Citation
Structure of a Skp1-glycan and biogenesis of its peptide linkage in Dictyostelium

Material Information

Title:
Structure of a Skp1-glycan and biogenesis of its peptide linkage in Dictyostelium
Creator:
Teng-Umnuay, Patana, 1961-
Publication Date:
Language:
English
Physical Description:
xiv, 139 leaves : ill. ; 29 cm.

Subjects

Subjects / Keywords:
Amino acids ( jstor )
Chromatography ( jstor )
Enzyme activity ( jstor )
Enzymes ( jstor )
Gels ( jstor )
Ions ( jstor )
pH ( jstor )
Polysaccharides ( jstor )
Purification ( jstor )
Sugars ( jstor )
Carbohydrate Conformation ( mesh )
Department of Anatomy and Cell Biology thesis Ph.D ( mesh )
Dictyostelium ( mesh )
Dissertations, Academic -- College of Medicine -- Department of Anatomy and Cell Biology -- UF ( mesh )
Glycopeptides ( mesh )
Glycosylation ( mesh )
Polysaccharides ( mesh )
Research ( mesh )
Transferases ( mesh )
Genre:
bibliography ( marcgt )
non-fiction ( marcgt )

Notes

Thesis:
Thesis (Ph.D.)--University of Florida, 1998.
Bibliography:
Bibliography: leaves 128-138.
General Note:
Typescript.
General Note:
Vita.
Statement of Responsibility:
by Patana Teng-umnuay.

Record Information

Source Institution:
University of Florida
Holding Location:
University of Florida
Rights Management:
The University of Florida George A. Smathers Libraries respect the intellectual property rights of others and do not claim any copyright interest in this item. This item may be protected by copyright but is made available here under a claim of fair use (17 U.S.C. §107) for non-profit research and educational purposes. Users of this work have responsibility for determining copyright status prior to reusing, publishing or reproducing this item for purposes other than what is allowed by fair use or other copyright exemptions. Any reuse of this item in excess of fair use or other copyright exemptions requires permission of the copyright holder. The Smathers Libraries would like to learn more about this item and invite individuals or organizations to contact the RDS coordinator (ufdissertations@uflib.ufl.edu) with any additional information they can provide.
Resource Identifier:
029814217 ( ALEPH )
51618544 ( OCLC )

Downloads

This item has the following downloads:


Full Text











STRUCTURE OF A SKP1-GLYCAN AND BIOGENESIS OF ITS PEPTIDE
LINKAGE IN DICTYOSTELIUM












By

PATANA TENG-UMNUAY













A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF TIlE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 1998














ACKNOWLEDGEMENTS

I would like to acknowledge my supervisor, Dr. Christopher M. West, for

allowing me to be a part of this interesting project and for his time and guidance. I would also like to thank other members of my committee, Dr. Jeffrey K. Harrison, Dr. Gudrun S. Bennett, and Dr. William A. Dunn, for their time and advice.

In addition, I would like to acknowledge the scientists who helped me in this

project, Drs. Howard R. Morris, Anne Dell, Maria Panico, and Thanai Paxton for their QTOF-MS study on the fucoglycopeptide, Dr. Michael R. Bubb for bringing us an idea of the actin binding motif and for his work on Skpl-actin interaction, Ms. Hanke van der Wel for her assistance and the preliminary work on purifying glycopeptide, Dr. Emil Kozarov for preparing the HW120 strain and the recombinant Skpl-His, Mr.Toby ScottWard for sharing his time with me on the fucosyltransferase project, Miss Kathryn T. Dobson for helping me screening Skpl -c-myc co-expression colonies, and Mr. Benjamin G. Luttge, Ms. Bonita Werts, Mr. Ryan Frankel, and Mr. Slim Sassi for their help in the GlcNAc-transferase project.

I would like to express my gratitude to Dr. Nancy D. Denslow and the scientists at the University of Florida ICBR Protein Chemistry Core Laboratory, Ms. Sara E. Petruska for showing me how to use MALDI-TOF-MS instrument, Mr. Edy Segura for the Edman degradation sequencing, and Mr. Alfred Chung for preparing the synthetic


Hi











peptides. Dr. David Rentz and Mr. James B. Parker at the University of Florida ICBR Glycobiology Core Laboratory are acknowledged for their assistance in the GC-MS and the Dionex-HPLC.

I would like to thank faculty members, secretaries, and graduate students in the Department of Anatomy and Cell Biology for their valuable friendship and for being an important part of my education. I also acknowledge my professor at the Chulalongkorn University, Dr. Visit Sitprija, for inspiring me to become a scientist.

Finally, I would like to thank my mother for believing in me, for teaching me to be a strong person, and for telling me not to give up my dream. Without her understanding and support, I would not be able to achieve my goal.



























Ii













TABLE OF CONTENT

page

ACKNOWLEDGMENTS ....................................................................... ii

LIST OF TABLES .............................................................................. vii

LIST O F FIG U R E S ............................................................................... viii

LIST OF ABBREVIATIONS ...................................................................... xi

A B ST R A C T ........................................................................................ xiii

CHAPTERS

1 INTRODUCTION

Protein G lycosylation ........................................................................... 1
Dictyostelium Skpl, a Marker Protein for a Novel Glycosylation Pathway ............ 5
Skpl is a Highly Conserved Protein with Multiple Cytoplasmic/Nuclear
Functions ................................................................................ 5
Skpl Mediates its Actions through an F-box Motif ................................ 7
Skpl Mediates Ubiquitin-Dependent Proteolysis of Cell Cycle and Other
Proteins through SCF complex .......................................................... 10
Skpl Mediates Phosphorylation of a Kinetochore Protein through an F-box
Motif which is Important for Kinetochore Assembly ........................... 12
The Possible Role of Skp 1 in von Hippel-Lindau Disease ........................... 13
The Importance of Skpl-Glycosylation Study ..................................... 14
The Characteristics and Compartmentalization of Skpl-Glycosylation ........... 15

2 THE GLYCOSIDIC LINKAGE AND STRUCTURE OF SKP1 GLYCAN

Introduction ..................................................................................... 17
M aterials and M ethods ........................................................................ 19
C ells ................................................................................... .. 19
Construction of Skp 1-c-myc Overexpression Strain HW120 ....................... 19
Preparation of Recombinant Dictyostelium Skp 1 (Skp 1-His) .................... 20


iv











Purification of Skpl ...................................................................... 21
Metabolic Labeling of Skpl .............................................................. 23
Monosaccharide Composition Analysis of Skpl-c-myc ......................... 23
Purification of Glycosylated Peptides .................................................. 23
Matrix-Assisted Laser Desorption Time-of-Flight (MALDI-TOF) Mass
Spectrom etry .............................................................................. 24
Q-TOF Mass Spectrometry ......................................................... 24
Exoglycosidase Digestion of Skpl Glycopeptides ................................ 24
Mild Acid Hydrolysis of the Fucoglycopeptide ................................... 26
R esults ........................................................................................ 26
Skpl Contained Only a Single Fucoglycopeptide ..................................... 26
Edman Degradation of Fucoglycopeptide Yielded the Sequence of
Peptide 139-151 ..................................................................... 28
Q-TOF MS Analysis Directly Demonstrated the Attachment of
Pentasaccharide at Pro 143 .............................................................. 28
MALDI-TOF MS Analysis of the Fucoglycopeptide ............................ 37
Sugar Composition Analysis of Skp 1 -c-myc ....................................... 37
Exoglycosidase Digestion of Fucoglycopeptide ....................................... 40
MALDI-TOF-MS Analysis of Afucosylated-Glycopeptide ...................... 42
Glycosylation Heterogeneity ......................................................... 47
D iscussion ................................................................................... 50

3 CHARACTERIZATION OF SKP1-GLCNAC TRANSFERASE

Introduction ..................................................................................... 58
M aterials and M ethods ........................................................................ 59
GlcNAc-Transferase Assay ........................................................... 59
Protein Concentration Determination ............................................... 61
Preparation of 5-Hg-dUMP Resin ................................................... 62
Preparation of Aminoallyl-UDP-GlcNAc-Sepharose for Affinity
C hrom atography ......................................................................... 63
GlcNAc-Transferase Purification ..................................................... 65
High-pH Anion-Exchange Chromatography of the Acid Hydrolysis
Derivatives of [3H]GlcNAc-Skpl ................................................. 68
The Reductive Alkaline Degradation of [3H]GlcNAc-Skpl ......................... 68
R esults ........................................................................................ 69
GlcNAc-Transferase Activity that Modified Skpl was Found in
the S 100 Fraction of Dictyostelium ................................................... 69
Purification Step 1: Anion Exchange Chromatography on DEAE
Fast-Flow .............................................................................. 75


v











Purification Step 2: Ammonium Sulfate Precipitation ................................ 79
Purification Step 3: Hydrophobic Interaction Chromatography on
Phenyl-Sepharose-(Low-Sub) Fast-Flow ......................................... 83
Purification Step 4: Reactive Dye Chromatography on Reactive Red-120
Fast-Flow .............................................................................. 83
Purification Step 5: Gel Filtration Chromatography on Superdex HPLC .......... 87 The Effects of Nucleotide Analogues on GlcNAc-Transferase Activity ........... 93
Purification Step 6: 5-Hg-dUMP-Sepharose 6B Chromatography ................ 96
Purification Step 7: affinity Chromatography on
5-(-3-aminoallyl)-UDP-GlcNAc Sepharose-4 Fast-Flow ......................... 100
Characteristics of the Acceptor Substrate Product .................................. 103
Kinetic Properites of the Skpl-GlcNAc-Transferase ............................... 105
D iscu ssion ..................................................................................... 110

4 SUMMARY AND PERSPECTIVES

Structure and Biogenesis of a Skp 1 -Glycan ............................................... 114
Dictyostelium Skpl Contains a Novel Pentasaccharide Linked to
H ydroxyproline ........................................................................ 114
Evidence of Skpl-Prolylhydroxylase Activity in the Cytosol ..................... 115
Characterization of Cytosolic Skpl-GlcNAc-Transferase .......................... 117
Characterization of Cytosolic Skpl-Fucosyltransferase ............................ 118
Evidence of Skpl-Galactosyltransferase in the Cytosol of Dictyostelium ........ 119
The Effects of Dictyostelium Skpl on Actin Polymerization ........................... 119
Preparation of Skp 1-c-myc Co-expression Strains ....................................... 120
Construction of a Plasmid Encoding Skpl-c-myc .................................... 120
In Vitro Site-Directed Mutagenesis of p48 ........................................... 122
Transformation of Dictyostelium Strain Ax3 .......................................... 124
Future D irection .............................................................................. 126

R E FE R E N C E S .................................................................................... 128
BIOGRAPHICAL SKETCH .................................................................... 139











vi













LIST OF TABLES


Table page


1.1. Glycosidic peptide linkage ................................................................3
1.2. Amino acid sequences of Skpl at positions 35-40 .....................................9
2.1. Exoglycosidase treatments of glycopeptides .........................................25
2.2 Predicted m/z values of endo-Lys-C derived Skpl peptides .......................29
2.3 MALDI-TOF-MS m/z values for endo-lys-c-derived glycopeptides .............51
2.4 Phylogenetic comparison of sequences surrounding Pro 143 .......................54
3.1 Purification of GlcNAc-transferase activity ..........................................80
3.2 Relative activity of the GlcNAc-transferase in the presence of donor
substrate analogues .......................................................................94
4.1 The oligonucleotide primers used to prepare Skpl 1-c-myc plasmids .............123


























vii














LIST OF FIGURES

Figure page

1.1 Genomic map of the regions surrounding thejfal andfpa2 genes ..................8
2.1. Purification of the [3H]fucoglycopeptide from Skpl .................................27
2.2 Q-TOF MS analysis of Skpl fucoglycopeptide ......................................30
2.3 MS/MS collisionally activated decomposition spectrum of m/z 829.42 ........31
2.4 Parts of the MS/MS spectrum shown in Fig. 2.3 expanded to show lower
mass region containing peptide-derived fragment ions more clearly ...............33
2.5 Parts of the MS/MS spectrum shown in Fig. 2.3 expanded to show higher
mass region containing peptide-derived fragment ions more clearly ...............34
2.6 Predicted masses of N and C terminal sequence ions of the
fucoglycopeptide.. .........................................................................35
2.7 MALDI-TOF-MS analysis of Skpl glycopeptides from normal strain Ax3 ......38 2.8 Fractionation of endo-Lys-C generated Skpl-His peptides .........................39
2.9 GC-MS analysis of Skpl -c-myc total sugars .........................................41
2.10 A time course MALDI-TOF-MS analysis of Skpl fucoglycopeptide
after m ild acid hydrolysis ................................................................43
2.11 Fractionation of endo-Lys-C generated afucosylated Skpl peptides .............. 44
2.12 MALDI-TOF-MS analysis of Skpl glycopeptides from
afucosylation strain HL250 ..............................................................46
2.13 Fractionation of endo-Lys-C generated Skpl-c-myc peptides ......................48
2.14 The mass spectra of endo-Lys-C generated Skpl-c-myc peptides ................49
3.1 Transfer of [3H] from UDP-[3H]-GlcNAc into S100 fractions of normal strain
Ax3 and overexpression strain HW120 ...............................................71
3.2 Transfer of [3H] from UDP-[3H]GlcNAc into S100 fractions of normal strain Ax3
and overexpression strain HW120 in the presence of Skpl-peptide 133-155 .....72
3.3 Inhibition of GlcNAc-transferase activities by synthetic peptide 133-155 and
anti-Skpl -antibody .......................................................................73
3.4 GlcNAc-transferase activity is specific for Skp 1l-c-myc ............................74


viii











3.5 Transfer of [3H] from UDP-[3H]-GlcNAc into P100 fractions of normal strain
Ax3 in the presence of Skpl-c-myc ....................................................76
3.6 The effects of pH on Skpl-GlcNAc-transferase activity ...........................77
3.7 GlcNAc-transferase activities in the flowthrough and wash fractions from
D EA E-Sepharose .........................................................................78
3.8 The effects of NaCl and KCl on GlcNAc-transferase activity .....................81
3.9 The effects of CaCl2 and MnCl2 on GlcNAc-transferase activity .................82
3.10 Purification of GlcNAc-transferase on phenyl-Sepharose low-sub column .......84
3.11 Purification of GlcNAc-transferase on a Reactive Red-120 column ............... 85
3.12 Reactive Red flowthrough fractions could not restore GlcNAc-transferase
activity ......................................................................................86
3.13 Ax3-S 100 or phenyl-Sepharose fraction did not increase GlcNAc-transferase
activity in the Reactive-Red purified fraction .........................................88
3.14 Purification of GlcNAc-transferase on a Superdex gel filtration HPLC
colum n ......................................................................................89
3.15 The GlcNAc-transferase activity is dependent on DTT ............................90
3.16 The GlcNAc-transferase activity is dependent on MgCl2 ..........................91
3.17 The effects of detergents on G1cNAc-transferase activities..........................92
3.18 The chemical structure of UDP-G1cNAc and the potential enzyme recognition
sites tested by nucleotide analogues ....................................................95
3.19 The structure of 5-Hg-dUMP-Sepharose 6B .........................................97
3.20 The effects of uracil on Superdex purifed and dUMP-Sepharose purified
G lcN A c-transferase .......................................................................98
3.21 Time course analysis of GlcNAc-transferase activity ...............................99
3.22 Chromatography of the reaction products from 5-(3-aminoallyl)-UDP-GlcNAc
synthesis after purification over a DEAE Sepharose Fast Flow column .........101 3.23 The structure of 5-(3-aminoallyl)-UDP-GlcNAc Sepharose 4 ....................102
3.24 Purification of GlcNAc-transferase activity on 5-(3-aminoallyl)-UDP-GlcNAc
Sepharose ................................................................................104
3.25 High-pH anion-exchange chromatography of the acid hydrolysis derivatives
of [3H ]G lcN A c-Skpl ...................................................................106



ix











3.26 Kinetic properties of the GlcNAc-transferase with respect to the HyPro
p eptid e .................................................................................... 107
3.27 Kinetic properties of the GlcNAc-transferase with respect to
Skp 1 -c-m yc ............................................................................... 108
3.28 Kinetic properties of the GlcNAc-transferase with respect to
U D P-G lcN A c ............................................................................. 109
4.1 Inhibition of actin polymerization by Dictyostelium Skpl ......................... 121






































x













LIST OF ABBREVIATIONS

Ara arabinose
ATP adenine 5'-triphosphate
Bio- 11 -UTP 5-(N-[N-biotinyl-e-aminocaproyl]-3-aminoallyl)-2'-UTP
cFTase cytosolic facosyltransferase
CTP cytosine 5'-triphosphate
Da dalton
DEAE diethylarninoethyl
DMF NN-dimethylfonnainide
DTT dithiothreitol
dUDP 2'-deoxy-uridine 5'-diphosphate
dUMP 2'-deoxy-uridine 5'-monophosphate
EDTA ethylenediamine-tetraacetic acid
Gal D-galactose
GaINAc N-acetylgalactosamine
GC-MS gas chromatography mass spectrometry
Glc D-glucose
GlcNAc N-acetyl-D-glucosamine
H20 water
HCI hydrochloric acid
HEPES N-(2-Hydroxyethyl)piperazine-N'-(2-ethanesulfonic acid)
Hg('-') mercury
HgCl mercury chloride
HPLC high pressure liquid chromatography
KCI potassium chloride
LiCl lithium chloride
LSB, Lammeli sample buffer
mAb monoclonal antibody
MALDI-TOF MS matrix-assisted laser desorption time-of-flight mass spectrometry
Man mannose
MeCN acetonitrile
M, molecular weight
NaBH4 sodium borohydride
NaCl sodium chloride
NaOAC sodium acetate
NaOH sodium hydroxide
NHS N-hydroxysuccinimide


?d











(NH4)2SO4 ammonium sulfate
ORF open reading frame
PAGE polyacrylamide gel electrophoresis
PCR polymerase chain reaction
POPOP (dimethyl) 1,4-Bis(2-(4-Methyl-5-Phenyloxazoyl))Benzene PPO 2,5-Diphenyloxazole
Q-TOF MS quadrupole time-of-flight mass spectrometry
Rha rhamnose
RP-HPLC reversed phase-high pressure liquid chromatography
SDS sodium dodecyl sulfate
TEA triethylamine
TEAB triethylamine-bicarbonate
TFA trifluoroacetic acid
TMS trimethylsilyl
UDP uridine 5'-diphosphate
UMP uridine 5'-monophosphate
UTP uridine 5'-triphosphate
Xyl xylose



























xii













Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy

STRUCTURE OF A SKP1-GLYCAN AND BIOGENESIS OF ITS PEPTIDE LINKAGE IN DICTYOSTELIUM

By

Patana Teng-umnuay

December, 1998

Chairman: Christopher M. West, Ph.D.
Major Department: Anatomy and Cell Biology

Skpl is involved in the ubiquitination of certain cell cycle and other proteins. In Dictyostelium discoideum, Skpl has an unusual O-linked carbohydrate modification. Based on Edman degradation, MALDI-TOF-MS, Q-TOF-MS-MS decomposition, acid hydrolysis, and exoglycosidase studies of Skp 1 -glycopeptides from both normal cells and a fucosylation mutant, and the sugar composition of the protein determined by GC/MS analysis of TMS-derivatives of methanolysates, the glycan is concluded to consist of a linear pentasaccharide (Gal 1 l-6Gala 1 -Fucoa 1 -2Galp 1-3 GlcNAc) attached to a hydroxyproline at codonl43, which lies in a highly conserved region of the protein. The structure of the pentasaccharide and its glycosidic peptide linkage indicate a novel pathway of protein glycosylation which is predicted to consist of six novel enzymes including a prolyl-hydroxylase and five glycosyltransferases. An assay was developed for



xiii











the GlcNAc-transferase responsible for the attachment of the first sugar to the HyPro residue, using UDP-[3H]GlcNAc as a donor, and underglycosylated Skpl isolated from a Dictyostelium overexpression strain or a synthetic peptide as an acceptor. Skp 1 -GlcNActransferase activity was found in the S100 fraction but not in the P100 particulate fraction. The recombinant Skp 1 from E. coli and the synthetic peptide containing Pro in place of HyPro were inactive. The radioactivity was recovered as GlcNH2 after acid hydrolysis, indicating the incorporation of GlcNAc. Incorporated GlcNAc could not be released by 3-elimination, indicating the attachment to HyPro. The GlcNAc-transferase activity was purified to 17,000 folds with 14% yield from the cytosolic S100 fraction over DEAE, phenyl, Reactive Red, Superdex, dUMP, and UDP-GlcNAc columns. The enzyme behaved as a single component with an apparent Mr of 33,000 and apparent Km for UDP-GlcNAc of 0.16 gM. Activity of the enzyme was absolutely dependent on DTT. The presence of this enzyme in the cytosolic fraction, its requirement for a reducing environment, and its high affinity for UDP-GlcNAc strongly suggest that the GlcNAc-transferase glycosylates Skp 1 in the cytoplasm. The Skp 1 -GlcNAc-transferase and the previously described Skpl-fucosyltransferase appear to belong to a glycosylation pathway which is novel with respect to the structure formed and its compartmentalization in the cytoplasm rather than in the secretory pathway.







xiv














CHAPTER 1
INTRODUCTION

Protein Glycosylation

Glycosylation, the construction of oligosaccharide side chains of proteins and lipids, is the most common and the most diverse type of protein posttranslational modification. It is known to occur in every eukaryotic organisms and in some prokaryotic organisms including many species of archaebacteria and eubacteria (reviewed in Hart, 1992, Opdenakker et al., 1993). In an individual glycoprotein, more than one carbohydrate attachment is often present and each attachment site may contain different glycans. This microheterogeneity generates multiple glycoforms which may have different physical and biochemical properties and may lead to different functions.

Glycans are conjugated to proteins by three types of covalent linkages: N-linked, O-linked, and phosphate-linked glycosylation. The most well known N-glycosidic linkages are formed between N-acetylglucosamine and the amido group of L-asparagine. It is initiated in the rER by the en bloc transfer of a Glc3Man9GlcNAc2 precursor from a dolichol carrier onto the nitrogen in the asparagine of nascent polypeptides. The oligosaccharide structures are later modified in the ER and in the Golgi apparatus (reviewed in Kornfeld & Kornfeld, 1985, Abeijon & Hirschberg, 1992). The asparagine which is the attachment site for the GlcNAc residue is a part of a consensus motif, AsnX-Ser/Thr, where X may be any amino acid except proline. The Asn-X-Thr motif is more commonly utilized compared to the Asn-X-Ser motif (Kasturi et al., 1995). The


1








2


exception to this motif is nephritogenoside, in which glucose is N-linked to the sequence Asn-Pro-Leu (Shibata et al., 1988). Other N-linked monosaccharides were discovered in bacterial glycoproteins including glucose, N-acetylgalactosamine and rhamnose (Lis and Sharon, 1993).

O-glycosidic linkages are formed between oligosaccharide side chains and the

hydroxyl group of serine, threonine, tyrosine, hydroxylysine, or hydroxyproline. Most of the O-linked glycosylation pathways also occur in the secretory pathway. The oligosaccharide side chains are linked through the oxygen of hydroxyl group of serine, threonine, tyrosine, hydroxylysine, or hydroxyproline by sequential enzymatic additions of monosaccharides directly to the protein, beginning with N-acetyl-galactosamine in mucin-type glycans. In contrast to N-linked glycosylation, different types of O-linked glycosidic-peptide linkages have been identified (Table 1.1). Whereas the existence of specific motifs for the acceptor site has been identified in most of O-glycosylproteins (Bourdon et al., 1987; Harris and Spellman, 1993; Pisano et al., 1993; Plummer et al., 1995, Prockop et al., 1979), the consensus motifs of O-linked glycosylation in the secretory pathway are less defined which might be explained by different types of GalNAc-transferases (reviewed in Clausen & Bennett, 1996).

Recently, a new type of carbohydrate-peptide linkage named

phosphoglycosylation has been demonstrated in Proteinase I isolated form Dictyostelium discoideumn. It contains GlcNAc-1-PO4 linked to serine (Gustafson and Milner, 1980). Thereafter, 2 other cystein proteinases from D.discoideum were also shown to posses GlcNAc-1- P04 phosphoglycosylation (Mehta et al., 1996). Besides D. discoideum,








3


Table 1.1 Glycosidic peptide linkage (modified from Vliegenthart and Montreuji, 1995)

Type of glycoprotein Amino acid Reducing terminus
monosaccharide
N-glycosylp~roteins
Secretory type Asn j3-GlcNAc
Bacterial proteins Asn 1-GalNAc
Bacterial proteins Asn cx! j-Glc
Bacterial proteins Asn L-Rha
0-glycosylproteins
Mucin type glycoproteins Ser/Thr cx-GalNAc
Cytosolic proteins Ser/Thr 1-GlcNAc
Yeast proteins Ser/Thr Man
Rat tissues Ser/Tbr c-L-Fuc
Proteoglycan Ser f3-Xyl
Worm collagen Ser u-Gal
Factor IX Ser f3-Glc
Collagen OH-Lys 1-Gal
Extensin OH-Pro j3-L-Araf
Algae proteins OH-Pro 1-Gal
Skpl OH-Pro GlcNAc
Glycogenin Tyr cx-Glc
Clostridium protein Tyr j3-Glc








4


other examples ofphosphoglycosylation were also identified in Leishmania secreted acid phosphatases, and Trypanosoma cruzi cell surface glycoproteins (reviewed in Haynes, 1998).

Even though glycosylation was first localized in the endoplasmic reticulum and the Golgi complex of eukaryotic cells, it has been shown that the cytosol is a site of a simple form of glycosylation: the attachment of single N-acetylglucosamine residues in Olinkage to serines and/or threonines on multiples sites of nuclear and cytoplasmic proteins (termed O-GlcNAc) (reviewed in Haltiwanger et al., 1992b, Hart 1997). The first OGlcNAc proteins to be identified were the nuclear pore proteins. Thereafter, an increasing number of O-GlcNAc proteins in cytosolic and nucleoplasmic compartments have been recognized. The model that O-GlcNAc occurs in the cytosol has been confirmed by the finding that a UDP-GlcNAc:polypeptide O-GlcNAc glycosyltransferase enzyme can be purified from a cytosolic preparation of the liver (Haltiwanger et al., 1992a). Besides OGlcNAc proteins, other known cytosolic proteins which contain carbohydrate include glycogenin, phosphoglucomutase, and Dictyostelium Skpl. Glycogenin is a precursor for glycogen synthesis. Its tyrosine residue is attached with glucose. After a glycogen synthesis is completed, the protein buries itself inside the glycogen molecule (Pitcher et al., 1987, reviewed in Alonso et al., 1995). Phosphoglucomutase or parafusin is a cytosoic enzyme catalyzing the converting reaction of glucose-1-PO4 into glucose-6- PO4. Its glycan consists of Man capped by Glc-1-PO4 (Dey et al. 1994, Marchase et al., 1993, Veyna et al., 1994).








5


Dictyostelium Skpl, a Marker Protein for a Novel Glycosylation Pathway

In Dictyostelium discoideum, Skpl (S phase kinase-associated protein 1 or

suppressor of kinetochore protein 1) was discovered in the mutant strain HL250 which is defective in the ability to make GDP-fucose from GDP-mannose and consequently, is unable to carry out any fucosylation (Gonzales-Yanes et al., 1992). When exogenous fucose was given, HL250 cells could synthesize GDP-fucose via a salvage pathway. Treatment of HL250 vegetative cells with 3H-fucose showed that majority of 3H-fucose was incorporated into a single protein, Skpl (previously known as FP21).

In a cytosolic preparation of Dictyostelium discoideum, Skpl was present in both the S100 which is a cytosolic fraction after centrifugation at 100,000 g, and the P100 which is a particle fraction. The P100-Skpl was salt but not detergent extractable. These data are relevant to immunofluorescence studies using antibody against Skp 1 showing the localization of Skpl in the cytosol, on the membrane of large vesicle-like structures, and in the membrane ruffle. The cytosolic-localization of Skpl raised the possibility of a novel pathway of glycosylation in the cytosolic compartment of eukaryotic cells. Skpl is a Highly Conserved Protein with Multiple Cytoplasmic/Nuclear Functions

Skp 1 is an evolutionarily conserved protein expressed in all eukaryotic organisms. Skpl homologs have been found in Saccharomyces cerevisiae, Homo sapiens, Cavia porcellus (OCP-II), Emericella nidulans (SconC), Arabidopsis thaliana, Phaseolus vulgaris, Caenorhabditis elegans, chlorella virus (PBCV-1) genome, and many others. The sequence analysis of homologs of Skpl gene shows more than 60% identity in pairwise comparisons. The cellular compartmentation of Skpl appears to be varied








6


depending on the tissue or cell type. The localization of Skpl indicates multiple proposed functions in both nuclei and cytoplasm.

In human transformed fibroblasts, Skpl was copurified with Skp2-cyclin A-Cdk2 complex and was named Skpl for S phase kinase-associated protein (Zhang et al., 1995). Skpl is indirectly associated with cyclin A by binding to a F-box motif on Skp2p. Even though the function of Skpl in mammalian cells seems to be cell cycle regulatory, the expression of Skpl in the cytosol of the inner ear organ of Corti in guinea pig (Chen et al., 1995) and in rat brain neurons which do not express cyclin A and CDKs (Uro-Coste et al., 1997) implicates other functions of Skpl.

In E. nidulans, the Skpl homolog, SconC, is important in sulphur metabolite repression, a condition when the addition of methionine to the growth medium reduces the utilization of less favored sulphur sources such as sulphate (Natorff et al., 1993).

Most of the known functions of Skpl came from studies in yeast. In S. cerevisiae, Skpl homolog was identified as a cyclin F binding protein using the two-hybrid system (Harper et al., 1993). It was also independently identified as a component ofS. cerevisiae kinetochore binding protein, Cbf3p, and was coincidentally named Skpl for suppressor of kinetochore protein 1 (Stemmann and Lechner, 1996).

Different temperature-sensitive alleles of Skpl show that Skpl is required for cell cycle progression at both the Gl/S and G2/M checkpoints. In one study, the mutation of Ile to Asn at codonl72 (Skpl-3) caused haploid cells to arrest with a Gl DNA content whereas the mutation of Leu to Ser at codonl46 (Skpl-4) caused haploid cells to arrest with a G2 DNA content with an increased rate of chromosome missegregation (Connelly








7


and Hieter, 1996). In another study, the temperature sensitive mutant carrying two mutations resulting in Gl60E and R167K changes caused cells to arrest with a GI DNA content whereas the mutant with L8G change caused cells to arrest in both G1 and G2 (Bai et al., 1996). It is notable that all of these amino acids where the mutation occured are well-conserved among species including D. discoideum.

