Citation
Characterization of a transgenic mouse expressing the HSV-1 latency associated transcript

Material Information

Title:
Characterization of a transgenic mouse expressing the HSV-1 latency associated transcript
Creator:
Gussow, Ann M
Publication Date:
Language:
English
Physical Description:
xv, 112 leaves : ill. (some col.) ; 29 cm.

Subjects

Subjects / Keywords:
Cells ( jstor )
DNA ( jstor )
Human herpesvirus 1 ( jstor )
Infections ( jstor )
Introns ( jstor )
Neurons ( jstor )
Polymerase chain reaction ( jstor )
Promoter regions ( jstor )
RNA ( jstor )
Transgenes ( jstor )
Department of Molecular Genetics and Microbiology thesis Ph.D ( mesh )
Dissertations, Academic -- College of Medicine -- Department of Molecular Genetics and Microbiology -- UF ( mesh )
Herpesvirus 1, Human -- pathogenicity ( mesh )
In Situ Hybridization -- methods ( mesh )
Mouse, Transgenic ( mesh )
Polymerase Chain Reaction -- methods ( mesh )
Virus Latency ( mesh )
Genre:
bibliography ( marcgt )
theses ( marcgt )
non-fiction ( marcgt )

Notes

Thesis:
Thesis (Ph. D.)--University of Florida, 2004.
Bibliography:
Includes bibliographical references (leaves 104-111).
Additional Physical Form:
Also available online.
General Note:
Typescript.
General Note:
Vita.
Statement of Responsibility:
by Anne M. Gussow.

Record Information

Source Institution:
University of Florida
Holding Location:
University of Florida
Rights Management:
Copyright Anne M. Gussow. Permission granted to the University of Florida to digitize, archive and distribute this item for non-profit research and educational purposes. Any reuse of this item in excess of fair use or other copyright exemptions requires permission of the copyright holder.
Resource Identifier:
022760136 ( ALEPH )
56537056 ( OCLC )

Downloads

This item has the following downloads:


Full Text











CHARACTERIZATION OF A TRANSGENIC MOUSE EXPRESSING THE HSV-1
LATENCY ASSOCIATED TRANSCRIPT
















By

ANNE M. GUSSOW













A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY

UNIVERSITY OF FLORIDA

2004

































Copyright 2004

by

ANNE M. GUSSOW

































To my husband, Karl, who is my best cheerleader,
and my son, Seth, who is too young to understand.















ACKNOWLEDGMENTS

I would first like to thank my mentor, Dr. David Bloom, for his guidance and

direction in the completion of this work and for providing me with the opportunity to

complete my doctoral studies at the University of Florida. I would also like to thank my

committee, Dr. Richard Condit, Dr. Sue Moyer, and Dr. Paul Reier, for their useful

discussions and suggestions to this project.

I would like to thank Dr. Robert Bonneau for encouraging me to apply to graduate

school and for giving me a start in my research career, and Dr. Eddie Castaneda for

helping to ease my transition from Arizona State to the University of Florida.

I would like to express my gratitude to the people who have worked with me in

Dave's lab over the years, both the ASU group, Rick Jarman, Robert Tran, Jerry O'Neil,

Niki Kubat, Melanie Paquette, and Lee Gary, as well as the UF group, Tony Amelio,

Zane Zeier, Nicole Giordiani, Peterjon McAnany and Loretta Arrue. Each of them has

brought a special quality to the lab that will not be forgotten.

The biggest acknowledgment goes to my husband, Karl, and my son, Seth.

Without the love and support of both of them this goal would have fallen short a long

time ago. I thank Karl for the 2500 miles of 1-10, I hope the journey has been worth the

sacrifices that he has made as a result. Although Seth is too young to understand any of

this, coming home to his simple outlook on life has put things into perspective on many

occasions.




iv









I also want to thank my mother who has listened to the ups and downs all along the

way and always been supportive of me no matter what. It's been a long journey around

the country and I'm finally going to "settle down" in one place. To my brothers, Marty

and Karl, who haven't understood all of what my research is about, thanks for listening

and pretending to understand. To Cathy Kostick, who has been like a sister to me, thank

you for always being there through the years, in good times and in bad, your friendship

means more to me than I can express.

Last but certainly not least, I would like to thank my friends who have been there

for me every time that I was ready to give up; those of you who reminded me to do the

next right thing, take it one day at a time and put first things first. In no particular order:

Corliss, Aileen, Julie, Betty, Sheila, Eve, Heather, Leona, Martha Ann, Jennifer, Sarah,

Claire, Alice, Polly, Joan, Mary Ellen, Marty, Ted, Steve, Dale, Rosemary, Julia, Casey,

Diedre, Buster, BJ, Warren, Jim, Walt, Dan, and Joe; you are each a special part of my

life and of making this dream come true. And to whomever I have forgotten, you know

who you are, and I thank you.





















v
















TABLE OF CONTENTS
Page

ACKNOW LEDGM ENTS ........................................................................................... iv

LIST OF TABLES ..................................................................................................... viii

LIST OF FIGURES ............................................................. ........................................ ix

KEY TO SYM BOLS ....................................................................................... ............ xi

ABSTRACT............................................................................................................... xiv

CHAPTER

1 INTRODUCTION ........................................................................... .........................

HSV Clinical Features........................................................................................... 1
Immune Response to HSV.................................................... .......................... 2
General HSV Characteristics ............................................................................... ....3
HSV Gene Regulation .......................................................................................... 6
Animal M odels of HSV Latency and Reactivation ....................................... .......... 11
Function of LAT ................................................................................................. 13
Use of Transgenics to Study Disease ......................................................................18
Hypotheses to be Tested Using Transgenic Approach .......................................... 20

2 GENERATION OF TRANSGENIC MOUSE EXPRESSING A PORTION OF
THE HSV-1 LATENCY ASSOCIATED TRANSCRIPT...................................23

Overview ...........................................................................................................23
M aterials and M ethods............................................................................................24
Results .....................................................................................................................33
Discussion .........................................................................................................41

3 EXPRESSION PROFILE OF THE LAT TRANSGENE ......................................43

Overview ...........................................................................................................43
M aterials and M ethods....................................................... ........ .....................44
Results ...............................................................................................................51
Discussion .........................................................................................................67




vi









4 CHARACTERIZATION OF THE EXPRESSION OF LAT IN TRANS ON THE
COURSE OF HSV-1 INFECTION IN MICE .................................................73

O verview ............................................ .............. ............... ..........................73
M aterials and M ethods .........................................................................................74
R esults ........................................................................ .............................................78
D iscussion ............................................................................................ .. 85

5 OVERALL CONCLUSIONS .................................. .....................................88

APPENDIX

A MAP AND SEQUENCE OF THE pLAT/LAT PLASMID................................ 91

B PCR PRIMER SEQUENCES ............................................................ 98

C EXPRESSION OF THE LAT TRANSGENE IS NOT AGE DEPENDENT........100

LIST OF REFERENCES...................................................................................... 104

BIOGRAPHICAL SKETCH .................... .................................... ..... ...... 112































vii















LIST OF TABLES

Table page

2-1 Determination of transgenic copy number by real-time PCR................................35

3-1 Quantitation of LAT Expressing Cells in Dorsal Root Ganglia by in situ
hybridization for the LA T 5' exon ..................................................................... .... 63

B-1 Conventional PCR Primers and Locations......................................... ......................98

B-2 Real time PCR Primer and Probe Sequences ......................................................99


































viii
















LIST OF FIGURES

Figure page

1-1 Diagram of the HSV-1 virion................................................................................ 4

1-2 Diagram of the HSV-1 genom e............................................................................. 5

1-3 Regulation of the different HSV gene promoter classes..........................................7

1-4 Diagram of the function of HSV-1 LAT........................................... ............... 13

2-1 Diagram of the LAT Transgene Insert ..................................................................26

2-2 HSV transgene copy number determination by slot blot hybridization analysis.....34

2-3 Mapping of the LAT transgene in the LAT transgenic mouse...............................37

2-4 PCR mapping the transgene insert ...................................................................... 38

2-5 Expression of the LAT transgene........................................................................ 40

3-1 Expression of the LAT transgene per gram of tissue ............................................53

3-2 Expression of the LAT transgene normalized to 18s RNA......................................55

3-3 LAT transgene expression is not age dependent in tissues typically involved in the
HSV infection when normalized on a per weight basis .........................................58

3-4 Expression of the LAT transgene is not age dependent in tissues involved in the
HSV infecction when calculated per cell by normalizing to 18s RNA....................58

3-5 In situ hybridization of a latently infected dorsal root ganglia ..............................59

3-6 In situ hybridization for 5' LAT exon................................ ....................................61

3-7 In situ hybridization for LAT intron in transgenic DRG .......................................62

3-8 In situ hybridization for LAT 5' exon in brain.................................................64

3-9 In situ hybridization of the transgenic brain with LAT intron probe .....................65

3-10 In situ hybridization in the transgenic spinal cord ........................................ ...66


ix









3-11 In situ hybridization oftransgenic foot .......................................... ............. 68

3-12 In situ hybridization in the transgenic kidney .....................................................69

4-1 Relative amounts of infectious virus in the feet of transgenic and non-transgenic
mice infected with HSV-1 strain 17+ during acute times post infection...............79

4-2 Titer of infectious virus in DRG of transgenic and non-transgenic mice infected
with HSV-1 strain 17+ at acute times post infection .......................... ..... 80

4-3 Quantitation of HSV-1 genomes present in mice infected with HSV-1 17+ at latent
tim es post infection ........................................... .......................... ..... ..........81

4-4 Reativation of HSV-1 from transgenic and non-transgenic mice by explant co-
cultivation of latently infected DRG ................................... .......... ............83

4-5 Diagram of the LAT region of HSV illustrating the location of the 17A480 virus
and the LAT transgene in relation to the virulence function of LAT.......................84

4-6 Relative amounts of infectious virus in feet of transgenic and non-transgenic mice
infected with a deletion mutant of HSV-1 at acute times post infection..................84

4-7 Relative amounts of infectious virus in DRGof transgenic and non-transgenic mice
infected with a deletion mutant of HSV-1 at acute times post infection..................85

A-1 Plasmid map of the HSV-1 LAT transgenic construct.......................... ... 91

C-1 Expression of the LAT transgene in neural tissues................................................101

C-2 Expression of the LAT transgene in non-neural tissues......................................... 101

C-3 Expression of the LAT transgene in neural tissues represented as copies per 18s
R N A ....... ......................... ........... .................................. ................................102

C-4 Expression of the LAT transgene in non-neural tissues represented as copies per
18s R N A ...... ............................................................................... ..................... 103














x














KEY TO SYMBOLS


C degrees Celsius
AL antisense to LAT
ANOVA analysis of variance
P-gal beta galactosidase
bp base pair
Br brain
CaC12 calcium chloride
cDNA copy deoxynucleic acid
cm centimeter
CMV cytomegalovirus
CO2 carbon dioxide
CPE cytopathic effect
cpm counts per minute
CRE cyclic AMP response element
CTL cytotoxic T lymphocyte
dATP adenosine triphosphate nucleotide
dCTP cytosine triphosphate nucleotide
dGTP guanine triphosphate nucleotide
dTTP thymine triphosphate nucletide
DEPC diethyl pyrocarbonate
DNA deoxyribonucleic acid
DRG dorsal root ganglia
EDTA ethylenediaminetetraacetic acid
TE TRIS/ EDTA buffer
F foot
FFLB formaldehyde loading buffer
FHP formamide prehybridization/ hybridization buffer
fmol femtomole
g centrifugal force
HC1 hydrochloric acid
HSV Herpes Simplex Virus
HSV-1 Herpes Simplex Virus Type 1
HSV-2 Herpes Simplex Virus Type 2
ICP infected cell protein
IFNy interferon gamma
K kidney
kb kilobases
kg kilogram
LAP1 latency associated promoter 1


xi










LAP2 latency associated promoter 2
LAT latency associated transcript
LN2 liquid nitrogen
LTE long term expression element
Lv liver
IpL microliter
[Ig microgram
(IM micromolar
mg milligram
mL milliliter
mM millimolar
M molar
MEM minimum essential medium
MgC12 magnesium chloride
MHC major histocompatibility complex
MMLvRT Muloney Murine Leukemia Virus reverse transcriptase
MOI multiplicity of infection
MOPS N-morpholino propanesulfonic acid
N normal
NaCl sodium chloride
NaOH sodium hydroxide
ng nanogram
NGF nerve growth factor
nt nucleotide
P32 phosphorus-32
PBS phosphate buffered saline
PCR polymerase chain reaction
pfu plaque forming unit
pg picogram
pol polymerase
QRT-PCR quantitative RT-PCR
RCR reactivation critical region
RNA ribonucleic acid
RL long repeat
Rs short repeat
RS rabbit skin cells
RT reverse transcriptase
RT-PCR reverse transcriptase- polymerase chain reaction
S35 sulfur-35
SDS sodium dodecylsulfate
SPF specific pathogen free
SSC sodium chloride/ sodium citrate
SV40 simian virus 40
TE TRIS/ EDTA buffer
TG trigeminal ganglia
tRNA transfer RNA


xii









U unit
UL unique long
Us unique short


















































xiii















Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy

CHARACTERIZATION OF A TRANSGENIC MOUSE EXPRESSING THE HSV-1
LATENCY ASSOCIATED TRANSCRIPT

By

Anne M. Gussow

May 2004

Chair: David Bloom
Major Department: Molecular Genetics and Microbiology

Herpes Simplex Virus Type 1 (HSV-1) is a double stranded DNA virus that causes

a life-long infection of its host. The infection is characterized by two phases, the acute

phase and the latent phase. The virus infects epithelial tissue during the acute infection

where it gains access to nerve termini and establishes a latent infection in sensory ganglia

neurons. During latency only a single viral transcript is expressed abundantly, the

Latency Associated Transcript (LAT). LAT is most abundantly transcribed in neurons,

and the 5' portion of the transcript has been implicated in the establishment and

reactivation of latent infections. In order to study the regulation of LAT expression in

neurons in the absence of viral functions, a transgenic mouse line was created in the

C57B1/6 background containing the region encoding the LAT 5' exon through the 2.0kb

intron under the control of its native promoter. Characterization of this transgenic mouse

indicates that there is a single copy of the transgene inserted into the mouse genome and

LAT expression is abundant in a number of tissues including dorsal root ganglia (DRG),



xiv









brain, skin, liver, and kidney. Additionally, in situ hybridization indicates that expression

of the transgene in the DRG is limited to a subset of cells, similar to what occurs during a

natural HSV infection.

During HSV infection of the transgenic mouse, expression of the transgene has no

effect on the amount of virus produced during the acute infection in feet, DRG, or spinal

cord. Since LAT has been implicated as playing a role in establishment and reactivation

of latency, we sought to determine whether expression of the transgene affected the

ability of the wild type virus to establish and reactivate from a latent infection. PCR for

HSV DNA in DRG detected no difference between transgenic and non-transgenic mice

following establishment of HSV latency. Reactivation by explant co-cultivation of

latently infected DRG exhibited a similar pattern of reactivation for both transgenic and

non-transgenic mice. Taken together, the infection data suggest that LAT is not

functioning in trans to regulate the HSV infection. This suggests that LAT acts in cis to

regulate reactivation.























xv














CHAPTER 1
INTRODUCTION

HSV Clinical Features

Herpes viruses are characterized by their ability to establish a life-long infection

of their host with long periods of latency during which the virus exists in ganglionic

neurons with only a single transcript detected abundantly. Herpes Simplex Virus Type 1

(HSV-1) infection causes lesions commonly known as cold sores. A large portion of the

world population, up to 90% in some areas, has been exposed to HSV-1 by adolescence

and produce detectable antibodies to the virus (Roizman and Sears, 1996).

Herpes infections have been described since the days of ancient Greece. Infection

with HSV-1 is typically characterized by lesions of the epithelium of the mouth or lips,

although it can infect other mucosal areas, such as the eyes. A closely related

Herpesvirus, HSV-2, causes the same type of lesions, although they are primarily genital

in nature (Roizman and Sears, 1996).

The initial phase of infection or primary infection lasts two to three weeks and is

often asymptomatic in young children. Once the lesions have healed, the virus enters a

latent state where it exists asymptomatically in sensory nerve ganglia. Latency is

interrupted by periods of reactivation, which is the result of stress. During reactivation,

lesions can recur at the initial site of infection. The frequency and severity of

reactivations vary depending upon the individual, although the duration of reactivation

lesions is typically shorter than the primary lesions, and asymptomatic shedding is

common (Roizman and Sears, 1996).


1






2


HSV infection is particularly dangerous in immunocompromised individuals.

Due to the inability to mount an immune response to the virus, these patients may

develop a number of more severe symptoms such as keratitus, which can lead to

blindness (Whitley, 1990). Newborns exposed to primary infection or reactivating HSV

at birth are susceptible to systemic infection that could result in fatal encephalitis

(Anderson and Nicholls, 1972).

Current treatments for HSV infection include several nucleoside analogs in either

topical or oral forms that reduce the severity of reactivations and shorten the duration of

lesions. Vaccines have been developed using peptides, attenuated viruses, and killed

viruses, all of which provided limited protection against recurrences. No cure is currently

available for HSV infection (Koelle and Corey, 2003).

Immune Response to HSV

The immune response to HSV-1 involves both specific and non-specific

mechanisms. In the initial stages of infection, CD4+ cells activate macrophages and

produce IFNy. The activated macrophages produce other cytokines to affect other

immune cells. Later in the immune response, CD8+ cytotoxic lymphocytes and antibody

producing B cells provide specific immunity that helps to clear virally infected cells

(Whitley, 1996).

Like other viruses, HSV has developed methods to evade the immune response.

For example, it establishes latency in an immune privileged site neurons do not

normally express MHC class I or II. This site of latency greatly reduces the likelihood of

CTL-mediated destruction of the host cell (Ward and Roizman, 1998). An example of

the ability of HSV to evade the humoral immune response is gC, an HSV virion






3


glycoprotein that can bind to the complement factor C3b and limit the induction of the

complement cascade (Chen et al., 2003)

In order to determine the role of the immune system in the latent phase of HSV

infection, a number of mouse strains deficient in specific aspects of the immune response

have been infected. These strains were each compared to the relatively HSV-resistant

C57B1/6 strain which contains a functional immune system. C57B1/6 mice can be

infected with HSV and establish a latent infection but do not develop encephalitis as a

result of infection (Lopez, 1975; Kastrukoff et al., 1986). In contrast, SCID mice are

highly susceptible to HSV as a result of being deficient in both T and B cells. Even so, it

was suggested that HSV has the potential to establish latency at early times post-infection

in these mice as defined by the observation of neuronal LAT expression in ganglia 1-2

days post infection (Gesser et al., 1994). Interferon knockout GKO mice exhibited a

delay in the peak of viral productive infection, but latency was established at a normal

rate and HSV infection was not lethal to these mice, suggesting that interferon

stimulation of the immune response is not necessary to resolve the acute infection. The

moderately susceptible Balb/c strain resulted in a stronger productive infection than seen

in C57B1/6 mice, but no differences were seen in the relative ability of HSV to establish

latent infections in these different mouse strains with known differences in immune

backgrounds (Ellison et al., 2000). These studies imply that establishment of latency is

the result of a virus neuron response and not mediated by the immune response since

latency was established in all strains tested.

General HSV Characteristics

HSV-1 is the prototype of the alphaherpes virus family causing life-long infection

of the host. The virus particle is enveloped with at least eleven glycoproteins present on






4


the surface. The capsid of the virus is icosahedral in shape and the space between the

envelope and the capsid, known as the tegument, contains proteins involved in the initial

stages of infection. A diagram of the HSV-1 virion structure in Figure 1-1 illustrates the

enveloped capsid with glycoproteins present on the outer surface of the envelope

(Roizman and Sears, 1996). Grunewald et al. (2003) were able to use electron

microscopy to clarify the HSV virion structure illustrating that the capsid arrangement in

the tegument is asymmetrical and that the some 750 glycoprotein spikes present on each

virion are arranged in an organized manner on the envelope surface.


















Figure 1-1. Diagram of the HSV-1 virion. HSV is an enveloped virus with an
icosahedral capsid and glycoproteins present on the envelope surface
(Roizman and Sears, 1996).

The HSV infection is characterized by three phases. During the initial infection or

establishment phase, lesions are seen primarily on the oral mucosa. The virus then enters

sensory nerve termini and is transported to the sensory ganglia where it establishes a

latent infection. The latent phase of infection is characterized by transcriptional activity

from a single viral region encoding the latency associated transcripts (LAT), while the






5


remainder of the genome is silenced. Latent infection is interrupted by periods of

reactivation where productive infection resumes and the virus travels through the nerve

axons back to the initial site of infection where lesions are seen on the skin surface

(Roizman and Sears, 1996).

The HSV-1 genome consists of approximately 152 kilobases (kb) of double-

stranded DNA. The genome (Figure 1-2) consists of two unique regions, the unique long

(UL) and the unique short (Us), each flanked by two repeated regions, the long repeat

(RL) and the short repeat (Rs). The repeat regions are joined together by the "a"

sequence, a 500bp highly

RL UL RL Rs Us Rs




LAT LAT

Figure 1-2. Diagram of the HSV-1 genome. HSV possesses a double-stranded DNA
genome that is organized into two repeat regions, the repeat long (RL) and the
repeat short (Rs), each flanking unique regions, the unique long (UL) and the
unique short (Us). The repeat regions are joined together by the "a" sequence.
Also shown is the region encoding the latency associated transcripts (LAT).

conserved region of small repetitive elements. HSV genes are identified by their relative

time of expression rather than by their position in the genome. The classes of expression

are alpha (a), beta (P), and gamma (y).

During the latent infection, the viral genome associates with cellular histone

proteins and circularizes to form an episome, thus existing as a "mini-chromosome" in

the infected cell. It has recently been determined that episome formation occurs in the

absence of lytic HSV gene products and the ICPO gene may be involved in the prevention

of circularization (Jackson and DeLuca, 2003).






6


HSV Gene Regulation

Immediate Early Genes

The alpha genes, also known as immediate early, peak in expression 2-4 hours

post infection and include infected cell proteins (ICP) 0, 4, 22, 27, and 47. Transcription

of the alpha genes is initiated by a complex including the HSV-1 tegument protein VP 16

(also known as ctTIF) binding to the TAATGARAT octamer located in the immediate

early promoters (Mackem and Roizman, 1982). Of the immediate early genes, ICP4 is a

strong trans-activator of the early and late viral genes and is essential for viral replication.

ICP4 binds to both consensus ATCGTC and non-consensus motifs in several other HSV

gene promoters or 5'untranslated regions. The trans activation function is promoted by

ICP4 binding to DNA as well as the transcription factors TBP and TFIIB (Smith et al.,

1993).

While not essential, ICPO is believed to have multiple functions, including that of

a non-specific transactivator (Cai and Schaffer, 1992) and a disruptor of ND10 regions in

the nucleus (Davido et al., 2003). The exact purpose of ND 10 structures in the nucleus

has not been determined, but they may be involved in replication and during the infection

a number of HSV proteins interact with ND10. Other studies suggest that ICPO is

involved in reactivation from latency since the latency associated transcripts are

expressed from the opposing strand of DNA in the same region as ICPO. Expressing

ICPO in trans from an adenovirus vector was sufficient to induce reactivation in latently

infected primary trigeminal ganglia cultures (Halford et al., 2001). These data support the

theory of LAT acting as a switch to turn on ICPO during reactivation. The involvement

of ICPO in reactivation will be discussed further in the section on LAT function.






7


A -300 +1
F`




B -105 -61 +1






C
-"7


-48 +1
D




E
-870 -141 +1 +600

----- --



LAP LAP 2

Figurel-3. Regulation of the different HSV gene promoter classes. A. Immediate early
genes. B. Early genes. C. Late genes. D. Leaky Late genes. E. LAT gene.
Abbrv: INR, initiator element. DAS, downstream activating sequence.
LAP1, latency associated promoter 1. LAP2, latency associated promoter 2.






8


Control of the immediate early genes is primarily under the direction of cellular

transcription factors although viral binding sites are also present (Figure 1-3). In addition

to a TATA box, immediate early promoters contain several SP1 binding sites and binding

sites for the VP16 viral activator protein. The ICP4 binding sites in the promoter allow

for down regulation of these genes by ICP4 as the course of infection progresses.

Early Genes

Early P genes include genes involved in viral replication such as the viral

polymerase and thymidine kinase. These genes show peak expression 5-7 hours post

infection. Despite containing only cellular elements in their promoters including SP1

sites, CAAT and TATA boxes (Figure 1-3), early genes require the viral ICP4 protein to

stimulate expression through interaction with the TATA element (reviewed in Weir,

2001).

Late Genes

Structural proteins such as the glycoproteins and tegument proteins make up the

group of late y genes which are expressed only after viral replication has occurred

(Roizman and Sears, 1996; Wagner et al., 1998). Late genes are divided into two sub-

classes, yl and y2. yl genes are leaky lates and can be transcribed in small quantities

before viral DNA synthesis has occurred. The y2 class consists of strictly late genes and

dependent upon viral replication.

Promoter sequences for the late genes are much less complicated than the

promoters for the two preceding kinetic classes and are limited to a TATA element and a

portion of the 5' noncoding region of the transcript acting as an enhancer for high levels

of expression (Levine et al., 1990). Expression of some viral genes are required for late






9


expression, and as an example, a transgenic mouse containing the gC promoter driving

p-gal exhibited no expression of P-gal in neuronal or non-neuronal tissues (Loiacono et

al., 2002). An example of both late promoter classes is presented in Figure 1-3.

The Latency Associated Transcript

During the latent period of infection, LAT is produced abundantly from the long

repeat region of the genome. LAT is the only HSV-1 transcript that has not been

classified in one of the classes of genes mentioned above (immediate early, early, or late).

The LAT RNA is made as an 8.3-kb primary transcript and is spliced into several smaller

RNAs. The most abundant LAT RNA is the 2kb intron that exists as a stable lariat

structure with a >24 hour half life (Farrell et al., 1991; Thomas et al., 2002). The stability

of the LAT intron may be due to the non-consensus branch point that allows for

generation of the lariat structure during splicing (Wu et al., 1998). Additionally, in

latently infected trigeminal ganglia a 0.5 kb region is spliced out of the 2 kb intron

resulting in a second stable 1.5 kb species (Spivack et al., 1991; Alvira et al., 1999).

There has been no direct evidence that LAT is translated into a protein during the

HSV infection despite extensive studies including sequence analysis (Drolet et al., 1998),

transient expression assays (Thomas et al., 1999), and site mutagenesis of ATG's (Bloom

et al., 1996). Some of these studies were able to generate a LAT protein outside of the

context of the natural viral infection, but there is no evidence to date that this protein is

expressed during infection (Coffin and Thomas, 1998; Thomas et al., 1999).

Transcription of LAT begins near the TATA box consensus sequence with the

promoter extending as much as 870 nucleotides upstream of the transcription start site

(Lokensgard et al., 1997). Several cellular regulatory sites have been identified in the






10


LAT promoter region including cyclic AMP response elements (CRE), Spl sites, CAAT

box, USF, YY1 and AP-2 (Kenny et al., 1994; Soares et al., 1996; Wagner and Bloom,

1997) as shown in Figure 1-3. The presence of cellular regulatory regions suggests

possible cellular control of the LAT promoter which will be examined in the experiments

presented in the following chapters.

A second, TATA-less promoter, LAP2 (latency associated promoter 2) has been

described in the region 3' of the LAP1 transcription start site (Figure 1-3). This region of

DNA contains elements such as a G/C rich segment that are found in housekeeping genes

and those genes involved in signal transduction pathways. Transcription from LAP2 is 5-

10 fold less abundant than from LAP as determined by transient expression with a CAT

reporter (Goins et al., 1994). LAP2 is active during the acute phase of the animal

infection and also in cell culture of both neuronal (SY5Y) and non-neuronal (CV-1) cells

but LAP2 is not active during the latent phase of infection in the absence of LAP1 core

promoter elements (Nicosia et al., 1993). The exact transcription start site for LAP2 has

yet to be mapped and further studies are necessary to determine the function of

transcript(s) derived from the LAP2 promoter. For the remainder of this dissertation the

LAT promoter refers to the LAP1 promoter unless otherwise noted.

Previous research has stated that LAT promoter activity is different in different

cell types. In addition to expression in neurons during latency, Jarman et al. (1999)

reported that LAT is expressed in murine feet during the acute infection following

footpad infection using P-gal reporter viruses. The expression was seen two to four

days post infection on both the dorsal (infected) and ventral sides of the foot and is in

contrast to only low levels of LAT expression observed in non-neuronal cells in culture









(Zwaagstra et al., 1990; Jarman et al., 1999). Additionally, more LAT expression was

seen in neuronal cell types (ND7 and C1300) than in non-neuronal rabbit skin cells using

in vitro infections (Coffin et al., 1998). Further studies with LAT promoter deletions

revealed LAT expression differences between neuronal cell cultures and infected dorsal

root ganglia neurons (Dobson et al., 1995). This suggests that different neuronal cell

types contain different levels or types of transcription factors and that there may be

neuronal specific elements in the LAT promoter. In vivo two regions in the promoter, -75

to -83 and -212 to -348 relative to the transcription start site, showed increased activity

in neuronal cells as opposed to non-neuronal cells (Kenny et al., 1994).

Sensory ganglia contain a variety of cell types, both neuronal and non-neuronal.

Margolis et al. (1992) analyzed some neuronal markers of neurons in mouse sensory

ganglia that corresponded with either sites ofHSV-1 LAT expression, or HSV-1 acute

antigen expression and determined that the neuronal population expressing SSEA-3+ as a

surface marker exhibited the highest percentage of LAT expression during acute infection

in the absence of acute antigen. These differences in LAT promoter activity could be

dependent on specific transcription factors present in different cell populations (Dobson

et al., 1995; Yang et al., 2000).

Animal Models of HSV Latency and Reactivation

A number of animal model systems are used to study latency and reactivation. In

the mouse, infection of the footpad results in latency in dorsal root ganglia (DRG).

While not the natural route of infection, the footpad is a large epithelial surface that can

support a uniform infection and dissection of infected tissues can be performed easily.

One limitation to the mouse model is that HSV reactivation does not result in virus being

transported to the primary site of infection as it does in humans. Local reactivation in the






12


ganglia can be induced however, in one of two ways: co-cult explant of DRG or

hyperthermal stress.

The explant model uses the stress caused by dissection of the ganglia from the

mouse to initiate reactivation. Dissected ganglia are incubated in tissue culture media

and infectious virus is detectable in the media by 2 weeks after explant. Mimicking one

of the natural causes of reactivation, fever, the hyperthermia model involves raising the

body temperature of the mouse to 430C for 10 minutes to induce reactivation. While this

model initiates the lytic cycle, lesions have not been seen at the initial site of infection but

virus can be detected in the sensory ganglion at 24 hours post stress (Sawtell and

Thompson, 1992).

Another common model of HSV infection is the rabbit ocular model. Prior to

HSV infection rabbit corneas are scarified to allow for a more uniform infection surface.

In this model, latency is established in the trigeminal ganglia and HSV can either

spontaneously reactivate or be induced to reactivate using iontophoresis of epinephrine to

mimic the host stress response (Hill et al., 1986).

There is one non-animal model of reactivation that involves culture of primary

neurons in the presence of NGF. For infection, acyclovir (the nucleoside analog used to

inhibit HSV lytic genes) and NGF are added to the media so that a quiescent infection is

established without killing the neurons. Acyclovir is removed once establishment has

taken place and reactivation can be induced by removal of NGF from the media (Colgin

et al., 2001). These quiescent cultures are the closest system available to an in-vitro

latency model, most tissue culture systems have the ability to support a lytic infection,

but not establish latency.







13


Function of LAT

Establishment and Reactivation

LAT has been linked with a number of different functions during the acute

infection, although the most extensive body of data supports a role of LAT in the

establishment of and/or reactivation from latency (Wagner, 1991; Roizman and Sears,

1996). The regions of LAT involved in these functions and the others described here are

depicted in Figure 1-4.

Using overlapping dermatomes in the mouse, Speck and Simmons (1991) were

able to demonstrate the establishment of latency (production of LAT) in the absence of

lytic gene production, thus suggesting that lytic and latent pathways can diverge early in


+1
.-... Intron


-161 +424

Virulence Effects
+76 +1667

LTE
+30 +661


Anti Apoptosis
-161 +1667

(LAP2)

AL
-198 +158 +661


Figure 1-4. Diagram of the function of HSV-1 LAT. Different regions of LAT have
been implicated in many functions. The location of these functions are mapped
here including the reactivation critical region (RCR), virulence effects, the long
term expression element (LTE), and anti-apoptotic region. Also included here is
the location of the antisense to LAT transcript, AL.






14


the infection. Separation of the establishment and reactivation functions was determined

by a number of LAT mutants that maintain the ability to establish latency but do not

reactivate (Bloom et al., 1994; Bloom et al., 1996; Wang et al., 1997).

These viruses delete either the core promoter sequences of LAT or a region of the

LAT 5' exon. Another LAT mutant, containing a large deletion encompassing both the

LAT promoter and 827 bp of the 5'exon, established 75% fewer latent infections than its

wild type parent virus. It was predicted that this reduction may be due to an increase in

neuronal cell death in the ganglia (Perg et al., 1994; Thompson and Sawtell, 2001).

Since this virus contains deletions of both LAP1 and LAP2, and is phenotypically distinct

from a LAP1 mutant, further studies are needed to determine if the increase in neuronal

cell death is related to multiple but genetically separable LAT functions.

Reactivation is typically related to a stress event for the host. In the rabbit eye

model, reactivation is seen after iontophoresis of epinephrine onto the eye surface. In the

mouse thermal stress model, reactivation of HSV is seen after an increase in basal body

temperature. On a cellular level, the mechanism by which stress is translated to

reactivation is not known.

Deletion of the LAT core promoter eliminates the ability to reactivate, but viral

DNA is still detected in neuronal ganglia. In addition to the LAT promoter, deletions of

regions downstream of the transcription start site and extending into the intron have been

shown to be important in HSV reactivation. The specific function of this region remains

unknown, but deletions of a 348 bp fragment as well as a 371 bp Styl fragment located

within the region result in reduced reactivation in the rabbit model (Bloom et al., 1996;

Hill et al., 1996; Jarman et al., 2002). Smaller deletions in this region do not affect






15


reactivation therefore, the act of expressing some LAT is not sufficient for reactivation,

and presumably either specific RNA sequences or cis acting DNA elements located

within the 5' exon are important for reactivation (Bloom et al., 1996; Bhattacharjee et al.,

2003). The 5' exon region and the LAT core promoter are referred to as the reactivation

critical region (rcr).

Since expression of RNA itself is not sufficient for reactivation, other

mechanisms of LAT action have been proposed. The regulation of reactivation and/or

establishment may be at the DNA level. Many cellular genes use methylation of CpG

islands as an epigenetic method of regulating transcription. In these genes, a methyl

group is added to the cytosine of the DNA at regions to be either silenced or transcribed.

Previous studies determined that methylation was not present in the HSV genome as a

whole, but did not look at specific promoter regions of the genome. Using bisulfite

analysis Kubat et al. (2004) determined that there is no pattern of methylation as a form

of regulating HSV latent transcription.

These data suggest that instead of methylation, the virus uses the DNA chromatin

structure and its association with specific histone proteins as a means of regulation.

Further studies indicate that there is a difference in the chromatin acetylation pattern

during latency when comparing the LAT promoter to other acute HSV promoters (Kubat

et al., 2004).

Virulence

Several LAT deletion mutants have an effect on virulence in either mice, rabbits,

or both experimental systems. The dLAT1.5 virus contains a 5'exon deletion of-1600bp

and is increased for virulence in mice. Increased virulence in rabbits and decreased

virulence in mice were seen with LAT2.9A which contains only a 371 bp deletion in the






16


5' LAT exon. This virus was also reduced for spontaneous reactivation in the rabbit

(Perng et al., 1999).

Other mutants deleting either a portion of the 5'exon (A307) or the 3' portion of

the intron (A480) exhibit decreased virulence (Gary et al., in preparation). These

experiments on the whole indicate that there are differences in the infection between mice

and rabbits since the deletion viruses produce different effects dependent on the model

system used. Further studies are necessary to determine the mechanism employed by

these viruses in both the mouse and rabbit models.

Enhancer

A number of studies have demonstrated that the LAT core promoter, by itself, is

not sufficient to direct long-term expression (Margolis et al., 1993). The long-term

expression element (LTE) has been described as the region of the 5' exon from PstI to the

splice junction (Berthomme et al., 2001). Analysis using reporter constructs containing

this region downstream of the core LAT promoter continued to express P-gal at 40 days

post infection while the control (containing just the LAT core promoter) had no

expression at 28 days post infection (Lokensgard et al., 1997). Transient expression

experiments containing the LTE showed that the LTE region can activate the HSV-1

thymidine kinase promoter in both neuronal and non-neuronal cells (Berthomme et al.,

2000). These data suggest that the LTE contains an enhancer element and functions to

promote long term LAT expression.

Neuronal Survival

LAT has also been implicated as a suppressor of apoptosis. A large LAT deletion

(-161 to +1667 relative to the LAT transcription start site) demonstrated increased






17


apoptosis by both TUNEL and PARP assays (Pemg et al., 2000). Ahmed, et al. (2002)

stated that plasmids lacking the sequences in the 5' LAT exon were least efficient in

blocking apoptosis, and that this region appears to contribute to cell survival. This is the

same region that contributes to the virulence and reactivation phenotypes mentioned

above (Figure 1-4). Additionally, Thompson and Sawtell (2001) have used LAT null

viruses to examine cell survival during infection. They showed that 75% less

establishment of latency occurred in the LAT null virus and this was accompanied by a

large amount of neuronal death. They propose that one function of LAT is to protect

sensory neurons from death and enhance the establishment of latency.

Other Possible LAT Functions

Since LAT is transcribed antisense to ICPO and the ICPO gene is one of the first

promoters activated in the lytic cascade, it was believed that LAT could have an antisense

effect on ICPO expression. A portion of the 2 kb LAT intron overlaps with the ICPO

transcript. In clonal cell lines containing these regions ofDNA, Burton et al. did not find

an antisense effect with ICPO when expressing LAT in trans in non-neuronal cells

(Burton et al., 2003). This does not mean that LAT cannot act in cis to affect the ICPO

region of transcription, perhaps acting on the DNA itself or in a structural manner to open

or close the region of DNA.

Another antisense function involves the transcript AL (antisense to LAT) which is

transcribed 6-8 hours post infection in PC-12 cells. AL is located in the 5'exon and core

promoter region of LAT (Figure 1-4), and may have an opposing or balancing function

with LAT although more research is needed to specifically define AL and its function in

the HSV infection (Pemg et al., 2002). To date the AL transcript has only been detected






18


in productively infected PC-12 cells in culture using RT-PCR, and can not been detected

in vivo.

LAT also has a repressive function. A LAT mutant which had reduced LAT

expression exhibited an increase in the amount of ICP4 and thymidine kinase expression

compared to wild type infection (Chen et al., 1997). A possible mechanism for this

repressive function may be explained by regions of sequence homology to Xist

suggesting that LAT may function to "paint" the HSV chromosome to silence it similar to

Xist painting the inactive X chromosome in mammalian cells (Bloom et al., 1996).

The HSV LAT region encompasses a number of transcripts present on both

strands of DNA. The various functions for LAT presented here may be important at

different times during the course of HSV infection, and some may work in combination

with other viral functions making them difficult to phenotypically dissect in the context

of the virus. It is also possible that some of these functions are not manifest during the in

vivo infection since they have been discovered and tested in cell culture systems only.

This complexity of dissecting LAT functions provides the basis for generating a

transgenic mouse containing this region of LAT DNA to further study its functions in the

absence of the HSV genome and its contributed cis and trans acting viral functions.

Use of Transgenics to Study Disease

Expression of Acute Genes in Transgenic Mice

Transgenic technology has been used to study the roles of genes out of their

native context. To generate a transgenic animal, the gene of interest is injected into the

single cell fertilized oocyte nucleus typically of mice, although other species have been

used as well. By injecting the single cell, the transgene is able to be integrated and

replicated with each cell division and is then present in every cell of the animal. The






19


expression of the transgene is generally dependent upon the promoter used to drive the

inserted gene.

In the case of HSV-1, transgenic mice have been created to study regulation of the

different classes of HSV genes. These mice each contain the HSV promoter in question

driving a lacZ reporter. An ICP4 transgenic mouse expressed such a reporter under the

control of the ICP4 promoter primarily in neuronal tissues, with lower levels of

expression in trigeminal ganglia and retinas and high levels of expression in brain regions

and the dorsal horn of the spinal cord (Mitchell, 1995). Additionally, ICPO and ICP27

transgenic mice demonstrated similar expression in neuronal tissues (Loiacono et al.,

2002). In addition the ICPO and ICP4 transgenic mice were shown to differentially

express the reporter based on the age of the mice. ICP4 transgenic mice had

approximately 100-fold greater expression in newborn mice compared to adults.

Differential expression of ICPO was the reverse of the expression seen with ICP4, with

expression increasing with age. These findings indicate that although HSV immediate

early promoters contain similar regulatory elements, they are regulated differently by

cellular factors in the absence of other HSV proteins. In contrast to the findings with the

IE promoters, both neuronal and non-neuronal cells were negative for expression in a gC

transgenic mouse, illustrating that HSV late promoters require other viral functions for

their expression (Mitchell, 1995; Loiacono et al., 2002).

Expression of LAT in Transgenics

Previously a LAT transgenic mouse had been created to specifically study the

splicing of the 1.5 kb LAT out of the 2 kb LAT intron. This mouse contains the 2 kb

LAT of HSV-1 under control of a CMV promoter. Studies have determined that the

splicing event of the 1.5 kb species is more efficient in neural tissues than non-neural






20


tissues and suggested that the LAT transgenic mouse reactivates more efficiently than

non transgenic littermates (Mador et al., 2003). One of the drawbacks of this transgenic

mouse model is that the CMV promoter was used instead of the native LAT promoter.

The CMV promoter is a strong constitutive promoter that has activity in all cell types.

Thus, while the splicing event may be specific to LAT, expression patterns may permit

splicing in cell types that are non-permissive for the latent HSV infection.

Using the LAT region from HSV-2, Wang et al. (2001) studied establishment and

reactivation in a transgenic mouse. HSV-2 LAT was driven by its native promoter and

had expression to high levels in neural tissues as well as some non-neural tissues

determined by northern blots of tissue RNA. The expression in non-neural tissues was

not expected, but not surprising since Jarman et al. had shown LAT expression in the feet

during acute HSV infection (Jarman et al., 1999). In these mice expressing LAT in trans

had no effect on the HSV-2 infection at the establishment or reactivation level. Since

there are a number of differences in tropism between HSV-1 and HSV-2, and because the

HSV-2 LAT intron is processed differently than that of HSV-1, the construction and

analysis of an HSV-1 transgenic mouse model expressing the HSV-1 LAT from its native

promoter was desirable and the focus of this dissertation.

Hypotheses to be Tested Using the Transgenic Approach

Generation of Transgenic Mouse

In the studies presented here, we have generated a LAT transgenic mouse from

HSV-1 strain 17+. This mouse line uses the native HSV-1 LAT promoter and contains

the region encoding the LAT transcript 5' exon and 2 kb intron. The rationale for using

these regions will be discussed further in Chapter 2. Initial characterization of the mouse






21


includes determination of the transgene copy number, mapping the transgene insert and

gross tissue-level expression studies.

Expression of LAT in trans

Since the LAT transgene is being controlled by the native LAT promoter and the

region of the promoter shown to contain neuronal specific elements was included in the

sequence inserted, it was hypothesized that LAT would be expressed in neuronal tissues.

Data from the HSV-2 transgenic mouse suggests that LAT can be expressed in non-

neuronal cells as well, although the expression was not quantitated (Wang et al., 2001).

In this study, quantitative RT-PCR was employed to determine if neuronal cells could

more efficiently produce the LAT transcript than non-neuronal cells. In addition to

quantitative RT-PCR of RNA extracted from whole tissues, in situ hybridization

techniques were used to determine if expression is from all cells or a subset of cells.

Infections

Effect of LAT on the course of infection

It is known that in the context of the HSV genome LAT is expressed in neuronal

cells during latency. It was possible that expressing LAT prior to the infection, in trans,

could have an effect on the course of infection, such as altering the establishment of

latency, or the ability of the virus to reactivate from latency. To study these effects,

transgenic mice and their non transgenic littermates were infected with wild type 17+

HSV-1. Similar to the observations made in the case of the HSV-2 mouse, we

hypothesized that expressing LAT in trans would not alter the HSV infection, and that

during a natural HSV-1 infection, LAT functions in cis on the HSV genome.






22


Restoration of virulence by expressing LAT in trans

One of the functions attributed to LAT is a change in virulence (Gary et al., in

preparation; Perng et al., 1999). By infecting LAT transgenic mice with a LAT mutant

that is reduced in virulence, we hypothesized that the expression of the transgene

containing the region deleted in the mutant could restore wild type virulence level if the

function can act in trans. In this case, virulence was measured as a function of virus

titers reaching the DRG and assayed by titering the amount of infectious virus present in

feet and DRG during the acute infection following footpad inoculation.

In summary, HSV-1 LAT is a complex region with a number of functions

attributed to it. Generation of a transgenic mouse containing this region can be used to

further define some of these functions a well as to determine which functions are trans-

acting and can be attributed to the expression of the RNA.














CHAPTER 2
GENERATION OF A TRANSGENIC MOUSE EXPRESSING A PORTION OF THE
HSV-1 LATENCY ASSOCIATED TRANSCRIPT

Overview

The latency-associated transcript (LAT) of HSV-1 has been implicated as playing

a role in a number of functions related to the viral infection. The mechanisms of these

functions and the regulation of the LAT transcript have not been determined. To

examine the regulation of the LAT in cells, we have generated a transgenic mouse

containing the LAT inserted into the mouse genome. This therefore has allowed us to

study the LAT's function outside its normal context of the HSV genome.

Transgenic technology was first used in 1980 to inject HSV and SV40 viral

plasmid DNA into a fertilized mouse pronucleus (Gordon et al., 1980); and has since

expanded to include transgenic animals for a number of human disease models and viral

gene models (Nomura, 1997). The use of mice for transgene studies is ideal because of

the knowledge of mouse genetics and the number of different genetic strains available.

Although other transgenic mice containing HSV LATs have been generated, they

did not contain the native promoter sequence or the LAT from HSV-1 (Wang et al., 2001;

Mador et al., 2003). Thus, the HSV-1 LAT transgenic mouse described here is a novel

model system because it allows for LAT to be regulated by its native promoter. This

mouse has provided a means for studying a number of the proposed LAT functions

including reactivation, virulence, and neuronal survival.





23






24


In addition to determining whether a transgenic mouse line expresses its

transgene, characterization of any new transgenic mouse line routinely requires

determining the copy number and the integration site of the transgene. The location of

the transgene in the genome may effect transcription of the transgene by position effects.

If the transgene inserts into a silenced region of the genome, it may not be expressed or

expressed at low levels due to the regulation of the surrounding region of DNA (Sippel et

al., 1997).

The goal of this dissertation was to generate a HSV-1 LAT transgenic mouse to

study LAT regulation by cellular factors in the absence of viral cis and trans factors.

This chapter describes the construction, breeding strategy, and the initial characterization

of the transgene in the HSV-1 LAT transgenic mouse line.

Materials and Methods

Plasmid Used to Generate the Transgenic Mouse

The pLAT/LAT plasmid was generated to construct the transgene insert. A

portion of the HSV-1 strain 17+ latency associated transcript (LAT), including the Dral

site (corresponding to HSV-1 genome base pair 116,516) to the AatII site (corresponding

to HSV-1 genome base pair 121,549), was ligated into a pBluescript backbone at the

Smal site. The SV40 poly A sequence from pNSE-Ex4 (a gift from G. Rail, The Fox

Chase Cancer Center) was removed using EcoRI and inserted at the XbaI site into the

pBluescript plasmid containing the LAT sequence. Figure 2-1 diagrams the region of the

LAT gene used in constructing the transgene as well as its location in the HSV genome.

The complete plasmid sequence and map is presented in Appendix A.






25


Screening for Founders Containing the LAT Insert

Fertilized oocytes were obtained from C3H/HeJ mice. Purification of the

transgene, preparation of mice, microinjection into fertilized oocytes and embryo

implants were carried out by Dr. Glenn Rail at Fox Chase Cancer Center as described

(Hogan et al., 1986; Rail et al., 1995).

DNA from the founder generation (Fl) of mice was obtained by clipping a 1 cm

portion of the tail from anesthesized mice. Tail clips were incubated overnight at 500C in

0.5 mL STE buffer (50 mM TRIS pH 8, 100 mM NaC1, ImM EDTA, 1% SDS) and 1 mg

Proteinase K. After incubation, hair and bone were removed by centrifugation at 20,000

x g and the supernatant transferred to a new centrifuge tube. DNA was extracted with

equal amounts of phenol and sevag (1:24 ratio of isoamyl alcohol and chloroform)

followed by extraction with sevag alone. DNA was precipitated with 100% ethanol. The

DNA pellet was resuspended in TE (10mM TRIS, ImM EDTA) pH 8 and quantitated by

spectrophotometry at A260. The founder generation was screened by Glenn Rail using

slot blot hybridization analysis. Briefly, 10 p.g of DNA per slot of a slot blot apparatus

was applied to a nylon membrane for hybridization as described by Rail et al. (1995).

The membrane was probed with a 32P-labeled DNA fragment from either the SV40 poly

A sequence in the pNSE-Ex4 plasmid or a portion of the LAT transgenic insert fragment

corresponding to 119,193 to 120,090 nucleotides (nt) of the HSV-1 strain 17+ genome.

The nt determinations for all genomic HSV sequences presented in this dissertation are

according to McGeoch numbering (Perry and McGeoch, 1988).

Genotyping of subsequent generations was determined by PCR analysis. DNA

was prepared from tail clips as described above. pLAT/LAT plasmid DNA was used as a






26




RL U. RL Rs Us R







ICPO
Primary transcript LAT
8.5kb










Transgene Insert

Dra I Aat II
SV40pA

-


Figure 2-1. Diagram of the LAT Transgene Insert. Shown is the HSV-1 genome with the
LAT region expanded to include the location of the LAT and ICPO genes. LAT is further
expanded to illustrate the exact region included in generating the transgenic mouse. For
the transgene insert the promoter is illustrated as a dotted line. A SV40 poly A sequence,
shown here in red, was added to stabilize the expressed RNA.

positive control for all genotyping PCR reactions. PCR primers were located in the 5'

exon region of LAT corresponding to nt 118,888 to 119,037 of the HSV-1 genome

(forward: 5'CGG CGA CAT CCT CCC CCT AAG C3' and reverse: 5'GAC AGA CGA

ACG AAA CAT TCC G3'). Each reaction contained 200 ng of tail DNA, 0.5 uM of






27


each primer, 1.5 mM Tris pH 8.8, 16.6 mM ammonium sulfate, 2 mM magnesium

chloride, 0.17 mg bovine serum albumin, 1.25 mM each dGTP, dCTP, dATP, dTTP and

2.5 U Taq polymerase (Perkin Elmer). PCR was performed using a Ericomp

thermalcycler (San Diego, CA) using the following conditions: one cycle 3 minutes 940C,

3 minutes 550C, 3 minutes 720C followed by 30 cycles 1 minute 940C, 1 minute 55C, 1

minute 720C.

PCR products were viewed on a 7% polyacrylamide gel using SYBR green

(Molecular Probes, Invitrogen) and a Storm Phosphoimager. The intensity of the tail

DNA amplification products were compared to PCR's of dilutions of the positive control

pLAT/LAT plasmid to determine the transgenic genotype by quantitating the intensity of

the bands using Image Quant software.

Breeding of Transgenic Mice

All mice were maintained under specific pathogen free (SPF) conditions with

access to food and water at will. Each cage contained corn cob bedding and cotton

nestlets. Cage bedding was replaced bi-weekly.

The positive founder mouse was backcrossed with a C57B1/6 mouse and the

resulting litter screened by hybridization for presence of the LAT transgene. The F2

generation transgenic positive mice were again backcrossed in the C57B1/6 background.

All breeder animals were at least 8 weeks old. Initial C57B1/6 breeders were obtained

from Harlan. A small C57B1/6 colony was then maintained to provide C57B1/6 breeders.

Mice were maintained as for the transgenic colony although only a single breeder pair

was needed and genotyping was not necessary for these mice.






28


Transgenic breeder cages contained one male with up to three females. Males

were kept in the same cage with the breeder females for one week to ensure pregnancy.

At approximately 18 days post breeding, females were separated into individual cages to

deliver their litters. Pregnant females and newborns were monitored at least twice daily

for difficulty with delivery and/or nurturing. Pups remained with their mother for three

weeks until they were weaned and sex-separated. Genotyping of the weanlings was

performed approximately one week after weaning.

Backcrosses continued until obtaining the F10 generation at which time the

transgenic background was considered to be genetically C57B1/6 and were crossed with

F10 littermates to generate homozygous transgenics. All mice used in the studies

described here are heterozygous for the LAT transgene and were of at least the F4

generation.

Determination of Transgene Copy Number

Slot blot hybridization

Slot blot hybridization was used to determine transgene copy number. DNA from

tail clips of weanlings was isolated and quantitated as described above for genotyping.

For each sample 10 ptg DNA, 15 pIL 3 M NaOH, and 130 iL TE in a final volume of 175

pL was vortexed and incubated at 65C for 30 minutes. During the incubation, the slot

blot apparatus (Gibco BRL) was loaded with Zeta Probe membrane (Bio Rad) pre-wet in

water followed by 15x SSC. Incubated samples were ice-quenched and 165 pL of 2 M

ammonium acetate added just prior to loading into the blot apparatus. Vacuum was

applied after all the samples had been loaded.






29


Prior to hybridization the blot was baked for two hours in a vacuum oven at 800C.

Pre-hybridization and hybridization were carried out at 650C in 20 mL of hybridization

buffer (5x SCC, 5x Denhardt's solution, 1% SDS) in a sealed bag with each incubation

lasting overnight. ATD19 probe (nt 119,664 to 119,972 bp of the HSV genome) labeled

with 32P was added to the buffer after the first overnight incubation. The labeled blot was

washed twice for 15 minutes each at room temperature with 0.3 M NaC1, 0.06 M Tris pH

8.0, 0.002 M EDTA followed by two washes for 15 minutes each at 650C with 0.3 M

NaC1, 0.06 M Tris pH 8.0, 0.002 M EDTA, 4% SDS. After washing the blot was dried

on Whatman paper and exposed to a phosphor screen overnight. The intensity of the

radiolabled bands was detected on a STORM phosphorimager and quantitated using

image quant software.

Real time PCR

To confirm and further quantitate the transgene copy number, a comparison

between the cellular Xist gene and LAT transgene was made using real time PCR.

Reactions were performed using primers specific for the 5' exon of the LAT and Xist.

Primer and probe sequences were 5'LAT forward: 5'GGC TCC ATC GCC TTT CCT,

5'LAT reverse: AAG GGA GGG AGG AGG GTA CTG, 5' LAT probe: 5'TCT CGC

TTC TCC CC, Xist forward: 5'GCT CTT AAA CTG AGT GGG TGT TCA, Xist reverse:

5'GTA TCA CGC AGA AGC CAT AAT GG, Xist probe: 5'ACG CGG GCT CTC CA.

PCRs were performed on an ABI Prism 7700 thermal cycler (Applied Biosystems)

located in the ICBR protein core at the University of Florida. Ten-fold dilutions of the

LAT transgenic plasmid (pLAT/LAT) corresponding to 104 to 10' copies were used to

generate a standard curve. For the Xist cellular control, a standard curve of the pBl/B10






30


plasmid, a generous gift of Dr. Jeannie Lee (Shibata and Lee, 2003), was diluted 10 fold

between 105 and 10'. Samples were run in triplicate. Each reaction contained 10 ng tail

DNA, 0.33 pL 60x Assay Mix (primer/probe set), 10 JiL Taqman Universal PCR Mix

(Applied Biosystems part #430437) in a final volume of 20 p.L. PCR was performed in

96 well plates under the following conditions: 1 cycle 2 minutes 500C, 1 cycle 10 minutes

950C, 40 cycles 15 seconds 950C 1 minute 600C.

Mapping of Transgene Insert

Mapping of the LAT DNA inserted into the transgenic mouse was determined

using both conventional and real time PCR. For conventional PCR, reactions contained

600 ng each of forward and reverse primers, 20 IL Hot Master PCR mix (Brinkman

Eppendorf) and 200 ng tail DNA in a 50 tL final reaction volume. Control PCR

reactions contained 600 ng each of forward and reverse primers, 20 pL Hot Master PCR

mix and 0.5 ng pLAT/LAT plasmid DNA in a final reaction volume of 50 pL. Primer

sequences, genome locations and optimal conditions for all primer sets used are found in

Appendix B.

Real time PCR was used for two regions of the transgene, one in the promoter and

one in the 5' exon. Primer and probe sequences for these reactions are found in Appendix

B. All real time reactions were performed on an ABI Prism 7700 thermal cycler (Applied

Biosystems) located in the ICBR protein core at the University of Florida. Samples were

run in triplicate. For each reaction, 50 ng of tail DNA was added to 0.33 pL 60x Assay

Mix (primer/probe set) or 1 pL 20x Assay Mix, and 10 pL Taqman Universal PCR Mix

(Applied Biosystems part #430437) in a final volume of 20 (pL. Control reactions used 1

ng ofpLAT/LAT plasmid in place of the tail DNA. PCR was performed in 96 well plates






31


under the following conditions: 1 cycle 2 mintues 50C, 1 cycle 10 minutes 950C, 40

cycles 15 seconds 950C 1 minute 600C.

Northern Blot of Transgenic RNA

Harvesting of transgenic tissues

Transgenic mice were euthanized with halothane and brain, DRG, liver, kidney,

and foot were dissected. Tissues were snap frozen in liquid nitrogen and stored at -80C

until processed for RNA.

Isolation of RNA from tissues

Tissues were homogenized in 400 (tL Trizol reagent (Invitrogen) using Kontes

glass tissue grinders (Fisher) or a ceramic mortar and pestle for larger tissues (i.e. skin,

feet, liver). Sterile sand was added to the mortar to aid in grinding of the feet. Grinders

were rinsed twice with 400 ptL Trizol each and this rinse solution added to the ground

tissue fraction. After 5 minutes at room temperature, 240 jiL of chloroform was added

and homogenates vortexed 15 seconds followed by a 5 minute incubation at room

temperature. Tissue homogenates were centrifuged at 9,000 x g for 15 minutes at 4C

and the aqueous phase containing the RNA was removed to a separate tube. The bottom

Trizol layer was stored at -800C for subsequent back-extraction of DNA, if necessary.

RNA was precipitated with 500 tL of isopropanol at room temperature for 10

mintues followed by centrifugation at 12,000 x g for 10 minutes at 40C. RNA pellets

were washed with 1 mL 70% ethanol and centrifuged 5 minutes at 40C, 7,500 x g. The

resulting pellet was air dried briefly and resuspended in 200 ptL diethyl pyrocarbonate

(DEPC, Sigma)-treated water.






32


Preparation of formaldehyde-agarose gels and blotting of RNA

To prepare the gel for RNA, a slurry of 1 gram of agarose was prepared in 75 mL

of sterile DEPC-treated water and microwaved to melt the agarose. The melted agarose

was then cooled to approximately 600C and, just prior to pouring the gel, 20 mL of 5X 3-

(N-morpholino) propanesulfonic acid (MOPS) and 5.3 mL of a 37% formaldehyde

solution (v/v) was added and mixed gently to prevent bubbles from forming in the gel.

The gel was allowed to harden for at least one hour before loading the RNA.

For each RNA sample, 5 pg of RNA was mixed with 15.5 mL FFLB (10 parts

formamide, 3.5 parts 37% formaldehyde, and 2 parts 5x MOPS) in a total volume of 20

|tL and incubated for 15 minutes at 650C. Samples were snap-cooled on ice prior to

loading on the gel, and 2 pL of RNA dyes (50% glycerol, ImM EDTA, 0.25%

bromophenol blue, 300 pg/itl ethidium bromide) were added to each sample for loading.

Running buffer consisted of 160 mL 5x MOPS, 43 mL 37% formaldehyde q.s. to 800 mL

with DEPC-treated water. The RNA was electrophoresed at 85 volts for approximately 3

hours. The dye front ran approximately 9 cm from the wells on a 14 cm gel. RNA was

viewed using ultraviolet light and photographed with a digital camera (Kodak Photo

Documentation System).

Transfer of RNA to membrane

The RNA was transferred onto to Zeta Probe Nylon Membrane (Bio Rad)

according to the manufacturer's directions. The gel was rinsed briefly in water and

transfer set up using Whatman paper as the wicking for capillary transfer. In addition to

the membrane located on top of the gel, four layers of whatman paper and 2 inches of

paper towels were included. For the transfer solution, 10X SSC was allowed to absorb






33


from the reservoir through the wicking papers at room temperature overnight. The

transferred membrane was rinsed in Nanopure water and baked at 800C in a vacuum oven

for 30 minutes to crosslink the RNA to the membrane.

Hybridization of northern blot

ATD19 probe (corresponding to nt 119,664 to 119,972 from the HSV genome)

was random hexamer primed (Random Labeling Kit, Roche) and labeled with 32P dCTP.

The blot was pre-hybridized for 3 hours at 420C in 20 mL FPH buffer (5X SSC, 5X

Denhardt's solution, 50% Formamide, 1% SDS) in a sealed bag. Labeled probe was

added through a small cut in the corer of the bag and resealed. The hybridization was

incubated overnight at 420C.

The Northern blot was washed twice at room temperature with 50 mL 2X

SSC/0.1% SDS for 5 minutes each followed by two washes in 0.2X SSC/0.1% SDS for 5

minutes each at room temperature. The blot was dried briefly on Whatman paper and

exposed to a phosphor screen for 5 hours. A STORM phosphorimager was used to scan

the blot and the intensity of bands measured by Image Quant software (Molecular

Dynamics, Sunnyvale, CA).

Results

Determination of the Number of Copies of the LAT Transgene

When generating transgenic animals, it is common for multiple copies of the

transgenic insert to be integrated into the animal genome (Ellis et al., 1997). There are a

number of ways to determine the number of integrated copies, including hybridization

and PCR. Initially, we used slot blot hybridization to quantitate the copies of LAT

transgene present in these mice. In this case, the LAT hybridization signal from a known






34

quantity of transgenic-positive tail DNA was compared to the hybridization signal

generated from a known number of copies of LAT plasmid DNA spiked into a negative

tail DNA sample to represent increasing copies per cell of the transgene. Comparison of

the transgenic-positive and transgenic-negative mouse DNA to the control samples

indicated that there was a low number of copies present in the transgenic mouse (figure

2-2). The difficulty in distinguishing between the positive and negative samples may

have been due to an error in dilution of the standards since this involved a

spectrophormetrically determined quantity.

wNr Pos

*W Neg

copy

2 copies




Figure 2-2. HSV transgene copy number determination by slot blot hybridization
analysis. Tail DNA from a transgenic (pos) and non-transgenic (neg) mouse
was compared to known copies of a plasmid containing the transgene, in the
background of tail DNA from a non-transgenic mouse.

Hybridization is not a reliably quantitative method, particularly with low copy

numbers, thus to more accurately evaluate the number of LAT transgenes inserted we

switched to real time PCR. For this system of analysis, a cellular gene of known copy

number, Xist, was compared to the number of copies of LAT in transgenic tail DNA.

Since Xist is located on the X chromosome, the sex of the animal was taken into

consideration and the copies of Xist for female mice was divided by 2 to standardize
^^~g^M IPYit
























consideration and the copies of Xist for female mice wias divided by 2 to standardize






35


samples to compare the LAT transgene to a single copy of the cellular control for both

male and female samples. Table 2-1 contains the PCR data for the cellular and LAT PCR

reactions. Although the copy number determined by this analysis is less than one, when

taking into account the error of the samples, and the fact that there has to be an integer

number of copies, the most likely interpretation is that there is only a single copy of LAT

present in these mice.

TABLE 2-1 Determination of transgenic copy number by real-time PCR.
Xist Copies' LAT copies LAT/Xist

1 3.03 x 10 1.28 x 10 0.422 +/-0.109
2 1.56 x 10 5.43 x 102 0.348 +/- 0.209
3 1.47 x 10 4.30 x 102 0.293 +/-0.193
4 2.69 x 103 2.80 x 10 1.041 +/- 0.306
5 3.39 x 10 5.83 x 103 1.720 +/- 0.385
Average 0.765 +/- 0.240
S+/- 730 copies

While mosaicism is possible in up to 30% of transgene insertions (Wilkie et al.,

1986), the genetic inheritance from the breeding of these mice does not suggest that a

mosaic is present. In a mosaic animal, the transgene inserted into the genome after the

first cell division and is therefore not present in the genome of each cell in the animal. If

this were the case, only a portion of the germ cells would contain the transgene and thus

less than 50% of the offspring of a transgenic and wild type mating would carry the

transgene. With almost 500 offspring from transgenic and wild type matings to date, we

have not seen evidence consistent with mosaicism in the LAT transgenic mouse.

Mapping of the Transgene Insert

Generation of the transgenic founder mouse was more difficult than usual,

requiring three separate sets of injections to obtain a single founder. Screening for the






36


founder mouse determined that the SV40 poly A signal has been deleted, thus the founder

was LAT positive and SV40 negative (G. Rail, personal communication). PCR analysis

of DNA from transgenic mice was used to confirm the extent of the LAT transgenic

insert present in the transgenic line. As described in the materials and methods, both

conventional and real time PCR were used to map a large portion of the transgene.

Figure 2-3 illustrates the location of primer sets used to map the transgene, and indicates

those that were positive for presence of the transgene. The regions analyzed by

conventional PCR are represented by black arrows, while the regions analyzed by real

time PCR are shown in red. Also shown are the locations of two probes, ATD17 and

ATD19 (shown in blue) which were used in hybridization analyses described later that

also confirmed the presence of the regions of the LAT in the transgenic mouse.

The PCR products resulting from the conventional PCR reactions (figure 2-4)

illustrate bands of the indicated sizes with both pLAT/LAT plasmid and mouse tail DNA.

One additional primer set AG29 and AG31 failed to detect the corresponding LAT

sequences in the DNA from the transgenic mouse. The location of these primers is

represented in green, and corresponds to the 3' end of the transgene insert (figure 2-3).

Since this primer pair (AG29 &31) has failed to detect a product from transgenic DNA it

is believed that a portion of the 3' end of the transgene has been deleted in addition to the

SV40 poly A signal.






37




LAT Promoter Intron


DralI AatII






00 -
00 04
'-4 b -^ >
PO g ,, ,'













M2 Probe
tj to



O -'
oo












LPro 5' LAT






Figure 2-3. Mapping of the LAT transgene in the LAT transgenic mouse. The blue lines
represent the location of hybridization probes positive with the indicated LAT
regions. Black arrows depict primers used for conventional PCR analysis
positive for the transgene, and primers used for real time PCR analyses are
shown in red. Illustrated in green are conventional PCR primers that were
positive in reactions with the transgenic plasmid but not in reactions
containing DNA from the transgenic mouse suggesting that this region has
been deleted.
been deleted.





38



A. Promar DB60, 61 M int M2 Probe




.*" 149

.. -- I101


H20 LAT Tg 20 LAT Tg 20 LAT Tg H20 LAT Tg


B. AG29, 30


228 -



H20 LAT Tg

C. AG29 31
489- 1o


H20 LAT Tg


Figure 2-4. PCR mapping the transgene insert. A. Four primer sets, Promar, DB60&61,
M int, and M2 Probe, all present in both the LAT plasmid (LAT) and
transgenic mouse (Tg). H20 lanes are no template control. B. Primer set AG
29&30 present in both LAT plasmid and transgenic mouse. C. Primer set
AG29&31 present in LAT plasmid but not transgenic mouse. The location of
the primer sets in the HSV genome are diagrammed in figure 2-3.






39


Determination of Transgene Expression by Northern Blot Analysis

Initial expression studies to determine if LAT was active in the transgenic mouse

line were carried out using a Northern blot and probing for the LAT intron which

typically accumulates to high levels in ganglia of infected mice. Since the transgene is

present in all cells of the mouse, neural and non-neural tissues were analyzed to see if

expression or accumulation of this intron was different in the various types of tissue.

DRG that were latently infected with HSV were used in this experiment as controls for

both the presence and size of the stable intron.

Figure 2-5b demonstrates that the LAT intron is accumulating in the DRG of

transgenic mice but not in the other tissues tested (Liver, Kidney, Brain, Feet). The RNA

gel (figure 2-5a), when photographed using ultraviolet light indicated that there was RNA

present in each of the wells and that there was more RNA present in the Kidney and

Brain samples than the DRG sample. Thus, the lack of hybridization in the samples was

not due to the absence of RNA. Lack of intron accumulation in tissues other than the

DRG does not mean that LAT is not being expressed in those tissues. In the tissues not

accumulating LAT intron, splicing may be inefficient or the intron maybe destabilized.

The presence of a higher molecular weight band in the brain sample (figure 2-5b) may

support these theories but further studies are necessary to confirm the mechanism

involved in the lack of intron accumulation. The size of the LAT intron band (relative to

the sizes of the 28s and 18s RNA bands) when compared to the controls (DRG compared

to K6) indicates that the intron from the transgenic mouse is complete, measuring to

approximately 1.9 kb.






40


A. B.

LV K F Br DRG K6 V K F DR












28s


18s
M1.9 kb

















18s and 28s RNA is marked on the gel. B. Northern blot using a probe for the
LAT 2kb intron. Accumulation is seen only in the infected DRG and the
transgenic DRG. A larger molecular weight band in the brain suggests that
there may be a splicing difference between different types of tissue.






41


Discussion

Unlike typical transgenic inserts, the LAT founder mouse was particularly

difficult to produce and required three separate injections. When the founder mouse was

generated there was only a single founder compared to other injections where there are

usually at least 10% transgenic animals in the first litter (Voncken, 2003), and the LAT

founder has deleted the SV40 poly A sequence. One potential interpretation of this result

is that a portion of the LAT region inserted in the context of genomic DNA may be lethal

to the embryo. Further studies are necessary to determine if this is the case. However,

the LAT transgenic line that was created can be (and has been) used to study LAT

regulation and functions provided that it is stable and expressed.

Initial studies by both hybridization and PCR to determine the number of

transgene copies inserted indicate that the LAT transgenic line contains a single copy.

The fact that only a single copy was inserted is consistent with the possibility that LAT

inserts may not be well-tolerated in mice since it is common to have multiple copies of

typical transgenes integrated at a single locus of the mouse genome, in some cases more

than 100 copies have been shown to be inserted (Ellis et al., 1997).

Screening for the founder mouse determined that the LAT transgenic mouse was

LAT positive and SV40 negative. The probe used to screen for LAT in this case

encompassed 897 bases of the transgene and would not evaluate the extent of the

deletion. In data presented here it was shown by PCR that the deletion is confined to the

3' most end of the transgene and may be as little as 132 bases. Based on figure 2-5b it

appears that the deletion does not include the splice acceptor site since the stable 2kb

LAT intron can be detected in transgenic DRG.






42


The LAT intron exists as a stable lariat structure with a half-life of approximately

24 hours (Thomas et al., 2002). The results obtained from Northern blotting transgenic

RNA suggest that the intron is present in its entirety and can be stably expressed in DRG

but not in the other transgenic tissues examined. The lack of intron signal in non-neural

tissues does not mean that LAT is not being expressed. It is possible that the intron is

stable only in ganglia or that splicing of the intron is not as efficient in non-neuronal

cells.














CHAPTER 3
EXPRESSION PROFILE OF THE LAT TRANSGENE

Overview

The previous chapter presented data that the LAT transgenic mouse was

expressing the LAT transgene through the detection of the stable intron in dorsal root

ganglion cells by Northern blot analysis. A quantitative expression profile encompassing

both neural and non-neural tissues is presented in this chapter. Since the HSV LAT is

expressed during latency, we expected that LAT expression is being regulated largely by

cellular functions, and we therefore expected to see LAT expression in the transgenic

mouse. What was less clear was whether some viral function contributed to the

regulation of LAT expression, and since no other viral genes were present in the

transgenic mouse to regulate LAT expression we expected the transgenic mouse would

be a valuable tool to look at the cellular control of the LAT promoter. During the course

of infection, accumulation of LAT intron typically occurs in neuronal cells (Rodahl and

Stevens, 1992), suggesting that neurons contain some factor not present in other cells to

allow for the expression of LAT or to prevent its repression. If this was the case, then

LAT expression should be seen either exclusively in neural tissues or at higher levels in

neural tissues of the transgenic mouse. Therefore, examining LAT expression in neural

vs. non-neural cell types was a high priority goal for this investigation.

The two previously described HSV transgenic mice have used non-quantitative

methods to examine expression of the LAT transgene. Both the HSV-2 LAT transgenic

and the HSV-1 LAT intron transgenic used a Northern blot to assess transgene


43






44


expression, and only a few different tissues were examined. In the case of the HSV-2

LAT transgenic mouse, detailed expression data was presented only for some central and

peripheral nervous tissues and expression in non-neural tissues was mentioned in the

discussion, but data was not presented (Wang et al., 2001; Mador et al., 2003).

In addition to determining the tissue-specific expression profile, the cell-specific

expression of LAT was examined by in situ hybridization. The Margolis group reported

that during an experimental HSV-1 infection of mice, the LAT is expressed in a

particular subset of neuronal cells of DRG and TG (Yang et al., 2000). By in situ

hybridization analysis of the LAT transgenic mouse, we sought to determine if LAT is

being expressed in all cells or a subset of cells as evidence of whether LAT expression in

different neurons is controlled primarily by cell-specific factors or whether trans-acting

viral factors may contribute to the differential expression profile noted by Margolis.

Materials and Methods

Harvesting of Transgenic Tissues

Transgenic mice were euthanized with halothane and cortex, hypothalamus

(cerebrum bottom), cerebellum, spinal cord, olfactory bulb, TG, DRG, spleen, liver,

kidney, skin, foot, heart, intestine, eye, and lung were dissected, snap-frozen in liquid

nitrogen, and stored at -800C until processed for RNA.

Isolation of RNA from Tissues

Tissues were homogenized in 400 tiL Trizol reagent (Invitrogen) using Kontes

glass tissue grinders (Fisher) or a ceramic mortar and pestle for larger tissues (i.e. skin,

feet, liver). Sterile sand was added to the mortar to aid in grinding the feet and skin.

Grinders were rinsed twice with 400 uL Trizol each and the rinse solution was added to






45


the ground tissue fraction. After a 5 minute room temperature incubation, 240 JtL of

chloroform was added and homogenates were vortexed 15 seconds followed by a 5

minute incubation at room temperature. Tissue homogenates were centrifuged at 9,000 x

g for 15 minutes at 40C, and the aqueous phase containing the RNA removed to a

separate tube. The bottom Trizol layer was stored at -800C for back extraction of DNA if

necessary.

RNA was precipitated by the addition of 500 |pL of isopropanol and incubation at

room temperature for 10 minutes followed by centrifugation at 12,000 x g for 10 minutes

at 40C. RNA pellets were washed with 1 mL 70% ethanol and centrifuged 5 minutes at

4C, 7,500 x g and the resulting pellet air dried briefly and resuspended in 200 gL diethyl

pyrocarbonate (DEPC, Sigma) treated water.

DNA contamination of the RNA was reduced using DNA-free (Ambion, Austin,

TX). One half of the tissue RNA was added to 2 units of DNaseI and 0.1 volumes of

DNaseI buffer, mixed gently and incubated at 370C for 30 minutes. After the incubation,

0.1 volumes of DNase-inactivation reagent was added to each tube and incubated at room

temperature for 2 minutes. DNase inactivation reagent was pelleted at 1,000 x g for 1

minute and supernatant was transferred to a new tube. RNA was then quantitated

spectrophometrically.

Reverse Transcription of Tissue RNA

cDNA was prepared from tissue RNA using Moloney Murine Leukemia Virus

Reverse Transcriptase (MMLvRT) and random hexamer priming. For each tissue

sample, 500 ng total RNA was added to 4 tiL 5x RT buffer (Invitrogen), 10 pmol random

hexamers, 12.5 pM each dATP, dTTP, dGTP, dCTP, 200 units MMLvRT (Invitrogen)






46


and 20 units RNasin (Promega) in a final volume of 20 ptL. Reactions were incubated at

370C for 1 hour followed by 10 minutes at 1000C to inactivate the reverse transcriptase

and then ice quenched.

Real Time PCR Reactions

The amount of LAT RNA in each transgenic mouse tissue sample was quantitated

using real time PCR and compared to cellular control RNA as described below.

Primer and probe sequences

Primer and probe sequences for the transgene were 5'LAT forward: 5'GGC TCC

ATC GCC TTT CCT, 5'LAT reverse: AAG GGA GGG AGG AGG GTA CTG, 5' LAT

probe: 5'TCT CGC TTC TCC CC. The location of these primers was diagramed in

figure 2-3.

18s RNA was used as a cellular control. The primer and probe set was obtained

from Applied Biosystems (PN 4308329). Control 18s RNA was provided with the 18s kit

and was reverse transcribed in the same manner as the tissue RNA as described above.

Standards

A standard curve was generated for each of the primer sets used. The pLAT/LAT

transgene plasmid was used as standard to determine copy number by performing PCR

on 10-fold dilutions of this target ranging from 104 to 101 copies. The cellular control

standard was 18s RNA and was used in 10-fold dilutions 10 ng to 1 pg corresponding to

the amount of RNA added to the reverse transcription reaction. This amount was

converted to copy number for final analysis.

Conversion of the 18s data from was required because the program associated

with the Real Time thermalcycler will not accept numbers for standards that are higher

than 106. To calculate copy number for 1 ng of 18s the size of mouse 18s RNA (1869 bp)






47


was obtained from the Qiagen catalog appendix (Qiagen, 2003) and the following

formula was used with 6.6 x 104 equaling the mass of one base pair.

1ng = fmol x 6.6x10-4 x 1869bp
pL

Ing = 1.23354 fmol
p.L

0.81 fmol x lxl1015 moles = 8.13x10-16 moles x 6.022x1023 molecules =
[tL fmol pL mole

4.9x108 molecules
pL

The molecules/ pL were multiplied by the number of copies generated by the real time

program to convert ng to molecules.


