Citation
Adenovirus induced adeno-associated virus gene expression is not dependent on AAV non-structural rep protein

Material Information

Title:
Adenovirus induced adeno-associated virus gene expression is not dependent on AAV non-structural rep protein
Creator:
Lackner, Daniel Francis, 1971-
Publication Date:
Language:
English
Physical Description:
ix, 125 leaves : ill. ; 29 cm.

Subjects

Subjects / Keywords:
Binding sites ( jstor )
Dependovirus ( jstor )
DNA ( jstor )
Gene expression ( jstor )
Infections ( jstor )
Plasmids ( jstor )
Proteins ( jstor )
Repression ( jstor )
RNA ( jstor )
Transactivation ( jstor )
Adenoviridae -- genetics ( mesh )
Department of Molecular Genetics and Microbiology thesis Ph.D ( mesh )
Dependovirus -- genetics ( mesh )
Dissertations, Academic -- College of Medicine -- Department of Molecular Genetics and Microbiology -- UF ( mesh )
Promoter Regions (Genetics) ( mesh )
Repressor Proteins -- genetics ( mesh )
Trans-Activation (Genetics) ( mesh )
Transcription Factors -- genetics ( mesh )
Genre:
bibliography ( marcgt )
theses ( marcgt )
non-fiction ( marcgt )

Notes

Thesis:
Thesis (Ph. D.)--University of Florida, 2002.
Bibliography:
Includes bibliographical references (leaves 105-124).
Additional Physical Form:
Also available online.
General Note:
Typescript.
General Note:
Vita.
Statement of Responsibility:
by Daniel Francis Lackner.

Record Information

Source Institution:
University of Florida
Holding Location:
University of Florida
Rights Management:
Copyright [name of dissertation author]. Permission granted to the University of Florida to digitize, archive and distribute this item for non-profit research and educational purposes. Any reuse of this item in excess of fair use or other copyright exemptions requires permission of the copyright holder.
Resource Identifier:
028651064 ( ALEPH )
54800689 ( OCLC )

Downloads

This item has the following downloads:


Full Text











ADENOVIRUS INDUCED ADENO-ASSOCIATED VIRUS GENE EXPRESSION IS
NOT DEPENDENT ON AAV NON-STRUCTURAL REP PROTEIN
















By

DANIEL FRANCIS LACKNER








A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2002



























Copyright 2002

by

Daniel Francis Lackner




















This work is dedicated to both of my parents, John and Sally Lackner.















ACKNOWLEDGMENTS

In my lab, I would like to thank a great number of people. First, I would like to thank Bill McDonald. He was the unfortunate postdoc that had to sit next to me as a first year graduate student. He answered every stupid question I ever asked and taught me to form the really important ones. Two other important postdocs were Christian and Cornea. Dr. Teshendorf introduced me to the wonders and peculiarity of the European lifestyle from the German perspective. He will be the measure to which I compare all future medical doctors. Cornea has exposed me to the Spanish version of the European lifestyle and created my entire knowledge of the neuroscience field.

I have enjoyed the large number of Chinese postdocs in the lab, which introduced me to the Chinese culture. Wei-jin, Pei, Wu, Yan, and Long-Gon have taught me the limited amount of Mandarin that I can speak in everyday conversation. More importantly, they showed me the similarities of China and American society but also the differences between the two cultures. This exposure to a different culture has been one of the most rewarding experiences in the Muzyczka lab.

Rodney and Opie have always been my lab mates and have made the experience one to long remember. They have been a great deal of entertainent and have made the process of getting a Ph.D. a great deal of fun. I would choose no one else to spend these years with at UF and they will always make me laugh.

Ken and Kevin have been great mentors even through we are the same age. I respect their opinions and have had no better time than discussing any aspect of AAV


iv









biology with these two great postdocs. They have taught me more than they know and I know they will do great in their future careers.

Without question, the enduring support of my parents, John and Sally, has

enabled me to complete this Ph.D. dissertation. During many phone calls, their own interest in my work has inspired me to explain many different aspects of basic AAV and Adenovirus biology. I cannot thank them enough for everything they have done for me.

I would like to give a very important acknowledgement and thanks to my wife, Dr. Cari Aspacher Lackner. From the beginning of my graduate career, she has been a great source of happiness and a great companion in scientific research. I have always had her as a research consultant and aspired to be her equal as a bench scientist.















TABLE OF CONTENTS

page

ACKNOWLEDGMENTS..................................... ................................. iv

ABSTRACT................................................................................... viii

INTRODUCTION..............................................................................1.

Eukaryotic Gene Expression ...............................................................1
The Chromatin Template.................................................................1.
Activation and Repression ................................................................. 5
Chromatin Modification .................................................................... 9
Basal Transcription Factors ..............................................................I1
RNA Polymerase 11 Holoenzyme ........................................................ 14
Adeno-Associated Virus..................................................................... 15
Adenovirus Helper Functions ............................................................ 18
AAV Rep Proteins......................................................................... 19
AAV Transcription without Adenovirus ................................................ 20
AAV Transcription with Adenovirus .................................................... 20
Model for Activation of an AAV Productive Infection from Latency............... 28

MATERIALS AND METHODS............................................................... 35

Cell Lines and Virus.......................................................................... 35
Plasmids ..................................................................................... 35
Transfections................................................................................ 39
CAT Reporter Assays........................................................................ 40

RESULTS ........................................................................................ 41

Analysis of Adeno-Associated Virus Transcription....................................... 41
Define Rep Binding Element as Enhancer or Proximal Promoter Element......... 41 The p5 RBE is not an upstream activation signal ....................................... 50
Activation ofpl19 is not due to read through from p5 .................................. 54
Transactivation ofpl19 can be modeled in the absence of Rep ....................... 60
Which p5 element is primarily responsible for Rep mediated induction of pl19?..64
Transcriptional Analysis of Mutant Rep Proteins ......................................... 67
Generation of Rep Mutant Plasmids ..................................................... 68
Transcriptional Activation of the p 19 Promoter by Rep Mutants .................... 71



vi









Repression of the p5 prom oter .................................................................................. 75

DISCUSSION .................................................................................................................... 79

The RBE is not a typical upstream activation signal ................................................... 79
The p5 RBE is probably an architectural element designed to bring the p5 and the p19 prom oters together ....................................................................................................... 81
Rep Protein Dom ains in AAV Transcriptional Regulation .......................................... 87
Future Directions .......................................................................................................... 96
Conclusions ................................................................................................................... 99

TABLE OF ABBREV IA TION S ..................................................................................... 104

LIST OF REFEREN CES ................................................................................................. 105

BIOGRAPH ICAL SKETCH ........................................................................................... 125



































vil















Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy

ADENOVIRUS INDUCED ADENO-ASSOCIATED VIRUS GENE EXPRESSION IS NOT DEPENDENT ON AAV NON-STRUCTURAL REP PROTEIN By

Daniel Francis Lackner

August 2002

Chairman: Nicholas Muzyczka, Ph.D.

Major Department: Molecular Genetics and Microbiology

The normal lifecycle of Adeno-Associated Virus (AAV) alternates between a

latent, repressed provirus and an actively transcribing viral genome. This switch in gene expression is the combination of cellular and viral factors to promote AAV replication. Previous studies of AAV have indicated regulatory pathways, which maintain the correct AAV transcription levels for productive infection. Autoregulation of the AAV genome is controlled by Rep protein interactions with cellular proteins. The addition of Adenovirus helper activities induce changes in both cellular and AAV transcriptional regulation. This combination of regulatory factors allows the dissection of a complex transcriptional regulation mechanism in a relatively simple genetic system. The dissection of the AAV transcriptional regulation was performed by a series of promoter constructs that would access the factors required for transcriptional activation of the AAV p 19 promoter. Initially, the first promoter constructs containing a single AAV Rep protein binding site were used to determine if the nonstructural Rep protein would function as a viii









transcriptional activator of AAV gene expression. The Rep protein was determined not to be a transcriptional activator but instead to function as a position-dependent inhibitor of p19 promoter activity. This position-dependent inhibition of the AAV p19 promoter activity suggested that the previously characterized Rep and Sp 1 interaction might not be the direct cause of Rep-mediated transactivation. In order to prove that the previous characterized Rep and Sp 1 interaction was not responsible for induction of the p 19 promoter, a novel system of hybrid transcription factors was used to replace the Rep and Sp I proteins. The novel hybrid transcription factors modified from the yeast two-hybrid system, consisted of two different proteins containing a GAL4-DNA binding domain fused to either an interaction domain from p53 or T-antigen. The replacement of the Rep and Sp I binding sites with GAL4 binding sequences in the p19 promoter showed that Rep and Spi1 were not required for transactivation. We conclude that the Rep and SplI transcription factors function as architectural proteins facilitating a DNA loop to form between the Rep binding site in the p5 promoter and the Sp 1 site within the p 19 promoter.






















ix














CHAPTER 1
INTRODUCTION


Eukaryotic Gene Expression

The regulation of eukaryotic gene expression has been shown to be far more complex than the original protein fractionations for RNA polymerase activities suggested. Initial fractionation protocols discovered three distinct RNA polymerases and their respective General or Basal Transcription Factors (GTFs). However, purification of these factors did not restore the complex regulation of transcription in vitro indicating that more factors were required for proper transcriptional regulation. More recent studies have observed that the RNA polymerase II holoenzyme (RNAP II) is about the same size as the ribosome and many other factors are critical for correct gene expression. DNA condensation into chromatin has been shown to regulate gene expression and the exposure of DNA sequences allows the assembly of transcriptional regulators to recruit the complete RNA polymerase II holoenzyme. The Chromatin Template

The DNA template of most promoters for protein-encoding genes contains three important features. The first component is the transcription initiation site that directs the initiation of polymerization of mRNA, which is catalyzed by the RNA polymerase II holoenzyme. The second component is the TATA box which regulates the binding of the TATA binding protein (TBP). The last component is the regulatory sequences






2


surrounding the transcription initiation site and the TATA box of the expressed gene product.

The transcription initiation site and the TATA box are defined as the core

promoter elements. This core element averages about 100 base pairs (bp) in length for most protein encoding genes. The AT-rich sequence named the TATA box is usually found about 25 to 30 bp upstream of the transcription initiation site in higher eukaryotic organisms (179). The TATA box was initially characterized for its ability to bind the TATA binding protein (TBP), a component of the TFIID complex that is important for initiating the formation of the RNA polymerase 11 holoenzyme. The binding activity of this AT-rich region was named for its apparently canonical sequence of TATA but it has been recently observed that TBP can bind to a range of sequences no longer defined by a simple sequence match to the TATA box region (58, 170, 208). In addition to the more common TATA box, many promoters can have an initiator element (Inr) that covers the transcriptional start site and recruits regulatory factors and the RNA polymerase II1(17 1, 172). The core promoter can therefore comprise a TATA and Inr elements (composite), either element alone (TATA- or Inr-directed), or neither element (null) (135). Most viralencoded proteins have composite promoters, most cellular RNAP 11 genes are TATAdirected promoters, and many null promoters have many different transcriptional initiator sites reflecting variable TBP binding positions (51, 79, 111).

The majority of gene regulation on protein-encoding genes functions at the level of upstream activating sequences, upstream repressing sequences, silencers, or locus control regions. Upstream activating sequences (UAS) are defined as sequences of DNA that bind specific transcription factors that promote the recruitment of the RNAP 11 at the






3


core promoter element and activate the initiation of gene expression. These activating sequences can be relatively close to the initiation site which allows activators to bind near the core promoter, thus defining this subgroup of UASs as proximal promoter elements (129, 179). Another subgroup of UASs, defined as enhancers, consist of binding sites for one or more transcriptional activators that function independent of their orientation and can be separated by DNA sequences of 85 kilobasepairs (kb) (15). Upstream repressing sequences (IJRSs) are DNA sequence elements that function negatively toward the recruitment and assembly of the RNA polymerase II holoenzyme at the nearby proximal core promoter element. In contrast to active recruitment by activators, the repressive elements that bind to URSs function in preventing gene expression by different mechanisms. The first mechanism is the passive exclusion of activator binding, thereby preventing the activator from RNA pol11 recruitment. Most commonly, the repressor will have a binding site sequence that is nearby or overlaps the activator, thereby excluding its binding by steric interference of their binding sites. Another active repressor mechanism is the modification of chromatin structure by histone deacetylation, which prevents transcriptional activators from binding their respective DNA sequences.

Silencers are defined as DNA sequence elements that repress promoter activity in an orientation- and position-independent manner (136). The silencer elements contain binding sites that recognize specific protein factors. These protein factors bind the silencer element and interact with chromatin histones H3 and H4. The result of this interaction is a deacetylation of the H3 and H4 histories inducing a condensation of the chromatin structure, thus preventing access and binding of any transcriptional activators.






4


Locus control regions (LCRs) are positive activators of expression for proximal genes but differ from upstream activating sequences in several aspects. After these LCR elements are integrated into cellular chromatin, the enhancer sequences function in an orientation and distance independent manner but the level of gene expression is influenced by the actual site of integration. This effect of integration is defined as position effect variegation because the structure of chromatin can overwhelm the enhancer's effect and the accessibility of transcriptional activators to the enhancer sequence. In contrast to enhancer elements, the locus control regions can always activate transcription when integrated into cellular chromatin because the LCR elements directly interact with the formation of the chromatin structure (44, 49, 55).

The last major chromatin element is the Insulator element which can limit the effects of the other regulator elements. The Insulator elements allow the chromatin template to be subdivided into different functional domains. Each chromatin domain is regulated by various enhancers, UASs, URSs, or LCRs and those respective elements are separated not by distance but by the function of the Insulator elements (10, 11, 182).

Chromatin structure is comprised of a series of nucleoprotein complexes called nucleosomes. A nucleosome contains 146 bp of genomic DNA wrapped around an octomer of histone proteins (92, 226). The octomer is arranged in a cylinder shape composed of two heterodimers of histones H3 and H4 and another two heterodimers of histones H2A and H2B. The nucleosome crystal structure shows DNA wrapped around the cylinder and the contact is maintained by interactions with the histone proteins and the phosphate backbone of the DNA (116). The DNA is bound so that the N-terminus of the histones can interact with other neighboring nucleosomes to form higher order






5


structures. In addition, the DNA and histone interactions are not fixed allowing some promoter sequences to be exposed for gene expression. The degree of chromatin structure and condensation within a promoter region is usually related to the level of transcriptional activation (Fig. 1, A) (56, 142, 152, 212). Many in vitro experiments have observed that transcriptional templates preincubated with chromatin fractions inhibit the initiation of RNA polymerases. In complementing experiments, in vivo yeast experiments which depleted histone proteins increase the transcriptional activity of many different genes (60, 61, 214). These experiments demonstrate how tight histone-DNA contacts and the organization of nucleosomes into higher order structures can limit and sterically inhibit binding of transcription factors to the promoter region. Activation and Repression

An activator is composed of two different functional protein domains (187). The first domain binds the specific DNA sequence within the upstream activating sequence and the second domain functions to recruit or stimulate the activity of the RNA polymerase 11 holoenzyme. A single activator can be used in order to activate multiple genes throughout the genome allowing synchronization of many different gene products. On the other hand, a single gene in the genome can be regulated by many separate transcriptional activators providing the genome a mechanism for variable control.

The main function of transcriptional activators is the binding and recruitment of the transcription initiation apparatus (Fig. 1, B) (15 1). This function has been demonstrated by direct binding between the activation domains of transcription factors and components of the transcription machinery (3, 59). Further evidence for the role of activation domains in binding and recruiting the transcription apparatus is provided by replacing the activation domains with an artificial activator such as a fusion protein




























Fig. 1. A model for the role of activators in transcriptional initiation. A, Genomic DNA is packaged into nucleosomes an higher ordered chromatin structures. B, Transcriptional activators bind to promoter sequences and can have a positive influence on promoter activity. C, Activators bind and recruit chromatin remodeling and modifying complexes that influence local chromatin structure. D, Activators bind and recruit the transcriptional initiation apparatus to promoters through the interactions of a few large complexes. E, Activators can affect the promoter clearance and RNA Polymerase 11 holoenzyme processivity.





7






A

High-Order Chromatin Structures


B I \ilul

Chromatin Activator Binding Remodeling
Complexes



Chromatin Remodeling
RNA Polymerase II Holoenzyme TFIID


TRI


Activators Recruit Transcription Complexes




Active RNA Polymerase
Active RNA Polymerase






8


between a DNA binding domain and corresponding domains from the transcriptional machinery. This artificial activator can substitute for the actual activator in vivo by exhibiting the same functional role in transcriptional activation (5, 26, 215).

Repressors of transcriptional activity usually function in either a general activity or in a very gene-specific manner (105). The general repressors of transcription interact with the TBP. In yeast, Moti represses transcription of some genes by directly binding the TBP-DNA complex and inducing dissociation of TBP from the TATA-box sequence (2, 131, 194). In large eukaryotic organisms, the Drl protein is another general negative regulator of RNA polymerase 11 transcription. The DrI protein binds the basic repeat domain of TBP bound to promoter DNA and prevents the assembly of the RNA polymerase 11 holoenzyme (53, 80, 85).

Gene-specific repressors can function by direct physical interaction with

transcriptional activators or by competition for activator binding sites. One classic model of gene-specific repression is the GAL4 and GAL80 interaction in yeast. The GAL4 transactivator stimulates the expression of yeast genes with a GAL4 binding site. However, the activity of GAL4 can be inhibited by its direct physical interaction with GAL80 (117). The GAL80 protein represses the GAL4 activator by binding and masking a portion of its activation domain (169). Another repressor, chaperone Hsp9O, functions by a different mechanism to inhibit the activity of the transcriptional activator Hsfl. Instead of an interaction which masks the activation domain, the Hsp9O protein prevents the formation of Hsfl trimers required for the binding of the Hsfl activators to its respective DNA element (227). These are two examples of how direct interaction or inhibition of an activator can lower transcriptional activity in a gene-specific manner.






9


Another method of gene-specific repression is steric interference at the level of DNA binding activity. In this mechanism, no direct interaction between an activation and a repressor is necessary. Two transcription factor groups representing activator and repressor activities compete for neighboring DNA promoter sequence. An example of this type of regulation is found between the Acri repressor and the ATFICREB activator (193). Promoters that use steric interference for transcriptional regulation have overlapping Acri and ATF/CREB sites within their promoter regions.

The interaction between activation and repression is also strongly dependent on the expression and concentration levels of the positive and negative transcription factors. A strong experimental example of this interplay between activation and repression can be found in yeast mutational screens that create loss-of- function alleles in negative transcription factors and are complemented by mutations in positive transcriptional activators (104, 149, 150).

Chromatin Modification

The compression of genomic DNA into nucleosomes and higher order chromatin organization provides yet another level of transcriptional regulation. The interactions between the N-terminus of histone proteins allows many different chromatin complexes to form based on the ability of the histones to contact one another. The majority of this variable chromatin structure is regulated by the aceytlation of the N-terminal domains of histories (130, 188, 225). The acetylation of histones induces the disruption of tight, high-order chromatin structures and increases transcription activity. On the other hand, various factors causing histone deacetylation allows the formation of higher-order chromatin structure and results in the repression of transcription.






10


Histone proteins are modified by acetylation, phosphorylation, methylation, and ubiquitination. The acetylation modification is the best understood with several lysines on the N-terminus of each histone protein reversibly acetylated (176). After acetylation, the nucleosomes are less likely to undergo physical interactions and condensation so the exposed DNA sequences may allow increased recruitment of the transcriptional machinery (Fig. 1, C) (63, 224). Additionally, acetylation of histones neutralizes the positively charged lysine groups thereby decreasing the histones affinity for DNA (56, 116). Acetylated histones may also directly interact with transcriptional activators increasing their binding affinities and inducing more RNA polymerase II holoenzyme recruitment (212).

Histone acetyltransferases (HATs) were first identified with transcriptional

activation by the structure and function studies of the Tetrahymena protein, p55. The p55 protein was known to function as a histone acetyltransferase but later studies showed it was related in sequence to the yeast transcriptional cofactor Gcn5 (16). The relationship between these two proteins correlated the activities of histone acetylation and increased transcriptional activation. For experimental evidence, the Gcn5-dependent promoters were shown to have increased acetylation of histones. Additionally, mutations in the HAT domain inhibited the ability of Gcn5 to activate transcription and acetylate promoter histones (96, 200). Several transcriptional coactivators that bind to activators, such as p300 and CBP, have HAT activity. The HAT activity enables them to alter the chromatin structure of proximal promoters after activators bind to DNA (43, 52, Ogryzko, 1996 #3438). Histone Deacetylases (HDACs) were first correlated to transcriptional repression by the identification of purified HDACs that have similarity to transcriptional






11


cofactors (156). As more cellular histone deacetylases were isolated, many were found to be components of corepressors recruited by transcription factors. Basal Transcription Factors

In order for any promoter sequence to function, a number of general transcription factors are required to direct RNA polymerase II to the specific site of transcriptional initiation. The general transcription factors, comprised of TFIIA, TFIIB, TFIID, TFIIE, TFIIF, and TFIIH, are necessary for assembly of RNA polymerase at the core promoter and for transcription initiation (Fig 1, D) (34). The combination of the RNA polymerase II and the basal transcription factors melts the core promoter sequence to create a open complex in which 12 to 15 basepairs (bp) of DNA unwind to form a single-stranded bubble (33, 54, 189). This open complex allows initiation to occur by catalyzing a number of phosphodiester bonds in messenger RNA (mRNA). In most cases of transcription initiation, RNA polymerase II and associated factors initiate transcription and release small mRNA fragments from the open promoter complex (118). Finally, the RNA polymerase II overcomes these abortive initiations to synthesize longer mRNA which extends past the open promoter complex. After 25 to 30 bp, the elongating complex pauses and usually requires stimulation from transcription factors in the promoter complex and modification of the RNAPII to undergo promoter escape and create the entire mRNA transcript (189).

One of the most critical factors for initiating transcriptional activity is the TATABinding Protein. The TBP is similar to a symmetrical molecular saddle on the core promoter DNA (25, 134). When the TBP is bound to a TATA box, the molecular saddle binds the promoter and causes a sharp bend in the DNA strands which induces a partial unwinding of base pairing at the initiation site (84). Along with TBP, the TFIID complex






12

contains the TBP-associated factors or TAFs (18, 192). The TAFs regulate the ability of the TBP to select the specific site of transcriptional initiation. The requirement for the TAFs is most clearly seen in the difference between the TATA-directed core promoters and the Inr-directed or null core promoter elements. The TBP protein is able to initiate transcription on TATA box elements, independent on any TAF proteins in the TFIID fraction. However, for Inr-dependent promoters or null core promoter sequences, the TAF proteins are required for transcriptional activation and interaction with the transcription factors in the URSs (119).

The TFIIA fraction acts directly with TBP and stabilizes the TBP-DNA interaction (120). The protein subunits within TFIIA have direct contacts with transcriptional activators (140, 220). TFIIA may inhibit general transcriptional repressors by displacing or blocking those proteins from their respective effects on TFIID activity (139). The TFIIB fraction has been shown to directly influence the selection and site of trancriptional activation (12, 146). The TFIIB subunit structure seems to set the distance between the core promoter element and the transcriptional start site. This observation is proven by TFIIB mutants which shift the site of initiation because they no longer allow interactions between RNA Polymerase II and the TFIIB fraction (4, 17, 19). Recent crystal structure experiments have shown that the actual distance between TFIIB and the RNA polymerase II catalytic site is about 32 bp which is the average distance between most core promoter TATA box elements and the transcriptional start site (107). TFIIB is able to interact with a large number of transcriptional activators and the resulting interaction is a measure of the effectiveness for that activator in the upstream activating sequence (110, 213).






13

The TFIIF fraction functions to stabilize the preinitiation complex on the core promoter element. This stabilization may be the result of altering the DNA topology. Experiments that crosslink the preinitiation complex to the DNA show that the DNA is wrapped in one complete turn around the preinitiation complex (153). TFIIF is required for this tight wrapping that causes stress in the DNA resulting in promoter melting and open complex formation. The TFIIF factors also function as a transcription elongation factor. This elongation activity may be regulated by its DNA wrapping ability or an intrinsic kinase activity (154).

The TFIIE function may be related to a zinc ribbon motif within its protein

sequence (95). TFIIE can bind single-stranded regions of DNA and enable melting of the core promoter sequence. From experimental data, the requirement of TFIIE in maintaining an open promoter complex can be overcome by a synthetic, premelted promoter sequence (72, 141). The induction and stability of an open promoter complex is related to the actual promoter sequence and the TFIIE requirement has been shown to vary between specific promoter sequences (158, 185). Other functions of the TFIIE fraction may be linked to the TFIIH fraction. TFIIE assembles into the RNA Polymerase II preinitiation complex before TFIIH and may stimulate TFIIH recruitment or the CTD kinase and ATPase activities of TFIIH.

The TFIIH fraction has been characterized into two separate functional

complexes. The first complex encompasses the core TFIIH functions and the second complex acts in a kinase/cyclin function. The core TFIIH contains a DNA-dependent ATPase, an ATP-dependent helicase, and a CTD kinase activity (32). The proteins responsible for these activities, XPB/ERCC3 and XPB/ERCC2, are found within the






14

nucleotide excision repair complex. The XPB helicase is required for promoter opening in vitro and is critical for the conversion from abortive transcription initiation to transcriptional elongation (42, 57, Bradsher, 2000 #3377, 71, 73). The TFIIH kinase/cyclin activities are found within the Cdk7/cyclin H proteins (155, 162, 167). The role of these proteins is to phosphorylate the RNA polymerase carboxy-terminal domain (CTD) (32). The degree of RNA polymerase II CTD phosphorylation is related to the ability to switch from transcription initiation to elongation. RNA Polymerase II Holoenzyme

The purified eukaryotic core RNA polymerase II contains between 10 and 12 different subunits that catalyze DNA-dependent RNA synthesis in vitro. However, the lack of general transcription factors prevents any specific core promoter recognition. The largest subunit of the RNA polymerase II has a carboxy-terminal domain (CTD) that contains tandem repeats of a consensus peptide sequence (Tyr-Ser-Pro-Thr-Ser-Pro-Ser) (35, 221). The CTD domain is essential for cell growth and there are 52 repeats of the consensus peptide sequence in the human RNA Polymerase II (1, 6, 223). CTD regulation is controlled by the amount of phosphorylation on the repeat sequences (37). Within transcription initiation complexes, the RNA polymerase II CTD domains are not phosphorylated and appear to recruit the Srb/Mediator complexes to the RNA polymerase (86, 127). The Srb/Mediator complex functions to transmit the signals from the upstream transcriptional activators to the components of the RNA polymerase II and its basal transcription factors.

After the recruitment and assembly of the RNA polymerase II preinitiation complex, the holoenzyme switches from a transcription initiation complex to an elongation complex through the modification of the CTD phosphorylation state. The two






15

kinases responsible for the CTD phosphorylation are Cdk7 and the Cdk8 proteins (46). The Cdk7 kinase is located within the general transcription factor, TFIIH (115). The TFIIH activity is required for the switch into a stable elongation complex and the Cdk7 kinase phosphorates the CTD subunit allowing release from the initiation complex (42). The Cdk8 protein is a subunit within the Srb/Mediator complex and may regulate transcription elongation through upstream activation factors (Fig. 1, E) (78, 115, 183).

After these two kinases have phosphorylated the RNA polymerase II CTD, the hyperphosphorylated CTD domain promotes the formation of DNA-dependent RNA synthesis along the protein coding sequence. The phosphorylated RNAPII recruits the mRNA capping enzyme to the newly formed transcript and allows mRNA capping to take place soon after promoter clearance (30, 126). In addition to mRNA capping events, the CTD phosphorylation alters the factors and subunits associated with the RNA polymerase II enzyme (137, 208). The Srb/Mediator complex only interacts with the hypophosphorylated CTD and is released with phosphorylation of the CTD. Elongation complexes containing TFIIS are associated with hyperphorylated CTD regions.




Adeno-Associated Virus

Adeno-associated virus (AAV) is a human, single-stranded DNA virus. It has a genome size of 4.7kb that encodes only two open reading frames (ORF), rep and cap (133). These two ORFs are flanked by two inverted terminal repeats that are required for genome replication, integration, and viral packaging (Fig. 2) (219). An AAV productive infection requires the activities of another virus to alter the cellular replication and transcriptional mechanisms. The most widely characterized helper virus for AAV is





























Fig. 2. Structure of the Adeno-Associated Virus Genome. In the upper section of the diagram, the two different open reading frames within AAV are shown by rectangles named Rep and Cap. The locations of the p5, p19, and p40 promoters are demonstrated by bent arrows. The terminal repeats (TR) sequences are diagrammed as darkened boxes at both ends of the AAV genome. The lower portion of the diagram shows the AAV transcripts initiated at their relative promoter location. The left side indicates the transcript size and the molecular weight of the protein is on the right.





17











TR p5 p1 9 p40poyA T



p5

4.2 kb Rep78
3.9 kb
Rep68 p19

3.6 kbRep52
3.3 kb
Rep4O p40

-2.3 kb
ATGvP
ACG 4P
2.3 kb
VP2, VP3






18


Adenovirus. Clinically, AAV is only isolated from patients with adenovirus (Ad) infections (13, 14, 148). However, AAV infection alone has never been associated with any disease. If adenovirus is not present during primary AAV infection, an abortive infection results in an integrated proviral structure (28, 125, 128). Most AAV provirus genomes exhibit site-specific integration events in the human genome (93, 160, 165, 204). These genomes can be rescued by superinfection with adenovirus, which induces both proviral rescue and replication (28, 101, 128). Adenovirus Helper Functions

Several adenovirus genes have been identified that possess specific helper

functions during AAV coinfection (48, 132, 133). The adenovirus EIA gene product functions as a trans-activator for both Ad and AAV promoters. The E1A 289 amino-acid protein expressed during an adenovirus infection binds to transcription factors on the AAV p5 promoter and induces AAV gene expression. The E1B 55-kd protein regulates the post-transcriptional export of viral mRNAs into the cytoplasm. The E2 region encodes the Ad DNA binding protein (Ad DBP). The Ad DP promotes transcriptional activation from the AAV promoters and may enhance AAV DNA replication. The E4 region influences many cellular activities to support both Ad and AAV productive infections. The E4 ORF6 gene product increases the degradation of cyclin A and inhibits the kinase activity of Cdc2 that promotes the cell to remain in late S phase of the cell cycle. The induction into S phase will result in the expression of more DNA replication proteins that will convert the single-stranded viral genomes into double-stranded DNA templates Finally, the VA RNAs of Adenovirus enable the initiation of AAV protein synthesis by overcoming Ad interferon-induced host cell shutdown of translation.






19


AAV Rep Proteins

The AAV genome has three different promoters identified by their map positions of p5, p19, and p40. The p5 and p19 promoters transcribe the rep open reading frame. Rep 78 and its alternatively spliced transcript Rep68 are produced from the p5 promoter. The Rep52 and its spliced transcript Rep40 are transcribed from the internal p 19 promoter. The larger Rep78/68 proteins have many different activities during AAV infection (9, 64, 67, 70, 97, 98, 100, 123). Rep78 and Rep68 have specific DNA binding activity, site- and strand-specific endonuclease activity, DNA and RNA helicase activity, and an ATPase activity (76, 89, 157, 175, 209). In the absence of adenovirus coinfection, the large Rep proteins repress the AAV promoters (74, 98, 143, 205). However, during Ad infection, Rep78/68 exhibit the dual abilities of transcriptional repression on the p5 promoter and transactivation for the p5, p1 9, and p40 promoters. Additionally, a model of AAV replication has been proposed in which the Rep78/68 proteins are responsible for nicking the terminal repeats. The site-specific endonuclease activity of the larger Rep proteins nick the terminal repeats thus creating a free 3'OH for AAV genome replication.

In contrast, the smaller Rep52 and Rep40 proteins have fewer characterized

activities during AAV replication. In the absence of adenovirus infection, these proteins have the ability to repress AAV promoters while not exhibiting any site specific DNA binding activity (74, 77, 97, 98, 138). Recently, Rep52 has been shown to exhibit ATPase and helicase activity. Additionally, the Rep52/40 proteins have been shown to increase the levels of single-stranded monomer during AAV infection. Since singlestranded genome formation correlates with the packaging of AAV particles, Rep52/40 may function in packaging viral particles (27, 74, 98). Recently, King et al. have






20


demonstrated that the Rep52 helicase activity is probably directly involved in AAV packaging (87).

AAV Transcription without Adenovirus

The p5 promoter is the most widely studied promoter in the AAV genome

because of its direct role in the switch between latent and productive infection in the viral lifecycle. Many previous studies demonstrated that no transcripts are detected during the latent state of AAV (31, 100, 123). The initial studies of the p5 promoter determined that the promoter contained a Major Late Transcription Factor (MLTF) binding site and a previously unknown element which was responsive to the E 1A trans-activator of adenovirus. The subsequent cloning of this transcription factor resulted in the identification of the YY1 protein (Ying-Yang protein) named for its dual activities of repression and activation on a downstream promoter (168).

Previous studies in our lab resulted in the identification of another protein binding site in the p5 promoter, the Rep binding element (p5RBE). DNaseI protection and gel shift assays determined that the binding site consisted of a 22 bp sequence (125). Initially, the determination of the p5RBE was performed using purified Rep68 from baculovirus expression vectors. Sequence analysis of the entire AAV genome showed that similar binding sites were located in the A-stem of the terminal repeat as well as the three AAV promoters. The A-stem RBE affinity was shown to be 20 fold higher than the p5RBE while the p19 and p40 binding affinities were 160- and 80- fold less than the A-stem RBE, respectively (125).

AAV Transcription with Adenovirus

Initial analysis of the p19 and p40 promoters was performed in our lab by a novel complementation system (123). Mutational analysis of the two promoters caused direct






21


alterations of the Rep protein sequence in the AAV genome. In order to prevent this problem, the Rep protein was supplied in trans by another plasmid plI9/40S which contained silent mutations in the Rep protein downstream of the p19 and p40 start sites. To analyze the effects of the deletions within the p 19 and p40 promoters, primers were selected that would distinguish between the p 19 and p40 mutant promoter transcripts and the transcripts from the Rep complementing plasmid, p1I9/40S. This allowed the measurement of transcripts by primer extension that were synthesized only from the p 19 and p40 promoter deletions.

The deletion analysis of both the p 19 and p40 promoters was performed in a

series of 5 contiguous 30 bp intervals proximal to each start site. For the p19 promoter, two separated 60 bp regions were necessary for the Rep-mediated activity. One region was identified between positions 153 to -94 and the other was the region from -63 to -4, both upstream of the p 19 start site (Fig. 3A). For the p40 promoter, two regions of Repmediated induction were identified through deletion analysis. One region was the immediately upstream -60 bp region of p40 while the other region required the 15 3 to 94 region upstream of the p 19 promoter.

Another deletion analysis for both p 19 and p40 promoters were performed by progressively larger proximal 5' deletions. The initial deletion named pIM29 dll-320 eliminated the p5 promoter and resulted in p19 and p40 transcript levels that were 5% of wild type levels. This data revealed a vital element for transactivation of the p19 and p40 promoters that was within the p5 promoter region. Subsequent serial deletions resulted in no greater Rep-mediated induction ofpl19 or p40 eliminating the possibility of a transcription factor binding site that represses the p 19 and p40 promoters (Fig. 3B). In
























Fig. 3. AAV Promoters and Promoter Deletion. A, A portion of the plasmid pIM29, containing wild type AAV nucleotides 191 to 4484, is shown with an expanded view of the p19 and p40 promoters. The relative positions of the p19 and p40 promoters are shown by arrows. The locations of the 30bp deletions are diagrammed by lines denoting the nucleotide position relative to the promoter initiation site which precedes each deletion. Below each 30bp deletion, the relative strength of that specific promoter mutant is shown as a precentage of wild type p19 or p40 promoter activity. B, The plasmid pIM29 is shown with the Rep coding region shaded. The relative positions of the p5, p19, and p40 promoters are marked by arrows, and the intron is represented by a bent arrow. Below pIM29, the 5'deletions used in that study and the AAV restriction sites used in their construction are shown in the diagram. They are designated by 29dl followed by the numbers of AAV nucleotides deleted. The relative transcriptional activity of each promoter mutant plasmid was shown as a percentage of the wild type pIM29 plasmid strength.





23






A
p19 p40
-154 -124 -94 -64 -34 -4 -154 -124 -94 -64 -34 -4



%wt
p19 10 10 100 10 <2 100 100 100 100 100

p40 10 30 150 100 100 92 65 25 10 < 2



B

190 p5 p19 p40 4484 p19 p40
I F~l Rep r*[- j,_IplM29 R100 100


29di 1-320 /.... < 5 5


29di 1-687 -* / < 5 5
Sst II

29di 1-809 I5 5
Sst I

29di 1-1044 5
Bam

dl 3-23 M- /--- 100
TR TR






24


contrast, the last two deletion constructs named pIM29 dl1I- 1044 and p1M29 d13-23 differ only by the presence of a terminal repeat. The presence of the terminal repeat caused the Rep-mediated induction of the p40 promoter at wild type levels.

The exact determination of the transcription factors proximal of the p 19 promoter was performed by DNase I protection. This biochemical analysis identified the transcription elements SPl1-50, GGT-1I 10, SP1I- 13 0, and CArG- 140 sites relative to the p19 start site (145). Direct determination for some of these protected regions as true SPI binding sites was performed by competitive gel shifts using SP I oligos and labeled wt AAV fragments. As a result, the -50, -110, and -130 sites were positively identified as SP I binding sites upstream of the p 19 promoter. The CArG- 140 site remained bound during competitive gel shift assays containing a serum response element (SRE) that normally contains authentic CArG-like elements. The next step in the CArG-140 identification procedure was an UTV cross-linking experiment, which identified a protein larger than 34kDa. The combination of a CArG-like binding site and a protein mass of 34 kDa indicated a previously uncharacterized protein. After the identification of each binding site, the actual in vivo function for each site on p 19 activity was tested using mutants in each transcription factor site. In order to do this in vivo, the p19/40S complementation assay was used to compare the effect of Rep-mediated induction on each p 19 promoter mutant. The average p 19 transcript level using the wt AAV genome without terminal repeats (pIM45) complemented with p1I9/40S was normalized to one. The ratio of p 19 transcripts in each of the p 19 promoter mutants with or without Rep+ p1I 9/40S was calculated to determine which elements were responsible for Rep-mediated induction. If the ratio was relatively unaffected, the p 19 element would be vital for Rep-






25


mediated induction ofpl9. From this data, only two sites were greatly affected by the Rep+ p19/40S induction of the p19 promoter. These two sites were the SPI-50 and CArG-140. Each resulted in the reduction of p19 transcripts to 20% of wt p19 promoter levels.

Analysis of the p40 promoter by Dnase I protection assay determined a number of protected elements. These elements were identified as AP1-40, SP1-50, GGT-70, and MLTF-100 binding sites. Two additional biochemical assays, competitive gel shift analysis and UV cross-linking, were performed to confirm the identity of the sites.. The combination of these two procedures determined that the SP 1-50, GGT-70, and MLTF100 sites did have transcription factor binding activities. To test the Rep-mediated response of the p40 promoter in vivo, transcription factor binding mutants were produced for each site. Using the p1I9/40S complementation assay, Rep induction depended only on the SP -50 and TATA -30 binding sites. Additionally, the p40 activity was dependent on the CArG- 140 element of p 19 correlating directly with the previous 153 to -94 bp p40 promoter deletion mutant (144).

This extensive deletion analysis determined that the Rep-mediated induction of both the p19 and p40 promoters required three separate elements. One required region is the proximal SPI-50 element at or in front of each promoter. Another element is a common -153 to -94 p19 region defined as the CArG-140 site. The third and final element appears to be a RBE that can be located in either the left terminal repeat's A-stem RBE or the p5RBE.

To distinguish between the effects of either the p5RBE or the A-stem RI3E on the AAV promoters, a series of RBE mutants were created to define Rep-mediated elements






26


responsible for trans-activation of the p5, p19 and p40 promoters. The AAV genomic subelone lacking terminal repeats (pIM45) was normalized to one for transcript levels from each promoter. The first mutant targeted the p5RBE. As result, the p5 promoter transcription increased by 3.2-fold while the p 19 and p40 promoters decreased by 5-fold. This result indicated the p5RBE had a repressive effect on the p5 promoter while simultaneously transactivating the p 19 and p40 promoters. The next RBE construct had an intact, wild type p5RBE and a wild type A-stem RBE resembling the fully functional AAV terminal repeat. This construct restored the p19 and p40 transcripts to plM45 levels while raising the p5 promoter to 3-fold. The final construct had a wild type Astem RBE and a mutated p5RBE. As a result, this construct exhibited a 8-fold increase in the level of p5 transcripts relative to the plM45 subclone. Additionally, the p 19 and p40 promoters had a 2-fold increase in transcription compared to pIM45 levels. This last construct showed the p5RBE had a direct repressive effect on p5 transcription while the more distal A-stem RBE transactivated the p5 promoter. However, the p5RBE and the A-stem RBE appear to be equivalent and redundant transcriptional elements in Repmediated transactivation of the p19 and p40 promoters. During adenovirus infection, Rep 78 or Rep 68 appeared to behave as a transcription factor that can be both a repressor (of p5) and a transactivator (of p 19 and p40).

Analysis of the Rep binding abilities on both the terminal repeat RBE and the p5RBE show that either the Rep78 or Rep68 proteins were required for trans-activation of the three AAV promoters. The Rep78 and Rep68 proteins were known to interact but no analysis had been performed on the ability of the larger Reps to bind either Rep52/40 or any cellular proteins. The initial analysis for large and small Rep interaction was






27


performed using immunoprecipitation against the larger Rep protein domains and by detecting any Rep proteins with an antibody against the common Rep protein carboxyterminal end. From this immunoprecipitation, the larger Rep proteins were only able to precipitate the Rep52 protein. The in vivo interaction between the large Rep78 and 68 proteins and Rep52 indicated a method of interaction between the Rep78/68 binding element within the TR and the p5RBE, the large Rep proteins, and the smaller Rep52 protein. To detect Rep78/68 effects on the p5RBE, a p5 promoter CAT construct was cotransfected with a constant amount of Rep78/68-expressing plasmid and increasing amounts of a Rep52 plasmid. The result of this titration was the derepression of the p5 promoter through an increasing gradient of Rep52 concentration.

Another suspected Rep78/68 interaction was the common SP 1-50 binding site that is conserved within the parvovirus family. The initial analysis of a Rep78/68 and SP I interaction was performed using a gel supershift assay with an Spl-50 binding site. The positive supershifting gel fragment indicated a direct role for the Rep78/68 interaction with Spl. Trans-activation of the p19 and p40 promoters could result from the Rep78/68 bound to the upstream RBEs and each of the SP1-50 binding sites proximal to each promoter. In order to test a model for DNA looping, an AAV genome fragment containing the p5RBE and the SP 1-50 p1 9 was incubated with purified Rep68 and SP 1 proteins. The mixture was examined by electron microscopy and analyzed by digitized measurements. These measurements showed a conserved DNA looping structure correlating to the direct interaction between the large Rep proteins bound at the p5RBE and the SpI protein at the p19 -50 binding site.






28


Model for Activation of an AAV Productive Infection from Latency

For this model, the proviral structure of AAV is limited to one proximal terminal repeat containing a single A-stem RBE site. The cellular YY1I and MLTF transcription factors are bound to their sites within the p5 promoter. In the absence of adenovirus infection, YY 1 bound at the -60 position of the p5 promoter acts as strong repressor of Rep78/68 transcription (Fig. 4, A) (168). The specific activity of the YY1 -60 binding prevents any trans-activation of the p5, p 19, or p40 promoters through either the terminal repeat or the p5RBE.

During adenovirus infection, the Ad early proteins are responsible for the switch between AAV latency and productive infection. The ElA trans-activating protein provides the first helper function for AAV transcription. The ElA protein has three conserved domains for interaction with cellular cell cycle control proteins. The ElIA CR1I and CR2 regions bind the pRB and p107 proteins. Expression of the adenovirus EIA protein prevents E2F:pRB complex formation. E2F displacement allows the protein to act as a transcription factor for many cellular replication proteins. However, the CR3 region of ElA interacts with the p300 protein in infected cells. This physical interaction between ElIA and p3 00 i s important because the YY1I repressor protein has been shown previously to bind p300. The last 17 amino acids of YY1 are responsible for this interaction and YY1I binding mutants are unable to show an ElIA-mediated response. As a result, the ElA protein binds specifically with a p300:YYl complex on the p5 promoter (24, 103, 108, 168). This binding activity induces a conformational change upon the YY1I protein in a repressive state to expose its activation domain. This change induces p5 promoter trans-activation (Fig. 4, B). After the exposure of the -60 YY1I activation domain, p5 transcription occurs through a mechanism involving the YY1 initiator




























Fig. 4. Loss of AAV Promoter Repression through Adenovirus Infection. A, In the absence of Adenovirus infection, YY 1 and Rep proteins bound at the p5 promoter act as strong repressors of AAV gene expression. B, during Adenovirus infection, the Ad E1A protein binds to the YY I proteins and converts their function as repressors to activators of AAV gene expression.





30








A




p5 P19 p40













p5 P19 p40






31


element. The YY1I initiator element binds to DNA and interacts with the TFIIB complex. The YYI protein is stabilized by its TFIIB interaction facilitating pre-initiation complex formation at the p5 promoter (19 1).

Induction of the p5 promoter results in the increased cellular concentration of Rep78/68. These two proteins bind the RBEs within the AAV genome as a direct function of their increased concentrations. The first RBE bound is the terminal repeat Astem. The binding of Rep 78 and/or Rep 68 trans-activates the p5, p19, and p40 promoters. As a direct result, the levels of larger Reps are increased through transcriptional activation (Fig. 5, A). In addition, the Rep 52/40 and capsid proteins are increased by the A-stem RBE trans-activation upon the p19 and p40 promoters. Rep68 is shown to specifically bind the p5 RBE and trans-activate the p 19 and p40 promoters. After p5RI3E binding, the p5 transcription levels decrease while p19 and p40 transcription levels increase (Fig. 5, B).

As the relative levels of p 19 and p40 promoter directed transcription increase, the Rep 52 and Rep 40 proteins alleviate the repression on the p5 promoter. Previous studies in our lab demonstrated complex formation between the Rep78/68 proteins and Rep52. In addition, the Rep78/68 proteins repress the p5 promoter. However, titration of increasing levels of Rep52 causes derepression of the p5 promoter. The present model supports a feedback mechanism in which the rising amounts of Rep52/40 act on the Rep78/68 proteins bound at the p5RiBE. The Rep52 protein would cause an alteration of the large Reps on the p5RBE to eliminate repression of the p5 promoter (Fig. 5, C).

This feedback loop model between the products of the p5 and p 19 promoters

creates a steady-state level of transcripts. The molar transcript ratios of 1: 10: 100 for the




























Fig. 5. Model of Rep Feedback Regulation between the p5 and p19 Promoters. A, Rep 78/68 bound to TR A-stem sequence transactivates the p5, p19, and p40 promoters. B, Increase of Rep protein concentration allows Rep 78/68 binding to p5 promoter repressing the p5 promoter. Rep bound at p5 promoter transactivates the p19 and p40 promoters. C, Higher p19 transcription creates more Rep52 protein which derepresses the p5 promoter.




33







R
e p5 p19



BP











C
p5 pl9





R
F e
R
e e p5 pl9 9 4
PP






34

p5, p 19, and p40 promoters maintain four relationships. First, the lower level of p5 transcription creates enough Rep78/68 to resolve the terminal repeats while preventing excess endonuclease and helicase activity from eliminating any transcriptionally competent AAV genomes. Second, the increasing Rep78/68 levels are autoregulated by their repression of the p5 promoter. Third, the synthesis of higher levels of Rep52/40 transcripts resulting from p5RBE trans-activation causes the derepression of the p5 promoter thereby increasing the Rep78/68 levels. Fourth, the p40 promoter is relatively unaffected by this feedback inhibition allowing constant transactivation of p40 and synthesis of the capsid transcripts.














CHAPTER 2
MATERIALS AND METHODS


Cell Lines and Virus.

Human A549 cells (ATCC #CCL 185) were maintained in Dulbeco's modified

essential media (DMEM, Gibco BRL) containing 10% bovine calf serum (BCS, HyClone Laboratories Inc.) at 370C in 100mm culture dishes. Adenovirus 5 was grown and titered on 293 cells.


Plasmids

The p5CAT plasmid is the same as the p5CAT 190 plasmid described by Chang et al. (24) and was kindly provided by Tom Shenk. It contains AAV2 nucleotides 190-310 followed by the CAT expression cassette.

The pIM45 plasmid contains the AAV-2 nucleotides 145-4373 in a pBS M13+ vector (Stratagene Corporation). It essentially contains all of the AAV genome except for the terminal repeats.

pAXX is a modified pIM45 plasmid in which stop codons have been inserted by site specific mutagenesis at Rep78 amino acid 71 and at Rep52 amino acid 14. Thus, pAXX is incapable of producing either p5 or p19 Rep proteins, and it was used for the construction of all of the CAT containing plasmids below. pAXX, pIM45 and all other plasmids used in this study were sequenced to insure that the AAV sequences were correct and to confirm the positions of the mutations.

The p l9CAT3 plasmid was created by inserting synthetic oligonucleotides within the pCAT3BASIC plasmid (Promega Corporation) that together reconstructed the 35






36


essential elements of the p19 promoter. The p19 synthetic sequence was created with three pairs ofoligonucleotides that were annealed and then ligated together. The first oligonucleotide pair (cAAP-140) had the sequence 5'CGTCACAAAGACCAGAAATGGCGCCGTCTCGAGTGACAATT-3' that contains AAV nucleotides 722-756 with a mutation that destroys the SPI-130 binding site and converts it into an XhoI restriction site. The second pair of oligonucleotides (pl9XbaSac) had the sequence 5'CTAGATCCGATGAGTGCTACATCCCCAATTACTTGCTCCCCAAAACCCAGCCT

GAGCT-3' that contains AAV nucleotides 757-814 with the GGT-110 binding site converted into an XbaI restriction site. The third pair of oligonucleotides (SPl-50CAT), had the sequence 5'CCAGTGGGCGTGGACCCGCGGGGAACAGTATTTAAGCGCCTA-3' that contained AAV nucleotides 815-869 with the TATA-35 site mutated into a SaclI restriction site. The Spl-130, GGT-110 and TATA-35 sites had been shown previously to have little effect on p 19 transcription. All three oligonucleotide pairs were heated to 900C and annealed together by slowly cooling to room temperature. They were then ligated using T4 DNA ligase (Life Technologies). After ligation, a small amount of the DNA product was used as template in a PCR reaction performed with two primers, pl 9XmaI 5'ATACCCGGGCACAAAGACCAGAAATGGCG-3' and pl 9BglII 5'ATAAGATCTCGTGAGATTCAAACAGGCGCTT-3'. The PCR reaction amplified the synthetic p19 promoter, which was digested with XmaI and BglII and cloned into pCAT3BASIC (Promega Corp.) vector that had been digested with the same restriction enzymes.






37

The p l9CAT3-700 plasmid was created by subcloning an oligonucleotide containing the wild type p5 promoter Rep binding element (p5RBE) sequence, 5'AAGCCCGAGTGAGCACGCAGGGTCTAGTACT-3', into the BsaAI restriction site of the pl9CAT3 plasmid 700 nucleotides upstream of the start of transcription of pl9. The p l 9CAT3-145 plasmid was created by subcloning the wild type p5RBE sequence into the Mlul site at the -145 site of p I9CAT3. The p I9CAT3-100 plasmid was created by subcloning the wild type p5RBE sequence into the XhoI site at the -100 site of pl9CAT3. The pl19CAT3+25 plasmid was created by subcloning the p5RBE sequence into the BglII site at the +25 nucleotide site of pl9CAT3. The pl9CAT3+1225 plasmid was created by subcloning the p5RBE sequence into the +1225 site of pl 9CAT3.

The plM45CAT3 plasmid was constructed by first digesting pAXX with BclI,

which cleaves at AAV nucleotide 965. The linear pAXX DNA was ligated to the BamHI and BclI fragment of pcDNA3.1(+)CAT (Invitrogen Corporation) which contains the CAT gene. plM45 contains AAV nucleotides 145-965 (including all of the p5 and p19 promoters) followed by the CAT gene. The psub262CAT3 plasmid was created in the same way by ligation of the BamHI and BclI fragment from pcDNA3.1(+)CAT into the psub262 plasmid, which contains a mutant p5 RBE.

The plM45CAT3poly A plasmid was created in two steps. The SmaI to NruI fragment from pAXX containing the AAV p5 promoter as well as a portion of the Rep gene (AAV bp 145- 658) was inserted into the BsaAl site ofpl9CAT3; this plasmid was called p5_pl9CAT3. Then, the SmaI and Sfil fragment from the p5_pl9CAT3 plasmid (containing AAV bp 145-544 and the late polyadenylation signal of SV40) was substituted for the NruI to Sfil fragment (containing AAV nucleotides 544-658) in the plM45CAT vector. The resulting plM45CAT3poly A contained AAV nucleotides 145-






38

544, followed by the SV40 late poly A site (563 bp), followed by AAV nucleotides 722869 from pl9CAT3 containing substitutions at Spl-120, GGT-110 and TATA-20, followed by the CAT gene.

The 2xGAL4 plasmid was created by site-directed mutagenesis of the p5RBE and the pl19 SPl-50 sites of plM45CAT3 to GAL4 DNA binding sites. The p5RBE within plM45CAT3 was mutated to a GAL4 DNA binding element using the oligonucleotide sequence 5'GCGACACCATGTGGTCACGCTGGGCCGCGGCGGAAGACTCTCCTCCGAGGGT

CTCC-3'. The p19 promoter SP1-50 site within plM45CAT3 was mutated to a GAL4 DNA binding site using the oligonucleotide sequence 5'CCCCAATTACTTGCTCCCCAAAACTCAGCCTGCGGAAGACTCTCCTCCGACTA

ATATGG-3'.

The pM-53 plasmid expressed a fusion protein of the GAL4 DNA binding domain and the mouse p53 protein containing p53 amino acids 72 to 390. It was supplied in the Mammalian MATCHMAKER Two-Hybrid Assay Kit (Clontech Laboratories). The pMTg plasmid contains the GAL4 DNA binding domain fused to SV40 T antigen amino acids 87-708. The SV40 T-antigen DNA fragment containing amino acids 87 to 708 was removed from the pVP 16-T plasmid (Clontech Laboratories) by EcoRI and SalI digestion and inserted by directional cloning into EcoRI and Sall digested pM plasmid (Clontech Laboratories).

The 2xGAL4 subMLTF plasmid was created by site-directed mutagenesis of plM45CAT3 2xGAL4 using the oligonucleotide 5'GGTCTAGAGGTCCTGTATTAGATACACGCGTGTCGTTTTGCGACATTTTGCGA CACC-3' that resulted in the replacement of the p5RBE site with the Mlul restriction






39

site. The 2xGAL4 subYY1-60 plasmid was mutated at the YY1-60 binding site within the p5 promoter to EcoRI and BamHI sites using the oligonucleotide 5'CCTGTATTAGATACACGCGTGTCGTTGAATTCTGGGATCCGACACCATGTGGT

CACGC-3'. The 2xGAL4 subMLTF, YY1-60 plasmid was created by the site-directed mutagenesis of the 2xGAL4 subMLTF plasmid using the subYY1-60 oligonucleotide sequence 5'CCTGTATTAGATACACGCGTGTCGTTGAATTCTGGGATCCGACACCATGTGGT CACGC-3'. The 2xGAL4 subMLTF, YY1-60, YY1+1 plasmid was created by sitedirected mutagenesis of the 2xGAL4 subMLTF, YY 1-60 plasmid using the oligonucleotide sequence of 5'CGGCGGAAGACTCTCCTCCGAGGGTCTAAATTTTGAAG-3'.


Transfections

Plasmid transfections were performed using cationic liposomes (LipofectAMINE Plus, Life Technologies). Twenty-four hours before transfection, A549 cells were plated in 60mm dishes so the cells were 75% to 90% confluent on the day of transfection. The A549 cell media was removed and 2 ml of serum-free DMEM was added for the transfection procedure. Plasmid DNA was mixed with 250 pl of serum free DMEM containing 8 jl Plus Reagent (Life Technologies) and incubated at room temperature for 15 minutes. The plasmid DNA and Plus Reagent mixture was mixed with 250 pl1 of serum-free DMEM containing 12 pl of LipofectAMINE and incubated for another 15 min. The entire 500 pl of plasmid DNA/LipofectAMINE mixture then was incubated with the A549 cells without serum for three hours. At three hours post-transfection, 2.5 ml of DMEM with 20% bovine serum with or without Adenovirus 5 at a multiplicity of infection (MOI) of 5 pfu/cell was added to the A549 cells. To control for transfection






40


efficiency, each transfection contained 1 pg of pcDNA 3.1(+)gfp and 1.5 p.g of pcDNA3.1(+)p3 gal. Extracts were then assayed for P gal activity using ONPG (Promega) to normalize for the transfection efficiency. In those cases where a linear CAT reporter plasmid was used, a linear 03 gal plasmid was also used.


CAT Reporter Assays

Forty-eight hours post-transfection, the A549 cells were washed with 2 mL PBS and lysed in 400 pl of lysis buffer (CAT Reporter Lysis Buffer, Promega Corporation). The whole cell extracts were vortexed for twenty seconds and heated at 650C for 10 minutes to inactivate endogenous deacetylases. After heat inactivation, the extracts were centrifuged for 2 minutes and the clarified supernatant was transferred to a new tube. CAT activity was measured by a standard chloramphenicol acetylation reaction, which contained in 125 pl: lx lysis buffer (Promega Corp.), 0.2 mM n-Butyryl Coenzyme A (Promega), 10 PM 14C-chloramphenicol (Amersham Pharmacia Biotech, 58 mCi/mmol) and either 4 ptg of protein from an adenovirus-infected extract or 20 jtg of protein from an uninfected extract. The reaction was incubated for 24 hr at 370C and then extracted with 300 pAl of mixed xylenes (Fisher Scientific). The entire upper organic phase containing the acetylated chloramphenicol was back extracted two times with 100 [l of 0.25M TrisHCI pH 8. The amount of acetylated chloramphenicol in 200 pl of the mixed xylenes phase was determined by liquid scintillation counting. Each construct was tested by transfection and CAT assay a minimum of three times. The average CAT activity (as cpm of acetylated product) was calculated after correction for the amount of extract used, and is reported +/- one standard deviation.














CHAPTER 3
RESULTS


Analysis of Adeno-Associated Virus Transcription

The overall goal of my research was to understand the regulation of the AdenoAssociated Virus promoters. In order to perform this analysis, the different AAV promoter elements were to placed upstream of reporter gene constructs which gauged the relative influence of the DNA sequence upon gene expression. In the previous studies of AAV transcriptional regulation, the analysis was performed by isolating a single AAV promoter region and mutating a series of single transcription factor binding sites (123). Another study focused on the effects of a single transcription factor upon all three AAV promoters was performed in the global genomic context of the AAV genome (143). In the context of the AAV genome, redundant transcription factor effects would not be detected through the loss of the single transcription factor. To address the combinatorial effects of multiple regulating factors on the AAV genome, my research goals focused on the determination of the non-structural AAV protein Rep as a transcriptional activator, defining the activity of Rep in AAV gene expression, and the role of a Rep-Sp I interaction in the direct mechanism of AAV transcriptional regulation. Define Rep Binding Element as Enhancer or Proximal Promoter Element

AAV must convert quickly from a latent virus, presumably integrated in

chromosome 19 (93, 160), to a productive, replicating genome following Ad infection (133). To accomplish this, the virus appears to use two factors as a switch. The first is




41






42


Rep protein, which in addition to YY1 and MLTF, binds upstream of the p5 promoter (Fig. 6) to shut off p5 transcription during latency (23, 97, 168). Thus, in the absence of Ad, Rep78 and 68 cooperate with cellular proteins to completely inhibit p5 transcription (143, 203). The second is adenovirus infection. Ad infection leads to Ela and Ad DBP mediated activation of p5 (23, 24, 102), which accomplishes two things. It increases transcription from the p5 and p 19 promoters to produce increased levels of the four Rep proteins (9, 23, 102). Rep78 and 68, in turn, increase transcription from the p19 and p40 promoters to an even higher level (100, 123, 143, 203), while reducing transcription from the p5 promoter (143, 203). Ad infection also independently activates p19 transcription

(9). Thus the p5 and p 19 promoters are repressed by Rep in the absence of Ad and differentially regulated in the presence of helper virus. During the proviral stage, Rep autorepresses its synthesis to prevent excision of the provirus and expression of its gene products. In the presence of the helper virus, Rep induces the synthesis of the p1 9 proteins that required are for encapsidation and maintains the p5 Rep proteins at a lower level to optimize the level of replicating intermediates.

The p5 promoter (Fig. 6) has been shown previously to contain three elements involved in p5 regulIation, an MLTF site at -8 0, a YY1I site at -60, and an RBE at -20 (23, 97, 125, 143, 168). In the absence of Ad infection, specifically ElIa gene expression, all three factors (YY I, MLTF and Rep) repress p5 transcription (24, 74, 97, 98, 143). In the presence of an adenovirus coinfection, YY1 and MLTF both activate p5 transcription

(24). In the case of YY 1, this apparently occurs via an interaction of YYlI and ElIa with the cellular p300 protein (103). Rep, however, continues to repress p5 when bound to the p5 RBE, but is now capable of activating the two downstream promoters, p 19 and


























Fig. 6. Sequences of the p5 and p19 promoters. The known transcription elements in the p5 and p19 promoters are diagrammed along with their approximate positions upstream of the mRNA start sites. p5CAT plasmid contains only the p5 promoter elements driving CAT expression, while pIM45CAT3 contains both the p5 and p19 promoter elements with the p 19 promoter driving CAT expression. Dotted lines indicate intervening sequences that are not shown. Shown in italics are substitutions within the p1I 9CAT3 promoter at 120, -110, and -20 that were previously demonstrated to have little effect on p19 transcription and the sub262 substitution within the p5 RBE that no longer binds Rep protein. Shown in bold italics are the GAL4 substitutions in 2xGAL4 that replace the p5 RBE and the p19 SPI-50 sites. A CREB/ATF site, which has been mapped upstream of the MLTF site in p5, is not shown.





44







p5
206 MLTF-80 YY1 -60
13TCACG AGTGTTTTG C...
TACACGCGTGTC GAATTCTGGGATCC
TATA-20 RBE yyl +1
... G(ITATTTAA13CCCGAGTGAGCACGCJAGGGTCFC CATTTT A
GAA7TCTGGATCCACT AA 294
CGGAAGACTCTCCTCCG

P19

73o cAAP-1 40 SP1 -130 GGT110
C C A G G C C G 0 A G G C G GG-A A C A A FFG-T--G--G--T-G .
SPl-50 TATA-35 TATA-20
..AGCTCC AC GAACAG C CGGAAGACTCTCCTCCG 851


pl 9CAT3

73o cAAP-140 subSP1 -130 subGGT-1 10
C C AG TG' JC G C C G r TC GA G -CTTA13AAC rCGA G ...
SP1 -50 TATA-35 subTATA-20
... CCA C GAACAG C
851






45


p40 (98, 143, 203). In addition to the YY1, RBE and MLTF sites, p5 contains a conventional TATA site (-30) and a YY1 responsive initiator site (+1) (164, 178). In the presence of Rep and Ad gene expression, only mutations in the TATA, YY 1-60 and MLTF sites significantly affect p5 transcription (143).

The p19 promoter (Fig. 6) contains two TATA sites (-30 and -35), which are redundant, two SpI sites (-50 and -130) and a site at -140 that binds an unidentified cellular AAV activating protein (cAAP) (27, 145, 178). Transactivation of the p19 promoter by Rep appears to require both the -50 SpI site and the -140 cAAP site (145). It also requires the p5 RBE (143). In the absence of the p5 RBE, the TR, presumably via its RBE, can transactivate all three promoters (9, 123, 143, 145, 203). Evidence that the RBE within the TR is probably responsible for transactivation comes from deletion analyses of the TR (9, 203). The two RBE elements appear to be redundant with respect to p 19 transactivation at low Adenovirus MOIs but the TR predominates at high Ad MOI (>10) (9, 143, 203). Furthermore, at high multiplicities of infection of Adenovirus (>25), the effect of Rep78 or 68 expression on p19 activity is no longer seen; that is, expression of Ad factors can substitute for Rep78 or 68 (203). Finally, it has been shown that Rep and SpI can directly interact (68, 145), and that Rep bound to the p5 RBE can form a DNA loop with SpI at p19 (144).

Repression by Rep proteins is more complex. In contrast to transactivation,

which appears to require either Rep78 or 68 plus Ad infection, repression of the p5 and p19 promoters occurs in the absence of Ad regardless of which Rep protein is expressed (74, 97). Repression of the p5 promoter depends in part on Rep binding to the p5 RBE but also requires a functional Rep ATPase (97, 98). However, repression of p5 can be






46

seen in the absence of a functional p5 RBE. Furthermore, the p19 promoter, which does not have an efficient RBE binding site, can be repressed by all four Rep proteins, including Rep52 and 40, which lack an RBE binding domain and contain only the Rep helicase and ATPase domains (74, 77, 97, 174).

Our initial hypothesis was that the upstream p5 RBE-Rep complex might behave like an enhancer sequence that activates transcription from downstream promoters. To determine if this were true we made a series ofpl9 CAT constructs (Figs. 7 and 8) in which CAT gene expression was driven by the p 19 promoter. The first set of constructs (Fig. 7) was made to be certain that the CAT constructs would accurately reflect the control of p5 and p19 transcription that is seen with the parental TR minus p1M45 plasmid or with wild type AAV. In this set of constructs (Fig. 7), all of the sequences upstream of the p 19 mRNA start site were identical to those of wild type AAV (pIM45CAT3) or contained a mutation in the p5 RBE (psub262CAT3) that eliminated Rep binding (125, 143). To prevent expression of aberrant Rep proteins from plM45CAT3 and psub262CAT3, both plasmids contained an amber mutation at amino acid 71 of Rep78. This mutation terminated the synthesis of Rep78 while the CAT insertion prevented synthesis of Rep52, so that no Rep proteins could be detected in the absence of a Rep expressing plasmid. With the exception of the terminal repeat, these constructs contain all the sequences necessary for p 19 regulation and p 19 transactivation by Rep (123, 143, 145). The p5CAT plasmid described by Chang et al. (24) was used to monitor expression from the p5 promoter (Fig. 7). It contained all of the sequences upstream of the p5 promoter that have been shown to be necessary for p5 regulation with the exception of the TRs. All of the plasmids used in this study were missing the AAV


























Fig. 7. Activity of the wild type p5 and p19 promoters. A, Diagram of the p5 and p19 promoter elements in the CAT reporter constructs p5CAT, pIM45CAT3 and psub262CAT3. The asterisk indicates a stop codon in the Rep78 open reading frame at amino acid position 71. B-D, Graphic representation of CAT activity from the p5CAT, pIM45CAT3, and psub262CAT3 reporter constructs after transfection in A549 cells in the presence of plasmid alone (Mock), or with the addition of 1 mg of pIM45 (Rep), Adenovirus at an MOI=5 (Ad), or 1 mg of pIM45 and Adenovirus at an MOI=5 (Ad & Rep).





48







RBE p5
0--a
ulwu-MLTF YYI YY1 p5CAT
p5 C"P SP1 P19
AT
A C
pIM45CAT3 p5 P19
I Rep- LO__Or psub262CAT3 Mock 10 6 Rep
Ad
=Ad & Rep .0."% E 105
CL
U

4
10


3
10
T

1 0 2'
P5CAT PIM45CAT3 Psub262CAT3

B C D






49

TRs because we and others have shown that the TRs are redundant activation elements that promote excision and replication, thereby changing the template copy number available for transcription (9, 123, 143, 159, 203).

The three plasmids (p5CAT, pIM45CAT3 and psub262CAT3) were transfected into A549 cells in the presence or absence of a coinfection with Adenovirus (MOI=5) or in the presence or absence of a cotransfection with the wild type Rep expressing plasmid pIM45 (Fig. 7). plM45 was chosen because we and others have shown that the four Rep proteins Rep78, 68, 52, and 40 are expressed at different levels and have differential effects on repression and transactivation of p 19 during productive infection (74, 97, 143), and because pIM45 expresses the Rep proteins at approximately the same relative levels that are seen during wild type viral infection (123, 203). Cells were harvested approximately 40 hours after plasmid transfection and Ad infection and cell free extracts were assayed for CAT activity as described in Methods.

As expected, coinfection with Ad alone significantly induced p5 transcription, approximately 4 fold (Fig. 7 B). This presumably occurs through the interaction of the El a proteins of Ad with the p300-YYI complex bound to the p5 promoter (24, 103, 168). Cotransfection with a Rep expressing plasmid repressed p5 transcription both in the absence (20 fold) and in the presence (12 fold) of Ad coinfection. This has also been observed previously (9, 74, 98, 143) and is due in part to binding of Rep to the p5 RBE. In contrast, p 19 transcription was significantly induced by Rep expression both in the presence and the absence of Ad coinfection, about 5-6 fold (Fig. 7 C). This induction did not occur if the p5 RBE was mutated so that it could no longer bind the Rep protein (Fig.

7 D). Ad coinfection alone also significantly induced pl 9 transcription, approximately






50


80 fold, and this occurred to approximately the same level regardless of whether the p5 RBE element was intact (Fig. 7, C and D). The induction by Ad and Rep appeared to be multiplicative and together they induced transcription from the p 19 promoter by almost 450 fold (Fig. 7 C). p 19 CAT activity in the presence of Rep and Ad was approximately 20 fold higher than p5 CAT activity. This 20 fold difference was approximately the same as that seen late after infection during normal wild type AAV infections when transcripts are compared by other methods such as Northemns (9, 100). Thus, the CAT constructs used in this study seemed to accurately reflect mRNA steady state levels seen during wild type AAV infections or those seen with TR minus plasmid transfections.

Finally, we noted that when basal expression from the psub262CAT3 plasmid was compared with that seen in the presence of the Rep expressing plasmid, there was approximately a 2 fold inhibition ofpl19 transcription (Fig. 7 D). Similarly, when the level of expression in the presence of Ad was compared with expression in the presence of Ad plus Rep, there was approximately a 2 fold inhibition ofpl19 transcription by Rep protein. Thus, expression of the Rep protein caused inhibition of the p19 promoter in the absence of the p5 RBE. This has also been reported previously (9, 97). The p5 RBE is not an upstream activation signal.

Having confirmed that the p5 RBE was essential for Rep mediated induction of p5 transcription, we then asked whether the p5 RBE behaved like a position independent enhancer or like an upstream activation signal. If the p5 RBE behaved like a conventional enhancer or upstream activation sequence, we expected that an artificial construct containing all of the essential p 19 proximal promoter elements would continue to respond to an upstream RBE in the presence of Ad and Rep gene expression. For this purpose we designed a series of CAT constructs in which the p 19 proximal promoter






51


elements were left intact but the upstream AAV sequences, including the p5 promoter were substituted with bacterial DNA. In these constructs the p19 sequences up to -150 bp of the mRNA start site were essentially the same as the wild type sequence (present in pIM45CAT3) except that the TATA site at -35, the GGT site at -110 and the SpI site at 130 were mutated (Fig. 6). These sites had been shown previously to be non-essential for Rep induction or basal p 19 activity (145). The CAT coding sequence was inserted at +92 of the p 19 message and a poiy A signal was inserted upstream of the p 19 promoter to prevent read through from fortuitous upstream polymerase 11 promoters in the bacterial sequences. The p5 RBE signal was then inserted at various positions upstream or downstream of the p 19 promoter. In the control plasmid, p1I9CAT3, the p5 RBE was omitted.

The level of p 19 activation seen with the p1I9CAT3 plasmid in the presence of either Rep or Ad alone was similar to that seen with the parental pLM445CAT3 plasmid that contained all of the upstream AAV sequences including the p5 promoter elements. As expected, Rep did not significantly induce p 19 when Rep and Ad were present together if there was no upstream RBE (Fig. 8 B). Surprisingly, Rep also did not induce p 19 transcription in the presence of both Rep and Ad when an RBE was inserted at -700 upstream of the p19 promoter. This is approximately the same position that the p5 RBE occupies in the parental plasmid pIM45CAT3. Furthermore, Rep did not activate p19 transcription (compare Ad only with Ad plus Rep lanes) regardless of where the RBE was inserted upstream or downstream of the p 19 mnRNA start site. Instead, the RBE acted like a repressor element at most of the positions tested in the presence of both Rep and Ad, and the level of repression increased dramatically as the RBE was inserted closer



























Fig. 8. Effect of RBE position on p19 activity. A, Diagram of transcription elements within the wild type p5 and p19 promoters. B-G, Diagrams of the parental plasmid p 19CAT3 (B) and derivatives of p 19CAT3 C-G, in which an RBE was inserted at various positions with respect to the start of p19 transcription (-700 to +1225). The pl9CAT3 plasmid has the minimum p19 promoter elements as shown in Fig. 6 and no p5 promoter elements. The CAT activity of each construct was determined after transfection into A549 cells in the presence of plasmid alone (Mock), pIM45 (Rep), Adenovirus (Ad) or plM45 and Ad (Ad & Rep).







53

























p5RBE
-600 p5 P19 CAT Activity (cpm)

84W -0-r- wt
MLTFYY1 YYI SP-1 6P op
-60

B CAT--l p19CAT3
POIVA
p5RBE CAT p5RBE
-700

p5RBE
CAT -145


r---l Mock p5RBE F---l Rep
-ioo Ad
Ad & Rep

p5RBE
W 425


CAT p5RBE +1225






54

to the p19 promoter. The most dramatic repression was seen when the RBE was placed at -100 upstream of the p19 start site (compare Fig. 8 B, Ad + Rep with 8 E, Ad + Rep). When the RBE was placed downstream of the p 19 start site (Fig. 8 F and G), some of the p 19 activity was recovered but the RBE continued to generally repress p 19 transcription even when it was placed far downstream at +1225. Curiously, in the presence of only Rep gene expression, p 19 activity was significantly induced over basal levels by Rep when the RBE was placed at -700 or -145.

We concluded from these experiments that the RBE was not a conventional

upstream activation signal or an enhancer. It did appear, however, to have the ability to act as a general repression signal in the presence of adenovirus infection under almost all conditions tested when it was closer than 700 bp upstream or 1200 bp downstream of the p19 promoter. Our data also suggested that Rep itself was probably not an activator and left open the question of how the p5 RBE could transactivate p 19 in the context of the normal AAV sequence.

Activation of p19 is not due to read through from p5.

We considered two other possible mechanisms of p 19 activation by the p5 RBE. One was that transcription from the p5 promoter activated p19 by a read through mechanism. Although poorly understood, this has been shown to occur in the case of the adenovirus El b gene. In this case, active transcription of the El a promoter causes read through activation of the Elb promoter in a cis-dependent manner (45, 121). Ela transcription appears to alter the adenovirus genome into a transcriptionally competent template before Ad DNA replication and late transcription have begun. This possibility was not likely in the case of the p5/p 19 promoters because the p5 RBE inhibited CAT expression (Fig. 7) from the p5 promoter at the same time that it induced CAT expression






55


from the p 19 promoter. However, it remained possible that CAT expression in this study (as well as other steady state mRNA measurements done previously) did not reflect the true firing rate of the p5 promoter. In order to address the possibility that p5 transcription may be transactivating p1 9, two kinds of experiments were done. In the first experiment, we compared p 19 CAT activity from the plM45CAT3 plasmid in the presence of Ad or Ad plus Rep when the physical connection between the p5 and p19 promoters was removed by a restriction digest (Fig. 9). The pIM45CAT3 plasmid was transfected either uncut, cut with Sphl, which cuts outside both the p5 and p19 promoters, or cut with Nru 1, which cuts between the p5 and p 19 promoters. As before, the supercoiled uncut plasmid showed strong activation of the p 19 promoter by Rep in the presence of Ad. This was not seen when the plasmid was linearized by restriction digestion at either restriction site even after the input DNA levels were normalized (see Methods). Thus, Rep induction appeared to require a superhelical template. The difference in CAT expression between the Sphl and Nrul cut plasmids in the presence of adenovirus alone or Ad plus Rep was 2-3 fold. Thus, read through activation was not likely to contribute more than 2-3 fold to p 19 activity.

In the second experiment, we inserted a poly A site between the p5 and p19

promoters of pIM45CAT3 and psub262CAT3. Insertion of a poly A site between p5 and p19 in the psub262CAT3 plasmid had a minimal (2-3 fold) effect on p19 activity (Fig. 10 D and E). This suggested again that relatively little if any p19 transcription relied on read through from the upstream p5 promoter. In contrast, when the p5 RBE was present (Fig. 10 B and C), insertion of the poly A site decreased p19 activity by 10-20 fold under all conditions tested. Regardless of whether a poly A site was inserted, the plasmids that



























Fig. 9. Linearization of plM45CAT3 plasmid to inhibit read through
transactivation. p19 CAT activity from A549 cells transfected with supercoiled pIM45CAT3 plasmid. A, or plasmid that had been linearized by digestion with NruI (B) or SphI (C). For each case the activity in the presence of Adenovirus infection, MOI=5
(Ad) is compared with the activity in the presence Ad infection and transfection with 1 mg of pIM45 (Ad & Rep). The values in (A) are the same as those in Fig. 7C and are presented for comparison.





57






CAT3 ORF

Nrul P19 P40

P5 t
pIM45CAT3



10 6

Sphl
E 5 Ad
COO Ad & Rep,



4
10



10 3
PIM45CAT3 pIM45CAT3-Sphi pIM45CAT3-Nrul
A B c


























Fig. 10. Effect of poly A insertion to inhibit read though activation. A, Poly A sequence was inserted into pIM45CAT3 and psub262CAT3 between the p5 and p19 promoters to determine the effect of a poly A signal on p19 activity when the plasmid was transfected by itself (Mock), in the presence of the Rep expressing plasmid pIM45 (Rep), in the presence of Ad at an MOI of 5 (Ad), or in the presence of both pIM45 and Ad (Rep & Ad). The asterisks indicate that the Rep coding sequence has a stop codon at Rep78 amino acid position 71 to prevent Rep expression from the CAT reporter plasmids. The values in (B) and (C) are the same as those in Fig. 7 C and D and are presented here for comparison.







59





















p5RBE
-600 P5 P19

A
MLTM1 YYI SPA wt CAT Activity (cpm)
-50 id 10, 101 104 or, 106



B C
pIM45CAT3


R PolyA rF--CAT-l
C =Mcck
pIM45CAT3PolyA = R"
MAd
M Rep & Ad

D
psub262CAT3

PolyA
R F CAT
E psub262CAT3PolyA






60


contained a p5 RBE both showed a Rep mediated induction of p19 in the presence of Ad. Taken together, our results suggested that modification of the p 19 plasmid template by a method that could change the secondary structure of the plasmid (restriction digestion) or potentially create new protein complexes in the region between p5 and p 19 (insertion of a poly A site) reduced p 19 activity. However, they did not suggest read through activation as a likely mechanism for p 19 induction.