S.cerevisiae Skpl has a 28 amino acid insertion (codon 37-64) when aligned with the other homologs of Skpl. Since a plasmid construct with an in-frame deletion of the 28 amino acids could rescue a null mutation of Skpl and high level of expression of the human gene can complement the Skpl temperature sensitive mutant, the amino acid insertion in the yeast protein seems not to be critically important (Bai et al., 1996).

In Dictyostelium, Skpl is encoded by 2 genes namedfral andfa2 which are wellconserved (Fig. 1.1, West et al., 1997). The coding regions of both genes differ by 33 nucleotides and a short intron within the codon33 inj~a2. Both genes encode identical proteins except a single amino acid Ser/Ala at the codon 39. The amino acid sequencing of Skpl detected both A and S at codon 39 indicating that both genes were expressed (Table

1.2, West et al., 1997). In comparison to Dictyostelium, there appears to be 1 gene in S. cerevisiae, more than 7 genes in C. elegan, and 2 loci in mammalian cells (Chen et al., 1995, Demetrick et al., 1996).

Skpl Mediates its Actions through an F-box Motif

Sequence comparison of Skpl-interacting proteins (Skp2 and cyclin F) revealed an important motif, F-box, as a Skpl binding site (Bai et al., 1996). The examples of F-box proteins include Cdc4, cyclin F, Skp2, Grrl, Scon-2, and other undefined sequences









8





















fpal v BI 1I; l IVRI VB A

ARRV BlA

-2.9 -1.2 -1.1 0 0.8 3.1 4.3 6.1 kb
0.33 0,41



fpa2 VV NB1X
RI BI
N A BI RIBI

-4.0 -2.5 -1.7 -1.0 0 0.0 .0 1.8 4.5 kb
0.34 0.55






Figure 1.1 Genomic map of the regions surrounding thefpal andfpa2 genes. The regions corresponding to the cDNA offal are represented by the boxes. Distances are given in kb from the start of thefal cDNA. N= Ndel, A=AccI, B1=BstBI, R1=EcoRI, V= EcoRV, X1= BstXL. (West et al., 1997)








9


Table 1.2 Amino acid sequences of Skpl at positions 35-40

Amino acid Position
35 36 37 38 39 40
Gly 5.73 0.95 0.24 0.00 0.09 0.00
Glu 0.00 5.12 0.54 0.00 0.15 0.00
Ser 0.07 0.00 1.85 0.14 0.45 0.00
Asp 0.07 0.00 0.00 3.85 0.51 0.17
Ala 0.02 0.00 0.02 0.00 2.46 0.49
Pro 0.00 0.14 0.00 0.00 0.01 3.02

Skpl sequence G E S D A'S P
fima1 sequence G E S D S P
fra2 sequence G E S D A P
Amino acid sequence of the M, 10,600 CNBr fragment isolated from total Skpl isolated from the soluble S100 fraction. Amino acid yields for cycles 5-10, corresponding to positions 35-40 of the intact protein, are given. In addition, both gene products are found in both soluble (I & 11) Skpl pools (West et al., 1997).








10


from Genebank database. Besides the F-box motif, these proteins usually contain either WD-40 repeats such as Cdc4 or leucine-rich repeats such as Skp2, Grrl, and p58 (Bai et al., 1996; Kaplan et al., 1997). The role of F-box proteins have been demonstrated in the ubiquitination of Sicl and Cln1 (Feldman et al., 1997; Skowyra et al., 1997), and the phosphorylation of p58, a subunit of a kinetochore binding protein, Cbf3p (Kaplan et al., 1997).

Skpl Mediates Ubiquitin-Dependent Proteolysis of Cell Cycle and Other Proteins through SCF Complex

Controlled intracellular proteolysis is important for many cell functions. One of the processes, ubiquitination, is composed of series of enzymatic reactions required for the attachment of a multiubiquitin chain on a target protein (reviewed in Hochstrasser, 1996). The first step is the activation of ubiquitin by the ubiquitin-activating enzyme

(El) resulting in the formation of an El-ubiquitin thiol ester. In the second step, ubiquitin-conjugating enzymes (E2) mediate the transfer of ubiquitin from El-ubiquitin complex to a substrate protein. This step usually requires an E3-enzyme (ubiquitinprotein ligase) for the substrate specificity. Then, ubiquitinated proteins are degraded by a specific multiprotein protease complex, the 26S protease.

Ubiquitin-dependent proteolysis is essential for two steps of cell cycle, G1 to Sphase, and metaphase to anaphase. Substrates for the ubiquitin proteolytic pathway include cyclins, which are positive regulators of cyclin-dependent kinases (Cdks), and Cdk inhibitors, which are negative regulators. In S. cerevisiae, Cdc 28 (Cdk 2,4,5, and 6 in higher eukaryotes) is activated in G1 phase by the G1 cyclins, Clnl,2, and 3 (cyclin C, D,








11

and E in higher eukaryotes) and in S through M phase by the mitotic cyclins, Clbl-Clb6 (reviewed in Nasmyth, 1996). Whereas mitotic cyclins degradation are regulated by E3 ubiquitin ligase called the anaphase promoting complex (APC), G1 cyclins and Cdk inhibitors are requlated by E3 ubiquitin ligase complex which recognizes phosphorylated substrate (reviewed in Hershko, 1997). One of the E3 ubiquitin ligase complex composed of Skpl, Cdc53 (Cullin) and the F-box protein (SCF complex) has been shown to regulate ubiquitin-dependent degradation of many GI cyclins and Cdk inhibitors (reviewed in Krek, 1998).

The entry into S-phase requires the activation of the Clb/Cdc28 kinase complex. These kinase complexes are initially inactive due to the presence of high levels of the Sphase Cdk inhibitor, Sicl (Nugroho and Mendenhall, 1994; Schwob et al., 1994) which is synthesized in late mitosis. Gl cyclin-dependent kinase proteins (Clns/Cdc28) phosphorylate Sicl (Verma et al., 1997a), which triggers the degradation of Sicl (Verma et al., 1997b). The degradation of phosphorylated Sicl is controlled by E2 ubiquitinconjugating enzyme, Cdc34 (Goebl et al., 1988; Schwob et al., 1994), and E3 ubiquitin ligase complex formed by three other proteins, Skpl, Cdc53, and F-box protein/Cdc4 (Schwob et al., 1994; Bai et al., 1996).

Similar to Sic 1, the degradation of G1 cyclins, Clns, also require Cdc34, Skpl, and Cdc53. However, the F-box component of SCF complex for Clns degradation process is Grrl instead of Cdc4 (Barral et al., 1995) indicating the role of F-box protein on substrate specificity. Grrl binds phosphorylated Clns and Grrl/Clns is connected to other ubiquitination regulatory proteins through Skpl ( Li and Johnston, 1997; Skowyra et al.,








12

1997; Kishi et al., 1998). GRR1 was initially identified as a gene required for glucose repression in S. cerevisiae (Flick and Johnston, 1991). Mutations in GRR1 relieve repression of many glucose-repressed genes (Bailey and Wood word, 1984; Flick and Johnston, 1991) and prevent glucose induction of hexose transporter (HXT) genes (Ozcan and Johnston, 1995). Interestingly, the binding of Skpl to Grrl is regulated by the presence of glucose in the media and Skplinteracts with Grrl and Cdc53 to mediate the glucose-induced HXT genes by an unknown mechanism which does not require Cdc34 (Li and Johnston, 1997).

The example of Sicl and Clns degradation indicates that one of the molecular mechanisms of Skpl is to link an F-box protein and its target to Cdc53 for ubiquitin dependent proteolysis. Besides Sicl and Clns, other regulatory proteins have been shown to be degraded by the SCF pathway, including the Cln/Cdc28 inhibitor Farl (Henchoz et al., 1997), the replication protein Cdc6 (Drury et al., 1997), and the transcription factor Gcn4 (Kornitzer et al., 1994).

Skpl Mediates Phosphorylation of a Kinetochore Protein through an F-box Motif which is Important for Kinetochore Assembly

Skpl has other functions that are not related to proteolysis as well. Skpl was independently identified as a component ofS. cerevisiae kinetochore binding protein, Cbf3 (Stemmann and Lechner, 1996). Cbf3 is a 240 kDa multicomponent protein that specifically binds to CDEIII, a conserved element of the centromere DNA sequence (lechner and carbon, 1991), Cbf3 is composed of 4 subunits, p23 (Skpl), p58, p64, and p110 (Lechner and Carbon, 1991; Stemmann and Lechner, 1996). All four components are








13


important for Cbf3 assembly and CDEIII binding (Lechner, 1994; Sorger et al., 1995; Kaplan et al., 1997). Yeast cells carrying the Skpl mutation arrest in G2 and exhibit an increased rate of chromosome loss (Connelly and Hieter, 1996).

Active Cbf3p can be formed from purifed p64, p110 and activated p58. Skpl activates p58 by an interaction with the F-box motif on p58 and mediates p58 phosphorylation. Recombinant Skpl alone was inactive in reconstituting the CDEIII binding activities of Cbf3p in Skpl-4 strain but recombinant p58 isolated from insect cells coexpressed with Skpl and p58 could restore the activities indicating the requirement of interaction between Skpl and p58 (Kaplan et al., 1997). Because Skpl does not contain any protein kinase motif, an unidentified kinase in Skpl-p58 complex is required for p58 phosphorylation.

The Possible Role of Skpl in von Hippel-Lindau Disease

Von Hippel-Lindau (VHL) disease is a hereditary syndrome characterized by the development of vascular tumors of the central nervous system, retina, kidney, pheochromocytomas, pancreatic islet cell tumors, and benign cysts in multiple organs. The defect occurs by germ line mutations of the tumor suppressor gene, VHL (reviewed in Maher and Kaelin, 1997). The VHL gene product, pVHL, blocks the binding of elongin A to elongin B and elongin C resulting in the inhibition of elongin activity (Duan et al., 1995). The elongin activity is important for stabilizing hypoxia-inducible mRNAs including vascular endothelial growth factor (VEGF) and Glutl glucose transporter and pVHL is a negative regulator. The role of SCF complex in von Hippel-Lindau disease has been investigated, based on the findings that elongin A is an F-box protein, elongin B








14


contains a region which is similar to ubiquitin and elongin C contains a region which is homologous to Skpl. Recently, cullin (Cul2), another component of SCF complex has been shown to interact with elongins B/C and pVHL (Lonergan et al., 1998). The similarity of pVHL-elongins B/C-Cul2 and SCF complex suggests the possible role of Skpl on the regulation of hypoxia-inducible mRNA by pVHL. The Importance of Skpl-Glycosylation Study

As described above, Skpl is an essential, multifunctional protein involved in

metabolite repression, kinetochore assembly, and cell cycle control in fungi, yeast, and mammalian cells. A putative mechanism of Skpl is to target F-box proteins and their complexes for specific activities, which can explain how the protein is associated with such diverse functions. Skpl binding to the F-box motif in Cdc4 and Grrl connects Sicl and Cln to the ubiquitin degradation complex, respectively. Another example is the binding of Skpl to p58 which leads to the activation of p58 by phosphorylation indicating that Skpl connects p58 to an unidentified kinase. Since many cytosolic and nuclei proteins have been found to contain the F-box motif, additional protein-complexes and functions of Skpl will likely be discovered.

In Dictyostelium, the finding that Skpl contains fucose, which is unusual for a cytosolic protein, has made Skpl a model for the study of a novel protein Oglycosylation pathway. It is yet to be proved whether glycosylation of Skp 1 occurs in other cell types. Structural heterogeneity mediated by glycosylation of Skpl may be important for the specificity of Skpl-protein interaction. Moreover, the carbohydrate structure may be important for cytosolic localization which consequently regulates Skp l








15


function in the nucleus.

Glycosylation in the secretory pathway of certain proteins has been shown to be important for protein folding, targeting, and/or ligand binding (reviewed in Varki, 1993). In addition, there is evidence that cytosolic glycosylation may have regulatory functions. Clostridial toxins inactivate Rho subfamily members of GTP-binding proteins by glycosylation (Just et al., 1995a; Just et al, 1995b). O-GlcNAc modifications are found to be dynamic and their attachment sites are indistinguishable from or close to those used by various protein kinases suggesting the competition of O-GlcNAcylation with phosphorylation (Chou et al., 1995; reviewed in Greis and Hart, 1997). Another example of the importance of cytosolic glycosylation is demonstrated in the O-GlcNAc protein, p67. Inactivation of eIF-2 kinase is dependent on the glycosylation state of p67. Deglycosylation of p67 activates eIF-2 kinase resulting in an inhibition of the translation factor, eIF-2o (Chakraborty et al., 1994).

The Characteristics and Compartmentalization of Skpl-Glycosylation

Indirect lines of evidence suggest that the glycosylation process of Skpl occurs in the cytosolic compartment. First, a fucosyltransferase (cFTase) which can fucosylate Skpl has been purified from the S100 of Dictyostelium (West et al., 1996). Moreover, the Skpl cDNA does not encode a targeting sequence essential for translocation into the secretory pathway. Finally, the Skpl sequence contains the consensus motif for N-linked glycosylation at amino acid residue 45, Asn45-Val-Thr, but it is not N-glycosylated. These reasons imply that Skpl remains in the cytoplasm after translation and is not translocated into the ER.








16

It will be impossible to study the importance of the cytosolic-fucosylation pathway of Skpl unless its glycan structure and biosynthesis are characterized. To support the future structure and function investigations of the Skpl glycan, the nature of the previously identified cytosolic fucosylation in Dictyostelium was determined in this study. The Skpl glycan has been identified as a linear pentasaccharide (Gall-6GalalFuccl-2GalP1-3GlcNAc) attached to a hydroxyproline at codonl43. The construction of this unusual structure is predicted to require six enzymes including one prolylhydroxylase and six glycosyltransferases. The Skpl-GlcNAc-transferase, the enzyme responsible for the attachment of the first sugar, GlcNAc, has been purified from the cytosol of Dictyostelium. Its activity is dependent on the presence of reducing reagent and has a submicromolar Km for the substrate, UDP-GlcNAc. These findings support the hypothesis that this new glycosylation pathway resides in the cytosolic compartment of the cell.













CHAPTER 2

THE GLYCOSIDIC-PEPTIDE LINKAGE AND STRUCTURE OF SKP1 GLYCAN Introduction

Skpl is found in a multiprotein complex with cullin (a cdc53 homologue) and an F-box containing protein to form the SCF complex, named as an acronym of the participating proteins. When this complex contains an E2 enzyme, it is responsible for ubiqutinating various target proteins, depending on the identity of the F-box protein. Targets for subsequent degradation identified in Saccharomyces cerevisiae include cell cycle proteins such as the S-phase kinase inhibitor Sic1 and G1 cyclins, and proteins specific to the nutrition of the cell (Bai et al., 1996; Skowra et al., 1997; Feldman et al., 1997; Li and Johnston, 1997). The SCF complex has also been implicated in phosphorylation of kinetochore proteins (Kaplan et al., 1997), and another distantly related complex affects mRNA metabolism (Lonergan et al., 1998). An SCF complex with Cyclin A and Cdk2 has been detected in mammalian cells and its abundance appears increased in transformed cells (Zhang et al, 1995; Lisatwan et al., 1998). Skpl itself is abundantly and dynamically expressed in the mouse embryo (Sowden et al., 1995) and central nervous system including post-mitotic neurons (Uro-coste et al., 1997) and at very high concentrations in the inner ear organ of Corti (Chen et al., 1995; Yoho et al., 1997), where it comprises up to 5% of total protein in the cytoplasm. The expression of several Skpl genes in plants appears to be governed by morphogenetic boundaries (Ingram et al., 1997). Thus Skpl is expressed ubiquitously in eukaryotes, and its role may


17








18


be to facilitate the selection of other proteins for specific posttranslational modification.

Binding of Skpl to different proteins may be regulated structurally, as it is encoded by multiple genes in multicellular organisms (Chen et al., 1995; Bai et al., 1996; Demetrick et al., 1996; Liang et al., 1997; West et al., 1997). Skpl structure is also altered by glycosylation in Dictyostelium discoideum (Gonzalez-Yanes et al., 1992; Kozarov et al., 1995), which may regulate its activity. Because complex glycosylation of cytoplasmic/nuclear proteins is unusual, we embarked on a study to establish the structure of the carbohydrate modification as a first step in investigating its function.

In order to determine the structure and site of attachment of the previously

described Skpl fuco-oligosaccharide(s) (Gonzalez-Yanes et al., 1992; Kozarov et al., 1995), mass spectrometric approaches were employed. Key to the success of the this methodology was the newly developed Q-TOF MS (Morris et al., 1996; Moris et al., 1997), which permitted MS-MS studies to be performed on the pmol quantities of material available from native sources. This recently designed instrument comprises a quadrupole with collision cell followed by an orthogonal acceleration time-of-flight (TOF) analyzer which confers a high degree of sensitivity and accuracy to the mass measurements. The ability of this instrument to sequence both the peptide and oligosaccharide chains of a Skpl fucoglycopeptide suggested that it consists of a linear pentasccharide, D-Galpcal,6-D-Galpc l,-L-Fucpol,2-D-Galpp31,3GlcNAc, attached to hydroxylated Pro 143. The sugar sequence was established from exoglycosidase studies using MALDI-TOF-MS and sugar analyses on genetically-overexpressed material. The protein attachment site was then confirmed by Edman degradation.








19

These results reinforce the model that complex O-linked glycosylation occurs in the eukaryotic cytoplasmic compartment. While there has been much circumstantial evidence to support this model (Hart et al., 1989), it has remained controversial (Medina and Haltiwanger, 1998). In contrast, simple glycosylation, in the form of GlcNAc O-linked to residues of Ser or Thr, is well established in this compartment (Hart, 1997). The sugar structures which have been described to date on cytoplasmic/nuclear proteins are generally distinctive from those produced in the secretory pathway, suggesting that there may be fundamental differences in the biogenesis and function of these modifications.

Materials and Methods

Cells

Strains Ax3 and HL250 were grown at 22oC in HL-5 medium on a gyratory shaker. In 6 liter flasks, cells grew to a density of 6-10 x 107per ml, which is referred to as stationary phase. Ax3 is a normal strain and HL250, derived from Ax3 by chemical mutagenesis, is unable to synthesize GDP-Fuc from GDP-Man and thus incorporates negligible Fuc into protein (Gonzalez-Yanes et al., 1992; Kozarov et al., 1995). Construction of Skpl-c-myc Overexpression Strain HW120

A full-length cDNA from thefpal gene with a decapeptide encoding the human cmyc epitope, EQKLISEEDL (Kolodziej, et al., 1991), inserted between codons 161 and 162 near the C-terminus was prepared by PCR and cloned into pT7Blue (Novagen). The cDNA was subcloned into pVEIIAATG (Rebstein et al., 1993) under the control of the inducible discoidin promoter and the actin 8 terminator. The plasmid was transformed








20

into D. discoideum by a CaPO4 precipitation method and selected in the presence of 15 mg/ml G418 (Ferguson et al., 1994). Strain HW120 was a clone which produced Skp 1-cmyc at higher levels than its companion strains based on Western blot analysis with mAb 9E10 against the c-myc epitope. Skpl-c-myc contained two missense mutations, T194C and A305G resulting in amino acid substitutions I34T and D71G, introduced by the PCR reaction and confirmed by MS analysis of its peptides (data not shown). Preparation of Recombinant Dictyostelium Skpl (Skpl-His)

The open reading frame of Skpl was amplified using Dictyostelium DNA as the template and oligonucleotides, 5'tgctctcgagctcggatccattttgtgatgctgtttgta3' and 5'gactgagctcgaggatccaatgtctttagttaaattagaatctt3' as primers in a polymerase chain reaction. these primers contained BamHI restriction sites which were used to clone the amplified DNA into the BamHI restriction site of the inducible (Dubendorff and studier, 1991; Studier, 1991) expression vector pET 19b (Novagen, Madison, WI), downstream of the T7 RNA polymerase transcription element such that an oligo-His tag was introduced at the NH2 terminus. The deduced NH2-terminal sequence of Skpl-His is MGHHHHHHHHHHSSGHIDDDDKHMLEDP followed by the natural Skpl sequence, which was verified by sequencing of the plasmid DNA and contained 2 nonsense mutations. Expression host Escherichia coli BL21(DE3) cells carrying a lysogen with a copy of the T7 RNA polymerase gene under lacUV5 control were transformed under carbenicillin selection. After induction with isopropyl-1-thio- 3-Dgalactopyranoside, expressing colonies were examined. Inclusion bodies were not observed. Skpl-His was isolated from a single colony under nondenaturing conditions








21

using an affinity column consisting of nickel cations immobilized on Sepharose 6B, essentially as described (Hochuli et al., 1988). Purified protein was exhaustively dialyzed against 50 mM HEPES-NaOH (pH 7.4) and concentrated in a centrifugal ultrafiltration concentrator (10-kDa molecular mass cut-off). Purified protein was shown to be recognized in a Western blot by monoclonal antibodies 3F9 and 4E1 confirming its identity as Skpl.

Purification of Skpl

Cell lysis. D. discoideum strains Ax3, HL250 or HW120 were grown to stationary phase in HL-5 medium. After washing once in ice-cold water, cells were resuspended in 50 mM Tris-HC1, 0.25 M sucrose, pH 7.4 containing protease inhibitors (10 gg/ml leupeptin, 10 gg/ml aprotinin, 1.0 mM phenylmethylsulfonyl fluoride). The suspension was suctioned though a bed of glass wool, and lysed by forced passage though a 47 mm diameter Nuclepore filter with 5 pm diameter pores mounted on the end of a 60 ml syringe. The lysate was centrifuged at 4,000 x g for 2 min, and the supernatant was centrifuged at 100,000 x g for 60 min. All procedures were performed at 0-40C.

DEAE-Sepharose-Fast-Flow chromatography. The final S100 supernatant was pumped onto a 450 ml DEAE-Sepharose Fast Flow Column (4.6 x 28 cm) preequilibrated in 50 mM HEPES-NaOH (pH7.4), 15% glycerol, 5 mM MgCl2, 0.1 mM disodiumEDTA, 1.0 mM DTT and the column was washed with the equilibration buffer until the A280 dropped below 1% of its maximum. Skpl was eluted in a linear gradient of 0-0.25 M NaCl, consisting of 2.5 x column bed volumn of equilibration buffer and 2.5 x








22

column bed volumn of 0.25 M NaC1 in the same buffer. Analysis of fractions using a mAb 3F9 ELISA/dot blot assay revealed that Skpl from Ax3 and HL250 were fractionated into pools-I and -II (Kozarov et al., 1995). Skpl-c-myc from strain HW120 was eluted after pool-II.

Phenyl-Sepharose 6 Fast-Flow chromatography. DEAE pools were pumped onto a phenyl-Sepharose 6 Fast Flow (high-sub) column pre-equilibrated in 15% saturated (NH4)2SO4, 85 mM NH4OAc and the column was washed with the equilibration buffer until the A280 dropped below 1% of its maximum. Skpl was eluted by a decreasing gradient of (NH4)2SO4, consisting of 2.5 x column bed vol. of starting buffer and 2.5 x column bed vol of 2 mM NH4OAc, pH 7.4.

Monoclonal antibody 3F9 affinity chromatography. Phenyl-Sepharose pools were applied to immobilized rabbit IgG (pre-column) and mAb 3F9 columns, which were connected in series and pre-equilibrated in PBS. After loading of the sample, the mAb 3F9 column was disconnected and washed with the same buffer until all nonbound protein was washed out. The column was eluted with 0.1 M glycine-HC1, pH 2.5. The eluted fractions were collected into 1.5 ml tubes containing 100 gl of 1M Tris, natural pH.

Reversed-phase high-performance liquid chromatography. In some cases, Skpl was reduced and carboxamidomethylated. The protein was partially dried down in a speed-vac, brought to 7.5 mM DTT in 8 M urea, 0.4 M NH4HCO3, pH 7.9, heated to 50'C for 15 min, and incubated at 220C in 17 mM iodoacetamide for 15 min in the dark. The carboxamidomethylated protein was further purified on a C2/C18 (PC 3.2/3) RP-








23


HPLC column on a Pharmacia SmartSystem HPLC and eluted with a gradient of 0% (v/v) MeCN in 0.1% (v/v) TFA to 100% MeCN in 0.085% TFA. The peak which contained more than 80% of total Skpl was examined further. Recombinant Skpl (fpal) containing an N-terminal oligo-His tag was isolated from E. coli as described (Kozarov et al., 1995), and further purified on a RP-column as above. Metabolic Labeling of Skpl

A 200 ml culture of Ax3 cells was grown for 3 generations in 0.05 mCi/ml [3H]Fuc in HL-5. Skpl was isolated in the same manner except the phenyl-Sepharose step was omitted. Purified radiolabeled Skpl was pooled with unlabeled Skpl. Monosaccharide Composition Analysis of Skpl-c-myc

Two nmol of mannitol was added as an internal standard to 1.5 nmol of Skpl -cmyc. The sample subjected to methanolysis, re-N-acetylation, and TMS-derivitization as described (Elwood et al., 1988), and analyzed in splitless mode on a 0.32 mm x 30 m SPB-1 column (Supelco) on a Shimadzu QP-5000 GC/MS workstation. Peaks were analyzed with selected ion monitoring at m/z 204 for the neutral sugars and m/z 173 for the N-acetylated amino sugars.

Purification of Glycosylated Peptides

Carboxamidomethylated Skpl was digested with endo-Lys-C from Achomobacter lyticus (Wako) in the presence of 2 M urea in 0.2 M Tris-HC1, pH 7.4, using an enzyme:substrate ratio of 1:200 (mol:mol), at 300C for 18 h. Peptides from metabolicallylabeled Skpl were fractionated on a Superdex Peptide HR10/30 HPLC column (Pharmacia) in 6 M urea in 50 mM NaCl, 50 mM Tris-HC1, pH 7.2, on an LKB GTi








24


HPLC system at 0.5 ml/min. Radioactive fractions were applied to a 4.6 x 150 mm, 3.5 mm particle C8 column (Zorbax) and eluted with a gradient of 5% (v/v) MeCN in 0.1% (v/v) TFA to 40% MeCN in 0.085% TFA at a flow rate of 1 ml/min. Peptides (25 pmol) were subjected to Edman degradation on an ABI model 494 Procise sequenator. Nonradiolabeled endo-Lys-C peptides were fractionated directly a C8 (Zorbac) or C2/C18 (PC

2.1/2; Smart System, Pharmacia) RP-columns as above. Matrix-Assisted Laser Desorption Time-of-Flight (MALDI-TOF) Mass Spectrometry

Samples were mixed with an equal volume of saturated a-cyano-4-hydroxycinnamic acid (Aldrich) in 70% acetonitrile. One gl (2-3 pmol) was deposited on a sample plate and allowed to air dry. Spectra were collected on a PerSeptive Biosystem Voyager RP MALDI-TOF-MS operated in the positive ion and linear modes. Q-TOF Mass Spectrometry

Samples from RP-fractions were introduced directly into the Q-TOF MS

(Micromass, UK) via a nanospray device. Primary and secondary ion spectra were collected in the positive ion mode.

Exoglycosidase Digestion of Skpl Glycopeptides

Approximate 15 pmol of glycopeptide from RP-fractions was partially dried by vacuum centrifugation, diluted to a final volume of 2.5 pl in a buffer containing the exoglycosidase (see Table 2-1), incubated at 370C for 18 h, and processed for MALDITOF-MS.









25


Table 2.1 Exoglycosidase treatments of glycopeptides

Pentasaccharide- peptide substrate
(initial mass m/z 2017) ______________________Enzyme Specificity Source Buffer b m/z
ct-galactosidase (10 mU/pil) Galcxl,2,3,4,6 green coffee 50 mM (NH4)2P04 2165
__________bean (B-M) d pH 6.0 (-2 hex)
oc-galactosidase (10 jiU/gl) Galcdl,3 recombinant 20 mM (NH4)2P04 2487
___________(Glyko) pH 6.0
c-galactosidase (IOjiU/jii) Galal,3/6 X.manihotis 20 mM (NH4)2P04 2327
____________________(NEB) pH 6.0 (-1 hex)
P-gucosidase (10 mU/gl) GluIGal/Fuc3 sweet almond 20 mM (NH4)2P04 2487
_____________________(B-M) pH 5.0
ax-fucosidase (2.5 mU/ Ll) Fuccl,2/314!6 bovine kidney 20 mM (NH4)2P04 2487
____________________(B-M) pH 5.0
cx-galactosidase (10 mU/ Ll) Galaxl,2,3,4,6 green coffee 50 mM (NH4)2P04 2017 + ax-fucosidase (IOWmU/ tl) -iFuccl,2 bean (B-M) d + pH 6.0 (-2 hex,
X.manihotis I dhex)
(NEB)

Disaccharide-4peptide substrate
(initial mass m/z 2017) ________ ________Enzyme Specificity Source Buffer b m/z
P-galactosidase (4 mU/[tl) Galfpl,3!4>6 bovine kidney 25 mM NH4OAc 1855
______________________________(OGS) pH 6.0 (-1 hex)
P-galactosidase (4.8 mU/gl) GalfPl,3/6 recombinant 20 mM (NH4)2P04 1855
___________(Glyko) pH 5.0 (-1 hex)
1-galactosidase (4.8 mU/pAl) Gal 31,3 X.manihotis 20 mM (NH4)2P04 1855
__________(NEB) pH 5.0 (-1 hex)
P-galactosidase (4 mU/gl ) Galfpl,3/4>6 bovine kidney 20 mM (NH4)2P04 1855
1-HexNAcase (6.5 mU/A) --GlcNAc/ (OGS) + pH 5.0 (-1 hex)
GalNAc3 jack bean (V________________________ ____________ Labs) _ ___aB-M = Boehinger-Mannheim, NEB = New England Biolabs, OGS =Oxford
GlycoSciences.
b. All reactions were incubated at 37'C for 18 h.
Glycopeptides purified by RP-HPLC were analyzed by MALDI-TOF-MS before and after treatment. All reactions were complete, that is, >95% of the parental ion was lost
and replaced by the major ion whose mass is described by the loss of one or more hex
or deoxyhex (dhex) units.
d. cx-galactosidase activity was purified from contaminating P-galactosidase activity as
described (Jacob and Scudder, 1994).








