Citation
Optimization of hepatic targeting for antisense inhibition of hypertension in spontaneously hypertensive rats

Material Information

Title:
Optimization of hepatic targeting for antisense inhibition of hypertension in spontaneously hypertensive rats
Creator:
Shi, Ningya, 1969-
Publication Date:
Language:
English
Physical Description:
xi, 150 leaves : ill. ; 29 cm.

Subjects

Subjects / Keywords:
Blood pressure ( jstor )
Dosage ( jstor )
Hypertension ( jstor )
Kidneys ( jstor )
Lipids ( jstor )
Liposomes ( jstor )
Liver ( jstor )
Messenger RNA ( jstor )
Plasmas ( jstor )
Rats ( jstor )
Department of Medicinal Chemistry thesis Ph.D ( mesh )
Dissertations, Academic -- College of Pharmacy -- Department of Medicinal Chemistry -- UF ( mesh )
Gene Expression Regulation ( mesh )
Gene Therapy ( mesh )
Hypertension -- therapy ( mesh )
Liposomes -- therapeutic use -- pharmacology ( mesh )
Oligonucleotides, Antisense -- pharmacology ( mesh )
Oligonucleotides, Antisense -- therapeutic use ( mesh )
Rats, Inbred SHR ( mesh )
Renin-Angiotensin System -- drug effects ( mesh )
Research ( mesh )
Genre:
bibliography ( marcgt )
non-fiction ( marcgt )

Notes

Thesis:
Thesis (Ph.D.)--University of Florida, 1999.
Bibliography:
Bibliography: leaves 134-149.
General Note:
Typescript.
General Note:
Vita.
Statement of Responsibility:
by Ningya Shi.

Record Information

Source Institution:
University of Florida
Holding Location:
University of Florida
Rights Management:
The University of Florida George A. Smathers Libraries respect the intellectual property rights of others and do not claim any copyright interest in this item. This item may be protected by copyright but is made available here under a claim of fair use (17 U.S.C. §107) for non-profit research and educational purposes. Users of this work have responsibility for determining copyright status prior to reusing, publishing or reproducing this item for purposes other than what is allowed by fair use or other copyright exemptions. Any reuse of this item in excess of fair use or other copyright exemptions requires permission of the copyright holder. The Smathers Libraries would like to learn more about this item and invite individuals or organizations to contact the RDS coordinator (ufdissertations@uflib.ufl.edu) with any additional information they can provide.
Resource Identifier:
030255849 ( ALEPH )
51624281 ( OCLC )

Downloads

This item has the following downloads:


Full Text















OPTIMIZATION OF HEPATIC TARGETING FOR ANTISENSE
INHIBITION OF HYPERTENSION IN SPONTANEOUSLY HYPERTENSIVE RATS














By


NINGYA SHI


















A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE
REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY



UNIVERSITY OF FLORIDA 1999


















ACKNOWLEDGMENTS

First, I want to express my sincere appreciation to Dr. Donna Wielbo, for her support, advice and guidance through my course of study, which I would not have completed without her help.

I would also like to express my gratitude to all MY committee members for their invaluable guidance and the time they committed to my graduate work. I want to thank Dr. Michae. Katovich for his guidance as I completed my dissertation, as and for helping me withl- my writing. I want to thank Dr. Kenneth Sloan for his supervision while I was a graduate student in the Department of Medicinal Chemistry. I want to thank Dr. Colin Sumners and Dr. Nasser Chegini as for their discussion of my research, and Dr. Ian Tebbett for his help in analytic method validation. I want to thank our lab members for their kind help.

Finally, I want to thank members of my family for their support during this time.

















TABLE OF CONTENTS

p1age

ACKNOWLEDGMENTS ..... ....................................ii

LIST OF TABLES ............................................ v

LIST OF FIGURES ........................................... vi

NOTATION ................................................. ix

ABSTRACT .................................................. x

CHAPTERS

I. INTRODUCTION ..................... ...................... 1

Hypertension ........ ..................... ............... .1
Antisense Oligodeoxynucleotides ........................ 21
Liposomes as a Delivery Vehicle for ASODN. ....... ...... 30
Hypothesis ............................................. 37

2. GENERAL MATERIAL AND METHODS .......................... 38.

3. LIPOSOME-MEDIATED OLIGONUCLEOTIDE
DELIVERY IN HEPATOMA CELL CULTURE .................. 47

Specific Aims .......................................... 47
Introduction ........................................... 47
Material and Methods .................................. 52
Results ................................................ 54
Discussion ............................................ 69

4. THE EFFECT OF ROUTE OF ADMINISTRATION OF CA/ASODN
ON BLOOD PRESSURE ANDTISSUE DISTRIBUTION OF
ASODN IN SHR: IMPLICATION OF THE ROLE OF TISSUE
RAS ON BLOOD PRESSURE REGULATION .................... 75

Specific Aims .......................................... 75
Introduction ........................................... 75
Material and Methods .................................. 79
Results ................................................ 81
Discussion ............................................. 94

5. DOSE-DEPENDENT PHYSIOLOGICAL EFFECTS OF CATIONIC



iii









LIPOSOSME COMPLEXED ASODN IN SHR MODEL............... 102

Specific Aims............................................ 102
Introduction............................................. 102
Material and Methods.................................... 105
Results.................................................. 107
Discussion............................................... 123

6. DISCUSSION AND SUMMARY.................................. 128

REFERENCES.................................................. 134

BIOGRAPHICAL SKETCH........................................ 150















































iv















LIST OF TABLES
Table pae

1-1. Properties of selected phosphodiester backbone
analogues .........................................29

5-1. Dose-response effects of CA/ASODN on water
intake and urine output in SHR ...................119

5-2. Dose-response effects of CA/ASODN on plasma
aldosterone levels in SHR .......................120

5-3. Dose-response effects of CA/ASODN on 24-hours
urinary sodium and potassium excretion in SHR .... 122



































v
















LIST OF FIGURES
Figure 1pae

1-1. Factors involved in the control of blood
pressure ............................................ 3

1-2. Schematic representation of the reninangiotensin-system ................................... 5

1-3. Signal transduction of angiotensin II receptor
type I .............................................. 11

1-4. Schematic representation of 5' flanking regions
of the AGT gene ...................................... 13

1-5. Zntihypertensive drugs working on the RAS ............ 19

1-6. Summary of the possible sites of sequencespecific actions of ASODN ............................. 23

1-7. Structures of phosphodiester and phosphorothioate
molecules ........................................... 26

1-8. Phase structures formed by lipids in the aqueous
solution ............................................ 31

1-9. Possible mechanisms of interaction between
liposome and cell surface .............................. 34

3-1. Effect of DDAB and DOPE molar ratio on the
cellular uptake of FITC-labeled ASODN ................ 56

3-2. Effect of DDAB to ASODN charge ratio on the
cellular uptake of FITC-labeled ASODN ................ 57

3-3. Time course of cellular uptake of FITC-labeled
ASODN, PC/ASODN, and CA/ASODN ....................... 58

3-4. Dose-dependent cellular uptake of FITC-labeled
ASODN ............................................... 60

3-5. Cellular uptake and intracellular distribution of
FITC-labeled ASODN observed by confocal
microscopy .......................................... 61




vi








3-6. Effects of liposome-associated ASODN on the AGT
mRNA expression in hepatoma cell culture ............63

3-7. Effects of liposome-associated ASODN on the AGT
protein expression in hepatoma cell culture ......... 64

3-8. Dose-dependent effects of CA/ASODN on AGT mRNA
expression in hepatoma cell .........................66

3-9. Dose-dependent effects of CA/ASODN on AGT protein
expression in hepatoma cell culture .................67

3-10.ASODN cytoxicity measured by MTT test ...............68

4-1. Mean arterial pressure changes from baseline 24
hours after intra-arterial injection of CA/ASODN
in SHR .............................................. 82

4-2. Mean arterial pressure changes from baseline 24
hours after intravenous injection of CA/ASODN in
SHR ................................................. 83

4-3. Tissue distribution of ASODN and CA/ASODN 1 hour
after IA or IV injection ............................85

4-4. Tissue distribution of ASODN and CA/ASODN 8 hours
after IA or IV injection ............................86

4-5. Tissue distribution of ASODN and CA/ASODN 24
hours after IA or IV. injection ......................87

4-6. Plasma AGT levels 24 hours after IA or IV
injection of ASODN with liposomes in SHR ............88

4-7. Plasma angiotensin II levels 24 hours after IA or
IV injection of ASODN with liposomes in SHR ......... 90

4-8. Liver AGT mRNA levels in SHR 24 hours after IA or
IV injection of ASODN with liposomes ................91

4-9. Heart AGT mRNA levels in SHR 24 hours after IA or
IV injection of ASODN with liposomes ................92

4-10.Kidney AGT mRNA levels in SHR 24 hours after IA
or IV injection of ASODN with liposomes .............93

5-1. The dose-response effects of CA/ASODN on systolic
blood pressure in SHR ..............................108

5-2. The dose-response effects of CA/ASODN on plasma
AGT levels in SHR ...................................110

5-3. The dose-response effects of CA/ASODN on plasma
angiotensin II levels in SHR .......................111


vii








5-4. Dose-response effects of medium dose CA/ASODN on
kidney AGT mRNA expression in SHR ..................112

5-5. Dose-response effects of high dose CA/ASODN on
kidney AGT mRNA expression in SHR ..................113

5-6. Dose-response effects of medium dose CA/ASODN on
liver AGT mRNA expression in SHR ...................114

5-7. Dose-response effects of high dose CA/ASODN on
liver AGT mRNA expression in SHR ...................115

5-8. Dose-response effects of medium dose CA/ASODN on
heart AGT mRNA expression in SHR ...................116

5-9. Dose-response effects of high dose CA/ASODN on
heart AGT mRNA expression in SHR ...................117

6-1. Summary of possible mechanisms for the observed
ASODN mediated blood pressure decrease .............130





































viii

















NOTATIONS


SHR Spontaneously hypertensive rat

WKY Wistar Kyoto rat

AGT Angiotensinogen

RAS Renin-angiotensin system

ASODN Antisense oligodeoxynucleotide

PC:Cholesterol Phosphatidy1choline: cholesterol DDAB D-'--metliyldi.octadecylammonium bromide

DOPE Dioleoylphosphatidylethaiiolamine

CA/ASODN Cationic liposome-complexed ASODN

CA/ScrODN Cationic liposome-complexed scrambled

oligonucleotide

PC/ASODN P%--:cholesterol liposome-encapsulated ASODN

FITC-ASODN Fluorescein isothiocyanate-conjugated ASODN



















ix















Abstract of A Dissertation presented to the Graduate School of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy


OPTIMIZATION OF HEPATIC TARGETING FOR ANTISENSE INHIBITION
OF HYPERTENSION IN SPONTANEOUSLY HYPERTENSIVE RATS


By

Ningya Shi

May 1999

Chairman: Donna Wielbo, Ph.D. Major Department: Medicinal Chemistry


The role of angiotensinogen (AGT) in the pathogenesis of hypertension, a major risk to human health, is well supported. Scientific studies have previously shown that the blockade of angiotensinogen gene expression has been effective in decreasing blood pressure. This dissertation focuses on the effect of cationic liposomes (CA) as a delivery system for an antisense oligodeoxynucleotide (ASODN) targeted to the AGT gene in rat hepatoma cell culture and in the spontaneously hypertensive rat (SHR) model of hypertension. The pharmacological effects of cationic liposome-complexed ASODN (CA/ASODN) on AGT mRNA and protein expression, blood pressure, and both hormonal and tissue renin-angiotensin system (RAS) in SHR are studied. The results presented demonstrate that cationic


x








liposome increases cellular uptake and tissue distribution of ASODN. An increased cellular uptake of ASODN resulted in enhanced gene inhibition and biological effects. These effects were demonstrated by a dosedependent decrease in AGT mRNA and protein in hepatoma cell culture and decreased blood pressure, plasma AGT, plasma Angiotensin II and AGT mRNA in heart, kidney, and liver in the SHR. Decreases in blood pressure were also shown to correlate with decreases in AGT mRNA in the kidney, suggesting renally mediated mechanisms may contribute to the observed blood pressure decrease. Plasma aldosterone levels also decreased after CA/ASODN treatment with a concomitant increase in urine output, a decrease in urinary potassium excretion and an increase in sodium excretion. These studies strongly suggest that ASODN targeted to AGT mRNA has, the potential to be used as a therapeutic agent for the treatment of hypertension as well as a research tool to study the mechanisms of development and maintenance of hypertension.


















xi
















CHAPTER 1
INTRODUCTION

Hypertension


overview~


Approximately 20% of the adult population in the United States suffers from hypertension[l]. Untreated, sustained hypertension can lead to serious complications such as congestive heart failure, myocardial infarction, and cerebrovascular hemorrhage[21, making it a major threat to human life. Hypertension is defined as an abnormal elevation of systemic arterial blood pressure. In a healthy human, blood pressure levels fluctuate within certain limits depending on body position, age, and stress. Adult individuals with blood pressure measurements in excess of 140/90 mm Hg are considered hypertensive. Ninety five percent of all hypertension has no identifiable cause and is termed essential or primary hypertension. Hypertension that results from other known diseases, is termed secondary hypertension. The most common cause of secondary hypertension is renovascular disease, such as acute and chronic glomerulonephritis. Cushing's disease, primary aldosteronism, pheochromocytoma, and coarctation of the



1





2


aorta are other causes of secondary hypertension[2].

Blood pressure homeostasis is maintained by the pumping action of the heart (cardiac output), the volume of the vascular system, and the tone of the peripheral vasculature (peripheral resistance). Blood pressure is determined by the product of cardiac output and peripheral resistance[3]. Three major mechanisms are responsible for normal blood pressure regulation: the fast neural baroreceptor feedback mechanism, the slower endocrine renin-angiotensin aldosterone system, and the renal regulation of water and sodium homeostasis[31.In the pathophysiological hypertensive condition, cardiac output and peripheral resistance deviate from the normal range via the interaction of a complex series of factors. Mechanisms currently being investigated include pressor and depressor factors of renal origin, neurogenic regulation, circulating humoral factors, vessel wall hypertrophy, and membrane transport abnormality[4].

The interdependence of different systems on hypertension is described in Figure 1-1[1] As shown, increased cardiac output can result from increased cardiac contractility or increased fluid volume. Increased fluid volume mainly results from a renal defect, such as decreased renal filtration, which leads to increased renal sodium retention. Increased cardiac contractility is mostly a direct consequence of overactivity of the sympathetic nervous system. Increased peripheral resistance may result from functional





3



Autoregulation

Blood Pressure = Cardiac Output X Peripheral Resistance
Hypertension = Increased CO and/or Increased PR


lPrelo d Cont actility Functional Structural
Constriction Hypertrophy

TFluid Volume
Volume Redistribution


Rinal Decreased Sympathetic Renin- Cell HyperSodium <- filtration nervous E--> Angiotensin membrane insulinem a
Retention surface Overactivity Excess alteration


Excess enetic S ess Gen ic Obe ity Endothelium
Sodium Alteration Alteration Derived factor
intake


Figure 1-1. Factors involved in the control of blood
pressure that affect the basic equation: blood pressure = cardiac output x peripheral resistance (adapted from reference 1).


constriction and structural hypertrophy of blood vessels. Among these factors, renin angiotensin system overactivity may lead to an increase in both cardiac output and peripheral resistance.

Among the different initiating factors of essential hypertension, the primacy of the kidney is supported by numerous studies[5]. For example, in experimental renal transplantation studies with rats, kidneys from genetically hypertensive donors, such as spontaneously hypertensive rats, consistently elicited hypertension in genetically normotensive recipients. Additionally, the removal of both native kidneys and transplantation of renal grafts from





4


genetically normotensive donors resulted in blood pressure normalization in genetically hypertensive rats, suggesting that renal mechanisms play a major role in the pathogenesis of hypertension in these strains[6]. Role of the Renin Angiotensin System (RAS) in Hypertension


The role of the renin angiotensin system (RAS) in the development and maintenance of hypertension is well established. The RAS plays a critical role in the control of blood pressure, fluid and eletrolyte homeostasis, and renal hemodynamics[7,8]. The primary components of the RAS include: (a) angiotensinogen, a 452 amino acid protein that serves as the substrate for (b) renin, the enzyme that catalyzes the proteolytic conversion of angiotensinogen to the decapeptide angiotensin I; (c) angiotensin converting enzyme, a dipeptidyl carboxypeptidase that converts angiotensin I to the octapeptide angiotensin II; (d) angiotensin II itself; and (e) the angiotensin II receptor which is responsible for transducing the cellular effects of angiotensin II (Figure 1- 2)[1]. The binding of angiotensin II to its receptor mediates various physiological responses such as vasoconstriction, cell proliferation, aldosterone and vasopressin release and dipsogenesis[9,101. Historically, this hormonal system has been viewed as an endocrine system. The various components of this cascade being derived from different organs which are then delivered to their sites of action by the circulatory system[9] However, in





5



Angi tensinogen Macula densa signal Renin Renal arterial pressure } Renal nerve activity
An iotensin I
giotensin Converting Enzyme
Angiotersin II
I I I I I I
Adrenal Kidney Intestine CNS Peripheral Vascular Heart
cortex nervous system smooth muscle

Adrenergic
facilitation
Aldosterone Sympathetic Contractility
discharge

4/ Ivas

Distal Sodium and water Thirst Vasopressin Vasoconstriction
nephron reabsorption salt appetite re ease L. reabsorption I
Mai in or increase Total periperal <-- Cardiac output
ECFV resistance

Figure 1-2. Schematic representation of the reninangioternsin-system. CNS: central nervous system; ECFV: extracellular fluid volume (adapted from reference 1).


recent years there has been an increasing number of studies to suggest that in addition to this traditional hormonal RAS, there is a tissue RAS which produces II for local needs [11-16]. The evidence for a functional tissue RAS is based on a number of findings: (a) the demonstration of reninlike activity in extra-renal tissues such as brain, heart, adrenal, and blood vessels, suggesting local synthesis of Angiotensin II; (b) chronic treatment with angiotensin converting enzyme inhibitors fails to correlate with pretreatment plasma renin activity but does correlate with sustained inhibition of converting enzyme activity in the kidney; (c) ligand binding studies reveal that angiotensin





6


receptors are present in various tissues, indicating that angiotensin exerts organ-specific effects; (d) expression analysis of renin, angiotensinogen, and converting enzyme show that they are coexpressed in several tissues, including the kidneys, the brain, the anterior pituitary gland, the ovaries, the adrenal cortex, vascular smooth muscle, and the heart. This observation provides the basis for de novo synthesis of angiotensin II[141 The existence of a local RAS also was supported by quantitative studies. For example, angiotensin II, the active peptide, has been shown to have an affinity for its receptor in the nanomolar range, but circulates at plasma levels in the picomolar range. This suggests a local angiotensin II-concentrating process in the vicinity of its receptor, and that plasma angiotensin II is not entirely responsible for the effects of the system[l11. The presence of a tissue RAS has been interpreted in paracrine/autocrine vs. endocrine models[17-19] which suggests that circulating endocrine angiotensin II participates in short-term mechanism of blood pressure and body fluid control, such as in the case of hemorrhage and aggressive diuretic treatment. While local paracrine/ autocrine angiotensin II systems participate more in long term regulation and in angiotensin II dependent structural changes, the role of angiotensin II as a mitogenic, proliferative factor which contributes to vascular and cardiac hypertrophy is mediated in a paracrine manner. The tissue RAS may also serve as a mechanism to compliment or interact





7


with the hormonal RAS[12].


Renin


Renin, an aspartyl protease responsible for the first

step in the formation of angiotensin II, is highly specific for its substrate angiotensinogen. The main source of renin is the juxtaglomerular cells of the afferent arterioles of the kidney. Renin levels are controlled at several stages, including the level of gene expression, rates of intracellular synthesis/processing, and the rate of secretion [201. Translation of renin mRNA yields preprorenin, which then undergoes cotranslational removal of a single peptide and glycosylation during transport through the rough endoplasmic reticulum to become prorenin. Prorenin can either be constitutively secreted from the Golgi apparatus or packaged in immature granules and secreted in a regulated fashion. Although prorenin is the major circulating form of renin, the primary site of conversion of plasma prorenin to renin still remains unclear. Prorenin activating enzymes have been found in the kidney as well as in endothelial cells and neutrophils. In transgenic mice expressing the human renin gene, renin mRNA expression was found to be high in the kidney, adrenal, ovary, testis, lung, and adipose tissue and low in the heart and submandibular gland[21].

Expression of renin mRNA in various tissues appears to be differentially regulated. Sodium depletion or -adrenergic receptor activation increases renin expression in the





8


kidney, heart, and adrenal but not in the submandibular or genital glands. Androgens and estrogens increase extrarenal tissue renin mRNA levels but not renal mRNA. Renal renin expression has also been shown to be regulated by alterations in the level of angiotensin II via a negative feedback mechanism. Treatment of transgenic mice bearing the human renin gene with the converting enzyme inhibitor captopril resulted in a 5-10 fold increase in renin expression in the kidney[21] Similarly, enalapril treatment of rats increased renal renin mRNA expression, which could be reversed by infusion of angiotensin II[22]. Further regulation of renin levels occurs by control of the synthesis and secretion of prorenin, such as by cAMP, and/or the conversion of prorenin to renin[10]. Angiotensin-Converting-Enzyme (ACE)


Angiotensin-Converting-Enzyme (ACE) is an endotheliumbound, dipeptidyl carboxypeptidase that converts angiotensin I to the potent vasoconstrictor angiotensin II and also inactivates the vasodilator bradykinin[10] ACE has been found to be present in nearly all mammalian tissues and body fluids. The highest levels of ACE activity in humans have been found in the lung, kidney, ileum, duodenum and uterus, with lower levels in the prostate, jejunum, testis, and adrenals[23] Little is known about the regulation of ACE mRNA expression. ACE can be induced by corticosteroids in cultured endothelial cells and alveolar macrophages[231.





9


Hyperthyroidism tends to elevate levels of circulating ACE. Angiotensin TI and Angiotensin TT Receptors


The octapeptide angiotensin II is the main effector of

the RAS. Certain peptide fragments, particularly Angiotensin III(2-8) and possibly Ang(l-7) and Ang(3-6), also have biological activity[24] Angiotensin II, itself, has profound effects on cardiovascular function. Its multiple biological actions in various target tissues include the following effects: induction of vasoconstriction and a subsequent increase in peripheral vascular resistance and arterial blood pressure; stimulation of aldosterone release from the zona glomerulosa cells of the adrenal cortex; stimulation of sodium and fluid reabsorption from the proximal tubules of the kidney; induction of thirst and sodium appetite; facilitation of norepinephrine release from the noradrenergic nerve endings; and stimulation of cellular growth in vascular and nonvascular smooth muscle and renal proximal tubular epithelium (Figure 1-2) [1]. Blocking Ang II production will reverse these effects, leading to renal vasodilation, and an increase in glomerular filtration rate and sodium excretion.

The effects of angiotensin II are modulated by an interaction with its receptors, which are present in different tissues. Two subtypes of angiotensin II receptors are identified based on their differential affinities for nonpeptide drugs[26]. The angiotensin II type I (AT1)





10


receptors have a high affinity for losartan, whereas AT2 receptors have a high affinity for PD123177. The AT1 subtype is the classical angiotensin II receptor which mediates the well known effects of this peptide[25]. The AT1 receptor mRNA has been detected in vascular smooth muscle cells, kidney, adrenal, liver, heart, aorta, lung, spleen, uterus, ovary, and specific regions of the brain. The AT2 receptor is expressed in the rat adrenal medulla, the inferior olive of the brain and in the fetus[261. The expression of angiotensin II receptors is influenced by circulating angiotensin II levels, dietary sodium intake and hormonal factors. Angiotensin II has been shown to reduce AT1 receptor mRNA expression by 50% after 4-6 hours in cultured vascular smooth muscle cells[10] Low sodium intake downregulates angiotensin II receptors while high sodium intake up-regulates the receptors[101. Glucocorticoids, estrogen, and insulin have also been shown to modulate Ang II receptors[101.

The AT1 receptor is a member of the superfamily of G protein-coupled receptors that have seven transmembrane regions[26]. The signal transduction pathway is initiated by the binding of angiotensin II with its receptor, which then activates phospholipase C-mediated breakdown of the membrane phosphatidylinositol biphosphate (PIP) to generate inositol triphosphate(IP3) and diacylglycerol(DG). IP3 is released into the cytosol and brings about the mobilization of intra-





11


cellular calcium. DG is retained in the cell membrane where it activates a protein kinase C that is linked to an


Effect of growth factor on cell
H

Amiloride
AllL


itembrane / Na
/ and
/ < k H
1P3P

Cytosol IP
Ca Growth and protein
C synthesis

Figure 1-3. Signal transduction of agiotensin II receptor type I. PIP:phosphatidylinositol biphosphate; IP3: Inositol triphosphate; DG:diacylglycerol(adapted from reference 1).


amiloride-sensitive Na'-H exchanger, resulting in an increase in intracellular pH and the promotion of growth and protein synthesis (Figure 1-3) [11.

The function of AT2 receptors is less well known than that of AT1. AT2 receptors are more abundant in embryonic and neonatal tissues than in adults, suggesting a role in development. The signaling transduction pathway of the AT2 receptor is much less elucidated and it does not appear to be G-protein-linked[26]. Angiotensinogen


Angiotensinogen(AGT), a 452 amino acid glycoprotein, is the precursor of the RAS, and the major substrate of renin. Angiotensin I is produced by renin cleavage of a leucine-





12


valine bond of the N-terminal region in the human angiotensinogen or a leucine-leucine bond in the angiotensinogens of other species[27,28]. The majority of circulating angiotensinogen is most likely derived from the liver, in particular the pericentral zone of the liver lobules. Adipocytes and astrocytes also produce small amounts of AGT. Unlike renin, whose secretion is highly regulated, newly synthesized AGT is released into the blood stream in a constitutive manner[28,29] The plasma serves as the major reservoir of this protein, and plasma and cerebrospinal fluid concentrations are approximately 1 pM and 0.2 pM, respectively[27] At the molecular level, glucocorticoid, estrogen and thyroid hormones increase angiotensinogen mRNA in rat hepatocytes[30-33] Transcriptional activity of the AGT gene is highly dependent on the upstream (5' end of the transcriptional initiation site) cis-acting DNA which responds to these hormones and cytokines (Figure 1-4)[10]. This region also contains an enhancer element and confers tissue specificity on AGT gene expression. AGT mRNA has been found to be abundant in liver, fat, and brain cells and has been detected in small amounts in the lung, kidney, ovary, adrenal gland, heart, spinal cord, and testes. Individual AGT secreting tissues may have higher levels of AGT than those that receive this protein only from circulation[34,35].


The Role of AGT in Hypertension





13


Several observations point to the relationship between AGT and blood pressure[36-421 Clinical studies have found statistically significant correlations between plasma Concentrations of AGT and blood pressure in human subjects (r=0.39, p<10-6); higher plasma concentrations of AGT have








ANGIOTENSINOGEN (Human)


Figure 1-4. Schematic representation of 5' flanking regions of the AGT gene. GRE: glucocorticoid response element; ERE: estrogen response element; TRE: thyroid hormone response element; APRE: acute-phase response element; ENH: enhancer region; PAL: palindromic sequende(adapted from reference 10)


been found in hypertensive subjects and in the offspring of hypertensive parents, compared with normotensives[371. A genetic linkage between molecular variants of AGT such as T174M, M235T and essential hypertension were also observed [39,40].

The SHR model of essential hypertension are found to have a higher plasma AGT levels than normotensive Wistar Kyoto rats at 14 weeks of age[421 Blood pressure also can be decreased after administration of AGT antibodies and increased in transgenic animals overexpressing AGT[381.

Despite this evidence, the role of AGT in hypertension is still debatable. Most arguments are based on the extracellular nature of AGT that makes it a major reservoir for





14


the action of renin. It is generally considered that small changes in AGT concentration would not affect the concentration of functioning angiotensin II, thus an exclusively AGT-dependent hypertension is theoretically difficult to imagine[28] However, based on enzyme kinetic studies, plasma AGT concentrations in the rat and human are about 1 [t mol/L. To reach a zero-order enzymatic reaction, ten times more AGT than naturally present is required[361. This suggests that the large amount of AGT present in plasma does not provide an excess of substrate for renin and a rise or fall in renin substrate can lead to a parallel change in the formation of angiotensin II.


Feedback Interactions Involved in ..AS


The feedback interactions of different components of the RAS have been investigated[43-551 By using experimental strategies such as transgenic animals, antisense technology, or by surgical ablation of organs involved in blood pressure regulation, it has been possible to dissect the multiple components that underlie primary hypertension[56-58].

By using gene targeting via homologous recombination, one can abolish or knock out a defined genetic locus or mutate a particular set of nucleotides that encodes a peptide domain of interest[57]. This technique has been used to define the exact role of genes that underlie normal cardiovascular function. Tanimoto, et al. [431, generated angiotensinogendeficient mice by homologous recombination in mouse





15


embryonic stem cells. These mice do not produce hepatic angiotensinogen, resulting in a complete loss of plasma immunoactive angiotensin I. The systolic blood pressure of the homozygous mutant mice was 66.94.1 mmHg, which was significantly lower than that of the wild-type mice (100.4

4.4 mmHg). This profound hypotension in angiotensinogendeficient rats demonstrates an indispensable role for the RAS in maintaining blood pressure. In contrast, Kimura, et al.[44], generated transgenic mice by injecting the entire rat angiotensinogen gene into the germline of mice. The transgenic line developed hypertension and both total plasma angiotensinogen and angiotensin I! concentration were three fold higher than in the control. In situ hybridization showed higher mRNA in the liver and the brain of these transgenic animals.

Fukamizu, et al. [451 constructed the chimeric reninangiotensin cascade in mice comprising both human renin and angiotensinogen as well as the endogenous angiotensin converting enzyme and angiotensin II receptor by crossmating separate lines of transgenic mice carrying either the human angiotensinogen or human renin gene. Neither single gene carrier developed hypertension despite the observed normal tissue-specific expression of the transgenes. Dual gene strains exhibited a chronically sustained increase in blood pressure. Administration of a human renin-specific inhibitor (ES-8891) effectively reduced the elevated blood pressure only in the cross-mated hybrid mice, but treatment





16


with the angiotensin converting enzyme inhibitor captopril and a selective antagonist (DuP753), directed at the angiotensin II receptor, decreased the basal level of blood pressure in the single gene carriers as well as in the dual gene mice[45]. These results demonstrated that the sustained increase in blood pressure of the hybrid was initiated by an interaction between the products of the two human genes.

Schunkert, et al. [47], investigated the feedback regulation of RAS by studying the effect of angiotensin II on the regulation of ACE gene expression and enzymatic activity. Angiotensin II infusions increased plasma Ang II concentration and mean arterial blood pressure and decreased ACE mRNA levels in the lung and testis, two major sites of ACE synthesis. There was less pronounced but parallel decreases in pulmonary ACE activity while serum and testicular ACE activity displayed only minimal changes. This data would suggest that pulmonary ACE expression is subject to negative feedback by angiotensin II. Angio-tensin II infusion suppressed plasma renin concentration, kidney renin concentration, and renal renin mRNA levels in a dose dependent manner. In contrast, angiotensin II infusion increased renal AGT mRNA and also increased liver AGT mRNA levels and plasma AGT concentration. These data suggest that plasma angiotensin II up-regulates renal AGT and down-regulates renal renin gene expression, a reciprocal feedback regulation which may have important physiological consequences.





17


Moreover, Dzau, et al.[48], found that infusion of

angiotensin II increases the AGT release rate while infusion of angiotensin I had no effect. Direct infusion of renin in rats treated with captopril resulted in a further suppression of the AGT release rate, suggesting that renin inhibits AGT release whereas angiotensin II stimulates it.

The interaction of the RAS also was studied by means of

nephrectomy combined with adrenalectomy. Hilgenfeldt, et al. [49], studied the changes in AGT, angiotensin I and plasma renin concentration after ablation of kidney and adrenals. Plasma AGT levels were shown to increase approximately 5fold after 24 hours in nephrectomized rats, and pretreatment with 0-adrenoceptor atenolol blunted this increase. The angiotensin II receptor antagonist Dup-753 also abolished the increase in AGT and nephrectomy plus adrenalectomy also blunted the rise in plasma AGT. Nephrectomy alone induced a 5-fold increase of AGT mRNA in liver and a 2.6-fold increase was observed with nephrectomy and adrenalectomy. These results suggest that the increase in plasma AGT after nephrectomy be essentially mediated by angiotensin II via an unknown adrenal mechanism.


Current Antihypertensive Drug Therapies


Antihypertensive drugs exert their effects by interfering with normal blood pressure regulatory mechanisms. Pharmaceutical agents are categorized based on the principle regulatory site or mechanisms by which they act[59,601.]





18


There are several antihypertensive agents such as diuretics, sympathoplegic agents, and vasodilators as well as types of RAS inhibiotrs. Diuretics lower blood pressure by depleting the body's sodium and reducing blood volume. Sympathoplegic agents lower blood pressure by reducing peripheral vascular resistance, inhibiting cardiac function, and increasing venous pooling in capacitance vessels. Direct vasodilators reduce pressure by relaxing vascular smooth muscle thus dilating resistance vessels and increasing capacitance. Calcium antagonists lower blood pressure by interfering with calcium-dependent contractions of vascular smooth muscle, thereby decreasing peripheral vascular resistance[59].

Four types of drugs which interrupt the RAS at different sites have been proven to be effective in decreasing blood pressure in hypertensive patients (Figure 1-5) [1] Adrenergic blockers lower blood pressure by decreasing cardiac output associated with bradycardia and depresses the RAS by inhibiting the stimulation of renin production by catecholamines[591; Renin inhibitors inhibit the release of renin; ACE inhibitors inhibit the enzyme that hydrolyzes angiotensin I to angiotensin II[591; The angiotensin II receptor antagonists competitively block the effect of angiotensin II at its receptor sites[59] The current antihypertensive drug therapies are not optimal. Problems such as unpleasant side effects, short half lives of the molecules and poor patient compliance result in noneffective therapy despite the potential pharmacological effectiveness





19


of each of these agents. Hence, the development of a long term, more specific therapeutic agent would greatly benefit patients and ultimately reduce health care costs.

Angiotensinogen
Renin (Renin Inhibitors, Adrenergic blockers) Angiotensin I

jAngiotensin converting enzyme< (ACE inhibitors)

Angiotensin II and Angiotensin II receptor < (ATII receptor antagonists) Figure 1-5. Antihypertensive drags working on the RAS (adapted from reference 1).


The Spontaneously Hypertensive Rat as an Animal Model of
Essential Hypertension


The spontaneously hypertensive rat(SHR) has been used to study the mechanisms of essential hypertension. This model was first introduced in 1963 by Okamoto and Aoki[61]. The colony was started by mating a male Wistar-Kyoto (WKY) rat with elevated blood pressure (145-175 mmHg) with a female WKY rat with slightly higher than average blood pressure (130-140 mmHg). They then conducted brother-sister inbreeding of siblings, selected for having the highest pressures in each litter. After the third generation, these rats, without exception, spontaneously developed hypertension as early as several months after birth.

By 1969, the group had successfully developed an inbred strain of SHR in which homozygosity had been achieved in more than 99% of all genetic loci. The absence of genetic variation among the individuals of the inbred strain made it





20


a powerful tool to study the determinants of elevated blood pressure. Similar to most patients with essential hypertension, SHR have normal or lower plasma renin activity and plasma angiotensin II concentrations relative to their normotensive counterparts-the WKY model[41] Administration of ACE inhibitors or anti-renin antibodies decreased blood pressure in SHR. These results suggest a possible role of RAS in the maintenance of their hypertensive blood pressure.

A recent study suggested that an abnormality in the

regulation of AGT gene expression might be involved in the development of hypertension in SHR[61]. It has been shown that, even though plasma AGT concentration in the SHR was comparable to that of WKY at six weeks of age, the level increased significantly at 14 weeks of age and was higher than the WKY. Brain AGT expression in SHR was higher than WKY at 6 weeks of age and was comparable to that of WKY at 14 weeks of age. Cardiac and fat AGT mRNA levels also were significantly higher at 14 weeks of age in SHR than in WKY [421. An alteration of AGT expression by sodium also has been observed in the SHR[62]. Gene Targeting in Hypertension Research and Treatment


Gene targeting techniques have been used both as research tools in hypertension research as well as therapeutic agents for other disease states. Disruption of the expression of genes involved in hypertension such as angiotensinogen [63, 64,66,68] and the angiotensin II receptor[651 have been





21


successful in decreasing blood pressure. Kallikrein gene therapy has been shown to decrease blood pressure in a hypertensive rat model[67]. Recently, Wielbo, et al. showed that central administration of ASODN targeted to AGT mRNA significantly decreased blood pressure in the SHR for a prolonged period of time (6 days) with corresponding decreases in hypothalamic angiotensin II and AGT levels[64]. Blood pressure has also been shown to decrease after interruption of peripheral RAS gene expression. Tomita et al.[631, were able to decrease blood pressure by using liposomes with a viral fusion protein mediated gene transfection technique. A transient decrease in plasma AGT and a concurrent decrease in blood pressure and plasma angiotensin II concentration were observed after giving the antisense RNA via the portal vein. Studies conducted by Wielbo, et al., showed significant decreases in blood pressure following the intra-arterial administration of a liposomeencapsulated antisense molecule targeted to AGT mRNA. The plasma Ang II and AGT levels also were decreased[68].



Antisense Oligodeoxynucleotides


Antisense oligodeoxynucleotides (ASODN) are short, single stranded sequences of DNA molecules that, by forming specific hydrogen bonds with complementary mRNA or DNA molecules, allow the specific regulation of gene expression [69]. Based on the simple Watson-Crick base-pairing rule, one can design ASODNs to target any gene with a known





22

sequence. A major advantage of this strategy is the specificity of the ASODN action. Theoretically, an ODN of 15-17 nucleotides in length should interact with only one target gene in the entire human genome[70]. In principle, an oligonucleotide(ODN) can be designed to target any single gene within the entire human genome, with the potential to create specific therapy for any disease in which the causative gene is known[71-73]. It also has the advantage of being used as a research tool to investigate the role of a particular gene in a physiological or pharmacological system.

ASODN activity was demonstrated in numerous biological

systems[70,71]. Viruses represent the most attractive therapeutic targets since their genetic sequences are unique with respect to the human host. ASODN have shown activity against HIV, HSV 1 and 2, HPV and influenza in vitro[71]. They also have been reported to inhibit a variety of oncogenes including c-RAS and c-myc. Inhibition of gene expression is generally seen at high concentrations of ODNs[72].

Theoretically, oligonucleotides can be designed to target and interfere with every stage of gene expression. For example, they can be designed to target and bind to doublestranded DNA resulting in a triple helix formation with the subsequent inhibition of transcription, or by hybridization to nascent RNA. They can be designed to interfere with RNA splicing and transport of mRNA from the nucleus to cytoplasm through hybridization at intron-exon junctions. Translation can be inhibited by targeting the antisense to the AUG





23

initiation codon, thereby inhibiting the assembly of ribosomal subunits and the subsequent reading of the messages to be translated (Figure 1-6)[73].










Transcription
3




c Ezon 4 Intron .


I Splicing

Cap A ... .A






Capiii iiii s,


Figure 1-6. Summry of the possible sites of sequencespecific actions of ASODN. ASDN could interfere with transcription by () hybridization to the locally opened loop created by RNA polymerase; (2) hybridization to nascent RNA; interfere with splicing through (3) hybridization at intron-exon junctions; (4) interfere with transport of mRNA from nucleus to cytoplasm (5) interfere with translation through inhibition of binding of initiation factors; (7) inhibition of the assembly of ribosomal subunits at the start codon (8) hbitionof ribosome sliding along the coding sequence of the mRNA (excerpted from reference 73)


Despite the observed activities, the mechanism of ASODN action is still unclear. It has been proposed that ASODN





24


inhibit gene expression through two distinct mechanisms[74]. One mechanism suggests that once the antisense molecules enter the cells, they bind to its target mRNA in either the cytoplasm, nucleus or both. Following this hybridization, cellular RNase H protects the cells by cleaving the RNA portion of the RNA:DNA duplex. Once cleaved, the mRNA is no longer competent for translation and may be rapidly degraded. This mechanism has an advantage in that each message is permanently inactivated upon cleavage and each ODN can inhibit multiple copies of each target mRNA. This cleavage, however, may have the disadvantage of being nonspecific, since the transient hybridization to other mRNAs may activate RNase H as well[751 In the second antisense mechanism, the binding of an ODN to a target mRNA inhibits gene expression through simple steric blocking. The ODN:RNA duplex forms and physically prevents the RNA from interacting with cellular components such as ribosomes, thereby inhibiting translation of the RNA into its specific protein[741.


Thermodynamics of DNAsRNA Duplexes Formation


The relative stability of a nucleic acid duplex is

measured by the melting temperature; the higher the melting temperature, the more stable the duplex[76]. Factors such as the length of the ODN, its AT/CG composition, and the base sequence all contribute to its stability[74]. On average, duplex stability is proportional to the number of base





25


pairs; the longer the duplex, the higher the stability. However, as the length increases, the affinity for closely related sequences also increases and the specificity may begin to decrease. Theoretically, the length of an ODN that should satisfy both stability and specificity requirement is as short as ten to fifteen bases. The stability of the duplex also increases as the G,C content of the ODN increases, due to their stronger hydrogen binding[76]. The development of ASODN as therapeutic agents has not been as smooth as once anticipated. Several requirements have to be met to ensure its practical use, such as large scale synthesis, in vitro and in vivo stability, successful delivery and specificity in its action[77,78. Stability


The ODNs initially used in physiological studies were

naturally occurring phosphodiesters. The linkages in these molecules are susceptible to degradation by endogenous serum and intracellular nucleases. An in vitro assay demonstrated that after microinjection into Xenopus embryos, phosphodiester ODNs have an intracellular half-life of less than 30 minutes[77]. Protection from degradation was achieved by use of a 3'-end cap strategy in which nucleaseresistant linkages were substituted for phosphodiester linkages at the 3' end of the ODN. Phosphorothioate analogs have a sulfur substituted for one or both nonbridging oxygens(Figure 1-7)[74]. This modification makes the





26

molecule more resistant to nuclease degradation, extending the half-life in vitro to 12 hours.


Operation


Further problems encountered with the use of ODNs include poor cellular uptake and intracellular compartmentalization. Unlike many other small organic drug molecules of low molecular weight, ODNs (15 to 28-mer) are polyanionic hydrophilic molecules with a molecular weight range of 500010,000 and cannot passively diffuse across Cell membranes. Although the mechanism by which the ODNs enter the cells is not clearly identified, it is generally



-0 0 A Natural Phosphate -0 X A Phosphorothioate
Diester Linkages Diester Linkages
o 0
O=P- 7 C O=P- 0
0.


0
? o

Figure 1-7. The structures of phosphodiester and phosphorothioate molecules (adapted from reference 74).


believed that the molecules enter the cells by a pinocytotic or receptor-mediated endocytotic mechanism[79-82]. In this process, molecules to be internalized first bind to specific receptors on the cell surface. These receptor/ligand complexes then become clustered in specialized areas of the plasma membrane, termed coated pits, and then become





27


invaginated to form a coated vesicle. The coat is rapidly removed. Fusion with the early endosome exposes the receptor /ligand complexes to lower pH which causes dissociation of ligand and receptor. Ligands may be transferred through late endosomes to lysosomes while the receptors which recycle are returned to the cell surface[831.

The cellular uptake of ODNs was studied in the HL60 cell line. Phosphorothioate ODN was demonstrated to be internalized by the process of adsorptive endocytosis and fluidphase pinocytosis. The process is slowed by the metabolic inhibitor of the cells and is temperature-dependent[84].

The intracellular distribution of the ODN has been

studied using fluorescence microscopy. A microinjection method was used to avoid the problem of the internalization pathway and fluorescently-labeled ODNs were observed to accumulate in the nucleus soon after injection. When fluorescently labeled ODNs are placed in tissue culture media, the fluorescence accumulates in vacuoles within the cell, forming a punctate perinuclear pattern which are presumably endosomal and lysosomal in nature. Weak visible fluorescence in the nucleus has been observed, suggesting that the release of ODNs from vacuoles is an inefficient process[82] This observation supported the view that the major limiting factor in effective ODN delivery appears to be the escape of the ODNs from the endosomes and lysosomes where they are rapidly degraded by hydrolytic enzymes. The uptake of fluorescently labeled ODNs was enhanced by





28


coadministration with cationic lipids, demonstrated by the presence of fluorescence in the nucleus and concurrent increase in ODN activity[741. Chemical Modification of the ASODNs


Efforts have been made to improve the properties of ODNs by chemical modification. Despite the fundamental Watson-Crick hydrogen-bonding scheme, which is central to the formation of the double helix and is unlikely to change substantially, all other structural features of the phosphodiester backbone, heterocyclic bases and sugars have been modified or replaced [74,851.

Modification of the phosphodiester backbone has been employed to improve stability, allowing for enhanced affinity and increased cellular permeation of ODNs. The properties of some of the phosphodiester backbone analogues are listed in Table 1-1[741.

In addition to phosphorothioation, mentioned previously, other linkages have been studied. Methylphosphonate-modified ODNs, which substitute the non-bridged oxygen with a methyl group, have the advantages of being neutral and providing better cellular uptake. But both of these two modifications suffer from decreased affinity to target sequences which affect their activity[74] The chiral properties of ODNs containing either of these modifications was suggested to be a factor that affects its activity. Each of these isomers consists of a mixture of 2' diastereomers (where n is the





29


number of linkages) and it is reported that pure R or pure S isomers would hybridize with different affinity[741. Lesnikowski, et al. showed that for a 7-mer oligothymidine with a methylphosphonate backbone, the all-RP (R diastereomer of phosphorus) ODN had a significantly higher melting temperature than ODNs which are a mixture of diastereomers [861.

Sugar modification also has been used to enhance

stability and affinity. Modification of the 2'-OH of the ribose sugar to form 2'-O-methyl or 2'-O-allyl sugar within oligonucleotides is found to enhance resistance to degradation without compromising affinity[74]. Heterocyclic



Table 1-1. Properties of selected phosphodiester backbone analogues (adapted from reference 74).

backbone analogue activation of resistance to Chiral
RNase H nuclease center
Phosphorus Analogues
phosphodiester Yes -- No
phosphorothioate Yes + Yes
phosphorodithioate Yes ++ No
methylphosphonate No ++ Yes
phosphoramidate No + Yes
alkyl phosphotriester No + Yes

Non-Phosphorus Analogues
sulfamnate No ++ No
3'-thioformacetal No ++ No
methylene(methylimino)(MMI) No ++ No
3'-N-carbamate No ++ No
morpholino carbamate No ++ No
peptide nucleic acids(PNAs) No ++ No


base modifications offer an opportunity to enhance the affinity without compromising RNase H cleavage of the target





30


RNA. 2-Amino-2'-deoxyadenosine introduces a third hydrogen bond into an A:T base pair which stabilizes duplex formation[74].

Modifications to enhance permeation by conjugation of an ODN to transferrin, a protein ligand for a cellular receptor, was shown to dramatically increase cellular association of ODNs[87] Increased cellular association and activity have also been reported for an ODN-asialoglycoprotein conjugate targeted to the hepatitis B virus[88]. Fluorescein labeled ODN bound to streptavidin, which had 12 mannose residues attached, was found to be internalized preferentially in liver cells via cellular mannose receptors. Poly(L-lysine), a polycationic drug carrier, was also shown to increase both the rate and extent of cellular uptake of ODNs[89]. The attachment of hydrophobic molecules, such as cholesterol and phospholipids to the ODNs also has been reported to increase cellular uptake[741.


Liposomes as a Delivery Vehicle for ASODN


The use of liposomes as a carrier system for nucleic acid has received increasing attention[90-93] Liposomes are vesicles in which an aqueous volume is enclosed by a membrane composed of lipid molecules with hydrophilic polar heads and hydrophobic nonpolar tails[91]. The membranes exhibit a variety of surface properties such as charge, membrane rigidity, and phase behavior[93]. In small organic molecule delivery only the self-closed bilayer vesicles, the





31


liposome is considered. In gene transfer several other structures and phases, such as the open lipid bilayer fragment, the inverse hexagonal phase and the micelle, are also important(Figure 1-8)[94]. Liposomes in Biological Systems


Liposomes administered in vivo are subjected to

physiological interactions that determine the rate of clearance and degree of organ uptake. The major limitation of liposomes for pharmaceutical applications is their unpreLipid Phase Molecular
Shape
Lysophosphotipids
Detergents


Micellar Inverted Cone



Phosphatidylcholine
Sphingomyelin I R U
Phosphatidylserine 8D
Phosphatidylglycerol
Bilayer Cylindrical



Phosphatidylethanoamine (unsaturated)
Cardiotipin Co2+

Ca2+
Hexagonal (Hd) Cone


Figure 1-8. Phase structures formed by lipids in the aqueous solutions (adapted from reference 101).





32


dictable behavior in the body, such as: rapid clearance from the blood, restricted control of the encapsulated molecule release, low or nonreproducible drug loading and physical or chemical instability[95].

Circulating liposomes are taken up to a large extent by organs rich in the cells of the reticulo-endothelial system (RES), such as the liver, spleen, lung, lymph nodes and bone marrow. Larger liposomes of conventional formulation are rapidly removed from the circulation following intravenous injection by uptake primarily into Kupffer cells of the liver and macrophages in the spleen and lung. This passive targeting to phagocytic cells has been used for treating diseases of the RES such as liver leishmaniasis and fungal infections[95] Small liposomes with diameters less than 0.1 pm can pass through fenestrated endothelium and gain access to liver parenchymal cells[96,971.

For therapeutic applications involving non-RES organs, prolonged blood circulation has been achieved by mimicking the composition of the red blood cell membrane. Inclusion of phospholipids with a synthetic hydrophilic polymer headgroup, such as a polyethyleneglycol chain, reduce the recognition of liposomes by the mononuclear phagocytic system and hence increases its circulation time[981. Specific organ targeting also can be achieved by incorporation of certain ligands. Liposome containing lactosylceramide was shown to increase the transfection efficiency by a factor of 1000 in HepG2 cells through





33


interaction with asialoglycoprotein receptors on the cell membranes[991.

The physical integrity of liposomes can be modulated by

changing the lipid composition. Increase in cholesterol composition has been shown to stabilize the bilayer and decrease the permeability of phosphatidylcholine liposome [1001.

Methods for DNA encapsulation include reverse-phase

evaporation(REV), sonication, Ca2+-EDTA chelation, cationic lipid complexes, detergent dialysis and viral envelope reconstitution[101]. Increased DNA encapsulation efficiency has been achieved by altering the physical state of the DNA such as condensing the DNA with bacteriophage protein or small organic molecules. In the REV method, multiple freezethawing and rehydration cycles, during which bilayers open and close, can make more molecules permeate into the interior of the liposome thus improving the encapsulation efficiency[1011.


The Tnteractions of Liposomes with CellS


The mechanism of liposome-cell interaction and the effect of liposome structure and composition on its association with the cell is not completely understood. Different modes of interaction have been summarized in the literature(Figure 1-9)[102,103]. The endocytosis/phagocytosis mechanism proposes that cells with phagocytic activity take up liposomes into endosomes, endosomes then fuse with lysosomes to form secondary lysosomes where degradation takes place in





34

low pH (4.5) environments. Liposome phospholipids are then hydrolyzed to fatty acids and recycled and reincorporated into the host phospholipid. The content of the aqueous compartment is released after the membrane disintegrates. They may either remain sequestered in the lysosome until exocytosis or they will slowly leak out of the lysosome and gain access to the rest of the cell. Liposomes may also be taken up by receptor-mediated endocytosis[108].

Liposomes coated with low-density lipoproteins or


Stable Absorption Endcytosis








Esion Lpid Trans,;fer







Figure 1-9. Possible mechanisms of interaction between liposome and cell surface (adapted from reference 102). transferrin bind to the cell via surface receptors for these moieties and then are internalized via coated pits with subsequent ligand degradation, or recycling[104]. Intermembrane transfer of lipid components can take place upon the close approach of the two phospholipid bilayers without disruption of the membrane's integrity[102].





35


Contact-release of the aqueous contents of liposomes occurs by a poorly understood mechanism in which contact with the cell causes an increase in permeability of the liposome membrane. This mechanism provides the means for introducing materials into specific cells without the need for ingestion of the whole liposome, and would be of particular value for cells which are not actively phagocytic[102]. Adsorption may take place either as a result of physical attractive force or as a result of binding by specific receptors to ligands on the vesicle membrane. Fusion results in incorporation of the liposomal lipids into the plasma membrane of the cell and diffusion of the liposome-trapped contents into the cytoplasm[102]. Incorporation of fusogens such as lysolecithin, detergent, surfactant or Sendai virus fusion proteins into the membrane have been shown to facilitate the liposome-cell fusion process[1051.

Liposomes have been used as a tool to deliver

oligonucleotides. Liposome encapsulation can improve the passage of ODNs through the cell membrane as well as protect them in the extracellular medium. It is also possible to target liposomes to specific cell populations by coupling certain proteins or antibodies on their surface[1071. Liposome structure and surface properties determine several different ways liposomes can interact with ODNs. ODNs can be encap-sulated in the liposome interior, bound onto the liposome surface, or embeded between bilayers[106]. Liposomes have been differentiated based on the mode of





36


liposome inter-action with their target cells[107]. Conventional liposomes are formulated with phosphotidylcholine and cholesterol are examples of this. These are also referred to as non-targeting liposomes. Liposomes which are pH-sensitive were designed to release their content as they pass through regions of low pH. They can be used to take advantage of the pH gradient of the endocytic process, to avoid lysosomal degradation and to improve the intracellular delivery of macromolecules[109112]. One way to make pH sensitive liposomes is to reconstitute it with a viruse such as vesicular stomatitis virus or with influenza virus membrane glycoproteins. These proteins undergo conformational changes at low pH levels and promote acid-induced liposome-cell fusion and increased delivery of the encapsulated contents into the cytoplasm[105] The poly-morphic phase behavior of some unsaturated lipids provides another way to make pH-sensitive liposomes. The most commonly used lipid com-position of pHsensitive liposome is dioleylphosphatidyl-ethanolamine(DOPE) which has ionizable headgroups. At low pH, the headgroup becomes protonated and forms the inverted hexagonal (HII) phase rather than the bilayers observed under normal physiological pH[1121. The inverted molecules fuse more readily with the endosomal membrane and leads to the release of the liposome contents. Immunoliposomes refer to liposomes linked to antibodies that are designed to target cells which express sufficient and specific antigens [1131. This method





37

has been applied to treat tumor cells by incorporating in the liposome the antibodies against folate protein, which has over a 20-fold higher expression in tumor than in normal cells and was shown to give more specific targeting to tumor cells.

Cationic liposomes as a DNA carrier system was first reported by Felger, et al. using the synthetic cationic lipid N-[1-(2,3-dioleyloxy)propyl]--N,N,N-rimethylammoniumn chlo-ride (DOTMA) in combination with DOPE[114]. The positively charged cationic liposomes form a complex with the negatively charged DNA. These complexes contain excess cationic lipids which neutralize the negative charge of the DNA and provide the complex with a net positive charge allowing interaction with negatively charged cell surface. Substitution with negatively charged lipids was shown to suppress the delivery[115,116].



Hypothesis


Based on these information, our hypothesis is: inhibition of angiotensinogen by antisense oligodeoxynucleotide to angiotensinogen mRNA attenuates hypertension in the SHR rat model, and this blood pressure decrease may be prolonged via optimization of route of ASODN administration and optimization of oligonucleotide delivery. To test this hypothesis, both in vitro and in vivo studies will be conducted.















CHAPTER 2
GENERAL MATERIAL AND METHODS


Animals


Male, spontaneously hypertensive rats(SHR), Sprague

Dawley and Wistar-Kyoto(WKY) rats weighing between 250-275g (Harlan, Indianapolis, Ind.), were kept in the University of Florida Animal Care Facilities. They were housed in a room with a 12-hour light-dark cycle and fed on standard laboratory rat chow and tap water ad libitum. Rats were accommodated for one week before experiments began. Arterial and Venous Cannju.atio=


Animals were anesthetized with ketamine/xylazine (100 mg ketamine + 20 mg xylazine/ml at a dose of 0.5-0.7 ml/kg, IP) and a heparinized (100U/ml) catheter made of PE50 tubing (0.58 mmID, 0.965 mmOD) was inserted into the left carotid artery, 25 mm toward the heart. In addition, a catheter was inserted into the femoral vein and extended 60 mm into the dorsal vena cava. The catheter dead space was filled with heparin (1000U/ml) to maintain patency. Both catheters were tunneled under the skin and exteriorized between the scapulae and plugged with stoppers. Animals were allowed to




38





39


recover for 24 hours after catheterization before experimentation.


Blood Pressunre Measurements


Blood pressure was measured by direct method or

indirectly, using the tail cuff method. For the direct method, a catheter was inserted into the external carotid artery and connected to a pressure transducer that was interfaced with a Digi-Med BP Analyzer (micro-Med1 Indianapolis, Ind.), Signals were recorded on a Gould TA2405 EasyGraf Physiograph, which provides information on systolic, diastolic anid mean arterial. pressure and heart rate. The indirect method refers to the tail-cuff plethysmography method [117,1181 The rats were first warmed for 15 minutes at 37 0C in a thermostatical ly controlled heating cabinet for better detection of tail artery pulse. Then the rats were put in a holder with heating pad. Their tails were passed through an inflatable cuff and a rubber bulb connected to a pulse transducer was taped on the tail distal to the cuff. The pressure in the cuff was increased rapidly when inflated, until the tail pulse disappeared and then released slowly. When pressure in the tail arteries exceed that in the cuff, the pulse reappeared and systolic pressure was indicated by the level of the first pulse wave. Daily values were obtained by averaging 5-10 successive readings.





40

H-4-II E, Hepatoma, Reuber H35, rat cells were purchased from ATCC (Rockville, Maryland). Cells were grown in a monolayer culture on 10 cm petri dishes in 12 ml of Eagles Minimum Essential Medium (EMEM) supplemented with 10% fetal bovine serum, 10% calf serum and incubated in 95% air-5% C02 at 370C. The culture medium was changed every other day. Cells were passaged until confluent at a ratio of 1:6 using

1.0 ml of 0.25% trypsin-EDTA. Oligodeoxynucl eantides


The antisense oligodeoxynucleotide (ASODN) was designed

based on the angiotensinogen(AGT) mRNA sequence published by Okhubo[119]. The ASODN is an 18-mer, complementary to the -5 to +13 base sequence of AGT mRNA, and covers the AUG translation start codon. The sequence is: 5'-CCGTGGGAGTCA TCACGG-3'. The scrambled ODN (ScrODN) has the same base composition but in random order: 5'-TCGCTAAGCGGCAGCGTG-3'. Both nucleotides were synthesized in the phosphorothioated form in the DNA Synthesis Laboratory, University of Florida. Liposome Synthesis


Phosphatidylcholine-cholesterol liposomes were composed

of 80% phosphatidylcholine and 20% cholesterol (Avanti Polar Lipids Inc., Alabaster Alabama). Liposomes were prepared by the reverse phase evaporation method[1201 The lipids were dried and dispersed by rotary evaporation and then rehydrated in phosphate buffer to form multilamellar





41


vesicles by mechanical shaking. The vesicles were subjected to ten freeze-thaw cycles to enhance ODN entrapment. Liposomes were then passed through a 0.1 gm filter membrane for size reduction.

Cationic liposomes were composed of dimethyl-dioctadecylammonium bromide (DDAB) and dioleoylphosphatidyl-ethanolamine(DOPE) (2:5,w/w) (Avanti Polar lipids, Alabaster Alabama). Lipids were dispersed and rehydrated in 1 ml deionized water and sonicated to reduce the size to about 100 nm. ASODNs were complexed with cationic liposomes by mixing at a -/+ charge ratio of ASODN/cationic lipids of

0.18 and incubated at room temperature for 30 minutes before experiments[1211.


Northern Blot Analysis


mRNA was isolated using acidic guanidium thiocyanatephenol-chloroform[122] and quantified by densitometry[123]. Cells or tissues were lysed using mercaptoethanol then reated with guanidium thiocyanate followed by phenol and chloroform extraction. RNA was then precipitated by isopropanol at -200C, evaporated and resuspended in sterile water. The concentration of total RNA was measured by spectrophotometry at a wavelength of 260 nm. An aliquot of 20 gg total mRNA was separated by electro-phoresis on an agarose formaldehyde gel at 25V for 16 hours. RNAs were then immobilized on nitrocellulose membranes by capillary transfer. The RNA was then subjected to prehybridization for





42


4 hours at 560C with 1 x Denhardts SSPE solution, 5 x SSPE,

0.1% SDS, 50% formamide, and 250 mg/ml denatured salmon sperm DNA. Hybridization was carried out under the same conditions with a 12p labeled riboprobe to the specific mRNA sequence. After stringency washes, the membrane was exposed to X-ray film then developed. Membranes were reprobed with Cathepsin D mRNA to ensure equal loading. Angiotensinogen Assay


Aliquots of 500 ul of culture medium or rat plasma were evaporated to dryness. The dried samples were assayed for AGT by the direct radioimmunoassay method of Sernia[1241. AGT sample content was measured from a standard curve of pure rat AGT diluted in the same cell culture medium or plasma. The assay sensitivity was 0.3 ng/tube, with an inter-assay and intra-assay variability of 14% and 9%, respectively.


Angiotensin TT Assay


Plasma samples were extracted using methanol and trifluoroacetate on C18 reverse phase extraction cartridges(Varian, Windham, NH). Angiotensin II(Ang II) was measured by double-radioimmunoassay (RK-A22, Alpco, Windham, NH). The samples were first incubated for 16 hours with an anti-angiotensin II antibody. The 125I-Ang II competes with Ang II present in the samples and standards for the same antibody binding sites. A solid-phase second antibody is





43


then added and antibody-bound fraction is precipitated and counted on a Beckman DP550 Gamma counter. The sensitivity of the assay is 0.7 pg/ml Ang II and there is minimal crossreaction with other peptides. Reverse-transcri)tase Polymerase Chain Reaction(RT-PCR)


RT-PCR was used to quantify messenger RNA. Total mRNA was first isolated, then converted to cDNA. The cDNA was then amplified by thermocycling. Total mRNA was isolated using acidic guanidium thiocyanate-phenol-chloroform. Then 5 ug of total mRNA was mixed with 10 mM dNTP, 0.1 M MgCl2, 100 pM oligo d(T), 40 U/ul of RNase inhibitor, and 50 U/ul of reverse transcriptase(Promega, Madison, WI) in a 50 ul volume. The reaction was incubated at 370C for 1 hour, then heated at 950C for 5 minutes, followed by a 5 minute incubation at 40C. Five microliters of RT product was then subjected to PCR reaction. The PCR reaction was performed in a total volume of 50 ul in the presence of 10 mM of dNTP, 100 pmol/ul of primers, 5 U/ul of TAQ Polymerase and 0.025 M of MgC12 (Promega, Madison, WI). The thermocycle was programmed as:

Step 1: 5 minutes at 950C

Step 2: 30 cycles at 1 minute at 940C; 2 minutes at

580C; 3 minutes at 720C

Step 3: 10 minutes at 720C

AGT and control genes were amplified in the same reaction to eliminate the factors that would affect the amplification





44


efficiency. The sizes of the two amplified products were AGT 463bp, r-actin 350bp. Ten microliters of each PCR reaction mixture were separated with 1.8% agarose gel using the electrophoresis method and stained with ethidium bromide and photographed. The density of the bands were then measured by densitometer(Biorad, Boston, MA) and the ratio of density between the AGT and control were plotted. The primer sequences for AGT were: Sense, CAACACCTACGTTCACTTCC and Antisense, GAGTTCAAGGAGGATGCTGT. The primer sequences for control P-actin were: Sense, AACCGCGAGAAGATGACCCAGATCATGTTT and Antisense, AGCAGCCGTGGCCATCTCTTGCTCGAAGTC[125]. Fluorimetric Analysis


Cells or weighed tissue were prepared for fluorimetric analysis of fluorescein isothio-cyanate (FITC)-conjugated oligonucleotide by homogenization in 1 ml PBS followed by centrifugation at 14,000 rpm for 10 minutes. The supernatant was aspirated and fluorescence activity was determined on a Perkin Elmer Luminescence Spectrometer, excitation:487 nm and emission:525 nm. The percentage of oligonucleotide present in each sample was determined by dividing the fluorescence of the sample by the fluorescence of a standard containing only

1 ml PBS and 2.5 pg FITC-conjugated oligonucleotide. Confocal Microscopy


Microscopical analysis of FITC conjugated ASODN uptake and distribution was carried out on a Nikon Optiphot-2-





45


Fluorescent laser scanning confocal microscope in the Center for Structural Biology, at the University of Florida. Cells were grown on plain glass microscope slides. After treated with ASODN, PS/ASODN or CA/ASODN for four hours, cells were fixed using 2% formaldehyde and then slides were mounted using Gel Mount (Biorad, Boston, MA) and micrographs were obtained at excitation and emission wavelengths of 472 and 525 nm, respectively.


MTT Test


MTT[3-(4,5-dimethylthiazole-2-yl)2,5-diphenyl-tetrazolium bromide] test, described by Mossmann[126], was used as an in vitro test for cellular toxicity. The cells were grown in a 96 well culture plate. After a 48-hour incubation with ASODNs, cationic lipids or CA/ASODN complexes, the medium was decanted. A 10 ul MTT stock solution (5 mg/ml in PBS) was added to 0.1 ml culture medium. After 4 hour incubation at 370C, the MTT cleavage product, formazan, was solubilized by the addition of 0.1 ml 0.04 N HCI prepared in isopropanol. The optical density of the product was measured using a reference wavelength of 630 nm and a test wavelength of 560 nm by microplate reader (Biorad, Boston, MA). Aldosterone Analysis


Plasma samples were collected and stored at -200C. Aldosterone was measured by radicimmunoassay (DSL-8600 ACTIVE Aldosterone Radioimmunoassay Coated-Tube Kit,







Diagnostic Systems Laboratories, Inc. Texas) The procedure is based on the basic principle of immunoassay where there is competition between a radioactive and non-radioactive antigen for a fixed number of antibody binding sites. The bound antigen is separated from free antigen by decanting the antibody coated tubes. The sensitivity of the assay was 25 pg/mi. Cross-reactivity to closely related naturally occurring steroids was reported as negligible. Sodium-p2otassium Analysi g


Urine samples were centrifuged and the supernatant was

saved for analysis on a NOVA 1+1 Automated Sodium/Potassium Analyzer (NOVA Biomedical, Massachusetts). The principle of the assay is based on the electrical potential of the solution measured against a reference electrode.





Statistical analysis was performed by ANOVA for treatment effect, and the Dun can multiple range test was used for individual comparisons. Data for individual time points were analyzed using the Students independent T-test. Significance was at the 95*- confidence limit.















CHAPTER 3
LIPOSOME-MEDIATED OLIGONUCLEOTIDE DELIVERY IN HEPATOMA CELL CULTURE


Specific Aims


The hepatoma H4 cell culture experiments seek to evaluate two specific aims. The first is to develop an efficient delivery mechanism for antisense oligonucleotide targeted to angiotensinogen mRNA for cells in culture; the second is to determine the uptake efficiency, cellular distribution, cytotoxicity, and effects of the antisense oligonucleotides on AGT mRNA and protein expression in hepatoma H4 cell culture.


Introduction


Pharmaceutical agents targeted to block the renin

angiotensin system are effective in treating hypertension [59]. Currently there are no drugs available to block the precursor of the RAS, angiotensinogen. In our previous studies, ASODN was designed to hybridize to the AUG start codon of angiotensinogen mRNA[64,68] This ASODN successfully decreased blood pressure in SHR when administered both centrally and peripherally. This treatment, however, did not return elevated blood pressures to normal levels and the effect lasted only for a limited time. One hurdle to ASODN 47





48


use is its poor tissue or cellular uptake[77]. Liposome vehicles were utilized to improve ASODN delivery by increasing the interaction of the ASODN with tissues or cells to protect the ASODN from degradation by intracellular enzymes[101].

Cationic liposomes have been shown to be effective for delivering oligonucleotides in cell culture[128] Even though novel synthetic cationic lipids have been reported to provide higher efficiency in tested cell lines, in general no single cationic lipid formulation appears to be uniformly superior to others[129,130]. Transfection conditions must be optimized individually for each cationic liposome formulation and cell line. The following parameters may be modulated: the DNA to lipid ratio of the complex; the total dose of DNA:lipid complex added; the density and dividing stage of the cultured cells; the medium in which the cells are cultured; the duration of exposure of the liposome:DNA complexes to the cells; and the time points when the cells are analyzed[1311.

Most cationic liposomes formulated contain two lipid

species, a cationic amphiphile and a neutral phospholipid which functions as fusogen, typically dioleoyl-phosphatidylethanolamine(DOPE). Cationic vesicles formulated without DOPE have been shown to be 2 to 5-fold less active than the one with DOPE[132]. The effect of DOPE is attributed to its capacity for transition from the bilayer phase into the inverted hexagonal phase, which leads to increased membrane





49


fusion[132,101] Replacing DOPE with other neutral phospholipids of the same acyl chain with a choline head group instead of the ethanolamine such as, dioleoylphosphatidyl-choline (DOPC), abolish most of the transfection activity of the liposomes[1331.

Compared with conventional liposomes, cationic liposomes do not require an encapsulation step that limits the application of the carrier. Instead, negatively charged ASODNs are directly mixed with preformed liposomes and form complexes through electrostatic interaction with cationic lipids[134]1. Despite the fact that the physicochemical properties of the cationic lipids and ASODN complexes are poorly characterized, it is generally agreed that the charge ratio of the ASODNs to the cationic lipid is a critical parameter. The charge ratio determines such factors as compactness of the complex; the masking of the negative charges of the ASODNs, and the steric interaction of the complex with the cell membrane[135] Numerous studies have shown that transfection efficiency changes dramatically with different ratios of DNA to cationic lipid[136,137].

The mechanism of cellular delivery of the cationic

liposome/ODN complex is via an endocytotic process, mainly mediated by the mononuclear phagocyte system, but also by non-phagocytic cells such as fibroblasts, kidney cells, lymphocytes and hepatocytes[1381. The non-receptor-mediated endocytosis appears to be strictly dependent on the size of the liposomes. Tightly compacted, condensed small-sized





50


cationic liposome/ASODN complexes are more favorable for uptake by endocytosis. The optimal size of the complexes is 50-100 nm. Vesicles larger than 400 nm are not favored for endocytosis. The particle size of the cationic liposome/ODN complex ranges from 75 nm to >3000 nm, and depends on several factors such as: (i)the cationic lipid species;

(ii)the amount of neutral co-lipid like DOPE; (iii)the cationic lipid/DNA ratio; (iv)the concentration of lipid and DNA in the final formulation; and (v)the composition of the suspending vehicle[1291.

Successful gene inhibition by ASODN has been reported in various biological systems[70,71]. The observed biological effects have mainly been observed at high concentrations of ASODN, when some non-specific effects were produced[781. Our previous in vitro transcription/translation study showed that a high doses of ODN (3-30pmol/l), both ASODN and control scrambled ODN caused a decrease in AGT expression [68]. By using cationic liposomes it may be possible to decrease the dose of ASODN required to produce the same biological effect while decreasing the potential for nonspecific effects caused by ASODN.

Cationic lipids such as DDAB have been reported to be highly toxic to cells. They are similar to surfactant molecules. At high concentrations, these lipids cause cell membrane disruption and poration[1391. Because of this, the toxicity of cationic lipids, ASODN alone and the ASODN-lipid complexes were determined by the [3-(4,5-dimethylthiazole-2-





51


yl)2,5-diphenyl-tetrazolium bromide](MTT) assay. This assay is based on the observation that the tetrazolium salt, MTT, is actively absorbed into cells and is reduced in a mitochondrial-dependent reaction to yield a formazan product. This product accumulates in the cells and can not pass through the cell membrane. The ability of cells to reduce MTT, as an indication of mitochondrial integrity and activity, is interpreted as a measure of cell viability [1261.

A cationic liposome combination of dimethyl-dioctadecylammonium bromide(DDAB) and dioleoyl-phosphatidyl-ethanolamine(DOPE) has been shown to have a higher efficiency compared to other lipids. The DDAB/DOPE lipid combination increased ODN delivery in Caski cell culture 4.5 fold, compared with a 2.0-2.5 fold increase by commercially available N-(1-(2,3-dioleoyloxy)propyl)-N,N,N-trimethylammonium-methyl-sulfate (DOTAP)[121] In this study, we used the DDAB/DOPE cationic liposome combination as a delivery system for ASODN and evaluated its cellular uptake characteristics. We also compared the uptake efficiency of ASODN with previously used phosphatidylcholine: cholesterol liposomes. The effect of ASODN on AGT mRNA and protein was also studied in rat H-4-II-E hepatoma cell culture, a cell line known to express AGT mRNA and secrete AGT protein constitutively[127] The effect of a control, scrambled ASODN also was determined to test the specificity of the target ASODN sequence.





52


Material and Methods


To determine the effects of liposome composition on the cellular uptake of ODN, H-4-II E cells were incubated in a medium containing 1 tM FITC-ODN complexed with cationic liposomes composed of DDAB(25 mg/ml) and DOPE, at different weight ratios, for 4 hours. Cells were then washed, lysed and the cellular associated fluorescence was measured by fluorometric analysis.

The effect of cationic lipid to ODN charge ratio on the

cellular uptake of ODN also was determined in H-4-II E cells. The cells were incubated in a medium containing 1 pM FITC-ODN complexed with cationic liposomes with DDAB to ODN at different charge ratios for 4 hours. The cells were then lysed and the cellular associated fluorescence was measured by fluorometric analysis.

The concentration effects of ASODN with the delivery

systems on ASODN uptake also were determined. H4 hepatoma cell cultures were grown to confluence, then treated with either cationic liposome-complexed ASODN, PC:cholesterol liposome-encapsulated ASODN, or naked ASODN at the following concentrations: 0.1, 0.5, 1.0, 2.5 and 5.0 M. Cultures were incubated for 4 hours, then media was decanted and cells were lysed and assayed for FITC intensity using fluorimetric analysis.

The effectiveness of the delivery mechanism on the rate of ASODN cellular uptake in Hepatoma H4 cell culture was





53


determined. The cell cultures were grown to confluence and treated with either a 1 gM cationic liposome-complexed ASODN, a 1 pM PC:cholesterol liposome-encapsulated ASODN, or an 1 pM naked ASODN. Cultures were incubated for 1-4 hours. The cellular associated fluorescence was measured at 0.5, 1, 2 and 4 hours.

FITC conjugated ASODN distribution and uptake was analyzed microscopically. Hepatoma cells were grown on glass microscope slides and treated with either 1 pM of naked FITCASODN, 1 pM PC:cholesterol liposome-encapsulated ASODN or 1 gM cationic liposome-complexed ASODN for four hours. The slides were then mounted and the image was observed under a Nikon Optiphot-2-Fluorescent laser scanning confocal microscope.

The in vitro effects of cationic liposome complexed with ASODN on AGT mRNA expression and AGT protein production were determined in hepatoma cells, which were grown to confluence. These cells were treated with either 1 pM cationic liposomes complexed with ASODN, naked ASODN, scrambled ODN or cationic lipids alone. Cultures were incubated for 24 hours, then the medium analyzed for AGT by radioimmunoassay. Hepatoma cells were lysed for mRNA measurement by Northern blot analysis.

Hepatoma cells were treated with complexed ASODN at

concentrations of 10 nM, 50 nM, 100 nM, 500 nM, and 1 uM to





54


determine the dose response effect of cationic liposomecomplexed ASODN on the expression of AGT mRNA and protein. Cells were incubated with CA/ASODNs and cationic lipids used in the formulation for 24 hours, then the AGT mRNA were measured by Northern blot analysis and the AGT protein levels in the medium were measured by radioimmunoassay.

Cellular toxicity was measured using the MTT test as

described in Chapter 2. Cells were incubated for 48 hours in medium containing either ASODN at concentrations of 0.1, 0.2,

0.5, 1.0, 2.0, 5.0, 10.0 IM, ASODN complexed with cationic lipids or the corresponding amount of cationic lipids used to complex ASODN at each concentration. After treatment, cells were washed with phosphate buffer and incubated in 0.25 mg/ml of MTT for 4 hours at 370C. A 1 ml solution of 0.04 N HCI, prepared in isopropanol, was added and agitated for 5 minutes to solubilize the formazan produced. The absorbance was measured at 560 nm by microplate reader.



Results


Figure 3-1 summarizes the effects of DDAB to DOPE molar

ratio from 1:8 to 8:1 on the cellular uptake of FITC labeled ASODN in H4 Hepatoma cells. The results demonstrate that without DOPE, ASODN uptake is low, as depicted by the

3.40.4% of total fluorescence detected in these cells. As the DOPE composition of the liposomes increased, cellular uptake of ASODN also increased. Maximum ASODN uptake observed





55


was 15.8 1.6%(P<0.05) at a DDAB to DOPE weight ratio of 1:2. As more DOPE was added to the liposomes, the ASODN uptake dropped rapidly. At a weight ratio of 1:8, the ASODN uptake was 3.20.7%. The optimal +/- charge ratio of DDAB to ASODN on the cellular uptake of ASODN was determined by treating the cells with 1pM of FITC-ASODN complexed with DDAB at different molar ratios. The uptake of ASODN complexed with liposomes composed of DDAB alone was used to test the effect of the helper lipid DOPE on the uptake of ASODN. Figure 3-2 shows that the maximum uptake was 16.11.9%(P<0.05) at a DDAB to ODN molar ratio of 5:1. Without DOPE, the ASODN uptake was low, ranging from 2.60.2% to 3.70.5%.

In a subsequent study with hepatoma cells, the time course of cellular uptake was evaluated with all three delivery Systems (naked ASODN, PC:cholesterol-encapsulated, and cationic liposome-complexed ASODN) using a 1 [M concentration of ASODN. Cellular uptake was determined at given time intervals after cells were treated with FITC labeled ASODN.

Figure 3-3 demonstrates that cationic liposome

complexation resulted in a more rapid cellular uptake of ASODN, with greater ASODN accumulation per time point when compared to both the PC:cholesterol liposome treated cells and cells treated with naked ASODN. With all treatments the most rapid intracellular ASODN accumulation was observed between 0 and 60 minutes after ASODN administration.




56









20
18 *
16 14
C
S12 10
_- 8
LL
4-
20
U
6

4 2
0 I I I I I I
DDAB8:1 4:1 2:1 1:1 1:2 1:4 1:8
DDAB/DOPE Molar Ratio


Figure 3-1. Effect of DDAB to DOPE molar ratio on the cellular uptake of FITC-labeled ASODN. Hepatoma cells were incubated with 1 pM of ASODN and DDAB (25 mg/ml) with DOPE at different molar ratios for 4 hours. The cellular associated FITC intensity was then measured by fluorimetry. Data represents mean standard error (n=3) P<0.05(*).




57






20
--- DOPE 18 -- Without DOPE
16
= 14

a 12-
C 10I- 8
LL
6
o


2


10:1 5:1 2.5:1 1:1 1:2.5 1:5 1:10

DDAB(+)/ASODN(-) Charge Ratio



Figure 3-2. Effect of DDAB to ASODN charge ratio on the cellular uptake of FITC-labeled ASODN. Hepatoma cells were incubated with 1 gM ASODN with DDAB at a charge ratio of 10:1 to 1:10 in the presence or absence of DOPE for 4 hours. The cellular associated FITC intensity was measured by fluorimetry. Data represents mean standard error (n=3)
P<0.05(*).




58





16
+- ASODN

14- PC/ASODN
-A+- CA/ASODN
12

C 10
a,) 40
;8

-- 6

2 4
2

0 1 I I

0 1 2 3 4
Time (hour)


Figure 3-3. Time course of cellular uptake of FITC- labeled ASODN. Hepatoma cells were incubated with 1 pM of ASODN, PC cholesterol liposome-encapsulated ASODN(PC/ASODN), or cationic liposome complexed ASODN(CA/ASODN) for 0.5 to 4 hours, then the cellular associated FITC intensity was measured by fluorimetry. Data represents mean standard error(n=3) P<0.05(*).





59


Figure 3-4 summarizes the results of the cellularassociated fluorescence intensities associated with FITClabeled ASODN uptake for a range of concentrations using each delivery mechanism. These data demonstrate that the amount of ASODN within the cells increased with each concentration. The amount of cellular ASODN accumulated was greater(P<0.05) with the PC:cholesterol liposome ASODN encapsulation delivery system compared to that observed with the naked ASODN at all the measured ASODN concentrations. However, this accumulation was most profound with the cationic lipid delivery. With cationic lipid delivery, the accumulation of ASODN was nearly linear at low concentrations; however, the amount of ASODN taken up did not increase substantially at concentrations greater than 1 ptM. Also, the 4-hour treatment with 1 IM concentration depicted in Figure 3-3 demonstrated results similar to those observed with the 1 JIM concentration in Fig 3-4, signifying the reproducibility of the system.

Four hours after treatment, the cellular uptake and

distribution of FITC-labeled ASODN was observed with confocal microscopy. Figure 3-5A shows a weak intracellular background fluorescence of untreated cells. Figure 3-5B shows the distribution of naked FITC-labeled ASODN. Although some intense fluorescence is observed within the cells, there appears to be a large proportion of fluorescence localized at the cell membrane surrounding the individual cells. Figure 35C shows cells treated with PC:cholesterol-encapsulated FITC-




60









18
*
16 *
> 14
C,)
: 12
a)
c-: 10
0
18
6
0
o- 4 ASODN
2 PC/ASODN
-A- CA/ASODN
0
0 1 2 3 4 5

ASODN Concentrations(uM)


Figure 3-4. Dose-dependent cellular uptake of FITC-labeled ASODN. Hepatoma cells were incubated with 1 pM of ASODN, PC cholesterol liposome-encapsulated ASODN(PC/ASODN), and cationic liposome-complexed ASODN(CA/ASODN) at ASODN doses from 100 nm to 5 gM for 4 hours. The cellular associated FITC intensity was then measured by fluorimetry. Data represents mean standard error (n=3) P<0.05(*).





61



































Figure 3-5. Cellular uptake and intracellular distribution of FITC-labeled ASODN observed by confocal microscopy. Hepatoma cells were grown on microslides then incubated with
1 [M ASODN, PC cholesterol liposome encapsulated ASODN (PC/ASODN), or cationic liposome complexed ASODN(CA/ASODN) for 4 hours. The cells were then fixed and the images were observed by confocal microscopy; A. control; B. cells treated with ASODN; D. cells treated with PC/ASODN; D. cells treated with CA/ASODN (n=3).





62


labeled ASODN. Most of these cells appear to have a fairly even intracellular distribution of ASODN, with very little of ASODN remaining outside the cell. The fluorescence was stronger within these cells compared to that observed after naked ASODN treatment. In some cells there was an accumulation of fluorescence in localized cellular areas, which may indicate nuclear accumulation. Finally, Figure 3-5D shows a more intense localized fluorescence observed in cells treated with cationic liposome-complexed, FITC-labeled ASODN. The fluorescence within these cells was the strongest compared to all other treatments and appeared to be mainly localized within the cell nucleus.

Figure 3-Ga demonstrates the AGT and control cathepsin D mRNA bands after various treatments measured by the Northern blot analysis. Figure 3-6b displays the density ratio of AGT to cathepsin D mRNA. In cell culture, the amount of AGT mRNA was shown to be decreased 75% after treatment with the cationic liposome-complexed ASODN, compared with a 30% decrease after naked ODN treatment. The control scrambled ODN and cationic lipid had no effect on mRNA expression and was similar to the untreated control. AGT protein production was attenuated similarly, and a more pronounced decrease was observed in those samples treated with cationic liposomecomplexed ASODN (Figure 3-7). In untreated control cells the baseline AGT level was 52.02.46 ng/ml. There was no significant decrease in AGT production from baseline levels in the lipid and complexed scrambled control groups, which





63


a.


