Citation
Important nucleotide sequences involved in latency of DNA viruses of animals

Material Information

Title:
Important nucleotide sequences involved in latency of DNA viruses of animals
Creator:
Rayfield, Mark A., 1953-
Publication Date:
Language:
English
Physical Description:
viii, 98 leaves : ill. ; 29 cm.

Subjects

Subjects / Keywords:
DNA ( jstor )
Ganglia ( jstor )
Gels ( jstor )
Genomes ( jstor )
Human herpesvirus 1 ( jstor )
Infections ( jstor )
RNA ( jstor )
Simplexvirus ( jstor )
Viral DNA ( jstor )
Virology ( jstor )
Dissertations, Academic -- Immunology and Medical Microbiology -- UF ( mesh )
Herpes Simplex -- genetics ( mesh )
Immunology and Medical Microbiology thesis Ph.D ( mesh )
Simplexvirus -- genetics ( mesh )
Genre:
bibliography ( marcgt )
theses ( marcgt )
non-fiction ( marcgt )

Notes

Thesis:
Thesis (Ph. D.)--University of Florida.
Bibliography:
Includes bibliographical references (leaves 88-97).
Additional Physical Form:
Also available online.
General Note:
Photocopy of typescript.
General Note:
Vita.
Statement of Responsibility:
by Mark A. Rayfield.

Record Information

Source Institution:
University of Florida
Holding Location:
University of Florida
Rights Management:
Copyright [name of dissertation author]. Permission granted to the University of Florida to digitize, archive and distribute this item for non-profit research and educational purposes. Any reuse of this item in excess of fair use or other copyright exemptions requires permission of the copyright holder.
Resource Identifier:
028969960 ( ALEPH )
09301041 ( OCLC )

Downloads

This item has the following downloads:


Full Text










IMPORTANT NUCLEOTIDE SEQUENCES INVOLVED IN
LATENCY OF DNA VIRUSES OF ANIMALS




















By

Mark A. Rayfield


A DISSERTATION PRESENTED TO THE GRADUATE COUNCIL
OF THE UNIVERSITY OF FLORIDA
PARTIAL FULFILLMENT OF THE REQUIREMENTS
FOR THE DEGREE OF DOCTOR OF PHILOSOPHY

UNIVERSITY OF FLORIDA
1982

































Copyright 1982

by
Mark A. Rayfield













This work is dedicated to my family: to my parents Martin and

Fran whose sacrifices made it all possible, to Glenn who shared the

lean years and to my wife Dot for her loving support of a very tired

and grouchy graduate student.....














ACKNOWLEDGEMENTS


I would like to acknowledge the efforts of Tess Korhnak and Dr.

Vishwanath Suryanarayanan with whom I've had the good fortune to be

associated during these studies. I would also like to take this oppor-

tunity to express my appreciation to the members of my advisory committee,

especially Dr. Kenneth I. Berns. A warm thanks is extended to Drs. Bill

Hauswirth, Bill Hollowman and Phil Laipis who have continually supplied

good natured advice and whose laboratories have been a warehouse of

materials and equipment. Finally, I would like to thank my wife Dot and

Gail Crummer, a masochist but dear friend, for their selfless contribu-

tions to the organization and drafting of this manuscript.













TABLE OF CONTENTS

SECTION PAGE

ACKNOWLEDGEMENTS . . . . . . . . . . . . iv

ABSTRACT . . . . . . . . . . . . . . vii

INTRODUCTION . . . . . . . . . . . . . 1

Molecular Biology of HSV . . . . . . . . 7
Genome Size and Composition . . . . . . . . 7
Nucleotide Sequence Arrangement. . . . . . .. 10
Endonuclease Cleavage Map . . . . . . . .. 13
Transcription . . . . . . . . . . . 14

MATERIALS AND METHODS . . . . . . . . . .. 20

Purification of Ganglion Cell DNA and RNA . . . .. 20
Viral DNA Purification . . . . . . . . . 20
Preparation of Cloned DNA . .. . . . . . . 22
DNA Restriction....... .. . . . . . . . 26
Gel Electrophoresis . . . . . . . . . 26
Isolation of Endonuclease Cleavage Products . . . .. 27
Mapping Approach . . . . . . . . . .. 28
Nick Translation . . . . . . . . . . 30
lodination of Cytoplasmic RNA . . . . . . .. 31
5' End Labeling Reactions . . . . . . . .. 31
Southern Blots . . . . . . . . . . 32
Hybridization Reaction . . . . . . . . .. 33

RESULTS . . . . . . . . . . . . . . 35

Experimental Approach .. . . . . . . ....... ... 35
Controls ............. ..... ....... . 37
Hybridization of Ganglia Nucleic Acids to HSV DNA ..... 41
CsCl Enrichment Studies ........ ............ .... 44
Mapping the L/S junction of HSV-1 F strain ......... .. 49

HYBRIDIZATIONS . . . . . . . . . . . . 59

Hybridization of ganglia RNA to the L/S junction ... 59
Cross Hybridization Experiments . . . . . . .. 60

DISCUSSION . . . . . . . . . . . .. .75








LIST OF REFERENCES . . . . . . . . . . . 88

BIOGRAPHICAL SKETCH . . . . . . . . . .. 98













Abstract of Dissertation Presented to the Graduate Council
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy


I.IPOPTArIlT NUCLEOTIDE SEQUENCES INVOLVED IN
LATENCY OF DNA VIRUSES OF ANIMALS


By


Mark A. Rayfield


December 1982

Chairman: Kenneth I. Berns, Ph.D., M.D.
Major Department: Immunology and Medical Microbiology


We have investigated the molecular status of the Herpes simplex

virus (HSV) genome in latently infected human trigeminal ganglia. The

general aim of this research is to illuminate the genetics of viral

latency during recurrent infections in man. The trigeminal ganglia of

22 patients have been assayed for HSV sequences by DNA/DNA or RNA/DNA

hybridization. None of the patients manifested clinical evidence of

recurrence at the time of death nor was a history of recurrent HSV

lesions noted. Fourteen of the patients were sero-positive for HSV.

Positive serology was assessed as a complement fixation titer of 1:8 or

greater. In 18 of the 22 assays in which trigeminal ganglia were evalu-

ated for the presence of HSV, total ganglionic DNA was cleaved by endo-

nuclease digestion, transferred to nitrocellulose and probed with rich

nick-translated HSV DNA. The nucleic acid from two of the sero-positive

vii








patients failed to demonstrate HSV specific sequences in either DNA or

RNA. Only one of the eight sero-negative patients gave evidence of the

presence of HSV DNA or RNA, the remainder were negative. Thus, there is

a positive correlation between the presence of complement fixing anti-

bodies and the presence of sequestered HSV specific sequences as

measured by these techniques. Further, from the mapping of those RNA

transcripts observed, it is clear that the regions of the genome most

frequently encountered to date are those containing sequences in the

immediate early and early mRNA species of HSV-1.


viii













INTRODUCTION


The involvement of herpes simplex virus (HSV) in recurrent infection

of man is well documented. These recurrences are most frequently mani-

fested as periodic ulcerations of the oral or genital mucosa and infections

of adjacent cutaneous tissues. Recurrent herpetic keratitis is, today,

the most common severe ocular infection in the United States and is the

principle factor involved in blinding corneal disease. Ocular infections

in 50% of the patients experiencing a primary episode will recur within

2 years. Latent virus is the probable source of infection producing

acute episodes of HSV encephalitis and meningitis in adults. It also

serves as a reservoir for virus involved in generalized herpetic infec-

tions in newborns and is potentially involved in carcinoma of the cervix.

Several lines of evidence suggest the involvement of neural tissue

with viral latency in man. Repetitive infections generally occur in

localized tissues which define together the limits of a region inner-

vated by a single sensory ganglia. Trauma to the sensory nerve will

consistently induce a viral recurrence in peripheral tissue. Reactiva-

tion occurs in greater than 90% of the patients undergoing root sections

of the trigeminal nerve; none is observed after trauma to tissue pre-

viously denervated (Carton and Kilborne, 1952). A majority of the patients

who reactivate following neurosurgical treatment for trigeminal neuralgia

have a history of recurrent herpes labialis (Pazin et al., 1978). While

such observations are only indirect evidence that neural tissue is the

site of latency, it is noteworthy that the significant efforts by






2
investigators to demonstrate virus in peripheral tissues during quiescent

periods have failed (Rustigan et al., 1966; Baringer, 1975)..

HSV can be liberated from cultures of latently infected trigeminal

ganglia from unselected humans (Bastian et al., 1972"; Baringer, 1974).

Using tissue cocultivation with HSV susceptible cell lines or organotypic

cultures for periods of 10-45 days in vitro, the vagus, sacral and

superior cervical ganglia may also be shown to harbor virus in some

individuals (Baringer 1974, 1975; Wlarren et al., 1978; Lonsdale et al.,

1979). EM studies show virions and cytopathology similar to that of HSV

in such cultures. The virus isolated may be identified as HSV on the

basis of both serologic (Bastian et al., 1972; Baringer, 1975) and genetic

criteria (Lonsdale et al., 1979). Similar culture techniques fail to

yield virus from the choroid plexus, trigeminal nerve root or cutaneous

tissues from known positive individuals. This argues that the ganglion

may be the sole site of latency.

Several parameters of latency can be envisioned from studies of

the virus yielded from explants. Serological evaluations of isolates

suggest that the virus remains phenotypically unaltered during latency;

reactivated virus may at some point spread to adjacent ganglia and

become latent in these; ganglia innervating remote peripheral sites may

infrequently become latent with seriologically distinct strains of the

virus; finally, both HSV type I and II may be latent and recur within the

same individual (Stevens and Cook, 1971; Baringer, 1975). Analysis of the

restriction endonuclease digestion patterns of their DNIA and gel electro-

phoresis patterns of isolates proteins confirms these observations

(Lonsdale et al., 1979; Buchman et al., 1978). Further, such studies

have shown that the isolates were unique to an individual unless they








were epidemiologically related and that within the individual multiple

isolates from different ganglia were usually genetically identical.

Infection of peripheral ganglia appears to be subsequent to viral spread

from the site of initial infection in a majority of individuals. These

observations suggest that once a sensory ganglion cell becomes latently

infected it is to some degree refractory to superinfection by a future

viral isolate. Complementation studies involving superinfection of

ganglia with temperature sensitive mutants of HSV indicate that many

harbor defective or parital viral genomes (Brown et al., 1979).

Currently two animal models exist for neural latency of HSV. Virus

inoculation in the foot pad of mice gives rise to a subsequent infection

of the spinal ganglia (Stevens and Cook, 1971)o This infection is

biphasic. A primary acute infection occurs during which high titers of

virus are found in spinal fluid and tissues. Virus titers then subside

and a chronic phase of infection follows. During this period virus may

only be demonstrated by maintenance of ganglia explants in organotypic

cultures. The chronic period probably most closely mirrors the quiescent

periods in many, but the mouse is not clearly known to undergo recurrence.

Intraocular inoculation of rabbits leads to viral spread and involvement

of the trigeminal ganglia (Stevens and Cook, 1972; Goodpasture 1929).

The infected globe will thereafter undergo periods of quiescence and

recurrent infections.

Several parallels can be drawn between chronically infected murine

neural tissue and latently infected human ganglia. Only the spinal

ganglia associated with sciatic nerves, innervating the site of inocula-

tion, harbor HSV. The virus can be demonstrated by immunofluorescence

and electron microscopy after explanation and in vitro maintenance in








organ cultures. Cultures of the sciatic nerve trunk, thoracic spinal

cord and medulla oblongata do not yield virus. Persistently infected

mice also possess neutralizing antibodies to HSV (Stevens and Cook, 1971).

The lack of virus-specific products during the chronic periods suggests

that the HSV genome may exist as a subviral unit in ganglionic cells.

Searches for products of viral replication in latent tissue confirm

the hypothesis that few ganglionic cells are directly involved with

persistence. In chronically infected mice less than 0.1% of the

ganglionic cells will act as infectious centers for the virus and those

cells positive in fluorescent antibody assays are in the great minority

(Walz et al., 1976; Stevens and Cook, 1972). The presence of HSV-

specific thymidine kinase activity in the absence of late viral protein

markers may indicate an early termination of viral replication in

chronically infected murine ganglia (Yamamoto et al., 1977). It is also

possible that some species of mRNA are very stable or that transcription

continues from "remnants" of the viral genome in some cells.

HSV initially inoculated into the mouse via the ear can be stimu-

lated to reactivate through localized minor trauma to the ear (Hill et

al., 1975). During the quiescent periods in this recurrence model, virus

is absent from the peripheral tissue, but can be found in the 2nd, 3rd

and 4th cervical ganglia. Several forms of stimuli are effective: UV

light, cellophane tape, and stripping or swabbing the ear with xylene.

All such agents produce a localized inflammatory response and provoke

increased levels of prostaglandins within the skin. It is uncertain

what role these factors may play during recurrence. It is clear that

the effective agents do induce changes within the ganglia as evidenced

by increases in infectious virus and tritiated thymidine uptake within

the ganglia 2 to 4 days following trauma to the ear (Hill et al., 1975).





5

Similar observations have been made in HSV latently infected rabbits.

In this model, viral spread may be clearly followed from the site of

inoculation to the peripheral nervous system and then to the central

nervous system in individuals where meningitis and encephalitis ensue.

At each level of spread the infection is first manifest in neurons and

then adjacent supportive cells, such as Schwann cells or satellite cells

(Goodpasture 1929; Baringer et al., 1974). The rate of viral spread

within the nerve trunk approaches that of retrograde transport of pro-

teins within the ganglia (Stevens 1975). The kinetics of viral infection

and the presence of virus in intra-axonal vesicles has prompted investi-

gators to propose that intra-axonal transport is the principal mode of

viral spread (Cook and Stevens, 1973; Kristensson et al., 1974; Baringer

1975). Seventy percent of the trigeminal ganglia in latent rabbits yield

virus upon explant while cultures of the conjunctiva, lacrimal gland,

cornea, iris, fifth cervical nerve and brain tissue are negative. Immuno-

flourescent antibody studies on serial sections of rabbit trigeminal

ganglia show 1/500 neurons infected with HSV during the first week

following corneal inoculation. This ratio of immunopositive to immuno-

negative neurons falls to approximately 1/2000 to 1/5000 by 20 weeks

following inoculation. At this later date the yield of infectious virus

from explanted organ cultures is still on the order of 90% (Racjani 1978).

These findings closely parallel the observations of Baringer and

Sworeland (1973) in man. Lastly, single abnormal ganglion cells

surrounded by a cuff of mononuclear cells may be seen infrequently as

late as 11 months post infection. The nuclei of such cells contain HSV

particles and their cytoplasm is highly vacolated with virions contained

within intra-axonal vesicles (Baringer 1974). It is unclear whether







such cells are the product of the original infection or remnants of a

recent recurrence. The mass of this evidence argues that the ganglionic

neuron serves as the site of viral latency. The findings also suggest

that latency is not a totally statess" event but is "dynamic" to the

extent that, with even long periods of clinical quiescence, a few neurons

continue to act as infectious centers within the ganglia.

Although recurrence appears to be a natural phenomenon in rabbits,

it can also be artificially induced. Mechanical stimulation is usually

achieved through neurosurgical manipulation of the trigeminal nerve

root. Following such treatment, virus can be isolated from the tears of

80% of the animals within 48 hours (Nesburn et al., 1976). These

findings closely parallel the observations made by Carton and Kilborne

(1959) and Pazin et al (1978) in man.

In situ hybridization of HSV specific complementary RNA probes to

latent murine ganglia genetic material show viral nucleic acid sequences

in a small minority of the neurons (Cook et al., 1974; Zur Hausen and

Schulte-Holthausen, 1975). Analysis of hybridization experiments by

Puga et al (1978) demonstrates approximately 0.1 genome equivalents of

HSV DNA per cell in such ganglia. The quantity of viral RNA fell below

the limits of detection during the chronic period. The techniques

employed in this work were sensitive enough to detect 1 genome equiva-

lent of viral RNA per 2000 cells but at this sensitivity as many as 400

RNA copies per cell would go undetected.

Finally, using a nick translated 3H-labeled HSV DNA probe, viral

specific RNA sequences can be demonstrated in human ganglia sections

with in situ hybridization (Galloway et al,, 1979). Such sequences may

be found in the sacral, thoracic and lumbar ganglia, confirming previous








observations that an individual could be latent at multiple ganglionic

sites. In each case only 0.4-8.0% of the ganglionic neurons possessed

HSV specific nucleic acid sequences..


Molecular Biology of HSV

The infectious HSV particle has evolved a rather complex architec-

ture. A 1000 A nucleocapsid of acosahedral symmetry encloses the double

stranded linear DNA chromosome and various phosphoproteins of the viral

chromatin (Russell et al., 1962; Becker et al., 1968; Spear and Roizman,

1972). This core is itself encompassed by a loose matrix of glycoproteins

and carbohydrates of viral origin. Ultimately, the entire structure is

surrounded by a lipid envelope, giving the infectious virion a diameter

of roughly 1800 A. Quantitatively the mature particle is comprised of

approximately 70% protein, 22% lipid, 7% nucleic acid and 2% carbohy-

drate (Scott and Tokumaru, 1964; Callaghan-et al., 1976). Although the

viral genome has the potential to encode and modify through methylation

or glycosylation all known virion associated proteins, the lipid moiety

of the envelope appears to be principally derived from the phospholipids

of the infected cell's nuclear membrane (Watson et al., 1973; Roizman

et al., 1974). All known protein species associated with the envelope

arise from either virus specified de novo synthesis or modification of

cellular proteins (Kaplan 1973; Spear 1972).


Genome Size and Composition

The DNAs extracted from sucrose gradient purified virions of HSV-1

and HSV-2 differ in bouyant density by 0.002 g/cm3 (Goodheart et al.,

1968; Kieff et al., 1971). Goodheart et al (1968) and Plummer et al

(1970) determined these densities to be 1.725 g/cm3 for HSV-1 and 1.727






8

g/cm3 for HSV-2. Similar estimates were obtained by Graham (1972) using

E. coli DNA as a density reference. These values predict a G + C ratio

of 66.3% for HSV-l and 68.4% for HSV-2 (Goodheart et al., 1975). Kieff
3
et al (1971) established 1.726 and 1.728 g/cm for the respective bouyant

densities in CsCl isopycnic gradients using SPOl DNA as a marker. The

resulting 67% and 68% G + C ratios were confirmed by the finding of a

1C difference in the Tm values for HSV-l and HSV-2. While Kieff

reported the Tm of type 1 to be 83C and type 2 to be 84C, Graham et al

(1972) found only a 0.1C difference in Tm values of 82.6 and 82.7C.

Both serotypes of HSV have a sedimentation rate in neutral sucrose

density gradients of 55 S with a co-responding molecular weight of

995x106 daltons (Kieff et al., 1971; Sheldrick and Berthelot, 1974).

The contour length for the linear duplex molecule, based on EM studies,

is approximately 100x106 daltons (Sheldrick and Berthelot, 1974; Wilkie,

1973). The estimated molecular weight of HSV-1 circles is 943x106

daltons; if one considers a 3% redundancy in their terminal overlap this

would suggest a value for the linear molecule of 973x106 daltons

(Grafstrom et al., 1974). In a comparative analysis of restriction endo-

nuclease fragments from 80 isolates of HSV-1 Buchman et al (1978) found

a variation of only 2% in the determination of overall molecular weight

between isolates.

The similarities between HSV-1 and HSV-2 are apparently not limited

to a cursory examination of molecular weight and composition. Liquid

and filter hybridization analysis of their DNAs suggests an 85% homology

over 46% of their genomes; the remaining 56% of their respective genomes

is highly variable with little homology (Kieff et al., 1971). Nearest -

neighbor analysis for the two gives virtually identical frequency patterns.








However, a 2.2% difference in G + C ratios would predict a mismatch of

at least 3850 base pairs between serotypes (Subak-Sharpe et al., 1973).

Polypeptide mapping studies of intratypic recombinants give strong evi-

dence of a collinearity in gene ordering within HSV-1 and HSV-2 chromo-

somes. The reported viability of intratypic recombinants and the ability

of ts mutants of HSV-1 to complement ts mutant of HSV-2 also suggest

little divergence within functionally critical regions of the genomes

(Subak-Sharpe et al., 1972; Morse et al., 1977). Such evidence indicates

extensive similarity in the gross architecture of the two genomes and

argues for a distant but common lineage.

An interesting characteristic of the structure of the HSV chromo-

some is the presence of single-strand interruptions in the DNA. When

alkali denatured DNA from purified virus is sedimented on alkaline

sucrose density gradients numerous bands of single-stranded DNA may be

observed. These bands correspond to fragments of 7x106 daltons to

intact strands 48x106 daltons in weight (Kieff et al., 1971; Wilkie 1973).

Frenkel and Roizman (1972) have distinguished 6 classes of fragments,

ranging from 10x106 to 39x106 daltons, in denatured HSV-1 DNA. The

kinetics of reassociation within the intact size, 39x106 daltons, class

indicated this class was composed of elements representing a single unique

strand of DNA. In conflict with this interpretation are the findings of

Wilkie (1973) which suggested a randomly gapped genome and nonunique

intact strands. To date no biological function has been ascribed to the

single strand gaps and the controversy over random vs. defined sizes has

not been reconciled. Newly synthesized viral DNA has been reported to

contain short stretches of RNA (Biswal et al., 1974). It is unlikely

that such RNA stretches alone would account for these gaps since the






10

sedimentation profiles in neutral sucrose gradients are indistinguishable

for DNA denatured with formamide versus alkali (Roizman, 1979). The

consequences of a randomly gapped genome in the absence of a mechanism

for repair are self evident. It can be speculated that abortive trans-

cription due to an early truncation of the template could play a role in

viral latency or oncogenic transformation. It is noteworthy that no

repair mechanism has yet been clearly demonstrated.


Nucleotide Sequence Arrangement

If following denaturation, single strands of HSV DNA are permitted

to reanneal a high degree of self annealing can be observed by electron

microscopy. Among those strands that have folded back on themselves

three recognizable structures can be identified: a linear form with

extensive folding at one end, a single stranded circle with a heavily

folded region and a structure consisting of two single stranded circles

joined by a duplex region (Sheldrick and Berthelot, 1974). The forming

of two single stranded circles connected by a double stranded region is

indicative of the presence of two inverted repetitions of the termini

within the molecule. In a similar manner duplex circles may be formed

after treatment of hative HSV DNA with exonuclease III (Sheldrick and

Berthelot, 1974; Grafstrom et al., 1975). Such behavior is consistent

with the presence of natural repetitions at the single strand termini.

Thus the HSV chromosome is bracketed by direct repeats and consists of

two unique gene regions of differential length separated by two tandemly

arranged inverted repetitions of the termini. One implication of such a

model is that following concatameric replication of the molecule the

relative orientation of the two unique gene regions may be inverted

through recombination between the external and internal repetitions

(Thomas and MacHattie, 1967; Sheldrick and Berthelot 1974).






11

Partial denaturation mapping of the chromosome confirms this archi-

tecture and permits the sizing of the various regions. The long unique

gene region comprises 70.2% of the genome while the shorter unique region

involves 9.4%. The direct and inverted repeats bracketing the long region

each represent 6% of the genome length and can be further divided into

two subregions: the a, a' reiteration and the b,b' reiteration, which

is found only in the long segment. In like manner repeats associated

with the short unique region can be designated a'c' and ca, respectively;

comprising 4.3% of the genome. The a,a' sequences are held in common

between the long and short gene regions while the c, c' and b, b' inver-

sions are limited to the short and long regions respectively (Wadworth

et al., 1975). Partial denaturation studies and subsequent endonuclease

digestion mapping further confirm that the long and short components are

able to invert in their relative orientations. Thus, as originally pre-

dicted by Sheldrick and Berthelot (1974), within a population of HSV DNA

four conformations of the molecule can be determined which differ in the

relative orientations of the long and short unique regions (Hayward 1975;

Delins and Clements, 1976; Wilkie, 1976). The diagram below illustrates

this point.

One consequence of such an arrangement is that endonuclease

cleavage fragments spanning the L/S junction will be found in a 0.25

molar ratio relative to unique fragments and the terminal fragments will

be present in a 0.5 molar ratio. This prediction was confirmed by

Hayward (1975) in an analysis of the HindIII and Eco R1 digestion frag-

ments of HSV-1. Morse et al (1977) has suggested that another conse-

quence of this genome architecture is that not all conformations may be

functionally equivalent. If one aligns the amps of intertypic















|TR, IR L^ I I R




oa b b'o'a'c' c a
E3 ---- ---=4-- -1---E

0
i

0 10 20 30 40 50 60 70 80 90 100
1 I I I -f-----1----t-- - I I -
I


prototype

S


I--


L & I
L&S -_ "





Figure 1. Inversion of HSV DNA


recombinants to give the least number of crossover points, the resulting

progeny could only have originated from recombination between parents

which were both in the prototype configuration. Such an approach does

not take into account the contribution of double cross over events

(Morse et al., 1977; Roizman, 1979). To date analysis of recombination

frequencies between genetic markers in the long and short regions has

shed little light on the validity of this assumption.








Endonuclease Cleavage Map

In addition to the size variation in fragments spanning the L/S

joint, arising from inversion of the unique components, two other

classes of heterogenity are evident in cleavage maps of both HSV-1 and

HSV-2. One type of heterogenity maps solely to the unique regions and

appears to define viral strains. The differences within this class

arise from the presence or absence of specific endonuclease cleavage

sites and are found throughout the long and short components (Skare,1975;

Hayward, 1975; Locker and Frenkel, 1979). In a study of eighty HSV-1

isolates, Buchman (1978) determined 19 out of 60 cleavage sites which

could be either present or absent; suggesting the possibility of at

least 219 viral strains within the population. At this level of analysis

the cleavage maps of HSV-1 and HSV-2 are quite distinct. This first

class of heterogenity is less frequent in HSV-2 (Roizman, 1979). The

loss or gain of a single cleavage site need not give rise to a new

clinically or immunologically recognizable viral strain. Thus the number

of immunologically identifiable strains need not approach 219 value.

The ability of HSV to remain latent within an individual with inter-

mittent recurrences would provide a natural reservoir for the accumula-

tion of nonlethal mutants within the population. The lower frequency of

heterogenity in HSV-2 may simply mirror a smaller reservoir within the

populace. The second class of heterogenity maps to the termini of the

long unique region (Wagner and Summers, 1978; Skare and Summer, 1977)

of HSV. These differences derive from the insertion of a 28Glbp segment

into the terminal reiteration of the L component in single or multiple

copies giving rise to a series of minor fragments with a distinct 2xlO5

dalton increment in size (Wagner and Summers, 1978). Here again a

variance between viral strains may occur since a 3.3x105 dalton








increment in size is observed between minor fragments in HSV-1 (F) DNA.

In addition, while the minor fragments from the termini of HSV-1 differ

by 255 base pairs, those arising from the L/S junction differ by only

125 base pairs (Locker and Frenkel, 1979). Subsequent work with HSV-l

(F) has directly linked the tandem addition through recombination of the

501 base pair 'a' segment to the L termini with the generation of those

minor bands (Mocarski et al., 1980). Size variability has also been

reported for endonuclease fragments containing the c, c' repeat regions

(Lonsdale et al., 1979). This heterogenity can again be traced to the

copy number of a 23 base pair repeat present within the c regions. The

reiteration can occur in a variable copy number between viral strains,

between clones of same viral strain and lastly between the c and c'

reiterations of the same strain (Watson and Van de Woude, 1982; Rixon

and Clements, 1982).


Transcription

Once a permissive host cell is infected, viral replication rapidly

follows in a well-ordered seuqence of events. With uncoating, transcrip-

tion of defined regions of the viral genome proceeds in a highly regu-

lated temporal manner (Clements et al., 1977; Jones and Roizman, 1979).

Transcription of host cell specific RNA (C-RNA) continues at a reduced

rate, but synthesis and processing of cellular mRNA is rapidly inhibited,

as is the appearance of mature cellular rRNA. This inhibition appears

to be coded for by the earliest viral transcripts (Wagner and Roizman,

1969; Kaplan, 1973). For the most part, the reduction in the rate at

which mature rRNA appears is brought about by the interference of

infection with its maturation; synthesis of the 45 s RNA precursor con-

tinues at roughly the same level as that of C-RNA (Wagner and Roizman,





















'ii

Iii! I

II I

-A-


0 10 20


I







30 I4 I5 6 0
II I I







I I I I l i
\-^- ----- I---- ^+4H-1--I-










30 40 50 60 70 80 90 1C
i- | I -- |I | -- | -- --I --- |!


Figure 2. Restriction Map of HSV-1 and HSV-2 DNAs (Roizman, 1979).


1969)o However, while there is a stable accumulation of C-RNA within

the infected cell, inhibition of host mRNA synthesis is completed to the

extent that no de novo synthesis of cellular mRNA can be observed late

in infection (Kaplan, 1973). As the rate of host cell DNA synthesis

gradually falls off, it is rapidly surpassed by that of nacent viral DNA.

By 7 to 8 hours post infection, host DNA is no longer replicated. This

inhibition is concomitant with that of host cell protein synthesis and


o ab

HSV--F
HSV-1IF


Eco RI

Hpa I

Hsu I

Xbo I




Eco RI

Hpa I

Hsu I

Xbo I


)0






16

thus may mirror the loss of proteins specifically required by the cell's

replicative machinery (Roizman et al,, 1974). The peak rate of synthesis

for the earliest viral polypeptides is reached between 2 and 4 hours post

infection. The chief function of these proteins is to govern the change

over from cellular to viral macromolecular synthesis. There is a strin-

gent requirement for these immediate early polypeptides (a-proteins)

prior to the production of a second and larger group of proteins, the

early polypeptides (s-proteins), which appear 5 to 7 hours post infection.

These g-polypeptides augment the replication of the HSV genome. They

also govern a' gradual reduction in a-protein synthesis and pave the way

for production of the late structural proteins (y-polypeptides) of the

HSV virion (Honess and Watson, 1974; Pereira et al., 1977).

Viral mRNA is transcribed within the nucleus (Wagner and Roizman,

1969), is polyadenylated at its 3' end (Bachenheimer and Roizman, 1972;

Silverstein et al., 1976) and carries a 5' cap (Moss et al., 1977).

Prior to viral DNA synthesis two classes of viral mRNA, the immediate

early and early transcripts, are abundant and are transcribed at least

in part by host cell RNA polymerase II (Jones and Roizman, 1979; Clements

et al., 1977). Translation of these two classes of transcripts gives

rise to the aforementioned a and polypeptides, respectively. The

immediate early mRNA represents approximately 12% of genome and is made

in the absence of previous viral polypeptide synthesis. It can be iso-

lated in abundance from the cytoplasm of infected cells treated with

cyclohexamide (Jones and Roizman, 1979). These transcripts range from

1,500-5,500 nucleotides in size and map preferentially to the terminally

reiterated portions of the genome (Clements et al., 1977, Holland et al.,

1979). The second class of mRNA which is abundant before viral DNA






17
synthesis have a stringent requirement for a polypeptide synthesis prior

to its production. The viral DNA polymerase falls within this group.

Early transcripts map throughout the HSV genome and the -size of their

nuclear precursors differs little from that of the polysomal bound popu-

lation suggesting that their promoters map close to the structural genes

(Holland et al., 1979). Together the sequences transcribed prior to DNA

synthesis represent approximately 25% of the genome.

Comparative inhibition studies indicate that more than one polypep-

tide in the a and groups is involved in regulation of transcription

and the transition from a to p to y protein synthesis. For example

canavanine selectively inhibits subsets of these proteins and permits

partial transition from immediate early to early and then to late trans-

cription. As with early transcripts, late transcription occurs through-

out the genome with approximately 50% of the viral RNA at 6 hours post

infection having a length of 5,000 to 10,000 nucleotides. At this time

transcription of most early viral RNA continues with y mRNA species

representing approximately 20% of the accumulated viral mRNA.

The complex overlapping hybridization patterns of viral mRNA to the

HSV genome suggest that an elaborate series of interlocking controls

regulate transcription and translation with multiple RNA species derived

from limited regions of the genome and nucleotide sequences common to

several messengers. As suggested above the immediate early promoters

are compatible with the existing host cell transcriptional machinery yet

early promoters appear to have been modified by one or more a viral

proteins. The insertion of the 5' promoter region of immediate early

(IE) mRNA 3 into sequences upstream from the early thymidine kinase

structural gene permits its transcription as an immediate early species







(Post et al., 1981). As with other mammalian DNA viruses both mRNA

splicing and overlapping coding regions has been documented. With

respect to overlapping coding regions, the 5' termini of two early mRNA's

have been mapped to the region of the HindIII cleavage site at 0.586.

The regulatory signals for transcription of the smaller 1.2 kb mRNA are

found within the larger 5.0 kb transcript. Both mRNAs are unspliced.

The 5.0 kb species encodes a 136,000 dalton protein while the smaller

1.2 kb messenger codes for a 38,000 dalton protein. These early mRNAs

have a 3' co-terminus (Anderson et al., 1981; McLauchlan and Clements,

1982). Analysis of the co-terminus revealed the sequence AAUAAA with an

A + T rich region 3' to the sequence. This is the general format for the

3' termini of all early HISV mRNAs studied to date.

The IE mRNA-4 and IE mRNA-5 share a common 5' sequence. In this

instance the promoter and capped 5' termini map to the reiterated

sequences flanking the short unique region. Both messages share a

common 247 bp leader with a single splice located within the reiterated

sequences. A 'TATA' box is located approximately 25 bases 5' to the

leader and the common splice appears to function only to remove the

introns from a 5' untranslated region (Rixon and Clements, 1982). Since

these are the only messages located in this portion of the genome,

splicing does not increase the coding capacity of this region. It should

be noted that between IE mRNA-3 and IE mRNA-5 is a stretch of 800 nucleo-

tides which is not transcribed. This region may include the origin of

DNA replication (Vlanzy and Frenkel, 1981; Watson and Van de Woude, 1982).

Lastly, comparison of the 5' terminus of the IE mRNA-5 gene to that of

early thymidine kinase gene revealed that the regulatory sequence GGCGATTC

was absent in the immediate early gene while present 80 base 5' to the








early transcribed region (Watson, 1982). Eco R1 endonuclease cleavage

at this sequence causes reduced levels of thymidine kinase expression

(Wigler et al., 1977; McKnight and Gavis, 1980) and the sequence is

similar to the RNA polymerase II regulatory signal GGPyCAATCT described

by Benoist et al (1980). Thus transcriptional control at the promoter

level must distinguish between immediate early, early and late signals

and between origins of transcription within the same class; as in the

case of the two early promoters described above with a 3' co-terminus.

The rationale for studying the molecular status of the latent herpes

genome is in reality twofold. In a general sense, if the latent genome

is present as a subviral unit within the cell it provides a well defined

gene region of which specific questions concerning gene content and

transcription may be asked. In theory, such a genetic system would be

subjected to many of the restraints governing the activities of the genes

of its eukaryotic host, regardless of whether the viral DNA was inte-

grated or funcitonally an episome. The more direct concern of this study

is to approach the question of whether the HSV genome is functionally

dormant during its latency or does itself provide some necessary

activity. An assay for specific regions of the HSV genome should deter-

mine which portions of the viral DNA are most frequently retained in

latency while an evaluation of viral RNA will determine which regions of

the genome are most frequently expressed. The retention and expression

of certain genomic regions common to all HSV latently infected ganglia

argue that the virus may play an active rather than passive role during

latency.













MATERIALS AND METHODS


Purification of Ganglion Cell DNA and RNA

Teased ganglia preparations were washed 2 times in 1 ml of lXSSC

(150 mM NaCI and 15 mM Na2C6H507, pH 7.6), Dounce homogenized and trans-

ferred to siliconized 1.5 ml Eppendorf centrifuge tubes. The homogenate

was spun at 10,000 rpm for 2 minutes to pellet nuclei from which the DNA

was extracted. The resulting supernatant was extracted 2 times with

phenol-cresol-chloroform (5:1:1 mixture) and ether extracted 3 times.

From the extracted supernatant, total cytoplasmic RNA was precipitated

with diethylpyrocarbinol (DEPC) treated ethanol and stored at -20C.

For isolation of nuclear DNA, the pellet was first resuspended in 1 ml

lXSSC, 1% sodium dodecyl sulfate (SDS) and then treated with pronase

(1 mg/ml) at 37C overnight. The preparation was then phenol extracted

2 times, ether extracted 3 times and RNase A treated (20 mg/ml) for 30

minutes at 37C to degrade nuclear RNA. This was followed by 2 addi-

tional phenol extractions. The DNA was then precipitated with ethanol

and stored at -20C. This procedure yielded approximately 26 Pg of DNA

pre ganglia preparation.


Viral DNA Purification

HSV-1 DNA was isolated as previously described by Holland (1979).

Briefly, confluent monolayers of human epidermoid carcinoma cells (HEP-2)

were infected with HSV-1 at a multiplicity of 10 PFU/cell and incubated

in Eagle's minimum essential medium with 10% calf serum at 37C (Roizman

1968). Thirty hours post infection the monolayers were scraped into
20






2]

medium, which was clarified by spinning at 1,000 xg for 15 minutes. The

clarified medium was stored on ice and the cell pellet resuspended in

cold reticulocyte saline buffer (0.01 m NaCl, 0.0015 m MgCl2, 0.01 iM Tris,

pH 7.4) and 0.5% Triton. The cells were lysed by 10 strokes in a Dounce

homogenizer. The cell homogenate and clarified media were then each

spun at 10,000 xg for 15 minutes to remove nuclei and cell debris. The

resulting supernatants were pooled and from these HSV-1 virions were

pelleted by centrifugation at 33,000 xg for 30 minutes. Virions were

resuspended and lysed in 10 mM Tris, pH 7.5, containing 50 mM EDTA, 0.5%

SDS and 1% sarkosyl. The lysate was digested overnight at 37C with

pronase at a final concentration of 2 mg/ml (Walboomers and Ter Schegget,

1976). The digest was phenol extracted twice and ether extracted 3 times.

HSV-1 DNA was purified by banding twice in an isopycnic ethidium bromide -
3
CsCl gradient. The starting density of CsCI was 1.566 g/cm with 100

tg/ml ethidium bromide and centrifugation was for 48 hours in a Ti50

rotor at 45,000 rpm (Pater et al., 1976).

Partially purified HSV-l F strain DNA was also received from Dr.

Saul Silverstein, Columbia University, New York, NY. These preparations

had been treated in the following manner: Nucleocapsids were purified

from cytoplasmic extracts of infected Vero cells by velocity sedimentation

in sucrose gradients. The virions were lysed in the presence of 0.5% SDS,

0.5% sarcosyl and 10 mM EDTA. The lysate was then extracted with phenol,

chloroform and 2% isoamyl alcohol to remove proteins and lipids. The DNA

was then precipitated with ethanol and stored (Spear and Roizman, 1972).

Viral DNA preparations received in this form were resuspended in

2XSSC and further purified on CsCl density gradients. A single viral

band was obtained at a density of approximately 1.728 g/cm which was well

separated from contaminating, cellular DNA and RNA in the pellet (see







Figure 3). The HSV-l DNA was not highly fragmented as shown by ultra-
centrifugation on 5-20% alkaline sucrose gradients using 32P-labeled

form II SV40 as a size marker (see Figure 4) (Kieff et al., 1971;

Pignatti et al., 1979).


Preparation of Cloned DNA

Two clones of the reiterated junction between the long and short

unique regions of HSV-l DNA designated pRB104 and pRB115 were obtained

from B. Roizman, University of Chicago, Chicago, IL. pRB104 was

generated by the insertion of the Bam HI fragment SP2 of F strain HSV-1

into the Bam HI site in the tetracycline resistance gene of the Escherichia

coli plasmid pBR322; pRB115 was derived in like manner but contained the

Bam HI fragment SP1 of F strain HSV-1 (see Figure 5). The plasmids were

provided in E. coli strain C600SF8 (Post et al., 1980). Stocks were

maintained in 50% glycerol at -70Co Prior to growth, single colony

isolates were selected for ampicillin resistance, and grown overnight at

37C in Luria broth with 100 mg/l ampicillin. Generally 20 mis of the

overnight culture were used to inoculate 2 liters of broth for the pro-

duction of DNA stocks. The cultures were induced with the addition of

200 pg/ml chloramphenicol 15 hours before harvest.

Upon harvest the cultures were centrifuged at 10,000 xg for 15

minutes to pellet the bacteria. The bacterial pellet was washed once in

a solution of 10 mM EDTA and 50 mM Tris, pH 7.5 and then resuspended in

a solution of 25% sucrose, 10 mM EDTA, and 50 mM Tris HC1, Ph 7.5. All

subsequent extractions were conducted at 4C. The bacterial cell wall

was digested with egg white lysozyme (500 pg/m1). After 20 minutes in

the presence of lysozyme, (1 pg/ml) DEPC was added to inhibit breakdown

of nucleic acids and the cells were gently lysed in 0.5% Triton, Low

molecular weight DNA was extracted in the manner described by Hirt (1967).


















270 IBO1.800
VIRAL
DNA

240 1.780



210 1.760


180 1.740


C. 150 1.720
Q0
U

120 1.700 "


90 1.680


60 1.660
..... ,,, /

30 1'.// / ,640



5 10 15 20 25


Figure 3. CsCI isopycnic gradient purification of HSV DNA













5- 20%Alkuline Sjcrose








./ \8
/
/




/
/





/ /
S./ 8 1
4 8 1. -


(3H) HSV DNA



\ i/ 32P) SV40 L.NA


,6 20


Figure 4. Alkaline Sucrose Gradient analysis of HSV DNA



















I
0 10 20 30 40 50 60 70 80P 90 100




L 104





1 S It II i I P 5



-- 1E-15 mRNA






sP 3
--------- 115
SP2 ---------- 104
SP3-------------


Origin of pRB104 and pRB115 DNAs


Figure 5.








The Hirt supernatant was brought to 0.5 M NaCl and polyethylenegycol

(PEG) 6000 was added to a final concentration of 5%. The plasmid DNA

was permitted to precipitate overnight at 4C. -The resulting pellet was

isolated by centrifugation and resuspended in 50 mn1 Tris, pH 7.6 and 10

mM EDTA; excess PEG was removed by chloroform-phenol extraction and the

nucleic acids were ethanol precipitated in 250 mM sodium acetate, pH 4.7,

at -20C. Residual RNA in the resultant pellet was degraded by RNase A

treatment and form I plasmid DNA was subsequently isolated by ultracen-

trifugation on CsCl-ethidium bromide isopycnic gradients (LePecq, 1970).


DNA Restriction

Viral DNA (3 ig) was digested with either EcoRl, HindIll or Hpal

endonuclease in a 50 pI reaction mixture at 37C for 2 hours; 1 unit of

enzyme per pg DNA was added per hour. The enzymes were obtained from

Bethesda Research Laboratories, Inc., Rockville, MD. Reaction buffers

used were in accordance with the instructions provided by the supplier.

Ganglionic DNA was digested with EcoRI or HindIII in a 100 il reaction

under the above conditions.

To develop a fine structure restriction of the BamHl fragment

spanning the joint region of HSV-l DNA, cloned viral DNA was digested by

BamHl, AluI, BstEll, TaqI, HincI, Aval and Smal endonucleases. All

cleavage reactions were conducted in accordance with the instructions

provided by Bethesda Research Laboratories, Inc. BstEll and TaqI endo-

nuclease digestions were carried out at 60C: all other digestion reac-

tions were done at 37C.


Gel Electrophoresis

Restriction enzyme digestions were phenol extracted and then electro-

phoresed on 0.5% or 1% agarose vertical slab gels at 2 V/cm. Viral DNA







was run on 40x15x3 cm 1% slabs with 1 cm wells, each receiving 500 ng

HSV-1 DNA in 10 pl of loading solution. Stock loading solution contained

0.05% bromphenol blue, 0.05% xylene cyanole and 50% glycerol in 0.01M

Tris, pH 7.4. This was diluted 1 to 3 with the digests prior to loading.

Digests of cloned viral DNA were electrophoresed in the same manner.

Cellular DNA was run on 14x12x3 cm 0.5% agarose slabs with 1 cm wells;

10 pg of DNA was loaded as above per well. The running buffer was con-

tinuously circulated and contained 5 mM sodium acetate and 1 mM EDTA in

40 mM Tris, pH 7.8.

For size~determination and mapping, the digests of cloned viral DNA

were also electrophoresed on 6% acrylamide 0.15% bisacrylamide or 12%

acrylamide 0.30% bisacrylamide gels. DNA (3 pg) was loaded as above

per 5 mm well on 40x15x3 cm gels and 1 pg per 5 mm well on 40x15x1.5 cm

vertical slabs. The running current was 3 volts/cm0 The continuously

circulated buffer was 40 mM sodium acetate and 2 mM EDTA in 50 nfmM Tris,

pH 7.8.


Isolation of Endonuclease Cleavage Products

Endonuclease cleavage products were isolated and purified following

agarose gel electrophoresis in the manner described by Finkelstein and

Rownd (1978). Ethidium bromide stained gels were illuminated with a UV

lamp and the fragment band sliced out. Gel slices were finely ground

and suspended in 200 pl of 100 mM Tris, pH 5.95. Agarose (Calbiochem-

Behring LaJolla, California) was added to a final concentration 0.5 pg/pl

and the suspension was incubated for 2 hours at 37C. The degraded

agarose was removed by centrifugation at 15,000 xg for 10 minutes.

Following two successive phenol and ether extractions the DNA was con-

centrated by ethanol precipitation.








Smaller cleavage fragments were extracted from 6% acrylamide gels,

following the method devised by Maxam and Gilbert (1980). Gel slices

were minced and suspended in a solution of 500 mM ammonium acetate,

10 nmM magnesium acetate, 1 mM EDTA, 0.1% (wt./vol.) sodium dodecyl

sulfate and 10 pg/ml yeast tRNA. This slurry was incubated at 37C for

10 hours and then the residual acrylamide was removed by filtration

through glass wool. The filtrate was phenol extracted once, ether

extracted once and then the extracted DNA was concentrated by ethanol

precipitation.

Bulk purification of cleavage fragments was done by affinity chroma-

tography (BiUnemann and MUller, 1978). Generally 200 jg of digested DNA

were loaded onto a malachite gree substituted bisacrylamide gel

(Beohringer Mannheim Biochemicals, Indianapolis, IN) column in the pre-

sence of 10 mM sodium phosphate and 1 mM EDTA, pH 6.0. The fragments were

eluted through a 0-2 molar gradient of sodium perchlorate in the same

phosphate buffer (see Figure 6). The sodium perchlorate was removed

from the eluate by dialysis against 10 mM Tris, 1 mM EDTA; pH 7.0. The

DNA was the concentrate from the dialyzed eluate by ethanol precipitation.


Mapping Approach

Endonuclease digestion maps for pRB104 and RB115 were determined

by two methods: double digestion mapping and partial digestion mapping.

Where applicable, new sites were mapped relative to known sites in

reactions where two or more digestions were done to completion before

gel electrophoresis of the fragments. All reactions and subsequent gel

fractionations were carried out as previously discussed. In this manner

the digestion sites for BamHl, BstEll, Hincli, Alul, and Taql were con-

firmed and ma-ped relative to one another. The size of the endonuclease








29



















1.3397 1..




1.33 65




1.3373 7 7






05


.3349

.03


I 3!37 .2







35 30 25 20 15 10 5
Froaction






Figure 6. Affinity Chromotography of BamHl digest of pRB104







cleavage fragments was determined by comparison to known digestion

standards of adeno-associated virus (AAV) DNA, lamda phage DNA, or

pBR322 DNA, which were run in parallel wells on the .'same gels (Berns and

Hauswirth, 1978; Cheung et al., 1980). The numerous cleavage products

arising from restriction by either Aval or Smal were oriented relative to

the Alul and Taql sites through partial digestion reactions in the manner

described by Smith and Birnstiel (1976). End labeled Alul or Taql frag-

ments were isolated and partially digested in the presence of 1 unit/Pg

DNA of Aval or Smal endonuclease under standard conditions. Aliquotes

were withdrawn from cleavage mixture and prepared for gel electrophoresis

after 5 minutes, 10 minutes, 20 minutes, 40 minutes and 80 minutes of

reaction time.


Nick Translation

1 pg HSV-1 F strain DNA was incubated. for 45 minutes at 15C in a

50 pIl reaction mixture containing 30 rmMdGTP, 30 mMdTTP, 30 mMdATP (sigma),

100 PCi[a 32P]dCTP (400 Ci/m mole; New England Nuclear), 5 mM MgCl2, 4

units DNA-polymerase I, 10 mM -mercaptoethanol, 0.05 mg/ml bovine serum

albumin, 50 mM Tris, pH 7.8, and 4.5 units of DNA-polymerase I (Boehringer

Mannheim Biochemicals, Indianapolis, IN). The reaction was stopped by

the addition of 100 ji of a solution containing 100 mM EDTA, 100 ug

sonicated calf thymus DNA and 10 mM Tris, pH 7.8. The mixture was

extracted with phenol and ether. Finally free [a 32P]dCTP was separated

from labeled DNA by passage through a Sephadex G75 column (IcmxlOcm).

This procedure usually yielded a viral probe with a specific activity of

approximately 3x108 cpm/ug. Cellular DNA was labeled in the same manner

except that the reaction volume was increased to 100 wl and 10 pg DNA

was labeled per reaction in the presence of 0.5-2 ng activated DNase I.







DNase I was activated by incubating the enzyme for 2 hours at 0C in a

solution containing 10 mM Tris, pH 7.6, 5 mM MgCl2 and 1 mg/ml bovine

serum albumin. DNase I was obtained from Worthington Biochemical Cor-

poration, Freehold, NJ and stock solutions of 1 mg/ml in 0.01 n HC1 were

stored at -20C (Rigby et al., 1977).


iodination of Cytoplasmic RNA

Ethanol precipitated cytoplasmic RNA was resuspended in 50 pl of

DEPC treated distilled water and transferred to a 1.5 ml Eppendorf

centrifugation tube containing 4 mCi 125I1 sodium iodide. To this, 20 Il

of 0.2M sodium acetate (pH 4.7) and 5 mM thallic chloride was added.