Transactivation of p19 can be modeled in the absence of Rep.

Thus far, our data were not consistent with the p5 RBE being a conventional

upstream activation signal or with the possibility that it stimulated p 19 transcription by read through from the p5 promoter. If Rep bound to the p5 RBE was not itself a transactivator, we then considered the possibility that it had an architectural role. We had shown previously that Rep bound to the p5 RBE could form a DNA loop via protein interaction with Sp 1 bound to the p 19 promoter (144). It was possible that the interaction between Rep and Sp I served primarily to bring the other p5 transcriptional elements (namely the MLTF and YY1I complexes) to the p 19 promoter, and that one of these elements was primarily responsible for p1 9 activation. If this were true, then it should be possible to substitute the Rep and Sp 1 sites with alternative elements that bound proteins that were capable of interacting.

To test this possibility we substituted both the p5 RBE and the p 19 -50 SplI site within the parental plasmid p1M\45CAT3 with Ga14 binding elements to make the plasmid called MxAL (Fig. 11). Substitution of the RBE and Sp I sites was done so that the spacing in the p5 and p 19 promoters remained the same (Fig. 6). We then tested for p 19 activation in the presence of two Ga14 fusion proteins that contained the well characterized interaction domains of SV40 T antigen and p53 (47, 109) but did not





















Fig. 11. Replacement of Rep & Spl with Hybrid GAL4 Factors. A, The diagram illustrates that the RBE in the p5 promoter and the Spl-50 site in the p19 promoter of pIM45CAT were both replaced with GAL4 binding sites. See Fig. 6 for specific sequence modifications. In the presence of hybrid GAL4-p53 and GAL4-Tag fusion proteins, the remaining p5 promoter elements and their associated protein complexes would be brought into close proximity with the p19 promoter resulting in a DNA loop structure. B, Transactivation of the pIM45CAT3 reporter plasmid when transfected alone (Mock), with lmg of pIM45 plasmid (Rep), with an adenovirus infection, MOI=5 (Ad), or an Adenovirus infection at MOI=5 + pIM45 transfection (Ad & Rep). (This data is identical to that in Fig. 7 B and is presented here for comparison.) C, Transactivation of the 2xGAL plasmid when transfected alone (Mock), with 1 mg of pM-53 plasmid (p53), with 1 mg of pM-Tg plasmid (T-Ag), with 1 mg of both pM-53 and pM-Tg plasmid (p53 & T-Ag), with Ad infection at MOI=5 (Ad), with Ad infection at MOI=5 and the two hybrid plasmids (Ad, p53, T-Ag) or with Ad at MOI=5 and either 1 mg pM-53 (Ad & p53) or 1 mg pM-Tg (Ad & T-Ag).






62









YY1+1 YY1-60 MLTF








1000000 F





100000




mMock
>E Rep
*.m 10000 Ad
0 Ad & Rep


Mp53 & T-Ag =Ad & p53
1000 Ad & T-Ag
I=Ad,p53,T-Ag




pIM45CAT3 2xGAL

B C






63


themselves contain transcriptional activation domains. Substitution of GAL4 binding sites for the p5RBE and p19 SpI -50bp binding sites within the pIM45CAT3 reporter plasmid was expected to allow the GAL4 DNA binding domains to bind DNA and create a DNA loop between the two promoters through the p53 and SV40 T-Antigen interaction domains (Fig. I IA).

As expected, basal p19 CAT activity from the 2xGAL plasmid was low and comparable to that seen with the parental pIM45CAT3 plasmid (Fig. 11, B and C, compare Mock lanes). Expression of the Gal4 DNA binding proteins alone induced p 19 activity by approximately 20 fold while infection with Ad alone induced p 19 activity by approximately 30 fold. However, when both the Gal4 fusion proteins and Ad were present, p19 activity was induced by 350 fold over the basal level. Transfection with only one of the GAL4 fusion plasmids (p53 or T-ag) and infection with Ad did not induce p 19 activation. These results demonstrated that an interaction between an activated p5 promoter, which occurs in the presence of Ad infection, and the p 19 promoter was essential for p19 activation, and that this could be engineered in the absence of Rep and Spl elements. It also suggested that Rep and SpI probably function primarily as architectural proteins and activate p 19 by bringing other p5 elements into close proximity with the p 19 promoter.

The level of p 19 activity seen in the presence of the two Gal4 fusion proteins and Ad was approximately half of that seen in the parental pIM45CAT3 plasmid in the presence of Rep and Ad (compare Fig. 1 B, Rep with I IC, Ad, p53, T-ag). This was consistent with the fact that unlike the pIM45CAT3 plasmid, which binds Rep and SpI at distinct sites, the 2xGAL plasmid could bind the same fusion protein (either T antigen or






64


p53) at each GAL4 binding site (p5 and p 19). When this happened it would lead to little or no interaction between p5 and p 19, and presumably no activation. This would theoretically occur 50% of the time; thus, the 2xGAL plasmid was expected to be activated about half as well as the parental pTM45CAT3 plasmid. Indeed, transfection with only one of the GAL4 fusion proteins in the presence of Ad inhibited the activation normally seen with Ad (Fig. 1 I C, Ad & p5 3 or Ad & T-ag lanes). Alternatively, the Sp I5 0 site may contribute to the basal level of the p 19 promoter or to its ability to be induced by the Ad El a gene product independently of an interaction with the p5 promoter elements.

Which p5 element is primarily responsible for Rep mediated induction of p19?

If the role of the p5 RBE is to bring some other element to the p 19 promoter, which of the known p5 promoter elements (MLTF, TATA or YY 1) is primarily responsible for Rep induced activation in the presence of adenovirus? To determine this we constructed a series of 2xGAL plasmids in which one or more of the other p5 transcription elements were mutated to eliminate binding of its cognate transcription factor (Fig. 6). Mutation of the p5 MLTF site had little effect (about 2 fold) on the final level ofpl19 activity (Fig. 12A and B). Furthermore, p 19 activity was induced in the presence of Ad and both of the hybrid GAL4 fusion proteins, suggesting that MLTF was not critical for p 19 induction (Fig. 1 2B). In contrast, any mutant that included a defective YY 1 -60 site was defective for induction in the presence of both Ad and the GALA factors (Fig. 12C, D, E). This suggested that at least one of the critical elements within the p5 promoter for p 19 activation by a putative Rep-Sp I interaction was the YY 1-60 site.

Two other points became clear from an examination of the mutants. First,

mutation of the YYI1-60 site had a major effect on the basal activity of the p 19 promoter.























Fig 12. Transactivation of the 2xGAL p19 promoter by mutant p5 promoters. The 2xGAL plasmid containing a wild type or mutant p5 promoter was transfected alone (Mock), with 1 mg each of the hybrid GAL4-p53 and GAL4-Tag expressing plasmids, pM-53 and pM-Tg (Hybrid), with an Adenovirus infection at MOI=5 (Ad), or with an Adenovirus infection at MOI=5 and the hybrid GAL4 expressing plasmids (Ad & Hybrid). See Fig. 6 for specific sequence modifications. A, Transactivation of the 2xGAL4 plasmid containing a wild type p5 promoter. (These values are extracted from Fig. 6B and presented here for comparison.) B, Transactivation of the 2xGAL reporter construct lacking the p5 promoter MLTF binding site. C, Transactivation of the 2xGAL reporter construct lacking the p5 promoter YY1 -60 binding site. D, Transactivation of the 2xGAL reporter construct lacking the p5 promoter MLTF and YY1 -60 binding sites. E, Transactivation of the 2xGAL reporter construct lacking the p5 promoter MLTF, YY1
-60, and YY1+1 binding sites.






66















140,000- Mock
Hybrid
,120,000- Ad
E Ad& Hybrid
CL
0100,000> 80,00060,0000
40,00020,0002xGAIA 2xGAL4 2xGAL4 2xGAL4 2xGAL4 subMLTF subYY1-60 subMLTF subMLTF subYY1-60 subYYI-60 subYY1+1

A B C D E






67


Mutation of this site in the p5 promoter increased basal transcription from the p 19 promoter by 100 fold (compare Fig. 1 2A mock with 1 2C mock), and in the presence of Ad, p 19 transcription was increased 10 fold (Fig. 12A, Ad and 12C, Ad). The YY 1-60 element has been shown previously (24, 168) to repress the p5 promoter in the absence of Ad or Rep. Our data (Figs. 1 2A, C) indicates that the YYI1-60 site also has a negative effect on p19 transcription both in the presence and the absence of Ad. In these two cases, no GAL4 fusion proteins were present; thus, interaction between the p5 and p 19 elements through the Ga14 sites was not possible. This means that other kinds of interactions between p5 and p 19 must be occurring in addition to those that occur between the Ga14 sites (ie., the p5 RBE and the p 19 Sp I sites). Second, mutation of the MLTF site also produced an increase (15 fold) in the basal level of p 19 expression (Fig. 12A and B, mock lanes). Like the YY I site, the MLTF site had been shown previously to repress p5 in the absence of Ad (24). Our results indicate that it also represses the p 19 promoter in the absence of Ad, possibly by a set of p5/p 19 interactions that are distinct from those mediated by the YY 1 site and the Ga14 (Rep/Sp 1) sites.


Transcriptional Analysis of Mutant Rep Proteins

Multiple studies of the AAV Rep proteins have demonstrated that the enzymatic activites of Rep could be localized into functional subunits within the protein. However, the complete elimination of one biological activity usually results in the loss of several others. The best example of this interactive effect is the nucleotide binding domain mutations. The loss of this ATPase domain removes Rep trs endonuclease activity and DNA replication but also creates a defect in transcriptional transactivation for both the p19 and p40 promoters (124). As result, a more detailed mutagenesis of the AAV Rep






68

protein was required to identify discrete protein domains for each individual enzymatic activity.

A previous study used the common method of charge-to-alanine mutagenesis for the production of temperature sensitive mutations. After an initial screening of 10 different Rep mutants, they isolated 2 mutants with separate conditional lethal phenotypes. The first mutant had an initial protein instability defect that was characterized as a Mg2+ binding mutation (50). This Mg dependent mutant was not required for Rep DNA binding or helicase but was critical for terminal repeat endonuclease activity. The second mutant was identified as a temperature sensitive mutation that was defective for intracellular replication of AAV. This temperature sensitivity created a 3-log titer difference between the permissive 32C temperature and nonpermissive 39C temperature.

Generation of Rep Mutant Plasmids.

In order to produce a large number of possible AAV Rep ts mutants, a charge-toalanine amino acid mutagenesis approach was performed on the Rep open reading frame. This process is believed to disrupt functional domains on the protein surface and result in conditional lethal mutants. Within the plasmid backbone of pIM45, a noninfectious genomic subclone of the AAV-2 genome, 20 different clusters of charged amino acids were substituted with alanine amino acids (Table 1). The pIM45 plasmid allowed the resulting protein sequence changes to be expressed in all four Rep proteins. Mutagenesis in every Rep protein would allow possible conditional lethals to be assayed for in vivo biological effects. The expression of both Rep78/68 and Rep52/40 mutant proteins could be used to detect conditional lethals within assays for terminal repeat endonuclease activity, DNA replication, and viral transcription. Previous research and site-directed




























Table 1. Biochemical Activities of Rep Alanine Scanning Mutagenesis Panel. In this Table, each Rep mutant was assayed for its ability to function as a possible mutant in Adeno-Associated Virus's known biochemical activities. Within the plasmid backbone of plM45, a noninfectious genomic subclone of the AAV-2 genome, 21 different clusters of charged amino acids were substituted with alanine amino acids.







70




















Amino Acid Change(s) Titer In vivo Replication Binding ATPase m13 helicass, Nick Nick
Double-Stranded No-Stem
Template Template


wild type ++ + + ++ ++ + +

KIOAD14A + ++ ++
D40AD42AD44A ts ts ts ++ ++ ts +
H90AH92A + ++ ++
Y156F + ++
K160AE164A + ++ ++
K340H
E345AH349A + + +
D371AK372A + + ++ +
K381AH385A n/d n/d n/d n/d n1d
E388AK391A + +/- +/- +

E32AK33AE34A ++ + n/d n/d
R68AR69AK72A ++ + n/d n/d
D149AEISOA ++ + n/d n/d
R223A ++ n/d n/d
D233AK234A ++ + n/d n/d
K278AD282A ++ + n/d n/d
E291AD292A ++ n1d n/d
D465AH456AD457A ++ n/d n/d
E481AE482A ++ + n/d n/d
D501AD504A ++ + n/d n/d
D519AE521A -+ + n/d n/d






71


mutagenesis of the AAV Rep protein has resulted in the preliminary identification of a temperature sensitive mutant (50). This mutant D40A, D42A, D44A had a delayed replication phenotype that resulted in a 3 log difference in viral titer between 32C and 39C. We have determined the enzymatic activity affected by this protein sequence change as well as screened a panel of 20 new Rep charge-to-alanine mutants. We have assayed their ability to exhibit a temperature sensitive phenotype and localized the specific enzymatic activities affected within these replication defective mutants. Transcriptional Activation of the p19 Promoter by Rep Mutants.

In order to directly examine the transcriptional activation of each charge-toalanine mutant on the p 19 promoter, pIM45CAT3 was used to assay each Rep mutant for its ability to specifically transactivate the p19 promoter during Adenovirus infection. The pIM45CAT3 construct had a strong level of Rep mediated transactivation that is comparable to previously published results ( Fig. 13 Lanes 1 and 2) (Lackner and Muzyczka in press). However, the cotransfection of several replication defective mutants during an Adenovirus infection resulted in even higher levels of p 19 transcriptional activation (Fig. 13 lanes 3,4,5,6, and 11). One of these mutants, K340H, is the well characterized nucleotide binding mutant (27, 38, 41, 74, 83, 90, 190, 195, 196, 203, 204). Previous studies have shown that this mutant is defective for both ATPase and M13 helicase activity but retains DNA binding activity. Weger et al. (203) have assayed its ability to transactivate the p 19 and p40 promoters which resulted in much higher levels of AAV gene expression. Although this same K340H mutant was unable to stimulate gene expression in an AAV construct containing the terminal repeats, the loss of transcriptional activation was believed to be the result of the loss of DNA replication on the transcriptional template and not its inability to transactivate the p 19 promoter.






























Fig. 13. Transcriptional Activation of the p19 Promoter by Rep Mutant Panel. pIM45CAT3 reporter plasmid was used to assay each Rep mutant protein for its ability to transactivate the p19 promoter. A Rep protein expression plasmid, pIM45, containing the various alanine scanning mutants was co-transfected with Adenovirus to transactivate the p 19 promoter.






73

















500000450000E
0.
C) 400000350000-T

300000- 250000S200000E
a 150000(D 1000000.
500000

vbSY, 1 A 5P ? 66VI






74

Another mutant construct, Y 156F, was used as an experimental control in the pIM45CAT3 transcriptional assay. This mutant has specifically targeted the tyrosine residue at amino acid position 156, which has direct role in the endonuclease cleavage reaction during AAV DNA replication. The AAV terminal repeat is cleaved by the tyrosine residue and substitution of a phenylalanine at this position created a replication defective mutant (39, 173, 195). The Y1 56F mutant had no significant difference in its ability to transactivate the p19 promoter in the pIM45CAT3 plasmid background (Fig. 13 lane 7). This mutant has a functional ATPase and helicase activity (39, 173, 195.)

The three other mutants retain their ATPase and helicase activity but also express much higher levels ofpl9 gene expression (Fig. 13 lanes 3, 4, and 5). All three of these mutants are able to bind the terminal repeat but are unable to nick at the trs site. One reason for this higher expression could be an alteration in Rep-DNA binding on the p5 promoter. The formation of stable Rep protein complexes on the p5 RBE may allow the DNA loop between the p5 and p19 promoters to occur more often and transactivate the p19 promoter through SpI at a much higher rate. Another reason for a higher level of p 19 transactivation may be a difference in binding affinity between the mutated Rep proteins and the Sp I protein bound at the p 19 promoter.

The most interesting result was the dramatic decrease in p 19 promoter

transactivation for the E345A, H349A and D371A, K372A mutants. These mutants have maintained their DNA binding, ATPase, and helicase activities although they are defective in p19 promoter transactivation. The p19 promoter assay using the pIM45CAT3 reporter gene plasmid was defective for both of these mutants as compared to the wt Rep protein. Although they were above the level of p19 transactivation with






75


Adenovirus alone, the mutants did not completely complement the ability of Rep to mediate p 19 transactivation (Fig. 13 lanes 8 and 9). The disruption of Rep mediated transactivation in both of these mutants may be in different protein domain but may affect a similar overall function. The E345A, H349A mutant has an interesting characteristic in that it mutates a potential HMG box that may contribute to a possible mechanism of transactivation. The potential HMG box domain may be responsible for separation of DNA strands and the initiation of gene expression for this mutant Rep protein. The alteration of this protein domain may prevent the correct level of p 19 transactivation through the action of Rep invading the DNA strands at the p5 or terminal repeat. The H1MG box may permit the correct Rep protein complex to form on the p5 promoter and correctly contact the Sp I bound at the p 19 promoter. This requirement of strand invasion may be dependent on helicase activity as well as a functional H1MG protein domain.

The D37 IA, K372A does not appear to directly affect any identifiable protein domains but its location is close to both a strong Rep-Rep interaction domain and a previously identified topoisomerase protein sequence. This protein domain could be responsible for the assembly of large Rep protein complexes that form on the various RBEs within the AAV genome. This mutant does not initially appear to target a critical domain required for Rep-Rep interactions but it appears to have multiple problems regulating the transcriptional activation of the p 19 promoter as well as the ability of Rep to repress the p5 promoter.

Repression of the p5 promoter.

One of the most important characteristics of the AAV lifecycle is to repress the expression of the Rep gene in the absence of an Adenovirus infection (98, 143). In order to localize the Rep protein domain responsible for this biological activity, the entire Rep






76


mutant panel was assayed for its ability to repress p5 transcription in the absence of an Adenovirus coinfection. In this assay of the p5 promoter, the p5CAT3 promoter was transfected into A549 cells and assayed for its ability to be repressed in the presence of a mutant Rep protein. As a negative control, the nonsense mutant Rep, dAXX, was transfected to determine the basal strength of the p5-190CAT promoter (Fig 14 lane 1). When the wt Rep protein was transfected into A549 cells, the transcriptional activity of the p5 promoter is 6% of its basal activity demonstrating a strong level of repression by the Rep protein (Fig. 14 lane 2). It was interesting to note that all of the Rep replication mutants that were defective in transactivation of p 19 were also greatly reduced in their ability to repress the p5 promoter. Strikingly, the two mutants E345A, H349A and D371A,K372A exhibited much lower Rep mediated transactivation of the p 19 promoter and were unable to repress the p5 promoter through Rep-DNA binding activity. Each of these two mutants had 7-fold higher levels of p5 promoter expression resulting from the inability of these Rep proteins to correctly bind the p5 RBE and repressing the promoter (Fig 14 E345A, H349A and D371A,K372A). The modification of the HMG box may result in Rep protein which is unable to correctly assemble large Rep complexes and repress the p5 promoter. The highest degree of lower repression of the p5 promoter is directly related to its distance to the HMG box domain.






























Fig. 14. Transcriptional Repression of the p5 Promoter by Rep Mutant Panel. p5CAT reporter plasmid was co-transfected with various Rep alanine scanning mutations. The basal level of p5 promoter activity was graphically shown as 1.0-fold of activity. The ability of each Rep mutant to repress the p5 promoter was shown as a percentage of p5 basal activity.






78















> 1.0o

.8
0


0
1-06
0 U,)
0.4

(0 0.4o) 0.2
C
0" 0 VI g~













CHAPTER 4
DISCUSSION

To learn more about how the Rep protein controls AAV transcription, we tested several mechanisms of transcriptional control. Using the CAT gene as a reporter, we first confirmed that activation of the p 19 promoter by Rep was dependent on a functional RBE within the p5 promoter (Fig. 7). As expected p 19 activity was significantly reduced in the absence of Rep or in the absence of the p5 RBE, provided that the cells had been infected with adenovirus. This confirmed the results of several previous studies including our own (100, 123, 143, 203). In addition, we measured accurately the induction of the p 19 promoter by Ad infection and Rep expression, and the range from basal to fully induced was almost 3 logs.


The RBE is not a typical upstream activation signal.

We initially expected that Rep would activate the p19 promoter in the same way that its homologue in the autonomous parvovirus family transactivates the p38 capsid promoter. The MVM Rep analog, NS 1, has been shown to induce transcription from the p38 capsid promoter by binding to a nearby NS1I binding site and interacting with an Spi1

-50 site upstream of p38 (94, 113, 114). In the case of NSl, it is clear that a C terminal activation domain is essential for induction (106) and that NS1I binding sites behave like upstream activation signals.

To test this possibility for Rep, the RBE was placed at several positions upstream or downstream of an artificial p 19 promoter that contained the key p 19 promoter




79






80


elements required for Rep activation (Fig. 8). However, surprisingly, the RBE resulted primarily in repression of the p 19 promoter, and in general, repression was most severe when the RBE was closest to the p19 start site. Several points are worth noting about this experiment. First, in the presence of adenovirus infection, Rep was not capable of transactivating the p 19 promoter when only the RB E was inserted into the construct. This clearly showed that the RBE-Rep complex alone was not sufficient for transactivation. It is also consistent with the fact that, to date an activation domain has not been found in Rep. Only the C terminal end of Rep has been found to activate transcription in two hybrid experiments and this region, which is absent in Rep68, is not essential for p 19 or p40 activation (29, 202, 203).

The second point worth noting is that the level of repression depended on the

conditions of measurement and the distance of the RBE from the start of the p19 miRNA. When Ad infected cells were compared with cells infected with Ad and expressing Rep, the repression was modest, at most 4 fold (in the case of the 145 position). When Rep was expressed by itself (in the absence of Ad) there was a 3-7 fold induction of p 19 activity (except in the case of the 100 construct). However, it was clear that placement of the RBE close to the p 19 promoter had a severe effect on p 19 activity. This was true even in the absence of Rep expression when Ad was present (Fig. 8, Ad only lanes), suggesting that a cellular factor as well as Rep were able to interact with the RBE to cause repression. When the RBE was inserted at the -100 position within the p19 promoter, a region previously shown to have no effect on transcription (144). p 19 activity was lower than the basal level under all conditions tested.






81


Repression by Rep protein has been demonstrated for a variety of heterologous promoters as well as the endogenous AAV promoters. These include the SV4O, c-ras, cmyc, c-fos, HPV, HIV and Ad early promoters (7, 8, 66, 74, 82, 91, 97, 143). The mechanism of repression is not clear. Rep has been shown to interact with TBP (69), and one report suggests that Rep may prevent assembly of TFIID complexes on DNA (18 1). Rep also has been shown to bind to the transcriptional activators PC4 (202), Spi1 (68, 145) and Topors (201), and to the protein kinases PKA and PrKX (29, 40). Recently, Cathomen et al. (21, 22) identified a cellular transcription factor ZF5 that binds to the RBE and may contribute to the cellular repression of p19 seen here in the absence of Rep. Rep has also been shown to stimulate some promoters, for example c-sis and CMV (210, 211). At least two mechanisms appear to be involved in Rep mediated repression as first suggested by Kyostio et al. (98). The first mechanism involves binding of Rep to an RBE as in the case of the p5 promoter. The second does not require an RBE but does require a functional ATP binding site in Rep. Presumably, the ATP binding site is needed either to modify the structure of Rep protein-DNA complexes or to modify the transcriptional template via the Rep associated DNA and RNA helicase activities (75, 209). Consistent with the helicase idea, mutations in the Rep protein's helicase motifs have been shown to be negative for transactivation and repression (98, 124). The p5 RBE is probably an architectural element designed to bring the p5 and the p19 promoters together.

Our failure to induce p19 activation in artificial constructs that contained only an upstream RBE suggested two other alternatives, read through activation from the p5 promoter and activation by other elements present in the p5 promoter via a looping mechanism. We found no compelling evidence of read through activation from the p5






82


promoter (Figs. 9 and 10). However, several experiments suggested that the p5 RBE served as a scaffold to bring the p5 promoter elements to the p 19 promoter.

Previous work had shown that if purified Rep and Sp I are incubated with DNA containing the p5 and p 19 promoters, a DNA loop can form between the two promoters via Rep-Sp I interaction (144). In this report, we showed that both the p5 RBlE and the p19 SpI1-50 site can be substituted with GAL4 sites. When this was done, activation of the p 19 promoter no longer required Rep but depended instead on the presence of hybrid GAL4 fusion proteins containing p53 and T antigen interaction domains. Neither fusion protein contained an activation domain of its own, and neither protein could activate p 19 on its own. However, together the two fusion proteins activated p 19 transcription nearly as well as Rep and Sp I (Fig. 11). This demonstrated that the role of the Rep-Sp I interaction was probably to bring transcription complexes assembled on the p5 promoter to the p 19 promoter.

Mutagenesis of the p5 promoter identified at least one element essential for p 19 activation, the YYI -60 site. Mutation of this element eliminated activation by the GAL4 hybrid proteins (Fig. 12). In contrast mutation of the p5 MLTF site did not eliminate activation by the hybrid proteins although it did reduce the level of activation. Our experiments did not exclude the possibility that the YY1+1 site or the TATA site was also involved in activation. However, the combination of mutants in YY 1-60 and MLTF or YY 1-60, MLTF, and YYlI +l were not substantially different the YY 1-60 mutant by itself

In addition to eliminating p 19 activation by Ad and the hybrid proteins, mutation of the YYl1-60 site also produced a substantial increase in basal p 19 expression and Ad






83


induced p 19 expression (Fig. 12). The implication of this is that there are alternative Rep independent interactions between the p5 and p 19 promoters and one of these is mediated by the YYI-60 site in the p5 promoter. The net effect of this interaction is to repress p19 promoter basal and Ad induced activity. Thus, the p5 YYI-60 site represses both the proximal p5 promoter and the downstream p 19 promoter.

Comparison of the YYI1-60 mutant with the parental 2xGAL4 plasmid illustrates one reason for the complexity of AAV transcriptional regulation (Fig. 12). Elimination of this site by mutation increases p19 activity in the presence of Ad to the level seen in the parental plasmid in the presence of Ad and the hybrid factors. Thus, p1 9 could be induced to the level needed during AAV replication without the need for further activation mechanisms (such as Rep) if the YY 1 -60 site were not present. However, as mentioned above, elimination of the YY 1 -60 also increases the basal level of p5 transcription and reduces the Ad induced level of p5 (168). Increasing the basal level of p5 transcription would lead to a virus that is less likely to maintain the latent state because of inappropriate p5 Rep expression. Decreasing the Ad induced level of p5 transcription would reduce the level of AAV DNA replication during productive infection.

To illustrate how p5/p 19 interactions might promote activation or repression of p,19 under different conditions, we have drawn the model in Fig. 15. The model compares the interaction in pIM45CAT3, which contains wild type p5 and p19 sequences, with that in psub262CAT3, which has a mutant p5 RBE. In the wild type p5 promoter (pIM45CAT), Rep binds to the p5 RBE and forms a complex with Sp I bound to the Spi-5O site in the p19 promoter. This places several potential activation regions






























Fig 15. Model of p19 promoter transactivation by interaction with transcription factor complexes bound to p5. See text for details.





85









YY1 REP TATA YY1 MLTF


ElA EIA pIM45CAT3

n I CAT
u
spi TATA


YY1 REP TATAYY1 MLTF
n F-i & U-u v
ElA
psub262CAT3

CAT

S P 1 TATA






86


including those of YYI1, MLTF, and ElI a near the p 19 TATA box to activate p 19 transcription. Meanwhile, within the p5 promoter, Rep binding inhibits p5 transcription either by steric hindrance of basal transcription factors (98), by an enzymatic mechanism involving the Rep ATPase activity (98) or by inhibitory contacts with YY1 or ElIa. When the RBE is absent (psub262CAT) or in the absence of Rep gene expression, the interaction between p5 and p19 is either absent or occurs between different proteins, for example, YY1I and SplI (163). The YY I-Sp I interaction places activating p5 complexes in a different position with respect to the p 19 basal transcription machinery, which may inhibit p19 rather than activating it. Meanwhile, within the p5 promoter, the absence of Rep binding leads to derepression of the p5 promoter (98, 143). The model does not include the contribution of p300 (103) as well as several other cellular and Ad proteins that are likely to be involved, for example, PC4 (202) and DBP (23). In addition, it is likely that other as yet unidentified cellular factors are involved in the complexes that form on the p5 and p 19 promoters. However, the model does illustrate how alternative interactions can be established between the two promoters that lead to repression or activation and emphasizes the role of Rep and YYl1. The next logical step will be to determine precisely what is present in the p5/p 19 complexes in uninfected and Ad infected cells.

Finally, our data also explains a puzzling observation made by Beaton et al (9). This group replaced the p5 promoter sequences upstream of the RBE (including the TATA, YYl1-60, and MLTF sites), with the SV40 ori region containing the promoter elements for early SV40 transcription. Surprisingly, this construct was indistinguishable from wild type AAV, but only if it contained an intact terminal repeat. Deletions of the






87


terminal repeat that removed the TR Rep binding elements were completely defective for AAV transcription. On the other hand, constructs that contained a wild type p5 promoter showed no effect on transcription when the same TR deletions were analyzed. The results obtained with the SV40-AAV hybrids are entirely consistent with our finding that the p5 YYlI site plays a key role in activation ofpl19. Because the TRs are redundant activation elements that contain an RBE, they substituted for the YY I complex that was missing in the SV40-AAV hybrid constructs. However, deletions in the TR that removed the RBE presumably prevented their interaction with the AAV promoters, and thus eliminated AAV transcription. This begs the question as to what transcription elements are present in the TR that can substitute for the p5 elements.


Rep Protein Domains in AAV Transcriptional Regulation

A previous study established that two different Rep mutants were created in this manner and resulted in different phenotypes. One mutant contained a magnesium binding mutation that affected the Rep protein in its trs endonuclease activity (50). The mutation did not affect the ability of the Rep protein to bind the terminal repeat or its helicase activity. However, it was demonstrated that the D4 12A mutant had a diminished ability to interact with Mg2+ ions and an interaction between the Rep D412A mutant and Mg2+ was essential for efficient trs endonuclease cleavage. This data was the first suggestion that a portion of the active DNA cleavage site required a Mg2+ ion and the D412A amino acid.

The second phenotype identified was the first identified conditional lethal

mutation within the AAV-2 Rep protein. The D4OA,D42A,D44A mutant was found to demonstrate a 3-log difference in rAAV titer between 32C and 39C. Examination of this






88

mutant in a replication assay showed a fairly strong delay in DNA replication at the permissive temperature of 32C (50) (Lackner in prep). However, the ts Rep mutant showed a complete lack of activity at 39C. In order to better understand the exact alterations in the D40A,D42A, D44A mutant, we analyzed each of the biochemical activities within this protein. We discovered that the temperature sensitivity was mainly dependent on a defect in DNA binding (Lackner in prep). Alteration of the protein sequence inhibited DNA binding of Rep to a synthetic terminal repeat in the AAV genome. The reduced level of DNA binding resulted in a complete loss of Rep endonuclease activity of the AAV terminal repeat.

An important aspect of this D40A, D42A, D44A mutation could be inferred from its sequence homology with other unrelated proteins such as E. coli DNA J and SV40 TAntigen (Fig. 16). The AAV-2 Rep sequences from amino acids 38 to 42 have a high degree of homology to the chaperone protein domain of DNA J in E. coli and a similar domain of SV40 T-Antigen (20, 166, 177). Based on this protein sequence alignment, the temperature sensitivity of the mutant Rep protein was a result of the disruption of this potential J domain. Similar to its role in SV40 T-Antigen, the potential J-domain within Rep78 may have a direct and stable interaction with the cellular chaperone protein, Hsp70 (62). The J-domain within most polyoma viruses makes direct contacts with the ATPase domain of Hsp70 (20, 88, 122, 161, 166, 197). It has been established through previous studies that the J-domain within SV40 T-Antigen is critical to SV40 DNA replication (20). T-Antigen mutations that affect the J-domain prevent the T-Antigen transactivation of E2F responsive promoters and their subsequent induction in the progression of the cell cycle (177, 180, 222). These same J-domain mutations were




























Fig. 16. Sequence Diagram of Rep Mutagenesis Results. See text for descriptions.






90











Rep 78/52 Functional Map


REP78 Moto I helix I j-domain helix 2
1 f YF i vi 1p gis,:sfvnwv a w 1 :s:BM(@1 n 1 i q
motif 2
51 ap1tva 1q ,-'f ltcw rv siap alf fv qf ekig-, sYfLi- mhvl :ttgv
glycine
'ksmv1grf1s qir-% ,Jiq:,i y gi-ptlpn wfavtktrng a.q.rq .... .....
motif 3 helix 3 turn helix 4 coil
151 !n lpk tqp,-Wqvavt nm.-q lsac: n1t 1va q7 lt vsgtq
no AAV5 homoloqv REP52
201 : Pvir-skt sa lvdkgits qwiq :qas

251 isfnaasnsr sqikaaldna gkims1t ta pii,,,1vgqqpv edissnri-;'k
A

301 lelngydpq yaasvflgwa tkkfgkrnti wifci attcrk t iaeaiaht I B,
P-'ooP
B topo domain 1 GG box
vpf,,,gcvnwt nenfpfndcv dkmviww@& &takv kail kvr
351 B,
F mg+2 TPGR box DEAD box F401 vdqkckssaq icl p s ntnmca[viag nsttfehqqp lqk Fmf@fel

451 trrl@h@fgk vt@qov@C)ff rvaW vv@v'@h fyvkJkgq akkrpapsda
Nu Lo REP68 Nu Lo
501 dise ,: krvre svaqpsts.-a .4 kasinyadty qnkcsrhvgm nlmlfpcrqc

551 ermnqnsnic fthgqkdcle cfpvsesqpv svvkkayqkl cyihhimgkv

601 pdactacd1v nvdlddcife q (larghsl)




TR Binding
Helicase ATPase Interaction
HSV6rep / Hox Homologies






91

deficient in their capability to bind to Hsp70. The J-domain on SV40 T-Antigen has been identified as a necessary requirement for nuclear localization (216). Direct interaction of the T-Antigen J-domain with Hsp70, results in complementation of a SV40 T-Antigen mutant containing a nuclear translocation and cellular transformation mutation (81). Although the nuclear localization domain of Rep has been localized to amino acids 483 to 519, this J-domain may explain many of the roles for Rep in DNA replication and modification of the cell cycle (99, 186, 198, 199, 206, 207). In SV40, this region has been shown to function as a molecular chaperone mediating phosphorylation of the TAntigen associated proteins p107 and p130 (180). This same protein domain in Rep may explain its role in interference with viral replication and oncogenicity in SV40, papilloma, and herpesviruses (65, 90, 100, 217, 218). The most likely explanation of the ability of Rep to inhibit cellular transformation after SV40 coinfection could be through a domain negative phenotype. The ability of T-Antigen to promote oncogenesis depends on two factors, the J-domain and the pRB-binding motif(147). The presence of another J-domain containing protein, Rep78, would act as a domain negative protein during an AAV and SV40 coinfection. The Rep78 protein could possibly interact with p107 and p130 but would be unable to fully overcome the G1 arrest or E2F-repression of the cell cycle promoters as a result of its inability to bind pRB. However, in regards to the D40A,D42A,D44A replication mutant, this targeted mutation may disrupt both DNA binding and direct assembly of replication complexes on the AAV terminal repeats. We have demonstrated that the mutation directly inhibits DNA binding and as a result prevents trs endonuclease activity. In addition to its defect in DNA binding, this Rep ts mutant may be defective in its ability to recruit active replication complexes due to this J-




Full Text
xml version 1.0 encoding UTF-8
REPORT xmlns http:www.fcla.edudlsmddaitss xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.fcla.edudlsmddaitssdaitssReport.xsd
INGEST IEID EHFX8XRWX_LTX7PS INGEST_TIME 2014-10-09T23:59:12Z PACKAGE AA00025790_00001
AGREEMENT_INFO ACCOUNT UF PROJECT UFDC
FILES


ADENOVIRUS INDUCED ADENO-ASSOCIATED VIRUS GENE EXPRESSION IS
NOT DEPENDENT ON AAV NON-STRUCTURAL REP PROTEIN
By
DANIEL FRANCIS LACKNER
A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY
UNIVERSITY OF FLORIDA
2002

Copyright 2002
by
Daniel Francis Lackner

This work is dedicated to both of my parents, John and Sally Lackner.

ACKNOWLEDGMENTS
In my lab, I would like to thank a great number of people. First, I would like to
thank Bill McDonald. He was the unfortunate postdoc that had to sit next to me as a first
year graduate student. He answered every stupid question I ever asked and taught me to
form the really important ones. Two other important postdocs were Christian and
Corrina. Dr. Teshendorf introduced me to the wonders and peculiarity of the European
lifestyle from the German perspective. He will be the measure to which I compare all
future medical doctors. Corrina has exposed me to the Spanish version of the European
lifestyle and created my entire knowledge of the neuroscience field.
I have enjoyed the large number of Chinese postdocs in the lab, which introduced
me to the Chinese culture. Wei-jin, Pei, Wu, Yan, and Long-Gon have taught me the
limited amount of Mandarin that I can speak in everyday conversation. More
importantly, they showed me the similarities of China and American society but also the
differences between the two cultures. This exposure to a different culture has been one of
the most rewarding experiences in the Muzyczka lab.
Rodney and Opie have always been my lab mates and have made the experience
one to long remember. They have been a great deal of entertainment and have made the
process of getting a Ph.D. a great deal of fun. I would choose no one else to spend these
years with at UF and they will always make me laugh.
Ken and Kevin have been great mentors even through we are the same age. I
respect their opinions and have had no better time than discussing any aspect of AAV
IV

biology with these two great postdocs. They have taught me more than they know and I
know they will do great in their future careers.
Without question, the enduring support of my parents, John and Sally, has
enabled me to complete this Ph.D. dissertation. During many phone calls, their own
interest in my work has inspired me to explain many different aspects of basic AAV and
Adenovirus biology. I cannot thank them enough for everything they have done for me.
I would like to give a very important acknowledgement and thanks to my wife,
Dr. Cari Aspacher Lackner. From the beginning of my graduate career, she has been a
great source of happiness and a great companion in scientific research. I have always had
her as a research consultant and aspired to be her equal as a bench scientist.
v

TABLE OF CONTENTS
Eige
ACKNOWLEDGMENTS iv
ABSTRACT viii
INTRODUCTION 1
Eukaryotic Gene Expression 1
The Chromatin Template 1
Activation and Repression 5
Chromatin Modification 9
Basal Transcription Factors 11
RNA Polymerase II Holoenzyme 14
Adeno-Associated Virus 15
Adenovirus Helper Functions 18
AAV Rep Proteins 19
AAV Transcription without Adenovirus 20
AAV Transcription with Adenovirus 20
Model for Activation of an AAV Productive Infection from Latency 28
MATERIALS AND METHODS 35
Cell Lines and Virus 35
Plasmids 35
Transfections 39
CAT Reporter Assays 40
RESULTS 41
Analysis of Adeno-Associated Virus Transcription 41
Define Rep Binding Element as Enhancer or Proximal Promoter Element 41
The p5 RBE is not an upstream activation signal 50
Activation of pl9 is not due to read through from p5 54
Transactivation of pi 9 can be modeled in the absence of Rep 60
Which p5 element is primarily responsible for Rep mediated induction of pi 9? .... 64
Transcriptional Analysis of Mutant Rep Proteins 67
Generation of Rep Mutant Plasmids 68
Transcriptional Activation of the pi 9 Promoter by Rep Mutants 71
vi

Repression of the p5 promoter.
75
DISCUSSION 79
The RBE is not a typical upstream activation signal 79
The p5 RBE is probably an architectural element designed to bring the p5 and the pi9
promoters together 81
Rep Protein Domains in AAV Transcriptional Regulation 87
Future Directions 96
Conclusions 99
TABLE OF ABBREVIATIONS 104
LIST OF REFERENCES 105
BIOGRAPHICAL SKETCH 125
vii

Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy
ADENOVIRUS INDUCED ADENO-ASSOCIATED VIRUS GENE EXPRESSION IS
NOT DEPENDENT ON AAV NON-STRUCTURAL REP PROTEIN
By
Daniel Francis Lackner
August 2002
Chairman: Nicholas Muzyczka, Ph.D.
Major Department: Molecular Genetics and Microbiology
The normal lifecycle of Adeno-Associated Virus (AAV) alternates between a
latent, repressed provirus and an actively transcribing viral genome. This switch in gene
expression is the combination of cellular and viral factors to promote AAV replication.
Previous studies of AAV have indicated regulatory pathways, which maintain the correct
AAV transcription levels for productive infection. Autoregulation of the AAV genome is
controlled by Rep protein interactions with cellular proteins. The addition of Adenovirus
helper activities induce changes in both cellular and AAV transcriptional regulation.
This combination of regulatory factors allows the dissection of a complex transcriptional
regulation mechanism in a relatively simple genetic system. The dissection of the AAV
transcriptional regulation was performed by a series of promoter constructs that would
access the factors required for transcriptional activation of the AAV pi 9 promoter.
Initially, the first promoter constructs containing a single AAV Rep protein binding site
were used to determine if the nonstructural Rep protein would function as a
viii

transcriptional activator of AAV gene expression. The Rep protein was determined not
to be a transcriptional activator but instead to function as a position-dependent inhibitor
of pl9 promoter activity. This position-dependent inhibition of the AAV pl9 promoter
activity suggested that the previously characterized Rep and Spl interaction might not be
the direct cause of Rep-mediated transactivation. In order to prove that the previous
characterized Rep and Spl interaction was not responsible for induction of the pi 9
promoter, a novel system of hybrid transcription factors was used to replace the Rep and
Spl proteins. The novel hybrid transcription factors modified from the yeast two-hybrid
system, consisted of two different proteins containing a GAL4-DNA binding domain
fused to either an interaction domain from p53 or T-antigen. The replacement of the Rep
and Spl binding sites with GAL4 binding sequences in the pi9 promoter showed that
Rep and Spl were not required for transactivation. We conclude that the Rep and Spl
transcription factors function as architectural proteins facilitating a DNA loop to form
between the Rep binding site in the p5 promoter and the Spl site within the pi9
promoter.
IX

CHAPTER 1
INTRODUCTION
Eukaryotic Gene Expression
The regulation of eukaryotic gene expression has been shown to be far more
complex than the original protein fractionations for RNA polymerase activities
suggested. Initial fractionation protocols discovered three distinct RNA polymerases and
their respective General or Basal Transcription Factors (GTFs). However, purification of
these factors did not restore the complex regulation of transcription in vitro indicating
that more factors were required for proper transcriptional regulation. More recent studies
have observed that the RNA polymerase II holoenzyme (RNAP II) is about the same size
as the ribosome and many other factors are critical for correct gene expression. DNA
condensation into chromatin has been shown to regulate gene expression and the
exposure of DNA sequences allows the assembly of transcriptional regulators to recruit
the complete RNA polymerase II holoenzyme.
The Chromatin Template
The DNA template of most promoters for protein-encoding genes contains three
important features. The first component is the transcription initiation site that directs the
initiation of polymerization of mRNA, which is catalyzed by the RNA polymerase II
holoenzyme. The second component is the TATA box which regulates the binding of the
TATA binding protein (TBP). The last component is the regulatory sequences
1

2
surrounding the transcription initiation site and the TATA box of the expressed gene
product.
The transcription initiation site and the TATA box are defined as the core
promoter elements. This core element averages about 100 base pairs (bp) in length for
most protein encoding genes. The AT-rich sequence named the TATA box is usually
found about 25 to 30 bp upstream of the transcription initiation site in higher eukaryotic
organisms (179). The TATA box was initially characterized for its ability to bind the
TATA binding protein (TBP), a component of the TFIID complex that is important for
initiating the formation of the RNA polymerase II holoenzyme. The binding activity of
this AT-rich region was named for its apparently canonical sequence of TATA but it has
been recently observed that TBP can bind to a range of sequences no longer defined by a
simple sequence match to the TATA box region (58, 170, 208). In addition to the more
common TATA box, many promoters can have an initiator element (Inr) that covers the
transcriptional start site and recruits regulatory factors and the RNA polymerase II (171,
172). The core promoter can therefore comprise a TATA and Inr elements (composite),
either element alone (TATA- or Inr-directed), or neither element (null) (135). Most viral-
encoded proteins have composite promoters, most cellular RNAP II genes are TATA-
directed promoters, and many null promoters have many different transcriptional initiator
sites reflecting variable TBP binding positions (51, 79, 111).
The majority of gene regulation on protein-encoding genes functions at the level
of upstream activating sequences, upstream repressing sequences, silencers, or locus
control regions. Upstream activating sequences (UAS) are defined as sequences of DNA
that bind specific transcription factors that promote the recruitment of the RNAP II at the

3
core promoter element and activate the initiation of gene expression. These activating
sequences can be relatively close to the initiation site which allows activators to bind near
the core promoter, thus defining this subgroup of UASs as proximal promoter elements
(129, 179). Another subgroup of UASs, defined as enhancers, consist of binding sites for
one or more transcriptional activators that function independent of their orientation and
can be separated by DNA sequences of 85 kilobasepairs (kb) (15). Upstream repressing
sequences (URSs) are DNA sequence elements that function negatively toward the
recruitment and assembly of the RNA polymerase II holoenzyme at the nearby proximal
core promoter element. In contrast to active recruitment by activators, the repressive
elements that bind to URSs function in preventing gene expression by different
mechanisms. The first mechanism is the passive exclusion of activator binding, thereby
preventing the activator from RNA pol II recruitment. Most commonly, the repressor
will have a binding site sequence that is nearby or overlaps the activator, thereby
excluding its binding by steric interference of their binding sites. Another active
repressor mechanism is the modification of chromatin structure by histone deacetylation,
which prevents transcriptional activators from binding their respective DNA sequences.
Silencers are defined as DNA sequence elements that repress promoter activity in
an orientation- and position-independent manner (136). The silencer elements contain
binding sites that recognize specific protein factors. These protein factors bind the
silencer element and interact with chromatin histones H3 and H4. The result of this
interaction is a deacetylation of the H3 and H4 histones inducing a condensation of the
chromatin structure, thus preventing access and binding of any transcriptional activators.

4
Locus control regions (LCRs) are positive activators of expression for proximal
genes but differ from upstream activating sequences in several aspects. After these LCR
elements are integrated into cellular chromatin, the enhancer sequences function in an
orientation and distance independent manner but the level of gene expression is
influenced by the actual site of integration This effect of integration is defined as
position effect variegation because the structure of chromatin can overwhelm the
enhancer’s effect and the accessibility of transcriptional activators to the enhancer
sequence. In contrast to enhancer elements, the locus control regions can always activate
transcription when integrated into cellular chromatin because the LCR elements directly
interact with the formation of the chromatin structure (44, 49, 55).
The last major chromatin element is the Insulator element which can limit the
effects of the other regulator elements. The Insulator elements allow the chromatin
template to be subdivided into different functional domains. Each chromatin domain is
regulated by various enhancers, UASs, URSs, or LCRs and those respective elements are
separated not by distance but by the function of the Insulator elements (10, 11, 182).
Chromatin structure is comprised of a series of nucleoprotein complexes called
nucleosomes. A nucleosome contains 146 bp of genomic DNA wrapped around an
octomer of histone proteins (92, 226). The octomer is arranged in a cylinder shape
composed of two heterodimers of histones H3 and H4 and another two heterodimers of
histones H2A and H2B. The nucleosome crystal structure shows DNA wrapped around
the cylinder and the contact is maintained by interactions with the histone proteins and
the phosphate backbone of the DNA (116). The DNA is bound so that the N-terminus of
the histones can interact with other neighboring nucleosomes to form higher order

5
structures. In addition, the DNA and histone interactions are not fixed allowing some
promoter sequences to be exposed for gene expression. The degree of chromatin
structure and condensation within a promoter region is usually related to the level of
transcriptional activation (Fig. 1, A) (56, 142, 152, 212). Many in vitro experiments have
observed that transcriptional templates preincubated with chromatin fractions inhibit the
initiation of RNA polymerases. In complementing experiments, in vivo yeast
experiments which depleted histone proteins increase the transcriptional activity of many
different genes (60, 61, 214). These experiments demonstrate how tight histone-DNA
contacts and the organization of nucleosomes into higher order structures can limit and
sterically inhibit binding of transcription factors to the promoter region.
Activation and Repression
An activator is composed of two different functional protein domains (187). The
first domain binds the specific DNA sequence within the upstream activating sequence
and the second domain functions to recruit or stimulate the activity of the RNA
polymerase II holoenzyme. A single activator can be used in order to activate multiple
genes throughout the genome allowing synchronization of many different gene products.
On the other hand, a single gene in the genome can be regulated by many separate
transcriptional activators providing the genome a mechanism for variable control.
The main function of transcriptional activators is the binding and recruitment of
the transcription initiation apparatus (Fig. 1, B) (151). This function has been
demonstrated by direct binding between the activation domains of transcription factors
and components of the transcription machinery (3, 59). Further evidence for the role of
activation domains in binding and recruiting the transcription apparatus is provided by
replacing the activation domains with an artificial activator such as a fusion protein

Fig. 1. A model for the role of activators in transcriptional initiation. A, Genomic
DNA is packaged into nucleosomes an higher ordered chromatin structures. B,
Transcriptional activators bind to promoter sequences and can have a positive influence
on promoter activity. C, Activators bind and recruit chromatin remodeling and
modifying complexes that influence local chromatin structure. D, Activators bind and
recruit the transcriptional initiation apparatus to promoters through the interactions of a
few large complexes. E, Activators can affect the promoter clearance and RNA
Polymerase II holoenzyme processivity.

7
High-Order Chromatin Structures
B
C
annum
chromatin Activator Binding
Remodeling
Complexes
Transcription Complexes

8
between a DNA binding domain and corresponding domains from the transcriptional
machinery. This artificial activator can substitute for the actual activator in vivo by
exhibiting the same functional role in transcriptional activation (5, 26, 215).
Repressors of transcriptional activity usually function in either a general activity
or in a very gene-specific manner (105). The general repressors of transcription interact
with the TBP. In yeast, Motl represses transcription of some genes by directly binding
the TBP-DNA complex and inducing dissociation of TBP from the TATA-box sequence
(2, 131, 194). In large eukaryotic organisms, the Drl protein is another general negative
regulator of RNA polymerase II transcription. The Drl protein binds the basic repeat
domain of TBP bound to promoter DNA and prevents the assembly of the RNA
polymerase II holoenzyme (53, 80, 85).
Gene-specific repressors can function by direct physical interaction with
transcriptional activators or by competition for activator binding sites. One classic model
of gene-specific repression is the GAL4 and GAL80 interaction in yeast. The GAL4
transactivator stimulates the expression of yeast genes with a GAL4 binding site.
However, the activity of GAL4 can be inhibited by its direct physical interaction with
GAL80 (117). The GAL80 protein represses the GAL4 activator by binding and masking
a portion of its activation domain (169). Another repressor, chaperone Hsp90, functions
by a different mechanism to inhibit the activity of the transcriptional activator Hsfl.
Instead of an interaction which masks the activation domain, the Hsp90 protein prevents
the formation of Hsfl trimers required for the binding of the Hsfl activators to its
9
respective DNA element (227). These are two examples of how direct interaction or
inhibition of an activator can lower transcriptional activity in a gene-specific manner.

9
Another method of gene-specific repression is steric interference at the level of
DNA binding activity. In this mechanism, no direct interaction between an activation
and a repressor is necessary. Two transcription factor groups representing activator and
repressor activities compete for neighboring DNA promoter sequence. An example of
this type of regulation is found between the Acrl repressor and the ATF/CREB activator
(193). Promoters that use steric interference for transcriptional regulation have
overlapping Acrl and ATF/CREB sites within their promoter regions.
The interaction between activation and repression is also strongly dependent on
the expression and concentration levels of the positive and negative transcription factors.
A strong experimental example of this interplay between activation and repression can be
found in yeast mutational screens that create loss-of-function alleles in negative
transcription factors and are complemented by mutations in positive transcriptional
activators (104, 149, 150).
Chromatin Modification
The compression of genomic DNA into nucleosomes and higher order chromatin
organization provides yet another level of transcriptional regulation. The interactions
between the N-terminus of histone proteins allows many different chromatin complexes
to form based on the ability of the histones to contact one another. The majority of this
variable chromatin structure is regulated by the aceytlation of the N-terminal domains of
histones (130, 188, 225). The acetylation of histones induces the disruption of tight,
high-order chromatin structures and increases transcription activity. On the other hand,
various factors causing histone deacetylation allows the formation of higher-order
chromatin structure and results in the repression of transcription.

10
Histone proteins are modified by acetylation, phosphorylation, methylation, and
ubiquitination. The acetylation modification is the best understood with several lysines
on the N-terminus of each histone protein reversibly acetylated (176). After acetylation,
the nucleosomes are less likely to undergo physical interactions and condensation so the
exposed DNA sequences may allow increased recruitment of the transcriptional
machinery (Fig. 1, C) (63, 224). Additionally, acetylation of histones neutralizes the
positively charged lysine groups thereby decreasing the histones affinity for DNA (56,
116). Acetylated histones may also directly interact with transcriptional activators
increasing their binding affinities and inducing more RNA polymerase II holoenzyme
recruitment (212).
Histone acetyltransferases (HATs) were first identified with transcriptional
activation by the structure and function studies of the Tetrahymena protein, p55. The p55
protein was known to function as a histone acetyltransferase but later studies showed it
was related in sequence to the yeast transcriptional cofactor Gcn5 (16). The relationship
between these two proteins correlated the activities of histone acetylation and increased
transcriptional activation. For experimental evidence, the Gcn5-dependent promoters
were shown to have increased acetylation of histones. Additionally, mutations in the
HAT domain inhibited the ability of Gcn5 to activate transcription and acetylate promoter
histones (96, 200). Several transcriptional coactivators that bind to activators, such as
p300 and CBP, have HAT activity. The HAT activity enables them to alter the chromatin
structure of proximal promoters after activators bind to DNA (43, 52, Ogryzko, 1996
#3438). Histone Deacetylases (HDACs) were first correlated to transcriptional
repression by the identification of purified HDACs that have similarity to transcriptional

11
cofactors (156). As more cellular histone deacetylases were isolated, many were found to
be components of corepressors recruited by transcription factors.
Basal Transcription Factors
In order for any promoter sequence to function, a number of general transcription
factors are required to direct RNA polymerase II to the specific site of transcriptional
initiation. The general transcription factors, comprised of TFIIA, TFIIB, TFIID, TFIIE,
TFIIF, and TFIIH, are necessary for assembly of RNA polymerase at the core promoter
and for transcription initiation (Fig 1, D) (34). The combination of the RNA polymerase
II and the basal transcription factors melts the core promoter sequence to create a open
complex in which 12 to 15 basepairs (bp) of DNA unwind to form a single-stranded
bubble (33, 54, 189). This open complex allows initiation to occur by catalyzing a
number of phosphodiester bonds in messenger RNA (mRNA). In most cases of
transcription initiation, RNA polymerase II and associated factors initiate transcription
and release small mRNA fragments from the open promoter complex (118). Finally, the
RNA polymerase II overcomes these abortive initiations to synthesize longer mRNA
which extends past the open promoter complex. After 25 to 30 bp, the elongating
complex pauses and usually requires stimulation from transcription factors in the
promoter complex and modification of the RNAPII to undergo promoter escape and
create the entire mRNA transcript (189).
One of the most critical factors for initiating transcriptional activity is the TATA-
Binding Protein. The TBP is similar to a symmetrical molecular saddle on the core
promoter DNA (25, 134). When the TBP is bound to a TATA box, the molecular saddle
binds the promoter and causes a sharp bend in the DNA strands which induces a partial
unwinding of base pairing at the initiation site (84). Along with TBP, the TFIID complex

12
contains the TBP-associated factors or TAFs (18, 192). The TAFs regulate the ability of
the TBP to select the specific site of transcriptional initiation. The requirement for the
TAFs is most clearly seen in the difference between the TATA-directed core promoters
and the Inr-directed or null core promoter elements. The TBP protein is able to initiate
transcription on TATA box elements, independent on any TAF proteins in the TFIID
fraction. However, for Inr-dependent promoters or null core promoter sequences, the
TAF proteins are required for transcriptional activation and interaction with the
transcription factors in the URSs (119).
The TFIIA fraction acts directly with TBP and stabilizes the TBP-DNA
interaction (120). The protein subunits within TFIIA have direct contacts with
transcriptional activators (140, 220). TFIIA may inhibit general transcriptional repressors
by displacing or blocking those proteins from their respective effects on TFIID activity
(139). The TFIIB fraction has been shown to directly influence the selection and site of
trancriptional activation (12, 146). The TFIIB subunit structure seems to set the distance
between the core promoter element and the transcriptional start site. This observation is
proven by TFIIB mutants which shift the site of initiation because they no longer allow
interactions between RNA Polymerase II and the TFIIB fraction (4, 17, 19). Recent
crystal structure experiments have shown that the actual distance between TFIIB and the
RNA polymerase II catalytic site is about 32 bp which is the average distance between
most core promoter TATA box elements and the transcriptional start site (107). TFIIB is
able to interact with a large number of transcriptional activators and the resulting
interaction is a measure of the effectiveness for that activator in the upstream activating
sequence (110, 213).

13
The TFIIF fraction functions to stabilize the preinitiation complex on the core
promoter element. This stabilization may be the result of altering the DNA topology.
Experiments that crosslink the preinitiation complex to the DNA show that the DNA is
wrapped in one complete turn around the preinitiation complex (153). TFIIF is required
for this tight wrapping that causes stress in the DNA resulting in promoter melting and
open complex formation. The TFIIF factors also function as a transcription elongation
factor. This elongation activity may be regulated by its DNA wrapping ability or an
intrinsic kinase activity (154).
The TFIIE function may be related to a zinc ribbon motif within its protein
sequence (95). TFIIE can bind single-stranded regions of DNA and enable melting of the
core promoter sequence. From experimental data, the requirement of TFIIE in
maintaining an open promoter complex can be overcome by a synthetic, premelted
promoter sequence (72, 141). The induction and stability of an open promoter complex is
related to the actual promoter sequence and the TFIIE requirement has been shown to
vary between specific promoter sequences (158, 185). Other functions of the TFIIE
fraction may be linked to the TFIIH fraction. TFIIE assembles into the RNA Polymerase
II preinitiation complex before TFIIH and may stimulate TFIIH recruitment or the CTD
kinase and ATPase activities of TFIIH.
The TFIIH fraction has been characterized into two separate functional
complexes. The first complex encompasses the core TFIIH functions and the second
complex acts in a kinase/cyclin function. The core TFIIH contains a DNA-dependent
ATPase, an ATP-dependent helicase, and a CTD kinase activity (32). The proteins
responsible for these activities, XPB/ERCC3 and XPB/ERCC2, are found within the

14
nucleotide excision repair complex. The XPB helicase is required for promoter opening
in vitro and is critical for the conversion from abortive transcription initiation to
transcriptional elongation (42, 57, Bradsher, 2000 #3377, 71, 73). The TFIIH
kinase/cyclin activities are found within the Cdk7/cyclin H proteins (155, 162, 167). The
role of these proteins is to phosphorylate the RNA polymerase carboxy-terminal domain
(CTD) (32). The degree of RNA polymerase II CTD phosphorylation is related to the
ability to switch from transcription initiation to elongation.
RNA Polymerase II Holoenzyme
The purified eukaryotic core RNA polymerase II contains between 10 and 12
different subunits that catalyze DNA-dependent RNA synthesis in vitro. However, the
lack of general transcription factors prevents any specific core promoter recognition. The
largest subunit of the RNA polymerase II has a carboxy-terminal domain (CTD) that
contains tandem repeats of a consensus peptide sequence (Tyr-Ser-Pro-Thr-Ser-Pro-Ser)
(35, 221). The CTD domain is essential for cell growth and there are 52 repeats of the
consensus peptide sequence in the human RNA Polymerase II (1, 6, 223). CTD
regulation is controlled by the amount of phosphorylation on the repeat sequences (37).
Within transcription initiation complexes, the RNA polymerase II CTD domains are not
phosphorylated and appear to recruit the Srb/Mediator complexes to the RNA polymerase
(86, 127). The Srb/Mediator complex functions to transmit the signals from the upstream
transcriptional activators to the components of the RNA polymerase II and its basal
transcription factors.
After the recruitment and assembly of the RNA polymerase II preinitiation
complex, the holoenzyme switches from a transcription initiation complex to an
elongation complex through the modification of the CTD phosphorylation state. The two

15
kinases responsible for the CTD phosphorylation are Cdk7 and the Cdk8 proteins (46).
The Cdk7 kinase is located within the general transcription factor, TFIIH (115). The
TFIIH activity is required for the switch into a stable elongation complex and the Cdk7
kinase phosphorates the CTD subunit allowing release from the initiation complex (42).
The Cdk8 protein is a subunit within the Srb/Mediator complex and may regulate
transcription elongation through upstream activation factors (Fig. 1, E) (78, 115, 183).
After these two kinases have phosphorylated the RNA polymerase II CTD, the
hyperphosphorylated CTD domain promotes the formation of DNA-dependent RNA
synthesis along the protein coding sequence. The phosphorylated RNAPII recruits the
mRNA capping enzyme to the newly formed transcript and allows mRNA capping to
take place soon after promoter clearance (30, 126). In addition to mRNA capping events,
the CTD phosphorylation alters the factors and subunits associated with the RNA
polymerase II enzyme (137, 208). The Srb/Mediator complex only interacts with the
hypophosphorylated CTD and is released with phosphorylation of the CTD. Elongation
complexes containing TFIIS are associated with hyperphorylated CTD regions.
Adeno-Associated Virus
Adeno-associated virus (AAV) is a human, single-stranded DNA virus. It has a
genome size of 4.7kb that encodes only two open reading frames (ORF), rep and cap
(133). These two ORFs are flanked by two inverted terminal repeats that are required for
genome replication, integration, and viral packaging (Fig. 2) (219). An AAV productive
infection requires the activities of another virus to alter the cellular replication and
transcriptional mechanisms. The most widely characterized helper virus for AAV is

Fig. 2. Structure of the Adeno-Associated Virus Genome. In the upper section of the
diagram, the two different open reading frames within AAV are shown by rectangles
named Rep and Cap. The locations of the p5, pi9, and p40 promoters are demonstrated
by bent arrows. The terminal repeats (TR) sequences are diagrammed as darkened boxes
at both ends of the AAV genome. The lower portion of the diagram shows the AAV
transcripts initiated at their relative promoter location. The left side indicates the
transcript size and the molecular weight of the protein is on the right.

17
â–º
p5 p19 p40
£cL
poly A
rep
cap
1
TR
â– 
Rep78
Rep68
Rep52
Rep40
ZZJ-
VP1
VP2, VP3
2.3 kb

18
Adenovirus. Clinically, AAV is only isolated from patients with adenovirus (Ad)
infections (13, 14, 148). However, AAV infection alone has never been associated with
any disease. If adenovirus is not present during primary AAV infection, an abortive
infection results in an integrated proviral structure (28, 125, 128). Most AAV provirus
genomes exhibit site-specific integration events in the human genome (93, 160, 165,
204). These genomes can be rescued by superinfection with adenovirus, which induces
both proviral rescue and replication (28, 101, 128).
Adenovirus Helper Functions
Several adenovirus genes have been identified that possess specific helper
functions during AAV coinfection (48, 132, 133). The adenovirus El A gene product
functions as a trans-activator for both Ad and AAV promoters. The El A 289 amino-acid
protein expressed during an adenovirus infection binds to transcription factors on the
AAV p5 promoter and induces AAV gene expression. The E1B 55-kd protein regulates
the post-transcriptional export of viral mRNAs into the cytoplasm. The E2 region
encodes the Ad DNA binding protein (Ad DBP). The Ad DP promotes transcriptional
activation from the AAV promoters and may enhance AAV DNA replication. The E4
region influences many cellular activities to support both Ad and AAV productive
infections. The E4 ORF6 gene product increases the degradation of cyclin A and inhibits
the kinase activity of Cdc2 that promotes the cell to remain in late S phase of the cell
cycle. The induction into S phase will result in the expression of more DNA replication
proteins that will convert the single-stranded viral genomes into double-stranded DNA
templates Finally, the VA RNAs of Adenovirus enable the initiation of AAV protein
synthesis by overcoming Ad interferon-induced host cell shutdown of translation.

19
AAV Rep Proteins
The AAV genome has three different promoters identified by their map positions
of p5, pl9, and p40. The p5 and pl9 promoters transcribe the rep open reading frame.
Rep 78 and its alternatively spliced transcript Rep68 are produced from the p5 promoter.
The Rep52 and its spliced transcript Rep40 are transcribed from the internal pl9
promoter. The larger Rep78/68 proteins have many different activities during AAV
infection (9, 64, 67, 70, 97, 98, 100, 123). Rep78 and Rep68 have specific DNA binding
activity, site- and strand-specific endonuclease activity, DNA and RNA helicase activity,
and an ATPase activity (76, 89, 157, 175, 209). In the absence of adenovirus coinfection,
the large Rep proteins repress the AAV promoters (74, 98, 143, 205). However, during
Ad infection, Rep78/68 exhibit the dual abilities of transcriptional repression on the p5
promoter and transactivation for the p5, pi9, and p40 promoters. Additionally, a model
of AAV replication has been proposed in which the Rep78/68 proteins are responsible for
nicking the terminal repeats. The site-specific endonuclease activity of the larger Rep
proteins nick the terminal repeats thus creating a free 3'OH for AAV genome replication.
In contrast, the smaller Rep52 and Rep40 proteins have fewer characterized
activities during AAV replication. In the absence of adenovirus infection, these proteins
have the ability to repress AAV promoters while not exhibiting any site specific DNA
binding activity (74, 77, 97, 98, 138). Recently, Rep52 has been shown to exhibit
ATPase and helicase activity. Additionally, the Rep52/40 proteins have been shown to
increase the levels of single-stranded monomer during AAV infection. Since single-
stranded genome formation correlates with the packaging of AAV particles, Rep52/40
may function in packaging viral particles (27, 74, 98). Recently, King et al. have

20
demonstrated that the Rep52 helicase activity is probably directly involved in AAV
packaging (87).
AAV Transcription without Adenovirus
The p5 promoter is the most widely studied promoter in the AAV genome
because of its direct role in the switch between latent and productive infection in the viral
lifecycle. Many previous studies demonstrated that no transcripts are detected during the
latent state of AAV (31, 100, 123). The initial studies of the p5 promoter determined that
the promoter contained a Major Late Transcription Factor (MLTF) binding site and a
previously unknown element which was responsive to the El A trans-activator of
adenovirus. The subsequent cloning of this transcription factor resulted in the
identification of the YY1 protein (Ying-Yang protein) named for its dual activities of
repression and activation on a downstream promoter (168).
Previous studies in our lab resulted in the identification of another protein binding
site in the p5 promoter, the Rep binding element (p5RBE). DNasel protection and gel
shift assays determined that the binding site consisted of a 22 bp sequence (125). Initially,
the determination of the p5RBE was performed using purified Rep68 from baculovirus
expression vectors. Sequence analysis of the entire AAV genome showed that similar
binding sites were located in the A-stem of the terminal repeat as well as the three AAV
promoters. The A-stem RBE affinity was shown to be 20 fold higher than the p5RBE
while the pl9 and p40 binding affinities were 160- and 80- fold less than the A-stem
RBE, respectively (125).
AAV Transcription with Adenovirus
Initial analysis of the pi 9 and p40 promoters was performed in our lab by a novel
complementation system (123). Mutational analysis of the two promoters caused direct

21
alterations of the Rep protein sequence in the AAV genome. In order to prevent this
problem, the Rep protein was supplied in trans by another plasmid pl9/40S which
contained silent mutations in the Rep protein downstream of the pl9 and p40 start sites.
To analyze the effects of the deletions within the pi 9 and p40 promoters, primers were
selected that would distinguish between the pi9 and p40 mutant promoter transcripts and
the transcripts from the Rep complementing plasmid, pl9/40S. This allowed the
measurement of transcripts by primer extension that were synthesized only from the pi 9
and p40 promoter deletions.
The deletion analysis of both the pi 9 and p40 promoters was performed in a
series of 5 contiguous 30 bp intervals proximal to each start site. For the pi9 promoter,
two separated 60 bp regions were necessary for the Rep-mediated activity. One region
was identified between positions -153 to -94 and the other was the region from -63 to -4,
both upstream of the pi 9 start site (Fig. 3 A). For the p40 promoter, two regions of Rep-
mediated induction were identified through deletion analysis. One region was the
immediately upstream -60 bp region of p40 while the other region required the -153 to -
94 region upstream of the pi 9 promoter.
Another deletion analysis for both pi9 and p40 promoters were performed by
progressively larger proximal 5' deletions. The initial deletion named pIM29 dll-320
eliminated the p5 promoter and resulted in pi9 and p40 transcript levels that were 5% of
wild type levels. This data revealed a vital element for transactivation of the pi 9 and p40
promoters that was within the p5 promoter region. Subsequent serial deletions resulted in
no greater Rep-mediated induction of pl9 or p40 eliminating the possibility of a
transcription factor binding site that represses the pi9 and p40 promoters (Fig. 3B). In

Fig. 3. AAV Promoters and Promoter Deletion. A, A portion of the plasmid pIM29,
containing wild type AAV nucleotides 191 to 4484, is shown with an expanded view of
the pi9 and p40 promoters. The relative positions of the pl9 and p40 promoters are
shown by arrows. The locations of the 30bp deletions are diagrammed by lines denoting
the nucleotide position relative to the promoter initiation site which precedes each
deletion. Below each 30bp deletion, the relative strength of that specific promoter mutant
is shown as a precentage of wild type pi9 or p40 promoter activity. B, The plasmid
pIM29 is shown with the Rep coding region shaded. The relative positions of the p5,
pi9, and p40 promoters are marked by arrows, and the intron is represented by a bent
arrow. Below pIM29, the 5’deletions used in that study and the AAV restriction sites
used in their construction are shown in the diagram. They are designated by 29dl
followed by the numbers of AAV nucleotides deleted. The relative transcriptional
activity of each promoter mutant plasmid was shown as a percentage of the wild type
pIM29 plasmid strength.

23
-154 -124 -94 -64 -34
\ \ \ \ \
-4
p19
-154 -124 -94 -64 -34
p40
-4
XX
%wt
p19 10 10 100 10 <2
p40 10 30 150 100 100
100 100 100 100 100
92 65 25 10 <2
B
190 P5
I c
plM29
P19 p40 4484
X
Rep llr
% wt
p19 p40
100 100
29dl 1-320
r
<5
29dl 1-687 f
29dl1-809
n
Sst II
H
Sst I
â– //â–  1
<5
29dl 1-1044
dl 3-23
Bam
TR
n
V/
TR
100

24
contrast, the last two deletion constructs named pIM29 dll-1044 and pIM29 dl3-23 differ
only by the presence of a terminal repeat. The presence of the terminal repeat caused the
Rep-mediated induction of the p40 promoter at wild type levels.
The exact determination of the transcription factors proximal of the pi 9 promoter
was performed by DNase I protection. This biochemical analysis identified the
transcription elements SP1-50, GGT-110, SP1-130, and CArG-140 sites relative to the
pi 9 start site (145). Direct determination for some of these protected regions as true SP1
binding sites was performed by competitive gel shifts using SP1 oligos and labeled wt
AAV fragments. As a result, the -50, -110, and -130 sites were positively identified as
SP1 binding sites upstream of the pi 9 promoter. The CArG-140 site remained bound
during competitive gel shift assays containing a serum response element (SRE) that
normally contains authentic CArG-like elements. The next step in the CArG-140
identification procedure was an UV cross-linking experiment, which identified a protein
larger than 34kDa. The combination of a CArG-like binding site and a protein mass of
34 kDa indicated a previously uncharacterized protein. After the identification of each
binding site, the actual in vivo function for each site on pi9 activity was tested using
mutants in each transcription factor site. In order to do this in vivo, the pl9/40S
complementation assay was used to compare the effect of Rep-mediated induction on
each pi9 promoter mutant. The average pi9 transcript level using the wt AAV genome
without terminal repeats (pIM45) complemented with pl9/40S was normalized to one.
The ratio of pi 9 transcripts in each of the pi 9 promoter mutants with or without Rep+
pl9/40S was calculated to determine which elements were responsible for Rep-mediated
induction. If the ratio was relatively unaffected, the pl9 element would be vital for Rep-

25
mediated induction of pi 9. From this data, only two sites were greatly affected by the
Rep+ pl9/40S induction of the pi 9 promoter. These two sites were the SP1-50 and
CArG-140. Each resulted in the reduction of pl9 transcripts to 20% of wt pi9 promoter
levels.
Analysis of the p40 promoter by Dnase I protection assay determined a number of
protected elements. These elements were identified as API-40, SP1-50, GGT-70, and
MLTF-100 binding sites. Two additional biochemical assays, competitive gel shift
analysis and UV cross-linking, were performed to confirm the identity of the sites.. The
combination of these two procedures determined that the SP1-50, GGT-70, and MLTF-
100 sites did have transcription factor binding activities. To test the Rep-mediated
response of the p40 promoter in vivo, transcription factor binding mutants were produced
for each site. Using the pl9/40S complementation assay, Rep induction depended only
on the SP -50 and TATA -30 binding sites. Additionally, the p40 activity was dependent
on the CArG-140 element of pl9 correlating directly with the previous -153 to -94 bp
p40 promoter deletion mutant (144).
This extensive deletion analysis determined that the Rep-mediated induction of
both the p 19 and p40 promoters required three separate elements. One required region is
the proximal SP1-50 element at or in front of each promoter. Another element is a
common -153 to -94 p 19 region defined as the CArG-140 site. The third and final
element appears to be a RBE that can be located in either the left terminal repeat's A-stem
RBE or the p5RBE.
To distinguish between the effects of either the p5RBE or the A-stem RBE on the
AAV promoters, a series of RBE mutants were created to define Rep-mediated elements

26
responsible for trans-activation of the p5, pi 9 and p40 promoters. The AAV genomic
subclone lacking terminal repeats (pIM45) was normalized to one for transcript levels
from each promoter. The first mutant targeted the p5RBE. As result, the p5 promoter
transcription increased by 3.2-fold while the pi9 and p40 promoters decreased by 5-fold.
This result indicated the p5RBE had a repressive effect on the p5 promoter while
simultaneously transactivating the pl9 and p40 promoters. The next RBE construct had
an intact, wild type p5RBE and a wild type A-stem RBE resembling the fully functional
AAV terminal repeat. This construct restored the pi9 and p40 transcripts to pIM45
levels while raising the p5 promoter to 3-fold. The final construct had a wild type A-
stem RBE and a mutated p5RBE. As a result, this construct exhibited a 8-fold increase in
the level of p5 transcripts relative to the pIM45 subclone. Additionally, the pi9 and p40
promoters had a 2-fold increase in transcription compared to pIM45 levels. This last
construct showed the p5RBE had a direct repressive effect on p5 transcription while the
more distal A-stem RBE transactivated the p5 promoter. However, the p5RBE and the
A-stem RBE appear to be equivalent and redundant transcriptional elements in Rep-
mediated transactivation of the pl9 and p40 promoters. During adenovirus infection, Rep
78 or Rep 68 appeared to behave as a transcription factor that can be both a repressor (of
p5) and a transactivator (of pl9 and p40).
Analysis of the Rep binding abilities on both the terminal repeat RBE and the
p5RBE show that either the Rep78 or Rep68 proteins were required for trans-activation
of the three AAV promoters. The Rep78 and Rep68 proteins were known to interact but
no analysis had been performed on the ability of the larger Reps to bind either Rep52/40
or any cellular proteins. The initial analysis for large and small Rep interaction was

27
performed using immunoprecipitation against the larger Rep protein domains and by
detecting any Rep proteins with an antibody against the common Rep protein carboxy-
terminal end. From this immunoprecipitation, the larger Rep proteins were only able to
precipitate the Rep52 protein. The in vivo interaction between the large Rep78 and 68
proteins and Rep52 indicated a method of interaction between the Rep78/68 binding
element within the TR and the p5RBE, the large Rep proteins, and the smaller Rep52
protein. To detect Rep78/68 effects on the p5RBE, a p5 promoter CAT construct was co¬
transfected with a constant amount of Rep78/68-expressing plasmid and increasing
amounts of a Rep52 plasmid. The result of this titration was the derepression of the p5
promoter through an increasing gradient of Rep52 concentration.
Another suspected Rep78/68 interaction was the common SP1-50 binding site that
is conserved within the parvovirus family. The initial analysis of a Rep78/68 and SP1
interaction was performed using a gel supershift assay with an Spl-50 binding site. The
positive supershifting gel fragment indicated a direct role for the Rep78/68 interaction
with Spl. Trans-activation of the p 19 and p40 promoters could result from the Rep78/68
bound to the upstream RBEs and each of the SP1-50 binding sites proximal to each
promoter. In order to test a model for DNA looping, an AAV genome fragment
containing the p5RBE and the SP1-50 pi9 was incubated with purified Rep68 and SP1
proteins. The mixture was examined by electron microscopy and analyzed by digitized
measurements. These measurements showed a conserved DNA looping structure
correlating to the direct interaction between the large Rep proteins bound at the p5RBE
and the Spl protein at the pi9 -50 binding site.

28
Model for Activation of an AAV Productive Infection from Latency
For this model, the proviral structure of AAV is limited to one proximal terminal
repeat containing a single A-stem RBE site. The cellular YY1 and MLTF transcription
factors are bound to their sites within the p5 promoter. In the absence of adenovirus
infection, YY1 bound at the -60 position of the p5 promoter acts as strong repressor of
Rep78/68 transcription (Fig. 4, A) (168). The specific activity of the YY1 -60 binding
prevents any trans-activation of the p5, pi 9, or p40 promoters through either the terminal
repeat or the p5RBE.
During adenovirus infection, the Ad early proteins are responsible for the switch
between AAV latency and productive infection. The El A trans-activating protein
provides the first helper function for AAV transcription. The El A protein has three
conserved domains for interaction with cellular cell cycle control proteins. The El A CR1
and CR2 regions bind the pRB and pi 07 proteins. Expression of the adenovirus El A
protein prevents E2F:pRB complex formation. E2F displacement allows the protein to
act as a transcription factor for many cellular replication proteins. However, the CR3
region of El A interacts with the p300 protein in infected cells. This physical interaction
between El A and p300 is important because the YY1 repressor protein has been shown
previously to bind p300. The last 17 amino acids of YY1 are responsible for this
interaction and YY1 binding mutants are unable to show an ElA-mediated response. As
a result, the El A protein binds specifically with a p300:YYl complex on the p5 promoter
(24, 103, 108, 168). This binding activity induces a conformational change upon the
YY1 protein in a repressive state to expose its activation domain. This change induces p5
promoter trans-activation (Fig. 4, B). After the exposure of the -60 YY1 activation
domain, p5 transcription occurs through a mechanism involving the YY1 initiator

Fig. 4. Loss of AAV Promoter Repression through Adenovirus Infection. A, In the
absence of Adenovirus infection, YY1 and Rep proteins bound at the p5 promoter act as
strong repressors of AAV gene expression. B, during Adenovirus infection, the Ad El A
protein binds to the YY 1 proteins and converts their function as repressors to activators
of AAV gene expression.