PCR reactions

All reactions were performed on an ABI Prism 7700 thermal cycler (Applied

Biosystems) located in the ICBR protein core at the University of Florida. Samples were

run in triplicate. For each reaction, 2 ptL of the reverse transcription reaction was added

to 0.33 pL 60x Assay Mix (primer/probe set), and 10 pLL Taqman Universal PCR Mix

(Applied Biosystems part #430437) in a final volume of 20 p.L. PCR was performed in

96 well plates under the following conditions: 1 cycle 2 minutes 500C, 1 cycle 10 minutes

950C, 40 cycles 15 seconds 950C, 1 minute 600C.

In-situ hybridization of Transgenic Tissues

Preparation of tissue sections

DRG, kidney, brain, and spinal cord tissues were harvested from transgenic, non-

transgenic littermates, and infected mice and fixed with 4% paraformaldehyde in






48


phosphate buffered saline (PBS) overnight at 40C then transferred to 70% ethanol.

Tissues were embedded in paraffin blocks and thin sections cut by the pathology core

laboratory at the University of Florida. To remove paraffin from cut sections, slides were

treated three times for 2 minutes each in Xylenes and then washed twice in 100% ethanol

followed by 95%, 70% and 50% ethanol, each for 2 minutes.

Prior to hybridization, slides were treated to remove excess protein and the

cellular DNA in the following manner. Fixed tissue was denatured in 0.2M HCI at room

temperature for 20 minutes, followed by 2 rinses in distilled water 5 minutes each at

room temperature, incubated at 700C for 30 minutes in 2x SSC, followed by 2 rinses in

water 5 minutes each at room temperature. The slides were then treated with Proteinase

K (1 p~g in 0.02 M Tris pH 7.4, 0.002 M CaC12) at 370C for 15 minutes followed by 2

rinses in water 5 minutes each.

DNase pretreatment was performed under treated coverslips. Briefly, coverslips

were acid washed in 1 M HCI for 20 minutes then rinsed 3 times in water for 5 minutes

each and 3 times in 95% ethanol for 5 minutes each. A final wash for 5 minutes in 100%

ethanol dehydrated the coverslips which were then baked for 5 hours in a drying oven at

2200C. For each site, 30 pL of 12U RNase-free DNase (Stratagene) in 20 mM Tris pH

7.4, 10 mM MgCl2 was added and coverslipped. Slides were then incubated at 37C for 1

hour in a humid chamber. Tissues were rinsed extensively (5x) in 2x SSC 5 minutes each

and post fixed in freshly made 5% paraformaldehyde, 0.3 N NaOH in phosphate buffered

saline pH 7 for 2 hours in the dark. Excess fixative was removed by washing 3 times in

2x SSC, 5 minutes each and twice in water 5 minutes each. To reduce non-specific

hybridization, samples were acetylated in 0.1 M triethanolamine pH 8 with 0.25% vol/vol






49


acetic anhydride for 10 minutes with stirring then rinsed twice with water for 5 minutes

each. A final denaturing step in 95% deionized formamide with 0.1x SSC incubated for

15 minutes at 700C followed by a 2.5 minutes rinse in ice cold 0.1x SSC and 2.5 minutes

in a water rinse.

Preparation of hybridization probes

Probes were prepared from pATD 17 (nt 118,863 to 119,343) and pATD 19 (nt

119,628 to 119,975) plasmids, as diagrammed in figure 2-3, using a random hexamer

labeling kit. pATD 17 was digested with PstI and SphI and pATD19 was digested with

EcoRI and HindIII to remove the HSV DNA from the plasmid backbone. Both inserts

were purified on an agarose gel and the DNA recovered by freeze fracture. For the

labeling reaction, 100 ng of digested plasmid DNA was incubated with random

hexamers, S35 dCTP, cold dGTP, cold dTTP, cold dATP, and Klenow fragment overnight

at room temperature according to the random hexamer labeling kit (Roche)

specifications. Labeled probes were purified on a Sephadex G-50 spin column to remove

unincorporated nucleotides and quantitated by counting 1 iL of labeled probe on a liquid

scintillation counter.

Hybridization

The hybridization solution was prepared as follows: 1.5 x 105 cpm/site of the

labeled probe was ethanol precipitated with 10 ptg of salmon sperm DNA, 1/50 volume

5M NaCl and 2 volumes ethanol and incubated at -800C for 15 minutes. The probe DNA

was pelleted by centrifuging for 30 minutes at 40C, the ethanol was removed, the pellet

dried briefly, and resuspended in 20 p.L TE. Immediately before use, the probe was

heated to 1000C for 5 minutes, followed by quenching on ice. Probes were diluted to 1.5






50


x 105 cpm/site by adding hybridization solution (50% deionized formamide, 0.3 M NaC1,

10 mM Tris pH 7.4, 2x SSC, 1 mM EDTA pH 8, lx Denhardt's solution, 100 tg/tLL

denatured salmon sperm DNA, 250 pg/p.L, tRNA, and 5 (tg/giL polyA) and heated to

100C for 2 minutes, followed by quenching on ice. To pre-hybridize the probe, the

diluted probes were incubated at 450C for 1 hour, followed by quenching on ice. For the

hybridization, 20 pL of the prehybridized probe solution was added to the tissue sections.

Slides were covered with a treated coverslip and sealed with rubber cement.

Hybridization was carried out at 450C for 72 hours.

Washes

Cover slips were removed by peeling off the rubber cement from the slides. The

slides were first washed in low stringency wash solution (50% crude formamide, 0.3 M

NaCI, 10 mM Tris pH 7.4, 1 mM EDTA pH 8) with stirring for 72 hours with 6 changes

of wash solution during that period. The first wash change was after 2 minutes to remove

excess hybridization solution. After the first wash, a small piece of nylon membrane (i.e.

Hybond-N) was included in the washing jar to collect any unbound probe.

After the low stringency wash, slides were washed for 2 hours in high stringency

wash solution (50% formamide, 2x SSC, 10 mM Tris pH 7.4, 1 mM EDTA pH 8) at

400C. Slides were rinsed twice in 2x SSC for 5 minutes each and dehydrated in ethanol

(70%, 70%, 95%) containing 0.3 M ammonium acetate to stabilize the counts 5 minutes

for each wash.

Filming

To film the slides, NTB-2 nuclear track emulsion (Kodak) diluted 1:1 with 0.6 M

ammonium acetate was liquefied at 450C in the dark. Each slide was dipped into the






51


emulsion once and allowed to dry approximately 20 minutes before being stood in a slide

drying rack for 3 hours with drierite. After slides were completely dry, they were put into

slide boxes containing drierite for up to 2 weeks at 40C. Each slide had a non-hybridized

blank slide between it and the next slide to prevent the 35S on one slide from non-

specifically exposing the emulsion on adjacent slides.

Developing

Slides were warmed to room temperature for approximately 1 hour before

developing. Fresh D-19 developer (Kodak) was used for each experiment. In the

darkroom, slides were incubated for 4 minutes in D-19 followed by 3 washes in water for

30 seconds each. Slides incubated in fixative (Kodak rapid fixer) for 4 minutes followed

by 2 washes in water 5 minutes each. Slides were counterstained with freshly made

Giemsa (Sigma) for 20 minutes, rinsed extensively in tap water and allowed to dry before

coverslipping and sealing with Permount.

Statistical Analysis

All data was analyzed using GraphPad In Stat software version 3.05 for the

Macintosh computer.

Results

Determination of the Amount of LAT Expressed in Non-Neural vs. Neural Tissues

Comparison of transgene expression on a per weight basis

The amount of LAT RNA present in transgenic tissues was determined by real

time PCR. Real time PCR is more accurate than traditional PCR methods because it

allows for data collection at the exponential phase of amplification, as opposed to

conventional PCR, which measures only the final amount of PCR product. Since

conventional PCR endpoints often represent reactions that may have plateaued many






52


cycles earlier, quantitative comparisons must be made following a series of dilutions of

the DNA targets, to insure that comparisons are being made under conditions where all of

the PCR products reflect a linear correspondence with the amount of target present in

each sample. Since real-time PCR measures the rate of product formation, linear ranges

of comparisons of all samples and standards are easily made. For each tissue, 500 ng of

total RNA was reverse transcribed (RT) and then a fraction of the RT reaction used for

PCR with a real time primer and probe set located within the 5'exon region of LAT (see

Figure 2-3). Quantitation of samples was standardized by generating a standard curve

from PCR reactions containing known quantities ofpLAT/LAT plasmid DNA.

Figure 3-la represents the expression data presented on a per gram of tissue basis

for a group of 4 eight week old mice. Both neural and non-neural tissues exhibited

expression of the LAT transgene ranging from 3.51 x 104 to 3.88 x 106 copies/gram of

tissue. The variations between the tissues were compared by ANOVA and were not

significantly different (F=1.079, P= 0.4017). Power analysis indicated that more than

100 mice would be needed to attain a statistically significant difference between the

expression levels in the transgenic tissues because there was little difference, relative to

the error, between the different tissues.

While on the whole there was no significant difference between all of the

transgenic tissues, we wanted to look closer at the tissues typically involved in the HSV-1

infection. For these analyses, paired t-tests compared skin with DRG (t=1.676,

P=0.1546) as well as feet with DRG (t=1.780, P=0.1253) demonstrated no significant

difference between either pair of tissues.







53



A. 1.00E+08 U Hypothalamus

Cerebellum
1.00E+07 Cortex

0 Olfactory Bulb
1.00E+06 [
.E+6 Spinal Cord

o I Dorsal Root Ganglia
| 1.00E+05
T Trigeminal Ganglia
0 Skin
1.00E+04 -
02 Foot
0 Heart
1 .OOE+03
< 0 Kidney

1.00E+02 Lung
Eye
.OO0E+01 -- Liver
Spleen
1.00E+00 Intestine


B.


1.00E+07 -

S DRG Acute HSV-1
1.0E+06 DRG Latent HSV-I



1.00E+04 -D c
S.OOE+05 3




1.00E+02

1.00E+01

I.OOE+00


Figure 3-1. Expression of LAT per gram of tissue. A. Both neural and non-neural tissues
expressed high levels of the LAT transgene although there was no significant
difference between the tissues. For each tissue n=4. B. Expression of LAT
during the acute and latent HSV-1 infection.






54


Comparison of LAT expression in the various tissues normalized to levels of
18s RNA

Although there was no significant difference in LAT expression between the

different tissues when compared on a per weight basis, this calculation did not take into

consideration that different tissues are composed of different cell types and each cell type

has a different density. As a result, comparison by weight, while typically accepted as a

basis for comparison did not represent the expression of LAT per cell. To examine the

LAT transgene expression on a per cell basis, RT data was normalized to the amount of

18s RNA present in each sample. For these studies, 18s RNA was chosen as the

normalizer because it was a cellular housekeeping molecule that remains fairly constant

in all tissues (Thellin et al., 1999). This is also a very abundant RNA species, therefore

in order to compare the amount of LAT to the amount of 18s RNA present in each tissue

sample, the 18s values were divided by 108 copies to be in the range of the LAT

transgene expression. The expression profile of the same mouse tissues from figure 3-1

was reanalyzed in figure 3-2 on the basis of 18s RNA. ANOVA determined that there

was no statistical significance between the transgenic tissues when normalized to the

amount of 18s RNA present in each tissue (F=1.308, P=0.2274).

Comparing the tissues involved in the HSV infection, feet vs. DRG (t=1.202,

P=0.2746) or skin vs. DRG (t=0.9631, P=0.3797) on a per 18s RNA basis again resulted

in no significant difference in the amount of LAT expression between these tissues. The

implications of this finding are considered in the Discussion section.







55




A.

I.00E+06



Hypothalamus
5 Cerebellum
O Cortex
O Olfactory Bulb
1.00E+04 ---- -------. I Spinal Cord
< U Dorsal Root Ganglia
STrigeminal Ganglia
LO E3 Skin
1.00E+03Foot
0 Foot
-8 Heart
1< 0 Kidney
1.00E+02 t- Lung
Eye
0 Liver
1.00E+01 a Spleen
Intestine


1.00E+00



]B. 1.00E+06


1.OOE+05


< 1.OOE+04

S i aDRG Acute HSV-I
1.00E+03
U DRG Latent HSV-I

< 1.OOE+02


1.00E+01 -- -


1.00E+00


Figure 3-2. Expression of LAT normalized to 1 8s RNA. A. Taking into account the
different cell densities in different tissues, LAT expression in transgenic
tissues was compared on a per cell basis by dividing the copies of LAT by 108
copies of 18s RNA in each tissue. n=4. B. Comparison of the amount of LAT
in infected DRG at acute and latent times post infection normalized to copies
of 18s RNA.






56


Comparison of the Amount of LAT Expressed in the LAT Transgenic Mouse to the
Amount of LAT Expressed in the DRG During HSV Infection

In the HSV-1 infection not all the DRG cells are infected and of the infected cells

only a portion detectably express LAT (Rodahl and Stevens, 1992). To compare the

amount of LAT being expressed in the transgenic mouse to the amount of LAT in an

infection, we infected mice with 17+ HSV-1 (wild type) and harvested DRG at 4 days

post infection (d.p.i.) (acute) and 28 d.p.i. (latent). These ganglia were processed to

isolate RNA and LAT expression was quantitated by RT-PCR as described above.

Figure 3-1b and 3-2b illustrate the amount of LAT present in DRG during the acute and

latent infection compared to the amount of LAT present in the transgenic tissues in

Figure 3-la and 3-2a respectively. The transgenic DRG contained 10-fold more LAT

expression per gram of tissue than either the acute or latent infected DRG. When

compared on a per weight basis there was no statistical difference between the amount of

LAT expressed in the transgenic DRG and either the acutely infected DRG (P= 0.1448)

or the latently infected DRG (P= 0.1204). When we looked at the amount of LAT in the

infected tissues on a per cell basis, there was approximately 10 fold more LAT in the

infected tissues than in the transgenic DRG. Statistically, the difference between the

transgenic DRG and the latent DRG was not quite significant (P= 0.0786) while the

difference between the transgenic DRG and the acute DRG was significant (P= 0.0283)

when compared relative to the amount of 18s RNA (Figure 3-2). While we would have

expected there to be more LAT in the transgenic tissue compared to the infection, it has

been shown that ganglionic levels of LAT are highest at the peak of the acute infection

and decline as latency is established. If this is the case, the differences in LAT






57


expression between the transgenic and infected tissues are minimal. This will be

discussed further in the discussion section.

Analysis of Transgene Expression as a Function of Age

Previous studies with HSV-1 transgenic mice expressing reporters behind ICPO

and ICP4 promoters demonstrated a difference in expression of these two lytic gene

promoters as a function of the age of the mice (Mitchell, 1995; Loiacono et al., 2002).

To determine if the LAT transgenic mouse exhibited an age related expression pattern,

we compared the amount of LAT RNA present in selected tissues at 1 day, 1 month, 2

months, and 18 months of age. A representative sample of these data is presented in

figures 3-3 and 3-4 while the profile for the entire tissue sampling is located in Appendix

C. There was no age related general trend of LAT expression among all of the tissues

tested. When compared by weight, the spinal cord (P= 0.3303), DRG (P= 0.6908), TG

(P= 0.4050), skin (P= 0.1728), and feet (P= 0.0657) had no significant difference in the

amount of LAT transgene expressed at different ages. This remained the same when

comparing LAT expression on a per cell basis using 18s RNA as a reference, with the P-

values of the spinal cord (P= 0.2859), DRG (P= 0.4803), TG (P= 0.2429), skin (P=

0.5305), and feet (P= 0.5707) indicating a lack of significance (figure 3-4).







58



1.0OE+07

1.00E+06

1.00E+05 Day Old I
S Month Old 1
S1.00E+04
0E Month Old 2
1.00E+03 0 Month Old 18

S.OO0E+02

1.00E+01









Figure 3-3 LAT transgene expression is not age dependent in tissues typically involved in
the HSV infection when normalized on a per weight basis.




1.00E+07

1.00E+06

7 1.00E+05 E 1 Day Old
oo E 1 Month Old
1.00E+04
0 2 Month Old
1.00E+03 0 18 Month Old

1.00E+02

1.00E+01








Figure 3-4. Expression of the LAT transgene is not age dependent in tissues involved in
the HSV infection when calculated per cell by normalizing to 18s RNA.






59

Analysis of Transgene Expression in Neural and Non-neural Tissue at the Cellular
Level Using In situ Hybridization

In situ hybridization examined two properties of expression, the number of cells

expressing the transcript of interest and the cellular localization of the transcript (nuclear

or cytoplasmic). To determine if the LAT transgene was being expressed in all cells of

transgenic tissues we probed for either the 5' LAT exon or the LAT intron by RNA in

situ hybridization. These tissue sections were counterstained with Giemsa stain after

hybridization which is a general membrane stain. In DRG, neurons were visible as large

blue round nucleated cells. The tissue between the groups of neurons included support

cells and the axons leading to the neuron cell bodies. Figure 3-5 illustrates the

architecture of the DRG magnified to point out the location of the nucleus seen as a white











PO










Figure 3-5. In situ hybridization of a latently infected dorsal root ganglia. This
photograph illustrates the neurons of the dorsal root ganglia (blue) and points
out the sub-cellular architecture with arrows pointing to the nucleus and
nucleolus of neurons. The small black dots on some of the cells are the
positive hybridization signal.






60


or lighter stained region within the neurons and the nucleolus seen as a gray circle within

the nucleus of some neurons.

The DRG is the primary site of LAT expression during the HSV infection

following footpad inoculation. Figure 3-6a illustrates the nuclear localization of

expression of the LAT 5' exon during the latent infection, marked by black arrows.

Surprisingly, in the transgenic DRG there were a subset of neurons that express LAT

with a different localization pattern than the infected DRG (compare figure 3-6a black

arrows with figure 3-6b red arrow) and some of the expression appears to be cytoplasmic.

This sub-population was in addition to the nuclear staining cells (figure 3-6b black

arrows) in the transgenic tissues that have the same pattern as the HSV infected DRG. A

non-transgenic mouse exhibited only background signal in this experiment (figure 3-6c).

When probed for the LAT intron, transgenic DRG showed the nuclear localization of

high levels of expression and low levels of expression in neurons as seen in Figure 3-7.

The cytoplasmic localization of LAT was not detected with the intron probe.

Neurons were counted to quantitate the positive sub-populations of neurons for

both the infected and the transgenic tissues with the 5' exon probe. During the HSV

infection LAT has been shown to be expressed in approximately one third of latently

infected neurons (Gressens and Martin, 1994; Maggioncalda et al., 1996). The data

presented here illustrated that LAT was being expressed in slightly more than two thirds

of transgenic neurons compared to just less than one third of neurons in infected dorsal

root ganglia (Table 3-1). Additionally, the transgenic tissue expression can be further







61


A.





~" t'- *.







;. i1 *. ,
I 7











^ ^ m -^~ie ''

'I 'P f*
-" A **"r^^S- i'

















F r 36 In stl h r 5. A. L






gagla B. Trngei poitv dorsa roo gaga C. Trsncneatv
l g i l ck ar'n hi o f n
'f_ 1* "* *

Figure~~~~~~~~~~~~ 3-.I iuhbiiainfr5 A eo.A aetyifce oslro
gagi.B rngei oiiedralro agi.C T crang cngtv
dosa rotgngia Bac row repeethbiiaino ula A






62



C.



+ T + + ;

I AxoMns and
-*+-0 0"Support Cells















Figure 3-6 (cont'd). expression. Red arrow indicates cytoplasmic LAT expression.
Arrows in C point out the neurons and axons of the DRG.
















Figure 3-7. In situ hybridization for LAT intron in transgenic DRG. Black arrows
*^ .. -. .
















Figure 3-7. 6n situ hybridization for LAT intron in transgenic DRG. Black arrows
represent nuclear localization of hybridization at both high and low levels of
expression.






63


divided into three subpopulations, darkly stained or high expression (33%), weakly

stained or low expression (56%), and cytoplasmic stained (11%). Further studies are

needed to determine if these subpopulations coordinate with neuronal markers for

neuronal subpopulations.


Table 3-1. Quantitation of LAT Expressing Cells in Dorsal Root Ganglia by in situ
hybridization for the 5' LAT exon

Number Percentage
Positive Of Total
Latently
Infected1 204 25
Transgenic
Tissues 709 65
Totals2
Darkly
Stained 233 333
Weakly
Stained 399 56
Cytoplasmic
Stained 77 11
Total neurons counted = 8neurons cod = 86 Tl eurons counted = 1095 3For the subsets of positive
neurons in the transgenic, percentage is of total positive transgenic neurons.

A significant finding of this study is that the 5' LAT expression pattern seen in the

transgenic DRG was not seen in other tissues of the transgenic mouse. A comparison of

other neuronal tissues of the transgenic mouse demonstrated a small amount of detectable

LAT expression in the thalamic neurons of the brain (figure 3-8 and figure 3-9) with

considerably less intensity than in DRG (compare figure 3-6b with figure 3-8 and 3-9).

Additionally, a small number of neurons in the spinal cord (figure 3-10) were expressing

LAT to levels comparable to that in the DRG. As with the DRG, further studies are

necessary to determine if these hybridization positive cells are from a specific population








64




A.T


























~JJ
I AL





















































Figure 3-8. In situ hybridization for LAT 5'exon in brain. A. Transgenic brain IOx B.
Transgenic brain magnifying the thalamic region 40x.
^~~ LB "*" x-^..,. ^ f B s
; **'* **. ^ .**^ .- ^ *; **"s .** -;. '* ^ *.* '-:






f^ ^;"; ,'r ;,..
*~ *" < ^* ,, .
.. l : e
-*. : **N X '
^~~: '' ^ ^ ^ '*. '" ^ '"*- .': .
*- ~ **' "" .''. '' * '' *^ ^ v e -'^ ..
"^ .. : *' ^ I ** i *


Figue 3-. /nsituhybidiain o AT5e in brin A.Tangnc ri lxB
Transgenic ~ ~ ~ ~ ~ ~ ~ E~ bri anfin h hlmi ein4x







65


A a .... '





Hippocampus





















I W


-A&
.. .^












>.. -. : _, .- -, > -" *







AkN











Figure 3-9. In situ hybridization of the transgenic brain with LAT intron probe. A. Low
magnification for orientation purposes. (lOx) B. Positive signal (black
arrows) was detected in thalamic neurons with primarily lower levels of
expression than seen in the DRG. (40x)
*; **.: ;* .. ; ^ *. ^ ^ / ^ *. ^ -/ ^ -









,*.!, .? -:^*--.-: Ay '-*^ *,^ ^ .-:--






66





*A. .
















*V
B. ..
















***





















Figure 3-10. In situ hybridization in the transgenic spinal cord. A. 5' LAT exon probe.
An example of positive neurons is marked with black arrows and examples of
negative neurons are marked with red arrows. B. LAT intron probe.
^ i ,




--y .^,''. 1 ;


:' t .. ;";' it. ; "* .


*. A i

i I :"* '- ; "- .
..... I~ 'r ;

^.. **^ ^ '



'>a > .4, .. .teh




> "




E .gr ,-1. I*. siuhyrdzain nte rnsei sialcr. A .. xo ro




An example of positive neurons is marked with black arrows and examples of
negative neurons are marked with red arrows. B. LAT intron probe.






67


of neurons. In contrast to the QRT-PR data for the non-neural tissues, both the transgenic

foot (Figure 3-11) and the transgenic kidney (Figure 3-12) exhibited no detectable LAT

expression by in situ hybridization. The cell specific distribution of LAT expression

exhibited by the transgenic mouse in both neuronal and non-neuronal tissues has

important implications for the final analysis of the overall LAT expression levels in the

different tissues of the transgenic mouse. This will be discussed in detail in the following

section.

Discussion

The LAT was able to be expressed in the absence of other HSV proteins in the

transgenic mouse. We had expected to see this expression primarily in neural tissues

(brain, spinal cord, ganglia) and possibly some epithelial tissues as well, for example skin

and foot, which have demonstrated some LAT expression during the HSV infection

(Jarman et al., 1999). The data presented here show that LAT can be detected at

relatively high overall levels, in a variety of tissues in the transgenic mouse. The tissues

expressing LAT were consistent with the expression patterns seen in the HSV-2

transgenic mouse (Wang et al., 2001) that was under control of the native HSV-2 LAT

promoter. We were unable to compare the amount of expression between the LAT HSV-

1 and HSV-2 mice because quantitative data were not reported in the HSV-2 mouse.

An important consideration, however, is that the analysis of the expression data

on a per weight basis did not take into consideration that different cell types have

different densities and cell compositions, although this is the standard method for

representing such data. To provide a per cell based analysis, we compared the expression

data to 18s RNA levels. Selection of a cellular gene to be used as a control must be done







68



A.




I











































Figure 3-11. In situ hybridization of transgenic foot. A. LAT 5' exon probe B. LAT
intron probe. There was no hybridization signal with either probe in the LAT
transgenic foot.
dtl^~ '''' *

Fiue31. nst ybiiain frngnc ot .LA 'eo poeB A
innpoe heewsn yridzto sgawiheterpoeithLA
transgen C fo.l






69












B.










*-* *
'*.x .^.".^' ^^ ^ ^ ^ '




Vn ',-.Nt: Aj~-^' 1ce
^^SIliaill^






,#' ..* '* ** ^ h.*At' *S-W '9W 4 ,'-! *
"' *
i~ ~ .. ~`"











Figure 3-12. In situ hybridization in the transgenic kidney. A. LAT 5' exon probe B. LAT
intron probe. No positive hybridization signal was detected with either probe.






70



with care since a number of cellular genes exhibit varied expression in different cell

types. In our studies these differences would have had an effect on the quantification of

LAT expression in the different tissue types. The 18s RNA species is a cellular

housekeeping gene that is considered to be constant in all cells (Thellin et al., 1999)

allowing for comparison between tissues.

Similar to the per weight analysis, LAT expression had no significant difference

between tissues. Despite of the inability to detect a difference in expression by either

analysis, the 18s RNA comparison appeared to be a more accurate overall representation

at the cellular level. The per weight analysis of expression would be sufficient for more

general comparisons but is not quantitative when expression may be present in only

certain cell types of a complex tissue.

There was a statistically significant difference between the amount of LAT in the

acute infection and the amount of LAT in the transgenic DRG when compared on a per

18s basis. The comparison with the latent infected DRG was not quite significant but

there was more LAT produced in the infected tissue than in the transgenic DRG. In

combination with the in situ data which suggests that LAT is not being produced in every

cell of the DRG, it is not hard to conceive that there could be more LAT in the infected

tissue. Further studies are needed to determine if this is the case, however, the 18s RNA

comparison remains a valid comparison between the non-infected tissues of the

transgenic mouse since they are comparing LAT that is being controlled in the same

manner.

We have also shown that LAT was not expressed in an age dependent manner.

Studies of immediate early HSV genes in transgenic mice determined that both ICPO and






71


ICP4 were expressed with age dependent differences (Mitchell, 1995; Loiacono et al.,

2002). There were a number of factors that made the comparison of the LAT and the

immediate early studies difficult. In the immediate early study they were counting the

number of cells expressing a p-gal reporter, not measuring the amount of p-gal

expressed. Our 18s RNA analysis would suggest that there was not a great variation in

the number of cells expressing the LAT transgene, but again, the two quantitations may

not be directly comparable.

Interestingly, LAT is not expressed in all cells of the transgenic mouse. In situ

hybridization for the LAT transgene illustrated that in the DRG, the transgene was being

expressed in only a subset of neurons. The pattern of LAT expression in the DRG of

transgenic mice seems to differ from the expression in the HSV-1 infection. In the

transgenic DRG we can detect two intensities of LAT expression, both nuclear in

localization, that were similar to the infected DRG, although more abundant.

Additionally, there was a small fraction of cytoplasmic localization of LAT expression in

the transgenic mice when using the LAT 5' exon probe but not with the LAT intron

probe. It is not clear whether these observed differences are related to LAT expression

differences by the transgenic mouse, or due to influences of other viral factors that may

modulate LAT expression in these neurons during a normal HSV infection. In addition,

further studies are needed to determine if these neurons have a particular characteristic or

if expression is in a random subset of neurons. Based on the expression patterns of LAT

in infected DRG and on the in situ data from the spinal cord in seems more likely that the

expression positive neurons in the transgenic mouse should have a particular

characteristic.






72


In other transgenic tissues, LAT expression was not detectable by in situ

hybridization with either the 5' LAT exon or LAT intron probes. The kidney and foot

both had transgene expression when measured by RT-PCR for the 5' exon but expression

was not seen by in situ hybridization. This could suggest that in some tissues LAT

expression is leaky in all cells and thus below the level of sensitivity for the in situ but, in

the neuronal tissues expression is confined to a subset of neurons resulting in the ability

to detect the expression by in situ hybridization. The small number of cells expressing

the LAT transgene in the spinal cord appears to support this theory in addition to the

expression in the DRG. These findings may suggest that LAT expression is more tightly

and dramatically regulated in sensory neurons.














CHAPTER 4
CHARACTERIZATION OF THE EXPRESSION OF LAT IN TRANS ON THE
COURSE OF HSV-1 INFECTION IN MICE

Overview

HSV-1 infection is characterized by three phases; acute, latent and reactivation.

The LAT has been suggested to play some role in all three phases, although its most

striking phenotype seems to be primarily at the level of reactivation (Wagner, 1991;

Bloom et al., 1994; Bloom et al., 1996b; Wang et al., 1997). The mechanism of its action

in this process has not been determined. Limited amounts of LAT have also been seen

during the acute phase of infection, although at present, there is no function linked to this

expression (Jarman et al., 1999).

If the LAT RNA used a trans mechanism of action, exerting a function on an

HSV-1 DNA molecule that had not actually produced the LAT RNA, then we would

expect to see a phenotype at some phase of the HSV infection in the LAT transgenic

mouse. For example, we could experimentally infect the LAT transgenic mouse with a

LAT(-) virus and phenotypically convert the virus to resemble wild type. Contrarily, if

LAT functions in cis, functionally regulating or interacting with the DNA molecule that

produced the LAT RNA, then there would be no visible phenotype when infecting the

LAT transgenic mouse with HSV-1. With this in mind, experiments that examined the

acute, establishment and reactivation phases of the HSV-1 infection were performed in

the LAT transgenic mouse. For the acute studies, LAT transgenic mice and their non-

transgenic littermates (as controls) were infected with HSV-1 on their rear footpads. The



73






74


relative progression of the acute infection was assessed by the yield of infectious virus in

the feet, spinal ganglia, and spinal cord at selected time points post infection.

Establishment of HSV latency was assessed by the amount of HSV-1 DNA present in the

DRG of transgenic and non-transgenic mice after the acute infection had resolved.

Explant co-cultivation was used as a reactivation model to determine if the LAT

transgenic mouse exhibited detectable differences in the ability to reactivate latent HSV.

Finally, deletion of a portion of the LAT region has been shown to dramatically

reduce the virulence and yield of virus within sensory neurons (Gary et al., in

preparation). While it has been shown that this virulence function acts independently of

the LAT promoter (which is primarily involved in reactivation), this new function still

resides within the region of the LAT gene present in the transgenic mouse. Here we

sought to determine if this phenotype could be rescued by using the LAT transgenic

mouse to provide the deleted region in trans during an experimental HSV infection.

Given the dramatic reduction in virulence associated with this LAT deletion, we felt this

would be a sensitive test of the LAT's ability to act in trans.

Materials and Methods

Growth of Cell lines and Viruses

Rabbit skin (RS) cells were maintained in minimum essential media (MEM) with

Earle's salts supplemented with 5% calf serum and antibiotics at 370C in a 5% CO2

incubator. HSV-1 strain 17+ and the HSV-1 mutant 17A480 were grown and titered on

RS cells. The mutation in 17A480 deletes a portion of the LAT intron corresponding to

nucleotides 119,502 to 119,981. Characterization of this virus has been described

elsewhere (Jarman et al., 2000).






75


Footpad Infection of Mice

All infections used adult mice of at least 6 weeks of age, HSV-1 LAT transgenics

and their transgenic negative littermates of at least the F6 generation. Mice were

transferred to the UF animal care infectious disease suite after genotyping, and were

allowed to acclimate to their new housing conditions for at least one week prior to

infection.

Mice were anesthetized with halothane and subcutaneously injected with 0.1 mL

of 10% saline in each of the rear footpads. Four hours post saline pre-treatment, mice

were anesthetized with 0.010 to 0.020 mL ofa ketamine cocktail (2.5-3.75 mg/kg

acepromazine, 7.5-11.5 mg/kg xylazine, 30-45 mg/kg ketamine) intramuscularly in the

thigh. Both rear footpads were abraded with an emery board to remove the keratinized

layer of skin tissue. Using a pipette tip, 1 x 106 plaque forming units (pfu) of virus in 50

p.L volume was added to the footpads and allowed to absorb for one hour with mice lying

on their backs under anesthesia. Mice were monitored twice daily for signs of

complications due to anesthesia or infection.

Harvesting of Infected Tissues

At specified times post infection, mice were euthanized with halothane and

infected tissues were dissected (feet, DRG, spinal cord). Tissues were snap-frozen in

liquid nitrogen and stored at -800C until processed.

Determination of Viral Titers from Infected Tissues

Infected tissues were homogenized in Kontes glass tissue grinders (Fisher) or a

ceramic mortar and pestle (feet). DRG were ground in 1 mL MEM with supplements and

grinders rinsed with 0.4 mL MEM. Spinal cords were ground in 2.5 mL MEM and rinsed

with 2.3 mL MEM. Feet were ground with 2.5 mL MEM containing 2x antibiotics and






76


250 ng/mL fungizone and sterile sand then rinsed with 5 mL MEM. Homogenates were

centrifuged at 3000 x g for 15 minutes to pellet cellular debris.

Titration dishes were prepared with rabbit skin cells in 24 well plates to be sub-

confluent at the time of inoculation. Serial dilutions from 10-1 to 10-8 of the tique

homogenate supernatants were made in MEM with supplements. Media was removed

from the titration plates and 200 gL of each dilution of tissue homogenate was added in

triplicate, and virus allowed to absorb for 1 hour at 370C with 5% CO2. After the

inoculation, plates were rinsed with 2 mL of MEM to remove the inoculum and any

residual cell debris and 2 mL MEM was added to each well. Cells were incubated for 72

hours at 370C with 5% CO2 then the media was removed and the cells were stained with

crystal violet to view plaques. Excess crystal violet was rinsed off with tap water and

plates were allowed to air dry before counting.

Determination of the Amount of HSV DNA in Latently Infected Mice

Adult transgenic mice and their non-transgenic littermates were infected as

described above with 1 x 106 pfu of HSV-1 17+ (wild type) and monitored for

complications. After 28 days, mice were euthanized, DRG removed, and snap-frozen in

LN2 until processing. DRG were ground in 400 piL Trizol reagent in a Kontes glass

tissue grinder (Fisher) to extract DNA. Grinders were rinsed twice with 400 ptL Trizol

each and rinse solution was added to the ground tissue. After a 5 minute room

temperature incubation, 240 pL of chloroform was added and the homogenates were

vortexed for 15 seconds followed by a 5 minute incubation at room temperature. Tissue

homogenates were centrifuged at 9,000 x g for 15 minutes at 40C. At this point, the clear

aqueous phase containing the RNA was removed to a separate tube.






77


RNA was precipitated with 500 piL ofisopropanol at room temperature for 10

minutes followed by centrifugation at 12,000 x g for 10 minutes at 40C. RNA pellets

were washed with 1 mL 70% ethanol and centrifuged 5 minutes at 40C, 7,500 x g. The

resulting pellet was air dried briefly and resuspended in 200 tL diethyl pyrocarbonate

(DEPC, Sigma) treated water. RNA fractions were stored at -800C for later use.

The lower phase (Trizol) of the extractions from the initial centrifugation step was

removed from the bottom keeping the interface intact. DNA was back extracted from the

remaining interface by adding 150 iL of 0.1M Tris and 0.1% Sarkosyl and centrifuging 5

minutes at 20,000 x g. This back-extraction was repeated twice, pooling the aqueous

layer after each centrifugation. Proteinase K (0.1 p.g/pl) was added to the pooled back-

extracted DNA samples and incubated at 370C overnight. DNA was purified by

sequential extractions with an equal volume of phenol and sevag followed by extraction

with sevag and precipitation in 100% ethanol. Pellets were resuspended in 50 pL TE and

quantitated spectrophotometrically (A260).

The amount of HSV genomes present in each mouse was quantitated by real time

PCR using primers and a probe specific for the HSV polymerase (pol) gene. Details of

the real time procedure were presented in chapter 3. The HSV pol primer/probe set was

custom made by Applied Biosystems, Assays by Design with the forward primer

sequence 5'AGAGGGACATCCAGGACTTTGT, reverse primer sequence

5'CAGGCGCTTGTTGGTGTAC and probe sequence 5'ACCGCCGAACTGAGCA

(65,880 to 65,953 nt). For the PCR reaction, conditions were 1 cycle 2 minutes 500C, 1

cycle 10 minutes 950C, 40 cycles 15 seconds 950C 1 minute 600C as described in chapter

3.






78


A standard curve was generated using HSV-1 genomic DNA of known copy

number ranging from 105 to 102 copies. Unknown samples were assayed using 50 ng of

DNA per reaction and were compared to the standard curve values for quantitation.

Explant Co-cultivation of Latently Infected DRG

Latently-infected transgenic and non-transgenic mice were euthanized and DRG

dissected as described above. DRG were cultured in MEM on with a RS cell monolayer

at 370C with 5% CO2 to detect reactivating virus. Every 48 hours, half of the media was

removed and replaced with fresh MEM to ensure the integrity of the monolayer. Cells

were monitored daily for 14 days for the presence of rounded, HSV infected RS cells.

Results

Expression of LAT in trans Does Not Detectably Alter the Course of an Acute HSV-
1 Infection in Mice

While the mouse footpad model of HSV-1 infection does not use the natural site of

HSV infection, it mimics the natural infection in that HSV can infect the epithelial

surface of the foot and travel along the sciatic nerve to reach the DRG. The reason that

the footpad model is extensively used to assess virulence properties of HSV-1 strains and

to study the progression of the acute infection is that it provides HSV-1 with a longer

path to travel through the nervous system until it reaches the brain. Therefore one can

sensitively assay the relative replication potential of different strains of HSV as it travels

from the foot, to the DRG, to the spinal cord and then to the brain.

To determine if expressing the LAT in the context of the transgenic mouse would

affect the course of the HSV-1 infection, we infected transgenic and non-transgenic mice

using the footpad model with wild-type HSV-1 strain 17+. The rationale for this

experiment is that if LAT is hypothesized to play a role in regulating HSV-1 gene







79


expression, expression of LAT prior to the HSV-1 infection might affect the outcome of

the acute infection, if could function in trans. Following footpad infection, tissues along

the path of HSV infection were assayed for amounts of infectious virus present at acute

times post infection, days one to four (figure 4-1). There was no significant difference

between the transgenic and non-transgenic mice at any of the four time points tested, day

1 P= 0.3501, day 2 P= 0.2403, day 3 P= 0.5476, and day 4 P= 0.5519. Similarly, the

amount of infectious virus in the DRG at acute times post infection shown in figure 4-2,

exhibited no significant difference between transgenic and non-transgenic mice, day 2

P=0.7364, day 3 P= 0.4309, and day 4 P= 0.3735. These data suggest that LAT was not


1.00E+08

1.00E+07 -.. .

1.00E+06

1.00E+05 -
I Transgenic Pos
l.OOE+04
I. N Transgenic Neg
1.00E+03

1.OOE+02

1.00E+01

1.00E+00
Day 1 Day 2 Day 3 Day 4


Figure 4-1. Relative amounts of infectious virus in the feet of transgenic and non-
transgenic mice infected with HSV-1 strain 17+ during acute times post
infection. n= 4






80



I.OOE+06
1.00E+06
1.00E+05 ...

1.00E+04 .

1.00E+03
I .OOE+03 Transgenic Pos
STransgenic Neg
1.00E+02

1.00E+01 -- -----

1.00E+00
Day 1 Day 2 Day 3 Day 4


Figure 4-2. Titer of infectious virus in DRG of transgenic and non-transgenic mice
infected with HSV-1 strain 17+ at acute times post infection. n= 4

affecting the acute phase of the HSV infection by being expressed at earlier times (prior

to infection) in the transgenic animals, and the LAT was not acting in trans to detectably

alter the outcome of the acute phase of HSV-1 infection.

Establishment of HSV-1 Latency in Transgenic Mice

Once the virus reaches the ganglia, it is able to establish latency in ganglionic

neurons. Since the LAT has been proposed by some to play a role in the establishment of

latency (Speck and Simmons, 1991; Bloom et al., 1994; Bloom et al., 1996a; Wang et al.,

1997), the expression of the LAT in the transgenic mice may affect the amount of

establishment in these mice. In order to determine if the expression of the LAT transgene

altered the amount of HSV that established latency in the infected mice, we infected

transgenic and non-transgenic mice with 1 x 106 pfu HSV-1 17+ (wild type) and waited

28 days for latency to be established. Mice were euthanized and DRG harvested and

snap frozen in LN2 until processed to extract the DNA. HSV DNA was quantitated






81


using real time PCR primers for the HSV polymerase. In figure 4-3 the amount of HSV

DNA present in ganglia of transgenic and non-transgenic infected mice, illustrated no

difference between the two groups (t= 0.1623, P= 0.8722). The mean for each group is

represented by a horizontal line. Scatter within the groups was expected because there is

some variability in the amount of virus infecting each mouse. Despite the expression of

the LAT from the transgenic mouse, there was no detectable difference in the amount of

establishment of HSV latency between the transgenic and non-transgenic mice, thus

expression of the LAT in trans did not affect the amount of HSV reaching the DRG and

establishing a latent infection.



1.00E+06



1.00E+05 --

S i _
a =* Positive
v 1.00E+04
1.OO 4 Negative
0


1.OE+03



1.00E+02

Figure 4-3. Quantitation of HSV-1 genomes present in mice infected with HSV-1 17+ at
latent times post infection. Each symbol represents one mouse.

Reactivation from Latency in Transgenic Mice

The LAT also plays a role in reactivation from latency (Wagner, 1991; Bloom et

al., 1996b; Hill et al., 1996; Jarman et al., 2002). During reactivation, the virus initiates a






82


productive cascade resulting in the generation of progeny virus. One of the methods for

measuring the presence of reactivatable virus in the mouse model is explant co-

cultivation. In this process, DRG were removed from latently infected mice and co-

cultured in tissue culture media until progeny virus was released and detected by the

presence of CPE on the RS monolayer. In the human or rabbit eye infection, reactivated

virus would travel along the axons to the initial site of infection. When using the mouse

explant model, those axons have been dissected away and the virus travels into the media

from the tissue. This virus can then infect tissue culture cells that are in the dish with the

ganglia to serve as a detection method for reactivation.

To study the effect of the LAT transgene on the reactivation phase of infection,

DRG from latently infected mice were dissected and cultured in tissue culture media on a

layer of rabbit skin cells for 14 days. Cultures were monitored daily for the presence of

infected rabbit skin cells. In both the transgenic and non-transgenic mice, virus was

detected in all of the cultures by day 10 post co-cultivation (figure 4-4). There was also

no observed difference in the time frame of reactivation between transgenic and non-

transgenic mice.

Expression of the Transgene in trans Does Not Rescue the Restriction of a LAT
Deletion Mutant in Neural Tissue

A region of the LAT transcript has been shown to play a role in the virulence ofHSV-1.

When this region of the virus was deleted, the resulting virus was markedly decreased in

virulence (Gary et al., in preparation). The LAT transgenic mouse includes the region

that was deleted in this virus, 17A480, and could provide that function during the course







83










3
---*- Transgenic
2-
-- Non-
=E transgenic
1


0 -
1 2 3 4 5 6 7 8 9 10
Days Post Co-Cultivation


Figure 4-4. Reactivation of HSV-1 from transgenic and non-transgenic mice by explant
co-cultivation of latently infected DRG.

of infection in the mouse. The location of this deletion in relation to the mapped

virulence function of LAT and the LAT transgene is diagramed in figure 4-5. To see if

providing the deleted LAT region in trans would rescue the virulence phenotype, we

infected transgenic mice with the 17A480 virus in the rear footpad. At acute times post

infection, days one to four, feet and DRG were harvested, homogenized and titered for

infectious virus. Both transgenic and non-transgenic mice exhibited similar levels of

virus in the feet, seen in figure 4-6, with no significant difference between the groups at

any timepoint. Day 1 P= 0.1990, day 2 P= 0.3281, day 3 P= 0.9528, day 4 P= 0.5585.







84




+1
_"Intron


LAT Transgene




Virulence Effects
+76 +1667


A480
+892 +1372


Figure 4-5. Diagram of the LAT region of HSV illustrating the location of the 17A480
virus and the LAT transgene in relation to the virulence function of LAT.





1.00E+08

1.OOE+07 ..

1.00E+06

1.00E+05
o Transgenic Pos
1.00E+04 i
Transgenic Neg
1.OOE+03

1.00E+02

1.00E+01

1.00E+00
Day 1 Day 2 Day 3 Day 4



Figure 4-6. Relative amounts of infectious virus in feet of transgenic and non-transgenic
mice infected with a deletion mutant of HSV-1 at acute times post infection. n=4







85


In the DRG, figure 4-7, the increase seen with the transgenic mice was not

significant, day 2 P= 0.3029, day 3 P= 0.3964, day 4 P= 0.0727. Since only four mice

were tested per group in these experiments it is possible that a larger sample size would

have resulted in a significant rescue of the virulence phenotype. The initial virulence

studies used Swiss Webster mice, which are less resistant to HSV infection. Thus, to

prevent genetic differences from complicating the results, the transgenic mouse is being

bred into the Swiss Webster background prior to repeating these experiments.


1.00E+06--


1.OOE+05 -


1.00E+04


S.OOE+03 Transgenic Pos
.0 Transgenic Neg

1.00E+02


1.OOE+I01


1.00E+00
Day 1 Day 2 Day 3 Day 4


Figure 4-7. Relative amounts of infectious virus in DRG of transgenic and non-transgenic
mice infected with a deletion mutant of HSV-1 at acute times post infection.
n=4.

Discussion

The LAT has been proposed to play a role in the establishment and reactivation

phases of the HSV infection. The LAT transgenic mouse expressed LAT to high levels

in a number of tissues, as presented in chapter 3. We hypothesized that the expression of

LAT by the transgenic mouse in a temporally different manner from what occurs during




Full Text
71
ICP4 were expressed with age dependent differences (Mitchell, 1995; Loiacono et al.,
2002). There were a number of factors that made the comparison of the LAT and the
immediate early studies difficult. In the immediate early study they were counting the
number of cells expressing a (3-gal reporter, not measuring the amount of (3-gal
expressed. Our 18s RNA analysis would suggest that there was not a great variation in
the number of cells expressing the LAT transgene, but again, the two quantitations may
not be directly comparable.
Interestingly, LAT is not expressed in all cells of the transgenic mouse. In situ
hybridization for the LAT transgene illustrated that in the DRG, the transgene was being
expressed in only a subset of neurons. The pattern of LAT expression in the DRG of
transgenic mice seems to differ from the expression in the HSV-1 infection. In the
transgenic DRG we can detect two intensities of LAT expression, both nuclear in
localization, that were similar to the infected DRG, although more abundant.
Additionally, there was a small fraction of cytoplasmic localization of LAT expression in
the transgenic mice when using the LAT 5 exon probe but not with the LAT intron
probe. It is not clear whether these observed differences are related to LAT expression
differences by the transgenic mouse, or due to influences of other viral factors that may
modulate LAT expression in these neurons during a normal HSV infection. In addition,
further studies are needed to determine if these neurons have a particular characteristic or
if expression is in a random subset of neurons. Based on the expression patterns of LAT
in infected DRG and on the in situ data from the spinal cord in seems more likely that the
expression positive neurons in the transgenic mouse should have a particular
characteristic.


99
Table B-2. Real Time PCR Primer and Probe Sequences
Primer Name
Sequence
XIST forward
GCT CTT AAA CTG AGT GGG
TGT TCA
XIST reverse
GTA TCA CGC AGA AGC CAT
AATGG
XIST probe
ACG CGG GCT CTC CA
5LAT forward
GGC TCC ATC GCC TTT CCT
5LAT reverse
AAG GGA GGG AGG AGG GTA
CTG
5LAT probe
TCT CGC TTC TCC CC
LPRO forward
CAA TAA CAA CCC CAA CGG
AAA GC
LPRO reverse
TCC ACT TCC CGT CCT TCC AT
LPRO probe
TCC CCT CGG TTG TTC C
POL forward
AGA GGG ACA TCC AGG ACT
TTGT
POL reverse
CAG GCG CTT GTT GGT GTA C
POL probe
ACC GCC GAA CTG AGC A


copies / g tissue
101
1 Day Old
1 Month Old
2 Month Old
18 Month Old
^ y y ^ y
// /./
^ $
y y
Figure C-l. Expression of the LAT transgene in neural tissues. Expression is
represented as LAT copies per gram of tissue, n = 4.
1 Day Old
1 Month Old
2 Month Old
18 Month Old
Figure C-2. Expression of the LAT transgene in non-neural tissues. Expression is
represented as LAT copies per gram of tissue, n = 4.


3-11 In situ hybridization of transgenic foot 68
3-12 In situ hybridization in the transgenic kidney 69
4-1 Relative amounts of infectious virus in the feet of transgenic and non-transgenic
mice infected with HSV-1 strain 17+ during acute times post infection 79
4-2 Titer of infectious virus in DRG of transgenic and non-transgenic mice infected
with HSV-1 strain 17+ at acute times post infection 80
4-3 Quantitation of HSV-1 genomes present in mice infected with HSV-1 17+ at latent
times post infection 81
4-4 Reativation of HSV-1 from transgenic and non-transgenic mice by explant co
cultivation of latently infected DRG 83
4-5 Diagram of the LAT region of HSV illustrating the location of the 17A480 virus
and the LAT transgene in relation to the virulence function of LAT 84
4-6 Relative amounts of infectious virus in feet of transgenic and non-transgenic mice
infected with a deletion mutant of HSV-1 at acute times post infection 84
4-7 Relative amounts of infectious virus in DRGof transgenic and non-transgenic mice
infected with a deletion mutant of HSV-1 at acute times post infection 85
A-l Plasmid map of the HSV-1 LAT transgenic construct 91
C-l Expression of the LAT transgene in neural tissues 101
C-2 Expression of the LAT transgene in non-neural tissues 101
C-3 Expression of the LAT transgene in neural tissues represented as copies per 18s
RNA
.102
C-4 Expression of the LAT transgene in non-neural tissues represented as copies per
18s RNA 103
x


93
1261 tgcttaatca gtgaggcacc tatctcagcg atctgtctat ttcgttcatc catagttgcc
1321 tgactccccg tcgtgtagat aactacgata cgggagggct taccatctgg ccccagtgct
1381 gcaatgatac cgcgagaccc acgctcaccg gctccagatt tatcagcaat aaaccagcca
1441 gccggaaggg ccgagcgcag aagtggtcct gcaactttat ccgcctccat ccagtctatt
1501 aattgttgcc gggaagctag agtaagtagt tcgccagtta atagtttgcg caacgttgtt
1561 gccattgcta caggcatcgt ggtgtcacgc tcgtcgtttg gtatggcttc attcagctcc
1621 ggttcccaac gatcaaggcg agttacatga tcccccatgt tgtgcaaaaa agcggttagc
1681 tccttcggtc ctccgatcgt tgtcagaagt aagttggccg cagtgttatc actcatggtt
1741 atggcagcac tgcataattc tcttactgtc atgccatccg taagatgctt ttctgtgact
1801 ggtgagtact caaccaagtc attctgagaa tagtgtatgc ggcgaccgag ttgctcttgc
1861 ccggcgtcaa tacgggataa taccgcgcca catagcagaa ctttaaaagt gctcatcatt
1921 ggaaaacgtt cttcggggcg aaaactctca aggatcttac cgctgttgag atccagttcg
1981 atgtaaccca ctcgtgcacc caactgatct tcagcatctt ttactttcac cagcgtttct
2041 gggtgagcaa aaacaggaag gcaaaatgcc gcaaaaaagg gaataagggc gacacggaaa
2101 tgttgaatac tcatactctt cctttttcaa tattattgaa gcatttatca gggttattgt
2161 ctcatgagcg gatacatatt tgaatgtatt tagaaaaata aacaaatagg ggttccgcgc
2221 acatttcccc gaaaagtgcc acctaaattg taagcgttaa tattttgtta aaattcgcgt
2281 taaatttttg ttaaatcagc tcatttttta accaataggc cgaaatcggc aaaatccctt
2341 ataaatcaaa agaatagacc gagatagggt tgagtgttgt tccagtttgg aacaagagtc
2401 cactattaaa gaacgtggac tccaacgtca aagggcgaaa aaccgtctat cagggcgatg
2461 gcccactacg tgaaccatca ccctaatcaa gttttttggg gtcgaggtgc cgtaaagcac
2521 taaatcggaa ccctaaaggg agcccccgat ttagagcttg acggggaaag ccggcgaacg
2581 tggcgagaaa ggaagggaag aaagcgaaag gagcgggcgc tagggcgctg gcaagtgtag


80
1.00E+06
1.00E+05
1.00E+04
ao
a 1.00E+03
c
n.
1.00E+02
1.00E+01
1.00E+00
Day 1 Day 2 Day 3 Day 4
Figure 4-2. Titer of infectious virus in DRG of transgenic and non-transgenic mice
infected with HSV-1 strain 17+ at acute times post infection. n= 4
affecting the acute phase of the HSV infection by being expressed at earlier times {prior
to infection) in the transgenic animals, and the LAT was not acting in tram to detectably
alter the outcome of the acute phase of HSV-1 infection.
Establishment of HSV-1 Latency in Transgenic Mice
Once the virus reaches the ganglia, it is able to establish latency in ganglionic
neurons. Since the LAT has been proposed by some to play a role in the establishment of
latency (Speck and Simmons, 1991; Bloom et al., 1994; Bloom et al., 1996a; Wang et al.,
1997), the expression of the LAT in the transgenic mice may affect the amount of
establishment in these mice. In order to determine if the expression of the LAT transgene
altered the amount of HSV that established latency in the infected mice, we infected
transgenic and non-transgenic mice with 1 x 106 pfu HSV-1 17+ (wild type) and waited
28 days for latency to be established. Mice were euthanized and DRG harvested and
snap frozen in LN2 until processed to extract the DNA. HSV DNA was quantitated


53
A.
1.00E+08
1.00E+07
1.00E+06
1 1.00E+05
P
oo
1.00E+04
D
Q.
O
h 1.00E+03
<
1.00E+02
1.00E+01
1.00E+00
Hypothalamus
Cerebellum
Cortex
Olfactory Bulb
Spinal Cord
Dorsal Root Ganglia
Trigeminal Ganglia
Skin
Foot
Heart
Kidney
Lung
Eye
Liver
Spleen
Intestine
B.
1.00E+08
1.00E+07
1.00E+06
it
P
CO
1.00E+05
1.00E+04
^ 1.00E+03
1 00E+02
1.00E+01
1.00E+00
DRG Acute HSV-1
DRG Latent HSV-1
Figure 3-1. Expression of LAT per gram of tissue. A. Both neural and non-neural tissues
expressed high levels of the LAT transgene although there was no significant
difference between the tissues. For each tissue n=4. B. Expression of LAT
during the acute and latent FISV-1 infection.


89
1990; Kenny et al., 1994; Dobson et al., 1995; Coffin and Thomas, 1998; Jarman et al.,
1999). In situ hybridization shed some light on this apparent incongruity by
demonstrating that the transgene was being expressed strongly in only a subset of
neurons in the dorsal root ganglia. Expression was not detected by in situ hybridization
in non-neural tissues. Thus, it can be concluded that strong LAT expression is specific
for some DRG neurons and that the expression seen by RT-PCR in other tissues may be
leaky or low-level expression in some (or perhaps most) cells within those tissues.
Retrospective analysis of the literature on neuronal-specific LAT expression shows that
most of these studies compared LAT expression in neuroblastoma vs. fibroblast cell lines,
and the few in vivo analyses relied primarily on reporter or in situ hybridization analyses.
Therefore our results serve to confirm and extend these analyses to indicate that the
pattern of abundant LAT expression is likely controlled at the level of different types of
neurons, and not other viral functions.
Mapping of the transgene insert determined that in addition to the SV40 poly A
sequence being deleted, a small portion of up to 132 bp of the 3 end of the transcript was
also deleted. This deletion does not appear to affect the splice acceptor site since the
stable LAT intron can be detected in the DRG by Northern blot.
The LAT transgene has no detectable effect on altering the outcome of an
experimental infection of the transgenic mice. Experiments presented here examined the
acute, establishment and reactivation phases of the HSV infection and in each of these
phases there was no difference between the transgenic and non-transgenic mice.
Additionally, infection of the transgenic mice with the 17A480 virus, a LAT mutant with
reduced virulence, did not rescue the virulence phenotype. There were slight but


CHARACTERIZATION OF A TRANSGENIC MOUSE EXPRESSING THE HSV-1
LATENCY ASSOCIATED TRANSCRIPT
By
ANNE M. GUSSOW
A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY
UNIVERSITY OF FLORIDA
2004

Copyright 2004
by
ANNE M. GUSSOW

To my husband, Karl, who is my best cheerleader,
and my son, Seth, who is too young to understand.

P
ACKNOWLEDGMENTS
I would first like to thank my mentor, Dr. David Bloom, for his guidance and
direction in the completion of this work and for providing me with the opportunity to
complete my doctoral studies at the University of Florida. I would also like to thank my
committee, Dr. Richard Condit, Dr. Sue Moyer, and Dr. Paul Reier, for their useful
discussions and suggestions to this project.
I would like to thank Dr. Robert Bonneau for encouraging me to apply to graduate
school and for giving me a start in my research career, and Dr. Eddie Castaneda for
helping to ease my transition from Arizona State to the University of Florida.
I would like to express my gratitude to the people who have worked with me in
Daves lab over the years, both the ASU group, Rick Jarman, Robert Tran, Jerry ONeil,
Niki Kubat, Melanie Paquette, and Lee Gary, as well as the UF group, Tony Amelio,
Zane Zeier, Nicole Giordiani, Peteijon McAnany and Loretta Arme. Each of them has
brought a special quality to the lab that will not be forgotten.
The biggest acknowledgment goes to my husband, Karl, and my son, Seth.
Without the love and support of both of them this goal would have fallen short a long
time ago. I thank Karl for the 2500 miles of I-10,1 hope the journey has been worth the
sacrifices that he has made as a result. Although Seth is too young to understand any of
this, coming home to his simple outlook on life has put things into perspective on many
occasions.
IV

I also want to thank my mother who has listened to the ups and downs all along the
way and always been supportive of me no matter what. Its been a long journey around
the country and Im finally going to settle down in one place. To my brothers, Marty
and Karl, who havent understood all of what my research is about, thanks for listening
and pretending to understand. To Cathy Kostick, who has been like a sister to me, thank
you for always being there through the years, in good times and in bad, your friendship
means more to me than I can express.
Last but certainly not least, I would like to thank my friends who have been there
for me every time that I was ready to give up; those of you who reminded me to do the
next right thing, take it one day at a time and put first things first. In no particular order:
Corliss, Aileen, Julie, Betty, Sheila, Eve, Heather, Leona, Martha Ann, Jennifer, Sarah,
Claire, Alice, Polly, Joan, Mary Ellen, Marty, Ted, Steve, Dale, Rosemary, Julia, Casey,
Diedre, Buster, BJ, Warren, Jim, Walt, Dan, and Joe; you are each a special part of my
life and of making this dream come true. And to whomever I have forgotten, you know
who you are, and I thank you.
v

TABLE OF CONTENTS
Page
ACKNOWLEDGMENTS iv
LIST OF TABLES viii
LIST OF FIGURES ix
KEY TO SYMBOLS xi
ABSTRACT xiv
CHAPTER
1 INTRODUCTION 1
HSV Clinical Features 1
Immune Response to HSV 2
General HSV Characteristics 3
HSV Gene Regulation 6
Animal Models of HSV Latency and Reactivation 11
Function of LAT 13
Use of Transgenics to Study Disease 18
Hypotheses to be Tested Using Transgenic Approach 20
2 GENERATION OF TRANSGENIC MOUSE EXPRESSING A PORTION OF
THE HSV-1 LATENCY ASSOCIATED TRANSCRIPT 23
Overview 23
Materials and Methods 24
Results 33
Discussion 41
3 EXPRESSION PROFILE OF THE LAT TRANSGENE 43
Overview 43
Materials and Methods 44
Results 51
Discussion 67
vi

4 CHARACTERIZATION OF THE EXPRESSION OF LAT IN TRANS ON THE
COURSE OF HSV-1 INFECTION IN MICE 73
Overview 73
Materials and Methods 74
Results 78
Discussion 85
5 OVERALL CONCLUSIONS 88
APPENDIX
A MAP AND SEQUENCE OF THE pLAT/LAT PLASMID 91
B PCR PRIMER SEQUENCES 98
C EXPRESSION OF THE LAT TRANSGENE IS NOT AGE DEPENDENT 100
LIST OF REFERENCES 104
BIOGRAPHICAL SKETCH 112
vii

LIST OF TABLES
Table page
2-1 Determination of transgenic copy number by real-time PCR 35
3-1 Quantitation of LAT Expressing Cells in Dorsal Root Ganglia by in situ
hybridization for the LAT 5 exon 63
B-l Conventional PCR Primers and Locations 98
B-2 Real time PCR Primer and Probe Sequences 99
viii

LIST OF FIGURES
Figure Page
1-1 Diagram of the HSV-1 virion 4
1-2 Diagram of the HSV-1 genome 5
1 -3 Regulation of the different HS V gene promoter classes 7
1 -4 Diagram of the function of HSV-1 LAT 13
2-1 Diagram of the LAT Transgene Insert 26
2-2 HSV transgene copy number determination by slot blot hybridization analysis 34
2-3 Mapping of the LAT transgene in the LAT transgenic mouse 37
2-4 PCR mapping the transgene insert 38
2-5 Expression of the LAT transgene 40
3-1 Expression of the LAT transgene per gram of tissue 53
3-2 Expression of the LAT transgene normalized to 18s RNA 55
3-3 LAT transgene expression is not age dependent in tissues typically involved in the
HSV infection when normalized on a per weight basis 58
3-4 Expression of the LAT transgene is not age dependent in tissues involved in the
HSV infecction when calculated per cell by normalizing to 18s RNA 58
3-5 In situ hybridization of a latently infected dorsal root ganglia 59
3-6 In situ hybridization for 5 LAT exon 61
3-7 In situ hybridization for LAT intron in transgenic DRG 62
3-8 In situ hybridization for LAT 5 exon in brain 64
3-9 In situ hybridization of the transgenic brain with LAT intron probe 65
3-10 In situ hybridization in the transgenic spinal cord 66
IX

3-11 In situ hybridization of transgenic foot 68
3-12 In situ hybridization in the transgenic kidney 69
4-1 Relative amounts of infectious virus in the feet of transgenic and non-transgenic
mice infected with HSV-1 strain 17+ during acute times post infection 79
4-2 Titer of infectious virus in DRG of transgenic and non-transgenic mice infected
with HSV-1 strain 17+ at acute times post infection 80
4-3 Quantitation of HSV-1 genomes present in mice infected with HSV-1 17+ at latent
times post infection 81
4-4 Reativation of HSV-1 from transgenic and non-transgenic mice by explant co
cultivation of latently infected DRG 83
4-5 Diagram of the LAT region of HSV illustrating the location of the 17A480 virus
and the LAT transgene in relation to the virulence function of LAT 84
4-6 Relative amounts of infectious virus in feet of transgenic and non-transgenic mice
infected with a deletion mutant of HSV-1 at acute times post infection 84
4-7 Relative amounts of infectious virus in DRGof transgenic and non-transgenic mice
infected with a deletion mutant of HSV-1 at acute times post infection 85
A-l Plasmid map of the HSV-1 LAT transgenic construct 91
C-l Expression of the LAT transgene in neural tissues 101
C-2 Expression of the LAT transgene in non-neural tissues 101
C-3 Expression of the LAT transgene in neural tissues represented as copies per 18s
RNA
.102
C-4 Expression of the LAT transgene in non-neural tissues represented as copies per
18s RNA 103
x

KEY TO SYMBOLS
C
AL
ANOVA
(3-gal
bp
Br
CaCl2
cDNA
cm
CMV
C02
CPE
cpm
CRE
CTL
dATP
dCTP
dGTP
dTTP
DEPC
DNA
DRG
EDTA
TE
F
FFLB
FHP
fmol
g
HC1
HSV
HSV-1
HSV-2
ICP
IFNy
K
kb
kg
LAP1
degrees Celsius
antisense to LAT
analysis of variance
beta galactosidase
base pair
brain
calcium chloride
copy deoxynucleic acid
centimeter
cytomegalovirus
carbon dioxide
cytopathic effect
counts per minute
cyclic AMP response element
cytotoxic T lymphocyte
adenosine triphosphate nucleotide
cytosine triphosphate nucleotide
guanine triphosphate nucleotide
thymine triphosphate nucletide
diethyl pyrocarbonate
deoxyribonucleic acid
dorsal root ganglia
ethylenediaminetetraacetic acid
TRIS/ EDTA buffer
foot
formaldehyde loading buffer
formamide prehybridization/ hybridization buffer
femtomole
centrifugal force
hydrochloric acid
Herpes Simplex Virus
Herpes Simplex Virus Type 1
Herpes Simplex Virus Type 2
infected cell protein
interferon gamma
kidney
kilobases
kilogram
latency associated promoter 1
xi

LAP2
LAT
LN2
LTE
Lv
PL
Pg
pM
mg
mL
mM
M
MEM
MgCl2
MHC
MMLvRT
MOI
MOPS
N
NaCl
NaOH
ng
NGF
nt
P32
PBS
PCR
pfu
Pg
pol
QRT-PCR
RCR
RNA
Rl
Rs
RS
RT
RT-PCR
S35
SDS
SPF
SSC
SV40
TE
TG
tRNA
latency associated promoter 2
latency associated transcript
liquid nitrogen
long term expression element
liver
microliter
microgram
micromolar
milligram
milliliter
millimolar
molar
minimum essential medium
magnesium chloride
major histocompatibility complex
Muloney Murine Leukemia Virus reverse transcriptase
multiplicity of infection
N-morpholino propanesulfonic acid
normal
sodium chloride
sodium hydroxide
nanogram
nerve growth factor
nucleotide
phosphorus-32
phosphate buffered saline
polymerase chain reaction
plaque forming unit
picogram
polymerase
quantitative RT-PCR
reactivation critical region
ribonucleic acid
long repeat
short repeat
rabbit skin cells
reverse transcriptase
reverse transcriptase- polymerase chain reaction
sulfur-35
sodium dodecylsulfate
specific pathogen free
sodium chloride/ sodium citrate
simian virus 40
TRIS/ EDTA buffer
trigeminal ganglia
transfer RNA
xii

unit
unique long
unique short

Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy
CHARACTERIZATION OF A TRANSGENIC MOUSE EXPRESSING THE HSV-1
LATENCY ASSOCIATED TRANSCRIPT
By
Anne M. Gussow
May 2004
Chair: David Bloom
Major Department: Molecular Genetics and Microbiology
Herpes Simplex Virus Type 1 (HSV-1) is a double stranded DNA virus that causes
a life-long infection of its host. The infection is characterized by two phases, the acute
phase and the latent phase. The virus infects epithelial tissue during the acute infection
where it gains access to nerve termini and establishes a latent infection in sensory ganglia
neurons. During latency only a single viral transcript is expressed abundantly, the
Latency Associated Transcript (LAT). LAT is most abundantly transcribed in neurons,
and the 5 portion of the transcript has been implicated in the establishment and
reactivation of latent infections. In order to study the regulation of LAT expression in
neurons in the absence of viral functions, a transgenic mouse line was created in the
C57B1/6 background containing the region encoding the LAT 5 exon through the 2.0kb
intron under the control of its native promoter. Characterization of this transgenic mouse
indicates that there is a single copy of the transgene inserted into the mouse genome and
LAT expression is abundant in a number of tissues including dorsal root ganglia (DRG),
xiv

brain, skin, liver, and kidney. Additionally, in situ hybridization indicates that expression
of the transgene in the DRG is limited to a subset of cells, similar to what occurs during a
natural HSV infection.
During HSV infection of the transgenic mouse, expression of the transgene has no
effect on the amount of virus produced during the acute infection in feet, DRG, or spinal
cord. Since LAT has been implicated as playing a role in establishment and reactivation
of latency, we sought to determine whether expression of the transgene affected the
ability of the wild type virus to establish and reactivate from a latent infection. PCR for
HSV DNA in DRG detected no difference between transgenic and non-transgenic mice
following establishment of HSV latency. Reactivation by explant co-cultivation of
latently infected DRG exhibited a similar pattern of reactivation for both transgenic and
non-transgenic mice. Taken together, the infection data suggest that LAT is not
functioning in trans to regulate the HSV infection. This suggests that LAT acts in cis to
regulate reactivation.
xv

CHAPTER 1
INTRODUCTION
HSV Clinical Features
Herpes viruses are characterized by their ability to establish a life-long infection
of their host with long periods of latency during which the virus exists in ganglionic
neurons with only a single transcript detected abundantly. Herpes Simplex Virus Type 1
(HSV-1) infection causes lesions commonly known as cold sores. A large portion of the
world population, up to 90% in some areas, has been exposed to HSV-1 by adolescence
and produce detectable antibodies to the virus (Roizman and Sears, 1996).
Herpes infections have been described since the days of ancient Greece. Infection
with HSV-1 is typically characterized by lesions of the epithelium of the mouth or lips,
although it can infect other mucosal areas, such as the eyes. A closely related
Herpesvirus, HSV-2, causes the same type of lesions, although they are primarily genital
in nature (Roizman and Sears, 1996).
The initial phase of infection or primary infection lasts two to three weeks and is
often asymptomatic in young children. Once the lesions have healed, the virus enters a
latent state where it exists asymptomatically in sensory nerve ganglia. Latency is
interrupted by periods of reactivation, which is the result of stress. During reactivation,
lesions can recur at the initial site of infection. The frequency and severity of
reactivations vary depending upon the individual, although the duration of reactivation
lesions is typically shorter than the primary lesions, and asymptomatic shedding is
common (Roizman and Sears, 1996).
1

2
HSV infection is particularly dangerous in immunocompromised individuals.
Due to the inability to mount an immune response to the virus, these patients may
develop a number of more severe symptoms such as keratitus, which can lead to
blindness (Whitley, 1990). Newborns exposed to primary infection or reactivating HSV
at birth are susceptible to systemic infection that could result in fatal encephalitis
(Anderson and Nicholls, 1972).
Current treatments for HSV infection include several nucleoside analogs in either
topical or oral forms that reduce the severity of reactivations and shorten the duration of
lesions. Vaccines have been developed using peptides, attenuated viruses, and killed
viruses, all of which provided limited protection against recurrences. No cure is currently
available for HSV infection (Koelle and Corey, 2003).
Immune Response to HSV
The immune response to HSV-1 involves both specific and non-specific
mechanisms. In the initial stages of infection, CD4+ cells activate macrophages and
produce IFNy. The activated macrophages produce other cytokines to affect other
immune cells. Later in the immune response, CD8+ cytotoxic lymphocytes and antibody
producing B cells provide specific immunity that helps to clear virally infected cells
(Whitley, 1996).
Like other viruses, HSV has developed methods to evade the immune response.
For example, it establishes latency in an immune privileged site neurons do not
normally express MHC class I or II. This site of latency greatly reduces the likelihood of
CTL-mediated destruction of the host cell (Ward and Roizman, 1998). An example of
the ability of HSV to evade the humoral immune response is gC, an HSV virion

3
glycoprotein that can bind to the complement factor C3b and limit the induction of the
complement cascade (Chen et al., 2003)
In order to determine the role of the immune system in the latent phase of HSV
infection, a number of mouse strains deficient in specific aspects of the immune response
have been infected. These strains were each compared to the relatively HSV-resistant
C57B1/6 strain which contains a functional immune system. C57B1/6 mice can be
infected with HSV and establish a latent infection but do not develop encephalitis as a
result of infection (Lopez, 1975; Kastrukoff et ah, 1986). In contrast, SCID mice are
highly susceptible to HSV as a result of being deficient in both T and B cells. Even so, it
was suggested that HSV has the potential to establish latency at early times post-infection
in these mice as defined by the observation of neuronal LAT expression in ganglia 1-2
days post infection (Gesser et ah, 1994). Interferon knockout GKO mice exhibited a
delay in the peak of viral productive infection, but latency was established at a normal
rate and HSV infection was not lethal to these mice, suggesting that interferon
stimulation of the immune response is not necessary to resolve the acute infection. The
moderately susceptible Balb/c strain resulted in a stronger productive infection than seen
in C57B1/6 mice, but no differences were seen in the relative ability of HSV to establish
latent infections in these different mouse strains with known differences in immune
backgrounds (Ellison et ah, 2000). These studies imply that establishment of latency is
the result of a virus neuron response and not mediated by the immune response since
latency was established in all strains tested.
General HSV Characteristics
HSV-1 is the prototype of the alphaherpes virus family causing life-long infection
of the host. The virus particle is enveloped with at least eleven glycoproteins present on

4
the surface. The capsid of the virus is icosahedral in shape and the space between the
envelope and the capsid, known as the tegument, contains proteins involved in the initial
stages of infection. A diagram of the HSV-1 virion structure in Figure 1-1 illustrates the
enveloped capsid with glycoproteins present on the outer surface of the envelope
(Roizman and Sears, 1996). Grnewald et al. (2003) were able to use electron
microscopy to clarify the HSV virion structure illustrating that the capsid arrangement in
the tegument is asymmetrical and that the some 750 glycoprotein spikes present on each
virion are arranged in an organized manner on the envelope surface.
Figure 1-1. Diagram of the HSV-1 virion. HSV is an enveloped virus with an
icosahedral capsid and glycoproteins present on the envelope surface
(Roizman and Sears, 1996).
The HSV infection is characterized by three phases. During the initial infection or
establishment phase, lesions are seen primarily on the oral mucosa. The virus then enters
sensory nerve termini and is transported to the sensory ganglia where it establishes a
latent infection. The latent phase of infection is characterized by transcriptional activity
from a single viral region encoding the latency associated transcripts (LAT), while the

5
remainder of the genome is silenced. Latent infection is interrupted by periods of
reactivation where productive infection resumes and the virus travels through the nerve
axons back to the initial site of infection where lesions are seen on the skin surface
(Roizman and Sears, 1996).
The HSV-1 genome consists of approximately 152 kilobases (kb) of double-
stranded DNA. The genome (Figure 1-2) consists of two unique regions, the unique long
(Ul) and the unique short (Us), each flanked by two repeated regions, the long repeat
(Rl) and the short repeat (Rs). The repeat regions are joined together by the a
sequence, a 500bp highly
rl ul rl rs us rs
Figure 1-2. Diagram of the HSV-1 genome. HSV possesses a double-stranded DNA
genome that is organized into two repeat regions, the repeat long (Rl) and the
repeat short (Rs), each flanking unique regions, the unique long (Ul) and the
unique short (Us). The repeat regions are joined together by the a sequence.
Also shown is the region encoding the latency associated transcripts (LAT).
conserved region of small repetitive elements. HSV genes are identified by their relative
time of expression rather than by their position in the genome. The classes of expression
are alpha (a), beta (p), and gamma (y).
During the latent infection, the viral genome associates with cellular histone
proteins and circularizes to form an episome, thus existing as a mini-chromosome in
the infected cell. It has recently been determined that episome formation occurs in the
absence of lytic HSV gene products and the ICPO gene may be involved in the prevention
of circularization (Jackson and DeLuca, 2003).

6
HSV Gene Regulation
Immediate Early Genes
The alpha genes, also known as immediate early, peak in expression 2-4 hours
post infection and include infected cell proteins (ICP) 0, 4, 22, 27, and 47. Transcription
of the alpha genes is initiated by a complex including the HSV-1 tegument protein VP 16
(also known as aTIF) binding to the TAATGARAT octamer located in the immediate
early promoters (Mackem and Roizman, 1982). Of the immediate early genes, ICP4 is a
strong trans-activator of the early and late viral genes and is essential for viral replication.
ICP4 binds to both consensus ATCGTC and non-consensus motifs in several other HSV
gene promoters or 5untranslated regions. The trans activation function is promoted by
ICP4 binding to DNA as well as the transcription factors TBP and TFIIB (Smith et al.,
1993).
While not essential, ICPO is believed to have multiple functions, including that of
a non-specific transactivator (Cai and Schaffer, 1992) and a disruptor of ND10 regions in
the nucleus (Davido et al., 2003). The exact purpose of ND10 structures in the nucleus
has not been determined, but they may be involved in replication and during the infection
a number of HSV proteins interact with ND10. Other studies suggest that ICPO is
involved in reactivation from latency since the latency associated transcripts are
expressed from the opposing strand of DNA in the same region as ICPO. Expressing
ICPO in trans from an adenovirus vector was sufficient to induce reactivation in latently
infected primary trigeminal ganglia cultures (Halford et al., 2001). These data support the
theory of LAT acting as a switch to turn on ICPO during reactivation. The involvement
of ICPO in reactivation will be discussed further in the section on LAT function.

7
-300
B
+i

%%%
-105 -61
+i
1L+
V'
%
*7
-29 +1
D
%
-48 +1_
fi^
T
-870
-141
+1
-* -
1T-
+600
iODO
,\ % ^ V5, ^ vw^ \ ^
~ V ^
\V'
LAP 1
LAP 2
Figure 1-3. Regulation of the different HSV gene promoter classes. A. Immediate early
genes. B. Early genes. C. Late genes. D. Leaky Late genes. E. LAT gene.
Abbrv: INR, initiator element. DAS, downstream activating sequence.
LAP1, latency associated promoter 1. LAP2, latency associated promoter 2.

