Citation
Elucidation of imprinting mechanisms and phenotypes in Prader-Willi syndrome mice

Material Information

Title:
Elucidation of imprinting mechanisms and phenotypes in Prader-Willi syndrome mice
Alternate title:
Elucidation of imprinting mechanisms & phenotypes in Prader-Willi syndrome mice
Creator:
Chamberlain, Stormy Jo
Publication Date:
Language:
English
Physical Description:
ix, 121 leaves : ill. ; 29 cm.

Subjects

Subjects / Keywords:
Alleles ( jstor )
Chromosomes ( jstor )
Genes ( jstor )
Genetic mutation ( jstor )
Libraries ( jstor )
Mice ( jstor )
Phenotypes ( jstor )
Pups ( jstor )
RNA ( jstor )
Transgenes ( jstor )
Department of Molecular Genetics and Microbiology thesis Ph.D ( mesh )
Disease Models, Animal ( mesh )
Dissertations, Academic -- College of Medicine -- Department of Molecular Genetics and Microbiology -- UF ( mesh )
Mice ( mesh )
Prader-Willi Syndrome -- genetics ( mesh )
Research ( mesh )
Genre:
bibliography ( marcgt )
theses ( marcgt )
non-fiction ( marcgt )

Notes

Thesis:
Thesis (Ph.D)--University of Florida, 2003.
Bibliography:
Bibliography: leaves 114-120.
Additional Physical Form:
Also available online.
General Note:
Typescript.
General Note:
Vita.
Statement of Responsibility:
by Stormy Jo Chamberlain.

Record Information

Source Institution:
University of Florida
Holding Location:
University of Florida
Rights Management:
Copyright [name of dissertation author]. Permission granted to the University of Florida to digitize, archive and distribute this item for non-profit research and educational purposes. Any reuse of this item in excess of fair use or other copyright exemptions requires permission of the copyright holder.
Resource Identifier:
030387300 ( ALEPH )
82319140 ( OCLC )

Downloads

This item has the following downloads:


Full Text









ELUCIDATION OF IMPRINTING MECHANISMS AND PHENOTYPES IN
PRADER-WILLI SYNDROME MICE















By

STORMY JO CHAMBERLAIN

















A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE
UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2003















ACKNOWLEDGMENTS

The author thanks the past and present members of the Brannan lab--Winthropian Peery, Karen Johnstone, Chris Futtner, Jessica Wairath, Susan Blaydes, Tom Simon, Mike Elmore, Todd Adamson, and Missy Shelley--for making lab such a fun place to work, for tolerating her daily, and for sticking together through some tough times. She extends special gratitude to Karen Johnstone for her gracious help with this document.

She also thanks Dan Driscoll for being the butt of her jokes and for not letting her forget that she, too, can be a butt, and Jim Resnick for accepting responsibility for her and for keeping all of us together.

The author extends her deepest gratitude to Cami Brannan for allowing her to

work on this project, for her ideas, for giving her someone to look up to, and for years too few of friendship.

Finally, the author thanks her parents for all of their support and for making her come home when she needs to.















TABLE OF CONTENTS

ACKNOW LEDGM ENTS ............................................................................................... ii

LIST OF ABBREVIATIONS ...................................................................... vi

ABSTRACT ........................................................................................ viii

CHAPTERS

1. INTRODUCTION ......................................................................................................... I
Genomic Imprinting ............................................................................................ I
The Prader W illi and Angelman Syndromes ........................................................ 4

2. IM PRINTED REGULATION OF UBE3A .................................................................... 9
Introduction ............................................................................................................. 9
M aterials and M ethods .......................................................................................... 11
Strains and M ratings ........................................................................................... 11
Identification of Polymorphisms ........................................................................ 12
RT-PCR ............................................................................................................. 12
Results ................................................................................................................... 13
Discussion ............................................................................................................. 15

3. IM PRINTED TRANSGENES ..................................................................................... 23
Introduction ........................................................................................................... 23
Use of Transgenic M ice to Study Gene Regulation ............................................ 23
M aterials and M ethods ......................................................................................... 26
Screening the BAC Libraries ............................................................................. 26
Probe Preparation .............................................................................................. 28
Verification of BAC Clones ............................................................................... 29
End Sequencing BAC Clones ............................................................................ 29
Pulse-Field Gel Electrophoresis ......................................................................... 30
Southern Blot ..................................................................................................... 30
Transgenic M ice Production .............................................................................. 31
M ouse Husbandry .............................................................................................. 32
M ouse Strains .................................................................................................... 32
Results ................................................................................................................... 32
YAC Studies ...................................................................................................... 32
129/Sv BAC Library Screen .............................................................................. 33


iii









RecA M ediated Homologous Recombination .................................................... 34
RecET M ediated Hom ologous Recombination ................................................... 36
C57BL/6J BAC Library Screen ......................................................................... 36
Lambda Red M ediated Hom ologous Recombination .......................................... 38
Production Of Transgenic M ice ......................................................................... 39
Characterization Of Transgenic Lines ................................................................ 40
The M arked Endogenous Snrpn Locus ............................................................... 41
Im printed Expression From Transgenes ............................................................. 42
Discussion ............................................................................................................. 46

4. STRAIN-DEPENDENT DIFFERENCES IN PHENOTYPE ..................................... 64
Introduction ........................................................................................................... 64
M aterials and M ethods .......................................................................................... 66
Strains and M ratings .......................................................................................... 66
Culling and Fostering ........................................................................................ 67
Identification of Polym orphism s ........................................................................ 67
RT-PCR ............................................................................................................. 68
Northern Blot Analysis ...................................................................................... 69
Results ................................................................................................................... 70
Discussion ............................................................................................................. 72

5. TRANSGENIC RESCUE OF THE PWS-IC DELETION MOUSE ........................... 80
Introduction ........................................................................................................... 80
M aterials and M ethods .......................................................................................... 85
Screening the BAC Libraries ............................................................................. 85
Probe Preparation .............................................................................................. 86
Verification of BAC Clones ............................................................................... 86
End Sequencing BAC Clones ............................................................................ 87
Pulse-Field Gel Electrophoresis ......................................................................... 87
Southern Blot ..................................................................................................... 88
Transgenic M ice Production .............................................................................. 88
M ouse Husbandry .............................................................................................. 89
M ouse Strains .................................................................................................... 89
Results ................................................................................................................... 90
Screening the BAC Library for Clones ............................................................... 90
Production and Characterization of Transgenic M ice ......................................... 91
Transgenic Rescue Experim ents: 454 Transgenic Lines .................................... 94
Transgenic Rescue Experiments: 380 and 1707 Transgenic Lines ..................... 95
Discussion ............................................................................................................. 96
BAC Isolation .................................................................................................... 96
Rearranged Transgenes ...................................................................................... 97
Transgenic Rescue ............................................................................................. 99

6. CONCLUSIONS AND FUTURE DIRECTIONS .................................................... 110




iv









REFERENCES ........................................................................................................... 114

BIOGRAPHICAL SKETCH ....................................................................................... 121














LIST OF ABBREVIATIONS AS Angelman syndrome

AS-IC Angelman syndrome imprinting center

AS-SRO Angelman syndrome smallest region of deletion overlap

BAC bacterial artificial chromosome

cDNA complementary deoxyribonucleic acid

CpG cytosine-phosphate-guanine

DNA deoxyribonucleic acid

DNaseI deoxyribonuclease I

IAP interstitial A particle

IC imprinting center

ICR imprinting control region

Igf2 insulin-like growth factor-2 gene

Igf2r insulin-like growth factor-2 receptor gene

Ipw imprinted in Prader-Willi gene

kb kilobase

Magel2 mage-like-2 gene

Mb megabase

Mkrn3 makorin-ring-3 gene

mRNA messenger ribonucleic acid

NCBI National Center for Biotechnology Information


vi









NCI National Cancer Institute

Ndn Necdin gene

PCR polymerase chain reaction

PWS Prader-Willi syndrome

PWS-IC Prader-Willi syndrome imprinting center

PWS-SRO Prader-Willi syndrome smallest region of deletion overlap

RNA ribonucleic acid

RNaseI ribonuclease I

RPCI Roswell Park Cancer Institute

RT reverse transcription

RT-PCR reverse transcription polymerase chain reaction

SmN small nuclear ribonucleoprotein particle N protein

snoRNA small nucleolar ribonucleic acid

Snrpn small nuclear ribonucleoprotein particle N gene

Snurf Snrpn upstream reading frame

Ube3A ubiquitin 3A ligase

UPD uniparental disomy

YAC yeast artificial chromosome

ZNF127 human zinc finger protein 127

Zfpl127 murine zinc finger protein 127









vii
















Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy

ELUCIDATION OF IMPRINTING MECHANISMS AND PHENOTYPES IN PRADER-WILLI SYNDROME MICE By

Stormy Jo Chamberlain

May, 2003

Chair: James Resnick
Major Department: Molecular Genetics and Microbiology

Genomic imprinting is an epigenetic phenomenon in which genes are expressed exclusively from one parental allele or the other. Prader-Willi syndrome (PWS) and Angelman syndrome (AS) are human genetic disorders resulting from the absence of genes that are subject to genomic imprinting. PWS is a contiguous gene syndrome that results from the absence of two or more paternally expressed genes, while AS is a disorder that can result from the absence of a single maternally expressed gene, UBE3A, which lies in the same region.

This study uses a mouse model for PWS in which paternal transmission of a PWS imprinting center (PWS-IC) mutation results in complete loss of local paternal gene expression. This targeted mutation accurately models both the molecular and phenotypic aspects of PWS, and it has been applied to both of these aspects in this study.






viii









It has first been shown that imprinted expression of Ube3a, most likely results from the regulation of a paternally expressed transcript that is antisense to the Ube3a gene, suggesting an interesting model for the regulation of gene expression in this imprinted region. The minimum sequence that is sufficient to confer proper imprinted expression of the paternally expressed genes to transgenes in vivo was then identified. This provides a stringent assay that can be used to test the proposed model of imprinted gene expression.

Transgenic rescue of the PWS mouse was also used in our mouse model to

correlate specific attributes of the PWS phenotype to specific gene products. A transgene that shows expression of a single small nucleolar RNA (snoRINA) cluster rescues the small stature phenotype of PWS mice, while three other genes were found to have no obvious effect on the PWS phenotype in mice. We have also found that the PWS phenotype is less severe on certain strain backgrounds, suggesting the presence of modifier genes that may ameliorate the PWS phenotype. These modifier genes may help to identify gene pathways involved in PWS as well as future targets for gene therapy that may ultimately help the PWS patient.



















ix













CHAPTER 1

INTRODUCTION

Prader-Willi and Angelman syndromes (PWS and AS, respectively) are two

human genetic disorders that result from deficiencies in genes that are subject to genomic imprinting. The causative genetic regions for both of these syndromes have been mapped to approximately 3 Mb in the 15ql 1-q13 region. They provide a clinically and scientifically interesting situation in which to study the mechanisms and phenotypes involved with one region of genomic imprinting.

Genomic Imprinting

Genomic imprinting is a phenomenon in which genes are expressed in a parentof-origin specific manner. Both parental genomes, in fact, are absolutely required for normal development of a mammal (mouse). Work from the laboratories of Davor Solter and Azim Surani showed that embryos with two genetic contributions from the same parent would not develop normally. 2,3 Embryos with two male pronuclei (androgenetic) developed into tissues that were mostly extraembryonic in nature, while those with two female pronuclei (parthenogenetic) developed into tissues that represented the embryo proper. 2 Cattanach showed that uniparental disomy, or the inheritance of specific chromosome segments from a single parent, also led to developmental abnormalities, further suggesting the importance of both parental genomes. This also led to the idea that it may be specific genes or regions that were differentially regulated between maternal and paternal alleles, and thus responsible for the failure of parthenogenetic or




I






2


androgenetic embryos to develop correctly. These experiments suggested that certain genes in the mammalian genome were subjected to genomic imprinting and are expressed exclusively from the paternally inherited allele and silenced from the maternally inherited allele, while others are expressed from the maternally inherited allele and repressed from the paternally inherited allele. '

The parent-of-origin specific expression is maintained from generation to

generation, and so with each passage through the germline, the past parental "label" of an imprinted gene is erased, and the gene is "re-labeled", based on the parent that it is now inherited from. 6.7 The ability of the two parental alleles to always be distinguished from one another is fascinating, especially since these alleles can be identical. The existence of identical alleles that are somehow regulated differentially indicates that genomic imprinting involves an epigenetic phenomenon. Epigenetic, meaning 'outside conventional genetics', 9 refers to the distinguishing mark being something other than changes in sequence. There is now considerable evidence to suggest that chemical modifications, such as methylation or acetylation, to DNA and proteins associated with DNA are responsible, in part, for the epigenetic changes that distinguish one parental allele from another. '0 DNA methylation has been known to be associated with silenced alleles, although some preferentially expressed alleles are known to be associated with DNA methylation. 6.11-13 The histone code has also been shown to be associated with either the maintenance or establishment of imprinted domains. The current understanding of how DNA methylation collaborates with proteins that modify nucleosomes to establish a stable chromatin state and epigenetically regulate gene






3


expression is nicely reviewed by Rudolf Jaenish and Adrian Bird in the March 2003 volume of Nature Genetics. '

Is extremely important to understand the cis acting regulatory sequences that harbor the epigenetic changes and translate them to changes in gene expression, since gene expression from one parental allele or the other is the ultimate goal of genomic imprinting. While many imprinted regions, such as H19-1g12 and Igf2r have been studied in great depth, it has become apparent that different imprinted regions are not necessarily subjected to the same regulation paradigms.

The PWS/AS region of genomic imprinting is an attractive imprinted region to

study for several reasons. First, the imprinted region spans a distance of approximately 3 Mb. The mechanism of a control element that influences gene regulation at such great distances is particularly intriguing. Secondly, this region seems relatively simple. At the outset of this study, there were four known paternally expressed genes and one known maternally expressed gene in the region. "-9 It was also known that this region was regulated by a bipartite imprinting center, with one portion regulating the maternally expressed gene, and the other regulating the paternally expressed genes. 20 Thirdly, at least two mouse models with disrupted imprinting in the PWS/AS region suggested that the imprinting mechanism was conserved between mouse and human, providing a genetic system in which to study imprinting. "' Most importantly, the PWS/AS region has clinical significance, as it was originally identified as a genetic region that was responsible for human disease.






4


The Prader Willi and Angelman Syndromes PWS is characterized by neonatal hypotonia, failure to thrive, hypogonadism, cryptorchidism, and poor suckle. 23 By 18-36 months, the failure to thrive and poor suckle symptoms subside, and PWS children begin to develop obesity that is complicated by hyperphagia, physical and mental developmental delay that leads to moderate mental retardation and small stature, and behavioral problems reminiscent of obsessivecompulsive disorder.13 AS is characterized by severe mental retardation, ataxic gait, inappropriate laughter, happy affect, and almost absent speech.'4 Each of these disorders occur at a frequency of approximately 1 in 15,000 live births. 24-26 While PWS and AS are relatively rare, they provide a closed genetic system in which to investigate human disorders, such as obesity, failure to thrive, ataxia, and mental retardation, that are much more common.

Ledbetter et al. first noticed that patients with PWS often had cytologically visible deletions of human 15q II-q 13. 14 Butler and Palmer later reported that these same deletions were occurring on the paternally inherited chromosome. 27 Finally, Nicholls et al. determined that maternal uniparental disomy was also a mechanism by which PWS could occur. 2" This led to the suspicion that PWS occurs as from the physical or functional deletion of the genes located on the paternally inherited chromosome. AS, on the other hand was known to be associated with similar deletions that were occurring on the maternally inherited chromosome. ",' Paternal uniparental disomy was also shown to result in AS. 332AS was found to be the result of the physical or functional deletion of maternal 15qI-q 13.






5


Patients with PWS lack expression of all of the paternally expressed genes in the region and can be divided into 3 genetic classes--maternal uniparental disomy patients, 28 deletion patients, and imprinting defect patients. 6.2 Maternal uniparental disomy patients have two chromosomes 15 that were inherited from their mother, presumably as a result of nondisjunction, followed by reduction in the zygote. Absence of a paternal allele of 15qI 1 -q 13 causes the absence of expression of the paternally expressed genes. The deletion patients have a 3-4 Mb deletion of the paternally inherited 1 5q 11 -q 13, which is facilitated by repeated regions that flank the entire imprinted domain. These repeats cause this type of deletion to occur at a comparatively high frequency. Patients with this deletion are physically missing the paternally inherited allele from which genes are expressed. Imprinting mutations were identified in patients that had inherited both a maternal and paternal chromosome 1 5q 1 -q 13, but the paternal chromosome had a maternal epigenotype as assayed by methylation at the SNRPN gene. Some of these imprinting mutations were found to be due to deletions of the PWS-IC and result in the silencing of the paternally expressed genes. 6,11-1320 Other imprinting mutations show no apparent deletion or mutation in the PWS-IC, and are thought to be epimutations of unknown origin. "

AS patients can be divided into five genetic classes--paternal uniparental disomy

313 6,20
patients, 32 deletion patients, 2"0 imprinting defect patients, 6.20 UBE3A mutation patients, 34,35 and biparental patients with an unidentified genetic lesion. Paternal uniparental disomy patients have two chromosomes 15 from their father. Again, nondisjunction is thought to be responsible for this, but it occurs less frequently in males than females, accounting for the reduced frequency of paternal uniparental disomy






6


patients. AS deletion patients are physically missing the maternal allele of 15q 11-q 13, and thus the two maternally expressed genes in the region. Imprinting mutations that result from microdeletion of the AS-IC disrupt the maternal pattern of gene expression. These imprinting mutations were shown to be small deletions upstream of the PWS-IC deletion mutations and never overlap them. Imprinting mutations in AS patients have been identified by mutation of the putative AS-IC and not by epimutation, since no known methylation mark has been associated with AS (A. Lossie and D.J. Driscoll, personal communication). Finally, the two biparental classes of AS patients indicate that AS can be caused by disruption of the UBE3A gene and that other genes are likely to be involved in the UBE3A pathway. "" The contribution of the other maternally expressed gene, ATPJOC to the AS phenotype is not well understood. 36

The imprinting center mutations from several PWS patients were mapped to identify the smallest region of deletion overlap for PWS (PWS-SRO). 1'3 The PWSSRO is located 5' of the SNRPN gene, including the first exon of the gene. The PWSSRO is often referred to as the PWS imprinting center or PWS-IC. Although the PWSSRO has been narrowed to approximately 4.3 kb, the actual deletions that have been shown to cause PWS are larger. 37,38 A smallest region of deletion overlap has also been identified for AS, and is referred to as the AS-SRO. The AS-SRO lies around 35 kb upstream of the PWS-SRO, and has been narrowed to 0.8 kb. 37.38 AS imprinting mutations never appear to overlap the PWS-SRO, while PWS imprinting mutations can overlap the AS-SRO. This also indicates a bipartite structure to the imprinting center, in which the PWS and AS components work together to control imprinting in the 15qI 1q 13 region.






7


The imprinting mutation class of patients for PWS and AS also suggests that the PWS-IC is required for the paternal pattern of gene expression across this approximately

3 Mb region, while the AS-IC is required for the maternal pattern of gene expression. Human chromosome 15ql 1-q13 contains at least six paternally expressed genes or transcripts including MKRN3, MAGEL2, NDN, SNRPN, HBII-13, HBII-436, HBII-437, HBII-438A, HBII-438B, HBII-85, HBII-52, and the UBE3A-antisense transcript 17.18.21.39-44 and two maternally expressed genes, UBE3A and ATPIOC. 19,36

The PWS/AS region lies in a region of synteny with a region of central mouse chromosome 7, 17 and the gene order and structure is highly conserved. In addition, two mouse models-one a model for uniparental disomy, 21 and the other a targeted mutation in the PWS-IC 22 -suggest that the imprinted regulation of the genes in this region is also conserved. Mice are also capable of showing physical phenotypes such as obesity, failure to thrive, and small stature as well as behavioral phenotypes such as obsessivecompulsive disorder. Making the murine system a robust one for the study of the molecular and phenotypic aspects of PWS and AS.

This dissertation focuses on the mechanisms and phenotypes of PWS. The rich genetic conservation between mouse and human has been harnessed to investigate these aspects of the disorder. This dissertation represents the four major accomplishments. First of all, the maternally expressed Ube3a gene was shown to be negatively regulated by an antisense transcript that is, in turn, positively regulated by the PWS-IC. This led to an attractive model for gene regulation in this region. Secondly, transgenes that show correct imprinted expression were identified, thus defining the minimal area sufficient to confer appropriate imprinted expression in vivo. These transgenes also provided






8


evidence for the functional conservation of the AS-IC in mouse as well as its approximate location in the region. Thirdly, the PWS phenotype in mice is influenced by different genetic backgrounds in mice. This discovery revealed a different phenotype in the PWS mouse model, as well as a method for identifying the particular modifying genes. Finally, transgenic rescue has identified a gene that is responsible for the small stature phenotype in the PWS mouse model and revealed a phenotype associated with snoRNAs. For ease of reading, each chapter contains sufficient background and methodology so that the reader may understand each one independently.














CHAPTER 2

IMPRINTED REGULATION OF UBE3A Introduction

Angelman syndrome (AS) and Prader-Willi syndrome (PWS) are caused by

defects in genes subject to genomic imprinting. AS results from a lack of a maternally inherited pattern of gene expression of human chromosome 15q 1 1-q 13, whereas PWS results from a lack of a paternally inherited pattern of gene expression in the l 5ql 1-q 13 region. The imprinted genes involved in AS and PWS are regulated by a bipartite imprinting center (IC) located upstream of the SNRPN gene. 26The IC is divided into the Angelman syndrome imprinting center (AS-IC) and the Prader-Willi syndrome imprinting center (PWS-IC). Many of the mouse orthologs of these imprinted genes are located in the syntenic region of murine chromosome 7, 17,402,46-48 furthermore, it is known that the PWS-IC is functionally conserved in the mouse. 22

Patients with PWS lack expression of multiple paternally expressed genes.

15.16.18.40-44 PWS patients can be divided into 3 genetic classes: (1) maternal uniparental disomy for chromosome 15; (2) 3-4 Mb deletion of the paternally inherited 15ql 1-q13, or

(3) imprinting mutations that are due to deletions of the PWS-IC and result in the silencing of the paternally expressed genes. 6.49-51 This latter class of patients indicates that the PWS-IC is required for the paternal pattern of gene expression across this approximately 2 Mb region.






9






10


AS patients can be divided into five genetic classes: (1) paternal uniparental

disomy for chromosome 15; (2) 3-4 Mb deletion of the paternally inherited 15ql 1-q13;

(3) imprinting mutations that result from microdeletion of the AS-IC and subsequent disruption of the maternal pattern of gene expression; (4) biparental with a mutation in the maternally derived UBE3A gene; or (5) biparental with another as yet unidentified anomaly that cannot be described as an imprinting mutation or deletion. 6,34.50,52 It is the fourth, biparental class that has demonstrated that mutations in the UBE3A are sufficient to cause AS.

Contrary to the known paternally expressed transcripts in the region, UBE3A does not exhibit strict imprinted expression: UBE3A is expressed predominantly from maternal chromosome 15 in the brain but shows biallelic expression in fibroblasts and lymphoblasts.9"" Albrecht et al. demonstrated that while the murine Ube3a gene is expressed exclusively from the maternal allele in hippocampal neurons and Purkinje cells, it is expressed from both alleles in other regions of the mouse brain.48 Another difference between paternally expressed transcripts and UBE3A is that for most of the paternal genes, a region of differential methylation exists between the maternal and paternal alleles.3.4'" This is not the case for UBE3A, as to date, no differentially methylated CpG sites have been shown to exist near UBE3A (A. Lossie and D.J. Driscoll, personal communication). Together, these differences in imprinted expression and parental-specific methylation suggest that the mechanism that regulates the paternal program of gene expression in this region may not be the same mechanism as that which regulates UBE3A imprinted expression.









Rougeulle et al. reported the existence of an antisense transcript to the UBE3A gene. 41 Using RT-PCR of RNA derived from AS and PWS patient brains, they determined that this antisense transcript was imprinted, expressed only from the paternal allele. Rougeulle et al. suggested that the maternal-only expression of UBE3A may result from tissue specific expression of this paternally expressed antisense transcript. Therefore, using a PWS-IC deletion (APWS-IC) mouse model,22,5 the role of the PWS-IC in the regulation of the murine Ube3a antisense transcript and its subsequent effects on the parent-of-origin specific expression of the sense Ube3a transcript were investigated. It was found that the murine Ube3a transcript is expressed exclusively from the paternal allele, the antisense transcript is regulated by the PWS-IC, and the level of paternal vs. maternal Ube3a expression is different between APWS-IC mice and wild-type littermates, suggesting a role for the antisense transcript in the regulation of maternal Ube3 expression

Materials and Methods

Strains and Matings

Mouse strains used were mus musculus 129/Sv (129/Sv or D) and a strain of

C57BL/6J that is congenic for the PWS/AS syntenic region of chromosome 7 from mus castaneus (B6.CAST.c7 or C) 56. For (B6.CAST.c7 X 129/Sv) F, matings, a female B6.CAST.c7 mouse was mated with a male APWS-IC mouse on a 129/Sv strain background. Both APWS-IC mice and wildtype littermates were used. The (129/Sv X B6.CAST.c7) F, mice were generated by mating a female 129/Sv mouse with a male B6.CASTc7 mouse.






12


Identification of Polymorphisms

Total brain RNA was prepared from both 129/Sv mice and B6.CAST.c7 mice. Each RNA sample was used to create single-stranded cDNA using random primers. These cDNAs were used to program PCR reactions using primers corresponding to Ube3a exons 4 and 7 (5'-CCTGCAGACTTGAAGAAGCAG-3' and 5'GAAAACCTCTGCGAAATGCCTT-3'). The resulting products were cloned, sequenced and compared. A polymorphism found in exon 5 created a Tsp509I restriction site in the 129/Sv clone and a Bst4CI site at the same location in the B6.CAST.c7 clone. RT-PCR

Total RNA was isolated from total brain obtained from neonatal mice. RNA was extracted using RNAzol (Tel-Test, Inc.) according to instructions. This total brain RNA (10tg) was then pretreated with DNAse I (Life Technologies) and half of the reaction was subsequently used to synthesize first strand cDNA with Superscript II reverse transcriptase (RT) (Life Tehcnologies) and either strand-specific primer SF or random primers (Life Technologies). The other half of the reaction was manipulated in parallel in the absence of RT. One-twentieth of the +RT or -RT reactions were used to seed PCR reactions using the following conditions: 10mM Tris-HC1, pH 8.3, 50mM KCI, 0.125mM of the four dNTPs, 1 unit Taq DNA polymerase (Boehringer), and 4tM of each of the appropriate primers. Sequences of the primers were 5F (5'CACATATGATGAAGCTACGA-3'), 5iR (5'-CAGAAAGAGAAGTGAGGTTG-3'), and 6R (5'-CACACTCCCTTCATATTCC-3'). PCR amplification conditions were: 950C for 5 min, followed by 30 cycles of 94*C for 30 s, 60*C for 45 s, and 720C for 45 s. The final cycle was followed by an extension step for 10 min at 72*C. The PCR products






13


were either left undigested or digested with enzymes and analyzed on either a 2% or

4.8% agarose gel.

Results

The expression of a Ube3a antisense transcript was first verified in mouse brain by performing PCR across intron 5 using randomly primed murine brain cDNA. Two bands were amplified from the cDNA: the smaller correctly spliced Ube3a transcript and the larger unspliced form of the Ube3a gene, which was verified by sequencing (data not shown). The existence of this unspliced form is consistent with a Ube3a antisense transcript that is expressed in mouse brain. The presence of the antisense transcript was then confirmed, and its paternal specific expression was determined using F, progeny derived from reciprocal matings between wild-type 129/Sv mice and B6.CAST.c7 mice which are congenic for the PWS/AS syntenic region from mus musculus castaneus chromosome 7 on a C57BL/6J background. 56 DNAseI treated RNA prepared from brains of F, mice was used to program strand-specific reverse transcription reactions using a forward primer from exon 5 (5F; Fig. 2-1A), thus yielding cDNA made from the antisense transcript. Using this strand specific cDNA as a template, PCR was performed with the forward primer 5F and a reverse primer from intron 5 (5iR; Fig. 2-1A). A polymorphism in Ube3a exon 5 between Mus musculus domesticus and Mus musculus castaneus enabled the determination of the parent of origin by digestion of the RT-PCR products with the enzyme Tsp509I, which digests only the domesticus allele. The RTPCR product derived from the antisense transcript was found to be resistant to Tsp509I digestion when the father was B6.CAST.c7, but was cleaved by this enzyme when the






14


father was 129/Sv. This demonstrates that the antisense Ube3a transcript is expressed exclusively from the paternally inherited allele (Fig. 2-1B).

As previous studies have shown that all other paternally expressed transcripts in the region are regulated by the PWS-IC in humans and mice, 6.2.".20.22.15 it was necessary to determine whether the paternally expressed Ube3a antisense transcript was also subject to regulation by the PWS-IC. Therefore, the PWS-IC deletion (APWS-IC) mouse strain was used. This mouse strain was created by targeted deletion in ES cells that includes exons 1 through 6 of Snrpn and extends approximately 23 kb 5' of the gene. 225 B6.CAST.c7 females were mated with APWS-IC males and total brain RNA was isolated from the resulting newborn (B6.CAST.c7 X APWS-IC) F, mice. The RNA was DNAseI treated and used to direct strand-specific RT reactions, each containing the sense 5F primer and an antisense f3-actin primer. The resulting cDNA was used as a template for PCR using the primers 5F and 5iR, or two -actin primers. Figure 2-2 shows that the Ube3a antisense-derived 840 bp band present in the wild type cDNA is absent in the APWS-IC littermate cDNA. In contrast, actin is detected in both cDNA preparations. This result demonstrates that the Ube3a antisense transcript is positively regulated by the PWS-IC.

Finally, to determine if the paternal Ube3a antisense transcript regulates the level of paternal Ube3a mRNA, RT-PCR followed by restriction enzyme digestion was performed to examine the levels of Ube3a expression produced from each parental allele in both wild-type and APWS-IC mice. To distinguish between Ube3a expression derived from the two parental alleles, two exon 5 polymorphisms between Mus musculus domesticus (D) and Mus musculus castaneus (C) were used: the enzyme Bst4CI cuts the






15


castaneus allele once but does not cut the domesticus allele; and the enzyme Tsp509I cuts the domesticus allele twice and the castaneus allele only once (Fig. 2-3A). The experimental cross of B6.CAST.c7 X APWS-IC was established to obtain both wild-type F1 pups (C X D wt) and APWS-IC F, pups (C X D A). The control strain reciprocal cross of 129/Sv X B6.CAST.c7 was also established to obtain wild-type F, pups (D X C wt). After birth, the pups were sacrificed, total brain RNA from all three classes was isolated, and then random primers were used to prepare cDNA. Subsequent PCR amplification with the Ube3a primers 5F and 6R demonstrated that Ube3a was detectable in all three classes of F, mice (Fig. 2-3B, first three lanes). Upon digestion of these RT-PCR products Bst4CI, expression of both parental Ube3a alleles was detected in all three classes. These results are expected, since Ube3a is known be expressed from both alleles in most regions of the brain, exhibiting imprinted expression in only a subset of brain cells. 4 However, in the PWS-AIC F, lane (C X D A) the ratio of paternal (uncut) to maternal (cut) Ube3a expression was found to be elevated compared to that observed in the wildtype F, lane (C X D wt). These results were confirmed by digestion of the RTPCR products with Tsp509I. In this case, the paternal Ube3a allele (138 bp + 87 bp bands) is clearly present at significantly higher levels in the APWS-IC F, lane (C X D A) than the wildtype F, lane (C X D wt). These results demonstrate that the loss of paternal Ube3a antisense expression in APWS-IC mice is accompanied by an increase in paternal sense Ube3a expression.

Discussion

In this study, the murine Ube3a antisense transcript was shown to be exclusively expressed from the paternal allele and positively regulated by the PWS-IC. Furthermore,






16


mice that inherit a paternal deletion of the PWS-IC, and thus lack Ube3a antisense expression have an upregulated paternal Ube3a allele relative to the maternal allele, as compared to the wild-type controls. Together, these results strongly suggest that the paternally derived antisense transcript negatively regulates the level of paternally expressed Ube3a mRNA.

The differences between the imprinted expression of paternally expressed genes in the region and UBE3A strongly suggest that the maternal-only expression of the UBE3A gene is regulated by a different mechanism. The hypothesis that the tissue specific imprinting of UBE3A is an indirect consequence of the imprinted antisense transcript has been previously proposed by this lab and others.4"" Specifically, in tissues that express the antisense transcript from the paternal allele, production of UBE3A mRNA from the paternal allele is inhibited (presumably this inhibition occurs at the transcriptional level). However, the maternal UBE3A allele is not prevented from producing mRNA, so in these tissues, maternal specific expression is observed (Fig. 24A). In tissues that do not express the antisense transcript but do express the UBE3A gene, biallelic expression of UBE3A is observed (Fig. 2-4A). The data presented here using the mouse model are consistent with this hypothesis and further suggest that the imprinted expression of UBE3A is not a direct consequence of the UBE3A promoter or the AS-IC. Rather, it appears to be the PWS-IC which negatively regulates the expression of paternal UBE3A via the antisense transcript.

These data support a model in which the primary targets of imprinting in the PWS/AS region are the paternally expressed transcripts, one of which, the UBE3A antisense transcript, results in maternal-specific expression of the UBE3A gene. The






17


advantage of this model is that it greatly simplifies the seemingly complex pattern of gene regulation in the PWS/AS region. A positive regulatory element, the PWS-IC, is responsible for establishing and maintaining the paternal mode of gene expression in somatic tissues (Fig. 2-413). A negative regulatory element, which is assumed to be the AS-IC, serves to prevent activation of the paternal program on the maternally inherited chromosome, presumably by blocking PWS-IC function in the maternal germline (Fig. 24C). As a result, different patterns of gene expression are observed for the two parental alleles. The paternally expressed genes including the UBE3A antisense transcript are expressed from the paternal chromosome but not from the maternal chromosome. In contrast, UBE3A is "constitutively" expressed from the maternal chromosome in all cell types that exhibit UBE3A expression, whereas the paternal UBE3A allele is only "allowed" to be expressed in cell types that do not express the antisense transcript. Therefore, according to this model, it is only the paternally expressed genes that are subject to regulation by the IC as a whole. This reduces the complex regulation in this region to a simple ON/OFF decision: the PWS-IC operates in the ON mode unless shut OFF by the AS-IC element. Therefore, the key to understanding imprinting in this region will be to determine how the AS-IC inhibits the PWS-IC on the maternal chromosome.

Finally, as the antisense transcript appears to be the cause of the tissue specific imprinting of UBE3A, it will be interesting to determine what regulatory elements result in the expression of the antisense in such a restricted cell population in the brain. It is possible that there are positive regulatory elements that drive expression of the antisense transcript in only a few cell types. Alternatively, there may be negative regulatory elements that prevent expression of the antisense in most cell types. At this point, it can






18


only be said that the PWS-IC exerts a positive effect on the transcription of the antisense. There may be additional levels of control that restrict the antisense to fewer cell types than the other PWS-IC regulated paternally expressed genes in the region.








19

A
5F Tsp509I

Exon 5 Exon 6
5iR
6R
C (B6.Cast.c7) 21 bp 640 bp 179 bp


D (129/Sv) 21 bpt 87bp 553bp 179bp




B uncut Tsp509I No RT
I -- I I --I r __ lmaternal C D C D C D
Xx x x x x
paternal D C C D D C C D D C


840 bp
640 bp
553 bp







Figure 2-1. The antisense transcript is expressed from the paternally-derived
allele only. A. Map of the exon 5 to exon 6 region of Ube3a and schematic
showing expected PCR products, restriction sites, and fragment sizes. Triangle lollipops represent Tsp509I sites, and horizontal arrows represent primers used
for RT and PCR. B. The antisense transcript was amplified by RT-PCR from
neonatal brains from (B6.CAST.c7 X 129/Sv) Fi and (129/Sv X B6.CAST.c7) F1
mice, and by PCR from genomic DNA from parental B6.CAST.c7, and 129/Sv
mice using primers 5F and SiR. The products were digested with Tsp509I and electrophoresed along with the uncut controls on a 2% agarose gel. C indicates
the B6.CAST.c7 strain, while D indicates the domesticus strain, 129/Sv. Arrows
indicate pertinent fragments and their sizes.









20













maternal C C
X X
paternal D D
genotype wt A

Ube3a antisense



P-actin








Figure 2-2. The antisense transcript is not expressed in the APWS-IC mouse. cDNAs were made from a APWS-IC mouse and a wildtype littermate using primers 5F and the 3' fl-actin control. PCR was done using primers 5F and 5iR. The resulting products were run on a 2% agarose gel.








21


A
A C (B6.Cast.c7) D (129/Sv)
5F 5F
t t

Exon 5 Exn 6 on 5 1Exon
.4 .4
6R 6R
uncut
246 bp 246 bp

108 bp 138 bp Bst 4CI 246 bp
~t Tsp509I t
21 bp 225 bp 21 bp 87 bp 138 bp


B
uncut Bst4CI Tsp509I No RT
I I I I I I I I
maternal C C D C C D C C D C C D
X XX X x x x x x XXX
paternal D D C D D C D D C D D C genotype wt A wt wt A wt wt A wt wt A wt

246 bp 225 bp

138 bp --- 138 bp
108 bp
87 bp





Figure 2-3. Paternal Ube3a expression is increased in APWS-IC mice. A.
B6.CAST.c7 and 129/SvEv alleles are diagrammed showing PCR products,
restriction sites, and fragment sizes. The circle lollipop indicates the location of a Bst4CI site, while the triangle popsicle indicates the Tsp509I sites. Horizontal
arrows show primers used for RT and PCR. B. Sense Ube3a cDNA was made
using RNA derived from (B6.CAST.c7 X 129/Sv) F1, (B6.CAST.c7 X APWSIC) F1, and (129/Sv X B6.CAST.c7) F1 brains using random primers and PCR
amplified using primers 5F and 6R. The spliced, sense band was gel purified
and each sample was divided three ways: one portion was left uncut, the second
was cut with Bst4CI, and the third was cut with Tsp509I. These samples were
loaded on a 4.8% agarose gel. C indicates the B6.CAST.c7 strain, while D
indicates the domesticus strain, 129/SvEv. For the genotype, wt indicates a wildtype mouse; A indicates a APWS-IC mouse. Arrows indicate the location of the
fragments and their sizes.








22


A Mkrn3,Magel2, Ndn Snrpn Ube3a AtplOC
F* .. .. .. ... 11 ....... D
Pat

Mat



Pat

Mat


B










C





LT



Figure 2-4. Model of gene regulation in the PWS/AS region. A. In the
brain, two different patterns of UBE3A expression occur. In cell types that express the paternal antisense transcript, UBE3A is imprinted (top box). In
cell types that do not express the antisense transcript, UBE3A is biallelically
expressed (bottom box). B. On the paternally-inherited chromosome, the
PWS-IC establishes the paternal mode of gene expression. C. On the
maternally-inherited chromosome, the AS-IC prevents activation of the
paternal program, presumably by blocking PWS-IC function.














CHAPTER 3

IMPRINTED TRANSGENES

Introduction

Use of Transgenic Mice to Study Gene Regulation

Transgenes have been used to study regulation of gene expression in many systems. They serve to isolate regulatory elements and relocate them to an ectopic location in the genome where their local activities may be separated from the influence of adjacent cooperating regulatory elements. One of the simplest instances of using transgenes to study regulatory elements involved the tyrosinase gene.589 A 250 kb yeast artificial chromosome (YAC) was found to faithfully express the tyrosinase gene.8 This YAC was subsequently engineered to harbor a deletion of a DNaseI hypersensitive site, demonstrating that the site is necessary for correct expression of the tyrosinase gene.9 The regulation of the 1-globin locus is another example that has benefited from the use of transgenes. In the 13-globin locus, long distance regulatory elements determine the tissue specificity and developmental timing of the expression of various exons in the locus. 60 Similar to the tyrosinase locus, DNaseI hypersensitive sites were deleted from a YAC using homologous recombination, and were determined to be locus control regions in vivo by demonstrating that YACs that were missing or had duplications of these hypersensitive sites no longer showed correct temporal expression of the P3-globin exons. This was accomplished by making transgenic mice that contained single copies of the wild-type or modified YAC.6162



23






24


Imprinted regions are also good candidates for study using large transgenes.

Wutz and colleagues used YAC transgenes to examine the role of chromosome location and the role of an intronic CpG island in the imprinted expression of Igf2r, a maternally expressed gene.63 They were able to show that Igf2r imprinting is not dependent on chromosome location, but that it is completely dependent on the intronic CpG island, such that deletion of the CpG island causes derepression of the paternal Igf2r allele. Regulation of another well understood imprinted region, the H19-Igf2 locus, has also been studied using transgenic mice. The Tilghman lab were able to show that multiplecopy insertions of an H19 transgene could exhibit parent-of-origin dependent expression patterns as well as proper DNA methylation patterns, but these patterns were not maintained when the same transgene was present in single-copy. 65 The authors reasoned that the transgene constructs lacked sufficient sequence information to confer proper imprinted expression. Kaffer et al. subsequently identified a 137 kb bacterial artificial chromosome (BAC) that exhibited the proper pattern of imprinted gene expression for the H19-Igf2 locus in single-copy transgenic lines. Hark et al. also used the smaller transgenes that were not imprinted in single copy to test a model of gene regulation for the Igf2 gene.66 The authors used a reporter construct that contained a portion of the imprinted control region (ICR) followed by a polymorphic copy of the H19 gene and its enhancers derived from Mus musculus spretus, another intact ICR, and a luciferase gene. In subsequent transgenic lines a portion of the ICR that acted as a putative barrier element, separating H19 from its enhancers, was deleted. These lines showed higher expression of luciferase, indicating that the barrier element acted as hypothesized."9






25


Single copy transgenes could be used to elucidate some of the elements necessary to achieve proper imprinted expression in the PWS region. Identification of a transgene that is capable of demonstrating correct imprinted expression in single copy would elucidate the minimal genetic information that is sufficient for imprinting in this region. This transgene could then be used to make various permutations and delineate whether individual components are necessary for either paternal expression or maternal repression. Furthermore, if an efficient method for modifying the transgene were developed, a latent mark could be applied to the transgene that would make it easy to distinguish between transgenic and endogenous expression. The system could then be used to easily introduce new changes into the transgene.

Previously, our lab produced seven lines of transgenic mice carrying either a

human or a mouse P1 clone. The human P1 clone was chosen because it was known to include the human Angelman syndrome smallest region of deletion overlap (AS-SRO) as well as the Prader-Willi syndrome smallest region of deletion overlap (PWS-SRO). Furthermore, it was polymorphic to the homologous mouse locus that is syntenic to 15ql 1-q13.7" The expressed polymorphisms between the human P1 clone and the mouse locus would allow us to easily distinguish expression originating from the transgene from that coming from the endogenous locus. This human P1 clone was never correctly imprinted in 5 transgenic lines produced from it. The human P1 clone was expressed when it was inherited from both father and mother, suggesting that while the human PWS-IC positive element is functional in mouse, the human AS-IC element, which is predicted to be a negative regulatory element, does not behave as one in mouse. The mouse P1 clone, on the other hand, contained the Snrpn gene as well as the functionally






26

defined PWS-IC, but since the AS-IC has not been functionally or physically identified in mouse, we could not be certain whether or not it contained the AS-IC. Two lines were created from the murine P1 clone. One was multi-copy and showed correct imprinted expression, while the other was single copy and was expressed regardless of the parentof-origin. It was hypothesized that the mouse P1 clone did not contain the entire AS-IC, indicating that more genetic information, specifically 5' sequence, is necessary to imprint a transgene in single copy.

Two murine bacterial artificial chromosome (BAC) clones were identified that were capable of being expressed in the appropriate parent-of-origin dependent manner. These BAC clones specify a minimal region that is sufficient to confer correct imprinted expression at an ectopic location in the genome.

Materials and Methods

Screening the BAC Libraries

The Research Genetics (Huntsville, AL) BAC library was initially screened for BAC clones. This library was made from the 129/Sv strain of mouse. The library consisted of 9 filters, each carrying 27,648 unique clones with an average insert size of 130 kb spotted in duplicate onto 9 different membranes. A PCR-generated probe that included the first exon of Snrpn and a 2.2 kb EcoRI-EcoRV restriction fragment that was

5 kb 3' of Snrpn was used to screen the library.

Prior to hybridization, BAC membranes were washed with 1500 mL of 6X SSC and 0.1% SDS at room temperature for 15 minutes. The membranes were then rinsed twice with 1500 ml of 6X SSC for 15 minutes at room temperature, and hybridized according to the Research Genetics protocol. Briefly, the membranes were prehybridized






27


in roller bottles with 3 membranes per bottle, each separated by one sheet of Flow Mesh (Diversfied Biotech, Boston, MA), in 120 ml of HyperHyb (Research Genetics, Huntsville, AL) per bottle at 650 C for 20 minutes. At least 10' counts of each probe were boiled for 5 min, snap cooled on ice, and then added to 3 ml] of HyperHyb that was pre-warmed to 65' C. One ml of hybridization solution was added to each of the roller bottles, and the membranes were allowed to hybridize for 2 hours at 650 C.

The membranes were washed in the roller bottles three times for 15 minutes at

650 C with 30 nilIX SSC and 0. 1% SDS. They were then removed from the bottles and washed twice more at 650 C with 1000m1l of IX SSC and 0. 1% SDS for 15 minutes. Finally, the membranes were rinsed with IX SSC at room temperature. The membranes were then wrapped in cellophane and exposed to film (XAR, Kodak) overnight at -~80' C. Positive clones were identified following the manufacturer's instructions, and the following clones were ordered: 181J3, 573138, 518H22, and 397F16.

The Roswell Park Cancer Institute (RPCI) RPCI-23 BAC library was also

screened for potential imprinted transgenes using two probes; the 2.2 kb Eco RI- EcoRV fragment lying 5 kb 3' of Snrpn and a 1 kb SacI-NotI fragment that lies 30 kb 5' of Snrpn. This library is made from the C57BL/6J strain of mouse, with an average insert size of 200kb and is the template library for the NIH mouse genome sequencing efforts. The RPCI-23 library consists of 10 filters, each representing 18,432 independent clones that have been spotted in duplicate. To screen this library, the filters were first rinsed for 10 minutes at room temperature in 6X SSC. The BAC library filters were placed into roller bottles, five membranes per bottle, rolled with intermittently with sheets of Flow Mesh. The filters were pre-hybridized for 2 hours at 650 C with 200 ml of Church buffer






28


(1 mM EDTA; 0.5M NaHPO4, pH 7.2; 7% SDS; and 1% BSA). Approximately half of the pre-hybridization solution was poured off. The boiled, snap cooled probes (at least 107 counts, each) were then added, and the membranes were hybridized overnight at 650C.

The next morning, the membranes were first washed 5 times for 10 minutes each in the bottle at 650 C with 200 ml per tube of Wash I (1 mM EDTA; 40 mM NaHPO4, pH

7.2; 5% SDS; and 0.5% BSA). The filters were then removed from the bottles and washed 3 times for 15 minutes each at 650 C with Wash II (1 mM EDTA; 40 mM NaHPO4, pH 7.2; and 1% SDS). The membranes were wrapped in cellophane and exposed to film overnight and for 3 hours each at -80 C. Positive clones were identified following the manufacturer's instruction and ordered from RPCI. The following BAC clones were obtained from this screen: 73N19, 78014, 148C8, 160G24, 227M21, 284G21, 359M8, 365C3, 382D19, 438B21, 396A12, 421K3, 9715, 215A9, 264P24, 276M11, 425D18, 380J10, 391B10, and 437G6. Probe Preparation

Probes were labeled using the Prime-It II kit (Stratagene, La Jolla, CA), with

minor modifications. Probe DNA (200 ng) was boiled for 5 minutes in the presence of random hexamers. The DNA-hexamer mix was cooled on ice, and 5X reaction buffer was added along with 25 [.Ci of ap32dCTP and 1U of exo klenow. The labeling reaction was placed at 370 C for 15 minutes. After labeling was complete, the probe was purified using the nucleotide removal kit (QIAGEN) and eluted in 200 Rl of water. Purified probes were boiled for 5 minutes and snap cooled on ice prior to use in hybridization.






29


Verification of BAC Clones

Single BAC colonies were tested to verify that the clone represented a BAC insert derived from the Snrpn locus. Four single colonies from each BAC were streaked in duplicate onto Luria broth plates that were supplemented with chloramphenicol (LB-CA). The plates were overlayed with a nylon filter and grown overnight at 370 C. The next morning, the bacteria were lysed on the filters as follows: first, the filters were soaked in alkali solution (1.5 M NaCl and 0.5 N NaOH) for 4 minutes, followed by neutralizing solution (1.5M NaCl and 1M Tris, pH 7.4) for 4 minutes, and finally rinsed in 6X SSC for 1 minute. The filters were then pre-hybridized in Church buffer for one hour at 65' C, and then one plate was hybridized with the 5' Snrpn probe, while the other was hybridized with the 3' Snrpn probe. Upon washing and laying the filters to film, the results were used to determine whether or not the clone was derived from the Snrpn locus and whether or not the clone encompassed the 5' or 3' flanking regions of Snrpn. End Sequencing BAC Clones

The BAC clones were end sequenced using the big dye termination reaction to obtain sequences unique to the mouse genomic DNA insert. Reactions were performed on 1 mg of BAC DNA that had been sheared by passing it five times through a 25 gauge needle using a modified version of the manufacturer's instructions, with 12RI of sequencing buffer, 4 [dl of big dye, 16 pmol of primer, and 2.5mM MgC12. The reactions were subjected to an initial 5 minute cycle at 950 C, followed by 30 cycles of 950 C for 30 seconds, 500 C for 10 seconds, and 60' C for 4 minutes. The completed reactions were purified from free nucleotides using Performa DTR Gel Filtration Columns (Edge






30


Biosystems), dried, and sequenced by the University of Florida Center for Mammalian Genetics Sequencing Core.

Pulse-Field Gel Electrophoresis

Pulse-field gel electorphoresis was carried out to create a rough restriction map and tiling pathway for the BAC clones. BAC DNAs digested with the appropriate enzymes were electrophoresed on a 1% genetic technology grade agarose gel (Nusieve, FMC) made with 1X TBE buffer. Samples were mixed with lOX ficoll loading dye and ran at 200V with a switch time of 1-12 seconds for 12.5 hours. This provided resolution of bands from 6-200 kb. The gel was stained with a dilute ethidium bromide solution, photographed, and blotted as described below. Southern Blot

Agarose gels carrying 5 tg of digested genomic DNA or I ptg of digested BAC DNA were photographed and UV nicked for 5 minutes. The gel was then soaked in alkali solution for 45 minutes, followed by soaking in neutralizing solution for 90 minutes. The gel was then transferred to Hybond nylon membrane (Amersham) in lOX SSC overnight. The membrane was then rinsed in 2X SSC and baked at 800 C for 2 hours. Hybridization was carried out according to the method of Church and Gilbert. Membranes were prehybridized in 20 ml of Church buffer for 1 hour at 65 C. The prehybridization solution was poured off and replaced with 5 ml of fresh solution and the boiled and cooled probe. Hybridization continued overnight at 650 C. Washing was carried out three times in 2XSSC and 0.1% SDS at 65' C for 15 minutes each.






31


Transgenic Mice Production

For production of transgenic mice, BAC DNA was prepared by large scale

plasmid preparation, using the alkaline lysis method. First, log phase cultures of BAC culture grown in LB-CA were centrifuged for 5 minutes at 6,000 rpm to pellet the cells. The supernatant was poured off and the pellet was resuspended in GTE solution (50 mM glucose; 25mM Tris, pH 8.0; and 10 mM EDTA) plus lysozyme. The suspension was then lysed in 0.2 N NaOH and 1% SDS. After addition of the lysis solution, the lysate was neutralized in 0.5 M potassium acetate, and poured through cotton gauze into Oak Ridge tubes. BAC DNA was precipitated with ethanol, and the pellet was resuspended in

4 ml TE with 10 pg/ml RNAse A, and allowed to incubate at 370 C for 1 hour. Cesium chloride and ethidium bromide were added to the DNA solution, and the solution was loaded into a heat sealable tube. The tube was sealed and centrifuged at 58,000 rpm for 18 hours. BAC supercoils were viewed with a UV light, and both nicked and supercoiled bands were pulled. The DNA was extracted with tert-butanol until the ethidium bromide was completely depleted from the BAC DNA. The DNA was then dialyzed twice against

1 L TE buffer, using dialysis tubing for 6 hours each. The concentration of the BAC DNA was measured by spectrophotometer, and then diluted to 2.5 ng/4dl for microinjection.

Transgenic mice were made by pronuclear injection into oocytes that were

obtained from superovulated, fertilized, FVB/NJ female mice. The fertilized, injected oocytes were then implanted into (B6D2) F, females that were made pseudopregnant by mating them with vasectomized (B6D2) F, males.






32


Mouse Husbandry

At 3 weeks of age approximately 2mm of tail was clipped from each mouse, and the ear was punched for identification. Genomic DNA was prepared from the tail piece by incubation in tail lysis buffer (100 mM Tris, pH 8.5; 5 mM EDTA; 2% SDS; and 200mM NaCI) with 100 ng/gl proteinase K overnight at 550 C. The tail lysate was extracted with phenol: chloroform: isoamyl alcohol (25:24:1) and then precipitated with ethanol. The tail DNA was screened for the presence of the transgene by PCR using both end sequences from the BAC.

Mouse Strains

APWS-IC mice maintained on the C57BL/6J background were developed by

Yang et al. and constituted a 35 kb deletion encompassing 16 kb of sequence 5' of Snrpn and 19 kb 3' of Snrpn 22.55. Lines 215A, 215B, 215C, 425A, and 425B were all transgenic lines produced as described above and maintained on the FVB/NJ strain background. Transgenic line 1707 was previously described and was originally maintained on the DBA/2J strain background 7o. For the purposes of this study, this line was backcrossed for 10 generations onto the FVB/NJ strain background.

Results

YAC Studies

A YAC that contained 320 kb of genetic information spanning the Snrpn area (Fig 3-1) was previously identified. Pulse-field gel electrophoresis was used in conjunction with rare cutting enzyme digests to confirm that the YAC was indeed intact and contained the genetic information that we anticipated. Several unsuccessful attempts were then made to subclone the regions that comprised the junction between the YAC






33

vector arms and the mouse DNA insert. Despite the failure to find these junction fragments, an attempt was made to make transgenic mice using the YAC, but it was not successful. Ultimately, the attention was focused on BACs, since candidate clones for imprinted transgenes had been identified with our screen. It was surmised that the YAC was not ideal for use, since a YAC of that size is difficult to characterize and manipulate. 129/Sv BAC Library Screen

BAC clones were the best suited for transgenic studies, since they are usually larger than the P1 clones that were previously shown not to contain sufficient sequence information to be imprinted in single copy. While they are larger than P1 clones, BAC clones are smaller than YACs and are maintained as supercoils, making them more resistant to shearing. They also have the advantage over YACs of being propagated in E. coli rather than S. cerevisiae, which makes their isolation and handling much easier. Most importantly, BACs are propagated in RecA cells, and are less likely to suffer rearrangement during manipulation and propagation than YACs. Traditionally, the advantage of using YACs as opposed to BACs was the ability to make modifications by exploiting the efficient homologous recombination in S. cerevisiae. However, early in this project a preliminary method of BAC modification using homologous recombination was published, making it possible to make similar changes to BAC clones ".

The first BAC library that we screened was derived from the 129/SvEv strain of mouse, and had an average insert size of 130 kb. Using a mixture of the Snrpn exon 1 probe and a 2.2 kb EcoRI-EcoRV that lies 5 kb 3' of Snrpn as probes in this screen, four BACs were isolated: 181J3, 573B8, 518H22, and 397F16. These BAC clones were each streaked to LB-CA plates to obtain single colonies. Four single colonies representing






34


each BAC clone were grown in 3 ml overnight cultures and DNA was isolated from each culture. The BAC DNA was cut with EcoRI, and a Southern blot was performed. The blot was first probed with a 1 kb SacI-NotI fragment that yielded a large fragment about 20 kb 5' of Snrpn, and later stripped and re-probed with the 3' Snrpn probe. Two BACs, 397F16 and 518H22 spanned 5' Snrpn, but terminated short of the 3' Snrpn probe, while the other two BACs, 573B8 and 181J3, conversely hybridized with the 3' probe, but appeared to lack 5' sequences (Fig. 3-1). All four BACs were end sequenced. Next, the BAC clones were each cut with Sal, NotI, SacI, or a combination of the enzymes and subjected to pulse-field gel electorphoresis and Southern blot. Using the 5' and 3' probes, probes intergenic to the Snrpn gene, and probes generated using the end sequences from each BAC, the approximate boundaries as well as a rough restriction map for each BAC clone was determined. Following this analysis, only two BACs, 397F16 and 573B8 remained interesting as potential imprinted transgene candidates. The 397F16 clone contained the most 5' sequence of the BAC clones, but it terminated before the polyadenylation signal of the Snrpn gene. This was a problem because it could cause an expressed Snrpn transcript to be targeted for degradation. The other BAC of interest, 573B8 contained the entire Snrpn gene, but did not contain enough 5' sequence. Since neither BAC was ideal for use as an imprinted transgene, a plan was made to join these two BACs using the recently developed BAC modification scheme to produce the additional 5' sequence as well as the complete Snrpn transcript. RecA Mediated Homologous Recombination

The first method attempted was analogous to the yeast two-step homologous recombination procedure, as described by the Nat Heintz group.71 It revolved around






35

supplying the bacterial RecA gene, which was missing in the BAC host strain, on a selectable episome.7" The bacterial RecA gene was provided on a plasmid with a temperature sensitive origin of replication. The plasmid could be positively selected for using tetracycline resistance. The plasmid could also be subjected to negative selection by plating on plates containing fusaric acid, since fusaric acid is toxic to cells that produce the tetracycline resistance gene. The idea behind this recombination scheme was that one could subclone the desired modification or sequence change flanked by 5' and 3' homology arms of at least 500 bp, into this temperature sensitive recombination vector. When transformed into the BAC strain, positive selection for the modification construct would identify colonies in which insertion of the construct had occurred. Then, negative selection with fusaric acid would cause resolution of the integrant into one of two possible conformations. One possible conformation is that in which the desired change has been made, and the other conformation recovers the unmodified BAC.

The scheme to join the two pertinent BACs involved using homologous recombination to insert a neomycin resistance cassette flanked by loxP sites approximately 30 kb upstream of the Snrpn gene on the 397F16 BAC. A 35 kb Sall fragment from the modified 397F16 BAC could then be excised and recombined into the 573B8 BAC using one arm of homology anchored in the BAC vector and the other end anchored near the first exon of Snrpn. The neomycin resistance gene could then be deleted using cre recombinase, leaving a single loxP site. The resulting BAC would have 35 kb sequence 5' of Snrpn and 55 kb 3' of Snrpn, and would be a good candidate for an imprinted transgene (Fig 3-2). While this method has been successful in other labs, it was not so in this case due to the difficulty of subcloning the initial recombination






36


construct into a low-copy number plasmid that is temperature-sensitive and already quite large (11 kb).

RecET Mediated Homologous Recombination

The second method, pioneered by Francis Stewart's group, was based on the RecET system in lambda phage. 72 This system is reputedly much more efficient than that of RecA and requires smaller homology arms. The RecET mediated recombination can be carried out using only large oligos and the RecET plasmid electroporated into the BAC containing bacterial strain. The RecE and RecT gene are expressed from the pBAD promoter, making its expression arabinose inducible. This method never worked as the wrong plasmids were sent. Following this attempt, BAC modification was postponed to begin the search for a more suitable BAC transgene. C57BL/6J BAC Library Screen

The RPCI-23 BAC library was screened since our attempts at BAC modification were not working well. The RPCI library had three major advantages to the Research Genetics library. First, the average insert size for this library is 200 kb, increasing the chances of obtaining a BAC that is suitable for use as an imprinted transgene without additional modification. Secondly, this library is the template for the mouse genome sequencing effort, and so complete BAC sequences could possibly be posted as the project continued. Thirdly, if a complete BAC sequence was desired for a given BAC from this library, it could be queued for sequencing. Similarly to the strategy with the 129/Sv library, the filters were probed using both the 5' and the 3' Snrpn probes. Several Snrpn transgenes were identified from this library. They are listed as follows:






37


73N19, 78014, 148C8, 160G24, 227M21, 284G21, 359M8, 365C3, 382D19, 438B21, 396A12, 421K3, 9715, 215A9, 264P24, 276M11, 425D18, 380J10, 391B10, and 437G6.

After streaking for single colonies and verifying that the clones represented the

Snrpn region, intact BAC molecules were subjected to restriction digestion with a variety of rare cutting enzymes, including Sall, SacII, and NotI and resolved the resulting fragments by pulse field electrophoresis. The gels were transferred to nylon membranes and probed with various probes in the Snrpn area to produce a rough restriction map of each BAC and to determine whether it contained enough genetic information to serve as a putative imprinted transgene. BAC end sequences for many of these clones were readily available on the National Center for Biotechnology Informatics (NCBI) website, and so primers could be ordered and used to create probes for the end of each BAC. The following probes were used in determining BAC tiling pathways and restriction map: a 1 kb SacI-NotI fragment 5' of Snrpn, a 2.2kb EcoRI-EcoRV fragment that is 5 kb 3' of Snrpn, an oligo that localized to an interstitial A particle (IAP) that is located in the 5' end of the Ipw gene and more than 100 kb 3' of Snrpn, and an oligo that is complimentary to a small nucleolar RNA (snoRNA) that was known to exist approximately 65 kb 3' of Snrpn. Using these probes, BACs 215A9, 425D18, and 380J10 were determined to be suitable for further analysis. BAC 215A9 was shown to extend 120 kb 5' of Snrpn and 20 kb 3' of Snrpn, BAC 425D18 spanned a region that was first predicted to cover sequence 40 kb 5' of Snrpn through 65 kb 3' of Snrpn, but was later discovered to extend 90 kb 5' of Snrpn. Finally, BAC 380J10 was shown to contain only 8 kb 5' of Snrpn, but extended nearly 140 kb 3' of Snrpn, into the IAP element and the start of the Ipw gene (Fig 3-3).






38


Lambda Red Mediated Homologous Recombination

Although intact BAC molecules that seemed well suited to be imprinted without further modification were available, it was desirable to create a subtle mutation in the BAC that would allow transgenic Snrpn expression to be distinguished from the endogenous message. A third method of BAC modification that was developed by Daiguan Yu and Don Court at the National Cancer Institute (NCI) was pursued. This method employed a defective lambda prophage in which the genes allowing entry into the lytic phase of the phage lifecycle were removed, leaving only the minimal elements required to express the red exo, beta, and gam genes under a temperature-sensitive promoter.73 The first version of this system was a modified strain, in which the defective lambda prophage was integrated into the bacterial genome. Unfortunately, this version had some remaining phage genes present that would cause lysis of the bacterial cell when induced, since these genes were also initiated from the temperature-sensitive promoter. The other major problem was that this phage system was developed in an E. coli host strain that had the opposite dam methylation status to the BAC host strain. A BAC clone isolated from a dam methylation-positive strain was therefore methylated and could not transform into the strain bearing the lambda prophage. As a result, none of the aforementioned BAC clones were successfully transformed into this strain. Two improved versions of the same system were later produced that were based on the BAC host strain of E.coli, DH1OB. One version featured the defective lambda prophage as an integrant into the DH1OB genome, while the other harbored a defective prophage that was maintained as a stable episome in the bacterial cell. While the transgenic mice in






39

this study were derived unsing unmodified BAC clones, the BACs have since been modified using the lambda Red system and will be the focus of future work. Production Of Transgenic Mice

While continuing with efforts to modify the BACs, it seemed prudent to begin producing transgenic mice carrying unmodified Snrpn BACs. BAC DNA was prepared by large-scale plasmid preparation, followed by cesium chloride banding of the resulting DNA. Both nicked and supercoiled bands were pulled and used for production of transgenic mice. It was important to have extremely fresh BAC, as the larger RPCI BACs degraded rapidly after isolation, as evidenced by low yield of supercoils and a diffuse appearance on pulse-field gels. The BAC DNA was dialyzed against TE buffer and diluted for injection with water to a concentration of 2.5 ng/gl. Transgenic mice were made by pronuclear injection into oocytes derived from superovulated, fertilized, FVB/NJ female mice. The injected oocytes were then implanted into pseudopregnant (B6D2) F, mice. When the resulting pups reached 3 weeks of age, they were tail clipped to obtain DNA and earpunched for identification. Genomic DNA was prepared from each tail piece and was screened for the presence of the transgene by PCR using both end sequences from the corresponding BAC. Three transgenic founder animals were produced with the 215A9 transgene, two lines were made with the 425D 18 transgene, and five lines carried the 380J10 transgene.

The transgenic founders were mated with wild-type FVB/NJ females and the resulting litters were genotyped at 3 weeks of age to make sure that the transgene had integrated into the germline of the founders (i.e. that the founders were not chimeric), and to establish additional transgenic animals to secure the survival of the transgenic line.






40


One transgenic mouse derived from the 380J10 BAC did not show germline transmission to subsequent generations, and most likely represented a chimeric mouse in which the transgene had integrated into the genome sometime after the first cleavage following fertilization. Once the remaining lines were established, the individual lines were characterized for intactness of the transgene and copy number (Fig. 3-4). Characterization Of Transgenic Lines

Characterization of the transgenic lines was necessary to determine the number of BAC molecules that were integrated into the transgene locus as well as the integrity of the molecules that had integrated. DNA used to make transgenic mice tends to integrate into the mouse genome in tandem arrays. For the purposes of our study, it was imperative that we obtain some single copy transgenic lines, since we were adhering to the most stringent determination of the minimum amount of sequence information that was sufficient to confer proper imprinted expression. It was also important that the transgene be intact, since proper imprinted expression may be a result of the relative location of the pertinent elements. Furthermore, the BAC molecules had to be linear prior to integration into the genome, and since we injected supercoils and nicked BAC molecules, the location of the site of breakage was random. This increased the chances of deriving a non-intact transgenic line.

Copy number was determined by preparing genomic DNA from mouse tails

harboring the transgene, performing Southern blot analysis on DNA that was cut with a specific restriction enzyme, and comparing bands from two different probes that would yield bands of similar size upon the same restriction digestion. One probe was located on the transgene, while the other was not. The intensities of the bands were compared and






41


the copy number was estimated as either single copy or multi-copy. One of the 215A9 lines, one of the 425D18 lines, and one of the 380J10 lines contained multiple copies of the transgene, leaving us with two 215A9 transgenic lines, one 425D18 transgenic line, and three 380J 10 transgenic lines that represented single copy transgene integrations (Fig. 3-4).

Similarly, rearrangements were determined by creating a panel of DNAs from the different transgenic lines digested by a variety of restriction enzymes. These panels were used to produce Southern blots, which were probed with several probes from the region (Fig 3-5). If a probe illuminated a band that was of a different size than that of a wildtype, non-transgenic mouse, then that transgene was considered rearranged. One 215A9 line and one 380J10 line appeared to be rearranged by this analysis. However, due to the relatively few non-repetitive probes in the sequence surrounding the Snrpn locus, we may not have detected other rearrangements.

The Marked Endogenous Snrpn Locus

The inability to mark the BACs prior to their injection into mouse oocytes forced the use of a previously engineered Snrpn deletion mouse strain (ASmN) 22. This mouse strain carries a deletion of exons 4-7 of the Snrpn gene, that results in almost complete absence of the Snrpn gene, and the low-level production of a larger fusion transcript that includes the first exons of Snrpn and the neomycin resistance gene. Using this allele, the endogenous Snrpn locus could be marked, alleviating the absolute requirement for a marked transgene (Fig 3-6).

The APWS-IC mouse strain was also used.22 This strain has a neomycin

resistance cassette inserted in place of exons 1-5 of Snrpn. When paternally inherited,






42

this deletion prevents expression from the Snrpn locus, allowing us to measure Snrpn expression that originates from the transgene (Fig 3-6). Imprinted Expression From Transgenes

Since the transgenic copy of Snrpn was not subtly marked to be easily

distinguishable from the endogenous allele, the ability of the transgene to show proper imprinted expression had to be tested by a complex breeding scheme using a marked endogenous allele. This breeding scheme is shown in Figure 3-7. First, the expression upon maternal inheritance was examined. Females who harbored a transgene were mated with a male mouse that carried the SmN deletion allele. The resulting pups were genotyped for the presence of the transgene, as well as for the presence of the deletion allele. Pups with both the transgene and deletion allele were sacrificed and their brains were used to make RNA. The RNA was analyzed by northern analysis for the expression of Snrpn. This is possible because the transgenic female mice transmit a transgene, which may or may not be expressed, depending on its epigenetic state, as well as a wildtype copy of the endogenous Snrpn locus that is not expressed since it is inherited from a female. The male mouse, on the other hand transmits the ASmN allele only, which is expressed as a larger, less abundant message. Any wild-type Snrpn message, would then come only from the transgene. Only the 380 transgenes were able to express Snrpn upon maternal inheritance, indicating that this transgene did not contain the sequence information that was required for silencing of the Snrpn gene upon maternal inheritance (Fig 3-8).

Next, expression upon paternal inheritance was tested. In this case, male mice from the above described mating who had inherited both the transgene as well as the






43


ASmN allele were mated to females who were homozygous for the ASmN allele. The resulting pups were sacrificed and genotyped for the presence of both the transgene and the ASmN allele. The rationale behind this scheme is that the female in this case can only send a ASmN allele, which is silenced. In the presence of a known maternal ASmN allele, a paternally inherited wild-type allele can be distinguished from a paternally inherited ASmN allele. The male mouse transmits the transgene, which may or may not be expressed depending on its epigenetic state, and either a wild-type or ASmN allele. If the male transmits the wild-type allele, the resulting pups cannot be used for analysis, since the paternally inherited Snrpn locus is indistinguishable from the transgenic Snrpn locus. Alternatively, if the male transmits the ASmN allele, the endogenous allele that is expressed produces the longer, less abundant ASmN message (Fig 3-6).

Originally, the idea was to identify Snrpn mice that were transgenic and

homozygous for the ASmN allele, and examine expression in these pups. However, the presence of a large transgene that produced a wild-type Snrpn allele by Southern blot hindered identification of ASmN homozygotes. Instead, the mice were genotyped for the transgene, and RNA was made from the brains of the resulting transgenic mice. The RNA was then used to program RT-PCR reactions. PCR was performed on the RT product, using primers for both the ASmN and wild-type alleles. Pups that express both the ASmN and wild-type alleles inherit the ASmN allele and not the endogenous wildtype allele from their father (Snrpn and the ASmN alleles are only paternally expressed). Thus the wild-type allele must be expressed from the transgene. If the pup did not show expression from the ASmN allele, then it was believed to have inherited the wild-type endogenous allele from its father, and was uninformative as far as transgene expression is






44


concerned. From this assay, lines from each the two transgenes, 215A9 and 425D 18, were shown to have expression upon paternal inheritance. Thus both 215A9 and 425D18 are capable of showing correct imprinted expression in single copy transgenes (Fig 3-9).

These experiments were repeated using the APWS-IC deletion mice in place of

the ASmN deletion mice. To ascertain transgene expression upon maternal inheritance, a transgenic female mouse is mated with a APWS-IC male mouse (Fig 3-10A). The resulting pups were sacrificed and genotyped. Pups that inherited both the APWS-IC allele and the transgene were used to produce brain RNA, which was subjected to northern blot analysis and probed for Snrpn expression. Again, the females transmit the transgene as well as an epigenetically silenced maternal Snrpn allele, while APWS-IC males transmit a APWS-IC allele that completely lacks Snrpn expression. Any Snrpn message would have to originate from the transgenic copy of Snrpn. All five transgenic lines were subjected to expression analysis upon maternal inheritance, and again, only the 380J10 transgenic lines, with the exception of line 380C, showed Snrpn expression upon maternal inheritance, verifying that they did not contain sufficient sequence to confer epigenetic silencing to the maternally inherited transgene (Fig 3-10B).

To ascertain expression upon paternal inheritance, APWS-IC females were mated with transgenic males, and male pups with both the APWS-IC allele and the transgene were identified by genotyping. These pups survive since the APWS-IC allele is maternally inherited and therefore exists on the chromosome that is already epigenetically silenced. Male pups that have inherited both the APWS-IC allele as well as the transgenic allele were mated with wild-type females from the C57BL/6J strain to produce pups that harbor both the APWS-IC and the transgene (Fig. 3-1 IA). These pups






45


do not express endogenous Snrpn since their paternally inherited allele is the APWS-IC allele, which is silenced because the major promoter for the Snrpn gene is missing and because it is epigenetically silenced as a result of the imprinting center mutation. The only Snrpn expression would come from the transgenic Snrpn allele, and would occur only if the transgene were expressed upon paternal transmission. In this assay, the pups were sacrificed at birth and genotyped for the APWS-IC allele and the transgene, since pups that inherit the APWS-IC allele from their father suffer from the Prader-Willi phenotype and die shortly after birth. Pups that inherited the transgene as well as the APWS-IC allele were used to make brain RNA. This RNA was subjected to northern analysis, using a probe for the Snrpn message (Fig 3-11IB). Two transgenic lines-215B and 425A-were identified that expressed transgenic Snrpn upon paternal transmission. Since neither of these lines were expressed upon maternal transmission, they were determined to demonstrate correct imprinted expression.

Line 425A contains a single copy transgene that is intact. The transgene in this line is estimated to include the 22 kb Sail fragment that hosts the entire Snrpn gene, as well as 90 kb 5' of Snrpn and 65 kb 3' of Snrpn. This establishes the minimal genomic sequence that is sufficient to allow for correct imprinted expression in this region to be approximately 170 kb. Line 215B, on the other hand, is a single copy transgene that has undergone both 5' and 3' truncation upon integration into the mouse genome. The 5' truncation occurs at least 38 kb 5' of the Snrpn gene, while the 3' truncation occurs approximately 5 kb 3' of Snrpn. While this data suggests that the minimal sufficient region for correct imprinting is approximately 65 kb, the specific rearrangements that led to the truncation of this transgene are not known. The transgene in this particular line






46


may have also sustained additional mutations that influence its ability to be correctly imprinted.

Discussion

The 85 kb PI clone that shows correct imprinted expression when present in

multiple copies, but not when present in single copy was later found to only be 65 kb in length. The discrepancy in length occurred because the P1 was isolated from the 129/01a mouse strain, which was found to have an insertion of a 20 kb VL-30 element into the region 5' of Snrpn. The parent-of-origin independent expression of this P1 clone, now known to be 65 kb in length, indicates that either the PI clone is missing important regulatory sequences that lie 5' or 3' of the Snrpn gene, or the P1I clone does not contain enough buffer sequence surrounding the necessary regulatory regions to establish a domain of imprinted expression. The P1 clone is expressed upon both paternal and maternal inheritance when present in single copy, indicating that the defect is most likely in the ability to be silenced in the maternal germline. Since the murine AS-IC has not been functionally or physically identified in mouse and is postulated to be the negative regulatory element required for the silencing of the positively acting PWS-IC (Fig 2-4), the most likely explanation for the absence of maternal silencing of the P1 transgene is that it does not contain the AS-IC regulatory sequences. Absense of the AS-IC would be predicted to prevent silencing of the positive element located on the transgene upon maternal inheritance. Since the P1 clone without the VL-30 insertion extends 23 kb 5' of Snrpn, we believe that the AS-IC is located further than 23 kb 5' of Snrpn. This data spurred the search for transgenes with additional sequence 5' to Snrpn, rather than seek additional buffer sequence. Whether it is indeed the absence of regulatory elements or






47


buffer sequence is a germane argument in this system, since we were seeking minimal sufficient sequence to achieve appropriate imprinting, rather than determining which specific elements are necessary. The data from the P1 clone suggested that the 65 kb sequence was not sufficient to confer appropriate imprinted expression, and a single-copy imprinted transgene is necessary to establish the minimal sequence that can accomplish correct parent-of-origin dependent expression. Once the minimal required sequence has been determined, modifications can be made to that sequence to delineate specific elements that are necessary for the establishment and maintenance of the imprint.

While initial attempts to make transgenic mice with the 320 kb YAC clone were unsuccessful, the YAC clone was used to establish the approximate distance between the 3' most exon of Snrpn and exons B and C of Ipw to be 100kb. However, the difficulties surrounding purification of a YAC of that size for transgenic injection precluded its convenient use as an imprinted transgene. Previously, the largest YACs that were successfully used in gene regulation studies involving transgenic mice were only 250 kb in length.

Screening the 129/Sv BAC library proved fruitful for mining additional sequence 5' of Snrpn, but did not provide an ideal BAC clone to use as an imprinted transgene. Two clones were obtained, 397F16 and 573H8 that together contained additional sequence 5' of Snrpn as well as a complete Snrpn gene. Unfortunately, the commercially available BAC libraries were of the 129/Sv or C57BL/6J strains, which made finding naturally expressed polymorphisms unlikely since both strains are from the domesticus subspecies of Mus musculus. The possibility of using a more polymorphic human Snrpn






48


transgene was explored and rejected earlier, since the human transgene is not silenced when present as a murine transgene regardless of copy number.70

Since the 129/Sv BACs were not ideal, the first strategy was to join the two BACs to create a larger BAC that was more suitable for transgene imprinting. The strategy was to place a neomycin resistance cassette into a 35kb Sall fragment derived from the 397F16 BAC that lies 5' of Snrpn, and then excise this fragment and ligate it into the 573H8 BAC near the site of exon 1 of Snrpn. At the time, only the RecA mediated homologous recombination method had been described. This method involved a twostep gene replacement strategy in which the RecA protein, absent in the BAC host strain, was provided from a pSV1-derived plasmid with a temperature-sensitive origin of replication ". Attempts to subclone homology arms into the RecA-containing plasmid failed, probably due to the large size of the plasmid. RecET mediated homologous recombination was also attempted. This method involved inducing RecE and RecT from an arabinose-inducible promoter. 72 This method was never fully explored because the wrong plasmids were sent.

In the absence of a reliable homologous recombination method for BACs, the

C57BLI6J BAC library that was available from the RPCI was screened. The BACs from this library were on average larger than those from the 129/Sv library. Additionally, the NCBI mouse genome sequencing effort was proceeding from this library, so the specific sequence in the region would eventually become available, as well as the addresses of additional clones in the region. Screening efforts for this library were very successful, as 20 clones were isolated with the Snrpn probes. From the 20 clones, two were chosen that contained the most detectable sequence upstream of Snrpn while still carrying the entire






49


gene. While neither of the two BACs were in the sequencing program, both BACs were present as T7 and Sp6 fingerprints (end sequences) in the NCBI database.

Pulse-field gel analysis initially indicated that BAC 425D 18 contained 40 kb of sequence 5' of Snrpn, while 215A12 contained nearly 120 kb 5' of Snrpn. These estimates are rough, since they are based on large pulse-field fragments. Subsequent analysis suggested that 425D 18 actually extended 80 kb 5' of Snrpn, and that the 40 kb Sally fragment that was originally thought to be the junction fragment between the mouse DNA insert and the BAC plasmid backbone was a doublet of two adjacent fragments.

Three lines of transgenic mice harboring BAC 215A9 and two lines harboring 425D18 were obtained from microinjection of mouse oocytes. These lines were named 215A through C and 425A and B. Among these five lines, lines 215B, 215C, and 425A were all suspected to be present in single copy. Lines 215A and 425B were estimated to be present in 2-4 copy arrays. The method of analysis of transgene copy number that was used is probably accurate in delineating single-copy transgenes, but not in determining the copy number in multi-copy lines. Additionally, all transgenic lines except 215B appeared to be intact.

Transgenes were first tested for correct imprinted expression using the ASmN strain of mouse. Expression upon maternal inheritance was readily assayed using the breeding scheme in Figure 3-7. Lines 215 A-C and lines 425 A and B were not expressed upon maternal transmission, suggesting that they could be silenced in the maternal germline (Fig 3-8). Lines 380A,B, and D, however were not correctly silenced upon maternal inheritance (Fig. 3-8) and were thought to be missing the AS-IC. This would result in the failure to silence the positively acting PWS-IC and lead to expression upon






50


maternal transmission. Paternal transmission was not conclusively tested using the ASmN breeding scheme (Fig 3-7). Mice homozygous for the ASmN allele and heterozygous for the transgene could not be distinguished from the ASmN heterozygotes by southern blot. Instead, RNA was made from the brains of transgenic mice and subjected to RT-PCR. If the ASmN allele was present, it was assumed that the paternally inherited allele was the ASmN allele and not the wild-type allele, leaving any wild-type Snrpn expression to be from the paternally inherited transgene. According to this assay, lines 215C, 425A, and 425B were all expressed upon paternal inheritance (Fig 3-9). This breeding scheme was not further pursued, since it required the production of RNA and subsequent RT-PCR from every transgenic mouse. It was also not ideal that the genotype of the mice was never certain with respect to the Snrpn versus the ASmN allele. Furthermore, the potential for leaky expression from the maternally inherited allele complicated an assay that required RT-PCR.

The imprinting assays were again tested using the APWS-IC strain and the

breeding schemes shown in Figures 3-10A and 3-1 IA. Snrpn expression upon maternal inheritance was tested in a similar manner and produced the same results as previously (Fig. 3-10B). Snrpn expression upon paternal inheritance of transgenes proved to be much simpler using the APWS-IC strain. Mice inheriting the APWS-IC allele were easily genotyped by PCR that was unimpeded by the transgene. These mice could also be identified shortly after birth by their failure to thrive phenotype. Expression from the transgene in pups with a paternally inherited transgene and a paternally inherited APWSIC allele could then be assayed for Snrpn expression by northern blot analysis, which does not detect the leaky maternal expression. By northern analysis, any Snrpn






51

expression originated from the transgene. Using the APWS-IC strain, lines 425A and 215B exhibited Snrpn expression upon paternal transmission of the transgene (Fig. 311B). Since both of these lines are also silenced upon maternal transmission, they are both correctly imprinted.

Line 215C was first shown to exhibit Snrpn expression upon paternal inheritance using the ASmN strain, but not with the APWS-IC strain. The most likely explanation for this is that the transgene is indeed expressed upon paternal inheritance, but at a low-level that is detectable by RT-PCR, but not by northern analysis. It was precisely this possibility that led to the use of the APWS-IC strain to test transgene imprinting. It was desirable to maintain a high level of stringency in considering a transgene correctly imprinted, the possibility that low-level expression could come from a correctly imprinted repressed allele existed. Since the expression of Snrpn from line 215C could possibly represent leaky expression of a repressed allele and not appropriate imprinting, line 215C was not considered to be correctly imprinted.

Lines 425A and 215B demonstrated appropriate imprinted expression, indicating that they contained sufficient sequence to confer proper imprinting. This was an important finding, since the AS-IC has to date not been defined functionally or physically in mouse. According to the current model for imprinting in the PWS/AS region, 7 a correctly imprinted transgene must contain the minimal sequence to harbor the positively acting PWS-IC element as well as the negatively acting AS-IC element. The identification of a correctly imprinted transgene indicates that the AS-IC can be functionally defined in mouse, since in this instance the silencing function occurs on a transgene that is integrated into a random genomic location. The transgene then serves to






52


define an approximate location of the AS-IC, and combined transgene data suggests that it lies upstream of the PWS-IC, as it does in humans. The 425A line definitively narrows this boundary to a region within 90 kb of the Snrpn gene. The 215B transgenic line has undergone truncations at both the 5' and 3' end of the BAC, but is still imprinted. These truncations narrow the probable location of the AS-IC to a region 38 kb 5' of Snrpn, but since the nature of the transgene rearrangements are not well understood, the use of this data to suggest the location of the AS-IC must be done with caution.

The ability to use the lambda Red system of homologous recombination in BACs will greatly simplify the study of transgene imprinting. A latent mark can now be placed into the Snrpn locus, and its expression upon both maternal and paternal inheritance can be ascertained in a single generation. This same system can be used to make deletions in the most 5' end of BAC 425D18 to better identify the AS-IC. Then, specific elements can be deleted, replaced, or rearranged to test different models of imprinting mechanisms in the PWS/AS region.









53








Snrpn Ipw
genelA 5' probe 3' probe
L I




22kb:
23 kb 1 30 kb
967 PI (murine)

181J3


397F16


518H22 I



573B8




YAC -.