CTRL PC CA ASODN PC/AS CA/AS

AGT +-1.9 kb
AG n



Cathepsin <- 2.1 kb




b.



120

0
.- 100
0
80 8
0
60
Z
Cr 40
E
o 20

0 0





Figure 3-6. Effect of liposome-associated ASODN on AGT mRNA expression in hepatoma cell culture. Cells were incubated with 1 pM of ASODN, PC/cholesterol liposome-encapsulated ASODN(PC/ASODN), cationic liposome-complexed ASODN (CA/ ASODN), PC/cholesterol liposome encapsulated scrambled ODN(PC/ScrODN) or cationic liposome complexed scrambled ODN(CA/ScrODN) for 24 hours. AGT mRNA was measured by Northern blot analysis: a. the result of Northern blot hybridization for AGT (1.9 kb) and the control gene cathepsin D(2.1 kb); b. the density ratio of AGT to cathepsin.




64









60

E 50c,)

C
-9 40C30

2 200
(D 10 -.









incubated with 1 1M of ASODN, PC/cholesterol liposome encapsulated ASODN(PC/ASODN), cationic liposome complexed
0 ... 1-/& /&, Obv, vok


Figure 3-7. Effect of liposome-associated ASODN on AGT protein expression in hepatoma cell culture. Cells were incubated with 1 LM of ASODN, PC/cholesterol liposome encapsulated ASODN(PC/ASODN), cationic liposome complexed ASODN(CA/ASODN), PC/cholesterol liposome encapsulated scrambled ODN(PC/ScrODN) or cationic liposome complexed scrambled ODN(CA/ScrODN) for 24 hours. AGT protein levels were measured by radioimmunoassay. Data represents the mean + standard error (n=3) P<0.05(*).





65


were 45.535.9, and 47.036.9 ng/ml, (n=3), respectively. In cells treated with naked ASODN, PC/ASODN and cationic liposome complexed ASODN, AGT levels were significantly (P<0.05) decreased from baseline levels: 30.23.0, 22.12.7,

5.610.95 ng/ml, respectively.

The dose response effect of CA/ASODN treatment demonstrates that AGT mRNA was reduced at an ASODN concentration of 100 nM. Northern blot analysis revealed that at both 100 and 500 nM concentrations of ASODN, there was a 40% reduction in AGT mRNA. At a higher concentration of 1 pM, a 70% decrease in AGT mRNA was observed(Figure 3-8). The decrease in AGT protein(Figure 3-9) at an ASODN concentration of 50 nM was 40.294.0 ng/ml compared to the 51.773.7 ng/ml observed in the control samples. At 0.1, 0.5 and 1 M ASODN, AGT protein levels were significantly (P<0.05) decreased from the baseline in a dose dependent manner, with AGT concentrations of 26.685.3; 23.276.1; 5.670.3 ng/ml, respectively. Cationic liposomes alone had no effect on AGT protein or mRNA levels.

ASODN cytotoxicity was determined over the concentration ranges of 0.1 to 10 pM. The toxicity of the CA/ASODN complexes and the cationic lipids used to complex the ASODN also was determined. Figure 3-10 demonstrates that 89% of the cells survived at a naked ASODN concentration of 10 M, while




66

a.

Cationic Liposome CA/ASODN
0.01 0.05 0.1 0.5 1.0 0.01 0.05 0.1 0.5 1.0 (4.M)

+-AGT (1.9 kb)


S +--cathepsin D (2.1 kb)



b.



2 140
O ul] Cationic liposome
Q, 120 CA/ASODN
H
o 100
0
80
60
W 40E
S20

0
< 0-- --0.01 0.05 0.10 0.50 1.00 control

ASODN Concentrations (uM)



Figure 3-8. Dose-dependent effects of CA/ASODN on AGT mRNA in hepatoma cell culture. Cells were incubated with CA/ASODN at doses from 10 nM to 1 RM for 24 hours. AGT mRNA was measured by Northern blot analysis: a. the result of Northern blot hybridization for AGT(1.9 kb) and the control gene cathepsin D(2.1 kb); b. the relative intensity of AGT gene expression compared with control(n=3)(*)P<0.05.





67














70 ---- Cationic Liposome
CA/ASODN
60


C
-50 T

C
ai)T



20

c0 0
0







10nM 50nM 0.1uM 0.5uM luM Control ASODN Concentrations
Figure 3-9. Dose-dependent effects of CA/ASODN on AGT






protein expression in hepatoma cell culture. Cells were incubated with CA/ASODN at doses from 10 nM to 1 M for 24 hours. AGT protein levels were measured by radicimmunoassay. Data represents mean standard error (n=3) P<0.05(*).
A.-A
10 ..


10nM 50nM 0.uM 0.5uM luM Control ASODN Concentrations



Figure 3-9. Dose-dependent effects of CA/ASODN on AGT protein expression in hepatoma cell culture. Cells were incubated with CA/ASODN at doses from 10 nM to I LM for 24 hours. AGT protein levels were measured by radio~immunoassay. Data represents mean standard error (n=3) P<0.05(*) .




68








120 110
Lo 100 c 90
0
o
0 80
o 70 *
6 60
50 -*
40
(U
30
ASODN
D 20 CA/ASODN
o 10 A CA
0 3
0- I I I I
0.1 0.2 0.5 1 2 5 10
ASODN Concentrations (uM)


Figure 3-10. In vitro cytotoxicity of CA/ASOSN, ASODN and cationic lipids measured by MTT test. Hepatoma cells were treated with ASODN, cationic lipids(CA), or cationic liposome complexed ASODN(CA/ASODN) at ASODN concentrations from 100 nM to 10 pLM for 48 hours, then cell viability was measured by MTT test. Data represents mean standard error (n=3)P<0.05(*).





69

at lower concentrations no obvious toxic effect was observed. The ASODN lipid complex showed a similar cytotoxic effect at ASODN concentrations up to 0.5 tM. Toxicity appeared to increase as ASODN concentration increased. At an ASODN concentration of 10 M the complex caused approximately 70% of the cells to die. The cationic lipids seemed less toxic than the complex. At an ASODN concentration of 0.5 j.M, the toxic effect was similar to that of CA/ASODN. However, at a concentration of 10 [M, 50% of the cells survived. The toxicity of the CA/ASODN complexes at 1.0 pM concentrations was seen to be similar to the toxicity of naked ASODN at the 10 pM concentration in the Hepatoma cell culture.


Discussion

Successful attenuation of the target protein has been achieved using antisense technology in a wide range of biological systems[70-72]. However, the development of antisense therapy has not been as smooth as once anticipated. Problems have been encountered in the delivery of the molecules to target sites, with general uptake efficiency of naked ASODN being as low as 2% [1401. The cationic liposomes used in this study were shown to improve the cellular uptake of ASODN in hepatoma cell culture. The composition of the lipids and the charge ratio of cationic lipid to ASODN appeared to be critical factors for successful transfection





70


(Figure 3-1,3-2). The uptake of the ASODN dramatically changed under different lipid to ASODN charge ratios. This is probably due to such factors as aggregation of the cationic lipids with the ASODN, the size of the complex particle and the overall charge of the ASODN-lipid complexes at different charge ratios. The uptake of ASODN is relatively higher when the complex has a net positive charge than when the complex has an overall net negative charge. The net positive charge may provide stronger forces of interaction between the complex and the negatively charged cell membrane. Inclusion of DOPE in the liposome appears to be essential for efficient delivery due to its fusogenic function[101,1321.

Results from the scanning confocal microscope (Figure 3-5) demonstrated FITC labeled ASODN is distributed intracellularly. The presence of fluorescence in the cytoplasm in a punctuated manner is considered to be consistent with distribution within endocytic vesicles, suggesting that cellular uptake of ASODN may be via an endocytotic process. In cells treated with cationic liposome-complexed ASODN, the fluorescence signal seemed diffuse in the cytoplasm and in the nucleus, suggesting that cationic liposomes may function to facilitate the release of ASODN from the endosomal vesicles. The extent of the endocytotic processes on the uptake of ASODN has been studied using different inhibitors of endocytosis. Agents that increase lysosomal pH, such as chloroquine and NH4C, did not prevent accumulation of ASODN within the nucleus or block ASODN activity[1411. These





71


observations suggest the participation of endosomal acidification in the release of ODN from the endosome into the cytoplasm.

The cationic liposomes also were shown to increase the

rate and the amount of ASODN accumulation by cells (Figure 33,3-4). At the beginning of the incubation, CA/ASODN displayed a higher association with the cells than either the naked ASODN or the PC/ASODN. It has been suggested that the initial stage of CA/ASODN interaction with cells induces adsorption of the positively charged CA/ASODN complexes to the negatively charged phospholipids of the cell membrane. The charge-induced interaction may account for the enhanced cellular association of CA/ASODN, compared with the PC/ASODN and naked ASODNs. The results from the time and dosedependent uptake curves suggest that ASODN uptake may be a saturable process. ASODN uptake reached a plateau at the four-hour time point at a 1 uM concentration.

Subsequent studies evaluated the effect of ASODN on AGT gene expression. The results demonstrate that CA/ASODN decreases AGT mRNA and protein in Hepatoma cell culture. The possible mechanisms for ASODN inhibition of gene expression may be explained as ASODN functioning as a "road blocker" to ribosome assembly thus impeding the binding of translation factors or acting to block translocation of ribosome on the mRNA. The involvement of RNase H, which hydrolyses the RNA part of RNA/DNA hybrids, may also be a possible mechanism. RNase H is a ubiquitous enzyme, with varying activity among





72


different cell types[751. The binding of ASODN to targeted mRNA may activate RNase H, which then degrades the RNA portion of an RNA-DNA duplex, and subsequently blocks gene expression. The RNase H mechanism is supported by the fact that failed translation blockage was observed in rabbit reticulocyte lysate which contains low to no RNase H activity[142]. The role of RNase H also is demonstrated by using an ASODN that is known to not activate RNase. The oligonucleotides such as methyl phosphonate and a-oligomers targeted to the coding region of the rabbit P-globin mRNA did not affect P-globin synthesis in wheat germ extract nor Xenopus oocytes[143].

These results also demonstrated that the effects of ASODN on the expression of AGT mRNA and protein levels was significantly enhanced by cationic liposomes, probably due to increased cellular and nuclear delivery of ASODN into the cells. Cationic liposomes also may protect the ASODN from enzyme degradation in the culture medium. The reported halflife of phosphorothioated ASODN in the cell culture medium RPMI 1640, with 10% fetal bovine serum, undiluted fetal bovine serum or rat cerebrospinal fluid is 142 hour, 81 hours and 197 hours, respectively[144] Cationic liposome complexation also has been shown to increase the stability of ASODN in cell culture[145].

The cytotoxic effect of the cationic liposome ASODN

complexes appears higher than either the ASODN molecules or





73


the cationic lipids alone (Figure 3-10). The toxic effects of cationic lipid are attributed to their surfactant like properties which cause solublization and portion of the cell membrane with subsequent damage to the cell integrity at higher concentrations[1391. The higher toxicity of CA/ASODN complexes may be a result of the non-specific effects of ASODN. Cationic liposomes resulted in increased intracellular delivery of ASODN. At high concentrations, ASODN may bind to non-targeted sequences and cause degradation of proteins, which may be essential for cell viability. This result was consistent with the previous in vitro transcription/ translation experiments, which showed that the scrambled ODNs also decreased the expression of AGT mRNA at ASODN concentrations higher than 3 M[681 The naked ASODN showed minimal cytotoxicity, probably due to its short half-life in the culture medium. Cationic liposome complexation improves its stability, but also increases its toxic effect. However, when used at doses of 1 tM or less, toxic effects are minimized, and are equivalent to the toxicity produced by 10 times the concentration of ASODN alone.

To summarize, these results support the following

conclusions. Cationic liposomes consisting of DDAB and DOPE increase the cellular delivery of ASODN, compared with previously used PC-cholesterol liposomes in hepatoma cell culture. Cationic liposome-complexed ASODN targeted to AGT mRNA decreased AGT mRNA and protein in cell culture in a dose





74


dependent manner. The CA/ASODN complex appeared to have a higher toxicity than either the cationic lipids or the ASODN alone, possibly due to the non-specific effects of high intracellular concentrations of ASODN.















CHAPTER 4

THE EFFECT OF ROUTE OF ADMINISTRATION OF CA/ASODN ON BLOOD PRESSURE AND TISSUE DISTRIBUTION OF ASODN IN SHR:
IMPLICATIONS OF THE ROLE OF TISSUE RAS ON BLOOD PRESSURE REGULATION


Specific Aims


The specific aim of this part of the research was to

develop a mechanism for targeted antisense oligonucleotide delivery to the liver using liposome technology and to determine ASODN tissue distribution after intraarterial and intravenous administration in SHR model and its subsequent effects on hypertension.


Tntroduction


The previous in vitro studies demonstrated that cationic liposomes composed of DDAB and DOPE are more effective in delivering ASODN than PC-cholesterol liposomes in hepatoma cell culture. The previous in vivo studies showed that PCcholesterol encapsulated ASODN successfully decreased blood pressure when administered both centrally and intraarterially in the SHR model of hypertension[65,68]. However, in vivo data was inconclusive when ASODN was administered intra-venously, despite the success of ASODN mediated gene



75





76


inhibition. Tissue and cellular ASODN delivery of ASODN remain the major obstacles for intended ASODN activity[771. Optimization of the ASODN delivery system and route of administration have been considered the most important aspects of improving the intended biological effect of ASODN.

The role of angiotensinogen in the pathogenesis of

hypertension has been supported by genetic studies[37-39]. AGT is expressed and constitutively secreted by hepatocytes. Successful delivery of ASODN to target cells should lead to suppression of AGT mRNA expression, resulting in decreased activity of the RAS and subsequent attenuation of hypertension. Delivery of macromolecules such as oligonucleotides to their target sites in vivo requires successful trans-endothelial migration and target cell endocytosis[146]. Strategies for liver(tissue)-specific targeting are divided into passive and active targeting. Passive targeting refers to the utilization of the natural disposition profiles of a drug carrier, which is determined by the physiochemical properties of the chemicals relative to the anatomical and physiological characteristics of the body. Delivery of macromolecules to the liver reticuloendothelial system, which lacks basement membrane on the endothelial cells and allows molecules 100 nm or less in diameter to permeate through, is an example of this. Active targeting refers to the alterations of the natural disposition of a drug carrier in order to direct it to





77


specific cells, tissues, or organs. Ligands, or monoclonal antibodies, which can bind specifically to the surface of target cells are used for this purpose[1471. In the case of hepatic targeting, antibodies targeted to asialoglycoprotein receptors, which are uniquely expressed by the liver, have been used to improve liver targeting[148,1491.

In this study, we utilized a cationic liposome approach to enhance ASODN delivery to the liver target. Small liposomes with a diameter of less than 100 nm are known to be naturally and rapidly cleared by the liver reticuloendothelial system after injection[961. Compared with previously used PC-cholesterol liposomes, positively charged cationic lipids may facilitate the adsorption of liposome/ASODN complex to the negatively charged cell surface and subsequently increase the cellular delivery of ASODN molecules. Incorporating the pH-sensitive fusogenic lipid DOPE also may facilitate target cell endocytosis of ASODN[150,151].

The renin-angiotensin system(RAS) has long been known as a circulating endocrine system that regulates blood pressure and fluid and electrolyte balance via its effector peptide angiotensin II[8]. The colocalization of renin, ACE, and angiotensin II receptor messenger RNA in tissues such as the kidney, heart, and brain suggest the existence of local RASs, which may play a functional role in blood pressure regulation [11-14]. Unlike the hormonal RAS, which regulates blood pressure by a closed-loop negative feedback mechanism,





78


the local RAS is thought to function in a paracrineautocrine manner. Angiotensin II produced by synthesizing cells can act on receptors of the neighboring cells (paracrine), or act on the receptors of the cells where it was synthesized (autocrine) to regulate such functions as smooth muscle cell contraction or release of endothelium derived relaxing factors[17-19].

The involvement of the tissue RAS in blood pressure regulation was first suggested by the effect of antihypertensive drugs. ACE and renin inhibitors with different physicochemical properties, and thus different tissue penetration profiles, showed different antihypertensive effects[111. The antihypertensive effects of ACE inhibitors and their duration are more consistent with the inhibition of ACE activity in the kidney and aorta rather than the plasma [152]. Renin inhibitors also appear to lower blood pressure in a fashion dissociated from their effect on plasma renin[153].

An intrarenal RAS has also been proposed as individual components of the RAS were detected in the renal cortex [154]. At a local level, angiotensin II influences glomerular micro-circulation, causing reductions in plasma flow rate; the ultrafiltration coefficient; and increases in the hydrostatic pressure difference and renal arteriolar resistance.

The SHR essential hypertension animal model is inbred from the normotensive strain of WKY rat[61] Abnormal RAS





79


activity resulting from genetic selection is believed to be responsible for the high blood pressure in SHRs[155]. In this study, we determined the effect of ASODN on blood pressure 24 hours after injection in both SHR and WKY strains, to investigate the role of the RAS in hypertension.

In previous studies, we measured the effect of blood

pressure changes after intra-arterial(IA) and intravenous

(IV) administration of ASODN in SHR. It appeared that ASODN caused more pronounced decreases in blood pressure after IA injection of ASODN than after IV injection. The discrepancy between blood pressure changes could result from tissue specific effects as a consequence of different tissue distribution of ASODN after IA and IV injection. In this study, the effects of intraarterial and intravenous administered ASODN on blood pressure, tissue distribution of ASODN, plasma and tissue angiotensinogen levels, were measured.

Material and Methods


To determine the mean arterial pressure (MAP) changes in SHR and WKY rats after intraarterial and intravenous injection of cationic liposome complexed ASODN, groups of rats (250-275 g, n=6), a catheter was implanted in the carotid artery and for intravenous studies, the femoral vein. Rats were allowed to recover for 24 hours after surgery, then baseline mean arterial blood pressure was determined using direct blood pressure measurement. A catheter was inserted into the external carotid artery and





80


connected to a pressure transducer that was interfaced with a Digi-Med BP Analyzer(micro-Med, Indianapolis,Ind). Signals were recorded on a Gould TA2405 EasyGraf Physiograph, which provides information on systolic, diastolic, and mean arterial pressure and heart rate. Following baseline pressure measurements, 50 pg doses of either cationic liposome complexed ASODN, scrambled ODN, uncomplexed ASODN or cationic lipid were injected either IA via the carotid catheters or IV via the femoral catheters. Twenty-four hours after injection, mean arterial pressure was measured using the same method.

The tissue distribution of FITC conjugated ASODN and

cationic liposome complexed FITC-ASODN after intravenous and intraarterial administration was then determined. Groups of Sprague Dawley rats(n=9) were injected with 100 [g FITCASODN and FITC-CA/ASODN via the carotid artery or femoral vein. One, 8, and 24 hours later, three of the injected rats were perfused with saline and then decapitated. Liver, kidney, heart, lung, brain, and plasma were collected. Tissues were then homogenized in Triton 100 and the associated fluorescence intensity was measured using fluorimetric analysis.

We also measured plasma AGT and Ang II levels after

intraarterial and intravenous administration of ASODN. 50 pg of cationic liposome complexed ASODN was injected via the carotid artery or femoral vein of SHR(n=3). After 24 hours, animals were decapitated and plasma samples were collected.





81


Plasma AGT and Ang II(RK-A22, Alpco, Windham, NH) were measured using radioimmunoassay[124].

In order to determine the effects of ASODN on tissue AGT expression, 50 pg doses of either cationic liposome complexed ASODN, scrambled ODN, uncomplexed ASODN or cationic lipid were injected either IA or IV in SHRs(n=3). After 24 hours, rats were sacrificed and liver, kidney, and heart were collected. Total mRNA was extracted and AGT and Cathepsin D mRNA levels were measured by Northern blot analysis[122,123]. The house-keeping gene cathepsin D was used as a control to ensure equal loading of RNA.


ResuIlts


Figure 4-1 demonstrates the change in mean arterial

pressure 24 hours after intraarterial injection of either CA/ASODN, CA/ScrODN, uncomplexed ASODN, or cationic lipids. A significant (P<0.05) decrease in MAP, 235 mmHg from baseline, was observed in SHR treated with CA/ASODN. A less marked but significant(P<0.05) decrease in blood pressure, 154 mmHg from baseline level, was observed in SHRs treated with uncomplexed ASODN. Blood pressure were unchanged in animals treated with either CA/ScrODN or cationic lipids (Figure 4-1). ASODNs administered by the intravenous route produced a significant but smaller decrease in blood pressure: 72 mmHg and 41 mmHg(P<0.05) from baseline after either CA/ASODN or ASODN treatment, respectively (Figure 42). No significant changes in blood pressure were observed





82











5

: E BL
cE
m E -5 \"

"- -10
Cl)



-20 *

S-25

-30







Figure 4-1. Mean arterial pressure changes from baseline 24 hours after intra-arterial injection of CA/ASODN in SHR. 50 p~g cationic liposome-complexed ASODN(CA/ASODN), ASODN, cationic lipids (CA), and cationic liposome-complexed scrambled ODN (CA/ScrODN) were used. Blood pressure was measured by direct method. Data represent mean standard error (n=6). P<0.05(*).





83














5

r 0



CU ,
5 -5
00


W -10


-15


< -20


-25 ,


4 04 O4V




Figure 4-2. Mean arterial pressure changes from baseline 24 hours after intravenous injection of CA/ASODN in SHR. 50 pg cationic liposome-complexed ASODN(CA/ASODN), ASODN, cationic lipids(CA), and cationic liposome-complexed scrambled ODN(ScrODN) were used. Blood pressure was measured by direct method. Data represents mean standard error(n=6).
P<0.05(*).





84


after CA/ScrODN or cationic lipid treatment. Similar experiments also were conducted in control WKY rats and no significant blood pressure changes from baseline level, 132+ 8 mmHg, were observed after IA or IV injection of ASODNs or controls.

To determine the mechanism of the observed differences in blood pressure reductions after IA and IV injection, tissue distribution of FITC labeled ASODN after IA and IV injection was determined. Figures 4-3, 4-4, and 4-5 summarize the measured tissue associated FITC intensity for each injected dose at 1, 8, and 24 hours. Figure 4-3 demonstrates that at the 1 hour time point, 30% of the injected complexed ASODN accumulated in the liver after IA injection, compared with 25% accumulation in the liver after IV injection. Cationic liposome complexation increased ASODN accumulation in the liver, lung, and heart by approximately 100%. As expected, a higher accumulation of CA/ASODN was seen in the lung after IV injection than after IA injection. At the 8 hour time point, a similar ASODN distribution was observed with either route of administration(Figure 4-4). At the 24-hour time point, a similar degree of CA/ASODN accumulation was observed in the liver after IA and IV injection. However, in the kidney, there was a greater accumulation of CA/ASODN after IA injection than after IV injection. With time the brain appeared to have greater level of accumulation.

Plasma AGT levels of SHR, 24 hours after IA injection of cationic lipids, CA/ScrODN, CA/ASODN, or ASODN, were 11715




85




40
35 r IA.1, ASODN
E30ZZ- IA.1,CA/ASODN
30
25 20
O 15 S10
t- 5
0 0 I I

40
35 | IV.1, ASODN
35
2222 [ IV.1, CA/ASODN
30
O
O 25
20 15 10
5
10 2


LV KN HT BR LU PL


Figure 4-3. Tissue distribution of ASODN and CA/ASODN in 1 hour after IA or IV injection. The FITC intensity were measured in liver(LV), heart(HT), kidney(KN), lung(LU), brain(BR), and plasma(PL) in Sprague Dawley rats. Figure demonstrates the FITC intensity measured by fluorimetry as a percentage of the injected dose. Data represent mean + standard error(n=3). P<0.05(*).




86




40
35 E---- IA.8, ASODN
IA.8,CA/ASODN 30 25
CD 2015
.-10
5
D 0
( 30 I- IV.8, ASODN
W 25 I 2 IV.8, CA/ASODN
I 20
C) 20
15
10




LV KN HT BR LU PL



Figure 4-4. Tissue distribution of ASODN and CA/ASODN in 8 hour after IA or IV injection. The FITC intensity were measured in liver(LV), heart(HT), kidney(KN), lung(LU), brain(BR), and plasma(PL) in Sprague Dawley rats. Figure demonstrates the FITC intensity measured by fluorimetry as a percentage of the injected dose. Data represent mean + standard error(n=3). P<0.05(*).




87




50
II1 IA.24, ASODN 40 22 IA.24,CA/ASODN

D 30

20

o 10E. 0 D 25
.,II IV.24, ASODN
o 20 IV.24,CA/ASODN

15



0


LV KN HT BR LU PL


Figure 4-5. Tissue distribution of ASODN and CA/ASODN in 24 hour after IA or IV injection. The FITC intensity were measured in liver(LV), heart(HT), kidney(KN), lung(LU) brain(BR), and plasma(PL) in Sprague Dawley rats. Figure demonstrates the FITC intensity measured by fluorimetry as a percentage of the injected dose. Data represent mean + standard error(n=3). P<0.05(*).


















140 ----] CA
CA/ScrODN S120 ASODN
EM CA/ASODN
9 100
80
.6-'M
60

<40
CU E
c 20
20

Intraarterial Intravenous



Figure 4-6. Plasma AGT levels 24 hours after IA and IV injection of ASODN with liposomes in SHR. Angiotensinogen was measured by radioimmunoassay. Data represents mean standard error (n=3). P<0.05(*).





89


ng/ml, 11910 ng/ml, 4610 ng/ml, and 6912 ng/ml, respectively. After IV injection, the levels were 12014 ng/ml, 12814 ng/ml, 589 ng/ml, and 717 ng/ml, respectively (Figure 4-6). The plasma levels of AGT decreased significantly(P<0.05) after either CA/ASODN or ASODN treatment, compared with CA/ScrODN or cationic lipid treatment. However, no significant difference of AGT levels between IA or IV injection of either CA/ASODN or ASODN was observed.

Similar reductions of plasma angiotensin II levels were also observed. Figure 4-7 summarizes the effect of CA/ASODN treatment on plasma angiotensin II levels in SHR. Arng II levels were 20826 ng/ml, 22616 ng/ml, 818 ng/ml, and 160

9 ng/ml after IA injection of cationic lipids, CA/ScrODN, CA/ASODN, or ASODN, respectively. After IV administration, the levels were 21218 ng/ml, 2099 ng/ml, 9410 ng/ml, and 17212 ng/ml, respectively. The Ang II levels after either CA/ASODN or ASODN treatment were significantly (P<0.05) lower compared with that after ScrODN and CA treatment. The difference between angiotensin II levels after IA and IV injection was not statistically significant.

We also measured AGT mRNA levels in the heart, kidney and liver after IA and IV injection of ASODNs using Northern blot analysis. In the kidney, AGT mRNA decreased approximately 50% 24 hours after IA ASODN administration, compared with a 20-30% decrease observed after IV injection




Full Text

PAGE 1

237,0,=$7,21 2) +(3$7,& 7$5*(7,1* )25 $17,6(16( ,1+,%,7,21 2) +<3(57(16,21 ,1 63217$1(286/< +<3(57(16,9( 5$76 %\ 1,1*<$ 6+, $ ',66(57$7,21 35(6(17(' 72 7+( *5$'8$7( 6&+22/ 2) 7+( 81,9(56,7< 2) )/25,'$ ,1 3$57,$/ )8/),//0(17 2) 7+( 5(48,5(0(176 )25 7+( '(*5(( 2) '2&725 2) 3+,/2623+< 81,9(56,7< 2) )/25,'$

PAGE 2

$&.12:/('*0(176 )LUVW ZDQW WR H[SUHVV P\ VLQFHUH DSSUHFLDWLRQ WR 'U 'RQQD :LHOER IRU KHU VXSSRUW DGYLFH DQG JXLGDQFH WKURXJK P\ FRXUVH RI VWXG\ ZKLFK ZRXOG QRW KDYH FRPSOHWHG ZLWKRXW KHU KHOS ZRXOG DOVR OLNH WR H[SUHVV P\ JUDWLWXGH WR DOO P\ FRPPLWWHH PHPEHUV IRU WKHLU LQYDOXDEOH JXLGDQFH DQG WKH WLPH WKH\ FRPPLWWHG WR P\ JUDGXDWH ZRUN ZDQW WR WKDQN 'U 0LFKDHO .DWRYLFK IRU KLV JXLGDQFH DV FRPSOHWHG P\ GLVVHUWDWLRQ DV DQG IRU KHOSLQJ PH ZLWK P\ ZULWLQJ ZDQW WR WKDQN 'U .HQQHWK 6ORDQ IRU KLV VXSHUYLVLRQ ZKLOH ZDV D JUDGXDWH VWXGHQW LQ WKH 'HSDUWPHQW RI 0HGLFLQDO &KHPLVWU\ ZDQW WR WKDQN 'U &ROLQ 6XPQHUV DQG 'U 1DVVHU &KHJLQL DV IRU WKHLU GLVFXVVLRQ RI P\ UHVHDUFK DQG 'U ,DQ 7HEEHWW IRU KLV KHOS LQ DQDO\WLF PHWKRG YDOLGDWLRQ ZDQW WR WKDQN RXU ODE PHPEHUV IRU WKHLU NLQG KHOS )LQDOO\ ZDQW WR WKDQN PHPEHUV RI P\ IDPLO\ IRU WKHLU VXSSRUW GXULQJ WKLV WLPH

PAGE 3

7$%/( 2) &217(176 SDJH $&.12:/('*0(176 LL /,67 2) 7$%/(6 9 /,67 2) ),*85(6 YL 127$7,21 L[ $%675$&7 [ &+$37(56 ,1752'8&7,21 +\SHUWHQVLRQ $QWLVHQVH 2OLJRGHR[\QXFOHRWLGHV /LSRVRPHV DV D 'HOLYHU\ 9HKLFOH IRU $62'1 n +\SRWKHVLV *(1(5$/ 0$7(5,$/ $1' 0(7+2'6 /,32620(0(',$7(' 2/,*218&/(27,'( '(/,9(5< ,1 +(3$720$ &(// &8/785( 6SHFLILF $LPV ,QWURGXFWLRQ 0DWHULDO DQG 0HWKRGV 5HVXOWV 'LVFXVVLRQ 7+( ())(&7 2) 5287( 2) $'0,1,675$7,21 2) &$$62'1 21 %/22' 35(6685( $1'7,668( ',675,%87,21 2) $62'1 ,1 6+5 ,03/,&$7,21 2) 7+( 52/( 2) 7,668( 5$6 21 %/22' 35(6685( 5(*8/$7,21 6SHFLILF $LPV ,QWURGXFWLRQ 0DWHULDO DQG 0HWKRGV 5HVXOWV 'LVFXVVLRQ '26('(3(1'(17 3+<6,2/2*,&$/ ())(&76 2) &$7,21,& LLL

PAGE 4

/,326260( &203/(;(' $62'1 ,1 6+5 02'(/ 6SHFLILF $LPV ,QWURGXFWLRQ 0DWHULDO DQG 0HWKRGV 5HVXOWV 'LVFXVVLRQ ',6&866,21 $1' 6800$5< 5()(5(1&(6 %,2*5$3+,&$/ 6.(7&+ LY

PAGE 5

/,67 2) 7$%/(6 7DEOH JDJH 3URSHUWLHV RI VHOHFWHG SKRVSKRGLHVWHU EDFNERQH DQDORJXHV 'RVHUHVSRQVH HIIHFWV RI &$$62'1 RQ ZDWHU LQWDNH DQG XULQH RXWSXW LQ 6+5 'RVHUHVSRQVH HIIHFWV RI &$$62'1 RQ SODVPD DOGRVWHURQH OHYHOV LQ 6+5 'RVHUHVSRQVH HIIHFWV RI &$$62'1 RQ KRXUV XULQDU\ VRGLXP DQG SRWDVVLXP H[FUHWLRQ LQ 6+5 Y

PAGE 6

/,67 2) ),*85(6 )LJXUH SDJH )DFWRUV LQYROYHG LQ WKH FRQWURO RI EORRG SUHVVXUH 6FKHPDWLF UHSUHVHQWDWLRQ RI WKH UHQLQ DQJLRWHQVLQV\VWHP 6LJQDO WUDQVGXFWLRQ RI DQJLRWHQVLQ ,, UHFHSWRU W\SH 6FKHPDWLF UHSUHVHQWDWLRQ RI n IODQNLQJ UHJLRQV RI WKH $*7 JHQH $QWLK\SHUWHQVLYH GUXJV ZRUNLQJ RQ WKH 5$6 6XPPDU\ RI WKH SRVVLEOH VLWHV RI VHTXHQFH VSHFLILF DFWLRQV RI $62'1 6WUXFWXUHV RI SKRVSKRGLHVWHU DQG SKRVSKRURWKLRDWH PROHFXOHV 3KDVH VWUXFWXUHV IRUPHG E\ OLSLGV LQ WKH DTXHRXV VROXWLRQ 3RVVLEOH PHFKDQLVPV RI LQWHUDFWLRQ EHWZHHQ OLSRVRPH DQG FHOO VXUIDFH (IIHFW RI ''$% DQG '23( PRODU UDWLR RQ WKH FHOOXODU XSWDNH RI ),7&ODEHOHG $62'1 (IIHFW RI ''$% WR $62'1 FKDUJH UDWLR RQ WKH FHOOXODU XSWDNH RI ),7&ODEHOHG $62'1 7LPH FRXUVH RI FHOOXODU XSWDNH RI ),7&ODEHOHG $62'1 3&$62'1 DQG &$$62'1 'RVHGHSHQGHQW FHOOXODU XSWDNH RI ),7&ODEHOHG $62'1 &HOOXODU XSWDNH DQG LQWUDFHOOXODU GLVWULEXWLRQ RI ),7&ODEHOHG $62'1 REVHUYHG E\ FRQIRFDO PLFURVFRS\ YL

PAGE 7

(IIHFWV RI OLSRVRPHDVVRFLDWHG $62'1 RQ WKH $*7 P51$ H[SUHVVLRQ LQ KHSDWRPD FHOO FXOWXUH (IIHFWV RI OLSRVRPHDVVRFLDWHG $62'1 RQ WKH $*7 SURWHLQ H[SUHVVLRQ LQ KHSDWRPD FHOO FXOWXUH 'RVHGHSHQGHQW HIIHFWV RI &$$62'1 RQ $*7 P51$ H[SUHVVLRQ LQ KHSDWRPD FHOO 'RVHGHSHQGHQW HIIHFWV RI &$$62'1 RQ $*7 SURWHLQ H[SUHVVLRQ LQ KHSDWRPD FHOO FXOWXUH $62'1 F\WR[LFLW\ PHDVXUHG E\ 077 WHVW 0HDQ DUWHULDO SUHVVXUH FKDQJHV IURP EDVHOLQH KRXUV DIWHU LQWUDDUWHULDO LQMHFWLRQ RI &$$62'1 LQ 6+5 0HDQ DUWHULDO SUHVVXUH FKDQJHV IURP EDVHOLQH KRXUV DIWHU LQWUDYHQRXV LQMHFWLRQ RI &$$62'1 LQ 6+5 7LVVXH GLVWULEXWLRQ RI $62'1 DQG &$$62'1 KRXU DIWHU ,$ RU ,9 LQMHFWLRQ 7LVVXH GLVWULEXWLRQ RI $62'1 DQG &$$62'1 KRXUV DIWHU ,$ RU ,9 LQMHFWLRQ 7LVVXH GLVWULEXWLRQ RI $62'1 DQG &$$62'1 KRXUV DIWHU ,$ RU ,9 LQMHFWLRQ 3ODVPD $*7 OHYHOV KRXUV DIWHU ,$ RU ,9 LQMHFWLRQ RI $62'1 ZLWK OLSRVRPHV LQ 6+5 3ODVPD DQJLRWHQVLQ ,, OHYHOV KRXUV DIWHU ,$ RU ,9 LQMHFWLRQ RI $62'1 ZLWK OLSRVRPHV LQ 6+5 /LYHU $*7 P51$ OHYHOV LQ 6+5 KRXUV DIWHU ,$ RU ,9 LQMHFWLRQ RI $62'1 ZLWK OLSRVRPHV +HDUW $*7 P51$ OHYHOV LQ 6+5 KRXUV DIWHU ,$ RU ,9 LQMHFWLRQ RI $62'1 ZLWK OLSRVRPHV .LGQH\ $*7 P51$ OHYHOV LQ 6+5 KRXUV DIWHU ,$ RU ,9 LQMHFWLRQ RI $62'1 ZLWK OLSRVRPHV 7KH GRVHUHVSRQVH HIIHFWV RI &$$62'1 RQ V\VWROLF EORRG SUHVVXUH LQ 6+5 7KH GRVHUHVSRQVH HIIHFWV RI &$$62'1 RQ SODVPD $*7 OHYHOV LQ 6+5 7KH GRVHUHVSRQVH HIIHFWV RI &$$62'1 RQ SODVPD DQJLRWHQVLQ ,, OHYHOV LQ 6+5 ,OO YLL

PAGE 8

'RVHUHVSRQVH HIIHFWV RI PHGLXP GRVH &$$62'1 RQ NLGQH\ $*7 P51$ H[SUHVVLRQ LQ 6+5 'RVHUHVSRQVH HIIHFWV RI KLJK GRVH &$$62'1 RQ NLGQH\ $*7 P51$ H[SUHVVLRQ LQ 6+5 'RVHUHVSRQVH HIIHFWV RI PHGLXP GRVH &$$62'1 RQ OLYHU $*7 P51$ H[SUHVVLRQ LQ 6+5 'RVHUHVSRQVH HIIHFWV RI KLJK GRVH &$$62'1 RQ OLYHU $*7 P51$ H[SUHVVLRQ LQ 6+5 'RVHUHVSRQVH HIIHFWV RI PHGLXP GRVH &$$62'1 RQ KHDUW $*7 P51$ H[SUHVVLRQ LQ 6+5 'RVHUHVSRQVH HIIHFWVRI KLJK GRVH &$$62'1 RQ KHDUW $*7 P51$ H[SUHVVLRQ LQ 6+5 6XPPDU\ RI SRVVLEOH PHFKDQLVPV IRU WKH REVHUYHG $62'1 PHGLDWHG EORRG SUHVVXUH GHFUHDVH YLLL

PAGE 9

127$7,216 6+5 :.< $*7 5$6 $62'1 3&&KROHVWHURO ''$% '23( &$$62'1 &$6FU2'1 3&$62'1 ),7&$62'1 6SRQWDQHRXVO\ K\SHUWHQVLYH UDW :LVWDU .\RWR UDW $QJLRWHQVLQRJHQ 5HQLQDQJLRWHQVLQ V\VWHP $QWLVHQVH ROLJRGHR[\QXFOHRWLGH 3KRVSKDWLG\OFKROLQH FKROHVWHURO 'LPHWK\OGLRFWDGHF\ODPPRQLXP EURPLGH 'LROHR\OSKRVSKDWLG\OHWKDQRODPLQH &DWLRQLF OLSRVRPHFRPSOH[HG $62'1 &DWLRQLF OLSRVRPHFRPSOH[HG VFUDPEOHG ROLJRQXFOHRWLGH 3&FKROHVWHURO OLSRVRPHHQFDSVXODWHG $62'1 )OXRUHVFHLQ LVRWKLRF\DQDWHFRQMXJDWHG $62'1 ,;

PAGE 10

$EVWUDFW RI $ 'LVVHUWDWLRQ SUHVHQWHG WR WKH *UDGXDWH 6FKRRO RI WKH 8QLYHUVLW\ RI )ORULGD LQ 3DUWLDO )XOILOOPHQW RI WKH 5HTXLUHPHQWV IRU WKH 'HJUHH RI 'RFWRU RI 3KLORVRSK\ 237,0,=$7,21 2) +(3$7,& 7$5*(7,1* )25 $17,6(16( ,1+,%,7,21 2) +<3(57(16,21 ,1 63217$1(286/< +<3(57(16,9( 5$76 %\ 1LQJ\D 6KL 0D\ &KDLUPDQ 'RQQD :LHOER 3K' 0DMRU 'HSDUWPHQW 0HGLFLQDO &KHPLVWU\ 7KH UROH RI DQJLRWHQVLQRJHQ $*7f LQ WKH SDWKRJHQHVLV RI K\SHUWHQVLRQ D PDMRU ULVN WR KXPDQ KHDOWK LV ZHOO VXSSRUWHG 6FLHQWLILF VWXGLHV KDYH SUHYLRXVO\ VKRZQ WKDW WKH EORFNDGH RI DQJLRWHQVLQRJHQ JHQH H[SUHVVLRQ KDV EHHQ HIIHFWLYH LQ GHFUHDVLQJ EORRG SUHVVXUH 7KLV GLVVHUWDWLRQ IRFXVHV RQ WKH HIIHFW RI FDWLRQLF OLSRVRPHV &$f DV D GHOLYHU\ V\VWHP IRU DQ DQWLVHQVH ROLJRGHR[\QXFOHRWLGH $62'1f WDUJHWHG WR WKH $*7 JHQH LQ UDW KHSDWRPD FHOO FXOWXUH DQG LQ WKH VSRQWDQHRXVO\ K\SHUWHQVLYH UDW 6+5f PRGHO RI K\SHUWHQVLRQ 7KH SKDUPDFRORJLFDO HIIHFWV RI FDWLRQLF OLSRVRPHFRPSOH[HG $62'1 &$$62'1f RQ $*7 P51$ DQG SURWHLQ H[SUHVVLRQ EORRG SUHVVXUH DQG ERWK KRUPRQDO DQG WLVVXH UHQLQDQJLRWHQVLQ V\VWHP 5$6f LQ 6+5 DUH VWXGLHG 7KH UHVXOWV SUHVHQWHG GHPRQVWUDWH WKDW FDWLRQLF [

PAGE 11

OLSRVRPH LQFUHDVHV FHOOXODU XSWDNH DQG WLVVXH GLVWULEXWLRQ RI $62'1 $Q LQFUHDVHG FHOOXODU XSWDNH RI $62'1 UHVXOWHG LQ HQKDQFHG JHQH LQKLELWLRQ DQG ELRORJLFDO HIIHFWV 7KHVH HIIHFWV ZHUH GHPRQVWUDWHG E\ D GRVH GHSHQGHQW GHFUHDVH LQ $*7 P51$ DQG SURWHLQ LQ KHSDWRPD FHOO FXOWXUH DQG GHFUHDVHG EORRG SUHVVXUH SODVPD $*7 SODVPD $QJLRWHQVLQ ,, DQG $*7 P51$ LQ KHDUW NLGQH\ DQG OLYHU LQ WKH 6+5 'HFUHDVHV LQ EORRG SUHVVXUH ZHUH DOVR VKRZQ WR FRUUHODWH ZLWK GHFUHDVHV LQ $*7 P51$ LQ WKH NLGQH\ VXJJHVWLQJ UHQDOO\ PHGLDWHG PHFKDQLVPV PD\ FRQWULEXWH WR WKH REVHUYHG EORRG SUHVVXUH GHFUHDVH 3ODVPD DOGRVWHURQH OHYHOV DOVR GHFUHDVHG DIWHU &$$62'1 WUHDWPHQW ZLWK D FRQFRPLWDQW LQFUHDV LQ XULQH RXWSXW D GHFUHDVH LQ XULQDU\ SRWDVVLXP H[FUHWLRQ DQG DQ LQFUHDVH LQ VRGLXP H[FUHWLRQ 7KHVH VWXGLHV VWURQJO\ VXJJHVW WKDW $62'1 WDUJHWHG FR $*7 P51$ KDV WKH SRWHQWLDO WR EH XVHG DV D WKHUDSHXWLF DJHQW IRU WKH WUHDWPHQW RI K\SHUWHQVLRQ DV ZHOO DV D UHVHDUFK WRRO WR VWXG\ WKH PHFKDQLVPV RI GHYHORSPHQW DQG PDLQWHQDQFH RI K\SHUWHQVLRQ [L

PAGE 12

&+$37(5 ,1752'8&7,21 +\SHUWHQVLRQ 2YHUYLHZ $SSUR[LPDWHO\ b RI WKH DGXOW SRSXODWLRQ LQ WKH 8QLWHG 6WDWHV VXIIHUV IURP K\SHUWHQVLRQ>@ 8QWUHDWHG VXVWDLQHG K\SHUWHQVLRQ FDQ OHDG WR VHULRXV FRPSOLFDWLRQV VXFK DV FRQJHVWLYH KHDUW IDLOXUH P\RFDUGLDO LQIDUFWLRQ DQG FHUHEURYDVFXODU KHPRUUKDJH>@ PDNLQJ LW D PDMRU WKUHDW WR KXPDQ OLIH +\SHUWHQVLRQ LV GHILQHG DV DQ DEQRUPDO HOHYDWLRQ RI V\VWHPLF DUWHULDO EORRG SUHVVXUH ,Q D KHDOWK\ KXPDQ EORRG SUHVVXUH OHYHOV IOXFWXDWH ZLWKLQ FHUWDLQ OLPLWV GHSHQGLQJ RQ ERG\ SRVLWLRQ DJH DQG VWUHVV $GXOW LQGLYLGXDOV ZLWK EORRG SUHVVXUH PHDVXUHPHQWV LQ H[FHVV RI PP +J DUH FRQVLGHUHG K\SHUWHQVLYH 1LQHW\ ILYH SHUFHQW RI DOO K\SHUWHQVLRQ KDV QR LGHQWLILDEOH FDXVH DQG LV WHUPHG HVVHQWLDO RU SULPDU\ K\SHUWHQVLRQ +\SHUWHQVLRQ WKDW UHVXOWV IURP RWKHU NQRZQ GLVHDVHV LV WHUPHG VHFRQGDU\ K\SHUWHQVLRQ 7KH PRVW FRPPRQ FDXVH RI VHFRQGDU\ K\SHUWHQVLRQ LV UHQRYDVFXODU GLVHDVH VXFK DV DFXWH DQG FKURQLF JORPHUXORQHSKULWLV &XVKLQJnV GLVHDVH SULPDU\ DOGRVWHURQLVP SKHRFKURPRF\WRPD DQG FRDUFWDWLRQ RI WKH

PAGE 13

DRUWD DUH RWKHU FDXVHV RI VHFRQGDU\ K\SHUWHQVLRQ>@ %ORRG SUHVVXUH KRPHRVWDVLV LV PDLQWDLQHG E\ WKH SXPSLQJ DFWLRQ RI WKH KHDUW FDUGLDF RXWSXWf WKH YROXPH RI WKH YDVFXODU V\VWHP DQG WKH WRQH RI WKH SHULSKHUDO YDVFXODWXUH SHULSKHUDO UHVLVWDQFHf %ORRG SUHVVXUH LV GHWHUPLQHG E\ WKH SURGXFW RI FDUGLDF RXWSXW DQG SHULSKHUDO UHVLVWDQFH>@ 7KUHH PDMRU PHFKDQLVPV DUH UHVSRQVLEOH IRU QRUPDO EORRG SUHVVXUH UHJXODWLRQ WKH IDVW QHXUDO EDURUHFHSWRU IHHGEDFN PHFKDQLVP WKH VORZHU HQGRFULQH UHQLQDQJLRWHQVLQ DOGRVWHURQH V\VWHP DQG WKH UHQDO UHJXODWLRQ RI ZDWHU DQG VRGLXP KRPHRVWDVLV>@,Q WKH SDWKRSK\VLRORJLFDO K\SHUWHQVLYH FRQGLWLRQ FDUGLDF RXWSXW DQG SHULSKHUDO UHVLVWDQFH GHYLDWH IURP WKH QRUPDO UDQJH YLD WKH LQWHUDFWLRQ RI D FRPSOH[ VHULHV RI IDFWRUV 0HFKDQLVPV FXUUHQWO\ EHLQJ LQYHVWLJDWHG LQFOXGH SUHVVRU DQG GHSUHVVRU IDFWRUV RI UHQDO RULJLQ QHXURJHQLF UHJXODWLRQ FLUFXODWLQJ KXPRUDO IDFWRUV YHVVHO ZDOO K\SHUWURSK\ DQG PHPEUDQH WUDQVSRUW DEQRUPDOLW\>@ 7KH LQWHUGHSHQGHQFH RI GLIIHUHQW V\VWHPV RQ K\SHUWHQVLRQ LV GHVFULEHG LQ )LJXUH >@ $V VKRZQ LQFUHDVHG FDUGLDF RXWSXW FDQ UHVXOW IURP LQFUHDVHG FDUGLDF FRQWUDFWLOLW\ RU LQFUHDVHG IOXLG YROXPH ,QFUHDVHG IOXLG YROXPH PDLQO\ UHVXOWV IURP D UHQDO GHIHFW VXFK DV GHFUHDVHG UHQDO ILOWUDWLRQ ZKLFK OHDGV WR LQFUHDVHG UHQDO VRGLXP UHWHQWLRQ ,QFUHDVHG FDUGLDF FRQWUDFWLOLW\ LV PRVWO\ D GLUHFW FRQVHn TXHQFH RI RYHUDFWLYLW\ RI WKH V\PSDWKHWLF QHUYRXV V\VWHP ,QFUHDVHG SHULSKHUDO UHVLVWDQFH PD\ UHVXOW IURP IXQFWLRQDO

PAGE 14

‘$XWRUHJXODWLRQ %ORRG 3UHVVXUH &DUGLDF 2XWSXW +\SHUWHQVLRQ ,QFUHDVHG &2 W3UHORL W &RQWUDFWLOLW\ W)OXLG 9ROXPH 9ROXPH 5HGLVWULEXWLRQ 5HQDO 6RGLXP 5HWHQWLRQ ([FHVV 6RGLXP LQWDNH 'HFUHDVHG ILOWUDWLRQ VXUIDFH $ A 1GHQHWLF $OWHUDWLRQ 6\PSDWKHWLF QHUYRXV 2YHUDFWLYLW\ $ 6WUHVV [ 3HULSKHUDO 5HVLVWDQFH DQGRU ,QFUHDVHG 35 $ )XQFWLRQDO &RQVWULFWLRQ 6WUXFWXUDO +\SHUWURSK\ $ 5HQLQ &HOO +\SHU $QJLRWHQVLQ PHPEUDQH LQVXOLQHPM ([FHVV *HQHWLF $OWHUDWLRQ (QGRWKHOLXP 'HULYHG IDFWRUV )LJXUH )DFWRUV LQYROYHG LQ WKH FRQWURO RI EORRG SUHVVXUH WKDW DIIHFW WKH EDVLF HTXDWLRQ EORRG SUHVVXUH FDUGLDF RXWSXW [ SHULSKHUDO UHVLVWDQFH DGDSWHG IURP UHIHUHQFH f FRQVWULFWLRQ DQG VWUXFWXUDO K\SHUWURSK\ RI EORRG YHVVHOV $PRQJ WKHVH IDFWRUV UHQLQ DQJLRWHQVLQ V\VWHP RYHUDFWLYLW\ PD\ OHDG WR DQ LQFUHDVH LQ ERWK FDUGLDF RXWSXW DQG SHULSKHUDO UHVLVWDQFH $PRQJ WKH GLIIHUHQW LQLWLDWLQJ IDFWRUV RI HVVHQWLDO K\SHUWHQVLRQ WKH SULPDF\ RI WKH NLGQH\ LV VXSSRUWHG E\ QXPHURXV VWXGLHV>@ )RU H[DPSOH LQ H[SHULPHQWDO UHQDO WUDQVSODQWDWLRQ VWXGLHV ZLWK UDWV NLGQH\V IURP JHQHWLFDOO\ K\SHUWHQVLYH GRQRUV VXFK DV VSRQWDQHRXVO\ K\SHUWHQVLYH UDWV FRQVLVWHQWO\ HOLFLWHG K\SHUWHQVLRQ LQ JHQHWLFDOO\ QRUPRWHQVLYH UHFLSLHQWV $GGLWLRQDOO\ WKH UHPRYDO RI ERWK QDWLYH NLGQH\V DQG WUDQVSODQWDWLRQ RI UHQDO JUDIWV IURP

PAGE 15

JHQHWLFDOO\ QRUPRWHQVLYH GRQRUV UHVXOWHG LQ EORRG SUHVVXUH QRUPDOL]DWLRQ LQ JHQHWLFDOO\ K\SHUWHQVLYH UDWV VXJJHVWLQJ WKDW UHQDO PHFKDQLVPV SOD\ D PDMRU UROH LQ WKH SDWKRJHQHVLV RI K\SHUWHQVLRQ LQ WKHVH VWUDLQV >@ 5ROH RI WKH 5HQLQ $QJLRWHQVLQ 6\VWHP 5$6f LQ +\SHUWHQVLRQ 7KH UROH RI WKH UHQLQ DQJLRWHQVLQ V\VWHP 5$6f LQ WKH GHYHORSPHQW DQG PDLQWHQDQFH RI K\SHUWHQVLRQ LV ZHOO HVWDEOLVKHG 7KH 5$6 SOD\V D FULWLFDO UROH LQ WKH FRQWURO RI EORRG SUHVVXUH IOXLG DQG HOHWURO\WH KRPHRVWDVLV DQG UHQDO KHPRG\QDPLFV>@ 7KH SULPDU\ FRPSRQHQWV RI WKH 5$6 LQFOXGH Df DQJLRWHQVLQRJHQ D DPLQR DFLG SURWHLQ WKDW VHUYHV DV WKH VXEVWUDWH IRU Ef UHQLQ WKH HQ]\PH WKDW FDWDO\]HV WKH SURWHRO\WLF FRQYHUVLRQ RI DQJLRWHQVLQRJHQ WR WKH GHFDSHSWLGH DQJLRWHQVLQ Ff DQJLRWHQVLQ FRQYHUWLQJ HQ]\PH D GLSHSWLG\O FDUER[\SHSWLGDVH WKDW FRQYHUWV DQJLRWHQVLQ WR WKH RFWDSHSWLGH DQJLRWHQVLQ ,, Gf DQJLRWHQVLQ ,, LWVHOI DQG Hf WKH DQJLRWHQVLQ ,, UHFHSWRU ZKLFK LV UHVSRQVLEOH IRU WUDQVGXFLQJ WKH FHOOXODU HIIHFWV RI DQJLRWHQVLQ ,, )LJXUH f>L@ 7KH ELQGLQJ RI DQJLRWHQVLQ ,, WR LWV UHFHSWRU PHGLDWHV YDULRXV SK\VLRORJLFDO UHVSRQVHV VXFK DV YDVRFRQVWULFWLRQ FHOO SUROLIHUDWLRQ DOGRVWHURQH DQG YDVRSUHVVLQ UHOHDVH DQG GLSVRJHQHVLV >@ +LVWRULn FDOO\ WKLV KRUPRQDO V\VWHP KDV EHHQ YLHZHG DV DQ HQGRFULQH V\VWHP 7KH YDULRXV FRPSRQHQWV RI WKLV FDVFDGH EHLQJ GHULYHG IURP GLIIHUHQW RUJDQV ZKLFK DUH WKHQ GHOLYHUHG WR WKHLU VLWHV RI DFWLRQ E\ WKH FLUFXODWRU\ V\VWHP>@ +RZHYHU LQ

PAGE 16

0DFXOD GHQVD VLJQDO f5HQDO DUWHULDO SUHVVXUH` 5HQDO QHUYH DFWLYLW\ $QJLSWHQVLQRJHQ 5HQLQ 9 $QJLRWHQVLQ ? $QJLRWHQVLQ &RQYHUWLQJ (Q]\PH $QJLRWHQVLQ ,, _ , , $GUHQDO .LGQH\ ,QWHVWLQH &16 3HULSKHUDO 9DVFXODU +HDUW FRUWH[ QHUYRXV V\VWHP VPRRWK PXVFOH 9 $OGRVWHURQH 9 'LVWDO QHSKURQ $GUHQHUJLF IDFLOLWDWLRQ 9 6\PSDWKHWLF GLVFKDUJH 9 0 9 6RGLXP DQG ZDWHU 7KLUVW UHDEVRUSWLRQ VDOW DSSHWLWH 9 &RQWUDFWLOLW\ 9DVRSUHVVLQ UHOHDVH 9 9DVRFRQVWULFWLRQ UHDEVRUSWLRQ 9 < 0DLQWDLQ RU LQFUHDVH (&)9 9 7RWDO SHULSKHUDO UHVLVWDQFH 9 &DUGLDF RXWSXW )LJXUH 6FKHPDWLF UHSUHVHQWDWLRQ RI WKH UHQLQ DQJLRWHQVLQV\VWHP &16 FHQWUDO QHUYRXV V\VWHP (&)9 H[WUDFHOOXODU IOXLG YROXPH DGDSWHG IURP UHIHUHQFH f UHFHQW \HDUV WKHUH KDV EHHQ DQ LQFUHDVLQJ QXPEHU RI VWXGLHV WR VXJJHVW WKDW LQ DGGLWLRQ WR WKLV WUDGLWLRQDO KRUPRQDO 5$6 WKHUH LV D WLVVXH 5$6 ZKLFK SURGXFHV ,, IRU ORFDO QHHGV >@ 7KH HYLGHQFH IRU D IXQFWLRQDO WLVVXH 5$6 LV EDVHG RQ D QXPEHU RI ILQGLQJV Df WKH GHPRQVWUDWLRQ RI UHQLQn OLNH DFWLYLW\ LQ H[WUDUHQDO WLVVXHV VXFK DV EUDLQ KHDUW DGUHQDO DQG EORRG YHVVHOV VXJJHVWLQJ ORFDO V\QWKHVLV RI $QJLRWHQVLQ ,, Ef FKURQLF WUHDWPHQW ZLWK DQJLRWHQVLQ FRQYHUWLQJ HQ]\PH LQKLELWRUV IDLOV WR FRUUHODWH ZLWK SUHWUHDWPHQW SODVPD UHQLQ DFWLYLW\ EXW GRHV FRUUHODWH ZLWK VXVWDLQHG LQKLELWLRQ RI FRQYHUWLQJ HQ]\PH DFWLYLW\ LQ WKH NLGQH\ Ff OLJDQG ELQGLQJ VWXGLHV UHYHDO WKDW DQJLRWHQVLQ

PAGE 17

UHFHSWRUV DUH SUHVHQW LQ YDULRXV WLVVXHV LQGLFDWLQJ WKDW DQJLRWHQVLQ H[HUWV RUJDQVSHFLILF HIIHFWV Gf H[SUHVVLRQ DQDO\VLV RI UHQLQ DQJLRWHQVLQRJHQ DQG FRQYHUWLQJ HQ]\PH VKRZ WKDW WKH\ DUH FRH[SUHVVHG LQ VHYHUDO WLVVXHV LQFOXGLQJ WKH NLGQH\V WKH EUDLQ WKH DQWHULRU SLWXLWDU\ JODQG WKH RYDULHV WKH DGUHQDO FRUWH[ YDVFXODU VPRRWK PXVFOH DQG WKH KHDUW 7KLV REVHUYDWLRQ SURYLGHV WKH EDVLV IRU GH QRYR V\QWKHVLV RI DQJLRWHQVLQ ,, >@ 7KH H[LVWHQFH RI D ORFDO 5$6 DOVR ZDV VXSSRUWHG E\ TXDQWLWDWLYH VWXGLHV )RU H[DPSOH DQJLRWHQVLQ ,, WKH DFWLYH SHSWLGH KDV EHHQ VKRZQ WR KDYH DQ DIILQLW\ IRU LWV UHFHSWRU LQ WKH QDQRPROD[ UDQJH EXW FLUFXODWHV DW SODVPD OHYHOV LQ WKH SLFRPRODU UDQJH 7KLV VXJJHVWV D ORFDO DQJLRWHQVLQ ,,FRQFHQWUDWLQJ SURFHVV LQ WKH YLFLQLW\ RI LWV UHFHSWRU DQG WKDW SODVPD DQJLRWHQVLQ ,, LV QRW HQWLUHO\ UHVSRQVLEOH IRU WKH HIIHFWV RI WKH V\VWHP>@ 7KH SUHVHQFH RI D WLVVXH 5$6 KDV EHHQ LQWHUSUHWHG LQ SDUDFULQHDXWRFULQH YV HQGRFULQH PRGHOV >@ ZKLFK VXJJHVWV WKDW FLUFXODWLQJ HQGRFULQH DQJLRWHQVLQ ,, SDUWLFLn SDWHV LQ VKRUWWHUP PHFKDQLVP RI EORRG SUHVVXUH DQG ERG\ IOXLG FRQWURO VXFK DV LQ WKH FDVH RI KHPRUUKDJH DQG DJJUHVVLYH GLXUHWLF WUHDWPHQW :KLOH ORFDO SDUDFULQH DXWRFULQH DQJLRWHQVLQ ,, V\VWHPV SDUWLFLSDWH PRUH LQ ORQJ WHUP UHJXODWLRQ DQG LQ DQJLRWHQVLQ ,, GHSHQGHQW VWUXFWXUDO FKDQJHV WKH UROH RI DQJLRWHQVLQ ,, DV D PLWRJHQLF SUROLn IHUDWLYH IDFWRU ZKLFK FRQWULEXWHV WR YDVFXODU DQG FDUGLDF K\SHUWURSK\ LV PHGLDWHG LQ D SDUDFULQH PDQQHU 7KH WLVVXH 5$6 PD\ DOVR VHUYH DV D PHFKDQLVP WR FRPSOLPHQW RU LQWHUDFW

PAGE 18

ZLWK WKH KRUPRQDO 5$6>@ 5HQLQ 5HQLQ DQ DVSDUW\O SURWHDVH UHVSRQVLEOH IRU WKH ILUVW VWHS LQ WKH IRUPDWLRQ RI DQJLRWHQVLQ ,, LV KLJKO\ VSHFLILF IRU LWV VXEVWUDWH DQJLRWHQVLQRJHQ 7KH PDLQ VRXUFH RI UHQLQ LV WKH MX[WDJORPHUXODU FHOOV RI WKH DIIHUHQW DUWHULROHV RI WKH NLGQH\ 5HQLQ OHYHOV DUH FRQWUROOHG DW VHYHUDO VWDJHV LQFOXGLQJ WKH OHYHO RI JHQH H[SUHVVLRQ UDWHV RI LQWUDn FHOOXODU V\QWKHVLVSURFHVVLQJ DQG WKH UDWH RI VHFUHWLRQ >@ 7UDQVODWLRQ RI UHQLQ P51$ \LHOGV SUHSURUHQLQ ZKLFK WKHQ XQGHUJRHV FRWUDQVODWLRQDO UHPRYDO RI D VLQJOH SHSWLGH DQG JO\FRV\ODWLRQ GXULQJ WUDQVSRUW WKURXJK WKH URXJK HQGRn SODVPLF UHWLFXOXP WR EHFRPH SURUHQLQ 3URUHQLQ FDQ HLWKHU EH FRQVWLWXLYHO\ VHFUHWHG IURP WKH *ROJL DSSDUDWXV RU SDFNDJHG LQ LPPDWXUH JUDQXOHV DQG VHFUHWHG LQ D UHJXODWHG IDVKLRQ $OWKRXJK SURUHQLQ LV WKH PDMRU FLUFXODWLQJ IRUP RI UHQLQ WKH SULPDU\ VLWH RI FRQYHUVLRQ RI SODVPD SURUHQLQ WR UHQLQ VWLOO UHPDLQV XQFOHDU 3URUHQLQ DFWLYDWLQJ HQ]\PHV KDYH EHHQ IRXQG LQ WKH NLGQH\ DV ZHOO DV LQ HQGRWKHOLDO FHOOV DQG QHXWURSKLOV ,Q WUDQVJHQLF PLFH H[SUHVVLQJ WKH KXPDQ UHQLQ JHQH UHQLQ P51$ H[SUHVVLRQ ZDV IRXQG WR EH KLJK LQ WKH NLGQH\ DGUHQDO RYDU\ WHVWLV OXQJ DQG DGLSRVH WLVVXH DQG ORZ LQ WKH KHDUW DQG VXEPDQGLEXODU JODQG>@ ([SUHVVLRQ RI UHQLQ P51$ LQ YDULRXV WLVVXHV DSSHDUV WR EH GLIIHUHQWLDOO\ UHJXODWHG 6RGLXP GHSOHWLRQ RU SDGUHQHUJLF UHFHSWRU DFWLYDWLRQ LQFUHDVHV UHQLQ H[SUHVVLRQ LQ WKH

PAGE 19

NLGQH\ KHDUW DQG DGUHQDO EXW QRW LQ WKH VXEPDQGLEXODU RU JHQLWDO JODQGV $QGURJHQV DQG HVWURJHQV LQFUHDVH H[WUDUHQDO WLVVXH UHQLQ P51$ OHYHOV EXW QRW UHQDO P51$ 5HQDO UHQLQ H[SUHVVLRQ KDV DOVR EHHQ VKRZQ WR EH UHJXODWHG E\ DOWHUDWLRQV LQ WKH OHYHO RI DQJLRWHQVLQ ,, YLD D QHJDWLYH IHHGEDFN PHFKDQLVP 7UHDWPHQW RI WUDQVJHQLF PLFH EHDULQJ WKH KXPDQ UHQLQ JHQH ZLWK WKH FRQYHUWLQJ HQ]\PH LQKLELWRU FDSWRSULO UHVXOWHG LQ D IROG LQFUHDVH LQ UHQLQ H[SUHVVLRQ LQ WKH NLGQH\>@ 6LPLODUO\ HQDODSULO WUHDWPHQW RI UDWV LQFUHDVHG UHQDO UHQLQ P51$ H[SUHVVLRQ ZKLFK FRXOG EH UHYHUVHG E\ LQIXVLRQ RI DQJLRWHQVLQ ,,>@ )XUWKHU UHJXODWLRQ RI UHQLQ OHYHOV RFFXUV E\ FRQWURO RI WKH V\QWKHVLV DQG VHFUHWLRQ RI SURUHQLQ VXFK DV E\ F$03 DQGRU WKH FRQYHUVLRQ RI SURUHQLQ WR UHQLQ>@ $QJLRWHQVLQ&RQYHUWLQJ(Q]\PH $&(f $QJLRWHQVLQ&RQYHUWLQJ(Q]\PH $&(f LV DQ HQGRWKHOLXP ERXQG GLSHSWLG\O FDUER[\SHSWLGDVH WKDW FRQYHUWV DQJLRWHQVLQ WR WKH SRWHQW YDVRFRQVWULFWRU DQJLRWHQVLQ ,, DQG DOVR LQDFWLYDWHV WKH YDVRGLODWRU EUDG\NLQLQ>@ $&( KDV EHHQ IRXQG WR EH SUHVHQW LQ QHDUO\ DOO PDPPDOLDQ WLVVXHV DQG ERG\ IOXLGV 7KH KLJKHVW OHYHOV RI $&( DFWLYLW\ LQ KXPDQV KDYH EHHQ IRXQG LQ WKH OXQJ NLGQH\ LOHXP GXRGHQXP DQG XWHUXV ZLWK ORZHU OHYHOV LQ WKH SURVWDWH MHMXQXP WHVWLV DQG DGUHQDOV>@ /LWWOH LV NQRZQ DERXW WKH UHJXODWLRQ RI $&( P51$ H[SUHVVLRQ $&( FDQ EH LQGXFHG E\ FRUWLFRVWHURLGV LQ FXOWXUHG HQGRWKHOLDO FHOOV DQG DOYHRODU PDFURSKDJHV>@

PAGE 20

+\SHUWK\URLGLVP WHQGV WR HOHYDWH OHYHOV RI FLUFXODWLQJ $&( $QJL4WHQVLQ ,, DQG $QJLRWHQVLQ ,,5HFHSWRUV 7KH RFWDSHSWLGH DQJLRWHQVLQ ,, LV WKH PDLQ HIIHFWRU RI WKH 5$6 &HUWDLQ SHSWLGH IUDJPHQWV SDUWLFXODUO\ $QJLRWHQVLQ f DQG SRVVLEO\ $QJOf DQG $QJf DOVR KDYH ELRORJLFDO DFWLYLW\>@ $QJLRWHQVLQ ,, LWVHOI KDV SURIRXQG HIIHFWV RQ FDUGLRYDVFXODU IXQFWLRQ ,WV PXOWLSOH ELRORJLFDO DFWLRQV LQ YDULRXV WDUJHW WLVVXHV LQFOXGH WKH IROORZLQJ HIIHFWV LQGXFWLRQ RI YDVRFRQVWULFWLRQ DQG D VXEVHTXHQW LQFUHDVH LQ SHULSKHUDO YDVFXODU UHVLVWDQFH DQG DUWHULDO EORRG SUHVVXUH VWLPXODWLRQ RI DOGRVWHURQH UHOHDVH IURP WKH ]RQD JORPHUXORVD FHOOV RI WKH DGUHQDO FRUWH[ VWLPXODWLRQ RI VRGLXP DQG IOXLG UHDEVRUSWLRQ IURP WKH SUR[LPDO WXEXOHV RI WKH NLGQH\ LQGXFWLRQ RI WKLUVW DQG VRGLXP DSSHWLWH IDFLOLWDWLRQ RI QRUHSLQHSKULQH UHOHDVH IURP WKH QRUDGUHQHUJLF QHUYH HQGLQJV DQG VWLPXODWLRQ RI FHOOXODU JURZWK LQ YDVFXODU DQG QRQYDVFXODU VPRRWK PXVFOH DQG UHQDO SUR[LPDO WXEXODU HSLWKHOLXP )LJXUH f>@ %ORFNLQJ $QJ ,, SURGXFWLRQ ZLOO UHYHUVH WKHVH HIIHFWV OHDGLQJ WR UHQDO YDVRGLODWLRQ DQG DQ LQFUHDVH LQ JORPHUXODU ILOWUDWLRQ UDWH DQG VRGLXP H[FUHWLRQ 7KH HIIHFWV RI DQJLRWHQVLQ ,, DUH PRGXODWHG E\ DQ LQWHUDFWLRQ ZLWK LWV UHFHSWRUV ZKLFK DUH SUHVHQW LQ GLIIHUHQW WLVVXHV 7ZR VXEW\SHV RI DQJLRWHQVLQ ,, UHFHSWRUV DUH LGHQWLILHG EDVHG RQ WKHLU GLIIHUHQWLDO DIILQLWLHV IRU QRQSHSWLGH GUXJV>@ 7KH DQJLRWHQVLQ ,, W\SH $7,f

PAGE 21

UHFHSWRUV KDYH D KLJK DIILQLW\ IRU ORVDUWDQ ZKHUHDV $7 UHFHSWRUV KDYH D KLJK DIILQLW\ IRU 3' 7KH $7, VXEW\SH LV WKH FODVVLFDO DQJLRWHQVLQ ,, UHFHSWRU ZKLFK PHGLDWHV WKH ZHOO NQRZQ HIIHFWV RI WKLV SHSWLGH>@ 7KH $7, UHFHSWRU P51$ KDV EHHQ GHWHFWHG LQ YDVFXODU VPRRWK PXVFOH FHOOV NLGQH\ DGUHQDO OLYHU KHDUW DRUWD OXQJ VSOHHQ XWHUXV RYDU\ DQG VSHFLILF UHJLRQV RI WKH EUDLQ 7KH $7 UHFHSWRU LV H[SUHVVHG LQ WKH UDW DGUHQDO PHGXOOD WKH LQIHULRU ROLYH RI WKH EUDLQ DQG LQ WKH IHWXV>@ 7KH H[SUHVVLRQ RI DQJLRWHQVLQ ,, UHFHSWRUV LV LQIOXHQFHG E\ FLUFXODWLQJ DQJLRWHQVLQ ,, OHYHOV GLHWDU\ VRGLXP LQWDNH DQG KRUPRQDO IDFWRUV $QJLRWHQVLQ ,, KDV EHHQ VKRZQ WR UHGXFH $7, UHFHSWRU P51$ H[SUHVVLRQ E\ b DIWHU KRXUV LQ FXOWXUHG YDVFXODU VPRRWK PXVFOH FHOOV>@ /RZ VRGLXP LQWDNH GRZQ UHJXODWHV DQJLRWHQVLQ ,, UHFHSWRUV ZKLOH KLJK VRGLXP LQWDNH XSUHJXODWHV WKH UHFHSWRUV>@ *OXFRFRUWLFRLGV HVWURJHQ DQG LQVXOLQ KDYH DOVR EHHQ VKRZQ WR PRGXODWH $QJ ,, UHFHSWRUV>@ 7KH $7, UHFHSWRU LV D PHPEHU RI WKH VXSHUIDPLL\ RI SURWHLQFRXSOHG UHFHSWRUV WKDW KDYH VHYHQ WUDQVPHPEUDQH UHJLRQV>@ 7KH VLJQDO WUDQVGXFWLRQ SDWKZD\ LV LQLWLDWHG E\ WKH ELQGLQJ RI DQJLRWHQVLQ ,, ZLWK LWV UHFHSWRU ZKLFK WKHQ DFWLYDWHV SKRVSKROLSDVH &PHGLDWHG EUHDNGRZQ RI WKH PHPEUDQH SKRVSKDWLG\OLQRVLWRO ELSKRVSKDWH 3,3f WR JHQHUDWH LQRVLWRO WULSKRVSKDWH,3f DQG GLDF\OJO\FHURO'*f ,3 LV UHOHDVHG LQWR WKH F\WRVRO DQG EULQJV DERXW WKH PRELOL]DWLRQ RI LQWUD

PAGE 22

FHOOXODU FDOFLXP '* LV UHWDLQHG LQ WKH FHOO PHPEUDQH ZKHUH LW DFWLYDWHV D SURWHLQ NLQDVH & WKDW LV OLQNHG WR DQ (IIHFW RI JURZWK IDFWRU RQ FHOO )LJXUH 6LJQDO WUDQVGXFWLRQ RI DJLRWHQVLQ ,, UHFHSWRU W\SH 3,3USKRVSKDWLG\OLQRVLWRO ELSKRVSKDWH ,3 ,QRVLWRO WULSKRVSKDWH '*GLDF\OJO\FHURODGDSWHG IURP UHIHUHQFH f DPLORULGHVHQVLWLYH 1D+ H[FKDQJHU UHVXOWLQJ LQ DQ LQFUHDVH LQ LQWUDFHOOXODU S+ DQG WKH SURPRWLRQ RI JURZWK DQG SURWHLQ V\QWKHVLV )LJXUH f >@ 7KH IXQFWLRQ RI $7 UHFHSWRUV LV OHVV ZHOO NQRZQ WKDQ WKDW RI $7, $7 UHFHSWRUV DUH PRUH DEXQGDQW LQ HPEU\RQLF DQG QHRQDWDO WLVVXHV WKDQ LQ DGXOWV VXJJHVWLQJ D UROH LQ GHYHORSPHQW 7KH VLJQDOLQJ WUDQVGXFWLRQ SDWKZD\ RI WKH $7 UHFHSWRU LV PXFK OHVV HOXFLGDWHG DQG LW GRHV QRW DSSHDU WR EH *SURWHLQOLQNHG>@ $QJLRWHQVLQRJHQ $QJLRWHQVLQRJHQ$*7f D DPLQR DFLG JO\FRSURWHLQ LV WKH SUHFXUVRU RI WKH 5$6 DQG WKH PDMRU VXEVWUDWH RI UHQLQ $QJLRWHQVLQ LV SURGXFHG E\ UHQLQ FOHDYDJH RI D OHXFLQH

PAGE 23

YDOLQH ERQG RI WKH 1WHUPLQDO UHJLRQ LQ WKH KXPDQ DQJLRWHQVLQRJHQ RU D OHXFLQHOHXFLQH ERQG LQ WKH DQJLR WHQVLQRJHQV RI RWKHU VSHFLHV >@ 7KH PDMRULW\ RI FLUFXODWLQJ DQJLRWHQVLQRJHQ LV PRVW OLNHO\ GHULYHG IURP WKH OLYHU LQ SDUWLFXODU WKH SHULFHQWUDO ]RQH RI WKH OLYHU OREXOHV $GLSRF\WHV DQG DVWURF\WHV DOVR SURGXFH VPDOO DPRXQWV RI $*7 8QOLNH UHQLQ ZKRVH VHFUHWLRQ LV KLJKO\ UHJXODWHG QHZO\ V\QWKHVL]HG $*7 LV UHOHDVHG LQWR WKH EORRG VWUHDP LQ D FRQVWLWXWLYH PDQQHU>@ 7KH SODVPD VHUYHV DV WKH PDMRU UHVHUYRLU RI WKLV SURWHLQ DQG SODVPD DQG FHUHEURVSLQDO IOXLG FRQFHQWUDWLRQV DUH DSSUR[LPDWHO\ S0 DQG _BL0 UHVSHFWLYHO\ > @ $W WKH PROHFXODU OHYHO JOXFRn FRUWLFRLG HVWURJHQ DQG WK\URLG KRUPRQHV LQFUHDVH DQJLRn WHQVLQRJHQ P51$ LQ UDW KHSDWRF\WHV>@ 7UDQVFULSWLRQDO DFWLYLW\ RI WKH $*7 JHQH LV KLJKO\ GHSHQGHQW RQ WKH XSVWUHDP HQG RI WKH WUDQVFULSWLRQDO LQLWLDWLRQ VLWHf FLVDFWLQJ '1$ ZKLFK UHVSRQGV WR WKHVH KRUPRQHV DQG F\WRNLQHV )LJXUH f>@ 7KLV UHJLRQ DOVR FRQWDLQV DQ HQKDQFHU HOHPHQW DQG FRQIHUV WLVVXH VSHFLILFLW\ RQ $*7 JHQH H[SUHVVLRQ $*7 P51$ KDV EHHQ IRXQG WR EH DEXQGDQW LQ OLYHU IDW DQG EUDLQ FHOOV DQG KDV EHHQ GHWHFWHG LQ VPDOO DPRXQWV LQ WKH OXQJ NLGQH\ RYDU\ DGUHQDO JODQG KHDUW VSLQDO FRUG DQG WHVWHV ,QGLYLGXDO $*7 VHFUHWLQJ WLVVXHV PD\ KDYH KLJKHU OHYHOV RI $*7 WKDQ WKRVH WKDW UHFHLYH WKLV SURWHLQ RQO\ IURP FLUFXODWLRQ>@ 7KH 5ROH RI $*7 LQ +\SHUWHQVLRQ

PAGE 24

6HYHUDO REVHUYDWLRQV SRLQW WR WKH UHODWLRQVKLS EHWZHHQ $*7 DQG EORRG SUHVVXUH>@ &OLQLFDO VWXGLHV KDYH IRXQG VWDWLVWLFDOO\ VLJQLILFDQW FRUUHODWLRQV EHWZHHQ SODVPD &RQn FHQWUDWLRQV RI $*7 DQG EORRG SUHVVXUH LQ KXPDQ VXEMHFWV U Sf KLJKHU SODVPD FRQFHQWUDWLRQV RI $*7 KDYH ++E Ef§W 9 +,f§, *U *" 9 &$7 B 7$7$ VY $1*,27(16,12*(1 +XPDQf )LJXUH 6FKHPDWLF UHSUHVHQWDWLRQ RI n IODQNLQJ UHJLRQV RI WKH $*7 JHQH *5( JOXFRFRUWLFRLG UHVSRQVH HOHPHQW (5( HVWURJHQ UHVSRQVH HOHPHQW 75( WK\URLG KRUPRQH UHVSRQVH HOHPHQW $35( DFXWHSKDVH UHVSRQVH HOHPHQW (1+ HQKDQFHU UHJLRQ 3$/ SDOLQGURPLF VHTXHQFHDGDSWHG IURP UHIHUHQFH f EHHQ IRXQG LQ K\SHUWHQVLYH VXEMHFWV DQG LQ WKH RIIVSULQJ RI K\SHUWHQVLYH SDUHQWV FRPSDUHG ZLWK QRUPRWHQVLYHV >@ $ JHQHWLF OLQNDJH EHWZHHQ PROHFXODU YDULDQWV RI $*7 VXFK DV 70 07 DQG HVVHQWLDO K\SHUWHQVLRQ ZHUH DOVR REVHUYHG >@ 7KH 6+5 PRGHO RI HVVHQWLDO K\SHUWHQVLRQ DUH IRXQG WR KDYH D KLJKHU SODVPD $*7 OHYHOV WKDQ QRUPRWHQVLYH :LVWDU .\RWR UDWV DW ZHHNV RI DJH>@ %ORRG SUHVVXUH DOVR FDQ EH GHFUHDVHG DIWHU DGPLQLVWUDWLRQ RI $*7 DQWLERGLHV DQG LQFUHDVHG LQ WUDQVJHQLF DQLPDOV RYHUH[SUHVVLQJ $*7>@ 'HVSLWH WKLV HYLGHQFH WKH UROH RI $*7 LQ K\SHUWHQVLRQ LV VWLOO GHEDWDEOH 0RVW DUJXPHQWV DUH EDVHG RQ WKH H[WUDn FHOOXODU QDWXUH RI $*7 WKDW PDNHV LW D PDMRU UHVHUYRLU IRU

PAGE 25

WKH DFWLRQ RI UHQLQ ,W LV JHQHUDOO\ FRQVLGHUHG WKDW VPDOO FKDQJHV LQ $*7 FRQFHQWUDWLRQ ZRXOG QRW DIIHFW WKH FRQFHQn WUDWLRQ RI IXQFWLRQLQJ DQJLRWHQVLQ ,, WKXV DQ H[FOXVLYHO\ $*7GHSHQGHQW K\SHUWHQVLRQ LV WKHRUHWLFDOO\ GLIILFXOW WR LPDJLQH>@ +RZHYHU EDVHG RQ HQ]\PH NLQHWLF VWXGLHV SODVPD $*7 FRQFHQWUDWLRQV LQ WKH UDW DQG KXPDQ DUH DERXW _PRO/ 7R UHDFK D ]HURRUGHU HQ]\PDWLF UHDFWLRQ WHQ WLPHV PRUH $*7 WKDQ QDWXUDOO\ SUHVHQW LV UHTXLUHG>@ 7KLV VXJJHVWV WKDW WKH ODUJH DPRXQW RI $*7 SUHVHQW LQ SODVPD GRHV QRW SURYLGH DQ H[FHVV RI VXEVWUDWH IRU UHQLQ DQG D ULVH RU IDOO LQ UHQLQ VXEVWUDWH FDQ OHDG WR D SDUDOOHO FKDQJH LQ WKH IRUPDWLRQ RI DQJLRWHQVLQ ,, )HHGEDFN ,QWHUDFWLRQV ,QYROYHG LQ 5$6 7KH IHHGEDFN LQWHUDFWLRQV RI GLIIHUHQW FRPSRQHQWV RI WKH 5$6 KDYH EHHQ LQYHVWLJDWHG>@ %\ XVLQJ H[SHULPHQWDO VWUDWHJLHV VXFK DV WUDQVJHQLF DQLPDOV DQWLVHQVH WHFKQRORJ\ RU E\ VXUJLFDO DEODWLRQ RI RUJDQV LQYROYHG LQ EORRG SUHVVXUH UHJXODWLRQ LW KDV EHHQ SRVVLEOH WR GLVVHFW WKH PXOWLSOH FRPSRQHQWV WKDW XQGHUOLH SULPDU\ K\SHUWHQVLRQ>@ %\ XVLQJ JHQH WDUJHWLQJ YLD KRPRORJRXV UHFRPELQDWLRQ RQH FDQ DEROLVK RU NQRFN RXW D GHILQHG JHQHWLF ORFXV RU PXWDWH D SDUWLFXODU VHW RI QXFOHRWLGHV WKDW HQFRGHV D SHSWLGH GRPDLQ RI LQWHUHVW>@ 7KLV WHFKQLTXH KDV EHHQ XVHG WR GHILQH WKH H[DFW UROH RI JHQHV WKDW XQGHUOLH QRUPDO FDUGLRYDVFXODU IXQFWLRQ 7DQLPRWR HW DO>@ JHQHUDWHG DQJLRWHQVLQRJHQ GHILFLHQW PLFH E\ KRPRORJRXV UHFRPELQDWLRQ LQ PRXVH