0£

31
element. The YY1 initiator element binds to DNA and interacts with the TFIIB complex.
The YY1 protein is stabilized by its TFIIB interaction facilitating pre-initiation complex
formation at the p5 promoter (191).
Induction of the p5 promoter results in the increased cellular concentration of
Rep78/68. These two proteins bind the RBEs within the AAV genome as a direct
function of their increased concentrations. The first RBE bound is the terminal repeat A-
stem. The binding of Rep 78 and/or Rep 68 trans-activates the p5, pi 9, and p40
promoters. As a direct result, the levels of larger Reps are increased through
transcriptional activation (Fig. 5, A). In addition, the Rep 52/40 and capsid proteins are
increased by the A-stem RBE trans-activation upon the p 19 and p40 promoters. Rep68 is
shown to specifically bind the p5RBE and trans-activate the pi9 and p40 promoters.
After p5RBE binding, the p5 transcription levels decrease while pi9 and p40
transcription levels increase (Fig. 5, B).
As the relative levels of p 19 and p40 promoter directed transcription increase, the
Rep 52 and Rep 40 proteins alleviate the repression on the p5 promoter. Previous studies
in our lab demonstrated complex formation between the Rep78/68 proteins and Rep52.
In addition, the Rep78/68 proteins repress the p5 promoter. However, titration of
increasing levels of Rep52 causes derepression of the p5 promoter. The present model
supports a feedback mechanism in which the rising amounts of Rep52/40 act on the
Rep78/68 proteins bound at the p5RBE. The Rep52 protein would cause an alteration of
the large Reps on the p5RBE to eliminate repression of the p5 promoter (Fig. 5, C).
This feedback loop model between the products of the p5 and p 19 promoters
creates a steady-state level of transcripts. The molar transcript ratios of 1:10:100 for the

Fig. 5. Model of Rep Feedback Regulation between the p5 and pl9 Promoters. A,
Rep 78/68 bound to TR A-stem sequence transactivates the p5, pi9, and p40 promoters.
B, Increase of Rep protein concentration allows Rep 78/68 binding to p5 promoter
repressing the p5 promoter. Rep bound at p5 promoter transactivates the pi9 and p40
promoters. C, Higher pi9 transcription creates more Rep52 protein which derepresses
the p5 promoter.


34
p5, pi9, and p40 promoters maintain four relationships. First, the lower level of p5
transcription creates enough Rep78/68 to resolve the terminal repeats while preventing
excess endonuclease and helicase activity from eliminating any transcriptionally
competent AAV genomes. Second, the increasing Rep78/68 levels are autoregulated by
their repression of the p5 promoter. Third, the synthesis of higher levels of Rep52/40
transcripts resulting from p5RBE trans-activation causes the derepression of the p5
promoter thereby increasing the Rep78/68 levels. Fourth, the p40 promoter is relatively
unaffected by this feedback inhibition allowing constant transactivation of p40 and
synthesis of the capsid transcripts.

CHAPTER 2
MATERIALS AND METHODS
Cell Lines and Virus.
Human A549 cells (ATCC #CCL 185) were maintained in Dulbeco’s modified
essential media (DMEM, Gibco BRL) containing 10% bovine calf serum (BCS, HyClone
Laboratories Inc.) at 37°C in 100mm culture dishes. Adenovirus 5 was grown and titered
on 293 cells.
Plasmids
The p5CAT plasmid is the same as the p5CAT190 plasmid described by Chang et
al. (24) and was kindly provided by Tom Shenk. It contains AAV2 nucleotides 190-310
followed by the CAT expression cassette.
The pIM45 plasmid contains the AAV-2 nucleotides 145-4373 in a pBS M13+
vector (Stratagene Corporation). It essentially contains all of the AAV genome except
for the terminal repeats.
pAXX is a modified pIM45 plasmid in which stop codons have been inserted by
site specific mutagenesis at Rep78 amino acid 71 and at Rep52 amino acid 14. Thus,
pAXX is incapable of producing either p5 or pi 9 Rep proteins, and it was used for the
construction of all of the CAT containing plasmids below. pAXX, pIM45 and all other
plasmids used in this study were sequenced to insure that the AAV sequences were
correct and to confirm the positions of the mutations.
The pl9CAT3 plasmid was created by inserting synthetic oligonucleotides within
the pCAT3BASIC plasmid (Promega Corporation) that together reconstructed the
35

36
essential elements of the p 19 promoter. The pi 9 synthetic sequence was created with
three pairs of oligonucleotides that were annealed and then ligated together. The first
oligonucleotide pair (cAAP-140) had the sequence 5'-
CGTCACAAAGACCAGAAATGGCGCCGTCTCGAGTGACAATT-3' that contains
AAV nucleotides 722-756 with a mutation that destroys the SP1-130 binding site and
converts it into an Xhol restriction site. The second pair of oligonucleotides
(pl9XbaSac) had the sequence 5'-
CTAGATCCGATGAGTGCTACATCCCCAATTACTTGCTCCCCAAAACCCAGCCT
GAGCT-3' that contains AAV nucleotides 757-814 with the GGT-110 binding site
converted into an Xbal restriction site. The third pair of oligonucleotides (SP1-50CAT),
had the sequence 5'-
CCAGTGGGCGTGGACCCGCGGGGAACAGTATTTAAGCGCCTA-3' that contained
AAV nucleotides 815-869 with the TATA-35 site mutated into a SacII restriction site.
The Spl-130, GGT-110 and TATA-35 sites had been shown previously to have little
effect on pl9 transcription. All three oligonucleotide pairs were heated to 90°C and
annealed together by slowly cooling to room temperature. They were then ligated using
T4 DNA ligase (Life Technologies). After ligation, a small amount of the DNA product
was used as template in a PCR reaction performed with two primers, pl9XmaI 5'-
ATACCCGGGCACAAAGACCAGAAATGGCG-3' and pl9BglII 5'-
ATAAGATCTCGTGAGATTCAAACAGGCGCTT-3'. The PCR reaction amplified the
synthetic pi9 promoter, which was digested with Xmal and Bglll and cloned into
pCAT3BASIC (Promega Corp.) vector that had been digested with the same restriction
enzymes.

37
The pl9CAT3-700 plasmid was created by subcloning an oligonucleotide
containing the wild type p5 promoter Rep binding element (p5RBE) sequence, 5’-
AAGCCCGAGTGAGCACGCAGGGTCTAGTACT-3 ’, into the BsaAI restriction site of
the pl9CAT3 plasmid 700 nucleotides upstream of the start of transcription of pi 9. The
pl9CAT3-145 plasmid was created by subcloning the wild type p5RBE sequence into the
Mlul site at the -145 site of pl9CAT3. The pl9CAT3-100 plasmid was created by
subcloning the wild type p5RBE sequence into the Xhol site at the -100 site of
pl9CAT3. The pl9CAT3+25 plasmid was created by subcloning the p5RBE sequence
into the Bglll site at the +25 nucleotide site of pl9CAT3. The pl9CAT3+1225 plasmid
was created by subcloning the p5RBE sequence into the +1225 site of pl9CAT3.
The pIM45CAT3 plasmid was constructed by first digesting pAXX with Bell,
which cleaves at AAV nucleotide 965. The linear pAXX DNA was ligated to the BamHI
and Bell fragment of pcDNA3.1(+)CAT (Invitrogen Corporation) which contains the
CAT gene. pIM45 contains AAV nucleotides 145-965 (including all of the p5 and pl9
promoters) followed by the CAT gene. The psub262CAT3 plasmid was created in the
same way by ligation of the BamHI and Bell fragment from pcDNA3.1(+)CAT into the
psub262 plasmid, which contains a mutant p5 RBE.
The pIM45CAT3poly A plasmid was created in two steps. The Smal to Nrul
fragment from pAXX containing the AAV p5 promoter as well as a portion of the Rep
gene (AAV bp 145- 658) was inserted into the BsaAI site of pl9CAT3; this plasmid was
called p5_pl9CAT3. Then, the Smal and Sfil fragment from the p5_pl9CAT3 plasmid
(containing AAV bp 145-544 and the late polyadenylation signal of SV40) was
substituted for the Nrul to Sfil fragment (containing AAV nucleotides 544-658) in the
pIM45CAT vector. The resulting pIM45CAT3poly A contained AAV nucleotides 145-

38
544, followed by the SV40 late poly A site (563 bp), followed by AAV nucleotides 722-
869 from pl9CAT3 containing substitutions at Spl-120, GGT-110 and TATA-20,
followed by the CAT gene.
The 2xGAL4 plasmid was created by site-directed mutagenesis of the p5RBE and
the pi9 SP1-50 sites of pIM45CAT3 to GAL4 DNA binding sites. The p5RBE within
pIM45CAT3 was mutated to a GAL4 DNA binding element using the oligonucleotide
sequence 5’-
GCGACACCATGTGGTCACGCTGGGCCGCGGCGGAAGACTCTCCTCCGAGGGT
CTCC-3’. The pl9 promoter SP1-50 site within pIM45CAT3 was mutated to a GAL4
DNA binding site using the oligonucleotide sequence 5’-
CCCCAATTACTTGCTCCCCAAAACTCAGCCTGCGGAAGACTCTCCTCCGACTA
ATATGG-3’.
The pM-53 plasmid expressed a fusion protein of the GAL4 DNA binding domain
and the mouse p53 protein containing p53 amino acids 72 to 390. It was supplied in the
Mammalian MATCHMAKER Two-Hybrid Assay Kit (Clontech Laboratories). The pM-
Tg plasmid contains the GAL4 DNA binding domain fused to SV40 T antigen amino
acids 87-708. The SV40 T-antigen DNA fragment containing amino acids 87 to 708 was
removed from the pVP16-T plasmid (Clontech Laboratories) by EcoRI and Sail digestion
and inserted by directional cloning into EcoRI and Sail digested pM plasmid (Clontech
Laboratories).
The 2xGAL4 subMLTF plasmid was created by site-directed mutagenesis of
pIM45CAT3 2xGAL4 using the oligonucleotide 5’-
GGT CT AG AGGT CCT GT ATT AG AT AC AC GCGT GTCGTTTT GCG AC ATTTTGCG A
CACC-3’ that resulted in the replacement of the p5RBE site with the Mlul restriction

39
site. The 2xGAL4 subYYl-60 plasmid was mutated at the YY1-60 binding site within
the p5 promoter to EcoRI and BamHI sites using the oligonucleotide 5’-
CCTGTATT AG AT AC ACGCGT GTCGTT GAATTCT GGGATCCGAC ACC AT GT GGT
CACGC-3’. The 2xGAL4 subMLTF, YY1-60 plasmid was created by the site-directed
mutagenesis of the 2xGAL4 subMLTF plasmid using the subYYl-60 oligonucleotide
sequence 5’-
CCTGTATTAGATACACGCGTGTCGTTGAATTCTGGGATCCGACACCATGTGGT
CACGC-3’. The 2xGAL4 subMLTF, YY1-60, YY1+1 plasmid was created by site-
directed mutagenesis of the 2xGAL4 subMLTF, YY1 -60 plasmid using the
oligonucleotide sequence of 5’-
CGGCGG AAGACTCTCCTCCGAGGGTCT AAATTTTGAAG-3 ’.
Transfections
Plasmid transfections were performed using cationic liposomes (LipofectAMINE
Plus, Life Technologies). Twenty-four hours before transfection, A549 cells were plated
in 60mm dishes so the cells were 75% to 90% confluent on the day of transfection. The
A549 cell media was removed and 2 ml of serum-free DMEM was added for the
transfection procedure. Plasmid DNA was mixed with 250 pi of serum free DMEM
containing 8 pi Plus Reagent (Life Technologies) and incubated at room temperature for
15 minutes. The plasmid DNA and Plus Reagent mixture was mixed with 250 pi of
serum-free DMEM containing 12 pi of LipofectAMINE and incubated for another 15
min. The entire 500 pi of plasmid DNA/Lipo feet AMINE mixture then was incubated
with the A549 cells without serum for three hours. At three hours post-transfection, 2.5
ml of DMEM with 20% bovine serum with or without Adenovirus 5 at a multiplicity of
infection (MOI) of 5 pfu/cell was added to the A549 cells. To control for transfection

40
efficiency, each transfection contained 1 pg ofpcDNA 3.1(+)gfp and 1.5 pg of
pcDNA3.1(+)P gal. Extracts were then assayed for (3 gal activity using ONPG (Promega)
to normalize for the transfection efficiency. In those cases where a linear CAT reporter
plasmid was used, a linear p gal plasmid was also used.
CAT Reporter Assays
Forty-eight hours post-transfection, the A549 cells were washed with 2 mL PBS
and lysed in 400 pi of lysis buffer (CAT Reporter Lysis Buffer, Promega Corporation).
The whole cell extracts were vortexed for twenty seconds and heated at 65°C for 10
minutes to inactivate endogenous deacetylases. After heat inactivation, the extracts were
centrifuged for 2 minutes and the clarified supernatant was transferred to a new tube.
CAT activity was measured by a standard chloramphenicol acetylation reaction, which
contained in 125 pi: lx lysis buffer (Promega Corp.), 0.2 mM n-Butyryl Coenzyme A
(Promega), 10 pM l4C-chloramphenicol (Amersham Pharmacia Biotech, 58 mCi/mmol)
and either 4 pg of protein from an adenovirus-infected extract or 20 pg of protein from an
uninfected extract. The reaction was incubated for 24 hr at 37°C and then extracted with
300 pi of mixed xylenes (Fisher Scientific). The entire upper organic phase containing
the acetylated chloramphenicol was back extracted two times with 100 pi of 0.25M Tris-
HC1 pH 8. The amount of acetylated chloramphenicol in 200 pi of the mixed xylenes
phase was determined by liquid scintillation counting. Each construct was tested by
transfection and CAT assay a minimum of three times. The average CAT activity (as
cpm of acetylated product) was calculated after correction for the amount of extract used,
and is reported +/- one standard deviation.

CHAPTER 3
RESULTS
Analysis of Adeno-Associated Virus Transcription
The overall goal of my research was to understand the regulation of the Adeno-
Associated Virus promoters. In order to perform this analysis, the different AAV
promoter elements were to placed upstream of reporter gene constructs which gauged the
relative influence of the DNA sequence upon gene expression. In the previous studies of
AAV transcriptional regulation, the analysis was performed by isolating a single AAV
promoter region and mutating a series of single transcription factor binding sites (123).
Another study focused on the effects of a single transcription factor upon all three AAV
promoters was performed in the global genomic context of the AAV genome (143). In
the context of the AAV genome, redundant transcription factor effects would not be
detected through the loss of the single transcription factor. To address the combinatorial
effects of multiple regulating factors on the AAV genome, my research goals focused on
the determination of the non-structural AAV protein Rep as a transcriptional activator,
defining the activity of Rep in AAV gene expression, and the role of a Rep-Spl
interaction in the direct mechanism of AAV transcriptional regulation.
Define Rep Binding Element as Enhancer or Proximal Promoter Element
AAV must convert quickly from a latent virus, presumably integrated in
chromosome 19 (93, 160), to a productive, replicating genome following Ad infection
(133). To accomplish this, the virus appears to use two factors as a switch. The first is
41

42
Rep protein, which in addition to YY1 and MLTF, binds upstream of the p5 promoter
(Fig. 6) to shut off p5 transcription during latency (23, 97, 168). Thus, in the absence of
Ad, Rep78 and 68 cooperate with cellular proteins to completely inhibit p5 transcription
(143, 203). The second is adenovirus infection. Ad infection leads to Ela and Ad DBP
mediated activation of p5 (23, 24, 102), which accomplishes two things. It increases
transcription from the p5 and pi 9 promoters to produce increased levels of the four Rep
proteins (9, 23, 102). Rep78 and 68, in turn, increase transcription from the pi9 and p40
promoters to an even higher level (100, 123, 143, 203), while reducing transcription from
the p5 promoter (143, 203). Ad infection also independently activates pi9 transcription
(9). Thus the p5 and pl9 promoters are repressed by Rep in the absence of Ad and
differentially regulated in the presence of helper virus. During the proviral stage, Rep
autorepresses its synthesis to prevent excision of the provirus and expression of its gene
products. In the presence of the helper virus, Rep induces the synthesis of the pl9
proteins that required are for encapsidation and maintains the p5 Rep proteins at a lower
level to optimize the level of replicating intermediates.
The p5 promoter (Fig. 6) has been shown previously to contain three elements
involved in p5 regulation, an MLTF site at -80, a YY1 site at -60, and an RBE at -20
(23, 97, 125, 143, 168). In the absence of Ad infection, specifically Ela gene expression,
all three factors (YY1, MLTF and Rep) repress p5 transcription (24, 74, 97, 98, 143). In
the presence of an adenovirus coinfection, YY1 and MLTF both activate p5 transcription
(24). In the case of YY1, this apparently occurs via an interaction of YY1 and Ela with
the cellular p300 protein (103). Rep, however, continues to repress p5 when bound to the
p5 RBE, but is now capable of activating the two downstream promoters, pl9 and

Fig. 6. Sequences of the p5 and pi9 promoters. The known transcription elements in
the p5 and pl9 promoters are diagrammed along with their approximate positions
upstream of the mRNA start sites. p5CAT plasmid contains only the p5 promoter
elements driving CAT expression, while pIM45CAT3 contains both the p5 and pl9
promoter elements with the pi9 promoter driving CAT expression. Dotted lines indicate
intervening sequences that are not shown. Shown in italics are substitutions within the
pl9CAT3 promoter at -120, -110, and -20 that were previously demonstrated to have
little effect on pi9 transcription and the sub262 substitution within the p5 RBE that no
longer binds Rep protein. Shown in bold italics are the GAL4 substitutions in 2xGAL4
that replace the p5 RBE and the pi9 SP1-50 sites. A CREB/ATF site, which has been
mapped upstream of the MLTF site in p5, is not shown.

44
P5
onR MLTF-80 YY1-60
5TCACGTt3AGTGTTTTG|CGACATTTTbC-
TACACGCGTGTC GAATTCTGGGATCC
TATA-20 RBE YY1+1
..â– GGtTATTTAA|3CCCGAGTGAGCACGC|AGGGTCffcCATTTTl3A
GAATTCTGGATCCACT AA 294
CGGAAGACTCTCCTCCG
p19
730 cAAP-140 SP1-130 GGT-110
CCAGAAÁfGGpGCCG|3AGGCGGG7lACAAgGTGGTGl...
SP1-50 TATA-35 TATA-20
. .AGCTCC^GTGGGCGTGQACfrAATATlGGAACAGffÁfTÍÁÁlGC
CGGAAGACTCTCCTCCG 851
P19CAT3
730 cAAP-140 subSP1-130 subGGT-110
CCAGAAÑG(jlpGCCG)pTCGAGCTTÁ)GAACrCGAGGTfr...
SP1-50 TATA-35 subTATA-20
... CC ApT G G G CGTG G^CfTA ATATp G AAC AG fcCGCGQ/GC
851

45
p40 (98, 143, 203). In addition to the YY1, RBE and MLTF sites, p5 contains a
conventional TATA site (-30) and a YY1 responsive initiator site (+1) (164, 178). In the
presence of Rep and Ad gene expression, only mutations in the TATA, YY1-60 and
MLTF sites significantly affect p5 transcription (143).
The pi9 promoter (Fig. 6) contains two TATA sites (-30 and -35), which are
redundant, two Spl sites (-50 and -130) and a site at -140 that binds an unidentified
cellular AAV activating protein (cAAP) (27, 145, 178). Transactivation of the pi 9
promoter by Rep appears to require both the -50 Spl site and the -140 cAAP site (145).
It also requires the p5 RBE (143). In the absence of the p5 RBE, the TR, presumably via
its RBE, can transactivate all three promoters (9, 123, 143, 145, 203). Evidence that the
RBE within the TR is probably responsible for transactivation comes from deletion
analyses of the TR (9, 203). The two RBE elements appear to be redundant with respect
to pl9 transactivation at low Adenovirus MOIs but the TR predominates at high Ad MOI
(>10) (9, 143, 203). Furthermore, at high multiplicities of infection of Adenovirus (>25),
the effect of Rep78 or 68 expression on pl9 activity is no longer seen; that is, expression
of Ad factors can substitute for Rep78 or 68 (203). Finally, it has been shown that Rep
and Spl can directly interact (68, 145), and that Rep bound to the p5 RBE can form a
DNA loop with Spl at pi9 (144).
Repression by Rep proteins is more complex. In contrast to transactivation,
which appears to require either Rep78 or 68 plus Ad infection, repression of the p5 and
pi 9 promoters occurs in the absence of Ad regardless of which Rep protein is expressed
(74, 97). Repression of the p5 promoter depends in part on Rep binding to the p5 RBE
but also requires a functional Rep ATPase (97, 98). However, repression of p5 can be

46
seen in the absence of a functional p5 RBE. Furthermore, the pi 9 promoter, which does
not have an efficient RBE binding site, can be repressed by all four Rep proteins,
including Rep52 and 40, which lack an RBE binding domain and contain only the Rep
helicase and ATPase domains (74, 77, 97, 174).
Our initial hypothesis was that the upstream p5 RBE-Rep complex might behave
like an enhancer sequence that activates transcription from downstream promoters. To
determine if this were true we made a series of pi 9 CAT constructs (Figs. 7 and 8) in
which CAT gene expression was driven by the pi 9 promoter. The first set of constructs
(Fig. 7) was made to be certain that the CAT constructs would accurately reflect the
control of p5 and pi9 transcription that is seen with the parental TR minus pIM45
plasmid or with wild type AAV. In this set of constructs (Fig. 7), all of the sequences
upstream of the pl9 mRNA start site were identical to those of wild type AAV
(pIM45CAT3) or contained a mutation in the p5 RBE (psub262CAT3) that eliminated
Rep binding (125, 143). To prevent expression of aberrant Rep proteins from
pIM45CAT3 and psub262CAT3, both plasmids contained an amber mutation at amino
acid 71 of Rep78. This mutation terminated the synthesis of Rep78 while the CAT
insertion prevented synthesis of Rep52, so that no Rep proteins could be detected in the
absence of a Rep expressing plasmid. With the exception of the terminal repeat, these
constructs contain all the sequences necessary for pi9 regulation and pl9 transactivation
by Rep (123, 143, 145). The p5CAT plasmid described by Chang et al. (24) was used to
monitor expression from the p5 promoter (Fig. 7). It contained all of the sequences
upstream of the p5 promoter that have been shown to be necessary for p5 regulation with
the exception of the TRs. All of the plasmids used in this study were missing the AAV

Fig. 7. Activity of the wild type p5 and pl9 promoters. A, Diagram of the p5 and pi 9
promoter elements in the CAT reporter constructs p5CAT, pIM45CAT3 and
psub262CAT3. The asterisk indicates a stop codon in the Rep78 open reading frame at
amino acid position 71. B-D, Graphic representation of CAT activity from the p5CAT,
pIM45CAT3, and psub262CAT3 reporter constructs after transfection in A549 cells in
the presence of plasmid alone (Mock), or with the addition of 1 mg of pfM45 (Rep),
Adenovirus at an MOI=5 (Ad), or 1 mg of pIM45 and Adenovirus at an MOI=5 (Ad &
Rep).

CAT Activity (cpm)
48
P5
RBE .
hHf
MLTFYY1 YY1
P5
0 -(WT
CAT I
p5CAT
Rep*
p19
cAAP Sp1_^
Q^,n~5sr
plM45CAT3
P5
HHJ1
Rep*
p19
â– o-o
CAT
psub262CAT3
] Mock
p5CAT plM45CAT3 psub262CAT3

49
TRs because we and others have shown that the TRs are redundant activation elements
that promote excision and replication, thereby changing the template copy number
available for transcription (9, 123, 143, 159, 203).
The three plasmids (p5CAT, pIM45CAT3 and psub262CAT3) were transfected
into A549 cells in the presence or absence of a coinfection with Adenovirus (MOI=5) or
in the presence or absence of a cotransfection with the wild type Rep expressing plasmid
pIM45 (Fig. 7). pIM45 was chosen because we and others have shown that the four Rep
proteins Rep78, 68, 52, and 40 are expressed at different levels and have differential
effects on repression and transactivation of pl9 during productive infection (74, 97, 143),
and because pIM45 expresses the Rep proteins at approximately the same relative levels
that are seen during wild type viral infection (123, 203). Cells were harvested
approximately 40 hours after plasmid transfection and Ad infection and cell free extracts
were assayed for CAT activity as described in Methods.
As expected, coinfection with Ad alone significantly induced p5 transcription,
approximately 4 fold (Fig. 7 B). This presumably occurs through the interaction of the
El a proteins of Ad with the p300-YYl complex bound to the p5 promoter (24, 103, 168).
Cotransfection with a Rep expressing plasmid repressed p5 transcription both in the
absence (20 fold) and in the presence (12 fold) of Ad coinfection. This has also been
observed previously (9, 74, 98, 143) and is due in part to binding of Rep to the p5 RBE.
In contrast, pi9 transcription was significantly induced by Rep expression both in the
presence and the absence of Ad coinfection, about 5-6 fold (Fig. 7 C). This induction did
not occur if the p5 RBE was mutated so that it could no longer bind the Rep protein (Fig.
7 D). Ad coinfection alone also significantly induced pi9 transcription, approximately

50
80 fold, and this occurred to approximately the same level regardless of whether the p5
RBE element was intact (Fig. 7, C and D). The induction by Ad and Rep appeared to be
multiplicative and together they induced transcription from the pi 9 promoter by almost
450 fold (Fig. 7 C). p 19 CAT activity in the presence of Rep and Ad was approximately
20 fold higher than p5 CAT activity. This 20 fold difference was approximately the same
as that seen late after infection during normal wild type AAV infections when transcripts
are compared by other methods such as Northerns (9, 100). Thus, the CAT constructs
used in this study seemed to accurately reflect mRNA steady state levels seen during wild
type AAV infections or those seen with TR minus plasmid transfections.
Finally, we noted that when basal expression from the psub262CAT3 plasmid was
compared with that seen in the presence of the Rep expressing plasmid, there was
approximately a 2 fold inhibition of p 19 transcription (Fig. 7 D). Similarly, when the
level of expression in the presence of Ad was compared with expression in the presence
of Ad plus Rep, there was approximately a 2 fold inhibition of p 19 transcription by Rep
protein. Thus, expression of the Rep protein caused inhibition of the pi 9 promoter in the
absence of the p5 RBE. This has also been reported previously (9, 97).
The p5 RBE is not an upstream activation signal.
Having confirmed that the p5 RBE was essential for Rep mediated induction of
p5 transcription, we then asked whether the p5 RBE behaved like a position independent
enhancer or like an upstream activation signal. If the p5 RBE behaved like a
conventional enhancer or upstream activation sequence, we expected that an artificial
construct containing all of the essential pi 9 proximal promoter elements would continue
to respond to an upstream RBE in the presence of Ad and Rep gene expression. For this
purpose we designed a series of CAT constructs in which the pl9 proximal promoter

51
elements were left intact but the upstream AAV sequences, including the p5 promoter
were substituted with bacterial DNA. In these constructs the pi9 sequences up to -150 bp
of the mRNA start site were essentially the same as the wild type sequence (present in
pIM45CAT3) except that the TATA site at -35, the GGT site at -110 and the Spl site at -
130 were mutated (Fig. 6). These sites had been shown previously to be non-essential for
Rep induction or basal pl9 activity (145). The CAT coding sequence was inserted at +92
of the pi 9 message and a poly A signal was inserted upstream of the p 19 promoter to
prevent read through from fortuitous upstream polymerase II promoters in the bacterial
sequences. The p5 RBE signal was then inserted at various positions upstream or
downstream of the pl9 promoter. In the control plasmid, pl9CAT3, the p5 RBE was
omitted.
The level of pi 9 activation seen with the pl9CAT3 plasmid in the presence of
either Rep or Ad alone was similar to that seen with the parental pIM45CAT3 plasmid
that contained all of the upstream AAV sequences including the p5 promoter elements.
As expected, Rep did not significantly induce p 19 when Rep and Ad were present
together if there was no upstream RBE (Fig. 8 B). Surprisingly, Rep also did not induce
pi 9 transcription in the presence of both Rep and Ad when an RBE was inserted at -700
upstream of the p 19 promoter. This is approximately the same position that the p5 RBE
occupies in the parental plasmid pIM45CAT3. Furthermore, Rep did not activate pl9
transcription (compare Ad only with Ad plus Rep lanes) regardless of where the RBE
was inserted upstream or downstream of the pi 9 mRNA start site. Instead, the RBE
acted like a repressor element at most of the positions tested in the presence of both Rep
and Ad, and the level of repression increased dramatically as the RBE was inserted closer

Fig. 8. Effect of RBE position on pl9 activity. A, Diagram of transcription elements
within the wild type p5 and pl9 promoters. B-G, Diagrams of the parental plasmid
pl9CAT3 (B) and derivatives of pl9CAT3 C-G, in which an RBE was inserted at various
positions with respect to the start of p 19 transcription (-700 to +1225). The pl9CAT3
plasmid has the minimum pl9 promoter elements as shown in Fig. 6 and no p5 promoter
elements. The CAT activity of each construct was determined after transfection into
A549 cells in the presence of plasmid alone (Mock), pIM45 (Rep), Adenovirus (Ad) or
pIM45 and Ad (Ad & Rep).

53
p5RBE
â– 600 p5 p19 CAT Activity (cpm)
MLTFYY1 YY1
A I W
I
B
o
r
wt
SP-1
-50
qS> qC? -fP qC?
p* <£T
PolyA
C
D
E
F
G
p5RBE
-O ** CAT -1 P19CAT3
. p5RBE
oQ^n -too
qM cat
p5RBE
-145
^ n—cat I P5RBE *
-100
p, ^ cat | p5RBE
+25
n n catt^p5RBE
W +1225

54
to the pi9 promoter. The most dramatic repression was seen when the RBE was placed
at -100 upstream of the pl9 start site (compare Fig. 8 B, Ad + Rep with 8 E, Ad + Rep).
When the RBE was placed downstream of the pi 9 start site (Fig. 8 F and G), some of the
pi9 activity was recovered but the RBE continued to generally repress p 19 transcription
even when it was placed far downstream at +1225. Curiously, in the presence of only
Rep gene expression, pi9 activity was significantly induced over basal levels by Rep
when the RBE was placed at -700 or -145.
We concluded from these experiments that the RBE was not a conventional
upstream activation signal or an enhancer. It did appear, however, to have the ability to
act as a general repression signal in the presence of adenovirus infection under almost all
conditions tested when it was closer than 700 bp upstream or 1200 bp downstream of the
pl9 promoter. Our data also suggested that Rep itself was probably not an activator and
left open the question of how the p5 RBE could transactivate pi 9 in the context of the
normal AAV sequence.
Activation of pl9 is not due to read through from p5.
We considered two other possible mechanisms of pi 9 activation by the p5 RBE.
One was that transcription from the p5 promoter activated pi9 by a read through
mechanism. Although poorly understood, this has been shown to occur in the case of the
adenovirus Elb gene. In this case, active transcription of the El a promoter causes read
through activation of the Elb promoter in a cis-dependent manner (45, 121). Ela
transcription appears to alter the adenovirus genome into a transcriptionally competent
template before Ad DNA replication and late transcription have begun. This possibility
was not likely in the case of the p5/p 19 promoters because the p5 RBE inhibited CAT
expression (Fig. 7) from the p5 promoter at the same time that it induced CAT expression

55
from the pl9 promoter. However, it remained possible that CAT expression in this study
(as well as other steady state mRNA measurements done previously) did not reflect the
true firing rate of the p5 promoter. In order to address the possibility that p5 transcription
may be transactivating pi 9, two kinds of experiments were done. In the first experiment,
we compared pi 9 CAT activity from the pIM45CAT3 plasmid in the presence of Ad or
Ad plus Rep when the physical connection between the p5 and pl9 promoters was
removed by a restriction digest (Fig. 9). The pIM45CAT3 plasmid was transfected either
uncut, cut with Sphl, which cuts outside both the p5 and pi9 promoters, or cut with
Nrul, which cuts between the p5 and pl9 promoters. As before, the supercoiled uncut
plasmid showed strong activation of the pl9 promoter by Rep in the presence of Ad.
This was not seen when the plasmid was linearized by restriction digestion at either
restriction site even after the input DNA levels were normalized (see Methods). Thus,
Rep induction appeared to require a superhelical template. The difference in CAT
expression between the Sphl and Nrul cut plasmids in the presence of adenovirus alone
or Ad plus Rep was 2-3 fold. Thus, read through activation was not likely to contribute
more than 2-3 fold to pi9 activity.
In the second experiment, we inserted a poly A site between the p5 and p 19
promoters of pIM45CAT3 and psub262CAT3. Insertion of a poly A site between p5 and
pl9 in the psub262CAT3 plasmid had a minimal (2-3 fold) effect on p 19 activity (Fig. 10
D and E). This suggested again that relatively little if any pi 9 transcription relied on read
through from the upstream p5 promoter. In contrast, when the p5 RBE was present (Fig.
10 B and C), insertion of the poly A site decreased pi 9 activity by 10-20 fold under all
conditions tested. Regardless of whether a poly A site was inserted, the plasmids that

Fig. 9. Linearization of pIM45CAT3 plasmid to inhibit read through
transactivation, pi9 CAT activity from A549 cells transfected with supercoiled
pIM45CAT3 plasmid. A, or plasmid that had been linearized by digestion with Nrul (B)
or SphI (C). For each case the activity in the presence of Adenovirus infection, MOI=5
(Ad) is compared with the activity in the presence Ad infection and transfection with 1
mg of pIM45 (Ad & Rep). The values in (A) are the same as those in Fig. 7C and are
presented for comparison.

PIM45CAT3 plM45CAT3-Sphl plM45
CAT Activity (cpm)
plM45CAT3

Fig. 10. Effect of poly A insertion to inhibit read though activation. A, Poly A
sequence was inserted into pIM45CAT3 and psub262CAT3 between the p5 and pi9
promoters to determine the effect of a poly A signal on pi9 activity when the plasmid
was transfected by itself (Mock), in the presence of the Rep expressing plasmid pIM45
(Rep), in the presence of Ad at an MOI of 5 (Ad), or in the presence of both pIM45 and
Ad (Rep & Ad). The asterisks indicate that the Rep coding sequence has a stop codon at
Rep78 amino acid position 71 to prevent Rep expression from the CAT reporter
plasmids. The values in (B) and (Q are the same as those in Fig. 7 C and D and are
presented here for comparison.

59
p5RBE
-600 p5
A 8-O^P-
MLTFYY1 YY1
p19
SP-1
-50
Wt
B OWT1 Rep'—*-0 rr^°
plM45CAT3
PolyA
C Q-ewX i—
plM45CAT3PolyA
D (KHT 1 Rep'—Lonoa
psub262CAT3
PolyA
E OQf1 P,,n, 'jn rAT 1
psub262CAT3PolyA
CAT Activity (cpm)
1C? 102 103 104 105 106
1—> * tmtl 1 t t mui i i i mill 1 i i mui i l muJ
h

60
contained a p5 RBE both showed a Rep mediated induction of pi 9 in the presence of Ad.
Taken together, our results suggested that modification of the pi 9 plasmid template by a
method that could change the secondary structure of the plasmid (restriction digestion) or
potentially create new protein complexes in the region between p5 and pi 9 (insertion of a
poly A site) reduced pl9 activity. However, they did not suggest read through activation
as a likely mechanism for pl9 induction.
Transactivation of pl9 can be modeled in the absence of Rep.
Thus far, our data were not consistent with the p5 RBE being a conventional
upstream activation signal or with the possibility that it stimulated pl9 transcription by
read through from the p5 promoter. If Rep bound to the p5 RBE was not itself a
transactivator, we then considered the possibility that it had an architectural role. We had
shown previously that Rep bound to the p5 RBE could form a DNA loop via protein
interaction with Spl bound to the pi9 promoter (144). It was possible that the interaction
between Rep and Spl served primarily to bring the other p5 transcriptional elements
(namely the MLTF and YY1 complexes) to the pi 9 promoter, and that one of these
elements was primarily responsible for pi 9 activation. If this were true, then it should be
possible to substitute the Rep and Spl sites with alternative elements that bound proteins
that were capable of interacting.
To test this possibility we substituted both the p5 RBE and the p 19 -50 Spl site
within the parental plasmid pIM45CAT3 with Gal4 binding elements to make the
plasmid called 2xGAL (Fig. 11). Substitution of the RBE and Spl sites was done so that
the spacing in the p5 and pi9 promoters remained the same (Fig. 6). We then tested for
p 19 activation in the presence of two Gal4 fusion proteins that contained the well
characterized interaction domains of SV40 T antigen and p53 (47, 109) but did not

Fig. 11. Replacement of Rep & Spl with Hybrid GAL4 Factors. A, The diagram
illustrates that the RBE in the p5 promoter and the Spl-50 site in the pl9 promoter of
pIM45CAT were both replaced with GAL4 binding sites. See Fig. 6 for specific
sequence modifications. In the presence of hybrid GAL4-p53 and GAL4-Tag fusion
proteins, the remaining p5 promoter elements and their associated protein complexes
would be brought into close proximity with the pi9 promoter resulting in a DNA loop
structure. B, Transactivation of the pIM45CAT3 reporter plasmid when transfected alone
(Mock), with lmg of pIM45 plasmid (Rep), with an adenovirus infection, MOI=5 (Ad),
or an Adenovirus infection at MOI=5 + pIM45 transfection (Ad & Rep). (This data is
identical to that in Fig. 7 B and is presented here for comparison.) C, Transactivation of
the 2xGAL plasmid when transfected alone (Mock), with 1 mg of pM-53 plasmid (p53),
with 1 mg of pM-Tg plasmid (T-Ag), with 1 mg of both pM-53 and pM-Tg plasmid (p53
& T-Ag), with Ad infection at MOI=5 (Ad), with Ad infection at MOI=5 and the two
hybrid plasmids (Ad, p53, T-Ag) or with Ad at MOI=5 and either 1 mg pM-53 (Ad &
p53) or 1 mg pM-Tg (Ad & T-Ag).

62
1000000 -i
YY1+1 YY1-60 MLTF
n n n
—• l I |VlV0)t_
jAd'á \ S
^ feV-i
(p53)
(GALA)
H cat i
100000 -
E
a.
>
'>
10000 -
o
<
5
O
1000 -
15333 p53 & T-Ag
Ad & p53
Ad & T-Ag
E2223 Ad,p53,T-Ag
PIM45CAT3 2xGAL
B C

63
themselves contain transcriptional activation domains. Substitution of GAL4 binding
sites for the p5RBE and pi9 Spl -50bp binding sites within the pIM45CAT3 reporter
plasmid was expected to allow the GAL4 DNA binding domains to bind DNA and create
a DNA loop between the two promoters through the p53 and SV40 T-Antigen interaction
domains (Fig. 11A).
As expected, basal pi9 CAT activity from the 2xGAL plasmid was low and
comparable to that seen with the parental pIM45CAT3 plasmid (Fig. 11, B and C,
compare Mock lanes). Expression of the Gal4 DNA binding proteins alone induced pi 9
activity by approximately 20 fold while infection with Ad alone induced pl9 activity by
approximately 30 fold. However, when both the Gal4 fusion proteins and Ad were
present, pi9 activity was induced by 350 fold over the basal level. Transfection with
only one of the GAL4 fusion plasmids (p53 or T-ag) and infection with Ad did not induce
pi9 activation. These results demonstrated that an interaction between an activated p5
promoter, which occurs in the presence of Ad infection, and the pi 9 promoter was
essential for pi 9 activation, and that this could be engineered in the absence of Rep and
Spl elements. It also suggested that Rep and Spl probably function primarily as
architectural proteins and activate p 19 by bringing other p5 elements into close proximity
with the pi9 promoter.
The level of pi 9 activity seen in the presence of the two Gal4 fusion proteins and
Ad was approximately half of that seen in the parental pIM45CAT3 plasmid in the
presence of Rep and Ad (compare Fig. 1 IB, Rep with 11C, Ad, p53, T-ag). This was
consistent with the fact that unlike the pIM45CAT3 plasmid, which binds Rep and Spl at
distinct sites, the 2xGAL plasmid could bind the same fusion protein (either T antigen or

64
p53) at each GAL4 binding site (p5 and pi9). When this happened it would lead to little
or no interaction between p5 and pi9, and presumably no activation. This would
theoretically occur 50% of the time; thus, the 2xGAL plasmid was expected to be
activated about half as well as the parental pIM45CAT3 plasmid. Indeed, transfection
with only one of the GAL4 fusion proteins in the presence of Ad inhibited the activation
normally seen with Ad (Fig. 11C, Ad & p53 or Ad & T-ag lanes). Alternatively, the Spl-
50 site may contribute to the basal level of the pi 9 promoter or to its ability to be induced
by the Ad El a gene product independently of an interaction with the p5 promoter
elements.
Which p5 element is primarily responsible for Rep mediated induction of pi9?
If the role of the p5 RBE is to bring some other element to the pi 9 promoter,
which of the known p5 promoter elements (MLTF, TATA or YY1) is primarily
responsible for Rep induced activation in the presence of adenovirus? To determine this
we constructed a series of 2xGAL plasmids in which one or more of the other p5
transcription elements were mutated to eliminate binding of its cognate transcription
factor (Fig. 6). Mutation of the p5 MLTF site had little effect (about 2 fold) on the final
level of pi 9 activity (Fig. 12A and B). Furthermore, pl9 activity was induced in the
presence of Ad and both of the hybrid GAL4 fusion proteins, suggesting that MLTF was
not critical for pi9 induction (Fig. 12B). In contrast, any mutant that included a defective
YY1-60 site was defective for induction in the presence of both Ad and the GAL4 factors
(Fig. 12C, D, E). This suggested that at least one of the critical elements within the p5
promoter for pl9 activation by a putative Rep-Spl interaction was the YY1-60 site.
Two other points became clear from an examination of the mutants. First,
mutation of the YY1-60 site had a major effect on the basal activity of the pl9 promoter.

Fig 12. Transactivation of the 2xGAL pl9 promoter by mutant p5 promoters. The
2xGAL plasmid containing a wild type or mutant p5 promoter was transfected alone
(Mock), with 1 mg each of the hybrid GAL4-p53 and GAL4-Tag expressing plasmids,
pM-53 and pM-Tg (Hybrid), with an Adenovirus infection at MOI=5 (Ad), or with an
Adenovirus infection at MOI=5 and the hybrid GAL4 expressing plasmids (Ad &
Hybrid). See Fig. 6 for specific sequence modifications. A, Transactivation of the
2xGAL4 plasmid containing a wild type p5 promoter. (These values are extracted from
Fig. 6B and presented here for comparison.) B, Transactivation of the 2xGAL reporter
construct lacking the p5 promoter MLTF binding site. C, Transactivation of the 2xGAL
reporter construct lacking the p5 promoter YY1 -60 binding site. D, Transactivation of
the 2xGAL reporter construct lacking the p5 promoter MLTF and YY1 -60 binding sites.
E, Transactivation of the 2xGAL reporter construct lacking the p5 promoter MLTF, YY1
-60, and YY1+1 binding sites.

CAT Activity (cpm)
66
140,000
120,000
100,000
80,000
60,000
40,000
20,000
I I Mock
I I Hybrid
I 1 Ad
2xGAL4
2xGAL4
subMLTF
2xGAL4
subYY1-60
2xGAL4
subMLTF
subYY1-60
2xGAL4
subMLTF
subYY1-60
subYY1+1
A
B
C
D
E

67
Mutation of this site in the p5 promoter increased basal transcription from the pl9
promoter by 100 fold (compare Fig. 12A mock with 12C mock), and in the presence of
Ad, pl9 transcription was increased 10 fold (Fig. 12A, Ad and 12C, Ad). The YY1-60
element has been shown previously (24, 168) to repress the p5 promoter in the absence of
Ad or Rep. Our data (Figs. 12A, C) indicates that the YY1-60 site also has a negative
effect on pi 9 transcription both in the presence and the absence of Ad. In these two
cases, no GAL4 fusion proteins were present; thus, interaction between the p5 and pl9
elements through the Gal4 sites was not possible. This means that other kinds of
interactions between p5 and pl9 must be occurring in addition to those that occur
between the Gal4 sites (ie., the p5 RBE and the pi 9 Spl sites). Second, mutation of the
MLTF site also produced an increase (15 fold) in the basal level of pi 9 expression (Fig.
12A and B, mock lanes). Like the YY1 site, the MLTF site had been shown previously
to repress p5 in the absence of Ad (24). Our results indicate that it also represses the pi 9
promoter in the absence of Ad, possibly by a set of p5/pl9 interactions that are distinct
from those mediated by the YY1 site and the Gal4 (Rep/Spl) sites.
Transcriptional Analysis of Mutant Rep Proteins
Multiple studies of the AAV Rep proteins have demonstrated that the enzymatic
activites of Rep could be localized into functional subunits within the protein. However,
the complete elimination of one biological activity usually results in the loss of several
others. The best example of this interactive effect is the nucleotide binding domain
mutations. The loss of this ATPase domain removes Rep trs endonuclease activity and
DNA replication but also creates a defect in transcriptional transactivation for both the
pi 9 and p40 promoters (124). As result, a more detailed mutagenesis of the AAV Rep

68
protein was required to identify discrete protein domains for each individual enzymatic
activity.
A previous study used the common method of charge-to-alanine mutagenesis for
the production of temperature sensitive mutations. After an initial screening of 10
different Rep mutants, they isolated 2 mutants with separate conditional lethal
phenotypes. The first mutant had an initial protein instability defect that was
characterized as a Mg2+ binding mutation (50). This Mg dependent mutant was not
required for Rep DNA binding or helicase but was critical for terminal repeat
endonuclease activity. The second mutant was identified as a temperature sensitive
mutation that was defective for intracellular replication of AAV. This temperature
sensitivity created a 3-log titer difference between the permissive 32C temperature and
nonpermissive 39C temperature.
Generation of Rep Mutant Plasmids.
In order to produce a large number of possible AAV Rep ts mutants, a charge-to-
alanine amino acid mutagenesis approach was performed on the Rep open reading frame.
This process is believed to disrupt functional domains on the protein surface and result in
conditional lethal mutants. Within the plasmid backbone of pIM45, a noninfectious
genomic subclone of the AAV-2 genome, 20 different clusters of charged amino acids
were substituted with alanine amino acids (Table 1). The pIM45 plasmid allowed the
resulting protein sequence changes to be expressed in all four Rep proteins. Mutagenesis
in every Rep protein would allow possible conditional lethals to be assayed for in vivo
biological effects. The expression of both Rep78/68 and Rep52/40 mutant proteins could
be used to detect conditional lethals within assays for terminal repeat endonuclease
activity, DNA replication, and viral transcription. Previous research and site-directed

Table 1. Biochemical Activities of Rep Alanine Scanning Mutagenesis Panel. In this
Table, each Rep mutant was assayed for its ability to function as a possible mutant in
Adeno-Associated Virus’s known biochemical activities. Within the plasmid backbone
of pIM45, a noninfectious genomic subclone of the AAV-2 genome, 21 different clusters
of charged amino acids were substituted with alanine amino acids.

70
Amino Acid Change(s)
Titer
in vivo Replication
Binding
ATP ase
m13 helicase
Nick
Nick
Double-Stranded
No-Stem
Template
Template
wild type
++
+
+
++
++
+
+
K10A.D14A
-
-
+
++
+ +
-
—
D40A.D42A.D44A
ts
ts
ts
++
+ +
ts
+
H90A,H92A
-
-
+
+ +
+ +
—
-
Y156F
+
+ +
—
-
K160A.E164A
-
-
+
+ +
+ +
—
—
K340H
-
-
—
-
E345A.H349A
-
-
+
+
+
-
-
D371A.K372A
-
-
+
+
+ +
—
+
K381A.H385A
-
-
n/d
n/d
n/d
n/d
n/d
E388AK391A
-
-
+
+ /-
+ /-
—
+
E32A.K33A.E34A
++
+
n/d
n/d
R68A.R69A.K72A
++
+
n/d
n/d
D149A.E150A
++
+
n/d
n/d
R223A
++
n/d
n/d
D233A.K234A
++
+
n/d
n/d
K278A.D282A
++
+
n/d
n/d
E291 A,D292A
++
n/d
n/d
D455A,H456A,D457A
++
n/d
n/d
E481A,E482A
++
+
n/d
n/d
D501A.D504A
++
+
n/d
n/d
D519A,E521A
+
+
n/d
n/d

71
mutagenesis of the AAV Rep protein has resulted in the preliminary identification of a
temperature sensitive mutant (50). This mutant D40A, D42A, D44A had a delayed
replication phenotype that resulted in a 3 log difference in viral titer between 32C and
39C. We have determined the enzymatic activity affected by this protein sequence
change as well as screened a panel of 20 new Rep charge-to-alanine mutants. We have
assayed their ability to exhibit a temperature sensitive phenotype and localized the
specific enzymatic activities affected within these replication defective mutants.
Transcriptional Activation of the pi9 Promoter by Rep Mutants.
In order to directly examine the transcriptional activation of each charge-to-
alanine mutant on the pi9 promoter, pIM45CAT3 was used to assay each Rep mutant for
its ability to specifically transactivate the p 19 promoter during Adenovirus infection. The
pIM45CAT3 construct had a strong level of Rep mediated transactivation that is
comparable to previously published results ( Fig. 13 Lanes 1 and 2) (Lackner and
Muzyczka in press). However, the cotransfection of several replication defective mutants
during an Adenovirus infection resulted in even higher levels of pi 9 transcriptional
activation (Fig. 13 lanes 3,4,5,6, and 11). One of these mutants, K340H, is the well
0
characterized nucleotide binding mutant (27, 38, 41, 74, 83, 90, 190, 195, 196, 203, 204).
Previous studies have shown that this mutant is defective for both ATPase and M13
helicase activity but retains DNA binding activity. Weger et al. (203) have assayed its
ability to transactivate the pi9 and p40 promoters which resulted in much higher levels of
AAV gene expression. Although this same K340H mutant was unable to stimulate gene
expression in an AAV construct containing the terminal repeats, the loss of
transcriptional activation was believed to be the result of the loss of DNA replication on
the transcriptional template and not its inability to transactivate the pl9 promoter.

Fig. 13. Transcriptional Activation of the pi9 Promoter by Rep Mutant Panel.
pIM45CAT3 reporter plasmid was used to assay each Rep mutant protein for its ability to
transactivate the pi9 promoter. A Rep protein expression plasmid, pIM45, containing the
various alanine scanning mutants was co-transfected with Adenovirus to transactivate the
pi 9 promoter.

73

74
Another mutant construct, Y156F, was used as an experimental control in the
pIM45CAT3 transcriptional assay. This mutant has specifically targeted the tyrosine
residue at amino acid position 156, which has direct role in the endonuclease cleavage
reaction during AAV DNA replication. The AAV terminal repeat is cleaved by the
tyrosine residue and substitution of a phenylalanine at this position created a replication
defective mutant (39, 173, 195). The Y156F mutant had no significant difference in its
ability to transactivate the p 19 promoter in the pIM45CAT3 plasmid background (Fig. 13
lane 7). This mutant has a functional ATPase and helicase activity (39, 173, 195.)
The three other mutants retain their ATPase and helicase activity but also express
much higher levels of pi 9 gene expression (Fig. 13 lanes 3, 4, and 5). All three of these
mutants are able to bind the terminal repeat but are unable to nick at the trs site. One
reason for this higher expression could be an alteration in Rep-DNA binding on the p5
promoter. The formation of stable Rep protein complexes on the p5 RBE may allow the
DNA loop between the p5 and pi9 promoters to occur more often and transactivate the
pl9 promoter through Spl at a much higher rate. Another reason for a higher level of
pi9 transactivation may be a difference in binding affinity between the mutated Rep
proteins and the Spl protein bound at the pi9 promoter.
The most interesting result was the dramatic decrease in pl9 promoter
transactivation for the E345A, H349A and D371 A, K372A mutants. These mutants have
maintained their DNA binding, ATPase, and helicase activities although they are
defective in pi9 promoter transactivation. The pi9 promoter assay using the
pIM45CAT3 reporter gene plasmid was defective for both of these mutants as compared
to the wt Rep protein. Although they were above the level of pi 9 transactivation with

75
Adenovirus alone, the mutants did not completely complement the ability of Rep to
mediate pi 9 transactivation (Fig. 13 lanes 8 and 9). The disruption of Rep mediated
transactivation in both of these mutants may be in different protein domain but may affect
a similar overall function. The E345A, H349A mutant has an interesting characteristic in
that it mutates a potential HMG box that may contribute to a possible mechanism of
transactivation. The potential HMG box domain may be responsible for separation of
DNA strands and the initiation of gene expression for this mutant Rep protein. The
alteration of this protein domain may prevent the correct level of p 19 transactivation
through the action of Rep invading the DNA strands at the p5 or terminal repeat. The
HMG box may permit the correct Rep protein complex to form on the p5 promoter and
correctly contact the Spl bound at the pi 9 promoter. This requirement of strand invasion
may be dependent on helicase activity as well as a functional HMG protein domain.
The D371A, K372A does not appear to directly affect any identifiable protein
domains but its location is close to both a strong Rep-Rep interaction domain and a
previously identified topoisomerase protein sequence. This protein domain could be
responsible for the assembly of large Rep protein complexes that form on the various
RBEs within the AAV genome. This mutant does not initially appear to target a critical
domain required for Rep-Rep interactions but it appears to have multiple problems
regulating the transcriptional activation of the pi 9 promoter as well as the ability of Rep
to repress the p5 promoter.
Repression of the p5 promoter.
One of the most important characteristics of the AAV lifecycle is to repress the
expression of the Rep gene in the absence of an Adenovirus infection (98, 143). In order
to localize the Rep protein domain responsible for this biological activity, the entire Rep

76
mutant panel was assayed for its ability to repress p5 transcription in the absence of an
Adenovirus coinfection. In this assay of the p5 promoter, the p5CAT3 promoter was
transfected into A549 cells and assayed for its ability to be repressed in the presence of a
mutant Rep protein. As a negative control, the nonsense mutant Rep, dAXX, was
transfected to determine the basal strength of the p5-190CAT promoter (Fig 14 lane 1).
When the wt Rep protein was transfected into A549 cells, the transcriptional activity of
the p5 promoter is 6% of its basal activity demonstrating a strong level of repression by
the Rep protein (Fig. 14 lane 2). It was interesting to note that all of the Rep replication
mutants that were defective in transactivation of pl9 were also greatly reduced in their
ability to repress the p5 promoter. Strikingly, the two mutants E345A, H349A and
D371A,K372A exhibited much lower Rep mediated transactivation of the pl9 promoter
and were unable to repress the p5 promoter through Rep-DNA binding activity. Each of
these two mutants had 7-fold higher levels of p5 promoter expression resulting from the
inability of these Rep proteins to correctly bind the p5 RBE and repressing the promoter
(Fig 14 E345A, H349A and D371A,K372A ). The modification of the HMG box may
result in Rep protein which is unable to correctly assemble large Rep complexes and
repress the p5 promoter. The highest degree of lower repression of the p5 promoter is
directly related to its distance to the HMG box domain.

Fig. 14. Transcriptional Repression of the p5 Promoter by Rep Mutant Panel.
p5CAT reporter plasmid was co-transfected with various Rep alanine scanning
mutations. The basal level of p5 promoter activity was graphically shown as 1.0-fold of
activity. The ability of each Rep mutant to repress the p5 promoter was shown as a
percentage of p5 basal activity.

Percent of Basal p5 Promoter Activity
O O O O O -I
b K> ^ b) bo o
i l i i i i i l i l
00

CHAPTER 4
DISCUSSION
To learn more about how the Rep protein controls AAV transcription, we tested
several mechanisms of transcriptional control. Using the CAT gene as a reporter, we first
confirmed that activation of the pi 9 promoter by Rep was dependent on a functional RBE
within the p5 promoter (Fig. 7). As expected pi9 activity was significantly reduced in
the absence of Rep or in the absence of the p5 RBE, provided that the cells had been
infected with adenovirus. This confirmed the results of several previous studies
including our own (100, 123, 143, 203). In addition, we measured accurately the
induction of the pi 9 promoter by Ad infection and Rep expression, and the range from
basal to fully induced was almost 3 logs.
The RBE is not a typical upstream activation signal.
We initially expected that Rep would activate the pi9 promoter in the same way
that its homologue in the autonomous parvovirus family transactivates the p38 capsid
promoter. The MVM Rep analog, NS1, has been shown to induce transcription from the
p38 capsid promoter by binding to a nearby NS1 binding site and interacting with an Spl
-50 site upstream of p38 (94, 113, 114). In the case of NS1, it is clear that a C terminal
activation domain is essential for induction (106) and that NS1 binding sites behave like
upstream activation signals.
To test this possibility for Rep, the RBE was placed at several positions upstream
or downstream of an artificial p 19 promoter that contained the key pi 9 promoter
79

80
elements required for Rep activation (Fig. 8). However, surprisingly, the RBE resulted
primarily in repression of the p 19 promoter, and in general, repression was most severe
when the RBE was closest to the p 19 start site. Several points are worth noting about this
experiment. First, in the presence of adenovirus infection. Rep was not capable of
transactivating the p 19 promoter when only the RBE was inserted into the construct.
This clearly showed that the RBE-Rep complex alone was not sufficient for
transactivation. It is also consistent with the fact that, to date an activation domain has
not been found in Rep. Only the C terminal end of Rep has been found to activate
transcription in two hybrid experiments and this region, which is absent in Rep68, is not
essential for p 19 or p40 activation (29, 202, 203).
The second point worth noting is that the level of repression depended on the
conditions of measurement and the distance of the RBE from the start of the pi 9 mRNA.
When Ad infected cells were compared with cells infected with Ad and expressing Rep,
the repression was modest, at most 4 fold (in the case of the -145 position). When Rep
was expressed by itself (in the absence of Ad) there was a 3-7 fold induction of p 19
activity (except in the case of the -100 construct). However, it was clear that placement
of the RBE close to the p 19 promoter had a severe effect on pl9 activity. This was true
even in the absence of Rep expression when Ad was present (Fig. 8, Ad only lanes),
suggesting that a cellular factor as well as Rep were able to interact with the RBE to
cause repression. When the RBE was inserted at the -100 position within the p 19
promoter, a region previously shown to have no effect on transcription (144), p 19 activity
was lower than the basal level under all conditions tested.

81
Repression by Rep protein has been demonstrated for a variety of heterologous
promoters as well as the endogenous AAV promoters. These include the SV40, c-ras, c-
myc, c-fos, HPV, HIV and Ad early promoters (7, 8, 66, 74, 82, 91, 97, 143). The
mechanism of repression is not clear. Rep has been shown to interact with TBP (69), and
one report suggests that Rep may prevent assembly of TFIID complexes on DNA (181).
Rep also has been shown to bind to the transcriptional activators PC4 (202), Spl (68,
145) and Topors (201), and to the protein kinases PKA and PrKX (29, 40). Recently,
Cathomen et al. (21, 22) identified a cellular transcription factor ZF5 that binds to the
RBE and may contribute to the cellular repression of pi 9 seen here in the absence of Rep.
Rep has also been shown to stimulate some promoters, for example c-sis and CMV (210,
211). At least two mechanisms appear to be involved in Rep mediated repression as first
suggested by Kyostio et al. (98). The first mechanism involves binding of Rep to an RBE
as in the case of the p5 promoter. The second does not require an RBE but does require a
functional ATP binding site in Rep. Presumably, the ATP binding site is needed either to
modify the structure of Rep protein-DNA complexes or to modify the transcriptional
template via the Rep associated DNA and RNA helicase activities (75, 209). Consistent
with the helicase idea, mutations in the Rep protein’s helicase motifs have been shown to
be negative for transactivation and repression (98, 124).
The p5 RBE is probably an architectural element designed to bring the p5 and the
pi9 promoters together.
Our failure to induce pi9 activation in artificial constructs that contained only an
upstream RBE suggested two other alternatives, read through activation from the p5
promoter and activation by other elements present in the p5 promoter via a looping
mechanism. We found no compelling evidence of read through activation from the p5

82
promoter (Figs. 9 and 10). However, several experiments suggested that the p5 RBE
served as a scaffold to bring the p5 promoter elements to the pi9 promoter.
Previous work had shown that if purified Rep and Spl are incubated with DNA
containing the p5 and pi9 promoters, a DNA loop can form between the two promoters
via Rep-Spl interaction (144). In this report, we showed that both the p5 RBE and the
pl9 Spl-50 site can be substituted with GAL4 sites. When this was done, activation of
the pi 9 promoter no longer required Rep but depended instead on the presence of hybrid
GAL4 fusion proteins containing p53 and T antigen interaction domains. Neither fusion
protein contained an activation domain of its own, and neither protein could activate pi 9
on its own. However, together the two fusion proteins activated pi9 transcription nearly
as well as Rep and Spl (Fig. 11). This demonstrated that the role of the Rep-Spl
interaction was probably to bring transcription complexes assembled on the p5 promoter
to the pi9 promoter.
Mutagenesis of the p5 promoter identified at least one element essential for pi 9
activation, the YY1 -60 site. Mutation of this element eliminated activation by the GAL4
hybrid proteins (Fig. 12). In contrast mutation of the p5 MLTF site did not eliminate
activation by the hybrid proteins although it did reduce the level of activation. Our
experiments did not exclude the possibility that the YY1+1 site or the TATA site was
also involved in activation. However, the combination of mutants in YY1-60 and MLTF
or YY1-60, MLTF, and YY1 + 1 were not substantially different the YY1-60 mutant by
itself.
In addition to eliminating pi9 activation by Ad and the hybrid proteins, mutation
of the YY1-60 site also produced a substantial increase in basal pl9 expression and Ad

83
induced p 19 expression (Fig. 12). The implication of this is that there are alternative Rep
independent interactions between the p5 and pi 9 promoters and one of these is mediated
by the YY1-60 site in the p5 promoter. The net effect of this interaction is to repress pl9
promoter basal and Ad induced activity. Thus, the p5 YY1 -60 site represses both the
proximal p5 promoter and the downstream pi9 promoter.
Comparison of the YY1-60 mutant with the parental 2xGAL4 plasmid illustrates
one reason for the complexity of AAV transcriptional regulation (Fig. 12). Elimination
of this site by mutation increases pi 9 activity in the presence of Ad to the level seen in
the parental plasmid in the presence of Ad and the hybrid factors. Thus, pi 9 could be
induced to the level needed during AAV replication without the need for further
activation mechanisms (such as Rep) if the YY1-60 site were not present. Flowever, as
mentioned above, elimination of the YY1-60 also increases the basal level of p5
transcription and reduces the Ad induced level of p5 (168). Increasing the basal level of
p5 transcription would lead to a virus that is less likely to maintain the latent state
because of inappropriate p5 Rep expression. Decreasing the Ad induced level of p5
transcription would reduce the level of AAV DNA replication during productive
infection.
To illustrate how p5/p 19 interactions might promote activation or repression of
pl9 under different conditions, we have drawn the model in Fig. 15. The model
compares the interaction in pIM45CAT3, which contains wild type p5 and pi9
sequences, with that in psub262CAT3, which has a mutant p5 RBE. In the wild type p5
promoter (pIM45CAT), Rep binds to the p5 RBE and forms a complex with Spl bound
to the Spl-50 site in the pi9 promoter. This places several potential activation regions

Fig 15. Model of pl9 promoter transactivation by interaction with transcription
factor complexes bound to p5. See text for details.

85
A
.♦*
♦
♦
*
( plM45CAT3
YY1 REP TATA YY1 MLTF

86
including those of YY1, MLTF, and El a near the pi 9 TATA box to activate pi 9
transcription. Meanwhile, within the p5 promoter, Rep binding inhibits p5 transcription
either by steric hindrance of basal transcription factors (98), by an enzymatic mechanism
involving the Rep ATPase activity (98) or by inhibitory contacts with YY1 or El a.
When the RBE is absent (psub262C AT) or in the absence of Rep gene expression, the
interaction between p5 and pi9 is either absent or occurs between different proteins, for
example, YY1 and Spl (163). The YYl-Spl interaction places activating p5 complexes
in a different position with respect to the pi9 basal transcription machinery, which may
inhibit pi9 rather than activating it. Meanwhile, within the p5 promoter, the absence of
Rep binding leads to derepression of the p5 promoter (98, 143). The model does not
include the contribution of p300 (103) as well as several other cellular and Ad proteins
that are likely to be involved, for example, PC4 (202) and DBP (23). In addition, it is
likely that other as yet unidentified cellular factors are involved in the complexes that
form on the p5 and pl9 promoters. However, the model does illustrate how alternative
interactions can be established between the two promoters that lead to repression or
activation and emphasizes the role of Rep and YY1. The next logical step will be to
determine precisely what is present in the p5/pl9 complexes in uninfected and Ad
infected cells.
Finally, our data also explains a puzzling observation made by Beaton et al (9).
This group replaced the p5 promoter sequences upstream of the RBE (including the
TATA, YY1-60, and MLTF sites), with the SV40 ori region containing the promoter
elements for early SV40 transcription. Surprisingly, this construct was indistinguishable
from wild type AAV, but only if it contained an intact terminal repeat. Deletions of the

87
terminal repeat that removed the TR Rep binding elements were completely defective for
AAV transcription. On the other hand, constructs that contained a wild type p5 promoter
showed no effect on transcription when the same TR deletions were analyzed. The
results obtained with the SV40-AAV hybrids are entirely consistent with our finding that
the p5 YY1 site plays a key role in activation of pi 9. Because the TRs are redundant
activation elements that contain an RBE, they substituted for the YY1 complex that was
missing in the SV40-AAV hybrid constructs. However, deletions in the TR that removed
the RBE presumably prevented their interaction with the AAV promoters, and thus
eliminated AAV transcription. This begs the question as to what transcription elements
are present in the TR that can substitute for the p5 elements.
Rep Protein Domains in AAV Transcriptional Regulation
A previous study established that two different Rep mutants were created in this
manner and resulted in different phenotypes. One mutant contained a magnesium
binding mutation that affected the Rep protein in its trs endonuclease activity (50). The
mutation did not affect the ability of the Rep protein to bind the terminal repeat or its
helicase activity. However, it was demonstrated that the D412A mutant had a diminished
ability to interact with Mg2+ ions and an interaction between the Rep D412A mutant and
Mg2+ was essential for efficient trs endonuclease cleavage. This data was the first
suggestion that a portion of the active DNA cleavage site required a Mg2+ ion and the
D412A amino acid.
The second phenotype identified was the first identified conditional lethal
mutation within the AAV-2 Rep protein. The D40A,D42A,D44A mutant was found to
demonstrate a 3-log difference in rAAV titer between 32C and 39C. Examination of this

88
mutant in a replication assay showed a fairly strong delay in DNA replication at the
permissive temperature of 32C (50) (Lackner in prep). However, the ts Rep mutant
showed a complete lack of activity at 39C. In order to better understand the exact
alterations in the D40A,D42A, D44A mutant, we analyzed each of the biochemical
activities within this protein. We discovered that the temperature sensitivity was mainly
dependent on a defect in DNA binding (Lackner in prep). Alteration of the protein
sequence inhibited DNA binding of Rep to a synthetic terminal repeat in the AAV
genome. The reduced level of DNA binding resulted in a complete loss of Rep
endonuclease activity of the AAV terminal repeat.
An important aspect of this D40A, D42A, D44A mutation could be inferred from
its sequence homology with other unrelated proteins such as E. coli DNA J and SV40 T-
Antigen (Fig. 16). The AAV-2 Rep sequences from amino acids 38 to 42 have a high
degree of homology to the chaperone protein domain of DNA J in E. coli and a similar
domain of SV40 T-Antigen (20, 166, 177). Based on this protein sequence alignment,
the temperature sensitivity of the mutant Rep protein was a result of the disruption of this
potential J domain. Similar to its role in SV40 T-Antigen, the potential J-domain within
Rep78 may have a direct and stable interaction with the cellular chaperone protein,
Hsp70 (62). The J-domain within most polyoma viruses makes direct contacts with the
ATPase domain of Hsp70 (20, 88, 122, 161, 166, 197). It has been established through
previous studies that the J-domain within SV40 T-Antigen is critical to SV40 DNA
replication (20). T-Antigen mutations that affect the J-domain prevent the T-Antigen
transactivation of E2F responsive promoters and their subsequent induction in the
progression of the cell cycle (177, 180, 222). These same J-domain mutations were

Fig. 16. Sequence Diagram of Rep Mutagenesis Results. See text for descriptions.

90
Rep 78/52 Functional Map
REP78
helix 1
j-domain I helix 2
1 |mpgfyeivik vpsdldehlp gisdsfvnwv aekewe 1|PP&) sfflnQlnlieg
¡ijiij jijij ;t: molil 2
51 dpltvaeklq rdfltewrrv1 skap'éálffv gfekgesyfb mhvllvettqv
i'ij-
'r*\
glycine
101 ksmvlgrfls qirei< liqri yrgieptlpn wfavtktrng a
j=-i -■»- Rep/PC4
r
¡ ^ ! helix 3
vvde
coil
151 ^cyipnyjllpk
no AAV5 homology
nmeqylsacl nlterkrlva qhlthvsqtq^
REPJ* :'t J <—
201 legnkenqnpn sdppvirstct sarwnéXvgw lvdkgitsek qWiqedqasy
:x; Rep/cap ¿
. • _ _ j i _ _ j
251 isfnaasnsr sqikaaldna gkimsltkta pdylvgqqpv edissnriyk
^ ' • p-ioop ] i
301 ilelngydpq yaasvflgwa 'tkkfgkrnti wlfg^attgfe tfria.aeai.aht Q,
p i_
D| I topo domain 1 GG box
351 ^vpfygcvnwt nenfpfndcv dkmviwwg0g (jkfrntakv|vesa -kail ggjskvr
C I ; >Jr ; Mg+2 TPGR box C DEAD box I I
401 vdq®ckssaq idp|tpvivt|s ntnmca|vi dg] n sttfehqqp 1 m f®fel
ii • j, l_
n.Y.r
111,1V
451 trrl@h@fgk vt0q0v00ff rwa0^i vv ©v 0#Tyvkkgg akkrpapsda
Nu Lo -M—
it t
REP68
501 disepkrvre svaqpstsdal easinyadry qnkcsrhvgm nlmlfpcrqc
Rep/Cap I
551 ermnqnsnic fthgqkdcle cfpvsesqpv svvkkayqkl cyihhimgkv
601 pdactacdlv nvdlddcife q (larghsl)
TR Binding
trs Nicking
wild type
Helicase
ATPase
Cjlep/ Reg) Interaction
HSV6rep / Hox Homologies
(^Rep/Cap^)
¡ Transactivation j •
Integration

91
deficient in their capability to bind to Hsp70. The J-domain on SV40 T-Antigen has been
identified as a necessary requirement for nuclear localization (216). Direct interaction of
the T-Antigen J-domain with Hsp70, results in complementation of a SV40 T-Antigen
mutant containing a nuclear translocation and cellular transformation mutation (81).
Although the nuclear localization domain of Rep has been localized to amino acids 483 to
519, this J-domain may explain many of the roles for Rep in DNA replication and
modification of the cell cycle (99, 186, 198, 199, 206, 207). In SV40, this region has
been shown to function as a molecular chaperone mediating phosphorylation of the T-
Antigen associated proteins pi07 and pi30 (180). This same protein domain in Rep may
explain its role in interference with viral replication and oncogenicity in SV40,
papilloma, and herpesviruses (65, 90, 100, 217, 218). The most likely explanation of the
ability of Rep to inhibit cellular transformation after SV40 coinfection could be through a
domain negative phenotype. The ability of T-Antigen to promote oncogenesis depends
on two factors, the J-domain and the pRB-binding motif (147). The presence of another
J-domain containing protein, Rep78, would act as a domain negative protein during an
AAV and SV40 coinfection. The Rep78 protein could possibly interact with pi07 and
pi 30 but would be unable to fully overcome the G1 arrest or E2F-repression of the cell
cycle promoters as a result of its inability to bind pRB. However, in regards to the
D40A,D42A,D44A replication mutant, this targeted mutation may disrupt both DNA
binding and direct assembly of replication complexes on the AAV terminal repeats. We
have demonstrated that the mutation directly inhibits DNA binding and as a result
prevents trs endonuclease activity. In addition to its defect in DNA binding, this Rep ts
mutant may be defective in its ability to recruit active replication complexes due to this J-

92
domain mutation. It has suggested that T-Antigen uses its J-domain to support SV40
DNA replication in a manner that is strikingly similar to the use of Escherichia coli DnaJ
by bacteriophage lambda in DNA replication (20). In addition to the polyoma virus
family, the HPV replication initiator, El helicase, has enhanced binding to the origin of
replication by the direct interactions of hsp70 proteins (112). This data suggests a strong
role for chaperones in viral DNA replication through contacts in a functional J-domain.
As result, the inability of this mutant Rep78 to bind the synthetic AAV terminal repeats
may be a function of their reduced affinity for the chaperone proteins, Hsp70. Without a
possible Hsp70 interaction through the J-domain, the Rep protein complexes may not be
correctly assembled for DNA binding and trs endonuclease activity.
The second mutant E345A, E349A affects a possible HMG box in the Rep protein
sequence. Between amino acids 340 to 350 of Rep78, protein sequence alignment has
identified a possible HMG box that may have multiple roles in the enzymatic activities
and biological roles of Rep throughout the AAV lifecycle. Previous research
demonstrated that most of the activities associated with the Rep protein are enhanced
with the presence and co-expression of the HMG-1 protein (36). This study discovered
that the presence of HMG-1 stimulated Rep-mediated trs endonuclease cleavage, ATPase
activity, DNA binding, and p5 transcriptional repression. Since the activities of Rep were
assayed both in vivo and in vitro, the HMG-1 and Rep protein HMG box may have very
similar functional roles in which they recognize the cruciform structures of AAV terminal
repeat and form stable nucleoprotein structures. HMG-1 has a general DNA binding
activity but an extremely high affinity for cruciform structures and bends in DNA. The
sole function of HMG-1 enhancement may be to recognize these odd DNA fragments

93
within the cell and recruit Rep proteins to form multimeric protein complexes on Rep
binding elements. This Rep recruitment would affect every type of RBE within the AAV
genome and influence both the latent and lytic lifecycle. The transient transfection of
HMG-1 in the presence of a p5 promoter assay was shown to have a stronger level of p5
repression but only in the presence of the Rep protein (36). This data indicates that the
assembly of the Rep protein complexes may be more stable in the presence of HMG-1 or
may be recruited by HMG-1 bound to the AAV genome.
It was suggested that HMG-1 and HMG-2 interact with transcription factors that
contain HMG boxes to stimulate DNA binding and form a DNA bend (184).
Transcriptional regulators that contain HMG boxes such as the AAV Rep protein may
recruit the HMG-1 protein through protein-protein interactions thereby increasing the
affinity of transcription factors to their DNA binding sequence. This increase in
transcription factor binding affinity would be dependent on the induction of DNA
bending by HMG-1. After the stabilization of transcription factor binding, the DNA bend
could recruit a second unrelated transcription factor to another site within the DNA
sequence (184). In the case of the E345A,E349A Rep mutant, modification of the HMG
box may prevent any possible Rep and HMG-1 protein interaction either in the AAV
terminal repeat or the p5RBE. Without the HMG-1 protein to alter the structure of DNA
and allow Rep to correctly bind the RBE, a number of biological activities would fail to
occur. First, the mutant would have a much lower level of p5 promoter repression as we
have shown by transient transfection (Fig. 14, E345A,E349A). The lower level of Rep
protein binding would affect both replication and transcription. The defect in pi9
transactivation could be the result of failure to produce the proper DNA loop between the

94
p5 and pl9 promoters. If HMG-1 stimulates the Rep protein to tightly bind its RBE,
mutation of the HMG box in the Rep protein sequence may prevent a possible p 19
transactivation complex. We believe previous studies demonstrating the stable
interaction between Spl and Rep on AAV support this model (145). However, in vivo
conditions may require that the DNA loop created between the p5 and pi9 promoter for
pi 9 transactivation be stabilized through the activities of the HMG-1 proteins. This
E345A,E349A Rep mutant would support this model because it maintains helicase
activities but it is unable to repress or transactivate the AAV promoters (Fig. 13 and 14).
Remarkably, the in vitro binding assays between Rep and HMG-1 have indicated that a
possible interaction domain between these two protein lies around the proposed Rep
HMG box sequence (36).
The next mutant in our charge-to-alanine scanning mutagenesis was the E371 A,
E372A Rep protein. Although this region of the Rep protein does not contain any known
protein motifs, it is in a close proximity to a Rep-Rep interaction domain and the
previously discussed HMG box. This mutation caused a replication negative phenotype
but did not result in a conditional lethal virus. The E371 A, E372A mutant was capable of
both DNA binding and helicase activities. However, two very important biological
activities were found to be greatly reduced. First, the protein was extremely deficient in
its ability to express the Rep 52 and 40 proteins. As further proof for this disruption of
the pi9 promoter, the pIM45CAT3 reporter construct was unable to transactivate this
promoter at a level significantly higher than with Adenovirus alone (Fig. 13). The most
interesting effect was the complete lack of transcriptional repression on the p5 promoter.
The E371 A,E372A mutant was 7-fold higher in its level of p5 promoter expression

95
compared to the wt level of p5 activity. Interestingly, all of the replication defective
mutants had p5 promoter expression that was 3-fold higher than wild type. Although the
highest levels of defective p5 promoter repression were focused around the
E371 A,E372A mutant and the potential HMG box at E345A, E349A (Fig. 13,
E345A,E349A and E371A,E372A), other important areas in the Rep protein sequence
that targeted specific p5 repression activity colocalized with motifs based on AAV Rep
and Rolling Circle Replication (RCR) proteins (Fig. 16). Motif 1 from Rep amino acids
10 to 14 corresponds to the K10A,D14A mutant and motif 2 corresponds with amino
acids 90 to 94 similar to the H90A,H92A mutant. Both of these mutations are unable to
replicate viral DNA, transactivate the pi9 promoter, or repress p5. This combination of
mutants would indicate a defect in the assembly of Rep protein complexes similar to the
other RCR proteins. The assembly mutants could be unable to tightly bind DNA, have a
reduced interaction with possible chaperone activities of HMG-1, or lose the ability to
recruit replication machinery to the AAV terminal repeat.
Due to the difficulty in producing large amounts of pure Rep78 for protein
crystalization, we are limited in our dissection of the enzymatic activities to protein
sequence alignment with other unrelated viral proteins. Based on limited homology with
SV40 T-Antigen, previous mutagenesis studies have created ATPase mutants in the Rep
protein. However, the elimination of the ATPase function of Rep created a wide variety
of lost biochemical activities within the Rep78 protein. The ATPase mutants in those
studies also lost DNA helicase activity, the trs endonuclease cleavage at the terminal
repeat, and all transactivation from the p 19 and p40 promoters (124). Based on
homology to those SV40 T-Antigen ATPase mutations, all of the enzymatic activities of

96
Rep appeared to be dependent on a functional ATPase activity. A new strategy called
charge-to-alanine mutagenesis was indiscriminant to helicase homology and targeted
only charged amino acid clusters within Rep78 in the hope of creating conditional lethal
mutations. Previous work was able to identify an unknown Mg2+ binding site whose
mutation resulted in a lack of endonuclease cleavage at the terminal repeat but was
completely wild type in other aspects for Rep78 activity. This work has continued to
characterize several potential new protein domains within the Rep78 protein. A single
HMG box was localized to a specific domain without the loss of any helicase activity and
it may have a direct effect in stablizing the DNA loop between the p5 and pl9 promoters.
Another Rep mutant suggested the role of a J-domain in a temperature sensitive mutant
that could influence the ability of the Rep protein in binding to the terminal repeat, trs
endonuclease activity, and the recruitment of DNA replication factors at the terminal
repeat. However, until the crystalization of Rep78 is performed further localization and
biochemical characterization of Rep protein domains will be dependent on continued
mutagenesis of the entire protein sequence.
Future Directions
During various cellular conditions, there are a large number of different protein
complexes bound to the p5 promoter. One of most important and least examined
questions in AAV biology is the actual organization of proteins within the p5
transcriptional complex. One experimental protocol to define the factors bound to this
sequence of DNA would be to isolate and purify the p5 promoter. After purification, the
p5 promoter element could be incubated in a cellular extract for one of four cellular
conditions. The first condition would be a mock extract containing neither an

97
Adenovirus or Adeno-Associated Virus infection. The second and third conditions would
be an single viral infection extract of Ad or AAV, respectively. The last cellular extract
would be a combined infection of both Adenovirus and AAV.
With these four types of cellular extract, the p5 DNA sequence could be incubated
with them to allow DNA-protein complexes to form on the p5 promoter. After a
sufficient time for incubation, the protein complexes formed on the DNA would be fixed
by the addition of a reversible cross-linking agent. The DNA sequence could be
precipitated after the cross-linking event to isolate the protein complexes. By reversing
the mechanism of cross-linking, the DNA-protein complexes could be disassembled and
the proteins within this protein complex could be analyzed by various methods. One
method of analysis could be a simple Western blot for antibodies of suspected proteins in
these complexes. Other methods of analysis could be a 2-D gel electrophoresis or Mass
Spectroscopy to gain possible protein sequence information on the proteins precipitated
with the p5 promoter DNA.
Another process of p5 promoter transcription complex isolation could be the use
of DNA labeled with biomagnetic beads. The purification of the p5 promoter could
occur through restriction enzyme digestion. The ends of the restriction enzyme site could
be filled by Klenow to incorporate biotinylated labeled dNTPs into the p5 promoter
sequence. The biotinylated p5 promoter could be incubated with streptavidin-conjugated
Dynabeads. Through the use of a magnet, the labeled p5 promoter could be precipitated,
washed, and released from bound DNA-protein complexes after incubation with Ad or
AAV infected cells. This biotinylated DNA approach would allow great variety in
protein purification by the use of many salt wash conditions. The washed protein

98
complexes could be purified and analyzed for protein sequence information without
reversible cross-linking procedures.
Another protocol for isolating the protein complexes formed on the p5 promoter is
the use of DNA affinity column chromatography. The cross-linking of a large number of
p5 promoter oligonucleotides to column matrix would enable the formation and
purification of proteins bound to the DNA sequence. The four different cellular extracts
would be poured over the p5 promoter column and washed with various buffer solutions.
The isolation of protein complexes could proceed a number of different ways. One, a
reversible cross-linking agent could fix the complexes and later release them after many
successive column washings. Second, the washed protein complexes could be
fractionated by step or gradient elutions with various salt solutions. Either of these
purification protocols would isolate proteins to be sequenced or identified by Western
immunoblot procedures.
These three protocols of p5 promoter protein complexes could be analyzed in a
number of different ways. First, the structure and composition of these protein
complexes could be compared in the four cellular conditions. The composition of these
complexes could differ greatly during an Adenovirus infection, Rep protein expression or
the combination of both situations. The El A, E4orf6/7, or any other Adenovirus gene
product could influence the structure of these complexes. The stringency of the salt
elution or the concentration of cross-linking reagent could determine the overall order of
protein binding on the p5 promoter. Second, another interesting assay would be the
comparison between the psub262 and p5 promoter. This differential of the two
promoters could define the role of Rep in forming various protein complexes as well as

99
the role of steric interference in p5 transcription factor binding. In combination with the
four different cellular extracts, the p5 and psub262 promoters could exhibit and
characterize a large number of protein complexes. The analysis of the differential
between the mutant sub262 promoter and the wild type p5 promoter in every cellular
condition should demonstrate the order of addition in the assembly of transcriptional
complexes on the active p5 promoter.
Conclusions
The regulation of gene expression for the Adeno-Associated Virus is one of the
most complex and compact transcriptional mechanisms in molecular biology. The entire
AAV genome is only 4.5kb in size and contains only three promoter elements. In
addition to this relatively minor genome, the lifecycle of AAV can alternate between a
latent, repressed proviral state and an actively lytic infection. The regulation for this
wide range of transcriptional state is controlled by only one single open reading frame in
the AAV genome. The nonstructural proteins of AAV manage every aspect of its
lifecycle as well as influence the infected cell environment. These proteins process the
cellular stasis of the infected host and decide a wide range of viral responses. If the host
cell is healthy, the AAV genome will be directed to site-specifically integrate and repress
all viral transcription. If the host cell is coinfected or superinfected with Adenovirus, the
AAV genome will respond to the Ad proteins, rapidly replicate its viral DNA, and escape
the host cell when the Adenovirus lyzes the host cell. All of these aspects of the AAV
lifecycle are processed and directly controlled by the one nonstructural protein, Rep.
The major rate controlled step in the AAV lifecycle is the transcriptional
regulation of the p5 promoter. This promoter expresses the largest Rep protein and

100
determines the rate of Rep and Capsid protein expression. Without Adenovirus, the p5
promoter produces a very minute amount of Rep, which represses the expression of the
p5 promoter. However, an Adenovirus infection will induce a large number of changes
in p5 transcription. The Early Ad protein, El A, directly binds to the YY1 repressors on
the p5 promoter converting them into activators of Rep expression. The combination of
large Rep expression and p5 promoter activation induces the other two promoters of
AAV to express their gene products.
The most fascinating AAV promoter is the pl9 promoter. The pi9 promoter
expresses the Rep52 and Rep40 proteins that regulate the expression of the p5 promoter.
During Ad infection, the large Rep proteins are expressed from the p5 promoter and
inhibit their own expression. In addition to feedback inhibition of the p5 promoter, the
large Rep proteins bind the same inhibitory location on the p5 inducing expression from
the pi9 promoter. The pl9 promoter will produce the Rep52 protein which depresses the
p5 promoter by directly interacting with the large Rep proteins on the p5 promoter. This
regulation and interplay with the p5 and pi9 gene products allows the constant
expression of large and small Rep proteins. These Rep protein concentrations permit a
number of conditions in the lytic phase of AAV. First, the large Rep protein is expressed
enough to nick and initiate the replicating pool of AAV genomes. Second, the Rep52
protein concentration is high enough to depress the p5 promoter but low enough to
prevent packaging of the entire AAV genome replication pool. Third, the p40 promoter
producing Capsid protein is always expressed at excess. The maintenance of this
complex transcriptional regulation is controlled by the p5 and pi9 promoters.