Figure 3-1. Restriction map of YAC clone and 129/Sv BAC library clones. YAC and BACs were subjected to restriction digestion with rare cutting enzymes and analyzed by pulse-field gel electrophoresis and southern analysis. Thin vertical lines represent Sail sites. Black boxes represent the Snrpn gene or Ipw IAP element. The 5' probe is a 1 kb SacI-NotI fragment, while the 3' probe is a 2.2 kb EcoRI-EcoRV fragment.









54




397F16 V V


Homologous recombination 397-neo



Sally digestion





S Ligation into Sall digested BAC





Snrpn
I I

573B8 /










Snrpn


SCre recombinase





Snrpn
35 kb 55 kb






Figure 3-2. Strategy to combine BACs 396F16 and 573B8. The strategy for joining two BACs to create one of an ideal size is diagrammed. Vertical hash marks indicate Sall sites. Dashed line represents BAC vector.









55








Snrpn
gene 5' probe 3' probe

I I -I

I I I kb 967P1(muri) 23kb 2 30kb
I I I I 8kb 140 kb
380J10



425D18


170 kb 20 kb
215I I
I I I I I I














Figure 3-3. Restiction map of C57BL/6 BAC clones. BAC clones were subjected to restriction digestion and analyzed by pulse-field electrophoresis and southern analysis. The 5' probe is a I kb SacI-NotI fragment, while the 3' probe is a 2.2 kb EcoRk-EcoRV fragment. Vertical hash marks represent Sall sites. Not all clones are diagrammed.










56








PI-967 1 1707 1 copy, intact
P1-9671737 2 copies, intact





A 2-4 copies, intact 215 00 B I copy, rearranged
C I copy, intact






425 10 A 1 copy, intact
B 2-4 copies, intact





A 2-4 copies, intact 380 ,B I copy, intact
380 00 C 1 copy, truncated
D 1 copy, intact










Figure 3-4. Transgenic lines investigated for imprinted expression. Copy number and intactness is indicated according to available probes.








57




Snrpn locus



A B C D

1 2 3 45 67 8 910
I I IIII II










Figure 3-5. Location of probes around the Snrpn locus. Probe A represents A 0.8 kb PCR fragment 38 kb 5' of Snrpn. Probe B is a 1 kb SacI-NotI fragment that is 30 kb 5' of Snrpn. Probe C is a probe for exon 1 of Snrpn. Probe D is a 2.2 kb EcoRI-EcoRV fragment 5 kb 3' of Snrpn.








58





Snrpn locus

1 2 3 45 6 7 8 910






ASmN allele

1 2 3 4 8 9 10
Neo I I






APWS-IC allele
8 910
Is







Figure 3-6. Snrpn locus, ASmN allele, and APWS-IC allele structures. The ASmN allele represents a deletion of exons 5-7 of the Snrpn gene. The Neomycin resistance cassete (Neo) produces a larger fusion transcript by Northern blot, thus marking that allele. The APWS-IC allele represents a 35 kb deletion that includes 16 kb of sequence 5' of Snrpn as well as exons 1-7 of the Snrpn gene.








59




Maternal transmission



Tg X P












Paternal transmission ko X Tg ko




Tg ko
ko





Figure 3-7. Breeding scheme for testing expression upon maternal and paternal transmission of transgenes. Tg represents any transgene, while ko represents the ASmN allele. Maternal and paternal alleles are indicated where relevant. Only offspring of the desired genotype are indicated.








60










Line 0

ASmiN

Snrpn








Figure 3-8. Expression of Snrpn from transgenes upon maternal transmission.
The upper band results from a paternally inherited ASmN allele that creates a fusion transcript that is larger than the normal Snrpn message. Snrpn is only expressed from transgenes upon maternal inheritance in lines 380A, 380B, and 380D.







61






A


ASmN allele Neo




Endogenous allele/ transgene





B


425A 425B 215C
-No RT

1 2 1 2 1

ASmN allele


Endogenous allele/
transgene





Figure 3-9. Expression of Snrpn from transgenes upon paternal inheritance.
A. PCR primer locations for each allele. B. RT-PCR showing ASmN and
wild-type alleles. The presence of the ASmN allele indicates that the paternally inherited endogenous allele was the ASmN allele, and then
expression of the wild-type allele indicates expression of the transgene. If
the ASmN allele is not present, then the paternally inherited endogenous allele
is assumed to be a wild-type allele and this mouse is uninformative for transgene
expression.







62




A



Tg X
++ ko


mT i+

Tg I
ko P




B


Snrpn





SnrpSnrpn


Snrpn







Figure 3-10. Transgenic expression of Snrpn upon maternal transmission of transgenes. A. Breeding scheme used to assay transgenic expression using the APWS-IC strain. Tg represents any transgene, while ko represents the APWS-IC allele. Maternal and paternal alleles are indicated where relevant. Note that APWS-IC pups are missing all paternally expressed gene products in this region and succumb to neonatal lethality when the APWS-IC allele is paternally inherited. B. Northern blot showing Snrpn expression in transgenic pups inheriting a paternal APWS-IC allele and a maternal transgenic allele.







63


A
k X Tg +
ko +
1st
Generation


Tg ko m





X Tg m
+ o
2nd
Generation
+m
Tg p p
ko P



B






Snrpn





Figure 3-11. Transgenic expression of Snrpn upon paternal transmission
of transgenes. A. Breeding scheme used to assay transgenic expression using
the APWS-IC strain. Tg represents any transgene, while ko represents the
APWS-IC allele. Maternal and paternal alleles are indicated where relevant.
Note that APWS-IC pups are missing all paternally expressed gene products in this region and succumb to neonatal lethality when the APWS-IC allele is
paternally inherited. B. Northern blot showing that Snrpn is expressed upon
paternal expression in lines 425A and 215B. 380 lines are not shown













CHAPTER 4

STRAIN-DEPENDENT DIFFERENCES IN PHENOTYPE Introduction

Angelman Syndrome (AS) and Prader-Willi Syndrome (PWS) are caused by

deficiencies in genes subject to genomic imprinting. PWS is characterized by infantile hypotonia, gonadal hypoplasia, short stature, a moderate delay in physical and mental development, and obsessive/compulsive behavior, as well as neonatal feeding difficulties followed later by hyperphagia leading to profound obesity.74 AS is characterized by severe mental retardation, absent speech, ataxic gait and a happy demeanor.24 Approximately 70% of PWS patients have a 3-4 megabase deletion of the paternal chromosome 15q1 1-q13.49'75'76 The clinically distinct AS results from the same 15ql 1q 13 deletion in about 70% of patients, however the deletion is always on the maternally inherited chromosome.4577'78 Either syndrome can also result from uniparental disomy (UPD), in which both copies of chromosome 15 are inherited from only one parent. The UPD is always maternal in PWS patients 29.76 and paternal in AS patients.3'79 The identification of both of these classes of patients has led to the conclusion that PWS is caused by a loss of gene expression from the paternally inherited chromosome, whereas AS is caused by a loss of gene expression from the maternally inherited chromosome.

Many AS patients have been shown to contain intragenic mutations in the UBE3A gene, indicating that mutations in UBE3A are sufficient to cause AS. 34,35 In contrast to AS, no single gene has been identified for PWS, strongly suggesting that PWS is a



64






65

contiguous gene syndrome, requiring the loss of two or more paternally expressed genes to cause the PWS phenotype. 80 All the PWS candidate loci identified to date in humans and mice are expressed exclusively from the paternally inherited chromosome. These include: MKRN3/Mkrn3 (previously known as ZNF127/Zfp127), 46.81 MAGEL2/Magel2, 42,65NDN/Ndn, 40 SNRPN/Snrpn, 11,82 HBII-486, HBH-13/MbII-13, 41 HBII-487, HBII438A, HBII-85/MbH-85, 41,44 IPW/Ipw, '8'47 HBII-52/MbI-52, 43 HBII-438B, and an antisense transcript to the UBE3A gene. 41 Recently, the latter genes (SNRPN through the antisense UBE3A transcript) were shown to be derived from a single transcriptional unit.83

The imprinted genes involved in AS and PWS are regulated by a bipartite

imprinting center (IC) located upstream of the SNRPN gene.26 The IC is divided into the Angelman Syndrome Imprinting Center (AS-IC) and the Prader-Willi Syndrome Imprinting Center (PWS-IC). Previously, it was demonstrated that the PWS-IC is

22
functionally conserved in the mouse. A 35 kb deletion mutation (the deletion was originally reported to be 42 kb, but is now known that the original map was based on a strain that contained a VL30 insertion) was created in a male embryonic stem (ES) cell line. This 35 kb deletion included 16 kb of upstream sequence plus exons 1-6 of the Snrpn gene. Breeding male chimeric founders (129/Sv) harboring a maternal deletion mutation to wild-type females (C57BL/6J) resulted in mutant offspring that usually died within 48 hours, but never survived beyond 7 days after birth. These mice exhibited several phenotypes similar to those found in PWS infants including small size, poor feeding, and failure to thrive. In addition, these progeny were shown to lack expression of






66


the local paternally expressed genes Mkrn3 (aka Zfp 127), Ndn, and Ipw22 as well as Magel2, MblI-13, MbII-85, and MblI-52. 43,44,84

Since germline transmission from chimeric males produced mutant offspring that died prior to weaning, this 35 kb deletion mutation was recreated using J4 female

(XO) ES cells. As expected, transmission of the deletion mutation from female chimeras resulted in normal heterozygous carrier offspring.55 Consistent with previous observations, heterozygous carrier males (129/Sv) bred to C57BL/6J females produced mutant offspring that did not survive until weaning, even if the wild-type siblings were removed to reduce competition. This strain has been used to breed unaffected males APWS-IC carriers with mice of different genetic backgrounds to study phenotypic variation. Here, long-term survival of APWS-IC mice upon breeding to several strain backgrounds is reported.

Materials and Methods

Strains and Matings.

Mouse strains used were APWS-IC deletion mice backcrossed onto a C57BL/6J genetic background for 10 generations, C57BL/6J, FVB/NJ, 129/Sv, C3H/HeJ, DBA/2J, and C57BL/6J congenic for a region of Mus musculus castaneus chromosome 7 (B6.CAST.c7).56 APWS-IC males were mated with females of the strains described above to produce affected PWS progeny pups, which were used to ascertain survival and gene expression. For (B6.CAST.c7 x FVB/NJ) F, matings, B6.CAST.c7 females were mated with FVB/NJ males. Conversely, (FVB/NJ x B6.CAST.c7) F, matings were produced using FVB/NJ females and B6.CAST.c7 males.






67


Culling and Fostering

Litters resulting from matings with APWS-IC males were selectively culled to aid survival of affected APWS-IC pups. Culling was carried out by sacrificing all of the wild-type pups except one within two days after birth, depending on whether or not wildtype pups could be distinguished from their APWS-IC littermates. One wild-type pup was left to stimulate milk production in the absence of robust pups. Mice were fostered to another mother by removing the APWS-IC pups from one mother (usually from the C57BL/6J strain) and giving them to the other mother (usually from the FVB/NJ strain) whose pups had been removed. Additionally, urine from the foster mother was wiped on the foster pups to aid in her acceptance of the new pups. In some fostering cases, two mothers of different strains were set up to litter together, and the litter from the FVB/NJ mother was then removed and the wild-type littermates from the other mother were culled. This allowed two new mothers to care for a small number of APWS-IC pups. Identification of Polymorphisms

Total brain RNA was prepared from both 129/Sv mice and B6.CAST.c7 mice. Each RNA sample was used to create single-stranded cDNA using random primers in a reverse transcription reaction. These cDNAs were used to program PCR reactions using primers corresponding to Ube3a exons 4 and 7 (5'-CCTGCAGACTTGAAGAAGCAG3' and 5'-GAAAACCTCTGCGAAATGCCTI-3'). The resulting products were cloned, sequenced and compared. A polymorphism found in exon 5 created a Tsp509I restriction site in the 129/Sv clone and a Bst4CI site at the same location in the B6.CAST.c7 clone.

A polymorphic AvaIL site between Mus musculus castaneus and Mus musculus domesticus was identified and kindly provided to us by Marisa Bartolomei (M.






68

Bartolomei, personal communication). This polymorphism results from a cytosine nucleotide, rather than a thymine nucleotide at position 117 of the Ndn transcript. AvalI cuts the domesticus allele, but not the castaneus allele due to the presence of the cytosine nucleotide. PCR primers flanking the polymorphic restriction site were designed as follows: NdnpolyF 5'-ACAAAGTAAGGACCTGAGCGACC-3' and NdnpolyR 5'CAACATCTTCTATCCGTTCTTCG-3'. The PCR product amplified using NdnpolyF and NdnpolyR was gel purified on a 2% agarose gel, extracted from the gel using the QIAGEN gel extraction kit, and digested with Avail. The digested products were electrophoresed on a 4.8% agarose gel (2:1 low-melt agarose: agarose). RT-PCR

Total RNA was isolated from complete brains obtained from neonatal, 1 week

old, 2 week old, and 3 week old mice. RNA was extracted using RNAzol (Tel-Test, Inc.) according to instructions. The total brain RNA (10tpg) was pretreated with DNaseI (Invitrogen), and half of the reaction was subsequently used to synthesize first-strand cDNA with Superscript II reverse transcriptase (RT) and random primers (Invitrogen). The other half of the reaction was manipulated in parallel in the absence of RT. Onetwentieth of the +RT or -RT reactions was used to seed PCRs using the following conditions: 10mM Tris-HC1, pH 8.3, 50mM KC1, the four dNTPs at 0.125 mM each, 1 unit Taq DNA polymerase (Boehringer), and the appropriate primers at 4 [LM each. Sequences of the primers were as follows: Ndn 9F (5'- GTATCCCAAATCCACA GTGC -3'), Ndnl0R (5'- CTTCCTGTGCCAGTTGAAGT -3'), Ndnpoly F (5'- ACAAA GTAAGGACCTGAGCGACC -3'), Ndnpoly R (5'- CAACATC'TTCTATCCGTTC






69

TTCG -3'), Ube3a 5F (5'- CACATATGATGAAGCTACGA -3'), Ube3a intron 5 R (5'CAGAAAGAGAAGTGAGGTrG -3'), Snrpn N1.1 (5'- CTGAGGAGTGATTGCA ACGC -3'), Snrpn N2.2 (5'- GTTCTAGGAATTATGAGCCCC -3'), P3-actin F (5'GTGGGCCGCTCTAGGCACCAA 3'), and -actin R (5'- CTCTTTGATGTCA CGCACGATTTC 3'). PCR amplifications conditions were 95* C for 5 min., followed by either 20 or 30 cycles of 940 C for 30 s, 60* C for 45 s, and 72* C for 45 s. The final cycle was followed by an extension step for 10 min at 72* C. Northern Blot Analysis

To detect the presence of processed snoRNAs, total RNA was separated on 8% denaturing polyacrylamide gels (7M urea, IX TBE buffer) and transferred to nylon membranes (Hybond N+) using a semi-dry blotting apparatus (Trans-blot SD, BioRad) as described by Cavaille et al. 4' RNA was fixed to the membrane by baking at 800 C in a vacuum oven. The membranes were prehybridized and hybridized overnight at 580 C, according to the Church and Gilbert method. Oligonucleotides complementary to snoRNA sequences were end-labeled using a32 P-dATP (NEN) and T4 polynucleotide kinase (Invitrogen). Their sequences are as follows: MblI-85 (5' TTCCGATGAGAG TGGCGGTACAGA 3'), MbII-52 (5' CCTCAGCGTAATCCTATTGAGCATGAA 3'), and 5.8S rRNA (5' TCCTGCAATT'CACATT'AATTCTCGCAGCTAGC 3'). Probes were purified from free nucleotides using the nucleotide removal kit (QIAGEN). Membranes used for detecting snoRNA expression were washed twice for 15 min at room temperature using 2X SSC, 0.1% SDS, and then exposed to Kodak XAR film at 800 C for 12-36 hours.






70


Results

In contrast to the fully penetrant neonatal lethality phenotype previously seen on the C57BL/6J strain background, APWS-IC carrier males on the 129/Sv strain background or APWS-IC carrier males made congenic on the C57BL/6J background bred to wild-type female FVB/NJ mice, produced several mutant offspring that survived to two weeks of age. Furthermore, if most of the wild-type competitor sibs are removed, the mutant offspring could survive to adulthood. Although these surviving APWS-IC mice are significantly smaller than wild-type sibs (Fig. 4-1), both males and females are fertile.

To examine whether the increased survival was simply due to superior mothering abilities of the FVB/NJ females as compared to C57BL/6J females, newborn pups were fostered to mothers of the opposite strain and also trio matings of a APWS-IC carrier male with both an FVB/NJ and a C57BL/6J female were established. In both situations, survival of only those F, mice born to the FVB/NJ females was observed, demonstrating that it is the genetic background of either the offspring or the mother that leads to survival rather than the skill of the mother (data not shown).

Next, the expression of several PWS candidate genes in these surviving (FVB/NJ x APWS-IC) F, mice was examined. Surprisingly, low levels of Ndn and antisense Ube3a expression was detected by RT-PCR in newborn mice (data not shown). By Northern blot, expression of several snoRNAs mapping to the region was also detected (data not shown). These results were unexpected as expression of these genes in pups with a paternally inherited PWS-IC deletion had not been previously detected. However, when RNA expression from the 5' half of the Snrpn gene, a region that is physically deleted






71

from the paternally inherited APWS-IC allele, was examined, expression was detected by RT-PCR (data not shown). Therefore, this strongly suggested that low-level expression detected for Ndn, antisense Ube3a, MbII-85 and Snrpn is derived at least somewhat from leaky expression of the maternal FVB/NJ allele. A time course for the observed lowlevel expression of Ndn and Snrpn at newborn, 1 week, 2 weeks, and 3 weeks of age was followed, and the leaky expression was detectable in all ages of mice (Fig4-2). It was hypothesized that expression of these genes is sufficient to rescue the lethality phenotype associated with the APWS-IC mutation.

Next, the extended survival and leaky expression of these imprinted genes was investigated to determine if it was restricted to the FVB/NJ strain. Females for the C57BL/6J, DBA/2J, BALB/cJ, C3H/HeJ, and 129/SvEv strains were mated to APWS-IC carrier males on the C57BL/6J genetic background. Wild-type pups were removed from the litters within two days after birth and the longest possible survival of APWS-IC pups was determined. Pups derived from C57BL/6J and DBA/2J females had the shortest survival time, with the longest surviving affected individual from either strain living only

7 days. Pups derived from all other strains had at least one affected individual that survived for at least 3 weeks. Leaky expression of Snrpn, Ndn, and MbII-85 was observed at comparable levels in all strains (Fig. 4-3), regardless of their ability to survive.

Finally, the leaky maternal expression of these PWS candidate genes was

investigated in wild-type mice. FVB/NJ females were mated with wild-type males from the B6.CAST.c7 strain, a strain that is congenic for the mus musculus castaneus chromosome 7 on a C57BL/6J background. The reciprocal mating was also performed.






72


Total brain RNA was isolated from the resulting (FVB/NJ X B6.CAST c.7) F, or (B6.CAST.c7 X FVB/NJ) F, mice at birth. RT-PCR followed by a polymorphic restriction enzyme digest of the RT-PCR product was used to distinguish between expression of Ndn produced from the domesticus and castaneus alleles. Only the paternal castaneus allele was expressed in each case (Fig 4-4). B6.CAST.c7 females were then mated with APWS-IC carrier males and the same RT-PCR and restriction digestion on brain RNA made from (B6.CAST.c7 X APWS-IC) F, pups was performed. While expression from wild-type pups was limited strictly to the domesticus allele, the expression in pups that had inherited the paternal APWS-IC allele was biallelic, representing both domesticus and castaneus alleles. This indicates that leaky maternal expression is only observed or detectable when in combination with a paternal APWS-IC mutation.

Discussion

This study demonstrated that strain background affects the phenotype of the APWS-IC mice. Heterozygous carrier males (either 129/Sv or C57BL/6J) bred to C57BL/6J or DBA/2J females produced mutant offspring that do not survive until weaning, even if wild-type siblings are removed to reduce competition. However, longterm survival was achieved upon breeding these same carrier males to several other strains, including FVB/NJ, C3H/HeJ, 129/Sv, and BALB/cJ. While surviving APWS-IC mice are smaller than wild-type littermates, they do not become obese on a low-fat diet, both males and females are fertile, and they appear to be normal in all other respects.

Expression analysis of Snrpn, the antisense transcript of Ube3a, and the MbII-85 snoRNA reveals leaky expression of these paternally expressed genes in APWS-IC pups.






73


This expression occurs at a very low level, and originates, in part, from the maternally derived chromosome. This leaky expression, originally detected in PWS-IC deletion pups with FVB/NJ mothers, is also present at comparable levels in all other strains, including C57BL/6J and DBA/2J. This suggests that the increased survival of APWS-IC pups is not due to the low-level expression of genes in the PWS region. Furthermore, this expression is not sufficient to ameliorate the failure to thrive phenotype and permit survival in APWS-IC pups. Similarly, humans that have PWS due to maternal uniparental disomy or a balanced translocation have also been reported to show weak, but detectable expression of genes in the PWS region.8" No obvious clinical differences were reported from individuals with leaky expression from imprinted genes when compared to affected individuals that did not show leaky gene expression from these genes.","8

Why would APWS-IC pups survive on some strains and not others, when the gene expression in the PWS region appears to be identical between survivors and nonsurvivors? The most likely explanation for this would be the presence of specific modifier alleles in some inbred strains that either permit or prevent survival of affected pups. An alternate explanation may be the general unfitness of a particular strain for survival of neonates. This is unlikely, however, as the APWS-IC pups are genetically F, individuals and should benefit from hybrid vigor.

Heterozygous carrier males on the 129/Sv genetic background bred to C57BL/6J females, produce APWS-IC pups that never survive. Conversely, carrier males on the C57BL/6J genetic background bred with I 29ISv females produce APWS-IC pups that are capable of surviving to adulthood, even though the genetic background of these reciprocal matings are identical. One explanation of this is that the modifier gene or






74


genes responsible for survival of APWS-IC mice could be required in the oocyte. The oocyte specific factor would not be present in C57BL/6J oocytes that are not permissive for survival, but would be present in 129/Sv oocytes and allow survival of affected pups. An alternate explanation is that the modifier gene or genes are themselves imprinted. If the modifier gene was only expressed from the maternally inherited chromosome, and the allele of this gene that was permissive for survival was the 129/Sv allele and not the C57BL/6 allele, then survival could only be achieved when the maternal allele of this gene is from the 129/Sv strain. Pronuclear transplant, where the pronuclei from a (B6 X APWS-IC) F, oocyte could be moved into "emptied" oocytes from fertilized FVB/NJ or (FVB/NJ X APWS-IC) F females, could be used to distinguish between these two possibilities. If the transplanted pronuclei gave rise to pups that were able to survive, then the modifier gene is most likely oocyte specific, however, if the resultant pups still do not survive, then the modifying gene is most likely imprinted.

It is interesting that the leakiness of the maternal allele is only detectable when in combination with a paternal APWS-IC allele, but not when in combination with a wildtype paternal allele. There are three possible explanations for this. First, low-level expression from the maternal allele would produce a few transcripts from the maternal allele that could simply be swamped by the more abundant transcripts originating from the paternal allele. Perhaps imprinting in mouse is only strong allele bias, and low-level expression could mark the repressed chromosome as a region that is repressed in a facultative manner as opposed to a constitutive manner. Another possibility is that the expression of genes or transcripts downstream of Snrpn could be allowed by the splicing of the upstream exons of Snrpn 17that are left intact on the APWS-IC chromosome into






75


the downstream exons of Snrpn or the run-on transcripts from which the snoRNAs are spliced."3 These upstream exons have been shown to be functional alternate promoters for Snurf, but their level of expression is much weaker than that of the major promoter. Perhaps this could explain the weak expression of the snoRNAs. Additionally, the physical interaction between the silenced imprinting center and the upstream genes, including Mkrn3, Magel2, and Ndn, could be required for the silencing of these genes that lie more than 1 Mb away from the imprinting center. The missing imprinting center could cause the alternate Snurf promoters to be juxtaposed to the regulatory elements of the upstream genes, and result in leaky expression. While this may explain leaky paternal expression, it doesn't explain residual expression from the maternal chromosome. The third explanation is that communication between one silenced and one expressed imprinting center is required for the proper silencing of the maternal allele and the expression of the paternal allele. Specifically, the unmethylated, unsilenced, paternal PWS-IC may be required in trans to silence the maternal region. While this explanation could account for the bi-allelic: expression in the APWS-IC mice, it doesn't explain why the expression levels of the imprinted genes are so low. Furthermore, trans-activation is a phenomenon not documented in mouse and would be difficult to prove or disprove. Leaky gene expression in the region is not unique to mice, as human patients with maternal uniparental disomy have also been reported to show leaky expression "5,".











76






35



30



25



20.



y15
--O-wild-type
--O-wild-type 10 -O---wild-type
-O--wild-type
---IC-deletion
---IC-deletion 5. --IC-deletion
-U--IC-deletion


0
3 6 9 12 s15
Age (weeks)
















Figure 4-1. Surviving APWS-IC mice are smaller than their wild-type littermates. APWS-IC mice and their wild-type littermates were weighed at 3, 6, 9, 12, and 15 weeks of age. Their weight in grams is plotted versus their age in weeks. Filled symbols represent APWS-IC mice and open symbols represent the wild-type littermates.








77

4:4,



Ndn RT-PCR


5'Snrpn RT-PCR



fi-actin RT-PCR





No RT control




MbII-85 MbII-52




5.8S rRNA






Figure 4-2. Leaky expression from paternally expressed genes is not age dependent. APWS-IC mice were sacrificed at birth, one week, two weeks, and three weeks of age. Total brain RNA was made from the sacrificed mice and subjected to either RT-PCR or northern analysis. RT-PCR is shown for Ndn and 5' Snrpn since the expression level is not detectable by northern analysis. 5.8S rRNA and P-actin were used as controls for northern analysis and RT-PCR, respectively. Low-level expression is noted in APWS-IC mice regardless of their age.








78

B6 FVB/N C3H/HeJ Balb/c 129/Sv DBA/2J


WA Aw A A wA A wA Aw A A wA A

Ndn RT-PCR



5'Snrpn RT-PCR




fli-actin RT-PCR




No RT control




Ndn RT-PCR 20 cycles, blot



5'Snrpn RT-PCR
20 cycles, blot





MblI-85




5.8S rRNA



Figure 4-3. Leaky gene expression does not account for strain dependent
differences in phenotype. APWS-IC mice made congenic on the C57BL/6J strain
background were mated with either C57BL/6J, FVB/NJ, C3H/HeJ, Balb/cJ, DBA/2J, or 129/Sv females. Total RNA was prepared from the brains of two
APWS-IC mice and one wild-type littermate. The RNA was subjected to RT-PCR and northern analysis. Ndn and 5'Snrpn were analyzed by RT-PCR at 40 cycles or at 20 cycles and blotted and probed. 5.8S rRNA and f-actin were used as controls
for northern analysis and RT-PCR, respectively. APWS-IC mice showed leaky
expression in all strains analyzed.







79



A
A FVB/NJ x B6. Castc7/B6.Cast.c7 x FVB/NJ


FxC CxF
FxC C x F genomic genomic

castaneus
domesticus






B B6.Cast.c7 x APWS-IC

APWS-IC wt
APWS-IC Wt
genomic genomnic

castaneus domesticus








Figure 4-4. Leaky gene expression is biallelic in APWS-IC pups. A. Brain RNA from reciprocal crosses between FVB/NJ and B6.CAST.c7 was subjected to RT-PCR with primers flanking a polymorphic Avall site in the Ndn transcript from mus musculus domesticus. The product was digested with AvalI and run on a 4.8% agarose gel. Wild-type Ndn expression in both crosses originates from the paternally inherited chromosome. B. B6.CAST.c7 females were mated with males that were carriers for the APWS-IC allele. APWS-IC and wildtype littermate pups were sacrificed at birth and total RNA was prepared from their brains. RT-PCR and Avall digestion of the Ndn transcript was performed as described above. Wild-type Ndn expression occurs from the paternally inherited allele, while APWS-IC expression occurs from both paternal and maternal alleles.














CHAPTER 5

TRANSGENIC RESCUE OF THE PWS-IC DELETION MOUSE Introduction

Prader-Willi syndrome (PWS) patients first present with severe infantile

hypotonia and failure to thrive that leads to a requirement for gavage feeding in most PWS neonates. The infantile phenotype subsides after several months and gives way to a period of normal feeding behavior, but soon progresses to hyperphagia and severe obesity, if uncontrolled.23 PWS children also possess a distinctive behavioral phenotype that is similar, but not identical to obsessive-compulsive disorder. Outwardly visible signs of the disease in humans may also include almond-shaped eyes, strabismus, small stature, small hands and feet, and hypogonadism.23'" Caused by the physical or functional deletion of paternal chromosome 15q 11-q 13, PWS occurs at a frequency of about 1/15,000 live births.226 Approximately 70% of PWS patients have sustained a large (3-4 Mb) deletion of their paternally inherited chromosome 15. Other PWS patients have either inherited both copies of chromosome 15 from their mother (maternal uniparental disomy), or have an imprinting mutation. Patients with an imprinting mutation have either a deletion in the 5' region of Snrpn, including exon 1, an area
knon a th ceter ofhe6,11-1,2
known as the imprinting center (IC) of the q 1-q1 3 region,' 13.20 or have no detectable DNA sequence mutation, but still possess a paternally inherited chromosome that epigenetically behaves as a maternally inherited chromosome.






80






81

Human chromosome 15q 1-q 13 contains at least six paternally expressed genes or transcripts and is syntenic with central chromosome 7 in mouse. The genes and transcripts include: MKRN3, MAGEL2, NDN, SNRPN, HBII-13, HBII-436, HBII-437, HBII-438A, HBII-438B, HBII-85, HBII-52, and the UBE3A-antisense transcript.17"18,21,39-A Expression of each of these genes is completely absent in most PWS patients, although some patients show low-level expression, but still present with classical PWS.85'86 A large region of sequence between SNRPN and NDN still remains unexplored and may contain additional genes. This region encompasses nearly 1.5 Mb, and additional genes discovered in this region might be predicted to be imprinted and paternally expressed.

The distinct paternal inheritance pattern of PWS identifies 15qI 1-q13, as well as the syntenic mouse chromosome 7 as a region of genomic imprinting.7-'2'39 Genomic imprinting involves the expression of only one parental allele in somatic cells. The other parental allele is transcriptionally silenced. The non-transcribed alleles of the PWS genes, maternal in the case of PWS-related genes, are often associated with nearby methylated cytosine residues present in CpG islands, while the transcribed alleles, are associated with the lack of methylation at these same CpG residues.6"''3 This indicates that the maternal allele has a different epigenotype than the paternal allele. It is not known whether the eventual silencing of the maternal allele causes this epigenetic mark, or whether it is a mark to identify the allele to be silenced.

Conversely, Angelman syndrome (AS) results from the functional deletion of the maternal complement of the same interval of chromosome 15.24 A unique class of AS patients with specific mutations in the UBE3A gene suggests that loss of UBE3A expression can be solely responsible for the major clinical features of AS.3435 Another






82


maternally expressed gene, ATPIOC, has also been identified in the PWS region, but its contribution to the phenotype of AS is yet to be determined.36 AS can result from maternal deletion of 15q 11-q 13, paternal uniparental disomy, IC mutations, and from putative single gene mutations, as evidenced by completely normal epigenotype in the region and the UBE3A mutation class which present with classical AS.24 The absence of the class of PWS patients in which a single gene mutation is responsible for the complete phenotype, as well as the presence of multiple paternally expressed genes that are disrupted, indicate that PWS is a contiguous gene syndrome where the clinical features are the cumulative effect of multiple disrupted genes."0'8

PWS and AS patients with imprinting defects have either a relatively small deletion or no noticeable mutation at all, but these mutations alter the entire 3-4 Mb region on the paternal and maternal chromosomes, respectively.20 In PWS-IC mutation patients, the paternally derived genes assume maternal, or silenced, epigenotypes. The deletion breakpoints of several PWS patients with IC mutations were mapped to identify the smallest region of deletion overlap for PWS (PWS-SRO).'3"7 The PWS-SRO is located 5' of the SNRPN gene, includes the first exon of the gene, and is often referred to as the PWS-IC. Although the PWS-SRO has been narrowed down to approximately

4.3kb, the actual deletions that have been shown to cause PWS are much larger.37'38 A smallest region of deletion overlap has also been identified for AS, and is referred to as the AS-SRO. The AS-SRO lies around 35 kb upstream of the PWS-SRO, and has been narrowed to 0.8 kb.37'38 AS-IC mutations never appear to overlap the PWS-SRO, while PWS-IC mutations can overlap the AS-SRO, suggesting that in the absence of the PWSIC, the AS-IC is not necessary. This indicates that the sole purpose of the AS-IC may






83

be to regulate the PWS-IC in the maternal germlineY This also indicates a bipartite structure to the IC, in which the PWS and AS components work together to control imprinting in the 15ql 1-q13 region. In mouse, the PWS-IC has been functionally defined by deletion, indicating that the bipartite IC is most likely functioning similarly between humans and mice.

Our lab previously created a mouse model of PWS that emulates both the

phenotypic and molecular characteristics of PWS by deletion of the mouse PWS-IC.22 Mice that inherit a PWS-IC deletion (APWS-IC) from their father lose expression of the known paternal-specific genes, including Snrpn, Mkrn3, Ndn, and the Ube3a antisense transcript. The APWS-IC mice also demonstrate poor suckle and failure to thrive, indicative of the infantile characteristics of human PWS. These mice thus provide an excellent mouse model of PWS. Unfortunately, APWS-IC mice on the inbred C57BL/6J background die within seven days of birth, presumably a result of poor suckle and failure to thrive. Progression to obesity and the development of other PWS related phenotypes has yet to be seen in APWS-IC mice due to neonatal lethality. APWS-IC mice mated with mothers of other strain backgrounds survive to adulthood if the wild-type siblings are removed shortly after birth. These surviving APWS-IC mice remain smaller than their wild-type siblings, but are otherwise grossly normal. Furthermore, surviving APWS-IC females and males are both fertile and never become obese on an ordinary rodent diet.

Individual knockouts of Snurf, Snrpn, and Mkrn3 appear completely normal and show no PWS associated phenotype.22899 Conflicting data regarding the phenotype of the Ndn gene knockout have been reported. Tsai and colleagues report that the Ndn






84


knockout mouse has no discernable phenotype, while Gerard et al. and Muscatelli et al. report partial neonatal lethality that is strain dependent and not consistent from generation to generation.9'-92 On the other hand, mice inheriting a paternal deletion spanning from exon 2 of Snrpn to Ube3a succumb to neonatal lethality in 80% of the affected pups."' Together, this data strengthens the hypothesis that PWS is a contiguous gene syndrome caused by the absence of multiple gene products, and not caused by the absence of any single gene product. Despite the efforts of many labs to create individual gene knockouts, the contribution of each gene in human chromosome 15q II-q 13 and the syntenic mouse chromosome 7 to the PWS phenotype is still a mystery. Figure 5-1 shows a summary of the individual gene deletions that have been reported.

Efforts to model PWS using individual gene knockouts have been largely

unfruitful .22,19,90 -9 However, engineering multiple gene deletions is also limited by the location of the imprinting centers (several desired mutations would remove them, creating an imprinting mutation). Therefore, a different approach was adopted to determine the individual gene contribution to this contiguous gene syndrome. This approach involved transgenic rescue, and the strategy was to produce transgenic mice harboring either individual or multiple PWS genes and mate them to APWS-IC mice. In mice paternally inheriting an imprinting center mutation and maternally inheriting a transgene, the ability of the transgene to rescue the phenotype of the APWS-IC mice could be ascertained. The genes responsible for the individual aspects of the PWS phenotype could then be definitively determined, since one transgene could conceivably rescue the neonatal lethality defect, while another could rescue the small stature defect. In addition, the rescued mice may live longer or recapitulate other human PWS






85


symptoms and allow the dissection of additional later onset phenotypes in our mouse model.

Materials and Methods

Screening the BAC Libraries

The Research Genetics (Huntsville, AL) BAC library was initially screened for BAC clones. This library was made from the 129/Sv strain of mouse. The library consisted of 9 filters, each carrying 27,648 unique clones, with an average insert size of 130 kb, spotted in duplicate onto 9 different membranes. Probes for Ndn, Mkrn3, Ube3a, and the gene formerly known as Ipw were used to screen the library simultaneously.

Prior to hybridization, BAC membranes were washed with 1500 ml, of 6X SSC and 0. 1% SDS at room temperature for 15 minutes. The membranes were then rinsed twice with 1500 ml of 6X SSC for 15 minutes at room temperature, and hybridized according to the Research Genetics protocol. Briefly, the membranes were prehybridized in roller bottles with 3 membranes per bottle, each separated by one sheet of Flow Mesh (Diversfied Biotech, Boston, MA), in 120 ml of HyperHyb (Research Genetics, Huntsville, AL) per bottle at 650 C for 20 minutes. At least 10' counts of each probe were boiled for 5 min, snap cooled on ice, and then added to 3 ml of HyperHyb that was pre-warmed to 650 C, and 1 ml of hybridization solution was added to each of the roller bottles. The membranes were allowed to hybridize for 2 hours at 650 C.

The membranes were washed in the roller bottles three times for 15 minutes at

65' C with 30 ml IX SSC and 0.1% SDS. They were then removed from the bottles and washed twice more at 650 C with 1OO0ml of IX SSC and 0. 1% SDS for 15 minutes. Finally, the membranes were rinsed with IX SSC at room temperature. The membranes






86

were then wrapped in cellophane and exposed to film (XAR, Kodak) overnight at -80 C. Positive clones were identified following the manufacturer's instructions, and the following clones were ordered: 454N20, 205L17, 581E10, 173C16, and 143C10. In addition to screening the 129/Sv library, a single RPCI-23 BAC, 452P17 was found by screening the library virtually with a probe to the 3' most intron of the Ube3a gene. Probe Preparation

Probes were labeled using the Prime-It II kit (Stratagene, La Jolla, CA), with

minor modifications. DNA (200 ng)was boiled for 5 minutes in the presence of random hexamers. The DNA-hexamer mix was cooled on ice, and 5X reaction buffer was added along with 25 [tCi of c32P dCTP and 1 U of exo klenow. The labeling reaction was placed at 370 C for 15 minutes. After labeling was complete, the probe was purified using the nucleotide removal kit (QIAGEN) and eluted in 200 p.l of water. Purified probes were boiled for 5 minutes and snap cooled on ice prior to use in hybridization. Verification of BAC Clones

Single BAC colonies were tested to determine which clones were derived from each gene locus. Four single colonies from each BAC were streaked onto LB plates supplemented with the antibiotic, chloramphenicol (LB-CA). The plates were overlayed with a nylon filter and grown overnight at 370 C. The next morning, the bacteria were lysed on the filters as follows: first, the filters were soaked in alkali solution for 4 minutes, followed by neutralizing solution for 4 minutes, and finally rinsed in 6X SSC for 1 minute. The filters were then baked at 800 C for 2 hours, pre-hybridized in Church and Gilbert buffer for one hour at 650 C, and hybridized with the Ndn probe. Upon washing and laying the filters to film, the results were used to determine which clones were






87

derived from the Ndn locus and whether the culture sent represented a pure colony from a single clone, or a mixed culture with multiple BAC clones. The filters were then stripped in boiling 0.5% SDS and the entire hybridization procedure was performed again with the remaining probes.

End Sequencing BAC Clones

The BAC clones were end sequenced using the big dye termination reaction to obtain sequences unique to the mouse genomic DNA insert. Reactions were performed on 1 mg of BAC DNA that had been sheared by passing it five times through a 25 gauge needle, using a modified version of the manufacturer's instructions, with 12 [d of sequencing buffer, 4 id of big dye, 16pmol of primer, and 2.5mM MgCl2. The reactions were subjected to an initial 5 min. cycle at 950 C, followed by 30 cycles of 950 C for 30 s, 500 C for 10 s, and 600 C for 4 min. The completed reactions were purified from free nucleotides using Performa DTR Gel Filtration Columns (Edge Biosystems), vacuum dried, and sequenced by the University of Florida Center for Mammalian Genetics Sequencing Core.

Pulse-Field Gel Electrophoresis

Pulse-field gel electorphoresis was carried out to create a rough restriction map and tiling pathway for the BAC clones. BAC DNAs digested with the appropriate enzymes were electrophoresed on a 1% genetic technology grade agarose gel (Nusieve, FMC) made with IX TBE buffer. Samples were mixed with loX ficoll loading dye and ran at 200V with a switch time of 1-12 seconds for 12.5 hours. This provided resolution of bands from 6-200 kb. The gel was stained with a dilute ethidium bromide solution, photographed, and blotted as described below.






88


Southern Blot

Agarose gels carrying 5 pg of digested genomic DNA or 1 [.tg of digested BAC DNA were photographed and UV nicked for 5 minutes. The gel was soaked in Alkali solution for 45 minutes, followed by soaking in neutralizing solution for 90 minutes. The gel was transferred to Hybond nylon membrane (Amersham) in loX SSC overnight. The membrane was rinsed in 2X SSC and baked at 80* C for 2 hours. Hybridization was carried out according to the method of Church and Gilbert. Membranes were prehybridized in 20 ml of Church and Gilbert Buffer for 1 hour at 65* C. The prehybridization solution was poured off and replaced with 5 ml of fresh solution and the boiled, cooled probe. Hybridization continued overnight at 650 C. Washing was carried out three times in 2XSSC and 0.1% SDS at 65' C for 15 minutes each. Transgenic Mice Production

For production of transgenic mice, BAC DNA was prepared by large scale

plasmid preparation, using the alkaline lysis method. First, log phase cultures of BAC culture grown in LB-CA were centrifuged for 5 minutes at 6,000 rpm to pellet the cells. The supernatant was poured off and the pellet was resuspended in GTE solution plus lysozyme. The suspension was then lysed with NaOH and SDS. After addition of the lysis solution, the lysate was neutralized in 0.5M potassium acetate, and poured through cotton gauze into Oak Ridge tubes. BAC DNA was precipitated with ethanol, and the pellet was resuspended in 4 ml TE with 10 [tg/ml RNAse A, and allowed to incubate at 370 C for 1 hour. Cesium chloride and ethidium bromide were added to the DNA solution, and the solution was loaded into a heat sealable tube. The tube was sealed and spun at 58,000 rpm for 18 hours. BAC supercoils were viewed with a UV light, and both






89


nicked and supercoiled bands were pulled. The DNA was extracted with tert-butanol until the ethidium bromide was completely depleted from the BAC DNA. The DNA was then dialyzed twice against I L TE buffer, using dialysis tubing for 6 hours each. The concentration of the BAC DNA was then measured by spectrophotometer, and then diluted to 2.5 ng/Rl for microinjection.

Transgenic mice were made by pronuclear injection into oocytes that were

obtained from superovulated, fertilized, FVB/NJ female mice. The fertilized, injected oocytes were then implanted into (B6D2) F, females that were made pseudopregnant by mating them with vasectomized (B6D2) F, males. Mouse Husbandry

At 3 weeks of age approximately 2mm of tail was clipped from each mouse, and the ear was punched for identification. Genomic DNA was prepared from the tail piece by incubation in tail lysis buffer with proteinase K (100 ng/pl) overnight at 550 C. The tail lysate was extracted with phenol: chloroform: isoamyl alcohol (25:24:1) and then precipitated with ethanol. The tail DNA was screened for the presence of the transgene by PCR using both end sequences from the BAC. Mouse Strains

APWS-IC mice were developed in our lab 22.55 and constituted a 35 kb deletion encompassing the sequence froml6 kb 5' of Snrpn and 19 kb 3' of Snrpn. These mice were backcrossed for 10 generations to C57BL/6J males and were thus made congenic on that strain background.

Transgenic mouse strains were originally maintained on the FVB/NJ genetic background, but selected strains were then backcrossed for 10 generations to the






90


C57BL/6J strain background. Four strains of 454N20 transgenic mice are referred to as 454A-D, one strain of mice representing the P1 clone 967 is referred to as line 1707, and

5 lines representing transgene 380J10 are referred to as 380A-E.

Results

Screening the BAC Library for Clones

The first step toward transgenic rescue was to screen a commercially available BAC library for clones that would putatively contain the PWS genes. BAC clones were chosen to perform the rescue as they are likely to contain all of the necessary regulatory regions for the individual genes due to their size. They are also relatively easy to handle, as they are propagated in bacteria, rather than yeast. Additionally, they can be modified by homologous recombination.7'3 The Research Genetics BAC library was first screened for clones. This library is made from the 129/SvEv strain of mouse, and the average insert size for BAC clones is 130kb. Some clones by screening the RPCI-23 BAC library were also obtained. This library is made from a female C57BL/6J mouse. The average insert size for this library is 200 kb and is the template for the public mouse genome sequencing effort.

The BAC libraries were screened using probes for Ndn, Mkrn3, and the gene formerly known as Ipw. With the first screen of the Research Genetics library, two BACs were obtained that hybridized with the probe for Mkrn3, one of which also hybridized with the Ndn probe. No clones for Ipw were identified. From subsequent screenings of this library, one BAC containing Ipw, one that hybridized with a probe for the Ube3a gene, and one that hybridized with Ndn, Mkrn3, and Magel2 were isolated. From screening the RPCI library with the Snrpn probes, a single BAC that spanned most






91


of the distance between Snrpn and Ipw was isolated. An electronic database search also identified a single BAC that contained the 3' most intron to Ube3a.

Addresses for the BAC clones were determined, the BACs were ordered, and then they were streaked out to determine their clonality and to verify the presence of the probes that the library was screened for. The span of the individual BAC clones were determined by end sequencing, making end probes by PCR, and using them to probe southern blots produced from restriction digestion with rare cutting enzymes, separated by pulse-field electrophoresis. From this it was determined that the previously published gene order in the Ndn region was incorrect. The correct order places Magel2 between Mkrn3 and Ndn, and in a transcriptional orientation opposite that of Mkrn3. The BACs that were isolated were 454N20, which contains Mkrn3, Magel2, and Ndn; 205L17, which contains Frat3 and Mkrn3; 173C16, which contains Ube3a; and 380J10, which extends from Snrpn to the MbII-85 snoRNA cluster (Fig 5-2). Production and Characterization of Transgenic Mice

Once the BACs of interest had been identified and mapped, transgenic mice were made. BAC DNA was prepared by large scale plasmid preparation, followed by cesium chloride banding of the resulting DNA. Both nicked and supercoiled bands were pulled and used for production of transgenic mice. It was important to have extremely fresh BAC, as the larger BACs from Roswell Park degraded rapidly after isolation. The DNA was injected at 2.5 ng/ul. Transgenic mice were made by pronuclear injection into superovulated, fertilized, FVB/NJ female mice. The fertilized oocytes were then implanted into pseudopregnant (B6D2) F, mice. When the resulting pups reached 3 weeks of age, they were tail clipped to obtain DNA and earpunched for identification.




Full Text

PAGE 1

(/8&,'$7,21 2) ,035,17,1* 0(&+$1,606 $1' 3+(127<3(6 ,1 35$'(5:,//, 6<1'520( 0,&( %\ 67250< -2 &+$0%(5/$,1 $ ',66(57$7,21 35(6(17(' 72 7+( *5$'8$7( 6&+22/ 2) 7+( 81,9(56,7< 2) )/25,'$ ,1 3$57,$/ )8/),//0(17 2) 7+( 5(48,5(0(176 )25 7+( '(*5(( 2) '2&725 2) 3+,/2623+< 81,9(56,7< 2) )/25,'$

PAGE 2

$&.12:/('*0(176 7KH DXWKRU WKDQNV WKH SDVW DQG SUHVHQW PHPEHUV RI WKH %UDQQDQ ODEf§:LQWKURSLDQ 3HHU\ .DUHQ -RKQVWRQH &KULV )XWWQHU -HVVLFD :DOUDWK 6XVDQ %OD\GHV 7RP 6LPRQ 0LNH (OPRUH 7RGG $GDPVRQ DQG 0LVV\ 6KHOOH\IRU PDNLQJ ODE VXFK D IXQ SODFH WR ZRUN IRU WROHUDWLQJ KHU GDLO\ DQG IRU VWLFNLQJ WRJHWKHU WKURXJK VRPH WRXJK WLPHV 6KH H[WHQGV VSHFLDO JUDWLWXGH WR .DUHQ -RKQVWRQH IRU KHU JUDFLRXV KHOS ZLWK WKLV GRFXPHQW 6KH DOVR WKDQNV 'DQ 'ULVFROO IRU EHLQJ WKH EXWW RI KHU MRNHV DQG IRU QRW OHWWLQJ KHU IRUJHW WKDW VKH WRR FDQ EH D EXWW DQG -LP 5HVQLFN IRU DFFHSWLQJ UHVSRQVLELOLW\ IRU KHU DQG IRU NHHSLQJ DOO RI XV WRJHWKHU 7KH DXWKRU H[WHQGV KHU GHHSHVW JUDWLWXGH WR &DPL %UDQQDQ IRU DOORZLQJ KHU WR ZRUN RQ WKLV SURMHFW IRU KHU LGHDV IRU JLYLQJ KHU VRPHRQH WR ORRN XS WR DQG IRU \HDUV WRR IHZ RI IULHQGVKLS )LQDOO\ WKH DXWKRU WKDQNV KHU SDUHQWV IRU DOO RI WKHLU VXSSRUW DQG IRU PDNLQJ KHU FRPH KRPH ZKHQ VKH QHHGV WR

PAGE 3

7$%/( 2) &217(176 $&.12:/('*0(176 LL /,67 2) $%%5(9,$7,216 YL $%675$&7 YLLL &+$37(56 ,1752'8&7,21 *HQRPLF ,PSULQWLQJ 7KH 3UDGHU :LOOL DQG $QJHOPDQ 6\QGURPHV ,035,17(' 5(*8/$7,21 2) 8%($ ,QWURGXFWLRQ 0DWHULDOV DQG 0HWKRGV 6WUDLQV DQG 0DWLQJV ,GHQWLILFDWLRQ RI 3RO\PRUSKLVPV 573&5 5HVXOWV 'LVFXVVLRQ ,035,17(' 75$16*(1(6 ,QWURGXFWLRQ 8VH RI 7UDQVJHQLF 0LFH WR 6WXG\ *HQH 5HJXODWLRQ 0DWHULDOV DQG 0HWKRGV 6FUHHQLQJ WKH %$& /LEUDULHV 3UREH 3UHSDUDWLRQ 9HULILFDWLRQ RI %$& &ORQHV (QG 6HTXHQFLQJ %$& &ORQHV 3XOVH)LHOG *HO (OHFWURSKRUHVLV 6RXWKHUQ %ORW 7UDQVJHQLF 0LFH 3URGXFWLRQ 0RXVH +XVEDQGU\ 0RXVH 6WUDLQV 5HVXOWV <$& 6WXGLHV 6Y %$& /LEUDU\ 6FUHHQ LLL

PAGE 4

5HF$ 0HGLDWHG +RPRORJRXV 5HFRPELQDWLRQ 5HF(7 0HGLDWHG +RPRORJRXV 5HFRPELQDWLRQ &%/%$& /LEUDU\ 6FUHHQ /DPEGD 5HG 0HGLDWHG +RPRORJRXV 5HFRPELQDWLRQ 3URGXFWLRQ 2I 7UDQVJHQLF 0LFH &KDUDFWHUL]DWLRQ 2I 7UDQVJHQLF /LQHV 7KH 0DUNHG (QGRJHQRXV 6QUSQ /RFXV ,PSULQWHG ([SUHVVLRQ )URP 7UDQVJHQHV 'LVFXVVLRQ 675$,1'(3(1'(17 ',))(5(1&(6 ,1 3+(127<3( ,QWURGXFWLRQ 0DWHULDOV DQG 0HWKRGV 6WUDLQV DQG 0DWLQJV &XOOLQJ DQG )RVWHULQJ ,GHQWLILFDWLRQ RI 3RO\PRUSKLVPV 573&5 1RUWKHUQ %ORW $QDO\VLV 5HVXOWV 'LVFXVVLRQ 75$16*(1,& 5(6&8( 2) 7+( 3:6,& '(/(7,21 0286( ,QWURGXFWLRQ 0DWHULDOV DQG 0HWKRGV 6FUHHQLQJ WKH %$& /LEUDULHV 3UREH 3UHSDUDWLRQ 9HULILFDWLRQ RI %$& &ORQHV (QG 6HTXHQFLQJ %$& &ORQHV 3XOVH)LHOG *HO (OHFWURSKRUHVLV 6RXWKHUQ %ORW 7UDQVJHQLF 0LFH 3URGXFWLRQ 0RXVH +XVEDQGU\ 0RXVH 6WUDLQV 5HVXOWV 6FUHHQLQJ WKH %$& /LEUDU\ IRU &ORQHV 3URGXFWLRQ DQG &KDUDFWHUL]DWLRQ RI 7UDQVJHQLF 0LFH 7UDQVJHQLF 5HVFXH ([SHULPHQWV 7UDQVJHQLF /LQHV 7UDQVJHQLF 5HVFXH ([SHULPHQWV DQG 7UDQVJHQLF /LQHV 'LVFXVVLRQ %$& ,VRODWLRQ 5HDUUDQJHG 7UDQVJHQHV 7UDQVJHQLF 5HVFXH &21&/86,216 $1' )8785( ',5(&7,216 ,9

PAGE 5

5()(5(1&(6 %,2*5$3+,&$/ 6.(7&+ Y

PAGE 6

/,67 2) $%%5(9,$7,216 $6 $QJHOPDQ V\QGURPH $6,& $QJHOPDQ V\QGURPH LPSULQWLQJ FHQWHU $6652 $QJHOPDQ V\QGURPH VPDOOHVW UHJLRQ RI GHOHWLRQ RYHUODS %$& EDFWHULDO DUWLILFLDO FKURPRVRPH F'1$ FRPSOHPHQWDU\ GHR[\ULERQXFOHLF DFLG &S* F\WRVLQHSKRVSKDWHJXDQLQH '1$ GHR[\ULERQXFOHLF DFLG '1DVHO GHR[\ULERQXFOHDVH ,$3 LQWHUVWLWLDO $ SDUWLFOH ,& LPSULQWLQJ FHQWHU ,&5 LPSULQWLQJ FRQWURO UHJLRQ ,JI LQVXOLQOLNH JURZWK IDFWRU JHQH ,JIU LQVXOLQOLNH JURZWK IDFWRU UHFHSWRU JHQH ,SZ LPSULQWHG LQ 3UDGHU:LOOL JHQH NE NLOREDVH 0DJHO PDJHOLNH JHQH 0E PHJDEDVH 0NUQ PDNRULQULQJ JHQH P51$ PHVVHQJHU ULERQXFOHLF DFLG 1&%, 1DWLRQDO &HQWHU IRU %LRWHFKQRORJ\ ,QIRUPDWLRQ YL

PAGE 7

1&, 1DWLRQDO &DQFHU ,QVWLWXWH 1GQ 1HFGLQ JHQH 3&5 SRO\PHUDVH FKDLQ UHDFWLRQ 3:6 3UDGHU:LOOL V\QGURPH 3:6,& 3UDGHU:LOOL V\QGURPH LPSULQWLQJ FHQWHU 3:6652 3UDGHU:LOOL V\QGURPH VPDOOHVW UHJLRQ RI GHOHWLRQ RYHUODS 51$ ULERQXFOHLF DFLG 51DVHO ULERQXFOHDVH 53&, 5RVZHOO 3DUN &DQFHU ,QVWLWXWH 57 UHYHUVH WUDQVFULSWLRQ 573&5 UHYHUVH WUDQVFULSWLRQ SRO\PHUDVH FKDLQ UHDFWLRQ 6P1 VPDOO QXFOHDU ULERQXFOHRSURWHLQ SDUWLFOH 1 SURWHLQ VQR51$ VPDOO QXFOHRODU ULERQXFOHLF DFLG 6QUSQ VPDOO QXFOHDU ULERQXFOHRSURWHLQ SDUWLFOH 1 JHQH 6QXUI 6QUSQ XSVWUHDP UHDGLQJ IUDPH 8EH$ XELTXLWLQ $ OLJDVH 83' XQLSDUHQWDO GLVRP\ <$& \HDVW DUWLILFLDO FKURPRVRPH =1) KXPDQ ]LQF ILQJHU SURWHLQ =ISO PXULQH ]LQF ILQJHU SURWHLQ 9LO

PAGE 8

$EVWUDFW RI 'LVVHUWDWLRQ 3UHVHQWHG WR WKH *UDGXDWH 6FKRRO RI WKH 8QLYHUVLW\ RI )ORULGD LQ 3DUWLDO )XOILOOPHQW RI WKH 5HTXLUHPHQWV IRU WKH 'HJUHH RI 'RFWRU RI 3KLORVRSK\ (/8&,'$7,21 2) ,035,17,1* 0(&+$1,606 $1' 3+(127<3(6 ,1 35$'(5:,//, 6<1'520( 0,&( %\ 6WRUP\ -R &KDPEHUODLQ 0D\ &KDLU -DPHV 5HVQLFN 0DMRU 'HSDUWPHQW 0ROHFXODU *HQHWLFV DQG 0LFURELRORJ\ *HQRPLF LPSULQWLQJ LV DQ HSLJHQHWLF SKHQRPHQRQ LQ ZKLFK JHQHV DUH H[SUHVVHG H[FOXVLYHO\ IURP RQH SDUHQWDO DOOHOH RU WKH RWKHU 3UDGHU:LOOL V\QGURPH 3:6f DQG $QJHOPDQ V\QGURPH $6f DUH KXPDQ JHQHWLF GLVRUGHUV UHVXOWLQJ IURP WKH DEVHQFH RI JHQHV WKDW DUH VXEMHFW WR JHQRPLF LPSULQWLQJ 3:6 LV D FRQWLJXRXV JHQH V\QGURPH WKDW UHVXOWV IURP WKH DEVHQFH RI WZR RU PRUH SDWHUQDOO\ H[SUHVVHG JHQHV ZKLOH $6 LV D GLVRUGHU WKDW FDQ UHVXOW IURP WKH DEVHQFH RI D VLQJOH PDWHUQDOO\ H[SUHVVHG JHQH 8%($ ZKLFK OLHV LQ WKH VDPH UHJLRQ 7KLV VWXG\ XVHV D PRXVH PRGHO IRU 3:6 LQ ZKLFK SDWHUQDO WUDQVPLVVLRQ RI D 3:6 LPSULQWLQJ FHQWHU 3:6,&f PXWDWLRQ UHVXOWV LQ FRPSOHWH ORVV RI ORFDO SDWHUQDO JHQH H[SUHVVLRQ 7KLV WDUJHWHG PXWDWLRQ DFFXUDWHO\ PRGHOV ERWK WKH PROHFXODU DQG SKHQRW\SLF DVSHFWV RI 3:6 DQG LW KDV EHHQ DSSOLHG WR ERWK RI WKHVH DVSHFWV LQ WKLV VWXG\ YP

PAGE 9

,W KDV ILUVW EHHQ VKRZQ WKDW LPSULQWHG H[SUHVVLRQ RI 8EHD PRVW OLNHO\ UHVXOWV IURP WKH UHJXODWLRQ RI D SDWHUQDOO\ H[SUHVVHG WUDQVFULSW WKDW LV DQWLVHQVH WR WKH 8EHD JHQH VXJJHVWLQJ DQ LQWHUHVWLQJ PRGHO IRU WKH UHJXODWLRQ RI JHQH H[SUHVVLRQ LQ WKLV LPSULQWHG UHJLRQ 7KH PLQLPXP VHTXHQFH WKDW LV VXIILFLHQW WR FRQIHU SURSHU LPSULQWHG H[SUHVVLRQ RI WKH SDWHUQDOO\ H[SUHVVHG JHQHV WR WUDQVJHQHV LQ YLYR ZDV WKHQ LGHQWLILHG 7KLV SURYLGHV D VWULQJHQW DVVD\ WKDW FDQ EH XVHG WR WHVW WKH SURSRVHG PRGHO RI LPSULQWHG JHQH H[SUHVVLRQ 7UDQVJHQLF UHVFXH RI WKH 3:6 PRXVH ZDV DOVR XVHG LQ RXU PRXVH PRGHO WR FRUUHODWH VSHFLILF DWWULEXWHV RI WKH 3:6 SKHQRW\SH WR VSHFLILF JHQH SURGXFWV $ WUDQVJHQH WKDW VKRZV H[SUHVVLRQ RI D VLQJOH VPDOO QXFOHRODU 51$ VQR51$f FOXVWHU UHVFXHV WKH VPDOO VWDWXUH SKHQRW\SH RI 3:6 PLFH ZKLOH WKUHH RWKHU JHQHV ZHUH IRXQG WR KDYH QR REYLRXV HIIHFW RQ WKH 3:6 SKHQRW\SH LQ PLFH :H KDYH DOVR IRXQG WKDW WKH 3:6 SKHQRW\SH LV OHVV VHYHUH RQ FHUWDLQ VWUDLQ EDFNJURXQGV VXJJHVWLQJ WKH SUHVHQFH RI PRGLILHU JHQHV WKDW PD\ DPHOLRUDWH WKH 3:6 SKHQRW\SH 7KHVH PRGLILHU JHQHV PD\ KHOS WR LGHQWLI\ JHQH SDWKZD\V LQYROYHG LQ 3:6 DV ZHOO DV IXWXUH WDUJHWV IRU JHQH WKHUDS\ WKDW PD\ XOWLPDWHO\ KHOS WKH 3:6 SDWLHQW ,;

PAGE 10

&+$37(5 ,1752'8&7,21 3UDGHU:LOOL DQG $QJHOPDQ V\QGURPHV 3:6 DQG $6 UHVSHFWLYHO\f DUH WZR KXPDQ JHQHWLF GLVRUGHUV WKDW UHVXOW IURP GHILFLHQFLHV LQ JHQHV WKDW DUH VXEMHFW WR JHQRPLF LPSULQWLQJ 7KH FDXVDWLYH JHQHWLF UHJLRQV IRU ERWK RI WKHVH V\QGURPHV KDYH EHHQ PDSSHG WR DSSUR[LPDWHO\ 0E LQ WKH TO OTO UHJLRQ 7KH\ SURYLGH D FOLQLFDOO\ DQG VFLHQWLILFDOO\ LQWHUHVWLQJ VLWXDWLRQ LQ ZKLFK WR VWXG\ WKH PHFKDQLVPV DQG SKHQRW\SHV LQYROYHG ZLWK RQH UHJLRQ RI JHQRPLF LPSULQWLQJ *HQRPLF ,PSULQWLQJ *HQRPLF LPSULQWLQJ LV D SKHQRPHQRQ LQ ZKLFK JHQHV DUH H[SUHVVHG LQ D SDUHQW RIRULJLQ VSHFLILF PDQQHU %RWK SDUHQWDO JHQRPHV LQ IDFW DUH DEVROXWHO\ UHTXLUHG IRU QRUPDO GHYHORSPHQW RI D PDPPDO PRXVHf :RUN IURP WKH ODERUDWRULHV RI 'DYRU 6ROWHU DQG $]LP 6XUDQL VKRZHG WKDW HPEU\RV ZLWK WZR JHQHWLF FRQWULEXWLRQV IURP WKH VDPH SDUHQW ZRXOG QRW GHYHORS QRUPDOO\ (PEU\RV ZLWK WZR PDOH SURQXFOHL DQGURJHQHWLFf GHYHORSHG LQWR WLVVXHV WKDW ZHUH PRVWO\ H[WUDHPEU\RQLF LQ QDWXUH ZKLOH WKRVH ZLWK WZR IHPDOH SURQXFOHL SDUWKHQRJHQHWLFf GHYHORSHG LQWR WLVVXHV WKDW UHSUHVHQWHG WKH HPEU\R SURSHU &DWWDQDFK VKRZHG WKDW XQLSDUHQWDO GLVRP\ RU WKH LQKHULWDQFH RI VSHFLILF FKURPRVRPH VHJPHQWV IURP D VLQJOH SDUHQW DOVR OHG WR GHYHORSPHQWDO DEQRUPDOLWLHV IXUWKHU VXJJHVWLQJ WKH LPSRUWDQFH RI ERWK SDUHQWDO JHQRPHV 7KLV DOVR OHG WR WKH LGHD WKDW LW PD\ EH VSHFLILF JHQHV RU UHJLRQV WKDW ZHUH GLIIHUHQWLDOO\ UHJXODWHG EHWZHHQ PDWHUQDO DQG SDWHUQDO DOOHOHV DQG WKXV UHVSRQVLEOH IRU WKH IDLOXUH RI SDUWKHQRJHQHWLF RU

PAGE 11

DQGURJHQHWLF HPEU\RV WR GHYHORS FRUUHFWO\ 7KHVH H[SHULPHQWV VXJJHVWHG WKDW FHUWDLQ JHQHV LQ WKH PDPPDOLDQ JHQRPH ZHUH VXEMHFWHG WR JHQRPLF LPSULQWLQJ DQG DUH H[SUHVVHG H[FOXVLYHO\ IURP WKH SDWHUQDOO\ LQKHULWHG DOOHOH DQG VLOHQFHG IURP WKH PDWHUQDOO\ LQKHULWHG DOOHOH ZKLOH RWKHUV DUH H[SUHVVHG IURP WKH PDWHUQDOO\ LQKHULWHG DOOHOH DQG UHSUHVVHG IURP WKH SDWHUQDOO\ LQKHULWHG DOOHOH 7KH SDUHQWRIRULJLQ VSHFLILF H[SUHVVLRQ LV PDLQWDLQHG IURP JHQHUDWLRQ WR JHQHUDWLRQ DQG VR ZLWK HDFK SDVVDJH WKURXJK WKH JHUPOLQH WKH SDVW SDUHQWDO fODEHOf RI DQ LPSULQWHG JHQH LV HUDVHG DQG WKH JHQH LV fUHODEHOHGf EDVHG RQ WKH SDUHQW WKDW LW LV QRZ LQKHULWHG IURP 7KH DELOLW\ RI WKH WZR SDUHQWDO DOOHOHV WR DOZD\V EH GLVWLQJXLVKHG IURP RQH DQRWKHU LV IDVFLQDWLQJ HVSHFLDOO\ VLQFH WKHVH DOOHOHV FDQ EH LGHQWLFDO 7KH H[LVWHQFH RI LGHQWLFDO DOOHOHV WKDW DUH VRPHKRZ UHJXODWHG GLIIHUHQWLDOO\ LQGLFDWHV WKDW JHQRPLF LPSULQWLQJ LQYROYHV DQ HSLJHQHWLF SKHQRPHQRQ (SLJHQHWLF PHDQLQJ fRXWVLGH FRQYHQWLRQDO JHQHWLFVf UHIHUV WR WKH GLVWLQJXLVKLQJ PDUN EHLQJ VRPHWKLQJ RWKHU WKDQ FKDQJHV LQ VHTXHQFH 7KHUH LV QRZ FRQVLGHUDEOH HYLGHQFH WR VXJJHVW WKDW FKHPLFDO PRGLILFDWLRQV VXFK DV PHWK\ODWLRQ RU DFHW\ODWLRQ WR '1$ DQG SURWHLQV DVVRFLDWHG ZLWK '1$ DUH UHVSRQVLEOH LQ SDUW IRU WKH HSLJHQHWLF FKDQJHV WKDW GLVWLQJXLVK RQH SDUHQWDO DOOHOH IURP DQRWKHU '1$ PHWK\ODWLRQ KDV EHHQ NQRZQ WR EH DVVRFLDWHG ZLWK VLOHQFHG DOOHOHV DOWKRXJK VRPH SUHIHUHQWLDOO\ H[SUHVVHG DOOHOHV DUH NQRZQ WR EH DVVRFLDWHG ZLWK '1$ PHWK\ODWLRQ 7KH KLVWRQH FRGH KDV DOVR EHHQ VKRZQ WR EH DVVRFLDWHG ZLWK HLWKHU WKH PDLQWHQDQFH RU HVWDEOLVKPHQW RI LPSULQWHG GRPDLQV 7KH FXUUHQW XQGHUVWDQGLQJ RI KRZ '1$ PHWK\ODWLRQ FROODERUDWHV ZLWK SURWHLQV WKDW PRGLI\ QXFOHRVRPHV WR HVWDEOLVK D VWDEOH FKURPDWLQ VWDWH DQG HSLJHQHWLFDOO\ UHJXODWH JHQH

PAGE 12

H[SUHVVLRQ LV QLFHO\ UHYLHZHG E\ 5XGROI -DHQLVK DQG $GULDQ %LUG LQ WKH 0DUFK YROXPH RI 1DWXUH *HQHWLFV ,V H[WUHPHO\ LPSRUWDQW WR XQGHUVWDQG WKH FLV DFWLQJ UHJXODWRU\ VHTXHQFHV WKDW KDUERU WKH HSLJHQHWLF FKDQJHV DQG WUDQVODWH WKHP WR FKDQJHV LQ JHQH H[SUHVVLRQ VLQFH JHQH H[SUHVVLRQ IURP RQH SDUHQWDO DOOHOH RU WKH RWKHU LV WKH XOWLPDWH JRDO RI JHQRPLF LPSULQWLQJ :KLOH PDQ\ LPSULQWHG UHJLRQV VXFK DV +,JI DQG ,JIU KDYH EHHQ VWXGLHG LQ JUHDW GHSWK LW KDV EHFRPH DSSDUHQW WKDW GLIIHUHQW LPSULQWHG UHJLRQV DUH QRW QHFHVVDULO\ VXEMHFWHG WR WKH VDPH UHJXODWLRQ SDUDGLJPV 7KH 3:6$6 UHJLRQ RI JHQRPLF LPSULQWLQJ LV DQ DWWUDFWLYH LPSULQWHG UHJLRQ WR VWXG\ IRU VHYHUDO UHDVRQV )LUVW WKH LPSULQWHG UHJLRQ VSDQV D GLVWDQFH RI DSSUR[LPDWHO\ 0E 7KH PHFKDQLVP RI D FRQWURO HOHPHQW WKDW LQIOXHQFHV JHQH UHJXODWLRQ DW VXFK JUHDW GLVWDQFHV LV SDUWLFXODUO\ LQWULJXLQJ 6HFRQGO\ WKLV UHJLRQ VHHPV UHODWLYHO\ VLPSOH $W WKH RXWVHW RI WKLV VWXG\ WKHUH ZHUH IRXU NQRZQ SDWHUQDOO\ H[SUHVVHG JHQHV DQG RQH NQRZQ PDWHUQDOO\ H[SUHVVHG JHQH LQ WKH UHJLRQ ,W ZDV DOVR NQRZQ WKDW WKLV UHJLRQ ZDV UHJXODWHG E\ D ELSDUWLWH LPSULQWLQJ FHQWHU ZLWK RQH SRUWLRQ UHJXODWLQJ WKH PDWHUQDOO\ H[SUHVVHG JHQH DQG WKH RWKHU UHJXODWLQJ WKH SDWHUQDOO\ H[SUHVVHG JHQHV 7KLUGO\ DW OHDVW WZR PRXVH PRGHOV ZLWK GLVUXSWHG LPSULQWLQJ LQ WKH 3:6$6 UHJLRQ VXJJHVWHG WKDW WKH LPSULQWLQJ PHFKDQLVP ZDV FRQVHUYHG EHWZHHQ PRXVH DQG KXPDQ SURYLGLQJ D JHQHWLF V\VWHP LQ ZKLFK WR VWXG\ LPSULQWLQJ 0RVW LPSRUWDQWO\ WKH 3:6$6 UHJLRQ KDV FOLQLFDO VLJQLILFDQFH DV LW ZDV RULJLQDOO\ LGHQWLILHG DV D JHQHWLF UHJLRQ WKDW ZDV UHVSRQVLEOH IRU KXPDQ GLVHDVH

PAGE 13

7KH 3UDGHU :LOOL DQG $QJHOPDQ 6\QGURPHV 3:6 LV FKDUDFWHUL]HG E\ QHRQDWDO K\SRWRQLD IDLOXUH WR WKULYH K\SRJRQDGLVP FU\SWRUFKLGLVP DQG SRRU VXFNOH %\ PRQWKV WKH IDLOXUH WR WKULYH DQG SRRU VXFNOH V\PSWRPV VXEVLGH DQG 3:6 FKLOGUHQ EHJLQ WR GHYHORS REHVLW\ WKDW LV FRPSOLFDWHG E\ K\SHUSKDJLD SK\VLFDO DQG PHQWDO GHYHORSPHQWDO GHOD\ WKDW OHDGV WR PRGHUDWH PHQWDO UHWDUGDWLRQ DQG VPDOO VWDWXUH DQG EHKDYLRUDO SUREOHPV UHPLQLVFHQW RI REVHVVLYH FRPSXOVLYH GLVRUGHU $6 LV FKDUDFWHUL]HG E\ VHYHUH PHQWDO UHWDUGDWLRQ DWD[LF JDLW LQDSSURSULDWH ODXJKWHU KDSS\ DIIHFW DQG DOPRVW DEVHQW VSHHFK (DFK RI WKHVH GLVRUGHUV RFFXU DW D IUHTXHQF\ RI DSSUR[LPDWHO\ LQ OLYH ELUWKV :KLOH 3:6 DQG $6 DUH UHODWLYHO\ UDUH WKH\ SURYLGH D FORVHG JHQHWLF V\VWHP LQ ZKLFK WR LQYHVWLJDWH KXPDQ GLVRUGHUV VXFK DV REHVLW\ IDLOXUH WR WKULYH DWD[LD DQG PHQWDO UHWDUGDWLRQ WKDW DUH PXFK PRUH FRPPRQ /HGEHWWHU HW DO ILUVW QRWLFHG WKDW SDWLHQWV ZLWK 3:6 RIWHQ KDG F\WRORJLFDOO\ YLVLEOH GHOHWLRQV RI KXPDQ TO OTO %XWOHU DQG 3DOPHU ODWHU UHSRUWHG WKDW WKHVH VDPH GHOHWLRQV ZHUH RFFXUULQJ RQ WKH SDWHUQDOO\ LQKHULWHG FKURPRVRPH )LQDOO\ 1LFKROOV HW DO GHWHUPLQHG WKDW PDWHUQDO XQLSDUHQWDO GLVRP\ ZDV DOVR D PHFKDQLVP E\ ZKLFK 3:6 FRXOG RFFXU 7KLV OHG WR WKH VXVSLFLRQ WKDW 3:6 RFFXUV DV IURP WKH SK\VLFDO RU IXQFWLRQDO GHOHWLRQ RI WKH JHQHV ORFDWHG RQ WKH SDWHUQDOO\ LQKHULWHG FKURPRVRPH $6 RQ WKH RWKHU KDQG ZDV NQRZQ WR EH DVVRFLDWHG ZLWK VLPLODU GHOHWLRQV WKDW ZHUH RFFXUULQJ RQ WKH PDWHUQDOO\ LQKHULWHG FKURPRVRPH 3DWHUQDO XQLSDUHQWDO GLVRP\ ZDV DOVR VKRZQ WR UHVXOW LQ $6 $6 ZDV IRXQG WR EH WKH UHVXOW RI WKH SK\VLFDO RU IXQFWLRQDO GHOHWLRQ RI PDWHUQDO TO TO

PAGE 14

3DWLHQWV ZLWK 3:6 ODFN H[SUHVVLRQ RI DOO RI WKH SDWHUQDOO\ H[SUHVVHG JHQHV LQ WKH UHJLRQ DQG FDQ EH GLYLGHG LQWR JHQHWLF FODVVHVf§PDWHUQDO XQLSDUHQWDO GLVRP\ SDWLHQWV GHOHWLRQ SDWLHQWV DQG LPSULQWLQJ GHIHFW SDWLHQWV 0DWHUQDO XQLSDUHQWDO GLVRP\ SDWLHQWV KDYH WZR FKURPRVRPHV WKDW ZHUH LQKHULWHG IURP WKHLU PRWKHU SUHVXPDEO\ DV D UHVXOW RI QRQGLVMXQFWLRQ IROORZHG E\ UHGXFWLRQ LQ WKH ]\JRWH $EVHQFH RI D SDWHUQDO DOOHOH RI TO TO FDXVHV WKH DEVHQFH RI H[SUHVVLRQ RI WKH SDWHUQDOO\ H[SUHVVHG JHQHV 7KH GHOHWLRQ SDWLHQWV KDYH D 0E GHOHWLRQ RI WKH SDWHUQDOO\ LQKHULWHG TO T ZKLFK LV IDFLOLWDWHG E\ UHSHDWHG UHJLRQV WKDW IODQN WKH HQWLUH LPSULQWHG GRPDLQ 7KHVH UHSHDWV FDXVH WKLV W\SH RI GHOHWLRQ WR RFFXU DW D FRPSDUDWLYHO\ KLJK IUHTXHQF\ 3DWLHQWV ZLWK WKLV GHOHWLRQ DUH SK\VLFDOO\ PLVVLQJ WKH SDWHUQDOO\ LQKHULWHG DOOHOH IURP ZKLFK JHQHV DUH H[SUHVVHG ,PSULQWLQJ PXWDWLRQV ZHUH LGHQWLILHG LQ SDWLHQWV WKDW KDG LQKHULWHG ERWK D PDWHUQDO DQG SDWHUQDO FKURPRVRPH TO OTO EXW WKH SDWHUQDO FKURPRVRPH KDG D PDWHUQDO HSLJHQRW\SH DV DVVD\HG E\ PHWK\ODWLRQ DW WKH 61531 JHQH 6RPH RI WKHVH LPSULQWLQJ PXWDWLRQV ZHUH IRXQG WR EH GXH WR GHOHWLRQV RI WKH 3:6,& DQG UHVXOW LQ WKH VLOHQFLQJ RI WKH SDWHUQDOO\ H[SUHVVHG JHQHV0r 2WKHU LPSULQWLQJ PXWDWLRQV VKRZ QR DSSDUHQW GHOHWLRQ RU PXWDWLRQ LQ WKH 3:6,& DQG DUH WKRXJKW WR EH HSLPXWDWLRQV RI XQNQRZQ RULJLQ $6 SDWLHQWV FDQ EH GLYLGHG LQWR ILYH JHQHWLF FODVVHVf§SDWHUQDO XQLSDUHQWDO GLVRP\ SDWLHQWV GHOHWLRQ SDWLHQWV LPSULQWLQJ GHIHFW SDWLHQWV 8%($ PXWDWLRQ SDWLHQWV DQG ELSDUHQWDO SDWLHQWV ZLWK DQ XQLGHQWLILHG JHQHWLF OHVLRQ 3DWHUQDO XQLSDUHQWDO GLVRP\ SDWLHQWV KDYH WZR FKURPRVRPHV IURP WKHLU IDWKHU $JDLQ QRQGLVMXQFWLRQ LV WKRXJKW WR EH UHVSRQVLEOH IRU WKLV EXW LW RFFXUV OHVV IUHTXHQWO\ LQ PDOHV WKDQ IHPDOHV DFFRXQWLQJ IRU WKH UHGXFHG IUHTXHQF\ RI SDWHUQDO XQLSDUHQWDO GLVRP\

PAGE 15

SDWLHQWV $6 GHOHWLRQ SDWLHQWV DUH SK\VLFDOO\ PLVVLQJ WKH PDWHUQDO DOOHOH RI TO OTO DQG WKXV WKH WZR PDWHUQDOO\ H[SUHVVHG JHQHV LQ WKH UHJLRQ ,PSULQWLQJ PXWDWLRQV WKDW UHVXOW IURP PLFURGHOHWLRQ RI WKH $6,& GLVUXSW WKH PDWHUQDO SDWWHUQ RI JHQH H[SUHVVLRQ 7KHVH LPSULQWLQJ PXWDWLRQV ZHUH VKRZQ WR EH VPDOO GHOHWLRQV XSVWUHDP RI WKH 3:6,& GHOHWLRQ PXWDWLRQV DQG QHYHU RYHUODS WKHP ,PSULQWLQJ PXWDWLRQV LQ $6 SDWLHQWV KDYH EHHQ LGHQWLILHG E\ PXWDWLRQ RI WKH SXWDWLYH $6,& DQG QRW E\ HSLPXWDWLRQ VLQFH QR NQRZQ PHWK\ODWLRQ PDUN KDV EHHQ DVVRFLDWHG ZLWK $6 $ /RVVLH DQG ''ULVFROO SHUVRQDO FRPPXQLFDWLRQf )LQDOO\ WKH WZR ELSDUHQWDO FODVVHV RI $6 SDWLHQWV LQGLFDWH WKDW $6 FDQ EH FDXVHG E\ GLVUXSWLRQ RI WKH 8%($ JHQH DQG WKDW RWKHU JHQHV DUH OLNHO\ WR EH LQYROYHG LQ WKH 8%($ SDWKZD\ 7KH FRQWULEXWLRQ RI WKH RWKHU PDWHUQDOO\ H[SUHVVHG JHQH $73& WR WKH $6 SKHQRW\SH LV QRW ZHOO XQGHUVWRRG 7KH LPSULQWLQJ FHQWHU PXWDWLRQV IURP VHYHUDO 3:6 SDWLHQWV ZHUH PDSSHG WR LGHQWLI\ WKH VPDOOHVW UHJLRQ RI GHOHWLRQ RYHUODS IRU 3:6 3:6652f 7KH 3:6 652 LV ORFDWHG f RI WKH 61531 JHQH LQFOXGLQJ WKH ILUVW H[RQ RI WKH JHQH 7KH 3:6 652 LV RIWHQ UHIHUUHG WR DV WKH 3:6 LPSULQWLQJ FHQWHU RU 3:6,& $OWKRXJK WKH 3:6 652 KDV EHHQ QDUURZHG WR DSSUR[LPDWHO\ NE WKH DFWXDO GHOHWLRQV WKDW KDYH EHHQ VKRZQ WR FDXVH 3:6 DUH ODUJHU $ VPDOOHVW UHJLRQ RI GHOHWLRQ RYHUODS KDV DOVR EHHQ LGHQWLILHG IRU $6 DQG LV UHIHUUHG WR DV WKH $6652 7KH $6652 OLHV DURXQG NE XSVWUHDP RI WKH 3:6652 DQG KDV EHHQ QDUURZHG WR NE $6 LPSULQWLQJ PXWDWLRQV QHYHU DSSHDU WR RYHUODS WKH 3:6652 ZKLOH 3:6 LPSULQWLQJ PXWDWLRQV FDQ RYHUODS WKH $6652 7KLV DOVR LQGLFDWHV D ELSDUWLWH VWUXFWXUH WR WKH LPSULQWLQJ FHQWHU LQ ZKLFK WKH 3:6 DQG $6 FRPSRQHQWV ZRUN WRJHWKHU WR FRQWURO LPSULQWLQJ LQ WKH TO T UHJLRQ

PAGE 16

7KH LPSULQWLQJ PXWDWLRQ FODVV RI SDWLHQWV IRU 3:6 DQG $6 DOVR VXJJHVWV WKDW WKH 3:6,& LV UHTXLUHG IRU WKH SDWHUQDO SDWWHUQ RI JHQH H[SUHVVLRQ DFURVV WKLV DSSUR[LPDWHO\ 0E UHJLRQ ZKLOH WKH $6,& LV UHTXLUHG IRU WKH PDWHUQDO SDWWHUQ RI JHQH H[SUHVVLRQ +XPDQ FKURPRVRPH TO OTO FRQWDLQV DW OHDVW VL[ SDWHUQDOO\ H[SUHVVHG JHQHV RU WUDQVFULSWV LQFOXGLQJ 0.51 0$*(/ 1'1 61531 +%,, +%,, +%,, +%,$ +%,,% +%, +%,, DQG WKH 8%($DQWLVHQVH WUDQVFULSWn DQG WZR PDWHUQDOO\ H[SUHVVHG JHQHV 8%($ DQG $73 ,2& 7KH 3:6$6 UHJLRQ OLHV LQ D UHJLRQ RI V\QWHQ\ ZLWK D UHJLRQ RI FHQWUDO PRXVH FKURPRVRPH DQG WKH JHQH RUGHU DQG VWUXFWXUH LV KLJKO\ FRQVHUYHG ,Q DGGLWLRQ WZR PRXVH PRGHOVf§RQH D PRGHO IRU XQLSDUHQWDO GLVRP\ DQG WKH RWKHU D WDUJHWHG PXWDWLRQ LQ WKH 3:6,& f§VXJJHVW WKDW WKH LPSULQWHG UHJXODWLRQ RI WKH JHQHV LQ WKLV UHJLRQ LV DOVR FRQVHUYHG 0LFH DUH DOVR FDSDEOH RI VKRZLQJ SK\VLFDO SKHQRW\SHV VXFK DV REHVLW\ IDLOXUH WR WKULYH DQG VPDOO VWDWXUH DV ZHOO DV EHKDYLRUDO SKHQRW\SHV VXFK DV REVHVVLYH FRPSXOVLYH GLVRUGHU 0DNLQJ WKH PXULQH V\VWHP D UREXVW RQH IRU WKH VWXG\ RI WKH PROHFXODU DQG SKHQRW\SLF DVSHFWV RI 3:6 DQG $6 7KLV GLVVHUWDWLRQ IRFXVHV RQ WKH PHFKDQLVPV DQG SKHQRW\SHV RI 3:6 7KH ULFK JHQHWLF FRQVHUYDWLRQ EHWZHHQ PRXVH DQG KXPDQ KDV EHHQ KDUQHVVHG WR LQYHVWLJDWH WKHVH DVSHFWV RI WKH GLVRUGHU 7KLV GLVVHUWDWLRQ UHSUHVHQWV WKH IRXU PDMRU DFFRPSOLVKPHQWV )LUVW RI DOO WKH PDWHUQDOO\ H[SUHVVHG 8EHD JHQH ZDV VKRZQ WR EH QHJDWLYHO\ UHJXODWHG E\ DQ DQWLVHQVH WUDQVFULSW WKDW LV LQ WXUQ SRVLWLYHO\ UHJXODWHG E\ WKH 3:6,& 7KLV OHG WR DQ DWWUDFWLYH PRGHO IRU JHQH UHJXODWLRQ LQ WKLV UHJLRQ 6HFRQGO\ WUDQVJHQHV WKDW VKRZ FRUUHFW LPSULQWHG H[SUHVVLRQ ZHUH LGHQWLILHG WKXV GHILQLQJ WKH PLQLPDO DUHD VXIILFLHQW WR FRQIHU DSSURSULDWH LPSULQWHG H[SUHVVLRQ LQ YLYR 7KHVH WUDQVJHQHV DOVR SURYLGHG