PAGE 26

HPEU\RQLF VWHP FHOOV 7KHVH PLFH GR QRW SURGXFH KHSDWLF DQJLRWHQVLQRJHQ UHVXOWLQJ LQ D FRPSOHWH ORVV RI SODVPD LPPXQRDFWLYH DQJLRWHQVLQ 7KH V\VWROLF EORRG SUHVVXUH RI WKH KRPR]\JRXV PXWDQW PLFH ZDV s PP+J ZKLFK ZDV VLJQLILFDQWO\ ORZHU WKDQ WKDW RI WKH ZLOGW\SH PLFH s PP+Jf 7KLV SURIRXQG K\SRWHQVLRQ LQ DQJLRWHQVLQRJHQ GHILFLHQW UDWV GHPRQVWUDWHV DQ LQGLVSHQVDEOH UROH IRU WKH 5$6 LQ PDLQWDLQLQJ EORRG SUHVVXUH ,Q FRQWUDVW 5LPXUD HW DO>@ JHQHUDWHG WUDQVJHQLF PLFH E\ LQMHFWLQJ WKH HQWLUH UDW DQJLRWHQVLQRJHQ JHQH LQWR WKH JHUPOLQH RI PLFH 7KH WUDQVJHQLF OLQH GHYHORSHG K\SHUWHQVLRQ DQG ERWK WRWDO SODVPD DQJLRWHQVLQRJHQ DQG DQJLRWHQVLQ ,, FRQFHQWUDWLRQ ZHUH WKUHH IROG KLJKHU WKDQ LQ WKH FRQWURO ,Q VLWX K\EULGL]DWLRQ VKRZHG KLJKHU P51$ LQ WKH OLYHU DQG WKH EUDLQ RI WKHVH WUDQVJHQLF DQLPDOV )XNDPL]X HW DO >@ FRQVWUXFWHG WKH FKLPHULF UHQLQ DQJLRWHQVLQ FDVFDGH LQ PLFH FRPSULVLQJ ERWK KXPDQ UHQLQ DQG DQJLRWHQVLQRJHQ DV ZHOO DV WKH HQGRJHQRXV DQJLRWHQVLQ FRQYHUWLQJ HQ]\PH DQG DQJLRWHQVLQ ,, UHFHSWRU E\ FURVVn PDWLQJ VHSDUDWH OLQHV RI WUDQVJHQLF PLFH FDUU\LQJ HLWKHU WKH KXPDQ DQJLRWHQVLQRJHQ RU KXPDQ UHQLQ JHQH 1HLWKHU VLQJOH JHQH FDUULHU GHYHORSHG K\SHUWHQVLRQ GHVSLWH WKH REVHUYHG QRUPDO WLVVXHVSHFLILF H[SUHVVLRQ RI WKH WUDQVJHQHV 'XDO JHQH VWUDLQV H[KLELWHG D FKURQLFDOO\ VXVWDLQHG LQFUHDVH LQ EORRG SUHVVXUH $GPLQLVWUDWLRQ RI D KXPDQ UHQLQVSHFLILF LQKLELWRU (6f HIIHFWLYHO\ UHGXFHG WKH HOHYDWHG EORRG SUHVVXUH RQO\ LQ WKH FURVVPDWHG K\EULG PLFH EXW WUHDWPHQW

PAGE 27

ZLWK WKH DQJLRWHQVLQ FRQYHUWLQJ HQ]\PH LQKLELWRU FDSWRSULO DQG D VHOHFWLYH DQWDJRQLVW 'X3f GLUHFWHG DW WKH DQJLRWHQVLQ ,, UHFHSWRU GHFUHDVHG WKH EDVDO OHYHO RI EORRG SUHVVXUH LQ WKH VLQJOH JHQH FDUULHUV DV ZHOO DV LQ WKH GXDO JHQH PLFH>@ 7KHVH UHVXOWV GHPRQVWUDWHG WKDW WKH VXVWDLQHG LQFUHDVH LQ EORRG SUHVVXUH RI WKH K\EULG ZDV LQLWLDWHG E\ DQ LQWHUDFWLRQ EHWZHHQ WKH SURGXFWV RI WKH WZR KXPDQ JHQHV 6FKXQNHUW HW DO>@ LQYHVWLJDWHG WKH IHHGEDFN UHJXODn WLRQ RI 5$6 E\ VWXG\LQJ WKH HIIHFW RI DQJLRWHQVLQ ,, RQ WKH UHJXODWLRQ RI $&( JHQH H[SUHVVLRQ DQG HQ]\PDWLF DFWLYLW\ $QJLRWHQVLQ ,, LQIXVLRQV LQFUHDVHG SODVPD $QJ ,, FRQFHQn WUDWLRQ DQG PHDQ DUWHULDO EORRG SUHVVXUH DQG GHFUHDVHG $&( P51$ OHYHOV LQ WKH OXQJ DQG WHVWLV WZR PDMRU VLWHV RI $&( V\QWKHVLV 7KHUH ZDV OHVV SURQRXQFHG EXW SDUDOOHO GHFUHDVHV LQ SXOPRQDU\ $&( DFWLYLW\ ZKLOH VHUXP DQG WHVWLFXODU $&( DFWLYLW\ GLVSOD\HG RQO\ PLQLPDO FKDQJHV 7KLV GDWD ZRXOG VXJJHVW WKDW SXOPRQDU\ $&( H[SUHVVLRQ LV VXEMHFW WR QHJDWLYH IHHGEDFN E\ DQJLRWHQVLQ ,, $QJLRWHQVLQ ,, LQIXVLRQ VXSSUHVVHG SODVPD UHQLQ FRQFHQWUDWLRQ NLGQH\ UHQLQ FRQFHQn WUDWLRQ DQG UHQDO UHQLQ P51$ OHYHOV LQ D GRVH GHSHQGHQW PDQQHU ,Q FRQWUDVW DQJLRWHQVLQ ,, LQIXVLRQ LQFUHDVHG UHQDO $*7 P51$ DQG DOVR LQFUHDVHG OLYHU $*7 P51$ OHYHOV DQG SODVPD $*7 FRQFHQWUDWLRQ 7KHVH GDWD VXJJHVW WKDW SODVPD DQJLRWHQn VLQ ,, XSUHJXODWHV UHQDO $*7 DQG GRZQUHJXODWHV UHQDO UHQLQ JHQH H[SUHVVLRQ D UHFLSURFDO IHHGEDFN UHJXODWLRQ ZKLFK PD\ KDYH LPSRUWDQW SK\VLRORJLFDO FRQVHTXHQFHV

PAGE 28

0RUHRYHU ']DX HW DO>@ IRXQG WKDW LQIXVLRQ RI DQJLRWHQVLQ ,, LQFUHDVHV WKH $*7 UHOHDVH UDWH ZKLOH LQIXVLRQ RI DQJLRWHQVLQ KDG QR HIIHFW 'LUHFW LQIXVLRQ RI UHQLQ LQ UDWV WUHDWHG ZLWK FDSWRSULO UHVXOWHG LQ D IXUWKHU VXSSUHVVLRQ RI WKH $*7 UHOHDVH UDWH VXJJHVWLQJ WKDW UHQLQ LQKLELWV $*7 UHOHDVH ZKHUHDV DQJLRWHQVLQ ,, VWLPXODWHV LW 7KH LQWHUDFWLRQ RI WKH 5$6 DOVR ZDV VWXGLHG E\ PHDQV RI QHSKUHFWRP\ FRPELQHG ZLWK DGUHQDOHFWRP\ +LOJHQIHOGW HW DO >@ VWXGLHG WKH FKDQJHV LQ $*7 DQJLRWHQVLQ DQG SODVPD UHQLQ FRQFHQWUDWLRQ DIWHU DEODWLRQ RI NLGQH\ DQG DGUHQDOV 3ODVPD $*7 OHYHOV ZHUH VKRZQ WR LQFUHDVH DSSUR[LPDWHO\ IROG DIWHU KRXUV LQ QHSKUHFWRPL]HG UDWV DQG SUHWUHDWPHQW ZLWK 3DGUHQRFHSWRU DWHQRORO EOXQWHG WKLV LQFUHDVH 7KH DQJLRWHQVLQ ,, UHFHSWRU DQWDJRQLVW 'XS DOVR DEROLVKHG WKH LQFUHDVH LQ $*7 DQG QHSKUHFWRP\ SOXV DGUHQDOHFWRP\ DOVR EOXQWHG WKH ULVH LQ SODVPD $*7 1HSKUHFWRP\ DORQH LQGXFHG D IROG LQFUHDVH RI $*7 P51$ LQ OLYHU DQG D IROG LQFUHDVH ZDV REVHUYHG ZLWK QHSKUHFWRP\ DQG DGUHQDOHFWRP\ 7KHVH UHVXOWV VXJJHVW WKDW WKH LQFUHDVH LQ SODVPD $*7 DIWHU QHSKUHFWRP\ EH HVVHQWLDOO\ PHGLDWHG E\ DQJLRWHQVLQ ,, YLD DQ XQNQRZQ DGUHQDO PHFKDQLVP &XUUHQW $QWLK\SHUWHQVLYH 'UXJ 7KHUDSLHV $QWLK\SHUWHQVLYH GUXJV H[HUW WKHLU HIIHFWV E\ LQWHUIHULQJ ZLWK QRUPDO EORRG SUHVVXUH UHJXODWRU\ PHFKDQLVPV 3KDUPDn FHXWLFDO DJHQWV DUH FDWHJRUL]HG EDVHG RQ WKH SULQFLSOH UHJXODWRU\ VLWH RU PHFKDQLVPV E\ ZKLFK WKH\ DFW >@

PAGE 29

7KHUH DUH VHYHUDO DQWLK\SHUWHQVLYH DJHQWV VXFK DV GLXUHWLFV V\PSDWKRSOHJLF DJHQWV DQG YDVRGLODWRUV DV ZHOO DV W\SHV RI 5$6 LQKLELRWUV 'LXUHWLFV ORZHU EORRG SUHVVXUH E\ GHSOHWLQJ WKH ERG\nV VRGLXP DQG UHGXFLQJ EORRG YROXPH 6\PSDWKRSOHJLF DJHQWV ORZHU EORRG SUHVVXUH E\ UHGXFLQJ SHULSKHUDO YDVFXODU UHVLVWDQFH LQKLELWLQJ FDUGLDF IXQFWLRQ DQG LQFUHDVLQJ YHQRXV SRROLQJ LQ FDSDFLWDQFH YHVVHOV 'LUHFW YDVRGLODWRUV UHGXFH SUHVVXUH E\ UHOD[LQJ YDVFXODU VPRRWK PXVFOH WKXV GLODWLQJ UHVLVWDQFH YHVVHOV DQG LQFUHDVLQJ FDSDFLWDQFH &DOFLXP DQWDJRQLVWV ORZHU EORRG SUHVVXUH E\ LQWHUIHULQJ ZLWK FDOFLXPGHSHQGHQW FRQWUDFWLRQV RI YDVFXODU VPRRWK PXVFOH WKHUHE\ GHFUHDVLQJ SHULSKHUDO YDVFXODU UHVLVWDQFH >@ )RXU W\SHV RI GUXJV ZKLFK LQWHUUXSW WKH 5$6 DW GLIIHUHQW VLWHV KDYH EHHQ SURYHQ WR EH HIIHFWLYH LQ GHFUHDVLQJ EORRG SUHVVXUH LQ K\SHUWHQVLYH SDWLHQWV )LJXUH f>@ S $GUHQHUJLF EORFNHUV ORZHU EORRG SUHVVXUH E\ GHFUHDVLQJ FDUGLDF RXWSXW DVVRFLDWHG ZLWK EUDG\FDUGLD DQG GHSUHVVHV WKH 5$6 E\ LQKLELWLQJ WKH VWLPXODWLRQ RI UHQLQ SURGXFWLRQ E\ FDWHFKRODPLQHV>@ 5HQLQ LQKLELWRUV LQKLELW WKH UHOHDVH RI UHQLQ $&( LQKLELWRUV LQKLELW WKH HQ]\PH WKDW K\GURO\]HV DQJLRWHQVLQ WR DQJLRWHQVLQ ,, >@ 7KH DQJLRWHQVLQ ,, UHFHSWRU DQWDJRQLVWV FRPSHWLWLYHO\ EORFN WKH HIIHFW RI DQJLRWHQVLQ ,, DW LWV UHFHSWRU VLWHV >@ 7KH FXUUHQW DQWLn K\SHUWHQVLYH GUXJ WKHUDSLHV DUH QRW RSWLPDO 3UREOHPV VXFK DV XQSOHDVDQW VLGH HIIHFWV VKRUW KDOI OLYHV RI WKH PROHFXOHV DQG SRRU SDWLHQW FRPSOLDQFH UHVXOW LQ QRQHIIHFWLYH WKHUDS\ GHVSLWH WKH SRWHQWLDO SKDUPDFRORJLFDO HIIHFWLYHQHVV

PAGE 30

RI HDFK RI WKHVH DJHQWV +HQFH WKH GHYHORSPHQW RI D ORQJ WHUP PRUH VSHFLILF WKHUDSHXWLF DJHQW ZRXOG JUHDWO\ EHQHILW SDWLHQWV DQG XOWLPDWHO\ UHGXFH KHDOWK FDUH FRVWV $QJLRWHQVLQRJHQ 5HQLQ ? 5HQLQ ,QKLELWRUV $GUHQHUJLF EORFNHUVf 9 $QJLRWHQVLQ $QJLRWHQVLQ FRQYHUWLQJ HQ]\PHrnn ? $&( LQKLELWRUVf 9 $QJLRWHQVLQ ,, DQG $QJLRWHQVLQ ,, UHFHSWRU f§ $7,, UHFHSWRU DQWDJRQLVWVf )LJXUH $QWLK\SHUWHQVLYH GUXJV ZRUNLQJ RQ WKH 5$6 DGDSWHG IURP UHIHUHQFH f 7KH 6SRQWDQHRXVO\ +\SHUWHQVLYH 5DW DV DQ $QLPDO 0RGHO RI (VVHQWLDO +\SHUWHQVLRQ 7KH VSRQWDQHRXVO\ K\SHUWHQVLYH UDW6+5f KDV EHHQ XVHG WR VWXG\ WKH PHFKDQLVPV RI HVVHQWLDO K\SHUWHQVLRQ 7KLV PRGHO ZDV ILUVW LQWURGXFHG LQ E\ 2NDPRWR DQG $RNL>@ 7KH FRORQ\ ZDV VWDUWHG E\ PDWLQJ D PDOH :LVWDU.\RWR :.
PAGE 31

D SRZHUIXO WRRO WR VWXG\ WKH GHWHUPLQDQWV RI HOHYDWHG EORRG SUHVVXUH 6LPLODU WR PRVW SDWLHQWV ZLWK HVVHQWLDO K\SHUn WHQVLRQ 6+5 KDYH QRUPDO RU ORZHU SODVPD UHQLQ DFWLYLW\ DQG SODVPD DQJLRWHQVLQ ,, FRQFHQWUDWLRQV UHODWLYH WR WKHLU QRUPRWHQVLYH FRXQWHUSDUWVWKH :.< PRGHO>@ $GPLQLVWUDWLRQ RI $&( LQKLELWRUV RU DQWLUHQLQ DQWLERGLHV GHFUHDVHG EORRG SUHVVXUH LQ 6+5 7KHVH UHVXOWV VXJJHVW D SRVVLEOH UROH RI 5$6 LQ WKH PDLQWHQDQFH RI WKHLU K\SHUWHQVLYH EORRG SUHVVXUH $ UHFHQW VWXG\ VXJJHVWHG WKDW DQ DEQRUPDOLW\ LQ WKH UHJXODWLRQ RI $*7 JHQH H[SUHVVLRQ PLJKW EH LQYROYHG LQ WKH GHYHORSPHQW RI K\SHUWHQVLRQ LQ 6+5 >@ ,W KDV EHHQ VKRZQ WKDW HYHQ WKRXJK SODVPD $*7 FRQFHQWUDWLRQ LQ WKH 6+5 ZDV FRPSDUDEOH WR WKDW RI :.< DW VL[ ZHHNV RI DJH WKH OHYHO LQFUHDVHG VLJQLILFDQWO\ DW ZHHNV RI DJH DQG ZDV KLJKHU WKDQ WKH :.< %UDLQ $*7 H[SUHVVLRQ LQ 6+5 ZDV KLJKHU WKDQ :.< DW ZHHNV RI DJH DQG ZDV FRPSDUDEOH WR WKDW RI :.< DW ZHHNV RI DJH &DUGLDF DQG IDW $*7 P51$ OHYHOV DOVR ZHUH VLJQLILFDQWO\ KLJKHU DW ZHHNV RI DJH LQ 6+5 WKDQ LQ :.< >@ $Q DOWHUDWLRQ RI $*7 H[SUHVVLRQ E\ VRGLXP DOVR KDV EHHQ REVHUYHG LQ WKH 6+5>@ *HQH 7DUJHWLQJ LQ +\SHUWHQVLRQ 5HVHDUFK DQG 7UHDWPHQW *HQH WDUJHWLQJ WHFKQLTXHV KDYH EHHQ XVHG ERWK DV UHVHDUFK WRROV LQ K\SHUWHQVLRQ UHVHDUFK DV ZHOO DV WKHUDSHXWLF DJHQWV IRU RWKHU GLVHDVH VWDWHV 'LVUXSWLRQ RI WKH H[SUHVVLRQ RI JHQHV LQYROYHG LQ K\SHUWHQVLRQ VXFK DV DQJLRWHQVLQRJHQ > @ DQG WKH DQJLRWHQVLQ ,, UHFHSWRU>@ KDYH EHHQ

PAGE 32

VXFFHVVIXO LQ GHFUHDVLQJ EORRG SUHVVXUH .DOOLNUHLQ JHQH WKHUDS\ KDV EHHQ VKRZQ WR GHFUHDVH EORRG SUHVVXUH LQ D K\SHUWHQVLYH UDW PRGHO>@ 5HFHQWO\ :LHOER HW DO VKRZHG WKDW FHQWUDO DGPLQLVWUDWLRQ RI $62'1 WDUJHWHG WR $*7 P51$ VLJQLILFDQWO\ GHFUHDVHG EORRG SUHVVXUH LQ WKH 6+5 IRU D SURORQJHG SHULRG RI WLPH GD\Vf ZLWK FRUUHVSRQGLQJ GHFUHDVHV LQ K\SRWKDODPLF DQJLRWHQVLQ ,, DQG $*7 OHYHOV>@ %ORRG SUHVVXUH KDV DOVR EHHQ VKRZQ WR GHFUHDVH DIWHU LQWHUUXSWLRQ RI SHULSKHUDO 5$6 JHQH H[SUHVVLRQ 7RPLWD HW DO >@ ZHUH DEOH WR GHFUHDVH EORRG SUHVVXUH E\ XVLQJ OLSRVRPHV ZLWK D YLUDO IXVLRQ SURWHLQ PHGLDWHG JHQH WUDQVn IHFWLRQ WHFKQLTXH $ WUDQVLHQW GHFUHDVH LQ SODVPD $*7 DQG D FRQFXUUHQW GHFUHDVH LQ EORRG SUHVVXUH DQG SODVPD DQJLRWHQVLQ ,, FRQFHQWUDWLRQ ZHUH REVHUYHG DIWHU JLYLQJ WKH DQWLVHQVH 51$ YLD WKH SRUWDO YHLQ 6WXGLHV FRQGXFWHG E\ :LHOER HW DO VKRZHG VLJQLILFDQW GHFUHDVHV LQ EORRG SUHVVXUH IROORZLQJ WKH LQWUDDUWHULDO DGPLQLVWUDWLRQ RI D OLSRVRPH HQFDSVXODWHG DQWLVHQVH PROHFXOH WDUJHWHG WR $*7 P51$ 7KH SODVPD $QJ ,, DQG $*7 OHYHOV DOVR ZHUH GHFUHDVHG>@ $QWLVHQVH 2OLJRGHR[\QXFOHRWLGHV $QWLVHQVH ROLJRGHR[\QXFOHRWLGHV $62'1f DUH VKRUW VLQJOH VWUDQGHG VHTXHQFHV RI '1$ PROHFXOHV WKDW E\ IRUPLQJ VSHFLILF K\GURJHQ ERQGV ZLWK FRPSOHPHQWDU\ P51$ RU '1$ PROHFXOHV DOORZ WKH VSHFLILF UHJXODWLRQ RI JHQH H[SUHVVLRQ >@ %DVHG RQ WKH VLPSOH :DWVRQ&ULFN EDVHSDLULQJ UXOH RQH FDQ GHVLJQ $62'1V WR WDUJHW DQ\ JHQH ZLWK D NQRZQ

PAGE 33

VHTXHQFH $ PDMRU DGYDQWDJH RI WKLV VWUDWHJ\ LV WKH VSHFLn ILFLW\ RI WKH $62'1 DFWLRQ 7KHRUHWLFDOO\ DQ 2'1 RI QXFOHRWLGHV LQ OHQJWK VKRXOG LQWHUDFW ZLWK RQO\ RQH WDUJHW JHQH LQ WKH HQWLUH KXPDQ JHQRPH>@ ,Q SULQFLSOH DQ ROLJRn QXFOHRWLGH 2'1f FDQ EH GHVLJQHG WR WDUJHW DQ\ VLQJOH JHQH ZLWKLQ WKH HQWLUH KXPDQ JHQRPH ZLWK WKH SRWHQWLDO WR FUHDWH VSHFLILF WKHUDS\ IRU DQ\ GLVHDVH LQ ZKLFK WKH FDXVDWLYH JHQH LV NQRZQ>@ ,W DOVR KDV WKH DGYDQWDJH RI EHLQJ XVHG DV D UHVHDUFK WRRO WR LQYHVWLJDWH WKH UROH RI D SDUWLFXODU JHQH LQ D SK\VLRORJLFDO RU SKDUPDFRORJLFDO V\VWHP $62'1 DFWLYLW\ ZDV GHPRQVWUDWHG LQ QXPHURXV ELRORJLFDO V\VWHPV>@ 9LUXVHV UHSUHVHQW WKH PRVW DWWUDFWLYH WKHUDn SHXWLF WDUJHWV VLQFH WKHLU JHQHWLF VHTXHQFHV DUH XQLTXH ZLWK UHVSHFW WR WKH KXPDQ KRVW $62'1 KDYH VKRZQ DFWLYLW\ DJDLQVW +,9 +69 DQG +39 DQG LQIOXHQ]D LQ YLWUR >@ 7KH\ DOVR KDYH EHHQ UHSRUWHG WR LQKLELW D YDULHW\ RI RQFRJHQHV LQFOXGLQJ F5$6 DQG FP\F ,QKLELWLRQ RI JHQH H[SUHVVLRQ LV JHQHUDOO\ VHHQ DW KLJK FRQFHQWUDWLRQV RI 2'1V>@ 7KHRUHWLFDOO\ ROLJRQXFOHRWLGHV FDQ EH GHVLJQHG WR WDUJHW DQG LQWHUIHUH ZLWK HYHU\ VWDJH RI JHQH H[SUHVVLRQ )RU H[DPSOH WKH\ FDQ EH GHVLJQHG WR WDUJHW DQG ELQG WR GRXEOH VWUDQGHG '1$ UHVXOWLQJ LQ D WULSOH KHOL[ IRUPDWLRQ ZLWK WKH VXEVHTXHQW LQKLELWLRQ RI WUDQVFULSWLRQ RU E\ K\EULGL]DWLRQ WR QDVFHQW 51$ 7KH\ FDQ EH GHVLJQHG WR LQWHUIHUH ZLWK 51$ VSOLFLQJ DQG WUDQVSRUW RI P51$ IURP WKH QXFOHXV WR F\WRSODVP WKURXJK K\EULGL]DWLRQ DW LQWURQH[RQ MXQFWLRQV 7UDQVODWLRQ FDQ EH LQKLELWHG E\ WDUJHWLQJ WKH DQWLVHQVH WR WKH $8*

PAGE 34

LQLWLDWLRQ FRGRQ WKHUHE\ LQKLELWLQJ WKH DVVHPEO\ RI ULERVRPDO VXEXQLWV DQG WKH VXEVHTXHQW UHDGLQJ RI WKH PHVVDJHV WR EH WUDQVODWHG )LJXUH f>@ &DS ‘ A, ,;, M L $$$$ 9 )LJXUH 6XPPDU\ RI WKH SRVVLEOH VLWHV RI VHTXHQFH VSHFLILF DFWLRQV RI $62'1 $62'1 FRXOG LQWHUIHUH ZLWK WUDQVFULSWLRQ E\ f K\EULGL]DWLRQ WR WKH ORFDOO\ RSHQHG ORRS FUHDWHG E\ 51$ SRO\PHUDVH f K\EULGL]DWLRQ WR QDVFHQW 51$ LQWHUIHUH ZLWK VSOLFLQJ WKURXJK f K\EULGL]DWLRQ DW LQWURQH[RQ MXQFWLRQV f LQWHUIHUH ZLWK WUDQVSRUW RI P51$ IURP QXFOHXV WR F\WRSODVP f LQWHUIHUH ZLWK WUDQVODWLRQ WKURXJK LQKLELWLRQ RI ELQGLQJ RI LQLWLDWLRQ IDFWRUV f LQKLELWLRQ RI WKH DVVHPEO\ RI ULERVRPDO VXEXQLWV DW WKH VWDUW FRGRQ f RU LQKLELWLRQ RI ULERVRPH VOLGLQJ DORQJ WKH FRGLQJ VHTXHQFH RI WKH P51$ H[FHUSWHG IURP UHIHUHQFH f 'HVSLWH WKH REVHUYHG DFWLYLWLHV WKH PHFKDQLVP RI $62'1 DFWLRQ LV VWLOO XQFOHDU ,W KDV EHHQ SURSRVHG WKDW $62'1

PAGE 35

LQKLELW JHQH H[SUHVVLRQ WKURXJK WZR GLVWLQFW PHFKDQLVPV>@ 2QH PHFKDQLVP VXJJHVWV WKDW RQFH WKH DQWLVHQVH PROHFXOHV HQWHU WKH FHOOV WKH\ ELQG WR LWV WDUJHW P51$ LQ HLWKHU WKH F\WRSODVP QXFOHXV RU ERWK )ROORZLQJ WKLV K\EULGL]DWLRQ FHOOXODU 51DVH + SURWHFWV WKH FHOOV E\ FOHDYLQJ WKH 51$ SRUWLRQ RI WKH 51$'1$ GXSOH[ 2QFH FOHDYHG WKH P51$ LV QR ORQJHU FRPSHWHQW IRU WUDQVODWLRQ DQG PD\ EH UDSLGO\ GHJUDGHG 7KLV PHFKDQLVP KDV DQ DGYDQWDJH LQ WKDW HDFK PHVVDJH LV SHUPDQHQWO\ LQDFWLYDWHG XSRQ FOHDYDJH DQG HDFK 2'1 FDQ LQKLELW PXOWLSOH FRSLHV RI HDFK WDUJHW P51$ 7KLV FOHDYDJH KRZHYHU PD\ KDYH WKH GLVDGYDQWDJH RI EHLQJ QRQVSHFLILF VLQFH WKH WUDQVLHQW K\EULGL]DWLRQ WR RWKHU P51$V PD\ DFWLYDWH 51DVH + DV ZHOO>@ ,Q WKH VHFRQG DQWLVHQVH PHFKDQLVP WKH ELQGLQJ RI DQ 2'1 WR D WDUJHW P51$ LQKLELWV JHQH H[SUHVVLRQ WKURXJK VLPSOH VWHULF EORFNLQJ 7KH 2'151$ GXSOH[ IRUPV DQG SK\VLFDOO\ SUHYHQWV WKH 51$ IURP LQWHUDFWLQJ ZLWK FHOOXODU FRPSRQHQWV VXFK DV ULERVRPHV WKHUHE\ LQKLELWLQJ WUDQVODWLRQ RI WKH 51$ LQWR LWV VSHFLILF SURWHLQ>@ 7KHUPRG\QDPLFV RI '1$51$ 'XSOH[HV )RUPDWLRQ 7KH UHODWLYH VWDELOLW\ RI D QXFOHLF DFLG GXSOH[ LV PHDVXUHG E\ WKH PHOWLQJ WHPSHUDWXUH WKH KLJKHU WKH PHOWLQJ WHPSHUDWXUH WKH PRUH VWDEOH WKH GXSOH[>@ )DFWRUV VXFK DV WKH OHQJWK RI WKH 2'1 LWV $7&* FRPSRVLWLRQ DQG WKH EDVH VHTXHQFH DOO FRQWULEXWH WR LWV VWDELOLW\>@ 2Q DYHUDJH GXSOH[ VWDELOLW\ LV SURSRUWLRQDO WR WKH QXPEHU RI EDVH

PAGE 36

SDLUV WKH ORQJHU WKH GXSOH[ WKH KLJKHU WKH VWDELOLW\ +RZHYHU DV WKH OHQJWK LQFUHDVHV WKH DIILQLW\ IRU FORVHO\ UHODWHG VHTXHQFHV DOVR LQFUHDVHV DQG WKH VSHFLILFLW\ PD\ EHJLQ WR GHFUHDVH 7KHRUHWLFDOO\ WKH OHQJWK RI DQ 2'1 WKDW VKRXOG VDWLVI\ ERWK VWDELOLW\ DQG VSHFLILFLW\ UHTXLUHPHQW LV DV VKRUW DV WHQ WR ILIWHHQ EDVHV 7KH VWDELOLW\ RI WKH GXSOH[ DOVR LQFUHDVHV DV WKH *& FRQWHQW RI WKH 2'1 LQFUHDVHV GXH WR WKHLU VWURQJHUK\GURJHQ ELQGLQJ>@ 7KH GHYHORSPHQW RI $62'1 DV WKHUDSHXWLF DJHQWV KDV QRW EHHQ DV VPRRWK DV RQFH DQWLFLSDWHG 6HYHUDO UHTXLUHPHQWV KDYH WR EH PHW WR HQVXUH LWV SUDFWLFDO XVH VXFK DV ODUJH VFDOH V\QWKHVLV LQ YLWUR DQG LQ YLYR VWDELOLW\ VXFFHVVIXO GHOLYHU\ DQG VSHFLILFLW\ LQ LWV DFWLRQ>@ 6WDELOLW\ 7KH 2'1V LQLWLDOO\ XVHG LQ SK\VLRORJLFDO VWXGLHV ZHUH QDWXUDOO\ RFFXUULQJ SKRVSKRGLHVWHUV 7KH OLQNDJHV LQ WKHVH PROHFXOHV DUH VXVFHSWLEOH WR GHJUDGDWLRQ E\ HQGRJHQRXV VHUXP DQG LQWUDFHOOXODU QXFOHDVHV $Q LQ YLWUR DVVD\ GHPRQVWUDWHG WKDW DIWHU PLFURLQMHFWLRQ LQWR ;HQRSXV HPEU\RV SKRVSKRGLHVWHU 2'1V KDYH DQ LQWUDFHOOXODU KDOIOLIH RI OHVV WKDQ PLQXWHV>@ 3URWHFWLRQ IURP GHJUDGDWLRQ ZDV DFKLHYHG E\ XVH RI D HQG FDS VWUDWHJ\ LQ ZKLFK QXFOHDVH UHVLVWDQW OLQNDJHV ZHUH VXEVWLWXWHG IRU SKRVSKRGLHVWHU OLQNDJHV DW WKH n HQG RI WKH 2'1 3KRVSKRURWKLRDWH DQDORJV KDYH D VXOIXU VXEVWLWXWHG IRU RQH RU ERWK QRQEULGJLQJ R[\JHQV)LJXUH f>@ 7KLV PRGLILFDWLRQ PDNHV WKH

PAGE 37

PROHFXOH PRUH UHVLVWDQW WR QXFOHDVH GHJUDGDWLRQ H[WHQGLQJ WKH KDOIOLIH LQ YLWUR WR KRXUV )XUWKHU SUREOHPV HQFRXQWHUHG ZLWK WKH XVH RI 2'1V LQFOXGH SRRU FHOOXODU XSWDNH DQG LQWUDFHOOXODU FRPSDUWPHQWDOL]DWLRQ 8QOLNH PDQ\ RWKHU VPDOO RUJDQLF GUXJ PROHFXOHV RI ORZ PROHFXODU ZHLJKW 2'1V WR PHUf DUH SRO\DQLRQLF K\GURSKLOLF PROHFXOHV ZLWK D PROHFXODU ZHLJKW UDQJH RI DQG FDQQRW SDVVLYHO\ GLIIXVH DFURVV &HOO PHPEUDQHV $OWKRXJK WKH PHFKDQLVP E\ ZKLFK WKH 2'1V HQWHU WKH FHOOV LV QRW FOHDUO\ LGHQWLILHG LW LV JHQHUDOO\ )LJXUH 7KH VWUXFWXUHV RI SKRVSKRGLHVWHU DQG SKRVSKRURWKLRDWH PROHFXOHV DGDSWHG IURP UHIHUHQFH f EHOLHYHG WKDW WKH PROHFXOHV HQWHU WKH FHOOV E\ D SLQRF\WRWLF RU UHFHSWRUPHGLDWHG HQGRF\WRWLF PHFKDQLVP>@ ,Q WKLV SURFHVV PROHFXOHV WR EH LQWHUQDOL]HG ILUVW ELQG WR VSHFLILF UHFHSWRUV RQ WKH FHOO VXUIDFH 7KHVH UHFHSWRUOLJDQG FRPSOH[HV WKHQ EHFRPH FOXVWHUHG LQ VSHFLDOL]HG DUHDV RI WKH SODVPD PHPEUDQH WHUPHG FRDWHG SLWV DQG WKHQ EHFRPH

PAGE 38

LQYDJLQDWHG WR IRUP D FRDWHG YHVLFOH 7KH FRDW LV UDSLGO\ UHPRYHG )XVLRQ ZLWK WKH HDUO\ HQGRVPH H[SRVHV WKH UHFHSWRU OLJDQG FRPSOH[HV WR ORZHU S+ ZKLFK FDXVHV GLVVRFLDWLRQ RI OLJDQG DQG UHFHSWRU /LJDQGV PD\ EH WUDQVIHUUHG WKURXJK ODWH HQGRVRPHV WR O\VRVRPHV ZKLOH WKH UHFHSWRUV ZKLFK UHF\FOH DUH UHWXUQHG WR WKH FHOO VXUIDFH >@ 7KH FHOOXODU XSWDNH RI 2'1V ZDV VWXGLHG LQ WKH +/ FHOO OLQH 3KRVSKRURWKLRDWH 2'1 ZDV GHPRQVWUDWHG WR EH LQWHUn QDOL]HG E\ WKH SURFHVV RI DGVRUSWLYH HQGRF\WRVLV DQG IOXLG SKDVH SLQRF\WRVLV 7KH SURFHVV LV VORZHG E\ WKH PHWDEROLF LQKLELWRU RI WKH FHOOV DQG LV WHPSHUDWXUHGHSHQGHQW>@ 7KH LQWUDFHOOXODU GLVWULEXWLRQ RI WKH 2'1 KDV EHHQ VWXGLHG XVLQJ IOXRUHVFHQFH PLFURVFRS\ $ PLFURLQMHFWLRQ PHWKRG ZDV XVHG WR DYRLG WKH SUREOHP RI WKH LQWHUQDOL]DWLRQ SDWKZD\ DQG IOXRUHVFHQWO\ODEHOHG 2'1V ZHUH REVHUYHG WR DFFXPXODWH LQ WKH QXFOHXV VRRQ DIWHU LQMHFWLRQ :KHQ IOXRUHVFHQWO\ ODEHOHG 2'1V DUH SODFHG LQ WLVVXH FXOWXUH PHGLD WKH IOXRUHVFHQFH DFFXPXODWHV LQ YDFXROHV ZLWKLQ WKH FHOO IRUPLQJ D SXQFWDWH SHULQXFOHDU SDWWHUQ ZKLFK DUH SUHVXPDEO\ HQGRVRPDO DQG O\VRVRPDO LQ QDWXUH :HDN YLVLEOH IOXRUHVFHQFH LQ WKH QXFOHXV KDV EHHQ REVHUYHG VXJJHVWLQJ WKDW WKH UHOHDVH RI 2'1V IURP YDFXROHV LV DQ LQHIILFLHQW SURFHVV >@ 7KLV REVHUYDWLRQ VXSSRUWHG WKH YLHZ WKDW WKH PDMRU OLPLWLQJ IDFWRU LQ HIIHFWLYH 2'1 GHOLYHU\ DSSHDUV WR EH WKH HVFDSH RI WKH 2'1V IURP WKH HQGRVRPHV DQG O\VRVRPHV ZKHUH WKH\ DUH UDSLGO\ GHJUDGHG E\ K\GURO\WLF HQ]\PHV 7KH XSWDNH RI IOXRUHVFHQWO\ ODEHOHG 2'1V ZDV HQKDQFHG E\

PAGE 39

FRDGPLQLVWUDWLRQ ZLWK FDWLRQLF OLSLGV GHPRQVWUDWHG E\ WKH SUHVHQFH RI IOXRUHVFHQFH LQ WKH QXFOHXV DQG FRQFXUUHQW LQFUHDVH LQ 2'1 DFWLYLW\>@ &KHPLFDO 0RGLILFDWLRQ RI WKH $64'1V (IIRUWV KDYH EHHQ PDGH WR LPSURYH WKH SURSHUWLHV RI 2'1V E\ FKHPLFDO PRGLILFDWLRQ 'HVSLWH WKH IXQGDPHQWDO :DWVRQ&ULFN K\GURJHQERQGLQJ VFKHPH ZKLFK LV FHQWUDO WR WKH IRUPDWLRQ RI WKH GRXEOH KHOL[ DQG LV XQOLNHO\ WR FKDQJH VXEVWDQWLDOO\ DOO RWKHU VWUXFWXUDO IHDWXUHV RI WKH SKRVSKRGLHVWHU EDFNERQH KHWHURF\FOLF EDVHV DQG VXJDUV KDYH EHHQ PRGLILHG RU UHSODFHG >@ 0RGLILFDWLRQ RI WKH SKRVSKRGLHVWHU EDFNERQH KDV EHHQ HPSOR\HG WR LPSURYH VWDELOLW\ DOORZLQJ IRU HQKDQFHG DIILQLW\ DQG LQFUHDVHG FHOOXODU SHUPHDWLRQ RI 2'1V 7KH SURSHUWLHV RI VRPH RI WKH SKRVSKRGLHVWHU EDFNERQH DQDORJXHV DUH OLVWHG LQ 7DEOH >@ ,Q DGGLWLRQ WR SKRVSKRURWKLRDWLRQ PHQWLRQHG SUHYLRXVO\ RWKHU OLQNDJHV KDYH EHHQ VWXGLHG 0HWK\OSKRVSKRQDWHPRGLILHG 2'1V ZKLFK VXEVWLWXWH WKH QRQEULGJHG R[\JHQ ZLWK D PHWK\O JURXS KDYH WKH DGYDQWDJHV RI EHLQJ QHXWUDO DQG SURYLGLQJ EHWWHU FHOOXODU XSWDNH %XW ERWK RI WKHVH WZR PRGLILFDWLRQV VXIIHU IURP GHFUHDVHG DIILQLW\ WR WDUJHW VHTXHQFHV ZKLFK DIIHFW WKHLU DFWLYLW\>@ 7KH FKLUDO SURSHUWLHV RI 2'1V FRQWDLQLQJ HLWKHU RI WKHVH PRGLILFDWLRQV ZDV VXJJHVWHG WR EH D IDFWRU WKDW DIIHFWV LWV DFWLYLW\ (DFK RI WKHVH LVRPHUV FRQVLVWV RI D PL[WXUH RI Q GLDVWHUHRPHUV ZKHUH Q LV WKH

PAGE 40

QXPEHU RI OLQNDJHVf DQG LW LV UHSRUWHG WKDW SXUH 5 RU SXUH 6 LVRPHUV ZRXOG K\EULGL]H ZLWK GLIIHUHQW DIILQLW\>@ /HVQLNRZVNL HW DO VKRZHG WKDW IRU D PHU ROLJRWK\PLGLQH ZLWK D PHWK\OSKRVSKRQDWH EDFNERQH WKH DOO53 5 GLDVWHUHR PHU RI SKRVSKRUXVf 2'1 KDG D VLJQLILFDQWO\ KLJKHU PHOWLQJ WHPSHUDWXUH WKDQ 2'1V ZKLFK DUH D PL[WXUH RI GLDVWHUHRPHUV >@ 6XJDU PRGLILFDWLRQ DOVR KDV EHHQ XVHG WR HQKDQFH VWDELOLW\ DQG DIILQLW\ 0RGLILFDWLRQ RI WKH n2+ RI WKH ULERVH VXJDU WR IRUP n2PHWK\O RU n2DOO\O VXJDU ZLWKLQ ROLJRQXFOHRWLGHV LV IRXQG WR HQKDQFH UHVLVWDQFH WR GHJUDGDWLRQ ZLWKRXW FRPSURPLVLQJ DIILQLW\ >@ +HWHURF\FOLF 7DEOH 3URSHUWLHV RI VHOHFWHG SKRVSERGLHVWHU EDFNERQH DQDORJXHV DGDSWHG IURP UHIHUHQFH f EDFNERQH DQDORJXH DFWLYDWLRQ RI 51DVH + UHVLVWDQFH WR QXFOHDVH &KLUDO FHQWHU SKRVSKRGLHVWHU 3KRVSKRUXV $QDORJXHV
PAGE 41

51$ $PLQRnGHR[\DGHQRVLQH LQWURGXFHV D WKLUG K\GURJHQ ERQG LQWR DQ $7 EDVH SDLU ZKLFK VWDELOL]HV GXSOH[ IRUPDWLRQ>@ 0RGLILFDWLRQV WR HQKDQFH SHUPHDWLRQ E\ FRQMXJDWLRQ RI DQ 2'1 WR WUDQVIHUULQ D SURWHLQ OLJDQG IRU D FHOOXODU UHFHSWRU ZDV VKRZQ WR GUDPDWLFDOO\ LQFUHDVH FHOOXODU DVVRFLDWLRQ RI 2'1V>@ ,QFUHDVHG FHOOXODU DVVRFLDWLRQ DQG DFWLYLW\ KDYH DOVR EHHQ UHSRUWHG IRU DQ 2'1DVLDORJO\ FRSURWHLQ FRQMXJDWH WDUJHWHG WR WKH KHSDWLWLV % YLUXV>@ )OXRUHVFHLQ ODEHOHG 2'1 ERXQG WR VWUHSWDYLGLQ ZKLFK KDG PDQQRVH UHVLGXHV DWWDFKHG ZDV IRXQG WR EH LQWHUQDOL]HG SUHIHUHQWLDOO\ LQ OLYHU FHOOV YLD FHOOXODU PDQQRVH UHFHSWRUV 3RO\/O\VLQHf D SRO\FDWLRQLF GUXJ FDUULHU ZDV DOVR VKRZQ WR LQFUHDVH ERWK WKH UDWH DQG H[WHQW RI FHOOXODU XSWDNH RI 2'1V>@ 7KH DWWDFKPHQW RI K\GURSKRELF PROHFXOHV VXFK DV FKROHVWHURO DQG SKRVSKROLSLGV WR WKH 2'1V DOVR KDV EHHQ UHSRUWHG WR LQFUHDVH FHOOXODU XSWDNH>@ /LSRVRPHV DV D 'HOLYHU\ 9HKLFOH IRU $62'1 7KH XVH RI OLSRVRPHV DV D FDUULHU V\VWHP IRU QXFOHLF DFLG KDV UHFHLYHG LQFUHDVLQJ DWWHQWLRQ >@ /LSRVRPHV DUH YHVLFOHV LQ ZKLFK DQ DTXHRXV YROXPH LV HQFORVHG E\ D PHPEUDQH FRPSRVHG RI OLSLG PROHFXOHV ZLWK K\GURSKLOLF SRODU KHDGV DQG K\GURSKRELF QRQSRODU WDLOV >@ 7KH PHPEUDQHV H[KLELW D YDULHW\ RI VXUIDFH SURSHUWLHV VXFK DV FKDUJH PHPEUDQH ULJLGLW\ DQG SKDVH EHKDYLRU>@ ,Q VPDOO RUJDQLF PROHFXOH GHOLYHU\ RQO\ WKH VHOIFORVHG ELOD\HU YHVLFOHV WKH

PAGE 42

OLSRVRPH LV FRQVLGHUHG ,Q JHQH WUDQVIHU VHYHUDO RWKHU VWUXFWXUHV DQG SKDVHV VXFK DV WKH RSHQ OLSLG ELOD\HU IUDJPHQW WKH LQYHUVH KH[DJRQDO SKDVH DQG WKH PLFHOOH DUH DOVR LPSRUWDQW)LJXUH f >@ /LSRVRPHV LQ %LRORJLFDO 6\VWHPV /LSRVRPHV DGPLQLVWHUHG LQ YLYR DUH VXEMHFWHG WR SK\VLRORJLFDO LQWHUDFWLRQV WKDW GHWHUPLQH WKH UDWH RI FOHDUDQFH DQG GHJUHH RI RUJDQ XSWDNH 7KH PDMRU OLPLWDWLRQ RI OLSRVRPHV IRU SKDUPDFHXWLFDO DSSOLFDWLRQV LV WKHLU XQSUH /LSLG /\VRSKRVSKROLSLGV 'HWHUJHQWV 3KDVH Z 0LFHOODU 0ROHFXODU 6KDSH 9 ,QYHUWHG &RQH 3KRVSKDW LG\WFKRO LQH 6SKLQJRP\HOLQ 3KRVSKDWLG\WVHULQH PP PP 4f§ 3KRVSKDW LG\OJO\FHUR L %LOD\HU &\OLQGULFDO 3KRVSKDW LG\OHWKDQRO V DPLQH XQVDWXUDWHGf nVL :U9$ &DUGLROLSLQ &D 3KRVSKDWLGLF DFLG &D +H[DJRQDO +ff &RQH )LJXUH 3KDVH VWUXFWXUHV IRUPHG E\ OLSLGV LQ WKH DTXHRXV VROXWLRQV DGDSWHG IURP UHIHUHQFH f

PAGE 43

GLFWDEOH EHKDYLRU LQ WKH ERG\ VXFK DV UDSLG FOHDUDQFH IURP WKH EORRG UHVWULFWHG FRQWURO RI WKH HQFDSVXODWHG PROHFXOH UHOHDVH ORZ RU QRQUHSURGXFLEOH GUXJ ORDGLQJ DQG SK\VLFDO RU FKHPLFDO LQVWDELOLW\>@ &LUFXODWLQJ OLSRVRPHV DUH WDNHQ XS WR D ODUJH H[WHQW E\ RUJDQV ULFK LQ WKH FHOOV RI WKH UHWLFXORHQGRWKHOLDO V\VWHP 5(6f VXFK DV WKH OLYHU VSOHHQ OXQJ O\PSK QRGHV DQG ERQH PDUURZ /DUJHU OLSRVRPHV RI FRQYHQWLRQDO IRUPXODWLRQ DUH UDSLGO\ UHPRYHG IURP WKH FLUFXODWLRQ IROORZLQJ LQWUDYHQRXV LQMHFWLRQ E\ XSWDNH SULPDULO\ LQWR .XSIIHU FHOOV RI WKH OLYHU DQG PDFURSKDJHV LQ WKH VSOHHQ DQG OXQJ 7KLV SDVVLYH WDUJHWLQJ WR SKDJRF\WLF FHOOV KDV EHHQ XVHG IRU WUHDWLQJ GLVHDVHV RI WKH 5(6 VXFK DV OLYHU OHLVKPDQLDVLV DQG IXQJDO LQIHFWLRQV >@ 6PDOO OLSRVRPHV ZLWK GLDPHWHUV OHVV WKDQ _MP FDQ SDVV WKURXJK IHQHVWUDWHG HQGRWKHOLXP DQG JDLQ DFFHVV WR OLYHU SDUHQFK\PDO FHOOV >@ )RU WKHUDSHXWLF DSSOLFDWLRQV LQYROYLQJ QRQ5(6 RUJDQV SURORQJHG EORRG FLUFXODWLRQ KDV EHHQ DFKLHYHG E\ PLPLFNLQJ WKH FRPSRVLWLRQ RI WKH UHG EORRG FHOO PHPEUDQH ,QFOXVLRQ RI SKRVSKROLSLGV ZLWK D V\QWKHWLF K\GURSKLOLF SRO\PHU KHDGJURXS VXFK DV D SRO\HWK\OHQHJO\FRO FKDLQ UHGXFH WKH UHFRJQLWLRQ RI OLSRVRPHV E\ WKH PRQRQXFOHDU SKDJRF\WLF V\VWHP DQG KHQFH LQFUHDVHV LWV FLUFXODWLRQ WLPH>@ 6SHFLILF RUJDQ WDUJHWLQJ DOVR FDQ EH DFKLHYHG E\ LQFRUSRUDWLRQ RI FHUWDLQ OLJDQGV /LSRVRPH FRQWDLQLQJ ODFWR V\OFHUDPLGH ZDV VKRZQ WR LQFUHDVH WKH WUDQVIHFWLRQ HIILFLHQF\ E\ D IDFWRU RI LQ +HS* FHOOV WKURXJK

PAGE 44

LQWHUDFWLRQ ZLWK DVLDORJO\FRSURWHLQ UHFHSWRUV RQ WKH FHOO PHPEUDQHV>@ 7KH SK\VLFDO LQWHJULW\ RI OLSRVRPHV FDQ EH PRGXODWHG E\ FKDQJLQJ WKH OLSLG FRPSRVLWLRQ ,QFUHDVH LQ FKROHVWHURO FRPn SRVLWLRQ KDV EHHQ VKRZQ WR VWDELOL]H WKH ELOD\HU DQG GHFUHDn VH WKH SHUPHDELOLW\ RI SKRVSKDWLG\OFKROLQH OLSRVRPH >@ 0HWKRGV IRU '1$ HQFDSVXODWLRQ LQFOXGH UHYHUVHSKDVH HYDSRUDWLRQ5(9f VRQLFDWLRQ &D('7$ FKHODWLRQ FDWLRQLF OLSLG FRPSOH[HV GHWHUJHQW GLDO\VLV DQG YLUDO HQYHORSH UHFRQVWLWXWLRQ >@ ,QFUHDVHG '1$ HQFDSVXODWLRQ HIILFLHQF\ KDV EHHQ DFKLHYHG E\ DOWHULQJ WKH SK\VLFDO VWDWH RI WKH '1$ VXFK DV FRQGHQVLQJ WKH '1$ ZLWK EDFWHULRSKDJH SURWHLQ RU VPDOO RUJDQLF PROHFXOHV ,Q WKH 5(9 PHWKRG PXOWLSOH IUHH]Hn WKDZLQJ DQG UHK\GUDWLRQ F\FOHV GXULQJ ZKLFK ELOD\HUV RSHQ DQG FORVH FDQ PDNH PRUH PROHFXOHV SHUPHDWH LQWR WKH LQWHULRU RI WKH OLSRVRPH WKXV LPSURYLQJ WKH HQFDSVXODWLRQ HIILFLHQF\>@ 7KH ,QWHUDFWLRQV RI /LSRVRPHV ZLWK &HOOV 7KH PHFKDQLVP RI OLSRVRPHFHOO LQWHUDFWLRQ DQG WKH HIIHFW RI OLSRVRPH VWUXFWXUH DQG FRPSRVLWLRQ RQ LWV DVVRFLDWLRQ ZLWK WKH FHOO LV QRW FRPSOHWHO\ XQGHUVWRRG 'LIIHUHQW PRGHV RI LQWHUDFWLRQ KDYH EHHQ VXPPDUL]HG LQ WKH OLWHUDWXUH)LJXUH f >@ 7KH HQGRF\WRVLVSKDJRF\WRVLV PHFKDQLVP SURSRVHV WKDW FHOOV ZLWK SKDJRF\WLF DFWLYLW\ WDNH XS OLSRVRPHV LQWR HQGRVRPHV HQGRVRPHV WKHQ IXVH ZLWK O\VRVRPHV WR IRUP VHFRQGDU\ O\VRVRPHV ZKHUH GHJUDGDWLRQ WDNHV SODFH LQ

PAGE 45

ORZ S+ f HQYLURQPHQWV /LSRVRPH SKRVSKROLSLGV DUH WKHQ K\GURO\]HG WR IDWW\ DFLGV DQG UHF\FOHG DQG UHLQFRUSRUDWHG LQWR WKH KRVW SKRVSKROLSLG 7KH FRQWHQW RI WKH DTXHRXV FRPSDUWPHQW LV UHOHDVHG DIWHU WKH PHPEUDQH GLVLQWHJUDWHV 7KH\ PD\ HLWKHU UHPDLQ VHTXHVWHUHG LQ WKH O\VRVRPH XQWLO H[RF\WRVLV RU WKH\ ZLOO VORZO\ OHDN RXW RI WKH O\VRVRPH DQG JDLQ DFFHVV WR WKH UHVW RI WKH FHOO /LSRVRPHV PD\ DOVR EH WDNHQ XS E\ UHFHSWRUPHGLDWHG HQGRF\WRVLV>@ /LSRVRPHV FRDWHG ZLWK ORZGHQVLW\ OLSRSURWHLQV RU 6WDKOX$EVRUSWLRQ (QGRF\WRVLV )XVLRQ /LSLG 7UDQVIHU )LJXUH 3RVVLEOH PHFKDQLVPV RI LQWHUDFWLRQ EHWZHHQ OLSRVRPH DQG FHOO VXUIDFH DGDSWHG IURP UHIHUHQFH f WUDQVIHUULQ ELQG WR WKH FHOO YLD VXUIDFH UHFHSWRUV IRU WKHVH PRLHWLHV DQG WKHQ DUH LQWHUQDOL]HG YLD FRDWHG SLWV ZLWK VXEVHTXHQW OLJDQG GHJUDGDWLRQ RU UHF\FOLQJ>@ ,QWHUn PHPEUDQH WUDQVIHU RI OLSLG FRPSRQHQWV FDQ WDNH SODFH XSRQ WKH FORVH DSSURDFK RI WKH WZR SKRVSKROLSLG ELOD\HUV ZLWKRXW GLVUXSWLRQ RI WKH PHPEUDQHnV LQWHJULW\>@

PAGE 46

&RQWDFWUHOHDVH RI WKH DTXHRXV FRQWHQWV RI OLSRVRPHV RFFXUV E\ D SRRUO\ XQGHUVWRRG PHFKDQLVP LQ ZKLFK FRQWDFW ZLWK WKH FHOO FDXVHV DQ LQFUHDVH LQ SHUPHDELOLW\ RI WKH OLSRVRPH PHPEUDQH 7KLV PHFKDQLVP SURYLGHV WKH PHDQV IRU LQWURGXFLQJ PDWHULDOV LQWR VSHFLILF FHOOV ZLWKRXW WKH QHHG IRU LQJHVWLRQ RI WKH ZKROH OLSRVRPH DQG ZRXOG EH RI SDUWLFXODU YDOXH IRU FHOOV ZKLFK DUH QRW DFWLYHO\ SKDJRF\WLF>@ $GVRUSWLRQ PD\ WDNH SODFH HLWKHU DV D UHVXOW RI SK\VLFDO DWWUDFWLYH IRUFH RU DV D UHVXOW RI ELQGLQJ E\ VSHFLILF UHFHSWRUV WR OLJDQGV RQ WKH YHVLFOH PHPEUDQH )XVLRQ UHVXOWV LQ LQFRUSRUDWLRQ RI WKH OLSRVRPDO OLSLGV LQWR WKH SODVPD PHPEUDQH RI WKH FHOO DQG GLIIXVLRQ RI WKH OLSRVRPHWUDSSHG FRQWHQWV LQWR WKH F\WRSODVP>@ ,QFRUSRUDWLRQ RI IXVRJHQV VXFK DV O\VROHFLWKLQ GHWHUJHQW VXUIDFWDQW RU 6HQGDL YLUXV IXVLRQ SURWHLQV LQWR WKH PHPEUDQH KDYH EHHQ VKRZQ WR IDFLOLWDWH WKH OLSRVRPHFHOO IXVLRQ SURFHVV >@ /LSRVRPHV KDYH EHHQ XVHG DV D WRRO WR GHOLYHU ROLJRQXFOHRWLGHV /LSRVRPH HQFDSVXODWLRQ FDQ LPSURYH WKH SDVVDJH RI 2'1V WKURXJK WKH FHOO PHPEUDQH DV ZHOO DV SURWHFW WKHP LQ WKH H[WUDFHOOXODU PHGLXP ,W LV DOVR SRVVLEOH WR WDUJHW OLSRVRPHV WR VSHFLILF FHOO SRSXODWLRQV E\ FRXSOLQJ FHUWDLQ SURWHLQV RU DQWLERGLHV RQ WKHLU VXUIDFH >@ /LSRVRPH VWUXFWXUH DQG VXUIDFH SURSHUWLHV GHWHUPLQH VHYHUDO GLIIHUHQW ZD\V OLSRVRPHV FDQ LQWHUDFW ZLWK 2'1V 2'1V FDQ EH HQFDSVXODWHG LQ WKH OLSRVRPH LQWHULRU ERXQG RQWR WKH OLSRVRPH VXUIDFH RU HPEHGHG EHWZHHQ ELOD\HUV>@ /LSRVRPHV KDYH EHHQ GLIIHUHQWLDWHG EDVHG RQ WKH PRGH RI

PAGE 47

OLSRVRPH LQWHUDFWLRQ ZLWK WKHLU WDUJHW FHOOV >@ &RQYHQWLRQDO OLSRVRPHV DUH IRUPXODWHG ZLWK SKRVSKRWLG\OFKROLQH DQG FKROHVWHURO DUH H[DPSOHV RI WKLV 7KHVH DUH DOVR UHIHUUHG WR DV QRQWDUJHWLQJ OLSRVRPHV /LSRVRPHV ZKLFK DUH S+VHQVLWLYH ZHUH GHVLJQHG WR UHOHDVH WKHLU FRQWHQW DV WKH\ SDVV WKURXJK UHJLRQV RI ORZ S+ 7KH\ FDQ EH XVHG WR WDNH DGYDQWDJH RI WKH S+ JUDGLHQW RI WKH HQGRF\WLF SURFHVV WR DYRLG O\VRVRPDO GHJUDGDWLRQ DQG WR LPSURYH WKH LQWUDFHOOXODU GHOLYHU\ RI PDFURPROHFXOHV> @ 2QH ZD\ WR PDNH S+ VHQVLWLYH OLSRVRPHV LV WR UHFRQVWLWXWH LW ZLWK D YLUXVH VXFK DV YHVLFXODU VWRPDWLWLV YLUXV RU ZLWK LQIOXHQ]D YLUXV PHPEUDQH JO\FRSURWHLQV 7KHVH SURWHLQV XQGHUJR FRQIRUPDWLRQDO FKDQJHV DW ORZ S+ OHYHOV DQG SURPRWH DFLGLQGXFHG OLSRVRPHFHOO IXVLRQ DQG LQFUHDVHG GHOLYHU\ RI WKH HQFDSVXODWHG FRQWHQWV LQWR WKH F\WRSODVP>@ 7KH SRO\PRUSKLF SKDVH EHKDYLRU RI VRPH XQVDWXUDWHG OLSLGV SURYLGHV DQRWKHU ZD\ WR PDNH S+VHQVLWLYH OLSRVRPHV 7KH PRVW FRPPRQO\ XVHG OLSLG FRUQSRVLWLRQ RI S+ VHQVLWLYH OLSRVRPH LV GLROH\OSKRVSKDWLG\OHWKDQRODPLQH'23(f ZKLFK KDV LRQL]DEOH KHDGJURXSV $W ORZ S+ WKH KHDGJURXS EHFRPHV SURWRQDWHG DQG IRUPV WKH LQYHUWHG KH[DJRQDO +,,f SKDVH UDWKHU WKDQ WKH ELOD\HUV REVHUYHG XQGHU QRUPDO SK\VLRORJLFDO S+>@ 7KH LQYHUWHG PROHFXOHV IXVH PRUH UHDGLO\ ZLWK WKH HQGRVRPDO PHPEUDQH DQG OHDGV WR WKH UHOHDVH RI WKH OLSRVRPH FRQWHQWV ,PPXQROLSRVRPHV UHIHU WR OLSRVRPHV OLQNHG WR DQWLERGLHV WKDW DUH GHVLJQHG WR WDUJHW FHOOV ZKLFK H[SUHVV VXIILFLHQW DQG VSHFLILF DQWLJHQV >@ 7KLV PHWKRG

PAGE 48

KDV EHHQ DSSOLHG WR WUHDW WXPRU FHOOV E\ LQFRUSRUDWLQJ LQ WKH OLSRVRPH WKH DQWLERGLHV DJDLQVW IRODWH SURWHLQ ZKLFK KDV RYHU D IROG KLJKHU H[SUHVVLRQ LQ WXPRU WKDQ LQ QRUPDO FHOOV DQG ZDV VKRZQ WR JLYH PRUH VSHFLILF WDUJHWLQJ WR WXPRU FHOOV &DWLRQLF OLSRVRPHV DV D '1$ FDUULHU V\VWHP ZDV ILUVW UHSRUWHG E\ )HOJHU HW DO XVLQJ WKH V\QWKHWLF FDWLRQLF OLSLG 1 > GLROH\@ R[\f SURS\O@ 1 1 1ULPHWK\ODPPRQLXPQ FKORULGH '270$f LQ FRPELQDWLRQ ZLWK '23(>@ 7KH SRVLWLYHO\ FKDUJHG FDWLRQLF OLSRVRPHV IRUP D FRPSOH[ ZLWK WKH QHJDWLYHO\ FKDUJHG '1$ 7KHVH FRPSOH[HV FRQWDLQ H[FHVV FDWLRQLF OLSLGV ZKLFK QHXWUDOL]H WKH QHJDWLYH FKDUJH RI WKH '1$ DQG SURYLGH WKH FRPSOH[ ZLWK D QHW SRVLWLYH FKDUJH DOORZLQJ LQWHUDFWLRQ ZLWK QHJDWLYHO\ FKDUJHG FHOO VXUIDFH 6XEVWLWXWLRQ ZLWK QHJDWLYHO\ FKDUJHG OLSLGV ZDV VKRZQ WR VXSSUHVV WKH GHOLYHU\>@ +\SRWKHVLV %DVHG RQ WKHVH LQIRUPDWLRQ RXU K\SRWKHVLV LV LQKLELWLRQ RI DQJLRWHQVLQRJHQ E\ DQWLVHQVH ROLJRGHR[\QXFOHRWLGH WR DQJLRWHQVLQRJHQ P51$ DWWHQXDWHV K\SHUWHQVLRQ LQ WKH 6+5 UDW PRGHO DQG WKLV EORRG SUHVVXUH GHFUHDVH PD\ EH SURORQJHG YLD RSWLPL]DWLRQ RI URXWH RI $62'1 DGPLQLVWUDWLRQ DQG RSWLPL]DWLRQ RI ROLJRQXFOHRWLGH GHOLYHU\ 7R WHVW WKLV K\SRWKHVLV ERWK LQ YLWUR DQG LQ YLYR VWXGLHV ZLOO EH FRQGXFWHG

PAGE 49

&+$37(5 *(1(5$/ 0$7(5,$/ $1' 0(7+2'6 $QLPDOV 0DOH VSRQWDQHRXVO\ K\SHUWHQVLYH UDWV6+5f 6SUDJXH 'DZOH\ DQG :LVWDU.\RWR:.
PAGE 50

UHFRYHU IRU KRXUV DIWHU FDWKHWHUL]DWLRQ EHIRUH H[SHULPHQWDWLRQ %ORRG 3UHVVXUH 0HDVXUHPHQWV %ORRG SUHVVXUH ZDV PHDVXUHG E\ GLUHFW PHWKRG RU LQGLUHFWO\ XVLQJ WKH WDLO FXII PHWKRG )RU WKH GLUHFW PHWKRG D FDWKHWHU ZDV LQVHUWHG LQWR WKH H[WHUQDO FDURWLG DUWHU\ DQG FRQQHFWHG WR D SUHVVXUH WUDQVGXFHU WKDW ZDV LQWHUIDFHG ZLWK D 'LJL0HG %3 $QDO\]HUPLFUR0HG ,QGLDQDSROLV ,QGf 6LJQDOV ZHUH UHFRUGHG RQ D *RXOG 7$ (DV\*UDI 3K\VLRJUDSK ZKLFK SURYLGHV LQIRUPDWLRQ RQ V\VWROLF GLDVWROLF DQG PHDQ DUWHULD SUHVVXUH DQG KHDUW UDWH 7KH LQGLUHFW PHWKRG UHIHUV WR WKH WDLOFXII SOHWK\Vn PRJUDSK\ PHWKRG>@ 7KH UDWV ZHUH ILUVW ZDUPHG IRU PLQXWHV DW r& LQ D WKHUPRVWDWLFDOO\ FRQWUROOHG KHDWLQJ FDELQHW IRU EHWWHU GHWHFWLRQ RI WDLO DUWHU\ SXOVH 7KHQ WKH UDWV ZHUH SXW LQ D KROGHU ZLWK KHDWLQJ SDG 7KHLU WDLOV ZHUH SDVVHG WKURXJK DQ LQIODWDEOH FXII DQG D UXEEHU EXOE FRQQHFWHG WR D SXOVH WUDQVGXFHU ZDV WDSHG RQ WKH WDLO GLVWDO WR WKH FXII 7KH SUHVVXUH LQ WKH FXII ZDV LQFUHDVHG UDSLGO\ ZKHQ LQIODWHG XQWLO WKH WDLO SXOVH GLVDSSHDUHG DQG WKHQ UHOHDVHG VORZO\ :KHQ SUHVVXUH LQ WKH WDLO DUWHULHV H[FHHG WKDW LQ WKH FXII WKH SXOVH UHDSSHDUHG DQG V\VWROLF SUHVVXUH ZDV LQGLFDWHG E\ WKH OHYHO RI WKH ILUVW SXOVH ZDYH 'DLO\ YDOXHV ZHUH REWDLQHG E\ DYHUDJLQJ VXFFHVVLYH UHDGLQJV &HOO &XOWXUH

PAGE 51

+,, ( +HSDWRPD 5HXEHU + UDW FHOOV ZHUH SXUFKDVHG IURP $7&& 5RFNYLOOH 0DU\ODQGf &HOOV ZHUH JURZQ LQ D PRQROD\HU FXOWXUH RQ FP SHWUL GLVKHV LQ PO RI (DJOHV 0LQLPXP (VVHQWLDO 0HGLXP (0(0f VXSSOHPHQWHG ZLWK b IHWDO ERYLQH VHUXP b FDOI VHUXP DQG LQFXEDWHG LQ b DLUb & DW r& 7KH FXOWXUH PHGLXP ZDV FKDQJHG HYHU\ RWKHU GD\ &HOOV ZHUH SDVVDJHG XQWLO FRQIOXHQW DW D UDWLR RI XVLQJ PO RI b WU\SVLQ('7$ LJRGHR[\QXFOHRWLGHV 7KH DQWLVHQVH ROLJRGHR[\QXFLHRWLGH $62'1f ZDV GHVLJQHG EDVHG RQ WKH DQJLRWHQVLQRJHQ$*7f P51$ VHTXHQFH SXEOLVKHG E\ NKXER>@ 7KH $62'1 LV DQ PHU FRPSOHPHQWDU\ WR WKH WR EDVH VHTXHQFH RI $*7 P51$ DQG FRYHUV WKH $8* WUDQVODWLRQ VWDUW FRGRQ 7KH VHTXHQFH LV n&&*7***$*7&$ 7&$&**n 7KH VFUDPEOHG 2'1 6FU2'1f KDV WKH VDPH EDVH FRPSRVLWLRQ EXW LQ UDQGRP RUGHU f7&*&7$$*&**&$*&*7*n %RWK QXFOHRWLGHV ZHUH V\QWKHVL]HG LQ WKH SKRVSKRURWKLRDWHG IRUP LQ WKH '1$ 6\QWKHVLV /DERUDWRU\ 8QLYHUVLW\ RI )ORULGD /LSRVRPH 6\QWKHVLV 3KRVSKDWLG\OFKROLQHFKROHVWHURO OLSRVRPHV ZHUH FRPSRVHG RI b SKRVSKDWLG\OFKROLQH DQG b FKROHVWHURO $YDQWL 3RODU /LSLGV ,QF $ODEDVWHU $ODEDPDf /LSRVRPHV ZHUH SUHSDUHG E\ WKH UHYHUVH SKDVH HYDSRUDWLRQ PHWKRG>@ 7KH OLSLGV ZHUH GULHG DQG GLVSHUVHG E\ URWDU\ HYDSRUDWLRQ DQG WKHQ UHK\GUDWHG LQ SKRVSKDWH EXIIHU WR IRUP PXOWLODPHOODU

PAGE 52

YHVLFOHV E\ PHFKDQLFDO VKDNLQJ 7KH YHVLFOHV ZHUH VXEMHFWHG WR WHQ IUHH]HWKDZ F\FOHV WR HQKDQFH 2'1 HQWUDSPHQW /LSRVRPHV ZHUH WKHQ SDVVHG WKURXJK D SP ILOWHU PHPEUDQH IRU VL]H UHGXFWLRQ &DWLRQLF OLSRVRPHV ZHUH FRPSRVHG RI GLPHWK\OGLRFWDGHF\O DPPRQLXP EURPLGH ''$%f DQG GLROHR\OSKRVSKDWLG\OHWKDQRO DPLQH '23(f ZZf $YDQWL 3RODU OLSLGV $ODEDVWHU $ODEDPDf /LSLGV ZHUH GLVSHUVHG DQG UHK\GUDWHG LQ PO GHLRQL]HG ZDWHU DQG VRQLFDWHG WR UHGXFH WKH VL]H WR DERXW QP $62'1V ZHUH FRPSOH[HG ZLWK FDWLRQLF OLSRVRPHV E\ PL[LQJ DW D FKDUJH UDWLR RI $62'1FDWLRQLF OLSLGV RI DQG LQFXEDWHG DW URRP WHPSHUDWXUH IRU PLQXWHV EHIRUH H[SHULPHQWV>@ 1RUWKHUQ %ORW $QDO\VLV P51$ ZDV LVRODWHG XVLQJ DFLGLF JXDQLGLXP WKLRF\DQDWH SKHQROFKORURIRUP>@ DQG TXDQWLILHG E\ GHQVLWRPHWU\>@ &HOOV RU WLVVXHV ZHUH O\VHG XVLQJ PHUFDSWRHWKDQRO WKHQ UHDWHG ZLWK JXDQLGLXP WKLRF\DQDWH IROORZHG E\ SKHQRO DQG FKORURIRUP H[WUDFWLRQ 51$ ZDV WKHQ SUHFLSLWDWHG E\ LVRSURSDQRO DW r& HYDSRUDWHG DQG UHVXVSHQGHG LQ VWHULOH ZDWHU 7KH FRQFHQWUDWLRQ RI WRWDO 51$ ZDV PHDVXUHG E\ VSHFWURSKRWRPHWU\ DW D ZDYHOHQJWK RI QP $Q DOLTXRW RI SJ WRWDO P51$ ZDV VHSDUDWHG E\ HOHFWURSKRUHVLV RQ DQ DJDURVH IRUPDOGHK\GH JHO DW 9 IRU KRXUV 51$V ZHUH WKHQ LPPRELOL]HG RQ QLWURFHOOXORVH PHPEUDQHV E\ FDSLOODU\ WUDQVIHU 7KH 51$ ZDV WKHQ VXEMHFWHG WR SUHK\EULGL]DWLRQ IRU

PAGE 53

KRXUV DW r& ZLWK [ 'HQKDUGWV 663( VROXWLRQ [ 663( b 6'6 b IRUPDPLGH DQG PJPO GHQDWXUHG VDOPRQ VSHUP '1$ +\EULGL]DWLRQ ZDV FDUULHG RXW XQGHU WKH VDPH FRQGLWLRQV ZLWK D 3 ODEHOHG ULERSUREH WR WKH VSHFLILF P51$ VHTXHQFH $IWHU VWULQJHQF\ ZDVKHV WKH PHPEUDQH ZDV H[SRVHG WR ;UD\ ILOP WKHQ GHYHORSHG 0HPEUDQHV ZHUH UHSUREHG ZLWK &DWKHSVLQ P51$ WR HQVXUH HTXDO ORDGLQJ $QJLRWHQVLQRJHQ $VVD\ $OLTXRWV RI XO RI FXOWXUH PHGLXP RU UDW SODVPD ZHUH HYDSRUDWHG WR GU\QHVV 7KH GULHG VDPSOHV ZHUH DVVD\HG IRU $*7 E\ WKH GLUHFW UDGLRLPPXQRDVVD\ PHWKRG RI 6HUQLD>@ $*7 VDPSOH FRQWHQW ZDV PHDVXUHG IURP D VWDQGDUG FXUYH RI SXUH UDW $*7 GLOXWHG LQ WKH VDPH FHOO FXOWXUH PHGLXP RU SODVPD 7KH DVVD\ VHQVLWLYLW\ ZDV QJWXEH ZLWK DQ LQWHUDVVD\ DQG LQWUDDVVD\ YDULDELOLW\ RI b DQG b UHVSHFWLYHO\ $QJLRWHQVLQ ,, $VVD\ 3ODVPD VDPSOHV ZHUH H[WUDFWHG XVLQJ PHWKDQRO DQG WULIOXRURDFHWDWH RQ & UHYHUVH SKDVH H[WUDFWLRQ FDUWULGJHV9DULDQ :LQGKDP 1+f $QJLRWHQVLQ ,,$QJ ,,f ZDV PHDVXUHG E\ GRXEOHUDGLRLPPXQRDVVD\ 5.$ $OSFR :LQGKDP 1+f 7KH VDPSOHV ZHUH ILUVW LQFXEDWHG IRU KRXUV ZLWK DQ DQWLDQJLRWHQVLQ ,, DQWLERG\ 7KH ,$QJ ,, FRPSHWHV ZLWK $QJ ,, SUHVHQW LQ WKH VDPSOHV DQG VWDQGDUGV IRU WKH VDPH DQWLERG\ ELQGLQJ VLWHV $ VROLGSKDVH VHFRQG DQWLERG\ LV

PAGE 54

WKHQ DGGHG DQG DQWLERG\ERXQG IUDFWLRQ LV SUHFLSLWDWHG DQG FRXQWHG RQ D %HFNPDQ '3 *DPPD FRXQWHU 7KH VHQVLWLYLW\ RI WKH DVVD\ LV SJPO $QJ ,, DQG WKHUH LV PLQLPDO FURVVn UHDFWLRQ ZLWK RWKHU SHSWLGHV 5HYHUVHWUDQVFULSWDVH 3RO\PHUDVH &KDLQ 5HDFWLRQ573&5f 573&5 ZDV XVHG WR TXDQWLI\ PHVVHQJHU 51$ 7RWDO P51$ ZDV ILUVW LVRODWHG WKHQ FRQYHUWHG WR F'1$ 7KH F'1$ ZDV WKHQ DPSOLILHG E\ WKHUPRF\FOLQJ 7RWDO P51$ ZDV LVRODWHG XVLQJ DFLGLF JXDQLGLXP WKLRF\DQDWHSKHQROFKORURIRUP 7KHQ XJ RI WRWDO P51$ ZDV PL[HG ZLWK P0 G173 _D0 0J&O S0 ROLJR G7f 8XO RI 51DVH LQKLELWRU DQG 8XO RI UHYHUVH WUDQVFULSWDVH3URPHJD 0DGLVRQ :,f LQ D XO YROXPH 7KH UHDFWLRQ ZDV LQFXEDWHG DW r& IRU KRXU WKHQ KHDWHG DW r& IRU PLQXWHV IROORZHG E\ D PLQXWH LQFXEDWLRQ DW r& )LYH PLFUROLWHUV RI 57 SURGXFW ZDV WKHQ VXEMHFWHG WR 3&5 UHDFWLRQ 7KH 3&5 UHDFWLRQ ZDV SHUIRUPHG LQ D WRWDO YROXPH RI XO LQ WKH SUHVHQFH RI P0 RI G173 SPROXO RI SULPHUV 8XO RI 7$4 3RO\PHUDVH DQG 0 RI 0J&O 3URPHJD 0DGLVRQ :,f 7KH WKHUPRF\FOH ZDV SURJUDPPHG DV 6WHS PLQXWHV DW r& 6WHS F\FOHV DW PLQXWH DW r& PLQXWHV DW r& PLQXWHV DW r& 6WHS PLQXWHV DW r& $*7 DQG FRQWURO JHQHV ZHUH DPSOLILHG LQ WKH VDPH UHDFWLRQ WR HOLPLQDWH WKH IDFWRUV WKDW ZRXOG DIIHFW WKH DPSOLILFDWLRQ

PAGE 55

HIILFLHQF\ 7KH VL]HV RI WKH WZR DPSOLILHG SURGXFWV ZHUH $*7 ES DFWLQ ES 7HQ PLFUROLWHUV RI HDFK 3&5 UHDFWLRQ PL[WXUH ZHUH VHSDUDWHG ZLWK b DJDURVH JHO XVLQJ WKH HOHFWURSKRUHVLV PHWKRG DQG VWDLQHG ZLWK HWKLGLXP EURPLGH DQG SKRWRJUDSKHG 7KH GHQVLW\ RI WKH EDQGV ZHUH WKHQ PHDVXUHG E\ GHQVLWRPHWHU%LRUDG %RVWRQ 0$f DQG WKH UDWLR RI GHQVLW\ EHWZHHQ WKH $*7 DQG FRQWURO ZHUH SORWWHG 7KH SULPHU VHTXHQFHV IRU $*7 ZHUH 6HQVH &$$&$&&7$&*77&$&77&& DQG $QWLVHQVH *$*77&$$**$**$7*&7*7 7KH SULPHU VHTXHQFHV IRU FRQWURO SDFWLQ ZHUH 6HQVH $$&&*&*$*$$*$7*$&&&$*$7&$7*777 DQG $QWLVHQVH $*&$*&&*7**&&$7&7&77*&7&*$$*7& >@ )OXRU LPH/UOFB$QDs\DLV &HOOV RU ZHLJKHG WLVVXH ZHUH SUHSDUHG IRU IOXRULPHWULF DQDO\VLV RI IOXRUHVFHLQ LVRWKLRF\DQDWH ),7&fFRQMXJDWHG ROLJRQXFOHRWLGH E\ KRPRJHQL]DWLRQ LQ PO 3%6 IROORZHG E\ FHQWULIXJDWLRQ DW USP IRU PLQXWHV 7KH VXSHUQDWDQW ZDV DVSLUDWHG DQG IOXRUHVFHQFH DFWLYLW\ ZDV GHWHUPLQHG RQ D 3HUNLQ (OPHU /XPLQHVFHQFH 6SHFWURPHWHU H[FLWDWLRQ QP DQG HPLVVLRQ QP 7KH SHUFHQWDJH RI ROLJRQXFOHRWLGH SUHVHQW LQ HDFK VDPSOH ZDV GHWHUPLQHG E\ GLYLGLQJ WKH IOXRUHVFHQFH RI WKH VDPSOH E\ WKH IOXRUHVFHQFH RI D VWDQGDUG FRQWDLQLQJ RQO\ PO 3%6 DQG >LJ ),7&FRQMXJDWHG ROLJRQXFOHRWLGH &RQIRFDO 0LFURVFRS\ 0LFURVFRSLFDO DQDO\VLV RI ),7& FRQMXJDWHG $62'1 XSWDNH DQG GLVWULEXWLRQ ZDV FDUULHG RXW RQ D 1LNRQ 2SWLSKRW

PAGE 56

)OXRUHVFHQW ODVHU VFDQQLQJ FRQIRFDO PLFURVFRSH LQ WKH &HQWHU IRU 6WUXFWXUDO %LRORJ\ DW WKH 8QLYHUVLW\ RI )ORULGD &HOOV ZHUH JURZQ RQ SODLQ JODVV PLFURVFRSH VOLGHV $IWHU WUHDWHG ZLWK $62'1 36$62'1 RU &$$62'1 IRU IRXU KRXUV FHOOV ZHUH IL[HG XVLQJ b IRUPDOGHK\GH DQG WKHQ VOLGHV ZHUH PRXQWHG XVLQJ *HO 0RXQW %LRUDG %RVWRQ 0$f DQG PLFURJUDSKV ZHUH REWDLQHG DW H[FLWDWLRQ DQG HPLVVLRQ ZDYHOHQJWKV RI DQG QP UHVSHFWLYHO\ 077 7HVW 077> GLPHWK\OWKLD]ROH\OfGLSKHQ\OWHWUD]ROLXP EURPLGH@ WHVW GHVFULEHG E\ 0RVVUDDQQ>@ ZDV XVHG DV DQ LQ YLWUR WHVW IRU FHOOXODU WR[LFLW\ 7KH FHOOV ZHUH JURZQ LQ D ZHOO FXOWXUH SODWH $IWHU D KRXU LQFXEDWLRQ ZLWK $62'1V FDWLRQLF OLSLGV RU &$$62'1 FRPSOH[HV WKH PHGLXP ZDV GHFDQWHG $ XO 077 VWRFN VROXWLRQ PJPO LQ 3%6f ZDV DGGHG WR PO FXOWXUH PHGLXP $IWHU KRXU LQFXEDWLRQ DW r& WKH 077 FOHDYDJH SURGXFW IRUPD]DQ ZDV VROXELOL]HG E\ WKH DGGLWLRQ RI PO 1 +& SUHSDUHG LQ LVRSURSDQRO 7KH RSWLFDO GHQVLW\ RI WKH SURGXFW ZDV PHDVXUHG XVLQJ D UHIHUHQFH ZDYHOHQJWK RI QP DQG D WHVW ZDYHOHQJWK RI QP E\ PLFURSODWH UHDGHU %LRUDG %RVWRQ 0$f $OGRVWHURQH $QDO\VLV 3ODVPD VDPSOHV ZHUH FROOHFWHG DQG VWRUHG DW r& $OGRVWHURQH ZDV PHDVXUHG E\ UDGLRLPPXQRDVVD\ '6/ $&7,9( $OGRVWHURQH 5DGLRLPPXQRDVVD\ &RDWHG7XEH .LW

PAGE 57

'LDJQRVWLF 6\VWHPV /DERUDWRULHV ,QF 7H[DVf 7KH SURFHGXUH LV EDVHG RQ WKH EDVLF SULQFLSOH RI LPPXQRDVVD\ ZKHUH WKHUH LV FRPSHWLWLRQ EHWZHHQ D UDGLRDFWLYH DQG QRQUDGLRDFWLYH DQWLJHQ IRU D IL[HG QXPEHU RI DQWLERG\ ELQGLQJ VLWHV 7KH ERXQG DQWLJHQ LV VHSDUDWHG IURP IUHH DQWLJHQ E\ GHFDQWLQJ WKH DQWLERG\ FRDWHG WXEHV 7KH VHQVLWLYLW\ RI WKH DVVD\ ZDV SJPO &URVVUHDFWLYLW\ WR FORVHO\ UHODWHG QDWXUDOO\ RFFXUULQJ VWHURLGV ZDV UHSRUWHG DV QHJOLJLEOH 6RGLXPSRWDVVLXP $QDO\VLV 8ULQH VDPSOHV ZHUH FHQWULIXJHG DQG WKH VXSHUQDWDQW ZDV VDYHG IRU DQDO\VLV RQ D 129$ $XWRPDWHG 6RGLXP3RWDVVLXP $QDO\]HU 129$ %LRPHGLFDO 0DVVDFKXVHWWVf 7KH SULQFLSOH RI WKH DVVD\ LV EDVHG RQ WKH HOHFWULFDO SRWHQWLDO RI WKH VROXn WLRQ PHDVXUHG DJDLQVW D UHIHUHQFH HOHFWURGH 6WDWLVWLFDO $QDO\VLV 6WDWLVWLFDO DQDO\VLV ZDV SHUIRUPHG E\ $129$ IRU WUHDWPHQW HIIHFW DQG WKH 'XQFDQ PXOWLSOH UDQJH WHVW ZDV XVHG IRU LQGLYLGXDO FRPSDULVRQV 'DWD IRU LQGLYLGXDO WLPH SRLQWV ZHUH DQDO\]HG XVLQJ WKH 6WXGHQWV LQGHSHQGHQW 7WHVW 6LJQLILFDQFH ZDV DW WKH b FRQILGHQFH OLPLW