The tube was sealed and incubated at 70C for 20 minutes. 1251 sodium

iodide with a specific activity of 350-600 mCi/m mole was purchased from

Amersham/Searle Corporation, Arlington Heights, IL. Thallium chloride

was purchased from ICN Pharmaceuticals, Incorporated, Plainview, NY.

After incubation the reaction was chilled and stopped by the addition of

20 il of 0.02 M1-mecaptoethanol, 1 M sodium phosphate, pH 6.8. The

solution was heated to 70C for 15 minutes and 50 vg of yeast tRNA was

added as carrier. Labeled RNA was separated from free 1251 by passage

through a Sephadex G75 column (IcmxlOcm) (Tereba and McCarthy, 1973).


5' End Labeling Reactions

The 5' ends of endonuclease digestion fragments were labeled with
[y 32PdATP in the presence of T4 polynucleotide kinase (Richardson,

1966). The 5' terminal phosphate of the polynucleotide was first removed

by treatment bacterial alkaline phosphatase in 10 mM Tris, pH 7.4 and

100 mM NaCl at 60C for 30 minutes. To halt the reaction 5 mM EDTA was

added and the solution was phenol extracted twice then ether extracted








3 times. The DNA was then precipitated with ethanol and dried under

vacuum. The DNA was redissolved in a solution containing 50 mM Tris,

pH 9.5, 10 mM MgCl2, 5 mM dithiolthreatol, and 50% glycerol. To this

was added 100 mM spermidine and 20 units T4 polynucleotide kinase. The

resulting solution was mixed with 200 pCi of dried [y -32P]dATP and

allowed to react at 37C for 30 minutes. To stop the reaction 5 mM EDTA

was added and the solution was dialyzed against 10 mM1 Tris, pH 7.4,

5 mM EDTA, and 1 M NaCI to remove unreacted [y -32P]dATP. The bacterial

alkaline phosphatase was purchased from Worthington Biochemical Corpora-

tion, Freehold, NJ; the Kinase was obtained from Bethesda Research Labora-

tories, Inc., Rockville, MD; and the [y -32P]dATP was obtained from

Amersham, Arlington Heights, IL. Generally 50-100 pg of DNA were

labeled in a 50 pl reaction volume to a specific activity of 105 cpm/pg

of DNA.

The large "A" fragment of E.coli polymerase I was used to 3' end-

label various digestion fragments. For this purpose the 50 pl cleavage

reaction mixture was blown down to approximately 20 pl and 20 pCi of
[a -32P]dCTP or [a -32P]dATP with 0.9 units of the Klenow polymerase

fragment (New England BioLabs, Beverly, MA) were added. Labeling was

done at 37C for 30 minutes. To half the reaction the sample was placed

at 60C for 10 minutes, then 20 pg of sonicated carrier DNA was added

and the sample was ethanol precipitated.


Southern Blots

DNA restriction fragments were transferred from agarose or polyacry-

lamide gels to nitrocellulose filters in the manner described by Southern

(1975). Gels were first stained in a 1 pg/ml ethidium bromide bath,

visualized under UV light and photographed. The right corner of the gel






33
and the furtherest points of migration were notched to facilitate future

orientation of the gel. The DNA fragments were then denatured in situ

by soaking the gel for 20 minutes in a 1 M KOH solution. The KOH wash

and gel were then tritrated to neutrality with IM HCI-IM Tris. The gel

was then aligned on a prewashed nitrocellulose filter for transfer. The

nitrocellulose filter was prewet by washing for 20 minutes in a 5XSSC

bath. The DNA was eluted from the gel with 1OXSSC. For transfer from

a 1% or greater agarose gel, the gel was placed on a paper wick soaked

in 1OXSSC, overlaid with the nitrocellulose and absorbant material.

This arrangement permitted a higher volume of 10XSSC to pass through the

gel and enhanced transfer of higher molecular weight fragments. For

transfer from agarose gels of less than 1% and polyacrylamide gels, a

slightly different procedure was used in order to decrease diffusion of

the DNA bands during transfer. The filter was again sandwiched between

the gel and absorbant material but arranged in the reverse order so that

transfer was in a downward direction. The gel was overlaid with a paper

wick which was periodically wet with 1OXSSC. Thus a decreased volume of

1OXSSC was passed through the gel and diffusion was diminished. After

transfer the nitrocellulose filter was dried at 80C for 2 hours under

vacuum.


Hybridization Reaction

Hybridizations were carried out in sealed plastic bags containing

the filter and a hybridization mixture composed of the following: 50%

formamide, 5XSSC, 0.08% polyvinylpyriodate, 0.08% bovine serum albumin,

0.08% ficoll, 0.5% SDS, 0.02 M Tris (pH 7.4), 50 pg/ml sonicated calf

thymus DNA as a carrier and either 32P or 125I-labeled probe at a con-

centration of at least 106 cpm/ml. All blots were prewashed with the








hybridization mixture minus the probe at 37C for 2 hours prior to the

hybridization. Hybridization was carried out in the presence of the

complete mixture for 72 hours at 37C. The blots were then removed and

washed twice to remove nonspecifically bound label, with the hybridiza-

tion mixture minus carrier and probe for 30 minutes at 37C. The blots

were then rinsed twice with 2XSSC and 0.5% SDS in 50% formamide. The

blots were washed twice in 1XSSC and 0.5% SDS in 50% formamide for 30

minutes at 37C (McConaughy et al., 1969; Tereba and McCarthy, 1973).

Finally, the blots were washed overnight at 65C in 1XSSC and 0.5% SDS,

with 4 changes of the wash.

On occasion the hybridization was carried out at 65C. In these

instances the reaction and washes were done as described above at 37C

but in the absence of formamide. Attempts were made to increase the

sensitivity of the hybridization by adding 10% dextran sulfate to the

hybridization reaction (Wetmur, 1975). The findings were inconsistent

due to variable nonspecific background on the autoradiographs of such

experiments.

Following the hybridization and washings the blots were dried and

then autoradiographed with Kodak X-Omatic regular intensifying screens

and Dupont Cronex 4 X-ray film at -70C for 3-21 days.













RESULTS


Experimental Approach

As stated previously, the general aim of this research is to illu-

minate the molecular status of the HSV genome in latently infected human

trigeminal ganglia. Specifically the studies are designed to

1. Detect HSV DNA and RNA sequences in human ganglia.

2. Determine the extent of the viral genome present through

hybridization of HSV DNA to nitrocellulose paper bound ganglia

DNA.

3. Determine the extent of viral DNA expressed as cytoplasmic

RNA through mapping of ganglia RNA hybridized to nitrocellu-

lose paper bound viral DNA.

4. Correlate genome presence with the expression of a humoral

immune response to HSV antigens in immuno-competent patients

as measured by complement fixation.

5. Evaluate the manner of viral genome latency.

To achieve this end the following experimental approach was taken.

Total cellular DNA and cytoplasmic RNA were extracted from trigeminal

ganglia. Three different experimental routes could then be carried out.

The DNA was either radiolabeled with [a 32P]dCTP by nick translation

(Rigby et al., 1977) or it was digested with a restriction endonuclease,

gel electrophoresed and then transferred and immobilized on nitrocellu-

lose paper by the blotting method of Southern (Southern, 1975; lWahl et

al., 1979) (see Figure 7). Radiolabeled ganglia DNA was subsequently








hybridized to EcoRl digests of HSV DNA immobilized on nitrocellulose

paper under conditions favorable for formation of DNA-DNA hybrids. The

reverse experiment was also done using nick translated [a 32P]dCTP

labeled HSV DNA as a probe and hybridizing with endonuclease digested

ganglia DNA.


chemically


la



32P-DNA


Shybridize



HSV DNA
Blots


Isolate Ganglia

dissection

Neurons

DNA E


bel


di


ndo R
gestion


hybridize

32P-HSV DNA


Figure 7. DNA/DNA Hybridization Procedure

1 25
The third procedure entailed hybridizing 125I-labeled total cytoplasmic

RNA from ganglia to immobilized restriction endonuclease digests of HSV

DNA (Tereba and McCarthy, 1973) (see Figure 8). In all these approaches

viral DNA or RNA sequences complementary to immobilized sequences were

detected by autoradiography at -70C for 1-21 days. The pattern of

radioactive bands was compared to control HSV DNA run in parallel
experiments.
experiments.


Ganglia
DNA
Blots


I










Isolate Ganglia

dissection
Neurons
I
RNA HSV DNA
125 chemically label
125I RNA I

hybridize ___ Endo R Digest
HSV DNA Blots" '

Figure 8. RNA/DNA Hybridization Procedure


Controls

The binding of radiolabeled ganglion DNA or RNA to nitrocellulose

bound viral DNA permits the detection of specific genome regions of HSV

DNA sequences in neural tissue. This is a considerable refinement over

standard filter hybridization methods or in situ methods where only

hybridization to the whole genome is monitored and where a consideration

must be given to high backgrounds due to nonspecific binding of the

probe.

The selectivity of the assay is still largely a product of the

purity of the known viral DNA preparation. To assay this purity HSV-l

F strain DNA was nick translated and hybridized to EcoRl endonuclease

digests of DNA from calf thymus tissue, salmon sperm, human foreskin,

Hela M monolayers and Hep 2 cells (see Figure 9). The HSV DNA was pre-

pared by high salt precipitation in the manner described by Pater et al

(1976). This approach is a modification of the high salt extraction

method first devised by Hirt (1967). Nonspecific binding of label

occurred with each digestion assayed. This suggests the presence of

cellular DNA copurifying within the viral DNA preparation. For this


















CL
0 Q
" -. r


EcoRi


Figure 9. Cellular DNA Controls






39
reason, only HSV-l F strain DNA extracted from sucrose gradient purified

nucleocapsids and banded twice in CsCI density gradients to remove con-

taminating cellular DNA and RNA was used throughout (Spear and Roizman,

1972). To further eliminate the possibility of contamination by copuri-

fying cellular nucleic acids, HSV-1 F strain DNA sequences cloned in

PBR322 were also used in some of the hybridization studies. DNA isolated

from purified nucleocapsids failed to hybridize to cellular DNA in a

repetition of the above described assays. In control experiments such

a probe also failed to bind to DNA from adenovirus (Ad2), adenoassociated

(AAV) virus and Simian Virus 40 (SV40) (see Figure 10). DNAs extracted

from thoracic ganglia and connective tissue of patients have been run in

parallel reactions with trigeminal gnaglia DNA and failed to hybridize

with this probe.

To determine the sensitivity of the hybridization assay reconstruc-

tion experiments were run using HSV and AAV DNA. Samples of AAV DNA

were digested with either BamHl, EcoRl or Alul and then mixed. Starting

with a total of 10 ug of digested AAV DNA serial dilutions of the

preparation were then made. To maintain a total of 10 ug DNA in each

sample sonicated calf thymus DNA was added as needed. The samples were

electrophoresed on a 6% polyacrylamide gel and then transferred to

nitrocellulose by the Southern blotting method. Using a nick translated

AAV probe with a specific activity of 108cpm/ug DNA the sample containing

100 pg of AAV DNA could be visualized by autoradiography after 2 weeks.

A 200bp fragment within this sample would represent 5pg of DNA. Because

fragments within this size range are visualized the assay is sensitive

enough to distinguish 5pg of AAV in 10 ug of calf thymus DNA, a dilution

factor of 2x106. Similar experiments using HSV DNA established that














HSV


Eco RI


AL
EK


JK
DEFG
H "

J hi.
\ta

*1


M



N


0


Figure 10. Viral DNA Controls


SV40


AAV





































, 'i






41

endonuclease fragments transferred from 0.5% agarose gels to nitrocellu-

lose could be distinguished at a dilution factor of 106 of Ipg of HSV

DNA in 1 ug of carrier DNA.


Hybridization of Ganglia Nucleic Acids to HSV DNA

The trigeminal ganglia of 18 patients have been assayed for HSV

sequences by DNA/DNA or DNA/RNA hybridization. None of the patients

manifested clinical evidence of recurrence at the time of death nor was

a history of recurrence noted (Table 1).


Table 1. Hybridization of trigeminal nucleic acids to HSV DNA.


Patient CT titer

227 32
228 32
367 32
951 64
883 64
1072 32
1034 32
1082 128
1089 128
1033 64
949 32
941 <8
319 <8
943 <8
947 <8
893 <8
1143 <8
1110 <8

*(+) present
(-) absent
(N.D.) not determined


Viral DNA*

+
+
+
+
+
+
+
+
+


+


Viral RNA*

N.D.
N.D.
N.D.
+
N.D.
N.D.
N.D.
N.D.
N.D.

+
+
N.D.


N.D.


Briefly, the findings from the experimental approaches have been

listed in Table 1. The first approach entails the hybridization of a

nick translated 32P labeled viral DNA to either EcoRl or HindIII endo-

nuclease digests of ganglia DNA bound to nitrocellulose filters. The







second is the hybridization of 1251-labeled ganglia cytoplasmic RNA to

restriction endonuclease digests of HSV-1 DNA bound to nitrocellulose.

Eleven of these patients were sero-positive for HSV. A positive serology

here is assessed as a compliment fixation titer of 1:8 or greater. The

trigeminal gnaglia from 9 such individuals were shown to contain HSV

DNA sequences. Viral DNA was not detected in the remaining two members

of this group (949 and 1033) but viral sequences were demonstrated in a

preparation of total cytoplasmic RNA from the ganglia of patient #949.

Only one of the sero-negative individuals (941) yielded ganglia con-

taining latent HSV DNA and viral RNA was also detected in this case.

Figure 11 is an example of the autoradiographs obtained from

hybridization assays involving viral and ganglia DNA. The first lane

(A) is a photograph of the ethidium bromide stain of an EcoRl digest of

HSV-1 run as a marker. The second lane (B) is the autoradiograph of

labeled viral DNA hybridized to EcoRl digests of ganglia DNA. Lane C

is the photograph of the ethidium bromide stain of the HindIll digested

control as it appeared after agarose gel electrophoresis. Lanes D and

E are the autoradiographs of labeled viral DNA bound to HindIII endo-

nuclease digests of ganglia DNA. In the experimental reaction with

ganglia #228 DNA, extensive binding of the probe is evident in the

regions where the larger EcoRl fragments (MW 8.4-17.5x106 dal.) of HSV

would migrate as determined by comparison to the controls. Binding is

also apparent where the EcoRl M (MW 2.7x106 dal.) fragments are expected

to migrate. The viral probe did not hybridize in the region where the

EcoRl K(MIJ 3.5x106 dal.) fragment should be found. EcoRl K maps at the

terminus of the short unique portion of the genome. The fragment may

display an altered migration here, or this portion of the viral genome

may not be represented in the ganglia. It is of interest to note that






43





AB C D
E' Pl i* ;'. H ,i '' i ir 1 .:-








'2,~






























Figure 11. Viral DNA hybridized to Ganglia DNA

ganglia of patient #227 also revealed an altered migration of the EcoRl

K fragment. Unfortunately the HindiI1 digestion pattern does not permit

such an analysis. Patient #228 is representative of the type of findings

obtained when a major portion of the HSV genome was demonstrated in the

ganglia. In all such cases to date the endonuclease digestion pattern








revealed was consistent with that of HSV-1. In several of the ganglia

only part of the HSV genome could be detected; whether the remainder of

the genome is absent or those portions are present in too few copies for

the assay to reveal is as yet uncertain.

Figure 12 is an autoradiograph of 1251-labeled ganglia cytoplasmic

RNA hybridized to an EcoRl endonuclease digest of HSV-1 F strain DNA

bound to nitrocellulose paper. To the left of the autoradiograph is a

photograph of the cleaved HSV stained with ethidium bromide after agarose

gel electrophoresis and prior to transfer to nitrocellulose. Clearly

not all regions of the viral genome are represented in the ganglia cyto-

plasmic RNA. This would not be the case if the ganglia were actively

supporting a lytic infection as shown in the HSV control. Further,

those fragments present are not uniformly represented in the RNA. For

instance, transcripts of EcoRl K appear most abundant in the RNA of

patient #951. In this manner the viral RNA transcripts found in several

ganglia have been mapped on the HSV-1 genome. Figure 13 summarizes this

data.


CsCl Enrichment

To determine whether HSV DNA could be isolated in an episomal form

free from host chromatin total ganglia nucleic acid was fractionated on

CsCl density gradients. As a control human thoracic ganglia DNA was

kinased and run in a parallel gradient. 3H labeled lambda DNA was run

as a marker in all gradients and 50 ug of sonicated calf thymus DNA was

added to each as a carrier. The gradient profiles are shown in Figure

14.












HSV 951 HSV 941


AL
E K,
DIF JK
-- AL

DEFGH
Ij







M ,
k"
9'"5










NN






I ,.1


Ganglia RNA Hybridized to Viral DNA


Figure 12.

















L
L_________^ I
l


0 10
I -I


20 30
I ti


40 50
I I


I i i IIH
J 0 G N F MO


7
70 80
! I1-n


I
LA I IE KI
LA I E IK


9 5 1 1. --

941---- ----


Hpal I i I l I II I I II
LN K ORSUJ M IV
941 ! !- i F---


iHI I


, I I


HI E II II I I
H F E TOXPL2


Figure 13. Mapping HSV specific RNA found in the Ganglia


EcoRI


949


90 100
It I


H K2


V---


i


E---






47














3H 32 P

10 it I

9 \ 9



o_ i \'*
Ia.


X6 I 0\

1 0
0.5 I 5x

I I \ ,0.
4 \



2 2




I 2 3 4 5 6 7 8 9 0 I 12 13 i4 5 6 17
FRACTION


Figure 14. Fractionation of Total Ganglia Nucleic Acid






48












A B C






\






1 ^RACTI0N
I
CLH

U 2





2 3 .4 5 7 14 115 Is I7
F PtACT ION




Figure 15. Sectioning of CsCl gradient



Using the lambda marker as a reference the gradients were divided

into five segments. Within gradients A, B and C fractions were pooled

and the total DNA per section isolated and nick translated. The findings

are summarized in Table 2. Approximately 25 ug of DNA from HEP2 mono-

layers infected with HSV-1 F at an m.o.l. of 1 and harvested at 20 hours

post infection was used as a positive control for this assay.






49
Table 2. CsCl enrichment study

Probe
Patient CF-titer I II III

1168 256 -
1090 256 -
1144 128 -
1143 8 -
thoracic ganglia 16 -
HepII ND -
HSV infected Hep2 ND + + -

Mapping the L/S junction of HSV-1 F strain

The immediate early mRNA species of HSV-1 are known to map to the

reiterated portions of the genome. This fact coupled with the observa-

tion that transcripts mapping to this region were present in all posi-

tive ganglia studied to date suggested that this area warranted further

analysis. Hybridizations of ganglia RNA to pBR322 clones of the L/S

junction were undertaken in order to develop a clearer picture of the

degree of transcription. To gain such an understanding it was necessary

to first derive detailed restriction digestion maps of the DNA in

question.

Two plasmids were used for this purpose, pRB104 and pRB115 (Post

et al., 1981; Material & Methods) (see Figure 16). The SP2 insert in

pRB104 is approximately 500bp greater in length than the SP1 species in-

serted into pRB115 (Post, 1981). First the DNA was evaluated by single

and double or triple endonuclease digestions using BamHl, Pstl, HindII

and BstEll. This confirmed the identity of the two plasmids and also

allowed us to map a 520bp insertion to the largest BamHl/HindII fragment

of pRB115 (see Figure 17). The size markers in these assays were known

digests of either pBR322 or AAV DNA. The clones were then screened with

various additional endonucleases to determine their digestion patterns.

A summary of the restriction enzyme fragment sizes is given in Table 3

















I
o 10 20 30 40 50 60 70 80 90 100

ab 4 | 4 a, O12 C
A


104
!





2 51 5
- "-_ iE-mRNA
1 ~ ~-- -- - -\ ^ j --- -

S14 3

* I 1 'ii II I i 111 |'I !1 I t U B am .
i I l!il I il l ;: I1 ill l i l i .1 i i ; i l ii I s



spp
S P S IP \P




SPI 104
---------------04


SP3


Derivation of Clones pRB104 and pRB115


Figure 16.












1 2 3 4 5 6 7 8


Figure 17. Restriction Digests of pRB115 and pRB104


Lanes: 1.
2.
3.
4.
5.
6.
7.
8.


BamHl/Pstl/BstEll digest of pRB115
BamHl/Pstl/BstEll digest of pBR322
BamHl/Pstl digest of pRB115
BamHl/Pstl digest of pBR322
Pstl digest of pRB115
Pstl digest of pRB322
BamHl/HincII digest of pRB115
BamHl/HincII digest of pRB104








Table 3. Endonucleases


BamHl/HindII BamHl/BstEll BamHl/BstEll/TaqI Smal Aval
Clone: 115 104 115 104 115 104 115 115

fragment
size (bp) 4600 5200 750 4200 2400 2350 1075 890
1230 1240 2300 2300 1950 2200 677 566
1600 1975 577 483
450 453
430 400
365 380
337 336
222 317
140 226
102 206
84 170
148
138
99
82
55


Enzymes that did not cut:


BglII, Kpnl, Hpal,
Pstl and Sail


Xbal, EcoRl, HindIII,


and a comparison of the Smal and Aval digests of pRB104 and pRB115 are

shown in Figure 18. The mean length of the insert in pRB104 was calcu-

lated to be approximately 6382 base pairs and that of pRB115 was 5830 base

pairs. A comparison of the Smal and Aval digestion patterns of the two

clones indicates that more than a single insertion event has occurred

in the derivation of the SPI, and SP2 fragments. The fragment corres-

ponding to the 1075 bp Smal fragment of pRB115 is only 880bp in pRB104

even though pRB104 contains the larger insert. The 360bp Smal fragment

of pRB115 is overrepresented in pRB104. The 450bp Aval fragment of

pRB115 is overrepresented in pRB104 and the 483bp Aval fragment of

pRB115 is missing in pRB104. The pRB104 Aval digest also has a cluster

of fragments between 330bp and 380bp that are not found in pRB115.








Because of these additional rearrangements the Sinai and Aval maps of

only pRB115 were determined.


1 2 3


1075






360


-450

-380
-330


Figure 18. Smal and Aval digests of pRB104 and pRB115

Lanes: 1. Smal digest of pRB115
2. Smal digest of pRB104
3. Aval digest of pRB115
4. Aval digest of pRB104








The SP1 insert in pRB115 was excised by BamHl cleavage and the

insert separated in bulk from the vector by affinity chromatography over

a malachite green substituted bisacrylamide gel column. The Smal and

Aval cleavage maps were determined by partial digestion mapping (Smith

and Birnstiel, 1976). The approach was as follows. The DNA was cut with

Alul and then 5' end labeled by the T4 polynucleotide kinase reaction.

The DNA was then recut with Taql endonuclease and the digestion fragments

separated by agarose gel electrophoresis. The three largest fragments

spanning the insert were designated 1, 2 and 3, respectively. These

fragments were aligned on the general map using double digestion assays

with Hincil or BstEll as shown in figure 19a. Partial cleavage mapping

was then done using Smal and Aval on each of the Alul/Taql fragments.

The map was confirmed by first cutting with Taql, labeling and then

recutting with Alul; thus generating an overlapping map going in the

opposite direction.

Figure 19b shows the generation of the Smal map for Alul/Taql frag-

ment 2 and the Hincil digestion of fragment 2 and fragment 3. The

accompanying figure 19b shows the mapping strategy and the log plot of

migration distance versus molecular weight from which the size of the

partial Smal fragments was determined. The resulting cleavage map of

fragment 2 is also shown. Figure 20 shows the partial digestion frag-

ments resulting from Aval cleavage of the Alu /Taql fragments 2 and 3.

Sall, EcoRl, BamHl and Alul digests of AAV were used as size markers.

The maps resulting from these gels and similar experiments are shown in

Figure 21.













2


3
T__o_______ 3I A I
ITo-} Atu I


& i AiI I


Sal I A









SSl I B

-i \ Al, I A

2
2
-J___ 6


*c







E.


0


Dislance Migroted (cm)


Figure 19a. Strategy for Partial Digestion Mapping of pRBII5


8S


3000.





2CCO


1000


o 0
C











3
Hincli uncut


2 Sma I
HinclI 0 5 10 20 40 80


AAV


EcoRI A -


B -
Alul A -


-. P.-


H
II




K





La








Figure 19b. Smal partial digestion of pRBll5







Ava I
2 3
AAV 0 5 10 20 40 80 5 10 20
haamaaaa





'II



tI
mom
'%












lb


Figure 20. Aval Partial Digestion Mapping of pRB115

















< c



























































0


oc
- Lii
S0- -
- 0 ">


._ > E

I
I I
I I


-D
-z

-".0








~-


-Ce)


T














HYBRIDIZATIONS


Hybridization of ganglia RNA to the L/S junction

As stated previously hybridization of total cytoplasmic RNA from

ganglia to Southern blots of clone pRB115 of the L/S junction of HSV-1

F was undertaken in hopes of better delineating the level of transcrip-
1 25
tion through this portion of the genome. The 125I-labeled RNA from

five sero-positive patients was evaluated in this manner. The nucleic

acids from thoracic ganglia and a normal lytic infection were also

evaluated as controls. The findings are given in Table 4. As in the


Table 4. Analysis of L/S Junction

Patient CT titer Viral DNA* Viral RNA*

1033 64 -
1034 32 +
1082 128 +
969 16 -
1089 128 +
thoracic
ganglia 16
HSV infected
Hep2 N.D. + +

*(+) present
(-) absent
(N.D.) not done

CsCl enrichment studies DNA or RNA from Hep2 monolayers infected with

HSV-1 F at an m.o.i. of 1 and harvested at 20 hours post infection were

used in the control assays.








Cross Hybridization Experiments

The close biological relationship between AAV, Ad and HSV suggests

the possibility of partial genome homology; however previous attempts

have failed to demonstrate detectable homology. Using the more sensi-

tive technique of cross hybridization of 32P-labeled AAV, HSV or Ad

probes to restriction endonuclease digests of the reciprocal genome

immobilized on nitrocellulose filters, we were able to determine limited

regions of homology. Figure 22 outlines a typical cross hybridization

assay and our findings to date from the hybridization assays are sum-

marized in Table 5.


Table 5. Cross Hybridization Analysis

BLOT

AAV-2 Ad2 Ad5 SV40 HSV-l Hep2 HelaM Hela

AAV-2 + + + -
Ad2 + + + -
Ad5 + + + -
SV40 + -
HSV-1 + -

(+) homology
(-) no homology


To determine the level of nonspecific hybridization that could occur in

our assays, such as that which might arise from long stretches of high

G+C content, hybridizations were done with the DNA from the Hep2, HelaM

and Hela suspension cell lines. The Ad5, Ad2, and AAV2 virus stocks

were grown in Hela suspension cultures. The HSV-1 virus was grown in

either Hep2 or HelaM monolayers. Thus these controls would also allow

us to detect any cellular DNA which might be copurifying with viral DNA

during its preparation. Our findings were consistently negative although

the controls were hybridized under several degrees of stringency as were
























4--)

a


N




s-
>S S

>3-= "S


(U
1/)
cu
S.-
0

c-
0
-


+-'
cu


(D LU

---* --
.r- a)


<-- COJ


a(
IA
o i-

(0 tn







CD


a)
4-
U,
C

S.-
I-


a.)
0







-o

Cn


C\j
m


s-
QL
to
S-
Cn
0

- -o

10






C-
r0
4-)
Z3












IS






S-
0
4->


(3)
V)

0




0
I-. +a

C)
u
o 4-
4-











cuJ
C)

0

s-
r L)

-)



o- 4-

4-J
S.-






0 -1-' 4-
4-1 *r- (n
4r3 in I E
to L/)
r ro

Q- .r I--



C\






C)
C/C
0 i-
Ln a
0 )
ro Cm








the experimental group. Figure 23 shows the findings of 2 sets of

experiments in which an Ad2 nick translated probe was hybridized to AAV

blots and washed under varying salt concentrations. The hybridizations

were done overnight (as described in the Materials and Methods portion

of this text) at 68C and all washes were done at 68C. On the left of

Figure 23 are the autoradiographs from the hybridizations to a HpaII

blot to AAV and on the right are those from a HaeII blot of AAV. As

one progresses from a 2XSSC wash with 300 mM NaCI to a O.5XSSC wash with

only 75 mM NaCl various bands are seen to drop from the autoradiographs.

In the case of the HaeII digest, clearly all bands are present in the

autoradiograph of the blot washed in 2XSSC but the blot washed in 1XSSC

has lost the HaeII D fragment and the intensity of the HaeII B band is

greatly diminished. The O.5XSSC level of stringency reveals only strong

hybridization to the HaeII A and C fragments with significant binding

remaining to the HaeII E fragment.

When assays are done in the manner described above whole viral DNA

is nick translated as a probe. This approach permits the mapping of

homologous regions on the nitrocellulose bound DNA but fails to correlate

that portion found in the blot with the portion of probe hybridizing in

reciprocal crosses. To obtain this information fragments which failed

to show homology when bound to nitrocellulose were extracted from gels

after endonuclease digestion and gel electrophoresis. These fragments

were nick translated and then used as independent probes in cross hybridi-

zation assays. Figure 24 shows the results of such an assay using the

EcoRl A and C fragments of Ad2 as probes against a HaeII digestion blot

of AAV. On the left is the autoradiograph of total AAV hybridized to

an EcoRl digest of Ad2 under stringent conditions (hybridization over-

night at 68C in 5XSSC and final overnight wash at 68C in O.5XSSC).

















SSC \ cs-






Tec 4 s4
..AA -c


Helo
IX


i-
















,,a ?:"




I



, ,.' -


Ad crobe
X IX .5X



Bli- Hoell



A' r^ ;.


,'.4










D |



E *.,*^


F L:


Figure 23. Autoradiograph of Ad2 Probe Hybridized to AAV


















Ad AAV
Ad2 -
Eco Rl ,:





& V





4.1.


C







E




F


SV40


AAV Ad RI
AAV '" "
Hasl1


Autoradiograph of AAV/Ad2 Cross Hybridizations


-A RI-C


* .^,.



* '1
j it*









* .4
* I'.


"'
"'I
p
>



*






: :O










t
i.e


HSV


I.


Figure 24.








The AAV probe binds only to the EcoRl D and F fragments. A self

hybridization with an Ad2 probe was done to confirm that all the diges-

tion fragments were transferred efficiently to the blot. A specificity

control is also shown using a nick translated SV40 probe. The EcoRl

A and C fragments were extracted from another portion of the gel and

nick translated. The findings are shown on the left. A total Ad2 probe

bound to the HaeII A and C fragments of AAV. The EcoRl A and C probes

of Ad2 showed no homology with AAV under these conditions of hybridiza-

tion. The HaeII A and C fragments of AAV contain the terminal inverted

repeats, which have been shown to have a high G+C content. For this

reason HSV-1 DNA, which also has a high G+C content, was used as a

control for nonspecific hybridization and none was found.

Because of its defective nature AAV must be grown in the presence

of Ad. Unfortunately this situation permits the potential cross contam-

ination of AAV viral stocks with Ad DNA. To limit this occurrence both

AAV and Ad DNA stocks were extracted from CsCl gradient purified virions.

The possibility still remains that a small portion of the contaminating

DNA may have been packaged in the reciprocal viral capsid, thus copuri-

fying throughout the preparative procedure. It may be argued that such

an event could in part give rise to the finding demonstrated in the

previous experiments. In dealing with this argument two approaches have

been taken. First, Ad5 stocks which were maintained continually in the

absence of AAV were cut with BamHl giving rise to two fragments of

approximately 14.3x10 dalton and 9.7x10 dalton in size. After electro-

phoresis the digest was transferred to nitrocellulose and hybridized

with a nick translated probe of total AAV which had been grown in cocul-

ture with Ad2. Hybridization with the AAV probe involved only the high






66

molecular weight Ad5 BamHl fragments and showed no smaller contaminating

AAV fragments. The second approach was to hybridize Ad DNA from a viral

stock shown to be free of AAV by EM studies, to AAV DNA generated from

a clone of the entire genome inserted into pBR322. The Ad DNA for this

assay was donated by Peter McGuire, Department of Biochemistry, Univer-

sity of Florida, and the 620 pBR322 clone of AAV was a gift from Jude

Samulski, Department of Immunology and Medical Microbiology, University

of Florida. In both cases, the results confirm the previous findings

in the AAV and Ad2 cross hybridizations. The hybridization studies on

Ad5 were extended to map the regions of the genome to which binding was

most stringent. For this purpose EcoRl and Hindill digests were used

and again the salt conditions for the hybridizations or washes varied.

The findings are compatible with those previously found for Ad2. A

summary of the cross hybridization mapping studies is shown in Figure

25.

To evaluate in better detail the cross hybridization studies a

computer comparison was done of the entire nucleotide sequence of AAV-2

against the published sequences of the first 11,600 bases of the left

half of Ad2 and the final 8,561 nucleotides of the right half of Ad2.

Three programs were run: the first conducted a random search for

sequences with a minimum perfect match of six bases, the second searched

for a 3 out of 5 base match and the third looked for a 7 out of 10 match.

In general the data showed extensive random homology throughout both

genomes. This is supportive of the less stringent hybridization studies.

If one analyzed the data for sets of adjacent homologies that mapped

co-linearly between the two genomes these sequences were invariably

found within the terminal 20% of the AAV genome, again corroborating the

hybridization data. The following are comparisons of some of the

















Adenovirus t


Ecc R I


A C B



Hind III
73 .C 97.3


G E C H A B F



Eco R I Acenovirus 2
707 89.7
___________1 t=^ -

AB F D E C



Hpa I



E C F A B 0 G


0 10 20 30 40 50 60 70 80 90 100


Adenc asscci ted Virus
Hoe II
15.6 607


C E F B D A

Hpo ;I



T'- V P N F B FR K US A L E
H C


S C 2C 3C


40 5C C: 70 80 90 J'0


Figure 25. Mapping of Homologous Regions in AAV and Ad






68












__ Iliaoll

44
U 1IL "


C6C
W >1
--a


^ ~111 -o r.! 0? .
I1 . i,, 1








II<
CI) tg
Illl-









Ic 0
1N I

cjl









'I,1 FE4
"rr lio



C uJ -I E )T


U),
^ g .- t_ -o-"T



0l 0 E

<- E



V)
1rn


Cj-
*
U-
:3
cm
Ll-








sequences found in this manner. "These-regions of homology .have been

numbered and are summarized in Figure 26.

Upon comparison the portion of the Ad2 genome mapping 7930 to 7999

base pairs in from its right terminus shows a 71% sequence homology with

the 60 base pair sequence beginning 40 nucleotidesin on the inverted

terminal repeat of AAV (see Figure 27). This maps within the EcoRl D

fragment of Ad2 78% of the B and C' domains of AAV are conserved as are

the functions between B and B' domains and the C' to A' junction.

Eighty-eight percent of the C reiteration of AAV is retained. Approxi-

mately 20 nucleotides upstream from the homologous stretch shown the

sequence 5' TGCGC 3' is conserved in both genomes; similarly 25 nucleo-

tides downstream in both genomes the sequence 5' CTCCA 3' is retained.

The sequence 5' CTCACCGG 3' shown in figure 27 in Ad2 complements the

3' end of the first leader sequence in the E3 transcription complex

(Herisse et al., 1980).


B B' C C' A'
AAV CCGGGCGACCAAAGGTCGCCCGACGCCCGGGCTTTGCCCGGGCGGCCTCACTGAGCGAG
IIIII I lllll I IIII III1IIII II 11 1 1 HII 1I II I
Ad2 TCGGGCAATCAAAG ACTCCCGGAGCCCGGGCAAAGCACTGGCGGCGGCAGTGGTCGAG 7
I i 7999
T / A G TGT
TAACAAA

Figure 27. Ad2 Early Region 3A (Herisse et al., 1980)

Figure 28 details the sequence homology surrounding the beginning

of the second coding region in AAV and a homologous stretch in Ad2

starting 5252 nucleotides in from the right terminus. This 53 base

pair sequence maps to the EcoRl E fragment of Ad2 and is part of

sequence involved in the E3 transcription complex. There is about 69%

total sequence homology between the two genomes over this area and it

should be noted that the ATG start signal found in AAV is absent in the







Ad2 sequence. Figure 29 compares a 26 nucleotide sequence found just

outside the inverted terminal repeat of AAV starting at base pair 144

to a similar region in the terminal repeat of Ad2. 'There is an 87%

homology between the two regions.


AAV TCAGCCAGGTACATGGAGCTGGTCGGGTGGGTCGTGGACAAGGGGATTACCTCGGAG 1306
1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1
Ad2 GCA CCAG TTTTTGGCGCTGGGTGGGTAGCTTGTAGCTGAGGCGGTTGCC GGAG 5305
T

Figure 28. AAV Coding Region 3 (Heriss6 et al., 1980)


AAV CTGGAGGGGTGGAGTCGTGACGTGA 168
I I I I 1 1 1 1 I I 1 1
Ad2 ATGAGGGGGTGGAGTTGTGACGTGG
1 70
T

Figure 29. Ad2 Terminal Repetition (Herisse et al., 1980)



Although cross hybridization assays failed to reveal any homology

between HSV and AAV three lines of evidence suggest at least a general

similarity in the architecture of their genomes. The termini of both

genomes contain a tandem array of natural and inverted repeats. Portions

of these repeat regions may be flipped or inverted in their relation to

unique regions of the genomes and this flip-flopping appears to be a

natural consequence of viral DNA replication. And lastly there is an

inherent ability within the replication cycle for maintaining identity

between the termini through some mechanism of gene conversion. The

reiterated sequences in both viruses probably contain the origin of

replication and at least some early regulatory function. A comparison

was made between the terminal reiterated sequences of AAV and the pub-

lished sequence for the L/S junction of HSV-1, which contains the HSV














LCn













co L.D
(ct-- .c!



0D-- O u








C5~ - -- 0

<-:- (-L









CD uL


(!D -L


- -CD
cD -c u
<--






c::J -(F,
to --u












CD C)
0j < -^
0--










F:- I-c
CD --
0- 0J














<-H-
c0 --
0 -0 0 -























0- 0D
<-H-0--





0 U
-" <-H-
0) -C0
0D-C0
0D- 0)
0)-C0
0- -D-C)


















u 0C -C)

I-I -)-gD

egH- -<
0 -
CD- C)-
Q- aC)-CD
>- 0D-C0







C)0 -C0


0 -
H0-






72

terminal repeats also. Figure 30 presents the "flip" and "flop" orien-

tations of the AAV genome to which the HSV sequences were compared.

The direct repeat which brackets the ends of the a reiteration in

the termini of HSV-l has a similar sequence to the B', C, and C' domains

of the AAV hairpin. The short palindrome GCCCGGGC forms the core of

this repeat in HSV-1 DNA. This palindrome is found in the core of the

inverted repeat of AAV also. One finds that 80% of the base sequence

is conserved between the HSV-1 direct repeat and the B', C and C'

domains of AAV DNA. The nucleotide sequences bordering the palindrome

conserve 66% of the B' and C' repeated domains (see Figure 31).

B C C'
AAV GGTCGCCCGACGCCCGGGCTTTGCCCGGGCG 86
11 111 I I I IIIIII 11 1 1 11
HSV GGCCGCGGGGGGCCCGGGCT GCGCCGCCG 213
DR1

Figure 31. Homology between short palindromes in HSV-l and AAV
(Mocarski et al., 1980)


By expanding the comparison of this region in HSV with AAV one finds

approximately 72% of the flip orientation of the AAV terminal palindrome

is conserved in the HSV sequences (see Figure 32). Eighty-two percent

of the nucleotides reading from roughly the middle of the A domain of

AAV through the C and into the C' domains are the same. Approximately

110 base pairs upstream in the HSV-l map from the sequence described

above one finds a stretch of 43 nucleotides which can be aligned with

the flop orientation of the AAV termini. Having done this there appears

to be roughly 84% homology between the two genomes in this region. As

one continues to read in a 5' to 3' direction the HSV sequence is highly

compatible with the terminal domains of AAV arranged in the order A, C,

C', B, B', C, C' then A. There is an 84% homology between genomes in



























L-) (S
C( C)
C) C)CJ

C)

CC
F-
F-













F-
CJ













(S C-CD
CD CD













CD- CD
C D C) C(
J-'-CJ




0) CD

C (SCD

















CJ CD
I- C3
CD- C3
< -cc
















3J CD
SC)-C3- C)



F- C
0--

FJ--
CJ- CD

C3--C3


F- C
C)- C3

-J CD--(S

C)-- CJ



C) CD

C)C3-CJ
C) C3


.-:

C) < CC
(3 F---F- (D
C-)--<) I-




G (3 CD
F-- D- :
co F- F-











CD--0 I-
(_> CD (S














C) D(


CD-(D (
CD--I- (
:I,- (<













CDS -U C3
D- D (S
(S















CC
(_)
F-U

- CD C)
C) (3S- I-
(3--S3C0 (S
(S 0: I-
U3--F-^I (S c
(S--(S\I-- 0)



(S F- \(S

*a I- \<
C-) (S3 \(

(S C3) t
C)- 0


0-'-C)



(S--(S

I- <:

C5--CD~(

CJ-'-C)et
0 0S


(S CO




(S -(S
U3 0 (
(3--C3
- C <) (
Co C-)--0

F- <)
(S-(S3


F- -F-


0 I-
C) F
C-) --U




CD C
Co C)
(3
CD
C)



C3 -L)C
F--

CD--(D
C)- C)
- (3 C)
CD) C
C-) C)
C -SC3


C-) C)


SU-F
0--C)



(S (S-
(S -(S-


0-C-)
(S-(
C3-- C3
C~-)C)'C
C-) (S








U,
I- 0
*=3 C3) C

(-'-C-)

(-'-o)
C F--F-
I- I-
(S --CS-)
C)-C
F-)-F
C3-C




L)

S-

C

1-












V)
c-
















E
C














4)
4-
0

V)




C) =3

0a
E -
aC:







0 c


4-)E







E=
-cl
-i--
CC

0














V,)
1.-

(U >








this first half of this array. The second half of the array is con-

served in 68 to 70% of the sequences.

The ends of the HSV sequences displayed in Figure 32 are separated

by 20 nucleotides. This boundary is formed in part by a twelve base

pair inverted repeat.

As one reads downstream From the end of the proceeding sequence

through the A reiteration of HSV, one comes to the direct repeat

defining its far terminus. Again this region can be aligned with the

terminal AAV sequences. About 63% of the sequence of the A domain is

conserved and the short palindrome GCCCGGGC is retained in full within

both genomes (see Figure 33). The sequence ACTCC is found 51 base pairs

downstream from this short palindrome in both AAV and HSV, followed by

the sequence GGTTCCT. In HSV these two short sequences are contiguous

while in AAV they are separated by 10 base pairs.

A C
541
AAV CACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCAAAG
I 1 I1 1 1 11111 i 111 1 1 1 1 1II 11111111
HSV CCCGCCTTTTTTGCGCGC CGC CCCGCCCGCGGGGGGCCCGGGCTGCC 685
----- DR1 -----685
DR1

Figure 33. Homology between the terminus of the short unique region in
HSV-l and the terminus of AAV (Mocarski et al., 1980)













DISCUSSION


The trigeminal ganglia of 22 patients have been assayed for HSV

sequences by DNA/DNA hybridization: None of the patients manifested

clinical evidence of recurrence at the time of death nor was a history

of recurrence noted. Fourteen of the patients were sero-positive for

HSV. A positive serology was assessed as a complement fixation titer of

1:8 or greater. The RNA from the trigeminal ganglia of 16 patients was

also surveyed for HSV transcripts by RNA/DNA hybridization.

Hybridizations were conducted in 50% formamide and 5XSSC solution

at 37C. Given a Tm of 97C in 1XSSC and a G + C value of 68% the calcu-

lated value of the Tm for HSV in 5XSSC would be approximately 104C

(Sheldrick and Berthelot, 1974). Allowing for a 0.7C decrease in the Tm

value for each 1% of formamide present and a 1C lowering for each 1.5%

mismatching of base pairs (McConaughy et al., 1969), the initial condi-

tions of hybridization would permit a 21% mismatch in base pairing be-

tween the probe and nitrocellulose bound DNA. Subsequent washes in 1XSSC

and 50% formamide at 37C would permit no more than a 16% mismatch to be

retained. In like manner it can be calculated that washes in O.1XSSC

solution alone at 68C would permit no greater than 10% mismatch in base

pairing. Consequently, the signal retained in hybridizations between the

HSV-1 probe and ganglia containing HSV-2 DNA or transcripts would be

greatly subdued. In such instances the strongest binding would occue in

the regions of greatest homology between the two types, namely, the

termini and L/S junction.






76

Under any of the above conditions control experiments demonstrated

that the HSV-l nick translated probe failed to bind to DNA from unin-

fected human ganglia or connective tissue as well as to the DNAs of AAV,

SV40 and Ad2. All three of these viruses have a demonstrated potential

for latency in human cell lines in vitro. In reconstruction experiments

using blots of 6% acrylamide gels, we were able to detect 5 pg of viral

DNA in the presence of 10 pg of carrier DNA, a dilution factor of

2xlO6. Similarly 10 pg of viral DNA could be detected in the presence

of 10 jg of carrier when hybridization was to Southern blots of 0.5%

agarose gels. Any real differences in the sensitivities of these two

approaches is largely indicative of the increased diffusion witnessed

when transfer was from low percentage agarose gels. If the DNA content

of the normal diploid human cell is 5 pg (Luria and Darnell, 1978), the

10 pg of ganglia DNA normally assayed would represent the product of about

2x106 cells. Thus, given the molecular weight of the HSV genome is 108

daltons, the sensitivity of our hybridization assay is such that we can

detect roughly 1 copy of the HSV genome per 200 cells.

In 18 of the 22 assays in which trigeminal ganglia were evaluated

for the presence of HSV, total ganglionic DNA was cleaved by endonuclease

digestion, transferred to nitrocellulose and probed with nick translated

HSV DNA. Eleven of these patients were sero-positive for HSV. Nine of

the sero-positive were shown to carry HSV DNA and two of these were also

shown to be positive for RNA transcripts. The nucleic acid from two of

the sero-positive patients failed to demonstrate HSV specific sequences

in either DNA or RNA. Only one of the seven sero-negative patients gave

evidence of the presence of HSV DNA or RNA; the remainder were negative.

Thus, there is a positive correlation between the presence of compliment






77

fixing antibodies and the presence of HSV specific sequences as measured

by this approach.

Two patients warrant some further discussion. Patient #941 was a

1 year old male who died from congenital lobar emphysema. Although both

viral DNA and RNA were detected repeatedly in the trigeminal ganglia no

humoral immune response to HSV could be determined by either complement

fixation or indirect immunofluoresence assays. The patient had not

received sufficient immunosuppressive therapy to negate a humoral re-

sponse nor was there evidence of congenital failure of the humoral immune

system. It is possible the primary viral infection of the infant occurred

before the humoral immune system was competent enough to mount a response

and no subsequent recurrences occurred. No viral DNA was detected in the

ganglia from patient #949 although RNA transcripts from the short repeat

regions of the HSV genome were demonstrated. It may be that only this

portion of the genome was latent in the ganglia; these findings would

then mirror the varied sensitivities of the two experimental approaches.

The detection of only part of the HSV genome in several of the

ganglia raises the question of whether the remainder of the genome is

absent. Brown et al (1979) has reported the detection of latent defec-

tive HSV by complementation of the endogenous genome iwth ts mutants of

HSV-1 in 8 out of 14 individuals previously negative for spontaneous

release of virus. The altered migration or absence of the terminal EcoRl

K fragments revealed in patients #228 and #227 could be examples of such

an event. The frequency with which large deletions could occur would be

greatest in the terminal regions of the linear genome. Conversely, it

may be argued that these fragments have undergone an apparent increase

in molecular weight due to covalent linkage with host DNA or some other








form of rearrangement. The approach taken here would not resolve this

issue. Frequently the regions which we failed to detect gave rise to

smaller endonuclease digestion fragments whose copy number would fall

below our level of detection. The sensitivity of our assay would allow

us to detect a fragment representing 1% of the genome only if it was

present in at least 1 copy per cell. The findings in patients #1082 and

#1089 probably fall within this category.

In a recent repetition of this approach using human brain tissue

Fraser et al (1981) reported the detection of HSV DNA sequences in six of

eleven individuals assayed. Hybridization against total viral DNA

revealed all or portions of the HSV genome were present in the six posi-

tive individuals. Hybridization against the clone pRB115 showed a

marked alteration of the electrophoretic migration pattern of the ter-

minal fragment in oen individual and no change in the two other patients.

The findings of the CsCl enrichment studies lead us to consider the

possibility that the bands we detected by blot hybridizations are the

product of a lytic infection that ensued at the time of death. The

positive controls using DNA from a known HSV infection insures that the

mechanics of this approach were efficient enough to retain sufficient

levels of viral DNA if this were the case. Given the sensitivity of the

hybridization assay itself and the negative findings in known sero-posi-

tive patients a reasonable argument can be made against an ongoing lytic

infection within the ganglia.

RNA from the trigeminal ganglia of 16 patients was screened for HSV

specific transcripts by DNA/RMA hybridization. In 8 of these patients
1251-labeled ganglia cytoplasmic RNA was hybridized to either EcoRl or

Hpal endonuclease digests of HSV-1 F strain DNA bound to nitrocellulose

paper. We were able to demonstrate HSV specific RNA transcripts in two






79

of three sero-positive patients assayed and one of the five sero-negative

patients. The medical history of the single sero-negative patient, ':941,

has been discussed along with our findings from DNA/DNA hybridizations.