101
In previous work, it was shown that Adenovirus always induced high levels of p5
expression. In contrast, the large Rep proteins seemed to exclusively repress the p5
promoter. This data appears opposite to the requirement of Rep for AAV gene
expression. This question was addressed in a series of assays to determine if Rep
functioned as an enhancer or proximal promoter element.
The Rep binding element was moved to various locations next to the pi9
promoter. In the correct genomic location, the p5RBE did not transactivate the pl9
promoter. The series of pl9CAT3 constructs indicated that as the p5RBE was placed
closer to the transcriptional start site, it caused a much higher level of transcriptional
repression. These constructs would support the conclusion that the Rep protein does not
have any transcriptional activation domain but instead functions exclusively as a
transcriptional repressor.
The lack of any transcriptional activation supported the hypothesis that the Rep
protein does not exclusively or directly activate transcription. It may function to connect
or join two proteins which directly recruit the RNA polymerase II holoenzyme at the p 19
promoter. Since the Rep is bound to the p5RBE site in the latent proviral state, the other
p5 transcription factors may induce the p 19 promoter during an Adenovirus infection.
This hypothesis was tested by the subcloning of the p5 promoter elements into the correct
spacing in the synthetic pl9CAT3 plasmid. With Ad and Rep gene expression, these
constructs fail to induce the correct transcriptional regulation. At this point of pi 9
promoter analysis, it was believed the synthetic nature of the pl9CAT3 promoter may
lack the correct transcription factor for gene expression. As a result, the CAT reporter
gene was subcloned into the AAV genomic subclone plasmid, pIM45.

102
This pIM45CAT3 plasmid expressed the correct transcriptional regulation with
Ad and Rep gene expression. This result implies the sequence of the synthetic pl9
promoters cannot exhibit correct pl9 gene expression or their Rep-Spl interaction is
incorrect. The Rep and Spl proteins were replaced in the pIM45CAT3 plasmid and
replaced with GAL4 hybrid transcription factors. Without any Rep or Spl protein
sequences, it was shown these two proteins have no direct influence on transcriptional
activation of the pi 9 promoter. The genomic organization of the p5 and pl9 promoters
form a stable DNA loop through the protein interaction of Rep-SPl or GAL4 Hybrid
transcription factors. This stable DNA loop allows the protein complexes on the Ad-
induced p5 promoter to contact and stimulate the formation of a RNA polymerase II
holoenzyme at the pi9 promoter.
This observation of the p5 promoter transcription factors stimulating the pi 9 and
p40 promoters supports the strong role of p5 induction by the Adenovirus El A proteins.
The mutagenesis of the p5 transcription factors in the GAL4 hybrid reporter plasmid
showed several unique facts. First, the mutation of the MLTF site did not affect the Ad
and Rep induced transactivation of the p 19 promoter. Second, the mutagenesis of both
YY1 -60bp and YY1+1 caused the loss of this Ad and Rep induced transactivation.
Third, the mutation of the YY1 -60bp induced an extremely high basal transcriptional
activity for the p5 promoter. All of these results support the hypothesis that the El A
proteins bound to the two YY1 proteins at the p5 promoter perform the direct
transactivation of the pi 9 promoter.
This series of conclusions has a very profound effect on understanding the basic
biology of the Adeno-Associated Virus. First, the nonstructural protein, Rep, exhibits no

103
transcriptional transactivation activity or domains for the AAV promoters. With or
without Ad infection, the large Rep proteins inhibit the transcriptional activity of the p5
promoter. In the context of the pi 9 promoter, the Rep protein does not transactivate the
promoter and will inhibit transcriptional activity when its binding site moved closer to the
transcriptional start site. Second, separation of the p5 and pi 9 promoters by a PolyA
Signal influences both a synthetic pi9 promoter and the genomic pIM45 backbone. For
the genomic plasmids, it strongly decreases the degree of all transcriptional activation.
This observation would support the idea that the presence of a terminating RNA
polymerase II holoenzyme would inhibit the stable DNA loop formed between Rep and
Spl. The synthetic pi 9 promoters had a very different result because the lack of a Rep
binding element induced the strongest level of Ad and Rep induced transactivation. This
effect could be the result of different DNA sequences or the disruption of proper wild
type protein-protein interactions. Third, the Rep and Spl proteins exhibit no requirement
on Ad and Rep induced p 19 transactivation. The sole function of these two proteins is to
bind DNA sequences at the p5 and pi9 promoters and form a stable DNA loop structure.
Any other protein complex which performs this same function can replace the role of Rep
and Spl in AAV transcription. The substitution of GAL4 hybrid transcription factors for
Rep and Spl proteins supports the hypothesis that the Rep and Spl proteins act as
architectural proteins in the regulation of AAV gene expression.

APPENDIX
TABLE OF ABBREVIATIONS
AAV
Adeno-Associated Virus
ATP
Adenosine Triphosphate
Ad
Adenovirus
ATPase
Adenosine Triphosphatase
Bp
Base Pair
CAT
chloramphenicol acetyl transferase
CTD
carboxy-terminal domain
DNA
Deoxyribonucleic Acid
Hsp90
Heat Shock Protein 90
HAT
Histone Acetyltransferase
HDAC
Histone Deacetylase
Inr
Initiator
LCR
Locus Control Region
MVM
Minute Virus of Mice
N-terminus
Amino Terminus
RNA
Ribonucleic Acid
RBE
Rep binding element
TBP
TATA binding protein
YY1
Ying Yang Protein 1
UAS
Upstream Activating Sequence
URS
Upstream Repressing Sequence
104

LIST OF REFERENCES
1. Allison, L. A., J. K. Wong, V. D. Fitzpatrick, M. Moyle, and C. J. Ingles 1988.
The C-terminal domain of the largest subunit of RNA polymerase II of
Saccharomyces cerevisiae, Drosophila melanogaster, and mammals: a conserved
structure with an essential function Mol Cell Biol. 8:321-9.
2. Auble, D. T., D. Wang, K. W. Post, and S. Hahn 1997. Molecular analysis of
the SNF2/SWI2 protein family member MOT1, an ATP- driven enzyme that
dissociates TATA-binding protein from DNA Mol Cell Biol. 17:4842-51.
3. Barberis, A., and L. Gaudreau 1998. Recruitment of the RNA polymerase II
holoenzyme and its implications in gene regulation Biol Chem. 379:1397-405.
4. Barberis, A., C. W. Muller, S. C. Harrison, and M. Ptashne 1993. Delineation
of two functional regions of transcription factor TFIIB Proc Natl Acad Sci USA.
90:5628-32.
5. Barberis, A., J. Pearlberg, N. Simkovich, S. Farrell, P. Reinagel, C. Bamdad,
G. Sigal, and M. Ptashne 1995. Contact with a component of the polymerase II
holoenzyme suffices for gene activation Cell. 81:359-68.
6. Bartolomei, M. S., N. F. Halden, C. R. Cullen, and J. L. Corden 1988. Genetic
analysis of the repetitive carboxyl-terminal domain of the largest subunit of
mouse RNA polymerase II Mol Cell Biol. 8:330-9.
7. Batchu, R. B., and P. L. Hermonat 1995. The trans-inhibitory Rep78 protein of
adeno-associated virus binds to TAR region DNA of the human
immunodeficiency virus type 1 long terminal repeat FEBS Lett. 367:267-271.
8. Batchu, R. B., R. M. Kotin, and P. L. Hermonat 1994. The regulatory rep
protein of adeno-associated virus binds to sequences within the c-H-ras promoter
Cancer Lett. 86:23-31.
9. Beaton, A., P. Palumbo, and K. I. Berns 1989. Expression from the adeno-
associated virus p5 and pi9 promoters is negatively regulated in trans by the rep
protein J. Virol. 63:4450-4454.
10. Bell, A., J. Boyes, J. Chung, M. Pikaart, M. N. Prioleau, F. Recillas, N.
Saitoh, and G. Felsenfeld 1998. The establishment of active chromatin domains
Cold Spring Harb Symp Quant Biol. 63:509-14.
105

106
11. Bell, A. C., and G. Felsenfeld 1999. Stopped at the border: boundaries and
insulators Curr Opin Genet Dev. 9:191-8.
12. Berroteran, R. W., D. E. Ware, and M. Hampsey 1994. The sua8 suppressors
of Saccharomyces cerevisiae encode replacements of conserved residues within
the largest subunit of RNA polymerase II and affect transcription start site
selection similarly to sua7 (TFIIB) mutations Mol Cell Biol. 14:226-37.
13. Blacklow, N. R., M. D. Hoggan, and W. P. Rowe 1968. Serologic evidence for
human infection with adenovirus-associated viruses J Natl Cancer Inst. 40:319-
27.
14. Blacklow, N. R., M. D. Hoggan, M. S. Sereno, C. D. Brandt, H. W. Kim, R. H.
Parrott, and R. M. Chanock 1971. A seroepidemiologic study of adenovirus-
associated virus infection in infants and children Am. J. Epidemiol. 94:359-366.
15. Blackwood, E. M., and J. T. Kadonaga 1998. Going the distance: a current view
of enhancer action Science. 281:61-3.
16. Brownell, J. E., J. Zhou, T. Ranalli, R. Kobayashi, D. G. Edmondson, S. Y.
Roth, and C. D. Allis 1996. Tetrahymena histone acetyltransferase A: a homolog
to yeast Gcn5p linking histone acetylation to gene activation Cell. 84:843-51.
17. Buratowski, S., and H. Zhou 1993. Functional domains of transcription factor
TFIIB Proc Natl Acad Sci USA. 90:5633-7.
18. Burley, S. K., and R. G. Roeder 1996. Biochemistry and structural biology of
transcription factor IID (TFIID) Annu Rev Biochem. 65:769-99.
19. Bushnell, D. A., C. Bamdad, and R. D. Kornberg 1996. A minimal set of RNA
polymerase II transcription protein interactions J Biol Chem. 271:20170-4.
20. Campbell, K. S., K. P. Mullane, I. A. Aksoy, H. Stubdal, J. Zalvide, J. M.
Pipas, P. A. Silver, T. M. Roberts, B. S. Schaffhausen, and J. A. DeCaprio
1997. DnaJ/hsp40 chaperone domain of SV40 large T antigen promotes efficient
viral DNA replication Genes Dev. 11:1098-110.
21. Cathomen, T., D. Collete, and M. D. Weitzman 2000. A chimeric protein
containing the N terminus of the adeno-associated virus Rep protein recognizes its
target site in an in vivo assay J Virol. 74:2372-82.
22. Cathomen, T., T. H. Stracker, L. B. Gilbert, and M. D. Weitzman 2001. A
genetic screen identifies a cellular regulator of adeno-associated virus Proc Natl
Acad Sci US A. 98:14991-6.

107
23. Chang, L. S., and T. Shenk 1990. The adenovirus DNA-binding protein
stimulates the rate of transcription directed by adenovirus and adeno-associated
virus promoters J. Virol. 64:2103-2109.
24. Chang, L. S., Y. Shi, and T. Shenk 1989. Adeno-associated virus P5 promoter
contains an adenovirus El A-inducible element and a binding site for the major
late transcription factor J. Virol. 63:3479-3488.
25. Chasman, D. I., K. M. Flaherty, P. A. Sharp, and R. D. Kornberg 1993.
Crystal structure of yeast TATA-binding protein and model for interaction with
DNA Proc Natl Acad Sci USA. 90:8174-8.
26. Chatterjee, S., and K. Struhl 1995. Connecting a promoter-bound protein to
TBP bypasses the need for a transcriptional activation domain Nature. 374:820-2.
27. Chejanovsky, N., and B. J. Carter 1989. Mutagenesis of an AUG codon in the
adeno-associated virus rep gene: effects on viral DNA replication Virology.
173:120-128.
28. Cheung, A. K., M. D. Hoggan, W. W. Hauswirth, and K. 1. Berns 1980.
Integration of the adeno-associated virus genome into cellular DNA in latently
infected human Detroit 6 cells J. Virol. 33:739-748.
29. Chiorini, J. A., B. Zimmermann, L. Yang, R. H. Smith, A. Ahearn, F.
Herberg, and R. M. Kotin 1998. Inhibition of PrKX, a novel protein kinase, and
the cyclic AMP- dependent protein kinase PKA by the regulatory proteins of
adeno- associated virus type 2 Mol Cell Biol. 18:5921-9.
30. Cho, E. J., T. Takagi, C. R. Moore, and S. Buratowski 1997. mRNA capping
enzyme is recruited to the transcription complex by phosphorylation of the RNA
polymerase II carboxy-terminal domain Genes Dev. 11:3319-26.
31. Clark, K. R., D. M. Voulgaropoulou, D. M. Fraley, and P. R. Johnson 1995.
Cell lines for the production of recombinant adeno-associated virus. Human. Gene
Ther. 6:1329-1341.
32. Coin, F., and J. M. Egly 1998. Ten years of TFIIH Cold Spring Harb Symp
Quant Biol. 63:105-10.
33. Conaway, J. W., A. Dvir, R. J. Moreland, Q. Yan, B. J. Elmendorf, S. Tan,
and R. C. Conaway 1998. Mechanism of promoter escape by RNA polymerase
II Cold Spring Harb Symp Quant Biol. 63:357-64.
34. Conaway, R. C., and J. W. Conaway 1997. General transcription factors for
RNA polymerase II Prog Nucleic Acid Res Mol Biol. 56:327-46.

108
35. Corden, J. L. 1990. Tails of RNA polymerase II Trends Biochem Sci. 15:383-7.
36. Costello, E., P. Saudan, E. Winocour, L. Pizer, and P. Beard 1997. High
mobility group chromosomal protein 1 binds to the adeno-associated virus
replication protein (Rep) and promotes Rep-mediated site-specific cleavage of
DNA, ATPase activity and transcriptional repression Embo J. 16:5943-54.
37. Dahmus, M. E. 1996. Reversible phosphorylation of the C-terminal domain of
RNA polymerase II J Biol Chem. 271:19009-12.
38. Davis, M. D., R. S. Wonderling, S. L. Walker, and R. A. Owens 1999.
Analysis of the effects of charge cluster mutations in adeno-associated virus
Rep68 protein in vitro J Virol. 73:2084-93.
39. Davis, M. D., J. Wu, and R. A. Owens 2000. Mutational analysis of adeno-
associated virus type 2 rep68 protein endonuclease activity on partially single-
stranded substrates [In Process Citation] J Virol. 74:2936-42.
40. Di Pasquale, G., and S. N. Stacey 1998. Adeno-associated virus Rep78 protein
interacts with protein kinase A and its homolog PRKX and inhibits CREB-
dependent transcriptional activation J Virol. 72:7916-25.
41. Dubielzig, R., J. A. King, S. Weger, A. Kern, and J. A. Kleinschmidt 1999.
Adeno-associated virus type 2 protein interactions: formation of pre-
encapsidation complexes J Virol. 73:8989-98.
42. Dvir, A., R. C. Conaway, and J. W. Conaway 1997. A role for TFIIH in
controlling the activity of early RNA polymerase II elongation complexes Proc
Natl Acad Sci USA. 94:9006-10.
43. Eckner, R. 1996. p300 and CBP as transcriptional regulators and targets of
oncogenic events Biol Chem. 377:685-8.
44. Engel, J. D., and K. Tanimoto 2000. Looping, linking, and chromatin activity:
new insights into beta-globin locus regulation Cell. 100:499-502.
45. Falck-Pedersen, E., J. Logan, T. Shenk, and J. E. Darnell, Jr. 1985.
Transcription termination within the El A gene of adenovirus induced by insertion
of the mouse beta-major globin terminator element Cell. 40:897-905.
46. Feaver, W. J., O. Gileadi, Y. Li, and R. D. Kornberg 1991. CTD kinase
associated with yeast RNA polymerase II initiation factor b Cell. 67:1223-30.
47. Fields, S., and S. K. Jang 1990. Presence of a potent transcription activating
sequence in the p53 protein Science. 249:1046-9.

109
48. Flotte, T. R., X. Barraza Ortiz, R. Solow, S. A. Afione, B. J. Carter, and W.
B. Guggino 1995. An improved system for packaging recombinant adeno-
associated virus vectors capable of in vivo transduction Gene Ther. 2:29-37.
49. Fraser, P., and F. Grosveld 1998. Locus control regions, chromatin activation
and transcription Curr Opin Cell Biol. 10:361-5.
50. Gavin, D. K., S. M. Young, Jr., W. Xiao, B. Temple, C. R. Abernathy, D. J.
Pereira, N. Muzyczka, and R. J. Samulski 1999. Charge-to-alanine mutagenesis
of the adeno-associated virus type 2 Rep78/68 proteins yields temperature-
sensitive and magnesium-dependent variants [published erratum appears in J
Virol 2000 Jan;74(l):591] J Virol. 73:9433-45.
51. Geng, Y., and L. F. Johnson 1993. Lack of an initiator element is responsible for
multiple transcriptional initiation sites of the TATA-less mouse thymidylate
synthase promoter Mol Cell Biol. 13:4894-903.
52. Giordano, A., and M. L. Avantaggiati 1999. p300 and CBP: partners for life
and death J Cell Physiol. 181:218-30.
53. Goppelt, A., G. Stelzer, F. Lottspeich, and M. Meisterernst 1996. A
mechanism for repression of class II gene transcription through specific binding
of NC2 to TBP-promoter complexes via heterodimeric histone fold domains
Embo J. 15:3105-16.
54. Gralla, J. D. 1996. Global steps during initiation by RNA polymerase II Methods
Enzymol. 273:99-110.
55. Grosveld, F. 1999. Activation by locus control regions? Curr Opin Genet Dev.
9:152-7.
56. Grunstein, M. 1997. Histone acetylation in chromatin structure and transcription
Nature. 389:349-52.
57. Guzman, E., and J. T. Lis 1999. Transcription factor TFIIH is required for
promoter melting in vivo Mol Cell Biol. 19:5652-8.
58. Hahn, S., S. Buratovvski, P. A. Sharp, and L. Guarente 1989. Yeast TATA-
binding protein TFIID binds to TATA elements with both consensus and
nonconsensus DNA sequences Proc Natl Acad Sci USA. 86:5718-22.
59. Hampsey, M. 1998. Molecular genetics of the RNA polymerase II general
transcriptional machinery Microbiol Mol Biol Rev. 62:465-503.
60. Han, M., and M. Grunstein 1988. Nucleosome loss activates yeast downstream
promoters in vivo Cell. 55:1137-45.

110
61. Han, M., U. J. Kim, P. Kayne, and M. Grunstein 1988. Depletion of histone
H4 and nucleosomes activates the PH05 gene in Saccharomyces cerevisiae Embo
J. 7:2221-8.
62. Hartl, F. U. 1996. Molecular chaperones in cellular protein folding Nature.
381:571-9.
63. Hebbes, T. R., A. W. Thorne, and C. Crane-Robinson 1988. A direct link
between core histone acetylation and transcriptionally active chromatin Embo J.
7:1395-402.
64. Hermonat, P. L. 1994. Down-regulation of the human c-fos and c-myc proto¬
oncogene promoters by adeno-associated virus Rep78 Cancer Lett. 81:129-136.
65. Hermonat, P. L. 1992. Inhibition of bovine papillomavirus plasmid DNA
replication by adeno-associated virus Virology. 189:329-333.
66. Hermonat, P. L. 1991. Inhibition of H-ras expression by the adeno-associated
virus Rep78 transformation suppressor gene product Cancer Res. 51:3373-3377.
67. Hermonat, P. L., M. A. Labow, R. Wright, K. I. Berns, and N. Muzyczka
1984. Genetics of adeno-associated virus: isolation and preliminary
characterization of adeno-associated virus type 2 mutants J. Virol. 51:329-339.
68. Hermonat, P. L., A. D. Santin, and R. B. Batchu 1996. The adeno-associated
virus Rep78 major regulatory/transformation suppressor protein binds cellular
Spl in vitro and evidence of a biological effect Cancer Res. 56:5299-304.
69. Hermonat, P. L., A. D. Santin, R. B. Batchu, and D. Zhan 1998. The adeno-
associated virus Rep78 major regulatory protein binds the cellular TATA-binding
protein in vitro and in vivo Virology. 245:120-7.
70. Hoerer, M., C. Bogedain, U. Scheer, C. Heberger, S. Steyrer, A. Burger, and
G. Maass 1997. The use of recombinant adeno-associated viral vectors for the
transduction of epithelial tumor cells Int J Immunopharmacol. 19:473-9.
71. Holstege, F. C., U. Fiedler, and H. T. Timmers 1997. Three transitions in the
RNA polymerase II transcription complex during initiation Embo J. 16:7468-80.
72. Holstege, F. C., D. Tantin, M. Carey, P. C. van der Vliet, and H. T. Timmers
1995. The requirement for the basal transcription factor IIE is determined by the
helical stability of promoter DNA Embo J. 14:810-9.
73. Holstege, F. C., P. C. van der Vliet, and H. T. Timmers 1996. Opening of an
RNA polymerase II promoter occurs in two distinct steps and requires the basal
transcription factors IIE and IIH Embo J. 15:1666-77.

Ill
74. Horer, ML, S. Weger, K. Butz, F. Hoppe Seyler, C. Geisen, and J. A.
Kleinschmidt 1995. Mutational analysis of adeno-associated virus Rep protein-
mediated inhibition of heterologous and homologous promoters J. Virol. 69:5485-
5496.
75. Im, D. S., and N. Muzyczka 1990. The AAV origin binding protein Rep68 is an
ATP-dependent site-specific endonuclease with DNA helicase activity Cell.
61:447-457.
76. Im, D. S., and N. Muzyczka 1989. Factors that bind to adeno-associated virus
terminal repeats J.Virol. 63:3095-3104.
77. Im, D. S., and N. Muzyczka 1992. Partial purification of adeno-associated virus
Rep78, Rep52, and Rep40 and their biochemical characterization J.Virol.
66:1119-1128.
78. Imbalzano, A. N. 1998. Energy-dependent chromatin remodelers: complex
complexes and their components Crit Rev Eukaryot Gene Expr. 8:225-55.
79. Ince, T. A., and K. W. Scotto 1995. Differential utilization of multiple
transcription start points accompanies the overexpression of the P-glycoprotein-
encoding gene in Chinese hamster lung cells Gene. 156:287-90.
80. Inostroza, J. A., F. H. Mermelstein, I. Ha, W. S. Lane, and D. Reinberg 1992.
Drl, a TATA-binding protein-associated phosphoprotein and inhibitor of class II
gene transcription Cell. 70:477-89.
81. Jeoung, D. I., S. Chen, J. Windsor, and R. E. Pollack 1991. Human major
HSP70 protein complements the localization and functional defects of
cytoplasmic mutant SV40 T antigen in Swiss 3T3 mouse fibroblast cells Genes
Dev. 5:2235-44.
82. Jing, X. J., V. Kalman-Maltese, X. Cao, Q. Yang, and J. P. Trempe 2001.
Inhibition of adenovirus cytotoxicity, replication, and E2a gene expression by
adeno-associated virus Virology. 291:140-51.
83. Khleif, S. N., T. Myers, B. J. Carter, and J. P. Trempe 1991. Inhibition of
cellular transformation by the adeno-associated virus rep gene Virology. 181:738-
741.
84. Kim, J. L., D. B. Nikolov, and S. K. Burley 1993. Co-crystal structure of TBP
recognizing the minor groove of a TATA element Nature. 365:520-7.
85. Kim, T. K., Y. Zhao, H. Ge, R. Bernstein, and R. G. Roeder 1995. TATA-
binding protein residues implicated in a functional interplay between negative

112
cofactor NC2 (Drl) and general factors TFIIA and TFIIB J Biol Chem.
270:10976-81.
86. Kim, Y. J., S. Bjorklund, Y. Li, M. H. Sayre, and R. D. Kornberg 1994. A
multiprotein mediator of transcriptional activation and its interaction with the C-
terminal repeat domain of RNA polymerase II Cell. 77:599-608.
87. King, J. A., R. Dubielzig, D. Grimm, and J. A. Kleinschmidt 2001. DNA
helicase-mediated packaging of adeno-associated virus type 2 genomes into
preformed capsids Embo J. 20:3282-91.
88. Kitay, M. K., and D. T. Rowe 1996. Protein-protein interactions between
Epstein-Barr virus nuclear antigen- LP and cellular gene products: binding of 70-
kilodalton heat shock proteins Virology. 220:91-9.
89. Klein, P., B. L. Pool Zobel, O. Yalkinoglu, and J. R. Schlehofer 1990.
Induction of selective DNA amplification and morphological cell transformation
in Syrian hamster embryo cells Mutat.Res. 232:183-190.
90. Kleinschmidt, J. A., M. Mohler, F. W. Weindler, and R. Heilbronn 1995.
Sequence elements of the adeno-associated virus rep gene required for
suppression of herpes-simplex-virus-induced DNA amplification Virology.
206:254-262.
91. Kokorina, N. A., A. D. Santin, C. Li, and P. L. Hermonat 1998. Involvement
of protein-DNA interaction in adeno-associated virus Rep78- mediated inhibition
of HIV-1 J Hum Virol. 1:441-50.
92. Kornberg, R. D., and Y. Lorch 1999. Twenty-five years of the nucleosome,
fundamental particle of the eukaryote chromosome Cell. 98:285-94.
93. Kotin, R. M., M. Siniscalco, R. J. Samulski, X. D. Zhu, L. Hunter, C. A.
Laughlin, S. McLaughlin, N. Muzyczka, M. Rocchi, and K. I. Berns 1990.
Site-specific integration by adeno-associated virus Proc Natl Acad Sci USA.
87:2211-5.
94. Krady, J. K., and D. C. Ward 1995. Transcriptional activation by the parvoviral
nonstructural protein NS-1 is mediated via a direct interaction with Spl. Mol.
Cell. Biol. 15:524-533.
95. Kuldell, N. H., and S. Buratowski 1997. Genetic analysis of the large subunit of
yeast transcription factor HE reveals two regions with distinct functions Mol Cell
Biol. 17:5288-98.

113
96. Kuo, M. H., J. Zhou, P. Jambeck, M. E. Churchill, and C. D. Allis 1998.
Histone acetyltransferase activity of yeast Gcn5p is required for the activation of
target genes in vivo Genes Dev. 12:627-39.
97. Kyostio, S. R., R. A. Owens, M. D. Weitzman, B. A. Antoni, N. Chejanovsky,
and B. J. Carter 1994. Analysis of adeno-associated virus (AAV) wild-type and
mutant Rep proteins for their abilities to negatively regulate AAV p5 and p 19
mRNA levels J. Virol. 68:2947-2957.
98. Kyostio, S. R., R. S. Wonderling, and R. A. Owens 1995. Negative regulation
of the adeno-associated virus (AAV) P5 promoter involves both the P5 rep
binding site and the consensus ATP-binding motif of the AAV Rep68 protein J.
Virol. 69:6787-6796.
99. Labow, M. A., L. H. Graf, Jr., and K. I. Berns 1987. Adeno-associated virus
gene expression inhibits cellular transformation by heterologous genes Mol. Cell
Biol. 7:1320-1325.
100. Labow, M. A., P. L. Hermonat, and K. I. Berns 1986. Positive and negative
autoregulation of the adeno-associated virus type 2 genome J. Virol. 60:251-258.
101. Laughlin, C. A., C. B. Cardellichio, and H. C. Coon 1986. Latent infection of
KB cells with adeno-associated virus type 2 J. Virol. 60:515-524.
102. Laughlin, C. A., N. Jones, and B. J. Carter 1982. Effect of deletions in
adenovirus early region 1 genes upon replication of adeno-associated virus J.
Virol. 41:868-876.
103. Lee, J. S., K. M. Galvin, R. H. See, R. Eckner, D. Livingston, E. Moran, and
Y. Shi 1995. Relief of YY1 transcriptional repression by adenovirus E1A is
mediated by ElA-associated protein p300 Genes Dev. 9:1188-98.
104. Lee, T. L, J. J. Wyrick, S. S. Koh, E. G. Jennings, E. L. Gadbois, and R. A.
Young 1998. Interplay of positive and negative regulators in transcription
initiation by RNA polymerase II holoenzyme Mol Cell Biol. 18:4455-62.
105. Lee, T. I., and R. A. Young 1998. Regulation of gene expression by TBP-
associated proteins Genes Dev. 12:1398-408.
106. Legendre, D., and J. Rommelaere 1994. Targeting of promoters for trans
activation by a carboxy-terminal domain of the NS-1 protein of the parvovirus
minute virus of mice J Virol. 68:7974-85.
107. Leuther, K. K., D. A. Bushnell, and R. D. Kornberg 1996. Two-dimensional
crystallography of TFIIB- and IIE-RNA polymerase II complexes: implications
for start site selection and initiation complex formation Cell. 85:773-9.

114
108. Lewis, B. A., G. Tullís, E. Seto, N. Horikoshi, R. Weinmann, and T. Shenk
1995. Adenovirus El A proteins interact with the cellular YY1 transcription
factor.J.Virol. 69:1628-1636.
109. Li, B., and S. Fields 1993. Identification of mutations in p53 that affect its
binding to SV40 large T antigen by using the yeast two-hybrid system Faseb J.
7:957-63.
110. Lin, Y. S., I. Ha, E. Maldonado, D. Reinberg, and M. R. Green 1991. Binding
of general transcription factor TFIIB to an acidic activating region Nature.
353:569-71.
111. Lis, J. 1998. Promoter-associated pausing in promoter architecture and
postinitiation transcriptional regulation Cold Spring Harb Symp Quant Biol.
63:347-56.
112. Liu, J. S., S. R. Kuo, A. M. Makhov, D. M. Cyr, J. D. Griffith, T. R. Broker,
and L. T. Chow 1998. Human Hsp70 and Hsp40 chaperone proteins facilitate
human papillomavirus-11 El protein binding to the origin and stimulate cell- free
DNA replication J Biol Chem. 273:30704-12.
113. Lorson, C., L. R. Burger, M. Mouw, and D. J. Pintel 1996. Efficient
transactivation of the minute virus of mice P38 promoter requires upstream
binding of NS1 J Virol. 70:834-42.
114. Lorson, C., J. Pearson, L. Burger, and D. J. Pintel 1998. An Spl-binding site
and TATA element are sufficient to support full transactivation by proximally
bound NS1 protein of minute virus of mice Virology. 240:326-37.
115. Lu, H., L. Zawel, L. Fisher, J. M. Egly, and D. Reinberg 1992. Human general
transcription factor IIH phosphorylates the C-terminal domain of RNA
polymerase II Nature. 358:641-5.
116. Luger, K., and T. J. Richmond 1998. The histone tails of the nucleosome Curr
Opin Genet Dev. 8:140-6.
117. Ma, J., and M. Ptashne 1987. The carboxy-terminal 30 amino acids of GAL4 are
recognized by GAL80 Cell. 50:137-42.
118. Marshall, N. F., and D. H. Price 1995. Purification of P-TEFb, a transcription
factor required for the transition into productive elongation J Biol Chem.
270:12335-8.
119. Martinez, E., C. M. Chiang, H. Ge, and R. G. Roeder 1994. TATA-binding
protein-associated factor(s) in TFIID function through the initiator to direct basal
transcription from a TATA-less class II promoter Embo J. 13:3115-26.

115
120. Martinez, E., H. Ge, Y. Tao, C. X. Yuan, V. Palhan, and R. G. Roeder 1998.
Novel cofactors and TFIIA mediate functional core promoter selectivity by the
human TAFII150-containing TFIID complex Mol Cell Biol. 18:6571-83.
121. Maxfield, L. F., and D. J. Spector 1997. Readthrough activation of early
adenovirus Elb gene transcription J Virol. 71:8321-9.
122. May, E., C. Breugnot, A. Duthu, and P. May 1991. Immunological evidence
for the association between simian virus 40 115- kDa super T antigen and hsp70
proteins in rat, monkey, and human cells Virology. 180:285-93.
123. McCarty, D. M., M. Christensen, and N. Muzyczka 1991. Sequences required
for coordinate induction of adeno-associated virus pi9 and p40 promoters by Rep
protein J. Virol. 65:2936-2945.
124. McCarty, D. M., T. H. Ni, and N. Muzyczka 1992. Analysis of mutations in
adeno-associated virus Rep protein in vivo and in vitro J.Virol. 66:4050-4057.
125. McCarty, D. M., D. J. Pereira, 1. Zolotukhin, X. Zhou, J. H. Ryan, and N.
Muzyczka 1994. Identification of linear DNA sequences that specifically bind the
adeno-associated virus Rep protein J Virol. 68:4988-4997.
126. McCracken, S., N. Fong, E. Rosonina, K. Yankulov, G. Brothers, D.
Siderovski, A. Hessel, S. Foster, S. Shuman, and D. L. Bentley 1997. 5'-
Capping enzymes are targeted to pre-mRNA by binding to the phosphorylated
carboxy-terminal domain of RNA polymerase II Genes Dev. 11:3306-18.
127. McCracken, S., N. Fong, K. Yankulov, S. Ballantyne, G. Pan, J. Greenblatt,
S. D. Patterson, M. Wickens, and D. L, Bentley 1997. The C-terminal domain
of RNA polymerase II couples mRNA processing to transcription Nature.
385:357-61.
128. McLaughlin, S. K., P. Collis, P. L. Hermonat, and N. Muzyczka 1988. Adeno-
associated virus general transduction vectors: analysis of pro viral structures J.
Virol. 62:1963-1973.
129. Mitchell, P. J., and R. Tjian 1989. Transcriptional regulation in mammalian
cells by sequence-specific DNA binding proteins Science. 245:371-8.
130. Moore, S. C., and J. Ausio 1997. Major role of the histones H3-H4 in the folding
of the chromatin fiber Biochem Biophys Res Commun. 230:136-9.
131. Muldrow, T. A., A. M. Campbell, P. A. Weil, and D. T. Auble 1999. MOT1
can activate basal transcription in vitro by regulating the distribution of TATA
binding protein between promoter and nonpromoter sites Mol Cell Biol. 19:2835-
45.

116
132. Muzyczka, N. 1992. Use of adeno-associated virus as a general transduction
vector for mammalian cells Curr. Top. Microbiol. Immunol. 158:97-129.
133. Muzyczka, N., and K. I. Berns 2001. Parvoviridae: The viruses and their
replication, p. 2327-2360. In D. M. Knipe, and P. M. Howley (eds), Fields
Virology, Fourth ed. Lippincott Williams and Wilkins, New York.
134. Nikolov, D. B., S. H. Hu, J. Lin, A. Gasch, A. Hoffmann, M. Horikoshi, N. H.
Chua, R. G. Roeder, and S. K. Burley 1992. Crystal structure of TFIID TATA-
box binding protein Nature. 360:40-6.
135. Novina, C. D., and A. L. Roy 1996. Core promoters and transcriptional control
Trends Genet. 12:351-5.
136. Ogbourne, S., and T. M. Antalis 1998. Transcriptional control and the role of
silencers in transcriptional regulation in eukaryotes Biochem J. 331:1-14.
137. Otero, G., J. Fellows, Y. Li, T. de Bizemont, A. M. Dirac, C. M. Gustafsson,
H. Erdjument-Bromage, P. Tempst, and J. Q. Svejstrup 1999. Elongator, a
multisubunit component of a novel RNA polymerase II holoenzyme for
transcriptional elongation Mol Cell. 3:109-18.
138. Owens, R. A., M. D. Weitzman, S. R. Kyostio, and B. J. Carter 1993.
Identification of a DNA-binding domain in the amino terminus of adeno-
associated virus Rep proteins J Virol. 67:997-1005.
139. Ozer, J., K. Mitsouras, D. Zerby, M. Carey, and P. M. Lieberman 1998.
Transcription factor IIA derepresses TATA-binding protein (TBP)- associated
factor inhibition of TBP-DNA binding J Biol Chem. 273:14293-300.
140. Ozer, J., P. A. Moore, A. H. Bolden, A. Lee, C. A. Rosen, and P. M.
Lieberman 1994. Molecular cloning of the small (gamma) subunit of human
TFIIA reveals functions critical for activated transcription Genes Dev. 8:2324-35.
141. Pan, G., and J. Greenblatt 1994. Initiation of transcription by RNA polymerase
II is limited by melting of the promoter DNA in the region immediately upstream
of the initiation site J Biol Chem. 269:30101-4.
142. Paranjape, S. M., R. T. Kamakaka, and J. T. Kadonaga 1994. Role of
chromatin structure in the regulation of transcription by RNA polymerase II Annu
Rev Biochem. 63:265-97.
143. Pereira, D. J., D. M. McCarty, and N. Muzyczka 1997. The adeno-associated
virus (AAV) Rep protein acts as both a repressor and an activator to regulate
AAV transcription during a productive infection J Virol. 71:1079-88.

117
144. Pereira, D. J., and N. Muzyczka 1997. The adeno-associated virus type 2 p40
promoter requires a proximal Spl interaction and a pi9 CArG-like element to
facilitate Rep transactivation J Virol. 71:4300-9.
145. Pereira, D. J., and N. Muzyczka 1997. The cellular transcription factor SP1 and
an unknown cellular protein are required to mediate Rep protein activation of the
adeno-associated virus pl9 promoter J Virol. 71:1747-56.
146. Pinto, L, W. H. Wu, J. G. Na, and M. Hampsey 1994. Characterization of sua7
mutations defines a domain of TFIIB involved in transcription start site selection
in yeast J Biol Chem. 269:30569-73.
147. Pipas, J. M. 1998. Molecular chaperone function of the SV40 large T antigen
Dev Biol Stand. 94:313-9.
148. Podsakoff, G., K. K. Wong, Jr., and S. Chatterjee 1994. Efficient gene transfer
into nondividing cells by adeno-associated virus-based vectors J.Virol. 68:5656-
5666.
149. Prelich, G. 1997. Saccharomyces cerevisiae BUR6 encodes a DRAPl/NC2alpha
homolog that has both positive and negative roles in transcription in vivo Mol
Cell Biol. 17:2057-65.
150. Prelich, G., and F. Winston 1993. Mutations that suppress the deletion of an
upstream activating sequence in yeast: involvement of a protein kinase and
histone H3 in repressing transcription in vivo Genetics. 135:665-76.
151. Ptashne, M., and A. Gann 1997. Transcriptional activation by recruitment
Nature. 386:569-77.
152. Ramakrishnan, V. 1997. Histone HI and chromatin higher-order structure Crit
Rev Eukaryot Gene Expr. 7:215-30.
153. Robert, F., M. Douziech, D. Forget, J. M. Egly, J. Greenblatt, Z. F. Burton,
and B. Coulombe 1998. Wrapping of promoter DNA around the RNA
polymerase II initiation complex induced by TFIIF Mol Cell. 2:341-51.
154. Rossignol, M., A. Keriel, A. Staub, and J. M. Egly 1999. Kinase activity and
phosphorylation of the largest subunit of TFIIF transcription factor J Biol Chem.
274:22387-92.
155. Roy, R., J. P. Adamczewski, T. Seroz, W. Vermeulen, J. P. Tassan, L.
Schaeffer, E. A. Nigg, J. H. Hoeijmakers, and J. M. Egly 1994. The MO 15 cell
cycle kinase is associated with the TFIIH transcription- DNA repair factor Cell.
79:1093-101.

118
156. Rundlett, S. E., A. A. Carmen, R. Kobayashi, S. Bavykin, B. M. Turner, and
M. Grunstein 1996. HDA1 and RPD3 are members of distinct yeast histone
deacetylase complexes that regulate silencing and transcription Proc Natl Acad
SciUS A. 93:14503-8.
157. Ryan, J. H., S. Zolotukhin, and N. Muzyczka 1996. Sequence requirements for
binding of Rep68 to the adeno-associated virus terminal repeats J Virol. 70:1542-
53.
158. Sakurai, H., T. Ohishi, and T. Fukasawa 1997. Promoter structure-dependent
functioning of the general transcription factor HE in Saccharomyces cerevisiae J
Biol Chem. 272:15936-42.
159. Samulski, R. J., A. Srivastava, K. I. Berns, and N. Muzyczka 1983. Rescue of
adeno-associated virus from recombinant plasmids: gene correction within the
terminal repeats of AAV Cell. 33:135-43.
160. Samulski, R. J., X. Zhu, X. Xiao, J. D. Brook, D. E. Housman, N. Epstein,
and L. A. Hunter 1991. Targeted integration of adeno-associated virus (AAV)
into human chromosome 19 [published erratum appears in EMBO J 1992
Mar; 11 (3): 1228] Embo J. 10:3941-50.
161. Sawai, E. T., and J. S. Butel 1989. Association of a cellular heat shock protein
with simian virus 40 large T antigen in transformed cells J Virol. 63:3961-73.
162. Serizawa, H., T. P. Makela, J. W. Conaway, R. C. Conaway, R. A. Weinberg,
and R. A. Young 1995. Association of Cdk-activating kinase subunits with
transcription factor TFIIH Nature. 374:280-2.
163. Seto, E., B. Lewis, and T. Shenk 1993. Interaction between transcription factors
Spl and YY1 Nature. 365:462-4.
164. Seto, E., Y. Shi, and T. Shenk 1991. YY1 is an initiator sequence-binding
protein that directs and activates transcription in vitro Nature. 354:241-5.
165. Shelling, A. N., and M. G. Smith 1994. Targeted integration of transfected and
infected adeno-associated virus vectors containing the neomycin resistance gene
Gene Ther. 1:165-169.
166. Sheng, Q., D. Denis, M. Ratnofsky, T. M. Roberts, J. A. DeCaprio, and B.
Schaffhausen 1997. The DnaJ domain of polyomavirus large T antigen is
required to regulate Rb family tumor suppressor function J Virol. 71:9410-6.
167. Shi, X., M. Chang, A. J. Wolf, C. H. Chang, A. A. Frazer-Abel, P. A. Wade,
Z. F. Burton, and J. A. Jaehning 1997. Cdc73p and Paflp are found in a novel

119
RNA polymerase II-containing complex distinct from the Srbp-containing
holoenzyme Mol Cell Biol. 17:1160-9.
168. Shi, Y., E. Seto, L. S. Chang, and T. Shenk 1991. Transcriptional repression by
YY1, a human GLI-Kruppel-related protein, and relief of repression by
adenovirus El A protein Cell. 67:377-388.
169. Sil, A. K., S. Alam, P. Xin, L. Ma, M. Morgan, C. M. Lebo, M. P. Woods, and
J. E, Hopper 1999. The Gal3p-Gal80p-Gal4p transcription switch of yeast:
Gal3p destabilizes the Gal80p-Gal4p complex in response to galactose and ATP
Mol Cell Biol. 19:7828-40.
170. Singer, V. L., C. R. Wobbe, and K. Struhl 1990. A wide variety of DNA
sequences can functionally replace a yeast TATA element for transcriptional
activation Genes Dev. 4:636-45.
171. Smale, S. T., and D. Baltimore 1989. The "initiator" as a transcription control
element Cell. 57:103-13.
172. Smale, S. T., A. Jain, J. Kaufmann, K. H. Emami, K. Lo, and I. P. Garraway
1998. The initiator element: a paradigm for core promoter heterogeneity within
metazoan protein-coding genes Cold Spring Harb Symp Quant Biol. 63:21-31.
173. Smith, R. H., and R. M. Kotin 2000. An adeno-associated virus (AAV) initiator
protein, Rep78, catalyzes the cleavage and ligation of single-stranded AAV ori
DNA J Virol. 74:3122-9.
174. Smith, R. H., and R. M. Kotin 1998. The Rep52 gene product of adeno-
associated virus is a DNA helicase with 3'-to-5' polarity J Virol. 72:4874-81.
175. Snyder, R. O., R. J. Samulski, and N. Muzyczka 1990. In vitro resolution of
covalently joined AAV chromosome ends Cell. 60:105-13.
176. Spencer, V. A., and J. R. Davie 1999. Role of covalent modifications of histones
in regulating gene expression Gene. 240:1-12.
177. Srinivasan, A., A. J. McClellan, J. Vartikar, I. Marks, P. Cantalupo, Y. Li, P.
Whyte, K. Rundell, J. L. Brodsky, and J. M. Pipas 1997. The amino-terminal
transforming region of simian virus 40 large T and small t antigens functions as a
J domain Mol Cell Biol. 17:4761-73.
178. Srivastava, A., E. W. Lusby, and K. I. Berns 1983. Nucleotide sequence and
organization of the adeno-associated virus 2 genome J Virol. 45:555-64.
179. Struhl, K. 1995. Yeast transcriptional regulatory mechanisms Annu Rev Genet.
29:651-74.

120
180. Stubdal, H., J. Zalvide, K. S. Campbell, C. Schweitzer, T. M. Roberts, and J.
A. DeCaprio 1997. Inactivation of pRB-related proteins pi30 and pi07 mediated
by the J domain of simian virus 40 large T antigen Mol Cell Biol. 17:4979-90.
181. Su, P. F., S. Y. Chiang, C. W. Wu, and F. Y. Wu 2000. Adeno-associated virus
major rep78 protein disrupts binding of TATA- binding protein to the p97
promoter of human papillomavirus type 16 [In Process Citation] J Virol. 74:2459-
65.
182. Sun, F. L., and S. C. Elgin 1999. Putting boundaries on silence Cell. 99:459-62.
183. Sun, X., Y. Zhang, H. Cho, P. Rickert, E. Lees, W. Lane, and D. Reinberg
1998. NAT, a human complex containing Srb polypeptides that functions as a
negative regulator of activated transcription Mol Cell. 2:213-22.
184. Thomas, J. O., and A. A. Travers 2001. HMG1 and 2, and related 'architectural'
DNA-binding proteins Trends Biochem Sci. 26:167-74.
185. Tijerina, P., and M. H. Sayre 1998. A debilitating mutation in transcription
factor HE with differential effects on gene expression in yeast J Biol Chem.
273:1107-13.
186. Trempe, J. P., and B. J. Carter 1988. Regulation of adeno-associated virus gene
expression in 293 cells: control of mRNA abundance and translation J. Virol.
62:68-74.
187. Triezenberg, S. J. 1995. Structure and function of transcriptional activation
domains Curr Opin Genet Dev. 5:190-6.
188. Tse, C., and J. C. Hansen 1997. Hybrid trypsinized nucleosomal arrays:
identification of multiple functional roles of the H2A/H2B and H3/H4 N-termini
in chromatin fiber compaction Biochemistry. 36:11381-8.
189. Uptain, S. M., C. M. Kane, and M. J. Chamberlin 1997. Basic mechanisms of
transcript elongation and its regulation Annu Rev Biochem. 66:117-72.
190. Urabe, M., Y. Hasumi, A. Kume, R. T. Surosky, G. J. Kurtzman, K. Tobita,
and K. Ozawa 1999. Charged-to-alanine scanning mutagenesis of the N-terminal
half of adeno- associated virus type 2 Rep78 protein J Virol. 73:2682-93.
191. Usheva, A., and T. Shenk 1994. TATA-binding protein-independent initiation:
YY1, TFIIB, and RNA polymerase II direct basal transcription on supercoiled
template DNA.Cell. 76:1115-1121.
192. Verrijzer, C. P., and R. Tjian 1996. TAFs mediate transcriptional activation and
promoter selectivity Trends Biochem Sci. 21:338-42.

121
193. Vincent, A. C., and K. Struhl 1992. ACR1, a yeast ATF/CREB repressor Mol
Cell Biol. 12:5394-405.
194. Wade, P. A., and J. A. Jaehning 1996. Transcriptional corepression in vitro: a
Motlp-associated form of TATA- binding protein is required for repression by
Leu3p Mol Cell Biol. 16:1641-8.
195. Walker, S. L., R. S. Wonderling, and R. A. Owens 1997. Mutational analysis of
the adeno-associated virus Rep68 protein: identification of critical residues
necessary for site-specific endonuclease activity J Virol. 71:2722-30.
196. Walker, S. L., R. S. Wonderling, and R. A. Owens 1997. Mutational analysis of
the adeno-associated virus type 2 Rep68 protein helicase motifs J Virol. 71:6996-
7004.
197. Walter, G., A. Carbone, and W. J. Welch 1987. Medium tumor antigen of
polyomavirus transformation-defective mutant NG59 is associated with 73-
kilodalton heat shock protein J Virol. 61:405-10.
198. Walz, C., and J. R. Schlehofer 1992. Modification of some biological properties
of HeLa cells containing adeno-associated virus DNA integrated into
chromosome 17 J.Virol. 66:2990-3002.
199. Walz, C., J. R. Schlehofer, M. Flentje, V. Rudat, and H. zur Hausen 1992.
Adeno-associated virus sensitizes HeLa cell tumors to gamma rays J.Virol.
66:5651-5657.
200. Wang, L., C. Mizzen, C. Ying, R. Candau, N. Bariev, J. Brownell, C. D. Allis,
and S. L. Berger 1997. Histone acetyltransferase activity is conserved between
yeast and human GCN5 and is required for complementation of growth and
transcriptional activation Mol Cell Biol. 17:519-27.
201. Weger, S., E. Hammer, and R. Heilbronn 2002. Topors, a p53 and
topoisomerase I binding protein, interacts with the adeno-associated virus (AAV-
2) Rep78/68 proteins and enhances AAV-2 gene expression J Gen Virol. 83:511-
516.
202. Weger, S., M. Wendland, J. A. Kleinschmidt, and R. Heilbronn 1999. The
adeno-associated virus type 2 regulatory proteins rep78 and rep68 interact with
the transcriptional coactivator PC4 J Virol. 73:260-9.
203. Weger, S., A. Wistuba, D. Grimm, and J. A. Kleinschmidt 1997. Control of
adeno-associated virus type 2 cap gene expression: relative influence of helper
virus, terminal repeats, and Rep proteins J Virol. 71:8437-47.

122
204. Weitzman, M. D., S. R. Kyostio, B. J. Carter, and R. A. Owens 1996.
Interaction of wild-type and mutant adeno-associated virus (AAV) Rep proteins
on AAV hairpin DNA J Virol. 70:2440-8.
205. Weitzman, M. D., S. R. Kyostio, R. M. Kotin, and R. A. Owens 1994. Adeno-
associated virus (AAV) Rep proteins mediate complex formation between AAV
DNA and its integration site in human DNA Proc.Natl.Acad.Sci.U.S.A. 91:5808-
5812.
206. Winocour, E., M. F. Caliaham, and E. Huberman 1988. Perturbation of the
cell cycle by adeno-associated virus Virology. 167:393-399.
207. Winocour, E., L. Puzis, S. Etkin, T. Koch, B. Danovitch, E. Mendelson, E.
Shaulian, S. Karby, and S. Lavi 1992. Modulation of the cellular phenotype by
integrated adeno-associated virus Virology. 190:316-329.
208. Wobbe, C. R., and K. Struhl 1990. Yeast and human TATA-binding proteins
have nearly identical DNA sequence requirements for transcription in vitro Mol
Cell Biol. 10:3859-67.
209. Wonderling, R. S., S. R. Kyostio, and R. A. Owens 1995. A maltose-binding
protein/adeno-associated virus Rep68 fusion protein has DNA-RNA helicase and
ATPase activities J Virol. 69:3542-3548.
210. Wonderling, R. S., S. R. Kyostio, S. L. Walker, and R. A. Owens 1997. The
Rep68 protein of adeno-associated virus type 2 increases RNA levels from the
human cytomegalovirus major immediate early promoter Virology. 236:167-76.
211. Wonderling, R. S., and R. A. Owens 1996. The Rep68 protein of adeno-
associated virus type 2 stimulates expression of the platelet-derived growth factor
B c-sis proto-oncogene [published erratum appears in J Virol 1996
Dec;70(12):9084] J Virol. 70:4783-6.
212. Workman, J. L., and R. E. Kingston 1998. Alteration of nucleosome structure
as a mechanism of transcriptional regulation Annu Rev Biochem. 67:545-79.
213. Wu, Y., R. J. Reece, and M. Ptashne 1996. Quantitation of putative activator-
target affinities predicts transcriptional activating potentials Embo J. 15:3951-63.
214. Wyrick, J. J., F. C. Holstege, E. G. Jennings, H. C. Causton, D. Shore, M.
Grunstein, E. S. Lander, and R. A. Young 1999. Chromosomal landscape of
nucleosome-dependent gene expression and silencing in yeast Nature. 402:418-
21.

123
215. Xiao, H., J. D. Friesen, and J. T. Lis 1995. Recruiting TATA-binding protein to
a promoter: transcriptional activation without an upstream activator Mol Cell
Biol. 15:5757-61.
216. Yang, J., and D. B. DeFranco 1994. Differential roles of heat shock protein 70
in the in vitro nuclear import of glucocorticoid receptor and simian virus 40 large
tumor antigen Mol Cell Biol. 14:5088-98.
217. Yang, Q., F. Chen, J. Ross, and J. P. Trempe 1995. Inhibition of cellular and
SV40 DNA replication by the adeno-associated virus Rep proteins Virology.
207:246-250.
218. Yang, Q., F. Chen, and J. P. Trempe 1994. Characterization of cell lines that
inducibly express the adeno- associated virus Rep proteins J Virol. 68:4847-56.
219. Yang, Q., and J. P. Trempe 1993. Analysis of the terminal repeat binding
abilities of mutant adeno- associated virus replication proteins J Virol. 67:4442-7.
220. Yokomori, K., M. P. Zeidler, J. L. Chen, C. P. Verrijzer, M. Mlodzik, and R.
Tjian 1994. Drosophila TFIIA directs cooperative DNA binding with TBP and
mediates transcriptional activation Genes Dev. 8:2313-23.
221. Young, R. A. 1991. RNA polymerase II Annu Rev Biochem. 60:689-715.
222. Zalvide, J., H. Stubdal, and J. A. DeCaprio 1998. The J domain of simian virus
40 large T antigen is required to functionally inactivate RB family proteins Mol
Cell Biol. 18:1408-15.
223. Zehring, W. A., J. M. Lee, J. R. Weeks, R. S. Jokerst, and A. L. Greenleaf
1988. The C-terminal repeat domain of RNA polymerase II largest subunit is
essential in vivo but is not required for accurate transcription initiation in vitro
Proc Natl Acad Sci USA. 85:3698-702.
224. Zhang, D. E., and D. A. Nelson 1988. Histone acetylation in chicken
erythrocytes. Rates of acetylation and evidence that histones in both active and
potentially active chromatin are rapidly modified Biochem J. 250:233-40.
225. Zlatanova, J., S. H. Leuba, and K. van Holde 1998. Chromatin fiber structure:
morphology, molecular determinants, structural transitions Biophys J. 74:2554-
66.
226. Zlatanova, J., S. H. Leuba, and K. van Holde 1999. Chromatin structure
revisited Crit Rev Eukaryot Gene Expr. 9:245-55.

124
227. Zou, J., Y. Guo, T. Guettouche, D. F. Smith, and R. Voellmy 1998. Repression
of heat shock transcription factor HSF1 activation by HSP90 (HSP90 complex) that
forms a stress-sensitive complex with HSF1 Cell. 94:471-80.

BIOGRAPHICAL SKETCH
Daniel Francis Lackner was bom on September 28, 1971 in Midland, Michigan.
He spent the first four years of his life in Michigan until his parents moved to Madison,
Indiana. He attended Pope John XXII Elementary School and Madison Junior High
School in Indiana. While he was fourteen years old, his parents moved back to Midland,
Michigan where he finished school at Northeast Junior High School and Midland Public
High School. During the fall of 1990, Dan enrolled in college undergraduate studies at
Delta College in University Center, Michigan. After the first two years of Delta College,
he transferred to Michigan State University in East Lansing, Michigan. He received a
Bachelor of Science degree with High Honors in Biochemistry in the spring of 1994.
After earning a Biochemistry degree, he obtained a job as a Laboratory Technician at the
University of Rochester Biology Department in Rochester, New York. He spent one year
in the laboratory of Susan Zusman studying the functions of Integin proteins within the
model organism, Drosophilia melanogaster. He began his graduate career by joining the
Center of Mammalian Genetics at the University of Florida in the fall of 1995. He joined
the laboratory of Nicholas Muzyczka in the summer of 1996. In October of 1999, he
married Cari Lynn Aspacher, a fellow graduate student in the Department of Molecular
Genetics. In August of 2002, he received a Ph.D in biomedical science.
125

I certify that I have read this study and that in my opinion it conforms to
acceptable standards of scholarly presentation and is fully adequate, in scope and quality,
as a dissertation for the degree of Doctor of Philosophy.
C ^ '
Nicholas Muzyczka, Chair
Eminent Scholar and Professor of
Molecular Genetics and Microbiology
I certify that I have read this study and that in my opinion it conforms to
acceptable standards of scholarly presentation and is fully adequate, in scope and quality,
as a dissertation for the degree of Doctor of Philosophy.
Maureen Goodeñow
Professor of Pathology, Immunology, and
Laboratory Medicine
I certify that I have read this study and that in my opinion it conforms to
acceptable standards of scholarly presentation and is fully adequate/m scope and quality,
as a dissertation for the degree of Doctor of Philosophy. y
^J
7iffiam Hauswirth
Eminent Scholar and Professor of
Molecular Genetics and Microbiology
I certify that I have read this study and that in my opinion it conforms to
acceptable standards of scholarly presentation and is fully adequate,in^scppe and quality,
as a dissertation for the degree of Doctor of Philosophy.
Maurice Swanson
Professor of Molecular Genetics and
Microbiology

This dissertation was submitted to the Graduate Faculty of the College of
Agricultural and Life Sciences and to the Graduate School and was accepted as partial
fulfillment of the requirements for the degree of Doctor of Philosophy.
August 2002 'yifnMr^jSViA C
Dean, Cóllege of Medicine
Dean, Graduate School




PAGE 1

$'(129,586 ,1'8&(' $'(12$662&,$7(' 9,586 *(1( (;35(66,21 ,6 127 '(3(1'(17 21 $$9 1216758&785$/ 5(3 3527(,1 %\ '$1,(/ )5$1&,6 /$&.1(5 $ ',66(57$7,21 35(6(17(' 72 7+( *5$'8$7( 6&+22/ 2) 7+( 81,9(56,7< 2) )/25,'$ ,1 3$57,$/ )8/),//0(17 2) 7+( 5(48,5(0(176 )25 7+( '(*5(( 2) '2&725 2) 3+,/2623+< 81,9(56,7< 2) )/25,'$

PAGE 2

&RS\ULJKW E\ 'DQLHO )UDQFLV /DFNQHU

PAGE 3

7KLV ZRUN LV GHGLFDWHG WR ERWK RI P\ SDUHQWV -RKQ DQG 6DOO\ /DFNQHU

PAGE 4

$&.12:/('*0(176 ,Q P\ ODE ZRXOG OLNH WR WKDQN D JUHDW QXPEHU RI SHRSOH )LUVW ZRXOG OLNH WR WKDQN %LOO 0F'RQDOG +H ZDV WKH XQIRUWXQDWH SRVWGRF WKDW KDG WR VLW QH[W WR PH DV D ILUVW \HDU JUDGXDWH VWXGHQW +H DQVZHUHG HYHU\ VWXSLG TXHVWLRQ HYHU DVNHG DQG WDXJKW PH WR IRUP WKH UHDOO\ LPSRUWDQW RQHV 7ZR RWKHU LPSRUWDQW SRVWGRFV ZHUH &KULVWLDQ DQG &RUULQD 'U 7HVKHQGRUI LQWURGXFHG PH WR WKH ZRQGHUV DQG SHFXOLDULW\ RI WKH (XURSHDQ OLIHVW\OH IURP WKH *HUPDQ SHUVSHFWLYH +H ZLOO EH WKH PHDVXUH WR ZKLFK FRPSDUH DOO IXWXUH PHGLFDO GRFWRUV &RUULQD KDV H[SRVHG PH WR WKH 6SDQLVK YHUVLRQ RI WKH (XURSHDQ OLIHVW\OH DQG FUHDWHG P\ HQWLUH NQRZOHGJH RI WKH QHXURVFLHQFH ILHOG KDYH HQMR\HG WKH ODUJH QXPEHU RI &KLQHVH SRVWGRFV LQ WKH ODE ZKLFK LQWURGXFHG PH WR WKH &KLQHVH FXOWXUH :HLMLQ 3HL :X
PAGE 5

ELRORJ\ ZLWK WKHVH WZR JUHDW SRVWGRFV 7KH\ KDYH WDXJKW PH PRUH WKDQ WKH\ NQRZ DQG NQRZ WKH\ ZLOO GR JUHDW LQ WKHLU IXWXUH FDUHHUV :LWKRXW TXHVWLRQ WKH HQGXULQJ VXSSRUW RI P\ SDUHQWV -RKQ DQG 6DOO\ KDV HQDEOHG PH WR FRPSOHWH WKLV 3K' GLVVHUWDWLRQ 'XULQJ PDQ\ SKRQH FDOOV WKHLU RZQ LQWHUHVW LQ P\ ZRUN KDV LQVSLUHG PH WR H[SODLQ PDQ\ GLIIHUHQW DVSHFWV RI EDVLF $$9 DQG $GHQRYLUXV ELRORJ\ FDQQRW WKDQN WKHP HQRXJK IRU HYHU\WKLQJ WKH\ KDYH GRQH IRU PH ZRXOG OLNH WR JLYH D YHU\ LPSRUWDQW DFNQRZOHGJHPHQW DQG WKDQNV WR P\ ZLIH 'U &DUL $VSDFKHU /DFNQHU )URP WKH EHJLQQLQJ RI P\ JUDGXDWH FDUHHU VKH KDV EHHQ D JUHDW VRXUFH RI KDSSLQHVV DQG D JUHDW FRPSDQLRQ LQ VFLHQWLILF UHVHDUFK KDYH DOZD\V KDG KHU DV D UHVHDUFK FRQVXOWDQW DQG DVSLUHG WR EH KHU HTXDO DV D EHQFK VFLHQWLVW Y

PAGE 6

7$%/( 2) &217(176 (LJH $&.12:/('*0(176 LY $%675$&7 YLLL ,1752'8&7,21 (XNDU\RWLF *HQH ([SUHVVLRQ 7KH &KURPDWLQ 7HPSODWH $FWLYDWLRQ DQG 5HSUHVVLRQ &KURPDWLQ 0RGLILFDWLRQ %DVDO 7UDQVFULSWLRQ )DFWRUV 51$ 3RO\PHUDVH ,, +RORHQ]\PH $GHQR$VVRFLDWHG 9LUXV $GHQRYLUXV +HOSHU )XQFWLRQV $$9 5HS 3URWHLQV $$9 7UDQVFULSWLRQ ZLWKRXW $GHQRYLUXV $$9 7UDQVFULSWLRQ ZLWK $GHQRYLUXV 0RGHO IRU $FWLYDWLRQ RI DQ $$9 3URGXFWLYH ,QIHFWLRQ IURP /DWHQF\ 0$7(5,$/6 $1' 0(7+2'6 &HOO /LQHV DQG 9LUXV 3ODVPLGV 7UDQVIHFWLRQV &$7 5HSRUWHU $VVD\V 5(68/76 $QDO\VLV RI $GHQR$VVRFLDWHG 9LUXV 7UDQVFULSWLRQ 'HILQH 5HS %LQGLQJ (OHPHQW DV (QKDQFHU RU 3UR[LPDO 3URPRWHU (OHPHQW 7KH S 5%( LV QRW DQ XSVWUHDP DFWLYDWLRQ VLJQDO $FWLYDWLRQ RI SO LV QRW GXH WR UHDG WKURXJK IURP S 7UDQVDFWLYDWLRQ RI SL FDQ EH PRGHOHG LQ WKH DEVHQFH RI 5HS :KLFK S HOHPHQW LV SULPDULO\ UHVSRQVLEOH IRU 5HS PHGLDWHG LQGXFWLRQ RI SL 7UDQVFULSWLRQDO $QDO\VLV RI 0XWDQW 5HS 3URWHLQV *HQHUDWLRQ RI 5HS 0XWDQW 3ODVPLGV 7UDQVFULSWLRQDO $FWLYDWLRQ RI WKH SL 3URPRWHU E\ 5HS 0XWDQWV YL

PAGE 7

5HSUHVVLRQ RI WKH S SURPRWHU ',6&866,21 7KH 5%( LV QRW D W\SLFDO XSVWUHDP DFWLYDWLRQ VLJQDO 7KH S 5%( LV SUREDEO\ DQ DUFKLWHFWXUDO HOHPHQW GHVLJQHG WR EULQJ WKH S DQG WKH SL SURPRWHUV WRJHWKHU 5HS 3URWHLQ 'RPDLQV LQ $$9 7UDQVFULSWLRQDO 5HJXODWLRQ )XWXUH 'LUHFWLRQV &RQFOXVLRQV 7$%/( 2) $%%5(9,$7,216 /,67 2) 5()(5(1&(6 %,2*5$3+,&$/ 6.(7&+ YLL

PAGE 8

$EVWUDFW RI 'LVVHUWDWLRQ 3UHVHQWHG WR WKH *UDGXDWH 6FKRRO RI WKH 8QLYHUVLW\ RI )ORULGD LQ 3DUWLDO )XOILOOPHQW RI WKH 5HTXLUHPHQWV IRU WKH 'HJUHH RI 'RFWRU RI 3KLORVRSK\ $'(129,586 ,1'8&(' $'(12$662&,$7(' 9,586 *(1( (;35(66,21 ,6 127 '(3(1'(17 21 $$9 1216758&785$/ 5(3 3527(,1 %\ 'DQLHO )UDQFLV /DFNQHU $XJXVW &KDLUPDQ 1LFKRODV 0X]\F]ND 3K' 0DMRU 'HSDUWPHQW 0ROHFXODU *HQHWLFV DQG 0LFURELRORJ\ 7KH QRUPDO OLIHF\FOH RI $GHQR$VVRFLDWHG 9LUXV $$9f DOWHUQDWHV EHWZHHQ D ODWHQW UHSUHVVHG SURYLUXV DQG DQ DFWLYHO\ WUDQVFULELQJ YLUDO JHQRPH 7KLV VZLWFK LQ JHQH H[SUHVVLRQ LV WKH FRPELQDWLRQ RI FHOOXODU DQG YLUDO IDFWRUV WR SURPRWH $$9 UHSOLFDWLRQ 3UHYLRXV VWXGLHV RI $$9 KDYH LQGLFDWHG UHJXODWRU\ SDWKZD\V ZKLFK PDLQWDLQ WKH FRUUHFW $$9 WUDQVFULSWLRQ OHYHOV IRU SURGXFWLYH LQIHFWLRQ $XWRUHJXODWLRQ RI WKH $$9 JHQRPH LV FRQWUROOHG E\ 5HS SURWHLQ LQWHUDFWLRQV ZLWK FHOOXODU SURWHLQV 7KH DGGLWLRQ RI $GHQRYLUXV KHOSHU DFWLYLWLHV LQGXFH FKDQJHV LQ ERWK FHOOXODU DQG $$9 WUDQVFULSWLRQDO UHJXODWLRQ 7KLV FRPELQDWLRQ RI UHJXODWRU\ IDFWRUV DOORZV WKH GLVVHFWLRQ RI D FRPSOH[ WUDQVFULSWLRQDO UHJXODWLRQ PHFKDQLVP LQ D UHODWLYHO\ VLPSOH JHQHWLF V\VWHP 7KH GLVVHFWLRQ RI WKH $$9 WUDQVFULSWLRQDO UHJXODWLRQ ZDV SHUIRUPHG E\ D VHULHV RI SURPRWHU FRQVWUXFWV WKDW ZRXOG DFFHVV WKH IDFWRUV UHTXLUHG IRU WUDQVFULSWLRQDO DFWLYDWLRQ RI WKH $$9 SL SURPRWHU ,QLWLDOO\ WKH ILUVW SURPRWHU FRQVWUXFWV FRQWDLQLQJ D VLQJOH $$9 5HS SURWHLQ ELQGLQJ VLWH ZHUH XVHG WR GHWHUPLQH LI WKH QRQVWUXFWXUDO 5HS SURWHLQ ZRXOG IXQFWLRQ DV D YLLL

PAGE 9

WUDQVFULSWLRQDO DFWLYDWRU RI $$9 JHQH H[SUHVVLRQ 7KH 5HS SURWHLQ ZDV GHWHUPLQHG QRW WR EH D WUDQVFULSWLRQDO DFWLYDWRU EXW LQVWHDG WR IXQFWLRQ DV D SRVLWLRQGHSHQGHQW LQKLELWRU RI SO SURPRWHU DFWLYLW\ 7KLV SRVLWLRQGHSHQGHQW LQKLELWLRQ RI WKH $$9 SO SURPRWHU DFWLYLW\ VXJJHVWHG WKDW WKH SUHYLRXVO\ FKDUDFWHUL]HG 5HS DQG 6SO LQWHUDFWLRQ PLJKW QRW EH WKH GLUHFW FDXVH RI 5HSPHGLDWHG WUDQVDFWLYDWLRQ ,Q RUGHU WR SURYH WKDW WKH SUHYLRXV FKDUDFWHUL]HG 5HS DQG 6SO LQWHUDFWLRQ ZDV QRW UHVSRQVLEOH IRU LQGXFWLRQ RI WKH SL SURPRWHU D QRYHO V\VWHP RI K\EULG WUDQVFULSWLRQ IDFWRUV ZDV XVHG WR UHSODFH WKH 5HS DQG 6SO SURWHLQV 7KH QRYHO K\EULG WUDQVFULSWLRQ IDFWRUV PRGLILHG IURP WKH \HDVW WZRK\EULG V\VWHP FRQVLVWHG RI WZR GLIIHUHQW SURWHLQV FRQWDLQLQJ D *$/'1$ ELQGLQJ GRPDLQ IXVHG WR HLWKHU DQ LQWHUDFWLRQ GRPDLQ IURP S RU 7DQWLJHQ 7KH UHSODFHPHQW RI WKH 5HS DQG 6SO ELQGLQJ VLWHV ZLWK *$/ ELQGLQJ VHTXHQFHV LQ WKH SL SURPRWHU VKRZHG WKDW 5HS DQG 6SO ZHUH QRW UHTXLUHG IRU WUDQVDFWLYDWLRQ :H FRQFOXGH WKDW WKH 5HS DQG 6SO WUDQVFULSWLRQ IDFWRUV IXQFWLRQ DV DUFKLWHFWXUDO SURWHLQV IDFLOLWDWLQJ D '1$ ORRS WR IRUP EHWZHHQ WKH 5HS ELQGLQJ VLWH LQ WKH S SURPRWHU DQG WKH 6SO VLWH ZLWKLQ WKH SL SURPRWHU ,;