PAGE 17

HYLGHQFH IRU WKH IXQFWLRQDO FRQVHUYDWLRQ RI WKH $6,& LQ PRXVH DV ZHOO DV LWV DSSUR[LPDWH ORFDWLRQ LQ WKH UHJLRQ 7KLUGO\ WKH 3:6 SKHQRW\SH LQ PLFH LV LQIOXHQFHG E\ GLIIHUHQW JHQHWLF EDFNJURXQGV LQ PLFH 7KLV GLVFRYHU\ UHYHDOHG D GLIIHUHQW SKHQRW\SH LQ WKH 3:6 PRXVH PRGHO DV ZHOO DV D PHWKRG IRU LGHQWLI\LQJ WKH SDUWLFXODU PRGLI\LQJ JHQHV )LQDOO\ WUDQVJHQLF UHVFXH KDV LGHQWLILHG D JHQH WKDW LV UHVSRQVLEOH IRU WKH VPDOO VWDWXUH SKHQRW\SH LQ WKH 3:6 PRXVH PRGHO DQG UHYHDOHG D SKHQRW\SH DVVRFLDWHG ZLWK VQR51$V )RU HDVH RI UHDGLQJ HDFK FKDSWHU FRQWDLQV VXIILFLHQW EDFNJURXQG DQG PHWKRGRORJ\ VR WKDW WKH UHDGHU PD\ XQGHUVWDQG HDFK RQH LQGHSHQGHQWO\

PAGE 18

&+$37(5 ,035,17(' 5(*8/$7,21 2) 8%($ ,QWURGXFWLRQ $QJHOPDQ V\QGURPH $6f DQG 3UDGHU:LOOL V\QGURPH 3:6f DUH FDXVHG E\ GHIHFWV LQ JHQHV VXEMHFW WR JHQRPLF LPSULQWLQJ $6 UHVXOWV IURP D ODFN RI D PDWHUQDOO\ LQKHULWHG SDWWHUQ RI JHQH H[SUHVVLRQ RI KXPDQ FKURPRVRPH TO OTO ZKHUHDV 3:6 UHVXOWV IURP D ODFN RI D SDWHUQDOO\ LQKHULWHG SDWWHUQ RI JHQH H[SUHVVLRQ LQ WKHOTO TO UHJLRQ 7KH LPSULQWHG JHQHV LQYROYHG LQ $6 DQG 3:6 DUH UHJXODWHG E\ D ELSDUWLWH LPSULQWLQJ FHQWHU ,&f ORFDWHG XSVWUHDP RI WKH 61531 JHQH 7KH ,& LV GLYLGHG LQWR WKH $QJHOPDQ V\QGURPH LPSULQWLQJ FHQWHU $6,&f DQG WKH 3UDGHU:LOOL V\QGURPH LPSULQWLQJ FHQWHU 3:6,&f 0DQ\ RI WKH PRXVH RUWKRORJV RI WKHVH LPSULQWHG JHQHV DUH ORFDWHG LQ WKH V\QWHQLF UHJLRQ RI PXULQH FKURPRVRPH nn IXUWKHUPRUH LW LV NQRZQ WKDW WKH 3:6,& LV IXQFWLRQDOO\ FRQVHUYHG LQ WKH PRXVH 3DWLHQWV ZLWK 3:6 ODFN H[SUHVVLRQ RI PXOWLSOH SDWHUQDOO\ H[SUHVVHG JHQHV SDWLHQWV FDQ EH GLYLGHG LQWR JHQHWLF FODVVHV f PDWHUQDO XQLSDUHQWDO GLVRP\ IRU FKURPRVRPH f 0E GHOHWLRQ RI WKH SDWHUQDOO\ LQKHULWHG TO OTO RU f LPSULQWLQJ PXWDWLRQV WKDW DUH GXH WR GHOHWLRQV RI WKH 3:6,& DQG UHVXOW LQ WKH VLOHQFLQJ RI WKH SDWHUQDOO\ H[SUHVVHG JHQHV nf 7KLV ODWWHU FODVV RI SDWLHQWV LQGLFDWHV WKDW WKH 3:6,& LV UHTXLUHG IRU WKH SDWHUQDO SDWWHUQ RI JHQH H[SUHVVLRQ DFURVV WKLV DSSUR[LPDWHO\ 0E UHJLRQ

PAGE 19

$6 SDWLHQWV FDQ EH GLYLGHG LQWR ILYH JHQHWLF FODVVHV f SDWHUQDO XQLSDUHQWDO GLVRP\ IRU FKURPRVRPH f 0E GHOHWLRQ RI WKH SDWHUQDOO\ LQKHULWHG TO OTO f LPSULQWLQJ PXWDWLRQV WKDW UHVXOW IURP PLFURGHOHWLRQ RI WKH $6,& DQG VXEVHTXHQW GLVUXSWLRQ RI WKH PDWHUQDO SDWWHUQ RI JHQH H[SUHVVLRQ f ELSDUHQWDO ZLWK D PXWDWLRQ LQ WKH PDWHUQDOO\ GHULYHG 8%($ JHQH RU f ELSDUHQWDO ZLWK DQRWKHU DV \HW XQLGHQWLILHG DQRPDO\ WKDW FDQQRW EH GHVFULEHG DV DQ LPSULQWLQJ PXWDWLRQ RU GHOHWLRQnn ,W LV WKH IRXUWK ELSDUHQWDO FODVV WKDW KDV GHPRQVWUDWHG WKDW PXWDWLRQV LQ WKH 8%($ DUH VXIILFLHQW WR FDXVH $6 &RQWUDU\ WR WKH NQRZQ SDWHUQDOO\ H[SUHVVHG WUDQVFULSWV LQ WKH UHJLRQ 8%($ GRHV QRW H[KLELW VWULFW LPSULQWHG H[SUHVVLRQ 8%($ LV H[SUHVVHG SUHGRPLQDQWO\ IURP PDWHUQDO FKURPRVRPH LQ WKH EUDLQ EXW VKRZV ELDOOHOLF H[SUHVVLRQ LQ ILEUREODVWV DQG O\PSKREODVWV $OEUHFKW HW DO GHPRQVWUDWHG WKDW ZKLOH WKH PXULQH 8EHD JHQH LV H[SUHVVHG H[FOXVLYHO\ IURP WKH PDWHUQDO DOOHOH LQ KLSSRFDPSDO QHXURQV DQG 3XUNLQMH FHOOV LW LV H[SUHVVHG IURP ERWK DOOHOHV LQ RWKHU UHJLRQV RI WKH PRXVH EUDLQ $QRWKHU GLIIHUHQFH EHWZHHQ SDWHUQDOO\ H[SUHVVHG WUDQVFULSWV DQG 8%($ LV WKDW IRU PRVW RI WKH SDWHUQDO JHQHV D UHJLRQ RI GLIIHUHQWLDO PHWK\ODWLRQ H[LVWV EHWZHHQ WKH PDWHUQDO DQG SDWHUQDO DOOHOHV 7KLV LV QRW WKH FDVH IRU 8%($ DV WR GDWH QR GLIIHUHQWLDOO\ PHWK\ODWHG &S* VLWHV KDYH EHHQ VKRZQ WR H[LVW QHDU 8%($ $ /RVVLH DQG ''ULVFROO SHUVRQDO FRPPXQLFDWLRQf 7RJHWKHU WKHVH GLIIHUHQFHV LQ LPSULQWHG H[SUHVVLRQ DQG SDUHQWDOVSHFLILF PHWK\ODWLRQ VXJJHVW WKDW WKH PHFKDQLVP WKDW UHJXODWHV WKH SDWHUQDO SURJUDP RI JHQH H[SUHVVLRQ LQ WKLV UHJLRQ PD\ QRW EH WKH VDPH PHFKDQLVP DV WKDW ZKLFK UHJXODWHV 8%($ LPSULQWHG H[SUHVVLRQ

PAGE 20

5RXJHXOOH HW DO UHSRUWHG WKH H[LVWHQFH RI DQ DQWLVHQVH WUDQVFULSW WR WKH 8%($ JHQH 8VLQJ 573&5 RI 51$ GHULYHG IURP $6 DQG 3:6 SDWLHQW EUDLQV WKH\ GHWHUPLQHG WKDW WKLV DQWLVHQVH WUDQVFULSW ZDV LPSULQWHG H[SUHVVHG RQO\ IURP WKH SDWHUQDO DOOHOH 5RXJHXOOH HW DO VXJJHVWHG WKDW WKH PDWHUQDORQO\ H[SUHVVLRQ RI 8%($ PD\ UHVXOW IURP WLVVXH VSHFLILF H[SUHVVLRQ RI WKLV SDWHUQDOO\ H[SUHVVHG DQWLVHQVH WUDQVFULSW 7KHUHIRUH XVLQJ D 3:6,& GHOHWLRQ $3:6,&f PRXVH PRGHOn WKH UROH RI WKH 3:6,& LQ WKH UHJXODWLRQ RI WKH PXULQH 8EHD DQWLVHQVH WUDQVFULSW DQG LWV VXEVHTXHQW HIIHFWV RQ WKH SDUHQWRIRULJLQ VSHFLILF H[SUHVVLRQ RI WKH VHQVH 8EHD WUDQVFULSW ZHUH LQYHVWLJDWHG ,W ZDV IRXQG WKDW WKH PXULQH 8EHD WUDQVFULSW LV H[SUHVVHG H[FOXVLYHO\ IURP WKH SDWHUQDO DOOHOH WKH DQWLVHQVH WUDQVFULSW LV UHJXODWHG E\ WKH 3:6,& DQG WKH OHYHO RI SDWHUQDO YV PDWHUQDO 8EHD H[SUHVVLRQ LV GLIIHUHQW EHWZHHQ $3:6,& PLFH DQG ZLOGW\SH OLWWHUPDWHV VXJJHVWLQJ D UROH IRU WKH DQWLVHQVH WUDQVFULSW LQ WKH UHJXODWLRQ RI PDWHUQDO 8EH H[SUHVVLRQ 0DWHULDOV DQG 0HWKRGV 6WUDLQV DQG 0DWLQJV 0RXVH VWUDLQV XVHG ZHUH PXV PXVFXOXV 6Y 6Y RU 'f DQG D VWUDLQ RI &%/WKDW LV FRQJHQLH IRU WKH 3:6$6 V\QWHQLF UHJLRQ RI FKURPRVRPH IURP PXV FDVWDQHXV %&$67F RU &f )RU %&$67F ; 6Yf ) PDWLQJV D IHPDOH %&$67F PRXVH ZDV PDWHG ZLWK D PDOH $3:6,& PRXVH RQ D 6Y VWUDLQ EDFNJURXQG %RWK $3:6,& PLFH DQG ZLOGW\SH OLWWHUPDWHV ZHUH XVHG 7KH 6Y ; %&$67Ff ) PLFH ZHUH JHQHUDWHG E\ PDWLQJ D IHPDOH 6Y PRXVH ZLWK D PDOH %&$67F PRXVH

PAGE 21

,GHQWLILFDWLRQ RI 3RO\PRUSKLVPV 7RWDO EUDLQ 51$ ZDV SUHSDUHG IURP ERWK 6Y PLFH DQG %&$67F PLFH (DFK 51$ VDPSOH ZDV XVHG WR FUHDWH VLQJOHVWUDQGHG F'1$ XVLQJ UDQGRP SULPHUV 7KHVH F'1$V ZHUH XVHG WR SURJUDP 3&5 UHDFWLRQV XVLQJ SULPHUV FRUUHVSRQGLQJ WR 8EHD H[RQV DQG f&&7*&$*$&77*$$*$$*&$*f DQG f *$$$$&&7&7*&*$$$7*&&77ff 7KH UHVXOWLQJ SURGXFWV ZHUH FORQHG VHTXHQFHG DQG FRPSDUHG $ SRO\PRUSKLVP IRXQG LQ H[RQ FUHDWHG D 7\S, UHVWULFWLRQ VLWH LQ WKH 6Y FORQH DQG D %VW&O VLWH DW WKH VDPH ORFDWLRQ LQ WKH %&$67F FORQH 573&5 7RWDO 51$ ZDV LVRODWHG IURP WRWDO EUDLQ REWDLQHG IURP QHRQDWDO PLFH 51$ ZDV H[WUDFWHG XVLQJ 51$]RO 7HO7HVW ,QFf DFFRUGLQJ WR LQVWUXFWLRQV 7KLV WRWDO EUDLQ 51$ SJf ZDV WKHQ SUHWUHDWHG ZLWK '1$VH /LIH 7HFKQRORJLHVf DQG KDOI RI WKH UHDFWLRQ ZDV VXEVHTXHQWO\ XVHG WR V\QWKHVL]H ILUVW VWUDQG F'1$ ZLWK 6XSHUVFULSW ,, UHYHUVH WUDQVFULSWDVH 57f /LIH 7HKFQRORJLHVf DQG HLWKHU VWUDQGVSHFLILF SULPHU ) RU UDQGRP SULPHUV /LIH 7HFKQRORJLHVf 7KH RWKHU KDOI RI WKH UHDFWLRQ ZDV PDQLSXODWHG LQ SDUDOOHO LQ WKH DEVHQFH RI 57 2QHWZHQWLHWK RI WKH 57 RU 57 UHDFWLRQV ZHUH XVHG WR VHHG 3&5 UHDFWLRQV XVLQJ WKH IROORZLQJ FRQGLWLRQV O2P0 7ULV+&O S+ P0 .& P0 RI WKH IRXU G173V XQLW 7DT '1$ SRO\PHUDVH %RHKULQJHUf DQG S0 RI HDFK RI WKH DSSURSULDWH SULPHUV 6HTXHQFHV RI WKH SULPHUV ZHUH ) f &$&$7$7*$7*$$*&7$&*$ff L5 f & $* $$ $* $* $ $*7* $**77* ff DQG 5 f&$&$&7&&&77&$7$77&&ff 3&5 DPSOLILFDWLRQ FRQGLWLRQV ZHUH r& IRU PLQ IROORZHG E\ F\FOHV RI r& IRU V r& IRU V DQG r& IRU V 7KH ILQDO F\FOH ZDV IROORZHG E\ DQ H[WHQVLRQ VWHS IRU PLQ DW r& 7KH 3&5 SURGXFWV

PAGE 22

ZHUH HLWKHU OHIW XQGLJHVWHG RU GLJHVWHG ZLWK HQ]\PHV DQG DQDO\]HG RQ HLWKHU D b RU b DJDURVH JHO 5HVXOWV 7KH H[SUHVVLRQ RI D 8EHD DQWLVHQVH WUDQVFULSW ZDV ILUVW YHULILHG LQ PRXVH EUDLQ E\ SHUIRUPLQJ 3&5 DFURVV LQWURQ XVLQJ UDQGRPO\ SULPHG PXULQH EUDLQ F'1$ 7ZR EDQGV ZHUH DPSOLILHG IURP WKH F'1$ WKH VPDOOHU FRUUHFWO\ VSOLFHG 8EHD WUDQVFULSW DQG WKH ODUJHU XQVSOLFHG IRUP RI WKH 8EHD JHQH ZKLFK ZDV YHULILHG E\ VHTXHQFLQJ GDWD QRW VKRZQf 7KH H[LVWHQFH RI WKLV XQVSOLFHG IRUP LV FRQVLVWHQW ZLWK D 8EHD DQWLVHQVH WUDQVFULSW WKDW LV H[SUHVVHG LQ PRXVH EUDLQ 7KH SUHVHQFH RI WKH DQWLVHQVH WUDQVFULSW ZDV WKHQ FRQILUPHG DQG LWV SDWHUQDO VSHFLILF H[SUHVVLRQ ZDV GHWHUPLQHG XVLQJ ) SURJHQ\ GHULYHG IURP UHFLSURFDO PDWLQJV EHWZHHQ ZLOGW\SH 6Y PLFH DQG %&$67F PLFH ZKLFK DUH FRQJHQLH IRU WKH 3:6$6 V\QWHQLF UHJLRQ IURP PXV PXVFXOXV FDVWDQHXV FKURPRVRPH RQ D &%/EDFNJURXQG '1$VHO WUHDWHG 51$ SUHSDUHG IURP EUDLQV RI )M PLFH ZDV XVHG WR SURJUDP VWUDQGVSHFLILF UHYHUVH WUDQVFULSWLRQ UHDFWLRQV XVLQJ D IRUZDUG SULPHU IURP H[RQ ) )LJ $f WKXV \LHOGLQJ F'1$ PDGH IURP WKH DQWLVHQVH WUDQVFULSW 8VLQJ WKLV VWUDQG VSHFLILF F'1$ DV D WHPSODWH 3&5 ZDV SHUIRUPHG ZLWK WKH IRUZDUG SULPHU ) DQG D UHYHUVH SULPHU IURP LQWURQ L5 )LJ $f $ SRO\PRUSKLVP LQ 8EHD H[RQ EHWZHHQ 0XV PXVFXOXV GRPHVWLFXV DQG 0XV PXVFXOXV FDVWDQHXV HQDEOHG WKH GHWHUPLQDWLRQ RI WKH SDUHQW RI RULJLQ E\ GLJHVWLRQ RI WKH 573&5 SURGXFWV ZLWK WKH HQ]\PH 7VSO ZKLFK GLJHVWV RQO\ WKH GRPHVWLFXV DOOHOH 7KH 57 3&5 SURGXFW GHULYHG IURP WKH DQWLVHQVH WUDQVFULSW ZDV IRXQG WR EH UHVLVWDQW WR 7\S, GLJHVWLRQ ZKHQ WKH IDWKHU ZDV %&$67F EXW ZDV FOHDYHG E\ WKLV HQ]\PH ZKHQ WKH

PAGE 23

IDWKHU ZDV 6Y 7KLV GHPRQVWUDWHV WKDW WKH DQWLVHQVH 8EHD WUDQVFULSW LV H[SUHVVHG H[FOXVLYHO\ IURP WKH SDWHUQDOO\ LQKHULWHG DOOHOH )LJ ,%f $V SUHYLRXV VWXGLHV KDYH VKRZQ WKDW DOO RWKHU SDWHUQDOO\ H[SUHVVHG WUDQVFULSWV LQ WKH UHJLRQ DUH UHJXODWHG E\ WKH 3:6,& LQ KXPDQV DQG PLFH LW ZDV QHFHVVDU\ WR GHWHUPLQH ZKHWKHU WKH SDWHUQDOO\ H[SUHVVHG 8EHD DQWLVHQVH WUDQVFULSW ZDV DOVR VXEMHFW WR UHJXODWLRQ E\ WKH 3:6,& 7KHUHIRUH WKH 3:6,& GHOHWLRQ $3:6,&f PRXVH VWUDLQ ZDV XVHG 7KLV PRXVH VWUDLQ ZDV FUHDWHG E\ WDUJHWHG GHOHWLRQ LQ (6 FHOOV WKDW LQFOXGHV H[RQV WKURXJK RI 6QUSQ DQG H[WHQGV DSSUR[LPDWHO\ NE n RI WKH JHQH %&$67F IHPDOHV ZHUH PDWHG ZLWK $3:6,& PDOHV DQG WRWDO EUDLQ 51$ ZDV LVRODWHG IURP WKH UHVXOWLQJ QHZERUQ %&$67F ; $3:6,&f ) PLFH 7KH 51$ ZDV '1$VHO WUHDWHG DQG XVHG WR GLUHFW VWUDQGVSHFLILF 57 UHDFWLRQV HDFK FRQWDLQLQJ WKH VHQVH ) SULPHU DQG DQ DQWLVHQVH DFWLQ SULPHU 7KH UHVXOWLQJ F'1$ ZDV XVHG DV D WHPSODWH IRU 3&5 XVLQJ WKH SULPHUV ) DQG L5 RU WZR ILDFWLQ SULPHUV )LJXUH VKRZV WKDW WKH 8EHD DQWLVHQVHGHULYHG ES EDQG SUHVHQW LQ WKH ZLOG W\SH F'1$ LV DEVHQW LQ WKH $3:6,& OLWWHUPDWH F'1$ ,Q FRQWUDVW DFWLQ LV GHWHFWHG LQ ERWK F'1$ SUHSDUDWLRQV 7KLV UHVXOW GHPRQVWUDWHV WKDW WKH 8EHD DQWLVHQVH WUDQVFULSW LV SRVLWLYHO\ UHJXODWHG E\ WKH 3:6,& )LQDOO\ WR GHWHUPLQH LI WKH SDWHUQDO 8EHD DQWLVHQVH WUDQVFULSW UHJXODWHV WKH OHYHO RI SDWHUQDO 8EHD P51$ 573&5 IROORZHG E\ UHVWULFWLRQ HQ]\PH GLJHVWLRQ ZDV SHUIRUPHG WR H[DPLQH WKH OHYHOV RI 8EHD H[SUHVVLRQ SURGXFHG IURP HDFK SDUHQWDO DOOHOH LQ ERWK ZLOGW\SH DQG $3:6,& PLFH 7R GLVWLQJXLVK EHWZHHQ 8EHD H[SUHVVLRQ GHULYHG IURP WKH WZR SDUHQWDO DOOHOHV WZR H[RQ SRO\PRUSKLVPV EHWZHHQ 0XV PXVFXOXV GRPHVWLFXV 'f DQG 0XV PXVFXOXV FDVWDQHXV &f ZHUH XVHG WKH HQ]\PH %VW$&O FXWV WKH

PAGE 24

FDVWDQHXV DOOHOH RQFH EXW GRHV QRW FXW WKH GRPHVWLFXV DOOHOH DQG WKH HQ]\PH 7VSO FXWV WKH GRPHVWLFXV DOOHOH WZLFH DQG WKH FDVWDQHXV DOOHOH RQO\ RQFH )LJ $f 7KH H[SHULPHQWDO FURVV RI %&$67F ; $3:6,& ZDV HVWDEOLVKHG WR REWDLQ ERWK ZLOGW\SH ) SXSV & ; ZWf DQG $3:6,& ) SXSV & ; $f 7KH FRQWURO VWUDLQ UHFLSURFDO FURVV RI 6Y ; %&$67F ZDV DOVR HVWDEOLVKHG WR REWDLQ ZLOGW\SH ) SXSV ; & ZWf $IWHU ELUWK WKH SXSV ZHUH VDFULILFHG WRWDO EUDLQ 51$ IURP DOO WKUHH FODVVHV ZDV LVRODWHG DQG WKHQ UDQGRP SULPHUV ZHUH XVHG WR SUHSDUH F'1$ 6XEVHTXHQW 3&5 DPSOLILFDWLRQ ZLWK WKH 8EHD SULPHUV ) DQG 5 GHPRQVWUDWHG WKDW 8EHD ZDV GHWHFWDEOH LQ DOO WKUHH FODVVHV RI ) PLFH )LJ % ILUVW WKUHH ODQHVf 8SRQ GLJHVWLRQ RI WKHVH 573&5 SURGXFWV %VW&O H[SUHVVLRQ RI ERWK SDUHQWDO 8EHD DOOHOHV ZDV GHWHFWHG LQ DOO WKUHH FODVVHV 7KHVH UHVXOWV DUH H[SHFWHG VLQFH 8EHD LV NQRZQ EH H[SUHVVHG IURP ERWK DOOHOHV LQ PRVW UHJLRQV RI WKH EUDLQ H[KLELWLQJ LPSULQWHG H[SUHVVLRQ LQ RQO\ D VXEVHW RI EUDLQ FHOOV +RZHYHU LQ WKH 3:6$,& ) ODQH & ; $f WKH UDWLR RI SDWHUQDO XQFXWf WR PDWHUQDO FXWf 8EHD H[SUHVVLRQ ZDV IRXQG WR EH HOHYDWHG FRPSDUHG WR WKDW REVHUYHG LQ WKH ZLOGW\SH ) ODQH & ; ZWf 7KHVH UHVXOWV ZHUH FRQILUPHG E\ GLJHVWLRQ RI WKH 57 3&5 SURGXFWV ZLWK VS, ,Q WKLV FDVH WKH SDWHUQDO 8EHD DOOHOH ES ES EDQGVf LV FOHDUO\ SUHVHQW DW VLJQLILFDQWO\ KLJKHU OHYHOV LQ WKH $3:6,& )M ODQH & ; $f WKDQ WKH ZLOGW\SH ) ODQH & ; ZWf 7KHVH UHVXOWV GHPRQVWUDWH WKDW WKH ORVV RI SDWHUQDO 8EHD DQWLVHQVH H[SUHVVLRQ LQ $3:6,& PLFH LV DFFRPSDQLHG E\ DQ LQFUHDVH LQ SDWHUQDO VHQVH 8EHD H[SUHVVLRQ 'LVFXVVLRQ ,Q WKLV VWXG\ WKH PXULQH 8EHD DQWLVHQVH WUDQVFULSW ZDV VKRZQ WR EH H[FOXVLYHO\ H[SUHVVHG IURP WKH SDWHUQDO DOOHOH DQG SRVLWLYHO\ UHJXODWHG E\ WKH 3:6,& )XUWKHUPRUH

PAGE 25

PLFH WKDW LQKHULW D SDWHUQDO GHOHWLRQ RI WKH 3:6,& DQG WKXV ODFN 8EHD DQWLVHQVH H[SUHVVLRQ KDYH DQ XSUHJXODWHG SDWHUQDO 8EHD DOOHOH UHODWLYH WR WKH PDWHUQDO DOOHOH DV FRPSDUHG WR WKH ZLOGW\SH FRQWUROV 7RJHWKHU WKHVH UHVXOWV VWURQJO\ VXJJHVW WKDW WKH SDWHUQDOO\ GHULYHG DQWLVHQVH WUDQVFULSW QHJDWLYHO\ UHJXODWHV WKH OHYHO RI SDWHUQDOO\ H[SUHVVHG 8EHD P51$ 7KH GLIIHUHQFHV EHWZHHQ WKH LPSULQWHG H[SUHVVLRQ RI SDWHUQDOO\ H[SUHVVHG JHQHV LQ WKH UHJLRQ DQG 8%($ VWURQJO\ VXJJHVW WKDW WKH PDWHUQDORQO\ H[SUHVVLRQ RI WKH 8%($ JHQH LV UHJXODWHG E\ D GLIIHUHQW PHFKDQLVP 7KH K\SRWKHVLV WKDW WKH WLVVXH VSHFLILF LPSULQWLQJ RI 8%($ LV DQ LQGLUHFW FRQVHTXHQFH RI WKH LPSULQWHG DQWLVHQVH WUDQVFULSW KDV EHHQ SUHYLRXVO\ SURSRVHG E\ WKLV ODE DQG RWKHUV 6SHFLILFDOO\ LQ WLVVXHV WKDW H[SUHVV WKH DQWLVHQVH WUDQVFULSW IURP WKH SDWHUQDO DOOHOH SURGXFWLRQ RI 8%($ P51$ IURP WKH SDWHUQDO DOOHOH LV LQKLELWHG SUHVXPDEO\ WKLV LQKLELWLRQ RFFXUV DW WKH WUDQVFULSWLRQDO OHYHOf +RZHYHU WKH PDWHUQDO 8%($ DOOHOH LV QRW SUHYHQWHG IURP SURGXFLQJ P51$ VR LQ WKHVH WLVVXHV PDWHUQDO VSHFLILF H[SUHVVLRQ LV REVHUYHG )LJ $f ,Q WLVVXHV WKDW GR QRW H[SUHVV WKH DQWLVHQVH WUDQVFULSW EXW GR H[SUHVV WKH 8%($ JHQH ELDOOHOLF H[SUHVVLRQ RI 8%($ LV REVHUYHG )LJ $f 7KH GDWD SUHVHQWHG KHUH XVLQJ WKH PRXVH PRGHO DUH FRQVLVWHQW ZLWK WKLV K\SRWKHVLV DQG IXUWKHU VXJJHVW WKDW WKH LPSULQWHG H[SUHVVLRQ RI 8%($ LV QRW D GLUHFW FRQVHTXHQFH RI WKH 8%($ SURPRWHU RU WKH $6,& 5DWKHU LW DSSHDUV WR EH WKH 3:6,& ZKLFK QHJDWLYHO\ UHJXODWHV WKH H[SUHVVLRQ RI SDWHUQDO 8%($ YLD WKH DQWLVHQVH WUDQVFULSW 7KHVH GDWD VXSSRUW D PRGHO LQ ZKLFK WKH SULPDU\ WDUJHWV RI LPSULQWLQJ LQ WKH 3:6$6 UHJLRQ DUH WKH SDWHUQDOO\ H[SUHVVHG WUDQVFULSWV RQH RI ZKLFK WKH 8%($ DQWLVHQVH WUDQVFULSW UHVXOWV LQ PDWHUQDOVSHFLILF H[SUHVVLRQ RI WKH 8%($ JHQH 7KH

PAGE 26

DGYDQWDJH RI WKLV PRGHO LV WKDW LW JUHDWO\ VLPSOLILHV WKH VHHPLQJO\ FRPSOH[ SDWWHUQ RI JHQH UHJXODWLRQ LQ WKH 3:6$6 UHJLRQ $ SRVLWLYH UHJXODWRU\ HOHPHQW WKH 3:6,& LV UHVSRQVLEOH IRU HVWDEOLVKLQJ DQG PDLQWDLQLQJ WKH SDWHUQDO PRGH RI JHQH H[SUHVVLRQ LQ VRPDWLF WLVVXHV )LJ %f $ QHJDWLYH UHJXODWRU\ HOHPHQW ZKLFK LV DVVXPHG WR EH WKH $6,& VHUYHV WR SUHYHQW DFWLYDWLRQ RI WKH SDWHUQDO SURJUDP RQ WKH PDWHUQDOO\ LQKHULWHG FKURPRVRPH SUHVXPDEO\ E\ EORFNLQJ 3:6,& IXQFWLRQ LQ WKH PDWHUQDO JHUPOLQH )LJ &f $V D UHVXOW GLIIHUHQW SDWWHUQV RI JHQH H[SUHVVLRQ DUH REVHUYHG IRU WKH WZR SDUHQWDO DOOHOHV 7KH SDWHUQDOO\ H[SUHVVHG JHQHV LQFOXGLQJ WKH 8%($ DQWLVHQVH WUDQVFULSW DUH H[SUHVVHG IURP WKH SDWHUQDO FKURPRVRPH EXW QRW IURP WKH PDWHUQDO FKURPRVRPH ,Q FRQWUDVW 8%($ LV fFRQVWLWXWLYHO\f H[SUHVVHG IURP WKH PDWHUQDO FKURPRVRPH LQ DOO FHOO W\SHV WKDW H[KLELW 8%($ H[SUHVVLRQ ZKHUHDV WKH SDWHUQDO 8%($ DOOHOH LV RQO\ fDOORZHGf WR EH H[SUHVVHG LQ FHOO W\SHV WKDW GR QRW H[SUHVV WKH DQWLVHQVH WUDQVFULSW 7KHUHIRUH DFFRUGLQJ WR WKLV PRGHO LW LV RQO\ WKH SDWHUQDOO\ H[SUHVVHG JHQHV WKDW DUH VXEMHFW WR UHJXODWLRQ E\ WKH ,& DV D ZKROH 7KLV UHGXFHV WKH FRPSOH[ UHJXODWLRQ LQ WKLV UHJLRQ WR D VLPSOH 212)) GHFLVLRQ WKH 3:6,& RSHUDWHV LQ WKH 21 PRGH XQOHVV VKXW 2)) E\ WKH $6,& HOHPHQW 7KHUHIRUH WKH NH\ WR XQGHUVWDQGLQJ LPSULQWLQJ LQ WKLV UHJLRQ ZLOO EH WR GHWHUPLQH KRZ WKH $6,& LQKLELWV WKH 3:6,& RQ WKH PDWHUQDO FKURPRVRPH )LQDOO\ DV WKH DQWLVHQVH WUDQVFULSW DSSHDUV WR EH WKH FDXVH RI WKH WLVVXH VSHFLILF LPSULQWLQJ RI 8%($ LW ZLOO EH LQWHUHVWLQJ WR GHWHUPLQH ZKDW UHJXODWRU\ HOHPHQWV UHVXOW LQ WKH H[SUHVVLRQ RI WKH DQWLVHQVH LQ VXFK D UHVWULFWHG FHOO SRSXODWLRQ LQ WKH EUDLQ ,W LV SRVVLEOH WKDW WKHUH DUH SRVLWLYH UHJXODWRU\ HOHPHQWV WKDW GULYH H[SUHVVLRQ RI WKH DQWLVHQVH WUDQVFULSW LQ RQO\ D IHZ FHOO W\SHV $OWHUQDWLYHO\ WKHUH PD\ EH QHJDWLYH UHJXODWRU\ HOHPHQWV WKDW SUHYHQW H[SUHVVLRQ RI WKH DQWLVHQVH LQ PRVW FHOO W\SHV $W WKLV SRLQW LW FDQ

PAGE 27

RQO\ EH VDLG WKDW WKH 3:6,& H[HUWV D SRVLWLYH HIIHFW RQ WKH WUDQVFULSWLRQ RI WKH DQWLVHQVH 7KHUH PD\ EH DGGLWLRQDO OHYHOV RI FRQWURO WKDW UHVWULFW WKH DQWLVHQVH WR IHZHU FHOO W\SHV WKDQ WKH RWKHU 3:6,& UHJXODWHG SDWHUQDOO\ H[SUHVVHG JHQHV LQ WKH UHJLRQ

PAGE 28

) US, ([RQ ([RQ L5 & %&DVWFf ESA ES ‘I ES 5 6Yf ESA ES A ES e ES % XQFXW VS, 1R57 PDWHUQDO & Lf§ F F ; ; [ ; ; ; SDWHUQDO & & ' & & ' & ES f§ r F W ‘ r L I PP r r ? PP f ‘; Y r ES ES )LJXUH 7KH DQWLVHQVH WUDQVFULSW LV H[SUHVVHG IURP WKH SDWHUQDOO\GHULYHG DOOHOH RQO\ $ 0DS RI WKH H[RQ WR H[RQ UHJLRQ RI 8EHD DQG VFKHPDWLF VKRZLQJ H[SHFWHG 3&5 SURGXFWV UHVWULFWLRQ VLWHV DQG IUDJPHQW VL]HV 7ULDQJOH OROOLSRSV UHSUHVHQW VS, VLWHV DQG KRUL]RQWDO DUURZV UHSUHVHQW SULPHUV XVHG IRU 57 DQG 3&5 % 7KH DQWLVHQVH WUDQVFULSW ZDV DPSOLILHG E\ 573&5 IURP QHRQDWDO EUDLQV IURP %&$67F ; 6Yf ) DQG 6Y ; %&$67Ff ) PLFH DQG E\ 3&5 IURP JHQRPLF '1$ IURP SDUHQWDO %&$67F DQG 6Y PLFH XVLQJ SULPHUV ) DQG L5 7KH SURGXFWV ZHUH GLJHVWHG ZLWK 7VSO DQG HOHFWURSKRUHVHG DORQJ ZLWK WKH XQFXW FRQWUROV RQ D b DJDURVH JHO & LQGLFDWHV WKH %&$67F VWUDLQ ZKLOH LQGLFDWHV WKH GRPHVWLFXV VWUDLQ 6Y $UURZV LQGLFDWH SHUWLQHQW IUDJPHQWV DQG WKHLU VL]HV

PAGE 29

PDWHUQDO SDWHUQDO JHQRW\SH 8EHD DQWLVHQVH 3DFWLQ )LJXUH 7KH DQWLVHQVH WUDQVFULSW LV QRW H[SUHVVHG LQ WKH $3:6,& PRXVH F'1$V ZHUH PDGH IURP D $3:6,& PRXVH DQG D ZLOGW\SH OLWWHUPDWH XVLQJ SULPHUV ) DQG WKH f cDFWLQ FRQWURO 3&5 ZDV GRQH XVLQJ SULPHUV ) DQG L5 7KH UHVXOWLQJ SURGXFWV ZHUH UXQ RQ D b DJDURVH JHO

PAGE 30

& %&DVWFf 6Yf ) W 7 ([RQ ([RQ 5 ES / ES ES ES ES XQFXW %VW &, LS, ) W W ([RQ ([RQ 5 ES ES -/W ES ES ES % XQFXW %UU&, US, 1R57 PDWHUQDO & & F & F & F & ; ; ; ; ; ; ; ; ; ; ; ; SDWHUQDO ' & ' & ' & ' & JHQRW\SH :W $ :W :W $ :W :O $ :W :W $ :W ES ES ES )LJXUH 3DWHUQDO 8EHD H[SUHVVLRQ LV LQFUHDVHG LQ $3:6,& PLFH $ %&$67F DQG 6Y(Y DOOHOHV DUH GLDJUDPPHG VKRZLQJ 3&5 SURGXFWV UHVWULFWLRQ VLWHV DQG IUDJPHQW VL]HV 7KH FLUFOH OROOLSRS LQGLFDWHV WKH ORFDWLRQ RI D %VW&O VLWH ZKLOH WKH WULDQJOH SRSVLFOH LQGLFDWHV WKH LS, VLWHV +RUL]RQWDO DUURZV VKRZ SULPHUV XVHG IRU 57 DQG 3&5 % 6HQVH 8EHD F'1$ ZDV PDGH XVLQJ 51$ GHULYHG IURP %&$67F ; 6Yf )f %&$67F ; $3:6 ,&f )M DQG 6Y ; %&$67Ff ) EUDLQV XVLQJ UDQGRP SULPHUV DQG 3&5 DPSOLILHG XVLQJ SULPHUV ) DQG 5 7KH VSOLFHG VHQVH EDQG ZDV JHO SXULILHG DQG HDFK VDPSOH ZDV GLYLGHG WKUHH ZD\V RQH SRUWLRQ ZDV OHIW XQFXW WKH VHFRQG ZDV FXW ZLWK %VW&O DQG WKH WKLUG ZDV FXW ZLWK 7VSO 7KHVH VDPSOHV ZHUH ORDGHG RQ D b DJDURVH JHO & LQGLFDWHV WKH %&$67F VWUDLQ ZKLOH LQGLFDWHV WKH GRPHVWLFXV VWUDLQ 6Y(Y )RU WKH JHQRW\SH ZW LQGLFDWHV D ZLOG W\SH PRXVH $ LQGLFDWHV D $3:6,& PRXVH $UURZV LQGLFDWH WKH ORFDWLRQ RI WKH IUDJPHQWV DQG WKHLU VL]HV

PAGE 31

)LJXUH 0RGHO RI JHQH UHJXODWLRQ LQ WKH 3:6$6 UHJLRQ $ ,Q WKH EUDLQ WZR GLIIHUHQW SDWWHUQV RI 8%($ H[SUHVVLRQ RFFXU ,Q FHOO W\SHV WKDW H[SUHVV WKH SDWHUQDO DQWLVHQVH WUDQVFULSW 8%($ LV LPSULQWHG WRS ER[f ,Q FHOO W\SHV WKDW GR QRW H[SUHVV WKH DQWLVHQVH WUDQVFULSW 8%($ LV ELDOOHOLFDOO\ H[SUHVVHG ERWWRP ER[f % 2Q WKH SDWHUQDOO\LQKHULWHG FKURPRVRPH WKH 3:6,& HVWDEOLVKHV WKH SDWHUQDO PRGH RI JHQH H[SUHVVLRQ & 2Q WKH PDWHUQDOO\LQKHULWHG FKURPRVRPH WKH $6,& SUHYHQWV DFWLYDWLRQ RI WKH SDWHUQDO SURJUDP SUHVXPDEO\ E\ EORFNLQJ 3:6,& IXQFWLRQ

PAGE 32

&+$37(5 ,035,17(' 75$16*(1(6 ,QWURGXFWLRQ 8VH RI 7UDQVJHQLF 0LFH WR 6WXG\ *HQH 5HJXODWLRQ 7UDQVJHQHV KDYH EHHQ XVHG WR VWXG\ UHJXODWLRQ RI JHQH H[SUHVVLRQ LQ PDQ\ V\VWHPV 7KH\ VHUYH WR LVRODWH UHJXODWRU\ HOHPHQWV DQG UHORFDWH WKHP WR DQ HFWRSLF ORFDWLRQ LQ WKH JHQRPH ZKHUH WKHLU ORFDO DFWLYLWLHV PD\ EH VHSDUDWHG IURP WKH LQIOXHQFH RI DGMDFHQW FRRSHUDWLQJ UHJXODWRU\ HOHPHQWV 2QH RI WKH VLPSOHVW LQVWDQFHV RI XVLQJ WUDQVJHQHV WR VWXG\ UHJXODWRU\ HOHPHQWV LQYROYHG WKH W\URVLQDVH JHQH $ NE \HDVW DUWLILFLDO FKURPRVRPH <$&f ZDV IRXQG WR IDLWKIXOO\ H[SUHVV WKH W\URVLQDVH JHQH 7KLV <$& ZDV VXEVHTXHQWO\ HQJLQHHUHG WR KDUERU D GHOHWLRQ RI D '1DVHO K\SHUVHQVLWLYH VLWH GHPRQVWUDWLQJ WKDW WKH VLWH LV QHFHVVDU\ IRU FRUUHFW H[SUHVVLRQ RI WKH W\URVLQDVH JHQH 7KH UHJXODWLRQ RI WKH JORELQ ORFXV LV DQRWKHU H[DPSOH WKDW KDV EHQHILWHG IURP WKH XVH RI WUDQVJHQHV ,Q WKH JORELQ ORFXV ORQJ GLVWDQFH UHJXODWRU\ HOHPHQWV GHWHUPLQH WKH WLVVXH VSHFLILFLW\ DQG GHYHORSPHQWDO WLPLQJ RI WKH H[SUHVVLRQ RI YDULRXV H[RQV LQ WKH ORFXV 6LPLODU WR WKH W\URVLQDVH ORFXV '1DVHO K\SHUVHQVLWLYH VLWHV ZHUH GHOHWHG IURP D <$& XVLQJ KRPRORJRXV UHFRPELQDWLRQ DQG ZHUH GHWHUPLQHG WR EH ORFXV FRQWURO UHJLRQV LQ YLYR E\ GHPRQVWUDWLQJ WKDW <$&V WKDW ZHUH PLVVLQJ RU KDG GXSOLFDWLRQV RI WKHVH K\SHUVHQVLWLYH VLWHV QR ORQJHU VKRZHG FRUUHFW WHPSRUDO H[SUHVVLRQ RI WKH JORELQ H[RQV 7KLV ZDV DFFRPSOLVKHG E\ PDNLQJ WUDQVJHQLF PLFH WKDW FRQWDLQHG VLQJOH FRSLHV RI WKH ZLOGW\SH RU PRGLILHG <$&n

PAGE 33

,PSULQWHG UHJLRQV DUH DOVR JRRG FDQGLGDWHV IRU VWXG\ XVLQJ ODUJH WUDQVJHQHV :XW] DQG FROOHDJXHV XVHG <$& WUDQVJHQHV WR H[DPLQH WKH UROH RI FKURPRVRPH ORFDWLRQ DQG WKH UROH RI DQ LQWURQLF &S* LVODQG LQ WKH LPSULQWHG H[SUHVVLRQ RI ,JIU D PDWHUQDOO\ H[SUHVVHG JHQH 7KH\ ZHUH DEOH WR VKRZ WKDW ,JIU LPSULQWLQJ LV QRW GHSHQGHQW RQ FKURPRVRPH ORFDWLRQ EXW WKDW LW LV FRPSOHWHO\ GHSHQGHQW RQ WKH LQWURQLF &S* LVODQG VXFK WKDW GHOHWLRQ RI WKH &S* LVODQG FDXVHV GHUHSUHVVLRQ RI WKH SDWHUQDO ,JIU DOOHOH 5HJXODWLRQ RI DQRWKHU ZHOO XQGHUVWRRG LPSULQWHG UHJLRQ WKH +,JI ORFXV KDV DOVR EHHQ VWXGLHG XVLQJ WUDQVJHQLF PLFH 7KH 7LOJKPDQ ODE ZHUH DEOH WR VKRZ WKDW PXOWLSOH FRS\ LQVHUWLRQV RI DQ +, WUDQVJHQH FRXOG H[KLELW SDUHQWRIRULJLQ GHSHQGHQW H[SUHVVLRQ SDWWHUQV DV ZHOO DV SURSHU '1$ PHWK\ODWLRQ SDWWHUQV EXW WKHVH SDWWHUQV ZHUH QRW PDLQWDLQHG ZKHQ WKH VDPH WUDQVJHQH ZDV SUHVHQW LQ VLQJOHFRS\ 7KH DXWKRUV UHDVRQHG WKDW WKH WUDQVJHQH FRQVWUXFWV ODFNHG VXIILFLHQW VHTXHQFH LQIRUPDWLRQ WR FRQIHU SURSHU LPSULQWHG H[SUHVVLRQ .DIIHU HW DO VXEVHTXHQWO\ LGHQWLILHG D NE EDFWHULDO DUWLILFLDO FKURPRVRPH %$&f WKDW H[KLELWHG WKH SURSHU SDWWHUQ RI LPSULQWHG JHQH H[SUHVVLRQ IRU WKH +,JI ORFXV LQ VLQJOHFRS\ WUDQVJHQLF OLQHV +DUN HW DO DOVR XVHG WKH VPDOOHU WUDQVJHQHV WKDW ZHUH QRW LPSULQWHG LQ VLQJOH FRS\ WR WHVW D PRGHO RI JHQH UHJXODWLRQ IRU WKH ,JI JHQH 7KH DXWKRUV XVHG D UHSRUWHU FRQVWUXFW WKDW FRQWDLQHG D SRUWLRQ RI WKH LPSULQWHG FRQWURO UHJLRQ ,&5f IROORZHG E\ D SRO\PRUSKLF FRS\ RI WKH +, JHQH DQG LWV HQKDQFHUV GHULYHG IURP 0XV PXVFXOXV VSUHWXV DQRWKHU LQWDFW ,&5 DQG D OXFLIHUDVH JHQH ,Q VXEVHTXHQW WUDQVJHQLF OLQHV D SRUWLRQ RI WKH ,&5 WKDW DFWHG DV D SXWDWLYH EDUULHU HOHPHQW VHSDUDWLQJ +, IURP LWV HQKDQFHUV ZDV GHOHWHG 7KHVH OLQHV VKRZHG KLJKHU H[SUHVVLRQ RI OXFLIHUDVH LQGLFDWLQJ WKDW WKH EDUULHU HOHPHQW DFWHG DV K\SRWKHVL]HG

PAGE 34

6LQJOH FRS\ WUDQVJHQHV FRXOG EH XVHG WR HOXFLGDWH VRPH RI WKH HOHPHQWV QHFHVVDU\ WR DFKLHYH SURSHU LPSULQWHG H[SUHVVLRQ LQ WKH 3:6 UHJLRQ ,GHQWLILFDWLRQ RI D WUDQVJHQH WKDW LV FDSDEOH RI GHPRQVWUDWLQJ FRUUHFW LPSULQWHG H[SUHVVLRQ LQ VLQJOH FRS\ ZRXOG HOXFLGDWH WKH PLQLPDO JHQHWLF LQIRUPDWLRQ WKDW LV VXIILFLHQW IRU LPSULQWLQJ LQ WKLV UHJLRQ 7KLV WUDQVJHQH FRXOG WKHQ EH XVHG WR PDNH YDULRXV SHUPXWDWLRQV DQG GHOLQHDWH ZKHWKHU LQGLYLGXDO FRPSRQHQWV DUH QHFHVVDU\ IRU HLWKHU SDWHUQDO H[SUHVVLRQ RU PDWHUQDO UHSUHVVLRQ )XUWKHUPRUH LI DQ HIILFLHQW PHWKRG IRU PRGLI\LQJ WKH WUDQVJHQH ZHUH GHYHORSHG D ODWHQW PDUN FRXOG EH DSSOLHG WR WKH WUDQVJHQH WKDW ZRXOG PDNH LW HDV\ WR GLVWLQJXLVK EHWZHHQ WUDQVJHQLF DQG HQGRJHQRXV H[SUHVVLRQ 7KH V\VWHP FRXOG WKHQ EH XVHG WR HDVLO\ LQWURGXFH QHZ FKDQJHV LQWR WKH WUDQVJHQH 3UHYLRXVO\ RXU ODE SURGXFHG VHYHQ OLQHV RI WUDQVJHQLF PLFH FDUU\LQJ HLWKHU D KXPDQ RU D PRXVH 3, FORQH 7KH KXPDQ 3, FORQH ZDV FKRVHQ EHFDXVH LW ZDV NQRZQ WR LQFOXGH WKH KXPDQ $QJHOPDQ V\QGURPH VPDOOHVW UHJLRQ RI GHOHWLRQ RYHUODS $6652f DV ZHOO DV WKH 3UDGHU:LOOL V\QGURPH VPDOOHVW UHJLRQ RI GHOHWLRQ RYHUODS 3:6652f )XUWKHUPRUH LW ZDV SRO\PRUSKLF WR WKH KRPRORJRXV PRXVH ORFXV WKDW LV V\QWHQLF WR TO OTO 7KH H[SUHVVHG SRO\PRUSKLVPV EHWZHHQ WKH KXPDQ 3, FORQH DQG WKH PRXVH ORFXV ZRXOG DOORZ XV WR HDVLO\ GLVWLQJXLVK H[SUHVVLRQ RULJLQDWLQJ IURP WKH WUDQVJHQH IURP WKDW FRPLQJ IURP WKH HQGRJHQRXV ORFXV 7KLV KXPDQ 3, FORQH ZDV QHYHU FRUUHFWO\ LPSULQWHG LQ WUDQVJHQLF OLQHV SURGXFHG IURP LW 7KH KXPDQ 3, FORQH ZDV H[SUHVVHG ZKHQ LW ZDV LQKHULWHG IURP ERWK IDWKHU DQG PRWKHU VXJJHVWLQJ WKDW ZKLOH WKH KXPDQ 3:6,& SRVLWLYH HOHPHQW LV IXQFWLRQDO LQ PRXVH WKH KXPDQ $6,& HOHPHQW ZKLFK LV SUHGLFWHG WR EH D QHJDWLYH UHJXODWRU\ HOHPHQW GRHV QRW EHKDYH DV RQH LQ PRXVH 7KH PRXVH 3, FORQH RQ WKH RWKHU KDQG FRQWDLQHG WKH 6QUSQ JHQH DV ZHOO DV WKH IXQFWLRQDOO\

PAGE 35

GHILQHG 3:6,& EXW VLQFH WKH $6,& KDV QRW EHHQ IXQFWLRQDOO\ RU SK\VLFDOO\ LGHQWLILHG LQ PRXVH ZH FRXOG QRW EH FHUWDLQ ZKHWKHU RU QRW LW FRQWDLQHG WKH $6,& 7ZR OLQHV ZHUH FUHDWHG IURP WKH PXULQH 3, FORQH 2QH ZDV PXOWLFRS\ DQG VKRZHG FRUUHFW LPSULQWHG H[SUHVVLRQ ZKLOH WKH RWKHU ZDV VLQJOH FRS\ DQG ZDV H[SUHVVHG UHJDUGOHVV RI WKH SDUHQW RIRULJLQ ,W ZDV K\SRWKHVL]HG WKDW WKH PRXVH 3, FORQH GLG QRW FRQWDLQ WKH HQWLUH $6,& LQGLFDWLQJ WKDW PRUH JHQHWLF LQIRUPDWLRQ VSHFLILFDOO\ f VHTXHQFH LV QHFHVVDU\ WR LPSULQW D WUDQVJHQH LQ VLQJOH FRS\ 7ZR PXULQH EDFWHULDO DUWLILFLDO FKURPRVRPH %$&f FORQHV ZHUH LGHQWLILHG WKDW ZHUH FDSDEOH RI EHLQJ H[SUHVVHG LQ WKH DSSURSULDWH SDUHQWRIRULJLQ GHSHQGHQW PDQQHU 7KHVH %$& FORQHV VSHFLI\ D PLQLPDO UHJLRQ WKDW LV VXIILFLHQW WR FRQIHU FRUUHFW LPSULQWHG H[SUHVVLRQ DW DQ HFWRSLF ORFDWLRQ LQ WKH JHQRPH 0DWHULDOV DQG 0HWKRGV 6FUHHQLQJ WKH %$& /LEUDULHV 7KH 5HVHDUFK *HQHWLFV +XQWVYLOOH $/f %$& OLEUDU\ ZDV LQLWLDOO\ VFUHHQHG IRU %$& FORQHV 7KLV OLEUDU\ ZDV PDGH IURP WKH 6Y VWUDLQ RI PRXVH 7KH OLEUDU\ FRQVLVWHG RI ILOWHUV HDFK FDUU\LQJ XQLTXH FORQHV ZLWK DQ DYHUDJH LQVHUW VL]H RI NE VSRWWHG LQ GXSOLFDWH RQWR GLIIHUHQW PHPEUDQHV $ 3&5JHQHUDWHG SUREH WKDW LQFOXGHG WKH ILUVW H[RQ RI 6QUSQ DQG D NE (FR5,=VFR59 UHVWULFWLRQ IUDJPHQW WKDW ZDV NE f RI 6QUSQ ZDV XVHG WR VFUHHQ WKH OLEUDU\ 3ULRU WR K\EULGL]DWLRQ %$& PHPEUDQHV ZHUH ZDVKHG ZLWK P/ RI ; 66& DQG b 6'6 DW URRP WHPSHUDWXUH IRU PLQXWHV 7KH PHPEUDQHV ZHUH WKHQ ULQVHG WZLFH ZLWK PO RI ; 66& IRU PLQXWHV DW URRP WHPSHUDWXUH DQG K\EULGL]HG DFFRUGLQJ WR WKH 5HVHDUFK *HQHWLFV SURWRFRO %ULHIO\ WKH PHPEUDQHV ZHUH SUHK\EULGL]HG

PAGE 36

LQ UROOHU ERWWOHV ZLWK PHPEUDQHV SHU ERWWOH HDFK VHSDUDWHG E\ RQH VKHHW RI )ORZ 0HVK 'LYHUVILHG %LRWHFK %RVWRQ 0$f LQ PO RI +\SHU+\E 5HVHDUFK *HQHWLFV +XQWVYLOOH $/f SHU ERWWOH DW r & IRU PLQXWHV $W OHDVW FRXQWV RI HDFK SUREH ZHUH ERLOHG IRU PLQ VQDS FRROHG RQ LFH DQG WKHQ DGGHG WR PO RI +\SHU+\E WKDW ZDV SUHZDUPHG WR r & 2QH PO RI K\EULGL]DWLRQ VROXWLRQ ZDV DGGHG WR HDFK RI WKH UROOHU ERWWOHV DQG WKH PHPEUDQHV ZHUH DOORZHG WR K\EULGL]H IRU KRXUV DW r & 7KH PHPEUDQHV ZHUH ZDVKHG LQ WKH UROOHU ERWWOHV WKUHH WLPHV IRU PLQXWHV DW r & ZLWK PO ,; 66& DQG b 6'6 7KH\ ZHUH WKHQ UHPRYHG IURP WKH ERWWOHV DQG ZDVKHG WZLFH PRUH DW r & ZLWK PO RI ,; 66& DQG b 6'6 IRU PLQXWHV )LQDOO\ WKH PHPEUDQHV ZHUH ULQVHG ZLWK ,; 66& DW URRP WHPSHUDWXUH 7KH PHPEUDQHV ZHUH WKHQ ZUDSSHG LQ FHOORSKDQH DQG H[SRVHG WR ILOP ;$5 .RGDNf RYHUQLJKW DW r & 3RVLWLYH FORQHV ZHUH LGHQWLILHG IROORZLQJ WKH PDQXIDFWXUHUfV LQVWUXFWLRQV DQG WKH IROORZLQJ FORQHV ZHUH RUGHUHG % + DQG ) 7KH 5RVZHOO 3DUN &DQFHU ,QVWLWXWH 53&,f 53&, %$& OLEUDU\ ZDV DOVR VFUHHQHG IRU SRWHQWLDO LPSULQWHG WUDQVJHQHV XVLQJ WZR SUREHV WKH NE (FR 5, (FR.9 IUDJPHQW O\LQJ NE f RI 6QUSQ DQG D NE 6DFO1RWO IUDJPHQW WKDW OLHV NE f RI 6QUSQ 7KLV OLEUDU\ LV PDGH IURP WKH &%/VWUDLQ RI PRXVH ZLWK DQ DYHUDJH LQVHUW VL]H RI NE DQG LV WKH WHPSODWH OLEUDU\ IRU WKH 1,+ PRXVH JHQRPH VHTXHQFLQJ HIIRUWV 7KH 53&, OLEUDU\ FRQVLVWV RI ILOWHUV HDFK UHSUHVHQWLQJ LQGHSHQGHQW FORQHV WKDW KDYH EHHQ VSRWWHG LQ GXSOLFDWH 7R VFUHHQ WKLV OLEUDU\ WKH ILOWHUV ZHUH ILUVW ULQVHG IRU PLQXWHV DW URRP WHPSHUDWXUH LQ ; 66& 7KH %$& OLEUDU\ ILOWHUV ZHUH SODFHG LQWR UROOHU ERWWOHV ILYH PHPEUDQHV SHU ERWWOH UROOHG ZLWK LQWHUPLWWHQWO\ ZLWK VKHHWV RI )ORZ 0HVK 7KH ILOWHUV ZHUH SUHK\EULGL]HG IRU KRXUV DW r & ZLWK PO RI &KXUFK EXIIHU

PAGE 37

P0 ('7$ 0 1D+3 S+ b 6'6 DQG b %6$f $SSUR[LPDWHO\ KDOI RI WKH SUHK\EULGL]DWLRQ VROXWLRQ ZDV SRXUHG RII 7KH ERLOHG VQDS FRROHG SUREHV DW OHDVW FRXQWV HDFKf ZHUH WKHQ DGGHG DQG WKH PHPEUDQHV ZHUH K\EULGL]HG RYHUQLJKW DW r& 7KH QH[W PRUQLQJ WKH PHPEUDQHV ZHUH ILUVW ZDVKHG WLPHV IRU PLQXWHV HDFK LQ WKH ERWWOH DW r & ZLWK PO SHU WXEH RI :DVK P0 ('7$ P0 1D+3 S+ b 6'6 DQG b %6$f 7KH ILOWHUV ZHUH WKHQ UHPRYHG IURP WKH ERWWOHV DQG ZDVKHG WLPHV IRU PLQXWHV HDFK DW r & ZLWK :DVK ,, P0 ('7$ P0 1D+3 S+ DQG b 6'6f 7KH PHPEUDQHV ZHUH ZUDSSHG LQ FHOORSKDQH DQG H[SRVHG WR ILOP RYHUQLJKW DQG IRU KRXUV HDFK DW r & 3RVLWLYH FORQHV ZHUH LGHQWLILHG IROORZLQJ WKH PDQXIDFWXUHUfV LQVWUXFWLRQ DQG RUGHUHG IURP 53&, 7KH IROORZLQJ %$& FORQHV ZHUH REWDLQHG IURP WKLV VFUHHQ 1 & 0 0 & '% $. $ 3 0 % DQG 3UREH 3UHSDUDWLRQ 3UREHV ZHUH ODEHOHG XVLQJ WKH 3ULPH,W ,, NLW 6WUDWDJHQH /D -ROOD &$f ZLWK PLQRU PRGLILFDWLRQV 3UREH '1$ QJf ZDV ERLOHG IRU PLQXWHV LQ WKH SUHVHQFH RI UDQGRP KH[DPHUV 7KH '1$KH[DPHU PL[ ZDV FRROHG RQ LFH DQG ; UHDFWLRQ EXIIHU ZDV DGGHG DORQJ ZLWK S&L RI D3G&73 DQG 8 RI H[Rn NOHQRZ 7KH ODEHOLQJ UHDFWLRQ ZDV SODFHG DW r & IRU PLQXWHV $IWHU ODEHOLQJ ZDV FRPSOHWH WKH SUREH ZDV SXULILHG XVLQJ WKH QXFOHRWLGH UHPRYDO NLW 4,$*(1f DQG HOXWHG LQ SL RI ZDWHU 3XULILHG SUREHV ZHUH ERLOHG IRU PLQXWHV DQG VQDS FRROHG RQ LFH SULRU WR XVH LQ K\EULGL]DWLRQ

PAGE 38

9HULILFDWLRQ RI %$& &ORQHV 6LQJOH %$& FRORQLHV ZHUH WHVWHG WR YHULI\ WKDW WKH FORQH UHSUHVHQWHG D %$& LQVHUW GHULYHG IURP WKH 6QUSQ ORFXV )RXU VLQJOH FRORQLHV IURP HDFK %$& ZHUH VWUHDNHG LQ GXSOLFDWH RQWR /XULD EURWK SODWHV WKDW ZHUH VXSSOHPHQWHG ZLWK FKORUDPSKHQLFRO /%&$f 7KH SODWHV ZHUH RYHUOD\HG ZLWK D Q\ORQ ILOWHU DQG JURZQ RYHUQLJKW DW r & 7KH QH[W PRUQLQJ WKH EDFWHULD ZHUH O\VHG RQ WKH ILOWHUV DV IROORZV ILUVW WKH ILOWHUV ZHUH VRDNHG LQ DONDOL VROXWLRQ 0 1D&O DQG 1 1D2+f IRU PLQXWHV IROORZHG E\ QHXWUDOL]LQJ VROXWLRQ 0 1D&O DQG 0 7ULV S+ f IRU PLQXWHV DQG ILQDOO\ ULQVHG LQ ; 66& IRU PLQXWH 7KH ILOWHUV ZHUH WKHQ SUHK\EULGL]HG LQ &KXUFK EXIIHU IRU RQH KRXU DW r & DQG WKHQ RQH SODWH ZDV K\EULGL]HG ZLWK WKH f 6QUSQ SUREH ZKLOH WKH RWKHU ZDV K\EULGL]HG ZLWK WKH f 6QUSQ SUREH 8SRQ ZDVKLQJ DQG OD\LQJ WKH ILOWHUV WR ILOP WKH UHVXOWV ZHUH XVHG WR GHWHUPLQH ZKHWKHU RU QRW WKH FORQH ZDV GHULYHG IURP WKH 6QUSQ ORFXV DQG ZKHWKHU RU QRW WKH FORQH HQFRPSDVVHG WKH f RU f IODQNLQJ UHJLRQV RI 6QUSQ (QG 6HTXHQFLQJ %$& &ORQHV 7KH %$& FORQHV ZHUH HQG VHTXHQFHG XVLQJ WKH ELJ G\H WHUPLQDWLRQ UHDFWLRQ WR REWDLQ VHTXHQFHV XQLTXH WR WKH PRXVH JHQRPLF '1$ LQVHUW 5HDFWLRQV ZHUH SHUIRUPHG RQ PJ RI %$& '1$ WKDW KDG EHHQ VKHDUHG E\ SDVVLQJ LW ILYH WLPHV WKURXJK D JDXJH QHHGOH XVLQJ D PRGLILHG YHUVLRQ RI WKH PDQXIDFWXUHUfV LQVWUXFWLRQV ZLWK SO RI VHTXHQFLQJ EXIIHU S RI ELJ G\H SPRO RI SULPHU DQG P0 0J&O 7KH UHDFWLRQV ZHUH VXEMHFWHG WR DQ LQLWLDO PLQXWH F\FOH DW r & IROORZHG E\ F\FOHV RI r & IRU VHFRQGV r & IRU VHFRQGV DQG r & IRU PLQXWHV 7KH FRPSOHWHG UHDFWLRQV ZHUH SXULILHG IURP IUHH QXFOHRWLGHV XVLQJ 3HUIRUPD '75 *HO )LOWUDWLRQ &ROXPQV (GJH

PAGE 39

%LRV\VWHPVf GULHG DQG VHTXHQFHG E\ WKH 8QLYHUVLW\ RI )ORULGD &HQWHU IRU 0DPPDOLDQ *HQHWLFV 6HTXHQFLQJ &RUH 3XOVH)LHOG *HO (OHFWURSKRUHVLV 3XOVHILHOG JHO HOHFWRUSKRUHVLV ZDV FDUULHG RXW WR FUHDWH D URXJK UHVWULFWLRQ PDS DQG WLOLQJ SDWKZD\ IRU WKH %$& FORQHV %$& '1$V GLJHVWHG ZLWK WKH DSSURSULDWH HQ]\PHV ZHUH HOHFWURSKRUHVHG RQ D b JHQHWLF WHFKQRORJ\ JUDGH DJDURVH JHO 1XVLHYH )0&f PDGH ZLWK ,; 7%( EXIIHU 6DPSOHV ZHUH PL[HG ZLWK ; ILFROO ORDGLQJ G\H DQG UDQ DW 9 ZLWK D VZLWFK WLPH RI VHFRQGV IRU KRXUV 7KLV SURYLGHG UHVROXWLRQ RI EDQGV IURP NE 7KH JHO ZDV VWDLQHG ZLWK D GLOXWH HWKLGLXP EURPLGH VROXWLRQ SKRWRJUDSKHG DQG EORWWHG DV GHVFULEHG EHORZ 6RXWKHUQ %ORW $JDURVH JHOV FDUU\LQJ SJ RI GLJHVWHG JHQRPLF '1$ RU SJ RI GLJHVWHG %$& '1$ ZHUH SKRWRJUDSKHG DQG 89 QLFNHG IRU PLQXWHV 7KH JHO ZDV WKHQ VRDNHG LQ DONDOL VROXWLRQ IRU PLQXWHV IROORZHG E\ VRDNLQJ LQ QHXWUDOL]LQJ VROXWLRQ IRU PLQXWHV 7KH JHO ZDV WKHQ WUDQVIHUUHG WR +\ERQG Q\ORQ PHPEUDQH $PHUVKDPf LQ ; 66& RYHUQLJKW 7KH PHPEUDQH ZDV WKHQ ULQVHG LQ ; 66& DQG EDNHG DW r & IRU KRXUV +\EULGL]DWLRQ ZDV FDUULHG RXW DFFRUGLQJ WR WKH PHWKRG RI &KXUFK DQG *LOEHUW 0HPEUDQHV ZHUH SUHK\EULGL]HG LQ PO RI &KXUFK EXIIHU IRU KRXU DW r & 7KH SUHK\EULGL]DWLRQ VROXWLRQ ZDV SRXUHG RII DQG UHSODFHG ZLWK PO RI IUHVK VROXWLRQ DQG WKH ERLOHG DQG FRROHG SUREH +\EULGL]DWLRQ FRQWLQXHG RYHUQLJKW DW r & :DVKLQJ ZDV FDUULHG RXW WKUHH WLPHV LQ ;66& DQG b 6'6 DW r & IRU PLQXWHV HDFK

PAGE 40

7UDQVJHQLF 0LFH 3URGXFWLRQ )RU SURGXFWLRQ RI WUDQVJHQLF PLFH %$& '1$ ZDV SUHSDUHG E\ ODUJH VFDOH SODVPLG SUHSDUDWLRQ XVLQJ WKH DONDOLQH O\VLV PHWKRG )LUVW ORJ SKDVH FXOWXUHV RI %$& FXOWXUH JURZQ LQ /%&$ ZHUH FHQWULIXJHG IRU PLQXWHV DW USP WR SHOOHW WKH FHOOV 7KH VXSHUQDWDQW ZDV SRXUHG RII DQG WKH SHOOHW ZDV UHVXVSHQGHG LQ *7( VROXWLRQ P0 JOXFRVH P0 7ULV S+ DQG P0 ('7$f SOXV O\VR]\PH 7KH VXVSHQVLRQ ZDV WKHQ O\VHG LQ 1 1D2+ DQG b 6'6 $IWHU DGGLWLRQ RI WKH O\VLV VROXWLRQ WKH O\VDWH ZDV QHXWUDOL]HG LQ 0 SRWDVVLXP DFHWDWH DQG SRXUHG WKURXJK FRWWRQ JDX]H LQWR 2DN 5LGJH WXEHV %$& '1$ ZDV SUHFLSLWDWHG ZLWK HWKDQRO DQG WKH SHOOHW ZDV UHVXVSHQGHG LQ PO 7( ZLWK _[JPO 51$VH $ DQG DOORZHG WR LQFXEDWH DW r & IRU KRXU &HVLXP FKORULGH DQG HWKLGLXP EURPLGH ZHUH DGGHG WR WKH '1$ VROXWLRQ DQG WKH VROXWLRQ ZDV ORDGHG LQWR D KHDW VHDODEOH WXEH 7KH WXEH ZDV VHDOHG DQG FHQWULIXJHG DW USP IRU KRXUV %$& VXSHUFRLOV ZHUH YLHZHG ZLWK D 89 OLJKW DQG ERWK QLFNHG DQG VXSHUFRLOHG EDQGV ZHUH SXOOHG 7KH '1$ ZDV H[WUDFWHG ZLWK WHUWEXWDQRO XQWLO WKH HWKLGLXP EURPLGH ZDV FRPSOHWHO\ GHSOHWHG IURP WKH %$& '1$ 7KH '1$ ZDV WKHQ GLDO\]HG WZLFH DJDLQVW / 7( EXIIHU XVLQJ GLDO\VLV WXELQJ IRU KRXUV HDFK 7KH FRQFHQWUDWLRQ RI WKH %$& '1$ ZDV PHDVXUHG E\ VSHFWURSKRWRPHWHU DQG WKHQ GLOXWHG WR QJSO IRU PLFURLQMHFWLRQ 7UDQVJHQLF PLFH ZHUH PDGH E\ SURQXFOHDU LQMHFWLRQ LQWR RRF\WHV WKDW ZHUH REWDLQHG IURP VXSHURYXODWHG IHUWLOL]HG )9%1IHPDOH PLFH 7KH IHUWLOL]HG LQMHFWHG RRF\WHV ZHUH WKHQ LPSODQWHG LQWR %'f ) IHPDOHV WKDW ZHUH PDGH SVHXGRSUHJQDQW E\ PDWLQJ WKHP ZLWK YDVHFWRPL]HG %'f ) PDOHV

PAGE 41

0RXVH +XVEDQGU\ $W ZHHNV RI DJH DSSUR[LPDWHO\ PP RI WDLO ZDV FOLSSHG IURP HDFK PRXVH DQG WKH HDU ZDV SXQFKHG IRU LGHQWLILFDWLRQ *HQRPLF '1$ ZDV SUHSDUHG IURP WKH WDLO SLHFH E\ LQFXEDWLRQ LQ WDLO O\VLV EXIIHU P0 7ULV S+ P0 ('7$ b 6'6 DQG P0 1D&Of ZLWK QJSO SURWHLQDVH RYHUQLJKW DW r & 7KH WDLO O\VDWH ZDV H[WUDFWHG ZLWK SKHQRO FKORURIRUP LVRDP\O DOFRKRO f DQG WKHQ SUHFLSLWDWHG ZLWK HWKDQRO 7KH WDLO '1$ ZDV VFUHHQHG IRU WKH SUHVHQFH RI WKH WUDQVJHQH E\ 3&5 XVLQJ ERWK HQG VHTXHQFHV IURP WKH %$& 0RXVH 6WUDLQV $3:6,& PLFH PDLQWDLQHG RQ WKH &%/EDFNJURXQG ZHUH GHYHORSHG E\
PAGE 42

YHFWRU DUPV DQG WKH PRXVH '1$ LQVHUW 'HVSLWH WKH IDLOXUH WR ILQG WKHVH MXQFWLRQ IUDJPHQWV DQ DWWHPSW ZDV PDGH WR PDNH WUDQVJHQLF PLFH XVLQJ WKH <$& EXW LW ZDV QRW VXFFHVVIXO 8OWLPDWHO\ WKH DWWHQWLRQ ZDV IRFXVHG RQ %$&V VLQFH FDQGLGDWH FORQHV IRU LPSULQWHG WUDQVJHQHV KDG EHHQ LGHQWLILHG ZLWK RXU VFUHHQ ,W ZDV VXUPLVHG WKDW WKH <$& ZDV QRW LGHDO IRU XVH VLQFH D <$& RI WKDW VL]H LV GLIILFXOW WR FKDUDFWHUL]H DQG PDQLSXODWH 6Y %$& /LEUDU\ 6FUHHQ %$& FORQHV ZHUH WKH EHVW VXLWHG IRU WUDQVJHQLF VWXGLHV VLQFH WKH\ DUH XVXDOO\ ODUJHU WKDQ WKH 3, FORQHV WKDW ZHUH SUHYLRXVO\ VKRZQ QRW WR FRQWDLQ VXIILFLHQW VHTXHQFH LQIRUPDWLRQ WR EH LPSULQWHG LQ VLQJOH FRS\ :KLOH WKH\ DUH ODUJHU WKDQ 3, FORQHV %$& FORQHV DUH VPDOOHU WKDQ <$&V DQG DUH PDLQWDLQHG DV VXSHUFRLOV PDNLQJ WKHP PRUH UHVLVWDQW WR VKHDULQJ 7KH\ DOVR KDYH WKH DGYDQWDJH RYHU <$&V RI EHLQJ SURSDJDWHG LQ ( FROL UDWKHU WKDQ 6 FHUHYLVLDH ZKLFK PDNHV WKHLU LVRODWLRQ DQG KDQGOLQJ PXFK HDVLHU 0RVW LPSRUWDQWO\ %$&V DUH SURSDJDWHG LQ 5HF$ FHOOV DQG DUH OHVV OLNHO\ WR VXIIHU UHDUUDQJHPHQW GXULQJ PDQLSXODWLRQ DQG SURSDJDWLRQ WKDQ <$&V 7UDGLWLRQDOO\ WKH DGYDQWDJH RI XVLQJ <$&V DV RSSRVHG WR %$&V ZDV WKH DELOLW\ WR PDNH PRGLILFDWLRQV E\ H[SORLWLQJ WKH HIILFLHQW KRPRORJRXV UHFRPELQDWLRQ LQ 6 FHUHYLVLDH +RZHYHU HDUO\ LQ WKLV SURMHFW D SUHOLPLQDU\ PHWKRG RI %$& PRGLILFDWLRQ XVLQJ KRPRORJRXV UHFRPELQDWLRQ ZDV SXEOLVKHG PDNLQJ LW SRVVLEOH WR PDNH VLPLODU FKDQJHV WR %$& FORQHV 7KH ILUVW %$& OLEUDU\ WKDW ZH VFUHHQHG ZDV GHULYHG IURP WKH 6Y(Y VWUDLQ RI PRXVH DQG KDG DQ DYHUDJH LQVHUW VL]H RI NE 8VLQJ D PL[WXUH RI WKH 6QUSQ H[RQ SUREH DQG D NE VFR5,=FR59 WKDW OLHV NE f RI 6QUSQ DV SUREHV LQ WKLV VFUHHQ IRXU %$&V ZHUH LVRODWHG % + DQG ) 7KHVH %$& FORQHV ZHUH HDFK VWUHDNHG WR /%&$ SODWHV WR REWDLQ VLQJOH FRORQLHV )RXU VLQJOH FRORQLHV UHSUHVHQWLQJ

PAGE 43

HDFK %$& FORQH ZHUH JURZQ LQ PO RYHUQLJKW FXOWXUHV DQG '1$ ZDV LVRODWHG IURP HDFK FXOWXUH 7KH %$& '1$ ZDV FXW ZLWK eFR5, DQG D 6RXWKHUQ EORW ZDV SHUIRUPHG 7KH EORW ZDV ILUVW SUREHG ZLWK D NE 6DFO1RWO IUDJPHQW WKDW \LHOGHG D ODUJH IUDJPHQW DERXW NE f RI 6QUSQ DQG ODWHU VWULSSHG DQG UHSUREHG ZLWK WKH f 6QUSQ SUREH 7ZR %$&V ) DQG + VSDQQHG f 6QUSQ EXW WHUPLQDWHG VKRUW RI WKH f 6QUSQ SUREH ZKLOH WKH RWKHU WZR %$&V % DQG FRQYHUVHO\ K\EULGL]HG ZLWK WKH f SUREH EXW DSSHDUHG WR ODFN f VHTXHQFHV )LJ f $OO IRXU %$&V ZHUH HQG VHTXHQFHG 1H[W WKH %$& FORQHV ZHUH HDFK FXW ZLWK 6DLO 1RWO 6DF,, RU D FRPELQDWLRQ RI WKH HQ]\PHV DQG VXEMHFWHG WR SXOVHILHOG JHO HOHFWRUSKRUHVLV DQG 6RXWKHUQ EORW 8VLQJ WKH f DQG f SUREHV SUREHV LQWHUJHQLF WR WKH 6QUSQ JHQH DQG SUREHV JHQHUDWHG XVLQJ WKH HQG VHTXHQFHV IURP HDFK %$& WKH DSSUR[LPDWH ERXQGDULHV DV ZHOO DV D URXJK UHVWULFWLRQ PDS IRU HDFK %$& FORQH ZDV GHWHUPLQHG )ROORZLQJ WKLV DQDO\VLV RQO\ WZR %$&V ) DQG % UHPDLQHG LQWHUHVWLQJ DV SRWHQWLDO LPSULQWHG WUDQVJHQH FDQGLGDWHV 7KH ) FORQH FRQWDLQHG WKH PRVW f VHTXHQFH RI WKH %$& FORQHV EXW LW WHUPLQDWHG EHIRUH WKH SRO\DGHQ\ODWLRQ VLJQDO RI WKH 6QUSQ JHQH 7KLV ZDV D SUREOHP EHFDXVH LW FRXOG FDXVH DQ H[SUHVVHG 6QUSQ WUDQVFULSW WR EH WDUJHWHG IRU GHJUDGDWLRQ 7KH RWKHU %$& RI LQWHUHVW % FRQWDLQHG WKH HQWLUH 6QUSQ JHQH EXW GLG QRW FRQWDLQ HQRXJK f VHTXHQFH 6LQFH QHLWKHU %$& ZDV LGHDO IRU XVH DV DQ LPSULQWHG WUDQVJHQH D SODQ ZDV PDGH WR MRLQ WKHVH WZR %$&V XVLQJ WKH UHFHQWO\ GHYHORSHG %$& PRGLILFDWLRQ VFKHPH WR SURGXFH WKH DGGLWLRQDO f VHTXHQFH DV ZHOO DV WKH FRPSOHWH 6QUSQ WUDQVFULSW 5HF$ 0HGLDWHG +RPRORJRXV 5HFRPELQDWLRQ 7KH ILUVW PHWKRG DWWHPSWHG ZDV DQDORJRXV WR WKH \HDVW WZRVWHS KRPRORJRXV UHFRPELQDWLRQ SURFHGXUH DV GHVFULEHG E\ WKH 1DW +HLQW] JURXS ,W UHYROYHG DURXQG

PAGE 44

VXSSO\LQJ WKH EDFWHULDO 5HF$ JHQH ZKLFK ZDV PLVVLQJ LQ WKH %$& KRVW VWUDLQ RQ D VHOHFWDEOH HSLVRPH 7KH EDFWHULDO 5HF$ JHQH ZDV SURYLGHG RQ D SODVPLG ZLWK D WHPSHUDWXUH VHQVLWLYH RULJLQ RI UHSOLFDWLRQ 7KH SODVPLG FRXOG EH SRVLWLYHO\ VHOHFWHG IRU XVLQJ WHWUDF\FOLQH UHVLVWDQFH 7KH SODVPLG FRXOG DOVR EH VXEMHFWHG WR QHJDWLYH VHOHFWLRQ E\ SODWLQJ RQ SODWHV FRQWDLQLQJ IXVDULF DFLG VLQFH IXVDULF DFLG LV WR[LF WR FHOOV WKDW SURGXFH WKH WHWUDF\FOLQH UHVLVWDQFH JHQH 7KH LGHD EHKLQG WKLV UHFRPELQDWLRQ VFKHPH ZDV WKDW RQH FRXOG VXEFORQH WKH GHVLUHG PRGLILFDWLRQ RU VHTXHQFH FKDQJH IODQNHG E\ f DQG f KRPRORJ\ DUPV RI DW OHDVW ES LQWR WKLV WHPSHUDWXUH VHQVLWLYH UHFRPELQDWLRQ YHFWRU :KHQ WUDQVIRUPHG LQWR WKH %$& VWUDLQ SRVLWLYH VHOHFWLRQ IRU WKH PRGLILFDWLRQ FRQVWUXFW ZRXOG LGHQWLI\ FRORQLHV LQ ZKLFK LQVHUWLRQ RI WKH FRQVWUXFW KDG RFFXUUHG 7KHQ QHJDWLYH VHOHFWLRQ ZLWK IXVDULF DFLG ZRXOG FDXVH UHVROXWLRQ RI WKH LQWHJUDQW LQWR RQH RI WZR SRVVLEOH FRQIRUPDWLRQV 2QH SRVVLEOH FRQIRUPDWLRQ LV WKDW LQ ZKLFK WKH GHVLUHG FKDQJH KDV EHHQ PDGH DQG WKH RWKHU FRQIRUPDWLRQ UHFRYHUV WKH XQPRGLILHG %$& 7KH VFKHPH WR MRLQ WKH WZR SHUWLQHQW %$&V LQYROYHG XVLQJ KRPRORJRXV UHFRPELQDWLRQ WR LQVHUW D QHRP\FLQ UHVLVWDQFH FDVVHWWH IODQNHG E\ OR[3 VLWHV DSSUR[LPDWHO\ NE XSVWUHDP RI WKH 6QUSWL JHQH RQ WKH ) %$& $ NE 6DLO IUDJPHQW IURP WKH PRGLILHG ) %$& FRXOG WKHQ EH H[FLVHG DQG UHFRPELQHG LQWR WKH % %$& XVLQJ RQH DUP RI KRPRORJ\ DQFKRUHG LQ WKH %$& YHFWRU DQG WKH RWKHU HQG DQFKRUHG QHDU WKH ILUVW H[RQ RI 6QUSQ 7KH QHRP\FLQ UHVLVWDQFH JHQH FRXOG WKHQ EH GHOHWHG XVLQJ HUH UHFRPELQDVH OHDYLQJ D VLQJOH OR[3 VLWH 7KH UHVXOWLQJ %$& ZRXOG KDYH NE VHTXHQFH f RI 6QUSQ DQG NE f RI 6QUSQ DQG ZRXOG EH D JRRG FDQGLGDWH IRU DQ LPSULQWHG WUDQVJHQH )LJ f :KLOH WKLV PHWKRG KDV EHHQ VXFFHVVIXO LQ RWKHU ODEV LW ZDV QRW VR LQ WKLV FDVH GXH WR WKH GLIILFXOW\ RI VXEFORQLQJ WKH LQLWLDO UHFRPELQDWLRQ