8
Control of the immediate early genes is primarily under the direction of cellular
transcription factors although viral binding sites are also present (Figure 1-3). In addition
to a TATA box, immediate early promoters contain several SP1 binding sites and binding
sites for the VP 16 viral activator protein. The ICP4 binding sites in the promoter allow
for down regulation of these genes by ICP4 as the course of infection progresses.
Early Genes
Early P genes include genes involved in viral replication such as the viral
polymerase and thymidine kinase. These genes show peak expression 5-7 hours post
infection. Despite containing only cellular elements in their promoters including SP1
sites, CAAT and TATA boxes (Figure 1-3), early genes require the viral ICP4 protein to
stimulate expression through interaction with the TATA element (reviewed in Weir,
2001).
Late Genes
Structural proteins such as the glycoproteins and tegument proteins make up the
group of late y genes which are expressed only after viral replication has occurred
(Roizman and Sears, 1996; Wagner et al., 1998). Late genes are divided into two sub
classes, yl and y2. yl genes are leaky lates and can be transcribed in small quantities
before viral DNA synthesis has occurred. The y2 class consists of strictly late genes and
dependent upon viral replication.
Promoter sequences for the late genes are much less complicated than the
promoters for the two preceding kinetic classes and are limited to a TATA element and a
portion of the 5 noncoding region of the transcript acting as an enhancer for high levels
of expression (Levine et al., 1990). Expression of some viral genes are required for late

9
expression, and as an example, a transgenic mouse containing the gC promoter driving
P~gal exhibited no expression of P-gal in neuronal or non-neuronal tissues (Loiacono et
al., 2002). An example of both late promoter classes is presented in Figure 1-3.
The Latency Associated Transcript
During the latent period of infection, LAT is produced abundantly from the long
repeat region of the genome. LAT is the only HSV-1 transcript that has not been
classified in one of the classes of genes mentioned above (immediate early, early, or late).
The LAT RNA is made as an 8.3-kb primary transcript and is spliced into several smaller
RNAs. The most abundant LAT RNA is the 2kb intron that exists as a stable lariat
structure with a >24 hour half life (Farrell et al., 1991; Thomas et al., 2002). The stability
of the LAT intron may be due to the non-consensus branch point that allows for
generation of the lariat structure during splicing (Wu et al., 1998). Additionally, in
latently infected trigeminal ganglia a 0.5 kb region is spliced out of the 2 kb intron
resulting in a second stable 1.5 kb species (Spivack et al., 1991; Alvira et al., 1999).
There has been no direct evidence that LAT is translated into a protein during the
HSV infection despite extensive studies including sequence analysis (Drolet et al., 1998),
transient expression assays (Thomas et al., 1999), and site mutagenesis of ATGs (Bloom
et al., 1996). Some of these studies were able to generate a LAT protein outside of the
context of the natural viral infection, but there is no evidence to date that this protein is
expressed during infection (Coffin and Thomas, 1998; Thomas et al., 1999).
Transcription of LAT begins near the TATA box consensus sequence with the
promoter extending as much as 870 nucleotides upstream of the transcription start site
(Lokensgard et al., 1997). Several cellular regulatory sites have been identified in the

10
LAT promoter region including cyclic AMP response elements (CRE), Spl sites, CAAT
box, USF, YY1 and AP-2 (Kenny et al., 1994; Soares et al., 1996; Wagner and Bloom,
1997) as shown in Figure 1-3. The presence of cellular regulatory regions suggests
possible cellular control of the LAT promoter which will be examined in the experiments
presented in the following chapters.
A second, TATA-less promoter, LAP2 (latency associated promoter 2) has been
described in the region 3 of the LAP1 transcription start site (Figure 1-3). This region of
DNA contains elements such as a G/C rich segment that are found in housekeeping genes
and those genes involved in signal transduction pathways. Transcription from LAP2 is 5-
10 fold less abundant than from LAP1 as determined by transient expression with a CAT
reporter (Goins et al., 1994). LAP2 is active during the acute phase of the animal
infection and also in cell culture of both neuronal (SY5Y) and non-neuronal (CV-1) cells
but LAP2 is not active during the latent phase of infection in the absence of LAP 1 core
promoter elements (Nicosia et al., 1993). The exact transcription start site for LAP2 has
yet to be mapped and further studies are necessary to determine the function of
transcript(s) derived from the LAP2 promoter. For the remainder of this dissertation the
LAT promoter refers to the LAP1 promoter unless otherwise noted.
Previous research has stated that LAT promoter activity is different in different
cell types. In addition to expression in neurons during latency, Jarman et al. (1999)
reported that LAT is expressed in murine feet during the acute infection following
footpad infection using P-gal reporter viruses. The expression was seen two to four
days post infection on both the dorsal (infected) and ventral sides of the foot and is in
contrast to only low levels of LAT expression observed in non-neuronal cells in culture

11
(Zwaagstra et al., 1990; Jarman et al., 1999). Additionally, more LAT expression was
seen in neuronal cell types (ND7 and Cl300) than in non-neuronal rabbit skin cells using
in vitro infections (Coffin et al., 1998). Further studies with LAT promoter deletions
revealed LAT expression differences between neuronal cell cultures and infected dorsal
root ganglia neurons (Dobson et al., 1995). This suggests that different neuronal cell
types contain different levels or types of transcription factors and that there may be
neuronal specific elements in the LAT promoter. In vivo two regions in the promoter, -75
to -83 and -212 to -348 relative to the transcription start site, showed increased activity
in neuronal cells as opposed to non-neuronal cells (Kenny et al., 1994).
Sensory ganglia contain a variety of cell types, both neuronal and non-neuronal.
Margolis et al. (1992) analyzed some neuronal markers of neurons in mouse sensory
ganglia that corresponded with either sites of HSV-1 LAT expression, or HSV-1 acute
antigen expression and determined that the neuronal population expressing SSEA-3+ as a
surface marker exhibited the highest percentage of LAT expression during acute infection
in the absence of acute antigen. These differences in LAT promoter activity could be
dependent on specific transcription factors present in different cell populations (Dobson
et al., 1995; Yang et al., 2000).
Animal Models of HSV Latency and Reactivation
A number of animal model systems are used to study latency and reactivation. In
the mouse, infection of the footpad results in latency in dorsal root ganglia (DRG).
While not the natural route of infection, the footpad is a large epithelial surface that can
support a uniform infection and dissection of infected tissues can be performed easily.
One limitation to the mouse model is that HSV reactivation does not result in virus being
transported to the primary site of infection as it does in humans. Local reactivation in the

12
ganglia can be induced however, in one of two ways: co-cult explant of DRG or
hyperthermal stress.
The explant model uses the stress caused by dissection of the ganglia from the
mouse to initiate reactivation. Dissected ganglia are incubated in tissue culture media
and infectious virus is detectable in the media by 2 weeks after explant. Mimicking one
of the natural causes of reactivation, fever, the hyperthermia model involves raising the
body temperature of the mouse to 43C for 10 minutes to induce reactivation. While this
model initiates the lytic cycle, lesions have not been seen at the initial site of infection but
virus can be detected in the sensory ganglion at 24 hours post stress (Sawtell and
Thompson, 1992).
Another common model of HSV infection is the rabbit ocular model. Prior to
HSV infection rabbit corneas are scarified to allow for a more uniform infection surface.
In this model, latency is established in the trigeminal ganglia and HSV can either
spontaneously reactivate or be induced to reactivate using iontophoresis of epinephrine to
mimic the host stress response (Hill et al., 1986).
There is one non-animal model of reactivation that involves culture of primary
neurons in the presence of NGF. For infection, acyclovir (the nucleoside analog used to
inhibit HSV lytic genes) and NGF are added to the media so that a quiescent infection is
established without killing the neurons. Acyclovir is removed once establishment has
taken place and reactivation can be induced by removal of NGF from the media (Colgin
et ah, 2001). These quiescent cultures are the closest system available to an in-vitro
latency model, most tissue culture systems have the ability to support a lytic infection,
but not establish latency.

13
Function of LAT
Establishment and Reactivation
LAT has been linked with a number of different functions during the acute
infection, although the most extensive body of data supports a role of LAT in the
establishment of and/or reactivation from latency (Wagner, 1991; Roizman and Sears,
1996). The regions of LAT involved in these functions and the others described here are
depicted in Figure 1-4.
Using overlapping dermatomes in the mouse, Speck and Simmons (1991) were
able to demonstrate the establishment of latency (production of LAT) in the absence of
lytic gene production, thus suggesting that lytic and latent pathways can diverge early in
+1
C:
-161 +424
Intron
^^VmenceEfect^^^
+76 +1667
LTE
+30 +661
Anti Apoptosis
-161 +1667
(LAP2)
AL
-198 +158 +661
Figure 1-4. Diagram of the function of HSV-1 LAT. Different regions of LAT have
been implicated in many functions. The location of these functions are mapped
here including the reactivation critical region (RCR), virulence effects, the long
term expression element (LTE), and anti-apoptotic region. Also included here is
the location of the antisense to LAT transcript, AL.

14
the infection. Separation of the establishment and reactivation functions was determined
by a number of LAT mutants that maintain the ability to establish latency but do not
reactivate (Bloom et al., 1994; Bloom et al., 1996; Wang et al., 1997).
These viruses delete either the core promoter sequences of LAT or a region of the
LAT 5 exon. Another LAT mutant, containing a large deletion encompassing both the
LAT promoter and 827 bp of the 5exon, established 75% fewer latent infections than its
wild type parent virus. It was predicted that this reduction may be due to an increase in
neuronal cell death in the ganglia (Pemg et al., 1994; Thompson and Sawtell, 2001).
Since this virus contains deletions of both LAP1 and LAP2, and is phenotypically distinct
from a LAP1 mutant, further studies are needed to determine if the increase in neuronal
cell death is related to multiple but genetically separable LAT functions.
Reactivation is typically related to a stress event for the host. In the rabbit eye
model, reactivation is seen after iontophoresis of epinephrine onto the eye surface. In the
mouse thermal stress model, reactivation of HSV is seen after an increase in basal body
temperature. On a cellular level, the mechanism by which stress is translated to
reactivation is not known.
Deletion of the LAT core promoter eliminates the ability to reactivate, but viral
DNA is still detected in neuronal ganglia. In addition to the LAT promoter, deletions of
regions downstream of the transcription start site and extending into the intron have been
shown to be important in HSV reactivation. The specific function of this region remains
unknown, but deletions of a 348 bp fragment as well as a 371 bp Styl fragment located
within the region result in reduced reactivation in the rabbit model (Bloom et al., 1996;
Hill et al., 1996; Jarman et al., 2002). Smaller deletions in this region do not affect

15
reactivation therefore, the act of expressing some LAT is not sufficient for reactivation,
and presumably either specific RNA sequences or cis acting DNA elements located
within the 5 exon are important for reactivation (Bloom et al., 1996; Bhattachaijee et ah,
2003). The 5 exon region and the LAT core promoter are referred to as the reactivation
critical region (rcr).
Since expression of RNA itself is not sufficient for reactivation, other
mechanisms of LAT action have been proposed. The regulation of reactivation and/or
establishment may be at the DNA level. Many cellular genes use methylation of CpG
islands as an epigenetic method of regulating transcription. In these genes, a methyl
group is added to the cytosine of the DNA at regions to be either silenced or transcribed.
Previous studies determined that methylation was not present in the HSV genome as a
whole, but did not look at specific promoter regions of the genome. Using bisulfite
analysis Kubat et ah (2004) determined that there is no pattern of methylation as a form
of regulating HSV latent transcription.
These data suggest that instead of methylation, the virus uses the DNA chromatin
structure and its association with specific histone proteins as a means of regulation.
Further studies indicate that there is a difference in the chromatin acetylation pattern
during latency when comparing the LAT promoter to other acute HSV promoters (Kubat
et ah, 2004).
Virulence
Several LAT deletion mutants have an effect on virulence in either mice, rabbits,
or both experimental systems. The dLATl .5 virus contains a 5exon deletion of ~1600bp
and is increased for virulence in mice. Increased virulence in rabbits and decreased
virulence in mice were seen with LAT2.9A which contains only a 371 bp deletion in the

16
5 LAT exon. This virus was also reduced for spontaneous reactivation in the rabbit
(Pemg et al., 1999).
Other mutants deleting either a portion of the 5exon (A307) or the 3 portion of
the intron (A480) exhibit decreased virulence (Gary et al., in preparation). These
experiments on the whole indicate that there are differences in the infection between mice
and rabbits since the deletion viruses produce different effects dependent on the model
system used. Further studies are necessary to determine the mechanism employed by
these viruses in both the mouse and rabbit models.
Enhancer
A number of studies have demonstrated that the LAT core promoter, by itself, is
not sufficient to direct long-term expression (Margolis et al., 1993). The long-term
expression element (LTE) has been described as the region of the 5 exon from PstI to the
splice junction (Berthomme et al., 2001). Analysis using reporter constructs containing
this region downstream of the core LAT promoter continued to express (3-gal at 40 days
post infection while the control (containing just the LAT core promoter) had no
expression at 28 days post infection (Lokensgard et al., 1997). Transient expression
experiments containing the LTE showed that the LTE region can activate the HSV-1
thymidine kinase promoter in both neuronal and non-neuronal cells (Berthomme et al.,
2000). These data suggest that the LTE contains an enhancer element and functions to
promote long term LAT expression.
Neuronal Survival
LAT has also been implicated as a suppressor of apoptosis. A large LAT deletion
(-161 to +1667 relative to the LAT transcription start site) demonstrated increased

17
apoptosis by both TUNEL and PARP assays (Pemg et al., 2000). Ahmed, et al. (2002)
stated that plasmids lacking the sequences in the 5 LAT exon were least efficient in
blocking apoptosis, and that this region appears to contribute to cell survival. This is the
same region that contributes to the virulence and reactivation phenotypes mentioned
above (Figure 1-4). Additionally, Thompson and Sawtell (2001) have used LAT null
viruses to examine cell survival during infection. They showed that 75% less
establishment of latency occurred in the LAT null virus and this was accompanied by a
large amount of neuronal death. They propose that one function of LAT is to protect
sensory neurons from death and enhance the establishment of latency.
Other Possible LAT Functions
Since LAT is transcribed antisense to ICP0 and the ICP0 gene is one of the first
promoters activated in the lytic cascade, it was believed that LAT could have an antisense
effect on ICP0 expression. A portion of the 2 kb LAT intron overlaps with the ICP0
transcript. In clonal cell lines containing these regions of DNA, Burton et al. did not find
an antisense effect with ICP0 when expressing LAT in trans in non-neuronal cells
(Burton et al., 2003). This does not mean that LAT cannot act in cis to affect the ICP0
region of transcription, perhaps acting on the DNA itself or in a structural manner to open
or close the region of DNA.
Another antisense function involves the transcript AL (antisense to LAT) which is
transcribed 6-8 hours post infection in PC-12 cells. AL is located in the 5exon and core
promoter region of LAT (Figure 1-4), and may have an opposing or balancing function
with LAT although more research is needed to specifically define AL and its function in
the HSV infection (Pemg et al., 2002). To date the AL transcript has only been detected

18
in productively infected PC-12 cells in culture using RT-PCR, and can not been detected
in vivo.
LAT also has a repressive function. A LAT mutant which had reduced LAT
expression exhibited an increase in the amount of ICP4 and thymidine kinase expression
compared to wild type infection (Chen et al., 1997). A possible mechanism for this
repressive function may be explained by regions of sequence homology to Xist
suggesting that LAT may function to paint the HSV chromosome to silence it similar to
Xist painting the inactive X chromosome in mammalian cells (Bloom et ah, 1996).
The HSV LAT region encompasses a number of transcripts present on both
strands of DNA. The various functions for LAT presented here may be important at
different times during the course of HSV infection, and some may work in combination
with other viral functions making them difficult to phenotypically dissect in the context
of the virus. It is also possible that some of these functions are not manifest during the in
vivo infection since they have been discovered and tested in cell culture systems only.
This complexity of dissecting LAT functions provides the basis for generating a
transgenic mouse containing this region of LAT DNA to further study its functions in the
absence of the HSV genome and its contributed cis and trans acting viral functions.
Use of Transgenics to Study Disease
Expression of Acute Genes in Transgenic Mice
Transgenic technology has been used to study the roles of genes out of their
native context. To generate a transgenic animal, the gene of interest is injected into the
single cell fertilized oocyte nucleus typically of mice, although other species have been
used as well. By injecting the single cell, the transgene is able to be integrated and
replicated with each cell division and is then present in every cell of the animal. The

19
expression of the transgene is generally dependent upon the promoter used to drive the
inserted gene.
In the case of HSV-1, transgenic mice have been created to study regulation of the
different classes of HSV genes. These mice each contain the HSV promoter in question
driving a lacZ reporter. An ICP4 transgenic mouse expressed such a reporter under the
control of the ICP4 promoter primarily in neuronal tissues, with lower levels of
expression in trigeminal ganglia and retinas and high levels of expression in brain regions
and the dorsal hom of the spinal cord (Mitchell, 1995). Additionally, ICPO and ICP27
transgenic mice demonstrated similar expression in neuronal tissues (Loiacono et al.,
2002). In addition the ICPO and ICP4 transgenic mice were shown to differentially
express the reporter based on the age of the mice. ICP4 transgenic mice had
approximately 100-fold greater expression in newborn mice compared to adults.
Differential expression of ICPO was the reverse of the expression seen with ICP4, with
expression increasing with age. These findings indicate that although HSV immediate
early promoters contain similar regulatory elements, they are regulated differently by
cellular factors in the absence of other HSV proteins. In contrast to the findings with the
IE promoters, both neuronal and non-neuronal cells were negative for expression in a gC
transgenic mouse, illustrating that HSV late promoters require other viral functions for
their expression (Mitchell, 1995; Loiacono et al., 2002).
Expression of LAT in Transgenics
Previously a LAT transgenic mouse had been created to specifically study the
splicing of the 1.5 kb LAT out of the 2 kb LAT intron. This mouse contains the 2 kb
LAT of HSV-1 under control of a CMV promoter. Studies have determined that the
splicing event of the 1.5 kb species is more efficient in neural tissues than non-neural

20
tissues and suggested that the LAT transgenic mouse reactivates more efficiently than
non transgenic littermates (Mador et al., 2003). One of the drawbacks of this transgenic
mouse model is that the CMV promoter was used instead of the native LAT promoter.
The CMV promoter is a strong constitutive promoter that has activity in all cell types.
Thus, while the splicing event may be specific to LAT, expression patterns may permit
splicing in cell types that are non-permissive for the latent HSV infection.
Using the LAT region from HSV-2, Wang et al. (2001) studied establishment and
reactivation in a transgenic mouse. HSV-2 LAT was driven by its native promoter and
had expression to high levels in neural tissues as well as some non-neural tissues
determined by northern blots of tissue RNA. The expression in non-neural tissues was
not expected, but not surprising since Jarman et al. had shown LAT expression in the feet
during acute HSV infection (Jarman et al., 1999). In these mice expressing LAT in trans
had no effect on the HSV-2 infection at the establishment or reactivation level. Since
there are a number of differences in tropism between HSV-1 and HSV-2, and because the
HSV-2 LAT intron is processed differently than that of HSV-1, the construction and
analysis of an HSV-1 transgenic mouse model expressing the HSV-1 LAT from its native
promoter was desirable and the focus of this dissertation.
Hypotheses to be Tested Using the Transgenic Approach
Generation of Transgenic Mouse
In the studies presented here, we have generated a LAT transgenic mouse from
HSV-1 strain 17+. This mouse line uses the native HSV-1 LAT promoter and contains
the region encoding the LAT transcript 5 exon and 2 kb intron. The rationale for using
these regions will be discussed further in Chapter 2. Initial characterization of the mouse

21
includes determination of the transgene copy number, mapping the transgene insert and
gross tissue-level expression studies.
Expression of LAT in trans
Since the LAT transgene is being controlled by the native LAT promoter and the
region of the promoter shown to contain neuronal specific elements was included in the
sequence inserted, it was hypothesized that LAT would be expressed in neuronal tissues.
Data from the HSV-2 transgenic mouse suggests that LAT can be expressed in non
neuronal cells as well, although the expression was not quantitated (Wang et al., 2001).
In this study, quantitative RT-PCR was employed to determine if neuronal cells could
more efficiently produce the LAT transcript than non-neuronal cells. In addition to
quantitative RT-PCR of RNA extracted from whole tissues, in situ hybridization
techniques were used to determine if expression is from all cells or a subset of cells.
Infections
Effect of LAT on the course of infection
It is known that in the context of the HSV genome LAT is expressed in neuronal
cells during latency. It was possible that expressing LAT prior to the infection, in trans,
could have an effect on the course of infection, such as altering the establishment of
latency, or the ability of the virus to reactivate from latency. To study these effects,
transgenic mice and their non transgenic littermates were infected with wild type 17+
HSV-1. Similar to the observations made in the case of the HSV-2 mouse, we
hypothesized that expressing LAT in trans would not alter the HSV infection, and that
during a natural HSV-1 infection, LAT functions in cis on the HSV genome.

22
Restoration of virulence by expressing LAT in trans
One of the functions attributed to LAT is a change in virulence (Gary et al., in
preparation; Pemg et al., 1999). By infecting LAT transgenic mice with a LAT mutant
that is reduced in virulence, we hypothesized that the expression of the transgene
containing the region deleted in the mutant could restore wild type virulence level if the
function can act in trans. In this case, virulence was measured as a function of virus
titers reaching the DRG and assayed by titering the amount of infectious virus present in
feet and DRG during the acute infection following footpad inoculation.
In summary, HSV-1 LAT is a complex region with a number of functions
attributed to it. Generation of a transgenic mouse containing this region can be used to
further define some of these functions a well as to determine which functions are trans
acting and can be attributed to the expression of the RNA.

CHAPTER 2
GENERATION OF A TRANSGENIC MOUSE EXPRESSING A PORTION OF THE
HSV-1 LATENCY ASSOCIATED TRANSCRIPT
Overview
The latency-associated transcript (LAT) of HSV-1 has been implicated as playing
a role in a number of functions related to the viral infection. The mechanisms of these
functions and the regulation of the LAT transcript have not been determined. To
examine the regulation of the LAT in cells, we have generated a transgenic mouse
containing the LAT inserted into the mouse genome. This therefore has allowed us to
study the LATs function outside its normal context of the HSV genome.
Transgenic technology was first used in 1980 to inject HSV and SV40 viral
plasmid DNA into a fertilized mouse pronucleus (Gordon et al., 1980); and has since
expanded to include transgenic animals for a number of human disease models and viral
gene models (Nomura, 1997). The use of mice for transgene studies is ideal because of
the knowledge of mouse genetics and the number of different genetic strains available.
Although other transgenic mice containing HSV LATs have been generated, they
did not contain the native promoter sequence or the LAT from HSV-1 (Wang et al., 2001;
Mador et al., 2003). Thus, the HSV-1 LAT transgenic mouse described here is a novel
model system because it allows for LAT to be regulated by its native promoter. This
mouse has provided a means for studying a number of the proposed LAT functions
including reactivation, virulence, and neuronal survival.
23

24
In addition to determining whether a transgenic mouse line expresses its
transgene, characterization of any new transgenic mouse line routinely requires
determining the copy number and the integration site of the transgene. The location of
the transgene in the genome may effect transcription of the transgene by position effects.
If the transgene inserts into a silenced region of the genome, it may not be expressed or
expressed at low levels due to the regulation of the surrounding region of DNA (Sippel et
al 1997).
The goal of this dissertation was to generate a HSV-1 LAT transgenic mouse to
study LAT regulation by cellular factors in the absence of viral cis and trans factors.
This chapter describes the construction, breeding strategy, and the initial characterization
of the transgene in the HSV-1 LAT transgenic mouse line.
Materials and Methods
Plasmid Used to Generate the Transgenic Mouse
The pLAT/LAT plasmid was generated to construct the transgene insert. A
portion of the HSV-1 strain 17+ latency associated transcript (LAT), including the Dral
site (corresponding to HSV-1 genome base pair 116,516) to the Aatll site (corresponding
to HSV-1 genome base pair 121,549), was ligated into a pBluescript backbone at the
Smal site. The SV40 poly A sequence from pNSE-Ex4 (a gift from G. Rail, The Fox
Chase Cancer Center) was removed using EcoRI and inserted at the Xbal site into the
pBluescript plasmid containing the LAT sequence. Figure 2-1 diagrams the region of the
LAT gene used in constructing the transgene as well as its location in the HSV genome.
The complete plasmid sequence and map is presented in Appendix A.

25
Screening for Founders Containing the LAT Insert
Fertilized oocytes were obtained from C3H/HeJ mice. Purification of the
transgene, preparation of mice, microinjection into fertilized oocytes and embryo
implants were carried out by Dr. Glenn Rail at Fox Chase Cancer Center as described
(Hogan et al., 1986; Rail et al., 1995).
DNA from the founder generation (FI) of mice was obtained by clipping a 1 cm
portion of the tail from anesthesized mice. Tail clips were incubated overnight at 50C in
0.5 mL STE buffer (50 mM TRIS pH 8, 100 mM NaCl, ImM EDTA, 1% SDS) and 1 mg
Proteinase K. After incubation, hair and bone were removed by centrifugation at 20,000
x g and the supernatant transferred to a new centrifuge tube. DNA was extracted with
equal amounts of phenol and sevag (1:24 ratio of isoamyl alcohol and chloroform)
followed by extraction with sevag alone. DNA was precipitated with 100% ethanol. The
DNA pellet was resuspended in TE (lOmM TRIS, ImM EDTA) pH 8 and quantitated by
spectrophotometry at A26o- The founder generation was screened by Glenn Rail using
slot blot hybridization analysis. Briefly, 10 pg of DNA per slot of a slot blot apparatus
was applied to a nylon membrane for hybridization as described by Rail et al. (1995).
The membrane was probed with a P-labeled DNA fragment from either the SV40 poly
A sequence in the pNSE-Ex4 plasmid or a portion of the LAT transgenic insert fragment
corresponding to 119,193 to 120,090 nucleotides (nt) of the HSV-1 strain 17+ genome.
The nt determinations for all genomic HSV sequences presented in this dissertation are
according to McGeoch numbering (Perry and McGeoch, 1988).
Genotyping of subsequent generations was determined by PCR analysis. DNA
was prepared from tail clips as described above. pLAT/LAT plasmid DNA was used as a

26
Transgene Insert
Dra I Aat II
3ZZZZ ~ SV40pA
0
£
K)
Figure 2-1. Diagram of the LAT Transgene Insert. Shown is the HSV-1 genome with the
LAT region expanded to include the location of the LAT and ICPO genes. LAT is further
expanded to illustrate the exact region included in generating the transgenic mouse. For
the transgene insert the promoter is illustrated as a dotted line. A SV40 poly A sequence,
shown here in red, was added to stabilize the expressed RNA.
positive control for all genotyping PCR reactions. PCR primers were located in the 5
exon region of LAT corresponding to nt 118,888 to 119,037 of the HSV-1 genome
(forward: 5CGG CGA CAT CCT CCC CCT AAG C3 and reverse: 5GAC AGA CGA
ACG AAA CAT TCC G3). Each reaction contained 200 ng of tail DNA, 0.5 pM of

27
each primer, 1.5 mM Tris pH 8.8, 16.6 mM ammonium sulfate, 2 mM magnesium
chloride, 0.17 mg bovine serum albumin, 1.25 mM each dGTP, dCTP, dATP, dTTP and
2.5 U Taq polymerase (Perkin Elmer). PCR was performed using a Ericomp
thermalcycler (San Diego, CA) using the following conditions: one cycle 3 minutes 94C,
3 minutes 55C, 3 minutes 72C followed by 30 cycles 1 minute 94C, 1 minute 55C, 1
minute 72C.
PCR products were viewed on a 7% polyacrylamide gel using SYBR green
(Molecular Probes, Invitrogen) and a Storm Phosphoimager. The intensity of the tail
DNA amplification products were compared to PCRs of dilutions of the positive control
pLAT/LAT plasmid to determine the transgenic genotype by quantitating the intensity of
the bands using Image Quant software.
Breeding of Transgenic Mice
All mice were maintained under specific pathogen free (SPF) conditions with
access to food and water at will. Each cage contained com cob bedding and cotton
nestlets. Cage bedding was replaced bi-weekly.
The positive founder mouse was backcrossed with a C57B1/6 mouse and the
resulting litter screened by hybridization for presence of the LAT transgene. The F2
generation transgenic positive mice were again backcrossed in the C57B1/6 background.
All breeder animals were at least 8 weeks old. Initial C57B1/6 breeders were obtained
from Harlan. A small C57B1/6 colony was then maintained to provide C57B1/6 breeders.
Mice were maintained as for the transgenic colony although only a single breeder pair
was needed and genotyping was not necessary for these mice.

28
Transgenic breeder cages contained one male with up to three females. Males
were kept in the same cage with the breeder females for one week to ensure pregnancy.
At approximately 18 days post breeding, females were separated into individual cages to
deliver their litters. Pregnant females and newborns were monitored at least twice daily
for difficulty with delivery and/or nurturing. Pups remained with their mother for three
weeks until they were weaned and sex-separated. Genotyping of the weanlings was
performed approximately one week after weaning.
Backcrosses continued until obtaining the FI0 generation at which time the
transgenic background was considered to be genetically C57B1/6 and were crossed with
F10 littermates to generate homozygous transgenics. All mice used in the studies
described here are heterozygous for the LAT transgene and were of at least the F4
generation.
Determination of Transgene Copy Number
Slot blot hybridization
Slot blot hybridization was used to determine transgene copy number. DNA from
tail clips of weanlings was isolated and quantitated as described above for genotyping.
For each sample 10 pg DNA, 15 pL 3 M NaOH, and 130 pL TE in a final volume of 175
pL was vortexed and incubated at 65C for 30 minutes. During the incubation, the slot
blot apparatus (Gibco BRL) was loaded with Zeta Probe membrane (Bio Rad) pre-wet in
water followed by 15x SSC. Incubated samples were ice-quenched and 165 pL of 2 M
ammonium acetate added just prior to loading into the blot apparatus. Vacuum was
applied after all the samples had been loaded.

29
Prior to hybridization the blot was baked for two hours in a vacuum oven at 80C.
Pre-hybridization and hybridization were carried out at 65C in 20 mL of hybridization
buffer (5x SCC, 5x Denhardts solution, 1% SDS) in a sealed bag with each incubation
lasting overnight. ATD19 probe (nt 119,664 to 119,972 bp of the HSV genome) labeled
with P was added to the buffer after the first overnight incubation. The labeled blot was
washed twice for 15 minutes each at room temperature with 0.3 M NaCl, 0.06 M Tris pH
8.0, 0.002 M EDTA followed by two washes for 15 minutes each at 65C with 0.3 M
NaCl, 0.06 M Tris pH 8.0, 0.002 M EDTA, 4% SDS. After washing the blot was dried
on Whatman paper and exposed to a phosphor screen overnight. The intensity of the
radiolabled bands was detected on a STORM phosphorimager and quantitated using
image quant software.
Real time PCR
To confirm and further quantitate the transgene copy number, a comparison
between the cellular Xist gene and LAT transgene was made using real time PCR.
Reactions were performed using primers specific for the 5 exon of the LAT and Xist.
Primer and probe sequences were 5LAT forward: 5GGC TCC ATC GCC TTT CCT,
5LAT reverse: AAG GGA GGG AGG AGG GTA CTG, 5 LAT probe: 5TCT CGC
TTC TCC CC, Xist forward: 5GCT CTT AAA CTG AGT GGG TGT TCA, Xist reverse:
5GTA TCA CGC AGA AGC CAT AAT GG, Xist probe: 5ACG CGG GCT CTC CA.
PCRs were performed on an ABI Prism 7700 thermal cycler (Applied Biosystems)
located in the ICBR protein core at the University of Florida. Ten-fold dilutions of the
LAT transgenic plasmid (pLAT/LAT) corresponding to 104 to 101 copies were used to
generate a standard curve. For the Xist cellular control, a standard curve of the pBl/B10

30
plasmid, a generous gift of Dr. Jeannie Lee (Shibata and Lee, 2003), was diluted 10 fold
between 105 and 101. Samples were run in triplicate. Each reaction contained 10 ng tail
DNA, 0.33 pL 60x Assay Mix (primer/probe set), 10 pL Taqman Universal PCR Mix
(Applied Biosystems part #430437) in a final volume of 20 pL. PCR was performed in
96 well plates under the following conditions: 1 cycle 2 minutes 50C, 1 cycle 10 minutes
95C, 40 cycles 15 seconds 95C 1 minute 60C.
Mapping of Transgene Insert
Mapping of the LAT DNA inserted into the transgenic mouse was determined
using both conventional and real time PCR. For conventional PCR, reactions contained
600 ng each of forward and reverse primers, 20 pL Hot Master PCR mix (Brinkman
Eppendorf) and 200 ng tail DNA in a 50 pL final reaction volume. Control PCR
reactions contained 600 ng each of forward and reverse primers, 20 pL Hot Master PCR
mix and 0.5 ng pLAT/LAT plasmid DNA in a final reaction volume of 50 pL. Primer
sequences, genome locations and optimal conditions for all primer sets used are found in
Appendix B.
Real time PCR was used for two regions of the transgene, one in the promoter and
one in the 5 exon. Primer and probe sequences for these reactions are found in Appendix
B. All real time reactions were performed on an ABI Prism 7700 thermal cycler (Applied
Biosystems) located in the ICBR protein core at the University of Florida. Samples were
run in triplicate. For each reaction, 50 ng of tail DNA was added to 0.33 pL 60x Assay
Mix (primer/probe set) or 1 pL 20x Assay Mix, and 10 pL Taqman Universal PCR Mix
(Applied Biosystems part #430437) in a final volume of 20 pL. Control reactions used 1
ng of pLAT/LAT plasmid in place of the tail DNA. PCR was performed in 96 well plates

31
under the following conditions: 1 cycle 2 mintues 50C, 1 cycle 10 minutes 95C, 40
cycles 15 seconds 95C 1 minute 60C.
Northern Blot of Transgenic RNA
Harvesting of transgenic tissues
Transgenic mice were euthanized with halothane and brain, DRG, liver, kidney,
and foot were dissected. Tissues were snap frozen in liquid nitrogen and stored at -80C
until processed for RNA.
Isolation of RNA from tissues
Tissues were homogenized in 400 pL Trizol reagent (In vitro gen) using Kontes
glass tissue grinders (Fisher) or a ceramic mortar and pestle for larger tissues (i.e. skin,
feet, liver). Sterile sand was added to the mortar to aid in grinding of the feet. Grinders
were rinsed twice with 400 pL Trizol each and this rinse solution added to the ground
tissue fraction. After 5 minutes at room temperature, 240 pL of chloroform was added
and homogenates vortexed 15 seconds followed by a 5 minute incubation at room
temperature. Tissue homogenates were centrifuged at 9,000 x g for 15 minutes at 4C
and the aqueous phase containing the RNA was removed to a separate tube. The bottom
Trizol layer was stored at -80C for subsequent back-extraction of DNA, if necessary.
RNA was precipitated with 500 pL of isopropanol at room temperature for 10
mintues followed by centrifugation at 12,000 x g for 10 minutes at 4C. RNA pellets
were washed with 1 mL 70% ethanol and centrifuged 5 minutes at 4C, 7,500 x g. The
resulting pellet was air dried briefly and resuspended in 200 pL diethyl pyrocarbonate
(DEPC, Sigma)-treated water.

32
Preparation of formaldehyde-agarose gels and blotting of RNA
To prepare the gel for RNA, a slurry of 1 gram of agarose was prepared in 75 mL
of sterile DEPC-treated water and microwaved to melt the agarose. The melted agarose
was then cooled to approximately 60C and, just prior to pouring the gel, 20 mL of 5X 3-
(N-morpholino) propanesulfonic acid (MOPS) and 5.3 mL of a 37% formaldehyde
solution (v/v) was added and mixed gently to prevent bubbles from forming in the gel.
The gel was allowed to harden for at least one hour before loading the RNA.
For each RNA sample, 5 pg of RNA was mixed with 15.5 mL FFLB (10 parts
formamide, 3.5 parts 37% formaldehyde, and 2 parts 5x MOPS) in a total volume of 20
pL and incubated for 15 minutes at 65C. Samples were snap-cooled on ice prior to
loading on the gel, and 2 pL of RNA dyes (50% glycerol, ImM EDTA, 0.25%
bromophenol blue, 300 pg/pl ethidium bromide) were added to each sample for loading.
Running buffer consisted of 160 mL 5x MOPS, 43 mL 37% formaldehyde q.s. to 800 mL
with DEPC-treated water. The RNA was electrophoresed at 85 volts for approximately 3
hours. The dye front ran approximately 9 cm from the wells on a 14 cm gel. RNA was
viewed using ultraviolet light and photographed with a digital camera (Kodak Photo
Documentation System).
Transfer of RNA to membrane
The RNA was transferred onto to Zeta Probe Nylon Membrane (Bio Rad)
according to the manufacturers directions. The gel was rinsed briefly in water and
transfer set up using Whatman paper as the wicking for capillary transfer. In addition to
the membrane located on top of the gel, four layers of whatman paper and 2 inches of
paper towels were included. For the transfer solution, 10X SSC was allowed to absorb

33
from the reservoir through the wicking papers at room temperature overnight. The
transferred membrane was rinsed in Nanopure water and baked at 80C in a vacuum oven
for 30 minutes to crosslink the RNA to the membrane.
Hybridization of northern blot
ATD19 probe (corresponding to nt 119,664 to 119,972 from the HSV genome)
was random hexamer primed (Random Labeling Kit, Roche) and labeled with P dCTP.
The blot was pre-hybridized for 3 hours at 42C in 20 mL FPH buffer (5X SSC, 5X
Denhardts solution, 50% Formamide, 1% SDS) in a sealed bag. Labeled probe was
added through a small cut in the comer of the bag and resealed. The hybridization was
incubated overnight at 42C.
The Northern blot was washed twice at room temperature with 50 mL 2X
SSC/0.1% SDS for 5 minutes each followed by two washes in 0.2X SSC/0.1% SDS for 5
minutes each at room temperature. The blot was dried briefly on Whatman paper and
exposed to a phosphor screen for 5 hours. A STORM phosphorimager was used to scan
the blot and the intensity of bands measured by Image Quant software (Molecular
Dynamics, Sunnyvale, CA).
Results
Determination of the Number of Copies of the LAT Transgene
When generating transgenic animals, it is common for multiple copies of the
transgenic insert to be integrated into the animal genome (Ellis et al., 1997). There are a
number of ways to determine the number of integrated copies, including hybridization
and PCR. Initially, we used slot blot hybridization to quantitate the copies of LAT
transgene present in these mice. In this case, the LAT hybridization signal from a known

34
quantity of transgenic-positive tail DNA was compared to the hybridization signal
generated from a known number of copies of LAT plasmid DNA spiked into a negative
tail DNA sample to represent increasing copies per cell of the transgene. Comparison of
the transgenic-positive and transgenic-negative mouse DNA to the control samples
indicated that there was a low number of copies present in the transgenic mouse (figure
2-2). The difficulty in distinguishing between the positive and negative samples may
have been due to an error in dilution of the standards since this involved a
spectrophormetrically determined quantity.
Pos
Neg
1 copy
>2 copies
15 copies
Figure 2-2. HSV transgene copy number determination by slot blot hybridization
analysis. Tail DNA from a transgenic (pos) and non-transgenic (neg) mouse
was compared to known copies of a plasmid containing the transgene, in the
background of tail DNA from a non-transgenic mouse.
Hybridization is not a reliably quantitative method, particularly with low copy
numbers, thus to more accurately evaluate the number of LAT transgenes inserted we
switched to real time PCR. For this system of analysis, a cellular gene of known copy
number, Xist, was compared to the number of copies of LAT in transgenic tail DNA.
Since Xist is located on the X chromosome, the sex of the animal was taken into
consideration and the copies of Xist for female mice was divided by 2 to standardize

35
samples to compare the LAT transgene to a single copy of the cellular control for both
male and female samples. Table 2-1 contains the PCR data for the cellular and LAT PCR
reactions. Although the copy number determined by this analysis is less than one, when
taking into account the error of the samples, and the fact that there has to be an integer
number of copies, the most likely interpretation is that there is only a single copy of LAT
present in these mice.
TABLE 2-1 Determination of transgenic copy number by real-time PCR.
Xist Copies1
LAT copies
LAT/Xist
1
3.03 x 10J
1.28 x 10J
0.422+/-0.109
2
1.56 x 10J
5.43 x 10'
0.348 +/- 0.209
3
1.47 x 10J
4.30 x 102
0.293+/-0.193
4
2.69 x 10J
2.80 x 10J
1.041 +/- 0.306
5
3.39 x 10J
5.83 x 10J
1.720+/- 0.385
Average
0.765 +/- 0.240
1 +/- 730 copies
While mosaicism is possible in up to 30% of transgene insertions (Wilkie et al.,
1986), the genetic inheritance from the breeding of these mice does not suggest that a
mosaic is present. In a mosaic animal, the transgene inserted into the genome after the
first cell division and is therefore not present in the genome of each cell in the animal. If
this were the case, only a portion of the germ cells would contain the transgene and thus
less than 50% of the offspring of a transgenic and wild type mating would carry the
transgene. With almost 500 offspring from transgenic and wild type matings to date, we
have not seen evidence consistent with mosaicism in the LAT transgenic mouse.
Mapping of the Transgene Insert
Generation of the transgenic founder mouse was more difficult than usual,
requiring three separate sets of injections to obtain a single founder. Screening for the

36
founder mouse determined that the SV40 poly A signal has been deleted, thus the founder
was LAT positive and SV40 negative (G. Rail, personal communication). PCR analysis
of DNA from transgenic mice was used to confirm the extent of the LAT transgenic
insert present in the transgenic line. As described in the materials and methods, both
conventional and real time PCR were used to map a large portion of the transgene.
Figure 2-3 illustrates the location of primer sets used to map the transgene, and indicates
those that were positive for presence of the transgene. The regions analyzed by
conventional PCR are represented by black arrows, while the regions analyzed by real
time PCR are shown in red. Also shown are the locations of two probes, ATD17 and
ATD19 (shown in blue) which were used in hybridization analyses described later that
also confirmed the presence of the regions of the LAT in the transgenic mouse.
The PCR products resulting from the conventional PCR reactions (figure 2-4)
illustrate bands of the indicated sizes with both pLAT/LAT plasmid and mouse tail DNA.
One additional primer set AG29 and AG31 failed to detect the corresponding LAT
sequences in the DNA from the transgenic mouse. The location of these primers is
represented in green, and corresponds to the 3 end of the transgene insert (figure 2-3).
Since this primer pair (AG29 &31) has failed to detect a product from transgenic DNA it
is believed that a portion of the 3 end of the transgene has been deleted in addition to the
SV40 poly A signal.

37
LAT Promoter Intron
Dral
oo

£
K)
Aatn
Promar
00 00
- w
*
O Vi
= ATO 17
**
I ATD19
¡
X
fi
vO
X
"to
b
O
to
sO
O'
a
o
to
DB60&61
X vO
<
X o
X w
X vj
> >
Mint AG29&30
to to to
p p -
'o oo o
vO vO ^
0 00 A
to
to
vl
to
M2 Probe
to
p
'0
£
oo
to
o
3v
u
LPro
5LAT

-
00 00
vO so
w V
w w
vO 00
W vo
vO v|
* o
AG29&31
to Z
Figure 2-3. Mapping of the LAT transgene in the LAT transgenic mouse. The blue lines
represent the location of hybridization probes positive with the indicated LAT
regions. Black arrows depict primers used for conventional PCR analysis
positive for the transgene, and primers used for real time PCR analyses are
shown in red. Illustrated in green are conventional PCR primers that were
positive in reactions with the transgenic plasmid but not in reactions
containing DNA from the transgenic mouse suggesting that this region has
been deleted.

38
A. Promar DB60, 61 M int M2 Probe
315
Us*
149
101
H20 LATTg H20 LAT Tg H20 LAT Tg H20 LAT Tg
B.
AG29, 30
228'
H20 LATTg
C.
489
AG29, 31
H20 LATTg
Figure 2-4. PCR mapping the transgene insert. A. Four primer sets, Promar, DB60&61,
M int, and M2 Probe, all present in both the LAT plasmid (LAT) and
transgenic mouse (Tg). FLO lanes are no template control. B. Primer set AG
29&30 present in both LAT plasmid and transgenic mouse. C. Primer set
AG29&31 present in LAT plasmid but not transgenic mouse. The location of
the primer sets in the HSV genome are diagrammed in figure 2-3.

39
Determination of Transgene Expression by Northern Blot Analysis
Initial expression studies to determine if LAT was active in the transgenic mouse
line were carried out using a Northern blot and probing for the LAT intron which
typically accumulates to high levels in ganglia of infected mice. Since the transgene is
present in all cells of the mouse, neural and non-neural tissues were analyzed to see if
expression or accumulation of this intron was different in the various types of tissue.
DRG that were latently infected with HSV were used in this experiment as controls for
both the presence and size of the stable intron.
Figure 2-5b demonstrates that the LAT intron is accumulating in the DRG of
transgenic mice but not in the other tissues tested (Liver, Kidney, Brain, Feet). The RNA
gel (figure 2-5a), when photographed using ultraviolet light indicated that there was RNA
present in each of the wells and that there was more RNA present in the Kidney and
Brain samples than the DRG sample. Thus, the lack of hybridization in the samples was
not due to the absence of RNA. Lack of intron accumulation in tissues other than the
DRG does not mean that LAT is not being expressed in those tissues. In the tissues not
accumulating LAT intron, splicing may be inefficient or the intron maybe destabilized.
The presence of a higher molecular weight band in the brain sample (figure 2-5b) may
support these theories but further studies are necessary to confirm the mechanism
involved in the lack of intron accumulation. The size of the LAT intron band (relative to
the sizes of the 28s and 18s RNA bands) when compared to the controls (DRG compared
to K6) indicates that the intron from the transgenic mouse is complete, measuring to
approximately 1.9 kb.

40
Figure 2-5. Expression of the LAT transgene. A. Agarose gel of total RNA from
transgenic and HSV-1 infected mice. In the transgenic total RNA was
isolated from liver (LV), kidney (K), foot (F), brain (BR), and dorsal root
ganglia (DRG). Control RNA from HSV infected mice (K6). The location of
18s and 28s RNA is marked on the gel. B. Northern blot using a probe for the
LAT 2kb intron. Accumulation is seen only in the infected DRG and the
transgenic DRG. A larger molecular weight band in the brain suggests that
there may be a splicing difference between different types of tissue.

41
Discussion
Unlike typical transgenic inserts, the LAT founder mouse was particularly
difficult to produce and required three separate injections. When the founder mouse was
generated there was only a single founder compared to other injections where there are
usually at least 10% transgenic animals in the first litter (Voncken, 2003), and the LAT
founder has deleted the SV40 poly A sequence. One potential interpretation of this result
is that a portion of the LAT region inserted in the context of genomic DNA may be lethal
to the embryo. Further studies are necessary to determine if this is the case. However,
the LAT transgenic line that was created can be (and has been) used to study LAT
regulation and functions provided that it is stable and expressed.
Initial studies by both hybridization and PCR to determine the number of
transgene copies inserted indicate that the LAT transgenic line contains a single copy.
The fact that only a single copy was inserted is consistent with the possibility that LAT
inserts may not be well-tolerated in mice since it is common to have multiple copies of
typical transgenes integrated at a single locus of the mouse genome, in some cases more
than 100 copies have been shown to be inserted (Ellis et al., 1997).
Screening for the founder mouse determined that the LAT transgenic mouse was
LAT positive and SV40 negative. The probe used to screen for LAT in this case
encompassed 897 bases of the transgene and would not evaluate the extent of the
deletion. In data presented here it was shown by PCR that the deletion is confined to the
3 most end of the transgene and may be as little as 132 bases. Based on figure 2-5b it
appears that the deletion does not include the splice acceptor site since the stable 2kb
LAT intron can be detected in transgenic DRG.

42
The LAT intron exists as a stable lariat structure with a half-life of approximately
24 hours (Thomas et al., 2002). The results obtained from Northern blotting transgenic
RNA suggest that the intron is present in its entirety and can be stably expressed in DRG
but not in the other transgenic tissues examined. The lack of intron signal in non-neural
tissues does not mean that LAT is not being expressed. It is possible that the intron is
stable only in ganglia or that splicing of the intron is not as efficient in non-neuronal
cells.

CHAPTER 3
EXPRESSION PROFILE OF THE LAT TRANSGENE
Overview
The previous chapter presented data that the LAT transgenic mouse was
expressing the LAT transgene through the detection of the stable intron in dorsal root
ganglion cells by Northern blot analysis. A quantitative expression profile encompassing
both neural and non-neural tissues is presented in this chapter. Since the HSV LAT is
expressed during latency, we expected that LAT expression is being regulated largely by
cellular functions, and we therefore expected to see LAT expression in the transgenic
mouse. What was less clear was whether some viral function contributed to the
regulation of LAT expression, and since no other viral genes were present in the
transgenic mouse to regulate LAT expression we expected the transgenic mouse would
be a valuable tool to look at the cellular control of the LAT promoter. During the course
of infection, accumulation of LAT intron typically occurs in neuronal cells (Rodahl and
Stevens, 1992), suggesting that neurons contain some factor not present in other cells to
allow for the expression of LAT or to prevent its repression. If this was the case, then
LAT expression should be seen either exclusively in neural tissues or at higher levels in
neural tissues of the transgenic mouse. Therefore, examining LAT expression in neural
vs. non-neural cell types was a high priority goal for this investigation.
The two previously described HSV transgenic mice have used non-quantitative
methods to examine expression of the LAT transgene. Both the HSV-2 LAT transgenic
and the HSV-1 LAT intron transgenic used a Northern blot to assess transgene
43

44
expression, and only a few different tissues were examined. In the case of the HSV-2
LAT transgenic mouse, detailed expression data was presented only for some central and
peripheral nervous tissues and expression in non-neural tissues was mentioned in the
discussion, but data was not presented (Wang et al., 2001; Mador et ah, 2003).
In addition to determining the tissue-specific expression profile, the cell-specific
expression of LAT was examined by in situ hybridization. The Margolis group reported
that during an experimental HSV-1 infection of mice, the LAT is expressed in a
particular subset of neuronal cells of DRG and TG (Yang et ah, 2000). By in situ
hybridization analysis of the LAT transgenic mouse, we sought to determine if LAT is
being expressed in all cells or a subset of cells as evidence of whether LAT expression in
different neurons is controlled primarily by cell-specific factors or whether trans-acting
viral factors may contribute to the differential expression profile noted by Margolis.
Materials and Methods
Harvesting of Transgenic Tissues
Transgenic mice were euthanized with halothane and cortex, hypothalamus
(cerebrum bottom), cerebellum, spinal cord, olfactory bulb, TG, DRG, spleen, liver,
kidney, skin, foot, heart, intestine, eye, and lung were dissected, snap-frozen in liquid
nitrogen, and stored at -80C until processed for RNA.
Isolation of RNA from Tissues
Tissues were homogenized in 400 pL Trizol reagent (Invitrogen) using Kontes
glass tissue grinders (Fisher) or a ceramic mortar and pestle for larger tissues (i.e. skin,
feet, liver). Sterile sand was added to the mortar to aid in grinding the feet and skin.
Grinders were rinsed twice with 400 pL Trizol each and the rinse solution was added to

45
the ground tissue fraction. After a 5 minute room temperature incubation, 240 pL of
chloroform was added and homogenates were vortexed 15 seconds followed by a 5
minute incubation at room temperature. Tissue homogenates were centrifuged at 9,000 x
g for 15 minutes at 4C, and the aqueous phase containing the RNA removed to a
separate tube. The bottom Trizol layer was stored at -80C for back extraction of DNA if
necessary.
RNA was precipitated by the addition of 500 pL of isopropanol and incubation at
room temperature for 10 minutes followed by centrifugation at 12,000 x g for 10 minutes
at 4C. RNA pellets were washed with 1 mL 70% ethanol and centrifuged 5 minutes at
4C, 7,500 x g and the resulting pellet air dried briefly and resuspended in 200 pL diethyl
pyrocarbonate (DEPC, Sigma) treated water.
DNA contamination of the RNA was reduced using DNA-free (Ambion, Austin,
TX). One half of the tissue RNA was added to 2 units of DNasel and 0.1 volumes of
DNasel buffer, mixed gently and incubated at 37C for 30 minutes. After the incubation,
0.1 volumes of DNase-inactivation reagent was added to each tube and incubated at room
temperature for 2 minutes. DNase inactivation reagent was pelleted at 1,000 x g for 1
minute and supernatant was transferred to a new tube. RNA was then quantitated
spectrophometrically.
Reverse Transcription of Tissue RNA
cDNA was prepared from tissue RNA using Moloney Murine Leukemia Virus
Reverse Transcriptase (MMLvRT) and random hexamer priming. For each tissue
sample, 500 ng total RNA was added to 4 pL 5x RT buffer (Invitrogen), 10 pmol random
hexamers, 12.5 pM each dATP, dTTP, dGTP, dCTP, 200 units MMLvRT (Invitrogen)

46
and 20 units RNasin (Promega) in a final volume of 20 (iL. Reactions were incubated at
37C for 1 hour followed by 10 minutes at 100C to inactivate the reverse transcriptase
and then ice quenched.
Real Time PCR Reactions
The amount of LAT RNA in each transgenic mouse tissue sample was quantitated
using real time PCR and compared to cellular control RNA as described below.
Primer and probe sequences
Primer and probe sequences for the transgene were 5LAT forward: 5GGC TCC
ATC GCC TTT CCT, 5LAT reverse: AAG GGA GGG AGG AGG GTA CTG, 5 LAT
probe: 5TCT CGC TTC TCC CC. The location of these primers was diagramed in
figure 2-3.
18s RNA was used as a cellular control. The primer and probe set was obtained
from Applied Biosystems (PN 4308329). Control 18s RNA was provided with the 18s kit
and was reverse transcribed in the same manner as the tissue RNA as described above.
Standards
A standard curve was generated for each of the primer sets used. The pLAT/LAT
transgene plasmid was used as standard to determine copy number by performing PCR
on 10-fold dilutions of this target ranging from 104 to 101 copies. The cellular control
standard was 18s RNA and was used in 10-fold dilutions 10 ng to 1 pg corresponding to
the amount of RNA added to the reverse transcription reaction. This amount was
converted to copy number for final analysis.
Conversion of the 18s data from was required because the program associated
with the Real Time thermalcycler will not accept numbers for standards that are higher
than 106. To calculate copy number for 1 ng of 18s the size of mouse 18s RNA (1869 bp)

47
was obtained from the Qiagen catalog appendix (Qiagen, 2003) and the following
formula was used with 6.6 x 10'4 equaling the mass of one base pair.
lng fmol x 6.6x1 O4 x 1869bp
pL
lng = 1.23354 find
pL
0.81 fmol x lxlO'15 moles = 8.13xl0'16 moles x 6.022x1023 molecules =
pL f mol pL mole
o
4.9x10 molecules
pL
The molecules/ pL were multiplied by the number of copies generated by the real time
program to convert ng to molecules.
PCR reactions
All reactions were performed on an ABI Prism 7700 thermal cycler (Applied
Biosystems) located in the ICBR protein core at the University of Florida. Samples were
run in triplicate. For each reaction, 2 pL of the reverse transcription reaction was added
to 0.33 pL 60x Assay Mix (primer/probe set), and 10 pL Taqman Universal PCR Mix
(Applied Biosystems part #430437) in a final volume of 20 pL. PCR was performed in
96 well plates under the following conditions: 1 cycle 2 minutes 50C, 1 cycle 10 minutes
95C, 40 cycles 15 seconds 95C, 1 minute 60C.
In-situ hybridization of Transgenic Tissues
Preparation of tissue sections
DRG, kidney, brain, and spinal cord tissues were harvested from transgenic, non-
transgenic littermates, and infected mice and fixed with 4% paraformaldehyde in

48
phosphate buffered saline (PBS) overnight at 4C then transferred to 70% ethanol.
Tissues were embedded in paraffin blocks and thin sections cut by the pathology core
laboratory at the University of Florida. To remove paraffin from cut sections, slides were
treated three times for 2 minutes each in Xylenes and then washed twice in 100% ethanol
followed by 95%, 70% and 50% ethanol, each for 2 minutes.
Prior to hybridization, slides were treated to remove excess protein and the
cellular DNA in the following manner. Fixed tissue was denatured in 0.2M HC1 at room
temperature for 20 minutes, followed by 2 rinses in distilled water 5 minutes each at
room temperature, incubated at 70C for 30 minutes in 2x SSC, followed by 2 rinses in
water 5 minutes each at room temperature. The slides were then treated with Proteinase
K (1 pg in 0.02 M Tris pH 7.4, 0.002 M CaC^) at 37C for 15 minutes followed by 2
rinses in water 5 minutes each.
DNase pretreatment was performed under treated coverslips. Briefly, coverslips
were acid washed in 1 M HC1 for 20 minutes then rinsed 3 times in water for 5 minutes
each and 3 times in 95% ethanol for 5 minutes each. A final wash for 5 minutes in 100%
ethanol dehydrated the coverslips which were then baked for 5 hours in a drying oven at
220C. For each site, 30 pL of 12U RNase-free DNase (Stratagene) in 20 mM Tris pH
7.4, 10 mM MgCb was added and coverslipped. Slides were then incubated at 37C for 1
hour in a humid chamber. Tissues were rinsed extensively (5x) in 2x SSC 5 minutes each
and post fixed in freshly made 5% paraformaldehyde, 0.3 N NaOH in phosphate buffered
saline pH 7 for 2 hours in the dark. Excess fixative was removed by washing 3 times in
2x SSC, 5 minutes each and twice in water 5 minutes each. To reduce non-specific
hybridization, samples were acetylated in 0.1 M triethanolamine pH 8 with 0.25% vol/vol

49
acetic anhydride for 10 minutes with stirring then rinsed twice with water for 5 minutes
each. A final denaturing step in 95% deionized formamide with O.lx SSC incubated for
15 minutes at 70C followed by a 2.5 minutes rinse in ice cold O.lx SSC and 2.5 minutes
in a water rinse.
Preparation of hybridization probes
Probes were prepared from pATD 17 (nt 118,863 to 119,343) and pATD 19 (nt
119,628 to 119,975) plasmids, as diagrammed in figure 2-3, using a random hexamer
labeling kit. pATD 17 was digested with PstI and SphI and pATD 19 was digested with
EcoRI and Hindlll to remove the HSV DNA from the plasmid backbone. Both inserts
were purified on an agarose gel and the DNA recovered by freeze fracture. For the
labeling reaction, 100 ng of digested plasmid DNA was incubated with random
hexamers, S35 dCTP, cold dGTP, cold dTTP, cold dATP, and Klenow fragment overnight
at room temperature according to the random hexamer labeling kit (Roche)
specifications. Labeled probes were purified on a Sephadex G-50 spin column to remove
unincorporated nucleotides and quantitated by counting 1 pL of labeled probe on a liquid
scintillation counter.
Hybridization
The hybridization solution was prepared as follows: 1.5 x 105 cpm/site of the
labeled probe was ethanol precipitated with 10 pg of salmon sperm DNA, 1/50 volume
5M NaCl and 2 volumes ethanol and incubated at -80C for 15 minutes. The probe DNA
was pelleted by centrifuging for 30 minutes at 4C, the ethanol was removed, the pellet
dried briefly, and resuspended in 20 pL TE. Immediately before use, the probe was
heated to 100C for 5 minutes, followed by quenching on ice. Probes were diluted to 1.5

50
x 105 cpm/site by adding hybridization solution (50% deionized formamide, 0.3 M NaCl,
10 mM Tris pH 7.4, 2x SSC, 1 mM EDTA pH 8, lx Denhardts solution, 100 pg/pL
denatured salmon sperm DNA, 250 pg/pL, tRNA, and 5 pg/pL polyA) and heated to
100C for 2 minutes, followed by quenching on ice. To pre-hybridize the probe, the
diluted probes were incubated at 45C for 1 hour, followed by quenching on ice. For the
hybridization, 20 pL of the prehybridized probe solution was added to the tissue sections.
Slides were covered with a treated coverslip and sealed with rubber cement.
Hybridization was carried out at 45C for 72 hours.
Washes
Cover slips were removed by peeling off the rubber cement from the slides. The
slides were first washed in low stringency wash solution (50% crude formamide, 0.3 M
NaCl, 10 mM Tris pH 7.4, 1 mM EDTA pH 8) with stirring for 72 hours with 6 changes
of wash solution during that period. The first wash change was after 2 minutes to remove
excess hybridization solution. After the first wash, a small piece of nylon membrane (i.e.
Hybond-N) was included in the washing jar to collect any unbound probe.
After the low stringency wash, slides were washed for 2 hours in high stringency
wash solution (50% formamide, 2x SSC, 10 mM Tris pH 7.4, 1 mM EDTA pH 8) at
40C. Slides were rinsed twice in 2x SSC for 5 minutes each and dehydrated in ethanol
(70%, 70%, 95%) containing 0.3 M ammonium acetate to stabilize the counts 5 minutes
for each wash.
Filming
To film the slides, NTB-2 nuclear track emulsion (Kodak) diluted 1:1 with 0.6 M
ammonium acetate was liquefied at 45C in the dark. Each slide was dipped into the

51
emulsion once and allowed to dry approximately 20 minutes before being stood in a slide
drying rack for 3 hours with drierite. After slides were completely dry, they were put into
slide boxes containing drierite for up to 2 weeks at 4C. Each slide had a non-hybridized
blank slide between it and the next slide to prevent the 35S on one slide from non-
specifically exposing the emulsion on adjacent slides.
Developing
Slides were warmed to room temperature for approximately 1 hour before
developing. Fresh D-19 developer (Kodak) was used for each experiment. In the
darkroom, slides were incubated for 4 minutes in D-19 followed by 3 washes in water for
30 seconds each. Slides incubated in fixative (Kodak rapid fixer) for 4 minutes followed
by 2 washes in water 5 minutes each. Slides were counterstained with freshly made
Giemsa (Sigma) for 20 minutes, rinsed extensively in tap water and allowed to dry before
coverslipping and sealing with Permount.
Statistical Analysis
All data was analyzed using GraphPad In Stat software version 3.05 for the
Macintosh computer.
Results
Determination of the Amount of LAT Expressed in Non-Neural vs. Neural Tissues
Comparison of transgene expression on a per weight basis
The amount of LAT RNA present in transgenic tissues was determined by real
time PCR. Real time PCR is more accurate than traditional PCR methods because it
allows for data collection at the exponential phase of amplification, as opposed to
conventional PCR, which measures only the final amount of PCR product. Since
conventional PCR endpoints often represent reactions that may have plateaued many

52
cycles earlier, quantitative comparisons must be made following a series of dilutions of
the DNA targets, to insure that comparisons are being made under conditions where all of
the PCR products reflect a linear correspondence with the amount of target present in
each sample. Since real-time PCR measures the rate of product formation, linear ranges
of comparisons of all samples and standards are easily made. For each tissue, 500 ng of
total RNA was reverse transcribed (RT) and then a fraction of the RT reaction used for
PCR with a real time primer and probe set located within the 5exon region of LAT (see
Figure 2-3). Quantitation of samples was standardized by generating a standard curve
from PCR reactions containing known quantities of pLAT/LAT plasmid DNA.
Figure 3-la represents the expression data presented on a per gram of tissue basis
for a group of 4 eight week old mice. Both neural and non-neural tissues exhibited
expression of the LAT transgene ranging from 3.51 x 104 to 3.88 x 106 copies/gram of
tissue. The variations between the tissues were compared by ANOVA and were not
significantly different (F=1.079, P= 0.4017). Power analysis indicated that more than
100 mice would be needed to attain a statistically significant difference between the
expression levels in the transgenic tissues because there was little difference, relative to
the error, between the different tissues.
While on the whole there was no significant difference between all of the
transgenic tissues, we wanted to look closer at the tissues typically involved in the HSV-1
infection. For these analyses, paired t-tests compared skin with DRG (t=l .676,
P=0.1546) as well as feet with DRG (t=1.780, P=0.1253) demonstrated no significant
difference between either pair of tissues.

53
A.
1.00E+08
1.00E+07
1.00E+06
1 1.00E+05
P
oo
1.00E+04
D
Q.
O
h 1.00E+03
<
1.00E+02
1.00E+01
1.00E+00
Hypothalamus
Cerebellum
Cortex
Olfactory Bulb
Spinal Cord
Dorsal Root Ganglia
Trigeminal Ganglia
Skin
Foot
Heart
Kidney
Lung
Eye
Liver
Spleen
Intestine
B.
1.00E+08
1.00E+07
1.00E+06
it
P
CO
1.00E+05
1.00E+04
^ 1.00E+03
1 00E+02
1.00E+01
1.00E+00
DRG Acute HSV-1
DRG Latent HSV-1
Figure 3-1. Expression of LAT per gram of tissue. A. Both neural and non-neural tissues
expressed high levels of the LAT transgene although there was no significant
difference between the tissues. For each tissue n=4. B. Expression of LAT
during the acute and latent FISV-1 infection.

54
Comparison of LAT expression in the various tissues normalized to levels of
18s RNA
Although there was no significant difference in LAT expression between the
different tissues when compared on a per weight basis, this calculation did not take into
consideration that different tissues are composed of different cell types and each cell type
has a different density. As a result, comparison by weight, while typically accepted as a
basis for comparison did not represent the expression of LAT per cell. To examine the
LAT transgene expression on a per cell basis, RT data was normalized to the amount of
18s RNA present in each sample. For these studies, 18s RNA was chosen as the
normalizer because it was a cellular housekeeping molecule that remains fairly constant
in all tissues (Thellin et al., 1999). This is also a very abundant RNA species, therefore
in order to compare the amount of LAT to the amount of 18s RNA present in each tissue
sample, the 18s values were divided by 108 copies to be in the range of the LAT
transgene expression. The expression profile of the same mouse tissues from figure 3-1
was reanalyzed in figure 3-2 on the basis of 18s RNA. ANOVA determined that there
was no statistical significance between the transgenic tissues when normalized to the
amount of 18s RNA present in each tissue (F=1.308, P=0.2274).
Comparing the tissues involved in the HSV infection, feet vs. DRG (t=1.202,
P=0.2746) or skin vs. DRG (t=0.9631, P=0.3797) on a per 18s RNA basis again resulted
in no significant difference in the amount of LAT expression between these tissues. The
implications of this finding are considered in the Discussion section.

LAT copies / 18s RNA
55
A.
1.00E+06
1.00E+05
1 00E+04
1.00E+03
1.00E+02
1.00E+01
1.00E+00
Hypothalamus
Cerebellum
Cortex
Olfactory Bulb
Spinal Cord
Dorsal Root Ganglia
Trigeminal Ganglia
Skin
Foot
Heart
Kidney
Lung
Eye
Liver
Spleen
Intestine
B.
1.00E+06 i
1 OOE+05
1.00E+00
DRG Acute HSV-1
0 DRG Latent HSV-1
Figure 3-2. Expression of LAT normalized tol8s RNA. A. Taking into account the
different cell densities in different tissues, LAT expression in transgenic
tissues was compared on a per cell basis by dividing the copies of LAT by 108
copies of 18s RNA in each tissue. n=4. B. Comparison of the amount of LAT
in infected DRG at acute and latent times post infection normalized to copies
of 18s RNA.

56
Comparison of the Amount of LAT Expressed in the LAT Transgenic Mouse to the
Amount of LAT Expressed in the DRG During HSV Infection
In the HSV-1 infection not all the DRG cells are infected and of the infected cells
only a portion detectably express LAT (Rodahl and Stevens, 1992). To compare the
amount of LAT being expressed in the transgenic mouse to the amount of LAT in an
infection, we infected mice with 17+ HSV-1 (wild type) and harvested DRG at 4 days
post infection (d.p.i.) (acute) and 28 d.p.i. (latent). These ganglia were processed to
isolate RNA and LAT expression was quantitated by RT-PCR as described above.
Figure 3-lb and 3-2b illustrate the amount of LAT present in DRG during the acute and
latent infection compared to the amount of LAT present in the transgenic tissues in
Figure 3-la and 3-2a respectively. The transgenic DRG contained 10-fold more LAT
expression per gram of tissue than either the acute or latent infected DRG. When
compared on a per weight basis there was no statistical difference between the amount of
LAT expressed in the transgenic DRG and either the acutely infected DRG (P= 0.1448)
or the latently infected DRG (P= 0.1204). When we looked at the amount of LAT in the
infected tissues on a per cell basis, there was approximately 10 fold more LAT in the
infected tissues than in the transgenic DRG. Statistically, the difference between the
transgenic DRG and the latent DRG was not quite significant (P= 0.0786) while the
difference between the transgenic DRG and the acute DRG was significant (P= 0.0283)
when compared relative to the amount of 18s RNA (Figure 3-2). While we would have
expected there to be more LAT in the transgenic tissue compared to the infection, it has
been shown that ganglionic levels of LAT are highest at the peak of the acute infection
and decline as latency is established. If this is the case, the differences in LAT

57
expression between the transgenic and infected tissues are minimal. This will be
discussed further in the discussion section.
Analysis of Transgene Expression as a Function of Age
Previous studies with HSV-1 transgenic mice expressing reporters behind ICPO
and ICP4 promoters demonstrated a difference in expression of these two lytic gene
promoters as a function of the age of the mice (Mitchell, 1995; Loiacono et al., 2002).
To determine if the LAT transgenic mouse exhibited an age related expression pattern,
we compared the amount of LAT RNA present in selected tissues at 1 day, 1 month, 2
months, and 18 months of age. A representative sample of these data is presented in
figures 3-3 and 3-4 while the profile for the entire tissue sampling is located in Appendix
C. There was no age related general trend of LAT expression among all of the tissues
tested. When compared by weight, the spinal cord (P= 0.3303), DRG (P= 0.6908), TG
(P= 0.4050), skin (P= 0.1728), and feet (P= 0.0657) had no significant difference in the
amount of LAT transgene expressed at different ages. This remained the same when
comparing LAT expression on a per cell basis using 18s RNA as a reference, with the P-
values of the spinal cord (P= 0.2859), DRG (P= 0.4803), TG (P= 0.2429), skin (P=
0.5305), and feet (P= 0.5707) indicating a lack of significance (figure 3-4).

58
1.00E+07
1.00E+06
(L)
3
P 1.00E+05
00
S E00E+04
Q.
5 E00E+03
E1
-1 E00E+02
1.00E+01
Day Old 1
Month Old 1
Month Old 2
Month Old 18
. G
9$
.6*
Figure 3-3 LAT transgene expression is not age dependent in tissues typically involved in
the HSY infection when normalized on a per weight basis.
1.00E+07
1.00E+06
<
Z 1.00E+05
on
1.00E+04
c/l
'§ 1.00E+03
u
I.00E+02
1.00E+01
1 Day Old
1 Month Old
2 Month Old
18 Month Old
C
&
if
Figure 3-4. Expression of the LAT transgene is not age dependent in tissues involved in
the HSV infection when calculated per cell by normalizing to 18s RNA.

59
Analysis of Transgene Expression in Neural and Non-neural Tissue at the Cellular
Level Using In situ Hybridization
In situ hybridization examined two properties of expression, the number of cells
expressing the transcript of interest and the cellular localization of the transcript (nuclear
or cytoplasmic). To determine if the LAT transgene was being expressed in all cells of
transgenic tissues we probed for either the 5 LAT exon or the LAT intron by RNA in
situ hybridization. These tissue sections were counterstained with Giemsa stain after
hybridization which is a general membrane stain. In DRG, neurons were visible as large
blue round nucleated cells. The tissue between the groups of neurons included support
cells and the axons leading to the neuron cell bodies. Figure 3-5 illustrates the
architecture of the DRG magnified to point out the location of the nucleus seen as a white
Figure 3-5. In situ hybridization of a latently infected dorsal root ganglia. This
photograph illustrates the neurons of the dorsal root ganglia (blue) and points
out the sub-cellular architecture with arrows pointing to the nucleus and
nucleolus of neurons. The small black dots on some of the cells are the
positive hybridization signal.

60
or lighter stained region within the neurons and the nucleolus seen as a gray circle within
the nucleus of some neurons.
The DRG is the primary site of LAT expression during the HSV infection
following footpad inoculation. Figure 3-6a illustrates the nuclear localization of
expression of the LAT 5 exon during the latent infection, marked by black arrows.
Surprisingly, in the transgenic DRG there were a subset of neurons that express LAT
with a different localization pattern than the infected DRG (compare figure 3-6a black
arrows with figure 3-6b red arrow) and some of the expression appears to be cytoplasmic.
This sub-population was in addition to the nuclear staining cells (figure 3-6b black
arrows) in the transgenic tissues that have the same pattern as the HSV infected DRG. A
non-transgenic mouse exhibited only background signal in this experiment (figure 3-6c).
When probed for the LAT intron, transgenic DRG showed the nuclear localization of
high levels of expression and low levels of expression in neurons as seen in Figure 3-7.
The cytoplasmic localization of LAT was not detected with the intron probe.
Neurons were counted to quantitate the positive sub-populations of neurons for
both the infected and the transgenic tissues with the 5 exon probe. During the HSV
infection LAT has been shown to be expressed in approximately one third of latently
infected neurons (Gressens and Martin, 1994; Maggioncalda et al., 1996). The data
presented here illustrated that LAT was being expressed in slightly more than two thirds
of transgenic neurons compared to just less than one third of neurons in infected dorsal
root ganglia (Table 3-1). Additionally, the transgenic tissue expression can be further

61
A.
B.
.JB- 'y-'T-.: $kM&k .
. TV .>** *,.v v'o": **
- 4&
^asr
F2fr
4
^ *
% ..c
n~,
a
1*^/1
*CV- ,
,v *v ** / .; ** *9**, ,
& cJr- . '*** 4;
f #** Ir'
V' :5 *Se
~w
W £ 4
r*r t: \
Figure 3-6. In situ hybridization for 5 LAT exon. A. Latently infected dorsal root
ganglia. B. Transgenic positive dorsal root ganglia. C. Transgenic negative
dorsal root ganglia. Black arrows represent hybridization of nuclear LAT

62
C.
Figure 3-6 (contd). expression. Red arrow indicates cytoplasmic LAT expression.
Arrows in C point out the neurons and axons of the DRG.
Figure 3-7. In situ hybridization for LAT intron in transgenic DRG. Black arrows
represent nuclear localization of hybridization at both high and low levels of
expression.

63
divided into three subpopulations, darkly stained or high expression (33%), weakly
stained or low expression (56%), and cytoplasmic stained (11%). Further studies are
needed to determine if these subpopulations coordinate with neuronal markers for
neuronal subpopulations.
Table 3-1. Quantitation of LAT Expressing Cells in Dorsal Root Ganglia by in situ
hybridization for the 5 LAT exon
Number
Positive
Percentage
Of Total
Latently
Infected1
204
25
Transgenic
Tissues
Totals2
709
65
Darkly
Stained
233
333
Weakly
Stained
399
56
Cytoplasmic
Stained
77
11
'Total neurons counted = 806 2Total neurons counted = 1095 3For the subsets of positive
neurons in the transgenic, percentage is of total positive transgenic neurons.
A significant finding of this study is that the 5 LAT expression pattern seen in the
transgenic DRG was not seen in other tissues of the transgenic mouse. A comparison of
other neuronal tissues of the transgenic mouse demonstrated a small amount of detectable
LAT expression in the thalamic neurons of the brain (figure 3-8 and figure 3-9) with
considerably less intensity than in DRG (compare figure 3-6b with figure 3-8 and 3-9).
Additionally, a small number of neurons in the spinal cord (figure 3-10) were expressing
LAT to levels comparable to that in the DRG. As with the DRG, further studies are
necessary to determine if these hybridization positive cells are from a specific population

64
Hippocampus
jk 7 vi*
Thalamus
Figure 3-8. In situ hybridization for LAT 5exon in brain. A. Transgenic brain lOx B
Transgenic brain magnifying the thalamic region 40x.

65
A.
Figure 3-9. In situ hybridization of the transgenic brain with LAT intron probe. A. Low
magnification for orientation purposes. (lOx) B. Positive signal (black
arrows) was detected in thalamic neurons with primarily lower levels of
expression than seen in the DRG. (40x)

66
Figure 3-10. In situ hybridization in the transgenic spinal cord. A. 5 LAT exon probe.
An example of positive neurons is marked with black arrows and examples of
negative neurons are marked with red arrows. B. LAT intron probe.

67
of neurons. In contrast to the QRT-PR data for the non-neural tissues, both the transgenic
foot (Figure 3-11) and the transgenic kidney (Figure 3-12) exhibited no detectable LAT
expression by in situ hybridization. The cell specific distribution of LAT expression
exhibited by the transgenic mouse in both neuronal and non-neuronal tissues has
important implications for the final analysis of the overall LAT expression levels in the
different tissues of the transgenic mouse. This will be discussed in detail in the following
section.
Discussion
The LAT was able to be expressed in the absence of other HSV proteins in the
transgenic mouse. We had expected to see this expression primarily in neural tissues
(brain, spinal cord, ganglia) and possibly some epithelial tissues as well, for example skin
and foot, which have demonstrated some LAT expression during the HSV infection
(Jarman et al., 1999). The data presented here show that LAT can be detected at
relatively high overall levels, in a variety of tissues in the transgenic mouse. The tissues
expressing LAT were consistent with the expression patterns seen in the HSV-2
transgenic mouse (Wang et al., 2001) that was under control of the native HSV-2 LAT
promoter. We were unable to compare the amount of expression between the LAT HSV-
1 and HSV-2 mice because quantitative data were not reported in the HSV-2 mouse.
An important consideration, however, is that the analysis of the expression data
on a per weight basis did not take into consideration that different cell types have
different densities and cell compositions, although this is the standard method for
representing such data. To provide a per cell based analysis, we compared the expression
data to 18s RNA levels. Selection of a cellular gene to be used as a control must be done

68
Figure 3-11. In situ hybridization of transgenic foot. A. LAT 5 exon probe B. LAT
intron probe. There was no hybridization signal with either probe in the LAT
transgenic foot.

69
Figure 3-12. In situ hybridization in the transgenic kidney. A. LAT 5 exon probe B. LAT
intron probe. No positive hybridization signal was detected with either probe.