PAGE 10

&+$37(5 ,1752'8&7,21 (XNDU\RWLF *HQH ([SUHVVLRQ 7KH UHJXODWLRQ RI HXNDU\RWLF JHQH H[SUHVVLRQ KDV EHHQ VKRZQ WR EH IDU PRUH FRPSOH[ WKDQ WKH RULJLQDO SURWHLQ IUDFWLRQDWLRQV IRU 51$ SRO\PHUDVH DFWLYLWLHV VXJJHVWHG ,QLWLDO IUDFWLRQDWLRQ SURWRFROV GLVFRYHUHG WKUHH GLVWLQFW 51$ SRO\PHUDVHV DQG WKHLU UHVSHFWLYH *HQHUDO RU %DVDO 7UDQVFULSWLRQ )DFWRUV *7)Vf +RZHYHU SXULILFDWLRQ RI WKHVH IDFWRUV GLG QRW UHVWRUH WKH FRPSOH[ UHJXODWLRQ RI WUDQVFULSWLRQ LQ YLWUR LQGLFDWLQJ WKDW PRUH IDFWRUV ZHUH UHTXLUHG IRU SURSHU WUDQVFULSWLRQDO UHJXODWLRQ 0RUH UHFHQW VWXGLHV KDYH REVHUYHG WKDW WKH 51$ SRO\PHUDVH ,, KRORHQ]\PH 51$3 ,,f LV DERXW WKH VDPH VL]H DV WKH ULERVRPH DQG PDQ\ RWKHU IDFWRUV DUH FULWLFDO IRU FRUUHFW JHQH H[SUHVVLRQ '1$ FRQGHQVDWLRQ LQWR FKURPDWLQ KDV EHHQ VKRZQ WR UHJXODWH JHQH H[SUHVVLRQ DQG WKH H[SRVXUH RI '1$ VHTXHQFHV DOORZV WKH DVVHPEO\ RI WUDQVFULSWLRQDO UHJXODWRUV WR UHFUXLW WKH FRPSOHWH 51$ SRO\PHUDVH ,, KRORHQ]\PH 7KH &KURPDWLQ 7HPSODWH 7KH '1$ WHPSODWH RI PRVW SURPRWHUV IRU SURWHLQHQFRGLQJ JHQHV FRQWDLQV WKUHH LPSRUWDQW IHDWXUHV 7KH ILUVW FRPSRQHQW LV WKH WUDQVFULSWLRQ LQLWLDWLRQ VLWH WKDW GLUHFWV WKH LQLWLDWLRQ RI SRO\PHUL]DWLRQ RI P51$ ZKLFK LV FDWDO\]HG E\ WKH 51$ SRO\PHUDVH ,, KRORHQ]\PH 7KH VHFRQG FRPSRQHQW LV WKH 7$7$ ER[ ZKLFK UHJXODWHV WKH ELQGLQJ RI WKH 7$7$ ELQGLQJ SURWHLQ 7%3f 7KH ODVW FRPSRQHQW LV WKH UHJXODWRU\ VHTXHQFHV

PAGE 11

VXUURXQGLQJ WKH WUDQVFULSWLRQ LQLWLDWLRQ VLWH DQG WKH 7$7$ ER[ RI WKH H[SUHVVHG JHQH SURGXFW 7KH WUDQVFULSWLRQ LQLWLDWLRQ VLWH DQG WKH 7$7$ ER[ DUH GHILQHG DV WKH FRUH SURPRWHU HOHPHQWV 7KLV FRUH HOHPHQW DYHUDJHV DERXW EDVH SDLUV ESf LQ OHQJWK IRU PRVW SURWHLQ HQFRGLQJ JHQHV 7KH $7ULFK VHTXHQFH QDPHG WKH 7$7$ ER[ LV XVXDOO\ IRXQG DERXW WR ES XSVWUHDP RI WKH WUDQVFULSWLRQ LQLWLDWLRQ VLWH LQ KLJKHU HXNDU\RWLF RUJDQLVPV f 7KH 7$7$ ER[ ZDV LQLWLDOO\ FKDUDFWHUL]HG IRU LWV DELOLW\ WR ELQG WKH 7$7$ ELQGLQJ SURWHLQ 7%3f D FRPSRQHQW RI WKH 7),,' FRPSOH[ WKDW LV LPSRUWDQW IRU LQLWLDWLQJ WKH IRUPDWLRQ RI WKH 51$ SRO\PHUDVH ,, KRORHQ]\PH 7KH ELQGLQJ DFWLYLW\ RI WKLV $7ULFK UHJLRQ ZDV QDPHG IRU LWV DSSDUHQWO\ FDQRQLFDO VHTXHQFH RI 7$7$ EXW LW KDV EHHQ UHFHQWO\ REVHUYHG WKDW 7%3 FDQ ELQG WR D UDQJH RI VHTXHQFHV QR ORQJHU GHILQHG E\ D VLPSOH VHTXHQFH PDWFK WR WKH 7$7$ ER[ UHJLRQ f ,Q DGGLWLRQ WR WKH PRUH FRPPRQ 7$7$ ER[ PDQ\ SURPRWHUV FDQ KDYH DQ LQLWLDWRU HOHPHQW ,QUf WKDW FRYHUV WKH WUDQVFULSWLRQDO VWDUW VLWH DQG UHFUXLWV UHJXODWRU\ IDFWRUV DQG WKH 51$ SRO\PHUDVH ,, f 7KH FRUH SURPRWHU FDQ WKHUHIRUH FRPSULVH D 7$7$ DQG ,QU HOHPHQWV FRPSRVLWHf HLWKHU HOHPHQW DORQH 7$7$ RU ,QUGLUHFWHGf RU QHLWKHU HOHPHQW QXOOf f 0RVW YLUDO HQFRGHG SURWHLQV KDYH FRPSRVLWH SURPRWHUV PRVW FHOOXODU 51$3 ,, JHQHV DUH 7$7$ GLUHFWHG SURPRWHUV DQG PDQ\ QXOO SURPRWHUV KDYH PDQ\ GLIIHUHQW WUDQVFULSWLRQDO LQLWLDWRU VLWHV UHIOHFWLQJ YDULDEOH 7%3 ELQGLQJ SRVLWLRQV f 7KH PDMRULW\ RI JHQH UHJXODWLRQ RQ SURWHLQHQFRGLQJ JHQHV IXQFWLRQV DW WKH OHYHO RI XSVWUHDP DFWLYDWLQJ VHTXHQFHV XSVWUHDP UHSUHVVLQJ VHTXHQFHV VLOHQFHUV RU ORFXV FRQWURO UHJLRQV 8SVWUHDP DFWLYDWLQJ VHTXHQFHV 8$6f DUH GHILQHG DV VHTXHQFHV RI '1$ WKDW ELQG VSHFLILF WUDQVFULSWLRQ IDFWRUV WKDW SURPRWH WKH UHFUXLWPHQW RI WKH 51$3 ,, DW WKH

PAGE 12

FRUH SURPRWHU HOHPHQW DQG DFWLYDWH WKH LQLWLDWLRQ RI JHQH H[SUHVVLRQ 7KHVH DFWLYDWLQJ VHTXHQFHV FDQ EH UHODWLYHO\ FORVH WR WKH LQLWLDWLRQ VLWH ZKLFK DOORZV DFWLYDWRUV WR ELQG QHDU WKH FRUH SURPRWHU WKXV GHILQLQJ WKLV VXEJURXS RI 8$6V DV SUR[LPDO SURPRWHU HOHPHQWV f $QRWKHU VXEJURXS RI 8$6V GHILQHG DV HQKDQFHUV FRQVLVW RI ELQGLQJ VLWHV IRU RQH RU PRUH WUDQVFULSWLRQDO DFWLYDWRUV WKDW IXQFWLRQ LQGHSHQGHQW RI WKHLU RULHQWDWLRQ DQG FDQ EH VHSDUDWHG E\ '1$ VHTXHQFHV RI NLOREDVHSDLUV NEf f 8SVWUHDP UHSUHVVLQJ VHTXHQFHV 856Vf DUH '1$ VHTXHQFH HOHPHQWV WKDW IXQFWLRQ QHJDWLYHO\ WRZDUG WKH UHFUXLWPHQW DQG DVVHPEO\ RI WKH 51$ SRO\PHUDVH ,, KRORHQ]\PH DW WKH QHDUE\ SUR[LPDO FRUH SURPRWHU HOHPHQW ,Q FRQWUDVW WR DFWLYH UHFUXLWPHQW E\ DFWLYDWRUV WKH UHSUHVVLYH HOHPHQWV WKDW ELQG WR 856V IXQFWLRQ LQ SUHYHQWLQJ JHQH H[SUHVVLRQ E\ GLIIHUHQW PHFKDQLVPV 7KH ILUVW PHFKDQLVP LV WKH SDVVLYH H[FOXVLRQ RI DFWLYDWRU ELQGLQJ WKHUHE\ SUHYHQWLQJ WKH DFWLYDWRU IURP 51$ SRO ,, UHFUXLWPHQW 0RVW FRPPRQO\ WKH UHSUHVVRU ZLOO KDYH D ELQGLQJ VLWH VHTXHQFH WKDW LV QHDUE\ RU RYHUODSV WKH DFWLYDWRU WKHUHE\ H[FOXGLQJ LWV ELQGLQJ E\ VWHULF LQWHUIHUHQFH RI WKHLU ELQGLQJ VLWHV $QRWKHU DFWLYH UHSUHVVRU PHFKDQLVP LV WKH PRGLILFDWLRQ RI FKURPDWLQ VWUXFWXUH E\ KLVWRQH GHDFHW\ODWLRQ ZKLFK SUHYHQWV WUDQVFULSWLRQDO DFWLYDWRUV IURP ELQGLQJ WKHLU UHVSHFWLYH '1$ VHTXHQFHV 6LOHQFHUV DUH GHILQHG DV '1$ VHTXHQFH HOHPHQWV WKDW UHSUHVV SURPRWHU DFWLYLW\ LQ DQ RULHQWDWLRQ DQG SRVLWLRQLQGHSHQGHQW PDQQHU f 7KH VLOHQFHU HOHPHQWV FRQWDLQ ELQGLQJ VLWHV WKDW UHFRJQL]H VSHFLILF SURWHLQ IDFWRUV 7KHVH SURWHLQ IDFWRUV ELQG WKH VLOHQFHU HOHPHQW DQG LQWHUDFW ZLWK FKURPDWLQ KLVWRQHV + DQG + 7KH UHVXOW RI WKLV LQWHUDFWLRQ LV D GHDFHW\ODWLRQ RI WKH + DQG + KLVWRQHV LQGXFLQJ D FRQGHQVDWLRQ RI WKH FKURPDWLQ VWUXFWXUH WKXV SUHYHQWLQJ DFFHVV DQG ELQGLQJ RI DQ\ WUDQVFULSWLRQDO DFWLYDWRUV

PAGE 13

/RFXV FRQWURO UHJLRQV /&5Vf DUH SRVLWLYH DFWLYDWRUV RI H[SUHVVLRQ IRU SUR[LPDO JHQHV EXW GLIIHU IURP XSVWUHDP DFWLYDWLQJ VHTXHQFHV LQ VHYHUDO DVSHFWV $IWHU WKHVH /&5 HOHPHQWV DUH LQWHJUDWHG LQWR FHOOXODU FKURPDWLQ WKH HQKDQFHU VHTXHQFHV IXQFWLRQ LQ DQ RULHQWDWLRQ DQG GLVWDQFH LQGHSHQGHQW PDQQHU EXW WKH OHYHO RI JHQH H[SUHVVLRQ LV LQIOXHQFHG E\ WKH DFWXDO VLWH RI LQWHJUDWLRQ 7KLV HIIHFW RI LQWHJUDWLRQ LV GHILQHG DV SRVLWLRQ HIIHFW YDULHJDWLRQ EHFDXVH WKH VWUXFWXUH RI FKURPDWLQ FDQ RYHUZKHOP WKH HQKDQFHUfV HIIHFW DQG WKH DFFHVVLELOLW\ RI WUDQVFULSWLRQDO DFWLYDWRUV WR WKH HQKDQFHU VHTXHQFH ,Q FRQWUDVW WR HQKDQFHU HOHPHQWV WKH ORFXV FRQWURO UHJLRQV FDQ DOZD\V DFWLYDWH WUDQVFULSWLRQ ZKHQ LQWHJUDWHG LQWR FHOOXODU FKURPDWLQ EHFDXVH WKH /&5 HOHPHQWV GLUHFWO\ LQWHUDFW ZLWK WKH IRUPDWLRQ RI WKH FKURPDWLQ VWUXFWXUH f 7KH ODVW PDMRU FKURPDWLQ HOHPHQW LV WKH ,QVXODWRU HOHPHQW ZKLFK FDQ OLPLW WKH HIIHFWV RI WKH RWKHU UHJXODWRU HOHPHQWV 7KH ,QVXODWRU HOHPHQWV DOORZ WKH FKURPDWLQ WHPSODWH WR EH VXEGLYLGHG LQWR GLIIHUHQW IXQFWLRQDO GRPDLQV (DFK FKURPDWLQ GRPDLQ LV UHJXODWHG E\ YDULRXV HQKDQFHUV 8$6V 856V RU /&5V DQG WKRVH UHVSHFWLYH HOHPHQWV DUH VHSDUDWHG QRW E\ GLVWDQFH EXW E\ WKH IXQFWLRQ RI WKH ,QVXODWRU HOHPHQWV f &KURPDWLQ VWUXFWXUH LV FRPSULVHG RI D VHULHV RI QXFOHRSURWHLQ FRPSOH[HV FDOOHG QXFOHRVRPHV $ QXFOHRVRPH FRQWDLQV ES RI JHQRPLF '1$ ZUDSSHG DURXQG DQ RFWRPHU RI KLVWRQH SURWHLQV f 7KH RFWRPHU LV DUUDQJHG LQ D F\OLQGHU VKDSH FRPSRVHG RI WZR KHWHURGLPHUV RI KLVWRQHV + DQG + DQG DQRWKHU WZR KHWHURGLPHUV RI KLVWRQHV +$ DQG +% 7KH QXFOHRVRPH FU\VWDO VWUXFWXUH VKRZV '1$ ZUDSSHG DURXQG WKH F\OLQGHU DQG WKH FRQWDFW LV PDLQWDLQHG E\ LQWHUDFWLRQV ZLWK WKH KLVWRQH SURWHLQV DQG WKH SKRVSKDWH EDFNERQH RI WKH '1$ f 7KH '1$ LV ERXQG VR WKDW WKH 1WHUPLQXV RI WKH KLVWRQHV FDQ LQWHUDFW ZLWK RWKHU QHLJKERULQJ QXFOHRVRPHV WR IRUP KLJKHU RUGHU

PAGE 14

VWUXFWXUHV ,Q DGGLWLRQ WKH '1$ DQG KLVWRQH LQWHUDFWLRQV DUH QRW IL[HG DOORZLQJ VRPH SURPRWHU VHTXHQFHV WR EH H[SRVHG IRU JHQH H[SUHVVLRQ 7KH GHJUHH RI FKURPDWLQ VWUXFWXUH DQG FRQGHQVDWLRQ ZLWKLQ D SURPRWHU UHJLRQ LV XVXDOO\ UHODWHG WR WKH OHYHO RI WUDQVFULSWLRQDO DFWLYDWLRQ )LJ $f f 0DQ\ LQ YLWUR H[SHULPHQWV KDYH REVHUYHG WKDW WUDQVFULSWLRQDO WHPSODWHV SUHLQFXEDWHG ZLWK FKURPDWLQ IUDFWLRQV LQKLELW WKH LQLWLDWLRQ RI 51$ SRO\PHUDVHV ,Q FRPSOHPHQWLQJ H[SHULPHQWV LQ YLYR \HDVW H[SHULPHQWV ZKLFK GHSOHWHG KLVWRQH SURWHLQV LQFUHDVH WKH WUDQVFULSWLRQDO DFWLYLW\ RI PDQ\ GLIIHUHQW JHQHV f 7KHVH H[SHULPHQWV GHPRQVWUDWH KRZ WLJKW KLVWRQH'1$ FRQWDFWV DQG WKH RUJDQL]DWLRQ RI QXFOHRVRPHV LQWR KLJKHU RUGHU VWUXFWXUHV FDQ OLPLW DQG VWHULFDOO\ LQKLELW ELQGLQJ RI WUDQVFULSWLRQ IDFWRUV WR WKH SURPRWHU UHJLRQ $FWLYDWLRQ DQG 5HSUHVVLRQ $Q DFWLYDWRU LV FRPSRVHG RI WZR GLIIHUHQW IXQFWLRQDO SURWHLQ GRPDLQV f 7KH ILUVW GRPDLQ ELQGV WKH VSHFLILF '1$ VHTXHQFH ZLWKLQ WKH XSVWUHDP DFWLYDWLQJ VHTXHQFH DQG WKH VHFRQG GRPDLQ IXQFWLRQV WR UHFUXLW RU VWLPXODWH WKH DFWLYLW\ RI WKH 51$ SRO\PHUDVH ,, KRORHQ]\PH $ VLQJOH DFWLYDWRU FDQ EH XVHG LQ RUGHU WR DFWLYDWH PXOWLSOH JHQHV WKURXJKRXW WKH JHQRPH DOORZLQJ V\QFKURQL]DWLRQ RI PDQ\ GLIIHUHQW JHQH SURGXFWV 2Q WKH RWKHU KDQG D VLQJOH JHQH LQ WKH JHQRPH FDQ EH UHJXODWHG E\ PDQ\ VHSDUDWH WUDQVFULSWLRQDO DFWLYDWRUV SURYLGLQJ WKH JHQRPH D PHFKDQLVP IRU YDULDEOH FRQWURO 7KH PDLQ IXQFWLRQ RI WUDQVFULSWLRQDO DFWLYDWRUV LV WKH ELQGLQJ DQG UHFUXLWPHQW RI WKH WUDQVFULSWLRQ LQLWLDWLRQ DSSDUDWXV )LJ %f f 7KLV IXQFWLRQ KDV EHHQ GHPRQVWUDWHG E\ GLUHFW ELQGLQJ EHWZHHQ WKH DFWLYDWLRQ GRPDLQV RI WUDQVFULSWLRQ IDFWRUV DQG FRPSRQHQWV RI WKH WUDQVFULSWLRQ PDFKLQHU\ f )XUWKHU HYLGHQFH IRU WKH UROH RI DFWLYDWLRQ GRPDLQV LQ ELQGLQJ DQG UHFUXLWLQJ WKH WUDQVFULSWLRQ DSSDUDWXV LV SURYLGHG E\ UHSODFLQJ WKH DFWLYDWLRQ GRPDLQV ZLWK DQ DUWLILFLDO DFWLYDWRU VXFK DV D IXVLRQ SURWHLQ

PAGE 15

)LJ $ PRGHO IRU WKH UROH RI DFWLYDWRUV LQ WUDQVFULSWLRQDO LQLWLDWLRQ $ *HQRPLF '1$ LV SDFNDJHG LQWR QXFOHRVRPHV DQ KLJKHU RUGHUHG FKURPDWLQ VWUXFWXUHV % 7UDQVFULSWLRQDO DFWLYDWRUV ELQG WR SURPRWHU VHTXHQFHV DQG FDQ KDYH D SRVLWLYH LQIOXHQFH RQ SURPRWHU DFWLYLW\ & $FWLYDWRUV ELQG DQG UHFUXLW FKURPDWLQ UHPRGHOLQJ DQG PRGLI\LQJ FRPSOH[HV WKDW LQIOXHQFH ORFDO FKURPDWLQ VWUXFWXUH $FWLYDWRUV ELQG DQG UHFUXLW WKH WUDQVFULSWLRQDO LQLWLDWLRQ DSSDUDWXV WR SURPRWHUV WKURXJK WKH LQWHUDFWLRQV RI D IHZ ODUJH FRPSOH[HV ( $FWLYDWRUV FDQ DIIHFW WKH SURPRWHU FOHDUDQFH DQG 51$ 3RO\PHUDVH ,, KRORHQ]\PH SURFHVVLYLW\

PAGE 16

+LJK2UGHU &KURPDWLQ 6WUXFWXUHV % & DQQXP FKURPDWLQ $FWLYDWRU %LQGLQJ 5HPRGHOLQJ &RPSOH[HV 7UDQVFULSWLRQ &RPSOH[HV

PAGE 17

EHWZHHQ D '1$ ELQGLQJ GRPDLQ DQG FRUUHVSRQGLQJ GRPDLQV IURP WKH WUDQVFULSWLRQDO PDFKLQHU\ 7KLV DUWLILFLDO DFWLYDWRU FDQ VXEVWLWXWH IRU WKH DFWXDO DFWLYDWRU LQ YLYR E\ H[KLELWLQJ WKH VDPH IXQFWLRQDO UROH LQ WUDQVFULSWLRQDO DFWLYDWLRQ f 5HSUHVVRUV RI WUDQVFULSWLRQDO DFWLYLW\ XVXDOO\ IXQFWLRQ LQ HLWKHU D JHQHUDO DFWLYLW\ RU LQ D YHU\ JHQHVSHFLILF PDQQHU f 7KH JHQHUDO UHSUHVVRUV RI WUDQVFULSWLRQ LQWHUDFW ZLWK WKH 7%3 ,Q \HDVW 0RWO UHSUHVVHV WUDQVFULSWLRQ RI VRPH JHQHV E\ GLUHFWO\ ELQGLQJ WKH 7%3'1$ FRPSOH[ DQG LQGXFLQJ GLVVRFLDWLRQ RI 7%3 IURP WKH 7$7$ER[ VHTXHQFH f ,Q ODUJH HXNDU\RWLF RUJDQLVPV WKH 'UO SURWHLQ LV DQRWKHU JHQHUDO QHJDWLYH UHJXODWRU RI 51$ SRO\PHUDVH ,, WUDQVFULSWLRQ 7KH 'UO SURWHLQ ELQGV WKH EDVLF UHSHDW GRPDLQ RI 7%3 ERXQG WR SURPRWHU '1$ DQG SUHYHQWV WKH DVVHPEO\ RI WKH 51$ SRO\PHUDVH ,, KRORHQ]\PH f *HQHVSHFLILF UHSUHVVRUV FDQ IXQFWLRQ E\ GLUHFW SK\VLFDO LQWHUDFWLRQ ZLWK WUDQVFULSWLRQDO DFWLYDWRUV RU E\ FRPSHWLWLRQ IRU DFWLYDWRU ELQGLQJ VLWHV 2QH FODVVLF PRGHO RI JHQHVSHFLILF UHSUHVVLRQ LV WKH *$/ DQG *$/ LQWHUDFWLRQ LQ \HDVW 7KH *$/ WUDQVDFWLYDWRU VWLPXODWHV WKH H[SUHVVLRQ RI \HDVW JHQHV ZLWK D *$/ ELQGLQJ VLWH +RZHYHU WKH DFWLYLW\ RI *$/ FDQ EH LQKLELWHG E\ LWV GLUHFW SK\VLFDO LQWHUDFWLRQ ZLWK *$/ f 7KH *$/ SURWHLQ UHSUHVVHV WKH *$/ DFWLYDWRU E\ ELQGLQJ DQG PDVNLQJ D SRUWLRQ RI LWV DFWLYDWLRQ GRPDLQ f $QRWKHU UHSUHVVRU FKDSHURQH +VS IXQFWLRQV E\ D GLIIHUHQW PHFKDQLVP WR LQKLELW WKH DFWLYLW\ RI WKH WUDQVFULSWLRQDO DFWLYDWRU +VIO ,QVWHDG RI DQ LQWHUDFWLRQ ZKLFK PDVNV WKH DFWLYDWLRQ GRPDLQ WKH +VS SURWHLQ SUHYHQWV WKH IRUPDWLRQ RI +VIO WULPHUV UHTXLUHG IRU WKH ELQGLQJ RI WKH +VIO DFWLYDWRUV WR LWV r UHVSHFWLYH '1$ HOHPHQW f 7KHVH DUH WZR H[DPSOHV RI KRZ GLUHFW LQWHUDFWLRQ RU LQKLELWLRQ RI DQ DFWLYDWRU FDQ ORZHU WUDQVFULSWLRQDO DFWLYLW\ LQ D JHQHVSHFLILF PDQQHU

PAGE 18

$QRWKHU PHWKRG RI JHQHVSHFLILF UHSUHVVLRQ LV VWHULF LQWHUIHUHQFH DW WKH OHYHO RI '1$ ELQGLQJ DFWLYLW\ ,Q WKLV PHFKDQLVP QR GLUHFW LQWHUDFWLRQ EHWZHHQ DQ DFWLYDWLRQ DQG D UHSUHVVRU LV QHFHVVDU\ 7ZR WUDQVFULSWLRQ IDFWRU JURXSV UHSUHVHQWLQJ DFWLYDWRU DQG UHSUHVVRU DFWLYLWLHV FRPSHWH IRU QHLJKERULQJ '1$ SURPRWHU VHTXHQFH $Q H[DPSOH RI WKLV W\SH RI UHJXODWLRQ LV IRXQG EHWZHHQ WKH $FUO UHSUHVVRU DQG WKH $7)&5(% DFWLYDWRU f 3URPRWHUV WKDW XVH VWHULF LQWHUIHUHQFH IRU WUDQVFULSWLRQDO UHJXODWLRQ KDYH RYHUODSSLQJ $FUO DQG $7)&5(% VLWHV ZLWKLQ WKHLU SURPRWHU UHJLRQV 7KH LQWHUDFWLRQ EHWZHHQ DFWLYDWLRQ DQG UHSUHVVLRQ LV DOVR VWURQJO\ GHSHQGHQW RQ WKH H[SUHVVLRQ DQG FRQFHQWUDWLRQ OHYHOV RI WKH SRVLWLYH DQG QHJDWLYH WUDQVFULSWLRQ IDFWRUV $ VWURQJ H[SHULPHQWDO H[DPSOH RI WKLV LQWHUSOD\ EHWZHHQ DFWLYDWLRQ DQG UHSUHVVLRQ FDQ EH IRXQG LQ \HDVW PXWDWLRQDO VFUHHQV WKDW FUHDWH ORVVRIIXQFWLRQ DOOHOHV LQ QHJDWLYH WUDQVFULSWLRQ IDFWRUV DQG DUH FRPSOHPHQWHG E\ PXWDWLRQV LQ SRVLWLYH WUDQVFULSWLRQDO DFWLYDWRUV f &KURPDWLQ 0RGLILFDWLRQ 7KH FRPSUHVVLRQ RI JHQRPLF '1$ LQWR QXFOHRVRPHV DQG KLJKHU RUGHU FKURPDWLQ RUJDQL]DWLRQ SURYLGHV \HW DQRWKHU OHYHO RI WUDQVFULSWLRQDO UHJXODWLRQ 7KH LQWHUDFWLRQV EHWZHHQ WKH 1WHUPLQXV RI KLVWRQH SURWHLQV DOORZV PDQ\ GLIIHUHQW FKURPDWLQ FRPSOH[HV WR IRUP EDVHG RQ WKH DELOLW\ RI WKH KLVWRQHV WR FRQWDFW RQH DQRWKHU 7KH PDMRULW\ RI WKLV YDULDEOH FKURPDWLQ VWUXFWXUH LV UHJXODWHG E\ WKH DFH\WODWLRQ RI WKH 1WHUPLQDO GRPDLQV RI KLVWRQHV f 7KH DFHW\ODWLRQ RI KLVWRQHV LQGXFHV WKH GLVUXSWLRQ RI WLJKW KLJKRUGHU FKURPDWLQ VWUXFWXUHV DQG LQFUHDVHV WUDQVFULSWLRQ DFWLYLW\ 2Q WKH RWKHU KDQG YDULRXV IDFWRUV FDXVLQJ KLVWRQH GHDFHW\ODWLRQ DOORZV WKH IRUPDWLRQ RI KLJKHURUGHU FKURPDWLQ VWUXFWXUH DQG UHVXOWV LQ WKH UHSUHVVLRQ RI WUDQVFULSWLRQ

PAGE 19

+LVWRQH SURWHLQV DUH PRGLILHG E\ DFHW\ODWLRQ SKRVSKRU\ODWLRQ PHWK\ODWLRQ DQG XELTXLWLQDWLRQ 7KH DFHW\ODWLRQ PRGLILFDWLRQ LV WKH EHVW XQGHUVWRRG ZLWK VHYHUDO O\VLQHV RQ WKH 1WHUPLQXV RI HDFK KLVWRQH SURWHLQ UHYHUVLEO\ DFHW\ODWHG f $IWHU DFHW\ODWLRQ WKH QXFOHRVRPHV DUH OHVV OLNHO\ WR XQGHUJR SK\VLFDO LQWHUDFWLRQV DQG FRQGHQVDWLRQ VR WKH H[SRVHG '1$ VHTXHQFHV PD\ DOORZ LQFUHDVHG UHFUXLWPHQW RI WKH WUDQVFULSWLRQDO PDFKLQHU\ )LJ &f f $GGLWLRQDOO\ DFHW\ODWLRQ RI KLVWRQHV QHXWUDOL]HV WKH SRVLWLYHO\ FKDUJHG O\VLQH JURXSV WKHUHE\ GHFUHDVLQJ WKH KLVWRQHV DIILQLW\ IRU '1$ f $FHW\ODWHG KLVWRQHV PD\ DOVR GLUHFWO\ LQWHUDFW ZLWK WUDQVFULSWLRQDO DFWLYDWRUV LQFUHDVLQJ WKHLU ELQGLQJ DIILQLWLHV DQG LQGXFLQJ PRUH 51$ SRO\PHUDVH ,, KRORHQ]\PH UHFUXLWPHQW f +LVWRQH DFHW\OWUDQVIHUDVHV +$7Vf ZHUH ILUVW LGHQWLILHG ZLWK WUDQVFULSWLRQDO DFWLYDWLRQ E\ WKH VWUXFWXUH DQG IXQFWLRQ VWXGLHV RI WKH 7HWUDK\PHQD SURWHLQ S 7KH S SURWHLQ ZDV NQRZQ WR IXQFWLRQ DV D KLVWRQH DFHW\OWUDQVIHUDVH EXW ODWHU VWXGLHV VKRZHG LW ZDV UHODWHG LQ VHTXHQFH WR WKH \HDVW WUDQVFULSWLRQDO FRIDFWRU *FQ f 7KH UHODWLRQVKLS EHWZHHQ WKHVH WZR SURWHLQV FRUUHODWHG WKH DFWLYLWLHV RI KLVWRQH DFHW\ODWLRQ DQG LQFUHDVHG WUDQVFULSWLRQDO DFWLYDWLRQ )RU H[SHULPHQWDO HYLGHQFH WKH *FQGHSHQGHQW SURPRWHUV ZHUH VKRZQ WR KDYH LQFUHDVHG DFHW\ODWLRQ RI KLVWRQHV $GGLWLRQDOO\ PXWDWLRQV LQ WKH +$7 GRPDLQ LQKLELWHG WKH DELOLW\ RI *FQ WR DFWLYDWH WUDQVFULSWLRQ DQG DFHW\ODWH SURPRWHU KLVWRQHV f 6HYHUDO WUDQVFULSWLRQDO FRDFWLYDWRUV WKDW ELQG WR DFWLYDWRUV VXFK DV S DQG &%3 KDYH +$7 DFWLYLW\ 7KH +$7 DFWLYLW\ HQDEOHV WKHP WR DOWHU WKH FKURPDWLQ VWUXFWXUH RI SUR[LPDO SURPRWHUV DIWHU DFWLYDWRUV ELQG WR '1$ 2JU\]NR f +LVWRQH 'HDFHW\ODVHV +'$&Vf ZHUH ILUVW FRUUHODWHG WR WUDQVFULSWLRQDO UHSUHVVLRQ E\ WKH LGHQWLILFDWLRQ RI SXULILHG +'$&V WKDW KDYH VLPLODULW\ WR WUDQVFULSWLRQDO

PAGE 20

FRIDFWRUV f $V PRUH FHOOXODU KLVWRQH GHDFHW\ODVHV ZHUH LVRODWHG PDQ\ ZHUH IRXQG WR EH FRPSRQHQWV RI FRUHSUHVVRUV UHFUXLWHG E\ WUDQVFULSWLRQ IDFWRUV %DVDO 7UDQVFULSWLRQ )DFWRUV ,Q RUGHU IRU DQ\ SURPRWHU VHTXHQFH WR IXQFWLRQ D QXPEHU RI JHQHUDO WUDQVFULSWLRQ IDFWRUV DUH UHTXLUHG WR GLUHFW 51$ SRO\PHUDVH ,, WR WKH VSHFLILF VLWH RI WUDQVFULSWLRQDO LQLWLDWLRQ 7KH JHQHUDO WUDQVFULSWLRQ IDFWRUV FRPSULVHG RI 7),,$ 7),,% 7),,' 7),,( 7),,) DQG 7),,+ DUH QHFHVVDU\ IRU DVVHPEO\ RI 51$ SRO\PHUDVH DW WKH FRUH SURPRWHU DQG IRU WUDQVFULSWLRQ LQLWLDWLRQ )LJ 'f f 7KH FRPELQDWLRQ RI WKH 51$ SRO\PHUDVH ,, DQG WKH EDVDO WUDQVFULSWLRQ IDFWRUV PHOWV WKH FRUH SURPRWHU VHTXHQFH WR FUHDWH D RSHQ FRPSOH[ LQ ZKLFK WR EDVHSDLUV ESf RI '1$ XQZLQG WR IRUP D VLQJOHVWUDQGHG EXEEOH f 7KLV RSHQ FRPSOH[ DOORZV LQLWLDWLRQ WR RFFXU E\ FDWDO\]LQJ D QXPEHU RI SKRVSKRGLHVWHU ERQGV LQ PHVVHQJHU 51$ P51$f ,Q PRVW FDVHV RI WUDQVFULSWLRQ LQLWLDWLRQ 51$ SRO\PHUDVH ,, DQG DVVRFLDWHG IDFWRUV LQLWLDWH WUDQVFULSWLRQ DQG UHOHDVH VPDOO P51$ IUDJPHQWV IURP WKH RSHQ SURPRWHU FRPSOH[ f )LQDOO\ WKH 51$ SRO\PHUDVH ,, RYHUFRPHV WKHVH DERUWLYH LQLWLDWLRQV WR V\QWKHVL]H ORQJHU P51$ ZKLFK H[WHQGV SDVW WKH RSHQ SURPRWHU FRPSOH[ $IWHU WR ES WKH HORQJDWLQJ FRPSOH[ SDXVHV DQG XVXDOO\ UHTXLUHV VWLPXODWLRQ IURP WUDQVFULSWLRQ IDFWRUV LQ WKH SURPRWHU FRPSOH[ DQG PRGLILFDWLRQ RI WKH 51$3,, WR XQGHUJR SURPRWHU HVFDSH DQG FUHDWH WKH HQWLUH P51$ WUDQVFULSW f 2QH RI WKH PRVW FULWLFDO IDFWRUV IRU LQLWLDWLQJ WUDQVFULSWLRQDO DFWLYLW\ LV WKH 7$7$ %LQGLQJ 3URWHLQ 7KH 7%3 LV VLPLODU WR D V\PPHWULFDO PROHFXODU VDGGOH RQ WKH FRUH SURPRWHU '1$ f :KHQ WKH 7%3 LV ERXQG WR D 7$7$ ER[ WKH PROHFXODU VDGGOH ELQGV WKH SURPRWHU DQG FDXVHV D VKDUS EHQG LQ WKH '1$ VWUDQGV ZKLFK LQGXFHV D SDUWLDO XQZLQGLQJ RI EDVH SDLULQJ DW WKH LQLWLDWLRQ VLWH f $ORQJ ZLWK 7%3 WKH 7),,' FRPSOH[

PAGE 21

FRQWDLQV WKH 7%3DVVRFLDWHG IDFWRUV RU 7$)V f 7KH 7$)V UHJXODWH WKH DELOLW\ RI WKH 7%3 WR VHOHFW WKH VSHFLILF VLWH RI WUDQVFULSWLRQDO LQLWLDWLRQ 7KH UHTXLUHPHQW IRU WKH 7$)V LV PRVW FOHDUO\ VHHQ LQ WKH GLIIHUHQFH EHWZHHQ WKH 7$7$GLUHFWHG FRUH SURPRWHUV DQG WKH ,QUGLUHFWHG RU QXOO FRUH SURPRWHU HOHPHQWV 7KH 7%3 SURWHLQ LV DEOH WR LQLWLDWH WUDQVFULSWLRQ RQ 7$7$ ER[ HOHPHQWV LQGHSHQGHQW RQ DQ\ 7$) SURWHLQV LQ WKH 7),,' IUDFWLRQ +RZHYHU IRU ,QUGHSHQGHQW SURPRWHUV RU QXOO FRUH SURPRWHU VHTXHQFHV WKH 7$) SURWHLQV DUH UHTXLUHG IRU WUDQVFULSWLRQDO DFWLYDWLRQ DQG LQWHUDFWLRQ ZLWK WKH WUDQVFULSWLRQ IDFWRUV LQ WKH 856V f 7KH 7),,$ IUDFWLRQ DFWV GLUHFWO\ ZLWK 7%3 DQG VWDELOL]HV WKH 7%3'1$ LQWHUDFWLRQ f 7KH SURWHLQ VXEXQLWV ZLWKLQ 7),,$ KDYH GLUHFW FRQWDFWV ZLWK WUDQVFULSWLRQDO DFWLYDWRUV f 7),,$ PD\ LQKLELW JHQHUDO WUDQVFULSWLRQDO UHSUHVVRUV E\ GLVSODFLQJ RU EORFNLQJ WKRVH SURWHLQV IURP WKHLU UHVSHFWLYH HIIHFWV RQ 7),,' DFWLYLW\ f 7KH 7),,% IUDFWLRQ KDV EHHQ VKRZQ WR GLUHFWO\ LQIOXHQFH WKH VHOHFWLRQ DQG VLWH RI WUDQFULSWLRQDO DFWLYDWLRQ f 7KH 7),,% VXEXQLW VWUXFWXUH VHHPV WR VHW WKH GLVWDQFH EHWZHHQ WKH FRUH SURPRWHU HOHPHQW DQG WKH WUDQVFULSWLRQDO VWDUW VLWH 7KLV REVHUYDWLRQ LV SURYHQ E\ 7),,% PXWDQWV ZKLFK VKLIW WKH VLWH RI LQLWLDWLRQ EHFDXVH WKH\ QR ORQJHU DOORZ LQWHUDFWLRQV EHWZHHQ 51$ 3RO\PHUDVH ,, DQG WKH 7),,% IUDFWLRQ f 5HFHQW FU\VWDO VWUXFWXUH H[SHULPHQWV KDYH VKRZQ WKDW WKH DFWXDO GLVWDQFH EHWZHHQ 7),,% DQG WKH 51$ SRO\PHUDVH ,, FDWDO\WLF VLWH LV DERXW ES ZKLFK LV WKH DYHUDJH GLVWDQFH EHWZHHQ PRVW FRUH SURPRWHU 7$7$ ER[ HOHPHQWV DQG WKH WUDQVFULSWLRQDO VWDUW VLWH f 7),,% LV DEOH WR LQWHUDFW ZLWK D ODUJH QXPEHU RI WUDQVFULSWLRQDO DFWLYDWRUV DQG WKH UHVXOWLQJ LQWHUDFWLRQ LV D PHDVXUH RI WKH HIIHFWLYHQHVV IRU WKDW DFWLYDWRU LQ WKH XSVWUHDP DFWLYDWLQJ VHTXHQFH f

PAGE 22

7KH 7),,) IUDFWLRQ IXQFWLRQV WR VWDELOL]H WKH SUHLQLWLDWLRQ FRPSOH[ RQ WKH FRUH SURPRWHU HOHPHQW 7KLV VWDELOL]DWLRQ PD\ EH WKH UHVXOW RI DOWHULQJ WKH '1$ WRSRORJ\ ([SHULPHQWV WKDW FURVVOLQN WKH SUHLQLWLDWLRQ FRPSOH[ WR WKH '1$ VKRZ WKDW WKH '1$ LV ZUDSSHG LQ RQH FRPSOHWH WXUQ DURXQG WKH SUHLQLWLDWLRQ FRPSOH[ f 7),,) LV UHTXLUHG IRU WKLV WLJKW ZUDSSLQJ WKDW FDXVHV VWUHVV LQ WKH '1$ UHVXOWLQJ LQ SURPRWHU PHOWLQJ DQG RSHQ FRPSOH[ IRUPDWLRQ 7KH 7),,) IDFWRUV DOVR IXQFWLRQ DV D WUDQVFULSWLRQ HORQJDWLRQ IDFWRU 7KLV HORQJDWLRQ DFWLYLW\ PD\ EH UHJXODWHG E\ LWV '1$ ZUDSSLQJ DELOLW\ RU DQ LQWULQVLF NLQDVH DFWLYLW\ f 7KH 7),,( IXQFWLRQ PD\ EH UHODWHG WR D ]LQF ULEERQ PRWLI ZLWKLQ LWV SURWHLQ VHTXHQFH f 7),,( FDQ ELQG VLQJOHVWUDQGHG UHJLRQV RI '1$ DQG HQDEOH PHOWLQJ RI WKH FRUH SURPRWHU VHTXHQFH )URP H[SHULPHQWDO GDWD WKH UHTXLUHPHQW RI 7),,( LQ PDLQWDLQLQJ DQ RSHQ SURPRWHU FRPSOH[ FDQ EH RYHUFRPH E\ D V\QWKHWLF SUHPHOWHG SURPRWHU VHTXHQFH f 7KH LQGXFWLRQ DQG VWDELOLW\ RI DQ RSHQ SURPRWHU FRPSOH[ LV UHODWHG WR WKH DFWXDO SURPRWHU VHTXHQFH DQG WKH 7),,( UHTXLUHPHQW KDV EHHQ VKRZQ WR YDU\ EHWZHHQ VSHFLILF SURPRWHU VHTXHQFHV f 2WKHU IXQFWLRQV RI WKH 7),,( IUDFWLRQ PD\ EH OLQNHG WR WKH 7),,+ IUDFWLRQ 7),,( DVVHPEOHV LQWR WKH 51$ 3RO\PHUDVH ,, SUHLQLWLDWLRQ FRPSOH[ EHIRUH 7),,+ DQG PD\ VWLPXODWH 7),,+ UHFUXLWPHQW RU WKH &7' NLQDVH DQG $73DVH DFWLYLWLHV RI 7),,+ 7KH 7),,+ IUDFWLRQ KDV EHHQ FKDUDFWHUL]HG LQWR WZR VHSDUDWH IXQFWLRQDO FRPSOH[HV 7KH ILUVW FRPSOH[ HQFRPSDVVHV WKH FRUH 7),,+ IXQFWLRQV DQG WKH VHFRQG FRPSOH[ DFWV LQ D NLQDVHF\FOLQ IXQFWLRQ 7KH FRUH 7),,+ FRQWDLQV D '1$GHSHQGHQW $73DVH DQ $73GHSHQGHQW KHOLFDVH DQG D &7' NLQDVH DFWLYLW\ f 7KH SURWHLQV UHVSRQVLEOH IRU WKHVH DFWLYLWLHV ;3%(5&& DQG ;3%(5&& DUH IRXQG ZLWKLQ WKH

PAGE 23

QXFOHRWLGH H[FLVLRQ UHSDLU FRPSOH[ 7KH ;3% KHOLFDVH LV UHTXLUHG IRU SURPRWHU RSHQLQJ LQ YLWUR DQG LV FULWLFDO IRU WKH FRQYHUVLRQ IURP DERUWLYH WUDQVFULSWLRQ LQLWLDWLRQ WR WUDQVFULSWLRQDO HORQJDWLRQ %UDGVKHU f 7KH 7),,+ NLQDVHF\FOLQ DFWLYLWLHV DUH IRXQG ZLWKLQ WKH &GNF\FOLQ + SURWHLQV f 7KH UROH RI WKHVH SURWHLQV LV WR SKRVSKRU\ODWH WKH 51$ SRO\PHUDVH FDUER[\WHUPLQDO GRPDLQ &7'f f 7KH GHJUHH RI 51$ SRO\PHUDVH ,, &7' SKRVSKRU\ODWLRQ LV UHODWHG WR WKH DELOLW\ WR VZLWFK IURP WUDQVFULSWLRQ LQLWLDWLRQ WR HORQJDWLRQ 51$ 3RO\PHUDVH ,, +RORHQ]\PH 7KH SXULILHG HXNDU\RWLF FRUH 51$ SRO\PHUDVH ,, FRQWDLQV EHWZHHQ DQG GLIIHUHQW VXEXQLWV WKDW FDWDO\]H '1$GHSHQGHQW 51$ V\QWKHVLV LQ YLWUR +RZHYHU WKH ODFN RI JHQHUDO WUDQVFULSWLRQ IDFWRUV SUHYHQWV DQ\ VSHFLILF FRUH SURPRWHU UHFRJQLWLRQ 7KH ODUJHVW VXEXQLW RI WKH 51$ SRO\PHUDVH ,, KDV D FDUER[\WHUPLQDO GRPDLQ &7'f WKDW FRQWDLQV WDQGHP UHSHDWV RI D FRQVHQVXV SHSWLGH VHTXHQFH 7\U6HU3UR7KU6HU3UR6HUf f 7KH &7' GRPDLQ LV HVVHQWLDO IRU FHOO JURZWK DQG WKHUH DUH UHSHDWV RI WKH FRQVHQVXV SHSWLGH VHTXHQFH LQ WKH KXPDQ 51$ 3RO\PHUDVH ,, f &7' UHJXODWLRQ LV FRQWUROOHG E\ WKH DPRXQW RI SKRVSKRU\ODWLRQ RQ WKH UHSHDW VHTXHQFHV f :LWKLQ WUDQVFULSWLRQ LQLWLDWLRQ FRPSOH[HV WKH 51$ SRO\PHUDVH ,, &7' GRPDLQV DUH QRW SKRVSKRU\ODWHG DQG DSSHDU WR UHFUXLW WKH 6UE0HGLDWRU FRPSOH[HV WR WKH 51$ SRO\PHUDVH f 7KH 6UE0HGLDWRU FRPSOH[ IXQFWLRQV WR WUDQVPLW WKH VLJQDOV IURP WKH XSVWUHDP WUDQVFULSWLRQDO DFWLYDWRUV WR WKH FRPSRQHQWV RI WKH 51$ SRO\PHUDVH ,, DQG LWV EDVDO WUDQVFULSWLRQ IDFWRUV $IWHU WKH UHFUXLWPHQW DQG DVVHPEO\ RI WKH 51$ SRO\PHUDVH ,, SUHLQLWLDWLRQ FRPSOH[ WKH KRORHQ]\PH VZLWFKHV IURP D WUDQVFULSWLRQ LQLWLDWLRQ FRPSOH[ WR DQ HORQJDWLRQ FRPSOH[ WKURXJK WKH PRGLILFDWLRQ RI WKH &7' SKRVSKRU\ODWLRQ VWDWH 7KH WZR

PAGE 24

NLQDVHV UHVSRQVLEOH IRU WKH &7' SKRVSKRU\ODWLRQ DUH &GN DQG WKH &GN SURWHLQV f 7KH &GN NLQDVH LV ORFDWHG ZLWKLQ WKH JHQHUDO WUDQVFULSWLRQ IDFWRU 7),,+ f 7KH 7),,+ DFWLYLW\ LV UHTXLUHG IRU WKH VZLWFK LQWR D VWDEOH HORQJDWLRQ FRPSOH[ DQG WKH &GN NLQDVH SKRVSKRUDWHV WKH &7' VXEXQLW DOORZLQJ UHOHDVH IURP WKH LQLWLDWLRQ FRPSOH[ f 7KH &GN SURWHLQ LV D VXEXQLW ZLWKLQ WKH 6UE0HGLDWRU FRPSOH[ DQG PD\ UHJXODWH WUDQVFULSWLRQ HORQJDWLRQ WKURXJK XSVWUHDP DFWLYDWLRQ IDFWRUV )LJ (f f $IWHU WKHVH WZR NLQDVHV KDYH SKRVSKRU\ODWHG WKH 51$ SRO\PHUDVH ,, &7' WKH K\SHUSKRVSKRU\ODWHG &7' GRPDLQ SURPRWHV WKH IRUPDWLRQ RI '1$GHSHQGHQW 51$ V\QWKHVLV DORQJ WKH SURWHLQ FRGLQJ VHTXHQFH 7KH SKRVSKRU\ODWHG 51$3,, UHFUXLWV WKH P51$ FDSSLQJ HQ]\PH WR WKH QHZO\ IRUPHG WUDQVFULSW DQG DOORZV P51$ FDSSLQJ WR WDNH SODFH VRRQ DIWHU SURPRWHU FOHDUDQFH f ,Q DGGLWLRQ WR P51$ FDSSLQJ HYHQWV WKH &7' SKRVSKRU\ODWLRQ DOWHUV WKH IDFWRUV DQG VXEXQLWV DVVRFLDWHG ZLWK WKH 51$ SRO\PHUDVH ,, HQ]\PH f 7KH 6UE0HGLDWRU FRPSOH[ RQO\ LQWHUDFWV ZLWK WKH K\SRSKRVSKRU\ODWHG &7' DQG LV UHOHDVHG ZLWK SKRVSKRU\ODWLRQ RI WKH &7' (ORQJDWLRQ FRPSOH[HV FRQWDLQLQJ 7),,6 DUH DVVRFLDWHG ZLWK K\SHUSKRU\ODWHG &7' UHJLRQV $GHQR$VVRFLDWHG 9LUXV $GHQRDVVRFLDWHG YLUXV $$9f LV D KXPDQ VLQJOHVWUDQGHG '1$ YLUXV ,W KDV D JHQRPH VL]H RI NE WKDW HQFRGHV RQO\ WZR RSHQ UHDGLQJ IUDPHV 25)f UHS DQG FDS f 7KHVH WZR 25)V DUH IODQNHG E\ WZR LQYHUWHG WHUPLQDO UHSHDWV WKDW DUH UHTXLUHG IRU JHQRPH UHSOLFDWLRQ LQWHJUDWLRQ DQG YLUDO SDFNDJLQJ )LJ f f $Q $$9 SURGXFWLYH LQIHFWLRQ UHTXLUHV WKH DFWLYLWLHV RI DQRWKHU YLUXV WR DOWHU WKH FHOOXODU UHSOLFDWLRQ DQG WUDQVFULSWLRQDO PHFKDQLVPV 7KH PRVW ZLGHO\ FKDUDFWHUL]HG KHOSHU YLUXV IRU $$9 LV

PAGE 25

)LJ 6WUXFWXUH RI WKH $GHQR$VVRFLDWHG 9LUXV *HQRPH ,Q WKH XSSHU VHFWLRQ RI WKH GLDJUDP WKH WZR GLIIHUHQW RSHQ UHDGLQJ IUDPHV ZLWKLQ $$9 DUH VKRZQ E\ UHFWDQJOHV QDPHG 5HS DQG &DS 7KH ORFDWLRQV RI WKH S SL DQG S SURPRWHUV DUH GHPRQVWUDWHG E\ EHQW DUURZV 7KH WHUPLQDO UHSHDWV 75f VHTXHQFHV DUH GLDJUDPPHG DV GDUNHQHG ER[HV DW ERWK HQGV RI WKH $$9 JHQRPH 7KH ORZHU SRUWLRQ RI WKH GLDJUDP VKRZV WKH $$9 WUDQVFULSWV LQLWLDWHG DW WKHLU UHODWLYH SURPRWHU ORFDWLRQ 7KH OHIW VLGH LQGLFDWHV WKH WUDQVFULSW VL]H DQG WKH PROHFXODU ZHLJKW RI WKH SURWHLQ LV RQ WKH ULJKW

PAGE 26

S S S ‹ F/ SRO\ $ UHS FDS 75 ‘ 5HS 5HS 5HS 5HS K 93 NE ==K 93 93

PAGE 27

$GHQRYLUXV &OLQLFDOO\ $$9 LV RQO\ LVRODWHG IURP SDWLHQWV ZLWK DGHQRYLUXV $Gf LQIHFWLRQV f +RZHYHU $$9 LQIHFWLRQ DORQH KDV QHYHU EHHQ DVVRFLDWHG ZLWK DQ\ GLVHDVH ,I DGHQRYLUXV LV QRW SUHVHQW GXULQJ SULPDU\ $$9 LQIHFWLRQ DQ DERUWLYH LQIHFWLRQ UHVXOWV LQ DQ LQWHJUDWHG SURYLUDO VWUXFWXUH f 0RVW $$9 SURYLUXV JHQRPHV H[KLELW VLWHVSHFLILF LQWHJUDWLRQ HYHQWV LQ WKH KXPDQ JHQRPH f 7KHVH JHQRPHV FDQ EH UHVFXHG E\ VXSHULQIHFWLRQ ZLWK DGHQRYLUXV ZKLFK LQGXFHV ERWK SURYLUDO UHVFXH DQG UHSOLFDWLRQ f $GHQRYLUXV +HOSHU )XQFWLRQV 6HYHUDO DGHQRYLUXV JHQHV KDYH EHHQ LGHQWLILHG WKDW SRVVHVV VSHFLILF KHOSHU IXQFWLRQV GXULQJ $$9 FRLQIHFWLRQ f 7KH DGHQRYLUXV (O $ JHQH SURGXFW IXQFWLRQV DV D WUDQVDFWLYDWRU IRU ERWK $G DQG $$9 SURPRWHUV 7KH (O $ DPLQRDFLG SURWHLQ H[SUHVVHG GXULQJ DQ DGHQRYLUXV LQIHFWLRQ ELQGV WR WUDQVFULSWLRQ IDFWRUV RQ WKH $$9 S SURPRWHU DQG LQGXFHV $$9 JHQH H[SUHVVLRQ 7KH (% NG SURWHLQ UHJXODWHV WKH SRVWWUDQVFULSWLRQDO H[SRUW RI YLUDO P51$V LQWR WKH F\WRSODVP 7KH ( UHJLRQ HQFRGHV WKH $G '1$ ELQGLQJ SURWHLQ $G '%3f 7KH $G '3 SURPRWHV WUDQVFULSWLRQDO DFWLYDWLRQ IURP WKH $$9 SURPRWHUV DQG PD\ HQKDQFH $$9 '1$ UHSOLFDWLRQ 7KH ( UHJLRQ LQIOXHQFHV PDQ\ FHOOXODU DFWLYLWLHV WR VXSSRUW ERWK $G DQG $$9 SURGXFWLYH LQIHFWLRQV 7KH ( 25) JHQH SURGXFW LQFUHDVHV WKH GHJUDGDWLRQ RI F\FOLQ $ DQG LQKLELWV WKH NLQDVH DFWLYLW\ RI &GF WKDW SURPRWHV WKH FHOO WR UHPDLQ LQ ODWH 6 SKDVH RI WKH FHOO F\FOH 7KH LQGXFWLRQ LQWR 6 SKDVH ZLOO UHVXOW LQ WKH H[SUHVVLRQ RI PRUH '1$ UHSOLFDWLRQ SURWHLQV WKDW ZLOO FRQYHUW WKH VLQJOHVWUDQGHG YLUDO JHQRPHV LQWR GRXEOHVWUDQGHG '1$ WHPSODWHV )LQDOO\ WKH 9$ 51$V RI $GHQRYLUXV HQDEOH WKH LQLWLDWLRQ RI $$9 SURWHLQ V\QWKHVLV E\ RYHUFRPLQJ $G LQWHUIHURQLQGXFHG KRVW FHOO VKXWGRZQ RI WUDQVODWLRQ

PAGE 28

$$9 5HS 3URWHLQV 7KH $$9 JHQRPH KDV WKUHH GLIIHUHQW SURPRWHUV LGHQWLILHG E\ WKHLU PDS SRVLWLRQV RI S SO DQG S 7KH S DQG SO SURPRWHUV WUDQVFULEH WKH UHS RSHQ UHDGLQJ IUDPH 5HS DQG LWV DOWHUQDWLYHO\ VSOLFHG WUDQVFULSW 5HS DUH SURGXFHG IURP WKH S SURPRWHU 7KH 5HS DQG LWV VSOLFHG WUDQVFULSW 5HS DUH WUDQVFULEHG IURP WKH LQWHUQDO SO SURPRWHU 7KH ODUJHU 5HS SURWHLQV KDYH PDQ\ GLIIHUHQW DFWLYLWLHV GXULQJ $$9 LQIHFWLRQ f 5HS DQG 5HS KDYH VSHFLILF '1$ ELQGLQJ DFWLYLW\ VLWH DQG VWUDQGVSHFLILF HQGRQXFOHDVH DFWLYLW\ '1$ DQG 51$ KHOLFDVH DFWLYLW\ DQG DQ $73DVH DFWLYLW\ f ,Q WKH DEVHQFH RI DGHQRYLUXV FRLQIHFWLRQ WKH ODUJH 5HS SURWHLQV UHSUHVV WKH $$9 SURPRWHUV f +RZHYHU GXULQJ $G LQIHFWLRQ 5HS H[KLELW WKH GXDO DELOLWLHV RI WUDQVFULSWLRQDO UHSUHVVLRQ RQ WKH S SURPRWHU DQG WUDQVDFWLYDWLRQ IRU WKH S SL DQG S SURPRWHUV $GGLWLRQDOO\ D PRGHO RI $$9 UHSOLFDWLRQ KDV EHHQ SURSRVHG LQ ZKLFK WKH 5HS SURWHLQV DUH UHVSRQVLEOH IRU QLFNLQJ WKH WHUPLQDO UHSHDWV 7KH VLWHVSHFLILF HQGRQXFOHDVH DFWLYLW\ RI WKH ODUJHU 5HS SURWHLQV QLFN WKH WHUPLQDO UHSHDWV WKXV FUHDWLQJ D IUHH n2+ IRU $$9 JHQRPH UHSOLFDWLRQ ,Q FRQWUDVW WKH VPDOOHU 5HS DQG 5HS SURWHLQV KDYH IHZHU FKDUDFWHUL]HG DFWLYLWLHV GXULQJ $$9 UHSOLFDWLRQ ,Q WKH DEVHQFH RI DGHQRYLUXV LQIHFWLRQ WKHVH SURWHLQV KDYH WKH DELOLW\ WR UHSUHVV $$9 SURPRWHUV ZKLOH QRW H[KLELWLQJ DQ\ VLWH VSHFLILF '1$ ELQGLQJ DFWLYLW\ f 5HFHQWO\ 5HS KDV EHHQ VKRZQ WR H[KLELW $73DVH DQG KHOLFDVH DFWLYLW\ $GGLWLRQDOO\ WKH 5HS SURWHLQV KDYH EHHQ VKRZQ WR LQFUHDVH WKH OHYHOV RI VLQJOHVWUDQGHG PRQRPHU GXULQJ $$9 LQIHFWLRQ 6LQFH VLQJOH VWUDQGHG JHQRPH IRUPDWLRQ FRUUHODWHV ZLWK WKH SDFNDJLQJ RI $$9 SDUWLFOHV 5HS PD\ IXQFWLRQ LQ SDFNDJLQJ YLUDO SDUWLFOHV f 5HFHQWO\ .LQJ HW DO KDYH

PAGE 29

GHPRQVWUDWHG WKDW WKH 5HS KHOLFDVH DFWLYLW\ LV SUREDEO\ GLUHFWO\ LQYROYHG LQ $$9 SDFNDJLQJ f $$9 7UDQVFULSWLRQ ZLWKRXW $GHQRYLUXV 7KH S SURPRWHU LV WKH PRVW ZLGHO\ VWXGLHG SURPRWHU LQ WKH $$9 JHQRPH EHFDXVH RI LWV GLUHFW UROH LQ WKH VZLWFK EHWZHHQ ODWHQW DQG SURGXFWLYH LQIHFWLRQ LQ WKH YLUDO OLIHF\FOH 0DQ\ SUHYLRXV VWXGLHV GHPRQVWUDWHG WKDW QR WUDQVFULSWV DUH GHWHFWHG GXULQJ WKH ODWHQW VWDWH RI $$9 f 7KH LQLWLDO VWXGLHV RI WKH S SURPRWHU GHWHUPLQHG WKDW WKH SURPRWHU FRQWDLQHG D 0DMRU /DWH 7UDQVFULSWLRQ )DFWRU 0/7)f ELQGLQJ VLWH DQG D SUHYLRXVO\ XQNQRZQ HOHPHQW ZKLFK ZDV UHVSRQVLYH WR WKH (O $ WUDQVDFWLYDWRU RI DGHQRYLUXV 7KH VXEVHTXHQW FORQLQJ RI WKLV WUDQVFULSWLRQ IDFWRU UHVXOWHG LQ WKH LGHQWLILFDWLRQ RI WKH << SURWHLQ
PAGE 30

DOWHUDWLRQV RI WKH 5HS SURWHLQ VHTXHQFH LQ WKH $$9 JHQRPH ,Q RUGHU WR SUHYHQW WKLV SUREOHP WKH 5HS SURWHLQ ZDV VXSSOLHG LQ WUDQV E\ DQRWKHU SODVPLG SO6 ZKLFK FRQWDLQHG VLOHQW PXWDWLRQV LQ WKH 5HS SURWHLQ GRZQVWUHDP RI WKH SO DQG S VWDUW VLWHV 7R DQDO\]H WKH HIIHFWV RI WKH GHOHWLRQV ZLWKLQ WKH SL DQG S SURPRWHUV SULPHUV ZHUH VHOHFWHG WKDW ZRXOG GLVWLQJXLVK EHWZHHQ WKH SL DQG S PXWDQW SURPRWHU WUDQVFULSWV DQG WKH WUDQVFULSWV IURP WKH 5HS FRPSOHPHQWLQJ SODVPLG SO6 7KLV DOORZHG WKH PHDVXUHPHQW RI WUDQVFULSWV E\ SULPHU H[WHQVLRQ WKDW ZHUH V\QWKHVL]HG RQO\ IURP WKH SL DQG S SURPRWHU GHOHWLRQV 7KH GHOHWLRQ DQDO\VLV RI ERWK WKH SL DQG S SURPRWHUV ZDV SHUIRUPHG LQ D VHULHV RI FRQWLJXRXV ES LQWHUYDOV SUR[LPDO WR HDFK VWDUW VLWH )RU WKH SL SURPRWHU WZR VHSDUDWHG ES UHJLRQV ZHUH QHFHVVDU\ IRU WKH 5HSPHGLDWHG DFWLYLW\ 2QH UHJLRQ ZDV LGHQWLILHG EHWZHHQ SRVLWLRQV WR DQG WKH RWKHU ZDV WKH UHJLRQ IURP WR ERWK XSVWUHDP RI WKH SL VWDUW VLWH )LJ $f )RU WKH S SURPRWHU WZR UHJLRQV RI 5HS PHGLDWHG LQGXFWLRQ ZHUH LGHQWLILHG WKURXJK GHOHWLRQ DQDO\VLV 2QH UHJLRQ ZDV WKH LPPHGLDWHO\ XSVWUHDP ES UHJLRQ RI S ZKLOH WKH RWKHU UHJLRQ UHTXLUHG WKH WR UHJLRQ XSVWUHDP RI WKH SL SURPRWHU $QRWKHU GHOHWLRQ DQDO\VLV IRU ERWK SL DQG S SURPRWHUV ZHUH SHUIRUPHG E\ SURJUHVVLYHO\ ODUJHU SUR[LPDO n GHOHWLRQV 7KH LQLWLDO GHOHWLRQ QDPHG S,0 GOO HOLPLQDWHG WKH S SURPRWHU DQG UHVXOWHG LQ SL DQG S WUDQVFULSW OHYHOV WKDW ZHUH b RI ZLOG W\SH OHYHOV 7KLV GDWD UHYHDOHG D YLWDO HOHPHQW IRU WUDQVDFWLYDWLRQ RI WKH SL DQG S SURPRWHUV WKDW ZDV ZLWKLQ WKH S SURPRWHU UHJLRQ 6XEVHTXHQW VHULDO GHOHWLRQV UHVXOWHG LQ QR JUHDWHU 5HSPHGLDWHG LQGXFWLRQ RI SO RU S HOLPLQDWLQJ WKH SRVVLELOLW\ RI D WUDQVFULSWLRQ IDFWRU ELQGLQJ VLWH WKDW UHSUHVVHV WKH SL DQG S SURPRWHUV )LJ %f ,Q

PAGE 31

)LJ $$9 3URPRWHUV DQG 3URPRWHU 'HOHWLRQ $ $ SRUWLRQ RI WKH SODVPLG S,0 FRQWDLQLQJ ZLOG W\SH $$9 QXFOHRWLGHV WR LV VKRZQ ZLWK DQ H[SDQGHG YLHZ RI WKH SO DQG S SURPRWHUV 7KH UHODWLYH SRVLWLRQV RI WKH SO DQG S SURPRWHUV DUH VKRZQ E\ DUURZV 7KH ORFDWLRQV RI WKH ES GHOHWLRQV DUH GLDJUDPPHG E\ OLQHV GHQRWLQJ WKH QXFOHRWLGH SRVLWLRQ UHODWLYH WR WKH SURPRWHU LQLWLDWLRQ VLWH ZKLFK SUHFHGHV HDFK GHOHWLRQ %HORZ HDFK ES GHOHWLRQ WKH UHODWLYH VWUHQJWK RI WKDW VSHFLILF SURPRWHU PXWDQW LV VKRZQ DV D SUHFHQWDJH RI ZLOG W\SH SL RU S SURPRWHU DFWLYLW\ % 7KH SODVPLG S,0 LV VKRZQ ZLWK WKH 5HS FRGLQJ UHJLRQ VKDGHG 7KH UHODWLYH SRVLWLRQV RI WKH S SL DQG S SURPRWHUV DUH PDUNHG E\ DUURZV DQG WKH LQWURQ LV UHSUHVHQWHG E\ D EHQW DUURZ %HORZ S,0 WKH fGHOHWLRQV XVHG LQ WKDW VWXG\ DQG WKH $$9 UHVWULFWLRQ VLWHV XVHG LQ WKHLU FRQVWUXFWLRQ DUH VKRZQ LQ WKH GLDJUDP 7KH\ DUH GHVLJQDWHG E\ GO IROORZHG E\ WKH QXPEHUV RI $$9 QXFOHRWLGHV GHOHWHG 7KH UHODWLYH WUDQVFULSWLRQDO DFWLYLW\ RI HDFK SURPRWHU PXWDQW SODVPLG ZDV VKRZQ DV D SHUFHQWDJH RI WKH ZLOG W\SH S,0 SODVPLG VWUHQJWK

PAGE 32

? ? ? ? ? S S ;; bZW S S % 3 F SO0 3 S  I91 5HS ,,LU b ZW S S GO U GO I GO GO GO Q 6VW ,, + 6VW %DP 75 ‘‘ f§ U 9 75

PAGE 33

FRQWUDVW WKH ODVW WZR GHOHWLRQ FRQVWUXFWV QDPHG S,0 GOO DQG S,0 GO GLIIHU RQO\ E\ WKH SUHVHQFH RI D WHUPLQDO UHSHDW 7KH SUHVHQFH RI WKH WHUPLQDO UHSHDW FDXVHG WKH 5HSPHGLDWHG LQGXFWLRQ RI WKH S SURPRWHU DW ZLOG W\SH OHYHOV 7KH H[DFW GHWHUPLQDWLRQ RI WKH WUDQVFULSWLRQ IDFWRUV SUR[LPDO RI WKH SL SURPRWHU ZDV SHUIRUPHG E\ '1DVH SURWHFWLRQ 7KLV ELRFKHPLFDO DQDO\VLV LGHQWLILHG WKH WUDQVFULSWLRQ HOHPHQWV 63 **7 63 DQG &$U* VLWHV UHODWLYH WR WKH SL VWDUW VLWH f 'LUHFW GHWHUPLQDWLRQ IRU VRPH RI WKHVH SURWHFWHG UHJLRQV DV WUXH 63 ELQGLQJ VLWHV ZDV SHUIRUPHG E\ FRPSHWLWLYH JHO VKLIWV XVLQJ 63 ROLJRV DQG ODEHOHG ZW $$9 IUDJPHQWV $V D UHVXOW WKH DQG VLWHV ZHUH SRVLWLYHO\ LGHQWLILHG DV 63 ELQGLQJ VLWHV XSVWUHDP RI WKH SL SURPRWHU 7KH &$U* VLWH UHPDLQHG ERXQG GXULQJ FRPSHWLWLYH JHO VKLIW DVVD\V FRQWDLQLQJ D VHUXP UHVSRQVH HOHPHQW 65(f WKDW QRUPDOO\ FRQWDLQV DXWKHQWLF &$U*OLNH HOHPHQWV 7KH QH[W VWHS LQ WKH &$U* LGHQWLILFDWLRQ SURFHGXUH ZDV DQ 89 FURVVOLQNLQJ H[SHULPHQW ZKLFK LGHQWLILHG D SURWHLQ ODUJHU WKDQ N'D 7KH FRPELQDWLRQ RI D &$U*OLNH ELQGLQJ VLWH DQG D SURWHLQ PDVV RI N'D LQGLFDWHG D SUHYLRXVO\ XQFKDUDFWHUL]HG SURWHLQ $IWHU WKH LGHQWLILFDWLRQ RI HDFK ELQGLQJ VLWH WKH DFWXDO LQ YLYR IXQFWLRQ IRU HDFK VLWH RQ SL DFWLYLW\ ZDV WHVWHG XVLQJ PXWDQWV LQ HDFK WUDQVFULSWLRQ IDFWRU VLWH ,Q RUGHU WR GR WKLV LQ YLYR WKH SO6 FRPSOHPHQWDWLRQ DVVD\ ZDV XVHG WR FRPSDUH WKH HIIHFW RI 5HSPHGLDWHG LQGXFWLRQ RQ HDFK SL SURPRWHU PXWDQW 7KH DYHUDJH SL WUDQVFULSW OHYHO XVLQJ WKH ZW $$9 JHQRPH ZLWKRXW WHUPLQDO UHSHDWV S,0f FRPSOHPHQWHG ZLWK SO6 ZDV QRUPDOL]HG WR RQH 7KH UDWLR RI SL WUDQVFULSWV LQ HDFK RI WKH SL SURPRWHU PXWDQWV ZLWK RU ZLWKRXW 5HS SO6 ZDV FDOFXODWHG WR GHWHUPLQH ZKLFK HOHPHQWV ZHUH UHVSRQVLEOH IRU 5HSPHGLDWHG LQGXFWLRQ ,I WKH UDWLR ZDV UHODWLYHO\ XQDIIHFWHG WKH SO HOHPHQW ZRXOG EH YLWDO IRU 5HS

PAGE 34

PHGLDWHG LQGXFWLRQ RI SL )URP WKLV GDWD RQO\ WZR VLWHV ZHUH JUHDWO\ DIIHFWHG E\ WKH 5HS SO6 LQGXFWLRQ RI WKH SL SURPRWHU 7KHVH WZR VLWHV ZHUH WKH 63 DQG &$U* (DFK UHVXOWHG LQ WKH UHGXFWLRQ RI SO WUDQVFULSWV WR b RI ZW SL SURPRWHU OHYHOV $QDO\VLV RI WKH S SURPRWHU E\ 'QDVH SURWHFWLRQ DVVD\ GHWHUPLQHG D QXPEHU RI SURWHFWHG HOHPHQWV 7KHVH HOHPHQWV ZHUH LGHQWLILHG DV $3, 63 **7 DQG 0/7) ELQGLQJ VLWHV 7ZR DGGLWLRQDO ELRFKHPLFDO DVVD\V FRPSHWLWLYH JHO VKLIW DQDO\VLV DQG 89 FURVVOLQNLQJ ZHUH SHUIRUPHG WR FRQILUP WKH LGHQWLW\ RI WKH VLWHV 7KH FRPELQDWLRQ RI WKHVH WZR SURFHGXUHV GHWHUPLQHG WKDW WKH 63 **7 DQG 0/7) VLWHV GLG KDYH WUDQVFULSWLRQ IDFWRU ELQGLQJ DFWLYLWLHV 7R WHVW WKH 5HSPHGLDWHG UHVSRQVH RI WKH S SURPRWHU LQ YLYR WUDQVFULSWLRQ IDFWRU ELQGLQJ PXWDQWV ZHUH SURGXFHG IRU HDFK VLWH 8VLQJ WKH SO6 FRPSOHPHQWDWLRQ DVVD\ 5HS LQGXFWLRQ GHSHQGHG RQO\ RQ WKH 63 DQG 7$7$ ELQGLQJ VLWHV $GGLWLRQDOO\ WKH S DFWLYLW\ ZDV GHSHQGHQW RQ WKH &$U* HOHPHQW RI SO FRUUHODWLQJ GLUHFWO\ ZLWK WKH SUHYLRXV WR ES S SURPRWHU GHOHWLRQ PXWDQW f 7KLV H[WHQVLYH GHOHWLRQ DQDO\VLV GHWHUPLQHG WKDW WKH 5HSPHGLDWHG LQGXFWLRQ RI ERWK WKH S DQG S SURPRWHUV UHTXLUHG WKUHH VHSDUDWH HOHPHQWV 2QH UHTXLUHG UHJLRQ LV WKH SUR[LPDO 63 HOHPHQW DW RU LQ IURQW RI HDFK SURPRWHU $QRWKHU HOHPHQW LV D FRPPRQ WR S UHJLRQ GHILQHG DV WKH &$U* VLWH 7KH WKLUG DQG ILQDO HOHPHQW DSSHDUV WR EH D 5%( WKDW FDQ EH ORFDWHG LQ HLWKHU WKH OHIW WHUPLQDO UHSHDWnV $VWHP 5%( RU WKH S5%( 7R GLVWLQJXLVK EHWZHHQ WKH HIIHFWV RI HLWKHU WKH S5%( RU WKH $VWHP 5%( RQ WKH $$9 SURPRWHUV D VHULHV RI 5%( PXWDQWV ZHUH FUHDWHG WR GHILQH 5HSPHGLDWHG HOHPHQWV

PAGE 35

UHVSRQVLEOH IRU WUDQVDFWLYDWLRQ RI WKH S SL DQG S SURPRWHUV 7KH $$9 JHQRPLF VXEFORQH ODFNLQJ WHUPLQDO UHSHDWV S,0f ZDV QRUPDOL]HG WR RQH IRU WUDQVFULSW OHYHOV IURP HDFK SURPRWHU 7KH ILUVW PXWDQW WDUJHWHG WKH S5%( $V UHVXOW WKH S SURPRWHU WUDQVFULSWLRQ LQFUHDVHG E\ IROG ZKLOH WKH SL DQG S SURPRWHUV GHFUHDVHG E\ IROG 7KLV UHVXOW LQGLFDWHG WKH S5%( KDG D UHSUHVVLYH HIIHFW RQ WKH S SURPRWHU ZKLOH VLPXOWDQHRXVO\ WUDQVDFWLYDWLQJ WKH SO DQG S SURPRWHUV 7KH QH[W 5%( FRQVWUXFW KDG DQ LQWDFW ZLOG W\SH S5%( DQG D ZLOG W\SH $VWHP 5%( UHVHPEOLQJ WKH IXOO\ IXQFWLRQDO $$9 WHUPLQDO UHSHDW 7KLV FRQVWUXFW UHVWRUHG WKH SL DQG S WUDQVFULSWV WR S,0 OHYHOV ZKLOH UDLVLQJ WKH S SURPRWHU WR IROG 7KH ILQDO FRQVWUXFW KDG D ZLOG W\SH $ VWHP 5%( DQG D PXWDWHG S5%( $V D UHVXOW WKLV FRQVWUXFW H[KLELWHG D IROG LQFUHDVH LQ WKH OHYHO RI S WUDQVFULSWV UHODWLYH WR WKH S,0 VXEFORQH $GGLWLRQDOO\ WKH SL DQG S SURPRWHUV KDG D IROG LQFUHDVH LQ WUDQVFULSWLRQ FRPSDUHG WR S,0 OHYHOV 7KLV ODVW FRQVWUXFW VKRZHG WKH S5%( KDG D GLUHFW UHSUHVVLYH HIIHFW RQ S WUDQVFULSWLRQ ZKLOH WKH PRUH GLVWDO $VWHP 5%( WUDQVDFWLYDWHG WKH S SURPRWHU +RZHYHU WKH S5%( DQG WKH $VWHP 5%( DSSHDU WR EH HTXLYDOHQW DQG UHGXQGDQW WUDQVFULSWLRQDO HOHPHQWV LQ 5HS PHGLDWHG WUDQVDFWLYDWLRQ RI WKH SO DQG S SURPRWHUV 'XULQJ DGHQRYLUXV LQIHFWLRQ 5HS RU 5HS DSSHDUHG WR EHKDYH DV D WUDQVFULSWLRQ IDFWRU WKDW FDQ EH ERWK D UHSUHVVRU RI Sf DQG D WUDQVDFWLYDWRU RI SO DQG Sf $QDO\VLV RI WKH 5HS ELQGLQJ DELOLWLHV RQ ERWK WKH WHUPLQDO UHSHDW 5%( DQG WKH S5%( VKRZ WKDW HLWKHU WKH 5HS RU 5HS SURWHLQV ZHUH UHTXLUHG IRU WUDQVDFWLYDWLRQ RI WKH WKUHH $$9 SURPRWHUV 7KH 5HS DQG 5HS SURWHLQV ZHUH NQRZQ WR LQWHUDFW EXW QR DQDO\VLV KDG EHHQ SHUIRUPHG RQ WKH DELOLW\ RI WKH ODUJHU 5HSV WR ELQG HLWKHU 5HS RU DQ\ FHOOXODU SURWHLQV 7KH LQLWLDO DQDO\VLV IRU ODUJH DQG VPDOO 5HS LQWHUDFWLRQ ZDV

PAGE 36

SHUIRUPHG XVLQJ LPPXQRSUHFLSLWDWLRQ DJDLQVW WKH ODUJHU 5HS SURWHLQ GRPDLQV DQG E\ GHWHFWLQJ DQ\ 5HS SURWHLQV ZLWK DQ DQWLERG\ DJDLQVW WKH FRPPRQ 5HS SURWHLQ FDUER[\ WHUPLQDO HQG )URP WKLV LPPXQRSUHFLSLWDWLRQ WKH ODUJHU 5HS SURWHLQV ZHUH RQO\ DEOH WR SUHFLSLWDWH WKH 5HS SURWHLQ 7KH LQ YLYR LQWHUDFWLRQ EHWZHHQ WKH ODUJH 5HS DQG SURWHLQV DQG 5HS LQGLFDWHG D PHWKRG RI LQWHUDFWLRQ EHWZHHQ WKH 5HS ELQGLQJ HOHPHQW ZLWKLQ WKH 75 DQG WKH S5%( WKH ODUJH 5HS SURWHLQV DQG WKH VPDOOHU 5HS SURWHLQ 7R GHWHFW 5HS HIIHFWV RQ WKH S5%( D S SURPRWHU &$7 FRQVWUXFW ZDV FRn WUDQVIHFWHG ZLWK D FRQVWDQW DPRXQW RI 5HSH[SUHVVLQJ SODVPLG DQG LQFUHDVLQJ DPRXQWV RI D 5HS SODVPLG 7KH UHVXOW RI WKLV WLWUDWLRQ ZDV WKH GHUHSUHVVLRQ RI WKH S SURPRWHU WKURXJK DQ LQFUHDVLQJ JUDGLHQW RI 5HS FRQFHQWUDWLRQ $QRWKHU VXVSHFWHG 5HS LQWHUDFWLRQ ZDV WKH FRPPRQ 63 ELQGLQJ VLWH WKDW LV FRQVHUYHG ZLWKLQ WKH SDUYRYLUXV IDPLO\ 7KH LQLWLDO DQDO\VLV RI D 5HS DQG 63 LQWHUDFWLRQ ZDV SHUIRUPHG XVLQJ D JHO VXSHUVKLIW DVVD\ ZLWK DQ 6SO ELQGLQJ VLWH 7KH SRVLWLYH VXSHUVKLIWLQJ JHO IUDJPHQW LQGLFDWHG D GLUHFW UROH IRU WKH 5HS LQWHUDFWLRQ ZLWK 6SO 7UDQVDFWLYDWLRQ RI WKH S DQG S SURPRWHUV FRXOG UHVXOW IURP WKH 5HS ERXQG WR WKH XSVWUHDP 5%(V DQG HDFK RI WKH 63 ELQGLQJ VLWHV SUR[LPDO WR HDFK SURPRWHU ,Q RUGHU WR WHVW D PRGHO IRU '1$ ORRSLQJ DQ $$9 JHQRPH IUDJPHQW FRQWDLQLQJ WKH S5%( DQG WKH 63 SL ZDV LQFXEDWHG ZLWK SXULILHG 5HS DQG 63 SURWHLQV 7KH PL[WXUH ZDV H[DPLQHG E\ HOHFWURQ PLFURVFRS\ DQG DQDO\]HG E\ GLJLWL]HG PHDVXUHPHQWV 7KHVH PHDVXUHPHQWV VKRZHG D FRQVHUYHG '1$ ORRSLQJ VWUXFWXUH FRUUHODWLQJ WR WKH GLUHFW LQWHUDFWLRQ EHWZHHQ WKH ODUJH 5HS SURWHLQV ERXQG DW WKH S5%( DQG WKH 6SO SURWHLQ DW WKH SL ELQGLQJ VLWH