26


Mild Acid Hydrolysis of the Fucoglycopeptide

Approximate 20 pmol of the fucoglycopeptide was partially dried down in a

vacuum centrifuge, reconstituted in 10 gl of 0.05 M TFA, and incubated at 95C for up to 6 h.

Results

Skpl Contained Only a Single Fucoglycopeptide

To investigate the glycosylation of Skpl, normal cells (strain Ax3) were

metabolically labeled with [3H]Fuc, S 100 was extracted and purified by DEAE anion exchange chromatography. Skpl was separated into 2 pools as described (Kozarov et al., 1995; West et al., 1996). Skpl pool II was further purified to homogeneity by phenyl Sepharose chromatography and mAb 3F9 affinity chromatography. A pooled preparation of labeled and unlabeled material was denatured in urea, reduced and alkylated with iodoacetamide, and digested with endo-Lys-C in the presence of 2 M urea. When fractionated on a Superdex Peptide gel filtration column in the presence of 6 M urea, radioactivity eluted as a single peak centered at fraction 23 (Fig. 2.1A), which was further fractionated on a C8-reversed-phase (RP) HPLC column, again yielding a single radioactive peak centered at fraction 35 (Fig. 2.1B) which did not absorb at 280 nm and contained 30% of the original radioactivity. These results suggested that Skpl contained only a single fucoglycopeptide. A parallel experiment using unlabeled preparation showed an identical absorbance peak at fraction 35. Unlabeled purified peptide was used for MS analysis and Edman degradation.









27






A



E
o 023
0
O


10 20 30 40 50
35 time (min) 40 B
E






80
0






C2
20 40 60 80 35 time (min)





Figure 2.1 Purification of the [ H]fucoglycopeptide from Skpl. The normal strain Ax3 was metabolically labeled with [3H]Fuc, and Skpl pool II was purified from the
0
4


0 20 40 60 80
ti me (mi n)


Figure 2.1 Purification of the [3 Hjfuoglycopeptide from Skpl. The normal strain Ax3 was metabolically labeled with [3 H]Fuc, and Skpl pool Il was purified from the S 100 fraction to homogeneity. Reduced and alkylated Skpl was digested with Endo-LysC, and peptides were resolved on a Superdex Peptide gel filtration column (A). The radioactive fraction 23 was chomatographed on a C8-reversed phase column, which resolved 4 peptides (B). One of these, centered at fraction 35, was radioactive and did not absorb at 280 nm. This Skpl fucoglycopeptide was used for most of the structural studies.








28


Edman Degradation of Fucoglycopeptide Yielded the Sequence of Peptide 139-151

Edman degradation of unlabeled peptide fraction 35 yield the sequence

NDFTEEEEQIRK, which corresponded to that predicted for peptide 139-151 (Table 2.2) except that no signal was detected at the position of Pro 143. This finding suggested that Pro 143 was modified which could be explained if Pro 143 was glycosylated (Allen, 1981).

Q-TOF-MS Analysis Directly Demonstrates the Attachment of the Pentasaccharide at Pro143

This work was in collaboration with Dr. Howard R. Morris and Prof. Anne Dell at the Department of Biochemistry, Imperial College, London. The HPLC fraction (#35) containing the putative fucoglycopeptide was subjected to tandem mass spectrometry on a Q-TOF mass spectrometer. Analysis of a few picomoles in the MS-only mode gave a major [M+3H]3+ signal at m/z 829.42 (Fig. 2.2, including inset). Note the resolved natural abundance 13C isotopes at m/z 829.70 and 830.03 showing that this signal is triplycharged. It therefore derives from a molecule of mass 2485 Da. A series of doubly-charged ions were also apparent in the spectrum, separated by sugar mass differences (m/z 1244, 1163, 1081, 1008 and 927). The ion at m/z 1244 is the [M+2H]2+ ion corresponding to the [M+3H]3+ at m/z 829.42, and the mass differences from this correspond to intervals of Hex, Hex, Fuc and Hex respectively.

MS/MS of the m/z 829 [M+3H]3+ ion using argon gas and 50 eV collision energy produced the spectrum shown in Fig. 2.3. Interestingly, the spectrum shows the formation (from rn/z 829) of a number of doubly-charged ions at m/z 826, 927, 1009,









29


Table 2.2 Predicted m/z values of endo-Lys-C derived Skpl peptides

Peptide Sequence Predicted mass (mlz)
2-5 SLVK 447
6-12 LESSDEK 808
13-18 VFEIEK 765
19-28 EIAC*MSVTIK 1153
29-53 NMIEDIGESDS(A)PIPLPNVTSTILEK 2714
54-72 VLDYC*RHHHQHSPQGDDK 2328
73 K 147
74-76 DEK 391
77-90 RLDDIPPYDRDFC*K 1812
91-109 VDQPTLFELILAANYLDIK 2177
110-117 PLLDVTC*K 947
118-126 TVANMIRGK 990
127-133 TPEEJRK 873
134-138 IFNIK 635
139-151 NDFTPEEEEQIRK 1636
152-159 ENEWC*EDK 1111
160-162 GGN 247

* assume single C has carboxyamidomethyl substituent












30


















100- 829.70
+++
100 829.70


829.42 80.03










10




829 830 831/

p+

1008"46
~10089

37.009,47

84 .8209 +- 1009,92 108198
-- ,9 ,.,,,-, 2 27.4"1+ +
84 5 .41 927.9 954.91
~8 0 900.9K 1 10, 040.88 1162.91 124405


8 8 O 940 1000 1050 i10 Ii80 12b0 1250 1300 150 1400



Figure 2.2 Q-TOF MS analysis of Skpl fucoglycopeptide. A partial ES mass

spectrum of fraction 35 from Fig. 1 is presented, showing doubly and triply-charged ions.

The triply-charged ion at m/z 829 is expanded in the inset to show the isotope pattern.












31


















100. 16308

91 05







Peptide
I
HexNAc
[M+2H]2
927.92


927.45
204.12
Peptide

HexNAc, Hex
Peptide 28.42 [M+2H]2 M 2 .1008.94
826.41 Peptlde
825.90- 1
1008.46 HexNAc, Hex, Fuc 1009.43 [M+2H]2 Peptide Peptide
26.924 [M+H] + HexNAc
.230. 10 1851.79 tM+H)
2'9 y"' 1650.78
1081.48 1173.57 1 255,12377.17 .1081.48 Ha117.57xNAc 1
813.39 1019 175

4820 818.94 126
41 th a 11 4 2 61 L9 j1 1 1 1 7 1853.74
o260 360 460 60 s60 760 'abo ao' iooo ilbo 1200 130.1400 1800 i600 1f00 1800 1900 200




Figure 2.3 MS/MS collisionally activated decomposition spectrum of m/z 829.42+++. There is evidence in the MS and MS/MS spectra of minor variants in structure, but the data are consistent with the major molecular species present corresponding to the structure described in the text.








32

1081 and 1163 separated by sugar mass differences of HexNAc, Hex, Fuc and Hex respectively, suggesting a stepwise stripping of these sugars from a linear oligosaccharide attached to the glycopeptide. These data confirm that, in the MS spectrum shown in Fig.

2.2, the labeled doubly-charged ions were formed in that case by cone-voltage induced fragmentation from a true quasimolecular ion at m/z 829. The doubly-charged ion at m/z 826 (Fig. 2.3) showed no evidence of further sugar loss and is interpreted as the remaining peptide backbone. This is confirmed by the presence of a major singly-charged quasimolecular ion signal at m/z 1651 [M+H] for the peptide. A search for this mass in the gene derived sequence finds nothing, but the peptide identity can be determined from the presence of N- and C-terminal sequence ions (Morris et al., 1981) (Fig. 2.6, b and y" respectively) in the low mass range of the spectrum. This shows the presence of a Cterminal Lys in the molecule via an ion at m/z 147 which is extended via signals at m/z 303 (y2"), 416 (y3"), 544 (y4"), 673 (y5") and 802 (y6") (Figs. 2.3 and 2.4) to give the sequence ... EEQL/IRK. Note the relatively high intensity of the m/z 544 isotope peak at m/z 545 (Fig. 2.4) showing that the Q residue is partially deamidated. This is observed in all ions containing that residue and also accounts for the high intensity of the 1651.79 satellite to the quasimolecular ion signal in Fig. 2.3. The partial sequence determined from the C-terminal (y") ions is further complemented by N-terminal (b) ions at m/z 230, 377 and 478 corresponding to a (230)-F-T sequence. The sequence ion data thus lock the peptide portion of the molecule onto residues 139-151 in the sequence (NDFTPEEEEQIRK) except that the mass found in the Q-TOF MS/MS collision spectrum is 16 Da higher than that predicted for the peptide (1635 [M+H] ). This is












33
















100 230.10
b2









b3
377.17





% 255.12 36.1
386.18


618.94
273.13
b4
Y 47820
y2z
30324 587.33 YS 711.33

Y"4 802.47
378.15 y"3 544.38 63781 88.86 712,33 739,88
309.13 360.16 416.31 5323.4 2 3 8
50119 5.32 588.27 ,682 359.16 433.18 461.20 .19
.388.20 58.78 75832 7598811


225 25( 25 3 00 3 3 3~5 40 5 40 4 0 25 S6 55 600' 6 5 65 65 700 725 70 775 0





Figure 2.4 Parts of the MS/MS spectrum shown in Fig. 2.3 expanded to show lower

mass region containing peptide-derived fragment ions more clearly.













34













100 1173.57
y"a
Peptide
I
HoxNAc, Hex, Fuc
[M+2Hj 2*
1081.98





1174.54 1082.41

1081.48
y"9
I
HexNAa 1376.61


1082.91
1377.66

y"10 1274.64 y11 y y"
II y"8 1175.63 1378.62 1421.81 HexNAc HexNAe, Hex

112 75.48 1422.74 7 2
1 9.8 1162.7412 .6

1423.77 1 1522 3.94



1050 10 1 1100 11 5 111 115 1200 15 1250 12 130 1 S 1350 135 14 14 1450 14 5 150 2 125 190








Figure 2.5 Parts of the MS/MS spectrum shown in Fig. 2.3 expanded to show

higher mass region containing peptide-derived fragment ions more clearly.









35




















bl b2 b3 b4 b5 b6 b7 b8 b9 blO bl1 b12
11505 230.08 377.15 478j.19 591.24 720.28 849.32 978.36 1107.41 1235.47 1348.55 1504.65


NDFT EEEEQIRK

1536.71 1421M 1274-1 1173.56 1060,52 931Q48 802. 67339 544.35 41629 30321 147.11 y"12 y"11 y"10 y"9 y"8 y"7 y"6 y"5 y"4 y"3 y"2 y"l







Figure 2.6 Predicted masses of N and C terminal sequence ions of the fucoglycopeptide.








36


interpreted as a post-translational hydroxylation of one of the amino acids present, and this could not be at the C-terminal Lys residue, already assigned in the fragmentation data.

Screening the higher mass fragments in the spectrum alows a clear assignment of where the 16 Da increment is attached via the signals at m/z 1060 and 1173 in Fig. 2.5. These show that the Pro C-terminal sequence ion, y9", is 16 Da higher than the theoretical value for the sequence (1057 Da), showing that it is a HyPro in this position. The signals at m/z 1274 and 1421 complete a series showing -F-T-P(OH)- in the sequence.

Importantly, Fig. 2.5 also allows assignment of the attachment site of the

carbohydrate to the peptide. The signal at m/z 1376 is a HexNAc residue away from the m/z 1173 ion showing that the carbohydrate is attached via a HexNAc residue to the HyPro and not, as may have been expected, to the Thr residue. A further signal at m/z 1477 extends this ion series to the yl0" sequence ion TP(OH)EEEEQIRK substituted with HexNAc on the HyPro. The signal at m/z 1538 corresponds to the y9" ion with a Hex-HexNAc substituent, and the sugar sequence data assigned from the doubly-charged ions at m/z 826, 927, 1008, 1081, 1163 and 1244 (Figs. 2.2 and 2.3) now overlaps the singly-charged MS/MS glycopeptide data giving confirmation of the sequence. MS/MS data on several of the cone-voltage induced doubly-charged glycopeptide fragment ions also corroborated the above interpretation.

A mild TFA hydrolysis experiment on a remaining small quantity of sample

showed the disappearance of the m/z 829 triply-charged signal together with the other doubly-charged ions, excepting m/z 1008 and a weak triply-charged signal at m/z 672,








37

suggesting, as do the MS/MS data, that the saccharide is a linear molecule with Fuc midchain.

Taking all the MS and MS-MS data into consideration the structure of the

fucoglycopeptide was assigned as NDFT(Hex---Hex- Fuc- Hex--->HexNAc)hydroxyPEEEEQIRK. Subsequent Edman degradation sequencing on a 20 pmol sample confirmed the entire sequence of 13 residues, except for a blank at cycle 5, expected to be Pro. MALDI-TOF-MS Analysis of the Fucoglycopeptide

The MALDI spectrum contained a major [M+H] signal at m/z 2487 (Fig. 2.7A) which was equivalent to the triply-charged ion at m/z 829.70 in the Q-TOF spectrum. In addition, a series of low abundance ions were observed at m/z 2326, 2164, 2017, 1855 and 1652 consistent with sequential loss of Hex, Hex, Fuc, Hex and HexNAc respectively. The low abundance ions appeared to be fragmentation products of the m/z 2487 ion resulting from similar frequency of scission of each of the glycosidic linkages (Dell, 1983) rather than incompletely glycosylated species, because less-glycosylated peptides eluted later from the RP-column (see below). The m/z 2487 ion was not seen in a similar analysis of RP-fractionated peptides (Fig. 2.8) of recombinant Skpl isolated from E. coli (data not shown), showing that it was specific to the protein expressed in Dictyostelium. Sugar Composition Analysis of Skpl-c-myc

To determine its monosaccharide composition, Skpl was isolated from the S100 fraction of a D. discoideum strain (HW120) genetically modified to overexpress, under the control of the inducible discoidin promoter, a form of the protein with a c-myc-epitope tag near its C-terminus. The sugars of purified Skpl-c-myc were examined by GC/MS









38



A. Hex- Hex- deoxyHex- Hex- HexNAc- OHPro
2487










1653 1855 2017 2164 2326

B. [Galhl,6- Hex- deoxyHex- Hex- HexNAc- OHPro 2325

2487


C. [Gala1,6-Galal ]- deoxyHex- Hex-HexNAc- OHPro 2163




D. [Galal,6- Galal,- Fucal,2J- Hex- HexNAc- OHPr o 2017




I I I II
1600 1800 2000 2200 2400
Mass (m/z)


Figure 2.7 MALDI-TOF-MS analysis of Skpl glycopeptides from normal strain Ax3. A. Mass spectra of the fraction 35 fucoglycopeptide from Fig. 2.1, isolated from the normal strain Ax3. In addition to the primary ion, a series of low abundance fragment ions corresponding to selective glycosidic scissions of the glycan chain are noted. B. Treatment of the fraction 35 fucoglycopeptide with Xmanihotis al-->3/6-galactosidase. C. Treatment of the fraction 35 fucoglycopeptide with green coffee bean a-galactosidase. D. Treatment of the fraction 35 fucoglycopeptide with green coffee bean a-galactosidase and X manihotis oal-->2-fucosidase. Structures suggested by the experimental result shown and other results are given in each panel in brackets.









39






%B
A. RPC 3.2 100

a
AU 80
1.0
0.8- 60
S0.6- -40
S0.4
-20
S0.2
~0.0
2.0 4.0 6.0 ml
AU B. RPC 2.1
1.5


S1.0 Skpl peptide 139-151 %B
50
-40
0.5- 30
0
.20

-10
0.0
1.0 5.0 10.0 ml







Figure 2.8 Fractionation of endo-Lys-C generated Skpl-His peptides. A. Purified recombinant Skpl (Skp 1-His) from E.coli was reduced-alkylated and furthered purified over the RP-HPLC. The first peak (a) was used for Endo-Lys-C digestion. B. Endo-LysC digested Skp 1-His were fractionated over the RP-HPLC. The fractions containing peptide peak with 215 nm absorbance were subjected for MALDI-TOF mass spectrometry. Skpl-peptide 139-151 with a predicted m/z 1636 was eluted at 5.5 min.








40


after methanolysis, re-N-acetylation, and formation of TMS-derivatives. To achieve the sensitivity required to analyze 1.5 nmol of Skpl-c-myc, splitless injection and selected ion monitoring was employed. Fuc (0.33 nmol), Gal (0.70 nmol), and GlcNAc (0.32 nmol) were the three most abundant sugars detected (Fig. 2.9), and their low levels indicated that overexpressed Skpl was under-glycosylated. Fuc and Gal were previously detected after 2M TFA hydrolysis (Kozarov et al., 1995), but GlcNAc was not. The stronger acid conditions of methanolysis were probably required to liberate GlcNAc from its linkage with hydroxyproline, and Xyl is not found in the fucoglycopeptide according to the MS results. Thus the GC/MS data showed that the deoxyHex residue identified by MS was L-Fuc as suggested by metabolic labeling, and showed that all thee Hex residues were Gal and that the HexNAc was GlcNAc. Exoglycosidase Digestion of Fucoglycopeptide

To assign linkages, the fucoglycopeptide was treated with exoglycosidases and analyzed by MALDI-TOF-MS. The mass of the glycopeptide was reduced by 2 Gal residues (to m/z 2163) after treatment with the non-specific green coffee bean a-Dgalactosidase (Fig. 2.7C), but was not altered by non-specific bovine kidney Pgalactosidase, sweet almond 3-glucosidase, or bovine kidney a-fucosidase. Furthermore, one Gal residue was susceptible to removal by X manihotis c l--+3/6-galactosidase (Fig.

2.7B) but not recombinant Glyko al-+3-galactosidase, showing that it was cal--6linked. Fuc was susceptible to removal (yielding m/z 2017) only after removal of the ca-









41















Standard jMan
Fuc Gal GIC GIcNAc



ji IIlaIy A AAL MaAO GaINAcJ

FSkpl -c- myc ~Ga j 1a(
Mac GIcNAc



Blank




22 i4 26 8 3'0 3A 34 3,6 30 40

El uti on ti me





Figure 2.9 GC-MIS analysis of Skpl-c-mye total sugars. Standard sample containing 2 nmol of the indicated sugars, 1.5 nmnol Skpl-c-myc with 2 nmnol of added mannitol (ManOH) as an internal standard, and blank sample were subjected to methanolysis, reN-acetylation, and TMS-derivitization, and analyzed in splitless mode on a Shimadzu QP-5000GC/MS workstation.








42


linked Gal residues, as shown by double enzyme digestion experiments employing the oagalactosidase and either non-specific bovine kidney c-fucosidase or X manihotis cal ---2L-fucosidase (Fig. 2.7D). Since Fuc does not contain a 6-linkage site, this means that Fuc was capped by a Galcal--6Gal disaccharide, and the disaccharide was ca-linked to L-Fuc. These results indicate that the outer sugars form a linear trisaccharide, Gall -- 6Galal--4Fucal-->2, in accord with the MS data.

A time course MALDI-TOF-MS analysis during mild acid hydrolysis of the fucoglycopeptide yielded a mass decrease of 2 Hex residues and one deoxyHex residue (m/z 2487 to m/z 2017) with no intermediates detected (Fig. 2.10), as also seen in the corresponding Q-TOF experiment (see above), confirming that the outer Gala-linked residues were attached to the acid-labile internal Fuc residue, whose more rapid release resulted in the simultaneous loss of all three sugars. MALDI-TOF-MS Analysis of Afucosylated-Glycopeptide

The core region of the glycan was examined in a mutant strain (HL250) which does not synthesize GDP-Fuc and does not fucosylate Skpl (Kozarov et al., 1995). It was predicted that this strain would produce the truncated sugar chain Gal-GlcNAc if alternative processing did not occur. HL250 Skpl purified from pool II of the S100 fraction resolved into 2 closely spaced peaks during RP-HPLC, each yielding similar results (Fig. 2.11A). Each peak was digested with endo-Lys-C and fractionated on a C2/C18-RP-HPLC column (Fig. 2.11B), and all peptide peaks were examined by MALDITOF-MS. Ions with m/z values corresponding to each of the predicted unmodified 139-











43








0.05 M TFA, 0 h











0.05 M TFA, 2 h
C




N IN ,N




S0.05 M TFA, 4 h





t I Wi

IN



1500 2000 2500 3000






Figure 2.10 A time course MALDI-TOF-MS analysis of Skpl fucoglycopeptide after mild acid hydrolysis. The fucoglycopeptide fraction 35 was treated with 0.05 M TFA at 950C. At indicated times, the aliquots were subjected to MALDI-TOF-MS.









44













AU A. RPC3.2 a b
AU %B
0.05 80
S0.04 60
006
0.03 -4
-40
S0.02
0.01 .
S0.00

AU 1.0 2.0 3.0 ml
1.0 B. RPC 2.1

0.8

S0.6 %B
8 50 12 14 s
0.4 1 40
L -30
4 0.2 --20
-- -1,10
0.0
1.0 5.0 10.0 ml





Figure 2.11 Fractionation of endo-Lys-C generated afucosylated Skpl peptides. A.
The immunoaffinity purified Skpl from afucosylation mutant strain HL250 was reducedalkylated and furthered purified over the RP-HPLC. Two eluted peaks (a and b) yield similar results after digestion with Endo-Lys-C. B. Peak b was digested with endo-Lys-C and fractionated on a C2/C18 RP-HPLC. The eluted fractions were subjected to MALDITOF MS. The Skpl peptide 139-151 was found in peaks 11, 12, and 14.








45

151 peptides with Mr values >600 were detected, including the unmodified peptide (m/z 1636) (Fig. 2.12C). In addition, the expected Gal-GlcNAc--peptide ion (m/z 2017) was abundant (Fig. 2.12A) in an earlier eluting RP-fraction. No ions which might represent other glycosylated derivatives of peptidel39-151 were detected. The accumulation of this disaccharide, which corresponded to the two core sugars of the wild-type pentasaccharide, confirmed that the addition of the two a-linked Gal residues depends on Fuc. When the disaccharide--peptide was treated with X manihotis 31--+3 galactosidase or other -galactosidases capable of cleaving this linkage, an ion corresponding to the loss of one Hex residue (m/z 1855) appeared in place of the parent ion (Fig. 2.12B). The agalactosidases had no effect. The linking GlcNAc residue was not released in double digestion by bovine kidney [3-galactosidase and jack bean 0-hexosaminidase. The Galp l--+3HexNAc disaccharide found on HL250 Skpl is assumed to be equivalent to the core disaccharide of the normal Skpl pentasaccharide, because the previously characterized Skpl-fucosyltransferase (West et al., 1996) which fucosylates HL250 Skpl in vitro depends on a Gal31- -3HexNAc acceptor.

Taking all of the evidence together, the sugar sequence was assigned as DGalpoal--+6-D-Galpo1 ---L-Fucpxl1 -2-D-Galp1 ---3-D-GlcNAc--HyProl43.

Configurations and the assignment of Gal and Fuc as pyranose forms were based on the exoglycosidase specificities. This structure was derived from about 50 pmol of purified fucoglycopeptide. Methods which require substantially larger amounts of sugars will be










46














A. Hex-HexNAc- OHPro
2017





B. [Gal01,3]- HexNAc- OHPro 1855





C. Pro
1636





I I I I I
1600 1800 2000 2200 2400
Mass (m/z)





Figure 2.12 MALDI-TOF-MS analysis of Skpl glycopeptides from afucosylation strain HL250. A. Mass spectra of RP-HPLC peak # 12 from Fig. 2.11 containing the glycopeptidel39-151 isolated from the afucosylation mutant strain HL250. A. No treatment. B. Treatment with Xmanihotis 31--+3galactosidase. The structure suggested by the experimental result is given in a bracket. C. A later eluting peak #14 containing the unmodified peptide.








47


necessary to determine the exact linkage of the second a-linked Gal residue and the configuration of the GlcNAc-HyPro linkage. Glycosylation Heterogeneity

Detection of the unmodified peptide in the fucosylation mutant suggested that

hydroxylation of Pro 143, the first step in the glycosylation pathway, is rate-limiting and possibly regulatory. Similarly, MALDI-TOF-MS analysis of RP-fractions from endoLys-C released peptides from pool I of Skpl from normal cells yielded ions corresponding only to the pentasaccharide--peptide (m/z 2487) and unmodified peptide 139-151 (m/z 1637). It remains to be determined whether Pro 143 hydroxylation occurs on products of both Skpl genes, as each are present in pool I and pool II, as shown previously by Edman degradation (West et al., 1997) and confirmed here by MS. To characterize the glycosylation pathway further, Skpl-c-myc was expressed at an elevated level in strain HW120. Endo-Lys-C generated peptides were fractionated by RPHPLC (Fig. 2.13) and analyzed by MALDI-TOF-MS, yielding abundant [M+H] ions of 2487, 2327, 2165, 1652 and 1636 in successive fractions (Fig. 2.14). These corresponded to multiple glycoforms, including the full-length pentasaccharide, the pentasaccharide minus one or two of the outer a-linked Gal residues, the hydroxylated but unglycosylated peptide, and the unmodified peptide. These findings were consistent with the monosaccharide composition results shown (Fig. 2.9): 1) Fuc and GlcNAc were present at equal levels, as expected since no mono- and disaccharide intermediates were detected. 2) The Gal:Fuc ratio was 2.1, indicating that there is on average one a-linked Gal (the










48







A. RPC 3.2 %B
AU 100
0.5


0.4 80

0
00 60
S0.3

40
0.2 40
-4
b
0.1 20


0 .0 ----------1.0 2.0 3.0 4.0 ml


B. RPC 2.1
AU
0.6 %B
.1415 17 19 50
0.4

30

0.2 20
10
0.0
1.0 5.0 10.0 ml





Figure 2.13 Fractionation of endo-Lys-C generated Skpl-c-mye peptides. A. The immunoaffinity purified Skp-1-c-myc from the overexpression strain HW120 was reduced-alkylated and furthered purified over the RP-HPLC. The first peak (a) was used for endo-Lys-C digestion. B. Endo-lys-C digested Skpl-c-myc peptides were fractionated over the RP-HPLC. The fractions containing peptide peaks with 215 nm absorbance were subjected for MALDI-TOF mass spectrometry. The Skp 1 peptide 139-151 was found in the peaks 14, 15, 17, and 19.








49





Pk.14
N




Pk.1 5 m un rO N, CO N N00


Pk.17





Pk.19 o


Ii



1000 1500 2000 2500 3000
Mass (m/z)



Figure 2.14 The mass spectra of endo-Lys-C generated Skpl-c-myc peptides. The MALDI-TOF mass spectra of Skpl-c-myc peptides show multiple glycoforms of the peptide 139-151 including completely glycosylated peptide (m/z 2487), -1 and -2 hexoses peptides (m/z 2325 and m/z 2163), unglycosylated-hydroxylated peptide (m/z 1653), and unmodified peptide (m/z 1636).








50


other being P3-linked), which correlated with the detection of glycopeptides containing 0, 1 or 2 outer Gal residues. 3) Only 22% of the protein was glycosylated, which correlated with the high levels of unmodified and hydroxylated forms of peptide 139-151 detected. The results indicated that, secondary to Pro hydroxylation, attachment of the reducing terminal GlcNAc and the outer a-linked Gal residues were the next most rate limiting, suggesting that the enzymes which add these sugars may potentially regulate the structure of the Prol43 glycan at other stages of the life cycle.

Discussion

The mass spectrometric analyses (Table 2.3) suggested that the Skpl glycan

consists of a linear pentasaccharide attached to a HyPro at positionl143. The attachment site was confirmed by Edman degradation. The exoglycosidase studies and sugar analyses confirmed the linear model and showed the sequence to be D-Galpal-->6-D-GalpcI->LFucpa 1 --42-D-Galpl1 --3-D-GlcNAc-+HyPro 143. Substantially greater amounts of the fucoglycopeptide will be necessary to determine the linkage position of the second xlinked Gal residue, and the configuration of the GlcNAc-->HyPro linkage. The core trisaccharide, Fucal--2GalP31-->3GlcNAc, is equivalent to blood group H (type 1) expressed by mammalian cells (Greenwell, 1997). Although internal Fuc linkages have been found in glycoproteins (Zhang et al., 1997; Harris et al., 1993), the outer Galcl--->6Galocl--Fuc cap structure has not been previously described. However, this sugar chain is not immunogenic in mice (Kozarov et al., 1995), unlike other Dictyostelium








51


Table 2.3 MALDI-TOF-MS m/z values for endo-Lys-C-derived glycopeptides

Sample Strain HPLC Measured Derived structure
peaka m/z
[3H]glycopeptide Ax3 fr.35 2487 Hex2deoxyHexHexHexNAcOPro
2325b HexdeoxyHexHexHexNAcOPro
2163b deoxyHexHexHexNAcOPro
2017b HexHexNAcOPro
1855b HexNAcOPro
1653b HOPro

Skpl-II peptides HL250 pk. 11, 2017 HexHexNAcOPro
1855 HexNAcOPro
pk.14 1636 Pro

Skpl-His peptides E.coli pk. 18 1636 Pro

Skpl-I peptides Ax3 pk. 23 2487 Hex2deoxyHexHexHexNAcOPro
pk. 25 1636 Pro

Skpl-c-myc HW120 pk. 14 2487 Hex2deoxyHexHexHexNAcOPro
peptides
pk. 15 2325 HexdeoxyHexHexHexNAcOPro
2163 deoxyHexHexHexNAcOPro
pk. 17 1652 HOPro
pk. 19 1636 Pro

a. Fraction or peak (based on A214 tracings) numbers are consistent only within a given
experiment.
b. The structure given is based on the mass of the parent ion as MH+ and the m/z values
of the daughter ion set.
c. These are decomposition ions in the MALDI-TOF-MS analysis.








52


sugar protein conjugates (West et al., 1986; Freeze, 1997), suggesting that a similar structure may be expressed in mammals. The linkage amino acid, hydroxyproline, is possibly 4-hydroxylated based on the specificity of a Skp 1 :UDP-GlcNAc GlcNActransferase activity which has been detected and partially purified (Chapter 3). 4hydroxylation is phylogenetically ubiquitous and 4-OH-Pro has been found to be derivatized with Ara or Gal in plants and algae (Fincher et al., 1972; Allen et al., 1978) but substitution by GlcNAc has not been described previously. The double-negative charge previously attributed to the sugar moiety after attempted P-elimination (GonzalezYanes et al., 1992) may have resulted from base-catalyzed scission of the adjacent E-E peptide bond, as sugar-HyPro linkages are known to be alkali-resistant (Fincher et al., 1972; Allen et al., 1978). GlcNAc was not previously detected in Skpl (Kozarov et al., 1995), probably because methanolysis is more effective than 2 M TFA in causing its release from HyPro.