From the mapping of those RNA transcripts observed it is clear that the

regions of the genome most frequently encountered to date are those con-

taining sequences in the immediate early and early mRNA species of HSV-l

(Clements et al., 1979; Roizman, 1979).

Because of the frequency with which transcripts mapping to the region

of the L/S junction were encountered, the cytoplasmic RNA from 9 indivi-

duals was used as a probe in hybridizations against endonuclease digests

of the clone pRB11I5. Eight of these patients were sero-positive. None

of the patients contained RNA which would hybridize with pRB115. This

result was curious in view of the fact that RNA was present which would

hybridize to the larger EcoRl K fragment present in EcoRl digests of the

total HSV genome. It can be argued that the two probes allowed the

recognition of a subset of transcripts associated with latency, namely,

a set of transcripts mapping to a region of the EcoRl K fragment not

common to the BamHl P fragment. The region running downstream from the

right end of BamHl P to the right terminus of EcoRl K is approxiamtely

1.8 kb in size (see Figure 13).

Using the tsB2 mutant Holland et al (1979) has reported finding no

mRNA species of greater than 3 kb in this region. This temperature sen-

sitive mutant is one of a group of ts mutants mapping within the sequences

of the short reiterated region which code for ICP4 (Schaffer et al., 1973).

The viral gene function coding for transition from immediate early to

early polypeptide synthesis also maps to this region and is thought to be

a function of ICP4 (Preston et al., 1978). Studies of protein synthesis








during temperature shift experiments on this group of mutants suggest

that ICP4 is autoregulated (Schaffer et al., 1973). The 5' terminus of

IEmRNA-3 which is believed to code for ICP4 lies within the 1.8 kb region

described above (Watson and Van de Woude, 1982; Clements et al,, 1979;

Anderson et al., 1980). Transcription is normally in a leftward direction

proceeding into the region of the BamHl P fragment at the joint (iaxam

and Gilbert, 1980).

Finally, two ts mutants of ICP4, tsD and tsK, have been assayed for

their ability to establish latency in mice; tsK fails to establish

latency in mice while tsD will (Stevens and Cook, 1971). Both mutants

block viral DNA synthesis. Thus two ts mutants within a single gene

within this region can distinguish between viral functions permitting

subsequent DNA replication and the establishment of latency. In light

of the above findings further evaluation of transcription through this
=
region during latency is warranted, especially in animal models.

Another portion of the genome highlighted by the transcription

studies is the region mapping from about 0.08 to 0.65, especially the

area from 0.1 to 0.3 (see Figure 13). The bulk of the early viral pro-

teins genes are within these domains (Schaffer et al., 1973). The genes

for the viral thymidine kinase and the viral DNA polymerase of both HSV-1

and HSV-2 map within the region 0.27-0.43 (Clements et al., 1977; Schaffer

et al., 1973). Spear and Roizman (1972) have reported a correlation be-

tween viral induced oncogenic transformation and ICP8 within the region

from 0.30 0.45 map units. Stevens and Cook (1971) have demonstrated

a latency negative phenotype for the mutants tsA, tsS, tsT, and tsl; all

of which map within the region 0.1 to 0.6. It is noteworthy that in

subsequent mappings of RNA transcripts by in situ hybridization,

Galloway and McDougall (1981) have consistently found the region 0.1 to






81

0.3 represented in ganglia; other regions including the L/S junction were

variably demonstrated. In similar studies of HSV RNA in cervical car-

cinoma cells sequences spanning map positions 0.07 to 0.4, 0.58 to 0.63,

0.82 to 0.85 and 0.94 to 0.96 were represented (McDougall et al., 1982).

These findings are noteworthy because of the collinearity of the HSV-l

and HSV-2 transcription maps. Taken in total, the studies are supportive

of our findings and suggest that a subset of the immediate early and

early genes are involved in the establishment and maintenance of latency.

The binding of 32P-labeled HSV DNA to restriction endonuclease

digests of ganglia DNA, or conversely 1251-labeled ganglia RNA to HSV

DNA has permitted several questions to be considered. Those regions of

the viral genome which are represented have been determined by simply

noting the presence or absence of given viral DNA bands on the autoradio-

graph. Although it is reasonable to expect the entire genome must be

present as a single unit to give rise to recurrence, some cells within

the population may carry only portions of the viral genome. It is there-

fore not surprising to find an apparent unequal molar representation of

viral fragments. This is demonstrated by our findings and suggested by

previous work on viral thymidine kinase in ganglia (Yamamoto et al., 1977).

Finally, the question of whether latent viral DNA is covalently

intefrated into cellular chromosomes was approached. Any digestion frag-

ments which are covalently linked to cellular DNA will migrate in the

agarose gels with an apparent increase in molecular weight as a result

of the added cellular component. Digests of viral DNA present as a free

circular episome would also have an altered migration for the terminal

fragments. DNA sequestered in immature nucleocapsids would give rise to

banding patterns similar to that of wild type viral DNA. In interpreting

such data it should be noted that most virus isolates from ganglia






82

explants, to date, have yielded unique endonuclease restriction patterns.

Thus for alteration in electrophoretic migration to be reasonably com-

ponent, the shift should be significant and repeatable when the ganglia

DNA is restricted with an enzyme such as Xbal which does not reveal

strain differences in HSV. When the latent virus is HSV-2 the fidelity

of hybridization with the HSV-1 probe could also be significantly reduced.

Thus although our data is compatible with integration of HSV into cellu-

lar genomes, it is not sufficient to prove it.

Hybridization of 1251-labeled cytoplasmic RNA to digests of HSV DNA

demonstrates the presence of viral RNA transcripts in the ganglia. The

design of our experiments using several different restriction digests of

HSV enabled us to corroborate our findings and more finely map these

sequence homologies. Autoradiographic density of hybridized bands per-

mits estimates of the frequency of given RNA species in our sample.
125
For this reason control reactions were run with the 1251-labeled cyto-

plasmic RNA from both HSV lyticly infected Hep2 cells and uninfected

tissue cultures for comparison. This experimental approach answers the

question of which regions of the latent HSV genome are undergoing active

transcription. The fact that only a subset of the RNA transcripts were

found in latently infected ganglia suggests that some HSV genes may be

necessary for maintenance of the latent state.

A number of general observations have prompted the inclusion of a

comparative analysis of the HSV, Ad, and AAV genomes within this study

of HSV latency. The genomes studies are representative of the three

linear DNA virus families whose members are known to replicate within

the nuceli of human cells. Architecturally each of these linear genomes

contains inverted repeats within their terminal regions. Each of the

viruses have a demonstrated potential in vitro for latency in human cells.








And lastly, the defective parvovirus (AAV) is absolutely dependent upon

coinfection with either an edenovirus or herpesvirus for its multiplica-

tion.

In the absence of a coinfecting helper, AAV enters the cell where

its virion is uncoated within the nucleus. No detectable macromolecular

synthesis occurs at this time. The naked AAV DNA may then establish a

stable relationship with the host cell (Hoggan et al., 1966; Cheung et al.,

1980). Subsequent infection with a helper virus promotes the multiplica-

tion of infectious AAV within these latent cells. Although the nature of

this stable relationship between AAV and the host cell is complex, it is

clear that at least a portion of the genome is covalently linked to

cellular DNA and in part copies of the entire genome are tandeomly

arrayed within this linkage with cellular DNA (Handa and Shimogo, 1977;

Cheung et al., 1980). Our findings demonstrate a substantial sequence

homology within apparent regulatory regions between the defective genome

and those of its helpers. This is of particular interest since no bio-

chemical relatedness has been previously demonstrated between these

viruses and the principal role the helper plays in this partnership is

the promoting of AAV macromolecular synthesis.

Although 6 to 12 base pair stretches of homology with AAV were

found randomly throughout the Ad genome these homologies were concen-

trated largely within the terminal sequences of the AAV genome. The

strongest co-linear homologies between regions of the two genomes which

at present appear to have no functional relatedness, involve the EcoRl

D and F fragments of Ad and the terminal repitition of AAV. Two examples

of sequence homology within these regions have been described. The

first of these analyzes the area surrounding the 3' end of the first

leader sequence in the E3 transcription complex of Ad and the termini








of AAV. The second compares the beginning of the second coding region

in AAV and a portion of the E3 transcription complex. The second exam-

ple actually lies within the potential coding sequence of the 14K E3

polypeptide of Ad (Herisse et al., 1980). Because the function of E3

region of Ad is obscure, it is difficult to evaluate these homologies.

There is no evidence to date which directly ascribes a specific regula-

tory role during transcription to the terminal repetition in AAV nor has

a role been assigned to the E3 transcription products of Ad. Transcrip-

tion of the E3 complex is nonessential for growth of Ad or AAV in vitro

(Richardson and 'Jestphal, 1981).

Two other short stretches of homology hying within the left half

of the Ad genome were also found. The first of these is the 26 bp

stretch in AAV (142-168) which is complimentary to a portion of the

inverted terminal repeat of Ad. The second is the AAV sequence sur-

rounding the TATA box 31 bases upstream from the leftward most site of

initiation of transcription. It has a 17/19 base homology with a com-

parable sequence upstream from the initiation of the Ad5 early region

1A transcripts. Lusby et al (1980) had previously reported these are

example regions with a potential role in transcriptional regulation.

Taken in total the data suggest a conservation through evolution of

regions of these genomes involved in transcriptional regulation.

As noted previously several lines of evidence suggest at least a

general similarity in the architecture of the AAV and HSV genomes. The

termini of both genomes contain a tandem array of natural and inverted

repeats. Also portions of these repeated regions may be inverted in

their relationship to unique regions of the genome as a natural conse-

quence of viral DNA replication (Lusby et al., 1980; Mocarski et al.,






85

1980). And there is apparently an inherent ability within the replica-

tive cycle for maintaining identity between the termini through some

mechanism of gene conversion. Probable origins of replication and at

least some early regulatory functions lie within the reiterated sequences

in both viruses.

The nucleotide sequence of the natural terminal repeat in HSV-1 F

was used for the comparison with the terminal 200 nucleotides of AAV

described in this study. The terminal 200 nucleotides of AAV contain

the 143 bp inverted terminal repeat. This region can further be broken

into two smaller internal palindromic sequences which are bracketed by

a larger repeat and its inverse (Lusby et al., 1980). The 5001 bp

natural repeat in HSV-l F is inverted to form the junction of the long

and short unique regions of the genome; thus each unique arm of the

genome is in turn roughly similar in architecture to the AAV genome, as

is the whole. The 501 bp sequence is composed of 20 direct repeats of a

12 nucleotide sequence, 3 repeats of a 37 base sequence and some inter-

nally unique sequences; the entire domain is bracketed by a 20 base pair

direct repeat (Mocarski et al., 1980).

Our findings demonstrate an extensive homology between portions of

the HSV inverted repeats found at the L/S junction and termini with the

termini of AAV. The regions of HSV homology are 1) those regions of

the "b" reiteration which bracket the long unique region and are imme-

diately adjacent to the "a" repeat, 2) those portions of the "c" reitera-

tion which bracket the short unique region and are contiguous with the
"a" repeat, and 3) the 20 base direct repeat (DRI) which brackets the

"a" repeat. The high G + C content and repetiveness of these regions

would explain our earlier failure to find these homologies by Southern

hybridization.








The extensive homology between DRI and the small internal palin-

dromes of the AAV sequence is of particular interest. The short palin-

drome GCCCGGGC has been totally conserved within both. A role for DRI

has been proposed in both the site specific cleavage of concatomeric

replicative intermediates of HSV and the inversion of the long and short

domains (Mocarski et al., 1980). Similar, deletion mutants within this

sequence in AAV are unable to resolve high molecular weight intermediates

in DNA replication. Fifty-one base pairs downstream from GCCCGGGC in

AAV one finds the sequence ACTCC followed nine base pairs further down-

stream by the sequence GGTTCCT; ACTCC is the probable cleavage site for

the inversion of the AAV terminal palindrome and resolution of the hair-

pin during DNA replication. The sequence ACTCC followed by GGTTCCT is

also found within the "c" reiteration of HSV-1 F fifty-one bases down-

stream from the sequence GCCCGGGC within DRI. The question of whether

this arrangement is coincidental or the sequence actually serves a

similar function in the replication of both genomes will require genetic

analysis. It should be noted that HSV-l F strain DNA contains a single

copy of the "a" reiteration at its right terminus and the putative

cleavage site for resolution of concatomers is thought to lie within or

just outside the "a" reiteration adjacent to the "c" repeat (Mocarski

et al., 1980).

The terminal sequences of AAV DNA appear to be intimately involved

in the integration of latent AAV DNA into cellular chromatin. Endo-

nuclease analysis of AAV DNA from early (10) and late (118) passages of

latently infected cells demonstrated that the only sequences altered

during clonal passage were those within the palindromic region of the

terminal repeat, specifically, the sequence GCCCGGGCT which contains the






87

Smal recognition site (Cheung et al., 1980). Thus these sequences could

potentially serve a similar role in latency of HSV.

The conservation of similar GC content and architecture between

the termini of several parvoviruses supports the genetic evidence

assigning identical biological roles to these regions. These observa-

tions appear to signify the direct involvement of the termini in viral

multiplication. Further the potential to form nearly identical curci-

form structures through secondary folding of their 3' termini appears

to be stringently conserved even within those genomes which have signif-

icant sequence divergence from that of AAV. Thus the evolution of

this family of small DNA viruses has conserved both primary sequence and

secondary structure within a region of the genome in which both must

interact in the preservation of fidelity in viral replication.

The question of whether sequence homology between AAV and HSV is a

consequence of similar function warrants further investigation in light

of the findings within the parvovirus family. Our observations to date

do not permit the assumption that homologous sequences serve identical

functions within AAV and HSV. A cursory analysis of the homologous

sequences in HSV reveals that they are not self complimentary and cannot

easily be ascribed a secondary structure similar to AAV. Determination

of whether the primary sequence within HSV would lend itself to the

formation of a stable curciform secondary structure is central to this

line of investigation. In conclusion the sequence homology between AAV

and HSV demonstrates the potential for similar mechanics of early regu-

lation and macromolecular synthesis, events which appear to be concomit-

tant with the establishment and maintenance of latency.













LIST OF REFERENCES


Anderson, K., J. Stringer, L. Holland and E. Wagner. 19791 Isolation
and localization of herpes simplex virus type I mRNA. Journal of
Virology. 30: 805-820.

Anderson, K., L. Holland, B. Gaylord and E. Wagner. 1980. Isolation and
transcription of mRNA encoded by a specific region of the Herpes
Simplex virus type I genome. Journal of Virology. 33: 749-759.

Atkinson, M.A., S. Barr and M.C. Timbury. 1978. The fine structure of
cells infected with temperature sensitive mutants of herpes simplex
virus type 2. Journal of General Virology. 2: 517-536.

Bachenheimer, S. and B. Roizmano 1972. Ribonucleic acid synthesis in
cells infected with herpes simplex virus. Journal of Virology.
10: 875-879.

Baringer, J.R. 1974. Recovery of herpes simplex virus from human
sacral ganglions. New England Journal of Medicine. 291: 828-830.

Baringer, J.R. 1975. Herpes simplex virus infection of nervous tissue
in animals and man. Progress in Medical Virology. 20: 1-26.

Baringer, J.R. and P. Sworeland. 1973. Recovery of herpes simplex
virus from human trigeminal ganglions. New England Journal of
Medicine. 288: 546-650.

Bastian, R.O., A.S. Rabson, C.L. Yee and T.S. Tralka. 1972. Herpes
hominis isolation from human trigeminal ganglion. Science. 178:
305-307.

Becker, Y., H. Dym and I. Sarov. 1968. Herpes Simplex virus DNA.
Virology. 36: 184-192.

Berns, K.I. and W. Hauswirth. 1978. Parvovirus DNA structure and
replication. Replication of Mammalian Parvoviruses. Cold Spring
Harbor Laboratory Press. pp. 13-32.

Biswal, N., B. Murray and M. Benyesh-Melnick. 1974. Ribonucleotides in
newly synthesized DNA of herpes simplex virus. Virology. 61:
87-99.

Brown, S.M., J.H. Subak-Sharpe, K.G. Warren, Z. Wroblewska, and H.
Koprowski. 1979. Detection of uninducible herpes simplex virus
genomes latnet in human ganglia explants. Proceedings of the
National Academy of Science, U.S.A. 76: 2364-2368.








Buchman, T.G., B. Roizman, G. Adams and B.H. Storer. 1978. Restriction
endonuclease fingerprinting of herpes simplex virus DNA: a novel
epidemiological tool applied to a nosocomial outbreak. Journal
of Infectious Diseases. 138: 488-498.


BUnemann, H. and W. Muller.
stranded DNA: affinity
Nucleic Acids Research.


1978. Base specific fractionation of double
chromatography on a novel type of absorbant.
5: 1059-1074.


Carton, C.A. and E.D. Kilborne. 1952. Activation of latent herpes sim-
plex by trigeminal sensory-root section. New England Journal of
Medicine. 246: 172-176.

Centifanto-Fitzgerald, Y., E. Varnell and H. Kaufman. 1982. Initial
herpes simplex virus type 1 infection prevents ganglionic super-
infection by other strains. Infection and Immunity. 35: 1125-
1132.

Centifanto-Fitzgerald, Y., T. Yamaguchi, H. Kaufman, M11. Tognon and B.
Roizman. 1982. Ocular disease pattern induced by herpes simplex
virus is genetically determined by a specific region of viral DNA.
Journal of Experimental Medicine. 155: 475-489.


Cheung, A., D. Hoggan, U. Hauswvirth and K.I. Berns. 1980.
of the adeno-associated virus genome into cellular DNA
infected human Detroit 6 cells. Journal of Virology.


Clements, J., R. Watson, and N. Wilkie. 1977.
herpes simplex virus type I transcription:
on the viral genome. Cell. 12: 275-285.


Integration
in latently
33: 730-748.


Temporal regulation of
location of transcripts


Clements, J.D., T. McLaughlan and D.S. McGeoch. 1979. Orientation of
herpes simplex virus type 1 immediate early mRNAs. Nuclear Acid
Research. 7: 77-93.


Comerford, S. 1971. lodination of Nucleic Acids in vitro.
10: 1993-1995.


Biochemistry.


Cook, M.L., V.B. Bastone and J.G. Stevens. 1974. Evidence that neurons
harbor latent herpes simplex virus. Infection and Immunology. 9:
946-951.

Cook, M.L. and J.G. Stevens. 1973. Pathogenesis of herpetic neuritis
and ganglionitis in mice: evidence for intra-axonal transport of
infection. Infection and Immunity. 7: 272-288.

Cook, M.L. and J.G. Stevens. 1976. Latent Herpetic infections following
experimental viremia. Journal of General Virology. 31: 75-80.


Daniels, C.A., S.G. LeGoff, and A.L. Notkins.
infectious virus-antibody complexes from
patients with recurrent herpes labialis.


1975. Shedding of
vesticular lesions of
Lancet. 2: 524-528.








Delius, Ho and J. Clements. 1976. A parital denaturation map of herpes
simplex virus type 1 DNA: evidence for inversion of the unique
DNA regions. Journal of General Virology. 33: 125-133.

Ecob-Johnston, M.S. and W.O. Whetsell. 1979. Host-cell response to
herpes virus infection in central and peripheral nervous tissue
in vitro. Journal of General Virology. 44: 747-757.


Feldman, L.A., R.D. Sheppard and M.B. Bronstein. 1968.
virus-host cell relationships in organized cultures
nerve tissues. Journal of Virology. 2: 621-628.


Herpes simplex
of mammalian


Finkelstein, M. and R. Rownd. 1978. A rapid method for extracting DNA
from agarose gels. Plasmid. 1: 557-562.

Fraser, N., W. Lawrence, Z. Wroblewska, D. Gilden, and H. Koprowski.
1981. Herpes Simplex type 1 DNA in human brain tissue. Proceedings
National Academy of Science, U.S.A. 78: 6461-6465.

Frenkel, N. and B. Roizman. 1972. Separation of herpes virus DNA duplex
into unique fragments and intact strand on sedimentation in alkaline
gradients. Journal of Virology. 10: 565-572.


Frenkel, N., H.
Anatomy of
from the S


Locker, W. Batterson, G.S. Hayward and B. Roizman. 1976.
herpes simplex virus DNA VI. Defective DNA originates
component. Journal of Virology. 20: 527-531.


Galloway, D.A., C. Genoglio, M. Shevchuk and J.K. McDougall. 1979.
Detection of herpes simplex RNlA in human sensory ganglia. Virology.
95: 265-268.

Galloway, D. and J. McDougall. 1981. Transformation of rodent cells
by a cloned DNA fragment of Herpes Simplex type 2. Journal of
Virology. 38: 749-760.

Goodpasture, E.W. 1929. Herpetic infection with especial reference to
involvement of the nervous system. Medicine. 8: 223-243.

Grafstrom, R.H., J.C. Alwine, W.L. Steinhart and C.S. Hill. 1974.
Terminal repetitions in herpes simplex virus type I DNA. Cold
Springs Harbor Symposium Quart. Biol. 39: 679-681.


Graham, B., H. Ludwig, D. Bronson, M.
1972. Physiochemical properties
Biochemical and Biophysical Acta.


Benyesh-Melnick and N. Biswal.
of the DNA of herpes viruses.
259: 13-23.


Handa, H. and H. Shimojo. 1977. Isolation of the viral DNA replication
complex from adeno-associated virus type 1 infected cells. Journal
of Virology. 24: 444-450.

Hayward, G.S., N. Frenkel and B. Roizman. 1975. Anatomy of herpes
simplex virus DNA: strain differences and heterogeneity in the
location of restriction endonuclease cleavage sites. Proceedings
of the National Academy of Science. 72: 1768-1772.








Hayward, G.S., R.J. Jacob, S.C. Wadsworth, and B. Roizman. 1975.
Anatomy of herpes simplex virus: Evidence for four populations of
molecules that differ in the relative orientations of their long
and short components. Biochemistry. 72: 4243-4247.

Herisse, J., G. Courtois and F. Galibert. 1980. Nucleotide sequence of
the EcoRl D fragment of Adenovirus z genome. Nucleic Acid Research.
8: 2173-2191.

Heriss6, J. and F. Galibert. 1981. Nucleotide sequence of the EcoRl E
fragment of adenovirus 2 genome. Nucleic Acid Research. 9: 1229-
1240.

Hill, T.S. and H.S. Field. 1973. The interaction of herpes simplex
virus with cultures of peripheral nervous tissue: an electron
microscope study. Journal of General Virology. 21: 123-133o

Hill, T.S., H.S. Field and W.A. Blyth. 1975. Acute recurrent infection
with herpes simplex virus in the mouse: a model for studying and
recurrent disease. Journal of General Virology. 28: 341-353.

Hirt, B. 1967. Selective extraction of polyoma DNA from infected
mouse cell cultures. Journal of Molecular Biology. 26: 365-369.

Hoggan, M., N. Blacklow and W. Rowe. 1966. Studies of small DNA viruses
found in various adenovirus preparations! Physical, biological
and immunological characteristics. Proceedings of the National
Academy of Science, U.S.A. 55: 1467-1575.

Holland, L.E., K.P. Anderson, J.R. Stringer and E.K. Wagner. 1979.
Isolation and localization of herpes simplex virus type 1 mRNA
abundant before viral DNA synthesis. Journal of Virology. 3_1:
447-462.

Honess, M. and D. Watson. 1974. Herpes simplex virus-specific polypep-
tides studied by polyacrylamide gel electrophoresis of immune preci-
pitates. Journal of General Virology. 22: 171-183.

Jones, P. and B. Roizman. 1979. Regulation of Herpesvirus macromolecular
synthesis VIII. The transcription program consists of three phases
during which both extent of transcription and accumulation of RNA
in the cytoplasm are regulated. Journal of Virology. 31: 299-
314.

Kaplan, A.S. (ed.) 1973. The Herpesviruses Academic Press, New York.

Kieff, E.D., S.L. Bachenheimer and B. Roizman. 1971. Size, composition
and structure of the deoxyribonucleic acid of herpes simplex virus
subtypes 1 and 2. Journal of Virology. 8: 125-132.

Knipe, D., W. Ruyechan, R. Honess and B. Roizman. 1979. Molecular
genetics of herpes simplex virus: The terminal a sequences of the
L and S components are obligatorily identical and constitute a part
of a structural gene mapping predominantly in the S component.
Proceedings of the National Academyof Science, U.S.A. 76: 4534-4538.








Kristensson, K., B. Ghetti and H.M. Wisniewski. 1974. Study on the
propagation of herpes simplex virus (type 2) into the brain after
intraocular injection. Brain Research. 69: 189-201.

LePecq, J. 1970. Use of ethidium bromide for separation and determina-
tion of nucleic acids of various conformational forms and measure-
ment of their associated enzymes. ;ethods of Biochemical Analysis.
20: 41-86.

Lis, J.T. 1980. Fractionation of DNA fragments by polyethylene glycol
induced precipitation. Methods in Enzymology. 65: 347-353.

Locker, H. and N. Frenkel. 1979. Baml, Kpnl and SalI restriction enzyme
maps of the DNAs of herpes simplex virus strains Justin and F:
occurrence of heterogeneities in defined regions of the viral DNA.
Journal of Virology. 32: 429-441.

Lonsdale, D.M., S.M. Brown and J.H. Subak-Sharpe. 1979. The polypep-
tide and the DNA restriction enzyme profiles of spontaneous iso-
lates of herpes simplex virus type 1 from explants of human
trigeminal, superior cervical and vagus ganglia. Journal of
General Virology. 43: 151-171.


Luria, S. and J. Darnell.
New York, New York.


1978. General Virology.


3rd ed. Wiley.


Lusby, E., K. Fife and K. Berns. 1980. Nucleotide sequence of the
inverted terminal repetition in adeno-associated virus DNA.
Journal of Virology. 34: 402-409.


Lusby,E. and K.
associated
Virology.


Berns. 1982. Mapping the 5' termini of two adeno-
virus RNAs in the left-half of the genome. Journal of
41: 518-524.


McConaughy, B.L., C.D. Laird and B.S. McCarthy.
reassociation in formamide. Biochemistry.


McDougall, J., C. Crum, C. Fenoglio,
1982. Herpesvirus-specific RNA
uterine cervix. Proceedings of
79: 3853-3857.

McLauchlan, J. and J.B. Clements. 1I
herpes simplex virus type 1 mRN/
501-512.


1969. Nucleic acid
8: 3289-3294.


L. Goldstein, and D. Galloway.
and protein in carcinoma of the
National Academy of Science, U.S.A.


)82. A 3' co-terminus of two early
ks. Nucleic Acid Research. 10:


Maxam, A.M. and W. Gilbert. 1980. Sequencing end-labeled DNA with base-
specific chemical cleavages. Methods of Enzymology. 65: 499-460.

Mocarski, E.S., L.E. Post and B. Roizman. 1980. Molecular Engineering
of the herpes simplex virus genome: insertion of a second L-S
junction into the genome causes additional genome inversions. Cell.
22: 240-255,




Full Text
15
o b
HSV- 1 F
Eco Rl
Xbo I
Eco Rl
Hpo I
Hsu I
X bo I
ba
4-44-
4 b
HP 1 H-H t If-4 I
Hsu I h 1 1
44-44+
H M-
0
h
10 20 30
H 1 4-
40
50
I
60
70
-4
80
-M-
-I 4-
4b
90
-4
100
-4
Figure 2. Restriction Map of HSV-1 and HSV-2 DMAs (Roizman, 1979).
1969). However, while there is a stable accumulation of C-RNA within
the infected cell, inhibition of host mRNA synthesis is completed to the
extent that no de novo synthesis of cellular mRNA can be observed late
in infection (Kaplan, 1973). As the rate of host cell DNA synthesis
gradually falls off, it is rapidly surpassed by that of nacent viral DNA.
By 7 to 8 hours post infection, host DNA is no longer replicated. This
inhibition is concomitant with that of host cell protein synthesis and


34
hybridization mixture minus the probe at 37C for 2 hours prior to the
hybridization. Hybridization was carried out in the presence of the
complete mixture for 72 hours at 37C. The blots were then removed and
washed twice to remove nonspecifically bound label, with the hybridiza
tion mixture minus carrier and probe for 30 minutes at 37C. The blots
were then rinsed twice with 2XSSC and 0.5% SDS in 50% formamide. The
blots were washed twice in 1XSSC and 0.5% SDS in 50% formamide for 30
minutes at 37C (McConaughy et al., 1969; Tereba and McCarthy, 1973).
Finally, the blots were v/ashed overnight at 65C in 1XSSC and 0.5% SDS,
with 4 changes of the wash.
On occasion the hybridization was carried out at 65C. In these
instances the reaction and v/ashes were done as described above at 37C
but in the absence of formamide. Attempts were made to increase the
sensitivity of the hybridization by adding 10% dextran sulfate to the
hybridization reaction (Wetmur, 1975). The findings were inconsistent
due to variable nonspecific background on the autoradiographs of such
experiments.
Following the hybridization and washings the blots were dried and
then autoradiographed with Kodak X-0matic regular intensifying screens
and Dupont Cronex 4 X-ray film at -70C for 3-21 days.


Table 2. CsCl enrichment study
Probe
Patient
CF-ti ter
I
II
III
1168
256
r
1090
256

-
-
1144
128
-

-
1143
8
-
-
-
thoracic ganglia
16
-
-
-
HepII
ND
-
-
HSV infected Hep2
ND
+
+
Mapping the L/S junction of HSV-1 F strain
The immediate early mRNA species of HSV-1 are known to map to the
reiterated portions of the genome. This fact coupled with the observa
tion that transcripts mapping to this region were present in all posi
tive ganglia studied to date suggested that this area warranted further
analysis. Hybridizations of ganglia RNA to pBR322 clones of the L/S
junction were undertaken in order to develop a clearer picture of the
degree of transcription. To gain such an understanding it was necessary
to first derive detailed restriction digestion maps of the DNA in
question.
Two plasmids were used for this purpose, pRBl04 and pRBl15 (Post
et al_., 1981; Material & Methods) (see Figure 16). The SP^ insert in
pRBl04 is approximately 500bp greater in length than the SP-j species in
serted into pRB115 (Post, 1981). First the DNA was evaluated by single
and double or triple endonuclease digestions using BamHl, Pstl, Hindll
and BstEll. This confirmed the identity of the two plasmids and also
allowed us to map a 520bp insertion to the largest BamHl/Hindll fragment
of pRBl15 (see Figure 17). The size markers in these assays were known
digests of either pBR322 or AAV DNA. The clones were then screened with
various additional endonucleases to determine their digestion patterns.
A summary of the restriction enzyme fragment sizes is given in Table 3


96
Vlanzy, D., A. Kwong and N. Frenkel 1982 Site specific cleavage/
packaging of herpes simplex virus DMA and the selective maturation
of nucleocapsids containing full length viral DNA. Proceedings of
the National Academy of Science, U.S.A. 79: 1423-1427.
Wadsworth, S., R.J. Jacob and B. Roizman. 1975. Anatomy of herpes
virus DNA. II. Size, composition and arrangement of inverted ter
minal repetitions. Journal of Virology. J_5: 1487-1497.
Wagner, E. and B. Roizman. 1969. RNA synthesis in cells infected with
herpes simplex virus II. Evidence that a class of viral mRNA is
derived from a high molecular wright precursor synthesized in
the nucleus. Proceedings of the National Academy of Science, U.S.A.
64: 626-633.
Wagner, N.M. and W.C. Summers. 1978. Structure of the joint region and
the termini of the DNA of herpes simplex virus type I. Journal of
Virology. 27: 374-387.
Wahl, G.M., M. Stern and G.R. Stark. 1979. Efficient transfer of large
DNA fragments from agarose gels to diazobenzyloxymethyl-paper and
rapid hybridization by using dextran sulfate. Proceedings of the
National Academy of Sciences. 78: 3683-3687.
Walboomers, J. and J. Ter Schegget. 1976. A new method for the isola
tion of herpes simplex virus type 2 DNA. Virology. 74: 256-258.
Walz, M.A., R.W. Price and A.L. Notkins. .1974. Latent ganglionic infec
tion with herpes simplex virus types 1 and 2: viral reactivation
in vitro after neurectomy. Science. 184: 1185-1187.
Walz, M.A., H. Yamamoto and A.L. Notkins. 1976. Immunological response
restricts number of cells in sensory ganglia infected with herpes
simplex virus. Mature. 264: 554-556.
Warren, K.G., S.M. Brown, Z. Wroblewska, D. Gilden, H. Koprowski and J.
H. Subak-Sharpe. 1978. Isolation of latent herpes virus from the
superior cervical and vagus ganglia of humans. New England Journal
of Medicine. 298: 1068-1069.
Watson, R.J. and G.F. VandeWoude. 1982. DNA sequence of an immediate-
early gene (IEmRNA-5) of herpes simplex virus type I. Nucleic
Acid Research. K): 979-991 .
Wetmur, J. 1975. Acceleration of DNA renaturation rates. Biopolymers.
14_: 2517-2524.
Wilkie, N. 1973. The synthesis and sub structure of herpes virus DNA:
the distribution of alkali-labile single strand interruptions in
HSV-1 DNA. Journal of General Virology. 21_: 453-467.
Wilkie, N. 1976. Physical maps for herpes simplex virus DNA for restric
tion endonucleases Hindlll, Hpal, and Xbal. Journal of Virology.
20: 222-233.


77
fixing antibodies and the presence of HSV specific sequences as measured
by this approach.
Two patients warrant some further discussion. Patient #941 was a
1 year old male who died from congenital lobar emphysema. Although both
viral DNA and RNA were detected repeatedly in the trigeminal ganglia no
humoral immune response to HSV could be determined by either complement
fixation or indirect immunofluoresence assays. The patient had not
received sufficient immunosuppressive therapy to negate a humoral re
sponse nor was there evidence of congenital failure of the humoral immune
system. It is possible the primary viral infection of the infant occurred
before the humoral immune system was competent enough to mount a response
and no subsequent recurrences occurred. No viral DNA was detected in the
ganglia from patient #949 although RNA transcripts from the short repeat
regions of the HSV genome were demonstrated. It may be that only this
portion of the genome was latent in the ganglia; these findings would
then mirror the varied sensitivities of the two experimental approaches.
The detection of only part of the HSV genome in several of the
ganglia raises the question of whether the remainder of the genome is
absent. Brown et aj_ (1979) has reported the detection of latent defec
tive HSV by complementation of the endogenous genome iwth ts mutants of
HSV-1 in 8 out of 14 individuals previously negative for spontaneous
release of virus. The altered migration or absence of the terminal EcoRl
K fragments revealed in patients #228 and #227 could be examples of such
an event. The frequency with which large deletions could occur would be
greatest in the terminal regions of the linear genome. Conversely, it
may be argued that these fragments have undergone an apparent increase
in molecular weight due to covalent linkage with host DNA or some other


64
Ad Rl-A Rl-C HSV
\
Figure 24. Autoradiograph of AAV/Ad2 Cross Hybridizations


CPM
24
I
I
Figure 4. Alkaline Sucrose Gradient analysis of HSV DNA


33
and the furtherest points of migration were notched to facilitate future
orientation of the gel. The DNA fragments were then denatured i_n situ
by soaking the gel for 20 minutes in a 1 M KOH solution. The KOH wash
and gel were then tritrated to neutrality with 1M HC1-1M Tris. The gel
was then aligned on a prewashed nitrocellulose filter for transfer. The
nitrocellulose filter was prewet by washing for 20 minutes in a 5XSSC
bath. The DNA was eluted from the gel with 10XSSC. For transfer from
a 1% or greater agarose gel, the gel was placed on a paper wick soaked
in 10XSSC, overlaid with the nitrocellulose and absorbant material.
This arrangement permitted a higher volume of 10XSSC to pass through the
gel and enhanced transfer of higher molecular weight fragments. For
transfer from agarose gels of less than 1% and polyacrylamide gels, a
slightly different procedure was used in order to decrease diffusion of
the DNA bands during transfer. The filter was again sandwiched between
the gel and absorbant material but arranged in the reverse order so that
transfer was in a downward direction. The gel was overlaid with a paper
wick which was periodically wet with 10XSSC. Thus a decreased volume of
10XSSC was passed through the gel and diffusion was diminished. After
transfer the nitrocellulose filter was dried at 80C for 2 hours under
vacuum.
Hybridization Reaction
Hybridizations were carried out in sealed plastic bags containing
the filter and a hybridization mixture composed of the following: 50%
formamide, 5XSSC, 0.08% polyvinylpyriodate, 0.08% bovine serum albumin,
0.08% ficoll, 0.5% SDS, 0.02 M Tris (pH 7.4), 50 yg/ml sonicated calf
32 125
thymus DNA as a carrier and either or £JI-labeled probe at a con
centration of at least 10^ cpm/ml. All blots were prewashed with the
V-


92
Kristensson, K., B. Ghetti and H.M. Wisniewski. 1974. Study on the
propagation of herpes simplex virus (type 2) into the brain after
intraocular injection. Brain Research. 69; 189-201.
LePecq, J. 1970. Use of ethidium bromide for separation and determina
tion of nucleic acids of various conformational forms and measure
ment of their associated enzymes. Methods of Biochemical Analysis.
20: 41-86.
Lis, J.T. 1980. Fractionation of DMA fragments by polyethylene glycol
induced precipitation. Methods in Enzymology. 65_: 347-353.
Locker, H. and N. Frenkel. 1979. Baml, Kpnl and Sail restriction enzyme
maps of the DMAs of herpes simplex virus strains Justin and F:
occurrence of heterogeneities in defined regions of the viral DMA.
Journal of Virology. 32; 429-441.
Lonsdale, D.M., S.M. Brown and J.H. Subak-Sharpe. 1979. The polypep
tide and the DMA restriction enzyme profiles of spontaneous iso
lates of herpes simplex virus type 1 from explants of human
trigeminal, superior cervical and vagus ganglia. Journal of
General Virology. 43: 151-171.
Luria, S. and J. Darnell. 1978. General Virology. 3rd ed. Wiley.
Mew York, Mew York.
Lusby, E., K. Fife and K. Berns. 1980. Nucleotide sequence of the
inverted terminal repetition in adeno-associated virus DMA.
Journal of Virology. 34: 402-409.
Lusby,E. and K. Berns. 1982. Mapping the 5' termini of two adeno-
associated virus RNAs in the left-half of the genome. Journal of
Virology. 41_: 518-524.
McConaughy, B.L., C.D. Laird and B.S. McCarthy. 1969. Nucleic acid
reassociation in formamide. Biochemistry. 8: 3289-3294.
McDougall, J., C. Crum, C. Fenoglio, L. Goldstein, and D. Galloway.
1982. Herpesvirus-specific RNA and protein in carcinoma of the
uterine cervix. Proceedings of National Academy of Science, U.S.A.
79: 3853-3857.
McLauchlan, J. and J.B. Clements. 1982. A 3' co-terminus of two early
herpes simplex virus type 1 mRNAs. Nucleic Acid Research. 10:
501-512.
Maxam, A.M. and W. Gilbert. 1980. Sequencing end-labeled DNA with base-
specific chemical cleavages. Methods of Enzymology. 65; 499-460.
Mocarski, E.S., L.E. Post and B. Roizman. 1980. Molecular Engineering
of the herpes simplex virus genome: insertion of a second L-S
junction into the genome causes additional genome inversions. Cell.
22: 240-255.


AAV
HSV
C C B B' C C1
GAGGCCGCCCGGGCAAAGCCCGGGCGTCGGGCGACCTTTGGTCGCCCGACGCCCGGGCTTTGCCCGGGC
ii i mu! i iniiiiii mum i n i i 11 11 m
GACGGCGCCCGTGG GCCCGGGCGCCGGGCGGCG GGGGCCGGCATGGCGGCG CGGCG
\ A
G GG
A'
GGCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGCCAA
mu ii ii mu ii i i i mi i in
GGCCTGAGACAGAGAGCGTGCCGGGTGGTA GAGT GGCAA
// ^7 \
AG ^-^TTGACA
TTGGCCACTCCCTCTCTGC
II I III III
GTAGTGCTTGCCTGTCTA/
TTGACAGGCAAGCATGTGCGTGCAGAGGCGAGTAGTGCTTGCCTGTCTAA
B
B'
GCGCTCGCTCGCTCACTGAGGCCGCCCGGGCAAAGCCCGGGCGTCGGGCGACCTTTGGTCGCCCGG
11111111111 I I II III III 11 III III ll I I! Ill II
ctcgctcgctcgccgcgggggcccgggctGcgccgccgcg actta ggccgcgcgc
I \ I / \
T G G AAG
DR1
85
231
Figure 32.
Homology between the terminus of the long unique region in HSV-1
and the terminus of AAV
^4
CO


25
O
I
10 20 30 40 50 60 70 80' 90 100
o b
E3-
' 'l '
b o *a c c o
hp^n
i
104
c=f-
2 13 5
i. lE-mRNA
L- I t Q
14 3
Figure 5. Origin of pRB104 and pRBl15 DNAs


9
However, a 2.2% difference in G + C ratios would predict a mismatch of
at least 3850 base pairs between serotypes (Subak-Sharpe et al., 1973).
Polypeptide mapping studies of intratypic recombinants give strong evi
dence of a col linearity in gene ordering within HSV-1 and HSV-2 chromo
somes. The reported viability of intratypic recombinants and the ability
of ts mutants of HSV-1 to complement ts mutant of HSV-2 also suggest
little divergence within functionally critical regions of the genomes
(Subak-Sharpe et al_., 1972; Morse et al_., 1977). Such evidence indicates
extensive similarity in the gross architecture of the two genomes and
argues for a distant but common lineage.
An interesting characteristic of the structure of the HSV chromo
some is the presence of single-strand interruptions in the DMA. When
alkali denatured DMA from purified virus is sedimented on alkaline
sucrose density gradients numerous bands of single-stranded DMA may be
observed. These bands correspond to fragments of 7x10^ dal tons to
intact strands 48x10^ daltons in weight (Kieff et al., 1971; Wilkie 1973).
Frenkel and Roizman (1972) have distinguished 6 classes of fragments,
ranging from 10x10^ to 39x10^ daltons, in denatured HSV-1 DNA. The
kinetics of reassociation within the intact size, 39x10^ daltons, class
indicated this class was composed of elements representing a single unique
strand of DNA. In conflict with this interpretation are the findings of
Wilkie (1973) which suggested a randomly gapped genome and nonunique
intact strands. To date no biological function has been ascribed to the
single strand gaps and the controversy over random vs. defined sizes has
not been reconciled. Newly synthesized viral DNA has been reported to
contain short stretches of RNA (Biswal et al., 1974). It is unlikely
that such RNA stretches alone would account for these gaps since the


97
Wilkie, N.M., J.B. Clements, J.C.M. MacMab and J.H. Subak-Sharpe. 1974.
The structure and biological properties of herpes simplex virus DNA.
Cold Spring Harbor Symp. Quant. Biol. 39: 657-666.
Wilkie, N. and R. Cortini. 1976. Sequence arrangement in herpes
simplex virus type 1 DNA: identification of terminal fragments in
restriction endonuclease digests and evidence for inversions in
redundant and unique sequences. Journal of Virology. 20: 211-221.


37
Isolate Ganglia
dissection
Neurons
1
RNA
HSV DNA
chemically label
125I RNA
hybridize |
HSV DNA Blots
Endo R Digest
Figure 8. RNA/DNA Hybridization Procedure
Controls
The binding of radiolabeled ganglion DNA or RNA to nitrocellulose
bound viral DNA permits the detection of specific genome regions of HSV
DNA sequences in neural tissue. This is a considerable refinement over
standard filter hybridization methods or in situ methods where only
hybridization to the whole genome is monitored and where a consideration
must be given to high backgrounds due to nonspecific binding of the
probe.
The selectivity of the assay is still largely a product of the
purity of the known viral DNA preparation. To assay this purity HSV-1
F strain DNA was nick translated and hybridized to EcoRl endonuclease
digests of DNA from calf thymus tissue, salmon sperm, human foreskin,
Hela M monolayers and Hep 2 cells (see Figure 9). The HSV DNA was pre
pared by high salt precipitation in the manner described by Pater et al
(1976). This approach is a modification of the high salt extraction
method first devised by Hirt (1967). Nonspecific binding of label
occurred with each digestion assayed. This suggests the presence of
cellular DNA copurifying within the viral DNA preparation. For this


8
g/cm3 for HSV-2. Similar estimates were obtained by Graham (1972) using
E. col i DNA as a density reference These values predict a G + C ratio
of 66.3% for HSV-1 and 68.4% for HSV-2 (Goodheart et al_., 1975). Kieff
3
et al_ (1971) established 1.726 and 1.728 g/cm for the respective bouyant
densities in CsCl isopycnic gradients using SP01 DNA as a marker. The
resulting 67% and 68% G + C ratios were confirmed by the finding of a
1C difference in the Tm values for HSV-1 and HSV-2. While Kieff
reported the Tm of type 1 to be 83C and type 2 to be 84C, Graham et al_
(1972) found only a 0.1C difference in Tm values of 82.6 and 82.7C.
Both serotypes of HSV have a sedimentation rate in neutral sucrose
density gradients of 55 S with a co-responding molecular weight of
995xl0^ daltons (Kieff et al_., 1971; Sheldrick and Berthelot, 1974).
The contour length for the linear duplex molecule, based on EM studies,
is approximately 100x10 daltons (Sheldrick and Berthelot, 1974; Wilkie,
1973). The estimated molecular weight of HSV-1 circles is 943xl0
daltons; if one considers a 3% redundancy in their terminal overlap this
would suggest a value for the linear molecule of 973xl0^ daltons
(Grafstrom et a]_., 1974). In a comparative analysis of restriction endo
nuclease fragments from 80 isolates of HSV-1 Buchman et al_ (1978) found
a variation of only 2% in the determination of overall molecular weight
between isolates.
The similarities between HSV-1 and HSV-2 are apparently not limited
to a cursory examination of molecular weight and composition. Liquid
and filter hybridization analysis of their DNAs suggests an 85% homology
over 46% of their genomes; the remaining 56% of their respective genomes
is highly variable with little homology (Kieff et a]_., 1971). Nearest -
neighbor analysis for the two gives virtually identical frequency patterns.


4
organ cultures. Cultures of the sciatic nerve trunk, thoracic spinal
cord and medulla oblongata do not yield virus. Persistently infected
mice also possess neutralizing antibodies to HSV (Stevens and Cook, 1971).
The lack of virus-specific products during the chronic periods suggests
that the HSV genome may exist as a subviral unit in ganglionic cells.
Searches for products of viral replication in latent tissue confirm
the hypothesis that few ganglionic cells are directly involved with
persistence. In chronically infected mice less than 0.1% of the
ganglionic cells will act as infectious centers for the virus and those
cells positive in fluorescent antibody assays are in the great minority
(Walz et al_., 1976; Stevens and Cook, 1972). The presence of HSV-
specific thymidine kinase activity in the absence of late viral protein
markers may indicate an early termination of viral replication in
chronically infected murine ganglia (Yamamoto et al_., 1977). It is also
possible that some species of mRNA are very stable or that transcription
continues from "remnants" of the viral genome in some cells.
HSV initially inoculated into the mouse via the ear can be stimu
lated to reactivate through localized minor trauma to the ear (Hill et
al., 1975). During the quiescent periods in this recurrence model, virus
is absent from the peripheral tissue, but can be found in the 2nd, 3rd
and 4th cervical ganglia. Several forms of stimuli are effective: UV
light, cellophane tape, and stripping or swabbing the ear with xylene.
All such agents produce a localized inflammatory response and provoke
increased levels of prostaglandins within the skin. It is uncertain
what role these factors may play during recurrence. It is clear that
the effective agents do induce changes within the ganglia as evidenced
by increases in infectious virus and tritiated thymidine uptake within
the ganglia 2 to 4 days following trauma to the ear (Hill et aK, 1975).