PAGE 45

FRQVWUXFW LQWR D ORZFRS\ QXPEHU SODVPLG WKDW LV WHPSHUDWXUHVHQVLWLYH DQG DOUHDG\ TXLWH ODUJH NEf 5HF(7 0HGLDWHG +RPRORJRXV 5HFRPELQDWLRQ 7KH VHFRQG PHWKRG SLRQHHUHG E\ )UDQFLV 6WHZDUWfV JURXS ZDV EDVHG RQ WKH 5HF(7 V\VWHP LQ ODPEGD SKDJH 7KLV V\VWHP LV UHSXWHGO\ PXFK PRUH HIILFLHQW WKDQ WKDW RI 5HF$ DQG UHTXLUHV VPDOOHU KRPRORJ\ DUPV 7KH 5HF(7 PHGLDWHG UHFRPELQDWLRQ FDQ EH FDUULHG RXW XVLQJ RQO\ ODUJH ROLJRV DQG WKH 5HF(7 SODVPLG HOHFWURSRUDWHG LQWR WKH %$& FRQWDLQLQJ EDFWHULDO VWUDLQ 7KH 5HF( DQG 5HF7 JHQH DUH H[SUHVVHG IURP WKH S%$' SURPRWHU PDNLQJ LWV H[SUHVVLRQ DUDELQRVH LQGXFLEOH 7KLV PHWKRG QHYHU ZRUNHG DV WKH ZURQJ SODVPLGV ZHUH VHQW )ROORZLQJ WKLV DWWHPSW %$& PRGLILFDWLRQ ZDV SRVWSRQHG WR EHJLQ WKH VHDUFK IRU D PRUH VXLWDEOH %$& WUDQVJHQH &%/%$& /LEUDU\ 6FUHHQ 7KH 53&, %$& OLEUDU\ ZDV VFUHHQHG VLQFH RXU DWWHPSWV DW %$& PRGLILFDWLRQ ZHUH QRW ZRUNLQJ ZHOO 7KH 53&, OLEUDU\ KDG WKUHH PDMRU DGYDQWDJHV WR WKH 5HVHDUFK *HQHWLFV OLEUDU\ )LUVW WKH DYHUDJH LQVHUW VL]H IRU WKLV OLEUDU\ LV NE LQFUHDVLQJ WKH FKDQFHV RI REWDLQLQJ D %$& WKDW LV VXLWDEOH IRU XVH DV DQ LPSULQWHG WUDQVJHQH ZLWKRXW DGGLWLRQDO PRGLILFDWLRQ 6HFRQGO\ WKLV OLEUDU\ LV WKH WHPSODWH IRU WKH PRXVH JHQRPH VHTXHQFLQJ HIIRUW DQG VR FRPSOHWH %$& VHTXHQFHV FRXOG SRVVLEO\ EH SRVWHG DV WKH SURMHFW FRQWLQXHG 7KLUGO\ LI D FRPSOHWH %$& VHTXHQFH ZDV GHVLUHG IRU D JLYHQ %$& IURP WKLV OLEUDU\ LW FRXOG EH TXHXHG IRU VHTXHQFLQJ 6LPLODUO\ WR WKH VWUDWHJ\ ZLWK WKH 6Y OLEUDU\ WKH ILOWHUV ZHUH SUREHG XVLQJ ERWK WKH f DQG WKH f 6QUSQ SUREHV 6HYHUDO 6QUSQ WUDQVJHQHV ZHUH LGHQWLILHG IURP WKLV OLEUDU\ 7KH\ DUH OLVWHG DV IROORZV

PAGE 46

1 & 0 0 & '% $. $ 3 0' % DQG $IWHU VWUHDNLQJ IRU VLQJOH FRORQLHV DQG YHULI\LQJ WKDW WKH FORQHV UHSUHVHQWHG WKH 6QUSQ UHJLRQ LQWDFW %$& PROHFXOHV ZHUH VXEMHFWHG WR UHVWULFWLRQ GLJHVWLRQ ZLWK D YDULHW\ RI UDUH FXWWLQJ HQ]\PHV LQFOXGLQJ 6DLO 6DF,, DQG 1RWO DQG UHVROYHG WKH UHVXOWLQJ IUDJPHQWV E\ SXOVH ILHOG HOHFWURSKRUHVLV 7KH JHOV ZHUH WUDQVIHUUHG WR Q\ORQ PHPEUDQHV DQG SUREHG ZLWK YDULRXV SUREHV LQ WKH 6QUSQ DUHD WR SURGXFH D URXJK UHVWULFWLRQ PDS RI HDFK %$& DQG WR GHWHUPLQH ZKHWKHU LW FRQWDLQHG HQRXJK JHQHWLF LQIRUPDWLRQ WR VHUYH DV D SXWDWLYH LPSULQWHG WUDQVJHQH %$& HQG VHTXHQFHV IRU PDQ\ RI WKHVH FORQHV ZHUH UHDGLO\ DYDLODEOH RQ WKH 1DWLRQDO &HQWHU IRU %LRWHFKQRORJ\ ,QIRUPDWLFV 1&%,f ZHEVLWH DQG VR SULPHUV FRXOG EH RUGHUHG DQG XVHG WR FUHDWH SUREHV IRU WKH HQG RI HDFK %$& 7KH IROORZLQJ SUREHV ZHUH XVHG LQ GHWHUPLQLQJ %$& WLOLQJ SDWKZD\V DQG UHVWULFWLRQ PDS D NE 6DFO1RWO IUDJPHQW f RI 6QUSQ D NE IFR5,=VFR59 IUDJPHQW WKDW LV NE f RI 6QUSQ DQ ROLJR WKDW ORFDOL]HG WR DQ LQWHUVWLWLDO $ SDUWLFOH ,$3f WKDW LV ORFDWHG LQ WKH f HQG RI WKH ,SZ JHQH DQG PRUH WKDQ NE f RI 6QUSQ DQG DQ ROLJR WKDW LV FRPSOLPHQWDU\ WR D VPDOO QXFOHRODU 51$ VQR51$f WKDW ZDV NQRZQ WR H[LVW DSSUR[LPDWHO\ NE f RI 6QUSQ 8VLQJ WKHVH SUREHV %$&V $ DQG ZHUH GHWHUPLQHG WR EH VXLWDEOH IRU IXUWKHU DQDO\VLV %$& $ ZDV VKRZQ WR H[WHQG NE f RI 6QUSQ DQG NE f RI 6QUSQ %$& VSDQQHG D UHJLRQ WKDW ZDV ILUVW SUHGLFWHG WR FRYHU VHTXHQFH NE f RI 6QUSQ WKURXJK NE f RI 6QUSQ EXW ZDV ODWHU GLVFRYHUHG WR H[WHQG NE f RI 6QUSQ )LQDOO\ %$& ZDV VKRZQ WR FRQWDLQ RQO\ NE f RI 6QUSQ EXW H[WHQGHG QHDUO\ NE f RI 6QUSQ LQWR WKH ,$3 HOHPHQW DQG WKH VWDUW RI WKH ,SZ JHQH )LJ f

PAGE 47

/DPEGD 5HG 0HGLDWHG +RPRORJRXV 5HFRPELQDWLRQ $OWKRXJK LQWDFW %$& PROHFXOHV WKDW VHHPHG ZHOO VXLWHG WR EH LPSULQWHG ZLWKRXW IXUWKHU PRGLILFDWLRQ ZHUH DYDLODEOH LW ZDV GHVLUDEOH WR FUHDWH D VXEWOH PXWDWLRQ LQ WKH %$& WKDW ZRXOG DOORZ WUDQVJHQLF 6QUSQ H[SUHVVLRQ WR EH GLVWLQJXLVKHG IURP WKH HQGRJHQRXV PHVVDJH $ WKLUG PHWKRG RI %$& PRGLILFDWLRQ WKDW ZDV GHYHORSHG E\ 'DLJXDQ
PAGE 48

WKLV VWXG\ ZHUH GHULYHG XQVLQJ XQPRGLILHG %$& FORQHV WKH %$&V KDYH VLQFH EHHQ PRGLILHG XVLQJ WKH ODPEGD 5HG V\VWHP DQG ZLOO EH WKH IRFXV RI IXWXUH ZRUN 3URGXFWLRQ 2I 7UDQVJHQLF 0LFH :KLOH FRQWLQXLQJ ZLWK HIIRUWV WR PRGLI\ WKH %$&V LW VHHPHG SUXGHQW WR EHJLQ SURGXFLQJ WUDQVJHQLF PLFH FDUU\LQJ XQPRGLILHG 6WLUSQ %$&V %$& '1$ ZDV SUHSDUHG E\ ODUJHVFDOH SODVPLG SUHSDUDWLRQ IROORZHG E\ FHVLXP FKORULGH EDQGLQJ RI WKH UHVXOWLQJ '1$ %RWK QLFNHG DQG VXSHUFRLOHG EDQGV ZHUH SXOOHG DQG XVHG IRU SURGXFWLRQ RI WUDQVJHQLF PLFH ,W ZDV LPSRUWDQW WR KDYH H[WUHPHO\ IUHVK %$& DV WKH ODUJHU 53&, %$&V GHJUDGHG UDSLGO\ DIWHU LVRODWLRQ DV HYLGHQFHG E\ ORZ \LHOG RI VXSHUFRLOV DQG D GLIIXVH DSSHDUDQFH RQ SXOVHILHOG JHOV 7KH %$& '1$ ZDV GLDO\]HG DJDLQVW 7( EXIIHU DQG GLOXWHG IRU LQMHFWLRQ ZLWK ZDWHU WR D FRQFHQWUDWLRQ RI QJSO 7UDQVJHQLF PLFH ZHUH PDGH E\ SURQXFOHDU LQMHFWLRQ LQWR RRF\WHV GHULYHG IURP VXSHURYXODWHG IHUWLOL]HG )9%1IHPDOH PLFH 7KH LQMHFWHG RRF\WHV ZHUH WKHQ LPSODQWHG LQWR SVHXGRSUHJQDQW %'f ) PLFH :KHQ WKH UHVXOWLQJ SXSV UHDFKHG ZHHNV RI DJH WKH\ ZHUH WDLO FOLSSHG WR REWDLQ '1$ DQG HDUSXQFKHG IRU LGHQWLILFDWLRQ *HQRPLF '1$ ZDV SUHSDUHG IURP HDFK WDLO SLHFH DQG ZDV VFUHHQHG IRU WKH SUHVHQFH RI WKH WUDQVJHQH E\ 3&5 XVLQJ ERWK HQG VHTXHQFHV IURP WKH FRUUHVSRQGLQJ %$& 7KUHH WUDQVJHQLF IRXQGHU DQLPDOV ZHUH SURGXFHG ZLWK WKH $ WUDQVJHQH WZR OLQHV ZHUH PDGH ZLWK WKH WUDQVJHQH DQG ILYH OLQHV FDUULHG WKH WUDQVJHQH 7KH WUDQVJHQLF IRXQGHUV ZHUH PDWHG ZLWK ZLOGW\SH )9%1IHPDOHV DQG WKH UHVXOWLQJ OLWWHUV ZHUH JHQRW\SHG DW ZHHNV RI DJH WR PDNH VXUH WKDW WKH WUDQVJHQH KDG LQWHJUDWHG LQWR WKH JHUPOLQH RI WKH IRXQGHUV LH WKDW WKH IRXQGHUV ZHUH QRW FKLPHULFf DQG WR HVWDEOLVK DGGLWLRQDO WUDQVJHQLF DQLPDOV WR VHFXUH WKH VXUYLYDO RI WKH WUDQVJHQLF OLQH

PAGE 49

2QH WUDQVJHQLF PRXVH GHULYHG IURP WKH %$& GLG QRW VKRZ JHUPOLQH WUDQVPLVVLRQ WR VXEVHTXHQW JHQHUDWLRQV DQG PRVW OLNHO\ UHSUHVHQWHG D FKLPHULF PRXVH LQ ZKLFK WKH WUDQVJHQH KDG LQWHJUDWHG LQWR WKH JHQRPH VRPHWLPH DIWHU WKH ILUVW FOHDYDJH IROORZLQJ IHUWLOL]DWLRQ 2QFH WKH UHPDLQLQJ OLQHV ZHUH HVWDEOLVKHG WKH LQGLYLGXDO OLQHV ZHUH FKDUDFWHUL]HG IRU LQWDFWQHVV RI WKH WUDQVJHQH DQG FRS\ QXPEHU )LJ f &KDUDFWHUL]DWLRQ 2I 7UDQVJHQLF /LQHV &KDUDFWHUL]DWLRQ RI WKH WUDQVJHQLF OLQHV ZDV QHFHVVDU\ WR GHWHUPLQH WKH QXPEHU RI %$& PROHFXOHV WKDW ZHUH LQWHJUDWHG LQWR WKH WUDQVJHQH ORFXV DV ZHOO DV WKH LQWHJULW\ RI WKH PROHFXOHV WKDW KDG LQWHJUDWHG '1$ XVHG WR PDNH WUDQVJHQLF PLFH WHQGV WR LQWHJUDWH LQWR WKH PRXVH JHQRPH LQ WDQGHP DUUD\V )RU WKH SXUSRVHV RI RXU VWXG\ LW ZDV LPSHUDWLYH WKDW ZH REWDLQ VRPH VLQJOH FRS\ WUDQVJHQLF OLQHV VLQFH ZH ZHUH DGKHULQJ WR WKH PRVW VWULQJHQW GHWHUPLQDWLRQ RI WKH PLQLPXP DPRXQW RI VHTXHQFH LQIRUPDWLRQ WKDW ZDV VXIILFLHQW WR FRQIHU SURSHU LPSULQWHG H[SUHVVLRQ ,W ZDV DOVR LPSRUWDQW WKDW WKH WUDQVJHQH EH LQWDFW VLQFH SURSHU LPSULQWHG H[SUHVVLRQ PD\ EH D UHVXOW RI WKH UHODWLYH ORFDWLRQ RI WKH SHUWLQHQW HOHPHQWV )XUWKHUPRUH WKH %$& PROHFXOHV KDG WR EH OLQHDU SULRU WR LQWHJUDWLRQ LQWR WKH JHQRPH DQG VLQFH ZH LQMHFWHG VXSHUFRLOV DQG QLFNHG %$& PROHFXOHV WKH ORFDWLRQ RI WKH VLWH RI EUHDNDJH ZDV UDQGRP 7KLV LQFUHDVHG WKH FKDQFHV RI GHULYLQJ D QRQLQWDFW WUDQVJHQLF OLQH &RS\ QXPEHU ZDV GHWHUPLQHG E\ SUHSDULQJ JHQRPLF '1$ IURP PRXVH WDLOV KDUERULQJ WKH WUDQVJHQH SHUIRUPLQJ 6RXWKHUQ EORW DQDO\VLV RQ '1$ WKDW ZDV FXW ZLWK D VSHFLILF UHVWULFWLRQ HQ]\PH DQG FRPSDULQJ EDQGV IURP WZR GLIIHUHQW SUREHV WKDW ZRXOG \LHOG EDQGV RI VLPLODU VL]H XSRQ WKH VDPH UHVWULFWLRQ GLJHVWLRQ 2QH SUREH ZDV ORFDWHG RQ WKH WUDQVJHQH ZKLOH WKH RWKHU ZDV QRW 7KH LQWHQVLWLHV RI WKH EDQGV ZHUH FRPSDUHG DQG

PAGE 50

WKH FRS\ QXPEHU ZDV HVWLPDWHG DV HLWKHU VLQJOH FRS\ RU PXOWLFRS\ 2QH RI WKH $ OLQHV RQH RI WKH OLQHV DQG RQH RI WKH OLQHV FRQWDLQHG PXOWLSOH FRSLHV RI WKH WUDQVJHQH OHDYLQJ XV ZLWK WZR $ WUDQVJHQLF OLQHV RQH WUDQVJHQLF OLQH DQG WKUHH WUDQVJHQLF OLQHV WKDW UHSUHVHQWHG VLQJOH FRS\ WUDQVJHQH LQWHJUDWLRQV )LJ f 6LPLODUO\ UHDUUDQJHPHQWV ZHUH GHWHUPLQHG E\ FUHDWLQJ D SDQHO RI '1$V IURP WKH GLIIHUHQW WUDQVJHQLF OLQHV GLJHVWHG E\ D YDULHW\ RI UHVWULFWLRQ HQ]\PHV 7KHVH SDQHOV ZHUH XVHG WR SURGXFH 6RXWKHUQ EORWV ZKLFK ZHUH SUREHG ZLWK VHYHUDO SUREHV IURP WKH UHJLRQ )LJ f ,I D SUREH LOOXPLQDWHG D EDQG WKDW ZDV RI D GLIIHUHQW VL]H WKDQ WKDW RI D ZLOG W\SH QRQWUDQVJHQLF PRXVH WKHQ WKDW WUDQVJHQH ZDV FRQVLGHUHG UHDUUDQJHG 2QH $ OLQH DQG RQH OLQH DSSHDUHG WR EH UHDUUDQJHG E\ WKLV DQDO\VLV +RZHYHU GXH WR WKH UHODWLYHO\ IHZ QRQUHSHWLWLYH SUREHV LQ WKH VHTXHQFH VXUURXQGLQJ WKH 6QUSQ ORFXV ZH PD\ QRW KDYH GHWHFWHG RWKHU UHDUUDQJHPHQWV 7KH 0DUNHG (QGRJHQRXV 6QUSQ /RFXV 7KH LQDELOLW\ WR PDUN WKH %$&V SULRU WR WKHLU LQMHFWLRQ LQWR PRXVH RRF\WHV IRUFHG WKH XVH RI D SUHYLRXVO\ HQJLQHHUHG 6QUSQ GHOHWLRQ PRXVH VWUDLQ $6P1f 7KLV PRXVH VWUDLQ FDUULHV D GHOHWLRQ RI H[RQV RI WKH 6QUSQ JHQH WKDW UHVXOWV LQ DOPRVW FRPSOHWH DEVHQFH RI WKH 6QUSQ JHQH DQG WKH ORZOHYHO SURGXFWLRQ RI D ODUJHU IXVLRQ WUDQVFULSW WKDW LQFOXGHV WKH ILUVW H[RQV RI 6QUSQ DQG WKH QHRP\FLQ UHVLVWDQFH JHQH 8VLQJ WKLV DOOHOH WKH HQGRJHQRXV 6QUSQ ORFXV FRXOG EH PDUNHG DOOHYLDWLQJ WKH DEVROXWH UHTXLUHPHQW IRU D PDUNHG WUDQVJHQH )LJ f 7KH $3:6,& PRXVH VWUDLQ ZDV DOVR XVHG 7KLV VWUDLQ KDV D QHRP\FLQ UHVLVWDQFH FDVVHWWH LQVHUWHG LQ SODFH RI H[RQV RI 6QUSQ :KHQ SDWHUQDOO\ LQKHULWHG

PAGE 51

WKLV GHOHWLRQ SUHYHQWV H[SUHVVLRQ IURP WKH 6QUSQ ORFXV DOORZLQJ XV WR PHDVXUH 6QUSQ H[SUHVVLRQ WKDW RULJLQDWHV IURP WKH WUDQVJHQH )LJ f ,PSULQWHG ([SUHVVLRQ )URP 7UDQVJHQHV 6LQFH WKH WUDQVJHQLF FRS\ RI 6QUSQ ZDV QRW VXEWO\ PDUNHG WR EH HDVLO\ GLVWLQJXLVKDEOH IURP WKH HQGRJHQRXV DOOHOH WKH DELOLW\ RI WKH WUDQVJHQH WR VKRZ SURSHU LPSULQWHG H[SUHVVLRQ KDG WR EH WHVWHG E\ D FRPSOH[ EUHHGLQJ VFKHPH XVLQJ D PDUNHG HQGRJHQRXV DOOHOH 7KLV EUHHGLQJ VFKHPH LV VKRZQ LQ )LJXUH )LUVW WKH H[SUHVVLRQ XSRQ PDWHUQDO LQKHULWDQFH ZDV H[DPLQHG )HPDOHV ZKR KDUERUHG D WUDQVJHQH ZHUH PDWHG ZLWK D PDOH PRXVH WKDW FDUULHG WKH 6P1 GHOHWLRQ DOOHOH 7KH UHVXOWLQJ SXSV ZHUH JHQRW\SHG IRU WKH SUHVHQFH RI WKH WUDQVJHQH DV ZHOO DV IRU WKH SUHVHQFH RI WKH GHOHWLRQ DOOHOH 3XSV ZLWK ERWK WKH WUDQVJHQH DQG GHOHWLRQ DOOHOH ZHUH VDFULILFHG DQG WKHLU EUDLQV ZHUH XVHG WR PDNH 51$ 7KH 51$ ZDV DQDO\]HG E\ QRUWKHUQ DQDO\VLV IRU WKH H[SUHVVLRQ RI 6QUSQ 7KLV LV SRVVLEOH EHFDXVH WKH WUDQVJHQLF IHPDOH PLFH WUDQVPLW D WUDQVJHQH ZKLFK PD\ RU PD\ QRW EH H[SUHVVHG GHSHQGLQJ RQ LWV HSLJHQHWLF VWDWH DV ZHOO DV D ZLOG W\SH FRS\ RI WKH HQGRJHQRXV 6QUSQ ORFXV WKDW LV QRW H[SUHVVHG VLQFH LW LV LQKHULWHG IURP D IHPDOH 7KH PDOH PRXVH RQ WKH RWKHU KDQG WUDQVPLWV WKH $6P1 DOOHOH RQO\ ZKLFK LV H[SUHVVHG DV D ODUJHU OHVV DEXQGDQW PHVVDJH $Q\ ZLOGW\SH 6QUSQ PHVVDJH ZRXOG WKHQ FRPH RQO\ IURP WKH WUDQVJHQH 2QO\ WKH WUDQVJHQHV ZHUH DEOH WR H[SUHVV 6QUSQ XSRQ PDWHUQDO LQKHULWDQFH LQGLFDWLQJ WKDW WKLV WUDQVJHQH GLG QRW FRQWDLQ WKH VHTXHQFH LQIRUPDWLRQ WKDW ZDV UHTXLUHG IRU VLOHQFLQJ RI WKH 6QUSQ JHQH XSRQ PDWHUQDO LQKHULWDQFH )LJ f 1H[W H[SUHVVLRQ XSRQ SDWHUQDO LQKHULWDQFH ZDV WHVWHG ,Q WKLV FDVH PDOH PLFH IURP WKH DERYH GHVFULEHG PDWLQJ ZKR KDG LQKHULWHG ERWK WKH WUDQVJHQH DV ZHOO DV WKH

PAGE 52

$6P1 DOOHOH ZHUH PDWHG WR IHPDOHV ZKR ZHUH KRPR]\JRXV IRU WKH $6P1 DOOHOH 7KH UHVXOWLQJ SXSV ZHUH VDFULILFHG DQG JHQRW\SHG IRU WKH SUHVHQFH RI ERWK WKH WUDQVJHQH DQG WKH $6P1 DOOHOH 7KH UDWLRQDOH EHKLQG WKLV VFKHPH LV WKDW WKH IHPDOH LQ WKLV FDVH FDQ RQO\ VHQG D $6P1 DOOHOH ZKLFK LV VLOHQFHG ,Q WKH SUHVHQFH RI D NQRZQ PDWHUQDO $6P1 DOOHOH D SDWHUQDOO\ LQKHULWHG ZLOGW\SH DOOHOH FDQ EH GLVWLQJXLVKHG IURP D SDWHUQDOO\ LQKHULWHG $6P1 DOOHOH 7KH PDOH PRXVH WUDQVPLWV WKH WUDQVJHQH ZKLFK PD\ RU PD\ QRW EH H[SUHVVHG GHSHQGLQJ RQ LWV HSLJHQHWLF VWDWH DQG HLWKHU D ZLOGW\SH RU $6P1 DOOHOH ,I WKH PDOH WUDQVPLWV WKH ZLOGW\SH DOOHOH WKH UHVXOWLQJ SXSV FDQQRW EH XVHG IRU DQDO\VLV VLQFH WKH SDWHUQDOO\ LQKHULWHG 6QUSQ ORFXV LV LQGLVWLQJXLVKDEOH IURP WKH WUDQVJHQLF 6QUSQ ORFXV $OWHUQDWLYHO\ LI WKH PDOH WUDQVPLWV WKH $6P1 DOOHOH WKH HQGRJHQRXV DOOHOH WKDW LV H[SUHVVHG SURGXFHV WKH ORQJHU OHVV DEXQGDQW $6P1 PHVVDJH )LJ f 2ULJLQDOO\ WKH LGHD ZDV WR LGHQWLI\ 6QUSQ PLFH WKDW ZHUH WUDQVJHQLF DQG KRPR]\JRXV IRU WKH $6P1 DOOHOH DQG H[DPLQH H[SUHVVLRQ LQ WKHVH SXSV +RZHYHU WKH SUHVHQFH RI D ODUJH WUDQVJHQH WKDW SURGXFHG D ZLOGW\SH 6QUSQ DOOHOH E\ 6RXWKHUQ EORW KLQGHUHG LGHQWLILFDWLRQ RI $6P1 KRPR]\JRWHV ,QVWHDG WKH PLFH ZHUH JHQRW\SHG IRU WKH WUDQVJHQH DQG 51$ ZDV PDGH IURP WKH EUDLQV RI WKH UHVXOWLQJ WUDQVJHQLF PLFH 7KH 51$ ZDV WKHQ XVHG WR SURJUDP 573&5 UHDFWLRQV 3&5 ZDV SHUIRUPHG RQ WKH 57 SURGXFW XVLQJ SULPHUV IRU ERWK WKH $6P1 DQG ZLOGW\SH DOOHOHV 3XSV WKDW H[SUHVV ERWK WKH $6P1 DQG ZLOGW\SH DOOHOHV LQKHULW WKH $6P1 DOOHOH DQG QRW WKH HQGRJHQRXV ZLOG W\SH DOOHOH IURP WKHLU IDWKHU 6QUSQ DQG WKH $6P1 DOOHOHV DUH RQO\ SDWHUQDOO\ H[SUHVVHGf 7KXV WKH ZLOGW\SH DOOHOH PXVW EH H[SUHVVHG IURP WKH WUDQVJHQH ,I WKH SXS GLG QRW VKRZ H[SUHVVLRQ IURP WKH $6P1 DOOHOH WKHQ LW ZDV EHOLHYHG WR KDYH LQKHULWHG WKH ZLOGW\SH HQGRJHQRXV DOOHOH IURP LWV IDWKHU DQG ZDV XQLQIRUPDWLYH DV IDU DV WUDQVJHQH H[SUHVVLRQ LV

PAGE 53

FRQFHUQHG )URP WKLV DVVD\ OLQHV IURP HDFK WKH WZR WUDQVJHQHV $ DQG ZHUH VKRZQ WR KDYH H[SUHVVLRQ XSRQ SDWHUQDO LQKHULWDQFH 7KXV ERWK $ DQG DUH FDSDEOH RI VKRZLQJ FRUUHFW LPSULQWHG H[SUHVVLRQ LQ VLQJOH FRS\ WUDQVJHQHV )LJ f 7KHVH H[SHULPHQWV ZHUH UHSHDWHG XVLQJ WKH $3:6,& GHOHWLRQ PLFH LQ SODFH RI WKH $6P1 GHOHWLRQ PLFH 7R DVFHUWDLQ WUDQVJHQH H[SUHVVLRQ XSRQ PDWHUQDO LQKHULWDQFH D WUDQVJHQLF IHPDOH PRXVH LV PDWHG ZLWK D $3:6,& PDOH PRXVH )LJ $f 7KH UHVXOWLQJ SXSV ZHUH VDFULILFHG DQG JHQRW\SHG 3XSV WKDW LQKHULWHG ERWK WKH $3:6,& DOOHOH DQG WKH WUDQVJHQH ZHUH XVHG WR SURGXFH EUDLQ 51$ ZKLFK ZDV VXEMHFWHG WR QRUWKHUQ EORW DQDO\VLV DQG SUREHG IRU 6QUSQ H[SUHVVLRQ $JDLQ WKH IHPDOHV WUDQVPLW WKH WUDQVJHQH DV ZHOO DV DQ HSLJHQHWLFDOO\ VLOHQFHG PDWHUQDO 6QUSQ DOOHOH ZKLOH $3:6,& PDOHV WUDQVPLW D $3:6,& DOOHOH WKDW FRPSOHWHO\ ODFNV 6QUSQ H[SUHVVLRQ $Q\ 6QUSQ PHVVDJH ZRXOG KDYH WR RULJLQDWH IURP WKH WUDQVJHQLF FRS\ RI 6QUSQ $OO ILYH WUDQVJHQLF OLQHV ZHUH VXEMHFWHG WR H[SUHVVLRQ DQDO\VLV XSRQ PDWHUQDO LQKHULWDQFH DQG DJDLQ RQO\ WKH WUDQVJHQLF OLQHV ZLWK WKH H[FHSWLRQ RI OLQH & VKRZHG 6QUSQ H[SUHVVLRQ XSRQ PDWHUQDO LQKHULWDQFH YHULI\LQJ WKDW WKH\ GLG QRW FRQWDLQ VXIILFLHQW VHTXHQFH WR FRQIHU HSLJHQHWLF VLOHQFLQJ WR WKH PDWHUQDOO\ LQKHULWHG WUDQVJHQH )LJ %f 7R DVFHUWDLQ H[SUHVVLRQ XSRQ SDWHUQDO LQKHULWDQFH $3:6,& IHPDOHV ZHUH PDWHG ZLWK WUDQVJHQLF PDOHV DQG PDOH SXSV ZLWK ERWK WKH $3:6,& DOOHOH DQG WKH WUDQVJHQH ZHUH LGHQWLILHG E\ JHQRW\SLQJ 7KHVH SXSV VXUYLYH VLQFH WKH $3:6,& DOOHOH LV PDWHUQDOO\ LQKHULWHG DQG WKHUHIRUH H[LVWV RQ WKH FKURPRVRPH WKDW LV DOUHDG\ HSLJHQHWLFDOO\ VLOHQFHG 0DOH SXSV WKDW KDYH LQKHULWHG ERWK WKH $3:6,& DOOHOH DV ZHOO DV WKH WUDQVJHQLF DOOHOH ZHUH PDWHG ZLWK ZLOGW\SH IHPDOHV IURP WKH &%/VWUDLQ WR SURGXFH SXSV WKDW KDUERU ERWK WKH $3:6,& DQG WKH WUDQVJHQH )LJ $f 7KHVH SXSV

PAGE 54

GR QRW H[SUHVV HQGRJHQRXV 6QUSQ VLQFH WKHLU SDWHUQDOO\ LQKHULWHG DOOHOH LV WKH $3:6,& DOOHOH ZKLFK LV VLOHQFHG EHFDXVH WKH PDMRU SURPRWHU IRU WKH 6QUSQ JHQH LV PLVVLQJ DQG EHFDXVH LW LV HSLJHQHWLFDOO\ VLOHQFHG DV D UHVXOW RI WKH LPSULQWLQJ FHQWHU PXWDWLRQ 7KH RQO\ 6QUSQ H[SUHVVLRQ ZRXOG FRPH IURP WKH WUDQVJHQLF 6QUSQ DOOHOH DQG ZRXOG RFFXU RQO\ LI WKH WUDQVJHQH ZHUH H[SUHVVHG XSRQ SDWHUQDO WUDQVPLVVLRQ ,Q WKLV DVVD\ WKH SXSV ZHUH VDFULILFHG DW ELUWK DQG JHQRW\SHG IRU WKH $3:6,& DOOHOH DQG WKH WUDQVJHQH VLQFH SXSV WKDW LQKHULW WKH $3:6,& DOOHOH IURP WKHLU IDWKHU VXIIHU IURP WKH 3UDGHU:LOOL SKHQRW\SH DQG GLH VKRUWO\ DIWHU ELUWK 3XSV WKDW LQKHULWHG WKH WUDQVJHQH DV ZHOO DV WKH $3:6,& DOOHOH ZHUH XVHG WR PDNH EUDLQ 51$ 7KLV 51$ ZDV VXEMHFWHG WR QRUWKHUQ DQDO\VLV XVLQJ D SUREH IRU WKH 6QUSQ PHVVDJH )LJ ,%f 7ZR WUDQVJHQLF OLQHVf§% DQG $f§ZHUH LGHQWLILHG WKDW H[SUHVVHG WUDQVJHQLF 6QUSQ XSRQ SDWHUQDO WUDQVPLVVLRQ 6LQFH QHLWKHU RI WKHVH OLQHV ZHUH H[SUHVVHG XSRQ PDWHUQDO WUDQVPLVVLRQ WKH\ ZHUH GHWHUPLQHG WR GHPRQVWUDWH FRUUHFW LPSULQWHG H[SUHVVLRQ /LQH $ FRQWDLQV D VLQJOH FRS\ WUDQVJHQH WKDW LV LQWDFW 7KH WUDQVJHQH LQ WKLV OLQH LV HVWLPDWHG WR LQFOXGH WKH NE 6DLO IUDJPHQW WKDW KRVWV WKH HQWLUH 6QUSQ JHQH DV ZHOO DV NE f RI 6QUSQ DQG NE f RI 6QUSQ 7KLV HVWDEOLVKHV WKH PLQLPDO JHQRPLF VHTXHQFH WKDW LV VXIILFLHQW WR DOORZ IRU FRUUHFW LPSULQWHG H[SUHVVLRQ LQ WKLV UHJLRQ WR EH DSSUR[LPDWHO\ NE /LQH % RQ WKH RWKHU KDQG LV D VLQJOH FRS\ WUDQVJHQH WKDW KDV XQGHUJRQH ERWK f DQG f WUXQFDWLRQ XSRQ LQWHJUDWLRQ LQWR WKH PRXVH JHQRPH 7KH f WUXQFDWLRQ RFFXUV DW OHDVW NE f RI WKH 6QUSQ JHQH ZKLOH WKH f WUXQFDWLRQ RFFXUV DSSUR[LPDWHO\ NE f RI 6QUSQ :KLOH WKLV GDWD VXJJHVWV WKDW WKH PLQLPDO VXIILFLHQW UHJLRQ IRU FRUUHFW LPSULQWLQJ LV DSSUR[LPDWHO\ NE WKH VSHFLILF UHDUUDQJHPHQWV WKDW OHG WR WKH WUXQFDWLRQ RI WKLV WUDQVJHQH DUH QRW NQRZQ 7KH WUDQVJHQH LQ WKLV SDUWLFXODU OLQH

PAGE 55

PD\ KDYH DOVR VXVWDLQHG DGGLWLRQDO PXWDWLRQV WKDW LQIOXHQFH LWV DELOLW\ WR EH FRUUHFWO\ LPSULQWHG 'LVFXVVLRQ 7KH NE 3, FORQH WKDW VKRZV FRUUHFW LPSULQWHG H[SUHVVLRQ ZKHQ SUHVHQW LQ PXOWLSOH FRSLHV EXW QRW ZKHQ SUHVHQW LQ VLQJOH FRS\ ZDV ODWHU IRXQG WR RQO\ EH NE LQ OHQJWK 7KH GLVFUHSDQF\ LQ OHQJWK RFFXUUHG EHFDXVH WKH 3, ZDV LVRODWHG IURP WKH 2OD PRXVH VWUDLQ ZKLFK ZDV IRXQG WR KDYH DQ LQVHUWLRQ RI D NE 9/ HOHPHQW LQWR WKH UHJLRQ f RI 6QUSQ 7KH SDUHQWRIRULJLQ LQGHSHQGHQW H[SUHVVLRQ RI WKLV 3, FORQH QRZ NQRZQ WR EH NE LQ OHQJWK LQGLFDWHV WKDW HLWKHU WKH 3, FORQH LV PLVVLQJ LPSRUWDQW UHJXODWRU\ VHTXHQFHV WKDW OLH f RU f RI WKH 6QUSQ JHQH RU WKH 3, FORQH GRHV QRW FRQWDLQ HQRXJK EXIIHU VHTXHQFH VXUURXQGLQJ WKH QHFHVVDU\ UHJXODWRU\ UHJLRQV WR HVWDEOLVK D GRPDLQ RI LPSULQWHG H[SUHVVLRQ 7KH 3, FORQH LV H[SUHVVHG XSRQ ERWK SDWHUQDO DQG PDWHUQDO LQKHULWDQFH ZKHQ SUHVHQW LQ VLQJOH FRS\ LQGLFDWLQJ WKDW WKH GHIHFW LV PRVW OLNHO\ LQ WKH DELOLW\ WR EH VLOHQFHG LQ WKH PDWHUQDO JHUPOLQH 6LQFH WKH PXULQH $6,& KDV QRW EHHQ IXQFWLRQDOO\ RU SK\VLFDOO\ LGHQWLILHG LQ PRXVH DQG LV SRVWXODWHG WR EH WKH QHJDWLYH UHJXODWRU\ HOHPHQW UHTXLUHG IRU WKH VLOHQFLQJ RI WKH SRVLWLYHO\ DFWLQJ 3:6,& )LJ f WKH PRVW OLNHO\ H[SODQDWLRQ IRU WKH DEVHQFH RI PDWHUQDO VLOHQFLQJ RI WKH 3, WUDQVJHQH LV WKDW LW GRHV QRW FRQWDLQ WKH $6,& UHJXODWRU\ VHTXHQFHV $EVHQVH RI WKH $6,& ZRXOG EH SUHGLFWHG WR SUHYHQW VLOHQFLQJ RI WKH SRVLWLYH HOHPHQW ORFDWHG RQ WKH WUDQVJHQH XSRQ PDWHUQDO LQKHULWDQFH 6LQFH WKH 3, FORQH ZLWKRXW WKH 9/ LQVHUWLRQ H[WHQGV NE f RI 6QUSQ ZH EHOLHYH WKDW WKH $6,& LV ORFDWHG IXUWKHU WKDQ NE f RI 6QUSQ 7KLV GDWD VSXUUHG WKH VHDUFK IRU WUDQVJHQHV ZLWK DGGLWLRQDO VHTXHQFH f WR 6QUSQ UDWKHU WKDQ VHHN DGGLWLRQDO EXIIHU VHTXHQFH :KHWKHU LW LV LQGHHG WKH DEVHQFH RI UHJXODWRU\ HOHPHQWV RU

PAGE 56

EXIIHU VHTXHQFH LV D JHUPDQH DUJXPHQW LQ WKLV V\VWHP VLQFH ZH ZHUH VHHNLQJ PLQLPDO VXIILFLHQW VHTXHQFH WR DFKLHYH DSSURSULDWH LPSULQWLQJ UDWKHU WKDQ GHWHUPLQLQJ ZKLFK VSHFLILF HOHPHQWV DUH QHFHVVDU\ 7KH GDWD IURP WKH 3, FORQH VXJJHVWHG WKDW WKH NE VHTXHQFH ZDV QRW VXIILFLHQW WR FRQIHU DSSURSULDWH LPSULQWHG H[SUHVVLRQ DQG D VLQJOHFRS\ LPSULQWHG WUDQVJHQH LV QHFHVVDU\ WR HVWDEOLVK WKH PLQLPDO VHTXHQFH WKDW FDQ DFFRPSOLVK FRUUHFW SDUHQWRIRULJLQ GHSHQGHQW H[SUHVVLRQ 2QFH WKH PLQLPDO UHTXLUHG VHTXHQFH KDV EHHQ GHWHUPLQHG PRGLILFDWLRQV FDQ EH PDGH WR WKDW VHTXHQFH WR GHOLQHDWH VSHFLILF HOHPHQWV WKDW DUH QHFHVVDU\ IRU WKH HVWDEOLVKPHQW DQG PDLQWHQDQFH RI WKH LPSULQW :KLOH LQLWLDO DWWHPSWV WR PDNH WUDQVJHQLF PLFH ZLWK WKH NE <$& FORQH ZHUH XQVXFFHVVIXO WKH <$& FORQH ZDV XVHG WR HVWDEOLVK WKH DSSUR[LPDWH GLVWDQFH EHWZHHQ WKH f PRVW H[RQ RI 6QUSQ DQG H[RQV % DQG & RI ,SZ WR EH O22NE +RZHYHU WKH GLIILFXOWLHV VXUURXQGLQJ SXULILFDWLRQ RI D <$& RI WKDW VL]H IRU WUDQVJHQLF LQMHFWLRQ SUHFOXGHG LWV FRQYHQLHQW XVH DV DQ LPSULQWHG WUDQVJHQH 3UHYLRXVO\ WKH ODUJHVW <$&V WKDW ZHUH VXFFHVVIXOO\ XVHG LQ JHQH UHJXODWLRQ VWXGLHV LQYROYLQJ WUDQVJHQLF PLFH ZHUH RQO\ NE LQ OHQJWK 6FUHHQLQJ WKH 6Y %$& OLEUDU\ SURYHG IUXLWIXO IRU PLQLQJ DGGLWLRQDO VHTXHQFH f RI 6QUSQ EXW GLG QRW SURYLGH DQ LGHDO %$& FORQH WR XVH DV DQ LPSULQWHG WUDQVJHQH 7ZR FORQHV ZHUH REWDLQHG ) DQG + WKDW WRJHWKHU FRQWDLQHG DGGLWLRQDO VHTXHQFH f RI 6QUSQ DV ZHOO DV D FRPSOHWH 6QUSQ JHQH 8QIRUWXQDWHO\ WKH FRPPHUFLDOO\ DYDLODEOH %$& OLEUDULHV ZHUH RI WKH 6Y RU &%/VWUDLQV ZKLFK PDGH ILQGLQJ QDWXUDOO\ H[SUHVVHG SRO\PRUSKLVPV XQOLNHO\ VLQFH ERWK VWUDLQV DUH IURP WKH GRPHVWLFXV VXEVSHFLHV RI 0XV PXVFXOXV 7KH SRVVLELOLW\ RI XVLQJ D PRUH SRO\PRUSKLF KXPDQ 6QUSQ

PAGE 57

WUDQVJHQH ZDV H[SORUHG DQG UHMHFWHG HDUOLHU VLQFH WKH KXPDQ WUDQVJHQH LV QRW VLOHQFHG ZKHQ SUHVHQW DV D PXULQH WUDQVJHQH UHJDUGOHVV RI FRS\ QXPEHU 6LQFH WKH 6Y %$&V ZHUH QRW LGHDO WKH ILUVW VWUDWHJ\ ZDV WR MRLQ WKH WZR %$&V WR FUHDWH D ODUJHU %$& WKDW ZDV PRUH VXLWDEOH IRU WUDQVJHQH LPSULQWLQJ 7KH VWUDWHJ\ ZDV WR SODFH D QHRP\FLQ UHVLVWDQFH FDVVHWWH LQWR D NE 6DLO IUDJPHQW GHULYHG IURP WKH ) %$& WKDW OLHV f RI 6QUSQ DQG WKHQ H[FLVH WKLV IUDJPHQW DQG OLJDWH LW LQWR WKH + %$& QHDU WKH VLWH RI H[RQ RI 6QUSQ $W WKH WLPH RQO\ WKH 5HF$ PHGLDWHG KRPRORJRXV UHFRPELQDWLRQ PHWKRG KDG EHHQ GHVFULEHG 7KLV PHWKRG LQYROYHG D WZR VWHS JHQH UHSODFHPHQW VWUDWHJ\ LQ ZKLFK WKH 5HF$ SURWHLQ DEVHQW LQ WKH %$& KRVW VWUDLQ ZDV SURYLGHG IURP D S69OGHULYHG SODVPLG ZLWK D WHPSHUDWXUHVHQVLWLYH RULJLQ RI UHSOLFDWLRQ $WWHPSWV WR VXEFORQH KRPRORJ\ DUPV LQWR WKH 5HF$FRQWDLQLQJ SODVPLG IDLOHG SUREDEO\ GXH WR WKH ODUJH VL]H RI WKH SODVPLG 5HF(7 PHGLDWHG KRPRORJRXV UHFRPELQDWLRQ ZDV DOVR DWWHPSWHG 7KLV PHWKRG LQYROYHG LQGXFLQJ 5HF( DQG 5HF7 IURP DQ DUDELQRVHLQGXFLEOH SURPRWHU 7KLV PHWKRG ZDV QHYHU IXOO\ H[SORUHG EHFDXVH WKH ZURQJ SODVPLGV ZHUH VHQW ,Q WKH DEVHQFH RI D UHOLDEOH KRPRORJRXV UHFRPELQDWLRQ PHWKRG IRU %$&V WKH &%/%$& OLEUDU\ WKDW ZDV DYDLODEOH IURP WKH 53&, ZDV VFUHHQHG 7KH %$&V IURP WKLV OLEUDU\ ZHUH RQ DYHUDJH ODUJHU WKDQ WKRVH IURP WKH 6Y OLEUDU\ $GGLWLRQDOO\ WKH 1&%, PRXVH JHQRPH VHTXHQFLQJ HIIRUW ZDV SURFHHGLQJ IURP WKLV OLEUDU\ VR WKH VSHFLILF VHTXHQFH LQ WKH UHJLRQ ZRXOG HYHQWXDOO\ EHFRPH DYDLODEOH DV ZHOO DV WKH DGGUHVVHV RI DGGLWLRQDO FORQHV LQ WKH UHJLRQ 6FUHHQLQJ HIIRUWV IRU WKLV OLEUDU\ ZHUH YHU\ VXFFHVVIXO DV FORQHV ZHUH LVRODWHG ZLWK WKH 6QUSQ SUREHV )URP WKH FORQHV WZR ZHUH FKRVHQ WKDW FRQWDLQHG WKH PRVW GHWHFWDEOH VHTXHQFH XSVWUHDP RI 6QUSQ ZKLOH VWLOO FDUU\LQJ WKH HQWLUH

PAGE 58

JHQH :KLOH QHLWKHU RI WKH WZR %$&V ZHUH LQ WKH VHTXHQFLQJ SURJUDP ERWK %$&V ZHUH SUHVHQW DV 7 DQG 6S ILQJHUSULQWV HQG VHTXHQFHVf LQ WKH 1&%, GDWDEDVH 3XOVHILHOG JHO DQDO\VLV LQLWLDOO\ LQGLFDWHG WKDW %$& FRQWDLQHG NE RI VHTXHQFH f RI 6QUSQ ZKLOH $ FRQWDLQHG QHDUO\ NE f RI 6QUSQ 7KHVH HVWLPDWHV DUH URXJK VLQFH WKH\ DUH EDVHG RQ ODUJH SXOVHILHOG IUDJPHQWV 6XEVHTXHQW DQDO\VLV VXJJHVWHG WKDW DFWXDOO\ H[WHQGHG NE f RI 6QUSQ DQG WKDW WKH NE 6DLO IUDJPHQW WKDW ZDV RULJLQDOO\ WKRXJKW WR EH WKH MXQFWLRQ IUDJPHQW EHWZHHQ WKH PRXVH '1$ LQVHUW DQG WKH %$& SODVPLG EDFNERQH ZDV D GRXEOHW RI WZR DGMDFHQW IUDJPHQWV 7KUHH OLQHV RI WUDQVJHQLF PLFH KDUERULQJ %$& $ DQG WZR OLQHV KDUERULQJ ZHUH REWDLQHG IURP PLFURLQMHFWLRQ RI PRXVH RRF\WHV 7KHVH OLQHV ZHUH QDPHG $ WKURXJK & DQG $ DQG % $PRQJ WKHVH ILYH OLQHV OLQHV % & DQG $ ZHUH DOO VXVSHFWHG WR EH SUHVHQW LQ VLQJOH FRS\ /LQHV $ DQG % ZHUH HVWLPDWHG WR EH SUHVHQW LQ FRS\ DUUD\V 7KH PHWKRG RI DQDO\VLV RI WUDQVJHQH FRS\ QXPEHU WKDW ZDV XVHG LV SUREDEO\ DFFXUDWH LQ GHOLQHDWLQJ VLQJOHFRS\ WUDQVJHQHV EXW QRW LQ GHWHUPLQLQJ WKH FRS\ QXPEHU LQ PXOWLFRS\ OLQHV $GGLWLRQDOO\ DOO WUDQVJHQLF OLQHV H[FHSW % DSSHDUHG WR EH LQWDFW 7UDQVJHQHV ZHUH ILUVW WHVWHG IRU FRUUHFW LPSULQWHG H[SUHVVLRQ XVLQJ WKH $6P1 VWUDLQ RI PRXVH ([SUHVVLRQ XSRQ PDWHUQDO LQKHULWDQFH ZDV UHDGLO\ DVVD\HG XVLQJ WKH EUHHGLQJ VFKHPH LQ )LJXUH /LQHV $& DQG OLQHV $ DQG % ZHUH QRW H[SUHVVHG XSRQ PDWHUQDO WUDQVPLVVLRQ VXJJHVWLQJ WKDW WKH\ FRXOG EH VLOHQFHG LQ WKH PDWHUQDO JHUPOLQH )LJ f /LQHV $% DQG KRZHYHU ZHUH QRW FRUUHFWO\ VLOHQFHG XSRQ PDWHUQDO LQKHULWDQFH )LJ f DQG ZHUH WKRXJKW WR EH PLVVLQJ WKH $6,& 7KLV ZRXOG UHVXOW LQ WKH IDLOXUH WR VLOHQFH WKH SRVLWLYHO\ DFWLQJ 3:6,& DQG OHDG WR H[SUHVVLRQ XSRQ

PAGE 59

PDWHUQDO WUDQVPLVVLRQ 3DWHUQDO WUDQVPLVVLRQ ZDV QRW FRQFOXVLYHO\ WHVWHG XVLQJ WKH $6P1 EUHHGLQJ VFKHPH )LJ f 0LFH KRPR]\JRXV IRU WKH $6P1 DOOHOH DQG KHWHUR]\JRXV IRU WKH WUDQVJHQH FRXOG QRW EH GLVWLQJXLVKHG IURP WKH $6P1 KHWHUR]\JRWHV E\ VRXWKHUQ EORW ,QVWHDG 51$ ZDV PDGH IURP WKH EUDLQV RI WUDQVJHQLF PLFH DQG VXEMHFWHG WR 573&5 ,I WKH $6P1 DOOHOH ZDV SUHVHQW LW ZDV DVVXPHG WKDW WKH SDWHUQDOO\ LQKHULWHG DOOHOH ZDV WKH $6P1 DOOHOH DQG QRW WKH ZLOGW\SH DOOHOH OHDYLQJ DQ\ ZLOGW\SH 6QUSQ H[SUHVVLRQ WR EH IURP WKH SDWHUQDOO\ LQKHULWHG WUDQVJHQH $FFRUGLQJ WR WKLV DVVD\ OLQHV & $ DQG % ZHUH DOO H[SUHVVHG XSRQ SDWHUQDO LQKHULWDQFH )LJ f 7KLV EUHHGLQJ VFKHPH ZDV QRW IXUWKHU SXUVXHG VLQFH LW UHTXLUHG WKH SURGXFWLRQ RI 51$ DQG VXEVHTXHQW 573&5 IURP HYHU\ WUDQVJHQLF PRXVH ,W ZDV DOVR QRW LGHDO WKDW WKH JHQRW\SH RI WKH PLFH ZDV QHYHU FHUWDLQ ZLWK UHVSHFW WR WKH 6QUSQ YHUVXV WKH $6P1 DOOHOH )XUWKHUPRUH WKH SRWHQWLDO IRU OHDN\ H[SUHVVLRQ IURP WKH PDWHUQDOO\ LQKHULWHG DOOHOH FRPSOLFDWHG DQ DVVD\ WKDW UHTXLUHG 573&5 7KH LPSULQWLQJ DVVD\V ZHUH DJDLQ WHVWHG XVLQJ WKH $3:6,& VWUDLQ DQG WKH EUHHGLQJ VFKHPHV VKRZQ LQ )LJXUHV $ DQG $ 6QUSQ H[SUHVVLRQ XSRQ PDWHUQDO LQKHULWDQFH ZDV WHVWHG LQ D VLPLODU PDQQHU DQG SURGXFHG WKH VDPH UHVXOWV DV SUHYLRXVO\ )LJ %f 6QUSQ H[SUHVVLRQ XSRQ SDWHUQDO LQKHULWDQFH RI WUDQVJHQHV SURYHG WR EH PXFK VLPSOHU XVLQJ WKH $3:6,& VWUDLQ 0LFH LQKHULWLQJ WKH $3:6,& DOOHOH ZHUH HDVLO\ JHQRW\SHG E\ 3&5 WKDW ZDV XQLPSHGHG E\ WKH WUDQVJHQH 7KHVH PLFH FRXOG DOVR EH LGHQWLILHG VKRUWO\ DIWHU ELUWK E\ WKHLU IDLOXUH WR WKULYH SKHQRW\SH ([SUHVVLRQ IURP WKH WUDQVJHQH LQ SXSV ZLWK D SDWHUQDOO\ LQKHULWHG WUDQVJHQH DQG D SDWHUQDOO\ LQKHULWHG $3:6 ,& DOOHOH FRXOG WKHQ EH DVVD\HG IRU 6QUSQ H[SUHVVLRQ E\ QRUWKHUQ EORW DQDO\VLV ZKLFK GRHV QRW GHWHFW WKH OHDN\ PDWHUQDO H[SUHVVLRQ %\ QRUWKHUQ DQDO\VLV DQ\ 6QUSQ

PAGE 60

H[SUHVVLRQ RULJLQDWHG IURP WKH WUDQVJHQH 8VLQJ WKH $3:6,& VWUDLQ OLQHV $ DQG % H[KLELWHG 6QUSQ H[SUHVVLRQ XSRQ SDWHUQDO WUDQVPLVVLRQ RI WKH WUDQVJHQH )LJ %f 6LQFH ERWK RI WKHVH OLQHV DUH DOVR VLOHQFHG XSRQ PDWHUQDO WUDQVPLVVLRQ WKH\ DUH ERWK FRUUHFWO\ LPSULQWHG /LQH & ZDV ILUVW VKRZQ WR H[KLELW 6QUSQ H[SUHVVLRQ XSRQ SDWHUQDO LQKHULWDQFH XVLQJ WKH $6P1 VWUDLQ EXW QRW ZLWK WKH $3:6,& VWUDLQ 7KH PRVW OLNHO\ H[SODQDWLRQ IRU WKLV LV WKDW WKH WUDQVJHQH LV LQGHHG H[SUHVVHG XSRQ SDWHUQDO LQKHULWDQFH EXW DW D ORZOHYHO WKDW LV GHWHFWDEOH E\ 573&5 EXW QRW E\ QRUWKHUQ DQDO\VLV ,W ZDV SUHFLVHO\ WKLV SRVVLELOLW\ WKDW OHG WR WKH XVH RI WKH $3:6,& VWUDLQ WR WHVW WUDQVJHQH LPSULQWLQJ ,W ZDV GHVLUDEOH WR PDLQWDLQ D KLJK OHYHO RI VWULQJHQF\ LQ FRQVLGHULQJ D WUDQVJHQH FRUUHFWO\ LPSULQWHG WKH SRVVLELOLW\ WKDW ORZOHYHO H[SUHVVLRQ FRXOG FRPH IURP D FRUUHFWO\ LPSULQWHG UHSUHVVHG DOOHOH H[LVWHG 6LQFH WKH H[SUHVVLRQ RI 6QUSQ IURP OLQH & FRXOG SRVVLEO\ UHSUHVHQW OHDN\ H[SUHVVLRQ RI D UHSUHVVHG DOOHOH DQG QRW DSSURSULDWH LPSULQWLQJ OLQH & ZDV QRW FRQVLGHUHG WR EH FRUUHFWO\ LPSULQWHG /LQHV $ DQG % GHPRQVWUDWHG DSSURSULDWH LPSULQWHG H[SUHVVLRQ LQGLFDWLQJ WKDW WKH\ FRQWDLQHG VXIILFLHQW VHTXHQFH WR FRQIHU SURSHU LPSULQWLQJ 7KLV ZDV DQ LPSRUWDQW ILQGLQJ VLQFH WKH $6,& KDV WR GDWH QRW EHHQ GHILQHG IXQFWLRQDOO\ RU SK\VLFDOO\ LQ PRXVH $FFRUGLQJ WR WKH FXUUHQW PRGHO IRU LPSULQWLQJ LQ WKH 3:6$6 UHJLRQ D FRUUHFWO\ LPSULQWHG WUDQVJHQH PXVW FRQWDLQ WKH PLQLPDO VHTXHQFH WR KDUERU WKH SRVLWLYHO\ DFWLQJ 3:6,& HOHPHQW DV ZHOO DV WKH QHJDWLYHO\ DFWLQJ $6,& HOHPHQW 7KH LGHQWLILFDWLRQ RI D FRUUHFWO\ LPSULQWHG WUDQVJHQH LQGLFDWHV WKDW WKH $6,& FDQ EH IXQFWLRQDOO\ GHILQHG LQ PRXVH VLQFH LQ WKLV LQVWDQFH WKH VLOHQFLQJ IXQFWLRQ RFFXUV RQ D WUDQVJHQH WKDW LV LQWHJUDWHG LQWR D UDQGRP JHQRPLF ORFDWLRQ 7KH WUDQVJHQH WKHQ VHUYHV WR

PAGE 61

GHILQH DQ DSSUR[LPDWH ORFDWLRQ RI WKH $6,& DQG FRPELQHG WUDQVJHQH GDWD VXJJHVWV WKDW LW OLHV XSVWUHDP RI WKH 3:6,& DV LW GRHV LQ KXPDQV 7KH $ OLQH GHILQLWLYHO\ QDUURZV WKLV ERXQGDU\ WR D UHJLRQ ZLWKLQ NE RI WKH 6QUSQ JHQH 7KH % WUDQVJHQLF OLQH KDV XQGHUJRQH WUXQFDWLRQV DW ERWK WKH f DQG f HQG RI WKH %$& EXW LV VWLOO LPSULQWHG 7KHVH WUXQFDWLRQV QDUURZ WKH SUREDEOH ORFDWLRQ RI WKH $6,& WR D UHJLRQ NE f RI 6QUSQ EXW VLQFH WKH QDWXUH RI WKH WUDQVJHQH UHDUUDQJHPHQWV DUH QRW ZHOO XQGHUVWRRG WKH XVH RI WKLV GDWD WR VXJJHVW WKH ORFDWLRQ RI WKH $6,& PXVW EH GRQH ZLWK FDXWLRQ 7KH DELOLW\ WR XVH WKH ODPEGD 5HG V\VWHP RI KRPRORJRXV UHFRPELQDWLRQ LQ %$&V ZLOO JUHDWO\ VLPSOLI\ WKH VWXG\ RI WUDQVJHQH LPSULQWLQJ $ ODWHQW PDUN FDQ QRZ EH SODFHG LQWR WKH 6QUSQ ORFXV DQG LWV H[SUHVVLRQ XSRQ ERWK PDWHUQDO DQG SDWHUQDO LQKHULWDQFH FDQ EH DVFHUWDLQHG LQ D VLQJOH JHQHUDWLRQ 7KLV VDPH V\VWHP FDQ EH XVHG WR PDNH GHOHWLRQV LQ WKH PRVW f HQG RI %$& WR EHWWHU LGHQWLI\ WKH $6,& 7KHQ VSHFLILF HOHPHQWV FDQ EH GHOHWHG UHSODFHG RU UHDUUDQJHG WR WHVW GLIIHUHQW PRGHOV RI LPSULQWLQJ PHFKDQLVPV LQ WKH 3:6$6 UHJLRQ

PAGE 62

6QUSQ JHQH f SUREH f SUREH ,SZ ,$3 A f NE NE L NE 6+" B % <$& )LJXUH 5HVWULFWLRQ PDS RI <$& FORQH DQG 6Y %$& OLEUDU\ FORQHV <$& DQG %$&V ZHUH VXEMHFWHG WR UHVWULFWLRQ GLJHVWLRQ ZLWK UDUH FXWWLQJ HQ]\PHV DQG DQDO\]HG E\ SXOVHILHOG JHO HOHFWURSKRUHVLV DQG VRXWKHUQ DQDO\VLV 7KLQ YHUWLFDO OLQHV UHSUHVHQW 6DLO VLWHV %ODFN ER[HV UHSUHVHQW WKH 6QUSQ JHQH RU ,SZ ,$3 HOHPHQW 7KH f SUREH LV D NE 6DFO1RWO IUDJPHQW ZKLOH WKH f SUREH LV D NE enFR5,enFR59 IUDJPHQW

PAGE 63

) QHR WU O ‘‘‘‘ +RPRORJRXV UHFRPELQDWLRQ 6DLO GLJHVWLRQ + L /LJDWLRQ LQWR 6DLO GLJHVWHG %$& + 6WLUSQ &UH UHFRPELQDVH 6QUSQ NE NE )LJXUH 6WUDWHJ\ WR FRPELQH %$&V ) DQG % 7KH VWUDWHJ\ IRU MRLQLQJ WZR %$&V WR FUHDWH RQH RI DQ LGHDO VL]H LV GLDJUDPPHG 9HUWLFDO KDVK PDUNV LQGLFDWH 6DLO VLWHV 'DVKHG OLQH UHSUHVHQWV %$& YHFWRU

PAGE 64

6QUSQ JHQH f SUREH f SUREH f /B,___ L L L L O 3, PXULQHf L L L NE L NE NE NE L L L L L L NE c NE L L L L L L L L L L L L NE NE c L L L L L L L L L L L L L L L L L NE )LJXUH 5HVWLFWLRQ PDS RI &%/ %$& FORQHV %$& FORQHV ZHUH VXEMHFWHG WR UHVWULFWLRQ GLJHVWLRQ DQG DQDO\]HG E\ SXOVHILHOG HOHFWURSKRUHVLV DQG VRXWKHUQ DQDO\VLV 7KH f SUREH LV D NE 6DFO1RWO IUDJPHQW ZKLOH WKH f SUREH LV D NE )FR5,)FR59 IUDJPHQW 9HUWLFDO KDVK PDUNV UHSUHVHQW 6DLO VLWHV 1RW DOO FORQHV DUH GLDJUDPPHG

PAGE 65

3, FRS\ LQWDFW FRSLHV LQWDFW $ FRSLHV LQWDFW % FRS\ UHDUUDQJHG & FRS\ LQWDFW $ FRS\ LQWDFW % FRSLHV LQWDFW $ FRSLHV LQWDFW % FRS\ LQWDFW & FRS\ WUXQFDWHG FRS\ LQWDFW )LJXUH 7UDQVJHQLF OLQHV LQYHVWLJDWHG IRU LPSULQWHG H[SUHVVLRQ &RS\ QXPEHU DQG LQWDFWQHVV LV LQGLFDWHG DFFRUGLQJ WR DYDLODEOH SUREHV

PAGE 66

6QUSQ ORFXV F 0LOO ,, )LJXUH /RFDWLRQ RI SUREHV DURXQG WKH 6QUSQ ORFXV 3UREH $ UHSUHVHQWV $ NE 3&5 IUDJPHQW NE f RI 6QUSQ 3UREH % LV D NE 6DFO1RWO IUDJPHQW WKDW LV NE f RI 6QUSQ 3UREH & LV D SUREH IRU H[RQ RI 6QUSQ 3UREH LV D NE )FR5,)FR59 IUDJPHQW NE f RI 6QUSQ

PAGE 67

6QUSQ ORFXV O OOOOO ,, $6P1 DOOHOH O :f§,f§f§ $3:6,& DOOHOH )LJXUH 6QUSQ ORFXV $6P1 DOOHOH DQG $3:6,& DOOHOH VWUXFWXUHV 7KH $6P1 DOOHOH UHSUHVHQWV D GHOHWLRQ RI H[RQV RI WKH 6QUSQ JHQH 7KH 1HRP\FLQ UHVLVWDQFH FDVVHWH 1HRf SURGXFHV D ODUJHU IXVLRQ WUDQVFULSW E\ 1RUWKHUQ EORW WKXV PDUNLQJ WKDW DOOHOH 7KH $3:6,& DOOHOH UHSUHVHQWV D NE GHOHWLRQ WKDW LQFOXGHV NE RI VHTXHQFH f RI 6QUSQ DV ZHOO DV H[RQV RI WKH 6QUSQ JHQH

PAGE 68

0DWHUQDO WUDQVPLVVLRQ 3DWHUQDO WUDQVPLVVLRQ )LJXUH %UHHGLQJ VFKHPH IRU WHVWLQJ H[SUHVVLRQ XSRQ PDWHUQDO DQG SDWHUQDO WUDQVPLVVLRQ RI WUDQVJHQHV 7J UHSUHVHQWV DQ\ WUDQVJHQH ZKLOH NR UHSUHVHQWV WKH $6P1 DOOHOH 0DWHUQDO DQG SDWHUQDO DOOHOHV DUH LQGLFDWHG ZKHUH UHOHYDQW 2QO\ RIIVSULQJ RI WKH GHVLUHG JHQRW\SH DUH LQGLFDWHG

PAGE 69

/LQH $6P1 6QUSQ )LJXUH ([SUHVVLRQ RI 6QUSQ IURP WUDQVJHQHV XSRQ PDWHUQDO WUDQVPLVVLRQ 7KH XSSHU EDQG UHVXOWV IURP D SDWHUQDOO\ LQKHULWHG $6P1 DOOHOH WKDW FUHDWHV D IXVLRQ WUDQVFULSW WKDW LV ODUJHU WKDQ WKH QRUPDO 6QUSQ PHVVDJH 6QUSQ LV RQO\ H[SUHVVHG IURP WUDQVJHQHV XSRQ PDWHUQDO LQKHULWDQFH LQ OLQHV $ % DQG '

PAGE 70

$ $6P1 DOOHOH (QGRJHQRXV DOOHOH WUDQVJHQH % $ % & 1R57 $6P1 DOOHOH (QGRJHQRXV DOOHOH WUDQVJHQH )LJXUH ([SUHVVLRQ RI 6QUSQ IURP WUDQVJHQHV XSRQ SDWHUQDO LQKHULWDQFH $ 3&5 SULPHU ORFDWLRQV IRU HDFK DOOHOH % 573&5 VKRZLQJ $6P1 DQG ZLOGW\SH DOOHOHV 7KH SUHVHQFH RI WKH $6P1 DOOHOH LQGLFDWHV WKDW WKH SDWHUQDOO\ LQKHULWHG HQGRJHQRXV DOOHOH ZDV WKH $6P1 DOOHOH DQG WKHQ H[SUHVVLRQ RI WKH ZLOGW\SH DOOHOH LQGLFDWHV H[SUHVVLRQ RI WKH WUDQVJHQH ,I WKH $6P1 DOOHOH LV QRW SUHVHQW WKHQ WKH SDWHUQDOO\ LQKHULWHG HQGRJHQRXV DOOHOH LV DVVXPHG WR EH D ZLOGW\SH DOOHOH DQG WKLV PRXVH LV XQLQIRUPDWLYH IRU WUDQVJHQH H[SUHVVLRQ

PAGE 71

$ % V m 24 fR e e 1 ‘f§r 1 f L \ ‹ b &2 &R L mnQ )LJXUH 7UDQVJHQLF H[SUHVVLRQ RI 6QUSQ XSRQ PDWHUQDO WUDQVPLVVLRQ RI WUDQVJHQHV $ %UHHGLQJ VFKHPH XVHG WR DVVD\ WUDQVJHQLF H[SUHVVLRQ XVLQJ WKH $3:6,& VWUDLQ 7J UHSUHVHQWV DQ\ WUDQVJHQH ZKLOH NR UHSUHVHQWV WKH $3:6,& DOOHOH 0DWHUQDO DQG SDWHUQDO DOOHOHV DUH LQGLFDWHG ZKHUH UHOHYDQW 1RWH WKDW $3:6,& SXSV DUH PLVVLQJ DOO SDWHUQDOO\ H[SUHVVHG JHQH SURGXFWV LQ WKLV UHJLRQ DQG VXFFXPE WR QHRQDWDO OHWKDOLW\ ZKHQ WKH $3:6,& DOOHOH LV SDWHUQDOO\ LQKHULWHG % 1RUWKHUQ EORW VKRZLQJ 6QUSQ H[SUHVVLRQ LQ WUDQVJHQLF SXSV LQKHULWLQJ D SDWHUQDO $3:6,& DOOHOH DQG D PDWHUQDO WUDQVJHQLF DOOHOH

PAGE 72

$ VW *HQHUDWLRQ QG *HQHUDWLRQ % e e D e D e 1 &4 R ff§r &1 t 1 )LJXUH 7UDQVJHQLF H[SUHVVLRQ RI 6QUSQ XSRQ SDWHUQDO WUDQVPLVVLRQ RI WUDQVJHQHV $ %UHHGLQJ VFKHPH XVHG WR DVVD\ WUDQVJHQLF H[SUHVVLRQ XVLQJ WKH $3:6,& VWUDLQ 7J UHSUHVHQWV DQ\ WUDQVJHQH ZKLOH NR UHSUHVHQWV WKH $3:6,& DOOHOH 0DWHUQDO DQG SDWHUQDO DOOHOHV DUH LQGLFDWHG ZKHUH UHOHYDQW 1RWH WKDW $3:6,& SXSV DUH PLVVLQJ DOO SDWHUQDOO\ H[SUHVVHG JHQH SURGXFWV LQ WKLV UHJLRQ DQG VXFFXPE WR QHRQDWDO OHWKDOLW\ ZKHQ WKH $3:6,& DOOHOH LV SDWHUQDOO\ LQKHULWHG % 1RUWKHUQ EORW VKRZLQJ WKDW 6QUSQ LV H[SUHVVHG XSRQ SDWHUQDO H[SUHVVLRQ LQ OLQHV $ DQG % OLQHV DUH QRW VKRZQ

PAGE 73

&+$37(5 675$,1'(3(1'(17 ',))(5(1&(6 ,1 3+(127<3( ,QWURGXFWLRQ $QJHOPDQ 6\QGURPH $6f DQG 3UDGHU:LOOL 6\QGURPH 3:6f DUH FDXVHG E\ GHILFLHQFLHV LQ JHQHV VXEMHFW WR JHQRPLF LPSULQWLQJ 3:6 LV FKDUDFWHUL]HG E\ LQIDQWLOH K\SRWRQLD JRQDGDO K\SRSODVLD VKRUW VWDWXUH D PRGHUDWH GHOD\ LQ SK\VLFDO DQG PHQWDO GHYHORSPHQW DQG REVHVVLYHFRPSXOVLYH EHKDYLRU DV ZHOO DV QHRQDWDO IHHGLQJ GLIILFXOWLHV IROORZHG ODWHU E\ K\SHUSKDJLD OHDGLQJ WR SURIRXQG REHVLW\ $6 LV FKDUDFWHUL]HG E\ VHYHUH PHQWDO UHWDUGDWLRQ DEVHQW VSHHFK DWD[LF JDLW DQG D KDSS\ GHPHDQRU $SSUR[LPDWHO\ b RI 3:6 SDWLHQWV KDYH D PHJDEDVH GHOHWLRQ RI WKH SDWHUQDO FKURPRVRPH TO TO 7KH FOLQLFDOO\ GLVWLQFW $6 UHVXOWV IURP WKH VDPH TO TO GHOHWLRQ LQ DERXW b RI SDWLHQWV KRZHYHU WKH GHOHWLRQ LV DOZD\V RQ WKH PDWHUQDOO\ LQKHULWHG FKURPRVRPH (LWKHU V\QGURPH FDQ DOVR UHVXOW IURP XQLSDUHQWDO GLVRP\ 83'f LQ ZKLFK ERWK FRSLHV RI FKURPRVRPH DUH LQKHULWHG IURP RQO\ RQH SDUHQW 7KH 83' LV DOZD\V PDWHUQDO LQ 3:6 SDWLHQWV DQG SDWHUQDO LQ $6 SDWLHQWV 7KH LGHQWLILFDWLRQ RI ERWK RI WKHVH FODVVHV RI SDWLHQWV KDV OHG WR WKH FRQFOXVLRQ WKDW 3:6 LV FDXVHG E\ D ORVV RI JHQH H[SUHVVLRQ IURP WKH SDWHUQDOO\ LQKHULWHG FKURPRVRPH ZKHUHDV $6 LV FDXVHG E\ D ORVV RI JHQH H[SUHVVLRQ IURP WKH PDWHUQDOO\ LQKHULWHG FKURPRVRPH 0DQ\ $6 SDWLHQWV KDYH EHHQ VKRZQ WR FRQWDLQ LQWUDJHQLF PXWDWLRQV LQ WKH 8%($ JHQH LQGLFDWLQJ WKDW PXWDWLRQV LQ 8%($ DUH VXIILFLHQW WR FDXVH $6 ,Q FRQWUDVW WR $6 QR VLQJOH JHQH KDV EHHQ LGHQWLILHG IRU 3:6 VWURQJO\ VXJJHVWLQJ WKDW 3:6 LV D

PAGE 74

FRQWLJXRXV JHQH V\QGURPH UHTXLULQJ WKH ORVV RI WZR RU PRUH SDWHUQDOO\ H[SUHVVHG JHQHV WR FDXVH WKH 3:6 SKHQRW\SH $OO WKH 3:6 FDQGLGDWH ORFL LGHQWLILHG WR GDWH LQ KXPDQV DQG PLFH DUH H[SUHVVHG H[FOXVLYHO\ IURP WKH SDWHUQDOO\ LQKHULWHG FKURPRVRPH 7KHVH LQFOXGH 0.510NUQ SUHYLRXVO\ NQRZQ DV =1)=ISOf 0$*(/0DJHO 1'11GQ 615316QUSQ +%,, +%,,0E,, +%,, +%,, $ +%,,0E,, ,3:,SZ +%,,0E,, +%,,% DQG DQ DQWLVHQVH WUDQVFULSW WR WKH 8%($ JHQH 5HFHQWO\ WKH ODWWHU JHQHV 61531 WKURXJK WKH DQWLVHQVH 8%($ WUDQVFULSWf ZHUH VKRZQ WR EH GHULYHG IURP D VLQJOH WUDQVFULSWLRQDO XQLW 7KH LPSULQWHG JHQHV LQYROYHG LQ $6 DQG 3:6 DUH UHJXODWHG E\ D ELSDUWLWH LPSULQWLQJ FHQWHU ,&f ORFDWHG XSVWUHDP RI WKH 61531 JHQH 7KH ,& LV GLYLGHG LQWR WKH $QJHOPDQ 6\QGURPH ,PSULQWLQJ &HQWHU $6,&f DQG WKH 3UDGHU:LOOL 6\QGURPH ,PSULQWLQJ &HQWHU 3:6,&f 3UHYLRXVO\ LW ZDV GHPRQVWUDWHG WKDW WKH 3:6,& LV IXQFWLRQDOO\ FRQVHUYHG LQ WKH PRXVH $ NE GHOHWLRQ PXWDWLRQ WKH GHOHWLRQ ZDV RULJLQDOO\ UHSRUWHG WR EH NE EXW LV QRZ NQRZQ WKDW WKH RULJLQDO PDS ZDV EDVHG RQ D VWUDLQ WKDW FRQWDLQHG D 9/ LQVHUWLRQf ZDV FUHDWHG LQ D PDOH HPEU\RQLF VWHP (6f FHOO OLQH 7KLV NE GHOHWLRQ LQFOXGHG NE RI XSVWUHDP VHTXHQFH SOXV H[RQV RI WKH 6QUSQ JHQH %UHHGLQJ PDOH FKLPHULF IRXQGHUV 6Yf KDUERULQJ D PDWHUQDO GHOHWLRQ PXWDWLRQ WR ZLOGW\SH IHPDOHV &%/-f UHVXOWHG LQ PXWDQW RIIVSULQJ WKDW XVXDOO\ GLHG ZLWKLQ KRXUV EXW QHYHU VXUYLYHG EH\RQG GD\V DIWHU ELUWK 7KHVH PLFH H[KLELWHG VHYHUDO SKHQRW\SHV VLPLODU WR WKRVH IRXQG LQ 3:6 LQIDQWV LQFOXGLQJ VPDOO VL]H SRRU IHHGLQJ DQG IDLOXUH WR WKULYH ,Q DGGLWLRQ WKHVH SURJHQ\ ZHUH VKRZQ WR ODFN H[SUHVVLRQ RI

PAGE 75

WKH ORFDO SDWHUQDOO\ H[SUHVVHG JHQHV 0NUQ DND =ISOf 1GQ DQG ,SZ DV ZHOO DV 0DJHO 0E,, 0E,, DQG 0E,, fn 6LQFH JHUPOLQH WUDQVPLVVLRQ IURP FKLPHULF PDOHV SURGXFHG PXWDQW RIIVSULQJ WKDW GLHG SULRU WR ZHDQLQJ WKLV NE GHOHWLRQ PXWDWLRQ ZDV UHFUHDWHG XVLQJ IHPDOH ;2f (6 FHOOV $V H[SHFWHG WUDQVPLVVLRQ RI WKH GHOHWLRQ PXWDWLRQ IURP IHPDOH FKLPHUDV UHVXOWHG LQ QRUPDO KHWHUR]\JRXV FDUULHU RIIVSULQJ &RQVLVWHQW ZLWK SUHYLRXV REVHUYDWLRQV KHWHUR]\JRXV FDUULHU PDOHV 6Yf EUHG WR &%/IHPDOHV SURGXFHG PXWDQW RIIVSULQJ WKDW GLG QRW VXUYLYH XQWLO ZHDQLQJ HYHQ LI WKH ZLOGW\SH VLEOLQJV ZHUH UHPRYHG WR UHGXFH FRPSHWLWLRQ 7KLV VWUDLQ KDV EHHQ XVHG WR EUHHG XQDIIHFWHG PDOHV $3:6,& FDUULHUV ZLWK PLFH RI GLIIHUHQW JHQHWLF EDFNJURXQGV WR VWXG\ SKHQRW\SLF YDULDWLRQ +HUH ORQJWHUP VXUYLYDO RI $3:6,& PLFH XSRQ EUHHGLQJ WR VHYHUDO VWUDLQ EDFNJURXQGV LV UHSRUWHG 0DWHULDOV DQG 0HWKRGV 6WUDLQV DQG 0DWLQJV 0RXVH VWUDLQV XVHG ZHUH $3:6,& GHOHWLRQ PLFH EDFNFURVVHG RQWR D &%/JHQHWLF EDFNJURXQG IRU JHQHUDWLRQV &%/)9%16Y &++H'%$DQG &%/FRQJHQLH IRU D UHJLRQ RI 0XV PXVFXOXV FDVWDQHXV FKURPRVRPH %&$67Ff $3:6,& PDOHV ZHUH PDWHG ZLWK IHPDOHV RI WKH VWUDLQV GHVFULEHG DERYH WR SURGXFH DIIHFWHG 3:6 SURJHQ\ SXSV ZKLFK ZHUH XVHG WR DVFHUWDLQ VXUYLYDO DQG JHQH H[SUHVVLRQ )RU %&$67F [ )9%1-f ) PDWLQJV %&$67F IHPDOHV ZHUH PDWHG ZLWK )9%1PDOHV &RQYHUVHO\ )9%1[ %&$67Ff ) PDWLQJV ZHUH SURGXFHG XVLQJ )9%1IHPDOHV DQG %&$67F PDOHV

PAGE 76

&XOOLQJ DQG )RVWHULQJ /LWWHUV UHVXOWLQJ IURP PDWLQJV ZLWK $3:6,& PDOHV ZHUH VHOHFWLYHO\ FXOOHG WR DLG VXUYLYDO RI DIIHFWHG $3:6,& SXSV &XOOLQJ ZDV FDUULHG RXW E\ VDFULILFLQJ DOO RI WKH ZLOGW\SH SXSV H[FHSW RQH ZLWKLQ WZR GD\V DIWHU ELUWK GHSHQGLQJ RQ ZKHWKHU RU QRW ZLOG W\SH SXSV FRXOG EH GLVWLQJXLVKHG IURP WKHLU $3:6,& OLWWHUPDWHV 2QH ZLOGW\SH SXS ZDV OHIW WR VWLPXODWH PLON SURGXFWLRQ LQ WKH DEVHQFH RI UREXVW SXSV 0LFH ZHUH IRVWHUHG WR DQRWKHU PRWKHU E\ UHPRYLQJ WKH $3:6,& SXSV IURP RQH PRWKHU XVXDOO\ IURP WKH &%/VWUDLQf DQG JLYLQJ WKHP WR WKH RWKHU PRWKHU XVXDOO\ IURP WKH )9%1VWUDLQf ZKRVH SXSV KDG EHHQ UHPRYHG $GGLWLRQDOO\ XULQH IURP WKH IRVWHU PRWKHU ZDV ZLSHG RQ WKH IRVWHU SXSV WR DLG LQ KHU DFFHSWDQFH RI WKH QHZ SXSV ,Q VRPH IRVWHULQJ FDVHV WZR PRWKHUV RI GLIIHUHQW VWUDLQV ZHUH VHW XS WR OLWWHU WRJHWKHU DQG WKH OLWWHU IURP WKH )9%1PRWKHU ZDV WKHQ UHPRYHG DQG WKH ZLOGW\SH OLWWHUPDWHV IURP WKH RWKHU PRWKHU ZHUH FXOOHG 7KLV DOORZHG WZR QHZ PRWKHUV WR FDUH IRU D VPDOO QXPEHU RI $3:6,& SXSV ,GHQWLILFDWLRQ RI 3RO\PRUSKLVPV 7RWDO EUDLQ 51$ ZDV SUHSDUHG IURP ERWK 6Y PLFH DQG %&$67F PLFH (DFK 51$ VDPSOH ZDV XVHG WR FUHDWH VLQJOHVWUDQGHG F'1$ XVLQJ UDQGRP SULPHUV LQ D UHYHUVH WUDQVFULSWLRQ UHDFWLRQ 7KHVH F'1$V ZHUH XVHG WR SURJUDP 3&5 UHDFWLRQV XVLQJ SULPHUV FRUUHVSRQGLQJ WR 8EHD H[RQV DQG f&&7*&$*$&77*$$*$$*&$*n 6f DQG f*$$$$&&7&7*&*$$$7*&&77ff 7KH UHVXOWLQJ SURGXFWV ZHUH FORQHG VHTXHQFHG DQG FRPSDUHG $ SRO\PRUSKLVP IRXQG LQ H[RQ FUHDWHG D 7VSO UHVWULFWLRQ VLWH LQ WKH 6Y FORQH DQG D %VW&O VLWH DW WKH VDPH ORFDWLRQ LQ WKH %&$67F FORQH $ SRO\PRUSKLF $YDLO VLWH EHWZHHQ 0XV PXVFXOXV FDVWDQHXV DQG 0XV PXVFXOXV GRPHVWLFXV ZDV LGHQWLILHG DQG NLQGO\ SURYLGHG WR XV E\ 0DULVD %DUWRORPHL 0

PAGE 77

%DUWRORPHL SHUVRQDO FRPPXQLFDWLRQf 7KLV SRO\PRUSKLVP UHVXOWV IURP D F\WRVLQH QXFOHRWLGH UDWKHU WKDQ D WK\PLQH QXFOHRWLGH DW SRVLWLRQ RI WKH 1GQ WUDQVFULSW $YDLO FXWV WKH GRPHVWLFXV DOOHOH EXW QRW WKH FDVWDQHXV DOOHOH GXH WR WKH SUHVHQFH RI WKH F\WRVLQH QXFOHRWLGH 3&5 SULPHUV IODQNLQJ WKH SRO\PRUSKLF UHVWULFWLRQ VLWH ZHUH GHVLJQHG DV IROORZV 1GQSRO\) f $& $$$*7 $$**$&&7*$*&* $&& f DQG 1GQSRO\5 f &$$&$7&77&7$7&&*77&77&*f 7KH 3&5 SURGXFW DPSOLILHG XVLQJ 1GQSRO\) DQG 1GQSRO\5 ZDV JHO SXULILHG RQ D b DJDURVH JHO H[WUDFWHG IURP WKH JHO XVLQJ WKH 4,$*(1 JHO H[WUDFWLRQ NLW DQG GLJHVWHG ZLWK $YDLO 7KH GLJHVWHG SURGXFWV ZHUH HOHFWURSKRUHVHG RQ D b DJDURVH JHO ORZPHOW DJDURVH DJDURVHf 573&5 7RWDO 51$ ZDV LVRODWHG IURP FRPSOHWH EUDLQV REWDLQHG IURP QHRQDWDO ZHHN ROG ZHHN ROG DQG ZHHN ROG PLFH 51$ ZDV H[WUDFWHG XVLQJ 51$]RO 7HO7HVW ,QFf DFFRUGLQJ WR LQVWUXFWLRQV 7KH WRWDO EUDLQ 51$ SJf ZDV SUHWUHDWHG ZLWK '1DVHO ,QYLWURJHQf DQG KDOI RI WKH UHDFWLRQ ZDV VXEVHTXHQWO\ XVHG WR V\QWKHVL]H ILUVWVWUDQG F'1$ ZLWK 6XSHUVFULSW ,, UHYHUVH WUDQVFULSWDVH 57f DQG UDQGRP SULPHUV ,QYLWURJHQf 7KH RWKHU KDOI RI WKH UHDFWLRQ ZDV PDQLSXODWHG LQ SDUDOOHO LQ WKH DEVHQFH RI 57 2QH WZHQWLHWK RI WKH 57 RU 57 UHDFWLRQV ZDV XVHG WR VHHG 3&5V XVLQJ WKH IROORZLQJ FRQGLWLRQV O2P0 7ULV+&O S+ P0 .& WKH IRXU G173V DW P0 HDFK XQLW 7DT '1$ SRO\PHUDVH %RHKULQJHUf DQG WKH DSSURSULDWH SULPHUV DW S0 HDFK 6HTXHQFHV RI WKH SULPHUV ZHUH DV IROORZV 1GQ ) f *7$7&&&$$$7&&$&$ *7*& ff 1GQ 25 f &77&&7*7*&&$*77*$$*7 ff 1GQSRO\ ) f $&$$$ *7 $$**$&&7*$*&* $&& ff 1GQSRO\ 5 f &$$&$7&77&7$7&&*77&