The aforementioned structures homologous to the Skpl oligosaccharide are synthesized in either the rER or the Golgi apparatus, and then expressed on the cell surface or secreted. However, Skpl is not secreted, but rather is located and functions in the cytoplasm and nucleus (Kozarov et al., 1995; Bai et al., 1996; Yoho et al., 1997). These data imply that known enzymes directing the synthesis of the homologous structures would not be accessible to Skp 1, unless Skp 1 transiently visits the lumen of the secretory pathway.








53


Current evidence suggests that Skpl is partially modified in the cytosol by a novel biosynthetic pathway. The enzyme which adds Fuc is likely to be the previously characterized cytosolic fucosyltransferase (cFTase). The cFTase fucosylates Skpl in vitro with a submicromolar Km (West et al., 1996), and catalyzes formation of the same Fuc linkage on the same acceptor disaccharide (West et al., 1996; Trincher, and Bozzarro, 1996) as the present results show occur naturally in Skpl. The cFTase is likely to reside in the cytoplasmic compartment of the cell as it was purified from the cytosolic fraction and its submicromolar Km for GDP-pFuc is more characteristic of cytoplasmic compared to Golgi glycosyltransferases (West et al., 1996). Recent studies on Pro hydroxylase and GlcNAcTase activities which modify overexpressed Skpl -c-myc and synthetic peptides suggest that they also reside in the cytoplasmic compartment. These enzymes may constitute a hitherto unrecognized complex pathway of O-glycosylation localized in the cytoplasm, not the secretory pathway, which attaches sugars to Skpl incrementally rather than en bloc. Although glycosylation heterogeneity was not observed in Skp 1 from cells at the end of the growth phase, accumulation of incompeletely glycosylated chains in the overexpression strain raises the possibility of the expression of glycoforms at Pro143 at other stages of the life cycle.

Pro 143 is located within the highly conserved C-terminal domain of the Skpl

amino acid sequence (West et al., 1997). The C-terminal domain sequences are identical in the two Dictyostelium Skpl genes, and a Pro at the equivalent position of Prol43 is present in each of the numerous yeast, fungal, plant and plant viral genes cloned to date (Table 2.4). Of the nine Skpl genes suggested by DNA sequencing data to exist in










54


Table 2.4 Phylogenetic comparison of sequences surrounding Prol.43

121 131 141 151 161 Dictyostelium a.a.
NMIRGKTPEE IRKiFNIKND FTPEEEEQIP KENEWCEDKG gn D. discoideum
NMIKGKTPEE IRKTFNIKND FTeEEEaQVR KENQWCEEK H. sapiens
EMIRGRSPEE IRRTFNIvND FTOEEEaaIR RENEWaEDR S. cerevislae
NMIKGKSPEE IRKTFNIQND FTNEEEDQIR RENEWAEE S. nidulans
DMIKGKTPEE IRKTFNIKND FT PEEEEEVR RENQWafE P. vulgaris
DRIRGKTPEQ IRevFgIeND LTOEEEaaAl aEhsWthlvP iedy Chlorella Virus DMIKGKTPEE IRtTFNIKND FTTEEEEEVR RENQWafE A. thaliana
NMIKGKSPEE IRRTFNIKND FTIPEEEEQIR KENaAWCED C. elegant (a)
NMIKGKSPdE IRRaFNIKdD FTaEErEQIR KENaWCDD C. elegant (c)
iML GRT1NE VKlmLrvggv eSOsDREDsl eDvlelEvdv d ... C. elegant (b)
qnPReiiD gl vndEEEEQpv ypvkkCknht n ... C. elegant (d)
nsAKGKnaEE MRe1F g ipepwEQpst statWdD C. elegant (e)
ELIRGKStEE IRKIYgIRsD eeqmEEalan ggegtsamtf t ... C. elegant (f) NMAKGKTtaE LReiFaIntD eadaaEEtaa Raaaeva C. elaaans (a)

Note: upper case letters denote similar residues; lower case denotes non-conserved residues.








55


Caenorhabditis elegans, three are highly homologous to Dictyostelium Skpl in this region, and two of these have the equivalent of Prol43 (West et al. 1997). Thus this key Pro residue may be modified in other organisms as well. The known mouse, guinea pig and human cDNAs encode nearly identical proteins (Chen et al., 1995; Zhang et al., 1995; Demetrick et al., 1996; Liang et al., 1997) and lack this Pro residue, despite a high degree of similarity (>80%) with the Dictyostelium sequence in the C-terminal domain. Other mammalian Skpl loci (Chen et al., 1995; Demetrick et al., 1996; Liang et al., 1997) may contain the equivalent ofProl43, or Skpl may be modified on a second, nearby TPEE sequence motif like that containing Pro 143.

The structural evidence shown here adds Skpl to the short list of examples that complex glycosylation does in fact occur on cytoplasmic and nuclear proteins, as has often been postulated based on indirect evidence (Medina and Haltiwanger, 1998). It has been well-documented in the past decade that many cytoplasmic/nuclear proteins are monoglycosylated by GlcNAc on Ser or Thr residues. However, the only generally accepted examples of oligo-glycosylation are an incompletely defined, pan-eukaryotic Glc-1-PO4 modification of phosphoglucomutase (Marchase et al., 1993), also known as parafusin, and glycogenin, the primer for glycogen (Alonso et al., 1995). The novel GlcNAc---HyPro linkage in Skpl is distinct from the GlcNAc-Ser/Thr (Hart, 1997), Glc-->Tyr (Alonso et al., 1995), and possible Man--Ser/Thr (Marchase et al., 1993) linkages found in the other cytoplasmic/nuclear proteins, and has not been detected on proteins modified in the secretory pathway. Though other proteins in the cytoplasmic








56


fraction appear to be metabolically-labelled by [3H]Fuc, Skpl appears to be a major recipient of cFTase-mediated fucosylation both in vivo and in vitro (Gonzalez-Yanes et al., 1992; Kozarov et al., 1995). Further studies are required to determine whether the other fucoproteins in this fraction reside in the cytoplasmic/nuclear compartment prior to cell lysis. The availability of the newly designed Q-TOF-MS is expected to make it more practical to investigate the posttranslational modifications of other lower abundance intracellular proteins, which must be isolated from natural sources to analyze their posttranslational modifications.

Cytoplasmic glycosylation can have dramatic consequences, as highlighted by a Clostridial enzyme toxin which applies Glc or GlcNAc to a specific Thr residue of cytoplasmic rho and cdc42 proteins resulting in major effects on the actin cytoskeleton (Selzer et al., 1996). The function of the Skpl pentasaccharide modification is not likely to involve competition with phosphorylation as proposed for the simple GlcNAc monosaccharide modification of many cytoplasmic/nuclear proteins (Hart, 1997). Instead, it may serve as a ligand for a cytoplasmic/nuclear carbohydrate-binding protein (Jung et al., 1996; Kasai and Hirabayashi, 1996), or as a steric shield. The observation that the pentasaccharide modification appears to be completed on all pool I and pool II Skpl proteins whose Pro143 residues are hydroxylated supports the model that it is a ligand for a receptor, which must be structurally rich and constant. Skp 1 subpopulations differing with respect to the pentasaccharide--HyPro modification might vary in their ability to interact with specific F-box containing proteins, thereby potentially regulating








57

ubiquitination or phosphorylation of selected target proteins in response to, e.g., changes in the nutritional, differentiation, or cell cycle status of the cell. The new knowledge of glycan structure and attachment now renders the function of Skpl glycosylation susceptible to genetic investigation.













CHAPTER 3
CHARACTERIZATION OF SKP1-GLCNAC TRANSFERASE Introduction

Skpl is found in the cytoplasmic SCF protein complex which helps target cell cycle and other proteins for ubiquitination. In Dictyostelium, Skpl is variably modified by an unusual linear pentasaccharide; Galal-6Gala l-Fucaxl-2Galpl-3GcNAc, attached to a hydroxyproline (HyPro) residue at amino acid position 143 (Teng-umnuay et al., 1998).The pentasaccharide structure of Skpl indicates a novel glycosylation pathway (HyPro-glycosylation). This pathway is predicted to contain a novel set of enzymes, including, prolylhydroxylase, GlcNAc-transferase, fucosyltransferase, and three distinct galactosyltransferases. Only one of these enzymes, the fucosyltransferase (cFTase), has been purified from a cytosolic preparation of Dictyostelium and characterized (West et al., 1996). This cFTase has characteristics of a cytosolic enzyme, although all other known eukaryotic fucosyltransferases reside in the golgi compartment.

Disruption of one of the first two key enzymes, Skpl-prolylhydroxylase and

Skpl-GlcNAc-transferase, would completely eliminate the Skpl-glycosylation and allow us to study the importance and function of the glycan. To achieve the goal, an enzyme purification is required in order to get the cDNA sequences. In this study, a UDP-Nacetylglucosamine: Skpl-N-acetylglucosaminyltransferase (GlcNAc-transferase), the enzyme responsible for the attachment of the first sugar to the HyPro residue, has been purified from the cytosol of Dictyostelium strain HW120 over DEAE, phenyl, Reactive



58








59


Red, Superdex, dUMP, and UDP-GlcNAc columns. The activity behaved as a single component with an apparent Mr of -33,000. The glycosidic linkage was alkali-resistant and was recovered as GlcNH2 after acid hydrolysis, consistent with a linkage to HyPro.

Activity of the purified enzyme was dependent on DTT and MgC12. Its apparent Km for UDP-GlcNAc was 0.16 gM. The presence of this enzyme in the cytosolic fraction, its requirement for a reducing environment, and its exceedingly high affinity for its donor substrate UDP-GlcNAc, strongly suggest that the GlcNAc-transferase glycosylates Skpl in the cytoplasm. The Skpl-GlcNAc-transferase and the previously described Skpl-fucosyltransferase appear to belong to a glycosylation pathway which is novel with respect to the structure formed and its compartmentalization in the cytosol rather than in the secretory pathway of the cell.

The characteristics of the enzyme give us a better knowledge about the

mechanism of Skpl glycosylation and its compartmentalization. Once the cDNA sequences of the enzyme is known, we will be able to screen genomic and cDNA databases and explore whether a similar pathway exists in other species. Moreover, it will be possible to create a GlcNAc-transferase co-expression and a GlcNAc-transferase knock-out strain to verify that it is the real enzyme in vivo.

Materials and Methods

GlcNAc-Transferase Assay

Substrates. Skpl-c-myc was purified from strain HW120 through the mAb 3F9 affinity column step as described (chapter 2). The recombinant Skpl-His was purified through a nickel metal chelating column as described (chapter 2) and further purified on a








60

mAb 3F9 affinity column. The purified proteins were concentrated in an ultrafiltration concentrator (Centriplus-10, Amicon) to the final concentration of 11 gM for Skpl-cmyc and 9 RM for Skpl-His, aliquoted, and kept as stock solutions at -80oC. Two synthetic peptides, KIFNIKDFTPEEEEQIRKENEW and KIFNIKNDFT4-hydroxyProEEEQIRKENEW, which corresponded to the amino acid 133-155 of Skpl, were synthesized by the ICBR Protein Core, University of Florida. The dried peptides were reconstituted in 50 mM HEPES-NaOH, pH 7.4 at the concentration of 20 mg/ml and kept as stock solutions at -80'C. UDP-[3H]GlcNAc in which [3H] was attached to C6 of the glucosamine group was from Dupont NEN. It had a specific activity of 34.8 Ci/mmol.

GlcNAc-transferase activity. GlcNAc-transferase activity was assayed as the transfer of [3H]GlcNAc from UDP-[3H]GlcNAc to Skpl-c-myc or synthetic peptides. Typically, each assay contained 1 RM Skpl-c-myc, 50 mM HEPES-NaOH (pH 7.8), 5 mM MgCl2, 1 mM ATP, 5 mM DTT, 0.5 mg/ml BSA, and 0.657 RM UDP-[3H]GlcNAc in a total volume of 35 gl in 1.6 ml microtubes. After enzyme fractions were added, the reactions were incubated at 30'C for 1 h, and stopped by diluting with 35 pl of 2 X LSB containing 2 gg of soybean trypsin inhibitor (Sigma) and frozen at -200C. Trypsin inhibitor has an Mr of 20,100 and served as a marker for the position of Skp 1 -c-myc. After boiling for 3 min, each sample was resolved on a 7%-20% SDS-PAGE gel. The gel was stained with Coomassie Blue R-250 (0.25% in 45% methanol, 10% acetic acid) for 1 h, destained (5% methanol, 7.5% acetic acid) overnight, and rinsed in distilled H20 for 0.5 1 h. The gel slice from each lane was cut from the region containing Skpl-c-myc








61


(21 kDa) or synthetic peptides with two additional slices, 4 mm above and 4 mm below. The gel slices were extracted in 10% TS-2 (Research Products International, Mt. Prospect, IL), 0.6% PPO, 0.015% dimethyl POPOP in toluene (scintanalysis grade). After 72 h, [3H]incorporation was determined by scintillation counting (Beckman LS6500). [3Hlincorporation into Skpl-c-myc was found in the slices of 21 kDa and one slice above. The test of Skp 1-His as a substrate was performed in a similar way except gel slices were excised from the 24 kDa region.

The test of optimum pH for GlcNAc-transferase activity was performed by

changing the buffer with desalting PD 10 columns. Five PD 10 columns were equilibrated with 50 mM Tris-HCl with different pH, 6.0, 6.5, 7.0, 7.5, and 8.0 measured at 22C. S100 500 pl was loaded on each column and 1 ml fractions were collected at 4C. Fractions # 3, containing the highest activity, were tested. Protein Concentration Determination

Protein concentration was determined by a commercial modification of a Coomassie Blue dye binding method (Sedmak and Grossberg, 1977) according the manufacturer's protocol (Pierce, Rockford, IL). One ml of a diluted sample was mixed with 1 ml of the reagent. After 5 min, absorbance at 595 nm was measured and the protein concentration was calculated from a standard curve of bovine serum albumin. To determine the protein concentration of the desalted affinity purified GlcNAc-transferase fraction, 20 gl of sample was dried down, acid hydrolyzed, and subjected to amino acid composition analysis at the ICBR Protein Chemistry Core Laboratory using norleucine as an internal standard. Total protein was calculated based on the molar content of amino








62


acids.

Preparation of the 5-Hg-dUMP Resin

Synthesis of 5-Hg-dUMP. 5-Hg-dUMP was synthesized as described (Meikle et al., 1991, Zeng et al. 1996) with some modifications. Fifteen ml of 20 mM dUMP in 15 ml of 0.5 M NaOAc buffer, pH 7.0 (prepared by adjusting pH of 0.5 M NaOAC with 0.5 M acetic acid) was added dropwise to 15 ml of 100 mM Hg-acetate in 0.5 M NaOAc buffer, pH 7.0. The process was performed in a light protected container since Hg-acetate is very light sensitive. The mixture was incubated at 50'C for 5 h. After cooling down to room temperature, 148 mg (3.5 mmol) of LiC1 was added to convert the excess Hgz+ into HgC2. Ethyl acetate extraction was performed 6 times by mixing the reaction mixture with an equal vol of cold ethyl acetate in a phase-separation flask and the lower aqueous phase was collected. Five ml aliquots of the aqueous phase in Corex centrifuge tubes were each diluted with 20 ml of ice-cold absolute ethanol to precipitate 5-Hg-dUMP. The precipitate was allowed to develop at 4C overnight. The precipitate was collected by centrifugation in a SS34 rotor at 7,500 rpm for 20 min. After the ethanol was discarded, the pellet in each tube was washed with a mixture of ethyl acetate:ethanol (1:4). The pellets were collected by centrifugation, dissolved in 50 ml H20, and loaded onto a Chelex- 100 resin (bed vol 10 ml, Biorad) to remove residual Hg2+. The flowthrough, containing 5Hg-dUMP, was collected and used for the coupling reaction. The yield of dUMP mercuration was estimated from the shift of maximum absorbance from 260 nm to 267 in. Absorbances were compared to the molar extinction coefficients of UDP (Max A260 = 1.00 x 104) and 5-HgUDP (Max A267 1.08 x 104) at pH 7.5. All solutions in this








63


procedure were degassed and free of reducing reagents.

Coupling of 5-Hg-dUMP to Thiopropyl Sepharose 6B. Thiopropyl Sepharose 6B gel was prepared according to the manufacturer's protocol (Pharmacia Biotech) as follows. The dried material was swollen in 50 mM Tris-HC1, 0.1 M NaC1, pH 7.0, at room temperature overnight and washed on a Buchner funnel with a large amount of H20. The free thiol group was released by suspending gel in 1% (w/v) DTT in 0.3 M NaHCO3, 1 mM disodium EDTA, pH 8.4 for 1 h. The gel was washed with a large amount of 0.5 M NaC1, 0.1 M acetic acid, 1 mM disodiumEDTA followed by H20. The coupling reaction with 5-Hg-dUMP was performed by resuspending the gel in the Chelex-100 flowthrough with gentle mixing on a shaking platform for 2 h at room temperature. The unreacted thiol group was inactivated in 0.2 M cysteine in 10 mM TrisHC1, pH 7.4. The yield of the coupling reaction was determined from the decrease of absorbance at 267 nm.

Preparation of Aminoallyl-UDP-GlcNAc-Sepharose for Affinity Chromatography

Synthesis of aminoallyl-UDP-GlcNAc. 5-(3-Amino)allyl-UDP-GlcNAc was synthesized from 5-Hg-UDP-GlcNAc as described (Zeng et al., 1996) with some modifications. Synthesis of 5-Hg-UDP-GlcNAc was performed in a similar manner to the synthesis of 5-Hg-dUMP except the Chelex-100 resin step was omitted. The 5-Hg-UDPGlcNAc precipitate was dissolved in 0.5 M NaOAc buffer, pH 5.0 to the final concentration of 20 mM. Twenty ml of 5-Hg-UDP-GlcNAc solution was mixed with 2.4 ml of freshly prepared 2 M allylamine-acetate, pH 6.0. To make 2 M allylamine-acetate, pH 6.0, 0.75 ml of allylamine is dissolved in 4.25 ml of 17.4 N acetic acid on ice. The








64

condensation reaction of allylamine with nucleotide sugar was initiated by adding 1 nucleotide equivalent of K2PdCI4 (Sigma-Aldrich) in 1 ml H20. The reaction was maintained at room temperature on a shaking platform for 16 h.

The black metal deposit was removed by filtration though a 0.2 micron syringe

filter twice. The yield of the reaction was determined from the absorbance at 288 nm (7.1 X 103 M-1cm-'). The yellow filtrate was diluted with 9 vol of H20 and applied to a DEAE-Sepharose Fast Flow column (2.6 cm x 37 cm) pre-treated with 1 M NaHCO3 and equilibrated with 1 1 of H20. Then the column was washed with H20 until the A280 returned to baseline. 5-(3-amino)allyl-UDP-GcNAc was eluted with a gradient of 0 300 mM triethylammonium bicarbonate (TEAB), pH 7.7, prepared from 500 ml of H20 and 500 ml of 300 mM TEAB, pH 7.7. Ten ml fractions were collected. TEAB buffer was prepared by adjusting the pH of 300 mM TEA in H20 with CO2.

Coupling reaction of 5-(3-amino)allyl-UDP-GlcNAc to NHS-activated

Sepharose-4 Fast-Flow. The fractions containing 5-(3-amino)allyl-UDP-GlcNAc were pooled and dried under vacuum centrifugation. The dried material was dissolved in anhydrous dimethylformamide stored in molecular sieves (pore diameter 3 angstrom, Sigma) and the pH was adjusted to 7.5 with TEA. The pH of the solution was measured with pH paper (Sigma) and higher pH resulted in insolubilization. Two ml of NHSactivated Sepharose-4 Fast Flow gel was washed with 10 ml of dimethylformamide on a Buchner funnel and the gel was resuspended in the 5-(3-amino)allyl-UDP-GlcNAc solution. The coupling reaction was performed for 24 h with gentle mixing on a shaking platform at room temperature; however, the maximum of coupling reaction, determined








65

by the decrease of absorbance at 288 nm, occurred in 2 h. The unreacted NHS group was inactivated in 1 M aminoethanol in 50 mM Tris-HC1, pH 7.8 for 2 h. One ml gel was packed in a HR5/5 column (Pharmacia). The column was installed in a Smart system HPLC and was run extensively with degassed 50 mM Tris-HC1, pH 7.8, followed by 0.1 M boric acid, pH 8.0, and stored in 2 M NaC1, 0.005% thimerosol in 50 mM HEPESNaOH (pH 7.8).

GlcNAc-Transferase Purification

Cell lysis and DEAE-Sepharose Fast-Flow chromatography. Cell lysis was performed and the final S100 supernatant was pumped onto a DEAE-Sepharose Fast Flow column equilibrated in 50 mM HEPES-NaOH (pH 7.4), 1 mM DTT, 5 mM MgCl2, 0.1 mM disodiumEDTA, 10% glycerol as described (chapter 2). Skpl was retained in the column whereas GlcNAc-transferase activity was found primarily in the wash fractions.

Ammonium sulfate precipitation. (NH4)2SO4 (ultrapure, ICN) was added to the wash fractions from DEAE-Sepharose column to the final concentration of 25% saturation with stirring at 40C for 30 min. The sample was centrifuged in a GSA rotor at 10,000 rpm for 20 min. The GlcNAc-transferase activity in the supernatant was precipitated by increasing (NH4)2SO4 to 60% saturation. The pellet was collected by centrifugation in a GSA rotor at 10,000 rpm for 20 min and dissolved in 300 ml of 25% saturated (NH4)20SO4, 50 mM HEPES-NaOH (pH 7.8), 5.0 mM MgCl2, 0.1 mM disodium EDTA, 1 mM DTT, 15% (v/v) glycerol.

Phenyl-Sepharose Fast-Flow (low-sub) chromatography. The ammonium sulfate precipitated sample was applied to a phenyl-Sepharose Fast Flow (low-sub)








66

column (2.6 cm x 20 cm) pre-equilibrated with 25% saturated (NH4)2SO4, 50 mM HEPES-NaOH (pH 7.8), 5.0 mM MgC12, 0.1 mM disodium EDTA, 1 mM DTT, 15% (v/v) glycerol at 4C at the flow rate of 190 ml/h. The column was washed with the same buffer until the A280 dropped below 1% of its maximum. GlcNAc-transferase activity was eluted by a decreasing gradient of saturated (NH4)2SO4 from 25% to 0% prepared from 300 ml of the equilibration buffer and 300 ml of the same buffer without (NH4)2SO4. Fractions were stored at -80'C.

Reactive Red-120 chromatography. Reactive Red-120 Fast Flow (1.6 cm x 5 cm) was equilibrated with 50 mM HEPES-NaOH (pH 7.8), 5.0 mM MgC12, 0.1 mM disodium EDTA, 1 mM DTT, 15% (v/v) glycerol. The phenyl-Sepharose fractions containing GlcNAc-transferase activities were pooled and loaded onto the column at 40C and at the flow rate of 80 ml/h. The column was washed with the equilibration buffer until the A280 dropped to within 10% of baseline. The column was eluted by an application of a 0 1.5 M NaCl gradient prepared from 75 ml of the equilibration buffer and 75 ml of 1.5 M NaC1 in the same buffer. Six ml fractions were collected and stored at

-800C.

Superdex HPLC chromatography. A Superdex 200 (16/60) HPLC column (Pharmacia Biotech) was equilibrated with 50 mM HEPES-NaOH (pH 7.8), 5.0 mM MgCl2, 0.1 mM disodium EDTA, 15% (v/v) glycerol at 220C on an LKB GTi HPLC system. The Reactive Red fractions containing GlcNAc-transferase activity were pooled, concentrated in Centriplus-10 ultrafiltration cartridges to less than 2 ml, and loaded onto








67


the column via a 2 ml injection loop. The isocratic run of the same buffer was performed at the flow rate of 0.8 ml/min and 1.2 ml fractions were collected and stored at -800C. The Mr was calculated based on horse spleen apoferritin (443,000), yeast alcohol dehydrogenase (150,000), bovine serum albumin (66,000), and soybean trypsin inhibitor (20,100).

5-Hg-dUMP chromatography. The Superdex fractions containing GlcNActransferase activity were pooled and loaded onto 5-Hg-dUMP column (bed vol 1 ml). DTT was added into the flowthrough to the final concentration of 5 mM. The flowthrough was concentrated in a Centriplus-10 cartridge to less than 2 ml. After use, the column was cleaned with 5 mM dUMP and stored in 2 M NaC1, 0.005% thimerosol in 50 mM HEPES-NaOH (pH 7.8).

Aminoallyl-UDP-G1cNAc affinity chromatography. The aminoallyl-UDPGlcNAc HR5/5 column was connected to a short adaptor in a Smart HPLC system and was equilibrated with 0.1% Tween-80, 5 mM DTT, 50 mM HEPES-NaOH (pH 7.8), 5.0 mM MgCl2, 0.1 mM disodium EDTA, 15% (v/v) glycerol. The concentrated flowthrough from 5Hg-dUMP column was loaded onto the column via a 2 ml injection loop at 100 gl/min. After 60 min, the column was eluted by a gradient of 0 2 mM UMP in the equilibration buffer at 250 pl/min. In order to identify enzyme activity, an aliquot from the fractions containing UMP were desalted in ultrafiltration concentrators (Microcon-10, Amicon) as follows. One hundred 4l of eluted fractions was diluted with 400 pl of 5 mM DTT, 50 mM HEPES-NaOH (pH 7.8), 5.0 mM MgC12, 0.1 mM disodium EDTA, 15% (v/v) glycerol in a Microcon-10 device and centrifuged at 6095 g for 20 min. New buffer








68


was added and the filtrate was discarded. The process was repeated 3 times to reduce the UMP concentration to less than 20 gM. The fractions containing activities were pooled, concentrated in a Centricon-10 cartridge, and desalted on a Fast Desalting PC3.2/10 column (Smart system HPLC). An isocratic run of 50 mM HEPES-NaOH (pH 7.8), 5 mM MgCl2, 0.1 mM disodium EDTA, 5 mM DTT was performed at the flow rate of 100 pl/min. Fractions of 100 pl were collected. The GlcNAc-transferase activity came out in fractions 3-6 which were pooled and used for subsequent studies. High-pH Anion-Exchange Chromatography of the Acid Hydrolysis Derivatives of [3H]GIcNAc-Skpl

GlcNAc-transferase assays using the aminoallyl-UDP-GlcNAc-affinity-purified GlcNAc-transferase were performed as described. The gel slices containing [3H]GlcNAcSkpl were rinsed with filtered H20. Minced gel slices were hydrolyzed in 1 ml of 4 M TFA at 1000C for 4 h. The soluble part was dried by vacuum centrifugation and resuspended in 1 ml methanol with vortexing. This process was repeated twice. The radioactive products were reconstituted in 100 .l of 0.2 pm filtered water, mixed with 1 nmol of D-glucosamine (GlcNH2), and chromatographed on a Dionex PA-10 HPLC column equilibrated in 17 mM NaOH at 1 ml/min. The flowthrough fractions were counted for [3H]radioactivity directly using Scintiverse-HP scintillation cocktail. Reductive Alkaline Degradation of [3H]GIcNAc-Skpl

GlcNAc-transferase assays using the aminoallyl-UDP-GlcNAc-affinity-purified enzyme were performed as described. The gel slices containing [3H]GlcNAc-Skpl were rinsed with filtered H20. The 8-elimination of gel slices was performed with the addition








69

of an equal vol of IM NaBH4 in 0.2 M NaOH in 5 ml Reacti-vials. After incubation at 450C for 20 h, the supernatant was transferred into a polypropylene tube, neutralized with an equal vol of 1 M acetic acid in methanol, and dried under vacuum centrifugation. The radioactive residue was dissolved in 2 ml of H20, adjusted the pH to 9.5 with 2-amino-2methyl-1 propanol determined by spotting 5 Rl of the sample on pH paper, and loaded onto 1 ml Dowex-1 strong anion exchange resin pre-activated with 5 ml of 1 M HCI and equilibrated with 10 ml of H20. The flowthrough was collected and an aliquot was measured for [3H] using Scintiverse-HP scintillation cocktail.

Results

GlcNAc-Transferase Activity that Modified Skpl was Found in the S100 Fraction of Dictyostelium

The monosaccharide composition analysis (Fig. 2.8) of Skpl-c-myc isolated from overexpression strain HW120 detected only one-sixth of the expected amount of Fuc and GlcNAc (Teng-umninuay et al., 1998). This finding suggested that Skpl-c-myc was under-glycosylated which was supported by the MALDI-TOF-MS data of Skp 1-cmyc peptide l39-155. The endolysin-C digested Skpl-c-myc peptides were separated on a reverse phase HPLC (Fig. 2.12) and the eluted fractions were subjected to MALDI-TOF MS study. The mass spectra of peptidel39-155 showed series of m/z 2487, 2325, 2163, 1653, and 1636 indicating various stages of glycosylation (Fig. 2.13). One of these peptides had an m/z 1652 which corresponded to the hydroxylated-unglycosylated-Skplpeptide 139-151. This finding indicated that Skpl-c-myc should contain a hydroxylated form which could be a suitable substrate for a GlcNAc-transferase predicted to attach the first sugar on to the hydroxyproline residue. To test the hypothesis, an assay for the








70


GlcNAc-transferase was developed, based on a transfer of [3H] from UDP-[3H]GlcNAc to Skpl-c-myc. The reactions were resolved by SDS-PAGE, and [3H] incorporation into gel slices containing Skpl-c-myc was measured. GlcNAc-transferase activities were tested in crude S 100 from the normal strain Ax3 and from the overexpression strain HW120 (Fig. 3.1). In the absence of Skpl-c-myc, incorporation of [3H] into Ax3-S100 was found throughout the gel indicating that multiple proteins could take up [3H]GlcNAc. However, in the presence of Skpl-c-myc, increased incorporation was found in the 21-24 kDa region of the gel as expected for Skpl-c-myc. In contrast, in HW120-S100, incorporation of [3H]GlcNAc into the region of the gel containing Skp 1-c-myc was found with a relatively high level and was stimulated only slightly by added Skp 1 -c-myc suggesting that endogenous Skpl-c-myc had nearly saturated the enzyme in vitro. The hypothesis was supported by the finding that the addition ofa Skpl mAb 3F9 greatly inhibited incorporation (Fig. 3.3).