18
(Post et al_., 1981). As with other mammalian DNA viruses both mRMA
splicing and overlapping coding regions has been documented. With
respect to overlapping coding regions, the 5' termini of two early mRNA's
have been mapped to the region of the HindiII cleavage site at 0.586.
The regulatory signals for transcription of the smaller 1.2 kb mRNA are
found within the larger 5.0 kb transcript. Both mRNAs are unspliced.
The 5.0 kb species encodes a 136,000 dalton protein while the smaller
1.2 kb messenger codes for a 38,000 dalton protein. These early mRNAs
have a 3' co-terminus (Anderson et al., 1981; McLauchlan and Clements,
1982). Analysis of the co-terminus revealed the sequence AAUAAA with an
A + T rich region 3' to the sequence. This is the general format for the
3' termini of all early HSV mRNAs studied to date.
The IE mRNA-4 and IE mRNA-5 share a common 5' sequence. In this
instance the promoter and capped 5' termini map to the reiterated
sequences flanking the short unique region. Both messages share a
common 247 bp leader with a single splice located within the reiterated
sequences. A 'TATA' box is located approximately 25 bases 5' to the
leader and the common splice appears to function only to remove the
introns from a 5' untranslated region (Rixon and Clements, 1982). Since
these are the only messages located in this portion of the genome,
splicing does not increase the coding capacity of this region. It should
be noted that between IE mRNA-3 and IE mRNA-5 is a stretch of 800 nucleo
tides which is not transcribed. This region may include the origin of
DNA replication (Vlanzy and Frenkel, 1981; Watson and Van de Woude, 1982).
Lastly, comparison of the 5' terminus of the IE mRNA-5 gene to that of
early thymidine kinase gene revealed that the regulatory sequence GGCGATTC
was absent in the immediate early gene while present 80 base 5' to the


11
Partial denaturation mapping of the chromosome confirms this archi
tecture and permits the sizing of the various regions. The long unique
gene region comprises 70.2% of the genome while the shorter unique region
involves 9.4%. The direct and inverted repeats bracketing the long region
each represent 6% of the genome length and can be further divided into
two subregions: the a, a' reiteration and the b,b' reiteration, which
is found only in the long segment. In like manner repeats associated
with the short unique region can be designated a'c1 and ca, respectively;
comprising 4.3% of the genome. The a,a' sequences are held in common
between the long and short gene regions while the c, c1 and b, b' inver
sions are limited to the short and long regions respectively (Wadworth
et al_., 1975). Partial denaturation studies and subsequent endonuclease
digestion mapping further confirm that the long and short components are
able to invert in their relative orientations. Thus, as originally pre
dicted by Sheldrick and Berthelot (1974), within a population of HSV DMA
four conformations of the molecule can be determined which differ in the
relative orientations of the long and short unique regions (Hayward 1975;
Delins and Clements, 1976; Wilkie, 1976). The diagram below illustrates
this point.
One consequence of such an arrangement is that endonuclease
cleavage fragments spanning the L/S junction will be found in a 0.25
molar ratio relative to unique fragments and the terminal fragments will
be present in a 0.5 molar ratio. This prediction was confirmed by
Hayward (1975) in an analysis of the Mind III and Eco R1 digestion frag
ments of HSV-1. Morse et_ al_ (1977) has suggested that another conse
quence of this genome architecture is that not all conformations may be
functionally equivalent. If one aligns the amps of intertypic


HYBRIDIZATIONS
Hybridization of ganglia RNA to the L/S junction
As stated previously hybridization of total cytoplasmic RNA from
ganglia to Southern blots of clone pRBl 15 of the L/S junction of HSV-1
F was undertaken in hopes of better delineating the level of transcrip-
125
tion through this portion of the genome. The I-labeled RNA from
five sero-positive patients was evaluated in this manner. The nucleic
acids from thoracic ganglia and a normal lytic infection were also
evaluated as controls. The findings are given in Table 4. As in the
Table 4. Analysis of L/S Junction
Patient
CT titer
Viral DMA*
Viral RNA*
1033
64
_
__
1034
32
+
-
1082
128
+
-
969
16
-
-
1089
128
+
-
thoracic
ganglia
16
-
-
HSV infected
Hep2
N.D.
+
+
*(+) present
(-) absent
(N.D.) not done
CsCl enrichment studies DNA or RNA from Hep2 monolayers infected with
HSV-1 F at an m.o.i. of 1 and harvested at 20 hours post infection were
used in the control assays.
59


Abstract of Dissertation Presented to the Graduate Council
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy
IMPORTANT NUCLEOTIDE SEQUENCES INVOLVED IN
LATENCY OF DNA VIRUSES OF ANIMALS
By
Mark A. Rayfield
December 1982
Chairman: Kenneth I. Berns, Ph.D., M.D.
Major Department: Immunology and Medical Microbiology
We have investigated the molecular status of the Herpes simplex
virus (HSV) genome in latently infected human trigeminal ganglia. The
general aim of this research is to illuminate the genetics of viral
latency during recurrent infections in man. The trigeminal ganglia of
22 patients have been assayed for HSV sequences by DNA/DNA or RNA/DNA
hybridization. None of the patients manifested clinical evidence of
recurrence at the time of death nor was a history of recurrent HSV
lesions noted. Fourteen of the patients were sero-positive for HSV.
Positive serology was assessed as a complement fixation titer of 1:8 or
greater. In 18 of the 22 assays in which trigeminal ganglia were evalu
ated for the presence of HSV, total ganglionic DNA was cleaved by endo
nuclease digestion, transferred to nitrocellulose and probed with rich
nick-translated HSV DNA. The nucleic acid from two of the sero-positive


This work is dedicated to my family: to my parents Martin and
Fran whose sacrifices made it all possible, to Glenn who shared the
lean years and to my wife Dot for her loving support of a very tired
and grouchy graduate student


85
1980)o And there is apparently an inherent ability within the replica
tive cycle for maintaining identity between the termini through some
mechanism of gene conversion. Probable origins of replication and at
least some early regulatory functions lie within the reiterated sequences
in both viruses.
The nucleotide sequence of the natural terminal repeat in HSV-1 F
was used for the comparison with the terminal 200 nucleotides of AAV
described in this study. The terminal 200 nucleotides of AAV contain
the 143 bp inverted terminal repeat. This region can further be broken
into two smaller internal palindromic sequences which are bracketed by
a larger repeat and its inverse (Lusby e_t al_., 1980). The 5001 bp
natural repeat in HSV-1 F is inverted to form the junction of the long
and short unique regions of the genome; thus each unique arm of the
genome is in turn roughly similar in architecture to the AAV genome, as
is the whole. The 501 bp sequence is composed of 20 direct repeats of a
12 nucleotide sequence, 3 repeats of a 37 base sequence and some inter
nally unique sequences; the entire domain is bracketed by a 20 base pair
direct repeat (Mocarski et al_., 1980).
Our findings demonstrate an extensive homology between portions of
the HSV inverted repeats found at the L/S junction and termini with the
termini of AAV. The regions of HSV homology are 1) those regions of
the "b" reiteration which bracket the long unique region and are imme
diately adjacent to the "a" repeat, 2) those portions of the "c" reitera
tion which bracket the short unique region and are contiguous with the
"a" repeat, and 3) the 20 base direct repeat (DRI) which brackets the
"a" repeat. The high G + C content and repetiveness of these regions
would explain our earlier failure to find these homologies by Southern
hybridization.


87
Smal recognition site (Cheung et al_., 1980). Thus these sequences could
potentially serve a similar role in latency of HSV.
The conservation of similar GC content and architecture between
the termini of several parvoviruses supports the genetic evidence
assigning identical biological roles to these regions. These observa
tions appear to signify the direct involvement of the termini in viral
multiplication. Further the potential to form nearly identical curci-
form structures through secondary folding of their 3' termini appears
to be stringently conserved even within those genomes which have signif
icant sequence divergence from that of AAV. Thus the evolution of
this family of small DNA viruses has conserved both primary sequence and
secondary structure within a region of the genome in which both must
interact in the preservation of fidelity in viral replication.
The question of whether sequence homology between AAV and HSV is a
consequence of similar function warrants further investigation in light
of the findings within the parvovirus family. Our observations to date
do not permit the assumption that homologous sequences serve identical
functions within AAV and HSV. A cursory analysis of the homologous
sequences in HSV reveals that they are not self complimentary and cannot
easily be ascribed a secondary structure similar to AAV. Determination
of whether the primary sequence within HSV would lend itself to the
formation of a stable curciform secondary structure is central to this
line of investigation. In conclusion the sequence homology between AAV
and HSV demonstrates the potential for similar mechanics of early regu
lation and macromolecular synthesis, events which appear to be concomit
tant with the establishment and maintenance of latency.


29
1.3385
1.3373
*1.3361
Figure 6. Affinity Chromotography of BamHl digest of pRB104


86
The extensive homology between DRI and the small internal palin
dromes of the AAV sequence is of particular interest. The short palin
drome GCCCGGGC has been totally conserved within both. A role for DRI
has been proposed in both the site specific cleavage of concatomeric
replicative intermediates of HSV and the inversion of the long and short
domains (Mocarski et al_., 1980). Similary, deletion mutants within this
sequence in AAV are unable to resolve high molecular weight intermediates
in DNA replication. Fifty-one base pairs downstream from GCCCGGGC in
AAV one finds the sequence ACTCC followed nine base pairs further down
stream by the sequence GGTTCCT; ACTCC is the probable cleavage site for
the inversion of the AAV terminal palindrome and resolution of the hair
pin during DMA replication. The sequence ACTCC followed by GGTTCCT is
also found within the "c" reiteration of HSV-1 F fifty-one bases down
stream from the sequence GCCCGGGC within DRI. The question of whether
this arrangement is coincidental or the sequence actually serves a
similar function in the replication of both genomes will require genetic
analysis. It should be noted that HSV-1 F strain DNA contains a single
copy of the "a" reiteration at its right terminus and the putative
cleavage site for resolution of concatomers is thought to lie within or
just outside the "a" reiteration adjacent to the "c" repeat (Mocarski
et al., 1980).
The terminal sequences of AAV DNA appear to be intimately involved
in the integration of latent AAV DNA into cellular chromatin. Endo
nuclease analysis of AAV DNA from early (10) and late (118) passages of
latently infected cells demonstrated that the only sequences altered
during clonal passage were those within the palindromic region of the
terminal repeat, specifically, the sequence GCCCGGGCT which contains the


82
explants, to date, have yielded unique endonuclease restriction patterns.
Thus for alteration in electrophoretic migration to be reasonably com
ponent, the shift should be significant and repeatable when the ganglia
DNA is restricted with an enzyme such as Xbal which does not reveal
strain differences in HSV. When the latent virus is HSV-2 the fidelity
of hybridization with the HSV-1 probe could also be significantly reduced.
Thus although our data is compatible with integration of HSV into cellu
lar genomes, it is not sufficient to prove it.
Hybridization of 3I-labeled cytoplasmic RNA to digests of HSV DNA
demonstrates the presence of viral RNA transcripts in the ganglia. The
design of our experiments using several different restriction digests of
HSV enabled us to corroborate our findings and more finely map these
sequence homologies. Autoradiographic density of hybridized bands per
mits estimates of the frequency of given RNA species in our sample.
125
For this reason control reactions were run with the I-labeled cyto
plasmic RNA from both HSV lyticly infected Hep2 cells and uninfected
tissue cultures for comparison. This experimental approach answers the
question of which regions of the latent HSV genome are undergoing active
transcription. The fact that only a subset of the RNA transcripts were
found in latently infected ganglia suggests that some HSV genes may be
necessary for maintenance of the latent state.
A number of general observations have prompted the inclusion of a
comparative analysis of the HSV, Ad, and AAV genomes within this study
of HSV latency. The genomes studies are representative of the three
linear DNA virus families whose members are known to replicate within
the nuceli of human cells. Architecturally each of these linear genomes
contains inverted repeats within their terminal regions. Each of the
viruses have a demonstrated potential in vitro for latency in human cells.


Ad Sequences Searched
11.6 kb
T ranscription
I A I B VA
=3 Zt

3 A
A
EcoR I
hybridization
12
3 4
4
Homolog ¡es
3 4
Figure 26. Summary of Ad/AAV Homology
CT>
CO


3
were epidemiologically related and that within the individual multiple
isolates from different ganglia were usually genetically identical
Infection of peripheral ganglia appears to be subsequent to viral spread
from the site of initial infection in a majority of individuals. These
observations suggest that once a sensory ganglion cell becomes latently
infected it is to some degree refractory to superinfection by a future
viral isolate. Complementation studies involving superinfection of
ganglia with temperature sensitive mutants of HSV indicate that many
harbor defective or pari tal viral genomes (Brown et al_., 1979).
Currently two animal models exist for neural latency of HSV. Virus
inoculation in the foot pad of mice gives rise to a subsequent infection
of the spinal ganglia (Stevens and Cook, 1971). This infection is
biphasic. A primary acute infection occurs during which high titers of
virus are found in spinal fluid and tissues. Virus titers then subside
and a chronic phase of infection follows. During this period virus may
only be demonstrated by maintenance of ganglia explants in organotypic
cultures. The chronic period probably most closely mirrors the quiescent
periods in many, but the mouse is not clearly known to undergo recurrence.
Intraocular inoculation of rabbits leads to viral spread and involvement
of the trigeminal ganglia (Stevens and Cook, 1972; Goodpasture 1929).
The infected globe will thereafter undergo periods of quiescence and
recurrent infections.
Several parallels can be drawn betv/een chronically infected murine
neural tissue and latently infected human ganglia. Only the spinal
ganglia associated with sciatic nerves, innervating the site of inocula
tion, harbor HSV. The virus can be demonstrated by immunofluorescence
and electron microscopy after explanation and in vitro maintenance in


45
Figure 12. Ganglia RNA Hybridized to Viral DHA


-l-t- Alu I
104
4-Taq I
Hindi
.Bst Ell
115
H f-t- Alu I
4_ Taq I
Bst Ell
Hie II
H 1 1I 1 1 h-H 1 f |H 1 H-f-
- ~4 11 1 1 HI I
ll t-
Ava II
Sma I
I
3
-1
5
1 kb
6
c_n
CO
Figure 21. Restriction Digest Map of pRBl15


observations that an individual could be latent at multiple ganglionic
sites. In each case only 0.4-8.0% of the ganglionic neurons possessed
HSV specific nucleic acid sequences..
Molecular Biology of HSV
The infectious HSV particle has evolved a rather complex architec
ture. A 1000 nucleocapsid of acosahedral symmetry encloses the double
stranded linear DNA chromosome and various phosphoproteins of the viral
chromatin (Russell et al_., 1962; Becker £t al_., 1968; Spear and Roizman,
1972). This core is itself encompassed by a loose matrix of glycoproteins
and carbohydrates of viral origin. Ultimately, the entire structure is
surrounded by a lipid envelope, giving the infectious virion a diameter
of roughly 1800 A. Quantitatively the mature particle is comprised of
approximately 70% protein, 22% lipid, 7% nucleic acid and 2% carbohy
drate (Scott and Tokumaru, 1964; Callaghan et al_., 1976). Although the
viral genome has the potential to encode and modify through methylation
or glycosylation all known virion associated proteins, the lipid moiety
of the envelope appears to be principally derived from the phospholipids
of the infected cell's nuclear membrane (Watson et al_., 1973; Roizman
et al_., 1974). All known protein species associated with the envelope
arise from either virus specified de novo synthesis or modification of
cellular proteins (Kaplan 1973; Spear 1972).
Genome Size and Composition
The DMAs extracted from sucrose gradient purified virions of HSV-1
and HSV-2 differ in bouyant density by 0.002 g/cm3 (Goodheart et al.,
1968; Kieff ejt aj_., 1971). Goodheart £t al_ (1968) and Plummer et al
(1970) determined these densities to be 1.725 g/cm3 for HSV-1 and 1.727


17
synthesis have a stringent requirement for a polypeptide synthesis prior
to its production. The viral DNA polymerase falls within this group.
Early transcripts map throughout the HSV genome and the size of their
nuclear precursors differs little from that of the polysomal bound popu
lation suggesting that their promoters map close to the structural genes
(Holland et al_., 1979). Together the sequences transcribed prior to DNA
synthesis represent approximately 25% of the genome.
Comparative inhibition studies indicate that more than one polypep
tide in the a and g groups is involved in regulation of transcription
and the transition from a to 0 to y protein synthesis. For example
canavanine selectively inhibits subsets of these proteins and permits
partial transition from immediate early to early and then to late trans
cription. As with early transcripts, late transcription occurs through
out the genome with approximately 50% of the viral RNA at 6 hours post
infection having a length of 5,000 to 10,000 nucleotides. At this time
transcription of most early viral RNA continues with y mRNA species
representing approximately 20% of the accumulated viral mRNA.
The complex overlapping hybridization patterns of viral mRNA to the
HSV genome suggest that an elaborate series of interlocking controls
regulate transcription and translation with multiple RNA species derived
from limited regions of the genome and nucleotide sequences common to
several messengers. As suggested above the immediate early promoters
are compatible with the existing host cell transcriptional machinery yet
early promoters appear to have been modified by one or more a viral
proteins. The insertion of the 5' promoter region of immediate early
(IE) mRNA 3 into sequences upstream from the early thymidine kinase
structural gene permits its transcription as an immediate early species


90
Delius, Ho and J. Clements. 1976. A parital denaturation map of herpes
simplex virus type 1 DMA: evidence for inversion of the unique
DNA regions. Journal of General Virology. ^3: 125-133.
Ecob-Johnston, M.S. and W.O. Whetsell. 1979. Host-cell response to
herpes virus infection in central and peripheral nervous tissue
in vitro. Journal of General Virology. 44: 747-757.
Feldman, L.A., R.D. Sheppard and M.B. Bronstein. 1968. Herpes simplex
virus-host cell relationships in organized cultures of mammalian
nerve tissues. Journal of Virology. 2: 621-628.
Finkelstein, M. and R. Rownd. 1978. A rapid method for extracting DNA
from agarose gels. Plasmid. 1_: 557-562.
Fraser, N., W. Lawrence, Z. VIroblewska, D. Gilden, and H. Koprowski.
1981. Herpes Simplex type 1 DMA in human brain tissue. Proceedings
National Academy of Science, U.S.A. 78: 6461-6465.
Frenkel, N. and B. Roizman. 1972. Separation of herpes virus DNA duplex
into unique fragments and intact strand on sedimentation in alkaline
gradients. Journal of Virology. 1_0: 565-572.
Frenkel, N., H. Locker, W. Batterson, G.S. Hayward and B. Roizman. 1976.
Anatomy of herpes simplex virus DNA VI. Defective DNA originates
from the S component. Journal of Virology. 20_: 527-531 .
Galloway, D.A., C. Genoglio, M. Shevchuk and J.K. McDougall. 1979.
Detection of herpes simplex RMA in human sensory ganglia. Virology.
95: 265-268.
Galloway, D. and J. McDougall. 1981. Transformation of rodent cells
by a cloned DNA fragment of Herpes Simplex type 2. Journal of
Virology. 749-760.
Goodpasture, E.W. 1929. Herpetic infection with especial reference to
involvement of the nervous system. Medicine. 8: 223-243.
Grafstrom, R.H., J.C. Alwine, W.L. Steinhart and C.S. Hill. 1974.
Terminal repetitions in herpes simplex virus type I DNA. Cold
Springs Harbor Symposium Quart. Biol. 3£: 679-681.
Graham, B., H. Ludwig, D. Bronson, M. Benyesh-Melnick and N. Biswal.
1972. Physiochemical properties of the DNA of herpes viruses.
Biochemical and Biophysical Acta. 259: 13-23.
Handa, H. and H. Shimojo. 1977. Isolation of the viral DNA replication
complex from adeno-associated virus type 1 infected cells. Journal
of Virology. £4: 444-450.
Hayward, G.S., N. Frenkel and B. Roizman. 1975. Anatomy of herpes
simplex virus DNA: strain differences and heterogeneity in the
location of restriction endonuclease cleavage sites. Proceedings
of the National Academy of Science. 72: 1768-1772.


I certify that I have read this study and that in my opinion it
conforms to acceptable standards of scholarly presentation and is
fully adequate, in scope and quality, as a dissertation for the degree
of Doctor of Philosophy.
//J/'Cot'3\uc^A c,
/
Nicholas Muzyczka, Ph.D. ^
Assistant Professor of Immunology and
Medical Microbiology
I certify that I have read this study and that in my opinion it
conforms to acceptable standards of scholarly presentation and is
fully adequate, in scope and quality, as a dissertation for the degree
of Doctor of Philosophy.
William K. Holloman, Ph.D.
Assistant Professor of Immunology and
Medical Microbiology
I certify that I have read this study and that in my opinion it
conforms to acceptable standards of scholarly presentation and is
fully adequate, in scope and quality, as a dissertation for the degree
of Doctor of Philosophy.
^Gary S. StejJj/'RTID.
Professor of Biochemistry and Molecular
Biology


IMPORTANT NUCLEOTIDE SEQUENCES INVOLVED IN
LATENCY OF DNA VIRUSES OF ANIMALS
By
Mark A. Rayfield
A DISSERTATION PRESENTED TO THE GRADUATE COUNCIL
OF THE UNIVERSITY OF FLORIDA
PARTIAL FULFILLMENT OF THE REQUIREMENTS
FOR THE DEGREE OF DOCTOR OF PHILOSOPHY
UNIVERSITY OF FLORIDA
1982

Copyright 1982
by
Mark A. Rayfield

This work is dedicated to my family: to my parents Martin and
Fran whose sacrifices made it all possible, to Glenn who shared the
lean years and to my wife Dot for her loving support of a very tired
and grouchy graduate student

ACKNOWLEDGEMENTS
I would like to acknowledge the efforts of Tess Korhnak and Dr.
Vishwanath Suryanarayanan with whom I've had the good fortune to be
associated during these studies. I would also like to take this oppor
tunity to express my appreciation to the members of my advisory committee,
especially Dr. Kenneth I. Berns. A warm thanks is extended to Drs. Bill
Hauswirth, Bill Hollowman and Phil Laipis who have continually supplied
good natured advice and whose laboratories have been a warehouse of
materials and equipment. Finally, I would like to thank my wife Dot and
Gail Crummer, a masochist but dear friend, for their selfless contribu
tions to the organization and drafting of this manuscript.
IV

TABLE OF CONTENTS
SECTION PAGE
ACKNOWLEDGEMENTS iv
ABSTRACT . vi i
INTRODUCTION 1
Molecular Biology of HSV 7
Genome Size and Composition 7
Nucleotide Sequence Arrangement 10
Endonuclease Cleavage Map 13
Transcription 14
MATERIALS AND METHODS ..... 20
Purification of Ganglion Cell DNA and RNA 20
Viral DNA Purification 20
Preparation of Cloned DNA ...... 22
DMA Restriction 26
Gel Electrophoresis 26
Isolation of Endonuclease Cleavage Products 27
Mapping Approach 28
Nick Translation 30
Iodination of Cytoplasmic RNA 31
5' End Labeling Reactions 31
Southern Blots 32
Hybridization Reaction 33
RESULTS 35
Experimental Approach 35
Controls 37
Hybridization of Ganglia Nucleic Acids to HSV DNA 41
CsCl Enrichment Studies 44
Mapping the L/S junction of HSV-1 F strain 49
HYBRIDIZATIONS 59
Hybridization of ganglia RNA to the L/S junction 59
Cross Hybridization Experiments 60
DISCUSSION
75

LIST OF REFERENCES 88
BIOGRAPHICAL SKETCH 98
vi

Abstract of Dissertation Presented to the Graduate Council
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy
IMPORTANT NUCLEOTIDE SEQUENCES INVOLVED IN
LATENCY OF DNA VIRUSES OF ANIMALS
By
Mark A. Rayfield
December 1982
Chairman: Kenneth I. Berns, Ph.D., M.D.
Major Department: Immunology and Medical Microbiology
We have investigated the molecular status of the Herpes simplex
virus (HSV) genome in latently infected human trigeminal ganglia. The
general aim of this research is to illuminate the genetics of viral
latency during recurrent infections in man. The trigeminal ganglia of
22 patients have been assayed for HSV sequences by DNA/DNA or RNA/DNA
hybridization. None of the patients manifested clinical evidence of
recurrence at the time of death nor was a history of recurrent HSV
lesions noted. Fourteen of the patients were sero-positive for HSV.
Positive serology was assessed as a complement fixation titer of 1:8 or
greater. In 18 of the 22 assays in which trigeminal ganglia were evalu
ated for the presence of HSV, total ganglionic DNA was cleaved by endo
nuclease digestion, transferred to nitrocellulose and probed with rich
nick-translated HSV DNA. The nucleic acid from two of the sero-positive

patients failed to demonstrate HSV specific sequences in either DMA or
RNA. Only one of the eight sero-negative patients gave evidence of the
presence of HSV DNA or RNA, the remainder were negative. Thus, there is
a positive correlation between the presence of complement fixing anti
bodies and the presence of sequestered HSV specific sequences as
measured by these techniques. Further, from the mapping of those RNA
transcripts observed, it is clear that the regions of the genome most
frequently encountered to date are those containing sequences in the
immediate early and early mRNA species of HSV-1.
vm

INTRODUCTION
The involvement of herpes simplex virus (HSV) in recurrent infection
of man is well documented. These recurrences are most frequently mani
fested as periodic ulcerations of the oral or genital mucosa and infections
of adjacent cutaneous tissues. Recurrent herpetic keratitis is, today,
the most common severe ocular infection in the United States and is the
principle factor involved in blinding corneal disease. Ocular infections
in 50% of the patients experiencing a primary episode will recur within
2 years. Latent virus is the probable source of infection producing
acute episodes of HSV encephalitis and meningitis in adults. It also
serves as a reservoir for virus involved in generalized herpetic infec
tions in newborns and is potentially involved in carcinoma of the cervix.
Several lines of evidence suggest the involvement of neural tissue
with viral latency in man. Repetitive infections generally occur in
localized tissues which define together the limits of a region inner
vated by a single sensory ganglia. Trauma to the sensory nerve will
consistently induce a viral recurrence in peripheral tissue. Reactiva
tion occurs in greater than 90% of the patients undergoing root sections
of the trigeminal nerve; none is observed after trauma to tissue pre
viously denervated (Carton and Kilborne, 1952). A majority of the patients
who reactivate following neurosurgical treatment for trigeminal neuralgia
have a history of recurrent herpes labial is (Pazin £t aj_., 1978). While
such observations are only indirect evidence that neural tissue is the
site of latency, it is noteworthy that the significant efforts by
1

2
investigators to demonstrate virus in peripheral tissues during quiescent
periods have failed (Rustigan et al_., 1966; Baringer, 1975)..
HSV can be liberated from cultures of latently infected trigeminal
ganglia from unselected humans (Bastian et al_., 197.2.; Baringer., 1974).
Using tissue cocultivation with HSV susceptible cell lines or organotypic
cultures for periods of 10-45 days in vitro, the vagus, sacral and
superior cervical ganglia may also be shown to harbor virus in some
individuals (Baringer 1974, 1975; Marren et al_., 1978; Lonsdale et al.,
1979). EM studies show virions and cytopathology similar to that of HSV
in such cultures. The virus isolated may be identified as HSV on the
basis of both serologic (Bastian et al_., 1972; Baringer, 1975) and genetic
criteria (Lonsdale et al_., 1979). Similar culture techniques fail to
yield virus from the choroid plexus, trigeminal nerve root or cutaneous
tissues from known positive individuals. This argues that the ganglion
may be the sole site of latency.
Several parameters of latency can be envisioned from studies of
the virus yielded from explants. Serological evaluations of isolates
suggest that the virus remains phenotypically unaltered during latency;
reactivated virus may at some point spread to adjacent ganglia and
become latent in these; ganglia innervating remote peripheral sites may
infrequently become latent with seriologically distinct strains of the
virus; finally, both HSV type I and II may be latent and recur within the
same individual (Stevens and Cook, 1971; Baringer, 1975). Analysis of the
restriction endonuclease digestion patterns of their DMA and gel electro
phoresis patterns of isolates proteins confirms these observations
(Lonsdale et al., 1979; Buchman et al., 1978). Further, such studies
have shown that the isolates were unique to an individual unless they

3
were epidemiologically related and that within the individual multiple
isolates from different ganglia were usually genetically identical
Infection of peripheral ganglia appears to be subsequent to viral spread
from the site of initial infection in a majority of individuals. These
observations suggest that once a sensory ganglion cell becomes latently
infected it is to some degree refractory to superinfection by a future
viral isolate. Complementation studies involving superinfection of
ganglia with temperature sensitive mutants of HSV indicate that many
harbor defective or pari tal viral genomes (Brown et al_., 1979).
Currently two animal models exist for neural latency of HSV. Virus
inoculation in the foot pad of mice gives rise to a subsequent infection
of the spinal ganglia (Stevens and Cook, 1971). This infection is
biphasic. A primary acute infection occurs during which high titers of
virus are found in spinal fluid and tissues. Virus titers then subside
and a chronic phase of infection follows. During this period virus may
only be demonstrated by maintenance of ganglia explants in organotypic
cultures. The chronic period probably most closely mirrors the quiescent
periods in many, but the mouse is not clearly known to undergo recurrence.
Intraocular inoculation of rabbits leads to viral spread and involvement
of the trigeminal ganglia (Stevens and Cook, 1972; Goodpasture 1929).
The infected globe will thereafter undergo periods of quiescence and
recurrent infections.
Several parallels can be drawn betv/een chronically infected murine
neural tissue and latently infected human ganglia. Only the spinal
ganglia associated with sciatic nerves, innervating the site of inocula
tion, harbor HSV. The virus can be demonstrated by immunofluorescence
and electron microscopy after explanation and in vitro maintenance in

4
organ cultures. Cultures of the sciatic nerve trunk, thoracic spinal
cord and medulla oblongata do not yield virus. Persistently infected
mice also possess neutralizing antibodies to HSV (Stevens and Cook, 1971).
The lack of virus-specific products during the chronic periods suggests
that the HSV genome may exist as a subviral unit in ganglionic cells.
Searches for products of viral replication in latent tissue confirm
the hypothesis that few ganglionic cells are directly involved with
persistence. In chronically infected mice less than 0.1% of the
ganglionic cells will act as infectious centers for the virus and those
cells positive in fluorescent antibody assays are in the great minority
(Walz et al_., 1976; Stevens and Cook, 1972). The presence of HSV-
specific thymidine kinase activity in the absence of late viral protein
markers may indicate an early termination of viral replication in
chronically infected murine ganglia (Yamamoto et al_., 1977). It is also
possible that some species of mRNA are very stable or that transcription
continues from "remnants" of the viral genome in some cells.
HSV initially inoculated into the mouse via the ear can be stimu
lated to reactivate through localized minor trauma to the ear (Hill et
al., 1975). During the quiescent periods in this recurrence model, virus
is absent from the peripheral tissue, but can be found in the 2nd, 3rd
and 4th cervical ganglia. Several forms of stimuli are effective: UV
light, cellophane tape, and stripping or swabbing the ear with xylene.
All such agents produce a localized inflammatory response and provoke
increased levels of prostaglandins within the skin. It is uncertain
what role these factors may play during recurrence. It is clear that
the effective agents do induce changes within the ganglia as evidenced
by increases in infectious virus and tritiated thymidine uptake within
the ganglia 2 to 4 days following trauma to the ear (Hill et aK, 1975).

5
Similar observations have been made in HSV latently infected rabbits
In this model, viral spread may be clearly followed from the site of
inoculation to the peripheral nervous system and then to the central
nervous system in individuals where meningitis and encephalitis ensue.
At each level of spread the infection is first manifest in neurons and
then adjacent supportive cells, such as Schwann cells or satellite cells
(Goodpasture 1929; Baringer et al_., 1974). The rate of viral spread
within the nerve trunk approaches that of retrograde transport of pro
teins within the ganglia (Stevens 1975). The kinetics of viral infection
and the presence of virus in intra-axonal vesicles has prompted investi
gators to propose that intra-axonal transport is the principal mode of
viral spread (Cook and Stevens, 1973; Kristensson et al_., 1974; Baringer
1975). Seventy percent of the trigeminal ganglia in latent rabbits yield
virus upon explant while cultures of the conjunctiva, lacrimal gland,
cornea, iris, fifth cervical nerve and brain tissue are negative. Immuno
flourescent antibody studies on serial sections of rabbit trigeminal
ganglia show 1/500 neurons infected with HSV during the first week
following corneal inoculation. This ratio of immunopositive to immuno-
negative neurons falls to approximately 1/2000 to 1/5000 by 20 weeks
following inoculation. At this later date the yield of infectious virus
from explanted organ cultures is still on the order of 90% (Racjani 1978)
These findings closely parallel the observations of Baringer and
Sworeland (1973) in man. Lastly, single abnormal ganglion cells
surrounded by a cuff of mononuclear cells may be seen infrequently as
late as 11 months post infection. The nuclei of such cells contain HSV
particles and their cytoplasm is highly vacolated with virions contained
within intra-axonal vesicles (Baringer 1974). It is unclear whether

6
such cells are the product of the original infection or remnants of a
recent recurrence. The mass of this evidence argues that the ganglionic
neuron serves as the site of viral latency. The findings also suggest
that latency is not a totally "statis" event but is "dynamic" to the
extent that, with even long periods of clinical quiescence, a few neurons
continue to act as infectious centers within the ganglia.
Although recurrence appears to be a natural phenomenon in rabbits,
it can also be artificially induced. Mechanical stimulation is usually
achieved through neurosurgical manipulation of the trigeminal nerve
root. Following such treatment, virus can be isolated from the tears of
80% of the animals within 48 hours (Nesburn ejt al_., 1976). These
findings closely parallel the observations made by Carton and Kilborne
(1959) and Pazin et aj_ (1978) in man.
In situ hybridization of HSV specific complementary RNA probes to
latent murine ganglia genetic material show viral nucleic acid sequences
in a small minority of the neurons (Cook ejt al_., 1974; Zur Hausen and
Schulte-Holthausen, 1975). Analysis of hybridization experiments by
Puga ejt aj_ (1978) demonstrates approximately 0.1 genome equivalents of
HSV DMA per cell in such ganglia. The quantity of viral RNA fell below
the limits of detection during the chronic period. The techniques
employed in this work were sensitive enough to detect 1 genome equiva
lent of viral RNA per 2000 cells but at this sensitivity as many as 400
RNA copies per cell would go undetected.
Finally, using a nick translated H-labeled HSV DMA probe, viral
specific RNA sequences can be demonstrated in human ganglia sections
with in situ hybridization (Galloway ejt a_T_^, 1979). Such sequences may
be found in the sacral, thoracic and lumbar ganglia, confirming previous

observations that an individual could be latent at multiple ganglionic
sites. In each case only 0.4-8.0% of the ganglionic neurons possessed
HSV specific nucleic acid sequences..
Molecular Biology of HSV
The infectious HSV particle has evolved a rather complex architec
ture. A 1000 nucleocapsid of acosahedral symmetry encloses the double
stranded linear DNA chromosome and various phosphoproteins of the viral
chromatin (Russell et al_., 1962; Becker £t al_., 1968; Spear and Roizman,
1972). This core is itself encompassed by a loose matrix of glycoproteins
and carbohydrates of viral origin. Ultimately, the entire structure is
surrounded by a lipid envelope, giving the infectious virion a diameter
of roughly 1800 A. Quantitatively the mature particle is comprised of
approximately 70% protein, 22% lipid, 7% nucleic acid and 2% carbohy
drate (Scott and Tokumaru, 1964; Callaghan et al_., 1976). Although the
viral genome has the potential to encode and modify through methylation
or glycosylation all known virion associated proteins, the lipid moiety
of the envelope appears to be principally derived from the phospholipids
of the infected cell's nuclear membrane (Watson et al_., 1973; Roizman
et al_., 1974). All known protein species associated with the envelope
arise from either virus specified de novo synthesis or modification of
cellular proteins (Kaplan 1973; Spear 1972).
Genome Size and Composition
The DMAs extracted from sucrose gradient purified virions of HSV-1
and HSV-2 differ in bouyant density by 0.002 g/cm3 (Goodheart et al.,
1968; Kieff ejt aj_., 1971). Goodheart £t al_ (1968) and Plummer et al
(1970) determined these densities to be 1.725 g/cm3 for HSV-1 and 1.727

8
g/cm3 for HSV-2. Similar estimates were obtained by Graham (1972) using
E. col i DNA as a density reference These values predict a G + C ratio
of 66.3% for HSV-1 and 68.4% for HSV-2 (Goodheart et al_., 1975). Kieff
3
et al_ (1971) established 1.726 and 1.728 g/cm for the respective bouyant
densities in CsCl isopycnic gradients using SP01 DNA as a marker. The
resulting 67% and 68% G + C ratios were confirmed by the finding of a
1C difference in the Tm values for HSV-1 and HSV-2. While Kieff
reported the Tm of type 1 to be 83C and type 2 to be 84C, Graham et al_
(1972) found only a 0.1C difference in Tm values of 82.6 and 82.7C.
Both serotypes of HSV have a sedimentation rate in neutral sucrose
density gradients of 55 S with a co-responding molecular weight of
995xl0^ daltons (Kieff et al_., 1971; Sheldrick and Berthelot, 1974).
The contour length for the linear duplex molecule, based on EM studies,
is approximately 100x10 daltons (Sheldrick and Berthelot, 1974; Wilkie,
1973). The estimated molecular weight of HSV-1 circles is 943xl0
daltons; if one considers a 3% redundancy in their terminal overlap this
would suggest a value for the linear molecule of 973xl0^ daltons
(Grafstrom et a]_., 1974). In a comparative analysis of restriction endo
nuclease fragments from 80 isolates of HSV-1 Buchman et al_ (1978) found
a variation of only 2% in the determination of overall molecular weight
between isolates.
The similarities between HSV-1 and HSV-2 are apparently not limited
to a cursory examination of molecular weight and composition. Liquid
and filter hybridization analysis of their DNAs suggests an 85% homology
over 46% of their genomes; the remaining 56% of their respective genomes
is highly variable with little homology (Kieff et a]_., 1971). Nearest -
neighbor analysis for the two gives virtually identical frequency patterns.

9
However, a 2.2% difference in G + C ratios would predict a mismatch of
at least 3850 base pairs between serotypes (Subak-Sharpe et al., 1973).
Polypeptide mapping studies of intratypic recombinants give strong evi
dence of a col linearity in gene ordering within HSV-1 and HSV-2 chromo
somes. The reported viability of intratypic recombinants and the ability
of ts mutants of HSV-1 to complement ts mutant of HSV-2 also suggest
little divergence within functionally critical regions of the genomes
(Subak-Sharpe et al_., 1972; Morse et al_., 1977). Such evidence indicates
extensive similarity in the gross architecture of the two genomes and
argues for a distant but common lineage.
An interesting characteristic of the structure of the HSV chromo
some is the presence of single-strand interruptions in the DMA. When
alkali denatured DMA from purified virus is sedimented on alkaline
sucrose density gradients numerous bands of single-stranded DMA may be
observed. These bands correspond to fragments of 7x10^ dal tons to
intact strands 48x10^ daltons in weight (Kieff et al., 1971; Wilkie 1973).
Frenkel and Roizman (1972) have distinguished 6 classes of fragments,
ranging from 10x10^ to 39x10^ daltons, in denatured HSV-1 DNA. The
kinetics of reassociation within the intact size, 39x10^ daltons, class
indicated this class was composed of elements representing a single unique
strand of DNA. In conflict with this interpretation are the findings of
Wilkie (1973) which suggested a randomly gapped genome and nonunique
intact strands. To date no biological function has been ascribed to the
single strand gaps and the controversy over random vs. defined sizes has
not been reconciled. Newly synthesized viral DNA has been reported to
contain short stretches of RNA (Biswal et al., 1974). It is unlikely
that such RNA stretches alone would account for these gaps since the

10
sedimentation profiles in neutral sucrose gradients are indistinguishable
for DMA denatured with formamide versus alkali (Roizman, 1979). The
consequences of a randomly gapped genome in the absence of a mechanism
for repair are self evident. It can be speculated that abortive trans
cription due to an early truncation of the template could play a role in
viral latency or oncogenic transformation. It is noteworthy that no
repair mechanism has yet been clearly demonstrated.
Nucleotide Sequence Arrangement
If following denaturation, single strands of HSV DNA are permitted
*
to reanneal a high degree of self annealing can be observed by electron
microscopy. Among those strands that have folded back on themselves
three recognizable structures can be identified: a linear form with
extensive folding at one end, a single stranded circle with a heavily
folded region and a structure consisting of two single stranded circles
joined by a duplex region (Sheldrick and Berthelot, 1974). The forming
of two single stranded circles connected by a double stranded region is
indicative of the presence of two inverted repetitions of the termini
within the molecule. In a similar manner duplex circles may be formed
after treatment of hative HSV DNA with exonuclease III (Sheldrick and
Berthelot, 1974; Grafstrom et ajk, 1975). Such behavior is consistent
with the presence of natural repetitions at the single strand termini.
Thus the HSV chromosome is bracketed by direct repeats and consists of
two unique gene regions of differential length separated by two tandemly
arranged inverted repetitions of the termini. One implication of such a
model is that following concatameric replication of the molecule the
relative orientation of the two unique gene regions may be inverted
through recombination between the external and internal repetitions
(Thomas and MacHattie, 1967; Sheldrick and Berthelot 1974).

11
Partial denaturation mapping of the chromosome confirms this archi
tecture and permits the sizing of the various regions. The long unique
gene region comprises 70.2% of the genome while the shorter unique region
involves 9.4%. The direct and inverted repeats bracketing the long region
each represent 6% of the genome length and can be further divided into
two subregions: the a, a' reiteration and the b,b' reiteration, which
is found only in the long segment. In like manner repeats associated
with the short unique region can be designated a'c1 and ca, respectively;
comprising 4.3% of the genome. The a,a' sequences are held in common
between the long and short gene regions while the c, c1 and b, b' inver
sions are limited to the short and long regions respectively (Wadworth
et al_., 1975). Partial denaturation studies and subsequent endonuclease
digestion mapping further confirm that the long and short components are
able to invert in their relative orientations. Thus, as originally pre
dicted by Sheldrick and Berthelot (1974), within a population of HSV DMA
four conformations of the molecule can be determined which differ in the
relative orientations of the long and short unique regions (Hayward 1975;
Delins and Clements, 1976; Wilkie, 1976). The diagram below illustrates
this point.
One consequence of such an arrangement is that endonuclease
cleavage fragments spanning the L/S junction will be found in a 0.25
molar ratio relative to unique fragments and the terminal fragments will
be present in a 0.5 molar ratio. This prediction was confirmed by
Hayward (1975) in an analysis of the Mind III and Eco R1 digestion frag
ments of HSV-1. Morse et_ al_ (1977) has suggested that another conse
quence of this genome architecture is that not all conformations may be
functionally equivalent. If one aligns the amps of intertypic

12
B
o
t-
10 20 30 40
H 1 1-
50 60 70 80
H 1 1 H-
90
100
I
prototype
L
L&S
Figure 1. Inversion of HSV DNA
recombinants to give the least number of crossover points, the resulting
progeny could only have originated from recombination between parents
which were both in the prototype configuration. Such an approach does
not take into account the contribution of double cross over events
(Morse et_ al_., 1977; Roizman, 1979). To date analysis of recombination
frequencies between genetic markers in the long and short regions has
shed little light on the validity of this assumption.

13
Endonuclease Cleavage Map
In addition to the size variation in fragments spanning the L/S
joint, arising from inversion of the unique components, two other
classes of heterogenity are evident in cleavage maps of both HSV-1 and
HSV-2. One type of heterogenity maps solely to the unique regions and
appears to define viral strains. The differences within this class
arise from the presence or absence of specific endonuclease cleavage
sites and are found throughout the long and short components (Skare, 1975;
Hayward, 1975; Locker and Frenkel, 1979). In a study of eighty HSV-1
isolates, Buchman (1978) determined 19 out of 60 cleavage sites which
could be either present or absent; suggesting the possibility of at
19
least 2 viral strains within the population. At this level of analysis
the cleavage maps of HSV-1 and HSV-2 are quite distinct. This first
class of heterogenity is less frequent in HSV-2 (Roizman, 1979). The
loss or gain of a single cleavage site need not give rise to a new
clinically or immunologically recognizable viral strain. Thus the number
19
of immunologically identifiable strains need not approach 2 value.
The ability of HSV to remain latent within an individual with inter
mittent recurrences would provide a natural reservoir for the accumula
tion of nonlethal mutants within the population. The lower frequency of
heterogenity in HSV-2 may simply mirror a smaller reservoir within the
populace. The second class of heterogenity maps to the termini of the
long unique region (Wagner and Summers, 1978; Skare and Summer, 1977)
of HSV. These differences derive from the insertion of a 280bp segment
into the terminal reiteration of the L component in single or multiple
5
copies giving rise to a series of minor fragments with a distinct 2x10
dal ton increment in size (Wagner and Summers, 1978). Here again a
5
variance between viral strains may occur since a 3.3x10 dal ton

14
increment in size is observed between minor fragments in HSV-1 (F) DNA.
In addition, while the minor fragments from the termini of HSV-1 differ
by 255 base pairs, those arising from the L/S junction differ by only
125 base pairs (Locker and Frenkel, 1979). Subsequent work with HSV-1
(F) has directly linked the tandem addition through recombination of the
501 base pair 'a' segment to the L termini with the generation of those
minor bands (Mocarski et al_., 1980). Size variability has also been
reported for endonuclease fragments containing the c, c1 repeat regions
(Lonsdale et al_., 1979). This heterogenity can again be traced to the
copy number of a 23 base pair repeat present within the c regions. The
reiteration can occur in a variable copy number between viral strains,
between clones of same viral strain and lastly between the c and c1
reiterations of the same strain (Watson and Van de Woude, 1982; Rixon
and Clements, 1982).
Transcription
Once a permissive host cell is infected, viral replication rapidly
follows in a well-ordered seuqence of events. With uncoating, transcrip
tion of defined regions of the viral genome proceeds in a highly regu
lated temporal manner (Clements ejt afl_., 1977; Jones and Roizman, 1979).
Transcription of host cell specific RNA (C-RNA) continues at a reduced
rate, but synthesis and processing of cellular mRNA is rapidly inhibited,
as is the appearance of mature cellular rRNA. This inhibition appears
to be coded for by the earliest viral transcripts (Wagner and Roizman,
1969; Kaplan, 1973). For the most part, the reduction in the rate at
which mature rRNA appears is brought about by the interference of
infection with its maturation; synthesis of the 45 s RNA precursor con
tinues at roughly the same level as that of C-RNA (Wagner and Roizman,

15
o b
HSV- 1 F
Eco Rl
Xbo I
Eco Rl
Hpo I
Hsu I
X bo I
ba
4-44-
4 b
HP 1 H-H t If-4 I
Hsu I h 1 1
44-44+
H M-
0
h
10 20 30
H 1 4-
40
50
I
60
70
-4
80
-M-
-I 4-
4b
90
-4
100
-4
Figure 2. Restriction Map of HSV-1 and HSV-2 DMAs (Roizman, 1979).
1969). However, while there is a stable accumulation of C-RNA within
the infected cell, inhibition of host mRNA synthesis is completed to the
extent that no de novo synthesis of cellular mRNA can be observed late
in infection (Kaplan, 1973). As the rate of host cell DNA synthesis
gradually falls off, it is rapidly surpassed by that of nacent viral DNA.
By 7 to 8 hours post infection, host DNA is no longer replicated. This
inhibition is concomitant with that of host cell protein synthesis and

16
thus may mirror the loss of proteins specifically required by the cell's
replicative machinery (Roizman et al_., 1974). The peak rate of synthesis
for the earliest viral polypeptides is reached between 2 and 4 hours post
infection. The chief function of these proteins is to govern the change
over from cellular to viral macromolecular synthesis. There is a strin
gent requirement for these immediate early polypeptides (a-proteins)
prior to the production of a second and larger group of proteins, the
early polypeptides (e-proteins), which appear 5 to 7 hours post infection.
These e-polypeptides augment the replication of the HSV genome. They
also govern argradual reduction in a-protein synthesis and pave the way
for production of the late structural proteins (y-polypeptides) of the
HSV virion (Honess and Watson, 1974; Pereira et al., 1977).
Viral mRNA is transcribed within the nucleus (Wagner and Roizman,
1969), is polyadenylated at its 3' end (Bachenheimer and Roizman, 1972;
Silverstein et al_., 1976) and carries a 5' cap (Moss et al_., 1977).
Prior to viral DNA synthesis two classes of viral mRNA, the immediate
early and early transcripts, are abundant and are transcribed at least
in part by host cell RNA polymerase II (Jones and Roizman, 1979; Clements
et al_., 1977). Translation of these two classes of transcripts gives
rise to the aforementioned a and 3 polypeptides, respectively. The
immediate early mRNA represents approximately 12% of genome and is made
in the absence of previous viral polypeptide synthesis. It can be iso
lated in abundance from the cytoplasm of infected cells treated with
cyclohexamide (Jones and Roizman, 1979). These transcripts range from
1,500-5,500 nucleotides in size and map preferentially to the terminally
reiterated portions of the genome (Clements et al_., 1977, Holland et al.,
1979). The second class of mRNA which is abundant before viral DNA

17
synthesis have a stringent requirement for a polypeptide synthesis prior
to its production. The viral DNA polymerase falls within this group.
Early transcripts map throughout the HSV genome and the size of their
nuclear precursors differs little from that of the polysomal bound popu
lation suggesting that their promoters map close to the structural genes
(Holland et al_., 1979). Together the sequences transcribed prior to DNA
synthesis represent approximately 25% of the genome.
Comparative inhibition studies indicate that more than one polypep
tide in the a and g groups is involved in regulation of transcription
and the transition from a to 0 to y protein synthesis. For example
canavanine selectively inhibits subsets of these proteins and permits
partial transition from immediate early to early and then to late trans
cription. As with early transcripts, late transcription occurs through
out the genome with approximately 50% of the viral RNA at 6 hours post
infection having a length of 5,000 to 10,000 nucleotides. At this time
transcription of most early viral RNA continues with y mRNA species
representing approximately 20% of the accumulated viral mRNA.
The complex overlapping hybridization patterns of viral mRNA to the
HSV genome suggest that an elaborate series of interlocking controls
regulate transcription and translation with multiple RNA species derived
from limited regions of the genome and nucleotide sequences common to
several messengers. As suggested above the immediate early promoters
are compatible with the existing host cell transcriptional machinery yet
early promoters appear to have been modified by one or more a viral
proteins. The insertion of the 5' promoter region of immediate early
(IE) mRNA 3 into sequences upstream from the early thymidine kinase
structural gene permits its transcription as an immediate early species

18
(Post et al_., 1981). As with other mammalian DNA viruses both mRMA
splicing and overlapping coding regions has been documented. With
respect to overlapping coding regions, the 5' termini of two early mRNA's
have been mapped to the region of the HindiII cleavage site at 0.586.
The regulatory signals for transcription of the smaller 1.2 kb mRNA are
found within the larger 5.0 kb transcript. Both mRNAs are unspliced.
The 5.0 kb species encodes a 136,000 dalton protein while the smaller
1.2 kb messenger codes for a 38,000 dalton protein. These early mRNAs
have a 3' co-terminus (Anderson et al., 1981; McLauchlan and Clements,
1982). Analysis of the co-terminus revealed the sequence AAUAAA with an
A + T rich region 3' to the sequence. This is the general format for the
3' termini of all early HSV mRNAs studied to date.
The IE mRNA-4 and IE mRNA-5 share a common 5' sequence. In this
instance the promoter and capped 5' termini map to the reiterated
sequences flanking the short unique region. Both messages share a
common 247 bp leader with a single splice located within the reiterated
sequences. A 'TATA' box is located approximately 25 bases 5' to the
leader and the common splice appears to function only to remove the
introns from a 5' untranslated region (Rixon and Clements, 1982). Since
these are the only messages located in this portion of the genome,
splicing does not increase the coding capacity of this region. It should
be noted that between IE mRNA-3 and IE mRNA-5 is a stretch of 800 nucleo
tides which is not transcribed. This region may include the origin of
DNA replication (Vlanzy and Frenkel, 1981; Watson and Van de Woude, 1982).
Lastly, comparison of the 5' terminus of the IE mRNA-5 gene to that of
early thymidine kinase gene revealed that the regulatory sequence GGCGATTC
was absent in the immediate early gene while present 80 base 5' to the

19
early transcribed region (Watson, 1982). Eco R1 endonuclease cleavage
at this sequence causes reduced levels of thymidine kinase expression
(Wigler et al_., 1977; McKnight and Gavis, 1980) and the sequence is
similar to the RNA polymerase II regulatory signal GGPyCAATCT described
by Benoist et al_ (1980). Thus transcriptional control at the promoter
level must distinguish between immediate early, early and late signals
and between origins of transcription within the same class; as in the
case of the two early promoters described above with a 3' co-terminus.
The rationale for studying the molecular status of the latent herpes
genome is in reality twofold. In a general sense, if the latent genome
is present as a subviral unit within the cell it provides a well defined
gene region of which specific questions concerning gene content and
transcription may be asked. In theory, such a genetic system would be
subjected to many of the restraints governing the activities of the genes
of its eukaryotic host, regardless of whether the viral DNA was inte
grated or funcitonally an episome. The more direct concern of this study
is to approach the question of whether the HSV genome is functionally
dormant during its latency or does itself provide some necessary
activity. An assay for specific regions of the HSV genome should deter
mine which portions of the viral DNA are most frequently retained in
latency while an evaluation of viral RNA will determine which regions of
the genome are most frequently expressed. The retention and expression
of certain genomic regions common to all HSV latently infected ganglia
argue that the virus may play an active rather than passive role during
latency.

