
>v
E B S Bg H
III II
BS H BgPv
III II
E
p s PvBg s
U lili
B P
si
1
Shi
E
=v
B S BgH
II I I vv I
BS H BgPv
JJ 1 LL
E P
P Pv S SN
1 1 1 1
SH 4.1 Kb
BE pv B S HBg
II I I I II
BS H BgPv
JJ 1 1 1
E P
P Pv S SN
U 1 1 'I
fH
f B E pv B S H Bg
II I I I II
BS H BgPv
JJ 1 LL
E
P s PvBg S
U 1 1 1
B P
si
i
5H
B E pv B S H Bg
_LL I I I II
BgH
Bg

Figure 5-1. continued
176
BS H BgPv
C57BL/1I I I I
E
P PvBg S
li ni i**>
B P
ni
Shf
?
>v
E B S H Bg
| III 1
BS H BgPv
BFM III II
MI
E
P Pv S
I I I
UT
P
SI
SHF
B
1
>v
E B S HBg
III if
BS H BgPv
BNC III II
E
p PvBg s
I III
B P
s
shf
r?
sv
E B S Bg
1 III
BS H BgPv
DBP III II
E
P PvBg S
I III
B P
s
SHPv
S Bb9
111 1 II
BS H BgPv
DGD III II
E
p Pv S
I I I
B P
s
H
B E Pv b S HBg
u l i i Si
BS H BgPv
dot III II
E
P PvBg S
I III
B P
s
shf
h
sv:
E S Bg
1 1
BS H BgPv
BIB-2 III II
E
P Pv S
I I I
B P
s
SH
f BE Pv s HBg
i i i i Si
BS H BgPv
BEP-2 III II
E
p s PvBg s
J lili
B P
s
S F
B
M
>v
Bgs H
'll 1
BS H BgPv
DJO-2 III II
E
P s PvBg S
J lili
3 P
sH
'BE Pv S H
III 1 1
BS H BgPv
DSD-2 III II
=
P Pv S
J I L
3 P
SH
f B E Pv s Bg
III 1 1

177
different species and subspecies. For example, lineage 2A
alleles, C57BL/10 and SEG1, restriction maps of which resemble
to each other, are found in M. m. domesticus and M. spretus,
respectively. Likewise, MET2 and CRP1, both of which are
lineage 1 alleles, are identified to in M. m. domesticus and
M. cervicolor. indicating that Mhc genes evolve in a trans
species fashion.
Lineage Distribution of Ab Alleles Within the Genus Mus
As the Ab genes derived from different species and
subspecies of genus Mus were classified into evolutionary
lineages (i.e. 1, 2A, 2B and 3), the distribution patterns of
those different lineages of Ab genes in Mus were determined.
Figure 5-2 presents a phylogenetic tree which was built on the
basis of evolutionary relationships of these separate lineages
of Ab genes in various species and subspecies of Mus Several
additional features of trans-species evolution of these Ab
lineages are revealed from this analysis. This study has
expanded the analysis of M. spretus. M. spretoides. M.
spicilegus to include a total of 20 H-2 haplotypes. Ab
alleles from lineages 1 and 2A were found in all three of
these aboriginal mouse species. Ab alleles from both lineages
are present in M. caroli. indicating that alleles in these two
lineages diverged at least 2.5 million year ago. The
emergence of lineage 2B and 3 must be very recent events as

Figure 5-2. Diagram illustrating the evolutionary origins of the 4
lineages of Ab alleles assayed. The Mus species analyzed are given at
the bottom of each line. The number of alleles assayed is given below
each species name. The solid line represents the evolutionary lineage
1 allele, dotted line, lineage 2A, hatched line, lineage 2B and
crosshatched line, lineage 3. m. dom: Mus m. musculus. m. mus: Mus m.
musculus. m. molo: Mus m. molossinus. m.cas: Mus m. castaneus. sptd: Mus
spretoid. spic: Mus spicilequs. spretus: Mus spretus. cerv: Mus
cervicolor. cooki: Mus cooki. caroli: Mus caroli. plat: Mus platvthrix.
pahari: Mus pahari.

Ancestral Mus
Lineage 1
Insertion in A@
produces Lineage 2A
Insertion in Lineage 2A
produces Lineage 2B
Insertion in Lineage 2B
produces Lineage 3
Modern
Mus m.dom m.mus m.molo m.cas
sptd
spic
spretus cerv
cooki caroli
plat pahari
H-2 Tested 67 18
4 6 4 12
2 1
2
179

180
both are found only in subspecies of M. musculus complex,which
are estimated to diverge at least 0.4 million years ago. It
is worth noting that although lineage 3 alleles are found in
both M. m. musculus and M. m. domesticus. lineage 2B allele
is only found in M. m. musculus. However, as shown before,
lineage 3 alleles are derived from lineage 2B allele. The
failure to identify lineage 2B allele in M. m. domesticus may
indicate that it has been lost from the natural populations,
or may be due to the low number of sampled alleles in our
collection.
On the basis of distribution pattern of individual
lineage of Ab gene, it was concluded that the lineage 1, 2A,
2B and 3 alleles had persisted through at least five, three,
and one speciation events, respectively, during the course of
Ab gene evolution.
Phylogenetic Relationships of 86 Ab Genes in the Genus Mus
Restriction mapping and DNA sequencing enabled us to
determine not only the quantity of DNA sequence variation but
also the nature of this variation. Phylogenetic analysis,
based on the restriction map and sequence data, can provide
a huge amount of information concerning the origins of
different sequence types.
To investigate the phylogenetic relationships among Ab
genes of genus Mus, we analyzed the restriction map data by

181
the parsimony method. A 16-kilobase region around the Ab gene
in each allele was examined with seven restriction
endonucleases (Bam HI, Eco RI, Hind III, Pvu II, Pst I, Bgl
II, Sst I ). As expected, the gain and loss of restriction
sites accounts for most of the polymorphism observed (Nei
1987) In addition, several major insertions, which have been
used to delineate the evolutionary lineages, were also
detected. A total of 86 alleles was identified from 115 H-2
haplotypes on the basis of restriction site polymorphisms and
3 different sizes of retroposon insertions. Using restriction
site polymorphism as a character state, it became possible to
reconstruct the phylogenetic relationships from restriction
map data.
The phylogenetic trees can be constructed in many
different ways, often with slightly different results.
(Felsenstein 1982) The method used in this analysis is named
"mixed parsimony", supplied by Felsenstein's PHYLIP package.
This algorithm does not produce a rooted tree.
Among 41 polymorphic restriction sites recognized by 7
restriction enzymes, 29 were informative for phylogeny
analysis(that is, polymorphic restriction sites were present
in at least two alleles each.). A typical restriction site
allele exemplified by B10.D2 is shown in Figure 5-3. The
full restriction site character set of 86 Ab alleles is shown
in Table 5-2. Each allele is composed of restriction map
variants shown in 5' to 3' with respect to order of each

Figure 5-3. Example of a restriction site allele used for parsimony
analysis. The "+" and indicate the presence and absence of
restriction site, respectively.

Restriction Site Allele (A^)
CD'COt-OCOt-
h ID CO CM CM CM CO
L m m
XXXXIII^^cvi
EEEEEEEI
CO
in
in
h-
in
CM
T-
3
CM
CO
in
CO
CO
1
CM
CM
1
T

t
in
CM
CD
T-
CM
CM
i
CM
CM
2
CO
CM
CO
in
1
1
i
1
1
1
1
CJ
u
u
U
o
o
to
to
M
c/>
to
to
*M
c/>
to
-M
C/>
c
c
c
c
c
c
D)
O)
CO
CO
CO
CO
CO
CO
CO
CO
X
X
X
X
X
X
CD
CD
m
N-
o>
o
i
"5
£
't
2 9 CV1
CC CC v
0 0^3
0 0(0
LU LU D_
Example:
B10.D2 1 000010101001000100111010011110
1: presence, 0: absence of restriction site
B10.D2

in
O)
Q)
r-
iH
<
-Ql
<1
CO
of
o
o
o
o
-p
a)
a>
rH
CM
co
cq
CM
o
o
o
o
o
o
o
o
o
o
o
o
o
O
O
o
O
o
o
o
o
o
O
O
o
o
o
o
o
o
o
o
o
o
rH
rH
rH
rH
o
o
O
o
o
o
o
o
O
o
rH
rH
rH
o
o
rH
rH
rH
o
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
n*
rH
rH
n-
n>
rH
n-
rH
o
rH
n-
rH
rH
rH
rH
rH
n*
rH
rH
rH
O
rH
rH
rH
rH
o
p
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
o
rH
rH
rH
o
rH
rH
n*
o
rH
n*
o
rH
n-
o
o
o
n
rH
rH
o
o
o
n-
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
o
o
o
o
rH
o
o
o
o
o
o
o
rH
o
rH
o
o
o
o
o
o
o
rH
rH
o
o
rH
o
o
o
o
o
o
o
o
o
rH
o
o
o
o
o
o
o
o
o
o
-p
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
o
o
rH
rH
rH
rH
rH
rH
o
o
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
H
rH
rH
rH
rH
rH
rH
rH
o
rH
H
rH
rH
rH
rH
rH
rH
rH
rH
(0
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
p
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
rH
rH
rH
rH
rH
o
rH
o
o
m
o
rH
o
rH
o
rH
rH
o
rH
o
rH
rH
o
rH
rH
o
rH
o
rH
o
rH
o
o
rH
rH
rH
rH
rH
rH
o
o
o
o
rH
rH
o
o
o
o
n*
o
o
o
n-
o
o
o
o
o
x¡
CM
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
rH
o
o
o
rH
o
o
o
o
o
u
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
H
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
o
rH
o
rH
rH
rH
rH
rH
rH
rH
rH
rH
H
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
H
rH
rH
rH
rH
rH
rH
rH
o
o
o
o
o
o
o
o
o
o
o
o
o
o
0)
rH
o
o
o
o
o
o
o
o
o
o
rH
o
rH
o
rH
o
o
o
o
rH
o
o
o
o
o
o
rH
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
p
o
o
o
o
o
o
o
o
o
o
o
rH
o
o
o
o
rH
o
o
o
rH
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
H
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
n*
rH
o
rH
n*
rH
rH
rH
rH
rH
rH
n-
n*
n-
o
o
H
o
rH
o
o
n-
o
o
o
o
o
H
rH
rH
rH
rH
rH
rH
rH
cq
o
o
o
o
o
o
o
o
o
o
o
o
rH
o
o
o
n*
o
o
o
o
o
o
rH
rH
rH
o
o
o
o
o
o
o
rH
o
o
o
o
rH
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
n*
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
c
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
rH
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
O
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
o
o
rH
rH
rH
o
rH
rH
o
o
o
o
rH
rH
rH
rH
rH
rH
rH
P
rH
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
-p
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
rH
o
rH
o
rH
rH
o
0
rH
rH
rH
rH
o
rH
rH
rH
rH
o
H
o
o
rH
rH
rH
rH
rH
rH
o
o
rH
rH
o
o
o
o
o
rH
rH
rH
rH
o
o
o
rH
o
rH
o
o
o
o
o
o
o
o
o
o
H
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
H
o
rH
rH
H
rH
rH
rH
rH
rH
H
H
H
o
rH
rH
rH
rH
rH
rH
rH
rH
rH
o
rH
rH
rH
H
rH
rH
rH
p
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
rH
o
o
o
o
o
o
o
o
o
o
o
o
o
o
-p
rH
rH
rH
rH
rH
rH
rH
rH
rH
o
rH
rH
n-
o
o
rH
rH
rH
rH
rH
rH
rH
rH
n-
rH
n-
rH
o
rH
rH
rH
rH
rH
o
rH
rH
rH
o
o
o
o
o
o
o
o
o
o
o
in
o
o
o
o
o
o
o
o
o
o
o
o
rH
o
o
o
o
o
o
o
o
o
o
rH
o
rH
o
o
o
o
o
o
o
o
o
o
o
o
H
rH
H
rH
rH
rH
a)
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
rH
H
rH
rH
rH
rH
rH
rH
o
o
o
o
X
o
rH
o
o
o
o
rH
o
H
o
o
o
o
o
o
o
o
rH
o
o
o
o
o
o
o
o
o
o
rH
rH
rH
rH
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
rH
o
o
o
o
o
o
o
o
o
o
o
o
CM
CO
o
1
H
CM
o
cn
ID
H
<
cq
H
o
CM
H
2
<
D
<
\
X
Eh
d)
a
Ph
X
cq
U3
CQ
CM
u
rH
a
tn
rH
rH
H
rH
rH
rH
CM
rH
rH
rH
CM
rH
rH
CM
CM
PI
2
h)
CQ
CQ
CO
CO
rH
1
rH

2
\X
i
i
1
i
i
i
1
1
1
i
1
i
i
1
1
CQ



<
1
1
1
CM
X!
O
o
o
o
o
o
H
in
CO
PI
o
O
X U
pp
a
CQ
*
CQ
2
in
CQ
2
X X >
X
X
a
X
PI
>
o
X
o
O
(N
H
H
Eh
rH
(0
H
rH
rH
rH
rH
rH
X
£
w
rH
X
<4
H
CO
w
CQ
CQ
CQ
Uh
Eh
CQ
CQ
03
CQ
<
O X
X
X
>H
Cw
a
CQ
in
H
CO
rH
rH
rH
c <
X
Eh
cq
cq
cq
cq
03
CQ
2
H
H
cq
CQ
H
X
CQ
co
a
CQ
a
2
2
u
CQ
CQ
X
X
X
IS)
X
u
o
a
u
tsi
N
X
2
2
a
u
CQ
a
CQ
03 ¡2
X X
2 -P
t
)

185
Table 5-2. continued
TT6
BRNO-1
CADIZ-1
PAN-B
BFM
BNC
DBP
DGD
DOT
BIB-2
BEP-2
DJO-2
DSD-2
MAI
MBB-2
MBS-2
MBT
MDS
MPW
MYL-1
MYL-2
MOL
SEI
SEG-1
SPE
SET-1
SFM-2
SMA-1
SMA-2
ZRU-1
ZRU-2
ZYD-2
ZYP-2
KAR-2
10 20 29
00010010011000100010000100110
00110010111000100010010100110 50
00000010111000100010010110110
00100110011017700010010110110
00010010011000100010000110110
00101010011000000010010110110
00101010011177700010011110110
00101010011000100010000100110
00100010011000000010010110110
00100010011000100010000100110
00100010111000100000011110100
00100010111000100010010100110 60
00100010011000100010000100110
00110010111000100011710110010
00100000010000000010000100110
00100010111000100010010100110
00101010011000000010010110110
00111010011000100010010100110
00101010111000100010010100110
00110010011001000011710110110
00101000011000000010010110110
00101010011000100010010100110 70
00010010111000000010010110110
00110010111001000011010110110
10101070011000100010010110110
00110010011000100011710110110
00110010111001000011010110110
00000010011000000010010110110
00110010111001000010010110110
00100110011017700010010110110
00100100011000000010010110110
00110010011001000010010110110 80
00110010011017700010010110110
00100010011000000011700010010
Character set derived from Figure 5-1 and Table 5-1 The
numbers on the top of column indicate the character number
described in Table 5-2, 1: indicates the presence of the
specified restriction site, 0: indicates the absence of
restriction site, 7: indicates the restriction site is
undetermined.

186
restriction enzymes. "+" and indicate the presence, and
absence, respectively, of a given restriction site. The
character state of Ab allele is explained in Table 5-3. As
the computer program supplied by Felsenstein1s package has a
limited capacity to analyze all the alleles at a time, each
lineage of alleles were analyzed first (data not shown) to
find out the phylogenetic relationship of closely related
alleles. Then, the different lineage alleles were pooled and
analyzed altogether. The parsimonious network of the 86 Ab
alleles constructed is shown in Figure 5-4. This phylogenetic
tree reguires 96 mutational steps. The bar(s) between the
alleles indicate the character state change. Branch lengths
are proportional to the number of character changes. The
distance between the different alleles is proportional to
their DNA sequence divergence, which is reflected by the
numbers of character change between them. Those alleles that
are encircled by solid lines are different alleles which are
shown to be phylogenetically identical by parsimony analysis.
The Mhc class II Ab genes have been divided into four
evolutionary lineages based on retroposon polymorphisms. A
remarkable feature about this Ab phylogenetic tree is that its
main branches correspond very closely to the evolutionary
lineages defined before. It is evident from this phylogenetic
tree that lineage 3 alleles are evolutionarily more closely
related to lineage 2 than to lineage 1 (Figure 5-4) In light
of the fact that each Ab lineage is derived from other lineage

187
Table 5-3. Coding of Restriction Site Data of Ab Alleles.
Character
number
Feature
Character
number
Feature
1
Bam
HI-5.4
16
Sst 1-2.3
2
Bam
HI-3.6
17
Hind III-2.5
3
Bam
HI-2.1
18
Hind III-2.5
4
Bam
HI-2.0
19
Hind III-1.7
5
Bam
HI-2.6
20
Hind III-4.5
6
Bam
HI-3.1
21
Hind III-5.2
7
Sst
1-7.8
22
Bgl II-3.62
8
Sst
1-2.6
23
Bgl II-5.1
9
Sst
1-2.1
24
Pvu II-2.75
10
Sst
1-2.1
25
Pvu II-3.75
11
Sst
1-1.65
26
Pvu II-0.9
12
Sst
1-2.2
27
Eco RI-5.4
13
Sst
1-2.8
28
ECO RI-5.4
14
Sst
1-3.5
29
Pst 1-1.2
15
Sst
1-3.8
The data are derived from restriction map of Figure 5-1

Figure 5-4. Phylogenetic relationships of 86 Ab alleles derived from 12
Mus species and subspecies. Thin circle indicates alleles have the same
restriction site allele by parsimony analysis. Dotted circle indicate
cluster of alleles closedly related to each other. Thick lines
encompass 3 major clusters of alleles that are designated as lineage 1,
2A and 2B, and 3.

189

190
by retroposon insertion, it is obvious that the divergence of
alleles within each lineage occurs by the accumulation of
mutational events, mainly due to base substitution.
The phylogenetic tree shown in Figure 5-5 suggests that
each lineage contains a few meaningful sublineages (designated
by circle broken lines). These sublineages each contain a
cluster of closely related alleles. In some sublineages, the
cluster of alleles are derived from different Mus species, for
example, MYL1, C57BL/10, SEG1, SFM1, suggesting the trans
species mode of evolution operating on the Ab gene.
Occasionally, clusters of alleles are derived from the same
subspecies, e.g., CAS and THON1, both of which belong to M.
m. castaneus.

Figure 5-5. Phylogenetic relationships of 86 Ab alleles derived from 12
Mus species and subspecies. Thin circle indicates alleles have the same
restriction site allele by parsimony analysis. Dotted circle indicate
cluster of alleles closedly related to each other.

KAR-1
192

CHAPTER 6
DISCUSSION
Function of Mhc Genes
The function of Mhc molecules is to present antigen to
T cell receptors on thymus-derived lymphocytes (reviewed by
Klein 1986) T cell responses to antigen have a dual
specificity-one for the protein antigen itself and another
dictated by the allelic form of the Mhc molecules (reviewed
by Schwartz 1985). The molecular basis of this "Mhc-
restricted recognition is explained by the remarkable finding
that Mhc molecules are actually peptide carriers or receptors.
The physical complex of peptide fragments and Mhc molecules
is what interacts with T cell (Buus et al. 1987; Allen et al.
1987). X-ray crystallographic studies of three-dimensional
structure of Mhc class I revealed a putative peptide-binding
groove lined
with the
most
polymorphic
residues
of Mhc
polypeptides
(Bjorkman
et
al. 1987a,
1987b).
These
observations
suggest that the majority
of class
II gene
polymorphisms may dictate the binding specificity of class II
molecules for antigenic peptides.
193

194
Features of Mhc polymorphism
The unusual genetic features of Mhc genes suggest that
novel evolutionary mechanisms must operate on these genes.
Analysis of the unprecedented genetic diversity of Mhc loci
has indicated four important properties of Mhc genes (reviewed
by Potts & Wakeland 1990). First, selective neutrality is
inconsistent with the observations made from population data,
suggesting some forms of balancing selection is operating on
Mhc loci. Second, the population analysis indicate that
selection is operating in contemporary populations and is not
episodic with long intervening periods of neutrality. Third,
diversifying selection is operating directly on the ABS.
Fourth, selection my be strong enough, at least for species
like Mus, to measure directly in population studies. As many
of the polymorphic amino acid residues of class II molecules
occur within the ABS, these allelic molecules may have
different binding properties. Subsequently, these variations
may alter the immune response of individuals to foreign
antigen. Although a wealth of information regarding the
functional and structural properties is currently available,
little is known about the significance of Mhc polymorphism.
The selective forces involved remain elusive (Klitz et al
1986; Potts et al. 1988).

195
Mechanism of Generation of Ab Gene Polymorphisms
Mutational changes in DNA can be classified as four
types: substitution, deletion, insertion and inversion. RFLP
analysis is able to detect all four types of DNA changes,
although it is most efficient in detecting deletions,
insertions and inversions. Substitutions are detectable only
when point mutations occur which alter the recognition
sequences of restriction enzymes. Therefore, RFLP analysis
tends to underestimate the degree of substitution in
comparison with insertion, deletion and inversion.
For the seven restriction enzymes used in our analysis,
the segment of genomic DNA assayed by the Ab gene probe
spanned about 16 kb. Therefore, the polymorphic restriction
sites revealed in this study are distributed over a fairly
large segment of DNA. As the Ab gene is encoded by 700 bps
of exonic DNA, the majority of DNA examined by RFLP analysis
is the noncoding regions of DNA such as introns and flanking
regions. Thus, the restriction site polymorphisms detected
reflect DNA sequence variations in the non-coding regions.
Inspection of restriction maps of 86 Ab alleles in our
analysis indicated that in addition to three distinct
insertion events which constitute the basis of evolutionary
lineages, most restriction site polymorphisms are caused by
point mutations.

196
Mhc Genes Evolve via Trans-species Mode
If Mhc polymorphism arose exclusively after the
initiation of speciation, then one would expect Mhc alleles
in a given species to be more closely related to each other
than they are to those in other species. However, if the Mhc
evolves in a trans-specific manner, some Mhc alleles from one
species would be expected to resemble those from other species
more closely than they do to each other.
A number of studies exploring the genetic diversity of
Mhc class I and II genes indicate that a considerable
proportion of the polymorphisms of contemporary alleles
predated speciation events, i.e. the Mhc genes evolve in a
trans-species manner, and during the course of gene evolution,
they diverge by slowly accumulating point mutations (McConnell
et al. 1988; Figueroa et al. 1988; Lawlor et a. 1988; Mayer
et al. 1988). Previously, McConnell et al (1988) demonstrated
that alleles of Mhc class II Ab gene can be organized into 3
evolutionary lineages based on their genomic structures. The
evolutionary relationship between lineages 1 and 2 is that
lineage 2 alleles are produced from lineage 1 alleles by an
861 bp retroposon insertion in the intron separating A^ and
Ap2 exons. The evolutionary relationships among these
lineages of alleles were first elucidated by determining the
DNA sequence of intron 2 from a lineage 3 allele (k
haplotype). This sequence analysis has provided some unique

197
insight into the mechanism (s) of generating Ab gene
polymorphism. On the basis of sequence data, PCR enzymatic
amplification and restriction analysis, the Ab genes were
reorganized into four evolutionary lineages, 1, 2A, 2B and 3.
The result of this analysis clearly indicated that four Ab
lineage alleles were derived from three independent successive
retroposon insertions in the intron between A^ and A^2 exons.
Lineage 2B allele was generated from lineage 2A allele by an
insertion of B1 family repeat. Subsequently, another new
family of retroposon, composed of 539 bp of nucleotides,
integrated into a lineage 2B allele, thus generating lineage
3 allele. Lineage 1 alleles are present in all species and
subspecies of genus Mus examined so far, suggesting probably
it is the most ancient lineage of Ab genes. Lineage 2A
alleles are identified in one Asian species, Mus caroli. three
aboriginal species, Mus spicileaus. Mus spretoides. Mus
spretus as well as Mus m. musculus and Mus m. domesticus.
Lineage 2B alleles are only found in M. m. musculus to date.
However, lineage 3 alleles are present in M. m. musculus and
M. m. domesticus. Simultaneously, during the course of Ab
gene evolution, the progenitor alleles thus generated from
retroposon insertion accumulate mutational changes, leading
to the formation of cluster(s) of alleles closely related to
each other.

198
Possible Impact of Retroposons on Ab Gene Expression
Since retroposons are dispersed through the host DNA by
duplicative retroposition, it is likely that they have a major
impact on genomes. The most obvious is their mutagenic
potential due to the disruption of sequences at the site of
integration (Chao et al. 1983). Retroposon integrations in
exons and other regulatory regions would result in null
alleles and might be selected against even in heterozygous
states. However, retroposon insertions in introns and
intergenic regions are more likely to be neutral (reviewed by
Deininger 1990) In addition, there are several examples of
SINE elements found in noncoding and coding regions of
numerous genes without deleterious effects. The insertions
of SINE elements have been used as a signal for
polyadenylation, portion of coding sequence, and termination
signal. In addition, SINEs have been implicated in
recombination (Lehrman et al. 1987) act as limits to gene
conversions (Hess et al. 1983) and mobilize unrelated DNA
sequences throughout the genome either via retroposition of
sequences adjacent to SINEs (Zelnick et al. 1987) or by
facilitating recombination. The SINE elements and repetitive
family member identified in various Ab lineages are all
positioned in intron 2. Presumably, these retroposons may
not have any drastic impact on Ab gene function as this intron
has 5' splice site with GT dinucleotide and 3' splice site

199
with AG dinucleotides. Subsequently, these inserted sequences
would be removed from primary transcripts by RNA processing.
However, in studies of Ab gene expression using DNAase I
hypersensitivity (DH) assay, it has been shown that DH sites
unique to transcriptionally active tissues were mapped into
SINE elements (Mclndoe et al. 1990). These data suggest that
the retroposon insertions in the gene may have a subtle
unrecognized effect on the expression of Ab genes. The
influence of these retroposon insertions on Ab gene expression
may be significant in light of the fact that numerous studies
have shown the level of la antigen expression is critical to
the efficiency of antigen-presentation to T cells (Matis et
al. 1983; Janeway et al. 1984). Moreover, the exceptionally
high abundance of SINEs in the intron may reflect a more open
chromatin structure associated with such genes in the germ
line (Slagel et al. 1987)
Linkage Diseauilibria Among Restriction Sites
Among the 115 H-2 haplotypes studied in this
dissertation, a total of 86 Ab alleles was identified by RFLP
analysis. Close inspection of their restriction maps revealed
one unusual feature of restriction-site polymorphism, that is,
there is strong nonrandom association of polymorphic
restriction sites among themselves. This nonrandom
association or linkage disequilibrium occurs mainly because

200
association or linkage disequilibrium occurs mainly because
restriction sites and their neighboring genetic loci are
tightly linked (Nei 1987b). During the construction of
phylogenetic tree of Ab genes, 29 informative sites were
uncovered and used for parsimony analysis. Therefore, one
would predict that 229 > 52 x 108 different alleles will be
generated if random combination of restriction sites occurs.
However, our global sampling of mouse H-2 haplotypes came up
with the number much lower than that. Clearly, this is a
strong case of linkage disequilibrium. The surveys of
distribution and frequencies of Mhc class I and class II genes
in natural populations of mouse indicate that H-2 polymorphism
is not as extensive as would be predicted if the diversity of
these gene is unlimited (Wakeland & Nadeau 1980) Studies of
H-2 and allozyme polymorphisms with respect to geographical
and temporal distribution in wild mice have indicated that H^
2 polymorphisms were more uniformly distributed than allozymes
(Nadeau et al. 1988). Taken together, these data indicate
that some alleles are selectively maintained in many
populations as suggested previously (Wakeland & Nadeau 1980).
If the only selective pressure operating on H-2 genes is
random diversification, then natural populations should
contain a virtually unlimited number of H-2 alleles. However,
the analysis of class I and class II genes suggests that they
are present at appreciable frequencies in different natural
populations of mice and are more uniformly distributed than

201
indicated that similar or identical H-2 genes can be
identified in both laboratory inbred strains and wild mice.
These observations can be interpreted as evidence that
selective pressures are operating to restrict the polymorphism
of H-2 genes (Wakeland & Nadeau 1980).
Maintenance of Mhc Polymorphism
Although there are numerous mechanisms that could
contribute to the maintenance of polymorphism, only a few are
likely to apply to the Mhc. These are overdominance
selection, high mutation rates, neutrality, frequency
dependent selection, variation in pathogen assemblages across
space and time, mating preferences, and transmission
distortion favoring Mhc heterozygotes. The mutation rate at
the Mhc loci is not particularly high as shown by Hayashida
& Miyata (1983). The allelic frequencies of HLA are too
regular to be compatible with neutrality expectations (Hedrick
& Thomson 1983), and neutrality is too weak a force to account
for the degree of H-2 polymorphisms in local population of
Mus (Potts et al. 1987).
Frequency dependent selection favoring rare alleles is
a more potent mechanism to maintain polymorphism than
heterozygote advantage (Herick 1972). It is theoretically
appealing because the rare Mhc alleles might enjoy an
advantage in the molecular arms race against pathogens (Bodmer

202
1972). However, it is difficult to demonstrate frequency
dependent selection caused by pathogen evolution as it
requires long term studies to observe cycles due to pathogen
evolution.
If pathogen assemblages vary in space and time, and
specific Mhc alleles are more effective against one subset of
pathogens than others, then natural selection would favor
different subsets of Mhc alleles according to the current
pathogen assemblages. This type of selection would contribute
to the maintenance of Mhc polymorphism because different
alleles would be maintained in different populations.
Unfortunately, the data available concerning pathogens are
not sufficient to test this hypothesis.
Disassortative mating according to Mhc genotypes would
contribute to the maintenance of polymorphisms. This
mechanism involves olfaction and the genes responsible have
been mapped to Mhc loci (Yamazaki 1976; Boyce et al. 1983).
Transmission distortion, proposed by Clarke and Kirby
(1966), also favors the production of Mhc heterozygotes. On
the surface, both mating preferences and transmission
distortion resemble heterozygote advantage in that they result
in an excess proportion of heterozygotes. However, they are
more effective at maintaining polymorphism because rare
alleles have an advantage in all genotypes, whereas under
heterozygote advantage, rare alleles enjoy an advantage only
in the heterozygote condition (reviewed by Potts et al. 1988).

203
Overdominant Selection for Mhc Polymorphism
The extraordinary polymorphism of Mhc genes set them
apart from all other known genetic loci. It is generally
believed that the Mhc loci have been molded by special forces
not acting, or at least not to the same degree, on other loci
(Klein & Figueroa 1986; Klein et al. 1989). On one hand,
there is no doubt that Mhc loci are subject to negative
purifying selection which eradicates functionally unfit
variants as can be judged from the fact that the diversity of
these genes is not unlimited. But this type of selection
probably also acts on most other functional loci. On the
other hand, one wonders whether Mhc loci are also subject to
positive selection which, for example, provides an advantage
to individuals heterozygous at Mhc genes? Although some
observations indicate that Mhc loci of certain species are
not polymorphic or at least not highly polymorphic (Figueroa
et al. 1986; Watkins et al. 1988), there is some evidence
suggesting that positive selection are operating to drive the
diversification of Mhc genes. Hughes and Nei's (1988, 1989)
analysis of the pattern of nucleotide substitution at
synonymous and nonsynonymous positions in the codons of ABS
provided one of the most convincing argument for positive
Darwinian selection. Their approach was to compare the
nucleotides constituting the ABS with those coding the rest
of the genes. The role of positive selection implicated in
enhancing the diversity is indicated by the fact that the rate

204
enhancing the diversity is indicated by the fact that the rate
of nonsynonymous substitutions in the ABS is higher than would
be expected if the substitutions are neutral. In the rest of
molecule, nonsynonymous substitutions are lower than expected,
indicating the negative selection is acting on the
corresponding portions of the genes. Positive selection may
act via heterozygous advantage (overdominant selection) in
which the superior ability of Mhc heterozygotes to bind and
present antigen will enhance their resistance to infectious
diseases ,thus increasing their relative fitness in the
population. Overdominant selection is also known to enhance
the rate of amino acid substitution and increase the
heterozygosity and persistence of polymorphic alleles
enormously compared with those of neutral alleles (Maruyama
& Nei 1981; Nei 1987b). The conservation of evolutionary
lineages over long periods can also be explained by assuming
that positive selection has been acting on the functional Mhc
genes through overdominant selection.
Divergent Allele Advantage
Although overdominant selection alone may explain the
number of Mhc alleles prevalent in natural populations and the
retention of ancestral polymorphisms, the extensive sequence
diversity between alleles in A^ exons indicates that another
selective mechanism specifically enhancing diversification
must also be operative (Wakeland et al. 1990a). This type of

205
the other two forms of balancing selection (i.e. overdominant
and rare allele advantage) commonly thought to operate on Mhc
genes (Bodmer 1972; Zinkernagel & Doherty 1974). All three
types of selection would contribute to the maintenance of Mhc
polymorphism of highly divergent alleles within population
(Wakeland et al. 1990b)
Alu-like Repetitive Elements in Ap Genes
SINE as Evolutionary and Genetic Tags
Interspersed repetitive DNA sequences have been
discovered in the genomes of all vertebrate species studied
to date (Schmid & Jelinek 1982; Jelinek & Schmid 1982). Many
of these repetitive DNA families are present in extremely high
copy numbers. On the average, Alu elements appear every 5 kb,
so it is not surprising that the intron between A^1 and A^
exons of Ab genes contains three different sizes of retroposon
inserts in various lineage alleles. Moreover, these three
retroposon insertions were produced from three successive
independent insertional events resulting in the formation of
four evolutionary lineages. Alu elements in specific
locations have been used as markers to study gene and genome
evolution (Barsh et al. 1983; Ruffner et al. 1987).
Previously, McConnell et al. (1988) proposed that SINE
retroposons can be used as evolutionary tags for Mhc class II
genes. In this dissertation, two additional SINE retroposons

206
were identified and used to further dissect the evolutionary
course of Ab genes. On the basis of divergence time estimated
from studies of different species and subspecies of Mus. these
evolutionary tags can be used as a molecular clock to estimate
the time of divergence of different lineages of Ab alleles.
Recently, Pozzo and his coworkers (1990) utilized the presence
of an Alu repeat in the 5' flanking region of D£> genes to
infer the phylogenetic relationship of D0A1 and D0A2. It is
generally accepted that transposition of repetitive elements
is a demonstrated fact over evolutionary times. Yet it is
very difficult, in higher eukaryotes, to demonstrate the
transposition of a family repeat in contemporary populations.
The insertion of Alu-like repeats has been shown to result in
intraspecies polymorphisms within the genus Mus (Kominami et
al. 1983) and Rattus (Schuler et al. 1983) Consistent with
these observations is the finding that lineage 2B allele,
distinguished from lineage 2A by an additional B1 family
repeat, is only found in one subspecies of M. musculus
complex, in contrast to lineage 2A which is found in three
subspecies of M. musculus complex. Likewise, the lineage 3
alleles, derived from lineage 2B alleles by an 539 bp
insertional event, is identified in two subspecies of M.
musculus complex. In summary, the different retroposon
inserts have created both intra- and inter-species
polymorphisms.

207
Retroposons have been found in organisms as diverse as
bacteria and humans. These observations have supported the
view that they are a major evolutionary force contributing to
sequence duplications, dispersions and rearrangements that
maintain the fluidity of eukaryotic genomes. Because
retroposons have generated many families of pseudogenes and
transposable elements that impose no apparent advantage to the
host, it has been proposed that nonviral retroposons could be
thought of as "selfish DNA" that infest that the genome but
barely confer a selective advantage on host (Orgel & Crick
1980; Doolittle & Sapienza 1980).
539 bp Retroposon: a Newly Arisen Repetitive Family
DNA sequence analysis of this 539 bp repeat revealed that
it is composed of a core element of 235 nucleotides, bounded
by two flanking B1 family repeats. A search of GenBank with
the sequence of the core element revealed no homology with
known sequences, suggesting that it is unique. Blot
hybridization experiment using the sequence of core element
as a probe has confirmed this observation. Taken together,
these data indicated that this 539 bp repeat transposed
recently in the evolution of Ab genes. This is consistent
with the fact that the lineage 3 alleles containing this
repeat are found exclusively in M. m. domesticus and M. m.
musculus. The molecular mechansims leading to the dispersal
of this type of retroposon is unclear. Although the core

208
element does not contain the putative RNA polymerase III
promotor, presumably, the internal RNA polymerase III
promotors contained within both B1 repetitive elements would
cotranscribe adjacent sequence (Rogers 1985) and therefore
spread through the genome via RNA-mediated transposition
(Jagadeeswaran et al. 1981).
Transposition of Middle Repetitive Elements
Preferential Site of Integration
The close similarities in the structure of SINE elements
suggest that they are spread throughout the genome by a common
mechanism (Schmid & Shen 1986). The majority of these SINEs
have a precisely defined 5' terminus and a variable oligo dA-
rich 3' terminus, flanked by terminal direct repeats. It has
been shown that the 5' end of the direct repeats is abundant
in dA residues. Similarly, the 5' flanking region adjacent
to the 5' direct repeat is strongly biased for d(A+T)-rich
sequences. Thus, it was concluded that regions of the genome
that are rich in d(A+T) residues are likely to be preferred
integration sites (Daniels & Deininger 1985). In keeping with
this finding, the B1 repeat found in both lineage 2B and
lineage 3 alleles is found to insert into the region rich in
dA residues (Figure 4-6).
In fact, there are numerous examples of SINEs integrating
adjacent to each other, sharing a set of direct repeats,

209
indicating that they might transpose as a single unit (Roger
1985) What is interesting is that the 539 bp repetitive
elements identified in intron 2 of lineage 3 alleles is
integrated into a B1 family repeat of lineage 2A alleles.
This is consistent with observations made by others (Roger
1985).
Possible Transposition Mechanism
Structural analysis of the 539 bp repetitive element
reveals that it is composed of two Alu-like elements plus some
unique DNA sequences in between. This structural feature
strongly suggests that this combined unit may transpose in a
manner suggested above. The transposition mechanism involved
the transcription of sequence into RNA. This RNA transcript
is initiated from the 5' Alu-like repeat by the internal RNA
polymerase III promotor. Termination occurs at some point 3'
to the second Alu-like sequence as Alu-like repeat does not
contain termination sequence of transcription. The obvious
non-repetitive sequence bound by the flanking 51 and 3' Alu-
like repeats may have been cotranscribed into an RNA
transposition intermediate by readthrough synthesis from the
adjacent Alu-like repeat promotor. The RNA molecule thus made
can be converted into DNA by reverse transcriptase The cDNA
consisting of two Alu-like repeats flanking a non-repetitive
internal fragment could then be inserted into a novel genomic
location. Although both the Alu-like elements involved are

210
not flanked by terminal direct repeats, yet it is not uncommon
to find Alu family member without direct repeats. It is worth
mentioning that this new repetitive element is integrated into
a B1 family repeat.
Phylogenetic Relationship of Ab Genes
To analyze the distribution of various mutational events
in the evolutionary history of the 86 Ab alleles in our
collection, we have conducted phylogenetic analysis by
parsimony analysis. A remarkable feature of the Ab
phylogenetic tree is that its main branches correspond very
closely to the 4 evolutionary lineages, 1, 2A, 2B and 3
defined both by sequence analysis and restriction mapping.
It is noteworthy that the phylogenetic tree (gene tree)
constructed from Ab gene locus does not agree with the
phylogenetic relationship of the species involved (species
tree) One of the predominant factors that lead to such a
difference is the genetic polymorphism in the ancestral
species as indicated by Pamilo & Nei (1988) The results from
Figure 5-4 demonstrated that all 86 Ab alleles we analyzed
can be grouped into at least three major clusters of alleles,
which correspond to three evolutionary lineages, 1, 2A, 2B and
3 defined previously. Moreover, each cluster of alleles is
composed of alleles derived from different species and
subspecies of genus Mus. supporting the idea that Mhc alleles

211
evolve in a trans-species manner. Trans-specific evolution,
the occurrence of polymorphisms predates the origin of the
species, have been proposed as the explanation for the
existence of identical alleles in multiple subspecies.
The distribution patterns of Ab alleles in the
phylogenetic analysis suggest that alleles harboring
transposable elements are not subjected to deleterious
selection. The number of alleles related by descent keep
proliferating as evidenced by the clustering of alleles within
each lineage. This finding is in direct contrast to a
neutrality model suggested by Golding et al (1986) that
haplotypes carrying the transposable elements are selectively
deleterious as they are located at the tips of phylogenetic
trees. However, a quantitative population genetic model
proposed by Hickey (1982) suggested that the spread of
transposable genetic elements in natural populations depends
on sexual reproduction of the host. These self-replicative
transposable elements do not have to be selectively neutral
at the organismal level; they can generate major deleterious
effects on the host and still spread through the population.
This analysis has allowed us to construct an evolutionary
trees whereby the different alleles currently distributed
throughout the natural populations are generated by stepwise
divergence from various lineage progenitor alleles. The
presence of different sizes of retroposon insertions in the
intron 2 between the A^1 and A^2 exons of Ab alleles has served

212
as evolutionary tags in deciphering the phylogenetic
relationships of these alleles.
The restriction map data, DNA sequence analysis, and
phylogenetic analysis are consistent with the idea that the
Mhc class II genes are evolving in a trans-species mode. Each
lineage of Ab gene, consisting of alleles closely related to
each other, are composed of alleles belonging to different
species and subspecies of genus Mus.