PAGE 58

&+$37(5 /,32620(0(',$7(' 2/,*218&/(27,'( '(/,9(5< ,1 +(3$720$ &(// &8/785( 6SHFL ILU $LPV 7KH KHSDWRPD + FHOO FXOWXUH H[SHULPHQWV VHHN WR HYDOXDWH WZR VSHFLILF DLPV 7KH ILUVW LV WR GHYHORS DQ HIILFLHQW GHOLYHU\ PHFKDQLVP IRU DQWLVHQVH ROLJRQXFOHRWLGH WDUJHWHG WR DQJLRWHQVLQRJHQ P51$ IRU FHOOV LQ FXOWXUH WKH VHFRQG LV WR GHWHUPLQH WKH XSWDNH HIILFLHQF\ FHOOXODU GLVWULEXWLRQ F\WRWR[LFLW\ DQG HIIHFWV RI WKH DQWLVHQVH ROLJRQXFOHRWLGHV RQ $*7 P51$ DQG SURWHLQ H[SUHVVLRQ LQ KHSDWRPD + FHOO FXOWXUH ,QW[DGXFWL4LL 3KDUPDFHXWLFDO DJHQWV WDUJHWHG WR EORFN WKH UHQLQ DQJLRWHQVLQ V\VWHP DUH HIIHFWLYH LQ WUHDWLQJ K\SHUWHQVLRQ >@ &XUUHQWO\ WKHUH DUH QR GUXJV DYDLODEOH WR EORFN WKH SUHFXUVRU RI WKH 5$6 DQJLRWHQVLQRJHQ ,Q RXU SUHYLRXV VWXGLHV $62'1 ZDV GHVLJQHG WR K\EULGL]H WR WKH $8* VWDUW FRGRQ RI DQJLRWHQVLQRJHQ P51$>@ 7KLV $62'1 VXFFHVVIXOO\ GHFUHDVHG EORRG SUHVVXUH LQ 6+5 ZKHQ DGPLQLVWHUHG ERWK FHQWUDOO\ DQG SHULSKHUDOO\ 7KLV WUHDWPHQW KRZHYHU GLG QRW UHWXUQ HOHYDWHG EORRG SUHVVXUHV WR QRUPDO OHYHOV DQG WKH HIIHFW ODVWHG RQO\ IRU D OLPLWHG WLPH 2QH KXUGOH WR $62'1

PAGE 59

XVH LV LWV SRRU WLVVXH RU FHOOXODU XSWDNH >@ /LSRVRPH YHKLFOHV ZHUH XWLOL]HG WR LPSURYH $62'1 GHOLYHU\ E\ LQFUHDVLQJ WKH LQWHUDFWLRQ RI WKH $62'1 ZLWK WLVVXHV RU FHOOV WR SURWHFW WKH $62'1 IURP GHJUDGDWLRQ E\ LQWUDFHOOXODU HQ]\PHV>@ &DWLRQLF OLSRVRPHV KDYH EHHQ VKRZQ WR EH HIIHFWLYH IRU GHOLYHULQJ ROLJRQXFOHRWLGHV LQ FHOO FXOWXUH >@ (YHQ WKRXJK QRYHO V\QWKHWLF FDWLRQLF OLSLGV KDYH EHHQ UHSRUWHG WR SURYLGH KLJKHU HIILFLHQF\ LQ WHVWHG FHOO OLQHV LQ JHQHUDO QR VLQJOH FDWLRQLF OLSLG IRUPXODWLRQ DSSHDUV WR EH XQLIRUPO\ VXSHULRU WR RWKHUV>@ 7UDQVIHFWLRQ FRQGLWLRQV PXVW EH RSWLPL]HG LQGLYLGXDOO\ IRU HDFK FDWLRQLF OLSRVRPH IRUPXODWLRQ DQG FHOO OLQH 7KH IROORZLQJ SDUDPHWHUV PD\ EH PRGXODWHG WKH '1$ WR OLSLG UDWLR RI WKH FRPSOH[ WKH WRWDO GRVH RI '1$OLSLG FRPSOH[ DGGHG WKH GHQVLW\ DQG GLYLGLQJ VWDJH RI WKH FXOWXUHG FHOOV WKH PHGLXP LQ ZKLFK WKH FHOOV DUH FXOWXUHG WKH GXUDWLRQ RI H[SRVXUH RI WKH OLSRVRPH'1$ FRPSOH[HV WR WKH FHOOV DQG WKH WLPH SRLQWV ZKHQ WKH FHOOV DUH DQDO\]HG>@ 0RVW FDWLRQLF OLSRVRPHV IRUPXODWHG FRQWDLQ WZR OLSLG VSHFLHV D FDWLRQLF DPSKLSKLOH DQG D QHXWUDO SKRVSKROLSLG ZKLFK IXQFWLRQV DV IXVRJHQ W\SLFDOO\ GLROHR\OSKRVSKDWLG\O HWKDQRODPLQH'23(f &DWLRQLF YHVLFOHV IRUPXODWHG ZLWKRXW '23( KDYH EHHQ VKRZQ WR EH WR IROG OHVV DFWLYH WKDQ WKH RQH ZLWK '23(>@ 7KH HIIHFW RI '23( LV DWWULEXWHG WR LWV FDSDFLW\ IRU WUDQVLWLRQ IURP WKH ELOD\HU SKDVH LQWR WKH LQYHUWHG KH[DJRQDO SKDVH ZKLFK OHDGV WR LQFUHDVHG PHPEUDQH

PAGE 60

IXVLRQ>@ 5HSODFLQJ '23( ZLWK RWKHU QHXWUDO SKRVSKROLSLGV RI WKH VDPH DF\O FKDLQ ZLWK D FKROLQH KHDG JURXS LQVWHDG RI WKH HWKDQRODPLQH VXFK DV GLROHR\OSKRVSKDWLG\OFKROLQH '23&f DEROLVK PRVW RI WKH WUDQVIHFWLRQ DFWLYLW\ RI WKH OLSRVRPHV>@ &RPSDUHG ZLWK FRQYHQWLRQDO OLSRVRPHV FDWLRQLF OLSRVRPHV GR QRW UHTXLUH DQ HQFDSVXODWLRQ VWHS WKDW OLPLWV WKH DSSOLFDWLRQ RI WKH FDUULHU ,QVWHDG QHJDWLYHO\ FKDUJHG $62'1V DUH GLUHFWO\ PL[HG ZLWK SUHIRUPHG OLSRVRPHV DQG IRUP FRPSOH[HV WKURXJK HOHFWURVWDWLF LQWHUDFWLRQ ZLWK FDWLRQLF OLSLGV >@ 'HVSLWH WKH IDFW WKDW WKH SK\VLFRFKHPLFDO SURSHUWLHV RI WKH FDWLRQLF OLSLGV DQG $62'1 FRPSOH[HV DUH SRRUO\ FKDUDFWHUL]HG LW LV JHQHUDOO\ DJUHHG WKDW WKH FKDUJH UDWLR RI WKH $62'1V WR WKH FDWLRQLF OLSLG LV D FULWLFDO SDUDPHWHU 7KH FKDUJH UDWLR GHWHUPLQHV VXFK IDFWRUV DV FRPSDFWQHVV RI WKH FRPSOH[ WKH PDVNLQJ RI WKH QHJDWLYH FKDUJHV RI WKH $62'1V DQG WKH VWHULF LQWHUDFWLRQ RI WKH FRPSOH[ ZLWK WKH FHOO PHPEUDQH>@ 1XPHURXV VWXGLHV KDYH VKRZQ WKDW WUDQVIHFWLRQ HIILFLHQF\ FKDQJHV GUDPDWLFDOO\ ZLWK GLIIHUHQW UDWLRV RI '1$ WR FDWLRQLF OLSLG>@ 7KH PHFKDQLVP RI FHOOXODU GHOLYHU\ RI WKH FDWLRQLF OLSRVRPH2'1 FRPSOH[ LV YLD DQ HQGRF\WRWLF SURFHVV PDLQO\ PHGLDWHG E\ WKH PRQRQXFOHDU SKDJRF\WH V\VWHP EXW DOVR E\ QRQSKDJRF\WLF FHOOV VXFK DV ILEUREODVWV NLGQH\ FHOOV O\PSKRF\WHV DQG KHSDWRF\WHV>@ 7KH QRQUHFHSWRUPHGLDWHG HQGRF\WRVLV DSSHDUV WR EH VWULFWO\ GHSHQGHQW RQ WKH VL]H RI WKH OLSRVRPHV 7LJKWO\ FRPSDFWHG FRQGHQVHG VPDOOVL]HG

PAGE 61

FDWLRQLF OLSRVRPH$62'1 FRPSOH[HV DUH PRUH IDYRUDEOH IRU XSWDNH E\ HQGRF\WRVLV 7KH RSWLPDO VL]H RI WKH FRPSOH[HV LV QP 9HVLFOHV ODUJHU WKDQ QP DUH QRW IDYRUHG IRU HQGRF\WRVLV 7KH SDUWLFOH VL]H RI WKH FDWLRQLF OLSRVRPH2'1 FRPSOH[ UDQJHV IURP QP WR QP DQG GHSHQGV RQ VHYHUDO IDFWRUV VXFK DV LfWKH FDWLRQLF OLSLG VSHFLHV LLfWKH DPRXQW RI QHXWUDO FROLSLG OLNH '23( LLLfWKH FDWLRQLF OLSLG'1$ UDWLR LYfWKH FRQFHQWUDWLRQ RI OLSLG DQG '1$ LQ WKH ILQDO IRUPXODWLRQ DQG YfWKH FRPSRVLWLRQ RI WKH VXVSHQGLQJ YHKLFOH >@ 6XFFHVVIXO JHQH LQKLELWLRQ E\ $62'1 KDV EHHQ UHSRUWHG LQ YDULRXV ELRORJLFDO V\VWHPV>@ 7KH REVHUYHG ELRORJLFDO HIIHFWV KDYH PDLQO\ EHHQ REVHUYHG DW KLJK FRQFHQWUDWLRQV RI $62'1 ZKHQ VRPH QRQVSHFLILF HIIHFWV ZHUH SURGXFHG>@ 2XU SUHYLRXV LQ YLWUR WUDQVFULSWLRQWUDQVODWLRQ VWXG\ VKRZHG WKDW D KLJK GRVHV RI 2'1 _LPROOf ERWK $62'1 DQG FRQWURO VFUDPEOHG 2'1 FDXVHG D GHFUHDVH LQ $*7 H[SUHVVLRQ >@ %\ XVLQJ FDWLRQLF OLSRVRPHV LW PD\ EH SRVVLEOH WR GHFUHDVH WKH GRVH RI $62'1 UHTXLUHG WR SURGXFH WKH VDPH ELRORJLFDO HIIHFW ZKLOH GHFUHDVLQJ WKH SRWHQWLDO IRU QRQn VSHFLILF HIIHFWV FDXVHG E\ $62'1 &DWLRQLF OLSLGV VXFK DV ''$% KDYH EHHQ UHSRUWHG WR EH KLJKO\ WR[LF WR FHOOV 7KH\ DUH VLPLODU WR VXUIDFWDQW PROHFXOHV $W KLJK FRQFHQWUDWLRQV WKHVH OLSLGV FDXVH FHOO PHPEUDQH GLVUXSWLRQ DQG SRUDWLRQ>@ %HFDXVH RI WKLV WKH WR[LFLW\ RI FDWLRQLF OLSLGV $62'1 DORQH DQG WKH $62'1OLSLG FRPSOH[HV ZHUH GHWHUPLQHG E\ WKH > GLPHWK\OWKLD]ROH

PAGE 62

\OfGLSKHQ\OWHWUD]ROLXP EURPLGH@077f DVVD\ 7KLV DVVD\ LV EDVHG RQ WKH REVHUYDWLRQ WKDW WKH WHWUD]ROLXP VDOW 077 LV DFWLYHO\ DEVRUEHG LQWR FHOOV DQG LV UHGXFHG LQ D PLWRFKRQGULDOGHSHQGHQW UHDFWLRQ WR \LHOG D IRUPD]DQ SURGXFW 7KLV SURGXFW DFFXPXODWHV LQ WKH FHOOV DQG FDQ QRW SDVV WKURXJK WKH FHOO PHPEUDQH 7KH DELOLW\ RI FHOOV WR UHGXFH 077 DV DQ LQGLFDWLRQ RI PLWRFKRQGULDO LQWHJULW\ DQG DFWLYLW\ LV LQWHUSUHWHG DV D PHDVXUH RI FHOO YLDELOLW\ >@ $ FDWLRQLF OLSRVRPH FRPELQDWLRQ RI GLPHWK\OGLRFWDGHF\O DPPRQLXP EURPLGH''$%f DQG GLROHR\OSKRVSKDWLG\OHWKDQRO DPLQH'23(f KDV EHHQ VKRZQ WR KDYH D KLJKHU HIILFLHQF\ FRPSDUHG WR RWKHU OLSLGV 7KH ''$%'23( OLSLG FRPELQDWLRQ LQFUHDVHG 2'1 GHOLYHU\ LQ &DVNL FHOO FXOWXUH IROG FRPSDUHG ZLWK D IROG LQFUHDVH E\ FRPPHUFLDOO\ DYDLODEOH 1GLROHR\OR[\fSURS\Of111WULPHWK\O DPPRQLXPPHWK\OVXOIDWH '27$3f >@ ,Q WKLV VWXG\ ZH XVHG WKH ''$%'23( FDWLRQLF OLSRVRPH FRPELQDWLRQ DV D GHOLYHU\ V\VWHP IRU $62'1 DQG HYDOXDWHG LWV FHOOXODU XSWDNH FKDUDFWHULVWLFV :H DOVR FRPSDUHG WKH XSWDNH HIILFLHQF\ RI $62'1 ZLWK SUHYLRXVO\ XVHG SKRVSKDWLG\OFKROLQH FKROHVWHURO OLSRVRPHV 7KH HIIHFW RI $62'1 RQ $*7 P51$ DQG SURWHLQ ZDV DOVR VWXGLHG LQ UDW +,,( KHSDWRPD FHOO FXOWXUH D FHOO OLQH NQRZQ WR H[SUHVV $*7 P51$ DQG VHFUHWH $*7 SURWHLQ FRQVWLWXWLYHO\>@ 7KH HIIHFW RI D FRQWURO VFUDPEOHG $62'1 DOVR ZDV GHWHUPLQHG WR WHVW WKH VSHFLILFLW\ RI WKH WDUJHW $62'1 VHTXHQFH

PAGE 63

0DWHULDO DQG 0HWKRGV 7R GHWHUPLQH WKH HIIHFWV RI OLSRVRPH FRPSRVLWLRQ RQ WKH FHOOXODU XSWDNH RI 2'1 +,, ( FHOOV ZHUH LQFXEDWHG LQ D PHGLXP FRQWDLQLQJ MD0 ),7&2'1 FRPSOH[HG ZLWK FDWLRQLF OLSRVRPHV FRPSRVHG RI ''$% PJPOf DQG '23( DW GLIIHUHQW ZHLJKW UDWLRV IRU KRXUV &HOOV ZHUH WKHQ ZDVKHG O\VHG DQG WKH FHOOXODU DVVRFLDWHG IOXRUHVFHQFH ZDV PHDVXUHG E\ IOXRURPHWULF DQDO\VLV 7KH HIIHFW RI FDWLRQLF OLSLG WR 2'1 FKDUJH UDWLR RQ WKH FHOOXODU XSWDNH RI 2'1 DOVR ZDV GHWHUPLQHG LQ +,, ( FHOOV 7KH FHOOV ZHUH LQFXEDWHG LQ D PHGLXP FRQWDLQLQJ c-0 ),7&2'1 FRPSOH[HG ZLWK FDWLRQLF OLSRVRPHV ZLWK ''$% WR 2'1 DW GLIIHUHQW FKDUJH UDWLRV IRU KRXUV 7KH FHOOV ZHUH WKHQ O\VHG DQG WKH FHOOXODU DVVRFLDWHG IOXRUHVFHQFH ZDV PHDVXUHG E\ IOXRURPHWULF DQDO\VLV 7KH FRQFHQWUDWLRQ HIIHFWV RI $62'1 ZLWK WKH GHOLYHU\ V\VWHPV RQ $62'1 XSWDNH DOVR ZHUH GHWHUPLQHG + KHSDWRPD FHOO FXOWXUHV ZHUH JURZQ WR FRQIOXHQFH WKHQ WUHDWHG ZLWK HLWKHU FDWLRQLF OLSRVRPHFRPSOH[HG $62'1 3&FKROHVWHURO OLSRVRPHHQFDSVXODWHG $62'1 RU QDNHG $62'1 DW WKH IROORZLQJ FRQFHQWUDWLRQV DQG S0 &XOWXUHV ZHUH LQFXEDWHG IRU KRXUV WKHQ PHGLD ZDV GHFDQWHG DQG FHOOV ZHUH O\VHG DQG DVVD\HG IRU ),7& LQWHQVLW\ XVLQJ IOXRULPHWULF DQDO\VLV 7KH HIIHFWLYHQHVV RI WKH GHOLYHU\ PHFKDQLVP RQ WKH UDWH RI $62'1 FHOOXODU XSWDNH LQ +HSDWRPD + FHOO FXOWXUH ZDV

PAGE 64

GHWHUPLQHG 7KH FHOO FXOWXUHV ZHUH JURZQ WR FRQIOXHQFH DQG WUHDWHG ZLWK HLWKHU D IL0 FDWLRQLF OLSRVRPHFRPSOH[HG $62'1 D IL0 3& FKROHVWHURO OLSRVRPHHQFDSVXODWHG $62'1 RU DQ L0 QDNHG $62'1 &XOWXUHV ZHUH LQFXEDWHG IRU KRXUV 7KH FHOOXODU DVVRFLDWHG IOXRUHVFHQFH ZDV PHDVXUHG DW DQG KRXUV ),7& FRQMXJDWHG $62'1 GLVWULEXWLRQ DQG XSWDNH ZDV DQDO\]HG PLFURVFRSLFDOO\ +HSDWRPD FHOOV ZHUH JURZQ RQ JODVV PLFURVFRSH VOLGHV DQG WUHDWHG ZLWK HLWKHU MD0 RI QDNHG ),7& $62'1 _-0 3& FKROHVWHURO OLSRVRPHHQFDSVXODWHG $62'1 RU c-0 FDWLRQLF OLSRVRPHFRPSOH[HG $62'1 IRU IRXU KRXUV 7KH VOLGHV ZHUH WKHQ PRXQWHG DQG WKH LPDJH ZDV REVHUYHG XQGHU D 1LNRQ 2SWLSKRW)OXRUHVFHQW ODVHU VFDQQLQJ FRQIRFDO PLFURVFRSH 7KH LQ YLWUR HIIHFWV RI FDWLRQLF OLSRVRPH FRPSOH[HG ZLWK $62'1 RQ $*7 P51$ H[SUHVVLRQ DQG $*7 SURWHLQ SURGXFWLRQ ZHUH GHWHUPLQHG LQ KHSDWRPD FHOOV ZKLFK ZHUH JURZQ WR FRQIOXHQFH 7KHVH FHOOV ZHUH WUHDWHG ZLWK HLWKHU _-0 FDWLRQLF OLSRVRPHV FRPSOH[HG ZLWK $62'1 QDNHG $62'1 VFUDPEOHG 2'1 RU FDWLRQLF OLSLGV DORQH &XOWXUHV ZHUH LQFXEDWHG IRU KRXUV WKHQ WKH PHGLXP DQDO\]HG IRU $*7 E\ UDGLRLPPXQRDVVD\ +HSDWRPD FHOOV ZHUH O\VHG IRU P51$ PHDVXUHPHQW E\ 1RUWKHUQ EORW DQDO\VLV +HSDWRPD FHOOV ZHUH WUHDWHG ZLWK FRPSOH[HG $62'1 DW FRQFHQWUDWLRQV RI Q0 Q0 Q0 Q0 DQG BL0 WR

PAGE 65

GHWHUPLQH WKH GRVH UHVSRQVH HIIHFW RI FDWLRQLF OLSRVRPH FRPSOH[HG $62'1 RQ WKH H[SUHVVLRQ RI $*7 P51$ DQG SURWHLQ &HOOV ZHUH LQFXEDWHG ZLWK &$$62'1V DQG FDWLRQLF OLSLGV XVHG LQ WKH IRUPXODWLRQ IRU KRXUV WKHQ WKH $*7 P51$ ZHUH PHDVXUHG E\ 1RUWKHUQ EORW DQDO\VLV DQG WKH $*7 SURWHLQ OHYHOV LQ WKH PHGLXP ZHUH PHDVXUHG E\ UDGLRLPPXQRDVVD\ &HOOXODU WR[LFLW\ ZDV PHDVXUHG XVLQJ WKH 077 WHVW DV GHVFULEHG LQ &KDSWHU &HOOV ZHUH LQFXEDWHG IRU KRXUV LQ PHGLXP FRQWDLQLQJ HLWKHU $62'1 DW FRQFHQWUDWLRQV RI 0 $62'1 FRPSOH[HG ZLWK FDWLRQLF OLSLGV RU WKH FRUUHVSRQGLQJ DPRXQW RI FDWLRQLF OLSLGV XVHG WR FRPSOH[ $62'1 DW HDFK FRQFHQWUDWLRQ $IWHU WUHDWPHQW FHOOV ZHUH ZDVKHG ZLWK SKRVSKDWH EXIIHU DQG LQFXEDWHG LQ PJPO RI 077 IRU KRXUV DW r& $ PO VROXWLRQ RI 1 +& SUHSDUHG LQ LVRSURSDQRO ZDV DGGHG DQG DJLWDWHG IRU PLQXWHV WR VROXELOL]H WKH IRUPD]DQ SURGXFHG 7KH DEVRUEDQFH ZDV PHDVXUHG DW QP E\ PLFURSODWH UHDGHU 5HVXOWV )LJXUH VXPPDUL]HV WKH HIIHFWV RI ''$% WR '23( PRODU UDWLR IURP WR RQ WKH FHOOXODU XSWDNH RI ),7& ODEHOHG $62'1 LQ + +HSDWRPD FHOOV 7KH UHVXOWV GHPRQVWUDWH WKDW ZLWKRXW '23( $62'1 XSWDNH LV ORZ DV GHSLFWHG E\ WKH b RI WRWDO IOXRUHVFHQFH GHWHFWHG LQ WKHVH FHOOV $V WKH '23( FRPSRVLWLRQ RI WKH OLSRVRPHV LQFUHDVHG FHOOXODU XSWDNH RI $62'1 DOVR LQFUHDVHG 0D[LPXP $62'1 XSWDNH REVHUYHG

PAGE 66

ZDV sb3f DW D ''$% WR '23( ZHLJKW UDWLR RI $V PRUH '23( ZDV DGGHG WR WKH OLSRVRPHV WKH $62'1 XSWDNH GURSSHG UDSLGO\ $W D ZHLJKW UDWLR RI WKH $62'1 XSWDNH ZDV sb 7KH RSWLPDO FKDUJH UDWLR RI ''$% WR $62'1 RQ WKH FHOOXODU XSWDNH RI $62'1 ZDV GHWHUPLQHG E\ WUHDWLQJ WKH FHOOV ZLWK OS0 RI ),7&$62'1 FRPSOH[HG ZLWK ''$% DW GLIIHUHQW PRODU UDWLRV 7KH XSWDNH RI $62'1 FRPSOH[HG ZLWK OLSRVRPHV FRPSRVHG RI ''$% DORQH ZDV XVHG WR WHVW WKH HIIHFW RI WKH KHOSHU OLSLG '23( RQ WKH XSWDNH RI $62'1 )LJXUH VKRZV WKDW WKH PD[LPXP XSWDNH ZDV sb3f DWD ''$% WR 2'1 PRODU UDWLR RI :LWKRXW '23( WKH $62'1 XSWDNH ZDV ORZ UDQJLQJ IURP sb WR sb ,Q D VXEVHTXHQW VWXG\ ZLWK KHSDWRPD FHOOV WKH WLPH FRXUVH RI FHOOXODU XSWDNH ZDV HYDOXDWHG ZLWK DOO WKUHH GHOLYHU\ 6\VWHPV QDNHG $62'1 3&FKROHVWHUROHQFDSVXODWHG DQG FDWLRQLF OLSRVRPHFRPSOH[HG $62'1f XVLQJ D S0 FRQFHQWUDWLRQ RI $62'1 &HOOXODU XSWDNH ZDV GHWHUPLQHG DW JLYHQ WLPH LQWHUYDOV DIWHU FHOOV ZHUH WUHDWHG ZLWK ),7& ODEHOHG $62'1 )LJXUH GHPRQVWUDWHV WKDW FDWLRQLF OLSRVRPH FRPSOH[DWLRQ UHVXOWHG LQ D PRUH UDSLG FHOOXODU XSWDNH RI $62'1 ZLWK JUHDWHU $62'1 DFFXPXODWLRQ SHU WLPH SRLQW ZKHQ FRPSDUHG WR ERWK WKH 3&FKROHVWHURO OLSRVRPH WUHDWHG FHOOV DQG FHOOV WUHDWHG ZLWK QDNHG $62'1 :LWK DOO WUHDWPHQWV WKH PRVW UDSLG LQWUDFHOOXODU $62'1 DFFXPXODWLRQ ZDV REVHUYHG EHWZHHQ DQG PLQXWHV DIWHU $62'1 DGPLQLVWUDWLRQ

PAGE 67

''$%'23( 0RODU 5DWLR )LJXUH (IIHFW RI ''$% WR '23( PRODU UDWLR RQ WKH FHOOXODU XSWDNH RI ),7&ODEHOHG $62'1 +HSDWRPD FHOOV ZHUH LQFXEDWHG ZLWK IM0 RI $62'1 DQG ''$% PJPOf ZLWK '23( DW GLIIHUHQW PRODU UDWLRV IRU KRXUV 7KH FHOOXODU DVVRFLDWHG ),7& LQWHQVLW\ ZDV WKHQ PHDVXUHG E\ IOXRULPHWU\ 'DWD UHSUHVHQWV PHDQ VWDQGDUG HUURU Q f 3rf

PAGE 68

''$%f$62'1f &KDUJH 5DWLR )LJXUH (IIHFW RI ''$% WR $62'1 FKDUJH UDWLR RQ WKH FHOOXODU XSWDNH RI ),7&ODEHOHG $62'1 +HSDWRPD FHOOV ZHUH LQFXEDWHG ZLWK _M0 $62'1 ZLWK ''$% DW D FKDUJH UDWLR RI WR LQ WKH SUHVHQFH RU DEVHQFH RI '23( IRU KRXUV 7KH FHOOXODU DVVRFLDWHG ),7& LQWHQVLW\ ZDV PHDVXUHG E\ IOXRULPHWU\ 'DWD UHSUHVHQWV PHDQ s VWDQGDUG HUURU Q f 3 rf

PAGE 69

7LPH KRXUf )LJXUH 7LPH FRXUVH RI FHOOXODU XSWDNH RI ),7& ODEHOHG $62'1 +HSDWRPD FHOOV ZHUH LQFXEDWHG ZLWK -0 RI $62'1 3& FKROHVWHURO OLSRVRPHHQFDSVXODWHG $62'13&$62'1f RU FDWLRQLF OLSRVRPH FRPSOH[HG $62'1&$$62'1f IRU WR KRXUV WKHQ WKH FHOOXODU DVVRFLDWHG ),7& LQWHQVLW\ ZDV PHDVXUHG E\ IOXRULPHWU\ 'DWD UHSUHVHQWV PHDQ s VWDQGDUG HUURUQ f 3rf

PAGE 70

)LJXUH VXPPDUL]HV WKH UHVXOWV RI WKH FHOOXODU DVVRFLDWHG IOXRUHVFHQFH LQWHQVLWLHV DVVRFLDWHG ZLWK ),7& ODEHOHG $62'1 XSWDNH IRU D UDQJH RI FRQFHQWUDWLRQV XVLQJ HDFK GHOLYHU\ PHFKDQLVP 7KHVH GDWD GHPRQVWUDWH WKDW WKH DPRXQW RI $62'1 ZLWKLQ WKH FHOOV LQFUHDVHG ZLWK HDFK FRQFHQWUDWLRQ 7KH DPRXQW RI FHOOXODU $62'1 DFFXPXODWHG ZDV JUHDWHU3f ZLWK WKH 3&FKROHVWHURO OLSRVRPH $62'1 HQFDSVXODWLRQ GHOLYHU\ V\VWHP FRPSDUHG WR WKDW REVHUYHG ZLWK WKH QDNHG $62'1 DW DOO WKH PHDVXUHG $62'1 FRQFHQWUDWLRQV +RZHYHU WKLV DFFXPXODWLRQ ZDV PRVW SURIRXQG ZLWK WKH FDWLRQLF OLSLG GHOLYHU\ :LWK FDWLRQLF OLSLG GHOLYHU\ WKH DFFXPXODWLRQ RI $62'1 ZDV QHDUO\ OLQHDU DW ORZ FRQFHQWUDWLRQV KRZHYHU WKH DPRXQW RI $62'1 WDNHQ XS GLG QRW LQFUHDVH VXEVWDQWLDOO\ DW FRQFHQWUDWLRQV JUHDWHU WKDQ _M0 $OVR WKH KRXU WUHDWPHQW ZLWK O_M0 FRQFHQWUDWLRQ GHSLFWHG LQ )LJXUH GHPRQVWUDWHG UHVXOWV VLPLODU WR WKRVH REVHUYHG ZLWK WKH -0 FRQFHQWUDWLRQ LQ )LJ VLJQLI\LQJ WKH UHSURGXFLELOLW\ RI WKH V\VWHP )RXU KRXUV DIWHU WUHDWPHQW WKH FHOOXODU XSWDNH DQG GLVWULEXWLRQ RI ),7&ODEHOHG $62'1 ZDV REVHUYHG ZLWK FRQIRFDO PLFURVFRS\ )LJXUH $ VKRZV D ZHDN LQWUDFHOOXODU EDFNJURXQG IOXRUHVFHQFH RI XQWUHDWHG FHOOV )LJXUH % VKRZV WKH GLVWULEXWLRQ RI QDNHG ),7&ODEHOHG $62'1 $OWKRXJK VRPH LQWHQVH IOXRUHVFHQFH LV REVHUYHG ZLWKLQ WKH FHOOV WKHUH DSSHDUV WR EH D ODUJH SURSRUWLRQ RI IOXRUHVFHQFH ORFDOL]HG DW WKH FHOO PHPEUDQH VXUURXQGLQJ WKH LQGLYLGXDO FHOOV )LJXUH & VKRZV FHOOV WUHDWHG ZLWK 3&FKROHVWHUROHQFDSVXODWHG ),7&

PAGE 71

$62'1 &RQFHQWUDWLRQVX0f )LJXUH 'RVHGHSHQGHQW FHOOXODU XSWDNH RI ),7&ODEHOHG $62'1 +HSDWRPD FHOOV ZHUH LQFXEDWHG ZLWK 0 RI $62'1 3& FKROHVWHURO OLSRVRPHHQFDSVXODWHG $62'13&$62'1f DQG FDWLRQLF OLSRVRPHFRPSOH[HG $62'1&$$62'1f DW $62'1 GRVHV IURP QP WR ID0 IRU KRXUV 7KH FHOOXODU DVVRFLDWHG ),7& LQWHQVLW\ ZDV WKHQ PHDVXUHG E\ IOXRULPHWU\ 'DWD UHSUHVHQWV PHDQ s VWDQGDUG HUURU Q f 3rf

PAGE 72

)LJXUH &HOOXODU XSWDNH DQG LQWUDFHOOXODU GLVWULEXWLRQ RI ),7&ODEHOHG $62'1 REVHUYHG E\ FRQIRFDO PLFURVFRS\ +HSDWRPD FHOOV ZHUH JURZQ RQ PLFURVOLGHV WKHQ LQFXEDWHG ZLWK S0 $62'1 3& FKROHVWHURO OLSRVRPH HQFDSVXODWHG $62'1 3&$62'1f RU FDWLRQLF OLSRVRPH FRPSOH[HG $62'1&$$62'1f IRU KRXUV 7KH FHOOV ZHUH WKHQ IL[HG DQG WKH LPDJHV ZHUH REVHUYHG E\ FRQIRFDO PLFURVFRS\ $ FRQWURO % FHOOV WUHDWHG ZLWK $62'1 FHOOV WUHDWHG ZLWK 3&$62'1 FHOOV WUHDWHG ZLWK &$$62'1 Q f

PAGE 73

ODEHOHG $62'1 0RVW RI WKHVH FHOOV DSSHDU WR KDYH D IDLUO\ HYHQ LQWUDFHOOXODU GLVWULEXWLRQ RI $62'1 ZLWK YHU\ OLWWOH RI $62'1 UHPDLQLQJ RXWVLGH WKH FHOO 7KH IOXRUHVFHQFH ZDV VWURQJHU ZLWKLQ WKHVH FHOOV FRPSDUHG WR WKDW REVHUYHG DIWHU QDNHG $62'1 WUHDWPHQW ,Q VRPH FHOOV WKHUH ZDV DQ DFFXPXODWLRQ RI IOXRUHVFHQFH LQ ORFDOL]HG FHOOXODU DUHDV ZKLFK PD\ LQGLFDWH QXFOHDU DFFXPXODWLRQ )LQDOO\ )LJXUH VKRZV D PRUH LQWHQVH ORFDOL]HG IOXRUHVFHQFH REVHUYHG LQ FHOOV WUHDWHG ZLWK FDWLRQLF OLSRVRPHFRPSOH[HG ),7&ODEHOHG $62'1 7KH IOXRUHVFHQFH ZLWKLQ WKHVH FHOOV ZDV WKH VWURQJHVW FRPSDUHG WR DOO RWKHU WUHDWPHQWV DQG DSSHDUHG WR EH PDLQO\ ORFDOL]HG ZLWKLQ WKH FHOO QXFOHXV )LJXUH D GHPRQVWUDWHV WKH $*7 DQG FRQWURO FDWKHSVLQ P51$ EDQGV DIWHU YDULRXV WUHDWPHQWV PHDVXUHG E\ WKH 1RUWKHUQ EORW DQDO\VLV )LJXUH E GLVSOD\V WKH GHQVLW\ UDWLR RI $*7 WR FDWKHSVLQ P51$ ,Q FHOO FXOWXUH WKH DPRXQW RI $*7 P51$ ZDV VKRZQ WR EH GHFUHDVHG b DIWHU WUHDWPHQW ZLWK WKH FDWLRQLF OLSRVRPHFRPSOH[HG $62'1 FRPSDUHG ZLWK D b GHFUHDVH DIWHU QDNHG 2'1 WUHDWPHQW 7KH FRQWURO VFUDPEOHG 2'1 DQG FDWLRQLF OLSLG KDG QR HIIHFW RQ P51$ H[SUHVVLRQ DQG ZDV VLPLODU WR WKH XQWUHDWHG FRQWURO $*7 SURWHLQ SURGXFWLRQ ZDV DWWHQXDWHG VLPLODUO\ DQG D PRUH SURQRXQFHG GHFUHDVH ZDV REVHUYHG LQ WKRVH VDPSOHV WUHDWHG ZLWK FDWLRQLF OLSRVRPH FRPSOH[HG $62'1 )LJXUH f ,Q XQWUHDWHG FRQWURO FHOOV WKH EDVHOLQH $*7 OHYHO ZDV s QJPO 7KHUH ZDV QR VLJQLILFDQW GHFUHDVH LQ $*7 SURGXFWLRQ IURP EDVHOLQH OHYHOV LQ WKH OLSLG DQG FRPSOH[HG VFUDPEOHG FRQWURO JURXSV ZKLFK

PAGE 74

D &75/ 3& &$ $62'1 3&$6 &$$6 $*7 NE &DWKHSVLQ 0O NE E F R 2 R )LJXUH (IIHFW RI OLSRVRPHDVVRFLDWHG $62'1 RQ $*7 P51$ H[SUHVVLRQ LQ KHSDWRPD FHOO FXOWXUH &HOOV ZHUH LQFXEDWHG ZLWK L0 RI $62'1 3&FKROHVWHURO OLSRVRPHHQFDSVXODWHG $62'13&$62'1f FDWLRQLF OLSRVRPHFRPSOH[HG $62'1 &$ $62'1f 3&FKROHVWHURO OLSRVRPH HQFDSVXODWHG VFUDPEOHG 2'13&6FU2'1f RU FDWLRQLF OLSRVRPH FRPSOH[HG VFUDPEOHG 2'1&$6FU2'1f IRU KRXUV $*7 P51$ ZDV PHDVXUHG E\ 1RUWKHUQ EORW DQDO\VLV D WKH UHVXOW RI 1RUWKHUQ EORW K\EULGL]DWLRQ IRU $*7 NEf DQG WKH FRQWURO JHQH FDWKHSVLQ NEf E WKH GHQVLW\ UDWLR RI $*7 WR FDWKHSVLQ

PAGE 75

)LJXUH (IIHFW RI OLSRVRPHDVVRFLDWHG $62'1 RQ $*7 SURWHLQ H[SUHVVLRQ LQ KHSDWRPD FHOO FXOWXUH &HOOV ZHUH LQFXEDWHG ZLWK MD0 RI $62'1 3&FKROHVWHURO OLSRVRPH HQFDSVXODWHG $62'13&$62'1f FDWLRQLF OLSRVRPH FRPSOH[HG $62'1&$$62'1f 3&FKROHVWHURO OLSRVRPH HQFDSVXODWHG VFUDPEOHG 2'13&6FU2'1f RU FDWLRQLF OLSRVRPH FRPSOH[HG VFUDPEOHG 2'1&$6FU2'1f IRU KRXUV $*7 SURWHLQ OHYHOV ZHUH PHDVXUHG E\ UDGLRLPPXQRDVVD\ 'DWD UHSUHVHQWV WKH PHDQ s VWDQGDUG HUURU Q f 3rf

PAGE 76

ZHUH DQG QJPO Q f UHVSHFWLYHO\ ,Q FHOOV WUHDWHG ZLWK QDNHG $62'1 3&$62'1 DQG FDWLRQLF OLSRVRPH FRPSOH[HG $62'1 $*7 OHYHOV ZHUH VLJQLILFDQWO\ 3f GHFUHDVHG IURP EDVHOLQH OHYHOV QJPO UHVSHFWLYHO\ 7KH GRVH UHVSRQVH HIIHFW RI &$$62'1 WUHDWPHQW GHPRQVn WUDWHV WKDW $*7 P51$ ZDV UHGXFHG DW DQ $62'1 FRQFHQWUDWLRQ RI Q0 1RUWKHUQ EORW DQDO\VLV UHYHDOHG WKDW DW ERWK DQG Q0 FRQFHQWUDWLRQV RI $62'1 WKHUH ZDV D b UHGXFWLRQ LQ $*7 P51$ $W D KLJKHU FRQFHQWUDWLRQ RI S0 D b GHFUHDVH LQ $*7 P51$ ZDV REVHUYHG)LJXUH f 7KH GHFUHDVH LQ $*7 SURWHLQ)LJXUH f DW DQ $62'1 FRQFHQWUDWLRQ RI Q0 ZDV QJPO FRPSDUHG WR WKH QJPO REVHUYHG LQ WKH FRQWURO VDPSOHV $W DQG S0 $62'1 $*7 SURWHLQ OHYHOV ZHUH VLJQLILFDQWO\ 3f GHFUHDVHG IURP WKH EDVHOLQH LQ D GRVH GHSHQGHQW PDQQHU ZLWK $*7 FRQFHQWUDWLRQV RI QJPO UHVSHFWLYHO\ &DWLRQLF OLSRVRPHV DORQH KDG QR HIIHFW RQ $*7 SURWHLQ RU P51$ OHYHOV $62'1 F\WRWR[LFLW\ ZDV GHWHUPLQHG RYHU WKH FRQFHQWUDWLRQ UDQJHV RI WR S0 7KH WR[LFLW\ RI WKH &$$62'1 FRPSOH[HV DQG WKH FDWLRQLF OLSLGV XVHG WR FRPSOH[ WKH $62'1 DOVR ZDV GHWHUPLQHG )LJXUH GHPRQVWUDWHV WKDW b RI WKH FHOOV VXUYLYHG DW D QDNHG $62'1 FRQFHQWUDWLRQ RI S0 ZKLOH

PAGE 77

D &DWLRQLF /LSRVRPH &$$62'1 X0f f§$*7 NEf fAFDWKHSVLQ NEf E )LJXUH 'RVHGHSHQGHQW HIIHFWV RI &$$62'1 RQ $*7 P51$ LQ KHSDWRPD FHOO FXOWXUH &HOOV ZHUH LQFXEDWHG ZLWK &$$62'1 DW GRVHV IURP Q0 WR S0 IRU KRXUV $*7 P51$ ZDV PHDVXUHG E\ 1RUWKHUQ EORW DQDO\VLV D WKH UHVXOW RI 1RUWKHUQ EORW K\EULGL]DWLRQ IRU $*7 NEf DQG WKH FRQWURO JHQH FDWKHSVLQ NEf E WKH UHODWLYH LQWHQVLW\ RI $*7 JHQH H[SUHVVLRQ FRPSDUHG ZLWK FRQWUROQ frf3

PAGE 78

)LJXUH 'RVHGHSHQGHQW HIIHFWV RI &$$62'1 RQ $*7 SURWHLQ H[SUHVVLRQ LQ KHSDWRPD FHOO FXOWXUH &HOOV ZHUH LQFXEDWHG ZLWK &$$62'1 DW GRVHV IURP Q0 WR _BL0 IRU KRXUV $*7 SURWHLQ OHYHOV ZHUH PHDVXUHG E\ UDGLRLPPXQRDVVD\ 'DWD UHSUHVHQWV PHDQ s VWDQGDUG HUURU Q f 3rf

PAGE 79

)LJXUH ,Q YLWUR F\WRWR[LFLW\ RI &$$6261 $62'1 DQG FDWLRQLF OLSLGV PHDVXUHG E\ 077 WHVW +HSDWRPD FHOOV ZHUH WUHDWHG ZLWK $62'1 FDWLRQLF OLSLGV&$f RU FDWLRQLF OLSRVRPH FRPSOH[HG $62'1&$$62'1f DW $62'1 FRQFHQWUDWLRQV IURP Q0 WR -0 IRU KRXUV WKHQ FHOO YLDELOLW\ ZDV PHDVXUHG E\ 077 WHVW 'DWD UHSUHVHQWV PHDQ s VWDQGDUG HUURU Q f3rf

PAGE 80

DW ORZHU FRQFHQWUDWLRQV QR REYLRXV WR[LF HIIHFW ZDV REVHUYHG 7KH $62'1 OLSLG FRPSOH[ VKRZHG D VLPLODU F\WRWR[LF HIIHFW DW $62'1 FRQFHQWUDWLRQV XS WR M0 7R[LFLW\ DSSHDUHG WR LQFUHDVH DV $62'1 FRQFHQWUDWLRQ LQFUHDVHG $W DQ $62'1 FRQFHQWUDWLRQ RI -0 WKH FRPSOH[ FDXVHG DSSUR[LPDWHO\ b RI WKH FHOOV WR GLH 7KH FDWLRQLF OLSLGV VHHPHG OHVV WR[LF WKDQ WKH FRPSOH[ $W DQ $62'1 FRQFHQWUDWLRQ RI _-0 WKH WR[LF HIIHFW ZDV VLPLODU WR WKDW RI &$$62'1 +RZHYHU DW D FRQFHQWUDWLRQ RI c-0 b RI WKH FHOOV VXUYLYHG 7KH WR[LFLW\ RI WKH &$$62'1 FRPSOH[HV DW _L0 FRQFHQWUDWLRQV ZDV VHHQ WR EH VLPLODU WR WKH WR[LFLW\ RI QDNHG $62'1 DW WKH _L0 FRQFHQWUDWLRQ LQ WKH +HSDWRPD FHOO FXOWXUH 'LDJXVVL4Q 6XFFHVVIXO DWWHQXDWLRQ RI WKH WDUJHW SURWHLQ KDV EHHQ DFKLHYHG XVLQJ DQWLVHQVH WHFKQRORJ\ LQ D ZLGH UDQJH RI ELRORJLFDO V\VWHPV>@ +RZHYHU WKH GHYHORSPHQW RI DQWLVHQVH WKHUDS\ KDV QRW EHHQ DV VPRRWK DV RQFH DQWLFLSDWHG 3UREOHPV KDYH EHHQ HQFRXQWHUHG LQ WKH GHOLYHU\ RI WKH PROHFXOHV WR WDUJHW VLWHV ZLWK JHQHUDO XSWDNH HIILFLHQF\ RI QDNHG $62'1 EHLQJ DV ORZ DV b >@ 7KH FDWLRQLF OLSRVRPHV XVHG LQ WKLV VWXG\ ZHUH VKRZQ WR LPSURYH WKH FHOOXODU XSWDNH RI $62'1 LQ KHSDWRPD FHOO FXOWXUH 7KH FRPSRVLWLRQ RI WKH OLSLGV DQG WKH FKDUJH UDWLR RI FDWLRQLF OLSLG WR $62'1 DSSHDUHG WR EH FULWLFDO IDFWRUV IRU VXFFHVVIXO WUDQVIHFWLRQ

PAGE 81

)LJXUH f 7KH XSWDNH RI WKH $62'1 GUDPDWLFDOO\ FKDQJHG XQGHU GLIIHUHQW OLSLG WR $62'1 FKDUJH UDWLRV 7KLV LV SUREDEO\ GXH WR VXFK IDFWRUV DV DJJUHJDWLRQ RI WKH FDWLRQLF OLSLGV ZLWK WKH $62'1 WKH VL]H RI WKH FRPSOH[ SDUWLFOH DQG WKH RYHUDOO FKDUJH RI WKH $62'1OLSLG FRPSOH[HV DW GLIIHUHQW FKDUJH UDWLRV 7KH XSWDNH RI $62'1 LV UHODWLYHO\ KLJKHU ZKHQ WKH FRPSOH[ KDV D QHW SRVLWLYH FKDUJH WKDQ ZKHQ WKH FRPSOH[ KDV DQ RYHUDOO QHW QHJDWLYH FKDUJH 7KH QHW SRVLWLYH FKDUJH PD\ SURYLGH VWURQJHU IRUFHV RI LQWHUDFWLRQ EHWZHHQ WKH FRPSOH[ DQG WKH QHJDWLYHO\ FKDUJHG FHOO PHPEUDQH ,QFOXVLRQ RI '23( LQ WKH OLSRVRPH DSSHDUV WR EH HVVHQWLDO IRU HIILFLHQW GHOLYHU\ GXH WR LWV IXVRJHQLF IXQFWLRQ>@ 5HVXOWV IURP WKH VFDQQLQJ FRQIRFDO PLFURVFRSH )LJXUH f GHPRQVWUDWHG ),7& ODEHOHG $62'1 LV GLVWULEXWHG LQWUDFHOOX ODUO\ 7KH SUHVHQFH RI IOXRUHVFHQFH LQ WKH F\WRSODVP LQ D SXQFWXDWHG PDQQHU LV FRQVLGHUHG WR EH FRQVLVWHQW ZLWK GLVWULEXWLRQ ZLWKLQ HQGRF\WLF YHVLFOHV VXJJHVWLQJ WKDW FHOOXODU XSWDNH RI $62'1 PD\ EH YLD DQ HQGRF\WRWLF SURFHVV ,Q FHOOV WUHDWHG ZLWK FDWLRQLF OLSRVRPHFRPSOH[HG $62'1 WKH IOXRUHVFHQFH VLJQDO VHHPHG GLIIXVH LQ WKH F\WRSODVP DQG LQ WKH QXFOHXV VXJJHVWLQJ WKDW FDWLRQLF OLSRVRPHV PD\ IXQFWLRQ WR IDFLOLWDWH WKH UHOHDVH RI $62'1 IURP WKH HQGRVRPDO YHVLFOHV 7KH H[WHQW RI WKH HQGRF\WRWLF SURFHVVHV RQ WKH XSWDNH RI $62'1 KDV EHHQ VWXGLHG XVLQJ GLIIHUHQW LQKLELWRUV RI HQGRF\WRVLV $JHQWV WKDW LQFUHDVH O\VRVRPDO S+ VXFK DV FKORURTXLQH DQG 1+& GLG QRW SUHYHQW DFFXPXODWLRQ RI $62'1 ZLWKLQ WKH QXFOHXV RU EORFN $62'1 DFWLYLW\>@ 7KHVH

PAGE 82

REVHUYDWLRQV VXJJHVW WKH SDUWLFLSDWLRQ RI HQGRVRPDO DFLGLILFDWLRQ LQ WKH UHOHDVH RI 2'1 IURP WKH HQGRVPH LQWR WKH F\WRSODVP 7KH FDWLRQLF OLSRVRPHV DOVR ZHUH VKRZQ WR LQFUHDVH WKH UDWH DQG WKH DPRXQW RI $62'1 DFFXPXODWLRQ E\ FHOOV )LJXUH f $W WKH EHJLQQLQJ RI WKH LQFXEDWLRQ &$$62'1 GLVSOD\HG D KLJKHU DVVRFLDWLRQ ZLWK WKH FHOOV WKDQ HLWKHU WKH QDNHG $62'1 RU WKH 3&$62'1 ,W KDV EHHQ VXJJHVWHG WKDW WKH LQLWLDO VWDJH RI &$$62'1 LQWHUDFWLRQ ZLWK FHOOV LQGXFHV DGVRUSWLRQ RI WKH SRVLWLYHO\ FKDUJHG &$$62'1 FRPSOH[HV WR WKH QHJDWLYHO\ FKDUJHG SKRVSKROLSLGV RI WKH FHOO PHPEUDQH 7KH FKDUJHLQGXFHG LQWHUDFWLRQ PD\ DFFRXQW IRU WKH HQKDQFHG FHOOXODU DVVRFLDWLRQ RI &$$62'1 FRPSDUHG ZLWK WKH 3&$62'1 DQG QDNHG $62'1V 7KH UHVXOWV IURP WKH WLPH DQG GRVH GHSHQGHQW XSWDNH FXUYHV VXJJHVW WKDW $62'1 XSWDNH PD\ EH D VDWXUDEOH SURFHVV $62'1 XSWDNH UHDFKHG D SODWHDX DW WKH IRXUKRXU WLPH SRLQW DW D X0 FRQFHQWUDWLRQ 6XEVHTXHQW VWXGLHV HYDOXDWHG WKH HIIHFW RI $62'1 RQ $*7 JHQH H[SUHVVLRQ 7KH UHVXOWV GHPRQVWUDWH WKDW &$$62'1 GHFUHDVHV $*7 P51$ DQG SURWHLQ LQ +HSDWRPD FHOO FXOWXUH 7KH SRVVLEOH PHFKDQLVPV IRU $62'1 LQKLELWLRQ RI JHQH H[SUHVVLRQ PD\ EH H[SODLQHG DV $62'1 IXQFWLRQLQJ DV D URDG EORFNHU WR ULERVRPH DVVHPEO\ WKXV LPSHGLQJ WKH ELQGLQJ RI WUDQVODWLRQ IDFWRUV RU DFWLQJ WR EORFN WUDQVORFDWLRQ RI ULERVRPH RQ WKH P51$ 7KH LQYROYHPHQW RI 51DVH + ZKLFK K\GURO\VHV WKH 51$ SDUW RI 51$'1$ K\EULGV PD\ DOVR EH D SRVVLEOH PHFKDQLVP 51DVH + LV D XELTXLWRXV HQ]\PH ZLWK YDU\LQJ DFWLYLW\ DPRQJ

PAGE 83

GLIIHUHQW FHOO W\SHV>@ 7KH ELQGLQJ RI $62'1 WR WDUJHWHG P51$ PD\ DFWLYDWH 51DVH + ZKLFK WKHQ GHJUDGHV WKH 51$ SRUWLRQ RI DQ 51$'1$ GXSOH[ DQG VXEVHTXHQWO\ EORFNV JHQH H[SUHVVLRQ 7KH 51DVH + PHFKDQLVP LV VXSSRUWHG E\ WKH IDFW WKDW IDLOHG WUDQVODWLRQ EORFNDJH ZDV REVHUYHG LQ UDEELW UHWLFXORF\WH O\VDWH ZKLFK FRQWDLQV ORZ WR QR 51DVH + DFWLYLW\>@ 7KH UROH RI 51DVH + DOVR LV GHPRQVWUDWHG E\ XVLQJ DQ $62'1 WKDW LV NQRZQ WR QRW DFWLYDWH 51DVH 7KH ROLJRQXFOHRWLGHV VXFK DV PHWK\O SKRVSKRQDWH DQG DROLJRPHUV WDUJHWHG WR WKH FRGLQJ UHJLRQ RI WKH UDEELW >JORELQ P51$ GLG QRW DIIHFW 3JORELQ V\QWKHVLV LQ ZKHDW JHUP H[WUDFW QRU ;HQRSXV RRF\WHV>@ 7KHVH UHVXOWV DOVR GHPRQVWUDWHG WKDW WKH HIIHFWV RI $62'1 RQ WKH H[SUHVVLRQ RI $*7 P51$ DQG SURWHLQ OHYHOV ZDV VLJQLILFDQWO\ HQKDQFHG E\ FDWLRQLF OLSRVRPHV SUREDEO\ GXH WR LQFUHDVHG FHOOXODU DQG QXFOHDU GHOLYHU\ RI $62'1 LQWR WKH FHOOV &DWLRQLF OLSRVRPHV DOVR PD\ SURWHFW WKH $62'1 IURP HQ]\PH GHJUDGDWLRQ LQ WKH FXOWXUH PHGLXP 7KH UHSRUWHG KDOI OLIH RI SKRVSKRURWKLRDWHG $62'1 LQ WKH FHOO FXOWXUH PHGLXP 530, ZLWK b IHWDO ERYLQH VHUXP XQGLOXWHG IHWDO ERYLQH VHUXP RU UDW FHUHEURVSLQDO IOXLG LV s KRXU s KRXUV DQG s KRXUV UHVSHFWLYHO\ >@ &DWLRQLF OLSRVRPH FRPSOH[DWLRQ DOVR KDV EHHQ VKRZQ WR LQFUHDVH WKH VWDELOLW\ RI $62'1 LQ FHOO FXOWXUH>@ 7KH F\WRWR[LF HIIHFW RI WKH FDWLRQLF OLSRVRPH $62'1 FRPSOH[HV DSSHDUV KLJKHU WKDQ HLWKHU WKH $62'1 PROHFXOHV RU

PAGE 84

WKH FDWLRQLF OLSLGV DORQH )LJXUH f 7KH WR[LF HIIHFWV RI FDWLRQLF OLSLG DUH DWWULEXWHG WR WKHLU VXUIDFWDQW OLNH SURSHUWLHV ZKLFK FDXVH VROXEOL]DWLRQ DQG SRUDWLRQ RI WKH FHOO PHPEUDQH ZLWK VXEVHTXHQW GDPDJH WR WKH FHOO LQWHJULW\ DW KLJKHU FRQFHQWUDWLRQV>@ 7KH KLJKHU WR[LFLW\ RI &$$62'1 FRPSOH[HV PD\ EH D UHVXOW RI WKH QRQVSHFLILF HIIHFWV RI $62'1 &DWLRQLF OLSRVRPHV UHVXOWHG LQ LQFUHDVHG LQWUDFHOOXODU GHOLYHU\ RI $62'1 $W KLJK FRQFHQWUDWLRQV $62'1 PD\ ELQG WR QRQWDUJHWHG VHTXHQFHV DQG FDXVH GHJUDGDWLRQ RI SURWHLQV ZKLFK PD\ EH HVVHQWLDO IRU FHOO YLDELOLW\ 7KLV UHVXOW ZDV FRQVLVWHQW ZLWK WKH SUHYLRXV LQ YLWUR WUDQVFULSWLRQ WUDQVODWLRQ H[SHULPHQWV ZKLFK VKRZHG WKDW WKH VFUDPEOHG 2'1V DOVR GHFUHDVHG WKH H[SUHVVLRQ RI $*7 P51$ DW $62'1 FRQFHQWUDWLRQV KLJKHU WKDQ MM0>@ 7KH QDNHG $62'1 VKRZHG PLQLPDO F\WRWR[LFLW\ SUREDEO\ GXH WR LWV VKRUW KDOIOLIH LQ WKH FXOWXUH PHGLXP &DWLRQLF OLSRVRPH FRPSOH[DWLRQ LPSURYHV LWV VWDELOLW\ EXW DOVR LQFUHDVHV LWV WR[LF HIIHFW +RZHYHU ZKHQ XVHG DW GRVHV RI MBL0 RU OHVV WR[LF HIIHFWV DUH PLQLPL]HG DQG DUH HTXLYDOHQW WR WKH WR[LFLW\ SURGXFHG E\ WLPHV WKH FRQFHQWUDWLRQ RI $62'1 DORQH 7R VXPPDUL]H WKHVH UHVXOWV VXSSRUW WKH IROORZLQJ FRQFOXVLRQV &DWLRQLF OLSRVRPHV FRQVLVWLQJ RI ''$% DQG '23( LQFUHDVH WKH FHOOXODU GHOLYHU\ RI $62'1 FRPSDUHG ZLWK SUHYLRXVO\ XVHG 3&FKROHVWHURO OLSRVRPHV LQ KHSDWRPD FHOO FXOWXUH &DWLRQLF OLSRVRPHFRPSOH[HG $62'1 WDUJHWHG WR $*7 P51$ GHFUHDVHG $*7 P51$ DQG SURWHLQ LQ FHOO FXOWXUH LQ D GRVH

PAGE 85

GHSHQGHQW PDQQHU 7KH &$$62'1 FRPSOH[ DSSHDUHG WR KDYH D KLJKHU WR[LFLW\ WKDQ HLWKHU WKH FDWLRQLF OLSLGV RU WKH $62'1 DORQH SRVVLEO\ GXH WR WKH QRQVSHFLILF HIIHFWV RI KLJK LQWUDFHOOXODU FRQFHQWUDWLRQV RI $62'1

PAGE 86

&+$37(5 7+( ())(&7 2) 5287( 2) $'0,1,675$7,21 2) &$$62'1 21 %/22' 35(6685( $1' 7,668( ',675,%87,21 2) $62'1 ,1 6+5 ,03/,&$7,216 2) 7+( 52/( 2) 7,668( 5$6 21 %/22' 35(6685( 5(*8/$7,21 6SHFLILF $LPV 7KH VSHFLILF DLP RI WKLV SDUW RI WKH UHVHDUFK ZDV WR GHYHORS D PHFKDQLVP IRU WDUJHWHG DQWLVHQVH ROLJRQXFOHRWLGH GHOLYHU\ WR WKH OLYHU XVLQJ OLSRVRPH WHFKQRORJ\ DQG WR GHWHUPLQH $62'1 WLVVXH GLVWULEXWLRQ DIWHU LQWUDDUWHULDO DQG LQWUDYHQRXV DGPLQLVWUDWLRQ LQ 6+5 PRGHO DQG LWV VXEVHTXHQW HIIHFWV RQ K\SHUWHQVLRQ ,QWURGXFWLRQ 7KH SUHYLRXV LQ YLWUR VWXGLHV GHPRQVWUDWHG WKDW FDWLRQLF OLSRVRPHV FRPSRVHG RI ''$% DQG '23( DUH PRUH HIIHFWLYH LQ GHOLYHULQJ $62'1 WKDQ 3&FKROHVWHURO OLSRVRPHV LQ KHSDWRPD FHOO FXOWXUH 7KH SUHYLRXV LQ YLYR VWXGLHV VKRZHG WKDW 3& FKROHVWHURO HQFDSVXODWHG $62'1 VXFFHVVIXOO\ GHFUHDVHG EORRG SUHVVXUH ZKHQ DGPLQLVWHUHG ERWK FHQWUDOO\ DQG LQWUDn DUWHULDOO\ LQ WKH 6+5 PRGHO RI K\SHUWHQVLRQ>@ +RZHYHU LQ YLYR GDWD ZDV LQFRQFOXVLYH ZKHQ $62'1 ZDV DGPLQLVWHUHG LQWUDYHQRXVO\ GHVSLWH WKH VXFFHVV RI $62'1 PHGLDWHG JHQH

PAGE 87

LQKLELWLRQ 7LVVXH DQG FHOOXODU $62'1 GHOLYHU\ RI $62'1 UHPDLQ WKH PDMRU REVWDFOHV IRU LQWHQGHG $62'1 DFWLYLW\>@ 2SWLPL]DWLRQ RI WKH $62'1 GHOLYHU\ V\VWHP DQG URXWH RI DGPLQLVWUDWLRQ KDYH EHHQ FRQVLGHUHG WKH PRVW LPSRUWDQW DVSHFWV RI LPSURYLQJ WKH LQWHQGHG ELRORJLFDO HIIHFW RI $62'1 7KH UROH RI DQJLRWHQVLQRJHQ LQ WKH SDWKRJHQHVLV RI K\SHUWHQVLRQ KDV EHHQ VXSSRUWHG E\ JHQHWLF VWXGLHV>@ $*7 LV H[SUHVVHG DQG FRQVWLWXWLYHO\ VHFUHWHG E\ KHSDWRF\WHV 6XFFHVVIXO GHOLYHU\ RI $62'1 WR WDUJHW FHOOV VKRXOG OHDG WR VXSSUHVVLRQ RI $*7 P51$ H[SUHVVLRQ UHVXOWLQJ LQ GHFUHDVHG DFWLYLW\ RI WKH 5$6 DQG VXEVHTXHQW DWWHQXDWLRQ RI K\SHUWHQVLRQ 'HOLYHU\ RI PDFURPROHFXOHV VXFK DV ROLJRn QXFOHRWLGHV WR WKHLU WDUJHW VLWHV LQ YLYR UHTXLUHV VXFFHVVIXO WUDQVHQGRWKHOLDO PLJUDWLRQ DQG WDUJHW FHOO HQGR F\WRVLV>@ 6WUDWHJLHV IRU OLYHUWLVVXHfVSHFLILF WDUJHWn LQJ DUH GLYLGHG LQWR SDVVLYH DQG DFWLYH WDUJHWLQJ 3DVVLYH WDUJHWLQJ UHIHUV WR WKH XWLOL]DWLRQ RI WKH QDWXUDO GLVSRVLWLRQ SURILOHV RI D GUXJ FDUULHU ZKLFK LV GHWHUPLQHG E\ WKH SK\VLRFKHPLFDO SURSHUWLHV RI WKH FKHPLFDOV UHODWLYH WR WKH DQDWRPLFDO DQG SK\VLRORJLFDO FKDUDFWHULVWLFV RI WKH ERG\ 'HOLYHU\ RI PDFURPROHFXOHV WR WKH OLYHU UHWLFXORHQGRn WKHOLDO V\VWHP ZKLFK ODFNV EDVHPHQW PHPEUDQH RQ WKH HQGRWKHOLDO FHOOV DQG DOORZV PROHFXOHV QP RU OHVV LQ GLDPHWHU WR SHUPHDWH WKURXJK LV DQ H[DPSOH RI WKLV $FWLYH WDUJHWLQJ UHIHUV WR WKH DOWHUDWLRQV RI WKH QDWXUDO GLVSRVLWLRQ RI D GUXJ FDUULHU LQ RUGHU WR GLUHFW LW WR

PAGE 88

VSHFLILF FHOOV WLVVXHV RU RUJDQV /LJDQGV RU PRQRFORQDO DQWLERGLHV ZKLFK FDQ ELQG VSHFLILFDOO\ WR WKH VXUIDFH RI WDUJHW FHOOV DUH XVHG IRU WKLV SXUSRVH >@ ,Q WKH FDVH RI KHSDWLF WDUJHWLQJ DQWLERGLHV WDUJHWHG WR DVLDORJO\FRSURWHLQ UHFHSWRUV ZKLFK DUH XQLTXHO\ H[SUHVVHG E\ WKH OLYHU KDYH EHHQ XVHG WR LPSURYH OLYHU WDUJHWLQJ>@ ,Q WKLV VWXG\ ZH XWLOL]HG D FDWLRQLF OLSRVRPH DSSURDFK WR HQKDQFH $62'1 GHOLYHU\ WR WKH OLYHU WDUJHW 6PDOO OLSRVRPHV ZLWK D GLDPHWHU RI OHVV WKDQ QP DUH NQRZQ WR EH QDWXUDOO\ DQG UDSLGO\ FOHDUHG E\ WKH OLYHU UHWLFXORHQGRn WKHOLDO V\VWHP DIWHU LQMHFWLRQ>@ &RPSDUHG ZLWK SUHYLRXVO\ XVHG 3&FKROHVWHURO OLSRVRPHV SRVLWLYHO\ FKDUJHG FDWLRQLF OLSLGV PD\ IDFLOLWDWH WKH DGVRUSWLRQ RI OLSRVRPH$62'1 FRPSOH[ WR WKH QHJDWLYHO\ FKDUJHG FHOO VXUIDFH DQG VXEVHTXHQWO\ LQFUHDVH WKH FHOOXODU GHOLYHU\ RI $62'1 PROHFXOHV ,QFRUSRUDWLQJ WKH S+VHQVLWLYH IXVRJHQLF OLSLG '23( DOVR PD\ IDFLOLWDWH WDUJHW FHOO HQGRF\WRVLV RI $62'1>@ 7KH UHQLQDQJLRWHQVLQ V\VWHP5$6f KDV ORQJ EHHQ NQRZQ DV D FLUFXODWLQJ HQGRFULQH V\VWHP WKDW UHJXODWHV EORRG SUHVVXUH DQG IOXLG DQG HOHFWURO\WH EDODQFH YLD LWV HIIHFWRU SHSWLGH DQJLRWHQVLQ ,, >@ 7KH FRORFDOL]DWLRQ RI UHQLQ $&( DQG DQJLRWHQVLQ ,, UHFHSWRU PHVVHQJHU 51$ LQ WLVVXHV VXFK DV WKH NLGQH\ KHDUW DQG EUDLQ VXJJHVW WKH H[LVWHQFH RI ORFDO 5$6V ZKLFK PD\ SOD\ D IXQFWLRQDO UROH LQ EORRG SUHVVXUH UHJXODWLRQ >@ 8QOLNH WKH KRUPRQDO 5$6 ZKLFK UHJXODWHV EORRG SUHVVXUH E\ D FORVHGORRS QHJDWLYH IHHGEDFN PHFKDQLVP

PAGE 89

WKH ORFDO 5$6 LV WKRXJKW WR IXQFWLRQ LQ D SDUDFULQH DXWRFULQH PDQQHU $QJLRWHQVLQ ,, SURGXFHG E\ V\QWKHVL]LQJ FHOOV FDQ DFW RQ UHFHSWRUV RI WKH QHLJKERULQJ FHOOV SDUDFULQHf RU DFW RQ WKH UHFHSWRUV RI WKH FHOOV ZKHUH LW ZDV V\QWKHVL]HG DXWRFULQHf WR UHJXODWH VXFK IXQFWLRQV DV VPRRWK PXVFOH FHOO FRQWUDFWLRQ RU UHOHDVH RI HQGRWKHOLXP GHULYHG UHOD[LQJ IDFWRUV >@ 7KH LQYROYHPHQW RI WKH WLVVXH 5$6 LQ EORRG SUHVVXUH UHJXODWLRQ ZDV ILUVW VXJJHVWHG E\ WKH HIIHFW RI DQWLn K\SHUWHQVLYH GUXJV $&( DQG UHQLQ LQKLELWRUV ZLWK GLIIHUHQW SK\VLFRFKHPLFDO SURSHUWLHV DQG WKXV GLIIHUHQW WLVVXH SHQHWUDWLRQ SURILOHV VKRZHG GLIIHUHQW DQWLK\SHUWHQVLYH HIIHFWV >@ 7KH DQWLK\SHUWHQVLYH HIIHFWV RI $&( LQKLELWRUV DQG WKHLU GXUDWLRQ DUH PRUH FRQVLVWHQW ZLWK WKH LQKLELWLRQ RI $&( DFWLYLW\ LQ WKH NLGQH\ DQG DRUWD UDWKHU WKDQ WKH SODVPD >@ 5HQLQ LQKLELWRUV DOVR DSSHDU WR ORZHU EORRG SUHVVXUH LQ D IDVKLRQ GLVVRFLDWHG IURP WKHLU HIIHFW RQ SODVPD UHQLQ>@ $Q LQWUDUHQDO 5$6 KDV DOVR EHHQ SURSRVHG DV LQGLYLGXDO FRPSRQHQWV RI WKH 5$6 ZHUH GHWHFWHG LQ WKH UHQDO FRUWH[ >@ $W D ORFDO OHYHO DQJLRWHQVLQ ,, LQIOXHQFHV JORPHUXODU PLFURFLUFXODWLRQ FDXVLQJ UHGXFWLRQV LQ SODVPD IORZ UDWH WKH XOWUDILOWUDWLRQ FRHIILFLHQW DQG LQFUHDVHV LQ WKH K\GURVWDWLF SUHVVXUH GLIIHUHQFH DQG UHQDO DUWHULRODU UHVLVWDQFH 7KH 6+5 HVVHQWLDO K\SHUWHQVLRQ DQLPDO PRGHO LV LQEUHG IURP WKH QRUPRWHQVLYH VWUDLQ RI :.< UDW >@ $EQRUPDO 5$6

PAGE 90

DFWLYLW\ UHVXOWLQJ IURP JHQHWLF VHOHFWLRQ LV EHOLHYHG WR EH UHVSRQVLEOH IRU WKH KLJK EORRG SUHVVXUH LQ 6+5V>@ ,Q WKLV VWXG\ ZH GHWHUPLQHG WKH HIIHFW RI $62'1 RQ EORRG SUHVVXUH KRXUV DIWHU LQMHFWLRQ LQ ERWK 6+5 DQG :.< VWUDLQV WR LQYHVWLJDWH WKH UROH RI WKH 5$6 LQ K\SHUWHQVLRQ ,Q SUHYLRXV VWXGLHV ZH PHDVXUHG WKH HIIHFW RI EORRG SUHVVXUH FKDQJHV DIWHU LQWUDDUWHULDO,$f DQG LQWUDYHQRXV ,9f DGPLQLVWUDWLRQ RI $62'1 LQ 6+5 ,W DSSHDUHG WKDW $62'1 FDXVHG PRUH SURQRXQFHG GHFUHDVHV LQ EORRG SUHVVXUH DIWHU ,$ LQMHFWLRQ RI $62'1 WKDQ DIWHU ,9 LQMHFWLRQ 7KH GLVFUHSDQF\ EHWZHHQ EORRG SUHVVXUH FKDQJHV FRXOG UHVXOW IURP WLVVXH VSHFLILF HIIHFWV DV D FRQVHTXHQFH RI GLIIHUHQW WLVVXH GLVWULEXWLRQ RI $62'1 DIWHU ,$ DQG ,9 LQMHFWLRQ ,Q WKLV VWXG\ WKH HIIHFWV RI LQWUDDUWHULDO DQG LQWUDYHQRXV DGPLQLVWHUHG $62'1 RQ EORRG SUHVVXUH WLVVXH GLVWULEXWLRQ RI $62'1 SODVPD DQG WLVVXH DQJLRWHQVLQRJHQ OHYHOV ZHUH PHDVXUHG 0DWHULDO DQG 0HWKRGV 7R GHWHUPLQH WKH PHDQ DUWHULDO SUHVVXUH 0$3f FKDQJHV LQ 6+5 DQG :.< UDWV DIWHU LQWUDDUWHULDO DQG LQWUDYHQRXV LQMHFWLRQ RI FDWLRQLF OLSRVRPH FRPSOH[HG $62'1 JURXSV RI UDWV J Q f D FDWKHWHU ZDV LPSODQWHG LQ WKH FDURWLG DUWHU\ DQG IRU LQWUDYHQRXV VWXGLHV WKH IHPRUDO YHLQ 5DWV ZHUH DOORZHG WR UHFRYHU IRU KRXUV DIWHU VXUJHU\ WKHQ EDVHOLQH PHDQ DUWHULDO EORRG SUHVVXUH ZDV GHWHUPLQHG XVLQJ GLUHFW EORRG SUHVVXUH PHDVXUHPHQW $ FDWKHWHU ZDV LQVHUWHG LQWR WKH H[WHUQDO FDURWLG DUWHU\ DQG

PAGE 91

FRQQHFWHG WR D SUHVVXUH WUDQVGXFHU WKDW ZDV LQWHUIDFHG ZLWK D 'LJL0HG %3 $QDO\]HUPLFUR0HG ,QGLDQDSROLV,QGf 6LJQDOV ZHUH UHFRUGHG RQ D *RXOG 7$ (DV\*UDI 3K\VLRJUDSK ZKLFK SURYLGHV LQIRUPDWLRQ RQ V\VWROLF GLDVWROLF DQG PHDQ DUWHULDO SUHVVXUH DQG KHDUW UDWH )ROORZLQJ EDVHOLQH SUHVVXUH PHDVXUHPHQWV SJ GRVHV RI HLWKHU FDWLRQLF OLSRVRPH FRPSOH[HG $62'1 VFUDPEOHG 2'1 XQFRPSOH[HG $62'1 RU FDWLRQLF OLSLG ZHUH LQMHFWHG HLWKHU ,$ YLD WKH FDURWLG FDWKHWHUV RU ,9 YLD WKH IHPRUDO FDWKHWHUV 7ZHQW\IRXU KRXUV DIWHU LQMHFWLRQ PHDQ DUWHULDO SUHVVXUH ZDV PHDVXUHG XVLQJ WKH VDPH PHWKRG 7KH WLVVXH GLVWULEXWLRQ RI ),7& FRQMXJDWHG $62'1 DQG FDWLRQLF OLSRVRPH FRPSOH[HG ),7&$62'1 DIWHU LQWUDYHQRXV DQG LQWUDDUWHULDO DGPLQLVWUDWLRQ ZDV WKHQ GHWHUPLQHG *URXSV RI 6SUDJXH 'DZOH\ UDWVQ f ZHUH LQMHFWHG ZLWK SJ ),7& $62'1 DQG ),7&&$$62'1 YLD WKH FDURWLG DUWHU\ RU IHPRUDO YHLQ 2QH DQG KRXUV ODWHU WKUHH RI WKH LQMHFWHG UDWV ZHUH SHUIXVHG ZLWK VDOLQH DQG WKHQ GHFDSLWDWHG /LYHU NLGQH\ KHDUW OXQJ EUDLQ DQG SODVPD ZHUH FROOHFWHG 7LVVXHV ZHUH WKHQ KRPRJHQL]HG LQ 7ULWRQ DQG WKH DVVRFLDWHG IOXRUHVFHQFH LQWHQVLW\ ZDV PHDVXUHG XVLQJ IOXRULPHWULF DQDO\VLV :H DOVR PHDVXUHG SODVPD $*7 DQG $QJ ,, OHYHOV DIWHU LQWUDDUWHULDO DQG LQWUDYHQRXV DGPLQLVWUDWLRQ RI $62'1 SJ RI FDWLRQLF OLSRVRPH FRPSOH[HG $62'1 ZDV LQMHFWHG YLD WKH FDURWLG DUWHU\ RU IHPRUDO YHLQ RI 6+5Q f $IWHU KRXUV DQLPDOV ZHUH GHFDSLWDWHG DQG SODVPD VDPSOHV ZHUH FROOHFWHG

PAGE 92

3ODVPD $*7 DQG $QJ ,,5.$ $OSFR :LQGKDP 1+f ZHUH PHDVXUHG XVLQJ UDGLRLPPXQRDVVD\>@ ,Q RUGHU WR GHWHUPLQH WKH HIIHFWV RI $62'1 RQ WLVVXH $*7 H[SUHVVLRQ ?[J GRVHV RI HLWKHU FDWLRQLF OLSRVRPH FRPSOH[HG $62'1 VFUDPEOHG 2'1 XQFRPSOH[HG $62'1 RU FDWLRQLF OLSLG ZHUH LQMHFWHG HLWKHU ,$ RU ,9 LQ 6+5VQ f $IWHU KRXUV UDWV ZHUH VDFULILFHG DQG OLYHU NLGQH\ DQG KHDUW ZHUH FROOHFWHG 7RWDO P51$ ZDV H[WUDFWHG DQG $*7 DQG &DWKHSVLQ P51$ OHYHOV ZHUH PHDVXUHG E\ 1RUWKHUQ EORW DQDO\VLV>@ 7KH KRXVHNHHSLQJ JHQH FDWKHSVLQ ZDV XVHG DV D FRQWURO WR HQVXUH HTXDO ORDGLQJ RI 51$ 5HVXOWV )LJXUH GHPRQVWUDWHV WKH FKDQJH LQ PHDQ DUWHULDO SUHVVXUH KRXUV DIWHU LQWUDDUWHULDO LQMHFWLRQ RI HLWKHU &$$62'1 &$6FU2'1 XQFRPSOH[HG $62'1 RU FDWLRQLF OLSLGV $ VLJQLILFDQW 3f GHFUHDVH LQ 0$3 s PP+J IURP EDVHOLQH ZDV REVHUYHG LQ 6+5 WUHDWHG ZLWK &$$62'1 $ OHVV PDUNHG EXW VLJQLILFDQW3f GHFUHDVH LQ EORRG SUHVVXUH s PP+J IURP EDVHOLQH OHYHO ZDV REVHUYHG LQ 6+5V WUHDWHG ZLWK XQFRPSOH[HG $62'1 %ORRG SUHVVXUH ZHUH XQFKDQJHG LQ DQLPDOV WUHDWHG ZLWK HLWKHU &$6FU2'1 RU FDWLRQLF OLSLGV )LJXUH f $62'1V DGPLQLVWHUHG E\ WKH LQWUDYHQRXV URXWH SURGXFHG D VLJQLILFDQW EXW VPDOOHU GHFUHDVH LQ EORRG SUHVVXUH PP+J DQG s PP+J3f IURP EDVHOLQH DIWHU HLWKHU &$$62'1 RU $62'1 WUHDWPHQW UHVSHFWLYHO\ )LJXUH f 1R VLJQLILFDQW FKDQJHV LQ EORRG SUHVVXUH ZHUH REVHUYHG

PAGE 93

)LJXUH 0HDQ DUWHULDO SUHVVXUH FKDQJHV IURP EDVHOLQH KRXUV DIWHU LQWUDDUWHULDO LQMHFWLRQ RI &$$62'1 LQ 6+5 J FDWLRQLF OLSRVRPHFRPSOH[HG $62'1 &$$62'1f $62'1 FDWLRQLF OLSLGV &$f DQG FDWLRQLF OLSRVRPHFRPSOH[HG VFUDPEOHG 2'1 &$6FU&'1f ZHUH XVHG %ORRG SUHVVXUH ZDV PHDVXUHG E\ GLUHFW PHWKRG 'DWD UHSUHVHQW PHDQ s VWDQGDUG HUURU Q f 3rf

PAGE 94

)LJXUH 0HDQ DUWHULDO SUHVVXUH FKDQJHV IURP EDVHOLQH KRXUV DIWHU LQWUDYHQRXV LQMHFWLRQ RI &$$62'1 LQ 6+5 ILJ FDWLRQLF OLSRVRPHFRPSOH[HG $62'1&$$62'1f $62'1 FDWLRQLF OLSLGV&$f DQG FDWLRQLF OLSRVRPHFRPSOH[HG VFUDPEOHG 2'16FU2'1f ZHUH XVHG %ORRG SUHVVXUH ZDV PHDVXUHG E\ GLUHFW PHWKRG 'DWD UHSUHVHQWV PHDQ s VWDQGDUG HUURUQ f 3 rf

PAGE 95

DIWHU &$6FU2'1 RU FDWLRQLF OLSLG WUHDWPHQW 6LPLODU H[SHULPHQWV DOVR ZHUH FRQGXFWHG LQ FRQWURO :.< UDWV DQG QR VLJQLILFDQW EORRG SUHVVXUH FKDQJHV IURP EDVHOLQH OHYHO s PP+J ZHUH REVHUYHG DIWHU ,$ RU ,9 LQMHFWLRQ RI $62'1V RU FRQWUROV 7R GHWHUPLQH WKH PHFKDQLVP RI WKH REVHUYHG GLIIHUHQFHV LQ EORRG SUHVVXUH UHGXFWLRQV DIWHU ,$ DQG ,9 LQMHFWLRQ WLVVXH GLVWULEXWLRQ RI ),7& ODEHOHG $62'1 DIWHU ,$ DQG ,9 LQMHFWLRQ ZDV GHWHUPLQHG )LJXUHV DQG VXPPDUL]H WKH PHDVXUHG WLVVXH DVVRFLDWHG ),7& LQWHQVLW\ IRU HDFK LQMHFWHG GRVH DW DQG KRXUV )LJXUH GHPRQVWUDWHV WKDW DW WKH KRXU WLPH SRLQW b RI WKH LQMHFWHG FRPSOH[HG $62'1 DFFXPXODWHG LQ WKH OLYHU DIWHU ,$ LQMHFWLRQ FRPSDUHG ZLWK b DFFXPXODWLRQ LQ WKH OLYHU DIWHU ,9 LQMHFWLRQ &DWLRQLF OLSRVRPH FRPSOH[DWLRQ LQFUHDVHG $62'1 DFFXPXODWLRQ LQ WKH OLYHU OXQJ DQG KHDUW E\ DSSUR[LPDWHO\ b $V H[SHFWHG D KLJKHU DFFXPXODWLRQ RI &$$62'1 ZDV VHHQ LQ WKH OXQJ DIWHU ,9 LQMHFWLRQ WKDQ DIWHU ,$ LQMHFWLRQ $W WKH KRXU WLPH SRLQW D VLPLODU $62'1 GLVWULEXWLRQ ZDV REVHUYHG ZLWK HLWKHU URXWH RI DGPLQLVWUDWLRQ)LJXUH f $W WKH KRXU WLPH SRLQW D VLPLODU GHJUHH RI &$$62'1 DFFXPXODWLRQ ZDV REVHUYHG LQ WKH OLYHU DIWHU ,$ DQG ,9 LQMHFWLRQ +RZHYHU LQ WKH NLGQH\ WKHUH ZDV D JUHDWHU DFFXPXODWLRQ RI &$$62'1 DIWHU ,$ LQMHFWLRQ WKDQ DIWHU ,9 LQMHFWLRQ :LWK WLPH WKH EUDLQ DSSHDUHG WR KDYH JUHDWHU OHYHO RI DFFXPXODWLRQ 3ODVPD $*7 OHYHOV RI 6+5 KRXUV DIWHU ,$ LQMHFWLRQ RI FDWLRQLF OLSLGV &$6FU2'1 &$$62'1 RU $62'1 ZHUH s

PAGE 96

/9 .1 +7 %5 /8 3/ )LJXUH 7LVVXH GLVWULEXWLRQ RI $62'1 DQG &$$62'1 LQ KRXU DIWHU ,$ RU ,9 LQMHFWLRQ 7KH ),7& LQWHQVLW\ ZHUH PHDVXUHG LQ OLYHU/9f KHDUW+7f NLGQH\.1f OXQJ/8f EUDLQ%5f DQG SODVPD3/f LQ 6SUDJXH 'DZOH\ UDWV )LJXUH GHPRQVWUDWHV WKH ),7& LQWHQVLW\ PHDVXUHG E\ IOXRULPHWU\ DV D SHUFHQWDJH RI WKH LQMHFWHG GRVH 'DWD UHSUHVHQW PHDQ s VWDQGDUG HUURUQ f 3rf

PAGE 97

' 2f &' 2 &' &/ &2 2 4 /9 .1 +7 %5 /8 3/ )LJXUH 7LVVXH GLVWULEXWLRQ RI $62'1 DQG &$n$62'1 LQ KRXU DIWHU ,$ RU ,9 LQMHFWLRQ 7KH ),7& LQWHQVLW\ ZHUH PHDVXUHG LQ OLYHU/9f KHDUW+7f NLGQH\.1f OXQJ/8f EUDLQ%5f DQG SODVPD3/f LQ 6SUDJXH 'DZOH\ UDWV )LJXUH GHPRQVWUDWHV WKH ),7& LQWHQVLW\ PHDVXUHG E\ IOXRULPHWU\ DV D SHUFHQWDJH RI WKH LQMHFWHG GRVH 'DWD UHSUHVHQW PHDQ s VWDQGDUG HUURUQ f 3rf