PAGE 78

77&* ff 8EHD ) f &$&$7$7*$7*$$*&7$&*$ ff 8EHD LQWURQ 5 f &$*$$$*$*$$*7*$**77* ff 6QUSQ1OO f &7*$**$*7*$77*&$ $&*& ff 6QUSQ 1 f *77&7 $** $ $77 $7*$*&&&& ff DFWLQ ) f *7***&&*&7&7$**&$&&$$ ff DQG DFWLQ 5 f &7&777*$7*7&$ &*&$&*$777& ff 3&5 DPSOLILFDWLRQV FRQGLWLRQV ZHUH r & IRU PLQ IROORZHG E\ HLWKHU RU F\FOHV RI r & IRU V r & IRU V DQG r & IRU V 7KH ILQDO F\FOH ZDV IROORZHG E\ DQ H[WHQVLRQ VWHS IRU PLQ DW r & 1RUWKHUQ %ORW $QDO\VLV 7R GHWHFW WKH SUHVHQFH RI SURFHVVHG VQR51$V WRWDO 51$ ZDV VHSDUDWHG RQ b GHQDWXULQJ SRO\DFU\ODPLGH JHOV 0 XUHD ,; 7%( EXIIHUf DQG WUDQVIHUUHG WR Q\ORQ PHPEUDQHV +\ERQG 1f XVLQJ D VHPLGU\ EORWWLQJ DSSDUDWXV 7UDQVEORW 6' %LR5DGf DV GHVFULEHG E\ &DYDGOH HW DO 51$ ZDV IL[HG WR WKH PHPEUDQH E\ EDNLQJ DW r & LQ D YDFXXP RYHQ 7KH PHPEUDQHV ZHUH SUHK\EULGL]HG DQG K\EULGL]HG RYHUQLJKW DW r & DFFRUGLQJ WR WKH &KXUFK DQG *LOEHUW PHWKRG 2OLJRQXFOHRWLGHV FRPSOHPHQWDU\ WR VQR51$ VHTXHQFHV ZHUH HQGODEHOHG XVLQJ D 3G$73 1(1f DQG 7 SRO\QXFOHRWLGH NLQDVH ,QYLWURJHQf 7KHLU VHTXHQFHV DUH DV IROORZV 0E,, f 77&&*$7*$*$* 7**&**7$&$*$ ff 0E,O f &&7&$*&*7$$7&&7$77*$*&$7*$$ ff DQG 6 U51$ f 7&&7*& $$77& $& $77 $$77&7&*& $*&7 $*& ff 3UREHV ZHUH SXULILHG IURP IUHH QXFOHRWLGHV XVLQJ WKH QXFOHRWLGH UHPRYDO NLW 4,$*(1f 0HPEUDQHV XVHG IRU GHWHFWLQJ VQR51$ H[SUHVVLRQ ZHUH ZDVKHG WZLFH IRU PLQ DW URRP WHPSHUDWXUH XVLQJ ; 66& b 6'6 DQG WKHQ H[SRVHG WR .RGDN ;$5 ILOP DW r & IRU KRXUV

PAGE 79

5HVXOWV ,Q FRQWUDVW WR WKH IXOO\ SHQHWUDQW QHRQDWDO OHWKDOLW\ SKHQRW\SH SUHYLRXVO\ VHHQ RQ WKH &%/VWUDLQ EDFNJURXQG $3:6,& FDUULHU PDOHV RQ WKH 6Y VWUDLQ EDFNJURXQG RU $3:6,& FDUULHU PDOHV PDGH FRQJHQLH RQ WKH &%/EDFNJURXQG EUHG WR ZLOGW\SH IHPDOH )9%1PLFH SURGXFHG VHYHUDO PXWDQW RIIVSULQJ WKDW VXUYLYHG WR WZR ZHHNV RI DJH )XUWKHUPRUH LI PRVW RI WKH ZLOGW\SH FRPSHWLWRU VLEV DUH UHPRYHG WKH PXWDQW RIIVSULQJ FRXOG VXUYLYH WR DGXOWKRRG $OWKRXJK WKHVH VXUYLYLQJ $3:6,& PLFH DUH VLJQLILFDQWO\ VPDOOHU WKDQ ZLOGW\SH VLEV )LJ f ERWK PDOHV DQG IHPDOHV DUH IHUWLOH 7R H[DPLQH ZKHWKHU WKH LQFUHDVHG VXUYLYDO ZDV VLPSO\ GXH WR VXSHULRU PRWKHULQJ DELOLWLHV RI WKH )9%1IHPDOHV DV FRPSDUHG WR &%/IHPDOHV QHZERUQ SXSV ZHUH IRVWHUHG WR PRWKHUV RI WKH RSSRVLWH VWUDLQ DQG DOVR WULR PDWLQJV RI D $3:6,& FDUULHU PDOH ZLWK ERWK DQ )9%1DQG D &%/IHPDOH ZHUH HVWDEOLVKHG ,Q ERWK VLWXDWLRQV VXUYLYDO RI RQO\ WKRVH ) PLFH ERUQ WR WKH )9%1IHPDOHV ZDV REVHUYHG GHPRQVWUDWLQJ WKDW LW LV WKH JHQHWLF EDFNJURXQG RI HLWKHU WKH RIIVSULQJ RU WKH PRWKHU WKDW OHDGV WR VXUYLYDO UDWKHU WKDQ WKH VNLOO RI WKH PRWKHU GDWD QRW VKRZQf 1H[W WKH H[SUHVVLRQ RI VHYHUDO 3:6 FDQGLGDWH JHQHV LQ WKHVH VXUYLYLQJ )9%1[ $3:6,&f )L PLFH ZDV H[DPLQHG 6XUSULVLQJO\ ORZ OHYHOV RI 1GQ DQG DQWLVHQVH 8EHD H[SUHVVLRQ ZDV GHWHFWHG E\ 573&5 LQ QHZERUQ PLFH GDWD QRW VKRZQf %\ 1RUWKHUQ EORW H[SUHVVLRQ RI VHYHUDO VQR51$V PDSSLQJ WR WKH UHJLRQ ZDV DOVR GHWHFWHG GDWD QRW VKRZQf 7KHVH UHVXOWV ZHUH XQH[SHFWHG DV H[SUHVVLRQ RI WKHVH JHQHV LQ SXSV ZLWK D SDWHUQDOO\ LQKHULWHG 3:6,& GHOHWLRQ KDG QRW EHHQ SUHYLRXVO\ GHWHFWHG +RZHYHU ZKHQ 51$ H[SUHVVLRQ IURP WKH f KDOI RI WKH 6QUSQ JHQH D UHJLRQ WKDW LV SK\VLFDOO\ GHOHWHG

PAGE 80

IURP WKH SDWHUQDOO\ LQKHULWHG $3:6,& DOOHOH ZDV H[DPLQHG H[SUHVVLRQ ZDV GHWHFWHG E\ 573&5 GDWD QRW VKRZQf 7KHUHIRUH WKLV VWURQJO\ VXJJHVWHG WKDW ORZOHYHO H[SUHVVLRQ GHWHFWHG IRU 1GQ DQWLVHQVH 8EHD 0EO, DQG 6QUSQ LV GHULYHG DW OHDVW VRPHZKDW IURP OHDN\ H[SUHVVLRQ RI WKH PDWHUQDO )9%1DOOHOH $ WLPH FRXUVH IRU WKH REVHUYHG ORZ OHYHO H[SUHVVLRQ RI 1GQ DQG 6QUSQ DW QHZERUQ ZHHN ZHHNV DQG ZHHNV RI DJH ZDV IROORZHG DQG WKH OHDN\ H[SUHVVLRQ ZDV GHWHFWDEOH LQ DOO DJHV RI PLFH )LJf ,W ZDV K\SRWKHVL]HG WKDW H[SUHVVLRQ RI WKHVH JHQHV LV VXIILFLHQW WR UHVFXH WKH OHWKDOLW\ SKHQRW\SH DVVRFLDWHG ZLWK WKH $3:6,& PXWDWLRQ 1H[W WKH H[WHQGHG VXUYLYDO DQG OHDN\ H[SUHVVLRQ RI WKHVH LPSULQWHG JHQHV ZDV LQYHVWLJDWHG WR GHWHUPLQH LI LW ZDV UHVWULFWHG WR WKH )9%1VWUDLQ )HPDOHV IRU WKH &%/'%$%$/%F&++HDQG 6Y(Y VWUDLQV ZHUH PDWHG WR $3:6,& FDUULHU PDOHV RQ WKH &%/JHQHWLF EDFNJURXQG :LOGW\SH SXSV ZHUH UHPRYHG IURP WKH OLWWHUV ZLWKLQ WZR GD\V DIWHU ELUWK DQG WKH ORQJHVW SRVVLEOH VXUYLYDO RI $3:6,& SXSV ZDV GHWHUPLQHG 3XSV GHULYHG IURP &%/DQG '%$IHPDOHV KDG WKH VKRUWHVW VXUYLYDO WLPH ZLWK WKH ORQJHVW VXUYLYLQJ DIIHFWHG LQGLYLGXDO IURP HLWKHU VWUDLQ OLYLQJ RQO\ GD\V 3XSV GHULYHG IURP DOO RWKHU VWUDLQV KDG DW OHDVW RQH DIIHFWHG LQGLYLGXDO WKDW VXUYLYHG IRU DW OHDVW ZHHNV /HDN\ H[SUHVVLRQ RI 6QUSQ 1GQ DQG 0E,, ZDV REVHUYHG DW FRPSDUDEOH OHYHOV LQ DOO VWUDLQV )LJ f UHJDUGOHVV RI WKHLU DELOLW\ WR VXUYLYH )LQDOO\ WKH OHDN\ PDWHUQDO H[SUHVVLRQ RI WKHVH 3:6 FDQGLGDWH JHQHV ZDV LQYHVWLJDWHG LQ ZLOGW\SH PLFH )9%1IHPDOHV ZHUH PDWHG ZLWK ZLOGW\SH PDOHV IURP WKH %&$67F VWUDLQ D VWUDLQ WKDW LV FRQJHQLH IRU WKH PXV PXVFXOXV FDVWDQHXV FKURPRVRPH RQ D &%/EDFNJURXQG 7KH UHFLSURFDO PDWLQJ ZDV DOVR SHUIRUPHG

PAGE 81

7RWDO EUDLQ 51$ ZDV LVRODWHG IURP WKH UHVXOWLQJ )9%1; %&$67 Ff )L RU %&$67F ; )9%1-f ) PLFH DW ELUWK 573&5 IROORZHG E\ D SRO\PRUSKLF UHVWULFWLRQ HQ]\PH GLJHVW RI WKH 573&5 SURGXFW ZDV XVHG WR GLVWLQJXLVK EHWZHHQ H[SUHVVLRQ RI 1GQ SURGXFHG IURP WKH GRPHVWLFXV DQG FDVWDQHXV DOOHOHV 2QO\ WKH SDWHUQDO FDVWDQHXV DOOHOH ZDV H[SUHVVHG LQ HDFK FDVH )LJ f %&$67F IHPDOHV ZHUH WKHQ PDWHG ZLWK $3:6,& FDUULHU PDOHV DQG WKH VDPH 573&5 DQG UHVWULFWLRQ GLJHVWLRQ RQ EUDLQ 51$ PDGH IURP %&$67F ; $3:6,&f ) SXSV ZDV SHUIRUPHG :KLOH H[SUHVVLRQ IURP ZLOGW\SH SXSV ZDV OLPLWHG VWULFWO\ WR WKH GRPHVWLFXV DOOHOH WKH H[SUHVVLRQ LQ SXSV WKDW KDG LQKHULWHG WKH SDWHUQDO $3:6,& DOOHOH ZDV ELDOOHOLF UHSUHVHQWLQJ ERWK GRPHVWLFXV DQG FDVWDQHXV DOOHOHV 7KLV LQGLFDWHV WKDW OHDN\ PDWHUQDO H[SUHVVLRQ LV RQO\ REVHUYHG RU GHWHFWDEOH ZKHQ LQ FRPELQDWLRQ ZLWK D SDWHUQDO $3:6,& PXWDWLRQ 'LVFXVVLRQ 7KLV VWXG\ GHPRQVWUDWHG WKDW VWUDLQ EDFNJURXQG DIIHFWV WKH SKHQRW\SH RI WKH $3:6,& PLFH +HWHUR]\JRXV FDUULHU PDOHV HLWKHU 6Y RU &%/-f EUHG WR &%/RU '%$IHPDOHV SURGXFHG PXWDQW RIIVSULQJ WKDW GR QRW VXUYLYH XQWLO ZHDQLQJ HYHQ LI ZLOGW\SH VLEOLQJV DUH UHPRYHG WR UHGXFH FRPSHWLWLRQ +RZHYHU ORQJn WHUP VXUYLYDO ZDV DFKLHYHG XSRQ EUHHGLQJ WKHVH VDPH FDUULHU PDOHV WR VHYHUDO RWKHU VWUDLQV LQFOXGLQJ )9%1&++H6Y DQG %$/%F:KLOH VXUYLYLQJ $3:6,& PLFH DUH VPDOOHU WKDQ ZLOGW\SH OLWWHUPDWHV WKH\ GR QRW EHFRPH REHVH RQ D ORZIDW GLHW ERWK PDOHV DQG IHPDOHV DUH IHUWLOH DQG WKH\ DSSHDU WR EH QRUPDO LQ DOO RWKHU UHVSHFWV ([SUHVVLRQ DQDO\VLV RI 6QUSQ WKH DQWLVHQVH WUDQVFULSW RI 8EHD DQG WKH 0E,, VQR51$ UHYHDOV OHDN\ H[SUHVVLRQ RI WKHVH SDWHUQDOO\ H[SUHVVHG JHQHV LQ $3:6,& SXSV

PAGE 82

7KLV H[SUHVVLRQ RFFXUV DW D YHU\ ORZ OHYHO DQG RULJLQDWHV LQ SDUW IURP WKH PDWHUQDOO\ GHULYHG FKURPRVRPH 7KLV OHDN\ H[SUHVVLRQ RULJLQDOO\ GHWHFWHG LQ 3:6,& GHOHWLRQ SXSV ZLWK )9%1PRWKHUV LV DOVR SUHVHQW DW FRPSDUDEOH OHYHOV LQ DOO RWKHU VWUDLQV LQFOXGLQJ &%/DQG '%$7KLV VXJJHVWV WKDW WKH LQFUHDVHG VXUYLYDO RI $3:6,& SXSV LV QRW GXH WR WKH ORZOHYHO H[SUHVVLRQ RI JHQHV LQ WKH 3:6 UHJLRQ )XUWKHUPRUH WKLV H[SUHVVLRQ LV QRW VXIILFLHQW WR DPHOLRUDWH WKH IDLOXUH WR WKULYH SKHQRW\SH DQG SHUPLW VXUYLYDO LQ $3:6,& SXSV 6LPLODUO\ KXPDQV WKDW KDYH 3:6 GXH WR PDWHUQDO XQLSDUHQWDO GLVRP\ RU D EDODQFHG WUDQVORFDWLRQ KDYH DOVR EHHQ UHSRUWHG WR VKRZ ZHDN EXW GHWHFWDEOH H[SUHVVLRQ RI JHQHV LQ WKH 3:6 UHJLRQ 1R REYLRXV FOLQLFDO GLIIHUHQFHV ZHUH UHSRUWHG IURP LQGLYLGXDOV ZLWK OHDN\ H[SUHVVLRQ IURP LPSULQWHG JHQHV ZKHQ FRPSDUHG WR DIIHFWHG LQGLYLGXDOV WKDW GLG QRW VKRZ OHDN\ JHQH H[SUHVVLRQ IURP WKHVH JHQHV :K\ ZRXOG $3:6,& SXSV VXUYLYH RQ VRPH VWUDLQV DQG QRW RWKHUV ZKHQ WKH JHQH H[SUHVVLRQ LQ WKH 3:6 UHJLRQ DSSHDUV WR EH LGHQWLFDO EHWZHHQ VXUYLYRUV DQG QRQn VXUYLYRUV" 7KH PRVW OLNHO\ H[SODQDWLRQ IRU WKLV ZRXOG EH WKH SUHVHQFH RI VSHFLILF PRGLILHU DOOHOHV LQ VRPH LQEUHG VWUDLQV WKDW HLWKHU SHUPLW RU SUHYHQW VXUYLYDO RI DIIHFWHG SXSV $Q DOWHUQDWH H[SODQDWLRQ PD\ EH WKH JHQHUDO XQILWQHVV RI D SDUWLFXODU VWUDLQ IRU VXUYLYDO RI QHRQDWHV 7KLV LV XQOLNHO\ KRZHYHU DV WKH $3:6,& SXSV DUH JHQHWLFDOO\ ) LQGLYLGXDOV DQG VKRXOG EHQHILW IURP K\EULG YLJRU +HWHUR]\JRXV FDUULHU PDOHV RQ WKH 6Y JHQHWLF EDFNJURXQG EUHG WR &%/IHPDOHV SURGXFH $3:6,& SXSV WKDW QHYHU VXUYLYH &RQYHUVHO\ FDUULHU PDOHV RQ WKH &%/JHQHWLF EDFNJURXQG EUHG ZLWK 6Y IHPDOHV SURGXFH $3:6,& SXSV WKDW DUH FDSDEOH RI VXUYLYLQJ WR DGXOWKRRG HYHQ WKRXJK WKH JHQHWLF EDFNJURXQG RI WKHVH UHFLSURFDO PDWLQJV DUH LGHQWLFDO 2QH H[SODQDWLRQ RI WKLV LV WKDW WKH PRGLILHU JHQH RU

PAGE 83

JHQHV UHVSRQVLEOH IRU VXUYLYDO RI $3:6,& PLFH FRXOG EH UHTXLUHG LQ WKH RRF\WH 7KH RRF\WH VSHFLILF IDFWRU ZRXOG QRW EH SUHVHQW LQ &%/RRF\WHV WKDW DUH QRW SHUPLVVLYH IRU VXUYLYDO EXW ZRXOG EH SUHVHQW LQ 6Y RRF\WHV DQG DOORZ VXUYLYDO RI DIIHFWHG SXSV $Q DOWHUQDWH H[SODQDWLRQ LV WKDW WKH PRGLILHU JHQH RU JHQHV DUH WKHPVHOYHV LPSULQWHG ,I WKH PRGLILHU JHQH ZDV RQO\ H[SUHVVHG IURP WKH PDWHUQDOO\ LQKHULWHG FKURPRVRPH DQG WKH DOOHOH RI WKLV JHQH WKDW ZDV SHUPLVVLYH IRU VXUYLYDO ZDV WKH 6Y DOOHOH DQG QRW WKH &%/ DOOHOH WKHQ VXUYLYDO FRXOG RQO\ EH DFKLHYHG ZKHQ WKH PDWHUQDO DOOHOH RI WKLV JHQH LV IURP WKH 6Y VWUDLQ 3URQXFOHDU WUDQVSODQW ZKHUH WKH SURQXFOHL IURP D % ; $3:6,&f ) RRF\WH FRXOG EH PRYHG LQWR fHPSWLHGf RRF\WHV IURP IHUWLOL]HG )9%1RU )9%1; $3:6,&f ) IHPDOHV FRXOG EH XVHG WR GLVWLQJXLVK EHWZHHQ WKHVH WZR SRVVLELOLWLHV ,I WKH WUDQVSODQWHG SURQXFOHL JDYH ULVH WR SXSV WKDW ZHUH DEOH WR VXUYLYH WKHQ WKH PRGLILHU JHQH LV PRVW OLNHO\ RRF\WH VSHFLILF KRZHYHU LI WKH UHVXOWDQW SXSV VWLOO GR QRW VXUYLYH WKHQ WKH PRGLI\LQJ JHQH LV PRVW OLNHO\ LPSULQWHG ,W LV LQWHUHVWLQJ WKDW WKH OHDNLQHVV RI WKH PDWHUQDO DOOHOH LV RQO\ GHWHFWDEOH ZKHQ LQ FRPELQDWLRQ ZLWK D SDWHUQDO $3:6,& DOOHOH EXW QRW ZKHQ LQ FRPELQDWLRQ ZLWK D ZLOG W\SH SDWHUQDO DOOHOH 7KHUH DUH WKUHH SRVVLEOH H[SODQDWLRQV IRU WKLV )LUVW ORZOHYHO H[SUHVVLRQ IURP WKH PDWHUQDO DOOHOH ZRXOG SURGXFH D IHZ WUDQVFULSWV IURP WKH PDWHUQDO DOOHOH WKDW FRXOG VLPSO\ EH VZDPSHG E\ WKH PRUH DEXQGDQW WUDQVFULSWV RULJLQDWLQJ IURP WKH SDWHUQDO DOOHOH 3HUKDSV LPSULQWLQJ LQ PRXVH LV RQO\ VWURQJ DOOHOH ELDV DQG ORZOHYHO H[SUHVVLRQ FRXOG PDUN WKH UHSUHVVHG FKURPRVRPH DV D UHJLRQ WKDW LV UHSUHVVHG LQ D IDFXOWDWLYH PDQQHU DV RSSRVHG WR D FRQVWLWXWLYH PDQQHU $QRWKHU SRVVLELOLW\ LV WKDW WKH H[SUHVVLRQ RI JHQHV RU WUDQVFULSWV GRZQVWUHDP RI 6QUSQ FRXOG EH DOORZHG E\ WKH VSOLFLQJ RI WKH XSVWUHDP H[RQV RI 6QUSQ WKDW DUH OHIW LQWDFW RQ WKH $3:6,& FKURPRVRPH LQWR

PAGE 84

WKH GRZQVWUHDP H[RQV RI 6QUSQ RU WKH UXQRQ WUDQVFULSWV IURP ZKLFK WKH VQR51$V DUH VSOLFHG 7KHVH XSVWUHDP H[RQV KDYH EHHQ VKRZQ WR EH IXQFWLRQDO DOWHUQDWH SURPRWHUV IRU 6QXUI EXW WKHLU OHYHO RI H[SUHVVLRQ LV PXFK ZHDNHU WKDQ WKDW RI WKH PDMRU SURPRWHU 3HUKDSV WKLV FRXOG H[SODLQ WKH ZHDN H[SUHVVLRQ RI WKH VQR51$V $GGLWLRQDOO\ WKH SK\VLFDO LQWHUDFWLRQ EHWZHHQ WKH VLOHQFHG LPSULQWLQJ FHQWHU DQG WKH XSVWUHDP JHQHV LQFOXGLQJ 0NUQ 0DJHO DQG 1GQ FRXOG EH UHTXLUHG IRU WKH VLOHQFLQJ RI WKHVH JHQHV WKDW OLH PRUH WKDQ 0E DZD\ IURP WKH LPSULQWLQJ FHQWHU 7KH PLVVLQJ LPSULQWLQJ FHQWHU FRXOG FDXVH WKH DOWHUQDWH 6QXUI SURPRWHUV WR EH MX[WDSRVHG WR WKH UHJXODWRU\ HOHPHQWV RI WKH XSVWUHDP JHQHV DQG UHVXOW LQ OHDN\ H[SUHVVLRQ :KLOH WKLV PD\ H[SODLQ OHDN\ SDWHUQDO H[SUHVVLRQ LW GRHVQfW H[SODLQ UHVLGXDO H[SUHVVLRQ IURP WKH PDWHUQDO FKURPRVRPH 7KH WKLUG H[SODQDWLRQ LV WKDW FRPPXQLFDWLRQ EHWZHHQ RQH VLOHQFHG DQG RQH H[SUHVVHG LPSULQWLQJ FHQWHU LV UHTXLUHG IRU WKH SURSHU VLOHQFLQJ RI WKH PDWHUQDO DOOHOH DQG WKH H[SUHVVLRQ RI WKH SDWHUQDO DOOHOH 6SHFLILFDOO\ WKH XQPHWK\ODWHG XQVLOHQFHG SDWHUQDO 3:6,& PD\ EH UHTXLUHG LQ WUDQV WR VLOHQFH WKH PDWHUQDO UHJLRQ :KLOH WKLV H[SODQDWLRQ FRXOG DFFRXQW IRU WKH ELDOOHOLF H[SUHVVLRQ LQ WKH $3:6,& PLFH LW GRHVQfW H[SODLQ ZK\ WKH H[SUHVVLRQ OHYHOV RI WKH LPSULQWHG JHQHV DUH VR ORZ )XUWKHUPRUH WUDQVDFWLYDWLRQ LV D SKHQRPHQRQ QRW GRFXPHQWHG LQ PRXVH DQG ZRXOG EH GLIILFXOW WR SURYH RU GLVSURYH /HDN\ JHQH H[SUHVVLRQ LQ WKH UHJLRQ LV QRW XQLTXH WR PLFH DV KXPDQ SDWLHQWV ZLWK PDWHUQDO XQLSDUHQWDO GLVRP\ KDYH DOVR EHHQ UHSRUWHG WR VKRZ OHDN\ H[SUHVVLRQ

PAGE 85

)LJXUH 6XUYLYLQJ $3:6,& PLFH DUH VPDOOHU WKDQ WKHLU ZLOGW\SH OLWWHUPDWHV $3:6,& PLFH DQG WKHLU ZLOGW\SH OLWWHUPDWHV ZHUH ZHLJKHG DW DQG ZHHNV RI DJH 7KHLU ZHLJKW LQ JUDPV LV SORWWHG YHUVXV WKHLU DJH LQ ZHHNV )LOOHG V\PEROV UHSUHVHQW $3:6,& PLFH DQG RSHQ V\PEROV UHSUHVHQW WKH ZLOGW\SH OLWWHUPDWHV

PAGE 86

1GQ 573&5 6n6QUSQ 573&5 `DFWLQ 573&5 1R 57 FRQWURO 0E,, 0EO, 6 U51$ )LJXUH /HDN\ H[SUHVVLRQ IURP SDWHUQDOO\ H[SUHVVHG JHQHV LV QRW DJH GHSHQGHQW $3:6,& PLFH ZHUH VDFULILFHG DW ELUWK RQH ZHHN WZR ZHHNV DQG WKUHH ZHHNV RI DJH 7RWDO EUDLQ 51$ ZDV PDGH IURP WKH VDFULILFHG PLFH DQG VXEMHFWHG WR HLWKHU 573&5 RU QRUWKHUQ DQDO\VLV 573&5 LV VKRZQ IRU 1GQ DQG f 6QUSQ VLQFH WKH H[SUHVVLRQ OHYHO LV QRW GHWHFWDEOH E\ QRUWKHUQ DQDO\VLV 6 U51$ DQG DFWLQ ZHUH XVHG DV FRQWUROV IRU QRUWKHUQ DQDO\VLV DQG 573&5 UHVSHFWLYHO\ /RZOHYHO H[SUHVVLRQ LV QRWHG LQ $3:6,& PLFH UHJDUGOHVV RI WKHLU DJH

PAGE 87

% )9%1 &++H%DOEF 6Y '%$1GQ 573&5 f6QUSQ 573&5 ILDFWLQ 573&5 1R 57 FRQWURO 1GQ 573&5 F\FOHV EORW 6n6QUSQ 573&5 F\FOHV EORW 0 EOO66 6 U51$ Z $ $Z$$Z$$Z$ $Z $ $ Z $ $ )LJXUH /HDN\ JHQH H[SUHVVLRQ GRHV QRW DFFRXQW IRU VWUDLQ GHSHQGHQW GLIIHUHQFHV LQ SKHQRW\SH $3:6,& PLFH PDGH FRQJHQLH RQ WKH &%/VWUDLQ EDFNJURXQG ZHUH PDWHG ZLWK HLWKHU &%/)9%1&++H%DOEF'%$RU 6Y IHPDOHV 7RWDO 51$ ZDV SUHSDUHG IURP WKH EUDLQV RI WZR $3:6,& PLFH DQG RQH ZLOGW\SH OLWWHUPDWH 7KH 51$ ZDV VXEMHFWHG WR 573&5 DQG QRUWKHUQ DQDO\VLV 1GQ DQG 6n6QUSQ ZHUH DQDO\]HG E\ 573&5 DW F\FOHV RU DW F\FOHV DQG EORWWHG DQG SUREHG 6 U51$ DQG ILDFWLQ ZHUH XVHG DV FRQWUROV IRU QRUWKHUQ DQDO\VLV DQG 573&5 UHVSHFWLYHO\ $3:6,& PLFH VKRZHG OHDN\ H[SUHVVLRQ LQ DOO VWUDLQV DQDO\]HG

PAGE 88

$ )9%1[ % &DVWF%&DVWF [ )9%1FDVWDQHXV GRPHVWLFXV )[& &[) JHQRPLF JHQRPLF % %&DVWF [ $3:6,& FDVWDQHXV GRPHVWLFXV )LJXUH /HDN\ JHQH H[SUHVVLRQ LV ELDOOHOLF LQ $3:6,& SXSV $ %UDLQ 51$ IURP UHFLSURFDO FURVVHV EHWZHHQ )9%1DQG %&$67F ZDV VXEMHFWHG WR 573&5 ZLWK SULPHUV IODQNLQJ D SRO\PRUSKLF $YDLO VLWH LQ WKH 1GQ WUDQVFULSW IURP PXV PXVFXOXV GRPHVWLFXV 7KH SURGXFW ZDV GLJHVWHG ZLWK $YDLO DQG UXQ RQ D b DJDURVH JHO :LOGW\SH 1GQ H[SUHVVLRQ LQ ERWK FURVVHV RULJLQDWHV IURP WKH SDWHUQDOO\ LQKHULWHG FKURPRVRPH % %&$67F IHPDOHV ZHUH PDWHG ZLWK PDOHV WKDW ZHUH FDUULHUV IRU WKH $3:6,& DOOHOH $3:6,& DQG ZLOG W\SH OLWWHUPDWH SXSV ZHUH VDFULILFHG DW ELUWK DQG WRWDO 51$ ZDV SUHSDUHG IURP WKHLU EUDLQV 573&5 DQG $YDLO GLJHVWLRQ RI WKH 1GQ WUDQVFULSW ZDV SHUIRUPHG DV GHVFULEHG DERYH :LOGW\SH 1GQ H[SUHVVLRQ RFFXUV IURP WKH SDWHUQDOO\ LQKHULWHG DOOHOH ZKLOH $3:6,& H[SUHVVLRQ RFFXUV IURP ERWK SDWHUQDO DQG PDWHUQDO DOOHOHV

PAGE 89

&+$37(5 75$16*(1,& 5(6&8( 2) 7+( 3:6,& '(/(7,21 0286( ,QWURGXFWLRQ 3UDGHU:LOOL V\QGURPH 3:6f SDWLHQWV ILUVW SUHVHQW ZLWK VHYHUH LQIDQWLOH K\SRWRQLD DQG IDLOXUH WR WKULYH WKDW OHDGV WR D UHTXLUHPHQW IRU JDYDJH IHHGLQJ LQ PRVW 3:6 QHRQDWHV 7KH LQIDQWLOH SKHQRW\SH VXEVLGHV DIWHU VHYHUDO PRQWKV DQG JLYHV ZD\ WR D SHULRG RI QRUPDO IHHGLQJ EHKDYLRU EXW VRRQ SURJUHVVHV WR K\SHUSKDJLD DQG VHYHUH REHVLW\ LI XQFRQWUROOHG 3:6 FKLOGUHQ DOVR SRVVHVV D GLVWLQFWLYH EHKDYLRUDO SKHQRW\SH WKDW LV VLPLODU EXW QRW LGHQWLFDO WR REVHVVLYHFRPSXOVLYH GLVRUGHU 2XWZDUGO\ YLVLEOH VLJQV RI WKH GLVHDVH LQ KXPDQV PD\ DOVR LQFOXGH DOPRQGVKDSHG H\HV VWUDELVPXV VPDOO VWDWXUH VPDOO KDQGV DQG IHHW DQG K\SRJRQDGLVP &DXVHG E\ WKH SK\VLFDO RU IXQFWLRQDO GHOHWLRQ RI SDWHUQDO FKURPRVRPH TO OTO 3:6 RFFXUV DW D IUHTXHQF\ RI DERXW OLYH ELUWKVn $SSUR[LPDWHO\ b RI 3:6 SDWLHQWV KDYH VXVWDLQHG D ODUJH 0Ef GHOHWLRQ RI WKHLU SDWHUQDOO\ LQKHULWHG FKURPRVRPH 2WKHU 3:6 SDWLHQWV KDYH HLWKHU LQKHULWHG ERWK FRSLHV RI FKURPRVRPH IURP WKHLU PRWKHU PDWHUQDO XQLSDUHQWDO GLVRP\f RU KDYH DQ LPSULQWLQJ PXWDWLRQ 3DWLHQWV ZLWK DQ LPSULQWLQJ PXWDWLRQ KDYH HLWKHU D GHOHWLRQ LQ WKH f UHJLRQ RI 6QUSQ LQFOXGLQJ H[RQ DQ DUHD NQRZQ DV WKH LPSULQWLQJ FHQWHU ,&f RI WKH TO OTO UHJLRQ n RU KDYH QR GHWHFWDEOH '1$ VHTXHQFH PXWDWLRQ EXW VWLOO SRVVHVV D SDWHUQDOO\ LQKHULWHG FKURPRVRPH WKDW HSLJHQHWLFDOO\ EHKDYHV DV D PDWHUQDOO\ LQKHULWHG FKURPRVRPH

PAGE 90

+XPDQ FKURPRVRPH TO OTO FRQWDLQV DW OHDVW VL[ SDWHUQDOO\ H[SUHVVHG JHQHV RU WUDQVFULSWV DQG LV V\QWHQLF ZLWK FHQWUDO FKURPRVRPH LQ PRXVH 7KH JHQHV DQG WUDQVFULSWV LQFOXGH 0.51 0$*(/ 1'1 61531 +%,, +%,, +%,, +%,,$ +%,% +%,, +%,, DQG WKH WIO(0DQWLVHQVH WUDQVFULSWn ([SUHVVLRQ RI HDFK RI WKHVH JHQHV LV FRPSOHWHO\ DEVHQW LQ PRVW 3:6 SDWLHQWV DOWKRXJK VRPH SDWLHQWV VKRZ ORZOHYHO H[SUHVVLRQ EXW VWLOO SUHVHQW ZLWK FODVVLFDO 3:6 $ ODUJH UHJLRQ RI VHTXHQFH EHWZHHQ 61531 DQG 1'1 VWLOO UHPDLQV XQH[SORUHG DQG PD\ FRQWDLQ DGGLWLRQDO JHQHV 7KLV UHJLRQ HQFRPSDVVHV QHDUO\ 0E DQG DGGLWLRQDO JHQHV GLVFRYHUHG LQ WKLV UHJLRQ PLJKW EH SUHGLFWHG WR EH LPSULQWHG DQG SDWHUQDOO\ H[SUHVVHG 7KH GLVWLQFW SDWHUQDO LQKHULWDQFH SDWWHUQ RI 3:6 LGHQWLILHV TO OTO DV ZHOO DV WKH V\QWHQLF PRXVH FKURPRVRPH DV D UHJLRQ RI JHQRPLF LPSULQWLQJ *HQRPLF LPSULQWLQJ LQYROYHV WKH H[SUHVVLRQ RI RQO\ RQH SDUHQWDO DOOHOH LQ VRPDWLF FHOOV 7KH RWKHU SDUHQWDO DOOHOH LV WUDQVFULSWLRQDOO\ VLOHQFHG 7KH QRQWUDQVFULEHG DOOHOHV RI WKH 3:6 JHQHV PDWHUQDO LQ WKH FDVH RI 3:6UHODWHG JHQHV DUH RIWHQ DVVRFLDWHG ZLWK QHDUE\ PHWK\ODWHG F\WRVLQH UHVLGXHV SUHVHQW LQ &S* LVODQGV ZKLOH WKH WUDQVFULEHG DOOHOHV DUH DVVRFLDWHG ZLWK WKH ODFN RI PHWK\ODWLRQ DW WKHVH VDPH &S* UHVLGXHVn 7KLV LQGLFDWHV WKDW WKH PDWHUQDO DOOHOH KDV D GLIIHUHQW HSLJHQRW\SH WKDQ WKH SDWHUQDO DOOHOH ,W LV QRW NQRZQ ZKHWKHU WKH HYHQWXDO VLOHQFLQJ RI WKH PDWHUQDO DOOHOH FDXVHV WKLV HSLJHQHWLF PDUN RU ZKHWKHU LW LV D PDUN WR LGHQWLI\ WKH DOOHOH WR EH VLOHQFHG &RQYHUVHO\ $QJHOPDQ V\QGURPH $6f UHVXOWV IURP WKH IXQFWLRQDO GHOHWLRQ RI WKH PDWHUQDO FRPSOHPHQW RI WKH VDPH LQWHUYDO RI FKURPRVRPH $ XQLTXH FODVV RI $6 SDWLHQWV ZLWK VSHFLILF PXWDWLRQV LQ WKH 8%($ JHQH VXJJHVWV WKDW ORVV RI 8%($ H[SUHVVLRQ FDQ EH VROHO\ UHVSRQVLEOH IRU WKH PDMRU FOLQLFDO IHDWXUHV RI $6 $QRWKHU

PAGE 91

PDWHUQDOO\ H[SUHVVHG JHQH $73 ,2& KDV DOVR EHHQ LGHQWLILHG LQ WKH 3:6 UHJLRQ EXW LWV FRQWULEXWLRQ WR WKH SKHQRW\SH RI $6 LV \HW WR EH GHWHUPLQHG $6 FDQ UHVXOW IURP PDWHUQDO GHOHWLRQ RI TO OTO SDWHUQDO XQLSDUHQWDO GLVRP\ ,& PXWDWLRQV DQG IURP SXWDWLYH VLQJOH JHQH PXWDWLRQV DV HYLGHQFHG E\ FRPSOHWHO\ QRUPDO HSLJHQRW\SH LQ WKH UHJLRQ DQG WKH 8%($ PXWDWLRQ FODVV ZKLFK SUHVHQW ZLWK FODVVLFDO $6 7KH DEVHQFH RI WKH FODVV RI 3:6 SDWLHQWV LQ ZKLFK D VLQJOH JHQH PXWDWLRQ LV UHVSRQVLEOH IRU WKH FRPSOHWH SKHQRW\SH DV ZHOO DV WKH SUHVHQFH RI PXOWLSOH SDWHUQDOO\ H[SUHVVHG JHQHV WKDW DUH GLVUXSWHG LQGLFDWH WKDW 3:6 LV D FRQWLJXRXV JHQH V\QGURPH ZKHUH WKH FOLQLFDO IHDWXUHV DUH WKH FXPXODWLYH HIIHFW RI PXOWLSOH GLVUXSWHG JHQHV 3:6 DQG $6 SDWLHQWV ZLWK LPSULQWLQJ GHIHFWV KDYH HLWKHU D UHODWLYHO\ VPDOO GHOHWLRQ RU QR QRWLFHDEOH PXWDWLRQ DW DOO EXW WKHVH PXWDWLRQV DOWHU WKH HQWLUH 0E UHJLRQ RQ WKH SDWHUQDO DQG PDWHUQDO FKURPRVRPHV UHVSHFWLYHO\ ,Q 3:6,& PXWDWLRQ SDWLHQWV WKH SDWHUQDOO\ GHULYHG JHQHV DVVXPH PDWHUQDO RU VLOHQFHG HSLJHQRW\SHV 7KH GHOHWLRQ EUHDNSRLQWV RI VHYHUDO 3:6 SDWLHQWV ZLWK ,& PXWDWLRQV ZHUH PDSSHG WR LGHQWLI\ WKH VPDOOHVW UHJLRQ RI GHOHWLRQ RYHUODS IRU 3:6 3:6652f 7KH 3:6652 LV ORFDWHG f RI WKH 61531 JHQH LQFOXGHV WKH ILUVW H[RQ RI WKH JHQH DQG LV RIWHQ UHIHUUHG WR DV WKH 3:6,& $OWKRXJK WKH 3:6652 KDV EHHQ QDUURZHG GRZQ WR DSSUR[LPDWHO\ NE WKH DFWXDO GHOHWLRQV WKDW KDYH EHHQ VKRZQ WR FDXVH 3:6 DUH PXFK ODUJHU $ VPDOOHVW UHJLRQ RI GHOHWLRQ RYHUODS KDV DOVR EHHQ LGHQWLILHG IRU $6 DQG LV UHIHUUHG WR DV WKH $6652 7KH $6652 OLHV DURXQG NE XSVWUHDP RI WKH 3:6652 DQG KDV EHHQ QDUURZHG WR NE $6,& PXWDWLRQV QHYHU DSSHDU WR RYHUODS WKH 3:6652 ZKLOH 3:6,& PXWDWLRQV FDQ RYHUODS WKH $6652 VXJJHVWLQJ WKDW LQ WKH DEVHQFH RI WKH 3:6 ,& WKH $6,& LV QRW QHFHVVDU\ 7KLV LQGLFDWHV WKDW WKH VROH SXUSRVH RI WKH $6,& PD\

PAGE 92

EH WR UHJXODWH WKH 3:6,& LQ WKH PDWHUQDO JHUPOLQH 7KLV DOVR LQGLFDWHV D ELSDUWLWH VWUXFWXUH WR WKH ,& LQ ZKLFK WKH 3:6 DQG $6 FRPSRQHQWV ZRUN WRJHWKHU WR FRQWURO LPSULQWLQJ LQ WKH TO TO UHJLRQ ,Q PRXVH WKH 3:6,& KDV EHHQ IXQFWLRQDOO\ GHILQHG E\ GHOHWLRQ LQGLFDWLQJ WKDW WKH ELSDUWLWH ,& LV PRVW OLNHO\ IXQFWLRQLQJ VLPLODUO\ EHWZHHQ KXPDQV DQG PLFH 2XU ODE SUHYLRXVO\ FUHDWHG D PRXVH PRGHO RI 3:6 WKDW HPXODWHV ERWK WKH SKHQRW\SLF DQG PROHFXODU FKDUDFWHULVWLFV RI 3:6 E\ GHOHWLRQ RI WKH PRXVH 3:6,& 0LFH WKDW LQKHULW D 3:6,& GHOHWLRQ $3:6,&f IURP WKHLU IDWKHU ORVH H[SUHVVLRQ RI WKH NQRZQ SDWHUQDOVSHFLILF JHQHV LQFOXGLQJ 6QUSQ 0NUQ 1GQ DQG WKH 8EHD DQWLVHQVH WUDQVFULSW 7KH $3:6,& PLFH DOVR GHPRQVWUDWH SRRU VXFNOH DQG IDLOXUH WR WKULYH LQGLFDWLYH RI WKH LQIDQWLOH FKDUDFWHULVWLFV RI KXPDQ 3:6 7KHVH PLFH WKXV SURYLGH DQ H[FHOOHQW PRXVH PRGHO RI 3:6 8QIRUWXQDWHO\ $3:6,& PLFH RQ WKH LQEUHG &%/EDFNJURXQG GLH ZLWKLQ VHYHQ GD\V RI ELUWK SUHVXPDEO\ D UHVXOW RI SRRU VXFNOH DQG IDLOXUH WR WKULYH 3URJUHVVLRQ WR REHVLW\ DQG WKH GHYHORSPHQW RI RWKHU 3:6 UHODWHG SKHQRW\SHV KDV \HW WR EH VHHQ LQ $3:6,& PLFH GXH WR QHRQDWDO OHWKDOLW\ $3:6,& PLFH PDWHG ZLWK PRWKHUV RI RWKHU VWUDLQ EDFNJURXQGV VXUYLYH WR DGXOWKRRG LI WKH ZLOGW\SH VLEOLQJV DUH UHPRYHG VKRUWO\ DIWHU ELUWK 7KHVH VXUYLYLQJ $3:6,& PLFH UHPDLQ VPDOOHU WKDQ WKHLU ZLOGW\SH VLEOLQJV EXW DUH RWKHUZLVH JURVVO\ QRUPDO )XUWKHUPRUH VXUYLYLQJ $3:6,& IHPDOHV DQG PDOHV DUH ERWK IHUWLOH DQG QHYHU EHFRPH REHVH RQ DQ RUGLQDU\ URGHQW GLHW ,QGLYLGXDO NQRFNRXWV RI 6QXUI 6QUSQ DQG 0NUQ DSSHDU FRPSOHWHO\ QRUPDO DQG VKRZ QR 3:6 DVVRFLDWHG SKHQRW\SHnn &RQIOLFWLQJ GDWD UHJDUGLQJ WKH SKHQRW\SH RI WKH 1GQ JHQH NQRFNRXW KDYH EHHQ UHSRUWHG 7VDL DQG FROOHDJXHV UHSRUW WKDW WKH 1GQ

PAGE 93

NQRFNRXW PRXVH KDV QR GLVFHUQDEOH SKHQRW\SH ZKLOH *HUDUG HW DO DQG 0XVFDWHOOL HW DO UHSRUW SDUWLDO QHRQDWDO OHWKDOLW\ WKDW LV VWUDLQ GHSHQGHQW DQG QRW FRQVLVWHQW IURP JHQHUDWLRQ WR JHQHUDWLRQ 2Q WKH RWKHU KDQG PLFH LQKHULWLQJ D SDWHUQDO GHOHWLRQ VSDQQLQJ IURP H[RQ RI 6QUSQ WR 8EHD VXFFXPE WR QHRQDWDO OHWKDOLW\ LQ b RI WKH DIIHFWHG SXSV 7RJHWKHU WKLV GDWD VWUHQJWKHQV WKH K\SRWKHVLV WKDW 3:6 LV D FRQWLJXRXV JHQH V\QGURPH FDXVHG E\ WKH DEVHQFH RI PXOWLSOH JHQH SURGXFWV DQG QRW FDXVHG E\ WKH DEVHQFH RI DQ\ VLQJOH JHQH SURGXFW 'HVSLWH WKH HIIRUWV RI PDQ\ ODEV WR FUHDWH LQGLYLGXDO JHQH NQRFNRXWV WKH FRQWULEXWLRQ RI HDFK JHQH LQ KXPDQ FKURPRVRPH TO OTO DQG WKH V\QWHQLF PRXVH FKURPRVRPH WR WKH 3:6 SKHQRW\SH LV VWLOO D P\VWHU\ )LJXUH VKRZV D VXPPDU\ RI WKH LQGLYLGXDO JHQH GHOHWLRQV WKDW KDYH EHHQ UHSRUWHG (IIRUWV WR PRGHO 3:6 XVLQJ LQGLYLGXDO JHQH NQRFNRXWV KDYH EHHQ ODUJHO\ XQIUXLWIXO +RZHYHU HQJLQHHULQJ PXOWLSOH JHQH GHOHWLRQV LV DOVR OLPLWHG E\ WKH ORFDWLRQ RI WKH LPSULQWLQJ FHQWHUV VHYHUDO GHVLUHG PXWDWLRQV ZRXOG UHPRYH WKHP FUHDWLQJ DQ LPSULQWLQJ PXWDWLRQf 7KHUHIRUH D GLIIHUHQW DSSURDFK ZDV DGRSWHG WR GHWHUPLQH WKH LQGLYLGXDO JHQH FRQWULEXWLRQ WR WKLV FRQWLJXRXV JHQH V\QGURPH 7KLV DSSURDFK LQYROYHG WUDQVJHQLF UHVFXH DQG WKH VWUDWHJ\ ZDV WR SURGXFH WUDQVJHQLF PLFH KDUERULQJ HLWKHU LQGLYLGXDO RU PXOWLSOH 3:6 JHQHV DQG PDWH WKHP WR $3:6,& PLFH ,Q PLFH SDWHUQDOO\ LQKHULWLQJ DQ LPSULQWLQJ FHQWHU PXWDWLRQ DQG PDWHUQDOO\ LQKHULWLQJ D WUDQVJHQH WKH DELOLW\ RI WKH WUDQVJHQH WR UHVFXH WKH SKHQRW\SH RI WKH $3:6,& PLFH FRXOG EH DVFHUWDLQHG 7KH JHQHV UHVSRQVLEOH IRU WKH LQGLYLGXDO DVSHFWV RI WKH 3:6 SKHQRW\SH FRXOG WKHQ EH GHILQLWLYHO\ GHWHUPLQHG VLQFH RQH WUDQVJHQH FRXOG FRQFHLYDEO\ UHVFXH WKH QHRQDWDO OHWKDOLW\ GHIHFW ZKLOH DQRWKHU FRXOG UHVFXH WKH VPDOO VWDWXUH GHIHFW ,Q DGGLWLRQ WKH UHVFXHG PLFH PD\ OLYH ORQJHU RU UHFDSLWXODWH RWKHU KXPDQ 3:6

PAGE 94

V\PSWRPV DQG DOORZ WKH GLVVHFWLRQ RI DGGLWLRQDO ODWHU RQVHW SKHQRW\SHV LQ RXU PRXVH PRGHO 0DWHULDOV DQG 0HWKRGV 6FUHHQLQJ WKH %$& /LEUDULHV 7KH 5HVHDUFK *HQHWLFV +XQWVYLOOH $/f %$& OLEUDU\ ZDV LQLWLDOO\ VFUHHQHG IRU %$& FORQHV 7KLV OLEUDU\ ZDV PDGH IURP WKH 6Y VWUDLQ RI PRXVH 7KH OLEUDU\ FRQVLVWHG RI ILOWHUV HDFK FDUU\LQJ XQLTXH FORQHV ZLWK DQ DYHUDJH LQVHUW VL]H RI NE VSRWWHG LQ GXSOLFDWH RQWR GLIIHUHQW PHPEUDQHV 3UREHV IRU 1GQ 0NUQ 8EHD DQG WKH JHQH IRUPHUO\ NQRZQ DV ,SZ ZHUH XVHG WR VFUHHQ WKH OLEUDU\ VLPXOWDQHRXVO\ 3ULRU WR K\EULGL]DWLRQ %$& PHPEUDQHV ZHUH ZDVKHG ZLWK P/ RI ; 66& DQG b 6'6 DW URRP WHPSHUDWXUH IRU PLQXWHV 7KH PHPEUDQHV ZHUH WKHQ ULQVHG WZLFH ZLWK PO RI ; 66& IRU PLQXWHV DW URRP WHPSHUDWXUH DQG K\EULGL]HG DFFRUGLQJ WR WKH 5HVHDUFK *HQHWLFV SURWRFRO %ULHIO\ WKH PHPEUDQHV ZHUH SUHK\EULGL]HG LQ UROOHU ERWWOHV ZLWK PHPEUDQHV SHU ERWWOH HDFK VHSDUDWHG E\ RQH VKHHW RI )ORZ 0HVK 'LYHUVILHG %LRWHFK %RVWRQ 0$f LQ PO RI +\SHU+\E 5HVHDUFK *HQHWLFV +XQWVYLOOH $/f SHU ERWWOH DW r & IRU PLQXWHV $W OHDVW FRXQWV RI HDFK SUREH ZHUH ERLOHG IRU PLQ VQDS FRROHG RQ LFH DQG WKHQ DGGHG WR PO RI +\SHU+\E WKDW ZDV SUHZDUPHG WR r & DQG PO RI K\EULGL]DWLRQ VROXWLRQ ZDV DGGHG WR HDFK RI WKH UROOHU ERWWOHV 7KH PHPEUDQHV ZHUH DOORZHG WR K\EULGL]H IRU KRXUV DW r & 7KH PHPEUDQHV ZHUH ZDVKHG LQ WKH UROOHU ERWWOHV WKUHH WLPHV IRU PLQXWHV DW r & ZLWK PO ,; 66& DQG b 6'6 7KH\ ZHUH WKHQ UHPRYHG IURP WKH ERWWOHV DQG ZDVKHG WZLFH PRUH DW r & ZLWK PO RI ,; 66& DQG b 6'6 IRU PLQXWHV )LQDOO\ WKH PHPEUDQHV ZHUH ULQVHG ZLWK ,; 66& DW URRP WHPSHUDWXUH 7KH PHPEUDQHV

PAGE 95

ZHUH WKHQ ZUDSSHG LQ FHOORSKDQH DQG H[SRVHG WR ILOP ;$5 .RGDNf RYHUQLJKW DW r & 3RVLWLYH FORQHV ZHUH LGHQWLILHG IROORZLQJ WKH PDQXIDFWXUHUfV LQVWUXFWLRQV DQG WKH IROORZLQJ FORQHV ZHUH RUGHUHG 1 / ( & DQG & ,Q DGGLWLRQ WR VFUHHQLQJ WKH 6Y OLEUDU\ D VLQJOH 53&, %$& 3 ZDV IRXQG E\ VFUHHQLQJ WKH OLEUDU\ YLUWXDOO\ ZLWK D SUREH WR WKH f PRVW LQWURQ RI WKH 8EHD JHQH 3UREH 3UHSDUDWLRQ 3UREHV ZHUH ODEHOHG XVLQJ WKH 3ULPH,W ,, NLW 6WUDWDJHQH /D -ROOD &$f ZLWK PLQRU PRGLILFDWLRQV '1$ QJfZDV ERLOHG IRU PLQXWHV LQ WKH SUHVHQFH RI UDQGRP KH[DPHUV 7KH '1$KH[DPHU PL[ ZDV FRROHG RQ LFH DQG ; UHDFWLRQ EXIIHU ZDV DGGHG DORQJ ZLWK S&L RI D3 G&73 DQG 8 RI H[Rn NOHQRZ 7KH ODEHOLQJ UHDFWLRQ ZDV SODFHG DW r & IRU PLQXWHV $IWHU ODEHOLQJ ZDV FRPSOHWH WKH SUREH ZDV SXULILHG XVLQJ WKH QXFOHRWLGH UHPRYDO NLW 4,$*(1f DQG HOXWHG LQ SL RI ZDWHU 3XULILHG SUREHV ZHUH ERLOHG IRU PLQXWHV DQG VQDS FRROHG RQ LFH SULRU WR XVH LQ K\EULGL]DWLRQ 9HULILFDWLRQ RI %$& &ORQHV 6LQJOH %$& FRORQLHV ZHUH WHVWHG WR GHWHUPLQH ZKLFK FORQHV ZHUH GHULYHG IURP HDFK JHQH ORFXV )RXU VLQJOH FRORQLHV IURP HDFK %$& ZHUH VWUHDNHG RQWR /% SODWHV VXSSOHPHQWHG ZLWK WKH DQWLELRWLF FKORUDPSKHQLFRO /%&$f 7KH SODWHV ZHUH RYHUOD\HG ZLWK D Q\ORQ ILOWHU DQG JURZQ RYHUQLJKW DW r & 7KH QH[W PRUQLQJ WKH EDFWHULD ZHUH O\VHG RQ WKH ILOWHUV DV IROORZV ILUVW WKH ILOWHUV ZHUH VRDNHG LQ DONDOL VROXWLRQ IRU PLQXWHV IROORZHG E\ QHXWUDOL]LQJ VROXWLRQ IRU PLQXWHV DQG ILQDOO\ ULQVHG LQ ; 66& IRU PLQXWH 7KH ILOWHUV ZHUH WKHQ EDNHG DW r & IRU KRXUV SUHK\EULGL]HG LQ &KXUFK DQG *LOEHUW EXIIHU IRU RQH KRXU DW r & DQG K\EULGL]HG ZLWK WKH 1GQ SUREH 8SRQ ZDVKLQJ DQG OD\LQJ WKH ILOWHUV WR ILOP WKH UHVXOWV ZHUH XVHG WR GHWHUPLQH ZKLFK FORQHV ZHUH

PAGE 96

GHULYHG IURP WKH 1GQ ORFXV DQG ZKHWKHU WKH FXOWXUH VHQW UHSUHVHQWHG D SXUH FRORQ\ IURP D VLQJOH FORQH RU D PL[HG FXOWXUH ZLWK PXOWLSOH %$& FORQHV 7KH ILOWHUV ZHUH WKHQ VWULSSHG LQ ERLOLQJ b 6'6 DQG WKH HQWLUH K\EULGL]DWLRQ SURFHGXUH ZDV SHUIRUPHG DJDLQ ZLWK WKH UHPDLQLQJ SUREHV (QG 6HTXHQFLQJ %$& &ORQHV 7KH %$& FORQHV ZHUH HQG VHTXHQFHG XVLQJ WKH ELJ G\H WHUPLQDWLRQ UHDFWLRQ WR REWDLQ VHTXHQFHV XQLTXH WR WKH PRXVH JHQRPLF '1$ LQVHUW 5HDFWLRQV ZHUH SHUIRUPHG RQ PJ RI %$& '1$ WKDW KDG EHHQ VKHDUHG E\ SDVVLQJ LW ILYH WLPHV WKURXJK D JDXJH QHHGOH XVLQJ D PRGLILHG YHUVLRQ RI WKH PDQXIDFWXUHUfV LQVWUXFWLRQV ZLWK SL RI VHTXHQFLQJ EXIIHU SL RI ELJ G\H OSPRO RI SULPHU DQG P0 0J&O 7KH UHDFWLRQV ZHUH VXEMHFWHG WR DQ LQLWLDO PLQ F\FOH DW r & IROORZHG E\ F\FOHV RI r & IRU V r & IRU V DQG r & IRU PLQ 7KH FRPSOHWHG UHDFWLRQV ZHUH SXULILHG IURP IUHH QXFOHRWLGHV XVLQJ 3HUIRUPD '75 *HO )LOWUDWLRQ &ROXPQV (GJH %LRV\VWHPVf YDFXXP GULHG DQG VHTXHQFHG E\ WKH 8QLYHUVLW\ RI )ORULGD &HQWHU IRU 0DPPDOLDQ *HQHWLFV 6HTXHQFLQJ &RUH 3XOVH)LHOG *HO (OHFWURSKRUHVLV 3XOVHILHOG JHO HOHFWRUSKRUHVLV ZDV FDUULHG RXW WR FUHDWH D URXJK UHVWULFWLRQ PDS DQG WLOLQJ SDWKZD\ IRU WKH %$& FORQHV %$& '1$V GLJHVWHG ZLWK WKH DSSURSULDWH HQ]\PHV ZHUH HOHFWURSKRUHVHG RQ D b JHQHWLF WHFKQRORJ\ JUDGH DJDURVH JHO 1XVLHYH )0&f PDGH ZLWK ,; 7%( EXIIHU 6DPSOHV ZHUH PL[HG ZLWK ; ILFROO ORDGLQJ G\H DQG UDQ DW 9 ZLWK D VZLWFK WLPH RI VHFRQGV IRU KRXUV 7KLV SURYLGHG UHVROXWLRQ RI EDQGV IURP NE 7KH JHO ZDV VWDLQHG ZLWK D GLOXWH HWKLGLXP EURPLGH VROXWLRQ SKRWRJUDSKHG DQG EORWWHG DV GHVFULEHG EHORZ

PAGE 97

6RXWKHUQ %ORW $JDURVH JHOV FDUU\LQJ SLJ RI GLJHVWHG JHQRPLF '1$ RU SJ RI GLJHVWHG %$& '1$ ZHUH SKRWRJUDSKHG DQG 89 QLFNHG IRU PLQXWHV 7KH JHO ZDV VRDNHG LQ $ONDOL VROXWLRQ IRU PLQXWHV IROORZHG E\ VRDNLQJ LQ QHXWUDOL]LQJ VROXWLRQ IRU PLQXWHV 7KH JHO ZDV WUDQVIHUUHG WR +\ERQG Q\ORQ PHPEUDQH $PHUVKDPf LQ ; 66& RYHUQLJKW 7KH PHPEUDQH ZDV ULQVHG LQ ; 66& DQG EDNHG DW r & IRU KRXUV +\EULGL]DWLRQ ZDV FDUULHG RXW DFFRUGLQJ WR WKH PHWKRG RI &KXUFK DQG *LOEHUW 0HPEUDQHV ZHUH SUHK\EULGL]HG LQ PO RI &KXUFK DQG *LOEHUW %XIIHU IRU KRXU DW r & 7KH SUHK\EULGL]DWLRQ VROXWLRQ ZDV SRXUHG RII DQG UHSODFHG ZLWK PO RI IUHVK VROXWLRQ DQG WKH ERLOHG FRROHG SUREH +\EULGL]DWLRQ FRQWLQXHG RYHUQLJKW DW r & :DVKLQJ ZDV FDUULHG RXW WKUHH WLPHV LQ ;66& DQG b 6'6 DW r & IRU PLQXWHV HDFK 7UDQVJHQLF 0LFH 3URGXFWLRQ )RU SURGXFWLRQ RI WUDQVJHQLF PLFH %$& '1$ ZDV SUHSDUHG E\ ODUJH VFDOH SODVPLG SUHSDUDWLRQ XVLQJ WKH DONDOLQH O\VLV PHWKRG )LUVW ORJ SKDVH FXOWXUHV RI %$& FXOWXUH JURZQ LQ /%&$ ZHUH FHQWULIXJHG IRU PLQXWHV DW USP WR SHOOHW WKH FHOOV 7KH VXSHUQDWDQW ZDV SRXUHG RII DQG WKH SHOOHW ZDV UHVXVSHQGHG LQ *7( VROXWLRQ SOXV O\VR]\PH 7KH VXVSHQVLRQ ZDV WKHQ O\VHG ZLWK 1D2+ DQG 6'6 $IWHU DGGLWLRQ RI WKH O\VLV VROXWLRQ WKH O\VDWH ZDV QHXWUDOL]HG LQ 0 SRWDVVLXP DFHWDWH DQG SRXUHG WKURXJK FRWWRQ JDX]H LQWR 2DN 5LGJH WXEHV %$& '1$ ZDV SUHFLSLWDWHG ZLWK HWKDQRO DQG WKH SHOOHW ZDV UHVXVSHQGHG LQ PO 7( ZLWK SJPO 51$VH $ DQG DOORZHG WR LQFXEDWH DW r & IRU KRXU &HVLXP FKORULGH DQG HWKLGLXP EURPLGH ZHUH DGGHG WR WKH '1$ VROXWLRQ DQG WKH VROXWLRQ ZDV ORDGHG LQWR D KHDW VHDODEOH WXEH 7KH WXEH ZDV VHDOHG DQG VSXQ DW USP IRU KRXUV %$& VXSHUFRLOV ZHUH YLHZHG ZLWK D 89 OLJKW DQG ERWK

PAGE 98

QLFNHG DQG VXSHUFRLOHG EDQGV ZHUH SXOOHG 7KH '1$ ZDV H[WUDFWHG ZLWK WHUWEXWDQRO XQWLO WKH HWKLGLXP EURPLGH ZDV FRPSOHWHO\ GHSOHWHG IURP WKH %$& '1$ 7KH '1$ ZDV WKHQ GLDO\]HG WZLFH DJDLQVW / 7( EXIIHU XVLQJ GLDO\VLV WXELQJ IRU KRXUV HDFK 7KH FRQFHQWUDWLRQ RI WKH %$& '1$ ZDV WKHQ PHDVXUHG E\ VSHFWURSKRWRPHWHU DQG WKHQ GLOXWHG WR QJS IRU PLFURLQMHFWLRQ 7UDQVJHQLF PLFH ZHUH PDGH E\ SURQXFOHDU LQMHFWLRQ LQWR RRF\WHV WKDW ZHUH REWDLQHG IURP VXSHURYXODWHG IHUWLOL]HG )9%1IHPDOH PLFH 7KH IHUWLOL]HG LQMHFWHG RRF\WHV ZHUH WKHQ LPSODQWHG LQWR %'f ) IHPDOHV WKDW ZHUH PDGH SVHXGRSUHJQDQW E\ PDWLQJ WKHP ZLWK YDVHFWRPL]HG %'f ) PDOHV 0RXVH +XVEDQGU\ $W ZHHNV RI DJH DSSUR[LPDWHO\ PP RI WDLO ZDV FOLSSHG IURP HDFK PRXVH DQG WKH HDU ZDV SXQFKHG IRU LGHQWLILFDWLRQ *HQRPLF '1$ ZDV SUHSDUHG IURP WKH WDLO SLHFH E\ LQFXEDWLRQ LQ WDLO O\VLV EXIIHU ZLWK SURWHLQDVH QJSf RYHUQLJKW DW r & 7KH WDLO O\VDWH ZDV H[WUDFWHG ZLWK SKHQRO FKORURIRUP LVRDP\O DOFRKRO f DQG WKHQ SUHFLSLWDWHG ZLWK HWKDQRO 7KH WDLO '1$ ZDV VFUHHQHG IRU WKH SUHVHQFH RI WKH WUDQVJHQH E\ 3&5 XVLQJ ERWK HQG VHTXHQFHV IURP WKH %$& 0RXVH 6WUDLQV $3:6,& PLFH ZHUH GHYHORSHG LQ RXU ODE DQG FRQVWLWXWHG D NE GHOHWLRQ HQFRPSDVVLQJ WKH VHTXHQFH IURP NE f RI 6QUSQ DQG NE f RI 6QUSQ 7KHVH PLFH ZHUH EDFNFURVVHG IRU JHQHUDWLRQV WR &%/PDOHV DQG ZHUH WKXV PDGH FRQJHQLH RQ WKDW VWUDLQ EDFNJURXQG 7UDQVJHQLF PRXVH VWUDLQV ZHUH RULJLQDOO\ PDLQWDLQHG RQ WKH )9%1JHQHWLF EDFNJURXQG EXW VHOHFWHG VWUDLQV ZHUH WKHQ EDFNFURVVHG IRU JHQHUDWLRQV WR WKH

PAGE 99

&%/VWUDLQ EDFNJURXQG )RXU VWUDLQV RI 1 WUDQVJHQLF PLFH DUH UHIHUUHG WR DV $' RQH VWUDLQ RI PLFH UHSUHVHQWLQJ WKH 3, FORQH LV UHIHUUHG WR DV OLQH DQG OLQHV UHSUHVHQWLQJ WUDQVJHQH DUH UHIHUUHG WR DV $( 5HVXOWV 6FUHHQLQJ WKH %$& /LEUDU\ IRU &ORQHV 7KH ILUVW VWHS WRZDUG WUDQVJHQLF UHVFXH ZDV WR VFUHHQ D FRPPHUFLDOO\ DYDLODEOH %$& OLEUDU\ IRU FORQHV WKDW ZRXOG SXWDWLYHO\ FRQWDLQ WKH 3:6 JHQHV %$& FORQHV ZHUH FKRVHQ WR SHUIRUP WKH UHVFXH DV WKH\ DUH OLNHO\ WR FRQWDLQ DOO RI WKH QHFHVVDU\ UHJXODWRU\ UHJLRQV IRU WKH LQGLYLGXDO JHQHV GXH WR WKHLU VL]H 7KH\ DUH DOVR UHODWLYHO\ HDV\ WR KDQGOH DV WKH\ DUH SURSDJDWHG LQ EDFWHULD UDWKHU WKDQ \HDVW $GGLWLRQDOO\ WKH\ FDQ EH PRGLILHG E\ KRPRORJRXV UHFRPELQDWLRQn 7KH 5HVHDUFK *HQHWLFV %$& OLEUDU\ ZDV ILUVW VFUHHQHG IRU FORQHV 7KLV OLEUDU\ LV PDGH IURP WKH 6Y(Y VWUDLQ RI PRXVH DQG WKH DYHUDJH LQVHUW VL]H IRU %$& FORQHV LV NE 6RPH FORQHV E\ VFUHHQLQJ WKH 53&, %$& OLEUDU\ ZHUH DOVR REWDLQHG 7KLV OLEUDU\ LV PDGH IURP D IHPDOH &%/PRXVH 7KH DYHUDJH LQVHUW VL]H IRU WKLV OLEUDU\ LV NE DQG LV WKH WHPSODWH IRU WKH SXEOLF PRXVH JHQRPH VHTXHQFLQJ HIIRUW 7KH %$& OLEUDULHV ZHUH VFUHHQHG XVLQJ SUREHV IRU 1GQ 0NUQ DQG WKH JHQH IRUPHUO\ NQRZQ DV ,SZ :LWK WKH ILUVW VFUHHQ RI WKH 5HVHDUFK *HQHWLFV OLEUDU\ WZR %$&V ZHUH REWDLQHG WKDW K\EULGL]HG ZLWK WKH SUREH IRU 0NUQ RQH RI ZKLFK DOVR K\EULGL]HG ZLWK WKH 1GQ SUREH 1R FORQHV IRU ,SZ ZHUH LGHQWLILHG )URP VXEVHTXHQW VFUHHQLQJV RI WKLV OLEUDU\ RQH %$& FRQWDLQLQJ ,SZ RQH WKDW K\EULGL]HG ZLWK D SUREH IRU WKH 8EHD JHQH DQG RQH WKDW K\EULGL]HG ZLWK 1GQ 0NUQ DQG 0DJHO ZHUH LVRODWHG )URP VFUHHQLQJ WKH 53&, OLEUDU\ ZLWK WKH 6QUSQ SUREHV D VLQJOH %$& WKDW VSDQQHG PRVW

PAGE 100

RI WKH GLVWDQFH EHWZHHQ 6QUSQ DQG ,SZ ZDV LVRODWHG $Q HOHFWURQLF GDWDEDVH VHDUFK DOVR LGHQWLILHG D VLQJOH %$& WKDW FRQWDLQHG WKH f PRVW LQWURQ WR 8EHD $GGUHVVHV IRU WKH %$& FORQHV ZHUH GHWHUPLQHG WKH %$&V ZHUH RUGHUHG DQG WKHQ WKH\ ZHUH VWUHDNHG RXW WR GHWHUPLQH WKHLU FORQDOLW\ DQG WR YHULI\ WKH SUHVHQFH RI WKH SUREHV WKDW WKH OLEUDU\ ZDV VFUHHQHG IRU 7KH VSDQ RI WKH LQGLYLGXDO %$& FORQHV ZHUH GHWHUPLQHG E\ HQG VHTXHQFLQJ PDNLQJ HQG SUREHV E\ 3&5 DQG XVLQJ WKHP WR SUREH VRXWKHUQ EORWV SURGXFHG IURP UHVWULFWLRQ GLJHVWLRQ ZLWK UDUH FXWWLQJ HQ]\PHV VHSDUDWHG E\ SXOVHILHOG HOHFWURSKRUHVLV )URP WKLV LW ZDV GHWHUPLQHG WKDW WKH SUHYLRXVO\ SXEOLVKHG JHQH RUGHU LQ WKH 1GQ UHJLRQ ZDV LQFRUUHFW 7KH FRUUHFW RUGHU SODFHV 0DJHO EHWZHHQ 0NUQ DQG 1GQ DQG LQ D WUDQVFULSWLRQDO RULHQWDWLRQ RSSRVLWH WKDW RI 0NUQ 7KH %$&V WKDW ZHUH LVRODWHG ZHUH 1 ZKLFK FRQWDLQV 0NUQ 0DJHO DQG 1GQ / ZKLFK FRQWDLQV )UDW DQG 0NUQ & ZKLFK FRQWDLQV 8EHD DQG ZKLFK H[WHQGV IURP 6QUSQ WR WKH 0E,O VQR51$ FOXVWHU )LJ f 3URGXFWLRQ DQG &KDUDFWHUL]DWLRQ RI 7UDQVJHQLF 0LFH 2QFH WKH %$&V RI LQWHUHVW KDG EHHQ LGHQWLILHG DQG PDSSHG WUDQVJHQLF PLFH ZHUH PDGH %$& '1$ ZDV SUHSDUHG E\ ODUJH VFDOH SODVPLG SUHSDUDWLRQ IROORZHG E\ FHVLXP FKORULGH EDQGLQJ RI WKH UHVXOWLQJ '1$ %RWK QLFNHG DQG VXSHUFRLOHG EDQGV ZHUH SXOOHG DQG XVHG IRU SURGXFWLRQ RI WUDQVJHQLF PLFH ,W ZDV LPSRUWDQW WR KDYH H[WUHPHO\ IUHVK %$& DV WKH ODUJHU %$&V IURP 5RVZHOO 3DUN GHJUDGHG UDSLGO\ DIWHU LVRODWLRQ 7KH '1$ ZDV LQMHFWHG DW QJXO 7UDQVJHQLF PLFH ZHUH PDGH E\ SURQXFOHDU LQMHFWLRQ LQWR VXSHURYXODWHG IHUWLOL]HG )9%1IHPDOH PLFH 7KH IHUWLOL]HG RRF\WHV ZHUH WKHQ LPSODQWHG LQWR SVHXGRSUHJQDQW %'f ) PLFH :KHQ WKH UHVXOWLQJ SXSV UHDFKHG ZHHNV RI DJH WKH\ ZHUH WDLO FOLSSHG WR REWDLQ '1$ DQG HDUSXQFKHG IRU LGHQWLILFDWLRQ

PAGE 101

7KH WDLO '1$ ZDV VFUHHQHG IRU WKH SUHVHQFH RI WKH WUDQVJHQH E\ 3&5 XVLQJ ERWK HQG VHTXHQFHV IURP WKH %$& )RXU WUDQVJHQLF IRXQGHU OLQHV ZHUH PDGH ZLWK %$& 1 DQG ILYH ZHUH PDGH ZLWK %$& 7KH WUDQVJHQLF IRXQGHUV ZHUH PDWHG WR DVFHUWDLQ ZKHWKHU RU QRW WKH WUDQVJHQH EUHG WUXH 7KLV LQGLFDWHV ZKHWKHU RU QRW WKH IRXQGHU ZDV SHUKDSV D FKLPHUD DQG WKHUHIRUH PD\ QRW KDYH WKH WUDQVJHQH SUHVHQW LQ LWV JHUPOLQH 2QO\ RQH OLQH IURP WKH %$& GLG QRW EUHHG WUXH 7KH HVWDEOLVKHG OLQHV ZHUH WKHQ FKDUDFWHUL]HG IRU UHDUUDQJHPHQWV DQG FRS\ QXPEHU 5HDUUDQJHPHQWV ZHUH GHWHUPLQHG E\ DVVHPEOLQJ D SDQHO RI '1$ IURP WUDQVJHQLF PLFH GLJHVWHG ZLWK GLIIHUHQW UHVWULFWLRQ HQ]\PHV 7KH SDQHO RI FXW '1$V ZDV XVHG WR SURGXFH 6RXWKHUQ EORWV ZKLFK ZHUH WKHQ SUREHG ZLWK YDULRXV SUREHV WKDW ZHUH NQRZQ WR EH RQ WKH WUDQVJHQH $ UHDUUDQJHPHQW ZDV GHWHFWHG LI D EDQG SUHVHQW LQ D WUDQVJHQLF PRXVH ZDV D GLIIHUHQW VL]H WKDQ WKDW RI D ZLOGW\SH PRXVH 5HDUUDQJHPHQWV ZHUH GHWHFWHG LQ OLQHV % & DQG & &RS\ QXPEHU ZDV GHWHUPLQHG FUXGHO\ E\ FRPSDULQJ WKH LQWHQVLW\ RI D EDQG UHSUHVHQWHG E\ ERWK HQGRJHQRXV DOOHOHV DQG WKH WUDQVJHQLF DOOHOH ZLWK D VLPLODUO\ VL]HG EDQG WKDW LV QRW ORFDWHG RQ WKH WUDQVJHQH 7KH FRS\ QXPEHU ZDV VLPSO\ HVWLPDWHG DV VLQJOH FRS\ RU PXOWLFRS\ 2QH VLQJOH FRS\ DQG WZR PXOWLFRS\ OLQHV ZHUH REWDLQHG ZLWK WKH WUDQVJHQH WKH UHDUUDQJHG OLQH ZDV QRW WHVWHGf )RU WKH WUDQVJHQH WZR VLQJOH FRS\ DQG WZR PXOWLFRS\ OLQHV ZHUH REWDLQHG )LJXUH VXPPDUL]HV WKH FKDUDFWHUL]DWLRQ RI WKH WUDQVJHQLF OLQHV ZLWK UHVSHFW WR WKH FRS\ QXPEHU DQG LQWHJULW\ RI WKH %$& WUDQVJHQH ZLWKLQ HDFK OLQH 1H[W ZKHWKHU RU QRW WKH LQGLYLGXDO JHQHV ZHUH DFWXDOO\ H[SUHVVHG IURP WKH WUDQVJHQH LQ HDFK WUDQVJHQLF OLQH ZDV GHWHUPLQHG 7KLV ZDV GLIILFXOW EHFDXVH D KXPDQ WUDQVJHQH RU D UHSRUWHU FRQVWUXFW ZDV QRW XVHG WR GLVWLQJXLVK WUDQVJHQLF H[SUHVVLRQ IURP

PAGE 102

HQGRJHQRXV H[SUHVVLRQ ,QVWHDG WUDQVJHQLF H[SUHVVLRQ ZDV DQDO\]HG E\ PDWLQJ D IHPDOH WUDQVJHQLF PRXVH ZLWK D $3:6,& PDOH ,Q WKH SXSV LQKHULWLQJ D SDWHUQDO $3:6,& DOOHOH WKH SDWHUQDOO\ H[SUHVVHG JHQHV DUH VLOHQW ,I D $3:6,& PDOH LV PDWHG ZLWK D WUDQVJHQLF IHPDOH DQ\ H[SUHVVLRQ RI WKH ORFDO SDWHUQDOO\ H[SUHVVHG JHQHV ZRXOG EH IURP WKH WUDQVJHQH LQ SXSV WKDW KDYH ERWK WKH $3:6,& DOOHOH DQG WKH WUDQVJHQH 7KH EUHHGLQJ VFKHPH IRU REWDLQLQJ $3:6,& GHOHWLRQ PLFH WKDW DUH DOVR WUDQVJHQLF LV VKRZQ LQ )LJXUH ([SUHVVLRQ ZDV H[DPLQHG E\ QRUWKHUQ EORW DQDO\VLV DQG E\ 573&5 SHUIRUPHG RQ EUDLQ 51$ IURP SXSV WKDW KDG LQKHULWHG ERWK WKH WUDQVJHQH DQG WKH $3:6,& DOOHOH %\ QRUWKHUQ EORW OLQHV $ DQG VKRZ GHWHFWDEOH 1GQ H[SUHVVLRQ IURP WKH WUDQVJHQH )LJXUH f 3UREHV IRU 0DJHO DQG 0NUQ GLG QRW ZRUN LQ 1RUWKHUQ DQDO\VLV VR WKH\ ZHUH DQDO\]HG E\ 573&5 7KHVH JHQHV ZHUH DOVR H[SUHVVHG IURP WKH WUDQVJHQHV LQ WKH $ DQG WUDQVJHQLF OLQH 7UDQVJHQLF H[SUHVVLRQ IURP OLQHV $ DQG ZDV REVHUYHG E\ 573&5 IRU DOO WKUHH JHQHV ZKLOH OLQH % GLG QRW VKRZ H[SUHVVLRQ RI 0NUQ 0DJHO RU 1GQ )RU WKH WUDQVJHQLF OLQHV 6QUSQ ZDV GHWHFWHG E\ QRUWKHUQ DQDO\VLV LQ $ % DQG )LJ f +RZHYHU 0E,, D VQR51$ FOXVWHU WKDW LV SUHVHQW RQ WKH WUDQVJHQH ZDV RQO\ GHWHFWDEOH E\ QRUWKHUQ LQ OLQH $ LQGLFDWLQJ WKDW WKHUH PD\ EH VRPH XQGHWHFWHG UHDUUDQJHPHQWV LQ OLQHV % DQG )LJ f 2QH FDYHDW WR WKH H[SUHVVLRQ DQG UHDUUDQJHPHQW GDWD LV WKDW TXDQWLWDWLRQ RI WKH H[SUHVVLRQ OHYHO RI HDFK JHQH LQ WKH WUDQVJHQLF PLFH KDV RQO\ EHHQ DVFHUWDLQHG LQ D URXJK IDVKLRQ ,QGLYLGXDO JHQHV DUH XQGHU WKH FRQWURO RI WKHLU QDWLYH SURPRWHUV DQG UHJXODWRU\ HOHPHQWV VLQFH WKH %$& WUDQVJHQHV FRQWDLQ VHYHUDO NLOREDVH SDLUV RI IODQNLQJ VHTXHQFH 5RXJK HVWLPDWHV IURP QRUWKHUQ DQDO\VLV RI WKH WUDQVJHQHV VKRZ WKDW 1GQ VHHPV WR EH H[SUHVVHG DW QHDU ZLOGW\SH OHYHOV )LJ f ,Q FRQWUDVW 0E,, D VQR51$ KDUERUHG RQ

PAGE 103

WKH $ WUDQVJHQLF OLQH LV H[SUHVVHG DW D UHGXFHG OHYHO FRPSDUHG WR ZLOGW\SH DV DQDO\]HG E\ QRUWKHUQ DQDO\VLV )LJ f +RZHYHU 6QUSQ H[SUHVVLRQ DSSHDUV WR RFFXU DW FORVH WR ZLOGW\SH OHYHOV LQ DOO DQG WUDQVJHQLF OLQHV )LJ f 3UHFLVH H[SUHVVLRQ OHYHO EH\RQG WKDW GHVFULEHG KDV QRW VHHPHG SHUWLQHQW 7KH UHDUUDQJHPHQW GHWHFWLRQ FDSDELOLWLHV LQ WKH %$& WUDQVJHQLF PRXVH OLQHV DUH DOVR OLPLWHG 6HTXHQFHV XSVWUHDP RI 6QUSQ DUH ULGGOHG ZLWK /,1( HOHPHQWV DQG ORFDO UHSHDWV WKDW KDYH SUHFOXGHG GHYHORSPHQW RI SUREHV QHDU WKH HQGSRLQWV RI WKH %$& 6LPLODUO\ WKH UHSHWLWLYH QDWXUH RI WKH VQR51$ FOXVWHUV SUHFOXGHV GHYHORSPHQW RI XVHIXO SUREHV DQG VR UHDUUDQJHPHQWV RU EUHDNSRLQWV LQ %$&V RFFXUULQJ f RI 6QUSQ DUH QHDUO\ LPSRVVLEOH WR GHWHFW 7UDQVJHQLF 5HVFXH ([SHULPHQWV 7UDQVJHQLF /LQHV 7UDQVJHQLF IHPDOH PLFH UHSUHVHQWLQJ HDFK OLQH ZHUH PDWHG ZLWK PDOHV WKDW ZHUH KHWHUR]\JRXV IRU WKH $3:6,& DOOHOH )LJ f :KHQ SXSV ZHUH ERP WKH\ ZHUH FRXQWHG HDFK GD\ XS XQWLO ZHDQLQJ DQG GHDG PLFH DQG ERG\ SDUWV ZHUH FROOHFWHG DV WKH\ EHFDPH DYDLODEOH 7KH GHDG SXSV DV ZHOO DV WKH OLYH SXSV ZHUH JHQRW\SHG IRU WKH WUDQVJHQH DV ZHOO DV WKH $3:6,& DOOHOH ,Q WKH FDVH RI HDFK WUDQVJHQLF OLQH DVVD\HG QR SXS VXUYLYHG WR ZHDQLQJ WKDW LQKHULWHG WKH $3:6,& DOOHOH HYHQ LI WKH\ ZHUH DOVR WUDQVJHQLF LQGLFDWLQJ WKDW WKH WUDQVJHQLF OLQHV H[SUHVVLQJ 1GQ 0DJHO DQG 0NUQ FRXOG QRW UHVFXH WKH QHRQDWDO OHWKDOLW\ SKHQRW\SH :KLOH PLFH ZLWK )9%1PRWKHUV KDUERULQJ D SDWHUQDOO\ LQKHULWHG $3:6,& DOOHOH GLG QRW VXUYLYH XQWLO ZHDQLQJ WKH\ GLG IUHTXHQWO\ VXUYLYH XQWLO ZHHNV RI DJH ,W ZDV HYHQWXDOO\ GHWHUPLQHG WKDW $3:6,& FRXOG VXUYLYH WR DGXOWKRRG LI WKH ZLOGW\SH VLEV ZHUH UHPRYHG DQG WKDW VXUYLYLQJ $3:6,& PLFH ZHUH VPDOOHU WKDQ WKHLU ZLOGW\SH