70
with care since a number of cellular genes exhibit varied expression in different cell
types. In our studies these differences would have had an effect on the quantification of
LAT expression in the different tissue types. The 18s RNA species is a cellular
housekeeping gene that is considered to be constant in all cells (Thellin et al., 1999)
allowing for comparison between tissues.
Similar to the per weight analysis, LAT expression had no significant difference
between tissues. Despite of the inability to detect a difference in expression by either
analysis, the 18s RNA comparison appeared to be a more accurate overall representation
at the cellular level. The per weight analysis of expression would be sufficient for more
general comparisons but is not quantitative when expression may be present in only
certain cell types of a complex tissue.
There was a statistically significant difference between the amount of LAT in the
acute infection and the amount of LAT in the transgenic DRG when compared on a per
18s basis. The comparison with the latent infected DRG was not quite significant but
there was more LAT produced in the infected tissue than in the transgenic DRG. In
combination with the in situ data which suggests that LAT is not being produced in every
cell of the DRG, it is not hard to conceive that there could be more LAT in the infected
tissue. Further studies are needed to determine if this is the case, however, the 18s RNA
comparison remains a valid comparison between the non-infected tissues of the
transgenic mouse since they are comparing LAT that is being controlled in the same
manner.
We have also shown that LAT was not expressed in an age dependent manner.
Studies of immediate early HSV genes in transgenic mice determined that both ICPO and

71
ICP4 were expressed with age dependent differences (Mitchell, 1995; Loiacono et al.,
2002). There were a number of factors that made the comparison of the LAT and the
immediate early studies difficult. In the immediate early study they were counting the
number of cells expressing a (3-gal reporter, not measuring the amount of (3-gal
expressed. Our 18s RNA analysis would suggest that there was not a great variation in
the number of cells expressing the LAT transgene, but again, the two quantitations may
not be directly comparable.
Interestingly, LAT is not expressed in all cells of the transgenic mouse. In situ
hybridization for the LAT transgene illustrated that in the DRG, the transgene was being
expressed in only a subset of neurons. The pattern of LAT expression in the DRG of
transgenic mice seems to differ from the expression in the HSV-1 infection. In the
transgenic DRG we can detect two intensities of LAT expression, both nuclear in
localization, that were similar to the infected DRG, although more abundant.
Additionally, there was a small fraction of cytoplasmic localization of LAT expression in
the transgenic mice when using the LAT 5 exon probe but not with the LAT intron
probe. It is not clear whether these observed differences are related to LAT expression
differences by the transgenic mouse, or due to influences of other viral factors that may
modulate LAT expression in these neurons during a normal HSV infection. In addition,
further studies are needed to determine if these neurons have a particular characteristic or
if expression is in a random subset of neurons. Based on the expression patterns of LAT
in infected DRG and on the in situ data from the spinal cord in seems more likely that the
expression positive neurons in the transgenic mouse should have a particular
characteristic.

72
In other transgenic tissues, LAT expression was not detectable by in situ
hybridization with either the 5 LAT exon or LAT intron probes. The kidney and foot
both had transgene expression when measured by RT-PCR for the 5 exon but expression
was not seen by in situ hybridization. This could suggest that in some tissues LAT
expression is leaky in all cells and thus below the level of sensitivity for the in situ but, in
the neuronal tissues expression is confined to a subset of neurons resulting in the ability
to detect the expression by in situ hybridization. The small number of cells expressing
the LAT transgene in the spinal cord appears to support this theory in addition to the
expression in the DRG. These findings may suggest that LAT expression is more tightly
and dramatically regulated in sensory neurons.

CHAPTER 4
CHARACTERIZATION OF THE EXPRESSION OF LAT IN TRANS ON THE
COURSE OF HSV-1 INFECTION IN MICE
Overview
HSV-1 infection is characterized by three phases; acute, latent and reactivation.
The LAT has been suggested to play some role in all three phases, although its most
striking phenotype seems to be primarily at the level of reactivation (Wagner, 1991;
Bloom et al., 1994; Bloom et al., 1996b; Wang et ah, 1997). The mechanism of its action
in this process has not been determined. Limited amounts of LAT have also been seen
during the acute phase of infection, although at present, there is no function linked to this
expression (Jarman et ah, 1999).
If the LAT RNA used a trans mechanism of action, exerting a function on an
HSV-1 DNA molecule that had not actually produced the LAT RNA, then we would
expect to see a phenotype at some phase of the HSV infection in the LAT transgenic
mouse. For example, we could experimentally infect the LAT transgenic mouse with a
LAT(-) virus and phenotypically convert the virus to resemble wild type. Contrarily, if
LAT functions in cis, functionally regulating or interacting with the DNA molecule that
produced the LAT RNA, then there would be no visible phenotype when infecting the
LAT transgenic mouse with HSV-1. With this in mind, experiments that examined the
acute, establishment and reactivation phases of the HSV-1 infection were performed in
the LAT transgenic mouse. For the acute studies, LAT transgenic mice and their non-
transgenic littermates (as controls) were infected with HSV-1 on their rear footpads. The
73

74
relative progression of the acute infection was assessed by the yield of infectious virus in
the feet, spinal ganglia, and spinal cord at selected time points post infection.
Establishment of HSV latency was assessed by the amount of HSV-1 DNA present in the
DRG of transgenic and non-transgenic mice after the acute infection had resolved.
Explant co-cultivation was used as a reactivation model to determine if the LAT
transgenic mouse exhibited detectable differences in the ability to reactivate latent HSV.
Finally, deletion of a portion of the LAT region has been shown to dramatically
reduce the virulence and yield of virus within sensory neurons (Gary et al., in
preparation). While it has been shown that this virulence function acts independently of
the LAT promoter (which is primarily involved in reactivation), this new function still
resides within the region of the LAT gene present in the transgenic mouse. Here we
sought to determine if this phenotype could be rescued by using the LAT transgenic
mouse to provide the deleted region in trans during an experimental HSV infection.
Given the dramatic reduction in virulence associated with this LAT deletion, we felt this
would be a sensitive test of the LATs ability to act in trans.
Materials and Methods
Growth of Cell lines and Viruses
Rabbit skin (RS) cells were maintained in minimum essential media (MEM) with
Earles salts supplemented with 5% calf serum and antibiotics at 37C in a 5% CO2
incubator. HSV-1 strain 17+ and the HSV-1 mutant 17A480 were grown and titered on
RS cells. The mutation in 17A480 deletes a portion of the LAT intron corresponding to
nucleotides 119,502 to 119,981. Characterization of this virus has been described
elsewhere (Jarman et al., 2000).

75
Footpad Infection of Mice
All infections used adult mice of at least 6 weeks of age, HSV-1 LAT transgenics
and their transgenic negative littermates of at least the F6 generation. Mice were
transferred to the UF animal care infectious disease suite after genotyping, and were
allowed to acclimate to their new housing conditions for at least one week prior to
infection.
Mice were anesthetized with halothane and subcutaneously injected with 0.1 mL
of 10% saline in each of the rear footpads. Four hours post saline pre-treatment, mice
were anesthetized with 0.010 to 0.020 mL of a ketamine cocktail (2.5-3.75 mg/kg
acepromazine, 7.5-11.5 mg/kg xylazine, 30-45 mg/kg ketamine) intramuscularly in the
thigh. Both rear footpads were abraded with an emery board to remove the keratinized
layer of skin tissue. Using a pipette tip, 1 x 106 plaque forming units (pfu) of virus in 50
pL volume was added to the footpads and allowed to absorb for one hour with mice lying
on their backs under anesthesia. Mice were monitored twice daily for signs of
complications due to anesthesia or infection.
Harvesting of Infected Tissues
At specified times post infection, mice were euthanized with halothane and
infected tissues were dissected (feet, DRG, spinal cord). Tissues were snap-frozen in
liquid nitrogen and stored at -80C until processed.
Determination of Viral Titers from Infected Tissues
Infected tissues were homogenized in Kontes glass tissue grinders (Fisher) or a
ceramic mortar and pestle (feet). DRG were ground in 1 mL MEM with supplements and
grinders rinsed with 0.4 mL MEM. Spinal cords were ground in 2.5 mL MEM and rinsed
with 2.3 mL MEM. Feet were ground with 2.5 mL MEM containing 2x antibiotics and

76
250 ng/mL fungizone and sterile sand then rinsed with 5 mL MEM. Homogenates were
centrifuged at 3000 x g for 15 minutes to pellet cellular debris.
Titration dishes were prepared with rabbit skin cells in 24 well plates to be sub-
confluent at the time of inoculation. Serial dilutions from 10' to 10' of the tingue
homogenate supernatants were made in MEM with supplements. Media was removed
from the titration plates and 200 pL of each dilution of tissue homogenate was added in
triplicate, and virus allowed to absorb for 1 hour at 37C with 5% CO2. After the
inoculation, plates were rinsed with 2 mL of MEM to remove the inoculum and any
residual cell debris and 2 mL MEM was added to each well. Cells were incubated for 72
hours at 37C with 5% CO2 then the media was removed and the cells were stained with
crystal violet to view plaques. Excess crystal violet was rinsed off with tap water and
plates were allowed to air dry before counting.
Determination of the Amount of HSV DNA in Latently Infected Mice
Adult transgenic mice and their non-transgenic littermates were infected as
described above with 1 x 106 pfu of HSV-1 17+ (wild type) and monitored for
complications. After 28 days, mice were euthanized, DRG removed, and snap-frozen in
LN2 until processing. DRG were ground in 400 pL Trizol reagent in a Kontes glass
tissue grinder (Fisher) to extract DNA. Grinders were rinsed twice with 400 pL Trizol
each and rinse solution was added to the ground tissue. After a 5 minute room
temperature incubation, 240 pL of chloroform was added and the homogenates were
vortexed for 15 seconds followed by a 5 minute incubation at room temperature. Tissue
homogenates were centrifuged at 9,000 x g for 15 minutes at 4C. At this point, the clear
aqueous phase containing the RNA was removed to a separate tube.

77
RNA was precipitated with 500 pL of isopropanol at room temperature for 10
minutes followed by centrifugation at 12,000 x g for 10 minutes at 4C. RNA pellets
were washed with 1 mL 70% ethanol and centrifuged 5 minutes at 4C, 7,500 x g. The
resulting pellet was air dried briefly and resuspended in 200 p.L diethyl pyrocarbonate
(DEPC, Sigma) treated water. RNA fractions were stored at -80C for later use.
The lower phase (Trizol) of the extractions from the initial centrifugation step was
removed from the bottom keeping the interface intact. DNA was back extracted from the
remaining interface by adding 150 pL of 0.1 M Tris and 0.1% Sarkosyl and centrifuging 5
minutes at 20,000 x g. This back-extraction was repeated twice, pooling the aqueous
layer after each centrifugation. Proteinase K (0.1 pg/pl) was added to the pooled back-
extracted DNA samples and incubated at 37C overnight. DNA was purified by
sequential extractions with an equal volume of phenol and sevag followed by extraction
with sevag and precipitation in 100% ethanol. Pellets were resuspended in 50 pL TE and
quantitated spectrophotometrically (A2o)-
The amount of HSV genomes present in each mouse was quantitated by real time
PCR using primers and a probe specific for the HSV polymerase (pol) gene. Details of
the real time procedure were presented in chapter 3. The HSV pol primer/probe set was
custom made by Applied Biosystems, Assays by Design with the forward primer
sequence 5AGAGGGACATCCAGGACTTTGT, reverse primer sequence
5CAGGCGCTTGTTGGTGTAC and probe sequence 5ACCGCCGAACTGAGCA
(65,880 to 65,953 nt). For the PCR reaction, conditions were 1 cycle 2 minutes 50C, 1
cycle 10 minutes 95C, 40 cycles 15 seconds 95C 1 minute 60C as described in chapter
3.

78
A standard curve was generated using HSV-1 genomic DNA of known copy
number ranging from 105 to 102 copies. Unknown samples were assayed using 50 ng of
DNA per reaction and were compared to the standard curve values for quantitation.
Explant Co-cultivation of Latently Infected DRG
Latently-infected transgenic and non-transgenic mice were euthanized and DRG
dissected as described above. DRG were cultured in MEM on with a RS cell monolayer
at 37C with 5% CO2 to detect reactivating virus. Every 48 hours, half of the media was
removed and replaced with fresh MEM to ensure the integrity of the monolayer. Cells
were monitored daily for 14 days for the presence of rounded, HSV infected RS cells.
Results
Expression of LAT in trans Does Not Detectably Alter the Course of an Acute HSV-
1 Infection in Mice
While the mouse footpad model of HSV-1 infection does not use the natural site of
HSV infection, it mimics the natural infection in that HSV can infect the epithelial
surface of the foot and travel along the sciatic nerve to reach the DRG. The reason that
the footpad model is extensively used to assess virulence properties of HSV-1 strains and
to study the progression of the acute infection is that it provides HSV-1 with a longer
path to travel through the nervous system until it reaches the brain. Therefore one can
sensitively assay the relative replication potential of different strains of HSV as it travels
from the foot, to the DRG, to the spinal cord and then to the brain.
To determine if expressing the LAT in the context of the transgenic mouse would
affect the course of the HSV-1 infection, we infected transgenic and non-transgenic mice
using the footpad model with wild-type HSV-1 strain 17+. The rationale for this
experiment is that if LAT is hypothesized to play a role in regulating HSV-1 gene

79
expression, expression of LAT prior to the HSV-1 infection might affect the outcome of
the acute infection, if could function in irons. Following footpad infection, tissues along
the path of HSV infection were assayed for amounts of infectious virus present at acute
times post infection, days one to four (figure 4-1). There was no significant difference
between the transgenic and non-transgenic mice at any of the four time points tested, day
1 P= 0.3501, day 2 P= 0.2403, day 3 P= 0.5476, and day 4 P= 0.5519. Similarly, the
amount of infectious virus in the DRG at acute times post infection shown in figure 4-2,
exhibited no significant difference between transgenic and non-transgenic mice, day 2
P=0.7364, day 3 P= 0.4309, and day 4 P= 0.3735. These data suggest that LAT was not
1.00E+08
1.00E+07
1.00E+06
1.00E+05
GO
3 1.00E+04
Cl
1.00E+03
1.00E+02
1.00E+01
1.00E+00
Day 1 Day 2 Day 3 Day 4
Figure 4-1. Relative amounts of infectious virus in the feet of transgenic and non-
transgenic mice infected with HSV-1 strain 17+ during acute times post
infection. n= 4

80
1.00E+06
1.00E+05
1.00E+04
ao
a 1.00E+03
c
n.
1.00E+02
1.00E+01
1.00E+00
Day 1 Day 2 Day 3 Day 4
Figure 4-2. Titer of infectious virus in DRG of transgenic and non-transgenic mice
infected with HSV-1 strain 17+ at acute times post infection. n= 4
affecting the acute phase of the HSV infection by being expressed at earlier times {prior
to infection) in the transgenic animals, and the LAT was not acting in tram to detectably
alter the outcome of the acute phase of HSV-1 infection.
Establishment of HSV-1 Latency in Transgenic Mice
Once the virus reaches the ganglia, it is able to establish latency in ganglionic
neurons. Since the LAT has been proposed by some to play a role in the establishment of
latency (Speck and Simmons, 1991; Bloom et al., 1994; Bloom et al., 1996a; Wang et al.,
1997), the expression of the LAT in the transgenic mice may affect the amount of
establishment in these mice. In order to determine if the expression of the LAT transgene
altered the amount of HSV that established latency in the infected mice, we infected
transgenic and non-transgenic mice with 1 x 106 pfu HSV-1 17+ (wild type) and waited
28 days for latency to be established. Mice were euthanized and DRG harvested and
snap frozen in LN2 until processed to extract the DNA. HSV DNA was quantitated

Copies / g
81
using real time PCR primers for the HSV polymerase. In figure 4-3 the amount of HSV
DNA present in ganglia of transgenic and non-transgenic infected mice, illustrated no
difference between the two groups (t= 0.1623, P= 0.8722). The mean for each group is
represented by a horizontal line. Scatter within the groups was expected because there is
some variability in the amount of virus infecting each mouse. Despite the expression of
the LAT from the transgenic mouse, there was no detectable difference in the amount of
establishment of HSV latency between the transgenic and non-transgenic mice, thus
expression of the LAT in trans did not affect the amount of HSV reaching the DRG and
establishing a latent infection.
1.00E+06
1.00E+05
1.00E+04
1.00E+03
1.00E+02
Figure 4-3. Quantitation of HSV-1 genomes present in mice infected with HSV-1 17+at
latent times post infection. Each symbol represents one mouse.
Reactivation from Latency in Transgenic Mice
The LAT also plays a role in reactivation from latency (Wagner, 1991; Bloom et
al., 1996b; Hill et al., 1996; Jarman et al., 2002). During reactivation, the virus initiates a
Positive
Negative

82
productive cascade resulting in the generation of progeny virus. One of the methods for
measuring the presence of reactivatable virus in the mouse model is explant co
cultivation. In this process, DRG were removed from latently infected mice and co
cultured in tissue culture media until progeny virus was released and detected by the
presence of CPE on the RS monolayer. In the human or rabbit eye infection, reactivated
virus would travel along the axons to the initial site of infection. When using the mouse
explant model, those axons have been dissected away and the virus travels into the media
from the tissue. This virus can then infect tissue culture cells that are in the dish with the
ganglia to serve as a detection method for reactivation.
To study the effect of the LAT transgene on the reactivation phase of infection,
DRG from latently infected mice were dissected and cultured in tissue culture media on a
layer of rabbit skin cells for 14 days. Cultures were monitored daily for the presence of
infected rabbit skin cells. In both the transgenic and non-transgenic mice, virus was
detected in all of the cultures by day 10 post co-cultivation (figure 4-4). There was also
no observed difference in the time frame of reactivation between transgenic and non-
transgenic mice.
Expression of the Transgene in trans Does Not Rescue the Restriction of a LAT
Deletion Mutant in Neural Tissue
A region of the LAT transcript has been shown to play a role in the virulence of HSV-1.
When this region of the virus was deleted, the resulting virus was markedly decreased in
virulence (Gary et al., in preparation). The LAT transgenic mouse includes the region
that was deleted in this virus, 17A480, and could provide that function during the course

83
Figure 4-4. Reactivation of HSV-1 from transgenic and non-transgenic mice by explant
co-cultivation of latently infected DRG.
of infection in the mouse. The location of this deletion in relation to the mapped
virulence function of LAT and the LAT transgene is diagramed in figure 4-5. To see if
providing the deleted LAT region in trans would rescue the virulence phenotype, we
infected transgenic mice with the 17A480 virus in the rear footpad. At acute times post
infection, days one to four, feet and DRG were harvested, homogenized and titered for
infectious virus. Both transgenic and non-transgenic mice exhibited similar levels of
virus in the feet, seen in figure 4-6, with no significant difference between the groups at
any timepoint. Day 1 P= 0.1990, day 2 P= 0.3281, day 3 P= 0.9528, day 4 P= 0.5585.

pfu / g
Intron
c
LAT Transgene
^^VimlenceEflect^^^
+76 +1667
A480
+892 +1372
Figure 4-5. Diagram of the LAT region of HSV illustrating the location of the 17A480
virus and the LAT transgene in relation to the virulence function of LAT.
1.00E+08
1.00E+07
1.00E+06
1.00E+05
1.00E+04
1.00E+03
I.00E+02
1.00E+01
1.00E+00
Transgenic Pos
T ransgenic Neg
Day 1 Day 2 Day 3 Day 4
Figure 4-6. Relative amounts of infectious virus in feet of transgenic and non-transgenic
mice infected with a deletion mutant of HSV-1 at acute times post infection. n=4

85
In the DRG, figure 4-7, the increase seen with the transgenic mice was not
significant, day 2 P= 0.3029, day 3 P= 0.3964, day 4 P= 0.0727. Since only four mice
were tested per group in these experiments it is possible that a larger sample size would
have resulted in a significant rescue of the virulence phenotype. The initial virulence
studies used Swiss Webster mice, which are less resistant to HSV infection. Thus, to
prevent genetic differences from complicating the results, the transgenic mouse is being
bred into the Swiss Webster background prior to repeating these experiments.
P Transgenic Pos
P Transgenic Neg
Figure 4-7. Relative amounts of infectious virus in DRG of transgenic and non-transgenic
mice infected with a deletion mutant of HSV-1 at acute times post infection.
n= 4.
Discussion
The LAT has been proposed to play a role in the establishment and reactivation
phases of the HSV infection. The LAT transgenic mouse expressed LAT to high levels
in a number of tissues, as presented in chapter 3. We hypothesized that the expression of
LAT by the transgenic mouse in a temporally different manner from what occurs during

86
the normal HSV infection could have an effect on either the establishment or reactivation
of latency. We examined all three phases of the HSV infection in the transgenic mouse.
During the acute infection there was no difference in the amount of infectious virus
present in the feet or DRG of transgenic and non-transgenic mice. The amount of HSV
DNA present in latently infected DRG of the transgenic and non-transgenic mice was
comparable, indicating that the LAT transgene was not detectably affecting the
establishment of a latent infection, at least by the criterion of the presence of HSV-1
genomes. Co-cultivation measured the ability of these genomes for biological activity
and their ability to reactivate and, again no difference between transgenic and non-
transgenic mice was observed. Thus, expression of the LAT transgene prior to infection
in the mouse had no detectable effect on any phase of the HSV infection.
The LAT region also encodes a virulence function that seems to be genetically
distinct from LATs reactivation function, as seen with deletion mutants in the region of
the intron illustrated in figure 4-5. The transgenic mouse contains the region of HSV
DNA corresponding to this virulence function. When infecting transgenic mice with the
deletion mutant, 17A480, there was no significant restoration of the wild type virulence
levels during the acute infection, although some slight differences were observed. Since
the transgenic mouse is in the more resistant C57B1/6 background, there could be other
genetic factors involved in the virulence function that was initially discovered by
infecting more sensitive Swiss mice. The data presented suggest that there may be a
slight restoration of virulence, although the difference was not statistically significant, in
the transgenic mouse which will be further studied in the Swiss background after
backcrossing of the transgenic mouse with Swiss mice to obtain a Swiss genetic

87
background transgenic line. It should be pointed out, however, that the dramatic
restriction in ganglionic replication exhibited by 17A480, and the fact that this restriction
is also detected on PC-12 cells in culture would seem to suggest that it is unlikely that the
lack of rescue was due to a difference in mouse background.
Taken together, these data suggest that LAT does not act in trans to regulate its
functions. A more likely model is that LAT is acting in cis to regulate other functions in
the HSV-1 genome. Given the proximate location of the LAT to ICPO and ICP4, these
might be candidates for this c/'s-acting activity.

CHAPTER 5
OVERALL CONCLUSIONS
The LAT is the only transcript detected abundantly during the latent phase of HSV-
1 infection (Roizman and Sears, 1996). This transcript has been implicated as a
modulator of a number of viral functions including, but not limited to, establishment of
latency (Speck and Simmons, 1991), reactivation (Wagner, 1991; Bloom et al., 1994;
Bloom et al., 1996), virulence (Pemg et al., 1999), and neuronal survival (Pemg et al.,
2000; Thompson and Sawtell, 2001; Ahmed et al., 2002). One of the key features of the
LAT is that it exhibits a differential tropism of expression with only 1/3 of latently
infected neurons expressing large amounts (Maggioncalda et al., 1996). In addition,
LAT-expressing neurons seem to segregate into subsets of sensory neurons expressing
specific markers. Since the degree to which the regulation of LAT expression is dictated
by phenotypically different classes of neurons is not well understood, we sought to study
the regulation of LAT expression in the absence of other viral proteins by generating a
transgenic mouse that contains the LAT region.
Characterization of the transgenic mouse described in this dissertation has shown
that the LAT transgene exists in a single copy in the mouse genome and that it is
expressed to high levels in a number of tissues. This overall expression, as assessed by
total LAT RNA detected at the level of whole tissues, does not seem to be neuronal-
specific since expression was seen in non-neural tissues as well. This seemed somewhat
surprising to us initially since the literature contains numerous studies showing that LAT
has higher levels of expression in neuronal cells than in other cell types (Zwaagstra et al.,
88

89
1990; Kenny et al., 1994; Dobson et al., 1995; Coffin and Thomas, 1998; Jarman et al.,
1999). In situ hybridization shed some light on this apparent incongruity by
demonstrating that the transgene was being expressed strongly in only a subset of
neurons in the dorsal root ganglia. Expression was not detected by in situ hybridization
in non-neural tissues. Thus, it can be concluded that strong LAT expression is specific
for some DRG neurons and that the expression seen by RT-PCR in other tissues may be
leaky or low-level expression in some (or perhaps most) cells within those tissues.
Retrospective analysis of the literature on neuronal-specific LAT expression shows that
most of these studies compared LAT expression in neuroblastoma vs. fibroblast cell lines,
and the few in vivo analyses relied primarily on reporter or in situ hybridization analyses.
Therefore our results serve to confirm and extend these analyses to indicate that the
pattern of abundant LAT expression is likely controlled at the level of different types of
neurons, and not other viral functions.
Mapping of the transgene insert determined that in addition to the SV40 poly A
sequence being deleted, a small portion of up to 132 bp of the 3 end of the transcript was
also deleted. This deletion does not appear to affect the splice acceptor site since the
stable LAT intron can be detected in the DRG by Northern blot.
The LAT transgene has no detectable effect on altering the outcome of an
experimental infection of the transgenic mice. Experiments presented here examined the
acute, establishment and reactivation phases of the HSV infection and in each of these
phases there was no difference between the transgenic and non-transgenic mice.
Additionally, infection of the transgenic mice with the 17A480 virus, a LAT mutant with
reduced virulence, did not rescue the virulence phenotype. There were slight but

90
insignificant differences seen during the acute phase of infection and these differences
will be re-evaluated by backcrossing the transgenic mouse into the Swiss-Webster
background, which is more sensitive to HSV infection and then repeating the infection
study. However, given the fact that the 17A480 virus is also restricted in replication in
PC-12 cells in vitro, our favored hypothesis is that the transgenic mouse in the Swiss-
Webster background will not rescue the virulence of 17A480.
On the whole, the data presented here suggest that, in the context of the HSV-1
genome, the LAT is functioning in cis to regulate or affect the DNA that transcribed it in
order to modulate the genetically distinct virulence and reactivation phenotypes that map
to this region. There are a number of possible mechanisms for this LAT function,
including acting as a boundary element to prevent transcription of the surrounding acute
transcripts or aiding modification of the chromatin structure to control transcription in
this important regulatory region of the viral genome. Further studies with the transgenic
mouse will investigate these potential regulation mechanisms.

APPENDIX A
MAP AND SEQUENCE OF THE pLAT/LAT PLASMID
The pLAT/LAT plasmid was generated to construct the transgene insert. A
portion of the HSV-1 strain 17+ latency associated transcript (LAT) including the Dral
site (corresponding to HSV-1 genome base pair 116,516) to the Aatll site (corresponding
to HSV-1 genome base pair 121,549) was ligated into a pBluescript backbone at the Smal
site. The SV40 poly A sequence from pNSE-Ex4 was removed using EcoRI and inserted
at the Xbal site into the pBluescript plasmid containing the LAT sequence.
Sue 1(7491)
Xhn 1(7466) Sac 1(41)
SV40 poly A signal ||
LAT 2 kb Intron
1
Amp resistance gene
h
Pst 1(3819)
/
Xho 1(2908)
Eco R I (2941)
Pst 1(2951)
LAT promoter
Pst 1 (3616)
pLAT/LAT transgenic construct
7496 bp
Figure A-l. Plasmid map of the HSV-1 LAT transgenic construct. This plasmid was
linearized by digesting with Xhol for injection into the mouse pronucleus as
described in Chapter 2.
91

92
Presented here is the nucleotide sequence of pLAT/LAT plasmid used to generate
the HSV-1 LAT transgenic mouse.
1 gatccactag ttctagagcg gccgccaccg cggtggagct ccagcttttg ttccctttag
61 tgagggttaa tttcgagctt ggcgtaatca tggtcatagc tgtttcctgt gtgaaattgt
121 tatccgctca caattccaca caacatacga gccggaagca taaagtgtaa agcctggggt
181 gcctaatgag tgagctaact cacattaatt gcgttgcgct cactgcccgc tttccagtcg
241 ggaaacctgt cgtgccagct gcattaatga atcggccaac gcgcggggag aggcggtttg
301 cgtattgggc gctcttccgc ttcctcgctc actgactcgc tgcgctcggt cgttcggctg
361 cggcgagcgg tatcagctca ctcaaaggcg gtaatacggt tatccacaga atcaggggat
421 aacgcaggaa agaacatgtg agcaaaaggc cagcaaaagg ccaggaaccg taaaaaggcc
481 gcgttgctgg cgtttttcca taggctccgc ccccctgacg agcatcacaa aaatcgacgc
541 tcaagtcaga ggtggcgaaa cccgacagga ctataaagat accaggcgtt tccccctgga
601 agctccctcg tgcgctctcc tgttccgacc ctgccgctta ccggatacct gtccgccttt
661 ctcccttcgg gaagcgtggc gctttctcat agctcacgct gtaggtatct cagttcggtg
721 taggtcgttc gctccaagct gggctgtgtg cacgaacccc ccgttcagcc cgaccgctgc
781 gccttatccg gtaactatcg tcttgagtcc aacccggtaa gacacgactt atcgccactg
841 gcagcagcca ctggtaacag gattagcaga gcgaggtatg taggcggtgc tacagagttc
901 ttgaagtggt ggcctaacta cggctacact agaaggacag tatttggtat ctgcgctctg
961 ctgaagccag ttaccttcgg aaaaagagtt ggtagctctt gatccggcaa acaaaccacc
1021 gctggtagcg gtggtttttt tgtttgcaag cagcagatta cgcgcagaaa aaaaggatct
1081 caagaagatc ctttgatctt ttctacgggg tctgacgctc agtggaacga aaactcacgt
1141 taagggattt tggtcatgag attatcaaaa aggatcttca cctagatcct tttaaattaa
1201 aaatgaagtt ttaaatcaat ctaaagtata tatgagtaaa cttggtctga cagttaccaa

93
1261 tgcttaatca gtgaggcacc tatctcagcg atctgtctat ttcgttcatc catagttgcc
1321 tgactccccg tcgtgtagat aactacgata cgggagggct taccatctgg ccccagtgct
1381 gcaatgatac cgcgagaccc acgctcaccg gctccagatt tatcagcaat aaaccagcca
1441 gccggaaggg ccgagcgcag aagtggtcct gcaactttat ccgcctccat ccagtctatt
1501 aattgttgcc gggaagctag agtaagtagt tcgccagtta atagtttgcg caacgttgtt
1561 gccattgcta caggcatcgt ggtgtcacgc tcgtcgtttg gtatggcttc attcagctcc
1621 ggttcccaac gatcaaggcg agttacatga tcccccatgt tgtgcaaaaa agcggttagc
1681 tccttcggtc ctccgatcgt tgtcagaagt aagttggccg cagtgttatc actcatggtt
1741 atggcagcac tgcataattc tcttactgtc atgccatccg taagatgctt ttctgtgact
1801 ggtgagtact caaccaagtc attctgagaa tagtgtatgc ggcgaccgag ttgctcttgc
1861 ccggcgtcaa tacgggataa taccgcgcca catagcagaa ctttaaaagt gctcatcatt
1921 ggaaaacgtt cttcggggcg aaaactctca aggatcttac cgctgttgag atccagttcg
1981 atgtaaccca ctcgtgcacc caactgatct tcagcatctt ttactttcac cagcgtttct
2041 gggtgagcaa aaacaggaag gcaaaatgcc gcaaaaaagg gaataagggc gacacggaaa
2101 tgttgaatac tcatactctt cctttttcaa tattattgaa gcatttatca gggttattgt
2161 ctcatgagcg gatacatatt tgaatgtatt tagaaaaata aacaaatagg ggttccgcgc
2221 acatttcccc gaaaagtgcc acctaaattg taagcgttaa tattttgtta aaattcgcgt
2281 taaatttttg ttaaatcagc tcatttttta accaataggc cgaaatcggc aaaatccctt
2341 ataaatcaaa agaatagacc gagatagggt tgagtgttgt tccagtttgg aacaagagtc
2401 cactattaaa gaacgtggac tccaacgtca aagggcgaaa aaccgtctat cagggcgatg
2461 gcccactacg tgaaccatca ccctaatcaa gttttttggg gtcgaggtgc cgtaaagcac
2521 taaatcggaa ccctaaaggg agcccccgat ttagagcttg acggggaaag ccggcgaacg
2581 tggcgagaaa ggaagggaag aaagcgaaag gagcgggcgc tagggcgctg gcaagtgtag

94
2641 cggtcacgct gcgcgtaacc accacacccg ccgcgcttaa tgcgccgcta cagggcgcgt
2701 cccattcgcc attcaggctg cgcaactgtt gggaagggcg atcggtgcgg gcctcttcgc
2761 tattacgcca gctggcgaaa gggggatgtg ctgcaaggcg attaagttgg gtaacgccag
2821 ggttttccca gtcacgacgt tgtaaaacga cggccagtga attgtaatac gactcactat
2881 agggcgaatt gggtaccggg ccccccctcg aggtcgacgg tatcgataag cttgatatcg
2941 aattcctgca gcccaaataa accaatgtcg gaataaacaa acacaaacac ccgcgacggg
3001 gggacggagg ggacggaggg agggggtgac gggggacggg aacagacaca aaaacaacca
3061 caaaaaacaa ccacccaccg acacccccac cccagtctcc tcgccttctc ccacccaccc
3121 cacgccccca ctgagcccgg tcgatcgacg agcacccccg cccacgcccc cgcccctgcc
3181 ccggcgaccc ccggcccgca cgatcccgac aacaataaca accccaacgg aaagcggcgg
3241 ggtgttgggg gaggcgagga acaaccgagg ggaacggggg atggaaggac gggaagtgga
3301 agtcctgata cccatcctac acccccctgc cttccaccct ccggcccccc gcgagtccac
3361 ccgccggccg gctaccgaga ccgaacacgg cggccgccgc agccgccgca gccgccgccg
3421 acaccgcaga gccggcgcgc gcactcacaa gcggcagagg cagaaaggcc cagagtcatt
3481 gtttatgtgg ccgcgggcca gcagacggcc cgcgacaccc cccccccgcc cgtgtgggta
3541 tccggccccc cgccccgcgc cggtccatta agggcgcgcg tgcccgcgag atatcaatcc
3601 gttaagtgct ctgcagacag gggcaccgcg cccggaaatc cattaggccg cagacgagga
3661 aaataaaatt acatcaccta cccacgtggt gctgtggcct gtttttgctg cgtcatctca
3721 gcctttataa aagcgggggc gcggccgtgc cgatcgcggg tggtgcgaaa gactttccgg
3781 gcgcgtccgg gtgccgcggc tctccgggcc cccctgcagc cggggcggcc aaggggcgtc
3841 ggcgacatcc tccccctaag cgccggccgg ccgctggtct gttttttcgt tttccccgtt
3901 tcgggggtgg tgggggttgc ggtttctgtt tctttaaccc gtctggggtg tttttcgttc
3961 cgtcgccgga atgtttcgtt cgtctgtccc ctcacggggc gaaggccgcg tacggcccgg

95
4021 gacgaggggc ccccgaccgc ggcggtccgg gccccgtccg gacccgctcg ccggcacgcg
4081 acgcgaaaaa ggccccccgg aggcttttcc gggttcccgg cccggggcct gagatgaaca
4141 ctcggggtta ccgccaacgg ccggcccccg tggcggcccg gcccggggcc ccggcggacc
4201 caaggggccc cggcccgggg ccccacaacg gcccggcgca tgcgctgtgg tttttttttc
4261 ctcggtgttc tgccgggctc catcgccttt cctgttctcg cttctccccc cccccttctt
4321 cacccccagt accctcctcc ctcccttcct cccccgttat cccactcgtc gagggcgccc
4381 cggtgtcgtt caacaaagac gccgcgtttc caggtaggtt agacacctgc ttctccccaa
4441 tagagggggg ggacccaaac gacagggggc gccccagagg ctaaggtcgg ccacgccact
4501 cgcgggtggg ctcgtgttac agcacaccag cccgttcttt tccccccctc ccacccttag
4561 tcagactctg ttacttaccc gtccgaccac caactgcccc cttatctaag ggccggctgg
4621 aagaccgcca gggggtcggc cggtgtcgct gtaacccccc acgccaatga cccacgtact
4681 ccaagaaggc atgtgtccca ccccgcctgt gtttttgtgc ctggctctct atgcttgggt
4741 cttactgcct gggggggggg agtgcggggg agggggggtg tggaaggaaa tgcacggcgc
4801 gtgtgtaccc cccctaaagt tgttcctaaa gcgaggatac ggaggagtgg cgggtgccgg
4861 gggaccgggg tgatctctgg cacgcggggg tgggaagggt cgggggaggg ggggatggag
4921 taccggccca cctggccgcg cgggtgcgcg tgcctttgca caccaacccc acgtcccccg
4981 gcggtctcta agaagcaccg ccccccctcc ttcataccac cgagcatgcc tgggtgtggg
5041 ttggtaacca acacgcccat cccctcgtct cctgtgattc tctggctgca ccgcattctt
5101 gttttctaac tatgttcctg tttctgtctc cccccccccc acccctccgc cccacccccc
5161 aacacccacg tctgtggtgt ggccgacccc cttttgggcg ccccgtcccg ccccgccacc
5221 cctcccatcc tttgttgccc tatagtgtag ttaacccccc ccgccctttg tggcggccag
5281 aggccaggtc agtccgggcg ggcaggcgct cgcggaaact taacacccac acccaaccca
5341 ctgtggttct ggctccatgc cagtggcagg atgctttcgg ggatcggtgg tcaggcagcc
1

96
5401 cgggccgcgg ctctgtggtt aacaccagag cctgcccaac atggcacccc cactcccacg
5461 cacccccact cccacgcacc cccactccca cgcaccccca ctcccacgca cccccactcc
5521 cacgcacccc cactcccacg cacccccact cccacgcacc cccactccca cgcaccccca
5581 ctcccacgca tccccgcgat acatccaaca cagacaggga aaagatacaa aagtaaacct
5641 ttatttccca acagacagca aaaatcccct gagttttttt ttattagggc caacacaaaa
5701 gacccgctgg tgtgtggtgc ccgtgtcttt cacttttccc ctccccgaca cggattggct
5761 ggtgtagtgg gcgcggccag agaccaccca gcgcccgacc cccccctccc cacaaacacg
5821 gggggcgtcc cttattgttt tccctcgtcc cgggtcgacg ccccctgctc cccggaccac
5881 gggtgccgag accgcaggct gcggaagtcc agggcgccca ctagggtgcc ctggtcgaac
5941 agcatgttcc ccacgggggt catccagagg ctgttccact ccgacgcggg ggccgtcggg
6001 tactcggggg gcatcacgtg gttacccgcg gtctcgggga gcagggtgcg gcggctccag
6061 ccggggaccg cggcccgcag ccgggtcgcc atgtttcccg tctggtccac caggaccacg
6121 tacgccccga tgttccccgt ctccatgtcc aggatgggca ggcagtcccc cgtgatagtc
6181 ttgttcacgt aaggcgacag ggcgaccacg ctagagaccc ccgagatggg caggtagcgc
6241 gtgaggccgc ccgcggggac ggccccggaa gtctccgcgt ggcgcgtctt ccgggcacac
6301 ttcctcggcc cccgcggccc agaagcagcg cgggggccga gggaggtttc ctcttgtctc
6361 cctcccaggg caccgacggc cccgcccgag gaggcggaag cggaggagga cgcggccccg
6421 gcggcggaag aggcggcccc cgcgggggtc ggggccgagg aggaagaggc agaggaggaa
6481 gaggcggagg ccgccgaggg ggggatcaat tcagctgagc gccggtcgct accattacca
6541 gttggtctgg tgtcaaaaat aataataacc gggcaggggg gatctgcatg gatcgatcca
6601 gacatgataa gatacattga tgagtttgga caaaccacaa ctagaatgca gtgaaaaaaa
6661 tgctttattt gtgaaatttg tgatgctatt gctttatttg taaccattat aagctgcaat
6721 aaacaagtta acaacaacaa ttgcattcat tttatgtttc aggttcaggg ggaggtgtgg

97
6781 gaggtttttt aaagcaagta aaacctctac aaatgtggta tggctgatta tgatctctag
6841 tcaaggcact atacatcaaa tattccttat taaccccttt acaaattaaa aagctaaagg
6901 tacacaattt ttgagcatag ttattaatag cagacactct atgcctgtgt ggagtaagaa
6961 aaaacagtat gttatgatta taactgttat gcctacttat aaaggttaca gaatattttt
7021 ccataatttt cttgtatagc agtgcagctt tttcctttgt ggtgtaaata gcaaagcaag
7081 caagagttct attactaaac acagcatgac tcaaaaaact tagcaattct gaaggaaagt
7141 ccttggggtc ttctaccttt ctcttctttt ttggaggagt agaatgttga gagtcagcag
7201 tagcctcatc atcactagat ggcatttctt ctgagcaaaa caggttttcc tcattaaagg
7261 cattccacca ctgctcccat tcatcagttc cataggttgg aatctaaaat acacaaacaa
7321 ttagaatcag tagtttaaca cattatacac ttaaaaattt tatatttacc ttagagcttt
7381 aaatctctgt aggtagtttg tccaattatg tcacaccaca gaagtaaggt tccttcacaa
7441 agatcctcta gcgataccgt cgacctcgag ggggggcccg gtaccgagct cgaatt

APPENDIX B
PCR PRIMER SEQUENCES
Polymerase chain reaction (PCR) was used in the experiments described in this
dissertation for a number of quantifications and identifications. The complete list of
primers used for these reactions is presented here in tabular form for easy reference.
Table B-l. Conventional PCR Primers and Locations
Primer Name
Sequence
Genome
Location
PCR
Conditions'
Promar 1
GCA CGA TCC CGA CAA CAA TAA CAA C
118,246-
118,270
94, 55,
72
Promar 2
ACT TCC ACT TCC CGT CCT TCC ATC C
118,327-
118,351
94, 55,
72
DB60
CGG CGA CAT CCT CCC CCT AAG C
118,888-
118,910
94, 55,
72
DB61
GAC AGA CGA ACG AAA CAT TCC G
118,994-
HO,016
94, 55,
72
M int 1
GAC ACG CAT TGG CTG GTG TAG TGG G
120,795-
120,819
94, 55,
72
M int 2
ACG AGG GAA AAC AAT AAG GGA CGC C
120,872-
nO,898
94, 55,
72
M2 probe up
AGA CCC GCT GGT GG TGG TG
120,748-
nO,767
94, 55,
72
M2 probe down
GAT GCC CCC CGA GTA CCC GA
121,044-
121,063
94, 55,
72
AG 29
CGG GTA CTC GGG GGG CA
121,044-
121,061
94, 55,
72
AG 30
CTC GGG GGT CTC TAG CGT GG
121,252-
121,272
94, 55,
72
AG 31
CGC CTC TTC CTC CTC TGC CT
121,513-
121,533
94, 68,
72
1 All PCR conditions are one cycle for 3 minutes followed by 30 cycles for 1 minute.
98

99
Table B-2. Real Time PCR Primer and Probe Sequences
Primer Name
Sequence
XIST forward
GCT CTT AAA CTG AGT GGG
TGT TCA
XIST reverse
GTA TCA CGC AGA AGC CAT
AATGG
XIST probe
ACG CGG GCT CTC CA
5LAT forward
GGC TCC ATC GCC TTT CCT
5LAT reverse
AAG GGA GGG AGG AGG GTA
CTG
5LAT probe
TCT CGC TTC TCC CC
LPRO forward
CAA TAA CAA CCC CAA CGG
AAA GC
LPRO reverse
TCC ACT TCC CGT CCT TCC AT
LPRO probe
TCC CCT CGG TTG TTC C
POL forward
AGA GGG ACA TCC AGG ACT
TTGT
POL reverse
CAG GCG CTT GTT GGT GTA C
POL probe
ACC GCC GAA CTG AGC A

APPENDIX C
EXPRESSION OF THE LAT TRANSGENE IS NOT AGE DEPENDENT
The expression profile for the LAT transgenic mouse was presented in Chapter 3.
Due to the large amount of data generated by studying the expression profile in four age
groups of mice, only a portion of the age related expression data was presented. The
complete age related expression profile for the transgenic mouse is presented here.
For each tissue RNA was extracted and reverse transcribed as described in the
materials and methods, chapter 3. RT-PCR reactions were performed using real time
PCR for the 5 LAT exon or 18s RNA and compared to a standard curve generated by
known copies of plasmid DNA.
The LAT expression in transgenic neural tissues for the four age groups, 1 day, 1
month, 2 months, and 18 months old, is graphed in figure C-l. By ANOVA there was no
statistical difference between the age groups for each tissue, hypothalamus (P= 0.1744),
cerebellum (P= 0.7774), cortex (P= 0.7537), olfactory bulb (P= 0.5967), spinal cord (P=
0.3303), dorsal root ganglia (P= 0.6908), trigeminal ganglia (P= 0.4050) when
represented per gram of tissue.
Figure C-2 illustrates the expression data for non-neural tissues at the four age
groups. There was no statistically significant difference between the ages of any of the
tissues tested. Skin (P= 0.1728), foot (P= 0.0657), heart (P= 0.1623), kidney (P=
0.5630), lung (P= 0.2311), eye (P= 0.6017), liver (P= 0.3415), spleen (P= 0.5750), and
intestine (P= 0.6113).
100

copies / g tissue
101
1 Day Old
1 Month Old
2 Month Old
18 Month Old
^ y y ^ y
// /./
^ $
y y
Figure C-l. Expression of the LAT transgene in neural tissues. Expression is
represented as LAT copies per gram of tissue, n = 4.
1 Day Old
1 Month Old
2 Month Old
18 Month Old
Figure C-2. Expression of the LAT transgene in non-neural tissues. Expression is
represented as LAT copies per gram of tissue, n = 4.

102
As discussed in chapter 3, comparison of different tissues on a per weight basis
does not take into consideration the different sizes and densities of each cell type. Thus,
this representation is not on a per cell basis. To address this issue, tissue expression was
compared normalized to levels of 18s RNA which was considered to be constant in all
cells (Thellin et al., 1999).
As for the per weight analysis, tissues were divided into neural tissues (figure C-3)
and non-neural tissues (figure C-4). The neural tissues when normalized to 18s RNA
exhibited no significant difference between the amount of expression at the four age
groups. Hypothalamus (P= 0.7320), cerebellum (P= 0.6499), cortex (P= 0.2609),
olfactory bulb (P= 0.4991), spinal cord (P= 0.2859), dorsal root ganglia (P= 0.4803), and
trigeminal ganglia (P= 0.2429).
1 Day Old
1 Month Old
2 Month Old
18 Month Old
Figure C-3. Expression of the LAT transgene in neural tissues represented as copies per
18s RNA.

103
1.00E+07
1.00E+06
Z 1.00E+05
a£,
zr¡
* 1.00E+04
'I 1.00E+03
o
1.00E+02
1.00E+01
1 Day Old
I Month Old
2 Month Old
18 Month Old
^
V ^ ^
Figure C-4. Expression of the LAT transgene in non-neural tissues represented as copies
per 18s RNA.
The non-neural tissues were not statistically different between the age groups
when normalized to 18s RNA. Skin (P= 0.5305), foot (P= 0.5707), heart (P= 0.2801),
kidney (P= 0.5286), lung (P= 0.1606), eye (P=0.4662), liver (P= 0.3247), spleen (P=
0.4737), and intestine (P= 0.2770).
Among all of the tissues tested at the four age groups, only the foot was close to
having a significant age dependent expression pattern. If more mice were sampled it is
possible that the expression in the foot would be age dependent on a per weight basis.
Due to the fact that the expression in the foot when compared on per 18s RNA basis was
not significant, there is probably no scientific merit to difference in expression in the foot
especially since the foot consists of many different cell types including the bone and
muscles. Thus, there is no age dependent expression of the LAT transgene in these
tissues.

LIST OF REFERENCES
Ahmed, M., M. Lock, C. G. Miller and N. W. Fraser (2002). "Regions of the herpes
simplex virus type 1 latency-associated transcript that protect cells from apoptosis
in vitro and protect neural cells in vivo." Journal of Virology 76(2): 717-729
Alvira, M. R., W. F. Goins, J. B. Cohen and J. Glorioso (1999). "Genetic studies
exposing the splicing events involved in herpes simplex virus type 1 latency-
associated transcript production during lytic and latent infection." Journal of
Virology 73(5): 3866-3876.
Anderson, J. M. and M. W. N. Nicholls (1972). "Herpes encephalitis in pregnancy."
British Medical Journal 1(800): 632.
Berthomme, H., J. Lokensgard, L. Yang, T. Margolis and L. T. Feldman (2000).
"Evidence for a bidirectional element located downstream from the herpes simplex
virus type 1 latency-associated promoter that increases its activity during latency."
Journal of Virology 74(8): 3613-3622.
Berthomme, H., J. Thomas, P. Texier, A. Epstein and L. T. Feldman (2001). "Enhancer
and long-term expression functions of herpes simplex virus type 1 latency-
associated promoter are both located in the same region." Journal of Virology
75(9): 4386-4393.
Bhattachaijee, P. S., R. K. Tran, M. E. Myles, K. Maruyama, A. Mallakin, D. C. Bloom
and J. M. Hill (2003). "Overlapping subdeletions within a 348-bp in the 5' exon of
the LAT region that facilitates epinephrine-induced reactivation of HSV-1 in the
rabbit ocular model do not further define a functional element." Virology 312(1):
151-158.
Bloom, D. C., G. B. Devi-Rao, J. M. Hill, J. G. Stevens and E. K. Wagner (1994).
"Molecular analysis of herpes simplex virus type 1 during epinephrine induced
reactivation of latently infected rabbits in vivo." Journal of Virology 68(3): 1283-
1292.
Bloom, D. C., J. M. Hill, E. K. Wagner, L. T. Feldman and J. G. Stevens (1996). "A 348-
bp region in the latency associated transcript facilitates herpes simplex virus type 1
reactivation." Journal of Virology 70: 2449-2459.
104

105
Burton, E. A., C. S. Hong and J. C. Glorioso (2003). "The stable 2.0-kilobase intron of
the herpes simplex virus type 1 latency-associated transcript does not function as an
antisense repressor of ICPO in nonneuronal cells." Journal of Virology 77(6): 3516-
3530.
Cai, W. and P. Schaffer (1992). "Herpes simplex virus type 1 ICPO plays a critical role in
the de novo synthesis of infectious virus following transfection of viral DNA."
Journal of Virology 66: 2904-2915.
Chen, S. H., M. F. Kramer, P. A. Schaffer and D. M. Cohen (1997). "A viral function
represses accumulation of transcripts from productive-cycle genes in mouse ganglia
latently infected with herpes simplex virus." Journal of Virology 71: 5878-5884.
Chen, Y. T., Y. H. Wang, Y. Y. Cheng and S. L. Hung (2003). "Direct binding of herpes
simplex virus type 1 virions to complement C3." Viral Immunology 16(3): 347-
355.
Coffin, R. S. and M. S. Thomas (1998). "The herpes simplex virus 2 kb latency-
associated transcript (LAT) leader sequence allows efficient expression of
downstream proteins which is enhanced in neuronal cells: possible function of LAT
ORFs." Journal of General Virology 79: 3019-3026.
Colgin, M. A., R. L. Smith and C. L. Wilcox (2001). "Inducible cyclic AMP early
repressor produces reactivation of latent herpes simplex virus type 1 in neurons in
vitro." Journal of Virology 75(6): 2912-2920.
Davido, D. J., W. F. von Zagorski, G. G. Maul and P. A. Schaffer (2003). "The
differential requirement for cyclin-dependent kinase activities distinguishes two
functions of herpes simplex virus type 1 ICPO." Journal of Virology 77(23): 12603-
12616.
Dobson, A. T., T. P. Margolis, W. A. Gomes and L. T. Feldman (1995). "In vivo deletion
analysis of the herpes simplex virus type 1 latency associated transcript promoter."
Journal of Virology 69(4): 2264-2270.
Drolet, B. S., G. C. Pemg, J. Cohen, S. M. Slanina, A. Yukht, A. B. Nesbum and S. L.
Wechsler (1998). "The region of the herpes simplex virus type 1 LAT gene
involved in spontaneous reactivation does not encode a functional protein."
Virology 242:221-232.
Ellis, J., P. Pasceri, K. C. Tan-Un, X. Wu, A. Harper, P. Fraser and F. Grosveld (1997).
"Evaluation of beta-globin gene therapy constructs in single copy transgenic mice."
Nucleic Acids Research 25:1296-1302.
Ellison, A. R., L. Yang, C. C. Voytek and T. Margolis (2000). "Establishment of latent
herpes simplex virus type 1 infection in resistant, sensitive, and immunodeficient
mouse strains." Virology 268: 17-28.

106
Farrell, M. J., A. T. Dobson and L. T. Feldman (1991). "Herpes simplex virus latency-
associated transcript is a stable intron." Proceedings of the National Academy of
Sciences 88: 790-794.
Gary, L.W., J.M. Loutsch, J. M. Hill, E.K. Wagner and D.C. Bloom. In preparation.
Identification of a virulence function in herpes simplex virus type 1 mapping to
the latency-associated transcript locus.
Gesser, R. M, T. Valyi-Nagy and N. Fraser (1994). "Restricted herpes virus type 1 gene
expression within sensory neurons in the absence of functional B and T
lymphocytes." Virology 200: 791-795.
Goins, W. F., L. R. Sternberg, K. D. Croen, P. R. Krause, R. L. Hendricks, D. J. Fink, S.
E. Straus, M. Levine and J. C. Glorioso (1994). "A novel latency-active promoter is
contained within the herpes simplex virus type 1 UL flanking repeats." Journal of
Virology 68(4): 2239-2252.
Gordon, J. W., G. A. Scangos, D. J. Plotkin, J. A. Barbosa and F. H. Ruddle (1980).
"Genetic transformation of mouse embryos by microinjection of purified DNA."
Proceedings of the National Academy of Sciences 77(12): 7380-7384.
Gressens, P. and J. R. Martin (1994). "In situ polymerase chain reaction: localization of
HSV-2 DNA sequences in infections of the nervous system." Journal of Virology
Methods 46: 61-83.
Grnewald, K., P. Desai, D. C. Winkler, J. B. Heymann, D. M. Belnap, W. Baumeister
and A. L. Steven (2003). "Three-dimensional structure of herpes simplex virus
from cryo-electron tomography." Science 302: 1396-1398.
Halford, W. P. and P. A. Schaffer (2001). "ICP0 is required for efficient reactivation of
herpes simplex virus type 1 from neuronal latency." Journal of Virology 75(7):
3240-3249.
Halford, W. P., C. D. Kemp, J. A. Isler, D. J. Davido and P. Schaffer (2001). "ICP0,
ICP4, or VP 16 expressed from adenovirus vectors induces reactivation of latent
herpes simplex virus type 1 in primary cultures of latently infected trigeminal
ganglion cells." Journal of Virology 75(13): 6143-6153.
Hill, J. M., J. B. Dudley, Y. Shimomura and H. E. Kaufman (1986). "Quantitation and
kinetics of adrenergic induced HSV-1 ocular shedding." Current Eye Research 5:
241-246.

107
Hill, J. M., J. B. Maggioncalda, H. H. Garza, Y.-H. Su, N. W. Fraser and T. M. Block
(1996). "In vivo epinephrine reactivation of ocular herpes simplex type 1 (HSV-1)
in the rabbit is correlated to a 370 base pair region located between the promoter
and the 5' end of the 2.0 kb latency-associated transcript (LAT)." Journal of
Virology 70: 7270-7274.
Hogan, B., F. Constantini and E. Lacy (1986). Manipulating the mouse genome. Cold
Spring Harbor, NY, Cold Spring Harbor Laboratory Press.
Jackson, S. A. and N. A. DeLuca (2003). "Relationship of herpes simplex virus genome
configuration to productive and persistent infections." Proceedings of the National
Academy of Sciences 100(13): 7871-7876.
Jarman, R. G., E. K. Wagner and D. C. Bloom (1999). "LAT expression during an acute
HSV infection in the mouse." Virology 262: 384-397.
Jarman, R. G., J. M. Loutsch, G. B. Devi-Rao, M. E. Marquart, M. P. Banaszak, X.
Zheng, J. M. Hill, E. K. Wagner and D. C. Bloom (2002). "The region of the HSV-
1 latency-associated transcript required for epinephrine-induced reactivation in the
rabbit does not include the 2.0 kb intron." Virology 292: 59-69.
Kastrukoff, L. F., A. S. Lau and M. L. Puterman (1986). "Genetics of natural resistance
to herpes simplex virus type 1 latent infection of the peripheral nervous system in
mice." Journal of General Virology 67: 613-621.
Kenny, J. J., F. C. Krebs, H. T. Hartle, A. E. Gartner, B. Chatton, J. M. Leiden, J. P.
Hoeffler, P. C. Weber and B. Wigdahl (1994). "Identification of a second
ATF/CREB-like element in the herpes simplex virus type 1 (HSV-1) latency-
associated transcript (LAT) promoter." Virology 200: 220-235.
Koelle, D. M. and L. Corey (2003). "Recent progress in herpes simplex virus
immunobiology and vaccine research." Clinical Microbiology Reviews 16(1): 96-
113.
Kubat, N. J., R. K. Tran, P. McAnany and D. Bloom (2004). "Specific histone tail
modification and not DNA methylation is a determinant of HSV-1 latent gene
expression." Journal of Virology 78(3): 1139-1149.
Levine, M., A. Krikos, J. C. Glorioso and F. L. Homa (1990). "Regulation of expression
of the glycoprotein genes of herpes simplex virus type 1 (HSV-1)." Advances in
Experimental Medicine and Biology 278: 151-164.
Loiacono, C. M., R. Myers and W. J. Mitchell (2002). "Neurons differentially activate the
herpes simplex virus type 1 immediate-early gene ICP0 and ICP27 promoters in
transgenic mice." Journal of Virology 76(5): 2449-2459.

108
Lokensgard, J. R., H. Berthomme and L. T. Feldman (1997). "The latency-associated
promoter of herpes simplex virus type 1 requires a region downstream of the
transcription start site for long-term expression during latency." Journal of Virology
71(9): 6714-6719.
Lopez, C. (1975). "Genetics of natural resistance to herpes simplex virus infections in
mice." Nature 258: 152-153.
Mackem, S. and B. Roizman (1982). "Differentiation between alpha promoter and
regulator regions of herpes simplex virus 1: the functional domains and sequence of
a movable alpha regulator." Proceedings of the National Academy of Sciences
79(16): 4917-4921.
Mador, N., E. Braun, H. Haim, I. Ariel, A. Panet and I. Steiner (2003). "Transgenic
mouse with the herpes simplex virus type 1 latency-associated gene: expression and
function of the transgene." Journal of Virology 77(23): 12421-12429.
Maggioncalda, J., A. Mehta, Y. H. Su, N. W. Fraser and T. M. Block (1996).
"Correlation between herpes simplex virus type 1 rate of reactivation from latent
infection and the number of infected neurons in trigeminal ganglia." Virology
225: 72-81.
Margolis, T. P., F. Sedarati, A. T. Dobson, L. T. Feldman and J. G. Stevens (1992).
"Pathways of viral gene expression during acute neuronal infection with HSV-1."
Virology 189(1): 150-160.
Margolis, T. P., D. C. Bloom, A. T. Dobson, L. T. Feldman and J. G. Stevens (1993).
"LAT promoter activity decreases dramatically during the latent phase of
ganglionic infection with HSV." Virology 197(2): 585-592.
Mitchell, W. J. (1995). "Neurons differentially control expression of a herpes simplex
virus type 1 immediate-early promoter in transgenic mice." Journal of Virology
69(12): 7942-50.
Nomura, T. (1997). "Practical development of genetically engineered animals as human
disease models." Laboratory Animal Science 47(2): 113-117.
Nicosia, M., S. L. Deshmane, J. M. Zaboloty, T. Valyi-Nagy and N. Fraser (1993).
"Herpes simplex virus type 1 latency-associated transcript (LAT) promoter deletion
mutants can express a 2-kilobase transcript mapping to the LAT region." Journal of
Virology 67(12): 7276-7283.
Pemg, G.-C., E. C. Dunkel, P. A. Geary, S. M. Slanina, H. Ghiasi, R. Kaiwar, A. B.
Nesbum and S. L. Wechsler (1994). "The latency-associated transcript gene of
herpes simplex virus type 1 (HSV-1) is required for efficient in vivo spontaneous
reactivation of HSV-1 from latency." Journal of Virology 68(12): 8045-8055.

109
Pemg, G. C., S. M. Slanina, A. Yukht, B. S. Drolet, W. Keleher, Jr., H. Ghiasi, A. B.
Nesbum and S. L. Wechsler (1999). "A herpes simplex virus type 1 latency-
associated transcript mutant with increased virulence and reduced spontaneous
reactivation." Journal of Virology 73(2): 920-929.
Pemg, G. C., C. Jones, J. Ciacci-Zanella, M. Stone, G. Henderson, A. Yukht, S. M.
Slanina, F. M. Hofman, H. Ghiasi, A. B. Nesbum and S. L. Wechsler (2000).
"Virus-induced neuronal apoptosis blocked by the herpes simplex vims latency-
associated transcript." Science 287(5457): 1500-1503.
Pemg, G. C., B. Maguen, L. Jin, K. R. Mott, J. Kurylo, L. BenMohamed, A. Yukht, N.
Osorio, A. B. Nesbum, G. Henderson, M. Inman, C. Jones and S. L. Wechsler
(2002). "A novel herpes simplex vims type 1 transcript (AL-RNA) antisense to the
5' end of the latency associated transcript produces a protein in infected rabbits."
Journal of Virology 76(16): 8003-8010.
Perry, L. J. and D. J. McGeoch (1988). "The DNA sequences of the long repeat region
and adjoining parts of the long unique region in the genome of herpes simplex vims
type 1." Journal of General Virology 69(11): 2831-2846.
Qiagen, Inc. (2003). Qiagen Product Guide. Valencia, CA.
Rail, G. F., L. Mucke and M. B. A. Oldstone (1995). "Consequences of cytotoxic T
lymphocyte interaction with major histocompatibility complex class 1-expressing
neurons in vivo." Journal of Experimental Medicine 182: 1201-1212.
Rodahl, E. and J. G. Stevens (1992). "Differential accumulation of herpes simplex vims
type 1 latency-associated transcripts in sensory and autonomic ganglia." Virology
189(1): 385-388.
Roizman, B. and A. E. Sears (1996). Herpes Simplex Vimses and Their Replication.
Virology. B. N. Fields. New York, Raven Press, Ltd., 2: 1795-1841.
Sawtell, N. M. and R. L. Thompson (1992). "Rapid in vivo reactivation of herpes simplex
vims in latently infected murine ganglionic neurons after transient hyperthermia."
Journal of Virology 66(4): 2150-2156.
Shibata, S. and J. T. Lee (2003). "Characterization and quantitation of differential Tsix
transcripts: implications for Tsix function." Human Molecular Genetics 12(2): 125-
136.
Sippel, A. E., H. Saueressig, M. C. Huber, N. Faust and C. Bonifer (1997). Insulation of
transgenes from chromosomal position effects. Transgenic Animals Generation and
Use. L. M. Houdebine. Amsterdam, OPA.

110
Smith, C. A., P. Bates, R. Rivera-Gonzalez, B. Gu and N. A. DeLuca (1993). "ICP4, the
major transcriptional regulatory protein of herpes simplex virus type 1, forms a
tripartite complex with TATA-binding protein and TFIIB." Journal of Virology
67(8): 4676-4687.
Soares, K., D. Hwang, R. Ramakrishnan, M. Schmidt, D. J. Fink and J. Glorioso (1996).
"Cw-acting elements involved in transcriptional regulation of the herpes simplex
virus type 1 latency-associated promoter 1 (LAP1) in vitro and in vivo." Journal of
Virology 70(8): 5384-5394.
Speck, P. G. and A. Simmons (1991). "Divergent molecular pathways of productive and
latent infection with a virulent strain of herpes simplex virus type 1." Journal of
Virology 65(8): 4001-4005.
Spivack, J. G., G. M. Woods and N. W. Fraser (1991). "Identification of a novel latency-
specific splice donor signal within the herpes simplex virus type 1 2.0-kilobase
latency-associated transcript (LAT): translation inhibition of LAT open reading
frames by the intron within the 2.0-kilobase LAT." Journal of Virology 65: 6800-
6810.
Thellin, O., W. Zorzi, B. Lakaye, B. De Borman, B. Coumans, G. Hennen, T. Grisar, A.
Igout and E. Heinen (1999). "Housekeeping genes as internal standards: uses and
limits." Journal of Biotechnology 75: 291-295.
Thomas, S. K., G. Gough, D. S. Latchman and R. S. Coffin (1999). "Herpes simplex
virus latency-associated transcript encodes a protein which greatly enhances
growth, can compensate for deficiencies in immediate early gene expression, and is
likely to function during reactivation from virus latency." Journal of Virology
73(8): 6618-6625.
Thomas, D. L., M. Lock, J. Zaboloty, B. R. Mohan and N. Fraser (2002). "The 2-kilobase
intron of herpes simplex virus type 1 latency-associated transcript has a half-life of
approximately 24 hours in SY5Y and COS-1 cells." Journal of Virology 76(2):
532-540.
Thompson, R. L. and N. M. Sawtell (2001). "Herpes simplex virus type 1 latency-
associated transcript gene promotes neuronal survival." Journal of Virology 75(14):
6660-6675.
Voncken, J. W. (2003). Genetic modification of the mouse. Transgenic Mouse Methods
and Protocols. M. H. Hofker and J. van Deursen. Totowa, NJ, Humana Press Inc.
Wagner, E. K. (1991). Herpesvirus Transcription and its Regulation. Boca Raton, CRC
Press.
Wagner, E. K. and D. C. Bloom (1997). "Experimental investigation of herpes simplex
virus latency." Clinical Microbiology Reviews 10(3): 419-443.

Ill
Wagner, E. K., M. D. Petroski, N. T. Pande, P. Leiu and M. K. Rice (1998). "Analysis of
factors influencing the kinetics of herpes simplex virus transcript expression
utilizing recombinant virus." Methods 16: 105-116.
Wang, K., L. Pesnicak and S. E. Straus (1997). "Mutations in the 5' end of the herpes
simplex virus type 2 latency-associated transcript (LAT) promoter affect LAT
expression in vivo but not the rate of spontaneous reactivation of genital herpes."
Journal of Virology 71(10): 7903-7910.
Wang, K., L. Pesnicak, E. Guandal, P. Krause and S. E. Straus (2001). "The 2.2-kilobase
latency-associated transcript of herpes simplex virus type 2 does not modulate viral
replication, reactivation, or establishment of latency in transgenic mice." Journal of
Virology 75(17): 8166-8172.
Ward, P. L. and B. Roizman (1998). Evasion and obstruction: the central strategy of the
interaction of human herpesviruses with host defenses. Herpesviruses and
Immunity. M. P.G., H. M. Friedman and M. Bendinelli. New York, Plenum Press.
Weir, J. P. (2001). "Regulation of herpes simplex virus gene expression." Gene 271: 117-
130.
Whitley, R. J. (1990). Herpes Simplex Viruses. Virology. B. N. Fields. New York, Raven
Press, Ltd., 2: 1843-1887.
Whitley, R. J. (1996). Herpes Simplex Viruses. Fields Virology. P. M. Howley. New
York, Raven Press, Ltd., 2: 2297-2342.
Wilkie, T. M., R. L. Brinster and R. D. Palmiter (1986). "Germline and somatic
mosaicism in transgenic mice." Developmental Biology 118: 9-18.
Wu, T.-T., Y.-H. Su, T. Block and J. M. Taylor (1998). "Atypical splicing of the latency-
associated transcripts of herpes simplex type 1." Virology 243: 140-149.
Yang, L., C. C. Voytek and T. P. Margolis (2000). "Immunohistochemical analysis of
primary sensory neurons latently infected with herpes simplex virus type 1."
Journal of Virology 74(1): 209-217.
Zwaagstra, J. C., J. C. Ghiasi, S. M. Slanina, A. B. Nesbum, S. C. Wheatley, K.
Lillycrop, J. Wood, D. S. Latchman, K. Patel and S. L. Wechsler (1990). "Activity
of herpes simplex virus type 1 latency-associated transcript (LAT) promoter in
neuron-derived cells: evidence for neuron specificity and for a large LAT
transcript." Journal of Virology 64: 5019-5028.

BIOGRAPHICAL SKETCH
Anne Gussow was bom in Pottsville, Pennsylvania and graduated from Pottsville
Area High School. She received her B.S. degree in biology from Susquehanna
University in Selinsgrove, PA. She then went on to do research at the Pennsylvania State
University College of Medicine, Hershey Medical Center, with Dr. Robert Bonneau
studying the effects of stress on the immune response to Herpes Simplex Virus. Ms.
Gussow began her graduate career at Arizona State University in Tempe, Arizona, with
Dr. David Bloom before transferring to the University of Florida where she has
completed her doctoral studies.
112

I certify that I have read this study and that in my opinion it conforms to acceptable
standards of scholarly presentation and is fully adequate, in scope and quality, as a
dissertation for the degree of Doctor of Philosophy.
David C. Bloom^Chair
Assistant Professor of Molecular Genetics
and Microbiology
I certify that I have read this study and that in my opinion it conforms to acceptable
standards of scholarly presentation and is fully adequate, in scope and quality, as a
dissertation for the degree of Doctor of Philosophy.

"Paul J.
Mark &T)verstreet Professor of
Neuroscience
I certify that I have read this study and that in my opinion it conforms to acceptable
standards of scholarly presentation and is fully adequate, in scope and quality, as a
dissertation for the degree of Doctor of Philosophy.
Richard C. Condit
Professor of Molecular Genetics and
Microbiology
I certify that I have read this study and that in my opinion it conforms to acceptable
standards of scholarly presentation and is fully adequate, in scope and quality, as a
dissertation for the degree of Doctor of Philosophy.
r\A
Sue A. Moyer
Professor of Molecular Genetics and
Microbiology
This dissertation was submitted to the Graduate Faculty of the College of Medicine
and to the Graduate School and was accepted as partial fulfillment of the requirements for
the degree of Doctor of Philosophy.
May 2004
Dean, Graduate School



BIOGRAPHICAL SKETCH
Anne Gussow was bom in Pottsville, Pennsylvania and graduated from Pottsville
Area High School. She received her B.S. degree in biology from Susquehanna
University in Selinsgrove, PA. She then went on to do research at the Pennsylvania State
University College of Medicine, Hershey Medical Center, with Dr. Robert Bonneau
studying the effects of stress on the immune response to Herpes Simplex Virus. Ms.
Gussow began her graduate career at Arizona State University in Tempe, Arizona, with
Dr. David Bloom before transferring to the University of Florida where she has
completed her doctoral studies.
112


KEY TO SYMBOLS
C
AL
ANOVA
(3-gal
bp
Br
CaCl2
cDNA
cm
CMV
C02
CPE
cpm
CRE
CTL
dATP
dCTP
dGTP
dTTP
DEPC
DNA
DRG
EDTA
TE
F
FFLB
FHP
fmol
g
HC1
HSV
HSV-1
HSV-2
ICP
IFNy
K
kb
kg
LAP1
degrees Celsius
antisense to LAT
analysis of variance
beta galactosidase
base pair
brain
calcium chloride
copy deoxynucleic acid
centimeter
cytomegalovirus
carbon dioxide
cytopathic effect
counts per minute
cyclic AMP response element
cytotoxic T lymphocyte
adenosine triphosphate nucleotide
cytosine triphosphate nucleotide
guanine triphosphate nucleotide
thymine triphosphate nucletide
diethyl pyrocarbonate
deoxyribonucleic acid
dorsal root ganglia
ethylenediaminetetraacetic acid
TRIS/ EDTA buffer
foot
formaldehyde loading buffer
formamide prehybridization/ hybridization buffer
femtomole
centrifugal force
hydrochloric acid
Herpes Simplex Virus
Herpes Simplex Virus Type 1
Herpes Simplex Virus Type 2
infected cell protein
interferon gamma
kidney
kilobases
kilogram
latency associated promoter 1
xi


41
Discussion
Unlike typical transgenic inserts, the LAT founder mouse was particularly
difficult to produce and required three separate injections. When the founder mouse was
generated there was only a single founder compared to other injections where there are
usually at least 10% transgenic animals in the first litter (Voncken, 2003), and the LAT
founder has deleted the SV40 poly A sequence. One potential interpretation of this result
is that a portion of the LAT region inserted in the context of genomic DNA may be lethal
to the embryo. Further studies are necessary to determine if this is the case. However,
the LAT transgenic line that was created can be (and has been) used to study LAT
regulation and functions provided that it is stable and expressed.
Initial studies by both hybridization and PCR to determine the number of
transgene copies inserted indicate that the LAT transgenic line contains a single copy.
The fact that only a single copy was inserted is consistent with the possibility that LAT
inserts may not be well-tolerated in mice since it is common to have multiple copies of
typical transgenes integrated at a single locus of the mouse genome, in some cases more
than 100 copies have been shown to be inserted (Ellis et al., 1997).
Screening for the founder mouse determined that the LAT transgenic mouse was
LAT positive and SV40 negative. The probe used to screen for LAT in this case
encompassed 897 bases of the transgene and would not evaluate the extent of the
deletion. In data presented here it was shown by PCR that the deletion is confined to the
3 most end of the transgene and may be as little as 132 bases. Based on figure 2-5b it
appears that the deletion does not include the splice acceptor site since the stable 2kb
LAT intron can be detected in transgenic DRG.


52
cycles earlier, quantitative comparisons must be made following a series of dilutions of
the DNA targets, to insure that comparisons are being made under conditions where all of
the PCR products reflect a linear correspondence with the amount of target present in
each sample. Since real-time PCR measures the rate of product formation, linear ranges
of comparisons of all samples and standards are easily made. For each tissue, 500 ng of
total RNA was reverse transcribed (RT) and then a fraction of the RT reaction used for
PCR with a real time primer and probe set located within the 5exon region of LAT (see
Figure 2-3). Quantitation of samples was standardized by generating a standard curve
from PCR reactions containing known quantities of pLAT/LAT plasmid DNA.
Figure 3-la represents the expression data presented on a per gram of tissue basis
for a group of 4 eight week old mice. Both neural and non-neural tissues exhibited
expression of the LAT transgene ranging from 3.51 x 104 to 3.88 x 106 copies/gram of
tissue. The variations between the tissues were compared by ANOVA and were not
significantly different (F=1.079, P= 0.4017). Power analysis indicated that more than
100 mice would be needed to attain a statistically significant difference between the
expression levels in the transgenic tissues because there was little difference, relative to
the error, between the different tissues.
While on the whole there was no significant difference between all of the
transgenic tissues, we wanted to look closer at the tissues typically involved in the HSV-1
infection. For these analyses, paired t-tests compared skin with DRG (t=l .676,
P=0.1546) as well as feet with DRG (t=1.780, P=0.1253) demonstrated no significant
difference between either pair of tissues.


xml version 1.0 encoding UTF-8
REPORT xmlns http:www.fcla.edudlsmddaitss xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.fcla.edudlsmddaitssdaitssReport.xsd
INGEST IEID EG7S11Y9C_UXWSYX INGEST_TIME 2014-11-25T18:58:58Z PACKAGE AA00026430_00001
AGREEMENT_INFO ACCOUNT UF PROJECT UFDC
FILES


LIST OF TABLES
Table page
2-1 Determination of transgenic copy number by real-time PCR 35
3-1 Quantitation of LAT Expressing Cells in Dorsal Root Ganglia by in situ
hybridization for the LAT 5 exon 63
B-l Conventional PCR Primers and Locations 98
B-2 Real time PCR Primer and Probe Sequences 99
viii


95
4021 gacgaggggc ccccgaccgc ggcggtccgg gccccgtccg gacccgctcg ccggcacgcg
4081 acgcgaaaaa ggccccccgg aggcttttcc gggttcccgg cccggggcct gagatgaaca
4141 ctcggggtta ccgccaacgg ccggcccccg tggcggcccg gcccggggcc ccggcggacc
4201 caaggggccc cggcccgggg ccccacaacg gcccggcgca tgcgctgtgg tttttttttc
4261 ctcggtgttc tgccgggctc catcgccttt cctgttctcg cttctccccc cccccttctt
4321 cacccccagt accctcctcc ctcccttcct cccccgttat cccactcgtc gagggcgccc
4381 cggtgtcgtt caacaaagac gccgcgtttc caggtaggtt agacacctgc ttctccccaa
4441 tagagggggg ggacccaaac gacagggggc gccccagagg ctaaggtcgg ccacgccact
4501 cgcgggtggg ctcgtgttac agcacaccag cccgttcttt tccccccctc ccacccttag
4561 tcagactctg ttacttaccc gtccgaccac caactgcccc cttatctaag ggccggctgg
4621 aagaccgcca gggggtcggc cggtgtcgct gtaacccccc acgccaatga cccacgtact
4681 ccaagaaggc atgtgtccca ccccgcctgt gtttttgtgc ctggctctct atgcttgggt
4741 cttactgcct gggggggggg agtgcggggg agggggggtg tggaaggaaa tgcacggcgc
4801 gtgtgtaccc cccctaaagt tgttcctaaa gcgaggatac ggaggagtgg cgggtgccgg
4861 gggaccgggg tgatctctgg cacgcggggg tgggaagggt cgggggaggg ggggatggag
4921 taccggccca cctggccgcg cgggtgcgcg tgcctttgca caccaacccc acgtcccccg
4981 gcggtctcta agaagcaccg ccccccctcc ttcataccac cgagcatgcc tgggtgtggg
5041 ttggtaacca acacgcccat cccctcgtct cctgtgattc tctggctgca ccgcattctt
5101 gttttctaac tatgttcctg tttctgtctc cccccccccc acccctccgc cccacccccc
5161 aacacccacg tctgtggtgt ggccgacccc cttttgggcg ccccgtcccg ccccgccacc
5221 cctcccatcc tttgttgccc tatagtgtag ttaacccccc ccgccctttg tggcggccag
5281 aggccaggtc agtccgggcg ggcaggcgct cgcggaaact taacacccac acccaaccca
5341 ctgtggttct ggctccatgc cagtggcagg atgctttcgg ggatcggtgg tcaggcagcc
1


105
Burton, E. A., C. S. Hong and J. C. Glorioso (2003). "The stable 2.0-kilobase intron of
the herpes simplex virus type 1 latency-associated transcript does not function as an
antisense repressor of ICPO in nonneuronal cells." Journal of Virology 77(6): 3516-
3530.
Cai, W. and P. Schaffer (1992). "Herpes simplex virus type 1 ICPO plays a critical role in
the de novo synthesis of infectious virus following transfection of viral DNA."
Journal of Virology 66: 2904-2915.
Chen, S. H., M. F. Kramer, P. A. Schaffer and D. M. Cohen (1997). "A viral function
represses accumulation of transcripts from productive-cycle genes in mouse ganglia
latently infected with herpes simplex virus." Journal of Virology 71: 5878-5884.
Chen, Y. T., Y. H. Wang, Y. Y. Cheng and S. L. Hung (2003). "Direct binding of herpes
simplex virus type 1 virions to complement C3." Viral Immunology 16(3): 347-
355.
Coffin, R. S. and M. S. Thomas (1998). "The herpes simplex virus 2 kb latency-
associated transcript (LAT) leader sequence allows efficient expression of
downstream proteins which is enhanced in neuronal cells: possible function of LAT
ORFs." Journal of General Virology 79: 3019-3026.
Colgin, M. A., R. L. Smith and C. L. Wilcox (2001). "Inducible cyclic AMP early
repressor produces reactivation of latent herpes simplex virus type 1 in neurons in
vitro." Journal of Virology 75(6): 2912-2920.
Davido, D. J., W. F. von Zagorski, G. G. Maul and P. A. Schaffer (2003). "The
differential requirement for cyclin-dependent kinase activities distinguishes two
functions of herpes simplex virus type 1 ICPO." Journal of Virology 77(23): 12603-
12616.
Dobson, A. T., T. P. Margolis, W. A. Gomes and L. T. Feldman (1995). "In vivo deletion
analysis of the herpes simplex virus type 1 latency associated transcript promoter."
Journal of Virology 69(4): 2264-2270.
Drolet, B. S., G. C. Pemg, J. Cohen, S. M. Slanina, A. Yukht, A. B. Nesbum and S. L.
Wechsler (1998). "The region of the herpes simplex virus type 1 LAT gene
involved in spontaneous reactivation does not encode a functional protein."
Virology 242:221-232.
Ellis, J., P. Pasceri, K. C. Tan-Un, X. Wu, A. Harper, P. Fraser and F. Grosveld (1997).
"Evaluation of beta-globin gene therapy constructs in single copy transgenic mice."
Nucleic Acids Research 25:1296-1302.
Ellison, A. R., L. Yang, C. C. Voytek and T. Margolis (2000). "Establishment of latent
herpes simplex virus type 1 infection in resistant, sensitive, and immunodeficient
mouse strains." Virology 268: 17-28.