MATERIALS AND METHODS
Purification of Ganglion Cell DNA and RNA
Teased ganglia preparations were washed 2 times in 1 ml of 1XSSC
(150 mM NaCl and 15 mM Na2CgHg0y, pH 7.6), Dounce homogenized and trans
ferred to siliconized 1.5 ml Eppendorf centrifuge tubes. The homogenate
was spun at 10,000 rpm for 2 minutes to pellet nuclei from which the DMA
was extracted. The resulting supernatant was extracted 2 times with
phenol-cresol-chloroform (5:1:1 mixture) and ether extracted 3 times.
From the extracted supernatant, total cytoplasmic RNA was precipitated
with diethylpyrocarbinol (DEPC) treated ethanol and stored at -20C.
For isolation of nuclear DNA, the pellet was first resuspended in 1 ml
1XSSC, 1% sodium dodecyl sulfate (SDS) and then treated with pronase
(1 mg/ml) at 37C overnight. The preparation was then phenol extracted
2 times, ether extracted 3 times and RNase A treated (20 mg/ml) for 30
minutes at 37C to degrade nuclear RNA. This was followed by 2 addi
tional phenol extractions. The DNA was then precipitated with ethanol
and stored at -20C. This procedure yielded approximately 26 yg of DNA
pre ganglia preparation.
Viral DNA Purification
HSV-1 DNA was isolated as previously described by Holland (1979).
Briefly, confluent monolayers of human epidermoid carcinoma cells (HEP-2)
were infected with HSV-1 at a multiplicity of 10 PFU/cell and incubated
in Eagle's minimum essential medium with 10% calf serum at 37C (Roizman
1968). Thirty hours post infection the monolayers were scraped into
20

21
medium, which was clarified by spinning at 1,000 xg for 15 minutes. The
clarified medium was stored on ice and the cell pellet resuspended in
cold reticulocyte saline buffer (0.01 m NaCl, 0.00T5 m MgC^ 0.01 M Tris,
pH 7.4) and 0.5% Triton. The cells were lysed by 10 strokes in a Dounce
homogenizer. The cell homogenate and clarified media were then each
spun at 10,000 xg for 15 minutes to remove nuclei and cell debris. The
resulting supernatants were pooled and from these HSV-1 virions were
pelleted by centrifugation at 33,000 xg for 30 minutes. Virions were
resuspended and lysed in 10 mM Tris, pH 7.5, containing 50 mM EDTA, 0.5%
SDS and 1% sarkosyl. The lysate was digested overnight at 37C with
pronase at a final concentration of 2 mg/ml (Walboomers and Ter Schegget,
1976). The digest was phenol extracted twice and ether extracted 3 times.
HSV-1 DNA was purified by banding twice in an isopycnic ethidium bromide -
3
CsCl gradient. The starting density of CsCl was 1 .566 g/cm with 100
yg/ml ethidium bromide and centrifugation was for 48 hours in a Ti50
rotor at 45,000 rpm (Pater et aj_., 1976).
Partially purified HSV-1 F strain DMA was also received from Dr.
Saul Silverstein, Columbia University, New York, NY. These preparations
had been treated in the following manner: Nucleocapsids were purified
from cytoplasmic extracts of infected Vero cells by velocity sedimentation
in sucrose gradients. The virions were lysed in the presence of 0.5% SDS,
0.5% sarcosyl and 10 mM EDTA. The lysate was then extracted with phenol,
chloroform and 2% isoamyl alcohol to remove proteins and lipids. The DNA
was then precipitated with ethanol and stored (Spear and Roizman, 1972).
Viral DNA preparations received in this form were resuspended in
2XSSC and further purified on CsCl density gradients. A single viral
band was obtained at a density of approximately 1.728 g/cm which was well
separated from contaminating, cellular DNA and RNA in the pellet (see

22
Figure 3), The HSV-1 DMA was not highly fragmented as shown by ultra-
32
centrifugation on 5-20% alkaline sucrose gradients using P-labeled
form II SV40 as a size marker (see Figure 4) (Kieff et al_., 1971;
Pignatti et al., 1979).
Preparation of Cloned DMA
Two clones of the reiterated junction between the long and short
unique regions of HSV-1 DNA designated pRBl04 and pRBl15 were obtained
from B. Roizman, University of Chicago, Chicago, IL. pRBl04 was
generated by the insertion of the Bam HI fragment SP^ of F strain HSV-1
into the Bam HI site in the tetracycline resistance gene of the Escherichia
coli plasmid pBR322; pRBl15 was derived in like manner but contained the
Bam HI fragment SP-| of F strain HSV-1 (see Figure 5). The plasmids were
provided in E. coli strain C600SF8 (Post et al_., 1980). Stocks were
maintained in 50% glycerol at -70Co Prior to growth, single colony
isolates were selected for ampicillin resistance, and grown overnight at
37C in Luria broth with 100 mg/1 ampicillin. Generally 20 mis of the
overnight culture were used to inoculate 2 liters of broth for the pro
duction of DNA stocks. The cultures were induced with the addition of
200 yg/ml chloramphenicol 15 hours before harvest.
Upon harvest the cultures were centrifuged at 10,000 xg for 15
minutes to pellet the bacteria. The bacterial pellet was washed once in
a solution of 10 mM EDTA and 50 mM Tris, pH 7.5 and then resuspended in
a solution of 25% sucrose, 10 mM EDTA, and 50 mM Tris HC1, Ph 7.5. All
subsequent extractions were conducted at 4C. The bacterial cell wall
was digested with egg white lysozyme (500 pg/ml). After 20 minutes in
the presence of lysozyme, (1 yg/ml) DEPC was added to inhibit breakdown
of nucleic acids and the cells were gently lysed in 0.5% Triton. Low
molecular weight DNA was extracted in the manner described by Hirt (1967).

Figure
IBOO
1.780
1.760
1740
1.720
1.700
1.69 0
1.6 60
1.640
3. CsCl isopycnic gradient purification of HSV DNA
q/cc CsCl

CPM
24
I
I
Figure 4. Alkaline Sucrose Gradient analysis of HSV DNA

25
O
I
10 20 30 40 50 60 70 80' 90 100
o b
E3-
' 'l '
b o *a c c o
hp^n
i
104
c=f-
2 13 5
i. lE-mRNA
L- I t Q
14 3
Figure 5. Origin of pRB104 and pRBl15 DNAs

26
The Hirt supernatant was brought to 0.5 M NaCI and polyethylenegycol
(PEG) 6000 was added to a final concentration of 5%. The plasmid DNA
was permitted to precipitate overnight at 4C. The resulting pellet was
isolated by centrifugation and resuspended in 50 mM Tris, pH 7.6 and 10
mM EDTA; excess PEG was removed by chloroform-phenol extraction and the
nucleic acids were ethanol precipitated in 250 mM sodium acetate, pH 4.7,
at -20Co Residual RNA in the resultant pellet was degraded by RNase A
treatment and form I plasmid DNA was subsequently isolated by ultracen
trifugation on CsCl-ethidium bromide isopycnic gradients (LePecq, 1970).
r
DMA Restriction
Viral DNA (3 yg) was digested with either EcoRl, HindiII or Hpal
endonuclease in a 50 yl reaction mixture at 37C for 2 hours; 1 unit of
enzyme per yg DNA was added per hour. The enzymes were obtained from
Bethesda Research Laboratories, Inc., Rockville, MD. Reaction buffers
used were in accordance with the instructions provided by the supplier.
Ganglionic DNA was digested with EcoRl or Hindlll in a 100 yl reaction
under the above conditions.
To develop a fine structure restriction of the BamHl fragment
spanning the joint region of HSV-1 DNA, cloned viral DNA was digested by
BamHl, Alul, BstEll, TaqI, Hindi, Aval and Smal endonucleases. All
cleavage reactions were conducted in accordance with the instructions
provided by Bethesda Research Laboratories, Inc. BstEll and TaqI endo
nuclease digestions were carried out at 60C: all other digestion reac
tions were done at 37C.
Gel Electrophoresis
Restriction enzyme digestions were phenol extracted and then electro-
phoresed on 0.5% or 1% agarose vertical slab gels at 2 V/cm. Viral DNA

27
was run on 40x15x3 cm 1% slabs with 1 cm wells, each receiving 500 ng
HSV-1 DNA in 10 yl of loading solution. Stock loading solution contained
0.05% bromphenol blue, 0.05% xylene cyanole and 50% glycerol in 0.01M
Tris, pH 7.4. This was diluted 1 to 3 with the digests prior to loading.
Digests of cloned viral DNA were electrophoresed in the same manner.
Cellular DNA was run on 14x12x3 cm 0.5% agarose slabs with 1 cm wells;
10 yg of DNA was loaded as above per well. The running buffer was con
tinuously circulated and contained 5 mM sodium acetate and 1 mM EDTA in
40 mM Tris, pH 7.8.
For size.determination and mapping, the digests of cloned viral DNA
were also electrophoresed on 6% acrylamide 0.15% bisacrylamide or 12%
acrylamide 0.30% bisacrylamide gels. DNA (3 yg) was loaded as above
per 5 mm well on 40x15x3 cm gels and 1 yg per 5 mm well on 40x15x1.5 cm
vertical slabs. The running current was 3 volts/cm. The continuously
circulated buffer was 40 mM sodium acetate and 2 mM EDTA in 50 mM Tris,
pH 7.8.
Isolation of Endonuclease Cleavage Products
Endonuclease cleavage products were isolated and purified following
agarose gel electrophoresis in the manner described by Finkelstein and
Rownd (1978). Ethidium bromide stained gels were illuminated with a UV
lamp and the fragment band sliced out. Gel slices were finely ground
and suspended in 200 yl of 100 mM Tris, pH 5.95. Agarose (Calbiochem-
Behring LaJolla, California) was added to a final concentration 0.5 yg/yl
and the suspension was incubated for 2 hours at 37C. The degraded
agarose was removed by centrifugation at 15,000 xg for 10 minutes.
Following two successive phenol and ether extractions the DNA was con
centrated by ethanol precipitation.

28
Smaller cleavage fragments viere extracted from 6% acrylamide gels.,
following the method devised by Maxam and Gilbert (1980). Gel slices
were minced and suspended in a solution of 500 mM ammonium acetate,
10 mM magnesium acetate, 1 mM EDTA, 0.1% (wt./vol.) sodium dodecyl
sulfate and 10 yg/ml yeast tRNA. This slurry was incubated at 37C for
10 hours and then the residual acrylamide was removed by filtration
through glass wool. The filtrate was phenol extracted once, ether
extracted once and then the extracted DMA was concentrated by ethanol
precipitation.
Bulk purification of cleavage fragments was done by affinity chroma
tography (Bnemann and Muller, 1978). Generally 200 yg of digested DNA
were loaded onto a malachite gree substituted bisacrylamide gel
(Beohringer Mannheim Biochemicals, Indianapolis, IN) column in the pre
sence of 10 mM sodium phosphate and 1 mM EDTA, pH 6.0. The fragments were
eluted through a 0t2 molar gradient of sodium perchlorate in the same
phosphate buffer (see Figure 6). The sodium perchlorate was removed
from the eluate by dialysis against 10 mM Tris, 1 mM EDTA; pH 7.0. The
DNA was the concentrate from the dialyzed eluate by ethanol precipitation.
Mapping Approach
Endonuclease digestion maps for pRB104 and RBI 15 were determined
by tv/o methods: double digestion mapping and partial digestion mapping.
Where applicable, new sites were mapped relative to known sites in
reactions where two or more digestions were done to completion before
gel electrophoresis of the fragments. All reactions and subsequent gel
fractionations were carried out as previously discussed. In this manner
the digestion sites for BamHl, BstEll, Hindi, Alul, and Taql were con
firmed and ma-ped relative to one another., The size of the endonuclease

29
1.3385
1.3373
*1.3361
Figure 6. Affinity Chromotography of BamHl digest of pRB104

30
cleavage fragments was determined by comparison to known digestion
standards of adeno-associated virus (AAV) DNA, lamda phage DNA, or
pBR322 DNA, which were run in parallel wells on the ;same gels (Berns and
Hauswirth, 1978; Cheung et al_., 1980). The numerous 'cleavage products
arising from restriction by either Aval or Smal were oriented relative to
the Alul and Taql sites through partial digestion reactions in the manner
described by Smith and Birnstiel (1976). End labeled Alul or Taql frag
ments were isolated and partially digested in the presence of 1 unit/yg
DNA of Aval or Smal endonuclease under standard conditions. Aliquotes
were withdrawn from cleavage mixture and prepared for gel electrophoresis
after 5 minutes, 10 minutes, 20 minutes, 40 minutes and 80 minutes of
reaction time.
Nick Translation
1 yg HSV-1 F strain DNA was incubated.for 45 minutes at 15C in a
50 yl reaction mixture containing 30 mfidGTP, 30 mMdTTP, 30 mMdATP (sigma),
100 yCi [a ^P]dCTP (400 Ci/m mole; New England Nuclear), 5 mM MgC^, 4
units DNA-polymerase I, 10 mM p-mercaptoethanol, 0.05 mg/ml bovine serum
albumin, 50 mM Tris, pH 7.8, and 4.5 units of DNA-polymerase I (Boehringer
Mannheim Biochemicals, Indianapolis, IN). The reaction was stopped by
the addition of 100 yl of a solution containing 100 mM EDTA, 100 yg
sonicated calf thymus DNA and 10 mM Tris, pH 7.8. The mixture was
32
extracted with phenol and ether. Finally free [a P]dCTP was separated
from labeled DMA by passage through a Sephadex G75 column (IcmxlOcm).
This procedure usually yielded a viral probe with a specific activity of
O
approximately 3x10 cpm/yg. Cellular DNA was labeled in the same manner
except that the reaction volume was increased to 100 yl and 10 yg DNA
was labeled per reaction in the presence of 0.5-2 ng activated DNase I.

31
DNase I was activated by incubating the enzyme for 2 hours at 0C in a
solution containing 10 mM Tris, pH 7.6, 5 mM MgCl2 and 1 mg/rnl bovine
serum albumin. DNase I was obtained from Worthington Biochemical Cor
poration, Freehold, NJ and stock solutions of 1 mg/ml in 0.01 n HC1 were
stored at -20C (Rigby et aj_., 1977).
Iodination of Cytoplasmic RNA
Ethanol precipitated cytoplasmic RNA was resuspended in 50 yl of
DEPC treated distilled water and transferred to a 1.5 ml Eppendorf
125
centrifugation tube containing 4 mCi I sodium iodide. To this, 20 yl
of 0.2M sodium acetate (pH 4.7) and 5 mM thallic chloride was added.
125
The tube was sealed and incubated at 70C for 20 minutes. I sodium
iodide with a specific activity of 350-600 mCi/m mole was purchased from
Amersham/Searle Corporation, Arlington Heights, IL. Thallium chloride
was purchased from ICN Pharmaceuticals, Incorporated, Plainview, NY.
After incubation the reaction was chilled and stopped by the addition of
20 yl of 0.02 Me-mecaptoethanol, 1 M sodium phosphate, pH 6.8. The
solution was heated to 70C for 15 minutes and 50 yg of yeast tRNA was
125
added as carrier. Labeled RNA was separated from free I by passage
through a Sephadex G75 column (lcmxlOcm) (Tereba and McCarthy, 1973).
5' End Labeling Reactions
The 5 ends of endonuclease digestion fragments v/ere labeled with
32
[y P]dATP in the presence of T^ polynucleotide kinase (Richardson,
1966). The 5' terminal phosphate of the polynucleotide was first removed
by treatment bacterial alkaline phosphatase in 10 mM Tris, pH 7.4 and
100 mM NaCl at 60C for 30 minutes. To halt the reaction 5 mM EDTA was
added and the solution was phenol extracted twice then ether extracted

32
3 times. The DNA was then precipitated with ethanol and dried under
vacuum. The DNA was redissolved in a solution containing 50 mM Tris,
pH 9.5, 10 mM MgCl^, 5 mM dithiolthreatol, and 50% glycerol. To this
was added 100 mM spermidine and 20 units T^ polynucleotide kinase. The
32
resulting solution was mixed with 200 pCi of dried [y P]dATP and
allowed to react at 37C for 30 minutes. To stop the reaction 5 mM EDTA
was added and the solution was dialyzed against 10 mM Tris, pH 7.4,
5 mM EDTA, and 1 M NaCl to remove unreacted [y -^P]dATP. The bacterial
alkaline phosphatase was purchased from Worthington Biochemical Corpora
tion, Freehold, NJ; the Kinase was obtained from Bethesda Research Labora-
32
tories, Inc., Rockville, MD; and the [y P]dATP was obtained from
Amersham, Arlington Heights, IL. Generally 50-100 pg of DNA were
5
labeled in a 50 pi reaction volume to a specific activity of 10 cpm/pg
of DNA.
The large "A" fragment of E.coli polymerase I was used to 3' end-
label various digestion fragments For this purpose the 50 pi cleavage
reaction mixture was blown down to approximately 20 pi and 20 pCi of
[a -^PjdCTP or [a -^P]dATP with 0.9 units of the Klenow polymerase
fragment (New England BioLabs, Beverly, MA) were added. Labeling was
done at 37C for 30 minutes. To half the reaction the sample was placed
at 60C for 10 minutes, then 20 pg of sonicated carrier DNA was added
and the sample was ethanol precipitated.
Southern Blots
DNA restriction fragments were transferred from agarose or polyacry
lamide gels to nitrocellulose filters in the manner described by Southern
(1975). Gels were first stained in a 1 pg/ml ethidium bromide bath,
visualized under UV light and photographed. The right corner of the gel

33
and the furtherest points of migration were notched to facilitate future
orientation of the gel. The DNA fragments were then denatured i_n situ
by soaking the gel for 20 minutes in a 1 M KOH solution. The KOH wash
and gel were then tritrated to neutrality with 1M HC1-1M Tris. The gel
was then aligned on a prewashed nitrocellulose filter for transfer. The
nitrocellulose filter was prewet by washing for 20 minutes in a 5XSSC
bath. The DNA was eluted from the gel with 10XSSC. For transfer from
a 1% or greater agarose gel, the gel was placed on a paper wick soaked
in 10XSSC, overlaid with the nitrocellulose and absorbant material.
This arrangement permitted a higher volume of 10XSSC to pass through the
gel and enhanced transfer of higher molecular weight fragments. For
transfer from agarose gels of less than 1% and polyacrylamide gels, a
slightly different procedure was used in order to decrease diffusion of
the DNA bands during transfer. The filter was again sandwiched between
the gel and absorbant material but arranged in the reverse order so that
transfer was in a downward direction. The gel was overlaid with a paper
wick which was periodically wet with 10XSSC. Thus a decreased volume of
10XSSC was passed through the gel and diffusion was diminished. After
transfer the nitrocellulose filter was dried at 80C for 2 hours under
vacuum.
Hybridization Reaction
Hybridizations were carried out in sealed plastic bags containing
the filter and a hybridization mixture composed of the following: 50%
formamide, 5XSSC, 0.08% polyvinylpyriodate, 0.08% bovine serum albumin,
0.08% ficoll, 0.5% SDS, 0.02 M Tris (pH 7.4), 50 yg/ml sonicated calf
32 125
thymus DNA as a carrier and either or £JI-labeled probe at a con
centration of at least 10^ cpm/ml. All blots were prewashed with the
V-

34
hybridization mixture minus the probe at 37C for 2 hours prior to the
hybridization. Hybridization was carried out in the presence of the
complete mixture for 72 hours at 37C. The blots were then removed and
washed twice to remove nonspecifically bound label, with the hybridiza
tion mixture minus carrier and probe for 30 minutes at 37C. The blots
were then rinsed twice with 2XSSC and 0.5% SDS in 50% formamide. The
blots were washed twice in 1XSSC and 0.5% SDS in 50% formamide for 30
minutes at 37C (McConaughy et al., 1969; Tereba and McCarthy, 1973).
Finally, the blots were v/ashed overnight at 65C in 1XSSC and 0.5% SDS,
with 4 changes of the wash.
On occasion the hybridization was carried out at 65C. In these
instances the reaction and v/ashes were done as described above at 37C
but in the absence of formamide. Attempts were made to increase the
sensitivity of the hybridization by adding 10% dextran sulfate to the
hybridization reaction (Wetmur, 1975). The findings were inconsistent
due to variable nonspecific background on the autoradiographs of such
experiments.
Following the hybridization and washings the blots were dried and
then autoradiographed with Kodak X-0matic regular intensifying screens
and Dupont Cronex 4 X-ray film at -70C for 3-21 days.

RESULTS
Experimental Approach
As stated previously, the general aim of this research is to illu
minate the molecular status of the HSV genome in latently infected human
trigeminal ganglia. Specifically the studies are designed to
1. Detect HSV DMA and RNA sequences in human ganglia.
2. Determine the extent of the viral genome present through
hybridization of HSV DMA to nitrocellulose paper bound ganglia
DMA.
3. Determine the extent of viral DMA expressed as cytoplasmic
RMA through mapping of ganglia RNA hybridized to nitrocellu
lose paper bound viral DMA.
4. Correlate genome presence with the expression of a humoral
immune response to HSV antigens in immuno-competent patients
as measured by complement fixation.
5. Evaluate the manner of viral genome latency.
To achieve this end the following experimental approach was taken.
Total cellular DMA and cytoplasmic RMA were extracted from trigeminal
ganglia. Three different experimental routes could then be carried out.
32
The DMA was either radiolabeled with [a P]dCTP by nick translation
(Rigby et al_., 1977) or it was digested with a restriction endonuclease,
gel electrophoresed and then transferred and immobilized on nitrocellu
lose paper by the blotting method of Southern (Southern, 1975; Wahl et
al., 1979) (see Figure 7). Radiolabeled ganglia DNA was subsequently
35

36
hybridized to EcoRl digests of HSV DNA immobilized on nitrocellulose
paper under conditions favorable for formation of DNA-DNA hybrids. The
32
reverse experiment was also done using nick translated [a PjdCTP
labeled HSV DNA as a probe and hybridizing with endonuclease digested
ganglia DNA.
Isolate Ganglia
chemical ly
32
label
P-
DNA
hybridize
v
HSV DNA
Blots
dissection
Neurons
DNA
I
Endo R
digestion
Gang!ia
DNA
Blots
hybridize
32
P-HSV DNA
Figure 7. DNA/DNA Hybridization Procedure
125
The third procedure entailed hybridizing I-labeled total cytoplasmic
RNA from ganglia to immobilized restriction endonuclease digests of HSV
DNA (Tereba and McCarthy, 1973) (see Figure 8). In all these approaches
viral DNA or RNA sequences complementary to immobilized sequences were
detected by autoradiography at -70C for 1-21 days. The pattern of

radioactive bands was compared to control HSV DNA run in parallel
i
experiments.

37
Isolate Ganglia
dissection
Neurons
1
RNA
HSV DNA
chemically label
125I RNA
hybridize |
HSV DNA Blots
Endo R Digest
Figure 8. RNA/DNA Hybridization Procedure
Controls
The binding of radiolabeled ganglion DNA or RNA to nitrocellulose
bound viral DNA permits the detection of specific genome regions of HSV
DNA sequences in neural tissue. This is a considerable refinement over
standard filter hybridization methods or in situ methods where only
hybridization to the whole genome is monitored and where a consideration
must be given to high backgrounds due to nonspecific binding of the
probe.
The selectivity of the assay is still largely a product of the
purity of the known viral DNA preparation. To assay this purity HSV-1
F strain DNA was nick translated and hybridized to EcoRl endonuclease
digests of DNA from calf thymus tissue, salmon sperm, human foreskin,
Hela M monolayers and Hep 2 cells (see Figure 9). The HSV DNA was pre
pared by high salt precipitation in the manner described by Pater et al
(1976). This approach is a modification of the high salt extraction
method first devised by Hirt (1967). Nonspecific binding of label
occurred with each digestion assayed. This suggests the presence of
cellular DNA copurifying within the viral DNA preparation. For this

38
Figure 9. Cellular DNA Controls

39
reason, only HSV-1 F strain DMA extracted from sucrose gradient purified
nucleocapsids and banded twice in CsCl density gradients to remove con
taminating cellular DNA and RNA was used throughout (Spear and Roizman,
1972). To further eliminate the possibility of contamination by copuri
fying cellular nucleic acids, HSV-1 F strain DNA sequences cloned in
PBR322 were also used in some of the hybridization studies. DMA isolated
from purified nucleocapsids failed to hybridize to cellular DNA in a
repetition of the above described assays. In control experiments such
a probe also failed to bind to DNA from adenovirus (Ad2), adenoassociated
(AAV) virus and Simian Virus 40 (SV40) (see Figure 10). DMAs extracted
from thoracic ganglia and connective tissue of patients have been run in
parallel reactions with trigeminal gnaglia DNA and failed to hybridize
with this probe.
To determine the sensitivity of the hybridization assay reconstruc
tion experiments were run using HSV and AAV DNA. Samples of AAV DNA
were digested with either BamHl, EcoRl or Alul and then mixed. Starting
with a total of 10 ug of digested AAV DNA serial dilutions of the
preparation viere then made. To maintain a total of 10 ug DNA in each
sample sonicated calf thymus DNA was added as needed. The samples were
electrophoresed on a 6% polyacrylamide gel and then transferred to
nitrocellulose by the Southern blotting method. Using a nick translated
g
AAV probe with a specific activity of 10 cpm/ug DNA the sample containing
100 pg of AAV DNA could be visualized by autoradiography after 2 v/eeks.
A 200bp fragment within this sample would represent 5pg of DNA. Because
fragments within this size range are visualized the assay is sensitive
enough to distinguish 5pg of AAV in 10 ug of calf thymus DNA, a dilution
factor of 2x10^. Similar experiments using HSV DNA established that

40
Figure 10. Viral DNA Controls
AAV

41
endonuclease fragments transferred from 0.5% agarose gels to nitrocellu
lose could be distinguished at a dilution factor of 106 of lpg of HSV
DNA in 1 ug of carrier DNA.
Hybridization of Ganglia Nucleic Acids to HSV DNA
The trigeminal ganglia of 18 patients have been assayed for HSV
sequences by DNA/DNA or DNA/RNA hybridization. None of the patients
manifested clinical evidence of recurrence at the time of death nor was
a history of recurrence noted (Table 1).
Table 1. Hybridization of trigeminal nucleic acids to HSV DNA.
Patient
CT titer
Viral DNA*
Viral RNA*
227
32
+
N.D.
228
32
+
N.D.
367
32
+
N.D.
951
64
+
+
883
64
+
N.D.
1072
32
+
N.D.
1034
32
+
N.D.
1082
128
+
N.D.
1089
128
+
N.D.
1033
64
-
-
949
32
-
+
941
<8
+
+
319
<8
-
N.D..
943
<8
-
-
947
<8
-
-
893
<8
-
N.D.
1143
<8
-
-
1110
<8
-
-
*(+) present
(-) absent
(N.D.) not determined
Briefly, the findings from the experimental approaches have been
listed in Table 1. The first approach entails the hybridization of a
32
nick translated P labeled viral DNA to either EcoRl or Hindi 11 endo
nuclease digests of ganglia DNA bound to nitrocellulose filters. The

42
125
second is the hybridization of I-labeled ganglia cytoplasmic RNA to
restriction endonuclease digests of HSV-1 DMA bound to nitrocellulose.
Eleven of these patients were sero-positive for HSV. A positive serology
here is assessed as a compliment fixation titer of 1:8 or greater. The
trigeminal gnaglia from 9 such individuals were shown to contain HSV
DNA sequences. Viral DMA v/as not detected in the remaining two members
of this group (949 and 1033) but viral sequences were demonstrated in a
preparation of total cytoplasmic RNA from the ganglia of patient #949.
Only one of the sero-negative individuals (941) yielded ganglia con
taining latent HSV DNA and viral RNA was also detected in this case.
Figure 11 is an example of the autoradiographs obtained from
hybridization assays involving viral and ganglia DNA. The first lane
(A) is a photograph of the ethidium bromide stain of an EcoRl digest of
HSV-1 run as a marker. The second lane (B) is the autoradiograph of
labeled viral DNA hybridized to EcoRl digests of ganglia DNA. Lane C
is the photograph of the ethidium bromide stain of the Hindi 11 digested
control as it appeared after agarose gel electrophoresis. Lanes D and
E are the autoradiographs of labeled viral DNA bound to HindiII endo
nuclease digests of ganglia DNA. In the experimental reaction with
ganglia #228 DNA, extensive binding of the probe is evident in the
regions where the larger EcoRl fragments (MW 8.4-17.5x10^ dal.) of HSV
would migrate as determined by comparison to the controls. Binding is
also apparent where the EcoRl M (MW 2.7x10^ dal.) fragments are expected
to migrate. The viral probe did not hybridize in the region where the
EcoRl K(MW 3.5x10^ dal.) fragment should be found. EcoRl K maps at the
terminus of the short unique portion of the genome. The fragment may
display an altered migration here, or this portion of the viral genome
may not be represented in the ganglia. It is of interest to note that

43
A B C D
Ero PI 225 H n d III 1CB2 1 OB'/
Figure 11. Viral DNA hybridized to Ganglia DNA
ganglia of patient #227 also revealed an altered migration of the EcoRl
K fragment. Unfortunately the Hindi 11 digestion pattern does not permit
such an analysis. Patient #228 is representative of the type of findings
obtained when a major portion of the HSV genome was demonstrated in the
ganglia. In all such cases to date the endonuclease digestion pattern

44
revealed was consistent with that of HSV-1. In several of the ganglia
only part of the HSV genome could be detected; whether the remainder of
the genome is absent or those portions are present in too few copies for
the assay to reveal is as yet uncertain.
] pc
Figure 12 is an autoradiograph of I-labeled ganglia cytoplasmic
RNA hybridized to an EcoRl endonuclease digest of HSV-1 F strain DMA
bound to nitrocellulose paper. To the left of the autoradiograph is a
photograph of the cleaved HSV stained with ethidium bromide after agarose
gel electrophoresis and prior to transfer to nitrocellulose. Clearly
not all regions of the viral genome are represented in the ganglia cyto
plasmic RNA. This would not be the case if the ganglia were actively
supporting a lytic infection as shown in the HSV control. Further,
those fragments present are not uniformly represented in the RNA. For
instance, transcripts of EcoRl K appear most abundant in the RNA of
patient #951. In this manner the viral RNA transcripts found in several
ganglia have been mapped on the HSV-1 genome. Figure 13 summarizes this
data.
CsCl Enrichment
To determine whether HSV DNA could be isolated in an episomal form
free from host chromatin total ganglia nucleic acid was fractionated on
CsCl density gradients. As a control human thoracic ganglia DNA was
3
kinased and run in a parallel gradient. H labeled lambda DNA was run
as a marker in all gradients and 50 ug of sonicated calf thymus DNA was
added to each as a carrier. The gradient profiles are shown in Figure
14.

45
Figure 12. Ganglia RNA Hybridized to Viral DHA

46
O 10 20 30 40 50 60 70 80 90 100
I 1 1 1 1 1 1 1 H 1 1
EcoRI
949
-H F+F
D G N F MO LA
H F
H F
K, H K2
II
951
I d H H F
d I 1I h
941 1
I -I 1I F
Hpal M H l -u
H 1 i FF-fF
LNKQRSUJ M IV B H F E T0XP1_2 D G
941 IF+-H Ii
> HI F
Figure 13. Mapping HSV specific RMA found in the Ganglia

C PM
47
Figure 14. Fractionation of Total Ganglia Nucleic Acid
C PM

48
Figure 15. Sectioning of CsCl gradient
Using the lambda marker as a reference the gradients were divided
into five segments. Within gradients A, B and C fractions were pooled
and the total DNA per section isolated and nick translated. The findings
are summarized in Table 2. Approximately 25 ug of DNA from HEP2 mono-
layers infected with HSV-1 F at an m.o.l. of 1 and harvested at 20 hours
post infection was used as a positive control for this assay.

Table 2. CsCl enrichment study
Probe
Patient
CF-ti ter
I
II
III
1168
256
r
1090
256

-
-
1144
128
-

-
1143
8
-
-
-
thoracic ganglia
16
-
-
-
HepII
ND
-
-
HSV infected Hep2
ND
+
+
Mapping the L/S junction of HSV-1 F strain
The immediate early mRNA species of HSV-1 are known to map to the
reiterated portions of the genome. This fact coupled with the observa
tion that transcripts mapping to this region were present in all posi
tive ganglia studied to date suggested that this area warranted further
analysis. Hybridizations of ganglia RNA to pBR322 clones of the L/S
junction were undertaken in order to develop a clearer picture of the
degree of transcription. To gain such an understanding it was necessary
to first derive detailed restriction digestion maps of the DNA in
question.
Two plasmids were used for this purpose, pRBl04 and pRBl15 (Post
et al_., 1981; Material & Methods) (see Figure 16). The SP^ insert in
pRBl04 is approximately 500bp greater in length than the SP-j species in
serted into pRB115 (Post, 1981). First the DNA was evaluated by single
and double or triple endonuclease digestions using BamHl, Pstl, Hindll
and BstEll. This confirmed the identity of the two plasmids and also
allowed us to map a 520bp insertion to the largest BamHl/Hindll fragment
of pRBl15 (see Figure 17). The size markers in these assays were known
digests of either pBR322 or AAV DNA. The clones were then screened with
various additional endonucleases to determine their digestion patterns.
A summary of the restriction enzyme fragment sizes is given in Table 3

50
10
i
20
i
30
i
40

50 60
A A
70 80*
A 1 *..
90 100
A A
o b
EZ3-
i
' 'l '
b a *0 c q c o
qH ,o4
i
c=>
i
i 4
I
~ ^ lE rr>RN A
Figure 16. Derivation of Clones pRBI04 and pRB115

51
Figure 17. Restriction Digests of pRBl15 and pRBl04
Lanes: 1.
2.
3.
4.
5.
6.
7.
8.
BamHl/Pstl/BstEll digest of pRB115
BamHl/Pstl/BstEl1 digest of pBR322
BamHl/Pstl digest of pRBl15
BamHl/Pstl digest of pBR322
Pstl digest of pRBl15
Pstl digest of pRB322
BamHl/HincII digest of pRBl15
BamHl/HincII digest of pRBl04

52
Table 3. Endonucleases
BamHl/Hindll
BamHl/BstEll
BamHl/BstEll/Taql
Smal
Aval
Clone:
115
104
115
104
115
104
115
115
fragment
size (bp)
4600
5200
750
4200
2400
2350
1075
890
1230
1240
2300
2300
1950
2200
677
566
1600
1975
577
483
450
453
430
400
365
380
337
336
222
317
140
226
102
206
84
170
148
138
99
82
55
Enzymes that did not cut: BglII, Kpnl, Hpal, Xbal, EcoRl, Hindlll,
Pstl and Sal I
and a comparison of the Smal and Aval digests of pRBl04 and pRBl15 are
shown in Figure 18. The mean length of the insert in pRB104 was calcu
lated to be approximately 6382 base pairs and that of pRBl15 was 5830 base
pairs. A comparison of the Smal and Aval digestion patterns of the two
clones indicates that more than a single insertion event has occurred
in the derivation of the SP-j, and SP2 fragments. The fragment corres
ponding to the 1075 bp Smal fragment of pRB115 is only 880bp in pRBl04
even though pRBl04 contains the larger insert. The 360bp Smal fragment
of pRBl15 is overrepresented in pRB104. The 450bp Aval fragment of
pRBl15 is overrepresented in pRBl04 and the 483bp Aval fragment of
pRBl15 is missing in pRB104. The pRB104 Aval digest also has a cluster
of fragments between 330bp and 380bp that are not found in pRBl15.

Because of these additional rearrangements the Smal and Aval maps of
only pRBl15 were determined.
53
12 3 4
Figure 18. Smal and Aval digests of pRBl04 and pRBll5
Lanes:
1. Smal digest of pRB115
2. Smal digest of pRBl04
3. Aval digest of pRBl15
4. Aval digest of pRB104

54
The SPi insert in pRB115 was excised by BamHl cleavage and the
insert separated in bulk from the vector by affinity chromatography over
a malachite green substituted bisacrylamide gel column. The Smal and
Aval cleavage maps were determined by partial digestion mapping (Smith
and Birnstiel, 1976). The approach was as follows. The DMA was cut with
Alul and then 5' end labeled by the T^ polynucleotide kinase reaction.
The DMA was then recut with Taql endonuclease and the digestion fragments
separated by agarose gel electrophoresis. The three largest fragments
spanning the insert were designated 1, 2 and 3, respectively. These
fragments were aligned on the general map using double digestion assays
with Hindi or BstEll as shown in figure 19a. Partial cleavage mapping
was then done using Smal and Aval on each of the A1ul/Taql fragments.
The map was confirmed by first cutting with Taql, labeling and then
recutting with Alul; thus generating an overlapping map going in the
opposite direction.
Figure 19b shows the generation of the Smal map for A1ul/Taql frag
ment 2 and the Hindi digestion of fragment 2 and fragment 3. The
accompanying figure 19b shows the mapping strategy and the log plot of
migration distance versus molecular weight from which the size of the
partial Smal fragments was determined. The resulting cleavage map of
fragment 2 is also shown. Figure 20 shows the partial digestion frag
ments resulting from Aval cleavage of the AluVTaqI fragments 2 and 3.
Sail, EcoRl, BamHl and Alul digests of AAV were used as size markers.
The maps resulting from these gels and similar experiments are shown in
Figure 21.

Molecular Weight ( base pairs
55
Tog I
Alii I
>
t-
Alu I
4
Figure 19a. Strategy for Partial Digestion Mapping of pRBl15

56
t
3
Hindi uncut
2 Sma I
Hindi 0 5 10 20 40 80
AAV gg
*
EcoRI A
D Us
E
F
G
I
4
*
k
Figure 19b. Smal partial digestion of pRB115

57
A va I
AAV 0 5 10_ 20 40 80 5 10 20
tat
l
Figure 20. Aval Partial Digestion Mapping of pRB115

-l-t- Alu I
104
4-Taq I
Hindi
.Bst Ell
115
H f-t- Alu I
4_ Taq I
Bst Ell
Hie II
H 1 1I 1 1 h-H 1 f |H 1 H-f-
- ~4 11 1 1 HI I
ll t-
Ava II
Sma I
I
3
-1
5
1 kb
6
c_n
CO
Figure 21. Restriction Digest Map of pRBl15

HYBRIDIZATIONS
Hybridization of ganglia RNA to the L/S junction
As stated previously hybridization of total cytoplasmic RNA from
ganglia to Southern blots of clone pRBl 15 of the L/S junction of HSV-1
F was undertaken in hopes of better delineating the level of transcrip-
125
tion through this portion of the genome. The I-labeled RNA from
five sero-positive patients was evaluated in this manner. The nucleic
acids from thoracic ganglia and a normal lytic infection were also
evaluated as controls. The findings are given in Table 4. As in the
Table 4. Analysis of L/S Junction
Patient
CT titer
Viral DMA*
Viral RNA*
1033
64
_
__
1034
32
+
-
1082
128
+
-
969
16
-
-
1089
128
+
-
thoracic
ganglia
16
-
-
HSV infected
Hep2
N.D.
+
+
*(+) present
(-) absent
(N.D.) not done
CsCl enrichment studies DNA or RNA from Hep2 monolayers infected with
HSV-1 F at an m.o.i. of 1 and harvested at 20 hours post infection were
used in the control assays.
59

60
Cross Hybridization Experiments
The close biological relationship between AAV, Ad and HSV suggests
the possibility of partial genome homology; however previous attempts
have failed to demonstrate detectable homology. Using the more sensi-
tive technique of cross hybridization of P-labeled AAV, HSV or Ad
probes to restriction endonuclease digests of the reciprocal genome
immobilized on nitrocellulose filters, we were able to determine limited
regions of homology. Figure 22 outlines a typical cross hybridization
assay and our findings to date from the hybridization assays are sum
marized in Table 5.
Table 5. Cross Hybridization Analysis
BLOT
AAV-2 Ad2 Ad5 SV40
HSV-1 Hep2 HelaM Hela
AAV-2 +
Ad2 +
Ad5 +
SV40
HSV-1
+ +
+ +
+ +
(+) homology
(-) no homology
To determine the level of nonspecific hybridization that could occur in
our assays, such as that which might arise from long stretches of high
G+C content, hybridizations were done with the DNA from the Hep2, HelaM
and Hela suspension cell lines. The Ad5, Ad2, and AAV2 virus stocks
were grown in Hela suspension cultures. The HSV-1 virus was grown in
either Hep2 or HelaM monolayers. Thus these controls would also allow
us to detect any cellular DNA which might be copurifying with viral DNA
during its preparation. Our findings were consistantly negative although
the controls were hybridized under several degrees of stringency as were

Label
<
1. Digest
2. Gel Electrophoresis
V
V
1. Digest
2. Gel Electrophores
Agarose
gel
1 Denature
in situ
Ni troce 11ulose
Nitrocellulose
filter
1. Denature
in situ
Agarose
gel
filter
2. Transfer
>
2. Transfer
V
Autoradiograph
Figure 22. Cross Hybridization Strategy
Y
Autoradiograph

62
the experimental group. Figure 23 shows the findings of 2 sets of
experiments in which an Ad2 nick translated probe was hybridized to AAV
blots and washed under varying salt concentrations. The hybridizations
were done overnight (as described in the Materials and Methods portion
of this text) at 68C and all washes were done at 68C. On the left of
Figure 23 are the autoradiographs from the hybridizations to a Hpall
blot to AAV and on the right are those from a Haell blot of AAV. As
one progresses from a 2XSSC wash with 300 mM NaCl to a 0.5XSSC wash with
only 75 mM NaCl various bands are seen to drop from the autoradiographs.
In the case of the Haell digest, clearly all bands are present in the
autoradiograph of the blot washed in 2XSSC but the blot washed in 1XSSC
has lost the Haell D fragment and the intensity of the Haell B band is
greatly diminished. The 0.5XSSC level of stringency reveals only strong
hybridization to the Haell A and C fragments with significant binding
remaining to the Haell E fragment.
When assays are done in the manner described above whole viral DNA
is nick translated as a probe. This approach permits the mapping of
homologous regions on the nitrocellulose bound DNA but fails to correlate
that portion found in the blot with the portion of probe hybridizing in
reciprocal crosses. To obtain this information fragments which failed
to show homology when bound to nitrocellulose were extracted from gels
after endonuclease digestion and gel electrophoresis. These fragments
were nick translated and then used as independent probes in cross hybridi
zation assays. Figure 24 shows the results of such an assay using the
EcoRl A and C fragments of Ad2 as probes against a Haell digestion blot
of AAV. On the left is the autoradiograph of total AAV hybridized to
an EcoRl digest of Ad2 under stringent conditions (hybridization over
night at 68C in 5XSSC and final overnight wash at 68C in 0.5XSSC).