PAGE 104

OLWWHUPDWHV :KLOH LW ZDV HYLGHQW WKDW WKH WUDQVJHQHV FRXOG QRW FRPSOHWHO\ UHVFXH WKH QHRQDWDO OHWKDOLW\ SKHQRW\SH LW FRXOG EH SRVVLEOH WKDW WKH WUDQVJHQHV FRXOG UHVFXH WKH VPDOO VWDWXUH SKHQRW\SH REVHUYHG LQ VXUYLYLQJ $3:6,& PLFH $JDLQ WUDQVJHQLF IHPDOHV ZHUH PDWHG ZLWK $3:6,& FDUULHU PDOHV EXW WKHQ WKH ZLOGW\SH OLWWHUPDWHV ZHUH UHPRYHG DW GD\V DIWHU ELUWK ZKHQ WKH\ FRXOG EH HDVLO\ GLVWLQJXLVKHG IURP WKH DIIHFWHG $3:6,& SXSV 7KH ZLOGW\SH SXSV ZHUH IRVWHUHG WR D VHSDUDWH PRWKHU IURP RXU PRXVH FRORQ\ VR WKDW WKH\ FRXOG EH FRPSDUHG WR WKH $3:6,& PLFH IURP WKH VDPH OLWWHU $W ZHDQLQJ WLPH ZHHNV RI DJHf WKH SXSV ZHUH JHQRW\SHG DQG ZHLJKHG 7KH SXSV ZHUH DJDLQ ZHLJKHG RQFH HYHU\ ZHHNV XQWLO WKH\ ZHUH ZHHNV RI DJH )LJXUH VKRZV D JUDSK RI DJH LQ ZHHNV YHUVXV ZHLJKW LQ JUDPV 7KH $ % DQG OLQHV ZHUH QRW FDSDEOH RI UHVFXLQJ WKH VPDOO VWDWXUH SKHQRW\SH RI $3:6,& PLFH 7UDQVJHQLF 5HVFXH ([SHULPHQWV DQG 7UDQVJHQLF /LQHV 6LPLODU WR WKH OLQHV IHPDOH WUDQVJHQLF PLFH UHSUHVHQWLQJ WKH WKUHH OLQHV DV ZHOO DV WKH VLQJOH 3, GHULYHG OLQH ZHUH PDWHG ZLWK $3:6,& FDUULHU PDOHV 3XSV ZHUH DOORZHG WR SURJUHVV WR ZHDQLQJ QDWXUDOO\ DQG GHDG ERGLHV ZHUH FROOHFWHG $V ZLWK WKH WUDQVJHQHV WKH DQG WUDQVJHQLF OLQHV GLG QRW SHUPLW VXUYLYDO RI $3:6,& PLFH VXJJHVWLQJ WKDW WUDQVJHQHV H[SUHVVLQJ 6QUSQ GR QRW UHVFXH WKH QHRQDWDO OHWKDOLW\ REVHUYHG LQ $3:6,& PLFH 7KH UHVFXH PDWLQJ ZDV UHSHDWHG DQG WKH ZLOGW\SH SXSV ZHUH IRVWHUHG WR QHZ PRWKHUV WR UHPRYH ZLOGW\SH FRPSHWLWLRQ $W GD\V DIWHU ELUWK DOO RI WKH $3:6,& PLFH ZHUH UHDGLO\ LGHQWLILHG UHJDUGOHVV RI ZKHWKHU RU QRW WKH\ FDUULHG D WUDQVJHQH ,Q WUDQVJHQLF OLQHV % DQG WKH WUDQVJHQLF OLWWHUPDWHV ZHUH QRW GLVWLQJXLVKDEOH E\ ZHHNV RI DJH HLWKHU /LQH & ZDV QRW VXEMHFWHG WR UHVFXH

PAGE 105

DQDO\VLV VLQFH 6QUSQ ZDV QRW H[SUHVVHG LQ WKLV OLQH ,Q OLQH $ KRZHYHU ZKLOH WUDQVJHQLF $3:6,& SXSV ZHUH LQGLVWLQJXLVKDEOH IURP QRQWUDQVJHQLF $3:6,& SXSV DW ELUWK E\ ZHHNV RI DJH WKH WUDQVJHQLF YHUVXV QRQWUDQVJHQLF $3:6,& SXSV FRXOG EH VHSDUDWHG E\ VL]H 7KH VPDOO SXSV ZHUH WKH $3:6,& SXSV ZKLOH WKH ODUJHU SXSV UHSUHVHQWHG WKRVH WKDW KDG LQKHULWHG WKH $ WUDQVJHQH DV ZHOO DV WKH $3:6,& DOOHOH 3XSV IURP HDFK WUDQVJHQLF OLQH ZHUH ZHLJKHG DW ZHDQLQJ ZHHNV RI DJHf DQG WKHQ HYHU\ ZHHNV WKHUHDIWHU XQWLO ZHHNV RI DJH )LJXUH VKRZV WKHVH JURZWK FKDUWV IRU WKH DQG WUDQVJHQLF OLQHV 7KH $ WUDQVJHQH DSSHDUV WR UHVFXH WKH VPDOO VWDWXUH SKHQRW\SH RI WKH VXUYLYLQJ $3:6,& PLFH EXW GRHV QRW UHVFXH WKH QHRQDWDO IDLOXUH WR WKULYH )XUWKHUPRUH ZLOGW\SH PLFH WKDW DUH WUDQVJHQLF IRU WKH $ WUDQVJHQH DUH ODUJHU WKDQ WKHLU QRQWUDQVJHQLF FRXQWHUSDUWV VXJJHVWLQJ WKDW WKH $ WUDQVJHQH SURPRWHV JURZWK 1RQH RI WKH RWKHU WUDQVJHQHV UHVFXH WKH VPDOO VWDWXUH RU WKH IDLOXUH WR WKULYH RQ WKH )9%1VWUDLQ EDFNJURXQG 'LVFXVVLRQ %$& ,VRODWLRQ %$& FORQHV SURYHG WR EH LGHDO IRU XVH DV WUDQVJHQHV LQ WKH WUDQVJHQLF UHVFXH H[SHULPHQWV IRU D YDULHW\ RI UHDVRQV 7KH\ DUH UHODWLYHO\ HDV\ WR KDQGOH EHLQJ SURSDJDWHG DQG LVRODWHG OLNH FRQYHQWLRQDO SODVPLGV ,QWULJXLQJO\ WKH %$& FORQHV WKDW ZHUH LVRODWHG 1 DQG HDFK FRQWDLQHG PXOWLSOH JHQHV IDFLOLWDWLQJ WKH DWWHPSWHG WUDQVJHQLF UHVFXH ZLWK WKH NQRZQ SDWHUQDOO\ H[SUHVVHG JHQHV %$& FORQHV FRQWDLQLQJ HDFK RI WKH NQRZQ SDWHUQDOO\ H[SUHVVHG JHQHV ZHUH LVRODWHG KRZHYHU WKH %$& FRQWLJ KDV QRW EHHQ H[WHQGHG DFURVV D 0E UHJLRQ WKDW OLHV f RI 6QUSQ DQG f RI 1GQ 7KLV UHJLRQ LV KLJKO\ UHSHWLWLYH GLIILFXOW WR SUREH DQG LWV VL]H ZDV XQGHUHVWLPDWHG

PAGE 106

SULRU WR WKH SXEOLFDWLRQ RI WKH ILUVW GUDIW RI WKH SXEOLF PRXVH JHQRPH VHTXHQFLQJ SURMHFW ZDV GRQH +RZHYHU WKH 1&%, VHTXHQFLQJ HIIRUWV KDYH QRZ LGHQWLILHG D %$& ILQJHUSULQW WKDW VSDQV WKLV UHJLRQ 7UDQVJHQLF PLFH SURGXFHG IURP WKH %$& FORQHV UHSUHVHQWHG D PL[ RI VLQJOHFRS\ DQG PXOWLFRS\ OLQHV ZLWK WKH RYHUDOO HIILFLHQF\ RI SURGXFLQJ WUDQVJHQLF PLFH EHLQJ DERXW LQ OLYH ELUWKV GDWD QRW VKRZQf 7KH WUDQVJHQHV LQ WKLV VWXG\ ZHUH DOVR WUDQVPLWWHG LQ QRUPDO PHQGHOLDQ UDWLRV GDWD QRW VKRZQf )RXU WUDQVJHQLF OLQHV ZLWK %$& 1 IRXU OLQHV UHSUHVHQWLQJ %$& DQG D VLQJOH OLQH IURP WKH 3, FORQH ZHUH SURGXFHG /LQHV $ DQG H[SUHVVHG 0NUQ 0DJHO DQG 1GQ OLQH % GLG QRW H[SUHVV DQ\ RI WKH WKUHH JHQHV FRQWDLQHG RQ WKH %$& DQG OLQH & ZDV ORVW GXULQJ PDLQWHQDQFH RI WKH VWUDLQ DQG ZDV QRW DQDO\]HG IXUWKHU /LQH $ H[SUHVVHG 6QUSQ 0E,, DQG SXWDWLYHO\ DOO RI WKH VQR51$V ORFDWHG EHWZHHQ WKRVH WZR JHQHV ZKLOH OLQHV % DQG H[SUHVVHG RQO\ 6QUSQ ,W LV XQNQRZQ ZKHWKHU RU QRW WKHVH WUDQVJHQLF OLQHV H[SUHVV DQ\ RI WKH VLQJOH FRS\ VQR51$V RWKHU WKDQ 0EOO WKDW OLH f RI 6QUSQ 5HDUUDQJHG 7UDQVJHQHV 5HDUUDQJHG WUDQVJHQHV DUH LQHYLWDEOH ZKHQ PDNLQJ WUDQVJHQLF PLFH XVLQJ RXU WHFKQLTXH DV %$& VXSHUFRLOV DQG QLFNHG PROHFXOHV IURP WKH FHVLXP FKORULGH EDQGLQJ SURFHGXUH ZHUH LQMHFWHG ,Q WKH QLFNHG IUDFWLRQ WKH QLFN RFFXUV UDQGRPO\ ZLWK QR GLVFHUQPHQW DJDLQVW GLVUXSWLRQ RI WKH PRXVH '1$ LQVHUW 6LPLODUO\ WKH VXSHUFRLOV PXVW EUHDN WR LQWHJUDWH LQWR WKH PRXVH JHQRPH DQG VR WKLV EUHDN RFFXUV UDQGRPO\ 7KH EXUGHQ WKHQ IDOOV RQ WKH DELOLW\ WR JHQHUDWH HQRXJK WUDQVJHQLF OLQHV WR REWDLQ DW OHDVW RQH WKDW LV QRW UHDUUDQJHG DQG WKHQ RQ WKH DELOLW\ WR GHWHFW UHDUUDQJHPHQWV 6LQFH JHQH

PAGE 107

H[SUHVVLRQ ZDV WKH DVVD\ IRU ZKHWKHU RU QRW D WUDQVJHQH ZDV IXQFWLRQDO RQO\ D FUXGH HVWLPDWH RI WKH ORFDWLRQV RI UHDUUDQJHPHQWV ZDV QHHGHG ,W KDV DOVR ZRUNHG WR RXU DGYDQWDJH WKDW VRPH RI WKH UHDUUDQJHPHQWV WKDW ZHUH REWDLQHG XQZLWWLQJO\ SURGXFH D GHOHWLRQ VHULHV IRU WKH UHVFXLQJ %$&V )RU H[DPSOH OLQH $ H[SUHVVHV 6QUSQ 0E,, DQG SUREDEO\ WKH VQR51$V WKDW OLH EHWZHHQ WKHP ZKLOH OLQHV % DQG RQO\ H[SUHVV 6QUSQ DQG VRPH RI WKH VLQJOHFRS\ VQR51$V 7KLV FUHDWHV WKH RSSRUWXQLW\ WR GLIIHUHQWLDWH EHWZHHQ WKH HIIHFWV RI 6QUSQ LQ D WUDQVJHQLF UHVFXH SDUDGLJP DQG 6QUSQ SOXV 0E,, ZLWKRXW KDYLQJ WR LQMHFW D GLIIHUHQW WUDQVJHQH 1 DQG WUDQVJHQLF OLQHV WKDW GR QRW H[SUHVV DOO RI WKH JHQHV WKDW DUH ORFDWHG ZLWKLQ WKHLU UHVSHFWLYH FORQHV PD\ GR VR IRU D YDULHW\ RI UHDVRQV ,Q WKH FDVH RI WKH % WUDQVJHQLF OLQH D UHDUUDQJHPHQW WKDW GLVUXSWV RU GHOHWHV WKH SURPRWHU UHJLRQ RI 1GQ LV WKH PRVW OLNHO\ H[SODQDWLRQ IRU WKH LQDELOLW\ RI WKLV OLQH WR H[SUHVV 1GQ $OWHUQDWLYHO\ HLWKHU D UHJXODWRU\ UHJLRQ PD\ EH SK\VLFDOO\ VHSDUDWHG IURP WKH SURPRWHU UHJLRQ UHVXOWLQJ LQ GLVUXSWLRQ RI 1GQ WUDQVFULSWLRQ ,QWHUHVWLQJO\ LW PD\ EH WKH FDVH WKDW 0NUQ 0DJHO DQG 1GQ DUH UHJXODWHG E\ D FRPPRQ HQKDQFHU LQ DGGLWLRQ WR WKH 3:6 ,& ,Q WKH FDVH RI WKH WUDQVJHQHV WKH 6QUSQ WUDQVFULSW KDV EHHQ SRVWXODWHG WR GULYH H[SUHVVLRQ RI WKH KHDYLO\ VSOLFHG WUDQVFULSW WKDW WKH VQR51$V DUH VSOLFHG IURP VR GLVUXSWLRQ RI WKH 6QUSQ SURPRWHU LV QRW SRVVLEOH VLQFH 6QUSQ H[SUHVVLRQ VHHPV QRUPDO LQ WKHVH OLQHV ,W LV SUREDEOH WKDW WKH %$& FORQH ZDV EURNHQ f RI WKH 6QUSQ JHQH DOWKRXJK WKLV UHDUUDQJHPHQW ZDV QRW GHWHFWDEOH ZLWK DQ\ RI RXU SUREHV 'HYHORSPHQW RI DGGLWLRQDO SUREHV LQ WKLV UHJLRQ LV GLIILFXOW VLQFH LW LV KLJKO\ UHSHWLWLYH 7KH H[SUHVVLRQ RI 0E,, IURP WKH $ WUDQVJHQH SRVHV D FXULRXV REVHUYDWLRQ 7KH H[SUHVVLRQ OHYHO RI WKLV VQR51$ LV UHODWLYHO\ ORZ FRPSDUHG WR ZLOGW\SH H[SUHVVLRQ

PAGE 108

OHYHOV 7KH $ WUDQVJHQH PD\ QRW FRQWDLQ WKH IXOO 0E,, FOXVWHU 7KH %$& LWVHOI PD\ RQO\ H[WHQG LQWR WKH ILUVW IHZ FRSLHV RI 0E,, DQG WKH H[SUHVVLRQ OHYHO VHHQ E\ QRUWKHUQ PD\ EH D UHVXOW RI WKH IHZ FRSLHV SUHVHQW RQ WKH %$& $Q DOWHUQDWH H[SODQDWLRQ LV WKDW WKH UHSHDWHG WUDQVJHQH FDXVHV VRPH VLOHQFLQJ RI H[SUHVVLRQ IURP WKH WUDQJHQH DOWKRXJK WKLV LV VRPHZKDW XQOLNHO\ VLQFH 6QUSQ DSSHDUV WR EH H[SUHVVHG DW QHDU ZLOGW\SH OHYHOV ,W LV DOVR IRUPDOO\ SRVVLEOH WKDW OLQHV % DQG GR QRW KDYH D UHDUUDQJHPHQW DW DOO 7KH\ PD\ H[SUHVV 0E,, DV ZHOO DOEHLW DW D ORZHU OHYHO 0E,, H[SUHVVLRQ PD\ EH YLVLEOH VROHO\ EHFDXVH RI WKH PXOWLFRS\ LQVHUWLRQ RI WKLV WUDQVJHQH FDXVLQJ KLJKHU PRUH GHWHFWDEOH H[SUHVVLRQ RI WKH 0E,, VQR51$ VSHFLHV 7UDQVJHQLF 5HVFXH 7KDW WUDQVJHQLF OLQHV $ DQG GR QRW UHVFXH WKH QHRQDWDO OHWKDOLW\ RI WKH $3:6,& PRXVH LV SRVVLEO\ YHU\ LQWHUHVWLQJ LQ OLJKW RI WKH 1GQ NQRFNRXW GDWD 7ZR JURXSV UHSRUW QHRQDWDO OHWKDOLW\ RI YDULDEOH SHQHWUDQFH LQ FRQMXQFWLRQ ZLWK D WDUJHWHG PXWDWLRQ RI WKH 1GQ JHQH +RZHYHU WKH WUDQVJHQHV ZKLFK H[SUHVV 1GQ DV ZHOO DV 0DJHO DQG 0NUQ GR QRW UHVFXH QHRQDWDO OHWKDOLW\ DW DOO :KLOH WKHVH GDWD PD\ VHHP DW RGGV LW LV LPSRUWDQW WR UHPHPEHU WKDW 3:6 LV D FRQWLJXRXV JHQH V\QGURPH FDXVHG E\ WKH GLVUXSWLRQ RI WZR RU PRUH SDWHUQDOO\ H[SUHVVHG JHQHV 7KH LQDELOLW\ WR UHVFXH WKH 3:6 SKHQRW\SH ZLWK WKH 1GQ FRQWDLQLQJ WUDQVJHQHV FRXOG EH GXH WR WKH SUHVHQFH RI DQRWKHU XQLGHQWLILHG JHQH WKDW SDUWLFLSDWHV LQ WKH QHRQDWDO IDLOXUH WR WKULYH SKHQRW\SH $OWHUQDWLYHO\ WKH GLVSDUDWH UHVXOWV EHWZHHQ WKH PXOWLSOH ODEV FUHDWLQJ 1GQ NQRFNRXWV PD\ EH UHYHDOLQJ LQ WKHPVHOYHV LQ WKDW 1GQ PD\ QRW FRQWULEXWH VLJQLILFDQWO\ WR IDLOXUH WR WKULYH DQG WKDW WKH 6WHZDUW DQG 0XVFDWHOOL JURXSV PD\ EH SURGXFLQJ UHJXODWRU\ PXWDWLRQV

PAGE 109

WKDW DIIHFW JHQHV RWKHU WKDQ 1GQ $OWHUQDWHO\ WKHUH FRXOG VWLOO EH GLIIHUHQFHV LQ VWUDLQ EDFNJURXQGV WKDW H[SODLQ WKLV 1RQHWKHOHVV LW LV LPSRUWDQW WR SRLQW RXW WKDW 1GQ 0DJHO DQG 0NUQ GR QRW VHHP WR KDYH D PDMRU UROH LQ IDLOXUH WR WKULYH RU LQ VPDOO VWDWXUH 7UDQVJHQLF OLQHV H[SUHVVLQJ WKHVH JHQHV GR VR DW D OHYHO WKDW LV YHU\ FORVH WR ZLOGW\SH OHYHOV DQG RFFXUV IURP WKH QDWLYH SURPRWHU VR ODFN RI UHVFXH LV QRW OLNHO\ GXH WR LQFRUUHFW H[SUHVVLRQ OHYHOV RU LQFRUUHFW WLVVXH VSHFLILFLW\ RI WUDQVJHQLF H[SUHVVLRQ 7KH PRVW OLNHO\ H[SODQDWLRQ LV WKDW WKHUH LV PRUH WKDQ RQH JHQH WKDW FRQWULEXWHV WR WKH IDLOXUH WR WKULYH SKHQRW\SH ,I WKLV LV WKH FDVH ZH PD\ KDYH WR FRPSOHPHQW ZLWK ERWK JHQHV LQ RUGHU WR VHH UHVFXH RI WKH $3:6,& SKHQRW\SH $OWHUQDWLYHO\ WKHVH WKUHH JHQHV PD\ EH LQYROYHG LQ VRPH RI WKH EHKDYLRUDO SKHQRW\SHV RI 3:6 WKDW ZH KDYH QRW LQYHVWLJDWHG LQ RXU PRXVH PRGHO ,W LV DOVR SRVVLEOH WKDW WKHVH JHQHV DUH UHVSRQVLEOH IRU REHVLW\ LQ KXPDQV DQG WKH UHVFXH RI DQ 3:6DVVRFLDWHG REHVLW\ SKHQRW\SH FDQQRW EH LQYHVWLJDWHG EHFDXVH WKH PRXVH PRGHO GRHV QRW EHFRPH REHVH 7KH DELOLW\ RI WKH $ WUDQVJHQH WR UHVFXH WKH VPDOO VWDWXUH SKHQRW\SH RI WKH $3:6,& PLFH LV SDUWLFXODUO\ LQWULJXLQJ 7KLV UHVFXH KDV ILUVW DOORZHG WKH VHSDUDWLRQ RI WKH IDLOXUH WR WKULYH SKHQRW\SH IURP WKH VPDOO VWDWXUH VHHQ LQ WKH $3:6,& PRXVH PRGHO 6HFRQGO\ LW KDV DWWULEXWHG WKH VPDOO VWDWXUH SKHQRW\SH WR WKH 0E,, VQR51$ FOXVWHU 7UDQVJHQLF OLQHV % DQG HDFK IDLO WR UHVFXH WKH VPDOO VWDWXUH SKHQRW\SH VXJJHVWLQJ WKDW QHLWKHU 6QXUI QRU 6QUSQ LV UHVSRQVLEOH IRU WKH VPDOO VWDWXUH SKHQRW\SH +RZHYHU OLQH $ WKH RQO\ OLQH H[SUHVVLQJ 0E,, GRHV UHVFXH WKLV SKHQRW\SH VXJJHVWLQJ WKDW 0E,, LV DW OHDVW VRPHZKDW UHVSRQVLEOH IRU JURZWK 7KLV LV WKH ILUVW LQVWDQFH RI D SKHQRW\SH EHLQJ VSHFLILFDOO\ DWWULEXWHG WR D VQR51$ DQG DVVLJQV D IXQFWLRQ

PAGE 110

WR RQH RI WKHVH LOOXVLYH LPSULQWHG VPDOO 51$V LQ WKH UHJLRQ ,W LV DOVR LQWHUHVWLQJ WKDW WKH H[SUHVVLRQ OHYHO UHTXLUHG WR UHVFXH WKLV DVSHFW RI WKH $3:6,& PRXVH LV UHODWLYHO\ ORZ 0DQ\ TXHVWLRQV VWLOO UHPDLQ UHJDUGLQJ WKH WUDQVJHQLF UHVFXH XVLQJ WKH $ %$& )LUVW RI DOO LI WKH H[SUHVVLRQ OHYHO RI 0E,, ZHUH RFFXUULQJ DW D ZLOGW\SH OHYHO ZRXOG WKH IDLOXUH WR WKULYH SKHQRW\SH EH DPHOLRUDWHG" 6HFRQGO\ GRHV $ H[SUHVV WKH HQWLUH 0E,, FOXVWHU" 6XEFDWHJRULHV RI WKH 0E,, VSHFLHV H[LVW DQG LW LV XQFHUWDLQ KRZ PDQ\ RI WKHVH DUH LQFOXGHG RQ WKH %$& )XUWKHUPRUH LW LV QRW NQRZQ ZKHWKHU RU QRW WKH GLIIHUHQW VXEFDWHJRULHV KDYH GLIIHUHQW IXQFWLRQV +RZHYHU WKHVH VWXGLHV VKRZ WKDW 0E,, GRHV SOD\ DQ LPSRUWDQW UROH LQ WKH 3:6 SKHQRW\SH LQGLFDWLQJ WKDW WKH VQR51$V ZDUUDQW IXUWKHU LQYHVWLJDWLRQ 5HPHPEHULQJ WKDW 3:6 LV D FRQWLJXRXV JHQH V\QGURPH PDWLQJV EHWZHHQ WKH $ WUDQVJHQLF PLFH DQG WUDQVJHQLF PLFH KDYH EHHQ HVWDELOLVKHG WR REWDLQ GRXEOH KHWHUR]\JRWHV WKDW FDQ EH PDWHG WR $3:6,& PDOHV 7KHVH PDWLQJV ZLOO \LHOG D VPDOO SHUFHQWDJH RI PLFH WKDW DUH WUDQVJHQLF IRU ERWK $ DQG EXW DOVR LQKHULW D SDWHUQDO $3:6,& DOOHOH ,Q WKHVH PLFH WKH DELOLW\ RI 1GQ 0DJHO DQG 0NUQ DV ZHOO DV 6QUSQ DQG 0E,, WR SURPRWH FRPSOHWH UHVFXH RI WKH 3:6 SKHQRW\SH FDQ EH LQYHVWLJDWHG 7KHVH WUDQVJHQLF PLFH FDQ DOVR EH XVHG WR WHVW WKH DELOLW\ RI WKH YDULRXV WUDQVJHQHV WR UHVFXH WKH IDLOXUH WR WKULYH DQG QHRQDWDO OHWKDOLW\ SKHQRW\SHV RQ WKH &%/VWUDLQ EDFNJURXQG VLQFH ILYH RI WKH WUDQVJHQLF OLQHV DUH EHLQJ PDGH FRQJHQLH RQ WKLV VWUDLQ

PAGE 111

+ ‘‘‘ 6QUSQ )LJXUH ,QGLYLGXDO JHQH GHOHWLRQV LQ WKH 3:6 UHJLRQ 0NUQ WDUJHWHG GLVUXSWLRQ VKRZV QR RYHUW SKHQRW\SH 1GQ WDUJHWHG GLVUXSWLRQ VKRZV HLWKHU QHRQDWDO OHWKDOLW\ RU QR RYHUW SKHQRW\SH 6QXUI WDUJHWHG GLVUXSWLRQ VKRZV QR RYHUW SKHQRW\SH 6QUSQ WDUJHWHG GLVUXSWLRQ VKRZV QR RYHUW SKHQRW\SH 'HOHWLRQ RI WKH 3:6,& FDXVHV QHRQDWDO OHWKDOLW\ 6PDOOHU GHOHWLRQV DURXQG WKH 3:6,& VKRZ LQFRPSOHWH ,& GHOHWLRQ SKHQRW\SH $ GHOHWLRQ VSDQQLQJ IURP 6QXUI WR 8EHD FDXVHV QHRQDWDO OHWKDOLW\ DQG VPDOO VWDWXUH ,, $ UDGLDWLRQ LQGXFHG PXWDWLRQ VSDQQLQJ IURP ,SZ GRZQVWUHDP FDXVHV QR RYHUW SKHQRW\SH ZKHQ SDWHUQDOO\ LQKHULWHG -RKQVRQf $ WUDQVJHQH LQVHUWLRQ WKDW FDXVHV D ODUJH GHOHWLRQ RI WKH 3:6$6 UHJLRQ FDXVHV D SKHQRW\SH VLPLODU WR WKH ,& GHOHWLRQ PRXVH 5 1LFKROOVf

PAGE 112

\nY" rSn $ NE 1 NE 3O NE NE 3 NE )LJXUH &ORQHV UHSUHVHQWLQJ WKH 3:6 UHJLRQ %$&V RU 3 FORQHV ZHUH LVRODWHG IURP 6Y RU &%/OLEUDULHV 7KHLU ORFDWLRQV DQG VL]HV DUH DSSUR[LPDWHG

PAGE 113

$ FRSLHV LQWDFW % FRS\ UHDUUDQJHG & OLQH ORVW FRS\ LQWDFW 3, FRS\ LQWDFW FRSLHV LQWDFW $ FRSLHV LQWDFW % FRS\ LQWDFW & FRS\ WUXQFDWHG FRS\ LQWDFW )LJXUH 7UDQVJHQLF OLQHV REWDLQHG IRU WUDQVJHQLF UHVFXH &RS\ QXPEHU DQG LQWDFWQHVV LV LQGLFDWHG DFFRUGLQJ WR DYDLODEOH SUREHV

PAGE 114

([SUHVVHV DOO JHQHV ([SUHVVHV DOO JHQHV ([SUHVVHV QRQH RI WKH ([SUHVVHV QRQH RI WKH SOXV JHQHV IURP WKH JHQHV JHQHV H[FHSW WKRVH WUDQVJHQH SURYLGHG E\ WKH WUDQVJHQH )LJXUH %UHHGLQJ VFKHPH IRU WUDQVJHQLF UHVFXH 6H[ DQG VWUDLQ DUH LQGLFDWHG ZKHUH UHOHYDQW

PAGE 115

)LJXUH 1GQ 0DJHO DQG 0NUQ DUH H[SUHVVHG LQ WZR WUDQVJHQLF OLQHV $ 1RUWKHUQ EORW DQDO\VLV ZDV XVHG WR LQYHVWLJDWH 1GQ H[SUHVVLRQ LQ PLFH WKDW KDG LQKHULWHG D SDWHUQDO $3:6,& DOOHOH DV ZHOO DV D WUDQVJHQH 7KH UHOHYDQW WUDQVJHQLF OLQH LV OLVWHG DERYH HDFK ODQH SJ RI WRWDO EUDLQ 51$ ZDV ORDGHG RQ D JHO DQG WKH EORW ZDV SUREHG ZLWK D SRUWLRQ RI WKH FRGLQJ UHJLRQ IRU WKH 1GQ JHQH % 573&5 ZDV XVHG WR LQYHVWLJDWH 0DJHO DQG 0NUQ LQ WKH VDPH PLFH SJ RI 51$ ZDV XVHG WR SURJUDP 573&5 UHDFWLRQV

PAGE 116

% 0EO, 0EO, 0EO, )LJXUH 6QUSQ DQG VQR51$ H[SUHVVLRQ LQ DQG WUDQVJHQLF OLQHV $ 1RUWKHUQ DQDO\VLV ZDV XVHG WR VKRZ 6QUSQ H[SUHVVLRQ LQ PLFH WKDW KDG LQKHULWHG D SDWHUQDO $3:6,& DOOHOH DV ZHOO DV D WUDQVJHQH 7KH UHOHYDQW WUDQVJHQHV DUH OLVWHG SJ RI WRWDO EUDLQ 51$ ZDV ORDGHG SHU ODQH DQG WKH EORW ZDV SUREHG ZLWK WKH f SRUWLRQ RI WKH 6QUSQ WUDQVFULSW % 1RUWKHUQ DQDO\VLV ZDV SHUIRUPHG IRU VQR51$V SJ RI WRWDO EUDLQ 51$ ZDV ORDGHG SHU ODQH RQ D b SRO\DFU\ODPLGH JHO 7KH EORW ZDV SUREHG ZLWK ROLJRQXFOHRWLGHV FRPSOHPHQWDU\ WR 0E,, 0E,, DQG 0E,,

PAGE 117

_ UH 2f HQ fX 7UDQVJHQLF )HPDOHV f§ZW & GHOHWLRQ & GHOHWLRQ $ & GHOHWLRQ % DWf§ & GHOHWLRQ $JH ZHHNVf nLQ ( e O ‘} 2f f 7UDQVJHQLF 0DOHV f§ZW ,& GHOHWLRQ ,& GHOHWLRQ $ ,& GHOHWLRQ % DWf§,& GHOHWLRQ $JH ZHHNVf )LJXUH 7UDQVJHQHV KDUERULQJ 0NUQ 0DJHO DQG 1GQ GR QRW UHVFXH VPDOO VWDWXUH SKHQRW\SH 0LFH LQKHULWLQJ D SDWHUQDO $3:6,& DOOHOH DV ZHOO DV D WUDQVJHQH ZHUH ZHLJKHG RQFH HYHU\ ZHHNV IURP ZHDQLQJ 7KHLU DJH LQ ZHHNV YHUVXV ZHLJKW LQ JUDPV ZDV SORWWHG

PAGE 118

Q 9f ( FQ R f ‘ 7UDQVJHQLF )HPDOHV f§rf§ZW ,& GHOHWLRQ ,& GHOHWLRQ ,& GHOHWLRQ $ ,& GHOHWLRQ % ,& GHOHWLRQ f§,f§ZW $ $JH ZHHNVf )LJXUH 7UDQVJHQH $ UHVFXHV VPDOO VWDWXUH SKHQRW\SH EXW RWKHU WUDQVJHQHV EHDULQJ 6QUSQ GR QRW 0LFH LQKHULWLQJ D SDWHUQDO $3:6,& DOOHOH DV ZHOO DV D WUDQVJHQH ZHUH ZHLJKHG HYHU\ ZHHNV EHJLQQLQJ DW ZHDQLQJ 7KHLU DJH LQ ZHHNV LV SORWWHG YHUVXV ZHLJKW LQ JUDPV :LOGW\SH PLFH KDUERULQJ WKH $ WUDQVJHQH DUH DOVR VKRZQ

PAGE 119

&+$37(5 &21&/86,216 $1' )8785( ',5(&7,216 7KLV VWXG\ RI WKH PHFKDQLVPV DQG SKHQRW\SHV LQYROYHG ZLWK 3:6 KDV FRQWULEXWHG PXFK WR WKH XQGHUVWDQGLQJ RI WKLV GLVRUGHU \HW WKHUH LV VWLOO PXFK WR EH OHDUQHG +RZHYHU WKLV VWXG\ GHPRQVWUDWHV WKH PXOWLSOH XVHV RI D PRXVH PRGHO IRU D KXPDQ LPSULQWLQJ GLVRUGHU DQG KRZ LW FDQ EH XVHG WR GLVVHFW WKH PDQ\ LQWULFDFLHV DVVRFLDWHG ZLWK D GLVHDVH 7KH PDWHUQDOO\ H[SUHVVHG JHQHV LQ WKH $63:6 UHJLRQ 8%($ DQG $73 ,2& VHHP P\VWHULRXV VLQFH WKHLU LPSULQWHG H[SUHVVLRQ VHHPV WR EH OLPLWHG WR VSHFLILF FHOO RU WLVVXH W\SHV 8%($ GRHV QRW DSSHDU WR EHKDYH DV D FODVVLFDO LPSULQWHG JHQH DVVRFLDWHG ZLWK PHWK\ODWLRQ LPSULQWV DQG WLJKWO\ UHJXODWHG SDUHQWRIRULJLQ H[SUHVVLRQ DQG $73 ,2& KDV QRW EHHQ ZHOO VWXGLHG WR GDWH 7KH GDWD SUHVHQWHG LQ WKLV GLVVHUWDWLRQ VXJJHVW D SRVVLEOH PRGHO IRU LPSULQWHG H[SUHVVLRQ RI PXULQH 8EHD WKDW VLPSOLILHV WKH UHJXODWLRQ RI WKH PDWHUQDOO\ H[SUHVVHG JHQHV )LJ f 7KH GDWD VSHFLILFDOO\ VXJJHVW WKDW 8EHD LV QHJDWLYHO\ UHJXODWHG E\ D SDWHUQDOO\ H[SUHVVHG WUDQVFULSW DQWLVHQVH WR WKH JHQH DQG WKDW WKLV WUDQVFULSW LV SRVLWLYHO\ UHJXODWHG E\ WKH 3:6,& 7KLV GRHV QRW SURYLGH GHILQLWLYH SURRI WKDW WKH UHJXODWLRQ RI 8EHD LPSULQWLQJ RFFXUV YLD WKH DQWLVHQVH WUDQVFULSW KRZHYHU 7HUPLQDWLRQ RI WKH DQWLVHQVH WUDQVFULSW WR 8EHD FRXOG EH XVHG WR SURYH WKLV K\SRWKHVLV IRU JHQH UHJXODWLRQ $OWHUQDWLYHO\ GHPRQVWUDWLRQ WKDW LPSULQWHG H[SUHVVLRQ RI 8EHD FRLQFLGHV ZLWK WKH SUHVHQFH RI WKH DQWLVHQVH WUDQVFULSW LQ D SDUWLFXODU FHOO W\SH DQG WKDW LQ WKH VDPH FHOO W\SH WKH DEVHQFH RI WKLV WUDQVFULSW SUHYHQWV LPSULQWHG 8EHD

PAGE 120

,OO H[SUHVVLRQ ZRXOG SURYLGH RYHUZKHOPLQJ HYLGHQFH WKDW WKLV PRGHO IRU UHJXODWLRQ RI 8EHD LV FRUUHFW ,W ZRXOG DOVR EH LQWHUHVWLQJ WR VHH ZKHWKHU $WSO2F LV VLPLODUO\ UHJXODWHG 7KH LPSULQWHG WUDQVJHQHV LGHQWLILHG LQ WKLV VWXG\ DUH QRW WHUULEO\ LQIRUPDWLYH ZLWK UHVSHFW WR WKH PHFKDQLVPV RI LPSULQWLQJ LQ WKH 3:6$6 UHJLRQ EXW WKH\ GR FUHDWH DQ DWWUDFWLYH V\VWHP LQ ZKLFK LW FDQ EH LQYHVWLJDWHG LQ JUHDW GHWDLO 7KH WUDQVJHQHV VWXGLHG GHPRQVWUDWH WKDW FRUUHFW LPSULQWLQJ RI D 6QUSQ WUDQVJHQH FDQ RFFXU HYHQ ZKHQ WKH\ DUH LQWHJUDWHG DW DQ HFWRSLF VLWH LQ WKH PRXVH JHQRPH 7KH PLQLPDO DUHD QHFHVVDU\ WR DFKLHYH DSSURSULDWH LPSULQWHG H[SUHVVLRQ LV QHDUO\ NE 6RPH GDWD VXJJHVW WKDW WKLV PLQLPDO UHJLRQ PLJKW EH DV VPDOO DV NE KRZHYHU WKLV PXVW EH WHVWHG LQ D PRUH ULJRURXV PDQQHU EHIRUH LW FDQ EH EHOLHYHG 7KHVH LPSULQWHG WUDQVJHQHV DOVR VXJJHVW WKDW WKH $6,& ZKLFK KDV QRW EHHQ IXQFWLRQDOO\ LGHQWLILHG LQ PRXVH LV ORFDWHG ZLWKLQ NE RI WKH 6QUSQ JHQH 7KHVH GDWD FDQ EH XVHG WR PDNH D WDUJHWHG PXULQH $6,& PXWDWLRQ )XUWKHU H[SHULPHQWV DORQJ WKHVH OLQHV LQFOXGH GHOHWLQJ WKH DSSURSULDWH UHJLRQV RQ WKH %$& WR PLPLF WKH UHDUUDQJHPHQWV VHHQ LQ WUDQVJHQLF OLQH % ZLWK KRSHV RI IXUWKHU QDUURZLQJ WKH PLQLPDO DUHD VXIILFLHQW WR FRQIHU SURSHU LPSULQWLQJ DQG GHOHWLQJ VSHFLILF HOHPHQWV ZLWKLQ WKH 3:6,& DQG $6,& WR VHH LI WKH\ DUH UHTXLUHG IRU LPSULQWHG H[SUHVVLRQ $ PDUNHG 6QUSQ ORFXV KDV DOUHDG\ EHHQ FUHDWHG WR EHJLQ WKHVH VWXGLHV 7KH SKHQRW\SH VWXGLHV SUHVHQWHG LQ WKLV GLVVHUWDWLRQ GHPRQVWUDWH WKH FOLQLFDO UHOHYDQFH RI PRXVH PRGHOV IRU 3:6 7KH REVHUYDWLRQ WKDW WKHUH DUH VWUDLQ GHSHQGHQW GLIIHUHQFHV LQ WKH SKHQRW\SH RI 3:6 PLFH KDV DOORZHG XV WR LQYHVWLJDWH WKH DGXOW RQVHW SKHQRW\SHV LQYROYHG ZLWK 3:6 6LQFH WKH DIIHFWHG PLFH FDQ VXUYLYH EHKDYLRUDO WHVWV REHVLW\ VWXGLHV DQG QXWULWLRQDO VWXGLHV FDQ QRZ EH FDUULHG RXW RQ WKHVH PLFH 7UHDWPHQWV

PAGE 121

IRU WKH GLVRUGHU FDQ DOVR EH WHVWHG 7KHVH PLFH DOVR VKRZHG D VPDOO VWDWXUH SKHQRW\SH WKDW SDUDOOHOV WKH JURZWK GHILFLHQFLHV VHHQ LQ KXPDQV ZLWK 3:6 3HUKDSV WKH PRVW LQWHUHVWLQJ RXWFRPH RI WKLV LQYHVWLJDWLRQ LV WKH LGHQWLILFDWLRQ RI PRGLILHU JHQHV WKDW PD\ DIIHFW WKH SKHQRW\SH RI 3:6 PLFH 7KHVH JHQHV PD\ LGHQWLI\ RWKHU JHQHV WKDW DUH LQYROYHG ZLWK 3:6 KHOSLQJ WR GLVVHFW WKH SUHFLVH UHDVRQV WKDW 3:6 LQIDQWV SUHVHQW ZLWK IDLOXUH WR WKULYH DQG SRRU VXFNOH &RQWLQXHG VWXGLHV LQ WKLV DUHD ZLOO IRFXV RQ WKH LGHQWLILFDWLRQ RI WKLV PRGLI\LQJ IDFWRU XVLQJ WKH $3:6,& PRXVH WR PDS DQG FORQH WKH JHQHVf UHVSRQVLEOH )LQDOO\ VRPH RI WKH PRVW FOLQLFDOO\ UHOHYDQW LQIRUPDWLRQ KDV FRPH IURP WKH WUDQVJHQLF UHVFXH H[SHULPHQWV 7ZR LPSRUWDQW GLVFRYHULHV DUH SUHVHQWHG LQ WKLV VWXG\ )LUVW QRQH RI WKH NQRZQ SDWHUQDOO\ H[SUHVVHG JHQHV UHVFXH WKH IDLOXUH WR WKULYH SKHQRW\SH LQ $3:6,& PLFH 7KLV LQGLFDWHV WKDW WKHUH DUH DGGLWLRQDO JHQHV LQYROYHG LQ WKH $3:6 ,& SKHQRW\SH WKDW KDYH QRW EHHQ LGHQWLILHG DQG WKDW 1GQ GHILFLHQF\ LQ PLFH QHHGV WR EH IXUWKHU VWXGLHG 6HFRQGO\ 0E,, LQ FRQFHUW ZLWK 6QUSQ 0E,, DQG RWKHU VLQJOH FRS\ VQR51$V FDQ UHVFXH WKH VPDOO VWDWXUH SKHQRW\SH RI $3:6,& PLFH 7KLV VHFRQG ILQGLQJ LV SDUWLFXODUO\ LPSRUWDQW VLQFH WKH PRVW HIIHFWLYH WKHUDS\ IRU 3:6 LV JURZWK KRUPRQH :KLOH WKH UHVFXLQJ WUDQVJHQH DOOHYLDWHV VPDOO VWDWXUH LQ $3:6,& PLFH LW PD\ KDYH RWKHU HIIHFWV RQO\ RQH RI ZKLFK PD\ EH DFWLYDWLRQ RI WKH JURZWK KRUPRQH SDWKZD\ 7KH VQR51$V RQ WKLV WUDQVJHQH PD\ VRPHGD\ SURYLGH XVHIXO WKHUDS\ WKDW FDQ DPHOLRUDWH VRPH RI WKH GLIILFXOWLHV WKDW KXPDQV ZLWK 3:6 IDFH $GGLWLRQDO VWXGLHV ZLOO LQFOXGH WDUJHWHG PXWDWLRQ RI WKH LQGLYLGXDO VQR51$V DQG SHUKDSV PRUH VSHFLILF UHVFXH H[SHULPHQWV WKDW LVRODWH HDFK VQR51$ 7KH WUDQVJHQHV WHVWHG LQ WKLV VWXG\ ZLOO DOVR EH SURYLGHG WRJHWKHU WR GHWHUPLQH WKHLU DELOLW\ WR UHVFXH WKH $3:6,& SKHQRW\SH 7KH

PAGE 122

SRVVLELOLW\ WKDW WKH UHVFXLQJ WUDQVJHQH PD\ DOVR UHYHDO DQ REHVLW\ SKHQRW\SH LV LQWULJXLQJ DQG ZDUUDQWV IXUWKHU VWXG\ )LQDOO\ EHKDYLRUDO SKHQRW\SHV DVVRFLDWHG ZLWK 3:6 FDQ DOVR EH LQYHVWLJDWHG XVLQJ WKH HVWDEOLVKHG WUDQVJHQLF OLQHV

PAGE 123

5()(5(1&(6 %DUORZ '3 *DPHWLF LPSULQWLQJ LQ PDPPDOV 6FLHQFH f 0F*UDWK t 6ROWHU &RPSOHWLRQ RI PRXVH HPEU\RJHQHVLV UHTXLUHV ERWK WKH PDWHUQDO DQG SDWHUQDO JHQRPHV &HOO f %DUWRQ 6& 6XUDQL 0$ t 1RUULV 0/ 5ROH RI SDWHUQDO DQG PDWHUQDO JHQRPHV LQ PRXVH GHYHORSPHQW 1DWXUH f &DWWDQDFK %0 3DUHQWDO RULJLQ HIIHFWV LQ PLFH (PEU\RO ([S 0RUSKRO f 5HLN : t $OOHQ 1' *HQRPLF LPSULQWLQJ ,PSULQWLQJ ZLWK DQG ZLWKRXW PHWK\ODWLRQ &XUU%LRO LVVQ f %XLWLQJ 6DLWRK 6 *URVV 6 'LWWULFK % 6FKZDUW] 6 1LFKROOV 5' t +RUVWKHPNH % ,QKHULWHG PLFURGHOHWLRQV LQ WKH $QJHOPDQ DQG 3UDGHU:LOOL V\QGURPHV GHILQH DQ LPSULQWLQJ FHQWUH RQ KXPDQ FKURPRVRPH 1DWXUH *HQHW f 'LWWULFK % %XLWLQJ .RUQ % 5LFNDUG 6 %X[WRQ 6DLWRK 6 1LFKROOV 51 3RXVWND $ :LQWHUSDFKW $ =DEHO % HW DO ,PSULQW VZLWFKLQJ RQ KXPDQ FKURPRVRPH PD\ LQYROYH DOWHUQDWLYH WUDQVFULSWV RI WKH 61531 JHQH 1DWXUH *HQHW f )QGHOH 5+ 6XUDQL 0$ t $OOHQ 1' &RQVHTXHQFHV RI JHQRPLF LPSULQWLQJ IRU IHWDO GHYHORSPHQW LQ *HQRPLF ,PSULQWLQJ HGV 5HLN : t 6XUDQL 0$f ,5/2[IRUG 8QLYHUVLW\ 3UHVV 2[IRUG 1HZ
PAGE 124

-RQJ 07& &DUH\ $+ 6WHZDUW &/ 5LQFKLN (0 *OHQQ && 'ULVFROO 't 1LFKROOV 5' 7KH =1) JHQH HQFRGHV D QRYHO &+ ]LQFILQJHU SURWHLQ DQG LWV H[SUHVVLRQ LV UHJXODWHG E\ JHQRPLF LPSULQWLQJ $P +XP *HQHW $ f -D\ 3 5RXJHXOOH & 0DVVDFULHU $ 0RQGD $ 0DWWHL 0* 0DO]DF 3 5RHFNHO 1 7DYLDX[ 6 /HIUDQF -/% &DX 3 HW DO 7KH KXPDQ QHFGLQ JHQH 1'1 LV PDWHUQDOO\ LPSULQWHG DQG ORFDWHG LQ WKH 3UDGHU:LOOL V\QGURPH FKURPRVRPDO UHJLRQ 1DWXUH *HQHW f /HII 6( %UDQQDQ &, 5HHG 0/ 2]FHOLN 7 )UDQFNH 8 &RSHODQG 1* t -HQNLQV 1$ 0DWHUQDO LPSULQWLQJ RI WKH PRXVH 6QUSQ JHQH DQG FRQVHUYHG OLQNDJH KRPRORJ\ ZLWK WKH KXPDQ 3UDGHU:LOOL V\QGURPH UHJLRQ 1DWXUH *HQHW f :HYULFN 5 .HUQV -$ t )UDQFNH 8 ,GHQWLILFDWLRQ RI D QRYHO SDWHUQDOO\ H[SUHVVHG JHQH LQ WKH 3UDGHU:LOOL V\QGURPH UHJLRQ +XP 0RO *HQHW f 5RXJHXOOH & *ODWW + t /DODQGH 0 7KH $QJHOPDQ V\QGURPH FDQGLGDWH JHQH 8%($-($3 LV LPSULQWHG LQ WKH EUDLQ 1DWXUH *HQHW f 6DLWRK 6 %XLWLQJ 5RJDQ 3. %X[WRQ -/ 'ULVFROO '$PHPDQQ .RQLJ 5 0DOFROP 6 +RUVWKHPNH % t 1LFKROOV 5' 0LQLPDO GHILQLWLRQ RI WKH LPSULQWLQJ FHQWHU DQG IL[DWLRQ RI FKURPRVRPH TO TO HSLJHQRW\SH E\ LPSULQWLQJ PXWDWLRQV 3URF 1DWO $FDG 6FL 86$ f &DWWDQDFK %0 %DUU -$ (YDQV (3 %XUWHQVKDZ 0 %HHFKH\ &9 /HII 6( %UDQQDQ &, &RSHODQG 1* -HQNLQV 1$ t -RQHV $ FDQGLGDWH PRXVH PRGHO IRU 3UDGHU:LOOL V\QGURPH ZKLFK VKRZV DQ DEVHQFH RI 6QUSQ H[SUHVVLRQ 1DWXUH *HQHW f OHWWHU@ /DQFHW LVVQ f 1LFKROOV 5' .QROO -+ %XWOHU 0* .DUDP 6 t /DODQGH 0 *HQHWLF LPSULQWLQJ VXJJHVWHG E\ PDWHUQDO KHWHURGLVRP\ LQ QRQGHOHWLRQ 3UDGHU:LOOL V\QGURPH 1DWXUH f 0DJHQLV 5( %URZQ 0* /DF\ '$ %XGGHQ 6 t /D)UDQFKL 6 ,V $QJHOPDQ V\QGURPH DQ DOWHUQDWH UHVXOW RI GHOfTO OTOf" $P-0HG*HQHW LVVQ f

PAGE 125

.QROO -+ 1LFKROOV 5' t /DODQGH 0 2Q WKH SDUHQWDO RULJLQ RI WKH GHOHWLRQ LQ $QJHOPDQ V\QGURPH +XP*HQHW f 0DOFROP 6 &OD\WRQ 6PLWK 1LFKROV 0 5REE 6 :HEE 7 $UPRXU -$ -HIIUH\V $t 3HPEUH\ 0( 8QLSDUHQWDO SDWHUQDO GLVRP\ LQ $QJHOPDQnV V\QGURPH /DQFHW f .QROO -+ *ODWW .$ 1LFKROOV 5' 0DOFROP 6 t /DODQGH 0 &KURPRVRPH XQLSDUHQWDO GLVRP\ LV QRW IUHTXHQW LQ $QJHOPDQ V\QGURPH $P-+XP*HQHW LVVQ f &R[ *) %XUJHU /LS 9 0DX 8$ 6SHUOLQJ :X %/ t +RUVWKHPNH % ,QWUDF\WRSODVPLF VSHUP LQMHFWLRQ PD\ LQFUHDVH WKH ULVN RI LPSULQWLQJ GHIHFWV $P +XP *HQHW f .LVKLQR 7 /DODQGH 0 t :DJVWDII 8%($-($3 PXWDWLRQV FDXVH $QJHOPDQ V\QGURPH 1DWXUH *HQHW f 0DWVXXUD 7 6XWFOLIIH -6 )DQJ 3 *DOMDDUG 5-LDQJ <+ %HQWRQ &6 5RPPHQV -0 t %HDXGHW $/ 'H QRYR WUXQFDWLQJ PXWDWLRQV LQ ($3 XELTXLWLQSURWHLQ OLJDVH JHQH 8%($f LQ $QJHOPDQ V\QGURPH 1DWXUH *HQHW f 0HJXUR 0 .$ 0LWVX\D 1DNDR 0 .RQGR 6DLWRK 6 2VKLPXUD 0 $ QRYHO PDWHUQDOO\ H[SUHVVHG JHQH $73 & HQFRGHV D SXWDWLYH DPLQRSKRVSKROLSLG WUDQVORFDVH DVVRFLDWHG ZLWK $QJHOPDQ V\QGURPH 1DWXUH *HQHW f 2KWD 7 *UD\ 7$ 5RJDQ 3. %XLWLQJ *DEULHO -0 6DLWRK 6 0XUDOLGKDU % %LOLHQVND % .UDMHZVND:DODVHN 0 'ULVFROO 'HW DO ,PSULQWLQJPXWDWLRQ PHFKDQLVPV LQ 3UDGHU:LOOL V\QGURPH $P +XP *HQHW f 2KWD 7 %XLWLQJ .RNNRQHQ + 0F&DQGOHVV 6 +HHJHU 6 /HLVWL + 'ULVFROO '&DVVLG\ 6% +RUVWKHPNH % t 1LFKROOV 5' 0ROHFXODU PHFKDQLVP RI $QJHOPDQ V\QGURPH LQ WZR ODUJH IDPLOLHV LQYROYHV DQ LPSULQWLQJ PXWDWLRQ $P +XP *HQHW f 2]FHOLN 7 /HII 6 5RELQVRQ : 'RQORQ 7 /DODQGH 0 6DQMLQHV ( 6FKLQ]HO $ t )UDQNH 8 6PDOO QXFOHDU ULERQXFOHRSURWHLQ SRO\SHSWLGH 1 61531f DQ H[SUHVVHG JHQH LQ WKH 3UDGHU:LOOL V\QGURPH FULWLFDO UHJLRQ 1DWXUH *HQHW f 0DF'RQDOG +5 t :HYULFN 5 7KH QHFGLQ JHQH LV GHOHWHG LQ 3UDGHU:LOOL V\QGURPH DQG LV LPSULQWHG LQ KXPDQ DQG PRXVH +XP 0RO *HQHW f 5RXJHXOOH & &DUGRVR & )RQWHV 0 &ROOHDX[ / t /DODQGH 0 $Q LPSULQWHG DQWLVHQVH 51$ RYHUODSV 8%($ DQG D VHFRQG PDWHUQDOO\ H[SUHVVHG WUDQVFULSW 1DWXUH *HQHW f %RFFDFFLR *ODWW'HHOH\ + :DWULQ ) 5RHFNHO 1 /DODQGH 0 t 0XVFDWHOOL ) 7KH KXPDQ 0$*(/ JHQH DQG LWV PRXVH KRPRORJXH DUH SDWHUQDOO\ H[SUHVVHG DQG PDSSHG WR WKH 3UDGHU:LOOL UHJLRQ +XP 0ROHF *HQHW f &DYDGOH %XLWLQJ .LHIPDQ 0 0 / &, % +RUVWKHPNH % %DFKHOOHULH -3 %URVLXV t +LLWWHQKRIIHU $ ,GHQWLILFDWLRQ RI EUDLQVSHFLILF DQG LPSULQWHG VPDOO QXFOHRODU 51$ JHQHV H[KLELWLQJ DQ XQXVXDO JHQRPLF RUJDQL]DWLRQ 3URF 1DW $FDG 6FL 86$ f

PAGE 126

GH ORV 6DQWRV 7 6FKZHL]HU 5HHV &$ t )UDQFNH 8 6PDOO HYROXWLRQDULO\ FRQVHUYHG 51$ UHVHPEOLQJ &' ER[ VPDOO QXFOHRODU 51$ LV WUDQVFULEHG IURP WKH 3:&5 D QRYHO LPSULQWHG JHQH LQ WKH 3UDGHU:LOOL GHOHWHG UHJLRQ ZKLFK LV KLJKO\ H[SUHVVHG LQ WKH EUDLQ $P +XP *HQHW f .QROO -+ 1LFKROOV 5' 0DJHQLV 5( *UDKDP -0 -U /DODQGH 0 t /DWW 6$ $QJHOPDQ DQG 3UDGHU:LOOL V\QGURPHV VKDUH D FRPPRQ FKURPRVRPH GHOHWLRQ EXW GLIIHU LQ SDUHQWDO RULJLQ RI WKH GHOHWLRQ $P 0HG *HQHW f -RQJ 07 &DUH\ $+ &DOGZHOO .$ /DX 0+ +DQGHO 0$ 'ULVFROO '6WHZDUW &/ 5LQFKLN (0 t 1LFKROOV 5' ,PSULQWLQJ RI D 5,1* ]LQF ILQJHU HQFRGLQJ JHQH LQ WKH PRXVH FKURPRVRPH UHJLRQ KRPRORJRXV WR WKH 3UDGHU :LOOL V\QGURPH JHQHWLF UHJLRQ +XP 0RO *HQHW f :HYULFN 5 t )UDQFNH 8 $Q LPSULQWHG PRXVH WUDQVFULSW KRPRORJRXV WR WKH KXPDQ ,PSULQWHG LQ 3UDGHU:LOOL V\QGURPH ,3:f JHQH +XP 0ROHF *HQHW f $OEUHFKW 8 6XWFOLIIH -6 &DWWDQDFK %0 %HHFK\ &9 $UPVWURQJ (LFKHOH t %HDXGHW $/ ,PSULQWHG H[SUHVVLRQ LI WKH PXULQH $QJHOPDQ V\QGURPH JHQH 8EHD LQ KLSSRFDPSDO DQG 3XUNLQMH QHXURQV 1DWXUH *HQHW f 0DVFDQ 0*RWWOLHE : 5RJDQ 3. %XWOHU 0* :DOOHU '$ $UPRXU -$ -HIIUH\V $/DGGD 5/ t 1LFKROOV 5' 7KH IUHTXHQF\ RI XQLSDUHQWDO GLVRP\ LQ 3UDGHU:LOOL V\QGURPH ,PSOLFDWLRQV IRU PROHFXODU GLDJQRVLV 1 (QJO 0HG f 'RQORQ 7$ 6LPLODU PROHFXODU GHOHWLRQV RQ FKURPRVRPH TO DUH HQFRXQWHUHG LQ ERWK WKH 3UDGHU:LOOL DQG $QJHOPDQ V\QGURPHV +XP*HQHW f 1LFKROOV 5' *HQRPLF LPSULQWLQJ DQG XQLSDUHQWDO GLVRP\ LQ $QJHOPDQ DQG 3UDGHU:LOOL V\QGURPHV D UHYLHZ $P-0HG*HQHW LVVQ f &KDQ &7 &OD\WRQ 6PLWK &KHQJ ;%X[WRQ :HEE 7 3HPEUH\ 0( t 0DOFROP 6 0ROHFXODU PHFKDQLVPV LQ $QJHOPDQ V\QGURPH D VXUYH\ RI SDWLHQWV -0HG*HQHW LVVQ f 9X 7+ t +RIIPDQ $5 ,PSULQWLQJ RI WKH $QJHOPDQ V\QGURPH JHQH 8%($ LV UHVWULFWHG WR WKH EUDLQ 1DWXUH *HQHW f 0RZHU\5XVKWRQ 3$ 'ULVFROO '1LFKROOV 5' /RFNHU t 6XUWL 8 '1$ PHWK\ODWLRQ SDWWHUQV LQ KXPDQ WLVVXHV RI XQLSDUHQWDO RULJLQ XVLQJ D ]LQF ILQJHU JHQH =1)f IURP WKH $QJHOPDQ3UDGHU:LOOL UHJLRQ $P 0HG *HQHW f %LHOLQVND % %OD\GHV 60 %XLWLQJ
PAGE 127

%UDQQDQ &, t %DUWRORPHL 06 0HFKDQLVPV RI JHQRPLF LPSULQWLQJ &XUU 2SLQ *HQHW 'HY f 6FKHGO $ 0RQWROLX / .HOVH\ t 6FKW] $ \HDVW DUWLILFLDO FKURPRVRPH FRYHULQJ WKH W\URVLQDVH JHQH FRQIHUV FRS\ QXPEHUGHSHQGHQW H[SUHVVLRQ LQ WUDQVJHQLF PLFH 1DWXUH f 0RQWROLX / 8PODQG 7 t 6FKW] $ ORFXV FRQWURO UHJLRQ DW NE RI WKH W\URVLQDVH JHQH (0%2 f )UDVHU 3 3UX]LQD 6 t *URVYHOG ) (DFK K\SHUVHQVLWLYH VLWH RI WKH KXPDQ JORELQ ORFXV FRQWURO UHJLRQ FRQIHUV D GLIIHUHQW GHYHORSPHQWDO SDWWHUQ RI H[SUHVVLRQ WR WKH JORELQ JHQHV *HQHV t 'HY f 3HWHUVRQ .5 && +X[OH\ & -RVHSKVRQ %0 +DXJHQ +6 )XUXNDZD 7 6WDPDWR\DQQRSRXORV 7UDQVJHQLF PLFH FRQWDLQLQJ D NE \HDVW DUWLILFLDO FKURPRVRPH FDUU\LQJ WKH KXPDQ 3JORELQ ORFXV GLVSOD\ SURSHU GHYHORSPHQWDO FRQWURO RI KXPDQ JORELQ JHQHV 3URF 1DW $FDG 6FL 86$ f %XQJHUW 'DYH 8 /LP .& 6KDYLW -$ /LX 4 t (QJHO -' 6\QHUJLVWLF UHJXODWLRQ RI KXPDQ EJORELQ JHQH VZLWFKLQJ E\ ORFXV FRQWURO UHJLRQ HOHPHQWV +6 DQG +6 *HQHV t 'HY f :XW] $ 6PU]ND 2: 6FKZHLIHU 1 6FKHOODQGHU :DJQHU () t %DUORZ '3 ,PSULQWHG H[SUHVVLRQ RI WKH ,JIU JHQH GHSHQGV RQ DQ LQWURQLF &S* LVODQG 1DWXUH f %DUWRORPHL 06 :HEEHU $/ %UXQNRZ 0( t 7LOJKPDQ 60 (SLJHQHWLF PHFKDQLVPV XQGHUO\LQJ WKH LPSULQWLQJ RI WKH PRXVH + JHQH *HQHV 'HY f 3IHLIHU /HLJKWRQ 3$ t 7LOJKPDQ 60 7KH VWUXFWXUDO + JHQH LV UHTXLUHG IRU WUDQVJHQH LPSULQWLQJ 3URF 1DWO $FDG 6FL 86$ f +DUN $7 6& .DW] ',QJUDP 56 /HYRUVH -0 7LOJKPDQ 60 &7&) PHGLDWHV PHWK\ODWLRQVHQVLWLYH HQKDQFHUEORFNLQJ DFWLYLW\ DW WKH +,JI ORFXV 1DWXUH f &UDQVWRQ 067 (OVRQ '$ %DUWRORPHL 06 (OXFLGDWLRQ RI WKH PLQLPDO VHTXHQFH UHTXLUHG WR LPSULQW + WUDQVJHQHV *HQRPLFV f $LQVFRXJK -); .RLGH 7 7DGD 0 %DUWRQ 6 t 6XUDQL $ ,PSULQWLQJ RI ,JI DQG + IURP D NE <$& WUDQVJHQH 'HYHORSPHQW f %HOO $& )* 0HWK\ODWLRQ RI D &7&)GHSHQGHQW ERXQGDU\ FRQWUROV LPSULQWHG H[SUHVVLRQ RI WKH ,JMO JHQH 1DWXUH f %OD\GHV 60 (OPRUH 0
PAGE 128

V\VWHP DGDSWHG IRU UHFRPELQRJHQLF WDUJHWLQJ DQG VXEFORQLQJ RI %$& '1$ *HQRPLFV f +ROP 9$ &DVVLG\ 6% %XWOHU 0* +DQFKHWW -0 *UHHQVZDJ /5 :KLWPDQ %< t *UHHQEHUJ ) 3UDGHU:LOOL V\QGURPH FRQVHQVXV GLDJQRVWLF FULWHULD 3HGLDWULFV f 1LFKROOV 5' .QROO -+ *ODWW +HUVK -+ %UHZVWHU 7' *UDKDP -0 -U :XUVWHU +LOO :KDUWRQ 5 t /DWW 6$ 5HVWULFWLRQ IUDJPHQW OHQJWK SRO\PRUSKLVPV ZLWKLQ SUR[LPDO T DQG WKHLU XVH LQ PROHFXODU F\WRJHQHWLFV DQG WKH 3UDGHU:LOOL V\QGURPH $P 0HG *HQHW f 5RELQVRQ :3 %RWWDQL $ ;LH <* %DODNULVKPDQ %LQNHUW ) 0DFKOHU 0 3UDGHU $ t 6FKLQ]HO $ 0ROHFXODU F\WRJHQHWLF DQG FOLQLFDO LQYHVWLJDWLRQV RI 3UDGHU:LOOL V\QGURPH SDWLHQWV $P +XP *HQHW f 0DJHQLV 5( 7RWK )HMHO 6 $OOHQ /%ODFN 0 %URZQ 0* %XGGHQ 6 &RKHQ 5 )ULHGPDQ -0 .DORXVHN =RQDQD HW DO &RPSDULVRQ RI WKH T GHOHWLRQV LQ 3UDGHU:LOOL DQG $QJHOPDQ V\QGURPHV VSHFLILF UHJLRQV H[WHQW RI GHOHWLRQV SDUHQWDO RULJLQ DQG FOLQLFDO FRQVHTXHQFHV $P 0HG *HQHW f :LOOLDPV &$ =RUL 57 6WRQH -: *UD\ %$ &DQWX (6 t 2VWUHU + 0DWHUQDO RULJLQ RI TO GHOHWLRQV LQ $QJHOPDQ V\QGURPH VXJJHVWV D UROH IRU JHQRPLF LPSULQWLQJ $P 0HG *HQHW f 1LFKROOV 5' 3DL *6 *RWWOLHE : t &DQWX (6 3DWHUQDO XQLSDUHQWDO GLVRP\ RI FKURPRVRPH LQ D FKLOG ZLWK $QJHOPDQ V\QGURPH $QQ 1HXURO f 1LFKROOV 5' 1HZ LQVLJKWV UHYHDO FRPSOH[ PHFKDQLVPV LQYROYHG LQ JHQRPLF LPSULQWLQJ $P +XP *HQHW f -RQJ 07 *UD\ 7$ -L < *OHQQ && 6DLWRK 6 'ULVFROO 't 1LFKROOV 5' $ QRYHO LPSULQWHG JHQH HQFRGLQJ D 5,1* ]LQFILQJHU SURWHLQ DQG RYHUODSSLQJ DQWLVHQVH WUDQVFULSW LQ WKH 3UDGHU:LOOL V\QGURPH FULWLFDO UHJLRQ +XP 0RO *HQHW f 5HHG 0/ t /HII 6( 0DWHUQDO LPSULQWLQJ RI KXPDQ 61531 D JHQH GHOHWHG LQ 3UDGHU:LOOL V\QGURPH 1DWXUH *HQHW f 5XQWH 0 +XWWHQKRIHU $ *URVV 6 .LHIPDQQ 0 +RUVWKHPNH % t %XLWLQJ 7KH ,&6185)61531 WUDQVFULSW VHUYHV DV D KRVW IRU PXOWLSOH VPDOO QXFOHRODU 51$ VSHFLHV DQG DV DQ DQWLVHQVH 51$ IRU 8EHD +XP 0RO *HQHW f /HH 6 .R]ORY 6 +HUQDQGH] / &KDPEHUODLQ 6%UDQQDQ &, 6WHZDUW &/ DQG :HYULFN 5 ([SUHVVLRQ DQG LPSULQWLQJ RI 0$*(/ VXJJHVW D UROH LQ 3UDGHU:LOOL V\QGURPH DQG WKH KRPRORJRXV PXULQH LPSULQWLQJ SKHQRW\SH +XP 0RO *HQHW f 6XQ < 1LFKROOV 51 %XOWHU 0* 6DLWRK 6 +DLQOLQH %( t 3DOPHU &* %UHDNDJH LQ WKH 6QUSQ ORFXV LQ D EDODQFHG ;
PAGE 129

%UHVVOHU 7VDL 7 5DPLUH] 0 $UPVWURQJ t %HDXGHW $ 7KH 61351 SURPRWHU LV QRW UHTXLUHG IRU JHQRPLF LPSULQWLQJ RI WKH 3UDGHU:LOOL$QJHOPDQ GRPDLQ LQ PLFH 1DWXUH *HQHW f %XGDUI 0/ (% 3URJUHVV LQ WKH DXWRVRPDO VHJPHQWDO DQHXVRP\ G\QGURPHV 6$6Vf VLQJOH RU PXOWLORFXV GLVRUGHUV" +XP 0RO *HQHW f 7VDL 7) $' %HDXGHW $/ 1HFGLQGHILFLHQW PLFH GR QRW VKRZ OHWKDOLW\ RU WKH REHVLW\ DQG LQIHUWLOLW\ RI 3UDGHU:LOOL V\QGURPH 1DWXUH *HQHW f *HUDUG 0 +/ :HYULFN 5 6WHZDUW &/ 'LVUXSWLRQ RI WKH PRXVH QHFGLQ JHQH UHVXOWV LQ HDUO\ SRVWQDWDO OHWKDOLW\ 1DWXUH *HQHW f 7VDL 7) -< %UHVVOHU $UPVWURQJ %HDXGHW $/ 3DWHUQDO GHOHWLRQ IURP 6QUSQ WR 8EHD LQ WKH PRXVH FDXVHV K\SRWRQLD JURZWK UHWDUGDWLRQ DQG SDUWLDO OHWKDOLW\ DQG SURYLGHV HYLGHQFH IRU D JHQH FRQWULEXWLQJ WR 3UDGHU:LOOL V\QGURPH +XP 0RO *HQHW f 0XVFDWHOOL ) $EURXV '1 0DVVDFULHU $ %RFFDFFLR /H 0RDO 0 &DX 3 t &UHPHU + 'LVUXSWLRQ RI WKH PRXVH 1HFGLQ JHQH UHVXOWV LQ K\SRWKDODPLF DQG EHKDYLRUDO DOWHUDWLRQV UHPLQLVFHQW RI WKH KXPDQ 3UDGHU:LOOL V\QGURPH +XP 0RO *HQHW f

PAGE 130

%,2*5$3+,&$/ 6.(7&+ 6WRUP\ -R &KDPEHUODLQ ZDV ERUQ LQ 0RVFRZ ,GDKR DQG JUHZ XS RQ D YHU\ QLFH WUDFWRU LQ WKH PLGGOH RI QRZKHUH QHDU &DVSHU :\RPLQJ 6KH JUDGXDWHG IURP 1DWURQD &RXQW\ +LJK 6FKRRO LQ &DVSHU :\RPLQJ LQ 6KH WKHQ UHFHLYHG KHU %$ GHJUHH LQ 0ROHFXODU %LRORJ\ IURP 3ULQFHWRQ 8QLYHUVLW\ LQ 6WRUP\ HQWHUHG WKH ,QWHUGLVFLSOLQDU\ 3URJUDP LQ %LRPHGLFDO 6FLHQFHV DW WKH 8QLYHUVLW\ RI )ORULGD LQ

PAGE 131

, FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ -DPHV 5HVQLFN &KDLU $VVRFLDWH 3URIHVVRU RI 0ROHFXODU *HQHWLFV DQG 0LFURELRORJ\ FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWRU RI-(KLORVRSK\ 'DQLHO 'ULVFROO 3URIHVVRU RI 0ROHFXODU *HQHWLFV DQG 0LFURELRORJ\ FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ 5LFKDUG 0R\HU 3URIHVVRU RI 0ROHFXODU *HQHWLFV DQG 0LFURELRORJ\ FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ $VVLVWDQW 3URIHVVRU RI %LRFKHPLVW\ DQG 0ROHFXODU %LRORJ\

PAGE 132

, FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ /DXUHQFH 0RUHO $VVLVWDQW 3URIHVVRU RI 3DWKRORJ\ ,PPXQRORJ\ DQG /DERUDWRU\ 0HGLFLQH FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ 0DUN /HZLV 3URIHVVRU RI 1HXURVFLHQFH 7KLV GLVVHUWDWLRQ ZDV VXEPLWWHG WR WKH *UDGXDWH )DFXOW\ RI WKH &ROOHJH RI 0HGLFLQH DQG WR WKH *UDGXDWH 6FKRRO DQG ZDV DFFHSWHG DV SDUWLDO IXOILOOPHQW RI WKH UHTXLUHPHQWV IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ 0D\  'HDQ &ROOHJH RI 0HGLFLQH 'HDQ *UDGXDWH 6FKRRO


xml version 1.0 encoding UTF-8
REPORT xmlns http:www.fcla.edudlsmddaitss xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.fcla.edudlsmddaitssdaitssReport.xsd
INGEST IEID E6HX4WZHO_67QPTO INGEST_TIME 2014-10-09T23:10:25Z PACKAGE AA00025831_00001
AGREEMENT_INFO ACCOUNT UF PROJECT UFDC
FILES


ELUCIDATION OF IMPRINTING MECHANISMS AND PHENOTYPES IN
PRADER-WILLI SYNDROME MICE
By
STORMY JO CHAMBERLAIN
A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE
UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE
REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY
UNIVERSITY OF FLORIDA
2003

ACKNOWLEDGMENTS
The author thanks the past and present members of the Brannan lab—Winthropian
Peery, Karen Johnstone, Chris Futtner, Jessica Walrath, Susan Blaydes, Tom Simon,
Mike Elmore, Todd Adamson, and Missy Shelley-for making lab such a fun place to
work, for tolerating her daily, and for sticking together through some tough times. She
extends special gratitude to Karen Johnstone for her gracious help with this document.
She also thanks Dan Driscoll for being the butt of her jokes and for not letting her
forget that she, too, can be a butt, and Jim Resnick for accepting responsibility for her
and for keeping all of us together.
The author extends her deepest gratitude to Cami Brannan for allowing her to
work on this project, for her ideas, for giving her someone to look up to, and for years too
few of friendship.
Finally, the author thanks her parents for all of their support and for making her
come home when she needs to.
11

TABLE OF CONTENTS
ACKNOWLEDGMENTS ii
LIST OF ABBREVIATIONS vi
ABSTRACT viii
CHAPTERS
1. INTRODUCTION 1
Genomic Imprinting 1
The Prader Willi and Angelman Syndromes 4
2. IMPRINTED REGULATION OF UBE3A 9
Introduction 9
Materials and Methods 11
Strains and Matings 11
Identification of Polymorphisms 12
RT-PCR 12
Results 13
Discussion 15
3. IMPRINTED TRANSGENES 23
Introduction 23
Use of Transgenic Mice to Study Gene Regulation 23
Materials and Methods 26
Screening the BAC Libraries 26
Probe Preparation 28
Verification of BAC Clones 29
End Sequencing BAC Clones 29
Pulse-Field Gel Electrophoresis 30
Southern Blot 30
Transgenic Mice Production 31
Mouse Husbandry 32
Mouse Strains 32
Results 32
YAC Studies 32
129/Sv BAC Library Screen 33
iii

RecA Mediated Homologous Recombination 34
RecET Mediated Homologous Recombination 36
C57BL/6J BAC Library Screen 36
Lambda Red Mediated Homologous Recombination 38
Production Of Transgenic Mice 39
Characterization Of Transgenic Lines 40
The Marked Endogenous Snrpn Locus 41
Imprinted Expression From Transgenes 42
Discussion 46
4. STRAIN-DEPENDENT DIFFERENCES IN PHENOTYPE 64
Introduction 64
Materials and Methods 66
Strains and Matings 66
Culling and Fostering 67
Identification of Polymorphisms 67
RT-PCR 68
Northern Blot Analysis 69
Results 70
Discussion 72
5. TRANSGENIC RESCUE OF THE PWS-IC DELETION MOUSE 80
Introduction 80
Materials and Methods 85
Screening the BAC Libraries 85
Probe Preparation 86
Verification of BAC Clones 86
End Sequencing BAC Clones 87
Pulse-Field Gel Electrophoresis 87
Southern Blot 88
Transgenic Mice Production 88
Mouse Husbandry 89
Mouse Strains 89
Results 90
Screening the BAC Library for Clones 90
Production and Characterization of Transgenic Mice 91
Transgenic Rescue Experiments: 454 Transgenic Lines 94
Transgenic Rescue Experiments: 380 and 1707 Transgenic Lines 95
Discussion 96
BAC Isolation 96
Rearranged Transgenes 97
Transgenic Rescue 99
6. CONCLUSIONS AND FUTURE DIRECTIONS 110
IV

REFERENCES 114
BIOGRAPHICAL SKETCH 121
v

LIST OF ABBREVIATIONS
AS
Angelman syndrome
AS-IC
Angelman syndrome imprinting center
AS-SRO
Angelman syndrome smallest region of deletion overlap
BAC
bacterial artificial chromosome
cDNA
complementary deoxyribonucleic acid
CpG
cytosine-phosphate-guanine
DNA
deoxyribonucleic acid
DNasel
deoxyribonuclease I
IAP
interstitial A particle
IC
imprinting center
ICR
imprinting control region
Igf2
insulin-like growth factor-2 gene
Igf2r
insulin-like growth factor-2 receptor gene
Ipw
imprinted in Prader-Willi gene
kb
kilobase
Magel2
mage-like-2 gene
Mb
megabase
Mkrn3
makorin-ring-3 gene
mRNA
messenger ribonucleic acid
NCBI
National Center for Biotechnology Information
vi

NCI
National Cancer Institute
Ndn
Necdin gene
PCR
polymerase chain reaction
PWS
Prader-Willi syndrome
PWS-IC
Prader-Willi syndrome imprinting center
PWS-SRO
Prader-Willi syndrome smallest region of deletion overlap
RNA
ribonucleic acid
RNasel
ribonuclease I
RPCI
Roswell Park Cancer Institute
RT
reverse transcription
RT-PCR
reverse transcription polymerase chain reaction
SmN
small nuclear ribonucleoprotein particle N protein
snoRNA
small nucleolar ribonucleic acid
Snrpn
small nuclear ribonucleoprotein particle N gene
Snurf
Snrpn upstream reading frame
Ube3A
ubiquitin 3A ligase
UPD
uniparental disomy
YAC
yeast artificial chromosome
ZNF127
human zinc finger protein 127
Zfpl27
murine zinc finger protein 127
Vil

Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy
ELUCIDATION OF IMPRINTING MECHANISMS AND PHENOTYPES IN
PRADER-WILLI SYNDROME MICE
By
Stormy Jo Chamberlain
May, 2003
Chair: James Resnick
Major Department: Molecular Genetics and Microbiology
Genomic imprinting is an epigenetic phenomenon in which genes are expressed
exclusively from one parental allele or the other. Prader-Willi syndrome (PWS) and
Angelman syndrome (AS) are human genetic disorders resulting from the absence of
genes that are subject to genomic imprinting. PWS is a contiguous gene syndrome that
results from the absence of two or more paternally expressed genes, while AS is a
disorder that can result from the absence of a single maternally expressed gene, UBE3A,
which lies in the same region.
This study uses a mouse model for PWS in which paternal transmission of a PWS
imprinting center (PWS-IC) mutation results in complete loss of local paternal gene
expression. This targeted mutation accurately models both the molecular and phenotypic
aspects of PWS, and it has been applied to both of these aspects in this study.
vm

It has first been shown that imprinted expression of Ube3a, most likely results
from the regulation of a paternally expressed transcript that is antisense to the Ube3a
gene, suggesting an interesting model for the regulation of gene expression in this
imprinted region. The minimum sequence that is sufficient to confer proper imprinted
expression of the paternally expressed genes to transgenes in vivo was then identified.
This provides a stringent assay that can be used to test the proposed model of imprinted
gene expression.
Transgenic rescue of the PWS mouse was also used in our mouse model to
correlate specific attributes of the PWS phenotype to specific gene products. A transgene
that shows expression of a single small nucleolar RNA (snoRNA) cluster rescues the
small stature phenotype of PWS mice, while three other genes were found to have no
obvious effect on the PWS phenotype in mice. We have also found that the PWS
phenotype is less severe on certain strain backgrounds, suggesting the presence of
modifier genes that may ameliorate the PWS phenotype. These modifier genes may help
to identify gene pathways involved in PWS as well as future targets for gene therapy that
may ultimately help the PWS patient.
IX

CHAPTER 1
INTRODUCTION
Prader-Willi and Angelman syndromes (PWS and AS, respectively) are two
human genetic disorders that result from deficiencies in genes that are subject to genomic
imprinting. The causative genetic regions for both of these syndromes have been mapped
to approximately 3 Mb in the 15ql l-ql3 region. They provide a clinically and
scientifically interesting situation in which to study the mechanisms and phenotypes
involved with one region of genomic imprinting.
Genomic Imprinting
Genomic imprinting is a phenomenon in which genes are expressed in a parent-
of-origin specific manner. 1 Both parental genomes, in fact, are absolutely required for
normal development of a mammal (mouse). Work from the laboratories of Davor Solter
and Azim Surani showed that embryos with two genetic contributions from the same
parent would not develop normally.2,3 Embryos with two male pronuclei (androgenetic)
developed into tissues that were mostly extraembryonic in nature, while those with two
female pronuclei (parthenogenetic) developed into tissues that represented the embryo
proper.2 Cattanach showed that uniparental disomy, or the inheritance of specific
chromosome segments from a single parent, also led to developmental abnormalities,
further suggesting the importance of both parental genomes.4 This also led to the idea
that it may be specific genes or regions that were differentially regulated between
maternal and paternal alleles, and thus responsible for the failure of parthenogenetic or
1

2
androgenetic embryos to develop correctly. These experiments suggested that certain
genes in the mammalian genome were subjected to genomic imprinting and are expressed
exclusively from the paternally inherited allele and silenced from the maternally inherited
allele, while others are expressed from the maternally inherited allele and repressed from
the paternally inherited allele.5
The parent-of-origin specific expression is maintained from generation to
generation, and so with each passage through the germline, the past parental “label” of an
imprinted gene is erased, and the gene is “re-labeled”, based on the parent that it is now
inherited from.6-7 The ability of the two parental alleles to always be distinguished from
one another is fascinating, especially since these alleles can be identical. The existence
of identical alleles that are somehow regulated differentially indicates that genomic
imprinting involves an epigenetic phenomenon.8 Epigenetic, meaning ‘outside
conventional genetics’,9 refers to the distinguishing mark being something other than
changes in sequence. There is now considerable evidence to suggest that chemical
modifications, such as methylation or acetylation, to DNA and proteins associated with
DNA are responsible, in part, for the epigenetic changes that distinguish one parental
allele from another. 10 DNA methylation has been known to be associated with silenced
alleles, although some preferentially expressed alleles are known to be associated with
DNA methylation.61113 The histone code has also been shown to be associated with
either the maintenance or establishment of imprinted domains. The current
understanding of how DNA methylation collaborates with proteins that modify
nucleosomes to establish a stable chromatin state and epigenetically regulate gene

3
expression is nicely reviewed by Rudolf Jaenish and Adrian Bird in the March 2003
volume of Nature Genetics.9
Is extremely important to understand the cis acting regulatory sequences that
harbor the epigenetic changes and translate them to changes in gene expression, since
gene expression from one parental allele or the other is the ultimate goal of genomic
imprinting. While many imprinted regions, such as H19-Igf2 and Igf2r have been studied
in great depth, it has become apparent that different imprinted regions are not necessarily
subjected to the same regulation paradigms.
The PWS/AS region of genomic imprinting is an attractive imprinted region to
study for several reasons. First, the imprinted region spans a distance of approximately 3
Mb. 14 The mechanism of a control element that influences gene regulation at such great
distances is particularly intriguing. Secondly, this region seems relatively simple. At the
outset of this study, there were four known paternally expressed genes and one known
maternally expressed gene in the region. 1519 It was also known that this region was
regulated by a bipartite imprinting center, with one portion regulating the maternally
expressed gene, and the other regulating the paternally expressed genes.20 Thirdly, at
least two mouse models with disrupted imprinting in the PWS/AS region suggested that
the imprinting mechanism was conserved between mouse and human, providing a genetic
system in which to study imprinting.21,22 Most importantly, the PWS/AS region has
clinical significance, as it was originally identified as a genetic region that was
responsible for human disease.

The Prader Willi and Angelman Syndromes
PWS is characterized by neonatal hypotonia, failure to thrive, hypogonadism,
4
cryptorchidism, and poor suckle.23 By 18-36 months, the failure to thrive and poor
suckle symptoms subside, and PWS children begin to develop obesity that is complicated
by hyperphagia, physical and mental developmental delay that leads to moderate mental
retardation and small stature, and behavioral problems reminiscent of obsessive-
compulsive disorder.23 AS is characterized by severe mental retardation, ataxic gait,
inappropriate laughter, happy affect, and almost absent speech.24 Each of these disorders
occur at a frequency of approximately 1 in 15,000 live births. 24-26 While PWS and AS
are relatively rare, they provide a closed genetic system in which to investigate human
disorders, such as obesity, failure to thrive, ataxia, and mental retardation, that are much
more common.
Ledbetter et al. first noticed that patients with PWS often had cytologically visible
deletions of human 15ql l-ql3.14 Butler and Palmer later reported that these same
deletions were occurring on the paternally inherited chromosome.27 Finally, Nicholls et
al. determined that maternal uniparental disomy was also a mechanism by which PWS
could occur.28 This led to the suspicion that PWS occurs as from the physical or
functional deletion of the genes located on the paternally inherited chromosome. AS, on
the other hand was known to be associated with similar deletions that were occurring on
the maternally inherited chromosome.2930 Paternal uniparental disomy was also shown
to result in AS.31,32 AS was found to be the result of the physical or functional deletion
of maternal 15ql l-ql3.