PAGE 98

/9 .1 +7 %5 /8 3/ )LJXUH 7LVVXH GLVWULEXWLRQ RI $62'1 DQG &$$62'1 LQ KRXU DIWHU ,$ RU ,9 LQMHFWLRQ 7KH ),7& LQWHQVLW\ ZHUH PHDVXUHG LQ OLYHU/9f KHDUW+7f NLGQH\.1f OXQJ/8f EUDLQ%5f DQG SODVPD3/f LQ 6SUDJXH 'DZOH\ UDWV )LJXUH GHPRQVWUDWHV WKH ),7& LQWHQVLW\ PHDVXUHG E\ IOXRULPHWU\ DV D SHUFHQWDJH RI WKH LQMHFWHG GRVH 'DWD UHSUHVHQW PHDQ s VWDQGDUG HUURUQ f 3rf

PAGE 99

9$ &$6FU2'1 $62'1 ( &$$62'1 ,QWUDDUWHULDO ,QWUDYHQRXV )LJXUH 3ODVPD $*7 OHYHOV KRXUV DIWHU ,$ DQG ,9 LQMHFWLRQ RI $62'1 ZLWK OLSRVRPHV LQ 6+5 $QJLRWHQVLQRJHQ ZDV PHDVXUHG E\ UDGLRLPPXQRDVVD\ 'DWD UHSUHVHQWV PHDQ s VWDQGDUG HUURU Q f 3rf

PAGE 100

QJPO s QJPO QJPO DQG QJPO UHVSHFWLYHO\ $IWHU ,9 LQMHFWLRQ WKH OHYHOV ZHUH QJPO QJPO QJPO DQG QJPO UHVSHFWLYHO\ )LJXUH f 7KH SODVPD OHYHOV RI $*7 GHFUHDVHG VLJQLILFDQWO\3f DIWHU HLWKHU &$$62'1 RU $62'1 WUHDWPHQW FRPSDUHG ZLWK &$6FU2'1 RU FDWLRQLF OLSLG WUHDWPHQW +RZHYHU QR VLJQLILFDQW GLIIHUHQFH RI $*7 OHYHOV EHWZHHQ ,$ RU ,9 LQMHFWLRQ RI HLWKHU &$$62'1 RU $62'1 ZDV REVHUYHG 6LPLODU UHGXFWLRQV RI SODVPD DQJLRWHQVLQ ,, OHYHOV ZHUH DOVR REVHUYHG )LJXUH VXPPDUL]HV WKH HIIHFW RI &$$62'1 WUHDWPHQW RQ SODVPD DQJLRWHQVLQ ,, OHYHOV LQ 6+5 $QJ ,, OHYHOV ZHUH QJPO QJPO QJPO DQG QJPO DIWHU ,$ LQMHFWLRQ RI FDWLRQLF OLSLGV &$6FU2'1 &$$62'1 RU $62'1 UHVSHFWLYHO\ $IWHU ,9 DGPLQLVWUDWLRQ WKH OHYHOV ZHUH QJPO QJPO QJPO DQG QJPO UHVSHFWLYHO\ 7KH $QJ ,, OHYHOV DIWHU HLWKHU &$$62'1 RU $62'1 WUHDWPHQW ZHUH VLJQLILFDQWO\ 3f ORZHU FRPSDUHG ZLWK WKDW DIWHU 6FU2'1 DQG &$ WUHDWPHQW 7KH GLIIHUHQFH EHWZHHQ DQJLRWHQVLQ ,, OHYHOV DIWHU ,$ DQG ,9 LQMHFWLRQ ZDV QRW VWDWLVWLFDOO\ VLJQLILFDQW :H DOVR PHDVXUHG $*7 P51$ OHYHOV LQ WKH KHDUW NLGQH\ DQG OLYHU DIWHU ,$ DQG ,9 LQMHFWLRQ RI $62'1V XVLQJ 1RUWKHUQ EORW DQDO\VLV ,Q WKH NLGQH\ $*7 P51$ GHFUHDVHG DSSUR[LPDWHO\ b KRXUV DIWHU ,$ $62'1 DGPLQLVWUDWLRQ FRPSDUHG ZLWK D b GHFUHDVH REVHUYHG DIWHU ,9 LQMHFWLRQ

PAGE 101

)LJXUH 3ODVPD DQJLRWHQVLQ ,, OHYHOV KRXUV DIWHU ,$ RU ,9 LQMHFWLRQ RI $62'1 ZLWK OLSRVRPHV LQ 6+5 $QJLRWHQVLQ ,, ZDV PHDVXUHG E\ UDGLRLPPXQRDVVD\ 'DWD UHSUHVHQWV PHDQ s VWDQGDUG HUURU Q f 3rf

PAGE 102

] ] ] ] 4 4 4 4 2 R 2 ] 2 ] R R &2 4 &2 4 &2 &2 R R &2 &2 R R R 2 R R ! ! $*7 NEf! FDWKHSVLQ NEf} E 4f V] ,f§} F ] FU ( H R R 2 )LJXUH /LYHU $*7 P51$ OHYHOV LQ 6+5 KRXUV DIWHU ,$ RU ,9 LQMHFWLRQ RI $62'1 ZLWK OLSRVRPHV XJ RI FDWLRQLF OLSRVRPHFRPSOH[HG $62'1 &$$62'1f FDWLRQLF OLSRVRPH FRPSOH[HG 6FU2'1 &$6FU2'1f FDWLRQLF OLSLGV&$f RU $62'1 ZHUH XVHG D WKH 1RUWKHUQ EORW DQDO\VLV RI $*7 NEf DQG FRQWURO FDWKHSVLQ NEf E WKH UHODWLYH YDOXHV RI $*7 P51$ FRPSDUHG ZLWK FRQWUROQ f 3rf

PAGE 103

D $*7 NEf! FDWKHSVLQ NEf! ] ] ] ] 4 4 4 4 2 2 ] 2 ] 2 R R 4 &2 4 &2 FR &2 R &2 2 &2 R R R 2 R R ! ! E &.FN$ W\4[?$0T &URY &U2RIW nVRIU E )LJXUH +HDUW $*7 P51$ OHYHOV LQ 6+5 KRXUV DIWHU ,$ RU ,9 LQMHFWLRQ RI $62'1 ZLWK OLSRVRPH SJ RI FDWLRQLF OLSRVRPHFRPSOH[HG $62'1 &$$62'1f FDWLRQLF OLSRVRPH FRPSOH[HG 6FU2'1 &$6FU2'1f FDWLRQLF OLSLGV&$f RU $62'1 ZHUH XVHG D WKH 1RUWKHUQ EORW DQDO\VLV RI $*7 NEf DQG FRQWURO FDWKHSVLQ NEf E WKH UHODWLYH YDOXHV RI $*7 P51$ FRPSDUHG ZLWK FRQWUROQ f 3rf

PAGE 104

E )LJXUH .LGQH\ $*7 P51$ OHYHOV LQ 6+5 KRXUV DIWHU ,$ RU ,9 LQMHFWLRQ RI RI $62'1 ZLWK OLSRVRPHV SJ RI FDWLRQLF OLSRVRPHFRPSOH[HG $62'1 &$$62'1f FDWLRQLF OLSRVRPHFRPSOH[HG 6FU2'1 &$6FU2'1f FDWLRQLF OLSLGV&$f RU $62'1 D WKH 1RUWKHUQ EORW DQDO\VLV RI $*7 NEf DQG FRQWURO FDWKHSVLQ NEf E WKH UHODWLYH YDOXHV RI $*7 P51$ FRPSDUHG ZLWK FRQWURO Q f 3rf

PAGE 105

)LJXUH f ,Q WKH OLYHU $*7 P51$ GHFUHDVHG VLPLODUO\ DIWHU HLWKHU ,$ RU ,9 LQMHFWLRQ RI &$$62'1 ZKLOH ODUJHU GHFUHDVHV b ZHUH REVHUYHG LQ UDWV WUHDWHG ZLWK &$$62'1 FRPSDUHG ZLWK b GHFUHDVHV DIWHU WUHDWHG ZLWK $62'1 DORQH DW WKH KRXU WLPH SRLQW )LJXUH f ,Q WKH KHDUW $*7 P51$ GHFUHDVHG PRUH DIWHU ,$ WKDQ DIWHU ,9 LQMHFWLRQ RI HLWKHU &$$62'1 RU $62'1 DORQH 'HFUHDVHV LQ $*7 P51$ DIWHU LQWUDDUWHULDO &$$62'1 $62'1 DQG LQWUDYHQRXV &$$62'1 WUHDWPHQW ZHUH b b b UHVSHFWLYHO\ 1R VLJQLILFDQW FKDQJHV LQ $*7 P51$ ZDV REVHUYHG DIWHU ,9 $62'1 WUHDWPHQW)LJXUH f 'LeFDVVs4Q $ VLJQLILFDQW GHFUHDVH LQ EORRG SUHVVXUH ZDV REVHUYHG KRXUV DIWHU ERWK LQWUDDUWHULDO DQG LQWUDYHQRXV LQMHFWLRQ RI FDWLRQLF OLSRVRPHFRPSOH[HG $62'1 XJ GRVHf WDUJHWHG WR $*7 P51$ LQ WKH 6+5 7KH GHFUHDVH LQ EORRG SUHVVXUH DIWHU ,$ LQMHFWLRQ ZDV FRQVLVWHQW ZLWK SUHYLRXV UHVXOWV >@ $OWKRXJK LW LV JHQHUDOO\ FRQVLGHUHG WKDW LQ WKH UHQLQDQJLRWHQVLQ HQ]\PDWLF FDVFDGH WKDW UHQLQ LV WKH UDWHOLPLWLQJ IDFWRU ZKLFK GHWHUPLQHV WKH DPRXQW RI $*7 EHLQJ FRQYHUWHG WR DQJLRWHQVLQ ,, ZKLOH $*7 LV FRQVWLWXWLYHO\ UHOHDVHG IURP WKH KHSDWRF\WHV DQG LV DOZD\V SUHVHQW LQ H[WUD DPRXQWV IRU WKH UHQLQ UHDFWLRQ >@ 7KH UHVXOWV RI WKHVH VWXGLHV VKRZHG WKDW LQKLELWLRQ RI WKH $*7 JHQH H[SUHVVLRQ LQ YLYR GHFUHDVHV EORRG SUHVVXUH HIIHFWLYHO\ ZKLFK PD\ SURYLGH D QRYHO WKHUDSHXWLF FKRLFH IRU WUHDWLQJ K\SHUWHQVLRQ 2XU UHVXOWV

PAGE 106

DOVR LPSO\ WKDW $*7 PD\ EH LQYROYHG LQ WKH SDWKRJHQHVLV RI K\SHUWHQVLRQ 7KH GLIIHUHQFH LQ PDJQLWXGH RI EORRG SUHVVXUH GHFUHDVHV DIWHU ,$ DQG ,9 DGPLQLVWUDWLRQ PLJKW EH DWWULEXWHG WR WKH GLIIHUHQFH LQ WLVVXH GLVWULEXWLRQ RI $62'1 UHVXOWLQJ IURP GLIIHUHQW URXWHV RI DGPLQLVWUDWLRQ DQG VXEVHTXHQWO\ OHDGV WR VSHFLILF WLVVXHPHGLDWHG HIIHFWV &RPSDUHG ZLWK ,$ DGPLQLVWUDWLRQ DIWHU ,9 LQMHFWLRQ D ODUJHU SDUW RI WKH &$$62'1 SDUWLFOHV DUH VHTXHVWHUHG E\ WKH OXQJV ZKHQ WKH FLUFXODWLRQ SUHVHQWV WKHP WR WKLV RUJDQ 7KH DFFXPXODWLRQ RI $62'1 E\ RWKHU WLVVXHV VXFK DV NLGQH\ DQG KHDUW PD\ VXEVHTXHQWO\ GHFUHDVH GXH WR WKH ORZHUHG $62'1 FRQFHQWUDWLRQ LQ WKH FLUFXODWLRQ DV WKH $62'1 LV VHTXHVWHUHG E\ WKH SXOPRQDU\ V\VWHP 7KH WLVVXH GLVWULEXWLRQ RI $62'1 KRXUV DIWHU LQMHFWLRQ VKRZHG D KLJKHU $62'1 DFFXPXODWLRQ RFFXUUHG LQ WKH OXQJ DIWHU ,9 WKDQ DIWHU ,$ LQMHFWLRQ ZKLOH JUHDWHU DFFXPXODWLRQ RI $62'1 RFFXUUHG LQ WKH NLGQH\ DIWHU ,$ WKDQ DIWHU ,9 LQMHFWLRQ 7KH DFFXPXODWLRQ LQ WKH OLYHU ZDV VOLJKWO\ KLJKHU DIWHU ,$ WKDQ DIWHU ,9 LQMHFWLRQ )LJXUH f 7KH GLIIHUHQFH LQ WLVVXH GLVWULEXWLRQ DIWHU ,$ DQG ,9 LQMHFWLRQ VXJJHVWV WKDW D WLVVXH RU RUJDQ HIIHFW VXFK DV D UHQDO HIIHFW PLJKW EH LQYROYHG LQ WKH REVHUYHG EORRG SUHVVXUH GHFUHDVHV 7KLV VWXG\ DOVR VKRZHG WKDW IRU ERWK LQWUDDUWHULDO DQG LQWUDYHQRXV DGPLQLVWUDWLRQ EORRG SUHVVXUH GHFUHDVHV ZHUH PRUH SURQRXQFHG DIWHU WUHDWPHQW ZLWK FDWLRQLF OLSRVRPH FRPSOH[HG $62'1 FRPSDUHG ZLWK WKDW DIWHU WKH XQFRPSOH[HG

PAGE 107

$62'1 WUHDWPHQW 7KLV LV LQ DJUHHPHQW ZLWK WKH K\SRWKHVLV ZKLFK SURSRVHV WKDW FDWLRQLF OLSRVRPH HQKDQFHV WKH DQWLK\SHUWHQVLYH HIIHFW RI $62'1 7KHVH REVHUYDWLRQV DUH DOVR FRQVLVWHQW ZLWK WKH LQ YLWUR VWXGLHV ZKLFK VXJJHVW WKDW FDWLRQLF OLSRVRPHV HQKDQFH WKH FHOOXODU GHOLYHU\ RI $62'1 DQG VXEVHTXHQWO\ SRWHQWLDWHV WKH LQKLELWRU\ HIIHFWV RI $62'1 RQ $*7 P51$ DQG SURWHLQ SURGXFWLRQ LQ FHOO FXOWXUH 3UHYLRXV VWXGLHV VKRZHG LQFRQFOXVLYH UHVXOWV LQ EORRG SUHVVXUH FKDQJHV DIWHU ,9 LQMHFWLRQ RI 3&FKROHVWHURO OLSRVRPH HQFDSVXODWHG $62'1 $ VLJQLILFDQW GHFUHDVH LQ EORRG SUHVVXUH ZDV REVHUYHG DIWHU ,9 LQMHFWLRQ RI FDWLRQLF OLSRVRPHFRPSOH[HG $62'1 VXJJHVWLQJ FDWLRQLF OLSRVRPH LV PRUH HIILFLHQW LQ GHOLYHU\ $62'1 WKDQ 3&FKROHVWHURO OLSRVRPH 7KH WLVVXH GLVWULEXWLRQ VWXGLHV GHPRQVWUDWHG WKDW FDWLRQLF OLSRVRPH GHOLYHU\ LQFUHDVHG VSHFLILF WLVVXH DFFXPXODWLRQ RI $62'1 ZKLFK PD\ EH D FRQWULEXWLQJ IDFWRU OHDGLQJ WR DQ LQFUHDVHG LQKLELWRU\ HIIHFW RQ EORRG SUHVVXUH 2QH DQG KRXUV DIWHU ,$ DGPLQLVWUDWLRQ WKH OLYHU KDG WKH KLJKHVW DFFXPXODWLRQ RI $62'1 $ERXW b RI WKH LQMHFWHG FDWLRQLF OLSRVRPH FRPSOH[HG ),7&$62'1 ZDV VKRZQ WR EH SUHVHQW LQ WKH OLYHU SUREDEO\ GXH WR WKH DQDWRPLFDO IHDWXUHV RI WKH UHWLFXORHQGRWKHOLDO V\VWHP $IWHU ,9 DGPLQLVWUDWLRQ PRUH $62'1 ZDV VHHQ WR DFFXPXODWH LQ WKH OXQJV DV H[SHFWHG 7KH DFFXPXODWLRQ LQ RWKHU RUJDQV VXFK DV EUDLQ DQG KHDUW LV PLQLPDO GXH WR WKH FRQWLQXRXV FDSLOODU\ HQGRWKHOLXP SUHVHQW LQ WKH EORRG EUDLQ EDUULHU DQG

PAGE 108

LQ WKH KHDUW PXVFOH $W WKH DQG KRXU WLPH SRLQW WKH DFFXPXODWLRQ RI $62'1 LQ WKH NLGQH\ DSSHDUV KLJKHU WKDQ WKDW DIWHU &$$62'1 SUREDEO\ EHFDXVH $62'1V ZHUH FOHDUHG E\ WKH OLYHU IDVWHU WKDQ WKH &$$62'1 ZKLFK ZDV ODUJHU DQG KHOG LQ WKH OLYHU WLVVXHV IRU D ORQJHU SHULRG RI WLPH 7ZHQW\IRXU KRXUV DIWHU LQMHFWLRQ LW DSSHDUHG WKDW WKH DFFXPXODWLRQ RI &$$62'1 LQ WKH NLGQH\ LV KLJKHU WKDQ DIWHU WKH QDNHG $62'1 7KLV FRXOG EH D UHVXOW RI VORZ FOHDUDQFH RI &$$62'1 IURP WKH 5(6 FRPSDUHG WR $62'1 7KH $62'1 DOVR ZHUH VXEMHFWHG WR PHWDEROLVP LQ YLYR 7KH KLJK LQWHQVLW\ RI IOXRUHVFHQW VLJQDO LQ WKH NLGQH\ KRXUV DIWHU LQMHFWLRQ PLJKW EH D UHVXOW RI WLPHGHSHQGHQW HOLPLQDWLRQ E\ WKH NLGQH\ 7KLV FRXOG DOVR EH D SRVVLEOH UHDVRQ IRU WKH ODFN RI GLIIHUHQFHV LQ DFFXPXODWLRQ EHWZHHQ $62'1 DQG &$$62'1 DW KRXUV \HW QRW WKH FDVH DW DQG KRXUV +HSDWLF XSWDNH DQG XULQDU\ H[FUHWLRQ DUH WKH WZR PDMRU URXWHV IRU WKH FOHDUDQFH RI PDFURPROHFXOHV VXFK DV $62'1>@ 7KH GLVWULEXWLRQ RI PDFURPROHFXOHV LV EDVLFDOO\ UHVWULFWHG WR WKH LQWUDYDVFXODU VSDFH LPPHGLDWHO\ DIWHU LQMHFWLRQ GXH WR ORZ FDSLOODU\ SHUPHDELOLW\ LQ PRVW RUJDQV 7KH $62'1 GLVWULEXWLRQ SURILOH GHSHQGV RQ WKH EDVLF VWUXFWXUDO IHDWXUH RI FDSLOODULHV ZKLFK UHSUHVHQW WKH PDMRU EDUULHU EHWZHHQ WKH FLUFXODWLRQ DQG WKH WLVVXH FHOOV DQG DUH GLYHUVH LQ SRURVLW\ DPRQJ RUJDQV >@ 7KH URXWH WKDW WKH PROHFXOHV WDNH WR FLUFXODWH LQ WKH ERG\ DOVR GHWHUPLQHV WKHLU LPPHGLDWH GLVSRVLWLRQ 7KUHH W\SHV RI FDSLOODU\ HQGRWKHOLXP SUHVHQW LQ GLIIHUHQW WLVVXHV &RQWLQXRXV

PAGE 109

FDSLOODU\ WKH PRVW ZLGHO\ GLVWULEXWHG LV IRXQG LQ FDUGLDF PXVFOH DQG FRQVWLWXWHV WKH EORRG EUDLQ EDUULHU 7KH WUDQVSRUW SDWKZD\ IRU PROHFXOHV LQ WKLV FDSLOODU\ LV YLD VPDOO SRUHV ZLWK HVWLPDWHG VL]HV RI QP DQG ODUJH SRUHV RI QP 7KH IHQHVWUDWHG FDSLOODULHV SUHVHQW LQ WKH LQWHVWLQDO PXFRVD DQG WKH JORPHUXODU DQG SHULWXEXODU FDSLOODULHV RI WKH NLGQH\ KDYH RSHQLQJV ZLWK GLDPHWHUV RI QP 'LVFRQWLQXRXV FDSLOODULHV ZKLFK DUH IRXQG DOPRVW H[FOXVLYHO\ LQ OLYHU VSOHHQ DQG ERQH PDUURZ DUH FKDUDFn WHUL]HG E\ WKH DEVHQFH RI D EDVHPHQW PHPEUDQH DQG WKH SUHVHQFH RI ODUJH HQGRWKHOLDO JDSV ZLWK GLDPHWHUV UDQJLQJ EHWZHHQ WR QP 7KH DQDWRPLFDO IHDWXUH RI WKH OLYHU VLQXVRLGV DOORZV PDFURPROHFXOHV ZLWK VL]HV RI QP WR SDVV RXW RI WKH YDVFXODU VSDFH LQWR WKH VXUURXQGLQJ WLVVXH HDVLO\>@ )RU ERWK ,$ DQG ,9 LQMHFWLRQ KHSDWLF XSWDNH DW WKH DQG KRXU WLPH SRLQWV LV VXEVWDQWLDOO\ KLJKHU GXH WR WKH VWUXFWXUH RI WKH GLVFRQWLQXRXV HQGRWKHOLXP RI WKH OLYHU ZKLFK EULQJV WKH FLUFXODWLQJ PROHFXOHV LQWR IUHH FRQWDFW ZLWK WKH VXUIDFH RI WKH SDUHQFK\PDO FHOOV ,Q WKH NLGQH\ WKH JORPHUXODU FDSLOODU\ ZDOO IXQFWLRQV DV D VL]H DQG FKDUJH VHOHFWLYH EDUULHU 0DFURPROHFXOHV ZLWK D PROHFXODU ZHLJKW RI OHVV WKDQ DSSUR[LPDWHO\ QP LQ GLDPHWHU DUH VXVFHSWLEOH WR JORPHUXODU ILOWUDWLRQ DQG DUH H[FUHWHG LQWR WKH XULQH HDVLO\ /DUJHU PROHFXOHV WHQG WR KDYH D KLJKHU UHQDO DFFXPXODWLRQ GXH WR ERWK WXEXODU UHDEVRUSWLRQ DQG XSWDNH IURP WKH SHULWXEXODU FDSLOODU\ VLGH>@ /LWWOH KDV

PAGE 110

EHHQ UHSRUWHG RQ WKH HIIHFW RI FKDUJH RQ WKH UHQDO DFFXPXODWLRQ RI $62'1 $V VKRZQ LQ WKLV VWXG\ DW DQG KRXUV DIWHU LQMHFWLRQ WKH $62'1 VHHPV WR KDYH D KLJKHU DFFXPXODWLRQ LQ WKH NLGQH\ WKDQ WKH FRPSOH[HG $62'1 ZKLOH DW KRXUV WKH KLJKHU GLVWULEXWLRQ RI FRPSOH[HG $62'1 PLJKW EH GXH WR D WLPHGHSHQGHQW FOHDUDQFH ,Q WKHRU\ DQWLVHQVH ROLJRQXFOHRWLGH EORFNV JHQH H[SUHVVLRQ E\ DFWLYDWLQJ 51DVH + ZLWK WKH VXEVHTXHQW GHJUDGDWLRQ RI WKH P51$ SRUWLRQ RI WKH P51$$62'1 K\EULG &RPSDUHG ZLWK PRVW SKDUPDFHXWLFDOV ZKLFK DFW RQ WKH HQG SURGXFWV RI WKH JHQH H[SUHVVLRQ WKH SURWHLQV $62'1V DFW RQ WKH HDUOLHU VWDJH RI WKH JHQH H[SUHVVLRQ DW WKH P51$ OHYHO>@ PDNLQJ D PRUH FRPSOHWH DQG ORQJODVWLQJ LQKLELWRU\ HIIHFW SRVVLEOH 7KLV LQ YLWUR VWXGLHV VKRZHG WKDW FDWLRQLF OLSRVRPHFRPSOH[HG $62'1 GHFUHDVHG $*7 SURWHLQ H[SUHVVLRQ E\ b LQ KHSDWRPD FHOO FXOWXUH DW D S0 FRQFHQWUDWLRQ ,Q WKH LQ YLYR VLWXDWLRQ E\ RSWLPL]LQJ SKDUPDFRNLQHWLF SDUDPHWHUV VXFK DV GRVDJH DQG URXWH RI DGPLQLVWUDWLRQ VXEVWDQWLDO LQKLELWLRQ RI WKH $*7 JHQH H[SUHVVLRQ DOVR LV H[SHFWHG LQ YLYR &$$62'1 WUHDWPHQW UHVXOWHG LQ D EORRG SUHVVXUH GHFUHDVH LQ 6+5 EXW QRW LQ :.< UDWV 7KH VDPH HIIHFW ZDV DOVR REVHUYHG DIWHU JLYLQJ ERWK VWUDLQV RI UDWV $&( LQKLELWRUV 7KH $&( LQKLELWRU FDSWRSULO FDXVHG D GRVHGHSHQGHQW GHFUHDVH LQ EORRG SUHVVXUH ZLWK D PD[LPDO GHFUHDVH RI PP+J LQ 6+5 ZKLOH QR VLJQLILFDQW GHFUHDVH LQ EORRG SUHVVXUH ZDV REVHUYHG

PAGE 111

LQ :.<>@ 7KHVH UHVXOWV VXJJHVW WKDW RYHUDFWLYLW\ RI 5$6 FRXOG EH D IDFWRU WKDW OHDGV WR K\SHUWHQVLRQ LQ WKH 6+5 VWUDLQ $ GLIIHUHQFH LQ EORRG SUHVVXUH FKDQJH DIWHU ,$ DQG ,9 LQMHFWLRQ ZDV REVHUYHG +RZHYHU WKH SODVPD $*7 DQG $QJ ,, OHYHO GLG QRW VKRZ VLJQLILFDQW GLIIHUHQFHV DIWHU ,$ DQG ,9 DGPLQLVWUDWLRQ 7KLV PD\ EH H[SODLQHG E\ WKH VLPLODU GLVWULEXWLRQ RI &$$62'1 LQ WKH OLYHU KRXUV DIWHU ERWK URXWHV RI LQMHFWLRQ VLQFH WKH OLYHU LV WKH RQO\ RUJDQ WKDW SURYLGHV WKH FLUFXODWLQJ $*7 7KLV LV DOVR VXSSRUWHG E\ WKH OLYHU $*7 P51$ OHYHO PHDVXUHG E\ 1RUWKHUQ EORW DQDO\VLV ZKLFK VKRZHG D VLPLODU GHFUHDVH RI P51$ LQ WKH OLYHU DIWHU HLWKHU ,$ RU ,9 LQMHFWLRQ 7KH NLGQH\ DQG KHDUW $*7 P51$ ZHUH VKRZQ WR EH VLJQLILFDQWO\ ORZHU KRXUV DIWHU ,$ WKDQ DIWHU ,9 DGPLQLVWUDWLRQ ZKLFK PLJKW EH D FRQVHTXHQFH RI GLIIHUHQW $62'1 XSWDNH DIWHU GLIIHUHQW URXWH RI DGPLQLVWUDWLRQ 'HFUHDVHV LQ ERWK WKH NLGQH\ DQG KHDUW P51$ ZHUH JUHDWHU DIWHU &$$62'1 WKDQ DIWHU QDNHG $62'1 WUHDWPHQW 7KHVH REVHUYHG GLIIHUHQFHV LQ $*7 P51$ GHFUHDVHV LQ WKH NLGQH\ DQG WKH KHDUW FRUUHODWH ZLWK WKH GLIIHUHQFH LQ EORRG SUHVVXUH GHFUHDVHV DIWHU ,$ DQG ,9 LQMHFWLRQ 7KLV LPSOLHV WKDW WKH ORFDO 5$6 SRVVLEO\ WKH NLGQH\ DQG WKH KHDUW PLJKW PHGLDWH WKH REVHUYHG EORRG SUHVVXUH FKDQJHV 'HFUHDVHV LQ $*7 P51$ LQ ORFDO WLVVXHV VXFK DV WKH NLGQH\ PD\ OHDG WR D GHFUHDVH LQ ORFDO 5$6 DFWLYLW\ ZKLFK VXEVHTXHQWO\ PHGLDWHV WLVVXH VSHFLILF SK\VLRORJLFDO HIIHFWV RQ EORRG SUHVVXUH

PAGE 112

7KH KHDUW DQG NLGQH\ DUH WZR PDMRU RUJDQV LQ EORRG SUHVVXUH UHJXODWLRQ 5HQLQ HQ]\PDWLF DFWLYLW\ ZDV GHWHFWHG LQ WKH KRPRJHQDWH RI ZKROH KHDUW>@ 7KH SUHVHQFH RI ERWK UHQLQ DQG $*7 P51$ LQ WKH KHDUW DQG WKH NLGQH\ ZDV GHPRQVWUDWHG XVLQJ LQ VLWX K\EULGL]DWLRQ 7KH FRH[SUHVVLRQ RI UHQLQ DQG WKH $*7 JHQH PDNHV WKH ORFDO GH QRYR V\QWKHVLV RI DQJLRWHQVLQ ,, SRVVLEOH DQG VXJJHVWV WKH H[LVWHQFH RI D IXQFWLRQLQJ ORFDO 5$6 $QJLRWHQVLQ ,, DV D YDVRDFWLYH KRUPRQH KDV WKH HIIHFW RI DFXWHO\ LQFUHDVLQJ FDUGLDF FRQWUDFWLOLW\ RU ORQJ WHUP VWLPXODWLRQ RI FDUGLDF K\SHUWURSK\ 7KH NLGQH\ ZDV WKH ILUVW RUJDQ IRU ZKLFK D IXQFWLRQLQJ WLVVXHVSHFLILF 5$6 KDG EHHQ GLVFXVVHG &Rn H[SUHVVLRQ RI UHQLQ $*7 DQG DQJLRWHQVLQ FRQYHUWLQJ HQ]\PH P51$ LQ WKH NLGQH\ VXSSRUW WKH H[LVWHQFH RI DQ LQWUDUHQDO 5$6 ZKLFK IXQFWLRQV WR UHJXODWH UHQDO VRGLXP DEVRUSWLRQ DQG KHPRG\QDPLFV>@ ,Q VXPPDU\ WKHVH UHVXOWV VXSSRUW WKH IROORZLQJ FRQFOXVLRQV &DWLRQLF OLSRVRPH FRPSOH[HG $62'1 DJDLQVW $*7 P51$ GHFUHDVHV EORRG SUHVVXUH fLQ 6+5 DIWHU ,$ DQG ,9 LQMHFWLRQ 2EVHUYHG GHFUHDVHV LQ EORRG SUHVVXUH ZHUH JUHDWHU DIWHU ,$ UDWKHU WKDQ ,9 LQMHFWLRQ 7KH GHFUHDVH LQ EORRG SUHVVXUH ZDV FRQVLVWHQW ZLWK WKH GHFUHDVH LQ $*7 P51$ LQ WKH NLGQH\ DQG KHDUW

PAGE 113

&+$37(5 '26('(3(1'(17 3+<6,2/2*,&$/ ())(&76 2) &$7,21,& /,32620( &203/(;(' $62'1 ,1 6+5 02'(/ 6SHFLILF $LPV 7KH VSHFLILF DLP RI WKLV SDUW RI WKH SURMHFW LV WR VWXG\ WKH GRVHUHVSRQVH HIIHFWV RI &$$62'1 ORZ MDJ PHGLXP ILJ KLJK _MJf RQ EORRG SUHVVXUH SODVPD DQG WLVVXH DQJLRWHQVLQRJHQ OHYHOV DQG WKH ZDWHU LQWDNH DQG XULQH RXWSXW LQ WKH 6+5 PRGHO RI K\SHUWHQVLRQ LQ RUGHU WR GHWHUPLQH WKH UROH RI NLGQH\ LQ $62'1 PHGLDWHG LQKLELWLRQ RI K\SHUWHQVLRQ ,QWURGXFWLRQ %ORFNLQJ WKH UHQLQ DQJLRWHQVLQ V\VWHP E\ DJHQWV VXFK DV DQJLRWHQVLQ FRQYHUWLQJ HQ]\PH LQKLELWRUV UHQLQ LQKLELWRUV DQG DQJLRWHQVLQ ,, UHFHSWRU DQWDJRQLVWV LV RQH RI WKH PRVW LPSRUWDQW WKHUDSHXWLF RSWLRQV IRU WUHDWLQJ K\SHUWHQVLRQ>@ 5HQLQ LQKLELWRUV KDYH EHHQ VKRZQ WR GHFUHDVH EORRG SUHVVXUH DQJLRWHQVLQ ,, DQG DOGRVWHURQH OHYHOV LQ D GRVHGHSHQGHQW PDQQHU>@ $ VWXG\ FRQGXFWHG RQ HVVHQWLDO K\SHUWHQVLRQ LQ KXPDQ VXEMHFWV VKRZHG WKDW WKH UHQLQ LQKLELWRU ). DW GRVHV RI PJ PJ DQG PJ GHFUHDVHG EORRG SUHVVXUHV IURP D EDVHOLQH OHYHO RI sO PP+J WR ss ss DQG ss PP+J UHVSHFWLYHO\ 7KH K\SRWHQVLYH

PAGE 114

HIIHFWV RI ). GLG QRW FRUUHODWH ZLWK EDVHOLQH SODVPD UHQLQ DFWLYLW\ VXJJHVWLQJ WKDW WKH VXSSUHVVLRQ RI WKH QRQn FLUFXODWLQJ WLVVXH UHQLQDQJLRWHQVLQ V\VWHP PD\ DFFRXQW IRU WKH K\SRWHQVLYH HIIHFW>@ 6WXGLHV ZLWK DQRWKHU UHQLQ LQKLELWRU 5HPLNLUHQ VKRZHG LW GHFUHDVHG EORRG SUHVVXUH LQ HVVHQWLDO K\SHUWHQVLRQ SDWLHQWV ZLWK FRQFRPLWDQW LQFUHDVHV LQ UHQDO EORRG IORZ DQG VRGLXP H[FUHWLRQ>@ $Q DQJLRWHQVLQ ,, W\SH UHFHSWRU DQWDJRQLVW /RVDUWDQ DOVR KDV EHHQ VKRZQ WR LQGXFH D GRVHGHSHQGHQW LQKLELWLRQ RI WKH SUHVVRU HIIHFW RI DQJLRWHQVLQ ,, $W D PJ RU PJ GRVH ORVDUWDQ GHFUHDVHV V\VWROLF EORRG SUHVVXUH DERXW PP+J DQG PP+J UHVSHFWLYHO\>@ +RZHYHU WKHVH DJHQWV JLYHQ DORQH RU LQ FRPELQDWLRQ ZLWK RWKHU GUXJV FRQWURO EORRG SUHVVXUH LQ b RI K\SHUWHQVLYH SDWLHQWV>@ ,Q DGGLWLRQ DOO FXUUHQW GUXJ WKHUDSLHV VXIIHU IURP YDULRXV SUREOHPV IRU H[DPSOH DQJLRWHQVLQ FRQYHUWLQJ HQ]\PH LQKLELWRUV RQH RI WKH PRVW ZLGHO\ XVHG DJHQWV WKDW LQKLELW WKH UHQLQ DQJLRWHQVLQ V\VWHPV DUH QRW VSHFLILF IRU WKH 5$6 EHFDXVH WKH\ DOVR LQKLELW NLQLQDVH ,, ZKLFK GHJUDGHV EUDG\NLQLQ ,QFUHDVHG OHYHOV RI EUDG\NLQLQ FDXVH XQGHVLUDEOH VLGH HIIHFWV VXFK DV GU\ FRXJK DQJLRHGHPD DQG XUWLFDULD>@ 5HQLQ LQKLELWRUV HYHQ WKRXJK PRUH VSHFLILF DUH OLPLWHG E\ LQVXIILFLHQW ELRDYDLODELOLW\ >@ DQG DQJLRWHQVLQ DQWDJRQLVWV ZRUN ZHOO RQO\ RQ SDWLHQWV ZLWK KLJK FLUFXODWLQJ DQJLRWHQVLQ ,, >@ 7KHUHIRUH DOWHUQDWLYH URXWHV WR EORFN WKH 5$6 PD\ KDYH SRWHQWLDO DGYDQWDJHV $QJLRWHQVLQRJHQ WKH SUHFXUVRU RI WKH

PAGE 115

5$6 KDV EHHQ VXJJHVWHG DV DQ LPSRUWDQW GHWHUPLQDQW RI EORRG SUHVVXUH DQG HOHFWURO\WH KRPHRVWDVLV>@ %ORFNLQJ DQJLR WHQVLQRJHQ V\QWKHVLV XVLQJ DQWLVHQVH WHFKQLTXHV KDV SURYHG WR EH HIIHFWLYH LQ GHFUHDVLQJ EORRG SUHVVXUH LQ WKH 6+5 PRGHO >@ $QWLVHQVH DV D WKHUDSHXWLF RSWLRQ KDV WKH DGYDQWDJHV RI SURYLGLQJ VSHFLILF DQG ORQJ WHUP SKDUPDFRORJLFDO HIIHFWV ,Q D SUHYLRXV VWXG\ LW ZDV GHPRQVWUDWHG WKDW LQWUDn DUWHULDOO\ DGPLQLVWHUHG FDWLRQLF OLSRVRPHFRPSOH[HG $62'1 DW D GRVH RI MJ _DJNJ%:f GHFUHDVHG EORRG SUHVVXUH LQ 6+5 DSSUR[LPDWHO\ PP+J ZLWKLQ KRXUV RI DGPLQLVWUDWLRQ >@ &RQFRPLWDQW GHFUHDVHV LQ SODVPD $&7 DQJLRWHQVLQ ,, DQG WLVVXH $*7 P51$ ZHUH DOVR REVHUYHG 7KH GHFUHDVH LQ EORRG SUHVVXUH ZDV FRUUHODWHG ZLWK D GHFUHDVH LQ NLGQH\ $*7 P51$ OHYHOV UDWKHU WKDQ SODVPD $*7 SURWHLQ OHYHOV VXJJHVWLQJ WKDW WKH REVHUYHG EORRG SUHVVXUH GHFUHDVHV PD\ EH PHGLDWHG E\ WKH DFWLRQV RI WKH ORFDO UHQDO WLVVXH 5$6 5HVXOWV IURP SUHYLRXV LQ YLWUR VWXGLHV GHPRQVWUDWHG WKDW WKH FHOOXODU XSWDNH RI FDWLRQLF OLSRVRPHFRPSOH[HG $62'1 LV GRVHGHSHQGHQW>@ $GGLWLRQDOO\ &$$62'1 GHFUHDVHG $*7 P51$ DQG SURWHLQ LQ D GRVHGHSHQGHQW PDQQHU LQ +HSDWRPD FHOO FXOWXUH ,Q DQ LQ YLYR VLWXDWLRQ DQJLRWHQVLQRJHQ IXQFWLRQV DV WKH VXEVWUDWH RI UHQLQ DQG D VXEVWDQWLDO GHFUHDVH LQ $*7 OHYHO LV UHTXLUHG WR OHDG WR WKH GHFUHDVH LQ DFWLYLW\ RI WKH 5$6 +LJK GRVHV RI &$$62'1 PD\ FDXVH GHSOHWLRQ RI WKH $*7 SRRO LQ WKH ERG\ ZKLFK WKHQ GHFUHDVHV WKH DFWLYLW\ RI WKH

PAGE 116

5$6 DQG VXEVHTXHQWO\ LQFUHDVHV WKH H[WHQW DQG GXUDWLRQ RI WKH DQWLK\SHUWHQVLYH HIIHFWV 2QH RI WKH HIIHFWV RI DQJLRWHQVLQ ,, LV WR VWLPXODWH WKH UHOHDVH RI DOGRVWHURQH IURP WKH DGUHQDO FRUWH[ $OGRVWHURQH DFWV RQ WKH UHQDO GLVWDO WXEXOH WR LQFUHDVH WKH UHDEVRUSWLRQ RI ZDWHU DQG VRGLXP DQG WKH H[FUHWLRQ RI SRWDVVLXP>@ %ORFNLQJ $*7 H[SUHVVLRQ VKRXOG VXEVHTXHQWO\ GHFUHDVH DQJLRWHQVLQ ,, OHYHOV DQG DOGRVWHURQH UHOHDVH DQG UHYHUVH WKHLU HIIHFWV $QJLRWHQVLQ ,, DOVR KDV D GLUHFW HIIHFW RQ WKH NLGQH\ E\ UHJXODWLQJ YDVRFRQVWULFWLRQ UHQDO EORRG IORZ JORPHUXODU ILOWUDWLRQ UDWH DQG VRGLXP ZDWHU H[FUHWLRQ>@ ,Q WKLV VWXG\ ZH PHDVXUHG WKH HIIHFW RI ORZ M-Jf PHGLXP MLJf DQG KLJK _LJf GRVHV RI &$$62'1 RQ EORRG SUHVVXUH SODVPD $*7 DQJLRWHQVLQ ,, OHYHO DQG $*7 P51$ OHYHOV LQ WKH KHDUW OLYHU NLGQH\ DQG LWV HIIHFWV RQ SODVPD DOGRVWHURQH XULQDU\ VRGLXP DQG SRWDVVLXP H[FUHWLRQ ZDWHU LQWDNH DQG XULQH RXWSXW 7KHVH UHVXOWV PD\ SURYLGH LQIRUPDWLRQ UHJDUGLQJ WKH SRWHQWLDO RI $62'1 DV D WKHUDSHXWLF DJHQW DQG RQ UHQDO PHFKDQLVPV RI EORRG SUHVVXUH UHJXODWLRQ 0DWHULD@ DQG 0HWKRGV 7R GHWHUPLQH WKH GRVHGHSHQGHQW HIIHFW RI &$$62'1 RQ WKH OHYHO DQG GXUDWLRQ RI EORRG SUHVVXUH FKDQJHV FDURWLG DUWHU\ FDWKHWHUL]DWLRQ ZDV SHUIRUPHG LQ 6+5V $QLPDOV ZHUH DOORZHG WR UHFRYHU IRU KRXUV DIWHU VXUJHU\ WKHQ EDVHOLQH EORRG SUHVVXUHV ZHUH PHDVXUHG XVLQJ WKH WDLO FXII PHWKRG $IWHU

PAGE 117

WKLV RQH RI WKUHH GRVHV RI &$$62'1 -JORZf MWJ PHGLXPf RU LJ KLJKf Q f ZDV LQMHFWHG YLD WKH FDURWLG DUWHU\ $ VLQJOH GRVH RI LJ RI FDWLRQLF OLSRVRPH FRPSOH[HG VFUDPEOHG 2'1 ZDV DOVR DGPLQLVWHUHG DV D FRQWURO WR GHWHUPLQH WKH VSHFLILFLW\ RI WKH DQWLVHQVH HIIHFW %ORRG SUHVVXUH ZDV PHDVXUHG XVLQJ WKH WDLO FXII PHWKRG IRU PLQXWHV DW WKH VDPH WLPH HYHU\ GD\ IRU GD\V 'XULQJ WKH ZHHN RI VWXG\ UDWV ZHUH KRXVHG LQ WKH PHWDEROLF FDJHV DQG WKHLU ZDWHU LQWDNH DQG XULQH RXWSXW ZDV PHDVXUHG GDLO\ ,Q D VXEVHTXHQW H[SHULPHQW WKH GRVHGHSHQGHQW HIIHFW RI &$$62'1 RQ SODVPD $*7 $QJ ,, DQG DOGRVWHURQH OHYHOV HYHU\ KRXUV IRU GD\V ZDV GHWHUPLQHG DIWHU D VLQJOH LQMHFWLRQ &DURWLG DUWHU\ FDWKHWHUL]DWLRQ ZDV SHUIRUPHG LQ 6+5V DQG DIWHU D KRXU UHFRYHU\ HLWKHU MDJ SJ RU D IMJ RI &$$62'1Q f ZDV LQMHFWHG YLD WKH FDURWLG DUWHU\ $JDLQ &$6FU2'1 ZDV XVHG DV D FRQWUROQ f *URXSV RI UDWV ZHUH VDFULILFHG KRXUV DIWHU LQMHFWLRQ DQG SODVPD VDPSOHV OLYHU NLGQH\ DQG KHDUW WLVVXHV ZHUH FROOHFWHG 3ODVPD $*7 >@ DQJLRWHQVLQ ,,5.$ $OSFR :LQGKDP 1+f DQG DOGRVWHURQH OHYHOV'LDJQRVWLF 6\VWHPV /DERUDWRULHV ,QF 7H[DVf ZHUH PHDVXUHG XVLQJ UDGLRLPPXQRDVVD\ 7KH GRVHGHSHQGHQW HIIHFW RI HDFK GRVH RI &$$62'1 RQ WLVVXH $*7 P51$ DOVR ZDV PHDVXUHG 7RWDO P51$ ZDV H[WUDFWHG IURP OLYHU NLGQH\ DQG KHDUW WLVVXHV 0HVVHQJHU 51$ ZDV UHYHUVH WUDQVFULSWHG WR F'1$ DQG WKHQ VXEMHFWHG WR DPSOLILFDWLRQ E\ SRO\PHUDVH FKDLQ UHDFWLRQ

PAGE 118

,Q WKH VXEVHTXHQW H[SHULPHQW WKH GRVH HIIHFW RI &$$62'1 RQ XULQDU\ VRGLXPSRWDVVLXP H[FUHWLRQ DW KRXU LQWHUYDOV IRU GD\V DIWHU WUHDWPHQW ZDV GHWHUPLQHG 7KH FROOHFWHG XULQH ZDV FHQWULIXJHG DQG RI WKH VXSHUQDWDQW ZDV DVSLUDWHG 8ULQDU\ VRGLXP DQG SRWDVVLXP FRQFHQWUDWLRQ ZDV PHDVXUHG XVLQJ 129$ $XWRPDWHG 6RGLXP3RWDVVLXP $QDO\]HU 129$ %LRPHGLFDO 0DVVDFKXVHWWVf 7KH FXPXODWLYH VRGLXP DQG SRWDVVLXP H[FUHWLRQ ZDV FDOFXODWHG DV WKH VRGLXP DQG SRWDVVLXP FRQFHQWUDWLRQ PXOWLSOLHG E\ WKH XULQH RXWSXW 6WDWLVWLFDO DQDO\VLV ZDV SHUIRUPHG E\ WZR ZD\ $129$ IRU WUHDWPHQW HIIHFW 'DWD IRU LQGLYLGXDO WLPH SRLQWV ZHUH DQDO\]HG XVLQJ WKH 6WXGHQWV LQGHSHQGHQW 7WHVW 6LJQLILFDQFH ZDV DW WKH b FRQILGHQFH OLPLW 5HVXOWV )LJXUH GHPRQVWUDWHV WKH GRVHGHSHQGHQW HIIHFW RI &$$62'1 RQ WKH EORRG SUHVVXUH RI 6+5 7KH FRQWURO 6+5V VKRZHG D EDVHOLQH OHYHO RI s PP+J $W WKH KRXU WLPH SRLQW D VOLJKW LQFUHDVH LQ EORRG SUHVVXUHs PP+Jf ZDV REVHUYHG 6+5V WUHDWHG ZLWK WKH ORZ GRVH RI &$$62'1 VKRZHG EORRG SUHVVXUH IOXFWXDWLRQV ZLWKLQ WKH QRUPDO UDQJH IRU WKH GD\V RI PHDVXUHPHQW 6+5V WUHDWHG ZLWK WKH PHGLXP GRVH RI &$$62'1 VKRZHG D VLJQLILFDQW GHFUHDVH LQ EORRG SUHVVXUH RQ GD\ PP+Jf3f DQG GD\ PP+Jf3f FRPSDUHG ZLWK WKH EDVHOLQH OHYHO s PP+Jf SULRU WR DGPLQLVWUDWLRQ 0RUH SURQRXQFHG GHFUHDVHV LQ EORRG SUHVVXUH

PAGE 119

)LJXUH 'RVHUHVSRQVH HIIHFWV RI FDWLRQLF OLSRVRPH FRPSOH[HG $62'1 &$$62'1f RQ V\VWROLF EORRG SUHVVXUH LQ 6+5 6+5V ZHUH LQMHFWHG ZLWK HLWKHU ORZ cDJf PHGLXP _DJf KLJK _DJf GRVH RI &$$62'1 RU _DJ &$6FU2'1 LQWUDDUWHULDOO\ 6\VWROLF EORRG SUHVVXUHV ZHUH PRQLWRUHG E\ WDLOFXII HYHU\ KRXUV IRU GD\V 'DWD UHSUHVHQW PHDQ s VWDQGDUG HUURU Q f rf VLJQLILFDQW GLIIHUHQW IURP WKH EDVHOLQH OHYHO 3f

PAGE 120

ZHUH REVHUYHG DIWHU WKH KLJK GRVH WUHDWPHQW %ORRG SUHVVXUH ZDV UHGXFHG IURP EDVHOLQH OHYHOV RI PP+J WR s PP+J RQ GD\ 3f s PP+J3f RQ GD\ DQG PP+J3f RQ GD\ %ORRG SUHVVXUHV VWDUWHG WR UHFRYHU WRZDUGV EDVHOLQH OHYHOV RQ GD\ PP+Jf)LJXUH f &$$62'1 WUHDWPHQW DOVR FDXVHG D GRVHGHSHQGHQW GHFUHDVH LQ SODVPD $*7 $W WKH PHGLXP GRVH RI &$$62'1 WKH SODVPD $*7 OHYHO GHFUHDVHG IURP D EDVHOLQH OHYHO RI s QJPO WR s QJPO3f RQ GD\ WR QJPO RQ GD\ DQG s QJPO3f RQ GD\ 3ODVPD $*7 FRQFHQWUDWLRQV FRPSOHWHO\ UHFRYHUHG WR EDVHOLQH OHYHOV RQ GD\ $W WKH KLJK GRVH RI &$$62'1 WKH GHFUHDVH LQ SODVPD $*7 OHYHOV ZDV JUHDWHU WKDQ RI WKH PHGLXP GRVH DQG ODVWHG IRU D ORQJHU SHULRG 7KH EDVHOLQH OHYHOV RI SODVPD $*7 ZHUH s QJPO ZKLFK ZDV VLPLODU WR WKH EDVHOLQH YDOXHV IRU WKH RWKHU H[SHULPHQWDO JURXSV 7KLV OHYHO ZDV UHGXFHG WR QJPO RQ GD\ QJPO RQ GD\ 3f s QJPO RQ GD\ DQG s QJPO RQ GD\ 3f )LJXUH f 3ODVPD $QJ ,, OHYHOV VKRZHG D VLPLODU GHFUHDVLQJ WUHQG ZLWK &$$62'1 WUHDWPHQW $IWHU WUHDWPHQW ZLWK WKH PHGLXP GRVH RI &$$62'1 $QJ ,, GHFUHDVHG IURP QJPO WR s QJPO RQ GD\ DQG WR s QJPO RQ GD\ $W WKH KLJK GRVH $QJ ,, OHYHOV GHFUHDVHG PRUH SURIRXQGO\ IURP s QJPO WR s QJPO RQ GD\ QJPO RQ GD\ DQG s QJPO RQ GD\ 3f 7KH UHGXFWLRQ RI SODVPD $QJ ,, ODVWHG IRU GD\V DQG VWDUWHG WR UHFRYHU WRZDUGV EDVHOLQH RQ GD\)LJXUH f

PAGE 121

)LJXUH 'RVHUHVSRQVH HIIHFWV RI &$$62'1 RQ SODVPD $*7 OHYHOV LQ 6+5 6+5V ZHUH LQMHFWHG ZLWK RQH RI WKUHH GRVHV RI &$$62'1 ORZ LJf PHGLXP _DJf KLJK -Jf RU _-J &$6FU2'1 LQWUDDUWHULDOO\ 3ODVPD DQJLRWHQVLQRJHQ OHYHOV ZHUH PHDVXUHG E\ UDGLRLPPXQRDVVD\ HYHU\ KRXUV IRU GD\V 'DWD UHSUHVHQW PHDQ s VWDQGDUG HUURUQ f rf VLJQLILFDQW GLIIHUHQW IURP WKH EDVHOLQH OHYHOV3f

PAGE 122

,OO )LJXUH 'RVHUHVSRQVH HIIHFWV &$$62'1 RQ SODVPD DQJLRWHQVLQ ,, OHYHOV LQ 6+5 6+5V ZHUH LQMHFWHG ZLWK RQH RI WKUHH GRVHV RI &$$62'1 ORZ SLJf PHGLXP MLJf KLJK _MJf RU _MJ &$6FU2'1 LQWUDDUWHULDOO\ 3ODVPD DQJLRWHQVLQ ,, OHYHOV ZHUH PHDVXUHG E\ UDGLRLPPXQRDVVD\ HYHU\ KRXUV IRU GD\V 'DWD UHSUHVHQW PHDQ s VWDQGDUG HUURUQ f rf VLJQLILFDQW GLIIHUHQW IURP WKH EDVHOLQH OHYHOV 3f

PAGE 123

$*7 ESf} 3DFWcQ ESf} &' F ,G LI &2 1 &2 !! !r 72 &' 4 4 4 4 )LJXUH 'RVHUHVSRQVH HIIHFWV RI PHGLXP GRVH &$$62'1 RQ NLGQH\ $*7 P51$ H[SUHVVLRQ LQ 6+5 6+5V ZHUH LQMHFWHG ZLWK SJ RI &$$62'1 LQWUDDUWHULDOO\ $*7 P51$ H[SUHVVLRQ LQ WKH NLGQH\ ZDV PHDVXUHG E\ 573&5 8SSHU 5HVXOW IURP WKH 573&5 $*76 ES DFWLQ ES /RZHU 5DWLR RI WKH LQWHQVLW\ RI $*7 WR FRQWURO SDFWLQ EDQGV 5HVXOWV ZHUH FRQVLVWHQW IRU WKUHH PHDVXUHPHQWV

PAGE 124

&' & a ‘VU &2 &0 f ! ! &2 UR UR &' &' &2 4 4 4 4 $*7 ESf! 3DFWLQ ESf! )LJXUH 'RVHUHVSRQVH HIIHFWV RI KLJK GRVH &$$62'1 RQ NLGQH\ $*7 P51$ H[SUHVVLRQ LQ 6+5 6+5V ZHUH LQMHFWHG ZLWK SJ RI &$$62'1 LQWUDDUWHULDOO\ $*7 P51$ H[SUHVVLRQ LQ WKH NLGQH\ ZDV PHDVXUHG E\ 573&5 8SSHU 5HVXOW IURP WKH 573&5 $*7 ES 3DFWLQ ES /RZHU 5DWLR RI WKH LQWHQVLW\ RI $*7 WR FRQWURO 3DFWLQ EDQGV 5HVXOWV ZHUH FRQVLVWHQW IRU WKUHH PHDVXUHPHQWV

PAGE 125

k F D Z 9 &2 &0 !! !! 44 4 4 4 4 $*7 ESf} SDFWLQ ESf} %DVHOLQH 'D\ 'D\ 'D\ 'D\ )LJXUH 'RVHUHVSRQVH HIIHFWV RI PHGLXP GRVH &$$62'1 RQ OLYHU $*7 P51$ H[SUHVVLRQ LQ 6+5 6+5V ZHUH LQMHFWHG ZLWK SJ RI &$$62'1 $*7 P51$ H[SUHVVLRQ LQ WKH OLYHU ZHUH PHDVXUHG E\ 573&5 8SSHU 5HVXOW IURP WKH 573&5 $*7 ES SDFWLQ ES /RZHU 5DWLR RI WKH LQWHQVLW\ RI $*7 WR FRQWURO SDFWLQ EDQGVQ f 5HVXOWV ZHUH FRQVLVWHQW IRU WKUHH PHDVXUHPHQWV

PAGE 126

&' F 9 &2 &0 Y If !} FR &2 &2 &2 &' 4 2 4 4 $*7 ESfA 3DFWLQ ESfQ! f F f i r nf6 f§ .rr} \YY Y}Y. %DVHOLQH 'D\ 'D\ 'D\ 'D\ )LJXUH 'RVHUHVSRQVH HIIHFWV RI KLJK GRVH &$$62'1 RQ OLYHU $*7 P51$ H[SUHVVLRQ LQ 6+5 6+5V ZHUH LQMHFWHG ZLWK SJ RI &$$62'1 $*7 P51$ H[SUHVVLRQ LQ WKH OLYHU ZHUH PHDVXUHG E\ 573&5 8SSHU 5HVXOW IURP WKH 573&5 $*7 ES 3DFWLQ ES /RZHU 5DWLR RI WKH LQWHQVLW\ RI $*7 WR FRQWURO 3DFWLQ EDQGVQ f 5HVXOWV ZHUH FRQVLVWHQW IRU WKUHH PHDVXUHPHQWV

PAGE 127

$*7 ESf! SDFWLQ ESf! )LJXUH 'RVHUHVSRQVH HIIHFWV RI PHGLXP GRVH &$$62'1 RQ KHDUW $*7 P51$ H[SUHVVLRQ LQ 6+5 6+5V ZHUH LQMHFWHG ZLWK SJ GRVH RI &$$62'1 $*7 P51$ H[SUHVVLRQV LQ WKH KHDUW ZHUH PHDVXUHG E\ 573&5 8SSHU 5HVXOW IURP WKH 573&5 $*7 ES SDFWLQ ES /RZHU 5DWLRV RI WKH LQWHQVLW\ RI $*7 EDQG WR FRQWURO 3DFWLQQ f 5HVXOWV ZHUH FRQVLVWHQW IRU WKUHH PHDVXUHPHQWV

PAGE 128

$*7 ESf} DFWLQ ESf} I %DVHOLQH 'D\ 'D\ 'D\ 'D\ )LJXUH 'RVHUHVSRQVH HIIHFWV RI KLJK GRVH &$$62'1 RQ KHDUW $*7 P51$ H[SUHVVLRQ LQ 6+5 6+5V ZHUH LQMHFWHG ZLWK SJ RI &$$62'1 $*7 P51$ H[SUHVVLRQV LQ WKH KHDUW ZHUH PHDVXUHG E\ 573&5 8SSHU 5HVXOW IURP WKH 573&5 $*7 ES SDFWLQ ES /RZHU 5DWLRV RI WKH LQWHQVLW\ RI $*7 EDQG WR FRQWURO 3DFWLQQ f 5HVXOWV ZHUH FRQVLVWHQW IRU WKUHH PHDVXUHPHQWV

PAGE 129

7KH GRVH GHSHQGHQW HIIHFW RI &$$62'1 RQ WLVVXH $*7 P51$ DOVR ZDV VWXGLHG $*7 P51$V ZHUH TXDQWLILHG E\ WKH 573&5 PHWKRG )LJXUH DQG VKRZ WKH UDWLRV RI $*7 P51$ WR FRQWURO 3DFWLQ P51$ 7KH ILJXUHV GHPRQVWUDWH WKDW NLGQH\ $*7 P51$ GHFUHDVHG b RQ GD\ DIWHU WKH KLJK GRVH WUHDWn PHQW ZLWK IXOO UHFRYHU\ RFFXUULQJ RQ GD\ :LWK WKH PHGLXP GRVH $*7 P51$ GHFUHDVHG b RQ GD\ DQG UHFRYHUHG E\ GD\ )LJXUH f ,Q WKH OLYHU $*7 P51$ ZDV GHFUHDVHG b DQG b RQ WKH ILUVW GD\ DIWHU WKH KLJK DQG PHGLXP GRVH RI &$ $62'1 WUHDWPHQWV UHVSHFWLYHO\ 7KLV UHGXFWLRQ ODVWHG DERXW GD\V)LJXUH f 7KH KLJK GRVH RI &$$62'1 WUHDWPHQW DOVR LQGXFHG D VLJQLILFDQW GHFUHDVH RI $*7 P51$ LQ WKH KHDUW DV VKRZQ LQ )LJXUH *UHDWHU GHFUHDVHV RI $*7 P51$ ZHUH REVHUYHG DIWHU WKH KLJK GRVH &$$62'1 WUHDWPHQW WKDQ DIWHU WKH PHGLXP GRVH 7DEOH SUHVHQWV WKH ZDWHU LQWDNH DQG XULQH RXWSXW RI 6+5nV DIWHU &$$62'1 WUHDWPHQW 6LQFH WKH UDWV ZHUH WDNHQ IURP PHWDEROLF FDJHV IRU KRXUV HYHU\ GD\ IRU EORRG SUHVVXUH PHDVXUHPHQW WKH YDOXHV UHIOHFW ZDWHU LQWDNH DQG XULQH RXWSXW GXULQJ DQ KRXU SHULRG UDWKHU WKDQ KRXUV 7KH ZDWHU LQWDNH IOXFWXDWHG GDLO\ DQG QR VLJQLILFDQW GLIIHUHQFH FRXOG EH DWWULEXWHG WR WKH &$$62'1 WUHDWPHQW ZKHQ FRPSDUHG ZLWK FRQWUROV RU HYHQ ZLWKLQ JURXSV +RZHYHU XULQH YROXPHV ZHUH VLJQLILFDQWO\ LQFUHDVHG 3f DIWHU &$$62'1 WUHDWPHQW :LWK WKH PHGLXP GRVH XULQH YROXPHV LQFUHDVHG WR PO 3f RQ GD\ PO RQ GD\ 3f FRPSDUHG ZLWK WKH EDVHOLQH XULQH RXWSXW RI

PAGE 130

7DEOH 'RVHUHVSRQVH HIIHFWV RI &$$62'1 RQ ZDWHU LQWDNH DQG XULQH RXWSXW LQ 6+5 6+5V ZHUH LQMHFWHG ZLWK PHGLXP MMJf RU KLJK GRVH SLJf RI &$$62'1 LQWUDDUWHULDOO\ 8ULQH RXWSXW DQG GULQNLQJ YROXPH ZHUH PHDVXUHG GDLO\ IRU GD\V Q f %/ EDVHOLQH 3rf :DWHU LQWDNH s 6( PO KfQ f 8ULQH RXWSXW 6( PO KfQ f &RQWURO%/f s 'D\ s 'D\ s 'D\ s 'D\ s 'D\ s 0HGLXP GRVH%/f OsnO 'D\ s s 'D\ s r 'D\ s s 'D\ s 'D\ s +LJK GRVH%/f s 'D\ s r 'D\ sr 'D\ sr 'D\ s 'D\ s s

PAGE 131

7DEOH 'RVHUHVSRQVH HIIHFWV RI &$$62'1 RQ SODVPD DOGRVWHURQH OHYHOV LQ 6+5 6+5V ZHUH LQMHFWHG ZLWK PHGLXP _Jf RU KLJK GRVH IDJf RI &$$62'1 LQWUDDUWHULDOO\ 3ODVPD DOGRVWHURQH OHYHOV ZHUH PHDVXUHG E\ UDGLRLPPXQRDVVD\ HYHU\ KRXUV IRU GD\VQ f 3rf $OGRVWHURQH s 6(QJPOf &RQWUROEDVHOLQHf s GD\ s GD\ GD\ s GD\ GD\ s 0HGLXP GRVHEDVHOLQHf s GD\ r GD\ r GD\ r GD\ GD\ +LJK GRVHEDVHOLQHf GD\ r GD\ r GD\ r GD\ GD\

PAGE 132

s PO $W WKH KLJK GRVH WKLV VLJQLILFDQW LQFUHDVH LQ XULQH YROXPH ZDV JUHDWHU DQG PRUH SURORQJHG s PO RQ GD\ PO RQ GD\ DQG PO RQ GD\ 3f FRPSDUHG ZLWK D EDVHOLQH OHYHO RI PO 3ODVPD DOGRVWHURQH OHYHOV LQ UHVSRQVH WR &$$62'1 WUHDWPHQW ZHUH DOVR GHWHUPLQHG LQ WKH 6+5V 6LJQLILFDQW GHFUHDVHV LQ DOGRVWHURQH ZHUH REVHUYHG DIWHU ERWK WKH PHGLXP DQG KLJK GRVH WUHDWPHQWV $W PHGLXP GRVHV DOGRVWHURQH OHYHOV GURSSHG IURP D EDVHOLQH OHYHO RI QJPO WR QJPO RQ GD\ QJPO RQ GD\ DQG QJPO3f RQ GD\ $OGRVWHURQH YDOXHV ZHUH QRUPDOL]HG E\ GD\ $IWHU WKH KLJK GRVH RI &$$62'1 WKH UHGXFWLRQ LQ DOGRVWHURQH OHYHOV ZDV PRUH LPSUHVVLYH )URP D EDVHOLQH YDOXH RI QJPO DOGRVWHURQH OHYHO ZDV UHGXFHG WR QJPO RQ GD\ QJPO RQ GD\ DQG QJPO RQ GD\ 3f $OGRVWHURQH YDOXHV ZHUH QRW DOWHUHG LQ 6+5V WUHDWHG ZLWK FRQWURO 6FU2'1 7DEOH f 7KH REVHUYHG GHFUHDVHV LQ DOGRVWHURQH OHYHOV ZHUH FRQVLVWHQW ZLWK XULQDU\ VRGLXP DQG SRWDVVLXP H[FUHWLRQ 3ULRU WR &$$62'1 WUHDWPHQW XULQDU\ VRGLXP DQG SRWDVVLXP H[FUHWLRQ ZDV VLPLODU LQ DOO JURXSV GXULQJ WKH KRXU PHDVXUHPHQW SHULRG 7KHUH ZHUH QR FKDQJHV REVHUYHG LQ WKH FRQWURO JURXS RYHU WKH GD\ PHDVXUHPHQW +RZHYHU D GRVHUHVSRQVH OLNH HIIHFW RQ VRGLXP DQG SRWDVVLXP H[FUHWLRQ ZDV REVHUYHG LQ WKH &$$62'1 WUHDWPHQW JURXSV $Q LQFUHDVH LQ WKH FXPXODWLYH VRGLXP H[FUHWLRQ ZLWK D FRQFRPLWDQW GHFUHDVH LQ SRWDVVLXP H[FUHWLRQ

PAGE 133

7DEOH 'RVHUHVSRQVH HIIHFWV RI &$$62'1 RQ KRXU XULQDU\ VRGLXP DQG SRWDVVLXP H[FUHWLRQ LQ 6+5 6+5V ZHUH LQMHFWHG ZLWK PHGLXP _XJf DQG KLJK MXJf GRVHV RI &$$62'1 LQWUDDUWHULDOO\ 7KH VRGLXP DQG SRWDVVLXP FRQFHQWUDWLRQV LQ WKH XULQH ZHUH PHDVXUHG DQG WRWDO VRGLXP DQG SRWDVVLXP H[FUHWLRQV ZHUH FDOFXODWHG DV WKH FRQFHQWUDWLRQ PXOWLSOLHG E\ WKH XULQH YROXPH Q f 3 rf 6RGLXP s 6( PPRO KfQ f 3RWDVVLXP 6( PPRO KfQ f &RQWURO %/f s GD\ GD\ GD\ GD\ GD\ 0HGLXP GRVH%/f 'D\ r r 'D\ r r 'D\ 'D\ 'D\ +LJK GRVH%/f 'D\ r r GD\ r r GD\ r r GD\ GD\

PAGE 134

ZDV REVHUYHG :LWK WKH PHGLXP GRVH RI &$$62'1 WUHDWPHQW VRGLXP H[FUHWLRQ LQFUHDVHG IURP D EDVHOLQH YDOXH RI PPRO WR PPRO RQ GD\ DQG s PPRO RQ GD\ ZKLOH SRWDVVLXP H[FUHWLRQ GHFUHDVHG IURP D EDVHOLQH OHYHO RI PPRO WR s PPRO RQ GD\ DQG s PPRO RQ GD\ 3f $IWHU WKH KLJK GRVH VRGLXP H[FUHWLRQ LQFUHDVHG IURP D EDVHOLQH OHYHO RI PPRO WR PPRO RQ GD\ PPRO RQ GD\ DQG s PPRO RQ GD\ 3RWDVVLXP H[FUHWLRQ GHFUHDVHG IURP D EDVHOLQH OHYHO RI s PPRO WR s PPRO RQ GD\ s PPRO RQ GD\ DQG s PPRO RQ GD\ 3f 7DEOH f 7KH UHVXOWV RI WKLV VWXG\ GHPRQVWUDWH WKDW LQWUDDUWHULDO LQMHFWLRQ RI FDWLRQLFn OLSRVRPHFRPSOH[HG $62'1 WDUJHWHG DJDLQVW $*7 P51$ GHFUHDVHG EORRG SUHVVXUH LQ D GRVH GHSHQGHQW PDQQHU %ORRG SUHVVXUH GHFUHDVHG VLJQLILFDQWO\ DW ERWK _LJ DQG SJ GRVHV LQ 6+5 ZKLOH LQMHFWLRQ RI VFUDPEOHG 2'1 FRPSOH[ GLG QRW SURGXFH D VLPLODU HIIHFW VXJJHVWLQJ VSHFLILFLW\ RI WKH DQWLVHQVH DFWLRQ DW WKHVH FRQFHQWUDWLRQV $W WKH 622SJ GRVH D PP+J GHFUHDVH LQ V\VWROLF EORRG SUHVVXUH ZDV REVHUYHG 7KH GHFUHDVH LQ EORRG SUHVVXUH ODVWHG DERXW KRXUV FRPSDUHG ZLWK WKH PHGLXP GRVH WUHDWHG 6+5V ZKLFK VKRZHG D VPDOOHU GHFUHDVH LQ EORRG SUHVVXUH ZLWK D VKRUWHU GXUDWLRQ RI DFWLRQ

PAGE 135

'HFUHDVLQJ EORRG SUHVVXUH LQ 6+5 YLD LQKLELWLRQ RI WKH $*7 JHQH H[SUHVVLRQ XVLQJ DQ DQWLVHQVH WHFKQLTXH KDV EHHQ UHSRUWHG LQ WKH OLWHUDWXUH>@ 7KH DQWLK\SHUWHQVLYH HIIHFWV GLIIHU EDVHG RQ URXWHV RI DQWLVHQVH DGPLQLVWUDWLRQ DQG PHWKRGV RI KHSDWRF\WH GHOLYHU\ 7RPLWD HW DO WUDQVIHFWHG DQWLVHQVH DJDLQVW $*7 P51$ YLD WKH KHSDWLF SRUWDO YHLQ XVLQJ OLSRVRPHV FRQWDLQLQJ YLUDO DJJOXWLQLQV $62'1 DW D FRQFHQWUDWLRQ RI -0 GHFUHDVHG EORRG SUHVVXUH IURP PP+J WR PP+J 7KH GHFUHDVH LQ EORRG SUHVVXUH ODVWHG IRU GD\V>@ 0DNLQR HW DO LQMHFWHG $62'1 DJDLQVW UDW DQJLRWHQVLQRJHQ FRXSOHG WR DQ DVLDORJO\FRSURWHLQ FDUULHU PROHFXOH YLD WKH WDLO YHLQ 7KH\ REVHUYHG D EORRG SUHVVXUH GHFUHDVH IURP PP+J WR PP+J DW D XJ $62'1 GRVH KRXUV DIWHU LQMHFWLRQ>@ +RZHYHU QRQH RI WKHVH PHWKRGV ZHUH DEOH WR GHFUHDVH EORRG SUHVVXUH WR QRUPRWHQVLYH OHYHOV ,Q WKLV VWXG\ LW KDV EHHQ GHPRQVWUDWHG WKDW DQ LQWUDn DUWHULDO LQMHFWLRQ RI D _MJ GRVH RI &$$62'1 ZDV DEOH WR GHFUHDVH EORRG SUHVVXUH IURP D EDVHOLQH RI PP+J WR PP+J DIWHU KRXUV 7KLV VLQJOH GRVH RI &$$62'1 SURGXFHG D K\SRWHQVLYH HIIHFW FRPSDUDEOH WR WKH DQWLK\SHUn WHQVLYH HIIHFW SURGXFHG E\ PXOWLSOH GRVLQJV RI RWKHU GUXJV ZRUNLQJ RQ WKH UHQLQ DQJLRWHQVLQ V\VWHP VXFK DV $&( LQKLELWRUV DQG UHQLQ LQKLELWRUV>@ 7KLV VXJJHVWV WKDW DQWLVHQVH EORFNLQJ WKH UHQLQ DQJLRWHQVLQ V\VWHP PD\ KDYH SRWHQWLDO DV DQ DQWLK\SHUWHQVLYH DJHQW ZLWK ORQJHU GXUDWLRQ 7KHVH UHVXOWV DOVR VXSSRUW WKH IDFW WKDW $*7 LV LPSRUWDQW LQ EORRG SUHVVXUH UHJXODWLRQ

PAGE 136

7KH REVHUYHG DQWLK\SHUWHQVLYH HIIHFW ZDV GRVH GHSHQGHQW $ PRUH SURQRXQFHG GHFUHDVH LQ EORRG SUHVVXUH ZDV REVHUYHG DIWHU KLJK GRVH WUHDWPHQW FRPSDUHG ZLWK WKDW RI WKH PHGLXP GRVH 2XU SUHYLRXV LQ YLWUR VWXG\ VKRZHG WKDW WKH XSWDNH RI &$$62'1 UHDFKHG D SODWHDX DW &$$62'1 FRQFHQWUDWLRQ DW DERXW M0 LQ FHOO FXOWXUH ,Q DQ LQ YLYR VLWXDWLRQ LQFUHDVLQJ WKH GRVH VKRXOG LQFUHDVH WKH SODVPD FRQFHQWUDWLRQ DQG WKHQ OHDG WR D PRUH HIIHFWLYH LQWUDFHOOXODU GHOLYHU\ RI $62'1 VXEVHTXHQWO\ LQFUHDVLQJ WKH H[WHQW DQG GXUDWLRQ RI WKH ELRORJLFDO HIIHFW $W WKHVH FRQFHQWUDWLRQV OHVVHU FHOOXODU WR[LFLW\ KDV EHHQ VKRZQ DIWHU LQ YLWUR VWXGLHV 7R HOXFLGDWH WKH XQGHUO\LQJ PHFKDQLVPV IRU WKH EORRG SUHVVXUH GHFUHDVH SODVPD $*7 DQJLRWHQVLQ ,, OHYHOV DQG WLVVXH $*7 P51$ H[SUHVVLRQ DUH VXEVHTXHQWO\ PHDVXUHG $ VLJQLILFDQW GRVHGHSHQGHQW GHFUHDVH LQ SODVPD $*7 DQG DQJLRWHQVLQ ,, ZDV REVHUYHG 7KH GXUDWLRQ RI WKH SODVPD $*7 DQG DQJLRWHQVLQ ,, GHFUHDVHV ZDV FRQVLVWHQW ZLWK WKDW RI WKH GHFUHDVH LQ EORRG SUHVVXUH VXJJHVWLQJ D SRVVLEOH UROH RI SODVPD 5$6 LQ WKH EORRG SUHVVXUH GHFUHDVH DW WKHVH GRVHV ,Q KHDUW NLGQH\ DQG OLYHU D GRVHGHSHQGHQW GHFUHDVH LQ $*7 P51$ ZDV REVHUYHG GD\V DIWHU WUHDWPHQW 7KH GHFUHDVH LQ $*7 P51$ LQ WKH OLYHU ODVWHG IRU GD\V ZKLFK FRUUHVSRQGV WR REVHUYHG SODVPD $*7 OHYHOV SRVVLEO\ EHFDXVH OLYHU LV WKH SULPDU\ RUJDQ WKDW FRQWULEXWHV WR WKH FLUFXODWLQJ $*7 7KH GHFUHDVH LQ $*7 P51$ ZDV PRUH SURQRXQFHG DW WKH KLJK GRVH VXJJHVWLQJ WKDW DQ LQFUHDVH LQ

PAGE 137

WLVVXH DQG FHOOXODU XSWDNH PD\ SURGXFH D JUHDWHU LQKLELWLRQ RI $*7 JHQH H[SUHVVLRQ $W D PHGLXP RU KLJK GRVH &$$62'1 LQGXFHG LQFUHDVHG XULQH RXWSXW VXJJHVWLQJ D UROH RI LQFUHDVHG IOXLG H[FUHWLRQ IRU WKH REVHUYHG GHFUHDVH LQ EORRG SUHVVXUH 7R VSHFLI\ WKH PHFKDQLVP IRU WKLV DSSDUHQW GLXUHWLF RU QDWULXUHWLF HIIHFW SODVPD DOGRVWHURQH OHYHOV DQG XULQDU\ VRGLXP DQG SRWDVVLXP RXWSXW DUH VXEVHTXHQWO\ PHDVXUHG $OGRVWHURQH ZDV VHFUHWHG E\ WKH ]RQD JORPHUXORVD RI WKH DGUHQDO FRUWH[>@ $OO RI WKH FRPSRQHQWV RI WKH UHQLQ DQJLRWHQVLQ V\VWHP KDYH EHHQ LGHQWLILHG LQ WKH DGUHQDO FRUWH[>@ 7KH PHFKDQLVP E\ ZKLFK WKH UHQLQDQJLRWHQVLQ V\VWHP DFWV ZLWKLQ WKH DGUHQDO LV QRW NQRZQ 2QH SRVVLn ELOLW\ LV WKDW DOO RI WKH UHDFWLRQV WDNH SODFH ZLWKLQ WKH ]RQD JORPHUXORVD FHOOV DQG WKH ILQDO SURGXFW DQJLRWHQVLQ ,, VWLPXODWHV DOGRVWHURQH SURGXFWLRQ $ b GHFUHDVH LQ SODVPD DOGRVWHURQH ZDV REVHUYHG DIWHU WKH KLJK GRVH WUHDWPHQW 7KLV GHFUHDVH LQ DOGRVWHURQH DOVR PLJKW EH D GLUHFW UHVSRQVH RI WKH GHFUHDVH LQ DQJLRWHQVLQ ,, OHYHO SURGXFHG E\ $62'1 WUHDWPHQW $ GHFUHDVH LQ DQJLRWHQVLQ ,, LQKLELWV WKH UHOHDVH RI DOGRVWHURQH IURP WKH DGUHQDO FRUWH[ ZLWK D VXEVHTXHQW LQFUHDVH LQ ZDWHU DQG VRGLXP UHDEVRUSWLRQ IURP WKH GLVWDO WXEXOH RI WKH NLGQH\ 7KH UHVXOWV RI KRXU FXPXODWLYH VRGLXP DQG SRWDVVLXP H[FUHWLRQ VXSSRUWV WKH UROH SOD\HG E\ WKH DOGRVWHURQH DQ LQFUHDVH LQ VRGLXP H[FUHWLRQ ZLWK D FRQFRPLWDQW GHFUHDVH LQ SRWDVVLXP H[FUHWLRQ ZDV REVHUYHG ,QFUHDVHG ZDWHU

PAGE 138

H[FUHWLRQ FRXOG DOVR EH PHGLDWHG E\ WKH GLUHFW HIIHFW RI DQJLRWHQVLQ ,, RQ WKH NLGQH\ $GGLWLRQDOO\ DQ LQFUHDVH LQ ZDWHU H[FUHWLRQ FRXOG DOVR UHVXOW IURP WKH DFWLRQ RI DQWLGLXUHWLF KRUPRQH$'+f $QJLRWHQVLQ ,, LV NQRZQ WR VWLPXODWH WKH UHOHDVH RI $'+ IURP WKH SRVWHULRU SLWXLWDU\ $'+ LQFUHDVHV UHDEVRUSWLRQ RI ZDWHU E\ WKH GLVWDO WXEXOH DQG FROOHFWLQJ GXFWV WKXV LQFUHDVLQJ IOXLG YROXPH >@ 6LQFH $QJ ,, LQFUHDVHV $'+ UHOHDVH WKH GHFUHDVHV LQ $QJ ,, OHYHOV PD\ UHGXFH $'+ OHYHOV ZKLFK LQ WXUQ FRXOG UHVXOW LQ JUHDWHU XULQH ORVV 7KH ZDWHU LQWDNH GLG QRW FKDQJH VLJQLILFDQWO\ DIWHU WKH &$$62'1 WUHDWPHQW VXJJHVWLQJ WKDW LQFUHDVHG XULQH RXWSXW LV QRW VWULFWO\ D FRXSOHG UHDFWLRQ WR IOXLG LQWDNH ,Q VXPPDU\ WKHVH UHVXOWV VXSSRUW WKH IROORZLQJ FRQFOXVLRQV )LUVW LQWUDDUWHULDO LQMHFWLRQ RI &$$62'1 GHFUHDVHG EORRG SUHVVXUH LQ D GRVHGHSHQGHQW PDQQHU ZLWK D s PP+J GHFUHDVH LQ EORRG SUHVVXUH DIWHU D XJ GRVH RI $62'1 WUHDWPHQW 6HFRQG SODVPD $*7 DQJLRWHQVLQ ,, DQG WLVVXH $*7 P51$ DOVR VKRZHG GRVHGHSHQGHQW GHFUHDVHV 7KLUG WKH WUHDWPHQW DOVR UHVXOWHG LQ D GHFUHDVH LQ SODVPD DOGRVWHURQH OHYHOV ZLWK D FRQFRPLWDQW LQFUHDVH LQ VRGLXP H[FUHWLRQ DQG D GHFUHDVH LQ SRWDVVLXP H[FUHWLRQ 7KHVH UHVXOWV VXJJHVW WKDW DQ DOGRVWHURQH PHGLDWHG NLGQH\ HIIHFW EH LQYROYHG LQ WKH REVHUYHG EORRG SUHVVXUH GHFUHDVH

PAGE 139

&+$37(5 ',6&866,21 $1' 6800$5< 7KH XQLTXH SURSHUW\ RI DQWLVHQVH ROLJRQXFOHRWLGHV ZKLFK LQWHUYHQHV DQG LQKLELWV D JHQH H[SUHVVLRQ ZLWK KLJK VSHFLILFLW\ SURYLGHV D JUHDW DGYDQWDJH IRU XVH DV ERWK D WKHUDSHXWLF DJHQW DQG D UHVHDUFK WRRO $OWKRXJK YDULRXV SUREOHPV DUH QRW FRPSOHWHO\ VROYHG FHUWDLQ IDFWRUV UHJDUGLQJ WKHLU DSSOLFDWLRQ VXFK DV VWDELOLW\ DQG GHOLYHU\ KDYH LPSURYHG RYHU WKH \HDUV 0RUH WKDQ D GR]HQ $62'1V GHVLJQDWHG IRU ERWK WRSLFDO XVH DQG LQ YLYR DSSOLFDWLRQV DUH QRZ XQGHUJRLQJ FOLQLFDO WULDOV>@ ,Q WKHVH VWXGLHV LW KDV EHHQ SURSRVHG WR DSSO\ $62'1 WHFKQRORJ\ WR VWXG\ WKH PHFKDQLVP RI HVVHQWLDO K\SHUWHQVLRQ LQ WKH 6+5 PRGHO DQG WR VWXG\ WKH SRWHQWLDO RI GHYHORSPHQW RI DQ $62'1 DV DQWLK\SHUWHQVLYH DJHQW ZLWK ORQJ ODVWLQJ WKHUDSHXWLF HIIHFWV ,Q WKH ILUVW SDUW RI WKLV VWXG\ WKH HIILFLHQF\ RI FDWLRQLF OLSRVRPHV FRPSRVHG RI ''$% DQG '23( DV D GHOLYHU\ V\VWHP IRU WKH FHOOXODU GHOLYHU\ RI $62'1 LQ KHSDWRPD FHOO FXOWXUH ZDV HYDOXDWHG 7KH UHVXOWV GHPRQVn WUDWHG WKDW FDWLRQLF OLSRVRPHFRPSOH[DWLRQ LQFUHDVHG WKH UDWH DQG H[WHQW RI FHOOXODU GHOLYHU\ RI $62'1 LQ D GRVH GHSHQGHQW PDQQHU 7KH LQFUHDVHG GHOLYHU\ VXEVHTXHQWO\ OHG WR LQFUHDVHG LQKLELWLRQ RI WDUJHWHG JHQH H[SUHVVLRQ %RWK $*7