To gain further evidence that [3H]GlcNAc was incorporated into Skpl, a synthetic peptide corresponding to residues 133-155 of Skpl with 4-hydroxyproline at the equivalent residue 143 was added to the reactions in addition to Ax3-S100 or HW120S100 (Fig. 3.2). The SDS-PAGE analyses showed that the region of the gel containing the peptide incorporated substantial levels of [3H] in both strains. In HW120-S100, there was less [3H]incorporation in the Skpl region suggesting that the peptide and endogenous Skpl were competitive as acceptor substrates (compare Fig. 3.1 and 3.2).

To address whether the attachment of [3H]GlcNAc occured at the hydroxyproline, His-tagged recombinant Skp-1 from E. coli (Skp l-His), in which Pro 143 was not








71











AX3-S100 HW120-S100
116-205 kDa
97-116 kDa O without Skpl-c-myc
66-97 kDa 1 with Skpl -c-myc
45-66 kDa
36-45 kDa
29-36 kDa
24-29 kDa
21-24 kDa
14-21 kDa
7.14 kDa
0.3-7 kDa
<0.3 kDa
400 300 200o 100 0 0 100 2o00 300 400
Activity (pmol/gm/h) Activity (pmol/gm/h)






Figure 3.1 Transfer of [3H] from UDP-[3H]-GlcNAc into S100 fractions of normal
strain Ax3 and Skpl-overexpression strain HW120. S100 fractions from normal strain
Ax3 and overexpression strain HW120 were incubated with 0.6 gM UDP-[3H]-GlcNAc in areaction mixture containing 50 mm Tris-HCi (pH 7.4), 14 mM MgC12, 3 mM MnC12, 3 mM ATP, and 6 mM NaF in the absence or presence of 0.54 gM Skpl-c-myc. After 2
h incubation at 300C, the samples were diluted with LSB, boiled and resolved by SDSPAGE. After staining and destaining, proteins in gel slices were extracted and measured for [3H] incorporation. The incorporation into Skpl-containing gel slices with the Mr of 21-24 kDa was greater in strain HW120 than those of strain Ax3 due to the higher level
of endogenous Skpl substrate. In the presence of Skpl-c-myc, [3H] incorporation in
Skp 1-containing gel slices was increased in both strains.








72











116-205 kDa
97-116 kDa ] AX3
66-97 kDa l HW120
45-66 kDa 36-45 kDa 29-36 kDa 24-29 kDa 21-24 kDa
21 kDa
14-20 kDa 0.3-14 kDa
peptide band
< 0.2 KDa
0 100 200 300 400
Activity (pmol/gm/h)


Figure 3.2 Transfer of [3H] from UDP-[3H]GlcNAc into S100 fractions of normal strain Ax3 and overexpression strain HW120 in the presence of Skpl-peptide 133155. S100 fractions from normal strain Ax3 and overexpression strain HW120 were incubated with 0.6 gM UDP-[3H]GlcNAc in the presence or absence of 0.18 mM synthetic Skp 1l-peptide 133-155 and GlcNAc-transferase assays were performed as described in Fig. 3.1. Increased incorporation in peptide containing gel slices was apparent in both strains. In comparison to Fig. 3.1, [3H]incorporation into the peptide and endogenous Skpl-c-myc in HW120-S 100 were competitive with each other.








73









2000
Ol Peptide slice Skp-1l-slice 1500

E CL
1000



500


0
1 2 3
Synthetic peptide +
mAb 3F9 +




Figure 3.3 Inhibition of GlcNAc-transferase activities by synthetic peptide 133-155 and anti-Skpl-antibody. S100 fractions from overexpression strain HW120 were assayed for GlcNAc-transferase activity as described in Fig. 3.1 in the absence or presence of 2.5 gl ofmAb3F9 ascites which is specific to Skpl. The mAb3F9 inhibited incorporation in both endogenous Skpl 1-c-myc and synthetic peptide suggesting the specificity of both substrates.








74





1.0

E HW120-S100 L AX3-S100
0.8



E 0.6
0
E 0.
0.4
>-.


0.2



0.0
Skpl-c-myc Skpl-His No substrate



Figure 3.4 GcNAc-transferase activity is specific for Skpl-c-myc. S100 from normal strain Ax3 and overexpression strain HW120 were assayed for the GlcNAc-transferase activities in the absence or presence of 0.54 gM Skpl-c-myc or 0.54 RM recombinant Skpl from E.coli (Skpl-His) as described in Fig 3.1. Only Skpl-c-myc, which contains the unglycosylated-hydroxylated form of Skp 1, can stimulate the GlcNAc-tranferase activities in both Ax3-S 100 and HW120-S 100.








75


hydroxylated, was tested as a substrate. The result (Fig. 3.4) showed that Skp 1-His could not stimulate the enzyme activity suggesting that [3H]GlcNAc was attached to the hydroxyproline residue. These data were supported by the evidence that synthetic peptide 133-155 with Pro in place of HyPro could not stimulate enzyme activity (data not shown).

To address the compartmentalization of the enzyme activity, GlcNAc-transferase activities were tested in P100 fraction from Ax-3 strain and P100 treated with 0.25% Tween-80 (Fig. 3.5). The [3H]incorporation in P100 treated with Tween-80 was expectedly higher than that of P 100 due to the leakage of membrane bound proteins. The incorporation in both P100 fractions was higher than that of S100 (compare Fig 3.1 and 3.5) indicating more proteins residing in P 100 could uptake [3H]GlcNAc. However, in P 100 fractions, the incorporation in [3H]incorporation in the 21-24kDa region of the gel was not increased when Skp 1 -c-myc was added.

The dependence of enzyme activities on pH was tested after enzyme buffer was

replaced by gel filtration (Fig. 3.6). The highest activity was found at pH 7.5 8.0 and pH

7.8 was chosen as the assay pH in subsequent studies. Purification Step 1: Anion Exchange Chromatography on DEAE Fast-Flow

The S 100 preparation from overexpression strain HW1 20 was loaded onto DEAE Fast-Flow Sepharose at pH 7.4 and eluted with a gradient of 0 0.25 M NaCl. GlcNActransferase activity was found in the wash fractions (Fig. 3.7) suggesting that the enzyme was bound weakly to the column. The result was reproducible when the buffer was replaced with 50 mM Tris-HC1, lmM DTT, pH 7.5. Since the total activity in S100 could











76























P100 P 100/0.25%Tween- 80

a without Skpl-c-myc 116205kDa
with Skpl -c-myc 977.116kDa
66-97 kDa
46-66 kDa
36-45 kVa
2946 k~a
24-29 kDa
21-24 KD8
14-21 hDa
7-14 Da
03-7 kDa
<0.3 KDa
800 600 400 200 0 0 200 400 600 800
Activity (pmol/gm/h) Activity (pmol/gm/h)






Figure 3.5 Transfer of [3H] from UDP-[3H]-GIcNAc into P100 fractions of normal strain Ax3 in the presence of Skpl-c-myc. The P100 fraction from normal strain Ax3 was diluted 5 times with 0.25 M sucrose in 50 mM Tris-HCI (pH 7.4). An aliquot of diluted P100 was treated with 0.25% Tween-80 to measure potential latent activity. GlcNAc-transferase assays of P100 and P100/Tween-80 were performed as described in Fig. 3.1. Exogenous Skpl1-c-myc did not stimulate incorporation in P100 fractions.








77






2000




1500




E
CL 1000




500



N .D .... .
0
6 6.5 7 7.5 8

pH

Figure 3.6 The effects of pH on Skpl-GIcNAc-transferase activity. SlO fractions from HW120 were applied to PD10 columns pre-equilibrated with 50 mM Tris-HCl with different pH. GlcNAc-transferase activity in PD-10 fractions 3 which contained the highest activity was assayed. The data showed that low pH inhibited and high pH stimulated enzyme activity.








78




14000 12000 10000


8000
E

6000 4000 2000 .


0
o3 o3 o3C) o CO c
o C C C C3 C3 C


o
U.


Figure 3.7 GlcNAc-transferase activities in the flowthrough and wash fractions from DEAE-Sepharose. HW120-S 100 was pumped onto a DEAE-Sepharose column. Twenty gl aliquots of the flowthrough (total vol = 800 ml) and wash fractions (approximate total vol = 200 ml each) were assayed for GlcNAc-transferase activity. Majority of the enzyme activity was found in the wash fractions.








79

not be determined due to the presence of an unknown amount of the endogenous substrate, Skp 1 -c-myc, the activity in the wash fractions was taken as 100% (Table 3.1, line 1).

To optimize the assay conditions of the enzyme, the DEAE wash fraction was concentrated in an ultrafiltration cell, and tested for enzyme activity in the absence or presence of various concentration of NaCl, KC1, MnC12, and CaC12. NaCl inhibited activities more than KC1 (Fig. 3.8) and both MnC12 and CaC12 inhibited enzyme activity (Fig.3.9). It is notable that the assays contained 5 mM MgC12 and the enzyme activity was partially inhibited at MgC12 concentration higher than 10 mM (see below). Purification Step 2: Ammonium Sulfate Precipitation

The enzyme activity was purified further by ammonium sulfate fractionation.

Ammonium sulfate ((NH4)2SO4) was added to the DEAE wash to 25% saturation. The enzyme activity which remained soluble could be precipitated by increasing (NH4)2SO4 to 60% saturation. The pellet was collected and redissolved in 25% saturated (NH4)2SO4 in 50 mM HEPES-NaOH (pH 7.8), 5 mM MgC12, 0.1 mM disodiumEDTA, 1 mM DTT, 15% glycerol. Small aliquots of the enzyme fractions containing (NH4)2SO4 were desalted in Microcon- 10 devices and tested for GlcNAc-transferase activity. The recovery of enzyme activity in 25% saturated (NH4)2SO4 supernatant and 60% saturated (NH4)2SO4 pellet (Table 3.1, line 3 and 4) was only 81% and 50%, respectively. The activities might be lower than expected due to inhibition by remaining (NH4)2SO4 in the assays. Enzyme activity was completely recovered after (NH4)2SO4was removed by purification over a phenyl-Sepharose column (see below).









80


Table 3.1 Purification of GlcNAc-transferase activity. Purification of GlcNActransferase activity from the cytosol of Dictyostelium strain HW120. S 100 extract was prepared and applied on DEAE-Sepharose Fast Flow. The wash fractions were further purified over phenyl-Sepharose (low sub), Reactive Red-120, Superdex HPLC, dUMP, and UDP-GlcNAc columns.
Preparation Protein Total Yield Specific Purification
(mg) activity (%) activity (fold)
(pmol/h) (pmol/mg/h)
1. S100 4431 480.84a 100 0.108 1
2. DEAE-Sepharose 1744 480.84 100 0.276 2.54
3. 25% Saturated (NH4)2SO4 sup. 1603 388.18 80.73 0.242 2.23
4. 60% Saturated (NH4)2SO4 pel. 745.5 242.79 50.49 0.326 3
5. Phenyl-Sepharose 161.6 759.99 158.05 4.703 43.3
6. Reactive Red-120 agarose 16.02 77.32 16.08 4.826 44.5
7. Superdex-HPLC 3.09 70.95 14.76 22.91 221
8. dUMP-Sepharose 2.25 70.41 14.64 31.29 288
9. UDP-GlcNAc-Sepharose 0.035 66.75 13.88 1887 17393
a Minimum estimate derived from the next stage of purification.








81





100% KCI


-NaCI

80%



> 60%,i


S 40%




20%



0%
0 0.05 0.1 0.2 0.5 1

Concentration (M)



Figure 3.8 The effects of NaCl and KCI on GcNAc-transferase activity. The concentrated DEAE wash fractions were assayed for GlcNAc-transferase activity in the presence of different concentration of NaCl or KC1. Each reaction contained 5 mM MgC12, 3 mM ATP, 5 mM DTT, 0.5 mg/ml BSA, and 0.6 gM UDP-GlcNAc. NaCl inhibited the activity more than KC1.








82










100% EI CaCI2
MnCI 2

80%


& 60%
.>
0

40%
-0


20% L


0%
0 1 2.5 5 10
Concentration (mM)



Figure 3.9 The effects of CaC12 and MnCl2 on GlcNAc-transferase activity. The concentrated DEAE wash fraction was assayed for GlcNAc-transferase activity in the presence of different concentration of CaC12 and MnC12. Each reaction contained 5 mM MgC12, 3 mM ATP, 5 mM DTT, 0.5 mg/ml BSA, and 0.6 pM UDP-GlcNAc. Both CaC12 and MnC12 inhibit the activity.








83


Purification Step 3: Hydrophobic Interaction Chromatography on PhenylSepharose-(Low-Sub) Fast-Flow

The enzyme activity which had been dissolved in 25% saturated (NH4)2SO4 was loaded onto a phenyl-Sepharose-low-sub column. Enzyme activity bound to the column could be eluted by decreasing the concentration of (NH4)2SO4. The enzyme activities were found in late fractions as (NH4)2SO4 concentration diminished near to zero (Fig.

3.10). Based on the purification yield (Table 3.1, line 5), the activity was recovered completely. Further elution with 50% ethylene glycol did not yield any more activity. Purification Step 4: Reactive Dye Chromatography on Reactive Red-120 Fast Flow

The phenyl-Sepharose fractions containing GlcNAc-transferase activity were

applied to a Reactive Red- 120 fast flow column. Activity bound to the column and eluted in a gradient of 0-1.5 M NaC1 (Fig. 3.11). A KC1 gradient was not as effective since the enzyme activity was eluted broadly across the gradient (data not shown).

Only 16% of the activity was recovered from Reactive Red purification (Table

3.1, line 6). The small amount of the activity (2%) found in the flowthrough fraction could not explain the significant losts of activity (Fig. 3.12). To test for a potential subunit which might have been separated during the purification, the flowthrough fractions mixed with the eluted fraction were assayed for the activity (Fig. 3.12). The addition of the flowthrough fractions to the eluted fraction could not recover any more activity but instead inhibited it by 45% indicating that an essential cofactor did not seem to be separated from the enzyme unless it was eluted at a higher NaC1 concentration or still bound to the column. To test for the possibility that an essential cofactor existed at an









84












T







(NH4)2 SO4 saturation
25% 1200
1000

800
600

f e -400 2 00
0% 0
0 10 20 30 40 50 60 70 Fraction number




Figure 3.10 Purification of GlcNAc-transferase on phenyl-Sepharose low-sub column. GlcNAc-transferase activity in DEAE wash fraction was precipitated with 60% saturated (NH4)2SO4 and applied onto a phenyl-Sepharose low-sub column preequilibrated with 25% saturated (NH4)2SO4 in 50 mM HEPES-NaOH (pH 7.8), 5 mM MgC12, 0.1 mM EDTA, 1 mM DTT, 15% glycerol. The column was eluted by decreasing (NH4)2SO4 concentration down to zero. The eluted fractions were tested for GlcNActransferase activity.








85









14~









NaCl
500- 1.5 M
400300
200100
0 ISt0 M
0 5 10 15 20 25 Fraction number





Figure 3.11 Purification of GleNAc-transferase on a Reactive Red-120 column. The phenyl-Sepharose eluted fractions which contained GlcNAc-transferase activities were pooled and loaded onto a Reactive Red-120 column. The column was eluted by an application of NaCI gradient to 1.5 M. The eluted fractions were tested for GlcNActransferase activity.








86





500



400



300
E
"O

200



100


N.D.
0
1 2 3 4 5

Reactive Red fr. 9 + + +
Flowthrough fr. 1 + +
Flowthrough fr. 2 + +




Figure. 3.12 Reactive Red flowthrough fractions could not restore GlcNActransferase activity. Reactive-Red eluted fraction 9 which contained the highest activity was assayed in the absence or presence of flowthrough fraction 1 and 2. The flowthrough fraction did not increase the GlcNAc-transferase activity but instead inhibited it.




Full Text

PAGE 1

6758&785( 2) $ 6.3*/<&$1 $1' %,2*(1(6,6 2) ,76 3(37,'( /,1.$*( ,1 ',&7<267(/,80 %\ 3$7$1$ 7(1*8018$< $ ',66(57$7,21 35(6(17(' 72 7+( *5$'8$7( 6&+22/ 2) 7+( 81,9(56,7< 2) )/25,'$ ,1 3$57,$/ )8/),//0(17 2) 7+( 5(48,5(0(176 )25 7+( '(*5(( 2) '2&725 2) 3+,/2623+< 81,9(56,7< 2) )/25,'$

PAGE 2

$&.12:/('*(0(176 ZRXOG OLNH WR DFNQRZOHGJH P\ VXSHUYLVRU 'U &KULVWRSKHU 0 :HVW IRU DOORZLQJ PH WR EH D SDUW RI WKLV LQWHUHVWLQJ SURMHFW DQG IRU KLV WLPH DQG JXLGDQFH ZRXOG DOVR OLNH WR WKDQN RWKHU PHPEHUV RI P\ FRPPLWWHH 'U -HIIUH\ +DUULVRQ 'U *XGUXQ 6 %HQQHWW DQG 'U :LOOLDP $ 'XQQ IRU WKHLU WLPH DQG DGYLFH ,Q DGGLWLRQ ZRXOG OLNH WR DFNQRZOHGJH WKH VFLHQWLVWV ZKR KHOSHG PH LQ WKLV SURMHFW 'UV +RZDUG 5 0RUULV $QQH 'HOO 0DULD 3£QLFR DQG 7KDQDL 3D[WRQ IRU WKHLU 4 72)06 VWXG\ RQ WKH IXFRJO\FRSHSWLGH 'U 0LFKDHO 5 %XEE IRU EULQJLQJ XV DQ LGHD RI WKH DFWLQ ELQGLQJ PRWLI DQG IRU KLV ZRUN RQ 6NSODFWLQ LQWHUDFWLRQ 0V +DQNH YDQ GHU :HL IRU KHU DVVLVWDQFH DQG WKH SUHOLPLQDU\ ZRUN RQ SXULI\LQJ JO\FRSHSWLGH 'U (PLO .R]DURY IRU SUHSDULQJ WKH +: VWUDLQ DQG WKH UHFRPELQDQW 6NSO+LV 0U7RE\ 6FRWW :DUG IRU VKDULQJ KLV WLPH ZLWK PH RQ WKH IXFRV\OWUDQVIHUDVH SURMHFW 0LVV .DWKU\Q 7 'REVRQ IRU KHOSLQJ PH VFUHHQLQJ 6NSOFP\F FRH[SUHVVLRQ FRORQLHV DQG 0U %HQMDPLQ /XWWJH 0V %RQLWD :HUWV 0U 5\DQ )UDQNHO DQG 0U 6OLP 6DVVL IRU WKHLU KHOS LQ WKH *OF1$FWUDQVIHUDVH SURMHFW ZRXOG OLNH WR H[SUHVV P\ JUDWLWXGH WR 'U 1DQF\ 'HQVORZ DQG WKH VFLHQWLVWV DW WKH 8QLYHUVLW\ RI )ORULGD ,&%5 3URWHLQ &KHPLVWU\ &RUH /DERUDWRU\ 0V 6DUD ( 3HWUXVND IRU VKRZLQJ PH KRZ WR XVH 0$/',72)06 LQVWUXPHQW 0U (G\ 6HJXUD IRU WKH (GPDQ GHJUDGDWLRQ VHTXHQFLQJ DQG 0U $OIUHG &KXQJ IRU SUHSDULQJ WKH V\QWKHWLF X

PAGE 3

SHSWLGHV 'U 'DYLG 5HQW] DQG 0U -DPHV % 3DUNHU DW WKH 8QLYHUVLW\ RI )ORULGD ,&%5 *O\FRELRORJ\ &RUH /DERUDWRU\ DUH DFNQRZOHGJHG IRU WKHLU DVVLVWDQFH LQ WKH *&06 DQG WKH 'LRQH[+3/& ZRXOG OLNH WR WKDQN IDFXOW\ PHPEHUV VHFUHWDULHV DQG JUDGXDWH VWXGHQWV LQ WKH 'HSDUWPHQW RI $QDWRP\ DQG &HOO %LRORJ\ IRU WKHLU YDOXDEOH IULHQGVKLS DQG IRU EHLQJ DQ LPSRUWDQW SDUW RI P\ HGXFDWLRQ DOVR DFNQRZOHGJH P\ SURIHVVRU DW WKH &KXODORQJNRUQ 8QLYHUVLW\ 'U 9LVLW 6LWSULMD IRU LQVSLULQJ PH WR EHFRPH D VFLHQWLVW )LQDOO\ ZRXOG OLNH WR WKDQN P\ PRWKHU IRU EHOLHYLQJ LQ PH IRU WHDFKLQJ PH WR EH D VWURQJ SHUVRQ DQG IRU WHOOLQJ PH QRW WR JLYH XS P\ GUHDP :LWKRXW KHU XQGHUVWDQGLQJ DQG VXSSRUW ZRXOG QRW EH DEOH WR DFKLHYH P\ JRDO

PAGE 4

7$%/( 2) &217(17 SDJH $&.12:/('*0(176 LL /,67 2) 7$%/(6 YLL /,67 2) ),*85(6 YLLL /,67 2) $%%5(9,$7,216 [L $%675$&7 [LLL &+$37(56 ,1752'8&7,21 3URWHLQ *O\FRV\ODWLRQ 'LFW\RVWHOLXP 6NSO D 0DUNHU 3URWHLQ IRU D 1RYHO *O\FRV\ODWLRQ 3DWKZD\ 6NSO LV D +LJKO\ &RQVHUYHG 3URWHLQ ZLWK 0XOWLSOH &\WRSODVPLF1XFOHDU )XQFWLRQV 6NSO 0HGLDWHV LWV $FWLRQV WKURXJK DQ )ER[ 0RWLI 6NSO 0HGLDWHV 8ELTXLWLQ'HSHQGHQW 3URWHRO\VLV RI &HOO &\FOH DQG 2WKHU 3URWHLQV WKURXJK 6&) FRPSOH[ 6NSO 0HGLDWHV 3KRVSKRU\ODWLRQ RI D .LQHWRFKRUH 3URWHLQ WKURXJK DQ )ER[ 0RWLI ZKLFK LV ,PSRUWDQW IRU .LQHWRFKRUH $VVHPEO\ 7KH 3RVVLEOH 5ROH RI 6NSO LQ YRQ +LSSHO/LQGDX 'LVHDVH 7KH ,PSRUWDQFH RI 6NSO*O\FRV\ODWLRQ 6WXG\ 7KH &KDUDFWHULVWLFV DQG &RPSDUWPHQWDOL]DWLRQ RI 6NSO*O\FRV\ODWLRQ 7+( */<&26,',& /,1.$*( $1' 6758&785( 2) 6.3 */<&$1 ,QWURGXFWLRQ 0DWHULDOV DQG 0HWKRGV &HOOV &RQVWUXFWLRQ RI 6NSOFP\F 2YHUH[SUHVVLRQ 6WUDLQ +: 3UHSDUDWLRQ RI 5HFRPELQDQW 'LFW\RVWHOLXP 6NSO 6NSO+LVf LY

PAGE 5

3XULILFDWLRQ RI 6NSO 0HWDEROLF /DEHOLQJ RI 6NSO 0RQRVDFFKDULGH &RPSRVLWLRQ $QDO\VLV RI 6NSOFP\F 3XULILFDWLRQ RI *O\FRV\ODWHG 3HSWLGHV 0DWUL[$VVLVWHG /DVHU 'HVRUSWLRQ 7LPHRI)OLJKW 0$/',72)f 0DVV 6SHFWURPHWU\ 472) 0DVV 6SHFWURPHWU\ ([RJO\FRVLGDVH 'LJHVWLRQ RI 6NSO *O\FRSHSWLGHV 0LOG $FLG +\GURO\VLV RI WKH )XFRJO\FRSHSWLGH 5HVXOWV 6NSO &RQWDLQHG 2QO\ D 6LQJOH )XFRJO\FRSHSWLGH (GPDQ 'HJUDGDWLRQ RI )XFRJO\FRSHSWLGH +@*OF1$F6NSO 7KH 5HGXFWLYH $ONDOLQH 'HJUDGDWLRQ RI >+@*OF1$F6NSO 5HVXOWV *OF1$F7UDQVIHUDVH $FWLYLW\ WKDW 0RGLILHG 6NSO ZDV )RXQG LQ WKH 6, )UDFWLRQ RI 'LFW\RVWHOLXP 3XULILFDWLRQ 6WHS $QLRQ ([FKDQJH &KURPDWRJUDSK\ RQ '($( )DVW)ORZ Y

PAGE 6

3XULILFDWLRQ 6WHS $PPRQLXP 6XOIDWH 3UHFLSLWDWLRQ 3XULILFDWLRQ 6WHS +\GURSKRELF ,QWHUDFWLRQ &KURPDWRJUDSK\ RQ 3KHQ\O6HSKDURVH/RZ6XEf )DVW)ORZ 3XULILFDWLRQ 6WHS 5HDFWLYH '\H &KURPDWRJUDSK\ RQ 5HDFWLYH 5HG )DVW)ORZ 3XULILFDWLRQ 6WHS *HO )LOWUDWLRQ &KURPDWRJUDSK\ RQ 6XSHUGH[ +3/& 7KH (IIHFWV RI 1XFOHRWLGH $QDORJXHV RQ *OF1$F7UDQVIHUDVH $FWLYLW\ 3XULILFDWLRQ 6WHS +JG8036HSKDURVH % &KURPDWRJUDSK\ 3XULILFDWLRQ 6WHS DIILQLW\ &KURPDWRJUDSK\ RQ DPLQRDOO\Of8'3*OF1$F 6HSKDURVH )DVW)ORZ &KDUDFWHULVWLFV RI WKH $FFHSWRU 6XEVWUDWH 3URGXFW .LQHWLF 3URSHULWHV RI WKH 6NSO*OF1$F7UDQVIHUDVH 'LVFXVVLRQ 6800$5< $1' 3(563(&7,9(6 6WUXFWXUH DQG %LRJHQHVLV RI D 6NSO*O\FDQ 'LFW\RVWHOLXP 6NSO &RQWDLQV D 1RYHO 3HQWDVDFFKDULGH /LQNHG WR +\GUR [\SUROLQH (YLGHQFH RI 6NSO3URO\OK\GUR[\ODVH $FWLYLW\ LQ WKH &\WRVRO &KDUDFWHUL]DWLRQ RI &\WRVROLF 6NSO*OF1$F7UDQVIHUDVH &KDUDFWHUL]DWLRQ RI &\WRVROLF 6NSO)XFRV\OWUDQVIHUDVH (YLGHQFH RI 6NSO*DODFWRV\OWUDQVIHUDVH LQ WKH &\WRVRO RI 'LFW\RVWHOLXP 7KH (IIHFWV RI 'LFW\RVWHOLXP 6NSO RQ $FWLQ 3RO\PHUL]DWLRQ 3UHSDUDWLRQ RI 6NSOFP\F &RH[SUHVVLRQ 6WUDLQV &RQVWUXFWLRQ RI D 3ODVPLG (QFRGLQJ 6NSOFP\F ,Q 9LWUR 6LWH'LUHFWHG 0XWDJHQHVLV RI S 7UDQVIRUPDWLRQ RI 'LFW\RVWHOLXP 6WUDLQ $[ )XWXUH 'LUHFWLRQ 5()(5(1&(6 %,2*5$3+,&$/ 6.(7&+ YL

PAGE 7

/,67 2) 7$%/(6 7DEOH SDJH *O\FRVLGLF SHSWLGH OLQNDJH $PLQR DFLG VHTXHQFHV RI 6NSO DW SRVLWLRQV ([RJO\FRVLGDVH WUHDWPHQWV RI JO\FRSHSWLGHV 3UHGLFWHG P] YDOXHV RI HQGR/\V& GHULYHG 6NSO SHSWLGHV 0$/',72)06 P] YDOXHV IRU HQGRO\VFGHULYHG JO\FRSHSWLGHV 3K\ORJHQHWLF FRPSDULVRQ RI VHTXHQFHV VXUURXQGLQJ 3UR 3XULILFDWLRQ RI *OF1$FWUDQVIHUDVH DFWLYLW\ 5HODWLYH DFWLYLW\ RI WKH *OF1$FWUDQVIHUDVH LQ WKH SUHVHQFH RI GRQRU VXEVWUDWH DQDORJXHV 7KH ROLJRQXFOHRWLGH SULPHUV XVHG WR SUHSDUH 6NS FP\F SODVPLGV 9OO

PAGE 8

/,67 2) ),*85(6 )LJXUH SDJH *HQRPLF PDS RI WKH UHJLRQV VXUURXQGLQJ WKH ISDO DQG ISD JHQHV 3XULILFDWLRQ RI WKH >),@IXFRJO\FRSHSWLGH IURP 6NSO 472) 06 DQDO\VLV RI 6NSO IXFRJO\FRSHSWLGH 0606 FROOLVLRQDOO\ DFWLYDWHG GHFRPSRVLWLRQ VSHFWUXP RI P] 3DUWV RI WKH 0606 VSHFWUXP VKRZQ LQ )LJ H[SDQGHG WR VKRZ ORZHU PDVV UHJLRQ FRQWDLQLQJ SHSWLGHGHULYHG IUDJPHQW LRQV PRUH FOHDUO\ 3DUWV RI WKH 0606 VSHFWUXP VKRZQ LQ )LJ H[SDQGHG WR VKRZ KLJKHU PDVV UHJLRQ FRQWDLQLQJ SHSWLGHGHULYHG IUDJPHQW LRQV PRUH FOHDUO\ 3UHGLFWHG PDVVHV RI 1 DQG & WHUPLQDO VHTXHQFH LRQV RI WKH IXFRJO\FRSHSWLGH 0$/',72)06 DQDO\VLV RI 6NSO JO\FRSHSWLGHV IURP QRUPDO VWUDLQ $[ )UDFWLRQDWLRQ RI HQGR/\V& JHQHUDWHG 6NSO+LV SHSWLGHV *&06 DQDO\VLV RI 6NSOFP\F WRWDO VXJDUV $ WLPH FRXUVH 0$/',72)06 DQDO\VLV RI 6NSO IXFRJO\FRSHSWLGH DIWHU PLOG DFLG K\GURO\VLV )UDFWLRQDWLRQ RI HQGR/\V& JHQHUDWHG DIXFRV\ODWHG 6NSO SHSWLGHV 0$/',72)06 DQDO\VLV RI 6NSO JO\FRSHSWLGHV IURP DIXFRV\ODWLRQ VWUDLQ +/ )UDFWLRQDWLRQ RI HQGR/\V& JHQHUDWHG 6NSOFP\F SHSWLGHV 7KH PDVV VSHFWUD RI HQGR/\V& JHQHUDWHG 6NSOFP\F SHSWLGHV 7UDQVIHU RI >+@ IURP 8'3>+@*OF1$F LQWR 6, IUDFWLRQV RI QRUPDO VWUDLQ $[ DQG RYHUH[SUHVVLRQ VWUDLQ +: 7UDQVIHU RI >+@ IURP 8'3>+@*F1$F LQWR 6 IUDFWLRQV RI QRUPDO VWUDLQ $[ DQG RYHUH[SUHVVLRQ VWUDLQ +: LQ WKH SUHVHQFH RI 6NSOSHSWLGH ,QKLELWLRQ RI *OF1$FWUDQVIHUDVH DFWLYLWLHV E\ V\QWKHWLF SHSWLGH DQG DQWL6NSODQWLERG\ *OF1$FWUDQVIHUDVH DFWLYLW\ LV VSHFLILF IRU 6NSOFP\F YP