102
As discussed in chapter 3, comparison of different tissues on a per weight basis
does not take into consideration the different sizes and densities of each cell type. Thus,
this representation is not on a per cell basis. To address this issue, tissue expression was
compared normalized to levels of 18s RNA which was considered to be constant in all
cells (Thellin et al., 1999).
As for the per weight analysis, tissues were divided into neural tissues (figure C-3)
and non-neural tissues (figure C-4). The neural tissues when normalized to 18s RNA
exhibited no significant difference between the amount of expression at the four age
groups. Hypothalamus (P= 0.7320), cerebellum (P= 0.6499), cortex (P= 0.2609),
olfactory bulb (P= 0.4991), spinal cord (P= 0.2859), dorsal root ganglia (P= 0.4803), and
trigeminal ganglia (P= 0.2429).
1 Day Old
1 Month Old
2 Month Old
18 Month Old
Figure C-3. Expression of the LAT transgene in neural tissues represented as copies per
18s RNA.


11
(Zwaagstra et al., 1990; Jarman et al., 1999). Additionally, more LAT expression was
seen in neuronal cell types (ND7 and Cl300) than in non-neuronal rabbit skin cells using
in vitro infections (Coffin et al., 1998). Further studies with LAT promoter deletions
revealed LAT expression differences between neuronal cell cultures and infected dorsal
root ganglia neurons (Dobson et al., 1995). This suggests that different neuronal cell
types contain different levels or types of transcription factors and that there may be
neuronal specific elements in the LAT promoter. In vivo two regions in the promoter, -75
to -83 and -212 to -348 relative to the transcription start site, showed increased activity
in neuronal cells as opposed to non-neuronal cells (Kenny et al., 1994).
Sensory ganglia contain a variety of cell types, both neuronal and non-neuronal.
Margolis et al. (1992) analyzed some neuronal markers of neurons in mouse sensory
ganglia that corresponded with either sites of HSV-1 LAT expression, or HSV-1 acute
antigen expression and determined that the neuronal population expressing SSEA-3+ as a
surface marker exhibited the highest percentage of LAT expression during acute infection
in the absence of acute antigen. These differences in LAT promoter activity could be
dependent on specific transcription factors present in different cell populations (Dobson
et al., 1995; Yang et al., 2000).
Animal Models of HSV Latency and Reactivation
A number of animal model systems are used to study latency and reactivation. In
the mouse, infection of the footpad results in latency in dorsal root ganglia (DRG).
While not the natural route of infection, the footpad is a large epithelial surface that can
support a uniform infection and dissection of infected tissues can be performed easily.
One limitation to the mouse model is that HSV reactivation does not result in virus being
transported to the primary site of infection as it does in humans. Local reactivation in the


42
The LAT intron exists as a stable lariat structure with a half-life of approximately
24 hours (Thomas et al., 2002). The results obtained from Northern blotting transgenic
RNA suggest that the intron is present in its entirety and can be stably expressed in DRG
but not in the other transgenic tissues examined. The lack of intron signal in non-neural
tissues does not mean that LAT is not being expressed. It is possible that the intron is
stable only in ganglia or that splicing of the intron is not as efficient in non-neuronal
cells.


LAP2
LAT
LN2
LTE
Lv
PL
Pg
pM
mg
mL
mM
M
MEM
MgCl2
MHC
MMLvRT
MOI
MOPS
N
NaCl
NaOH
ng
NGF
nt
P32
PBS
PCR
pfu
Pg
pol
QRT-PCR
RCR
RNA
Rl
Rs
RS
RT
RT-PCR
S35
SDS
SPF
SSC
SV40
TE
TG
tRNA
latency associated promoter 2
latency associated transcript
liquid nitrogen
long term expression element
liver
microliter
microgram
micromolar
milligram
milliliter
millimolar
molar
minimum essential medium
magnesium chloride
major histocompatibility complex
Muloney Murine Leukemia Virus reverse transcriptase
multiplicity of infection
N-morpholino propanesulfonic acid
normal
sodium chloride
sodium hydroxide
nanogram
nerve growth factor
nucleotide
phosphorus-32
phosphate buffered saline
polymerase chain reaction
plaque forming unit
picogram
polymerase
quantitative RT-PCR
reactivation critical region
ribonucleic acid
long repeat
short repeat
rabbit skin cells
reverse transcriptase
reverse transcriptase- polymerase chain reaction
sulfur-35
sodium dodecylsulfate
specific pathogen free
sodium chloride/ sodium citrate
simian virus 40
TRIS/ EDTA buffer
trigeminal ganglia
transfer RNA
xii


30
plasmid, a generous gift of Dr. Jeannie Lee (Shibata and Lee, 2003), was diluted 10 fold
between 105 and 101. Samples were run in triplicate. Each reaction contained 10 ng tail
DNA, 0.33 pL 60x Assay Mix (primer/probe set), 10 pL Taqman Universal PCR Mix
(Applied Biosystems part #430437) in a final volume of 20 pL. PCR was performed in
96 well plates under the following conditions: 1 cycle 2 minutes 50C, 1 cycle 10 minutes
95C, 40 cycles 15 seconds 95C 1 minute 60C.
Mapping of Transgene Insert
Mapping of the LAT DNA inserted into the transgenic mouse was determined
using both conventional and real time PCR. For conventional PCR, reactions contained
600 ng each of forward and reverse primers, 20 pL Hot Master PCR mix (Brinkman
Eppendorf) and 200 ng tail DNA in a 50 pL final reaction volume. Control PCR
reactions contained 600 ng each of forward and reverse primers, 20 pL Hot Master PCR
mix and 0.5 ng pLAT/LAT plasmid DNA in a final reaction volume of 50 pL. Primer
sequences, genome locations and optimal conditions for all primer sets used are found in
Appendix B.
Real time PCR was used for two regions of the transgene, one in the promoter and
one in the 5 exon. Primer and probe sequences for these reactions are found in Appendix
B. All real time reactions were performed on an ABI Prism 7700 thermal cycler (Applied
Biosystems) located in the ICBR protein core at the University of Florida. Samples were
run in triplicate. For each reaction, 50 ng of tail DNA was added to 0.33 pL 60x Assay
Mix (primer/probe set) or 1 pL 20x Assay Mix, and 10 pL Taqman Universal PCR Mix
(Applied Biosystems part #430437) in a final volume of 20 pL. Control reactions used 1
ng of pLAT/LAT plasmid in place of the tail DNA. PCR was performed in 96 well plates


Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy
CHARACTERIZATION OF A TRANSGENIC MOUSE EXPRESSING THE HSV-1
LATENCY ASSOCIATED TRANSCRIPT
By
Anne M. Gussow
May 2004
Chair: David Bloom
Major Department: Molecular Genetics and Microbiology
Herpes Simplex Virus Type 1 (HSV-1) is a double stranded DNA virus that causes
a life-long infection of its host. The infection is characterized by two phases, the acute
phase and the latent phase. The virus infects epithelial tissue during the acute infection
where it gains access to nerve termini and establishes a latent infection in sensory ganglia
neurons. During latency only a single viral transcript is expressed abundantly, the
Latency Associated Transcript (LAT). LAT is most abundantly transcribed in neurons,
and the 5 portion of the transcript has been implicated in the establishment and
reactivation of latent infections. In order to study the regulation of LAT expression in
neurons in the absence of viral functions, a transgenic mouse line was created in the
C57B1/6 background containing the region encoding the LAT 5 exon through the 2.0kb
intron under the control of its native promoter. Characterization of this transgenic mouse
indicates that there is a single copy of the transgene inserted into the mouse genome and
LAT expression is abundant in a number of tissues including dorsal root ganglia (DRG),
xiv


20
tissues and suggested that the LAT transgenic mouse reactivates more efficiently than
non transgenic littermates (Mador et al., 2003). One of the drawbacks of this transgenic
mouse model is that the CMV promoter was used instead of the native LAT promoter.
The CMV promoter is a strong constitutive promoter that has activity in all cell types.
Thus, while the splicing event may be specific to LAT, expression patterns may permit
splicing in cell types that are non-permissive for the latent HSV infection.
Using the LAT region from HSV-2, Wang et al. (2001) studied establishment and
reactivation in a transgenic mouse. HSV-2 LAT was driven by its native promoter and
had expression to high levels in neural tissues as well as some non-neural tissues
determined by northern blots of tissue RNA. The expression in non-neural tissues was
not expected, but not surprising since Jarman et al. had shown LAT expression in the feet
during acute HSV infection (Jarman et al., 1999). In these mice expressing LAT in trans
had no effect on the HSV-2 infection at the establishment or reactivation level. Since
there are a number of differences in tropism between HSV-1 and HSV-2, and because the
HSV-2 LAT intron is processed differently than that of HSV-1, the construction and
analysis of an HSV-1 transgenic mouse model expressing the HSV-1 LAT from its native
promoter was desirable and the focus of this dissertation.
Hypotheses to be Tested Using the Transgenic Approach
Generation of Transgenic Mouse
In the studies presented here, we have generated a LAT transgenic mouse from
HSV-1 strain 17+. This mouse line uses the native HSV-1 LAT promoter and contains
the region encoding the LAT transcript 5 exon and 2 kb intron. The rationale for using
these regions will be discussed further in Chapter 2. Initial characterization of the mouse


13
Function of LAT
Establishment and Reactivation
LAT has been linked with a number of different functions during the acute
infection, although the most extensive body of data supports a role of LAT in the
establishment of and/or reactivation from latency (Wagner, 1991; Roizman and Sears,
1996). The regions of LAT involved in these functions and the others described here are
depicted in Figure 1-4.
Using overlapping dermatomes in the mouse, Speck and Simmons (1991) were
able to demonstrate the establishment of latency (production of LAT) in the absence of
lytic gene production, thus suggesting that lytic and latent pathways can diverge early in
+1
C:
-161 +424
Intron
^^VmenceEfect^^^
+76 +1667
LTE
+30 +661
Anti Apoptosis
-161 +1667
(LAP2)
AL
-198 +158 +661
Figure 1-4. Diagram of the function of HSV-1 LAT. Different regions of LAT have
been implicated in many functions. The location of these functions are mapped
here including the reactivation critical region (RCR), virulence effects, the long
term expression element (LTE), and anti-apoptotic region. Also included here is
the location of the antisense to LAT transcript, AL.


109
Pemg, G. C., S. M. Slanina, A. Yukht, B. S. Drolet, W. Keleher, Jr., H. Ghiasi, A. B.
Nesbum and S. L. Wechsler (1999). "A herpes simplex virus type 1 latency-
associated transcript mutant with increased virulence and reduced spontaneous
reactivation." Journal of Virology 73(2): 920-929.
Pemg, G. C., C. Jones, J. Ciacci-Zanella, M. Stone, G. Henderson, A. Yukht, S. M.
Slanina, F. M. Hofman, H. Ghiasi, A. B. Nesbum and S. L. Wechsler (2000).
"Virus-induced neuronal apoptosis blocked by the herpes simplex vims latency-
associated transcript." Science 287(5457): 1500-1503.
Pemg, G. C., B. Maguen, L. Jin, K. R. Mott, J. Kurylo, L. BenMohamed, A. Yukht, N.
Osorio, A. B. Nesbum, G. Henderson, M. Inman, C. Jones and S. L. Wechsler
(2002). "A novel herpes simplex vims type 1 transcript (AL-RNA) antisense to the
5' end of the latency associated transcript produces a protein in infected rabbits."
Journal of Virology 76(16): 8003-8010.
Perry, L. J. and D. J. McGeoch (1988). "The DNA sequences of the long repeat region
and adjoining parts of the long unique region in the genome of herpes simplex vims
type 1." Journal of General Virology 69(11): 2831-2846.
Qiagen, Inc. (2003). Qiagen Product Guide. Valencia, CA.
Rail, G. F., L. Mucke and M. B. A. Oldstone (1995). "Consequences of cytotoxic T
lymphocyte interaction with major histocompatibility complex class 1-expressing
neurons in vivo." Journal of Experimental Medicine 182: 1201-1212.
Rodahl, E. and J. G. Stevens (1992). "Differential accumulation of herpes simplex vims
type 1 latency-associated transcripts in sensory and autonomic ganglia." Virology
189(1): 385-388.
Roizman, B. and A. E. Sears (1996). Herpes Simplex Vimses and Their Replication.
Virology. B. N. Fields. New York, Raven Press, Ltd., 2: 1795-1841.
Sawtell, N. M. and R. L. Thompson (1992). "Rapid in vivo reactivation of herpes simplex
vims in latently infected murine ganglionic neurons after transient hyperthermia."
Journal of Virology 66(4): 2150-2156.
Shibata, S. and J. T. Lee (2003). "Characterization and quantitation of differential Tsix
transcripts: implications for Tsix function." Human Molecular Genetics 12(2): 125-
136.
Sippel, A. E., H. Saueressig, M. C. Huber, N. Faust and C. Bonifer (1997). Insulation of
transgenes from chromosomal position effects. Transgenic Animals Generation and
Use. L. M. Houdebine. Amsterdam, OPA.


97
6781 gaggtttttt aaagcaagta aaacctctac aaatgtggta tggctgatta tgatctctag
6841 tcaaggcact atacatcaaa tattccttat taaccccttt acaaattaaa aagctaaagg
6901 tacacaattt ttgagcatag ttattaatag cagacactct atgcctgtgt ggagtaagaa
6961 aaaacagtat gttatgatta taactgttat gcctacttat aaaggttaca gaatattttt
7021 ccataatttt cttgtatagc agtgcagctt tttcctttgt ggtgtaaata gcaaagcaag
7081 caagagttct attactaaac acagcatgac tcaaaaaact tagcaattct gaaggaaagt
7141 ccttggggtc ttctaccttt ctcttctttt ttggaggagt agaatgttga gagtcagcag
7201 tagcctcatc atcactagat ggcatttctt ctgagcaaaa caggttttcc tcattaaagg
7261 cattccacca ctgctcccat tcatcagttc cataggttgg aatctaaaat acacaaacaa
7321 ttagaatcag tagtttaaca cattatacac ttaaaaattt tatatttacc ttagagcttt
7381 aaatctctgt aggtagtttg tccaattatg tcacaccaca gaagtaaggt tccttcacaa
7441 agatcctcta gcgataccgt cgacctcgag ggggggcccg gtaccgagct cgaatt


LIST OF REFERENCES
Ahmed, M., M. Lock, C. G. Miller and N. W. Fraser (2002). "Regions of the herpes
simplex virus type 1 latency-associated transcript that protect cells from apoptosis
in vitro and protect neural cells in vivo." Journal of Virology 76(2): 717-729
Alvira, M. R., W. F. Goins, J. B. Cohen and J. Glorioso (1999). "Genetic studies
exposing the splicing events involved in herpes simplex virus type 1 latency-
associated transcript production during lytic and latent infection." Journal of
Virology 73(5): 3866-3876.
Anderson, J. M. and M. W. N. Nicholls (1972). "Herpes encephalitis in pregnancy."
British Medical Journal 1(800): 632.
Berthomme, H., J. Lokensgard, L. Yang, T. Margolis and L. T. Feldman (2000).
"Evidence for a bidirectional element located downstream from the herpes simplex
virus type 1 latency-associated promoter that increases its activity during latency."
Journal of Virology 74(8): 3613-3622.
Berthomme, H., J. Thomas, P. Texier, A. Epstein and L. T. Feldman (2001). "Enhancer
and long-term expression functions of herpes simplex virus type 1 latency-
associated promoter are both located in the same region." Journal of Virology
75(9): 4386-4393.
Bhattachaijee, P. S., R. K. Tran, M. E. Myles, K. Maruyama, A. Mallakin, D. C. Bloom
and J. M. Hill (2003). "Overlapping subdeletions within a 348-bp in the 5' exon of
the LAT region that facilitates epinephrine-induced reactivation of HSV-1 in the
rabbit ocular model do not further define a functional element." Virology 312(1):
151-158.
Bloom, D. C., G. B. Devi-Rao, J. M. Hill, J. G. Stevens and E. K. Wagner (1994).
"Molecular analysis of herpes simplex virus type 1 during epinephrine induced
reactivation of latently infected rabbits in vivo." Journal of Virology 68(3): 1283-
1292.
Bloom, D. C., J. M. Hill, E. K. Wagner, L. T. Feldman and J. G. Stevens (1996). "A 348-
bp region in the latency associated transcript facilitates herpes simplex virus type 1
reactivation." Journal of Virology 70: 2449-2459.
104


24
In addition to determining whether a transgenic mouse line expresses its
transgene, characterization of any new transgenic mouse line routinely requires
determining the copy number and the integration site of the transgene. The location of
the transgene in the genome may effect transcription of the transgene by position effects.
If the transgene inserts into a silenced region of the genome, it may not be expressed or
expressed at low levels due to the regulation of the surrounding region of DNA (Sippel et
al 1997).
The goal of this dissertation was to generate a HSV-1 LAT transgenic mouse to
study LAT regulation by cellular factors in the absence of viral cis and trans factors.
This chapter describes the construction, breeding strategy, and the initial characterization
of the transgene in the HSV-1 LAT transgenic mouse line.
Materials and Methods
Plasmid Used to Generate the Transgenic Mouse
The pLAT/LAT plasmid was generated to construct the transgene insert. A
portion of the HSV-1 strain 17+ latency associated transcript (LAT), including the Dral
site (corresponding to HSV-1 genome base pair 116,516) to the Aatll site (corresponding
to HSV-1 genome base pair 121,549), was ligated into a pBluescript backbone at the
Smal site. The SV40 poly A sequence from pNSE-Ex4 (a gift from G. Rail, The Fox
Chase Cancer Center) was removed using EcoRI and inserted at the Xbal site into the
pBluescript plasmid containing the LAT sequence. Figure 2-1 diagrams the region of the
LAT gene used in constructing the transgene as well as its location in the HSV genome.
The complete plasmid sequence and map is presented in Appendix A.


Copies / g
81
using real time PCR primers for the HSV polymerase. In figure 4-3 the amount of HSV
DNA present in ganglia of transgenic and non-transgenic infected mice, illustrated no
difference between the two groups (t= 0.1623, P= 0.8722). The mean for each group is
represented by a horizontal line. Scatter within the groups was expected because there is
some variability in the amount of virus infecting each mouse. Despite the expression of
the LAT from the transgenic mouse, there was no detectable difference in the amount of
establishment of HSV latency between the transgenic and non-transgenic mice, thus
expression of the LAT in trans did not affect the amount of HSV reaching the DRG and
establishing a latent infection.
1.00E+06
1.00E+05
1.00E+04
1.00E+03
1.00E+02
Figure 4-3. Quantitation of HSV-1 genomes present in mice infected with HSV-1 17+at
latent times post infection. Each symbol represents one mouse.
Reactivation from Latency in Transgenic Mice
The LAT also plays a role in reactivation from latency (Wagner, 1991; Bloom et
al., 1996b; Hill et al., 1996; Jarman et al., 2002). During reactivation, the virus initiates a
Positive
Negative


63
divided into three subpopulations, darkly stained or high expression (33%), weakly
stained or low expression (56%), and cytoplasmic stained (11%). Further studies are
needed to determine if these subpopulations coordinate with neuronal markers for
neuronal subpopulations.
Table 3-1. Quantitation of LAT Expressing Cells in Dorsal Root Ganglia by in situ
hybridization for the 5 LAT exon
Number
Positive
Percentage
Of Total
Latently
Infected1
204
25
Transgenic
Tissues
Totals2
709
65
Darkly
Stained
233
333
Weakly
Stained
399
56
Cytoplasmic
Stained
77
11
'Total neurons counted = 806 2Total neurons counted = 1095 3For the subsets of positive
neurons in the transgenic, percentage is of total positive transgenic neurons.
A significant finding of this study is that the 5 LAT expression pattern seen in the
transgenic DRG was not seen in other tissues of the transgenic mouse. A comparison of
other neuronal tissues of the transgenic mouse demonstrated a small amount of detectable
LAT expression in the thalamic neurons of the brain (figure 3-8 and figure 3-9) with
considerably less intensity than in DRG (compare figure 3-6b with figure 3-8 and 3-9).
Additionally, a small number of neurons in the spinal cord (figure 3-10) were expressing
LAT to levels comparable to that in the DRG. As with the DRG, further studies are
necessary to determine if these hybridization positive cells are from a specific population


49
acetic anhydride for 10 minutes with stirring then rinsed twice with water for 5 minutes
each. A final denaturing step in 95% deionized formamide with O.lx SSC incubated for
15 minutes at 70C followed by a 2.5 minutes rinse in ice cold O.lx SSC and 2.5 minutes
in a water rinse.
Preparation of hybridization probes
Probes were prepared from pATD 17 (nt 118,863 to 119,343) and pATD 19 (nt
119,628 to 119,975) plasmids, as diagrammed in figure 2-3, using a random hexamer
labeling kit. pATD 17 was digested with PstI and SphI and pATD 19 was digested with
EcoRI and Hindlll to remove the HSV DNA from the plasmid backbone. Both inserts
were purified on an agarose gel and the DNA recovered by freeze fracture. For the
labeling reaction, 100 ng of digested plasmid DNA was incubated with random
hexamers, S35 dCTP, cold dGTP, cold dTTP, cold dATP, and Klenow fragment overnight
at room temperature according to the random hexamer labeling kit (Roche)
specifications. Labeled probes were purified on a Sephadex G-50 spin column to remove
unincorporated nucleotides and quantitated by counting 1 pL of labeled probe on a liquid
scintillation counter.
Hybridization
The hybridization solution was prepared as follows: 1.5 x 105 cpm/site of the
labeled probe was ethanol precipitated with 10 pg of salmon sperm DNA, 1/50 volume
5M NaCl and 2 volumes ethanol and incubated at -80C for 15 minutes. The probe DNA
was pelleted by centrifuging for 30 minutes at 4C, the ethanol was removed, the pellet
dried briefly, and resuspended in 20 pL TE. Immediately before use, the probe was
heated to 100C for 5 minutes, followed by quenching on ice. Probes were diluted to 1.5


unit
unique long
unique short


106
Farrell, M. J., A. T. Dobson and L. T. Feldman (1991). "Herpes simplex virus latency-
associated transcript is a stable intron." Proceedings of the National Academy of
Sciences 88: 790-794.
Gary, L.W., J.M. Loutsch, J. M. Hill, E.K. Wagner and D.C. Bloom. In preparation.
Identification of a virulence function in herpes simplex virus type 1 mapping to
the latency-associated transcript locus.
Gesser, R. M, T. Valyi-Nagy and N. Fraser (1994). "Restricted herpes virus type 1 gene
expression within sensory neurons in the absence of functional B and T
lymphocytes." Virology 200: 791-795.
Goins, W. F., L. R. Sternberg, K. D. Croen, P. R. Krause, R. L. Hendricks, D. J. Fink, S.
E. Straus, M. Levine and J. C. Glorioso (1994). "A novel latency-active promoter is
contained within the herpes simplex virus type 1 UL flanking repeats." Journal of
Virology 68(4): 2239-2252.
Gordon, J. W., G. A. Scangos, D. J. Plotkin, J. A. Barbosa and F. H. Ruddle (1980).
"Genetic transformation of mouse embryos by microinjection of purified DNA."
Proceedings of the National Academy of Sciences 77(12): 7380-7384.
Gressens, P. and J. R. Martin (1994). "In situ polymerase chain reaction: localization of
HSV-2 DNA sequences in infections of the nervous system." Journal of Virology
Methods 46: 61-83.
Grnewald, K., P. Desai, D. C. Winkler, J. B. Heymann, D. M. Belnap, W. Baumeister
and A. L. Steven (2003). "Three-dimensional structure of herpes simplex virus
from cryo-electron tomography." Science 302: 1396-1398.
Halford, W. P. and P. A. Schaffer (2001). "ICP0 is required for efficient reactivation of
herpes simplex virus type 1 from neuronal latency." Journal of Virology 75(7):
3240-3249.
Halford, W. P., C. D. Kemp, J. A. Isler, D. J. Davido and P. Schaffer (2001). "ICP0,
ICP4, or VP 16 expressed from adenovirus vectors induces reactivation of latent
herpes simplex virus type 1 in primary cultures of latently infected trigeminal
ganglion cells." Journal of Virology 75(13): 6143-6153.
Hill, J. M., J. B. Dudley, Y. Shimomura and H. E. Kaufman (1986). "Quantitation and
kinetics of adrenergic induced HSV-1 ocular shedding." Current Eye Research 5:
241-246.


78
A standard curve was generated using HSV-1 genomic DNA of known copy
number ranging from 105 to 102 copies. Unknown samples were assayed using 50 ng of
DNA per reaction and were compared to the standard curve values for quantitation.
Explant Co-cultivation of Latently Infected DRG
Latently-infected transgenic and non-transgenic mice were euthanized and DRG
dissected as described above. DRG were cultured in MEM on with a RS cell monolayer
at 37C with 5% CO2 to detect reactivating virus. Every 48 hours, half of the media was
removed and replaced with fresh MEM to ensure the integrity of the monolayer. Cells
were monitored daily for 14 days for the presence of rounded, HSV infected RS cells.
Results
Expression of LAT in trans Does Not Detectably Alter the Course of an Acute HSV-
1 Infection in Mice
While the mouse footpad model of HSV-1 infection does not use the natural site of
HSV infection, it mimics the natural infection in that HSV can infect the epithelial
surface of the foot and travel along the sciatic nerve to reach the DRG. The reason that
the footpad model is extensively used to assess virulence properties of HSV-1 strains and
to study the progression of the acute infection is that it provides HSV-1 with a longer
path to travel through the nervous system until it reaches the brain. Therefore one can
sensitively assay the relative replication potential of different strains of HSV as it travels
from the foot, to the DRG, to the spinal cord and then to the brain.
To determine if expressing the LAT in the context of the transgenic mouse would
affect the course of the HSV-1 infection, we infected transgenic and non-transgenic mice
using the footpad model with wild-type HSV-1 strain 17+. The rationale for this
experiment is that if LAT is hypothesized to play a role in regulating HSV-1 gene


LAT copies / 18s RNA
55
A.
1.00E+06
1.00E+05
1 00E+04
1.00E+03
1.00E+02
1.00E+01
1.00E+00
Hypothalamus
Cerebellum
Cortex
Olfactory Bulb
Spinal Cord
Dorsal Root Ganglia
Trigeminal Ganglia
Skin
Foot
Heart
Kidney
Lung
Eye
Liver
Spleen
Intestine
B.
1.00E+06 i
1 OOE+05
1.00E+00
DRG Acute HSV-1
0 DRG Latent HSV-1
Figure 3-2. Expression of LAT normalized tol8s RNA. A. Taking into account the
different cell densities in different tissues, LAT expression in transgenic
tissues was compared on a per cell basis by dividing the copies of LAT by 108
copies of 18s RNA in each tissue. n=4. B. Comparison of the amount of LAT
in infected DRG at acute and latent times post infection normalized to copies
of 18s RNA.


8
Control of the immediate early genes is primarily under the direction of cellular
transcription factors although viral binding sites are also present (Figure 1-3). In addition
to a TATA box, immediate early promoters contain several SP1 binding sites and binding
sites for the VP 16 viral activator protein. The ICP4 binding sites in the promoter allow
for down regulation of these genes by ICP4 as the course of infection progresses.
Early Genes
Early P genes include genes involved in viral replication such as the viral
polymerase and thymidine kinase. These genes show peak expression 5-7 hours post
infection. Despite containing only cellular elements in their promoters including SP1
sites, CAAT and TATA boxes (Figure 1-3), early genes require the viral ICP4 protein to
stimulate expression through interaction with the TATA element (reviewed in Weir,
2001).
Late Genes
Structural proteins such as the glycoproteins and tegument proteins make up the
group of late y genes which are expressed only after viral replication has occurred
(Roizman and Sears, 1996; Wagner et al., 1998). Late genes are divided into two sub
classes, yl and y2. yl genes are leaky lates and can be transcribed in small quantities
before viral DNA synthesis has occurred. The y2 class consists of strictly late genes and
dependent upon viral replication.
Promoter sequences for the late genes are much less complicated than the
promoters for the two preceding kinetic classes and are limited to a TATA element and a
portion of the 5 noncoding region of the transcript acting as an enhancer for high levels
of expression (Levine et al., 1990). Expression of some viral genes are required for late


72
In other transgenic tissues, LAT expression was not detectable by in situ
hybridization with either the 5 LAT exon or LAT intron probes. The kidney and foot
both had transgene expression when measured by RT-PCR for the 5 exon but expression
was not seen by in situ hybridization. This could suggest that in some tissues LAT
expression is leaky in all cells and thus below the level of sensitivity for the in situ but, in
the neuronal tissues expression is confined to a subset of neurons resulting in the ability
to detect the expression by in situ hybridization. The small number of cells expressing
the LAT transgene in the spinal cord appears to support this theory in addition to the
expression in the DRG. These findings may suggest that LAT expression is more tightly
and dramatically regulated in sensory neurons.


38
A. Promar DB60, 61 M int M2 Probe
315
Us*
149
101
H20 LATTg H20 LAT Tg H20 LAT Tg H20 LAT Tg
B.
AG29, 30
228'
H20 LATTg
C.
489
AG29, 31
H20 LATTg
Figure 2-4. PCR mapping the transgene insert. A. Four primer sets, Promar, DB60&61,
M int, and M2 Probe, all present in both the LAT plasmid (LAT) and
transgenic mouse (Tg). FLO lanes are no template control. B. Primer set AG
29&30 present in both LAT plasmid and transgenic mouse. C. Primer set
AG29&31 present in LAT plasmid but not transgenic mouse. The location of
the primer sets in the HSV genome are diagrammed in figure 2-3.


62
C.
Figure 3-6 (contd). expression. Red arrow indicates cytoplasmic LAT expression.
Arrows in C point out the neurons and axons of the DRG.
Figure 3-7. In situ hybridization for LAT intron in transgenic DRG. Black arrows
represent nuclear localization of hybridization at both high and low levels of
expression.


28
Transgenic breeder cages contained one male with up to three females. Males
were kept in the same cage with the breeder females for one week to ensure pregnancy.
At approximately 18 days post breeding, females were separated into individual cages to
deliver their litters. Pregnant females and newborns were monitored at least twice daily
for difficulty with delivery and/or nurturing. Pups remained with their mother for three
weeks until they were weaned and sex-separated. Genotyping of the weanlings was
performed approximately one week after weaning.
Backcrosses continued until obtaining the FI0 generation at which time the
transgenic background was considered to be genetically C57B1/6 and were crossed with
F10 littermates to generate homozygous transgenics. All mice used in the studies
described here are heterozygous for the LAT transgene and were of at least the F4
generation.
Determination of Transgene Copy Number
Slot blot hybridization
Slot blot hybridization was used to determine transgene copy number. DNA from
tail clips of weanlings was isolated and quantitated as described above for genotyping.
For each sample 10 pg DNA, 15 pL 3 M NaOH, and 130 pL TE in a final volume of 175
pL was vortexed and incubated at 65C for 30 minutes. During the incubation, the slot
blot apparatus (Gibco BRL) was loaded with Zeta Probe membrane (Bio Rad) pre-wet in
water followed by 15x SSC. Incubated samples were ice-quenched and 165 pL of 2 M
ammonium acetate added just prior to loading into the blot apparatus. Vacuum was
applied after all the samples had been loaded.


To my husband, Karl, who is my best cheerleader,
and my son, Seth, who is too young to understand.


35
samples to compare the LAT transgene to a single copy of the cellular control for both
male and female samples. Table 2-1 contains the PCR data for the cellular and LAT PCR
reactions. Although the copy number determined by this analysis is less than one, when
taking into account the error of the samples, and the fact that there has to be an integer
number of copies, the most likely interpretation is that there is only a single copy of LAT
present in these mice.
TABLE 2-1 Determination of transgenic copy number by real-time PCR.
Xist Copies1
LAT copies
LAT/Xist
1
3.03 x 10J
1.28 x 10J
0.422+/-0.109
2
1.56 x 10J
5.43 x 10'
0.348 +/- 0.209
3
1.47 x 10J
4.30 x 102
0.293+/-0.193
4
2.69 x 10J
2.80 x 10J
1.041 +/- 0.306
5
3.39 x 10J
5.83 x 10J
1.720+/- 0.385
Average
0.765 +/- 0.240
1 +/- 730 copies
While mosaicism is possible in up to 30% of transgene insertions (Wilkie et al.,
1986), the genetic inheritance from the breeding of these mice does not suggest that a
mosaic is present. In a mosaic animal, the transgene inserted into the genome after the
first cell division and is therefore not present in the genome of each cell in the animal. If
this were the case, only a portion of the germ cells would contain the transgene and thus
less than 50% of the offspring of a transgenic and wild type mating would carry the
transgene. With almost 500 offspring from transgenic and wild type matings to date, we
have not seen evidence consistent with mosaicism in the LAT transgenic mouse.
Mapping of the Transgene Insert
Generation of the transgenic founder mouse was more difficult than usual,
requiring three separate sets of injections to obtain a single founder. Screening for the


48
phosphate buffered saline (PBS) overnight at 4C then transferred to 70% ethanol.
Tissues were embedded in paraffin blocks and thin sections cut by the pathology core
laboratory at the University of Florida. To remove paraffin from cut sections, slides were
treated three times for 2 minutes each in Xylenes and then washed twice in 100% ethanol
followed by 95%, 70% and 50% ethanol, each for 2 minutes.
Prior to hybridization, slides were treated to remove excess protein and the
cellular DNA in the following manner. Fixed tissue was denatured in 0.2M HC1 at room
temperature for 20 minutes, followed by 2 rinses in distilled water 5 minutes each at
room temperature, incubated at 70C for 30 minutes in 2x SSC, followed by 2 rinses in
water 5 minutes each at room temperature. The slides were then treated with Proteinase
K (1 pg in 0.02 M Tris pH 7.4, 0.002 M CaC^) at 37C for 15 minutes followed by 2
rinses in water 5 minutes each.
DNase pretreatment was performed under treated coverslips. Briefly, coverslips
were acid washed in 1 M HC1 for 20 minutes then rinsed 3 times in water for 5 minutes
each and 3 times in 95% ethanol for 5 minutes each. A final wash for 5 minutes in 100%
ethanol dehydrated the coverslips which were then baked for 5 hours in a drying oven at
220C. For each site, 30 pL of 12U RNase-free DNase (Stratagene) in 20 mM Tris pH
7.4, 10 mM MgCb was added and coverslipped. Slides were then incubated at 37C for 1
hour in a humid chamber. Tissues were rinsed extensively (5x) in 2x SSC 5 minutes each
and post fixed in freshly made 5% paraformaldehyde, 0.3 N NaOH in phosphate buffered
saline pH 7 for 2 hours in the dark. Excess fixative was removed by washing 3 times in
2x SSC, 5 minutes each and twice in water 5 minutes each. To reduce non-specific
hybridization, samples were acetylated in 0.1 M triethanolamine pH 8 with 0.25% vol/vol


6
HSV Gene Regulation
Immediate Early Genes
The alpha genes, also known as immediate early, peak in expression 2-4 hours
post infection and include infected cell proteins (ICP) 0, 4, 22, 27, and 47. Transcription
of the alpha genes is initiated by a complex including the HSV-1 tegument protein VP 16
(also known as aTIF) binding to the TAATGARAT octamer located in the immediate
early promoters (Mackem and Roizman, 1982). Of the immediate early genes, ICP4 is a
strong trans-activator of the early and late viral genes and is essential for viral replication.
ICP4 binds to both consensus ATCGTC and non-consensus motifs in several other HSV
gene promoters or 5untranslated regions. The trans activation function is promoted by
ICP4 binding to DNA as well as the transcription factors TBP and TFIIB (Smith et al.,
1993).
While not essential, ICPO is believed to have multiple functions, including that of
a non-specific transactivator (Cai and Schaffer, 1992) and a disruptor of ND10 regions in
the nucleus (Davido et al., 2003). The exact purpose of ND10 structures in the nucleus
has not been determined, but they may be involved in replication and during the infection
a number of HSV proteins interact with ND10. Other studies suggest that ICPO is
involved in reactivation from latency since the latency associated transcripts are
expressed from the opposing strand of DNA in the same region as ICPO. Expressing
ICPO in trans from an adenovirus vector was sufficient to induce reactivation in latently
infected primary trigeminal ganglia cultures (Halford et al., 2001). These data support the
theory of LAT acting as a switch to turn on ICPO during reactivation. The involvement
of ICPO in reactivation will be discussed further in the section on LAT function.


70
with care since a number of cellular genes exhibit varied expression in different cell
types. In our studies these differences would have had an effect on the quantification of
LAT expression in the different tissue types. The 18s RNA species is a cellular
housekeeping gene that is considered to be constant in all cells (Thellin et al., 1999)
allowing for comparison between tissues.
Similar to the per weight analysis, LAT expression had no significant difference
between tissues. Despite of the inability to detect a difference in expression by either
analysis, the 18s RNA comparison appeared to be a more accurate overall representation
at the cellular level. The per weight analysis of expression would be sufficient for more
general comparisons but is not quantitative when expression may be present in only
certain cell types of a complex tissue.
There was a statistically significant difference between the amount of LAT in the
acute infection and the amount of LAT in the transgenic DRG when compared on a per
18s basis. The comparison with the latent infected DRG was not quite significant but
there was more LAT produced in the infected tissue than in the transgenic DRG. In
combination with the in situ data which suggests that LAT is not being produced in every
cell of the DRG, it is not hard to conceive that there could be more LAT in the infected
tissue. Further studies are needed to determine if this is the case, however, the 18s RNA
comparison remains a valid comparison between the non-infected tissues of the
transgenic mouse since they are comparing LAT that is being controlled in the same
manner.
We have also shown that LAT was not expressed in an age dependent manner.
Studies of immediate early HSV genes in transgenic mice determined that both ICPO and


107
Hill, J. M., J. B. Maggioncalda, H. H. Garza, Y.-H. Su, N. W. Fraser and T. M. Block
(1996). "In vivo epinephrine reactivation of ocular herpes simplex type 1 (HSV-1)
in the rabbit is correlated to a 370 base pair region located between the promoter
and the 5' end of the 2.0 kb latency-associated transcript (LAT)." Journal of
Virology 70: 7270-7274.
Hogan, B., F. Constantini and E. Lacy (1986). Manipulating the mouse genome. Cold
Spring Harbor, NY, Cold Spring Harbor Laboratory Press.
Jackson, S. A. and N. A. DeLuca (2003). "Relationship of herpes simplex virus genome
configuration to productive and persistent infections." Proceedings of the National
Academy of Sciences 100(13): 7871-7876.
Jarman, R. G., E. K. Wagner and D. C. Bloom (1999). "LAT expression during an acute
HSV infection in the mouse." Virology 262: 384-397.
Jarman, R. G., J. M. Loutsch, G. B. Devi-Rao, M. E. Marquart, M. P. Banaszak, X.
Zheng, J. M. Hill, E. K. Wagner and D. C. Bloom (2002). "The region of the HSV-
1 latency-associated transcript required for epinephrine-induced reactivation in the
rabbit does not include the 2.0 kb intron." Virology 292: 59-69.
Kastrukoff, L. F., A. S. Lau and M. L. Puterman (1986). "Genetics of natural resistance
to herpes simplex virus type 1 latent infection of the peripheral nervous system in
mice." Journal of General Virology 67: 613-621.
Kenny, J. J., F. C. Krebs, H. T. Hartle, A. E. Gartner, B. Chatton, J. M. Leiden, J. P.
Hoeffler, P. C. Weber and B. Wigdahl (1994). "Identification of a second
ATF/CREB-like element in the herpes simplex virus type 1 (HSV-1) latency-
associated transcript (LAT) promoter." Virology 200: 220-235.
Koelle, D. M. and L. Corey (2003). "Recent progress in herpes simplex virus
immunobiology and vaccine research." Clinical Microbiology Reviews 16(1): 96-
113.
Kubat, N. J., R. K. Tran, P. McAnany and D. Bloom (2004). "Specific histone tail
modification and not DNA methylation is a determinant of HSV-1 latent gene
expression." Journal of Virology 78(3): 1139-1149.
Levine, M., A. Krikos, J. C. Glorioso and F. L. Homa (1990). "Regulation of expression
of the glycoprotein genes of herpes simplex virus type 1 (HSV-1)." Advances in
Experimental Medicine and Biology 278: 151-164.
Loiacono, C. M., R. Myers and W. J. Mitchell (2002). "Neurons differentially activate the
herpes simplex virus type 1 immediate-early gene ICP0 and ICP27 promoters in
transgenic mice." Journal of Virology 76(5): 2449-2459.


15
reactivation therefore, the act of expressing some LAT is not sufficient for reactivation,
and presumably either specific RNA sequences or cis acting DNA elements located
within the 5 exon are important for reactivation (Bloom et al., 1996; Bhattachaijee et ah,
2003). The 5 exon region and the LAT core promoter are referred to as the reactivation
critical region (rcr).
Since expression of RNA itself is not sufficient for reactivation, other
mechanisms of LAT action have been proposed. The regulation of reactivation and/or
establishment may be at the DNA level. Many cellular genes use methylation of CpG
islands as an epigenetic method of regulating transcription. In these genes, a methyl
group is added to the cytosine of the DNA at regions to be either silenced or transcribed.
Previous studies determined that methylation was not present in the HSV genome as a
whole, but did not look at specific promoter regions of the genome. Using bisulfite
analysis Kubat et ah (2004) determined that there is no pattern of methylation as a form
of regulating HSV latent transcription.
These data suggest that instead of methylation, the virus uses the DNA chromatin
structure and its association with specific histone proteins as a means of regulation.
Further studies indicate that there is a difference in the chromatin acetylation pattern
during latency when comparing the LAT promoter to other acute HSV promoters (Kubat
et ah, 2004).
Virulence
Several LAT deletion mutants have an effect on virulence in either mice, rabbits,
or both experimental systems. The dLATl .5 virus contains a 5exon deletion of ~1600bp
and is increased for virulence in mice. Increased virulence in rabbits and decreased
virulence in mice were seen with LAT2.9A which contains only a 371 bp deletion in the


4
the surface. The capsid of the virus is icosahedral in shape and the space between the
envelope and the capsid, known as the tegument, contains proteins involved in the initial
stages of infection. A diagram of the HSV-1 virion structure in Figure 1-1 illustrates the
enveloped capsid with glycoproteins present on the outer surface of the envelope
(Roizman and Sears, 1996). Grnewald et al. (2003) were able to use electron
microscopy to clarify the HSV virion structure illustrating that the capsid arrangement in
the tegument is asymmetrical and that the some 750 glycoprotein spikes present on each
virion are arranged in an organized manner on the envelope surface.
Figure 1-1. Diagram of the HSV-1 virion. HSV is an enveloped virus with an
icosahedral capsid and glycoproteins present on the envelope surface
(Roizman and Sears, 1996).
The HSV infection is characterized by three phases. During the initial infection or
establishment phase, lesions are seen primarily on the oral mucosa. The virus then enters
sensory nerve termini and is transported to the sensory ganglia where it establishes a
latent infection. The latent phase of infection is characterized by transcriptional activity
from a single viral region encoding the latency associated transcripts (LAT), while the


34
quantity of transgenic-positive tail DNA was compared to the hybridization signal
generated from a known number of copies of LAT plasmid DNA spiked into a negative
tail DNA sample to represent increasing copies per cell of the transgene. Comparison of
the transgenic-positive and transgenic-negative mouse DNA to the control samples
indicated that there was a low number of copies present in the transgenic mouse (figure
2-2). The difficulty in distinguishing between the positive and negative samples may
have been due to an error in dilution of the standards since this involved a
spectrophormetrically determined quantity.
Pos
Neg
1 copy
>2 copies
15 copies
Figure 2-2. HSV transgene copy number determination by slot blot hybridization
analysis. Tail DNA from a transgenic (pos) and non-transgenic (neg) mouse
was compared to known copies of a plasmid containing the transgene, in the
background of tail DNA from a non-transgenic mouse.
Hybridization is not a reliably quantitative method, particularly with low copy
numbers, thus to more accurately evaluate the number of LAT transgenes inserted we
switched to real time PCR. For this system of analysis, a cellular gene of known copy
number, Xist, was compared to the number of copies of LAT in transgenic tail DNA.
Since Xist is located on the X chromosome, the sex of the animal was taken into
consideration and the copies of Xist for female mice was divided by 2 to standardize


57
expression between the transgenic and infected tissues are minimal. This will be
discussed further in the discussion section.
Analysis of Transgene Expression as a Function of Age
Previous studies with HSV-1 transgenic mice expressing reporters behind ICPO
and ICP4 promoters demonstrated a difference in expression of these two lytic gene
promoters as a function of the age of the mice (Mitchell, 1995; Loiacono et al., 2002).
To determine if the LAT transgenic mouse exhibited an age related expression pattern,
we compared the amount of LAT RNA present in selected tissues at 1 day, 1 month, 2
months, and 18 months of age. A representative sample of these data is presented in
figures 3-3 and 3-4 while the profile for the entire tissue sampling is located in Appendix
C. There was no age related general trend of LAT expression among all of the tissues
tested. When compared by weight, the spinal cord (P= 0.3303), DRG (P= 0.6908), TG
(P= 0.4050), skin (P= 0.1728), and feet (P= 0.0657) had no significant difference in the
amount of LAT transgene expressed at different ages. This remained the same when
comparing LAT expression on a per cell basis using 18s RNA as a reference, with the P-
values of the spinal cord (P= 0.2859), DRG (P= 0.4803), TG (P= 0.2429), skin (P=
0.5305), and feet (P= 0.5707) indicating a lack of significance (figure 3-4).


68
Figure 3-11. In situ hybridization of transgenic foot. A. LAT 5 exon probe B. LAT
intron probe. There was no hybridization signal with either probe in the LAT
transgenic foot.


brain, skin, liver, and kidney. Additionally, in situ hybridization indicates that expression
of the transgene in the DRG is limited to a subset of cells, similar to what occurs during a
natural HSV infection.
During HSV infection of the transgenic mouse, expression of the transgene has no
effect on the amount of virus produced during the acute infection in feet, DRG, or spinal
cord. Since LAT has been implicated as playing a role in establishment and reactivation
of latency, we sought to determine whether expression of the transgene affected the
ability of the wild type virus to establish and reactivate from a latent infection. PCR for
HSV DNA in DRG detected no difference between transgenic and non-transgenic mice
following establishment of HSV latency. Reactivation by explant co-cultivation of
latently infected DRG exhibited a similar pattern of reactivation for both transgenic and
non-transgenic mice. Taken together, the infection data suggest that LAT is not
functioning in trans to regulate the HSV infection. This suggests that LAT acts in cis to
regulate reactivation.
xv


64
Hippocampus
jk 7 vi*
Thalamus
Figure 3-8. In situ hybridization for LAT 5exon in brain. A. Transgenic brain lOx B
Transgenic brain magnifying the thalamic region 40x.


5
remainder of the genome is silenced. Latent infection is interrupted by periods of
reactivation where productive infection resumes and the virus travels through the nerve
axons back to the initial site of infection where lesions are seen on the skin surface
(Roizman and Sears, 1996).
The HSV-1 genome consists of approximately 152 kilobases (kb) of double-
stranded DNA. The genome (Figure 1-2) consists of two unique regions, the unique long
(Ul) and the unique short (Us), each flanked by two repeated regions, the long repeat
(Rl) and the short repeat (Rs). The repeat regions are joined together by the a
sequence, a 500bp highly
rl ul rl rs us rs
Figure 1-2. Diagram of the HSV-1 genome. HSV possesses a double-stranded DNA
genome that is organized into two repeat regions, the repeat long (Rl) and the
repeat short (Rs), each flanking unique regions, the unique long (Ul) and the
unique short (Us). The repeat regions are joined together by the a sequence.
Also shown is the region encoding the latency associated transcripts (LAT).
conserved region of small repetitive elements. HSV genes are identified by their relative
time of expression rather than by their position in the genome. The classes of expression
are alpha (a), beta (p), and gamma (y).
During the latent infection, the viral genome associates with cellular histone
proteins and circularizes to form an episome, thus existing as a mini-chromosome in
the infected cell. It has recently been determined that episome formation occurs in the
absence of lytic HSV gene products and the ICPO gene may be involved in the prevention
of circularization (Jackson and DeLuca, 2003).


61
A.
B.
.JB- 'y-'T-.: $kM&k .
. TV .>** *,.v v'o": **
- 4&
^asr
F2fr
4
^ *
% ..c
n~,
a
1*^/1
*CV- ,
,v *v ** / .; ** *9**, ,
& cJr- . '*** 4;
f #** Ir'
V' :5 *Se
~w
W £ 4
r*r t: \
Figure 3-6. In situ hybridization for 5 LAT exon. A. Latently infected dorsal root
ganglia. B. Transgenic positive dorsal root ganglia. C. Transgenic negative
dorsal root ganglia. Black arrows represent hybridization of nuclear LAT


14
the infection. Separation of the establishment and reactivation functions was determined
by a number of LAT mutants that maintain the ability to establish latency but do not
reactivate (Bloom et al., 1994; Bloom et al., 1996; Wang et al., 1997).
These viruses delete either the core promoter sequences of LAT or a region of the
LAT 5 exon. Another LAT mutant, containing a large deletion encompassing both the
LAT promoter and 827 bp of the 5exon, established 75% fewer latent infections than its
wild type parent virus. It was predicted that this reduction may be due to an increase in
neuronal cell death in the ganglia (Pemg et al., 1994; Thompson and Sawtell, 2001).
Since this virus contains deletions of both LAP1 and LAP2, and is phenotypically distinct
from a LAP1 mutant, further studies are needed to determine if the increase in neuronal
cell death is related to multiple but genetically separable LAT functions.
Reactivation is typically related to a stress event for the host. In the rabbit eye
model, reactivation is seen after iontophoresis of epinephrine onto the eye surface. In the
mouse thermal stress model, reactivation of HSV is seen after an increase in basal body
temperature. On a cellular level, the mechanism by which stress is translated to
reactivation is not known.
Deletion of the LAT core promoter eliminates the ability to reactivate, but viral
DNA is still detected in neuronal ganglia. In addition to the LAT promoter, deletions of
regions downstream of the transcription start site and extending into the intron have been
shown to be important in HSV reactivation. The specific function of this region remains
unknown, but deletions of a 348 bp fragment as well as a 371 bp Styl fragment located
within the region result in reduced reactivation in the rabbit model (Bloom et al., 1996;
Hill et al., 1996; Jarman et al., 2002). Smaller deletions in this region do not affect


21
includes determination of the transgene copy number, mapping the transgene insert and
gross tissue-level expression studies.
Expression of LAT in trans
Since the LAT transgene is being controlled by the native LAT promoter and the
region of the promoter shown to contain neuronal specific elements was included in the
sequence inserted, it was hypothesized that LAT would be expressed in neuronal tissues.
Data from the HSV-2 transgenic mouse suggests that LAT can be expressed in non
neuronal cells as well, although the expression was not quantitated (Wang et al., 2001).
In this study, quantitative RT-PCR was employed to determine if neuronal cells could
more efficiently produce the LAT transcript than non-neuronal cells. In addition to
quantitative RT-PCR of RNA extracted from whole tissues, in situ hybridization
techniques were used to determine if expression is from all cells or a subset of cells.
Infections
Effect of LAT on the course of infection
It is known that in the context of the HSV genome LAT is expressed in neuronal
cells during latency. It was possible that expressing LAT prior to the infection, in trans,
could have an effect on the course of infection, such as altering the establishment of
latency, or the ability of the virus to reactivate from latency. To study these effects,
transgenic mice and their non transgenic littermates were infected with wild type 17+
HSV-1. Similar to the observations made in the case of the HSV-2 mouse, we
hypothesized that expressing LAT in trans would not alter the HSV infection, and that
during a natural HSV-1 infection, LAT functions in cis on the HSV genome.


37
LAT Promoter Intron
Dral
oo

£
K)
Aatn
Promar
00 00
- w
*
O Vi
= ATO 17
**
I ATD19
¡
X
fi
vO
X
"to
b
O
to
sO
O'
a
o
to
DB60&61
X vO
<
X o
X w
X vj
> >
Mint AG29&30
to to to
p p -
'o oo o
vO vO ^
0 00 A
to
to
vl
to
M2 Probe
to
p
'0
£
oo
to
o
3v
u
LPro
5LAT

-
00 00
vO so
w V
w w
vO 00
W vo
vO v|
* o
AG29&31
to Z
Figure 2-3. Mapping of the LAT transgene in the LAT transgenic mouse. The blue lines
represent the location of hybridization probes positive with the indicated LAT
regions. Black arrows depict primers used for conventional PCR analysis
positive for the transgene, and primers used for real time PCR analyses are
shown in red. Illustrated in green are conventional PCR primers that were
positive in reactions with the transgenic plasmid but not in reactions
containing DNA from the transgenic mouse suggesting that this region has
been deleted.


2
HSV infection is particularly dangerous in immunocompromised individuals.
Due to the inability to mount an immune response to the virus, these patients may
develop a number of more severe symptoms such as keratitus, which can lead to
blindness (Whitley, 1990). Newborns exposed to primary infection or reactivating HSV
at birth are susceptible to systemic infection that could result in fatal encephalitis
(Anderson and Nicholls, 1972).
Current treatments for HSV infection include several nucleoside analogs in either
topical or oral forms that reduce the severity of reactivations and shorten the duration of
lesions. Vaccines have been developed using peptides, attenuated viruses, and killed
viruses, all of which provided limited protection against recurrences. No cure is currently
available for HSV infection (Koelle and Corey, 2003).
Immune Response to HSV
The immune response to HSV-1 involves both specific and non-specific
mechanisms. In the initial stages of infection, CD4+ cells activate macrophages and
produce IFNy. The activated macrophages produce other cytokines to affect other
immune cells. Later in the immune response, CD8+ cytotoxic lymphocytes and antibody
producing B cells provide specific immunity that helps to clear virally infected cells
(Whitley, 1996).
Like other viruses, HSV has developed methods to evade the immune response.
For example, it establishes latency in an immune privileged site neurons do not
normally express MHC class I or II. This site of latency greatly reduces the likelihood of
CTL-mediated destruction of the host cell (Ward and Roizman, 1998). An example of
the ability of HSV to evade the humoral immune response is gC, an HSV virion


60
or lighter stained region within the neurons and the nucleolus seen as a gray circle within
the nucleus of some neurons.
The DRG is the primary site of LAT expression during the HSV infection
following footpad inoculation. Figure 3-6a illustrates the nuclear localization of
expression of the LAT 5 exon during the latent infection, marked by black arrows.
Surprisingly, in the transgenic DRG there were a subset of neurons that express LAT
with a different localization pattern than the infected DRG (compare figure 3-6a black
arrows with figure 3-6b red arrow) and some of the expression appears to be cytoplasmic.
This sub-population was in addition to the nuclear staining cells (figure 3-6b black
arrows) in the transgenic tissues that have the same pattern as the HSV infected DRG. A
non-transgenic mouse exhibited only background signal in this experiment (figure 3-6c).
When probed for the LAT intron, transgenic DRG showed the nuclear localization of
high levels of expression and low levels of expression in neurons as seen in Figure 3-7.
The cytoplasmic localization of LAT was not detected with the intron probe.
Neurons were counted to quantitate the positive sub-populations of neurons for
both the infected and the transgenic tissues with the 5 exon probe. During the HSV
infection LAT has been shown to be expressed in approximately one third of latently
infected neurons (Gressens and Martin, 1994; Maggioncalda et al., 1996). The data
presented here illustrated that LAT was being expressed in slightly more than two thirds
of transgenic neurons compared to just less than one third of neurons in infected dorsal
root ganglia (Table 3-1). Additionally, the transgenic tissue expression can be further


103
1.00E+07
1.00E+06
Z 1.00E+05
a£,
zr¡
* 1.00E+04
'I 1.00E+03
o
1.00E+02
1.00E+01
1 Day Old
I Month Old
2 Month Old
18 Month Old
^
V ^ ^
Figure C-4. Expression of the LAT transgene in non-neural tissues represented as copies
per 18s RNA.
The non-neural tissues were not statistically different between the age groups
when normalized to 18s RNA. Skin (P= 0.5305), foot (P= 0.5707), heart (P= 0.2801),
kidney (P= 0.5286), lung (P= 0.1606), eye (P=0.4662), liver (P= 0.3247), spleen (P=
0.4737), and intestine (P= 0.2770).
Among all of the tissues tested at the four age groups, only the foot was close to
having a significant age dependent expression pattern. If more mice were sampled it is
possible that the expression in the foot would be age dependent on a per weight basis.
Due to the fact that the expression in the foot when compared on per 18s RNA basis was
not significant, there is probably no scientific merit to difference in expression in the foot
especially since the foot consists of many different cell types including the bone and
muscles. Thus, there is no age dependent expression of the LAT transgene in these
tissues.


79
expression, expression of LAT prior to the HSV-1 infection might affect the outcome of
the acute infection, if could function in irons. Following footpad infection, tissues along
the path of HSV infection were assayed for amounts of infectious virus present at acute
times post infection, days one to four (figure 4-1). There was no significant difference
between the transgenic and non-transgenic mice at any of the four time points tested, day
1 P= 0.3501, day 2 P= 0.2403, day 3 P= 0.5476, and day 4 P= 0.5519. Similarly, the
amount of infectious virus in the DRG at acute times post infection shown in figure 4-2,
exhibited no significant difference between transgenic and non-transgenic mice, day 2
P=0.7364, day 3 P= 0.4309, and day 4 P= 0.3735. These data suggest that LAT was not
1.00E+08
1.00E+07
1.00E+06
1.00E+05
GO
3 1.00E+04
Cl
1.00E+03
1.00E+02
1.00E+01
1.00E+00
Day 1 Day 2 Day 3 Day 4
Figure 4-1. Relative amounts of infectious virus in the feet of transgenic and non-
transgenic mice infected with HSV-1 strain 17+ during acute times post
infection. n= 4


18
in productively infected PC-12 cells in culture using RT-PCR, and can not been detected
in vivo.
LAT also has a repressive function. A LAT mutant which had reduced LAT
expression exhibited an increase in the amount of ICP4 and thymidine kinase expression
compared to wild type infection (Chen et al., 1997). A possible mechanism for this
repressive function may be explained by regions of sequence homology to Xist
suggesting that LAT may function to paint the HSV chromosome to silence it similar to
Xist painting the inactive X chromosome in mammalian cells (Bloom et ah, 1996).
The HSV LAT region encompasses a number of transcripts present on both
strands of DNA. The various functions for LAT presented here may be important at
different times during the course of HSV infection, and some may work in combination
with other viral functions making them difficult to phenotypically dissect in the context
of the virus. It is also possible that some of these functions are not manifest during the in
vivo infection since they have been discovered and tested in cell culture systems only.
This complexity of dissecting LAT functions provides the basis for generating a
transgenic mouse containing this region of LAT DNA to further study its functions in the
absence of the HSV genome and its contributed cis and trans acting viral functions.
Use of Transgenics to Study Disease
Expression of Acute Genes in Transgenic Mice
Transgenic technology has been used to study the roles of genes out of their
native context. To generate a transgenic animal, the gene of interest is injected into the
single cell fertilized oocyte nucleus typically of mice, although other species have been
used as well. By injecting the single cell, the transgene is able to be integrated and
replicated with each cell division and is then present in every cell of the animal. The


94
2641 cggtcacgct gcgcgtaacc accacacccg ccgcgcttaa tgcgccgcta cagggcgcgt
2701 cccattcgcc attcaggctg cgcaactgtt gggaagggcg atcggtgcgg gcctcttcgc
2761 tattacgcca gctggcgaaa gggggatgtg ctgcaaggcg attaagttgg gtaacgccag
2821 ggttttccca gtcacgacgt tgtaaaacga cggccagtga attgtaatac gactcactat
2881 agggcgaatt gggtaccggg ccccccctcg aggtcgacgg tatcgataag cttgatatcg
2941 aattcctgca gcccaaataa accaatgtcg gaataaacaa acacaaacac ccgcgacggg
3001 gggacggagg ggacggaggg agggggtgac gggggacggg aacagacaca aaaacaacca
3061 caaaaaacaa ccacccaccg acacccccac cccagtctcc tcgccttctc ccacccaccc
3121 cacgccccca ctgagcccgg tcgatcgacg agcacccccg cccacgcccc cgcccctgcc
3181 ccggcgaccc ccggcccgca cgatcccgac aacaataaca accccaacgg aaagcggcgg
3241 ggtgttgggg gaggcgagga acaaccgagg ggaacggggg atggaaggac gggaagtgga
3301 agtcctgata cccatcctac acccccctgc cttccaccct ccggcccccc gcgagtccac
3361 ccgccggccg gctaccgaga ccgaacacgg cggccgccgc agccgccgca gccgccgccg
3421 acaccgcaga gccggcgcgc gcactcacaa gcggcagagg cagaaaggcc cagagtcatt
3481 gtttatgtgg ccgcgggcca gcagacggcc cgcgacaccc cccccccgcc cgtgtgggta
3541 tccggccccc cgccccgcgc cggtccatta agggcgcgcg tgcccgcgag atatcaatcc
3601 gttaagtgct ctgcagacag gggcaccgcg cccggaaatc cattaggccg cagacgagga
3661 aaataaaatt acatcaccta cccacgtggt gctgtggcct gtttttgctg cgtcatctca
3721 gcctttataa aagcgggggc gcggccgtgc cgatcgcggg tggtgcgaaa gactttccgg
3781 gcgcgtccgg gtgccgcggc tctccgggcc cccctgcagc cggggcggcc aaggggcgtc
3841 ggcgacatcc tccccctaag cgccggccgg ccgctggtct gttttttcgt tttccccgtt
3901 tcgggggtgg tgggggttgc ggtttctgtt tctttaaccc gtctggggtg tttttcgttc
3961 cgtcgccgga atgtttcgtt cgtctgtccc ctcacggggc gaaggccgcg tacggcccgg


77
RNA was precipitated with 500 pL of isopropanol at room temperature for 10
minutes followed by centrifugation at 12,000 x g for 10 minutes at 4C. RNA pellets
were washed with 1 mL 70% ethanol and centrifuged 5 minutes at 4C, 7,500 x g. The
resulting pellet was air dried briefly and resuspended in 200 p.L diethyl pyrocarbonate
(DEPC, Sigma) treated water. RNA fractions were stored at -80C for later use.
The lower phase (Trizol) of the extractions from the initial centrifugation step was
removed from the bottom keeping the interface intact. DNA was back extracted from the
remaining interface by adding 150 pL of 0.1 M Tris and 0.1% Sarkosyl and centrifuging 5
minutes at 20,000 x g. This back-extraction was repeated twice, pooling the aqueous
layer after each centrifugation. Proteinase K (0.1 pg/pl) was added to the pooled back-
extracted DNA samples and incubated at 37C overnight. DNA was purified by
sequential extractions with an equal volume of phenol and sevag followed by extraction
with sevag and precipitation in 100% ethanol. Pellets were resuspended in 50 pL TE and
quantitated spectrophotometrically (A2o)-
The amount of HSV genomes present in each mouse was quantitated by real time
PCR using primers and a probe specific for the HSV polymerase (pol) gene. Details of
the real time procedure were presented in chapter 3. The HSV pol primer/probe set was
custom made by Applied Biosystems, Assays by Design with the forward primer
sequence 5AGAGGGACATCCAGGACTTTGT, reverse primer sequence
5CAGGCGCTTGTTGGTGTAC and probe sequence 5ACCGCCGAACTGAGCA
(65,880 to 65,953 nt). For the PCR reaction, conditions were 1 cycle 2 minutes 50C, 1
cycle 10 minutes 95C, 40 cycles 15 seconds 95C 1 minute 60C as described in chapter
3.


59
Analysis of Transgene Expression in Neural and Non-neural Tissue at the Cellular
Level Using In situ Hybridization
In situ hybridization examined two properties of expression, the number of cells
expressing the transcript of interest and the cellular localization of the transcript (nuclear
or cytoplasmic). To determine if the LAT transgene was being expressed in all cells of
transgenic tissues we probed for either the 5 LAT exon or the LAT intron by RNA in
situ hybridization. These tissue sections were counterstained with Giemsa stain after
hybridization which is a general membrane stain. In DRG, neurons were visible as large
blue round nucleated cells. The tissue between the groups of neurons included support
cells and the axons leading to the neuron cell bodies. Figure 3-5 illustrates the
architecture of the DRG magnified to point out the location of the nucleus seen as a white
Figure 3-5. In situ hybridization of a latently infected dorsal root ganglia. This
photograph illustrates the neurons of the dorsal root ganglia (blue) and points
out the sub-cellular architecture with arrows pointing to the nucleus and
nucleolus of neurons. The small black dots on some of the cells are the
positive hybridization signal.


69
Figure 3-12. In situ hybridization in the transgenic kidney. A. LAT 5 exon probe B. LAT
intron probe. No positive hybridization signal was detected with either probe.


83
Figure 4-4. Reactivation of HSV-1 from transgenic and non-transgenic mice by explant
co-cultivation of latently infected DRG.
of infection in the mouse. The location of this deletion in relation to the mapped
virulence function of LAT and the LAT transgene is diagramed in figure 4-5. To see if
providing the deleted LAT region in trans would rescue the virulence phenotype, we
infected transgenic mice with the 17A480 virus in the rear footpad. At acute times post
infection, days one to four, feet and DRG were harvested, homogenized and titered for
infectious virus. Both transgenic and non-transgenic mice exhibited similar levels of
virus in the feet, seen in figure 4-6, with no significant difference between the groups at
any timepoint. Day 1 P= 0.1990, day 2 P= 0.3281, day 3 P= 0.9528, day 4 P= 0.5585.


74
relative progression of the acute infection was assessed by the yield of infectious virus in
the feet, spinal ganglia, and spinal cord at selected time points post infection.
Establishment of HSV latency was assessed by the amount of HSV-1 DNA present in the
DRG of transgenic and non-transgenic mice after the acute infection had resolved.
Explant co-cultivation was used as a reactivation model to determine if the LAT
transgenic mouse exhibited detectable differences in the ability to reactivate latent HSV.
Finally, deletion of a portion of the LAT region has been shown to dramatically
reduce the virulence and yield of virus within sensory neurons (Gary et al., in
preparation). While it has been shown that this virulence function acts independently of
the LAT promoter (which is primarily involved in reactivation), this new function still
resides within the region of the LAT gene present in the transgenic mouse. Here we
sought to determine if this phenotype could be rescued by using the LAT transgenic
mouse to provide the deleted region in trans during an experimental HSV infection.
Given the dramatic reduction in virulence associated with this LAT deletion, we felt this
would be a sensitive test of the LATs ability to act in trans.
Materials and Methods
Growth of Cell lines and Viruses
Rabbit skin (RS) cells were maintained in minimum essential media (MEM) with
Earles salts supplemented with 5% calf serum and antibiotics at 37C in a 5% CO2
incubator. HSV-1 strain 17+ and the HSV-1 mutant 17A480 were grown and titered on
RS cells. The mutation in 17A480 deletes a portion of the LAT intron corresponding to
nucleotides 119,502 to 119,981. Characterization of this virus has been described
elsewhere (Jarman et al., 2000).


17
apoptosis by both TUNEL and PARP assays (Pemg et al., 2000). Ahmed, et al. (2002)
stated that plasmids lacking the sequences in the 5 LAT exon were least efficient in
blocking apoptosis, and that this region appears to contribute to cell survival. This is the
same region that contributes to the virulence and reactivation phenotypes mentioned
above (Figure 1-4). Additionally, Thompson and Sawtell (2001) have used LAT null
viruses to examine cell survival during infection. They showed that 75% less
establishment of latency occurred in the LAT null virus and this was accompanied by a
large amount of neuronal death. They propose that one function of LAT is to protect
sensory neurons from death and enhance the establishment of latency.
Other Possible LAT Functions
Since LAT is transcribed antisense to ICP0 and the ICP0 gene is one of the first
promoters activated in the lytic cascade, it was believed that LAT could have an antisense
effect on ICP0 expression. A portion of the 2 kb LAT intron overlaps with the ICP0
transcript. In clonal cell lines containing these regions of DNA, Burton et al. did not find
an antisense effect with ICP0 when expressing LAT in trans in non-neuronal cells
(Burton et al., 2003). This does not mean that LAT cannot act in cis to affect the ICP0
region of transcription, perhaps acting on the DNA itself or in a structural manner to open
or close the region of DNA.
Another antisense function involves the transcript AL (antisense to LAT) which is
transcribed 6-8 hours post infection in PC-12 cells. AL is located in the 5exon and core
promoter region of LAT (Figure 1-4), and may have an opposing or balancing function
with LAT although more research is needed to specifically define AL and its function in
the HSV infection (Pemg et al., 2002). To date the AL transcript has only been detected


33
from the reservoir through the wicking papers at room temperature overnight. The
transferred membrane was rinsed in Nanopure water and baked at 80C in a vacuum oven
for 30 minutes to crosslink the RNA to the membrane.
Hybridization of northern blot
ATD19 probe (corresponding to nt 119,664 to 119,972 from the HSV genome)
was random hexamer primed (Random Labeling Kit, Roche) and labeled with P dCTP.
The blot was pre-hybridized for 3 hours at 42C in 20 mL FPH buffer (5X SSC, 5X
Denhardts solution, 50% Formamide, 1% SDS) in a sealed bag. Labeled probe was
added through a small cut in the comer of the bag and resealed. The hybridization was
incubated overnight at 42C.
The Northern blot was washed twice at room temperature with 50 mL 2X
SSC/0.1% SDS for 5 minutes each followed by two washes in 0.2X SSC/0.1% SDS for 5
minutes each at room temperature. The blot was dried briefly on Whatman paper and
exposed to a phosphor screen for 5 hours. A STORM phosphorimager was used to scan
the blot and the intensity of bands measured by Image Quant software (Molecular
Dynamics, Sunnyvale, CA).
Results
Determination of the Number of Copies of the LAT Transgene
When generating transgenic animals, it is common for multiple copies of the
transgenic insert to be integrated into the animal genome (Ellis et al., 1997). There are a
number of ways to determine the number of integrated copies, including hybridization
and PCR. Initially, we used slot blot hybridization to quantitate the copies of LAT
transgene present in these mice. In this case, the LAT hybridization signal from a known


I also want to thank my mother who has listened to the ups and downs all along the
way and always been supportive of me no matter what. Its been a long journey around
the country and Im finally going to settle down in one place. To my brothers, Marty
and Karl, who havent understood all of what my research is about, thanks for listening
and pretending to understand. To Cathy Kostick, who has been like a sister to me, thank
you for always being there through the years, in good times and in bad, your friendship
means more to me than I can express.
Last but certainly not least, I would like to thank my friends who have been there
for me every time that I was ready to give up; those of you who reminded me to do the
next right thing, take it one day at a time and put first things first. In no particular order:
Corliss, Aileen, Julie, Betty, Sheila, Eve, Heather, Leona, Martha Ann, Jennifer, Sarah,
Claire, Alice, Polly, Joan, Mary Ellen, Marty, Ted, Steve, Dale, Rosemary, Julia, Casey,
Diedre, Buster, BJ, Warren, Jim, Walt, Dan, and Joe; you are each a special part of my
life and of making this dream come true. And to whomever I have forgotten, you know
who you are, and I thank you.
v


26
Transgene Insert
Dra I Aat II
3ZZZZ ~ SV40pA
0
£
K)
Figure 2-1. Diagram of the LAT Transgene Insert. Shown is the HSV-1 genome with the
LAT region expanded to include the location of the LAT and ICPO genes. LAT is further
expanded to illustrate the exact region included in generating the transgenic mouse. For
the transgene insert the promoter is illustrated as a dotted line. A SV40 poly A sequence,
shown here in red, was added to stabilize the expressed RNA.
positive control for all genotyping PCR reactions. PCR primers were located in the 5
exon region of LAT corresponding to nt 118,888 to 119,037 of the HSV-1 genome
(forward: 5CGG CGA CAT CCT CCC CCT AAG C3 and reverse: 5GAC AGA CGA
ACG AAA CAT TCC G3). Each reaction contained 200 ng of tail DNA, 0.5 pM of


75
Footpad Infection of Mice
All infections used adult mice of at least 6 weeks of age, HSV-1 LAT transgenics
and their transgenic negative littermates of at least the F6 generation. Mice were
transferred to the UF animal care infectious disease suite after genotyping, and were
allowed to acclimate to their new housing conditions for at least one week prior to
infection.
Mice were anesthetized with halothane and subcutaneously injected with 0.1 mL
of 10% saline in each of the rear footpads. Four hours post saline pre-treatment, mice
were anesthetized with 0.010 to 0.020 mL of a ketamine cocktail (2.5-3.75 mg/kg
acepromazine, 7.5-11.5 mg/kg xylazine, 30-45 mg/kg ketamine) intramuscularly in the
thigh. Both rear footpads were abraded with an emery board to remove the keratinized
layer of skin tissue. Using a pipette tip, 1 x 106 plaque forming units (pfu) of virus in 50
pL volume was added to the footpads and allowed to absorb for one hour with mice lying
on their backs under anesthesia. Mice were monitored twice daily for signs of
complications due to anesthesia or infection.
Harvesting of Infected Tissues
At specified times post infection, mice were euthanized with halothane and
infected tissues were dissected (feet, DRG, spinal cord). Tissues were snap-frozen in
liquid nitrogen and stored at -80C until processed.
Determination of Viral Titers from Infected Tissues
Infected tissues were homogenized in Kontes glass tissue grinders (Fisher) or a
ceramic mortar and pestle (feet). DRG were ground in 1 mL MEM with supplements and
grinders rinsed with 0.4 mL MEM. Spinal cords were ground in 2.5 mL MEM and rinsed
with 2.3 mL MEM. Feet were ground with 2.5 mL MEM containing 2x antibiotics and


APPENDIX B
PCR PRIMER SEQUENCES
Polymerase chain reaction (PCR) was used in the experiments described in this
dissertation for a number of quantifications and identifications. The complete list of
primers used for these reactions is presented here in tabular form for easy reference.
Table B-l. Conventional PCR Primers and Locations
Primer Name
Sequence
Genome
Location
PCR
Conditions'
Promar 1
GCA CGA TCC CGA CAA CAA TAA CAA C
118,246-
118,270
94, 55,
72
Promar 2
ACT TCC ACT TCC CGT CCT TCC ATC C
118,327-
118,351
94, 55,
72
DB60
CGG CGA CAT CCT CCC CCT AAG C
118,888-
118,910
94, 55,
72
DB61
GAC AGA CGA ACG AAA CAT TCC G
118,994-
HO,016
94, 55,
72
M int 1
GAC ACG CAT TGG CTG GTG TAG TGG G
120,795-
120,819
94, 55,
72
M int 2
ACG AGG GAA AAC AAT AAG GGA CGC C
120,872-
nO,898
94, 55,
72
M2 probe up
AGA CCC GCT GGT GG TGG TG
120,748-
nO,767
94, 55,
72
M2 probe down
GAT GCC CCC CGA GTA CCC GA
121,044-
121,063
94, 55,
72
AG 29
CGG GTA CTC GGG GGG CA
121,044-
121,061
94, 55,
72
AG 30
CTC GGG GGT CTC TAG CGT GG
121,252-
121,272
94, 55,
72
AG 31
CGC CTC TTC CTC CTC TGC CT
121,513-
121,533
94, 68,
72
1 All PCR conditions are one cycle for 3 minutes followed by 30 cycles for 1 minute.
98


CHAPTER 3
EXPRESSION PROFILE OF THE LAT TRANSGENE
Overview
The previous chapter presented data that the LAT transgenic mouse was
expressing the LAT transgene through the detection of the stable intron in dorsal root
ganglion cells by Northern blot analysis. A quantitative expression profile encompassing
both neural and non-neural tissues is presented in this chapter. Since the HSV LAT is
expressed during latency, we expected that LAT expression is being regulated largely by
cellular functions, and we therefore expected to see LAT expression in the transgenic
mouse. What was less clear was whether some viral function contributed to the
regulation of LAT expression, and since no other viral genes were present in the
transgenic mouse to regulate LAT expression we expected the transgenic mouse would
be a valuable tool to look at the cellular control of the LAT promoter. During the course
of infection, accumulation of LAT intron typically occurs in neuronal cells (Rodahl and
Stevens, 1992), suggesting that neurons contain some factor not present in other cells to
allow for the expression of LAT or to prevent its repression. If this was the case, then
LAT expression should be seen either exclusively in neural tissues or at higher levels in
neural tissues of the transgenic mouse. Therefore, examining LAT expression in neural
vs. non-neural cell types was a high priority goal for this investigation.
The two previously described HSV transgenic mice have used non-quantitative
methods to examine expression of the LAT transgene. Both the HSV-2 LAT transgenic
and the HSV-1 LAT intron transgenic used a Northern blot to assess transgene
43


67
of neurons. In contrast to the QRT-PR data for the non-neural tissues, both the transgenic
foot (Figure 3-11) and the transgenic kidney (Figure 3-12) exhibited no detectable LAT
expression by in situ hybridization. The cell specific distribution of LAT expression
exhibited by the transgenic mouse in both neuronal and non-neuronal tissues has
important implications for the final analysis of the overall LAT expression levels in the
different tissues of the transgenic mouse. This will be discussed in detail in the following
section.
Discussion
The LAT was able to be expressed in the absence of other HSV proteins in the
transgenic mouse. We had expected to see this expression primarily in neural tissues
(brain, spinal cord, ganglia) and possibly some epithelial tissues as well, for example skin
and foot, which have demonstrated some LAT expression during the HSV infection
(Jarman et al., 1999). The data presented here show that LAT can be detected at
relatively high overall levels, in a variety of tissues in the transgenic mouse. The tissues
expressing LAT were consistent with the expression patterns seen in the HSV-2
transgenic mouse (Wang et al., 2001) that was under control of the native HSV-2 LAT
promoter. We were unable to compare the amount of expression between the LAT HSV-
1 and HSV-2 mice because quantitative data were not reported in the HSV-2 mouse.
An important consideration, however, is that the analysis of the expression data
on a per weight basis did not take into consideration that different cell types have
different densities and cell compositions, although this is the standard method for
representing such data. To provide a per cell based analysis, we compared the expression
data to 18s RNA levels. Selection of a cellular gene to be used as a control must be done


TABLE OF CONTENTS
Page
ACKNOWLEDGMENTS iv
LIST OF TABLES viii
LIST OF FIGURES ix
KEY TO SYMBOLS xi
ABSTRACT xiv
CHAPTER
1 INTRODUCTION 1
HSV Clinical Features 1
Immune Response to HSV 2
General HSV Characteristics 3
HSV Gene Regulation 6
Animal Models of HSV Latency and Reactivation 11
Function of LAT 13
Use of Transgenics to Study Disease 18
Hypotheses to be Tested Using Transgenic Approach 20
2 GENERATION OF TRANSGENIC MOUSE EXPRESSING A PORTION OF
THE HSV-1 LATENCY ASSOCIATED TRANSCRIPT 23
Overview 23
Materials and Methods 24
Results 33
Discussion 41
3 EXPRESSION PROFILE OF THE LAT TRANSGENE 43
Overview 43
Materials and Methods 44
Results 51
Discussion 67
vi


16
5 LAT exon. This virus was also reduced for spontaneous reactivation in the rabbit
(Pemg et al., 1999).
Other mutants deleting either a portion of the 5exon (A307) or the 3 portion of
the intron (A480) exhibit decreased virulence (Gary et al., in preparation). These
experiments on the whole indicate that there are differences in the infection between mice
and rabbits since the deletion viruses produce different effects dependent on the model
system used. Further studies are necessary to determine the mechanism employed by
these viruses in both the mouse and rabbit models.
Enhancer
A number of studies have demonstrated that the LAT core promoter, by itself, is
not sufficient to direct long-term expression (Margolis et al., 1993). The long-term
expression element (LTE) has been described as the region of the 5 exon from PstI to the
splice junction (Berthomme et al., 2001). Analysis using reporter constructs containing
this region downstream of the core LAT promoter continued to express (3-gal at 40 days
post infection while the control (containing just the LAT core promoter) had no
expression at 28 days post infection (Lokensgard et al., 1997). Transient expression
experiments containing the LTE showed that the LTE region can activate the HSV-1
thymidine kinase promoter in both neuronal and non-neuronal cells (Berthomme et al.,
2000). These data suggest that the LTE contains an enhancer element and functions to
promote long term LAT expression.
Neuronal Survival
LAT has also been implicated as a suppressor of apoptosis. A large LAT deletion
(-161 to +1667 relative to the LAT transcription start site) demonstrated increased


85
In the DRG, figure 4-7, the increase seen with the transgenic mice was not
significant, day 2 P= 0.3029, day 3 P= 0.3964, day 4 P= 0.0727. Since only four mice
were tested per group in these experiments it is possible that a larger sample size would
have resulted in a significant rescue of the virulence phenotype. The initial virulence
studies used Swiss Webster mice, which are less resistant to HSV infection. Thus, to
prevent genetic differences from complicating the results, the transgenic mouse is being
bred into the Swiss Webster background prior to repeating these experiments.
P Transgenic Pos
P Transgenic Neg
Figure 4-7. Relative amounts of infectious virus in DRG of transgenic and non-transgenic
mice infected with a deletion mutant of HSV-1 at acute times post infection.
n= 4.
Discussion
The LAT has been proposed to play a role in the establishment and reactivation
phases of the HSV infection. The LAT transgenic mouse expressed LAT to high levels
in a number of tissues, as presented in chapter 3. We hypothesized that the expression of
LAT by the transgenic mouse in a temporally different manner from what occurs during


CHAPTER 5
OVERALL CONCLUSIONS
The LAT is the only transcript detected abundantly during the latent phase of HSV-
1 infection (Roizman and Sears, 1996). This transcript has been implicated as a
modulator of a number of viral functions including, but not limited to, establishment of
latency (Speck and Simmons, 1991), reactivation (Wagner, 1991; Bloom et al., 1994;
Bloom et al., 1996), virulence (Pemg et al., 1999), and neuronal survival (Pemg et al.,
2000; Thompson and Sawtell, 2001; Ahmed et al., 2002). One of the key features of the
LAT is that it exhibits a differential tropism of expression with only 1/3 of latently
infected neurons expressing large amounts (Maggioncalda et al., 1996). In addition,
LAT-expressing neurons seem to segregate into subsets of sensory neurons expressing
specific markers. Since the degree to which the regulation of LAT expression is dictated
by phenotypically different classes of neurons is not well understood, we sought to study
the regulation of LAT expression in the absence of other viral proteins by generating a
transgenic mouse that contains the LAT region.
Characterization of the transgenic mouse described in this dissertation has shown
that the LAT transgene exists in a single copy in the mouse genome and that it is
expressed to high levels in a number of tissues. This overall expression, as assessed by
total LAT RNA detected at the level of whole tissues, does not seem to be neuronal-
specific since expression was seen in non-neural tissues as well. This seemed somewhat
surprising to us initially since the literature contains numerous studies showing that LAT
has higher levels of expression in neuronal cells than in other cell types (Zwaagstra et al.,
88


65
A.
Figure 3-9. In situ hybridization of the transgenic brain with LAT intron probe. A. Low
magnification for orientation purposes. (lOx) B. Positive signal (black
arrows) was detected in thalamic neurons with primarily lower levels of
expression than seen in the DRG. (40x)


I certify that I have read this study and that in my opinion it conforms to acceptable
standards of scholarly presentation and is fully adequate, in scope and quality, as a
dissertation for the degree of Doctor of Philosophy.
David C. Bloom^Chair
Assistant Professor of Molecular Genetics
and Microbiology
I certify that I have read this study and that in my opinion it conforms to acceptable
standards of scholarly presentation and is fully adequate, in scope and quality, as a
dissertation for the degree of Doctor of Philosophy.