PAGE 140

P51$ DQG SURWHLQ H[SUHVVLRQ GHFUHDVHG LQ D GRVHGHSHQGHQW PDQQHU 7KH FRPSRVLWLRQ RI WKH FDWLRQLF OLSLGV DQG $62'1 DIIHFWV LWV LQWHUDFWLRQV ZLWK FHOOV 7KH FHOOXODU XSWDNH RI &$$62'1 FKDQJHG GUDPDWLFDOO\ ZLWK GLIIHUHQW OLSLGV$62'1 UDWLRV SRVVLEO\ GXH WR VXFK IDFWRUV DV VL]H FKDUJH DQG PHPEUDQH LQWHUDFWLRQ 7KH RYHUDOO SRVLWLYH FKDUJH RI WKH FRPSOH[ IDFLOLWDWHV LWV DGVRUSWLRQ RQWR WKH FHOO VXUIDFH DQG VXEVHTXHQW LQWUDFHOOXODU $62'1 GHOLYHU\ &DWLRQLF OLSRVRPHV DOVR DSSHDUHG WR DVVLVW WKH HVFDSH RI WKH $62'1 IURP LQWUDFHOOXODU FRPSDUWPHQWV $ VHFRQG VSHFLILF JRDO ZDV WR VWXG\ WKH HIIHFWV RI WKH URXWH RI DGPLQLVWUDWLRQ RI &$$62'1 RQ EORRG SUHVVXUH DQG WLVVXH GLVWULEXWLRQ RI $62'1 LQ 6+5 %ORRG SUHVVXUHV GHFUHDVHG PRUH SURIRXQGO\ DIWHU LQWUDDUWHULDO DGPLQLVWUDWLRQ WKDQ DIWHU LQWUDYHQRXV DGPLQLVWUDWLRQ 3ODVPD $*7 DQG DQJLRWHQVLQ ,, OHYHOV GHFUHDVHG VLPLODUO\ DIWHU ERWK ,$ DQG ,9 LQMHFWLRQ +RZHYHU $*7 P51$ LQ WKH KHDUW DQG WKH NLGQH\ WLVVXHV VKRZHG D JUHDWHU GHFUHDVH DIWHU ,$ WKDQ DIWHU ,9 LQMHFWLRQ VXJJHVWLQJ WKDW D WLVVXH VSHFLILF HIIHFW PD\ EH LQYROYHG 2XU WLVVXH GLVWULEXWLRQ VWXGLHV VKRZHG WKDW FDWLRQLF OLSRVRPHV LQFUHDVHG WKH GLVSRVLWLRQ RI $62'1 LQ WKH PHDVXUHG WLVVXHV ,Q VSHFLILF DLP WKUHH WKH GRVHGHSHQGHQW HIIHFWV RI &$$62'1 RQ EORRG SUHVVXUH SODVPD DQG WLVVXH 5$6 LQ 6+5 ZDV VWXGLHG %ORRG SUHVVXUH SODVPD $*7 DQJLRWHQVLQ ,, DQG WLVVXH $*7 P51$ GHFUHDVHG LQ D GRVHGHSHQGHQW PDQQHU $V

PAGE 141

H[SHFWHG WKHVH HIIHFWV ODVWHG ORQJHU DW WKH KLJKHU GRVH 3ODVPD DOGRVWHURQH OHYHOV DOVR GHFUHDVHG ZLWK D FRQFRPLWDQW LQFUHDVH LQ XULQDU\ RXWSXW ZLWK DQ LQFUHDVH LQ VRGLXP H[FUHWLRQ DQG D GHFUHDVH LQ SRWDVVLXP H[FUHWLRQ 7KLV VXJJHVWV WKDW WKH GHFUHDVH LQ EORRG SUHVVXUH PD\ EH WKH UHVXOW RI NLGQH\ HIIHFWV PHGLDWHG E\ DOGRVWHURQH 7KH SRVVLEOH PHFKDQLVPV XQGHUO\LQJ WKH REVHUYHG $62'1 PHGLDWHG EORRG SUHVVXUH GHFUHDVH LV VXPPDUL]HG LQ )LJXUH $62'1 )LJXUH 6XPPDU\ RI SRVVLEOH PHFKDQLVPV IRU WKH REVHUYHG $62'1 PHGLDWHG EORRG SUHVVXUH GHFUHDVH )URP OLQNDJH JHQHWLF VWXGLHV $*7 KDV EHHQ LQGLFDWHG WR EH RQH RI WKH FDQGLGDWH JHQHV LQYROYHG LQ WKH SDWKRJHQHVLV

PAGE 142

RI K\SHUWHQVLRQ 7KHVH ILQGLQJV VXJJHVW WKDW ERWK FLUFXODWLQJ DQG WLVVXH $*7 VXFK DV LQ NLGQH\ DQG KHDUW SOD\ DQ LPSRUWDQW UROH LQ WKH SDWKRJHQHVLV RI K\SHUWHQVLRQ LQ WKH 6+5 (YHQ WKRXJK IHHGEDFN PHFKDQLVPV PD\ IXQFWLRQ WR UHJXODWH EORRG SUHVVXUH LW DSSHDUV WKDW LQKLELWLRQ RI $*7 JHQH H[SUHVVLRQ E\ $62'1 ZDV HIIHFWLYH LQ GHFUHDVLQJ KLJK EORRG SUHVVXUH 7KH UHVXOWV DOVR GHPRQVWUDWHG WKDW D VLQJOH GRVH RI &$$62'1 SURGXFHG D ORQJ ODVWLQJ K\SRWHQVLYH HIIHFW FRPSDUHG ZLWK RWKHU DQWLK\SHUWHQVLYH DJHQWV $OO WKHVH UHVXOWV VXSSRUW WKH IDFW WKDW $62'1 WDUJHWHG DJDLQVW $*7 FRXOG SRWHQWLDOO\ EH XVHG DV D WKHUDSHXWLF DJHQW IRU WKH WUHDWPHQW RI K\SHUWHQVLRQ 6XFFHVVIXO GHFUHDVHV LQ EORRG SUHVVXUH PD\ EH PHGLDWHG E\ HIIHFWLYH WLVVXH WDUJHWLQJ RI $62'1 7KH UHVXOWV RI WKLV VWXG\ VXSSRUW WKH ILQGLQJ WKDW WKH FDWLRQLF OLSRVRPH DSSURDFK LV DQ HIIHFWLYH PHWKRG IRU GHOLYHULQJ WKH $62'1 WR WKH OLYHU 6SHFLILF JHQH WDUJHWLQJ WR WKH OLYHU KDV EHHQ UHSRUWHG LQ WKH OLWHUDWXUH :X HW DO >@ GHYHORSHG DVLDORJO\FRSURWHLQSRO\O\VLQH'1$ FRQMXJDWHV WR WDUJHW DVLDORJO\FRSURWHLQ UHFHSWRUV ZKLFK DUH XQLTXHO\ H[SUHVVHG E\ KHSDWRF\WHV 6XFFHVVIXO KHSDWLF H[SUHVVLRQ RI WKH H[RJHQRXV JHQH DIWHU ,9 LQMHFWLRQ ZDV REVHUYHG =KX HW DO >@ HPSOR\HG D FDWLRQLF OLSRVRPH DSSURDFK WR GHOLYHU D PRGHO SODVPLG 7KH\ REWDLQHG YDULDEOH JHQH H[SUHVVLRQ LQ WLVVXHV LQ DQ LQ YLYR VWXG\ ,Q D PRUH UHFHQW VWXG\ 0DNLQR HW DO >@ UHSRUWHG WKDW DQ LQWUDYHQRXV LQMHFWLRQ RI DVLDORJO\FRSURWHLQSRO\/fO\VLQHDQWLVHQVH FRPSOH[ DWUJHWHG

PAGE 143

WR $*7 UHGXFHG SODVPD $*7 OHYHOV DQG KHSDWLF $*7 P51$ DV ZHOO DV V\VWROLF EORRG SUHVVXUH LQ 6+5 7KH HIIHFWV ODVWHG IRU ILYH GD\V ZKHUHDV WKH FRQWURO VHQVH FRPSOH[ GLG QRW SURGXFH VLPLODU HIIHFWV 7KH URXWHV DQG GRVHV RI &$$62'1 DGPLQLVWUDWLRQ DOVR ZHUH VXJJHVWHG WR EH LPSRUWDQW IDFWRUV 7KHVH UHVXOWV VKRZHG WKDW DW D XJ GRVH EORRG SUHVVXUH GHFUHDVHG PRUH DIWHU ,$ WKDQ DIWHU ,9 LQMHFWLRQ $ PP+J GHFUHDVH LQ EORRG SUHVVXUHV ZDV REVHUYHG DIWHU WKH XJ ,$ LQMHFWLRQ RI &$$62'1 ,9 LQMHFWLRQ RI D XJ GRVH SURGXFHG D OHVV EXW VLJQLILFDQW GHFUHDVH LQ EORRG SUHVVXUH 7KH HIIHFW RI D KLJK GRVH RI &$$62'1 RQ EORRG SUHVVXUH ZKHQ DGPLQLVWHUHG ,9 ZDV QRW GHWHUPLQHG LQ WKLV VWXG\ +RZHYHU D VLJQLILFDQW GHFUHDVH LQ EORRG SUHVVXUHV DIWHU ,9 LQMHFWLRQ RI WKLV GRVH LV H[SHFWHG 7KH ,9 URXWH RI DGPLQLVWUDWLRQ LV D PRUH SUDFWLFDO DSSURDFK IRU LWV DSSOLFDWLRQ WKDQ ,$ URXWH ZKLFK LV UDUHO\ XVHG LQ WKH FOLQLF VHWWLQJ $Q LQ YLWUR VWXG\ VKRZHG WKDW WKH FHOOXODU XSWDNH RI &$$62'1 LV GRVH GHSHQGHQW ,Q DQ LQ YLYR VLWXDWLRQ D GRVHGHSHQGHQW WLVVXH XSWDNH RI $62'1 DOVR LV H[SHFWHG ,QFUHDVLQJ WKH GRVH PD\ LQFUHDVH WKH DPRXQW RI $62'1 WKDW JHW WR WKH WDUJHW VLWH 2XU WLVVXH GLVWULEXWLRQ VWXGLHV VKRZHG WKDW D VXEVWDQWLDO DPRXQW RI &$$62'1 DFFXPXODWHV LQ WKH OXQJ DIWHU ,9 LQMHFWLRQ WKDQ DIWHU ,$ LQMHFWLRQ 7KLV PD\ GHFUHDVH WKH GRVH DYDLODELOLW\ UHDFKLQJ WKH OLYHU RU NLGQH\ %\ LQFUHDVLQJ WKH GRVH WR SJ DQG XVLQJ ,9 DGPLQLVWUDWLRQ

PAGE 144

PRUH &$$62'1 PD\ UHDFK WKH WDUJHW VLWH VXFK DV REVHUYHG YLD WKH ,$ URXWH RI DGPLQLVWUDWLRQ ,Q VXPPDU\ WKHVH VWXGLHV VXSSRUW WKH IROORZLQJ FRQFOXVLRQV )LUVW FDWLRQLF OLSRVRPHV FRPSRVHG RI ''$% DQG '23( DUH PRUH HIIHFWLYH LQ GHOLYHULQJ $62'1 LQ KHSDWRPD FHOO FXOWXUH DQG LQ D UDW PRGHO RI K\SHUWHQVLRQ WKDQ SUHYLRXVO\ XVHG SKRVSKDWLG\OFKROLQH FKROHVWHURO OLSRVRPHV 6HFRQG $62'1V WDUJHWHG WR $*7 P51$ GHFUHDVH EORRG SUHVVXUH LQ 6+5 K\SHUWHQVLRQ PRGHO DIWHU ,$ DQG ,9 LQMHFWLRQ ZLWK WKH K\SRWHQVLYH HIIHFWV EHLQJ PRUH SURQRXQFHG DIWHU ,$ DGPLQLVWUDWLRQ &DWLRQLF OLSRVRPH FRPSOH[DWLRQ SRWHQWLDWHV WKLV HIIHFW DQG WKH REVHUYHG GHFUHDVHV LQ EORRG SUHVVXUH FRUUHODWH ZLWK WKH GHFUHDVHV LQ $*7 P51$ H[SUHVVLRQ LQ WKH NLGQH\ 7KLUG &$$62'1 GHFUHDVHV EORRG SUHVVXUH SODVPD $*7 DQJLRWHQVLQ ,, DQG $*7 P51$ LQ D GRVHGHSHQGHQW PDQQHU 7KH SODVPD DOGRVWHURQH OHYHOV DOVR GHPRQVWUDWH D GRVH GHSHQGHQW GHFUHDVH ZLWK FRQFRPLWDQW LQFUHDVHV LQ XULQDU\ VRGLXP H[FUHWLRQ DQG GHFUHDVHV LQ XULQDU\ SRWDVVLXP H[FUHWLRQ &ROOHFWLYHO\ WKHVH UHVXOWV VXJJHVW WKDW WKH EORRG SUHVVXUH FKDQJHV REVHUYHG ZLWK &$$62'1 WUHDWPHQW PD\ EH PHGLDWHG YLD WLVVXH HIIHFWV LQ SDUWLFXODU WKH NLGQH\

PAGE 145

5()(5(1&(6 .DSODQ 3ULPDU\ K\SHUWHQVLRQ SDWKRJHQHVLV &OLQLFDO +\SHUWHQVLRQ :LOOLDP t :LOVRQ &KDSWHU %XOORFN % +\SHUWHQVLRQ 3DWKRSK\VLRORJ\ $GDSWDWLRQ DQG $OWHUDWLRQ LQ )XQFWLRQ 6FRWW )RUHVPDQ DQG &RPSDQ\ &KDSWHU 6WDQWRQ : 7KH FDUGLRYDVFXODU V\VWHP 3K\VLRORJ\ %HUQH /HY\ &KDSWHU ,9 .ULHJHU DQG ']DX 9 0ROHFXODU ELRORJ\ RI K\SHUWHQVLRQ +\SHUWHQVLRQ >VXSSO ,@,, /DUDJK -+ DQG %UHQQHU %0 'RPLQDQW UROH RI WKH NLGQH\V LQ DUWHULDO SUHVVXUH UHJXODWLRQ LQ QRUPDO DQG K\SHUWHQVLYH VWDWHV +\SHUWHQVLRQ 3DWKRSK\VLRORJ\ GLDJQRVLV DQG PDQDJHPHQW 5DYHQ 3UHVV &KDSWHU 3DWVFKDQ .LGQH\V IURP QRUPRWHQVLYH GRQRUV ORZHU EORRG SUHVVXUH LQ \RXQJ WUDQVSODQWHG VSRQWDQHRXVO\ K\SHUWHQVLYH UDWV $P 3K\VLRO 55 &RUYRO 3 -HXQHPDLWUH ; &KDUUX $ .RWHOHYWVHY < DQG 6RXEULHU ) 5ROH RI WKH 5HQLQ$QJLRWHQVLQ 6\VWHP LQ %ORRG 3UHVVXUH 5HJXODWLRQ DQG LQ +XPDQ +\SHUWHQVLRQ 1HZ ,QVLJKWV IURP 0ROHFXODU *HQHWLFV 5HFHQW 3URJUHVV LQ +RUPRQH 5HVHDUFK *DQWHQ 7KH 5HQLQ$QJLRWHQVLQ 3DUDGLJP $U]QHLP )RUVFK'UXJ 5HV f 1UD ']DX 9%XUW ': DQG 3UDWW 5( 0ROHFXODU ELRORJ\ RI WKH UHQLQDQJLRWHQVLQ V\VWHP $P 3K\VLRO f ) *ULHQGOLQJ 0XUSK\ 7DQG $OH[DQGHU 5: 0ROHFXODU %LRORJ\ RI WKH 5HQLQ$QJLRWHQVLQ 6\VWHP &LUFXODWLRQ f

PAGE 146

']DX 9&LUFXODWLQJ YHUVXV ORFDO UHQLQDQJLRWHQVLQ V\VWHP LQ FDUGLRYDVFXODU KRPHRVWDVLV &LUFXODWLRQ 6XSSO ,f 8QJHU 7 *RKONH 3 3DXO 0 DQG 5HWWLJ 5 7LVVXH 5HQLQ$QJLRWHQVLQ 6\VWHPV )DFW RU ILFWLRQ" &DUGLRYDVF 3KDUP 6XSSO f66 *DQRQJ :) &2'$ 7LVVXH 5HQLQ$QJLRWHQVLQ 6\VWHPV 7LVVXH UHQLQDQJLRWHQVLQ V\VWHPV 3OHQXP 3UHVV /HH 0 %RKP 0 3DXO 0 DQG *DQWHQ 7LVVXH 5HQLQ$QJLRWHQVLQ 6\VWHPV 7KHLU 5ROH LQ &DUGLRYDVFXODU 'LVHDVH &LUFXODWLRQ >VXSSO ,9@,9,9 'D]X 9DQG 5LFKDUG 5H 7LVVXH $QJLRWHQVLQ 6\VWHP LQ &DUGLRYDVFXODU 0HGLFLQH $ 3DUDGLJP VKLIW" &LUFXODWLRQ f ']DX 97LVVXH UHQLQDQJLRWHQVLQ V\VWHP SK\VLRORJLF DQG SKDUPDFRORJLF LPSOLFDWLRQV &LUFXODWLRQ VXSSO ,f,, ']DX 99DVFXODU 5HQLQ$QJLRWHQVLQ $ SRVVLEOH $XWRFULQH RU 3DUDFULQH 6\VWHP LQ &RQWURO RI 9DVFXODU )XQFWLRQ &DUGLRYDVF 3KDUP VXSS f 6 6 &DUUHWHUR 2 6FLFOL /RFDO +RUPRQDO )DFWRUV ,QWUDFULQH $XWRFULQH DQG 3DUDFULQHf LQ K\SHUWHQVLRQ +\SHUWHQVLRQ VXSSO ,f,, 5LFKDUG 1 5H 7KH FHOOXODU %LRORJ\ RI $QJLRWHQVLQ 3DUDFULQH $XWRFULQH DQG ,QWUDFULQH $FWLRQV LQ &DUGLRYDVFXODU 7LVVXHV 0RO &HOO &DUGLRO VXSSO 9f +DFNHQWKDO ( 3DXO0 *DQWHQ DQG 7DXJQHU 5 0RUSKRORJ\ SK\VLRORJ\ DQG PROHFXODU ELRORJ\ RI UHQLQ VHFUHWLRQ 3K\VLRORJLFDO 5HYLHZV f 6LJPXQG &' -RQHV &$ .DQH &0 :X & /DQJ-$ *URVV .: 5HJXODWHG 7LVVXH DQG &HOO VSHFLILF ([SUHVVLRQ RI WKH +XPDQ UHQLQ JHQH LQ 7UDQVJHQLF 0LFH &LUF 5HV -RKQV ': 3HDFK 0*RPH] 5$ ,QDJDPL 7 &DUH\ 50 $QJLRWHQVLQ ,, UHJXODWHV UHQLQ JHQH H[SUHVVLRQ $P 3K\VLRO ))

PAGE 147

/DUDJK DQG %UHQQHU % +\SHUWHQVLRQ 3DWKRSK\VLRORJ\ GLDJQRVLV DQG PDQDJHPHQW 9ROXPH &KDSWHU 7LVVXH GLVWULEXWLRQ RI $QJLRWHQVLQ &RQYHUWLQJ (Q]\PH .DWVXKLNR %URVQLKDQ .% &KDSSHOO 0& .KRVOD 0& )HUUDUOR &0 $QJLRWHQVLQf $ PHPEHU RI FLUFXODWLQJ $QJLRWHQVLQ SHSWLGHV +\SHUWHQVLRQ /DUDJK DQG %UHQQHU % 7KH GLVWULEXWLRQ RI DQJLRWHQVLQ ,, UHFHSWRUV +\SHUWHQVLRQ 3DWKRSK\VLRO RJ\ GLDJQRVLV DQG PDQDJHPHQW &KDSWHU 7LPPHUPDQV 3%0:0 &KLX $7 +HUEOLQ :) :RQJ 3& 6PLWK 5' $QJLRWHQVLQ ,, UHFHSWRU VXEW\SHV $P +\SHUWHQV /\QFK .5 DQG 3HDFK 00ROHFXODU %LRORJ\ RI $QJLRWHQVLQRJHQ +\SHUWHQVLRQ f /DUDJK DQG %UHQQHU % $QJLRWHQVLQRJHQ 0ROHFXODU %LRORJ\ DQG *HQHWLFV +\SHUWHQVLRQ 3DWKRSK\VLRORJ\ GLDJQRVLV DQG PDQDJHPHQW 5DYHQ 3UHVV f 'HVFKHSSHU & 5HXGHOKXEHU 7/ 5DW $QJLRWHQVLQRJHQ ,V 6HFUHWHG 2QO\ &RQVWLWXWLYHO\ :KHQ 7UDQVIHFWHG LQWR $W7 &HOOV +\SHUWHQVLRQ &ODXVHU( *DLOODUG :HL / DQG &RUYRO 3 5HJXODWLRQ RI $QJLRWHQVLQRJHQ *HQH $P +\SHUWHQV )XNDPL]X $ 7DNDKDVKL 6 6HR 06 7DGD 0 7DQLPRWR 8HKDUD 6 DQG 0XUDNDPL 6WUXFWXUH DQG ([SUHVVLRQ RI WKH +XPDQ $QJLRWHQVLQRJHQ *HQH %LRO &KHP f %HQ$UL (7 DQG *DUULVRQ -& 5HJXODWLRQ RI DQJLRWHQVLQRJHQ P51$ DFFXPXODWLRQ LQ UDW KHSDWRF\WHV $P 3K\VLRO (( &KDQJH ( DQG 3HUOPDQ $0XOWLSOH +RUPRQHV 5HJXODWH $QJLRWHQVLQRJHQ 0HVVHQJHU 5LERQXFOHLF $FLG /HYHOV LQ D 5DW +HSDWRPD &HOO /LQH (QGRFULQRORJ\

PAGE 148

&DVVLV /$ 6D\HDQG 3HDFK 0/RFDWLRQ DQG 5HJXODWLRQ RI 5DW $QJLRWHQVLQRJHQ 0HVVHQJHU 51$ +\SHUWHQVLRQ 2KNXER + 1DND\DPD 7DQDND 7 DQG 1DNDQLVKL 6 7LVVXH 'LVWULEXWLRQ RI 5DW $QJLRWHQVLQRJHQ P51$ DQG 6WUXFWXUDO $QDO\VLV RI ,WV +HWHURJHQHLW\ %LRO &KHP f *RXOG $% DQG *UHHQ % .LQHWLFV RI WKH KXPDQ UHQLQ DQG KXPDQ UHQLQ VXEVWUDWH UHDFWLRQ &DUGLRYDVF 5HV -HXQHPDLWUH ; 6RXEULHU ) .RWHOHYWVHY<9 /LIWRQ 53 :LOOLDPV &6 &KDUUX $ +XQW 6& +RSNLQV 31 :LOOLDPV 53 /DORXHO &RUYRO 3 0ROHFXODU %DVLV RI +XPDQ +\SHUWHQVLRQ 5ROH RI $QJLRWHQVLQRJHQ &HOO *DUGHV %RXKQLN &ODXVHU ( &RUYRO 3 0HQDUG 5ROH RI $QJLRWHQVLQRJHQ LQ %ORRG 3UHVVXUH +RPHRVWDVLV +\SHUWHQVLRQ &DXOILHOG 0 /DYHQGHU 3 )DUUDOO 0 0XQURH 3 /DZVRQ 0 7XUQHU 3 &ODUN -/ /LQNDJH RI WKH $QJLRWHQVLQRJHQ JHQH WR HVVHQWLDO K\SHUWHQVLRQ 7KH 1HZ (QJODQG -RXUQDO RI 0HGLFLQH f +LQJRUDQL $' 6KDUPD 3 -LD + +RSSHU 5 DQG %URZQ 0 %ORRG SUHVVXUH DQG WKH 07 SRO\PRUSKLVP RI WKH $*7 JHQH +\SHUWHQVLRQ /RGZLFN .DLVHU 0$ +DUULV &XPLQ ) 9LQFHQW 0 6DPDQL 1$QDO\VLV RI WKH 5ROH RI $QJLRWHQVLQRJHQ LQ 6SRQWDQHRXV +\SHUWHQVLRQ +\SHUWHQVLRQ 7DPXUD. 8PHPXUD6 1\XL 1
PAGE 149

*DQWHQ .DOLQJ 0 +LJK EORRG SUHVVXUH LQ WUDQVJHQLF PLFH FDUU\LQJ WKH UDW DQJLRWHQVLQRJHQ (0%2 f )XNDPL]X $ 6XJLPXUD 7DNLPRWR ( 6XJL\DPD ) 6HR 0 7DNDKDVKL 6 +DWHD 7 .DMLZDUD 1
PAGE 150

&RUUHD5RWWHU 5 +RVWHWWHU 7+ 0DQLYHO -& DQG 5RVHQEHUJ 0( 5HQLQ H[SUHVVLRQ LQ UHQDO DEODWLRQ +\SHUWHQVLRQ &DPSEHOO '.ODGLV $ 'XQFDQ $ 1HSKUHFWRP\ FRQYHUWLQJ HQ]\PH LQKLELWLRQ DQG DQJLRWHQVLQ SHSWLGHV +\SHUWHQVLRQ -RKQV ': 3HDFK 0*RPH] $ ,QDJDPL 7 DQG &DUH\ 50 $QJLRWHQVLQ ,, UHJXODWHV UHQLQ JHQH H[SUHVVLRQ $P 3K\VLRO )) 5REELQV *HQH 7DUJHWLQJ 7KH 3UHFLVH 0DQLSXODWLRQ RI WKH 0DPPDOLDQ *HQRPH &LUF 5HV 0RFNULQ 6 ']DX 9*URVV .: DQG +RUDQ 07UDQVJHQLF $QLPDOV 1HZ DSSURDFKHV WR K\SHUWHQVLRQ 5HVHDUFK +\SHUWHQVLRQ f 0XOOLQV -0XOOLQV /7UDQVJHQH K\SRWKHVLV DQG K\SHUWHQVLRQ +\SHUWHQVLRQ .DW]XQJ %* %DVLF DQG &OLQLFDO 3KDUPDFRORJ\ $SSOHWRQ DQG /DQJH 6L[WK HGLWLRQ &KDSWHU $QWLK\SHUWHQVLYH $JHQWV &KDL 6< =KXR 0HQGHOVRKQ )$2 /RFDOL]DWLRQ RI &RPSRQHQWV RI WKH 5HQLQ$QJLRWHQVLQ 6\VWHP DQG 6LWH RI $FWLRQ RI ,QKLELWRUV $U]QHLP)RUVFKGUXJ 5HV ,f1UD %RKU ') DQG 'RPLQLF]DN $) ([SHULPHQWDO K\SHUWHQVLRQ +\SHUWHQVLRQ VXSSO ,f,, 3UDWW 5( 0LQ =RX : 1DIWLODQ $,QJHOILQJHU -5 DQG ']DX 9$OWHUHG VRGLXP UHJXODWLRQ RI UHQDO $*7 P51$ LQ WKH 6+5 $P 3K\VLRO )) 7RPLWD 1 0RULVKLWD 5 +LJDNL .DQHGD < 0LNDPL + DQG 2JLKDUD 7 ,Q YLYR WUDQVIHU RI DQWLVHQVH ROLJRQXFOHRWLGH DJDLQVW UDW DQJLRWHQVLQRJHQ ZLWK +-9OLSRVRPH GHOLYHU\ UHVXOWHG LQ UHGXFWLRQ RI EORRG SUHVVXUH LQ 6+5 +\SHUWHQVLRQ f :LHOER 6HUQLD & *\XUNR 5 3KLOOLSV 0, $QWLVHQVH LQKLELWRQ RI K\SHUWHQVLRQ LQ WKH VSRQWDQHRXVO\ K\SHUWHQVLYH UDW +\SHUWHQVLRQ

PAGE 151

*\XUNR 5 :LHOER DQG 3KLOOLSV 0, $QWLVHQVH LQKLELWLRQ RI $7, UHFHSWRU UHFHSWRU P51$ DQG DQJLRWHQVLQRJHQ P51$ LQ WKH EUDLQ RI VSRQWDQHRXVO\ K\SHUWHQVLYH UDWV UHGXFH K\SHUWHQVLRQ RI QHXURJHQLF RULJLQ 5HJXO 3HSW 7RPLWD 1 0RULVKLWD 5 +LJDNL $RNL 0 1DNDPXUD < 0LNDPL + )XNDPL]X $ 0XUDNDPL .DQHGD < 2JLKDUD 7 7UDQVLHQW GHFUHDVH LQ KLJK EORRG SUHVVXUH E\ LQ YLYR WUDQVIHU RI DQWLVHQVH ROLJRGHR[\QXFOHRWLGHV DJDLQVW UDW DQJLRWHQVLQRJHQ +\SHUWHQVLRQ &KDR =KDQJ -/LQ .) &KDR / +XPDQ NDOOLNUHLQ JHQH WKHUDS\ DWWHQXDWHV K\SHUWHQVLRQ FDUGLDF K\SHUWURSK\ DQG UHQDO LQMXU\ LQ 'DKO VDOW VHQVLWLYH UDWV +XPDQ *HQH 7KHUDS\ f :LHOER 6LPRQ $ 7RIIROR 60 3KLOOLSV 0, ,QKLELWLRQ RI K\SHUWHQVLRQ E\ SHULSKHUDO DGPLQLVWUDWLRQ RI DQWLVHQVH ROLJRGHR[\QXFOHRWLGHV +\SHUWHQVLRQ :DJQHU 5: *HQH LQKLELWLRQ XVLQJ DQWLVHQVH ROLJRGHR[\QXFOHRWLGHV 1DWXUH (FN 6/ DQG 1DEHO */ $QWLVHQVH ROLJRQXFOHRWLGHV IRU WKHUDSHXWLF LQWHUYHQWLRQ &XUUHQW 2SLQLRQ LQ %LRWHFKQRORJ\ 6WDQOH\ 7& 3URJUHVV WRZDUG ROLJRQXFOHRWLGH WKHUDSHXWLFV 3KDUPDFRG\QDPLF SURSHUWLHV )$6(% 0DKHU /,OO 3URVSHFWV IRU WKH WKHUDSHXWLF XVH RI DQWLJHQH ROLJRQXFOHRWLGHV &DQFHU ,QYHVW +HOHQH & DQG 7RXOPH 6SHFLILF UHJXODWLRQ RI JHQH H[SUHVVLRQ E\ DQWLVHQVH VHQVH DQG DQWLJHQH QXFOHLF DFLGV %LRFKLP HW %LRSK\V $FWD 0LOOLJDQ 0DWWHXFFL 0' 0DUWLQ -& &XUUHQW FRQFHSWV LQ DQWLVHQVH GUXJ GHVLJQ 0HG &KHP %RL]LDX& .XUIXUVW5 &D]HQDYH& 5RLJ9 7KXRQJ 17 7RXOPH -,QKLELWLRQ RI WUDQVODWLRQ LQLWLDWLRQ E\ DQWLVHQVH ROLJRQXFOHRWLGHV YLD DQ 51DVH+ GHSHQGHQW PHFKDQLVP 1XFOHLF $FLGV 5HV

PAGE 152

.QRUUH '* 9ODVVRY 99 =DU\WRYD 9) /HEHGHY $9 )HGHURYD 26 'HVLJQ DQG WDUJHWHG UHDFWLRQV RI ROLJRQXFOHRWLGH GHULYDWLYHV &5& 3UHVV 6WHLQ &$ DQG &KHQJ <& $QWLVHQVH ROLJRQXFOHRWLGHV DV WKHUDSHXWLF DJHQWV ,V WKH EXOOHW UHDOO\ PDJLFDO" 6FLHQFH 0DWWHXFFL 0' DQG :DJQHU 5: ,Q 3XUVXLW RI $QWLVHQVH 1DWXUH /RNH 6/ 6WHLQ &$ =KDQJ ;+ 0RUL 1DNDQLVKL 0 6XEDVLQJKH& &RKHQ -6 &KDUDFWHUL]DWLRQ RI ROLJRQXFOHRWLGH WUDQVSRUW LQWR OLYLQJ FHOOV 3URF 1DWO $FDG 6FL =DPHFQLN 3 $JKDMDQLDQ =DPHFQLN 0 *RRGFKLOG :LWPDQ (OHFWURQ PLFURJUDSKLF VWXGLHV RI WUDQVSRUW RI ROLJRQXFOHRWLGHV DFURVV HXNDU\RWLF FHOO PHPEUDQH 3URF 1DWO $FDG 6FL
PAGE 153

FKLUDOLW\ DW SKRVSKRUXV RQ ELQGLQJ WR SHQWDGHR[\ULER DGHQ\OLF DFLG 1XFOHLF $FLG 5HV :DJQHU ( =HQNH 0 &RWWRQ 0 %HXJ + %LUQVWLHO 0/ 7UDQVIHUULQSRO\FDWLRQ FRQMXJDWHV DV FDUULHU IRU '1$ XSWDNH LQWR FHOOV 3URF 1DWO $FDG 6FL :X *< :X &+ 6SHFLILF LQKLELWLRQ RI KHSDWLWLV % YLUDO JHQH H[SUHVVLRQ LQ YLWUR E\ WDUJHWHG DQWLVHQVH ROLJRQXFOHRWLGHV %LRO &KHP &XULHO '7 $JUDZDO 6 :DJQHU ( 7UDQVIHUULQ SRO\O\VLQHPHGLDWHG JHQH GHOLYHU\ 3URF 1DWO $FDG 6FL =HOSKDWL 2 6]RND )& /LSRVRPH DV D FDUULHU IRU LQWUDFHOOXODU GHOLYHU\ RI DQWLVHQVH ROLJRQXFOHRWLGHV D UHDO RU PDJLF EXOOHW" &RQWUROOHG UHOHDVH 0DQQLQR 5DQG *RXOG)RJHULWH 6 /LSRVRPH PHGLDWHG JHQH WUDQVIHU %LRWHFKQLTXHV 3DSDKDGMRSRXORV 1HZ JHQHUDWLRQ OLSRVRPHV WKH HQJLQHHULQJ RI DQ HIILFLHQW YHKLFOH IRU LQWUDFHOOXODU GHOLYHU\ RI QXFOHLF DFLGV 7,%6 0DUFK +XJ 3 DQG 6OHLJKW 5 /LSRVRPHV IRU WKH WUDQVIRUPDWLRQ RI HXNDU\RWLF FHOOV %LRFKLP HW %LRSK\V $FWD /DVLF'' &5& 3UHVV /LSRVRPHV LQ *HQH GHOLYHU\ &KDSWHU *HQH GHOLYHU\
PAGE 154

5HP\ -6 .LFKOHU $ 0RUGYLQRY 9 6FKXEHU ) DQG %HKU -3 7DUJHWHG JHQH WUDQVIHU LQWR KHSDWRPD FHOOV ZLWK OLSRSRO\DPLQHFRQGHQVHG '1$ SDUWLFOHV SUHVHQWLQJ JDODFWRVH OLJDQGV D VWDJH WRZDUG DUWLILFLDO YLUXVHV 3URF 1DWO $FDG 6FL *UHJRULDGLV *DQG 6HQLRU 6WDELOLW\ RI VPDOO XQLODPHOODU OLSRVRPHV LQ VHUXP DQG FOHDUDQFH IURP WKH FLUFXODWLRQ WKH HIIHFW RI WKH SKRVSKROLSLG DQG FKROHVWHURO FRPSRQHQWV /LIH 6FLHQFH /DVLF'' &5& 3UHVV /LSRVRPHV LQ *HQH GHOLYHU\ &KDSWHU /LSRVRPH 3DJDQR 5 (OVHYLHU1RUWK+ROODQG %LRPHGLFDO 3UHVV /LSRVRPHV )URP 3K\VLFDO 6WUXFWXUH WR 7KHUDSHXWLF $SSOLFDWLRQ &KDSWHU ,QWHUDFWLRQ RI SKRVSKROLSLG YHVLFOHV ZLWK PDPPDOLDQ FHOOV LQ YLWUR VWXGLHV RI PHFKDQLVP 0DUJROLV / /LSLG FHOO LQWHUDFWLRQV $ QRYHO PHFKDQLVP RI WUDQVIHU RI OLSRVRPHHQWUDSSHG VXEVWDQFH LQWR FHOOV %LRFKLPLFD HW %LRSK\VLFD $FWD 0DUJROLV / &HOO LQWHUDFWLRQ ZLWK PRGHO PHPEUDQHV SURELQJ PRGLILFDWLRQ DQG VLPXODWLRQ RI FHOO VXUIDFH IXQFWLRQ %LRFKLPLFD HW %LRSK\VLFD $FWD 3KLOLSSRW -5 DQG 6FKXEHU) /LSRVRPH DV WRROV LQ EDVLF UHVHDUFK DQG LQGXVWU\ &KDSWHU /LSRVRPH 9LUXVHV DQG PHPEUDQH IXVLRQ /DVLF'' &5& 3UHVV /LSRVRPHV LQ *HQH GHOLYHU\ &KDSWHU *HQRVRPHV'1$/LSLG &RPSOH[HVf 3KLOLSSRW -5 DQG 6FKXEHU) /LSRVRPH DV WRROV LQ EDVLF UHVHDUFK DQG LQGXVWU\ &KDSWHU /LSRVRPHV DV WUDQVSRUWHUV RI ROLJRQXFOHRWLGHV 'DOHNH (QGRF\WRVLV RI OLSRVRPHV E\ PDFURSKDJHV ELQGLQJ DFLGLILFDWLRQ DQG OHDNDJH RI OLSRVRPHV PRQLWRUHG E\ D QHZ IOXRUHVFHQFH DVVD\ %LRFKLPLFD HW %LRSK\VLFD $FWD 6WUDXELQJHU 5 'X]JXQHV 1 3DSDKDGMRSRXORV S+ VHQVLWLYH OLSRVRPHV PHGLDWH F\WRSODVPLF GHOLYHU\ RI HQFDSVXODWHG PDFURPROHFXOHV )(%6

PAGE 155

6WUDXELQJHU 5 HW DO (QGRF\WRVLV RI OLSRVRPHV DQG LQWUDFHOOXODU IDWH RI HQFDSVXODWHG PROHFXOHV HQFRXQWHU ZLWK D ORZ S+ FRPSDUWPHQW DIWHU LQWHUQDOL]DWLRQ LQ FRDWHG YHVLFOHV &HOO &RQQRU DQG +XDQJ / (IILFLHQW F\WRSODVPLF GHOLYHU\ RI D IOXRUHVFHQW G\H E\ S+VHQVLWLYH LPPXQROLSRVRPHV &HOO %LRO &RQQRU DQG +XDQJ / S+VHQVLWLYH OLSRVRPHV DFLG LQGXFHG OLSRVRPH IXVLRQ 3URF 1DWO $FDG 6FL +XDQJ / DQG 3LQQDGXZDJH3 6WDEOH WDUJHWVHQVLWLYH LPPXQROLSRVRPHV %LRFKHPLVWU\ )HLJQHU 3/ DQG 5LQJROG *0 &DWLRQLF OLSRVRPH PHGLDWHG WUDQVIHFWLRQ 1DWXUH 3KLOLSSRW -5 DQG 6FKXEHU) /LSRVRPH DV WRROV LQ EDVLF UHVHDUFK DQG LQGXVWU\ &KDSWHU *HQH WUDQVIHU ZLWK FDWLRQLF DPSKLSKLOHV 3KLOLSSRW -5 DQG 6FKXEHU) /LSRVRPH DV WRROV LQ EDVLF UHVHDUFK DQG LQGXVWU\ &KDSWHU &DWLRQLF OLSRVRPHPHGLDWHG JHQH WUDQVIHU LQ 9LWUR DQG ,Q YLYR 0DLVWUHOOR DQG 0DWVFKHU 5 0HDVXUHPHQW RI V\VWROLF SUHVVXUH RI UDWV FRPSDULVRQ RI LQWUDDUWHULDO DQG FXII YDOXHV $SSO 3K\VLRO )UDQJLSDQH DQG $SRUWL ) ,PSURYHG LQGLUHFW PHWKRG IRU WKH PHDVXUHPHQW RI V\VWROLF EORRG SUHVVXUH LQ WKH UDW /DE &OLQ 0HG 2KNXER + .DJH\DPD 5 8MLKDUD 0 +LURVH 7 ,QD\DPD 6 DQG 1DNDQLVKL 6 &ORQLQJ DQG VHTXHQFH DQDO\VLV RI F'1$ IRU UDW DQJLRWHQVLQRJHQ 3URF 1DWO $FDG 6FL /LSRVRPH DV GUXJ GHOLYHU\ V\VWHPV 3DUW 3UHSDUDWLRQ %LRSKDUP 2FWREHU /DSSDODLQHQ 8UWWL $ 6RGHUOLQJ ( -DDVNHO DLQHQ 6\UMDQHQ. DQG 6\UMDQHQ6 &DWLRQLF OLSRVRPHV LPSURYH VWDELOLW\ DQG LQWUDFHOOXODU GHOLYHU\ RI DQWLVHQVH ROLJRQXFOHRWLGHV LQWR &DVNL FHOOV %LRFKLP HW %LRSK\V $FWD

PAGE 156

&KRPF]\QVNL 3 DQG 6DFFKL 1 6LQJOHVWHS PHWKRG RI 51$ LVRODWLRQ E\ DFLG JXDQLGLXP WKLRF\DQDWHSKHQRO FKORURIRUP H[WUDFWLRQ $QDO %LRFKHP 0HLQNRWK DQG :DKO +\EULGL]DWLRQ RI 1XFOHLF DFLGV LPPRELOL]HG RQ VROLG VXSSRUWV $QDO %LRFKHP 6HUQLD& 6KLQNHO7$ 7KRPDV :* +R ..< DQG /LQFROQ' $*7 VHFUHWLRQ E\ VLQJOH UDW SLWXLWDU\ FHOOV 'HWHFWLRQ E\ D UHYHUVH KHPRO\WLF SODTXH DVVD\ DQG FHOO LGHQWLILFDWLRQ E\ LPPXQRF\WRFKHPLVWU\ 1HXURHQGRFULQRORJ\ 6LQJK *UDPV 0 :DQJ :
PAGE 157

+X 6: /DQJQHU 0 =KDR < 5RVV 3 +XUOH\ ( &KDQ 7KH UROH RI KHOSHU OLSLGV LQ FDWLRQLF OLSRVRPHPHGLDWHG JHQH WUDQVIHU %LRSK\VLFDO 6WUDXELQJHU 50 'X]JXQHV1 DQG 3DSDKDGMRSRXORV S+VHQVLWLYH OLSRVRPHV PHGLDWH F\WRSODVPLF GHOLYHU\ RI HQFDSVXODWHG PDFURPROHFXOHV )(%6 f .DEDQRY $9 DQG .DEDQRY 9$ '1$ FRPSOH[HV ZLWK SRO\FDWLRQV IRU WKH GHOLYHU\ RI JHQHWLF PDWHULDO LQWR FHOOV %LRFRQMXJDWH &KHP +RIODQG +6KHSKDUG / DQG 6XOOLYDQ 60 )RUPDWLRQ RI VWDEOH FDWLRQLF OLSLG'1$ FRPSOH[HV IRU JHQH WUDQVIHU 3URF 1DWO $FDG 6FL )HLJQHU -+ .XPDU 5 6ULGKDU &1 :KHHOHU &7VDL <%RUGHU 5 5DPVH\ 3 0DUWLQ 0 DQG IHLJQHU 3/ (QKDQFHG JHQH GHOLYHU\ DQG PHFKDQLVP VWXGLHV ZLWK D QRYHO VHULHV RI FDWLRQLF OLSLG IRUPXODWLRQ %LRO &KHP f 38<$/ & 0LOKDXG 3 %LHQYHQXH $ DQG 3KLOLSSRW -5 $ QHZ FDWLRQLF OLSRVRPH HQFDSVXODWLQJ JHQHWLF PDWHULDO $ SRWHQWLDO GHOLYHU\ V\VWHP IRU SRO\QXFOHRWLGHV (XU %LRFKHP /HRQHWWL -3 'HJROV &ODUHQF 3 0HFKWL 1 DQG /HEOHX % &HOO GHOLYHU\ DQG PHFKDQLVPV RI DFWLRQ RI DQWLVHQVH ROLJRQXFOHRWLGHV 3URJ 1XFOHLF $FLG 5HV 0RO ELRO &DPSEHOO3, 7R[LFLW\ RI VRPH FKDUJHG OLSLGV XVHG LQ OLSRVRPH SUHSDUDWLRQV &\WRELRV $KNWDU 6 DQG -XOLDQR 5/ &HOOXODU XSWDNH DQG LQWUDFHOOXODU IDWH RI DQWLVHQVH ROLJRQXFOHRWLGHV 7UHQGV LQ FHOO ELRORJ\ =HOSKDWL 2 DQG 6]RND )& ,QWUDFHOOXODU GLVWULEXWLRQ DQG PHFKDQLVP RI GHOLYHU\ RI ROLJRQXFOHRWLGHV PHGLDWHG E\ FDWLRQLF OLSLGV 3KDUP 5HV 0LQVKXOO DQG +XQW 7 7KH XVH RI VLQJOHVWUDQGHG '1$ DQG 51DVH + WR SURPRWH TXDQWLWDWLYH K\EULG DUUHVW RI WUDQVODWLRQ RI P51$'1$ K\EULGV LQ UHWLFXORF\WH

PAGE 158

O\VDWH FHOOIUHH WUDQVODWLRQV 1XFOHLF $FLGV 5HV &D]HQDYH & 6WHLQ &$ /RUHDX 1 7KXRQJ 17 1HFNHUV /0 6XEDVLQJKH & +HOHQH & &RKHQ -6 DQG 7RXOPH -&RPSDUDWLYH LQKLELWLRQ RI UDEELW JORELQ P51$ WUDQVODWLRQ E\ PRGLILHG DQWLVHQVH ROLJRQXFOHRWLGHV 1XFOHLF $FLGV 5HV &DPSEHOO -0 %DFRQ 7$ DQG :LFNVWURP ( 2OLJRGHR[\QXFOHRVLGH SKRVSKRURWKLRDWH VWDELOLW\ LQ VXEFHOOXODU H[WUDFWV FXOWXUH PHGLD VHUD DQG FHUHEURVSLQDO IOXLG %LRFKHP %LRSK\V 0HWKRGV &DSDFFLROL 6 3DVTXDOH *' 0LQL ( 0D]]HL 7 DQG 4XDWWURQH $ &DWLRQLF OLSLGV LPSURYH DQWLVHQVH ROLJRQXFOHRWLGH XSWDNH DQG SUHYHQW GHJUDGDWLRQ LQ FXOWXUHG FHOOV DQG LQ KXPDQ VHUXP %LRFKHPLFDO DQG %LRSK\VLFDO FRPPXQLFDWLRQV 3DUGULGJH :0 .DQJ <6
PAGE 159

8QJHU 7+ *DQWHQ /DQJ 5( 7LVVXH FRQYHUWLQJ HQ]\PH DQG FDUGLRYDVFXODU DFWLRQV RI FRQYHUWLQJ HQ]\PH LQKLELWRUV &DUGLRYDVF 3KDUP VXSSO f6 6 +DEHU( =XVPDQ5 %XUWRQ ']DX 9%DUJHU $& ,V UHQLQ D IDFWRU LQ WKH HWLRORJ\ RI HVVHQWLDO K\SHUWHQVLRQ" +\SHUWHQVLRQ VXSSO 9f9 /DUDJK DQG %UHQQHU % +\SHUWHQVLRQ 3DWKRSK\VLRORJ\ GLDJQRVLV DQG PDQDJHPHQW 9ROXPH 5DYHQ 3UHVV &KDSWHU ([SUHVVLRQ RI WKH 5HQLQ DQJLRWHQVLQ V\VWHP LQ WKH NLGQH\ /LQGSDLQWQHU. .UHXW]5 *DQWHQ *HQHWLF YDULDWLRQ LQ K\SHUWHQVLYH DQG FRQWURO VWUDLQV :KDW DUH ZH FRQWUROOLQJ IRU DQ\ZD\" +\SHUWHQVLRQ 0HGLQD 5 &DUGRQD 6/( %RUQ *9 DQG %URZQ 0(IIHFW RI FDSWRSULO DQG ORVDUWDQ RQ EORRG SUHVVXUH DQG DFFXPXODWLRQ RI /'/ DQG ILEULQRJHQ E\ DRUWLF ZDOO DQG RWKHU WLVVXHV LQ QRUPRWHQVLYH DQG K\SHUWHQVLYH UDWV &DUGLRYDVF 3KDUP fa /HPRLQH 15 DQG &RRSHU '1 *HQH WKHUDS\ %LRV 6FLHQWLILF 3XEOLVKHU &KDSWHU 7LVVXHGLUHFWHG JHQH GHOLYHU\ V\VWHP *DYUDV + DQG *DYUDV $QJLRWHQVLQ FRQYHUWLQJ HQ]\PH LQKLELWRUV 3URSHUWLHV DQG VLGH HIIHFWV +\SHUWHQVLRQ VXSSO ,,f ,,,, 9HUEXUJ .0 3RODNRZVNL -6 .RYDU 3.OLQJKRIHU 9 %DUORZ -/ 6WHLQ ++ 0DQWHL 5$ )XQJ ./ %R\G 6$ %DNHU :5 .OHLQHUW +' (IIHFWV RI KLJK GRHV RI D $ $ QRYHO QRQSHSWLGLF DQG RUDOO\ ELRDYDLODEOH UHQLQ LQKLELWRU &DUGLRYDVF 3KDUP 0DNLQR 1 6XJDQR 0 2KWVXND 6 6DZDGD 6 ,QWUDYHQRXV LQMHFWLRQ ZLWK DQWLVHQVH ROLJRGHR[\ QXFOHRWLGHV DJDLQVW DQJLRWHQVLQRJHQ GHFUHDHVV EORRG SUHVVXUH LQ VSRQWDQHRXVO\ K\SHUWHQVLYH UDWV +\SHUWHQVLRQ 0HQDUG%RJHU56 0R\VH'0 *X\HQH 77 *ODVVPDQ +1 .OHLQHUW +' 'RVHGHSHQGHQW HIIHFWV RI WKH UHQLQ LQKLELWRU =DQNLUHQ +&O DIWHU D VLQJOH RUDO

PAGE 160

GRVH LQ PLOGO\ VRGLXPGHSOHWHG QRUPRWHQVLYH VXEMHFWV &LUFXODWLRQ 2JLKDUD 7 1DJDQR 0 +LJDNL+LJDVKLPRUL 0DVXR 0LNDPL + $QWLK\SHUWHQVLYH HIILFDF\ RI ). $ QRYHO KXPDQ UHQLQ LQKLELWRU &OLQLFDO 7KHUDSHXWLFV 3DDVVHQ 39 =HHXZ -RQJ 3( 5HQDO DQG V\VWHPLF HIIHFWV RI WKH UHQLQ LQKLELWRU 5HPLNLUHQ LQ SDWLHQWV ZLWK HVVHQWLDO K\SHUWHQVLRQ &DUGLRYDVF 3KDUP 1HXWHO-0 /XWKHU 55 %RJHU 56 :HEHU 0$ ,PPHGLDWH EORRG SUHVVXUH HIIHFWV RI WKH UHQLQ LQKLELWRU HQDONLUHQ DQG WKH DQJLRWHQVLQFRQYHUWLQJ HQ]\PH LQKLELWRU HQDODSULODW $P +HDUW 0LWFKHOO .' %UDDP % DQG 1DYDU /* +\SHUWHQVLQRJHQLF PHFKDQLVPV PHGLDWHG E\ UHQDO DFWLRQV RI UHQLQDQJLRWHQVLQ V\VWHP +\SHUWHQVLRQ 6XSSO ,f (OOLV 0/ DQG 3DWWHUVRQ -+ $ QHZ FODVV RI DQWLK\SHUWHQVLYH WKHUDS\ $QJLRWHQVLQ ,, UHFHSWRU DQWDJRQLVWV 3KDUPDFRWKHUDS\ f 0XOURZ 3/ DQG )UDQFR6DHQ] 5 7KH DGUHQDO UHQLQ DQJLRWHQVLQ V\VWHP D ORFDO KRUPRQDO UHJXODWRU RI DOGRVWHURQH SURGXFWLRQ +\SHUWHQVLRQ 5DF] 3LQHW ) *DVF -0 *X\HQH 77 &RUYRO 3 &RH[SUHVVLRQ RI UHQLQ DQJLRWHQVLQRJHQ DQG WKHLU PHVVHQJHU ULERQXFOHLF DFLGV LQ DGUHQDO WLVVXHV &OLQ (QGR 0HWDE &ODXVHU ( &RUYRO 3 0HQDUG (IIHFWV RI DQJLRWHQVLQ ,, RQ SODVPD $'+ SURVWDJODQGLQ V\QWKHVLV DQG ZDWHU H[FUHWLRQ LQ QRUPDO KXPDQ $P 3K\VLRO )) :X *< DQG :X &+ 5HFHSWRU PHGLDWHG JHQH GHOLYHU\ DQG H[SUHVVLRQ LQ YLYR %LRO &KHP =KX 1 /LJJLWW /LX < 'HEV 5 6\VWHPLF JHQH H[SUHVVLRQ DIWHU ,9 '1$ GHOLYHU\ LQWR DGXOW PLFH 6FLHQFH

PAGE 161

%,2*5$3+,&$/ 6.(7&+ ZDV ERUQ LQ +HL/RQJ-LDQJ &KLQD LQ -DQXDU\ $IWHU JUDGXDWLQJ IURP 1RUPDQ %HWKXQH 8QLYHUVLW\ RI 0HGLFDO 6FLHQFHV &KDQJFKXQ &KLQD ZLWK 0' LQ ZRUNHG IRU \HDUV DW WKH ,QVWLWXWH RI %DVLF 0HGLFDO 6FLHQFHV &KLQHVH $FDGHP\ RI 0HGLFDO 6FLHQFHV VWDUWHG JUDGXDWH VFKRRO LQ -DQXDU\ DW &ROOHJH RI 3KDUPDF\ 8QLYHUVLW\ RI )ORULGD

PAGE 162

, FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ &OF2&N 'RQQD :LHOER &KDLU $VVLVWDQW 3URIHVVRU RI 0HGLFLQDO &KHPLVWU\ FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLW\ D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ DV .HQQHWK 6ORDQ 3URIHVVRU RI 0HGLFLQDO &KHPLVWU\ FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ 0LFKDHO .GURYLFK 3URIHVVRU RI 3KDUPDFRG\QDPLFV FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ &N= &ROLQ 6XPQHUV 3URIHVVRU RI 3K\VLRORJ\

PAGE 163

, FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ ,DQ 7HEEHWW 3URIHVVRU RI 0HGLFLQDO &KHPLVWU\ FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ 1DVVHU AKHJLQL 3URIHVVRU RI $QDWRP\ DQG &HOO %LRORJ\ 7KLV GLVVHUWDWLRQ ZDV VXEPLWWHG WR WKH *UDGXDWH )DFXOW\ RI WKH &ROOHJH RI (GXFDWLRQ DQG WR WKH *UDGXDWH 6FKRRO DQG ZDV DFFHSWHG DV SDUWLDO IXOILOOPHQW RI WKH UHTXLUHPHQWV IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ 0D\ 'HDQ *UDGXDWH 6FKRRO


OPTIMIZATION OF HEPATIC TARGETING FOR ANTISENSE
INHIBITION OF HYPERTENSION IN SPONTANEOUSLY
HYPERTENSIVE RATS
By
NINGYA SHI
A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE
REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY
UNIVERSITY OF FLORIDA

ACKNOWLEDGMENTS
First, I want to express my sincere appreciation to Dr.
Donna Wielbo, for her support, advice and guidance through
my course of study, which I would not have completed
without her help.
I would also like to express my gratitude to all my
committee members for their invaluable guidance and the
time they committed to my graduate work. I want to thank
Dr. Michael Katovich for his guidance as I completed my
dissertation, as and for helping me with my writing, I want
to thank Dr. Kenneth Sloan for his supervision while I was
a graduate student in the Department of Medicinal
Chemistry. I want to thank Dr. Colin Sumners and Dr. Nasser
Chegini as for their discussion of my research, and Dr. Ian
Tebbett for his help in analytic method validation. I want
to thank our lab members for their kind help.
Finally, I want to thank members of my family for their
support during this time.
11

TABLE OF CONTENTS
page
ACKNOWLEDGMENTS ii
LIST OF TABLES V
LIST OF FIGURES vi
NOTATION ix
ABSTRACT x
CHAPTERS
1. INTRODUCTION. 1
Hypertension . 1
Antisense Oligodeoxynucleotides 21
Liposomes as a Delivery Vehicle for ASODN ' 3 0
Hypothesis 37
2. GENERAL MATERIAL AND METHODS 38
3 . LIPOSOME-MEDIATED OLIGONUCLEOTIDE
DELIVERY IN HEPATOMA CELL CULTURE 47
Specific Aims 47
Introduction 4 7
Material and Methods 52
Results 54
Discussion 69
4 . THE EFFECT OF ROUTE OF ADMINISTRATION OF CA/ASODN
ON BLOOD PRESSURE ANDTISSUE DISTRIBUTION OF
ASODN IN SHR: IMPLICATION OF THE ROLE OF TISSUE
RAS ON BLOOD PRESSURE REGULATION 75
Specific Aims 75
Introduction 75
Material and Methods 7 9
Results 81
Discussion 94
5. DOSE-DEPENDENT PHYSIOLOGICAL EFFECTS OF CATIONIC
iii

LIPOSOSME COMPLEXED ASODN IN SHR MODEL
102
Specific Aims 102
Introduction 102
Material and Methods 105
Results 107
Discussion 123
6. DISCUSSION AND SUMMARY 128
REFERENCES 134
BIOGRAPHICAL SKETCH 150
iv

LIST OF TABLES
-T.abl.-e. page.
1-1. Properties of selected phosphodiester backbone
analogues 2 9
5-1. Dose-response effects of CA/ASODN on water
intake and urine output in SHR 119
5-2. Dose-response effects of CA/ASODN on plasma
aldosterone levels in SHR 120
5-3. Dose-response effects of CA/ASODN on 24-hours
urinary sodium and potassium excretion in SHR .... 122
v

LIST OF FIGURES
Figure page
1-1. Factors involved in the control of blood
pressure 3
1-2. Schematic representation of the renin-
angiotensin-system 5
1-3. Signal transduction of angiotensin II receptor
type I 11
1-4. Schematic representation of 5' flanking regions
of the AGT gene 13
1-5. Antihypertensive drugs working on the RAS 13
1-6. Summary of the possible sites of sequence-
specific actions of ASODN 23
1-7. Structures of phosphodiester and phosphorothioate
molecules 26
1-8. Phase structures formed by lipids in the aqueous
solution 31
1-9. Possible mechanisms of interaction between
liposome and cell surface 34
3-1. Effect of DDAB and DOPE molar ratio on the
cellular uptake of FITC-labeled ASODN 56
3-2. Effect of DDAB to ASODN charge ratio on the
cellular uptake of FITC-labeled ASODN 57
3-3. Time course of cellular uptake of FITC-labeled
ASODN, PC/ASODN, and CA/ASODN 58
3-4. Dose-dependent cellular uptake of FITC-labeled
ASODN 6 0
3-5. Cellular uptake and intracellular distribution of
FITC-labeled ASODN observed by confocal
microscopy 61
vi

3-6. Effects of liposome-associated ASODN on the AGT
mRNA expression in hepatoma cell culture 63
3-7. Effects of liposome-associated ASODN on the AGT
protein expression in hepatoma cell culture 64
3-8. Dose-dependent effects of CA/ASODN on AGT mRNA
expression in hepatoma cell 66
3-9. Dose-dependent effects of CA/ASODN on AGT protein
expression in hepatoma cell culture 67
3-10.ASODN cytoxicity measured by MTT test 68
4-1. Mean arterial pressure changes from baseline 24
hours after intra-arterial injection of CA/ASODN
in SHR .82
4-2. Mean arterial pressure changes from baseline 24
hours after intravenous injection of CA/ASODN in
SHR .83
4-3. Tissue distribution of ASODN and CA/ASODN 1 hour
after IA or IV injection 85
4-4. Tissue distribution of ASODN and CA/ASODN 8 hours
after IA or IV injection 86
4-5. Tissue distribution of ASODN and CA/ASODN 24
hours after IA or IV, injection 87
4-6. Plasma AGT levels 24 hours after IA or IV
injection of ASODN with liposomes in SHR 88
4-7. Plasma angiotensin II levels 24 hours after IA or
IV injection of ASODN with liposomes in SHR 90
4-8. Liver AGT mRNA levels in SHR 24 hours after IA or
IV injection of ASODN with liposomes 91
4-9. Heart AGT mRNA levels in SHR 24 hours after IA or
IV injection of ASODN with liposomes 92
4-10.Kidney AGT mRNA levels in SHR 24 hours after IA
or IV injection of ASODN with liposomes 93
5-1. The dose-response effects of CA/ASODN on systolic
blood pressure in SHR 108
5-2. The dose-response effects of CA/ASODN on plasma
AGT levels in SHR . 110
5-3. The dose-response effects of CA/ASODN on plasma
angiotensin II levels in SHR Ill
vii

5-4. Dose-response effects of medium dose CA/ASODN on
kidney AGT mRNA expression in SHR 112
5-5. Dose-response effects of high dose CA/ASODN on
kidney AGT mRNA expression in SHR 113
5-6. Dose-response effects of medium dose CA/ASODN on
liver AGT mRNA expression in SHR 114
5-7. Dose-response effects of high dose CA/ASODN on
liver AGT mRNA expression in SHR 115
5-8. Dose-response effects of medium dose CA/ASODN on
heart AGT mRNA expression in SHR 116
5-9. Dose-response effects.of high dose CA/ASODN on
heart AGT mRNA expression, in SHR 117
6-1. Summary of possible mechanisms for the observed
ASODN mediated blood pressure decrease 130
viii

NOTATIONS
SHR
WKY
AGT
RAS
ASODN
PC:Cholesterol
DDAB
DOPE
CA/ASODN
CA/ScrODN
PC/ASODN
FITC-ASODN
Spontaneously hypertensive rat
Wistar Kyoto rat
Angiotensinogen
Renin-angiotensin system
Antisense oligodeoxynucleotide
Phosphatidylcholine: cholesterol
Dimethyldioctadecylammonium bromide
Dioleoylphosphatidylethanolamine
Cationic liposome-complexed ASODN
Cationic liposome-complexed scrambled
oligonucleotide
PC:cholesterol liposome-encapsulated ASODN
Fluorescein isothiocyanate-conjugated ASODN
IX

Abstract of A Dissertation presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy
OPTIMIZATION OF HEPATIC TARGETING FOR ANTISENSE INHIBITION
OF HYPERTENSION IN SPONTANEOUSLY HYPERTENSIVE RATS
By
Ningya Shi
May 1999
Chairman: Donna Wielbo, Ph.D.
Major Department: Medicinal Chemistry
The role of angiotensinogen (AGT) in the pathogenesis of
hypertension, a major risk to human health, is well
supported. Scientific studies have previously shown that
the blockade of angiotensinogen gene expression has been
effective in decreasing blood pressure. This dissertation
focuses on the effect of cationic liposomes (CA) as a
delivery system for an antisense oligodeoxynucleotide
(ASODN) targeted to the AGT gene in rat hepatoma cell
culture and in the spontaneously hypertensive rat (SHR)
model of hypertension. The pharmacological effects of
cationic liposome-complexed ASODN (CA/ASODN) on AGT mRNA
and protein expression, blood pressure, and both hormonal
and tissue renin-angiotensin system (RAS) in SHR are
studied. The results presented demonstrate that cationic
x

liposome increases cellular uptake and tissue
distribution of ASODN. An increased cellular uptake of
ASODN resulted in enhanced gene inhibition and biological
effects. These effects were demonstrated by a dose-
dependent decrease in AGT mRNA and protein in hepatoma cell
culture and decreased blood pressure, plasma AGT, plasma
Angiotensin II and AGT mRNA in heart, kidney, and liver in
the SHR. Decreases in blood pressure were also shown to
correlate with decreases in AGT mRNA in the kidney,
suggesting renally mediated mechanisms may contribute to
the observed blood pressure decrease. Plasma aldosterone
levels also decreased after CA/ASODN treatment with a
concomitant increasé in urine output, a decrease in urinary
potassium excretion and an increase in sodium excretion.
These studies strongly suggest that ASODN targeted co AGT
mRNA has. the potential to be used as a therapeutic agent
for the treatment of hypertension as well as a research
tool to study the mechanisms of development and maintenance
of hypertension.
xi

CHAPTER 1
INTRODUCTION
Hypertensi on
Overview
Approximately 20% of the adult population in the United
States suffers from hypertension[1]. Untreated, sustained
hypertension can lead to serious complications such as
congestive heart failure, myocardial infarction, and
cerebrovascular hemorrhage[2], making it a major threat to
human life. Hypertension is defined as an abnormal elevation
of systemic arterial blood pressure. In a healthy human,
blood pressure levels fluctuate within certain limits
depending on body position, age, and stress. Adult
individuals with blood pressure measurements in excess of
140/90 mm Hg are considered hypertensive. Ninety five
percent of all hypertension has no identifiable cause and is
termed essential or primary hypertension. Hypertension that
results from other known diseases, is termed secondary
hypertension. The most common cause of secondary
hypertension is renovascular disease, such as acute and
chronic glomerulonephritis. Cushing's disease, primary
aldosteronism, pheochromocytoma, and coarctation of the
1

2
aorta are other causes of secondary hypertension[2].
Blood pressure homeostasis is maintained by the pumping
action of the heart (cardiac output), the volume of the
vascular system, and the tone of the peripheral vasculature
(peripheral resistance). Blood pressure is determined by the
product of cardiac output and peripheral resistance[3].
Three major mechanisms are responsible for normal blood
pressure regulation: the fast neural baroreceptor feedback
mechanism, the slower endocrine renin-angiotensin
aldosterone system, and the renal regulation of water and
sodium homeostasis[3].In the pathophysiological hypertensive
condition, cardiac output and peripheral resistance deviate
from the normal range via the interaction of a complex
series of factors. Mechanisms currently being investigated
include pressor and depressor factors of renal origin,
neurogenic regulation, circulating humoral factors, vessel
wall hypertrophy, and membrane transport abnormality[4].
The interdependence of different systems on hypertension
is described in Figure 1-1 [1] . As shown, increased cardiac
output can result from increased cardiac contractility or
increased fluid volume. Increased fluid volume mainly
results from a renal defect, such as decreased renal
filtration, which leads to increased renal sodium retention.
Increased cardiac contractility is mostly a direct conse¬
quence of overactivity of the sympathetic nervous system.
Increased peripheral resistance may result from functional

3
â– Autoregulation
Blood Pressure = Cardiac Output
Hypertension = Increased CO
tPreloj
t Contractility
tFluid
Volume
Volume
Redistribution
Renal
Sodium -
Retention
Excess
Sodium
intake
Decreased
filtration
surface
A ^
Ndenetic
Alteration
Sympathetic
nervous ^
Overactivity
A
Stress
x Peripheral Resistance
and/or Increased PR
A
Functional
Constriction
Structural
Hypertrophy
A
<
Renin- Cell Hyper-
Angiotensin membrane insulinemj
Excess
Genetic
Alteration
Endothelium
Derived factors;
Figure 1-1. Factors involved in the control of blood
pressure that affect the basic equation: blood pressure =
cardiac output x peripheral resistance (adapted from
reference 1).
constriction and structural hypertrophy of blood vessels.
Among these factors, renin angiotensin system overactivity
may lead to an increase in both cardiac output and
peripheral resistance.
Among the different initiating factors of essential
hypertension, the primacy of the kidney is supported by
numerous studies[5]. For example, in experimental renal
transplantation studies with rats, kidneys from genetically
hypertensive donors, such as spontaneously hypertensive
rats, consistently elicited hypertension in genetically
normotensive recipients. Additionally, the removal of both
native kidneys and transplantation of renal grafts from

4
genetically normotensive donors resulted in blood pressure
normalization in genetically hypertensive rats, suggesting
that renal mechanisms play a major role in the pathogenesis
of hypertension in these strains[6].
Role of the Renin Angiotensin System (RAS) in Hypertension
The role of the renin angiotensin system (RAS) in the
development and maintenance of hypertension is well
established. The RAS plays a critical role in the control of
blood pressure, fluid and eletrolyte homeostasis, and renal
hemodynamics[7,8]. The primary components of the RAS
include: (a) angiotensinogen, a 452 amino acid protein that
serves as the substrate for (b) renin, the enzyme that
catalyzes the proteolytic conversion of angiotensinogen to
the decapeptide angiotensin I; (c) angiotensin converting
enzyme, a dipeptidyl carboxypeptidase that converts
angiotensin I to the octapeptide angiotensin II; (d)
angiotensin II itself; and (e) the angiotensin II receptor
which is responsible for transducing the cellular effects of
angiotensin II (Figure 1- 2)[i]. The binding of angiotensin
II to its receptor mediates various physiological responses
such as vasoconstriction, cell proliferation, aldosterone
and vasopressin release and dipsogenesis [9,10] . Histori¬
cally, this hormonal system has been viewed as an endocrine
system. The various components of this cascade being derived
from different organs which are then delivered to their
sites of action by the circulatory system[9]. However, in

5
Macula densa signal
“Renal arterial pressure}
-Renal nerve activity
Angiptensinogen
Renin
V
Angiotensin I
\ Angiotensin Converting Enzyme
Angiotensin II
| I ¡ I I I I
Adrenal Kidney Intestine CNS Peripheral Vascular Heart
cortex nervous system smooth muscle
V
Aldosterone
V
Distal
nephron
Adrenergic
facilitation
V
Sympathetic
discharge
V M/ V
Sodium and water Thirst
reabsorption salt appetite
V
Contractility
Vasopressin
release
V
Vasoconstriction
reabsorption
V V
Maintain or increase
ECFV
:v
Total peripheral
resistance
V
Cardiac output
Figure 1-2. Schematic representation of the renin-
angiotensin-system. CNS: central nervous system; ECFV:
extracellular fluid volume (adapted from reference 1).
recent years there has been an increasing number of studies
to suggest that in addition to this traditional hormonal
RAS, there is a tissue RAS which produces II for local needs
[11-16]. The evidence for a functional tissue RAS is based
on a number of findings: (a) the demonstration of renin¬
like activity in extra-renal tissues such as brain, heart,
adrenal, and blood vessels, suggesting local synthesis of
Angiotensin II; (b) chronic treatment with angiotensin
converting enzyme inhibitors fails to correlate with
pretreatment plasma renin activity but does correlate with
sustained inhibition of converting enzyme activity in the
kidney; (c) ligand binding studies reveal that angiotensin

6
receptors are present in various tissues, indicating that
angiotensin exerts organ-specific effects; (d) expression
analysis of renin, angiotensinogen, and converting enzyme
show that they are coexpressed in several tissues, including
the kidneys, the brain, the anterior pituitary gland, the
ovaries, the adrenal cortex, vascular smooth muscle, and the
heart. This observation provides the basis for de novo
synthesis of angiotensin II [14] . The existence of a local
RAS also was supported by quantitative studies. For example,
angiotensin II, the active peptide, has been shown to have
an affinity for its receptor in the nanomolax range, but
circulates at plasma levels in the picomolar range. This
suggests a local angiotensin II-concentrating process in the
vicinity of its receptor, and that plasma angiotensin II is
not entirely responsible for the effects of the system[11].
The presence of a tissue RAS has been interpreted in
paracrine/autocrine vs. endocrine models [17-19] which
suggests that circulating endocrine angiotensin II partici¬
pates in short-term mechanism of blood pressure and body
fluid control, such as in the case of hemorrhage and
aggressive diuretic treatment. While local paracrine/
autocrine angiotensin II systems participate more in long
term regulation and in angiotensin II dependent structural
changes, the role of angiotensin II as a mitogenic, proli¬
ferative factor which contributes to vascular and cardiac
hypertrophy is mediated in a paracrine manner. The tissue
RAS may also serve as a mechanism to compliment or interact

7
with the hormonal RAS[12].
Renin
Renin, an aspartyl protease responsible for the first
step in the formation of angiotensin II, is highly specific
for its substrate angiotensinogen. The main source of renin
is the juxtaglomerular cells of the afferent arterioles of
the kidney. Renin levels are controlled at several stages,
including the level of gene expression, rates of intra¬
cellular synthesis/processing, and the rate of secretion
[20]. Translation of renin mRNA yields preprorenin, which
then undergoes cotranslational removal of a single peptide
and glycosylation during transport through the rough endo¬
plasmic reticulum to become prorenin. Prorenin can either be
constituí.ively .secreted from the Golgi apparatus or packaged
in immature granules and secreted in a regulated fashion.
Although prorenin is the major circulating form of renin,
the primary site of conversion of plasma prorenin to renin
still remains unclear. Prorenin activating enzymes have been
found in the kidney as well as in endothelial cells and
neutrophils. In transgenic mice expressing the human renin
gene, renin mRNA expression was found to be high in the
kidney, adrenal, ovary, testis, lung, and adipose tissue and
low in the heart and submandibular gland[21].
Expression of renin mRNA in various tissues appears to be
differentially regulated. Sodium depletion or p-adrenergic
receptor activation increases renin expression in the

8
kidney, heart, and adrenal but not in the submandibular or
genital glands. Androgens and estrogens increase extrarenal
tissue renin mRNA levels but not renal mRNA. Renal renin
expression has also been shown to be regulated by
alterations in the level of angiotensin II via a negative
feedback mechanism. Treatment of transgenic mice bearing the
human renin gene with the converting enzyme inhibitor
captopril resulted in a 5-10 fold increase in renin
expression in the kidney[21]. Similarly, enalapril treatment
of rats increased renal renin mRNA expression, which could
be reversed by infusion of angiotensin II [22] . Further
regulation of renin levels occurs by control of the
synthesis and secretion of prorenin, such as by cAMP, and/or
the conversion of prorenin to renin[10].
Angiotensin-Converting-Enzyme (ACE)
Angiotensin-Converting-Enzyme (ACE) is an endothelium-
bound, dipeptidyl carboxypeptidase that converts angiotensin
I to the potent vasoconstrictor angiotensin II and also
inactivates the vasodilator bradykinin[10]. ACE has been
found to be present in nearly all mammalian tissues and body
fluids. The highest levels of ACE activity in humans have
been found in the lung, kidney, ileum, duodenum and uterus,
with lower levels in the prostate, jejunum, testis, and
adrenals[23]. Little is known about the regulation of ACE
mRNA expression. ACE can be induced by corticosteroids in
cultured endothelial cells and alveolar macrophages[23].

9
Hyperthyroidism tends to elevate levels of circulating ACE.
Angi.Qt.ensin II and Angiotensin II-Receptors
The octapeptide angiotensin II is the main effector of
the RAS. Certain peptide fragments, particularly Angiotensin
111(2-8) and possibly Ang(l-7) and Ang(3-6), also have
biological activity[24]. Angiotensin II, itself, has
profound effects on cardiovascular function. Its multiple
biological actions in various target tissues include the
following effects: induction of vasoconstriction and a
subsequent increase in peripheral vascular resistance and
arterial blood pressure; stimulation of aldosterone release
from the zona glomerulosa cells of the adrenal cortex;
stimulation of sodium and fluid reabsorption from the
proximal tubules of the kidney; induction of thirst and
sodium appetite; facilitation of norepinephrine release from
the noradrenergic nerve endings; and stimulation of cellular
growth in vascular and nonvascular smooth muscle and renal
proximal tubular epithelium (Figure 1-2)[1]. Blocking Ang II
production will reverse these effects, leading to renal
vasodilation, and an increase in glomerular filtration rate
and sodium excretion.
The effects of angiotensin II are modulated by an
interaction with its receptors, which are present in
different tissues. Two subtypes of angiotensin II receptors
are identified based on their differential affinities for
nonpeptide drugs[26]. The angiotensin II type I (ATI)

10
receptors have a high affinity for losartan, whereas AT2
receptors have a high affinity for PD123177. The ATI subtype
is the classical angiotensin II receptor which mediates the
well known effects of this peptide[25]. The ATI receptor
mRNA has been detected in vascular smooth muscle cells,
kidney, adrenal, liver, heart, aorta, lung, spleen, uterus,
ovary, and specific regions of the brain. The AT2 receptor
is expressed in the rat adrenal medulla, the inferior olive
of the brain and in the fetus[26] . The expression of
angiotensin II receptors is influenced by circulating
angiotensin II levels, dietary sodium intake and hormonal
factors. Angiotensin II has been shown to reduce ATI
receptor mRNA expression by 50% after 4-6 hours in cultured,
vascular smooth muscle cells[10]. Low sodium intake down-
regulates angiotensin II receptors while high sodium intake
up-regulates the receptors[10]. Glucocorticoids, estrogen,
and insulin have also been shown to modulate Ang II
receptors[10].
The ATI receptor is a member of the superfamiiy of G
protein-coupled receptors that have seven transmembrane
regions[26]. The signal transduction pathway is initiated by
the binding of angiotensin II with its receptor, which then
activates phospholipase C-mediated breakdown of the membrane
phosphatidylinositol biphosphate (PIP) to generate inositol
triphosphate(IP3) and diacylglycerol(DG). IP3 is released
into the cytosol and brings about the mobilization of intra-

11
cellular calcium. DG is retained in the cell membrane where
it activates a protein kinase C that is linked to an
Effect of growth factor on cell
Figure 1-3. Signal transduction of agiotensin II receptor
type I. PIPrphosphatidylinositol biphosphate; IP3: Inositol
triphosphate; DG:diacylglycerol(adapted from reference 1).
amiloride-sensitive Na+-H+ exchanger, resulting in an
increase in intracellular pH and the promotion of growth and
protein synthesis (Figure 1-3) [1] .
The function of AT2 receptors is less well known than
that of ATI. AT2 receptors are more abundant in embryonic
and neonatal tissues than in adults, suggesting a role in
development. The signaling transduction pathway of the AT2
receptor is much less elucidated and it does not appear to
be G-protein-linked[26].
Angiotensinogen
Angiotensinogen(AGT), a 452 amino acid glycoprotein, is
the precursor of the RAS, and the major substrate of renin.
Angiotensin I is produced by renin cleavage of a leucine-

12
valine bond of the N-terminal region in the human
angiotensinogen or a leucine-leucine bond in the angio-
tensinogens of other species [27,28] . The majority of
circulating angiotensinogen is most likely derived from the
liver, in particular the pericentral zone of the liver
lobules. Adipocytes and astrocytes also produce small
amounts of AGT. Unlike renin, whose secretion is highly
regulated, newly synthesized AGT is released into the blood
stream in a constitutive manner[28,29]. The plasma serves as
the major reservoir of this protein, and plasma and
cerebrospinal fluid concentrations are approximately 1 pM
and 0.2 pM, respectively[27]. At the molecular level, gluco¬
corticoid, estrogen and thyroid hormones increase angio¬
tensinogen mRNA in rat hepatocytes [30-33] . Transcriptional
activity of the AGT gene is highly dependent on the upstream
(51 end of the transcriptional initiation site) cis-acting
DNA which responds to these hormones and cytokines (Figure
1-4) [10] . This region also contains an enhancer element and
confers tissue specificity on AGT gene expression. AGT mRNA
has been found to be abundant in liver, fat, and brain cells
and has been detected in small amounts in the lung, kidney,
ovary, adrenal gland, heart, spinal cord, and testes.
Individual AGT secreting tissues may have higher levels of
AGT than those that receive this protein only from
circulation[34,35] .
The Role of AGT in Hypertension

13
Several observations point to the relationship between
AGT and blood pressure[36-42]. Clinical studies have found
statistically significant correlations between plasma Con¬
centrations of AGT and blood pressure in human subjects
(r=0.39, p<10"6) ; higher plasma concentrations of AGT have
-Hb
-b—t
¿V
-l—I
Gr G? V
Ü-+
CAT _ TATA
-sv
ANGIOTENSINOGEN (Human)
Figure 1-4. Schematic representation of 5' flanking regions
of the AGT gene. GRE: glucocorticoid response element; ERE:
estrogen response element; TRE: thyroid hormone response
element; APRE: acute-phase response element; ENH: enhancer
region; PAL: palindromic sequence(adapted from reference 10)
been found in hypertensive subjects and in the offspring of
hypertensive parents, compared with normotensives [37] . A
genetic linkage between molecular variants of AGT such as
T174M, M235T and essential hypertension were also observed
[39,40] .
The SHR model of essential hypertension are found to have
a higher plasma AGT levels than normotensive Wistar Kyoto
rats at 14 weeks of age[42]. Blood pressure also can be
decreased after administration of AGT antibodies and
increased in transgenic animals overexpressing AGT[38].
Despite this evidence, the role of AGT in hypertension is
still debatable. Most arguments are based on the extra¬
cellular nature of AGT that makes it a major reservoir for

14
the action of renin. It is generally considered that small
changes in AGT concentration would not affect the concen¬
tration of functioning angiotensin II, thus an exclusively
AGT-dependent hypertension is theoretically difficult to
imagine[28]. However, based on enzyme kinetic studies,
plasma AGT concentrations in the rat and human are about 1 |J.
mol/L. To reach a zero-order enzymatic reaction, ten times
more AGT than naturally present is required[36]. This
suggests that the large amount of AGT present in plasma does
not provide an excess of substrate for renin and a rise or
fall in renin substrate can lead to a parallel change in the
formation of angiotensin II.
Feedback Interactions Involved in RAS
The feedback interactions of different components of the
RAS have been investigated[43-55]. By using experimental
strategies such as transgenic animals, antisense technology,
or by surgical ablation of organs involved in blood pressure
regulation, it has been possible to dissect the multiple
components that underlie primary hypertension[56-58].
By using gene targeting via homologous recombination, one
can abolish or knock out a defined genetic locus or mutate a
particular set of nucleotides that encodes a peptide domain
of interest[57]. This technique has been used to define the
exact role of genes that underlie normal cardiovascular
function. Tanimoto, et al.[43], generated angiotensinogen-
deficient mice by homologous recombination in mouse

15
embryonic stem cells. These mice do not produce hepatic
angiotensinogen, resulting in a complete loss of plasma
immunoactive angiotensin I. The systolic blood pressure of
the homozygous mutant mice was 66.9±4.1 mmHg, which was
significantly lower than that of the wild-type mice (100.4±
4.4 mmHg). This profound hypotension in angiotensinogen-
deficient rats demonstrates an indispensable role for the
RAS in maintaining blood pressure. In contrast, Rimura, et
al.[44], generated transgenic mice by injecting the entire
rat angiotensinogen gene into the germline of mice. The
transgenic line developed hypertension and both total plasma
angiotensinogen and angiotensin II concentration were three
fold higher than in the control. In situ hybridization
showed higher mRNA in the liver and the brain of these
transgenic animals.
Fukamizu, et al. [45], constructed the chimeric renin-
angiotensin cascade in mice comprising both human renin and
angiotensinogen as well as the endogenous angiotensin
converting enzyme and angiotensin II receptor by cross¬
mating separate lines of transgenic mice carrying either the
human angiotensinogen or human renin gene. Neither single
gene carrier developed hypertension despite the observed
normal tissue-specific expression of the transgenes. Dual
gene strains exhibited a chronically sustained increase in
blood pressure. Administration of a human renin-specific
inhibitor (ES-8891) effectively reduced the elevated blood
pressure only in the cross-mated hybrid mice, but treatment

16
with the angiotensin converting enzyme inhibitor captopril
and a selective antagonist (DuP753), directed at the
angiotensin II receptor, decreased the basal level of blood
pressure in the single gene carriers as well as in the dual
gene mice[45]. These results demonstrated that the sustained
increase in blood pressure of the hybrid was initiated by an
interaction between the products of the two human genes.
Schunkert, et al.[47], investigated the feedback regula¬
tion of RAS by studying the effect of angiotensin II on the
regulation of ACE gene expression and enzymatic activity.
Angiotensin II infusions increased plasma Ang II concen¬
tration and mean arterial blood pressure and decreased ACE
mRNA levels in the lung and testis, two major sites of ACE
synthesis. There was less pronounced but parallel decreases
in pulmonary ACE activity while serum and testicular ACE
activity displayed only minimal changes. This data would
suggest that pulmonary ACE expression is subject to negative
feedback by angiotensin II. Angio-tensin II infusion
suppressed plasma renin concentration, kidney renin concen¬
tration, and renal renin mRNA levels in a dose dependent
manner. In contrast, angiotensin II infusion increased renal
AGT mRNA and also increased liver AGT mRNA levels and plasma
AGT concentration. These data suggest that plasma angioten¬
sin II up-regulates renal AGT and down-regulates renal renin
gene expression, a reciprocal feedback regulation which may
have important physiological consequences.