REFERENCE LIST
Allen, P. M., Matsueda, G. R., Evans, R. J., Dunbar, J. B.,
Marshall, G. R., and Unanue, E. R. 1987. Identification of
the T-cell and la contact residues of a T-cell antigenic
epitope. Nature (London) 327: 713.
Alper, C. 1981. Complement and the MHC. In Dorf, M. (ed.),
The Role of the Manor Histocompatibility Complex in
Immunobiology. pp.173-220, Garland STPM, New York.
Anderson, G. D. and David, C. S. 1989. In vivo expression
and function of hybrid la dimers (EA^) in recombinant and
transgenic mice. J. Exp. Med. 170: 1003.
Arden, B., Wakeland, E. K. and Klein, J. Structural
comparisons of serologically indistinguishable H-2K-encoded
antigens from inbred and wild mice. 1980. J. Immunol. 125:
2424.
Arden, B., and Klein, J. 1982. Biochemical comparison of
major histocompatibility complex molecules from different
subspecies of Mus musculus: evidence for trans-specific
evolution of alleles. Proc. Natl. Acad. Sci. U. S. A. 79:
2342.
Avner, P., Amar, L., Dndolo, L., and Guenet, J. L. 1988.
Genetic analysis of the mouse using interspecific crosses.
T. I. G. 4: 18.
Babbitt, B., Allen, P. M., Matsueda, G., Haber, E., Unanue,
E. 1985. Binding of immunogenic peptides to la
histocompatibility molecules. Nature (London) 317: 359.
Baltimore, D. 1981. Gene conversion: some implications for
immunoglobulin genes. Cell 24: 592.
Barsh, G. S., Seeburg, P. H. and Gelinas, R. E. 1983. The
human growth hormone gene family: structure and evolution of
the chromosomal locus. Nucleic Acids Res. 11: 3939.
213

214
Baxevanis, C. N., Nagy, Z. A., Klein, J. 1981. A novel type
of T-T cell interaction removes the requirement for I-B
region in the H-2 complex. Proc. Natl. Acad. Sci U. S. A.
78: 3809.
Begovich, A. B., and Jones, P. P. 1985. Free la E chain
expression in the recombinant strain A.TFR5.
Immunogenetics. 22: 523.
Benaceraf, B. 1981. Role of MHC gene products in immune
regulation. Science 212: 1229.
Bennaceraf, B., and Germain, R. N. 1978. The immune response
genes of the major histocompatibility complex. Immunological
Reviews 38: 70.
Ben-Nun, A., Glimcher, L. H., Weiss, J., Seidmam, J. G. 1984
1984. Functional expression of a cloned I-A1^ gene in B
lymphoma cells. Science 223: 825.
Benoist, C. 0., Mathis, D. J., Kanter, M. R., William II, V.
E. and McDevitt, H. 0. 1983. Regions of allelic
hypervariability in the murine Aa immune response gene. Cell
34: 169.
Berkower, I., Buckenmeyer, G. K and Berzofsky, J. A. 1986.
Molecular mapping of a histocompatibility-restricted
immunodominant T cell epitope with synthetic and natural
peptides: Implications for T cell antigenic structure. J.
Immunol. 136: 2498.
Bishop, C. E., Boursot, P., Baron, B., Bonhomme, F. and
Hatat, D. 1985. Most classical Mus musculus domesticus
laboratory mouse strains carry a Mus musculus musculus Y
chromosome. Nature (London) 315: 70.
Bjorkman, P. J., Saper, M. A., Samraoui, B., Bennett, W. S.,
Strominger, J. L. & Wiley, D. C. (1987a). Structure of the
human class I histocompatibility antigen, HLA-A2. Nature
(London) 329: 506.
Bjorkman, P. J., Saper, M. A., Samraoui, B., Bennett, W. S.,
Strominger, J. L., and Wiley, D. C. (1987b). The foreign
antigen binding site and T cell recognition regions of class
I histocompatibility antigens. Natured (London) 329: 512.
Bodmer, W. F. 1972. Evolutionary significance of the HL-A
system. Nature (London) 237: 139.

215
Bogenhagen, D. F., Sakonju, S. and Brown, D. D. 1980. A
control region in the center of the 5S RNA gene directs
specific initiation of transcription. II. The 3' border of
the region. Cell 19: 27.
Bonhomme, F. 1986. The evolutionary relationships in the
genus Mus. In Potter, M., Nadeau, J. H. and Cancro, M. P.,
(eds.), The Wild Mice in Immunology. Curr. Top. Microbiol,
and Immunol. 127: 19.
Bono, M. R., Strominger, J. L. 1982. Direct evidence of
homology between human DC-1 antigen and murine I-A
molecules. Nature (London) 299: 836.
Boyce, E. A., Beauchamp, G. K., Yamazaki, K. 1983. The
sensory perception of genotypic polymorphism of the major
histocompatibility complex and other genes: some
physiological and phylogenetic implication. Human
Immunoqenetics 6: 177.
Braunstein, N. S., and German, R. N. 1987. Allele-specific
control of I molecule surface expression and conformation:
Implications for a gereral model of la stucture-function
relationships. Proc. Natl. Acad. Sci. U. S. A. 84. 2921.
Breathnach, R., Benoist, C., O'hare, K. Gannon, F., and
Chambn, P. 1978. Ovalbumin gene: Evidence for a leader
seguence in mRNA and DNA sequence at the exon-intron
boundaries. Proc. Natl. Acad. Sci. U. S. A. 75: 4853.
Britten, R. J., & Kohne, D. E. 1968. Repeated sequences in
DNA. Science. 161: 529.
Brown, J. H., Jardetzky, T., Saper, M. A., Samraoui, B.,
Bjorkman, P. J., and Wiley, D. C. 1988. A hypothetical model
of the foreign antigen binding site of class II
histocompatibility molecules. Nature (London) 332: 845
Busk, H., Thomsen, B., Bonven, B. J., Kjeldsen, E., Nielsen,
O. F., and Westergaard, O. 1987. Preferential relaxation of
supercoiled DNA containing a hexadecameric recognition
sequence for topoisomerase I. Nature (London) 327: 638.
Buus, S., Sette, A., Colon, S. M., Miles, C., and Grey, H.
M. 1987. The relation between major histocompatibility
complex (MHC) restriction and the capacity of la to bind
immunogenic peptides. Science. 235: 1353.
Caras I. W., Davitz, M. A., Rhee, L., Weddell, G., Martin,
D. W. and Nussenzweig, V. 1987. Cloning of decay-
accelerating factor suggests novel use of splicing to
generated two proteins. Nature (London) 325: 545.

216
Cavalier-Smith, T. 1985. Selfish DNA and the origin of
introns. Nature (London) 315: 283.
Cech, T. R. 1986. The generality of self-splicing RNA:
relationhip of nuclear RNA mRNA splicing. Cell 44: 207.
Chao, L., Vargas, C., Spear, B. B., and Cox, E. C. 1983.
Transposable elements as mutator genes in evolution. Nature
(London) 303: 633.
Church, G. M. and Gilbert, W. Genomic sequencing. 1984.
Proc. Natl. Acad. Sci. U. S. A. 81: 1991.
Coligan, J. E., Kindt, T. J., Uehara, H., Martinko, J., and
Nathenson, S. G. 1981. Primary structure of a murine
transplantation antigen. Nature (London) 291: 35.
Costantini, F. D., Britten, R. J., and Davidson, E. H. 1980.
Message sequences and short repetitive sequences are
interspersed in sea urchin egg poly(A) RNAs. Nature (London)
111: 287.
Crick, F. H. C. 1979. Split gene and RNA splicing. Science
204: 264.
Daniels, G. R. and Deininger, P. L. 1985. Integration site
preferences of the Alu family and similar repetitive DNA
sequences. Nucleic Acids Res. 13: 8939.
Davidson, E. H. and Britten, R. J. 1979. Regulation of gene
expression: possible role of repetitive sequences. Science
204: 1052.
Davis, M. M., Cohen, D. I., Nielsen, E. A., Steinmetz, M.,
Paul, W. E., and Hood, L. 1984. Cell-type-specific cDNA
probes and the murine I region: the localization and
orientation of Ada. Proc. Natl. Acad. Sci. U. S. A. 81: 2194.
Deininger, P. L. 1989. SINEs: Short interspersed repeated
DNA elements in higher eukaryotes. In Berg, D. E. and Howe,
M. M. (eds.), Mobile DNA. pp. 619, Am. Soc. Microbiol..
Washington, D. C.
Deininger, P. L., and Schmid, C. W. 1979. A study of the
evolution of repeated DNA sequences in primate and the
existence of a new class of repetitive sequences in
primates. J. Mol. Biol. 127: 437.

217
Devlin, J. J., Wake, C. T., Allen, H., Widera, G., Mellor,
A. L. 1984. The major histocompatibility complex of the
C57BL/10 mouse: Gene organization and function. In Sercarz.
E., Cantor, H. and Chess, L. (eds.), Regulation of the
immune system. (UCLA symposia on Molecular and Cellular
Biology, New Series), vol.18
Doolittle, W. F. Genes in pieces: were they ever together.
1978. Nature (London) 272: 581.
Doolittle, W. F., and Sapienza, C. 1980. Selfish genes, the
phenotype paradigm and genome evolution. Nature (London)
284: 601.
Duncan, W. R., Wakeland, E. K., and Klein, J. 1979.
Heterozygosity of H-2 loci in wild mice. Nature (London) 281
: 603.
Estess, P., Begovich, A. B., Koo, M., Jones, P. P., and
McDevitt, H. O. 1986. Sequence analysis and structure-
function correlations of murine g, k, u, s, and f haplotypes
I-A^ cDNA clones. Proc. Natl. Acad. Sci. USA 83: 3594.
Fachet, J., Ando, I. 1977. Genetic control of contact
sensitivity to oxazolone in inbred, H-2 congenie and intra-
H-2recombinant strains of mice. Eur. J. Immunol. 7: 223.
Fathman, C. G. and Kimoto, M. 1981. Studies utilizing murine
T cell clones: Ir genes, la antigens, and MLR stimulating
determinant. Immunol. Rev. 54: 57.
Felsenstein, J. 1982. Numerical methods for inferring
evolutionary trees. 0. Rev. Biol. 57: 379.
Ferris, S. D., Sage, R. D., Wison A. C. 1982. Evidence from
mt DNA sequence that common laboratory strains of inbred
mice are descended from a single female. Nature (London)
295: 163.
Figueroa, F., Tichy, H., Berry, R. J. and Klein, J. 1986.
Mhc polymorphism in island populations of mice. Curr. Top.
Microbiol. Immunol. 127: 100.
Figueroa, F., Gunther, E., and Klein, J. 1988. MHC
polymorphism pre-dating speciation. Nature (London) 335:
265.
Flavell, R.A., Burkly, L.C., Wake, C., and Widera, G.,
Structure and expression of class II gene of murine MHC, 4th
MHC Clonging Worshop, (Abstr.), 1985a.

218
Flavell, R. A., Allen, H., Huber, B., Wake, C. and Widera,
G. 1985b. Organization and expression of the MHC of the
C57Black/10 Mouse. Ixianunoloaical Reviews. 84: 29.
Flaherty, L. 1980. The Tla region antigens. In Dorf, M.
E.(ed.) The role of the major histocompatibility complex in
immunobiology, pp. 33-58, Garland STPM, New York.
Fowlkes, D. M. and Shenk, T. 1980. Transcriptional control
regions of adenovirus VAI RNA gene. Cell. 22:405
Fuhrman, S. A., Deininger, P. L., LaPorte, P., Friedmann, T.
and Geiduschek, E. P. 1981. Analysis of transcription of the
human Alu family ubiquitous repeating elements by eukaryotic
RNA polymerase III. Nucleic Acids Res. 9: 6439.
Fuhrman, S. A., Deininger, P. L., LaPorte, P., Friedmann,
T., & Geiduschek, E. P. 1981. Analysis of transcription of
the human Alu family ubiquitous repeating elements by
eukaryotic RNA polymerse III. Nucleic Acids Res. 9: 6439.
Galli, G., Hofstetter, H., and Birnstiel, M. L. 1981. Two
conserved sequence blocks within eukaryotic tRNA genes are
major promotor elements. Nature (London) 294: 626.
Geliebter, J., Zeff, R. A., Spathis, R., Pfaffenbach, G.,
Nakagawa, M., Mcgue, B., Mashimo, H., Kesari, K., Hemmi, S.,
Hasenkrug, K., Borriello, F., Kumar, P. A. and Nathenson, S.
G. 1987. The anaysis of H-2 mutants: Molecuar genetics and
structure/function relationships. In David, C. S. (ed.), H-
2 Antigens: Genes, molecules, function, pp. 169-176, Plenum
Press, New York and London.
Germain, R. N., Bentley, D. M., and Quill, H. 1985.
Influence of allelic polymorphism on the assembly and
surface expression of class II MHC (la) molecules. Cell 43:
233.
Germain, R.N., Quill, H. 1985. Unexpected expression a
unique mixed-isotype class II MHC molecule by transfected L
cells. Nature (London) 320: 72.
Germain, R. and Malissen, B. 1986. Analysis of the
expression and function of class-II major histocompatibility
complex-encoded molecules by DNA-mediated gene transfer.
Ann. Rev. Immunol. 4: 281.
Gilbert, W. 1978. Why genes in pieces. Nature (London). 271:
501.
Gilbert, W. 1985. Genes-in-pieces revisited. Science 228:
823

219
Gilbert, W., Marchionni, and McKnight, G. 1986. On the
antiquity of intron. Cell 46: 151.
Goding, J. W. Evidence for linkage of murine 02-
microglobulin to H-3 and Lv-4. 1981. J. Immunol. 126:1644.
Gorer, P.A. 1938. The antigenic basis of tumour
transplantation J. Pathol. Bacteriol. 47:231.
Gorer, P.A., Lyman, S., Snell, G.D. 1948. Studies on the
genetic and antigenic basis of tumour transplantation:
lingkage between a histocompatibility gene and "fused" in
mice. Proc. R. Soc. London. B 135:499.
Gotze, D., ed. 1977. The Major Histocompatibility System in
Man and Animals. Berlin: Springer-Verlag.
Gotze, D., Nadeau, J., Wakeland, E. K., Berry, R. J.,
Bonhomme, F., Egorov, I. K., Hjorth, J. P., Hoogstraal, H.,
Vives, J., Winking, H., and Klein, J. 1980.
Histocompatibility-2 system in wild mice X. Frequencies of
H-2 and la antigens in wild mice from Europe and Africa. J.
Immunol. 124: 2675.
Guenet J. L. 1985. Do non-linked genes really reassort at
random? Ann. Inst. Pasteur Immunol. 136c: 85
Guillet, J. G., Lai, M.-Z., Briner, T. J., Smith, J. A., &
Gefter, M. L. 1986. Interaction of peptide antigens and
class II major histocompatibility complex antigens. Nature
(London) 324: 260.
Gustafsson, K., Wiman, K., Emmoth, E., Larhammar, O., Bohme,
J., Hyldig-Nielsen, J. J., Ronne, H., Peterson, P. and Rask,
L. 1984. Mutations and selection in the generation of class
II histocompatibility antigen polymorphism. EMBO J. 3: 1665.
Hansen, T. H., Spinella, D. G., Lee, D. R., and Shreffler,
D. C. 1984. The immunogenetics of the mouse major
histocompatibility gene complex. Ann. Rev. Genet. 18: 99.
Hayashida, H. and Miyata, T. 1983. Unusual evolutionary
conservation and frequent DNA segment exchange in class I
genes of the major histocompatibility complex. Proc. Natl.
Acad. Sci. U. S. A. 80: 2671.
Haynes, S. R.,and Jelinek, W. R. Low molecular weight RNAs
transcribed in vitro by RNA polymerase III from Alu-type
dispersed repeats in Chinese hamster DNA also found in vivo.
1981. Proc. Natl. Acad. Sci. U. S. A. 78: 6130.

220
Haynes, S. R., Toomey, P., Leinwand, L., & Jelinek, W. R.
1981. The Chinese hamster Alu-equivalent sequence: a
conserved, highly reptitious, interspersed deoxynucleotide
acid sequence in mammals has a structure suggestive of a
transposable element. Mol. Cell. Biol. 1: 573.
Heber-Katz, E., Hansburg, D., and Schwartz, R. H. 1983. The
la molecule of the antigen-presenting cell play a critical
role in immune response gene regulation of T cell
activation. J. Mol. Cell. Immunol. 1: 3.
Heber-Katz, E., Schwartz, R. H., Matis, L. A., Hannum, C.,
Fairwell, T., Appella, E., Hansburg, D. 1982. Contribution
of antigen-presenting cell major histocompatibility complex
gene products to the specificity of antigen-induced T cell
activation. J. Exp. Med. 155: 1086.
Hedrick, P. W. and Thomson, G. 1983. Evidence for balancing
selection at HLA. Genetics 104: 449.
Hess, J. F., Fox, G. M., Schmid, C., and Shen, C.-K. J.
1983. Molecular evolution of the human adult a-like globin
gene region: insertion and deletion of Alu family repeats
and non-Alu DNA sequences. Proc. Natl. Acad. Sci. U. S. A.
80: 5970.
Hickey, D. A. 1982. Selfish DNA: A sexually-transmitted
nuclear parasite. Genetics 101: 519.
Hickey, D. A. and Benkel, B. 1986. Introns as relict
retrotransposons: implication for the evolutionary origin of
eukaryotic mRNA splicing mechanisms. J. Theor. Biol. 121:
283.
Hildemann, W.H., Clark, F.A., Raison, R.L. 1981.
Comprehensive Immunoqenetics. New York: Elsevier.
Hood, L., Steinmetz, M., Malisson, B. 1983. Genes of the
major histocompatibility complex of the mouse. Ann. Rev.
Immunol. 1: 529.
Houck, C. M., Rinehart, F. P., & Schmid, C. W. 1979. A
ubiquitous family of repeated DNA sequences in the human
genome. J. Mol. Biol. 132: 289.
Hughes, A. and Nei, M. 1988. Pattern of nucleotide
substitution at major histocompatibility complex class I
loci reveals overdominant selection. Nature (London) 335:
167.

221
Hughes, A. and Nei, M. 1989. Nucleotide substitution at
major histocompatibility complex class II loci: Evidence for
overdominant selection. Proc. Natl. Acad. Sci. U. S. A. 86:
958.
Hunig, T. R., Bevan, M. J. 1982. Antigen recognition by
cloned cytotoxic T lymphocytes follows rules predicted by
altered-self hypothesis. J. Exp. Med. 155: 111.
Hurme, M., Chandler, P.R., Heterington, C.M., Simpson, E.
1978. Cytotoxic T-cell responses to H-Y: Correlation with
the rejection of syngeneic male skin grafts. J. Exp. Med.
147: 768
Jagadeeswaran, P., Forget, B. G., and Weissman, S. M., 1981.
Short, interspersed repetitive DNA elements in eukaryotes:
transposable DNA elements generated by reversed
transcription of RNA pol III transcripts? Cell 26: 141.
Janeway, C. A., Bottomly, K., Babich, J., Conrad, P.,
Conzen, S., Jones, B., Kaye, J., Katz, M., McVay, L.,
Murphy, D. B., and Tite, J. 1984. Quantitative variation
in la antigen expression plays a central role in immune
regulation. Immunol. Today. 5: 99.
Jelinek, W.R. and Schmid, C.W. 1982. Repetitive sequences in
eukaryotic DNA and their expression. Ann. Rev. Biochem. 51:
813
Jones, P. 1977. Analysis of H-2 and la molecules by two-
dimensional gel electrophoresis. J. Exp. Med. 146: 1261.
Jones, P. P., Murphy, D. B. and McDevitt, H. 0. 1978. Two
gene control of the expression of a murine la antigen. J.
Exp. Med. 148: 925.
Juretic, A., Nagy, Z. A. and Llein, J. 1981. Detetection of
CML determinants associated with H-2 controlled E£ and Ea
chains. Nature (London) 298: 308.
Kalb, V. F. Glasser, S., King, and Lingrel, J. B. 1983. A
cluster of repetitive elements within a 700 base pair region
in the mouse genome. Nucleic Acids Res. 11: 2177.
Kappler, J. W., Skidmore, B., White, J. and Marrack, P.
1981. Antigen-inducible H-restricted, interleukin-2-
producing T cell hybridoma. Lack of independent antigen and
H-2 recognition. J. Exp. Med. 153: 1198.

222
Kappler, J. W. Wade, T., White, J., Kushnir, E., Blackman,
M., Bill, J., Roehm, N. and Marrack, P. 1987. A T-cell
receptor V£ segment that imparts reactivity to a class II
major histocompatibility complex product. Cell 49: 263.
Kaufman, J. F., Auffray, C., Korman, A. J., Shackelford, D.
A. and Strominger, J. L. 1984. The class II molecules of the
human and murine major histocompatibility complex. Cell 36:
1.
Kelly, F., and Condamine, H. 1982. Tumor viruses and early
mouse embryos. Biochim. Biophvs. Acta. 651: 105.
Kim, J.-H., Yu, C.-Y. Bailey, A., Hardison, R. and Shen, C.-
K. J. 1989. Unique sequence organization and erythroid cell-
specific nuclear factor-binding of mammalian 9 1 globin
promotors. Nucleic Acids Res. 17: 5687.
King, D. P. and Jones, P. P. 1983. Induction of la H-2
antigens on a macrophage cell line by immune interferon. J_-.
Immunol. 131: 315.
King, D., Snider, L. D., and Lingrel, J. 1986. Polymorphism
in an Androgen-Regulated Mouse Gene is the result of the
insertion of a B1 repetitive element into the transcription
unit. Mol. Cell. Biol. 6: 209.
Klein, J. 1975. Biology of the Mouse Histocompatibility
Complex. Berlin: Springer-Verlag, New York.
Klein, J. 1978. H-2 mutations: Their genetics and effect on
immune function. 1978. Adv. Immunol. 26: 55.
Klein, J. 1980. Generation of diversity at MHC loci:
Implication for T-cell receptor repertoires. In Fougereau,
M. and Dausset, J.(eds.), Immunology 80, pp. 239. London,
Academic Press.
Klein, J. 1986. Natural history of major histocompatibility
complex, John Wiley, New York.
Klein, J. 1987. Origin of major histocompatibility complex
polymorphism: The transpecies hypothesis. Human Immunology.
19: 155.
Klein, J., and Figueroa, F. 1981. Polymorphism of the mouse
H-2 loci. Immunol. Rev. 60: 23.
Klein, J., and Figueroa, F. 1986. Evolution of the major
histocompatibility complex. CRC crit. Rev. Immunol. 6: 295.

223
Klein, J., Figueroa, F., and Nagy, Z. A. 1983. Genetics of
the major histocompatibility complex: the final act. Ann.
Rev. Immunol. 1: 119.
Klein, J., Juretic, A., Baxevanis, C. N., and Nagy, Z. A.
1981. The traditional and a new version of the mouse H-2
complex. Nature (London) 291: 455.
Klitz, W., Thomson, G. and Baur, M. P. 1986. Contrasting
evolutionary histories among tightly linked HLA loci. Am. J.
Hum. Genetics. 39: 340.
Kobori, J. A., Sinoto, A., McNicholas, J., Hood, L. 1984.
Molecular characterization of the recombination region of
six murine major histocompatibility complex (MHC) I region
recombinants. J. Mol. Cell. Immunol. 1: 125.
Kominami, R., M. Muramatsu, M., and Moriwaki, K. 1983. A
mouse type 2 Alu Sequence (M2) is mobile in the genome.
Nature (London) 301: 87.
Kramerov, D. A., Grigoryan, A. A., Ryskov, A. P., Georgier,
G. P. 1979. Long double-stranded sequences (ds RNA B) of
nuclear pre-mRNA consist of a few highly abundant classes of
sequences: evidence from DNA cloning experiments. Nucleic
Acids Res. 6: 697.
Krane, D. E., and Hardison, R. C. 1990. Short interspersed
repeats in rabbit DNA can provide functional polyadenylation
signals. Mol. Biol. Evol. 7: 1.
Krayev, A. S., D. A. Kramerov, K. G. Skryabin, A. P. Dyskov,
A. A. Bayev, and G. P. Georgiev. 1980. The nucleotide
sequence of the ubiquitous repetitive DNA sequence B1
complementary to the most abundant class of mouse fold-back
RNA. Nucleic Acids Res. 8: 1201.
Kress, M., Barra, Y., Seidman, J. G., Khoury, G., and Jay,
G. 1984. Functional insertion of an Alu-type 2 (B2 SINE)
repetitive sequence in murinre class I genes. Science 226:
974.
Kronenberg, M., Steinmeta, M., Kobori, T., Kaig, E., Kapp,
J. A., Pierce, C. W., Sorensen, C. M., Suzuki, G., Tada, T.
and Hood, L. 1983. RNA transcipts for I-J polypeptides are
apparently not encoded between the I-A and I-E subregions of
the murine major histocompatibility complex. Proc. Natl.
Acad. Sci. U. S. A. 80: 5074.

224
Krupen, K., Araneo, B. A., Brink, L., Kapp, J. A., Stein,
S., Wieder, K. J. and Webb, D. R. 1982. Purification and
characterization of a monoclonal T-Cell suppressor factor
specific for polyiLGlu60 LAla30 LTyr10) Proc. Natl. Acad. Sci.
U. S. A. 79: 1254.
Lafuse, W. and David, C. S. 1988. Recombination sites within
the I region of the mouse H-2 complex. In David, C. S.
(ed.), H-2 Antigens: Genes, molecules, function, pp. 41-47,
Plenum Press, New York.
Lambowitz, A. M. 1989. Infectious introns. Cell 56: 323.
Larhammar, D., Hammerling, U., Denaro, M., Lund, T.,
Flavell, R. A., Rask, L., and Peterson, P. A. 1983.
Structure of the murine immune response I-A* locus: sequence
of the I-A* gene and an adjacent /?-chain second domain exon.
Cell. 34: 179.
Lawlor, D. A., Ward, F. E., Ennis, P. D., Jackson, A. P. and
Parham, P. 1988. HLA-A and B polymorphisms predate the
divergence of humans and chimpanzees. 1988. Nature (London)
335: 268.
Lehrman, M. A., Goldstein, J. L., Russel, D. W. and Brown,
M. S. 1987. Duplication of seven exons in LDL receptor gene
casued by Alu-Alu recombination in a subject with familial
hypercholesterolemia. Cell 48: 827.
Lieberman, R., Paul, W.E., Humphrey, W.Jr., Stimpfing, J.H.
1972. H-2-linked immune response (Ir) genes.Independent loci
for Ir-IgG and Ir-IgA genes. J. Exp. Med. 136: 1231.
Lindahl, K. F. 1986. Genetic variants of histocompatibility
antigens from wild mice. In Potter, M., Nadeau, J. H. and
Cancro, M. P. (eds.) The Wild Mouse in Immunology. Curr.
Top. Microbiol. Immunol. 127: 272.
Linial, M., Medeiros, E. and Hayward, W. S. 1978. An avian
oncovirus mutant (SE21Q16) deficient in gonomic RNA:
biological and biochemical characterization. Cell 15: 1371.
Livnat, S., Llein, J., Bach, F.H. 1973. Graft versus host
reaction in strains of mice identical for H-2K and H-2D
antigens. Nature (London) 243: 42.
Lozner, E.C., Sachs, D.H., Shearer, G.M. 1974. Genetic
control of the immune response to staphylococcal nuclease.
I. Ir-Nase: Control of the antibody response to nuclease by
the Ir region of the mouse H-2 complex. J. Exp. Med. 139:
1204.

225
Luckett, W. P. and Hartenberger, J. L. 1985. Evolutionary
relationships among rodents. A multi-disciplinary analysis.
Plenum Press, New York.
Malissen, B., Peele-Price, M., Goverman, J. M., McMillan,
M., white, J., Kappler, J., Marrack, P., Pierres, F.,
Pierres, M., Hood, L. 1984. Gene transfer of H-2 class II
genes: Antigen presentation by mouse fibroblast and hamster
B cell lines. Cell 36: 319.
Maloy, W. L., Coligan, J. E. 1982. Primary structure of
2Db alloantigen II. Additional amino acid sequence
information, location of a third site of glycosylation and
evidence for K and D region specific sequences.
Immunoqenetics 16: 11.
Marrack, P. and Kappler, F. 1986. The antigen-specific,
major histocompatibility complex-restricted receptor on T
cells. Adv. Immunol. 38: 1.
Marshall, J. T. Taxonomy. 1981. In Foster, H. L., Small, J.
D., Fox, J. G., (eds.), The Mouse in Biomedical Research,
vol. I, pp. 17-25, Academic Press, Inc., New York, N.Y.
Martin, M. A., Bryan, T., Rasheed, S. and Khan, A. S. 1981.
Identificastion and cloning of endogenous retroviral
sequences present in human DNA. Proc. Natl. Acad. Sci. U. S.
A. 78: 4892.
Maruyama, T., and Nei, M. 1981. Genetic variability
maintained by mutation and overdominant selection in finite
populations. Genetics 98: 441.
Mathis, D.J., Benoist, C. 0., Williams, V. E. II, Kanter, M.
R., McDevitt, H. 0. 1983a. The murine E^ immune response
gene. Cell 32: 745.
Mathis, D. J., Benoist, C., William II, V. E., Kanter, M.
and McDevitt, H. 0. 1983b. Several mechanisms can account
for defective E gene expression in different mouse
haplotypes. Proc. Natl. Acad. Sci. U. S. A. 80: 237.
Mayer, W. E., Jonker, M., Klein, D., Ivanyi, P., Seventer G.
V., and Klein J. 1988. Nucleotide sequence of chimpanzee MHC
class I alleles: evidence for trans-species mode of
evolution. EMBO J. 7(9): 2765.
McCluskey, J., Germain, R. N., Margulies, D. H. 1985. Cell
surface expression of an in vitro recombinant classll/class
I major histocompatibility complex gene product. Cell 40:
247.

226
McConnell, T. J., Talbot, W. S., Mclndoe, R. A. and
Wakeland, E. K. 1988. The origin of MHC class II gene
polymorphism within the genus Mus. Nature (London) 332: 651.
McKinnon, R. D., Shinnick T. M. and Sutcliffe, J. G. 1986.
The neuronal identifier element is a cis-acting positive
regulator of gene expression. Proc. Natl. Acad. Sci. U. S.
A. 83: 3751.
McLachian, A. D. 1980. In Jaenicke, R.(ed.) Protein Folding
pp. 79-99, Elsevier, North Holland.
McNicholas, J. M., Murphy, D. B., Matis, L. A., Schwartz, R.
H., Lerner, E. A., Janeway, C. A.Jr., Jones, P. P. 1982.
Immune response gene function correlates with the expression
of an la antigen. I. Preferential association of certain Ae
and Ea chains results in a quantitative deficiency in
expression of an Ae:Ea complex. J. Exp. Med. 155: 490.
Melchers, I., Rajkewsky, K., Shreffler, D.C. 1973. Ir-
LDHB:Map postion and functional analysis. Eur. J. Immunol.
3: 754.
Mellor, A. L. Golden, L. Weiss, E. Bulliran, H. Hurst,
J., Simpson, E., James, R., Townsend, A. R. M., Taylor, P.
M., Schmidt, W., Ferluga, J., Leben, L., Santamara, M.,
Atfield, G., Festenstein, H. and Flavell, R. A. 1982.
Expression of the murine H-2Kb histocompatibility antigen in
cells transformed with cloned H-2 genes. Nature (London)
298: 529.
Mengle-Gaw, L., Conner, S., McDecitt, H. 0. and Fathman, C.
G. 1984. Gene conversion between murine class I major
histocompatibility complex loci. Functional and molecular
evidence from the bml2 mutant. J Exp. Med. 160: 1184.
Michaelson, J. Genetic polymorphism of )32-microglobulin
(B2m) maps the H-3 region of chromosome 2. 1981.
Immunoqenetics 13: 167.
Morse H. C. 1978. Origins of Inbred Mice. Academic Press
New-York.
Muller, U., Jongeneel, C. V., Nedospasov, S. A., Fischer
Lindahl, K., and Steinmetz, M. 1987a. Tumor necrosis factor
and lymphotoxin genes map close to H-2D in the mouse major
histocompatibility complex. Nature (London) 325: 265.
Muller, U., Stephan, D., Philippsen, P., and Steinmetz, M.
1987b. Orientation and molecular map position of the
complement genes in the mouse MHC. EMBO. J. 6: 369.

227
Murphy, D. B. 1978. The I-J subregion of the murine H-2
gene complex. Springer Sem. Immunopathol. 1: 111.
Murphy, D. B. 1981. Genetic fine structure of the H-2 gene
complex. In Dorf, M. E. (ed.) The Role of the Major
Histocompatibility Complex in Immunobiology. Garland STPM,
New York.
Murphy, D.B., Herzenberg, L. A., Okumura, K., Herzenberg, L.
A., McDevitt, H. 0. 1976. A new I subregion (I-J) marked by
a locus (la-4) controlling surface determinants on
suppressor T lymphocytes. J. Exp. Med. 144: 699.
Nadeau, J. H., Wakeland, E. K., Gotze, D. and Klein J. 1981.
The population genetics of the H-2 polymorphism in European
and North African populations of the house mouse (Mus
musculus L.) Genet. Res. 37: 17.
Nakamura, M., Manser, T., Pearson, G. D. N., Daley, M. J.,
Gefter, M. L. 1984. Effect of IFN-gamma on the immune
response in vivo and on gene expression in vitro. Nature
(London) 307: 381.
Nathenson, S. G., Uehara, H., Errenstein, B. M., Kindt, T.
J., Coligan, J. E. 1981. Primary structural analysis of the
transplantation antigens of the murine H-2 major
histocompatibility complex. Ann. Rev. Biochem. 50: 1025.
Nei, M., Li, W.-H. 1979. Mathematical model for studying
genetic variation in terms of restriction endonucleases.
Proc. Natl. Acad. Sci. USA. 76: 5269.
Nei, M. 1987a. In Molecular Evolutionary Genetics. Columbia
University Press, New York.
Nei, M. 1987b. Relative roles of mutation and selection in
the maintenance of genetic variability. Phil. Trans. R.
Soc. Lond. B319: 615.
Ng, R., Domdey, H., Lorson, G., Rossi, J. J., and Abelson,
J. 1985. A test for intron function in the yeast actin gene.
Nature (London) 314: 183.
Norcross, M. A., Raghupathy, R., Strominger, J. L., Germain,
R. N. 1986. Transfected human B lymphoblastoid cells express
the mouse A^-chain in association with DR,. J. Immunol 137:
1714.
Okuda, K., David, C. S. 1978. A new lymphocyte-activating
determinant locus expressed on T cells, and mapping in I-C
subregions. J. Exp. Med. 147: 1028.

228
Orgel, L. E., and Crick, F. H. C. 1980. Selfish DNA: the
ultimate parasite. Nature (London) 284: 604.
Pamilo, P. and Nei, M. 1988. Relationships between gene
trees and species trees. Mol. Biol. Evol. 5: 568.
Pan, J., Elder, J.T., Duncan, C.H., Weissman, S.M. 1981.
Structural analysis of interspersed repetitive RNA
polymerase III transcription units in human DNA. Nucleic
Acids Res. 9: 1151.
Parham, P. 1984. A repulsive view of MHC-restriction.
Immunol. Today. 5: 89.
Perez-Stable, C., Ayres, T. M. and Shen, C. K. J. 1984.
Distinctive seguence organization and functional programming
of an Alu repeat promotor. Proc. Natl. Acad. Sci. U. S. A.
81: 5291.
Perkins, D. L., Lai, M.-Z., Smith, J. A., and Gefter, M. L.
1989. Identical peptides recognized by MHC class I- and II-
restricted T cells. J. Exp. Med. 170: 279.
Peterson, P. A., Cunninghan, B. A., Berggard, I., Edelman,
G. M. 1972. 82-microglobulin-A free immunoglobulin domain.
Proc. Natl. Acad. Sci. U. S. A. 69: 1697.
Potts, W. K., Manning, C. J., Peck, A. B., Price-LaFace, M
and Wakeland, E. K. 1988. Can heterozygotes advantage
account for the maintenance of H-2 polymorphism ? In David,
C. S.(ed.), H-2 antigens: Genes. Molecules. Function. pp89-
102, Plenum Press, New York and London.
Potts, W. K. and Wakeland, E. K. 1990. Evolution of
diversity at the major histocompatibility complex. T. I. E.
E. 5: 181.
Pozzo, G. D. & Guardiola, J. 1990. A SINE insertion provides
information on the divergence of the HLA-D0A1 and HLA-D0A2
genes. Immonogenetics 31: 229.
Rabourdin-Combe, C., Mach, B. 1983. Expression of HLA-DR
antigens at the surface of mouse L cells cotransfected with
cloned human genes. Nature (London) 303: 670.
Rautmann, G. and Breatnach, R. 1985. A role for branch
points in splicing in vitro. Nature (London) 315: 430.
Rich, S. S., David, C. S., Rich, R. R. 1979a. Regulatory
mechanisms in cell-mediated immune response VII. Presence of
I-C subregion determinants on mixed leukocyte reaction
suppressor factor. J. Exp. Med. 149: 114.

229
Rich, R. R., Sdeberry, D. A., Kastner, D. L., Chu, L. 1979b
Primary in vitro cytotoxic response of NZB spleen cells to
Qa-lb-associated antigenic determinants. J. Exp. Med. 150:
1555.
Rinehart, F. P., Ritch, T. G., Deininger, P. L., and Schmid,
C. W. 1981. Renaturnation rate studies of a single family of
interspersed repeated sequences in human deoxynucleic acid.
Biochemistry. 20: 3003.
Robinson, R. R., Germain, R. N., McKean, D. J., Mescher, M.,
Seidman, J. G. 1983. Extensive polymorphism surrounding the
murine la A£ chain gene. J. Immunol. 131: 2025.
Robinson, P. J., Lundin, L., Sege, K., Graf, L., Wigzell,
H., Peterson, P. A. Location of the mouse /32-microglobulin
gene B2m determined by linkage analysis. 1981.
Immunocfenetics 14: 449.
Roger, J. H. 1985. The origin and evolution of retroposons.
Int. Rev. Cvtol. 93: 187.
Roger, J. H. 1989. How were introns inserted into nuclear
genes. T. I. G. 5: 213.
Ruffner, D. E., Sprung, C. N., Minghetti, P. P., Gibbs, P.
E. M. and Dugaiczyk, A. 1987. Invasion of the human
albumin-a-fetoprotein gene family by Alu, Kpn, and two novel
repetitive DNA elements. Mol. Biol. Evol. 4: 1-9.
Rupp, F., Acha-Orbea, H., Hengartner, H., Zinkernagel, R.,
and Joho, R. 1985. Identical Vp T-cell receptor genes used
in alloreactive cytotoxic and antigen plus I-A specific
helper T cells. Nature (London) 315: 425.
Sagai, T., Sakaizumi, M., Miyashita, N., Bonhomme, F.,
Petras, M. L., Nielsen, J. T., Shiroishi, T., and Moriwaki,
K. 1989. New evidence for trans-species evolution of the H-2
class I polymorphism. Immunogenetics 30: 89.
Sage, R. D. 1981. Wild mice. In H. L. Foster, J. D. Small
and Fox, J. G. (eds.), The Mouse in Biomedical Research, pp.
39-99, Academic Press, New York.
Sambrook, J., Fritsch, E. F., and Maniatis, T. 1989.
Isolation of high-molecular-weight DNA from mammalian cells
pp. In Molecular cloning, a laboratory manual. pp, 9.14-
9.19, 2nd ed. Cold Spring Harbor Laboratory Press, New York.
Sandrin, M. S., McKenzie, I. "F. C.1981. Production of a
cytotoxic anti-la.6 antibody. Immunogenetics 14: 345.