5
Patients with PWS lack expression of all of the paternally expressed genes in the
region and can be divided into 3 genetic classes—maternal uniparental disomy patients,28
deletion patients,14 and imprinting defect patients. 6 20 Maternal uniparental disomy
patients have two chromosomes 15 that were inherited from their mother, presumably as
a result of nondisjunction, followed by reduction in the zygote. Absence of a paternal
allele of 15ql 1 -ql 3 causes the absence of expression of the paternally expressed genes.
The deletion patients have a 3-4 Mb deletion of the paternally inherited 15ql 1 -q 13,
which is facilitated by repeated regions that flank the entire imprinted domain. These
repeats cause this type of deletion to occur at a comparatively high frequency. Patients
with this deletion are physically missing the paternally inherited allele from which genes
are expressed. Imprinting mutations were identified in patients that had inherited both a
maternal and paternal chromosome 15ql l-ql3, but the paternal chromosome had a
maternal epigenotype as assayed by methylation at the SNRPN gene. Some of these
imprinting mutations were found to be due to deletions of the PWS-IC and result in the
silencing of the paternally expressed genes.6,1 M3,2° Other imprinting mutations show no
apparent deletion or mutation in the PWS-IC, and are thought to be epimutations of
unknown origin.33
AS patients can be divided into five genetic classes—paternal uniparental disomy
patients,31,32 deletion patients, 29,30 imprinting defect patients,6,20 UBE3A mutation
patients, 34 35 and biparental patients with an unidentified genetic lesion. Paternal
uniparental disomy patients have two chromosomes 15 from their father. Again,
nondisjunction is thought to be responsible for this, but it occurs less frequently in males
than females, accounting for the reduced frequency of paternal uniparental disomy

6
patients. AS deletion patients are physically missing the maternal allele of 15ql l-ql3,
and thus the two maternally expressed genes in the region. Imprinting mutations that
result from microdeletion of the AS-IC disrupt the maternal pattern of gene expression.
These imprinting mutations were shown to be small deletions upstream of the PWS-IC
deletion mutations and never overlap them. Imprinting mutations in AS patients have
been identified by mutation of the putative AS-IC and not by epimutation, since no
known methylation mark has been associated with AS (A. Lossie and D.J. Driscoll,
personal communication). Finally, the two biparental classes of AS patients indicate that
AS can be caused by disruption of the UBE3A gene and that other genes are likely to be
involved in the UBE3A pathway. 34,35 The contribution of the other maternally expressed
gene, ATP10C to the AS phenotype is not well understood.36
The imprinting center mutations from several PWS patients were mapped to
identify the smallest region of deletion overlap for PWS (PWS-SRO).13,37 The PWS-
SRO is located 5’ of the SNRPN gene, including the first exon of the gene. The PWS-
SRO is often referred to as the PWS imprinting center or PWS-IC. Although the PWS-
SRO has been narrowed to approximately 4.3 kb, the actual deletions that have been
shown to cause PWS are larger.37,38 A smallest region of deletion overlap has also been
identified for AS, and is referred to as the AS-SRO. The AS-SRO lies around 35 kb
upstream of the PWS-SRO, and has been narrowed to 0.8 kb. 37,38 AS imprinting
mutations never appear to overlap the PWS-SRO, while PWS imprinting mutations can
overlap the AS-SRO. This also indicates a bipartite structure to the imprinting center, in
which the PWS and AS components work together to control imprinting in the 15ql 1-
q!3 region.

7
The imprinting mutation class of patients for PWS and AS also suggests that the
PWS-IC is required for the paternal pattern of gene expression across this approximately
3 Mb region, while the AS-IC is required for the maternal pattern of gene expression.
Human chromosome 15ql l-ql3 contains at least six paternally expressed genes or
transcripts including MKRN3, MAGEL2, NDN, SNRPN, HBII-13, HBII-436, HBII-437,
HBII-438A, HBII-438B, HBII-85, HBII-52, and the UBE3A-antisense transcript,7,18,21,39'44
and two maternally expressed genes, UBE3A and ATP10C.19,36
The PWS/AS region lies in a region of synteny with a region of central mouse
chromosome 7,17 and the gene order and structure is highly conserved. In addition, two
mouse models—one a model for uniparental disomy,21 and the other a targeted mutation
in the PWS-IC 22—suggest that the imprinted regulation of the genes in this region is also
conserved. Mice are also capable of showing physical phenotypes such as obesity,
failure to thrive, and small stature as well as behavioral phenotypes such as obsessive-
compulsive disorder. Making the murine system a robust one for the study of the
molecular and phenotypic aspects of PWS and AS.
This dissertation focuses on the mechanisms and phenotypes of PWS. The rich
genetic conservation between mouse and human has been harnessed to investigate these
aspects of the disorder. This dissertation represents the four major accomplishments.
First of all, the maternally expressed Ube3a gene was shown to be negatively regulated
by an antisense transcript that is, in turn, positively regulated by the PWS-IC. This led to
an attractive model for gene regulation in this region. Secondly, transgenes that show
correct imprinted expression were identified, thus defining the minimal area sufficient to
confer appropriate imprinted expression in vivo. These transgenes also provided

8
evidence for the functional conservation of the AS-IC in mouse as well as its approximate
location in the region. Thirdly, the PWS phenotype in mice is influenced by different
genetic backgrounds in mice. This discovery revealed a different phenotype in the PWS
mouse model, as well as a method for identifying the particular modifying genes.
Finally, transgenic rescue has identified a gene that is responsible for the small stature
phenotype in the PWS mouse model and revealed a phenotype associated with snoRNAs.
For ease of reading, each chapter contains sufficient background and methodology so that
the reader may understand each one independently.

CHAPTER 2
IMPRINTED REGULATION OF UBE3A
Introduction
Angelman syndrome (AS) and Prader-Willi syndrome (PWS) are caused by
defects in genes subject to genomic imprinting. AS results from a lack of a maternally
inherited pattern of gene expression of human chromosome 15ql l-ql3, whereas PWS
results from a lack of a paternally inherited pattern of gene expression in thel5ql 1-ql 3
region.45 The imprinted genes involved in AS and PWS are regulated by a bipartite
imprinting center (IC) located upstream of the SNRPN gene.26 The IC is divided into the
Angelman syndrome imprinting center (AS-IC) and the Prader-Willi syndrome
imprinting center (PWS-IC). Many of the mouse orthologs of these imprinted genes are
located in the syntenic region of murine chromosome 7,17,40'42'46"48 furthermore, it is
known that the PWS-IC is functionally conserved in the mouse.22
Patients with PWS lack expression of multiple paternally expressed genes.
15,16,18,40-44 patients can be divided into 3 genetic classes: (1) maternal uniparental
disomy for chromosome 15; (2) 3-4 Mb deletion of the paternally inherited 15ql l-ql3, or
(3) imprinting mutations that are due to deletions of the PWS-IC and result in the
silencing of the paternally expressed genes. 6,49'5‘ This latter class of patients indicates that
the PWS-IC is required for the paternal pattern of gene expression across this
approximately 2 Mb region.
9

10
AS patients can be divided into five genetic classes: (1) paternal uniparental
disomy for chromosome 15; (2) 3-4 Mb deletion of the paternally inherited 15ql l-ql3;
(3) imprinting mutations that result from microdeletion of the AS-IC and subsequent
disruption of the maternal pattern of gene expression; (4) biparental with a mutation in
the maternally derived UBE3A gene; or (5) biparental with another as yet unidentified
anomaly that cannot be described as an imprinting mutation or deletion.6’34'50,52 It is the
fourth, biparental class that has demonstrated that mutations in the UBE3A are sufficient
to cause AS.
Contrary to the known paternally expressed transcripts in the region, UBE3A does
not exhibit strict imprinted expression: UBE3A is expressed predominantly from maternal
chromosome 15 in the brain but shows biallelic expression in fibroblasts and
lymphoblasts.19-53 Albrecht et al. demonstrated that while the murine Ube3a gene is
expressed exclusively from the maternal allele in hippocampal neurons and Purkinje
cells, it is expressed from both alleles in other regions of the mouse brain.48 Another
difference between paternally expressed transcripts and UBE3A is that for most of the
paternal genes, a region of differential methylation exists between the maternal and
paternal alleles.13-54-55 This is not the case for UBE3A, as to date, no differentially
methylated CpG sites have been shown to exist near UBE3A (A. Lossie and D.J. Driscoll,
personal communication). Together, these differences in imprinted expression and
parental-specific methylation suggest that the mechanism that regulates the paternal
program of gene expression in this region may not be the same mechanism as that which
regulates UBE3A imprinted expression.

11
Rougeulle et al. reported the existence of an antisense transcript to the UBE3A
gene.41 Using RT-PCR of RNA derived from AS and PWS patient brains, they
determined that this antisense transcript was imprinted, expressed only from the paternal
allele. Rougeulle et al. suggested that the maternal-only expression of UBE3A may result
from tissue specific expression of this paternally expressed antisense transcript.
Therefore, using a PWS-IC deletion (APWS-IC) mouse model,22 55 the role of the PWS-IC
in the regulation of the murine Ube3a antisense transcript and its subsequent effects on
the parent-of-origin specific expression of the sense Ube3a transcript were investigated.
It was found that the murine Ube3a transcript is expressed exclusively from the paternal
allele, the antisense transcript is regulated by the PWS-IC, and the level of paternal vs.
maternal Ube3a expression is different between APWS-IC mice and wild-type
littermates, suggesting a role for the antisense transcript in the regulation of maternal
Ube3 expression
Materials and Methods
Strains and Matings
Mouse strains used were mus musculus 129/Sv (129/Sv or D) and a strain of
C57BL/6J that is congenie for the PWS/AS syntenic region of chromosome 7 from mus
castaneus (B6.CAST.c7 or C)56. For (B6.CAST.c7 X 129/Sv) F, matings, a female
B6.CAST.c7 mouse was mated with a male APWS-IC mouse on a 129/Sv strain
background. Both APWS-IC mice and wildtype littermates were used. The (129/Sv X
B6.CAST.c7) F, mice were generated by mating a female 129/Sv mouse with a male
B6.CASTc7 mouse.

12
Identification of Polymorphisms
Total brain RNA was prepared from both 129/Sv mice and B6.CAST.c7 mice.
Each RNA sample was used to create single-stranded cDNA using random primers.
These cDNAs were used to program PCR reactions using primers corresponding to
Ube3a exons 4 and 7 (5’-CCTGCAGACTTGAAGAAGCAG-3’ and 5’-
GAAAACCTCTGCGAAATGCCTT-3’). The resulting products were cloned, sequenced
and compared. A polymorphism found in exon 5 created a Typ509I restriction site in the
129/Sv clone and a fisMCI site at the same location in the B6.CAST.c7 clone.
RT-PCR
Total RNA was isolated from total brain obtained from neonatal mice. RNA was
extracted using RNAzol (Tel-Test, Inc.) according to instructions. This total brain RNA
(10pg) was then pretreated with DNAse I (Life Technologies) and half of the reaction
was subsequently used to synthesize first strand cDNA with Superscript II reverse
transcriptase (RT) (Life Tehcnologies) and either strand-specific primer 5F or random
primers (Life Technologies). The other half of the reaction was manipulated in parallel in
the absence of RT. One-twentieth of the +RT or -RT reactions were used to seed PCR
reactions using the following conditions: lOmM Tris-HCl, pH 8.3, 50mM KC1, 0.125mM
of the four dNTPs, 1 unit Taq DNA polymerase (Boehringer), and 4p.M of each of the
appropriate primers. Sequences of the primers were 5F (5’-
CACATATGATGAAGCTACGA-3’), 5iR (5 ’ -C AG AA AG AG A AGTG AGGTTG- 3 ’),
and 6R (5’-CACACTCCCTTCATATTCC-3’). PCR amplification conditions were: 95°C
for 5 min, followed by 30 cycles of 94°C for 30 s, 60°C for 45 s, and 72°C for 45 s. The
final cycle was followed by an extension step for 10 min at 72°C. The PCR products

13
were either left undigested or digested with enzymes and analyzed on either a 2% or
4.8% agarose gel.
Results
The expression of a Ube3a antisense transcript was first verified in mouse brain
by performing PCR across intron 5 using randomly primed murine brain cDNA. Two
bands were amplified from the cDNA: the smaller correctly spliced Ube3a transcript and
the larger unspliced form of the Ube3a gene, which was verified by sequencing (data not
shown). The existence of this unspliced form is consistent with a Ube3a antisense
transcript that is expressed in mouse brain. The presence of the antisense transcript was
then confirmed, and its paternal specific expression was determined using F( progeny
derived from reciprocal matings between wild-type 129/Sv mice and B6.CAST.c7 mice
which are congenie for the PWS/AS syntenic region from mus musculus castaneus
chromosome 7 on a C57BL/6J background.56 DNAsel treated RNA prepared from
brains of Fj mice was used to program strand-specific reverse transcription reactions
using a forward primer from exon 5 (5F; Fig. 2-1 A), thus yielding cDNA made from the
antisense transcript. Using this strand specific cDNA as a template, PCR was performed
with the forward primer 5F and a reverse primer from intron 5 (5iR; Fig. 2-1 A). A
polymorphism in Ube3a exon 5 between Mus musculus domesticus and Mus musculus
castaneus enabled the determination of the parent of origin by digestion of the RT-PCR
products with the enzyme Tsp509l, which digests only the domesticus allele. The RT-
PCR product derived from the antisense transcript was found to be resistant to 7s/?509I
digestion when the father was B6.CAST.c7, but was cleaved by this enzyme when the

14
father was 129/Sv. This demonstrates that the antisense Ube3a transcript is expressed
exclusively from the paternally inherited allele (Fig. 2-IB).
As previous studies have shown that all other paternally expressed transcripts in
the region are regulated by the PWS-IC in humans and mice,61213 20-22-55 it was necessary
to determine whether the paternally expressed Ube3a antisense transcript was also
subject to regulation by the PWS-IC. Therefore, the PWS-IC deletion (APWS-IC) mouse
strain was used. This mouse strain was created by targeted deletion in ES cells that
includes exons 1 through 6 of Snrpn and extends approximately 23 kb 5' of the gene.22,55
B6.CAST.c7 females were mated with APWS-IC males and total brain RNA was isolated
from the resulting newborn (B6.CAST.c7 X APWS-IC) F, mice. The RNA was DNAsel
treated and used to direct strand-specific RT reactions, each containing the sense 5F
primer and an antisense /3-actin primer. The resulting cDNA was used as a template for
PCR using the primers 5F and 5iR, or two fS-actin primers. Figure 2-2 shows that the
Ube3a antisense-derived 840 bp band present in the wild type cDNA is absent in the
APWS-IC littermate cDNA. In contrast, actin is detected in both cDNA preparations.
This result demonstrates that the Ube3a antisense transcript is positively regulated by the
PWS-IC.
Finally, to determine if the paternal Ube3a antisense transcript regulates the level
of paternal Ube3a mRNA, RT-PCR followed by restriction enzyme digestion was
performed to examine the levels of Ube3a expression produced from each parental allele
in both wild-type and APWS-IC mice. To distinguish between Ube3a expression derived
from the two parental alleles, two exon 5 polymorphisms between Mus musculus
domesticus (D) and Mus musculus castaneus (C) were used: the enzyme BstACl cuts the

15
castaneus allele once but does not cut the domesticus allele; and the enzyme Tsp509l cuts
the domesticus allele twice and the castaneus allele only once (Fig. 2-3A). The
experimental cross of B6.CAST.c7 X APWS-IC was established to obtain both wild-type
F, pups (C X D wt) and APWS-IC F, pups (C X D A). The control strain reciprocal cross
of 129/Sv X B6.CAST.c7 was also established to obtain wild-type F, pups (D X C wt).
After birth, the pups were sacrificed, total brain RNA from all three classes was isolated,
and then random primers were used to prepare cDNA. Subsequent PCR amplification
with the Ube3a primers 5F and 6R demonstrated that Ube3a was detectable in all three
classes of F, mice (Fig. 2-3B, first three lanes). Upon digestion of these RT-PCR
products Bst4Cl, expression of both parental Ube3a alleles was detected in all three
classes. These results are expected, since Ube3a is known be expressed from both alleles
in most regions of the brain, exhibiting imprinted expression in only a subset of brain
cells.48 However, in the PWS-AIC F, lane (C X D A) the ratio of paternal (uncut) to
maternal (cut) Ube3a expression was found to be elevated compared to that observed in
the wildtype F, lane (C X D wt). These results were confirmed by digestion of the RT-
PCR products with Tsp509l. In this case, the paternal Ube3a allele (138 bp + 87 bp
bands) is clearly present at significantly higher levels in the APWS-IC Fj lane (C X D A)
than the wildtype F, lane (C X D wt). These results demonstrate that the loss of paternal
Ube3a antisense expression in APWS-IC mice is accompanied by an increase in paternal
sense Ube3a expression.
Discussion
In this study, the murine Ube3a antisense transcript was shown to be exclusively
expressed from the paternal allele and positively regulated by the PWS-IC. Furthermore,

16
mice that inherit a paternal deletion of the PWS-IC, and thus lack Ube3a antisense
expression have an upregulated paternal Ube3a allele relative to the maternal allele, as
compared to the wild-type controls. Together, these results strongly suggest that the
paternally derived antisense transcript negatively regulates the level of paternally
expressed Ube3a mRNA.
The differences between the imprinted expression of paternally expressed genes
in the region and UBE3A strongly suggest that the maternal-only expression of the
UBE3A gene is regulated by a different mechanism. The hypothesis that the tissue
specific imprinting of UBE3A is an indirect consequence of the imprinted antisense
transcript has been previously proposed by this lab and others.4157 Specifically, in tissues
that express the antisense transcript from the paternal allele, production of UBE3A
mRNA from the paternal allele is inhibited (presumably this inhibition occurs at the
transcriptional level). However, the maternal UBE3A allele is not prevented from
producing mRNA, so in these tissues, maternal specific expression is observed (Fig. 2-
4A). In tissues that do not express the antisense transcript but do express the UBE3A
gene, biallelic expression of UBE3A is observed (Fig. 2-4A). The data presented here
using the mouse model are consistent with this hypothesis and further suggest that the
imprinted expression of UBE3A is not a direct consequence of the UBE3A promoter or
the AS-IC. Rather, it appears to be the PWS-IC which negatively regulates the expression
of paternal UBE3A via the antisense transcript.
These data support a model in which the primary targets of imprinting in the
PWS/AS region are the paternally expressed transcripts, one of which, the UBE3A
antisense transcript, results in maternal-specific expression of the UBE3A gene. The

17
advantage of this model is that it greatly simplifies the seemingly complex pattern of
gene regulation in the PWS/AS region. A positive regulatory element, the PWS-IC, is
responsible for establishing and maintaining the paternal mode of gene expression in
somatic tissues (Fig. 2-4B). A negative regulatory element, which is assumed to be the
AS-IC, serves to prevent activation of the paternal program on the maternally inherited
chromosome, presumably by blocking PWS-IC function in the maternal germline (Fig. 2-
4C). As a result, different patterns of gene expression are observed for the two parental
alleles. The paternally expressed genes including the UBE3A antisense transcript are
expressed from the paternal chromosome but not from the maternal chromosome. In
contrast, UBE3A is “constitutively” expressed from the maternal chromosome in all cell
types that exhibit UBE3A expression, whereas the paternal UBE3A allele is only
“allowed” to be expressed in cell types that do not express the antisense transcript.
Therefore, according to this model, it is only the paternally expressed genes that are
subject to regulation by the IC as a whole. This reduces the complex regulation in this
region to a simple ON/OFF decision: the PWS-IC operates in the ON mode unless shut
OFF by the AS-IC element. Therefore, the key to understanding imprinting in this region
will be to determine how the AS-IC inhibits the PWS-IC on the maternal chromosome.
Finally, as the antisense transcript appears to be the cause of the tissue specific
imprinting of UBE3A, it will be interesting to determine what regulatory elements result
in the expression of the antisense in such a restricted cell population in the brain. It is
possible that there are positive regulatory elements that drive expression of the antisense
transcript in only a few cell types. Alternatively, there may be negative regulatory
elements that prevent expression of the antisense in most cell types. At this point, it can

18
only be said that the PWS-IC exerts a positive effect on the transcription of the antisense.
There may be additional levels of control that restrict the antisense to fewer cell types
than the other PWS-IC regulated paternally expressed genes in the region.

19
5F
7xp509I
Exon 5
Exon 6
5iR
-4
C (B6.Cast.c7)
21 bp-f^
640 bp
í
6R
179 bp
D (129/Sv) 21 bp^, 87 bp ^
553 bp
£
179 bp
B
maternal
paternal
840 bp
uncut 7Sp509I No RT
640 bp
553 bp
Figure 2-1. The antisense transcript is expressed from the paternally-derived
allele only. A. Map of the exon 5 to exon 6 region of Ube3a and schematic
showing expected PCR products, restriction sites, and fragment sizes. Triangle
lollipops represent 7sp509I sites, and horizontal arrows represent primers used
for RT and PCR. B. The antisense transcript was amplified by RT-PCR from
neonatal brains from (B6.CAST.c7 X 129/Sv) F! and (129/Sv X B6.CAST.c7) F,
mice, and by PCR from genomic DNA from parental B6.CAST.c7, and 129/Sv
mice using primers 5F and 5iR. The products were digested with Tsp509l and
electrophoresed along with the uncut controls on a 2% agarose gel. C indicates
the B6.CAST.c7 strain, while D indicates the domesticus strain, 129/Sv. Arrows
indicate pertinent fragments and their sizes.

maternal
paternal
genotype
Ube3a antisense
P-actin
Figure 2-2. The antisense transcript is not expressed in the APWS-IC
mouse. cDNAs were made from a APWS-IC mouse and a wildtype
littermate using primers 5F and the 3’ ¡3-actin control. PCR was done
using primers 5F and 5iR. The resulting products were run on a 2%
agarose gel.

21
C (B6.Cast.c7)
D (129/Sv)
5F
â–º t T
Exon 5
Exon 6
<4
6R
246 bp
L
108 bp 138 bp
1
21 bp 225 bp
uncut
Bst 4CI
7ip509I
5F
â–ºt t
Exon 5
Exon 6
<4
6R
246 bp
246 bp
JL-t-
21 bp 87 bp 138 bp
B
uncut
Brr4CI
7rp509I
NoRT
maternal
1
C
C
1
D
1
c
C
1
D
1
c
C
1
D
1
c
C
1
D
X
X
X
X
X
X
X
X
X
X
X
X
paternal
D
D
C
D
D
c
D
D
C
D
D
C
genotype
Wt
A
Wt
Wt
A
Wt
Wl
A
Wt
Wt
A
Wt
225 bp
138 bp
87 bp
Figure 2-3. Paternal Ube3a expression is increased in APWS-IC mice. A.
B6.CAST.c7 and 129/SvEv alleles are diagrammed showing PCR products,
restriction sites, and fragment sizes. The circle lollipop indicates the location of
a Bst4Cl site, while the triangle popsicle indicates the 7ip509I sites. Horizontal
arrows show primers used for RT and PCR. B. Sense Ube3a cDNA was made
using RNA derived from (B6.CAST.c7 X 129/Sv) F„ (B6.CAST.c7 X APWS-
IC) Fj, and (129/Sv X B6.CAST.c7) F, brains using random primers and PCR
amplified using primers 5F and 6R. The spliced, sense band was gel purified
and each sample was divided three ways: one portion was left uncut, the second
was cut with Bst4Cl, and the third was cut with 75p509I. These samples were
loaded on a 4.8% agarose gel. C indicates the B6.CAST.c7 strain, while D
indicates the domesticus strain, 129/SvEv. For the genotype, wt indicates a wild-
type mouse; A indicates a APWS-IC mouse. Arrows indicate the location of the
fragments and their sizes.

22
Figure 2-4. Model of gene regulation in the PWS/AS region. A. In the
brain, two different patterns of UBE3A expression occur. In cell types that
express the paternal antisense transcript, UBE3A is imprinted (top box). In
cell types that do not express the antisense transcript, UBE3A is biallelically
expressed (bottom box). B. On the paternally-inherited chromosome, the
PWS-IC establishes the paternal mode of gene expression. C. On the
maternally-inherited chromosome, the AS-IC prevents activation of the
paternal program, presumably by blocking PWS-IC function.

CHAPTER 3
IMPRINTED TRANSGENES
Introduction
Use of Transgenic Mice to Study Gene Regulation
Transgenes have been used to study regulation of gene expression in many
systems. They serve to isolate regulatory elements and relocate them to an ectopic
location in the genome where their local activities may be separated from the influence of
adjacent cooperating regulatory elements. One of the simplest instances of using
transgenes to study regulatory elements involved the tyrosinase gene.58,59 A 250 kb yeast
artificial chromosome (YAC) was found to faithfully express the tyrosinase gene.58 This
YAC was subsequently engineered to harbor a deletion of a DNasel hypersensitive site,
demonstrating that the site is necessary for correct expression of the tyrosinase gene.59
The regulation of the (3-globin locus is another example that has benefited from the use of
transgenes. In the (3-globin locus, long distance regulatory elements determine the tissue
specificity and developmental timing of the expression of various exons in the locus.60
Similar to the tyrosinase locus, DNasel hypersensitive sites were deleted from a YAC
using homologous recombination, and were determined to be locus control regions in
vivo by demonstrating that YACs that were missing or had duplications of these
hypersensitive sites no longer showed correct temporal expression of the (3-globin exons.
This was accomplished by making transgenic mice that contained single copies of the
wild-type or modified YAC.61'62
23

24
Imprinted regions are also good candidates for study using large transgenes.
Wutz and colleagues used YAC transgenes to examine the role of chromosome location
and the role of an intronic CpG island in the imprinted expression of Igf2r, a maternally
expressed gene.63 They were able to show that Igf2r imprinting is not dependent on
chromosome location, but that it is completely dependent on the intronic CpG island,
such that deletion of the CpG island causes derepression of the paternal Igf2r allele.
Regulation of another well understood imprinted region, the H19-Igf2 locus, has also
been studied using transgenic mice. The Tilghman lab were able to show that multiple-
copy insertions of an HI 9 transgene could exhibit parent-of-origin dependent expression
patterns as well as proper DNA methylation patterns, but these patterns were not
maintained when the same transgene was present in single-copy. 64-65 The authors
reasoned that the transgene constructs lacked sufficient sequence information to confer
proper imprinted expression. Kaffer et al. subsequently identified a 137 kb bacterial
artificial chromosome (BAC) that exhibited the proper pattern of imprinted gene
expression for the H19-Igf2 locus in single-copy transgenic lines. Hark et al. also used
the smaller transgenes that were not imprinted in single copy to test a model of gene
regulation for the Igf2 gene.66 The authors used a reporter construct that contained a
portion of the imprinted control region (ICR) followed by a polymorphic copy of the HI 9
gene and its enhancers derived from Mus musculus spretus, another intact ICR, and a
luciferase gene. In subsequent transgenic lines a portion of the ICR that acted as a
putative barrier element, separating HI9 from its enhancers, was deleted. These lines
showed higher expression of luciferase, indicating that the barrier element acted as
hypothesized.66"69

25
Single copy transgenes could be used to elucidate some of the elements necessary
to achieve proper imprinted expression in the PWS region. Identification of a transgene
that is capable of demonstrating correct imprinted expression in single copy would
elucidate the minimal genetic information that is sufficient for imprinting in this region.
This transgene could then be used to make various permutations and delineate whether
individual components are necessary for either paternal expression or maternal
repression. Furthermore, if an efficient method for modifying the transgene were
developed, a latent mark could be applied to the transgene that would make it easy to
distinguish between transgenic and endogenous expression. The system could then be
used to easily introduce new changes into the transgene.
Previously, our lab produced seven lines of transgenic mice carrying either a
human or a mouse PI clone. The human PI clone was chosen because it was known to
include the human Angelman syndrome smallest region of deletion overlap (AS-SRO) as
well as the Prader-Willi syndrome smallest region of deletion overlap (PWS-SRO).
Furthermore, it was polymorphic to the homologous mouse locus that is syntenic to
15ql l-ql3.70 The expressed polymorphisms between the human PI clone and the mouse
locus would allow us to easily distinguish expression originating from the transgene from
that coming from the endogenous locus. This human PI clone was never correctly
imprinted in 5 transgenic lines produced from it. The human PI clone was expressed
when it was inherited from both father and mother, suggesting that while the human
PWS-IC positive element is functional in mouse, the human AS-IC element, which is
predicted to be a negative regulatory element, does not behave as one in mouse. The
mouse PI clone, on the other hand, contained the Snrpn gene as well as the functionally

26
defined PWS-IC, but since the AS-IC has not been functionally or physically identified in
mouse, we could not be certain whether or not it contained the AS-IC. Two lines were
created from the murine PI clone. One was multi-copy and showed correct imprinted
expression, while the other was single copy and was expressed regardless of the parent-
of-origin. It was hypothesized that the mouse PI clone did not contain the entire AS-IC,
indicating that more genetic information, specifically 5’ sequence, is necessary to imprint
a transgene in single copy.
Two murine bacterial artificial chromosome (BAC) clones were identified that
were capable of being expressed in the appropriate parent-of-origin dependent manner.
These BAC clones specify a minimal region that is sufficient to confer correct imprinted
expression at an ectopic location in the genome.
Materials and Methods
Screening the BAC Libraries
The Research Genetics (Huntsville, AL) BAC library was initially screened for
BAC clones. This library was made from the 129/Sv strain of mouse. The library
consisted of 9 filters, each carrying 27,648 unique clones with an average insert size of
130 kb spotted in duplicate onto 9 different membranes. A PCR-generated probe that
included the first exon of Snrpn and a 2.2 kb EcoRl-EcoRV restriction fragment that was
5 kb 3’ of Snrpn was used to screen the library.
Prior to hybridization, BAC membranes were washed with 1500 mL of 6X SSC
and 0.1% SDS at room temperature for 15 minutes. The membranes were then rinsed
twice with 1500 ml of 6X SSC for 15 minutes at room temperature, and hybridized
according to the Research Genetics protocol. Briefly, the membranes were prehybridized

27
in roller bottles with 3 membranes per bottle, each separated by one sheet of Flow Mesh
(Diversfied Biotech, Boston, MA), in 120 ml of HyperHyb (Research Genetics,
Huntsville, AL) per bottle at 65° C for 20 minutes. At least 107 counts of each probe
were boiled for 5 min, snap cooled on ice, and then added to 3 ml of HyperHyb that was
pre-warmed to 65° C. One ml of hybridization solution was added to each of the roller
bottles, and the membranes were allowed to hybridize for 2 hours at 65° C.
The membranes were washed in the roller bottles three times for 15 minutes at
65° C with 30 ml IX SSC and 0.1% SDS. They were then removed from the bottles and
washed twice more at 65° C with 1000ml of IX SSC and 0.1% SDS for 15 minutes.
Finally, the membranes were rinsed with IX SSC at room temperature. The membranes
were then wrapped in cellophane and exposed to film (XAR, Kodak) overnight at -80° C.
Positive clones were identified following the manufacturer’s instructions, and the
following clones were ordered: 181J3, 573B8, 518H22, and 397F16.
The Roswell Park Cancer Institute (RPCI) RPCI-23 BAC library was also
screened for potential imprinted transgenes using two probes; the 2.2 kb Eco RI- EcoKV
fragment lying 5 kb 3’ of Snrpn and a 1 kb Sacl-Notl fragment that lies 30 kb 5’ of
Snrpn. This library is made from the C57BL/6J strain of mouse, with an average insert
size of 200kb and is the template library for the NIH mouse genome sequencing efforts.
The RPCI-23 library consists of 10 filters, each representing 18,432 independent clones
that have been spotted in duplicate. To screen this library, the filters were first rinsed for
10 minutes at room temperature in 6X SSC. The BAC library filters were placed into
roller bottles, five membranes per bottle, rolled with intermittently with sheets of Flow
Mesh. The filters were pre-hybridized for 2 hours at 65° C with 200 ml of Church buffer

28
(1 mM EDTA; 0.5M NaHP04, pH 7.2; 7% SDS; and 1% BSA). Approximately half of
the pre-hybridization solution was poured off. The boiled, snap cooled probes (at least
107 counts, each) were then added, and the membranes were hybridized overnight at
65°C.
The next morning, the membranes were first washed 5 times for 10 minutes each
in the bottle at 65° C with 200 ml per tube of Wash I (1 mM EDTA; 40 mM NaHP04, pH
7.2; 5% SDS; and 0.5% BSA). The filters were then removed from the bottles and
washed 3 times for 15 minutes each at 65° C with Wash II (1 mM EDTA; 40 mM
NaHP04, pH 7.2; and 1% SDS). The membranes were wrapped in cellophane and
exposed to film overnight and for 3 hours each at -80° C. Positive clones were identified
following the manufacturer’s instruction and ordered from RPCI. The following BAC
clones were obtained from this screen: 73N19, 78014, 148C8, 160G24, 227M21,
284G21, 359M8, 365C3, 382D19,438B21, 396A12,421K3, 9715, 215A9, 264P24,
276M11, 425D18, 380J10, 391B10, and 437G6.
Probe Preparation
Probes were labeled using the Prime-It II kit (Stratagene, La Jolla, CA), with
minor modifications. Probe DNA (200 ng) was boiled for 5 minutes in the presence of
random hexamers. The DNA-hexamer mix was cooled on ice, and 5X reaction buffer
was added along with 25 pCi of aP32dCTP and 1U of exo' klenow. The labeling reaction
was placed at 37° C for 15 minutes. After labeling was complete, the probe was purified
using the nucleotide removal kit (QIAGEN) and eluted in 200 pi of water. Purified
probes were boiled for 5 minutes and snap cooled on ice prior to use in hybridization.

29
Verification of BAC Clones
Single BAC colonies were tested to verify that the clone represented a BAC insert
derived from the Snrpn locus. Four single colonies from each BAC were streaked in
duplicate onto Luria broth plates that were supplemented with chloramphenicol (LB-CA).
The plates were overlayed with a nylon filter and grown overnight at 37° C. The next
morning, the bacteria were lysed on the filters as follows: first, the filters were soaked in
alkali solution (1.5 M NaCl and 0.5 N NaOH) for 4 minutes, followed by neutralizing
solution (1.5M NaCl and 1M Tris, pH 7.4) for 4 minutes, and finally rinsed in 6X SSC
for 1 minute. The filters were then pre-hybridized in Church buffer for one hour at 65°
C, and then one plate was hybridized with the 5’ Snrpn probe, while the other was
hybridized with the 3’ Snrpn probe. Upon washing and laying the filters to film, the
results were used to determine whether or not the clone was derived from the Snrpn locus
and whether or not the clone encompassed the 5’ or 3’ flanking regions of Snrpn.
End Sequencing BAC Clones
The BAC clones were end sequenced using the big dye termination reaction to
obtain sequences unique to the mouse genomic DNA insert. Reactions were performed
on 1 mg of BAC DNA that had been sheared by passing it five times through a 25 gauge
needle using a modified version of the manufacturer’s instructions, with 12p,l of
sequencing buffer, 4 p.1 of big dye, 16 pmol of primer, and 2.5mM MgCl2. The reactions
were subjected to an initial 5 minute cycle at 95° C, followed by 30 cycles of 95° C for
30 seconds, 50° C for 10 seconds, and 60° C for 4 minutes. The completed reactions were
purified from free nucleotides using Performa DTR Gel Filtration Columns (Edge

30
Biosystems), dried, and sequenced by the University of Florida Center for Mammalian
Genetics Sequencing Core.
Pulse-Field Gel Electrophoresis
Pulse-field gel electorphoresis was carried out to create a rough restriction map
and tiling pathway for the BAC clones. BAC DNAs digested with the appropriate
enzymes were electrophoresed on a 1 % genetic technology grade agarose gel (Nusieve,
FMC) made with IX TBE buffer. Samples were mixed with 10X ficoll loading dye and
ran at 200V with a switch time of 1-12 seconds for 12.5 hours. This provided resolution
of bands from 6-200 kb. The gel was stained with a dilute ethidium bromide solution,
photographed, and blotted as described below.
Southern Blot
Agarose gels carrying 5 pg of digested genomic DNA or 1 pg of digested BAC
DNA were photographed and UV nicked for 5 minutes. The gel was then soaked in
alkali solution for 45 minutes, followed by soaking in neutralizing solution for 90
minutes. The gel was then transferred to Hybond nylon membrane (Amersham) in 10X
SSC overnight. The membrane was then rinsed in 2X SSC and baked at 80° C for 2
hours. Hybridization was carried out according to the method of Church and Gilbert.
Membranes were prehybridized in 20 ml of Church buffer for 1 hour at 65° C. The
prehybridization solution was poured off and replaced with 5 ml of fresh solution and the
boiled and cooled probe. Hybridization continued overnight at 65° C. Washing was
carried out three times in 2XSSC and 0.1% SDS at 65° C for 15 minutes each.

31
Transgenic Mice Production
For production of transgenic mice, BAC DNA was prepared by large scale
plasmid preparation, using the alkaline lysis method. First, log phase cultures of BAC
culture grown in LB-CA were centrifuged for 5 minutes at 6,000 rpm to pellet the cells.
The supernatant was poured off and the pellet was resuspended in GTE solution (50 mM
glucose; 25mM Tris, pH 8.0; and 10 mM EDTA) plus lysozyme. The suspension was
then lysed in 0.2 N NaOH and 1 % SDS. After addition of the lysis solution, the lysate
was neutralized in 0.5 M potassium acetate, and poured through cotton gauze into Oak
Ridge tubes. BAC DNA was precipitated with ethanol, and the pellet was resuspended in
4 ml TE with 10 |xg/ml RNAse A, and allowed to incubate at 37° C for 1 hour. Cesium
chloride and ethidium bromide were added to the DNA solution, and the solution was
loaded into a heat sealable tube. The tube was sealed and centrifuged at 58,000 rpm for
18 hours. BAC supercoils were viewed with a UV light, and both nicked and supercoiled
bands were pulled. The DNA was extracted with tert-butanol until the ethidium bromide
was completely depleted from the BAC DNA. The DNA was then dialyzed twice against
1 L TE buffer, using dialysis tubing for 6 hours each. The concentration of the BAC
DNA was measured by spectrophotometer, and then diluted to 2.5 ng/pl for
microinjection.
Transgenic mice were made by pronuclear injection into oocytes that were
obtained from superovulated, fertilized, FVB/NJ female mice. The fertilized, injected
oocytes were then implanted into (B6D2) F, females that were made pseudopregnant by
mating them with vasectomized (B6D2) F, males.

32
Mouse Husbandry
At 3 weeks of age approximately 2mm of tail was clipped from each mouse, and
the ear was punched for identification. Genomic DNA was prepared from the tail piece
by incubation in tail lysis buffer (100 mM Tris, pH 8.5; 5 mM EDTA; 2% SDS; and
200mM NaCl) with 100 ng/pl proteinase K overnight at 55° C. The tail lysate was
extracted with phenol: chloroform: isoamyl alcohol (25:24:1) and then precipitated with
ethanol. The tail DNA was screened for the presence of the transgene by PCR using both
end sequences from the BAC.
Mouse Strains
APWS-IC mice maintained on the C57BL/6J background were developed by
Yang et al. and constituted a 35 kb deletion encompassing 16 kb of sequence 5’ of Snrpn
and 19 kb 3’ of Snrpn 22-55. Lines 215A, 215B, 215C, 425A, and 425B were all transgenic
lines produced as described above and maintained on the FVB/NJ strain background.
Transgenic line 1707 was previously described and was originally maintained on the
DBA/2J strain background70. For the purposes of this study, this line was backcrossed
for 10 generations onto the FVB/NJ strain background.
Results
YAC Studies
A YAC that contained 320 kb of genetic information spanning the Snrpn area (Fig
3-1) was previously identified. Pulse-field gel electrophoresis was used in conjunction
with rare cutting enzyme digests to confirm that the YAC was indeed intact and
contained the genetic information that we anticipated. Several unsuccessful attempts
were then made to subclone the regions that comprised the junction between the YAC

33
vector arms and the mouse DNA insert. Despite the failure to find these junction
fragments, an attempt was made to make transgenic mice using the YAC, but it was not
successful. Ultimately, the attention was focused on BACs, since candidate clones for
imprinted transgenes had been identified with our screen. It was surmised that the YAC
was not ideal for use, since a YAC of that size is difficult to characterize and manipulate.
129/Sv BAC Library Screen
BAC clones were the best suited for transgenic studies, since they are usually
larger than the PI clones that were previously shown not to contain sufficient sequence
information to be imprinted in single copy. While they are larger than PI clones, BAC
clones are smaller than YACs and are maintained as supercoils, making them more
resistant to shearing. They also have the advantage over YACs of being propagated in E.
coli rather than S. cerevisiae, which makes their isolation and handling much easier. Most
importantly, BACs are propagated in RecA cells, and are less likely to suffer
rearrangement during manipulation and propagation than YACs. Traditionally, the
advantage of using YACs as opposed to BACs was the ability to make modifications by
exploiting the efficient homologous recombination in S. cerevisiae. However, early in
this project a preliminary method of BAC modification using homologous recombination
was published, making it possible to make similar changes to BAC clones 7I.
The first BAC library that we screened was derived from the 129/SvEv strain of
mouse, and had an average insert size of 130 kb. Using a mixture of the Snrpn exon 1
probe and a 2.2 kb ¿scoRI-ZícoRV that lies 5 kb 3’ of Snrpn as probes in this screen, four
BACs were isolated: 181J3, 573B8, 518H22, and 397F16. These BAC clones were each
streaked to LB-CA plates to obtain single colonies. Four single colonies representing

34
each BAC clone were grown in 3 ml overnight cultures and DNA was isolated from each
culture. The BAC DNA was cut with £coRI, and a Southern blot was performed. The
blot was first probed with a 1 kb Sacl-Notl fragment that yielded a large fragment about
20 kb 5’ of Snrpn, and later stripped and re-probed with the 3’ Snrpn probe. Two BACs,
397F16 and 518H22 spanned 5’ Snrpn, but terminated short of the 3’ Snrpn probe, while
the other two BACs, 573B8 and 181J3, conversely hybridized with the 3’ probe, but
appeared to lack 5’ sequences (Fig. 3-1). All four BACs were end sequenced. Next, the
BAC clones were each cut with Sail, Notl, SacII, or a combination of the enzymes and
subjected to pulse-field gel electorphoresis and Southern blot. Using the 5’ and 3’
probes, probes intergenic to the Snrpn gene, and probes generated using the end
sequences from each BAC, the approximate boundaries as well as a rough restriction map
for each BAC clone was determined. Following this analysis, only two BACs, 397F16
and 573B8 remained interesting as potential imprinted transgene candidates. The
397F16 clone contained the most 5’ sequence of the BAC clones, but it terminated before
the polyadenylation signal of the Snrpn gene. This was a problem because it could cause
an expressed Snrpn transcript to be targeted for degradation. The other BAC of interest,
573B8 contained the entire Snrpn gene, but did not contain enough 5’ sequence. Since
neither BAC was ideal for use as an imprinted transgene, a plan was made to join these
two BACs using the recently developed BAC modification scheme to produce the
additional 5’ sequence as well as the complete Snrpn transcript.
RecA Mediated Homologous Recombination
The first method attempted was analogous to the yeast two-step homologous
recombination procedure, as described by the Nat Heintz group.71 It revolved around

35
supplying the bacterial RecA gene, which was missing in the BAC host strain, on a
selectable episome.71 The bacterial RecA gene was provided on a plasmid with a
temperature sensitive origin of replication. The plasmid could be positively selected for
using tetracycline resistance. The plasmid could also be subjected to negative selection
by plating on plates containing fusaric acid, since fusaric acid is toxic to cells that
produce the tetracycline resistance gene. The idea behind this recombination scheme was
that one could subclone the desired modification or sequence change flanked by 5’ and 3’
homology arms of at least 500 bp, into this temperature sensitive recombination vector.
When transformed into the BAC strain, positive selection for the modification construct
would identify colonies in which insertion of the construct had occurred. Then, negative
selection with fusaric acid would cause resolution of the integrant into one of two
possible conformations. One possible conformation is that in which the desired change
has been made, and the other conformation recovers the unmodified BAC.
The scheme to join the two pertinent BACs involved using homologous
recombination to insert a neomycin resistance cassette flanked by loxP sites
approximately 30 kb upstream of the Snrpti gene on the 397F16 BAC. A 35 kb Sail
fragment from the modified 397F16 BAC could then be excised and recombined into the
573B8 BAC using one arm of homology anchored in the BAC vector and the other end
anchored near the first exon of Snrpn. The neomycin resistance gene could then be
deleted using ere recombinase, leaving a single loxP site. The resulting BAC would have
35 kb sequence 5’ of Snrpn and 55 kb 3’ of Snrpn, and would be a good candidate for an
imprinted transgene (Fig 3-2). While this method has been successful in other labs, it
was not so in this case due to the difficulty of subcloning the initial recombination

36
construct into a low-copy number plasmid that is temperature-sensitive and already quite
large (11 kb).
RecET Mediated Homologous Recombination
The second method, pioneered by Francis Stewart’s group, was based on the
RecET system in lambda phage.72 This system is reputedly much more efficient than
that of RecA and requires smaller homology arms. The RecET mediated recombination
can be carried out using only large oligos and the RecET plasmid electroporated into the
BAC containing bacterial strain. The RecE and RecT gene are expressed from the pBAD
promoter, making its expression arabinose inducible. This method never worked as the
wrong plasmids were sent. Following this attempt, BAC modification was postponed to
begin the search for a more suitable BAC transgene.
C57BL/6J BAC Library Screen
The RPCI-23 BAC library was screened since our attempts at BAC modification
were not working well. The RPCI library had three major advantages to the Research
Genetics library. First, the average insert size for this library is 200 kb, increasing the
chances of obtaining a BAC that is suitable for use as an imprinted transgene without
additional modification. Secondly, this library is the template for the mouse genome
sequencing effort, and so complete BAC sequences could possibly be posted as the
project continued. Thirdly, if a complete BAC sequence was desired for a given BAC
from this library, it could be queued for sequencing. Similarly to the strategy with the
129/Sv library, the filters were probed using both the 5’ and the 3’ Snrpn probes.
Several Snrpn transgenes were identified from this library. They are listed as follows:

37
73N19, 78014, 148C8, 160G24, 227M21, 284G21, 359M8, 365C3, 382D19,438B21,
396A12,421K3,9715, 215A9, 264P24, 276M11,425D18, 380J10, 391B10, and 437G6.
After streaking for single colonies and verifying that the clones represented the
Snrpn region, intact BAC molecules were subjected to restriction digestion with a variety
of rare cutting enzymes, including Sail, Sadi, and Notl and resolved the resulting
fragments by pulse field electrophoresis. The gels were transferred to nylon membranes
and probed with various probes in the Snrpn area to produce a rough restriction map of
each BAC and to determine whether it contained enough genetic information to serve as a
putative imprinted transgene. BAC end sequences for many of these clones were readily
available on the National Center for Biotechnology Informatics (NCBI) website, and so
primers could be ordered and used to create probes for the end of each BAC. The
following probes were used in determining BAC tiling pathways and restriction map: a 1
kb Sacl-Notl fragment 5’ of Snrpn, a 2.2kb fcoRI-ZscoRV fragment that is 5 kb 3’ of
Snrpn, an oligo that localized to an interstitial A particle (IAP) that is located in the 5’
end of the Ipw gene and more than 100 kb 3’ of Snrpn, and an oligo that is
complimentary to a small nucleolar RNA (snoRNA) that was known to exist
approximately 65 kb 3’ of Snrpn. Using these probes, BACs 215A9, 425D18, and
380J10 were determined to be suitable for further analysis. BAC 215A9 was shown to
extend 120 kb 5’ of Snrpn and 20 kb 3’ of Snrpn, BAC 425D18 spanned a region that
was first predicted to cover sequence 40 kb 5’ of Snrpn through 65 kb 3’ of Snrpn, but
was later discovered to extend 90 kb 5’ of Snrpn. Finally, BAC 380J10 was shown to
contain only 8 kb 5’ of Snrpn, but extended nearly 140 kb 3’ of Snrpn, into the IAP
element and the start of the Ipw gene (Fig 3-3).

38
Lambda Red Mediated Homologous Recombination
Although intact BAC molecules that seemed well suited to be imprinted without
further modification were available, it was desirable to create a subtle mutation in the
BAC that would allow transgenic Snrpn expression to be distinguished from the
endogenous message. A third method of BAC modification that was developed by
Daiguan Yu and Don Court at the National Cancer Institute (NCI) was pursued. This
method employed a defective lambda prophage in which the genes allowing entry into
the lytic phase of the phage lifecycle were removed, leaving only the minimal elements
required to express the red exo, beta, and gam genes under a temperature-sensitive
promoter.73 The first version of this system was a modified strain, in which the defective
lambda prophage was integrated into the bacterial genome. Unfortunately, this version
had some remaining phage genes present that would cause lysis of the bacterial cell when
induced, since these genes were also initiated from the temperature-sensitive promoter.
The other major problem was that this phage system was developed in an E. coli host
strain that had the opposite dam methylation status to the BAC host strain. A BAC clone
isolated from a dam methylation-positive strain was therefore methylated and could not
transform into the strain bearing the lambda prophage. As a result, none of the
aforementioned BAC clones were successfully transformed into this strain. Two
improved versions of the same system were later produced that were based on the BAC
host strain of E.coli, DH10B. One version featured the defective lambda prophage as an
integrant into the DH10B genome, while the other harbored a defective prophage that
was maintained as a stable episome in the bacterial cell. While the transgenic mice in

39
this study were derived unsing unmodified BAC clones, the BACs have since been
modified using the lambda Red system and will be the focus of future work.
Production Of Transgenic Mice
While continuing with efforts to modify the BACs, it seemed prudent to begin
producing transgenic mice carrying unmodified Snrpn BACs. BAC DNA was prepared
by large-scale plasmid preparation, followed by cesium chloride banding of the resulting
DNA. Both nicked and supercoiled bands were pulled and used for production of
transgenic mice. It was important to have extremely fresh BAC, as the larger RPCI
BACs degraded rapidly after isolation, as evidenced by low yield of supercoils and a
diffuse appearance on pulse-field gels. The BAC DNA was dialyzed against TE buffer
and diluted for injection with water to a concentration of 2.5 ng/pl. Transgenic mice
were made by pronuclear injection into oocytes derived from superovulated, fertilized,
FVB/NJ female mice. The injected oocytes were then implanted into pseudopregnant
(B6D2) F, mice. When the resulting pups reached 3 weeks of age, they were tail clipped
to obtain DNA and earpunched for identification. Genomic DNA was prepared from
each tail piece and was screened for the presence of the transgene by PCR using both end
sequences from the corresponding BAC. Three transgenic founder animals were
produced with the 215A9 transgene, two lines were made with the 425D18 transgene,
and five lines carried the 380J10 transgene.
The transgenic founders were mated with wild-type FVB/NJ females and the
resulting litters were genotyped at 3 weeks of age to make sure that the transgene had
integrated into the germline of the founders (i.e. that the founders were not chimeric), and
to establish additional transgenic animals to secure the survival of the transgenic line.

40
One transgenic mouse derived from the 380J10 BAC did not show germline transmission
to subsequent generations, and most likely represented a chimeric mouse in which the
transgene had integrated into the genome sometime after the first cleavage following
fertilization. Once the remaining lines were established, the individual lines were
characterized for intactness of the transgene and copy number (Fig. 3-4).
Characterization Of Transgenic Lines
Characterization of the transgenic lines was necessary to determine the number of
BAC molecules that were integrated into the transgene locus as well as the integrity of
the molecules that had integrated. DNA used to make transgenic mice tends to integrate
into the mouse genome in tandem arrays. For the purposes of our study, it was
imperative that we obtain some single copy transgenic lines, since we were adhering to
the most stringent determination of the minimum amount of sequence information that
was sufficient to confer proper imprinted expression. It was also important that the
transgene be intact, since proper imprinted expression may be a result of the relative
location of the pertinent elements. Furthermore, the BAC molecules had to be linear
prior to integration into the genome, and since we injected supercoils and nicked BAC
molecules, the location of the site of breakage was random. This increased the chances
of deriving a non-intact transgenic line.
Copy number was determined by preparing genomic DNA from mouse tails
harboring the transgene, performing Southern blot analysis on DNA that was cut with a
specific restriction enzyme, and comparing bands from two different probes that would
yield bands of similar size upon the same restriction digestion. One probe was located on
the transgene, while the other was not. The intensities of the bands were compared and

41
the copy number was estimated as either single copy or multi-copy. One of the 215A9
lines, one of the 425D18 lines, and one of the 380J10 lines contained multiple copies of
the transgene, leaving us with two 215A9 transgenic lines, one 425D18 transgenic line,
and three 380J10 transgenic lines that represented single copy transgene integrations (Fig.
3-4).
Similarly, rearrangements were determined by creating a panel of DNAs from the
different transgenic lines digested by a variety of restriction enzymes. These panels were
used to produce Southern blots, which were probed with several probes from the region
(Fig 3-5). If a probe illuminated a band that was of a different size than that of a wild-
type, non-transgenic mouse, then that transgene was considered rearranged. One 215A9
line and one 380J10 line appeared to be rearranged by this analysis. However, due to the
relatively few non-repetitive probes in the sequence surrounding the Snrpn locus, we may
not have detected other rearrangements.
The Marked Endogenous Snrpn Locus
The inability to mark the BACs prior to their injection into mouse oocytes forced
the use of a previously engineered Snrpn deletion mouse strain (ASmN)22. This mouse
strain carries a deletion of exons 4-7 of the Snrpn gene, that results in almost complete
absence of the Snrpn gene, and the low-level production of a larger fusion transcript that
includes the first exons of Snrpn and the neomycin resistance gene. Using this allele, the
endogenous Snrpn locus could be marked, alleviating the absolute requirement for a
marked transgene (Fig 3-6).
The APWS-IC mouse strain was also used.22 This strain has a neomycin
resistance cassette inserted in place of exons 1-5 of Snrpn. When paternally inherited,

42
this deletion prevents expression from the Snrpn locus, allowing us to measure Snrpn
expression that originates from the transgene (Fig 3-6).
Imprinted Expression From Transgenes
Since the transgenic copy of Snrpn was not subtly marked to be easily
distinguishable from the endogenous allele, the ability of the transgene to show proper
imprinted expression had to be tested by a complex breeding scheme using a marked
endogenous allele. This breeding scheme is shown in Figure 3-7. First, the expression
upon maternal inheritance was examined. Females who harbored a transgene were mated
with a male mouse that carried the SmN deletion allele. The resulting pups were
genotyped for the presence of the transgene, as well as for the presence of the deletion
allele. Pups with both the transgene and deletion allele were sacrificed and their brains
were used to make RNA. The RNA was analyzed by northern analysis for the expression
of Snrpn. This is possible because the transgenic female mice transmit a transgene,
which may or may not be expressed, depending on its epigenetic state, as well as a wild-
type copy of the endogenous Snrpn locus that is not expressed since it is inherited from a
female. The male mouse, on the other hand transmits the ASmN allele only, which is
expressed as a larger, less abundant message. Any wild-type Snrpn message, would then
come only from the transgene. Only the 380 transgenes were able to express Snrpn upon
maternal inheritance, indicating that this transgene did not contain the sequence
information that was required for silencing of the Snrpn gene upon maternal inheritance
(Fig 3-8).
Next, expression upon paternal inheritance was tested. In this case, male mice
from the above described mating who had inherited both the transgene as well as the

43
ASmN allele were mated to females who were homozygous for the ASmN allele. The
resulting pups were sacrificed and genotyped for the presence of both the transgene and
the ASmN allele. The rationale behind this scheme is that the female in this case can only
send a ASmN allele, which is silenced. In the presence of a known maternal ASmN
allele, a paternally inherited wild-type allele can be distinguished from a paternally
inherited ASmN allele. The male mouse transmits the transgene, which may or may not
be expressed depending on its epigenetic state, and either a wild-type or ASmN allele. If
the male transmits the wild-type allele, the resulting pups cannot be used for analysis,
since the paternally inherited Snrpn locus is indistinguishable from the transgenic Snrpn
locus. Alternatively, if the male transmits the ASmN allele, the endogenous allele that is
expressed produces the longer, less abundant ASmN message (Fig 3-6).
Originally, the idea was to identify Snrpn mice that were transgenic and
homozygous for the ASmN allele, and examine expression in these pups. However, the
presence of a large transgene that produced a wild-type Snrpn allele by Southern blot
hindered identification of ASmN homozygotes. Instead, the mice were genotyped for the
transgene, and RNA was made from the brains of the resulting transgenic mice. The
RNA was then used to program RT-PCR reactions. PCR was performed on the RT
product, using primers for both the ASmN and wild-type alleles. Pups that express both
the ASmN and wild-type alleles inherit the ASmN allele and not the endogenous wild-
type allele from their father (Snrpn and the ASmN alleles are only paternally expressed).
Thus the wild-type allele must be expressed from the transgene. If the pup did not show
expression from the ASmN allele, then it was believed to have inherited the wild-type
endogenous allele from its father, and was uninformative as far as transgene expression is

44
concerned. From this assay, lines from each the two transgenes, 215A9 and 425D18,
were shown to have expression upon paternal inheritance. Thus both 215A9 and 425D18
are capable of showing correct imprinted expression in single copy transgenes (Fig 3-9).
These experiments were repeated using the APWS-IC deletion mice in place of
the ASmN deletion mice. To ascertain transgene expression upon maternal inheritance, a
transgenic female mouse is mated with a APWS-IC male mouse (Fig 3-10A). The
resulting pups were sacrificed and genotyped. Pups that inherited both the APWS-IC
allele and the transgene were used to produce brain RNA, which was subjected to
northern blot analysis and probed for Snrpn expression. Again, the females transmit the
transgene as well as an epigenetically silenced maternal Snrpn allele, while APWS-IC
males transmit a APWS-IC allele that completely lacks Snrpn expression. Any Snrpn
message would have to originate from the transgenic copy of Snrpn. All five transgenic
lines were subjected to expression analysis upon maternal inheritance, and again, only the
380J10 transgenic lines, with the exception of line 380C, showed Snrpn expression upon
maternal inheritance, verifying that they did not contain sufficient sequence to confer
epigenetic silencing to the maternally inherited transgene (Fig 3-10B).
To ascertain expression upon paternal inheritance, APWS-IC females were mated
with transgenic males, and male pups with both the APWS-IC allele and the transgene
were identified by genotyping. These pups survive since the APWS-IC allele is
maternally inherited and therefore exists on the chromosome that is already
epigenetically silenced. Male pups that have inherited both the APWS-IC allele as well
as the transgenic allele were mated with wild-type females from the C57BL/6J strain to
produce pups that harbor both the APWS-IC and the transgene (Fig. 3-11 A). These pups

45
do not express endogenous Snrpn since their paternally inherited allele is the APWS-IC
allele, which is silenced because the major promoter for the Snrpn gene is missing and
because it is epigenetically silenced as a result of the imprinting center mutation. The
only Snrpn expression would come from the transgenic Snrpn allele, and would occur
only if the transgene were expressed upon paternal transmission. In this assay, the pups
were sacrificed at birth and genotyped for the APWS-IC allele and the transgene, since
pups that inherit the APWS-IC allele from their father suffer from the Prader-Willi
phenotype and die shortly after birth. Pups that inherited the transgene as well as the
APWS-IC allele were used to make brain RNA. This RNA was subjected to northern
analysis, using a probe for the Snrpn message (Fig 3-1 IB). Two transgenic lines—215B
and 425A—were identified that expressed transgenic Snrpn upon paternal transmission.
Since neither of these lines were expressed upon maternal transmission, they were
determined to demonstrate correct imprinted expression.
Line 425A contains a single copy transgene that is intact. The transgene in this
line is estimated to include the 22 kb Sail fragment that hosts the entire Snrpn gene, as
well as 90 kb 5’ of Snrpn and 65 kb 3’ of Snrpn. This establishes the minimal genomic
sequence that is sufficient to allow for correct imprinted expression in this region to be
approximately 170 kb. Line 215B, on the other hand, is a single copy transgene that has
undergone both 5’ and 3’ truncation upon integration into the mouse genome. The 5’
truncation occurs at least 38 kb 5’ of the Snrpn gene, while the 3’ truncation occurs
approximately 5 kb 3’ of Snrpn. While this data suggests that the minimal sufficient
region for correct imprinting is approximately 65 kb, the specific rearrangements that led
to the truncation of this transgene are not known. The transgene in this particular line

46
may have also sustained additional mutations that influence its ability to be correctly
imprinted.
Discussion
The 85 kb PI clone that shows correct imprinted expression when present in
multiple copies, but not when present in single copy was later found to only be 65 kb in
length. The discrepancy in length occurred because the PI was isolated from the 129/Ola
mouse strain, which was found to have an insertion of a 20 kb VL-30 element into the
region 5’ of Snrpn. The parent-of-origin independent expression of this PI clone, now
known to be 65 kb in length, indicates that either the PI clone is missing important
regulatory sequences that lie 5’ or 3’ of the Snrpn gene, or the PI clone does not contain
enough buffer sequence surrounding the necessary regulatory regions to establish a
domain of imprinted expression. The PI clone is expressed upon both paternal and
maternal inheritance when present in single copy, indicating that the defect is most likely
in the ability to be silenced in the maternal germline. Since the murine AS-IC has not
been functionally or physically identified in mouse and is postulated to be the negative
regulatory element required for the silencing of the positively acting PWS-IC (Fig 2-4),
the most likely explanation for the absence of maternal silencing of the PI transgene is
that it does not contain the AS-IC regulatory sequences. Absense of the AS-IC would be
predicted to prevent silencing of the positive element located on the transgene upon
maternal inheritance. Since the PI clone without the VL-30 insertion extends 23 kb 5’ of
Snrpn, we believe that the AS-IC is located further than 23 kb 5’ of Snrpn. This data
spurred the search for transgenes with additional sequence 5’ to Snrpn, rather than seek
additional buffer sequence. Whether it is indeed the absence of regulatory elements or

47
buffer sequence is a germane argument in this system, since we were seeking minimal
sufficient sequence to achieve appropriate imprinting, rather than determining which
specific elements are necessary. The data from the PI clone suggested that the 65 kb
sequence was not sufficient to confer appropriate imprinted expression, and a single-copy
imprinted transgene is necessary to establish the minimal sequence that can accomplish
correct parent-of-origin dependent expression. Once the minimal required sequence has
been determined, modifications can be made to that sequence to delineate specific
elements that are necessary for the establishment and maintenance of the imprint.
While initial attempts to make transgenic mice with the 320 kb YAC clone were
unsuccessful, the YAC clone was used to establish the approximate distance between the
3’ most exon of Snrpn and exons B and C of Ipw to be lOOkb. However, the difficulties
surrounding purification of a YAC of that size for transgenic injection precluded its
convenient use as an imprinted transgene. Previously, the largest YACs that were
successfully used in gene regulation studies involving transgenic mice were only 250 kb
in length.
Screening the 129/Sv BAC library proved fruitful for mining additional sequence
5’ of Snrpn, but did not provide an ideal BAC clone to use as an imprinted transgene.
Two clones were obtained, 397F16 and 573H8 that together contained additional
sequence 5’ of Snrpn as well as a complete Snrpn gene. Unfortunately, the commercially
available BAC libraries were of the 129/Sv or C57BL/6J strains, which made finding
naturally expressed polymorphisms unlikely since both strains are from the domesticus
subspecies of Mus musculus. The possibility of using a more polymorphic human Snrpn

48
transgene was explored and rejected earlier, since the human transgene is not silenced
when present as a murine transgene regardless of copy number.70
Since the 129/Sv BACs were not ideal, the first strategy was to join the two BACs
to create a larger BAC that was more suitable for transgene imprinting. The strategy was
to place a neomycin resistance cassette into a 35kb Sail fragment derived from the
397F16 BAC that lies 5’ of Snrpn, and then excise this fragment and ligate it into the
573H8 BAC near the site of exon 1 of Snrpn. At the time, only the RecA mediated
homologous recombination method had been described. This method involved a two-
step gene replacement strategy in which the RecA protein, absent in the BAC host strain,
was provided from a pSVl-derived plasmid with a temperature-sensitive origin of
replication71. Attempts to subclone homology arms into the RecA-containing plasmid
failed, probably due to the large size of the plasmid. RecET mediated homologous
recombination was also attempted. This method involved inducing RecE and RecT from
an arabinose-inducible promoter.72 This method was never fully explored because the
wrong plasmids were sent.
In the absence of a reliable homologous recombination method for BACs, the
C57BL/6J BAC library that was available from the RPCI was screened. The BACs from
this library were on average larger than those from the 129/Sv library. Additionally, the
NCBI mouse genome sequencing effort was proceeding from this library, so the specific
sequence in the region would eventually become available, as well as the addresses of
additional clones in the region. Screening efforts for this library were very successful, as
20 clones were isolated with the Snrpn probes. From the 20 clones, two were chosen that
contained the most detectable sequence upstream of Snrpn while still carrying the entire

49
gene. While neither of the two BACs were in the sequencing program, both BACs were
present as T7 and Sp6 fingerprints (end sequences) in the NCBI database.
Pulse-field gel analysis initially indicated that BAC 425D18 contained 40 kb of
sequence 5’ of Snrpn, while 215A12 contained nearly 120 kb 5’ of Snrpn. These
estimates are rough, since they are based on large pulse-field fragments. Subsequent
analysis suggested that 425D18 actually extended 80 kb 5’ of Snrpn, and that the 40 kb
Sail fragment that was originally thought to be the junction fragment between the mouse
DNA insert and the BAC plasmid backbone was a doublet of two adjacent fragments.
Three lines of transgenic mice harboring BAC 215A9 and two lines harboring
425D18 were obtained from microinjection of mouse oocytes. These lines were named
215A through C and 425A and B. Among these five lines, lines 215B, 215C, and 425A
were all suspected to be present in single copy. Lines 215A and 425B were estimated to
be present in 2-4 copy arrays. The method of analysis of transgene copy number that was
used is probably accurate in delineating single-copy transgenes, but not in determining
the copy number in multi-copy lines. Additionally, all transgenic lines except 215B
appeared to be intact.
Transgenes were first tested for correct imprinted expression using the ASmN
strain of mouse. Expression upon maternal inheritance was readily assayed using the
breeding scheme in Figure 3-7. Lines 215 A-C and lines 425 A and B were not expressed
upon maternal transmission, suggesting that they could be silenced in the maternal
germline (Fig 3-8). Lines 380A,B, and D, however were not correctly silenced upon
maternal inheritance (Fig. 3-8) and were thought to be missing the AS-IC. This would
result in the failure to silence the positively acting PWS-IC and lead to expression upon

50
maternal transmission. Paternal transmission was not conclusively tested using the
ASmN breeding scheme (Fig 3-7). Mice homozygous for the ASmN allele and
heterozygous for the transgene could not be distinguished from the ASmN heterozygotes
by southern blot. Instead, RNA was made from the brains of transgenic mice and
subjected to RT-PCR. If the ASmN allele was present, it was assumed that the paternally
inherited allele was the ASmN allele and not the wild-type allele, leaving any wild-type
Snrpn expression to be from the paternally inherited transgene. According to this assay,
lines 215C, 425A, and 425B were all expressed upon paternal inheritance (Fig 3-9). This
breeding scheme was not further pursued, since it required the production of RNA and
subsequent RT-PCR from every transgenic mouse. It was also not ideal that the genotype
of the mice was never certain with respect to the Snrpn versus the ASmN allele.
Furthermore, the potential for leaky expression from the maternally inherited allele
complicated an assay that required RT-PCR.
The imprinting assays were again tested using the APWS-IC strain and the
breeding schemes shown in Figures 3-10A and 3-11 A. Snrpn expression upon maternal
inheritance was tested in a similar manner and produced the same results as previously
(Fig. 3-10B). Snrpn expression upon paternal inheritance of transgenes proved to be
much simpler using the APWS-IC strain. Mice inheriting the APWS-IC allele were easily
genotyped by PCR that was unimpeded by the transgene. These mice could also be
identified shortly after birth by their failure to thrive phenotype. Expression from the
transgene in pups with a paternally inherited transgene and a paternally inherited APWS-
IC allele could then be assayed for Snrpn expression by northern blot analysis, which
does not detect the leaky maternal expression. By northern analysis, any Snrpn

51
expression originated from the transgene. Using the APWS-IC strain, lines 425A and
215B exhibited Snrpn expression upon paternal transmission of the transgene (Fig. 3-
11B). Since both of these lines are also silenced upon maternal transmission, they are
both correctly imprinted.
Line 215C was first shown to exhibit Snrpn expression upon paternal inheritance
using the ASmN strain, but not with the APWS-IC strain. The most likely explanation for
this is that the transgene is indeed expressed upon paternal inheritance, but at a low-level
that is detectable by RT-PCR, but not by northern analysis. It was precisely this
possibility that led to the use of the APWS-IC strain to test transgene imprinting. It was
desirable to maintain a high level of stringency in considering a transgene correctly
imprinted, the possibility that low-level expression could come from a correctly
imprinted repressed allele existed. Since the expression of Snrpn from line 215C could
possibly represent leaky expression of a repressed allele and not appropriate imprinting,
line 215C was not considered to be correctly imprinted.
Lines 425A and 215B demonstrated appropriate imprinted expression, indicating
that they contained sufficient sequence to confer proper imprinting. This was an
important finding, since the AS-IC has to date not been defined functionally or physically
in mouse. According to the current model for imprinting in the PWS/AS region,57 a
correctly imprinted transgene must contain the minimal sequence to harbor the positively
acting PWS-IC element as well as the negatively acting AS-IC element. The
identification of a correctly imprinted transgene indicates that the AS-IC can be
functionally defined in mouse, since in this instance the silencing function occurs on a
transgene that is integrated into a random genomic location. The transgene then serves to

52
define an approximate location of the AS-IC, and combined transgene data suggests that
it lies upstream of the PWS-IC, as it does in humans. The 425A line definitively narrows
this boundary to a region within 90 kb of the Snrpn gene. The 215B transgenic line has
undergone truncations at both the 5’ and 3’ end of the BAC, but is still imprinted. These
truncations narrow the probable location of the AS-IC to a region 38 kb 5’ of Snrpn, but
since the nature of the transgene rearrangements are not well understood, the use of this
data to suggest the location of the AS-IC must be done with caution.
The ability to use the lambda Red system of homologous recombination in BACs
will greatly simplify the study of transgene imprinting. A latent mark can now be placed
into the Snrpn locus, and its expression upon both maternal and paternal inheritance can
be ascertained in a single generation. This same system can be used to make deletions in
the most 5’ end of BAC 425D18 to better identify the AS-IC. Then, specific elements
can be deleted, replaced, or rearranged to test different models of imprinting mechanisms
in the PWS/AS region.

53
Snrpn
gene
5’ probe 3’ probe
Ipw
IAP
1 1
^ “ //
1 1
ft
22 kb!
23 kb
i 30 kb
S18H2? _
573B8
YAC
Figure 3-1. Restriction map of YAC clone and 129/Sv BAC library clones.
YAC and BACs were subjected to restriction digestion with rare cutting
enzymes and analyzed by pulse-field gel electrophoresis and southern analysis.
Thin vertical lines represent Sail sites. Black boxes represent the Snrpn gene or
Ipw IAP element. The 5’ probe is a 1 kb Sacl-Notl fragment, while the 3’ probe
is a 2.2 kb £’coRI-£'coRV fragment.

54
397F16
397-neo
tr
l
â– â– â– â– 
I
Homologous recombination
Sail digestion
H
i
Ligation into Sail digested BAC
I
Cre recombinase
Snrpn
35 kb
55 kb
Figure 3-2. Strategy to combine BACs 396F16 and 573B8. The strategy for
joining two BACs to create one of an ideal size is diagrammed. Vertical hash
marks indicate Sail sites. Dashed line represents BAC vector.

55
Snrpn
gene
5’ probe
3’ probe
1
“ L_J
1 I 1—
r
i i
i i
1 1 1
967 PI (murine)
i i
i 22 kb i
23 kb ! !
30 kb
380J10
90 kb
i i
i i
i i
8 kb ¡ !
140 kb
i i
i i
i i
i i
i i
i i
65 kb
170 kb
¡ i
i i
i i
i i
i i
i i
i i
i i
i i
20 kb
i i
i i
â–  i
Figure 3-3. Restiction map of C57BL/6 BAC clones. BAC clones were
subjected to restriction digestion and analyzed by pulse-field electrophoresis and
southern analysis. The 5’ probe is a 1 kb Sacl-Notl fragment, while the 3’ probe is
a 2.2 kb FcoRI-FcoRV fragment. Vertical hash marks represent Sail sites. Not all
clones are diagrammed.

PI-967
1707 - 1 copy, intact
1737-2 copies, intact
A - 2-4 copies, intact
215 â–º B -1 copy, rearranged
C -1 copy, intact
425
A -1 copy, intact
B - 2-4 copies, intact
380
A - 2-4 copies, intact
B -1 copy, intact
C -1 copy, truncated
D -1 copy, intact
Figure 3-4. Transgenic lines investigated for imprinted expression.
Copy number and intactness is indicated according to available probes.

57
Snrpn locus
c
1 2 3
45 6 7 8 910
INN II-
Figure 3-5. Location of probes around the Snrpn locus. Probe A represents
A 0.8 kb PCR fragment 38 kb 5’ of Snrpn. Probe B is a 1 kb Sacl-Notl
fragment that is 30 kb 5’ of Snrpn. Probe C is a probe for exon 1 of Snrpn.
Probe D is a 2.2 kb EcoRl-EcoRV fragment 5 kb 3’ of Snrpn.

58
Snrpn locus
l 2 3
4 5 6 7 8 9 10
lllll II
ASmN allele
l 2 3
-\\—I 1—4
APWS-IC allele
Figure 3-6. Snrpn locus, ASmN allele, and APWS-IC allele structures.
The ASmN allele represents a deletion of exons 5-7 of the Snrpn gene. The
Neomycin resistance cassete (Neo) produces a larger fusion transcript by
Northern blot, thus marking that allele. The APWS-IC allele represents a
35 kb deletion that includes 16 kb of sequence 5’ of Snrpn as well as exons
1-7 of the Snrpn gene.

59
Maternal transmission
Paternal transmission
Figure 3-7. Breeding scheme for testing expression upon maternal and
paternal transmission of transgenes. Tg represents any transgene, while
ko represents the ASmN allele. Maternal and paternal alleles are indicated
where relevant. Only offspring of the desired genotype are indicated.

60
Line
ASmN
Snrpn
Figure 3-8. Expression of Snrpn from transgenes upon maternal transmission.
The upper band results from a paternally inherited ASmN allele that creates a
fusion transcript that is larger than the normal Snrpn message. Snrpn is only
expressed from transgenes upon maternal inheritance in lines 380A, 380B,
and 380D.

61
A
ASmN allele
Endogenous allele/ transgene
B
425A 425B 215C
NoRT
ASmN allele
12 12 1
Endogenous allele/
transgene
Figure 3-9. Expression of Snrpn from transgenes upon paternal inheritance.
A. PCR primer locations for each allele. B. RT-PCR showing ASmN and
wild-type alleles. The presence of the ASmN allele indicates that the
paternally inherited endogenous allele was the ASmN allele, and then
expression of the wild-type allele indicates expression of the transgene. If
the ASmN allele is not present, then the paternally inherited endogenous allele
is assumed to be a wild-type allele and this mouse is uninformative for transgene
expression.

62
A
B
$
fO
CQ
to
£
$
N
<“7
r?
Snrpn
£
%
I
cc
fn
2c
I
Figure 3-10. Transgenic expression of Snrpn upon maternal transmission
of transgenes. A. Breeding scheme used to assay transgenic expression using
the APWS-IC strain . Tg represents any transgene, while ko represents the
APWS-IC allele. Maternal and paternal alleles are indicated where relevant.
Note that APWS-IC pups are missing all paternally expressed gene products
in this region and succumb to neonatal lethality when the APWS-IC allele is
paternally inherited. B. Northern blot showing Snrpn expression in transgenic
pups inheriting a paternal APWS-IC allele and a maternal transgenic allele.

63
A
1st
Generation
2nd
Generation
B
£
£
a,
<2
£
$
CQ
»—*
Figure 3-11. Transgenic expression of Snrpn upon paternal transmission
of transgenes. A. Breeding scheme used to assay transgenic expression using
the APWS-IC strain . Tg represents any transgene, while ko represents the
APWS-IC allele. Maternal and paternal alleles are indicated where relevant.
Note that APWS-IC pups are missing all paternally expressed gene products
in this region and succumb to neonatal lethality when the APWS-IC allele is
paternally inherited. B. Northern blot showing that Snrpn is expressed upon
paternal expression in lines 425A and 215B. 380 lines are not shown

CHAPTER 4
STRAIN-DEPENDENT DIFFERENCES IN PHENOTYPE
Introduction
Angelman Syndrome (AS) and Prader-Willi Syndrome (PWS) are caused by
deficiencies in genes subject to genomic imprinting. PWS is characterized by infantile
hypotonia, gonadal hypoplasia, short stature, a moderate delay in physical and mental
development, and obsessive/compulsive behavior, as well as neonatal feeding difficulties
followed later by hyperphagia leading to profound obesity.74 AS is characterized by
severe mental retardation, absent speech, ataxic gait and a happy demeanor.24
Approximately 70% of PWS patients have a 3-4 megabase deletion of the paternal
chromosome 15ql 1-ql3.49,75,76 The clinically distinct AS results from the same 15ql 1-
ql3 deletion in about 70% of patients, however the deletion is always on the maternally
inherited chromosome.45,77,78 Either syndrome can also result from uniparental disomy
(UPD), in which both copies of chromosome 15 are inherited from only one parent. The
UPD is always maternal in PWS patients 28,49,76 and paternal in AS patients.31,79 The
identification of both of these classes of patients has led to the conclusion that PWS is
caused by a loss of gene expression from the paternally inherited chromosome, whereas
AS is caused by a loss of gene expression from the maternally inherited chromosome.
Many AS patients have been shown to contain intragenic mutations in the UBE3A
gene, indicating that mutations in UBE3A are sufficient to cause AS. 34,35 In contrast to
AS, no single gene has been identified for PWS, strongly suggesting that PWS is a
64

65
contiguous gene syndrome, requiring the loss of two or more paternally expressed genes
to cause the PWS phenotype.80 All the PWS candidate loci identified to date in humans
and mice are expressed exclusively from the paternally inherited chromosome. These
include: MKRN3/Mkrn3 (previously known as ZNF127/Zfpl27), 46,81 MAGEL2/Magel2,
42,65 NDN/Ndn,40 SNRPN/Snrpn, 11,82 HBII-486, HBII-13/MbII-13,43 HBII-487, HBII-
438A, HBII-85/MbII-85,43,44 IPW/Ipw, 18,47 HBII-52/MbII-52,43 HBII-438B, and an
antisense transcript to the UBE3A gene.41,57 Recently, the latter genes (SNRPN through
the antisense UBE3A transcript) were shown to be derived from a single transcriptional
unit.83
The imprinted genes involved in AS and PWS are regulated by a bipartite
imprinting center (IC) located upstream of the SNRPN gene.26 The IC is divided into the
Angelman Syndrome Imprinting Center (AS-IC) and the Prader-Willi Syndrome
Imprinting Center (PWS-IC). Previously, it was demonstrated that the PWS-IC is
functionally conserved in the mouse.22 A 35 kb deletion mutation (the deletion was
originally reported to be 42 kb, but is now known that the original map was based on a
strain that contained a VL30 insertion) was created in a male embryonic stem (ES) cell
line. This 35 kb deletion included 16 kb of upstream sequence plus exons 1-6 of the
Snrpn gene. Breeding male chimeric founders (129/Sv) harboring a maternal deletion
mutation to wild-type females (C57BL/6J) resulted in mutant offspring that usually died
within 48 hours, but never survived beyond 7 days after birth. These mice exhibited
several phenotypes similar to those found in PWS infants including small size, poor
feeding, and failure to thrive. In addition, these progeny were shown to lack expression of

66
the local paternally expressed genes Mkrn3 (aka Zfpl27), Ndn, and Ipw22 as well as
Magel2, MbII-13, MbII-85, and MbII-52. 43’44'84
Since germline transmission from chimeric males produced mutant offspring
that died prior to weaning, this 35 kb deletion mutation was recreated using J4 female
(XO) ES cells. As expected, transmission of the deletion mutation from female chimeras
resulted in normal heterozygous carrier offspring.55 Consistent with previous
observations, heterozygous carrier males (129/Sv) bred to C57BL/6J females produced
mutant offspring that did not survive until weaning, even if the wild-type siblings were
removed to reduce competition. This strain has been used to breed unaffected males
APWS-IC carriers with mice of different genetic backgrounds to study phenotypic
variation. Here, long-term survival of APWS-IC mice upon breeding to several strain
backgrounds is reported.
Materials and Methods
Strains and Matings.
Mouse strains used were APWS-IC deletion mice backcrossed onto a C57BL/6J
genetic background for 10 generations, C57BL/6J, FVB/NJ, 129/Sv, C3H/HeJ, DBA/2J,
and C57BL/6J congenie for a region of Mus musculus castaneus chromosome 7
(B6.CAST.c7).56 APWS-IC males were mated with females of the strains described
above to produce affected PWS progeny pups, which were used to ascertain survival and
gene expression. For (B6.CAST.c7 x FVB/NJ) F, matings, B6.CAST.c7 females were
mated with FVB/NJ males. Conversely, (FVB/NJ x B6.CAST.c7) F, matings were
produced using FVB/NJ females and B6.CAST.c7 males.

67
Culling and Fostering
Litters resulting from matings with APWS-IC males were selectively culled to aid
survival of affected APWS-IC pups. Culling was carried out by sacrificing all of the
wild-type pups except one within two days after birth, depending on whether or not wild-
type pups could be distinguished from their APWS-IC littermates. One wild-type pup
was left to stimulate milk production in the absence of robust pups. Mice were fostered
to another mother by removing the APWS-IC pups from one mother (usually from the
C57BL/6J strain) and giving them to the other mother (usually from the FVB/NJ strain)
whose pups had been removed. Additionally, urine from the foster mother was wiped on
the foster pups to aid in her acceptance of the new pups. In some fostering cases, two
mothers of different strains were set up to litter together, and the litter from the FVB/NJ
mother was then removed and the wild-type littermates from the other mother were
culled. This allowed two new mothers to care for a small number of APWS-IC pups.
Identification of Polymorphisms
Total brain RNA was prepared from both 129/Sv mice and B6.CAST.c7 mice.
Each RNA sample was used to create single-stranded cDNA using random primers in a
reverse transcription reaction. These cDNAs were used to program PCR reactions using
primers corresponding to Ube3a exons 4 and 7 (5’-CCTGCAGACTTGAAGAAGCAG¬
S’ and 5’-GAAAACCTCTGCGAAATGCCTT-3’). The resulting products were cloned,
sequenced and compared. A polymorphism found in exon 5 created a Tsp5091 restriction
site in the 129/Sv clone and a Bst4Cl site at the same location in the B6.CAST.c7 clone.
A polymorphic Avail site between Mus musculus castaneus and Mus musculus
domesticus was identified and kindly provided to us by Marisa Bartolomei (M.