17
Moreover, Dzau, et al.[48], found that infusion of
angiotensin II increases the AGT release rate while infusion
of angiotensin I had no effect. Direct infusion of renin in
rats treated with captopril resulted in a further
suppression of the AGT release rate, suggesting that renin
inhibits AGT release whereas angiotensin II stimulates it.
The interaction of the RAS also was studied by means of
nephrectomy combined with adrenalectomy. Hilgenfeldt, et al.
[49], studied the changes in AGT, angiotensin I and plasma
renin concentration after ablation of kidney and adrenals.
Plasma AGT levels were shown to increase approximately 5-
fold after 24 hours in nephrectomized rats, and pretreatment
with p~adrenoceptor atenolol blunted this increase. The
angiotensin II receptor antagonist Dup-753 also abolished
the increase in AGT and nephrectomy plus adrenalectomy also
blunted the rise in plasma AGT. Nephrectomy alone induced a
5-fold increase of AGT mRNA in liver and a 2.6-fold increase
was observed with nephrectomy and adrenalectomy. These
results suggest that the increase in plasma AGT after
nephrectomy be essentially mediated by angiotensin II via an
unknown adrenal mechanism.
Current Antihypertensive Drug Therapies
Antihypertensive drugs exert their effects by interfering
with normal blood pressure regulatory mechanisms. Pharma¬
ceutical agents are categorized based on the principle
regulatory site or mechanisms by which they act [59,60] .

18
There are several antihypertensive agents such as diuretics,
sympathoplegic agents, and vasodilators as well as types of
RAS inhibiotrs. Diuretics lower blood pressure by depleting
the body's sodium and reducing blood volume. Sympathoplegic
agents lower blood pressure by reducing peripheral vascular
resistance, inhibiting cardiac function, and increasing
venous pooling in capacitance vessels. Direct vasodilators
reduce pressure by relaxing vascular smooth muscle thus
dilating resistance vessels and increasing capacitance.
Calcium antagonists lower blood pressure by interfering with
calcium-dependent contractions of vascular smooth muscle,
thereby decreasing peripheral vascular resistance [59] .
Four types of drugs which interrupt the RAS at different
sites have been proven to be effective in decreasing blood,
pressure in hypertensive patients (Figure 1-5) [1] . [3-
Adrenergic blockers lower blood pressure by decreasing
cardiac output associated with bradycardia and depresses the
RAS by inhibiting the stimulation of renin production by
catecholamines[59]; Renin inhibitors inhibit the release of
renin; ACE inhibitors inhibit the enzyme that hydrolyzes
angiotensin I to angiotensin II [59] ; The angiotensin II
receptor antagonists competitively block the effect of
angiotensin II at its receptor sites [59] . The current anti¬
hypertensive drug therapies are not optimal. Problems such
as unpleasant side effects, short half lives of the
molecules and poor patient compliance result in noneffective
therapy despite the potential pharmacological effectiveness

19
of each of these agents. Hence, the development of a long
term, more specific therapeutic agent would greatly benefit
patients and ultimately reduce health care costs.
Angiotensinogen
Renin \ (Renin Inhibitors, Adrenergic blockers)
V
Angiotensin I
Angiotensin converting enzyme*'' \ (ACE inhibitors)
V
Angiotensin II and Angiotensin II receptor — (ATII receptor antagonists)
Figure 1-5. Antihypertensive drugs working on the RAS
(adapted from reference 1).
The Spontaneously Hypertensive Rat as an Animal Model of
Essential Hypertension
The spontaneously hypertensive rat(SHR) has been used to
study the mechanisms of essential hypertension. This model
was first introduced in 1963 by Okamcto and Aoki[61]. The
colony was started by mating a male Wistar-Kyoto (WKY) rat
with elevated blood pressure (145-175 mmHg) with a female
WKY rat with slightly higher than average blood pressure
(130-140 mniHg) . They then conducted brother-sister inbreed¬
ing of siblings, selected for having the highest pressures
in each litter. After the third generation, these rats,
without exception, spontaneously developed hypertension as
early as several months after birth.
By 1969, the group had successfully developed an inbred
strain of SHR in which homozygosity had been achieved in
more than 99% of all genetic loci. The absence of genetic
variation among the individuals of the inbred strain made it

20
a powerful tool to study the determinants of elevated blood
pressure. Similar to most patients with essential hyper¬
tension, SHR have normal or lower plasma renin activity and
plasma angiotensin II concentrations relative to their
normotensive counterparts-the WKY model[41]. Administration
of ACE inhibitors or anti-renin antibodies decreased blood
pressure in SHR. These results suggest a possible role of
RAS in the maintenance of their hypertensive blood pressure.
A recent study suggested that an abnormality in the
regulation of AGT gene expression might be involved in the
development of hypertension in SHR [61] . It has been shown
that, even though plasma AGT concentration in the SHR was
comparable to that of WKY at six weeks of age, the level
increased significantly at 14 weeks of age and was higher
than the WKY. Brain AGT expression in SHR was higher than
WKY at. 6 weeks of age and was comparable to that of WKY at
14 weeks of age. Cardiac and fat AGT mRNA levels also were
significantly higher at 14 weeks of age in SHR than in WKY
[42]. An alteration of AGT expression by sodium also has
been observed in the SHR[62].
Gene Targeting in Hypertension Research and Treatment
Gene targeting techniques have been used both as research
tools in hypertension research as well as therapeutic agents
for other disease states. Disruption of the expression of
genes involved in hypertension such as angiotensinogen [63,
64,66,68] and the angiotensin II receptor[65] have been

21
successful in decreasing blood pressure. Kallikrein gene
therapy has been shown to decrease blood pressure in a
hypertensive rat model[67]. Recently, Wielbo, et al. showed
that central administration of ASODN targeted to AGT mRNA
significantly decreased blood pressure in the SHR for a
prolonged period of time (6 days) with corresponding
decreases in hypothalamic angiotensin II and AGT levels[64].
Blood pressure has also been shown to decrease after
interruption of peripheral RAS gene expression. Tomita et
al. [63] , were able to decrease blood pressure by using
liposomes with a viral fusion protein mediated gene trans¬
fection technique. A transient decrease in plasma AGT and a
concurrent decrease in blood pressure and plasma angiotensin
II concentration were observed after giving the antisense
RNA via the portal vein. Studies conducted by Wielbo, et
al., showed significant decreases in blood pressure
following the intra-arterial administration of a liposome-
encapsulated antisense molecule targeted to AGT mRNA. The
plasma Ang II and AGT levels also were decreased[68].
Antisense Oligodeoxynucleotides
Antisense oligodeoxynucleotides (ASODN) are short, single
stranded sequences of DNA molecules that, by forming
specific hydrogen bonds with complementary mRNA or DNA
molecules, allow the specific regulation of gene expression
[69]. Based on the simple Watson-Crick base-pairing rule,
one can design ASODNs to target any gene with a known

22
sequence. A major advantage of this strategy is the speci¬
ficity of the ASODN action. Theoretically, an ODN of 15-17
nucleotides in length should interact with only one target
gene in the entire human genome[70]. In principle, an oligo¬
nucleotide (ODN) can be designed to target any single gene
within the entire human genome, with the potential to create
specific therapy for any disease in which the causative gene
is known[71-73]. It also has the advantage of being used as
a research tool to investigate the role of a particular gene
in a physiological or pharmacological system.
ASODN activity was demonstrated in numerous biological
systems[70,71] . Viruses represent the most .attractive thera¬
peutic targets since their genetic sequences are unique with
respect to the human host. ASODN have shown activity against
HIV, HSV 1 and 2, HPV and influenza in vitro [71] . They also
have been reported to inhibit a variety of oncogenes
including c-RAS and c-myc. Inhibition of gene expression is
generally seen at high concentrations of ODNs[72].
Theoretically, oligonucleotides can be designed to target
and interfere with every stage of gene expression. For
example, they can be designed to target and bind to double-
stranded DNA resulting in a triple helix formation with the
subsequent inhibition of transcription, or by hybridization
to nascent RNA. They can be designed to interfere with RNA
splicing and transport of mRNA from the nucleus to cytoplasm
through hybridization at intron-exon junctions. Translation
can be inhibited by targeting the antisense to the AUG

23
initiation codon, thereby inhibiting the assembly of
ribosomal subunits and the subsequent reading of the
messages to be translated (Figure 1-6)[73].
Cap â–  ^I I 1 IXI j i . AA...AA
V 5 y
Figure 1-6. Summary of the possible sites of sequence-
specific actions of ASODN. ASODN could interfere with
transcription by (1) hybridization to the locally opened
loop created by RNA polymerase; (2) hybridization to nascent
RNA; interfere with splicing through (3) hybridization at
intron-exon junctions; (4) interfere with transport of mRNA
from nucleus to cytoplasm (5) interfere with translation
through inhibition of binding of initiation factors; (7)
inhibition of the assembly of ribosomal subunits at the
start codon (8) or inhibition of ribosome sliding along the
coding sequence of the mRNA (excerpted from reference 73).
Despite the observed activities, the mechanism of ASODN
action is still unclear. It has been proposed that ASODN

24
inhibit gene expression through two distinct mechanisms[74].
One mechanism suggests that once the antisense molecules
enter the cells, they bind to its target mRNA in either the
cytoplasm, nucleus or both. Following this hybridization,
cellular RNase H protects the cells by cleaving the RNA
portion of the RNA:DNA duplex. Once cleaved, the mRNA is no
longer competent for translation and may be rapidly
degraded. This mechanism has an advantage in that each
message is permanently inactivated upon cleavage and each
ODN can inhibit multiple copies of each target mRNA. This
cleavage, however, may have the disadvantage of being
nonspecific, since the transient hybridization to other
mRNAs may activate RNase H as well[75]. In the second
antisense mechanism, the binding of an ODN to a target mRNA
inhibits gene expression through simple steric blocking. The
ODN:RNA duplex forms and physically prevents the RNA from
interacting with cellular components such as ribosomes,
thereby inhibiting translation of the RNA into its specific
protein[74].
Thermodynamics of DNA:RNA Duplexes Formation
The relative stability of a nucleic acid duplex is
measured by the melting temperature; the higher the melting
temperature, the more stable the duplex[76]. Factors such as
the length of the ODN, its AT/CG composition, and the base
sequence all contribute to its stability[74]. On average,
duplex stability is proportional to the number of base

25
pairs; the longer the duplex, the higher the stability.
However, as the length increases, the affinity for closely
related sequences also increases and the specificity may
begin to decrease. Theoretically, the length of an ODN that
should satisfy both stability and specificity requirement is
as short as ten to fifteen bases. The stability of the
duplex also increases as the G,C content of the ODN
increases, due to their stronger.hydrogen binding[76]. The
development of ASODN as therapeutic agents has not been as
smooth as once anticipated. Several requirements have to be
met to ensure its practical use, such as large scale
synthesis, in vitro and in vivo stability, successful
delivery and specificity in its action[77,78].
Stability
The ODNs initially used in physiological studies were
naturally occurring phosphodiesters. The linkages in these
molecules are susceptible to degradation by endogenous serum
and intracellular nucleases. An in vitro assay demonstrated
that after microinjection into Xenopus embryos,
phosphodiester ODNs have an intracellular half-life of less
than 30 minutes[77]. Protection from degradation was
achieved by use of a 31-end cap strategy in which nuclease-
resistant linkages were substituted for phosphodiester
linkages at the 3' end of the ODN. Phosphorothioate analogs
have a sulfur substituted for one or both nonbridging
oxygens(Figure 1-7)[74]. This modification makes the

26
molecule more resistant to nuclease degradation, extending
the half-life in vitro to 12 hours.
Further problems encountered with the use of ODNs include
poor cellular uptake and intracellular compartmentalization.
Unlike many other small organic drug molecules of low
molecular weight, ODNs (15 to 28-mer) are polyanionic
hydrophilic molecules with a molecular weight range of 5000-
10,000 and cannot passively diffuse across Cell membranes.
Although the mechanism by which the ODNs enter the cells is
not clearly identified, it is generally
Figure 1-7. The structures of phosphodiester and
phosphorothioate molecules (adapted from reference 74).
believed that the molecules enter the cells by a pinocytotic
or receptor-mediated endocytotic mechanism[79-82]. In this
process, molecules to be internalized first bind to specific
receptors on the cell surface. These receptor/ligand
complexes then become clustered in specialized areas of the
plasma membrane, termed coated pits, and then become

27
invaginated to form a coated vesicle. The coat is rapidly-
removed. Fusion with the early endosóme exposes the receptor
/ligand complexes to lower pH which causes dissociation of
ligand and receptor. Ligands may be transferred through late
endosomes to lysosomes while the receptors which recycle are
returned to the cell surface [83] .
The cellular uptake of ODNs was studied in the HL60 cell
line. Phosphorothioate ODN was demonstrated to be inter¬
nalized by the process of adsorptive endocytosis and fluid-
phase pinocytosis. The process is slowed by the metabolic
inhibitor of the cells and is temperature-dependent[84].
The intracellular distribution of the ODN has been
studied using fluorescence microscopy. A microinjection
method was used to avoid the problem of the internalization
pathway and fluorescently-labeled ODNs were observed to
accumulate in the nucleus soon after injection. When
fluorescently labeled ODNs are placed in tissue culture
media, the fluorescence accumulates in vacuoles within the
cell, forming a punctate perinuclear pattern which are
presumably endosomal and lysosomal in nature. Weak visible
fluorescence in the nucleus has been observed, suggesting
that the release of ODNs from vacuoles is an inefficient
process [82] . This observation supported the view that the
major limiting factor in effective ODN delivery appears to
be the escape of the ODNs from the endosomes and lysosomes
where they are rapidly degraded by hydrolytic enzymes. The
uptake of fluorescently labeled ODNs was enhanced by

28
coadministration with cationic lipids, demonstrated by the
presence of fluorescence in the nucleus and concurrent
increase in ODN activity[74].
Chemical Modification of the ASQDNs
Efforts have been made to improve the properties of ODNs by
chemical modification. Despite the fundamental Watson-Crick
hydrogen-bonding scheme, which is central to the formation
of the double helix and is unlikely to change substantially,
all other structural features of the phosphodiester
backbone, heterocyclic bases and sugars have been modified
or replaced [74,85].
Modification of the phosphodiester backbone has been
employed to improve stability, allowing for enhanced
affinity and increased cellular permeation of ODNs. The
properties of some of the phosphodiester backbone analogues
are listed in Table 1-1 [74] .
In addition to phosphorothioation, mentioned previously,
other linkages have been studied. Methylphosphonate-modified
ODNs, which substitute the non-bridged oxygen with a methyl
group, have the advantages of being neutral and providing
better cellular uptake. But both of these two modifications
suffer from decreased affinity to target sequences which
affect their activity[74]. The chiral properties of ODNs
containing either of these modifications was suggested to be
a factor that affects its activity. Each of these isomers
consists of a mixture of 2n diastereomers (where n is the

29
number of linkages) and it is reported that pure R or pure S
isomers would hybridize with different affinity[74].
Lesnikowski, et al. showed that for a 7-mer oligothymidine
with a methylphosphonate backbone, the all-RP (R diastereo-
mer of phosphorus) ODN had a significantly higher melting
temperature than ODNs which are a mixture of diastereomers
[86] .
Sugar modification also has been used to enhance
stability and affinity. Modification of the 2'-OH of the
ribose sugar to form 2'-O-methyl or 2'-O-allyl sugar within
oligonucleotides is found to enhance resistance to
degradation without compromising affinity [74] . Heterocyclic
Table 1-1. Properties of selected phospbodiester backbone
analogues (adapted from reference 74).
backbone analogue
activation of
RNase H
resistance to
nuclease
Chiral
center
phosphodiester
Phosphorus Analogues
Yes
..
No
phosphorothioate
Yes
+
Yes
phosphorodithioate
Yes
++
No
methylphosphonate
No
++
Yes
phosphoramidate
No
+
Yes
alkyl phosphotriester
No
+
Yes
sulfamate
Non-Phosphorus Analogues
No
++
No
3’-thioformaceral
No
++
No
methylene(methy lim ino)(MMI)
No
++
No
3’-N-carbamate
No
++
No
morpholino carbamate
No
++
No
peptide nucleic acids(PNAs)
No
++
No
base modifications offer an opportunity to enhance the
affinity without compromising RNase H cleavage of the target

30
RNA. 2-Amino-2'-deoxyadenosine introduces a third hydrogen
bond into an A:T base pair which stabilizes duplex
formation[74].
Modifications to enhance permeation by conjugation of an
ODN to transferrin, a protein ligand for a cellular
receptor, was shown to dramatically increase cellular
association of ODNs[87]. Increased cellular association and
activity have also been reported for an ODN-asialogly-
coprotein conjugate targeted to the hepatitis B virus[88].
Fluorescein labeled ODN bound to streptavidin, which had 12
mannose residues attached, was found to be internalized
preferentially in liver cells via cellular mannose
receptors. Poly(L-lysine), a polycationic drug carrier, was
also shown to increase both the rate and extent of cellular
uptake of ODNs[89]. The attachment of hydrophobic molecules,
such as cholesterol and phospholipids to the ODNs also has
been reported to increase cellular uptake[74].
Liposomes as a Delivery Vehicle for ASODN
The use of liposomes as a carrier system for nucleic acid
has received increasing attention[90-93]. Liposomes are
vesicles in which an aqueous volume is enclosed by a
membrane composed of lipid molecules with hydrophilic polar
heads and hydrophobic nonpolar tails [91] . The membranes
exhibit a variety of surface properties such as charge,
membrane rigidity, and phase behavior[93]. In small organic
molecule delivery only the self-closed bilayer vesicles, the

31
liposome is considered. In gene transfer several other
structures and phases, such as the open lipid bilayer
fragment, the inverse hexagonal phase and the micelle, are
also important(Figure 1-8) [94] .
Liposomes in Biological Systems
Liposomes administered in vivo are subjected to
physiological interactions that determine the rate of
clearance and degree of organ uptake. The major limitation
of liposomes for pharmaceutical applications is their unpre-
Lipid
Lysophospholipids
Detergents
Phase
w
Micellar
Molecular
Shape
V""
Inverted Cone
Phosphat idytchol ine
Sphingomyelin
Phosphatidylserine
Phosphat idylglycerc
wii
l
Bilayer
-Q—
Cylindrical
Phosphat i dy let hand
/ . . :
amine (unsaturated) Kli
A""
Cardiol ipin - Ca2+
Phosphatidic acid -
Ca2+
Hexagonal (H,,)
Cone
Figure 1-8. Phase structures formed by lipids in the aqueous
solutions (adapted from reference 101).

32
dictable behavior in the body, such as: rapid clearance from
the blood, restricted control of the encapsulated molecule
release, low or nonreproducible drug loading and physical or
chemical instability[95].
Circulating liposomes are taken up to a large extent by
organs rich in the cells of the reticulo-endothelial system
(RES), such as the liver, spleen, lung, lymph nodes and bone
marrow. Larger liposomes of conventional formulation are
rapidly removed from the circulation following intravenous
injection by uptake primarily into Kupffer cells of the
liver and macrophages in the spleen and lung. This passive
targeting to phagocytic cells has been used for treating
diseases of the RES such as liver leishmaniasis and fungal
infections [95] . Small liposomes with diameters less than 0.1
|j,m can pass through fenestrated endothelium and gain access
to liver parenchymal cells [96,97] .
For therapeutic applications involving non-RES organs,
prolonged blood circulation has been achieved by mimicking
the composition of the red blood cell membrane. Inclusion of
phospholipids with a synthetic hydrophilic polymer
headgroup, such as a polyethyleneglycol chain, reduce the
recognition of liposomes by the mononuclear phagocytic
system and hence increases its circulation time[98].
Specific organ targeting also can be achieved by
incorporation of certain ligands. Liposome containing lacto-
sylceramide was shown to increase the transfection
efficiency by a factor of 1000 in HepG2 cells through

33
interaction with asialoglycoprotein receptors on the cell
membranes[99].
The physical integrity of liposomes can be modulated by
changing the lipid composition. Increase in cholesterol com¬
position has been shown to stabilize the bilayer and decrea¬
se the permeability of phosphatidylcholine liposome [100] .
Methods for DNA encapsulation include reverse-phase
evaporation(REV), sonication, Ca2+-EDTA chelation, cationic
lipid complexes, detergent dialysis and viral envelope
reconstitution [101] . Increased DNA encapsulation efficiency
has been achieved by altering the physical state of the DNA
such as condensing the DNA with bacteriophage protein or
small organic molecules. In the REV method, multiple freeze¬
thawing and rehydration cycles, during which bilayers open
and close, can make more molecules permeate into the
interior of the liposome thus improving the encapsulation
efficiency[101].
The Interactions of Liposomes with Cells
The mechanism of liposome-cell interaction and the effect
of liposome structure and composition on its association
with the cell is not completely understood. Different modes
of interaction have been summarized in the literature(Figure
1-9) [102,103] . The endocytosis/phagocytosis mechanism
proposes that cells with phagocytic activity take up
liposomes into endosomes, endosomes then fuse with lysosomes
to form secondary lysosomes where degradation takes place in

34
low pH (4.5) environments. Liposome phospholipids are then
hydrolyzed to fatty acids and recycled and reincorporat.ed
into the host phospholipid. The content of the aqueous
compartment is released after the membrane disintegrates.
They may either remain sequestered in the lysosome until
exocytosis or they will slowly leak out of the lysosome and
gain access to the rest of the cell. Liposomes may also be
taken up by receptor-mediated endocytosis[108].
Liposomes coated with low-density lipoproteins or
StahluAbsorption Endocytosis
Fusion Lipid Transfer
Figure 1-9. Possible mechanisms of interaction between
liposome and cell surface (adapted from reference 102).
transferrin bind to the cell via surface receptors for these
moieties and then are internalized via coated pits with
subsequent ligand degradation, or recycling[104]. Inter¬
membrane transfer of lipid components can take place upon
the close approach of the two phospholipid bilayers
without disruption of the membrane's integrity[102].

35
Contact-release of the aqueous contents of liposomes occurs
by a poorly understood mechanism in which contact with the
cell causes an increase in permeability of the liposome
membrane. This mechanism provides the means for introducing
materials into specific cells without the need for ingestion
of the whole liposome, and would be of particular value for
cells which are not actively phagocytic[102]. Adsorption may
take place either as a result of physical attractive force
or as a result of binding by specific receptors to ligands
on the vesicle membrane. Fusion results in incorporation of
the liposomal lipids into the plasma membrane of the cell
and diffusion of the liposome-trapped contents into the
cytoplasm[102]. Incorporation of fusogens such as
lysolecithin, detergent, surfactant or Sendai virus fusion
proteins into the membrane have been shown to facilitate the
liposome-cell fusion process [105] .
Liposomes have been used as a tool to deliver
oligonucleotides. Liposome encapsulation can improve the
passage of ODNs through the cell membrane as well as protect
them in the extracellular medium. It is also possible to
target liposomes to specific cell populations by coupling
certain proteins or antibodies on their surface [107] .
Liposome structure and surface properties determine several
different ways liposomes can interact with ODNs. ODNs can be
encap-sulated in the liposome interior, bound onto the
liposome surface, or embeded between bilayers[106].
Liposomes have been differentiated based on the mode of

36
liposome inter-action with their target cells [107] .
Conventional liposomes are formulated with
phosphotidylcholine and cholesterol are examples of this.
These are also referred to as non-targeting liposomes.
Liposomes which are pH-sensitive were designed to release
their content as they pass through regions of low pH. They
can be used to take advantage of the pH gradient of the
endocytic process, to avoid lysosomal degradation and to
improve the intracellular delivery of macromolecules[109-
112]. One way to make pH sensitive liposomes is to
reconstitute it with a viruse such as vesicular stomatitis
virus or with influenza virus membrane glycoproteins. These
proteins undergo conformational changes at low pH levels and
promote acid-induced liposome-cell fusion and increased
delivery of the encapsulated contents into the
cytoplasm[105]. The poly-morphic phase behavior of some
unsaturated lipids provides another way to make pH-sensitive
liposomes. The most commonly used lipid corn-position of pH-
sensitive liposome is dioleylphosphatidyl-ethanolamine(DOPE)
which has ionizable headgroups. At low pH, the headgroup
becomes protonated and forms the inverted hexagonal (HII)
phase rather than the bilayers observed under normal
physiological pH[112]. The inverted molecules fuse more
readily with the endosomal membrane and leads to the release
of the liposome contents. Immunoliposomes refer to liposomes
linked to antibodies that are designed to target cells which
express sufficient and specific antigens [113] . This method

37
has been applied to treat tumor cells by incorporating in
the liposome the antibodies against folate protein, which
has over a 20-fold higher expression in tumor than in normal
cells and was shown to give more specific targeting to tumor
cells.
Cationic liposomes as a DNA carrier system was first
reported by Felger, et al. using the synthetic cationic
lipid N- [1- (2,3-dioley] oxy) propyl] --N, N, N-rimethylammoniumn
chlo-ride (DOTMA) in combination with DOPE[114]. The
positively charged cationic liposomes form a complex with
the negatively charged DNA. These complexes contain excess
cationic lipids which neutralize the negative charge of the
DNA and provide the complex with a net positive charge
allowing interaction with negatively charged cell surface.
Substitution with negatively charged lipids was shown to
suppress the delivery[115,116] .
Hypothesis
Based on these information, our hypothesis is: inhibition
of angiotensinogen by antisense oligodeoxynucleotide to
angiotensinogen mRNA attenuates hypertension in the SHR rat
model, and this blood pressure decrease may be prolonged via
optimization of route of ASODN administration and
optimization of oligonucleotide delivery. To test this
hypothesis, both in vitro and in vivo studies will be
conducted.

CHAPTER 2
GENERAL MATERIAL AND METHODS
Animals
Male, spontaneously hypertensive rats(SHR), Sprague
Dawley and Wistar-Kyoto(WKY) rats weighing between 250-275g
(Harlan, Indianapolis, Ind.), were kept in the University of
Florida Animal Care Facilities. They were housed in a room
with a 12-hour light-dark cycle and fed on standard
laboratory rat chow and tap water ad libitum. Rats were ac¬
commodated for one week before experiments began.
Artarial and Venous Cannulation
Animals were anesthetized with ketamine/xylazine (100 mg
ketamine + 20 mg xylazine/ml at a dose of 0.5-0.7 ml/kg, IP)
and a heparinized (100U/ml) catheter made of PE50 tubing
(0.58 mmID, 0.965 mmOD) was inserted into the left carotid
artery, 25 mm toward the heart. In addition, a catheter was
inserted into the femoral vein and extended 60 mm into the
dorsal vena cava. The catheter dead space was filled with
heparin (1000U/ml) to maintain patency. Both catheters were
tunneled under the skin and exteriorized between the
scapulae and plugged with stoppers. Animals were allowed to
38

39
recover for 24 hours after catheterization before
experimentation.
Blood Pressure Measurements
Blood pressure was measured by direct method or
indirectly, using the tail cuff method. For the direct
method, a catheter was inserted into the external carotid
artery and connected to a pressure transducer that was
interfaced with a Digi-Med BP Analyzer(micro-Med,
Indianapolis, Ind.), Signals were recorded on a Gould TA2405
EasyGraf Physiograph, which provides information on
systolic, diastolic and mean arteria.!, pressure and heart
rate. The indirect method refers to the tail-cuff plethys¬
mography method[117,118]. The rats were first warmed for 15
minutes at 37°C in a thermostatically controlled heating
cabinet for better detection of tail artery pulse. Then the
rats were put in a holder with heating pad. Their tails were
passed through an inflatable cuff and a rubber bulb
connected to a pulse transducer was taped on the tail distal
to the cuff. The pressure in the cuff was increased rapidly
when inflated, until the tail pulse disappeared and then
released slowly. When pressure in the tail arteries exceed
that in the cuff, the pulse reappeared and systolic pressure
was indicated by the level of the first pulse wave. Daily
values were obtained by averaging 5-10 successive readings.
Cell Culture

40
H-4-II E, Hepatoma, Reuber H35, rat cells were purchased
from ATCC (Rockville, Maryland). Cells were grown in a
monolayer culture on 10 cm petri dishes in 12 ml of Eagles
Minimum Essential Medium (EMEM) supplemented with 10% fetal
bovine serum, 10% calf serum and incubated in 95% air-5% C02
at 37°C. The culture medium was changed every other day.
Cells were passaged until confluent at a ratio of 1:6 using
1.0 ml of 0.25% trypsin-EDTA.
01igodeoxynucleotides
The antisense oligodeoxynucieotide (ASODN) was designed
based on the angiotensinogen(AGT) mRNA sequence published by
0khubo[119]. The ASODN is an 18-mer, complementary to the -5
to +13 base sequence of AGT mRNA, and covers the AUG
translation start codon. The sequence is: 5'-CCGTGGGAGTCA
TCACGG-3'. The scrambled ODN (ScrODN) has the same base
composition but in random order: 5’-TCGCTAAGCGGCAGCGTG-3'.
Both nucleotides were synthesized in the phosphorothioated
form in the DNA Synthesis Laboratory, University of Florida.
Liposome Synthesis
Phosphatidylcholine-cholesterol liposomes were composed
of 80% phosphatidylcholine and 20% cholesterol (Avanti Polar
Lipids Inc., Alabaster Alabama). Liposomes were prepared by
the reverse phase evaporation method[120]. The lipids were
dried and dispersed by rotary evaporation and then
rehydrated in phosphate buffer to form multilamellar

41
vesicles by mechanical shaking. The vesicles were subjected
to ten freeze-thaw cycles to enhance ODN entrapment.
Liposomes were then passed through a 0.1 pm filter membrane
for size reduction.
Cationic liposomes were composed of dimethyl-dioctadecyl-
ammonium bromide (DDAB) and dioleoylphosphatidyl-ethanol-
amine (DOPE) (2:5,w/w) (Avanti Polar lipids, Alabaster
Alabama). Lipids were dispersed and rehydrated in 1 ml
deionized water and sonicated to reduce the size to about
100 nm. ASODNs were complexed with cationic liposomes by
mixing at a -/+ charge ratio of ASODN/cationic lipids of
0.18 and incubated at room temperature for 30 minutes before
experiments[121].
Northern Blot Analysis
mRNA was isolated using acidic guanidium thiocyanate-
phenol-chloroform[122] and quantified by densitometry[123].
Cells or tissues were lysed using mercaptoethanol then
reated with guanidium thiocyanate followed by phenol and
chloroform extraction. RNA was then precipitated by
isopropanol at -20°C, evaporated and resuspended in sterile
water. The concentration of total RNA was measured by
spectrophotometry at a wavelength of 260 nm. An aliquot of
20 pg total mRNA was separated by electro-phoresis on an
agarose formaldehyde gel at 25V for 16 hours. RNAs were then
immobilized on nitrocellulose membranes by capillary
transfer. The RNA was then subjected to prehybridization for

42
4 hours at 56°C with 1 x Denhardts SSPE solution, 5 x SSPE,
0.1% SDS, 50% formamide, and 250 mg/ml denatured salmon
sperm DNA. Hybridization was carried out under the same
conditions with a 32P labeled riboprobe to the specific mRNA
sequence. After stringency washes, the membrane was exposed
to X-ray film then developed. Membranes were reprobed with
Cathepsin D mRNA to ensure equal loading.
Angiotensinogen Assay
Aliquots of 500 ul of culture medium or rat plasma were
evaporated to dryness. The dried samples were assayed for
AGT by the direct radioimmunoassay method of Sernia[124].
AGT sample content was measured from a standard curve of
pure rat AGT diluted in the same cell culture medium or
plasma. The assay sensitivity was 0.3 ng/tube, with an
inter-assay and intra-assay variability of 14% and 9%,
respectively.
Angiotensin II Assay
Plasma samples were extracted using methanol and
trifluoroacetate on C18 reverse phase extraction
cartridges(Varian, Windham, NH). Angiotensin II(Ang II) was
measured by double-radioimmunoassay (RK-A22, Alpco, Windham,
NH). The samples were first incubated for 16 hours with an
anti-angiotensin II antibody. The 125I-Ang II competes with
Ang II present in the samples and standards for the same
antibody binding sites. A solid-phase second antibody is

43
then added and antibody-bound fraction is precipitated and
counted on a Beckman DP550 Gamma counter. The sensitivity of
the assay is 0.7 pg/ml Ang II and there is minimal cross¬
reaction with other peptides.
Reverse-transcriptase Polymerase Chain Reaction(RT-PCR)
RT-PCR was used to quantify messenger RNA. Total mRNA was
first isolated, then converted to cDNA. The cDNA was then
amplified by thermocycling. Total mRNA was isolated using
acidic guanidium thiocyanate-phenol-chloroform. Then 5 ug of
total mRNA was mixed with 10 mM dNTP, 0.1 |iM MgCl2, 100 |aM
oligo d(T), 40 U/ul of RNase inhibitor, and 50 U/ul of
reverse transcriptase(Promega, Madison, WI) in a 50 ul
volume. The reaction was incubated at 37°C for 1 hour, then
heated at 95°C for 5 minutes, followed by a 5 minute
incubation at 4°C. Five microliters of RT product was then
subjected to PCR reaction. The PCR reaction was performed in
a total volume of 50 ul in the presence of 10 mM of dNTP,
100 pmol/ul of primers, 5 U/ul of TAQ Polymerase and 0.025 M
of MgCl2 (Promega, Madison, WI). The thermocycle was
programmed as:
Step 1: 5 minutes at 95°C
Step 2: 30 cycles at 1 minute at 94°C; 2 minutes at
58°C; 3 minutes at 72°C
Step 3: 10 minutes at 72°C
AGT and control genes were amplified in the same reaction
to eliminate the factors that would affect the amplification

44
efficiency. The sizes of the two amplified products were AGT
463bp, (5-actin 350bp. Ten microliters of each PCR reaction
mixture were separated with 1.8% agarose gel using the
electrophoresis method and stained with ethidium bromide and
photographed. The density of the bands were then measured by
densitometer(Biorad, Boston, MA) and the ratio of density
between the AGT and control were plotted. The primer
sequences for AGT were: Sense, CAACACCTACGTTCACTTCC and
Antisense, GAGTTCAAGGAGGATGCTGT. The primer sequences for
control p-actin were: Sense, AACCGCGAGAAGATGACCCAGATCATGTTT
and Antisense, AGCAGCCGTGGCCATCTCTTGCTCGAAGTC [125] .
Fluor im.e.hrl..c_.An.al.ys.is.
Cells or weighed tissue were prepared for fluorimetric
analysis of fluorescein isothio-cyanate (FITC)-conjugated
oligonucleotide by homogenization in 1 ml PBS followed by
centrifugation at 14,000 rpm for 10 minutes. The supernatant
was aspirated and fluorescence activity was determined on a
Perkin Elmer Luminescence Spectrometer, excitation:487 nm and
emission:525 nm. The percentage of oligonucleotide present in
each sample was determined by dividing the fluorescence of
the sample by the fluorescence of a standard containing only
1 ml PBS and 2.5 |j.g FITC-conjugated oligonucleotide.
Confocal Microscopy
Microscopical analysis of FITC conjugated ASODN uptake
and distribution was carried out on a Nikon Optiphot-2-

45
Fluorescent laser scanning confocal microscope in the Center
for Structural Biology, at the University of Florida. Cells
were grown on plain glass microscope slides. After treated
with ASODN, PS/ASODN or CA/ASODN for four hours, cells were
fixed using 2% formaldehyde and then slides were mounted
using Gel Mount (Biorad, Boston, MA) and micrographs were
obtained at excitation and emission wavelengths of 472 and
525 nm, respectively.
MTT Tost
MTT[3 -(4,5-dimethylthiazole-2-yl)2,5-diphenyl-tetrazolium
bromide] test, described by Mossmann[126], was used as an in
vitro test for cellular toxicity. The cells were grown in a
96 well culture plate. After a 43-hour incubation with
ASODNs, cationic lipids or CA/ASODN complexes, the medium
was decanted. A 10 ul MTT stock solution (5 mg/ml in PBS)
was added to 0.1 ml culture medium. After 4 hour incubation
at 37°C, the MTT cleavage product, formazan, was solubilized
by the addition of 0.1 ml 0.04 N HC1 prepared in
isopropanol. The optical density of the product was measured
using a reference wavelength of 630 nm and a test wavelength
of 560 nm by microplate reader (Biorad, Boston, MA) .
Aldosterone Analysis
Plasma samples were collected and stored at -20°C.
Aldosterone was measured by radioimmunoassay (DSL-8600
ACTIVE Aldosterone Radioimmunoassay Coated-Tube Kit,

46
Diagnostic Systems Laboratories, Inc. Texas) The procedure
is based on the basic principle of immunoassay where there
is competition between a radioactive and non-radioactive
antigen for a fixed number of antibody binding sites. The
bound antigen is separated from free antigen by decanting
the antibody coated tubes. The sensitivity of the assay was
25 pg/ml. Cross-reactivity to closely related naturally
occurring steroids was reported as negligible.
Sodium-potassium Analysis
Urine samples were centrifuged and the supernatant was
saved for analysis on a NOVA 1+1 Automated Sodium/Potassium
Analyzer (NOVA Biomedical, Massachusetts). The principle of
the assay is based on the electrical potential of the solu¬
tion measured against a reference electrode.
Statistical Analysis
Statistical analysis was performed by ANOVA for treatment
effect, and the Duncan multiple range test was used for
individual comparisons. Data for individual time points were
analyzed using the Students independent T-test. Significance
was at the 95% confidence limit.

CHAPTER 3
LIPOSOME-MEDIATED OLIGONUCLEOTIDE DELIVERY
IN HEPATOMA CELL CULTURE
Speci fir: Aims
The hepatoma H4 cell culture experiments seek to evaluate
two specific aims. The first is to develop an efficient
delivery mechanism for antisense oligonucleotide targeted to
angiotensinogen mRNA for cells in culture; the second is to
determine the uptake efficiency, cellular distribution,
cytotoxicity, and effects of the antisense oligonucleotides
on AGT mRNA and protein expression in hepatoma H4 cell
culture.
,.Int.r.Qduc..t.i-Qn
Pharmaceutical agents targeted to block the renin
angiotensin system are effective in treating hypertension
[59]. Currently there are no drugs available to block the
precursor of the RAS, angiotensinogen. In our previous
studies, ASODN was designed to hybridize to the AUG start
codon of angiotensinogen mRNA[64,68]. This ASODN successfully
decreased blood pressure in SHR when administered both
centrally and peripherally. This treatment, however, did not
return elevated blood pressures to normal levels and the
effect lasted only for a limited time. One hurdle to ASODN

48
use is its poor tissue or cellular uptake [77] . Liposome
vehicles were utilized to improve ASODN delivery by
increasing the interaction of the ASODN with tissues or cells
to protect the ASODN from degradation by intracellular
enzymes[101].
Cationic liposomes have been shown to be effective for
delivering oligonucleotides in cell culture [128] . Even
though novel synthetic cationic lipids have been reported to
provide higher efficiency in tested cell lines, in general
no single cationic lipid formulation appears to be uniformly
superior to others[129,130]. Transfection conditions must be
optimized individually for each cationic liposome
formulation and cell line. The following parameters may be
modulated: the DNA to lipid ratio of the complex; the total
dose of DNA:lipid complex added; the density and dividing
stage of the cultured cells; the medium in which the cells
are cultured; the duration of exposure of the liposome:DNA
complexes to the cells; and the time points when the cells
are analyzed[131].
Most cationic liposomes formulated contain two lipid
species, a cationic amphiphile and a neutral phospholipid
which functions as fusogen, typically dioleoyl-phosphatidyl-
ethanolamine(DOPE). Cationic vesicles formulated without
DOPE have been shown to be 2 to 5-fold less active than the
one with DOPE[132]. The effect of DOPE is attributed to its
capacity for transition from the bilayer phase into the
inverted hexagonal phase, which leads to increased membrane

49
fusion[132,101]. Replacing DOPE with other neutral
phospholipids of the same acyl chain with a choline head
group instead of the ethanolamine such as,
dioleoylphosphatidyl-choline (DOPC), abolish most of the
transfection activity of the liposomes[133].
Compared with conventional liposomes, cationic liposomes
do not require an encapsulation step that limits the
application of the carrier. Instead, negatively charged
ASODNs are directly mixed with preformed liposomes and form
complexes through electrostatic interaction with cationic
lipids [134] . Despite the fact that the physicochemical
properties of the cationic lipids and ASODN complexes are
poorly characterized, it is generally agreed that the charge
ratio of the ASODNs to the cationic lipid is a critical
parameter. The charge ratio determines such factors as
compactness of the complex; the masking of the negative
charges of the ASODNs, and the steric interaction of the
complex with the cell membrane[135]. Numerous studies have
shown that transfection efficiency changes dramatically with
different ratios of DNA to cationic lipid[136,137].
The mechanism of cellular delivery of the cationic
liposome/ODN complex is via an endocytotic process, mainly
mediated by the mononuclear phagocyte system, but also by
non-phagocytic cells such as fibroblasts, kidney cells,
lymphocytes and hepatocytes[138]. The non-receptor-mediated
endocytosis appears to be strictly dependent on the size of
the liposomes. Tightly compacted, condensed small-sized

50
cationic liposome/ASODN complexes are more favorable for
uptake by endocytosis. The optimal size of the complexes is
50-100 nm. Vesicles larger than 400 nm are not favored for
endocytosis. The particle size of the cationic liposome/ODN
complex ranges from 75 nm to >3000 nm, and depends on
several factors such as: (i)the cationic lipid species;
(ii)the amount of neutral co-lipid like DOPE; (iii)the
cationic lipid/DNA ratio; (iv)the concentration of lipid and
DNA in the final formulation; and (v)the composition of the
suspending vehicle [129] .
Successful gene inhibition by ASODN has been reported in
various biological systems[70,71]. The observed biological
effects have mainly been observed at high concentrations of
ASODN, when some non-specific effects were produced[78]. Our
previous in vitro transcription/translation study showed
that a high doses of ODN (3-30|imol/l) , both ASODN and
control scrambled ODN caused a decrease in AGT expression
[68]. By using cationic liposomes it may be possible to
decrease the dose of ASODN required to produce the same
biological effect while decreasing the potential for non¬
specific effects caused by ASODN.
Cationic lipids such as DDAB have been reported to be
highly toxic to cells. They are similar to surfactant
molecules. At high concentrations, these lipids cause cell
membrane disruption and poration[139]. Because of this, the
toxicity of cationic lipids, ASODN alone and the ASODN-lipid
complexes were determined by the [3-(4,5-dimethylthiazole-2-

51
yl)2,5-diphenyl-tetrazolium bromide](MTT) assay. This assay
is based on the observation that the tetrazolium salt, MTT,
is actively absorbed into cells and is reduced in a
mitochondrial-dependent reaction to yield a formazan
product. This product accumulates in the cells and can not
pass through the cell membrane. The ability of cells to
reduce MTT, as an indication of mitochondrial integrity and
activity, is interpreted as a measure of cell viability
[126] .
A cationic liposome combination of dimethyl-dioctadecyl-
ammonium bromide(DDAB) and dioleoyl-phosphatidyl-ethanol-
amine(DOPE) has been shown to have a higher efficiency
compared to other lipids. The DDAB/DOPE lipid combination
increased ODN delivery in. Caski cell culture 4.5 fold,
compared with a 2.0-2.5 fold increase by commercially
available N-(1-(2,3-dioleoyloxy)propyl)-N,N,N-trimethyl-
ammonium-methyl-sulfate (DOTAP) [121] . In this study, we used
the DDAB/DOPE cationic liposome combination as a delivery
system for ASODN and evaluated its cellular uptake
characteristics. We also compared the uptake efficiency of
ASODN with previously used phosphatidylcholine: cholesterol
liposomes. The effect of ASODN on AGT mRNA and protein was
also studied in rat H-4-II-E hepatoma cell culture, a cell
line known to express AGT mRNA and secrete AGT protein
constitutively[127]. The effect of a control, scrambled
ASODN also was determined to test the specificity of the
target ASODN sequence.

52
Material and Methods
To determine the effects of liposome composition on the
cellular uptake of ODN, H-4-II E cells were incubated in a
medium containing 1 jaM FITC-ODN complexed with cationic
liposomes composed of DDAB(25 mg/ml) and DOPE, at different
weight ratios, for 4 hours. Cells were then washed, lysed and
the cellular associated fluorescence was measured by
fluorometric analysis.
The effect of cationic lipid to ODN charge ratio on the
cellular uptake of ODN also was determined in H-4-II E cells.
The cells were incubated in a medium containing 1 ¡J.M FITC-ODN
complexed with cationic liposomes with DDAB to ODN at
different charge ratios for 4 hours. The cells were then
lysed and the cellular associated fluorescence was measured
by fluorometric analysis.
The concentration effects of ASODN with the delivery
systems on ASODN uptake also were determined. H4 hepatoma
cell cultures were grown to confluence, then treated with
either cationic liposome-complexed ASODN, PC:cholesterol
liposome-encapsulated ASODN, or naked ASODN at the following
concentrations: 0.1, 0.5, 1.0, 2.5 and 5.0 pM. Cultures were
incubated for 4 hours, then media was decanted and cells were
lysed and assayed for FITC intensity using fluorimetric
analysis.
The effectiveness of the delivery mechanism on the rate of
ASODN cellular uptake in Hepatoma H4 cell culture was

53
determined. The cell cultures were grown to confluence and
treated with either a 1 fiM cationic liposome-complexed ASODN,
a 1 fiM PC: cholesterol liposome-encapsulated ASODN, or an 1 (iM
naked ASODN. Cultures were incubated for 1-4 hours. The
cellular associated fluorescence was measured at 0.5, 1, 2
and 4 hours.
FITC conjugated ASODN distribution and uptake was analyzed
microscopically. Hepatoma cells were grown on glass
microscope slides and treated with either 1 p,M of naked FITC-
ASODN, 1 |J.M PC: cholesterol liposome-encapsulated ASODN or 1
¡J.M cationic liposome-complexed ASODN for four hours. The
slides were then mounted and the image was observed under a
Nikon Optiphot-2-Fluorescent laser scanning confocal
microscope.
The in vitro effects of cationic liposome complexed with
ASODN on AGT mRNA expression and AGT protein production were
determined in hepatoma cells, which were grown to
confluence. These cells were treated with either 1 |J,M
cationic liposomes complexed with ASODN, naked ASODN,
scrambled ODN or cationic lipids alone. Cultures were
incubated for 24 hours, then the medium analyzed for AGT by
radioimmunoassay. Hepatoma cells were lysed for mRNA
measurement by Northern blot analysis.
Hepatoma cells were treated with complexed ASODN at
concentrations of 10 nM, 50 nM, 100 nM, 500 nM, and 1 (_iM to

54
determine the dose response effect of cationic liposome-
complexed ASODN on the expression of AGT mRNA and protein.
Cells were incubated with CA/ASODNs and cationic lipids used
in the formulation for 24 hours, then the AGT mRNA were
measured by Northern blot analysis and the AGT protein
levels in the medium were measured by radioimmunoassay.
Cellular toxicity was measured using the MTT test as
described in Chapter 2. Cells were incubated for 48 hours in
medium containing either ASODN at concentrations of 0.1, 0.2,
0.5, 1.0, 2.0, 5.0, 10.0 (0.M, ASODN complexed with cationic
lipids or the corresponding amount of cationic lipids used to
complex ASODN at each concentration. After treatment, cells
were washed with phosphate buffer and incubated in 0.25 mg/ml
of MTT for 4 hours at 37°C. A 1 ml solution of 0.04 N HC1,
prepared in isopropanol, was added and agitated for 5 minutes
to solubilize the formazan produced. The absorbance was
measured at 560 nm by microplate reader.
Results
Figure 3-1 summarizes the effects of DDAB to DOPE molar
ratio from 1:8 to 8:1 on the cellular uptake of FITC labeled
ASODN in H4 Hepatoma cells. The results demonstrate that
without DOPE, ASODN uptake is low, as depicted by the
3.4+0.4% of total fluorescence detected in these cells. As
the DOPE composition of the liposomes increased, cellular
uptake of ASODN also increased. Maximum ASODN uptake observed

55
was 15.8 ±1.6%(P<0.05) at a DDAB to DOPE weight ratio of 1:2.
As more DOPE was added to the liposomes, the ASODN uptake
dropped rapidly. At a weight ratio of 1:8, the ASODN uptake
was 3.2±0.7%. The optimal + /- charge ratio of DDAB to ASODN
on the cellular uptake of ASODN was determined by treating
the cells with l(a.M of FITC-ASODN complexed with DDAB at
different molar ratios. The uptake of ASODN complexed with
liposomes composed of DDAB alone was used to test the effect
of the helper lipid DOPE on the uptake of ASODN. Figure 3-2
shows that the maximum uptake was 16.1±1.9%(P<0.05) at.a DDAB
to ODN molar ratio of 5:1. Without DOPE, the ASODN uptake was
low, ranging from 2.6±0.2% to 3.7±0.5%.
In a subsequent study with hepatoma cells, the time course
of cellular uptake was evaluated with all three delivery
Systems (naked ASODN, PC:cholesterol-encapsulated, and
cationic liposome-complexed ASODN) using a 1 ¡aM concentration
of ASODN. Cellular uptake was determined at given time
intervals after cells were treated with FITC labeled ASODN.
Figure 3-3 demonstrates that cationic liposome
complexation resulted in a more rapid cellular uptake of
ASODN, with greater ASODN accumulation per time point when
compared to both the PC:cholesterol liposome treated cells
and cells treated with naked ASODN. With all treatments the
most rapid intracellular ASODN accumulation was observed
between 0 and 60 minutes after ASODN administration.

56
DDAB/DOPE Molar Ratio
Figure 3-1. Effect of DDAB to DOPE molar ratio on the
cellular uptake of FITC-labeled ASODN. Hepatoma cells were
incubated with 1 jj,M of ASODN and DDAB (25 mg/ml) with DOPE
at different molar ratios for 4 hours. The cellular
associated FITC intensity was then measured by fluorimetry.
Data represents mean + standard error (n=3) P<0.05(*).

57
DDAB(+)/ASODN(-) Charge Ratio
Figure 3-2. Effect of DDAB to ASODN charge ratio on the
cellular uptake of FITC-labeled ASODN. Hepatoma cells were
incubated with 1 |j,M ASODN with DDAB at a charge ratio of
10:1 to 1:10 in the presence or absence of DOPE for 4 hours.
The cellular associated FITC intensity was measured by
fluorimetry. Data represents mean ± standard error (n=3)
P<0.05 (*) .

58
0 12 3 4
Time (hour)
Figure 3-3. Time course of cellular uptake of FITC- labeled
ASODN. Hepatoma cells were incubated with 1 (J.M of ASODN, PC
cholesterol liposome-encapsulated ASODN(PC/ASODN), or
cationic liposome complexed ASODN(CA/ASODN) for 0.5 to 4
hours, then the cellular associated FITC intensity was
measured by fluorimetry. Data represents mean ± standard
error(n=3) P<0.05(*).

59
Figure 3-4 summarizes the results of the cellular-
associated fluorescence intensities associated with FITC-
labeled ASODN uptake for a range of concentrations using each
delivery mechanism. These data demonstrate that the amount of
ASODN within the cells increased with each concentration. The
amount of cellular ASODN accumulated was greater(P<0.05) with
the PC:cholesterol liposome ASODN encapsulation delivery
system compared to that observed with the naked ASODN at all
the measured ASODN concentrations. However, this accumulation
was most profound with the cationic lipid delivery. With
cationic lipid delivery, the accumulation of ASODN was nearly
linear at low concentrations; however, the amount of ASODN
taken up did not increase substantially at concentrations
greater than 1 pM. Also, the 4-hour treatment with lpM
concentration depicted in Figure 3-3 demonstrated results
similar to those observed with the 1 pM concentration in Fig
3-4, signifying the reproducibility of the system.
Four hours after treatment, the cellular uptake and
distribution of FITC-labeled ASODN was observed with confocal
microscopy. Figure 3-5A shows a weak intracellular background
fluorescence of untreated cells. Figure 3-5B shows the
distribution of naked FITC-labeled ASODN. Although some
intense fluorescence is observed within the cells, there
appears to be a large proportion of fluorescence localized at
the cell membrane surrounding the individual cells. Figure 3-
5C shows cells treated with PC:cholesterol-encapsulated FITC-

60
ASODN Concentrations(uM)
Figure 3-4. Dose-dependent cellular uptake of FITC-labeled
ASODN. Hepatoma cells were incubated with 1 (J.M of ASODN, PC
cholesterol liposome-encapsulated ASODN(PC/ASODN), and
cationic liposome-complexed ASODN(CA/ASODN) at ASODN doses
from 100 nm to 5 faM for 4 hours. The cellular associated
FITC intensity was then measured by fluorimetry. Data
represents mean ± standard error (n=3) P<0.05(*) .

61
Figure 3-5. Cellular uptake and intracellular distribution
of FITC-labeled ASODN observed by confocal microscopy.
Hepatoma cells were grown on microslides then incubated with
1 pM ASODN, PC cholesterol liposome encapsulated ASODN
(PC/ASODN), or cationic liposome complexed ASODN(CA/ASODN)
for 4 hours. The cells were then fixed and the images were
observed by confocal microscopy; A. control; B. cells
treated with ASODN; D. cells treated with PC/ASODN; D. cells
treated with CA/ASODN (n=3).

62
labeled ASODN. Most of these cells appear to have a fairly
even intracellular distribution of ASODN, with very little of
ASODN remaining outside the cell. The fluorescence was
stronger within these cells compared to that observed after
naked ASODN treatment. In some cells there was an
accumulation of fluorescence in localized cellular areas,
which may indicate nuclear accumulation. Finally, Figure 3-5D
shows a more intense localized fluorescence observed in cells
treated with cationic liposome-complexed, FITC-labeled ASODN.
The fluorescence within these cells was the strongest
compared to all other treatments and appeared to be mainly
localized within the cell nucleus.
Figure 3-6a demonstrates the AGT and control cathepsin D
mRNA bands after various treatments measured by the Northern
blot analysis. Figure 3-6b displays the density ratio of AGT
to cathepsin D mRNA. In cell culture, the amount of AGT mRNA
was shown to be decreased 75% after treatment with the
cationic liposome-complexed ASODN, compared with a 30%
decrease after naked ODN treatment. The control scrambled ODN
and cationic lipid had no effect on mRNA expression and was
similar to the untreated control. AGT protein production was
attenuated similarly, and a more pronounced decrease was
observed in those samples treated with cationic liposome-
complexed ASODN (Figure 3-7). In untreated control cells the
baseline AGT level was 52.0±2.46 ng/ml. There was no
significant decrease in AGT production from baseline levels
in the lipid and complexed scrambled control groups, which

63
a.
CTRL PC CA ASODN PC/AS CA/AS
AGT
Cathepsin «M I <-2.1 kb
b.
120
c
o
O
80
o
60
0
Figure 3-6. Effect of liposome-associated ASODN on AGT mRNA
expression in hepatoma cell culture. Cells were incubated
with 1 (iM of ASODN, PC/cholesterol liposome-encapsulated
ASODN(PC/ASODN), cationic liposome-complexed ASODN (CA/
ASODN), PC/cholesterol liposome encapsulated scrambled
ODN(PC/ScrODN) or cationic liposome complexed scrambled
ODN(CA/ScrODN) for 24 hours. AGT mRNA was measured by
Northern blot analysis: a. the result of Northern blot
hybridization for AGT (1.9 kb) and the control gene
cathepsin D(2.1 kb); b. the density ratio of AGT to
cathepsin.

64
Figure 3-7. Effect of liposome-associated ASODN on AGT
protein expression in hepatoma cell culture. Cells were
incubated with 1 jaM of ASODN, PC/cholesterol liposome
encapsulated ASODN(PC/ASODN), cationic liposome complexed
ASODN(CA/ASODN), PC/cholesterol liposome encapsulated
scrambled ODN(PC/ScrODN) or cationic liposome complexed
scrambled ODN(CA/ScrODN) for 24 hours. AGT protein levels
were measured by radioimmunoassay. Data represents the mean
± standard error (n=3) P<0.05(*).

65
were 45.53+5.9, and 47.03+6.9 ng/ml, (n=3), respectively. In
cells treated with naked ASODN, PC/ASODN and cationic
liposome complexed ASODN, AGT levels were significantly
(P<0.05) decreased from baseline levels: 30.2+3.0, 22.1+2.7,
5.61+0.95 ng/ml, respectively.
The dose response effect of CA/ASODN treatment demons¬
trates that AGT mRNA was reduced at an ASODN concentration of
100 nM. Northern blot analysis revealed that at both 100 and
500 nM concentrations of ASODN, there was a 40% reduction in
AGT mRNA. At a higher concentration of 1 pM, a 70% decrease
in AGT mRNA was observed(Figure 3-8). The decrease in AGT
protein(Figure 3-9) at an ASODN concentration of 50 nM was
40.29+4.0 ng/ml compared to the 51.77+3.7 ng/ml observed in
the control samples. At 0.1, 0.5 and 1 pM ASODN, AGT protein
levels were significantly (P<0.05) decreased from the
baseline in a dose dependent manner, with AGT concentrations
of 26.68+5.3; 23.27+6.1; 5.67+0.3 ng/ml, respectively.
Cationic liposomes alone had no effect on AGT protein or mRNA
levels.
ASODN cytotoxicity was determined over the concentration
ranges of 0.1 to 10 pM. The toxicity of the CA/ASODN
complexes and the cationic lipids used to complex the ASODN
also was determined. Figure 3-10 demonstrates that 89% of the
cells survived at a naked ASODN concentration of 10 pM, while

66
a.
Cationic Liposome CA/ASODN
0.01 0.05 0.1 0.5 1.0 0.01 0.05 0.1 0.5 1.0 (uM)
<—AGT (1.9 kb)
^-cathepsin D (2.1 kb)
b.
Figure 3-8. Dose-dependent effects of CA/ASODN on AGT mRNA
in hepatoma cell culture. Cells were incubated with CA/ASODN
at doses from 10 nM to 1 pM for 24 hours. AGT mRNA was
measured by Northern blot analysis: a. the result of
Northern blot hybridization for AGT(1.9 kb) and the control
gene cathepsin D(2.1 kb); b. the relative intensity of AGT
gene expression compared with control(n=3)(*)P<0.05.

67
Figure 3-9. Dose-dependent effects of CA/ASODN on AGT
protein expression in hepatoma cell culture. Cells were
incubated with CA/ASODN at doses from 10 nM to 1 |_iM for 24
hours. AGT protein levels were measured by radioimmunoassay.
Data represents mean ± standard error (n=3) P<0.05(*).

68
Figure 3-10. In vitro cytotoxicity of CA/ASOSN, ASODN and
cationic lipids measured by MTT test. Hepatoma cells were
treated with ASODN, cationic lipids(CA), or cationic
liposome complexed ASODN(CA/ASODN) at ASODN concentrations
from 100 nM to 10 (J.M for 48 hours, then cell viability was
measured by MTT test. Data represents mean ± standard error
(n=3)P<0.05(*).

69
at lower concentrations no obvious toxic effect was observed
The ASODN lipid complex showed a similar cytotoxic effect at
ASODN concentrations up to 0.5|iM. Toxicity appeared to
increase as ASODN concentration increased. At an ASODN
concentration of 10 (J.M the complex caused approximately 70%
of the cells to die. The cationic lipids seemed less toxic
than the complex. At an ASODN concentration of 0.5 |J,M, the
toxic effect was similar to that of CA/ASODN. However, at a
concentration of 10 ¡J.M, 50% of the cells survived. The
toxicity of the CA/ASODN complexes at 1.0 |iM concentrations
was seen to be similar to the toxicity of naked ASODN at the
10 |iM concentration in the Hepatoma cell culture.
Discus sion
Successful attenuation of the target protein has been
achieved using antisense technology in a wide range of
biological systems[70-72]. However, the development of
antisense therapy has not been as smooth as once anticipated
Problems have been encountered in the delivery of the
molecules to target sites, with general uptake efficiency of
naked ASODN being as low as 2%[140]. The cationic liposomes
used in this study were shown to improve the cellular uptake
of ASODN in hepatoma cell culture. The composition of the
lipids and the charge ratio of cationic lipid to ASODN
appeared to be critical factors for successful transfection

70
(Figure 3-1,3-2). The uptake of the ASODN dramatically
changed under different lipid to ASODN charge ratios. This is
probably due to such factors as aggregation of the cationic
lipids with the ASODN, the size of the complex particle and
the overall charge of the ASODN-lipid complexes at different
charge ratios. The uptake of ASODN is relatively higher when
the complex has a net positive charge than when the complex
has an overall net negative charge. The net positive charge
may provide stronger forces of interaction between the
complex and the negatively charged cell membrane. Inclusion
of DOPE in the liposome appears to be essential for efficient
delivery due to its fusogenic function[101,132].
Results from the scanning confocal microscope (Figure 3-5)
demonstrated FITC labeled ASODN is distributed intracellu-
larly. The presence of fluorescence in the cytoplasm in a
punctuated manner is considered to be consistent with
distribution within endocytic vesicles, suggesting that
cellular uptake of ASODN may be via an endocytotic process.
In cells treated with cationic liposome-complexed ASODN, the
fluorescence signal seemed diffuse in the cytoplasm and in
the nucleus, suggesting that cationic liposomes may function
to facilitate the release of ASODN from the endosomal
vesicles. The extent of the endocytotic processes on the
uptake of ASODN has been studied using different inhibitors
of endocytosis. Agents that increase lysosomal pH, such as
chloroquine and NH4C1, did not prevent accumulation of ASODN
within the nucleus or block ASODN activity[141]. These

71
observations suggest the participation of endosomal
acidification in the release of ODN from the endosóme into
the cytoplasm.
The cationic liposomes also were shown to increase the
rate and the amount of ASODN accumulation by cells (Figure 3-
3,3-4). At the beginning of the incubation, CA/ASODN
displayed a higher association with the cells than either the
naked ASODN or the PC/ASODN. It has been suggested that the
initial stage of CA/ASODN interaction with cells induces
adsorption of the positively charged CA/ASODN complexes to
the negatively charged phospholipids of the cell membrane.
The charge-induced interaction may account for the enhanced
cellular association of CA/ASODN, compared with the PC/ASODN
and naked ASODNs. The results from the time and dose-
dependent uptake curves suggest that ASODN uptake may be a
saturable process. ASODN uptake reached a plateau at the
four-hour time point at a 1 uM concentration.
Subsequent studies evaluated the effect of ASODN on AGT
gene expression. The results demonstrate that CA/ASODN
decreases AGT mRNA and protein in Hepatoma cell culture. The
possible mechanisms for ASODN inhibition of gene expression
may be explained as ASODN functioning as a "road blocker" to
ribosome assembly thus impeding the binding of translation
factors or acting to block translocation of ribosome on the
mRNA. The involvement of RNase H, which hydrolyses the RNA
part of RNA/DNA hybrids, may also be a possible mechanism.
RNase H is a ubiquitous enzyme, with varying activity among

72
different cell types[75]. The binding of ASODN to targeted
mRNA may activate RNase H, which then degrades the RNA
portion of an RNA-DNA duplex, and subsequently blocks gene
expression. The RNase H mechanism is supported by the fact
that failed translation blockage was observed in rabbit
reticulocyte lysate which contains low to no RNase H
activity[142]. The role of RNase H also is demonstrated by
using an ASODN that is known to not activate RNase. The
oligonucleotides such as methyl phosphonate and a-oligomers
targeted to the coding region of the rabbit [3-globin mRNA did
not affect P-globin synthesis in wheat germ extract nor
Xenopus oocytes[143].
These results also demonstrated that the effects of ASODN
on the expression of AGT mRNA and protein levels was
significantly enhanced by cationic liposomes, probably due to
increased cellular and nuclear delivery of ASODN into the
cells. Cationic liposomes also may protect the ASODN from
enzyme degradation in the culture medium. The reported half-
life of phosphorothioated ASODN in the cell culture medium
RPMI 1640, with 10% fetal bovine serum, undiluted fetal
bovine serum or rat cerebrospinal fluid is 14±2 hour, 8±1
hours and 19+7 hours, respectively [144] . Cationic liposome
complexation also has been shown to increase the stability of
ASODN in cell culture[145].
The cytotoxic effect of the cationic liposome ASODN
complexes appears higher than either the ASODN molecules or

73
the cationic lipids alone (Figure 3-10). The toxic effects of
cationic lipid are attributed to their surfactant like
properties which cause solublization and poration of the cell
membrane with subsequent damage to the cell integrity at
higher concentrations[139]. The higher toxicity of CA/ASODN
complexes may be a result of the non-specific effects of
ASODN. Cationic liposomes resulted in increased intracellular
delivery of ASODN. At high concentrations, ASODN may bind to
non-targeted sequences and cause degradation of proteins,
which may be essential for cell viability. This result was
consistent with the previous in vitro transcription/
translation experiments, which showed that the scrambled ODNs
also decreased the expression of AGT mRNA at ASODN
concentrations higher than 3jj.M[68] . The naked ASODN showed
minimal cytotoxicity, probably due to its short half-life in
the culture medium. Cationic liposome complexation improves
its stability, but also increases its toxic effect. However,
when used at doses of 1 j_iM or less, toxic effects are
minimized, and are equivalent to the toxicity produced by 10
times the concentration of ASODN alone.
To summarize, these results support the following
conclusions. Cationic liposomes consisting of DDAB and DOPE
increase the cellular delivery of ASODN, compared with
previously used PC-cholesterol liposomes in hepatoma cell
culture. Cationic liposome-complexed ASODN targeted to AGT
mRNA decreased AGT mRNA and protein in cell culture in a dose

74
dependent manner. The CA/ASODN complex appeared to have a
higher toxicity than either the cationic lipids or the ASODN
alone, possibly due to the non-specific effects of high
intracellular concentrations of ASODN.

CHAPTER 4
THE EFFECT OF ROUTE OF ADMINISTRATION OF CA/ASODN ON BLOOD
PRESSURE AND TISSUE DISTRIBUTION OF ASODN IN SHR:
IMPLICATIONS OF THE ROLE OF TISSUE RAS ON BLOOD PRESSURE
REGULATION
Specific Aims
The specific aim of this part of the research was to
develop a mechanism for targeted antisense oligonucleotide
delivery to the liver using liposome technology and to
determine ASODN tissue distribution after intraarterial and
intravenous administration in SHR model and its subsequent
effects on hypertension.
Introduction
The previous in vitro studies demonstrated that cationic
liposomes composed of DDAB and DOPE are more effective in
delivering ASODN than PC-cholesterol liposomes in hepatoma
cell culture. The previous in vivo studies showed that PC-
cholesterol encapsulated ASODN successfully decreased blood
pressure when administered both centrally and intra¬
arterially in the SHR model of hypertension[65,68]. However,
in vivo data was inconclusive when ASODN was administered
intra-venously, despite the success of ASODN mediated gene
75

76
inhibition. Tissue and cellular ASODN delivery of ASODN
remain the major obstacles for intended ASODN activity[77].
Optimization of the ASODN delivery system and route of
administration have been considered the most important
aspects of improving the intended biological effect of
ASODN.
The role of angiotensinogen in the pathogenesis of
hypertension has been supported by genetic studies[37-39].
AGT is expressed and constitutively secreted by hepatocytes.
Successful delivery of ASODN to target cells should lead to
suppression of AGT mRNA expression, resulting in decreased
activity of the RAS and subsequent attenuation of
hypertension. Delivery of macromolecules such as oligo¬
nucleotides to their target sites in vivo requires
successful trans-endothelial migration and. target cell endo-
cytosis[146]. Strategies for liver(tissue)-specific target¬
ing are divided into passive and active targeting. Passive
targeting refers to the utilization of the natural
disposition profiles of a drug carrier, which is determined
by the physiochemical properties of the chemicals relative
to the anatomical and physiological characteristics of the
body. Delivery of macromolecules to the liver reticuloendo¬
thelial system, which lacks basement membrane on the
endothelial cells and allows molecules 100 nm or less in
diameter to permeate through, is an example of this. Active
targeting refers to the alterations of the natural
disposition of a drug carrier in order to direct it to

77
specific cells, tissues, or organs. Ligands, or monoclonal
antibodies, which can bind specifically to the surface of
target cells are used for this purpose [147] . In the case of
hepatic targeting, antibodies targeted to asialoglycoprotein
receptors, which are uniquely expressed by the liver, have
been used to improve liver targeting[148,149].
In this study, we utilized a cationic liposome approach
to enhance ASODN delivery to the liver target. Small
liposomes with a diameter of less than 100 nm are known to
be naturally and rapidly cleared by the liver reticuloendo¬
thelial system after injection[96]. Compared with previously
used PC-cholesterol liposomes, positively charged cationic
lipids may facilitate the adsorption of liposome/ASODN
complex to the negatively charged cell surface and
subsequently increase the cellular delivery of ASODN
molecules. Incorporating the pH-sensitive fusogenic lipid
DOPE also may facilitate target cell endocytosis of
ASODN[150,151].
The renin-angiotensin system(RAS) has long been known as
a circulating endocrine system that regulates blood pressure
and fluid and electrolyte balance via its effector peptide
angiotensin II [8] . The colocalization of renin, ACE, and
angiotensin II receptor messenger RNA in tissues such as the
kidney, heart, and brain suggest the existence of local
RASs, which may play a functional role in blood pressure
regulation [11-14]. Unlike the hormonal RAS, which regulates
blood pressure by a closed-loop negative feedback mechanism,

78
the local RAS is thought to function in a paracrine-
autocrine manner. Angiotensin II produced by synthesizing
cells can act on receptors of the neighboring cells
(paracrine), or act on the receptors of the cells where it
was synthesized (autocrine) to regulate such functions as
smooth muscle cell contraction or release of endothelium
derived relaxing factors [17-19] .
The involvement of the tissue RAS in blood pressure
regulation was first suggested by the effect of anti¬
hypertensive drugs. ACE and renin inhibitors with different
physicochemical properties, and thus different tissue
penetration profiles, showed different antihypertensive
effects [11] . The antihypertensive effects of ACE inhibitors
and their duration are more consistent with the inhibition
of ACE activity in the kidney and aorta rather than the
plasma [152]. Renin inhibitors also appear to lower blood
pressure in a fashion dissociated from their effect on
plasma renin[153].
An intrarenal RAS has also been proposed as individual
components of the RAS were detected in the renal cortex
[154]. At a local level, angiotensin II influences
glomerular micro-circulation, causing reductions in plasma
flow rate; the ultrafiltration coefficient; and increases in
the hydrostatic pressure difference and renal arteriolar
resistance.
The SHR essential hypertension animal model is inbred
from the normotensive strain of WKY rat [61] . Abnormal RAS

79
activity resulting from genetic selection is believed to be
responsible for the high blood pressure in SHRs[155]. In
this study, we determined the effect of ASODN on blood
pressure 24 hours after injection in both SHR and WKY
strains, to investigate the role of the RAS in hypertension.
In previous studies, we measured the effect of blood
pressure changes after intra-arterial(IA) and intravenous
(IV) administration of ASODN in SHR. It appeared that ASODN
caused more pronounced decreases in blood pressure after IA
injection of ASODN than after IV injection. The discrepancy
between blood pressure changes could result from tissue
specific effects as a consequence of different tissue
distribution of ASODN after IA and IV injection. In this
study, the effects of intraarterial and intravenous
administered ASODN on blood pressure, tissue distribution of
ASODN, plasma and tissue angiotensinogen levels, were
measured.
Material and Methods
To determine the mean arterial pressure (MAP) changes in
SHR and WKY rats after intraarterial and intravenous
injection of cationic liposome complexed ASODN, groups of
rats (250-275 g, n=6), a catheter was implanted in the
carotid artery and for intravenous studies, the femoral
vein. Rats were allowed to recover for 24 hours after
surgery, then baseline mean arterial blood pressure was
determined using direct blood pressure measurement. A
catheter was inserted into the external carotid artery and

80
connected to a pressure transducer that was interfaced with
a Digi-Med BP Analyzer(micro-Med, Indianapolis,Ind). Signals
were recorded on a Gould TA2405 EasyGraf Physiograph, which
provides information on systolic, diastolic, and mean
arterial pressure and heart rate. Following baseline
pressure measurements, 50 pg doses of either cationic
liposome complexed ASODN, scrambled ODN, uncomplexed ASODN
or cationic lipid were injected either IA via the carotid
catheters or IV via the femoral catheters. Twenty-four
hours after injection, mean arterial pressure was measured
using the same method.
The tissue distribution of FITC conjugated ASODN and
cationic liposome complexed FITC-ASODN after intravenous and
intraarterial administration was then determined. Groups of
Sprague Dawley rats(n=9) were injected with 100 pg FITC-
ASODN and FITC-CA/ASODN via the carotid artery or femoral
vein. One, 8, and 24 hours later, three of the injected rats
were perfused with saline and then decapitated. Liver,
kidney, heart, lung, brain, and plasma were collected.
Tissues were then homogenized in Triton 100 and the
associated fluorescence intensity was measured using
fluorimetric analysis.
We also measured plasma AGT and Ang II levels after
intraarterial and intravenous administration of ASODN. 50 pg
of cationic liposome complexed ASODN was injected via the
carotid artery or femoral vein of SHR(n=3). After 24 hours,
animals were decapitated and plasma samples were collected.

81
Plasma AGT and Ang II(RK-A22, Alpco, Windham, NH) were
measured using radioimmunoassay[124].
In order to determine the effects of ASODN on tissue AGT
expression, 50 \xg doses of either cationic liposome
complexed ASODN, scrambled ODN, uncomplexed ASODN or
cationic lipid were injected either IA or IV in SHRs(n=3).
After 24 hours, rats were sacrificed and liver, kidney, and
heart were collected. Total mRNA was extracted and AGT and
Cathepsin D mRNA levels were measured by Northern blot
analysis[122,123]. The house-keeping gene cathepsin D was
used as a control to ensure equal loading of RNA.
Results
Figure 4-1 demonstrates the change in mean arterial
pressure 24 hours after intraarterial injection of either
CA/ASODN, CA/ScrODN, uncomplexed ASODN, or cationic lipids.
A significant (P<0.05) decrease in MAP, 23±5 mmHg from
baseline, was observed in SHR treated with CA/ASODN. A less
marked but significant(P<0.05) decrease in blood pressure,
15±4 mmHg from baseline level, was observed in SHRs treated
with uncomplexed ASODN. Blood pressure were unchanged in
animals treated with either CA/ScrODN or cationic lipids
(Figure 4-1). ASODNs administered by the intravenous route
produced a significant but smaller decrease in blood
pressure: 7+2 mmHg and 4±1 mmHg(P<0.05) from baseline after
either CA/ASODN or ASODN treatment, respectively (Figure 4-
2). No significant changes in blood pressure were observed

5
Figure 4-1. Mean arterial pressure changes from baseline 24
hours after intra-arterial injection of CA/ASODN in SHR. 50
(0,g cationic liposome-complexed ASODN (CA/ASODN) , ASODN,
cationic lipids (CA), and cationic liposome-complexed
scrambled ODN (CA/ScrCDN) were used. Blood pressure was
measured by direct method. Data represent mean ± standard
error (n=6). P<0.05(*).

83
Figure 4-2. Mean arterial pressure changes from baseline 24
hours after intravenous injection of CA/ASODN in SHR. 50 fig
cationic liposome-complexed ASODN(CA/ASODN), ASODN, cationic
lipids(CA), and cationic liposome-complexed scrambled
ODN(ScrODN) were used. Blood pressure was measured by direct
method. Data represents mean ± standard error(n=6).
P<0.05 (*) .

84
after CA/ScrODN or cationic lipid treatment. Similar
experiments also were conducted in control WKY rats and no
significant blood pressure changes from baseline level, 132±
8 mmHg, were observed after IA or IV injection of ASODNs or
controls.
To determine the mechanism of the observed differences in
blood pressure reductions after IA and IV injection, tissue
distribution of FITC labeled ASODN after IA and IV injection
was determined. Figures 4-3, 4-4, and 4-5 summarize the
measured tissue associated FITC intensity for each injected
dose at 1, 8, and 24 hours. Figure 4-3 demonstrates that at
the 1 hour time point, 30% of the injected complexed ASODN
accumulated in the liver after IA injection, compared with
25% accumulation in the liver after IV injection. Cationic
liposome complexation increased ASODN accumulation in the
liver, lung, and heart by approximately 100%. As expected, a
higher accumulation of CA/ASODN was seen in the lung after
IV injection than after IA injection. At the 8 hour time
point, a similar ASODN distribution was observed with either
route of administration(Figure 4-4). At the 24-hour time
point, a similar degree of CA/ASODN accumulation was
observed in the liver after IA and IV injection. However,
in the kidney, there was a greater accumulation of CA/ASODN
after IA injection than after IV injection. With time the
brain appeared to have greater level of accumulation.
Plasma AGT levels of SHR, 24 hours after IA injection of
cationic lipids, CA/ScrODN, CA/ASODN, or ASODN, were 117±15

85
LV KN HT BR LU PL
Figure 4-3. Tissue distribution of ASODN and CA/ASODN in 1
hour after IA or IV injection. The FITC intensity were
measured in liver(LV), heart(HT), kidney(KN), lung(LU),
brain(BR), and plasma(PL) in Sprague Dawley rats. Figure
demonstrates the FITC intensity measured by fluorimetry as a
percentage of the injected dose. Data represent mean ±
standard error(n=3). P<0.05(*).

86
O)
CD
<=
0
O
0
CL
0
CO
O
Q
LV KN HT BR LU PL
Figure 4-4. Tissue distribution of ASODN and CA/'ASODN in 8
hour after IA or IV injection. The FITC intensity were
measured in liver(LV), heart(HT), kidney(KN), lung(LU),
brain(BR), and plasma(PL) in Sprague Dawley rats. Figure
demonstrates the FITC intensity measured by fluorimetry as a
percentage of the injected dose. Data represent mean ±
standard error(n=3). P<0.05(*).

87
LV KN HT BR LU PL
Figure 4-5. Tissue distribution of ASODN and CA/ASODN in 24
hour after IA or IV injection. The FITC intensity were
measured in liver(LV), heart(HT), kidney(KN), lung(LU),
brain(BR), and plasma(PL) in Sprague Dawley rats. Figure
demonstrates the FITC intensity measured by fluorimetry as a
percentage of the injected dose. Data represent mean ±
standard error(n=3). P<0.05(*).

88
V7A CA/ScrODN
ASODN
E553 CA/ASODN
Intraarterial
Intravenous
Figure 4-6. Plasma AGT levels 24 hours after IA and IV
injection of ASODN with liposomes in SHR. Angiotensinogen
was measured by radioimmunoassay. Data represents mean ±
standard error (n=3). P<0.05(*).

89
ng/ml, 119±10 ng/ml, 46+10 ng/ml, and 69+12 ng/ml,
respectively. After IV injection, the levels were 120+14
ng/ml, 128+14 ng/ml, 58+9 ng/ml, and 71+7 ng/ml,
respectively (Figure 4-6). The plasma levels of AGT
decreased significantly(P<0.05) after either CA/ASODN or
ASODN treatment, compared with CA/ScrODN or cationic lipid
treatment. However, no significant difference of AGT levels
between IA or IV injection of either CA/ASODN or ASODN was
observed.
Similar reductions of plasma angiotensin II levels were
also observed. Figure 4-7 summarizes the effect of CA/ASODN
treatment on plasma angiotensin II levels in SHR. Ang II
levels were 208+26 ng/ml, 226+16 ng/ml, 81+8 ng/ml, and 160+
9 ng/ml after IA injection of cationic lipids, CA/ScrODN,
CA/ASODN, or ASODN, respectively. After IV administration,
the levels were 212+18 ng/ml, 209+9 ng/ml, 94+10 ng/ml, and
172+12 ng/ml, respectively. The Ang II levels after either
CA/ASODN or ASODN treatment were significantly (P<0.05)
lower compared with that after ScrODN and CA treatment. The
difference between angiotensin II levels after IA and IV
injection was not statistically significant.
We also measured AGT mRNA levels in the heart, kidney and
liver after IA and IV injection of ASODNs using Northern
blot analysis. In the kidney, AGT mRNA decreased
approximately 50% 24 hours after IA ASODN administration,
compared with a 20-30% decrease observed after IV injection

90
Figure 4-7. Plasma angiotensin II levels 24 hours after IA
or IV injection of ASODN with liposomes in SHR. Angiotensin
II was measured by radioimmunoassay. Data represents mean ±
standard error (n=3). P<0.05(*).

91
0
>
0
SZ
c
<
Z
cr
E
I—
o
<
e
o
o
120
100
80
60
40
20
0
Figure 4-8. Liver AGT mRNA levels in SHR 24 hours after IA
or IV injection of ASODN with liposomes. 50 ug of cationic
liposome-complexed ASODN (CA/ASODN), cationic liposome-
complexed ScrODN (CA/ScrODN), cationic lipids(CA) or ASODN
were used: a. the Northern blot analysis of AGT(1.9 kb) and
control cathepsin D(2.1 kb); b. the relative values of AGT
mRNA compared with control(n=3). P<0.05(*).

92
a.
AGT (1.9 kb)->
cathepsin D (2.1 kb)->
z
z
z
z
Q
Q
Q
Q
O
O
z
O
z
O
o
o
Q
CO
Q
CO
<
CO
<
<
CO
o
CO
<
O
CO
$
o
o
o
O
<
o
<
o
>
<
<
>
>
>
<
>
b.
qK 0/K ¿\sq /x\.a M. q
Figure 4-9. Heart AGT mRNA levels in SHR 24 hours after IA
or IV injection of ASODN with liposome. 50 pg of cationic
liposome-complexed ASODN (CA/ASODN), cationic liposome-
complexed ScrODN (CA/ScrODN), cationic lipids(CA), or ASODN
were used: a. the Northern blot analysis of AGT(1.9 kb) and
control cathepsin D(2.1 kb); b. the relative values of AGT
mRNA compared with control(n=3) . P<0.05(*) .

93
a.
z
z
z
z
o
Q
Q
Q
O
O
O
z
O
O
o
CO
Q
CO
CO
CO
<
o
<
<
<
<
CO
<
o
o
o
O
o
<
o
<
<
>
>
<
<
>
O
o
CO
<
>
AGI (1.9 kb)->
cathepsin D (2.1 kb)->
... , ......... ...
b.
0)
c
-O
CD ^
c.
o
O
0f
E
i—
O
<
120
100
80
60
40
20
0
Hc4c^c4,c4.^'feo0,
C/°%
&A/ %
«V
Figure 4-10. Kidney AGT mRNA levels in SHR 24 hours after IA
or IV injection of of ASODN with liposomes. 50 pg of
cationic liposome-complexed ASODN (CA/ASODN), cationic
liposome-complexed ScrODN (CA/ScrODN), cationic lipids(CA),
or ASODN: a. the Northern blot analysis of AGT (1.9 kb) and
control cathepsin D(2.1 kb); b. the relative values of AGT
mRNA compared with control (n=3). P<0.05(*).