230
Sanger, F., Nicklen, S., and Coulson, A. R. 1977. DNA
sequencing with chain terminating inhibitors. Proc. Natl.
Acad. Sci. U. S. A. 74: 5463.
Sant, A. J. and Germain, R. N. 1989. Intracellular
competition for component chains determines class II MHC
cell surface phenotype. Cell 57: 797.
Schmid, C. W., & Deininger, P. L. 1975. Sequence
organization of human genome. Cell 6: 345.
Schmid, C. W. and Jelinek, W. R. 1982. Sequence organization
of human genome. Science 216: 1065.
Schmid, C. W. and Shen, C.-K. J. The evolution of
interspersed repetitive DNA sequences in mammals and other
vertebrates. 1985. In MacIntyre, R. J. (ed): Molecular
Evolutionary Genetics, pp. 323-352, Plenum Press, New York.
Schuler, L. A., Weber, J. L., and Gorski, J. 1983.
Polymorphism near the rat prolactin gene caused by insertion
of an Alu-like element. Nature (Londond) 305: 159.
Sharma, S., Metha, S, Morgan, J. and Maizel, A. 1987.
Molecular cloning and expression of a human B-cell growth
factor gene in Escherichia coli. Science 235: 1489.
Sharp, P. A. 1983. Conversion of RNA to DNA in mammals: Alu-
like elements and pseudogenes. Nature (London) 301: 471.
She, J. X., Bonhomme, F., Boursot, P., Thaler, L. and
Catzeflis, F. 1990a. Molecular phylogenies in the genus
Mus: Comparative analysis of electrophoretic, scnDNA
hybridization and mtDNA RFLP data. Biol. J. Linn. Soc. 41:
83.
She, J. X., Boehme, S., Wang, T. W., Bonhomme, F., and
Wakeland, E. K. 1990b. The generation of MHC class II gene
polymorphism in the genus Mus. Biol. J. Linn. Soc. 41: 141.
Shiroishi, T., Hanzawa, N., Sagai, T., Ishiura, M.,
Gojobori, T., Steinmetz, M., and Moriwaki, K. 1990.
Recombinational hotspot specific to female meiosis in the
mouse major histocompatibility complex. Immunogenetics. 31:
79.
Silver, J., Swain, S. L., Hubert, J. J. 1980. Small subunit
of I-A subregion antigen determines the allospecificity
recognized by monoclonal antibody. Nature (Londlon) 286:
272.

231
Singer, M. F. 1982. Highly repeated sequences in mammalian
genomes. Int. Rev. Cvtol. 76: 67.
Slagel, V., Flemington, E., Traina-Dorge, V., Bradshaw, H.,
Deininger, P. 1987. Clustering and subfamily relationships
of the Alu family in the human genome. Mol. Biol. Evol. 4:
19.
Smith, L. J., Braylan, R. C., Nutkis, J. E., Edmundson, K.
B., Downing, J. R., and Wakeland, E. K. 1987. Extraction of
cellular DNA from human cells and tissues fixed in ethanol.
Anal. Biochem. 160: 135.
Southern, E. 1975. Detection of specific sequences among DNA
fragments separated by gel electrophoresis. J. Mol. Biol.
98: 503.
Snell, G. D. 1968. The H-2 locus of the mouse, observation
and speculations concerning its comparative genetics and its
polymorphisms. Folia Biol. 14: 335.
Spencer, J. S. and Kubo, R. 1989. Mixed isotype class II
antigen expression. A novel class II molecule is expressed
on a murine B cell lymphoma. J. Exp. Med. 169: 625.
Steeg, P. S., Moore, R. N. Oppenheim, J. J. 1980. Regulation
of murine macrophage la-antigen expression by products of
activated spleen cells. J. Exp. Med. 152: 1734.
Steinmetz, M., Malissen, M, Hood, L., Orn, A., Maki, R. A.,
Dastoormikoo, G. R., Stephan, D., Gibb, E. and Romaniuk, R.
1984. Tracts of high or low swquence divergence in the
mouse major histocompatibility complex. EMBO J. 3: 2995.
Steinmetz, M., Minard, K., Horvath, S., McNicholas, J.,
Frelinger, J, Wake, C., Long, E., Mcah, B. and Hood, L.
1982a. A molecular map of the immune response region from
the major histocompatibility complex of the mouse. Nature
(London) 300: 35.
Steinmetz, M., Moore, F. K. W., Frelinger, J. G., Sher, B.
T., Shen, F.-W., Boyse, E. A. and Hood, L. 1981. A
pseudogene homologous to mouse transplanation antigens :
Transplantation antigen are encoded by eitht exons that
correlate with protein domains. Cell 25: 683.
Steinmetz, M., Stephan, D., and Fischer-Lindahl, K. 1986.
Gene organization and recombinational hotspots in the murine
major histocompatibility complex. Cell 44: 895.

232
Steinmetz, M., and Uematsu, Y. 1987a. The major histocom
patibility complex of the BALB/C mouse: gene organization
and recombination. In David, C. S. (ed.): H-2 Antigens:
Genes, molecules, function, pp. 31-39. Plenum Press, New
York.
Steinmetz, M., Uematsu, Y., and Lindahl K. F. 1987b.
Hotspots of homologous recombination in mammalian genomes.
T. I. G. 3: 7.
Steinmetz, M., Winoto, A., Minard, K. and Hood, L. 1982b.
Cluster of genes encoding mouse transplantation antigens.
Cell 28: 489.
Stephan, D., Sun, H., Fischer Lindahl, K., Meyer, E.,
Hammerling, G., Hood, L., and Steinmetz, M. 1986.
Organization and evoluiton of D region class I genes in the
major histocompatibililty complex. J. Exp. Med. 163: 1227.
Strominger, J. L., Orr, H. T., Parham, P., Ploegh, H. L.,
Mann, D. L. 1980. An evaluation of the significance of
amino-acid sequence homologies in human histocompatibility
antigen (HLA-A and HLA-B) with immunoglobulins and other
proteins, using relative short sequences. Scand. J. Immunol.
11: 573.
Tacchini-Cottier, F. M., and Jones, P. P. 1988. Defective E^
expression in three mouse H-2 haplotypes results from
aberrant RNA splicing. J. Immunol. 141: 3647.
Uematsu, Y,, Kiefer, H., Schulze, R., Fischer Lindahl, K.,
and Steinmetz, M. 1986. Molecular characterization of a
meiotic recombinational hotspot enhancing homologous equal
cross-over. EMBO J. 5: 2123.
Uhr, J.W., Capra, J.D., Citetta, E.S.,Cook, R.G. 1979.
Organization of the immune response genes. Science 206: 292.
Ullu, E., and Weiner, A. M. 1985. Upstream sequences
modulate the internal promotor of the human 7SL RNA gene.
Nature (London) 318: 371.
Unanue, E. R., and Allen, P. M. 1987. The basis for the
immunoregulatory role of macrophages and other accessory
cells. Science 236: 551.
Urba, W. J., Hildemann, W. H. 1978. H-2-linked recessive Ir
gene regulation of high antibody responsiveness to TNP
hapten conjugated to autologous albumin. Immunogenetics 6:
433.

233
VanArsdell, S. W. R. A. Denison, L. B. Bernstein, A. M.
Weiner, T, Manser, and R. F. Gesteland. 1981. Direct repeats
flank three small nuclear RNA pseudogenes in the human
genome. Cell. 11.
Vanin, E. 1984. Processed pseudogenes: characteristica and
evolution. Biochim Biophvs. Acta 782: 231.
Wake, C. T. and Flavell, R. A. 1985. Multiple mechanisms
regulate the expression of murine immune response genes.
Cell. 42: 623.
Wakeland, E. K., Boehme, S., She, J. X. The generation and
maintenance of MHC Class II gene polymorphism in rodents.
1990a. Immunological Rev. 113: 207.
Wakeland, E. K., Boehme, S., She, J. X., Lu, C.-C., Mclndoe,
R. A., Cheng, I., Ye, Y and Potts, W. K. 1990b. Ancestral
polymorphisms of MHC Class II genes: Divergent Allele
Advantage. Immunological Research.
Wakeland, E. and Darby, B. 1983. Recombination and mutation
of class II histocompatibility genes in wild mice. J.
Immunol. 131: 3052.
Wakeland, E. K., Darby, B. and Coligan, J. E. 1985.
Localization of stuctural variations distinguishing I-Ak-
related molecules to the al and /31 domains. J. Immunol. 135:
391.
Wakeland, E. K., Klein, J. 1979. Structural comparisons of
serologically identical IA- and IE-encoded antigens from
inbred and wild mice. Immunogenetics 9: 535.
Wakeland, E. and Klein, J. 1983. Evidence for minor
structural variations of class II genes in wild and inbred
mice. J. Immunol. 130: 1280.
Wakeland, E. K. and J. H. Nadeau. 1980. Immune
responsiveness polymorphism of the major histocompatibility
complex: an interpretation. In Sercarz, E. I and
Cunningham, A. J. (eds.), Strategies of Immune Regulation,
pp. 149-156, Academic Press, New York.
Watson, J. B., and Sutcliffe, J. G. 1987. Primate brain-
specific cytoplasmic transcript of the Alu repeat family.
Mol. Cell. Biol. 7: 3324.
Waltenbaugh, C. 1981. Regulation of immu e response by I-
J gene products. I.Production and characterization of anti-
I-J monoclonal antibodies. J. Exp. Med. 154: 1570.

234
Walter, P., and Blobel, G. 1982. Signal recognition particle
contains a 7S RNA essential for protein translocation across
the endoplasmic reticulum. Nature (London) 299: 691.
Watkins, D. I., Hodi, F. S., Letvin, N. L. 1988. A primate
sepcies with limited major histocompatibility complex class
I polymorphism. Proc. Natl. Acad. Sci. U. S. A. 85: 7714.
Widera, G. and Flavell, R. A. 1985. The I-region of the
C57BL/10 mouse: characterization and linkae to H-2K of a
novel SB/3-like class II pseudogene A/93. Proc. Natl. Acad.
Sci. U. S. A 82: 5500.
Weiner, A. M., P. L. Deininiger, and A. Efstratiadis. 1986.
Nonviral retroposons: genes, pseudogenes, and transposable
elements generated by the dreversed flow of genetic
information. Annu. Rev. Biochem. 55: 631.
Weiss, E. H., Golden, L., Fahrner, K., Mellor, A. L.,
Devlin, J. J., Bullman, H., Tiddens, H., Bud, H. and
Flavell, R. A. 1984. Organization and evolution of the
class I gene family in the major histocompatibility complex
of the C57BL/10 mouse. Nature (London) 310: 650.
Wilson, S. H. and Kuff, E. D. 1972. A novel DNA polymerase
activity found in association with intracisternal A-type
particles. Proc. Natl. Acad. Sci. U. S. A 69: 1531.
Winoto, A., Steinmetz, M. and Hood, L. 1983. Genetic mapping
in the mouse major histocompatibility complex by restriction
enzyme polymorphisms: most mouse class I genes maps to the
Tla complex. Proc. Natl. Acad. Sci.U. S. A. 80: 3425.
Yamazaki, K., Boyse, E. A., Mike, V., Thaler, H. T.,
Mathieson, B. J., Abbott, Boyse, J. Zayas, Z. A., Thomas,
L. 1976. Control of mating preferences in mice by genes in
the major histocompatibility complex. J. Exp. Med. 144:
1324.
Yokoyama, K., Nathenson, S. G. 1983. Intramolecular
organization of class I H-2 MHC antigens; localization of
the alloantigenic determinants and the 02m binding site to
different regions of the H-2 Kb glycoprotein. J. Immunol.
130: 1419.
Yonekawa, H., Moriwaki, K., Gotoh, O., Miyashita, N.,
Matsushima, Y., Shi, L., Cho, W. S., Zhen, X.-L. and
Tagashira, Y. 1988. Hybrid origin of Japanese mice"
Mus musculus molossinus" Evidence from restriction analysis
of mitochondria DNA. Mol. Biol. Evol. 5: 63.

235
Zelnick, C. R., D. J. Burks, and C. H. Duncan. 1987. A
composite transposon 3' to the cow fetal globin gene binds a
sequence specific factor. Nucleic Acids Res. 15: 10437.
Zinkernagel, R. M. and Doherty, P. C. 1974. Immunological
surveilance against altered self components by sensitized T
lymphocytes in lymphocyte choriomeningitis. Nature (London)
251: 547.

BIOGRAPHICAL SKETCH
Cheng-Chan Lu was born in Taiwan, Republic of China, on
November 16, 1953. He grew up in Tainan, a historical city
in South Taiwan. As a child he enjoyed many extracurricular
activities, but enjoyed playing baseball the most. While
attending medical school of National Taiwan University, he
cultivated an interest in many sports. His favorites were
fencing, ping-pong, baseball and tennis. After graduating
from National Taiwan University, he served two years in the
army at a general hospital in Taiwan, and then he started
thinking of pursuing advanced education to satisfy his
desire for knowledge. Although he had previously performed
research with Dr. Czau-Siung Yang during his years in
medical school, he now sought more challenging bench work.
Consequently, he went to National Yang-Ming Medical College
to work with Dr. Wu-Tse Liu. There he spent two years
working as a research and teaching assistant before coming
to Florida to pursue a Ph.D. He first studied at the
University of South Florida and then transferred to
University of Florida. He received his Doctor of Philosophy
degree from the Department of Pathology and Laboratory
Medicine at the University of Florida in 1990.
236

I certify that I have read this study and that in my
opinion it conforms to acceptable standards of scholarly
presentation and is fully adequate, in scope and quality, as
a dissertation for the degree of Doctor of Philosophy.
Edward K. Wakeland, Chair
Professor of Pathology and
Laboratory Medicine
I certify that I have read this study and that in my
opinion it conforms to acceptable standards of scholarly
presentation and is fully adequate, in scope and quality, as
a dissertation for the degree of Doctor of Philosophy.
Kuo-Jang Kao
Associate Professor of Pathology
and Laboratory Medicine
I certify that I have read this study and that in my
opinion it conforms to acceptable standards of scholarly
presentation and is fully adequate, in scope and quality, as
a dissertation for the degree of Doctor of Philosophy.
taMJ.'Yli
HarrysT/ick
Associate Professor of
Biochemistry and Molecular
Biology
I certify that I have read this study and that in my
opinion it conforms to acceptable standards of scholarly
presentation and is fully adequate, in scope and quality, as
a dissertation for the degree of Doctor of Philosophy.
Ammon B. Peck
Associate Professor of Pathology
and Laboratory Medicine

I certify that I have read this study and that in my
opinion it conforms to acceptable standards of scholarly
presentation and is fully adequate, in scope and quality, as
a dissertation for the degree of Doctor of Philosophy.
William E. Winter
Associate Professor of Pathology
and Laboratory Medicine
This dissertation was submitted to the Graduate Faculty
of the College of Medicine and to the Graduate School and was
accepted as partial fulfillment of- the requirements for the
degree of Doctor of Philosophy. n
December 1990 ^
Dean,
Medicine
College of



Figure 5-4. Phylogenetic relationships of 86 Ab alleles derived from 12
Mus species and subspecies. Thin circle indicates alleles have the same
restriction site allele by parsimony analysis. Dotted circle indicate
cluster of alleles closedly related to each other. Thick lines
encompass 3 major clusters of alleles that are designated as lineage 1,
2A and 2B, and 3.


Figure 4-12. Southern blot hybridization experiments with 235 bp non-
repetitive elements. Double-digested DNA was hybridized with the non-
repetitive probe. S:Sst I, H: Hind III, E: Eco RI, P: Pst I, B: Bam HI,
Bg: Bgl II.


K2 K
SCALE, p-
0 100
200
Aft Ap Aa Ep E$2Ea
300
400
500kb


27
2-5). The folding of the class II molecule resembles that of
class I, in that two a helices are supported by an array of
eight 0-plated sheets (Brown et al. 1988). The recent results
of Perkins et al. (1989) showing that peptides presented by
class I molecules can be presented by class II molecules, and
vice versa, support the notion that the structures of peptide
binding sites are similar in class I and class II.
Structures of class II genes
There is a striking correlation between the gene
organization and domain structure of Mhc class II molecules
(Figure 2-4) Both a and p genes begin with leader-encoding
exons that contains 3-6 residues of the mature proteins. Exon
2 and 3 encode al or pi and a2 or ¡32 domains, respectively.
P genes have three exons encoding TM, CY, and 3'UT region,
while a genes have TM, CY, and the beginning of 3'UT regions
in exon 4, and the rest of 3'UT region in exon 5 (Larhammar
et al. 1983; Estess et al. 1986).
Analysis of the Structure-Function Relationship of Class II
Molecule
The application of DNA-mediated gene transfer (DMGT) has
been a major advancement in the analysis of structure and
function relationships of Mhc gene products. Particularly,


73
packaged into retroviral particles and be reverse transcribed
(Linial et aJL. 1978) Packaging should facilitate the reverse
transcription and may account for the high efficiency of SINE
retropositon. Packaging may also promote an "infection-like"
process facilitating RNA made in somatic cell to enter the
germ line (Vanin 1984).
Integration
To facilitate the integration process, the genome must
be nicked to allow the entry of new sequences, followed by
repair synthesis to make direct repeats at the integration
sites. Direct repeats generated are generally rich in A
residues and vary widely in length, suggesting that SINE do
not use specific integration enzymes but instead take
advantage of nicks generated by other nonspecific enzymes.
Topoisomerases, enzymes that relax the genome during
replication and transcription, have been shown to have nicking
activity in a SINE family member in vitro (Perez-Stable et al.
1984). Although topoisomerase I is generally thought to be
nonspecific in its nicking activity, hot spots for DNA
cleavage have been reported (Busk et al. 1987) These sites
are A rich and at least partially resemble the 3' terminus and
direct repeats of SINEs. Not only are the integration sites
of SINEs A rich, but the A richness is predominantly at the
left end of the direct repeat (Daniels & Deininger 1985;
Rogers et al. 1986) These findings have several


109
concentrated by ethanol precipitation. Precipitates were
resuspended in TE buffer and digested under appropriate
condition.
Amplification of Central Fragment for DNA Hybridization
To characterize the genetic nature of the central
fragment bounded by two members of the B1 family in the 539
bp insert in lineage 3 alleles, 5' and 3' oligonucleotide
primers flanking this region of DNA was designed and used to
amplify the plasmid PUC-K-1.9 encompassing this region of DNA
(Figure 3-4 & Figure 3-5). The amplified DNA products were
estimated to be 235 bp in length and subsequently, purified
from 6% polyacrylamide gel. The isolated 230 bp DNA fragments
were radiolabelled by primer extension and used to hybridize
the blots.


Table 5-1. continued
166
Strain
Pst I
Eco RI
Bam HI
Pvu II
Sst I
Bgl II
Hind III
tw5
3.89
5.4
9.0
2.89
5.2
12.7
6.2
2.6
2.75
3.8
5.5
2.65
1.7
tw8
3.89
18
5.4
2.89
5.2
12.2
10
3.6
2.75
3.8
5.5
2.6
2.65
1.7
tw32
3.89
18
5.4
2.89
5.2
12.2
10
3.6
2.75
3.8
5.5
2.6
2.65
1.7
BELGRADE1
3.89
5.4
9.0
2.89
7.8
12.2
6.2
8.0
2.75
3.8
5.5
1.7
BRNO 2
3.89
5.4
n. d.
2.89
5.2
11.7
n.d.
2.75
3.8
2.65
VIBORG5
3.89
5.4
5.4
2.89
5.2
11.7
8.5
3.6
2.75
3.8
5.5
2.6
2.65
1.7
VIBORG8
3.89
5.4
5.4
2.89
5.2
11.7
8.5
3.6
2.75
3.8
5.5
2.6
2.65
1.7
B10.CAS2
3.89
5.4
9.0
2.89
5.2
11.7
6.2
2.6
2.75
3.8
5.5
2.65
1.7
THONBURI1
3.89
5.4
11
2.89
5.5
12.7
11
2.6
2.75
3.8
2.5
2.3
1.7
THONBURI2
3.89
5.4
11.0
2.89
5.2
11.7
11
2.6
2.75
3.8
2.5
2.3
1.7
PANCEVO-d
3.89
5.4
9.0
2.89
7.8
12.2
6.2
2.0
2.75
3.5
5.5
1.7
BIO
4.80
6.38
7.6
3.79
7.3
9.0
8.0
2.12
2.75
3.5
3.62
4.5
2.0
1.58


89
In the past, M. (Pvromvs) platvthrix and M. (Coelomvs)
pahari are considered as subgenera of Mus based on their
morphology. They are not more related to Mus than they are to
other well defined Murid genera. The large, spiny M.
platvthrix occur in India. The large, shrew-like Mus pahari
is present from Sikkim to Thailand. The phylogenetic
relationships deduced from DNA-DNA hybridization studies among
9 species and 5 subspecies within the genus Mus are presented
in Figure 2-15. The % DNA divergence detected between the
various species is shown on the left axis, the estimated time
interval since genetic separation of their gene pools
(speciation) is listed on the right. Similar phylogenetic
relationships are obtained when these species are compared by
other techniques, such as, protein polymorphisms, mitochondria
DNA sequence divergence (She et al. 1989). However, estimates
of the genetic distance among Mus species will vary depending
on the techniques employed (She et al. 1989) There are seven
levels of divergence among these species, ranging from 0.3 to
10 million years (Luckett & Hartenbege 1985).


216
Cavalier-Smith, T. 1985. Selfish DNA and the origin of
introns. Nature (London) 315: 283.
Cech, T. R. 1986. The generality of self-splicing RNA:
relationhip of nuclear RNA mRNA splicing. Cell 44: 207.
Chao, L., Vargas, C., Spear, B. B., and Cox, E. C. 1983.
Transposable elements as mutator genes in evolution. Nature
(London) 303: 633.
Church, G. M. and Gilbert, W. Genomic sequencing. 1984.
Proc. Natl. Acad. Sci. U. S. A. 81: 1991.
Coligan, J. E., Kindt, T. J., Uehara, H., Martinko, J., and
Nathenson, S. G. 1981. Primary structure of a murine
transplantation antigen. Nature (London) 291: 35.
Costantini, F. D., Britten, R. J., and Davidson, E. H. 1980.
Message sequences and short repetitive sequences are
interspersed in sea urchin egg poly(A) RNAs. Nature (London)
111: 287.
Crick, F. H. C. 1979. Split gene and RNA splicing. Science
204: 264.
Daniels, G. R. and Deininger, P. L. 1985. Integration site
preferences of the Alu family and similar repetitive DNA
sequences. Nucleic Acids Res. 13: 8939.
Davidson, E. H. and Britten, R. J. 1979. Regulation of gene
expression: possible role of repetitive sequences. Science
204: 1052.
Davis, M. M., Cohen, D. I., Nielsen, E. A., Steinmetz, M.,
Paul, W. E., and Hood, L. 1984. Cell-type-specific cDNA
probes and the murine I region: the localization and
orientation of Ada. Proc. Natl. Acad. Sci. U. S. A. 81: 2194.
Deininger, P. L. 1989. SINEs: Short interspersed repeated
DNA elements in higher eukaryotes. In Berg, D. E. and Howe,
M. M. (eds.), Mobile DNA. pp. 619, Am. Soc. Microbiol..
Washington, D. C.
Deininger, P. L., and Schmid, C. W. 1979. A study of the
evolution of repeated DNA sequences in primate and the
existence of a new class of repetitive sequences in
primates. J. Mol. Biol. 127: 437.


I certify that I have read this study and that in my
opinion it conforms to acceptable standards of scholarly
presentation and is fully adequate, in scope and quality, as
a dissertation for the degree of Doctor of Philosophy.
Edward K. Wakeland, Chair
Professor of Pathology and
Laboratory Medicine
I certify that I have read this study and that in my
opinion it conforms to acceptable standards of scholarly
presentation and is fully adequate, in scope and quality, as
a dissertation for the degree of Doctor of Philosophy.
Kuo-Jang Kao
Associate Professor of Pathology
and Laboratory Medicine
I certify that I have read this study and that in my
opinion it conforms to acceptable standards of scholarly
presentation and is fully adequate, in scope and quality, as
a dissertation for the degree of Doctor of Philosophy.
taMJ.'Yli
HarrysT/ick
Associate Professor of
Biochemistry and Molecular
Biology
I certify that I have read this study and that in my
opinion it conforms to acceptable standards of scholarly
presentation and is fully adequate, in scope and quality, as
a dissertation for the degree of Doctor of Philosophy.
Ammon B. Peck
Associate Professor of Pathology
and Laboratory Medicine


Figure 2-8. Illustration of the evolutionary origins of the three
lineages of Ab alleles. The solid line represents evolutionary lineage
1 which was the earliest form of Ab in Mus. The open line represents
evolutionary lineage 2 which was formed by an 861 bp retroposon
insertion into a lineage 1 allele before the separation of 5 separate
Mus species assayed. The hatched line represents evolutionary lineage
3 which was formed by two additional insertions in a lineage 2 allele
subsequent to the inception of Mus m. domesticus.


43
alleles may exist in each of these genes (Gotze et al. 1980;
Klein & Figueroa 1981, 1986). There are other genes within
the H-2 complex are also highly polymorphic, but they tend to
be less polymorphic than the H-2K and H-2D genes. 2) most if
not all wild mice are heterozygous with respect to H-2 class
I and class II genes (Duncan et al. 1979; Nadeau et al. 1981).
This high level of heterozygosity is unprecedented in the
mouse and is mainly, if not entirely, a result of the presence
of a large number of alleles in wild mouse populations. It
was estimated that over 90-95% of the wild mice are
heterozygous at both K and D loci and at least 85% are
heterozygous at the Ab and Eb loci (Duncan et al. 1979;
Nadeau et al. 1981). These figures concur with the high H-2
polymorphism estimated from the antigen and gene frequencies
(Klein 1986). 3) H-2 polymorphism occurs as a family of
closely related alleles. Both amino acid and DNA sequence
analysis demonstrates that the similarity between H-2 genes
and proteins is discontinuous (Wakeland et aJL. 1986) 4) both
sequence and amino acid analysis of serologically and
biochemically indistinguishable class II molecules derived
from different subspecies suggest that they are identical
(Arden et al. 1980; Arden & Klein 1982). 5) there is a high
percentage of nucleotide difference between alleles from the
same locus. The nucleotide sequence variation can go up as
high as 5-10%, including the coding region (Benoist et al.
1983; Estess et al. 1986)


228
Orgel, L. E., and Crick, F. H. C. 1980. Selfish DNA: the
ultimate parasite. Nature (London) 284: 604.
Pamilo, P. and Nei, M. 1988. Relationships between gene
trees and species trees. Mol. Biol. Evol. 5: 568.
Pan, J., Elder, J.T., Duncan, C.H., Weissman, S.M. 1981.
Structural analysis of interspersed repetitive RNA
polymerase III transcription units in human DNA. Nucleic
Acids Res. 9: 1151.
Parham, P. 1984. A repulsive view of MHC-restriction.
Immunol. Today. 5: 89.
Perez-Stable, C., Ayres, T. M. and Shen, C. K. J. 1984.
Distinctive seguence organization and functional programming
of an Alu repeat promotor. Proc. Natl. Acad. Sci. U. S. A.
81: 5291.
Perkins, D. L., Lai, M.-Z., Smith, J. A., and Gefter, M. L.
1989. Identical peptides recognized by MHC class I- and II-
restricted T cells. J. Exp. Med. 170: 279.
Peterson, P. A., Cunninghan, B. A., Berggard, I., Edelman,
G. M. 1972. 82-microglobulin-A free immunoglobulin domain.
Proc. Natl. Acad. Sci. U. S. A. 69: 1697.
Potts, W. K., Manning, C. J., Peck, A. B., Price-LaFace, M
and Wakeland, E. K. 1988. Can heterozygotes advantage
account for the maintenance of H-2 polymorphism ? In David,
C. S.(ed.), H-2 antigens: Genes. Molecules. Function. pp89-
102, Plenum Press, New York and London.
Potts, W. K. and Wakeland, E. K. 1990. Evolution of
diversity at the major histocompatibility complex. T. I. E.
E. 5: 181.
Pozzo, G. D. & Guardiola, J. 1990. A SINE insertion provides
information on the divergence of the HLA-D0A1 and HLA-D0A2
genes. Immonogenetics 31: 229.
Rabourdin-Combe, C., Mach, B. 1983. Expression of HLA-DR
antigens at the surface of mouse L cells cotransfected with
cloned human genes. Nature (London) 303: 670.
Rautmann, G. and Breatnach, R. 1985. A role for branch
points in splicing in vitro. Nature (London) 315: 430.
Rich, S. S., David, C. S., Rich, R. R. 1979a. Regulatory
mechanisms in cell-mediated immune response VII. Presence of
I-C subregion determinants on mixed leukocyte reaction
suppressor factor. J. Exp. Med. 149: 114.


214
Baxevanis, C. N., Nagy, Z. A., Klein, J. 1981. A novel type
of T-T cell interaction removes the requirement for I-B
region in the H-2 complex. Proc. Natl. Acad. Sci U. S. A.
78: 3809.
Begovich, A. B., and Jones, P. P. 1985. Free la E chain
expression in the recombinant strain A.TFR5.
Immunogenetics. 22: 523.
Benaceraf, B. 1981. Role of MHC gene products in immune
regulation. Science 212: 1229.
Bennaceraf, B., and Germain, R. N. 1978. The immune response
genes of the major histocompatibility complex. Immunological
Reviews 38: 70.
Ben-Nun, A., Glimcher, L. H., Weiss, J., Seidmam, J. G. 1984
1984. Functional expression of a cloned I-A1^ gene in B
lymphoma cells. Science 223: 825.
Benoist, C. 0., Mathis, D. J., Kanter, M. R., William II, V.
E. and McDevitt, H. 0. 1983. Regions of allelic
hypervariability in the murine Aa immune response gene. Cell
34: 169.
Berkower, I., Buckenmeyer, G. K and Berzofsky, J. A. 1986.
Molecular mapping of a histocompatibility-restricted
immunodominant T cell epitope with synthetic and natural
peptides: Implications for T cell antigenic structure. J.
Immunol. 136: 2498.
Bishop, C. E., Boursot, P., Baron, B., Bonhomme, F. and
Hatat, D. 1985. Most classical Mus musculus domesticus
laboratory mouse strains carry a Mus musculus musculus Y
chromosome. Nature (London) 315: 70.
Bjorkman, P. J., Saper, M. A., Samraoui, B., Bennett, W. S.,
Strominger, J. L. & Wiley, D. C. (1987a). Structure of the
human class I histocompatibility antigen, HLA-A2. Nature
(London) 329: 506.
Bjorkman, P. J., Saper, M. A., Samraoui, B., Bennett, W. S.,
Strominger, J. L., and Wiley, D. C. (1987b). The foreign
antigen binding site and T cell recognition regions of class
I histocompatibility antigens. Natured (London) 329: 512.
Bodmer, W. F. 1972. Evolutionary significance of the HL-A
system. Nature (London) 237: 139.


This dissertation is dedicated to
the members of our family as a token
of my appreciation for the love,
support and encouragement they have
provided over the years.


189


208
element does not contain the putative RNA polymerase III
promotor, presumably, the internal RNA polymerase III
promotors contained within both B1 repetitive elements would
cotranscribe adjacent sequence (Rogers 1985) and therefore
spread through the genome via RNA-mediated transposition
(Jagadeeswaran et al. 1981).
Transposition of Middle Repetitive Elements
Preferential Site of Integration
The close similarities in the structure of SINE elements
suggest that they are spread throughout the genome by a common
mechanism (Schmid & Shen 1986). The majority of these SINEs
have a precisely defined 5' terminus and a variable oligo dA-
rich 3' terminus, flanked by terminal direct repeats. It has
been shown that the 5' end of the direct repeats is abundant
in dA residues. Similarly, the 5' flanking region adjacent
to the 5' direct repeat is strongly biased for d(A+T)-rich
sequences. Thus, it was concluded that regions of the genome
that are rich in d(A+T) residues are likely to be preferred
integration sites (Daniels & Deininger 1985). In keeping with
this finding, the B1 repeat found in both lineage 2B and
lineage 3 alleles is found to insert into the region rich in
dA residues (Figure 4-6).
In fact, there are numerous examples of SINEs integrating
adjacent to each other, sharing a set of direct repeats,


Page
Figure 3-1 The genomic restriction map of Abd probe . 98
Figure 3-2 The partial restriction map of Abk and the
sequencing strategy 103
Figure 3-3 The sequences flanking the target site
(GATTCTGATACA) for the "Alu-like"(Bl) element . 107
Figure 3-4 Location of two insertional events in a
lineage 3 allele(Abk) Ill
Figure 3-5 The nucleotide sequence of 539 bp insert . 113
Figure 4-1 Restriction mapping performed by double
digest experiment 116
Figure 4-2 Restriction mapping carried out by double
digest experiment 118
Figure 4-3 Restricion maps of seven lineage 3 Ab
alleles 121
Figure 4-4 Comparison of restriction maps of a
representative lineage 2 and 3 alleles 124
Figure 4-5 The 3735 bp of nucleotide sequence of Abk. 127
Figure 4-6 Partial nucleotide sequence of intron 2
from Abk 130
Figure 4-7 Location of two inserts in a lineage 3(Abk)
allele 132
Figure 4-8 Sequence identity between the retroposon
sequence in linage 2 (Ab6) and 3 (Abk) alleles .... 135
Figure 4-9 Sequence identity among 3 Ab alleles .... 137
Figure 4-10 Sequence alignment among three Bl repeats 139
Figure 4-11 Southern blot experiments with Abd and
235bp non-repetitive element probe 143
Figure 4-12 Blot hybridization experiment with 235 bp
non-repetitive probe 145
Figure 4-13 PCR amplification of DNA samples from 12
species and subspecies of genus Mus 148
ix


45
over in that neither gene gains or loses genetic material.
Classically, it has been studied in allelic genes of fungi due
to the ease of tetrad analysis. However, a growing amount of
evidence suggests its existence in mammalian genomes (reviewed
by Hansen et al. 1984) Analysis of the murine class I
mutants has provided compelling evidence for the occurrence
of gene conversion-like events in Mhc gene. Nathenson and his
coworkers have undertaken the painstaking structural analysis
of a series of mutant Kb molecules (Geliebter et al. 1987)
Four antigenically important regions within the al and a2
domains of Kb molecules are revealed from the analysis.
Alterations in these regions result in the formation of new
epitopes which are detectable by graft rejection in vivo and
CTL in vitro. The result of their analysis suggests that
micro-recombinations between Kb and other class I genes may be
responsible for the generation of diversity of class I gene.
In most, if not all, mutants analyzed, the non-classical H-2
genes, i.e. £a and Tla region gene are identified to be donor
genes that can recombine into and "mutate" H-2 genes. There
is evidence showing that the gene conversion is operating in
H-2 class II genes as well (Mengle-Gaw et al. 1984) A B6.C-
H 2bmi2 12) mouse is Mhc class II Abb mutant, derived by
spontaneous mutation from a (BALB/c x B^ parent. The bml2
mutant and its B6 parent show reciprocal skin graft and two-
way mixed lymphocyte reaction (MLR). Genetic studies and
tryptic peptide mapping studies have concluded that Ab112 gene


212
as evolutionary tags in deciphering the phylogenetic
relationships of these alleles.
The restriction map data, DNA sequence analysis, and
phylogenetic analysis are consistent with the idea that the
Mhc class II genes are evolving in a trans-species mode. Each
lineage of Ab gene, consisting of alleles closely related to
each other, are composed of alleles belonging to different
species and subspecies of genus Mus.


are evolutionarily more closely related to lineage 2 than to
lineage 1. DNA sequence of intron 2 from an evolutionary
lineage 3 allele was determined. The data indicated that
lineage 3 was derived from a lineage 2 allele by two
additional insertional events in the intron 2. One insertion,
composed of Alu-like(Bl) repeat, occurred 508 bp 3' of A/J1
exon. By using the polymerase chain reaction and restriction
analysis, a lineage 2 allele from Mus m. musculus. was
identified to carry that B1 insert, thus defining new lineage,
2B. The other insertion, occurring in the lineage 2
retroposon, starts 1141 bp 31 of the A^ exon. This latter
insertion is 539 bp in length and is composed of Alu-like
repetitive elements and unique sequence. In summary, the
murine Ab genes can be divided into 4 distinct evolutionary
lineages, 1, 2A, 2B, and 3, which are produced by 3
independent retroposon insertions. Lineage 3 alleles were
found in Mus m. musculus and Mus m. domesticus. indicating
that lineage 3 as well as 2A and 2B diverged a minimum of 0.5
millions years ago. These results indicate that all 4
lineages of Ab have persisted through several speciation
events in the genus Mus.
Xll


CHAPTER 6
DISCUSSION
Function of Mhc Genes
The function of Mhc molecules is to present antigen to
T cell receptors on thymus-derived lymphocytes (reviewed by
Klein 1986) T cell responses to antigen have a dual
specificity-one for the protein antigen itself and another
dictated by the allelic form of the Mhc molecules (reviewed
by Schwartz 1985). The molecular basis of this "Mhc-
restricted recognition is explained by the remarkable finding
that Mhc molecules are actually peptide carriers or receptors.
The physical complex of peptide fragments and Mhc molecules
is what interacts with T cell (Buus et al. 1987; Allen et al.
1987). X-ray crystallographic studies of three-dimensional
structure of Mhc class I revealed a putative peptide-binding
groove lined
with the
most
polymorphic
residues
of Mhc
polypeptides
(Bjorkman
et
al. 1987a,
1987b).
These
observations
suggest that the majority
of class
II gene
polymorphisms may dictate the binding specificity of class II
molecules for antigenic peptides.
193


16
many different peptides. It is also noted that some of
conserved amino acid residues are located in the ABS,
suggesting that they may recognize a constant feature of
processed antigens, consistent with the previous suggestions.
Genetic Organization of the I Region
In the past the I region had been divided into five
subregions by serological and functional analysis of
recombinant H-2 haplotypes; these are: I-A. I-B. I-J. I-E and
I-C (Murphy 1981; Klein et al. 1981; Klein et al. 1983). The
subregions are defined by crossover positions in H-2
recombinant strains. However, so far only four I region-
associated (la) products have been identified by both
serological and biochemical analysis (Jones 1977; Uhr et al.
1979). Failure to identify gene products encoded by I-B. I-
J, and I-C subregions was further explained as follows:
I-B subregion
The existence of a separate I-B subregion was initially
proposed by Lieberman and coworkers (1972) to explain the
genetic control of antibody response to a myeloma protein.
The involvement of the I-B subregion was later postulated for
immune responses to at least five other antigens: lactate
dehydrogenase B (LDHB) (Melchers et al. 1973), staphylococcus
nuclease (Lozner et al. 1974), oxazolone (Fachet et al. 1977),
the male-specific antigen (Hurme et al. 1978) and