PAGE 9

7UDQVIHU RI >+@ IURP 8'3>+@*F1$F LQWR 3, IUDFWLRQV RI QRUPDO VWUDLQ $[ LQ WKH SUHVHQFH RI 6NSOFP\F 7KH HIIHFWV RI S+ RQ 6NSO*OF1$FWUDQVIHUDVH DFWLYLW\ *OF1$FWUDQVIHUDVH DFWLYLWLHV LQ WKH IORZWKURXJK DQG ZDVK IUDFWLRQV IURP '($(6HSKDURVH 7KH HIIHFWV RI 1D&O DQG .& RQ *OF1$FWUDQVIHUDVH DFWLYLW\ 7KH HIIHFWV RI &D&O DQG 0Q&O RQ *OF1$FWUDQVIHUDVH DFWLYLW\ 3XULILFDWLRQ RI *OF1$FWUDQVIHUDVH RQ SKHQ\O6HSKDURVH ORZVXE FROXPQ 3XULILFDWLRQ RI *OF1$FWUDQVIHUDVH RQ D 5HDFWLYH 5HG FROXPQ 5HDFWLYH 5HG IORZWKURXJK IUDFWLRQV FRXOG QRW UHVWRUH *OF1$FWUDQVIHUDVH DFWLYLW\ $[6 RU SKHQ\O6HSKDURVH IUDFWLRQ GLG QRW LQFUHDVH *OF1$FWUDQVIHUDVH DFWLYLW\ LQ WKH 5HDFWLYH5HG SXULILHG IUDFWLRQ 3XULILFDWLRQ RI *OF1$FWUDQVIHUDVH RQ D 6XSHUGH[ JHO ILOWUDWLRQ +3/& FROXPQ 7KH *OF1$FWUDQVIHUDVH DFWLYLW\ LV GHSHQGHQW RQ '77 7KH *OF1$FWUDQVIHUDVH DFWLYLW\ LV GHSHQGHQW RQ 0J&O 7KH HIIHFWV RI GHWHUJHQWV RQ *OF1$FWUDQVIHUDVH DFWLYLWLHV 7KH FKHPLFDO VWUXFWXUH RI 8'3*OF1$F DQG WKH SRWHQWLDO HQ]\PH UHFRJQLWLRQ VLWHV WHVWHG E\ QXFOHRWLGH DQDORJXHV 7KH VWUXFWXUH RI +JG8036HSKDURVH % 7KH HIIHFWV RI XUDFLO RQ 6XSHUGH[ SXULIHG DQG G8036HSKDURVH SXULILHG *OF1$FWUDQVIHUDVH 7LPH FRXUVH DQDO\VLV RI *OF1$FWUDQVIHUDVH DFWLYLW\ &KURPDWRJUDSK\ RI WKH UHDFWLRQ SURGXFWV IURP DPLQRDOO\Of8'3*OF1$F V\QWKHVLV DIWHU SXULILFDWLRQ RYHU D '($( 6HSKDURVH )DVW )ORZ FROXPQ 7KH VWUXFWXUH RI DPLQRDOO\Of8'3*OF1$F 6HSKDURVH 3XULILFDWLRQ RI *OF1$FWUDQVIHUDVH DFWLYLW\ RQ DPLQRDOO\Of8'3*OF1$F 6HSKDURVH +LJKS+ DQLRQH[FKDQJH FKURPDWRJUDSK\ RI WKH DFLG K\GURO\VLV GHULYDWLYHV RI >+@*OF1$F6NSO L[

PAGE 10

.LQHWLF SURSHUWLHV RI WKH *OF1$FWUDQVIHUDVH ZLWK UHVSHFW WR WKH +\3UR SHSWLGH .LQHWLF SURSHUWLHV RI WKH *OF1$FWUDQVIHUDVH ZLWK UHVSHFW WR 6NSOFP\F .LQHWLF SURSHUWLHV RI WKH *OF1$FWUDQVIHUDVH ZLWK UHVSHFW WR 8'3*OF1$F ,QKLELWLRQ RI DFWLQ SRO\PHUL]DWLRQ E\ 'LFW\RVWHOLXP 6NS [

PAGE 11

/,67 2) $%%5(9,$7,216 $UD DUDELQRVH $73 DGHQLQH fWULSKRVSKDWH %LR873 1 >1ELRWLQ\OHDPLQRFDSUR\ @ DPLQRDOO\ Of f 873 F)7DVH F\WRVROLF IXFRV\OWUDQVIHUDVH &73 F\WRVLQH fWULSKRVSKDWH 'D GDOWRQ '($( GLHWK\ODPLQRHWK\O '0) 1O?S GLPHWK\OIRUPDPLGH '77 GLWKLRWKUHLWRO G8'3 fGHR[\XULGLQH fGLSKRVSKDWH G803 f GHR[\XULGLQH f PRQRSKRVSKDWH ('7$ HWK\OHQHGLDPLQHWHWUDDFHWLF DFLG *DO 'JDODFWRVH *DO1$F 1DFHW\OJDODFWRVDPLQH *&06 JDV FKURPDWRJUDSK\ PDVV VSHFWURPHWU\ *OF 'JOXFRVH *OF1$F 1DFHW\O'JOXFRVDPLQH KR ZDWHU +& K\GURFKORULF DFLG +(3(6 1+\GUR[\HWK\OfSLSHUD]LQH1fHWKDQHVXOIRQLF DFLGf +Jf PHUFXU\ +J&O PHUFXU\ FKORULGH +3/& KLJK SUHVVXUH OLTXLG FKURPDWRJUDSK\ .& SRWDVVLXP FKORULGH /L&O OLWKLXP FKORULGH /6% /DPPHOL VDPSOH EXIIHU P$E PRQRFORQDO DQWLERG\ 0$/',72) 06 PDWUL[DVVLVWHG ODVHU GHVRUSWLRQ WLPHRIIOLJKW PDVV VSHFWURPHWU\ 0DQ PDQQRVH 0H&1 DFHWRQLWULOH 0U PROHFXODU ZHLJKW 1D%+ VRGLXP ERURK\GULGH 1D&O VRGLXP FKORULGH 1D2$& VRGLXP DFHWDWH 1D2+ VRGLXP K\GUR[LGH 1+6 1K\GUR[\VXFFLQLPLGH [L

PAGE 12

1+f6 DPPRQLXP VXOIDWH 25) RSHQ UHDGLQJ IUDPH 3$*( SRO\DFU\ODPLGH JHO HOHFWURSKRUHVLV 3&5 SRO\PHUDVH FKDLQ UHDFWLRQ 32323 GLPHWK\Of O%LV0HWK\O3KHQ\OR[D]R\Off%HQ]HQH 332 'LSKHQ\ OR[D]ROH 472) 06 TXDGUXSROH WLPHRIIOLJKW PDVV VSHFWURPHWU\ 5KD UKDPQRVH 53+3/& UHYHUVHG SKDVHKLJK SUHVVXUH OLTXLG FKURPDWRJUDSK\ 6'6 VRGLXP GRGHF\O VXOIDWH 7($ WULHWK\ODPLQH 7($% WULHWK\ODPLQHELFDUERQDWH 7)$ WULIOXRURDFHWLF DFLG 706 WULPHWK\OVLO\O 8'3 XULGLQH fGLSKRVSKDWH 803 XULGLQH fPRQRSKRVSKDWH 873 XULGLQH fWULSKRVSKDWH ;\O [\ORVH ;8

PAGE 13

$EVWUDFW RI 'LVVHUWDWLRQ 3UHVHQWHG WR WKH *UDGXDWH 6FKRRO RI WKH 8QLYHUVLW\ RI )ORULGD LQ 3DUWLDO )XOILOOPHQW RI WKH 5HTXLUHPHQWV IRU WKH 'HJUHH RI 'RFWRU RI 3KLORVRSK\ 6758&785( 2) $ 6.3*/<&$1 $1' %,2*(1(6,6 2) ,76 3(37,'( /,1.$*( ,1 ',&7<267(/,80 %\ 3DWDQD 7HQJXPQXD\ 'HFHPEHU &KDLUPDQ &KULVWRSKHU 0 :HVW 3K' 0DMRU 'HSDUWPHQW $QDWRP\ DQG &HOO %LRORJ\ 6NSO LV LQYROYHG LQ WKH XELTXLWLQDWLRQ RI FHUWDLQ FHOO F\FOH DQG RWKHU SURWHLQV ,Q 'LFW\RVWHOLXP GLVFRLGHXP 6NSO KDV DQ XQXVXDO 2OLQNHG FDUERK\GUDWH PRGLILFDWLRQ %DVHG RQ (GPDQ GHJUDGDWLRQ 0$/',72)06 472)0606 GHFRPSRVLWLRQ DFLG K\GURO\VLV DQG H[RJO\FRVLGDVH VWXGLHV RI 6NSOJO\FRSHSWLGHV IURP ERWK QRUPDO FHOOV DQG D IXFRV\ODWLRQ PXWDQW DQG WKH VXJDU FRPSRVLWLRQ RI WKH SURWHLQ GHWHUPLQHG E\ *&06 DQDO\VLV RI 706GHULYDWLYHV RI PHWKDQRO\VDWHV WKH JO\FDQ LV FRQFOXGHG WR FRQVLVW RI D OLQHDU SHQWDVDFFKDULGH *DOD *DOD )XFD *DO >L *OF1$Ff DWWDFKHG WR D K\GUR[\SUROLQH DW FRGRQ ZKLFK OLHV LQ D KLJKO\ FRQVHUYHG UHJLRQ RI WKH SURWHLQ 7KH VWUXFWXUH RI WKH SHQWDVDFFKDULGH DQG LWV JO\FRVLGLF SHSWLGH OLQNDJH LQGLFDWH D QRYHO SDWKZD\ RI SURWHLQ JO\FRV\ODWLRQ ZKLFK LV SUHGLFWHG WR FRQVLVW RI VL[ QRYHO HQ]\PHV LQFOXGLQJ D SURO\OK\GUR[\ODVH DQG ILYH JO\FRV\OWUDQVIHUDVHV $Q DVVD\ ZDV GHYHORSHG IRU

PAGE 14

WKH *OF1$FWUDQVIHUDVH UHVSRQVLEOH IRU WKH DWWDFKPHQW RI WKH ILUVW VXJDU WR WKH +\3UR UHVLGXH XVLQJ 8'3>+@*F1$F DV D GRQRU DQG XQGHUJO\FRV\ODWHG 6NSO LVRODWHG IURP D 'LFW\RVWHOLXP RYHUH[SUHVVLRQ VWUDLQ RU D V\QWKHWLF SHSWLGH DV DQ DFFHSWRU 6NSO*OF1$F WUDQVIHUDVH DFWLYLW\ ZDV IRXQG LQ WKH 6, IUDFWLRQ EXW QRW LQ WKH 3, SDUWLFXODWH IUDFWLRQ 7KH UHFRPELQDQW 6NSO IURP (FROL DQG WKH V\QWKHWLF SHSWLGH FRQWDLQLQJ 3UR LQ SODFH RI +\3UR ZHUH LQDFWLYH 7KH UDGLRDFWLYLW\ ZDV UHFRYHUHG DV *OF1+ DIWHU DFLG K\GURO\VLV LQGLFDWLQJ WKH LQFRUSRUDWLRQ RI *OF1$F ,QFRUSRUDWHG *OF1$F FRXOG QRW EH UHOHDVHG E\ AHOLPLQDWLRQ LQGLFDWLQJ WKH DWWDFKPHQW WR +\3UR 7KH *OF1$FWUDQVIHUDVH DFWLYLW\ ZDV SXULILHG WR IROGV ZLWK b \LHOG IURP WKH F\WRVROLF 6, IUDFWLRQ RYHU '($( SKHQ\O 5HDFWLYH 5HG 6XSHUGH[ G803 DQG 8'3*OF1$F FROXPQV 7KH HQ]\PH EHKDYHG DV D VLQJOH FRPSRQHQW ZLWK DQ DSSDUHQW 0U RI DQG DSSDUHQW .P IRU 8'3*OF1$F RI S0 $FWLYLW\ RI WKH HQ]\PH ZDV DEVROXWHO\ GHSHQGHQW RQ '77 7KH SUHVHQFH RI WKLV HQ]\PH LQ WKH F\WRVROLF IUDFWLRQ LWV UHTXLUHPHQW IRU D UHGXFLQJ HQYLURQPHQW DQG LWV KLJK DIILQLW\ IRU 8'3*OF1$F VWURQJO\ VXJJHVW WKDW WKH *OF1$FWUDQVIHUDVH JO\FRV\ODWHV 6NSO LQ WKH F\WRSODVP 7KH 6NSO*OF1$FWUDQVIHUDVH DQG WKH SUHYLRXVO\ GHVFULEHG 6NSOIXFRV\OWUDQVIHUDVH DSSHDU WR EHORQJ WR D JO\FRV\ODWLRQ SDWKZD\ ZKLFK LV QRYHO ZLWK UHVSHFW WR WKH VWUXFWXUH IRUPHG DQG LWV FRPSDUWPHQWDOL]DWLRQ LQ WKH F\WRSODVP UDWKHU WKDQ LQ WKH VHFUHWRU\ SDWKZD\ [LY

PAGE 15

&+$37(5 ,1752'8&7,21 3URWHLQ *O\FRV\ODWLRQ *O\FRV\ODWLRQ WKH FRQVWUXFWLRQ RI ROLJRVDFFKDULGH VLGH FKDLQV RI SURWHLQV DQG OLSLGV LV WKH PRVW FRPPRQ DQG WKH PRVW GLYHUVH W\SH RI SURWHLQ SRVWWUDQVODWLRQDO PRGLILFDWLRQ ,W LV NQRZQ WR RFFXU LQ HYHU\ HXNDU\RWLF RUJDQLVPV DQG LQ VRPH SURNDU\RWLF RUJDQLVPV LQFOXGLQJ PDQ\ VSHFLHV RI DUFKDHEDFWHULD DQG HXEDFWHULD UHYLHZHG LQ +DUW 2SGHQDNNHU HW DK f ,Q DQ LQGLYLGXDO JO\FRSURWHLQ PRUH WKDQ RQH FDUERK\GUDWH DWWDFKPHQW LV RIWHQ SUHVHQW DQG HDFK DWWDFKPHQW VLWH PD\ FRQWDLQ GLIIHUHQW JO\FDQV 7KLV PLFURKHWHURJHQHLW\ JHQHUDWHV PXOWLSOH JO\FRIRUPV ZKLFK PD\ KDYH GLIIHUHQW SK\VLFDO DQG ELRFKHPLFDO SURSHUWLHV DQG PD\ OHDG WR GLIIHUHQW IXQFWLRQV *O\FDQV DUH FRQMXJDWHG WR SURWHLQV E\ WKUHH W\SHV RI FRYDOHQW OLQNDJHV $OLQNHG 2OLQNHG DQG SKRVSKDWHOLQNHG JO\FRV\ODWLRQ 7KH PRVW ZHOO NQRZQ $JO\FRVLGLF OLQNDJHV DUH IRUPHG EHWZHHQ 1DFHW\OJOXFRVDPLQH DQG WKH DPLGR JURXS RI /DVSDUDJLQH ,W LV LQLWLDWHG LQ WKH U(5 E\ WKH HQ EORF WUDQVIHU RI D *OF0DQ*OF1$F SUHFXUVRU IURP D GROLFKRO FDUULHU RQWR WKH QLWURJHQ LQ WKH DVSDUDJLQH RI QDVFHQW SRO\SHSWLGHV 7KH ROLJRVDFFKDULGH VWUXFWXUHV DUH ODWHU PRGLILHG LQ WKH (5 DQG LQ WKH *ROJL DSSDUDWXV UHYLHZHG LQ .RPIHOG t .RPIHOG $EHLMRQ t +LUVFKEHUJ f 7KH DVSDUDJLQH ZKLFK LV WKH DWWDFKPHQW VLWH IRU WKH *OF1$F UHVLGXH LV D SDUW RI D FRQVHQVXV PRWLI $VQ ;6HU7KU ZKHUH ; PD\ EH DQ\ DPLQR DFLG H[FHSW SUROLQH 7KH $VQ;7KU PRWLI LV PRUH FRPPRQO\ XWLOL]HG FRPSDUHG WR WKH $VQ;6HU PRWLI .DVWXUL HW DO f 7KH

PAGE 16

H[FHSWLRQ WR WKLV PRWLI LV QHSKULWRJHQRVLGH LQ ZKLFK JOXFRVH LV $0LQNHG WR WKH VHTXHQFH $VQ3UR/HX 6KLEDWD HW DO f 2WKHU 79OLQNHG PRQRVDFFKDULGHV ZHUH GLVFRYHUHG LQ EDFWHULDO JO\FRSURWHLQV LQFOXGLQJ JOXFRVH 1DFHW\OJDODFWRVDPLQH DQG UKDPQRVH /LV DQG 6KDURQ f 2JO\FRVLGLF OLQNDJHV DUH IRUPHG EHWZHHQ ROLJRVDFFKDULGH VLGH FKDLQV DQG WKH K\GUR[\O JURXS RI VHULQH WKUHRQLQH W\URVLQH K\GUR[\O\VLQH RU K\GUR[\SUROLQH 0RVW RI WKH 2OLQNHG JO\FRV\ODWLRQ SDWKZD\V DOVR RFFXU LQ WKH VHFUHWRU\ SDWKZD\ 7KH ROLJRVDFFKDULGH VLGH FKDLQV DUH OLQNHG WKURXJK WKH R[\JHQ RI K\GUR[\O JURXS RI VHULQH WKUHRQLQH W\URVLQH K\GUR[\O\VLQH RU K\GUR[\SUROLQH E\ VHTXHQWLDO HQ]\PDWLF DGGLWLRQV RI PRQRVDFFKDULGHV GLUHFWO\ WR WKH SURWHLQ EHJLQQLQJ ZLWK 1DFHW\OJDODFWRVDPLQH LQ PXFLQW\SH JO\FDQV ,Q FRQWUDVW WR $0 LQNHG JO\FRV\ODWLRQ GLIIHUHQW W\SHV RI 2OLQNHG JO\FRVLGLFSHSWLGH OLQNDJHV KDYH EHHQ LGHQWLILHG 7DEOH f :KHUHDV WKH H[LVWHQFH RI VSHFLILF PRWLIV IRU WKH DFFHSWRU VLWH KDV EHHQ LGHQWLILHG LQ PRVW RI 2JO\FRV\OSURWHLQV %RXUGRQ HW DO +DUULV DQG 6SHOOPDQ 3LVDQR HW DO 3OXPPHU HW DO 3URFNRS HW DO f WKH FRQVHQVXV PRWLIV RI 2OLQNHG JO\FRV\ODWLRQ LQ WKH VHFUHWRU\ SDWKZD\ DUH OHVV GHILQHG ZKLFK PLJKW EH H[SODLQHG E\ GLIIHUHQW W\SHV RI *DO1$FWUDQVIHUDVHV UHYLHZHG LQ &ODXVHQ t %HQQHWW f 5HFHQWO\ D QHZ W\SH RI FDUERK\GUDWHSHSWLGH OLQNDJH QDPHG SKRVSKRJO\FRV\ODWLRQ KDV EHHQ GHPRQVWUDWHG LQ 3URWHLQDVH LVRODWHG IRUP 'LFW\RVWHOLXP GLVFRLGHXP ,W FRQWDLQV *F1$F3 OLQNHG WR VHULQH *XVWDIVRQ DQG 0LOQHU f 7KHUHDIWHU RWKHU F\VWHLQ SURWHLQDVHV IURP 'GLVFRLGHXP ZHUH DOVR VKRZQ WR SRVVHV *OF1$F 3 SKRVSKRJO\FRV\ODWLRQ 0HKWD HW DO f %HVLGHV GLVFRLGHXP

PAGE 17

7DEOH *O\FRVLGLF SHSWLGH OLQNDJH PRGLILHG IURP 9OLHJHQWKDUW DQG 0RQWUHXLO f 7\SH RI JO\FRSURWHLQ $PLQR DFLG 5HGXFLQJ WHUPLQXV PRQRVDFFKDULGH 1HOYFRVYOQURWHLQV 6HFUHWRU\ W\SH $VQ *OF1$F %DFWHULDO SURWHLQV $VQ *DO1$F %DFWHULDO SURWHLQV $VQ D*OF %DFWHULDO SURWHLQV $VQ /5KD 2HOYFRVYOQURWHLQV 0XFLQ W\SH JO\FRSURWHLQV 6HU7KU RF*DO1$F &\WRVROLF SURWHLQV 6HU7KU *OF1$F *OF &ROODJHQ 2+/\V *DO ([WHQVLQ 2+3UR /$UDI $OJDH SURWHLQV 2+3UR *DO 6NSO 2+3UR *OF1$F *O\FRJHQLQ 7\U D*OF &ORVWULGLXP SURWHLQ 7\U *OF

PAGE 18

RWKHU H[DPSOHV RI SKRVSKRJO\FRV\ODWLRQ ZHUH DOVR LGHQWLILHG LQ /HLVKPDQLD VHFUHWHG DFLG SKRVSKDWDVHV DQG 7U\SDQRVRPD FUX]L FHOO VXUIDFH JO\FRSURWHLQV UHYLHZHG LQ +D\QHV f (YHQ WKRXJK JO\FRV\ODWLRQ ZDV ILUVW ORFDOL]HG LQ WKH HQGRSODVPLF UHWLFXOXP DQG WKH *ROJL FRPSOH[ RI HXNDU\RWLF FHOOV LW KDV EHHQ VKRZQ WKDW WKH F\WRVRO LV D VLWH RI D VLPSOH IRUP RI JO\FRV\ODWLRQ WKH DWWDFKPHQW RI VLQJOH 1DFHW\OJOXFRVDPLQH UHVLGXHV LQ 2 OLQNDJH WR VHULQHV DQGRU WKUHRQLQHV RQ PXOWLSOHV VLWHV RI QXFOHDU DQG F\WRSODVPLF SURWHLQV WHUPHG 2*OF1$Ff UHYLHZHG LQ +DOWLZDQJHU HW DO E +DUW f 7KH ILUVW 2 *OF1$F SURWHLQV WR EH LGHQWLILHG ZHUH WKH QXFOHDU SRUH SURWHLQV 7KHUHDIWHU DQ LQFUHDVLQJ QXPEHU RI 2*OF1$F SURWHLQV LQ F\WRVROLF DQG QXFOHRSODVPLF FRPSDUWPHQWV KDYH EHHQ UHFRJQL]HG 7KH PRGHO WKDW 2*OF1$F RFFXUV LQ WKH F\WRVRO KDV EHHQ FRQILUPHG E\ WKH ILQGLQJ WKDW D 8'3*OF1$FSRO\SHSWLGH 2*OF1$F JO\FRV\OWUDQVIHUDVH HQ]\PH FDQ EH SXULILHG IURP D F\WRVROLF SUHSDUDWLRQ RI WKH OLYHU +DOWLZDQJHU HW DO Df %HVLGHV 2 *OF1$F SURWHLQV RWKHU NQRZQ F\WRVROLF SURWHLQV ZKLFK FRQWDLQ FDUERK\GUDWH LQFOXGH JO\FRJHQLQ SKRVSKRJOXFRPXWDVH DQG 'LFW\RVWHOLXP 6NSO *O\FRJHQLQ LV D SUHFXUVRU IRU JO\FRJHQ V\QWKHVLV ,WV W\URVLQH UHVLGXH LV DWWDFKHG ZLWK JOXFRVH $IWHU D JO\FRJHQ V\QWKHVLV LV FRPSOHWHG WKH SURWHLQ EXULHV LWVHOI LQVLGH WKH JO\FRJHQ PROHFXOH 3LWFKHU HW DO UHYLHZHG LQ $ORQVR HW DO f 3KRVSKRJOXFRPXWDVH RU SDUDIXVLQ LV D F\WRVRLF HQ]\PH FDWDO\]LQJ WKH FRQYHUWLQJ UHDFWLRQ RI JOXFRVH3 LQWR JOXFRVH 3 ,WV JO\FDQ FRQVLVWV RI 0DQ FDSSHG E\ *OF3 'H\ HW DO 0DUFKDVH HW DO 9H\QD HW DO f

PAGE 19

'LFW\RVWHOLXP 6NSO D 0DUNHU 3URWHLQ IRU D 1RYHO *O\FRV\ODWLRQ 3DWKZD\ ,Q 'LFW\RVWHOLXP GLVFRLGHXP 6NSO 6 SKDVH NLQDVHDVVRFLDWHG SURWHLQ RU VXSSUHVVRU RI NLQHWRFKRUH SURWHLQ f ZDV GLVFRYHUHG LQ WKH PXWDQW VWUDLQ +/ ZKLFK LV GHIHFWLYH LQ WKH DELOLW\ WR PDNH *'3IXFRVH IURP *'3PDQQRVH DQG FRQVHTXHQWO\ LV XQDEOH WR FDUU\ RXW DQ\ IXFRV\ODWLRQ *RQ]DOHV
PAGE 20

GHSHQGLQJ RQ WKH WLVVXH RU FHOO W\SH 7KH ORFDOL]DWLRQ RI 6NSO LQGLFDWHV PXOWLSOH SURSRVHG IXQFWLRQV LQ ERWK QXFOHL DQG F\WRSODVP ,Q KXPDQ WUDQVIRUPHG ILEUREODVWV 6NSO ZDV FRSXULILHG ZLWK 6NSF\FOLQ $&GN FRPSOH[ DQG ZDV QDPHG 6NSO IRU 6 SKDVH NLQDVHDVVRFLDWHG SURWHLQ =KDQJ HW DO f 6NSO LV LQGLUHFWO\ DVVRFLDWHG ZLWK F\FOLQ $ E\ ELQGLQJ WR D )ER[ PRWLI RQ 6NSS (YHQ WKRXJK WKH IXQFWLRQ RI 6NSO LQ PDPPDOLDQ FHOOV VHHPV WR EH FHOO F\FOH UHJXODWRU\ WKH H[SUHVVLRQ RI 6NSO LQ WKH F\WRVRO RI WKH LQQHU HDU RUJDQ RI &RUWL LQ JXLQHD SLJ &KHQ HW DO f DQG LQ UDW EUDLQ QHXURQV ZKLFK GR QRW H[SUHVV F\FOLQ $ DQG &'.V 8UR&RVWH HW DO f LPSOLFDWHV RWKHU IXQFWLRQV RI 6NSO ,Q ( QLGXODQV WKH 6NSO KRPRORJ 6FRQ& LV LPSRUWDQW LQ VXOSKXU PHWDEROLWH UHSUHVVLRQ D FRQGLWLRQ ZKHQ WKH DGGLWLRQ RI PHWKLRQLQH WR WKH JURZWK PHGLXP UHGXFHV WKH XWLOL]DWLRQ RI OHVV IDYRUHG VXOSKXU VRXUFHV VXFK DV VXOSKDWH 1DWRUII HW DO f 0RVW RI WKH NQRZQ IXQFWLRQV RI 6NSO FDPH IURP VWXGLHV LQ \HDVW ,Q 6 FHUHYLVLDH 6NSO KRPRORJ ZDV LGHQWLILHG DV D F\FOLQ ) ELQGLQJ SURWHLQ XVLQJ WKH WZRK\EULG V\VWHP +DUSHU HW DO f ,W ZDV DOVR LQGHSHQGHQWO\ LGHQWLILHG DV D FRPSRQHQW RI 6 FHUHYLVLDH NLQHWRFKRUH ELQGLQJ SURWHLQ &EIS DQG ZDV FRLQFLGHQWDOO\ QDPHG 6NSO IRU VXSSUHVVRU RI NLQHWRFKRUH SURWHLQ 6WHPPDQQ DQG /HFKQHU f 'LIIHUHQW WHPSHUDWXUHVHQVLWLYH DOOHOHV RI 6NSO VKRZ WKDW 6NSO LV UHTXLUHG IRU FHOO F\FOH SURJUHVVLRQ DW ERWK WKH *O6 DQG *0 FKHFNSRLQWV ,Q RQH VWXG\ WKH PXWDWLRQ RI OLH WR $VQ DW FRGRQO 6NSOf FDXVHG KDSORLG FHOOV WR DUUHVW ZLWK D '1$ FRQWHQW ZKHUHDV WKH PXWDWLRQ RI /HX WR 6HU DW FRGRQO 6NSOf FDXVHG KDSORLG FHOOV WR DUUHVW ZLWK D '1$ FRQWHQW ZLWK DQ LQFUHDVHG UDWH RI FKURPRVRPH PLVVHJUHJDWLRQ &RQQHOO\