"Paul J.
Mark &T)verstreet Professor of
Neuroscience
I certify that I have read this study and that in my opinion it conforms to acceptable
standards of scholarly presentation and is fully adequate, in scope and quality, as a
dissertation for the degree of Doctor of Philosophy.
Richard C. Condit
Professor of Molecular Genetics and
Microbiology
I certify that I have read this study and that in my opinion it conforms to acceptable
standards of scholarly presentation and is fully adequate, in scope and quality, as a
dissertation for the degree of Doctor of Philosophy.
r\A
Sue A. Moyer
Professor of Molecular Genetics and
Microbiology
This dissertation was submitted to the Graduate Faculty of the College of Medicine
and to the Graduate School and was accepted as partial fulfillment of the requirements for
the degree of Doctor of Philosophy.
May 2004
Dean, Graduate School


108
Lokensgard, J. R., H. Berthomme and L. T. Feldman (1997). "The latency-associated
promoter of herpes simplex virus type 1 requires a region downstream of the
transcription start site for long-term expression during latency." Journal of Virology
71(9): 6714-6719.
Lopez, C. (1975). "Genetics of natural resistance to herpes simplex virus infections in
mice." Nature 258: 152-153.
Mackem, S. and B. Roizman (1982). "Differentiation between alpha promoter and
regulator regions of herpes simplex virus 1: the functional domains and sequence of
a movable alpha regulator." Proceedings of the National Academy of Sciences
79(16): 4917-4921.
Mador, N., E. Braun, H. Haim, I. Ariel, A. Panet and I. Steiner (2003). "Transgenic
mouse with the herpes simplex virus type 1 latency-associated gene: expression and
function of the transgene." Journal of Virology 77(23): 12421-12429.
Maggioncalda, J., A. Mehta, Y. H. Su, N. W. Fraser and T. M. Block (1996).
"Correlation between herpes simplex virus type 1 rate of reactivation from latent
infection and the number of infected neurons in trigeminal ganglia." Virology
225: 72-81.
Margolis, T. P., F. Sedarati, A. T. Dobson, L. T. Feldman and J. G. Stevens (1992).
"Pathways of viral gene expression during acute neuronal infection with HSV-1."
Virology 189(1): 150-160.
Margolis, T. P., D. C. Bloom, A. T. Dobson, L. T. Feldman and J. G. Stevens (1993).
"LAT promoter activity decreases dramatically during the latent phase of
ganglionic infection with HSV." Virology 197(2): 585-592.
Mitchell, W. J. (1995). "Neurons differentially control expression of a herpes simplex
virus type 1 immediate-early promoter in transgenic mice." Journal of Virology
69(12): 7942-50.
Nomura, T. (1997). "Practical development of genetically engineered animals as human
disease models." Laboratory Animal Science 47(2): 113-117.
Nicosia, M., S. L. Deshmane, J. M. Zaboloty, T. Valyi-Nagy and N. Fraser (1993).
"Herpes simplex virus type 1 latency-associated transcript (LAT) promoter deletion
mutants can express a 2-kilobase transcript mapping to the LAT region." Journal of
Virology 67(12): 7276-7283.
Pemg, G.-C., E. C. Dunkel, P. A. Geary, S. M. Slanina, H. Ghiasi, R. Kaiwar, A. B.
Nesbum and S. L. Wechsler (1994). "The latency-associated transcript gene of
herpes simplex virus type 1 (HSV-1) is required for efficient in vivo spontaneous
reactivation of HSV-1 from latency." Journal of Virology 68(12): 8045-8055.


25
Screening for Founders Containing the LAT Insert
Fertilized oocytes were obtained from C3H/HeJ mice. Purification of the
transgene, preparation of mice, microinjection into fertilized oocytes and embryo
implants were carried out by Dr. Glenn Rail at Fox Chase Cancer Center as described
(Hogan et al., 1986; Rail et al., 1995).
DNA from the founder generation (FI) of mice was obtained by clipping a 1 cm
portion of the tail from anesthesized mice. Tail clips were incubated overnight at 50C in
0.5 mL STE buffer (50 mM TRIS pH 8, 100 mM NaCl, ImM EDTA, 1% SDS) and 1 mg
Proteinase K. After incubation, hair and bone were removed by centrifugation at 20,000
x g and the supernatant transferred to a new centrifuge tube. DNA was extracted with
equal amounts of phenol and sevag (1:24 ratio of isoamyl alcohol and chloroform)
followed by extraction with sevag alone. DNA was precipitated with 100% ethanol. The
DNA pellet was resuspended in TE (lOmM TRIS, ImM EDTA) pH 8 and quantitated by
spectrophotometry at A26o- The founder generation was screened by Glenn Rail using
slot blot hybridization analysis. Briefly, 10 pg of DNA per slot of a slot blot apparatus
was applied to a nylon membrane for hybridization as described by Rail et al. (1995).
The membrane was probed with a P-labeled DNA fragment from either the SV40 poly
A sequence in the pNSE-Ex4 plasmid or a portion of the LAT transgenic insert fragment
corresponding to 119,193 to 120,090 nucleotides (nt) of the HSV-1 strain 17+ genome.
The nt determinations for all genomic HSV sequences presented in this dissertation are
according to McGeoch numbering (Perry and McGeoch, 1988).
Genotyping of subsequent generations was determined by PCR analysis. DNA
was prepared from tail clips as described above. pLAT/LAT plasmid DNA was used as a


19
expression of the transgene is generally dependent upon the promoter used to drive the
inserted gene.
In the case of HSV-1, transgenic mice have been created to study regulation of the
different classes of HSV genes. These mice each contain the HSV promoter in question
driving a lacZ reporter. An ICP4 transgenic mouse expressed such a reporter under the
control of the ICP4 promoter primarily in neuronal tissues, with lower levels of
expression in trigeminal ganglia and retinas and high levels of expression in brain regions
and the dorsal hom of the spinal cord (Mitchell, 1995). Additionally, ICPO and ICP27
transgenic mice demonstrated similar expression in neuronal tissues (Loiacono et al.,
2002). In addition the ICPO and ICP4 transgenic mice were shown to differentially
express the reporter based on the age of the mice. ICP4 transgenic mice had
approximately 100-fold greater expression in newborn mice compared to adults.
Differential expression of ICPO was the reverse of the expression seen with ICP4, with
expression increasing with age. These findings indicate that although HSV immediate
early promoters contain similar regulatory elements, they are regulated differently by
cellular factors in the absence of other HSV proteins. In contrast to the findings with the
IE promoters, both neuronal and non-neuronal cells were negative for expression in a gC
transgenic mouse, illustrating that HSV late promoters require other viral functions for
their expression (Mitchell, 1995; Loiacono et al., 2002).
Expression of LAT in Transgenics
Previously a LAT transgenic mouse had been created to specifically study the
splicing of the 1.5 kb LAT out of the 2 kb LAT intron. This mouse contains the 2 kb
LAT of HSV-1 under control of a CMV promoter. Studies have determined that the
splicing event of the 1.5 kb species is more efficient in neural tissues than non-neural


pfu / g
Intron
c
LAT Transgene
^^VimlenceEflect^^^
+76 +1667
A480
+892 +1372
Figure 4-5. Diagram of the LAT region of HSV illustrating the location of the 17A480
virus and the LAT transgene in relation to the virulence function of LAT.
1.00E+08
1.00E+07
1.00E+06
1.00E+05
1.00E+04
1.00E+03
I.00E+02
1.00E+01
1.00E+00
Transgenic Pos
T ransgenic Neg
Day 1 Day 2 Day 3 Day 4
Figure 4-6. Relative amounts of infectious virus in feet of transgenic and non-transgenic
mice infected with a deletion mutant of HSV-1 at acute times post infection. n=4


90
insignificant differences seen during the acute phase of infection and these differences
will be re-evaluated by backcrossing the transgenic mouse into the Swiss-Webster
background, which is more sensitive to HSV infection and then repeating the infection
study. However, given the fact that the 17A480 virus is also restricted in replication in
PC-12 cells in vitro, our favored hypothesis is that the transgenic mouse in the Swiss-
Webster background will not rescue the virulence of 17A480.
On the whole, the data presented here suggest that, in the context of the HSV-1
genome, the LAT is functioning in cis to regulate or affect the DNA that transcribed it in
order to modulate the genetically distinct virulence and reactivation phenotypes that map
to this region. There are a number of possible mechanisms for this LAT function,
including acting as a boundary element to prevent transcription of the surrounding acute
transcripts or aiding modification of the chromatin structure to control transcription in
this important regulatory region of the viral genome. Further studies with the transgenic
mouse will investigate these potential regulation mechanisms.


45
the ground tissue fraction. After a 5 minute room temperature incubation, 240 pL of
chloroform was added and homogenates were vortexed 15 seconds followed by a 5
minute incubation at room temperature. Tissue homogenates were centrifuged at 9,000 x
g for 15 minutes at 4C, and the aqueous phase containing the RNA removed to a
separate tube. The bottom Trizol layer was stored at -80C for back extraction of DNA if
necessary.
RNA was precipitated by the addition of 500 pL of isopropanol and incubation at
room temperature for 10 minutes followed by centrifugation at 12,000 x g for 10 minutes
at 4C. RNA pellets were washed with 1 mL 70% ethanol and centrifuged 5 minutes at
4C, 7,500 x g and the resulting pellet air dried briefly and resuspended in 200 pL diethyl
pyrocarbonate (DEPC, Sigma) treated water.
DNA contamination of the RNA was reduced using DNA-free (Ambion, Austin,
TX). One half of the tissue RNA was added to 2 units of DNasel and 0.1 volumes of
DNasel buffer, mixed gently and incubated at 37C for 30 minutes. After the incubation,
0.1 volumes of DNase-inactivation reagent was added to each tube and incubated at room
temperature for 2 minutes. DNase inactivation reagent was pelleted at 1,000 x g for 1
minute and supernatant was transferred to a new tube. RNA was then quantitated
spectrophometrically.
Reverse Transcription of Tissue RNA
cDNA was prepared from tissue RNA using Moloney Murine Leukemia Virus
Reverse Transcriptase (MMLvRT) and random hexamer priming. For each tissue
sample, 500 ng total RNA was added to 4 pL 5x RT buffer (Invitrogen), 10 pmol random
hexamers, 12.5 pM each dATP, dTTP, dGTP, dCTP, 200 units MMLvRT (Invitrogen)



PAGE 1

CHARACTERIZATION OF A TRANSGENIC MOUSE EXPRESSING THE HSV-1 LATENCY ASSOCIATED TRANSCRIPT By ANNE M. GUSSOW A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNrVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2004

PAGE 2

Copyright 2004 by ANNE M. GUSSOW

PAGE 3

To my husband, Karl, who is my best cheerleader, and my son, Seth, who is too young to understand.

PAGE 4

ACKNOWLEDGMENTS I would first like to thank my mentor, Dr. David Bloom, for his guidance and direction in the completion of this work and for providing me with the opportunity to complete my doctoral studies at the University of Florida. I would also like to thank my committee, Dr. Richard Condit, Dr. Sue Moyer, and Dr. Paul Reier, for their useful discussions and suggestions to this project. I would like to thank Dr. Robert Bonneau for encouraging me to apply to graduate school and for giving me a start in my research career, and Dr. Eddie Castaneda for helping to ease my transition from Arizona State to the University of Florida. I would like to express my gratitude to the people who have worked with me in Dave's lab over the years, both the ASU group, Rick Jarman, Robert Tran, Jerry O'Neil, Niki Kubat, Melanie Paquette, and Lee Gary, as well as the UF group, Tony Amelio, Zane Zeier, Nicole Giordiani, Peterjon McAnany and Loretta Arrue. Each of them has brought a special quality to the lab that will not be forgotten. The biggest acknowledgment goes to my husband, Karl, and my son, Seth. Without the love and support of both of them this goal would have fallen short a long time ago. I thank Karl for the 2500 miles of 1-10, 1 hope the journey has been worth the sacrifices that he has made as a result. Although Seth is too young to understand any of this, coming home to his simple outlook on life has put things into perspective on many occasions. IV

PAGE 5

I also want to thank my mother who has listened to the ups and downs all along the way and always been supportive of me no matter what. It's been a long journey around the country and I'm finally going to "settle down" in one place. To my brothers, Marty and Karl, who haven't understood all of what my research is about, thanks for listening and pretending to understand. To Cathy Kostick, who has been like a sister to me, thank you for always being there through the years, in good times and in bad, your friendship means more to me than I can express. Last but certainly not least, I would like to thank my friends who have been there for me every time that I was ready to give up; those of you who reminded me to do the next right thing, take it one day at a time and put first things first. In no particular order: Corliss, Aileen, Julie, Betty, Sheila, Eve, Heather, Leona, Martha Ann, Jennifer, Sarah, Claire, Alice, Polly, Joan, Mary Ellen, Marty, Ted, Steve, Dale, Rosemary, Julia, Casey, Diedre, Buster, BJ, Warren, Jim, Walt, Dan, and Joe; you are each a special part of my life and of making this dream come true. And to whomever I have forgotten, you know who you are, and I thank you.

PAGE 6

TABLE OF CONTENTS Page ACKNOWLEDGMENTS iv LIST OF TABLES viii LIST OF FIGURES ix KEY TO SYMBOLS xi ABSTRACT xiv CHAPTER 1 INTRODUCTION 1 HSV Clinical Features 1 Immune Response to HSV 2 General HSV Characteristics 3 HSV Gene Regulation 6 Animal Models of HSV Latency and Reactivation 11 Function of LAT 13 Use of Transgenics to Study Disease 18 Hypotheses to be Tested Using Transgenic Approach 20 2 GENERATION OF TRANSGENIC MOUSE EXPRESSING A PORTION OF THE HSV-1 LATENCY ASSOCIATED TRANSCRIPT 23 Overview 23 Materials and Methods 24 Results 33 Discussion 41 3 EXPRESSION PROFILE OF THE LAT TRANSGENE 43 Overview 43 Materials and Methods 44 Results 51 Discussion 67 VI

PAGE 7

4 CHARACTERIZATION OF THE EXPRESSION OF LAT IN TRANS ON THE COURSE OF HSV-1 INFECTION IN MICE 73 Overview 73 Materials and Methods 74 Results 78 Discussion 85 5 OVERALL CONCLUSIONS 88 APPENDIX A MAP AND SEQUENCE OF THE pLAT/LAT PLASMID 91 B PCR PRIMER SEQUENCES 98 C EXPRESSION OF THE LAT TRANSGENE IS NOT AGE DEPENDENT 100 LIST OF REFERENCES 104 BIOGRAPHICAL SKETCH 112 vn

PAGE 8

LIST OF TABLES Table E^ge 2-1 Determination of transgenic copy number by real-time PCR 35 3-1 Quantitation of LAT Expressing Cells in Dorsal Root Ganglia by in situ hybridization for the LAT 5' exon 63 B-l Conventional PCR Primers and Locations 98 B-2 Real time PCR Primer and Probe Sequences 99 vni

PAGE 9

LIST OF FIGURES Figure Eage 1-1 Diagram of the HSV-1 virion 4 1-2 Diagram of the HSV-1 genome 5 1-3 Regulation of the different HSV gene promoter classes 7 1-4 Diagram of the function of HSV-1 LAT 13 2-1 Diagram of the LAT Transgene Insert 26 2-2 HSV transgene copy number determination by slot blot hybridization analysis 34 2-3 Mapping of the LAT transgene in the LAT transgenic mouse 37 2-4 PCR mapping the transgene insert 38 2-5 Expression of the LAT transgene 40 3-1 Expression of the LAT transgene per gram of tissue 53 3-2 Expression of the LAT transgene normalized to 18s RNA 55 3-3 LAT transgene expression is not age dependent in tissues typically involved in the HSV infection when normalized on a per weight basis 58 3-4 Expression of the LAT transgene is not age dependent in tissues involved in the HSV infecction when calculated per cell by normalizing to 18s RNA 58 3-5 In situ hybridization of a latently infected dorsal root ganglia 59 3-6 In situ hybridization for 5' LAT exon 61 3-7 In situ hybridization for LAT intron in transgenic DRG 62 3-8 In situ hybridization for LAT 5' exon in brain 64 3-9 In situ hybridization of the transgenic brain with LAT intron probe 65 3-10 In situ hybridization in the transgenic spinal cord 66 IX

PAGE 10

3-1 1 In situ hybridization of transgenic foot 68 3-12 In situ hybridization in the transgenic kidney 69 41 Relative amounts of infectious virus in the feet of transgenic and non-transgenic mice infected with HSV-1 strain 17+ during acute times post infection 79 4-2 Titer of infectious virus in DRG of transgenic and non-transgenic mice infected with HSV-1 strain 17+ at acute times post infection 80 4-3 Quantitation of HSV-1 genomes present in mice infected with HSV-1 17+ at latent times post infection 1 4-4 Reativation of HS V1 from transgenic and non-transgenic mice by explant cocultivation of latently infected DRG 83 4-5 Diagram of the LAT region of HSV illustrating the location of the 17A480 virus and the LAT transgene in relation to the virulence function of LAT 84 4-6 Relative amounts of infectious virus in feet of transgenic and non-transgenic mice infected with a deletion mutant of HSV-1 at acute times post infection 84 4-7 Relative amounts of infectious virus in DRGof transgenic and non-transgenic mice infected with a deletion mutant of HSV-1 at acute times post infection 85 A-l Plasmid map of the HSV-1 LAT transgenic construct 91 C-l Expression of the LAT transgene in neural tissues 101 C-2 Expression of the LAT transgene in non-neural tissues 101 C-3 Expression of the LAT transgene in neural tissues represented as copies per 18s RNA 102 C-4 Expression of the LAT transgene in non-neural tissues represented as copies per 18s RNA 103

PAGE 11

KEY TO SYMBOLS C degrees Celsius AL antisense to LAT ANOVA analysis of variance (3-gal beta galactosidase bp base pair Br brain CaCl2 calcium chloride cDNA copy deoxynucleic acid cm centimeter CMV cytomegalovirus CO2 carbon dioxide CPE cytopathic effect cpm counts per minute CRE cyclic AMP response element CTL cytotoxic T lymphocyte dATP adenosine triphosphate nucleotide dCTP cytosine triphosphate nucleotide dGTP guanine triphosphate nucleotide dTTP thymine triphosphate nucletide DEPC diethyl pyrocarbonate DNA deoxyribonucleic acid DRG dorsal root ganglia EDTA ethylenediaminetetraacetic acid TE TRIS/ EDTA buffer F foot FFLB formaldehyde loading buffer FHP formamide prehybridization/ hybridization buffer fmol femtomole g centrifugal force HC1 hydrochloric acid HSV Herpes Simplex Virus HSV-1 Herpes Simplex Virus Type 1 HSV-2 Herpes Simplex Virus Type 2 ICP infected cell protein IFNy interferon gamma K kidney kb kilobases kg kilogram LAP1 latency associated promoter 1 XI

PAGE 12

LAT latency associated transcript LN 2 liquid nitrogen LTE long term expression element Lv liver uL microliter Hg microgram uM micromolar mg milligram mL milliliter mM millimolar M molar MEM minimum essential medium MgCl 2 magnesium chloride MHC major histocompatibility complex MMLvRT Muloney Murine Leukemia Virus reverse transcri MOI multiplicity of infection MOPS N-morpholino propanesulfonic acid N normal NaCl sodium chloride NaOH sodium hydroxide ng nanogram NGF nerve growth factor nt nucleotide p32 phosphorus-32 PBS phosphate buffered saline PCR polymerase chain reaction pfii plaque forming unit Pg picogram pol polymerase QRT-PCR quantitative RT-PCR RCR reactivation critical region RNA ribonucleic acid Rl long repeat Rs short repeat RS rabbit skin cells RT reverse transcriptase RT-PCR reverse transcriptasepolymerase chain reaction S 35 sulfur-35 SDS sodium dodecylsulfate SPF specific pathogen free SSC sodium chloride/ sodium citrate SV40 simian virus 40 TE TRIS/ EDTA buffer TG trigeminal ganglia tRNA transfer RNA Xll

PAGE 13

u unit u L unique long Us unique short Xlll

PAGE 14

Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy CHARACTERIZATION OF A TRANSGENIC MOUSE EXPRESSING THE HSV-1 LATENCY ASSOCIATED TRANSCRIPT By Anne M. Gussow May 2004 Chair: David Bloom Major Department: Molecular Genetics and Microbiology Herpes Simplex Virus Type 1 (HSV-1) is a double stranded DNA virus that causes a life-long infection of its host. The infection is characterized by two phases, the acute phase and the latent phase. The virus infects epithelial tissue during the acute infection where it gains access to nerve termini and establishes a latent infection in sensory ganglia neurons. During latency only a single viral transcript is expressed abundantly, the Latency Associated Transcript (LAT). LAT is most abundantly transcribed in neurons, and the 5' portion of the transcript has been implicated in the establishment and reactivation of latent infections. In order to study the regulation of LAT expression in neurons in the absence of viral functions, a transgenic mouse line was created in the C57B1/6 background containing the region encoding the LAT 5' exon through the 2.0kb intron under the control of its native promoter. Characterization of this transgenic mouse indicates that there is a single copy of the transgene inserted into the mouse genome and LAT expression is abundant in a number of tissues including dorsal root ganglia (DRG), xiv

PAGE 15

brain, skin, liver, and kidney. Additionally, in situ hybridization indicates that expression of the transgene in the DRG is limited to a subset of cells, similar to what occurs during a natural HSV infection. During HSV infection of the transgenic mouse, expression of the transgene has no effect on the amount of virus produced during the acute infection in feet, DRG, or spinal cord. Since LAT has been implicated as playing a role in establishment and reactivation of latency, we sought to determine whether expression of the transgene affected the ability of the wild type virus to establish and reactivate from a latent infection. PCR for HSV DNA in DRG detected no difference between transgenic and non-transgenic mice following establishment of HSV latency. Reactivation by explant co-cultivation of latently infected DRG exhibited a similar pattern of reactivation for both transgenic and non-transgenic mice. Taken together, the infection data suggest that LAT is not functioning in trans to regulate the HSV infection. This suggests that LAT acts in cis to regulate reactivation. xv

PAGE 16

CHAPTER 1 INTRODUCTION HSV Clinical Features Herpes viruses are characterized by their ability to establish a life-long infection of their host with long periods of latency during which the virus exists in ganglionic neurons with only a single transcript detected abundantly. Herpes Simplex Virus Type 1 (HSV-1) infection causes lesions commonly known as cold sores. A large portion of the world population, up to 90% in some areas, has been exposed to HSV-1 by adolescence and produce detectable antibodies to the virus (Roizman and Sears, 1996). Herpes infections have been described since the days of ancient Greece. Infection with HSV-1 is typically characterized by lesions of the epithelium of the mouth or lips, although it can infect other mucosal areas, such as the eyes. A closely related Herpesvirus, HSV-2, causes the same type of lesions, although they are primarily genital in nature (Roizman and Sears, 1996). The initial phase of infection or primary infection lasts two to three weeks and is often asymptomatic in young children. Once the lesions have healed, the virus enters a latent state where it exists asymptomatically in sensory nerve ganglia. Latency is interrupted by periods of reactivation, which is the result of stress. During reactivation, lesions can recur at the initial site of infection. The frequency and severity of reactivations vary depending upon the individual, although the duration of reactivation lesions is typically shorter than the primary lesions, and asymptomatic shedding is common (Roizman and Sears, 1996). 1

PAGE 17

HSV infection is particularly dangerous in immunocompromised individuals. Due to the inability to mount an immune response to the virus, these patients may develop a number of more severe symptoms such as keratitus, which can lead to blindness (Whitley, 1990). Newborns exposed to primary infection or reactivating HSV at birth are susceptible to systemic infection that could result in fatal encephalitis (Anderson and Nicholls, 1972). Current treatments for HSV infection include several nucleoside analogs in either topical or oral forms that reduce the severity of reactivations and shorten the duration of lesions. Vaccines have been developed using peptides, attenuated viruses, and killed viruses, all of which provided limited protection against recurrences. No cure is currently available for HSV infection (Koelle and Corey, 2003). Immune Response to HSV The immune response to HSV-1 involves both specific and non-specific mechanisms. In the initial stages of infection, CD4+ cells activate macrophages and produce IFNy. The activated macrophages produce other cytokines to affect other immune cells. Later in the immune response, CD8+ cytotoxic lymphocytes and antibody producing B cells provide specific immunity that helps to clear virally infected cells (Whitley, 1996). Like other viruses, HSV has developed methods to evade the immune response. For example, it establishes latency in an immune privileged site neurons do not normally express MHC class I or II. This site of latency greatly reduces the likelihood of CTL-mediated destruction of the host cell (Ward and Roizman, 1998). An example of the ability of HSV to evade the humoral immune response is gC, an HSV virion

PAGE 18

glycoprotein that can bind to the complement factor C3b and limit the induction of the complement cascade (Chen et al., 2003) In order to determine the role of the immune system in the latent phase of HSV infection, a number of mouse strains deficient in specific aspects of the immune response have been infected. These strains were each compared to the relatively HSV-resistant C57B1/6 strain which contains a functional immune system. C57B1/6 mice can be infected with HSV and establish a latent infection but do not develop encephalitis as a result of infection (Lopez, 1975; Kastrukoff et al., 1986). In contrast, SCID mice are highly susceptible to HSV as a result of being deficient in both T and B cells. Even so, it was suggested that HSV has the potential to establish latency at early times post-infection in these mice as defined by the observation of neuronal LAT expression in ganglia 1-2 days post infection (Gesser et al., 1994). Interferon knockout GKO mice exhibited a delay in the peak of viral productive infection, but latency was established at a normal rate and HSV infection was not lethal to these mice, suggesting that interferon stimulation of the immune response is not necessary to resolve the acute infection. The moderately susceptible Balb/c strain resulted in a stronger productive infection than seen in C57B1/6 mice, but no differences were seen in the relative ability of HSV to establish latent infections in these different mouse strains with known differences in immune backgrounds (Ellison et al., 2000). These studies imply that establishment of latency is the result of a virus neuron response and not mediated by the immune response since latency was established in all strains tested. General HSV Characteristics HSV-1 is the prototype of the alphaherpes virus family causing life-long infection of the host. The virus particle is enveloped with at least eleven glycoproteins present on

PAGE 19

the surface. The capsid of the virus is icosahedral in shape and the space between the envelope and the capsid, known as the tegument, contains proteins involved in the initial stages of infection. A diagram of the HSV-1 virion structure in Figure 1-1 illustrates the enveloped capsid with glycoproteins present on the outer surface of the envelope (Roizman and Sears, 1996). Grunewald et al. (2003) were able to use electron microscopy to clarify the HSV virion structure illustrating that the capsid arrangement in the tegument is asymmetrical and that the some 750 glycoprotein spikes present on each virion are arranged in an organized manner on the envelope surface. Figure 1-1. Diagram of the HSV-1 virion. HSV is an enveloped virus with an icosahedral capsid and glycoproteins present on the envelope surface (Roizman and Sears, 1996). The HSV infection is characterized by three phases. During the initial infection or establishment phase, lesions are seen primarily on the oral mucosa. The virus then enters sensory nerve termini and is transported to the sensory ganglia where it establishes a latent infection. The latent phase of infection is characterized by transcriptional activity from a single viral region encoding the latency associated transcripts (LAT), while the

PAGE 20

remainder of the genome is silenced. Latent infection is interrupted by periods of reactivation where productive infection resumes and the virus travels through the nerve axons back to the initial site of infection where lesions are seen on the skin surface (Roizman and Sears, 1996). The HSV-1 genome consists of approximately 152 kilobases (kb) of doublestranded DNA. The genome (Figure 1-2) consists of two unique regions, the unique long (Ul) and the unique short (Us), each flanked by two repeated regions, the long repeat (Rl) and the short repeat (Rs). The repeat regions are joined together by the "a" sequence, a 500bp highly R L U L R L R s U s R s LAT LAT Figure 1-2. Diagram of the HSV-1 genome. HSV possesses a double-stranded DNA genome that is organized into two repeat regions, the repeat long (Rl) and the repeat short (Rs), each flanking unique regions, the unique long (Ul) and the unique short (Us). The repeat regions are joined together by the "a" sequence. Also shown is the region encoding the latency associated transcripts (LAT). conserved region of small repetitive elements. HSV genes are identified by their relative time of expression rather than by their position in the genome. The classes of expression are alpha (a), beta (P), and gamma (y). During the latent infection, the viral genome associates with cellular histone proteins and circularizes to form an episome, thus existing as a "mini-chromosome" in the infected cell. It has recently been determined that episome formation occurs in the absence of lytic HSV gene products and the ICPO gene may be involved in the prevention of circularization (Jackson and DeLuca, 2003).

PAGE 21

HSV Gene Regulation Immediate Early Genes The alpha genes, also known as immediate early, peak in expression 2-4 hours post infection and include infected cell proteins (ICP) 0, 4, 22, 27, and 47. Transcription of the alpha genes is initiated by a complex including the HSV-1 tegument protein VP16 (also known as ccTIF) binding to the TAATGARAT octamer located in the immediate early promoters (Mackem and Roizman, 1982). Of the immediate early genes, ICP4 is a strong trans-activator of the early and late viral genes and is essential for viral replication. ICP4 binds to both consensus ATCGTC and non-consensus motifs in several other HSV gene promoters or 5 'untranslated regions. The trans activation function is promoted by ICP4 binding to DNA as well as the transcription factors TBP and TFIIB (Smith et al., 1993). While not essential, ICPO is believed to have multiple functions, including that of a non-specific transactivator (Cai and Schaffer, 1992) and a disruptor of ND10 regions in the nucleus (Davido et al., 2003). The exact purpose of ND10 structures in the nucleus has not been determined, but they may be involved in replication and during the infection a number of HSV proteins interact with ND10. Other studies suggest that ICPO is involved in reactivation from latency since the latency associated transcripts are expressed from the opposing strand of DNA in the same region as ICPO. Expressing ICPO in trans from an adenovirus vector was sufficient to induce reactivation in latently infected primary trigeminal ganglia cultures (Halford et al., 2001). These data support the theory of LAT acting as a switch to turn on ICPO during reactivation. The involvement of ICPO in reactivation will be discussed further in the section on LAT function.

PAGE 22

B -300 + 1 — % ^ %^Sf> '-%'% -105 -61 +1 D -29 +1 \\\ -48 +1 '_T "7 -870 141 -# + 1 W~ +600 ODO *\ *• ^ %p\%%%% % V' \% % Ci >. '<-> LAP1 LAP 2 Figure 1-3. Regulation of the different HSV gene promoter classes. A. Immediate early genes. B. Early genes. C. Late genes. D. Leaky Late genes. E. LAT gene. Abbrv: INR, initiator element. DAS, downstream activating sequence. LAP1, latency associated promoter 1. LAP2, latency associated promoter 2.

PAGE 23

8 Control of the immediate early genes is primarily under the direction of cellular transcription factors although viral binding sites are also present (Figure 1-3). In addition to a TATA box, immediate early promoters contain several SP1 binding sites and binding sites for the VP16 viral activator protein. The ICP4 binding sites in the promoter allow for down regulation of these genes by ICP4 as the course of infection progresses. Early Genes Early (3 genes include genes involved in viral replication such as the viral polymerase and thymidine kinase. These genes show peak expression 5-7 hours post infection. Despite containing only cellular elements in their promoters including SP1 sites, CAAT and TATA boxes (Figure 1-3), early genes require the viral ICP4 protein to stimulate expression through interaction with the TATA element (reviewed in Weir, 2001). Late Genes Structural proteins such as the glycoproteins and tegument proteins make up the group of late y genes which are expressed only after viral replication has occurred (Roizman and Sears, 1996; Wagner et al., 1998). Late genes are divided into two subclasses, yl and y2. yl genes are leaky lates and can be transcribed in small quantities before viral DNA synthesis has occurred. The y2 class consists of strictly late genes and dependent upon viral replication. Promoter sequences for the late genes are much less complicated than the promoters for the two preceding kinetic classes and are limited to a TATA element and a portion of the 5' noncoding region of the transcript acting as an enhancer for high levels of expression (Levine et al., 1990). Expression of some viral genes are required for late

PAGE 24

expression, and as an example, a transgenic mouse containing the gC promoter driving P-gal exhibited no expression of P~gal in neuronal or non-neuronal tissues (Loiacono et al., 2002). An example of both late promoter classes is presented in Figure 1-3. The Latency Associated Transcript During the latent period of infection, LAT is produced abundantly from the long repeat region of the genome. LAT is the only HSV-1 transcript that has not been classified in one of the classes of genes mentioned above (immediate early, early, or late). The LAT RNA is made as an 8.3-kb primary transcript and is spliced into several smaller RNAs. The most abundant LAT RNA is the 2kb intron that exists as a stable lariat structure with a >24 hour half life (Farrell et al., 1991; Thomas et al., 2002). The stability of the LAT intron may be due to the non-consensus branch point that allows for generation of the lariat structure during splicing (Wu et al., 1998). Additionally, in latently infected trigeminal ganglia a 0.5 kb region is spliced out of the 2 kb intron resulting in a second stable 1.5 kb species (Spivack et al., 1991; Alvira et al., 1999). There has been no direct evidence that LAT is translated into a protein during the HSV infection despite extensive studies including sequence analysis (Drolet et al., 1998), transient expression assays (Thomas et al., 1999), and site mutagenesis of ATG's (Bloom et al., 1996). Some of these studies were able to generate a LAT protein outside of the context of the natural viral infection, but there is no evidence to date that this protein is expressed during infection (Coffin and Thomas, 1998; Thomas et al., 1999). Transcription of LAT begins near the TATA box consensus sequence with the promoter extending as much as 870 nucleotides upstream of the transcription start site (Lokensgard et al., 1997). Several cellular regulatory sites have been identified in the

PAGE 25

10 LAT promoter region including cyclic AMP response elements (CRE), Spl sites, CAAT box, USF, YY1 and AP-2 (Kenny et al., 1994; Soares et al., 1996; Wagner and Bloom, 1997) as shown in Figure 1-3. The presence of cellular regulatory regions suggests possible cellular control of the LAT promoter which will be examined in the experiments presented in the following chapters. A second, TATA-less promoter, LAP2 (latency associated promoter 2) has been described in the region 3' of the LAP1 transcription start site (Figure 1-3). This region of DNA contains elements such as a G/C rich segment that are found in housekeeping genes and those genes involved in signal transduction pathways. Transcription from LAP2 is 510 fold less abundant than from LAP1 as determined by transient expression with a CAT reporter (Goins et al., 1994). LAP2 is active during the acute phase of the animal infection and also in cell culture of both neuronal (SY5Y) and non-neuronal (CV-1) cells but LAP2 is not active during the latent phase of infection in the absence of LAP 1 core promoter elements (Nicosia et al., 1993). The exact transcription start site for LAP2 has yet to be mapped and further studies are necessary to determine the function of transcript(s) derived from the LAP2 promoter. For the remainder of this dissertation the LAT promoter refers to the LAP1 promoter unless otherwise noted. Previous research has stated that LAT promoter activity is different in different cell types. In addition to expression in neurons during latency, Jarman et al. (1999) reported that LAT is expressed in murine feet during the acute infection following footpad infection using P-gal reporter viruses. The expression was seen two to four days post infection on both the dorsal (infected) and ventral sides of the foot and is in contrast to only low levels of LAT expression observed in non-neuronal cells in culture

PAGE 26

11 (Zwaagstra et al., 1990; Jarman et al., 1999). Additionally, more LAT expression was seen in neuronal cell types (ND7 and CI 300) than in non-neuronal rabbit skin cells using in vitro infections (Coffin et al., 1998). Further studies with LAT promoter deletions revealed LAT expression differences between neuronal cell cultures and infected dorsal root ganglia neurons (Dobson et al., 1995). This suggests that different neuronal cell types contain different levels or types of transcription factors and that there may be neuronal specific elements in the LAT promoter. In vivo two regions in the promoter, -75 to -83 and -212 to -348 relative to the transcription start site, showed increased activity in neuronal cells as opposed to non-neuronal cells (Kenny et al., 1994). Sensory ganglia contain a variety of cell types, both neuronal and non-neuronal. Margolis et al. (1992) analyzed some neuronal markers of neurons in mouse sensory ganglia that corresponded with either sites of HSV-1 LAT expression, or HSV-1 acute antigen expression and determined that the neuronal population expressing SSEA-3+ as a surface marker exhibited the highest percentage of LAT expression during acute infection in the absence of acute antigen. These differences in LAT promoter activity could be dependent on specific transcription factors present in different cell populations (Dobson etal., 1995; Yang et al., 2000). Animal Models of HSV Latency and Reactivation A number of animal model systems are used to study latency and reactivation. In the mouse, infection of the footpad results in latency in dorsal root ganglia (DRG). While not the natural route of infection, the footpad is a large epithelial surface that can support a uniform infection and dissection of infected tissues can be performed easily. One limitation to the mouse model is that HSV reactivation does not result in virus being transported to the primary site of infection as it does in humans. Local reactivation in the

PAGE 27

12 ganglia can be induced however, in one of two ways: co-cult explant of DRG or hyperthermal stress. The explant model uses the stress caused by dissection of the ganglia from the mouse to initiate reactivation. Dissected ganglia are incubated in tissue culture media and infectious virus is detectable in the media by 2 weeks after explant. Mimicking one of the natural causes of reactivation, fever, the hyperthermia model involves raising the body temperature of the mouse to 43C for 10 minutes to induce reactivation. While this model initiates the lytic cycle, lesions have not been seen at the initial site of infection but virus can be detected in the sensory ganglion at 24 hours post stress (Sawtell and Thompson, 1992). Another common model of HSV infection is the rabbit ocular model. Prior to HSV infection rabbit corneas are scarified to allow for a more uniform infection surface. In this model, latency is established in the trigeminal ganglia and HSV can either spontaneously reactivate or be induced to reactivate using iontophoresis of epinephrine to mimic the host stress response (Hill et al., 1986). There is one non-animal model of reactivation that involves culture of primary neurons in the presence of NGF. For infection, acyclovir (the nucleoside analog used to inhibit HSV lytic genes) and NGF are added to the media so that a quiescent infection is established without killing the neurons. Acyclovir is removed once establishment has taken place and reactivation can be induced by removal of NGF from the media (Colgin et al., 2001). These quiescent cultures are the closest system available to an in-vitro latency model, most tissue culture systems have the ability to support a lytic infection, but not establish latency.

PAGE 28

13 Function of LAT Establishment and Reactivation LAT has been linked with a number of different functions during the acute infection, although the most extensive body of data supports a role of LAT in the establishment of and/or reactivation from latency (Wagner, 1991; Roizman and Sears, 1 996). The regions of LAT involved in these functions and the others described here are depicted in Figure 1-4. Using overlapping dermatomes in the mouse, Speck and Simmons (1991) were able to demonstrate the establishment of latency (production of LAT) in the absence of lytic gene production, thus suggesting that lytic and latent pathways can diverge early in +1 !Inlron RCR -161 +424 +7( Virulence Effects +16 LTE +30 +661 Anti Apoptosis -161 +16( (LAP2) • 198 +158 +661 Figure 1-4. Diagram of the function of HSV-1 LAT. Different regions of LAT have been implicated in many functions. The location of these functions are mapped here including the reactivation critical region (RCR), virulence effects, the long term expression element (LTE), and anti-apoptotic region. Also included here is the location of the antisense to LAT transcript, AL.

PAGE 29

14 the infection. Separation of the establishment and reactivation functions was determined by a number of LAT mutants that maintain the ability to establish latency but do not reactivate (Bloom et al., 1994; Bloom et al., 1996; Wang et al., 1997). These viruses delete either the core promoter sequences of LAT or a region of the LAT 5' exon. Another LAT mutant, containing a large deletion encompassing both the LAT promoter and 827 bp of the 5 'exon, established 75% fewer latent infections than its wild type parent virus. It was predicted that this reduction may be due to an increase in neuronal cell death in the ganglia (Perng et al., 1994; Thompson and Sawtell, 2001). Since this virus contains deletions of both LAP1 and LAP2, and is phenotypically distinct from a LAP1 mutant, further studies are needed to determine if the increase in neuronal cell death is related to multiple but genetically separable LAT functions. Reactivation is typically related to a stress event for the host. In the rabbit eye model, reactivation is seen after iontophoresis of epinephrine onto the eye surface. In the mouse thermal stress model, reactivation of HSV is seen after an increase in basal body temperature. On a cellular level, the mechanism by which stress is translated to reactivation is not known. Deletion of the LAT core promoter eliminates the ability to reactivate, but viral DNA is still detected in neuronal ganglia. In addition to the LAT promoter, deletions of regions downstream of the transcription start site and extending into the intron have been shown to be important in HSV reactivation. The specific function of this region remains unknown, but deletions of a 348 bp fragment as well as a 371 bp Styl fragment located within the region result in reduced reactivation in the rabbit model (Bloom et al., 1996; Hill et al., 1996; Jarman et al., 2002). Smaller deletions in this region do not affect

PAGE 30

15 reactivation therefore, the act of expressing some LAT is not sufficient for reactivation, and presumably either specific RNA sequences or cis acting DNA elements located within the 5' exon are important for reactivation (Bloom et al., 1996; Bhattacharjee et al., 2003). The 5' exon region and the LAT core promoter are referred to as the reactivation critical region (rcr). Since expression of RNA itself is not sufficient for reactivation, other mechanisms of LAT action have been proposed. The regulation of reactivation and/or establishment may be at the DNA level. Many cellular genes use methylation of CpG islands as an epigenetic method of regulating transcription. In these genes, a methyl group is added to the cytosine of the DNA at regions to be either silenced or transcribed. Previous studies determined that methylation was not present in the HSV genome as a whole, but did not look at specific promoter regions of the genome. Using bisulfite analysis Kubat et al. (2004) determined that there is no pattern of methylation as a form of regulating HSV latent transcription. These data suggest that instead of methylation, the virus uses the DNA chromatin structure and its association with specific histone proteins as a means of regulation. Further studies indicate that there is a difference in the chromatin acetylation pattern during latency when comparing the LAT promoter to other acute HSV promoters (Kubat et al., 2004). Virulence Several LAT deletion mutants have an effect on virulence in either mice, rabbits, or both experimental systems. The dLAT1.5 virus contains a 5'exon deletion of ~1600bp and is increased for virulence in mice. Increased virulence in rabbits and decreased virulence in mice were seen with LAT2.9A which contains only a 371 bp deletion in the

PAGE 31

16 5' LAT exon. This virus was also reduced for spontaneous reactivation in the rabbit (Perngetal., 1999). Other mutants deleting either a portion of the 5'exon (A307) or the 3' portion of the intron (A480) exhibit decreased virulence (Gary et al., in preparation). These experiments on the whole indicate that there are differences in the infection between mice and rabbits since the deletion viruses produce different effects dependent on the model system used. Further studies are necessary to determine the mechanism employed by these viruses in both the mouse and rabbit models. Enhancer A number of studies have demonstrated that the LAT core promoter, by itself, is not sufficient to direct long-term expression (Margolis et al., 1993). The long-term expression element (LTE) has been described as the region of the 5' exon from PstI to the splice junction (Berthomme et al., 2001). Analysis using reporter constructs containing this region downstream of the core LAT promoter continued to express P~gal at 40 days post infection while the control (containing just the LAT core promoter) had no expression at 28 days post infection (Lokensgard et al., 1997). Transient expression experiments containing the LTE showed that the LTE region can activate the HSV-1 thymidine kinase promoter in both neuronal and non-neuronal cells (Berthomme et al., 2000). These data suggest that the LTE contains an enhancer element and functions to promote long term LAT expression. Neuronal Survival LAT has also been implicated as a suppressor of apoptosis. A large LAT deletion (-161 to +1667 relative to the LAT transcription start site) demonstrated increased

PAGE 32

17 apoptosis by both TUNEL and PARP assays (Pemg et al., 2000). Ahmed, et al. (2002) stated that plasmids lacking the sequences in the 5 LAT exon were least efficient in blocking apoptosis, and that this region appears to contribute to cell survival. This is the same region that contributes to the virulence and reactivation phenotypes mentioned above (Figure 1-4). Additionally, Thompson and Sawtell (2001) have used LAT null viruses to examine cell survival during infection. They showed that 75% less establishment of latency occurred in the LAT null virus and this was accompanied by a large amount of neuronal death. They propose that one function of LAT is to protect sensory neurons from death and enhance the establishment of latency. Other Possible LAT Functions Since LAT is transcribed antisense to ICP0 and the ICP0 gene is one of the first promoters activated in the lytic cascade, it was believed that LAT could have an antisense effect on ICP0 expression. A portion of the 2 kb LAT intron overlaps with the ICP0 transcript. In clonal cell lines containing these regions of DNA, Burton et al. did not find an antisense effect with ICP0 when expressing LAT in trans in non-neuronal cells (Burton et al., 2003). This does not mean that LAT cannot act in cis to affect the ICP0 region of transcription, perhaps acting on the DNA itself or in a structural manner to open or close the region of DNA. Another antisense function involves the transcript AL (antisense to LAT) which is transcribed 6-8 hours post infection in PC12 cells. AL is located in the 5 'exon and core promoter region of LAT (Figure 1-4), and may have an opposing or balancing function with LAT although more research is needed to specifically define AL and its function in the HSV infection (Perng et al., 2002). To date the AL transcript has only been detected

PAGE 33

18 in productively infected PC12 cells in culture using RT-PCR, and can not been detected in vivo. LAT also has a repressive function. A LAT mutant which had reduced LAT expression exhibited an increase in the amount of ICP4 and thymidine kinase expression compared to wild type infection (Chen et al., 1997). A possible mechanism for this repressive function may be explained by regions of sequence homology to Xist suggesting that LAT may function to "paint" the HSV chromosome to silence it similar to Xist painting the inactive X chromosome in mammalian cells (Bloom et al., 1996). The HSV LAT region encompasses a number of transcripts present on both strands of DNA. The various functions for LAT presented here may be important at different times during the course of HSV infection, and some may work in combination with other viral functions making them difficult to phenotypically dissect in the context of the virus. It is also possible that some of these functions are not manifest during the in vivo infection since they have been discovered and tested in cell culture systems only. This complexity of dissecting LAT functions provides the basis for generating a transgenic mouse containing this region of LAT DNA to further study its functions in the absence of the HSV genome and its contributed cis and trans acting viral functions. Use of Transgenics to Study Disease Expression of Acute Genes in Transgenic Mice Transgenic technology has been used to study the roles of genes out of their native context. To generate a transgenic animal, the gene of interest is injected into the single cell fertilized oocyte nucleus typically of mice, although other species have been used as well. By injecting the single cell, the transgene is able to be integrated and replicated with each cell division and is then present in every cell of the animal. The

PAGE 34

19 expression of the transgene is generally dependent upon the promoter used to drive the inserted gene. In the case of HSV-1, transgenic mice have been created to study regulation of the different classes of HSV genes. These mice each contain the HSV promoter in question driving a lacZ reporter. An ICP4 transgenic mouse expressed such a reporter under the control of the ICP4 promoter primarily in neuronal tissues, with lower levels of expression in trigeminal ganglia and retinas and high levels of expression in brain regions and the dorsal horn of the spinal cord (Mitchell, 1995). Additionally, ICPO and ICP27 transgenic mice demonstrated similar expression in neuronal tissues (Loiacono et al., 2002). In addition the ICPO and ICP4 transgenic mice were shown to differentially express the reporter based on the age of the mice. ICP4 transgenic mice had approximately 100-fold greater expression in newborn mice compared to adults. Differential expression of ICPO was the reverse of the expression seen with ICP4, with expression increasing with age. These findings indicate that although HSV immediate early promoters contain similar regulatory elements, they are regulated differently by cellular factors in the absence of other HSV proteins. In contrast to the findings with the IE promoters, both neuronal and non-neuronal cells were negative for expression in a gC transgenic mouse, illustrating that HSV late promoters require other viral functions for their expression (Mitchell, 1995; Loiacono et al., 2002). Expression of LAT in Transgenics Previously a LAT transgenic mouse had been created to specifically study the splicing of the 1.5 kb LAT out of the 2 kb LAT intron. This mouse contains the 2 kb LAT of HSV-1 under control of a CMV promoter. Studies have determined that the splicing event of the 1.5 kb species is more efficient in neural tissues than non-neural

PAGE 35

20 tissues and suggested that the LAT transgenic mouse reactivates more efficiently than non transgenic littermates (Mador et al., 2003). One of the drawbacks of this transgenic mouse model is that the CMV promoter was used instead of the native LAT promoter. The CMV promoter is a strong constitutive promoter that has activity in all cell types. Thus, while the splicing event may be specific to LAT, expression patterns may permit splicing in cell types that are non-permissive for the latent HSV infection. Using the LAT region from HSV-2, Wang et al. (2001) studied establishment and reactivation in a transgenic mouse. HSV-2 LAT was driven by its native promoter and had expression to high levels in neural tissues as well as some non-neural tissues determined by northern blots of tissue RNA. The expression in non-neural tissues was not expected, but not surprising since Jarman et al. had shown LAT expression in the feet during acute HSV infection (Jarman et al., 1999). In these mice expressing LAT in trans had no effect on the HSV-2 infection at the establishment or reactivation level. Since there are a number of differences in tropism between HSV-1 and HSV-2, and because the HSV-2 LAT intron is processed differently than that of HSV-1, the construction and analysis of an HSV-1 transgenic mouse model expressing the HSV-1 LAT from its native promoter was desirable and the focus of this dissertation. Hypotheses to be Tested Using the Transgenic Approach Generation of Transgenic Mouse In the studies presented here, we have generated a LAT transgenic mouse from HSV-1 strain 17+. This mouse line uses the native HSV-1 LAT promoter and contains the region encoding the LAT transcript 5' exon and 2 kb intron. The rationale for using these regions will be discussed further in Chapter 2. Initial characterization of the mouse

PAGE 36

21 includes determination of the transgene copy number, mapping the transgene insert and gross tissue-level expression studies. Expression of LAT in trans Since the LAT transgene is being controlled by the native LAT promoter and the region of the promoter shown to contain neuronal specific elements was included in the sequence inserted, it was hypothesized that LAT would be expressed in neuronal tissues. Data from the HSV-2 transgenic mouse suggests that LAT can be expressed in nonneuronal cells as well, although the expression was not quantitated (Wang et al., 2001). In this study, quantitative RT-PCR was employed to determine if neuronal cells could more efficiently produce the LAT transcript than non-neuronal cells. In addition to quantitative RT-PCR of RNA extracted from whole tissues, in situ hybridization techniques were used to determine if expression is from all cells or a subset of cells. Infections Effect of LAT on the course of infection It is known that in the context of the HSV genome LAT is expressed in neuronal cells during latency. It was possible that expressing LAT prior to the infection, in trans, could have an effect on the course of infection, such as altering the establishment of latency, or the ability of the virus to reactivate from latency. To study these effects, transgenic mice and their non transgenic littermates were infected with wild type 1 7+ HSV-1. Similar to the observations made in the case of the HSV-2 mouse, we hypothesized that expressing LAT in trans would not alter the HSV infection, and that during a natural HSV-1 infection, LAT functions in cis on the HSV genome.

PAGE 37

22 Restoration of virulence by expressing LAT in trans One of the functions attributed to LAT is a change in virulence (Gary et al., in preparation; Perng et al., 1999). By infecting LAT transgenic mice with a LAT mutant that is reduced in virulence, we hypothesized that the expression of the transgene containing the region deleted in the mutant could restore wild type virulence level if the function can act in trans. In this case, virulence was measured as a function of virus titers reaching the DRG and assayed by titering the amount of infectious virus present in feet and DRG during the acute infection following footpad inoculation. In summary, HSV-1 LAT is a complex region with a number of functions attributed to it. Generation of a transgenic mouse containing this region can be used to further define some of these functions a well as to determine which functions are transacting and can be attributed to the expression of the RNA.

PAGE 38

CHAPTER 2 GENERATION OF A TRANSGENIC MOUSE EXPRESSING A PORTION OF THE HSV-1 LATENCY ASSOCIATED TRANSCRIPT Overview The latency-associated transcript (LAT) of HSV-1 has been implicated as playing a role in a number of functions related to the viral infection. The mechanisms of these functions and the regulation of the LAT transcript have not been determined. To examine the regulation of the LAT in cells, we have generated a transgenic mouse containing the LAT inserted into the mouse genome. This therefore has allowed us to study the LAT's function outside its normal context of the HSV genome. Transgenic technology was first used in 1980 to inject HSV and SV40 viral plasmid DNA into a fertilized mouse pronucleus (Gordon et al., 1980); and has since expanded to include transgenic animals for a number of human disease models and viral gene models (Nomura, 1997). The use of mice for transgene studies is ideal because of the knowledge of mouse genetics and the number of different genetic strains available. Although other transgenic mice containing HSV LATs have been generated, they did not contain the native promoter sequence or the LAT from HSV-1 (Wang et al., 2001; Mador et al., 2003). Thus, the HSV-1 LAT transgenic mouse described here is a novel model system because it allows for LAT to be regulated by its native promoter. This mouse has provided a means for studying a number of the proposed LAT functions including reactivation, virulence, and neuronal survival. 23

PAGE 39

24 In addition to determining whether a transgenic mouse line expresses its transgene, characterization of any new transgenic mouse line routinely requires determining the copy number and the integration site of the transgene. The location of the transgene in the genome may effect transcription of the transgene by position effects. If the transgene inserts into a silenced region of the genome, it may not be expressed or expressed at low levels due to the regulation of the surrounding region of DNA (Sippel et al., 1997). The goal of this dissertation was to generate a HSV-1 LAT transgenic mouse to study LAT regulation by cellular factors in the absence of viral cis and trans factors. This chapter describes the construction, breeding strategy, and the initial characterization of the transgene in the HSV-1 LAT transgenic mouse line. Materials and Methods Plasmid Used to Generate the Transgenic Mouse The pLAT/LAT plasmid was generated to construct the transgene insert. A portion of the HSV-1 strain 17+ latency associated transcript (LAT), including the Dral site (corresponding to HSV-1 genome base pair 1 16,516) to the Aatll site (corresponding to HSV-1 genome base pair 121,549), was ligated into a pBluescript backbone at the Smal site. The SV40 poly A sequence from pNSE-Ex4 (a gift from G. Rail, The Fox Chase Cancer Center) was removed using EcoRI and inserted at the Xbal site into the pBluescript plasmid containing the LAT sequence. Figure 2-1 diagrams the region of the LAT gene used in constructing the transgene as well as its location in the HSV genome. The complete plasmid sequence and map is presented in Appendix A.

PAGE 40

25 Screening for Founders Containing the LAT Insert Fertilized oocytes were obtained from C3H/HeJ mice. Purification of the transgene, preparation of mice, microinjection into fertilized oocytes and embryo implants were carried out by Dr. Glenn Rail at Fox Chase Cancer Center as described (Hogan et al., 1986; Rail et al., 1995). DNA from the founder generation (Fl) of mice was obtained by clipping a 1 cm portion of the tail from anesthesized mice. Tail clips were incubated overnight at 50C in 0.5 mL STE buffer (50 mM TRIS pH 8, 100 mM NaCl, lmM EDTA, 1% SDS) and 1 mg Proteinase K. After incubation, hair and bone were removed by centrifugation at 20,000 x g and the supernatant transferred to a new centrifuge tube. DNA was extracted with equal amounts of phenol and sevag (1:24 ratio of isoamyl alcohol and chloroform) followed by extraction with sevag alone. DNA was precipitated with 100% ethanol. The DNA pellet was resuspended in TE (lOmM TRIS, lmM EDTA) pH 8 and quantitated by spectrophotometry at A 2 6oThe founder generation was screened by Glenn Rail using slot blot hybridization analysis. Briefly, 10 ug of DNA per slot of a slot blot apparatus was applied to a nylon membrane for hybridization as described by Rail et al. (1995). The membrane was probed with a 32 P-labeled DNA fragment from either the SV40 poly A sequence in the pNSE-Ex4 plasmid or a portion of the LAT transgenic insert fragment corresponding to 119,193 to 120,090 nucleotides (nt) of the HSV-1 strain 17+ genome. The nt determinations for all genomic HSV sequences presented in this dissertation are according to McGeoch numbering (Perry and McGeoch, 1988). Genotyping of subsequent generations was determined by PCR analysis. DNA was prepared from tail clips as described above. pLAT/LAT plasmid DNA was used as a

PAGE 41

26 R s U s R s Primary transcript lat 8.5 kb Transgene Insert ICPO Dral t Aatll SV40pA Figure 2-1 Diagram of the LAT Transgene Insert. Shown is the HSV-1 genome with the LAT region expanded to include the location of the LAT and ICPO genes. LAT is further expanded to illustrate the exact region included in generating the transgenic mouse. For the transgene insert the promoter is illustrated as a dotted line. A SV40 poly A sequence, shown here in red, was added to stabilize the expressed RNA. positive control for all genotyping PCR reactions. PCR primers were located in the 5' exon region of LAT corresponding to nt 1 18,888 to 1 19,037 of the HSV-1 genome (forward: 5'CGG CGA CAT CCT CCC CCT AAG C3' and reverse: 5'GAC AGA CGA ACG AAA CAT TCC G3'). Each reaction contained 200 ng of tail DNA, 0.5 uM of

PAGE 42

27 each primer, 1.5 mM Tris pH 8.8, 16.6 mM ammonium sulfate, 2 mM magnesium chloride, 0.17 mg bovine serum albumin, 1.25 mM each dGTP, dCTP, dATP, dTTP and 2.5 U Taq polymerase (Perkin Elmer). PCR was performed using a Ericomp thermalcycler (San Diego, CA) using the following conditions: one cycle 3 minutes 94C, 3 minutes 55C, 3 minutes 72C followed by 30 cycles 1 minute 94C, 1 minute 55C, 1 minute 72C. PCR products were viewed on a 7% polyacrylamide gel using S YBR green (Molecular Probes, Invitrogen) and a Storm Phosphoimager. The intensity of the tail DNA amplification products were compared to PCR's of dilutions of the positive control pLAT/LAT plasmid to determine the transgenic genotype by quantitating the intensity of the bands using Image Quant software. Breeding of Transgenic Mice All mice were maintained under specific pathogen free (SPF) conditions with access to food and water at will. Each cage contained corn cob bedding and cotton nestlets. Cage bedding was replaced bi-weekly. The positive founder mouse was backcrossed with a C57B1/6 mouse and the resulting litter screened by hybridization for presence of the LAT transgene. The F2 generation transgenic positive mice were again backcrossed in the C57B1/6 background. All breeder animals were at least 8 weeks old. Initial C57B1/6 breeders were obtained from Harlan. A small C57B1/6 colony was then maintained to provide C57B1/6 breeders. Mice were maintained as for the transgenic colony although only a single breeder pair was needed and genotyping was not necessary for these mice.

PAGE 43

28 Transgenic breeder cages contained one male with up to three females. Males were kept in the same cage with the breeder females for one week to ensure pregnancy. At approximately 1 8 days post breeding, females were separated into individual cages to deliver their litters. Pregnant females and newborns were monitored at least twice daily for difficulty with delivery and/or nurturing. Pups remained with their mother for three weeks until they were weaned and sex-separated. Genotyping of the weanlings was performed approximately one week after weaning. Backcrosses continued until obtaining the F10 generation at which time the transgenic background was considered to be genetically C57B1/6 and were crossed with F10 littermates to generate homozygous transgenics. All mice used in the studies described here are heterozygous for the LAT transgene and were of at least the F4 generation. Determination of Transgene Copy Number Slot blot hybridization Slot blot hybridization was used to determine transgene copy number. DNA from tail clips of weanlings was isolated and quantitated as described above for genotyping. For each sample 10 ug DNA, 15 uL 3 M NaOH, and 130 uL TE in a final volume of 175 uL was vortexed and incubated at 65C for 30 minutes. During the incubation, the slot blot apparatus (Gibco BRL) was loaded with Zeta Probe membrane (Bio Rad) pre-wet in water followed by 15x SSC. Incubated samples were ice-quenched and 165 uL of 2 M ammonium acetate added just prior to loading into the blot apparatus. Vacuum was applied after all the samples had been loaded.

PAGE 44

29 Prior to hybridization the blot was baked for two hours in a vacuum oven at 80C. Pre-hybridization and hybridization were carried out at 65C in 20 mL of hybridization buffer (5x SCC, 5x Denhardt's solution, 1% SDS) in a sealed bag with each incubation lasting overnight. ATD 19 probe (nt 1 19,664 to 1 19,972 bp of the HSV genome) labeled with 32 P was added to the buffer after the first overnight incubation. The labeled blot was washed twice for 15 minutes each at room temperature with 0.3 M NaCl, 0.06 M Tris pH 8.0, 0.002 M EDTA followed by two washes for 15 minutes each at 65C with 0.3 M NaCl, 0.06 M Tris pH 8.0, 0.002 M EDTA, 4% SDS. After washing the blot was dried on Whatman paper and exposed to a phosphor screen overnight. The intensity of the radiolabled bands was detected on a STORM phosphorimager and quantitated using image quant software. Real time PCR To confirm and further quantitate the transgene copy number, a comparison between the cellular Xist gene and LAT transgene was made using real time PCR. Reactions were performed using primers specific for the 5' exon of the LAT and Xist. Primer and probe sequences were 5 'LAT forward: 5'GGC TCC ATC GCC TTT CCT, 5 'LAT reverse: AAG GGA GGG AGG AGG GTA CTG, 5' LAT probe: 5'TCT CGC TTC TCC CC, Xist forward: 5'GCT CTT AAA CTG AGT GGG TGT TCA, Xist reverse: 5'GTA TCA CGC AGA AGC CAT AAT GG, Xist probe: 5'ACG CGG GCT CTC CA. PCRs were performed on an ABI Prism 7700 thermal cycler (Applied Biosystems) located in the ICBR protein core at the University of Florida. Ten-fold dilutions of the LAT transgenic plasmid (pLAT/LAT) corresponding to 10 4 to 10 1 copies were used to generate a standard curve. For the Xist cellular control, a standard curve of the pBl/BlO

PAGE 45

30 plasmid, a generous gift of Dr. Jeannie Lee (Shibata and Lee, 2003), was diluted 10 fold between 10 5 and 10 1 Samples were run in triplicate. Each reaction contained 10 ng tail DNA, 0.33 pL 60x Assay Mix (primer/probe set), 10 pL Taqman Universal PCR Mix (Applied Biosystems part #430437) in a final volume of 20 pL. PCR was performed in 96 well plates under the following conditions: 1 cycle 2 minutes 50C, 1 cycle 10 minutes 95C, 40 cycles 15 seconds 95C 1 minute 60C. Mapping of Transgene Insert Mapping of the LAT DNA inserted into the transgenic mouse was determined using both conventional and real time PCR. For conventional PCR, reactions contained 600 ng each of forward and reverse primers, 20 pL Hot Master PCR mix (Brinkman Eppendorf) and 200 ng tail DNA in a 50 pL final reaction volume. Control PCR reactions contained 600 ng each of forward and reverse primers, 20 pL Hot Master PCR mix and 0.5 ng pLAT/LAT plasmid DNA in a final reaction volume of 50 pL. Primer sequences, genome locations and optimal conditions for all primer sets used are found in Appendix B. Real time PCR was used for two regions of the transgene, one in the promoter and one in the 5' exon. Primer and probe sequences for these reactions are found in Appendix B. All real time reactions were performed on an ABI Prism 7700 thermal cycler (Applied Biosystems) located in the ICBR protein core at the University of Florida. Samples were run in triplicate. For each reaction, 50 ng of tail DNA was added to 0.33 pL 60x Assay Mix (primer/probe set) or 1 pL 20x Assay Mix, and 10 pL Taqman Universal PCR Mix (Applied Biosystems part #430437) in a final volume of 20 pL. Control reactions used 1 ng of pLAT/LAT plasmid in place of the tail DNA. PCR was performed in 96 well plates

PAGE 46

31 under the following conditions: 1 cycle 2 mintues 50C, 1 cycle 10 minutes 95C, 40 cycles 15 seconds 95C 1 minute 60C. Northern Blot of Transgenic RNA Harvesting of transgenic tissues Transgenic mice were euthanized with halothane and brain, DRG, liver, kidney, and foot were dissected. Tissues were snap frozen in liquid nitrogen and stored at -80C until processed for RNA. Isolation of RNA from tissues Tissues were homogenized in 400 pL Trizol reagent (Invitrogen) using Kontes glass tissue grinders (Fisher) or a ceramic mortar and pestle for larger tissues (i.e. skin, feet, liver). Sterile sand was added to the mortar to aid in grinding of the feet. Grinders were rinsed twice with 400 pL Trizol each and this rinse solution added to the ground tissue fraction. After 5 minutes at room temperature, 240 pL of chloroform was added and homogenates vortex ed 15 seconds followed by a 5 minute incubation at room temperature. Tissue homogenates were centrifuged at 9,000 x g for 15 minutes at 4C and the aqueous phase containing the RNA was removed to a separate tube. The bottom Trizol layer was stored at -80C for subsequent back-extraction of DNA, if necessary. RNA was precipitated with 500 pL of isopropanol at room temperature for 10 mintues followed by centrifugation at 12,000 x g for 10 minutes at 4C. RNA pellets were washed with 1 mL 70% ethanol and centrifuged 5 minutes at 4C, 7,500 x g. The resulting pellet was air dried briefly and resuspended in 200 pL diethyl pyrocarbonate (DEPC, Sigma)-treated water.

PAGE 47

32 Preparation of formaldehyde-agarose gels and blotting of RNA To prepare the gel for RNA, a slurry of 1 gram of agarose was prepared in 75 mL of sterile DEPC-treated water and microwaved to melt the agarose. The melted agarose was then cooled to approximately 60C and, just prior to pouring the gel, 20 mL of 5X 3(N-morpholino) propanesulfonic acid (MOPS) and 5.3 mL of a 37% formaldehyde solution (v/v) was added and mixed gently to prevent bubbles from forming in the gel. The gel was allowed to harden for at least one hour before loading the RNA. For each RNA sample, 5 ug of RNA was mixed with 15.5 mL FFLB (10 parts formamide, 3.5 parts 37% formaldehyde, and 2 parts 5x MOPS) in a total volume of 20 uL and incubated for 15 minutes at 65C. Samples were snap-cooled on ice prior to loading on the gel, and 2 uL of RNA dyes (50% glycerol, ImM EDTA, 0.25% bromophenol blue, 300 ug/ul ethidium bromide) were added to each sample for loading. Running buffer consisted of 160 mL 5x MOPS, 43 mL 37% formaldehyde q.s. to 800 mL with DEPC-treated water. The RNA was electrophoresed at 85 volts for approximately 3 hours. The dye front ran approximately 9 cm from the wells on a 14 cm gel. RNA was viewed using ultraviolet light and photographed with a digital camera (Kodak Photo Documentation System). Transfer of RNA to membrane The RNA was transferred onto to Zeta Probe Nylon Membrane (Bio Rad) according to the manufacturer's directions. The gel was rinsed briefly in water and transfer set up using Whatman paper as the wicking for capillary transfer. In addition to the membrane located on top of the gel, four layers of whatman paper and 2 inches of paper towels were included. For the transfer solution, 10X SSC was allowed to absorb

PAGE 48

33 from the reservoir through the wicking papers at room temperature overnight. The transferred membrane was rinsed in Nanopure water and baked at 80C in a vacuum oven for 30 minutes to crosslink the RNA to the membrane. Hybridization of northern blot ATD19 probe (corresponding to nt 1 19,664 to 1 19,972 from the HSV genome) was random hexamer primed (Random Labeling Kit, Roche) and labeled with 32 P dCTP. The blot was pre-hybridized for 3 hours at 42C in 20 mL FPH buffer (5X SSC, 5X Denhardt's solution, 50% Formamide, 1% SDS) in a sealed bag. Labeled probe was added through a small cut in the corner of the bag and resealed. The hybridization was incubated overnight at 42C. The Northern blot was washed twice at room temperature with 50 mL 2X SSC/0.1% SDS for 5 minutes each followed by two washes in 0.2X SSC/0.1% SDS for 5 minutes each at room temperature. The blot was dried briefly on Whatman paper and exposed to a phosphor screen for 5 hours. A STORM phosphorimager was used to scan the blot and the intensity of bands measured by Image Quant software (Molecular Dynamics, Sunnyvale, CA). Results Determination of the Number of Copies of the LAT Transgene When generating transgenic animals, it is common for multiple copies of the transgenic insert to be integrated into the animal genome (Ellis et al., 1997). There are a number of ways to determine the number of integrated copies, including hybridization and PCR. Initially, we used slot blot hybridization to quantitate the copies of LAT transgene present in these mice. In this case, the LAT hybridization signal from a known

PAGE 49

34 quantity of transgenic-positive tail DNA was compared to the hybridization signal generated from a known number of copies of LAT plasmid DNA spiked into a negative tail DNA sample to represent increasing copies per cell of the transgene. Comparison of the transgenic-positive and transgenic-negative mouse DNA to the control samples indicated that there was a low number of copies present in the transgenic mouse (figure 2-2). The difficulty in distinguishing between the positive and negative samples may have been due to an error in dilution of the standards since this involved a spectrophormetrically determined quantity. Neg .1 1 copy ii 2 copies mmmm 5 copies Figure 2-2. HSV transgene copy number determination by slot blot hybridization analysis. Tail DNA from a transgenic (pos) and non-transgenic (neg) mouse was compared to known copies of a plasmid containing the transgene, in the background of tail DNA from a non-transgenic mouse. Hybridization is not a reliably quantitative method, particularly with low copy numbers, thus to more accurately evaluate the number of LAT transgenes inserted we switched to real time PCR. For this system of analysis, a cellular gene of known copy number, Xist, was compared to the number of copies of LAT in transgenic tail DNA. Since Xist is located on the X chromosome, the sex of the animal was taken into consideration and the copies of Xist for female mice was divided by 2 to standardize

PAGE 50

35 samples to compare the LAT transgene to a single copy of the cellular control for both male and female samples. Table 2-1 contains the PCR data for the cellular and LAT PCR reactions. Although the copy number determined by this analysis is less than one, when taking into account the error of the samples, and the fact that there has to be an integer number of copies, the most likely interpretation is that there is only a single copy of LAT present in these mice. TABLE 2-1 Determination of transgenic copy number by real-time PCR. Xist Copies 1 LAT copies LAT/Xist 1 3.03 x 10 J 1.28 xlO J 0.422+/0.109 2 1.56 xlO J 5.43 x 10" 0.348 +/0.209 3 1.47 xlO J 4.30 xlO 2 0.293+/0.193 4 2.69 x 10 J 2.80 xlO 3 1.041+/0.306 5 3.39 xlO J 5.83 x 10 3 1.720+/0.385 Average i -,™ 0.765 +/0.240 While mosaicism is possible in up to 30% of transgene insertions (Wilkie et al., 1986), the genetic inheritance from the breeding of these mice does not suggest that a mosaic is present. In a mosaic animal, the transgene inserted into the genome after the first cell division and is therefore not present in the genome of each cell in the animal. If this were the case, only a portion of the germ cells would contain the transgene and thus less than 50% of the offspring of a transgenic and wild type mating would carry the transgene. With almost 500 offspring from transgenic and wild type matings to date, we have not seen evidence consistent with mosaicism in the LAT transgenic mouse. Mapping of the Transgene Insert Generation of the transgenic founder mouse was more difficult than usual, requiring three separate sets of injections to obtain a single founder. Screening for the

PAGE 51

36 founder mouse determined that the SV40 poly A signal has been deleted, thus the founder was LAT positive and SV40 negative (G. Rail, personal communication). PCR analysis of DNA from transgenic mice was used to confirm the extent of the LAT transgenic insert present in the transgenic line. As described in the materials and methods, both conventional and real time PCR were used to map a large portion of the transgene. Figure 2-3 illustrates the location of primer sets used to map the transgene, and indicates those that were positive for presence of the transgene. The regions analyzed by conventional PCR are represented by black arrows, while the regions analyzed by real time PCR are shown in red. Also shown are the locations of two probes, ATD17 and ATD19 (shown in blue) which were used in hybridization analyses described later that also confirmed the presence of the regions of the LAT in the transgenic mouse. The PCR products resulting from the conventional PCR reactions (figure 2-4) illustrate bands of the indicated sizes with both pLAT/LAT plasmid and mouse tail DNA. One additional primer set AG29 and AG31 failed to detect the corresponding LAT sequences in the DNA from the transgenic mouse. The location of these primers is represented in green, and corresponds to the 3' end of the transgene insert (figure 2-3). Since this primer pair (AG29 &3 1) has failed to detect a product from transgenic DNA it is believed that a portion of the 3' end of the transgene has been deleted in addition to the SV40 poly A signal.