100
crystalline grade bovine serum albumin/0.5 mM EDTA/0.5 M
NaHPO*, pH 7.2/7% SDS (Church & Gilbert 1984).
Genomic Restriction Mapping
To construct the restriction map, after autoradiography,
the blots were stripped of the genomic Abd probe by washing
in 0.1 x SSC and 0.1% SDS at 80 C for 20 min. and re
hybridized with labeled 5' and 3' regions of Abd probe,
respectively. The fragments obtained from each region of
hybridization were used to orient the restriction sites. All
unique alleles were characterized by double digestion to
confirm the results of restriction mapping by the above
method. In some cases, the fragment sizes were assigned to
either allele in Ab heterozygotes according to restriction
patterns of known alleles. To facilitate comparisons among
different alleles, a prototypical allele, B10.D (d haplotype,
lineage 1), C57BL/10 (b haplotype, lineage 2), B10.BR (k
haplotype, lineage 3), from each lineage was included on each
gel of restriction analysis.
Nucleotide Sequencing
A recombinant plasmid pI-Abk-gpt-l containing the entire
Abk gene plus flanking sequence was kindly supplied by Dr.
Ronald N. Germain. A 9.3 kb Hind III-Eco RI fragment from


99
for 1 hr at 65C shaking water bath to reduce the background.
Subsequently, the membranes are either dried in a 80 C vacuum
oven for 3 hours or at room temperature until further use.
A HindIII-cut Lambda DNA was included on every gel for use as
a molecular-weight standard. Prehybridization and
hybridization of the membranes are carried out as instructed
by manufacturer (AMF, Meriden, CT). The blots were hybridized
with 32P-labeled DNA probe with a specificity of approximately
2 x 108 dpm/ug by primer extension (Bethesda Research
Laboratory, Bethesda, MD) for overnight at 42C.
Nonspecifically bound probe was removed by two successive
washes in 0.1 x SSC/0.1 % SDS at 65 C shaking water bath. The
blots were then exposed to XAR-5 X-ray film (Kodar, Rochester,
NY) using Cronex Lightening-Plus intensifying screens (Dupont,
Wilmington, Delaware). Alternatively, the DNA was blotted to
GeneScreen membrane (Du Pont, NEN Product, Boston, MA). Using
this membrane, the gel was depurinated in 0.25N HC1 for lOmin
and then denatured in 0.2N NaOH, 0.6M NaCl before blotting.
After the DNA was transferred onto the membrane, the membrane
was dipped in 0.4N NaOH for 30-60 seconds to insure the
complete denaturation of DNA. Then, the membrane was
neutralized in 2X SSC adjusted with Tris buffer (PH 6.0) for
30-60 seconds. Subsequently, the DNA was UV cross-linked to
the membrane for 1.5 min. The pre-hybridization and
hybridization was carried out in solution containing 1%


201
indicated that similar or identical H-2 genes can be
identified in both laboratory inbred strains and wild mice.
These observations can be interpreted as evidence that
selective pressures are operating to restrict the polymorphism
of H-2 genes (Wakeland & Nadeau 1980).
Maintenance of Mhc Polymorphism
Although there are numerous mechanisms that could
contribute to the maintenance of polymorphism, only a few are
likely to apply to the Mhc. These are overdominance
selection, high mutation rates, neutrality, frequency
dependent selection, variation in pathogen assemblages across
space and time, mating preferences, and transmission
distortion favoring Mhc heterozygotes. The mutation rate at
the Mhc loci is not particularly high as shown by Hayashida
& Miyata (1983). The allelic frequencies of HLA are too
regular to be compatible with neutrality expectations (Hedrick
& Thomson 1983), and neutrality is too weak a force to account
for the degree of H-2 polymorphisms in local population of
Mus (Potts et al. 1987).
Frequency dependent selection favoring rare alleles is
a more potent mechanism to maintain polymorphism than
heterozygote advantage (Herick 1972). It is theoretically
appealing because the rare Mhc alleles might enjoy an
advantage in the molecular arms race against pathogens (Bodmer


40
activated only by the same combination of foreign and Mhc
molecules (reviewed by Parham 1984). T cells must corecognize
antigen in association with one of these Mhc-encoded molecules
in order for activation to occur. Cytotoxic T cells prefer
class I molecules whereas inducer T cells prefer class II
molecules. However, the relationship between the antigen-
specific and Mhc-specific recognition component of T-cell
receptor remained speculative until the advent of T-cell
cloning. Kappler et al. (1981) fused two T-cell clones with
different specificities and asked whether the antigen- and
Mhc-specific component could segregate independently. A
hybridoma specific for ovalbumin (OVA) in association with the
I-Ak molecules was fused to a normal T-cell line specific for
keyhole limpet hemocyanin (KLH) in the context of I-Af
molecules. The resulting cloned somatic hybrid could be
stimulated to secret interleukin-2 by either original pair of
antigen and la molecule, but not by OVA in association with
I-Af or KLH with I-Ak. These results indicated that T cell
recognition of antigen was dependent on recognition of the la
molecules. The first convincing evidence that indicated that
la molecules and antigen interact with each other during the
T-cell activation process came from the studies of BIO.A mice
immunized with pigeon cytochrome c (Heber-Katz et a. 1982).
In defining the specificity of the response by using different
species of cytochrome c, it was noted that the moth cytochrome
c and its C-terminal fragment always elicited a heteroclitic


221
Hughes, A. and Nei, M. 1989. Nucleotide substitution at
major histocompatibility complex class II loci: Evidence for
overdominant selection. Proc. Natl. Acad. Sci. U. S. A. 86:
958.
Hunig, T. R., Bevan, M. J. 1982. Antigen recognition by
cloned cytotoxic T lymphocytes follows rules predicted by
altered-self hypothesis. J. Exp. Med. 155: 111.
Hurme, M., Chandler, P.R., Heterington, C.M., Simpson, E.
1978. Cytotoxic T-cell responses to H-Y: Correlation with
the rejection of syngeneic male skin grafts. J. Exp. Med.
147: 768
Jagadeeswaran, P., Forget, B. G., and Weissman, S. M., 1981.
Short, interspersed repetitive DNA elements in eukaryotes:
transposable DNA elements generated by reversed
transcription of RNA pol III transcripts? Cell 26: 141.
Janeway, C. A., Bottomly, K., Babich, J., Conrad, P.,
Conzen, S., Jones, B., Kaye, J., Katz, M., McVay, L.,
Murphy, D. B., and Tite, J. 1984. Quantitative variation
in la antigen expression plays a central role in immune
regulation. Immunol. Today. 5: 99.
Jelinek, W.R. and Schmid, C.W. 1982. Repetitive sequences in
eukaryotic DNA and their expression. Ann. Rev. Biochem. 51:
813
Jones, P. 1977. Analysis of H-2 and la molecules by two-
dimensional gel electrophoresis. J. Exp. Med. 146: 1261.
Jones, P. P., Murphy, D. B. and McDevitt, H. 0. 1978. Two
gene control of the expression of a murine la antigen. J.
Exp. Med. 148: 925.
Juretic, A., Nagy, Z. A. and Llein, J. 1981. Detetection of
CML determinants associated with H-2 controlled E£ and Ea
chains. Nature (London) 298: 308.
Kalb, V. F. Glasser, S., King, and Lingrel, J. B. 1983. A
cluster of repetitive elements within a 700 base pair region
in the mouse genome. Nucleic Acids Res. 11: 2177.
Kappler, J. W., Skidmore, B., White, J. and Marrack, P.
1981. Antigen-inducible H-restricted, interleukin-2-
producing T cell hybridoma. Lack of independent antigen and
H-2 recognition. J. Exp. Med. 153: 1198.


217
Devlin, J. J., Wake, C. T., Allen, H., Widera, G., Mellor,
A. L. 1984. The major histocompatibility complex of the
C57BL/10 mouse: Gene organization and function. In Sercarz.
E., Cantor, H. and Chess, L. (eds.), Regulation of the
immune system. (UCLA symposia on Molecular and Cellular
Biology, New Series), vol.18
Doolittle, W. F. Genes in pieces: were they ever together.
1978. Nature (London) 272: 581.
Doolittle, W. F., and Sapienza, C. 1980. Selfish genes, the
phenotype paradigm and genome evolution. Nature (London)
284: 601.
Duncan, W. R., Wakeland, E. K., and Klein, J. 1979.
Heterozygosity of H-2 loci in wild mice. Nature (London) 281
: 603.
Estess, P., Begovich, A. B., Koo, M., Jones, P. P., and
McDevitt, H. O. 1986. Sequence analysis and structure-
function correlations of murine g, k, u, s, and f haplotypes
I-A^ cDNA clones. Proc. Natl. Acad. Sci. USA 83: 3594.
Fachet, J., Ando, I. 1977. Genetic control of contact
sensitivity to oxazolone in inbred, H-2 congenie and intra-
H-2recombinant strains of mice. Eur. J. Immunol. 7: 223.
Fathman, C. G. and Kimoto, M. 1981. Studies utilizing murine
T cell clones: Ir genes, la antigens, and MLR stimulating
determinant. Immunol. Rev. 54: 57.
Felsenstein, J. 1982. Numerical methods for inferring
evolutionary trees. 0. Rev. Biol. 57: 379.
Ferris, S. D., Sage, R. D., Wison A. C. 1982. Evidence from
mt DNA sequence that common laboratory strains of inbred
mice are descended from a single female. Nature (London)
295: 163.
Figueroa, F., Tichy, H., Berry, R. J. and Klein, J. 1986.
Mhc polymorphism in island populations of mice. Curr. Top.
Microbiol. Immunol. 127: 100.
Figueroa, F., Gunther, E., and Klein, J. 1988. MHC
polymorphism pre-dating speciation. Nature (London) 335:
265.
Flavell, R.A., Burkly, L.C., Wake, C., and Widera, G.,
Structure and expression of class II gene of murine MHC, 4th
MHC Clonging Worshop, (Abstr.), 1985a.


Figure 2-4. The location of Mhc class I and class II genes within the
H-2 complex. The solid boxes indicate the positions of individual
genes, the arrows indicate the transcriptional orientation of genes.


105
Polymerase Chain Reaction (PCR) Amplification
Enzymatic Amplification of Genomic DNA
Polymerase chain reactions (PCR) was performed with a
Geneamp kit (Cetus), using the recommended buffer formulas and
modified conditions. Samples were first heat-denatured at 94
C for 1.5 minutes, then cooled down to 0 C. Subsequently,
DNA were subjected to 35 cycles of PCR, each consisting of 1
minute of denaturation at 94 C, 2 minutes of annealing at
62 C, and 3 minutes of polymerization at 72 C with 3 units
of Taq polymerase. A typical PCR reaction consisting of 0.5-
1 ug target DNA resuspended in 100 ul reaction mixture
containing 10 ul of 10X buffer(lOx buffer= 500mM KC1, lOOmM
Tris-Cl, PH8.3, 15mM MgC12, 0.15 (w/v)), 10 ul of dNTPs mix
(2.0mM for each dNTP), 100 pm of each primer, 5 ul of dimethyl
sulfoxide (DMSO) and 3 units of Taq polymerase. Finally, the
reaction mixtures were overlaid with approximately 60 ul of
sterile mineral oil to prevent evaporation. After PCR
amplification One-tenth of reaction mixtures were
electrophoresed in TBE buffer and visualized on ethidium
bromide-stained 4 % Nusieve agarose gel. 5'and 3'
oligonucleotide primers (Figure 3-3) complementary to
conserved regions flanking the 174 bps small insert were used
to amplify 106 H-2 haplotypes in our collection. For
restriction enzyme analysis, the amplified products were


200
association or linkage disequilibrium occurs mainly because
restriction sites and their neighboring genetic loci are
tightly linked (Nei 1987b). During the construction of
phylogenetic tree of Ab genes, 29 informative sites were
uncovered and used for parsimony analysis. Therefore, one
would predict that 229 > 52 x 108 different alleles will be
generated if random combination of restriction sites occurs.
However, our global sampling of mouse H-2 haplotypes came up
with the number much lower than that. Clearly, this is a
strong case of linkage disequilibrium. The surveys of
distribution and frequencies of Mhc class I and class II genes
in natural populations of mouse indicate that H-2 polymorphism
is not as extensive as would be predicted if the diversity of
these gene is unlimited (Wakeland & Nadeau 1980) Studies of
H-2 and allozyme polymorphisms with respect to geographical
and temporal distribution in wild mice have indicated that H^
2 polymorphisms were more uniformly distributed than allozymes
(Nadeau et al. 1988). Taken together, these data indicate
that some alleles are selectively maintained in many
populations as suggested previously (Wakeland & Nadeau 1980).
If the only selective pressure operating on H-2 genes is
random diversification, then natural populations should
contain a virtually unlimited number of H-2 alleles. However,
the analysis of class I and class II genes suggests that they
are present at appreciable frequencies in different natural
populations of mice and are more uniformly distributed than


Ancestral Mus
Lineage 1
Insertion in A@
produces Lineage 2A
Insertion in Lineage 2A
produces Lineage 2B
Insertion in Lineage 2B
produces Lineage 3
Modern
Mus m.dom m.mus m.molo m.cas
sptd
spic
spretus cerv
cooki caroli
plat pahari
H-2 Tested 67 18
4 6 4 12
2 1
2
179


197
insight into the mechanism (s) of generating Ab gene
polymorphism. On the basis of sequence data, PCR enzymatic
amplification and restriction analysis, the Ab genes were
reorganized into four evolutionary lineages, 1, 2A, 2B and 3.
The result of this analysis clearly indicated that four Ab
lineage alleles were derived from three independent successive
retroposon insertions in the intron between A^ and A^2 exons.
Lineage 2B allele was generated from lineage 2A allele by an
insertion of B1 family repeat. Subsequently, another new
family of retroposon, composed of 539 bp of nucleotides,
integrated into a lineage 2B allele, thus generating lineage
3 allele. Lineage 1 alleles are present in all species and
subspecies of genus Mus examined so far, suggesting probably
it is the most ancient lineage of Ab genes. Lineage 2A
alleles are identified in one Asian species, Mus caroli. three
aboriginal species, Mus spicileaus. Mus spretoides. Mus
spretus as well as Mus m. musculus and Mus m. domesticus.
Lineage 2B alleles are only found in M. m. musculus to date.
However, lineage 3 alleles are present in M. m. musculus and
M. m. domesticus. Simultaneously, during the course of Ab
gene evolution, the progenitor alleles thus generated from
retroposon insertion accumulate mutational changes, leading
to the formation of cluster(s) of alleles closely related to
each other.


95
Restriction Enzyme Digestion and Agarose Gel Electrophoresis
Restriction enzymes (Bgl II, BamH I, Eco RI, Hind III,
Pst I, Pvu II, SSt I) were obtained from Bethesda Research
Laboratories (BRL) Restriction enzyme digestions were carried
out for about 18 hr. in a volume of 90 or 180 ul (microliter)
containing 20 ug of DNA and 4 units of enzymes per ug
(microgram) of DNA, under the conditions specified by the
supplier (Bethesda Research Laboratories, Bethesda, Maryland) .
Completeness of digestions was monitored by using Lambda DNA
coincubated with aliquots of the DNA samples. Briefly, 0.5
ug of lambda DNA was added to one-tenth volume of reaction
mixture and at the end of incubation period was
electrophoresed on a agarose gel. Characteristic restriction
patterns of lambda DNA and a homogenous smear of genomic DNA
are indicative of complete digestion. In the case of double
digestion, the digestion was first performed with enzymes
requiring low concentration of salt. After the completeness
of first digestion, the digests were adjusted for the content
of salt, subsequently, the buffer necessary for the second
enzyme and enzyme were added. For convenience, the volume of
double digestion were reduced by alcohol precipitation before
loading into the gel. Briefly, one-tenth volume of 3 M sodium
acetate was added to the digest, subsequently, 2 vol. of 95%
alcohol were added, and stored at -70 C for 30 min. The
precipitate was recovered by spinning at 12,000 x g in


10
whose functions are largely unknown. The class II loci and
a group of unrelated loci including genes coding for
complement components are inserted between two H-2K loci and
the rest of class I loci (Figure 2-1). The class I loci can
be assigned to one of four regions: K, D, Qa and Tla.
depending on their position, this division only in part
reflects the evolutionary relationships among the individual
loci (Klein & Figueroa 1986). Class I transplantation
antigen are found on virtually all nucleated cells of the
mouse. The cell surface antigens encoded in Oa-2.3 and Tla
region can be further distinguished from classical class I
antigen because they are less polymorphic and more limited in
tissue distribution than K or D-encoded antigens (Flaherty et
al. 1980).
Class I gene structure. The exon-intron organization of
class I genes are remarkably similar to each other. Each
class I gene is composed of 8 exons, which correlates
precisely with the domain structure of class I polypeptide
(Figure 2-2) (Steinmetz et al. 1981; Nathenson et al. 1981).
The first exon encodes the leader peptide, the second, third,
and fourth exons encode the al, a2 and a3 domains. The fifth
exon encodes the transmembrane region, and the sixth, seventh,
and eighth exons encode the cytoplasmic domain and 31
untranslated region (Figure 2-2).


230
Sanger, F., Nicklen, S., and Coulson, A. R. 1977. DNA
sequencing with chain terminating inhibitors. Proc. Natl.
Acad. Sci. U. S. A. 74: 5463.
Sant, A. J. and Germain, R. N. 1989. Intracellular
competition for component chains determines class II MHC
cell surface phenotype. Cell 57: 797.
Schmid, C. W., & Deininger, P. L. 1975. Sequence
organization of human genome. Cell 6: 345.
Schmid, C. W. and Jelinek, W. R. 1982. Sequence organization
of human genome. Science 216: 1065.
Schmid, C. W. and Shen, C.-K. J. The evolution of
interspersed repetitive DNA sequences in mammals and other
vertebrates. 1985. In MacIntyre, R. J. (ed): Molecular
Evolutionary Genetics, pp. 323-352, Plenum Press, New York.
Schuler, L. A., Weber, J. L., and Gorski, J. 1983.
Polymorphism near the rat prolactin gene caused by insertion
of an Alu-like element. Nature (Londond) 305: 159.
Sharma, S., Metha, S, Morgan, J. and Maizel, A. 1987.
Molecular cloning and expression of a human B-cell growth
factor gene in Escherichia coli. Science 235: 1489.
Sharp, P. A. 1983. Conversion of RNA to DNA in mammals: Alu-
like elements and pseudogenes. Nature (London) 301: 471.
She, J. X., Bonhomme, F., Boursot, P., Thaler, L. and
Catzeflis, F. 1990a. Molecular phylogenies in the genus
Mus: Comparative analysis of electrophoretic, scnDNA
hybridization and mtDNA RFLP data. Biol. J. Linn. Soc. 41:
83.
She, J. X., Boehme, S., Wang, T. W., Bonhomme, F., and
Wakeland, E. K. 1990b. The generation of MHC class II gene
polymorphism in the genus Mus. Biol. J. Linn. Soc. 41: 141.
Shiroishi, T., Hanzawa, N., Sagai, T., Ishiura, M.,
Gojobori, T., Steinmetz, M., and Moriwaki, K. 1990.
Recombinational hotspot specific to female meiosis in the
mouse major histocompatibility complex. Immunogenetics. 31:
79.
Silver, J., Swain, S. L., Hubert, J. J. 1980. Small subunit
of I-A subregion antigen determines the allospecificity
recognized by monoclonal antibody. Nature (Londlon) 286:
272.


83
least eight other species, including Mus spretus. M.
spretoides. M. spicileaeus. M. cooki. M. cervicolor. M.
pahari. M. platvthrix (Bonhomme et al. 1984; Bonhomme, 1986;
Avner et al. 1988) Mus musculus complex species itself
consists of four main biochemical groups Mus musculus
musculus. Mus musculus domesticus. Mus musculus castaneus. and
Mus musculus bactrianus. all of which are considered as
subspecies.
M. m. domesticus is present in Western Europe, the
Mediterranean basin, Africa, Arabia, Middle East and has been
transported by ship to the New World, Australia and
southeastern Africa, leaving few regions of the earth without
house mice. M. m. musculus occurs in Eastern Europe,
extending to Japan across USSR and North China. M. m.
bacitrianus is distributed from Eastern Europe to Pakistan and
India. The distribution of M. m. castaneus ranges from Ceylon
to South East Asia through the Indo-Malayan archipelago
(Figure 2-13). Even though these four subspecies are quite
biochemically differentiated, they may exchange genes wherever
they come into contact (Bonhomme et al. 1984) One of the
best understood cases is that between M. m. musculus and M.
m. castaneus in Japan (Yonekawa et al. 1986; Yonekawa et al.
1988). The Japanese mouse, M. m. molossinus. has long been
considered an independent subspecies of the house mouse.
However, the restriction enzyme analysis of mitochondrial DNA
(mt DNA) indicated that M. m. molossinus has two main maternal


Ab
Abk
135
Limits: 5190-5789
Limits: 1702-2301
5190
ATAGCCCTGGCTGTCCTGGAACTCACTCGGTAGACCAGGCTGGCCTCGAACTCAGAAATC
i i i i i i l l l l l l l l l I l l I l I l l i i i l i i i l i i i M i i i i i i i i i i M i i i i i M
i i i i i i i l i l l l l l i l i i i i i i i i i i i i i i i i i i M i i i l i i i i i i i i i i i i i i i
ATAGCCCTGGCTGTCCTGGAACTCACTCGGTAGA CA GATGGCCTC AACTCAG AATC
1702
CACCTACCTCTGCCTCCCGAGTGCTGGGAGTAAAGGTGTGCACCACCACTGCCCGGCGAA
l l l l l l l i i i i
i l i l l l l l i l l
i i l l l
i i i i i
l l
i l
III l l l l l i l l l l l l l l l
III III l l l l i l l l ll l l i li
l l
l l l
l l l l l l ll
i i i l l l ll
CACCTGCCTCTGACTCCCAAGAGCTAGGATTAAAGGTGTGCACCATCACCACCCGGCTAA
ACATTTTAATAGATATTTTCTTCATTTACATTTCAAATGCTATCCCAAAAGTCCCCTATA
i i i i i i i i i i i l l l l i i l l l l l l l i i ll i l l i i i i i l i i i l i i i i i i i l l i l l l i i
l l l i i i i l i l i l l l l l l l l l l l l l l l I l l l l l l l i i i i i l i i i l l i i i i l l
i i i l l
ATTTTTTATTAGATATTTTCTTCATTTACATTTCAAATGCTATCCCAAAAGTCCCCTATA
CCCTCCTCCCCCGCACCGCCCTGCTCCCCCTACCCACCCACTCCCACTTTTTGGCCCTAG
mi i
CCCAC
ll l l l i i i i
l l l l l i l l l l l l l l l l l i l
l i i l l i l l l l I i l i l l l i l
l l l
i i i
ll l l l l l l
l I ll i l ll
i
CCACCCTGCT CCCCTACCCACCCACTCCCGCTTCTTGGCCCTGG
CGTTCCCCTGTACTGGGGCATATAAAGTTTACAAGACCAAGGGGCCTCTCTCCCCAATGA
l l l l l l I l l l l l l l l l l l l I I l l l I l l I I
l l l l l I I I I I l I I I I l l l I I I I l I l I I I I I
I l l l I I I
I I I I I I
II I l l l I l I I I l l i i l i l l
I I l l I I I l I I I l I I I I I l l
CATTCCCCTGTACTGGGGCATATAAAGTTTACAAGACCAA GGGCCTCTCTCCCCAATGA
TGGC TGACTAGGCCATCTTCTGCTACATATGCAGCTAGAGACACGAGCT CTGGGGGTA
i l l i i i i i i
i i i i l i l l i
l i
i i
l l l i i l i l i l l l l l l l l i l i
i l ll l l l l l i i i i i l i i i i i
l l i l l i i i i i i l l i l
l l ll l l l i l i l l l i l
i i l i l l
i l l l i i
i i
TGGCTTGACT GGTCATCTTCTGCTACATATGCAACTAGAGACACGAGCTCCTGGGGATA
CTCGTTAGTTCATATTGTTGTTCCACCTATATGGTTGTAGACCCCTTCAGCTCCTTGGGT
l l l l I l l l l l l l l i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i
l i i i l l i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i
TTGATTAGTTTATATTGTTGTTCCACCTATAGAGTTGCAGACCCCTTCAGCTCCTTGGGT
ACTTTCTCTAACTCCTCCATTGGGGGCCCTGTGTTCTATCCTATAGATGACTGTGAGCAT
l l l ll i l i l l i i i i l l l l l l I l i i l l l l i i l l i i i i i i i i i i i i i i i i ii i i i i i i i i i
i i i i i i l i i i i i l l i i i i l l l l l l I i l i i l l l l l l l i l l l i i i i i i i i i i i i i i i i i i i
ACTTTCTCTAACTCCTCCATTGGGGGCCCTGTGTTCCATCCTATAGATGACTGTGAGCAT
CCATTTCTGTATTTGCCAGGCACTGGCATAGCCTCA CAGGGTCC
ill l l l l l l l l l l l l i i i i i i i i i i i i i i i i i l l l l l i l l
Ml i i i i i i i i i i i i i i i i i i i i i i i i i i i i i l i l i l l l i
CCACTTCTGTATTTGCCAGGTA TTGCATAGCCTCACAAGAGACAGTTATATCAGGGTCC
TTTCAGCATAATTTTGCTGGCATATGCAATAGTGTCTGCGTTTGGTGGCTGATTATGGGA
!!!!i i i i i i i i i i ti ti i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i
I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I
TTTCAGCATAATTTTGCTGGCATATGCAATAGTGTCTGCGTTTGGTGGCTGATTATGGGA
TGGATCCCCGGGTGGGGC
I I I I I l I I l l l l i i l l l i
l I l I I I I I l l I I i l l I I I
TGGATCCCCGGGTGGGGC
Matches = 548 Mismatches = 34 Unmatched = 36
Length = 618 Matches/length = 88.7 percent


116
H-2
k
BS
II
81
P
B2
S^B SBE
i i n ii
B
1
S
|
u
U
S
B
s
S B S B E
B
s
u
1
1
i
ii i ir
i
1
1 *-
KKKKUKKKKKKKK U
SPSSSSES
PPBbBBSHHE EBgB9E


222
Kappler, J. W. Wade, T., White, J., Kushnir, E., Blackman,
M., Bill, J., Roehm, N. and Marrack, P. 1987. A T-cell
receptor V£ segment that imparts reactivity to a class II
major histocompatibility complex product. Cell 49: 263.
Kaufman, J. F., Auffray, C., Korman, A. J., Shackelford, D.
A. and Strominger, J. L. 1984. The class II molecules of the
human and murine major histocompatibility complex. Cell 36:
1.
Kelly, F., and Condamine, H. 1982. Tumor viruses and early
mouse embryos. Biochim. Biophvs. Acta. 651: 105.
Kim, J.-H., Yu, C.-Y. Bailey, A., Hardison, R. and Shen, C.-
K. J. 1989. Unique sequence organization and erythroid cell-
specific nuclear factor-binding of mammalian 9 1 globin
promotors. Nucleic Acids Res. 17: 5687.
King, D. P. and Jones, P. P. 1983. Induction of la H-2
antigens on a macrophage cell line by immune interferon. J_-.
Immunol. 131: 315.
King, D., Snider, L. D., and Lingrel, J. 1986. Polymorphism
in an Androgen-Regulated Mouse Gene is the result of the
insertion of a B1 repetitive element into the transcription
unit. Mol. Cell. Biol. 6: 209.
Klein, J. 1975. Biology of the Mouse Histocompatibility
Complex. Berlin: Springer-Verlag, New York.
Klein, J. 1978. H-2 mutations: Their genetics and effect on
immune function. 1978. Adv. Immunol. 26: 55.
Klein, J. 1980. Generation of diversity at MHC loci:
Implication for T-cell receptor repertoires. In Fougereau,
M. and Dausset, J.(eds.), Immunology 80, pp. 239. London,
Academic Press.
Klein, J. 1986. Natural history of major histocompatibility
complex, John Wiley, New York.
Klein, J. 1987. Origin of major histocompatibility complex
polymorphism: The transpecies hypothesis. Human Immunology.
19: 155.
Klein, J., and Figueroa, F. 1981. Polymorphism of the mouse
H-2 loci. Immunol. Rev. 60: 23.
Klein, J., and Figueroa, F. 1986. Evolution of the major
histocompatibility complex. CRC crit. Rev. Immunol. 6: 295.


CHAPTER 2
GENOMIC ORGANIZATION OF MAJOR HISTOCOMPATIBILITY COMPLEX
In the past decade our understanding of the major
histocompatibillity complex has advanced dramatically because
of the application of both monoclonal antibody techniques and
recombinant DNA technology. Biologists are now able to
characterize one of the most fundamental phenomena of
eukaryotic biologythe ability of organisms to discriminate
between self and nonself in molecular terms. Even the most
primitive of metazoa, the sponges, display cell surface
recognition systems capable of discerning and destroying
nonself, probably to maintain the integrity of individuals
surviving in densely populated environments (Hildemann et al.
1981). There are three fundamental features about this
self/nonself recogntion systems cell-surface recognition
structures, effector mechanisms that result in the destruction
of nonself, and a high degree of genetic variability in the
recognition structures (Hood et al. 1983).
In mammalian genetic systems, a chromosomal region termed
the Mhc encodes the self/nonself recognition system with
similar features. Although all vertebrates appear to posses
a homologous Mhc, it has been most extensively studied in
4


57
of asan wild mice (e.g. Mus m. musculus. Mus m. domesticus.
Mus m. castaneus) carry a H-2Kf antigen detected by an
alloantiserum specific for H-2 class I gene (Sagai et al.
1989). H-2Kf antigen is further characterized by a panel of
monoclonal antibodies and restriction enzyme analysis with
a H-2K locus-specific probe for 3' end of H-2K. A
characteristic RFLP pattern was always found to be associated
with a monoclonal antibody reactivity pattern. The
concordance between the presence of antigenic determinant and
a particular RFLP pattern is observed not only in Mus musculus
subspecies, but also in M. spretus. Their results indicated
that the antigenic determinant reactive with monoclonal
antibodies is an ancient polymorphic structure which has
survived speciation in the Mus genus, and is closely
associated with a stable DNA segment at the 3' end of H-2K
gene.
Intra-exonic recombination. A recent study of Mhc class
II Ab genes indicated that another mechanism was mainly
responsible for the genetic diversity of Mhc genes (She et al.
1990b). A panel of 52 different alleles derived from
laboratory inbred mice as well as various species of mice and
rats was analyzed for their A^2 nucleotide sequence.
Examination of the patterns of sequence polymorphisms revealed
that the majority of sequence diversity was localized in five
subdomains. Each of these subdomains have several


31
of which introduced chain caused the phenotypic traits. Ia'
mouse fibroblast L cell lines derived from the original L-cell
line of C3H fibroblasts have been used for a variety of gene
transfer studies. Using cosmid clones containing the complete
DRA and DRB genes, L cells were first demonstrated to express
the class II molecules by Rabourdin-Combe & Mach (1983). No
expression was seen when either DRA gene or DRB gene was
introduced separately. This is consistent with the
suggestion that a:)3 pairing is required for the efficient
cell-surface expression of Mhc class II, although one
recombinant, A.TFR5 (I-Af. Eak) has been suggested to express
a free E, chain on the cell surface (Begovich et al. 1985) .
Their observations were confirmed by studies of Malissen and
coworkers (1984) and Norcross et al. (1985) with mouse class
II genes. In both studies, transfection of either a or /3
chain gene alone failed to lead to the membrane expression,
whereas the cotransfection of the A,,:^ pairs derived from the
same haplotypes (e.g. A^a/, AkA/) resulted in significant
surface expression. These results agree with those obtained
using Ia+ recipient cells, in that the independent transfer of
a or /3 chain genes result in the expression only through
pairing with the endogenous complementary class II gene
products (Ben-Nun et a^. 1984). However, one should be
cautious about the view that a:/3 heterodimers are required for
the surface expression, as most of the monoclonal antibodies
used for the detection of membrane molecules have not been


Evolutionary
Lineage
Pv
2
C57BL/10
B S H
Bg
E P
Pv
bs H Bg
P
3
B10.BR
Pv
B
Pv
Pv
4.6 Kb
3.79 Kb
BS h
B S
1 Kb
124


86
lineages. One lineage is closely related to the mtDNA of the
European subspecies M. m. musculus. the other is closely
related to the mtDNA of the Asiatic subspecies M. m.
castaneus.
The three aboriginal species, namely, M. spretus. M.
spretoid. and M. spicilequs. may be found in sympatry with M.
musculus subspecies. M. spretoides and M. spicilequs probably
represent the best case of sibling species thus far discovered
in mammals. They are very similar morphologically and
biochemically. Yet under the laboratory conditions they can
not interbreed (Bonhomme 1986). The mound-building species,
M, spicilequs. is found in steppe grasslands of the Carpathian
basin and the Ukraine. The distribution of short-tailed M.
spretoides is limited to southeastern Europe and Asia Minor
(mainly eastern Mediterranean). M. spretus is found existent
in the western Mediterranean, from France to Libya (Figure
2-14).
Europe is not the homeland of the genus Mus. All of the
Mus species and subspecies that presently inhabit the
continent seem to have entered it with man (Bonhomme 1986).
Certain members of genus Mus have apparently inhabited India
and Southeast Asia since their origins. Three strictly
oriental species, M. caroli. M. cervicolor. and M. cooki. form
a monophyletic group according to single copy nuclear DNA (sen
DNA) hybridization and mtDNA data. Protein electrophoretic
data also suggest that these three Asian species have
speciated almost simultaneously (She et al. 1990).


Figure 4-9 Sequence identity among among three Ab alleles. Schematic
diagram shows the sequence homology(%) among the respective region of
three prototypic lineage 1 (d), 2 (b) and 3 (k) allele.


196
Mhc Genes Evolve via Trans-species Mode
If Mhc polymorphism arose exclusively after the
initiation of speciation, then one would expect Mhc alleles
in a given species to be more closely related to each other
than they are to those in other species. However, if the Mhc
evolves in a trans-specific manner, some Mhc alleles from one
species would be expected to resemble those from other species
more closely than they do to each other.
A number of studies exploring the genetic diversity of
Mhc class I and II genes indicate that a considerable
proportion of the polymorphisms of contemporary alleles
predated speciation events, i.e. the Mhc genes evolve in a
trans-species manner, and during the course of gene evolution,
they diverge by slowly accumulating point mutations (McConnell
et al. 1988; Figueroa et al. 1988; Lawlor et a. 1988; Mayer
et al. 1988). Previously, McConnell et al (1988) demonstrated
that alleles of Mhc class II Ab gene can be organized into 3
evolutionary lineages based on their genomic structures. The
evolutionary relationship between lineages 1 and 2 is that
lineage 2 alleles are produced from lineage 1 alleles by an
861 bp retroposon insertion in the intron separating A^ and
Ap2 exons. The evolutionary relationships among these
lineages of alleles were first elucidated by determining the
DNA sequence of intron 2 from a lineage 3 allele (k
haplotype). This sequence analysis has provided some unique


151
amplified DNA fragment of approximate 192 bp. Unexpectedly,
MBB II is a lineage 2 allele identified by RFLP, and yet it
apparently contains the 174 bp insert (B1 repeat) in the
corresponding region as lineage 3 alleles does. In fact,
before the PCR experiments were ever completed, the Southern
blot analysis and the restriction mapping already indicated
the unusual SStI restriction fragment of MBBII (2.3 kb vs 2.1
kb) (Figure 4-15 & Table 5-1). To confirm that this lineage
2 allele (MBBII) contains this B1 family repeat, the PCR-
amplified product was isolated and subjected to restriction
enzyme analysis. The results of this restriction analysis are
shown in Figure 4-16. Four DNA samples, k haplotype (lineage
3) d haplotype (lineage 1) MBB, MBS, crucial to this
analysis were included in this experiment. MBB DNA sample was
heterozygous with respect to lineage 1 and lineage 2, and MBS
heterozygous for lineage 1 and 3 (Figure 4-15 & Table 5-1).
A conserved Hie II site ,found in lineage 1 and 2 but not in
lineage 3, would display two bands, 90 bp and 100 bp,
respectively, upon digestion (Figure 3-3). However, the
restriction analysis clearly point to the absence of HInc II
in MBBII allele. Moreover, the Hinf I site conserved in all
three lineages is also identified in MBB II allele as shown
by the production of two fragments, 12 0 bp and 255 bp, in
length upon digestion. Taken together, the findings of this
analysis demonstrate that although MBBII allele belongs to
lineage 2, it does contain the 174 bp insert in the


Figure 4-17. Summary of the evolutionary relationship among four lineage
Ab alleles. Diagram illustrates that the four evolutionary lineages of
Ab genes are generated by three independent successive insertional
events. Blank boxes indicate the exons, the double-hatched boxes
indicate the retroposon (861bp), and the small and large solid boxes
indicate the 175bp and 539 bp insert, respectively.


223
Klein, J., Figueroa, F., and Nagy, Z. A. 1983. Genetics of
the major histocompatibility complex: the final act. Ann.
Rev. Immunol. 1: 119.
Klein, J., Juretic, A., Baxevanis, C. N., and Nagy, Z. A.
1981. The traditional and a new version of the mouse H-2
complex. Nature (London) 291: 455.
Klitz, W., Thomson, G. and Baur, M. P. 1986. Contrasting
evolutionary histories among tightly linked HLA loci. Am. J.
Hum. Genetics. 39: 340.
Kobori, J. A., Sinoto, A., McNicholas, J., Hood, L. 1984.
Molecular characterization of the recombination region of
six murine major histocompatibility complex (MHC) I region
recombinants. J. Mol. Cell. Immunol. 1: 125.
Kominami, R., M. Muramatsu, M., and Moriwaki, K. 1983. A
mouse type 2 Alu Sequence (M2) is mobile in the genome.
Nature (London) 301: 87.
Kramerov, D. A., Grigoryan, A. A., Ryskov, A. P., Georgier,
G. P. 1979. Long double-stranded sequences (ds RNA B) of
nuclear pre-mRNA consist of a few highly abundant classes of
sequences: evidence from DNA cloning experiments. Nucleic
Acids Res. 6: 697.
Krane, D. E., and Hardison, R. C. 1990. Short interspersed
repeats in rabbit DNA can provide functional polyadenylation
signals. Mol. Biol. Evol. 7: 1.
Krayev, A. S., D. A. Kramerov, K. G. Skryabin, A. P. Dyskov,
A. A. Bayev, and G. P. Georgiev. 1980. The nucleotide
sequence of the ubiquitous repetitive DNA sequence B1
complementary to the most abundant class of mouse fold-back
RNA. Nucleic Acids Res. 8: 1201.
Kress, M., Barra, Y., Seidman, J. G., Khoury, G., and Jay,
G. 1984. Functional insertion of an Alu-type 2 (B2 SINE)
repetitive sequence in murinre class I genes. Science 226:
974.
Kronenberg, M., Steinmeta, M., Kobori, T., Kaig, E., Kapp,
J. A., Pierce, C. W., Sorensen, C. M., Suzuki, G., Tada, T.
and Hood, L. 1983. RNA transcipts for I-J polypeptides are
apparently not encoded between the I-A and I-E subregions of
the murine major histocompatibility complex. Proc. Natl.
Acad. Sci. U. S. A. 80: 5074.