PAGE 21

DQG +LHWHU f ,Q DQRWKHU VWXG\ WKH WHPSHUDWXUH VHQVLWLYH PXWDQW FDUU\LQJ WZR PXWDWLRQV UHVXOWLQJ LQ *( DQG 5. FKDQJHV FDXVHG FHOOV WR DUUHVW ZLWK D '1$ FRQWHQW ZKHUHDV WKH PXWDQW ZLWK /* FKDQJH FDXVHG FHOOV WR DUUHVW LQ ERWK DQG %DL HW DK f ,W LV QRWDEOH WKDW DOO RI WKHVH DPLQR DFLGV ZKHUH WKH PXWDWLRQ RFFXUHG DUH ZHOOFRQVHUYHG DPRQJ VSHFLHV LQFOXGLQJ GLVFRLGHXP 6FHUHYLVLDH 6NSO KDV D DPLQR DFLG LQVHUWLRQ FRGRQ f ZKHQ DOLJQHG ZLWK WKH RWKHU KRPRORJV RI 6NSO 6LQFH D SODVPLG FRQVWUXFW ZLWK DQ LQIUDPH GHOHWLRQ RI WKH DPLQR DFLGV FRXOG UHVFXH D QXOO PXWDWLRQ RI 6NSO DQG KLJK OHYHO RI H[SUHVVLRQ RI WKH KXPDQ JHQH FDQ FRPSOHPHQW WKH 6NSO WHPSHUDWXUH VHQVLWLYH PXWDQW WKH DPLQR DFLG LQVHUWLRQ LQ WKH \HDVW SURWHLQ VHHPV QRW WR EH FULWLFDOO\ LPSRUWDQW %DL HW DO f ,Q 'LFW\RVWHOLZQ 6NSO LV HQFRGHG E\ JHQHV QDPHG ISD DQG ISGO ZKLFK DUH ZHOO FRQVHUYHG )LJ :HVW HW DK f 7KH FRGLQJ UHJLRQV RI ERWK JHQHV GLIIHU E\ QXFOHRWLGHV DQG D VKRUW LQWURQ ZLWKLQ WKH FRGRQ LQ ISGO %RWK JHQHV HQFRGH LGHQWLFDO SURWHLQV H[FHSW D VLQJOH DPLQR DFLG 6HU$OD DW WKH FRGRQ 7KH DPLQR DFLG VHTXHQFLQJ RI 6NSO GHWHFWHG ERWK $ DQG 6 DW FRGRQ LQGLFDWLQJ WKDW ERWK JHQHV ZHUH H[SUHVVHG 7DEOH :HVW HW DK f ,Q FRPSDULVRQ WR 'LFW\RVWHOLZQ WKHUH DSSHDUV WR EH JHQH LQ 6 FHUHYLVLDH PRUH WKDQ JHQHV LQ & HOHJDQ DQG ORFL LQ PDPPDOLDQ FHOOV &KHQ HW DK 'HPHWULFN HW DK f 6NSO 0HGLDWHV LWV $FWLRQV WKURXJK DQ )ER[ 0RWLI 6HTXHQFH FRPSDULVRQ RI 6NSOLQWHUDFWLQJ SURWHLQV 6NS DQG F\FOLQ )f UHYHDOHG DQ LPSRUWDQW PRWLI )ER[ DV D 6NSO ELQGLQJ VLWH %DL HW DK f 7KH H[DPSOHV RI )ER[ SURWHLQV LQFOXGH &GF F\FOLQ ) 6NS *UUO 6FRQ DQG RWKHU XQGHILQHG VHTXHQFHV

PAGE 22

ISD $%5 5 9 % $ ISD 1 99 1%; % ? 5% NE )LJXUH *HQRPLF PDS RI WKH UHJLRQV VXUURXQGLQJ WKH ISDO DQG ISD JHQHV 7KH UHJLRQV FRUUHVSRQGLQJ WR WKH F'1$ RIISDO DUH UHSUHVHQWHG E\ WKH ER[HV 'LVWDQFHV DUH JLYHQ LQ NE IURP WKH VWDUW RI WKH ISDO F'1$ 1 1GHO $ $FFO %O L"V%, 5O "FR5, 9 (FR59 ;O %VW;O :HVW HW DO f

PAGE 23

7DEOH $PLQR DFLG VHTXHQFHV RI 6NSO DW SRVLWLRQV $PLQR DFLG 3RVLWLRQ *O\ *OX 6HU $VS $OD 3UR 6NSO VHTXHQFH ( 6 $6 3 ISD? VHTXHQFH ( V 6 3 ISDO VHTXHQFH ( V $ 3 $PLQR DFLG VHTXHQFH RI WKH 0U &1%U IUDJPHQW LVRODWHG IURP WRWDO 6NSO LVRODWHG IURP WKH VROXEOH 6, IUDFWLRQ $PLQR DFLG \LHOGV IRU F\FOHV FRUUHVSRQGLQJ WR SRVLWLRQV RI WKH LQWDFW SURWHLQ DUH JLYHQ ,Q DGGLWLRQ ERWK JHQH SURGXFWV DUH IRXQG LQ ERWK VROXEOH t ,,f 6NSO SRROV :HVW HW DO f

PAGE 24

IURP *HQHEDQN GDWDEDVH %HVLGHV WKH )ER[ PRWLI WKHVH SURWHLQV XVXDOO\ FRQWDLQ HLWKHU :' UHSHDWV VXFK DV &GF RU OHXFLQHULFK UHSHDWV VXFK DV 6NS *UUO DQG S %DL HW DO .DSODQ HW DO f 7KH UROH RI )ER[ SURWHLQV KDYH EHHQ GHPRQVWUDWHG LQ WKH XELTXLWLQDWLRQ RI 6LFO DQG &OQO )HOGPDQ HW DO 6NRZ\UD HW DO f DQG WKH SKRVSKRU\ODWLRQ RI S D VXEXQLW RI D NLQHWRFKRUH ELQGLQJ SURWHLQ &EI%S .DSODQ HW DO f 6NSO 0HGLDWHV 8ELTXLWLQ'HSHQGHQW 3URWHRO\VLV RI &HOO &\FOH DQG 2WKHU 3URWHLQV WKURXJK 6&) &RPSOH[ &RQWUROOHG LQWUDFHOOXODU SURWHRO\VLV LV LPSRUWDQW IRU PDQ\ FHOO IXQFWLRQV 2QH RI WKH SURFHVVHV XELTXLWLQDWLRQ LV FRPSRVHG RI VHULHV RI HQ]\PDWLF UHDFWLRQV UHTXLUHG IRU WKH DWWDFKPHQW RI D PXOWLXELTXLWLQ FKDLQ RQ D WDUJHW SURWHLQ UHYLHZHG LQ +RFKVWUDVVHU f 7KH ILUVW VWHS LV WKH DFWLYDWLRQ RI XELTXLWLQ E\ WKH XELTXLWLQDFWLYDWLQJ HQ]\PH (Of UHVXOWLQJ LQ WKH IRUPDWLRQ RI DQ (OXELTXLWLQ WKLRO HVWHU ,Q WKH VHFRQG VWHS XELTXLWLQFRQMXJDWLQJ HQ]\PHV (f PHGLDWH WKH WUDQVIHU RI XELTXLWLQ IURP (OXELTXLWLQ FRPSOH[ WR D VXEVWUDWH SURWHLQ 7KLV VWHS XVXDOO\ UHTXLUHV DQ (HQ]\PH XELTXLWLQ SURWHLQ OLJDVHf IRU WKH VXEVWUDWH VSHFLILFLW\ 7KHQ XELTXLWLQDWHG SURWHLQV DUH GHJUDGHG E\ D VSHFLILF PXOWLSURWHLQ SURWHDVH FRPSOH[ WKH 6 SURWHDVH 8ELTXLWLQGHSHQGHQW SURWHRO\VLV LV HVVHQWLDO IRU WZR VWHSV RI FHOO F\FOH WR 6 SKDVH DQG PHWDSKDVH WR DQDSKDVH 6XEVWUDWHV IRU WKH XELTXLWLQ SURWHRO\WLF SDWKZD\ LQFOXGH F\FOLQV ZKLFK DUH SRVLWLYH UHJXODWRUV RI F\FOLQGHSHQGHQW NLQDVHV &GNVf DQG &GN LQKLELWRUV ZKLFK DUH QHJDWLYH UHJXODWRUV ,Q 6 FHUHYLVLDH &GF &GN DQG LQ KLJKHU HXNDU\RWHVf LV DFWLYDWHG LQ SKDVH E\ WKH F\FOLQV &OQO DQG F\FOLQ & '

PAGE 25

DQG ( LQ KLJKHU HXNDU\RWHVf DQG LQ 6 WKURXJK 0 SKDVH E\ WKH PLWRWLF F\FOLQV &OEO&OE UHYLHZHG LQ 1DVP\WK f :KHUHDV PLWRWLF F\FOLQV GHJUDGDWLRQ DUH UHJXODWHG E\ ( XELTXLWLQ OLJDVH FDOOHG WKH DQDSKDVH SURPRWLQJ FRPSOH[ $3&f F\FOLQV DQG &GN LQKLELWRUV DUH UHTXODWHG E\ ( XELTXLWLQ OLJDVH FRPSOH[ ZKLFK UHFRJQL]HV SKRVSKRU\ODWHG VXEVWUDWH UHYLHZHG LQ +HUVKNR f 2QH RI WKH ( XELTXLWLQ OLJDVH FRPSOH[ FRPSRVHG RI 6NSO &GF &XOOLQf DQG WKH )ER[ SURWHLQ 6&) FRPSOH[f KDV EHHQ VKRZQ WR UHJXODWH XELTXLWLQGHSHQGHQW GHJUDGDWLRQ RI PDQ\ F\FOLQV DQG &GN LQKLELWRUV UHYLHZHG LQ .UHN f 7KH HQWU\ LQWR 6SKDVH UHTXLUHV WKH DFWLYDWLRQ RI WKH &OE&GF NLQDVH FRPSOH[ 7KHVH NLQDVH FRPSOH[HV DUH LQLWLDOO\ LQDFWLYH GXH WR WKH SUHVHQFH RI KLJK OHYHOV RI WKH 6 SKDVH &GN LQKLELWRU 6LFO 1XJURKR DQG 0HQGHQKDOO 6FKZRE HW DK f ZKLFK LV V\QWKHVL]HG LQ ODWH PLWRVLV F\FOLQGHSHQGHQW NLQDVH SURWHLQV &OQV&GFf SKRVSKRU\ODWH 6LFO 9HUPD HW DK Df ZKLFK WULJJHUV WKH GHJUDGDWLRQ RI 6LFO 9HUPD HW DK Ef 7KH GHJUDGDWLRQ RI SKRVSKRU\ODWHG 6LFO LV FRQWUROOHG E\ ( XELTXLWLQ FRQMXJDWLQJ HQ]\PH &GF *RHEO HW DK 6FKZRE HW DK f DQG ( XELTXLWLQ OLJDVH FRPSOH[ IRUPHG E\ WKUHH RWKHU SURWHLQV 6NSO &GF DQG )ER[ SURWHLQ&GF 6FKZRE HW DK %DL HW DK f 6LPLODU WR 6LF WKH GHJUDGDWLRQ RI F\FOLQV &OQV DOVR UHTXLUH &GF 6NSO DQG &GF +RZHYHU WKH )ER[ FRPSRQHQW RI 6&) FRPSOH[ IRU &OQV GHJUDGDWLRQ SURFHVV LV *UUO LQVWHDG RI &GF %DUUDO HW DK f LQGLFDWLQJ WKH UROH RI )ER[ SURWHLQ RQ VXEVWUDWH VSHFLILFLW\ *UUO ELQGV SKRVSKRU\ODWHG &OQV DQG *UUO&OQV LV FRQQHFWHG WR RWKHU XELTXLWLQDWLRQ UHJXODWRU\ SURWHLQV WKURXJK 6NSO /L DQG -RKQVWRQ 6NRZ\UD HW DK

PAGE 26

.LVKL HW DO f *55 ZDV LQLWLDOO\ LGHQWLILHG DV D JHQH UHTXLUHG IRU JOXFRVH UHSUHVVLRQ LQ 6 FHUHYLVLDH )OLFN DQG -RKQVWRQ f 0XWDWLRQV LQ *55 UHOLHYH UHSUHVVLRQ RI PDQ\ JOXFRVHUHSUHVVHG JHQHV %DLOH\ DQG :RRG ZRUG )OLFN DQG -RKQVWRQ f DQG SUHYHQW JOXFRVH LQGXFWLRQ RI KH[RVH WUDQVSRUWHU +;7f JHQHV •]FDQ DQG -RKQVWRQ f ,QWHUHVWLQJO\ WKH ELQGLQJ RI 6NSO WR *UUO LV UHJXODWHG E\ WKH SUHVHQFH RI JOXFRVH LQ WKH PHGLD DQG 6NSO LQWHUDFWV ZLWK *UUO DQG &GF WR PHGLDWH WKH JOXFRVHLQGXFHG +;7 JHQHV E\ DQ XQNQRZQ PHFKDQLVP ZKLFK GRHV QRW UHTXLUH &GF /L DQG -RKQVWRQ f 7KH H[DPSOH RI 6LFO DQG &OQV GHJUDGDWLRQ LQGLFDWHV WKDW RQH RI WKH PROHFXODU PHFKDQLVPV RI 6NSO LV WR OLQN DQ )ER[ SURWHLQ DQG LWV WDUJHW WR &GF IRU XELTXLWLQ GHSHQGHQW SURWHRO\VLV %HVLGHV 6LFO DQG &OQV RWKHU UHJXODWRU\ SURWHLQV KDYH EHHQ VKRZQ WR EH GHJUDGHG E\ WKH 6&) SDWKZD\ LQFOXGLQJ WKH &OQ&GF LQKLELWRU )DUO +HQFKR] HW DK f WKH UHSOLFDWLRQ SURWHLQ &GF 'UXU\ HW DO f DQG WKH WUDQVFULSWLRQ IDFWRU *FQ .RPLW]HU HW DO f 6NSO 0HGLDWHV 3KRVSKRU\ODWLRQ RI D .LQHWRFKRUH 3URWHLQ WKURXJK DQ )ER[ 0RWLI ZKLFK LV ,PSRUWDQW IRU .LQHWRFKRUH $VVHPEO\ 6NSO KDV RWKHU IXQFWLRQV WKDW DUH QRW UHODWHG WR SURWHRO\VLV DV ZHOO 6NSO ZDV LQGHSHQGHQWO\ LGHQWLILHG DV D FRPSRQHQW RI 6 FHUHYLVLDH NLQHWRFKRUH ELQGLQJ SURWHLQ &EI 6WHPPDQQ DQG /HFKQHU f &EI LV D N'D PXOWLFRPSRQHQW SURWHLQ WKDW VSHFLILFDOO\ ELQGV WR &'(,,, D FRQVHUYHG HOHPHQW RI WKH FHQWURPHUH '1$ VHTXHQFH OHFKQHU DQG FDUERQ f &EI LV FRPSRVHG RI VXEXQLWV S 6NSOf S S DQG SL /HFKQHU DQG &DUERQ 6WHPPDQQ DQG /HFKQHU f $OO IRXU FRPSRQHQWV DUH

PAGE 27

LPSRUWDQW IRU &EI DVVHPEO\ DQG &'(,,, ELQGLQJ /HFKQHU 6RUJHU HW DO .DSODQ HW DO f
PAGE 28

FRQWDLQV D UHJLRQ ZKLFK LV VLPLODU WR XELTXLWLQ DQG HORQJLQ & FRQWDLQV D UHJLRQ ZKLFK LV KRPRORJRXV WR 6NSO 5HFHQWO\ FXOOLQ &XOf DQRWKHU FRPSRQHQW RI 6&) FRPSOH[ KDV EHHQ VKRZQ WR LQWHUDFW ZLWK HORQJLQV %& DQG S9+/ /RQHUJDQ HW DO f 7KH VLPLODULW\ RI S9+/HORQJLQV %&&XO DQG 6&) FRPSOH[ VXJJHVWV WKH SRVVLEOH UROH RI 6NSO RQ WKH UHJXODWLRQ RI K\SR[LDLQGXFLEOH P51$ E\ S9+/ 7KH ,PSRUWDQFH RI 6NSO*O\FRV\ODWLRQ 6WXG\ $V GHVFULEHG DERYH 6NSO LV DQ HVVHQWLDO PXOWLIXQFWLRQDO SURWHLQ LQYROYHG LQ PHWDEROLWH UHSUHVVLRQ NLQHWRFKRUH DVVHPEO\ DQG FHOO F\FOH FRQWURO LQ IXQJL \HDVW DQG PDPPDOLDQ FHOOV $ SXWDWLYH PHFKDQLVP RI 6NSO LV WR WDUJHW )ER[ SURWHLQV DQG WKHLU FRPSOH[HV IRU VSHFLILF DFWLYLWLHV ZKLFK FDQ H[SODLQ KRZ WKH SURWHLQ LV DVVRFLDWHG ZLWK VXFK GLYHUVH IXQFWLRQV 6NSO ELQGLQJ WR WKH )ER[ PRWLI LQ &GF DQG *UUO FRQQHFWV 6LFO DQG &OQ WR WKH XELTXLWLQ GHJUDGDWLRQ FRPSOH[ UHVSHFWLYHO\ $QRWKHU H[DPSOH LV WKH ELQGLQJ RI 6NSO WR S ZKLFK OHDGV WR WKH DFWLYDWLRQ RI S E\ SKRVSKRU\ODWLRQ LQGLFDWLQJ WKDW 6NSO FRQQHFWV S WR DQ XQLGHQWLILHG NLQDVH 6LQFH PDQ\ F\WRVROLF DQG QXFOHL SURWHLQV KDYH EHHQ IRXQG WR FRQWDLQ WKH )ER[ PRWLI DGGLWLRQDO SURWHLQFRPSOH[HV DQG IXQFWLRQV RI 6NSO ZLOO OLNHO\ EH GLVFRYHUHG ,Q 'LFW\RVWHOLXP WKH ILQGLQJ WKDW 6NSO FRQWDLQV IXFRVH ZKLFK LV XQXVXDO IRU D F\WRVROLF SURWHLQ KDV PDGH 6NSO D PRGHO IRU WKH VWXG\ RI D QRYHO SURWHLQ 2 JO\FRV\ODWLRQ SDWKZD\ ,W LV \HW WR EH SURYHG ZKHWKHU JO\FRV\ODWLRQ RI 6NSO RFFXUV LQ RWKHU FHOO W\SHV 6WUXFWXUDO KHWHURJHQHLW\ PHGLDWHG E\ JO\FRV\ODWLRQ RI 6NSO PD\ EH LPSRUWDQW IRU WKH VSHFLILFLW\ RI 6NSOSURWHLQ LQWHUDFWLRQ 0RUHRYHU WKH FDUERK\GUDWH VWUXFWXUH PD\ EH LPSRUWDQW IRU F\WRVROLF ORFDOL]DWLRQ ZKLFK FRQVHTXHQWO\ UHJXODWHV 6NSO

PAGE 29

IXQFWLRQ LQ WKH QXFOHXV *O\FRV\ODWLRQ LQ WKH VHFUHWRU\ SDWKZD\ RI FHUWDLQ SURWHLQV KDV EHHQ VKRZQ WR EH LPSRUWDQW IRU SURWHLQ IROGLQJ WDUJHWLQJ DQGRU OLJDQG ELQGLQJ UHYLHZHG LQ 9DUNL f ,Q DGGLWLRQ WKHUH LV HYLGHQFH WKDW F\WRVROLF JO\FRV\ODWLRQ PD\ KDYH UHJXODWRU\ IXQFWLRQV &ORVWULGLDO WR[LQV LQDFWLYDWH 5KR VXEIDPLO\ PHPEHUV RI *73ELQGLQJ SURWHLQV E\ JO\FRV\ODWLRQ -XVW HW DO D -XVW HW DO Ef 2*OF1$F PRGLILFDWLRQV DUH IRXQG WR EH G\QDPLF DQG WKHLU DWWDFKPHQW VLWHV DUH LQGLVWLQJXLVKDEOH IURP RU FORVH WR WKRVH XVHG E\ YDULRXV SURWHLQ NLQDVHV VXJJHVWLQJ WKH FRPSHWLWLRQ RI *OF1$F\ODWLRQ ZLWK SKRVSKRU\ODWLRQ &KRX HW DO UHYLHZHG LQ *UHLV DQG +DUW f $QRWKHU H[DPSOH RI WKH LPSRUWDQFH RI F\WRVROLF JO\FRV\ODWLRQ LV GHPRQVWUDWHG LQ WKH *OF1$F SURWHLQ S ,QDFWLYDWLRQ RI H,) NLQDVH LV GHSHQGHQW RQ WKH JO\FRV\ODWLRQ VWDWH RI S 'HJO\FRV\ODWLRQ RI S DFWLYDWHV H,) NLQDVH UHVXOWLQJ LQ DQ LQKLELWLRQ RI WKH WUDQVODWLRQ IDFWRU H,)D &KDNUDERUW\ HW DO f 7KH &KDUDFWHULVWLFV DQG &RPSDUWPHQWDOL]DWLRQ RI 6NSO*O\FRV\ODWLRQ ,QGLUHFW OLQHV RI HYLGHQFH VXJJHVW WKDW WKH JO\FRV\ODWLRQ SURFHVV RI 6NSO RFFXUV LQ WKH F\WRVROLF FRPSDUWPHQW )LUVW D IXFRV\OWUDQVIHUDVH F)7DVHf ZKLFK FDQ IXFRV\ODWH 6NSO KDV EHHQ SXULILHG IURP WKH 6, RI 'LFW\RVWHOLXP :HVW HW DO f 0RUHRYHU WKH 6NSO F'1$ GRHV QRW HQFRGH D WDUJHWLQJ VHTXHQFH HVVHQWLDO IRU WUDQVORFDWLRQ LQWR WKH VHFUHWRU\ SDWKZD\ )LQDOO\ WKH 6NSO VHTXHQFH FRQWDLQV WKH FRQVHQVXV PRWLI IRU 79OLQNHG JO\FRV\ODWLRQ DW DPLQR DFLG UHVLGXH $VQ9DO7KU EXW LW LV QRW $JO\FRV\ODWHG 7KHVH UHDVRQV LPSO\ WKDW 6NSO UHPDLQV LQ WKH F\WRSODVP DIWHU WUDQVODWLRQ DQG LV QRW WUDQVORFDWHG LQWR WKH (5

PAGE 30

,W ZLOO EH LPSRVVLEOH WR VWXG\ WKH LPSRUWDQFH RI WKH F\WRVROLFIXFRV\ODWLRQ SDWKZD\ RI 6NSO XQOHVV LWV JO\FDQ VWUXFWXUH DQG ELRV\QWKHVLV DUH FKDUDFWHUL]HG 7R VXSSRUW WKH IXWXUH VWUXFWXUH DQG IXQFWLRQ LQYHVWLJDWLRQV RI WKH 6NSO JO\FDQ WKH QDWXUH RI WKH SUHYLRXVO\ LGHQWLILHG F\WRVROLF IXFRV\ODWLRQ LQ 'LFW\RVWHOLXP ZDV GHWHUPLQHG LQ WKLV VWXG\ 7KH 6NSO JO\FDQ KDV EHHQ LGHQWLILHG DV D OLQHDU SHQWDVDFFKDULGH *DODO*DODO )XFDO*DLSL*OF1$Ff DWWDFKHG WR D K\GUR[\SUROLQH DW FRGRQO 7KH FRQVWUXFWLRQ RI WKLV XQXVXDO VWUXFWXUH LV SUHGLFWHG WR UHTXLUH VL[ HQ]\PHV LQFOXGLQJ RQH SURO\OK\GUR[\ODVH DQG VL[ JO\FRV\OWUDQVIHUDVHV 7KH 6NSO*OF1$FWUDQVIHUDVH WKH HQ]\PH UHVSRQVLEOH IRU WKH DWWDFKPHQW RI WKH ILUVW VXJDU *OF1$F KDV EHHQ SXULILHG IURP WKH F\WRVRO RI 'LFW\RVWHOLXP ,WV DFWLYLW\ LV GHSHQGHQW RQ WKH SUHVHQFH RI UHGXFLQJ UHDJHQW DQG KDV D VXEPLFURPRODU .P IRU WKH VXEVWUDWH 8'3*OF1$F 7KHVH ILQGLQJV VXSSRUW WKH K\SRWKHVLV WKDW WKLV QHZ JO\FRV\ODWLRQ SDWKZD\ UHVLGHV LQ WKH F\WRVROLF FRPSDUWPHQW RI WKH FHOO

PAGE 31

&+$37(5 7+( */<&26,',&3(37,'( /,1.$*( $1' 6758&785( 2) 6.3 */<&$1 ,QWURGXFWLRQ 6NSO LV IRXQG LQ D PXOWLSURWHLQ FRPSOH[ ZLWK FXOOLQ D FGF KRPRORJXHf DQG DQ )ER[ FRQWDLQLQJ SURWHLQ WR IRUP WKH 6&) FRPSOH[ QDPHG DV DQ DFURQ\P RI WKH SDUWLFLSDWLQJ SURWHLQV :KHQ WKLV FRPSOH[ FRQWDLQV DQ ( HQ]\PH LW LV UHVSRQVLEOH IRU XELTXWLQDWLQJ YDULRXV WDUJHW SURWHLQV GHSHQGLQJ RQ WKH LGHQWLW\ RI WKH )ER[ SURWHLQ 7DUJHWV IRU VXEVHTXHQW GHJUDGDWLRQ LGHQWLILHG LQ 6DFFKDURP\FHV FHUHYLVLDH LQFOXGH FHOO F\FOH SURWHLQV VXFK DV WKH 6SKDVH NLQDVH LQKLELWRU 6LFO DQG F\FOLQV DQG SURWHLQV VSHFLILF WR WKH QXWULWLRQ RI WKH FHOO %DL HW DO 6NRZUD HW DK )HOGPDQ HW DO /L DQG -RKQVWRQ f 7KH 6&) FRPSOH[ KDV DOVR EHHQ LPSOLFDWHG LQ SKRVSKRU\ODWLRQ RI NLQHWRFKRUH SURWHLQV .DSODQ HW DO f DQG DQRWKHU GLVWDQWO\ UHODWHG FRPSOH[ DIIHFWV P51$ PHWDEROLVP /RQHUJDQ HW DO f $Q 6&) FRPSOH[ ZLWK &\FOLQ $ DQG &GN KDV EHHQ GHWHFWHG LQ PDPPDOLDQ FHOOV DQG LWV DEXQGDQFH DSSHDUV LQFUHDVHG LQ WUDQVIRUPHG FHOOV =KDQJ HW DO /LVDWZDQ HW DO f 6NSO LWVHOI LV DEXQGDQWO\ DQG G\QDPLFDOO\ H[SUHVVHG LQ WKH PRXVH HPEU\R 6RZGHQ HW DO f DQG FHQWUDO QHUYRXV V\VWHP LQFOXGLQJ SRVWPLWRWLF QHXURQV 8URFRVWH HW DO f DQG DW YHU\ KLJK FRQFHQWUDWLRQV LQ WKH LQQHU HDU RUJDQ RI &RUWL &KHQ HW DO
PAGE 32

EH WR IDFLOLWDWH WKH VHOHFWLRQ RI RWKHU SURWHLQV IRU VSHFLILF SRVWWUDQVODWLRQDO PRGLILFDWLRQ %LQGLQJ RI 6NSO WR GLIIHUHQW SURWHLQV PD\ EH UHJXODWHG VWUXFWXUDOO\ DV LW LV HQFRGHG E\ PXOWLSOH JHQHV LQ PXOWLFHOOXODU RUJDQLVPV &KHQ HW DO %DL HW DO 'HPHWULFN HW DO /LDQJ HW DO :HVW HW DO f 6NSO VWUXFWXUH LV DOVR DOWHUHG E\ JO\FRV\ODWLRQ LQ 'LFW\RVWHOLXP GLVFRLGHXP *RQ]DOH]
PAGE 33

7KHVH UHVXOWV UHLQIRUFH WKH PRGHO WKDW FRPSOH[ LQNHG JO\FRV\ODWLRQ RFFXUV LQ WKH HXNDU\RWLF F\WRSODVPLF FRPSDUWPHQW :KLOH WKHUH KDV EHHQ PXFK FLUFXPVWDQWLDO HYLGHQFH WR VXSSRUW WKLV PRGHO +DUW HW DO f LW KDV UHPDLQHG FRQWURYHUVLDO 0HGLQD DQG +DOWLZDQJHU f ,Q FRQWUDVW VLPSOH JO\FRV\ODWLRQ LQ WKH IRUP RI *OF1$F 2OLQNHG WR UHVLGXHV RI 6HU RU 7KU LV ZHOO HVWDEOLVKHG LQ WKLV FRPSDUWPHQW +DUW f 7KH VXJDU VWUXFWXUHV ZKLFK KDYH EHHQ GHVFULEHG WR GDWH RQ F\WRSODVPLFQXFOHDU SURWHLQV DUH JHQHUDOO\ GLVWLQFWLYH IURP WKRVH SURGXFHG LQ WKH VHFUHWRU\ SDWKZD\ VXJJHVWLQJ WKDW WKHUH PD\ EH IXQGDPHQWDO GLIIHUHQFHV LQ WKH ELRJHQHVLV DQG IXQFWLRQ RI WKHVH PRGLILFDWLRQV 0DWHULDOV DQG 0HWKRGV &HOOV 6WUDLQV $[ DQG +/ ZHUH JURZQ DW r& LQ +/ PHGLXP RQ D J\UDWRU\ VKDNHU ,Q OLWHU IODVNV FHOOV JUHZ WR D GHQVLW\ RI [ SHU PO ZKLFK LV UHIHUUHG WR DV VWDWLRQDU\ SKDVH $[ LV D QRUPDO VWUDLQ DQG +/ GHULYHG IURP $[ E\ FKHPLFDO PXWDJHQHVLV LV XQDEOH WR V\QWKHVL]H *'3)XF IURP *'30DQ DQG WKXV LQFRUSRUDWHV QHJOLJLEOH )XF LQWR SURWHLQ *RQ]DOH]
PAGE 34