63
Figure 23. Autoradiograph of Ad2 Probe Hybridized to AAV

64
Ad Rl-A Rl-C HSV
\
Figure 24. Autoradiograph of AAV/Ad2 Cross Hybridizations

65
The AAV probe binds only to the EcoRl D and F fragments. A self
hybridization with an Ad2 probe was done to confirm that all the diges
tion fragments were transferred efficiently to the blot. A specificity
control is also shown using a nick translated SV40 probe. The EcoRl
A and C fragments were extracted from another portion of the gel and
nick translated. The findings are shown on the left. A total Ad2 probe
bound to the Haell A and C fragments of AAV. The EcoRl A and C probes
of Ad2 showed no homology with AAV under these conditions of hybridiza
tion. The Haell A and C fragments of AAV contain the terminal inverted
repeats, which have been shown to have a high G+C content. For this
reason HSV-1 DNA, which also has a high G+C content, was used as a
control for nonspecific hybridization and none was found.
Because of its defective nature AAV must be grown in the presence
of Ad. Unfortunately this situation permits the potential cross contam
ination of AAV viral stocks with Ad DNA. To limit this occurrence both
AAV and Ad DNA stocks were extracted from CsCl gradient purified virions
The possibility still remains that a small portion of the contaminating
DNA may have been packaged in the reciprocal viral capsid, thus copuri
fying throughout the preparative procedure. It may be argued that such
an event could in part give rise to the finding demonstrated in the
previous experiments. In dealing with this argument two approaches have
been taken. First, Ad5 stocks which were maintained continually in the
absence of AAV were cut with BamHl giving rise to two fragments of
approximately 14.3x10^ dalton and 9.7x10^ dalton in size. After electro
phoresis the digest was transferred to nitrocellulose and hybridized
with a nick translated probe of total AAV which had been grown in cocul
ture with Ad2. Hybridization with the AAV probe involved only the high

66
molecular weight Ad5 BamHl fragments and showed no smaller contaminating
AAV fragments. The second approach was to hybridize Ad DMA from a viral
stock shown to be free of AAV by E*1 studies, to AAV DMA generated from
a clone of the entire genome inserted into pBR322. The Ad DNA for this
assay was donated by Peter McGuire, Department of Biochemistry, Univer
sity of Florida, and the 620 pBR322 clone of AAV was a gift from Jude
Samulski, Department of Immunology and Medical Microbiology, University
of Florida. In both cases, the results confirm the previous findings
in the AAV and Ad2 cross hybridizations. The hybridization studies on
Ad5 were extended to map the regions of the genome to which binding was
most stringent. For this purpose EcoRl and Hindlll digests were used
and again the salt conditions for the hybridizations or washes varied.
The findings are compatible with those previously found for Ad2. A
summary of the cross hybridization mapping studies is shown in Figure
25.
To evaluate in better detail the cross hybridization studies a
computer comparison was done of the entire nucleotide sequence of AAV-2
against the published sequences of the first 11,600 bases of the left
half of Ad2 and the final 8,561 nucleotides of the right half of Ad2.
Three programs were run: the first conducted a random search for
sequences with a minimum perfect match of six bases, the second searched
for a 3 out of 5 base match and the third looked for a 7 out of 10 match
In general the data showed extensive random homology throughout both
genomes. This is supportive of the less stringent hybridization studies
If one analyzed the data for sets of adjacent homologies that mapped
co-linearly between the two genomes these sequences were invariably
found within the terminal 20% of the AAV genome, again corroborating the
hybridization data. The following are comparisons of some of the

67
Eco R I
A
Adenovirus 5
75.9
B
Hind III
G E C H D A
97.3
Eco R I
Adenovirus 2
A
B
707

89.7
Hpa I
C
10
20
30
40
50
60
70
80
90 100
Hae II
15.6
Adenc associated Virus
6C.7
E F
Hpo i I
tz!
-M 1
*Jj
1 i 1
'
; ; c,
V
p
N u F G
0
B
K US A
i
i
E
D .1
S
H
C
0
.t
i.
20 30
i i
40 50
i 1
ec 70
i 1
80
90 PO
Figure 25
Mapping of Homologous Regions in AAV and Ad

Ad Sequences Searched
11.6 kb
T ranscription
I A I B VA
=3 Zt

3 A
A
EcoR I
hybridization
12
3 4
4
Homolog ¡es
3 4
Figure 26. Summary of Ad/AAV Homology
CT>
CO

69
sequences found in this manner. 'These-regions of homology have :been
numbered and are summarized in Figure 26.
Upon comparison the portion of the AcT2 genome mapping 7930 to 7999
base pairs in from its right terminus shows a 71% sequence homology with
the 60 base pair sequence beginning 40 nucleotidesin on the inverted
terminal repeat of AAV (see Figure 27). This maps within the EcoRl D
fragment of Ad2 78% of the B and C domains of AAV are conserved as are
the functions between B and B domains and the C to A1 junction.
Eighty-eight percent of the C reiteration of AAV is retained. Approxi
mately 20 nucleotides upstream from the homologous stretch shown the
sequence 51 TGCGC 31 is conserved in both genomes; similarly 25 nucleo
tides downstream in both genomes the sequence 51 CTCCA 3' is retained.
The sequence 5' CTCACCGG 3' shown in figure 27 in Ad2 complements the
3' end of the first leader sequence in the E3 transcription complex
(Heriss et al., 1980).
B B' C C A' gg
AAV CCGGGCGACCAAAGGTCGCCCGACGCCCGGGCTTTGCCCGGGCGGCCTCACTGAGCGAG
I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I
Ad2 TCGGGCAATCAAAG ACTCCCGGAGCCCGGGCAAAGCACTGGCGGCGGCAGTGGTCGAG ,nnn
l / \ \ I /x 7999
T / \ A G TGT
TAACAAA
Figure 27. Ad2 Early Region 3A (Heriss et al., 1980)
Figure 28 details the sequence homology surrounding the beginning
of the second coding region in AAV and a homologous stretch in Ad2
starting 5252 nucleotides in from the right terminus. This 53 base
pair sequence maps to the EcoRl E fragment of Ad2 and is part of
sequence involved in the E3 transcription complex. There is about 69%
total sequence homology between the two genomes over this area and it
should be noted that the ATG start signal found in AAV is absent in the

70
Ad2 sequence. Figure 29 compares a 26 nucleotide sequence found just
outside the inverted terminal repeat of AAV starting at base pair 144
to a similar region in the terminal repeat of Ad2. There is an 87%
homology between the two regions.
AAV TCAGCCAGGTACATGGAGCTGGTCGGGTGGGTCGTGGACAAGGGGATTACCTCGGAG
I I I I I II II I II I I I I 11 II I I I I I I I I II I I I 11 I
Ad2 GCA CCAG TTTTTGGCGCTGGGTGGGTAGCTTGTAGCTGAGGCGGTTGCC GGAG
i
T
Figure 28. AAV Coding Region 3 (Hriss et al., 1980)
AAV
Ad2
Figure 29. Ad2 Terminal Repetition (Heriss et al_., 1980)
Although cross hybridization assays failed to reveal any homology
between HSV and AAV three lines of evidence suggest at least a general
similarity in the architecture of their genomes. The termini of both
genomes contain a tandem array of natural and inverted repeats. Portions
of these repeat regions may be flipped or inverted in their relation to
unique regions of the genomes and this flip-flopping appears to be a
natural consequence of viral DNA replication. And lastly there is an
inherent ability within the replication cycle for maintaining identity
between the termini through some mechanism of gene conversion. The
reiterated sequences in both viruses probably contain the origin of
replication and at least some early regulatory function. A comparison
was made between the terminal reiterated sequences of AAV and the pub
lished sequence for the L/S junction of HSV-1, which contains the HSV
CTGGAGGGGTGGAGTCGTGACGTGA
II I I I I I I I I I I I I I I II I I
ATGAGGGGGTGGAGTTGTGACGTGG
I
T
168
70
1306
5305

T
T T
C G
C G
A T
G C
C G
G C
G C
G C
C G
T
G C
C G
G C
G C
G C
C G
C G
C G
G C
A A
A
FLIP
G C C T C A G T G A G C G A G C G A G C G C G C A G A G A G G G A G T G G C C A A 3
I | | I I I I I I I I I I I I I I I I | I I I I I I I II M | I l I I I I I I I 5,
CGGAGTCACTCGCTCGCTCGCGCGTCTCTCCCTCACCGGTTGAG
T
T T
C G
G C
G C
G C
C G
C G
C G
G C
r, G
A
G C
C G
C G
C G
G C
C G
T A
G C
G C
A A
A
FLOP
GCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGCC
I I I I I I I I I I I I I I I I IF I | I I I I I | | I | I I I I I I [ >
CGGAGTCACTCGCTC GCTCGCGCGTCTCTCCCTCACCGG
U3
i 1 5'
t t (a A
Figure 30. Inversion of portions of the AAV genome

72
terminal repeats also. Figure 30 presents the "flip" and "flop" orien
tations of the AAV genome to which the HSV sequences were compared.
The direct repeat which brackets the ends of the a reiteration in
the termini of HSV-1 has a similar sequence to the B1, C, and C domains
of the AAV hairpin. The short palindrome GCCCGGGC forms the core of
this repeat in HSV-1 DMA. This palindrome is found in the core of the
inverted repeat of AAV also. One finds that 80% of the base sequence
is conserved between the HSV-1 direct repeat and the B', C and C
domains of AAV DNA. The nucleotide sequences bordering the palindrome
conserve 66% of the B1 and C repeated domains (see Figure 31).
B C C
AAV
GGTCGCCCGACGCCCGGGCTTTGCCCGGGCG
II III 1 1 1 1 1 1 1 1 1 1 II 1 1 II
86
HSV
II III i 1 1 1 1 1 1 1 1 1 II 1 1 II
GGCCGCGGGGGGCCCGGGCT GCGCCGCCG
213
DR1
Figure 31. Homology between short palindromes in HSV-1 and AAV
(Mocarski et al., 1980)
By expanding the comparison of this region in HSV with AAV one finds
approximately 72% of the flip orientation of the AAV terminal palindrome
is conserved in the HSV sequences (see Figure 32). Eighty-two percent
of the nucleotides reading from roughly the middle of the A domain of
AAV through the C and into the C domains are the same. Approximately
110 base pairs upstream in the HSV-1 map from the sequence described
above one finds a stretch of 43 nucleotides which can be aligned with
the flop orientation of the AAV termini. Having done this there appears
to be roughly 84% homology between the two genomes in this region. As
one continues to read in a 5' to 3' direction the HSV sequence is highly
compatible with the terminal domains of AAV arranged in the order A, C,
C\ B, B1, C, C then A. There is an 84% homology between genomes in

AAV
HSV
C C B B' C C1
GAGGCCGCCCGGGCAAAGCCCGGGCGTCGGGCGACCTTTGGTCGCCCGACGCCCGGGCTTTGCCCGGGC
ii i mu! i iniiiiii mum i n i i 11 11 m
GACGGCGCCCGTGG GCCCGGGCGCCGGGCGGCG GGGGCCGGCATGGCGGCG CGGCG
\ A
G GG
A'
GGCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGCCAA
mu ii ii mu ii i i i mi i in
GGCCTGAGACAGAGAGCGTGCCGGGTGGTA GAGT GGCAA
// ^7 \
AG ^-^TTGACA
TTGGCCACTCCCTCTCTGC
II I III III
GTAGTGCTTGCCTGTCTA/
TTGACAGGCAAGCATGTGCGTGCAGAGGCGAGTAGTGCTTGCCTGTCTAA
B
B'
GCGCTCGCTCGCTCACTGAGGCCGCCCGGGCAAAGCCCGGGCGTCGGGCGACCTTTGGTCGCCCGG
11111111111 I I II III III 11 III III ll I I! Ill II
ctcgctcgctcgccgcgggggcccgggctGcgccgccgcg actta ggccgcgcgc
I \ I / \
T G G AAG
DR1
85
231
Figure 32.
Homology between the terminus of the long unique region in HSV-1
and the terminus of AAV
^4
CO

74
this first half of this array. The second half of the array is con
served in 68 to 70% of the sequences.
The ends of the HSV sequences displayed in Figure 32 are separated
by 20 nucleotides. This boundary is formed in part by a twelve base
pair inverted repeat.
As one reads downstream from the end of the preceeding sequence
through the A reiteration of HSV, one comes to the direct repeat
defining its far terminus. Again this region can be aligned with the
terminal AAV sequences. About 63% of the sequence of the A domain is
conserved and.the short palindrome GCCCGGGC is retained in full within
both genomes (see Figure 33). The sequence ACTCC is found 51 base pairs
downstream from this short palindrome in both AAV and HSV, followed by
the sequence GGTTCCT. In HSV these two short sequences are contiguous
while in AAV they are separated by 10 base pairs.
A C
AAV CACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCAAAG 54
I I I I I I I I I I I I I I I I I I I I II II I I I I I I
HSV CCCGCCTTTTTTGCGCGC CGC CCCGCCCGCGGGGGGCCCGGGCTGCC ,oc
DR1 685
Figure 33. Homology between the terminus of the short unique region in
HSV-1 and the terminus of AAV (Mocarski et al., 1980)

DISCUSSION
The trigeminal ganglia of 22 patients have been assayed for HSV
sequences by DNA/DNA hybridization: None of the patients manifested
clinical evidence of recurrence at the time of death nor was a history
of recurrence noted. Fourteen of the patients were sero-positive for
HSV. A positive serology was assessed as a complement fixation titer of
1:8 or greater. The RNA from the trigeminal ganglia of 16 patients was
also surveyed for HSV transcripts by RNA/DNA hybridization.
Hybridizations were conducted in 50% formamide and 5XSSC solution
at 37C. Given a T^ of 97C in 1XSSC and a G + C value of 68% the calcu
lated value of the T^ for HSV in 5XSSC would be approximately 104C
(Sheldrick and Berthelot, 1974). Allowing for a 0.7C decrease in the Tm
value for each 1% of formamide present and a 1C lowering for each 1.5%
mismatching of base pairs (McConaughy et al., 1969), the initial condi
tions of hybridization would permit a 21% mismatch in base pairing be
tween the probe and nitrocellulose bound DNA. Subsequent washes in 1XSSC
and 50% formamide at 37C would permit no more than a 16% mismatch to be
retained. In like manner it can be calculated that washes in 0.1XSSC
solution alone at 68C would permit no greater than 10% mismatch in base
pairing. Consequently, the signal retained in hybridizations between the
HSV-1 probe and ganglia containing HSV-2 DNA or transcripts would be
greatly subdued. In such instances the strongest binding would occue in
the regions of greatest homology between the two types, namely, the
termini and L/S junction.
75

76
Under any of the above conditions control experiments demonstrated
that the HSV-1 nick translated probe failed to bind to DMA from unin
fected human ganglia or connective tissue as well as to the DMAs of AAV,
SV40 and Ad2. All three of these viruses have a demonstrated potential
for latency in human cell lines in vitro. In reconstruction experiments
using blots of 6% acrylamide gels, we were able to detect 5 pg of viral
DMA in the presence of 10 yg of carrier DMA, a dilution factor of
2x10^. Similarly 10 pg of viral DMA could be detected in the presence
of 10 yg of carrier when hybridization was to Southern blots of 0.5%
agarose gels. Any real differences in the sensitivities of these two
approaches is largely indicative of the increased diffusion witnessed
when transfer was from low percentage agarose gels* If the DMA content
of the normal diploid human cell is 5 pg (Luria and Darnell, 1978), the
10 yg of ganglia DMA normally assayed would represent the product of about
r O
2x10 cells,, Thus, given the molecular weight of the HSV genome is 10
dal tons, the sensitivity of our hybridization assay is such that we can
detect roughly 1 copy of the HSV genome per 200 cells.
In 18 of the 22 assays in which trigeminal ganglia were evaluated
for the presence of HSV, total ganglionic DMA was cleaved by endonuclease
digestion, transferred to nitrocellulose and probed with nick translated
HSV DMA. Eleven of these patients were sero-positive for HSV. Nine of
the sero-positive were shown to carry HSV DMA and two of these were also
shown to be positive for RMA transcripts. The nucleic acid from two of
the sero-positive patients failed to demonstrate HSV specific sequences
in either DMA or RMA. Only one of the seven sero-negative patients gave
evidence of the presence of HSV DMA or RMA; the remainder were negative.
Thus, there is a positive correlation between the presence of compliment

77
fixing antibodies and the presence of HSV specific sequences as measured
by this approach.
Two patients warrant some further discussion. Patient #941 was a
1 year old male who died from congenital lobar emphysema. Although both
viral DNA and RNA were detected repeatedly in the trigeminal ganglia no
humoral immune response to HSV could be determined by either complement
fixation or indirect immunofluoresence assays. The patient had not
received sufficient immunosuppressive therapy to negate a humoral re
sponse nor was there evidence of congenital failure of the humoral immune
system. It is possible the primary viral infection of the infant occurred
before the humoral immune system was competent enough to mount a response
and no subsequent recurrences occurred. No viral DNA was detected in the
ganglia from patient #949 although RNA transcripts from the short repeat
regions of the HSV genome were demonstrated. It may be that only this
portion of the genome was latent in the ganglia; these findings would
then mirror the varied sensitivities of the two experimental approaches.
The detection of only part of the HSV genome in several of the
ganglia raises the question of whether the remainder of the genome is
absent. Brown et aj_ (1979) has reported the detection of latent defec
tive HSV by complementation of the endogenous genome iwth ts mutants of
HSV-1 in 8 out of 14 individuals previously negative for spontaneous
release of virus. The altered migration or absence of the terminal EcoRl
K fragments revealed in patients #228 and #227 could be examples of such
an event. The frequency with which large deletions could occur would be
greatest in the terminal regions of the linear genome. Conversely, it
may be argued that these fragments have undergone an apparent increase
in molecular weight due to covalent linkage with host DNA or some other

70
form of rearrangement. The approach taken here would not resolve this
issue. Frequently the regions which we failed to detect gave rise to
smaller endonuclease digestion fragments whose copy number would fall
below our level of detection. The sensitivity of our assay would allow
us to detect a fragment representing 1% of the genome only if it was
present in at least 1 copy per cell. The findings in patients #1082 and
#1089 probably fall within this category.
In a recent repetition of this approach using human brain tissue
Fraser et al_ (1981) reported the detection of HSV DNA sequences in six of
eleven individuals assayed. Hybridization against total viral DNA
revealed all or portions of the HSV genome were present in the six posi
tive individuals. Hybridization against the clone pRBllS showed a
marked alteration of the electrophoretic migration pattern of the ter
minal fragment in oen individual and no change in the two other patients.
The findings of the CsCl enrichment studies lead us to consider the
possibility that the bands we detected by blot hybridizations are the
product of a lytic infection that ensued at the time of death. The
positive controls using DNA from a known HSV infection insures that the
mechanics of this approach were efficient enough to retain sufficient
levels of viral DNA if this were the case. Given the sensitivity of the
hybridization assay itself and the negative findings in known sero-posi-
tive patients a reasonable argument can be made against an ongoing lytic
infection within the ganglia.
RNA from the trigeminal ganglia of 16 patients was screened for HSV
specific transcripts by DNA/RNA hybridization. In 8 of these patients
125
I-labeled ganglia cytoplasmic RNA was hybridized to either EcoRl or
Hpal endonuclease digests of HSV-1 F strain DNA bound to nitrocellulose
paper. We were able to demonstrate HSV specific RNA transcripts in two

79
of three sero-positive patients assayed and one of the five sero-negative
patients. The medical history of the single sero-negative patient, #941,
has been discussed along with our findings from DNA/DNA hybridizations.
From the mapping of those RNA transcripts observed it is clear that the
regions of the genome most frequently encountered to date are those con
taining sequences in the immediate early and early mRNA species of HSV-1
(Clements et aj_., 1979; Roizman, 1979).
Because of the frequency with which transcripts mapping to the region
of the L/S junction were encountered, the cytoplasmic RNA from 9 indivi
duals was used as a probe in hybridizations against endonuclease digests
of the clone pRBl15. Eight of these patients were sero-positive. None
of the patients contained RNA which would hybridize with pRBl15. This
result was curious in view of the fact that RNA was present which would
hybridize to the larger EcoRl K fragment present in EcoRl digests of the
total HSV genome. It can be argued that the two probes allowed the
recognition of a subset of transcripts associated with latency, namely,
a set of transcripts mapping to a region of the EcoRl K fragment not
common to the BamHl P fragment. The region running downstream from the
right end of BamHl P to the right terminus of EcoRl K is approxiamtely
1.8 kb in size (see Figure 13).
Using the tsB2 mutant Holland et al_ (1979) has reported finding no
mRNA species of greater than 3 kb in this region. This temperature sen
sitive mutant is one of a group of ts mutants mapping within the sequences
of the short reiterated region which code for ICP4 (Schaffer et aj_., 1973).
The viral gene function coding for transition from immediate early to
early polypeptide synthesis also maps to this region and is thought to be
a function of ICP4 (Preston et al_., 1978). Studies of protein synthesis

80
during temperature shift experiments on this group of mutants suggest
that ICP4 is autoregulated (Schaffer et al_., 1973). The 5' terminus of
IEmRNA-3 which is believed to code for ICP4 lies within the 1.8 kb region
described above (Watson and Van de Woude, 1982; Clements et al_., 1979;
Anderson et al_., 1980). Transcription is normally in a leftward direction
proceeding into the region of the BamHl P fragment at the joint (Maxam
and Gilbert, 1980).
Finally, two ts mutants of ICP4, tsD and tsK, have been assayed for
their ability to establish latency in mice; tsK fails to establish
latency in mice while tsD will (Stevens and Cook, 1971). Both mutants
block viral DNA synthesis. Thus two ts mutants within a single gene
within this region can distinguish between viral functions permitting
subsequent DNA replication and the establishment of latency. In light
of the above findings further evaluation of transcription through this
region during latency is warranted, especially in animal models.
Another portion of the genome highlighted by the transcription
studies is the region mapping from about 0.08 to 0.65, especially the
area from 0.1 to 0.3 (see Figure 13). The bulk of the early viral pro
teins genes are within these domains (Schaffer et al_., 1973). The genes
for the viral thymidine kinase and the viral DNA polymerase of both HSV-1
and HSV-2 map within the region 0.27-0.43 (Clements et al_., 1977; Schaffer
et al_., 1973). Spear and Roizman (1972) have reported a correlation be
tween viral induced oncogenic transformation and ICP8 within the region
from 0.30 0.45 map units. Stevens and Cook (1971) have demonstrated
a latency negative phenotype for the mutants tsA, tsS, tsT, and tsl; all
of which map within the region 0.1 to 0.6. It is noteworthy that in
subsequent mappings of RNA transcripts by in situ hybridization,
Galloway and McDougall (1981) have consistantly found the region 0.1 to

81
0.3 represented in ganglia; other regions including the L/S junction were
variably demonstrated. In similar studies of HSV RNA in cervical car
cinoma cells sequences spanning map positions 0.07 to 0.4, 0.58 to 0.63,
0.82 to 0.85 and 0.94 to 0.96 were represented (McDougall et a]_., 1982).
These findings are noteworthy because of the collinearity of the HSV-1
and HSV-2 transcription maps. Taken in total, the studies are supportive
of our findings and suggest that a subset of the immediate early and
early genes are involved in the establishment and maintenance of latency.
32
The binding of P-labeled HSV DMA to restriction endonuclease
1 25
digests of ganglia DNA, or conversely I-labeled ganglia RNA to HSV
DMA has permitted several questions to be considered. Those regions of
the viral genome which are represented have been determined by simply
noting the presence or absence of given viral DNA bands on the autoradio
graph. Although it is reasonable to expect the entire genome must be
present as a single unit to give rise to recurrence, some cells within
the population may carry only portions of the viral genome. It is there
fore not surprising to find an apparent unequal molar representation of
viral fragments. This is demonstrated by our findings and suggested by
previous work on viral thymidine kinase in ganglia (Yamamoto £t al_., 1977).
Finally, the question of whether latent viral DNA is covalently
intefrated into cellular chromosomes was approached. Any digestion frag
ments which are covalently linked to cellular DNA will migrate in the
agarose gels with an apparent increase in molecular weight as a result
of the added cellular component. Digests of viral DNA present as a free
circular episome would also have an altered migration for the terminal
fragments. DNA sequestered in immature nucleocapsids would give rise to
banding patterns similar to that of wild type viral DNA. In interpreting
such data it should be noted that most virus isolates from ganglia

82
explants, to date, have yielded unique endonuclease restriction patterns.
Thus for alteration in electrophoretic migration to be reasonably com
ponent, the shift should be significant and repeatable when the ganglia
DNA is restricted with an enzyme such as Xbal which does not reveal
strain differences in HSV. When the latent virus is HSV-2 the fidelity
of hybridization with the HSV-1 probe could also be significantly reduced.
Thus although our data is compatible with integration of HSV into cellu
lar genomes, it is not sufficient to prove it.
Hybridization of 3I-labeled cytoplasmic RNA to digests of HSV DNA
demonstrates the presence of viral RNA transcripts in the ganglia. The
design of our experiments using several different restriction digests of
HSV enabled us to corroborate our findings and more finely map these
sequence homologies. Autoradiographic density of hybridized bands per
mits estimates of the frequency of given RNA species in our sample.
125
For this reason control reactions were run with the I-labeled cyto
plasmic RNA from both HSV lyticly infected Hep2 cells and uninfected
tissue cultures for comparison. This experimental approach answers the
question of which regions of the latent HSV genome are undergoing active
transcription. The fact that only a subset of the RNA transcripts were
found in latently infected ganglia suggests that some HSV genes may be
necessary for maintenance of the latent state.
A number of general observations have prompted the inclusion of a
comparative analysis of the HSV, Ad, and AAV genomes within this study
of HSV latency. The genomes studies are representative of the three
linear DNA virus families whose members are known to replicate within
the nuceli of human cells. Architecturally each of these linear genomes
contains inverted repeats within their terminal regions. Each of the
viruses have a demonstrated potential in vitro for latency in human cells.

83
And lastly, the defective parvovirus (AAV) is absolutely dependent upon
coinfection with either an edenovirus or herpesvirus for its multiplica
tion.
In the absence of a coinfecting helper, AAV enters the cell where
its virion is uncoated within the nucleus. No detectable macromolecular
synthesis occurs at this time. The naked AAV DNA may then establish a
stable relationship with the host cell (Hoggan et a]_., 1966; Cheung et al.,
1980). Subsequent infection with a helper virus promotes the multiplica
tion of infectious AAV within these latent cells. Although the nature of
this stable relationship between AAV and the host cell is complex, it is
clear that at least a portion of the genome is covalently linked to
cellular DNA and in part copies of the entire genome are tandeomly
arrayed within this linkage with cellular DMA (Handa and Shimogo, 1977;
Cheung et al_., 1980). Our findings demonstrate a substantial sequence
homology within apparent regulatory regions between the defective genome
and those of its helpers. This is of particular interest since no bio
chemical relatedness has been previously demonstrated between these
viruses and the principal role the helper plays in this partnership is
the promoting of AAV macromolecular synthesis.
Although 6 to 12 base pair stretches of homology with AAV were
found randomly throughout the Ad genome these homologies were concen
trated largely within the terminal sequences of the AAV genome. The
strongest co-1inear homologies between regions of the two genomes which
at present appear to have no functional relatedness, involve the EcoRl
D and F fragments of Ad and the terminal repitition of AAV. Two examples
of sequence homology within these regions have been described. The
first of these analyzes the area surrounding the 3' end of the first
leader sequence in the E3 transcription complex of Ad and the termini

84
of AAV. The second compares the beginning of the second coding region
in AAV and a portion of the E3 transcription complex. The second exam
ple actually lies within the potential coding sequence of the 14K E3
polypeptide of Ad (Hriss et al., 1980). Because the function of E3
region of Ad is obscure, it is difficult to evaluate these homologies.
There is no evidence to date which directly ascribes a specific regula
tory role during transcription to the terminal repetition in AAV nor has
a role been assigned to the E3 transcription products of Ad. Transcrip
tion of the E3 complex is nonessential for growth of Ad or AAV in vitro
(Richardson and VJestphal, 1981).
Two other short stretches of homology hying within the left half
of the Ad genome were also found. The first of these is the 26 bp
stretch in AAV (142-168) which is complimentary to a portion of the
inverted terminal repeat of Ad. The second is the AAV sequence sur
rounding the TATA box 31 bases upstream from the leftward most site of
initiation of transcription. It has a 17/19 base homology with a com
parable sequence upstream from the initiation of the Ad5 early region
1A transcripts. Lusby et al_ (1980) had previously reported these are
example regions with a potential role in transcriptional regulation.
Taken in total the data suggest a conservation through evolution of
regions of these genomes involved in transcriptional regulation.
As noted previously several lines of evidence suggest at least a
general similarity in the architecture of the AAV and HSV genomes. The
termini of both genomes contain a tandem array of natural and inverted
repeats. Also portions of these repeated regions may be inverted in
their relationship to unique regions of the genome as a natural conse
quence of viral DMA replication (Lusby et al., 1980; Mocarski et al.,

85
1980)o And there is apparently an inherent ability within the replica
tive cycle for maintaining identity between the termini through some
mechanism of gene conversion. Probable origins of replication and at
least some early regulatory functions lie within the reiterated sequences
in both viruses.
The nucleotide sequence of the natural terminal repeat in HSV-1 F
was used for the comparison with the terminal 200 nucleotides of AAV
described in this study. The terminal 200 nucleotides of AAV contain
the 143 bp inverted terminal repeat. This region can further be broken
into two smaller internal palindromic sequences which are bracketed by
a larger repeat and its inverse (Lusby e_t al_., 1980). The 5001 bp
natural repeat in HSV-1 F is inverted to form the junction of the long
and short unique regions of the genome; thus each unique arm of the
genome is in turn roughly similar in architecture to the AAV genome, as
is the whole. The 501 bp sequence is composed of 20 direct repeats of a
12 nucleotide sequence, 3 repeats of a 37 base sequence and some inter
nally unique sequences; the entire domain is bracketed by a 20 base pair
direct repeat (Mocarski et al_., 1980).
Our findings demonstrate an extensive homology between portions of
the HSV inverted repeats found at the L/S junction and termini with the
termini of AAV. The regions of HSV homology are 1) those regions of
the "b" reiteration which bracket the long unique region and are imme
diately adjacent to the "a" repeat, 2) those portions of the "c" reitera
tion which bracket the short unique region and are contiguous with the
"a" repeat, and 3) the 20 base direct repeat (DRI) which brackets the
"a" repeat. The high G + C content and repetiveness of these regions
would explain our earlier failure to find these homologies by Southern
hybridization.

86
The extensive homology between DRI and the small internal palin
dromes of the AAV sequence is of particular interest. The short palin
drome GCCCGGGC has been totally conserved within both. A role for DRI
has been proposed in both the site specific cleavage of concatomeric
replicative intermediates of HSV and the inversion of the long and short
domains (Mocarski et al_., 1980). Similary, deletion mutants within this
sequence in AAV are unable to resolve high molecular weight intermediates
in DNA replication. Fifty-one base pairs downstream from GCCCGGGC in
AAV one finds the sequence ACTCC followed nine base pairs further down
stream by the sequence GGTTCCT; ACTCC is the probable cleavage site for
the inversion of the AAV terminal palindrome and resolution of the hair
pin during DMA replication. The sequence ACTCC followed by GGTTCCT is
also found within the "c" reiteration of HSV-1 F fifty-one bases down
stream from the sequence GCCCGGGC within DRI. The question of whether
this arrangement is coincidental or the sequence actually serves a
similar function in the replication of both genomes will require genetic
analysis. It should be noted that HSV-1 F strain DNA contains a single
copy of the "a" reiteration at its right terminus and the putative
cleavage site for resolution of concatomers is thought to lie within or
just outside the "a" reiteration adjacent to the "c" repeat (Mocarski
et al., 1980).
The terminal sequences of AAV DNA appear to be intimately involved
in the integration of latent AAV DNA into cellular chromatin. Endo
nuclease analysis of AAV DNA from early (10) and late (118) passages of
latently infected cells demonstrated that the only sequences altered
during clonal passage were those within the palindromic region of the
terminal repeat, specifically, the sequence GCCCGGGCT which contains the

87
Smal recognition site (Cheung et al_., 1980). Thus these sequences could
potentially serve a similar role in latency of HSV.
The conservation of similar GC content and architecture between
the termini of several parvoviruses supports the genetic evidence
assigning identical biological roles to these regions. These observa
tions appear to signify the direct involvement of the termini in viral
multiplication. Further the potential to form nearly identical curci-
form structures through secondary folding of their 3' termini appears
to be stringently conserved even within those genomes which have signif
icant sequence divergence from that of AAV. Thus the evolution of
this family of small DNA viruses has conserved both primary sequence and
secondary structure within a region of the genome in which both must
interact in the preservation of fidelity in viral replication.
The question of whether sequence homology between AAV and HSV is a
consequence of similar function warrants further investigation in light
of the findings within the parvovirus family. Our observations to date
do not permit the assumption that homologous sequences serve identical
functions within AAV and HSV. A cursory analysis of the homologous
sequences in HSV reveals that they are not self complimentary and cannot
easily be ascribed a secondary structure similar to AAV. Determination
of whether the primary sequence within HSV would lend itself to the
formation of a stable curciform secondary structure is central to this
line of investigation. In conclusion the sequence homology between AAV
and HSV demonstrates the potential for similar mechanics of early regu
lation and macromolecular synthesis, events which appear to be concomit
tant with the establishment and maintenance of latency.

LIST OF REFERENCES
Anderson, K., J. Stringer, L. Holland and E. Wagner. 19791 Isolation
and localization of herpes simplex virus type I mRNA. Journal of
Virology. 30: 805-820.
Anderson, K., L. Holland, B. Gaylord and E. Wagner. 1980. Isolation and
transcription of mRNA encoded by a specific region of the Herpes
Simplex virus type I genome. Journal of Virology. _33: 749-759.
Atkinson, M.A., S. Barr and M.C. Timbury. 1978. The fine structure of
cells infected with termperature sensitive mutants of herpes simplex
virus type 2. Journal of General Virology. 2: 517-536.
Bachenheimer, S. and B. Roizman. 1972. Ribonucleic acid synthesis in
cells infected with herpes simplex virus. Journal of Virology.
10: 875-879.
Baringer, J.R. 1974. Recovery of herpes simplex virus from human
sacral ganglions. New England Journal of Medicine. 291: 828-830.
Baringer, J.R. 1975. Herpes simplex virus infection of nervous tissue
in animals and man. Progress in Medical Virology. 20: 1-26.
Baringer, J.R. and P. Sworeland. 1973. Recovery of herpes simplex
virus from human trigeminal ganglions. New England Journal of
Medicine. 288: 546-650.
Bastian, R.O., A.S. Rabson, C.L. Yee and T.S. Tralka. 1972. Herpes
hominis isolation from human trigeminal ganglion. Science. 178:
305-307.
Becker, Y., H. Dym and I. Sarov. 1968. Herpes Simplex virus DNA.
Virology. 36: 184-192.
Berns, K.I. and W. Hauswirth. 1978. Parvovirus DNA structure and
replication. Replication of Mammalian Parvoviruses. Cold Spring
Harbor Laboratory Press, pp. 13-32.
Biswal, N., B. Murray and M. Benyesh-Melnick. 1974. Ribonucleotides in
newly synthesized DNA of herpes simplex virus. Virology. 61:
87-99.
Brown, S.M., J.H. Subak-Sharpe, K.G. Warren, Z. Wroblewska, and H.
Koprowski. 1979. Detection of uninducible herpes simplex virus
genomes latnet in human ganglia explants. Proceedings of the
National Academy of Science, U.S.A. 76: 2364-2368.
88

89
Buchman, T.G., B. Roizman, G. Adams and B.H. Storer. 1978. Restriction
endonuclease fingerprinting of herpes simplex virus DNA: a novel
epidemiological tool applied to a nosocomial outbreak. Journal
of Infectious Diseases. 138: 488-498.
Bnemann, H. and W. Mller. 1978. Base specific fractionation of double
stranded DNA: affinity chromatography on a novel type of absorbant.
Nucleic Acids Research. 5_: 1059-1074.
Carton, C.A. and E.D. Kilborne. 1952. Activation of latent herpes sim
plex by trigeminal sensory-root section. New England Journal of
Medicine. 246: 172-175.
Centifanto-Fitzgerald, Y., E. Varnell and H. Kaufman. 1932. Initial
herpes simplex virus type 1 infection prevents ganglionic super
infection by other strains. Infection and Immunity. 35_: 1125-
1132.
Centifanto-Fitzgerald, Y., T. Yamaguchi, H. Kaufman, M. Tognon and B.
Roizman. 1982. Ocular disease pattern induced by herpes simplex
virus is genetically determined by a specific region of viral DNA.
Journal of Experimental Medicine. 155: 475-489.
Cheung, A., D. Hoggan, W. Hausv/irth and K.I. Berns. 1980. Integration
of the adeno-associated virus genome into cellular DNA in latently
infected human Detroit 6 cells. Journal of Virology. 33: 730-748.
Clements, J., R. Watson, and N. Wilkie. 1977. Temporal regulation of
herpes simplex virus type I transcription: location of transcripts
on the viral genome. Cell. J_2: 275-285.
Clements, J.D., T. McLaughlan and D.S. McGeoch. 1979. Orientation of
herpes simplex virus type 1 immediate early mRNAs. Nuclear Acid
Research. 7_: 77-93.
Comerford, S. 1971. Iodination of Nucleic Acids in vitro. Biochemistry.
TO: 1993-1995.
Cook, M.L., V.B. Bastone and J.G. Stevens. 1974. Evidence that neurons
harbor latent herpes simplex virus. Infection and Immunology. 9:
946-951.
Cook, M.L. and J.G. Stevens. 1973. Pathogenesis of herpetic neuritis
and ganglionitis in mice: evidence for intra-axonal transport of
infection. Infection and Immunity. 7_: 272-288.
Cook, M.L. and J.G. Stevens. 1976. Latent Herpetic infections following
experimental viremia. Journal of General Virology. 31_: 75-80.
Daniels, C.A., S.G. LeGoff, and A.L. Notkins. 1975. Shedding of
infectious virus-antibody complexes from vesticular lesions of
patients with recurrent herpes labial is. Lancet. 2: 524-528.

90
Delius, Ho and J. Clements. 1976. A parital denaturation map of herpes
simplex virus type 1 DMA: evidence for inversion of the unique
DNA regions. Journal of General Virology. ^3: 125-133.
Ecob-Johnston, M.S. and W.O. Whetsell. 1979. Host-cell response to
herpes virus infection in central and peripheral nervous tissue
in vitro. Journal of General Virology. 44: 747-757.
Feldman, L.A., R.D. Sheppard and M.B. Bronstein. 1968. Herpes simplex
virus-host cell relationships in organized cultures of mammalian
nerve tissues. Journal of Virology. 2: 621-628.
Finkelstein, M. and R. Rownd. 1978. A rapid method for extracting DNA
from agarose gels. Plasmid. 1_: 557-562.
Fraser, N., W. Lawrence, Z. VIroblewska, D. Gilden, and H. Koprowski.
1981. Herpes Simplex type 1 DMA in human brain tissue. Proceedings
National Academy of Science, U.S.A. 78: 6461-6465.
Frenkel, N. and B. Roizman. 1972. Separation of herpes virus DNA duplex
into unique fragments and intact strand on sedimentation in alkaline
gradients. Journal of Virology. 1_0: 565-572.
Frenkel, N., H. Locker, W. Batterson, G.S. Hayward and B. Roizman. 1976.
Anatomy of herpes simplex virus DNA VI. Defective DNA originates
from the S component. Journal of Virology. 20_: 527-531 .
Galloway, D.A., C. Genoglio, M. Shevchuk and J.K. McDougall. 1979.
Detection of herpes simplex RMA in human sensory ganglia. Virology.
95: 265-268.
Galloway, D. and J. McDougall. 1981. Transformation of rodent cells
by a cloned DNA fragment of Herpes Simplex type 2. Journal of
Virology. 749-760.
Goodpasture, E.W. 1929. Herpetic infection with especial reference to
involvement of the nervous system. Medicine. 8: 223-243.
Grafstrom, R.H., J.C. Alwine, W.L. Steinhart and C.S. Hill. 1974.
Terminal repetitions in herpes simplex virus type I DNA. Cold
Springs Harbor Symposium Quart. Biol. 3£: 679-681.
Graham, B., H. Ludwig, D. Bronson, M. Benyesh-Melnick and N. Biswal.
1972. Physiochemical properties of the DNA of herpes viruses.
Biochemical and Biophysical Acta. 259: 13-23.
Handa, H. and H. Shimojo. 1977. Isolation of the viral DNA replication
complex from adeno-associated virus type 1 infected cells. Journal
of Virology. £4: 444-450.
Hayward, G.S., N. Frenkel and B. Roizman. 1975. Anatomy of herpes
simplex virus DNA: strain differences and heterogeneity in the
location of restriction endonuclease cleavage sites. Proceedings
of the National Academy of Science. 72: 1768-1772.

91
Hayward, G.S., R.J. Jacob, S.C. Wadsworth, and B. Roizman. 1975.
Anatomy of herpes simplex virus: Evidence for four populations of
molecules that differ in the relative orientations of their long
and short components. Biochemistry. 12} 4243-4247.
Hriss, J., G. Courtois and F. Galibert. 1980. Nucleotide sequence of
the EcoRl D fragment of Adenovirus z genome. Nucleic Acid Research.
8: 2173-2191.
Hriss, J. and F. Galibert. 1981. Nucleotide sequence of the EcoRl E
fraqment of adenovirus 2 genome. Nucleic Acid Research. 9: 1229-
1240.
Hill, T.S. and H.S. Field. 1973. The interaction of herpes simplex
virus with cultures of peripheral nervous tissue: an electron
microscope study. Journal of General Virology. 21_: 123-133.
Hill, T.S., H.S. Field and W.A. Blyth. 1975. Acute recurrent infection
with herpes simplex virus in the mouse: a model for studying and
recurrent disease. Journal of General Virology. 28: 341-353.
Hirt, B. 1967. Selective extraction of polyoma DNA from infected
mouse cell cultures. Journal of Molecular Biology. 26/ 365-369.
Hoggan, M., N. Blacklow and W. Rowe. 1966. Studies of small DNA viruses
found in various adenovirus preparations? Physical, biological
and immunological characteristics. Proceedings of the National
Academy of Science, U.S.A. 55/. 1467-1575.
Holland, L.E., K.P. Anderson, J.R. Stringer and E.K. Wagner. 1979.
Isolation and localization of herpes simplex virus type 1 mRNA
abundant before viral DNA synthesis. Journal of Virology. 31:
447-462.
Honess, M. and D. Watson. 1974. Herpes simplex virus-specific polypep
tides studied by polyacrylamide gel electrophoresis of immune preci
pitates. Journal of General Virology. 22: 171-183.
Jones, P. and B. Roizman. 1979. Regulation of Herpesvirus macromolecular
synthesis VIII. The transcription program consists of three phases
during which both extent of transcription and accumulation of RNA
in the cytoplasm are regulated. Journal of Virology. 31_: 299-
314.
Kaplan, A.S. (ed.) 1973. The Herpesviruses Academic Press, New York.
Kieff, E.D., S.L. Bachenheimer and B. Roizman. 1971. Size, composition
and structure of the deoxyribonucleic acid of herpes simplex virus
subtypes 1 and 2. Journal of Virology. 8: 125-132.
Knipe, D., W. Ruyechan, R. Honess and B. Roizman. 1979. Molecular
genetics of herpes simplex virus: The terminal a sequences of the
L and S components are obligatorily identical and constitute a part
of a structural gene mapping predominantly in the S component.
Proceedings of the National Academyof Science, U.S.A. 76: 4534-4538.

92
Kristensson, K., B. Ghetti and H.M. Wisniewski. 1974. Study on the
propagation of herpes simplex virus (type 2) into the brain after
intraocular injection. Brain Research. 69; 189-201.
LePecq, J. 1970. Use of ethidium bromide for separation and determina
tion of nucleic acids of various conformational forms and measure
ment of their associated enzymes. Methods of Biochemical Analysis.
20: 41-86.
Lis, J.T. 1980. Fractionation of DMA fragments by polyethylene glycol
induced precipitation. Methods in Enzymology. 65_: 347-353.
Locker, H. and N. Frenkel. 1979. Baml, Kpnl and Sail restriction enzyme
maps of the DMAs of herpes simplex virus strains Justin and F:
occurrence of heterogeneities in defined regions of the viral DMA.
Journal of Virology. 32; 429-441.
Lonsdale, D.M., S.M. Brown and J.H. Subak-Sharpe. 1979. The polypep
tide and the DMA restriction enzyme profiles of spontaneous iso
lates of herpes simplex virus type 1 from explants of human
trigeminal, superior cervical and vagus ganglia. Journal of
General Virology. 43: 151-171.
Luria, S. and J. Darnell. 1978. General Virology. 3rd ed. Wiley.
Mew York, Mew York.
Lusby, E., K. Fife and K. Berns. 1980. Nucleotide sequence of the
inverted terminal repetition in adeno-associated virus DMA.
Journal of Virology. 34: 402-409.
Lusby,E. and K. Berns. 1982. Mapping the 5' termini of two adeno-
associated virus RNAs in the left-half of the genome. Journal of
Virology. 41_: 518-524.
McConaughy, B.L., C.D. Laird and B.S. McCarthy. 1969. Nucleic acid
reassociation in formamide. Biochemistry. 8: 3289-3294.
McDougall, J., C. Crum, C. Fenoglio, L. Goldstein, and D. Galloway.
1982. Herpesvirus-specific RNA and protein in carcinoma of the
uterine cervix. Proceedings of National Academy of Science, U.S.A.
79: 3853-3857.
McLauchlan, J. and J.B. Clements. 1982. A 3' co-terminus of two early
herpes simplex virus type 1 mRNAs. Nucleic Acid Research. 10:
501-512.
Maxam, A.M. and W. Gilbert. 1980. Sequencing end-labeled DNA with base-
specific chemical cleavages. Methods of Enzymology. 65; 499-460.
Mocarski, E.S., L.E. Post and B. Roizman. 1980. Molecular Engineering
of the herpes simplex virus genome: insertion of a second L-S
junction into the genome causes additional genome inversions. Cell.
22: 240-255.

93
Morse, L., L. Pereira, B. Roizman, and P. Schaffer. 1977. Anatomy of
HSV DNA. VI Mapping of viral genes by analysis of polypeptides
and functions specified by HSV-1 X HSV-2 recombinants. Journal of
Virology. 26; 389-410.
Moss, B., A. Gershowitz, J. Stringer, L. Holland, and E. Wagner. 1977.
5'-Terminal and internal methylated nucleosides in herpes simplex
virus type 1 mRNA. Journal of Virology. 23; 234-239.
Naragi, S., G.G. Jackson and Q.M. Jonasson. 1976. Viremia with herpes
simplex type-1 in adults. Annals of Internal Medicine. 85; 165-
169.
Nesburn, A, M. Cook and J. Stevens. 1976. Latent herpes simplex virus.
Isolation from rabbit trigeminal ganglia between episodes of recur
rent ocular infection. Archives of Ophthalmology. 88: 412-418.
Nii, S., C. Morgan and H.M. Rose. 1968. Electron microscopy of herpes
simplex virus II: sequence of development. Journal of Virology.
2: 517-536.
Pater, M.M., R.W. Hyman and F. Rapp 1976 Isolation of herpes simplex
virus DNA from the "Hirt Supernatant". Virology 75; 481-483.
Pazin, G., M. Ho and P. Jannetta. 1978. Reactivation of herpes simplex
virus after decompression of the trigeminal nerve root. Journal
of Infectious Diseases. 138: 405-409.
Pereira, L., M. Wolff, M. Fenwick and B Roizman. 1977. Regulation of
herpesvirus macromolecular synthesis V. Properties of a polypep
tides made in HSV-1 and HSV-2 infected cells. Virology. 77; 733-
749.
Pignatti, P.F., E. Cassai, G. Memequzzi, N. Chenciner and G. Milanesi.
1979. Herpes simplex virus DMA isolation from infected cells with
a novel procedure. Virology. 93; 260-264.
Plummer, G., J. Wagner, A. Phuargsalo and C. Goodheart. 1970. Type 1
and Type 2 herpes simplex viruses: serological and biological
differences. Journal of Virology. 5; 51-59.
Post, L.E., A.J. Conley, E.S. Mocarski and B. Roizman. 1980. Cloning
of the reiterated and non-reiterated herpes simplex virus 1
sequences as BamHl fragments. Proceedings of the National Academy
of Science, U.S.A. 11_: 4201-4205.
Post, L., S. Mackem, and B. Roizman. 1981. Regulation of a genes of
herpes simplex virus: expression of chimeric genes produced by
fusion of thymidine kinase with y gene promoters. Cell. 24; 555-
565.
Preston, V., A. Davison, H Marsden, M. Timbury, J. Subak-Sharpe, and N.
Wilkie. 1978. Recombinants between Herpes simplex virus types
1 and 2: Analysis of genome structures and expression of immediate
early polypeptides. Journal of Virology. 28: 499-571.

94
Price, RoW. and A.L. Notkins. 1977. Viral infections of the autonomic
nervous system and its target organs: pathogenetic mechanisms.
Medical Hypothesis. 3; 33-36.
Price, R.W. and J. Schmitz. 1978. Reactivation of latent herpes simplex
virus infection of the autonomic nervous system by postganglionic
neuroctomy. Infection and Immunity. Hh 523-533.
Puga, A., J.D. Rosenthal, H. Openshaw and A.L. Notkins. 1978. Herpes
simplex virus DNA and mRNA sequences in acutely and chronically
infected trigeminal ganglia of mice. Virology. 89: 102-111.
Rajcani, F. 1978. Experimental pathogenesis of non-lethal herpes
virus infection and the establishment of latency. Acta Virology.
22: 278-286.
Richardson, C.C. 1966. The 5'-terminal nucleotides of T-j bacteriophage
deoxyribonucleic acid. Journal of Molecular Biology. 1_5: 49-61.
Richardson, W. and H. Westphal. 1981. A cascade of adenovirus early
functions is required fro expression of adeno-associated virus.
Cell. 27: 131-140.
Rigby, P.W.S., M..Dieckmann, C. Rhodes and P. Berg. 1977. Labeling
deoxyribonucleic acid to high specific activity in vitro by nick
translation with DNA polymerase I. Journal of Molecular Biology.
113: 237-251.
Rixon, F. and J.B. Clements. 1982. Detailed structural analysis of two
spliced HSV-1 immediate-early mRNAs. Nucleic Acids Research. 10:
2241-2256.
Roizman, B. 1979. The structure and isomerization of herpes simplex
virus genome. Cell. 1_6: 481-494.
Roizman, B. and P. Spear. 1968. Preparation of herpes simplex virus
of high titer. Journal of Virology. 2_: 83-84.
Roizman, B., M. Kozak, W. Honess and G. Hayward. 1974. Regulation of
herpesvirus macromolecular synthesis: Evidence for multilevel
regulation of herpes simplex 1 RNA and protein synthesis. Cold
Spring Harbor Symp. Quant. Biology. 39: 687-702.
Rustigan, R., J.B. Smalow, M. Type, VJ.A. Gibson and E. Shindell. 1966.
Studies on latent infection of skin and oral mucosa in individuals
with recurrent herpes simplex. Journal of Investigative Derma
tology. 47: 218-221.
Schaffer, P., G. Aron, N. Biswal and M. Benyesh-Melnick. 1973. Temp
erature-sensitive mutants of herpes simplex virus type 1: Isolation
complementation and partial characterization. Virology 52^: 57-71.

95
Scott, T. and T. Tokumaru. 1964. Herpesvirus hominis (virus of herpes
simplex). Bacteriological Reviews. 28: 458-471.
Sheldrick, P. and N. Berthelot. 1974. Inverted repetitions in the
chromosome of herpes simplex virus. Cold Spring Harbor Symposium
Quantitative Biology. 39: 667-678.
Silverstein, S., R. Millette, P. Jones and R. Roizman. 1976. RNA
synthesis in cells infected with herpes simplex virus. XII Sequence
simplexity and properties of RMA differing in extent of adenylation.
Journal of Virology. 15: 977-991.
Skare, J,, W.P. Summers and W.C. Summers. 1975. Structure and function
of herpes virus genomes I. Comparison of five HSV-1 and two HSV-2
strains of cleavage of their DMA with EcoRl restriction endonuclease.
Journal of Virology. J_5: 726-732.
Skare, J. and W. Summers. 1977. Structure and function of herpesvirus
genomes II. EcoRl, Xbal and Hindlll endonuclease cleavage sites
on herpes simplex virus type 1 DMA. Virology. 76: 581-595.
Smith, H. and M.L. Birnstiel. 1976. A simple method of DMA restriction
site mapping. Nucleic Acid Research. 3: 2387-2398.
Southern, E.M. 1975. Detection of specific sequences among DMA frag
ments separated by gel electrophoresis. Journal of Molecular
Biology. 98: 503-517.
Spear, P. and B. Roizman. 1972. Proteins specified by herpes simplex
viruses. V. Purification and structural proteins of the herpes
virions. Journal of Virology. 9_: 431-439.
Stevens, J.G. 1975. Latent herpes simplex virus and the nervous
system. Current Topics in Microbiology and Immunology. 70: 31-50.
Stevens, J.G. and M.L. Cook. 1972. Latent herpes simplex virus in
spinal ganglia of mice. Science. 173: 843-845.
Stevens, J.G. and M.L. Cook. 1972. Latent herpes simplex virus from
trigeminal ganglia of rabbits with recurrent eye infections.
Mature New Biology. 235: 216-217.
Subak-Sharpe, J., S. Brown, D. Ritchie, M. Timbury, J. Macnab, H. Marsden
and J. Hay. 1974. Genetic and biochemical studies with herpes
viruses. Cold Spring Harbor Symposia on Quantitative Biology.
39: 717-729.
Tereba, A. and B.J. McCarthy. 1973. Hybridization of ^I-labeled
ribonucleic acid. Biochemistry. J_2: 4675-4679.
Thomas, C.A. and L.A. MacHattie. 1967. The anatomy of viral DMA mole
cules. Annual Reviews of Biochemisty. 485.