68
Bartolomei, personal communication). This polymorphism results from a cytosine
nucleotide, rather than a thymine nucleotide at position 117 of the Ndn transcript. Avail
cuts the domesticus allele, but not the castaneus allele due to the presence of the cytosine
nucleotide. PCR primers flanking the polymorphic restriction site were designed as
follows: NdnpolyF 5 ’ - AC AAAGT AAGGACCTGAGCG ACC-3 ’ and NdnpolyR 5’-
CAACATCTTCTATCCGTTCTTCG-3’. The PCR product amplified using NdnpolyF
and NdnpolyR was gel purified on a 2% agarose gel, extracted from the gel using the
QIAGEN gel extraction kit, and digested with Avail. The digested products were
electrophoresed on a 4.8% agarose gel (2:1 low-melt agarose: agarose).
RT-PCR
Total RNA was isolated from complete brains obtained from neonatal, 1 week
old, 2 week old, and 3 week old mice. RNA was extracted using RNAzol (Tel-Test, Inc.)
according to instructions. The total brain RNA (10pg) was pretreated with DNasel
(Invitrogen), and half of the reaction was subsequently used to synthesize first-strand
cDNA with Superscript II reverse transcriptase (RT) and random primers (Invitrogen).
The other half of the reaction was manipulated in parallel in the absence of RT. One-
twentieth of the +RT or -RT reactions was used to seed PCRs using the following
conditions: lOmM Tris-HCl, pH 8.3, 50mM KC1, the four dNTPs at 0.125 mM each, 1
unit Taq DNA polymerase (Boehringer), and the appropriate primers at 4 pM each.
Sequences of the primers were as follows: Ndn 9F (5’- GTATCCCAAATCCACA
GTGC -3’), Ndn 1 OR (5’- CTTCCTGTGCCAGTTGAAGT -3’), Ndnpoly F (5’- ACAAA
GT AAGGACCTGAGCG ACC -3’), Ndnpoly R (5’- CAACATCTTCTATCCGTTC

69
TTCG -3’), Ube3a 5F (5’- CACATATGATGAAGCTACGA -3’), Ube3a intron 5 R (5’-
CAGAAAGAGAAGTGAGGTTG -3’), SnrpnNl.l (5’- CTGAGGAGTGATTGCA
ACGC -3’), Snrpn N2.2 (5’- GTTCT AGG A ATT ATGAGCCCC -3’), p-actin F (5’-
GTGGGCCGCTCTAGGCACCAA - 3’), and P-actin R (5’- CTCTTTGATGTCA
CGCACGATTTC - 3’). PCR amplifications conditions were 95° C for 5 min., followed
by either 20 or 30 cycles of 94° C for 30 s, 60° C for 45 s, and 72° C for 45 s. The final
cycle was followed by an extension step for 10 min at 72° C.
Northern Blot Analysis
To detect the presence of processed snoRNAs, total RNA was separated on 8%
denaturing polyacrylamide gels (7M urea, IX TBE buffer) and transferred to nylon
membranes (Hybond N+) using a semi-dry blotting apparatus (Trans-blot SD, BioRad) as
described by Cavadle et al.43 RNA was fixed to the membrane by baking at 80° C in a
vacuum oven. The membranes were prehybridized and hybridized overnight at 58° C,
according to the Church and Gilbert method. Oligonucleotides complementary to
snoRNA sequences were end-labeled using a32 P-dATP (NEN) and T4 polynucleotide
kinase (Invitrogen). Their sequences are as follows: MbII-85 (5’ - TTCCGATGAGAG
TGGCGGTACAGA - 3’), MbIl-52 (5’ - CCTCAGCGTAATCCTATTGAGCATGAA -
3’), and 5.8S rRNA (5’ - TCCTGC AATTC AC ATT AATTCTCGC AGCT AGC - 3’).
Probes were purified from free nucleotides using the nucleotide removal kit (QIAGEN).
Membranes used for detecting snoRNA expression were washed twice for 15 min at
room temperature using 2X SSC, 0.1% SDS, and then exposed to Kodak XAR film at -
80° C for 12-36 hours.

70
Results
In contrast to the fully penetrant neonatal lethality phenotype previously seen on
the C57BL/6J strain background, APWS-IC carrier males on the 129/Sv strain
background or APWS-IC carrier males made congenie on the C57BL/6J background bred
to wild-type female FVB/NJ mice, produced several mutant offspring that survived to
two weeks of age. Furthermore, if most of the wild-type competitor sibs are removed,
the mutant offspring could survive to adulthood. Although these surviving APWS-IC
mice are significantly smaller than wild-type sibs (Fig. 4-1), both males and females are
fertile.
To examine whether the increased survival was simply due to superior mothering
abilities of the FVB/NJ females as compared to C57BL/6J females, newborn pups were
fostered to mothers of the opposite strain and also trio matings of a APWS-IC carrier
male with both an FVB/NJ and a C57BL/6J female were established. In both situations,
survival of only those F, mice born to the FVB/NJ females was observed, demonstrating
that it is the genetic background of either the offspring or the mother that leads to survival
rather than the skill of the mother (data not shown).
Next, the expression of several PWS candidate genes in these surviving (FVB/NJ
x APWS-IC) Fi mice was examined. Surprisingly, low levels of Ndn and antisense Ube3a
expression was detected by RT-PCR in newborn mice (data not shown). By Northern
blot, expression of several snoRNAs mapping to the region was also detected (data not
shown). These results were unexpected as expression of these genes in pups with a
paternally inherited PWS-IC deletion had not been previously detected. However, when
RNA expression from the 5’ half of the Snrpn gene, a region that is physically deleted

71
from the paternally inherited APWS-IC allele, was examined, expression was detected by
RT-PCR (data not shown). Therefore, this strongly suggested that low-level expression
detected for Ndn, antisense Ube3a, MblI-85 and Snrpn is derived at least somewhat from
leaky expression of the maternal FVB/NJ allele. A time course for the observed low-
level expression of Ndn and Snrpn at newborn, 1 week, 2 weeks, and 3 weeks of age was
followed, and the leaky expression was detectable in all ages of mice (Fig4-2). It was
hypothesized that expression of these genes is sufficient to rescue the lethality phenotype
associated with the APWS-IC mutation.
Next, the extended survival and leaky expression of these imprinted genes was
investigated to determine if it was restricted to the FVB/NJ strain. Females for the
C57BL/6J, DBA/2J, BALB/cJ, C3H/HeJ, and 129/SvEv strains were mated to APWS-IC
carrier males on the C57BL/6J genetic background. Wild-type pups were removed from
the litters within two days after birth and the longest possible survival of APWS-IC pups
was determined. Pups derived from C57BL/6J and DBA/2J females had the shortest
survival time, with the longest surviving affected individual from either strain living only
7 days. Pups derived from all other strains had at least one affected individual that
survived for at least 3 weeks. Leaky expression of Snrpn, Ndn, and MbII-85 was
observed at comparable levels in all strains (Fig. 4-3), regardless of their ability to
survive.
Finally, the leaky maternal expression of these PWS candidate genes was
investigated in wild-type mice. FVB/NJ females were mated with wild-type males from
the B6.CAST.c7 strain, a strain that is congenie for the mus musculus castaneus
chromosome 7 on a C57BL/6J background. The reciprocal mating was also performed.

72
Total brain RNA was isolated from the resulting (FVB/NJ X B6.CAST c.7) Fi or
(B6.CAST.c7 X FVB/NJ) F, mice at birth. RT-PCR followed by a polymorphic
restriction enzyme digest of the RT-PCR product was used to distinguish between
expression of Ndn produced from the domesticus and castaneus alleles. Only the paternal
castaneus allele was expressed in each case (Fig 4-4). B6.CAST.c7 females were then
mated with APWS-IC carrier males and the same RT-PCR and restriction digestion on
brain RNA made from (B6.CAST.c7 X APWS-IC) F, pups was performed. While
expression from wild-type pups was limited strictly to the domesticus allele, the
expression in pups that had inherited the paternal APWS-IC allele was biallelic,
representing both domesticus and castaneus alleles. This indicates that leaky maternal
expression is only observed or detectable when in combination with a paternal APWS-IC
mutation.
Discussion
This study demonstrated that strain background affects the phenotype of the
APWS-IC mice. Heterozygous carrier males (either 129/Sv or C57BL/6J) bred to
C57BL/6J or DBA/2J females produced mutant offspring that do not survive until
weaning, even if wild-type siblings are removed to reduce competition. However, long¬
term survival was achieved upon breeding these same carrier males to several other
strains, including FVB/NJ, C3H/HeJ, 129/Sv, and BALB/cJ. While surviving APWS-IC
mice are smaller than wild-type littermates, they do not become obese on a low-fat diet,
both males and females are fertile, and they appear to be normal in all other respects.
Expression analysis of Snrpn, the antisense transcript of Ube3a, and the MbII-85
snoRNA reveals leaky expression of these paternally expressed genes in APWS-IC pups.

73
This expression occurs at a very low level, and originates, in part, from the maternally
derived chromosome. This leaky expression, originally detected in PWS-IC deletion
pups with FVB/NJ mothers, is also present at comparable levels in all other strains,
including C57BL/6J and DBA/2J. This suggests that the increased survival of APWS-IC
pups is not due to the low-level expression of genes in the PWS region. Furthermore, this
expression is not sufficient to ameliorate the failure to thrive phenotype and permit
survival in APWS-IC pups. Similarly, humans that have PWS due to maternal
uniparental disomy or a balanced translocation have also been reported to show weak, but
detectable expression of genes in the PWS region.85 No obvious clinical differences were
reported from individuals with leaky expression from imprinted genes when compared to
affected individuals that did not show leaky gene expression from these genes.85-86
Why would APWS-IC pups survive on some strains and not others, when the gene
expression in the PWS region appears to be identical between survivors and non¬
survivors? The most likely explanation for this would be the presence of specific
modifier alleles in some inbred strains that either permit or prevent survival of affected
pups. An alternate explanation may be the general unfitness of a particular strain for
survival of neonates. This is unlikely, however, as the APWS-IC pups are genetically F,
individuals and should benefit from hybrid vigor.
Heterozygous carrier males on the 129/Sv genetic background bred to C57BL/6J
females, produce APWS-IC pups that never survive. Conversely, carrier males on the
C57BL/6J genetic background bred with 129/Sv females produce APWS-IC pups that are
capable of surviving to adulthood, even though the genetic background of these
reciprocal matings are identical. One explanation of this is that the modifier gene or

74
genes responsible for survival of APWS-IC mice could be required in the oocyte. The
oocyte specific factor would not be present in C57BL/6J oocytes that are not permissive
for survival, but would be present in 129/Sv oocytes and allow survival of affected pups.
An alternate explanation is that the modifier gene or genes are themselves imprinted. If
the modifier gene was only expressed from the maternally inherited chromosome, and the
allele of this gene that was permissive for survival was the 129/Sv allele and not the
C57BL/6 allele, then survival could only be achieved when the maternal allele of this
gene is from the 129/Sv strain. Pronuclear transplant, where the pronuclei from a (B6 X
APWS-IC) F, oocyte could be moved into “emptied” oocytes from fertilized FVB/NJ or
(FVB/NJ X APWS-IC) F, females, could be used to distinguish between these two
possibilities. If the transplanted pronuclei gave rise to pups that were able to survive,
then the modifier gene is most likely oocyte specific, however, if the resultant pups still
do not survive, then the modifying gene is most likely imprinted.
It is interesting that the leakiness of the maternal allele is only detectable when in
combination with a paternal APWS-IC allele, but not when in combination with a wild-
type paternal allele. There are three possible explanations for this. First, low-level
expression from the maternal allele would produce a few transcripts from the maternal
allele that could simply be swamped by the more abundant transcripts originating from
the paternal allele. Perhaps imprinting in mouse is only strong allele bias, and low-level
expression could mark the repressed chromosome as a region that is repressed in a
facultative manner as opposed to a constitutive manner. Another possibility is that the
expression of genes or transcripts downstream of Snrpn could be allowed by the splicing
of the upstream exons of Snrpn 87that are left intact on the APWS-IC chromosome into

75
the downstream exons of Snrpn or the run-on transcripts from which the snoRNAs are
spliced.83 These upstream exons have been shown to be functional alternate promoters
for Snurf, but their level of expression is much weaker than that of the major promoter.
Perhaps this could explain the weak expression of the snoRNAs. Additionally, the
physical interaction between the silenced imprinting center and the upstream genes,
including Mkrn3, Magel2, and Ndn, could be required for the silencing of these genes
that lie more than 1 Mb away from the imprinting center. The missing imprinting center
could cause the alternate Snurf promoters to be juxtaposed to the regulatory elements of
the upstream genes, and result in leaky expression. While this may explain leaky paternal
expression, it doesn’t explain residual expression from the maternal chromosome. The
third explanation is that communication between one silenced and one expressed
imprinting center is required for the proper silencing of the maternal allele and the
expression of the paternal allele. Specifically, the unmethylated, unsilenced, paternal
PWS-IC may be required in trans to silence the maternal region. While this explanation
could account for the bi-allelic expression in the APWS-IC mice, it doesn’t explain why
the expression levels of the imprinted genes are so low. Furthermore, trans-activation is
a phenomenon not documented in mouse and would be difficult to prove or disprove.
Leaky gene expression in the region is not unique to mice, as human patients with
maternal uniparental disomy have also been reported to show leaky expression 85,86.

76
Figure 4-1. Surviving APWS-IC mice are smaller than their wild-type
littermates. APWS-IC mice and their wild-type littermates were weighed at 3, 6, 9,
12, and 15 weeks of age. Their weight in grams is plotted versus their age in weeks.
Filled symbols represent APWS-IC mice and open symbols represent the wild-type
littermates.

77
Ndn RT-PCR
S'Snrpn RT-PCR
fi-actin RT-PCR
No RT control
MbII-85
MbII-52
5.8S rRNA
Figure 4-2. Leaky expression from paternally expressed genes is not age
dependent. APWS-IC mice were sacrificed at birth, one week, two weeks, and
three weeks of age. Total brain RNA was made from the sacrificed mice and
subjected to either RT-PCR or northern analysis. RT-PCR is shown for Ndn and 5’
Snrpn since the expression level is not detectable by northern analysis. 5.8S rRNA
and /3-actin were used as controls for northern analysis and RT-PCR, respectively.
Low-level expression is noted in APWS-IC mice regardless of their age.

78
B6 FVB/N C3H/HeJ Balb/c 129/Sv DBA72J
Ndn RT-PCR
5’Snrpn RT-PCR
fi-actin RT-PCR
No RT control
Ndn RT-PCR
20 cycles, blot
S'Snrpn RT-PCR
20 cycles, blot
w A AwAAwAAwA Aw A A w A A
M bll-SS
5.8S rRNA
Figure 4-3. Leaky gene expression does not account for strain dependent
differences in phenotype. APWS-IC mice made congenie on the C57BL/6J strain
background were mated with either C57BL/6J, FVB/NJ, C3H/HeJ, Balb/cJ,
DBA/2J, or 129/Sv females. Total RNA was prepared from the brains of two
APWS-IC mice and one wild-type littermate. The RNA was subjected to RT-PCR
and northern analysis. Ndn and S'Snrpn were analyzed by RT-PCR at 40 cycles or
at 20 cycles and blotted and probed. 5.8S rRNA and /3-actin were used as controls
for northern analysis and RT-PCR, respectively. APWS-IC mice showed leaky
expression in all strains analyzed.

79
A
FVB/NJ x B6. Cast.c7/B6.Cast.c7 x FVB/NJ
castaneus
domesticus
FxC CxF
genomic genomic
B
B6.Cast.c7 x APWS-IC
castaneus
domesticus
Figure 4-4. Leaky gene expression is biallelic in APWS-IC pups. A. Brain
RNA from reciprocal crosses between FVB/NJ and B6.CAST.c7 was subjected
to RT-PCR with primers flanking a polymorphic Avail site in the Ndn transcript
from mus musculus domesticus. The product was digested with Avail and run
on a 4.8% agarose gel. Wild-type Ndn expression in both crosses originates
from the paternally inherited chromosome. B. B6.CAST.c7 females were
mated with males that were carriers for the APWS-IC allele. APWS-IC and wild-
type littermate pups were sacrificed at birth and total RNA was prepared from
their brains. RT-PCR and Avail digestion of the Ndn transcript was performed
as described above. Wild-type Ndn expression occurs from the paternally
inherited allele, while APWS-IC expression occurs from both paternal and
maternal alleles.

CHAPTER 5
TRANSGENIC RESCUE OF THE PWS-IC DELETION MOUSE
Introduction
Prader-Willi syndrome (PWS) patients first present with severe infantile
hypotonia and failure to thrive that leads to a requirement for gavage feeding in most
PWS neonates. The infantile phenotype subsides after several months and gives way to a
period of normal feeding behavior, but soon progresses to hyperphagia and severe
obesity, if uncontrolled.23 PWS children also possess a distinctive behavioral phenotype
that is similar, but not identical to obsessive-compulsive disorder. Outwardly visible
signs of the disease in humans may also include almond-shaped eyes, strabismus, small
stature, small hands and feet, and hypogonadism.23,37 Caused by the physical or
functional deletion of paternal chromosome 15ql l-ql3, PWS occurs at a frequency of
about 1/15,000 live births.24'26 Approximately 70% of PWS patients have sustained a
large (3-4 Mb) deletion of their paternally inherited chromosome 15. Other PWS patients
have either inherited both copies of chromosome 15 from their mother (maternal
uniparental disomy), or have an imprinting mutation. Patients with an imprinting
mutation have either a deletion in the 5’ region of Snrpn, including exon 1, an area
known as the imprinting center (IC) of the 15ql l-ql3 region,6 "'13,20 or have no detectable
DNA sequence mutation, but still possess a paternally inherited chromosome that
epigenetically behaves as a maternally inherited chromosome.
80

81
Human chromosome 15ql l-ql3 contains at least six paternally expressed genes
or transcripts and is syntenic with central chromosome 7 in mouse. The genes and
transcripts include: MKRN3, MAGEL2, NDN, SNRPN, HBII-13, HBII-436, HBII-437,
HBII-438A, HBII-438B, HBII-85, HBII-52, and the t/flEM-antisense transcript.17'18 2139-44
Expression of each of these genes is completely absent in most PWS patients, although
some patients show low-level expression, but still present with classical PWS.85-86 A
large region of sequence between SNRPN and NDN still remains unexplored and may
contain additional genes. This region encompasses nearly 1.5 Mb, and additional genes
discovered in this region might be predicted to be imprinted and paternally expressed.
The distinct paternal inheritance pattern of PWS identifies 15ql l-ql3, as well as
the syntenic mouse chromosome 7 as a region of genomic imprinting.17 21,39 Genomic
imprinting involves the expression of only one parental allele in somatic cells. The other
parental allele is transcriptionally silenced. The non-transcribed alleles of the PWS
genes, maternal in the case of PWS-related genes, are often associated with nearby
methylated cytosine residues present in CpG islands, while the transcribed alleles, are
associated with the lack of methylation at these same CpG residues.6'11"13 This indicates
that the maternal allele has a different epigenotype than the paternal allele. It is not
known whether the eventual silencing of the maternal allele causes this epigenetic mark,
or whether it is a mark to identify the allele to be silenced.
Conversely, Angelman syndrome (AS) results from the functional deletion of the
maternal complement of the same interval of chromosome 15.24 A unique class of AS
patients with specific mutations in the UBE3A gene suggests that loss of UBE3A
expression can be solely responsible for the major clinical features of AS.34,35 Another

82
maternally expressed gene, ATP IOC, has also been identified in the PWS region, but its
contribution to the phenotype of AS is yet to be determined.36 AS can result from
maternal deletion of 15ql l-ql3, paternal uniparental disomy, IC mutations, and from
putative single gene mutations, as evidenced by completely normal epigenotype in the
region and the UBE3A mutation class which present with classical AS.24 The absence of
the class of PWS patients in which a single gene mutation is responsible for the complete
phenotype, as well as the presence of multiple paternally expressed genes that are
disrupted, indicate that PWS is a contiguous gene syndrome where the clinical features
are the cumulative effect of multiple disrupted genes.80 88
PWS and AS patients with imprinting defects have either a relatively small
deletion or no noticeable mutation at all, but these mutations alter the entire 3-4 Mb
region on the paternal and maternal chromosomes, respectively.6,20 In PWS-IC mutation
patients, the paternally derived genes assume maternal, or silenced, epigenotypes. The
deletion breakpoints of several PWS patients with IC mutations were mapped to identify
the smallest region of deletion overlap for PWS (PWS-SRO).13,37 The PWS-SRO is
located 5’ of the SNRPN gene, includes the first exon of the gene, and is often referred to
as the PWS-IC. Although the PWS-SRO has been narrowed down to approximately
4.3kb, the actual deletions that have been shown to cause PWS are much larger.37,38 A
smallest region of deletion overlap has also been identified for AS, and is referred to as
the AS-SRO. The AS-SRO lies around 35 kb upstream of the PWS-SRO, and has been
narrowed to 0.8 kb.37,38 AS-IC mutations never appear to overlap the PWS-SRO, while
PWS-IC mutations can overlap the AS-SRO, suggesting that in the absence of the PWS-
IC, the AS-IC is not necessary.57 This indicates that the sole purpose of the AS-IC may

83
be to regulate the PWS-IC in the maternal germline.57 This also indicates a bipartite
structure to the IC, in which the PWS and AS components work together to control
imprinting in the 15q 11-ql3 region. In mouse, the PWS-IC has been functionally defined
by deletion, indicating that the bipartite IC is most likely functioning similarly between
humans and mice.22
Our lab previously created a mouse model of PWS that emulates both the
phenotypic and molecular characteristics of PWS by deletion of the mouse PWS-IC.22
Mice that inherit a PWS-IC deletion (APWS-IC) from their father lose expression of the
known paternal-specific genes, including Snrpn, Mkrn3, Ndn, and the Ube3a antisense
transcript. The APWS-IC mice also demonstrate poor suckle and failure to thrive,
indicative of the infantile characteristics of human PWS. These mice thus provide an
excellent mouse model of PWS. Unfortunately, APWS-IC mice on the inbred C57BL/6J
background die within seven days of birth, presumably a result of poor suckle and failure
to thrive. Progression to obesity and the development of other PWS related phenotypes
has yet to be seen in APWS-IC mice due to neonatal lethality. APWS-IC mice mated
with mothers of other strain backgrounds survive to adulthood if the wild-type siblings
are removed shortly after birth. These surviving APWS-IC mice remain smaller than
their wild-type siblings, but are otherwise grossly normal. Furthermore, surviving
APWS-IC females and males are both fertile and never become obese on an ordinary
rodent diet.
Individual knockouts of Snurf, Snrpn, and Mkrn3 appear completely normal and
show no PWS associated phenotype.22,46'89'91 Conflicting data regarding the phenotype of
the Ndn gene knockout have been reported. Tsai and colleagues report that the Ndn

84
knockout mouse has no discernable phenotype, while Gerard et al. and Muscatelli et al.
report partial neonatal lethality that is strain dependent and not consistent from generation
to generation.89,90,92 On the other hand, mice inheriting a paternal deletion spanning from
exon 2 of Snrpn to Ube3a succumb to neonatal lethality in 80% of the affected pups.91
Together, this data strengthens the hypothesis that PWS is a contiguous gene syndrome
caused by the absence of multiple gene products, and not caused by the absence of any
single gene product. Despite the efforts of many labs to create individual gene
knockouts, the contribution of each gene in human chromosome 15ql l-ql3 and the
syntenic mouse chromosome 7 to the PWS phenotype is still a mystery. Figure 5-1
shows a summary of the individual gene deletions that have been reported.
Efforts to model PWS using individual gene knockouts have been largely
unfruitful.22,89,90,92 However, engineering multiple gene deletions is also limited by the
location of the imprinting centers (several desired mutations would remove them,
creating an imprinting mutation). Therefore, a different approach was adopted to
determine the individual gene contribution to this contiguous gene syndrome. This
approach involved transgenic rescue, and the strategy was to produce transgenic mice
harboring either individual or multiple PWS genes and mate them to APWS-IC mice. In
mice paternally inheriting an imprinting center mutation and maternally inheriting a
transgene, the ability of the transgene to rescue the phenotype of the APWS-IC mice
could be ascertained. The genes responsible for the individual aspects of the PWS
phenotype could then be definitively determined, since one transgene could conceivably
rescue the neonatal lethality defect, while another could rescue the small stature defect.
In addition, the rescued mice may live longer or recapitulate other human PWS
,

85
symptoms and allow the dissection of additional later onset phenotypes in our mouse
model.
Materials and Methods
Screening the BAC Libraries
The Research Genetics (Huntsville, AL) BAC library was initially screened for
BAC clones. This library was made from the 129/Sv strain of mouse. The library
consisted of 9 filters, each carrying 27,648 unique clones, with an average insert size of
130 kb, spotted in duplicate onto 9 different membranes. Probes for Ndn, Mkrn3, Ube3a,
and the gene formerly known as Ipw were used to screen the library simultaneously.
Prior to hybridization, BAC membranes were washed with 1500 mL of 6X SSC
and 0.1% SDS at room temperature for 15 minutes. The membranes were then rinsed
twice with 1500 ml of 6X SSC for 15 minutes at room temperature, and hybridized
according to the Research Genetics protocol. Briefly, the membranes were prehybridized
in roller bottles with 3 membranes per bottle, each separated by one sheet of Flow Mesh
(Diversfied Biotech, Boston, MA), in 120 ml of HyperHyb (Research Genetics,
Huntsville, AL) per bottle at 65° C for 20 minutes. At least 107 counts of each probe
were boiled for 5 min, snap cooled on ice, and then added to 3 ml of HyperHyb that was
pre-warmed to 65° C, and 1 ml of hybridization solution was added to each of the roller
bottles. The membranes were allowed to hybridize for 2 hours at 65° C.
The membranes were washed in the roller bottles three times for 15 minutes at
65° C with 30 ml IX SSC and 0.1% SDS. They were then removed from the bottles and
washed twice more at 65° C with 1000ml of IX SSC and 0.1% SDS for 15 minutes.
Finally, the membranes were rinsed with IX SSC at room temperature. The membranes

86
were then wrapped in cellophane and exposed to film (XAR, Kodak) overnight at -80° C.
Positive clones were identified following the manufacturer’s instructions, and the
following clones were ordered: 454N20, 205L17, 581E10, 173C16, and 143C10. In
addition to screening the 129/Sv library, a single RPCI-23 BAC, 452P17 was found by
screening the library virtually with a probe to the 3’ most intron of the Ube3a gene.
Probe Preparation
Probes were labeled using the Prime-It II kit (Stratagene, La Jolla, CA), with
minor modifications. DNA (200 ng)was boiled for 5 minutes in the presence of random
hexamers. The DNA-hexamer mix was cooled on ice, and 5X reaction buffer was added
along with 25 pCi of a32P dCTP and 1U of exo' klenow. The labeling reaction was
placed at 37° C for 15 minutes. After labeling was complete, the probe was purified
using the nucleotide removal kit (QIAGEN) and eluted in 200 pi of water. Purified
probes were boiled for 5 minutes and snap cooled on ice prior to use in hybridization.
Verification of BAC Clones
Single BAC colonies were tested to determine which clones were derived from
each gene locus. Four single colonies from each BAC were streaked onto LB plates
supplemented with the antibiotic, chloramphenicol (LB-CA). The plates were overlayed
with a nylon filter and grown overnight at 37° C. The next morning, the bacteria were
lysed on the filters as follows: first, the filters were soaked in alkali solution for 4
minutes, followed by neutralizing solution for 4 minutes, and finally rinsed in 6X SSC for
1 minute. The filters were then baked at 80° C for 2 hours, pre-hybridized in Church and
Gilbert buffer for one hour at 65° C, and hybridized with the Ndn probe. Upon washing
and laying the filters to film, the results were used to determine which clones were

87
derived from the Ndn locus and whether the culture sent represented a pure colony from a
single clone, or a mixed culture with multiple BAC clones. The filters were then stripped
in boiling 0.5% SDS and the entire hybridization procedure was performed again with the
remaining probes.
End Sequencing BAC Clones
The BAC clones were end sequenced using the big dye termination reaction to
obtain sequences unique to the mouse genomic DNA insert. Reactions were performed
on 1 mg of BAC DNA that had been sheared by passing it five times through a 25 gauge
needle, using a modified version of the manufacturer’s instructions, with 12 pi of
sequencing buffer, 4 pi of big dye, lópmol of primer, and 2.5mM MgCl2. The reactions
were subjected to an initial 5 min. cycle at 95° C, followed by 30 cycles of 95° C for 30 s,
50° C for 10 s, and 60° C for 4 min. The completed reactions were purified from free
nucleotides using Performa DTR Gel Filtration Columns (Edge Biosystems), vacuum
dried, and sequenced by the University of Florida Center for Mammalian Genetics
Sequencing Core.
Pulse-Field Gel Electrophoresis
Pulse-field gel electorphoresis was carried out to create a rough restriction map
and tiling pathway for the BAC clones. BAC DNAs digested with the appropriate
enzymes were electrophoresed on a 1 % genetic technology grade agarose gel (Nusieve,
FMC) made with IX TBE buffer. Samples were mixed with 10X ficoll loading dye and
ran at 200V with a switch time of 1-12 seconds for 12.5 hours. This provided resolution
of bands from 6-200 kb. The gel was stained with a dilute ethidium bromide solution,
photographed, and blotted as described below.

88
Southern Blot
Agarose gels carrying 5 pg of digested genomic DNA or 1 pg of digested BAC
DNA were photographed and UV nicked for 5 minutes. The gel was soaked in Alkali
solution for 45 minutes, followed by soaking in neutralizing solution for 90 minutes. The
gel was transferred to Hybond nylon membrane (Amersham) in 10X SSC overnight. The
membrane was rinsed in 2X SSC and baked at 80° C for 2 hours. Hybridization was
carried out according to the method of Church and Gilbert. Membranes were
prehybridized in 20 ml of Church and Gilbert Buffer for 1 hour at 65° C. The
prehybridization solution was poured off and replaced with 5 ml of fresh solution and the
boiled, cooled probe. Hybridization continued overnight at 65° C. Washing was carried
out three times in 2XSSC and 0.1% SDS at 65° C for 15 minutes each.
Transgenic Mice Production
For production of transgenic mice, BAC DNA was prepared by large scale
plasmid preparation, using the alkaline lysis method. First, log phase cultures of BAC
culture grown in LB-CA were centrifuged for 5 minutes at 6,000 rpm to pellet the cells.
The supernatant was poured off and the pellet was resuspended in GTE solution plus
lysozyme. The suspension was then lysed with NaOH and SDS. After addition of the
lysis solution, the lysate was neutralized in 0.5M potassium acetate, and poured through
cotton gauze into Oak Ridge tubes. BAC DNA was precipitated with ethanol, and the
pellet was resuspended in 4 ml TE with 10 pg/ml RNAse A, and allowed to incubate at
37° C for 1 hour. Cesium chloride and ethidium bromide were added to the DNA
solution, and the solution was loaded into a heat sealable tube. The tube was sealed and
spun at 58,000 rpm for 18 hours. BAC supercoils were viewed with a UV light, and both

89
nicked and supercoiled bands were pulled. The DNA was extracted with tert-butanol
until the ethidium bromide was completely depleted from the BAC DNA. The DNA was
then dialyzed twice against 1 L TE buffer, using dialysis tubing for 6 hours each. The
concentration of the BAC DNA was then measured by spectrophotometer, and then
diluted to 2.5 ng/p.1 for microinjection.
Transgenic mice were made by pronuclear injection into oocytes that were
obtained from superovulated, fertilized, FVB/NJ female mice. The fertilized, injected
oocytes were then implanted into (B6D2) F, females that were made pseudopregnant by
mating them with vasectomized (B6D2) F, males.
Mouse Husbandry
At 3 weeks of age approximately 2mm of tail was clipped from each mouse, and
the ear was punched for identification. Genomic DNA was prepared from the tail piece
by incubation in tail lysis buffer with proteinase K (100 ng/p.1) overnight at 55° C. The
tail lysate was extracted with phenol: chloroform: isoamyl alcohol (25:24:1) and then
precipitated with ethanol. The tail DNA was screened for the presence of the transgene
by PCR using both end sequences from the BAC.
Mouse Strains
APWS-IC mice were developed in our lab 22,55 and constituted a 35 kb deletion
encompassing the sequence from 16 kb 5’ of Snrpn and 19 kb 3’ of Snrpn. These mice
were backcrossed for 10 generations to C57BL/6J males and were thus made congenie on
that strain background.
Transgenic mouse strains were originally maintained on the FVB/NJ genetic
background, but selected strains were then backcrossed for 10 generations to the

90
C57BL/6J strain background. Four strains of 454N20 transgenic mice are referred to as
454A-D, one strain of mice representing the PI clone 967 is referred to as line 1707, and
5 lines representing transgene 380J10 are referred to as 380A-E.
Results
Screening the BAC Library for Clones
The first step toward transgenic rescue was to screen a commercially available
BAC library for clones that would putatively contain the PWS genes. BAC clones were
chosen to perform the rescue as they are likely to contain all of the necessary regulatory
regions for the individual genes due to their size. They are also relatively easy to handle,
as they are propagated in bacteria, rather than yeast. Additionally, they can be modified
by homologous recombination.71'73 The Research Genetics BAC library was first
screened for clones. This library is made from the 129/SvEv strain of mouse, and the
average insert size for BAC clones is 130kb. Some clones by screening the RPCI-23
BAC library were also obtained. This library is made from a female C57BL/6J mouse.
The average insert size for this library is 200 kb and is the template for the public mouse
genome sequencing effort.
The BAC libraries were screened using probes for Ndn, Mkrn3, and the gene
formerly known as Ipw. With the first screen of the Research Genetics library, two
BACs were obtained that hybridized with the probe for Mkrn3, one of which also
hybridized with the Ndn probe. No clones for Ipw were identified. From subsequent
screenings of this library, one BAC containing Ipw, one that hybridized with a probe for
the Ube3a gene, and one that hybridized with Ndn, Mkrn3, and Magel2 were isolated.
From screening the RPCI library with the Snrpn probes, a single BAC that spanned most

91
of the distance between Snrpn and Ipw was isolated. An electronic database search also
identified a single BAC that contained the 3’ most intron to Ube3a.
Addresses for the BAC clones were determined, the BACs were ordered, and then
they were streaked out to determine their clonality and to verify the presence of the
probes that the library was screened for. The span of the individual BAC clones were
determined by end sequencing, making end probes by PCR, and using them to probe
southern blots produced from restriction digestion with rare cutting enzymes, separated
by pulse-field electrophoresis. From this it was determined that the previously published
gene order in the Ndn region was incorrect. The correct order places Magel2 between
Mkrn3 and Ndn, and in a transcriptional orientation opposite that of Mkrn3. The BACs
that were isolated were 454N20, which contains Mkrn3, Magel2, and Ndn; 205L17,
which contains Frat3 and Mkrn3; 173C16, which contains Ube3a; and 380J10, which
extends from Snrpn to the MbIl-85 snoRNA cluster (Fig 5-2).
Production and Characterization of Transgenic Mice
Once the BACs of interest had been identified and mapped, transgenic mice were
made. BAC DNA was prepared by large scale plasmid preparation, followed by cesium
chloride banding of the resulting DNA. Both nicked and supercoiled bands were pulled
and used for production of transgenic mice. It was important to have extremely fresh
BAC, as the larger BACs from Roswell Park degraded rapidly after isolation. The DNA
was injected at 2.5 ng/ul. Transgenic mice were made by pronuclear injection into
superovulated, fertilized, FVB/NJ female mice. The fertilized oocytes were then
implanted into pseudopregnant (B6D2) F, mice. When the resulting pups reached 3
weeks of age, they were tail clipped to obtain DNA and earpunched for identification.

92
The tail DNA was screened for the presence of the transgene by PCR using both end
sequences from the BAC. Four transgenic founder lines were made with BAC 454N20,
and five were made with BAC 380J10.
The transgenic founders were mated to ascertain whether or not the transgene
bred true. This indicates whether or not the founder was perhaps a chimera, and therefore
may not have the transgene present in its germline. Only one line from the 380J10 BAC
did not breed true. The established lines were then characterized for rearrangements and
copy number. Rearrangements were determined by assembling a panel of DNA from
transgenic mice digested with different restriction enzymes. The panel of cut DNAs was
used to produce Southern blots which were then probed with various probes that were
known to be on the transgene. A rearrangement was detected if a band present in a
transgenic mouse was a different size than that of a wild-type mouse. Rearrangements
were detected in lines 454B, 454C, and 380C. Copy number was determined crudely by
comparing the intensity of a band represented by both endogenous alleles and the
transgenic allele with a similarly sized band that is not located on the transgene. The
copy number was simply estimated as single copy or multi-copy. One single copy and
two multi-copy lines were obtained with the 454 transgene (the rearranged line was not
tested). For the 380J10 transgene, two single copy and two multi-copy lines were
obtained. Figure 5-3 summarizes the characterization of the transgenic lines with respect
to the copy number and integrity of the BAC transgene within each line.
Next, whether or not the individual genes were actually expressed from the
transgene in each transgenic line was determined. This was difficult because a human
transgene or a reporter construct was not used to distinguish transgenic expression from

93
endogenous expression. Instead, transgenic expression was analyzed by mating a female
transgenic mouse with a APWS-IC male. In the pups inheriting a paternal APWS-IC
allele, the paternally expressed genes are silent. If a APWS-IC male is mated with a
transgenic female, any expression of the local paternally expressed genes would be from
the transgene in pups that have both the APWS-IC allele and the transgene. The breeding
scheme for obtaining APWS-IC deletion mice that are also transgenic is shown in Figure
5-4. Expression was examined by northern blot analysis and by RT-PCR performed on
brain RNA from pups that had inherited both the transgene and the APWS-IC allele. By
northern blot, lines 454A and 454D show detectable Ndn expression from the transgene
(Figure 5-5). Probes for Magel2 and Mkrn3 did not work in Northern analysis, so they
were analyzed by RT-PCR. These genes were also expressed from the transgenes in the
454A and 454D transgenic line. Transgenic expression from lines 454A and 454D was
observed by RT-PCR for all three genes, while line 454B did not show expression of
Mkrn3, Magel2, or Ndn. For the 380 transgenic lines, Snrpn was detected by northern
analysis in 380A, 380B, and 380D (Fig 5-6). However, MbII-85, a snoRNA cluster that
is present on the transgene was only detectable by northern in line 380A, indicating that
there may be some undetected rearrangements in lines 380B and 380D (Fig 5-6).
One caveat to the expression and rearrangement data is that quantitation of the
expression level of each gene in the transgenic mice has only been ascertained in a rough
fashion. Individual genes are under the control of their native promoters and regulatory
elements since the BAC transgenes contain several kilobase pairs of flanking sequence.
Rough estimates from northern analysis of the 454 transgenes show that Ndn seems to be
expressed at near wild-type levels (Fig 5-5). In contrast, MbII-85, a snoRNA harbored on

94
the 3 80A transgenic line is expressed at a reduced level compared to wild-type as
analyzed by northern analysis (Fig 5-6). However, Snrpn expression appears to occur at
close to wild-type levels in all 380 and 1707 transgenic lines (Fig 5-6). Precise
expression level beyond that described has not seemed pertinent.
The rearrangement detection capabilities in the BAC transgenic mouse lines are
also limited. Sequences upstream of Snrpn are riddled with LINE elements and local
repeats that have precluded development of probes near the endpoints of the 454 BAC.
Similarly, the repetitive nature of the snoRNA clusters precludes development of useful
probes, and so rearrangements or breakpoints in BACs occurring 3’ of Snrpn are nearly
impossible to detect.
Transgenic Rescue Experiments: 454 Transgenic Lines
Transgenic female mice representing each 454 line were mated with males that
were heterozygous for the APWS-IC allele (Fig 5-3). When pups were bom, they were
counted each day up until weaning, and dead mice and body parts were collected as they
became available. The dead pups as well as the live pups were genotyped for the
transgene as well as the APWS-IC allele. In the case of each transgenic line assayed, no
pup survived to weaning that inherited the APWS-IC allele, even if they were also
transgenic, indicating that the 454 transgenic lines, expressing Ndn, Magel2, and Mkrn3
could not rescue the neonatal lethality phenotype.
While mice with FVB/NJ mothers harboring a paternally inherited APWS-IC
allele did not survive until weaning, they did frequently survive until 2 weeks of age. It
was eventually determined that APWS-IC could survive to adulthood if the wild-type sibs
were removed, and that surviving APWS-IC mice were smaller than their wild-type

95
littermates. While it was evident that the 454 transgenes could not completely rescue the
neonatal lethality phenotype, it could be possible that the 454 transgenes could rescue the
small stature phenotype observed in surviving APWS-IC mice. Again, 454 transgenic
females were mated with APWS-IC carrier males, but then the wild-type littermates were
removed at 2 days after birth, when they could be easily distinguished from the affected
APWS-IC pups. The wild-type pups were fostered to a separate mother from our mouse
colony so that they could be compared to the APWS-IC mice from the same litter. At
weaning time (3 weeks of age), the pups were genotyped and weighed. The pups were
again weighed once every 3 weeks until they were 15 weeks of age. Figure 5-7 shows a
graph of age in weeks versus weight in grams. The 454A, 454B, and 454D lines were not
capable of rescuing the small stature phenotype of APWS-IC mice.
Transgenic Rescue Experiments: 380 and 1707 Transgenic Lines
Similar to the 454 lines, female transgenic mice representing the three 380 lines as
well as the single PI derived line were mated with APWS-IC carrier males. Pups were
allowed to progress to weaning naturally, and dead bodies were collected. As with the
454 transgenes, the 380 and 1707 transgenic lines did not permit survival of APWS-IC
mice, suggesting that transgenes expressing Snrpn do not rescue the neonatal lethality
observed in APWS-IC mice.
The rescue mating was repeated and the wild-type pups were fostered to new
mothers to remove wild-type competition. At 2 days after birth, all of the APWS-IC mice
were readily identified, regardless of whether or not they carried a transgene. In
transgenic lines 380B, 380D, and 1707, the transgenic littermates were not
distinguishable by 3 weeks of age, either. Line 380C was not subjected to rescue

96
analysis, since Snrpn was not expressed in this line. In line 380A, however, while
transgenic APWS-IC pups were indistinguishable from non-transgenic APWS-IC pups at
birth, by 3 weeks of age the transgenic versus non-transgenic APWS-IC pups could be
separated by size. The small pups were the APWS-IC pups, while the larger pups
represented those that had inherited the 380A transgene as well as the APWS-IC allele.
Pups from each transgenic line were weighed at weaning (3 weeks of age), and then
every 3 weeks thereafter until 15 weeks of age. Figure 5-8 shows these growth charts for
the 380 and 1707 transgenic lines. The 380A transgene appears to rescue the small stature
phenotype of the surviving APWS-IC mice, but does not rescue the neonatal failure to
thrive. Furthermore, wild-type mice that are transgenic for the 380A transgene are larger
than their non-transgenic counterparts, suggesting that the 380A transgene promotes
growth. None of the other transgenes rescue the small stature or the failure to thrive on
the FVB/NJ strain background.
Discussion
BAC Isolation
BAC clones proved to be ideal for use as transgenes in the transgenic rescue
experiments for a variety of reasons. They are relatively easy to handle, being
propagated and isolated like conventional plasmids. Intriguingly, the BAC clones that
were isolated, 454N20 and 380J10, each contained multiple genes, facilitating the
attempted transgenic rescue with the known paternally expressed genes. BAC clones
containing each of the known paternally expressed genes were isolated, however, the
BAC contig has not been extended across a 1.5 Mb region that lies 5’ of Snrpn and 3’ of
Ndn. This region is highly repetitive, difficult to probe, and its size was underestimated

97
prior to the publication of the first draft of the public mouse genome sequencing project
was done. However, the NCBI sequencing efforts have now identified a BAC fingerprint
that spans this region.
Transgenic mice produced from the BAC clones represented a mix of single-copy
and multi-copy lines, with the overall efficiency of producing transgenic mice being
about 1 in 10 live births (data not shown). The transgenes in this study were also
transmitted in normal mendelian ratios (data not shown). Four transgenic lines with BAC
454N20, four lines representing BAC 380J10, and a single line from the PI clone were
produced. Lines 454A and 454D expressed Mkrn3, Magel2, and Ndn, line 454B did not
express any of the three genes contained on the BAC, and line 454C was lost during
maintenance of the strain, and was not analyzed further. Line 380A expressed Snrpn,
MbII-85, and putatively all of the snoRNAs located between those two genes, while lines
380B, 380D, and 1707 expressed only Snrpn. It is unknown whether or not these
transgenic lines express any of the single copy snoRNAs, other than Mbll-13, that lie 3’
of Snrpn.
Rearranged Transgenes
Rearranged transgenes are inevitable when making transgenic mice using our
technique, as BAC supercoils and nicked molecules from the cesium chloride banding
procedure were injected. In the nicked fraction, the nick occurs randomly with no
discernment against disruption of the mouse DNA insert. Similarly, the supercoils must
break to integrate into the mouse genome, and so this break occurs randomly. The
burden then falls on the ability to generate enough transgenic lines to obtain at least one
that is not rearranged, and then on the ability to detect rearrangements. Since gene

98
expression was the assay for whether or not a transgene was functional, only a crude
estimate of the locations of rearrangements was needed. It has also worked to our
advantage that some of the rearrangements that were obtained unwittingly produce a
deletion series for the rescuing BACs. For example, line 380A expresses Snrpn, MbII-
85, and probably the snoRNAs that lie between them, while lines 380B and 380D only
express Snrpn and some of the single-copy snoRNAs. This creates the opportunity to
differentiate between the effects of Snrpn in a transgenic rescue paradigm and Snrpn plus
MbII-85, without having to inject a different transgene.
454N20 and 380J10 transgenic lines that do not express all of the genes that are
located within their respective clones may do so for a variety of reasons. In the case of
the 454B transgenic line, a rearrangement that disrupts or deletes the promoter region of
Ndn is the most likely explanation for the inability of this line to express Ndn.
Alternatively, either a regulatory region may be physically separated from the promoter
region, resulting in disruption of Ndn transcription. Interestingly, it may be the case that
Mkrn3, Magel2, and Ndn are regulated by a common enhancer in addition to the PWS-
IC. In the case of the 380 transgenes, the Snrpn transcript has been postulated to drive
expression of the heavily spliced transcript that the snoRNAs are spliced from, so
disruption of the Snrpn promoter is not possible, since Snrpn expression seems normal in
these lines. It is probable that the BAC clone was broken 3’ of the Snrpn gene, although
this rearrangement was not detectable with any of our probes. Development of additional
probes in this region is difficult since it is highly repetitive.
The expression of MbII-85 from the 380A transgene poses a curious observation.
The expression level of this snoRNA is relatively low, compared to wild-type expression

99
levels. The 380A transgene may not contain the full MbII-85 cluster. The BAC itself
may only extend into the first few copies of MbII-85, and the expression level seen by
northern may be a result of the few copies present on the BAC. An alternate explanation
is that the repeated transgene causes some silencing of expression from the trangene,
although this is somewhat unlikely since Snrpn appears to be expressed at near wild-type
levels. It is also formally possible that lines 380B and 380D do not have a rearrangement
at all. They may express MbII-85 as well, albeit at a lower level. MbII-85 expression
may be visible solely because of the multi-copy insertion of this transgene causing
higher, more detectable expression of the MbII-85 snoRNA species.
Transgenic Rescue
That transgenic lines 454A and 454D do not rescue the neonatal lethality of the
APWS-IC mouse is possibly very interesting in light of the Ndn knockout data. Two
groups report neonatal lethality of variable penetrance in conjunction with a targeted
mutation of the Ndn gene.90,92 However, the 454 transgenes, which express Ndn, as well
as Magel2 and Mkrn3, do not rescue neonatal lethality at all. While these data may seem
at odds, it is important to remember that PWS is a contiguous gene syndrome, caused by
the disruption of two or more paternally expressed genes. The inability to rescue the
PWS phenotype with the Ndn- containing transgenes could be due to the presence of
another unidentified gene that participates in the neonatal failure to thrive phenotype.
Alternatively, the disparate results between the multiple labs creating Ndn knockouts may
be revealing in themselves in that Ndn may not contribute significantly to failure to
thrive, and that the Stewart and Muscatelli groups may be producing regulatory mutations

100
that affect genes other than Ndn. Alternately, there could still be differences in strain
backgrounds that explain this.
Nonetheless, it is important to point out that Ndn, Magel2, and Mkrn3 do not
seem to have a major role in failure to thrive or in small stature. Transgenic lines
expressing these genes do so at a level that is very close to wild-type levels and occurs
from the native promoter, so lack of rescue is not likely due to incorrect expression levels
or incorrect tissue specificity of transgenic expression. The most likely explanation is
that there is more than one gene that contributes to the failure to thrive phenotype. If this
is the case, we may have to complement with both genes in order to see rescue of the
APWS-IC phenotype. Alternatively, these three genes may be involved in some of the
behavioral phenotypes of PWS that we have not investigated in our mouse model. It is
also possible that these genes are responsible for obesity in humans, and the rescue of an
PWS-associated obesity phenotype cannot be investigated because the mouse model does
not become obese.
The ability of the 380A transgene to rescue the small stature phenotype of the
APWS-IC mice is particularly intriguing. This rescue has first allowed the separation of
the failure to thrive phenotype from the small stature seen in the APWS-IC mouse model.
Secondly, it has attributed the small stature phenotype to the MbII-85 snoRNA cluster.
Transgenic lines 380B, 380D, and 1707 each fail to rescue the small stature phenotype
suggesting that neither Snurf nor Snrpn is responsible for the small stature phenotype.
However, line 380A, the only line expressing MbII-85, does rescue this phenotype,
suggesting that MbII-85 is at least somewhat responsible for growth. This is the first
instance of a phenotype being specifically attributed to a snoRNA and assigns a function

101
to one of these illusive imprinted small RNAs in the region. It is also interesting that the
expression level required to rescue this aspect of the APWS-IC mouse is relatively low.
Many questions still remain regarding the transgenic rescue using the 380A BAC.
First of all, if the expression level of MbII-85 were occurring at a wild-type level would
the failure to thrive phenotype be ameliorated? Secondly, does 380A express the entire
MbII-85 cluster? Subcategories of the MbII-85 species exist, and it is uncertain how
many of these are included on the 380 BAC. Furthermore it is not known whether or not
the different subcategories have different functions. However, these studies show that
MbII-85 does play an important role in the PWS phenotype, indicating that the snoRNAs
warrant further investigation.
Remembering that PWS is a contiguous gene syndrome, matings between the
380A transgenic mice and 454D transgenic mice have been estabilished to obtain double
heterozygotes that can be mated to APWS-IC males. These matings will yield a small
percentage of mice that are transgenic for both 380A and 454D, but also inherit a paternal
APWS-IC allele. In these mice, the ability of Ndn, Magel2, and Mkrn3 as well as Snrpn
and MbII-85 to promote complete rescue of the PWS phenotype can be investigated.
These transgenic mice can also be used to test the ability of the various transgenes to
rescue the failure to thrive and neonatal lethality phenotypes on the C57BL/6J strain
background, since five of the transgenic lines are being made congenie on this strain..

102
x¿vx
A A
1 2-4
10
12
-H-
+/-â– â– â– 
Snrpn
Figure 5-1. Individual gene deletions in the PWS region.
I. Mkrn3 targeted disruption shows no overt phenotype46.
2-4. Ndn targeted disruption shows either neonatal lethality 89 or no overt phenotype90,92.
5. Snurf targeted disruption shows no overt phenotype91.
6. Snrpn targeted disruption shows no overt phenotype22.
7. Deletion of the PWS-IC causes neonatal lethality22.
8-9. Smaller deletions around the PWS-IC show incomplete IC deletion phenotype87.
10.A deletion spanning from Snurf to Ube3a causes neonatal lethality and small
stature91.
II. A radiation induced mutation spanning from Ipw downstream causes no overt
phenotype when paternally inherited (D. Johnson).
12.A transgene insertion that causes a large deletion of the PWS/AS region causes a
phenotype similar to the IC deletion mouse (R. Nicholls).

103
£
* £
-f
&
205A9
80 kb
454N20
150 kb
Pl-967
75 kb
380J10
170 kb
452P17
170 kb
Figure 5-2. Clones representing the PWS region. BACs or P1 clones were isolated from
129/Sv or C57BL/6J libraries. Their locations and sizes are approximated.

104
454
A - 2-4 copies, intact
B -1 copy, rearranged
C - line lost
D - 1 copy, intact
PI-967
1707 - 1 copy, intact
1737 - 2 copies, intact
380
A - 2-4 copies, intact
B - 1 copy, intact
C -1 copy, truncated
D -1 copy, intact
Figure 5-3. Transgenic lines obtained for transgenic rescue. Copy number and
intactness is indicated according to available probes.

105
Expresses all genes Expresses all genes Expresses none of the Expresses none of the
plus genes from the genes genes, except those
transgene provided by the transgene
Figure 5-4. Breeding scheme for transgenic rescue. Sex and strain are indicated where
relevant.

106
o
B
Magel2
Mkrn3
P-actin
-RT control
Figure 5-5. Ndn, Magel2, and Mkrn3 are expressed in two transgenic lines. A. Northern
blot analysis was used to investigate Ndn expression in mice that had inherited a paternal
APWS-IC allele as well as a transgene. The relevant transgenic line is listed above each lane.
5 pg of total brain RNA was loaded on a gel and the blot was probed with a portion of the
coding region for the Ndn gene. B. RT-PCR was used to investigate Magel2 and Mkrn3
in the same mice. 5 pg of RNA was used to program RT-PCR reactions.

107
B
MblI-85
MblI-52
MblI-13
Figure 5-6. Snrpn and snoRNA expression in 380 and 1707 transgenic lines. A.
Northern analysis was used to show Snrpn expression in mice that had inherited a
paternal APWS-IC allele as well as a transgene. The relevant transgenes are listed. 5
pg of total brain RNA was loaded per lane, and the blot was probed with the 5’ portion
of the Snrpn transcript. B. Northern analysis was performed for snoRNAs. 10 pg of
total brain RNA was loaded per lane on a 8% polyacrylamide gel. The blot was probed
with oligonucleotides complementary to MbII-85, MbII-52, and MbII-13.

108
E
<0
1-
O)
2:
U)
’o
5
454 Transgenic Females
12 15
Age (weeks)
18
21
24
35
30
"w 25
E
£ 20 l
3
â– 4-*
15
O)
‘53
5 10
5 -
0
454 Transgenic Males
-wt
IC deletion
IC deletion, 454A
IC deletion 454B
-IC deletion 454D
12 15 18
Age (weeks)
21
24
Figure 5-7. Transgenes harboring Mkrn3, Magel2, and Ndn do not rescue small
stature phenotype. Mice inheriting a paternal APWS-IC allele as well as a transgene
were weighed once every 3 weeks from weaning. Their age in weeks versus weight in
grams was plotted.

109
35 n
30
25 -1
V)
E
2 20
cn
o
‘5
5
15 -
10 â– 
5 -
0
380 Transgenic Females
—*—wt
IC deletion
IC deletion, 1707
IC deletion, 380A
IC deletion, 380B
IC deletion, 380D
—t—wt, 380A
12 15
Age (weeks)
18
21
24
Figure 5-8. Transgene 380A rescues small stature phenotype, but other
transgenes bearing Snrpn do not. Mice inheriting a paternal APWS-IC allele as well
as a transgene were weighed every 3 weeks beginning at weaning. Their age in weeks
is plotted versus weight in grams. Wild-type mice harboring the 380A transgene are
also shown.

CHAPTER 6
CONCLUSIONS AND FUTURE DIRECTIONS
This study of the mechanisms and phenotypes involved with PWS has contributed
much to the understanding of this disorder, yet there is still much to be learned.
However, this study demonstrates the multiple uses of a mouse model for a human
imprinting disorder and how it can be used to dissect the many intricacies associated with
a disease.
The maternally expressed genes in the AS/PWS region, UBE3A and ATP IOC,
seem mysterious since their imprinted expression seems to be limited to specific cell or
tissue types. UBE3A does not appear to behave as a classical imprinted gene, associated
with methylation imprints and tightly regulated parent-of-origin expression, and ATP IOC
has not been well studied to date. The data presented in this dissertation suggest a
possible model for imprinted expression of murine Ube3a that simplifies the regulation of
the maternally expressed genes (Fig. 2-4). The data specifically suggest that Ube3a is
negatively regulated by a paternally expressed transcript antisense to the gene and that
this transcript is positively regulated by the PWS-IC. This does not provide definitive
proof that the regulation of Ube3a imprinting occurs via the antisense transcript,
however. Termination of the antisense transcript to Ube3a could be used to prove this
hypothesis for gene regulation. Alternatively, demonstration that imprinted expression of
Ube3a coincides with the presence of the antisense transcript in a particular cell type and
that in the same cell type the absence of this transcript prevents imprinted Ube3a
110

Ill
expression would provide overwhelming evidence that this model for regulation of
Ube3a is correct. It would also be interesting to see whether AtplOc is similarly
regulated.
The imprinted transgenes identified in this study are not terribly informative with
respect to the mechanisms of imprinting in the PWS/AS region, but they do create an
attractive system in which it can be investigated in great detail. The transgenes studied
demonstrate that correct imprinting of a Snrpn transgene can occur even when they are
integrated at an ectopic site in the mouse genome. The minimal area necessary to achieve
appropriate imprinted expression is nearly 170 kb. Some data suggest that this minimal
region might be as small as 63 kb, however this must be tested in a more rigorous manner
before it can be believed. These imprinted transgenes also suggest that the AS-IC, which
has not been functionally identified in mouse, is located within 90 kb of the Snrpn gene.
These data can be used to make a targeted murine AS-IC mutation. Further experiments
along these lines include deleting the appropriate regions on the 425D18 BAC to mimic
the rearrangements seen in transgenic line 215B, with hopes of further narrowing the
minimal area sufficient to confer proper imprinting, and deleting specific elements within
the PWS-IC and AS-IC to see if they are required for imprinted expression. A marked
Snrpn locus has already been created to begin these studies.
The phenotype studies presented in this dissertation demonstrate the clinical
relevance of mouse models for PWS. The observation that there are strain dependent
differences in the phenotype of PWS mice has allowed us to investigate the adult onset
phenotypes involved with PWS. Since the affected mice can survive, behavioral tests,
obesity studies, and nutritional studies can now be carried out on these mice. Treatments

112
for the disorder can also be tested. These mice also showed a small stature phenotype
that parallels the growth deficiencies seen in humans with PWS. Perhaps the most
interesting outcome of this investigation is the identification of modifier genes that may
affect the phenotype of PWS mice. These genes may identify other genes that are
involved with PWS, helping to dissect the precise reasons that PWS infants present with
failure to thrive and poor suckle. Continued studies in this area will focus on the
identification of this modifying factor using the APWS-IC mouse to map and clone the
gene(s) responsible.
Finally, some of the most clinically relevant information has come from the
transgenic rescue experiments. Two important discoveries are presented in this study.
First, none of the known paternally expressed genes rescue the failure to thrive phenotype
in APWS-IC mice. This indicates that there are additional genes involved in the APWS-
IC phenotype that have not been identified and that Ndn deficiency in mice needs to be
further studied. Secondly, MbII-85 in concert with Snrpn, MbII-13, and other single copy
snoRNAs can rescue the small stature phenotype of APWS-IC mice. This second finding
is particularly important since the most effective therapy for PWS is growth hormone.
While the rescuing transgene alleviates small stature in APWS-IC mice, it may have other
effects, only one of which may be activation of the growth hormone pathway. The
snoRNAs on this transgene may someday provide useful therapy that can ameliorate
some of the difficulties that humans with PWS face. Additional studies will include
targeted mutation of the individual snoRNAs and perhaps more specific rescue
experiments that isolate each snoRNA. The transgenes tested in this study will also be
provided together to determine their ability to rescue the APWS-IC phenotype. The

113
possibility that the rescuing transgene may also reveal an obesity phenotype is intriguing
and warrants further study. Finally, behavioral phenotypes associated with PWS can also
be investigated using the established transgenic lines.

REFERENCES
1. Barlow, D.P. Gametic imprinting in mammals. Science 270, 1610-1613 (1995).
2. McGrath, J. & Solter, D. Completion of mouse embryogenesis requires both the
maternal and paternal genomes. Cell 37, 179-183 (1984).
3. Barton, S.C., Surani, M.A. & Norris, M.L. Role of paternal and maternal genomes
in mouse development. Nature 311, 374-376 (1984).
4. Cattanach, B.M. Parental origin effects in mice. J Embryol Exp Morphol 97, 137-
50 (1986).
5. Reik, W. & Allen, N.D. Genomic imprinting. Imprinting with and without
methylation. Curr-Biol 4, 145-7 issn: 0960-9822 (1994).
6. Buiting, K., Saitoh, S., Gross, S., Dittrich, B., Schwartz, S., Nicholls, R.D. &
Horsthemke, B. Inherited microdeletions in the Angelman and Prader-Willi
syndromes define an imprinting centre on human chromosome 15. Nature Genet.
9, 395-400 (1995).
7. Dittrich, B., Buiting, K., Korn, B., Rickard, S., Buxton, J., Saitoh, S., Nicholls,
R.N., Poustka, A., Winterpacht, A., Zabel, B. et al. Imprint switching on human
chromosome 15 may involve alternative transcripts of the SNRPN gene. Nature
Genet. 14, 163-170(1996).
8. Fúndele, R.H., Surani, M.A. & Allen, N.D. Consequences of genomic imprinting
for fetal development, in Genomic Imprinting (eds. Reik, W. & Surani, M.A.) 98-
112 (IRL/Oxford University Press, Oxford, New York, Tokyo, 1997).
9. Jaenisch, R. & Bird, A. Epigenetic regulation of gene expression: how the
genome integrates intrinsic and environmental signals. Nature Genet. Suppl. 33,
245-254 (2003).
10. Feil, R. & Kelsey, G. Genomic imprinting: A chromatin connection. Am J Hum
Genet 61, 1213-1219(1997).
11. Glenn, C.C., Porter, K.A., Jong, M.T., Nicholls, R.D. & Driscoll, D.J. Functional
imprinting and epigenetic modification of the human SNRPN gene. Hum. Mol.
Genet. 2, 2001-5 (1993).
12. Reis, A., Dittrich, B., Greger, V., Buiting, K., Lalande, M., Gillessen Kaesbach,
G., Anvret, M. & Horsthemke, B. Imprinting mutations suggested by abnormal
DNA methylation patterns in familial Angelman and Prader-Willi syndromes.
Am. J. Hum. Genet. 54, 741-7 (1994).
13. Sutcliffe, J.S., Nakao, M., Christian, S., Orstavik, K.H., Tommerup, N., Ledbetter,
D.H. & Beaudet, A.L. Deletions of a differentially methylated CpG island at the
SNRPN gene define a putative imprinting control region. Nature Genet. 8, 52-8
(1994).
14. Ledbetter, D.H., Riccardi, V.M., Airhart, S.D., Strobel, R.J., Keenan, B.S. &
Crawford, J.D. Deletions of chromosome 15 as a cause of the Prader-Willi
syndrome. N-Engl-J-Med 304, 325-9 issn: 0028-4793 (1981).
114

115
15. Jong, M.T.C., Carey, A.H., Stewart, C.L., Rinchik, E.M., Glenn, C.C., Driscoll,
D.J. & Nicholls, R.D. The ZNF127 gene encodes a novel C3H4 zinc-finger
protein and its expression is regulated by genomic imprinting. Am. J. Hum. Genet.
53, A697 (1993).
16. Jay, P., Rougeulle, C., Massacrier, A., Monda, A., Mattei, M.-G., Malzac, P.,
Roeckel, N., Taviaux, S., Lefranc, J.-L.B., Cau, P. et al. The human necdin gene,
NDN, is maternally imprinted and located in the Prader-Willi syndrome
chromosomal region. Nature Genet. 17, 357-361 (1997).
17. Leff, S.E., Brannan, C.I., Reed, M.L., Ozcelik, T., Francke, U., Copeland, N.G. &
Jenkins, N.A. Maternal imprinting of the mouse Snrpn gene and conserved
linkage homology with the human Prader-Willi syndrome region. Nature Genet.
2, 259-64 (1992).
18. Wevrick, R., Kerns, J.A. & Francke, U. Identification of a novel paternally
expressed gene in the Prader-Willi syndrome region. Hum. Mol. Genet. 3, 1877-
82 (1994).
19. Rougeulle, C., Glatt, H. & Lalande, M. The Angelman syndrome candidate gene,
UBE3AJE6-AP, is imprinted in the brain. Nature Genet. 17, 14-15 (1997).
20. Saitoh, S., Buiting, K., Rogan, P.K., Buxton, J.L., Driscoll, D.J., Amemann, J.,
Konig, R., Malcolm, S., Horsthemke, B. & Nicholls, R.D. Minimal definition of
the imprinting center and fixation of chromosome 15ql 1-ql 3 epigenotype by
imprinting mutations. Proc. Natl. Acad. Sci. USA 93, 7811-7815 (1996).
21. Cattanach, B.M., Barr, J.A., Evans, E.P., Burtenshaw, M., Beechey, C.V., Leff,
S.E., Brannan, C.I., Copeland, N.G., Jenkins, N.A. & Jones, J. A candidate mouse
model for Prader-Willi syndrome which shows an absence of Snrpn expression.
Nature Genet. 2, 270-4 (1992).
22. Yang, T., Adamson, T.E., Resnick, J.L., Leff, S., Wevrick, R., Francke, U.,
Jenkins, N.A., Copeland, N.G. & Brannan, C.I. A mouse model for Prader-Willi
syndrome imprinting-centre mutations. Nature Genet. 19, 25-31 (1998).
23. Holm, V.A., Cassidy, S.B., Butler, M.G., Hanchett, J.M., Greenswag, L.R.
Whitman, B.Y. and Greenberg, F. Prader-Willi syndrome: Consensus Diagnostic
Criteria. Pediatrics 91, 398-402 (1993).
24. Clayton-Smith, J. & Pembrey, M.E. Angelman syndrome. Med. Genet. 29, 412-
415 (1992).
25. Cassidy, S.B. & Ledbetter, D.H. Prader-Willi syndrome. Neurol-Clin 7, 37-54
issn: 0733-8619 (1989).
26. Nicholls, R.D., Saitoh, S. & Horsthemke, B. Imprinting in Prader-Willi and
Angelman syndromes. Trends Genet. 14, 194-200 (1998).
27. Butler, M.G. & Palmer, C.G. Parental origin of chromosome 15 deletion in
Prader-Willi syndrome [letter]. Lancet 1, 1285-6 issn: 0140-6736 (1983).
28. Nicholls, R.D., Knoll, J.H., Butler, M.G., Karam, S. & Lalande, M. Genetic
imprinting suggested by maternal heterodisomy in nondeletion Prader-Willi
syndrome. Nature 342, 281-5 (1989).
29. Magenis, R.E., Brown, M.G., Lacy, D.A., Budden, S. & LaFranchi, S. Is
Angelman syndrome an alternate result of del(15)(ql lql3)? Am-J-Med-Genet 28,
829-38 issn: 0148-7299 (1987).

116
30. Knoll, J.H., Nicholls, R.D. & Lalande, M. On the parental origin of the deletion in
Angelman syndrome. Hum-Genet 83, 205-7 (1989).
31. Malcolm, S., Clayton Smith, J., Nichols, M., Robb, S., Webb, T., Armour, J.A.,
Jeffreys, A.J. & Pembrey, M.E. Uniparental paternal disomy in Angelman's
syndrome. Lancet 337, 694-7 (1991).
32. Knoll, J.H., Glatt, K.A., Nicholls, R.D., Malcolm, S. & Lalande, M. Chromosome
15 uniparental disomy is not frequent in Angelman syndrome. Am-J-Hum-Genet
48, 16-21 issn: 0002-9297 (1991).
33. Cox, G.F., Burger, J., Lip, V., Mau, U.A., Sperling, K., Wu, B.L. & Horsthemke,
B. Intracytoplasmic sperm injection may increase the risk of imprinting defects.
Am J Hum Genet 71, 162-164 (2002).
34. Kishino, T., Lalande, M. & Wagstaff, J. UBE3AJE6-AP mutations cause
Angelman syndrome. Nature Genet. 15, 70-73 (1997).
35. Matsuura, T., Sutcliffe, J.S., Fang, P., Galjaard, R.-J., Jiang, Y.-H., Benton, C.S.,
Rommens, J.M. & Beaudet, A.L. De novo truncating mutations in E6-AP
ubiquitin-protein ligase gene (UBE3A) in Angelman syndrome. Nature Genet. 15,
74-77(1997).
36. Meguro M, K.A., Mitsuya K, Nakao M, Kondo I, Saitoh S, Oshimura, M. A novel
maternally expressed gene, ATP 10C encodes a putative aminophospholipid
translocase associated with Angelman syndrome. Nature Genet. 28, 19-20 (2001).
37. Ohta, T., Gray, T.A., Rogan, P.K., Buiting, K., Gabriel, J.M., Saitoh, S.,
Muralidhar, B., Bilienska, B., Krajewska-Walasek, M., Driscoll, D.J. et al.
Imprinting-mutation mechanisms in Prader-Willi syndrome. Am. J. Hum. Genet.
64, 397-413 (1999).
38. Ohta, T., Buiting, K., Kokkonen, H., McCandless, S., Heeger, S., Leisti, H.,
Driscoll, D.J., Cassidy, S.B., Horsthemke, B. & Nicholls, R.D. Molecular
mechanism of Angelman syndrome in two large families involves an imprinting
mutation. Am. J. Hum. Genet. 64, 385-396 (1999).
39. Ozcelik, T., Leff, S., Robinson, W., Donlon, T., Lalande, M., Sanjines, E.,
Schinzel, A. & Franke, U. Small nuclear ribonucleoprotein polypeptide N
(SNRPN), an expressed gene in the Prader-Willi syndrome critical region. Nature
Genet. 2, 265-269(1992).
40. MacDonald, H.R. & Wevrick, R. The necdin gene is deleted in Prader-Willi
syndrome and is imprinted in human and mouse. Hum. Mol. Genet. 6, 1873-1878
(1997).
41. Rougeulle, C., Cardoso, C., Fontes, M., Colleaux, L. & Lalande, M. An imprinted
antisense RNA overlaps UBE3A and a second maternally expressed transcript.
Nature Genet. 19, 15-16 (1998).
42. Boccaccio, I., Glatt-Deeley, H., Watrin, F., Roeckel, N., Lalande, M. &
Muscatelli, F. The human MAGEL2 gene and its mouse homologue are paternally
expressed and mapped to the Prader-Willi region. Hum. Molec. Genet. 8, 2497-
2505 (1999).
43. Cavadle, J., Buiting, K., Kiefman, M., M., L., C.I., B., Horsthemke, B.,
Bachellerie, J.-P., Brosius, J. & Hiittenhoffer, A. Identification of brain-specific
and imprinted small nucleolar RNA genes exhibiting an unusual genomic
organization. Proc. Nat. Acad. Sci. USA 97, 14311-6 (2000).

117
44. de los Santos, T., Schweizer, J., Rees, C.A. & Francke, U. Small evolutionarily
conserved RNA, resembling C/D box small nucleolar RNA, is transcribed from
the PWCR1, a novel imprinted gene in the Prader-Willi deleted region, which is
highly expressed in the brain. Am. J. Hum. Genet. 67, 1067-1082 (2000).
45. Knoll, J.H., Nicholls, R.D., Magenis, R.E., Graham, J.M., Jr., Lalande, M. & Latt,
S.A. Angelman and Prader-Willi syndromes share a common chromosome 15
deletion but differ in parental origin of the deletion. Am. J. Med. Genet. 32, 285-
90 (1989).
46. Jong, M.T., Carey, A.H., Caldwell, K.A., Lau, M.H., Handel, M.A., Driscoll,
D.J., Stewart, C.L., Rinchik, E.M. & Nicholls, R.D. Imprinting of a RING zinc-
finger encoding gene in the mouse chromosome region homologous to the Prader-
Willi syndrome genetic region. Hum. Mol. Genet. 8, 795-803 (1999).
47. Wevrick, R. & Francke, U. An imprinted mouse transcript homologous to the
human Imprinted in Prader-Willi syndrome (IPW) gene. Hum. Molec. Genet. 6,
325-332(1997).
48. Albrecht, U., Sutcliffe, J.S., Cattanach, B.M., Beechy, C.V., Armstrong, D.,
Eichele, G. & Beaudet, A.L. Imprinted expression if the murine Angelman
syndrome gene, Ube3a, in hippocampal and Purkinje neurons. Nature Genet. 17,
75-78 (1997).
49. Mascan, M.J., Gottlieb, W., Rogan, P.K., Butler, M.G., Waller, D.A., Armour,
J.A., Jeffreys, A.J., Ladda, R.L. & Nicholls, R.D. The frequency of uniparental
disomy in Prader-Willi syndrome. Implications for molecular diagnosis. N. Engl.
J. Med. 326, 1599-607 (1992).
50. Donlon, T.A. Similar molecular deletions on chromosome 15ql 1.2 are
encountered in both the Prader-Willi and Angelman syndromes. Hum-Genet 80,
322-328 (1988).
51. Nicholls, R.D. Genomic imprinting and uniparental disomy in Angelman and
Prader-Willi syndromes: a review. Am-J-Med-Genet 46, 16-25 issn: 0148-7299
(1993).
52. Chan, C.T., Clayton Smith, J., Cheng, X.J., Buxton, J., Webb, T., Pembrey, M.E.
& Malcolm, S. Molecular mechanisms in Angelman syndrome: a survey of 93
patients. J-Med-Genet 30, 895-902 issn: 0022-2593 (1993).
53. Vu, T.H. & Hoffman, A.R. Imprinting of the Angelman syndrome gene, UBE3A,
is restricted to the brain. Nature Genet. 17, 12-13 (1997).
54. Mowery-Rushton, P.A., Driscoll, D.J., Nicholls, R.D., Locker, J. & Surti, U.
DNA methylation patterns in human tissues of uniparental origin using a zinc-
finger gene (ZNF127) from the Angelman/Prader-Willi region. Am J Med Genet
61, 140-146(1996).
55. Bielinska, B., Blaydes, S.M., Buiting, K., Yang, T., Krajewska-Walasek, M.,
Horsthemke, B. & Brannan, C.I. De novo deletions of SNRPN exon 1 in early
human and mouse embryos result in a paternal to maternal imprint switch. Nature
Genet. 25, 74-8 (2000).
56. Wakeland, E.K., Morel, L., Achey, K., Yui, M. & Longmate, J. Speed congenies:
A classic technique in the fast lane (relatively speaking). Immunology Today 18,
472-477 (1997).

118
57. Brannan, C.I. & Bartolomei, M.S. Mechanisms of genomic imprinting. Curr Opin
Genet Dev 9, 164-70(1999).
58. Schedl, A., Montoliu, L., Kelsey, G. & Schütz, G. A yeast artificial chromosome
covering the tyrosinase gene confers copy number-dependent expression in
transgenic mice. Nature 362, 258-261 (1993).
59. Montoliu, L., Umland, T. & Schütz, G. A locus control region at -12 kb of the
tyrosinase gene. EMBO 15, 6026-6034 (1996).
60. Fraser, P., Pruzina, S. & Grosveld, F. Each hypersensitive site of the human |3-
globin locus control region confers a different developmental pattern of
expression to the globin genes. Genes & Dev. 7, 106-113 (1993).
61. Peterson KR, C.C., Huxley C, Josephson BM, Haugen HS, Furukawa T,
Stamatoyannopoulos G. Transgenic mice containing a 248-kb yeast artificial
chromosome carrying the human P-globin locus display proper developmental
control of human globin genes. Proc. Nat. Acad. Sci. USA 90, 7593-7597 (1993).
62. Bungert, J., Dave, U., Lim, K.-C., Shavit, J.A., Liu, Q. & Engel, J.D. Synergistic
regulation of human b-globin gene switching by locus control region elements
HS3 and HS4. Genes & Dev. 9, 3083-3096 (1995).
63. Wutz, A., Smrzka, O.W., Schweifer, N., Schellander, K., Wagner, E.F. & Barlow,
D.P. Imprinted expression of the Igf2r gene depends on an intronic CpG island.
Nature 389, 745-749 (1997).
64. Bartolomei, M.S., Webber, A.L., Brunkow, M.E. & Tilghman, S.M. Epigenetic
mechanisms underlying the imprinting of the mouse H19 gene. Genes Dev. 7,
1663-73 (1993).
65. Pfeifer, K., Leighton, P.A. & Tilghman, S.M. The structural H19 gene is required
for transgene imprinting. Proc. Natl. Acad. Sci. USA 93, 13876-13883 (1996).
66. Hark AT, S.C., Katz DJ, Ingram RS Levorse JM, Tilghman SM. CTCF mediates
methylation-sensitive enhancer-blocking activity at the H19/Igf2 locus. Nature
405, 486-489 (2000).
67. Cranston MJ, S.T., Elson DA, Bartolomei MS. Elucidation of the minimal
sequence required to imprint H19 transgenes. Genomics 73, 98-107 (2001).
68. Ainscough, J.F.-X., Koide, T., Tada, M., Barton, S. & Surani, A. Imprinting of
Igf2 and H19 from a 130 kb YAC transgene. Development 124, 3621-3632
(1997).
69. Bell AC, F.G. Methylation of a CTCF-dependent boundary controls imprinted
expression of the Igjl gene. Nature 405, 482-485 (2000).
70. Blaydes, S.M., Elmore, M., Yang, T. & Brannan, C.I. Analysis of murine Snrpn
and human SNRPN gene imprinting in transgenic mice. Mamm. Genome 10, 549-
555 (1999).
71. Yang, X.W., Model, P. & Heintz, N. Homologous recombination based
modification in Esherichia coli and germline transmission in transgenic mice of a
bacterial artificial chromosome. Nature Biotechnology 15, 859-865 (1997).
72. Zhang Y, B.F., Muyrers JPP, Stewart AF. A new logic for DNA engineering
using recombination in Escherichia coli. Nature Genet. 20, 123-128 (1998).
73. Lee EC, Y.D., de Velasco JM, Tessarollo L, Swing DA, Court DL, Jenkins NA,
Copeland NG. A highly efficient Escherichia coli-based chromosome engineering

119
system adapted for recombinogenic targeting and subcloning of BAC DNA.
Genomics 73, 56-65 (2001).
74. Holm, V.A., Cassidy, S.B., Butler, M.G., Hanchett, J.M., Greenswag, L.R.,
Whitman, B.Y. & Greenberg, F. Prader-Willi syndrome: consensus diagnostic
criteria. Pediatrics 91, 398-402 (1993).
75. Nicholls, R.D., Knoll, J.H., Glatt, K., Hersh, J.H., Brewster, T.D., Graham, J.M.,
Jr., Wurster Hill, D., Wharton, R. & Latt, S.A. Restriction fragment length
polymorphisms within proximal 15q and their use in molecular cytogenetics and
the Prader-Willi syndrome. Am. J. Med. Genet. 33, 66-77 (1989).
76. Robinson, W.P., Bottani, A., Xie, Y.G., Balakrishman, J., Binkert, F., Machler,
M., Prader, A. & Schinzel, A. Molecular, cytogenetic, and clinical investigations
of Prader-Willi syndrome patients. Am. J. Hum. Genet. 49, 1219-34 (1991).
77. Magenis, R.E., Toth Fejel, S., Allen, L.J., Black, M., Brown, M.G., Budden, S.,
Cohen, R., Friedman, J.M., Kalousek, D., Zonana, J. et al. Comparison of the 15q
deletions in Prader-Willi and Angelman syndromes: specific regions, extent of
deletions, parental origin, and clinical consequences. Am. J. Med. Genet. 35, 333-
49 (1990).
78. Williams, C.A., Zori, R.T., Stone, J.W., Gray, B.A., Cantu, E.S. & Ostrer, H.
Maternal origin of 15ql 1-13 deletions in Angelman syndrome suggests a role for
genomic imprinting. Am. J. Med. Genet. 35, 350-3 (1990).
79. Nicholls, R.D., Pai, G.S., Gottlieb, W. & Cantu, E.S. Paternal uniparental disomy
of chromosome 15 in a child with Angelman syndrome. Ann. Neurol. 32, 512-518
(1992).
80. Nicholls, R.D. New insights reveal complex mechanisms involved in genomic
imprinting. Am. J. Hum. Genet. 54, 733-40 (1994).
81. Jong, M.T., Gray, T.A., Ji, Y., Glenn, C.C., Saitoh, S., Driscoll, D.J. & Nicholls,
R.D. A novel imprinted gene, encoding a RING zinc-finger protein, and
overlapping antisense transcript in the Prader-Willi syndrome critical region.
Hum. Mol. Genet. 8, 783-793 (1999).
82. Reed, M.L. & Leff, S.E. Maternal imprinting of human SNRPN, a gene deleted in
Prader-Willi syndrome. Nature Genet. 6, 163-7 (1994).
83. Runte, M., Huttenhofer, A., Gross, S., Kiefmann, M., Horsthemke, B. & Buiting,
K. The IC-SNURF-SNRPN transcript serves as a host for multiple small nucleolar
RNA species and as an antisense RNA for Ube3a. Hum. Mol. Genet. 10, 2687-
2700 (2001).
84. Lee, S., Kozlov, S., Hernandez, L. Chamberlain, S.J., Brannan, C.I., Stewart,
C.L., and Wevrick, R. Expression and imprinting of MAGEL2 suggest a role in
Prader-Willi syndrome and the homologous murine imprinting phenotype. Hum.
Mol. Genet. 9, 1813-1819 (2000).
85. Sun, Y., Nicholls, R.N., Bulter, M.G., Saitoh, S., Hainline, B.E. & Palmer, C.G.
Breakage in the Snrpn locus in a balanced 46,XY,t(15;19) Prader-Willi syndrome
patient. Hum. Molec. Genet. 5, 517-524 (1996).
86. Muralidhar, B., Mamey, A. & Butler, M.G. Analysis of imprinted genes in
subjects with Prader-Willi syndrome and chromosome 15 abnormalities. Genet.
Med. 1, 141-145 (1999).

120
87. Bressler, J., Tsai, T., Ramirez, M., Armstrong, D. & Beaudet, A. The SNPRN
promoter is not required for genomic imprinting of the Prader-Willi/Angelman
domain in mice. Nature Genet. 28, 232-240 (2001).
88. Budarf ML, E.B. Progress in the autosomal segmental aneusomy dyndromes
(SASs): single or multi-locus disorders? Hum. Mol. Genet. 6, 1657-1665 (1997).
89. Tsai TF, A.D., Beaudet, AL. Necdin-deficient mice do not show lethality or the
obesity and infertility of Prader-Willi syndrome. Nature Genet. 22, 15-16 (1999).
90. Gerard M, H.L., Wevrick R, Stewart CL. Disruption of the mouse necdin gene
results in early post-natal lethality. Nature Genet. 23, 199-202 (1999).
91. Tsai TF, J.Y., Bressler J, Armstrong D, Beaudet, AL. Paternal deletion from
Snrpn to Ube3a in the mouse causes hypotonia, growth retardation, and partial
lethality and provides evidence for a gene contributing to Prader-Willi syndrome.
Hum. Mol. Genet. 8, 1357-1364 (1999).
92. Muscatelli, F., Abrous, D.N., Massacrier, A., Boccaccio, I., Le Moal, M., Cau, P.
& Cremer, H. Disruption of the mouse Necdin gene results in hypothalamic and
behavioral alterations reminiscent of the human Prader-Willi syndrome. Hum.
Mol. Genet. 9, 3101-3110 (2000).

BIOGRAPHICAL SKETCH
Stormy Jo Chamberlain was born in Moscow, Idaho and grew up on a very nice
tractor in the middle of nowhere near Casper, Wyoming. She graduated from Natrona
County High School in Casper, Wyoming in 1993. She then received her B.A. degree in
Molecular Biology from Princeton University in 1997. Stormy entered the
Interdisciplinary Program in Biomedical Sciences at the University of Florida in 1997.
121

I certify that I have read this study and that in my opinion it conforms to
acceptable standards of scholarly presentation and is fully adequate, in scope and quality,
as a dissertation for the degree of Doctor of Philosophy.
James Resnick, Chair
Associate Professor of Molecular Genetics and
Microbiology
I certify that I have read this study and that in my opinion it conforms to
acceptable standards of scholarly presentation and is fully adequate, in scope and quality,
as a dissertation for the degree of Doctor ofphilosophy.
Daniel J. Driscoll
Professor of Molecular Genetics and Microbiology
I certify that I have read this study and that in my opinion it conforms to
acceptable standards of scholarly presentation and is fully adequate, in scope and quality,
as a dissertation for the degree of Doctor of Philosophy.
Richard Moyer,
Professor of Molecular Genetics and Microbiology
I certify that I have read this study and that in my opinion it conforms to
acceptable standards of scholarly presentation and is fully adequate, in scope and quality,
as a dissertation for the degree of Doctor of Philosophy.
Assistant Professor of Biochemisty and Molecular
Biology

I certify that I have read this study and that in my opinion it conforms to
acceptable standards of scholarly presentation and is fully adequate, in scope and quality,
as a dissertation for the degree of Doctor of Philosophy.
Laurence Morel
Assistant Professor of Pathology, Immunology, and
Laboratory Medicine
I certify that I have read this study and that in my opinion it conforms to
acceptable standards of scholarly presentation and is fully adequate, in scope and quality,
as a dissertation for the degree of Doctor of Philosophy.
Mark Lewis
Professor of Neuroscience
This dissertation was submitted to the Graduate Faculty of the College of
Medicine and to the Graduate School and was accepted as partial fulfillment of the
requirements for the degree of Doctor of Philosophy.
May 2003
¿ —
Dean, College of Medicine
Dean, Graduate School