65
identified in the Eb hotspot exhibiting significant homology
to the human minisatellite core sequence, and thus may
represent a murine minisatellite (Steinmetz et al. 1987).
Recently, a female-specific recombination hotspot has been
mapped to a 1 kb region of DNA between the Pb and Ob genes
(Shiroishi et al. 1990) This hotspot predominantly occurs
in crosses between Japanese wild mice Mus musculus molossinus
and laboratory haplotypes. Its location overlaps with a sex-
independent hotspot previously identified in the Mus musculus
castaneus CAS3 haplotype. Sequence comparisons between DNA
surrounding this hotspot and corresponding regions from other
strains, including BIO.A, C57BL/10, CAS3 and C57BL/6, revealed
no significant difference. However, sequence analysis of this
Pb/Ob hotspot with a hotspot in Eb indicated that both have
a very similar molecular structure. Each hotspot is composed
of two elements, mouse middle repetitive MT family and the
tetrameric repeated sequence, both are separated by 1 kb of
DNA (Shiroishi et al. 1990).
Definition of Evolutionary Lineage
The evolutionary lineage of Ab was initially defined by
RFLP analysis of 31 Ab alleles from 5 different Mus species
(McConnell et al. 1988). These 31 alleles were ordered into
three distinct lineages based on calculating the fraction of
restriction fragments (F) (Nei & Li 1979) and sites shared
(S) which is used to estimate the genomic sequence divergence


71
Transcription
3'
AAAAA1 w- -AIU
AAAAA ii "i-TTTT-
IfTTTT" AAAA
mbmut
IRapair Synthasis
'


177
different species and subspecies. For example, lineage 2A
alleles, C57BL/10 and SEG1, restriction maps of which resemble
to each other, are found in M. m. domesticus and M. spretus,
respectively. Likewise, MET2 and CRP1, both of which are
lineage 1 alleles, are identified to in M. m. domesticus and
M. cervicolor. indicating that Mhc genes evolve in a trans
species fashion.
Lineage Distribution of Ab Alleles Within the Genus Mus
As the Ab genes derived from different species and
subspecies of genus Mus were classified into evolutionary
lineages (i.e. 1, 2A, 2B and 3), the distribution patterns of
those different lineages of Ab genes in Mus were determined.
Figure 5-2 presents a phylogenetic tree which was built on the
basis of evolutionary relationships of these separate lineages
of Ab genes in various species and subspecies of Mus Several
additional features of trans-species evolution of these Ab
lineages are revealed from this analysis. This study has
expanded the analysis of M. spretus. M. spretoides. M.
spicilegus to include a total of 20 H-2 haplotypes. Ab
alleles from lineages 1 and 2A were found in all three of
these aboriginal mouse species. Ab alleles from both lineages
are present in M. caroli. indicating that alleles in these two
lineages diverged at least 2.5 million year ago. The
emergence of lineage 2B and 3 must be very recent events as


Figure 4-15. A typical RFLP analysis and restriction mapping.
Restriction digested DNAs were hybridized with whole Ab probes as well
as 5' and 3' regions of Ab probes.


75
Recombination
Recombination involving the Alu repeats have resulted in
phenotypic changes. For example, at least two different forms
of globin gene defects occur in a pair of inverted Alu
repeats, which result in a deletion of gene. The LDL receptor
gene has a number of Alu dispersed repeats in its intron, 3'
noncoding region, and flanking region. Five naturally
occurring insertion/deletion mutants of this gene have
produced defective receptors, four of which involve Alu-Alu
recombination (Horsthemke et al. 1987).
Suppression of gene conversion
Examination of regions of globin genes have provided
evidence that SINE can help to limit gene conversion events
(Hess et al. 1983; Schimenti & Duncan 1984) The globin genes
consist of a multigene family whose members start to evolve
after duplication. By limiting the degree of gene conversion,
the SINE sequences may promote gene diversification and the
evolution of new functions(Deininger 1990).
Mobilization of DNA sequence
Several composite SINE families are formed by fusing new
sequences with a SINE to become a functionally-transposing
unit, indicating that SINE has a potential to mobilize other
sequences (reviewed by Weiner et al. 1986). There is one
example of genomic non-repetitive sequence that lay between


209
indicating that they might transpose as a single unit (Roger
1985) What is interesting is that the 539 bp repetitive
elements identified in intron 2 of lineage 3 alleles is
integrated into a B1 family repeat of lineage 2A alleles.
This is consistent with observations made by others (Roger
1985).
Possible Transposition Mechanism
Structural analysis of the 539 bp repetitive element
reveals that it is composed of two Alu-like elements plus some
unique DNA sequences in between. This structural feature
strongly suggests that this combined unit may transpose in a
manner suggested above. The transposition mechanism involved
the transcription of sequence into RNA. This RNA transcript
is initiated from the 5' Alu-like repeat by the internal RNA
polymerase III promotor. Termination occurs at some point 3'
to the second Alu-like sequence as Alu-like repeat does not
contain termination sequence of transcription. The obvious
non-repetitive sequence bound by the flanking 51 and 3' Alu-
like repeats may have been cotranscribed into an RNA
transposition intermediate by readthrough synthesis from the
adjacent Alu-like repeat promotor. The RNA molecule thus made
can be converted into DNA by reverse transcriptase The cDNA
consisting of two Alu-like repeats flanking a non-repetitive
internal fragment could then be inserted into a novel genomic
location. Although both the Alu-like elements involved are


Figure 4-4. Comparison of restriction maps of a representative lineage
2 and 3 alleles. Exons are indicated by empty boxes, filled boxes
illustrate the location of retroposon. This comparison indicates that
the intron size difference between these two lineages is about 0.8 kb.


101
this plasmid was subcloned in PUC 19 (PUC-K-9.3).
Subsequently, both the 1.9 kb Pvu II-Sst I and the 1.7 kb
Sst I fragments (derived from PUC-K-9.3) covering the 5' and
3' portions of intron 2 of Abk gene were subcloned in PUC19,
M13mpl8 and M13mpl9, respectively (Figure 3-2). As the 1.9
kb Pvu II-Sst I fragment cloned into M13 was frequently
deleted for various lengths due to the repetitive elements,
it was cloned into Pbluescript SK(+) and Pbluescript KS(+) as
well. The nucleotide sequences of both 1.9 kb PvuII-SstI and
1.7 kb SstI fragments were determined by Sanger's
dideoxynucleotide termination method in both orientations
using Sequenase (United States Biochemical Corporation,
Cleveland, Ohio) according to manufacture's instruction
without modification. Ambiguities were eliminated either by
substituting dGTP with 7-deaza-dGTP or by using Taq DNA
polymerase (United States Biochemical Corporation, Cleveland,
Ohio), which is performed at elevated temperature (labelling
reaction at 45C, termination reaction at 70C) to eliminate
gel compression.
Data Analysis
RFLP Patterns of Ab Alleles and Their Phylogenetic
Relationships
To investigate the evolutionary relationships of Ab genes
assembled from 12 different Mus species and subspecies, their


Figure 3-2. The partial restriction map of Abk and the sequencing
strategy. The arrows indicated the segment of DNA that were cloned into
PUC 18, M13, PbluescriptSK(+) and PbluescriptKS(+), respectively. The
arrowheads illustrated the size and orientation of nucleotide sequence.
The sequencing was performed by dideoxynucleotide termination method
using universal and synthesized oligomers.


Table 5-1. continued
164
Strain
Pst I
Eco RI
Bam HI
Pvu II
Sst I
Bgl II
Hind III
ZYP I
3.89
5.4
9.0*@
2.89*
7.80
9.2*
6.2
3.1*
2.75@
3.5*
5.5@
1.7
ZYP II
4.8
6.38
7.6@
3.79*
7.3 @
9.0*
8.0@
2.2*
2.75@
2.9*
3.62
9.4
2.0*
1.58
KAR I
3.89
7.2
10.0*
2.89*
4.1*
11.7
6.2*
4.4
1.85
3.8
5.5
0.90
1.7
KAR II
4.8
7.2
7.6
4.2*
7.3@
11.7
8.0
2.3*
4.1*
1.58
4.5*
COK
3.89
6.4
5.4 §
2.89*
5.2@
12.2
6.6
3.6*
2.75@
3.8*
5.5@
2.6*
2.9
1.7
CRV
3.89
9.8
5.4
2.89*
5.2@
12.2
7.0
3.6*
2.75@
4.6*
5.6§
2.6*
2.65
1.7
CRP I
3.89
6.4
5.4@
2.89*
5.2@
12.2
6.6
3.6*
2.75
3.8*
9.0
5.50
2.5*
2.9
2.65
1.7
CRPII
3.89
>10.0
5.4@
2.89*
3.8*
(9.0)
6.6
3.6*
2.75
2.90
5.5@
2.5*
1.7
PAH
3.39
>10.0
9.0@
2.89@
5.20
8.8*
10.8
4.2*
2.75
3.8*
2.2
6.5
PTX
4.14
>10.0
5.4@
5.7*@
5.7@
12.2
6.7*
3.68
3.6*
3.65@
11.7
5.9*
2.5*
3.5*
2.65
1.7
§ indicates restriction fragments that hybridize to 5' region
of Abd probe.
* indicates restriction fragments that hybridize to 3' region
of Abd probe.
indicates restriction fragments that have double dosage.


Figure 2-11. A proposed mechanism for SINE retroposition.
The first step is transcription of the repeated DNA sequence.
The repeat is represented by a heavy line, its flanking
sequence by thinner lines, an the transcript by a wavy line.
Transcription initiates at the beginning of the repeat,
adjacent to the flanking direct repeat (double solid arrows),
continues through the entire repeat, and terminates in
flanking sequence. This transcript is suggested to be capable
of self-priming reverse transcription by priming with its
terminal U residues on the 3' A-rich region of the repeat
transcript. Removal of the RNA will then leave a single-
stranded cDNA copy of the entire repeat with no falanking
sequences. This cDNA must tehn integrate into a genomic site
with staggered nicks. It is hypothesized that an A richness
at the nikc site may interact with the T-rich cDNA end to
stabilized the interaction. Repair synthiesis at the junctions
will then result in formation of a newly integrated repeated
DNA family member with a different flanking direct
repeat(double hollow adrrows). Many of these steps are
hypothetical and a number of alternatives are possible.
Adapted from Deininger (1989).


218
Flavell, R. A., Allen, H., Huber, B., Wake, C. and Widera,
G. 1985b. Organization and expression of the MHC of the
C57Black/10 Mouse. Ixianunoloaical Reviews. 84: 29.
Flaherty, L. 1980. The Tla region antigens. In Dorf, M.
E.(ed.) The role of the major histocompatibility complex in
immunobiology, pp. 33-58, Garland STPM, New York.
Fowlkes, D. M. and Shenk, T. 1980. Transcriptional control
regions of adenovirus VAI RNA gene. Cell. 22:405
Fuhrman, S. A., Deininger, P. L., LaPorte, P., Friedmann, T.
and Geiduschek, E. P. 1981. Analysis of transcription of the
human Alu family ubiquitous repeating elements by eukaryotic
RNA polymerase III. Nucleic Acids Res. 9: 6439.
Fuhrman, S. A., Deininger, P. L., LaPorte, P., Friedmann,
T., & Geiduschek, E. P. 1981. Analysis of transcription of
the human Alu family ubiquitous repeating elements by
eukaryotic RNA polymerse III. Nucleic Acids Res. 9: 6439.
Galli, G., Hofstetter, H., and Birnstiel, M. L. 1981. Two
conserved sequence blocks within eukaryotic tRNA genes are
major promotor elements. Nature (London) 294: 626.
Geliebter, J., Zeff, R. A., Spathis, R., Pfaffenbach, G.,
Nakagawa, M., Mcgue, B., Mashimo, H., Kesari, K., Hemmi, S.,
Hasenkrug, K., Borriello, F., Kumar, P. A. and Nathenson, S.
G. 1987. The anaysis of H-2 mutants: Molecuar genetics and
structure/function relationships. In David, C. S. (ed.), H-
2 Antigens: Genes, molecules, function, pp. 169-176, Plenum
Press, New York and London.
Germain, R. N., Bentley, D. M., and Quill, H. 1985.
Influence of allelic polymorphism on the assembly and
surface expression of class II MHC (la) molecules. Cell 43:
233.
Germain, R.N., Quill, H. 1985. Unexpected expression a
unique mixed-isotype class II MHC molecule by transfected L
cells. Nature (London) 320: 72.
Germain, R. and Malissen, B. 1986. Analysis of the
expression and function of class-II major histocompatibility
complex-encoded molecules by DNA-mediated gene transfer.
Ann. Rev. Immunol. 4: 281.
Gilbert, W. 1978. Why genes in pieces. Nature (London). 271:
501.
Gilbert, W. 1985. Genes-in-pieces revisited. Science 228:
823


234
Walter, P., and Blobel, G. 1982. Signal recognition particle
contains a 7S RNA essential for protein translocation across
the endoplasmic reticulum. Nature (London) 299: 691.
Watkins, D. I., Hodi, F. S., Letvin, N. L. 1988. A primate
sepcies with limited major histocompatibility complex class
I polymorphism. Proc. Natl. Acad. Sci. U. S. A. 85: 7714.
Widera, G. and Flavell, R. A. 1985. The I-region of the
C57BL/10 mouse: characterization and linkae to H-2K of a
novel SB/3-like class II pseudogene A/93. Proc. Natl. Acad.
Sci. U. S. A 82: 5500.
Weiner, A. M., P. L. Deininiger, and A. Efstratiadis. 1986.
Nonviral retroposons: genes, pseudogenes, and transposable
elements generated by the dreversed flow of genetic
information. Annu. Rev. Biochem. 55: 631.
Weiss, E. H., Golden, L., Fahrner, K., Mellor, A. L.,
Devlin, J. J., Bullman, H., Tiddens, H., Bud, H. and
Flavell, R. A. 1984. Organization and evolution of the
class I gene family in the major histocompatibility complex
of the C57BL/10 mouse. Nature (London) 310: 650.
Wilson, S. H. and Kuff, E. D. 1972. A novel DNA polymerase
activity found in association with intracisternal A-type
particles. Proc. Natl. Acad. Sci. U. S. A 69: 1531.
Winoto, A., Steinmetz, M. and Hood, L. 1983. Genetic mapping
in the mouse major histocompatibility complex by restriction
enzyme polymorphisms: most mouse class I genes maps to the
Tla complex. Proc. Natl. Acad. Sci.U. S. A. 80: 3425.
Yamazaki, K., Boyse, E. A., Mike, V., Thaler, H. T.,
Mathieson, B. J., Abbott, Boyse, J. Zayas, Z. A., Thomas,
L. 1976. Control of mating preferences in mice by genes in
the major histocompatibility complex. J. Exp. Med. 144:
1324.
Yokoyama, K., Nathenson, S. G. 1983. Intramolecular
organization of class I H-2 MHC antigens; localization of
the alloantigenic determinants and the 02m binding site to
different regions of the H-2 Kb glycoprotein. J. Immunol.
130: 1419.
Yonekawa, H., Moriwaki, K., Gotoh, O., Miyashita, N.,
Matsushima, Y., Shi, L., Cho, W. S., Zhen, X.-L. and
Tagashira, Y. 1988. Hybrid origin of Japanese mice"
Mus musculus molossinus" Evidence from restriction analysis
of mitochondria DNA. Mol. Biol. Evol. 5: 63.


TGAGCGCGGC GGTCCCGGGA GCGCGCGGGC
TGAGGAGCTG CATGGCCTCC TTCCTCCCGT
GTCTCCCTCC TGTCTCACCT CTGCCCTCTG
CTCTGCCCAT GAGGCCAGCT GCCCTCTGAC
TCAGCGCCAG GGAGGCTAAG CAGGGGAGAG
AGAAGCGGTT TAGCGCGGTA GCTCTGGCGT
CTGATTTCCT CGTGTCCCTT GAGGGCCACG
CGCTAACCCA AAGGCCTCAC TGTAATTTTC
GGGCCACACT AAAAGATTCT GATACAAGCT
GCACTCGGGA GGCAGAGGCA GGTGGATTTC
GAGTTCCAGG ACAGCCAGGG CTATACAGAG
AAACAAAACA AAACAAAACA AAATTCTGAT
AGCACACTCC CCGATACCCC CAGAGCCTCT
TAGGCATCAT ATTCAGATTT AATCTCCTAC
CTTAAGTTTT CCCTTCTTGC TTTCTGGGTG
CCTCACAGCA AGGGAACAGT GATGGCCACC
ACAACCAAAA ACCCAAAAAA CCAACCAAAA
ACAAGTTAAG TATGTATGCT GTTTTCTTCC
CCTTCCTTCC TTTCTTTCTT TTTTTTTTTC
TGTAGCTCTG GCTGTCCTGG AACTCACTTT
CCGACTGCCT CTGCCTCCCA AGTGCTGGGA
TTTAACTTTT AATATCCTCT TTGTCTTAAG
ATGCCCCTGC CTCAGCCTCT CATGCTCTCC
CATAGGTATA TAGTTTAATG TGTTTATTAC
GGCTTCAAGG CCTCCTTCGG CCAATCTGCT
TTTTTTCAAG ACAGGGTTTC TCTGTATAGC
CATGCTGGCC TCCAACTCAG AAATCTGCCT
CATGCGCCAC CATGCCCGGC TACTTAAATT
TTTCGAGACA GGGTTTCTCT GTATAGCCCT
TGGCCTCAAC TCAGAATCCA CCTGCCTCTG
CCATCACCAC CCGGCTAAAT TTTTTATTAG
TCCCAAAAGT CCCCTATACC CACCCACCCT
GCCCTGGCAT TCCCCTGTAC TGGGGCATAT
CAATGATGGC TTGACTGGTC ATCTTCTGCT
CGTGAGGGGA CGCGGAGCAG AGTTCCCGCG
CTGCCCTGCA CCACCTAGCG CCTCCTTGGA
CCCTCTGCCC TCTGCCCTCT GCCCTCTGCC
CCCTGGCTCT GCTGTGACCT CAGGCCCCTG
GGCGCCCGGG TGAGCGGCCA GGGTCGTGTC
CCTGTGGTTT CTCCCCGCCA TTCTGTTTTC
GTTGTCTTGT GAGGGCTGTT TGCTGCCTGG
CTCGTTCTCC GAGGTAGACT GTGTTTACTT
GGGCGTGGTG GGCGCACGCC TTTAATCCCA
TGAGTTCGAG GCCAGCCTGG TCTACAAAGT
AAACCCTGTC TCAAAAGAAC AAACAAAACA
ACAAAATCTG AGGAACTCAT TTTCGTTTCC
CACCCGTCGA TGCCAATTAA AACGGTCGGT
ATTAGGACTA ACGCTTAACT CCAAAGGTTG
GCCTTGTTAT TCAACTGTTC GCAACCGATT
AGGAATTAAT AGTCTTGACT GTGGAGGAAA
CAGTTGTAGA GAGTAGAAAA CAAACATTAA
TTCCTTCCTT CCTTCCTTCC TTCCTTCCTT
TTTTGGGTTT TTCGAGACAG GGTTTCTCTG
GTAGACCAGG CTGGCCTCGA ACTCAGAAAT
TTAAAGGCAT GAACCACCAC GCCCGGCCCC
ATGAGTCCAG GCTGGCCTCC GTTCTCCACA
ACAGCAAAGC CTATATCCTT TTATGTGAAA
CTGCAATGGC TGGGAATGGA ACCCAACCAA
CCCAGTCCCA AGGCTTTTTT TTTTTTTTTT
CCTGGCTATC CTGGAACTCA CTTTGTAGAC
GCCTCTGCCT CCCGAGTGCT GGGATTAAAG
TTTTTGTTTG TTTGTTTGTT TGTCTGTTTG
GGCTGTCCTG GAACTCACTC GGTAGACAGA
ACTCCCAAGA GCTAGGATTA AAGGTGTGCA
ATATTTTCTT CATTTACATT TCAAATGCTA
GCTCCCCTAC CCACCCACTC CCGCTTCTTG
AAAGTTTACA AGACCAAGGG CCTCTCTCCC
ACATATGCAA CTAGAGACAC GAGCTCCTGG
120
240
360
480
600
720
840
960
1080
1200
1320
1440
1560
1680
1800
1920
2040
127


REFERENCE LIST
Allen, P. M., Matsueda, G. R., Evans, R. J., Dunbar, J. B.,
Marshall, G. R., and Unanue, E. R. 1987. Identification of
the T-cell and la contact residues of a T-cell antigenic
epitope. Nature (London) 327: 713.
Alper, C. 1981. Complement and the MHC. In Dorf, M. (ed.),
The Role of the Manor Histocompatibility Complex in
Immunobiology. pp.173-220, Garland STPM, New York.
Anderson, G. D. and David, C. S. 1989. In vivo expression
and function of hybrid la dimers (EA^) in recombinant and
transgenic mice. J. Exp. Med. 170: 1003.
Arden, B., Wakeland, E. K. and Klein, J. Structural
comparisons of serologically indistinguishable H-2K-encoded
antigens from inbred and wild mice. 1980. J. Immunol. 125:
2424.
Arden, B., and Klein, J. 1982. Biochemical comparison of
major histocompatibility complex molecules from different
subspecies of Mus musculus: evidence for trans-specific
evolution of alleles. Proc. Natl. Acad. Sci. U. S. A. 79:
2342.
Avner, P., Amar, L., Dndolo, L., and Guenet, J. L. 1988.
Genetic analysis of the mouse using interspecific crosses.
T. I. G. 4: 18.
Babbitt, B., Allen, P. M., Matsueda, G., Haber, E., Unanue,
E. 1985. Binding of immunogenic peptides to la
histocompatibility molecules. Nature (London) 317: 359.
Baltimore, D. 1981. Gene conversion: some implications for
immunoglobulin genes. Cell 24: 592.
Barsh, G. S., Seeburg, P. H. and Gelinas, R. E. 1983. The
human growth hormone gene family: structure and evolution of
the chromosomal locus. Nucleic Acids Res. 11: 3939.
213


B.
>5.
k CGTGTCCCTTGAGGGCCACGGTTGTCTTGTGAGGGCTGTTTGCTGCCTGGCGCTAACCCA
k AAGGCCTCACTGTAATTTTCCTCGTTCTCCGAGGTAGACTGTGTTTACTTGGGCCACACT
k AAAAGATTCTGATACAAGCTGGGCGTGGTGGCGCACGCCTTTAATCCCAGCACTCGGGAG
Hinfl
k GCAGAGGCAGGTGGATTTCTGAGTTCGAGGCCAGCCTGGTCTACAAAGTGAGTTCCAGGA
k CAGCCAGGGCTATACAGAGAAACCCTGTCTCAAAAGAACAAACAAAACAAAACAAAACAA
k aacaaaacaaaattctgatacaaaatctgaggaactcattttcgtttccagcacactccc
3 <
k CGATACCCCCAGAGCCTCTCA
Amplified sequence length: 375 bp
108


235
Zelnick, C. R., D. J. Burks, and C. H. Duncan. 1987. A
composite transposon 3' to the cow fetal globin gene binds a
sequence specific factor. Nucleic Acids Res. 15: 10437.
Zinkernagel, R. M. and Doherty, P. C. 1974. Immunological
surveilance against altered self components by sensitized T
lymphocytes in lymphocyte choriomeningitis. Nature (London)
251: 547.


59
antigens recognized by either parental Mhc haplotypes, since
Mhc molecules encoded by both Mhc haplotypes are coexpressed
on the surfaces of antigen-presenting cells (Benaceraf &
Germain 1978) Hughes & Nei (1988) examined the pattern of
nucleotide substitution in the region of ABS, involving the
57 polymorphic amino acid residues and other regions of Mhc
class I alleles of both human and mice. Their study is based
on the theoretical prediction that in the presence of
overdominant selection the rate of codon substitution is
increased compared with that for neutral alleles and only
nonsynonymous substitution would be subject to overdominant
selection as synonymous substitutions are more or less neutral
(Maruyama & Nei 1981) This increase in rate of codon
substitution is due to the selective advantage of
heterozygotes carrying the new mutant allele. Their results
indicate that in the ABS the rate of nonsynonymous
substitution is higher than that of synonymous substitution,
whereas in other region the reverse is true. In a later study
(Hughes & Nei 1989), the same type of analysis is extended to
class II Mhc genes. It is concluded that the unusually high
degree of polymorphism at class II Mhc loci is caused mainly
by overdominant selection operating in the ABS. Therefore,
the biological basis of overdominant selection for class II
Mhc loci seems to be similar to that for class I Mhc loci.
A mathematical study of overdominant selection model also
indicates that it can maintain polymorphic allelic lineages


69
All SINEs contain an internal RNA polymerase III split
promotor (Galli et al. 1981). In vitro transcription
experiments have shown that the 5' end of the SINE transcripts
have coincided exactly with the left end of the repeated DNA
sequence. These results have led to the proposal that the
SINEs propagate via RNA-mediated retroposition (Jagadeeswaran
et al. 1982) SINE family members are able to produce in vivo
transcripts, their transcription is regulated in a tissue-
specific manner. The homogeneous size of Alu transcripts
indicates that one or a few identical family members are
transcribed (Watson & Sutfliffe 1987). The transcription of
7SL RNA gene requires a specific 37-bp upstream sequence in
addition to its internal promoter (Ullu & Weiner 1985). Since
the Alu family has evolved from 7SL RNA, its promotor may
similarly depend on such upstream sequences. A critical step
in promoting an efficient SINE retroposition may be mutations
that render the promotor independent of flanking sequence.
However, the established chromatin structure and environment
into which the SINE member is situated may have a regulatory
effect on the transcription of SINE family members. In
transfection assays, it was found that the introduced SINE
member is transcriptionally active in transient assay, but is
silent in long-term transformants. These results also support
the concept that the internal promotor is not sufficient by
itself in vivo (reviewed by Deninger 1990) .


44
Mechanisms generating polymorphism of Mhc genes
Mutation. It is generally believed that ultimate source
of genetic variation is mutation (Nei 1987b). There is no
evidence suggesting that the extensive diversity of Mhc is
generated by high mutation rate (Hayashida & Miyata 1983;
Klein 1987) Serologic typing of class II genes of wild mice
in global populations suggested class II molecules can be
arranged into families of alleles, based on the antigenic
similarity and tryptic peptide fingerprints of I-A molecules
(Wakeland & Klein 1979; Wakeland & Klein 1983). Each family
consists of a cluster of closely related alleles. Tryptic
peptide fingerprinting comparisons of alleles within the same
family revealed that the contemporary Aa and Ab alleles arose
from common ancestors by multiple independent mutational
events (Wakeland & Darby 1983). Furthermore, radiochemical
sequence analysis of structural variants within the family
indicates that these I-A variants have diversified by
accumulating discreet mutations within the al and ¡31 domains
of I-A molecules (Wakeland et al. 1985). Similar conclusions
have been drawn from the studies of human class II molecules
(Gustafsson et al. 1984).
Gene conversion. Gene conversion (hypermutational
mechanism or segmental exchange) is a process whereby the non
reciprocal exchange of genetic information between two genes
occurs (Baltimore 1981). It differs from unequal crossing


00
00


145
S.H S.E P.B S.B E.Bg
I 1 l 1 l 1 l 1 1 1
KUZKUZ UKZKUZKUZ
-4.5
Â¥
m "2.8
235 bp (non-reptitive element)


46
from bml2 mutant differ only 3 nucleotide from its B6 parent
Abb gene. By T cell proliferation assay and monoclonal
antibody-blocking studies, alloreactive T cell clones are
shown to recognize the EakE^b and AabA0bni12. Comparison of
sequences among Abbm12. Abb and Ebb indicates that the bml2 DNA
sequence is identical to the Ebb sequence in the region where
it differs from Abb. Furthermore, this region is flanked by
a stretch of identical DNA sequence between Abb and Ebb. These
results suggest that the bml2 mutation arose by gene
conversion of this region of Ebb into the corresponding region
of Abb. The maximum extent of sequence transfer between Ebb
and Abb is estimated to be 44 nucleotides, but could be as
little as 14 nucleotides. Evidence of segmental exchange has
also been provided by analyzing the exon sequences of eight
Ab alleles (McConnell et al. 1988). In an attempt to analyze
the association between exon and intron sequences, it was
noted that most alleles of exons evolve in association with
their associated intron sequence polymorphisms with the
exception of two alleles, Abb and Abnod (Figure 2-7) These
two alleles appear to be the products of intragenic segmental
exchange (McConnell et al. 1988).


Table 5-1. continued
162
Strain
Pst I
Eco RI
Bam HI
Pvu II
Sst I
Bgl II
Hind
MYL
4.80
6.38
7.6
3.79*
8.3@
9.5
8.0
2.6*
3.69*
7.3@
9.0
7.8*
2.12*
2.750
4.5*
3.620
4.5*
2.0*
3.5*
1.58
MOL
4.80
6.38
7.6
4.83*
7.3@
10.0
8.0
2.6*
2.750
3.8*
3.62@
6.4*
2.12*
1.58
CAS
3.89
5.4
9.0
3.17*
5.6@
11.0@
9.0*
2.5*
2.890
3.7*
2.5
2.3*
1.7
SEI
4.80
6.38
9.7*@
3.79*
5.20
12.6*
8.0@
2.0*
2.75@
4.1*
7.6*
2.1
1.58
SEG I
4.8
6.38
7.6@
3.91*
5.2
12.2*
8.0@
2.2*
2.750
3.5*
3.62
4.5*
2.0*
2.1
1.58
SEG II
4.8
6.38
5.4@
3.79*
4.8
7.6*
7.6@
(same ,
as SPE)
2.6*
2.75@
3.8*
3.5
7.3*
2.06*
1.58
SPE
4.8
6.38
5.4@
3.79*
4.8
9.3*
7.6@
2.6*
2.75@
3.8*
3.5
7.3*
2.06*
1.58
SET I
4.8
6.38
7.6
3.79*
7.3@
12.2
6.3
2.12*
2.75
3.8*
3.62
5.4
2.0*
1.58
SET II
4.8
6.38
5.4
3.79*
5.20
13.0
4.5
4.3*
2.75
3.8*
3.5
2.6*
1.58
SFM I
3.89
(6.40)
9.0*§
2.89*
5.2@
12.2
5.5@
2.6*
2.75@
3.8*
1.7
2.65
SFM II
4.8
6.38
7.6@
3.79*
5.2@
7.0
8.0@
2.12*
2.75@
3.5*
3.62
4.5
2.0*
2.1
1.58


58
polymorphic sequence motifs. On the basis of the hypothetical
three-dimensional structural model of class II molecules
(Brown et al. 1988), these polymorphic sequence motifs are
located in the regions encoding the ABS. With respect to the
whole Afi2 exon, it was found that a specific sequence motif
could associate with several different motifs from other
subdomains to form an allele. This observation indicated that
the diversification of Afi2 exons resulted from intraexonic
recombinations which shuffled these motifs into various
combinations (Wakeland et al. 1990a; She et al. 1990b)
Mechanisms that maintain Mhc polymorphisms
Although a variety of data indicate that Mhc polymorphism
is maintained by some type of balancing selection, the precise
mechanisms involved have remained controversial. Two forms
of balancing selections, overdominance and frequency-dependent
selection, have been proposed to account for the unprecedented
genetic diversity of Mhc genes.
Overdominant selection(heterozygous advantaged. The
maintenance of Mhc polymorphism by overdominant selection was
first proposed by Doherty and Zinkernagel (Doherty &
Zinkernagel 1975). It is based on the well-established
experimental observation that Mhc-1inked responsiveness is a
dominant (or codominant) genetic trait (Benaceraf & Germain
1978). Mhc heterozygotes are capable of responding to any


Table 5-1. continued
168
Strain
Pst I
Eco RI
Bain HI
Pvu II
Sst I
Bgl II
Hind
JERUSALEM4
4.80
6.38
7.6
4.83
7.3
11.0
8.0
2.12
2.75
3.8
3.62
6.6
2.0
1.58
METKOVIC3
4.80
12.0
7.6
3.79
5.2
9.5
8.0
2.12
2.75
3.8
3.62
7.4
2.0
2.1
1.58
tw12
4.80
6.38
9.7
4.83
7.3
13.6
8.0
2.0
2.75
3.8
1.58
7.0
TT6
4.80
6.38
9.7
4.83
7.3
13.6
8.0
2.0
2.75
3.8
1.58
6.6
BRN01
4.80
6.38
7.6
4.83
5.2
11.1
8.0
2.12
2.75
3.8
3.62
7.4
2.0
2.1
1.58
tw71
4.80
6.38
9.7
4.83
7.3
13.6
8.0
2.0
2.75
3.8
1.58
7.0
tw75
4.80
6.38
7.6
3.79
7.3
9.0
8.0
2.12
2.75
3.5
3.62
4.5
2.0
1.58
CADIZ1
4.80
6.38
9.7
3.79
5.2
9.5
8.0
2.38
2.75
3.8
2.1
1.58
3.62
7.3
PANCEVO-b
4.80
6.38
7.6
3.79
7.3
n. d.
8.0
2.92
2.75
2.8
1.58
n.d.idata is not available


Figure 4-2. Restriction mapping carried out by double digest
experiment.


Figure 2-2. Genomic structure of Mhc class I molecules. Black boxes
indicate the exons encoded by protein domains, introns are illustrated
by blank boxes. Shaded area is the 3' untranslated region.


232
Steinmetz, M., and Uematsu, Y. 1987a. The major histocom
patibility complex of the BALB/C mouse: gene organization
and recombination. In David, C. S. (ed.): H-2 Antigens:
Genes, molecules, function, pp. 31-39. Plenum Press, New
York.
Steinmetz, M., Uematsu, Y., and Lindahl K. F. 1987b.
Hotspots of homologous recombination in mammalian genomes.
T. I. G. 3: 7.
Steinmetz, M., Winoto, A., Minard, K. and Hood, L. 1982b.
Cluster of genes encoding mouse transplantation antigens.
Cell 28: 489.
Stephan, D., Sun, H., Fischer Lindahl, K., Meyer, E.,
Hammerling, G., Hood, L., and Steinmetz, M. 1986.
Organization and evoluiton of D region class I genes in the
major histocompatibililty complex. J. Exp. Med. 163: 1227.
Strominger, J. L., Orr, H. T., Parham, P., Ploegh, H. L.,
Mann, D. L. 1980. An evaluation of the significance of
amino-acid sequence homologies in human histocompatibility
antigen (HLA-A and HLA-B) with immunoglobulins and other
proteins, using relative short sequences. Scand. J. Immunol.
11: 573.
Tacchini-Cottier, F. M., and Jones, P. P. 1988. Defective E^
expression in three mouse H-2 haplotypes results from
aberrant RNA splicing. J. Immunol. 141: 3647.
Uematsu, Y,, Kiefer, H., Schulze, R., Fischer Lindahl, K.,
and Steinmetz, M. 1986. Molecular characterization of a
meiotic recombinational hotspot enhancing homologous equal
cross-over. EMBO J. 5: 2123.
Uhr, J.W., Capra, J.D., Citetta, E.S.,Cook, R.G. 1979.
Organization of the immune response genes. Science 206: 292.
Ullu, E., and Weiner, A. M. 1985. Upstream sequences
modulate the internal promotor of the human 7SL RNA gene.
Nature (London) 318: 371.
Unanue, E. R., and Allen, P. M. 1987. The basis for the
immunoregulatory role of macrophages and other accessory
cells. Science 236: 551.
Urba, W. J., Hildemann, W. H. 1978. H-2-linked recessive Ir
gene regulation of high antibody responsiveness to TNP
hapten conjugated to autologous albumin. Immunogenetics 6:
433.


Figure 2-3. Genomic structure of Mhc class II a and ¡3 chains. Black
boxes denote the exons encoded by protein domains. L: leader peptide,
al, at2, pi, >32: extracellular domains, TM: transmembrane region, CY:
cytoplasmic domain, 3'UT:3' untranslated region.


Table 5-1. continued
167
Strain
Pst I
Eco RI
Bam HI
Pvu II
Sst I
Bgl II
Hind
B10.M
4.80
6.38
7.6
4.83
7.3
10
8.0
2.12
2.75
3.8
3.62
6.6
2.0
1.58
B10.WB
4.80
6.38
7.6
4.83
7.3
11
8.0
2.12
2.75
3.8
3.62
6.6
2.0
1.58
B10.S
4.80
17
7.6
3.79
5.2
9.5
8.0
2.12
2.75
3.8
3.62
7.4
2.0
2.1
1.58
B10.STC90
4.80
6.38
9.7
3.79
7.3
9.0
8.0
2.0
2.75
3.8
3.62
4.5
1.58
W12A
4.80
6.38
9.7
3.79
5.2
12.6
8.0
2.0
2.75
3.8
7.4
2.1
1.58
STU
4.8
6.38
9.7
3.79
5.2
12.6
8.0
2.0
2.75
3.8
7.4
2.1
1.58
AZROU1
4.80
6.38
7.6
3.79
7.3
9.0
8.0
2.12
2.75
3.5
3.62
4.5
2.0
1.58
FAIYUM3
4.80
6.38
7.6
3.79
7.3
10.0
8.0
2.12
2.75
3.8
3.62
6.6
2.0
1.58
FAIYUM4
4.80
*6.38
9.7
3.79
5.2
12.6
8.0
2.0
2.75
3.8
7.0
2.1
1.58
FAIYUM5
4.80
*6.38
12.2
3.79
5.2
12.6
8.0
2.12
2.75
3.8
7.0
2.1
1.58
JERUSALEM3
4.80
chk
7.6
3.79
7.3
9.0
8.0
2.12
2.75
3.5
3.62
4.5
2.0
1.58


xml version 1.0 encoding UTF-8
REPORT xmlns http:www.fcla.edudlsmddaitss xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.fcla.edudlsmddaitssdaitssReport.xsd
INGEST IEID EZTG1FGIC_RLXDM6 INGEST_TIME 2014-12-03T19:15:55Z PACKAGE AA00026466_00001
AGREEMENT_INFO ACCOUNT UF PROJECT UFDC
FILES


104
restriction maps were analyzed by parsimony analysis. A
total of 86 Ab alleles, which were obtained separately from
this dissertation, McConnell et al.(1986, 1988), and Ying Ye
are included in this analysis. Restriction site polymorphisms
were used to derive the best fit of the most parsimonious
network that contains the minimum numbers of character state
changes necessary to account for the phylogenetic relationship
among the genes.
Computer Programs
The computer programs used were all from the package
distributed by J. Felsenstein under the name PHYLIP 3.0.
These programs generate phylogenetic trees and many of them
use algorithm that are designed to identify the tree(s) that
incorporate minimal convergent change. However, the programs
used are to some extent dependent on the input order of the
character sets, and subsequently must be run repeatedly with
the set input in a different order. As evolutionary trees
were constructed by the parsimony method, only the most
parsimonious network requiring the minimum number of character
state changes were displayed. It is noted that the
phylogenetic trees constructed by this program is unrooted.
This analysis is based on 41 variable sites recognized by the
7 different restriction enzymes, of which 29 were
phylogenetically informative.


Figure 4-7. Location of two inserts in a typical lineage 3 (Abk) A
comparison between a representative lineage 2 and 3 alleles to indicate
the position of two inserts in lineage 3. Exons are indicated by empty
boxes, double hatched boxes display the retroposon (861 bp) in lineage
2, the two inserts are illustrated by solid boxes.


19
characterized using molecular techniques, the data available
do not lend support for the existence of I-C. Others have
never been able to demonstrate any activity in I-C-defininq
H-2h2 anti H-2hA combination by serological methods, MLR,
graft-versus-host reaction, or cell-mediated lympho-
cytotoxicity (CML) assays (Juretic et al. 1981; Livnat et al.
1973).
Linkage Relationship of Class II Genes
Class II gene loci
Chromosomal walking through the I region by the ordering
of overlapping cosmid clones (Steinmetz et al. 1982a) as well
as genetic mapping of restriction fragment length
polymorphisms (Mathis et al. 1983; Hood et al. 1983), has
allowed the chromosomal localization of the loci encoding the
four functional defined class II genes. A continuous stretch
of about 500 kb of DNA encompassing the I region was first
isolated by screening a BALB/c sperm cosmid library with a
human Mhc class II DRA cDNA probe (Steinmetz et al. 1982a).
This 500 kb region of DNA includes the right end of I region,
as the complement component C4 gene mapping into the S region
, can be identified (Figure 2-1). C4 gene is located a few
hundred kb distal to the Ea gene and was identified by a
synthetic oligonucleotide probe specific for the amino-
terminal of C4a subunit. Five class II genes, Aa, Ab, Eb,
Eb2, and Ea extending over a 90 kb region of DNA, have been


194
Features of Mhc polymorphism
The unusual genetic features of Mhc genes suggest that
novel evolutionary mechanisms must operate on these genes.
Analysis of the unprecedented genetic diversity of Mhc loci
has indicated four important properties of Mhc genes (reviewed
by Potts & Wakeland 1990). First, selective neutrality is
inconsistent with the observations made from population data,
suggesting some forms of balancing selection is operating on
Mhc loci. Second, the population analysis indicate that
selection is operating in contemporary populations and is not
episodic with long intervening periods of neutrality. Third,
diversifying selection is operating directly on the ABS.
Fourth, selection my be strong enough, at least for species
like Mus, to measure directly in population studies. As many
of the polymorphic amino acid residues of class II molecules
occur within the ABS, these allelic molecules may have
different binding properties. Subsequently, these variations
may alter the immune response of individuals to foreign
antigen. Although a wealth of information regarding the
functional and structural properties is currently available,
little is known about the significance of Mhc polymorphism.
The selective forces involved remain elusive (Klitz et al
1986; Potts et al. 1988).