94
(Figure 4-8). In the liver, AGT mRNA decreased similarly
after either IA or IV injection of CA/ASODN, while larger
decreases, 60%, were observed in rats treated with CA/ASODN,
compared with 40% decreases after treated with ASODN alone
at the 24 hour time point (Figure 4-9). In the heart, AGT
mRNA decreased more after IA than after IV injection of
either CA/ASODN or ASODN alone. Decreases in AGT mRNA after
intraarterial CA/ASODN, ASODN and intravenous CA/ASODN
treatment were 60%, 30%, 20%, respectively. No significant
changes in AGT mRNA was observed after IV ASODN
treatment(Figure 4-10) .
Dis.-c:ass±Q.n
A significant decrease in blood pressure was observed 24
hours after both intraarterial and intravenous injection of
cationic liposome-complexed ASODN(50 ug dose) targeted to
AGT mRNA in the SHR. The decrease in blood pressure after IA
injection was consistent with previous results [68] . Although
it is generally considered that in the renin-angiotensin
enzymatic cascade, that renin is the rate-limiting factor
which determines the amount of AGT being converted to
angiotensin II, while AGT is constitutively released from
the hepatocytes and is always present in extra amounts for
the renin reaction [38] . The results of these studies showed
that inhibition of the AGT gene expression in vivo decreases
blood pressure effectively, which may provide a novel
therapeutic choice for treating hypertension. Our results

95
also imply that AGT may be involved in the pathogenesis of
hypertension.
The difference in magnitude of blood pressure decreases
after IA and IV administration might be attributed to the
difference in tissue distribution of ASODN, resulting from
different routes of administration, and subsequently leads
to specific tissue-mediated effects. Compared with IA
administration after IV injection, a larger part of the
CA/ASODN particles are sequestered by the lungs when the
circulation presents them to this organ. The accumulation of
ASODN by other tissues, such as kidney and heart, may
subsequently decrease due to the lowered ASODN concentration
in the circulation as the ASODN is sequestered by the
pulmonary system. The tissue distribution of ASODN 24 hours
after injection showed a. higher ASODN accumulation occurred
in the lung after IV than after IA injection, while greater
accumulation of ASODN occurred in the kidney after IA than
after IV injection. The accumulation in the liver was
slightly higher after IA than after IV injection (Figure 4-
5). The difference in tissue distribution after IA and IV
injection suggests that a tissue or organ effect, such as a
renal effect, might be involved in the observed blood
pressure decreases.
This study also showed that for both intraarterial and
intravenous administration, blood pressure decreases were
more pronounced after treatment with cationic liposome-
complexed ASODN compared with that after the uncomplexed

96
ASODN treatment. This is in agreement with the hypothesis,
which proposes that cationic liposome enhances the
antihypertensive effect of ASODN. These observations are
also consistent with the in vitro studies, which suggest
that cationic liposomes enhance the cellular delivery of
ASODN and subsequently potentiates the inhibitory effects of
ASODN on AGT mRNA and protein production in cell culture.
Previous studies showed inconclusive results in blood
pressure changes after IV injection of PC/cholesterol
liposome encapsulated ASODN. A significant decrease in blood
pressure was observed after IV injection of cationic
liposome-complexed ASODN, suggesting cationic liposome is
more efficient in delivery ASODN than PC/cholesterol
liposome.
The tissue distribution studies demonstrated that
cationic liposome delivery increased specific tissue
accumulation of ASODN, which may be a contributing factor
leading to an increased inhibitory effect on blood pressure.
One and 8 hours after IA administration, the liver had the
highest accumulation of ASODN. About 30% of the injected
cationic liposome complexed FITC-ASODN was shown to be
present in the liver, probably due to the anatomical
features of the reticuloendothelial system. After IV
administration, more ASODN was seen to accumulate in the
lungs, as expected. The accumulation in other organs, such
as brain and heart, is minimal due to the continuous
capillary endothelium present in the blood brain barrier and

97
in the heart muscle. At the 1 and 8 hour time point, the
accumulation of ASODN in the kidney appears higher than that
after CA/ASODN, probably because ASODNs were cleared by the
liver faster than the CA/ASODN, which was larger and held in
the liver tissues for a longer period of time. Twenty-four
hours after injection, it appeared that the accumulation of
CA/ASODN in the kidney is higher than after the naked ASODN.
This could be a result of slow clearance of CA/ASODN from
the RES compared to ASODN. The ASODN also were subjected to
metabolism in vivo. The high intensity of fluorescent signal
in the kidney 24 hours after injection might be a result of
time-dependent elimination by the kidney. This could also be
a possible reason for the lack of differences in
accumulation between ASODN and CA/ASODN at 24 hours yet not
the case at 1 and 8 hours.
Hepatic uptake and urinary excretion are the two major
routes for the clearance of macromolecules, such as
ASODN[147]. The distribution of macromolecules is basically
restricted to the intravascular space immediately after
injection, due to low capillary permeability in most organs.
The ASODN distribution profile depends on the basic
structural feature of capillaries which represent the major
barrier between the circulation and the tissue cells and are
diverse in porosity among organs [157] . The route that the
molecules take to circulate in the body also determines
their immediate disposition. Three types of capillary
endothelium present in different tissues. Continuous

98
capillary, the most widely distributed, is found in cardiac
muscle and constitutes the blood brain barrier. The
transport pathway for molecules in this capillary is via
small pores with estimated sizes of 6.7-8.0 nm and large
pores of 20-28 nm. The fenestrated capillaries present in
the intestinal mucosa and the glomerular and peritubular
capillaries of the kidney, have openings with diameters of
40-60 nm. Discontinuous capillaries, which are found almost
exclusively in liver, spleen and bone marrow, are charac¬
terized by the absence of a basement membrane and the
presence of large endothelial gaps with diameters ranging
between 100 to 1000 nm. The anatomical feature of the liver
sinusoids allows macromolecules with sizes of 50-200 nm to
pass out of the vascular space into the surrounding tissue
easily[157].
For both IA and IV injection, hepatic uptake at the 1 and
8 hour time points is substantially higher due to the
structure of the discontinuous endothelium of the liver,
which brings the circulating molecules into free contact
with the surface of the parenchymal cells. In the kidney,
the glomerular capillary wall functions as a size and charge
selective barrier. Macromolecules with a molecular weight of
less than 50000, approximately 6 nm in diameter, are
susceptible to glomerular filtration and are excreted into
the urine easily. Larger molecules tend to have a higher
renal accumulation due to both tubular reabsorption and
uptake from the peritubular capillary side[147]. Little has

99
been reported on the effect of charge on the renal
accumulation of ASODN. As shown in this study, at 1 and 8
hours after injection the ASODN seems to have a higher
accumulation in the kidney than the complexed ASODN, while
at 24 hours the higher distribution of complexed ASODN might
be due to a time-dependent clearance.
In theory, antisense oligonucleotide blocks gene
expression by activating RNase H with the subsequent
degradation of the mRNA portion of the mRNA/ASODN hybrid.
Compared with most pharmaceuticals which act on the end
products of the gene expression, the proteins, ASODNs act on
the earlier stage of the gene expression, at the mRNA
level[75], making a more complete and long-lasting
inhibitory effect possible. This in vitro studies showed
that cationic liposome-complexed ASODN decreased AGT protein
expression by 90% in hepatoma cell culture at a 1 |iM
concentration. In the in vivo situation, by optimizing
pharmacokinetic parameters such as dosage and route of
administration, substantial inhibition of the AGT gene
expression also is expected in vivo.
CA/ASODN treatment resulted in a blood pressure decrease
in SHR but not in WKY rats. The same effect was also
observed after giving both strains of rats ACE inhibitors.
The ACE inhibitor captopril caused a dose-dependent decrease
in blood pressure with a maximal decrease of 38 mmHg in SHR,
while no significant decrease in blood pressure was observed

100
in WKY[156]. These results suggest that overactivity of RAS
could be a factor that leads to hypertension in the SHR
strain.
A difference in blood pressure change after IA and IV
injection was observed. However, the plasma AGT and Ang II
level did not show significant differences after IA and IV
administration. This may be explained by the similar
distribution of CA/ASODN in the li.ver 24 hours after both
routes of injection, since the liver is the only organ that
provides the circulating AGT. This is also supported by the
liver AGT mRNA level measured by Northern blot analysis,
which showed a similar decrease of mRNA in the liver after
either IA or IV injection.
The kidney and heart AGT mRNA were shown to be
significantly lower 24 hours after IA than after IV
administration, which might be a consequence of different
ASODN uptake after different route of administration.
Decreases in both the kidney and heart mRNA were greater
after CA/ASODN than after naked ASODN treatment. These
observed differences in AGT mRNA decreases in the kidney and
the heart correlate with the difference in blood pressure
decreases after IA and IV injection. This implies that the
local RAS, possibly the kidney and the heart, might mediate
the observed blood pressure changes. Decreases in AGT mRNA
in local tissues, such as the kidney, may lead to a decrease
in local RAS activity, which subsequently mediates tissue
specific physiological effects on blood pressure.

101
The heart and kidney are two major organs in blood
pressure regulation. Renin enzymatic activity was detected
in the homogenate of whole heart[10]. The presence of both
renin and AGT mRNA in the heart and the kidney was
demonstrated using in situ hybridization. The coexpression
of renin and the AGT gene makes the local de novo synthesis
of angiotensin II possible and suggests the existence of a
functioning local RAS. Angiotensin II, as a vasoactive
hormone, has the effect of acutely increasing cardiac
contractility or long term stimulation of cardiac
hypertrophy. The kidney was the first organ for which a
functioning tissue-specific RAS had been discussed. Co¬
expression of renin, AGT and angiotensin converting enzyme
mRNA in the kidney support the existence of an intrarenal
RAS, which functions to regulate renal sodium absorption and
hemodynamics[154] .
In summary, these results support the following
conclusions: Cationic liposome complexed ASODN against AGT
mRNA decreases blood pressure ’in SHR after IA and IV
injection. Observed decreases in blood pressure were greater
after IA rather than IV injection. The decrease in blood
pressure was consistent with the decrease in AGT mRNA in the
kidney and heart.

CHAPTER 5
DOSE-DEPENDENT PHYSIOLOGICAL EFFECTS OF CATIONIC
LIPOSOME COMPLEXED ASODN IN SHR MODEL
Specific Aims
The specific aim of this part of the project is to study
the dose-response effects of CA/ASODN (low: 10 jag, medium: 50
fig, high: 500 |j.g) on blood pressure, plasma and tissue
angiotensinogen levels and the water intake and urine output
in the SHR model of hypertension in order to determine the
role of kidney in ASODN mediated inhibition of hypertension.
Introduction
Blocking the renin angiotensin system by agents such as
angiotensin converting enzyme inhibitors, renin inhibitors
and angiotensin II receptor antagonists is one of the most
important therapeutic options for treating hypertension[59].
Renin inhibitors have been shown to decrease blood pressure,
angiotensin II and aldosterone levels in a dose-dependent
manner[161,162]. A study conducted on essential hypertension
in human subjects showed that the renin inhibitor, FK906, at
doses of 25 mg, 50 mg, and 100 mg decreased blood pressures
from a baseline level of 169+3/97±l mmHg, to 153±5/87±3, 142
±5/78±3 and 137±10/77+8 mmHg, respectively. The hypotensive
102

103
effects of FK906 did not correlate with baseline plasma
renin activity, suggesting that the suppression of the non¬
circulating tissue renin-angiotensin system may account for
the hypotensive effect[163]. Studies with another renin
inhibitor, Remikiren, showed it decreased blood pressure in
essential hypertension patients with concomitant increases
in renal blood flow and sodium excretion[164]. An
angiotensin II type I receptor antagonist, Losartan also has
been shown to induce a dose-dependent inhibition of the
pressor effect of angiotensin II. At a 100 mg or 150 mg
dose, losartan decreases systolic blood pressure about 15
mmHg and 20 mmHg, respectively[165].
However, these agents, given alone or in combination with
other drugs, control blood pressure in 60-80% of
hypertensive patients[166]. In addition, all current drug
therapies suffer from various problems, for example,
angiotensin converting enzyme inhibitors, one of the most
widely used agents that inhibit the renin angiotensin
systems, are not specific for the RAS because they also
inhibit kininase II, which degrades bradykinin. Increased
levels of bradykinin cause undesirable side effects, such as
dry cough, angioedema and urticaria[158]. Renin inhibitors,
even though more specific, are limited by insufficient
bioavailability [159], and angiotensin antagonists work well
only on patients with high circulating angiotensin II [59] .
Therefore, alternative routes to block the RAS may have
potential advantages. Angiotensinogen, the precursor of the

104
RAS, has been suggested as an important determinant of blood
pressure and electrolyte homeostasis[37]. Blocking angio-
tensinogen synthesis using antisense techniques has proved
to be effective in decreasing blood pressure in the SHR
model [64,65,66,68,160] . Antisense as a therapeutic option
has the advantages of providing specific and long term
pharmacological effects.
In a previous study, it was demonstrated that intra¬
arterially administered cationic liposome-complexed ASODN,
at a dose of 50 (j,g(0.2 |a.g/kgBW) , decreased blood pressure in
SHR approximately 23 mmHg within 24 hours of administration
[68]. Concomitant decreases in plasma ACT, angiotensin II,
and tissue AGT mRNA were also observed. The decrease in
blood pressure was correlated with a decrease in kidney AGT
mRNA levels, rather than plasma AGT protein levels,
suggesting that the observed blood pressure decreases may be
mediated by the actions of the local renal tissue RAS.
Results from previous in vitro studies demonstrated that
the cellular uptake of cationic liposome-complexed ASODN is
dose-dependent[64]. Additionally, CA/ASODN decreased AGT
mRNA and protein in a dose-dependent manner in Hepatoma cell
culture. In an in vivo situation, angiotensinogen functions
as the substrate of renin, and a substantial decrease in AGT
level is required to lead to the decrease in activity of the
RAS. High doses of CA/ASODN may cause depletion of the AGT
pool in the body, which then decreases the activity of the

105
RAS, and subsequently increases the extent and duration of
the antihypertensive effects.
One of the effects of angiotensin II is to stimulate the
release of aldosterone from the adrenal cortex. Aldosterone
acts on the renal distal tubule to increase the reabsorption
of water and sodium and the excretion of potassium[3].
Blocking AGT expression should subsequently decrease
angiotensin II levels and aldosterone release and reverse
their effects. Angiotensin II also has a direct effect on
the kidney by regulating vasoconstriction, renal blood flow,
glomerular filtration rate, and sodium water excretion[165].
In this study, we measured the effect of low (10 p.g) ,
medium(50 jig) , and high(500 |i.g) doses of CA/ASODN on blood
pressure, plasma AGT, angiotensin II level and AGT mRNA
levels in the heart, liver, kidney and its effects on plasma
aldosterone, urinary sodium and potassium excretion, water
intake and urine output. These results may provide
information regarding the potential of ASODN as a
therapeutic agent and on renal mechanisms of blood pressure
regulation.
Materia] and Methods
To determine the dose-dependent effect of CA/ASODN on the
level and duration of blood pressure changes, carotid artery
catheterization was performed in SHRs. Animals were allowed
to recover for 24 hours after surgery, then baseline blood
pressures were measured using the tail cuff method. After

106
this, one of three doses of CA/ASODN, 10 (J.g(low),50 p.g
(medium) or 500 (ig (high) (n=6) , was injected via the carotid
artery. A single dose of 500 (ig of cationic liposome-
complexed scrambled ODN was also administered as a control
to determine the specificity of the antisense effect. Blood
pressure was measured using the tail cuff method for 30
minutes at the same time every day for 5 days. During the
week of study, rats were housed in the metabolic cages and
their water intake and urine output was measured daily.
In a subsequent experiment, the dose-dependent effect of
CA/ASODN on plasma AGT, Ang II, and aldosterone levels every
24 hours for 5 days was determined after a single injection.
Carotid artery catheterization was performed in SHRs, and
after a 24-hour recovery, either 10 jag, 50 pg or a 500 fj.g of
CA/ASODN(n=3) was injected via the carotid artery. Again
CA/ScrODN was used as a control(n=3). Groups of rats were
sacrificed 24 hours after injection and plasma samples,
liver, kidney and heart tissues were collected. Plasma AGT
[124], angiotensin II(RK-A22, Alpco, Windham, NH), and
aldosterone levels(Diagnostic Systems Laboratories, Inc.
Texas) were measured using radioimmunoassay.
The dose-dependent effect of each dose of CA/ASODN on
tissue AGT mRNA also was measured. Total mRNA was extracted
from liver, kidney, and heart tissues. Messenger RNA was
reverse transcripted to cDNA, and then subjected to
amplification by polymerase chain reaction.

107
In the subsequent experiment, the dose effect of CA/ASODN
on urinary sodium/potassium excretion at 24 hour intervals
for 5 days after treatment was determined. The collected
urine was centrifuged, and 200 (J.1 of the supernatant was
aspirated. Urinary sodium and potassium concentration was
measured using NOVA 1+1 Automated Sodium/Potassium Analyzer
(NOVA Biomedical, Massachusetts). The cumulative sodium and
potassium excretion was calculated as the sodium and
potassium concentration multiplied by the urine output.
Statistical analysis was performed by two way ANOVA for
treatment effect. Data for individual time points were
analyzed using the Students independent T-test. Significance
was at the 95% confidence limit.
Re.suI.tJ5.
Figure 5-1 demonstrates the dose-dependent effect of
CA/ASODN on the blood pressure of SHR. The control SHRs
showed a baseline level of 176±6 mmHg. At the 24 hour time
point, a slight increase in blood pressure(183±6 mmHg) was
observed. SHRs treated with the low dose of CA/ASODN showed
blood pressure fluctuations within the normal range for the
5 days of measurement. SHRs treated with the medium dose of
CA/ASODN showed a significant decrease in blood pressure on
day 1(145+8 mmHg)(P<0.05) and day 2 (151+4 mmHg)(P<0.05)
compared with the baseline level (168±6 mmHg) prior to
administration. More pronounced decreases in blood pressure

108
Figure 5-1. Dose-response effects of cationic liposome-
complexed ASODN (CA/ASODN) on systolic blood pressure in
SHR. SHRs were injected with either low(10 ¡ag) , medium(50
|ag), high (500 |ag) dose of CA/ASODN, or 500 |ag CA/ScrODN
intraarterially. Systolic blood pressures were monitored by
tail-cuff every 24 hours for 5 days. Data represent mean ±
standard error (n=4-6). (*) significant different from the
baseline level (P<0.05).

109
were observed after the high dose treatment. Blood pressure
was reduced from baseline levels of 172+10 mmHg to 132±8
mmHg on day 1(P<0.05), 143±8 mmHg(P<0.05) on day 2, and 149+
8 mmHg(P<0.05) on day 3. Blood pressures started to recover
towards baseline levels on day 4(168+7 mmHg)(Figure 5-1).
CA/ASODN treatment also caused a dose-dependent decrease
in plasma AGT. At the medium dose of CA/ASODN, the plasma
AGT level decreased from a baseline level of 113±7 ng/ml to
57±6 ng/ml(P<0.05) on day 1, to 62+11 ng/ml on day 2, and 88
±7 ng/ml(P<0.05) on day 3. Plasma AGT concentrations
completely recovered to baseline levels on day 4. At the
high dose of CA/ASODN, the decrease in plasma AGT levels was
greater than of the medium dose and lasted for a longer
period. The baseline levels of plasma AGT were 110±8 ng/ml,
which was similar to the baseline values for the other
experimental groups. This level was reduced to 45+8 ng/ml on
day 1, 51±5 ng/ml on day 2(P<0.05), 58±7 ng/ml on day 3, and
84±6 ng/ml on day 4(P<0.05) (Figure 5-2). Plasma Ang II
levels showed a similar decreasing trend with CA/ASODN
treatment. After treatment with the medium dose of CA/ASODN,
Ang II decreased from 217+13 ng/ml to 74±15 ng/ml on day 1,
and to 92±11 ng/ml on day 2. At the high dose, Ang II levels
decreased more profoundly, from 198±31 ng/ml to 37±5 ng/ml
on day 1, 74+15 ng/ml on day 2, and 94±12 ng/ml on day
3(P<0.05). The reduction of plasma Ang II lasted for 3 days
and started to recover towards baseline on day4(Figure 5-3).

110
Figure 5-2. Dose-response effects of CA/ASODN on plasma AGT
levels in SHR. SHRs were injected with one of three doses of
CA/ASODN, low(10 (ig) , medium(50 |ag) , high(500 jag) or 500 |J.g
CA/ScrODN intraarterially. Plasma angiotensinogen levels
were measured by radioimmunoassay every 24 hours for 5 days.
Data represent mean ± standard error(n=3). (*) significant
different from the baseline levels(P<0.05).

Ill
Figure 5-3. Dose-response effects CA/ASODN on plasma
angiotensin II levels in SHR. SHRs were injected with one of
three doses of CA/ASODN, low(10 pig) , medium(50 jig) , high
(500 |j,g) or 500 |j.g CA/ScrODN intraarterially. Plasma
angiotensin II levels were measured by radioimmunoassay
every 24 hours for 5 days. Data represent mean ± standard
error(n=3). (*) significant different from the baseline
levels (P<0.05) .

112
(U
c
15
if
CO
CM
C0
>>
>*
>
03
(0
(0
03
03
CD
Q
O
Q
o
AGT (463 bp)-»
P-act¡n (350 bp)-»
Figure 5-4. Dose-response effects of medium dose CA/ASODN on
kidney AGT mRNA expression in SHR. SHRs were injected with
50 pg of CA/ASODN intra-arterially. AGT mRNA expression in
the kidney was measured by RT-PCR. Upper: Result from the
RT-PCR. AGT-.4S3 bp, (3-actin: 350 bp; Lower: Ratio of the
intensity of AGT to control p-actin bands. Results were
consistent for three measurements.

113
CD
C
"0
â– sr
CO
CM
c/)
>.
>,
>.
>.
CO
ro
cd
CD
CD
CO
O
Q
Q
Q
AGT (463 bp)-»
P-actin (350 bp)-»
, ¿V: : :¡‘ . v - ■
s wiwmmwsim w>fi,*zv?w>>mzr
Figure 5-5. Dose-response effects of high dose CA/ASODN on
kidney AGT mRNA expression in SHR. SHRs were injected with
500 ¡ig of CA/ASODN intra-arterially. AGT mRNA expression in
the kidney was measured by RT-PCR. Upper: Result from the
RT-PCR. AGT:463 bp, P-actin: 350 bp; Lower: Ratio of the
intensity of AGT to control P-actin bands. Results were
consistent for three measurements.

114
Baseline Day 1 Day 2 Day 3 Day 4
Figure 5-6. Dose-response effects of medium dose CA/ASODN on
liver AGT mRNA expression in SHR. SHRs were injected with 50
(ig of CA/ASODN. AGT mRNA expression in the liver were
measured by RT-PCR. Upper: Result from the RT-PCR. AGT:463
bp, p-actin:350 bp; Lower: Ratio of the intensity of AGT to
control p-actin bands(n=3). Results were consistent for
three measurements.

115
CD
c
V
CO
CM
v-
(f)
>.
>*
>»
CO
co
CO
CO
CO
CG
Q
O
Q
Q
AGT (463 bp)^
P-actin (350 bp)n>
(U
>
-c 2
-*-* -b
.e §
< °
7= ^
1—
Ü
<
ivsw
MN
Baseline Day 1 Day 2 Day 3 Day 4
Figure 5-7. Dose-response effects of high dose CA/ASODN on
liver AGT mRNA expression in SHR. SHRs were injected with
500 pg of CA/ASODN. AGT mRNA expression in the liver were
measured by RT-PCR. Upper: Result from the RT-PCR. AGT:463
bp, P-actin:350 bp; Lower: Ratio of the intensity of AGT to
control P-actin bands(n=3). Results were consistent for
three measurements.

116
AGT (463 bp)->
p-actin (350 bp)->
Figure 5-8. Dose-response effects of medium dose CA/ASODN on
heart AGT mRNA expression in SHR. SHRs were injected with
500 pg dose of CA/ASODN. AGT mRNA expressions in the heart
were measured by RT-PCR. Upper: Result from the RT-PCR.
AGT:463 bp, p-actin:350 bp; Lower: Ratios of the intensity
of AGT band to control P-actin(n=3). Results were consistent
for three measurements.

117
AGT (463 bp)-»
p-actin (350 bp)-»
0
c
"55
CO
CM
c/>
>
ro
CO
CO
CO
CO
CD
Q
Q
Q
Q
.
t 120
Baseline Day 1 Day 2 Day 3 Day 4
Figure 5-9. Dose-response effects of high dose CA/ASODN on
heart AGT mRNA expression in SHR. SHRs were injected with
500 pg of CA/ASODN. AGT mRNA expressions in the heart were
measured by RT-PCR. Upper: Result from the RT-PCR. AGT:463
bp, p-actin:350 bp; Lower: Ratios of the intensity of AGT
band to control P-actin(n=3). Results were consistent for
three measurements.

118
The dose dependent effect of CA/ASODN on tissue AGT mRNA
also was studied. AGT mRNAs were quantified by the RT-PCR
method. Figure 5-4, 5-5 and 5-6 show the ratios of AGT mRNA
to control P-actin mRNA. The figures demonstrate that kidney
AGT mRNA decreased 70% on day 1 after the high dose treat¬
ment, with full recovery occurring on day 4. With the medium,
dose, AGT mRNA decreased 50% on day 1 and recovered by day
3(Figure 5-4). In the liver, AGT mRNA was decreased 90% and
50% on the first day after the high and medium dose of CA/
ASODN treatments, respectively. This reduction lasted about
2 days(Figure 5-5). The high dose of CA/ASODN treatment also
induced a significant decrease of AGT mRNA in the heart, as
shown in Figure 5-6. Greater decreases of AGT mRNA were
observed after the high dose CA/ASODN treatment than after
the medium dose.
Table 5-1 presents the water intake and urine output of
SHR's after CA/ASODN treatment. Since the rats were taken
from metabolic cages for 3-5 hours every day for blood
pressure measurement, the values reflect water intake and
urine output during an 18-20 hour period rather than 24
hours. The water intake fluctuated daily and no significant
difference could be attributed to the CA/ASODN treatment
when compared with controls or even within groups. However,
urine volumes were significantly increased (P<0.05) after
CA/ASODN treatment. With the medium dose, urine volumes
increased to 11.2+1.9 ml (P<0.05) on day 1, 12.4+3.3 ml on
day 2 (P<0.05) compared with the baseline urine output of

119
Table 5-1. Dose-response effects of CA/ASODN on water intake
and urine output in SHR. SHRs were injected with medium (50
jj.g) or high dose (500 pig) of CA/ASODN intra-arterially. Urine
output and drinking volume were measured daily for 5 days
(n=4-6). BL: baseline. P<0.05(*).
Water intake ± S.E.
(ml/24 h)(n=4-6)
Urine output 1 S.E.
(ml/24 h)(n=4-6)
Control(BL)
31.8±2.7
9.6+2.2
Day 1
26.4+3.7
7.9±1.8
Day 2
28.3±2.6
9.0+1.5
Day 3
27.3+3.9
10.1±2.2
Day 4
24.2±4.1
9.7+1.3
Day 5
26.8±2.1
11.3+0.9
Medium dose(BL)
32.2+1.9
9.1±1.3
Day 1
29.2±3.1
11.211.9*
Day 2
35.113.7
12.4+3.3*
Day 3
26.7±2.8
10.212.9
Day 4
31.3±1.8
9.011.7
Day 5
27.7+2.7
9.510.5
High dose(BL)
2 6.5±2.5
8.310.9
Day 1
28.3±2.2
12.811.1*
Day 2
31.7+3.7
11.711.6*
Day 3
29.7+1.7
11.310.6*
Day 4
33.3±5.1
8.510.6
Day 5
25.7±3.2
8.710.7

120
Table 5-2. Dose-response effects of CA/ASODN on plasma
aldosterone levels in SHR. SHRs were injected with medium
(50 (ag) or high dose (500 pg) of CA/ASODN intra-arterially.
Plasma aldosterone levels were measured by radioimmunoassay
every 24 hours for 5 days(n=3). P<0.05(*)
Aldosterone ± S.E.(ng/ml)
Control(baseline)
722±52
day 1
750±34
day 2
700+68
day 3
712±56
day 4
745+71
day 5
717±4 4
Medium dose(baseline)
788±36
day 1
620+26*
day 2
640+46*
day 3
594+44*
day 4
741+29
day 5
765+51
High dose(baseline)
774+37
day 1
379+19*
day 2
358+23*
day 3
333+15*
day 4
678+39
day 5
773+51

121
9.1±1.3 ml. At the high dose, this significant increase in
urine volume was greater and more prolonged: 12.8±1.1 ml on
day 1, 11.7+1.6 ml on day 2, and 11.3+0.6 ml on day
3(P<0.01), compared with a baseline level of 8.3+0.9 ml.
Plasma aldosterone levels in response to CA/ASODN
treatment were also determined in the SHRs. Significant
decreases in aldosterone were observed after both the medium
and high dose treatments. At medium doses, aldosterone
levels dropped from a baseline level of 788+36 ng/ml to 620+
26 ng/ml on day 1, 640+46 ng/ml on day 2, and 594+44
ng/ml(P<0.01) on day 3. Aldosterone values were normalized
by day 4. After the high dose of CA/ASODN, the reduction in
aldosterone levels was more impressive. From a baseline
value of 774+37 ng/ml, aldosterone level was reduced to 379+
19 ng/ml on day 1, 358+23 ng/ml on day 2, and 333+15 ng/ml
on day 3(P<0.01). Aldosterone values were not altered in
SHRs treated with control ScrODN (Table 5-2). The observed
decreases in aldosterone levels were consistent with urinary
sodium and potassium excretion. Prior to CA/ASODN treatment,
urinary sodium and potassium excretion was similar in all
groups during the 20 hour measurement period. There were no
changes observed in the control group over the 5 day
measurement. However, a dose-response like effect on sodium
and potassium excretion was observed in the CA/ASODN
treatment groups. An increase in the cumulative sodium
excretion with a concomitant decrease in potassium excretion

122
Table 5-3. Dose-response effects of CA/ASODN on 24-hour
urinary sodium and potassium excretion in SHR. SHRs were
injected with medium (50 |ug) and high (500 jug) doses of
CA/ASODN intra-arterially. The sodium and potassium
concentrations in the urine were measured and total sodium
and potassium excretions were calculated as the
concentration multiplied by the urine volume (n=4--6) .
P<0.05 (*)
Sodium ± S.E.
(mmol/24 h)(n=4-6)
Potassium 1 S.E.
(mmol/24 h)(n=4-6)
Control (BL)
1.82±0.05
1.3710.03
day 1
1.7810.03
1.3610.03
day 2
1.8810.08
1.4110.03
day 3
1,. 8510.11
1.3910.04
day 4
1.8310.06
1.3810.02
day 5
1.7910.04
1.4110.04
Medium dose(BL)
1.8010.09
1.3210.05
Day 1
2.0210.10*
1.1310.05*
Day 2
1.9610.10*
1.1510.08*
Day 3
1.8010.07
1.3510.06
Day 4
1.7710.06
1.3410.09
Day 5
1.8110.12
1.410.09
High dose(BL)
1.8010.11
1.3310.06
Day 1
2.2110.10*
1.0710.07*
day 2
2.1410.18*
1.1010.09*
day 3
1.9810.11*
1.2510.06*
day 4
1.8410.06
1.4010.07
day 5
1.7710.08
1.4710.08

123
was observed. With the medium dose of CA/ASODN treatment,
sodium excretion increased from a baseline value of 1.80+
0.09 mmol to 2.02+0.1 mmol on day 1, and 1.96±0.1 mmol on
day 2, while potassium excretion decreased from a baseline
level of 1.32+0.05 mmol to 1.13±0.05 mmol on day 1, and 1.15
±0.08 mmol on day 2(P<0.01) . After the high dose, sodium
excretion increased from a baseline level of 1.80+0.11 mmol
to 2.21+0.1 mmol on day 1, 2.14±0.18 mmol on day 2, and 1.98
±0.08 mmol on day 3. Potassium excretion decreased from a
baseline level of 1.33±0.06 mmol to 1.07±0.07 mmol on day 1,
1.10±0.09 mmol on day 2, and 1.25±0.06 mmol on day 3(P<0.01)
(Table 5-3) .
The results of this study demonstrate that intra-arterial
injection of cationic' liposome-complexed ASODN targeted
against AGT mRNA decreased blood pressure in a dose-
dependent manner. Blood pressure decreased significantly at
both 50|ig and 500p.g doses in SHR, while injection of
scrambled ODN- complex did not produce a similar effect,
suggesting specificity of the antisense action at these
concentrations. At the SOOpg dose, a 40 mmHg decrease in
systolic blood pressure was observed. The decrease in blood
pressure lasted about 72 hours, compared with the medium
dose treated SHRs, which showed a smaller decrease in blood
pressure with a shorter duration of action.

124
Decreasing blood pressure in SHR via inhibition of the
AGT gene expression using an antisense technique has been
reported in the literature[66,68,160]. The antihypertensive
effects differ based on routes of antisense administration
and methods of hepatocyte delivery. Tomita, et al.
transfected antisense against AGT mRNA via the hepatic
portal vein using liposomes containing viral agglutinins.
ASODN at a concentration of 5 (J.M decreased blood pressure
from 172 mmHg to 154 mmHg. The decrease in blood pressure
lasted for 3 days[66]. Makino, et al injected ASODN against
rat angiotensinogen coupled to an asialoglycoprotein carrier
molecule via the tail vein. They observed a blood pressure
decrease from 201 mmHg to 171 mmHg at a 50ug ASODN dose 24
hours after injection[160]. However, none of these methods
were able to decrease blood pressure to normotensive levels.
In this study, it has been demonstrated that an intra¬
arterial injection of a 500|jg dose of CA/ASODN was able to
decrease blood pressure from a baseline of 172+10 mmHg to
132+8 mmHg after 24 hours. This single dose of CA/ASODN
produced a hypotensive effect comparable to the antihyper¬
tensive effect produced by multiple dosings of other drugs
working on the renin angiotensin system such as ACE
inhibitors and renin inhibitors[164]. This suggests that
antisense blocking the renin angiotensin system may have
potential as an antihypertensive agent with longer duration.
These results also support the fact that AGT is important in
blood pressure regulation.

125
The observed antihypertensive effect was dose dependent.
A more pronounced decrease in blood pressure was observed
after high dose treatment compared with that of the medium
dose. Our previous in vitro study showed that the uptake of
CA/ASODN reached a plateau at CA/ASODN concentration at
about 1 (j,M in cell culture. In an in vivo situation,
increasing the dose should increase the plasma concentration
and then lead to a more effective intracellular delivery of
ASODN, subsequently increasing the extent and duration of
the biological effect. At these concentrations lesser
cellular toxicity has been shown after in vitro studies.
To elucidate the underlying mechanisms for the blood
pressure decrease, plasma AGT, angiotensin II levels and
tissue AGT mRNA expression are subsequently measured. A
significant, dose-dependent decrease in plasma AGT and
angiotensin II was observed. The duration of the plasma AGT
and angiotensin II decreases was consistent with that of the
decrease in blood pressure, suggesting a possible role of
plasma RAS in the blood pressure decrease at these doses.
In heart, kidney and liver, a dose-dependent decrease in
AGT mRNA was observed 1-3 days after treatment. The decrease
in AGT mRNA in the liver lasted for 3 days, which
corresponds to observed plasma AGT levels, possibly because
liver is the primary organ that contributes to the
circulating AGT. The decrease in AGT mRNA was more
pronounced at the high dose, suggesting that an increase in

126
tissue and cellular uptake may produce a greater inhibition
of AGT gene expression.
At a medium or high dose CA/ASODN induced increased
urine output, suggesting a role of increased fluid
excretion for the observed decrease in blood pressure. To
specify the mechanism for this apparent diuretic or
natriuretic effect, plasma aldosterone levels and urinary
sodium and potassium output are subsequently measured.
Aldosterone was secreted by the zona glomerulosa of the
adrenal cortex[167]. All of the components of the renin
angiotensin system have been identified in the adrenal
cortex[168]. The mechanism by which the renin-angiotensin
system acts within the adrenal is not known. One possi¬
bility is that all of the reactions take place within the
zona glomerulosa cells and the final product angiotensin
II stimulates aldosterone production. A 50% decrease i.n
plasma aldosterone was observed after the high dose
treatment. This decrease in aldosterone also might be a
direct response of the decrease in angiotensin II level
produced by ASODN treatment. A decrease in angiotensin II
inhibits the release of aldosterone from the adrenal
cortex, with a subsequent increase in water and sodium
reabsorption from the distal tubule of the kidney. The
results of 24-hour cumulative sodium and potassium
excretion supports the role played by the aldosterone; an
increase in sodium excretion with a concomitant decrease
in potassium excretion was observed. Increased water

127
excretion could also be mediated by the direct effect of
angiotensin II on the kidney. Additionally, an increase in
water excretion could also result from the action of
antidiuretic hormone(ADH). Angiotensin II is known to
stimulate the release of ADH from the posterior pituitary.
ADH increases reabsorption of water by the distal tubule
and collecting ducts, thus increasing fluid volume [169].
Since Ang II increases ADH release, the decreases in Ang
II levels may reduce ADH levels, which in turn could
result in greater urine loss. The water intake did not
change significantly after the CA/ASODN treatment,
suggesting that increased urine output is not strictly a
coupled reaction to fluid intake.
In summary, these results support the following
conclusions. First, intra-arterial injection of CA/ASODN
decreased blood pressure in a dose-dependent manner, with a
40±3 mmHg decrease in blood pressure after a 500 ug dose of
ASODN treatment. Second, plasma AGT, angiotensin II, and
tissue AGT mRNA also showed dose-dependent decreases. Third,
the treatment also resulted in a decrease in plasma
aldosterone levels, with a concomitant increase in sodium
excretion and a decrease in potassium excretion. These
results suggest that an aldosterone mediated kidney effect
be involved in the observed blood pressure decrease.

CHAPTER 6
DISCUSSION AND SUMMARY
The unique property of antisense oligonucleotides, which
intervenes and inhibits a gene expression with high
specificity, provides a great advantage for use as both a
therapeutic agent and a research tool. Although various
problems are not completely solved, certain factors
regarding their application, such as stability and delivery,
have improved over the years. More than a dozen ASODNs
designated for both topical use and in vivo applications are
now undergoing clinical trials[78].
In these studies, it has been proposed to apply ASODN
technology to study the mechanism of essential hypertension
in the SHR model and to study the potential of development
of an ASODN as antihypertensive agent with long lasting
therapeutic effects. In the first part of this study, the
efficiency of cationic liposomes composed of DDAB and DOPE,
as a delivery system for the cellular delivery of ASODN in
hepatoma cell culture was evaluated. The results demons¬
trated that cationic liposome-complexation increased the
rate and extent of cellular delivery of ASODN in a dose
dependent manner. The increased delivery subsequently led to
increased inhibition of targeted gene expression. Both AGT
128

129
mRNA and protein expression decreased in a dose-dependent
manner.
The composition of the cationic lipids and ASODN affects
its interactions with cells. The cellular uptake of CA/ASODN
changed dramatically with different lipids/ASODN ratios,
possibly due to such factors as size, charge, and membrane
interaction. The overall positive charge of the complex
facilitates its adsorption onto the cell surface and
subsequent intracellular ASODN delivery. Cationic liposomes
also appeared to assist the escape of the ASODN from
intracellular compartments.
A second specific goal was to study the effects of the
route of administration of CA/ASODN on blood pressure and
tissue distribution of ASODN in SHR. Blood pressures
decreased more profoundly after intraarterial administration
than after intravenous administration. Plasma AGT and
angiotensin II levels decreased similarly after both IA and
IV injection. However, AGT mRNA in the heart and the kidney
tissues showed a greater decrease after IA than after IV
injection, suggesting that a tissue specific effect may be
involved. Our tissue distribution studies showed that
cationic liposomes increased the disposition of ASODN in the
measured tissues.
In specific aim three, the dose-dependent effects of
CA/ASODN on blood pressure, plasma and tissue RAS in SHR was
studied. Blood pressure, plasma AGT, angiotensin II and
tissue AGT mRNA decreased in a dose-dependent manner. As

130
expected, these effects lasted longer at the higher dose.
Plasma aldosterone levels also decreased, with a concomitant
increase in urinary output, with an increase in sodium
excretion and a decrease in potassium excretion. This
suggests that the decrease in blood pressure may be the
result of kidney effects mediated by aldosterone. The
possible mechanisms underlying the observed ASODN mediated
blood pressure decrease is summarized in Figure 6-1.
ASODN
Figure 6-1. Summary of possible mechanisms for the observed
ASODN mediated blood pressure decrease.
From linkage genetic studies, AGT has been indicated to
be one of the candidate genes involved in the pathogenesis

131
of hypertension. These findings suggest that both
circulating and tissue AGT, such as in kidney and heart,
play an important role in the pathogenesis of hypertension
in the SHR. Even though feedback mechanisms may function to
regulate blood pressure, it appears that inhibition of AGT
gene expression by ASODN was effective in decreasing high
blood pressure. The results also demonstrated that a single
dose of CA/ASODN produced a long lasting hypotensive effect
compared with other antihypertensive agents. All these
results support the fact that ASODN targeted against AGT
could potentially be used as a therapeutic agent for the
treatment of hypertension.
Successful decreases in blood pressure may be mediated by
effective tissue targeting of ASODN. The results of this
study support the finding that the cationic liposome
approach is an effective method for delivering the ASODN to
the liver. Specific gene targeting to the liver has been
reported in the literature. Wu et al. [170] developed
asialogly-coprotein-polylysine-DNA conjugates to target
asialoglyco-protein receptors, which are uniquely expressed
by hepato-cytes. Successful hepatic expression of the
exogenous gene after IV injection was observed. Zhu et
al. [171] , employed a cationic liposome approach to deliver a
model plasmid. They obtained variable gene expression in
tissues in an in vivo study. In a more recent study, Makino
et al. [160] , reported that an intravenous injection of
asialoglycoprotein-poly-L)lysine-antisense complex atrgeted

132
to AGT reduced plasma AGT levels and hepatic AGT mRNA as
well as systolic blood pressure in SHR. The effects lasted
for five days, whereas the control sense complex did not
produce similar effects.
The routes and doses of CA/ASODN administration also were
suggested to be important factors. These results showed that
at a 500 ug dose, blood pressure decreased more after IA
than after IV injection. A 40 mmHg decrease in blood
pressures was observed after the 500ug IA injection of
CA/ASODN. IV injection of a 50 ug dose produced a less but
significant decrease in blood pressure. The effect of a high
dose of CA/ASODN on blood pressure when administered IV was
not determined in this study. However, a significant
decrease in blood pressures after IV injection of this dose
is expected. The IV route of administration is a more
practical approach for its application than IA route, which
is rarely used in the clinic setting. An in vitro study
showed that the cellular uptake of CA/ASODN is dose-
dependent. In an in vivo situation, a dose-dependent tissue
uptake of ASODN also is expected. Increasing the dose may
increase the amount of ASODN that get to the target site.
Our tissue distribution studies showed that a substantial
amount of CA/ASODN accumulates in the lung after IV
injection than after IA injection. This may decrease the
dose availability reaching the liver or kidney. By
increasing the dose to 500 pg, and using IV administration,

133
more CA/ASODN may reach the target site such as observed via
the IA route of administration.
In summary, these studies support the following
conclusions. First, cationic liposomes composed of DDAB and
DOPE are more effective in delivering ASODN in hepatoma cell
culture and in a rat model of hypertension than previously
used phosphatidylcholine cholesterol liposomes. Second,
ASODNs targeted to AGT mRNA decrease blood pressure in SHR
hypertension model after IA and IV injection, with the
hypotensive effects being more pronounced after IA
administration. Cationic liposome complexation potentiates
this effect and the observed decreases in blood pressure
correlate with the decreases in AGT mRNA expression in the
kidney. Third, CA/ASODN decreases blood pressure, plasma
AGT, angiotensin II and AGT mRNA in a dose-dependent manner.
The plasma aldosterone levels also demonstrate a dose-
dependent decrease, with concomitant increases in urinary
sodium excretion and decreases in urinary potassium
excretion. Collectively, these results suggest that the
blood pressure changes observed with CA/ASODN treatment may
be mediated via tissue effects, in particular, the kidney.

134
REFERENCES
1. Kaplan, D., Primary hypertension: pathogenesis.
Clinical Hypertension, William & Wilson 1994; Chapter
3:47-108.
2. Bullock, B., Hypertension. Pathophysiology, Adaptation
and Alteration in Function Scott, Foresman and Company
1988; Chapter 22:28-537.
3. Stanton, W., The cardiovascular system. Physiology,
Berne Levy 1998; Chapter IV:366-387.
4. Krieger, J., and Dzau, V. , Molecular biology of
hypertension. Hypertension 1991; 18 [suppl I]:I3-I17.
5. Laragh, J.H., and Brenner, B.M., Dominant role of the
kidneys in arterial pressure regulation in normal and
hypertensive states. Hypertension: Pathophysiology,
diagnosis, and management, Raven Press 1995; Chapter
78 :1311-1326.
6. Patschan, 0., Kidneys from normotensive donors lower
blood pressure in young transplanted spontaneously
hypertensive rats. Am. J. Physiol. 1997; 273:R175-R180.
7. Corvol, P., Jeunemaitre, X., Charru, A., Kotelevtsev,
Y. and Soubrier, F., Role of the Renin-Angiotensin
System in Blood Pressure Regulation and in Human
Hypertension: New Insights from Molecular Genetics.
Recent Progress in Hormone Research 1995; 50:287.
8. Ganten, D., The Renin-Angiotensin Paradigm. Arzneim-
Forsch/Drug Res. 1993; 43(1) . Nr.2a.
9. Dzau, V.J., Burt, D.W., and Pratt, R.E., Molecular
biology of the renin-angiotensin system. Am. J.
Physiol. 1988 ; 255 (4) :F563-573.
10. Griendling, K., Murphy T.J., and Alexander R.W.,
Molecular Biology of the Renin-Angiotensin System.
Circulation 1993; 87 (6) :1816-1828 .

135
11. Dzau, V.J., Circulating versus local renin-angiotensin
system in cardiovascular homeostasis. Circulation 1988;
77(Suppl I):1-4.
12. Unger, T., Gohlke, P., Paul. M., and Rettig, R.,
Tissue Renin-Angiotensin Systems: Fact or fiction? J.
Cardiovasc Pharm 1991; 18(Suppl 2):S20-S25.
13. Ganong, W.F., CODA, Tissue Renin-Angiotensin Systems,
Tissue renin-angiotensin systems. Plenum Press, 1995;
435-440.
14. Lee, M., Bohm, M., Paul, M., and Ganten, D., Tissue
Renin-Angiotensin Systems, Their Role in Cardiovascular
Disease. Circulation 1993; 87[suppl IV]:IV7-IV13.
15. Dazu, V.J. and Richard, Re, Tissue Angiotensin System
in Cardiovascular Medicine, A Paradigm shift?
Circulation 1994; 89 (1) :493-498.
16. Dzau, V.J., Tissue renin-angiotensin system:
physiologic and pharmacologic implications. Circulation
1988; 77 (suppl. I):I1-I3.
17. Dzau, V.J,, Vascular Renin-Angiotensin: A possible
Autocrine or Paracrine System in Control of Vascular
Function. J. Cardiovasc Pharm 1984; 6(supp 1.2): S377-
S382 .
18. Carretero, O., Scicli, G., Local Hormonal Factors
(Intracrine, Autocrine, and Paracrine) in hypertension.
Hypertension 1991; 18(suppl I):I58-I69.
19. Richard, N. Re, The cellular Biology of Angiotensin:
Paracrine, Autocrine and Intracrine Actions in
Cardiovascular Tissues. Mol Cell Cardiol 1989; 21 (suppl
V) : 63-69.
20. Hackenthal, E., Paul,M., Ganten, D., and Taugner, R.,
Morphology, physiology, and molecular biology of renin
secretion. Physiological Reviews 1990; 70 (4) : 1067-1116.
21. Sigmund, C.D., Jones, C.A., Kane, C.M., Wu, C.,
Lang,J.A., Gross, K.W., Regulated Tissue- and Cell-
specific Expression of the Human renin gene in
Transgenic Mice. Circ. Res. 1992; 70:1070-1079.
22. Johns, D.W., Peach, M.J., Gomez, R.A., Inagami, T.,
Carey, R.M., Angiotensin II regulates renin gene
expression. Am. J. Physiol. 1990; 259:F882-F887.

136
23. Laragh, J., and Brenner, B., Hypertension:
Pathophysiology, diagnosis, and management, Volume 2,
Chapter 101, Tissue distribution of Angiotensin-
Converting Enzyme. 1995; 1726-1765.
24. Katsuhiko, K., Brosnihan, K.B., Chappell, M.C., Khosla,
M.C., Ferrarlo, C.M., Angiotensin-(1-7) A member of
circulating Angiotensin peptides. Hypertension 1991;
17:131-138.
25. Laragh, J., and Brenner, B., The distribution of
angiotensin II receptors. Hypertension: Pathophysiol-
ogy, diagnosis, and management 1995; Chapter 104:1701.
26. Timmermans, PBMWM, Chiu, A.T., Herblin, W.F., Wong,
P.C., Smith, R.D., Angiotensin II receptor subtypes.
Am. J. Hypertens. 1992; 5:406-410.
27. Lynch, K.R., and Peach, M.J., Molecular Biology of
Angiotensinogen. Hypertension 1991; 17 (3): 263-269,
28. Laragh, J., and Brenner, B., Angiotensinogen: Molecular
Biology and Genetics. Hypertension: Pathophysiology,
diagnosis, and management Raven Press. 1995;
2 (99) :1653.
29. Deschepper, C., Reudelhuber, T.L., Rat Angiotensinogen
Is Secreted Only Constitutively When Transfected into
AtT-20 Cells. Hypertension 1990; 16:147-153.
30. Clauser,E., Gaillard, I., Wei, L., and Corvol, P.,
Regulation of Angiotensinogen Gene. Am J Hypertens
1989; 2:403-410.
31. Fukamizu, A., Takahashi, S., Seo, M.S., Tada, M.,
Tanimoto, K., Uehara, S., and Murakami, K., Structure
and Expression of the Human Angiotensinogen Gene. J.
Biol. Chem. 1990; 265(13):7576 - 7582.
32. Ben-Ari, E.T., and Garrison, J.C., Regulation of
angiotensinogen mRNA accumulation in rat hepatocytes.
Am. J. Physiol. 1988; 255:E70-E79.
33. Change, E., and Perlman, A.J., Multiple Hormones
Regulate Angiotensinogen Messenger Ribonucleic Acid
Levels in a Rat Hepatoma Cell Line. Endocrinology
1987; 121:513-519.

137
34. Cassis, L.A., Saye,J., and Peach, M.J., Location and
Regulation of Rat Angiotensinogen Messenger RNA.
Hypertension 1988; 11:591-596.
35. Ohkubo, H., Nakayama, K., Tanaka, T., and Nakanishi,
S., Tissue Distribution of Rat Angiotensinogen mRNA and
Structural Analysis of Its Heterogeneity. J. Biol.
Chem. 1986; 261 (1) :319-323 .
36. Gould, A.B., and Green, B., Kinetics of the human renin
and human renin substrate reaction. Cardiovasc. Res.
1971; 5:86-89.
37. Jeunemaitre, X., Soubrier, F., Kotelevtsev,Y.V.,
Lifton, R.P., Williams, C.S., Charru, A., Hunt, S.C.,
Hopkins, P.N., Williams, R.P., Lalouel, J., Corvol, P.,
Molecular Basis of Human Hypertension: Role of
Angiotensinogen. Cell 1992; 71:169-180.
38. Gardes, J., Bouhnik, J., Clauser, E., Corvol, P.,
Menard, J., Role of Angiotensinogen in Blood Pressure
Homeostasis. Hypertension 1982; 4:185-189.
39. Caulfield, M., Lavender, P., Farrall, M., Munroe, P.,
Lawson, M., Turner, P., Clark, J.L., Linkage of the
Angiotensinogen gene to essential hypertension. The New
England Journal of Medicine 1994; 330 (23) :1123-1126.
40. Hingorani, A.D., Sharma, P., Jia, H., Hopper, R., and
Brown, M., Blood pressure and the M235T polymorphism of
the AGT gene. Hypertension 1996; 28:907-911.
41. Lodwick, D., Kaiser, M.A., Harris, J., Cumin, F.,
Vincent, M., Samani, N.J., Analysis of the Role of
Angiotensinogen in Spontaneous Hypertension.
Hypertension 1995; 25:1245-1251.
42. Tamura,K., Umemura,S., Nyui, N., Yamakawa, T.,
Yamaguchi, S., Ishigami, T., Tanaka, S., Tanimoto, K.,
Takagi, N., Sekihara, H., Murakami, K., Ishii, M.,
Tissue-Specific Regulation of Angiotensinogen Gene
Expression in Spontaneously Hypertensive Rats.
Hypertension 1996; 27:1216-1223.
43. Tanimoto, K., Sugiyama, F., Goto, Y., Ishida, J.,
Takimoto, E., Yagami, K., Fukamizu, A., Murakami, K.,
Angiotensinogen-deficient mice with hypotension. J.
Biol. Chem. 1994; 269 (50) : 31334-31337.
44. Kimura, S., Mullins, J.J., Bunnemann, B., Metzger, R.,
Hilgenfeldt, U., Zimmermann, F., Jacob, H., Fuxe, K.,

138
Ganten, D., Kaling, M. , High blood pressure in
transgenic mice carrying the rat angiotensinogen. EMBO
J. 1992 ; 11 (3) : 821-827.
45. Fukamizu, A., Sugimura, K., Takimoto, E., Sugiyama, F.,
Seo, M, Takahashi, S., Hatea, T., Kajiwara, N., Yagami,
K., and Murakami, K., Chimeric renin-angiotensin system
demonstrates sustained increase in blood pressure of
transgenic mice carrying both human renin and human
angiotensinogen genes. J. Biol. Chem. 1993; 268(16):
1617-11621.
46. Ohkubo, H., Kawakami, H., Kakehi, Y., Takumi, T., Arai,
H., Yokota, Y., Iwai, M., Tanabe, Y., Masu, M., Hata,
J., Iwao, H., Okamoto, H., Yokoyama, M., Nomura, T.,
Katsuki, M., and Nakanishi, S., Generation of
transgenic mice with elevated blood pressure by
production of the rat renin and angiotensinogen genes.
Proc. Natl. Acad. Sci. 1990; 87:5153-5157.
47. Schunkert, H., Ingelfinger, J.R., Jacob, H., Jackson,
B., Bouyounes, B., Dzau, V. , Reciprocal feedback
regulation of kidney angiotensinogen and renin mRNA
expression by angiotensin II. Am. J. Physiol. 1992;
263:E863-E869.
48. Dazu, V. and Herrmann, H.C., The feedback regulation of
angiotensinogen production by componenets of the renin-
angiotensin system. Circ Res 1983; 52:328-334.
49. Hilgenfeldt, U., Schwind, S., Angiotensin II is the
mediator of the increase in hepatic angiotensinogen
synthesis after bilateral nephrectomy. Am. J. Physiol.
1993; 265:E414-E418.
50. Iwao, H., Kimura, S., Fukui, K., Nakamura, A., Tamaki,
T., Ohkubo, H., Nakanishi, S., and Abe, Y., Elevated
angiotensinogen mRNA levels in rat liver by
nephrectomy. Am. J. Physiol. 1990; 258:E413-417.
51. Schunkert, H., Ingelfinger, J.R., Hirsch, A.T., Pinto,
Y., Remme,W.J., Jacob, H., and Dzau, V.J., Feedback
regulation of Angiotensin converting enzyme activity
and mRNA levels by Angiotensin II. Circ. Res. 1993;
72:312-318.
52. Klett, C., Nobiling R., Gierschik, P., and Hackenthal,
E., Angiotensin II stimulates the synthesis of angio¬
tensinogen in hepatocytes by inhibiting adenylylcyclase
activity and stabilizing angiotensinogen mRNA. J. Biol.
Chem. 1993; 268 (33):25095-25107.

139
53. Correa-Rotter, R., Hostetter, T.H., Manivel, J.C., and
Rosenberg, M.E., Renin expression in renal ablation.
Hypertension 1992; 20:483-490.
54. Campbell, D.J., Kladis, A., Duncan, A., Nephrectomy,
converting enzyme inhibition, and angiotensin peptides.
Hypertension 1993; 22:513-522.
55. Johns, D.W., Peach, M.J., Gomez, A., Inagami, T., and
Carey, R.M., Angiotensin II regulates renin gene
expression. Am. J. Physiol. 1990; 259:F882-F887.
56. Robbins, J., Gene Targeting: The Precise Manipulation
of the Mammalian Genome. Circ. Res. 1993; 73:3-9.
57. Mockrin, S., Dzau, V.J., Gross, K.W., and Horan, M.J.,
Transgenic Animals: New approaches to hypertension
Research. Hypertension 1991; 17 (3): 394-399.
58. Mullins, J.J., Mullins, L.J., Transgene, hypothesis,
and hypertension. Hypertension 1994; 23:456-459
59. Katzung, B.G., Basic and Clinical Pharmacology,
Appleton and Lange, Sixth edition, Chapter 11,
Antihypertensive Agents. 1995; 147-170.
60. Chai, S.Y., Zhuo, J., Mendelsohn, F.A.O., Localization
of Components of the Renin-Angiotensin System and Site
of Action of Inhibitors. Arzneim-Forsch/drug Res. 1993;
43(I):Nr.2a.
61. Bohr, D.F., and Dominiczak, A.F., Experimental
hypertension. Hypertension 1991; 17(suppl I):I39-I44.
62. Pratt, R.E., Min Zou, W., Naftilan, A.J., Ingelfinger,
J.R., and Dzau, V.J., Altered sodium regulation of
renal AGT mRNA in the SHR. Am. J. Physiol. 1989; 256:
F469-F474.
63. Tomita, N., Morishita, R., Higaki, J., Kaneda, Y.,
Mikami, H., and Ogihara, T., In vivo transfer of
antisense oligonucleotide against rat angiotensinogen
with HJV-liposome delivery resulted in reduction of
blood pressure in SHR. Hypertension 1994; 24(3) :65.
64. Wielbo, D., Sernia, C., Gyurko, R., Phillips, M.I.,
Antisense inhibiton of hypertension in the
spontaneously hypertensive rat. Hypertension 1995;
25:314-319.

140
65. Gyurko, R., Wielbo, D., and Phillips, M.I., Antisense
inhibition of ATI receptor receptor mRNA and
angiotensinogen mRNA in the brain of spontaneously
hypertensive rats reduce hypertension of neurogenic
origin. Regul Pept. 1993; 49:167-174.
66. Tomita, N., Morishita, R.; Higaki, J., Aoki, M.,
Nakamura, Y., Mikami, H., Fukamizu, A., Murakami, K.,
Kaneda, Y., Ogihara, T., Transient decrease in high
blood pressure by in vivo transfer of antisense
oligodeoxynucleotides against rat angiotensinogen.
Hypertension 1995; 26:131-136.
67. Chao, J., Zhang, J.J., Lin, K.F., Chao, L., Human
kallikrein gene therapy attenuates hypertension,
cardiac hypertrophy and renal injury in Dahl salt-
sensitive rats. Human Gene Therapy 1998; 9(1) : 21-31.
68. Wielbo, D., Simon, A., Toffolo, S.M., Phillips, M.I.,
Inhibition of hypertension by peripheral administration
of antisense oligodeoxynucleotides. Hypertension 1996;
28:147-151.
69. Wagner, R.W., Gene inhibition using antisense
oligodeoxynucleotides. Nature 1994; 372:333-335.
70. Eck, S.L., and Nabel, G.L., Antisense oligonucleotides
for therapeutic intervention. Current Opinion in
Biotechnology 1991; 2:897-904.
71. Stanley, T.C., Progress toward oligonucleotide
therapeutics: Pharmacodynamic properties. FASEB J.
1993; 7:533-539.
72. Maher, L.J. Ill, Prospects for the therapeutic use of
antigene oligonucleotides. Cancer Invest. 1996; 14:66-
82 .
73. Helene, C., and Toulme, J., Specific regulation of gene
expression by antisense, sense and antigene nucleic
acids. Biochim et Biophys Acta 1990; 1049:99-125.
74. Milligan, J., Matteucci, M.D., Martin, J.C., Current
concepts in antisense drug design. J. Med Chem 1993;
36:1923-1937.
75. Boiziau,C., Kurfurst,R., Cazenave,C., Roig,V., Thuong,
N.T., Toulme, J.J., Inhibition of translation
initiation by antisense oligonucleotides via an RNase-H
dependent mechanism. Nucleic Acids Res 1991; 19:1113-
1119 .

141
76. Knorre, D.G., Vlassov, V.V., Zarytova, V.F., Lebedev,
A.V., Federova, O.S., Design and targeted reactions of
oligonucleotide derivatives. CRC Press, 1994; 7-15.
77. Stein, C.A. and Cheng Y.-C., Antisense oligonucleotides
as therapeutic agents - Is the bullet really magical?
Science 1993; 261:1004-1012.
78. Matteucci, M.D., and Wagner, R.W., In Pursuit of
Antisense. Nature 1996; 384:20-22.
79. Loke, S.L., Stein, C.A., Zhang, X.H., Mori, K.,
Nakanishi, M., Subasinghe,C., Cohen, J.S.,
Characterization of oligonucleotide transport into
living cells. Proc. Natl. Acad. Sci. 1989; 86:3474-
3478 .
80. Zamecnik, P., Aghajanian, J., Zamecnik, M., Goodchild,
J., Witman, G., Electron micrographic studies of
transport of oligonucleotides across eukaryotic cell
membrane. Proc. Natl. Acad. Sci. 1994; 91:3156-3160.
81. Yakubov, L., Deeva, E.A., Zarytova, V.F., Ivanova,
E.M., Ryte, A.S., Yurchenko, L.V., Vlassov, V.V.,
Mechanism of oligonucleotide uptake by cells:
involvement of specific receptors? Proc. Natl. Acad.
Sci. 1989; 86:6454-6458.
82. Fisher, T., Terhorst, T., Cao, Xiaodong and Wagner,
R.W., Intracellular disposition and metabolism of
fluorescently-labeled unmodified and modified
oligonucleotides microinjected into mammalian cells.
Nucleic Acid Res. 1993; 21 (16) :3857-3865.
83. Beltinger, C., Saragovi, H.U., Smith, R.M., Lesauteur,
L., Shah, N., Dedionisio, L., Christensen, L., Jarett,
L., Gewirtz, A.M., Binding, uptake, and intracellular
trafficking of phosphorothioate-modified oligonucleo¬
tides. J. Clin Invest 1995; 95:1814-1823.
84. Stein, C.A., Dynamics of the internalization of
phosphodiester oligonucleotides in HL60 Cells.
Biochemistry 1993; 32:4855-4861.
85. Miller, P., Development of antisense and antigene
oligonucleotide analogs. Prog Nucleic Acid Res Mol Biol
1996; 52:261-291.
86. Lesnikowski, Z.J., Jaworska, M., Stec, W.J.,
Octa(thymidine Methanephosphonates) of partially
defined stereochemistry: synthesis and effect of

142
chirality at phosphorus on binding to pentadeoxyribo-
adenylic acid. Nucleic Acid Res. 1990; 18:2109-2115.
87. Wagner, E., Zenke, M., Cotton, M., Beug, H., Birnstiel,
M.L., Transferrin-polycation conjugates as carrier for
DNA uptake into cells. Proc. Natl. Acad. Sci. 1990;
87:3410-3414.
88. Wu, G.Y., Wu, C.H., Specific inhibition of hepatitis B
viral gene expression in vitro by targeted antisense
oligonucleotides. J. Biol. Chem. 1992; 267:12436-12439.
89. Curiel, D.T., Agrawal, S., Wagner, E., Transferrin-
polylysine-mediated gene delivery. Proc. Natl. Acad.
Sci. 1991; 88:8850-8854.
90. Zelphati, O., Szoka, F.C., Liposome as a carrier for
intracellular delivery of antisense oligonucleotides: a
real or magic bullet? J. Controlled release 1996;
41:99-119.
91. Mannino, R.J., and Gould-Fogerite, S., Liposome
mediated gene transfer. Biotechniques 1988; 6:682-690.
92. Papahadjopoulos, D., New generation liposomes: the
engineering of an efficient vehicle for intracellular
delivery of nucleic acids. TIBS 1981; March:77-80.
93. Hug, P., and Sleight, R., Liposomes for the
transformation of eukaryotic cells. Biochim et Biophys
Acta. 1991; 1097:1-17.
94. Lasic,D.D., CRC Press, Liposomes in Gene delivery,
Chapter 5 Gene delivery. 1997; 53-66.
95. Yatvin, M.B., Clinical prospects for liposomes. Medical
Physics 1982; 9:149-175.
96. Allen, T., Liposomes with prolonged circulation times:
factors affecting uptake by reticuloendothelial and
other tissues. Biochim et Biophys Acta. 1989; 981:27-
35 .
97. Allen, T., Long-circulating (sterically stabilized)
liposomes for targeting drug delivery. TIPS 1994;
15:215-220.
98. Woodle, M.C., and Lasic, D.D., Sterically stabilized
liposomes. Biochim et Biophys Acta. 1992; 1113:171-199.

143
99. Remy, J.S., Kichler, A., Mordvinov, V. , Schuber, F.,
and Behr, J.P., Targeted gene transfer into hepatoma
cells with lipopolyamine-condensed DNA particles
presenting galactose ligands: a stage toward artificial
viruses. Proc. Natl. Acad. Sci. 1995; 92:1744-1748.
100. Gregoriadis, G.,and Senior, J., Stability of small
unilamellar liposomes in serum and clearance from the
circulation: the effect of the phospholipid and
cholesterol components. Life Science 1982; 30:2123-36.
101. Lasic,D.D., CRC Press, Liposomes in Gene delivery.
Chapter 6 Liposome 1997; 67-112.
102. Pagano, R., Elsevier/North-Holland Biomedical Press,
Liposomes: From Physical Structure to Therapeutic
Application, Chapter 11: Interaction of phospholipid
vesicles with mammalian cells in vitro: studies of
mechanism.. 1981; 323-335.
103. Margolis, L., Lipid cell interactions: A novel
mechanism of transfer of liposome-entrapped substance
into cells. Biochimica et Biophysica Acta 1982;
720:259-65.
104. Margolis, L., Cell interaction with model membranes:
probing, modification and simulation of cell surface
function. Biochimica et Biophysica Acta 1984; 779:161-
189 .
105. Philippot, J.R., and Schuber,F., Liposome as tools in
basic research and industry, Chapter 8, Liposome,
Viruses, and membrane fusion. 1995; 137-150.
106. Lasic,D.D., CRC Press, Liposomes in Gene delivery,
Chapter 7, Genosomes(DNA-Lipid Complexes). 1997; 113-
142 .
107. Philippot, J.R., and Schuber,F., Liposome as tools in
basic research and industry, Chapter 14: Liposomes as
transporters of oligonucleotides. 1995; 215-224.
108. Daleke, D., Endocytosis of liposomes by macrophages:
binding, acidification and leakage of liposomes
monitored by a new fluorescence assay. Biochimica et
Biophysica Acta 1990; 1024:352-366.
109. Straubinger, R., Duzgunes, N., Papahadjopoulos, D., pH-
sensitive liposomes mediate cytoplasmic delivery of
encapsulated macromolecules. FEBS 1985; 178:148-54.

144
110. Straubinger, R., et al, Endocytosis of liposomes and
intracellular fate of encapsulated molecules: encounter
with a low pH compartment after internalization in
coated vesicles. Cell 1983; 32:1069-79.
111. Connor, J., and Huang, L., Efficient cytoplasmic
delivery of a fluorescent dye by pH-sensitive
immunoliposomes. J. Cell Biol 1985; 101:582-89.
112. Connor, J. and Huang, L., pH-sensitive liposomes: acid-
induced liposome fusion. Proc. Natl. Acad. Sci. 1984;
81:1715-18.
113. Huang, L., and Pinnaduwage,P., Stable target-sensitive
immunoliposomes. Biochemistry 1992; 31:2850-55.
114. Feigner, P.L., and Ringold, G.M., Cationic liposome-
mediated transfection. Nature 1989; 337:387-388.
115. Philippot, J.R., and Schuber,F., Liposome as tools in
basic research and industry, Chapter 9, Gene transfer
with cationic amphiphiles. 1995; 159-170.
116. Philippot, J.R., and Schuber,F., Liposome as tools in
basic research and industry, Chapter 10, Cationic
liposome-mediated gene transfer in Vitro and In vivo.
1995; 171-175.
117. Maistrello, I., and Matscher, R., Measurement of
systolic pressure of rats: comparison of intraarterial
and cuff values. J. Appl Physiol 1969; 26:188-193.
118. Frangipane, G., and Aporti, F., Improved indirect
method for the measurement of systolic blood pressure
in the rat. J. Lab Clin Med 1969; 73:872-876.
119. Ohkubo, H., Kageyama, R., Ujihara, M., Hirose, T.,
Inayama, S., and Nakanishi, S., Cloning and sequence
analysis of cDNA for rat angiotensinogen. Proc. Natl.
Acad. Sci. 1983; 80:2196-2200.
120. Liposome as drug delivery systems, Part 1: Preparation.
Biopharm 1992 October; 36-40.
121. Lappalainen, K., Urtti, A., Soderling, E., Jaaskel-
ainen, I., Syrjanen,K., and Syrjanen,S., Cationic
liposomes improve stability and intracellular delivery
of antisense oligonucleotides into Caski cells. Biochim
et Biophys Acta. 1994; 1196:201-208.

145
122. Chomczynski, P., and Sacchi, N., Single-step method of
RNA isolation by acid guanidium thiocyanate-phenol-
chloroform extraction. Anal. Biochem. 1987; 162:156-9.
123. Meinkoth, J., and Wahl, G., Hybridization of Nucleic
acids immobilized on solid supports. 1984; Anal.
Biochem. 138: 267-284.
124. Sernia,C., Shinkel,T.A., Thomas, W.G., Ho, K.K.Y., and
Lincoln,D., AGT secretion by single rat pituitary
cells: Detection by a reverse hemolytic plaque assay
and cell identification by immunocytochemistry.
Neuroendocrinology 1992; 55:308-316.
125. Singh, I., Grams, M., Wang, W., Yang, T., Killen, P.,
Smart, A., Schnermann, J., and Briggs, J., Coordinate
regulation of renal expression of nitric oxide
synthase, renin, and angiotensinogen mRNA by dietary
salt. Am. J. Physiol. 1996; 270:F1027-F1037.
126. Mossmann, T., Rapid colorimetric assay for cellular
growth and survival: application to proliferation and
cytotoxic assays. J. Immunol. Methods 1983; 65:55-63.
127. Chang, E., and A.J. Perlman, Multiple hormones regulate
angiotensinogen messenger RNA levels in rat hepatoma
cell line. Endocrinology 1987; 121:513-519.
128. Bennett, C.F., Chiang, M., Chan, H., Ellen, J.,
Shoemaker, J.E., Mirabelli, C.K., Cationic lipids
enhance cellular uptake and activity of
phosphorothioate antisense oligonucleotides. Mol Pharm
1992; 41:1023-1033.
129. Feigner, P.L., Tsai, Y.J., Sukhu, L., Wheeler, C.J.,
Manthorpe, M., Marshall, J., and Cheng, S.H., Improved
cationic lipid formulations for in vivo gene therapy.
Annals New York Academy of Sciences 1992; 126-139.
130. Jarnagin, W.R., Debs, R.J., Wang, S., and Bissell,
D.M., Cationic lipid-mediated transfection of liver
cells in primary culture. Nucleic Acids Res 1992;
20:4205-4211.
131. Woude,I.V., Visser,H.W., Ter Beest, M.B.A., Wagenaar,
A., Ruiters, M.H.J., Engbert, J.B.F.N., and Hoekstra,
D., Parameters influencing the introduction of plasmid
DNA into cells by the use of synthetic amphiphiles as a
carrier system. Biochim et Biophys Acta 1995; 1240:34-
40 .

146
132. Huí, S.W., Langner, M., Zhao, Y., Ross, P., Hurley, E.,
Chan, K., The role of helper lipids in cationic
liposome-mediated gene transfer. Biophysical J. 1996;
71:590-599.
133. Straubinger, R.M., Duzgunes,N., and Papahadjopoulos,
D., pH-sensitive liposomes mediate cytoplasmic
delivery of encapsulated macromolecules. FEBS 1984;
179 (1) : 2107.
134. Kabanov, A.V. and Kabanov, V.A., DNA complexes with
polycations for the delivery of genetic material into
cells. Bioconjugate Chem. 1995; 6:7-20.
135. Hofland, H.J., Shephard, L., and Sullivan, S.M.,
Formation of stable cationic lipid/DNA complexes for
gene transfer. Proc. Natl. Acad. Sci., 1996; 93:7305-
7309 .
136. Feigner, J.H., Kumar, R., Sridhar, C.N., Wheeler, C.J.,
Tsai, Y.J., Border, R., Ramsey, P., Martin, M., and
feigner, P.L., Enhanced gene delivery and mechanism
studies with a novel series of cationic lipid
formulation. J. Biol Chem 1994; 269 (4) :2550-2561.
137. PUYAL, C., Milhaud, P., Bienvenue, A., and Philippot,
J.R., A new cationic liposome encapsulating genetic
material: A potential delivery system for
polynucleotides. Eur. J. Biochem. 1995; 228:697-703.
138. Leonetti, J.P., Degols, G., Clarenc, P., Mechti, N.,
and Lebleu, B., Cell delivery and mechanisms of action
of antisense oligonucleotides. Prog Nucleic Acid Res
Mol biol 1993; 44:143-166.
139. Campbell,P.I., Toxicity of some charged lipids used in
liposome preparations. Cytobios 1983; 37:21-26.
140. Ahktar, S., and Juliano, R.L., Cellular uptake and
intracellular fate of antisense oligonucleotides.
Trends in cell biology 1992; 2:139-144.
141. Zelphati, O., and Szoka, F.C., Intracellular
distribution and mechanism of delivery of
oligonucleotides mediated by cationic lipids. Pharm.
Res. 1996; 13:1367-1372.
142. Minshull, J., and Hunt, T., The use of single-stranded
DNA and RNase H to promote quantitative hybrid arrest
of translation of mRNA/DNA hybrids in reticulocyte

147
lysate cell-free translations. Nucleic Acids Res 1986;
14:6433-6451.
143. Cazenave, C., Stein, C.A., Loreau, N., Thuong, N.T.,
Neckers, L.M., Subasinghe, C., Helene, C., Cohen, J.S.,
and Toulme, J.J., Comparative inhibition of rabbit
globin mRNA translation by modified antisense
oligonucleotides. Nucleic Acids Res 1989; 17:4255-4273.
144. Campbell, J.M., Bacon, T.A., and Wickstrom, E.,
Oligodeoxynucleoside phosphorothioate stability in
subcellular extracts, culture media, sera and
cerebrospinal fluid. J. Biochem Biophys Methods 1990;
20:259-267.
145. Capaccioli, S., Pasquale, G.D., Mini, E., Mazzei, T.,
and Quattrone, A., Cationic lipids improve antisense
oligonucleotide uptake and prevent degradation in
cultured cells and in human serum. Biochemical and
Biophysical communications 1993; 197:818-825.
146. Pardridge, W.M., Kang, Y.S., Yang, J., and Buciak,
J.L., Enhanced cellular uptake and in vivo
biodistribution of a monoclonal antibody following
cationization. J. Pharm. Sci. 1995; 84:943-948.
147. Takakura, Y., Hashida, M., Macromolecular carrier
systems for targeted drug delivery: Pharmacokinetic
considerations on biodistribution. Pharm. Res. 1996;
13 : 820-831.
14 8. Chowdhury, N.R., Wu, C.H., Wu, G.Y., Yemeni, P.C.,
Bommineni, V.R., and Chowdhury, J.R., Fate of DNA
targeted to the liver by asialoglycoprotein receptor-
mediated endocytosis in vivo. J. Biol Chem 1993; 268:
11265-11271.
149. Midoux, P., Mendes, C., Legrand, A., Raimond, J.,
Mayer, R., Monsigny, M., Roche, A.C., Specific gene
transfer mediated by lactosylated poly-L-lysine into
hepatoma cells. Nucleic Acids Res. 1993; 21:871-878.
150. Farhood, H., Serbina, N., Huang, L., The role of
dioleoyl phosphatidylethanolamine in cationic liposome
mediated gene transfer. Biochim et Biophys Acta 1995;
1235:289-295.
151. Hui, S.W., Langner, M., Zhao, Y., Ross, P., Hurley, E.,
Chan, K., The role of helper lipids in cationic
liposome-mediated gene transfer. Biophysical J. 1996;
71 : 590-599.

148
152. Unger, T.H., Ganten, D., Lang, R.E., Tissue converting
enzyme and cardiovascular actions of converting enzyme
inhibitors. J. Cardiovasc Pharm 1986; 8(suppl 10):S75-
S81.
153. Haber,E., Zusman,R., Burton, J., Dzau, V.J., Barger,
A.C., Is renin a factor in the etiology of essential
hypertension? Hypertension 1983; 5(suppl V):V-8.
154. Laragh, J. and Brenner, B., Hypertension:
Pathophysiology, diagnosis, and management, Volume 2,
Raven Press. Chapter 98, Expression of the Renin
angiotensin system in the kidney. 1995; 1637-1652.
155. Lindpaintner,K., Kreutz,R., Ganten, D., Genetic
variation in hypertensive and control strains, What are
we controlling for anyway? Hypertension 1992; 19:428-
430 .
156. Medina, R., Cardona, S.LE., Born, G.V., and Brown,
M.J., Effect of captopril and losartan on blood
pressure and accumulation of LDL and fibrinogen by
aortic wall and other tissues in normotensive and
hypertensive rats. J. Cardiovasc Pharm 1997; 29(1):125~
9.
157. Lemoine, N.R., and Cooper, D.N., Gene therapy, Bios.
Scientific Publisher, Chapter 2, Tissue-directed gene
delivery system. 1996; 11-32.
158. Gavras, H., and Gavras, I., Angiotensin converting
enzyme inhibitors. Properties and side effects.
Hypertension 1988; 11(suppl II): II-37-II-41.
159. Verburg, K.M., Polakowski, J.S., Kovar, P.J.,
Klinghofer, V., Barlow, J.L., Stein, H.H., Mantei,
R.A., Fung, K.L., Boyd, S.A., Baker, W.R., Kleinert,
H.D., Effects of high does of a A-74273, A novel
nonpeptidic and orally bioavailable renin inhibitor. J.
Cardiovasc Pharm 1993; 52:149-155.
160. Makino, N., Sugano, M., Ohtsuka, S., Sawada, S.,
Intravenous injection with antisense oligodeoxy-
nucleotides against angiotensinogen decreaess blood
pressure in spontaneously hypertensive rats.
Hypertension 1998; 31:1166-1170.
161. Menard,J., Boger,R.S., Moyse,D.M., Guyene, T.T.,
Glassman, H.N., Kleinert, H.D., Dose-dependent effects
of the renin inhibitor Zankiren HCl after a single oral

149
dose in mildly sodium-depleted normotensive subjects.
Circulation 1995; 91:330-338.
162. Ogihara, T., Nagano, M.f Higaki,J., Higashimori, K.,
Masuo, K., Mikami, H., Antihypertensive efficacy of
FK906, A novel human renin inhibitor. Clinical
Therapeutics 1993; 15: 539-548.
163. Paassen, P.V., Zeeuw, D., Jong, P.E., Renal and
systemic effects of the renin inhibitor Remikiren in
patients with essential hypertension. J. Cardiovasc
Pharm 1995; 26:39-45.
164. Neutel,J.M., Luther, R.R., Boger, R.S., Weber, M.A.,
Immediate blood pressure effects of the renin inhibitor
enalkiren and the angiotensin-converting enzyme
inhibitor enalaprilat. Am Heart J 1991; 122:1094.
165. Mitchell, K.D., Braam, B., and Navar, L.G.,
Hypertensinogenic mechanisms mediated by renal actions
of renin-angiotensin system. Hypertension 1992;
19(Suppl I) : 118 -127.
166. Ellis, M.L. and Patterson, J.H., A new class of
antihypertensive therapy: Angiotensin II receptor
antagonists. Pharmacotherapy 1996; 16 (5) : 849-860.
167. Mulrow, P.L. and Franco-Saenz, R., The adrenal renin-
angiotensin system: a local hormonal regulator of
aldosterone production. J. Hypertension 1996; 14:173-
176 .
168. Racz, K., Pinet, F., Gasc, J.M., Guyene T.T., Corvol,
P., Coexpression of renin, angiotensinogen, and their
messenger ribonucleic acids in adrenal tissues. J Clin
Endo Metab 1992; 75:730-733.
169. Clauser, E., Corvol, P., Menard, J. Effects of
angiotensin II on plasma ADH, prostaglandin synthesis
and water excretion in normal human. Am. J. Physiol.
1985; 248:F254-F259.
170. Wu, G.Y., and Wu, C.H., Receptor mediated gene delivery
and expression in vivo. J. Biol. Chem. 1988; 263:14621-
14624.
171. Zhu, N., Liggitt, D., Liu, Y., Debs, R., Systemic gene
expression after IV DNA delivery into adult mice.
Science 1993; 261:209-211.

150
BIOGRAPHICAL SKETCH
I was born in HeiLongJiang, China in January 1969. After
graduating from Norman Bethune University of Medical
Sciences, Changchun, China, with M.D. in 1992, I worked for
2 years at the Institute of Basic Medical Sciences, Chinese
Academy of Medical Sciences. I started graduate school in
January 1995 at College of Pharmacy, University of Florida.

I certify that I have read this study and that in my
opinion it conforms to acceptable standards of scholarly
presentation and is fully adequate, in scope and quality, as
a dissertation for the degree of Doctor of Philosophy.
C.lcOCk
Donna Wielbo, Chair
Assistant Professor of
Medicinal Chemistry
I certify that I have read this study and that in my
opinion it conforms to acceptable standards of scholarly
presentation and is fully adequate, in scope and quality,
a dissertation for the degree of Doctor of Philosophy.
as
Kenneth Sloan
Professor of Medicinal
Chemistry
I certify that I have read this study and that in my
opinion it conforms to acceptable standards of scholarly
presentation and is fully adequate, in scope and quality, as
a dissertation for the degree of Doctor of Philosophy.
Michael Kdhovich
Professor of Pharmacodynamics
I certify that I have read this study and that in my
opinion it conforms to acceptable standards of scholarly
presentation and is fully adequate, in scope and quality, as
a dissertation for the degree of Doctor of Philosophy.
CkZ
Colin Sumners
Professor of Physiology

I certify that I have read this study and that in my
opinion it conforms to acceptable standards of scholarly
presentation and is fully adequate, in scope and quality, as
a dissertation for the degree of Doctor of Philosophy.
Ian Tebbett
Professor of Medicinal
Chemistry
I certify that I have read this study and that in my
opinion it conforms to acceptable standards of scholarly
presentation and is fully adequate, in scope and quality, as
a dissertation for the degree of Doctor of .Philosophy.
Nasser ^hegini
Professor of Anatomy and Cell
Biology
This dissertation was submitted to the Graduate Faculty
of the College of Education and to the Graduate School and
was accepted as partial fulfillment of the requirements for
the degree of Doctor of Philosophy.
May 1999
Dean, Graduate School



xml version 1.0 encoding UTF-8
REPORT xmlns http:www.fcla.edudlsmddaitss xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.fcla.edudlsmddaitssdaitssReport.xsd
INGEST IEID E1VHFLZ3I_YRACAW INGEST_TIME 2014-09-11T21:33:17Z PACKAGE AA00025062_00001
AGREEMENT_INFO ACCOUNT UF PROJECT UFDC
FILES