PAGE 37

0RGHO IRU $FWLYDWLRQ RI DQ $$9 3URGXFWLYH ,QIHFWLRQ IURP /DWHQF\ )RU WKLV PRGHO WKH SURYLUDO VWUXFWXUH RI $$9 LV OLPLWHG WR RQH SUR[LPDO WHUPLQDO UHSHDW FRQWDLQLQJ D VLQJOH $VWHP 5%( VLWH 7KH FHOOXODU << DQG 0/7) WUDQVFULSWLRQ IDFWRUV DUH ERXQG WR WKHLU VLWHV ZLWKLQ WKH S SURPRWHU ,Q WKH DEVHQFH RI DGHQRYLUXV LQIHFWLRQ << ERXQG DW WKH SRVLWLRQ RI WKH S SURPRWHU DFWV DV VWURQJ UHSUHVVRU RI 5HS WUDQVFULSWLRQ )LJ $f f 7KH VSHFLILF DFWLYLW\ RI WKH << ELQGLQJ SUHYHQWV DQ\ WUDQVDFWLYDWLRQ RI WKH S SL RU S SURPRWHUV WKURXJK HLWKHU WKH WHUPLQDO UHSHDW RU WKH S5%( 'XULQJ DGHQRYLUXV LQIHFWLRQ WKH $G HDUO\ SURWHLQV DUH UHVSRQVLEOH IRU WKH VZLWFK EHWZHHQ $$9 ODWHQF\ DQG SURGXFWLYH LQIHFWLRQ 7KH (O $ WUDQVDFWLYDWLQJ SURWHLQ SURYLGHV WKH ILUVW KHOSHU IXQFWLRQ IRU $$9 WUDQVFULSWLRQ 7KH (O $ SURWHLQ KDV WKUHH FRQVHUYHG GRPDLQV IRU LQWHUDFWLRQ ZLWK FHOOXODU FHOO F\FOH FRQWURO SURWHLQV 7KH (O $ &5 DQG &5 UHJLRQV ELQG WKH S5% DQG SL SURWHLQV ([SUHVVLRQ RI WKH DGHQRYLUXV (O $ SURWHLQ SUHYHQWV ()S5% FRPSOH[ IRUPDWLRQ () GLVSODFHPHQW DOORZV WKH SURWHLQ WR DFW DV D WUDQVFULSWLRQ IDFWRU IRU PDQ\ FHOOXODU UHSOLFDWLRQ SURWHLQV +RZHYHU WKH &5 UHJLRQ RI (O $ LQWHUDFWV ZLWK WKH S SURWHLQ LQ LQIHFWHG FHOOV 7KLV SK\VLFDO LQWHUDFWLRQ EHWZHHQ (O $ DQG S LV LPSRUWDQW EHFDXVH WKH << UHSUHVVRU SURWHLQ KDV EHHQ VKRZQ SUHYLRXVO\ WR ELQG S 7KH ODVW DPLQR DFLGV RI << DUH UHVSRQVLEOH IRU WKLV LQWHUDFWLRQ DQG << ELQGLQJ PXWDQWV DUH XQDEOH WR VKRZ DQ (O$PHGLDWHG UHVSRQVH $V D UHVXOW WKH (O $ SURWHLQ ELQGV VSHFLILFDOO\ ZLWK D S<
PAGE 38

)LJ /RVV RI $$9 3URPRWHU 5HSUHVVLRQ WKURXJK $GHQRYLUXV ,QIHFWLRQ $ ,Q WKH DEVHQFH RI $GHQRYLUXV LQIHFWLRQ << DQG 5HS SURWHLQV ERXQG DW WKH S SURPRWHU DFW DV VWURQJ UHSUHVVRUV RI $$9 JHQH H[SUHVVLRQ % GXULQJ $GHQRYLUXV LQIHFWLRQ WKH $G (O $ SURWHLQ ELQGV WR WKH << SURWHLQV DQG FRQYHUWV WKHLU IXQFWLRQ DV UHSUHVVRUV WR DFWLYDWRUV RI $$9 JHQH H[SUHVVLRQ

PAGE 39

e

PAGE 40

HOHPHQW 7KH << LQLWLDWRU HOHPHQW ELQGV WR '1$ DQG LQWHUDFWV ZLWK WKH 7),,% FRPSOH[ 7KH << SURWHLQ LV VWDELOL]HG E\ LWV 7),,% LQWHUDFWLRQ IDFLOLWDWLQJ SUHLQLWLDWLRQ FRPSOH[ IRUPDWLRQ DW WKH S SURPRWHU f ,QGXFWLRQ RI WKH S SURPRWHU UHVXOWV LQ WKH LQFUHDVHG FHOOXODU FRQFHQWUDWLRQ RI 5HS 7KHVH WZR SURWHLQV ELQG WKH 5%(V ZLWKLQ WKH $$9 JHQRPH DV D GLUHFW IXQFWLRQ RI WKHLU LQFUHDVHG FRQFHQWUDWLRQV 7KH ILUVW 5%( ERXQG LV WKH WHUPLQDO UHSHDW $ VWHP 7KH ELQGLQJ RI 5HS DQGRU 5HS WUDQVDFWLYDWHV WKH S SL DQG S SURPRWHUV $V D GLUHFW UHVXOW WKH OHYHOV RI ODUJHU 5HSV DUH LQFUHDVHG WKURXJK WUDQVFULSWLRQDO DFWLYDWLRQ )LJ $f ,Q DGGLWLRQ WKH 5HS DQG FDSVLG SURWHLQV DUH LQFUHDVHG E\ WKH $VWHP 5%( WUDQVDFWLYDWLRQ XSRQ WKH S DQG S SURPRWHUV 5HS LV VKRZQ WR VSHFLILFDOO\ ELQG WKH S5%( DQG WUDQVDFWLYDWH WKH SL DQG S SURPRWHUV $IWHU S5%( ELQGLQJ WKH S WUDQVFULSWLRQ OHYHOV GHFUHDVH ZKLOH SL DQG S WUDQVFULSWLRQ OHYHOV LQFUHDVH )LJ %f $V WKH UHODWLYH OHYHOV RI S DQG S SURPRWHU GLUHFWHG WUDQVFULSWLRQ LQFUHDVH WKH 5HS DQG 5HS SURWHLQV DOOHYLDWH WKH UHSUHVVLRQ RQ WKH S SURPRWHU 3UHYLRXV VWXGLHV LQ RXU ODE GHPRQVWUDWHG FRPSOH[ IRUPDWLRQ EHWZHHQ WKH 5HS SURWHLQV DQG 5HS ,Q DGGLWLRQ WKH 5HS SURWHLQV UHSUHVV WKH S SURPRWHU +RZHYHU WLWUDWLRQ RI LQFUHDVLQJ OHYHOV RI 5HS FDXVHV GHUHSUHVVLRQ RI WKH S SURPRWHU 7KH SUHVHQW PRGHO VXSSRUWV D IHHGEDFN PHFKDQLVP LQ ZKLFK WKH ULVLQJ DPRXQWV RI 5HS DFW RQ WKH 5HS SURWHLQV ERXQG DW WKH S5%( 7KH 5HS SURWHLQ ZRXOG FDXVH DQ DOWHUDWLRQ RI WKH ODUJH 5HSV RQ WKH S5%( WR HOLPLQDWH UHSUHVVLRQ RI WKH S SURPRWHU )LJ &f 7KLV IHHGEDFN ORRS PRGHO EHWZHHQ WKH SURGXFWV RI WKH S DQG S SURPRWHUV FUHDWHV D VWHDG\VWDWH OHYHO RI WUDQVFULSWV 7KH PRODU WUDQVFULSW UDWLRV RI IRU WKH

PAGE 41

)LJ 0RGHO RI 5HS )HHGEDFN 5HJXODWLRQ EHWZHHQ WKH S DQG SO 3URPRWHUV $ 5HS ERXQG WR 75 $VWHP VHTXHQFH WUDQVDFWLYDWHV WKH S SL DQG S SURPRWHUV % ,QFUHDVH RI 5HS SURWHLQ FRQFHQWUDWLRQ DOORZV 5HS ELQGLQJ WR S SURPRWHU UHSUHVVLQJ WKH S SURPRWHU 5HS ERXQG DW S SURPRWHU WUDQVDFWLYDWHV WKH SL DQG S SURPRWHUV & +LJKHU SL WUDQVFULSWLRQ FUHDWHV PRUH 5HS SURWHLQ ZKLFK GHUHSUHVVHV WKH S SURPRWHU

PAGE 43

S SL DQG S SURPRWHUV PDLQWDLQ IRXU UHODWLRQVKLSV )LUVW WKH ORZHU OHYHO RI S WUDQVFULSWLRQ FUHDWHV HQRXJK 5HS WR UHVROYH WKH WHUPLQDO UHSHDWV ZKLOH SUHYHQWLQJ H[FHVV HQGRQXFOHDVH DQG KHOLFDVH DFWLYLW\ IURP HOLPLQDWLQJ DQ\ WUDQVFULSWLRQDOO\ FRPSHWHQW $$9 JHQRPHV 6HFRQG WKH LQFUHDVLQJ 5HS OHYHOV DUH DXWRUHJXODWHG E\ WKHLU UHSUHVVLRQ RI WKH S SURPRWHU 7KLUG WKH V\QWKHVLV RI KLJKHU OHYHOV RI 5HS WUDQVFULSWV UHVXOWLQJ IURP S5%( WUDQVDFWLYDWLRQ FDXVHV WKH GHUHSUHVVLRQ RI WKH S SURPRWHU WKHUHE\ LQFUHDVLQJ WKH 5HS OHYHOV )RXUWK WKH S SURPRWHU LV UHODWLYHO\ XQDIIHFWHG E\ WKLV IHHGEDFN LQKLELWLRQ DOORZLQJ FRQVWDQW WUDQVDFWLYDWLRQ RI S DQG V\QWKHVLV RI WKH FDSVLG WUDQVFULSWV

PAGE 44

&+$37(5 0$7(5,$/6 $1' 0(7+2'6 &HOO /LQHV DQG 9LUXV +XPDQ $ FHOOV $7&& &&/ f ZHUH PDLQWDLQHG LQ 'XOEHFRfV PRGLILHG HVVHQWLDO PHGLD '0(0 *LEFR %5/f FRQWDLQLQJ b ERYLQH FDOI VHUXP %&6 +\&ORQH /DERUDWRULHV ,QFf DW r& LQ PP FXOWXUH GLVKHV $GHQRYLUXV ZDV JURZQ DQG WLWHUHG RQ FHOOV 3ODVPLGV 7KH S&$7 SODVPLG LV WKH VDPH DV WKH S&$7 SODVPLG GHVFULEHG E\ &KDQJ HW DO f DQG ZDV NLQGO\ SURYLGHG E\ 7RP 6KHQN ,W FRQWDLQV $$9 QXFOHRWLGHV IROORZHG E\ WKH &$7 H[SUHVVLRQ FDVVHWWH 7KH S,0 SODVPLG FRQWDLQV WKH $$9 QXFOHRWLGHV LQ D S%6 0O YHFWRU 6WUDWDJHQH &RUSRUDWLRQf ,W HVVHQWLDOO\ FRQWDLQV DOO RI WKH $$9 JHQRPH H[FHSW IRU WKH WHUPLQDO UHSHDWV S$;; LV D PRGLILHG S,0 SODVPLG LQ ZKLFK VWRS FRGRQV KDYH EHHQ LQVHUWHG E\ VLWH VSHFLILF PXWDJHQHVLV DW 5HS DPLQR DFLG DQG DW 5HS DPLQR DFLG 7KXV S$;; LV LQFDSDEOH RI SURGXFLQJ HLWKHU S RU SL 5HS SURWHLQV DQG LW ZDV XVHG IRU WKH FRQVWUXFWLRQ RI DOO RI WKH &$7 FRQWDLQLQJ SODVPLGV EHORZ S$;; S,0 DQG DOO RWKHU SODVPLGV XVHG LQ WKLV VWXG\ ZHUH VHTXHQFHG WR LQVXUH WKDW WKH $$9 VHTXHQFHV ZHUH FRUUHFW DQG WR FRQILUP WKH SRVLWLRQV RI WKH PXWDWLRQV 7KH SO&$7 SODVPLG ZDV FUHDWHG E\ LQVHUWLQJ V\QWKHWLF ROLJRQXFOHRWLGHV ZLWKLQ WKH S&$7%$6,& SODVPLG 3URPHJD &RUSRUDWLRQf WKDW WRJHWKHU UHFRQVWUXFWHG WKH

PAGE 45

HVVHQWLDO HOHPHQWV RI WKH S SURPRWHU 7KH SL V\QWKHWLF VHTXHQFH ZDV FUHDWHG ZLWK WKUHH SDLUV RI ROLJRQXFOHRWLGHV WKDW ZHUH DQQHDOHG DQG WKHQ OLJDWHG WRJHWKHU 7KH ILUVW ROLJRQXFOHRWLGH SDLU F$$3f KDG WKH VHTXHQFH n &*7&$&$$$*$&&$*$$$7**&*&&*7&7&*$*7*$&$$77n WKDW FRQWDLQV $$9 QXFOHRWLGHV ZLWK D PXWDWLRQ WKDW GHVWUR\V WKH 63 ELQGLQJ VLWH DQG FRQYHUWV LW LQWR DQ ;KRO UHVWULFWLRQ VLWH 7KH VHFRQG SDLU RI ROLJRQXFOHRWLGHV SO;ED6DFf KDG WKH VHTXHQFH n &7$*$7&&*$7*$*7*&7$&$7&&&&$$77$&77*&7&&&&$$$$&&&$*&&7 *$*&7n WKDW FRQWDLQV $$9 QXFOHRWLGHV ZLWK WKH **7 ELQGLQJ VLWH FRQYHUWHG LQWR DQ ;EDO UHVWULFWLRQ VLWH 7KH WKLUG SDLU RI ROLJRQXFOHRWLGHV 63&$7f KDG WKH VHTXHQFH n &&$*7***&*7**$&&&*&****$$&$*7$777$$*&*&&7$n WKDW FRQWDLQHG $$9 QXFOHRWLGHV ZLWK WKH 7$7$ VLWH PXWDWHG LQWR D 6DF,, UHVWULFWLRQ VLWH 7KH 6SO **7 DQG 7$7$ VLWHV KDG EHHQ VKRZQ SUHYLRXVO\ WR KDYH OLWWOH HIIHFW RQ SO WUDQVFULSWLRQ $OO WKUHH ROLJRQXFOHRWLGH SDLUV ZHUH KHDWHG WR r& DQG DQQHDOHG WRJHWKHU E\ VORZO\ FRROLQJ WR URRP WHPSHUDWXUH 7KH\ ZHUH WKHQ OLJDWHG XVLQJ 7 '1$ OLJDVH /LIH 7HFKQRORJLHVf $IWHU OLJDWLRQ D VPDOO DPRXQW RI WKH '1$ SURGXFW ZDV XVHG DV WHPSODWH LQ D 3&5 UHDFWLRQ SHUIRUPHG ZLWK WZR SULPHUV SO;PD, n $7$&&&***&$&$$$*$&&$*$$$7**&*n DQG SO%JO,, n $7$$*$7&7&*7*$*$77&$$$&$**&*&77n 7KH 3&5 UHDFWLRQ DPSOLILHG WKH V\QWKHWLF SL SURPRWHU ZKLFK ZDV GLJHVWHG ZLWK ;PDO DQG %JOOO DQG FORQHG LQWR S&$7%$6,& 3URPHJD &RUSf YHFWRU WKDW KDG EHHQ GLJHVWHG ZLWK WKH VDPH UHVWULFWLRQ HQ]\PHV

PAGE 46

7KH SO&$7 SODVPLG ZDV FUHDWHG E\ VXEFORQLQJ DQ ROLJRQXFOHRWLGH FRQWDLQLQJ WKH ZLOG W\SH S SURPRWHU 5HS ELQGLQJ HOHPHQW S5%(f VHTXHQFH f $$*&&&*$*7*$*&$&*&$***7&7$*7$&7 f LQWR WKH %VD$, UHVWULFWLRQ VLWH RI WKH SO&$7 SODVPLG QXFOHRWLGHV XSVWUHDP RI WKH VWDUW RI WUDQVFULSWLRQ RI SL 7KH SO&$7 SODVPLG ZDV FUHDWHG E\ VXEFORQLQJ WKH ZLOG W\SH S5%( VHTXHQFH LQWR WKH 0OXO VLWH DW WKH VLWH RI SO&$7 7KH SO&$7 SODVPLG ZDV FUHDWHG E\ VXEFORQLQJ WKH ZLOG W\SH S5%( VHTXHQFH LQWR WKH ;KRO VLWH DW WKH VLWH RI SO&$7 7KH SO&$7 SODVPLG ZDV FUHDWHG E\ VXEFORQLQJ WKH S5%( VHTXHQFH LQWR WKH %JOOO VLWH DW WKH QXFOHRWLGH VLWH RI SO&$7 7KH SO&$7 SODVPLG ZDV FUHDWHG E\ VXEFORQLQJ WKH S5%( VHTXHQFH LQWR WKH VLWH RI SO&$7 7KH S,0&$7 SODVPLG ZDV FRQVWUXFWHG E\ ILUVW GLJHVWLQJ S$;; ZLWK %HOO ZKLFK FOHDYHV DW $$9 QXFOHRWLGH 7KH OLQHDU S$;; '1$ ZDV OLJDWHG WR WKH %DP+, DQG %HOO IUDJPHQW RI SF'1$f&$7 ,QYLWURJHQ &RUSRUDWLRQf ZKLFK FRQWDLQV WKH &$7 JHQH S,0 FRQWDLQV $$9 QXFOHRWLGHV LQFOXGLQJ DOO RI WKH S DQG SO SURPRWHUVf IROORZHG E\ WKH &$7 JHQH 7KH SVXE&$7 SODVPLG ZDV FUHDWHG LQ WKH VDPH ZD\ E\ OLJDWLRQ RI WKH %DP+, DQG %HOO IUDJPHQW IURP SF'1$f&$7 LQWR WKH SVXE SODVPLG ZKLFK FRQWDLQV D PXWDQW S 5%( 7KH S,0&$7SRO\ $ SODVPLG ZDV FUHDWHG LQ WZR VWHSV 7KH 6PDO WR 1UXO IUDJPHQW IURP S$;; FRQWDLQLQJ WKH $$9 S SURPRWHU DV ZHOO DV D SRUWLRQ RI WKH 5HS JHQH $$9 ES f ZDV LQVHUWHG LQWR WKH %VD$, VLWH RI SO&$7 WKLV SODVPLG ZDV FDOOHG SBSO&$7 7KHQ WKH 6PDO DQG 6ILO IUDJPHQW IURP WKH SBSO&$7 SODVPLG FRQWDLQLQJ $$9 ES DQG WKH ODWH SRO\DGHQ\ODWLRQ VLJQDO RI 69f ZDV VXEVWLWXWHG IRU WKH 1UXO WR 6ILO IUDJPHQW FRQWDLQLQJ $$9 QXFOHRWLGHV f LQ WKH S,0&$7 YHFWRU 7KH UHVXOWLQJ S,0&$7SRO\ $ FRQWDLQHG $$9 QXFOHRWLGHV

PAGE 47

IROORZHG E\ WKH 69 ODWH SRO\ $ VLWH ESf IROORZHG E\ $$9 QXFOHRWLGHV IURP SO&$7 FRQWDLQLQJ VXEVWLWXWLRQV DW 6SO **7 DQG 7$7$ IROORZHG E\ WKH &$7 JHQH 7KH [*$/ SODVPLG ZDV FUHDWHG E\ VLWHGLUHFWHG PXWDJHQHVLV RI WKH S5%( DQG WKH SL 63 VLWHV RI S,0&$7 WR *$/ '1$ ELQGLQJ VLWHV 7KH S5%( ZLWKLQ S,0&$7 ZDV PXWDWHG WR D *$/ '1$ ELQGLQJ HOHPHQW XVLQJ WKH ROLJRQXFOHRWLGH VHTXHQFH f *&*$&$&&$7*7**7&$&*&7***&&*&**&**$$*$&7&7&&7&&*$***7 &7&&f 7KH SO SURPRWHU 63 VLWH ZLWKLQ S,0&$7 ZDV PXWDWHG WR D *$/ '1$ ELQGLQJ VLWH XVLQJ WKH ROLJRQXFOHRWLGH VHTXHQFH f &&&&$$77$&77*&7&&&&$$$$&7&$*&&7*&**$$*$&7&7&&7&&*$&7$ $7$7**f 7KH S0 SODVPLG H[SUHVVHG D IXVLRQ SURWHLQ RI WKH *$/ '1$ ELQGLQJ GRPDLQ DQG WKH PRXVH S SURWHLQ FRQWDLQLQJ S DPLQR DFLGV WR ,W ZDV VXSSOLHG LQ WKH 0DPPDOLDQ 0$7&+0$.(5 7ZR+\EULG $VVD\ .LW &ORQWHFK /DERUDWRULHVf 7KH S0 7J SODVPLG FRQWDLQV WKH *$/ '1$ ELQGLQJ GRPDLQ IXVHG WR 69 7 DQWLJHQ DPLQR DFLGV 7KH 69 7DQWLJHQ '1$ IUDJPHQW FRQWDLQLQJ DPLQR DFLGV WR ZDV UHPRYHG IURP WKH S937 SODVPLG &ORQWHFK /DERUDWRULHVf E\ (FR5, DQG 6DLO GLJHVWLRQ DQG LQVHUWHG E\ GLUHFWLRQDO FORQLQJ LQWR (FR5, DQG 6DLO GLJHVWHG S0 SODVPLG &ORQWHFK /DERUDWRULHVf 7KH [*$/ VXE0/7) SODVPLG ZDV FUHDWHG E\ VLWHGLUHFWHG PXWDJHQHVLV RI S,0&$7 [*$/ XVLQJ WKH ROLJRQXFOHRWLGH f **7 &7 $* $**7 &&7 *7 $77 $* $7 $& $& *&*7 *7&*7777 *&* $& $7777*&* $ &$&&f WKDW UHVXOWHG LQ WKH UHSODFHPHQW RI WKH S5%( VLWH ZLWK WKH 0OXO UHVWULFWLRQ

PAGE 48

VLWH 7KH [*$/ VXE<
PAGE 49

HIILFLHQF\ HDFK WUDQVIHFWLRQ FRQWDLQHG SJ RISF'1$ fJIS DQG SJ RI SF'1$f3 JDO ([WUDFWV ZHUH WKHQ DVVD\HG IRU JDO DFWLYLW\ XVLQJ 213* 3URPHJDf WR QRUPDOL]H IRU WKH WUDQVIHFWLRQ HIILFLHQF\ ,Q WKRVH FDVHV ZKHUH D OLQHDU &$7 UHSRUWHU SODVPLG ZDV XVHG D OLQHDU S JDO SODVPLG ZDV DOVR XVHG &$7 5HSRUWHU $VVD\V )RUW\HLJKW KRXUV SRVWWUDQVIHFWLRQ WKH $ FHOOV ZHUH ZDVKHG ZLWK P/ 3%6 DQG O\VHG LQ SL RI O\VLV EXIIHU &$7 5HSRUWHU /\VLV %XIIHU 3URPHJD &RUSRUDWLRQf 7KH ZKROH FHOO H[WUDFWV ZHUH YRUWH[HG IRU WZHQW\ VHFRQGV DQG KHDWHG DW r& IRU PLQXWHV WR LQDFWLYDWH HQGRJHQRXV GHDFHW\ODVHV $IWHU KHDW LQDFWLYDWLRQ WKH H[WUDFWV ZHUH FHQWULIXJHG IRU PLQXWHV DQG WKH FODULILHG VXSHUQDWDQW ZDV WUDQVIHUUHG WR D QHZ WXEH &$7 DFWLYLW\ ZDV PHDVXUHG E\ D VWDQGDUG FKORUDPSKHQLFRO DFHW\ODWLRQ UHDFWLRQ ZKLFK FRQWDLQHG LQ SL O[ O\VLV EXIIHU 3URPHJD &RUSf P0 Q%XW\U\O &RHQ]\PH $ 3URPHJDf S0 O&FKORUDPSKHQLFRO $PHUVKDP 3KDUPDFLD %LRWHFK P&LPPROf DQG HLWKHU SJ RI SURWHLQ IURP DQ DGHQRYLUXVLQIHFWHG H[WUDFW RU SJ RI SURWHLQ IURP DQ XQLQIHFWHG H[WUDFW 7KH UHDFWLRQ ZDV LQFXEDWHG IRU KU DW r& DQG WKHQ H[WUDFWHG ZLWK SL RI PL[HG [\OHQHV )LVKHU 6FLHQWLILFf 7KH HQWLUH XSSHU RUJDQLF SKDVH FRQWDLQLQJ WKH DFHW\ODWHG FKORUDPSKHQLFRO ZDV EDFN H[WUDFWHG WZR WLPHV ZLWK SL RI 0 7ULV +& S+ 7KH DPRXQW RI DFHW\ODWHG FKORUDPSKHQLFRO LQ SL RI WKH PL[HG [\OHQHV SKDVH ZDV GHWHUPLQHG E\ OLTXLG VFLQWLOODWLRQ FRXQWLQJ (DFK FRQVWUXFW ZDV WHVWHG E\ WUDQVIHFWLRQ DQG &$7 DVVD\ D PLQLPXP RI WKUHH WLPHV 7KH DYHUDJH &$7 DFWLYLW\ DV FSP RI DFHW\ODWHG SURGXFWf ZDV FDOFXODWHG DIWHU FRUUHFWLRQ IRU WKH DPRXQW RI H[WUDFW XVHG DQG LV UHSRUWHG RQH VWDQGDUG GHYLDWLRQ

PAGE 50

&+$37(5 5(68/76 $QDO\VLV RI $GHQR$VVRFLDWHG 9LUXV 7UDQVFULSWLRQ 7KH RYHUDOO JRDO RI P\ UHVHDUFK ZDV WR XQGHUVWDQG WKH UHJXODWLRQ RI WKH $GHQR $VVRFLDWHG 9LUXV SURPRWHUV ,Q RUGHU WR SHUIRUP WKLV DQDO\VLV WKH GLIIHUHQW $$9 SURPRWHU HOHPHQWV ZHUH WR SODFHG XSVWUHDP RI UHSRUWHU JHQH FRQVWUXFWV ZKLFK JDXJHG WKH UHODWLYH LQIOXHQFH RI WKH '1$ VHTXHQFH XSRQ JHQH H[SUHVVLRQ ,Q WKH SUHYLRXV VWXGLHV RI $$9 WUDQVFULSWLRQDO UHJXODWLRQ WKH DQDO\VLV ZDV SHUIRUPHG E\ LVRODWLQJ D VLQJOH $$9 SURPRWHU UHJLRQ DQG PXWDWLQJ D VHULHV RI VLQJOH WUDQVFULSWLRQ IDFWRU ELQGLQJ VLWHV f $QRWKHU VWXG\ IRFXVHG RQ WKH HIIHFWV RI D VLQJOH WUDQVFULSWLRQ IDFWRU XSRQ DOO WKUHH $$9 SURPRWHUV ZDV SHUIRUPHG LQ WKH JOREDO JHQRPLF FRQWH[W RI WKH $$9 JHQRPH f ,Q WKH FRQWH[W RI WKH $$9 JHQRPH UHGXQGDQW WUDQVFULSWLRQ IDFWRU HIIHFWV ZRXOG QRW EH GHWHFWHG WKURXJK WKH ORVV RI WKH VLQJOH WUDQVFULSWLRQ IDFWRU 7R DGGUHVV WKH FRPELQDWRULDO HIIHFWV RI PXOWLSOH UHJXODWLQJ IDFWRUV RQ WKH $$9 JHQRPH P\ UHVHDUFK JRDOV IRFXVHG RQ WKH GHWHUPLQDWLRQ RI WKH QRQVWUXFWXUDO $$9 SURWHLQ 5HS DV D WUDQVFULSWLRQDO DFWLYDWRU GHILQLQJ WKH DFWLYLW\ RI 5HS LQ $$9 JHQH H[SUHVVLRQ DQG WKH UROH RI D 5HS6SO LQWHUDFWLRQ LQ WKH GLUHFW PHFKDQLVP RI $$9 WUDQVFULSWLRQDO UHJXODWLRQ 'HILQH 5HS %LQGLQJ (OHPHQW DV (QKDQFHU RU 3UR[LPDO 3URPRWHU (OHPHQW $$9 PXVW FRQYHUW TXLFNO\ IURP D ODWHQW YLUXV SUHVXPDEO\ LQWHJUDWHG LQ FKURPRVRPH f WR D SURGXFWLYH UHSOLFDWLQJ JHQRPH IROORZLQJ $G LQIHFWLRQ f 7R DFFRPSOLVK WKLV WKH YLUXV DSSHDUV WR XVH WZR IDFWRUV DV D VZLWFK 7KH ILUVW LV

PAGE 51

5HS SURWHLQ ZKLFK LQ DGGLWLRQ WR << DQG 0/7) ELQGV XSVWUHDP RI WKH S SURPRWHU )LJ f WR VKXW RII S WUDQVFULSWLRQ GXULQJ ODWHQF\ f 7KXV LQ WKH DEVHQFH RI $G 5HS DQG FRRSHUDWH ZLWK FHOOXODU SURWHLQV WR FRPSOHWHO\ LQKLELW S WUDQVFULSWLRQ f 7KH VHFRQG LV DGHQRYLUXV LQIHFWLRQ $G LQIHFWLRQ OHDGV WR (OD DQG $G '%3 PHGLDWHG DFWLYDWLRQ RI S f ZKLFK DFFRPSOLVKHV WZR WKLQJV ,W LQFUHDVHV WUDQVFULSWLRQ IURP WKH S DQG SL SURPRWHUV WR SURGXFH LQFUHDVHG OHYHOV RI WKH IRXU 5HS SURWHLQV f 5HS DQG LQ WXUQ LQFUHDVH WUDQVFULSWLRQ IURP WKH SL DQG S SURPRWHUV WR DQ HYHQ KLJKHU OHYHO f ZKLOH UHGXFLQJ WUDQVFULSWLRQ IURP WKH S SURPRWHU f $G LQIHFWLRQ DOVR LQGHSHQGHQWO\ DFWLYDWHV SL WUDQVFULSWLRQ f 7KXV WKH S DQG SO SURPRWHUV DUH UHSUHVVHG E\ 5HS LQ WKH DEVHQFH RI $G DQG GLIIHUHQWLDOO\ UHJXODWHG LQ WKH SUHVHQFH RI KHOSHU YLUXV 'XULQJ WKH SURYLUDO VWDJH 5HS DXWRUHSUHVVHV LWV V\QWKHVLV WR SUHYHQW H[FLVLRQ RI WKH SURYLUXV DQG H[SUHVVLRQ RI LWV JHQH SURGXFWV ,Q WKH SUHVHQFH RI WKH KHOSHU YLUXV 5HS LQGXFHV WKH V\QWKHVLV RI WKH SO SURWHLQV WKDW UHTXLUHG DUH IRU HQFDSVLGDWLRQ DQG PDLQWDLQV WKH S 5HS SURWHLQV DW D ORZHU OHYHO WR RSWLPL]H WKH OHYHO RI UHSOLFDWLQJ LQWHUPHGLDWHV 7KH S SURPRWHU )LJ f KDV EHHQ VKRZQ SUHYLRXVO\ WR FRQWDLQ WKUHH HOHPHQWV LQYROYHG LQ S UHJXODWLRQ DQ 0/7) VLWH DW D << VLWH DW DQG DQ 5%( DW f ,Q WKH DEVHQFH RI $G LQIHFWLRQ VSHFLILFDOO\ (OD JHQH H[SUHVVLRQ DOO WKUHH IDFWRUV << 0/7) DQG 5HSf UHSUHVV S WUDQVFULSWLRQ f ,Q WKH SUHVHQFH RI DQ DGHQRYLUXV FRLQIHFWLRQ << DQG 0/7) ERWK DFWLYDWH S WUDQVFULSWLRQ f ,Q WKH FDVH RI << WKLV DSSDUHQWO\ RFFXUV YLD DQ LQWHUDFWLRQ RI << DQG (OD ZLWK WKH FHOOXODU S SURWHLQ f 5HS KRZHYHU FRQWLQXHV WR UHSUHVV S ZKHQ ERXQG WR WKH S 5%( EXW LV QRZ FDSDEOH RI DFWLYDWLQJ WKH WZR GRZQVWUHDP SURPRWHUV SO DQG

PAGE 52

)LJ 6HTXHQFHV RI WKH S DQG SL SURPRWHUV 7KH NQRZQ WUDQVFULSWLRQ HOHPHQWV LQ WKH S DQG SO SURPRWHUV DUH GLDJUDPPHG DORQJ ZLWK WKHLU DSSUR[LPDWH SRVLWLRQV XSVWUHDP RI WKH P51$ VWDUW VLWHV S&$7 SODVPLG FRQWDLQV RQO\ WKH S SURPRWHU HOHPHQWV GULYLQJ &$7 H[SUHVVLRQ ZKLOH S,0&$7 FRQWDLQV ERWK WKH S DQG SO SURPRWHU HOHPHQWV ZLWK WKH SL SURPRWHU GULYLQJ &$7 H[SUHVVLRQ 'RWWHG OLQHV LQGLFDWH LQWHUYHQLQJ VHTXHQFHV WKDW DUH QRW VKRZQ 6KRZQ LQ LWDOLFV DUH VXEVWLWXWLRQV ZLWKLQ WKH SO&$7 SURPRWHU DW DQG WKDW ZHUH SUHYLRXVO\ GHPRQVWUDWHG WR KDYH OLWWOH HIIHFW RQ SL WUDQVFULSWLRQ DQG WKH VXE VXEVWLWXWLRQ ZLWKLQ WKH S 5%( WKDW QR ORQJHU ELQGV 5HS SURWHLQ 6KRZQ LQ EROG LWDOLFV DUH WKH *$/ VXEVWLWXWLRQV LQ [*$/ WKDW UHSODFH WKH S 5%( DQG WKH SL 63 VLWHV $ &5(%$7) VLWH ZKLFK KDV EHHQ PDSSHG XSVWUHDP RI WKH 0/7) VLWH LQ S LV QRW VKRZQ

PAGE 53

3 RQ5 0/7) << 7&$&*7W$*7*7777*_&*$&$7777E& 7$&$&*&*7*7& *$$77&7***$7&& 7$7$ 5%( << **W7$777$$_&&&*$*7*$*&$&*&_$***7&IIF&$7777O$ *$$77&7**$7&&$&7 $$ &**$$*$&7&7&&7&&* S F$$3 63 **7 &&$*$$ƒI**S*&&*_$**&***O$&$$J*7**7*O 63 7$7$ 7$7$ $*&7&&A*7***&*7*4$&IU$$7$7O**$$&$*IIƒI7ƒƒO*& &**$$*$&7&7&&7&&* 3&$7 F$$3 VXE63 VXE**7 &&$*$$IL-*MOS*&&*@S7&*$*&77ƒf*$$&U&*$**7IU 63 7$7$ VXE7$7$ && $S7 * &*7* *A&I7$ $7$7S $$& $* S&*&**M*&

PAGE 54

S f ,Q DGGLWLRQ WR WKH << 5%( DQG 0/7) VLWHV S FRQWDLQV D FRQYHQWLRQDO 7$7$ VLWH f DQG D << UHVSRQVLYH LQLWLDWRU VLWH f f ,Q WKH SUHVHQFH RI 5HS DQG $G JHQH H[SUHVVLRQ RQO\ PXWDWLRQV LQ WKH 7$7$ << DQG 0/7) VLWHV VLJQLILFDQWO\ DIIHFW S WUDQVFULSWLRQ f 7KH SL SURPRWHU )LJ f FRQWDLQV WZR 7$7$ VLWHV DQG f ZKLFK DUH UHGXQGDQW WZR 6SO VLWHV DQG f DQG D VLWH DW WKDW ELQGV DQ XQLGHQWLILHG FHOOXODU $$9 DFWLYDWLQJ SURWHLQ F$$3f f 7UDQVDFWLYDWLRQ RI WKH SL SURPRWHU E\ 5HS DSSHDUV WR UHTXLUH ERWK WKH 6SO VLWH DQG WKH F$$3 VLWH f ,W DOVR UHTXLUHV WKH S 5%( f ,Q WKH DEVHQFH RI WKH S 5%( WKH 75 SUHVXPDEO\ YLD LWV 5%( FDQ WUDQVDFWLYDWH DOO WKUHH SURPRWHUV f (YLGHQFH WKDW WKH 5%( ZLWKLQ WKH 75 LV SUREDEO\ UHVSRQVLEOH IRU WUDQVDFWLYDWLRQ FRPHV IURP GHOHWLRQ DQDO\VHV RI WKH 75 f 7KH WZR 5%( HOHPHQWV DSSHDU WR EH UHGXQGDQW ZLWK UHVSHFW WR SO WUDQVDFWLYDWLRQ DW ORZ $GHQRYLUXV 02,V EXW WKH 75 SUHGRPLQDWHV DW KLJK $G 02, !f f )XUWKHUPRUH DW KLJK PXOWLSOLFLWLHV RI LQIHFWLRQ RI $GHQRYLUXV !f WKH HIIHFW RI 5HS RU H[SUHVVLRQ RQ SO DFWLYLW\ LV QR ORQJHU VHHQ WKDW LV H[SUHVVLRQ RI $G IDFWRUV FDQ VXEVWLWXWH IRU 5HS RU f )LQDOO\ LW KDV EHHQ VKRZQ WKDW 5HS DQG 6SO FDQ GLUHFWO\ LQWHUDFW f DQG WKDW 5HS ERXQG WR WKH S 5%( FDQ IRUP D '1$ ORRS ZLWK 6SO DW SL f 5HSUHVVLRQ E\ 5HS SURWHLQV LV PRUH FRPSOH[ ,Q FRQWUDVW WR WUDQVDFWLYDWLRQ ZKLFK DSSHDUV WR UHTXLUH HLWKHU 5HS RU SOXV $G LQIHFWLRQ UHSUHVVLRQ RI WKH S DQG SL SURPRWHUV RFFXUV LQ WKH DEVHQFH RI $G UHJDUGOHVV RI ZKLFK 5HS SURWHLQ LV H[SUHVVHG f 5HSUHVVLRQ RI WKH S SURPRWHU GHSHQGV LQ SDUW RQ 5HS ELQGLQJ WR WKH S 5%( EXW DOVR UHTXLUHV D IXQFWLRQDO 5HS $73DVH f +RZHYHU UHSUHVVLRQ RI S FDQ EH

PAGE 55

VHHQ LQ WKH DEVHQFH RI D IXQFWLRQDO S 5%( )XUWKHUPRUH WKH SL SURPRWHU ZKLFK GRHV QRW KDYH DQ HIILFLHQW 5%( ELQGLQJ VLWH FDQ EH UHSUHVVHG E\ DOO IRXU 5HS SURWHLQV LQFOXGLQJ 5HS DQG ZKLFK ODFN DQ 5%( ELQGLQJ GRPDLQ DQG FRQWDLQ RQO\ WKH 5HS KHOLFDVH DQG $73DVH GRPDLQV f 2XU LQLWLDO K\SRWKHVLV ZDV WKDW WKH XSVWUHDP S 5%(5HS FRPSOH[ PLJKW EHKDYH OLNH DQ HQKDQFHU VHTXHQFH WKDW DFWLYDWHV WUDQVFULSWLRQ IURP GRZQVWUHDP SURPRWHUV 7R GHWHUPLQH LI WKLV ZHUH WUXH ZH PDGH D VHULHV RI SL &$7 FRQVWUXFWV )LJV DQG f LQ ZKLFK &$7 JHQH H[SUHVVLRQ ZDV GULYHQ E\ WKH SL SURPRWHU 7KH ILUVW VHW RI FRQVWUXFWV )LJ f ZDV PDGH WR EH FHUWDLQ WKDW WKH &$7 FRQVWUXFWV ZRXOG DFFXUDWHO\ UHIOHFW WKH FRQWURO RI S DQG SL WUDQVFULSWLRQ WKDW LV VHHQ ZLWK WKH SDUHQWDO 75 PLQXV S,0 SODVPLG RU ZLWK ZLOG W\SH $$9 ,Q WKLV VHW RI FRQVWUXFWV )LJ f DOO RI WKH VHTXHQFHV XSVWUHDP RI WKH SO P51$ VWDUW VLWH ZHUH LGHQWLFDO WR WKRVH RI ZLOG W\SH $$9 S,0&$7f RU FRQWDLQHG D PXWDWLRQ LQ WKH S 5%( SVXE&$7f WKDW HOLPLQDWHG 5HS ELQGLQJ f 7R SUHYHQW H[SUHVVLRQ RI DEHUUDQW 5HS SURWHLQV IURP S,0&$7 DQG SVXE&$7 ERWK SODVPLGV FRQWDLQHG DQ DPEHU PXWDWLRQ DW DPLQR DFLG RI 5HS 7KLV PXWDWLRQ WHUPLQDWHG WKH V\QWKHVLV RI 5HS ZKLOH WKH &$7 LQVHUWLRQ SUHYHQWHG V\QWKHVLV RI 5HS VR WKDW QR 5HS SURWHLQV FRXOG EH GHWHFWHG LQ WKH DEVHQFH RI D 5HS H[SUHVVLQJ SODVPLG :LWK WKH H[FHSWLRQ RI WKH WHUPLQDO UHSHDW WKHVH FRQVWUXFWV FRQWDLQ DOO WKH VHTXHQFHV QHFHVVDU\ IRU SL UHJXODWLRQ DQG SO WUDQVDFWLYDWLRQ E\ 5HS f 7KH S&$7 SODVPLG GHVFULEHG E\ &KDQJ HW DO f ZDV XVHG WR PRQLWRU H[SUHVVLRQ IURP WKH S SURPRWHU )LJ f ,W FRQWDLQHG DOO RI WKH VHTXHQFHV XSVWUHDP RI WKH S SURPRWHU WKDW KDYH EHHQ VKRZQ WR EH QHFHVVDU\ IRU S UHJXODWLRQ ZLWK WKH H[FHSWLRQ RI WKH 75V $OO RI WKH SODVPLGV XVHG LQ WKLV VWXG\ ZHUH PLVVLQJ WKH $$9

PAGE 56

)LJ $FWLYLW\ RI WKH ZLOG W\SH S DQG SO SURPRWHUV $ 'LDJUDP RI WKH S DQG SL SURPRWHU HOHPHQWV LQ WKH &$7 UHSRUWHU FRQVWUXFWV S&$7 S,0&$7 DQG SVXE&$7 7KH DVWHULVN LQGLFDWHV D VWRS FRGRQ LQ WKH 5HS RSHQ UHDGLQJ IUDPH DW DPLQR DFLG SRVLWLRQ %' *UDSKLF UHSUHVHQWDWLRQ RI &$7 DFWLYLW\ IURP WKH S&$7 S,0&$7 DQG SVXE&$7 UHSRUWHU FRQVWUXFWV DIWHU WUDQVIHFWLRQ LQ $ FHOOV LQ WKH SUHVHQFH RI SODVPLG DORQH 0RFNf RU ZLWK WKH DGGLWLRQ RI PJ RI S,0 5HSf $GHQRYLUXV DW DQ 02, $Gf RU PJ RI S,0 DQG $GHQRYLUXV DW DQ 02, $G t 5HSf

PAGE 57

&$7 $FWLYLW\ FSPf 3 5%( K+I &$7 0/7)<< << 3 :7 S&$7 5HSr F$$3 6S S &$7 SO0&$7 3 ++5HSr S RR &$7 SVXE&$7 @ 0RFN S&$7 SO0&$7 SVXE&$7

PAGE 58

75V EHFDXVH ZH DQG RWKHUV KDYH VKRZQ WKDW WKH 75V DUH UHGXQGDQW DFWLYDWLRQ HOHPHQWV WKDW SURPRWH H[FLVLRQ DQG UHSOLFDWLRQ WKHUHE\ FKDQJLQJ WKH WHPSODWH FRS\ QXPEHU DYDLODEOH IRU WUDQVFULSWLRQ f 7KH WKUHH SODVPLGV S&$7 S,0&$7 DQG SVXE&$7f ZHUH WUDQVIHFWHG LQWR $ FHOOV LQ WKH SUHVHQFH RU DEVHQFH RI D FRLQIHFWLRQ ZLWK $GHQRYLUXV 02, f RU LQ WKH SUHVHQFH RU DEVHQFH RI D FRWUDQVIHFWLRQ ZLWK WKH ZLOG W\SH 5HS H[SUHVVLQJ SODVPLG S,0 )LJ f S,0 ZDV FKRVHQ EHFDXVH ZH DQG RWKHUV KDYH VKRZQ WKDW WKH IRXU 5HS SURWHLQV 5HS DQG DUH H[SUHVVHG DW GLIIHUHQW OHYHOV DQG KDYH GLIIHUHQWLDO HIIHFWV RQ UHSUHVVLRQ DQG WUDQVDFWLYDWLRQ RI SO GXULQJ SURGXFWLYH LQIHFWLRQ f DQG EHFDXVH S,0 H[SUHVVHV WKH 5HS SURWHLQV DW DSSUR[LPDWHO\ WKH VDPH UHODWLYH OHYHOV WKDW DUH VHHQ GXULQJ ZLOG W\SH YLUDO LQIHFWLRQ f &HOOV ZHUH KDUYHVWHG DSSUR[LPDWHO\ KRXUV DIWHU SODVPLG WUDQVIHFWLRQ DQG $G LQIHFWLRQ DQG FHOO IUHH H[WUDFWV ZHUH DVVD\HG IRU &$7 DFWLYLW\ DV GHVFULEHG LQ 0HWKRGV $V H[SHFWHG FRLQIHFWLRQ ZLWK $G DORQH VLJQLILFDQWO\ LQGXFHG S WUDQVFULSWLRQ DSSUR[LPDWHO\ IROG )LJ %f 7KLV SUHVXPDEO\ RFFXUV WKURXJK WKH LQWHUDFWLRQ RI WKH (O D SURWHLQV RI $G ZLWK WKH S<
PAGE 59

IROG DQG WKLV RFFXUUHG WR DSSUR[LPDWHO\ WKH VDPH OHYHO UHJDUGOHVV RI ZKHWKHU WKH S 5%( HOHPHQW ZDV LQWDFW )LJ & DQG 'f 7KH LQGXFWLRQ E\ $G DQG 5HS DSSHDUHG WR EH PXOWLSOLFDWLYH DQG WRJHWKHU WKH\ LQGXFHG WUDQVFULSWLRQ IURP WKH SL SURPRWHU E\ DOPRVW IROG )LJ &f S &$7 DFWLYLW\ LQ WKH SUHVHQFH RI 5HS DQG $G ZDV DSSUR[LPDWHO\ IROG KLJKHU WKDQ S &$7 DFWLYLW\ 7KLV IROG GLIIHUHQFH ZDV DSSUR[LPDWHO\ WKH VDPH DV WKDW VHHQ ODWH DIWHU LQIHFWLRQ GXULQJ QRUPDO ZLOG W\SH $$9 LQIHFWLRQV ZKHQ WUDQVFULSWV DUH FRPSDUHG E\ RWKHU PHWKRGV VXFK DV 1RUWKHUQV f 7KXV WKH &$7 FRQVWUXFWV XVHG LQ WKLV VWXG\ VHHPHG WR DFFXUDWHO\ UHIOHFW P51$ VWHDG\ VWDWH OHYHOV VHHQ GXULQJ ZLOG W\SH $$9 LQIHFWLRQV RU WKRVH VHHQ ZLWK 75 PLQXV SODVPLG WUDQVIHFWLRQV )LQDOO\ ZH QRWHG WKDW ZKHQ EDVDO H[SUHVVLRQ IURP WKH SVXE&$7 SODVPLG ZDV FRPSDUHG ZLWK WKDW VHHQ LQ WKH SUHVHQFH RI WKH 5HS H[SUHVVLQJ SODVPLG WKHUH ZDV DSSUR[LPDWHO\ D IROG LQKLELWLRQ RI S WUDQVFULSWLRQ )LJ 'f 6LPLODUO\ ZKHQ WKH OHYHO RI H[SUHVVLRQ LQ WKH SUHVHQFH RI $G ZDV FRPSDUHG ZLWK H[SUHVVLRQ LQ WKH SUHVHQFH RI $G SOXV 5HS WKHUH ZDV DSSUR[LPDWHO\ D IROG LQKLELWLRQ RI S WUDQVFULSWLRQ E\ 5HS SURWHLQ 7KXV H[SUHVVLRQ RI WKH 5HS SURWHLQ FDXVHG LQKLELWLRQ RI WKH SL SURPRWHU LQ WKH DEVHQFH RI WKH S 5%( 7KLV KDV DOVR EHHQ UHSRUWHG SUHYLRXVO\ f 7KH S 5%( LV QRW DQ XSVWUHDP DFWLYDWLRQ VLJQDO +DYLQJ FRQILUPHG WKDW WKH S 5%( ZDV HVVHQWLDO IRU 5HS PHGLDWHG LQGXFWLRQ RI S WUDQVFULSWLRQ ZH WKHQ DVNHG ZKHWKHU WKH S 5%( EHKDYHG OLNH D SRVLWLRQ LQGHSHQGHQW HQKDQFHU RU OLNH DQ XSVWUHDP DFWLYDWLRQ VLJQDO ,I WKH S 5%( EHKDYHG OLNH D FRQYHQWLRQDO HQKDQFHU RU XSVWUHDP DFWLYDWLRQ VHTXHQFH ZH H[SHFWHG WKDW DQ DUWLILFLDO FRQVWUXFW FRQWDLQLQJ DOO RI WKH HVVHQWLDO SL SUR[LPDO SURPRWHU HOHPHQWV ZRXOG FRQWLQXH WR UHVSRQG WR DQ XSVWUHDP 5%( LQ WKH SUHVHQFH RI $G DQG 5HS JHQH H[SUHVVLRQ )RU WKLV SXUSRVH ZH GHVLJQHG D VHULHV RI &$7 FRQVWUXFWV LQ ZKLFK WKH SO SUR[LPDO SURPRWHU

PAGE 60

HOHPHQWV ZHUH OHIW LQWDFW EXW WKH XSVWUHDP $$9 VHTXHQFHV LQFOXGLQJ WKH S SURPRWHU ZHUH VXEVWLWXWHG ZLWK EDFWHULDO '1$ ,Q WKHVH FRQVWUXFWV WKH SL VHTXHQFHV XS WR ES RI WKH P51$ VWDUW VLWH ZHUH HVVHQWLDOO\ WKH VDPH DV WKH ZLOG W\SH VHTXHQFH SUHVHQW LQ S,0&$7f H[FHSW WKDW WKH 7$7$ VLWH DW WKH **7 VLWH DW DQG WKH 6SO VLWH DW ZHUH PXWDWHG )LJ f 7KHVH VLWHV KDG EHHQ VKRZQ SUHYLRXVO\ WR EH QRQHVVHQWLDO IRU 5HS LQGXFWLRQ RU EDVDO SO DFWLYLW\ f 7KH &$7 FRGLQJ VHTXHQFH ZDV LQVHUWHG DW RI WKH SL PHVVDJH DQG D SRO\ $ VLJQDO ZDV LQVHUWHG XSVWUHDP RI WKH S SURPRWHU WR SUHYHQW UHDG WKURXJK IURP IRUWXLWRXV XSVWUHDP SRO\PHUDVH ,, SURPRWHUV LQ WKH EDFWHULDO VHTXHQFHV 7KH S 5%( VLJQDO ZDV WKHQ LQVHUWHG DW YDULRXV SRVLWLRQV XSVWUHDP RU GRZQVWUHDP RI WKH SO SURPRWHU ,Q WKH FRQWURO SODVPLG SO&$7 WKH S 5%( ZDV RPLWWHG 7KH OHYHO RI SL DFWLYDWLRQ VHHQ ZLWK WKH SO&$7 SODVPLG LQ WKH SUHVHQFH RI HLWKHU 5HS RU $G DORQH ZDV VLPLODU WR WKDW VHHQ ZLWK WKH SDUHQWDO S,0&$7 SODVPLG WKDW FRQWDLQHG DOO RI WKH XSVWUHDP $$9 VHTXHQFHV LQFOXGLQJ WKH S SURPRWHU HOHPHQWV $V H[SHFWHG 5HS GLG QRW VLJQLILFDQWO\ LQGXFH S ZKHQ 5HS DQG $G ZHUH SUHVHQW WRJHWKHU LI WKHUH ZDV QR XSVWUHDP 5%( )LJ %f 6XUSULVLQJO\ 5HS DOVR GLG QRW LQGXFH SL WUDQVFULSWLRQ LQ WKH SUHVHQFH RI ERWK 5HS DQG $G ZKHQ DQ 5%( ZDV LQVHUWHG DW XSVWUHDP RI WKH S SURPRWHU 7KLV LV DSSUR[LPDWHO\ WKH VDPH SRVLWLRQ WKDW WKH S 5%( RFFXSLHV LQ WKH SDUHQWDO SODVPLG S,0&$7 )XUWKHUPRUH 5HS GLG QRW DFWLYDWH SO WUDQVFULSWLRQ FRPSDUH $G RQO\ ZLWK $G SOXV 5HS ODQHVf UHJDUGOHVV RI ZKHUH WKH 5%( ZDV LQVHUWHG XSVWUHDP RU GRZQVWUHDP RI WKH SL P51$ VWDUW VLWH ,QVWHDG WKH 5%( DFWHG OLNH D UHSUHVVRU HOHPHQW DW PRVW RI WKH SRVLWLRQV WHVWHG LQ WKH SUHVHQFH RI ERWK 5HS DQG $G DQG WKH OHYHO RI UHSUHVVLRQ LQFUHDVHG GUDPDWLFDOO\ DV WKH 5%( ZDV LQVHUWHG FORVHU

PAGE 61

)LJ (IIHFW RI 5%( SRVLWLRQ RQ SO DFWLYLW\ $ 'LDJUDP RI WUDQVFULSWLRQ HOHPHQWV ZLWKLQ WKH ZLOG W\SH S DQG SO SURPRWHUV %* 'LDJUDPV RI WKH SDUHQWDO SODVPLG SO&$7 %f DQG GHULYDWLYHV RI SO&$7 &* LQ ZKLFK DQ 5%( ZDV LQVHUWHG DW YDULRXV SRVLWLRQV ZLWK UHVSHFW WR WKH VWDUW RI S WUDQVFULSWLRQ WR f 7KH SO&$7 SODVPLG KDV WKH PLQLPXP SO SURPRWHU HOHPHQWV DV VKRZQ LQ )LJ DQG QR S SURPRWHU HOHPHQWV 7KH &$7 DFWLYLW\ RI HDFK FRQVWUXFW ZDV GHWHUPLQHG DIWHU WUDQVIHFWLRQ LQWR $ FHOOV LQ WKH SUHVHQFH RI SODVPLG DORQH 0RFNf S,0 5HSf $GHQRYLUXV $Gf RU S,0 DQG $G $G t 5HSf

PAGE 62

S5%( S $ r 0/7)<< << 2 S Q &$7 $FWLYLW\ FSPf 63 T0 FDW ZW 3&$7 U2 U£ UI3 F63 ML3 S5%( R4AQ WRR S5%( A Qf§FDW 35%( r Uf S A FDW S5%( Q Q FD77A35%( AUf§ :

PAGE 63

WR WKH SL SURPRWHU 7KH PRVW GUDPDWLF UHSUHVVLRQ ZDV VHHQ ZKHQ WKH 5%( ZDV SODFHG DW XSVWUHDP RI WKH SO VWDUW VLWH FRPSDUH )LJ % $G 5HS ZLWK ( $G 5HSf :KHQ WKH 5%( ZDV SODFHG GRZQVWUHDP RI WKH SL VWDUW VLWH )LJ ) DQG *f VRPH RI WKH SL DFWLYLW\ ZDV UHFRYHUHG EXW WKH 5%( FRQWLQXHG WR JHQHUDOO\ UHSUHVV S WUDQVFULSWLRQ HYHQ ZKHQ LW ZDV SODFHG IDU GRZQVWUHDP DW &XULRXVO\ LQ WKH SUHVHQFH RI RQO\ 5HS JHQH H[SUHVVLRQ SL DFWLYLW\ ZDV VLJQLILFDQWO\ LQGXFHG RYHU EDVDO OHYHOV E\ 5HS ZKHQ WKH 5%( ZDV SODFHG DW RU :H FRQFOXGHG IURP WKHVH H[SHULPHQWV WKDW WKH 5%( ZDV QRW D FRQYHQWLRQDO XSVWUHDP DFWLYDWLRQ VLJQDO RU DQ HQKDQFHU ,W GLG DSSHDU KRZHYHU WR KDYH WKH DELOLW\ WR DFW DV D JHQHUDO UHSUHVVLRQ VLJQDO LQ WKH SUHVHQFH RI DGHQRYLUXV LQIHFWLRQ XQGHU DOPRVW DOO FRQGLWLRQV WHVWHG ZKHQ LW ZDV FORVHU WKDQ ES XSVWUHDP RU ES GRZQVWUHDP RI WKH SO SURPRWHU 2XU GDWD DOVR VXJJHVWHG WKDW 5HS LWVHOI ZDV SUREDEO\ QRW DQ DFWLYDWRU DQG OHIW RSHQ WKH TXHVWLRQ RI KRZ WKH S 5%( FRXOG WUDQVDFWLYDWH SL LQ WKH FRQWH[W RI WKH QRUPDO $$9 VHTXHQFH $FWLYDWLRQ RI SO LV QRW GXH WR UHDG WKURXJK IURP S :H FRQVLGHUHG WZR RWKHU SRVVLEOH PHFKDQLVPV RI SL DFWLYDWLRQ E\ WKH S 5%( 2QH ZDV WKDW WUDQVFULSWLRQ IURP WKH S SURPRWHU DFWLYDWHG SL E\ D UHDG WKURXJK PHFKDQLVP $OWKRXJK SRRUO\ XQGHUVWRRG WKLV KDV EHHQ VKRZQ WR RFFXU LQ WKH FDVH RI WKH DGHQRYLUXV (OE JHQH ,Q WKLV FDVH DFWLYH WUDQVFULSWLRQ RI WKH (O D SURPRWHU FDXVHV UHDG WKURXJK DFWLYDWLRQ RI WKH (OE SURPRWHU LQ D FLVGHSHQGHQW PDQQHU f (OD WUDQVFULSWLRQ DSSHDUV WR DOWHU WKH DGHQRYLUXV JHQRPH LQWR D WUDQVFULSWLRQDOO\ FRPSHWHQW WHPSODWH EHIRUH $G '1$ UHSOLFDWLRQ DQG ODWH WUDQVFULSWLRQ KDYH EHJXQ 7KLV SRVVLELOLW\ ZDV QRW OLNHO\ LQ WKH FDVH RI WKH SS SURPRWHUV EHFDXVH WKH S 5%( LQKLELWHG &$7 H[SUHVVLRQ )LJ f IURP WKH S SURPRWHU DW WKH VDPH WLPH WKDW LW LQGXFHG &$7 H[SUHVVLRQ

PAGE 64

IURP WKH SO SURPRWHU +RZHYHU LW UHPDLQHG SRVVLEOH WKDW &$7 H[SUHVVLRQ LQ WKLV VWXG\ DV ZHOO DV RWKHU VWHDG\ VWDWH P51$ PHDVXUHPHQWV GRQH SUHYLRXVO\f GLG QRW UHIOHFW WKH WUXH ILULQJ UDWH RI WKH S SURPRWHU ,Q RUGHU WR DGGUHVV WKH SRVVLELOLW\ WKDW S WUDQVFULSWLRQ PD\ EH WUDQVDFWLYDWLQJ SL WZR NLQGV RI H[SHULPHQWV ZHUH GRQH ,Q WKH ILUVW H[SHULPHQW ZH FRPSDUHG SL &$7 DFWLYLW\ IURP WKH S,0&$7 SODVPLG LQ WKH SUHVHQFH RI $G RU $G SOXV 5HS ZKHQ WKH SK\VLFDO FRQQHFWLRQ EHWZHHQ WKH S DQG SO SURPRWHUV ZDV UHPRYHG E\ D UHVWULFWLRQ GLJHVW )LJ f 7KH S,0&$7 SODVPLG ZDV WUDQVIHFWHG HLWKHU XQFXW FXW ZLWK 6SKO ZKLFK FXWV RXWVLGH ERWK WKH S DQG SL SURPRWHUV RU FXW ZLWK 1UXO ZKLFK FXWV EHWZHHQ WKH S DQG SO SURPRWHUV $V EHIRUH WKH VXSHUFRLOHG XQFXW SODVPLG VKRZHG VWURQJ DFWLYDWLRQ RI WKH SO SURPRWHU E\ 5HS LQ WKH SUHVHQFH RI $G 7KLV ZDV QRW VHHQ ZKHQ WKH SODVPLG ZDV OLQHDUL]HG E\ UHVWULFWLRQ GLJHVWLRQ DW HLWKHU UHVWULFWLRQ VLWH HYHQ DIWHU WKH LQSXW '1$ OHYHOV ZHUH QRUPDOL]HG VHH 0HWKRGVf 7KXV 5HS LQGXFWLRQ DSSHDUHG WR UHTXLUH D VXSHUKHOLFDO WHPSODWH 7KH GLIIHUHQFH LQ &$7 H[SUHVVLRQ EHWZHHQ WKH 6SKO DQG 1UXO FXW SODVPLGV LQ WKH SUHVHQFH RI DGHQRYLUXV DORQH RU $G SOXV 5HS ZDV IROG 7KXV UHDG WKURXJK DFWLYDWLRQ ZDV QRW OLNHO\ WR FRQWULEXWH PRUH WKDQ IROG WR SL DFWLYLW\ ,Q WKH VHFRQG H[SHULPHQW ZH LQVHUWHG D SRO\ $ VLWH EHWZHHQ WKH S DQG S SURPRWHUV RI S,0&$7 DQG SVXE&$7 ,QVHUWLRQ RI D SRO\ $ VLWH EHWZHHQ S DQG SO LQ WKH SVXE&$7 SODVPLG KDG D PLQLPDO IROGf HIIHFW RQ S DFWLYLW\ )LJ DQG (f 7KLV VXJJHVWHG DJDLQ WKDW UHODWLYHO\ OLWWOH LI DQ\ SL WUDQVFULSWLRQ UHOLHG RQ UHDG WKURXJK IURP WKH XSVWUHDP S SURPRWHU ,Q FRQWUDVW ZKHQ WKH S 5%( ZDV SUHVHQW )LJ % DQG &f LQVHUWLRQ RI WKH SRO\ $ VLWH GHFUHDVHG SL DFWLYLW\ E\ IROG XQGHU DOO FRQGLWLRQV WHVWHG 5HJDUGOHVV RI ZKHWKHU D SRO\ $ VLWH ZDV LQVHUWHG WKH SODVPLGV WKDW

PAGE 65

)LJ /LQHDUL]DWLRQ RI S,0&$7 SODVPLG WR LQKLELW UHDG WKURXJK WUDQVDFWLYDWLRQ SL &$7 DFWLYLW\ IURP $ FHOOV WUDQVIHFWHG ZLWK VXSHUFRLOHG S,0&$7 SODVPLG $ RU SODVPLG WKDW KDG EHHQ OLQHDUL]HG E\ GLJHVWLRQ ZLWK 1UXO %f RU 6SK, &f )RU HDFK FDVH WKH DFWLYLW\ LQ WKH SUHVHQFH RI $GHQRYLUXV LQIHFWLRQ 02, $Gf LV FRPSDUHG ZLWK WKH DFWLYLW\ LQ WKH SUHVHQFH $G LQIHFWLRQ DQG WUDQVIHFWLRQ ZLWK PJ RI S,0 $G t 5HSf 7KH YDOXHV LQ $f DUH WKH VDPH DV WKRVH LQ )LJ & DQG DUH SUHVHQWHG IRU FRPSDULVRQ

PAGE 66

3,0&$7 SO0&$76SKO SO0 &$7 $FWLYLW\ FSPf SO0&$7

PAGE 67

)LJ (IIHFW RI SRO\ $ LQVHUWLRQ WR LQKLELW UHDG WKRXJK DFWLYDWLRQ $ 3RO\ $ VHTXHQFH ZDV LQVHUWHG LQWR S,0&$7 DQG SVXE&$7 EHWZHHQ WKH S DQG SL SURPRWHUV WR GHWHUPLQH WKH HIIHFW RI D SRO\ $ VLJQDO RQ SL DFWLYLW\ ZKHQ WKH SODVPLG ZDV WUDQVIHFWHG E\ LWVHOI 0RFNf LQ WKH SUHVHQFH RI WKH 5HS H[SUHVVLQJ SODVPLG S,0 5HSf LQ WKH SUHVHQFH RI $G DW DQ 02, RI $Gf RU LQ WKH SUHVHQFH RI ERWK S,0 DQG $G 5HS t $Gf 7KH DVWHULVNV LQGLFDWH WKDW WKH 5HS FRGLQJ VHTXHQFH KDV D VWRS FRGRQ DW 5HS DPLQR DFLG SRVLWLRQ WR SUHYHQW 5HS H[SUHVVLRQ IURP WKH &$7 UHSRUWHU SODVPLGV 7KH YDOXHV LQ %f DQG 4 DUH WKH VDPH DV WKRVH LQ )LJ & DQG DQG DUH SUHVHQWHG KHUH IRU FRPSDULVRQ

PAGE 68

S5%( S $ 0/7)<< << S 63 :W % 2:7 5HSnf§r UUAr SO0&$7 3RO\$ F 44m&3r1A UUaAQ SO0&$73RO\$ G R4f§RU 5HSf§ SVXE&$7 3RO\$ ( 24I SQ MQ U$7 SVXE&$73RO\$ &$7 $FWLYLW\ FSPf &" f§! r WPWO W PXL L L L PLOO L L QXLO L O PXK

PAGE 69

FRQWDLQHG D S 5%( ERWK VKRZHG D 5HS PHGLDWHG LQGXFWLRQ RI SL LQ WKH SUHVHQFH RI $G 7DNHQ WRJHWKHU RXU UHVXOWV VXJJHVWHG WKDW PRGLILFDWLRQ RI WKH SL SODVPLG WHPSODWH E\ D PHWKRG WKDW FRXOG FKDQJH WKH VHFRQGDU\ VWUXFWXUH RI WKH SODVPLG UHVWULFWLRQ GLJHVWLRQf RU SRWHQWLDOO\ FUHDWH QHZ SURWHLQ FRPSOH[HV LQ WKH UHJLRQ EHWZHHQ S DQG SL LQVHUWLRQ RI D SRO\ $ VLWHf UHGXFHG SO DFWLYLW\ +RZHYHU WKH\ GLG QRW VXJJHVW UHDG WKURXJK DFWLYDWLRQ DV D OLNHO\ PHFKDQLVP IRU SO LQGXFWLRQ 7UDQVDFWLYDWLRQ RI SO FDQ EH PRGHOHG LQ WKH DEVHQFH RI 5HS 7KXV IDU RXU GDWD ZHUH QRW FRQVLVWHQW ZLWK WKH S 5%( EHLQJ D FRQYHQWLRQDO XSVWUHDP DFWLYDWLRQ VLJQDO RU ZLWK WKH SRVVLELOLW\ WKDW LW VWLPXODWHG SO WUDQVFULSWLRQ E\ UHDG WKURXJK IURP WKH S SURPRWHU ,I 5HS ERXQG WR WKH S 5%( ZDV QRW LWVHOI D WUDQVDFWLYDWRU ZH WKHQ FRQVLGHUHG WKH SRVVLELOLW\ WKDW LW KDG DQ DUFKLWHFWXUDO UROH :H KDG VKRZQ SUHYLRXVO\ WKDW 5HS ERXQG WR WKH S 5%( FRXOG IRUP D '1$ ORRS YLD SURWHLQ LQWHUDFWLRQ ZLWK 6SO ERXQG WR WKH SL SURPRWHU f ,W ZDV SRVVLEOH WKDW WKH LQWHUDFWLRQ EHWZHHQ 5HS DQG 6SO VHUYHG SULPDULO\ WR EULQJ WKH RWKHU S WUDQVFULSWLRQDO HOHPHQWV QDPHO\ WKH 0/7) DQG << FRPSOH[HVf WR WKH SL SURPRWHU DQG WKDW RQH RI WKHVH HOHPHQWV ZDV SULPDULO\ UHVSRQVLEOH IRU SL DFWLYDWLRQ ,I WKLV ZHUH WUXH WKHQ LW VKRXOG EH SRVVLEOH WR VXEVWLWXWH WKH 5HS DQG 6SO VLWHV ZLWK DOWHUQDWLYH HOHPHQWV WKDW ERXQG SURWHLQV WKDW ZHUH FDSDEOH RI LQWHUDFWLQJ 7R WHVW WKLV SRVVLELOLW\ ZH VXEVWLWXWHG ERWK WKH S 5%( DQG WKH S 6SO VLWH ZLWKLQ WKH SDUHQWDO SODVPLG S,0&$7 ZLWK *DO ELQGLQJ HOHPHQWV WR PDNH WKH SODVPLG FDOOHG [*$/ )LJ f 6XEVWLWXWLRQ RI WKH 5%( DQG 6SO VLWHV ZDV GRQH VR WKDW WKH VSDFLQJ LQ WKH S DQG SL SURPRWHUV UHPDLQHG WKH VDPH )LJ f :H WKHQ WHVWHG IRU S DFWLYDWLRQ LQ WKH SUHVHQFH RI WZR *DO IXVLRQ SURWHLQV WKDW FRQWDLQHG WKH ZHOO FKDUDFWHUL]HG LQWHUDFWLRQ GRPDLQV RI 69 7 DQWLJHQ DQG S f EXW GLG QRW

PAGE 70

)LJ 5HSODFHPHQW RI 5HS t 6SO ZLWK +\EULG *$/ )DFWRUV $ 7KH GLDJUDP LOOXVWUDWHV WKDW WKH 5%( LQ WKH S SURPRWHU DQG WKH 6SO VLWH LQ WKH SO SURPRWHU RI S,0&$7 ZHUH ERWK UHSODFHG ZLWK *$/ ELQGLQJ VLWHV 6HH )LJ IRU VSHFLILF VHTXHQFH PRGLILFDWLRQV ,Q WKH SUHVHQFH RI K\EULG *$/S DQG *$/7DJ IXVLRQ SURWHLQV WKH UHPDLQLQJ S SURPRWHU HOHPHQWV DQG WKHLU DVVRFLDWHG SURWHLQ FRPSOH[HV ZRXOG EH EURXJKW LQWR FORVH SUR[LPLW\ ZLWK WKH SL SURPRWHU UHVXOWLQJ LQ D '1$ ORRS VWUXFWXUH % 7UDQVDFWLYDWLRQ RI WKH S,0&$7 UHSRUWHU SODVPLG ZKHQ WUDQVIHFWHG DORQH 0RFNf ZLWK OPJ RI S,0 SODVPLG 5HSf ZLWK DQ DGHQRYLUXV LQIHFWLRQ 02, $Gf RU DQ $GHQRYLUXV LQIHFWLRQ DW 02, S,0 WUDQVIHFWLRQ $G t 5HSf 7KLV GDWD LV LGHQWLFDO WR WKDW LQ )LJ % DQG LV SUHVHQWHG KHUH IRU FRPSDULVRQf & 7UDQVDFWLYDWLRQ RI WKH [*$/ SODVPLG ZKHQ WUDQVIHFWHG DORQH 0RFNf ZLWK PJ RI S0 SODVPLG Sf ZLWK PJ RI S07J SODVPLG 7$Jf ZLWK PJ RI ERWK S0 DQG S07J SODVPLG S t 7$Jf ZLWK $G LQIHFWLRQ DW 02, $Gf ZLWK $G LQIHFWLRQ DW 02, DQG WKH WZR K\EULG SODVPLGV $G S 7$Jf RU ZLWK $G DW 02, DQG HLWKHU PJ S0 $G t Sf RU PJ S07J $G t 7$Jf

PAGE 71

<< << 0/7) ( D f! R R S t 7$J $G t S $G t 7$J ( $GS7$J 3,0&$7 [*$/ % &

PAGE 72

WKHPVHOYHV FRQWDLQ WUDQVFULSWLRQDO DFWLYDWLRQ GRPDLQV 6XEVWLWXWLRQ RI *$/ ELQGLQJ VLWHV IRU WKH S5%( DQG SL 6SO ES ELQGLQJ VLWHV ZLWKLQ WKH S,0&$7 UHSRUWHU SODVPLG ZDV H[SHFWHG WR DOORZ WKH *$/ '1$ ELQGLQJ GRPDLQV WR ELQG '1$ DQG FUHDWH D '1$ ORRS EHWZHHQ WKH WZR SURPRWHUV WKURXJK WKH S DQG 69 7$QWLJHQ LQWHUDFWLRQ GRPDLQV )LJ $f $V H[SHFWHG EDVDO SL &$7 DFWLYLW\ IURP WKH [*$/ SODVPLG ZDV ORZ DQG FRPSDUDEOH WR WKDW VHHQ ZLWK WKH SDUHQWDO S,0&$7 SODVPLG )LJ % DQG & FRPSDUH 0RFN ODQHVf ([SUHVVLRQ RI WKH *DO '1$ ELQGLQJ SURWHLQV DORQH LQGXFHG SL DFWLYLW\ E\ DSSUR[LPDWHO\ IROG ZKLOH LQIHFWLRQ ZLWK $G DORQH LQGXFHG SO DFWLYLW\ E\ DSSUR[LPDWHO\ IROG +RZHYHU ZKHQ ERWK WKH *DO IXVLRQ SURWHLQV DQG $G ZHUH SUHVHQW SL DFWLYLW\ ZDV LQGXFHG E\ IROG RYHU WKH EDVDO OHYHO 7UDQVIHFWLRQ ZLWK RQO\ RQH RI WKH *$/ IXVLRQ SODVPLGV S RU 7DJf DQG LQIHFWLRQ ZLWK $G GLG QRW LQGXFH SL DFWLYDWLRQ 7KHVH UHVXOWV GHPRQVWUDWHG WKDW DQ LQWHUDFWLRQ EHWZHHQ DQ DFWLYDWHG S SURPRWHU ZKLFK RFFXUV LQ WKH SUHVHQFH RI $G LQIHFWLRQ DQG WKH SL SURPRWHU ZDV HVVHQWLDO IRU SL DFWLYDWLRQ DQG WKDW WKLV FRXOG EH HQJLQHHUHG LQ WKH DEVHQFH RI 5HS DQG 6SO HOHPHQWV ,W DOVR VXJJHVWHG WKDW 5HS DQG 6SO SUREDEO\ IXQFWLRQ SULPDULO\ DV DUFKLWHFWXUDO SURWHLQV DQG DFWLYDWH S E\ EULQJLQJ RWKHU S HOHPHQWV LQWR FORVH SUR[LPLW\ ZLWK WKH SL SURPRWHU 7KH OHYHO RI SL DFWLYLW\ VHHQ LQ WKH SUHVHQFH RI WKH WZR *DO IXVLRQ SURWHLQV DQG $G ZDV DSSUR[LPDWHO\ KDOI RI WKDW VHHQ LQ WKH SDUHQWDO S,0&$7 SODVPLG LQ WKH SUHVHQFH RI 5HS DQG $G FRPSDUH )LJ ,% 5HS ZLWK & $G S 7DJf 7KLV ZDV FRQVLVWHQW ZLWK WKH IDFW WKDW XQOLNH WKH S,0&$7 SODVPLG ZKLFK ELQGV 5HS DQG 6SO DW GLVWLQFW VLWHV WKH [*$/ SODVPLG FRXOG ELQG WKH VDPH IXVLRQ SURWHLQ HLWKHU 7 DQWLJHQ RU

PAGE 73

Sf DW HDFK *$/ ELQGLQJ VLWH S DQG SLf :KHQ WKLV KDSSHQHG LW ZRXOG OHDG WR OLWWOH RU QR LQWHUDFWLRQ EHWZHHQ S DQG SL DQG SUHVXPDEO\ QR DFWLYDWLRQ 7KLV ZRXOG WKHRUHWLFDOO\ RFFXU b RI WKH WLPH WKXV WKH [*$/ SODVPLG ZDV H[SHFWHG WR EH DFWLYDWHG DERXW KDOI DV ZHOO DV WKH SDUHQWDO S,0&$7 SODVPLG ,QGHHG WUDQVIHFWLRQ ZLWK RQO\ RQH RI WKH *$/ IXVLRQ SURWHLQV LQ WKH SUHVHQFH RI $G LQKLELWHG WKH DFWLYDWLRQ QRUPDOO\ VHHQ ZLWK $G )LJ & $G t S RU $G t 7DJ ODQHVf $OWHUQDWLYHO\ WKH 6SO VLWH PD\ FRQWULEXWH WR WKH EDVDO OHYHO RI WKH SL SURPRWHU RU WR LWV DELOLW\ WR EH LQGXFHG E\ WKH $G (O D JHQH SURGXFW LQGHSHQGHQWO\ RI DQ LQWHUDFWLRQ ZLWK WKH S SURPRWHU HOHPHQWV :KLFK S HOHPHQW LV SULPDULO\ UHVSRQVLEOH IRU 5HS PHGLDWHG LQGXFWLRQ RI SL" ,I WKH UROH RI WKH S 5%( LV WR EULQJ VRPH RWKHU HOHPHQW WR WKH SL SURPRWHU ZKLFK RI WKH NQRZQ S SURPRWHU HOHPHQWV 0/7) 7$7$ RU <
PAGE 74