Figure 4-6. Partial nucleotide sequence of intron 2 from Abk. The number
refers to the number of base pairs 3' of A^1 exon. The two inserts are
underlined and shown in bold face, dr: the direct repeats(underlined);
IIA, IIB and III: evolutionary lineage 2A, 2B, and 3.


66
(Table 2-1). Sequence comparisons of lineage 1 (Abd) and
lineage 2 (Abb) alleles indicated that the major DNA sequence
polymorphism between these two lineages occur in the intron
2 between 01 and 02 exons (Figure 2-9) The sequence homology
in this intron is <90%, and Abb gene contains an extra 861 bp
of retroposon, flanked by 13 bp direct repeats
(ATGTATGCTGTTT). The host-derived nature of this direct
repeat sequence indicates that the 861 bp retroposon was
inserted into this position as a random event during the
evolutionary divergence Ab genes. Inspection of genomic
restriction maps of alleles derived from separate Mus species
indicate that the retroposon insertion is characteristic of
lineage 2 alleles (McConnell et al. 1988). These results
indicate the evolutionary lineages defined by RFLP analysis
reflect alleles with different retroposon polymorphisms.
Structure and Evolution of Retroposon
Before cloning of DNA became a major tool of studying
gene structure and function, chromosome renaturation
experiments showed that most organisms possess short stretches
of moderately repeated DNA (mrDNA) separated by longer
sequences of low copy number (Davidson and Britten 1979). For
mammals, most of the mrDNA is composed of retroposons, some
of which are thought to represent mobile genetic elements
using RNA intermediates in their replication (Jagadeeswaran


Figure 2-10. Location of recombinational hotspots (RHS) within the
2 complex. Arrows indicate the specific region of DNA's involved in
recombination. Adapted from Steinmetz et al. (1987b)


Figure 2 6. Recombinatorial association and expression of a chain and
/3 chain of Mhc class II molecules.


Figure 5-1. continued
174
SET I
SETII
SFM II
SMA I
SMA II
ZRU I
ZRU II
ZYD II
ZYP II
B
E
BgPv p
PvBg s
Li
B P
sHPv
S'llf BE
J l
B S H
Bg
B
E
BgPv p
INI
sHPv
B PvBg S
In i
B E
B S H
Bg
BS H
E
BgPv p
I I 1 I
S PvBg S
B P
J
sHPv
B E
B S H
Bg
sHPv
BS BgPv
II II
P PvBg S S
1 Li J^
B
1
E BS H Bg
1 'll II
BS BgPv
II II
E
p S PvBg S
1 1 1 1 1
B P
s'!
"1
HF
'a
I
v
E B S Bg H
III II
BS H BgPv
JJ I LL
E
P PvBg S
J U L
B P
s']
shf
B
l
v
E S B Bg
J U L
SB H BgPv
II 1 II
E
p PvBg S
1 III
B P
L5
*Hf
7b
L
Jv
E B S B9
J 1 1 1
BS H BgPv
U 1 LL
E
P PvBg S
1 III
B P
L
*HPv
e(E B S Bg
i i i
BS H BgPv
JJ 1 LL
E
p PvBg S
1 1 1
B P
s
7 B
I
v
^ b9
E BS
1 II 1
E
BS H Bg p py s
JJ 1 J 1 1 1
B P
--
HF
" B
J
E S H Bg
J u 1
H
KAR II


81
DNA insertion of
Group II intron
Mutation
T
21 A<


180
both are found only in subspecies of M. musculus complex,which
are estimated to diverge at least 0.4 million years ago. It
is worth noting that although lineage 3 alleles are found in
both M. m. musculus and M. m. domesticus. lineage 2B allele
is only found in M. m. musculus. However, as shown before,
lineage 3 alleles are derived from lineage 2B allele. The
failure to identify lineage 2B allele in M. m. domesticus may
indicate that it has been lost from the natural populations,
or may be due to the low number of sampled alleles in our
collection.
On the basis of distribution pattern of individual
lineage of Ab gene, it was concluded that the lineage 1, 2A,
2B and 3 alleles had persisted through at least five, three,
and one speciation events, respectively, during the course of
Ab gene evolution.
Phylogenetic Relationships of 86 Ab Genes in the Genus Mus
Restriction mapping and DNA sequencing enabled us to
determine not only the quantity of DNA sequence variation but
also the nature of this variation. Phylogenetic analysis,
based on the restriction map and sequence data, can provide
a huge amount of information concerning the origins of
different sequence types.
To investigate the phylogenetic relationships among Ab
genes of genus Mus, we analyzed the restriction map data by


Figure 4-13. PCR amplification of DNA samples from 12 species
and subspecies of Mus. H: lambda Hind-digested lambda
markers, P: Pst I-digested lambda markers, Kb: kiolbase
markers, m. dom.: M. m. domesticus. m. mus.: M. m. musculus.
spretus: M. spretus. sptd: M. spretoid. spic: M. spicilegus,
caroli: M. caroli. cooki: M. cooki. cerv: M. cervicolor
cervicolor. cerp: M. cervicolor popeaus. pahari: M. pahari,
plat: M. platyhrix.


LIST OF FIGURES
Page
Figure 2-1 Location of genes in the Mhc of the BALB/c
mouse 8
Figure 2-2 Genomic structures of Mhc class I molecules. 12
Figure 2-3 Genomic structures of Mhc class II a and (3
chain 22
Figure 2-4 Location of Mhc class I and class II genes
within H-2 complex 25
Figure 2-5 A model of the antigen-binding site of the
Mhc class II I-A molecules 29
Figure 2-6 Recombinatorial association and expression
of a and /3 chain of Mhc class II molecules 37
Figure 2-7 Segmental exchange of Mhc class II Ab
genes 48
Figure 2-8 Illustration of the evolutionary origins
of the three lineages of Ab alleles 52
Figure 2-9 Analysis of the sequence homology of
Abd(lineage 1) and Abb(lineage 2) 55
Figure 2-10 Location of Recombinational hot spot(RHS)
within the H-2 complex 64
Figure 2-11 A proposed mechanism for SINE retroposition 71
Figure 2-12 Proposed sequence of events that a group II
intron could mutate into a classical intron .... 81
Figure 2-13 Geographical distribution of four separate
subspecies of Mus musculus complex 85
Figure 2-14 Geographical distribution of four separate
species of genus Mus 88
Figure 2-15 Phylogenetic relationships within the genus
Mus and Rattus 91
viii


Figure 2-7. Segmental exchange of Mhc class II Ab genes. A summary of
the relationships of the sequence polymorphisms in the pi and (32 exons
with the retroposon polymorphism which occur in the intron between them.
Six of eight Ab alleles have exon sequence polymorphisms that are
associated with the retroposon polymorphism. The remaining two alleles
appear to have been produced by intragenic segmental exchange.


PbluescriptSK( + ) and PbluescriptKS ( + ) and for their technical
advice.
My sincere appreciation is extended to Vickie Henson,
Thomas McConnell, Roy Tarnuzzer, Judith Nutkins, Stefen
Boehme, Ivan Chang, Ying Ye, Mary Yu, Karen Wright, Julio Mas,
Kristy Myrisk, Jerome and Xemena for their lively company,
loving support and constant encouragement.
iv


93
Table 3-1. Geographic Origin and Distribution of Mouse Strains
STRAIN
SPECIES
GEOGRAPHIC
ORIGIN
MAI
Mus musculus musculus
Austria
MBB
Mus m. m.
Bulgaria
MBK
Mus m. m.
Bulgaria
MBS
Mus m. m.
Bulgaria
MBT
Mus m. m.
Bulgaria
MDL
Mus m. m.
Denmark
MDS
Mus m. m.
Denmark
MPW
Mus m. m.
Poland
MYL
Mus m. m.
Yugoslavia
MOL
Mus musculus molossinus
Japan
CAS
Mus musculus castaneus
Thailand
SEI
Mus spretus
Spain
SEG
Mus spretus
Spain
SPE
Mus spretus
Spain
SET
Mus spretus
Spain
SFM
Mus spretus
France
SMA
Mus spretus
Monaco
STF
Mus spretus
Tunisia
XBJ
Mus spretoides
Bulgaria
XBS
Mus spretoides
Bulgaria
ZBN
Mus spicilegus
Bulgaria
ZRU
Mus spicilegus
U.S.S.R.
ZYD
Mus spicilegus
Yugoslavia
ZYP
Mus spicilegus
Yugoslavia
KAR
Mus
caroli
Thailand
COK
Mus
cookii
Thailand
CRV
Mus
cervicolor
cervicolor
Thailand
CRP
Mus
cericolor
popaeus
Thailand
PAH
Mus
pahari
Thailand
PTX
Mus
platythrix
India


33
Dispensability of I-E molecules
It has been estimated that some 2 0% of wild mouse
populations do not express I-E molecules (Gotze et al. 1981).
Laboratory inbred mouse strains of b, s, f, and q haplotypes
fail to express serologically detectable I-E molecules (Jones
et al. 1981) The defect in mice of b and s haplotypes is due
to a deficiency of E,, chains; E^ polypeptide is undetectable
in the cytoplasm while the normal amount of cytoplasmic E^
chains can be visualized by 2-D gels (Jones et al. 1981) The
expression defect of these strains can be complemented by
crossing b or s haplotypes with Ea-expressing strains, which
results in normal expression of hybrid I-E molecules in FI
hybrids (Jones et al. 1981) However, neither E nor E* chain
can be detected in cytoplasm of f- and q-haplotype mice,
because of defective processing of both Ea and Eb mRNA (Mathis
et al. 1983; Tacchini-Cottier et al. 1988).
Combinatorial association
L cells have also been used to examine the issue of
allelic control of a:/3 pairing and restriction on cross
isotype a:p assembly. Initial studies by Fathman & Kimoto
(1981) and Silver et al.(1980) suggested that la* cells from
heterozygous individuals contain a mixture of la. molecules
derived from the free assortment of allelic a and /? chains of
a single isotype in all possible combinations. Thus, in (H-
2b x H-2k) Ft mice, one would find A^A^, A^A^, AakA^b and A^A/


Figure 4-16. Restriction analysis of PCR-amplified products.
Letter designationa are as follows: d: lineage 1 (Abd) k:
lineage 3 (Abk) MBB and MBS are heterozygous: lineage 1, 2
and lineage 2, 3, respectively. H: Hind Ill-digested lambda
markers, P: Pst I-digested lambda markers, Kb Ladder: kilobase
markers.


Table 2-1. Definition of 3 Evolutionary Lineages of Ab Alleles by Quantitative RFLP
Analysis
Evolutionary No. of Ab F Values Mus species
Lineage Alleles Within Group Between Group
1
14
0.65
0.15
m. domesticus, m. musculus,
m. castaneus, soicilecrus.
2
14
0.66
0.15
m. domesticus, m. musculus,
soretus, soicilecrus
3
3
0.66
0.13
m. domesticus


133
are retained in lineage 3 allele share 89% sequence identity
with the retroposon sequence of lineage 2 (Figure 4-8) ,
indicating that lineage 3 allele is derived from lineage 2.
The nature of retroposon insertion as shown by the generation
of a direct repeat bordering the inserted sequence
demonstrates again that the lineage 3 allele is generated from
lineage 2. The result of this sequence analysis including
the relative location of various retroposon insertions and the
percentage of nucleotide sequence homology from corresponding
region, is summarized and shown in Figure 4-9.
B1 family repeats in lineage 3 alleles
A comparison of the 174 bp inserted sequence with DNA
sequences from GenBank indicates that it is highly homologous
to the B1 family of Alu-like repeat of rodent (Krayev et al.
1980). It is characterized by an A-rich tract at its 3' end
and contains putative RNA polymerase III promotors as
indicated by box (Figure 4-6 and Figure 4-10). A consensus
RNA pol III promotor sequence compiled by Galli et al. (1981)
from functional tRNA and ribosomal RNA genes is shown on the
top of the box. There are also another two members of B1
family, identified by sequence analysis, at both the left and
the right ends of the large 539 bp insert. However, these two
B1 family repeats do not have terminal direct repeats.
Interestingly, the first 16 residues of left end B1 repeat
also form part of direct repeat flanking this large insert.


163
Table 5-1. continued
Strain
Pst I
ECO RI
Bam HI
Pvu II
Sst I
Bgl II
Hind
SMA I
4.8
6.38
9.7*
3.79*
7.3@
9.0*
8.0*
3.3*
2.75
4.1*
3.62
6.9*
1.58
5.5
3.7
SMA II
4.8
6.38
7.6
3.79*
5.2@
9.0*
2.2*
2.75
3.4*
3.62
2.06*
2.1
1.58
STF I
3.89
5.4
9.0*@
2.89*
5.2§
12.2*
6.2*
2.6*
2.75@
3.8*
5.5@
2.65
1.7
STF II
4.8
6.38
7.6@
3.79*
7.3
9.0*
8.0@
2.12*
2.75@
3.5*
3.62
4.5*
2.0*
1.58
XBJ
3.89
5.40
8.7*
2.89*
7.8@
12.2
6.2
>10.0
4.4
2.75
3.5*
9.0
5.5@
2.4*
2.0*
XBS
3.89
>10.0
9.0*
2.89*
7.8
9.0
6.2
2.0*
2.75
3.5*
5.5@
1.7
ZBN1
3.89
5.4
9.0*
2.89*
7.8@
9.30
6.2*
2.6*
2.75
4.5*
5.5@
1.7
ZRU I
4.8
6.38
7.6
3.79*
7.3@
9.0
8.0
3.1*
2.75@
2.9*
3.62
11
2.12*
1.58
ZRUII
4.8
6.38
7.6
3.79*
7.8
9.0
8.0
3.1*
2.12*
2.75@
4.2*
3.62
10.0
ZYD I
3.89
5.4
9.0
2.89*
7.8
9.2*
6.2*
2.6*
2.75@
4.5*
5.5@
1.7
ZYD II
4.8
6.38
7.6
3.79*
7.3
8.4*

o

CO
2.2*
2.75@
3.6*
3.62
2.0*
1.58


M. a. auaculut
M. a. bactrianua M. a. castancua


1 Kb
B1
103


B10.D2
BS
H P
SPv H
\
1 Kb


Figure 2-9. Analysis of the sequence homology of Abd (lineage 1) and
Abb (lineage 2) Comparison of sequence identity from sequences
available in the Genetic Sequences Data Bank (Genbank). The exons of
each gene are identified by open boxes and labelled on the basis of the
protein domains they encode. The hatched box in Abb represents an 861
bp sequence which was absent in Abd. An expanded version this inserted
sequence is presented below Ab^. The 13 bp host-derived direct
repeatwhich flank the inserted sequence are presented on either side of
the insert. A search for homologies in Genbank with the inserted
sequence revealed that it consisted entirely of short interspersed
nucleotide elements (SINEs). The regions which are homologous to
various SINEs are labelled beneath the insert.


119
Table 4-1
Strain
B10.BR
B10.CHA2
BIO.PL
MDL-2
NZW
DBV2
. RFLP Patterns of Lineage 3 Ab Alleles
Pst I Eco RI Bam HI Pvu II Sst I Bgl II Hind III
15
8.1
4.55
7.8
13
15
2.6
2.75
4.6
2.06
1.7
20
8.4
4.55
7.8
13
15
2.6
2.75
4.6
2.06
1.7
15
5.4
4.55
5.2
13
8.5
2.6
2.75
4.6
7.5
2.06
2.65
1.7
15
8.4
4.55
7.8
13
15
2.6
2.75
4.6
2.06
1.7
15
5.4
4.55
5.2
13
8.5
2.6
2.75
4.6
7.5
2.06
2.65
1.7
15
8.4
4.55
4.6
13
8.5
2.0
1.85
2.65
1.7
7.5
15
8.4
4.55
4.6
13
8.5
2.0
1.85
2.65
7.5
1.7
DFC 2
4.4


206
were identified and used to further dissect the evolutionary
course of Ab genes. On the basis of divergence time estimated
from studies of different species and subspecies of Mus. these
evolutionary tags can be used as a molecular clock to estimate
the time of divergence of different lineages of Ab alleles.
Recently, Pozzo and his coworkers (1990) utilized the presence
of an Alu repeat in the 5' flanking region of D£> genes to
infer the phylogenetic relationship of D0A1 and D0A2. It is
generally accepted that transposition of repetitive elements
is a demonstrated fact over evolutionary times. Yet it is
very difficult, in higher eukaryotes, to demonstrate the
transposition of a family repeat in contemporary populations.
The insertion of Alu-like repeats has been shown to result in
intraspecies polymorphisms within the genus Mus (Kominami et
al. 1983) and Rattus (Schuler et al. 1983) Consistent with
these observations is the finding that lineage 2B allele,
distinguished from lineage 2A by an additional B1 family
repeat, is only found in one subspecies of M. musculus
complex, in contrast to lineage 2A which is found in three
subspecies of M. musculus complex. Likewise, the lineage 3
alleles, derived from lineage 2B alleles by an 539 bp
insertional event, is identified in two subspecies of M.
musculus complex. In summary, the different retroposon
inserts have created both intra- and inter-species
polymorphisms.


SCALE
O
GENES
K2 K
RECOMBINATION AL HOTSPOTS
300 400 500kb
Aj?2 Aj Aa Ej? Eji2Ea
I
A
11
AA A


KAR-1
192


Figure 3-5. The nucleotide sequence of 539 bp insert. Shaded
areas indicate the direct repeats bordering the insert. The
two B1 family repeats at the left and right ends of the insert
are underlined and the central fragment bound by two B1
elements is double underlined. The 5'(GCCCCTTTAACTTTTAATAT)
and 3'(TGCTCCCAGTCCCAAGGCTTT) oligomers used for PCR
amplification is shown by the dash line over the oligomer
sequences. The amplified product is 235 bp long.


207
Retroposons have been found in organisms as diverse as
bacteria and humans. These observations have supported the
view that they are a major evolutionary force contributing to
sequence duplications, dispersions and rearrangements that
maintain the fluidity of eukaryotic genomes. Because
retroposons have generated many families of pseudogenes and
transposable elements that impose no apparent advantage to the
host, it has been proposed that nonviral retroposons could be
thought of as "selfish DNA" that infest that the genome but
barely confer a selective advantage on host (Orgel & Crick
1980; Doolittle & Sapienza 1980).
539 bp Retroposon: a Newly Arisen Repetitive Family
DNA sequence analysis of this 539 bp repeat revealed that
it is composed of a core element of 235 nucleotides, bounded
by two flanking B1 family repeats. A search of GenBank with
the sequence of the core element revealed no homology with
known sequences, suggesting that it is unique. Blot
hybridization experiment using the sequence of core element
as a probe has confirmed this observation. Taken together,
these data indicated that this 539 bp repeat transposed
recently in the evolution of Ab genes. This is consistent
with the fact that the lineage 3 alleles containing this
repeat are found exclusively in M. m. domesticus and M. m.
musculus. The molecular mechansims leading to the dispersal
of this type of retroposon is unclear. Although the core


72
Termination of transcription
Most SINEs do not contain the termination signal for RNA
polymerase III (Fuhrman et al. 1981). Transcription starts
from the 5' end of SINE, runs through the entire repeat, and
terminates at the flanking sequence by chance as the consensus
sequence for termination contains four or more T's in a row
(Bogenhagen et al. 1980). Most in vivo SINE transcripts appear
to be polyadenylated (Deininger 1990).
Reverse transcription
Since the transcripts of SINE family members normally
possess a poly(A) tract, they may be able to self-prime their
reverse transcription (Jagadeeswaran et al. 1981) Moreover,
the RNA polymerase III transcripts should have three or more
U's at their 3* end, which may fold back and prime reverse
transcription (Bogenhagen et al. 1980). Reverse transcription
could also be primed by an intermolecular interaction, for
instance, using the 3*end of another transcript through the
(A)-rich region (VanArsdell et al. 1981). The source of
reverse transcriptase, which must be active in germ line, is
unknown. One possible source is from the intracisternal A
particles (IAP), which produce particles containing reverse
transcriptase (Wilson & Kuff 1972) and are active in early
embryos (Kelly and Condamine 1982) Or it may be provided
during retroviral infections or from endogenous retroviral
sequences (Martin et al. 1981). Small RNA molecules can be


219
Gilbert, W., Marchionni, and McKnight, G. 1986. On the
antiquity of intron. Cell 46: 151.
Goding, J. W. Evidence for linkage of murine 02-
microglobulin to H-3 and Lv-4. 1981. J. Immunol. 126:1644.
Gorer, P.A. 1938. The antigenic basis of tumour
transplantation J. Pathol. Bacteriol. 47:231.
Gorer, P.A., Lyman, S., Snell, G.D. 1948. Studies on the
genetic and antigenic basis of tumour transplantation:
lingkage between a histocompatibility gene and "fused" in
mice. Proc. R. Soc. London. B 135:499.
Gotze, D., ed. 1977. The Major Histocompatibility System in
Man and Animals. Berlin: Springer-Verlag.
Gotze, D., Nadeau, J., Wakeland, E. K., Berry, R. J.,
Bonhomme, F., Egorov, I. K., Hjorth, J. P., Hoogstraal, H.,
Vives, J., Winking, H., and Klein, J. 1980.
Histocompatibility-2 system in wild mice X. Frequencies of
H-2 and la antigens in wild mice from Europe and Africa. J.
Immunol. 124: 2675.
Guenet J. L. 1985. Do non-linked genes really reassort at
random? Ann. Inst. Pasteur Immunol. 136c: 85
Guillet, J. G., Lai, M.-Z., Briner, T. J., Smith, J. A., &
Gefter, M. L. 1986. Interaction of peptide antigens and
class II major histocompatibility complex antigens. Nature
(London) 324: 260.
Gustafsson, K., Wiman, K., Emmoth, E., Larhammar, O., Bohme,
J., Hyldig-Nielsen, J. J., Ronne, H., Peterson, P. and Rask,
L. 1984. Mutations and selection in the generation of class
II histocompatibility antigen polymorphism. EMBO J. 3: 1665.
Hansen, T. H., Spinella, D. G., Lee, D. R., and Shreffler,
D. C. 1984. The immunogenetics of the mouse major
histocompatibility gene complex. Ann. Rev. Genet. 18: 99.
Hayashida, H. and Miyata, T. 1983. Unusual evolutionary
conservation and frequent DNA segment exchange in class I
genes of the major histocompatibility complex. Proc. Natl.
Acad. Sci. U. S. A. 80: 2671.
Haynes, S. R.,and Jelinek, W. R. Low molecular weight RNAs
transcribed in vitro by RNA polymerase III from Alu-type
dispersed repeats in Chinese hamster DNA also found in vivo.
1981. Proc. Natl. Acad. Sci. U. S. A. 78: 6130.


233
VanArsdell, S. W. R. A. Denison, L. B. Bernstein, A. M.
Weiner, T, Manser, and R. F. Gesteland. 1981. Direct repeats
flank three small nuclear RNA pseudogenes in the human
genome. Cell. 11.
Vanin, E. 1984. Processed pseudogenes: characteristica and
evolution. Biochim Biophvs. Acta 782: 231.
Wake, C. T. and Flavell, R. A. 1985. Multiple mechanisms
regulate the expression of murine immune response genes.
Cell. 42: 623.
Wakeland, E. K., Boehme, S., She, J. X. The generation and
maintenance of MHC Class II gene polymorphism in rodents.
1990a. Immunological Rev. 113: 207.
Wakeland, E. K., Boehme, S., She, J. X., Lu, C.-C., Mclndoe,
R. A., Cheng, I., Ye, Y and Potts, W. K. 1990b. Ancestral
polymorphisms of MHC Class II genes: Divergent Allele
Advantage. Immunological Research.
Wakeland, E. and Darby, B. 1983. Recombination and mutation
of class II histocompatibility genes in wild mice. J.
Immunol. 131: 3052.
Wakeland, E. K., Darby, B. and Coligan, J. E. 1985.
Localization of stuctural variations distinguishing I-Ak-
related molecules to the al and /31 domains. J. Immunol. 135:
391.
Wakeland, E. K., Klein, J. 1979. Structural comparisons of
serologically identical IA- and IE-encoded antigens from
inbred and wild mice. Immunogenetics 9: 535.
Wakeland, E. and Klein, J. 1983. Evidence for minor
structural variations of class II genes in wild and inbred
mice. J. Immunol. 130: 1280.
Wakeland, E. K. and J. H. Nadeau. 1980. Immune
responsiveness polymorphism of the major histocompatibility
complex: an interpretation. In Sercarz, E. I and
Cunningham, A. J. (eds.), Strategies of Immune Regulation,
pp. 149-156, Academic Press, New York.
Watson, J. B., and Sutcliffe, J. G. 1987. Primate brain-
specific cytoplasmic transcript of the Alu repeat family.
Mol. Cell. Biol. 7: 3324.
Waltenbaugh, C. 1981. Regulation of immu e response by I-
J gene products. I.Production and characterization of anti-
I-J monoclonal antibodies. J. Exp. Med. 154: 1570.


6
transplantation rejection and T -cell-mediated cytotoxic
killing. Class II molecules serve as restriction elements
during the presentation and processing of foreign antigen to
regulate the immune response. Certain complement components,
e.g. C3 and C4, are encoded by class III genes within the Mhc
complex. However, no significant homology can be shown
between Mhc genes and complement genes, and although the C4
genes is closely linked to Mhc in many species, the C3 genes
are only loosely linked to some species, but not in other
species (Alper 1981). Klein et al. (1983) have argued against
the inclusion of the complement genes as a class of Mhc genes.
Organization of Mouse Mhc
The H-2 complex of the laboratory mouse is the only Mhc
in which nearly all of the loci have been identified and
their position determined. For example, the molecular map of
Mhc genes of C57BL/10 (Weiss et al. 1984) and BALB/c
(Steinmetz et al. 1982a; Winoto et al. 1983) haplotypes have
been extensively characterized. From the centromeric part of
the Mhc of the BALB/c mouse, a 600 Kb segment cluster has been
cloned containing two class I (K and K2) and seven class II
genes (Pb(A^3) to Ea) (Steinmetz et al. 1986) (Figure 2-1) .


67
et al. 1981). These mrDNA belong to different sequence
families in different mammalian orders(reviewed by Rogers
1985). The majority of mammalian interspersed repeated DNA
falls into two families, referred to as short and long
interspersed nucleotide elements, SINEs and LINES,
respectively (Singer 1982). The "generic SINE sequence
contains an internal RNA polymerase III promoter, an A-rich
3'end and flanking direct repeats. The size of SINEs
typically range from 75 to as much as 500 bp in length. All
nonviral retroposons correspond to a partial or complete DNA
copy of a cellular RNA species. With a few exceptions,
nonviral retroposons are derived from fully processed RNAs
(reviewed by Weiner et al. 1986).
Structure of Alu and "Alu-like" Family
The first well-characterized and the most abundant
repeated DNA family in primates is the Alu family which
constitute most of the dispersed, repeated DNA (Houck et al.
1979). The 500,000 Alu elements in the human constitute 5-6%
of the genome by size, occurring on average every 5-9 kb and
differing on average by 13% from the consensus sequences
(Schmid & Jelinek 1982; Rinehart et al. 1981). Other SINE
families are referred to as "Alu-like" or "Alu-equivalent"
families. Mice, rats, and hamsters all contain two abundant
"Alu-like" families, B1 and B2 (Kramerove et al. 1979; Krayev
et al. 1980; Haynes et al. 1981). The Alu elements,


79
also indicated that in vivo self-splicing depends on so-
called maturase, some of which are encoded by the intron
themselves. All characterized maturase function only in
splicing the intron in which they are encoded or closely
related intron. It has been proposed that the nuclear pre-
mRNA intron have evolved from self-inserted group II intron
(Roger 1989) (Figure 2-12). Once an intron is inserted, it
might take only a single base change to convert the group II
intron into classical intron. Now both types of introns have
similar consensus sequences.
Wild Mice As a Useful Genetic Tool
Part of the goal of this dissertation is to determine the
distribution of evolutionary lineages of the class II Ab gene
in the genus Mus and to determine how long these lineages have
persisted in Mus during the evolution of Ab genes. Previous
studies of the evolution of Mhc class II genes were limited
in the number of species examined and limited in the number
of strains tested. In this dissertation, we have extended
the previous study by including twelve species and subspecies
of genus Mus and the 115 H-2 haplotypes extracted from them.
The "house mouse", has become the most studied animal of
laboratory research probably because its habitat is closest
to that of man. It has been known for some time that the
major laboratory inbred strains are derived from common


Figure 4-1. Restriction mapping performed by double digest
experiment. The restriction analysis of closely related
alleles was compared side by side.


42
demonstrated that hen egg lysozyme (HEL) 46-61 [HEL(46-61)]
bound to IAk. but not to I-Ad. This binding study correlated
with the finding that T cells specific for HEL (46-61) from
high responder H-2k mice are restricted by I-Ak whereas
2.d mice are low responders. These results demonstrated a
correlation between immunogenic peptide-la interaction and Mhc
restriction (Babbitt et al. 1985). Furthermore, it was shown
that the failure of pigeon cytochrome c to be recognized in
the context of the hybrid I-E molecule was due to the fact
that hybrid I-E molecule was unable to interact with pigeon
cytochrome c-derived synthetic peptides (Buus et al. 1987).
Each Mhc molecule binds many different peptides, using a
single binding site and probably through the recognition of
broadly defined motifs (Buus et al. 1987). This concept of
single antigen binding site is compatible with the recently
described X-ray crystallographic structure of human class I
molecules (Bjorkman et al. 1987a, 1987b).
Genetic Polymorphism of Mhc Genes
There are five distinguishing features of H-2 polymorphism
in wild mice that have been the subject of considerable
investigation. 1) there is a large number of alleles encoded
by each genetic locus. The most polymorphic genetic loci
known in the mouse are located within the H-2 complex.
Although at least 50 alleles have been detected for the H-2K
and for the H-2D genes, it is estimated that at least 100


Lineage Alleles
B1
1
d,p,q,r,v
H EHPv S H
H E S B9
2A b,s,fj J LjLn
H
2B
MBB 2
B2
HE B S
t4-b
i
861 bp retroposon
insertion
BS
175 bp "Alu-like"(B 1)
Y insertion
SB H E Pv
f
539 bp retroposon
insertion/deletion
158


227
Murphy, D. B. 1978. The I-J subregion of the murine H-2
gene complex. Springer Sem. Immunopathol. 1: 111.
Murphy, D. B. 1981. Genetic fine structure of the H-2 gene
complex. In Dorf, M. E. (ed.) The Role of the Major
Histocompatibility Complex in Immunobiology. Garland STPM,
New York.
Murphy, D.B., Herzenberg, L. A., Okumura, K., Herzenberg, L.
A., McDevitt, H. 0. 1976. A new I subregion (I-J) marked by
a locus (la-4) controlling surface determinants on
suppressor T lymphocytes. J. Exp. Med. 144: 699.
Nadeau, J. H., Wakeland, E. K., Gotze, D. and Klein J. 1981.
The population genetics of the H-2 polymorphism in European
and North African populations of the house mouse (Mus
musculus L.) Genet. Res. 37: 17.
Nakamura, M., Manser, T., Pearson, G. D. N., Daley, M. J.,
Gefter, M. L. 1984. Effect of IFN-gamma on the immune
response in vivo and on gene expression in vitro. Nature
(London) 307: 381.
Nathenson, S. G., Uehara, H., Errenstein, B. M., Kindt, T.
J., Coligan, J. E. 1981. Primary structural analysis of the
transplantation antigens of the murine H-2 major
histocompatibility complex. Ann. Rev. Biochem. 50: 1025.
Nei, M., Li, W.-H. 1979. Mathematical model for studying
genetic variation in terms of restriction endonucleases.
Proc. Natl. Acad. Sci. USA. 76: 5269.
Nei, M. 1987a. In Molecular Evolutionary Genetics. Columbia
University Press, New York.
Nei, M. 1987b. Relative roles of mutation and selection in
the maintenance of genetic variability. Phil. Trans. R.
Soc. Lond. B319: 615.
Ng, R., Domdey, H., Lorson, G., Rossi, J. J., and Abelson,
J. 1985. A test for intron function in the yeast actin gene.
Nature (London) 314: 183.
Norcross, M. A., Raghupathy, R., Strominger, J. L., Germain,
R. N. 1986. Transfected human B lymphoblastoid cells express
the mouse A^-chain in association with DR,. J. Immunol 137:
1714.
Okuda, K., David, C. S. 1978. A new lymphocyte-activating
determinant locus expressed on T cells, and mapping in I-C
subregions. J. Exp. Med. 147: 1028.


Figure 2-15. Phylogentic relationships within the genus Mus and Rattus.
Adapted from She et al. (1990a).


38
both for the level mRNA expression produced by transfected
genes and for their expression of inter- and intra-dimer at
the surface. In three gene transfection system (e.g., Ab, Ea,
and Eb) it was found that isotype-matched E^E^ dimer was
expressed at 3-5 times the efficiency of the isotype-
mismatched EA^ dimer based on the amounts of each /3 chain
required to drive cell surface expression for the limited
amount of E^. When A,, and E*, were compared their coexpression
with relative excess hpr the efficiency advantage of isotype-
matched (A,, Ap) versus isotype-mismatched (E^A^) is about 3 to
4 fold. Additional experiments employing transfectants
expressing Abd, Aad. Ebd. and Ea showed that in clones
expressing mRNA ratios similar to B cells, only the isotype-
matched dimers were expressed. In clones that expressed high
levels of Apd, in addition to isotype-matched h/h/' and e/e/,
there was a significant amount of E^Apd at the cell surface.
These data indicate that the asymmetry chain production in
individual chain levels can lead to the expression of less
favored isotype-mismatched dimers. In a recent report,
recombinant mouse strains and transgenic mice with defective
Eb genes, but with normal Ea genes, were examined for surface
expression of E molecules (Anderson & David 1989) E^,
molecules were shown to be expressed in B10.RFB2 (Abf, Aaf,
Ebf, Eak) and B10.RQB3 (Abq. Aaq. Ebq, Eak) by cell surface
staining with anti-E^ monoclonal antibody (14-4-4) in flow
cytometry analysis. It has been proposed that these


76
two artiodactyl SINEs retroposed with them as a unit,
resulting in the duplication within the cow haploid genome
(Zelnick et al. 1987).
In vitro transfection experiments also indicated that
SINEs might repress or activate transcription initiated by
adjacent RNA polymerase II promotor (McKinnon et al. 1986).
Another function conferred by certain SINEs is to encode
portion of polypeptides. Alu dispersed repeats constitute for
32 codons of 3' portion of genes for decay-accelerating factor
and for a B-cell growth factor (Caras et al. 1987; Sharma et
al. 1987). The CCAAT box of the 0-globin gene in primates is
part of an Alu repeat sequence (Kim et al. 1989). Some SINEs
are found in the 31 noncoding exons and provided
polyadenylation signal (Krane & Hardison. 1990). Thus,
functional sequences provided by SINE include promotor, RNA
processing and protein-coding sequences.
Evolution of Introns
Mammalian genes are discontinuous, broken up along the
DNA into alternating regions: coding sequence or exons, which
are interspaced with other noncoding sequences or introns that
will be spliced out of the primary transcript. An intriguing
question regarding the introns is what advantages or functions
are provided to the cell by them. There has been ample
speculation about the origin and maintenance of introns in


Figure 4-5. The 3735 bp of nucleotide sequence of Abk. The sequence
determined spans from the first base 3 of ¡31 exon across transmembrane
and ends at Sst I site.


78
that the introns of nuclear protein-coding genes were also
capable of replicative transposition at some stage in their
evolutionary history. Hickey & Benkel (1986) have suggested
a model to account for the evolutionary origin of introns.
The main points of this model are summarized as follows: (i)
Most present day introns are the relics of retrotransposons;
(ii) copies of transposable sequence were contained within the
RNA primary transcript; (iii) RNA splicing activity encoded
by the transposable elements processed the transcripts into
exon and intron sequences; (iv) the exons were then available
for translated into gene product; (v) the spliced intron were
able to be reversed-transcribed into DNA and reinserted into
else where in the genome. Although Doolittle (1978) argued
that the de novo insertion of introns into functional genes
would disrupt normal gene expression and thus would be
strongly selected against at the organismic level, it was
proposed that the RNA splicing might function solely to
counteract the potential negative effect of introns (Hickey
& Benkel 1986). A common property shared by all introns is
their removal from primary transcripts by splicing. Numerous
evidences have indicated that the splicing activity is
controlled by introns themselves. For instances, some fungal
mitochondrial group I and II introns can undergo self-splicing
which depends on the structure of RNA transcripts and can
propagate themselves by insertion into genes (reviewed by
Lambowitz 1989). Genetic analysis of mitochondrial system


224
Krupen, K., Araneo, B. A., Brink, L., Kapp, J. A., Stein,
S., Wieder, K. J. and Webb, D. R. 1982. Purification and
characterization of a monoclonal T-Cell suppressor factor
specific for polyiLGlu60 LAla30 LTyr10) Proc. Natl. Acad. Sci.
U. S. A. 79: 1254.
Lafuse, W. and David, C. S. 1988. Recombination sites within
the I region of the mouse H-2 complex. In David, C. S.
(ed.), H-2 Antigens: Genes, molecules, function, pp. 41-47,
Plenum Press, New York.
Lambowitz, A. M. 1989. Infectious introns. Cell 56: 323.
Larhammar, D., Hammerling, U., Denaro, M., Lund, T.,
Flavell, R. A., Rask, L., and Peterson, P. A. 1983.
Structure of the murine immune response I-A* locus: sequence
of the I-A* gene and an adjacent /?-chain second domain exon.
Cell. 34: 179.
Lawlor, D. A., Ward, F. E., Ennis, P. D., Jackson, A. P. and
Parham, P. 1988. HLA-A and B polymorphisms predate the
divergence of humans and chimpanzees. 1988. Nature (London)
335: 268.
Lehrman, M. A., Goldstein, J. L., Russel, D. W. and Brown,
M. S. 1987. Duplication of seven exons in LDL receptor gene
casued by Alu-Alu recombination in a subject with familial
hypercholesterolemia. Cell 48: 827.
Lieberman, R., Paul, W.E., Humphrey, W.Jr., Stimpfing, J.H.
1972. H-2-linked immune response (Ir) genes.Independent loci
for Ir-IgG and Ir-IgA genes. J. Exp. Med. 136: 1231.
Lindahl, K. F. 1986. Genetic variants of histocompatibility
antigens from wild mice. In Potter, M., Nadeau, J. H. and
Cancro, M. P. (eds.) The Wild Mouse in Immunology. Curr.
Top. Microbiol. Immunol. 127: 272.
Linial, M., Medeiros, E. and Hayward, W. S. 1978. An avian
oncovirus mutant (SE21Q16) deficient in gonomic RNA:
biological and biochemical characterization. Cell 15: 1371.
Livnat, S., Llein, J., Bach, F.H. 1973. Graft versus host
reaction in strains of mice identical for H-2K and H-2D
antigens. Nature (London) 243: 42.
Lozner, E.C., Sachs, D.H., Shearer, G.M. 1974. Genetic
control of the immune response to staphylococcal nuclease.
I. Ir-Nase: Control of the antibody response to nuclease by
the Ir region of the mouse H-2 complex. J. Exp. Med. 139:
1204.