PAGE 52

37 LAT Promoter Intron Dral X — X IJ AatO = ATD17 = X c IJ Z ATD19 S J> IJ Promar X X h o w DB60&61 X \0 X o X w X vl Mint AG29&30 10 10 N) o o -J. X o vl X M2 Probe to p j> p IJ LPro 5' LAT X x u iu 4 X IJ £ •J tu AG29&31 u c Ul 4Ul 4w Figure 2-3. Mapping of the LAT transgene in the LAT transgenic mouse. The blue lines represent the location of hybridization probes positive with the indicated LAT regions. Black arrows depict primers used for conventional PCR analysis positive for the transgene, and primers used for real time PCR analyses are shown in red. Illustrated in green are conventional PCR primers that were positive in reactions with the transgenic plasmid but not in reactions containing DNA from the transgenic mouse suggesting that this region has been deleted.

PAGE 53

38 A. Promar DB60, 61 M int M2 Probe B. 149 1$m+ioi H20LATTg H20LATTg H20LATTg H20LATTg AG29, 30 Z.Z.O c. H20LATTg AG29,3l 489 — ? H20LATTg Figure 2-4. PCR mapping the transgene insert. A. Four primer sets, Promar, DB60&61, M int, and M2 Probe, all present in both the LAT plasmid (LAT) and transgenic mouse (Tg). H 2 lanes are no template control. B. Primer set AG 29&30 present in both LAT plasmid and transgenic mouse. C. Primer set AG29&3 1 present in LAT plasmid but not transgenic mouse. The location of the primer sets in the HSV genome are diagrammed in figure 2-3.

PAGE 54

39 Determination of Transgene Expression by Northern Blot Analysis Initial expression studies to determine if LAT was active in the transgenic mouse line were carried out using a Northern blot and probing for the LAT intron which typically accumulates to high levels in ganglia of infected mice. Since the transgene is present in all cells of the mouse, neural and non-neural tissues were analyzed to see if expression or accumulation of this intron was different in the various types of tissue. DRG that were latently infected with HSV were used in this experiment as controls for both the presence and size of the stable intron. Figure 2-5b demonstrates that the LAT intron is accumulating in the DRG of transgenic mice but not in the other tissues tested (Liver, Kidney, Brain, Feet). The RNA gel (figure 2-5 a), when photographed using ultraviolet light indicated that there was RNA present in each of the wells and that there was more RNA present in the Kidney and Brain samples than the DRG sample. Thus, the lack of hybridization in the samples was not due to the absence of RNA. Lack of intron accumulation in tissues other than the DRG does not mean that LAT is not being expressed in those tissues. In the tissues not accumulating LAT intron, splicing may be inefficient or the intron maybe destabilized. The presence of a higher molecular weight band in the brain sample (figure 2-5b) may support these theories but further studies are necessary to confirm the mechanism involved in the lack of intron accumulation. The size of the LAT intron band (relative to the sizes of the 28s and 18s RNA bands) when compared to the controls (DRG compared to K6) indicates that the intron from the transgenic mouse is complete, measuring to approximately 1 .9 kb.

PAGE 55

40 1.9 kb Figure 2-5. Expression of the LAT transgene. A. Agarose gel of total RNA from transgenic and HSV-1 infected mice. In the transgenic total RNA was isolated from liver (LV), kidney (K), foot (F), brain (BR), and dorsal root ganglia (DRG). Control RNA from HSV infected mice (K6). The location of 1 8s and 28s RNA is marked on the gel. B. Northern blot using a probe for the LAT 2kb intron. Accumulation is seen only in the infected DRG and the transgenic DRG. A larger molecular weight band in the brain suggests that there may be a splicing difference between different types of tissue.

PAGE 56

41 Discussion Unlike typical transgenic inserts, the LAT founder mouse was particularly difficult to produce and required three separate injections. When the founder mouse was generated there was only a single founder compared to other injections where there are usually at least 10% transgenic animals in the first litter (Voncken, 2003), and the LAT founder has deleted the SV40 poly A sequence. One potential interpretation of this result is that a portion of the LAT region inserted in the context of genomic DNA may be lethal to the embryo. Further studies are necessary to determine if this is the case. However, the LAT transgenic line that was created can be (and has been) used to study LAT regulation and functions provided that it is stable and expressed. Initial studies by both hybridization and PCR to determine the number of transgene copies inserted indicate that the LAT transgenic line contains a single copy. The fact that only a single copy was inserted is consistent with the possibility that LAT inserts may not be well-tolerated in mice since it is common to have multiple copies of typical transgenes integrated at a single locus of the mouse genome, in some cases more than 100 copies have been shown to be inserted (Ellis et al., 1997). Screening for the founder mouse determined that the LAT transgenic mouse was LAT positive and SV40 negative. The probe used to screen for LAT in this case encompassed 897 bases of the transgene and would not evaluate the extent of the deletion. In data presented here it was shown by PCR that the deletion is confined to the 3' most end of the transgene and may be as little as 132 bases. Based on figure 2-5b it appears that the deletion does not include the splice acceptor site since the stable 2kb LAT intron can be detected in transgenic DRG.

PAGE 57

42 The LAT intron exists as a stable lariat structure with a half-life of approximately 24 hours (Thomas et al., 2002). The results obtained from Northern blotting transgenic RNA suggest that the intron is present in its entirety and can be stably expressed in DRG but not in the other transgenic tissues examined. The lack of intron signal in non-neural tissues does not mean that LAT is not being expressed. It is possible that the intron is stable only in ganglia or that splicing of the intron is not as efficient in non-neuronal cells.

PAGE 58

CHAPTER 3 EXPRESSION PROFILE OF THE LAT TRANSGENE Overview The previous chapter presented data that the LAT transgenic mouse was expressing the LAT transgene through the detection of the stable intron in dorsal root ganglion cells by Northern blot analysis. A quantitative expression profile encompassing both neural and non-neural tissues is presented in this chapter. Since the HSV LAT is expressed during latency, we expected that LAT expression is being regulated largely by cellular functions, and we therefore expected to see LAT expression in the transgenic mouse. What was less clear was whether some viral function contributed to the regulation of LAT expression, and since no other viral genes were present in the transgenic mouse to regulate LAT expression we expected the transgenic mouse would be a valuable tool to look at the cellular control of the LAT promoter. During the course of infection, accumulation of LAT intron typically occurs in neuronal cells (Rodahl and Stevens, 1992), suggesting that neurons contain some factor not present in other cells to allow for the expression of LAT or to prevent its repression. If this was the case, then LAT expression should be seen either exclusively in neural tissues or at higher levels in neural tissues of the transgenic mouse. Therefore, examining LAT expression in neural vs. non-neural cell types was a high priority goal for this investigation. The two previously described HSV transgenic mice have used non-quantitative methods to examine expression of the LAT transgene. Both the HSV-2 LAT transgenic and the HSV-1 LAT intron transgenic used a Northern blot to assess transgene 43

PAGE 59

44 expression, and only a few different tissues were examined. In the case of the HSV-2 LAT transgenic mouse, detailed expression data was presented only for some central and peripheral nervous tissues and expression in non-neural tissues was mentioned in the discussion, but data was not presented (Wang et al., 2001; Mador et al., 2003). In addition to determining the tissue-specific expression profile, the cell-specific expression of LAT was examined by in situ hybridization. The Margolis group reported that during an experimental HSV-1 infection of mice, the LAT is expressed in a particular subset of neuronal cells of DRG and TG (Yang et al., 2000). By in situ hybridization analysis of the LAT transgenic mouse, we sought to determine if LAT is being expressed in all cells or a subset of cells as evidence of whether LAT expression in different neurons is controlled primarily by cell-specific factors or whether trans-acting viral factors may contribute to the differential expression profile noted by Margolis. Materials and Methods Harvesting of Transgenic Tissues Transgenic mice were euthanized with halothane and cortex, hypothalamus (cerebrum bottom), cerebellum, spinal cord, olfactory bulb, TG, DRG, spleen, liver, kidney, skin, foot, heart, intestine, eye, and lung were dissected, snap-frozen in liquid nitrogen, and stored at -80C until processed for RNA. Isolation of RNA from Tissues Tissues were homogenized in 400 uL Trizol reagent (Invitrogen) using Kontes glass tissue grinders (Fisher) or a ceramic mortar and pestle for larger tissues (i.e. skin, feet, liver). Sterile sand was added to the mortar to aid in grinding the feet and skin. Grinders were rinsed twice with 400 \xL Trizol each and the rinse solution was added to

PAGE 60

45 the ground tissue fraction. After a 5 minute room temperature incubation, 240 uL of chloroform was added and homogenates were vortex ed 1 5 seconds followed by a 5 minute incubation at room temperature. Tissue homogenates were centrifuged at 9,000 x g for 15 minutes at 4C, and the aqueous phase containing the RNA removed to a separate tube. The bottom Trizol layer was stored at -80C for back extraction of DNA if necessary. RNA was precipitated by the addition of 500 pL of isopropanol and incubation at room temperature for 10 minutes followed by centrifugation at 12,000 x g for 10 minutes at 4C. RNA pellets were washed with 1 mL 70% ethanol and centrifuged 5 minutes at 4C, 7,500 x g and the resulting pellet air dried briefly and resuspended in 200 uL diethyl pyrocarbonate (DEPC, Sigma) treated water. DNA contamination of the RNA was reduced using DNA-free (Ambion, Austin, TX). One half of the tissue RNA was added to 2 units of DNasel and 0.1 volumes of DNasel buffer, mixed gently and incubated at 37C for 30 minutes. After the incubation, 0.1 volumes of DNase-inactivation reagent was added to each tube and incubated at room temperature for 2 minutes. DNase inactivation reagent was pelleted at 1,000 x g for 1 minute and supernatant was transferred to a new tube. RNA was then quantitated spectrophometrically. Reverse Transcription of Tissue RNA cDNA was prepared from tissue RNA using Moloney Murine Leukemia Virus Reverse Transcriptase (MMLvRT) and random hexamer priming. For each tissue sample, 500 ng total RNA was added to 4 uL 5x RT buffer (Invitrogen), 10 pmol random hexamers, 12.5 uM each dATP, dTTP, dGTP, dCTP, 200 units MMLvRT (Invitrogen)

PAGE 61

46 and 20 units RNasin (Promega) in a final volume of 20 uL. Reactions were incubated at 37C for 1 hour followed by 10 minutes at 100C to inactivate the reverse transcriptase and then ice quenched. Real Time PCR Reactions The amount of LAT RNA in each transgenic mouse tissue sample was quantitated using real time PCR and compared to cellular control RNA as described below. Primer and probe sequences Primer and probe sequences for the transgene were 5 'LAT forward: 5'GGC TCC ATC GCC TTT CCT, 5 'LAT reverse: AAG GGA GGG AGG AGG GTA CTG, 5' LAT probe: 5'TCT CGC TTC TCC CC. The location of these primers was diagramed in figure 2-3. 18s RNA was used as a cellular control. The primer and probe set was obtained from Applied Biosystems (PN 4308329). Control 18s RNA was provided with the 18s kit and was reverse transcribed in the same manner as the tissue RNA as described above. Standards A standard curve was generated for each of the primer sets used. The pLAT/LAT transgene plasmid was used as standard to determine copy number by performing PCR on 10-fold dilutions of this target ranging from 10 4 to 10 1 copies. The cellular control standard was 18s RNA and was used in 10-fold dilutions 10 ng to 1 pg corresponding to the amount of RNA added to the reverse transcription reaction. This amount was converted to copy number for final analysis. Conversion of the 18s data from was required because the program associated with the Real Time thermalcycler will not accept numbers for standards that are higher than 10 6 To calculate copy number for 1 ng of 18s the size of mouse 18s RNA (1869 bp)

PAGE 62

47 was obtained from the Qiagen catalog appendix (Qiagen, 2003) and the following formula was used with 6.6 x 10" 4 equaling the mass of one base pair. v4 lng = frnol x 6.6x1 0" 4 x 1869bp uL lng =1.23354 frnol pL 0.81 frnol x lxlO' 15 moles 8.13x10 16 moles x 6.022xl0 23 molecules = uL frnol pL mole 4 .9xl0 8 molecules pL The molecules/ pL were multiplied by the number of copies generated by the real time program to convert ng to molecules. PCR reactions All reactions were performed on an ABI Prism 7700 thermal cycler (Applied Biosystems) located in the ICBR protein core at the University of Florida. Samples were run in triplicate. For each reaction, 2 pL of the reverse transcription reaction was added to 0.33 pL 60x Assay Mix (primer/probe set), and 10 pL Taqman Universal PCR Mix (Applied Biosystems part #430437) in a final volume of 20 pL. PCR was performed in 96 well plates under the following conditions: 1 cycle 2 minutes 50C, 1 cycle 10 minutes 95C, 40 cycles 15 seconds 95C, 1 minute 60C. In-situ hybridization of Transgenic Tissues Preparation of tissue sections DRG, kidney, brain, and spinal cord tissues were harvested from transgenic, nontransgenic littermates, and infected mice and fixed with 4% paraformaldehyde in

PAGE 63

48 phosphate buffered saline (PBS) overnight at 4C then transferred to 70% ethanol. Tissues were embedded in paraffin blocks and thin sections cut by the pathology core laboratory at the University of Florida. To remove paraffin from cut sections, slides were treated three times for 2 minutes each in Xylenes and then washed twice in 100% ethanol followed by 95%, 70% and 50% ethanol, each for 2 minutes. Prior to hybridization, slides were treated to remove excess protein and the cellular DNA in the following manner. Fixed tissue was denatured in 0.2M HC1 at room temperature for 20 minutes, followed by 2 rinses in distilled water 5 minutes each at room temperature, incubated at 70C for 30 minutes in 2x SSC, followed by 2 rinses in water 5 minutes each at room temperature. The slides were then treated with Proteinase K (1 ug in 0.02 M Tris pH 7.4, 0.002 M CaCl 2 ) at 37C for 15 minutes followed by 2 rinses in water 5 minutes each. DNase pretreatment was performed under treated coverslips. Briefly, coverslips were acid washed in 1 M HC1 for 20 minutes then rinsed 3 times in water for 5 minutes each and 3 times in 95% ethanol for 5 minutes each. A final wash for 5 minutes in 100% ethanol dehydrated the coverslips which were then baked for 5 hours in a drying oven at 220C. For each site, 30 uL of 12U RNase-free DNase (Stratagene) in 20 mM Tris pH 7.4, 10 mM MgCl 2 was added and coverslipped. Slides were then incubated at 37C for 1 hour in a humid chamber. Tissues were rinsed extensively (5x) in 2x SSC 5 minutes each and post fixed in freshly made 5% paraformaldehyde, 0.3 N NaOH in phosphate buffered saline pH 7 for 2 hours in the dark. Excess fixative was removed by washing 3 times in 2x SSC, 5 minutes each and twice in water 5 minutes each. To reduce non-specific hybridization, samples were acetylated in 0.1 M triethanolamine pH 8 with 0.25% vol/vol

PAGE 64

49 acetic anhydride for 10 minutes with stirring then rinsed twice with water for 5 minutes each. A final denaturing step in 95% deionized formamide with O.lx SSC incubated for 15 minutes at 70C followed by a 2.5 minutes rinse in ice cold O.lx SSC and 2.5 minutes in a water rinse. Preparation of hybridization probes Probes were prepared from pATD 17 (nt 1 18,863 to 1 19,343) and pATD 19 (nt 1 19,628 to 1 19,975) plasmids, as diagrammed in figure 2-3, using a random hexamer labeling kit. pATD 17 was digested with PstI and SphI and pATD19 was digested with EcoRI and Hindlll to remove the HSV DNA from the plasmid backbone. Both inserts were purified on an agarose gel and the DNA recovered by freeze fracture. For the labeling reaction, 100 ng of digested plasmid DNA was incubated with random hexamers, S 35 dCTP, cold dGTP, cold dTTP, cold dATP, and Klenow fragment overnight at room temperature according to the random hexamer labeling kit (Roche) specifications. Labeled probes were purified on a Sephadex G-50 spin column to remove unincorporated nucleotides and quantitated by counting 1 p.L of labeled probe on a liquid scintillation counter. Hybridization The hybridization solution was prepared as follows: 1.5 x 10 5 cpm/site of the labeled probe was ethanol precipitated with 10 |ag of salmon sperm DNA, 1/50 volume 5M NaCl and 2 volumes ethanol and incubated at -80C for 15 minutes. The probe DNA was pelleted by centrifuging for 30 minutes at 4C, the ethanol was removed, the pellet dried briefly, and resuspended in 20 uL TE. Immediately before use, the probe was heated to 100C for 5 minutes, followed by quenching on ice. Probes were diluted to 1.5

PAGE 65

50 x 10 5 cpm/site by adding hybridization solution (50% deionized formamide, 0.3 M NaCl, 10 mM Tris pH 7.4, 2x SSC, 1 mM EDTA pH 8, lx Denhardt's solution, 100 ug/uL denatured salmon sperm DNA, 250 ug/uL, tRNA, and 5 f^g/uL polyA) and heated to 100C for 2 minutes, followed by quenching on ice. To pre-hybridize the probe, the diluted probes were incubated at 45C for 1 hour, followed by quenching on ice. For the hybridization, 20 uL of the prehybridized probe solution was added to the tissue sections. Slides were covered with a treated coverslip and sealed with rubber cement. Hybridization was carried out at 45C for 72 hours. Washes Cover slips were removed by peeling off the rubber cement from the slides. The slides were first washed in low stringency wash solution (50% crude formamide, 0.3 M NaCl, 10 mM Tris pH 7.4, 1 mM EDTA pH 8) with stirring for 72 hours with 6 changes of wash solution during that period. The first wash change was after 2 minutes to remove excess hybridization solution. After the first wash, a small piece of nylon membrane (i.e. Hybond-N) was included in the washing jar to collect any unbound probe. After the low stringency wash, slides were washed for 2 hours in high stringency wash solution (50% formamide, 2x SSC, 10 mM Tris pH 7.4, 1 mM EDTA pH 8) at 40C. Slides were rinsed twice in 2x SSC for 5 minutes each and dehydrated in ethanol (70%, 70%, 95%) containing 0.3 M ammonium acetate to stabilize the counts 5 minutes for each wash. Filming To film the slides, NTB-2 nuclear track emulsion (Kodak) diluted 1:1 with 0.6 M ammonium acetate was liquefied at 45C in the dark. Each slide was dipped into the

PAGE 66

51 emulsion once and allowed to dry approximately 20 minutes before being stood in a slide drying rack for 3 hours with drierite. After slides were completely dry, they were put into slide boxes containing drierite for up to 2 weeks at 4C. Each slide had a non-hybridized blank slide between it and the next slide to prevent the 35 S on one slide from nonspecifically exposing the emulsion on adjacent slides. Developing Slides were warmed to room temperature for approximately 1 hour before developing. Fresh D-19 developer (Kodak) was used for each experiment. In the darkroom, slides were incubated for 4 minutes in D-19 followed by 3 washes in water for 30 seconds each. Slides incubated in fixative (Kodak rapid fixer) for 4 minutes followed by 2 washes in water 5 minutes each. Slides were counterstained with freshly made Giemsa (Sigma) for 20 minutes, rinsed extensively in tap water and allowed to dry before coverslipping and sealing with Permount. Statistical Analysis All data was analyzed using GraphPad In Stat software version 3.05 for the Macintosh computer. Results Determination of the Amount of LAT Expressed in Non-Neural vs. Neural Tissues Comparison of transgene expression on a per weight basis The amount of LAT RNA present in transgenic tissues was determined by real time PCR. Real time PCR is more accurate than traditional PCR methods because it allows for data collection at the exponential phase of amplification, as opposed to conventional PCR, which measures only the final amount of PCR product. Since conventional PCR endpoints often represent reactions that may have plateaued many

PAGE 67

52 cycles earlier, quantitative comparisons must be made following a series of dilutions of the DNA targets, to insure that comparisons are being made under conditions where all of the PCR products reflect a linear correspondence with the amount of target present in each sample. Since real-time PCR measures the rate of product formation, linear ranges of comparisons of all samples and standards are easily made. For each tissue, 500 ng of total RNA was reverse transcribed (RT) and then a fraction of the RT reaction used for PCR with a real time primer and probe set located within the 5'exon region of LAT (see Figure 2-3). Quantitation of samples was standardized by generating a standard curve from PCR reactions containing known quantities of pLAT/LAT plasmid DNA. Figure 3-1 a represents the expression data presented on a per gram of tissue basis for a group of 4 eight week old mice. Both neural and non-neural tissues exhibited expression of the LAT transgene ranging from 3.51 x 10 4 to 3.88 x 10 6 copies/gram of tissue. The variations between the tissues were compared by ANOVA and were not significantly different (F=1.079, P= 0.4017). Power analysis indicated that more than 100 mice would be needed to attain a statistically significant difference between the expression levels in the transgenic tissues because there was little difference, relative to the error, between the different tissues. While on the whole there was no significant difference between all of the transgenic tissues, we wanted to look closer at the tissues typically involved in the HSV-1 infection. For these analyses, paired t-tests compared skin with DRG (t= 1.676, P=0.1546) as well as feet with DRG (t=1.780, P=0.1253) demonstrated no significant difference between either pair of tissues.

PAGE 68

53 A. 1.00E+08 l.OOE+07 1.00E+06 1.00E+05 ~ 1.00E+04
PAGE 69

54 Comparison of LAT expression in the various tissues normalized to levels of 18s RNA Although there was no significant difference in LAT expression between the different tissues when compared on a per weight basis, this calculation did not take into consideration that different tissues are composed of different cell types and each cell type has a different density. As a result, comparison by weight, while typically accepted as a basis for comparison did not represent the expression of LAT per cell. To examine the LAT transgene expression on a per cell basis, RT data was normalized to the amount of 18s RNA present in each sample. For these studies, 18s RNA was chosen as the normalizer because it was a cellular housekeeping molecule that remains fairly constant in all tissues (Thellin et al., 1999). This is also a very abundant RNA species, therefore in order to compare the amount of LAT to the amount of 18s RNA present in each tissue sample, the 18s values were divided by 10 8 copies to be in the range of the LAT transgene expression. The expression profile of the same mouse tissues from figure 3-1 was reanalyzed in figure 3-2 on the basis of 18s RNA. ANOVA determined that there was no statistical significance between the transgenic tissues when normalized to the amount of 18s RNA present in each tissue (F=1.308, P=0.2274). Comparing the tissues involved in the HSV infection, feet vs. DRG (t=T.202, P=0.2746) or skin vs. DRG (t=0.9631, P-0.3797) on a per 18s RNA basis again resulted in no significant difference in the amount of LAT expression between these tissues. The implications of this finding are considered in the Discussion section.

PAGE 70

55 A. 1.00E+06 l.OOE+05 1.00E+04 > 1.00E+03 s 'o. 8 1.00E+02 l.OOE+01 l.OOE+00 ll 1 I in i i Hypothalamus Cerebellum D Cortex D Ol&ctory Bulb Spinal Cord Dorsal Root Ganglia Trigeminal Ganglia Skin Foot Heart Kidney Lung Eye Liver Spleen Intestine B. l.OOE+06 I.00E+05 5 1.00E+04 1.00E+03 < 1.00E+02 -I l.OOE+01 l.OOE+00 I 1 IDRGAcuteHSV-1 I DRG Latent HSV-1 Figure 3-2. Expression of LAT normalized to 18s RNA. A. Taking into account the different cell densities in different tissues, LAT expression in transgenic tissues was compared on a per cell basis by dividing the copies of LAT by 10 8 copies of 18s RNA in each tissue. n=4. B. Comparison of the amount of LAT in infected DRG at acute and latent times post infection normalized to copies of 18s RNA.

PAGE 71

56 Comparison of the Amount of LAT Expressed in the LAT Transgenic Mouse to the Amount of LAT Expressed in the DRG During HSV Infection In the HSV-1 infection not all the DRG cells are infected and of the infected cells only a portion detectably express LAT (Rodahl and Stevens, 1992). To compare the amount of LAT being expressed in the transgenic mouse to the amount of LAT in an infection, we infected mice with 17+ HSV-1 (wild type) and harvested DRG at 4 days post infection (d.p.i.) (acute) and 28 d.p.i. (latent). These ganglia were processed to isolate RNA and LAT expression was quantitated by RT-PCR as described above. Figure 3-lb and 3-2b illustrate the amount of LAT present in DRG during the acute and latent infection compared to the amount of LAT present in the transgenic tissues in Figure 3la and 3-2a respectively. The transgenic DRG contained 10-fold more LAT expression per gram of tissue than either the acute or latent infected DRG. When compared on a per weight basis there was no statistical difference between the amount of LAT expressed in the transgenic DRG and either the acutely infected DRG (P= 0.1448) or the latently infected DRG (P= 0.1204). When we looked at the amount of LAT in the infected tissues on a per cell basis, there was approximately 10 fold more LAT in the infected tissues than in the transgenic DRG. Statistically, the difference between the transgenic DRG and the latent DRG was not quite significant (P= 0.0786) while the difference between the transgenic DRG and the acute DRG was significant (P= 0.0283) when compared relative to the amount of 18s RNA (Figure 3-2). While we would have expected there to be more LAT in the transgenic tissue compared to the infection, it has been shown that ganglionic levels of LAT are highest at the peak of the acute infection and decline as latency is established. If this is the case, the differences in LAT

PAGE 72

57 expression between the transgenic and infected tissues are minimal. This will be discussed further in the discussion section. Analysis of Transgene Expression as a Function of Age Previous studies with HSV-1 transgenic mice expressing reporters behind ICPO and ICP4 promoters demonstrated a difference in expression of these two lytic gene promoters as a function of the age of the mice (Mitchell, 1995; Loiacono et al., 2002). To determine if the LAT transgenic mouse exhibited an age related expression pattern, we compared the amount of LAT RNA present in selected tissues at 1 day, 1 month, 2 months, and 18 months of age. A representative sample of these data is presented in figures 3-3 and 3-4 while the profile for the entire tissue sampling is located in Appendix C. There was no age related general trend of LAT expression among all of the tissues tested. When compared by weight, the spinal cord (P= 0.3303), DRG (P= 0.6908), TG (P= 0.4050), skin (P= 0.1728), and feet (P= 0.0657) had no significant difference in the amount of LAT transgene expressed at different ages. This remained the same when comparing LAT expression on a per cell basis using 18s RNA as a reference, with the Pvalues of the spinal cord (P= 0.2859), DRG (P= 0.4803), TG (P= 0.2429), skin (P= 0.5305), and feet (P= 0.5707) indicating a lack of significance (figure 3-4).

PAGE 73

58 1.00E+02 l.OOE+01 :* & $ $• Day Old 1 Month Old 1 Month Old 2 Month Old 18 x c Figure 3-3 LAT transgene expression is not age dependent in tissues typically involved in the HSV infection when normalized on a per weight basis. l.OOE+01 1 Day Old 1 Month Old 2 Month Old D 18 Month Old 3 J> P Figure 3-4. Expression of the LAT transgene is not age dependent in tissues involved in the HSV infection when calculated per cell by normalizing to 18s RNA.

PAGE 74

59 Analysis of Transgene Expression in Neural and Non-neural Tissue at the Cellular Level Using In situ Hybridization In situ hybridization examined two properties of expression, the number of cells expressing the transcript of interest and the cellular localization of the transcript (nuclear or cytoplasmic). To determine if the LAT transgene was being expressed in all cells of transgenic tissues we probed for either the 5' LAT exon or the LAT intron by RNA in situ hybridization. These tissue sections were counterstained with Giemsa stain after hybridization which is a general membrane stain. In DRG, neurons were visible as large blue round nucleated cells. The tissue between the groups of neurons included support cells and the axons leading to the neuron cell bodies. Figure 3-5 illustrates the architecture of the DRG magnified to point out the location of the nucleus seen as a white m.fc-fc' Figure 3-5. In situ hybridization of a latently infected dorsal root ganglia. This photograph illustrates the neurons of the dorsal root ganglia (blue) and points out the sub-cellular architecture with arrows pointing to the nucleus and nucleolus of neurons. The small black dots on some of the cells are the positive hybridization signal.

PAGE 75

60 or lighter stained region within the neurons and the nucleolus seen as a gray circle within the nucleus of some neurons. The DRG is the primary site of LAT expression during the HSV infection following footpad inoculation. Figure 3-6a illustrates the nuclear localization of expression of the LAT 5' exon during the latent infection, marked by black arrows. Surprisingly, in the transgenic DRG there were a subset of neurons that express LAT with a different localization pattern than the infected DRG (compare figure 3 -6a black arrows with figure 3-6b red arrow) and some of the expression appears to be cytoplasmic. This sub-population was in addition to the nuclear staining cells (figure 3-6b black arrows) in the transgenic tissues that have the same pattern as the HSV infected DRG. A non-transgenic mouse exhibited only background signal in this experiment (figure 3-6c). When probed for the LAT intron, transgenic DRG showed the nuclear localization of high levels of expression and low levels of expression in neurons as seen in Figure 3-7. The cytoplasmic localization of LAT was not detected with the intron probe. Neurons were counted to quantitate the positive sub-populations of neurons for both the infected and the transgenic tissues with the 5' exon probe. During the HSV infection LAT has been shown to be expressed in approximately one third of latently infected neurons (Gressens and Martin, 1994; Maggioncalda et al., 1996). The data presented here illustrated that LAT was being expressed in slightly more than two thirds of transgenic neurons compared to just less than one third of neurons in infected dorsal root ganglia (Table 3-1). Additionally, the transgenic tissue expression can be further

PAGE 76

61 B. > .'>i5 Figure 3-6. In situ hybridization for 5' LAT exon. A. Latently infected dorsal root ganglia. B. Transgenic positive dorsal root ganglia. C. Transgenic negative dorsal root ganglia. Black arrows represent hybridization of nuclear LAT

PAGE 77

62 C. as \ Neurons w? *VT Figure 3-6 (cont'd), expression. Red arrow indicates cytoplasmic LAT expression. Arrows in C point out the neurons and axons of the DRG. K C 1 Figure 3-7. In situ hybridization for LAT intron in transgenic DRG. Black arrows represent nuclear localization of hybridization at both high and low levels of expression.

PAGE 78

63 divided into three subpopulations, darkly stained or high expression (33%), weakly stained or low expression (56%), and cytoplasmic stained (11%). Further studies are needed to determine if these subpopulations coordinate with neuronal markers for neuronal subpopulations. Table 3-1. Quantitation of LAT Expressing Cells in Dorsal Root Ganglia by in situ hybridiz ation for the 5' LAT exon Number Positive Percentage Of Total Latently Infected 1 204 25 Transgenic Tissues Totals 2 709 65 Darkly Stained 233 3 33 Weakly Stained 399 56 Cytoplasmic Stained 77 11 ited = 806 z Tol ;al neurons counted = 109 neurons in the transgenic, percentage is of total positive transgenic neurons. A significant finding of this study is that the 5' LAT expression pattern seen in the transgenic DRG was not seen in other tissues of the transgenic mouse. A comparison of other neuronal tissues of the transgenic mouse demonstrated a small amount of detectable LAT expression in the thalamic neurons of the brain (figure 3-8 and figure 3-9) with considerably less intensity than in DRG (compare figure 3-6b with figure 3-8 and 3-9). Additionally, a small number of neurons in the spinal cord (figure 3-10) were expressing LAT to levels comparable to that in the DRG. As with the DRG, further studies are necessary to determine if these hybridization positive cells are from a specific population

PAGE 79

64 B. Hippocampus Thalamus .. : ; Figure 3-8. In situ hybridization for LAT 5'exon in brain. A. Transgenic brain lOx B. Transgenic brain magnifying the thalamic region 40x.

PAGE 80

65 A. Hippocampus B. Thalamus -~ •:."' "... Figure 3-9. In situ hybridization of the transgenic brain with LAT intron probe. A. Low magnification for orientation purposes. (lOx) B. Positive signal (black arrows) was detected in thalamic neurons with primarily lower levels of expression than seen in the DRG. (40x)

PAGE 81

66 A. 4 ~ £ r *r *' i if r ** B. *'? *. V X • -* Figure 3-10. In situ hybridization in the transgenic spinal cord. A. 5' LAT exon probe. An example of positive neurons is marked with black arrows and examples of negative neurons are marked with red arrows. B. LAT intron probe.

PAGE 82

67 of neurons. In contrast to the QRT-PR data for the non-neural tissues, both the transgenic foot (Figure 3-1 1) and the transgenic kidney (Figure 3-12) exhibited no detectable LAT expression by in situ hybridization. The cell specific distribution of LAT expression exhibited by the transgenic mouse in both neuronal and non-neuronal tissues has important implications for the final analysis of the overall LAT expression levels in the different tissues of the transgenic mouse. This will be discussed in detail in the following section. Discussion The LAT was able to be expressed in the absence of other HSV proteins in the transgenic mouse. We had expected to see this expression primarily in neural tissues (brain, spinal cord, ganglia) and possibly some epithelial tissues as well, for example skin and foot, which have demonstrated some LAT expression during the HSV infection (Jarman et al., 1999). The data presented here show that LAT can be detected at relatively high overall levels, in a variety of tissues in the transgenic mouse. The tissues expressing LAT were consistent with the expression patterns seen in the HSV-2 transgenic mouse (Wang et al., 2001) that was under control of the native HSV-2 LAT promoter. We were unable to compare the amount of expression between the LAT HSV1 and HSV-2 mice because quantitative data were not reported in the HSV-2 mouse. An important consideration, however, is that the analysis of the expression data on a per weight basis did not take into consideration that different cell types have different densities and cell compositions, although this is the standard method for representing such data. To provide a per cell based analysis, we compared the expression data to 18s RNA levels. Selection of a cellular gene to be used as a control must be done

PAGE 83

68 A. B. | Figure 3-11. In situ hybridization of transgenic foot. A. LAT 5' exon probe B. LAT intron probe. There was no hybridization signal with either probe in the LAT transgenic foot.

PAGE 84

69 B. • ( J*-'.— Figure 3-12. In situ hybridization in the transgenic kidney. A. LAT 5' exon probe B. LAT intron probe. No positive hybridization signal was detected with either probe.

PAGE 85

70 with care since a number of cellular genes exhibit varied expression in different cell types. In our studies these differences would have had an effect on the quantification of LAT expression in the different tissue types. The 18s RNA species is a cellular housekeeping gene that is considered to be constant in all cells (Thellin et al., 1999) allowing for comparison between tissues. Similar to the per weight analysis, LAT expression had no significant difference between tissues. Despite of the inability to detect a difference in expression by either analysis, the 18s RNA comparison appeared to be a more accurate overall representation at the cellular level. The per weight analysis of expression would be sufficient for more general comparisons but is not quantitative when expression may be present in only certain cell types of a complex tissue. There was a statistically significant difference between the amount of LAT in the acute infection and the amount of LAT in the transgenic DRG when compared on a per 18s basis. The comparison with the latent infected DRG was not quite significant but there was more LAT produced in the infected tissue than in the transgenic DRG. In combination with the in situ data which suggests that LAT is not being produced in every cell of the DRG, it is not hard to conceive that there could be more LAT in the infected tissue. Further studies are needed to determine if this is the case, however, the 18s RNA comparison remains a valid comparison between the noninfected tissues of the transgenic mouse since they are comparing LAT that is being controlled in the same manner. We have also shown that LAT was not expressed in an age dependent manner. Studies of immediate early HSV genes in transgenic mice determined that both ICPO and

PAGE 86

71 ICP4 were expressed with age dependent differences (Mitchell, 1995; Loiacono et al., 2002). There were a number of factors that made the comparison of the LAT and the immediate early studies difficult. In the immediate early study they were counting the number of cells expressing a (3-gal reporter, not measuring the amount of p-gal expressed. Our 18s RNA analysis would suggest that there was not a great variation in the number of cells expressing the LAT transgene, but again, the two quantitations may not be directly comparable. Interestingly, LAT is not expressed in all cells of the transgenic mouse. In situ hybridization for the LAT transgene illustrated that in the DRG, the transgene was being expressed in only a subset of neurons. The pattern of LAT expression in the DRG of transgenic mice seems to differ from the expression in the HSV-1 infection. In the transgenic DRG we can detect two intensities of LAT expression, both nuclear in localization, that were similar to the infected DRG, although more abundant. Additionally, there was a small fraction of cytoplasmic localization of LAT expression in the transgenic mice when using the LAT 5' exon probe but not with the LAT intron probe. It is not clear whether these observed differences are related to LAT expression differences by the transgenic mouse, or due to influences of other viral factors that may modulate LAT expression in these neurons during a normal HSV infection. In addition, further studies are needed to determine if these neurons have a particular characteristic or if expression is in a random subset of neurons. Based on the expression patterns of LAT in infected DRG and on the in situ data from the spinal cord in seems more likely that the expression positive neurons in the transgenic mouse should have a particular characteristic.

PAGE 87

72 In other transgenic tissues, LAT expression was not detectable by in situ hybridization with either the 5' LAT exon or LAT intron probes. The kidney and foot both had transgene expression when measured by RT-PCR for the 5' exon but expression was not seen by in situ hybridization. This could suggest that in some tissues LAT expression is leaky in all cells and thus below the level of sensitivity for the in situ but, in the neuronal tissues expression is confined to a subset of neurons resulting in the ability to detect the expression by in situ hybridization. The small number of cells expressing the LAT transgene in the spinal cord appears to support this theory in addition to the expression in the DRG. These findings may suggest that LAT expression is more tightly and dramatically regulated in sensory neurons.

PAGE 88

CHAPTER 4 CHARACTERIZATION OF THE EXPRESSION OF LAT IN TRANS ON THE COURSE OF HSV-1 INFECTION IN MICE Overview HSV-1 infection is characterized by three phases; acute, latent and reactivation. The LAT has been suggested to play some role in all three phases, although its most striking phenotype seems to be primarily at the level of reactivation (Wagner, 1991; Bloom et al., 1994; Bloom et al., 1996b; Wang et al., 1997). The mechanism of its action in this process has not been determined. Limited amounts of LAT have also been seen during the acute phase of infection, although at present, there is no function linked to this expression (Jarman et al., 1999). If the LAT RNA used a trans mechanism of action, exerting a function on an HSV-1 DNA molecule that had not actually produced the LAT RNA, then we would expect to see a phenotype at some phase of the HSV infection in the LAT transgenic mouse. For example, we could experimentally infect the LAT transgenic mouse with a LAT(-) virus and phenotypically convert the virus to resemble wild type. Contrarily, if LAT functions in cis, functionally regulating or interacting with the DNA molecule that produced the LAT RNA, then there would be no visible phenotype when infecting the LAT transgenic mouse with HSV-1 With this in mind, experiments that examined the acute, establishment and reactivation phases of the HSV-1 infection were performed in the LAT transgenic mouse. For the acute studies, LAT transgenic mice and their nontransgenic littermates (as controls) were infected with HSV-1 on their rear footpads. The 73

PAGE 89

74 relative progression of the acute infection was assessed by the yield of infectious virus in the feet, spinal ganglia, and spinal cord at selected time points post infection. Establishment of HSV latency was assessed by the amount of HSV-1 DNA present in the DRG of transgenic and non-transgenic mice after the acute infection had resolved. Explant co-cultivation was used as a reactivation model to determine if the LAT transgenic mouse exhibited detectable differences in the ability to reactivate latent HSV. Finally, deletion of a portion of the LAT region has been shown to dramatically reduce the virulence and yield of virus within sensory neurons (Gary et al., in preparation). While it has been shown that this virulence function acts independently of the LAT promoter (which is primarily involved in reactivation), this new function still resides within the region of the LAT gene present in the transgenic mouse. Here we sought to determine if this phenotype could be rescued by using the LAT transgenic mouse to provide the deleted region in trans during an experimental HSV infection. Given the dramatic reduction in virulence associated with this LAT deletion, we felt this would be a sensitive test of the LAT's ability to act in trans. Materials and Methods Growth of Cell lines and Viruses Rabbit skin (RS) cells were maintained in minimum essential media (MEM) with Earle's salts supplemented with 5% calf serum and antibiotics at 37C in a 5% CO2 incubator. HSV-1 strain 17 + and the HSV-1 mutant 17A480 were grown and titered on RS cells. The mutation in 17A480 deletes a portion of the LAT intron corresponding to nucleotides 1 19,502 to 1 19,981. Characterization of this virus has been described elsewhere (Jarman et al., 2000).

PAGE 90

75 Footpad Infection of Mice All infections used adult mice of at least 6 weeks of age, HSV-1 LAT transgenics and their transgenic negative littermates of at least the F6 generation. Mice were transferred to the UF animal care infectious disease suite after genotyping, and were allowed to acclimate to their new housing conditions for at least one week prior to infection. Mice were anesthetized with halothane and subcutaneously injected with 0.1 mL of 10% saline in each of the rear footpads. Four hours post saline pre-treatment, mice were anesthetized with 0.010 to 0.020 mL of a ketamine cocktail (2.5-3.75 mg/kg acepromazine, 7.5-1 1.5 mg/kg xylazine, 30-45 mg/kg ketamine) intramuscularly in the thigh. Both rear footpads were abraded with an emery board to remove the keratinized layer of skin tissue. Using a pipette tip, 1 x 10 6 plaque forming units (pfu) of virus in 50 pL volume was added to the footpads and allowed to absorb for one hour with mice lying on their backs under anesthesia. Mice were monitored twice daily for signs of complications due to anesthesia or infection. Harvesting of Infected Tissues At specified times post infection, mice were euthanized with halothane and infected tissues were dissected (feet, DRG, spinal cord). Tissues were snap-frozen in liquid nitrogen and stored at -80C until processed. Determination of Viral Titers from Infected Tissues Infected tissues were homogenized in Kontes glass tissue grinders (Fisher) or a ceramic mortar and pestle (feet). DRG were ground in 1 mL MEM with supplements and grinders rinsed with 0.4 mL MEM. Spinal cords were ground in 2.5 mL MEM and rinsed with 2.3 mL MEM. Feet were ground with 2.5 mL MEM containing 2x antibiotics and

PAGE 91

76 250 ng/mL fungizone and sterile sand then rinsed with 5 mL MEM. Homogenates were centrifuged at 3000 x g for 15 minutes to pellet cellular debris. Titration dishes were prepared with rabbit skin cells in 24 well plates to be subconfluent at the time of inoculation. Serial dilutions from 10" to 10" oftheti^ue homogenate supernatants were made in MEM with supplements. Media was removed from the titration plates and 200 uL of each dilution of tissue homogenate was added in triplicate, and virus allowed to absorb for 1 hour at 37C with 5% CO2. After the inoculation, plates were rinsed with 2 mL of MEM to remove the inoculum and any residual cell debris and 2 mL MEM was added to each well. Cells were incubated for 72 hours at 37C with 5% CO2 then the media was removed and the cells were stained with crystal violet to view plaques. Excess crystal violet was rinsed off with tap water and plates were allowed to air dry before counting. Determination of the Amount of HSV DNA in Latently Infected Mice Adult transgenic mice and their non-transgenic littermates were infected as described above with 1 x 10 6 pfu of HSV1 17 + (wild type) and monitored for complications. After 28 days, mice were euthanized, DRG removed, and snap-frozen in LN 2 until processing. DRG were ground in 400 uL Trizol reagent in a Kontes glass tissue grinder (Fisher) to extract DNA. Grinders were rinsed twice with 400 uL Trizol each and rinse solution was added to the ground tissue. After a 5 minute room temperature incubation, 240 pL of chloroform was added and the homogenates were vortex ed for 15 seconds followed by a 5 minute incubation at room temperature. Tissue homogenates were centrifuged at 9,000 x g for 15 minutes at 4C. At this point, the clear aqueous phase containing the RNA was removed to a separate tube.

PAGE 92

77 RNA was precipitated with 500 pL of isopropanol at room temperature for 10 minutes followed by centrifugation at 12,000 x g for 10 minutes at 4C. RNA pellets were washed with 1 mL 70% ethanol and centrifuged 5 minutes at 4C, 7,500 x g. The resulting pellet was air dried briefly and resuspended in 200 pL diethyl pyrocarbonate (DEPC, Sigma) treated water. RNA fractions were stored at -80C for later use. The lower phase (Trizol) of the extractions from the initial centrifugation step was removed from the bottom keeping the interface intact. DNA was back extracted from the remaining interface by adding 150 pL of 0.1 M Tris and 0.1% Sarkosyl and centrifuging 5 minutes at 20,000 x g. This back-extraction was repeated twice, pooling the aqueous layer after each centrifugation. Proteinase K (0.1 pg/pl) was added to the pooled backextracted DNA samples and incubated at 37C overnight. DNA was purified by sequential extractions with an equal volume of phenol and sevag followed by extraction with sevag and precipitation in 100% ethanol. Pellets were resuspended in 50 pL TE and quantitated spectrophotometrically (A26o)The amount of HSV genomes present in each mouse was quantitated by real time PCR using primers and a probe specific for the HSV polymerase (pol) gene. Details of the real time procedure were presented in chapter 3. The HSV pol primer/probe set was custom made by Applied Biosystems, Assays by Design with the forward primer sequence 5'AGAGGGACATCCAGGACTTTGT, reverse primer sequence 5'CAGGCGCTTGTTGGTGTAC and probe sequence 5'ACCGCCGAACTGAGCA (65,880 to 65,953 nt). For the PCR reaction, conditions were 1 cycle 2 minutes 50C, 1 cycle 10 minutes 95C, 40 cycles 15 seconds 95C 1 minute 60C as described in chapter 3.

PAGE 93

78 A standard curve was generated using HSV-1 genomic DNA of known copy number ranging from 10 5 to 10 2 copies. Unknown samples were assayed using 50 ng of DNA per reaction and were compared to the standard curve values for quantitation. Explant Co-cultivation of Latently Infected DRG Latently-infected transgenic and non-transgenic mice were euthanized and DRG dissected as described above. DRG were cultured in MEM on with a RS cell monolayer at 37C with 5% C0 2 to detect reactivating virus. Every 48 hours, half of the media was removed and replaced with fresh MEM to ensure the integrity of the monolayer. Cells were monitored daily for 14 days for the presence of rounded, HSV infected RS cells. Results Expression of LAT in trans Does Not Detectably Alter the Course of an Acute HSV1 Infection in Mice While the mouse footpad model of HSV-1 infection does not use the natural site of HSV infection, it mimics the natural infection in that HSV can infect the epithelial surface of the foot and travel along the sciatic nerve to reach the DRG. The reason that the footpad model is extensively used to assess virulence properties of HSV-1 strains and to study the progression of the acute infection is that it provides HSV-1 with a longer path to travel through the nervous system until it reaches the brain. Therefore one can sensitively assay the relative replication potential of different strains of HSV as it travels from the foot, to the DRG, to the spinal cord and then to the brain. To determine if expressing the LAT in the context of the transgenic mouse would affect the course of the HSV-1 infection, we infected transgenic and non-transgenic mice using the footpad model with wild-type HSV-1 strain 17+. The rationale for this experiment is that if LAT is hypothesized to play a role in regulating HSV-1 gene

PAGE 94

79 expression, expression of LAT prior to the HSV-1 infection might affect the outcome of the acute infection, if could function in trans. Following footpad infection, tissues along the path of HSV infection were assayed for amounts of infectious virus present at acute times post infection, days one to four (figure 4-1). There was no significant difference between the transgenic and non-transgenic mice at any of the four time points tested, day 1 P= 0.3501, day 2 P= 0.2403, day 3 P= 0.5476, and day 4 P= 0.5519. Similarly, the amount of infectious virus in the DRG at acute times post infection shown in figure 4-2, exhibited no significant difference between transgenic and non-transgenic mice, day 2 P=0.7364, day 3 P= 0.4309, and day 4 P= 0.3735. These data suggest that LAT was not l.OOE+08 1.00E+07 1.00E+06 1.00E+05 1.00E+04 1.00E+03 1.00E+02 1.00E+01 1.00E+00 Transgenic Pos Transgenic Neg Day 1 Day 2 Day 3 Day 4 Figure 4-1. Relative amounts of infectious virus in the feet of transgenic and nontransgenic mice infected with HSV-1 strain 17+ during acute times post infection. n= 4

PAGE 95

80 1 .00E+06 1.00E+05 1.00E+04 1.00E+03 1.00E+02 1.00E+01 1.00E+00 I Transgenic Pos I Transgenic Neg Day 1 Day 2 Day 3 Day 4 Figure 4-2. Titer of infectious virus in DRG of transgenic and non-transgenic mice infected with HSV-1 strain 17+ at acute times post infection. n= 4 affecting the acute phase of the HSV infection by being expressed at earlier times {prior to infection) in the transgenic animals, and the LAT was not acting in trans to detectably alter the outcome of the acute phase of HSV-1 infection. Establishment of HSV-1 Latency in Transgenic Mice Once the virus reaches the ganglia, it is able to establish latency in ganglionic neurons. Since the LAT has been proposed by some to play a role in the establishment of latency (Speck and Simmons, 1991; Bloom et al., 1994; Bloom et al., 1996a; Wang et al., 1997), the expression of the LAT in the transgenic mice may affect the amount of establishment in these mice. In order to determine if the expression of the LAT transgene altered the amount of HSV that established latency in the infected mice, we infected transgenic and non-transgenic mice with 1 x 10 6 pfu HSV-1 17 + (wild type) and waited 28 days for latency to be established. Mice were euthanized and DRG harvested and snap frozen in LN 2 until processed to extract the DNA. HSV DNA was quantitated

PAGE 96

81 using real time PCR primers for the HSV polymerase. In figure 4-3 the amount of HSV DNA present in ganglia of transgenic and non-transgenic infected mice, illustrated no difference between the two groups (t= 0.1623, P= 0.8722). The mean for each group is represented by a horizontal line. Scatter within the groups was expected because there is some variability in the amount of virus infecting each mouse. Despite the expression of the LAT from the transgenic mouse, there was no detectable difference in the amount of establishment of HSV latency between the transgenic and non-transgenic mice, thus expression of the LAT in trans did not affect the amount of HSV reaching the DRG and establishing a latent infection. 1.00E+06 1.00E+05 U) U) 1.00E+04 a o u 1.00E+03 t • • 1 t • 1 • Positive • Negative 1.00E+02 Figure 4-3. Quantitation of HSV1 genomes present in mice infected with HSV-1 17+ at latent times post infection. Each symbol represents one mouse. Reactivation from Latency in Transgenic Mice The LAT also plays a role in reactivation from latency (Wagner, 1991; Bloom et al., 1996b; Hill et al., 1996; Jarman et al., 2002). During reactivation, the virus initiates a

PAGE 97

82 productive cascade resulting in the generation of progeny virus. One of the methods for measuring the presence of reactivatable virus in the mouse model is explant cocultivation. In this process, DRG were removed from latently infected mice and cocultured in tissue culture media until progeny virus was released and detected by the presence of CPE on the RS monolayer. In the human or rabbit eye infection, reactivated virus would travel along the axons to the initial site of infection. When using the mouse explant model, those axons have been dissected away and the virus travels into the media from the tissue. This virus can then infect tissue culture cells that are in the dish with the ganglia to serve as a detection method for reactivation. To study the effect of the LAT transgene on the reactivation phase of infection, DRG from latently infected mice were dissected and cultured in tissue culture media on a layer of rabbit skin cells for 14 days. Cultures were monitored daily for the presence of infected rabbit skin cells. In both the transgenic and non-transgenic mice, virus was detected in all of the cultures by day 10 post co-cultivation (figure 4-4). There was also no observed difference in the time frame of reactivation between transgenic and nontransgenic mice. Expression of the Transgene in trans Does Not Rescue the Restriction of a LAT Deletion Mutant in Neural Tissue A region of the LAT transcript has been shown to play a role in the virulence of HSV-1. When this region of the virus was deleted, the resulting virus was markedly decreased in virulence (Gary et al., in preparation). The LAT transgenic mouse includes the region that was deleted in this virus, 17A480, and could provide that function during the course

PAGE 98

83 re > S 3 re a> -Transgenic -Nontransgenic 3 4 5 6 7 8 9 Days Post Co-Cultivation 10 Figure 4-4. Reactivation of HSV-1 from transgenic and non-transgenic mice by explant co-cultivation of latently infected DRG. of infection in the mouse. The location of this deletion in relation to the mapped virulence function of LAT and the LAT transgene is diagramed in figure 4-5. To see if providing the deleted LAT region in trans would rescue the virulence phenotype, we infected transgenic mice with the 17A480 virus in the rear footpad. At acute times post infection, days one to four, feet and DRG were harvested, homogenized and titered for infectious virus. Both transgenic and non-transgenic mice exhibited similar levels of virus in the feet, seen in figure 4-6, with no significant difference between the groups at any timepoint. Day 1 P= 0.1990, day 2 P= 0.3281, day 3 P= 0.9528, day 4 P= 0.5585.

PAGE 99

84 +1 Intron LAT Transgene Virulence Effects +76 +1667 A480 +892 +1372 Figure 4-5. Diagram of the LAT region of HSV illustrating the location of the 17A480 virus and the LAT transgene in relation to the virulence function of LAT. 1.00E+08 1.00E+07 1.00E+06 1.00E+05 1.00E+04 I.00E+03 1 .00E+02 1.00E+01 1.00E+00 +-" Transgenic Pos Transgenic Neg Day Day 2 Day 3 Day 4 Figure 4-6. Relative amounts of infectious virus in feet of transgenic and non-transgenic mice infected with a deletion mutant of HSV1 at acute times post infection. n=4

PAGE 100

85 In the DRG, figure 4-7, the increase seen with the transgenic mice was not significant, day 2 P= 0.3029, day 3 P= 0.3964, day 4 P= 0.0727. Since only four mice were tested per group in these experiments it is possible that a larger sample size would have resulted in a significant rescue of the virulence phenotype. The initial virulence studies used Swiss Webster mice, which are less resistant to HSV infection. Thus, to prevent genetic differences from complicating the results, the transgenic mouse is being bred into the Swiss Webster background prior to repeating these experiments. a 1.00E+06 1.00E+05 1 .00E+04 1.00E+03 1 .00E+02 1.00E+01 1.00E+00 if. Transgenic Pos Transgenic Neg Day 1 Day 2 Day 3 Day 4 Figure 4-7. Relative amounts of infectious virus in DRG of transgenic and non-transgenic mice infected with a deletion mutant of HSV1 at acute times post infection. n=4. Discussion The LAT has been proposed to play a role in the establishment and reactivation phases of the HSV infection. The LAT transgenic mouse expressed LAT to high levels in a number of tissues, as presented in chapter 3. We hypothesized that the expression of LAT by the transgenic mouse in a temporally different manner from what occurs during

PAGE 101

86 the normal HSV infection could have an effect on either the establishment or reactivation of latency. We examined all three phases of the HSV infection in the transgenic mouse. During the acute infection there was no difference in the amount of infectious virus present in the feet or DRG of transgenic and non-transgenic mice. The amount of HSV DNA present in latently infected DRG of the transgenic and non-transgenic mice was comparable, indicating that the LAT transgene was not detectably affecting the establishment of a latent infection, at least by the criterion of the presence of HSV1 genomes. Co-cultivation measured the ability of these genomes for biological activity and their ability to reactivate and, again no difference between transgenic and nontransgenic mice was observed. Thus, expression of the LAT transgene prior to infection in the mouse had no detectable effect on any phase of the HSV infection. The LAT region also encodes a virulence function that seems to be genetically distinct from LAT's reactivation function, as seen with deletion mutants in the region of the intron illustrated in figure 4-5. The transgenic mouse contains the region of HSV DNA corresponding to this virulence function. When infecting transgenic mice with the deletion mutant, 17A480, there was no significant restoration of the wild type virulence levels during the acute infection, although some slight differences were observed. Since the transgenic mouse is in the more resistant C57B1/6 background, there could be other genetic factors involved in the virulence function that was initially discovered by infecting more sensitive Swiss mice. The data presented suggest that there may be a slight restoration of virulence, although the difference was not statistically significant, in the transgenic mouse which will be further studied in the Swiss background after backcrossing of the transgenic mouse with Swiss mice to obtain a Swiss genetic

PAGE 102

87 background transgenic line. It should be pointed out, however, that the dramatic restriction in ganglionic replication exhibited by 17A480, and the fact that this restriction is also detected on PC12 cells in culture would seem to suggest that it is unlikely that the lack of rescue was due to a difference in mouse background. Taken together, these data suggest that LAT does not act in trans to regulate its functions. A more likely model is that LAT is acting in cis to regulate other functions in the HSV-1 genome. Given the proximate location of the LAT to ICPO and ICP4, these might be candidates for this cw-acting activity.

PAGE 103

CHAPTER 5 OVERALL CONCLUSIONS The LAT is the only transcript detected abundantly during the latent phase of HSV1 infection (Roizman and Sears, 1996). This transcript has been implicated as a modulator of a number of viral functions including, but not limited to, establishment of latency (Speck and Simmons, 1991), reactivation (Wagner, 1991; Bloom et al., 1994; Bloom et al., 1996), virulence (Perng et al., 1999), and neuronal survival (Pemg et al., 2000; Thompson and Sawtell, 2001; Ahmed et al., 2002). One of the key features of the LAT is that it exhibits a differential tropism of expression with only 1/3 of latently infected neurons expressing large amounts (Maggioncalda et al., 1996). In addition, LAT-expressing neurons seem to segregate into subsets of sensory neurons expressing specific markers. Since the degree to which the regulation of LAT expression is dictated by phenotypically different classes of neurons is not well understood, we sought to study the regulation of LAT expression in the absence of other viral proteins by generating a transgenic mouse that contains the LAT region. Characterization of the transgenic mouse described in this dissertation has shown that the LAT transgene exists in a single copy in the mouse genome and that it is expressed to high levels in a number of tissues. This overall expression, as assessed by total LAT RNA detected at the level of whole tissues, does not seem to be neuronalspecific since expression was seen in non-neural tissues as well. This seemed somewhat surprising to us initially since the literature contains numerous studies showing that LAT has higher levels of expression in neuronal cells than in other cell types (Zwaagstra et al., 88

PAGE 104

89 1990; Kenny et al., 1994; Dobson et al., 1995; Coffin and Thomas, 1998; Jarman et al., 1999). In situ hybridization shed some light on this apparent incongruity by demonstrating that the transgene was being expressed strongly in only a subset of neurons in the dorsal root ganglia. Expression was not detected by in situ hybridization in non-neural tissues. Thus, it can be concluded that strong LAT expression is specific for some DRG neurons and that the expression seen by RT-PCR in other tissues may be leaky or low-level expression in some (or perhaps most) cells within those tissues. Retrospective analysis of the literature on neuronal-specific LAT expression shows that most of these studies compared LAT expression in neuroblastoma vs. fibroblast cell lines, and the few in vivo analyses relied primarily on reporter or in situ hybridization analyses. Therefore our results serve to confirm and extend these analyses to indicate that the pattern of abundant LAT expression is likely controlled at the level of different types of neurons, and not other viral functions. Mapping of the transgene insert determined that in addition to the SV40 poly A sequence being deleted, a small portion of up to 132 bp of the 3' end of the transcript was also deleted. This deletion does not appear to affect the splice acceptor site since the stable LAT intron can be detected in the DRG by Northern blot. The LAT transgene has no detectable effect on altering the outcome of an experimental infection of the transgenic mice. Experiments presented here examined the acute, establishment and reactivation phases of the HSV infection and in each of these phases there was no difference between the transgenic and non-transgenic mice. Additionally, infection of the transgenic mice with the 17A480 virus, a LAT mutant with reduced virulence, did not rescue the virulence phenotype. There were slight but

PAGE 105

90 insignificant differences seen during the acute phase of infection and these differences will be re-evaluated by backcrossing the transgenic mouse into the SwissWebster background, which is more sensitive to HSV infection and then repeating the infection study. However, given the fact that the 17A480 virus is also restricted in replication in PC12 cells in vitro, our favored hypothesis is that the transgenic mouse in the SwissWebster background will not rescue the virulence of 17A480. On the whole, the data presented here suggest that, in the context of the HSV-1 genome, the LAT is functioning in cis to regulate or affect the DNA that transcribed it in order to modulate the genetically distinct virulence and reactivation phenotypes that map to this region. There are a number of possible mechanisms for this LAT function, including acting as a boundary element to prevent transcription of the surrounding acute transcripts or aiding modification of the chromatin structure to control transcription in this important regulatory region of the viral genome. Further studies with the transgenic mouse will investigate these potential regulation mechanisms.

PAGE 106

APPENDIX A MAP AND SEQUENCE OF THE pLAT/LAT PLASMID The pLAT/LAT plasmid was generated to construct the transgene insert. A portion of the HSV-1 strain 17+ latency associated transcript (LAT) including the Dral site (corresponding to HSV-1 genome base pair 1 16,516) to the Aatll site (corresponding to HSV-1 genome base pair 121,549) was ligated into a pBluescript backbone at the Smal site. The SV40 poly A sequence from pNSE-Ex4 was removed using EcoRI and inserted at the Xbal site into the pBluescript plasmid containing the LAT sequence. Sac1(7491) Xho r (74661 Sac 1(41) SV40 poly A signal II LAT 2 kb Intron Amp resistance gene I Psl 1(3819) LAT promoter Psl 1(3616) pLAT/LAT transgenic construct 7496 bp Xho 1(2908) Et u R I (2941) Psl 1(2951) Figure A-l. Plasmid map of the HSV-1 LAT transgenic construct. This plasmid was linearized by digesting with Xhol for injection into the mouse pronucleus as described in Chapter 2. 91

PAGE 107

92 Presented here is the nucleotide sequence of pLAT/LAT plasmid used to generate the HSV-1 LAT transgenic mouse. 1 gatccactag ttctagagcg gccgccaccg cggtggagct ccagcttttg ttccctttag 61 tgagggttaa tttcgagctt ggcgtaatca tggtcatagc tgtttcctgt gtgaaattgt 121 tatccgctca caattccaca caacatacga gccggaagca taaagtgtaa agcctggggt 181 gcctaatgag tgagctaact cacattaatt gcgttgcgct cactgcccgc tttccagtcg 241 ggaaacctgt cgtgccagct gcattaatga atcggccaac gcgcggggag aggcggtttg 301 cgtattgggc gctcttccgc ttcctcgctc actgactcgc tgcgctcggt cgttcggctg 361 cggcgagcgg tatcagctca ctcaaaggcg gtaatacggt tatccacaga atcaggggat 421 aacgcaggaa agaacatgtg agcaaaaggc cagcaaaagg ccaggaaccg taaaaaggcc 481 gcgttgctgg cgtttttcca taggctccgc ccccctgacg agcatcacaa aaatcgacgc 541 tcaagtcaga ggtggcgaaa cccgacagga ctataaagat accaggcgtt tccccctgga 601 agctccctcg tgcgctctcc tgttccgacc ctgccgctta ccggatacct gtccgccttt 661 ctcccttcgg gaagcgtggc gctttctcat agctcacgct gtaggtatct cagttcggtg 721 taggtcgttc gctccaagct gggctgtgtg cacgaacccc ccgttcagcc cgaccgctgc 781 gccttatccg gtaactatcg tcttgagtcc aacccggtaa gacacgactt atcgccactg 841 gcagcagcca ctggtaacag gattagcaga gcgaggtatg taggcggtgc tacagagttc 901 ttgaagtggt ggcctaacta cggctacact agaaggacag tatttggtat ctgcgctctg 961 ctgaagccag ttaccttcgg aaaaagagtt ggtagctctt gatccggcaa acaaaccacc 1021 gctggtagcg gtggtttttt tgtttgcaag cagcagatta cgcgcagaaa aaaaggatct 1081 caagaagatc ctttgatctt ttctacgggg tctgacgctc agtggaacga aaactcacgt 1141 taagggattt tggtcatgag attatcaaaa aggatcttca cctagatcct tttaaattaa 1201 aaatgaagtt ttaaatcaat ctaaagtata tatgagtaaa cttggtctga cagttaccaa

PAGE 108

93 1261 tgcttaatca gtgaggcacc tatctcagcg atctgtctat ttcgttcatc catagttgcc 1321 tgactccccg tcgtgtagat aactacgata cgggagggct taccatctgg ccccagtgct 1381 gcaatgatac cgcgagaccc acgctcaccg gctccagatt tatcagcaat aaaccagcca 1441 gccggaaggg ccgagcgcag aagtggtcct gcaactttat ccgcctccat ccagtctatt 1501 aattgttgcc gggaagctag agtaagtagt tcgccagtta atagtttgcg caacgttgtt 1561 gccattgcta caggcatcgt ggtgtcacgc tcgtcgtttg gtatggcttc attcagctcc 1621 ggttcccaac gatcaaggcg agttacatga tcccccatgt tgtgcaaaaa agcggttagc 1681 tccttcggtc ctccgatcgt tgtcagaagt aagttggccg cagtgttatc actcatggtt 1741 atggcagcac tgcataattc tcttactgtc atgccatccg taagatgctt ttctgtgact 1801 ggtgagtact caaccaagtc attctgagaa tagtgtatgc ggcgaccgag ttgctcttgc 1861 ccggcgtcaa tacgggataa taccgcgcca catagcagaa ctttaaaagt gctcatcatt 1921 ggaaaacgtt cttcggggcg aaaactctca aggatcttac cgctgttgag atccagttcg 1981 atgtaaccca ctcgtgcacc caactgatct tcagcatctt ttactttcac cagcgtttct 2041 gggtgagcaa aaacaggaag gcaaaatgcc gcaaaaaagg gaataagggc gacacggaaa 2101 tgttgaatac tcatactctt cctttttcaa tattattgaa gcatttatca gggttattgt 2161 ctcatgagcg gatacatatt tgaatgtatt tagaaaaata aacaaatagg ggttccgcgc 2221 acatttcccc gaaaagtgcc acctaaattg taagcgttaa tattttgtta aaattcgcgt 2281 taaatttttg ttaaatcagc tcatttttta accaataggc cgaaatcggc aaaatccctt 2341 ataaatcaaa agaatagacc gagatagggt tgagtgttgt tccagtttgg aacaagagtc 2401 cactattaaa gaacgtggac tccaacgtca aagggcgaaa aaccgtctat cagggcgatg 2461 gcccactacg tgaaccatca ccctaatcaa gttttttggg gtcgaggtgc cgtaaagcac 2521 taaatcggaa ccctaaaggg agcccccgat ttagagcttg acggggaaag ccggcgaacg 2581 tggcgagaaa ggaagggaag aaagcgaaag gagcgggcgc tagggcgctg gcaagtgtag

PAGE 109

94 2641 cggtcacgct gcgcgtaacc accacacccg ccgcgcttaa tgcgccgcta cagggcgcgt 2701 cccattcgcc attcaggctg cgcaactgtt gggaagggcg atcggtgcgg gcctcttcgc 2761 tattacgcca gctggcgaaa gggggatgtg ctgcaaggcg attaagttgg gtaacgccag 2821 ggttttccca gtcacgacgt tgtaaaacga cggccagtga attgtaatac gactcactat 2881 agggcgaatt gggtaccggg ccccccctcg aggtcgacgg tatcgataag cttgatatcg 2941 aattcctgca gcccaaataa accaatgtcg gaataaacaa acacaaacac ccgcgacggg 3001 gggacggagg ggacggaggg agggggtgac gggggacggg aacagacaca aaaacaacca 3061 caaaaaacaa ccacccaccg acacccccac cccagtctcc tcgccttctc ccacccaccc 3121 cacgccccca ctgagcccgg tcgatcgacg agcacccccg cccacgcccc cgcccctgcc 3181 ccggcgaccc ccggcccgca cgatcccgac aacaataaca accccaacgg aaagcggcgg 3241 ggtgttgggg gaggcgagga acaaccgagg ggaacggggg atggaaggac gggaagtgga 3301 agtcctgata cccatcctac acccccctgc cttccaccct ccggcccccc gcgagtccac 3361 ccgccggccg gctaccgaga ccgaacacgg cggccgccgc agccgccgca gccgccgccg 3421 acaccgcaga gccggcgcgc gcactcacaa gcggcagagg cagaaaggcc cagagtcatt 3481 gtttatgtgg ccgcgggcca gcagacggcc cgcgacaccc cccccccgcc cgtgtgggta 3541 tccggccccc cgccccgcgc cggtccatta agggcgcgcg tgcccgcgag atatcaatcc 3601 gttaagtgct ctgcagacag gggcaccgcg cccggaaatc cattaggccg cagacgagga 3661 aaataaaatt acatcaccta cccacgtggt gctgtggcct gtttttgctg cgtcatctca 3721 gcctttataa aagcgggggc gcggccgtgc cgatcgcggg tggtgcgaaa gactttccgg 3781 gcgcgtccgg gtgccgcggc tctccgggcc cccctgcagc cggggcggcc aaggggcgtc 3841 ggcgacatcc tccccctaag cgccggccgg ccgctggtct gttttttcgt tttccccgtt 3901 tcgggggtgg tgggggttgc ggtttctgtt tctttaaccc gtctggggtg tttttcgttc 3961 cgtcgccgga atgtttcgtt cgtctgtccc ctcacggggc gaaggccgcg tacggcccgg

PAGE 110

95 4021 gacgaggggc ccccgaccgc ggcggtccgg gccccgtccg gacccgctcg ccggcacgcg 4081 acgcgaaaaa ggccccccgg aggcttttcc gggttcccgg cccggggcct gagatgaaca 4141 ctcggggtta ccgccaacgg ccggcccccg tggcggcccg gcccggggcc ccggcggacc 4201 caaggggccc cggcccgggg ccccacaacg gcccggcgca tgcgctgtgg tttttttttc 4261 ctcggtgttc tgccgggctc catcgccttt cctgttctcg cttctccccc cccccttctt 4321 cacccccagt accctcctcc ctcccttcct cccccgttat cccactcgtc gagggcgccc 4381 cggtgtcgtt caacaaagac gccgcgtttc caggtaggtt agacacctgc ttctccccaa 4441 tagagggggg ggacccaaac gacagggggc gccccagagg ctaaggtcgg ccacgccact 4501 cgcgggtggg ctcgtgttac agcacaccag cccgttcttt tccccccctc ccacccttag 4561 tcagactctg ttacttaccc gtccgaccac caactgcccc cttatctaag ggccggctgg 4621 aagaccgcca gggggtcggc cggtgtcgct gtaacccccc acgccaatga cccacgtact 4681 ccaagaaggc atgtgtccca ccccgcctgt gtttttgtgc ctggctctct atgcttgggt 4741 cttactgcct gggggggggg agtgcggggg agggggggtg tggaaggaaa tgcacggcgc 4801 gtgtgtaccc cccctaaagt tgttcctaaa gcgaggatac ggaggagtgg cgggtgccgg 4861 gggaccgggg tgatctctgg cacgcggggg tgggaagggt cgggggaggg ggggatggag 4921 taccggccca cctggccgcg cgggtgcgcg tgcctttgca caccaacccc acgtcccccg 4981 gcggtctcta agaagcaccg ccccccctcc ttcataccac cgagcatgcc tgggtgtggg 5041 ttggtaacca acacgcccat cccctcgtct cctgtgattc tctggctgca ccgcattctt 5101 gttttctaac tatgttcctg tttctgtctc cccccccccc acccctccgc cccacccccc 5161 aacacccacg tctgtggtgt ggccgacccc cttttgggcg ccccgtcccg ccccgccacc 5221 cctcccatcc tttgttgccc tatagtgtag ttaacccccc ccgccctttg tggcggccag 5281 aggccaggtc agtccgggcg ggcaggcgct cgcggaaact taacacccac acccaaccca 5341 ctgtggttct ggctccatgc cagtggcagg atgctttcgg ggatcggtgg tcaggcagcc

PAGE 111

540 546 552 558 564 570 576 582 588 594 600 606 612 618 624 630 636 642 648 654 660 666 672 96 cgggccgcgg ctctgtggtt aacaccagag cctgcccaac atggcacccc cactcccacg cacccccact cccacgcacc cccactccca cgcaccccca ctcccacgca cccccactcc cacgcacccc cactcccacg cacccccact cccacgcacc cccactccca cgcaccccca ctcccacgca tccccgcgat acatccaaca cagacaggga aaagatacaa aagtaaacct ttatttccca acagacagca aaaatcccct gagttttttt ttattagggc caacacaaaa gacccgctgg tgtgtggtgc ccgtgtcttt cacttttccc ctccccgaca cggattggct ggtgtagtgg gcgcggccag agaccaccca gcgcccgacc cccccctccc cacaaacacg gggggcgtcc cttattgttt tccctcgtcc cgggtcgacg ccccctgctc cccggaccac gggtgccgag accgcaggct gcggaagtcc agggcgccca ctagggtgcc ctggtcgaac agcatgttcc ccacgggggt catccagagg ctgttccact ccgacgcggg ggccgtcggg tactcggggg gcatcacgtg gttacccgcg gtctcgggga gcagggtgcg gcggctccag ccggggaccg cggcccgcag ccgggtcgcc atgtttcccg tctggtccac caggaccacg tacgccccga tgttccccgt ctccatgtcc aggatgggca ggcagtcccc cgtgatagtc ttgttcacgt aaggcgacag ggcgaccacg ctagagaccc ccgagatggg caggtagcgc gtgaggccgc ccgcggggac ggccccggaa gtctccgcgt ggcgcgtctt ccgggcacac ttcctcggcc cccgcggccc agaagcagcg cgggggccga gggaggtttc ctcttgtctc cctcccaggg caccgacggc cccgcccgag gaggcggaag cggaggagga cgcggccccg gcggcggaag aggcggcccc cgcgggggtc ggggccgagg aggaagaggc agaggaggaa gaggcggagg ccgccgaggg ggggatcaat tcagctgagc gccggtcgct accattacca gttggtctgg tgtcaaaaat aataataacc gggcaggggg gatctgcatg gatcgatcca gacatgataa gatacattga tgagtttgga caaaccacaa ctagaatgca gtgaaaaaaa tgctttattt gtgaaatttg tgatgctatt gctttatttg taaccattat aagctgcaat aaacaagtta acaacaacaa ttgcattcat tttatgtttc aggttcaggg ggaggtgtgg

PAGE 112

97 6781 gaggtttttt aaagcaagta aaacctctac aaatgtggta tggctgatta tgatctctag 6841 tcaaggcact atacatcaaa tattccttat taaccccttt acaaattaaa aagctaaagg 6901 tacacaattt ttgagcatag ttattaatag cagacactct atgcctgtgt ggagtaagaa 6961 aaaacagtat gttatgatta taactgttat gcctacttat aaaggttaca gaatattttt 7021 ccataatttt cttgtatagc agtgcagctt tttcctttgt ggtgtaaata gcaaagcaag 7081 caagagttct attactaaac acagcatgac tcaaaaaact tagcaattct gaaggaaagt 7141 ccttggggtc ttctaccttt ctcttctttt ttggaggagt agaatgttga gagtcagcag 7201 tagcctcatc atcactagat ggcatttctt ctgagcaaaa caggttttcc tcattaaagg 7261 cattccacca ctgctcccat tcatcagttc cataggttgg aatctaaaat acacaaacaa 7321 ttagaatcag tagtttaaca cattatacac ttaaaaattt tatatttacc ttagagcttt 7381 aaatctctgt aggtagtttg tccaattatg tcacaccaca gaagtaaggt tccttcacaa 7441 agatcctcta gcgataccgt cgacctcgag ggggggcccg gtaccgagct cgaatt

PAGE 113

APPENDIX B PCR PRIMER SEQUENCES Polymerase chain reaction (PCR) was used in the experiments described in this dissertation for a number of quantifications and identifications. The complete list of primers used for these reactions is presented here in tabular form for easy reference. Table B-l. Conventional PCR Primers and Locations Primer Name Sequence Genome Location PCR Conditions 1 Promar 1 GCA CGA TCC CGA CAA CAA TAA CAA C 118,246118,270 94, 55, 72 Promar 2 ACT TCC ACT TCC CGT CCT TCC ATC C 118,327118,351 94, 55, 72 DB60 CGG CGA CAT CCT CCC CCT AAG C 118,888118,910 94, 55, 72 DB61 GAC AGA CGA ACG AAA CAT TCC G 118,994119,016 94, 55, 72 Mintl GAC ACG CAT TGG CTG GTG TAG TGG G 120,795120,819 94, 55, 72 Mint 2 ACG AGG GAA AAC AAT AAG GGA CGC C 120,872120,898 94, 55, 72 M2 probe up AGA CCC GCT GGT GG TGG TG 120,748120,767 94, 55, 72 M2 probe down GAT GCC CCC CGA GTA CCC GA 121,044121,063 94, 55, 72 AG 29 CGG GTA CTC GGG GGG CA 121,044121,061 94, 55, 72 AG 30 CTC GGG GGT CTC TAG CGT GG 121,252121,272 94, 55, 72 AG 31 CGC CTC TTC CTC CTC TGC CT 121,513121,533 94, 68, 72 All PCR conditions are one cycle for 3 minutes followed by 30 cycles for 1 minute. 98

PAGE 114

99 Table B-2. Real Time PCR Primer and Probe Sequences Primer Name Sequence XIST forward GCT CTT AAA CTG AGT GGG TGT TCA XIST reverse GTA TCA CGC AGA AGC CAT AATGG XIST probe ACG CGG GCT CTC CA 5 'LAT forward GGC TCC ATC GCC TTT CCT 5 'LAT reverse AAG GGA GGG AGG AGG GTA CTG 5 'LAT probe TCT CGC TTC TCC CC LPRO forward CAA TAA CAA CCC CAA CGG AAAGC LPRO reverse TCC ACT TCC CGT CCT TCC AT LPRO probe TCC CCT CGG TTG TTC C POL forward AGA GGG ACA TCC AGG ACT TTGT POL reverse CAG GCG CTT GTT GGT GTA C POL probe ACC GCC GAA CTG AGC A

PAGE 115

APPENDIX C EXPRESSION OF THE LAT TRANSGENE IS NOT AGE DEPENDENT The expression profile for the LAT transgenic mouse was presented in Chapter 3. Due to the large amount of data generated by studying the expression profile in four age groups of mice, only a portion of the age related expression data was presented. The complete age related expression profile for the transgenic mouse is presented here. For each tissue RNA was extracted and reverse transcribed as described in the materials and methods, chapter 3. RT-PCR reactions were performed using real time PCR for the 5' LAT exon or 1 8s RNA and compared to a standard curve generated by known copies of plasmid DNA. The LAT expression in transgenic neural tissues for the four age groups, 1 day, 1 month, 2 months, and 18 months old, is graphed in figure C-l. By ANOVA there was no statistical difference between the age groups for each tissue, hypothalamus (P= 0.1744), cerebellum (P= 0.7774), cortex (P= 0.7537), olfactory bulb (P= 0.5967), spinal cord (P= 0.3303), dorsal root ganglia (P= 0.6908), trigeminal ganglia (P= 0.4050) when represented per gram of tissue. Figure C-2 illustrates the expression data for non-neural tissues at the four age groups. There was no statistically significant difference between the ages of any of the tissues tested. Skin (P= 0.1728), foot (P= 0.0657), heart (P= 0.1623), kidney (P= 0.5630), lung (P= 0.231 1), eye (P= 0.6017), liver (P= 0.3415), spleen (P= 0.5750), and intestine (P= 0.61 13). 100

PAGE 116

101 1 Day Old 1 Month Old 2 Month Old 18 Month Old & & ** ^ ^ ^ C* S? O^ Jft ^ c ^ ^ ^
PAGE 117

102 As discussed in chapter 3, comparison of different tissues on a per weight basis does not take into consideration the different sizes and densities of each cell type. Thus, this representation is not on a per cell basis. To address this issue, tissue expression was compared normalized to levels of 1 8s RNA which was considered to be constant in all cells (Thellin et al., 1999). As for the per weight analysis, tissues were divided into neural tissues (figure C-3) and non-neural tissues (figure C-4). The neural tissues when normalized to 1 8s RNA exhibited no significant difference between the amount of expression at the four age groups. Hypothalamus (P= 0.7320), cerebellum (P= 0.6499), cortex (P= 0.2609), olfactory bulb (P= 0.4991), spinal cord (P= 0.2859), dorsal root ganglia (P= 0.4803), and trigeminal ganglia (P= 0.2429). 1 Day Old 1 Month Old D 2 Month Old D 18 Month Old ** ,o< ^ fr o ^ ** & / # J*
PAGE 118

103 .00E+07 I.00E+06 i 1.00E+05 so 1.00E+04 g. 1.00E+03 1.00E+02 1.00E+01 1 Day Old 1 Month Old D 2 Month Old D 18 Month Old # s *
PAGE 119

LIST OF REFERENCES Ahmed, M., M. Lock, C. G. Miller and N. W. Fraser (2002). "Regions of the herpes simplex virus type 1 latency-associated transcript that protect cells from apoptosis in vitro and protect neural cells in vivo." Journal of Virology 76(2): 717-729 Alvira, M. R., W. F. Goins, J. B. Cohen and J. Glorioso (1999). "Genetic studies exposing the splicing events involved in herpes simplex virus type 1 latencyassociated transcript production during lytic and latent infection." Journal of Virology 73(5): 3866-3876. Anderson, J. M. and M. W. N. Nicholls (1972). "Herpes encephalitis in pregnancy." British Medical Journal 1(800): 632. Berthomme, H., J. Lokensgard, L. Yang, T. Margolis and L. T. Feldman (2000). "Evidence for a bidirectional element located downstream from the herpes simplex virus type 1 latency-associated promoter that increases its activity during latency." Journal of Virology 74(8): 3613-3622. Berthomme, H., J. Thomas, P. Texier, A. Epstein and L. T. Feldman (2001). "Enhancer and long-term expression functions of herpes simplex virus type 1 latencyassociated promoter are both located in the same region." Journal of Virology 75(9): 4386-4393. Bhattacharjee, P. S., R. K. Tran, M. E. Myles, K. Maruyama, A. Mallakin, D. C. Bloom and J. M. Hill (2003). "Overlapping subdeletions within a 348-bp in the 5' exon of the LAT region that facilitates epinephrine-induced reactivation of HSV-1 in the rabbit ocular model do not further define a functional element." Virology 312(1): 151-158. Bloom, D. C, G. B. Devi-Rao, J. M. Hill, J. G. Stevens and E. K. Wagner (1994). "Molecular analysis of herpes simplex virus type 1 during epinephrine induced reactivation of latently infected rabbits in vivo." Journal of Virology 68(3): 12831292. Bloom, D. C, J. M. Hill, E. K. Wagner, L. T. Feldman and J. G. Stevens (1996). "A 348bp region in the latency associated transcript facilitates herpes simplex virus type 1 reactivation." Journal of Virology 70: 2449-2459. 104

PAGE 120

105 Burton, E. A., C. S. Hong and J. C. Glorioso (2003). "The stable 2.0-kilobase intron of the herpes simplex virus type 1 latency-associated transcript does not function as an antisense repressor of ICPO in nonneuronal cells." Journal of Virology 77(6): 35163530. Cai, W. and P. Schaffer (1992). "Herpes simplex virus type 1 ICPO plays a critical role in the de novo synthesis of infectious virus following transfection of viral DNA." Journal of Virology 66: 2904-2915. Chen, S. H., M. F. Kramer, P. A. Schaffer and D. M. Cohen (1997). "A viral function represses accumulation of transcripts from productive-cycle genes in mouse ganglia latently infected with herpes simplex virus." Journal of Virology 71 : 5878-5884. Chen, Y. T., Y. H. Wang, Y. Y. Cheng and S. L. Hung (2003). "Direct binding of herpes simplex virus type 1 virions to complement C3." Viral Immunology 16(3): 347355. Coffin, R. S. and M. S. Thomas (1998). "The herpes simplex virus 2 kb latencyassociated transcript (LAT) leader sequence allows efficient expression of downstream proteins which is enhanced in neuronal cells: possible function of LAT ORFs." Journal of General Virology 79: 3019-3026. Colgin, M. A., R. L. Smith and C. L. Wilcox (2001). "Inducible cyclic AMP early repressor produces reactivation of latent herpes simplex virus type 1 in neurons in vitro." Journal of Virology 75(6): 2912-2920. Davido, D. J., W. F. von Zagorski, G. G. Maul and P. A. Schaffer (2003). "The differential requirement for cyclin-dependent kinase activities distinguishes two functions of herpes simplex virus type 1 ICPO." Journal of Virology 77(23): 1260312616. Dobson, A. T., T. P. Margolis, W. A. Gomes and L. T. Feldman (1995). "In vivo deletion analysis of the herpes simplex virus type 1 latency associated transcript promoter." Journal of Virology 69(4): 2264-2270. Drolet, B. S., G. C. Perng, J. Cohen, S. M. Slanina, A. Yukht, A. B. Nesbum and S. L. Wechsler (1998). "The region of the herpes simplex virus type 1 LAT gene involved in spontaneous reactivation does not encode a functional protein." Virology 242: 221-232. Ellis, J., P. Pasceri, K. C. Tan-Un, X. Wu, A. Harper, P. Fraser and F. Grosveld (1997). "Evaluation of beta-globin gene therapy constructs in single copy transgenic mice." Nucleic Acids Research 25:1296-1302. Ellison, A. R., L. Yang, C. C. Voytek and T. Margolis (2000). "Establishment of latent herpes simplex virus type 1 infection in resistant, sensitive, and immunodeficient mouse strains." Virology 268: 17-28.