96
Vlanzy, D., A. Kwong and N. Frenkel 1982 Site specific cleavage/
packaging of herpes simplex virus DMA and the selective maturation
of nucleocapsids containing full length viral DNA. Proceedings of
the National Academy of Science, U.S.A. 79: 1423-1427.
Wadsworth, S., R.J. Jacob and B. Roizman. 1975. Anatomy of herpes
virus DNA. II. Size, composition and arrangement of inverted ter
minal repetitions. Journal of Virology. J_5: 1487-1497.
Wagner, E. and B. Roizman. 1969. RNA synthesis in cells infected with
herpes simplex virus II. Evidence that a class of viral mRNA is
derived from a high molecular wright precursor synthesized in
the nucleus. Proceedings of the National Academy of Science, U.S.A.
64: 626-633.
Wagner, N.M. and W.C. Summers. 1978. Structure of the joint region and
the termini of the DNA of herpes simplex virus type I. Journal of
Virology. 27: 374-387.
Wahl, G.M., M. Stern and G.R. Stark. 1979. Efficient transfer of large
DNA fragments from agarose gels to diazobenzyloxymethyl-paper and
rapid hybridization by using dextran sulfate. Proceedings of the
National Academy of Sciences. 78: 3683-3687.
Walboomers, J. and J. Ter Schegget. 1976. A new method for the isola
tion of herpes simplex virus type 2 DNA. Virology. 74: 256-258.
Walz, M.A., R.W. Price and A.L. Notkins. .1974. Latent ganglionic infec
tion with herpes simplex virus types 1 and 2: viral reactivation
in vitro after neurectomy. Science. 184: 1185-1187.
Walz, M.A., H. Yamamoto and A.L. Notkins. 1976. Immunological response
restricts number of cells in sensory ganglia infected with herpes
simplex virus. Mature. 264: 554-556.
Warren, K.G., S.M. Brown, Z. Wroblewska, D. Gilden, H. Koprowski and J.
H. Subak-Sharpe. 1978. Isolation of latent herpes virus from the
superior cervical and vagus ganglia of humans. New England Journal
of Medicine. 298: 1068-1069.
Watson, R.J. and G.F. VandeWoude. 1982. DNA sequence of an immediate-
early gene (IEmRNA-5) of herpes simplex virus type I. Nucleic
Acid Research. K): 979-991 .
Wetmur, J. 1975. Acceleration of DNA renaturation rates. Biopolymers.
14_: 2517-2524.
Wilkie, N. 1973. The synthesis and sub structure of herpes virus DNA:
the distribution of alkali-labile single strand interruptions in
HSV-1 DNA. Journal of General Virology. 21_: 453-467.
Wilkie, N. 1976. Physical maps for herpes simplex virus DNA for restric
tion endonucleases Hindlll, Hpal, and Xbal. Journal of Virology.
20: 222-233.

97
Wilkie, N.M., J.B. Clements, J.C.M. MacMab and J.H. Subak-Sharpe. 1974.
The structure and biological properties of herpes simplex virus DNA.
Cold Spring Harbor Symp. Quant. Biol. 39: 657-666.
Wilkie, N. and R. Cortini. 1976. Sequence arrangement in herpes
simplex virus type 1 DNA: identification of terminal fragments in
restriction endonuclease digests and evidence for inversions in
redundant and unique sequences. Journal of Virology. 20: 211-221.

BIOGRAPHICAL SKETCH
I was born in Miami, Florida, on April 1, 1953, the first child of
Amos and Fran Rayfield. Our family was completed in 1956 with the birth
of my brother, Glenn. I attended the public school system of Dade County
and eventually enrolled at the University of Florida in the Department of
Immunology and Medical Microbiology as an undergraduate.
While an undergraduate, I worked in the Department of Ophthalmology
in the virology laboratory of Dr. Centifanto. I decided to further my
education in this field with a specific interest in HSV. I was accepted
into the Department of Immunology and Medical Microbiology and over the
years worked with various viruses which led to this dissertation.
I recently married Dorothy Lesso, a student at the University of
Florida, College of Environmental Engineering. Our plans include a move
to Mew Orleans where I am currently a post doctorate fellow at the LSU
Eye Institute.
Basically I'm an outdoors man and my interests include a spectrum
of sports which my wife and I share.
98

I certify that I have read this study and that in my opinion it
conforms to acceptable standards of scholarly presentation and is
fully adequate, in scope and quality, as a dissertation for the degree
of Doctor of Philosophy.
jeft
Kenneth I. Berns, M.D., Ph.D., Chairman
Professor and Chairman of Immunology
and Medical Microbiology
I certify that I have read this study and that in my opinion it
conforms to acceptable standards of scholarly presentation and is
fully adequate, in scope and quality, as a dissertation for the degree
of Doctor of Philosophy.
(-(nLbijdMl)
'Kenneth H. Rand, M.D., Ph.D.
Associate Professor of Immunology and
Medical Microbiology
I certify that I have read this study and that in my opinion it
conforms to acceptable standards of scholarly presentation and is
fully adequate, in scope and quality, as a dissertation for the degree
of Doctor of Philosophy.
Associate Professor of Immunology and
Medical Microbiology

I certify that I have read this study and that in my opinion it
conforms to acceptable standards of scholarly presentation and is
fully adequate, in scope and quality, as a dissertation for the degree
of Doctor of Philosophy.
//J/'Cot'3\uc^A c,
/
Nicholas Muzyczka, Ph.D. ^
Assistant Professor of Immunology and
Medical Microbiology
I certify that I have read this study and that in my opinion it
conforms to acceptable standards of scholarly presentation and is
fully adequate, in scope and quality, as a dissertation for the degree
of Doctor of Philosophy.
William K. Holloman, Ph.D.
Assistant Professor of Immunology and
Medical Microbiology
I certify that I have read this study and that in my opinion it
conforms to acceptable standards of scholarly presentation and is
fully adequate, in scope and quality, as a dissertation for the degree
of Doctor of Philosophy.
^Gary S. StejJj/'RTID.
Professor of Biochemistry and Molecular
Biology

This dissertation was submitted to the Graduate Faculty of the College
of Medicine and to the Graduate Council, and was accepted as partial



2
investigators to demonstrate virus in peripheral tissues during quiescent
periods have failed (Rustigan et al_., 1966; Baringer, 1975)..
HSV can be liberated from cultures of latently infected trigeminal
ganglia from unselected humans (Bastian et al_., 197.2.; Baringer., 1974).
Using tissue cocultivation with HSV susceptible cell lines or organotypic
cultures for periods of 10-45 days in vitro, the vagus, sacral and
superior cervical ganglia may also be shown to harbor virus in some
individuals (Baringer 1974, 1975; Marren et al_., 1978; Lonsdale et al.,
1979). EM studies show virions and cytopathology similar to that of HSV
in such cultures. The virus isolated may be identified as HSV on the
basis of both serologic (Bastian et al_., 1972; Baringer, 1975) and genetic
criteria (Lonsdale et al_., 1979). Similar culture techniques fail to
yield virus from the choroid plexus, trigeminal nerve root or cutaneous
tissues from known positive individuals. This argues that the ganglion
may be the sole site of latency.
Several parameters of latency can be envisioned from studies of
the virus yielded from explants. Serological evaluations of isolates
suggest that the virus remains phenotypically unaltered during latency;
reactivated virus may at some point spread to adjacent ganglia and
become latent in these; ganglia innervating remote peripheral sites may
infrequently become latent with seriologically distinct strains of the
virus; finally, both HSV type I and II may be latent and recur within the
same individual (Stevens and Cook, 1971; Baringer, 1975). Analysis of the
restriction endonuclease digestion patterns of their DMA and gel electro
phoresis patterns of isolates proteins confirms these observations
(Lonsdale et al., 1979; Buchman et al., 1978). Further, such studies
have shown that the isolates were unique to an individual unless they


13
Endonuclease Cleavage Map
In addition to the size variation in fragments spanning the L/S
joint, arising from inversion of the unique components, two other
classes of heterogenity are evident in cleavage maps of both HSV-1 and
HSV-2. One type of heterogenity maps solely to the unique regions and
appears to define viral strains. The differences within this class
arise from the presence or absence of specific endonuclease cleavage
sites and are found throughout the long and short components (Skare, 1975;
Hayward, 1975; Locker and Frenkel, 1979). In a study of eighty HSV-1
isolates, Buchman (1978) determined 19 out of 60 cleavage sites which
could be either present or absent; suggesting the possibility of at
19
least 2 viral strains within the population. At this level of analysis
the cleavage maps of HSV-1 and HSV-2 are quite distinct. This first
class of heterogenity is less frequent in HSV-2 (Roizman, 1979). The
loss or gain of a single cleavage site need not give rise to a new
clinically or immunologically recognizable viral strain. Thus the number
19
of immunologically identifiable strains need not approach 2 value.
The ability of HSV to remain latent within an individual with inter
mittent recurrences would provide a natural reservoir for the accumula
tion of nonlethal mutants within the population. The lower frequency of
heterogenity in HSV-2 may simply mirror a smaller reservoir within the
populace. The second class of heterogenity maps to the termini of the
long unique region (Wagner and Summers, 1978; Skare and Summer, 1977)
of HSV. These differences derive from the insertion of a 280bp segment
into the terminal reiteration of the L component in single or multiple
5
copies giving rise to a series of minor fragments with a distinct 2x10
dal ton increment in size (Wagner and Summers, 1978). Here again a
5
variance between viral strains may occur since a 3.3x10 dal ton


Because of these additional rearrangements the Smal and Aval maps of
only pRBl15 were determined.
53
12 3 4
Figure 18. Smal and Aval digests of pRBl04 and pRBll5
Lanes:
1. Smal digest of pRB115
2. Smal digest of pRBl04
3. Aval digest of pRBl15
4. Aval digest of pRB104


xml version 1.0 encoding UTF-8
REPORT xmlns http:www.fcla.edudlsmddaitss xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.fcla.edudlsmddaitssdaitssReport.xsd
INGEST IEID EQDRHBT8W_3AYZ13 INGEST_TIME 2014-10-07T21:12:19Z PACKAGE AA00025797_00001
AGREEMENT_INFO ACCOUNT UF PROJECT UFDC
FILES


51
Figure 17. Restriction Digests of pRBl15 and pRBl04
Lanes: 1.
2.
3.
4.
5.
6.
7.
8.
BamHl/Pstl/BstEll digest of pRB115
BamHl/Pstl/BstEl1 digest of pBR322
BamHl/Pstl digest of pRBl15
BamHl/Pstl digest of pBR322
Pstl digest of pRBl15
Pstl digest of pRB322
BamHl/HincII digest of pRBl15
BamHl/HincII digest of pRBl04


48
Figure 15. Sectioning of CsCl gradient
Using the lambda marker as a reference the gradients were divided
into five segments. Within gradients A, B and C fractions were pooled
and the total DNA per section isolated and nick translated. The findings
are summarized in Table 2. Approximately 25 ug of DNA from HEP2 mono-
layers infected with HSV-1 F at an m.o.l. of 1 and harvested at 20 hours
post infection was used as a positive control for this assay.


94
Price, RoW. and A.L. Notkins. 1977. Viral infections of the autonomic
nervous system and its target organs: pathogenetic mechanisms.
Medical Hypothesis. 3; 33-36.
Price, R.W. and J. Schmitz. 1978. Reactivation of latent herpes simplex
virus infection of the autonomic nervous system by postganglionic
neuroctomy. Infection and Immunity. Hh 523-533.
Puga, A., J.D. Rosenthal, H. Openshaw and A.L. Notkins. 1978. Herpes
simplex virus DNA and mRNA sequences in acutely and chronically
infected trigeminal ganglia of mice. Virology. 89: 102-111.
Rajcani, F. 1978. Experimental pathogenesis of non-lethal herpes
virus infection and the establishment of latency. Acta Virology.
22: 278-286.
Richardson, C.C. 1966. The 5'-terminal nucleotides of T-j bacteriophage
deoxyribonucleic acid. Journal of Molecular Biology. 1_5: 49-61.
Richardson, W. and H. Westphal. 1981. A cascade of adenovirus early
functions is required fro expression of adeno-associated virus.
Cell. 27: 131-140.
Rigby, P.W.S., M..Dieckmann, C. Rhodes and P. Berg. 1977. Labeling
deoxyribonucleic acid to high specific activity in vitro by nick
translation with DNA polymerase I. Journal of Molecular Biology.
113: 237-251.
Rixon, F. and J.B. Clements. 1982. Detailed structural analysis of two
spliced HSV-1 immediate-early mRNAs. Nucleic Acids Research. 10:
2241-2256.
Roizman, B. 1979. The structure and isomerization of herpes simplex
virus genome. Cell. 1_6: 481-494.
Roizman, B. and P. Spear. 1968. Preparation of herpes simplex virus
of high titer. Journal of Virology. 2_: 83-84.
Roizman, B., M. Kozak, W. Honess and G. Hayward. 1974. Regulation of
herpesvirus macromolecular synthesis: Evidence for multilevel
regulation of herpes simplex 1 RNA and protein synthesis. Cold
Spring Harbor Symp. Quant. Biology. 39: 687-702.
Rustigan, R., J.B. Smalow, M. Type, VJ.A. Gibson and E. Shindell. 1966.
Studies on latent infection of skin and oral mucosa in individuals
with recurrent herpes simplex. Journal of Investigative Derma
tology. 47: 218-221.
Schaffer, P., G. Aron, N. Biswal and M. Benyesh-Melnick. 1973. Temp
erature-sensitive mutants of herpes simplex virus type 1: Isolation
complementation and partial characterization. Virology 52^: 57-71.


LIST OF REFERENCES 88
BIOGRAPHICAL SKETCH 98
vi


This dissertation was submitted to the Graduate Faculty of the College
of Medicine and to the Graduate Council, and was accepted as partial


40
Figure 10. Viral DNA Controls
AAV


42
125
second is the hybridization of I-labeled ganglia cytoplasmic RNA to
restriction endonuclease digests of HSV-1 DMA bound to nitrocellulose.
Eleven of these patients were sero-positive for HSV. A positive serology
here is assessed as a compliment fixation titer of 1:8 or greater. The
trigeminal gnaglia from 9 such individuals were shown to contain HSV
DNA sequences. Viral DMA v/as not detected in the remaining two members
of this group (949 and 1033) but viral sequences were demonstrated in a
preparation of total cytoplasmic RNA from the ganglia of patient #949.
Only one of the sero-negative individuals (941) yielded ganglia con
taining latent HSV DNA and viral RNA was also detected in this case.
Figure 11 is an example of the autoradiographs obtained from
hybridization assays involving viral and ganglia DNA. The first lane
(A) is a photograph of the ethidium bromide stain of an EcoRl digest of
HSV-1 run as a marker. The second lane (B) is the autoradiograph of
labeled viral DNA hybridized to EcoRl digests of ganglia DNA. Lane C
is the photograph of the ethidium bromide stain of the Hindi 11 digested
control as it appeared after agarose gel electrophoresis. Lanes D and
E are the autoradiographs of labeled viral DNA bound to HindiII endo
nuclease digests of ganglia DNA. In the experimental reaction with
ganglia #228 DNA, extensive binding of the probe is evident in the
regions where the larger EcoRl fragments (MW 8.4-17.5x10^ dal.) of HSV
would migrate as determined by comparison to the controls. Binding is
also apparent where the EcoRl M (MW 2.7x10^ dal.) fragments are expected
to migrate. The viral probe did not hybridize in the region where the
EcoRl K(MW 3.5x10^ dal.) fragment should be found. EcoRl K maps at the
terminus of the short unique portion of the genome. The fragment may
display an altered migration here, or this portion of the viral genome
may not be represented in the ganglia. It is of interest to note that


10
sedimentation profiles in neutral sucrose gradients are indistinguishable
for DMA denatured with formamide versus alkali (Roizman, 1979). The
consequences of a randomly gapped genome in the absence of a mechanism
for repair are self evident. It can be speculated that abortive trans
cription due to an early truncation of the template could play a role in
viral latency or oncogenic transformation. It is noteworthy that no
repair mechanism has yet been clearly demonstrated.
Nucleotide Sequence Arrangement
If following denaturation, single strands of HSV DNA are permitted
*
to reanneal a high degree of self annealing can be observed by electron
microscopy. Among those strands that have folded back on themselves
three recognizable structures can be identified: a linear form with
extensive folding at one end, a single stranded circle with a heavily
folded region and a structure consisting of two single stranded circles
joined by a duplex region (Sheldrick and Berthelot, 1974). The forming
of two single stranded circles connected by a double stranded region is
indicative of the presence of two inverted repetitions of the termini
within the molecule. In a similar manner duplex circles may be formed
after treatment of hative HSV DNA with exonuclease III (Sheldrick and
Berthelot, 1974; Grafstrom et ajk, 1975). Such behavior is consistent
with the presence of natural repetitions at the single strand termini.
Thus the HSV chromosome is bracketed by direct repeats and consists of
two unique gene regions of differential length separated by two tandemly
arranged inverted repetitions of the termini. One implication of such a
model is that following concatameric replication of the molecule the
relative orientation of the two unique gene regions may be inverted
through recombination between the external and internal repetitions
(Thomas and MacHattie, 1967; Sheldrick and Berthelot 1974).


41
endonuclease fragments transferred from 0.5% agarose gels to nitrocellu
lose could be distinguished at a dilution factor of 106 of lpg of HSV
DNA in 1 ug of carrier DNA.
Hybridization of Ganglia Nucleic Acids to HSV DNA
The trigeminal ganglia of 18 patients have been assayed for HSV
sequences by DNA/DNA or DNA/RNA hybridization. None of the patients
manifested clinical evidence of recurrence at the time of death nor was
a history of recurrence noted (Table 1).
Table 1. Hybridization of trigeminal nucleic acids to HSV DNA.
Patient
CT titer
Viral DNA*
Viral RNA*
227
32
+
N.D.
228
32
+
N.D.
367
32
+
N.D.
951
64
+
+
883
64
+
N.D.
1072
32
+
N.D.
1034
32
+
N.D.
1082
128
+
N.D.
1089
128
+
N.D.
1033
64
-
-
949
32
-
+
941
<8
+
+
319
<8
-
N.D..
943
<8
-
-
947
<8
-
-
893
<8
-
N.D.
1143
<8
-
-
1110
<8
-
-
*(+) present
(-) absent
(N.D.) not determined
Briefly, the findings from the experimental approaches have been
listed in Table 1. The first approach entails the hybridization of a
32
nick translated P labeled viral DNA to either EcoRl or Hindi 11 endo
nuclease digests of ganglia DNA bound to nitrocellulose filters. The


43
A B C D
Ero PI 225 H n d III 1CB2 1 OB'/
Figure 11. Viral DNA hybridized to Ganglia DNA
ganglia of patient #227 also revealed an altered migration of the EcoRl
K fragment. Unfortunately the Hindi 11 digestion pattern does not permit
such an analysis. Patient #228 is representative of the type of findings
obtained when a major portion of the HSV genome was demonstrated in the
ganglia. In all such cases to date the endonuclease digestion pattern


84
of AAV. The second compares the beginning of the second coding region
in AAV and a portion of the E3 transcription complex. The second exam
ple actually lies within the potential coding sequence of the 14K E3
polypeptide of Ad (Hriss et al., 1980). Because the function of E3
region of Ad is obscure, it is difficult to evaluate these homologies.
There is no evidence to date which directly ascribes a specific regula
tory role during transcription to the terminal repetition in AAV nor has
a role been assigned to the E3 transcription products of Ad. Transcrip
tion of the E3 complex is nonessential for growth of Ad or AAV in vitro
(Richardson and VJestphal, 1981).
Two other short stretches of homology hying within the left half
of the Ad genome were also found. The first of these is the 26 bp
stretch in AAV (142-168) which is complimentary to a portion of the
inverted terminal repeat of Ad. The second is the AAV sequence sur
rounding the TATA box 31 bases upstream from the leftward most site of
initiation of transcription. It has a 17/19 base homology with a com
parable sequence upstream from the initiation of the Ad5 early region
1A transcripts. Lusby et al_ (1980) had previously reported these are
example regions with a potential role in transcriptional regulation.
Taken in total the data suggest a conservation through evolution of
regions of these genomes involved in transcriptional regulation.
As noted previously several lines of evidence suggest at least a
general similarity in the architecture of the AAV and HSV genomes. The
termini of both genomes contain a tandem array of natural and inverted
repeats. Also portions of these repeated regions may be inverted in
their relationship to unique regions of the genome as a natural conse
quence of viral DMA replication (Lusby et al., 1980; Mocarski et al.,


83
And lastly, the defective parvovirus (AAV) is absolutely dependent upon
coinfection with either an edenovirus or herpesvirus for its multiplica
tion.
In the absence of a coinfecting helper, AAV enters the cell where
its virion is uncoated within the nucleus. No detectable macromolecular
synthesis occurs at this time. The naked AAV DNA may then establish a
stable relationship with the host cell (Hoggan et a]_., 1966; Cheung et al.,
1980). Subsequent infection with a helper virus promotes the multiplica
tion of infectious AAV within these latent cells. Although the nature of
this stable relationship between AAV and the host cell is complex, it is
clear that at least a portion of the genome is covalently linked to
cellular DNA and in part copies of the entire genome are tandeomly
arrayed within this linkage with cellular DMA (Handa and Shimogo, 1977;
Cheung et al_., 1980). Our findings demonstrate a substantial sequence
homology within apparent regulatory regions between the defective genome
and those of its helpers. This is of particular interest since no bio
chemical relatedness has been previously demonstrated between these
viruses and the principal role the helper plays in this partnership is
the promoting of AAV macromolecular synthesis.
Although 6 to 12 base pair stretches of homology with AAV were
found randomly throughout the Ad genome these homologies were concen
trated largely within the terminal sequences of the AAV genome. The
strongest co-1inear homologies between regions of the two genomes which
at present appear to have no functional relatedness, involve the EcoRl
D and F fragments of Ad and the terminal repitition of AAV. Two examples
of sequence homology within these regions have been described. The
first of these analyzes the area surrounding the 3' end of the first
leader sequence in the E3 transcription complex of Ad and the termini


LIST OF REFERENCES
Anderson, K., J. Stringer, L. Holland and E. Wagner. 19791 Isolation
and localization of herpes simplex virus type I mRNA. Journal of
Virology. 30: 805-820.
Anderson, K., L. Holland, B. Gaylord and E. Wagner. 1980. Isolation and
transcription of mRNA encoded by a specific region of the Herpes
Simplex virus type I genome. Journal of Virology. _33: 749-759.
Atkinson, M.A., S. Barr and M.C. Timbury. 1978. The fine structure of
cells infected with termperature sensitive mutants of herpes simplex
virus type 2. Journal of General Virology. 2: 517-536.
Bachenheimer, S. and B. Roizman. 1972. Ribonucleic acid synthesis in
cells infected with herpes simplex virus. Journal of Virology.
10: 875-879.
Baringer, J.R. 1974. Recovery of herpes simplex virus from human
sacral ganglions. New England Journal of Medicine. 291: 828-830.
Baringer, J.R. 1975. Herpes simplex virus infection of nervous tissue
in animals and man. Progress in Medical Virology. 20: 1-26.
Baringer, J.R. and P. Sworeland. 1973. Recovery of herpes simplex
virus from human trigeminal ganglions. New England Journal of
Medicine. 288: 546-650.
Bastian, R.O., A.S. Rabson, C.L. Yee and T.S. Tralka. 1972. Herpes
hominis isolation from human trigeminal ganglion. Science. 178:
305-307.
Becker, Y., H. Dym and I. Sarov. 1968. Herpes Simplex virus DNA.
Virology. 36: 184-192.
Berns, K.I. and W. Hauswirth. 1978. Parvovirus DNA structure and
replication. Replication of Mammalian Parvoviruses. Cold Spring
Harbor Laboratory Press, pp. 13-32.
Biswal, N., B. Murray and M. Benyesh-Melnick. 1974. Ribonucleotides in
newly synthesized DNA of herpes simplex virus. Virology. 61:
87-99.
Brown, S.M., J.H. Subak-Sharpe, K.G. Warren, Z. Wroblewska, and H.
Koprowski. 1979. Detection of uninducible herpes simplex virus
genomes latnet in human ganglia explants. Proceedings of the
National Academy of Science, U.S.A. 76: 2364-2368.
88


93
Morse, L., L. Pereira, B. Roizman, and P. Schaffer. 1977. Anatomy of
HSV DNA. VI Mapping of viral genes by analysis of polypeptides
and functions specified by HSV-1 X HSV-2 recombinants. Journal of
Virology. 26; 389-410.
Moss, B., A. Gershowitz, J. Stringer, L. Holland, and E. Wagner. 1977.
5'-Terminal and internal methylated nucleosides in herpes simplex
virus type 1 mRNA. Journal of Virology. 23; 234-239.
Naragi, S., G.G. Jackson and Q.M. Jonasson. 1976. Viremia with herpes
simplex type-1 in adults. Annals of Internal Medicine. 85; 165-
169.
Nesburn, A, M. Cook and J. Stevens. 1976. Latent herpes simplex virus.
Isolation from rabbit trigeminal ganglia between episodes of recur
rent ocular infection. Archives of Ophthalmology. 88: 412-418.
Nii, S., C. Morgan and H.M. Rose. 1968. Electron microscopy of herpes
simplex virus II: sequence of development. Journal of Virology.
2: 517-536.
Pater, M.M., R.W. Hyman and F. Rapp 1976 Isolation of herpes simplex
virus DNA from the "Hirt Supernatant". Virology 75; 481-483.
Pazin, G., M. Ho and P. Jannetta. 1978. Reactivation of herpes simplex
virus after decompression of the trigeminal nerve root. Journal
of Infectious Diseases. 138: 405-409.
Pereira, L., M. Wolff, M. Fenwick and B Roizman. 1977. Regulation of
herpesvirus macromolecular synthesis V. Properties of a polypep
tides made in HSV-1 and HSV-2 infected cells. Virology. 77; 733-
749.
Pignatti, P.F., E. Cassai, G. Memequzzi, N. Chenciner and G. Milanesi.
1979. Herpes simplex virus DMA isolation from infected cells with
a novel procedure. Virology. 93; 260-264.
Plummer, G., J. Wagner, A. Phuargsalo and C. Goodheart. 1970. Type 1
and Type 2 herpes simplex viruses: serological and biological
differences. Journal of Virology. 5; 51-59.
Post, L.E., A.J. Conley, E.S. Mocarski and B. Roizman. 1980. Cloning
of the reiterated and non-reiterated herpes simplex virus 1
sequences as BamHl fragments. Proceedings of the National Academy
of Science, U.S.A. 11_: 4201-4205.
Post, L., S. Mackem, and B. Roizman. 1981. Regulation of a genes of
herpes simplex virus: expression of chimeric genes produced by
fusion of thymidine kinase with y gene promoters. Cell. 24; 555-
565.
Preston, V., A. Davison, H Marsden, M. Timbury, J. Subak-Sharpe, and N.
Wilkie. 1978. Recombinants between Herpes simplex virus types
1 and 2: Analysis of genome structures and expression of immediate
early polypeptides. Journal of Virology. 28: 499-571.


57
A va I
AAV 0 5 10_ 20 40 80 5 10 20
tat
l
Figure 20. Aval Partial Digestion Mapping of pRB115


79
of three sero-positive patients assayed and one of the five sero-negative
patients. The medical history of the single sero-negative patient, #941,
has been discussed along with our findings from DNA/DNA hybridizations.
From the mapping of those RNA transcripts observed it is clear that the
regions of the genome most frequently encountered to date are those con
taining sequences in the immediate early and early mRNA species of HSV-1
(Clements et aj_., 1979; Roizman, 1979).
Because of the frequency with which transcripts mapping to the region
of the L/S junction were encountered, the cytoplasmic RNA from 9 indivi
duals was used as a probe in hybridizations against endonuclease digests
of the clone pRBl15. Eight of these patients were sero-positive. None
of the patients contained RNA which would hybridize with pRBl15. This
result was curious in view of the fact that RNA was present which would
hybridize to the larger EcoRl K fragment present in EcoRl digests of the
total HSV genome. It can be argued that the two probes allowed the
recognition of a subset of transcripts associated with latency, namely,
a set of transcripts mapping to a region of the EcoRl K fragment not
common to the BamHl P fragment. The region running downstream from the
right end of BamHl P to the right terminus of EcoRl K is approxiamtely
1.8 kb in size (see Figure 13).
Using the tsB2 mutant Holland et al_ (1979) has reported finding no
mRNA species of greater than 3 kb in this region. This temperature sen
sitive mutant is one of a group of ts mutants mapping within the sequences
of the short reiterated region which code for ICP4 (Schaffer et aj_., 1973).
The viral gene function coding for transition from immediate early to
early polypeptide synthesis also maps to this region and is thought to be
a function of ICP4 (Preston et al_., 1978). Studies of protein synthesis


Label
<
1. Digest
2. Gel Electrophoresis
V
V
1. Digest
2. Gel Electrophores
Agarose
gel
1 Denature
in situ
Ni troce 11ulose
Nitrocellulose
filter
1. Denature
in situ
Agarose
gel
filter
2. Transfer
>
2. Transfer
V
Autoradiograph
Figure 22. Cross Hybridization Strategy
Y
Autoradiograph


14
increment in size is observed between minor fragments in HSV-1 (F) DNA.
In addition, while the minor fragments from the termini of HSV-1 differ
by 255 base pairs, those arising from the L/S junction differ by only
125 base pairs (Locker and Frenkel, 1979). Subsequent work with HSV-1
(F) has directly linked the tandem addition through recombination of the
501 base pair 'a' segment to the L termini with the generation of those
minor bands (Mocarski et al_., 1980). Size variability has also been
reported for endonuclease fragments containing the c, c1 repeat regions
(Lonsdale et al_., 1979). This heterogenity can again be traced to the
copy number of a 23 base pair repeat present within the c regions. The
reiteration can occur in a variable copy number between viral strains,
between clones of same viral strain and lastly between the c and c1
reiterations of the same strain (Watson and Van de Woude, 1982; Rixon
and Clements, 1982).
Transcription
Once a permissive host cell is infected, viral replication rapidly
follows in a well-ordered seuqence of events. With uncoating, transcrip
tion of defined regions of the viral genome proceeds in a highly regu
lated temporal manner (Clements ejt afl_., 1977; Jones and Roizman, 1979).
Transcription of host cell specific RNA (C-RNA) continues at a reduced
rate, but synthesis and processing of cellular mRNA is rapidly inhibited,
as is the appearance of mature cellular rRNA. This inhibition appears
to be coded for by the earliest viral transcripts (Wagner and Roizman,
1969; Kaplan, 1973). For the most part, the reduction in the rate at
which mature rRNA appears is brought about by the interference of
infection with its maturation; synthesis of the 45 s RNA precursor con
tinues at roughly the same level as that of C-RNA (Wagner and Roizman,


C PM
47
Figure 14. Fractionation of Total Ganglia Nucleic Acid
C PM


6
such cells are the product of the original infection or remnants of a
recent recurrence. The mass of this evidence argues that the ganglionic
neuron serves as the site of viral latency. The findings also suggest
that latency is not a totally "statis" event but is "dynamic" to the
extent that, with even long periods of clinical quiescence, a few neurons
continue to act as infectious centers within the ganglia.
Although recurrence appears to be a natural phenomenon in rabbits,
it can also be artificially induced. Mechanical stimulation is usually
achieved through neurosurgical manipulation of the trigeminal nerve
root. Following such treatment, virus can be isolated from the tears of
80% of the animals within 48 hours (Nesburn ejt al_., 1976). These
findings closely parallel the observations made by Carton and Kilborne
(1959) and Pazin et aj_ (1978) in man.
In situ hybridization of HSV specific complementary RNA probes to
latent murine ganglia genetic material show viral nucleic acid sequences
in a small minority of the neurons (Cook ejt al_., 1974; Zur Hausen and
Schulte-Holthausen, 1975). Analysis of hybridization experiments by
Puga ejt aj_ (1978) demonstrates approximately 0.1 genome equivalents of
HSV DMA per cell in such ganglia. The quantity of viral RNA fell below
the limits of detection during the chronic period. The techniques
employed in this work were sensitive enough to detect 1 genome equiva
lent of viral RNA per 2000 cells but at this sensitivity as many as 400
RNA copies per cell would go undetected.
Finally, using a nick translated H-labeled HSV DMA probe, viral
specific RNA sequences can be demonstrated in human ganglia sections
with in situ hybridization (Galloway ejt a_T_^, 1979). Such sequences may
be found in the sacral, thoracic and lumbar ganglia, confirming previous


44
revealed was consistent with that of HSV-1. In several of the ganglia
only part of the HSV genome could be detected; whether the remainder of
the genome is absent or those portions are present in too few copies for
the assay to reveal is as yet uncertain.
] pc
Figure 12 is an autoradiograph of I-labeled ganglia cytoplasmic
RNA hybridized to an EcoRl endonuclease digest of HSV-1 F strain DMA
bound to nitrocellulose paper. To the left of the autoradiograph is a
photograph of the cleaved HSV stained with ethidium bromide after agarose
gel electrophoresis and prior to transfer to nitrocellulose. Clearly
not all regions of the viral genome are represented in the ganglia cyto
plasmic RNA. This would not be the case if the ganglia were actively
supporting a lytic infection as shown in the HSV control. Further,
those fragments present are not uniformly represented in the RNA. For
instance, transcripts of EcoRl K appear most abundant in the RNA of
patient #951. In this manner the viral RNA transcripts found in several
ganglia have been mapped on the HSV-1 genome. Figure 13 summarizes this
data.
CsCl Enrichment
To determine whether HSV DNA could be isolated in an episomal form
free from host chromatin total ganglia nucleic acid was fractionated on
CsCl density gradients. As a control human thoracic ganglia DNA was
3
kinased and run in a parallel gradient. H labeled lambda DNA was run
as a marker in all gradients and 50 ug of sonicated calf thymus DNA was
added to each as a carrier. The gradient profiles are shown in Figure
14.


5
Similar observations have been made in HSV latently infected rabbits
In this model, viral spread may be clearly followed from the site of
inoculation to the peripheral nervous system and then to the central
nervous system in individuals where meningitis and encephalitis ensue.
At each level of spread the infection is first manifest in neurons and
then adjacent supportive cells, such as Schwann cells or satellite cells
(Goodpasture 1929; Baringer et al_., 1974). The rate of viral spread
within the nerve trunk approaches that of retrograde transport of pro
teins within the ganglia (Stevens 1975). The kinetics of viral infection
and the presence of virus in intra-axonal vesicles has prompted investi
gators to propose that intra-axonal transport is the principal mode of
viral spread (Cook and Stevens, 1973; Kristensson et al_., 1974; Baringer
1975). Seventy percent of the trigeminal ganglia in latent rabbits yield
virus upon explant while cultures of the conjunctiva, lacrimal gland,
cornea, iris, fifth cervical nerve and brain tissue are negative. Immuno
flourescent antibody studies on serial sections of rabbit trigeminal
ganglia show 1/500 neurons infected with HSV during the first week
following corneal inoculation. This ratio of immunopositive to immuno-
negative neurons falls to approximately 1/2000 to 1/5000 by 20 weeks
following inoculation. At this later date the yield of infectious virus
from explanted organ cultures is still on the order of 90% (Racjani 1978)
These findings closely parallel the observations of Baringer and
Sworeland (1973) in man. Lastly, single abnormal ganglion cells
surrounded by a cuff of mononuclear cells may be seen infrequently as
late as 11 months post infection. The nuclei of such cells contain HSV
particles and their cytoplasm is highly vacolated with virions contained
within intra-axonal vesicles (Baringer 1974). It is unclear whether


70
Ad2 sequence. Figure 29 compares a 26 nucleotide sequence found just
outside the inverted terminal repeat of AAV starting at base pair 144
to a similar region in the terminal repeat of Ad2. There is an 87%
homology between the two regions.
AAV TCAGCCAGGTACATGGAGCTGGTCGGGTGGGTCGTGGACAAGGGGATTACCTCGGAG
I I I I I II II I II I I I I 11 II I I I I I I I I II I I I 11 I
Ad2 GCA CCAG TTTTTGGCGCTGGGTGGGTAGCTTGTAGCTGAGGCGGTTGCC GGAG
i
T
Figure 28. AAV Coding Region 3 (Hriss et al., 1980)
AAV
Ad2
Figure 29. Ad2 Terminal Repetition (Heriss et al_., 1980)
Although cross hybridization assays failed to reveal any homology
between HSV and AAV three lines of evidence suggest at least a general
similarity in the architecture of their genomes. The termini of both
genomes contain a tandem array of natural and inverted repeats. Portions
of these repeat regions may be flipped or inverted in their relation to
unique regions of the genomes and this flip-flopping appears to be a
natural consequence of viral DNA replication. And lastly there is an
inherent ability within the replication cycle for maintaining identity
between the termini through some mechanism of gene conversion. The
reiterated sequences in both viruses probably contain the origin of
replication and at least some early regulatory function. A comparison
was made between the terminal reiterated sequences of AAV and the pub
lished sequence for the L/S junction of HSV-1, which contains the HSV
CTGGAGGGGTGGAGTCGTGACGTGA
II I I I I I I I I I I I I I I II I I
ATGAGGGGGTGGAGTTGTGACGTGG
I
T
168
70
1306
5305


16
thus may mirror the loss of proteins specifically required by the cell's
replicative machinery (Roizman et al_., 1974). The peak rate of synthesis
for the earliest viral polypeptides is reached between 2 and 4 hours post
infection. The chief function of these proteins is to govern the change
over from cellular to viral macromolecular synthesis. There is a strin
gent requirement for these immediate early polypeptides (a-proteins)
prior to the production of a second and larger group of proteins, the
early polypeptides (e-proteins), which appear 5 to 7 hours post infection.
These e-polypeptides augment the replication of the HSV genome. They
also govern argradual reduction in a-protein synthesis and pave the way
for production of the late structural proteins (y-polypeptides) of the
HSV virion (Honess and Watson, 1974; Pereira et al., 1977).
Viral mRNA is transcribed within the nucleus (Wagner and Roizman,
1969), is polyadenylated at its 3' end (Bachenheimer and Roizman, 1972;
Silverstein et al_., 1976) and carries a 5' cap (Moss et al_., 1977).
Prior to viral DNA synthesis two classes of viral mRNA, the immediate
early and early transcripts, are abundant and are transcribed at least
in part by host cell RNA polymerase II (Jones and Roizman, 1979; Clements
et al_., 1977). Translation of these two classes of transcripts gives
rise to the aforementioned a and 3 polypeptides, respectively. The
immediate early mRNA represents approximately 12% of genome and is made
in the absence of previous viral polypeptide synthesis. It can be iso
lated in abundance from the cytoplasm of infected cells treated with
cyclohexamide (Jones and Roizman, 1979). These transcripts range from
1,500-5,500 nucleotides in size and map preferentially to the terminally
reiterated portions of the genome (Clements et al_., 1977, Holland et al.,
1979). The second class of mRNA which is abundant before viral DNA


28
Smaller cleavage fragments viere extracted from 6% acrylamide gels.,
following the method devised by Maxam and Gilbert (1980). Gel slices
were minced and suspended in a solution of 500 mM ammonium acetate,
10 mM magnesium acetate, 1 mM EDTA, 0.1% (wt./vol.) sodium dodecyl
sulfate and 10 yg/ml yeast tRNA. This slurry was incubated at 37C for
10 hours and then the residual acrylamide was removed by filtration
through glass wool. The filtrate was phenol extracted once, ether
extracted once and then the extracted DMA was concentrated by ethanol
precipitation.
Bulk purification of cleavage fragments was done by affinity chroma
tography (Bnemann and Muller, 1978). Generally 200 yg of digested DNA
were loaded onto a malachite gree substituted bisacrylamide gel
(Beohringer Mannheim Biochemicals, Indianapolis, IN) column in the pre
sence of 10 mM sodium phosphate and 1 mM EDTA, pH 6.0. The fragments were
eluted through a 0t2 molar gradient of sodium perchlorate in the same
phosphate buffer (see Figure 6). The sodium perchlorate was removed
from the eluate by dialysis against 10 mM Tris, 1 mM EDTA; pH 7.0. The
DNA was the concentrate from the dialyzed eluate by ethanol precipitation.
Mapping Approach
Endonuclease digestion maps for pRB104 and RBI 15 were determined
by tv/o methods: double digestion mapping and partial digestion mapping.
Where applicable, new sites were mapped relative to known sites in
reactions where two or more digestions were done to completion before
gel electrophoresis of the fragments. All reactions and subsequent gel
fractionations were carried out as previously discussed. In this manner
the digestion sites for BamHl, BstEll, Hindi, Alul, and Taql were con
firmed and ma-ped relative to one another., The size of the endonuclease


74
this first half of this array. The second half of the array is con
served in 68 to 70% of the sequences.
The ends of the HSV sequences displayed in Figure 32 are separated
by 20 nucleotides. This boundary is formed in part by a twelve base
pair inverted repeat.
As one reads downstream from the end of the preceeding sequence
through the A reiteration of HSV, one comes to the direct repeat
defining its far terminus. Again this region can be aligned with the
terminal AAV sequences. About 63% of the sequence of the A domain is
conserved and.the short palindrome GCCCGGGC is retained in full within
both genomes (see Figure 33). The sequence ACTCC is found 51 base pairs
downstream from this short palindrome in both AAV and HSV, followed by
the sequence GGTTCCT. In HSV these two short sequences are contiguous
while in AAV they are separated by 10 base pairs.
A C
AAV CACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCAAAG 54
I I I I I I I I I I I I I I I I I I I I II II I I I I I I
HSV CCCGCCTTTTTTGCGCGC CGC CCCGCCCGCGGGGGGCCCGGGCTGCC ,oc
DR1 685
Figure 33. Homology between the terminus of the short unique region in
HSV-1 and the terminus of AAV (Mocarski et al., 1980)


95
Scott, T. and T. Tokumaru. 1964. Herpesvirus hominis (virus of herpes
simplex). Bacteriological Reviews. 28: 458-471.
Sheldrick, P. and N. Berthelot. 1974. Inverted repetitions in the
chromosome of herpes simplex virus. Cold Spring Harbor Symposium
Quantitative Biology. 39: 667-678.
Silverstein, S., R. Millette, P. Jones and R. Roizman. 1976. RNA
synthesis in cells infected with herpes simplex virus. XII Sequence
simplexity and properties of RMA differing in extent of adenylation.
Journal of Virology. 15: 977-991.
Skare, J,, W.P. Summers and W.C. Summers. 1975. Structure and function
of herpes virus genomes I. Comparison of five HSV-1 and two HSV-2
strains of cleavage of their DMA with EcoRl restriction endonuclease.
Journal of Virology. J_5: 726-732.
Skare, J. and W. Summers. 1977. Structure and function of herpesvirus
genomes II. EcoRl, Xbal and Hindlll endonuclease cleavage sites
on herpes simplex virus type 1 DMA. Virology. 76: 581-595.
Smith, H. and M.L. Birnstiel. 1976. A simple method of DMA restriction
site mapping. Nucleic Acid Research. 3: 2387-2398.
Southern, E.M. 1975. Detection of specific sequences among DMA frag
ments separated by gel electrophoresis. Journal of Molecular
Biology. 98: 503-517.
Spear, P. and B. Roizman. 1972. Proteins specified by herpes simplex
viruses. V. Purification and structural proteins of the herpes
virions. Journal of Virology. 9_: 431-439.
Stevens, J.G. 1975. Latent herpes simplex virus and the nervous
system. Current Topics in Microbiology and Immunology. 70: 31-50.
Stevens, J.G. and M.L. Cook. 1972. Latent herpes simplex virus in
spinal ganglia of mice. Science. 173: 843-845.
Stevens, J.G. and M.L. Cook. 1972. Latent herpes simplex virus from
trigeminal ganglia of rabbits with recurrent eye infections.
Mature New Biology. 235: 216-217.
Subak-Sharpe, J., S. Brown, D. Ritchie, M. Timbury, J. Macnab, H. Marsden
and J. Hay. 1974. Genetic and biochemical studies with herpes
viruses. Cold Spring Harbor Symposia on Quantitative Biology.
39: 717-729.
Tereba, A. and B.J. McCarthy. 1973. Hybridization of ^I-labeled
ribonucleic acid. Biochemistry. J_2: 4675-4679.
Thomas, C.A. and L.A. MacHattie. 1967. The anatomy of viral DMA mole
cules. Annual Reviews of Biochemisty. 485.


60
Cross Hybridization Experiments
The close biological relationship between AAV, Ad and HSV suggests
the possibility of partial genome homology; however previous attempts
have failed to demonstrate detectable homology. Using the more sensi-
tive technique of cross hybridization of P-labeled AAV, HSV or Ad
probes to restriction endonuclease digests of the reciprocal genome
immobilized on nitrocellulose filters, we were able to determine limited
regions of homology. Figure 22 outlines a typical cross hybridization
assay and our findings to date from the hybridization assays are sum
marized in Table 5.
Table 5. Cross Hybridization Analysis
BLOT
AAV-2 Ad2 Ad5 SV40
HSV-1 Hep2 HelaM Hela
AAV-2 +
Ad2 +
Ad5 +
SV40
HSV-1
+ +
+ +
+ +
(+) homology
(-) no homology
To determine the level of nonspecific hybridization that could occur in
our assays, such as that which might arise from long stretches of high
G+C content, hybridizations were done with the DNA from the Hep2, HelaM
and Hela suspension cell lines. The Ad5, Ad2, and AAV2 virus stocks
were grown in Hela suspension cultures. The HSV-1 virus was grown in
either Hep2 or HelaM monolayers. Thus these controls would also allow
us to detect any cellular DNA which might be copurifying with viral DNA
during its preparation. Our findings were consistantly negative although
the controls were hybridized under several degrees of stringency as were


26
The Hirt supernatant was brought to 0.5 M NaCI and polyethylenegycol
(PEG) 6000 was added to a final concentration of 5%. The plasmid DNA
was permitted to precipitate overnight at 4C. The resulting pellet was
isolated by centrifugation and resuspended in 50 mM Tris, pH 7.6 and 10
mM EDTA; excess PEG was removed by chloroform-phenol extraction and the
nucleic acids were ethanol precipitated in 250 mM sodium acetate, pH 4.7,
at -20Co Residual RNA in the resultant pellet was degraded by RNase A
treatment and form I plasmid DNA was subsequently isolated by ultracen
trifugation on CsCl-ethidium bromide isopycnic gradients (LePecq, 1970).
r
DMA Restriction
Viral DNA (3 yg) was digested with either EcoRl, HindiII or Hpal
endonuclease in a 50 yl reaction mixture at 37C for 2 hours; 1 unit of
enzyme per yg DNA was added per hour. The enzymes were obtained from
Bethesda Research Laboratories, Inc., Rockville, MD. Reaction buffers
used were in accordance with the instructions provided by the supplier.
Ganglionic DNA was digested with EcoRl or Hindlll in a 100 yl reaction
under the above conditions.
To develop a fine structure restriction of the BamHl fragment
spanning the joint region of HSV-1 DNA, cloned viral DNA was digested by
BamHl, Alul, BstEll, TaqI, Hindi, Aval and Smal endonucleases. All
cleavage reactions were conducted in accordance with the instructions
provided by Bethesda Research Laboratories, Inc. BstEll and TaqI endo
nuclease digestions were carried out at 60C: all other digestion reac
tions were done at 37C.
Gel Electrophoresis
Restriction enzyme digestions were phenol extracted and then electro-
phoresed on 0.5% or 1% agarose vertical slab gels at 2 V/cm. Viral DNA


80
during temperature shift experiments on this group of mutants suggest
that ICP4 is autoregulated (Schaffer et al_., 1973). The 5' terminus of
IEmRNA-3 which is believed to code for ICP4 lies within the 1.8 kb region
described above (Watson and Van de Woude, 1982; Clements et al_., 1979;
Anderson et al_., 1980). Transcription is normally in a leftward direction
proceeding into the region of the BamHl P fragment at the joint (Maxam
and Gilbert, 1980).
Finally, two ts mutants of ICP4, tsD and tsK, have been assayed for
their ability to establish latency in mice; tsK fails to establish
latency in mice while tsD will (Stevens and Cook, 1971). Both mutants
block viral DNA synthesis. Thus two ts mutants within a single gene
within this region can distinguish between viral functions permitting
subsequent DNA replication and the establishment of latency. In light
of the above findings further evaluation of transcription through this
region during latency is warranted, especially in animal models.
Another portion of the genome highlighted by the transcription
studies is the region mapping from about 0.08 to 0.65, especially the
area from 0.1 to 0.3 (see Figure 13). The bulk of the early viral pro
teins genes are within these domains (Schaffer et al_., 1973). The genes
for the viral thymidine kinase and the viral DNA polymerase of both HSV-1
and HSV-2 map within the region 0.27-0.43 (Clements et al_., 1977; Schaffer
et al_., 1973). Spear and Roizman (1972) have reported a correlation be
tween viral induced oncogenic transformation and ICP8 within the region
from 0.30 0.45 map units. Stevens and Cook (1971) have demonstrated
a latency negative phenotype for the mutants tsA, tsS, tsT, and tsl; all
of which map within the region 0.1 to 0.6. It is noteworthy that in
subsequent mappings of RNA transcripts by in situ hybridization,
Galloway and McDougall (1981) have consistantly found the region 0.1 to


30
cleavage fragments was determined by comparison to known digestion
standards of adeno-associated virus (AAV) DNA, lamda phage DNA, or
pBR322 DNA, which were run in parallel wells on the ;same gels (Berns and
Hauswirth, 1978; Cheung et al_., 1980). The numerous 'cleavage products
arising from restriction by either Aval or Smal were oriented relative to
the Alul and Taql sites through partial digestion reactions in the manner
described by Smith and Birnstiel (1976). End labeled Alul or Taql frag
ments were isolated and partially digested in the presence of 1 unit/yg
DNA of Aval or Smal endonuclease under standard conditions. Aliquotes
were withdrawn from cleavage mixture and prepared for gel electrophoresis
after 5 minutes, 10 minutes, 20 minutes, 40 minutes and 80 minutes of
reaction time.
Nick Translation
1 yg HSV-1 F strain DNA was incubated.for 45 minutes at 15C in a
50 yl reaction mixture containing 30 mfidGTP, 30 mMdTTP, 30 mMdATP (sigma),
100 yCi [a ^P]dCTP (400 Ci/m mole; New England Nuclear), 5 mM MgC^, 4
units DNA-polymerase I, 10 mM p-mercaptoethanol, 0.05 mg/ml bovine serum
albumin, 50 mM Tris, pH 7.8, and 4.5 units of DNA-polymerase I (Boehringer
Mannheim Biochemicals, Indianapolis, IN). The reaction was stopped by
the addition of 100 yl of a solution containing 100 mM EDTA, 100 yg
sonicated calf thymus DNA and 10 mM Tris, pH 7.8. The mixture was
32
extracted with phenol and ether. Finally free [a P]dCTP was separated
from labeled DMA by passage through a Sephadex G75 column (IcmxlOcm).
This procedure usually yielded a viral probe with a specific activity of
O
approximately 3x10 cpm/yg. Cellular DNA was labeled in the same manner
except that the reaction volume was increased to 100 yl and 10 yg DNA
was labeled per reaction in the presence of 0.5-2 ng activated DNase I.