161
Table 5-1. RFLP Patterns of Ab Alleles From 12 Species and
Subspecies of Genus Mus.
Strain
Pst I
EcoRI
BamHI
Pvu II
Sac I
Bgl II
Hind
MAI
4.80
>12.0
7.6
2.12*
2.0*
3.79*
2.750
5.20
3.5*
2.1
1.58
9.0*
3.620
8.0@
4.5*
MBB-1
3.89
>12.0
9.0*
2.6*
2.89*
2.75@
5.26
3.8*
2.65
12.2@
5.50
1.8
MBB-2
4.80
6.38
7.6@
2.12*
4.83*
2.75@
6.7@
4.6*
2.3
1.8
13.60
8.6@
7.2*
MBK
3.89
5.4
9.0*
2.6*
2.89*
2.750
7.8@
3.8*
12.20
6.2*
5.5@
1.7
MBS-1
(same
3.89
as MBK)
5.4
9.0*
2.6*
2.89*
2.75@
7.80
3.8*
12.20
6.2*
5.5@
1.7
MBS-2
4.80
6.38
7.6
2.12*
3.79*
2.75@
5.20
3.8*
2.1
1.58
12.2
3.62@
8.0@
6.6*
MBT
4.80
6.38
7.6
2.6*
2.06*
3.59*
2.65@
7.3@
4.5*
1.58
9.2
3.62@
8.0*0
MDL I
4.80
6.38
7.6
2.12*
2.0*
3.79*
2.75@
7.3@
3.5*
1.58
9.0
3.620
8.0
4.5*
MDL II
4.40
>12
8.4
2.6*
2.06*
4.6*
2.75@
7.8@
4.6*
1.7
13.0@
15.0*
MDS
4.80
6.38
7.6
2.6*
2.12*
4.83*
2.75@
7.3@
3.8*
10.0
3.62@
1.58
8.6*
8.0
MPW
4.80
6.38
7.6
2.6*
2.12*
4.83*
2.750
5.2@
3.8*
2.1
1.58
12.2
3.62@
8.0
6.4*


204
enhancing the diversity is indicated by the fact that the rate
of nonsynonymous substitutions in the ABS is higher than would
be expected if the substitutions are neutral. In the rest of
molecule, nonsynonymous substitutions are lower than expected,
indicating the negative selection is acting on the
corresponding portions of the genes. Positive selection may
act via heterozygous advantage (overdominant selection) in
which the superior ability of Mhc heterozygotes to bind and
present antigen will enhance their resistance to infectious
diseases ,thus increasing their relative fitness in the
population. Overdominant selection is also known to enhance
the rate of amino acid substitution and increase the
heterozygosity and persistence of polymorphic alleles
enormously compared with those of neutral alleles (Maruyama
& Nei 1981; Nei 1987b). The conservation of evolutionary
lineages over long periods can also be explained by assuming
that positive selection has been acting on the functional Mhc
genes through overdominant selection.
Divergent Allele Advantage
Although overdominant selection alone may explain the
number of Mhc alleles prevalent in natural populations and the
retention of ancestral polymorphisms, the extensive sequence
diversity between alleles in A^ exons indicates that another
selective mechanism specifically enhancing diversification
must also be operative (Wakeland et al. 1990a). This type of


ACKNOWLEDGEMENTS
The intellectual environment provided by Dr. Edward K.
Wakeland has been the single most important factor in the
enrichment of my evolution as a researcher; to him I am deeply
indebted. It is my privilege to express my sincere gratitude
to him for his patient guidance as well as constant infusion
of encouragement and inspiration, and for allowing me to
exercise thoughtful freedom to proceed with this work.
I thank the members of my supervisory committee, Drs.
Kuo-Jang Kao, Harry S. Nick, Ammon B. Peck and William E.
Winter, for their advice and assistance throughout. The timely
help and attention of my colleague Richard Mclndoe during the
preparation of the present work needs a special mention.
I acknowledge Drs. Wayne Potts, Murali, Jin-Xion She and
William Wang for their technical help and guidance.
I would like to thank the people in the department for
what they have done and provided for me to make the completion
and success of my graduate study possible.
My appreciation is extended to Dr. Linda Smith for her
friendship and hospitality through the years.
My sincere thanks are extended to Dr. Ahmad N. Ali and
Charles C. Brown for providing free cloning vector,
iii


Figure 5-1. continued
173
BS H Bcpv
C57BL/10I II II
E
P PvBg S
oLl^
B P
ni
ShPv
/ BE B S H Bg
i lilt] III 1
BS H B MAI JJ I M I | M L
B P
M
J
SHPv
' E B S H Bg
Jm i i L
SB H B MBBII | I | ||
E
P S Pv S
I I lg I
B P
N
Sh
' BE
1 1
9V
s g
i 11
w
1 Kb
BS H Bcpv
MBS II MI ||
E
p s P>Bgs
i lili
B P
S
Sh f
>v
S H B
1
BS H Bcpv
MBT i,, ||
E
P PvBg S
I III
3 P^
s
9V
E B S Bg
I 1 1 L
BS H Bcpv
MDS MI ||
E
' P PvBg S
I III
B P
M
sh f
'be
i i
>v
B S Bg H
II II
BS H Bcpv
MPW U I I I
E
p s P'Bgs
i lili
B P
M
sh f
' BE
1 1
Jv
B S H B
LJ 1
BS H Bcpvi
MYLI | | | ||
E
P PvBg s
I III
B P
M
HPv
E B S H Bg
JL i i i i
Bcpv
MYLII | | |
E
P PvBg S
I III
B P
M
SHI
'b
1
9v
E B s b9h
1 II II
BS H Bcpv
mol 111 II
E
P PvBg S
I I I I
p
L5
fH P
fe
V
B S H Bg
L 1 1 1
BS H Pv
SEI III I
E P?HF
P S Pv S si B
i i!? MI i
*v
E B S Bg H
III II
B H BcPy
SEGI JJ I!
E
P S PvBg S
I I II I
3 P
s
?
>v
E B S H Bg
1 III 1
B
H BS
SEGII I III
9
Py
L
E
P PvBg S
I I I I
3 P
Shf
h
>v
E B S Bg H
1 III 1
B
H BS
SPE I LL
9
E B P '
" P PvBg Si Si
J M il I
shf
'b
>v
E B S BgH
1 II II


56
But no Ab molecules were ever detected to be positive
ornegative for both antibodies simultaneously. The perfect
correlation between the serological pattern and the presence
or absence of the two deletions have been confirmed by testing
a panel of Ab in Northern blot analysis (Figueroa et al.
1988). The same deletion polymorphisms also exist in other
species distantly related to M. musculus complex such as M.
caroli and M. pahari. which is estimated to be separated from
M. musculus complex 1.7 and 4.8 million years ago,
respectively. Furthermore, the non-deleted and deleted forms
of Ab genes are also shown to be present in inbred strains of
rat, which is another rodent genus closely related to the
genus Mus. They conclude that the codon deletion polymorphisms
are shared not only by different species of the same genus but
also by different genera of the same order.
Comparisons of class I Mhc alleles in two closely
relatedly species: humans (Homo sapiens) and chimpanzees (Pan
troglodytes) have also indicated the trans-species mode of
evolution in this family of genes (Lawlor et al. 1988; Mayer
et al. 1988). There are no features that distinguish human
alleles from chimpanzees. Individual HLA-A or B alleles are
more closely related to individual chimpanzee alleles than to
other HLA-A or B alleles. These studies support the notion
that a considerable proportion of contemporary HLA-A and B
polymorphisms existed before divergence of the chimpanzee and
human lines. A recent report indicates that as high as 30%


Figure 5-1. Restriction maps of 86 Ab alleles derived from Table 5-1.


148
CD O O
O =r O O O ^
rr CD CD O O 3
w -7 t-u_
~ - < <-="
(/>
-O
3

3

CO
in
o
3
o.
-O
o'
TD
Q.
rf
C
(f)
c
c/>

o
3

m
rn
m
1 1
n
P PCCCK Z ZXX S SMMMBB NN j
TARROARBBBEEBBDZN00 *AA
XHPVKRUNSJG I S B LOC NDd K^P H ..
4% Nusieve agarose gel


Figure 5-2. Diagram illustrating the evolutionary origins of the 4
lineages of Ab alleles assayed. The Mus species analyzed are given at
the bottom of each line. The number of alleles assayed is given below
each species name. The solid line represents the evolutionary lineage
1 allele, dotted line, lineage 2A, hatched line, lineage 2B and
crosshatched line, lineage 3. m. dom: Mus m. musculus. m. mus: Mus m.
musculus. m. molo: Mus m. molossinus. m.cas: Mus m. castaneus. sptd: Mus
spretoid. spic: Mus spicilequs. spretus: Mus spretus. cerv: Mus
cervicolor. cooki: Mus cooki. caroli: Mus caroli. plat: Mus platvthrix.
pahari: Mus pahari.


K
S
I
REGION I 'I ~T
l-A l-E
BUBREGION i 1
k a^3
GENES h i H+t+t
1(2 / J >
6 S 62
SCALE i¡iiii
kb 0 500
21-OHB 21-OHA Bf
I I \
C4 Sip C2
I I
1000
D
Tla
TNF
TNF|J
-tt-
Qa2
Tla
1 I III I I I
till! lit
Tla-1.2
I I
1500
i i
i i
2000
2500
00


371 CGTGTCCCTT GAGGGCCACG GTTGTCTTGT GAGGGCTGTT TGCTGCCTGG CGCTAACCCA AAGGCCTCAC TGTAATTTTC CTCGTTCTCC GAGGTAGACT GTGTTTACTT GGGCCACACT 490
AAAAGATTCT GATACAAGCT GGGCGTGGTG GCGCACGCCT TTAATCCCAG CACTCGGGAG GCAGAGGCAG GTGGATTTCT GAGTTCGAGG CCAGCCTGGT CTACAAAGTG AGTTCCAG6A 610
(drIIB) 'Alu-like' repetitive element (Bl)
CAGCCAGGGC TATACAGAGA AACCCTGTCT CAAAAGAACA AACAAAACAA AACAAAACAA AACAAAACAA AATTCTGATA CAAAATCTGA GGAACTCATT TTCGTTTCCA GCACACTCCC 730
dr(lIB)
CGATACCCCC AGAGCCTCTC ACCCGTCGAT GCCAATTAAA ACGGTCGGTT AGGCATCATA TTCAGATTTA ATCTCCTACA TTAGGACTAA CGCTTAACTC CAAAGGTTGC TTAAGTTTTC 850
CCTTCTTGCT TTCTGGGTGG CCTTGTTATT CAACTGTTCG CAACCGATTC CTCACAGCAA GGGAACAGTG ATGGCCACCA GGAATTAATA GTCTTGACTG TGGAGGAAAA CAACCAAAAA 970
CCCAAAAAAC CAACCAAAAC AGTTGTAGAG AGTAGAAAAC AAACATTAAA CAAGTTAAGT ATGTATGCTG TTTTCTTCCT TCCTTCCTTC CTTCCTTCCT TCCTTCCTTC CTTCCTTCCT 1090
drillA)
TTCTTTCTTT TTTTTTTTCT TTTGGGTTTT TCGAGACAGG GTTTCTCTGT GTAGCTCTGG CTGTCCTGGA ACTCACTTTG TAGACCAGGC TGGCCTCGAA CTCAGAAATC CGACTGCCTC 1210
dr(III) mAhi-likem repetitive element (Bl)
TGCCTCCCAA GTGCTGGGAT TAAAGGCATG AACCACCACG CCCGGCCCCT TTAACTTTTA ATATCCTCTT TGTCTTAAGA TGAGTCCAGG CTGGCCTCCG TTCTCCACAA TGCCCCTGCC 1330
TCAGCCTCTC ATGCTCTCCA CAGCAAAGCC TATATCCTTT TATGTGAAAC ATAGGTATAT AGTTTAATGT GTTTATTACC TGCAATGGCT GGGAATGGAA CCCAACCAAG GCTTCAAGGC 1450
CTCCTTCGGC CAATCTGCTC CCAGTCCCAA GGCTTTTTTT TTTTTTTTTT TTTTTCAAGA CAGGGTTTCT CTGTATAGCC CTGGCTATCC TGGAACTCAC TTTGTAGACC ATGCTGGCCT 1570
*Aht-like" repetitive element(Bl)
CCAACTCAGA AATCTGCCTG CCTCTGCCTC CCGAGTGCTG GGATTAAAGC ATGCGCCACC ATGCCCGGCT ACTTAAATTT TTTTGTTTGT TTGTTTGTTT GTCTGTTTGT TTCGAGACAG 1690
¡¡Hill)
GGTTTCTCTG TATAGCCCTG GCTGTCCTGG AACTCACTCG GTAGACAGAT GGCCTCAACT CAGAATCCAC CTGCCTCTGA CTCCCAAGAG CTAGGATTAA AGGTGTGCAC CATCACCACC 1810
CGGCTAAATT TTTTATTAGA TATTTTCTTC ATTTACATTT CAAATGCTAT CCCAAAAGTC CCCTATACCC ACCCACCCTG CTCCCCTACC CACCCACTCC CGCTTCTTGG CCCTGGCATT 1930
CCCCTGTACT GGGGCATATA AAGTTTACAA GACCAAGGGC CTCTCTCCCC AATGATGGCT TGACTGGTCA TCTTCTGCTA CATATGCAAC TAGAGACACG AGCTCCTGGG GATATTGATT 2050
Sst I
AGTTTATATT GTTGTTCCAC CTATAGAGTT GCAGACCCCT TCAGCTCCTT GGGTACTTTC TCTAACTCCT CCATTGGGGG CCCTGTGTTC CATCCTATAG ATGACTGTGA GCATCCACTT 2170
CTGTATTTGC CAGGTATTGC ATAGCCTCAC AAGAGACAGT TATATCAGGG TCCTTTCAGC ATAATTTTGC TGGCATATGC AATAGTGTCT GCGTTTGGTG GCTGATTATG GGATGGATCC 2290
BamHI
CCGGGTGGGG CATGTATGCT GTTTTCAACT 2320
dr(llA)
130


125
k
exon and the transmembrane region of a lineage 3 (Ab ) allele
was determined. The sequencing strategy and the 3,735 bp of
nucleotide sequence determined was shown in Figure 3-2 and
Figure 4-5, respectively.
Lineage 3 Derived from Lineage 2
The evolutionary relationships among these 3 lineages
were assessed by comparing the published nucleotide sequences
of lineage 1 (Abd) and lineage 2 (Abb) obtained from GenBank
with the lineage 3 (Abk) sequence determined. Several notable
features about lineage 3 intron were revealed from this
sequence analysis (Figure 4-6 & Figure 4-7). There are two
additional inserted DNA sequences present in lineage 3 allele,
and absent in lineages 1 and 2. One of these two inserted
sequences is 174 bp long and its integration site starts 508
bp downstream of the A^ exon of Abk and ends at nucleotide
position 681. This small insert was flanked by 11 bp direct
repeats (ATTCTGATACA). The other inserted element is 539 bp
in length, and its integration site started at 1141 bp 31 of
A^., exon and ended at 1679 bp and was flanked by 22 bp direct
repeats (TTTCGAGACAGGGTTTCTCTGT). Of great interest was that
this large insert was interposed in the 861 bp retroposon,
distinguishing lineage 2 from lineage 1 alleles. Probably as
a result of this insertional event, there is a deletion of 130
bp in the 861 bps retroposon. The 618 bp of retroposon which


29


18
was mapped to a 3.4 kb segment of DNA between I-A and I-E.
including 3' half of Eb gene (Steinmetz et al. 1982).
Molecular cloning of this 3.4 Kb region from ten parental and
intra-I recombinant inbred strains have narrowed the distance
between cross points separating I-A and I-E to 2.0 kb,
contained entirely within the intron between E^-E^ and Ep2
exon of Eb gene (Kobori et al. 1984) Although a lot of
explanations have been put forth to account for the apparent
paradox of I-J. all of them are refuted by experiments
showing that cloned DNA of this region fails to hybridize to
mRNA isolated from I-J'1' suppressor T cell lines (Kronenberg
et al. 1983).
I-C subregion
This subregion was defined by the la. 6 specificity,
detected as a cytotoxic antibody present in B10.A(4R) (H-2h2)
anti-B10A(2R) (H-2h4) antiserum (Sandrin et al. 1981) These
antisera containing purported anti-I-C antibodies were shown
to react with a suppressor factor generated in a mixed
lymphocyte reaction (MLR) (Rich et al. 1979; Rich et al.
1979). A MLR that is generated in congenie strain combination
differing at the I-C subregion can be inhibited by the
addition of anti-I-C antisera (Okuda et al. 1978). Mapping
by classic genetic methods has suggested a locus in the I-C
subregion between Ea and the gene coding for the C4 complement
components. Although this segment of DNA has not been


195
Mechanism of Generation of Ab Gene Polymorphisms
Mutational changes in DNA can be classified as four
types: substitution, deletion, insertion and inversion. RFLP
analysis is able to detect all four types of DNA changes,
although it is most efficient in detecting deletions,
insertions and inversions. Substitutions are detectable only
when point mutations occur which alter the recognition
sequences of restriction enzymes. Therefore, RFLP analysis
tends to underestimate the degree of substitution in
comparison with insertion, deletion and inversion.
For the seven restriction enzymes used in our analysis,
the segment of genomic DNA assayed by the Ab gene probe
spanned about 16 kb. Therefore, the polymorphic restriction
sites revealed in this study are distributed over a fairly
large segment of DNA. As the Ab gene is encoded by 700 bps
of exonic DNA, the majority of DNA examined by RFLP analysis
is the noncoding regions of DNA such as introns and flanking
regions. Thus, the restriction site polymorphisms detected
reflect DNA sequence variations in the non-coding regions.
Inspection of restriction maps of 86 Ab alleles in our
analysis indicated that in addition to three distinct
insertion events which constitute the basis of evolutionary
lineages, most restriction site polymorphisms are caused by
point mutations.


30
DMGT has provided insight into the actual biochemical bases
of immune recognition and regulation, which are highly
dependent on the fine structure of Mhc-encoded products and
T cell receptors with which they interact.
Regulation of class II gene expression
The expression of class II genes is normally limited to
a number of tissues (Klein 1986). Cell surface expression of
class II is positively regulated by the addition of gamma
interferon (King & Jones 1983). Gamma interferon can increase
both class I and class II gene expression (King & Jones 1983).
It appears to act at the level of transcription, since the
surface expression is correlated with the level of specific
mRNA (Nakamura et al. 1984) Initial studies on class II gene
expression following transfection were performed using cells
that either constitutively expressed (B lymphoma) or were
inducible (macrophage cell lines) for endogenous class II
genes (reviewed by Germain & Malissen 1986). Introduction of
the genomic copies of mouse class-II genes into B-lymphomas
resulted in high levels of gene transcription and the
expression of gene products of the transfected genes on the
cell surface (Ben-Nun et al. 1984) However, it was difficult
to assign the observed effect in serologic or T cell
restriction element to the introduced gene products. The
assembly of a variety of class II molecules following the
introduction of a and/or (3 chains, prevented the dissection


82
ancestors (Morse 1978). Study of mitochondrial DNA has
indicated that most laboratory inbred strains belong to the
Mus musculus domesticus type (Ferris et al. 1982) On the
contrary, using a Y-specific DNA probe has revealed that the
Y chromosomes of most of laboratory inbred strains, except
SJL, is of M. m. musculus origin (Bishop et al. 1985). Thus
the pool of segregating genes in laboratory mice is fairly
limited and probably does not reflect the mouse species as it
is in the wild (Guenet 1986) In fact, had it not been for
wild mice, the analysis of certain genetic loci, e.g., Mta,
a maternally transmitted histocompatibility antigen, would
have suffered premature termination (Lindahl 1986). Depending
on the degree of association with humans, wild mice can be
distinguished into three groups. These are aboriginal,
commensal and feral. Aboriginal mice live primarily
independently of human construction. Commensal mice live in
close association with man-made structure, and feral mice have
resumed an aboriginal mode of life from the commensal stage
(reviewed by Sage 1981). The aboriginal species include Mus
spretus. M. spretoides (M. macedonicus; M. abbotti), M.
spicilequs (M. hortulanus). All introduced populations of M.
domesticus in the New World and in Australia, which live in
native vegetation, are considered feral forms derived from
commensal ancestors. Based on genetic variability of wild
mice, using both DNA and biochemical markers, the Mus genus
can be divided into the complex species Mus musculus and at


BIOGRAPHICAL SKETCH
Cheng-Chan Lu was born in Taiwan, Republic of China, on
November 16, 1953. He grew up in Tainan, a historical city
in South Taiwan. As a child he enjoyed many extracurricular
activities, but enjoyed playing baseball the most. While
attending medical school of National Taiwan University, he
cultivated an interest in many sports. His favorites were
fencing, ping-pong, baseball and tennis. After graduating
from National Taiwan University, he served two years in the
army at a general hospital in Taiwan, and then he started
thinking of pursuing advanced education to satisfy his
desire for knowledge. Although he had previously performed
research with Dr. Czau-Siung Yang during his years in
medical school, he now sought more challenging bench work.
Consequently, he went to National Yang-Ming Medical College
to work with Dr. Wu-Tse Liu. There he spent two years
working as a research and teaching assistant before coming
to Florida to pursue a Ph.D. He first studied at the
University of South Florida and then transferred to
University of Florida. He received his Doctor of Philosophy
degree from the Department of Pathology and Laboratory
Medicine at the University of Florida in 1990.
236


15
deep, has a size and shape consistent with the expectation.
By analogy with class II molecules, class I molecules bind
processed antigen in a form of peptides. Synthetic peptides
have been shown to bind to purified murine class II molecules,
presumably mimicking processed antigen (Guillet et al. 1986).
Because class I and class II molecules have homologous
structures (Kaufman et al. 1984) and T cells specific for
either class I or II molecules use the same receptors (Rupp
et al. 1985; Marrack & Kappler 1986), the type of interaction
described between peptides and class II molecule is assumed
to apply to peptides and class I molecules. Electron density
representing an unknown molecule, possibly a bound peptide
antigen, is found in the site of two crystal forms of HLA-A2
class I molecules (Bjorkman et al. 1987b). An a-helical
conformation has been proposed for bound peptide (Berkower et
al. 1986; Allen et al. 1987). Thus, one face of a peptide a-
helix is envisioned to contact the class II molecule, the
other to be contacted by T cell receptor. Many of the
polymorphic residues that are responsible for recognition by
T cells and haplotype-specific association with antigens are
located in this site where they could serve as ligands to a
processed antigen. This is further evidence that this region
functions as antigen binding site (Bjorkman et al. 1987b).
Most of non-conserved residues are located in and around the
ABS site, suggesting that most variable residues in class I
molecules have been selected to generate an ability to present


220
Haynes, S. R., Toomey, P., Leinwand, L., & Jelinek, W. R.
1981. The Chinese hamster Alu-equivalent sequence: a
conserved, highly reptitious, interspersed deoxynucleotide
acid sequence in mammals has a structure suggestive of a
transposable element. Mol. Cell. Biol. 1: 573.
Heber-Katz, E., Hansburg, D., and Schwartz, R. H. 1983. The
la molecule of the antigen-presenting cell play a critical
role in immune response gene regulation of T cell
activation. J. Mol. Cell. Immunol. 1: 3.
Heber-Katz, E., Schwartz, R. H., Matis, L. A., Hannum, C.,
Fairwell, T., Appella, E., Hansburg, D. 1982. Contribution
of antigen-presenting cell major histocompatibility complex
gene products to the specificity of antigen-induced T cell
activation. J. Exp. Med. 155: 1086.
Hedrick, P. W. and Thomson, G. 1983. Evidence for balancing
selection at HLA. Genetics 104: 449.
Hess, J. F., Fox, G. M., Schmid, C., and Shen, C.-K. J.
1983. Molecular evolution of the human adult a-like globin
gene region: insertion and deletion of Alu family repeats
and non-Alu DNA sequences. Proc. Natl. Acad. Sci. U. S. A.
80: 5970.
Hickey, D. A. 1982. Selfish DNA: A sexually-transmitted
nuclear parasite. Genetics 101: 519.
Hickey, D. A. and Benkel, B. 1986. Introns as relict
retrotransposons: implication for the evolutionary origin of
eukaryotic mRNA splicing mechanisms. J. Theor. Biol. 121:
283.
Hildemann, W.H., Clark, F.A., Raison, R.L. 1981.
Comprehensive Immunoqenetics. New York: Elsevier.
Hood, L., Steinmetz, M., Malisson, B. 1983. Genes of the
major histocompatibility complex of the mouse. Ann. Rev.
Immunol. 1: 529.
Houck, C. M., Rinehart, F. P., & Schmid, C. W. 1979. A
ubiquitous family of repeated DNA sequences in the human
genome. J. Mol. Biol. 132: 289.
Hughes, A. and Nei, M. 1988. Pattern of nucleotide
substitution at major histocompatibility complex class I
loci reveals overdominant selection. Nature (London) 335:
167.


Figure 2-1. Location of genes in the Mhc of the BALB/c mouse. Genes are
indicated by vertical bars on six gene clusters that have been defined
by overlapping cosmid clones. The order, orientation and spacing of the
three gene clusters in the Tla region is not known. Adapted from
Steinmetz et al. (1987a).


226
McConnell, T. J., Talbot, W. S., Mclndoe, R. A. and
Wakeland, E. K. 1988. The origin of MHC class II gene
polymorphism within the genus Mus. Nature (London) 332: 651.
McKinnon, R. D., Shinnick T. M. and Sutcliffe, J. G. 1986.
The neuronal identifier element is a cis-acting positive
regulator of gene expression. Proc. Natl. Acad. Sci. U. S.
A. 83: 3751.
McLachian, A. D. 1980. In Jaenicke, R.(ed.) Protein Folding
pp. 79-99, Elsevier, North Holland.
McNicholas, J. M., Murphy, D. B., Matis, L. A., Schwartz, R.
H., Lerner, E. A., Janeway, C. A.Jr., Jones, P. P. 1982.
Immune response gene function correlates with the expression
of an la antigen. I. Preferential association of certain Ae
and Ea chains results in a quantitative deficiency in
expression of an Ae:Ea complex. J. Exp. Med. 155: 490.
Melchers, I., Rajkewsky, K., Shreffler, D.C. 1973. Ir-
LDHB:Map postion and functional analysis. Eur. J. Immunol.
3: 754.
Mellor, A. L. Golden, L. Weiss, E. Bulliran, H. Hurst,
J., Simpson, E., James, R., Townsend, A. R. M., Taylor, P.
M., Schmidt, W., Ferluga, J., Leben, L., Santamara, M.,
Atfield, G., Festenstein, H. and Flavell, R. A. 1982.
Expression of the murine H-2Kb histocompatibility antigen in
cells transformed with cloned H-2 genes. Nature (London)
298: 529.
Mengle-Gaw, L., Conner, S., McDecitt, H. 0. and Fathman, C.
G. 1984. Gene conversion between murine class I major
histocompatibility complex loci. Functional and molecular
evidence from the bml2 mutant. J Exp. Med. 160: 1184.
Michaelson, J. Genetic polymorphism of )32-microglobulin
(B2m) maps the H-3 region of chromosome 2. 1981.
Immunoqenetics 13: 167.
Morse H. C. 1978. Origins of Inbred Mice. Academic Press
New-York.
Muller, U., Jongeneel, C. V., Nedospasov, S. A., Fischer
Lindahl, K., and Steinmetz, M. 1987a. Tumor necrosis factor
and lymphotoxin genes map close to H-2D in the mouse major
histocompatibility complex. Nature (London) 325: 265.
Muller, U., Stephan, D., Philippsen, P., and Steinmetz, M.
1987b. Orientation and molecular map position of the
complement genes in the mouse MHC. EMBO. J. 6: 369.


i
$ § I
3
3 i
£ £
LL
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19 -
20 -
/
29 -
30 L
% DNA
Divergence
JJ
CO
o>
5
£
-9
o
8-
s
s-
V
O
O
?
8
O
IIOJBo
P'atythrix
6
VD
Million
Years


in
O)
Q)
r-
iH
<
-Ql
<1
CO
of
o
o
o
o
-p
a)
a>
rH
CM
co
cq
CM
o
o
o
o
o
o
o
o
o
o
o
o
o
O
O
o
O
o
o
o
o
o
O
O
o
o
o
o
o
o
o
o
o
o
rH
rH
rH
rH
o
o
O
o
o
o
o
o
O
o
rH
rH
rH
o
o
rH
rH
rH
o
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
n*
rH
rH
n-
n>
rH
n-
rH
o
rH
n-
rH
rH
rH
rH
rH
n*
rH
rH
rH
O
rH
rH
rH
rH
o
p
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
o
rH
rH
rH
o
rH
rH
n*
o
rH
n*
o
rH
n-
o
o
o
n
rH
rH
o
o
o
n-
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
o
o
o
o
rH
o
o
o
o
o
o
o
rH
o
rH
o
o
o
o
o
o
o
rH
rH
o
o
rH
o
o
o
o
o
o
o
o
o
rH
o
o
o
o
o
o
o
o
o
o
-p
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
o
o
rH
rH
rH
rH
rH
rH
o
o
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
H
rH
rH
rH
rH
rH
rH
rH
o
rH
H
rH
rH
rH
rH
rH
rH
rH
rH
(0
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
p
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
rH
rH
rH
rH
rH
o
rH
o
o
m
o
rH
o
rH
o
rH
rH
o
rH
o
rH
rH
o
rH
rH
o
rH
o
rH
o
rH
o
o
rH
rH
rH
rH
rH
rH
o
o
o
o
rH
rH
o
o
o
o
n*
o
o
o
n-
o
o
o
o
o
x¡
CM
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
rH
o
o
o
rH
o
o
o
o
o
u
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
H
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
o
rH
o
rH
rH
rH
rH
rH
rH
rH
rH
rH
H
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
H
rH
rH
rH
rH
rH
rH
rH
o
o
o
o
o
o
o
o
o
o
o
o
o
o
0)
rH
o
o
o
o
o
o
o
o
o
o
rH
o
rH
o
rH
o
o
o
o
rH
o
o
o
o
o
o
rH
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
p
o
o
o
o
o
o
o
o
o
o
o
rH
o
o
o
o
rH
o
o
o
rH
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
H
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
n*
rH
o
rH
n*
rH
rH
rH
rH
rH
rH
n-
n*
n-
o
o
H
o
rH
o
o
n-
o
o
o
o
o
H
rH
rH
rH
rH
rH
rH
rH
cq
o
o
o
o
o
o
o
o
o
o
o
o
rH
o
o
o
n*
o
o
o
o
o
o
rH
rH
rH
o
o
o
o
o
o
o
rH
o
o
o
o
rH
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
n*
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
c
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
rH
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
O
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
o
o
rH
rH
rH
o
rH
rH
o
o
o
o
rH
rH
rH
rH
rH
rH
rH
P
rH
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
-p
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
rH
o
rH
o
rH
rH
o
0
rH
rH
rH
rH
o
rH
rH
rH
rH
o
H
o
o
rH
rH
rH
rH
rH
rH
o
o
rH
rH
o
o
o
o
o
rH
rH
rH
rH
o
o
o
rH
o
rH
o
o
o
o
o
o
o
o
o
o
H
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
rH
H
o
rH
rH
H
rH
rH
rH
rH
rH
H
H
H
o
rH
rH
rH
rH
rH
rH
rH
rH
rH
o
rH
rH
rH
H
rH
rH
rH
p
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
rH
o
o
o
o
o
o
o
o
o
o
o
o
o
o
-p
rH
rH
rH
rH
rH
rH
rH
rH
rH
o
rH
rH
n-
o
o
rH
rH
rH
rH
rH
rH
rH
rH
n-
rH
n-
rH
o
rH
rH
rH
rH
rH
o
rH
rH
rH
o
o
o
o
o
o
o
o
o
o
o
in
o
o
o
o
o
o
o
o
o
o
o
o
rH
o
o
o
o
o
o
o
o
o
o
rH
o
rH
o
o
o
o
o
o
o
o
o
o
o
o
H
rH
H
rH
rH
rH
a)
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
rH
H
rH
rH
rH
rH
rH
rH
o
o
o
o
X
o
rH
o
o
o
o
rH
o
H
o
o
o
o
o
o
o
o
rH
o
o
o
o
o
o
o
o
o
o
rH
rH
rH
rH
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
rH
o
o
o
o
o
o
o
o
o
o
o
o
CM
CO
o
1
H
CM
o
cn
ID
H
<
cq
H
o
CM
H
2
<
D
<
\
X
Eh
d)
a
Ph
X
cq
U3
CQ
CM
u
rH
a
tn
rH
rH
H
rH
rH
rH
CM
rH
rH
rH
CM
rH
rH
CM
CM
PI
2
h)
CQ
CQ
CO
CO
rH
1
rH

2
\X
i
i
1
i
i
i
1
1
1
i
1
i
i
1
1
CQ



<
1
1
1
CM
X!
O
o
o
o
o
o
H
in
CO
PI
o
O
X U
pp
a
CQ
*
CQ
2
in
CQ
2
X X >
X
X
a
X
PI
>
o
X
o
O
(N
H
H
Eh
rH
(0
H
rH
rH
rH
rH
rH
X
£
w
rH
X
<4
H
CO
w
CQ
CQ
CQ
Uh
Eh
CQ
CQ
03
CQ
<
O X
X
X
>H
Cw
a
CQ
in
H
CO
rH
rH
rH
c <
X
Eh
cq
cq
cq
cq
03
CQ
2
H
H
cq
CQ
H
X
CQ
co
a
CQ
a
2
2
u
CQ
CQ
X
X
X
IS)
X
u
o
a
u
tsi
N
X
2
2
a
u
CQ
a
CQ
03 ¡2
X X
2 -P
t
)


155
Hinc
II
Hint
1
1

1

*
r
"1
r
1
3
2
cr
M
M
M
M
M
M
1
0)
B
B
H
B
B
B
B
Q.
Q.
S
B
S
B
K
S
B K
-j (0
d -i
A A
P H
4% Nusieve agarose gel


CHAPTER 3
MATERIAL AND METHOD
Wild Mice
The wild mouse strains used in this study are listed in
Table 3-1 and were kindly provided by Dr. Franciose Bonhomme.
Geographic origins of these mouse strains are also included.
The distribution patterns of these wild mice indicate that
they are representative of the global mouse population.
Source of Mouse Tissues and Preparations of DNA
Tissue samples, such as livers and kidneys, were used for
the isolation of genomic DNA. Tissue samples from different
mouse strains were minced and preserved in 75% ethyl alcohol,
according to the method described by Smith et al. (1987).
Genomic DNA was isolated from tissues by the proteins K/sodium
dodecyl sulfate (SDS) as detailed in Sambrook et al. (1988).
Minced tissues are washed with PBS once, transferred to a
liquid nitrogen-cooled mortar containing liquid nitrogen, and
ground into fine powder. The frozen powder was added to TES
buffer (lOmM Tris-HCl, PH 7.5; 5 mM ethylenediaminetetraacetic
92


A


Ancestral Mu
Group 1


68
approximately 300 bp long, were so named because they contain
a distinctive Alu I cleavage site. Regions of direct internal
repetition within Alu seguences indicate that the Alu element
is composed of two incompletely homologous arms, an
approximately 130 bp left arm and a right arm which differs
from the other by an insertion of 31 bp (reviewed by Doolittle
1985). Although human Alu sequences are dimeric, the
homologous rodent sequences (the B1 superfamily) are
monomeric. It is believed that both Alu and B1 sequences are
derived independently from 7SL RNA as 7SL RNA gene has about
150 bp in the middle that is not found in the Alu family (Ullu
et al. 1985; Weiner et al. 1986). 7SL RNA is a component of
signal recognition particle, required for cotranslational
secretion of proteins into the lumen of rough endoplasmic
reticulum (Walter & Blobel 1982), and is highly conserved
throughout evolution. Alu-like sequences, and retroposons in
general, have a strong tendency to insert into each others'
(A)-rich tails. This has apparently generated composites
which are themselves propagated as single retroposons
(Jagadeeswaran et al. 1981; Haynes et al. 1981).
Mechanisms of Retroposition
Transcription by polymerase III
The basic model for retroposition of SINEs involves RNA
polymerase III transcription of genes, reverse transcription
of the RNA, and integration into the genome (Figure 2-11) .


35
were independently cotransfected with Aab,d,or k into L cells.
Their results indicate that the most important portion of Ab
with respect to a:(3 pairing is in the amino-half of A^, in
that molecules containing this region from a given allele
expressed best with cis-matched Aa and at levels similar to
wild type Ab, irrespective of the origin of the remainder Ab
gene. However, when isotype-different a:/3 pairs were
cotransfected into L cells, the results were quite unexpected.
Although introduction of Abk and Eaa/k yield no surface la
detectable with either anti-Ab or anti-E antibodies, Abd did
pair with Ea to produce membrane molecules reactive with anti-
I-Abd and anti-I-Ea antibodies. Immunoprecipitation studies
showed that these molecules existed as noncovalently
associated dimers (Germain & Quill 1985). These data support
the view that Aa and Ab genes located on the same chromosome
actually coevolve for best "fit", such that cis-pairs form
more efficiently than trans-pairs (Figure 2-6). This view is
further supported by the studies of McNicholas et al. (1982),
showing that an 8-10 fold preference of Eau:E/5u assembly over
Eu:E0k in cells of (B10.A(4R) x BIO. PL) F: mice. The data on
cross-isotype molecules indicate control of a:/3 pairing is
strongly influenced by the highly polymorphic amino termini.
To evaluate the relative efficiency of inter- versus
intraisotypic la dimer expression, L cells were sequentially
transfected with multiple class II a and ¡3 chain genes
(Germain & Sant 1989). Then individual clones were analyzed


181
the parsimony method. A 16-kilobase region around the Ab gene
in each allele was examined with seven restriction
endonucleases (Bam HI, Eco RI, Hind III, Pvu II, Pst I, Bgl
II, Sst I ). As expected, the gain and loss of restriction
sites accounts for most of the polymorphism observed (Nei
1987) In addition, several major insertions, which have been
used to delineate the evolutionary lineages, were also
detected. A total of 86 alleles was identified from 115 H-2
haplotypes on the basis of restriction site polymorphisms and
3 different sizes of retroposon insertions. Using restriction
site polymorphism as a character state, it became possible to
reconstruct the phylogenetic relationships from restriction
map data.
The phylogenetic trees can be constructed in many
different ways, often with slightly different results.
(Felsenstein 1982) The method used in this analysis is named
"mixed parsimony", supplied by Felsenstein's PHYLIP package.
This algorithm does not produce a rooted tree.
Among 41 polymorphic restriction sites recognized by 7
restriction enzymes, 29 were informative for phylogeny
analysis(that is, polymorphic restriction sites were present
in at least two alleles each.). A typical restriction site
allele exemplified by B10.D2 is shown in Figure 5-3. The
full restriction site character set of 86 Ab alleles is shown
in Table 5-2. Each allele is composed of restriction map
variants shown in 5' to 3' with respect to order of each


B1
B2
B10.BR
11 bp repeat
"Alu-like" Repetitive
Element
11 bp repeat
100 bp
22 bp repeat
22 bp repeat
1 Kb
11 bp repeat =
TTTCGAGACAGGGTTTCTCTGT
I I
TTTCGAGACAGGGTTTCTCTGT
i i
1 1
ATTCTGATACA
"Alu-like" Repetitive
Non-repetitive
"Alu-like" Repetitive 100bp
Element
Element
Element
132


32
shown to react with single a or /? chains, which presumably
would assume a different configuration as single chains from
when paired with the other complementary chain. Thus, the
surface expression of isolated a or /? chain might be
undetectable using standard reagents. However, additional
experiments are also consistent with a lack of surface
expression of free a or /3 chains. McCluskey et al. (1985)
compared the surface expression of ABk chain gene in L cells
to membrane expression of a chimeric classll:classl gene. The
latter chimeric molecule is composed of domain covalently
linked to the a3, TM and CY portion of class-I-Dd molecule.
Following transfection, the expression of the chimeric gene
can be detected with both anti-I-Ak and anti-a3 (Dd) monoclonal
antibodies. The same anti-I-Ak antibodies failed to detect
the surface expression of L cells transfected only with the
native A^k chain gene and shown to contain the high level of
Abk mRNA. This pair of cells was also analyzed using rabbit
anti-I-A heteroantiserum, which has been shown to precipitate
free A* chain from a reticulocyte lysate in vitro translation
product (Robinson et al. 1983) and to detect both A*, and
polypeptides in western blots (Germain & Malissen 1986).
Again, the cells containing the chimeric gene stained, but the
cells containing the native A^k gene alone did not. These
results indicate that single a or p chain do not reach cell
surface efficiently and further imply that the A^ domain per
se does not prevent surface expression.