PAGE 121

106 Farrell, M. J., A. T. Dobson and L. T. Feldman (1991). "Herpes simplex virus latencyassociated transcript is a stable intron." Proceedings of the National Academy of Sciences 88: 790-794. Gary, L.W., J.M. Loutsch, J. M. Hill, E.K. Wagner and D.C. Bloom. In preparation. "Identification of a virulence function in herpes simplex virus type 1 mapping to the latency-associated transcript locus." Gesser, R. M., T. Valyi-Nagy and N. Fraser (1994). "Restricted herpes virus type 1 gene expression within sensory neurons in the absence of functional B and T lymphocytes." Virology 200: 791-795. Goins, W. F., L. R. Sternberg, K. D. Croen, P. R. Krause, R. L. Hendricks, D. J. Fink, S. E. Straus, M. Levine and J. C. Glorioso (1994). "A novel latency-active promoter is contained within the herpes simplex virus type 1 UL flanking repeats." Journal of Virology 68(4): 2239-2252. Gordon, J. W., G A. Scangos, D. J. Plotkin, J. A. Barbosa and F. H. Ruddle (1980). "Genetic transformation of mouse embryos by microinjection of purified DNA." Proceedings of the National Academy of Sciences 77(12): 7380-7384. Gressens, P. and J. R. Martin (1994). "In situ polymerase chain reaction: localization of HSV-2 DNA sequences in infections of the nervous system." Journal of Virology Methods 46: 61-83. Grunewald, K., P. Desai, D. C. Winkler, J. B. Heymann, D. M. Belnap, W. Baumeister and A. L. Steven (2003). "Three-dimensional structure of herpes simplex virus from cryo-electron tomography." Science 302: 1396-1398. Halford, W. P. and P. A. Schaffer (2001). "ICP0 is required for efficient reactivation of herpes simplex virus type 1 from neuronal latency." Journal of Virology 75(7): 3240-3249. Halford, W. P., C. D. Kemp, J. A. Isler, D. J. Davido and P. Schaffer (2001). "ICP0, ICP4, or VP16 expressed from adenovirus vectors induces reactivation of latent herpes simplex virus type 1 in primary cultures of latently infected trigeminal ganglion cells." Journal of Virology 75(13): 6143-6153. Hill, J. M., J. B. Dudley, Y. Shimomura and H. E. Kaufman (1986). "Quantitation and kinetics of adrenergic induced HSV-1 ocular shedding." Current Eye Research 5: 241-246.

PAGE 122

107 Hill, J. M., J. B. Maggioncalda, H. H. Garza, Y.-H. Su, N. W. Fraser and T. M. Block (1996). "In vivo epinephrine reactivation of ocular herpes simplex type 1 (HSV-1) in the rabbit is correlated to a 370 base pair region located between the promoter and the 5' end of the 2.0 kb latency-associated transcript (LAT)." Journal of Virology 70: 7270-7274. Hogan, B., F. Constantini and E. Lacy (1986). Manipulating the mouse genome. Cold Spring Harbor, NY, Cold Spring Harbor Laboratory Press. Jackson, S. A. and N. A. DeLuca (2003). "Relationship of herpes simplex virus genome configuration to productive and persistent infections." Proceedings of the National Academy of Sciences 100(13): 7871-7876. Jarman, R. G., E. K. Wagner and D. C. Bloom (1999). "LAT expression during an acute HSV infection in the mouse." Virology 262: 384-397. Jarman, R. G, J. M. Loutsch, G. B. Devi-Rao, M. E. Marquart, M. P. Banaszak, X. Zheng, J. M. Hill, E. K. Wagner and D. C. Bloom (2002). "The region of the HSV1 latency-associated transcript required for epinephrine-induced reactivation in the rabbit does not include the 2.0 kb intron." Virology 292: 59-69. Kastrukoff, L. F., A. S. Lau and M. L. Puterman (1986). "Genetics of natural resistance to herpes simplex virus type 1 latent infection of the peripheral nervous system in mice." Journal of General Virology 67: 613-621. Kenny, J. J., F. C. Krebs, H. T. Hartle, A. E. Gartner, B. Chatton, J. M. Leiden, J. P. Hoeffler, P. C. Weber and B. Wigdahl (1994). "Identification of a second ATF/CREB-like element in the herpes simplex virus type 1 (HSV-1) latencyassociated transcript (LAT) promoter." Virology 200: 220-235. Koelle, D. M. and L. Corey (2003). "Recent progress in herpes simplex virus immunobiology and vaccine research." Clinical Microbiology Reviews 16(1): 96113. Kubat, N. J., R. K. Tran, P. McAnany and D. Bloom (2004). "Specific histone tail modification and not DNA methylation is a determinant of HSV-1 latent gene expression." Journal of Virology 78(3): 1139-1 149. Levine, M., A. Krikos, J. C. Glorioso and F. L. Homa (1990). "Regulation of expression of the glycoprotein genes of herpes simplex virus type 1 (HSV-1)." Advances in Experimental Medicine and Biology 278: 151-164. Loiacono, C. M., R. Myers and W. J. Mitchell (2002). "Neurons differentially activate the herpes simplex virus type 1 immediate-early gene ICP0 and ICP27 promoters in transgenic mice." Journal of Virology 76(5): 2449-2459.

PAGE 123

108 Lokensgard, J. R., H. Berthomme and L. T. Feldman (1997). "The latency-associated promoter of herpes simplex virus type 1 requires a region downstream of the transcription start site for long-term expression during latency." Journal of Virology 71(9): 6714-6719. Lopez, C. (1975). "Genetics of natural resistance to herpes simplex virus infections in mice." Nature 258: 152-153. Mackem, S. and B. Roizman (1982). "Differentiation between alpha promoter and regulator regions of herpes simplex virus 1 : the functional domains and sequence of a movable alpha regulator." Proceedings of the National Academy of Sciences 79(16): 4917-4921. Mador, N., E. Braun, H. Haim, I. Ariel, A. Panet and I. Steiner (2003). "Transgenic mouse with the herpes simplex virus type 1 latency-associated gene: expression and function of the transgene." Journal of Virology 77(23): 12421-12429. Maggioncalda, J., A. Mehta, Y. H. Su, N. W. Fraser and T. M. Block (1996). "Correlation between herpes simplex virus type 1 rate of reactivation from latent infection and the number of infected neurons in trigeminal ganglia." Virology 225:72-81. Margolis, T. P., F. Sedarati, A. T. Dobson, L. T. Feldman and J. G. Stevens (1992). "Pathways of viral gene expression during acute neuronal infection with HSV-1." Virology 189(1): 150-160. Margolis, T. P., D. C. Bloom, A. T. Dobson, L. T. Feldman and J. G. Stevens (1993). "LAT promoter activity decreases dramatically during the latent phase of ganglionic infection with HSV." Virology 197(2): 585-592. Mitchell, W. J. (1995). "Neurons differentially control expression of a herpes simplex virus type 1 immediate-early promoter in transgenic mice." Journal of Virology 69(12): 7942-50. Nomura, T. (1997). "Practical development of genetically engineered animals as human disease models." Laboratory Animal Science 47(2): 113-117. Nicosia, M., S. L. Deshmane, J. M. Zaboloty, T. Valyi-Nagy and N. Fraser (1993). "Herpes simplex virus type 1 latency-associated transcript (LAT) promoter deletion mutants can express a 2-kilobase transcript mapping to the LAT region." Journal of Virology 67(12): 7276-7283. Perng, G.-C, E. C. Dunkel, P. A. Geary, S. M. Slanina, H. Ghiasi, R. Kaiwar, A. B. Nesburn and S. L. Wechsler (1994). "The latency-associated transcript gene of herpes simplex virus type 1 (HSV-1) is required for efficient in vivo spontaneous reactivation of HSV-1 from latency." Journal of Virology 68(12): 8045-8055.

PAGE 124

109 Pemg, G. C, S. M. Slanina, A. Yukht, B. S. Drolet, W. Keleher, Jr., H. Ghiasi, A. B. Nesburn and S. L. Wechsler (1999). "A herpes simplex virus type 1 latencyassociated transcript mutant with increased virulence and reduced spontaneous reactivation." Journal of Virology 73(2): 920-929. Perng, G. C., C. Jones, J. Ciacci-Zanella, M. Stone, G. Henderson, A. Yukht, S. M. Slanina, F. M. Hofrnan, H. Ghiasi, A. B. Nesburn and S. L. Wechsler (2000). "Virus-induced neuronal apoptosis blocked by the herpes simplex virus latencyassociated transcript." Science 287(5457): 1500-1503. Perng, G. C, B. Maguen, L. Jin, K. R. Mott, J. Kurylo, L. BenMohamed, A. Yukht, N. Osorio, A. B. Nesburn, G. Henderson, M. Inman, C. Jones and S. L. Wechsler (2002). "A novel herpes simplex virus type 1 transcript (AL-RNA) antisense to the 5' end of the latency associated transcript produces a protein in infected rabbits." Journal of Virology 76(16): 8003-8010. Perry, L. J. and D. J. McGeoch (1988). "The DNA sequences of the long repeat region and adjoining parts of the long unique region in the genome of herpes simplex virus type 1." Journal of General Virology 69(1 1): 2831-2846. Qiagen, Inc. (2003). Qiagen Product Guide Valencia, CA. Rail, G. F., L. Mucke and M. B. A. Oldstone (1995). "Consequences of cytotoxic T lymphocyte interaction with major histocompatibility complex class 1 -expressing neurons in vivo." Journal of Experimental Medicine 182: 1201-1212. Rodahl, E. and J. G. Stevens (1992). "Differential accumulation of herpes simplex virus type 1 latencyassociated transcripts in sensory and autonomic ganglia." Virology 189(1): 385-388. Roizman, B. and A. E. Sears (1996). Herpes Simplex Viruses and Their Replication. Virology. B. N. Fields. New York, Raven Press, Ltd., 2: 1795-1841. Sawtell, N. M. and R. L. Thompson (1992). "Rapid in vivo reactivation of herpes simplex virus in latently infected murine ganglionic neurons after transient hyperthermia." Journal of Virology 66(4): 2150-2156. Shibata, S. and J. T. Lee (2003). "Characterization and quantitation of differential Tsix transcripts: implications for Tsix function." Human Molecular Genetics 12(2): 125136. Sippel, A. E., H. Saueressig, M. C. Huber, N. Faust and C. Bonifer (1997). Insulation of transgenes from chromosomal position effects. Transgenic Animals Generation and Use L. M. Houdebine. Amsterdam, OPA.

PAGE 125

110 Smith, C. A., P. Bates, R. Rivera-Gonzalez, B. Gu and N. A. DeLuca (1993). "ICP4, the major transcriptional regulatory protein of herpes simplex virus type 1, forms a tripartite complex with TATA-binding protein and TFIIB." Journal of Virology 67(8): 4676-4687. Soares, K., D. Hwang, R. Ramakrishnan, M. Schmidt, D. J. Fink and J. Glorioso (1996). "Cz's-acting elements involved in transcriptional regulation of the herpes simplex virus type 1 latency-associated promoter 1 (LAP1) in vitro and in vivo." Journal of Virology 70(8): 5384-5394. Speck, P. G. and A. Simmons (1991). "Divergent molecular pathways of productive and latent infection with a virulent strain of herpes simplex virus type 1." Journal of Virology 65(8): 4001-4005. Spivack, J. G., G. M. Woods and N. W. Fraser (1991). "Identification of a novel latencyspecific splice donor signal within the herpes simplex virus type 1 2.0-kilobase latency-associated transcript (LAT): translation inhibition of LAT open reading frames by the intron within the 2.0-kilobase LAT." Journal of Virology 65: 68006810. Thellin, O., W. Zorzi, B. Lakaye, B. De Borman, B. Coumans, G. Hennen, T. Grisar, A. Igout and E. Heinen (1999). "Housekeeping genes as internal standards: uses and limits." Journal of Biotechnology 75: 291-295. Thomas, S. K., G. Gough, D. S. Latchman and R. S. Coffin (1999). "Herpes simplex virus latency-associated transcript encodes a protein which greatly enhances growth, can compensate for deficiencies in immediate early gene expression, and is likely to function during reactivation from virus latency." Journal of Virology 73(8): 6618-6625. Thomas, D. L., M. Lock, J. Zaboloty, B. R. Mohan and N. Fraser (2002). "The 2-kilobase intron of herpes simplex virus type 1 latency-associated transcript has a half-life of approximately 24 hours in SY5Y and COS-1 cells." Journal of Virology 76(2): 532-540. Thompson, R. L. and N. M. Sawtell (2001). "Herpes simplex virus type 1 latencyassociated transcript gene promotes neuronal survival." Journal of Virology 75(14): 6660-6675. Voncken, J. W. (2003). Genetic modification of the mouse. Transgenic Mouse Methods and Protocols M. H. Hofker and J. van Deursen. Totowa, NJ, Humana Press Inc. Wagner, E. K. (1991). Herpesvirus Transcription and its Regulation. Boca Raton, CRC Press. Wagner, E. K. and D. C. Bloom (1997). "Experimental investigation of herpes simplex virus latency." Clinical Microbiology Reviews 10(3): 419-443.

PAGE 126

Ill Wagner, E. K., M. D. Petroski, N. T. Pande, P. Leiu and M. K. Rice (1998). "Analysis of factors influencing the kinetics of herpes simplex virus transcript expression utilizing recombinant virus." Methods 16: 105-116. Wang, K., L. Pesnicak and S. E. Straus (1997). "Mutations in the 5' end of the herpes simplex virus type 2 latency-associated transcript (LAT) promoter affect LAT expression in vivo but not the rate of spontaneous reactivation of genital herpes." Journal of Virology 71(10): 7903-7910. Wang, K., L. Pesnicak, E. Guancial, P. Krause and S. E. Straus (2001). "The 2.2-kilobase latency-associated transcript of herpes simplex virus type 2 does not modulate viral replication, reactivation, or establishment of latency in transgenic mice." Journal of Virology 75(17): 8166-8172. Ward, P. L. and B. Roizman (1998). Evasion and obstruction: the central strategy of the interaction of human herpesviruses with host defenses. Herpesviruses and Immunity M. P.G., H. M. Friedman and M. Bendinelli. New York, Plenum Press. Weir, J. P. (2001). "Regulation of herpes simplex virus gene expression." Gene 271: 117130. Whitley, R. J. (1990). Herpes Simplex Viruses. Virology. B. N. Fields. New York, Raven Press, Ltd., 2: 1843-1887. Whitley, R. J. (1996). Herpes Simplex Viruses. Fields Virology. P. M. Howley. New York, Raven Press, Ltd., 2: 2297-2342. Wilkie, T. M., R. L. Brinster and R. D. Palmiter (1986). "Germline and somatic mosaicism in transgenic mice." Developmental Biology 118: 9-18. Wu, T.-T., Y.-H. Su, T. Block and J. M. Taylor (1998). "Atypical splicing of the latencyassociated transcripts of herpes simplex type 1." Virology 243: 140-149. Yang, L., C. C. Voytek and T. P. Margolis (2000). "Immunohistochemical analysis of primary sensory neurons latently infected with herpes simplex virus type 1 ." Journal of Virology 74(1): 209-217. Zwaagstra, J. C, J. C. Ghiasi, S. M. Slanina, A. B. Nesburn, S. C. Wheatley, K. Lillycrop, J. Wood, D. S. Latchman, K. Patel and S. L. Wechsler (1990). "Activity of herpes simplex virus type 1 latency-associated transcript (LAT) promoter in neuron-derived cells: evidence for neuron specificity and for a large LAT transcript." Journal of Virology 64: 5019-5028.

PAGE 127

BIOGRAPHICAL SKETCH Anne Gussow was born in Pottsville, Pennsylvania and graduated from Pottsville Area High School. She received her B.S. degree in biology from Susquehanna University in Selinsgrove, PA. She then went on to do research at the Pennsylvania State University College of Medicine, Hershey Medical Center, with Dr. Robert Bonneau studying the effects of stress on the immune response to Herpes Simplex Virus. Ms. Gussow began her graduate career at Arizona State University in Tempe, Arizona, with Dr. David Bloom before transferring to the University of Florida where she has completed her doctoral studies. 112

PAGE 128

I certify that I have read this study and that in my opinion it conforms to acceptable standards of scholarly presentation and is fully adequate, in scope and quality, as a dissertation for the degree of Doctor of Philosophy. David C. Bloorh^Chair Assistant Professor of Molecular Genetics and Microbiology I certify that I have read this study and that in my opinion it conforms to acceptable standards of scholarly presentation and is fully adequate, in scope and quality, as a dissertation for the degree of Doctor of Philosophy. T*aul J. Rd/r Mark R -Overstreet Professor of Neuroscience I certify that I have read this study and that in my opinion it conforms to acceptable standards of scholarly presentation and is fully adequate, in scope and quality, as a dissertation for the degree of Doctor of Philosophy.

54
Comparison of LAT expression in the various tissues normalized to levels of
18s RNA
Although there was no significant difference in LAT expression between the
different tissues when compared on a per weight basis, this calculation did not take into
consideration that different tissues are composed of different cell types and each cell type
has a different density. As a result, comparison by weight, while typically accepted as a
basis for comparison did not represent the expression of LAT per cell. To examine the
LAT transgene expression on a per cell basis, RT data was normalized to the amount of
18s RNA present in each sample. For these studies, 18s RNA was chosen as the
normalizer because it was a cellular housekeeping molecule that remains fairly constant
in all tissues (Thellin et al., 1999). This is also a very abundant RNA species, therefore
in order to compare the amount of LAT to the amount of 18s RNA present in each tissue
sample, the 18s values were divided by 108 copies to be in the range of the LAT
transgene expression. The expression profile of the same mouse tissues from figure 3-1
was reanalyzed in figure 3-2 on the basis of 18s RNA. ANOVA determined that there
was no statistical significance between the transgenic tissues when normalized to the
amount of 18s RNA present in each tissue (F=1.308, P=0.2274).
Comparing the tissues involved in the HSV infection, feet vs. DRG (t=1.202,
P=0.2746) or skin vs. DRG (t=0.9631, P=0.3797) on a per 18s RNA basis again resulted
in no significant difference in the amount of LAT expression between these tissues. The
implications of this finding are considered in the Discussion section.


29
Prior to hybridization the blot was baked for two hours in a vacuum oven at 80C.
Pre-hybridization and hybridization were carried out at 65C in 20 mL of hybridization
buffer (5x SCC, 5x Denhardts solution, 1% SDS) in a sealed bag with each incubation
lasting overnight. ATD19 probe (nt 119,664 to 119,972 bp of the HSV genome) labeled
with P was added to the buffer after the first overnight incubation. The labeled blot was
washed twice for 15 minutes each at room temperature with 0.3 M NaCl, 0.06 M Tris pH
8.0, 0.002 M EDTA followed by two washes for 15 minutes each at 65C with 0.3 M
NaCl, 0.06 M Tris pH 8.0, 0.002 M EDTA, 4% SDS. After washing the blot was dried
on Whatman paper and exposed to a phosphor screen overnight. The intensity of the
radiolabled bands was detected on a STORM phosphorimager and quantitated using
image quant software.
Real time PCR
To confirm and further quantitate the transgene copy number, a comparison
between the cellular Xist gene and LAT transgene was made using real time PCR.
Reactions were performed using primers specific for the 5 exon of the LAT and Xist.
Primer and probe sequences were 5LAT forward: 5GGC TCC ATC GCC TTT CCT,
5LAT reverse: AAG GGA GGG AGG AGG GTA CTG, 5 LAT probe: 5TCT CGC
TTC TCC CC, Xist forward: 5GCT CTT AAA CTG AGT GGG TGT TCA, Xist reverse:
5GTA TCA CGC AGA AGC CAT AAT GG, Xist probe: 5ACG CGG GCT CTC CA.
PCRs were performed on an ABI Prism 7700 thermal cycler (Applied Biosystems)
located in the ICBR protein core at the University of Florida. Ten-fold dilutions of the
LAT transgenic plasmid (pLAT/LAT) corresponding to 104 to 101 copies were used to
generate a standard curve. For the Xist cellular control, a standard curve of the pBl/B10


82
productive cascade resulting in the generation of progeny virus. One of the methods for
measuring the presence of reactivatable virus in the mouse model is explant co
cultivation. In this process, DRG were removed from latently infected mice and co
cultured in tissue culture media until progeny virus was released and detected by the
presence of CPE on the RS monolayer. In the human or rabbit eye infection, reactivated
virus would travel along the axons to the initial site of infection. When using the mouse
explant model, those axons have been dissected away and the virus travels into the media
from the tissue. This virus can then infect tissue culture cells that are in the dish with the
ganglia to serve as a detection method for reactivation.
To study the effect of the LAT transgene on the reactivation phase of infection,
DRG from latently infected mice were dissected and cultured in tissue culture media on a
layer of rabbit skin cells for 14 days. Cultures were monitored daily for the presence of
infected rabbit skin cells. In both the transgenic and non-transgenic mice, virus was
detected in all of the cultures by day 10 post co-cultivation (figure 4-4). There was also
no observed difference in the time frame of reactivation between transgenic and non-
transgenic mice.
Expression of the Transgene in trans Does Not Rescue the Restriction of a LAT
Deletion Mutant in Neural Tissue
A region of the LAT transcript has been shown to play a role in the virulence of HSV-1.
When this region of the virus was deleted, the resulting virus was markedly decreased in
virulence (Gary et al., in preparation). The LAT transgenic mouse includes the region
that was deleted in this virus, 17A480, and could provide that function during the course


92
Presented here is the nucleotide sequence of pLAT/LAT plasmid used to generate
the HSV-1 LAT transgenic mouse.
1 gatccactag ttctagagcg gccgccaccg cggtggagct ccagcttttg ttccctttag
61 tgagggttaa tttcgagctt ggcgtaatca tggtcatagc tgtttcctgt gtgaaattgt
121 tatccgctca caattccaca caacatacga gccggaagca taaagtgtaa agcctggggt
181 gcctaatgag tgagctaact cacattaatt gcgttgcgct cactgcccgc tttccagtcg
241 ggaaacctgt cgtgccagct gcattaatga atcggccaac gcgcggggag aggcggtttg
301 cgtattgggc gctcttccgc ttcctcgctc actgactcgc tgcgctcggt cgttcggctg
361 cggcgagcgg tatcagctca ctcaaaggcg gtaatacggt tatccacaga atcaggggat
421 aacgcaggaa agaacatgtg agcaaaaggc cagcaaaagg ccaggaaccg taaaaaggcc
481 gcgttgctgg cgtttttcca taggctccgc ccccctgacg agcatcacaa aaatcgacgc
541 tcaagtcaga ggtggcgaaa cccgacagga ctataaagat accaggcgtt tccccctgga
601 agctccctcg tgcgctctcc tgttccgacc ctgccgctta ccggatacct gtccgccttt
661 ctcccttcgg gaagcgtggc gctttctcat agctcacgct gtaggtatct cagttcggtg
721 taggtcgttc gctccaagct gggctgtgtg cacgaacccc ccgttcagcc cgaccgctgc
781 gccttatccg gtaactatcg tcttgagtcc aacccggtaa gacacgactt atcgccactg
841 gcagcagcca ctggtaacag gattagcaga gcgaggtatg taggcggtgc tacagagttc
901 ttgaagtggt ggcctaacta cggctacact agaaggacag tatttggtat ctgcgctctg
961 ctgaagccag ttaccttcgg aaaaagagtt ggtagctctt gatccggcaa acaaaccacc
1021 gctggtagcg gtggtttttt tgtttgcaag cagcagatta cgcgcagaaa aaaaggatct
1081 caagaagatc ctttgatctt ttctacgggg tctgacgctc agtggaacga aaactcacgt
1141 taagggattt tggtcatgag attatcaaaa aggatcttca cctagatcct tttaaattaa
1201 aaatgaagtt ttaaatcaat ctaaagtata tatgagtaaa cttggtctga cagttaccaa


32
Preparation of formaldehyde-agarose gels and blotting of RNA
To prepare the gel for RNA, a slurry of 1 gram of agarose was prepared in 75 mL
of sterile DEPC-treated water and microwaved to melt the agarose. The melted agarose
was then cooled to approximately 60C and, just prior to pouring the gel, 20 mL of 5X 3-
(N-morpholino) propanesulfonic acid (MOPS) and 5.3 mL of a 37% formaldehyde
solution (v/v) was added and mixed gently to prevent bubbles from forming in the gel.
The gel was allowed to harden for at least one hour before loading the RNA.
For each RNA sample, 5 pg of RNA was mixed with 15.5 mL FFLB (10 parts
formamide, 3.5 parts 37% formaldehyde, and 2 parts 5x MOPS) in a total volume of 20
pL and incubated for 15 minutes at 65C. Samples were snap-cooled on ice prior to
loading on the gel, and 2 pL of RNA dyes (50% glycerol, ImM EDTA, 0.25%
bromophenol blue, 300 pg/pl ethidium bromide) were added to each sample for loading.
Running buffer consisted of 160 mL 5x MOPS, 43 mL 37% formaldehyde q.s. to 800 mL
with DEPC-treated water. The RNA was electrophoresed at 85 volts for approximately 3
hours. The dye front ran approximately 9 cm from the wells on a 14 cm gel. RNA was
viewed using ultraviolet light and photographed with a digital camera (Kodak Photo
Documentation System).
Transfer of RNA to membrane
The RNA was transferred onto to Zeta Probe Nylon Membrane (Bio Rad)
according to the manufacturers directions. The gel was rinsed briefly in water and
transfer set up using Whatman paper as the wicking for capillary transfer. In addition to
the membrane located on top of the gel, four layers of whatman paper and 2 inches of
paper towels were included. For the transfer solution, 10X SSC was allowed to absorb


LIST OF FIGURES
Figure Page
1-1 Diagram of the HSV-1 virion 4
1-2 Diagram of the HSV-1 genome 5
1 -3 Regulation of the different HS V gene promoter classes 7
1 -4 Diagram of the function of HSV-1 LAT 13
2-1 Diagram of the LAT Transgene Insert 26
2-2 HSV transgene copy number determination by slot blot hybridization analysis 34
2-3 Mapping of the LAT transgene in the LAT transgenic mouse 37
2-4 PCR mapping the transgene insert 38
2-5 Expression of the LAT transgene 40
3-1 Expression of the LAT transgene per gram of tissue 53
3-2 Expression of the LAT transgene normalized to 18s RNA 55
3-3 LAT transgene expression is not age dependent in tissues typically involved in the
HSV infection when normalized on a per weight basis 58
3-4 Expression of the LAT transgene is not age dependent in tissues involved in the
HSV infecction when calculated per cell by normalizing to 18s RNA 58
3-5 In situ hybridization of a latently infected dorsal root ganglia 59
3-6 In situ hybridization for 5 LAT exon 61
3-7 In situ hybridization for LAT intron in transgenic DRG 62
3-8 In situ hybridization for LAT 5 exon in brain 64
3-9 In situ hybridization of the transgenic brain with LAT intron probe 65
3-10 In situ hybridization in the transgenic spinal cord 66
IX


31
under the following conditions: 1 cycle 2 mintues 50C, 1 cycle 10 minutes 95C, 40
cycles 15 seconds 95C 1 minute 60C.
Northern Blot of Transgenic RNA
Harvesting of transgenic tissues
Transgenic mice were euthanized with halothane and brain, DRG, liver, kidney,
and foot were dissected. Tissues were snap frozen in liquid nitrogen and stored at -80C
until processed for RNA.
Isolation of RNA from tissues
Tissues were homogenized in 400 pL Trizol reagent (In vitro gen) using Kontes
glass tissue grinders (Fisher) or a ceramic mortar and pestle for larger tissues (i.e. skin,
feet, liver). Sterile sand was added to the mortar to aid in grinding of the feet. Grinders
were rinsed twice with 400 pL Trizol each and this rinse solution added to the ground
tissue fraction. After 5 minutes at room temperature, 240 pL of chloroform was added
and homogenates vortexed 15 seconds followed by a 5 minute incubation at room
temperature. Tissue homogenates were centrifuged at 9,000 x g for 15 minutes at 4C
and the aqueous phase containing the RNA was removed to a separate tube. The bottom
Trizol layer was stored at -80C for subsequent back-extraction of DNA, if necessary.
RNA was precipitated with 500 pL of isopropanol at room temperature for 10
mintues followed by centrifugation at 12,000 x g for 10 minutes at 4C. RNA pellets
were washed with 1 mL 70% ethanol and centrifuged 5 minutes at 4C, 7,500 x g. The
resulting pellet was air dried briefly and resuspended in 200 pL diethyl pyrocarbonate
(DEPC, Sigma)-treated water.


51
emulsion once and allowed to dry approximately 20 minutes before being stood in a slide
drying rack for 3 hours with drierite. After slides were completely dry, they were put into
slide boxes containing drierite for up to 2 weeks at 4C. Each slide had a non-hybridized
blank slide between it and the next slide to prevent the 35S on one slide from non-
specifically exposing the emulsion on adjacent slides.
Developing
Slides were warmed to room temperature for approximately 1 hour before
developing. Fresh D-19 developer (Kodak) was used for each experiment. In the
darkroom, slides were incubated for 4 minutes in D-19 followed by 3 washes in water for
30 seconds each. Slides incubated in fixative (Kodak rapid fixer) for 4 minutes followed
by 2 washes in water 5 minutes each. Slides were counterstained with freshly made
Giemsa (Sigma) for 20 minutes, rinsed extensively in tap water and allowed to dry before
coverslipping and sealing with Permount.
Statistical Analysis
All data was analyzed using GraphPad In Stat software version 3.05 for the
Macintosh computer.
Results
Determination of the Amount of LAT Expressed in Non-Neural vs. Neural Tissues
Comparison of transgene expression on a per weight basis
The amount of LAT RNA present in transgenic tissues was determined by real
time PCR. Real time PCR is more accurate than traditional PCR methods because it
allows for data collection at the exponential phase of amplification, as opposed to
conventional PCR, which measures only the final amount of PCR product. Since
conventional PCR endpoints often represent reactions that may have plateaued many


96
5401 cgggccgcgg ctctgtggtt aacaccagag cctgcccaac atggcacccc cactcccacg
5461 cacccccact cccacgcacc cccactccca cgcaccccca ctcccacgca cccccactcc
5521 cacgcacccc cactcccacg cacccccact cccacgcacc cccactccca cgcaccccca
5581 ctcccacgca tccccgcgat acatccaaca cagacaggga aaagatacaa aagtaaacct
5641 ttatttccca acagacagca aaaatcccct gagttttttt ttattagggc caacacaaaa
5701 gacccgctgg tgtgtggtgc ccgtgtcttt cacttttccc ctccccgaca cggattggct
5761 ggtgtagtgg gcgcggccag agaccaccca gcgcccgacc cccccctccc cacaaacacg
5821 gggggcgtcc cttattgttt tccctcgtcc cgggtcgacg ccccctgctc cccggaccac
5881 gggtgccgag accgcaggct gcggaagtcc agggcgccca ctagggtgcc ctggtcgaac
5941 agcatgttcc ccacgggggt catccagagg ctgttccact ccgacgcggg ggccgtcggg
6001 tactcggggg gcatcacgtg gttacccgcg gtctcgggga gcagggtgcg gcggctccag
6061 ccggggaccg cggcccgcag ccgggtcgcc atgtttcccg tctggtccac caggaccacg
6121 tacgccccga tgttccccgt ctccatgtcc aggatgggca ggcagtcccc cgtgatagtc
6181 ttgttcacgt aaggcgacag ggcgaccacg ctagagaccc ccgagatggg caggtagcgc
6241 gtgaggccgc ccgcggggac ggccccggaa gtctccgcgt ggcgcgtctt ccgggcacac
6301 ttcctcggcc cccgcggccc agaagcagcg cgggggccga gggaggtttc ctcttgtctc
6361 cctcccaggg caccgacggc cccgcccgag gaggcggaag cggaggagga cgcggccccg
6421 gcggcggaag aggcggcccc cgcgggggtc ggggccgagg aggaagaggc agaggaggaa
6481 gaggcggagg ccgccgaggg ggggatcaat tcagctgagc gccggtcgct accattacca
6541 gttggtctgg tgtcaaaaat aataataacc gggcaggggg gatctgcatg gatcgatcca
6601 gacatgataa gatacattga tgagtttgga caaaccacaa ctagaatgca gtgaaaaaaa
6661 tgctttattt gtgaaatttg tgatgctatt gctttatttg taaccattat aagctgcaat
6721 aaacaagtta acaacaacaa ttgcattcat tttatgtttc aggttcaggg ggaggtgtgg


9
expression, and as an example, a transgenic mouse containing the gC promoter driving
P~gal exhibited no expression of P-gal in neuronal or non-neuronal tissues (Loiacono et
al., 2002). An example of both late promoter classes is presented in Figure 1-3.
The Latency Associated Transcript
During the latent period of infection, LAT is produced abundantly from the long
repeat region of the genome. LAT is the only HSV-1 transcript that has not been
classified in one of the classes of genes mentioned above (immediate early, early, or late).
The LAT RNA is made as an 8.3-kb primary transcript and is spliced into several smaller
RNAs. The most abundant LAT RNA is the 2kb intron that exists as a stable lariat
structure with a >24 hour half life (Farrell et al., 1991; Thomas et al., 2002). The stability
of the LAT intron may be due to the non-consensus branch point that allows for
generation of the lariat structure during splicing (Wu et al., 1998). Additionally, in
latently infected trigeminal ganglia a 0.5 kb region is spliced out of the 2 kb intron
resulting in a second stable 1.5 kb species (Spivack et al., 1991; Alvira et al., 1999).
There has been no direct evidence that LAT is translated into a protein during the
HSV infection despite extensive studies including sequence analysis (Drolet et al., 1998),
transient expression assays (Thomas et al., 1999), and site mutagenesis of ATGs (Bloom
et al., 1996). Some of these studies were able to generate a LAT protein outside of the
context of the natural viral infection, but there is no evidence to date that this protein is
expressed during infection (Coffin and Thomas, 1998; Thomas et al., 1999).
Transcription of LAT begins near the TATA box consensus sequence with the
promoter extending as much as 870 nucleotides upstream of the transcription start site
(Lokensgard et al., 1997). Several cellular regulatory sites have been identified in the


CHAPTER 1
INTRODUCTION
HSV Clinical Features
Herpes viruses are characterized by their ability to establish a life-long infection
of their host with long periods of latency during which the virus exists in ganglionic
neurons with only a single transcript detected abundantly. Herpes Simplex Virus Type 1
(HSV-1) infection causes lesions commonly known as cold sores. A large portion of the
world population, up to 90% in some areas, has been exposed to HSV-1 by adolescence
and produce detectable antibodies to the virus (Roizman and Sears, 1996).
Herpes infections have been described since the days of ancient Greece. Infection
with HSV-1 is typically characterized by lesions of the epithelium of the mouth or lips,
although it can infect other mucosal areas, such as the eyes. A closely related
Herpesvirus, HSV-2, causes the same type of lesions, although they are primarily genital
in nature (Roizman and Sears, 1996).
The initial phase of infection or primary infection lasts two to three weeks and is
often asymptomatic in young children. Once the lesions have healed, the virus enters a
latent state where it exists asymptomatically in sensory nerve ganglia. Latency is
interrupted by periods of reactivation, which is the result of stress. During reactivation,
lesions can recur at the initial site of infection. The frequency and severity of
reactivations vary depending upon the individual, although the duration of reactivation
lesions is typically shorter than the primary lesions, and asymptomatic shedding is
common (Roizman and Sears, 1996).
1


22
Restoration of virulence by expressing LAT in trans
One of the functions attributed to LAT is a change in virulence (Gary et al., in
preparation; Pemg et al., 1999). By infecting LAT transgenic mice with a LAT mutant
that is reduced in virulence, we hypothesized that the expression of the transgene
containing the region deleted in the mutant could restore wild type virulence level if the
function can act in trans. In this case, virulence was measured as a function of virus
titers reaching the DRG and assayed by titering the amount of infectious virus present in
feet and DRG during the acute infection following footpad inoculation.
In summary, HSV-1 LAT is a complex region with a number of functions
attributed to it. Generation of a transgenic mouse containing this region can be used to
further define some of these functions a well as to determine which functions are trans
acting and can be attributed to the expression of the RNA.


36
founder mouse determined that the SV40 poly A signal has been deleted, thus the founder
was LAT positive and SV40 negative (G. Rail, personal communication). PCR analysis
of DNA from transgenic mice was used to confirm the extent of the LAT transgenic
insert present in the transgenic line. As described in the materials and methods, both
conventional and real time PCR were used to map a large portion of the transgene.
Figure 2-3 illustrates the location of primer sets used to map the transgene, and indicates
those that were positive for presence of the transgene. The regions analyzed by
conventional PCR are represented by black arrows, while the regions analyzed by real
time PCR are shown in red. Also shown are the locations of two probes, ATD17 and
ATD19 (shown in blue) which were used in hybridization analyses described later that
also confirmed the presence of the regions of the LAT in the transgenic mouse.
The PCR products resulting from the conventional PCR reactions (figure 2-4)
illustrate bands of the indicated sizes with both pLAT/LAT plasmid and mouse tail DNA.
One additional primer set AG29 and AG31 failed to detect the corresponding LAT
sequences in the DNA from the transgenic mouse. The location of these primers is
represented in green, and corresponds to the 3 end of the transgene insert (figure 2-3).
Since this primer pair (AG29 &31) has failed to detect a product from transgenic DNA it
is believed that a portion of the 3 end of the transgene has been deleted in addition to the
SV40 poly A signal.


10
LAT promoter region including cyclic AMP response elements (CRE), Spl sites, CAAT
box, USF, YY1 and AP-2 (Kenny et al., 1994; Soares et al., 1996; Wagner and Bloom,
1997) as shown in Figure 1-3. The presence of cellular regulatory regions suggests
possible cellular control of the LAT promoter which will be examined in the experiments
presented in the following chapters.
A second, TATA-less promoter, LAP2 (latency associated promoter 2) has been
described in the region 3 of the LAP1 transcription start site (Figure 1-3). This region of
DNA contains elements such as a G/C rich segment that are found in housekeeping genes
and those genes involved in signal transduction pathways. Transcription from LAP2 is 5-
10 fold less abundant than from LAP1 as determined by transient expression with a CAT
reporter (Goins et al., 1994). LAP2 is active during the acute phase of the animal
infection and also in cell culture of both neuronal (SY5Y) and non-neuronal (CV-1) cells
but LAP2 is not active during the latent phase of infection in the absence of LAP 1 core
promoter elements (Nicosia et al., 1993). The exact transcription start site for LAP2 has
yet to be mapped and further studies are necessary to determine the function of
transcript(s) derived from the LAP2 promoter. For the remainder of this dissertation the
LAT promoter refers to the LAP1 promoter unless otherwise noted.
Previous research has stated that LAT promoter activity is different in different
cell types. In addition to expression in neurons during latency, Jarman et al. (1999)
reported that LAT is expressed in murine feet during the acute infection following
footpad infection using P-gal reporter viruses. The expression was seen two to four
days post infection on both the dorsal (infected) and ventral sides of the foot and is in
contrast to only low levels of LAT expression observed in non-neuronal cells in culture


87
background transgenic line. It should be pointed out, however, that the dramatic
restriction in ganglionic replication exhibited by 17A480, and the fact that this restriction
is also detected on PC-12 cells in culture would seem to suggest that it is unlikely that the
lack of rescue was due to a difference in mouse background.
Taken together, these data suggest that LAT does not act in trans to regulate its
functions. A more likely model is that LAT is acting in cis to regulate other functions in
the HSV-1 genome. Given the proximate location of the LAT to ICPO and ICP4, these
might be candidates for this c/'s-acting activity.


56
Comparison of the Amount of LAT Expressed in the LAT Transgenic Mouse to the
Amount of LAT Expressed in the DRG During HSV Infection
In the HSV-1 infection not all the DRG cells are infected and of the infected cells
only a portion detectably express LAT (Rodahl and Stevens, 1992). To compare the
amount of LAT being expressed in the transgenic mouse to the amount of LAT in an
infection, we infected mice with 17+ HSV-1 (wild type) and harvested DRG at 4 days
post infection (d.p.i.) (acute) and 28 d.p.i. (latent). These ganglia were processed to
isolate RNA and LAT expression was quantitated by RT-PCR as described above.
Figure 3-lb and 3-2b illustrate the amount of LAT present in DRG during the acute and
latent infection compared to the amount of LAT present in the transgenic tissues in
Figure 3-la and 3-2a respectively. The transgenic DRG contained 10-fold more LAT
expression per gram of tissue than either the acute or latent infected DRG. When
compared on a per weight basis there was no statistical difference between the amount of
LAT expressed in the transgenic DRG and either the acutely infected DRG (P= 0.1448)
or the latently infected DRG (P= 0.1204). When we looked at the amount of LAT in the
infected tissues on a per cell basis, there was approximately 10 fold more LAT in the
infected tissues than in the transgenic DRG. Statistically, the difference between the
transgenic DRG and the latent DRG was not quite significant (P= 0.0786) while the
difference between the transgenic DRG and the acute DRG was significant (P= 0.0283)
when compared relative to the amount of 18s RNA (Figure 3-2). While we would have
expected there to be more LAT in the transgenic tissue compared to the infection, it has
been shown that ganglionic levels of LAT are highest at the peak of the acute infection
and decline as latency is established. If this is the case, the differences in LAT


4 CHARACTERIZATION OF THE EXPRESSION OF LAT IN TRANS ON THE
COURSE OF HSV-1 INFECTION IN MICE 73
Overview 73
Materials and Methods 74
Results 78
Discussion 85
5 OVERALL CONCLUSIONS 88
APPENDIX
A MAP AND SEQUENCE OF THE pLAT/LAT PLASMID 91
B PCR PRIMER SEQUENCES 98
C EXPRESSION OF THE LAT TRANSGENE IS NOT AGE DEPENDENT 100
LIST OF REFERENCES 104
BIOGRAPHICAL SKETCH 112
vii


CHAPTER 4
CHARACTERIZATION OF THE EXPRESSION OF LAT IN TRANS ON THE
COURSE OF HSV-1 INFECTION IN MICE
Overview
HSV-1 infection is characterized by three phases; acute, latent and reactivation.
The LAT has been suggested to play some role in all three phases, although its most
striking phenotype seems to be primarily at the level of reactivation (Wagner, 1991;
Bloom et al., 1994; Bloom et al., 1996b; Wang et ah, 1997). The mechanism of its action
in this process has not been determined. Limited amounts of LAT have also been seen
during the acute phase of infection, although at present, there is no function linked to this
expression (Jarman et ah, 1999).
If the LAT RNA used a trans mechanism of action, exerting a function on an
HSV-1 DNA molecule that had not actually produced the LAT RNA, then we would
expect to see a phenotype at some phase of the HSV infection in the LAT transgenic
mouse. For example, we could experimentally infect the LAT transgenic mouse with a
LAT(-) virus and phenotypically convert the virus to resemble wild type. Contrarily, if
LAT functions in cis, functionally regulating or interacting with the DNA molecule that
produced the LAT RNA, then there would be no visible phenotype when infecting the
LAT transgenic mouse with HSV-1. With this in mind, experiments that examined the
acute, establishment and reactivation phases of the HSV-1 infection were performed in
the LAT transgenic mouse. For the acute studies, LAT transgenic mice and their non-
transgenic littermates (as controls) were infected with HSV-1 on their rear footpads. The
73


CHARACTERIZATION OF A TRANSGENIC MOUSE EXPRESSING THE HSV-1
LATENCY ASSOCIATED TRANSCRIPT
By
ANNE M. GUSSOW
A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY
UNIVERSITY OF FLORIDA
2004


12
ganglia can be induced however, in one of two ways: co-cult explant of DRG or
hyperthermal stress.
The explant model uses the stress caused by dissection of the ganglia from the
mouse to initiate reactivation. Dissected ganglia are incubated in tissue culture media
and infectious virus is detectable in the media by 2 weeks after explant. Mimicking one
of the natural causes of reactivation, fever, the hyperthermia model involves raising the
body temperature of the mouse to 43C for 10 minutes to induce reactivation. While this
model initiates the lytic cycle, lesions have not been seen at the initial site of infection but
virus can be detected in the sensory ganglion at 24 hours post stress (Sawtell and
Thompson, 1992).
Another common model of HSV infection is the rabbit ocular model. Prior to
HSV infection rabbit corneas are scarified to allow for a more uniform infection surface.
In this model, latency is established in the trigeminal ganglia and HSV can either
spontaneously reactivate or be induced to reactivate using iontophoresis of epinephrine to
mimic the host stress response (Hill et al., 1986).
There is one non-animal model of reactivation that involves culture of primary
neurons in the presence of NGF. For infection, acyclovir (the nucleoside analog used to
inhibit HSV lytic genes) and NGF are added to the media so that a quiescent infection is
established without killing the neurons. Acyclovir is removed once establishment has
taken place and reactivation can be induced by removal of NGF from the media (Colgin
et ah, 2001). These quiescent cultures are the closest system available to an in-vitro
latency model, most tissue culture systems have the ability to support a lytic infection,
but not establish latency.


50
x 105 cpm/site by adding hybridization solution (50% deionized formamide, 0.3 M NaCl,
10 mM Tris pH 7.4, 2x SSC, 1 mM EDTA pH 8, lx Denhardts solution, 100 pg/pL
denatured salmon sperm DNA, 250 pg/pL, tRNA, and 5 pg/pL polyA) and heated to
100C for 2 minutes, followed by quenching on ice. To pre-hybridize the probe, the
diluted probes were incubated at 45C for 1 hour, followed by quenching on ice. For the
hybridization, 20 pL of the prehybridized probe solution was added to the tissue sections.
Slides were covered with a treated coverslip and sealed with rubber cement.
Hybridization was carried out at 45C for 72 hours.
Washes
Cover slips were removed by peeling off the rubber cement from the slides. The
slides were first washed in low stringency wash solution (50% crude formamide, 0.3 M
NaCl, 10 mM Tris pH 7.4, 1 mM EDTA pH 8) with stirring for 72 hours with 6 changes
of wash solution during that period. The first wash change was after 2 minutes to remove
excess hybridization solution. After the first wash, a small piece of nylon membrane (i.e.
Hybond-N) was included in the washing jar to collect any unbound probe.
After the low stringency wash, slides were washed for 2 hours in high stringency
wash solution (50% formamide, 2x SSC, 10 mM Tris pH 7.4, 1 mM EDTA pH 8) at
40C. Slides were rinsed twice in 2x SSC for 5 minutes each and dehydrated in ethanol
(70%, 70%, 95%) containing 0.3 M ammonium acetate to stabilize the counts 5 minutes
for each wash.
Filming
To film the slides, NTB-2 nuclear track emulsion (Kodak) diluted 1:1 with 0.6 M
ammonium acetate was liquefied at 45C in the dark. Each slide was dipped into the


Ill
Wagner, E. K., M. D. Petroski, N. T. Pande, P. Leiu and M. K. Rice (1998). "Analysis of
factors influencing the kinetics of herpes simplex virus transcript expression
utilizing recombinant virus." Methods 16: 105-116.
Wang, K., L. Pesnicak and S. E. Straus (1997). "Mutations in the 5' end of the herpes
simplex virus type 2 latency-associated transcript (LAT) promoter affect LAT
expression in vivo but not the rate of spontaneous reactivation of genital herpes."
Journal of Virology 71(10): 7903-7910.
Wang, K., L. Pesnicak, E. Guandal, P. Krause and S. E. Straus (2001). "The 2.2-kilobase
latency-associated transcript of herpes simplex virus type 2 does not modulate viral
replication, reactivation, or establishment of latency in transgenic mice." Journal of
Virology 75(17): 8166-8172.
Ward, P. L. and B. Roizman (1998). Evasion and obstruction: the central strategy of the
interaction of human herpesviruses with host defenses. Herpesviruses and
Immunity. M. P.G., H. M. Friedman and M. Bendinelli. New York, Plenum Press.
Weir, J. P. (2001). "Regulation of herpes simplex virus gene expression." Gene 271: 117-
130.
Whitley, R. J. (1990). Herpes Simplex Viruses. Virology. B. N. Fields. New York, Raven
Press, Ltd., 2: 1843-1887.
Whitley, R. J. (1996). Herpes Simplex Viruses. Fields Virology. P. M. Howley. New
York, Raven Press, Ltd., 2: 2297-2342.
Wilkie, T. M., R. L. Brinster and R. D. Palmiter (1986). "Germline and somatic
mosaicism in transgenic mice." Developmental Biology 118: 9-18.
Wu, T.-T., Y.-H. Su, T. Block and J. M. Taylor (1998). "Atypical splicing of the latency-
associated transcripts of herpes simplex type 1." Virology 243: 140-149.
Yang, L., C. C. Voytek and T. P. Margolis (2000). "Immunohistochemical analysis of
primary sensory neurons latently infected with herpes simplex virus type 1."
Journal of Virology 74(1): 209-217.
Zwaagstra, J. C., J. C. Ghiasi, S. M. Slanina, A. B. Nesbum, S. C. Wheatley, K.
Lillycrop, J. Wood, D. S. Latchman, K. Patel and S. L. Wechsler (1990). "Activity
of herpes simplex virus type 1 latency-associated transcript (LAT) promoter in
neuron-derived cells: evidence for neuron specificity and for a large LAT
transcript." Journal of Virology 64: 5019-5028.


110
Smith, C. A., P. Bates, R. Rivera-Gonzalez, B. Gu and N. A. DeLuca (1993). "ICP4, the
major transcriptional regulatory protein of herpes simplex virus type 1, forms a
tripartite complex with TATA-binding protein and TFIIB." Journal of Virology
67(8): 4676-4687.
Soares, K., D. Hwang, R. Ramakrishnan, M. Schmidt, D. J. Fink and J. Glorioso (1996).
"Cw-acting elements involved in transcriptional regulation of the herpes simplex
virus type 1 latency-associated promoter 1 (LAP1) in vitro and in vivo." Journal of
Virology 70(8): 5384-5394.
Speck, P. G. and A. Simmons (1991). "Divergent molecular pathways of productive and
latent infection with a virulent strain of herpes simplex virus type 1." Journal of
Virology 65(8): 4001-4005.
Spivack, J. G., G. M. Woods and N. W. Fraser (1991). "Identification of a novel latency-
specific splice donor signal within the herpes simplex virus type 1 2.0-kilobase
latency-associated transcript (LAT): translation inhibition of LAT open reading
frames by the intron within the 2.0-kilobase LAT." Journal of Virology 65: 6800-
6810.
Thellin, O., W. Zorzi, B. Lakaye, B. De Borman, B. Coumans, G. Hennen, T. Grisar, A.
Igout and E. Heinen (1999). "Housekeeping genes as internal standards: uses and
limits." Journal of Biotechnology 75: 291-295.
Thomas, S. K., G. Gough, D. S. Latchman and R. S. Coffin (1999). "Herpes simplex
virus latency-associated transcript encodes a protein which greatly enhances
growth, can compensate for deficiencies in immediate early gene expression, and is
likely to function during reactivation from virus latency." Journal of Virology
73(8): 6618-6625.
Thomas, D. L., M. Lock, J. Zaboloty, B. R. Mohan and N. Fraser (2002). "The 2-kilobase
intron of herpes simplex virus type 1 latency-associated transcript has a half-life of
approximately 24 hours in SY5Y and COS-1 cells." Journal of Virology 76(2):
532-540.
Thompson, R. L. and N. M. Sawtell (2001). "Herpes simplex virus type 1 latency-
associated transcript gene promotes neuronal survival." Journal of Virology 75(14):
6660-6675.
Voncken, J. W. (2003). Genetic modification of the mouse. Transgenic Mouse Methods
and Protocols. M. H. Hofker and J. van Deursen. Totowa, NJ, Humana Press Inc.
Wagner, E. K. (1991). Herpesvirus Transcription and its Regulation. Boca Raton, CRC
Press.
Wagner, E. K. and D. C. Bloom (1997). "Experimental investigation of herpes simplex
virus latency." Clinical Microbiology Reviews 10(3): 419-443.


58
1.00E+07
1.00E+06
(L)
3
P 1.00E+05
00
S E00E+04
Q.
5 E00E+03
E1
-1 E00E+02
1.00E+01
Day Old 1
Month Old 1
Month Old 2
Month Old 18
. G
9$
.6*
Figure 3-3 LAT transgene expression is not age dependent in tissues typically involved in
the HSY infection when normalized on a per weight basis.
1.00E+07
1.00E+06
<
Z 1.00E+05
on
1.00E+04
c/l
'§ 1.00E+03
u
I.00E+02
1.00E+01
1 Day Old
1 Month Old
2 Month Old
18 Month Old
C
&
if
Figure 3-4. Expression of the LAT transgene is not age dependent in tissues involved in
the HSV infection when calculated per cell by normalizing to 18s RNA.


P
ACKNOWLEDGMENTS
I would first like to thank my mentor, Dr. David Bloom, for his guidance and
direction in the completion of this work and for providing me with the opportunity to
complete my doctoral studies at the University of Florida. I would also like to thank my
committee, Dr. Richard Condit, Dr. Sue Moyer, and Dr. Paul Reier, for their useful
discussions and suggestions to this project.
I would like to thank Dr. Robert Bonneau for encouraging me to apply to graduate
school and for giving me a start in my research career, and Dr. Eddie Castaneda for
helping to ease my transition from Arizona State to the University of Florida.
I would like to express my gratitude to the people who have worked with me in
Daves lab over the years, both the ASU group, Rick Jarman, Robert Tran, Jerry ONeil,
Niki Kubat, Melanie Paquette, and Lee Gary, as well as the UF group, Tony Amelio,
Zane Zeier, Nicole Giordiani, Peteijon McAnany and Loretta Arme. Each of them has
brought a special quality to the lab that will not be forgotten.
The biggest acknowledgment goes to my husband, Karl, and my son, Seth.
Without the love and support of both of them this goal would have fallen short a long
time ago. I thank Karl for the 2500 miles of I-10,1 hope the journey has been worth the
sacrifices that he has made as a result. Although Seth is too young to understand any of
this, coming home to his simple outlook on life has put things into perspective on many
occasions.
IV


66
Figure 3-10. In situ hybridization in the transgenic spinal cord. A. 5 LAT exon probe.
An example of positive neurons is marked with black arrows and examples of
negative neurons are marked with red arrows. B. LAT intron probe.


40
Figure 2-5. Expression of the LAT transgene. A. Agarose gel of total RNA from
transgenic and HSV-1 infected mice. In the transgenic total RNA was
isolated from liver (LV), kidney (K), foot (F), brain (BR), and dorsal root
ganglia (DRG). Control RNA from HSV infected mice (K6). The location of
18s and 28s RNA is marked on the gel. B. Northern blot using a probe for the
LAT 2kb intron. Accumulation is seen only in the infected DRG and the
transgenic DRG. A larger molecular weight band in the brain suggests that
there may be a splicing difference between different types of tissue.


7
-300
B
+i

%%%
-105 -61
+i
1L+
V'
%
*7
-29 +1
D
%
-48 +1_
fi^
T
-870
-141
+1
-* -
1T-
+600
iODO
,\ % ^ V5, ^ vw^ \ ^
~ V ^
\V'
LAP 1
LAP 2
Figure 1-3. Regulation of the different HSV gene promoter classes. A. Immediate early
genes. B. Early genes. C. Late genes. D. Leaky Late genes. E. LAT gene.
Abbrv: INR, initiator element. DAS, downstream activating sequence.
LAP1, latency associated promoter 1. LAP2, latency associated promoter 2.


CHAPTER 2
GENERATION OF A TRANSGENIC MOUSE EXPRESSING A PORTION OF THE
HSV-1 LATENCY ASSOCIATED TRANSCRIPT
Overview
The latency-associated transcript (LAT) of HSV-1 has been implicated as playing
a role in a number of functions related to the viral infection. The mechanisms of these
functions and the regulation of the LAT transcript have not been determined. To
examine the regulation of the LAT in cells, we have generated a transgenic mouse
containing the LAT inserted into the mouse genome. This therefore has allowed us to
study the LATs function outside its normal context of the HSV genome.
Transgenic technology was first used in 1980 to inject HSV and SV40 viral
plasmid DNA into a fertilized mouse pronucleus (Gordon et al., 1980); and has since
expanded to include transgenic animals for a number of human disease models and viral
gene models (Nomura, 1997). The use of mice for transgene studies is ideal because of
the knowledge of mouse genetics and the number of different genetic strains available.
Although other transgenic mice containing HSV LATs have been generated, they
did not contain the native promoter sequence or the LAT from HSV-1 (Wang et al., 2001;
Mador et al., 2003). Thus, the HSV-1 LAT transgenic mouse described here is a novel
model system because it allows for LAT to be regulated by its native promoter. This
mouse has provided a means for studying a number of the proposed LAT functions
including reactivation, virulence, and neuronal survival.
23


Copyright 2004
by
ANNE M. GUSSOW


46
and 20 units RNasin (Promega) in a final volume of 20 (iL. Reactions were incubated at
37C for 1 hour followed by 10 minutes at 100C to inactivate the reverse transcriptase
and then ice quenched.
Real Time PCR Reactions
The amount of LAT RNA in each transgenic mouse tissue sample was quantitated
using real time PCR and compared to cellular control RNA as described below.
Primer and probe sequences
Primer and probe sequences for the transgene were 5LAT forward: 5GGC TCC
ATC GCC TTT CCT, 5LAT reverse: AAG GGA GGG AGG AGG GTA CTG, 5 LAT
probe: 5TCT CGC TTC TCC CC. The location of these primers was diagramed in
figure 2-3.
18s RNA was used as a cellular control. The primer and probe set was obtained
from Applied Biosystems (PN 4308329). Control 18s RNA was provided with the 18s kit
and was reverse transcribed in the same manner as the tissue RNA as described above.
Standards
A standard curve was generated for each of the primer sets used. The pLAT/LAT
transgene plasmid was used as standard to determine copy number by performing PCR
on 10-fold dilutions of this target ranging from 104 to 101 copies. The cellular control
standard was 18s RNA and was used in 10-fold dilutions 10 ng to 1 pg corresponding to
the amount of RNA added to the reverse transcription reaction. This amount was
converted to copy number for final analysis.
Conversion of the 18s data from was required because the program associated
with the Real Time thermalcycler will not accept numbers for standards that are higher
than 106. To calculate copy number for 1 ng of 18s the size of mouse 18s RNA (1869 bp)


3
glycoprotein that can bind to the complement factor C3b and limit the induction of the
complement cascade (Chen et al., 2003)
In order to determine the role of the immune system in the latent phase of HSV
infection, a number of mouse strains deficient in specific aspects of the immune response
have been infected. These strains were each compared to the relatively HSV-resistant
C57B1/6 strain which contains a functional immune system. C57B1/6 mice can be
infected with HSV and establish a latent infection but do not develop encephalitis as a
result of infection (Lopez, 1975; Kastrukoff et ah, 1986). In contrast, SCID mice are
highly susceptible to HSV as a result of being deficient in both T and B cells. Even so, it
was suggested that HSV has the potential to establish latency at early times post-infection
in these mice as defined by the observation of neuronal LAT expression in ganglia 1-2
days post infection (Gesser et ah, 1994). Interferon knockout GKO mice exhibited a
delay in the peak of viral productive infection, but latency was established at a normal
rate and HSV infection was not lethal to these mice, suggesting that interferon
stimulation of the immune response is not necessary to resolve the acute infection. The
moderately susceptible Balb/c strain resulted in a stronger productive infection than seen
in C57B1/6 mice, but no differences were seen in the relative ability of HSV to establish
latent infections in these different mouse strains with known differences in immune
backgrounds (Ellison et ah, 2000). These studies imply that establishment of latency is
the result of a virus neuron response and not mediated by the immune response since
latency was established in all strains tested.
General HSV Characteristics
HSV-1 is the prototype of the alphaherpes virus family causing life-long infection
of the host. The virus particle is enveloped with at least eleven glycoproteins present on


44
expression, and only a few different tissues were examined. In the case of the HSV-2
LAT transgenic mouse, detailed expression data was presented only for some central and
peripheral nervous tissues and expression in non-neural tissues was mentioned in the
discussion, but data was not presented (Wang et al., 2001; Mador et ah, 2003).
In addition to determining the tissue-specific expression profile, the cell-specific
expression of LAT was examined by in situ hybridization. The Margolis group reported
that during an experimental HSV-1 infection of mice, the LAT is expressed in a
particular subset of neuronal cells of DRG and TG (Yang et ah, 2000). By in situ
hybridization analysis of the LAT transgenic mouse, we sought to determine if LAT is
being expressed in all cells or a subset of cells as evidence of whether LAT expression in
different neurons is controlled primarily by cell-specific factors or whether trans-acting
viral factors may contribute to the differential expression profile noted by Margolis.
Materials and Methods
Harvesting of Transgenic Tissues
Transgenic mice were euthanized with halothane and cortex, hypothalamus
(cerebrum bottom), cerebellum, spinal cord, olfactory bulb, TG, DRG, spleen, liver,
kidney, skin, foot, heart, intestine, eye, and lung were dissected, snap-frozen in liquid
nitrogen, and stored at -80C until processed for RNA.
Isolation of RNA from Tissues
Tissues were homogenized in 400 pL Trizol reagent (Invitrogen) using Kontes
glass tissue grinders (Fisher) or a ceramic mortar and pestle for larger tissues (i.e. skin,
feet, liver). Sterile sand was added to the mortar to aid in grinding the feet and skin.
Grinders were rinsed twice with 400 pL Trizol each and the rinse solution was added to


47
was obtained from the Qiagen catalog appendix (Qiagen, 2003) and the following
formula was used with 6.6 x 10'4 equaling the mass of one base pair.
lng fmol x 6.6x1 O4 x 1869bp
pL
lng = 1.23354 find
pL
0.81 fmol x lxlO'15 moles = 8.13xl0'16 moles x 6.022x1023 molecules =
pL f mol pL mole
o
4.9x10 molecules
pL
The molecules/ pL were multiplied by the number of copies generated by the real time
program to convert ng to molecules.
PCR reactions
All reactions were performed on an ABI Prism 7700 thermal cycler (Applied
Biosystems) located in the ICBR protein core at the University of Florida. Samples were
run in triplicate. For each reaction, 2 pL of the reverse transcription reaction was added
to 0.33 pL 60x Assay Mix (primer/probe set), and 10 pL Taqman Universal PCR Mix
(Applied Biosystems part #430437) in a final volume of 20 pL. PCR was performed in
96 well plates under the following conditions: 1 cycle 2 minutes 50C, 1 cycle 10 minutes
95C, 40 cycles 15 seconds 95C, 1 minute 60C.
In-situ hybridization of Transgenic Tissues
Preparation of tissue sections
DRG, kidney, brain, and spinal cord tissues were harvested from transgenic, non-
transgenic littermates, and infected mice and fixed with 4% paraformaldehyde in


76
250 ng/mL fungizone and sterile sand then rinsed with 5 mL MEM. Homogenates were
centrifuged at 3000 x g for 15 minutes to pellet cellular debris.
Titration dishes were prepared with rabbit skin cells in 24 well plates to be sub-
confluent at the time of inoculation. Serial dilutions from 10' to 10' of the tingue
homogenate supernatants were made in MEM with supplements. Media was removed
from the titration plates and 200 pL of each dilution of tissue homogenate was added in
triplicate, and virus allowed to absorb for 1 hour at 37C with 5% CO2. After the
inoculation, plates were rinsed with 2 mL of MEM to remove the inoculum and any
residual cell debris and 2 mL MEM was added to each well. Cells were incubated for 72
hours at 37C with 5% CO2 then the media was removed and the cells were stained with
crystal violet to view plaques. Excess crystal violet was rinsed off with tap water and
plates were allowed to air dry before counting.
Determination of the Amount of HSV DNA in Latently Infected Mice
Adult transgenic mice and their non-transgenic littermates were infected as
described above with 1 x 106 pfu of HSV-1 17+ (wild type) and monitored for
complications. After 28 days, mice were euthanized, DRG removed, and snap-frozen in
LN2 until processing. DRG were ground in 400 pL Trizol reagent in a Kontes glass
tissue grinder (Fisher) to extract DNA. Grinders were rinsed twice with 400 pL Trizol
each and rinse solution was added to the ground tissue. After a 5 minute room
temperature incubation, 240 pL of chloroform was added and the homogenates were
vortexed for 15 seconds followed by a 5 minute incubation at room temperature. Tissue
homogenates were centrifuged at 9,000 x g for 15 minutes at 4C. At this point, the clear
aqueous phase containing the RNA was removed to a separate tube.


39
Determination of Transgene Expression by Northern Blot Analysis
Initial expression studies to determine if LAT was active in the transgenic mouse
line were carried out using a Northern blot and probing for the LAT intron which
typically accumulates to high levels in ganglia of infected mice. Since the transgene is
present in all cells of the mouse, neural and non-neural tissues were analyzed to see if
expression or accumulation of this intron was different in the various types of tissue.
DRG that were latently infected with HSV were used in this experiment as controls for
both the presence and size of the stable intron.
Figure 2-5b demonstrates that the LAT intron is accumulating in the DRG of
transgenic mice but not in the other tissues tested (Liver, Kidney, Brain, Feet). The RNA
gel (figure 2-5a), when photographed using ultraviolet light indicated that there was RNA
present in each of the wells and that there was more RNA present in the Kidney and
Brain samples than the DRG sample. Thus, the lack of hybridization in the samples was
not due to the absence of RNA. Lack of intron accumulation in tissues other than the
DRG does not mean that LAT is not being expressed in those tissues. In the tissues not
accumulating LAT intron, splicing may be inefficient or the intron maybe destabilized.
The presence of a higher molecular weight band in the brain sample (figure 2-5b) may
support these theories but further studies are necessary to confirm the mechanism
involved in the lack of intron accumulation. The size of the LAT intron band (relative to
the sizes of the 28s and 18s RNA bands) when compared to the controls (DRG compared
to K6) indicates that the intron from the transgenic mouse is complete, measuring to
approximately 1.9 kb.


APPENDIX C
EXPRESSION OF THE LAT TRANSGENE IS NOT AGE DEPENDENT
The expression profile for the LAT transgenic mouse was presented in Chapter 3.
Due to the large amount of data generated by studying the expression profile in four age
groups of mice, only a portion of the age related expression data was presented. The
complete age related expression profile for the transgenic mouse is presented here.
For each tissue RNA was extracted and reverse transcribed as described in the
materials and methods, chapter 3. RT-PCR reactions were performed using real time
PCR for the 5 LAT exon or 18s RNA and compared to a standard curve generated by
known copies of plasmid DNA.
The LAT expression in transgenic neural tissues for the four age groups, 1 day, 1
month, 2 months, and 18 months old, is graphed in figure C-l. By ANOVA there was no
statistical difference between the age groups for each tissue, hypothalamus (P= 0.1744),
cerebellum (P= 0.7774), cortex (P= 0.7537), olfactory bulb (P= 0.5967), spinal cord (P=
0.3303), dorsal root ganglia (P= 0.6908), trigeminal ganglia (P= 0.4050) when
represented per gram of tissue.
Figure C-2 illustrates the expression data for non-neural tissues at the four age
groups. There was no statistically significant difference between the ages of any of the
tissues tested. Skin (P= 0.1728), foot (P= 0.0657), heart (P= 0.1623), kidney (P=
0.5630), lung (P= 0.2311), eye (P= 0.6017), liver (P= 0.3415), spleen (P= 0.5750), and
intestine (P= 0.6113).
100


86
the normal HSV infection could have an effect on either the establishment or reactivation
of latency. We examined all three phases of the HSV infection in the transgenic mouse.
During the acute infection there was no difference in the amount of infectious virus
present in the feet or DRG of transgenic and non-transgenic mice. The amount of HSV
DNA present in latently infected DRG of the transgenic and non-transgenic mice was
comparable, indicating that the LAT transgene was not detectably affecting the
establishment of a latent infection, at least by the criterion of the presence of HSV-1
genomes. Co-cultivation measured the ability of these genomes for biological activity
and their ability to reactivate and, again no difference between transgenic and non-
transgenic mice was observed. Thus, expression of the LAT transgene prior to infection
in the mouse had no detectable effect on any phase of the HSV infection.
The LAT region also encodes a virulence function that seems to be genetically
distinct from LATs reactivation function, as seen with deletion mutants in the region of
the intron illustrated in figure 4-5. The transgenic mouse contains the region of HSV
DNA corresponding to this virulence function. When infecting transgenic mice with the
deletion mutant, 17A480, there was no significant restoration of the wild type virulence
levels during the acute infection, although some slight differences were observed. Since
the transgenic mouse is in the more resistant C57B1/6 background, there could be other
genetic factors involved in the virulence function that was initially discovered by
infecting more sensitive Swiss mice. The data presented suggest that there may be a
slight restoration of virulence, although the difference was not statistically significant, in
the transgenic mouse which will be further studied in the Swiss background after
backcrossing of the transgenic mouse with Swiss mice to obtain a Swiss genetic


27
each primer, 1.5 mM Tris pH 8.8, 16.6 mM ammonium sulfate, 2 mM magnesium
chloride, 0.17 mg bovine serum albumin, 1.25 mM each dGTP, dCTP, dATP, dTTP and
2.5 U Taq polymerase (Perkin Elmer). PCR was performed using a Ericomp
thermalcycler (San Diego, CA) using the following conditions: one cycle 3 minutes 94C,
3 minutes 55C, 3 minutes 72C followed by 30 cycles 1 minute 94C, 1 minute 55C, 1
minute 72C.
PCR products were viewed on a 7% polyacrylamide gel using SYBR green
(Molecular Probes, Invitrogen) and a Storm Phosphoimager. The intensity of the tail
DNA amplification products were compared to PCRs of dilutions of the positive control
pLAT/LAT plasmid to determine the transgenic genotype by quantitating the intensity of
the bands using Image Quant software.
Breeding of Transgenic Mice
All mice were maintained under specific pathogen free (SPF) conditions with
access to food and water at will. Each cage contained com cob bedding and cotton
nestlets. Cage bedding was replaced bi-weekly.
The positive founder mouse was backcrossed with a C57B1/6 mouse and the
resulting litter screened by hybridization for presence of the LAT transgene. The F2
generation transgenic positive mice were again backcrossed in the C57B1/6 background.
All breeder animals were at least 8 weeks old. Initial C57B1/6 breeders were obtained
from Harlan. A small C57B1/6 colony was then maintained to provide C57B1/6 breeders.
Mice were maintained as for the transgenic colony although only a single breeder pair
was needed and genotyping was not necessary for these mice.


APPENDIX A
MAP AND SEQUENCE OF THE pLAT/LAT PLASMID
The pLAT/LAT plasmid was generated to construct the transgene insert. A
portion of the HSV-1 strain 17+ latency associated transcript (LAT) including the Dral
site (corresponding to HSV-1 genome base pair 116,516) to the Aatll site (corresponding
to HSV-1 genome base pair 121,549) was ligated into a pBluescript backbone at the Smal
site. The SV40 poly A sequence from pNSE-Ex4 was removed using EcoRI and inserted
at the Xbal site into the pBluescript plasmid containing the LAT sequence.
Sue 1(7491)
Xhn 1(7466) Sac 1(41)
SV40 poly A signal ||
LAT 2 kb Intron
1
Amp resistance gene
h
Pst 1(3819)
/
Xho 1(2908)
Eco R I (2941)
Pst 1(2951)
LAT promoter
Pst 1 (3616)
pLAT/LAT transgenic construct
7496 bp
Figure A-l. Plasmid map of the HSV-1 LAT transgenic construct. This plasmid was
linearized by digesting with Xhol for injection into the mouse pronucleus as
described in Chapter 2.
91