TABLE OF CONTENTS
SECTION PAGE
ACKNOWLEDGEMENTS iv
ABSTRACT . vi i
INTRODUCTION 1
Molecular Biology of HSV 7
Genome Size and Composition 7
Nucleotide Sequence Arrangement 10
Endonuclease Cleavage Map 13
Transcription 14
MATERIALS AND METHODS ..... 20
Purification of Ganglion Cell DNA and RNA 20
Viral DNA Purification 20
Preparation of Cloned DNA ...... 22
DMA Restriction 26
Gel Electrophoresis 26
Isolation of Endonuclease Cleavage Products 27
Mapping Approach 28
Nick Translation 30
Iodination of Cytoplasmic RNA 31
5' End Labeling Reactions 31
Southern Blots 32
Hybridization Reaction 33
RESULTS 35
Experimental Approach 35
Controls 37
Hybridization of Ganglia Nucleic Acids to HSV DNA 41
CsCl Enrichment Studies 44
Mapping the L/S junction of HSV-1 F strain 49
HYBRIDIZATIONS 59
Hybridization of ganglia RNA to the L/S junction 59
Cross Hybridization Experiments 60
DISCUSSION
75


46
O 10 20 30 40 50 60 70 80 90 100
I 1 1 1 1 1 1 1 H 1 1
EcoRI
949
-H F+F
D G N F MO LA
H F
H F
K, H K2
II
951
I d H H F
d I 1I h
941 1
I -I 1I F
Hpal M H l -u
H 1 i FF-fF
LNKQRSUJ M IV B H F E T0XP1_2 D G
941 IF+-H Ii
> HI F
Figure 13. Mapping HSV specific RMA found in the Ganglia


89
Buchman, T.G., B. Roizman, G. Adams and B.H. Storer. 1978. Restriction
endonuclease fingerprinting of herpes simplex virus DNA: a novel
epidemiological tool applied to a nosocomial outbreak. Journal
of Infectious Diseases. 138: 488-498.
Bnemann, H. and W. Mller. 1978. Base specific fractionation of double
stranded DNA: affinity chromatography on a novel type of absorbant.
Nucleic Acids Research. 5_: 1059-1074.
Carton, C.A. and E.D. Kilborne. 1952. Activation of latent herpes sim
plex by trigeminal sensory-root section. New England Journal of
Medicine. 246: 172-175.
Centifanto-Fitzgerald, Y., E. Varnell and H. Kaufman. 1932. Initial
herpes simplex virus type 1 infection prevents ganglionic super
infection by other strains. Infection and Immunity. 35_: 1125-
1132.
Centifanto-Fitzgerald, Y., T. Yamaguchi, H. Kaufman, M. Tognon and B.
Roizman. 1982. Ocular disease pattern induced by herpes simplex
virus is genetically determined by a specific region of viral DNA.
Journal of Experimental Medicine. 155: 475-489.
Cheung, A., D. Hoggan, W. Hausv/irth and K.I. Berns. 1980. Integration
of the adeno-associated virus genome into cellular DNA in latently
infected human Detroit 6 cells. Journal of Virology. 33: 730-748.
Clements, J., R. Watson, and N. Wilkie. 1977. Temporal regulation of
herpes simplex virus type I transcription: location of transcripts
on the viral genome. Cell. J_2: 275-285.
Clements, J.D., T. McLaughlan and D.S. McGeoch. 1979. Orientation of
herpes simplex virus type 1 immediate early mRNAs. Nuclear Acid
Research. 7_: 77-93.
Comerford, S. 1971. Iodination of Nucleic Acids in vitro. Biochemistry.
TO: 1993-1995.
Cook, M.L., V.B. Bastone and J.G. Stevens. 1974. Evidence that neurons
harbor latent herpes simplex virus. Infection and Immunology. 9:
946-951.
Cook, M.L. and J.G. Stevens. 1973. Pathogenesis of herpetic neuritis
and ganglionitis in mice: evidence for intra-axonal transport of
infection. Infection and Immunity. 7_: 272-288.
Cook, M.L. and J.G. Stevens. 1976. Latent Herpetic infections following
experimental viremia. Journal of General Virology. 31_: 75-80.
Daniels, C.A., S.G. LeGoff, and A.L. Notkins. 1975. Shedding of
infectious virus-antibody complexes from vesticular lesions of
patients with recurrent herpes labial is. Lancet. 2: 524-528.


81
0.3 represented in ganglia; other regions including the L/S junction were
variably demonstrated. In similar studies of HSV RNA in cervical car
cinoma cells sequences spanning map positions 0.07 to 0.4, 0.58 to 0.63,
0.82 to 0.85 and 0.94 to 0.96 were represented (McDougall et a]_., 1982).
These findings are noteworthy because of the collinearity of the HSV-1
and HSV-2 transcription maps. Taken in total, the studies are supportive
of our findings and suggest that a subset of the immediate early and
early genes are involved in the establishment and maintenance of latency.
32
The binding of P-labeled HSV DMA to restriction endonuclease
1 25
digests of ganglia DNA, or conversely I-labeled ganglia RNA to HSV
DMA has permitted several questions to be considered. Those regions of
the viral genome which are represented have been determined by simply
noting the presence or absence of given viral DNA bands on the autoradio
graph. Although it is reasonable to expect the entire genome must be
present as a single unit to give rise to recurrence, some cells within
the population may carry only portions of the viral genome. It is there
fore not surprising to find an apparent unequal molar representation of
viral fragments. This is demonstrated by our findings and suggested by
previous work on viral thymidine kinase in ganglia (Yamamoto £t al_., 1977).
Finally, the question of whether latent viral DNA is covalently
intefrated into cellular chromosomes was approached. Any digestion frag
ments which are covalently linked to cellular DNA will migrate in the
agarose gels with an apparent increase in molecular weight as a result
of the added cellular component. Digests of viral DNA present as a free
circular episome would also have an altered migration for the terminal
fragments. DNA sequestered in immature nucleocapsids would give rise to
banding patterns similar to that of wild type viral DNA. In interpreting
such data it should be noted that most virus isolates from ganglia


ACKNOWLEDGEMENTS
I would like to acknowledge the efforts of Tess Korhnak and Dr.
Vishwanath Suryanarayanan with whom I've had the good fortune to be
associated during these studies. I would also like to take this oppor
tunity to express my appreciation to the members of my advisory committee,
especially Dr. Kenneth I. Berns. A warm thanks is extended to Drs. Bill
Hauswirth, Bill Hollowman and Phil Laipis who have continually supplied
good natured advice and whose laboratories have been a warehouse of
materials and equipment. Finally, I would like to thank my wife Dot and
Gail Crummer, a masochist but dear friend, for their selfless contribu
tions to the organization and drafting of this manuscript.
IV


32
3 times. The DNA was then precipitated with ethanol and dried under
vacuum. The DNA was redissolved in a solution containing 50 mM Tris,
pH 9.5, 10 mM MgCl^, 5 mM dithiolthreatol, and 50% glycerol. To this
was added 100 mM spermidine and 20 units T^ polynucleotide kinase. The
32
resulting solution was mixed with 200 pCi of dried [y P]dATP and
allowed to react at 37C for 30 minutes. To stop the reaction 5 mM EDTA
was added and the solution was dialyzed against 10 mM Tris, pH 7.4,
5 mM EDTA, and 1 M NaCl to remove unreacted [y -^P]dATP. The bacterial
alkaline phosphatase was purchased from Worthington Biochemical Corpora
tion, Freehold, NJ; the Kinase was obtained from Bethesda Research Labora-
32
tories, Inc., Rockville, MD; and the [y P]dATP was obtained from
Amersham, Arlington Heights, IL. Generally 50-100 pg of DNA were
5
labeled in a 50 pi reaction volume to a specific activity of 10 cpm/pg
of DNA.
The large "A" fragment of E.coli polymerase I was used to 3' end-
label various digestion fragments For this purpose the 50 pi cleavage
reaction mixture was blown down to approximately 20 pi and 20 pCi of
[a -^PjdCTP or [a -^P]dATP with 0.9 units of the Klenow polymerase
fragment (New England BioLabs, Beverly, MA) were added. Labeling was
done at 37C for 30 minutes. To half the reaction the sample was placed
at 60C for 10 minutes, then 20 pg of sonicated carrier DNA was added
and the sample was ethanol precipitated.
Southern Blots
DNA restriction fragments were transferred from agarose or polyacry
lamide gels to nitrocellulose filters in the manner described by Southern
(1975). Gels were first stained in a 1 pg/ml ethidium bromide bath,
visualized under UV light and photographed. The right corner of the gel


INTRODUCTION
The involvement of herpes simplex virus (HSV) in recurrent infection
of man is well documented. These recurrences are most frequently mani
fested as periodic ulcerations of the oral or genital mucosa and infections
of adjacent cutaneous tissues. Recurrent herpetic keratitis is, today,
the most common severe ocular infection in the United States and is the
principle factor involved in blinding corneal disease. Ocular infections
in 50% of the patients experiencing a primary episode will recur within
2 years. Latent virus is the probable source of infection producing
acute episodes of HSV encephalitis and meningitis in adults. It also
serves as a reservoir for virus involved in generalized herpetic infec
tions in newborns and is potentially involved in carcinoma of the cervix.
Several lines of evidence suggest the involvement of neural tissue
with viral latency in man. Repetitive infections generally occur in
localized tissues which define together the limits of a region inner
vated by a single sensory ganglia. Trauma to the sensory nerve will
consistently induce a viral recurrence in peripheral tissue. Reactiva
tion occurs in greater than 90% of the patients undergoing root sections
of the trigeminal nerve; none is observed after trauma to tissue pre
viously denervated (Carton and Kilborne, 1952). A majority of the patients
who reactivate following neurosurgical treatment for trigeminal neuralgia
have a history of recurrent herpes labial is (Pazin £t aj_., 1978). While
such observations are only indirect evidence that neural tissue is the
site of latency, it is noteworthy that the significant efforts by
1


I certify that I have read this study and that in my opinion it
conforms to acceptable standards of scholarly presentation and is
fully adequate, in scope and quality, as a dissertation for the degree
of Doctor of Philosophy.
jeft
Kenneth I. Berns, M.D., Ph.D., Chairman
Professor and Chairman of Immunology
and Medical Microbiology
I certify that I have read this study and that in my opinion it
conforms to acceptable standards of scholarly presentation and is
fully adequate, in scope and quality, as a dissertation for the degree
of Doctor of Philosophy.
(-(nLbijdMl)
'Kenneth H. Rand, M.D., Ph.D.
Associate Professor of Immunology and
Medical Microbiology
I certify that I have read this study and that in my opinion it
conforms to acceptable standards of scholarly presentation and is
fully adequate, in scope and quality, as a dissertation for the degree
of Doctor of Philosophy.
Associate Professor of Immunology and
Medical Microbiology


50
10
i
20
i
30
i
40

50 60
A A
70 80*
A 1 *..
90 100
A A
o b
EZ3-
i
' 'l '
b a *0 c q c o
qH ,o4
i
c=>
i
i 4
I
~ ^ lE rr>RN A
Figure 16. Derivation of Clones pRBI04 and pRB115


54
The SPi insert in pRB115 was excised by BamHl cleavage and the
insert separated in bulk from the vector by affinity chromatography over
a malachite green substituted bisacrylamide gel column. The Smal and
Aval cleavage maps were determined by partial digestion mapping (Smith
and Birnstiel, 1976). The approach was as follows. The DMA was cut with
Alul and then 5' end labeled by the T^ polynucleotide kinase reaction.
The DMA was then recut with Taql endonuclease and the digestion fragments
separated by agarose gel electrophoresis. The three largest fragments
spanning the insert were designated 1, 2 and 3, respectively. These
fragments were aligned on the general map using double digestion assays
with Hindi or BstEll as shown in figure 19a. Partial cleavage mapping
was then done using Smal and Aval on each of the A1ul/Taql fragments.
The map was confirmed by first cutting with Taql, labeling and then
recutting with Alul; thus generating an overlapping map going in the
opposite direction.
Figure 19b shows the generation of the Smal map for A1ul/Taql frag
ment 2 and the Hindi digestion of fragment 2 and fragment 3. The
accompanying figure 19b shows the mapping strategy and the log plot of
migration distance versus molecular weight from which the size of the
partial Smal fragments was determined. The resulting cleavage map of
fragment 2 is also shown. Figure 20 shows the partial digestion frag
ments resulting from Aval cleavage of the AluVTaqI fragments 2 and 3.
Sail, EcoRl, BamHl and Alul digests of AAV were used as size markers.
The maps resulting from these gels and similar experiments are shown in
Figure 21.


patients failed to demonstrate HSV specific sequences in either DMA or
RNA. Only one of the eight sero-negative patients gave evidence of the
presence of HSV DNA or RNA, the remainder were negative. Thus, there is
a positive correlation between the presence of complement fixing anti
bodies and the presence of sequestered HSV specific sequences as
measured by these techniques. Further, from the mapping of those RNA
transcripts observed, it is clear that the regions of the genome most
frequently encountered to date are those containing sequences in the
immediate early and early mRNA species of HSV-1.
vm


63
Figure 23. Autoradiograph of Ad2 Probe Hybridized to AAV


76
Under any of the above conditions control experiments demonstrated
that the HSV-1 nick translated probe failed to bind to DMA from unin
fected human ganglia or connective tissue as well as to the DMAs of AAV,
SV40 and Ad2. All three of these viruses have a demonstrated potential
for latency in human cell lines in vitro. In reconstruction experiments
using blots of 6% acrylamide gels, we were able to detect 5 pg of viral
DMA in the presence of 10 yg of carrier DMA, a dilution factor of
2x10^. Similarly 10 pg of viral DMA could be detected in the presence
of 10 yg of carrier when hybridization was to Southern blots of 0.5%
agarose gels. Any real differences in the sensitivities of these two
approaches is largely indicative of the increased diffusion witnessed
when transfer was from low percentage agarose gels* If the DMA content
of the normal diploid human cell is 5 pg (Luria and Darnell, 1978), the
10 yg of ganglia DMA normally assayed would represent the product of about
r O
2x10 cells,, Thus, given the molecular weight of the HSV genome is 10
dal tons, the sensitivity of our hybridization assay is such that we can
detect roughly 1 copy of the HSV genome per 200 cells.
In 18 of the 22 assays in which trigeminal ganglia were evaluated
for the presence of HSV, total ganglionic DMA was cleaved by endonuclease
digestion, transferred to nitrocellulose and probed with nick translated
HSV DMA. Eleven of these patients were sero-positive for HSV. Nine of
the sero-positive were shown to carry HSV DMA and two of these were also
shown to be positive for RMA transcripts. The nucleic acid from two of
the sero-positive patients failed to demonstrate HSV specific sequences
in either DMA or RMA. Only one of the seven sero-negative patients gave
evidence of the presence of HSV DMA or RMA; the remainder were negative.
Thus, there is a positive correlation between the presence of compliment


22
Figure 3), The HSV-1 DMA was not highly fragmented as shown by ultra-
32
centrifugation on 5-20% alkaline sucrose gradients using P-labeled
form II SV40 as a size marker (see Figure 4) (Kieff et al_., 1971;
Pignatti et al., 1979).
Preparation of Cloned DMA
Two clones of the reiterated junction between the long and short
unique regions of HSV-1 DNA designated pRBl04 and pRBl15 were obtained
from B. Roizman, University of Chicago, Chicago, IL. pRBl04 was
generated by the insertion of the Bam HI fragment SP^ of F strain HSV-1
into the Bam HI site in the tetracycline resistance gene of the Escherichia
coli plasmid pBR322; pRBl15 was derived in like manner but contained the
Bam HI fragment SP-| of F strain HSV-1 (see Figure 5). The plasmids were
provided in E. coli strain C600SF8 (Post et al_., 1980). Stocks were
maintained in 50% glycerol at -70Co Prior to growth, single colony
isolates were selected for ampicillin resistance, and grown overnight at
37C in Luria broth with 100 mg/1 ampicillin. Generally 20 mis of the
overnight culture were used to inoculate 2 liters of broth for the pro
duction of DNA stocks. The cultures were induced with the addition of
200 yg/ml chloramphenicol 15 hours before harvest.
Upon harvest the cultures were centrifuged at 10,000 xg for 15
minutes to pellet the bacteria. The bacterial pellet was washed once in
a solution of 10 mM EDTA and 50 mM Tris, pH 7.5 and then resuspended in
a solution of 25% sucrose, 10 mM EDTA, and 50 mM Tris HC1, Ph 7.5. All
subsequent extractions were conducted at 4C. The bacterial cell wall
was digested with egg white lysozyme (500 pg/ml). After 20 minutes in
the presence of lysozyme, (1 yg/ml) DEPC was added to inhibit breakdown
of nucleic acids and the cells were gently lysed in 0.5% Triton. Low
molecular weight DNA was extracted in the manner described by Hirt (1967).


36
hybridized to EcoRl digests of HSV DNA immobilized on nitrocellulose
paper under conditions favorable for formation of DNA-DNA hybrids. The
32
reverse experiment was also done using nick translated [a PjdCTP
labeled HSV DNA as a probe and hybridizing with endonuclease digested
ganglia DNA.
Isolate Ganglia
chemical ly
32
label
P-
DNA
hybridize
v
HSV DNA
Blots
dissection
Neurons
DNA
I
Endo R
digestion
Gang!ia
DNA
Blots
hybridize
32
P-HSV DNA
Figure 7. DNA/DNA Hybridization Procedure
125
The third procedure entailed hybridizing I-labeled total cytoplasmic
RNA from ganglia to immobilized restriction endonuclease digests of HSV
DNA (Tereba and McCarthy, 1973) (see Figure 8). In all these approaches
viral DNA or RNA sequences complementary to immobilized sequences were
detected by autoradiography at -70C for 1-21 days. The pattern of

radioactive bands was compared to control HSV DNA run in parallel
i
experiments.


12
B
o
t-
10 20 30 40
H 1 1-
50 60 70 80
H 1 1 H-
90
100
I
prototype
L
L&S
Figure 1. Inversion of HSV DNA
recombinants to give the least number of crossover points, the resulting
progeny could only have originated from recombination between parents
which were both in the prototype configuration. Such an approach does
not take into account the contribution of double cross over events
(Morse et_ al_., 1977; Roizman, 1979). To date analysis of recombination
frequencies between genetic markers in the long and short regions has
shed little light on the validity of this assumption.


69
sequences found in this manner. 'These-regions of homology have :been
numbered and are summarized in Figure 26.
Upon comparison the portion of the AcT2 genome mapping 7930 to 7999
base pairs in from its right terminus shows a 71% sequence homology with
the 60 base pair sequence beginning 40 nucleotidesin on the inverted
terminal repeat of AAV (see Figure 27). This maps within the EcoRl D
fragment of Ad2 78% of the B and C domains of AAV are conserved as are
the functions between B and B domains and the C to A1 junction.
Eighty-eight percent of the C reiteration of AAV is retained. Approxi
mately 20 nucleotides upstream from the homologous stretch shown the
sequence 51 TGCGC 31 is conserved in both genomes; similarly 25 nucleo
tides downstream in both genomes the sequence 51 CTCCA 3' is retained.
The sequence 5' CTCACCGG 3' shown in figure 27 in Ad2 complements the
3' end of the first leader sequence in the E3 transcription complex
(Heriss et al., 1980).
B B' C C A' gg
AAV CCGGGCGACCAAAGGTCGCCCGACGCCCGGGCTTTGCCCGGGCGGCCTCACTGAGCGAG
I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I
Ad2 TCGGGCAATCAAAG ACTCCCGGAGCCCGGGCAAAGCACTGGCGGCGGCAGTGGTCGAG ,nnn
l / \ \ I /x 7999
T / \ A G TGT
TAACAAA
Figure 27. Ad2 Early Region 3A (Heriss et al., 1980)
Figure 28 details the sequence homology surrounding the beginning
of the second coding region in AAV and a homologous stretch in Ad2
starting 5252 nucleotides in from the right terminus. This 53 base
pair sequence maps to the EcoRl E fragment of Ad2 and is part of
sequence involved in the E3 transcription complex. There is about 69%
total sequence homology between the two genomes over this area and it
should be noted that the ATG start signal found in AAV is absent in the


DISCUSSION
The trigeminal ganglia of 22 patients have been assayed for HSV
sequences by DNA/DNA hybridization: None of the patients manifested
clinical evidence of recurrence at the time of death nor was a history
of recurrence noted. Fourteen of the patients were sero-positive for
HSV. A positive serology was assessed as a complement fixation titer of
1:8 or greater. The RNA from the trigeminal ganglia of 16 patients was
also surveyed for HSV transcripts by RNA/DNA hybridization.
Hybridizations were conducted in 50% formamide and 5XSSC solution
at 37C. Given a T^ of 97C in 1XSSC and a G + C value of 68% the calcu
lated value of the T^ for HSV in 5XSSC would be approximately 104C
(Sheldrick and Berthelot, 1974). Allowing for a 0.7C decrease in the Tm
value for each 1% of formamide present and a 1C lowering for each 1.5%
mismatching of base pairs (McConaughy et al., 1969), the initial condi
tions of hybridization would permit a 21% mismatch in base pairing be
tween the probe and nitrocellulose bound DNA. Subsequent washes in 1XSSC
and 50% formamide at 37C would permit no more than a 16% mismatch to be
retained. In like manner it can be calculated that washes in 0.1XSSC
solution alone at 68C would permit no greater than 10% mismatch in base
pairing. Consequently, the signal retained in hybridizations between the
HSV-1 probe and ganglia containing HSV-2 DNA or transcripts would be
greatly subdued. In such instances the strongest binding would occue in
the regions of greatest homology between the two types, namely, the
termini and L/S junction.
75


70
form of rearrangement. The approach taken here would not resolve this
issue. Frequently the regions which we failed to detect gave rise to
smaller endonuclease digestion fragments whose copy number would fall
below our level of detection. The sensitivity of our assay would allow
us to detect a fragment representing 1% of the genome only if it was
present in at least 1 copy per cell. The findings in patients #1082 and
#1089 probably fall within this category.
In a recent repetition of this approach using human brain tissue
Fraser et al_ (1981) reported the detection of HSV DNA sequences in six of
eleven individuals assayed. Hybridization against total viral DNA
revealed all or portions of the HSV genome were present in the six posi
tive individuals. Hybridization against the clone pRBllS showed a
marked alteration of the electrophoretic migration pattern of the ter
minal fragment in oen individual and no change in the two other patients.
The findings of the CsCl enrichment studies lead us to consider the
possibility that the bands we detected by blot hybridizations are the
product of a lytic infection that ensued at the time of death. The
positive controls using DNA from a known HSV infection insures that the
mechanics of this approach were efficient enough to retain sufficient
levels of viral DNA if this were the case. Given the sensitivity of the
hybridization assay itself and the negative findings in known sero-posi-
tive patients a reasonable argument can be made against an ongoing lytic
infection within the ganglia.
RNA from the trigeminal ganglia of 16 patients was screened for HSV
specific transcripts by DNA/RNA hybridization. In 8 of these patients
125
I-labeled ganglia cytoplasmic RNA was hybridized to either EcoRl or
Hpal endonuclease digests of HSV-1 F strain DNA bound to nitrocellulose
paper. We were able to demonstrate HSV specific RNA transcripts in two


Molecular Weight ( base pairs
55
Tog I
Alii I
>
t-
Alu I
4
Figure 19a. Strategy for Partial Digestion Mapping of pRBl15


91
Hayward, G.S., R.J. Jacob, S.C. Wadsworth, and B. Roizman. 1975.
Anatomy of herpes simplex virus: Evidence for four populations of
molecules that differ in the relative orientations of their long
and short components. Biochemistry. 12} 4243-4247.
Hriss, J., G. Courtois and F. Galibert. 1980. Nucleotide sequence of
the EcoRl D fragment of Adenovirus z genome. Nucleic Acid Research.
8: 2173-2191.
Hriss, J. and F. Galibert. 1981. Nucleotide sequence of the EcoRl E
fraqment of adenovirus 2 genome. Nucleic Acid Research. 9: 1229-
1240.
Hill, T.S. and H.S. Field. 1973. The interaction of herpes simplex
virus with cultures of peripheral nervous tissue: an electron
microscope study. Journal of General Virology. 21_: 123-133.
Hill, T.S., H.S. Field and W.A. Blyth. 1975. Acute recurrent infection
with herpes simplex virus in the mouse: a model for studying and
recurrent disease. Journal of General Virology. 28: 341-353.
Hirt, B. 1967. Selective extraction of polyoma DNA from infected
mouse cell cultures. Journal of Molecular Biology. 26/ 365-369.
Hoggan, M., N. Blacklow and W. Rowe. 1966. Studies of small DNA viruses
found in various adenovirus preparations? Physical, biological
and immunological characteristics. Proceedings of the National
Academy of Science, U.S.A. 55/. 1467-1575.
Holland, L.E., K.P. Anderson, J.R. Stringer and E.K. Wagner. 1979.
Isolation and localization of herpes simplex virus type 1 mRNA
abundant before viral DNA synthesis. Journal of Virology. 31:
447-462.
Honess, M. and D. Watson. 1974. Herpes simplex virus-specific polypep
tides studied by polyacrylamide gel electrophoresis of immune preci
pitates. Journal of General Virology. 22: 171-183.
Jones, P. and B. Roizman. 1979. Regulation of Herpesvirus macromolecular
synthesis VIII. The transcription program consists of three phases
during which both extent of transcription and accumulation of RNA
in the cytoplasm are regulated. Journal of Virology. 31_: 299-
314.
Kaplan, A.S. (ed.) 1973. The Herpesviruses Academic Press, New York.
Kieff, E.D., S.L. Bachenheimer and B. Roizman. 1971. Size, composition
and structure of the deoxyribonucleic acid of herpes simplex virus
subtypes 1 and 2. Journal of Virology. 8: 125-132.
Knipe, D., W. Ruyechan, R. Honess and B. Roizman. 1979. Molecular
genetics of herpes simplex virus: The terminal a sequences of the
L and S components are obligatorily identical and constitute a part
of a structural gene mapping predominantly in the S component.
Proceedings of the National Academyof Science, U.S.A. 76: 4534-4538.


T
T T
C G
C G
A T
G C
C G
G C
G C
G C
C G
T
G C
C G
G C
G C
G C
C G
C G
C G
G C
A A
A
FLIP
G C C T C A G T G A G C G A G C G A G C G C G C A G A G A G G G A G T G G C C A A 3
I | | I I I I I I I I I I I I I I I I | I I I I I I I II M | I l I I I I I I I 5,
CGGAGTCACTCGCTCGCTCGCGCGTCTCTCCCTCACCGGTTGAG
T
T T
C G
G C
G C
G C
C G
C G
C G
G C
r, G
A
G C
C G
C G
C G
G C
C G
T A
G C
G C
A A
A
FLOP
GCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGCC
I I I I I I I I I I I I I I I I IF I | I I I I I | | I | I I I I I I [ >
CGGAGTCACTCGCTC GCTCGCGCGTCTCTCCCTCACCGG
U3
i 1 5'
t t (a A
Figure 30. Inversion of portions of the AAV genome


19
early transcribed region (Watson, 1982). Eco R1 endonuclease cleavage
at this sequence causes reduced levels of thymidine kinase expression
(Wigler et al_., 1977; McKnight and Gavis, 1980) and the sequence is
similar to the RNA polymerase II regulatory signal GGPyCAATCT described
by Benoist et al_ (1980). Thus transcriptional control at the promoter
level must distinguish between immediate early, early and late signals
and between origins of transcription within the same class; as in the
case of the two early promoters described above with a 3' co-terminus.
The rationale for studying the molecular status of the latent herpes
genome is in reality twofold. In a general sense, if the latent genome
is present as a subviral unit within the cell it provides a well defined
gene region of which specific questions concerning gene content and
transcription may be asked. In theory, such a genetic system would be
subjected to many of the restraints governing the activities of the genes
of its eukaryotic host, regardless of whether the viral DNA was inte
grated or funcitonally an episome. The more direct concern of this study
is to approach the question of whether the HSV genome is functionally
dormant during its latency or does itself provide some necessary
activity. An assay for specific regions of the HSV genome should deter
mine which portions of the viral DNA are most frequently retained in
latency while an evaluation of viral RNA will determine which regions of
the genome are most frequently expressed. The retention and expression
of certain genomic regions common to all HSV latently infected ganglia
argue that the virus may play an active rather than passive role during
latency.


BIOGRAPHICAL SKETCH
I was born in Miami, Florida, on April 1, 1953, the first child of
Amos and Fran Rayfield. Our family was completed in 1956 with the birth
of my brother, Glenn. I attended the public school system of Dade County
and eventually enrolled at the University of Florida in the Department of
Immunology and Medical Microbiology as an undergraduate.
While an undergraduate, I worked in the Department of Ophthalmology
in the virology laboratory of Dr. Centifanto. I decided to further my
education in this field with a specific interest in HSV. I was accepted
into the Department of Immunology and Medical Microbiology and over the
years worked with various viruses which led to this dissertation.
I recently married Dorothy Lesso, a student at the University of
Florida, College of Environmental Engineering. Our plans include a move
to Mew Orleans where I am currently a post doctorate fellow at the LSU
Eye Institute.
Basically I'm an outdoors man and my interests include a spectrum
of sports which my wife and I share.
98


56
t
3
Hindi uncut
2 Sma I
Hindi 0 5 10 20 40 80
AAV gg
*
EcoRI A
D Us
E
F
G
I
4
*
k
Figure 19b. Smal partial digestion of pRB115


65
The AAV probe binds only to the EcoRl D and F fragments. A self
hybridization with an Ad2 probe was done to confirm that all the diges
tion fragments were transferred efficiently to the blot. A specificity
control is also shown using a nick translated SV40 probe. The EcoRl
A and C fragments were extracted from another portion of the gel and
nick translated. The findings are shown on the left. A total Ad2 probe
bound to the Haell A and C fragments of AAV. The EcoRl A and C probes
of Ad2 showed no homology with AAV under these conditions of hybridiza
tion. The Haell A and C fragments of AAV contain the terminal inverted
repeats, which have been shown to have a high G+C content. For this
reason HSV-1 DNA, which also has a high G+C content, was used as a
control for nonspecific hybridization and none was found.
Because of its defective nature AAV must be grown in the presence
of Ad. Unfortunately this situation permits the potential cross contam
ination of AAV viral stocks with Ad DNA. To limit this occurrence both
AAV and Ad DNA stocks were extracted from CsCl gradient purified virions
The possibility still remains that a small portion of the contaminating
DNA may have been packaged in the reciprocal viral capsid, thus copuri
fying throughout the preparative procedure. It may be argued that such
an event could in part give rise to the finding demonstrated in the
previous experiments. In dealing with this argument two approaches have
been taken. First, Ad5 stocks which were maintained continually in the
absence of AAV were cut with BamHl giving rise to two fragments of
approximately 14.3x10^ dalton and 9.7x10^ dalton in size. After electro
phoresis the digest was transferred to nitrocellulose and hybridized
with a nick translated probe of total AAV which had been grown in cocul
ture with Ad2. Hybridization with the AAV probe involved only the high


Copyright 1982
by
Mark A. Rayfield


72
terminal repeats also. Figure 30 presents the "flip" and "flop" orien
tations of the AAV genome to which the HSV sequences were compared.
The direct repeat which brackets the ends of the a reiteration in
the termini of HSV-1 has a similar sequence to the B1, C, and C domains
of the AAV hairpin. The short palindrome GCCCGGGC forms the core of
this repeat in HSV-1 DMA. This palindrome is found in the core of the
inverted repeat of AAV also. One finds that 80% of the base sequence
is conserved between the HSV-1 direct repeat and the B', C and C
domains of AAV DNA. The nucleotide sequences bordering the palindrome
conserve 66% of the B1 and C repeated domains (see Figure 31).
B C C
AAV
GGTCGCCCGACGCCCGGGCTTTGCCCGGGCG
II III 1 1 1 1 1 1 1 1 1 1 II 1 1 II
86
HSV
II III i 1 1 1 1 1 1 1 1 1 II 1 1 II
GGCCGCGGGGGGCCCGGGCT GCGCCGCCG
213
DR1
Figure 31. Homology between short palindromes in HSV-1 and AAV
(Mocarski et al., 1980)
By expanding the comparison of this region in HSV with AAV one finds
approximately 72% of the flip orientation of the AAV terminal palindrome
is conserved in the HSV sequences (see Figure 32). Eighty-two percent
of the nucleotides reading from roughly the middle of the A domain of
AAV through the C and into the C domains are the same. Approximately
110 base pairs upstream in the HSV-1 map from the sequence described
above one finds a stretch of 43 nucleotides which can be aligned with
the flop orientation of the AAV termini. Having done this there appears
to be roughly 84% homology between the two genomes in this region. As
one continues to read in a 5' to 3' direction the HSV sequence is highly
compatible with the terminal domains of AAV arranged in the order A, C,
C\ B, B1, C, C then A. There is an 84% homology between genomes in


27
was run on 40x15x3 cm 1% slabs with 1 cm wells, each receiving 500 ng
HSV-1 DNA in 10 yl of loading solution. Stock loading solution contained
0.05% bromphenol blue, 0.05% xylene cyanole and 50% glycerol in 0.01M
Tris, pH 7.4. This was diluted 1 to 3 with the digests prior to loading.
Digests of cloned viral DNA were electrophoresed in the same manner.
Cellular DNA was run on 14x12x3 cm 0.5% agarose slabs with 1 cm wells;
10 yg of DNA was loaded as above per well. The running buffer was con
tinuously circulated and contained 5 mM sodium acetate and 1 mM EDTA in
40 mM Tris, pH 7.8.
For size.determination and mapping, the digests of cloned viral DNA
were also electrophoresed on 6% acrylamide 0.15% bisacrylamide or 12%
acrylamide 0.30% bisacrylamide gels. DNA (3 yg) was loaded as above
per 5 mm well on 40x15x3 cm gels and 1 yg per 5 mm well on 40x15x1.5 cm
vertical slabs. The running current was 3 volts/cm. The continuously
circulated buffer was 40 mM sodium acetate and 2 mM EDTA in 50 mM Tris,
pH 7.8.
Isolation of Endonuclease Cleavage Products
Endonuclease cleavage products were isolated and purified following
agarose gel electrophoresis in the manner described by Finkelstein and
Rownd (1978). Ethidium bromide stained gels were illuminated with a UV
lamp and the fragment band sliced out. Gel slices were finely ground
and suspended in 200 yl of 100 mM Tris, pH 5.95. Agarose (Calbiochem-
Behring LaJolla, California) was added to a final concentration 0.5 yg/yl
and the suspension was incubated for 2 hours at 37C. The degraded
agarose was removed by centrifugation at 15,000 xg for 10 minutes.
Following two successive phenol and ether extractions the DNA was con
centrated by ethanol precipitation.


39
reason, only HSV-1 F strain DMA extracted from sucrose gradient purified
nucleocapsids and banded twice in CsCl density gradients to remove con
taminating cellular DNA and RNA was used throughout (Spear and Roizman,
1972). To further eliminate the possibility of contamination by copuri
fying cellular nucleic acids, HSV-1 F strain DNA sequences cloned in
PBR322 were also used in some of the hybridization studies. DMA isolated
from purified nucleocapsids failed to hybridize to cellular DNA in a
repetition of the above described assays. In control experiments such
a probe also failed to bind to DNA from adenovirus (Ad2), adenoassociated
(AAV) virus and Simian Virus 40 (SV40) (see Figure 10). DMAs extracted
from thoracic ganglia and connective tissue of patients have been run in
parallel reactions with trigeminal gnaglia DNA and failed to hybridize
with this probe.
To determine the sensitivity of the hybridization assay reconstruc
tion experiments were run using HSV and AAV DNA. Samples of AAV DNA
were digested with either BamHl, EcoRl or Alul and then mixed. Starting
with a total of 10 ug of digested AAV DNA serial dilutions of the
preparation viere then made. To maintain a total of 10 ug DNA in each
sample sonicated calf thymus DNA was added as needed. The samples were
electrophoresed on a 6% polyacrylamide gel and then transferred to
nitrocellulose by the Southern blotting method. Using a nick translated
g
AAV probe with a specific activity of 10 cpm/ug DNA the sample containing
100 pg of AAV DNA could be visualized by autoradiography after 2 v/eeks.
A 200bp fragment within this sample would represent 5pg of DNA. Because
fragments within this size range are visualized the assay is sensitive
enough to distinguish 5pg of AAV in 10 ug of calf thymus DNA, a dilution
factor of 2x10^. Similar experiments using HSV DNA established that


MATERIALS AND METHODS
Purification of Ganglion Cell DNA and RNA
Teased ganglia preparations were washed 2 times in 1 ml of 1XSSC
(150 mM NaCl and 15 mM Na2CgHg0y, pH 7.6), Dounce homogenized and trans
ferred to siliconized 1.5 ml Eppendorf centrifuge tubes. The homogenate
was spun at 10,000 rpm for 2 minutes to pellet nuclei from which the DMA
was extracted. The resulting supernatant was extracted 2 times with
phenol-cresol-chloroform (5:1:1 mixture) and ether extracted 3 times.
From the extracted supernatant, total cytoplasmic RNA was precipitated
with diethylpyrocarbinol (DEPC) treated ethanol and stored at -20C.
For isolation of nuclear DNA, the pellet was first resuspended in 1 ml
1XSSC, 1% sodium dodecyl sulfate (SDS) and then treated with pronase
(1 mg/ml) at 37C overnight. The preparation was then phenol extracted
2 times, ether extracted 3 times and RNase A treated (20 mg/ml) for 30
minutes at 37C to degrade nuclear RNA. This was followed by 2 addi
tional phenol extractions. The DNA was then precipitated with ethanol
and stored at -20C. This procedure yielded approximately 26 yg of DNA
pre ganglia preparation.
Viral DNA Purification
HSV-1 DNA was isolated as previously described by Holland (1979).
Briefly, confluent monolayers of human epidermoid carcinoma cells (HEP-2)
were infected with HSV-1 at a multiplicity of 10 PFU/cell and incubated
in Eagle's minimum essential medium with 10% calf serum at 37C (Roizman
1968). Thirty hours post infection the monolayers were scraped into
20


IMPORTANT NUCLEOTIDE SEQUENCES INVOLVED IN
LATENCY OF DNA VIRUSES OF ANIMALS
By
Mark A. Rayfield
A DISSERTATION PRESENTED TO THE GRADUATE COUNCIL
OF THE UNIVERSITY OF FLORIDA
PARTIAL FULFILLMENT OF THE REQUIREMENTS
FOR THE DEGREE OF DOCTOR OF PHILOSOPHY
UNIVERSITY OF FLORIDA
1982


RESULTS
Experimental Approach
As stated previously, the general aim of this research is to illu
minate the molecular status of the HSV genome in latently infected human
trigeminal ganglia. Specifically the studies are designed to
1. Detect HSV DMA and RNA sequences in human ganglia.
2. Determine the extent of the viral genome present through
hybridization of HSV DMA to nitrocellulose paper bound ganglia
DMA.
3. Determine the extent of viral DMA expressed as cytoplasmic
RMA through mapping of ganglia RNA hybridized to nitrocellu
lose paper bound viral DMA.
4. Correlate genome presence with the expression of a humoral
immune response to HSV antigens in immuno-competent patients
as measured by complement fixation.
5. Evaluate the manner of viral genome latency.
To achieve this end the following experimental approach was taken.
Total cellular DMA and cytoplasmic RMA were extracted from trigeminal
ganglia. Three different experimental routes could then be carried out.
32
The DMA was either radiolabeled with [a P]dCTP by nick translation
(Rigby et al_., 1977) or it was digested with a restriction endonuclease,
gel electrophoresed and then transferred and immobilized on nitrocellu
lose paper by the blotting method of Southern (Southern, 1975; Wahl et
al., 1979) (see Figure 7). Radiolabeled ganglia DNA was subsequently
35


52
Table 3. Endonucleases
BamHl/Hindll
BamHl/BstEll
BamHl/BstEll/Taql
Smal
Aval
Clone:
115
104
115
104
115
104
115
115
fragment
size (bp)
4600
5200
750
4200
2400
2350
1075
890
1230
1240
2300
2300
1950
2200
677
566
1600
1975
577
483
450
453
430
400
365
380
337
336
222
317
140
226
102
206
84
170
148
138
99
82
55
Enzymes that did not cut: BglII, Kpnl, Hpal, Xbal, EcoRl, Hindlll,
Pstl and Sal I
and a comparison of the Smal and Aval digests of pRBl04 and pRBl15 are
shown in Figure 18. The mean length of the insert in pRB104 was calcu
lated to be approximately 6382 base pairs and that of pRBl15 was 5830 base
pairs. A comparison of the Smal and Aval digestion patterns of the two
clones indicates that more than a single insertion event has occurred
in the derivation of the SP-j, and SP2 fragments. The fragment corres
ponding to the 1075 bp Smal fragment of pRB115 is only 880bp in pRBl04
even though pRBl04 contains the larger insert. The 360bp Smal fragment
of pRBl15 is overrepresented in pRB104. The 450bp Aval fragment of
pRBl15 is overrepresented in pRBl04 and the 483bp Aval fragment of
pRBl15 is missing in pRB104. The pRB104 Aval digest also has a cluster
of fragments between 330bp and 380bp that are not found in pRBl15.


67
Eco R I
A
Adenovirus 5
75.9
B
Hind III
G E C H D A
97.3
Eco R I
Adenovirus 2
A
B
707

89.7
Hpa I
C
10
20
30
40
50
60
70
80
90 100
Hae II
15.6
Adenc associated Virus
6C.7
E F
Hpo i I
tz!
-M 1
*Jj
1 i 1
'
; ; c,
V
p
N u F G
0
B
K US A
i
i
E
D .1
S
H
C
0
.t
i.
20 30
i i
40 50
i 1
ec 70
i 1
80
90 PO
Figure 25
Mapping of Homologous Regions in AAV and Ad


38
Figure 9. Cellular DNA Controls


21
medium, which was clarified by spinning at 1,000 xg for 15 minutes. The
clarified medium was stored on ice and the cell pellet resuspended in
cold reticulocyte saline buffer (0.01 m NaCl, 0.00T5 m MgC^ 0.01 M Tris,
pH 7.4) and 0.5% Triton. The cells were lysed by 10 strokes in a Dounce
homogenizer. The cell homogenate and clarified media were then each
spun at 10,000 xg for 15 minutes to remove nuclei and cell debris. The
resulting supernatants were pooled and from these HSV-1 virions were
pelleted by centrifugation at 33,000 xg for 30 minutes. Virions were
resuspended and lysed in 10 mM Tris, pH 7.5, containing 50 mM EDTA, 0.5%
SDS and 1% sarkosyl. The lysate was digested overnight at 37C with
pronase at a final concentration of 2 mg/ml (Walboomers and Ter Schegget,
1976). The digest was phenol extracted twice and ether extracted 3 times.
HSV-1 DNA was purified by banding twice in an isopycnic ethidium bromide -
3
CsCl gradient. The starting density of CsCl was 1 .566 g/cm with 100
yg/ml ethidium bromide and centrifugation was for 48 hours in a Ti50
rotor at 45,000 rpm (Pater et aj_., 1976).
Partially purified HSV-1 F strain DMA was also received from Dr.
Saul Silverstein, Columbia University, New York, NY. These preparations
had been treated in the following manner: Nucleocapsids were purified
from cytoplasmic extracts of infected Vero cells by velocity sedimentation
in sucrose gradients. The virions were lysed in the presence of 0.5% SDS,
0.5% sarcosyl and 10 mM EDTA. The lysate was then extracted with phenol,
chloroform and 2% isoamyl alcohol to remove proteins and lipids. The DNA
was then precipitated with ethanol and stored (Spear and Roizman, 1972).
Viral DNA preparations received in this form were resuspended in
2XSSC and further purified on CsCl density gradients. A single viral
band was obtained at a density of approximately 1.728 g/cm which was well
separated from contaminating, cellular DNA and RNA in the pellet (see


31
DNase I was activated by incubating the enzyme for 2 hours at 0C in a
solution containing 10 mM Tris, pH 7.6, 5 mM MgCl2 and 1 mg/rnl bovine
serum albumin. DNase I was obtained from Worthington Biochemical Cor
poration, Freehold, NJ and stock solutions of 1 mg/ml in 0.01 n HC1 were
stored at -20C (Rigby et aj_., 1977).
Iodination of Cytoplasmic RNA
Ethanol precipitated cytoplasmic RNA was resuspended in 50 yl of
DEPC treated distilled water and transferred to a 1.5 ml Eppendorf
125
centrifugation tube containing 4 mCi I sodium iodide. To this, 20 yl
of 0.2M sodium acetate (pH 4.7) and 5 mM thallic chloride was added.
125
The tube was sealed and incubated at 70C for 20 minutes. I sodium
iodide with a specific activity of 350-600 mCi/m mole was purchased from
Amersham/Searle Corporation, Arlington Heights, IL. Thallium chloride
was purchased from ICN Pharmaceuticals, Incorporated, Plainview, NY.
After incubation the reaction was chilled and stopped by the addition of
20 yl of 0.02 Me-mecaptoethanol, 1 M sodium phosphate, pH 6.8. The
solution was heated to 70C for 15 minutes and 50 yg of yeast tRNA was
125
added as carrier. Labeled RNA was separated from free I by passage
through a Sephadex G75 column (lcmxlOcm) (Tereba and McCarthy, 1973).
5' End Labeling Reactions
The 5 ends of endonuclease digestion fragments v/ere labeled with
32
[y P]dATP in the presence of T^ polynucleotide kinase (Richardson,
1966). The 5' terminal phosphate of the polynucleotide was first removed
by treatment bacterial alkaline phosphatase in 10 mM Tris, pH 7.4 and
100 mM NaCl at 60C for 30 minutes. To halt the reaction 5 mM EDTA was
added and the solution was phenol extracted twice then ether extracted


66
molecular weight Ad5 BamHl fragments and showed no smaller contaminating
AAV fragments. The second approach was to hybridize Ad DMA from a viral
stock shown to be free of AAV by E*1 studies, to AAV DMA generated from
a clone of the entire genome inserted into pBR322. The Ad DNA for this
assay was donated by Peter McGuire, Department of Biochemistry, Univer
sity of Florida, and the 620 pBR322 clone of AAV was a gift from Jude
Samulski, Department of Immunology and Medical Microbiology, University
of Florida. In both cases, the results confirm the previous findings
in the AAV and Ad2 cross hybridizations. The hybridization studies on
Ad5 were extended to map the regions of the genome to which binding was
most stringent. For this purpose EcoRl and Hindlll digests were used
and again the salt conditions for the hybridizations or washes varied.
The findings are compatible with those previously found for Ad2. A
summary of the cross hybridization mapping studies is shown in Figure
25.
To evaluate in better detail the cross hybridization studies a
computer comparison was done of the entire nucleotide sequence of AAV-2
against the published sequences of the first 11,600 bases of the left
half of Ad2 and the final 8,561 nucleotides of the right half of Ad2.
Three programs were run: the first conducted a random search for
sequences with a minimum perfect match of six bases, the second searched
for a 3 out of 5 base match and the third looked for a 7 out of 10 match
In general the data showed extensive random homology throughout both
genomes. This is supportive of the less stringent hybridization studies
If one analyzed the data for sets of adjacent homologies that mapped
co-linearly between the two genomes these sequences were invariably
found within the terminal 20% of the AAV genome, again corroborating the
hybridization data. The following are comparisons of some of the


Figure
IBOO
1.780
1.760
1740
1.720
1.700
1.69 0
1.6 60
1.640
3. CsCl isopycnic gradient purification of HSV DNA
q/cc CsCl


62
the experimental group. Figure 23 shows the findings of 2 sets of
experiments in which an Ad2 nick translated probe was hybridized to AAV
blots and washed under varying salt concentrations. The hybridizations
were done overnight (as described in the Materials and Methods portion
of this text) at 68C and all washes were done at 68C. On the left of
Figure 23 are the autoradiographs from the hybridizations to a Hpall
blot to AAV and on the right are those from a Haell blot of AAV. As
one progresses from a 2XSSC wash with 300 mM NaCl to a 0.5XSSC wash with
only 75 mM NaCl various bands are seen to drop from the autoradiographs.
In the case of the Haell digest, clearly all bands are present in the
autoradiograph of the blot washed in 2XSSC but the blot washed in 1XSSC
has lost the Haell D fragment and the intensity of the Haell B band is
greatly diminished. The 0.5XSSC level of stringency reveals only strong
hybridization to the Haell A and C fragments with significant binding
remaining to the Haell E fragment.
When assays are done in the manner described above whole viral DNA
is nick translated as a probe. This approach permits the mapping of
homologous regions on the nitrocellulose bound DNA but fails to correlate
that portion found in the blot with the portion of probe hybridizing in
reciprocal crosses. To obtain this information fragments which failed
to show homology when bound to nitrocellulose were extracted from gels
after endonuclease digestion and gel electrophoresis. These fragments
were nick translated and then used as independent probes in cross hybridi
zation assays. Figure 24 shows the results of such an assay using the
EcoRl A and C fragments of Ad2 as probes against a Haell digestion blot
of AAV. On the left is the autoradiograph of total AAV hybridized to
an EcoRl digest of Ad2 under stringent conditions (hybridization over
night at 68C in 5XSSC and final overnight wash at 68C in 0.5XSSC).