156
corresponding region of lineage 3 allele. As a consequence
of these finding, the MBB II allele is assigned to lineage 2B,
which consists of a MBBII allele only. And the original
lineage 2 is now designated as lineage 2A.
4 Evolutionary Lineages of Ab Genes
The evolutionary relationships of these four lineages of
Ab genes in the genus Mus is exhibited in Figure 4-17. In
summary, the major characteristic distinction among four
evolutionary lineages resides in intron 2 separating the A^1
and Kpz exons. Lineage 2A allele was derived from a lineage
1 allele by an 861 bp retroposon insertion. Subsequently,
another B1 family repeat insertion, composed of 174 bp,
occurred at intron 2 in a lineage 2A allele, thus generating
lineage 2B. Eventually, a newly arisen family repeat,
consisting of 539 bp, integrates into a lineage 2B allele,
thus producing lineage 3. It is noteworthy that these four
distinct lineages can be identified in wild mouse populations.
However, all lineages except lineage 2B were found to be
present in laboratory inbred strains. The unusual scarcity
of lineage 2B alleles is illustrated by the fact that MBB II
is the only 2B allele of 44 lineage 2 alleles in our
collection.


Figure 4-10. Sequence alignment among three B1 repeats. An alignment
of three B1 family repeats identified in two inserts of lineage 3 (k)
allele. Putative RNA polymerase III split promotors are boxed.
Asterisk (*) indicates the sequence mismatched, dash line() indicates
sequence identity. 1: B1 repeat contained within the 175 bp insert, 2,
3: B1 repeats at the left and right ends of the 539 bp repeat.


39
molecules in fact may be hybrid la dimers formed by E^rA^
pairing, as they can not be stained by E^-specific antibodies
and can be detected in H-2q mice with the Eak transgene. This
finding is further supported by the demonstration of E^A^ as
a major class II molecule at the cell surface of a BALB/c B
cell lymphoma (Spencer & Kubo 1989). Furthermore, although
the hybrid E^A^ can not be isolated by immunoprecipitation, it
can function in vivo leading to the clonal deletion of two V£
TcR subsets, Vfl6 and Vffll (Anderson & David 1989) which have
been shown to interact with the I-E molecule during the thymic
selection (Kappler et al. 1987) .
Functional Role of Mhc Gene
One of the most distinguishing features of gene products
of Mhc is their extensive genetic diversity. One of the most
important breakthroughs in cellular immunology was the
discovery that the influence of gene products of the Mhc on
immune response stemmed mainly from the critical role they
played in the activation of regulatory T lymphocytes
(Benacerraf 1981; Heber-Katz et al. 1982, 1983). Immune T
cells are clonally specific and only recognize foreign
antigens in the context of appropriate Mhc molecules. The
discovery of this Mhc-restriction was possible only because
Mhc molecules are polymorphic and T cells selected by an
antigen in the context of one polymorphic variant can be


210
not flanked by terminal direct repeats, yet it is not uncommon
to find Alu family member without direct repeats. It is worth
mentioning that this new repetitive element is integrated into
a B1 family repeat.
Phylogenetic Relationship of Ab Genes
To analyze the distribution of various mutational events
in the evolutionary history of the 86 Ab alleles in our
collection, we have conducted phylogenetic analysis by
parsimony analysis. A remarkable feature of the Ab
phylogenetic tree is that its main branches correspond very
closely to the 4 evolutionary lineages, 1, 2A, 2B and 3
defined both by sequence analysis and restriction mapping.
It is noteworthy that the phylogenetic tree (gene tree)
constructed from Ab gene locus does not agree with the
phylogenetic relationship of the species involved (species
tree) One of the predominant factors that lead to such a
difference is the genetic polymorphism in the ancestral
species as indicated by Pamilo & Nei (1988) The results from
Figure 5-4 demonstrated that all 86 Ab alleles we analyzed
can be grouped into at least three major clusters of alleles,
which correspond to three evolutionary lineages, 1, 2A, 2B and
3 defined previously. Moreover, each cluster of alleles is
composed of alleles derived from different species and
subspecies of genus Mus. supporting the idea that Mhc alleles


160
and subspecies in the genus Mus. The mouse strains and their
geographic origins included in this study are listed in Table
3-1. The mouse genomic DNAs were digested with seven
restriction enzymes (Eco RI, Bam HI, Hind III, Bgl II, Pst I,
Pvu II, SSt I) and analyzed by Southern blot hybridization
with a genomic Abd probe. The orientation of restriction
fragments was determined by stripping and hybridizing with 5'
and 3' regions of Ab probe, respectively. A typical mapping
experiment is shown in Figure 4-15. In each case, the
restriction mapping of Ab alleles was further confirmed by
double digestion experiments. With regards to DNA samples
being heterozygous for Ab gene, the assignment of RFLP pattern
to individual allele was made possible by comparing
restriction fragments with other known alleles. The RFLP
patterns of individual Ab alleles and their corresponding
restriction maps are shown in Table 5-1 and Figure 5-1. Close
inspection of restriction maps of these Ab alleles indicate
that the majority of these restriction site polymorphisms are
due to insertion/deletion and point mutations, resulting in
the creation or loss of restriction sites. It is evident from
restriction analysis that there is no correlation between
restriction site allele and the distribution of species or
subspecies. A total of 86 Ab alleles is revealed from the
analysis of 115 H-2 haplotypes(Table 5-1 & Figure 5-1). Only
unigue Ab alleles are listed in Table 5-1. Even so, similar
or closely-related alleles were frequently found present in


Figure 2-5. A model of the antigen-binding site of the Mhc class II 1^
A molecules.


Figure 5-3. Example of a restriction site allele used for parsimony
analysis. The "+" and indicate the presence and absence of
restriction site, respectively.


r~
o
i
3
)
4
5.7kb
Signol
First Second
esternal external
Third Trans-
externol membrane Cytoplasmic 3' Untranslated
to


77
eukaryotic genomes. Gilbert (1978, 1985) proposed "exon
shuffling" hypothesis which states that introns provide an
evolutionary advantage by allowing recombination within intron
sequences, and that introns in modern genomes were remnants
of the recombination process that speed up evolution. The
observations that the exons often correlated with functional
domains and that the homologous exons can be found in
different genes have been used to support this idea.
Examinations of genes coding for certain ubiquitous
enzymes, such as triosephosphate isomerase, whose sequence is
highly conserved across species, have revealed that the intron
positions are not random and that all of these introns were
in place before the division of plants and animals (Gilbert
et al. 1986), the introns were lost from prokaryotes as their
genomes became streamlined for rapid DNA replication
(Doolittle 1978) After the discovery of introns, a number
of authors have suggested that intron might represent the
vestiges of transposable elements which had been inserted into
the genes (Cavalier-Smith 1985; Hickey & Benkel 1986).
Although there is evidence that many, if not all, introns are
dispensable (Ng et al. 1985), there is also evidence that the
internal sequences of introns are important for splicing
(Rautmann & Breatnach 1985). Cech (1986) has suggested that
all RNA splicing reactions are evolutionarily related, with
the exception of those involving some pre-tRNA. This
evolutionary link between different intron classes implies


211
evolve in a trans-species manner. Trans-specific evolution,
the occurrence of polymorphisms predates the origin of the
species, have been proposed as the explanation for the
existence of identical alleles in multiple subspecies.
The distribution patterns of Ab alleles in the
phylogenetic analysis suggest that alleles harboring
transposable elements are not subjected to deleterious
selection. The number of alleles related by descent keep
proliferating as evidenced by the clustering of alleles within
each lineage. This finding is in direct contrast to a
neutrality model suggested by Golding et al (1986) that
haplotypes carrying the transposable elements are selectively
deleterious as they are located at the tips of phylogenetic
trees. However, a quantitative population genetic model
proposed by Hickey (1982) suggested that the spread of
transposable genetic elements in natural populations depends
on sexual reproduction of the host. These self-replicative
transposable elements do not have to be selectively neutral
at the organismal level; they can generate major deleterious
effects on the host and still spread through the population.
This analysis has allowed us to construct an evolutionary
trees whereby the different alleles currently distributed
throughout the natural populations are generated by stepwise
divergence from various lineage progenitor alleles. The
presence of different sizes of retroposon insertions in the
intron 2 between the A^1 and A^2 exons of Ab alleles has served


Figure 4-11. Southern blot hybridization experiments with Abd and 235
non-repetitive element probe. Sst I-digested genomic DNA was hybridized
with indicated probes.


Figure 5-1. continued
176
BS H BgPv
C57BL/1I I I I
E
P PvBg S
li ni i**>
B P
ni
Shf
?
>v
E B S H Bg
| III 1
BS H BgPv
BFM III II
MI
E
P Pv S
I I I
UT
P
SI
SHF
B
1
>v
E B S HBg
III if
BS H BgPv
BNC III II
E
p PvBg s
I III
B P
s
shf
r?
sv
E B S Bg
1 III
BS H BgPv
DBP III II
E
P PvBg S
I III
B P
s
SHPv
S Bb9
111 1 II
BS H BgPv
DGD III II
E
p Pv S
I I I
B P
s
H
B E Pv b S HBg
u l i i Si
BS H BgPv
dot III II
E
P PvBg S
I III
B P
s
shf
h
sv:
E S Bg
1 1
BS H BgPv
BIB-2 III II
E
P Pv S
I I I
B P
s
SH
f BE Pv s HBg
i i i i Si
BS H BgPv
BEP-2 III II
E
p s PvBg s
J lili
B P
s
S F
B
M
>v
Bgs H
'll 1
BS H BgPv
DJO-2 III II
E
P s PvBg S
J lili
3 P
sH
'BE Pv S H
III 1 1
BS H BgPv
DSD-2 III II
=
P Pv S
J I L
3 P
SH
f B E Pv s Bg
III 1 1


205
the other two forms of balancing selection (i.e. overdominant
and rare allele advantage) commonly thought to operate on Mhc
genes (Bodmer 1972; Zinkernagel & Doherty 1974). All three
types of selection would contribute to the maintenance of Mhc
polymorphism of highly divergent alleles within population
(Wakeland et al. 1990b)
Alu-like Repetitive Elements in Ap Genes
SINE as Evolutionary and Genetic Tags
Interspersed repetitive DNA sequences have been
discovered in the genomes of all vertebrate species studied
to date (Schmid & Jelinek 1982; Jelinek & Schmid 1982). Many
of these repetitive DNA families are present in extremely high
copy numbers. On the average, Alu elements appear every 5 kb,
so it is not surprising that the intron between A^1 and A^
exons of Ab genes contains three different sizes of retroposon
inserts in various lineage alleles. Moreover, these three
retroposon insertions were produced from three successive
independent insertional events resulting in the formation of
four evolutionary lineages. Alu elements in specific
locations have been used as markers to study gene and genome
evolution (Barsh et al. 1983; Ruffner et al. 1987).
Previously, McConnell et al. (1988) proposed that SINE
retroposons can be used as evolutionary tags for Mhc class II
genes. In this dissertation, two additional SINE retroposons


190
by retroposon insertion, it is obvious that the divergence of
alleles within each lineage occurs by the accumulation of
mutational events, mainly due to base substitution.
The phylogenetic tree shown in Figure 5-5 suggests that
each lineage contains a few meaningful sublineages (designated
by circle broken lines). These sublineages each contain a
cluster of closely related alleles. In some sublineages, the
cluster of alleles are derived from different Mus species, for
example, MYL1, C57BL/10, SEG1, SFM1, suggesting the trans
species mode of evolution operating on the Ab gene.
Occasionally, clusters of alleles are derived from the same
subspecies, e.g., CAS and THON1, both of which belong to M.
m. castaneus.


Figure 2-13. Geographical distribution of four separate subspecies of
Mus musculus complex. M. m. domesticus. M. m. musculus, M. m.
bactrianus. M. m. castaneus.


17
trinitrophenylated mouse serum albumin (Urba et al. 1978).
In all these cases the mapping of genes controlling the immune
response centered around the four critical H-2 haplotypes,i.e.
BIO (A) (H-2a) C57BL/10 (H-2bl B10.A(4R) (H-2h4) and
BIO.A(5R) (H-215) used by Lieberman and her co-workers.
However, further analysis by Baxemanis et al. (1981) of the
response to LDHB and to myeloma protein MOPC173 revealed the
involvement of Th and Ts cells in response to these antigens,
making the postulate of a separate I-B subregion unnecessary.
I-J subregion
This locus was originally defined serologically and
mapped between I-A and I-E by reciprocal alloantisera raised
between strains B10.A(3R) and B10.A(5R), which are inbred
congenie recombinant strains with a crossover between I-A and
I-E subregions (Murphy et al. 1978a, 1978b). Alloantisera and
monoclonal antibodies raised against I-J-encoded molecules
react with determinants expressed on suppressor T cells, and
the soluble suppressor T cell factors released by these cell
lines (Krupen et al. 1982). There is a lot of experimental
data available supporting the existence of I-J locus (Murphy
et al. 1978a; Waltenbaugh et al. 1981) However, its true
identity and chromosomal location remain elusive. By using
restriction fragment polymorphisms (RFLP) to map the crossover
points among inbred congenie mouse strains that have
recombination events between I-A and I-E loci, I-J subregion


94
acid (EDTA), lOOmM NaCl) with 1% SDS and 0.4 mg/ml proteinase
K, which inactivates and digests the proteins, facilitating
the isolation of DNA. This solution was incubated at 65C
overnight. The digested DNA solution was extracted three
times with Tris equilibrated phenol (PH 7.5), twice with
chroloform/amyl alcohol (24:1) and precipitated with an equal
volume of isopropyl alcohol. The DNA was fished out by a
pasteur pipet and resuspended in TE (lOmM Tris (hydroxylmethyl)
aminomethane-HCl, PH 7.5, ImM EDTA). The resulting DNA
solution was quantitated by spectrophotometry and
electrophoreses on 0.7% agarose gels to confirm their high
molecular weight. Alternatively, genomic DNA was isolated
using an automated Nucleic Acid Extractor (Applied Biosystems
340A), following manufacture's instruction. Briefly, ground
fine tissue powders were suspended in 3 ml of lysis buffer
(Applied Biosystems), and 0.3 ml of Proteinase K (Applied
Biosystems) was added. The digested tissue was extracted with
phenol/chloroform (50/50, v/v) to remove the digested
proteins. The DNA was precipitated from the solution by
adding sodium acetate (to a final concentration 300 mM) and
2 volumes of ethanol (95%). Precipitated DNA was air-dried
and resupended in TE buffer.


Figure 4-8. Sequence identity between the retroposn sequences in lineage
2 (Abb) and lineage 3 (Abk) alleles. The number in lineage 2 (Abb) refers
to the number of base pair from the first base pair of published
sequence available from the Genbank, the number in lineage 3 refers to
the number of base pairs 3' of A(J1 exon.


150
_


Figure 2-14. Geographical distribution of four separate species and
subspecies of genus Mus. M. m. domesticus. M. m. musculus. M. spretus.
M. spicileaus. M. spretoides.


198
Possible Impact of Retroposons on Ab Gene Expression
Since retroposons are dispersed through the host DNA by
duplicative retroposition, it is likely that they have a major
impact on genomes. The most obvious is their mutagenic
potential due to the disruption of sequences at the site of
integration (Chao et al. 1983). Retroposon integrations in
exons and other regulatory regions would result in null
alleles and might be selected against even in heterozygous
states. However, retroposon insertions in introns and
intergenic regions are more likely to be neutral (reviewed by
Deininger 1990) In addition, there are several examples of
SINE elements found in noncoding and coding regions of
numerous genes without deleterious effects. The insertions
of SINE elements have been used as a signal for
polyadenylation, portion of coding sequence, and termination
signal. In addition, SINEs have been implicated in
recombination (Lehrman et al. 1987) act as limits to gene
conversions (Hess et al. 1983) and mobilize unrelated DNA
sequences throughout the genome either via retroposition of
sequences adjacent to SINEs (Zelnick et al. 1987) or by
facilitating recombination. The SINE elements and repetitive
family member identified in various Ab lineages are all
positioned in intron 2. Presumably, these retroposons may
not have any drastic impact on Ab gene function as this intron
has 5' splice site with GT dinucleotide and 3' splice site


225
Luckett, W. P. and Hartenberger, J. L. 1985. Evolutionary
relationships among rodents. A multi-disciplinary analysis.
Plenum Press, New York.
Malissen, B., Peele-Price, M., Goverman, J. M., McMillan,
M., white, J., Kappler, J., Marrack, P., Pierres, F.,
Pierres, M., Hood, L. 1984. Gene transfer of H-2 class II
genes: Antigen presentation by mouse fibroblast and hamster
B cell lines. Cell 36: 319.
Maloy, W. L., Coligan, J. E. 1982. Primary structure of
2Db alloantigen II. Additional amino acid sequence
information, location of a third site of glycosylation and
evidence for K and D region specific sequences.
Immunoqenetics 16: 11.
Marrack, P. and Kappler, F. 1986. The antigen-specific,
major histocompatibility complex-restricted receptor on T
cells. Adv. Immunol. 38: 1.
Marshall, J. T. Taxonomy. 1981. In Foster, H. L., Small, J.
D., Fox, J. G., (eds.), The Mouse in Biomedical Research,
vol. I, pp. 17-25, Academic Press, Inc., New York, N.Y.
Martin, M. A., Bryan, T., Rasheed, S. and Khan, A. S. 1981.
Identificastion and cloning of endogenous retroviral
sequences present in human DNA. Proc. Natl. Acad. Sci. U. S.
A. 78: 4892.
Maruyama, T., and Nei, M. 1981. Genetic variability
maintained by mutation and overdominant selection in finite
populations. Genetics 98: 441.
Mathis, D.J., Benoist, C. 0., Williams, V. E. II, Kanter, M.
R., McDevitt, H. 0. 1983a. The murine E^ immune response
gene. Cell 32: 745.
Mathis, D. J., Benoist, C., William II, V. E., Kanter, M.
and McDevitt, H. 0. 1983b. Several mechanisms can account
for defective E gene expression in different mouse
haplotypes. Proc. Natl. Acad. Sci. U. S. A. 80: 237.
Mayer, W. E., Jonker, M., Klein, D., Ivanyi, P., Seventer G.
V., and Klein J. 1988. Nucleotide sequence of chimpanzee MHC
class I alleles: evidence for trans-species mode of
evolution. EMBO J. 7(9): 2765.
McCluskey, J., Germain, R. N., Margulies, D. H. 1985. Cell
surface expression of an in vitro recombinant classll/class
I major histocompatibility complex gene product. Cell 40:
247.


Figure 3-4. Location of two insertional events in a lineage 3 allele
(Abk) Exons are indicated by blank boxes, hatched boxes indicate the
861 bp retroposon in lineage 2 and the two inserted elements are
indicated by solid boxes.


49
Trans-specific evolution. The evolutionary rate of Mhc
loci is not higher than that of any other loci (Hayashida &
Miyata 1983). Although the presumed rapid diversification
within species can be explained by mechanisms such as gene
conversion, an alternative hypothesis has been proposed by
Klein et al. (1980, 1987) According to this hypothesis, the
evolution of Mhc polymorphism is via a trans-species mode,
starting with a number of major alleles that are passed on in
phylogeny from one species to another. During the
evolutionary process the alleles accumulate the mutations,
which result in the extensive diversity of Mhc genes. There
is mounting evidence supporting this hypothesis. McConnell
et al. (1988) assembled a collection of 49 H-2 haplotypes
derived from five Mus species, including Mus m. musculus. Mus
m. domesticus. Mus m. castaneus. Mus spicilequs. Mus spretus.
A total of 31 Ab alleles was defined by RFLP analysis. Based
on the degree of sequence divergence, 31 alleles defined by
restriction fragment length polymorphism (RFLP) can be divided
into three distinct evolutionary lineages. Most of these
alleles (28 out of 31) were in either lineage 1 or 2, both of
which consisted of alleles derived from 4 separate Mus species
(Table 2-1 and Figure 2-8). These findings are consistent
with the trans-species evolution of Ab gene and contrast with
data obtained when other nuclear genes or mitochondrial DNA
(mtDNA) polymorphisms were analyzed in mice from the same
populations. Genomic sequence comparisons of Abd and Abb show


215
Bogenhagen, D. F., Sakonju, S. and Brown, D. D. 1980. A
control region in the center of the 5S RNA gene directs
specific initiation of transcription. II. The 3' border of
the region. Cell 19: 27.
Bonhomme, F. 1986. The evolutionary relationships in the
genus Mus. In Potter, M., Nadeau, J. H. and Cancro, M. P.,
(eds.), The Wild Mice in Immunology. Curr. Top. Microbiol,
and Immunol. 127: 19.
Bono, M. R., Strominger, J. L. 1982. Direct evidence of
homology between human DC-1 antigen and murine I-A
molecules. Nature (London) 299: 836.
Boyce, E. A., Beauchamp, G. K., Yamazaki, K. 1983. The
sensory perception of genotypic polymorphism of the major
histocompatibility complex and other genes: some
physiological and phylogenetic implication. Human
Immunoqenetics 6: 177.
Braunstein, N. S., and German, R. N. 1987. Allele-specific
control of I molecule surface expression and conformation:
Implications for a gereral model of la stucture-function
relationships. Proc. Natl. Acad. Sci. U. S. A. 84. 2921.
Breathnach, R., Benoist, C., O'hare, K. Gannon, F., and
Chambn, P. 1978. Ovalbumin gene: Evidence for a leader
seguence in mRNA and DNA sequence at the exon-intron
boundaries. Proc. Natl. Acad. Sci. U. S. A. 75: 4853.
Britten, R. J., & Kohne, D. E. 1968. Repeated sequences in
DNA. Science. 161: 529.
Brown, J. H., Jardetzky, T., Saper, M. A., Samraoui, B.,
Bjorkman, P. J., and Wiley, D. C. 1988. A hypothetical model
of the foreign antigen binding site of class II
histocompatibility molecules. Nature (London) 332: 845
Busk, H., Thomsen, B., Bonven, B. J., Kjeldsen, E., Nielsen,
O. F., and Westergaard, O. 1987. Preferential relaxation of
supercoiled DNA containing a hexadecameric recognition
sequence for topoisomerase I. Nature (London) 327: 638.
Buus, S., Sette, A., Colon, S. M., Miles, C., and Grey, H.
M. 1987. The relation between major histocompatibility
complex (MHC) restriction and the capacity of la to bind
immunogenic peptides. Science. 235: 1353.
Caras I. W., Davitz, M. A., Rhee, L., Weddell, G., Martin,
D. W. and Nussenzweig, V. 1987. Cloning of decay-
accelerating factor suggests novel use of splicing to
generated two proteins. Nature (London) 325: 545.


202
1972). However, it is difficult to demonstrate frequency
dependent selection caused by pathogen evolution as it
requires long term studies to observe cycles due to pathogen
evolution.
If pathogen assemblages vary in space and time, and
specific Mhc alleles are more effective against one subset of
pathogens than others, then natural selection would favor
different subsets of Mhc alleles according to the current
pathogen assemblages. This type of selection would contribute
to the maintenance of Mhc polymorphism because different
alleles would be maintained in different populations.
Unfortunately, the data available concerning pathogens are
not sufficient to test this hypothesis.
Disassortative mating according to Mhc genotypes would
contribute to the maintenance of polymorphisms. This
mechanism involves olfaction and the genes responsible have
been mapped to Mhc loci (Yamazaki 1976; Boyce et al. 1983).
Transmission distortion, proposed by Clarke and Kirby
(1966), also favors the production of Mhc heterozygotes. On
the surface, both mating preferences and transmission
distortion resemble heterozygote advantage in that they result
in an excess proportion of heterozygotes. However, they are
more effective at maintaining polymorphism because rare
alleles have an advantage in all genotypes, whereas under
heterozygote advantage, rare alleles enjoy an advantage only
in the heterozygote condition (reviewed by Potts et al. 1988).


Page
Figure 4-14 PCR amplification of DNA samples from
lineage 3 alleles and recombinant inbred strains. 150
Figure 4-15 A typical RFLP analysis and restriction
mapping 153
Figure 4-16 Restriction analysis of PCR-amplified
products 155
Figure 4-17 Summary of the evolutionary relationship
among four lineage Ab alleles 158
Figure 5-1 Restriction maps of 86 Ab alleles derived
from Table 5-1 170
Figure 5-2 Diagram illustrating the evolutionary
origins of the 4 lineages of Ab alleles assayed . 179
Figure 5-3 Example of a restriction site allele used
for parsimony analysis 183
Figure 5-4 Phylogenetic relationships of 86 Ab alleles
derived from 12 species and subspecies of genus
Mus 189
Figure 5-5 Phylogenetic relationships of 86 Ab alleles
from 12 species and subspecies of Mus 192
x


231
Singer, M. F. 1982. Highly repeated sequences in mammalian
genomes. Int. Rev. Cvtol. 76: 67.
Slagel, V., Flemington, E., Traina-Dorge, V., Bradshaw, H.,
Deininger, P. 1987. Clustering and subfamily relationships
of the Alu family in the human genome. Mol. Biol. Evol. 4:
19.
Smith, L. J., Braylan, R. C., Nutkis, J. E., Edmundson, K.
B., Downing, J. R., and Wakeland, E. K. 1987. Extraction of
cellular DNA from human cells and tissues fixed in ethanol.
Anal. Biochem. 160: 135.
Southern, E. 1975. Detection of specific sequences among DNA
fragments separated by gel electrophoresis. J. Mol. Biol.
98: 503.
Snell, G. D. 1968. The H-2 locus of the mouse, observation
and speculations concerning its comparative genetics and its
polymorphisms. Folia Biol. 14: 335.
Spencer, J. S. and Kubo, R. 1989. Mixed isotype class II
antigen expression. A novel class II molecule is expressed
on a murine B cell lymphoma. J. Exp. Med. 169: 625.
Steeg, P. S., Moore, R. N. Oppenheim, J. J. 1980. Regulation
of murine macrophage la-antigen expression by products of
activated spleen cells. J. Exp. Med. 152: 1734.
Steinmetz, M., Malissen, M, Hood, L., Orn, A., Maki, R. A.,
Dastoormikoo, G. R., Stephan, D., Gibb, E. and Romaniuk, R.
1984. Tracts of high or low swquence divergence in the
mouse major histocompatibility complex. EMBO J. 3: 2995.
Steinmetz, M., Minard, K., Horvath, S., McNicholas, J.,
Frelinger, J, Wake, C., Long, E., Mcah, B. and Hood, L.
1982a. A molecular map of the immune response region from
the major histocompatibility complex of the mouse. Nature
(London) 300: 35.
Steinmetz, M., Moore, F. K. W., Frelinger, J. G., Sher, B.
T., Shen, F.-W., Boyse, E. A. and Hood, L. 1981. A
pseudogene homologous to mouse transplanation antigens :
Transplantation antigen are encoded by eitht exons that
correlate with protein domains. Cell 25: 683.
Steinmetz, M., Stephan, D., and Fischer-Lindahl, K. 1986.
Gene organization and recombinational hotspots in the murine
major histocompatibility complex. Cell 44: 895.


9
Following a gap of about 170 kb, a second gene cluster of
330 kb in length has been cloned from the S region containing
(C4, Sip. Bf. C2) coding for complement or related components
and two homologous genes (21-OHA and 21-OHB), one of which
encodes for steroid 21-hydroxylase (Muller et al. 1987). A
third gene cluster covering 500 kb of DNA has been isolated
from the D and Qa regions and localizes the positions of 13
class I genes(D to 01-10) (Stephan et al. 1986), the TNF-a and
-B genes coding for cytotoxins (Muller et al. 1987b). From
the Tla region, a total of 19 class I genes are distributed
in 3 gene clusters. In summary, the Mhc complex of the BALB/c
mouse contains 50 loci, of which 34 loci are class I and 7 are
class II genes (Steinmetz & Uimatsu 1987) Whereas in the Mhc
of C57BL/10 mouse, 26 class I genes have been identified, of
which 10 genes are in the 0a2,3 regions and 13 genes in the
TL region (Flavell et al. 1985). Among 3 H-2 haplotypes (b,
d and k) analyzed thus far (b, d and k), the K and the class
II regions show no large differences in organization (Klein
& Figueroa 1986).
Genetic loci of class I gene
There are two class I genes (H-2K and H-2K1) at the
centromeric end of the H-2 region; all the remaining genes are
at the telomeric end. The class I loci can be divided into
two subclasses: I-a, consisting of loci with a known function
(H-2K, H-2D. H-2L) and I-b, consisting of the remaining loci


Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy
STABLE ALLELIC LINEAGES OF MHC CLASS II GENES
WITHIN THE GENUS MUS
By
Cheng-Chan Lu
December, 1990
Chairperson: Dr. Edward K. Wakeland
Major Department: Pathology and Laboratory Medicine
Previous studies have organized alleles of the Mhc class
II Ab gene into 3 evolutionary lineages based on genomic
structures. The major distinction between lineage 1 and 2 is
an 861 bp retroposon in the intron separating the A^ and Ap2
exons in lineage 2 alleles. By using this retroposon as an
evolutionary tag, we have extended our molecular genetic
studies of Ab to include 115 independently derived H-2
haplotypes from 12 separate species and subspecies of genus
Mus. Ab alleles from lineage 1 and 2 were found in all 3
aboriginal species (Mus spretus. Mus spicelious. and Mus
spretoides) and in Mus caroli. indicating that these two
lineages of Ab alleles diverged a minimum of 2.5 million years
ago. Parsimony analysis of 86 Ab alleles, using restriction
site as a character state, indicated that lineage 3 alleles
xi


185
Table 5-2. continued
TT6
BRNO-1
CADIZ-1
PAN-B
BFM
BNC
DBP
DGD
DOT
BIB-2
BEP-2
DJO-2
DSD-2
MAI
MBB-2
MBS-2
MBT
MDS
MPW
MYL-1
MYL-2
MOL
SEI
SEG-1
SPE
SET-1
SFM-2
SMA-1
SMA-2
ZRU-1
ZRU-2
ZYD-2
ZYP-2
KAR-2
10 20 29
00010010011000100010000100110
00110010111000100010010100110 50
00000010111000100010010110110
00100110011017700010010110110
00010010011000100010000110110
00101010011000000010010110110
00101010011177700010011110110
00101010011000100010000100110
00100010011000000010010110110
00100010011000100010000100110
00100010111000100000011110100
00100010111000100010010100110 60
00100010011000100010000100110
00110010111000100011710110010
00100000010000000010000100110
00100010111000100010010100110
00101010011000000010010110110
00111010011000100010010100110
00101010111000100010010100110
00110010011001000011710110110
00101000011000000010010110110
00101010011000100010010100110 70
00010010111000000010010110110
00110010111001000011010110110
10101070011000100010010110110
00110010011000100011710110110
00110010111001000011010110110
00000010011000000010010110110
00110010111001000010010110110
00100110011017700010010110110
00100100011000000010010110110
00110010011001000010010110110 80
00110010011017700010010110110
00100010011000000011700010010
Character set derived from Figure 5-1 and Table 5-1 The
numbers on the top of column indicate the character number
described in Table 5-2, 1: indicates the presence of the
specified restriction site, 0: indicates the absence of
restriction site, 7: indicates the restriction site is
undetermined.


26
studies (McNicholas et al. 1982; Mathis et al. 1983a; Malissen
et al. 1984; Benoist et al. 1983; Larhammar et al. 1983;
Estess et al. 1986). The sequence data available suggest that
the mouse I-A and I-E molecules are homologous to human DQ and
DR class II genes, respectively (McNicholas et al. 1982;
Malissen et al. 1983a; Larhammar et al. 1983) Each class II
molecule consists of two extracellular domains, al and a2 or
pi and /?2, each about 90 residues in length, a transmembrane
region of about 30 residues, and a cytoplasmic tail of about
10-15 residues. Three of the four extracellular domains (a2,
pi and p2) have a centrally placed disulfide bridge spanning
about 60 amino acid residues, while the al does not. The
membrane proximal domains of both a and p, like that of class
I molecules, show strong homology to immunoglobulin constant-
region domains. In this respect, the class I and class II
molecules are very similar to each other in overall
organization and domain structure. For each of the two
polypeptide chains of class II molecules, a and p chains, the
polymorphic residues are concentrated in the al and pi amino-
terminal domains (Benoist et al. 1983; Larhammar et al. 1983).
These domains are responsible for binding peptides in what
appears to be a single site. By aligning the sequences of
class II a and p chains with the class I heavy chain by
matching the al and pi domains of class II with the al and
a2 of class I, a hypothetical tertiary structure for class II
molecules has been proposed (Brown et al. 1987) (Figure


113
TTTCGAGACAGGGTTTCTCTGTGTAGCTCTGGCTGTCCTGGAACTCACTTTGTAGACCAG
direct repeat
GCTGGCCTCGAACTCAGAAATCCGACTGCCTCTGCCTCCCAAGTGCTGGGATTAAAGGCA
"Alu-like" repeat(Bl)
>5/
TGAACCACCACGCCCGGCCCCTTTAACTTTTAATATCCTCTTTGTCTTAAGATGAGTCCA
Non-repetitive element
GGCTGGCCTCCGTTCTCCACAATGCCCCTGCCTCAGCCTCTCATGCTCTCCACAGCAAAG
CCTATATCCTTTTATGTGAAACATAGGTATATAGTTTAATGTGTTTATTACCTGCAATGG
3 '<
CTGGGAATGGAACCCAACCAAGGCTTCAAGGCCTCCTTCGGCCAATCTGCTCCCAGTCCC
AAGGCTTTTTTTTTTTTTTTTTTTTTTCAAGACAGGGTTTCTCTGTATAGCCCTGGCTAT
"Alu-like" repeat(Bl)
CCTGGAACTCACTTTGTAGACCATGCTGGCCTCCAACTCAGAAATCTGCCTGCCTCTGCC
TCCCGAGTGCTGGGATTAAAGCATGCGCCACCATGCCCGGCTACTTAAATTTTTTTGTTT
GTTTGTTTGTTTGTCTGTTTGTTTCGAGACAGGGTTTCTCTGT
direct repeat


3
distribution of various Ab lineages within the genus Mus and
how long these Ab lineage have persisted in the genus Mus.
We have addressed this issue by expanding the RFLP analysis
to include 115 independently-derived H-2 haplotypes derived
from 12 separate species and subspecies of genus Mus. A total
of 86 Ab alleles was identified from this analysis. Parsimony
analysis, using restriction site as a character state, was
also exploited to construct the evolutionary trees of Ab
alleles to determine their phylogenetic relationships. DNA
sequence and restriction enzyme analysis indicate that Ab
genes can be divided into 4 distinct evolutionary lineages,
which are generated from three independent insertional events.
The presence of various lineages in different species and
subspecies of Mus further the idea that the Mhc genes evolved
in a trans-species fashion and they have persisted over long
evolutionary timespans in genus Mus.


Figure 5-1. continued
171
H
BgPv
Pv
P\H
Ps^Pv
H Bg
Bg
BS H E Pv
COK | [ | I I
r r
BSP>H Sx
II 1 1
B
|
v
E B S HBg
1 II II
B<
BS H E
CRV MI 1
3
Pv
Ll
r p.
BSPvH S
II II
> U
fl

v
BES H Bg
1 1 'll
CRPI
BS H B9Pv
B S
B
HBg
S H
BS H
PAH MI
Pv
1
S
Sbv
III
<
si
Pv
f
B S
PTXI 1 1
Pv
1
BS
II
H
1
s
s
B
1
>v
BS
II
SxB
PTX II 1
Pv
J
BS
II-
H
I

5h
B
I
>v
BS 1 kb
u
I
BS H Bg P\E
B10.F III 111
B S PvH SP1
Mil I
>v
E B S Bg |
J LL
P o'
5h_
BS H Ba P\E
B10.RUI II 111
S PvH SR
I I I
:
5v
E B S H Bg
1 II II
BS H Bg P\E
B10.SMU I III
p-
S PvH SJ
M
L
V
BS Bg H
1 1 II
BS H Bg P\E
B10.SAA481 I 111
p Su 3E site 5.0 Kb past H
Rl/Pv
SPvH SJ re B S H Bg
i i i Lu i j ii
BS Bg P\E
B10.BUAI I III
s p!
/Pv S PvH S J
l I II I
B
1
v
E B S H Bg
1 II II
H
BS Bg P\E
MET-2 U 1 I I
* P1
/PvSPvH SJ
1 L LL J
> (i
A
E
i
v
E B S H Bg
i...- .. IJ LL


"Alu-like" Repetitive
Element
Non-repetitive
Element
"Alu-like" Repetitive
Element
100 bp
111


13
Class I polypeptide. Class I protein has a mol. wt. of
45,000 daltons and is a transmembrane glycoprotein
noncovalently associated with 02-microglobulin (02m) a
12,000-dalton polypeptide encoded by a gene located on
chromosome 2 in the mouse (Goding et al. 1981; Michaelson et
al. 1981; Robinson et al. 1981). Amino acid sequence analyses
have demonstrated that class I antigen can be divided into 5
domains (Coligan et al. 1981). The three external domains,
al,a2 and a3, are each about 90 residues in length. The
transmembrane portion is about 40 residues and the cytoplasmic
region is about 30 residues long. The a2 and a3 domains have
a centrally placed disulfide bridge spanning about 60 residues
and up to three N-linked glycosyl units bound to these domains
(Maloy et al. 1982) Amino acid sequence analyses also
suggest that the a3 domain (Strominger et al. 1980) and 02-
microglobulin (Peterson et al. 1972) show strong sequence
homology to the constant region domains of immunoglobulins.
Binding studies from class I molecules with peptide fragments
have shown that the 02m subunit associated with the a3 domain
(Yokoyama et al. 1983).
Three dimensional model of class I molecules. Recently,
a three dimensional structure of human class I molecule HLA-
A2 was studied by X-ray crystallographic analysis (Bjorkman
et al. 1987a, b) Soluble HLA-A2 was purified and
crystallized after papain digestion of plasma membranes from


CHAPTER 5
EVOLUTION OF MHC CLASS II GENE POLYMORPHISMS
RFLP Analysis of Ab Genes Within Genus Mus
One of the goals of this dissertation is to find out the
distribution of Ab lineages among the various species and
subspecies in the genus Mus and to determine how long these
Ab lineages have persisted in the genus Mus. Mouse is an
excellent system in which to measure the time of divergence
as the phylogenetic relationships of various species and
subspecies have been studied extensively by various techniques
(She et al. 1990a). Previously, McConnell et al (1988) have
shown that Mhc class II Ab genes can be grouped into three
evolutionary lineages on the basis of retroposon
polymorphisms. However, the number of species and subspecies
of Mus included in their analysis was limited in scope. The
results of their analyses in terms of lineage distribution of
Ab genes in various species and subspecies are shown in Table
2-1 and Figure 2-8. In this dissertation, by Southern blot
hybridization, DNA sequence analysis and PCR amplification,
115 Ab genes have been analyzed and reorganized into four
distinct lineages. Furthermore, this analysis expands the
molecular genetic study of Ab genes to 12 separate species
159


I certify that I have read this study and that in my
opinion it conforms to acceptable standards of scholarly
presentation and is fully adequate, in scope and quality, as
a dissertation for the degree of Doctor of Philosophy.
William E. Winter
Associate Professor of Pathology
and Laboratory Medicine
This dissertation was submitted to the Graduate Faculty
of the College of Medicine and to the Graduate School and was
accepted as partial fulfillment of- the requirements for the
degree of Doctor of Philosophy. n
December 1990 ^
Dean,
Medicine
College of