)LJ 7UDQVDFWLYDWLRQ RI WKH [*$/ SO SURPRWHU E\ PXWDQW S SURPRWHUV 7KH [*$/ SODVPLG FRQWDLQLQJ D ZLOG W\SH RU PXWDQW S SURPRWHU ZDV WUDQVIHFWHG DORQH 0RFNf ZLWK PJ HDFK RI WKH K\EULG *$/S DQG *$/7DJ H[SUHVVLQJ SODVPLGV S0 DQG S07J +\EULGf ZLWK DQ $GHQRYLUXV LQIHFWLRQ DW 02, $Gf RU ZLWK DQ $GHQRYLUXV LQIHFWLRQ DW 02, DQG WKH K\EULG *$/ H[SUHVVLQJ SODVPLGV $G t +\EULGf 6HH )LJ IRU VSHFLILF VHTXHQFH PRGLILFDWLRQV $ 7UDQVDFWLYDWLRQ RI WKH [*$/ SODVPLG FRQWDLQLQJ D ZLOG W\SH S SURPRWHU 7KHVH YDOXHV DUH H[WUDFWHG IURP )LJ % DQG SUHVHQWHG KHUH IRU FRPSDULVRQf % 7UDQVDFWLYDWLRQ RI WKH [*$/ UHSRUWHU FRQVWUXFW ODFNLQJ WKH S SURPRWHU 0/7) ELQGLQJ VLWH & 7UDQVDFWLYDWLRQ RI WKH [*$/ UHSRUWHU FRQVWUXFW ODFNLQJ WKH S SURPRWHU << ELQGLQJ VLWH 7UDQVDFWLYDWLRQ RI WKH [*$/ UHSRUWHU FRQVWUXFW ODFNLQJ WKH S SURPRWHU 0/7) DQG << ELQGLQJ VLWHV ( 7UDQVDFWLYDWLRQ RI WKH [*$/ UHSRUWHU FRQVWUXFW ODFNLQJ WKH S SURPRWHU 0/7) << DQG << ELQGLQJ VLWHV

PAGE 75

&$7 $FWLYLW\ FSPf , 0RFN , +\EULG $G [*$/ [*$/ VXE0/7) [*$/ VXE<< [*$/ VXE0/7) VXE<< [*$/ VXE0/7) VXE<< VXE<< $ % & (

PAGE 76

0XWDWLRQ RI WKLV VLWH LQ WKH S SURPRWHU LQFUHDVHG EDVDO WUDQVFULSWLRQ IURP WKH SO SURPRWHU E\ IROG FRPSDUH )LJ $ PRFN ZLWK & PRFNf DQG LQ WKH SUHVHQFH RI $G SO WUDQVFULSWLRQ ZDV LQFUHDVHG IROG )LJ $ $G DQG & $Gf 7KH << HOHPHQW KDV EHHQ VKRZQ SUHYLRXVO\ f WR UHSUHVV WKH S SURPRWHU LQ WKH DEVHQFH RI $G RU 5HS 2XU GDWD )LJV $ &f LQGLFDWHV WKDW WKH << VLWH DOVR KDV D QHJDWLYH HIIHFW RQ SL WUDQVFULSWLRQ ERWK LQ WKH SUHVHQFH DQG WKH DEVHQFH RI $G ,Q WKHVH WZR FDVHV QR *$/ IXVLRQ SURWHLQV ZHUH SUHVHQW WKXV LQWHUDFWLRQ EHWZHHQ WKH S DQG SO HOHPHQWV WKURXJK WKH *DO VLWHV ZDV QRW SRVVLEOH 7KLV PHDQV WKDW RWKHU NLQGV RI LQWHUDFWLRQV EHWZHHQ S DQG SO PXVW EH RFFXUULQJ LQ DGGLWLRQ WR WKRVH WKDW RFFXU EHWZHHQ WKH *DO VLWHV LH WKH S 5%( DQG WKH SL 6SO VLWHVf 6HFRQG PXWDWLRQ RI WKH 0/7) VLWH DOVR SURGXFHG DQ LQFUHDVH IROGf LQ WKH EDVDO OHYHO RI SL H[SUHVVLRQ )LJ $ DQG % PRFN ODQHVf /LNH WKH << VLWH WKH 0/7) VLWH KDG EHHQ VKRZQ SUHYLRXVO\ WR UHSUHVV S LQ WKH DEVHQFH RI $G f 2XU UHVXOWV LQGLFDWH WKDW LW DOVR UHSUHVVHV WKH SL SURPRWHU LQ WKH DEVHQFH RI $G SRVVLEO\ E\ D VHW RI SSO LQWHUDFWLRQV WKDW DUH GLVWLQFW IURP WKRVH PHGLDWHG E\ WKH << VLWH DQG WKH *DO 5HS6SOf VLWHV 7UDQVFULSWLRQDO $QDO\VLV RI 0XWDQW 5HS 3URWHLQV 0XOWLSOH VWXGLHV RI WKH $$9 5HS SURWHLQV KDYH GHPRQVWUDWHG WKDW WKH HQ]\PDWLF DFWLYLWHV RI 5HS FRXOG EH ORFDOL]HG LQWR IXQFWLRQDO VXEXQLWV ZLWKLQ WKH SURWHLQ +RZHYHU WKH FRPSOHWH HOLPLQDWLRQ RI RQH ELRORJLFDO DFWLYLW\ XVXDOO\ UHVXOWV LQ WKH ORVV RI VHYHUDO RWKHUV 7KH EHVW H[DPSOH RI WKLV LQWHUDFWLYH HIIHFW LV WKH QXFOHRWLGH ELQGLQJ GRPDLQ PXWDWLRQV 7KH ORVV RI WKLV $73DVH GRPDLQ UHPRYHV 5HS WUV HQGRQXFOHDVH DFWLYLW\ DQG '1$ UHSOLFDWLRQ EXW DOVR FUHDWHV D GHIHFW LQ WUDQVFULSWLRQDO WUDQVDFWLYDWLRQ IRU ERWK WKH SL DQG S SURPRWHUV f $V UHVXOW D PRUH GHWDLOHG PXWDJHQHVLV RI WKH $$9 5HS

PAGE 77

SURWHLQ ZDV UHTXLUHG WR LGHQWLI\ GLVFUHWH SURWHLQ GRPDLQV IRU HDFK LQGLYLGXDO HQ]\PDWLF DFWLYLW\ $ SUHYLRXV VWXG\ XVHG WKH FRPPRQ PHWKRG RI FKDUJHWRDODQLQH PXWDJHQHVLV IRU WKH SURGXFWLRQ RI WHPSHUDWXUH VHQVLWLYH PXWDWLRQV $IWHU DQ LQLWLDO VFUHHQLQJ RI GLIIHUHQW 5HS PXWDQWV WKH\ LVRODWHG PXWDQWV ZLWK VHSDUDWH FRQGLWLRQDO OHWKDO SKHQRW\SHV 7KH ILUVW PXWDQW KDG DQ LQLWLDO SURWHLQ LQVWDELOLW\ GHIHFW WKDW ZDV FKDUDFWHUL]HG DV D 0J ELQGLQJ PXWDWLRQ f 7KLV 0J GHSHQGHQW PXWDQW ZDV QRW UHTXLUHG IRU 5HS '1$ ELQGLQJ RU KHOLFDVH EXW ZDV FULWLFDO IRU WHUPLQDO UHSHDW HQGRQXFOHDVH DFWLYLW\ 7KH VHFRQG PXWDQW ZDV LGHQWLILHG DV D WHPSHUDWXUH VHQVLWLYH PXWDWLRQ WKDW ZDV GHIHFWLYH IRU LQWUDFHOOXODU UHSOLFDWLRQ RI $$9 7KLV WHPSHUDWXUH VHQVLWLYLW\ FUHDWHG D ORJ WLWHU GLIIHUHQFH EHWZHHQ WKH SHUPLVVLYH & WHPSHUDWXUH DQG QRQSHUPLVVLYH & WHPSHUDWXUH *HQHUDWLRQ RI 5HS 0XWDQW 3ODVPLGV ,Q RUGHU WR SURGXFH D ODUJH QXPEHU RI SRVVLEOH $$9 5HS WV PXWDQWV D FKDUJHWR DODQLQH DPLQR DFLG PXWDJHQHVLV DSSURDFK ZDV SHUIRUPHG RQ WKH 5HS RSHQ UHDGLQJ IUDPH 7KLV SURFHVV LV EHOLHYHG WR GLVUXSW IXQFWLRQDO GRPDLQV RQ WKH SURWHLQ VXUIDFH DQG UHVXOW LQ FRQGLWLRQDO OHWKDO PXWDQWV :LWKLQ WKH SODVPLG EDFNERQH RI S,0 D QRQLQIHFWLRXV JHQRPLF VXEFORQH RI WKH $$9 JHQRPH GLIIHUHQW FOXVWHUV RI FKDUJHG DPLQR DFLGV ZHUH VXEVWLWXWHG ZLWK DODQLQH DPLQR DFLGV 7DEOH f 7KH S,0 SODVPLG DOORZHG WKH UHVXOWLQJ SURWHLQ VHTXHQFH FKDQJHV WR EH H[SUHVVHG LQ DOO IRXU 5HS SURWHLQV 0XWDJHQHVLV LQ HYHU\ 5HS SURWHLQ ZRXOG DOORZ SRVVLEOH FRQGLWLRQDO OHWKDOV WR EH DVVD\HG IRU LQ YLYR ELRORJLFDO HIIHFWV 7KH H[SUHVVLRQ RI ERWK 5HS DQG 5HS PXWDQW SURWHLQV FRXOG EH XVHG WR GHWHFW FRQGLWLRQDO OHWKDOV ZLWKLQ DVVD\V IRU WHUPLQDO UHSHDW HQGRQXFOHDVH DFWLYLW\ '1$ UHSOLFDWLRQ DQG YLUDO WUDQVFULSWLRQ 3UHYLRXV UHVHDUFK DQG VLWHGLUHFWHG

PAGE 78

7DEOH %LRFKHPLFDO $FWLYLWLHV RI 5HS $ODQLQH 6FDQQLQJ 0XWDJHQHVLV 3DQHO ,Q WKLV 7DEOH HDFK 5HS PXWDQW ZDV DVVD\HG IRU LWV DELOLW\ WR IXQFWLRQ DV D SRVVLEOH PXWDQW LQ $GHQR$VVRFLDWHG 9LUXVfV NQRZQ ELRFKHPLFDO DFWLYLWLHV :LWKLQ WKH SODVPLG EDFNERQH RI S,0 D QRQLQIHFWLRXV JHQRPLF VXEFORQH RI WKH $$9 JHQRPH GLIIHUHQW FOXVWHUV RI FKDUJHG DPLQR DFLGV ZHUH VXEVWLWXWHG ZLWK DODQLQH DPLQR DFLGV

PAGE 79

$PLQR $FLG &KDQJHVf 7LWHU LQ YLYR 5HSOLFDWLRQ %LQGLQJ $73 DVH P KHOLFDVH 1LFN 1LFN 'RXEOH6WUDQGHG 1R6WHP 7HPSODWH 7HPSODWH ZLOG W\SH .$'$ f§ '$'$'$ WV WV WV WV +$+$ f§ <) f§ .$($ f§ f§ .+ f§ ($+$ '$.$ f§ .$+$ QG QG QG QG QG ($.$ f§ ($.$($ QG QG 5$5$.$ QG QG '$($ QG QG 5$ QG QG '$.$ QG QG .$'$ QG QG ( $'$ QG QG '$+$'$ QG QG ($($ QG QG '$'$ QG QG '$($ QG QG

PAGE 80

PXWDJHQHVLV RI WKH $$9 5HS SURWHLQ KDV UHVXOWHG LQ WKH SUHOLPLQDU\ LGHQWLILFDWLRQ RI D WHPSHUDWXUH VHQVLWLYH PXWDQW f 7KLV PXWDQW '$ '$ '$ KDG D GHOD\HG UHSOLFDWLRQ SKHQRW\SH WKDW UHVXOWHG LQ D ORJ GLIIHUHQFH LQ YLUDO WLWHU EHWZHHQ & DQG & :H KDYH GHWHUPLQHG WKH HQ]\PDWLF DFWLYLW\ DIIHFWHG E\ WKLV SURWHLQ VHTXHQFH FKDQJH DV ZHOO DV VFUHHQHG D SDQHO RI QHZ 5HS FKDUJHWRDODQLQH PXWDQWV :H KDYH DVVD\HG WKHLU DELOLW\ WR H[KLELW D WHPSHUDWXUH VHQVLWLYH SKHQRW\SH DQG ORFDOL]HG WKH VSHFLILF HQ]\PDWLF DFWLYLWLHV DIIHFWHG ZLWKLQ WKHVH UHSOLFDWLRQ GHIHFWLYH PXWDQWV 7UDQVFULSWLRQDO $FWLYDWLRQ RI WKH SL 3URPRWHU E\ 5HS 0XWDQWV ,Q RUGHU WR GLUHFWO\ H[DPLQH WKH WUDQVFULSWLRQDO DFWLYDWLRQ RI HDFK FKDUJHWR DODQLQH PXWDQW RQ WKH SL SURPRWHU S,0&$7 ZDV XVHG WR DVVD\ HDFK 5HS PXWDQW IRU LWV DELOLW\ WR VSHFLILFDOO\ WUDQVDFWLYDWH WKH S SURPRWHU GXULQJ $GHQRYLUXV LQIHFWLRQ 7KH S,0&$7 FRQVWUXFW KDG D VWURQJ OHYHO RI 5HS PHGLDWHG WUDQVDFWLYDWLRQ WKDW LV FRPSDUDEOH WR SUHYLRXVO\ SXEOLVKHG UHVXOWV )LJ /DQHV DQG f /DFNQHU DQG 0X]\F]ND LQ SUHVVf +RZHYHU WKH FRWUDQVIHFWLRQ RI VHYHUDO UHSOLFDWLRQ GHIHFWLYH PXWDQWV GXULQJ DQ $GHQRYLUXV LQIHFWLRQ UHVXOWHG LQ HYHQ KLJKHU OHYHOV RI SL WUDQVFULSWLRQDO DFWLYDWLRQ )LJ ODQHV DQG f 2QH RI WKHVH PXWDQWV .+ LV WKH ZHOO FKDUDFWHUL]HG QXFOHRWLGH ELQGLQJ PXWDQW f 3UHYLRXV VWXGLHV KDYH VKRZQ WKDW WKLV PXWDQW LV GHIHFWLYH IRU ERWK $73DVH DQG 0 KHOLFDVH DFWLYLW\ EXW UHWDLQV '1$ ELQGLQJ DFWLYLW\ :HJHU HW DO f KDYH DVVD\HG LWV DELOLW\ WR WUDQVDFWLYDWH WKH SL DQG S SURPRWHUV ZKLFK UHVXOWHG LQ PXFK KLJKHU OHYHOV RI $$9 JHQH H[SUHVVLRQ $OWKRXJK WKLV VDPH .+ PXWDQW ZDV XQDEOH WR VWLPXODWH JHQH H[SUHVVLRQ LQ DQ $$9 FRQVWUXFW FRQWDLQLQJ WKH WHUPLQDO UHSHDWV WKH ORVV RI WUDQVFULSWLRQDO DFWLYDWLRQ ZDV EHOLHYHG WR EH WKH UHVXOW RI WKH ORVV RI '1$ UHSOLFDWLRQ RQ WKH WUDQVFULSWLRQDO WHPSODWH DQG QRW LWV LQDELOLW\ WR WUDQVDFWLYDWH WKH SO SURPRWHU

PAGE 81

)LJ 7UDQVFULSWLRQDO $FWLYDWLRQ RI WKH SL 3URPRWHU E\ 5HS 0XWDQW 3DQHO S,0&$7 UHSRUWHU SODVPLG ZDV XVHG WR DVVD\ HDFK 5HS PXWDQW SURWHLQ IRU LWV DELOLW\ WR WUDQVDFWLYDWH WKH SL SURPRWHU $ 5HS SURWHLQ H[SUHVVLRQ SODVPLG S,0 FRQWDLQLQJ WKH YDULRXV DODQLQH VFDQQLQJ PXWDQWV ZDV FRWUDQVIHFWHG ZLWK $GHQRYLUXV WR WUDQVDFWLYDWH WKH SL SURPRWHU

PAGE 83

$QRWKHU PXWDQW FRQVWUXFW <) ZDV XVHG DV DQ H[SHULPHQWDO FRQWURO LQ WKH S,0&$7 WUDQVFULSWLRQDO DVVD\ 7KLV PXWDQW KDV VSHFLILFDOO\ WDUJHWHG WKH W\URVLQH UHVLGXH DW DPLQR DFLG SRVLWLRQ ZKLFK KDV GLUHFW UROH LQ WKH HQGRQXFOHDVH FOHDYDJH UHDFWLRQ GXULQJ $$9 '1$ UHSOLFDWLRQ 7KH $$9 WHUPLQDO UHSHDW LV FOHDYHG E\ WKH W\URVLQH UHVLGXH DQG VXEVWLWXWLRQ RI D SKHQ\ODODQLQH DW WKLV SRVLWLRQ FUHDWHG D UHSOLFDWLRQ GHIHFWLYH PXWDQW f 7KH <) PXWDQW KDG QR VLJQLILFDQW GLIIHUHQFH LQ LWV DELOLW\ WR WUDQVDFWLYDWH WKH S SURPRWHU LQ WKH S,0&$7 SODVPLG EDFNJURXQG )LJ ODQH f 7KLV PXWDQW KDV D IXQFWLRQDO $73DVH DQG KHOLFDVH DFWLYLW\ f 7KH WKUHH RWKHU PXWDQWV UHWDLQ WKHLU $73DVH DQG KHOLFDVH DFWLYLW\ EXW DOVR H[SUHVV PXFK KLJKHU OHYHOV RI SL JHQH H[SUHVVLRQ )LJ ODQHV DQG f $OO WKUHH RI WKHVH PXWDQWV DUH DEOH WR ELQG WKH WHUPLQDO UHSHDW EXW DUH XQDEOH WR QLFN DW WKH WUV VLWH 2QH UHDVRQ IRU WKLV KLJKHU H[SUHVVLRQ FRXOG EH DQ DOWHUDWLRQ LQ 5HS'1$ ELQGLQJ RQ WKH S SURPRWHU 7KH IRUPDWLRQ RI VWDEOH 5HS SURWHLQ FRPSOH[HV RQ WKH S 5%( PD\ DOORZ WKH '1$ ORRS EHWZHHQ WKH S DQG SL SURPRWHUV WR RFFXU PRUH RIWHQ DQG WUDQVDFWLYDWH WKH SO SURPRWHU WKURXJK 6SO DW D PXFK KLJKHU UDWH $QRWKHU UHDVRQ IRU D KLJKHU OHYHO RI SL WUDQVDFWLYDWLRQ PD\ EH D GLIIHUHQFH LQ ELQGLQJ DIILQLW\ EHWZHHQ WKH PXWDWHG 5HS SURWHLQV DQG WKH 6SO SURWHLQ ERXQG DW WKH SL SURPRWHU 7KH PRVW LQWHUHVWLQJ UHVXOW ZDV WKH GUDPDWLF GHFUHDVH LQ SO SURPRWHU WUDQVDFWLYDWLRQ IRU WKH ($ +$ DQG $ .$ PXWDQWV 7KHVH PXWDQWV KDYH PDLQWDLQHG WKHLU '1$ ELQGLQJ $73DVH DQG KHOLFDVH DFWLYLWLHV DOWKRXJK WKH\ DUH GHIHFWLYH LQ SL SURPRWHU WUDQVDFWLYDWLRQ 7KH SL SURPRWHU DVVD\ XVLQJ WKH S,0&$7 UHSRUWHU JHQH SODVPLG ZDV GHIHFWLYH IRU ERWK RI WKHVH PXWDQWV DV FRPSDUHG WR WKH ZW 5HS SURWHLQ $OWKRXJK WKH\ ZHUH DERYH WKH OHYHO RI SL WUDQVDFWLYDWLRQ ZLWK

PAGE 84

$GHQRYLUXV DORQH WKH PXWDQWV GLG QRW FRPSOHWHO\ FRPSOHPHQW WKH DELOLW\ RI 5HS WR PHGLDWH SL WUDQVDFWLYDWLRQ )LJ ODQHV DQG f 7KH GLVUXSWLRQ RI 5HS PHGLDWHG WUDQVDFWLYDWLRQ LQ ERWK RI WKHVH PXWDQWV PD\ EH LQ GLIIHUHQW SURWHLQ GRPDLQ EXW PD\ DIIHFW D VLPLODU RYHUDOO IXQFWLRQ 7KH ($ +$ PXWDQW KDV DQ LQWHUHVWLQJ FKDUDFWHULVWLF LQ WKDW LW PXWDWHV D SRWHQWLDO +0* ER[ WKDW PD\ FRQWULEXWH WR D SRVVLEOH PHFKDQLVP RI WUDQVDFWLYDWLRQ 7KH SRWHQWLDO +0* ER[ GRPDLQ PD\ EH UHVSRQVLEOH IRU VHSDUDWLRQ RI '1$ VWUDQGV DQG WKH LQLWLDWLRQ RI JHQH H[SUHVVLRQ IRU WKLV PXWDQW 5HS SURWHLQ 7KH DOWHUDWLRQ RI WKLV SURWHLQ GRPDLQ PD\ SUHYHQW WKH FRUUHFW OHYHO RI S WUDQVDFWLYDWLRQ WKURXJK WKH DFWLRQ RI 5HS LQYDGLQJ WKH '1$ VWUDQGV DW WKH S RU WHUPLQDO UHSHDW 7KH +0* ER[ PD\ SHUPLW WKH FRUUHFW 5HS SURWHLQ FRPSOH[ WR IRUP RQ WKH S SURPRWHU DQG FRUUHFWO\ FRQWDFW WKH 6SO ERXQG DW WKH SL SURPRWHU 7KLV UHTXLUHPHQW RI VWUDQG LQYDVLRQ PD\ EH GHSHQGHQW RQ KHOLFDVH DFWLYLW\ DV ZHOO DV D IXQFWLRQDO +0* SURWHLQ GRPDLQ 7KH '$ .$ GRHV QRW DSSHDU WR GLUHFWO\ DIIHFW DQ\ LGHQWLILDEOH SURWHLQ GRPDLQV EXW LWV ORFDWLRQ LV FORVH WR ERWK D VWURQJ 5HS5HS LQWHUDFWLRQ GRPDLQ DQG D SUHYLRXVO\ LGHQWLILHG WRSRLVRPHUDVH SURWHLQ VHTXHQFH 7KLV SURWHLQ GRPDLQ FRXOG EH UHVSRQVLEOH IRU WKH DVVHPEO\ RI ODUJH 5HS SURWHLQ FRPSOH[HV WKDW IRUP RQ WKH YDULRXV 5%(V ZLWKLQ WKH $$9 JHQRPH 7KLV PXWDQW GRHV QRW LQLWLDOO\ DSSHDU WR WDUJHW D FULWLFDO GRPDLQ UHTXLUHG IRU 5HS5HS LQWHUDFWLRQV EXW LW DSSHDUV WR KDYH PXOWLSOH SUREOHPV UHJXODWLQJ WKH WUDQVFULSWLRQDO DFWLYDWLRQ RI WKH SL SURPRWHU DV ZHOO DV WKH DELOLW\ RI 5HS WR UHSUHVV WKH S SURPRWHU 5HSUHVVLRQ RI WKH S SURPRWHU 2QH RI WKH PRVW LPSRUWDQW FKDUDFWHULVWLFV RI WKH $$9 OLIHF\FOH LV WR UHSUHVV WKH H[SUHVVLRQ RI WKH 5HS JHQH LQ WKH DEVHQFH RI DQ $GHQRYLUXV LQIHFWLRQ f ,Q RUGHU WR ORFDOL]H WKH 5HS SURWHLQ GRPDLQ UHVSRQVLEOH IRU WKLV ELRORJLFDO DFWLYLW\ WKH HQWLUH 5HS

PAGE 85

PXWDQW SDQHO ZDV DVVD\HG IRU LWV DELOLW\ WR UHSUHVV S WUDQVFULSWLRQ LQ WKH DEVHQFH RI DQ $GHQRYLUXV FRLQIHFWLRQ ,Q WKLV DVVD\ RI WKH S SURPRWHU WKH S&$7 SURPRWHU ZDV WUDQVIHFWHG LQWR $ FHOOV DQG DVVD\HG IRU LWV DELOLW\ WR EH UHSUHVVHG LQ WKH SUHVHQFH RI D PXWDQW 5HS SURWHLQ $V D QHJDWLYH FRQWURO WKH QRQVHQVH PXWDQW 5HS G$;; ZDV WUDQVIHFWHG WR GHWHUPLQH WKH EDVDO VWUHQJWK RI WKH S&$7 SURPRWHU )LJ ODQH f :KHQ WKH ZW 5HS SURWHLQ ZDV WUDQVIHFWHG LQWR $ FHOOV WKH WUDQVFULSWLRQDO DFWLYLW\ RI WKH S SURPRWHU LV b RI LWV EDVDO DFWLYLW\ GHPRQVWUDWLQJ D VWURQJ OHYHO RI UHSUHVVLRQ E\ WKH 5HS SURWHLQ )LJ ODQH f ,W ZDV LQWHUHVWLQJ WR QRWH WKDW DOO RI WKH 5HS UHSOLFDWLRQ PXWDQWV WKDW ZHUH GHIHFWLYH LQ WUDQVDFWLYDWLRQ RI SO ZHUH DOVR JUHDWO\ UHGXFHG LQ WKHLU DELOLW\ WR UHSUHVV WKH S SURPRWHU 6WULNLQJO\ WKH WZR PXWDQWV ($ +$ DQG '$.$ H[KLELWHG PXFK ORZHU 5HS PHGLDWHG WUDQVDFWLYDWLRQ RI WKH SO SURPRWHU DQG ZHUH XQDEOH WR UHSUHVV WKH S SURPRWHU WKURXJK 5HS'1$ ELQGLQJ DFWLYLW\ (DFK RI WKHVH WZR PXWDQWV KDG IROG KLJKHU OHYHOV RI S SURPRWHU H[SUHVVLRQ UHVXOWLQJ IURP WKH LQDELOLW\ RI WKHVH 5HS SURWHLQV WR FRUUHFWO\ ELQG WKH S 5%( DQG UHSUHVVLQJ WKH SURPRWHU )LJ ($ +$ DQG '$.$ f 7KH PRGLILFDWLRQ RI WKH +0* ER[ PD\ UHVXOW LQ 5HS SURWHLQ ZKLFK LV XQDEOH WR FRUUHFWO\ DVVHPEOH ODUJH 5HS FRPSOH[HV DQG UHSUHVV WKH S SURPRWHU 7KH KLJKHVW GHJUHH RI ORZHU UHSUHVVLRQ RI WKH S SURPRWHU LV GLUHFWO\ UHODWHG WR LWV GLVWDQFH WR WKH +0* ER[ GRPDLQ

PAGE 86

)LJ 7UDQVFULSWLRQDO 5HSUHVVLRQ RI WKH S 3URPRWHU E\ 5HS 0XWDQW 3DQHO S&$7 UHSRUWHU SODVPLG ZDV FRWUDQVIHFWHG ZLWK YDULRXV 5HS DODQLQH VFDQQLQJ PXWDWLRQV 7KH EDVDO OHYHO RI S SURPRWHU DFWLYLW\ ZDV JUDSKLFDOO\ VKRZQ DV IROG RI DFWLYLW\ 7KH DELOLW\ RI HDFK 5HS PXWDQW WR UHSUHVV WKH S SURPRWHU ZDV VKRZQ DV D SHUFHQWDJH RI S EDVDO DFWLYLW\

PAGE 87

3HUFHQW RI %DVDO S 3URPRWHU $FWLYLW\ 2 2 2 2 2 E .! A Ef ER R L OLO L O L O

PAGE 88

&+$37(5 ',6&866,21 7R OHDUQ PRUH DERXW KRZ WKH 5HS SURWHLQ FRQWUROV $$9 WUDQVFULSWLRQ ZH WHVWHG VHYHUDO PHFKDQLVPV RI WUDQVFULSWLRQDO FRQWURO 8VLQJ WKH &$7 JHQH DV D UHSRUWHU ZH ILUVW FRQILUPHG WKDW DFWLYDWLRQ RI WKH SL SURPRWHU E\ 5HS ZDV GHSHQGHQW RQ D IXQFWLRQDO 5%( ZLWKLQ WKH S SURPRWHU )LJ f $V H[SHFWHG SL DFWLYLW\ ZDV VLJQLILFDQWO\ UHGXFHG LQ WKH DEVHQFH RI 5HS RU LQ WKH DEVHQFH RI WKH S 5%( SURYLGHG WKDW WKH FHOOV KDG EHHQ LQIHFWHG ZLWK DGHQRYLUXV 7KLV FRQILUPHG WKH UHVXOWV RI VHYHUDO SUHYLRXV VWXGLHV LQFOXGLQJ RXU RZQ f ,Q DGGLWLRQ ZH PHDVXUHG DFFXUDWHO\ WKH LQGXFWLRQ RI WKH SL SURPRWHU E\ $G LQIHFWLRQ DQG 5HS H[SUHVVLRQ DQG WKH UDQJH IURP EDVDO WR IXOO\ LQGXFHG ZDV DOPRVW ORJV 7KH 5%( LV QRW D W\SLFDO XSVWUHDP DFWLYDWLRQ VLJQDO :H LQLWLDOO\ H[SHFWHG WKDW 5HS ZRXOG DFWLYDWH WKH SL SURPRWHU LQ WKH VDPH ZD\ WKDW LWV KRPRORJXH LQ WKH DXWRQRPRXV SDUYRYLUXV IDPLO\ WUDQVDFWLYDWHV WKH S FDSVLG SURPRWHU 7KH 090 5HS DQDORJ 16 KDV EHHQ VKRZQ WR LQGXFH WUDQVFULSWLRQ IURP WKH S FDSVLG SURPRWHU E\ ELQGLQJ WR D QHDUE\ 16 ELQGLQJ VLWH DQG LQWHUDFWLQJ ZLWK DQ 6SO VLWH XSVWUHDP RI S f ,Q WKH FDVH RI 16 LW LV FOHDU WKDW D & WHUPLQDO DFWLYDWLRQ GRPDLQ LV HVVHQWLDO IRU LQGXFWLRQ f DQG WKDW 16 ELQGLQJ VLWHV EHKDYH OLNH XSVWUHDP DFWLYDWLRQ VLJQDOV 7R WHVW WKLV SRVVLELOLW\ IRU 5HS WKH 5%( ZDV SODFHG DW VHYHUDO SRVLWLRQV XSVWUHDP RU GRZQVWUHDP RI DQ DUWLILFLDO S SURPRWHU WKDW FRQWDLQHG WKH NH\ SL SURPRWHU

PAGE 89

HOHPHQWV UHTXLUHG IRU 5HS DFWLYDWLRQ )LJ f +RZHYHU VXUSULVLQJO\ WKH 5%( UHVXOWHG SULPDULO\ LQ UHSUHVVLRQ RI WKH S SURPRWHU DQG LQ JHQHUDO UHSUHVVLRQ ZDV PRVW VHYHUH ZKHQ WKH 5%( ZDV FORVHVW WR WKH S VWDUW VLWH 6HYHUDO SRLQWV DUH ZRUWK QRWLQJ DERXW WKLV H[SHULPHQW )LUVW LQ WKH SUHVHQFH RI DGHQRYLUXV LQIHFWLRQ 5HS ZDV QRW FDSDEOH RI WUDQVDFWLYDWLQJ WKH S SURPRWHU ZKHQ RQO\ WKH 5%( ZDV LQVHUWHG LQWR WKH FRQVWUXFW 7KLV FOHDUO\ VKRZHG WKDW WKH 5%(5HS FRPSOH[ DORQH ZDV QRW VXIILFLHQW IRU WUDQVDFWLYDWLRQ ,W LV DOVR FRQVLVWHQW ZLWK WKH IDFW WKDW WR GDWH DQ DFWLYDWLRQ GRPDLQ KDV QRW EHHQ IRXQG LQ 5HS 2QO\ WKH & WHUPLQDO HQG RI 5HS KDV EHHQ IRXQG WR DFWLYDWH WUDQVFULSWLRQ LQ WZR K\EULG H[SHULPHQWV DQG WKLV UHJLRQ ZKLFK LV DEVHQW LQ 5HS LV QRW HVVHQWLDO IRU S RU S DFWLYDWLRQ f 7KH VHFRQG SRLQW ZRUWK QRWLQJ LV WKDW WKH OHYHO RI UHSUHVVLRQ GHSHQGHG RQ WKH FRQGLWLRQV RI PHDVXUHPHQW DQG WKH GLVWDQFH RI WKH 5%( IURP WKH VWDUW RI WKH SL P51$ :KHQ $G LQIHFWHG FHOOV ZHUH FRPSDUHG ZLWK FHOOV LQIHFWHG ZLWK $G DQG H[SUHVVLQJ 5HS WKH UHSUHVVLRQ ZDV PRGHVW DW PRVW IROG LQ WKH FDVH RI WKH SRVLWLRQf :KHQ 5HS ZDV H[SUHVVHG E\ LWVHOI LQ WKH DEVHQFH RI $Gf WKHUH ZDV D IROG LQGXFWLRQ RI S DFWLYLW\ H[FHSW LQ WKH FDVH RI WKH FRQVWUXFWf +RZHYHU LW ZDV FOHDU WKDW SODFHPHQW RI WKH 5%( FORVH WR WKH S SURPRWHU KDG D VHYHUH HIIHFW RQ SO DFWLYLW\ 7KLV ZDV WUXH HYHQ LQ WKH DEVHQFH RI 5HS H[SUHVVLRQ ZKHQ $G ZDV SUHVHQW )LJ $G RQO\ ODQHVf VXJJHVWLQJ WKDW D FHOOXODU IDFWRU DV ZHOO DV 5HS ZHUH DEOH WR LQWHUDFW ZLWK WKH 5%( WR FDXVH UHSUHVVLRQ :KHQ WKH 5%( ZDV LQVHUWHG DW WKH SRVLWLRQ ZLWKLQ WKH S SURPRWHU D UHJLRQ SUHYLRXVO\ VKRZQ WR KDYH QR HIIHFW RQ WUDQVFULSWLRQ f S DFWLYLW\ ZDV ORZHU WKDQ WKH EDVDO OHYHO XQGHU DOO FRQGLWLRQV WHVWHG

PAGE 90

5HSUHVVLRQ E\ 5HS SURWHLQ KDV EHHQ GHPRQVWUDWHG IRU D YDULHW\ RI KHWHURORJRXV SURPRWHUV DV ZHOO DV WKH HQGRJHQRXV $$9 SURPRWHUV 7KHVH LQFOXGH WKH 69 FUDV F P\F FIRV +39 +,9 DQG $G HDUO\ SURPRWHUV f 7KH PHFKDQLVP RI UHSUHVVLRQ LV QRW FOHDU 5HS KDV EHHQ VKRZQ WR LQWHUDFW ZLWK 7%3 f DQG RQH UHSRUW VXJJHVWV WKDW 5HS PD\ SUHYHQW DVVHPEO\ RI 7),,' FRPSOH[HV RQ '1$ f 5HS DOVR KDV EHHQ VKRZQ WR ELQG WR WKH WUDQVFULSWLRQDO DFWLYDWRUV 3& f 6SO f DQG 7RSRUV f DQG WR WKH SURWHLQ NLQDVHV 3.$ DQG 3U.; f 5HFHQWO\ &DWKRPHQ HW DO f LGHQWLILHG D FHOOXODU WUDQVFULSWLRQ IDFWRU =) WKDW ELQGV WR WKH 5%( DQG PD\ FRQWULEXWH WR WKH FHOOXODU UHSUHVVLRQ RI SL VHHQ KHUH LQ WKH DEVHQFH RI 5HS 5HS KDV DOVR EHHQ VKRZQ WR VWLPXODWH VRPH SURPRWHUV IRU H[DPSOH FVLV DQG &09 f $W OHDVW WZR PHFKDQLVPV DSSHDU WR EH LQYROYHG LQ 5HS PHGLDWHG UHSUHVVLRQ DV ILUVW VXJJHVWHG E\ .\RVWLR HW DO f 7KH ILUVW PHFKDQLVP LQYROYHV ELQGLQJ RI 5HS WR DQ 5%( DV LQ WKH FDVH RI WKH S SURPRWHU 7KH VHFRQG GRHV QRW UHTXLUH DQ 5%( EXW GRHV UHTXLUH D IXQFWLRQDO $73 ELQGLQJ VLWH LQ 5HS 3UHVXPDEO\ WKH $73 ELQGLQJ VLWH LV QHHGHG HLWKHU WR PRGLI\ WKH VWUXFWXUH RI 5HS SURWHLQ'1$ FRPSOH[HV RU WR PRGLI\ WKH WUDQVFULSWLRQDO WHPSODWH YLD WKH 5HS DVVRFLDWHG '1$ DQG 51$ KHOLFDVH DFWLYLWLHV f &RQVLVWHQW ZLWK WKH KHOLFDVH LGHD PXWDWLRQV LQ WKH 5HS SURWHLQfV KHOLFDVH PRWLIV KDYH EHHQ VKRZQ WR EH QHJDWLYH IRU WUDQVDFWLYDWLRQ DQG UHSUHVVLRQ f 7KH S 5%( LV SUREDEO\ DQ DUFKLWHFWXUDO HOHPHQW GHVLJQHG WR EULQJ WKH S DQG WKH SL SURPRWHUV WRJHWKHU 2XU IDLOXUH WR LQGXFH SL DFWLYDWLRQ LQ DUWLILFLDO FRQVWUXFWV WKDW FRQWDLQHG RQO\ DQ XSVWUHDP 5%( VXJJHVWHG WZR RWKHU DOWHUQDWLYHV UHDG WKURXJK DFWLYDWLRQ IURP WKH S SURPRWHU DQG DFWLYDWLRQ E\ RWKHU HOHPHQWV SUHVHQW LQ WKH S SURPRWHU YLD D ORRSLQJ PHFKDQLVP :H IRXQG QR FRPSHOOLQJ HYLGHQFH RI UHDG WKURXJK DFWLYDWLRQ IURP WKH S

PAGE 91

SURPRWHU )LJV DQG f +RZHYHU VHYHUDO H[SHULPHQWV VXJJHVWHG WKDW WKH S 5%( VHUYHG DV D VFDIIROG WR EULQJ WKH S SURPRWHU HOHPHQWV WR WKH SL SURPRWHU 3UHYLRXV ZRUN KDG VKRZQ WKDW LI SXULILHG 5HS DQG 6SO DUH LQFXEDWHG ZLWK '1$ FRQWDLQLQJ WKH S DQG SL SURPRWHUV D '1$ ORRS FDQ IRUP EHWZHHQ WKH WZR SURPRWHUV YLD 5HS6SO LQWHUDFWLRQ f ,Q WKLV UHSRUW ZH VKRZHG WKDW ERWK WKH S 5%( DQG WKH SO 6SO VLWH FDQ EH VXEVWLWXWHG ZLWK *$/ VLWHV :KHQ WKLV ZDV GRQH DFWLYDWLRQ RI WKH SL SURPRWHU QR ORQJHU UHTXLUHG 5HS EXW GHSHQGHG LQVWHDG RQ WKH SUHVHQFH RI K\EULG *$/ IXVLRQ SURWHLQV FRQWDLQLQJ S DQG 7 DQWLJHQ LQWHUDFWLRQ GRPDLQV 1HLWKHU IXVLRQ SURWHLQ FRQWDLQHG DQ DFWLYDWLRQ GRPDLQ RI LWV RZQ DQG QHLWKHU SURWHLQ FRXOG DFWLYDWH SL RQ LWV RZQ +RZHYHU WRJHWKHU WKH WZR IXVLRQ SURWHLQV DFWLYDWHG SL WUDQVFULSWLRQ QHDUO\ DV ZHOO DV 5HS DQG 6SO )LJ f 7KLV GHPRQVWUDWHG WKDW WKH UROH RI WKH 5HS6SO LQWHUDFWLRQ ZDV SUREDEO\ WR EULQJ WUDQVFULSWLRQ FRPSOH[HV DVVHPEOHG RQ WKH S SURPRWHU WR WKH SL SURPRWHU 0XWDJHQHVLV RI WKH S SURPRWHU LGHQWLILHG DW OHDVW RQH HOHPHQW HVVHQWLDO IRU SL DFWLYDWLRQ WKH << VLWH 0XWDWLRQ RI WKLV HOHPHQW HOLPLQDWHG DFWLYDWLRQ E\ WKH *$/ K\EULG SURWHLQV )LJ f ,Q FRQWUDVW PXWDWLRQ RI WKH S 0/7) VLWH GLG QRW HOLPLQDWH DFWLYDWLRQ E\ WKH K\EULG SURWHLQV DOWKRXJK LW GLG UHGXFH WKH OHYHO RI DFWLYDWLRQ 2XU H[SHULPHQWV GLG QRW H[FOXGH WKH SRVVLELOLW\ WKDW WKH << VLWH RU WKH 7$7$ VLWH ZDV DOVR LQYROYHG LQ DFWLYDWLRQ +RZHYHU WKH FRPELQDWLRQ RI PXWDQWV LQ << DQG 0/7) RU << 0/7) DQG << ZHUH QRW VXEVWDQWLDOO\ GLIIHUHQW WKH << PXWDQW E\ LWVHOI ,Q DGGLWLRQ WR HOLPLQDWLQJ SL DFWLYDWLRQ E\ $G DQG WKH K\EULG SURWHLQV PXWDWLRQ RI WKH << VLWH DOVR SURGXFHG D VXEVWDQWLDO LQFUHDVH LQ EDVDO SO H[SUHVVLRQ DQG $G

PAGE 92

LQGXFHG S H[SUHVVLRQ )LJ f 7KH LPSOLFDWLRQ RI WKLV LV WKDW WKHUH DUH DOWHUQDWLYH 5HS LQGHSHQGHQW LQWHUDFWLRQV EHWZHHQ WKH S DQG SL SURPRWHUV DQG RQH RI WKHVH LV PHGLDWHG E\ WKH << VLWH LQ WKH S SURPRWHU 7KH QHW HIIHFW RI WKLV LQWHUDFWLRQ LV WR UHSUHVV SO SURPRWHU EDVDO DQG $G LQGXFHG DFWLYLW\ 7KXV WKH S << VLWH UHSUHVVHV ERWK WKH SUR[LPDO S SURPRWHU DQG WKH GRZQVWUHDP SL SURPRWHU &RPSDULVRQ RI WKH << PXWDQW ZLWK WKH SDUHQWDO [*$/ SODVPLG LOOXVWUDWHV RQH UHDVRQ IRU WKH FRPSOH[LW\ RI $$9 WUDQVFULSWLRQDO UHJXODWLRQ )LJ f (OLPLQDWLRQ RI WKLV VLWH E\ PXWDWLRQ LQFUHDVHV SL DFWLYLW\ LQ WKH SUHVHQFH RI $G WR WKH OHYHO VHHQ LQ WKH SDUHQWDO SODVPLG LQ WKH SUHVHQFH RI $G DQG WKH K\EULG IDFWRUV 7KXV SL FRXOG EH LQGXFHG WR WKH OHYHO QHHGHG GXULQJ $$9 UHSOLFDWLRQ ZLWKRXW WKH QHHG IRU IXUWKHU DFWLYDWLRQ PHFKDQLVPV VXFK DV 5HSf LI WKH << VLWH ZHUH QRW SUHVHQW )ORZHYHU DV PHQWLRQHG DERYH HOLPLQDWLRQ RI WKH << DOVR LQFUHDVHV WKH EDVDO OHYHO RI S WUDQVFULSWLRQ DQG UHGXFHV WKH $G LQGXFHG OHYHO RIS f ,QFUHDVLQJ WKH EDVDO OHYHO RI S WUDQVFULSWLRQ ZRXOG OHDG WR D YLUXV WKDW LV OHVV OLNHO\ WR PDLQWDLQ WKH ODWHQW VWDWH EHFDXVH RI LQDSSURSULDWH S 5HS H[SUHVVLRQ 'HFUHDVLQJ WKH $G LQGXFHG OHYHO RI S WUDQVFULSWLRQ ZRXOG UHGXFH WKH OHYHO RI $$9 '1$ UHSOLFDWLRQ GXULQJ SURGXFWLYH LQIHFWLRQ 7R LOOXVWUDWH KRZ SS LQWHUDFWLRQV PLJKW SURPRWH DFWLYDWLRQ RU UHSUHVVLRQ RI SO XQGHU GLIIHUHQW FRQGLWLRQV ZH KDYH GUDZQ WKH PRGHO LQ )LJ 7KH PRGHO FRPSDUHV WKH LQWHUDFWLRQ LQ S,0&$7 ZKLFK FRQWDLQV ZLOG W\SH S DQG SL VHTXHQFHV ZLWK WKDW LQ SVXE&$7 ZKLFK KDV D PXWDQW S 5%( ,Q WKH ZLOG W\SH S SURPRWHU S,0&$7f 5HS ELQGV WR WKH S 5%( DQG IRUPV D FRPSOH[ ZLWK 6SO ERXQG WR WKH 6SO VLWH LQ WKH SL SURPRWHU 7KLV SODFHV VHYHUDO SRWHQWLDO DFWLYDWLRQ UHJLRQV

PAGE 93

)LJ 0RGHO RI SO SURPRWHU WUDQVDFWLYDWLRQ E\ LQWHUDFWLRQ ZLWK WUDQVFULSWLRQ IDFWRU FRPSOH[HV ERXQG WR S 6HH WH[W IRU GHWDLOV

PAGE 94

$ << 5(3 7$7$ << 0/7) > SO0&$7 63 7$7$

PAGE 95

LQFOXGLQJ WKRVH RI << 0/7) DQG (O D QHDU WKH SL 7$7$ ER[ WR DFWLYDWH SL WUDQVFULSWLRQ 0HDQZKLOH ZLWKLQ WKH S SURPRWHU 5HS ELQGLQJ LQKLELWV S WUDQVFULSWLRQ HLWKHU E\ VWHULF KLQGUDQFH RI EDVDO WUDQVFULSWLRQ IDFWRUV f E\ DQ HQ]\PDWLF PHFKDQLVP LQYROYLQJ WKH 5HS $73DVH DFWLYLW\ f RU E\ LQKLELWRU\ FRQWDFWV ZLWK << RU (O D :KHQ WKH 5%( LV DEVHQW SVXE& $7f RU LQ WKH DEVHQFH RI 5HS JHQH H[SUHVVLRQ WKH LQWHUDFWLRQ EHWZHHQ S DQG SL LV HLWKHU DEVHQW RU RFFXUV EHWZHHQ GLIIHUHQW SURWHLQV IRU H[DPSOH << DQG 6SO f 7KH <
PAGE 96

WHUPLQDO UHSHDW WKDW UHPRYHG WKH 75 5HS ELQGLQJ HOHPHQWV ZHUH FRPSOHWHO\ GHIHFWLYH IRU $$9 WUDQVFULSWLRQ 2Q WKH RWKHU KDQG FRQVWUXFWV WKDW FRQWDLQHG D ZLOG W\SH S SURPRWHU VKRZHG QR HIIHFW RQ WUDQVFULSWLRQ ZKHQ WKH VDPH 75 GHOHWLRQV ZHUH DQDO\]HG 7KH UHVXOWV REWDLQHG ZLWK WKH 69$$9 K\EULGV DUH HQWLUHO\ FRQVLVWHQW ZLWK RXU ILQGLQJ WKDW WKH S << VLWH SOD\V D NH\ UROH LQ DFWLYDWLRQ RI SL %HFDXVH WKH 75V DUH UHGXQGDQW DFWLYDWLRQ HOHPHQWV WKDW FRQWDLQ DQ 5%( WKH\ VXEVWLWXWHG IRU WKH << FRPSOH[ WKDW ZDV PLVVLQJ LQ WKH 69$$9 K\EULG FRQVWUXFWV +RZHYHU GHOHWLRQV LQ WKH 75 WKDW UHPRYHG WKH 5%( SUHVXPDEO\ SUHYHQWHG WKHLU LQWHUDFWLRQ ZLWK WKH $$9 SURPRWHUV DQG WKXV HOLPLQDWHG $$9 WUDQVFULSWLRQ 7KLV EHJV WKH TXHVWLRQ DV WR ZKDW WUDQVFULSWLRQ HOHPHQWV DUH SUHVHQW LQ WKH 75 WKDW FDQ VXEVWLWXWH IRU WKH S HOHPHQWV 5HS 3URWHLQ 'RPDLQV LQ $$9 7UDQVFULSWLRQDO 5HJXODWLRQ $ SUHYLRXV VWXG\ HVWDEOLVKHG WKDW WZR GLIIHUHQW 5HS PXWDQWV ZHUH FUHDWHG LQ WKLV PDQQHU DQG UHVXOWHG LQ GLIIHUHQW SKHQRW\SHV 2QH PXWDQW FRQWDLQHG D PDJQHVLXP ELQGLQJ PXWDWLRQ WKDW DIIHFWHG WKH 5HS SURWHLQ LQ LWV WUV HQGRQXFOHDVH DFWLYLW\ f 7KH PXWDWLRQ GLG QRW DIIHFW WKH DELOLW\ RI WKH 5HS SURWHLQ WR ELQG WKH WHUPLQDO UHSHDW RU LWV KHOLFDVH DFWLYLW\ +RZHYHU LW ZDV GHPRQVWUDWHG WKDW WKH '$ PXWDQW KDG D GLPLQLVKHG DELOLW\ WR LQWHUDFW ZLWK 0J LRQV DQG DQ LQWHUDFWLRQ EHWZHHQ WKH 5HS '$ PXWDQW DQG 0J ZDV HVVHQWLDO IRU HIILFLHQW WUV HQGRQXFOHDVH FOHDYDJH 7KLV GDWD ZDV WKH ILUVW VXJJHVWLRQ WKDW D SRUWLRQ RI WKH DFWLYH '1$ FOHDYDJH VLWH UHTXLUHG D 0J LRQ DQG WKH '$ DPLQR DFLG 7KH VHFRQG SKHQRW\SH LGHQWLILHG ZDV WKH ILUVW LGHQWLILHG FRQGLWLRQDO OHWKDO PXWDWLRQ ZLWKLQ WKH $$9 5HS SURWHLQ 7KH '$'$'$ PXWDQW ZDV IRXQG WR GHPRQVWUDWH D ORJ GLIIHUHQFH LQ U$$9 WLWHU EHWZHHQ & DQG & ([DPLQDWLRQ RI WKLV

PAGE 97

PXWDQW LQ D UHSOLFDWLRQ DVVD\ VKRZHG D IDLUO\ VWURQJ GHOD\ LQ '1$ UHSOLFDWLRQ DW WKH SHUPLVVLYH WHPSHUDWXUH RI & f /DFNQHU LQ SUHSf +RZHYHU WKH WV 5HS PXWDQW VKRZHG D FRPSOHWH ODFN RI DFWLYLW\ DW & ,Q RUGHU WR EHWWHU XQGHUVWDQG WKH H[DFW DOWHUDWLRQV LQ WKH '$'$ '$ PXWDQW ZH DQDO\]HG HDFK RI WKH ELRFKHPLFDO DFWLYLWLHV ZLWKLQ WKLV SURWHLQ :H GLVFRYHUHG WKDW WKH WHPSHUDWXUH VHQVLWLYLW\ ZDV PDLQO\ GHSHQGHQW RQ D GHIHFW LQ '1$ ELQGLQJ /DFNQHU LQ SUHSf $OWHUDWLRQ RI WKH SURWHLQ VHTXHQFH LQKLELWHG '1$ ELQGLQJ RI 5HS WR D V\QWKHWLF WHUPLQDO UHSHDW LQ WKH $$9 JHQRPH 7KH UHGXFHG OHYHO RI '1$ ELQGLQJ UHVXOWHG LQ D FRPSOHWH ORVV RI 5HS HQGRQXFOHDVH DFWLYLW\ RI WKH $$9 WHUPLQDO UHSHDW $Q LPSRUWDQW DVSHFW RI WKLV '$ '$ '$ PXWDWLRQ FRXOG EH LQIHUUHG IURP LWV VHTXHQFH KRPRORJ\ ZLWK RWKHU XQUHODWHG SURWHLQV VXFK DV ( FROL '1$ DQG 69 7 $QWLJHQ )LJ f 7KH $$9 5HS VHTXHQFHV IURP DPLQR DFLGV WR KDYH D KLJK GHJUHH RI KRPRORJ\ WR WKH FKDSHURQH SURWHLQ GRPDLQ RI '1$ LQ ( FROL DQG D VLPLODU GRPDLQ RI 69 7$QWLJHQ f %DVHG RQ WKLV SURWHLQ VHTXHQFH DOLJQPHQW WKH WHPSHUDWXUH VHQVLWLYLW\ RI WKH PXWDQW 5HS SURWHLQ ZDV D UHVXOW RI WKH GLVUXSWLRQ RI WKLV SRWHQWLDO GRPDLQ 6LPLODU WR LWV UROH LQ 69 7$QWLJHQ WKH SRWHQWLDO -GRPDLQ ZLWKLQ 5HS PD\ KDYH D GLUHFW DQG VWDEOH LQWHUDFWLRQ ZLWK WKH FHOOXODU FKDSHURQH SURWHLQ +VS f 7KH -GRPDLQ ZLWKLQ PRVW SRO\RPD YLUXVHV PDNHV GLUHFW FRQWDFWV ZLWK WKH $73DVH GRPDLQ RI +VS f ,W KDV EHHQ HVWDEOLVKHG WKURXJK SUHYLRXV VWXGLHV WKDW WKH -GRPDLQ ZLWKLQ 69 7$QWLJHQ LV FULWLFDO WR 69 '1$ UHSOLFDWLRQ f 7$QWLJHQ PXWDWLRQV WKDW DIIHFW WKH -GRPDLQ SUHYHQW WKH 7$QWLJHQ WUDQVDFWLYDWLRQ RI () UHVSRQVLYH SURPRWHUV DQG WKHLU VXEVHTXHQW LQGXFWLRQ LQ WKH SURJUHVVLRQ RI WKH FHOO F\FOH f 7KHVH VDPH -GRPDLQ PXWDWLRQV ZHUH

PAGE 98

)LJ 6HTXHQFH 'LDJUDP RI 5HS 0XWDJHQHVLV 5HVXOWV 6HH WH[W IRU GHVFULSWLRQV

PAGE 99

5HS )XQFWLRQDO 0DS 5(3 KHOL[ MGRPDLQ KHOL[ _PSJI\HLYL_N YSVG>OGHKOS JLVGVIYQZY DHNHZHOOSSIF4 V4Q4OQOLHT LALAM cL PROLO DSOWYDHNOT UGIOWHZUUY VNDS£OIIY JIHNJHV9IE PKYOOYHWWJY L WM JO\FLQH NVPYOJUIOV TLUH
PAGE 100

GHILFLHQW LQ WKHLU FDSDELOLW\ WR ELQG WR +VS 7KH -GRPDLQ RQ 69 7$QWLJHQ KDV EHHQ LGHQWLILHG DV D QHFHVVDU\ UHTXLUHPHQW IRU QXFOHDU ORFDOL]DWLRQ f 'LUHFW LQWHUDFWLRQ RI WKH 7$QWLJHQ -GRPDLQ ZLWK +VS UHVXOWV LQ FRPSOHPHQWDWLRQ RI D 69 7$QWLJHQ PXWDQW FRQWDLQLQJ D QXFOHDU WUDQVORFDWLRQ DQG FHOOXODU WUDQVIRUPDWLRQ PXWDWLRQ f $OWKRXJK WKH QXFOHDU ORFDOL]DWLRQ GRPDLQ RI 5HS KDV EHHQ ORFDOL]HG WR DPLQR DFLGV WR WKLV -GRPDLQ PD\ H[SODLQ PDQ\ RI WKH UROHV IRU 5HS LQ '1$ UHSOLFDWLRQ DQG PRGLILFDWLRQ RI WKH FHOO F\FOH f ,Q 69 WKLV UHJLRQ KDV EHHQ VKRZQ WR IXQFWLRQ DV D PROHFXODU FKDSHURQH PHGLDWLQJ SKRVSKRU\ODWLRQ RI WKH 7 $QWLJHQ DVVRFLDWHG SURWHLQV SL DQG SL f 7KLV VDPH SURWHLQ GRPDLQ LQ 5HS PD\ H[SODLQ LWV UROH LQ LQWHUIHUHQFH ZLWK YLUDO UHSOLFDWLRQ DQG RQFRJHQLFLW\ LQ 69 SDSLOORPD DQG KHUSHVYLUXVHV f 7KH PRVW OLNHO\ H[SODQDWLRQ RI WKH DELOLW\ RI 5HS WR LQKLELW FHOOXODU WUDQVIRUPDWLRQ DIWHU 69 FRLQIHFWLRQ FRXOG EH WKURXJK D GRPDLQ QHJDWLYH SKHQRW\SH 7KH DELOLW\ RI 7$QWLJHQ WR SURPRWH RQFRJHQHVLV GHSHQGV RQ WZR IDFWRUV WKH -GRPDLQ DQG WKH S5%ELQGLQJ PRWLI f 7KH SUHVHQFH RI DQRWKHU -GRPDLQ FRQWDLQLQJ SURWHLQ 5HS ZRXOG DFW DV D GRPDLQ QHJDWLYH SURWHLQ GXULQJ DQ $$9 DQG 69 FRLQIHFWLRQ 7KH 5HS SURWHLQ FRXOG SRVVLEO\ LQWHUDFW ZLWK SL DQG SL EXW ZRXOG EH XQDEOH WR IXOO\ RYHUFRPH WKH DUUHVW RU ()UHSUHVVLRQ RI WKH FHOO F\FOH SURPRWHUV DV D UHVXOW RI LWV LQDELOLW\ WR ELQG S5% +RZHYHU LQ UHJDUGV WR WKH '$'$'$ UHSOLFDWLRQ PXWDQW WKLV WDUJHWHG PXWDWLRQ PD\ GLVUXSW ERWK '1$ ELQGLQJ DQG GLUHFW DVVHPEO\ RI UHSOLFDWLRQ FRPSOH[HV RQ WKH $$9 WHUPLQDO UHSHDWV :H KDYH GHPRQVWUDWHG WKDW WKH PXWDWLRQ GLUHFWO\ LQKLELWV '1$ ELQGLQJ DQG DV D UHVXOW SUHYHQWV WUV HQGRQXFOHDVH DFWLYLW\ ,Q DGGLWLRQ WR LWV GHIHFW LQ '1$ ELQGLQJ WKLV 5HS WV PXWDQW PD\ EH GHIHFWLYH LQ LWV DELOLW\ WR UHFUXLW DFWLYH UHSOLFDWLRQ FRPSOH[HV GXH WR WKLV -

PAGE 101

GRPDLQ PXWDWLRQ ,W KDV VXJJHVWHG WKDW 7$QWLJHQ XVHV LWV -GRPDLQ WR VXSSRUW 69 '1$ UHSOLFDWLRQ LQ D PDQQHU WKDW LV VWULNLQJO\ VLPLODU WR WKH XVH RI (VFKHULFKLD FROL 'QDE\ EDFWHULRSKDJH ODPEGD LQ '1$ UHSOLFDWLRQ f ,Q DGGLWLRQ WR WKH SRO\RPD YLUXV IDPLO\ WKH +39 UHSOLFDWLRQ LQLWLDWRU (O KHOLFDVH KDV HQKDQFHG ELQGLQJ WR WKH RULJLQ RI UHSOLFDWLRQ E\ WKH GLUHFW LQWHUDFWLRQV RI KVS SURWHLQV f 7KLV GDWD VXJJHVWV D VWURQJ UROH IRU FKDSHURQHV LQ YLUDO '1$ UHSOLFDWLRQ WKURXJK FRQWDFWV LQ D IXQFWLRQDO -GRPDLQ $V UHVXOW WKH LQDELOLW\ RI WKLV PXWDQW 5HS WR ELQG WKH V\QWKHWLF $$9 WHUPLQDO UHSHDWV PD\ EH D IXQFWLRQ RI WKHLU UHGXFHG DIILQLW\ IRU WKH FKDSHURQH SURWHLQV +VS :LWKRXW D SRVVLEOH +VS LQWHUDFWLRQ WKURXJK WKH -GRPDLQ WKH 5HS SURWHLQ FRPSOH[HV PD\ QRW EH FRUUHFWO\ DVVHPEOHG IRU '1$ ELQGLQJ DQG WUV HQGRQXFOHDVH DFWLYLW\ 7KH VHFRQG PXWDQW ($ ($ DIIHFWV D SRVVLEOH +0* ER[ LQ WKH 5HS SURWHLQ VHTXHQFH %HWZHHQ DPLQR DFLGV WR RI 5HS SURWHLQ VHTXHQFH DOLJQPHQW KDV LGHQWLILHG D SRVVLEOH +0* ER[ WKDW PD\ KDYH PXOWLSOH UROHV LQ WKH HQ]\PDWLF DFWLYLWLHV DQG ELRORJLFDO UROHV RI 5HS WKURXJKRXW WKH $$9 OLIHF\FOH 3UHYLRXV UHVHDUFK GHPRQVWUDWHG WKDW PRVW RI WKH DFWLYLWLHV DVVRFLDWHG ZLWK WKH 5HS SURWHLQ DUH HQKDQFHG ZLWK WKH SUHVHQFH DQG FRH[SUHVVLRQ RI WKH +0* SURWHLQ f 7KLV VWXG\ GLVFRYHUHG WKDW WKH SUHVHQFH RI +0* VWLPXODWHG 5HSPHGLDWHG WUV HQGRQXFOHDVH FOHDYDJH $73DVH DFWLYLW\ '1$ ELQGLQJ DQG S WUDQVFULSWLRQDO UHSUHVVLRQ 6LQFH WKH DFWLYLWLHV RI 5HS ZHUH DVVD\HG ERWK LQ YLYR DQG LQ YLWUR WKH +0* DQG 5HS SURWHLQ +0* ER[ PD\ KDYH YHU\ VLPLODU IXQFWLRQDO UROHV LQ ZKLFK WKH\ UHFRJQL]H WKH FUXFLIRUP VWUXFWXUHV RI $$9 WHUPLQDO UHSHDW DQG IRUP VWDEOH QXFOHRSURWHLQ VWUXFWXUHV +0* KDV D JHQHUDO '1$ ELQGLQJ DFWLYLW\ EXW DQ H[WUHPHO\ KLJK DIILQLW\ IRU FUXFLIRUP VWUXFWXUHV DQG EHQGV LQ '1$ 7KH VROH IXQFWLRQ RI +0* HQKDQFHPHQW PD\ EH WR UHFRJQL]H WKHVH RGG '1$ IUDJPHQWV

PAGE 102

ZLWKLQ WKH FHOO DQG UHFUXLW 5HS SURWHLQV WR IRUP PXOWLPHULF SURWHLQ FRPSOH[HV RQ 5HS ELQGLQJ HOHPHQWV 7KLV 5HS UHFUXLWPHQW ZRXOG DIIHFW HYHU\ W\SH RI 5%( ZLWKLQ WKH $$9 JHQRPH DQG LQIOXHQFH ERWK WKH ODWHQW DQG O\WLF OLIHF\FOH 7KH WUDQVLHQW WUDQVIHFWLRQ RI +0* LQ WKH SUHVHQFH RI D S SURPRWHU DVVD\ ZDV VKRZQ WR KDYH D VWURQJHU OHYHO RI S UHSUHVVLRQ EXW RQO\ LQ WKH SUHVHQFH RI WKH 5HS SURWHLQ f 7KLV GDWD LQGLFDWHV WKDW WKH DVVHPEO\ RI WKH 5HS SURWHLQ FRPSOH[HV PD\ EH PRUH VWDEOH LQ WKH SUHVHQFH RI +0* RU PD\ EH UHFUXLWHG E\ +0* ERXQG WR WKH $$9 JHQRPH ,W ZDV VXJJHVWHG WKDW +0* DQG +0* LQWHUDFW ZLWK WUDQVFULSWLRQ IDFWRUV WKDW FRQWDLQ +0* ER[HV WR VWLPXODWH '1$ ELQGLQJ DQG IRUP D '1$ EHQG f 7UDQVFULSWLRQDO UHJXODWRUV WKDW FRQWDLQ +0* ER[HV VXFK DV WKH $$9 5HS SURWHLQ PD\ UHFUXLW WKH +0* SURWHLQ WKURXJK SURWHLQSURWHLQ LQWHUDFWLRQV WKHUHE\ LQFUHDVLQJ WKH DIILQLW\ RI WUDQVFULSWLRQ IDFWRUV WR WKHLU '1$ ELQGLQJ VHTXHQFH 7KLV LQFUHDVH LQ WUDQVFULSWLRQ IDFWRU ELQGLQJ DIILQLW\ ZRXOG EH GHSHQGHQW RQ WKH LQGXFWLRQ RI '1$ EHQGLQJ E\ +0* $IWHU WKH VWDELOL]DWLRQ RI WUDQVFULSWLRQ IDFWRU ELQGLQJ WKH '1$ EHQG FRXOG UHFUXLW D VHFRQG XQUHODWHG WUDQVFULSWLRQ IDFWRU WR DQRWKHU VLWH ZLWKLQ WKH '1$ VHTXHQFH f ,Q WKH FDVH RI WKH ($($ 5HS PXWDQW PRGLILFDWLRQ RI WKH +0* ER[ PD\ SUHYHQW DQ\ SRVVLEOH 5HS DQG +0* SURWHLQ LQWHUDFWLRQ HLWKHU LQ WKH $$9 WHUPLQDO UHSHDW RU WKH S5%( :LWKRXW WKH +0* SURWHLQ WR DOWHU WKH VWUXFWXUH RI '1$ DQG DOORZ 5HS WR FRUUHFWO\ ELQG WKH 5%( D QXPEHU RI ELRORJLFDO DFWLYLWLHV ZRXOG IDLO WR RFFXU )LUVW WKH PXWDQW ZRXOG KDYH D PXFK ORZHU OHYHO RI S SURPRWHU UHSUHVVLRQ DV ZH KDYH VKRZQ E\ WUDQVLHQW WUDQVIHFWLRQ )LJ ($($f 7KH ORZHU OHYHO RI 5HS SURWHLQ ELQGLQJ ZRXOG DIIHFW ERWK UHSOLFDWLRQ DQG WUDQVFULSWLRQ 7KH GHIHFW LQ SL WUDQVDFWLYDWLRQ FRXOG EH WKH UHVXOW RI IDLOXUH WR SURGXFH WKH SURSHU '1$ ORRS EHWZHHQ WKH

PAGE 103

S DQG SO SURPRWHUV ,I +0* VWLPXODWHV WKH 5HS SURWHLQ WR WLJKWO\ ELQG LWV 5%( PXWDWLRQ RI WKH +0* ER[ LQ WKH 5HS SURWHLQ VHTXHQFH PD\ SUHYHQW D SRVVLEOH S WUDQVDFWLYDWLRQ FRPSOH[ :H EHOLHYH SUHYLRXV VWXGLHV GHPRQVWUDWLQJ WKH VWDEOH LQWHUDFWLRQ EHWZHHQ 6SO DQG 5HS RQ $$9 VXSSRUW WKLV PRGHO f +RZHYHU LQ YLYR FRQGLWLRQV PD\ UHTXLUH WKDW WKH '1$ ORRS FUHDWHG EHWZHHQ WKH S DQG SL SURPRWHU IRU SL WUDQVDFWLYDWLRQ EH VWDELOL]HG WKURXJK WKH DFWLYLWLHV RI WKH +0* SURWHLQV 7KLV ($($ 5HS PXWDQW ZRXOG VXSSRUW WKLV PRGHO EHFDXVH LW PDLQWDLQV KHOLFDVH DFWLYLWLHV EXW LW LV XQDEOH WR UHSUHVV RU WUDQVDFWLYDWH WKH $$9 SURPRWHUV )LJ DQG f 5HPDUNDEO\ WKH LQ YLWUR ELQGLQJ DVVD\V EHWZHHQ 5HS DQG +0* KDYH LQGLFDWHG WKDW D SRVVLEOH LQWHUDFWLRQ GRPDLQ EHWZHHQ WKHVH WZR SURWHLQ OLHV DURXQG WKH SURSRVHG 5HS +0* ER[ VHTXHQFH f 7KH QH[W PXWDQW LQ RXU FKDUJHWRDODQLQH VFDQQLQJ PXWDJHQHVLV ZDV WKH ( $ ($ 5HS SURWHLQ $OWKRXJK WKLV UHJLRQ RI WKH 5HS SURWHLQ GRHV QRW FRQWDLQ DQ\ NQRZQ SURWHLQ PRWLIV LW LV LQ D FORVH SUR[LPLW\ WR D 5HS5HS LQWHUDFWLRQ GRPDLQ DQG WKH SUHYLRXVO\ GLVFXVVHG +0* ER[ 7KLV PXWDWLRQ FDXVHG D UHSOLFDWLRQ QHJDWLYH SKHQRW\SH EXW GLG QRW UHVXOW LQ D FRQGLWLRQDO OHWKDO YLUXV 7KH ( $ ($ PXWDQW ZDV FDSDEOH RI ERWK '1$ ELQGLQJ DQG KHOLFDVH DFWLYLWLHV +RZHYHU WZR YHU\ LPSRUWDQW ELRORJLFDO DFWLYLWLHV ZHUH IRXQG WR EH JUHDWO\ UHGXFHG )LUVW WKH SURWHLQ ZDV H[WUHPHO\ GHILFLHQW LQ LWV DELOLW\ WR H[SUHVV WKH 5HS DQG SURWHLQV $V IXUWKHU SURRI IRU WKLV GLVUXSWLRQ RI WKH SL SURPRWHU WKH S,0&$7 UHSRUWHU FRQVWUXFW ZDV XQDEOH WR WUDQVDFWLYDWH WKLV SURPRWHU DW D OHYHO VLJQLILFDQWO\ KLJKHU WKDQ ZLWK $GHQRYLUXV DORQH )LJ f 7KH PRVW LQWHUHVWLQJ HIIHFW ZDV WKH FRPSOHWH ODFN RI WUDQVFULSWLRQDO UHSUHVVLRQ RQ WKH S SURPRWHU 7KH ( $($ PXWDQW ZDV IROG KLJKHU LQ LWV OHYHO RI S SURPRWHU H[SUHVVLRQ

PAGE 104

FRPSDUHG WR WKH ZW OHYHO RI S DFWLYLW\ ,QWHUHVWLQJO\ DOO RI WKH UHSOLFDWLRQ GHIHFWLYH PXWDQWV KDG S SURPRWHU H[SUHVVLRQ WKDW ZDV IROG KLJKHU WKDQ ZLOG W\SH $OWKRXJK WKH KLJKHVW OHYHOV RI GHIHFWLYH S SURPRWHU UHSUHVVLRQ ZHUH IRFXVHG DURXQG WKH ( $($ PXWDQW DQG WKH SRWHQWLDO +0* ER[ DW ($ ($ )LJ ($($ DQG ($($f RWKHU LPSRUWDQW DUHDV LQ WKH 5HS SURWHLQ VHTXHQFH WKDW WDUJHWHG VSHFLILF S UHSUHVVLRQ DFWLYLW\ FRORFDOL]HG ZLWK PRWLIV EDVHG RQ $$9 5HS DQG 5ROOLQJ &LUFOH 5HSOLFDWLRQ 5&5f SURWHLQV )LJ f 0RWLI IURP 5HS DPLQR DFLGV WR FRUUHVSRQGV WR WKH .$'$ PXWDQW DQG PRWLI FRUUHVSRQGV ZLWK DPLQR DFLGV WR VLPLODU WR WKH +$+$ PXWDQW %RWK RI WKHVH PXWDWLRQV DUH XQDEOH WR UHSOLFDWH YLUDO '1$ WUDQVDFWLYDWH WKH SL SURPRWHU RU UHSUHVV S 7KLV FRPELQDWLRQ RI PXWDQWV ZRXOG LQGLFDWH D GHIHFW LQ WKH DVVHPEO\ RI 5HS SURWHLQ FRPSOH[HV VLPLODU WR WKH RWKHU 5&5 SURWHLQV 7KH DVVHPEO\ PXWDQWV FRXOG EH XQDEOH WR WLJKWO\ ELQG '1$ KDYH D UHGXFHG LQWHUDFWLRQ ZLWK SRVVLEOH FKDSHURQH DFWLYLWLHV RI +0* RU ORVH WKH DELOLW\ WR UHFUXLW UHSOLFDWLRQ PDFKLQHU\ WR WKH $$9 WHUPLQDO UHSHDW 'XH WR WKH GLIILFXOW\ LQ SURGXFLQJ ODUJH DPRXQWV RI SXUH 5HS IRU SURWHLQ FU\VWDOL]DWLRQ ZH DUH OLPLWHG LQ RXU GLVVHFWLRQ RI WKH HQ]\PDWLF DFWLYLWLHV WR SURWHLQ VHTXHQFH DOLJQPHQW ZLWK RWKHU XQUHODWHG YLUDO SURWHLQV %DVHG RQ OLPLWHG KRPRORJ\ ZLWK 69 7$QWLJHQ SUHYLRXV PXWDJHQHVLV VWXGLHV KDYH FUHDWHG $73DVH PXWDQWV LQ WKH 5HS SURWHLQ +RZHYHU WKH HOLPLQDWLRQ RI WKH $73DVH IXQFWLRQ RI 5HS FUHDWHG D ZLGH YDULHW\ RI ORVW ELRFKHPLFDO DFWLYLWLHV ZLWKLQ WKH 5HS SURWHLQ 7KH $73DVH PXWDQWV LQ WKRVH VWXGLHV DOVR ORVW '1$ KHOLFDVH DFWLYLW\ WKH WUV HQGRQXFOHDVH FOHDYDJH DW WKH WHUPLQDO UHSHDW DQG DOO WUDQVDFWLYDWLRQ IURP WKH S DQG S SURPRWHUV f %DVHG RQ KRPRORJ\ WR WKRVH 69 7$QWLJHQ $73DVH PXWDWLRQV DOO RI WKH HQ]\PDWLF DFWLYLWLHV RI

PAGE 105

5HS DSSHDUHG WR EH GHSHQGHQW RQ D IXQFWLRQDO $73DVH DFWLYLW\ $ QHZ VWUDWHJ\ FDOOHG FKDUJHWRDODQLQH PXWDJHQHVLV ZDV LQGLVFULPLQDQW WR KHOLFDVH KRPRORJ\ DQG WDUJHWHG RQO\ FKDUJHG DPLQR DFLG FOXVWHUV ZLWKLQ 5HS LQ WKH KRSH RI FUHDWLQJ FRQGLWLRQDO OHWKDO PXWDWLRQV 3UHYLRXV ZRUN ZDV DEOH WR LGHQWLI\ DQ XQNQRZQ 0J ELQGLQJ VLWH ZKRVH PXWDWLRQ UHVXOWHG LQ D ODFN RI HQGRQXFOHDVH FOHDYDJH DW WKH WHUPLQDO UHSHDW EXW ZDV FRPSOHWHO\ ZLOG W\SH LQ RWKHU DVSHFWV IRU 5HS DFWLYLW\ 7KLV ZRUN KDV FRQWLQXHG WR FKDUDFWHUL]H VHYHUDO SRWHQWLDO QHZ SURWHLQ GRPDLQV ZLWKLQ WKH 5HS SURWHLQ $ VLQJOH +0* ER[ ZDV ORFDOL]HG WR D VSHFLILF GRPDLQ ZLWKRXW WKH ORVV RI DQ\ KHOLFDVH DFWLYLW\ DQG LW PD\ KDYH D GLUHFW HIIHFW LQ VWDEOL]LQJ WKH '1$ ORRS EHWZHHQ WKH S DQG SO SURPRWHUV $QRWKHU 5HS PXWDQW VXJJHVWHG WKH UROH RI D -GRPDLQ LQ D WHPSHUDWXUH VHQVLWLYH PXWDQW WKDW FRXOG LQIOXHQFH WKH DELOLW\ RI WKH 5HS SURWHLQ LQ ELQGLQJ WR WKH WHUPLQDO UHSHDW WUV HQGRQXFOHDVH DFWLYLW\ DQG WKH UHFUXLWPHQW RI '1$ UHSOLFDWLRQ IDFWRUV DW WKH WHUPLQDO UHSHDW +RZHYHU XQWLO WKH FU\VWDOL]DWLRQ RI 5HS LV SHUIRUPHG IXUWKHU ORFDOL]DWLRQ DQG ELRFKHPLFDO FKDUDFWHUL]DWLRQ RI 5HS SURWHLQ GRPDLQV ZLOO EH GHSHQGHQW RQ FRQWLQXHG PXWDJHQHVLV RI WKH HQWLUH SURWHLQ VHTXHQFH )XWXUH 'LUHFWLRQV 'XULQJ YDULRXV FHOOXODU FRQGLWLRQV WKHUH DUH D ODUJH QXPEHU RI GLIIHUHQW SURWHLQ FRPSOH[HV ERXQG WR WKH S SURPRWHU 2QH RI PRVW LPSRUWDQW DQG OHDVW H[DPLQHG TXHVWLRQV LQ $$9 ELRORJ\ LV WKH DFWXDO RUJDQL]DWLRQ RI SURWHLQV ZLWKLQ WKH S WUDQVFULSWLRQDO FRPSOH[ 2QH H[SHULPHQWDO SURWRFRO WR GHILQH WKH IDFWRUV ERXQG WR WKLV VHTXHQFH RI '1$ ZRXOG EH WR LVRODWH DQG SXULI\ WKH S SURPRWHU $IWHU SXULILFDWLRQ WKH S SURPRWHU HOHPHQW FRXOG EH LQFXEDWHG LQ D FHOOXODU H[WUDFW IRU RQH RI IRXU FHOOXODU FRQGLWLRQV 7KH ILUVW FRQGLWLRQ ZRXOG EH D PRFN H[WUDFW FRQWDLQLQJ QHLWKHU DQ

PAGE 106

$GHQRYLUXV RU $GHQR$VVRFLDWHG 9LUXV LQIHFWLRQ 7KH VHFRQG DQG WKLUG FRQGLWLRQV ZRXOG EH DQ VLQJOH YLUDO LQIHFWLRQ H[WUDFW RI $G RU $$9 UHVSHFWLYHO\ 7KH ODVW FHOOXODU H[WUDFW ZRXOG EH D FRPELQHG LQIHFWLRQ RI ERWK $GHQRYLUXV DQG $$9 :LWK WKHVH IRXU W\SHV RI FHOOXODU H[WUDFW WKH S '1$ VHTXHQFH FRXOG EH LQFXEDWHG ZLWK WKHP WR DOORZ '1$SURWHLQ FRPSOH[HV WR IRUP RQ WKH S SURPRWHU $IWHU D VXIILFLHQW WLPH IRU LQFXEDWLRQ WKH SURWHLQ FRPSOH[HV IRUPHG RQ WKH '1$ ZRXOG EH IL[HG E\ WKH DGGLWLRQ RI D UHYHUVLEOH FURVVOLQNLQJ DJHQW 7KH '1$ VHTXHQFH FRXOG EH SUHFLSLWDWHG DIWHU WKH FURVVOLQNLQJ HYHQW WR LVRODWH WKH SURWHLQ FRPSOH[HV %\ UHYHUVLQJ WKH PHFKDQLVP RI FURVVOLQNLQJ WKH '1$SURWHLQ FRPSOH[HV FRXOG EH GLVDVVHPEOHG DQG WKH SURWHLQV ZLWKLQ WKLV SURWHLQ FRPSOH[ FRXOG EH DQDO\]HG E\ YDULRXV PHWKRGV 2QH PHWKRG RI DQDO\VLV FRXOG EH D VLPSOH :HVWHUQ EORW IRU DQWLERGLHV RI VXVSHFWHG SURWHLQV LQ WKHVH FRPSOH[HV 2WKHU PHWKRGV RI DQDO\VLV FRXOG EH D JHO HOHFWURSKRUHVLV RU 0DVV 6SHFWURVFRS\ WR JDLQ SRVVLEOH SURWHLQ VHTXHQFH LQIRUPDWLRQ RQ WKH SURWHLQV SUHFLSLWDWHG ZLWK WKH S SURPRWHU '1$ $QRWKHU SURFHVV RI S SURPRWHU WUDQVFULSWLRQ FRPSOH[ LVRODWLRQ FRXOG EH WKH XVH RI '1$ ODEHOHG ZLWK ELRPDJQHWLF EHDGV 7KH SXULILFDWLRQ RI WKH S SURPRWHU FRXOG RFFXU WKURXJK UHVWULFWLRQ HQ]\PH GLJHVWLRQ 7KH HQGV RI WKH UHVWULFWLRQ HQ]\PH VLWH FRXOG EH ILOOHG E\ .OHQRZ WR LQFRUSRUDWH ELRWLQ\ODWHG ODEHOHG G173V LQWR WKH S SURPRWHU VHTXHQFH 7KH ELRWLQ\ODWHG S SURPRWHU FRXOG EH LQFXEDWHG ZLWK VWUHSWDYLGLQFRQMXJDWHG '\QDEHDGV 7KURXJK WKH XVH RI D PDJQHW WKH ODEHOHG S SURPRWHU FRXOG EH SUHFLSLWDWHG ZDVKHG DQG UHOHDVHG IURP ERXQG '1$SURWHLQ FRPSOH[HV DIWHU LQFXEDWLRQ ZLWK $G RU $$9 LQIHFWHG FHOOV 7KLV ELRWLQ\ODWHG '1$ DSSURDFK ZRXOG DOORZ JUHDW YDULHW\ LQ SURWHLQ SXULILFDWLRQ E\ WKH XVH RI PDQ\ VDOW ZDVK FRQGLWLRQV 7KH ZDVKHG SURWHLQ

PAGE 107

FRPSOH[HV FRXOG EH SXULILHG DQG DQDO\]HG IRU SURWHLQ VHTXHQFH LQIRUPDWLRQ ZLWKRXW UHYHUVLEOH FURVVOLQNLQJ SURFHGXUHV $QRWKHU SURWRFRO IRU LVRODWLQJ WKH SURWHLQ FRPSOH[HV IRUPHG RQ WKH S SURPRWHU LV WKH XVH RI '1$ DIILQLW\ FROXPQ FKURPDWRJUDSK\ 7KH FURVVOLQNLQJ RI D ODUJH QXPEHU RI S SURPRWHU ROLJRQXFOHRWLGHV WR FROXPQ PDWUL[ ZRXOG HQDEOH WKH IRUPDWLRQ DQG SXULILFDWLRQ RI SURWHLQV ERXQG WR WKH '1$ VHTXHQFH 7KH IRXU GLIIHUHQW FHOOXODU H[WUDFWV ZRXOG EH SRXUHG RYHU WKH S SURPRWHU FROXPQ DQG ZDVKHG ZLWK YDULRXV EXIIHU VROXWLRQV 7KH LVRODWLRQ RI SURWHLQ FRPSOH[HV FRXOG SURFHHG D QXPEHU RI GLIIHUHQW ZD\V 2QH D UHYHUVLEOH FURVVOLQNLQJ DJHQW FRXOG IL[ WKH FRPSOH[HV DQG ODWHU UHOHDVH WKHP DIWHU PDQ\ VXFFHVVLYH FROXPQ ZDVKLQJV 6HFRQG WKH ZDVKHG SURWHLQ FRPSOH[HV FRXOG EH IUDFWLRQDWHG E\ VWHS RU JUDGLHQW HOXWLRQV ZLWK YDULRXV VDOW VROXWLRQV (LWKHU RI WKHVH SXULILFDWLRQ SURWRFROV ZRXOG LVRODWH SURWHLQV WR EH VHTXHQFHG RU LGHQWLILHG E\ :HVWHUQ LPPXQREORW SURFHGXUHV 7KHVH WKUHH SURWRFROV RI S SURPRWHU SURWHLQ FRPSOH[HV FRXOG EH DQDO\]HG LQ D QXPEHU RI GLIIHUHQW ZD\V )LUVW WKH VWUXFWXUH DQG FRPSRVLWLRQ RI WKHVH SURWHLQ FRPSOH[HV FRXOG EH FRPSDUHG LQ WKH IRXU FHOOXODU FRQGLWLRQV 7KH FRPSRVLWLRQ RI WKHVH FRPSOH[HV FRXOG GLIIHU JUHDWO\ GXULQJ DQ $GHQRYLUXV LQIHFWLRQ 5HS SURWHLQ H[SUHVVLRQ RU WKH FRPELQDWLRQ RI ERWK VLWXDWLRQV 7KH (O $ (RUI RU DQ\ RWKHU $GHQRYLUXV JHQH SURGXFW FRXOG LQIOXHQFH WKH VWUXFWXUH RI WKHVH FRPSOH[HV 7KH VWULQJHQF\ RI WKH VDOW HOXWLRQ RU WKH FRQFHQWUDWLRQ RI FURVVOLQNLQJ UHDJHQW FRXOG GHWHUPLQH WKH RYHUDOO RUGHU RI SURWHLQ ELQGLQJ RQ WKH S SURPRWHU 6HFRQG DQRWKHU LQWHUHVWLQJ DVVD\ ZRXOG EH WKH FRPSDULVRQ EHWZHHQ WKH SVXE DQG S SURPRWHU 7KLV GLIIHUHQWLDO RI WKH WZR SURPRWHUV FRXOG GHILQH WKH UROH RI 5HS LQ IRUPLQJ YDULRXV SURWHLQ FRPSOH[HV DV ZHOO DV

PAGE 108

WKH UROH RI VWHULF LQWHUIHUHQFH LQ S WUDQVFULSWLRQ IDFWRU ELQGLQJ ,Q FRPELQDWLRQ ZLWK WKH IRXU GLIIHUHQW FHOOXODU H[WUDFWV WKH S DQG SVXE SURPRWHUV FRXOG H[KLELW DQG FKDUDFWHUL]H D ODUJH QXPEHU RI SURWHLQ FRPSOH[HV 7KH DQDO\VLV RI WKH GLIIHUHQWLDO EHWZHHQ WKH PXWDQW VXE SURPRWHU DQG WKH ZLOG W\SH S SURPRWHU LQ HYHU\ FHOOXODU FRQGLWLRQ VKRXOG GHPRQVWUDWH WKH RUGHU RI DGGLWLRQ LQ WKH DVVHPEO\ RI WUDQVFULSWLRQDO FRPSOH[HV RQ WKH DFWLYH S SURPRWHU &RQFOXVLRQV 7KH UHJXODWLRQ RI JHQH H[SUHVVLRQ IRU WKH $GHQR$VVRFLDWHG 9LUXV LV RQH RI WKH PRVW FRPSOH[ DQG FRPSDFW WUDQVFULSWLRQDO PHFKDQLVPV LQ PROHFXODU ELRORJ\ 7KH HQWLUH $$9 JHQRPH LV RQO\ NE LQ VL]H DQG FRQWDLQV RQO\ WKUHH SURPRWHU HOHPHQWV ,Q DGGLWLRQ WR WKLV UHODWLYHO\ PLQRU JHQRPH WKH OLIHF\FOH RI $$9 FDQ DOWHUQDWH EHWZHHQ D ODWHQW UHSUHVVHG SURYLUDO VWDWH DQG DQ DFWLYHO\ O\WLF LQIHFWLRQ 7KH UHJXODWLRQ IRU WKLV ZLGH UDQJH RI WUDQVFULSWLRQDO VWDWH LV FRQWUROOHG E\ RQO\ RQH VLQJOH RSHQ UHDGLQJ IUDPH LQ WKH $$9 JHQRPH 7KH QRQVWUXFWXUDO SURWHLQV RI $$9 PDQDJH HYHU\ DVSHFW RI LWV OLIHF\FOH DV ZHOO DV LQIOXHQFH WKH LQIHFWHG FHOO HQYLURQPHQW 7KHVH SURWHLQV SURFHVV WKH FHOOXODU VWDVLV RI WKH LQIHFWHG KRVW DQG GHFLGH D ZLGH UDQJH RI YLUDO UHVSRQVHV ,I WKH KRVW FHOO LV KHDOWK\ WKH $$9 JHQRPH ZLOO EH GLUHFWHG WR VLWHVSHFLILFDOO\ LQWHJUDWH DQG UHSUHVV DOO YLUDO WUDQVFULSWLRQ ,I WKH KRVW FHOO LV FRLQIHFWHG RU VXSHULQIHFWHG ZLWK $GHQRYLUXV WKH $$9 JHQRPH ZLOO UHVSRQG WR WKH $G SURWHLQV UDSLGO\ UHSOLFDWH LWV YLUDO '1$ DQG HVFDSH WKH KRVW FHOO ZKHQ WKH $GHQRYLUXV O\]HV WKH KRVW FHOO $OO RI WKHVH DVSHFWV RI WKH $$9 OLIHF\FOH DUH SURFHVVHG DQG GLUHFWO\ FRQWUROOHG E\ WKH RQH QRQVWUXFWXUDO SURWHLQ 5HS 7KH PDMRU UDWH FRQWUROOHG VWHS LQ WKH $$9 OLIHF\FOH LV WKH WUDQVFULSWLRQDO UHJXODWLRQ RI WKH S SURPRWHU 7KLV SURPRWHU H[SUHVVHV WKH ODUJHVW 5HS SURWHLQ DQG

PAGE 109

GHWHUPLQHV WKH UDWH RI 5HS DQG &DSVLG SURWHLQ H[SUHVVLRQ :LWKRXW $GHQRYLUXV WKH S SURPRWHU SURGXFHV D YHU\ PLQXWH DPRXQW RI 5HS ZKLFK UHSUHVVHV WKH H[SUHVVLRQ RI WKH S SURPRWHU +RZHYHU DQ $GHQRYLUXV LQIHFWLRQ ZLOO LQGXFH D ODUJH QXPEHU RI FKDQJHV LQ S WUDQVFULSWLRQ 7KH (DUO\ $G SURWHLQ (O $ GLUHFWO\ ELQGV WR WKH << UHSUHVVRUV RQ WKH S SURPRWHU FRQYHUWLQJ WKHP LQWR DFWLYDWRUV RI 5HS H[SUHVVLRQ 7KH FRPELQDWLRQ RI ODUJH 5HS H[SUHVVLRQ DQG S SURPRWHU DFWLYDWLRQ LQGXFHV WKH RWKHU WZR SURPRWHUV RI $$9 WR H[SUHVV WKHLU JHQH SURGXFWV 7KH PRVW IDVFLQDWLQJ $$9 SURPRWHU LV WKH SO SURPRWHU 7KH SL SURPRWHU H[SUHVVHV WKH 5HS DQG 5HS SURWHLQV WKDW UHJXODWH WKH H[SUHVVLRQ RI WKH S SURPRWHU 'XULQJ $G LQIHFWLRQ WKH ODUJH 5HS SURWHLQV DUH H[SUHVVHG IURP WKH S SURPRWHU DQG LQKLELW WKHLU RZQ H[SUHVVLRQ ,Q DGGLWLRQ WR IHHGEDFN LQKLELWLRQ RI WKH S SURPRWHU WKH ODUJH 5HS SURWHLQV ELQG WKH VDPH LQKLELWRU\ ORFDWLRQ RQ WKH S LQGXFLQJ H[SUHVVLRQ IURP WKH SL SURPRWHU 7KH SO SURPRWHU ZLOO SURGXFH WKH 5HS SURWHLQ ZKLFK GHSUHVVHV WKH S SURPRWHU E\ GLUHFWO\ LQWHUDFWLQJ ZLWK WKH ODUJH 5HS SURWHLQV RQ WKH S SURPRWHU 7KLV UHJXODWLRQ DQG LQWHUSOD\ ZLWK WKH S DQG SL JHQH SURGXFWV DOORZV WKH FRQVWDQW H[SUHVVLRQ RI ODUJH DQG VPDOO 5HS SURWHLQV 7KHVH 5HS SURWHLQ FRQFHQWUDWLRQV SHUPLW D QXPEHU RI FRQGLWLRQV LQ WKH O\WLF SKDVH RI $$9 )LUVW WKH ODUJH 5HS SURWHLQ LV H[SUHVVHG HQRXJK WR QLFN DQG LQLWLDWH WKH UHSOLFDWLQJ SRRO RI $$9 JHQRPHV 6HFRQG WKH 5HS SURWHLQ FRQFHQWUDWLRQ LV KLJK HQRXJK WR GHSUHVV WKH S SURPRWHU EXW ORZ HQRXJK WR SUHYHQW SDFNDJLQJ RI WKH HQWLUH $$9 JHQRPH UHSOLFDWLRQ SRRO 7KLUG WKH S SURPRWHU SURGXFLQJ &DSVLG SURWHLQ LV DOZD\V H[SUHVVHG DW H[FHVV 7KH PDLQWHQDQFH RI WKLV FRPSOH[ WUDQVFULSWLRQDO UHJXODWLRQ LV FRQWUROOHG E\ WKH S DQG SL SURPRWHUV

PAGE 110

,Q SUHYLRXV ZRUN LW ZDV VKRZQ WKDW $GHQRYLUXV DOZD\V LQGXFHG KLJK OHYHOV RI S H[SUHVVLRQ ,Q FRQWUDVW WKH ODUJH 5HS SURWHLQV VHHPHG WR H[FOXVLYHO\ UHSUHVV WKH S SURPRWHU 7KLV GDWD DSSHDUV RSSRVLWH WR WKH UHTXLUHPHQW RI 5HS IRU $$9 JHQH H[SUHVVLRQ 7KLV TXHVWLRQ ZDV DGGUHVVHG LQ D VHULHV RI DVVD\V WR GHWHUPLQH LI 5HS IXQFWLRQHG DV DQ HQKDQFHU RU SUR[LPDO SURPRWHU HOHPHQW 7KH 5HS ELQGLQJ HOHPHQW ZDV PRYHG WR YDULRXV ORFDWLRQV QH[W WR WKH SL SURPRWHU ,Q WKH FRUUHFW JHQRPLF ORFDWLRQ WKH S5%( GLG QRW WUDQVDFWLYDWH WKH SO SURPRWHU 7KH VHULHV RI SO&$7 FRQVWUXFWV LQGLFDWHG WKDW DV WKH S5%( ZDV SODFHG FORVHU WR WKH WUDQVFULSWLRQDO VWDUW VLWH LW FDXVHG D PXFK KLJKHU OHYHO RI WUDQVFULSWLRQDO UHSUHVVLRQ 7KHVH FRQVWUXFWV ZRXOG VXSSRUW WKH FRQFOXVLRQ WKDW WKH 5HS SURWHLQ GRHV QRW KDYH DQ\ WUDQVFULSWLRQDO DFWLYDWLRQ GRPDLQ EXW LQVWHDG IXQFWLRQV H[FOXVLYHO\ DV D WUDQVFULSWLRQDO UHSUHVVRU 7KH ODFN RI DQ\ WUDQVFULSWLRQDO DFWLYDWLRQ VXSSRUWHG WKH K\SRWKHVLV WKDW WKH 5HS SURWHLQ GRHV QRW H[FOXVLYHO\ RU GLUHFWO\ DFWLYDWH WUDQVFULSWLRQ ,W PD\ IXQFWLRQ WR FRQQHFW RU MRLQ WZR SURWHLQV ZKLFK GLUHFWO\ UHFUXLW WKH 51$ SRO\PHUDVH ,, KRORHQ]\PH DW WKH S SURPRWHU 6LQFH WKH 5HS LV ERXQG WR WKH S5%( VLWH LQ WKH ODWHQW SURYLUDO VWDWH WKH RWKHU S WUDQVFULSWLRQ IDFWRUV PD\ LQGXFH WKH S SURPRWHU GXULQJ DQ $GHQRYLUXV LQIHFWLRQ 7KLV K\SRWKHVLV ZDV WHVWHG E\ WKH VXEFORQLQJ RI WKH S SURPRWHU HOHPHQWV LQWR WKH FRUUHFW VSDFLQJ LQ WKH V\QWKHWLF SO&$7 SODVPLG :LWK $G DQG 5HS JHQH H[SUHVVLRQ WKHVH FRQVWUXFWV IDLO WR LQGXFH WKH FRUUHFW WUDQVFULSWLRQDO UHJXODWLRQ $W WKLV SRLQW RI SL SURPRWHU DQDO\VLV LW ZDV EHOLHYHG WKH V\QWKHWLF QDWXUH RI WKH SO&$7 SURPRWHU PD\ ODFN WKH FRUUHFW WUDQVFULSWLRQ IDFWRU IRU JHQH H[SUHVVLRQ $V D UHVXOW WKH &$7 UHSRUWHU JHQH ZDV VXEFORQHG LQWR WKH $$9 JHQRPLF VXEFORQH SODVPLG S,0

PAGE 111

7KLV S,0&$7 SODVPLG H[SUHVVHG WKH FRUUHFW WUDQVFULSWLRQDO UHJXODWLRQ ZLWK $G DQG 5HS JHQH H[SUHVVLRQ 7KLV UHVXOW LPSOLHV WKH VHTXHQFH RI WKH V\QWKHWLF SO SURPRWHUV FDQQRW H[KLELW FRUUHFW SO JHQH H[SUHVVLRQ RU WKHLU 5HS6SO LQWHUDFWLRQ LV LQFRUUHFW 7KH 5HS DQG 6SO SURWHLQV ZHUH UHSODFHG LQ WKH S,0&$7 SODVPLG DQG UHSODFHG ZLWK *$/ K\EULG WUDQVFULSWLRQ IDFWRUV :LWKRXW DQ\ 5HS RU 6SO SURWHLQ VHTXHQFHV LW ZDV VKRZQ WKHVH WZR SURWHLQV KDYH QR GLUHFW LQIOXHQFH RQ WUDQVFULSWLRQDO DFWLYDWLRQ RI WKH SL SURPRWHU 7KH JHQRPLF RUJDQL]DWLRQ RI WKH S DQG SO SURPRWHUV IRUP D VWDEOH '1$ ORRS WKURXJK WKH SURWHLQ LQWHUDFWLRQ RI 5HS63O RU *$/ +\EULG WUDQVFULSWLRQ IDFWRUV 7KLV VWDEOH '1$ ORRS DOORZV WKH SURWHLQ FRPSOH[HV RQ WKH $G LQGXFHG S SURPRWHU WR FRQWDFW DQG VWLPXODWH WKH IRUPDWLRQ RI D 51$ SRO\PHUDVH ,, KRORHQ]\PH DW WKH SL SURPRWHU 7KLV REVHUYDWLRQ RI WKH S SURPRWHU WUDQVFULSWLRQ IDFWRUV VWLPXODWLQJ WKH SL DQG S SURPRWHUV VXSSRUWV WKH VWURQJ UROH RI S LQGXFWLRQ E\ WKH $GHQRYLUXV (O $ SURWHLQV 7KH PXWDJHQHVLV RI WKH S WUDQVFULSWLRQ IDFWRUV LQ WKH *$/ K\EULG UHSRUWHU SODVPLG VKRZHG VHYHUDO XQLTXH IDFWV )LUVW WKH PXWDWLRQ RI WKH 0/7) VLWH GLG QRW DIIHFW WKH $G DQG 5HS LQGXFHG WUDQVDFWLYDWLRQ RI WKH S SURPRWHU 6HFRQG WKH PXWDJHQHVLV RI ERWK << ES DQG << FDXVHG WKH ORVV RI WKLV $G DQG 5HS LQGXFHG WUDQVDFWLYDWLRQ 7KLUG WKH PXWDWLRQ RI WKH << ES LQGXFHG DQ H[WUHPHO\ KLJK EDVDO WUDQVFULSWLRQDO DFWLYLW\ IRU WKH S SURPRWHU $OO RI WKHVH UHVXOWV VXSSRUW WKH K\SRWKHVLV WKDW WKH (O $ SURWHLQV ERXQG WR WKH WZR << SURWHLQV DW WKH S SURPRWHU SHUIRUP WKH GLUHFW WUDQVDFWLYDWLRQ RI WKH SL SURPRWHU 7KLV VHULHV RI FRQFOXVLRQV KDV D YHU\ SURIRXQG HIIHFW RQ XQGHUVWDQGLQJ WKH EDVLF ELRORJ\ RI WKH $GHQR$VVRFLDWHG 9LUXV )LUVW WKH QRQVWUXFWXUDO SURWHLQ 5HS H[KLELWV QR

PAGE 112

WUDQVFULSWLRQDO WUDQVDFWLYDWLRQ DFWLYLW\ RU GRPDLQV IRU WKH $$9 SURPRWHUV :LWK RU ZLWKRXW $G LQIHFWLRQ WKH ODUJH 5HS SURWHLQV LQKLELW WKH WUDQVFULSWLRQDO DFWLYLW\ RI WKH S SURPRWHU ,Q WKH FRQWH[W RI WKH SL SURPRWHU WKH 5HS SURWHLQ GRHV QRW WUDQVDFWLYDWH WKH SURPRWHU DQG ZLOO LQKLELW WUDQVFULSWLRQDO DFWLYLW\ ZKHQ LWV ELQGLQJ VLWH PRYHG FORVHU WR WKH WUDQVFULSWLRQDO VWDUW VLWH 6HFRQG VHSDUDWLRQ RI WKH S DQG SL SURPRWHUV E\ D 3RO\$ 6LJQDO LQIOXHQFHV ERWK D V\QWKHWLF SL SURPRWHU DQG WKH JHQRPLF S,0 EDFNERQH )RU WKH JHQRPLF SODVPLGV LW VWURQJO\ GHFUHDVHV WKH GHJUHH RI DOO WUDQVFULSWLRQDO DFWLYDWLRQ 7KLV REVHUYDWLRQ ZRXOG VXSSRUW WKH LGHD WKDW WKH SUHVHQFH RI D WHUPLQDWLQJ 51$ SRO\PHUDVH ,, KRORHQ]\PH ZRXOG LQKLELW WKH VWDEOH '1$ ORRS IRUPHG EHWZHHQ 5HS DQG 6SO 7KH V\QWKHWLF SL SURPRWHUV KDG D YHU\ GLIIHUHQW UHVXOW EHFDXVH WKH ODFN RI D 5HS ELQGLQJ HOHPHQW LQGXFHG WKH VWURQJHVW OHYHO RI $G DQG 5HS LQGXFHG WUDQVDFWLYDWLRQ 7KLV HIIHFW FRXOG EH WKH UHVXOW RI GLIIHUHQW '1$ VHTXHQFHV RU WKH GLVUXSWLRQ RI SURSHU ZLOG W\SH SURWHLQSURWHLQ LQWHUDFWLRQV 7KLUG WKH 5HS DQG 6SO SURWHLQV H[KLELW QR UHTXLUHPHQW RQ $G DQG 5HS LQGXFHG S WUDQVDFWLYDWLRQ 7KH VROH IXQFWLRQ RI WKHVH WZR SURWHLQV LV WR ELQG '1$ VHTXHQFHV DW WKH S DQG SL SURPRWHUV DQG IRUP D VWDEOH '1$ ORRS VWUXFWXUH $Q\ RWKHU SURWHLQ FRPSOH[ ZKLFK SHUIRUPV WKLV VDPH IXQFWLRQ FDQ UHSODFH WKH UROH RI 5HS DQG 6SO LQ $$9 WUDQVFULSWLRQ 7KH VXEVWLWXWLRQ RI *$/ K\EULG WUDQVFULSWLRQ IDFWRUV IRU 5HS DQG 6SO SURWHLQV VXSSRUWV WKH K\SRWKHVLV WKDW WKH 5HS DQG 6SO SURWHLQV DFW DV DUFKLWHFWXUDO SURWHLQV LQ WKH UHJXODWLRQ RI $$9 JHQH H[SUHVVLRQ

PAGE 113

$33(1',; 7$%/( 2) $%%5(9,$7,216 $$9 $GHQR$VVRFLDWHG 9LUXV $73 $GHQRVLQH 7ULSKRVSKDWH $G $GHQRYLUXV $73DVH $GHQRVLQH 7ULSKRVSKDWDVH %S %DVH 3DLU &$7 FKORUDPSKHQLFRO DFHW\O WUDQVIHUDVH &7' FDUER[\WHUPLQDO GRPDLQ '1$ 'HR[\ULERQXFOHLF $FLG +VS +HDW 6KRFN 3URWHLQ +$7 +LVWRQH $FHW\OWUDQVIHUDVH +'$& +LVWRQH 'HDFHW\ODVH ,QU ,QLWLDWRU /&5 /RFXV &RQWURO 5HJLRQ 090 0LQXWH 9LUXV RI 0LFH 1WHUPLQXV $PLQR 7HUPLQXV 51$ 5LERQXFOHLF $FLG 5%( 5HS ELQGLQJ HOHPHQW 7%3 7$7$ ELQGLQJ SURWHLQ <<
PAGE 114

/,67 2) 5()(5(1&(6 $OOLVRQ / $ :RQJ 9 )LW]SDWULFN 0 0R\OH DQG & ,QJOHV 7KH &WHUPLQDO GRPDLQ RI WKH ODUJHVW VXEXQLW RI 51$ SRO\PHUDVH ,, RI 6DFFKDURP\FHV FHUHYLVLDH 'URVRSKLOD PHODQRJDVWHU DQG PDPPDOV D FRQVHUYHG VWUXFWXUH ZLWK DQ HVVHQWLDO IXQFWLRQ 0RO &HOO %LRO $XEOH 7 :DQJ : 3RVW DQG 6 +DKQ 0ROHFXODU DQDO\VLV RI WKH 61)6:, SURWHLQ IDPLO\ PHPEHU 027 DQ $73 GULYHQ HQ]\PH WKDW GLVVRFLDWHV 7$7$ELQGLQJ SURWHLQ IURP '1$ 0RO &HOO %LRO %DUEHULV $ DQG / *DXGUHDX 5HFUXLWPHQW RI WKH 51$ SRO\PHUDVH ,, KRORHQ]\PH DQG LWV LPSOLFDWLRQV LQ JHQH UHJXODWLRQ %LRO &KHP %DUEHULV $ & : 0XOOHU 6 & +DUULVRQ DQG 0 3WDVKQH 'HOLQHDWLRQ RI WZR IXQFWLRQDO UHJLRQV RI WUDQVFULSWLRQ IDFWRU 7),,% 3URF 1DWO $FDG 6FL 86$ %DUEHULV $ 3HDUOEHUJ 1 6LPNRYLFK 6 )DUUHOO 3 5HLQDJHO & %DPGDG 6LJDO DQG 0 3WDVKQH &RQWDFW ZLWK D FRPSRQHQW RI WKH SRO\PHUDVH ,, KRORHQ]\PH VXIILFHV IRU JHQH DFWLYDWLRQ &HOO %DUWRORPHL 0 6 1 ) +DOGHQ & 5 &XOOHQ DQG / &RUGHQ *HQHWLF DQDO\VLV RI WKH UHSHWLWLYH FDUER[\OWHUPLQDO GRPDLQ RI WKH ODUJHVW VXEXQLW RI PRXVH 51$ SRO\PHUDVH ,, 0RO &HOO %LRO %DWFKX 5 % DQG 3 / +HUPRQDW 7KH WUDQVLQKLELWRU\ 5HS SURWHLQ RI DGHQRDVVRFLDWHG YLUXV ELQGV WR 7$5 UHJLRQ '1$ RI WKH KXPDQ LPPXQRGHILFLHQF\ YLUXV W\SH ORQJ WHUPLQDO UHSHDW )(%6 /HWW %DWFKX 5 % 5 0 .RWLQ DQG 3 / +HUPRQDW 7KH UHJXODWRU\ UHS SURWHLQ RI DGHQRDVVRFLDWHG YLUXV ELQGV WR VHTXHQFHV ZLWKLQ WKH F+UDV SURPRWHU &DQFHU /HWW %HDWRQ $ 3 3DOXPER DQG %HUQV ([SUHVVLRQ IURP WKH DGHQR DVVRFLDWHG YLUXV S DQG SL SURPRWHUV LV QHJDWLYHO\ UHJXODWHG LQ WUDQV E\ WKH UHS SURWHLQ 9LURO %HOO $ %R\HV &KXQJ 0 3LNDDUW 0 1 3ULROHDX ) 5HFLOODV 1 6DLWRK DQG )HOVHQIHOG 7KH HVWDEOLVKPHQW RI DFWLYH FKURPDWLQ GRPDLQV &ROG 6SULQJ +DUE 6\PS 4XDQW %LRO

PAGE 115

%HOO $ & DQG )HOVHQIHOG 6WRSSHG DW WKH ERUGHU ERXQGDULHV DQG LQVXODWRUV &XUU 2SLQ *HQHW 'HY %HUURWHUDQ 5 : ( :DUH DQG 0 +DPSVH\ 7KH VXD VXSSUHVVRUV RI 6DFFKDURP\FHV FHUHYLVLDH HQFRGH UHSODFHPHQWV RI FRQVHUYHG UHVLGXHV ZLWKLQ WKH ODUJHVW VXEXQLW RI 51$ SRO\PHUDVH ,, DQG DIIHFW WUDQVFULSWLRQ VWDUW VLWH VHOHFWLRQ VLPLODUO\ WR VXD 7),,%f PXWDWLRQV 0RO &HOO %LRO %ODFNORZ 1 5 0 +RJJDQ DQG : 3 5RZH 6HURORJLF HYLGHQFH IRU KXPDQ LQIHFWLRQ ZLWK DGHQRYLUXVDVVRFLDWHG YLUXVHV 1DWO &DQFHU ,QVW %ODFNORZ 1 5 0 +RJJDQ 0 6 6HUHQR & %UDQGW + : .LP 5 + 3DUURWW DQG 5 0 &KDQRFN $ VHURHSLGHPLRORJLF VWXG\ RI DGHQRYLUXV DVVRFLDWHG YLUXV LQIHFWLRQ LQ LQIDQWV DQG FKLOGUHQ $P (SLGHPLRO %ODFNZRRG ( 0 DQG 7 .DGRQDJD *RLQJ WKH GLVWDQFH D FXUUHQW YLHZ RI HQKDQFHU DFWLRQ 6FLHQFH %URZQHOO ( =KRX 7 5DQDOOL 5 .RED\DVKL (GPRQGVRQ 6 < 5RWK DQG & $OOLV 7HWUDK\PHQD KLVWRQH DFHW\OWUDQVIHUDVH $ D KRPRORJ WR \HDVW *FQS OLQNLQJ KLVWRQH DFHW\ODWLRQ WR JHQH DFWLYDWLRQ &HOO %XUDWRZVNL 6 DQG + =KRX )XQFWLRQDO GRPDLQV RI WUDQVFULSWLRQ IDFWRU 7),,% 3URF 1DWO $FDG 6FL 86$ %XUOH\ 6 DQG 5 5RHGHU %LRFKHPLVWU\ DQG VWUXFWXUDO ELRORJ\ RI WUDQVFULSWLRQ IDFWRU ,,' 7),,'f $QQX 5HY %LRFKHP %XVKQHOO $ & %DPGDG DQG 5 .RUQEHUJ $ PLQLPDO VHW RI 51$ SRO\PHUDVH ,, WUDQVFULSWLRQ SURWHLQ LQWHUDFWLRQV %LRO &KHP &DPSEHOO 6 3 0XOODQH $ $NVR\ + 6WXEGDO =DOYLGH 0 3LSDV 3 $ 6LOYHU 7 0 5REHUWV % 6 6FKDIIKDXVHQ DQG $ 'H&DSULR 'QD-KVS FKDSHURQH GRPDLQ RI 69 ODUJH 7 DQWLJHQ SURPRWHV HIILFLHQW YLUDO '1$ UHSOLFDWLRQ *HQHV 'HY &DWKRPHQ 7 &ROOHWH DQG 0 :HLW]PDQ $ FKLPHULF SURWHLQ FRQWDLQLQJ WKH 1 WHUPLQXV RI WKH DGHQRDVVRFLDWHG YLUXV 5HS SURWHLQ UHFRJQL]HV LWV WDUJHW VLWH LQ DQ LQ YLYR DVVD\ 9LURO &DWKRPHQ 7 7 + 6WUDFNHU / % *LOEHUW DQG 0 :HLW]PDQ $ JHQHWLF VFUHHQ LGHQWLILHV D FHOOXODU UHJXODWRU RI DGHQRDVVRFLDWHG YLUXV 3URF 1DWO $FDG 6FL 86 $

PAGE 116

&KDQJ / 6 DQG 7 6KHQN 7KH DGHQRYLUXV '1$ELQGLQJ SURWHLQ VWLPXODWHV WKH UDWH RI WUDQVFULSWLRQ GLUHFWHG E\ DGHQRYLUXV DQG DGHQRDVVRFLDWHG YLUXV SURPRWHUV 9LURO &KDQJ / 6 < 6KL DQG 7 6KHQN $GHQRDVVRFLDWHG YLUXV 3 SURPRWHU FRQWDLQV DQ DGHQRYLUXV (O $LQGXFLEOH HOHPHQW DQG D ELQGLQJ VLWH IRU WKH PDMRU ODWH WUDQVFULSWLRQ IDFWRU 9LURO &KDVPDQ 0 )ODKHUW\ 3 $ 6KDUS DQG 5 .RUQEHUJ &U\VWDO VWUXFWXUH RI \HDVW 7$7$ELQGLQJ SURWHLQ DQG PRGHO IRU LQWHUDFWLRQ ZLWK '1$ 3URF 1DWO $FDG 6FL 86$ &KDWWHUMHH 6 DQG 6WUXKO &RQQHFWLQJ D SURPRWHUERXQG SURWHLQ WR 7%3 E\SDVVHV WKH QHHG IRU D WUDQVFULSWLRQDO DFWLYDWLRQ GRPDLQ 1DWXUH &KHMDQRYVN\ 1 DQG % &DUWHU 0XWDJHQHVLV RI DQ $8* FRGRQ LQ WKH DGHQRDVVRFLDWHG YLUXV UHS JHQH HIIHFWV RQ YLUDO '1$ UHSOLFDWLRQ 9LURORJ\ &KHXQJ $ 0 +RJJDQ : : +DXVZLUWK DQG %HUQV ,QWHJUDWLRQ RI WKH DGHQRDVVRFLDWHG YLUXV JHQRPH LQWR FHOOXODU '1$ LQ ODWHQWO\ LQIHFWHG KXPDQ 'HWURLW FHOOV 9LURO &KLRULQL $ % =LPPHUPDQQ /
PAGE 117

&RUGHQ / 7DLOV RI 51$ SRO\PHUDVH ,, 7UHQGV %LRFKHP 6FL &RVWHOOR ( 3 6DXGDQ ( :LQRFRXU / 3L]HU DQG 3 %HDUG +LJK PRELOLW\ JURXS FKURPRVRPDO SURWHLQ ELQGV WR WKH DGHQRDVVRFLDWHG YLUXV UHSOLFDWLRQ SURWHLQ 5HSf DQG SURPRWHV 5HSPHGLDWHG VLWHVSHFLILF FOHDYDJH RI '1$ $73DVH DFWLYLW\ DQG WUDQVFULSWLRQDO UHSUHVVLRQ (PER 'DKPXV 0 ( 5HYHUVLEOH SKRVSKRU\ODWLRQ RI WKH &WHUPLQDO GRPDLQ RI 51$ SRO\PHUDVH ,, %LRO &KHP 'DYLV 0 5 6 :RQGHUOLQJ 6 / :DONHU DQG 5 $ 2ZHQV $QDO\VLV RI WKH HIIHFWV RI FKDUJH FOXVWHU PXWDWLRQV LQ DGHQRDVVRFLDWHG YLUXV 5HS SURWHLQ LQ YLWUR 9LURO 'DYLV 0 :X DQG 5 $ 2ZHQV 0XWDWLRQDO DQDO\VLV RI DGHQR DVVRFLDWHG YLUXV W\SH UHS SURWHLQ HQGRQXFOHDVH DFWLYLW\ RQ SDUWLDOO\ VLQJOH VWUDQGHG VXEVWUDWHV >,Q 3URFHVV &LWDWLRQ@ 9LURO 'L 3DVTXDOH DQG 6 1 6WDFH\ $GHQRDVVRFLDWHG YLUXV 5HS SURWHLQ LQWHUDFWV ZLWK SURWHLQ NLQDVH $ DQG LWV KRPRORJ 35.; DQG LQKLELWV &5(% GHSHQGHQW WUDQVFULSWLRQDO DFWLYDWLRQ 9LURO 'XELHO]LJ 5 $ .LQJ 6 :HJHU $ .HUQ DQG $ .OHLQVFKPLGW $GHQRDVVRFLDWHG YLUXV W\SH SURWHLQ LQWHUDFWLRQV IRUPDWLRQ RI SUH HQFDSVLGDWLRQ FRPSOH[HV 9LURO 'YLU $ 5 & &RQDZD\ DQG : &RQDZD\ $ UROH IRU 7),,+ LQ FRQWUROOLQJ WKH DFWLYLW\ RI HDUO\ 51$ SRO\PHUDVH ,, HORQJDWLRQ FRPSOH[HV 3URF 1DWO $FDG 6FL 86$ (FNQHU 5 S DQG &%3 DV WUDQVFULSWLRQDO UHJXODWRUV DQG WDUJHWV RI RQFRJHQLF HYHQWV %LRO &KHP (QJHO DQG 7DQLPRWR /RRSLQJ OLQNLQJ DQG FKURPDWLQ DFWLYLW\ QHZ LQVLJKWV LQWR EHWDJORELQ ORFXV UHJXODWLRQ &HOO )DOFN3HGHUVHQ ( /RJDQ 7 6KHQN DQG ( 'DUQHOO -U 7UDQVFULSWLRQ WHUPLQDWLRQ ZLWKLQ WKH (O $ JHQH RI DGHQRYLUXV LQGXFHG E\ LQVHUWLRQ RI WKH PRXVH EHWDPDMRU JORELQ WHUPLQDWRU HOHPHQW &HOO )HDYHU : 2 *LOHDGL < /L DQG 5 .RUQEHUJ &7' NLQDVH DVVRFLDWHG ZLWK \HDVW 51$ SRO\PHUDVH ,, LQLWLDWLRQ IDFWRU E &HOO )LHOGV 6 DQG 6 -DQJ 3UHVHQFH RI D SRWHQW WUDQVFULSWLRQ DFWLYDWLQJ VHTXHQFH LQ WKH S SURWHLQ 6FLHQFH

PAGE 118

)ORWWH 7 5 ; %DUUD]D 2UWL] 5 6RORZ 6 $ $ILRQH % &DUWHU DQG : % *XJJLQR $Q LPSURYHG V\VWHP IRU SDFNDJLQJ UHFRPELQDQW DGHQR DVVRFLDWHG YLUXV YHFWRUV FDSDEOH RI LQ YLYR WUDQVGXFWLRQ *HQH 7KHU )UDVHU 3 DQG ) *URVYHOG /RFXV FRQWURO UHJLRQV FKURPDWLQ DFWLYDWLRQ DQG WUDQVFULSWLRQ &XUU 2SLQ &HOO %LRO *DYLQ 6 0 SXEOLVKHG HUUDWXP DSSHDUV LQ 9LURO -DQOf@ 9LURO *HQJ < DQG / ) -RKQVRQ /DFN RI DQ LQLWLDWRU HOHPHQW LV UHVSRQVLEOH IRU PXOWLSOH WUDQVFULSWLRQDO LQLWLDWLRQ VLWHV RI WKH 7$7$OHVV PRXVH WK\PLG\ODWH V\QWKDVH SURPRWHU 0RO &HOO %LRO *LRUGDQR $ DQG 0 / $YDQWDJJLDWL S DQG &%3 SDUWQHUV IRU OLIH DQG GHDWK &HOO 3K\VLRO *RSSHOW $ 6WHO]HU ) /RWWVSHLFK DQG 0 0HLVWHUHUQVW $ PHFKDQLVP IRU UHSUHVVLRQ RI FODVV ,, JHQH WUDQVFULSWLRQ WKURXJK VSHFLILF ELQGLQJ RI 1& WR 7%3SURPRWHU FRPSOH[HV YLD KHWHURGLPHULF KLVWRQH IROG GRPDLQV (PER *UDOOD *OREDO VWHSV GXULQJ LQLWLDWLRQ E\ 51$ SRO\PHUDVH ,, 0HWKRGV (Q]\PRO *URVYHOG ) $FWLYDWLRQ E\ ORFXV FRQWURO UHJLRQV" &XUU 2SLQ *HQHW 'HY *UXQVWHLQ 0 +LVWRQH DFHW\ODWLRQ LQ FKURPDWLQ VWUXFWXUH DQG WUDQVFULSWLRQ 1DWXUH *X]PDQ ( DQG 7 /LV 7UDQVFULSWLRQ IDFWRU 7),,+ LV UHTXLUHG IRU SURPRWHU PHOWLQJ LQ YLYR 0RO &HOO %LRO +DKQ 6 6 %XUDWRYYVNL 3 $ 6KDUS DQG / *XDUHQWH
PAGE 119

+DQ 0 8 .LP 3 .D\QH DQG 0 *UXQVWHLQ 'HSOHWLRQ RI KLVWRQH + DQG QXFOHRVRPHV DFWLYDWHV WKH 3+ JHQH LQ 6DFFKDURP\FHV FHUHYLVLDH (PER +DUWO ) 8 0ROHFXODU FKDSHURQHV LQ FHOOXODU SURWHLQ IROGLQJ 1DWXUH +HEEHV 7 5 $ : 7KRUQH DQG & &UDQH5RELQVRQ $ GLUHFW OLQN EHWZHHQ FRUH KLVWRQH DFHW\ODWLRQ DQG WUDQVFULSWLRQDOO\ DFWLYH FKURPDWLQ (PER +HUPRQDW 3 / 'RZQUHJXODWLRQ RI WKH KXPDQ FIRV DQG FP\F SURWRn RQFRJHQH SURPRWHUV E\ DGHQRDVVRFLDWHG YLUXV 5HS &DQFHU /HWW +HUPRQDW 3 / ,QKLELWLRQ RI ERYLQH SDSLOORPDYLUXV SODVPLG '1$ UHSOLFDWLRQ E\ DGHQRDVVRFLDWHG YLUXV 9LURORJ\ +HUPRQDW 3 / ,QKLELWLRQ RI +UDV H[SUHVVLRQ E\ WKH DGHQRDVVRFLDWHG YLUXV 5HS WUDQVIRUPDWLRQ VXSSUHVVRU JHQH SURGXFW &DQFHU 5HV +HUPRQDW 3 / 0 $ /DERZ 5 :ULJKW %HUQV DQG 1 0X]\F]ND *HQHWLFV RI DGHQRDVVRFLDWHG YLUXV LVRODWLRQ DQG SUHOLPLQDU\ FKDUDFWHUL]DWLRQ RI DGHQRDVVRFLDWHG YLUXV W\SH PXWDQWV 9LURO +HUPRQDW 3 / $ 6DQWLQ DQG 5 % %DWFKX 7KH DGHQRDVVRFLDWHG YLUXV 5HS PDMRU UHJXODWRU\WUDQVIRUPDWLRQ VXSSUHVVRU SURWHLQ ELQGV FHOOXODU 6SO LQ YLWUR DQG HYLGHQFH RI D ELRORJLFDO HIIHFW &DQFHU 5HV +HUPRQDW 3 / $ 6DQWLQ 5 % %DWFKX DQG =KDQ 7KH DGHQR DVVRFLDWHG YLUXV 5HS PDMRU UHJXODWRU\ SURWHLQ ELQGV WKH FHOOXODU 7$7$ELQGLQJ SURWHLQ LQ YLWUR DQG LQ YLYR 9LURORJ\ +RHUHU 0 & %RJHGDLQ 8 6FKHHU & +HEHUJHU 6 6WH\UHU $ %XUJHU DQG 0DDVV 7KH XVH RI UHFRPELQDQW DGHQRDVVRFLDWHG YLUDO YHFWRUV IRU WKH WUDQVGXFWLRQ RI HSLWKHOLDO WXPRU FHOOV ,QW ,PPXQRSKDUPDFRO +ROVWHJH ) & 8 )LHGOHU DQG + 7 7LPPHUV 7KUHH WUDQVLWLRQV LQ WKH 51$ SRO\PHUDVH ,, WUDQVFULSWLRQ FRPSOH[ GXULQJ LQLWLDWLRQ (PER +ROVWHJH ) & 7DQWLQ 0 &DUH\ 3 & YDQ GHU 9OLHW DQG + 7 7LPPHUV 7KH UHTXLUHPHQW IRU WKH EDVDO WUDQVFULSWLRQ IDFWRU ,,( LV GHWHUPLQHG E\ WKH KHOLFDO VWDELOLW\ RI SURPRWHU '1$ (PER +ROVWHJH ) & 3 & YDQ GHU 9OLHW DQG + 7 7LPPHUV 2SHQLQJ RI DQ 51$ SRO\PHUDVH ,, SURPRWHU RFFXUV LQ WZR GLVWLQFW VWHSV DQG UHTXLUHV WKH EDVDO WUDQVFULSWLRQ IDFWRUV ,,( DQG ,,+ (PER

PAGE 120

,OO +RUHU 0/ 6 :HJHU %XW] ) +RSSH 6H\OHU & *HLVHQ DQG $ .OHLQVFKPLGW 0XWDWLRQDO DQDO\VLV RI DGHQRDVVRFLDWHG YLUXV 5HS SURWHLQ PHGLDWHG LQKLELWLRQ RI KHWHURORJRXV DQG KRPRORJRXV SURPRWHUV 9LURO ,P 6 DQG 1 0X]\F]ND 7KH $$9 RULJLQ ELQGLQJ SURWHLQ 5HS LV DQ $73GHSHQGHQW VLWHVSHFLILF HQGRQXFOHDVH ZLWK '1$ KHOLFDVH DFWLYLW\ &HOO ,P 6 DQG 1 0X]\F]ND )DFWRUV WKDW ELQG WR DGHQRDVVRFLDWHG YLUXV WHUPLQDO UHSHDWV -9LURO ,P 6 DQG 1 0X]\F]ND 3DUWLDO SXULILFDWLRQ RI DGHQRDVVRFLDWHG YLUXV 5HS 5HS DQG 5HS DQG WKHLU ELRFKHPLFDO FKDUDFWHUL]DWLRQ -9LURO ,PEDO]DQR $ 1 (QHUJ\GHSHQGHQW FKURPDWLQ UHPRGHOHUV FRPSOH[ FRPSOH[HV DQG WKHLU FRPSRQHQWV &ULW 5HY (XNDU\RW *HQH ([SU ,QFH 7 $ DQG : 6FRWWR 'LIIHUHQWLDO XWLOL]DWLRQ RI PXOWLSOH WUDQVFULSWLRQ VWDUW SRLQWV DFFRPSDQLHV WKH RYHUH[SUHVVLRQ RI WKH 3JO\FRSURWHLQ HQFRGLQJ JHQH LQ &KLQHVH KDPVWHU OXQJ FHOOV *HQH ,QRVWUR]D $ ) + 0HUPHOVWHLQ +D : 6 /DQH DQG 5HLQEHUJ 'UO D 7$7$ELQGLQJ SURWHLQDVVRFLDWHG SKRVSKRSURWHLQ DQG LQKLELWRU RI FODVV ,, JHQH WUDQVFULSWLRQ &HOO -HRXQJ 6 &KHQ :LQGVRU DQG 5 ( 3ROODFN +XPDQ PDMRU +63 SURWHLQ FRPSOHPHQWV WKH ORFDOL]DWLRQ DQG IXQFWLRQDO GHIHFWV RI F\WRSODVPLF PXWDQW 69 7 DQWLJHQ LQ 6ZLVV 7 PRXVH ILEUREODVW FHOOV *HQHV 'HY -LQJ ; 9 .DOPDQ0DOWHVH ; &DR 4
PAGE 121

FRIDFWRU 1& 'UOf DQG JHQHUDO IDFWRUV 7),,$ DQG 7),,% %LRO &KHP .LP < 6 %MRUNOXQG < /L 0 + 6D\UH DQG 5 .RUQEHUJ $ PXOWLSURWHLQ PHGLDWRU RI WUDQVFULSWLRQDO DFWLYDWLRQ DQG LWV LQWHUDFWLRQ ZLWK WKH & WHUPLQDO UHSHDW GRPDLQ RI 51$ SRO\PHUDVH ,, &HOO .LQJ $ 5 'XELHO]LJ *ULPP DQG $ .OHLQVFKPLGW '1$ KHOLFDVHPHGLDWHG SDFNDJLQJ RI DGHQRDVVRFLDWHG YLUXV W\SH JHQRPHV LQWR SUHIRUPHG FDSVLGV (PER .LWD\ 0 DQG 7 5RZH 3URWHLQSURWHLQ LQWHUDFWLRQV EHWZHHQ (SVWHLQ%DUU YLUXV QXFOHDU DQWLJHQ /3 DQG FHOOXODU JHQH SURGXFWV ELQGLQJ RI NLORGDOWRQ KHDW VKRFN SURWHLQV 9LURORJ\ .OHLQ 3 % / 3RRO =REHO 2
PAGE 122

.XR 0 + =KRX 3 -DPEHFN 0 ( &KXUFKLOO DQG & $OOLV +LVWRQH DFHW\OWUDQVIHUDVH DFWLYLW\ RI \HDVW *FQS LV UHTXLUHG IRU WKH DFWLYDWLRQ RI WDUJHW JHQHV LQ YLYR *HQHV 'HY .\RVWLR 6 5 5 $ 2ZHQV 0 :HLW]PDQ % $ $QWRQL 1 &KHMDQRYVN\ DQG % &DUWHU $QDO\VLV RI DGHQRDVVRFLDWHG YLUXV $$9f ZLOGW\SH DQG PXWDQW 5HS SURWHLQV IRU WKHLU DELOLWLHV WR QHJDWLYHO\ UHJXODWH $$9 S DQG S P51$ OHYHOV 9LURO .\RVWLR 6 5 5 6 :RQGHUOLQJ DQG 5 $ 2ZHQV 1HJDWLYH UHJXODWLRQ RI WKH DGHQRDVVRFLDWHG YLUXV $$9f 3 SURPRWHU LQYROYHV ERWK WKH 3 UHS ELQGLQJ VLWH DQG WKH FRQVHQVXV $73ELQGLQJ PRWLI RI WKH $$9 5HS SURWHLQ 9LURO /DERZ 0 $ / + *UDI -U DQG %HUQV $GHQRDVVRFLDWHG YLUXV JHQH H[SUHVVLRQ LQKLELWV FHOOXODU WUDQVIRUPDWLRQ E\ KHWHURORJRXV JHQHV 0RO &HOO %LRO /DERZ 0 $ 3 / +HUPRQDW DQG %HUQV 3RVLWLYH DQG QHJDWLYH DXWRUHJXODWLRQ RI WKH DGHQRDVVRFLDWHG YLUXV W\SH JHQRPH 9LURO /DXJKOLQ & $ & % &DUGHOOLFKLR DQG + & &RRQ /DWHQW LQIHFWLRQ RI .% FHOOV ZLWK DGHQRDVVRFLDWHG YLUXV W\SH 9LURO /DXJKOLQ & $ 1 -RQHV DQG % &DUWHU (IIHFW RI GHOHWLRQV LQ DGHQRYLUXV HDUO\ UHJLRQ JHQHV XSRQ UHSOLFDWLRQ RI DGHQRDVVRFLDWHG YLUXV 9LURO /HH 6 0 *DOYLQ 5 + 6HH 5 (FNQHU /LYLQJVWRQ ( 0RUDQ DQG < 6KL 5HOLHI RI << WUDQVFULSWLRQDO UHSUHVVLRQ E\ DGHQRYLUXV ($ LV PHGLDWHG E\ (O$DVVRFLDWHG SURWHLQ S *HQHV 'HY /HH 7 / :\ULFN 6 6 .RK ( -HQQLQJV ( / *DGERLV DQG 5 $
PAGE 123

/HZLV % $ 7XOOV ( 6HWR 1 +RULNRVKL 5 :HLQPDQQ DQG 7 6KHQN $GHQRYLUXV (O $ SURWHLQV LQWHUDFW ZLWK WKH FHOOXODU << WUDQVFULSWLRQ IDFWRU-9LURO /L % DQG 6 )LHOGV ,GHQWLILFDWLRQ RI PXWDWLRQV LQ S WKDW DIIHFW LWV ELQGLQJ WR 69 ODUJH 7 DQWLJHQ E\ XVLQJ WKH \HDVW WZRK\EULG V\VWHP )DVHE /LQ < 6 +D ( 0DOGRQDGR 5HLQEHUJ DQG 0 5 *UHHQ %LQGLQJ RI JHQHUDO WUDQVFULSWLRQ IDFWRU 7),,% WR DQ DFLGLF DFWLYDWLQJ UHJLRQ 1DWXUH /LV 3URPRWHUDVVRFLDWHG SDXVLQJ LQ SURPRWHU DUFKLWHFWXUH DQG SRVWLQLWLDWLRQ WUDQVFULSWLRQDO UHJXODWLRQ &ROG 6SULQJ +DUE 6\PS 4XDQW %LRO /LX 6 6 5 .XR $ 0 0DNKRY 0 &\U *ULIILWK 7 5 %URNHU DQG / 7 &KRZ +XPDQ +VS DQG +VS FKDSHURQH SURWHLQV IDFLOLWDWH KXPDQ SDSLOORPDYLUXV (O SURWHLQ ELQGLQJ WR WKH RULJLQ DQG VWLPXODWH FHOO IUHH '1$ UHSOLFDWLRQ %LRO &KHP /RUVRQ & / 5 %XUJHU 0 0RXZ DQG 3LQWHO (IILFLHQW WUDQVDFWLYDWLRQ RI WKH PLQXWH YLUXV RI PLFH 3 SURPRWHU UHTXLUHV XSVWUHDP ELQGLQJ RI 16 9LURO /RUVRQ & 3HDUVRQ / %XUJHU DQG 3LQWHO $Q 6SOELQGLQJ VLWH DQG 7$7$ HOHPHQW DUH VXIILFLHQW WR VXSSRUW IXOO WUDQVDFWLYDWLRQ E\ SUR[LPDOO\ ERXQG 16 SURWHLQ RI PLQXWH YLUXV RI PLFH 9LURORJ\ /X + / =DZHO / )LVKHU 0 (JO\ DQG 5HLQEHUJ +XPDQ JHQHUDO WUDQVFULSWLRQ IDFWRU ,,+ SKRVSKRU\ODWHV WKH &WHUPLQDO GRPDLQ RI 51$ SRO\PHUDVH ,, 1DWXUH /XJHU DQG 7 5LFKPRQG 7KH KLVWRQH WDLOV RI WKH QXFOHRVRPH &XUU 2SLQ *HQHW 'HY 0D DQG 0 3WDVKQH 7KH FDUER[\WHUPLQDO DPLQR DFLGV RI *$/ DUH UHFRJQL]HG E\ *$/ &HOO 0DUVKDOO 1 ) DQG + 3ULFH 3XULILFDWLRQ RI 37()E D WUDQVFULSWLRQ IDFWRU UHTXLUHG IRU WKH WUDQVLWLRQ LQWR SURGXFWLYH HORQJDWLRQ %LRO &KHP 0DUWLQH] ( & 0 &KLDQJ + *H DQG 5 5RHGHU 7$7$ELQGLQJ SURWHLQDVVRFLDWHG IDFWRUVf LQ 7),,' IXQFWLRQ WKURXJK WKH LQLWLDWRU WR GLUHFW EDVDO WUDQVFULSWLRQ IURP D 7$7$OHVV FODVV ,, SURPRWHU (PER

PAGE 124

0DUWLQH] ( + *H < 7DR & ;
PAGE 125

0X]\F]ND 1 8VH RI DGHQRDVVRFLDWHG YLUXV DV D JHQHUDO WUDQVGXFWLRQ YHFWRU IRU PDPPDOLDQ FHOOV &XUU 7RS 0LFURELRO ,PPXQRO 0X]\F]ND 1 DQG %HUQV 3DUYRYLULGDH 7KH YLUXVHV DQG WKHLU UHSOLFDWLRQ S ,Q 0 .QLSH DQG 3 0 +RZOH\ HGVf )LHOGV 9LURORJ\ )RXUWK HG /LSSLQFRWW :LOOLDPV DQG :LONLQV 1HZ
PAGE 126

3HUHLUD DQG 1 0X]\F]ND 7KH DGHQRDVVRFLDWHG YLUXV W\SH S SURPRWHU UHTXLUHV D SUR[LPDO 6SO LQWHUDFWLRQ DQG D SL &$U*OLNH HOHPHQW WR IDFLOLWDWH 5HS WUDQVDFWLYDWLRQ 9LURO 3HUHLUD DQG 1 0X]\F]ND 7KH FHOOXODU WUDQVFULSWLRQ IDFWRU 63 DQG DQ XQNQRZQ FHOOXODU SURWHLQ DUH UHTXLUHG WR PHGLDWH 5HS SURWHLQ DFWLYDWLRQ RI WKH DGHQRDVVRFLDWHG YLUXV SO SURPRWHU 9LURO 3LQWR / : + :X 1D DQG 0 +DPSVH\ &KDUDFWHUL]DWLRQ RI VXD PXWDWLRQV GHILQHV D GRPDLQ RI 7),,% LQYROYHG LQ WUDQVFULSWLRQ VWDUW VLWH VHOHFWLRQ LQ \HDVW %LRO &KHP 3LSDV 0 0ROHFXODU FKDSHURQH IXQFWLRQ RI WKH 69 ODUJH 7 DQWLJHQ 'HY %LRO 6WDQG 3RGVDNRII . :RQJ -U DQG 6 &KDWWHUMHH (IILFLHQW JHQH WUDQVIHU LQWR QRQGLYLGLQJ FHOOV E\ DGHQRDVVRFLDWHG YLUXVEDVHG YHFWRUV -9LURO 3UHOLFK 6DFFKDURP\FHV FHUHYLVLDH %85 HQFRGHV D '5$3O1&DOSKD KRPRORJ WKDW KDV ERWK SRVLWLYH DQG QHJDWLYH UROHV LQ WUDQVFULSWLRQ LQ YLYR 0RO &HOO %LRO 3UHOLFK DQG ) :LQVWRQ 0XWDWLRQV WKDW VXSSUHVV WKH GHOHWLRQ RI DQ XSVWUHDP DFWLYDWLQJ VHTXHQFH LQ \HDVW LQYROYHPHQW RI D SURWHLQ NLQDVH DQG KLVWRQH + LQ UHSUHVVLQJ WUDQVFULSWLRQ LQ YLYR *HQHWLFV 3WDVKQH 0 DQG $ *DQQ 7UDQVFULSWLRQDO DFWLYDWLRQ E\ UHFUXLWPHQW 1DWXUH 5DPDNULVKQDQ 9 +LVWRQH +, DQG FKURPDWLQ KLJKHURUGHU VWUXFWXUH &ULW 5HY (XNDU\RW *HQH ([SU 5REHUW ) 0 'RX]LHFK )RUJHW 0 (JO\ *UHHQEODWW = ) %XUWRQ DQG % &RXORPEH :UDSSLQJ RI SURPRWHU '1$ DURXQG WKH 51$ SRO\PHUDVH ,, LQLWLDWLRQ FRPSOH[ LQGXFHG E\ 7),,) 0RO &HOO 5RVVLJQRO 0 $ .HULHO $ 6WDXE DQG 0 (JO\ .LQDVH DFWLYLW\ DQG SKRVSKRU\ODWLRQ RI WKH ODUJHVW VXEXQLW RI 7),,) WUDQVFULSWLRQ IDFWRU %LRO &KHP 5R\ 5 3 $GDPF]HZVNL 7 6HUR] : 9HUPHXOHQ 3 7DVVDQ / 6FKDHIIHU ( $ 1LJJ + +RHLMPDNHUV DQG 0 (JO\ 7KH 02 FHOO F\FOH NLQDVH LV DVVRFLDWHG ZLWK WKH 7),,+ WUDQVFULSWLRQ '1$ UHSDLU IDFWRU &HOO

PAGE 127

5XQGOHWW 6 ( $ $ &DUPHQ 5 .RED\DVKL 6 %DY\NLQ % 0 7XUQHU DQG 0 *UXQVWHLQ +'$ DQG 53' DUH PHPEHUV RI GLVWLQFW \HDVW KLVWRQH GHDFHW\ODVH FRPSOH[HV WKDW UHJXODWH VLOHQFLQJ DQG WUDQVFULSWLRQ 3URF 1DWO $FDG 6FL86 $ 5\DQ + 6 =RORWXNKLQ DQG 1 0X]\F]ND 6HTXHQFH UHTXLUHPHQWV IRU ELQGLQJ RI 5HS WR WKH DGHQRDVVRFLDWHG YLUXV WHUPLQDO UHSHDWV 9LURO 6DNXUDL + 7 2KLVKL DQG 7 )XNDVDZD 3URPRWHU VWUXFWXUHGHSHQGHQW IXQFWLRQLQJ RI WKH JHQHUDO WUDQVFULSWLRQ IDFWRU +( LQ 6DFFKDURP\FHV FHUHYLVLDH %LRO &KHP 6DPXOVNL 5 $ 6ULYDVWDYD %HUQV DQG 1 0X]\F]ND 5HVFXH RI DGHQRDVVRFLDWHG YLUXV IURP UHFRPELQDQW SODVPLGV JHQH FRUUHFWLRQ ZLWKLQ WKH WHUPLQDO UHSHDWV RI $$9 &HOO 6DPXOVNL 5 ; =KX ; ;LDR %URRN ( +RXVPDQ 1 (SVWHLQ DQG / $ +XQWHU 7DUJHWHG LQWHJUDWLRQ RI DGHQRDVVRFLDWHG YLUXV $$9f LQWR KXPDQ FKURPRVRPH >SXEOLVKHG HUUDWXP DSSHDUV LQ (0%2 0DU f @ (PER 6DZDL ( 7 DQG 6 %XWHO $VVRFLDWLRQ RI D FHOOXODU KHDW VKRFN SURWHLQ ZLWK VLPLDQ YLUXV ODUJH 7 DQWLJHQ LQ WUDQVIRUPHG FHOOV 9LURO 6HUL]DZD + 7 3 0DNHOD : &RQDZD\ 5 & &RQDZD\ 5 $ :HLQEHUJ DQG 5 $
PAGE 128

51$ SRO\PHUDVH ,,FRQWDLQLQJ FRPSOH[ GLVWLQFW IURP WKH 6UESFRQWDLQLQJ KRORHQ]\PH 0RO &HOO %LRO 6KL < ( 6HWR / 6 &KDQJ DQG 7 6KHQN 7UDQVFULSWLRQDO UHSUHVVLRQ E\ << D KXPDQ */,.UXSSHOUHODWHG SURWHLQ DQG UHOLHI RI UHSUHVVLRQ E\ DGHQRYLUXV (O $ SURWHLQ &HOO 6LO $ 6 $ODP 3 ;LQ / 0D 0 0RUJDQ & 0 /HER 0 3 :RRGV DQG ( +RSSHU 7KH *DOS*DOS*DOS WUDQVFULSWLRQ VZLWFK RI \HDVW *DOS GHVWDELOL]HV WKH *DOS*DOS FRPSOH[ LQ UHVSRQVH WR JDODFWRVH DQG $73 0RO &HOO %LRO 6LQJHU 9 / & 5 :REEH DQG 6WUXKO $ ZLGH YDULHW\ RI '1$ VHTXHQFHV FDQ IXQFWLRQDOO\ UHSODFH D \HDVW 7$7$ HOHPHQW IRU WUDQVFULSWLRQDO DFWLYDWLRQ *HQHV 'HY 6PDOH 6 7 DQG %DOWLPRUH 7KH LQLWLDWRU DV D WUDQVFULSWLRQ FRQWURO HOHPHQW &HOO 6PDOH 6 7 $ -DLQ .DXIPDQQ + (PDPL /R DQG 3 *DUUDZD\ 7KH LQLWLDWRU HOHPHQW D SDUDGLJP IRU FRUH SURPRWHU KHWHURJHQHLW\ ZLWKLQ PHWD]RDQ SURWHLQFRGLQJ JHQHV &ROG 6SULQJ +DUE 6\PS 4XDQW %LRO 6PLWK 5 + DQG 5 0 .RWLQ $Q DGHQRDVVRFLDWHG YLUXV $$9f LQLWLDWRU SURWHLQ 5HS FDWDO\]HV WKH FOHDYDJH DQG OLJDWLRQ RI VLQJOHVWUDQGHG $$9 RUL '1$ 9LURO 6PLWK 5 + DQG 5 0 .RWLQ 7KH 5HS JHQH SURGXFW RI DGHQR DVVRFLDWHG YLUXV LV D '1$ KHOLFDVH ZLWK nWRn SRODULW\ 9LURO 6Q\GHU 5 2 5 6DPXOVNL DQG 1 0X]\F]ND ,Q YLWUR UHVROXWLRQ RI FRYDOHQWO\ MRLQHG $$9 FKURPRVRPH HQGV &HOO 6SHQFHU 9 $ DQG 5 'DYLH 5ROH RI FRYDOHQW PRGLILFDWLRQV RI KLVWRQHV LQ UHJXODWLQJ JHQH H[SUHVVLRQ *HQH 6ULQLYDVDQ $ $ 0F&OHOODQ 9DUWLNDU 0DUNV 3 &DQWDOXSR < /L 3 :K\WH 5XQGHOO / %URGVN\ DQG 0 3LSDV 7KH DPLQRWHUPLQDO WUDQVIRUPLQJ UHJLRQ RI VLPLDQ YLUXV ODUJH 7 DQG VPDOO W DQWLJHQV IXQFWLRQV DV D GRPDLQ 0RO &HOO %LRO 6ULYDVWDYD $ ( : /XVE\ DQG %HUQV 1XFOHRWLGH VHTXHQFH DQG RUJDQL]DWLRQ RI WKH DGHQRDVVRFLDWHG YLUXV JHQRPH 9LURO 6WUXKO
PAGE 129

6WXEGDO + =DOYLGH 6 &DPSEHOO & 6FKZHLW]HU 7 0 5REHUWV DQG $ 'H&DSULR ,QDFWLYDWLRQ RI S5%UHODWHG SURWHLQV SL DQG SL PHGLDWHG E\ WKH GRPDLQ RI VLPLDQ YLUXV ODUJH 7 DQWLJHQ 0RO &HOO %LRO 6X 3 ) 6 < &KLDQJ & : :X DQG ) < :X $GHQRDVVRFLDWHG YLUXV PDMRU UHS SURWHLQ GLVUXSWV ELQGLQJ RI 7$7$ ELQGLQJ SURWHLQ WR WKH S SURPRWHU RI KXPDQ SDSLOORPDYLUXV W\SH >,Q 3URFHVV &LWDWLRQ@ 9LURO 6XQ ) / DQG 6 & (OJLQ 3XWWLQJ ERXQGDULHV RQ VLOHQFH &HOO 6XQ ; < =KDQJ + &KR 3 5LFNHUW ( /HHV : /DQH DQG 5HLQEHUJ 1$7 D KXPDQ FRPSOH[ FRQWDLQLQJ 6UE SRO\SHSWLGHV WKDW IXQFWLRQV DV D QHJDWLYH UHJXODWRU RI DFWLYDWHG WUDQVFULSWLRQ 0RO &HOO 7KRPDV 2 DQG $ $ 7UDYHUV +0* DQG DQG UHODWHG nDUFKLWHFWXUDOn '1$ELQGLQJ SURWHLQV 7UHQGV %LRFKHP 6FL 7LMHULQD 3 DQG 0 + 6D\UH $ GHELOLWDWLQJ PXWDWLRQ LQ WUDQVFULSWLRQ IDFWRU +( ZLWK GLIIHUHQWLDO HIIHFWV RQ JHQH H[SUHVVLRQ LQ \HDVW %LRO &KHP 7UHPSH 3 DQG % &DUWHU 5HJXODWLRQ RI DGHQRDVVRFLDWHG YLUXV JHQH H[SUHVVLRQ LQ FHOOV FRQWURO RI P51$ DEXQGDQFH DQG WUDQVODWLRQ 9LURO 7ULH]HQEHUJ 6 6WUXFWXUH DQG IXQFWLRQ RI WUDQVFULSWLRQDO DFWLYDWLRQ GRPDLQV &XUU 2SLQ *HQHW 'HY 7VH & DQG & +DQVHQ +\EULG WU\SVLQL]HG QXFOHRVRPDO DUUD\V LGHQWLILFDWLRQ RI PXOWLSOH IXQFWLRQDO UROHV RI WKH +$+% DQG ++ 1WHUPLQL LQ FKURPDWLQ ILEHU FRPSDFWLRQ %LRFKHPLVWU\ 8SWDLQ 6 0 & 0 .DQH DQG 0 &KDPEHUOLQ %DVLF PHFKDQLVPV RI WUDQVFULSW HORQJDWLRQ DQG LWV UHJXODWLRQ $QQX 5HY %LRFKHP 8UDEH 0 < +DVXPL $ .XPH 5 7 6XURVN\ .XUW]PDQ 7RELWD DQG 2]DZD &KDUJHGWRDODQLQH VFDQQLQJ PXWDJHQHVLV RI WKH 1WHUPLQDO KDOI RI DGHQR DVVRFLDWHG YLUXV W\SH 5HS SURWHLQ 9LURO 8VKHYD $ DQG 7 6KHQN 7$7$ELQGLQJ SURWHLQLQGHSHQGHQW LQLWLDWLRQ << 7),,% DQG 51$ SRO\PHUDVH ,, GLUHFW EDVDO WUDQVFULSWLRQ RQ VXSHUFRLOHG WHPSODWH '1$&HOO 9HUULM]HU & 3 DQG 5 7MLDQ 7$)V PHGLDWH WUDQVFULSWLRQDO DFWLYDWLRQ DQG SURPRWHU VHOHFWLYLW\ 7UHQGV %LRFKHP 6FL

PAGE 130

9LQFHQW $ & DQG 6WUXKO $&5 D \HDVW $7)&5(% UHSUHVVRU 0RO &HOO %LRO :DGH 3 $ DQG $ -DHKQLQJ 7UDQVFULSWLRQDO FRUHSUHVVLRQ LQ YLWUR D 0RWOSDVVRFLDWHG IRUP RI 7$7$ ELQGLQJ SURWHLQ LV UHTXLUHG IRU UHSUHVVLRQ E\ /HXS 0RO &HOO %LRO :DONHU 6 / 5 6 :RQGHUOLQJ DQG 5 $ 2ZHQV 0XWDWLRQDO DQDO\VLV RI WKH DGHQRDVVRFLDWHG YLUXV 5HS SURWHLQ LGHQWLILFDWLRQ RI FULWLFDO UHVLGXHV QHFHVVDU\ IRU VLWHVSHFLILF HQGRQXFOHDVH DFWLYLW\ 9LURO :DONHU 6 / 5 6 :RQGHUOLQJ DQG 5 $ 2ZHQV 0XWDWLRQDO DQDO\VLV RI WKH DGHQRDVVRFLDWHG YLUXV W\SH 5HS SURWHLQ KHOLFDVH PRWLIV 9LURO :DOWHU $ &DUERQH DQG : :HOFK 0HGLXP WXPRU DQWLJHQ RI SRO\RPDYLUXV WUDQVIRUPDWLRQGHIHFWLYH PXWDQW 1* LV DVVRFLDWHG ZLWK NLORGDOWRQ KHDW VKRFN SURWHLQ 9LURO :DO] & DQG 5 6FKOHKRIHU 0RGLILFDWLRQ RI VRPH ELRORJLFDO SURSHUWLHV RI +H/D FHOOV FRQWDLQLQJ DGHQRDVVRFLDWHG YLUXV '1$ LQWHJUDWHG LQWR FKURPRVRPH -9LURO :DO] & 5 6FKOHKRIHU 0 )OHQWMH 9 5XGDW DQG + ]XU +DXVHQ $GHQRDVVRFLDWHG YLUXV VHQVLWL]HV +H/D FHOO WXPRUV WR JDPPD UD\V -9LURO :DQJ / & 0L]]HQ &
PAGE 131

:HLW]PDQ 0 6 5 .\RVWLR % &DUWHU DQG 5 $ 2ZHQV ,QWHUDFWLRQ RI ZLOGW\SH DQG PXWDQW DGHQRDVVRFLDWHG YLUXV $$9f 5HS SURWHLQV RQ $$9 KDLUSLQ '1$ 9LURO :HLW]PDQ 0 6 5 .\RVWLR 5 0 .RWLQ DQG 5 $ 2ZHQV $GHQR DVVRFLDWHG YLUXV $$9f 5HS SURWHLQV PHGLDWH FRPSOH[ IRUPDWLRQ EHWZHHQ $$9 '1$ DQG LWV LQWHJUDWLRQ VLWH LQ KXPDQ '1$ 3URF1DWO$FDG6FL86$ :LQRFRXU ( 0 ) &DOLDKDP DQG ( +XEHUPDQ 3HUWXUEDWLRQ RI WKH FHOO F\FOH E\ DGHQRDVVRFLDWHG YLUXV 9LURORJ\ :LQRFRXU ( / 3X]LV 6 (WNLQ 7 .RFK % 'DQRYLWFK ( 0HQGHOVRQ ( 6KDXOLDQ 6 .DUE\ DQG 6 /DYL 0RGXODWLRQ RI WKH FHOOXODU SKHQRW\SH E\ LQWHJUDWHG DGHQRDVVRFLDWHG YLUXV 9LURORJ\ :REEH & 5 DQG 6WUXKO SXEOLVKHG HUUDWXP DSSHDUV LQ 9LURO 'HFf@ 9LURO :RUNPDQ / DQG 5 ( .LQJVWRQ $OWHUDWLRQ RI QXFOHRVRPH VWUXFWXUH DV D PHFKDQLVP RI WUDQVFULSWLRQDO UHJXODWLRQ $QQX 5HY %LRFKHP :X < 5 5HHFH DQG 0 3WDVKQH 4XDQWLWDWLRQ RI SXWDWLYH DFWLYDWRU WDUJHW DIILQLWLHV SUHGLFWV WUDQVFULSWLRQDO DFWLYDWLQJ SRWHQWLDOV (PER :\ULFN ) & +ROVWHJH ( -HQQLQJV + & &DXVWRQ 6KRUH 0 *UXQVWHLQ ( 6 /DQGHU DQG 5 $
PAGE 132

;LDR + )ULHVHQ DQG 7 /LV 5HFUXLWLQJ 7$7$ELQGLQJ SURWHLQ WR D SURPRWHU WUDQVFULSWLRQDO DFWLYDWLRQ ZLWKRXW DQ XSVWUHDP DFWLYDWRU 0RO &HOO %LRO
PAGE 133

=RX < *XR 7 *XHWWRXFKH ) 6PLWK DQG 5 9RHOOP\ 5HSUHVVLRQ RI KHDW VKRFN WUDQVFULSWLRQ IDFWRU +6) DFWLYDWLRQ E\ +63 +63 FRPSOH[f WKDW IRUPV D VWUHVVVHQVLWLYH FRPSOH[ ZLWK +6) &HOO

PAGE 134

%,2*5$3+,&$/ 6.(7&+ 'DQLHO )UDQFLV /DFNQHU ZDV ERP RQ 6HSWHPEHU LQ 0LGODQG 0LFKLJDQ +H VSHQW WKH ILUVW IRXU \HDUV RI KLV OLIH LQ 0LFKLJDQ XQWLO KLV SDUHQWV PRYHG WR 0DGLVRQ ,QGLDQD +H DWWHQGHG 3RSH -RKQ ;;,, (OHPHQWDU\ 6FKRRO DQG 0DGLVRQ -XQLRU +LJK 6FKRRO LQ ,QGLDQD :KLOH KH ZDV IRXUWHHQ \HDUV ROG KLV SDUHQWV PRYHG EDFN WR 0LGODQG 0LFKLJDQ ZKHUH KH ILQLVKHG VFKRRO DW 1RUWKHDVW -XQLRU +LJK 6FKRRO DQG 0LGODQG 3XEOLF +LJK 6FKRRO 'XULQJ WKH IDOO RI 'DQ HQUROOHG LQ FROOHJH XQGHUJUDGXDWH VWXGLHV DW 'HOWD &ROOHJH LQ 8QLYHUVLW\ &HQWHU 0LFKLJDQ $IWHU WKH ILUVW WZR \HDUV RI 'HOWD &ROOHJH KH WUDQVIHUUHG WR 0LFKLJDQ 6WDWH 8QLYHUVLW\ LQ (DVW /DQVLQJ 0LFKLJDQ +H UHFHLYHG D %DFKHORU RI 6FLHQFH GHJUHH ZLWK +LJK +RQRUV LQ %LRFKHPLVWU\ LQ WKH VSULQJ RI $IWHU HDUQLQJ D %LRFKHPLVWU\ GHJUHH KH REWDLQHG D MRE DV D /DERUDWRU\ 7HFKQLFLDQ DW WKH 8QLYHUVLW\ RI 5RFKHVWHU %LRORJ\ 'HSDUWPHQW LQ 5RFKHVWHU 1HZ
PAGE 135

, FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ OXnR/G WZ ]e/f§ 1LFKRODV 0X]\F]ND &KDLU (PLQHQW 6FKRODU DQG 3URIHVVRU RI 0ROHFXODU *HQHWLFV DQG 0LFURELRORJ\ FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ 0DXUHHQ *RRGHR O2: 3URIHVVRU RI 3DWKRORJ\ ,PPXQRORJ\ DQG /DERUDWRU\ 0HGLFLQH FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWHP VFRSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ \ ALIILDP +DXVZLUWK (PLQHQW 6FKRODU DQG 3URIHVVRU RI 0ROHFXODU *HQHWLFV DQG 0LFURELRORJ\ FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWHLQAVFSSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ 0DXULFH 6ZDQVRQ 3URIHVVRU RI 0ROHFXODU *HQHWLFV DQG 0LFURELRORJ\

PAGE 136

7KLV GLVVHUWDWLRQ ZDV VXEPLWWHG WR WKH *UDGXDWH )DFXOW\ RI WKH &ROOHJH RI $JULFXOWXUDO DQG /LIH 6FLHQFHV DQG WR WKH *UDGXDWH 6FKRRO DQG ZDV DFFHSWHG DV SDUWLDO IXOILOOPHQW RI WKH UHTXLUHPHQWV IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ $XJXVW 'HDQ &OOHJH RI 0HGLFLQH 'HDQ *UDGXDWH 6FKRRO