LQWR GLVFRLGHXP E\ D &D3&! SUHFLSLWDWLRQ PHWKRG DQG VHOHFWHG LQ WKH SUHVHQFH RI PJPO )HUJXVRQ HW DO f 6WUDLQ +: ZDV D FORQH ZKLFK SURGXFHG 6NSOF P\F DW KLJKHU OHYHOV WKDQ LWV FRPSDQLRQ VWUDLQV EDVHG RQ :HVWHUQ EORW DQDO\VLV ZLWK P$E ( DJDLQVW WKH FP\F HSLWRSH 6NSOFP\F FRQWDLQHG WZR PLVVHQVH PXWDWLRQV 7& DQG $* UHVXOWLQJ LQ DPLQR DFLG VXEVWLWXWLRQV ,7 DQG '* LQWURGXFHG E\ WKH 3&5 UHDFWLRQ DQG FRQILUPHG E\ 06 DQDO\VLV RI LWV SHSWLGHV GDWD QRW VKRZQf 3UHSDUDWLRQ RI 5HFRPELQDQW 'LFW\RVWHOLXP 6NSO 6NSO+LVf 7KH RSHQ UHDGLQJ IUDPH RI 6NSO ZDV DPSOLILHG XVLQJ 'LFW\RVWHOLXP '1$ DV WKH WHPSODWH DQG ROLJRQXFOHRWLGHV 6fWJFWFWFJDJFWFJJDWFFDWWWWJWJDWJFWJWWWJWD6I DQG fJDFWJDJFWFJDJJDWFFDDWJWFWWWDJWWDDDWWDJDDWFWWf DV SULPHUV LQ D SRO\PHUDVH FKDLQ UHDFWLRQ WKHVH SULPHUV FRQWDLQHG %DP
PAGE 35

XVLQJ DQ DIILQLW\ FROXPQ FRQVLVWLQJ RI QLFNHO FDWLRQV LPPRELOL]HG RQ 6HSKDURVH % HVVHQWLDOO\ DV GHVFULEHG +RFKXOL HW DO f 3XULILHG SURWHLQ ZDV H[KDXVWLYHO\ GLDO\]HG DJDLQVW P0 +(3(61D2+ S+ f DQG FRQFHQWUDWHG LQ D FHQWULIXJDO XOWUDILOWUDWLRQ FRQFHQWUDWRU N'D PROHFXODU PDVV FXWRIIf 3XULILHG SURWHLQ ZDV VKRZQ WR EH UHFRJQL]HG LQ D :HVWHUQ EORW E\ PRQRFORQDO DQWLERGLHV ) DQG ( FRQILUPLQJ LWV LGHQWLW\ DV 6NSO 3XULILFDWLRQ RI 6NSO &HOO O\VLV GLVFRLGHXP VWUDLQV $[ +/ RU +: ZHUH JURZQ WR VWDWLRQDU\ SKDVH LQ +/ PHGLXP $IWHU ZDVKLQJ RQFH LQ LFHFROG ZDWHU FHOOV ZHUH UHVXVSHQGHG LQ P0 7ULV+&O 0 VXFURVH S+ FRQWDLQLQJ SURWHDVH LQKLELWRUV IWJPO OHXSHSWLQ cLJPO DSURWLQLQ P0 SKHQ\OPHWK\OVXOIRQ\O IOXRULGHf 7KH VXVSHQVLRQ ZDV VXFWLRQHG WKRXJK D EHG RI JODVV ZRRO DQG O\VHG E\ IRUFHG SDVVDJH WKRXJK D PP GLDPHWHU 1XFOHSRUH ILOWHU ZLWK _LP GLDPHWHU SRUHV PRXQWHG RQ WKH HQG RI D PO V\ULQJH 7KH O\VDWH ZDV FHQWULIXJHG DW [ J IRU PLQ DQG WKH VXSHUQDWDQW ZDV FHQWULIXJHG DW [ J IRU PLQ $OO SURFHGXUHV ZHUH SHUIRUPHG DW r& '($(6HSKDURVH)DVW)ORZ FKURPDWRJUDSK\ 7KH ILQDO 6, VXSHUQDWDQW ZDV SXPSHG RQWR D PO '($(6HSKDURVH )DVW )ORZ &ROXPQ [ FPf SUHn HTXLOLEUDWHG LQ P0 +(3(61D2+ S+f b JO\FHURO P0 0J&O P0 GLVRGLXP('7$ P0 '77 DQG WKH FROXPQ ZDV ZDVKHG ZLWK WKH HTXLOLEUDWLRQ EXIIHU XQWLO WKH $ GURSSHG EHORZ b RI LWV PD[LPXP 6NSO ZDV HOXWHG LQ D OLQHDU JUDGLHQW RI 0 1D&O FRQVLVWLQJ RI [ FROXPQ EHG YROXPQ RI HTXLOLEUDWLRQ EXIIHU DQG [

PAGE 36

FROXPQ EHG YROXPQ RI 0 1D&O LQ WKH VDPH EXIIHU $QDO\VLV RI IUDFWLRQV XVLQJ D P$E ) (/,6$GRW EORW DVVD\ UHYHDOHG WKDW 6NSO IURP $[ DQG +/ ZHUH IUDFWLRQDWHG LQWR SRROV, DQG ,, .R]DURY HW DK f 6NSOFP\F IURP VWUDLQ +: ZDV HOXWHG DIWHU SRRO,, 3KHQ\O6HSKDURVH )DVW)ORZ FKURPDWRJUDSK\ '($( SRROV ZHUH SXPSHG RQWR D SKHQ\O6HSKDURVH )DVW )ORZ KLJKVXEf FROXPQ SUHHTXLOLEUDWHG LQ b VDWXUDWHG 1+f6 P0 1+2$F DQG WKH FROXPQ ZDV ZDVKHG ZLWK WKH HTXLOLEUDWLRQ EXIIHU XQWLO WKH $2 GURSSHG EHORZ b RI LWV PD[LPXP 6NSO ZDV HOXWHG E\ D GHFUHDVLQJ JUDGLHQW RI 1+f6 FRQVLVWLQJ RI [ FROXPQ EHG YRO RI VWDUWLQJ EXIIHU DQG [ FROXPQ EHG YRO RI P0 1+2$F S+ 0RQRFORQDO DQWLERG\ ) DIILQLW\ FKURPDWRJUDSK\ 3KHQ\O6HSKDURVH SRROV ZHUH DSSOLHG WR LPPRELOL]HG UDEELW ,J* SUHFROXPQf DQG P$E ) FROXPQV ZKLFK ZHUH FRQQHFWHG LQ VHULHV DQG SUHHTXLOLEUDWHG LQ 3%6 $IWHU ORDGLQJ RI WKH VDPSOH WKH P$E ) FROXPQ ZDV GLVFRQQHFWHG DQG ZDVKHG ZLWK WKH VDPH EXIIHU XQWLO DOO QRQERXQG SURWHLQ ZDV ZDVKHG RXW 7KH FROXPQ ZDV HOXWHG ZLWK 0 JO\FLQH+&O S+ 7KH HOXWHG IUDFWLRQV ZHUH FROOHFWHG LQWR PO WXEHV FRQWDLQLQJ LO RI 0 7ULV QDWXUDO S+ 5HYHUVHGSKDVH KLJKSHUIRUPDQFH OLTXLG FKURPDWRJUDSK\ ,Q VRPH FDVHV 6NSO ZDV UHGXFHG DQG FDUER[DPLGRPHWK\ODWHG 7KH SURWHLQ ZDV SDUWLDOO\ GULHG GRZQ LQ D VSHHGYDF EURXJKW WR P0 '77 LQ 0 XUHD 0 1++&2 S+ KHDWHG WR r& IRU PLQ DQG LQFXEDWHG DW r& LQ P0 LRGRDFHWDPLGH IRU PLQ LQ WKH GDUN 7KH FDUER[DPLGRPHWK\ODWHG SURWHLQ ZDV IXUWKHU SXULILHG RQ D && 3& f 53

PAGE 37

+3/& FROXPQ RQ D 3KDUPDFLD 6PDUW6\VWHP +3/& DQG HOXWHG ZLWK D JUDGLHQW RI b YYf 0H&1 LQ b YYf 7)$ WR b 0H&1 LQ b 7)$ 7KH SHDN ZKLFK FRQWDLQHG PRUH WKDQ b RI WRWDO 6NSO ZDV H[DPLQHG IXUWKHU 5HFRPELQDQW 6NSO ISDOf FRQWDLQLQJ DQ 1WHUPLQDO ROLJR+LV WDJ ZDV LVRODWHG IURP ( FROL DV GHVFULEHG .R]DURY HW DO f DQG IXUWKHU SXULILHG RQ D 53FROXPQ DV DERYH 0HWDEROLF /DEHOLQJ RI 6NSO $ PO FXOWXUH RI $[ FHOOV ZDV JURZQ IRU JHQHUDWLRQV LQ P&LPO >),@)XF LQ +/ 6NSO ZDV LVRODWHG LQ WKH VDPH PDQQHU H[FHSW WKH SKHQ\O6HSKDURVH VWHS ZDV RPLWWHG 3XULILHG UDGLRODEHOHG 6NSO ZDV SRROHG ZLWK XQODEHOHG 6NSO 0RQRVDFFKDULGH &RPSRVLWLRQ $QDO\VLV RI 6NSOFP\F 7ZR QPRO RI PDQQLWRO ZDV DGGHG DV DQ LQWHUQDO VWDQGDUG WR QPRO RI 6NSOF P\F 7KH VDPSOH VXEMHFWHG WR PHWKDQRO\VLV UH1DFHW\ODWLRQ DQG 706GHULYLWL]DWLRQ DV GHVFULEHG (OZRRG HW DO f DQG DQDO\]HG LQ VSOLWOHVV PRGH RQ D PP [ P 63% FROXPQ 6XSHOFRf RQ D 6KLPDG]X 43 *&06 ZRUNVWDWLRQ 3HDNV ZHUH DQDO\]HG ZLWK VHOHFWHG LRQ PRQLWRULQJ DW P] IRU WKH QHXWUDO VXJDUV DQG P] IRU WKH 1DFHW\ODWHG DPLQR VXJDUV 3XULILFDWLRQ RI *O\FRV\ODWHG 3HSWLGHV &DUER[DPLGRPHWK\ODWHG 6NSO ZDV GLJHVWHG ZLWK HQGR/\V& IURP $FKRPREDFWHU O\WLFXV :DNRf LQ WKH SUHVHQFH RI 0 XUHD LQ 0 7ULV+&O S+ XVLQJ DQ HQ]\PHVXEVWUDWH UDWLR RI PRNPROf DW r& IRU K 3HSWLGHV IURP PHWDEROLFDOO\ ODEHOHG 6NSO ZHUH IUDFWLRQDWHG RQ D 6XSHUGH[ 3HSWLGH +5 +3/& FROXPQ 3KDUPDFLDf LQ 0 XUHD LQ P0 1D&O P0 7ULV+&O S+ RQ DQ /.% *7L

PAGE 38

+3/& V\VWHP DW POPLQ 5DGLRDFWLYH IUDFWLRQV ZHUH DSSOLHG WR D [ PP PP SDUWLFOH &J FROXPQ =RUED[f DQG HOXWHG ZLWK D JUDGLHQW RI b YYf 0H&1 LQ b YYf 7)$ WR b 0H&1 LQ b 7)$ DW D IORZ UDWH RI POPLQ 3HSWLGHV SPROf ZHUH VXEMHFWHG WR (GPDQ GHJUDGDWLRQ RQ DQ $%, PRGHO 3UHFLVH VHTXHQDWRU 1RQ UDGLRODEHOHG HQGR/\V& SHSWLGHV ZHUH IUDFWLRQDWHG GLUHFWO\ D &J =RUEDFf RU && 3& 6PDUW 6\VWHP 3KDUPDFLDf 53FROXPQV DV DERYH 0DWUL[$VVLVWHG /DVHU 'HVRUSWLRQ 7LPHRI)OLJKW 0$/',72)f 0DVV 6SHFWURPHWU\ 6DPSOHV ZHUH PL[HG ZLWK DQ HTXDO YROXPH RI VDWXUDWHG DF\DQRK\GUR[\FLQQDPLF DFLG $OGULFKf LQ b DFHWRQLWULOH 2QH SL SPROf ZDV GHSRVLWHG RQ D VDPSOH SODWH DQG DOORZHG WR DLU GU\ 6SHFWUD ZHUH FROOHFWHG RQ D 3HU6HSWLYH %LRV\VWHP 9R\DJHU 53 0$/',72)06 RSHUDWHG LQ WKH SRVLWLYH LRQ DQG OLQHDU PRGHV 472) 0DVV 6SHFWURPHWU\ 6DPSOHV IURP 53IUDFWLRQV ZHUH LQWURGXFHG GLUHFWO\ LQWR WKH 472) 06 0LFURPDVV 8.f YLD D QDQRVSUD\ GHYLFH 3ULPDU\ DQG VHFRQGDU\ LRQ VSHFWUD ZHUH FROOHFWHG LQ WKH SRVLWLYH LRQ PRGH ([RJO\FRVLGDVH 'LJHVWLRQ RI 6NSO *O\FRSHSWLGHV $SSUR[LPDWH SPRO RI JO\FRSHSWLGH IURP 53IUDFWLRQV ZDV SDUWLDOO\ GULHG E\ YDFXXP FHQWULIXJDWLRQ GLOXWHG WR D ILQDO YROXPH RI SL LQ D EXIIHU FRQWDLQLQJ WKH H[RJO\FRVLGDVH VHH 7DEOH f LQFXEDWHG DW r& IRU K DQG SURFHVVHG IRU 0$/', 72)06

PAGE 39

7DEOH ([RJO\FRVLGDVH WUHDWPHQWV RI JO\FRSHSWLGHV 3HQWDVDFFKDULGHf§ASHSWLGH VXEVWUDWH LQLWLDO PDVV P] f (Q]\PH 6SHFLILFLW\ 6RXUFH %XIIHU E P] DJDODFWRVLGDVH P8SOf *DODO JUHHQ FRIIHH M EHDQ %0f P0 1+f3 S+ KH[f DJDODFWRVLGDVH X8XOf *DODO UHFRPELQDQW *O\NRf P0 1+f3&! S+ DJDODFWRVLGDVH O2S8SOf *DOD ;PDQLKRWLV 1(%f P0 1+f3&! S+ KH[f JOXFRVLGDVH P8SOf *OX*DO)XF_ VZHHW DOPRQG %0f P0 1+f3&! S+ DIWLFRVLGDVH P8SOf )XFDO ERYLQH NLGQH\ %0f P0 1+f3&! S+ DJDODFWRVLGDVH P8SOf DIXFRVLGDVH P8SOf *DODO )XFDO JUHHQ FRIIHH EHDQ %0fA ;PDQLKRWLV 1(%f P0 1+f3 S+ KH[ ,GKH[f 'LVDFFKDULGHf§ASHSWLGH VXEVWUDWH LQLWLDO PDVV P] f (Q]\PH 6SHFLILFLW\ 6RXUFH %XIIHU N P] >JDODFWRVLGDVH P8SOf *DOO! ERYLQH NLGQH\ 2*6f P0 1+2$& S+ KH[f >JDODFWRVLGDVH P8SOf *DO>O UHFRPELQDQW *O\NRf P0 1+f3 S+ KH[f >JDODFWRVLGDVH P8XOf *DO>O ;PDQLKRWLV 1(%f P0 1+f3 S+ KH[f >JDODFWRVLGDVH P8XO f >+H[1$FDVH P8SOf *DO_O! *OF1$F *DO1$F_ ERYLQH NLGQH\ 2*6f MDFN EHDQ 9 /DEVf P0 1+f3 S+ KH[f D %0 %RHKLQJHU0DQQKHLP 1(% 1HZ (QJODQG %LRODEV 2*6 2[IRUG *O\FR6FLHQFHV E $OO UHDFWLRQV ZHUH LQFXEDWHG DW r& IRU K F *O\FRSHSWLGHV SXULILHG E\ 53+3/& ZHUH DQDO\]HG E\ 0$/',72)06 EHIRUH DQG DIWHU WUHDWPHQW $OO UHDFWLRQV ZHUH FRPSOHWH WKDW LV !b RI WKH SDUHQWDO LRQ ZDV ORVW DQG UHSODFHG E\ WKH PDMRU LRQ ZKRVH PDVV LV GHVFULEHG E\ WKH ORVV RI RQH RU PRUH KH[ RU GHR[\KH[ GKH[f XQLWV G DJDODFWRVLGDVH DFWLYLW\ ZDV SXULILHG IURP FRQWDPLQDWLQJ JDODFWRVLGDVH DFWLYLW\ DV GHVFULEHG -DFRE DQG 6FXGGHU f

PAGE 40

0LOG $FLG +\GURO\VLV RI WKH )XFRJO\FRSHSWLGH $SSUR[LPDWH SPRO RI WKH IXFRJO\FRSHSWLGH ZDV SDUWLDOO\ GULHG GRZQ LQ D YDFXXP FHQWULIXJH UHFRQVWLWXWHG LQ _LO RI 0 7)$ DQG LQFXEDWHG DW r& IRU XS WR K 5HVXOWV 6NSO &RQWDLQHG 2QO\ D 6LQJOH )XFRJO\FRSHSWLGH 7R LQYHVWLJDWH WKH JO\FRV\ODWLRQ RI 6NSO QRUPDO FHOOV VWUDLQ $[f ZHUH PHWDEROLFDOO\ ODEHOHG ZLWK >+@)XF 6, ZDV H[WUDFWHG DQG SXULILHG E\ '($( DQLRQ H[FKDQJH FKURPDWRJUDSK\ 6NSO ZDV VHSDUDWHG LQWR SRROV DV GHVFULEHG .R]DURY HW DO :HVW HW DO f 6NSO SRRO ,, ZDV IXUWKHU SXULILHG WR KRPRJHQHLW\ E\ SKHQ\O 6HSKDURVH FKURPDWRJUDSK\ DQG P$E ) DIILQLW\ FKURPDWRJUDSK\ $ SRROHG SUHSDUDWLRQ RI ODEHOHG DQG XQODEHOHG PDWHULDO ZDV GHQDWXUHG LQ XUHD UHGXFHG DQG DON\ODWHG ZLWK LRGRDFHWDPLGH DQG GLJHVWHG ZLWK HQGR/\V& LQ WKH SUHVHQFH RI 0 XUHD :KHQ IUDFWLRQDWHG RQ D 6XSHUGH[ 3HSWLGH JHO ILOWUDWLRQ FROXPQ LQ WKH SUHVHQFH RI 0 XUHD UDGLRDFWLYLW\ HOXWHG DV D VLQJOH SHDN FHQWHUHG DW IUDFWLRQ )LJ $f ZKLFK ZDV IXUWKHU IUDFWLRQDWHG RQ D &UHYHUVHGSKDVH 53f +3/& FROXPQ DJDLQ \LHOGLQJ D VLQJOH UDGLRDFWLYH SHDN FHQWHUHG DW IUDFWLRQ )LJ ,%f ZKLFK GLG QRW DEVRUE DW QP DQG FRQWDLQHG b RI WKH RULJLQDO UDGLRDFWLYLW\ 7KHVH UHVXOWV VXJJHVWHG WKDW 6NSO FRQWDLQHG RQO\ D VLQJOH IXFRJO\FRSHSWLGH $ SDUDOOHO H[SHULPHQW XVLQJ XQODEHOHG SUHSDUDWLRQ VKRZHG DQ LGHQWLFDO DEVRUEDQFH SHDN DW IUDFWLRQ 8QODEHOHG SXULILHG SHSWLGH ZDV XVHG IRU 06 DQDO\VLV DQG (GPDQ GHJUDGDWLRQ

PAGE 41

)LJXUH 3XULILFDWLRQ RI WKH >+@IXFRJO\FRSHSWLGH IURP 6NSO 7KH QRUPDO VWUDLQ $[ ZDV PHWDEROLFDOO\ ODEHOHG ZLWK >+@)XF DQG 6NSO SRRO ,, ZDV SXULILHG IURP WKH 6, IUDFWLRQ WR KRPRJHQHLW\ 5HGXFHG DQG DON\ODWHG 6NSO ZDV GLJHVWHG ZLWK (QGR/\V & DQG SHSWLGHV ZHUH UHVROYHG RQ D 6XSHUGH[ 3HSWLGH JHO ILOWUDWLRQ FROXPQ $f 7KH UDGLRDFWLYH IUDFWLRQ ZDV FKRPDWRJUDSKHG RQ D &UHYHUVHG SKDVH FROXPQ ZKLFK UHVROYHG SHSWLGHV %f 2QH RI WKHVH FHQWHUHG DW IUDFWLRQ ZDV UDGLRDFWLYH DQG GLG QRW DEVRUE DW QP 7KLV 6NSO IXFRJO\FRSHSWLGH ZDV XVHG IRU PRVW RI WKH VWUXFWXUDO VWXGLHV

PAGE 42

(GPDQ 'HJUDGDWLRQ RI )XFRJO\FRSHSWLGH 0+@ VLJQDO DW P] )LJ LQFOXGLQJ LQVHWf 1RWH WKH UHVROYHG QDWXUDO DEXQGDQFH O& LVRWRSHV DW P] DQG VKRZLQJ WKDW WKLV VLJQDO LV WULSO\ FKDUJHG ,W WKHUHIRUH GHULYHV IURP D PROHFXOH RI PDVV 'D $ VHULHV RI GRXEO\FKDUJHG LRQV ZHUH DOVR DSSDUHQW LQ WKH VSHFWUXP VHSDUDWHG E\ VXJDU PDVV GLIIHUHQFHV P] DQG f 7KH LRQ DW P] LV WKH >0+@ LRQ FRUUHVSRQGLQJ WR WKH >0+@ DW P] DQG WKH PDVV GLIIHUHQFHV IURP WKLV FRUUHVSRQG WR LQWHUYDOV RI )OH[ +H[ )XF DQG +H[ UHVSHFWLYHO\ 0606 RI WKH P] >0+@ LRQ XVLQJ DUJRQ JDV DQG H9 FROOLVLRQ HQHUJ\ SURGXFHG WKH VSHFWUXP VKRZQ LQ )LJ ,QWHUHVWLQJO\ WKH VSHFWUXP VKRZV WKH IRUPDWLRQ IURP P] f RI D QXPEHU RI GRXEO\FKDUJHG LRQV DW P]

PAGE 43

7DEOH 3UHGLFWHG P] YDOXHV RI HQGR/\V& GHULYHG 6NSO SHSWLGHV 3HSWLGH 6HTXHQFH 3UHGLFWHG PDVV P]f 6/9. /(66'(. 9)(,(. (,$&r0697,. 10,(',*(6'6$f3,3/319767,/(. 9/'<&r5+++4+634*''. '(. 5/'',33<'5')&r. 9'437/)(/,/$$1
PAGE 44

UQ] )LJXUH 472) 06 DQDO\VLV RI 6NSO IXFRJO\FRSHSWLGH $ SDUWLDO (6 PDVV VSHFWUXP RI IUDFWLRQ IURP )LJ LV SUHVHQWHG VKRZLQJ GRXEO\ DQG WULSO\FKDUJHG LRQV 7KH WULSO\FKDUJHG LRQ DW P] LV H[SDQGHG LQ WKH LQVHW WR VKRZ WKH LVRWRSH SDWWHUQ

PAGE 45

3HSWLGH +H[1$F >0+@ 1 3HSWLGH >0+@ n Z -:r $OOL • • • n • • •, 9V 3HSWLGH +H[1$F +H[ >0+A 3HSWLGH +H[1$F +H[ )XF 0+-r \f r \ +H[1$F  3HSWLGH >0+@ f§ 3HSWLGH +H[1$F >0+, nn •n fn • O LER ,=:f n OLER n nRR Ln • ER nn nRER )LJXUH 0606 FROOLVLRQDOO\ DFWLYDWHG GHFRPSRVLWLRQ VSHFWUXP RI P] 7KHUH LV HYLGHQFH LQ WKH 06 DQG 0606 VSHFWUD RI PLQRU YDULDQWV LQ VWUXFWXUH EXW WKH GDWD DUH FRQVLVWHQW ZLWK WKH PDMRU PROHFXODU VSHFLHV SUHVHQW FRUUHVSRQGLQJ WR WKH VWUXFWXUH GHVFULEHG LQ WKH WH[W

PAGE 46

DQG VHSDUDWHG E\ VXJDU PDVV GLIIHUHQFHV RI +H[1$F +H[ )XF DQG +H[ UHVSHFWLYHO\ VXJJHVWLQJ D VWHSZLVH VWULSSLQJ RI WKHVH VXJDUV IURP D OLQHDU ROLJRVDFFKDULGH DWWDFKHG WR WKH JO\FRSHSWLGH 7KHVH GDWD FRQILUP WKDW LQ WKH 06 VSHFWUXP VKRZQ LQ )LJ WKH ODEHOHG GRXEO\FKDUJHG LRQV ZHUH IRUPHG LQ WKDW FDVH E\ FRQHYROWDJH LQGXFHG IUDJPHQWDWLRQ IURP D WUXH TXDVLPROHFXODU LRQ DW P] 7KH GRXEO\FKDUJHG LRQ DW P] )LJ f VKRZHG QR HYLGHQFH RI IXUWKHU VXJDU ORVV DQG LV LQWHUSUHWHG DV WKH UHPDLQLQJ SHSWLGH EDFNERQH 7KLV LV FRQILUPHG E\ WKH SUHVHQFH RI D PDMRU VLQJO\FKDUJHG TXDVLPROHFXODU LRQ VLJQDO DW P] >0+@ IRU WKH SHSWLGH $ VHDUFK IRU WKLV PDVV LQ WKH JHQH GHULYHG VHTXHQFH ILQGV QRWKLQJ EXW WKH SHSWLGH LGHQWLW\ FDQ EH GHWHUPLQHG IURP WKH SUHVHQFH RI 1 DQG &WHUPLQDO VHTXHQFH LRQV 0RUULV HW DK f )LJ E DQG \ UHVSHFWLYHO\f LQ WKH ORZ PDVV UDQJH RI WKH VSHFWUXP 7KLV VKRZV WKH SUHVHQFH RI D & WHUPLQDO /\V LQ WKH PROHFXOH YLD DQ LRQ DW P] ZKLFK LV H[WHQGHG YLD VLJQDOV DW P] \f \f \f \f DQG \f )LJV DQG f WR JLYH WKH VHTXHQFH ((4/,5. 1RWH WKH UHODWLYHO\ KLJK LQWHQVLW\ RI WKH P] LVRWRSH SHDN DW P] )LJ f VKRZLQJ WKDW WKH 4 UHVLGXH LV SDUWLDOO\ GHDPLGDWHG 7KLV LV REVHUYHG LQ DOO LRQV FRQWDLQLQJ WKDW UHVLGXH DQG DOVR DFFRXQWV IRU WKH KLJK LQWHQVLW\ RI WKH VDWHOOLWH WR WKH TXDVLPROHFXODU LRQ VLJQDO LQ )LJ 7KH SDUWLDO VHTXHQFH GHWHUPLQHG IURP WKH &WHUPLQDO \f LRQV LV IXUWKHU FRPSOHPHQWHG E\ 1WHUPLQDO Ef LRQV DW P] DQG FRUUHVSRQGLQJ WR D f)7 VHTXHQFH 7KH VHTXHQFH LRQ GDWD WKXV ORFN WKH SHSWLGH SRUWLRQ RI WKH PROHFXOH RQWR UHVLGXHV LQ WKH VHTXHQFH 1')73((((4,5.f H[FHSW WKDW WKH PDVV IRXQG LQ WKH 472) 0606 FROOLVLRQ VSHFWUXP LV 'D KLJKHU WKDQ WKDW SUHGLFWHG IRU WKH SHSWLGH >0+@f 7KLV LV

PAGE 47

)LJXUH 3DUWV RI WKH 0606 VSHFWUXP VKRZQ LQ )LJ H[SDQGHG WR VKRZ ORZHU PDVV UHJLRQ FRQWDLQLQJ SHSWLGHGHULYHG IUDJPHQW LRQV PRUH FOHDUO\

PAGE 48

)LJXUH 3DUWV RI WKH 0606 VSHFWUXP VKRZQ LQ )LJ H[SDQGHG WR VKRZ KLJKHU PDVV UHJLRQ FRQWDLQLQJ SHSWLGHGHULYHG IUDJPHQW LRQV PRUH FOHDUO\

PAGE 49

EO E E E E E E E E EO2 EO EO \ \OO \ \ \ \ \ \ \ \ \ \O )LJXUH 3UHGLFWHG PDVVHV RI 1 DQG & WHUPLQDO VHTXHQFH LRQV RI WKH IXFRJO\FRSHSWLGH

PAGE 50

LQWHUSUHWHG DV D SRVWWUDQVODWLRQDO K\GUR[\ODWLRQ RI RQH RI WKH DPLQR DFLGV SUHVHQW DQG WKLV FRXOG QRW EH DW WKH &WHUPLQDO /\V UHVLGXH DOUHDG\ DVVLJQHG LQ WKH IUDJPHQWDWLRQ GDWD 6FUHHQLQJ WKH KLJKHU PDVV IUDJPHQWV LQ WKH VSHFWUXP DORZV D FOHDU DVVLJQPHQW RI ZKHUH WKH 'D LQFUHPHQW LV DWWDFKHG YLD WKH VLJQDOV DW P] DQG LQ )LJ 7KHVH VKRZ WKDW WKH 3UR &WHUPLQDO VHTXHQFH LRQ \ LV 'D KLJKHU WKDQ WKH WKHRUHWLFDO YDOXH IRU WKH VHTXHQFH 'Df VKRZLQJ WKDW LW LV D +\3UR LQ WKLV SRVLWLRQ 7KH VLJQDOV DW P] DQG FRPSOHWH D VHULHV VKRZLQJ )732+f LQ WKH VHTXHQFH ,PSRUWDQWO\ )LJ DOVR DOORZV DVVLJQPHQW RI WKH DWWDFKPHQW VLWH RI WKH FDUERK\GUDWH WR WKH SHSWLGH 7KH VLJQDO DW P] LV D )OH[1$F UHVLGXH DZD\ IURP WKH P] LRQ VKRZLQJ WKDW WKH FDUERK\GUDWH LV DWWDFKHG YLD D +H[1$F UHVLGXH WR WKH +\3UR DQG QRW DV PD\ KDYH EHHQ H[SHFWHG WR WKH 7KU UHVLGXH $ IXUWKHU VLJQDO DW P] H[WHQGV WKLV LRQ VHULHV WR WKH \O2 VHTXHQFH LRQ 732+f((((4,5. VXEVWLWXWHG ZLWK +H[1$F RQ WKH +\3UR 7KH VLJQDO DW P] FRUUHVSRQGV WR WKH \ LRQ ZLWK D +H[+H[1$F VXEVWLWXHQW DQG WKH VXJDU VHTXHQFH GDWD DVVLJQHG IURP WKH GRXEO\FKDUJHG LRQV DW P] DQG )LJV DQG f QRZ RYHUODSV WKH VLQJO\FKDUJHG 0606 JO\FRSHSWLGH GDWD JLYLQJ FRQILUPDWLRQ RI WKH VHTXHQFH 0606 GDWD RQ VHYHUDO RI WKH FRQHYROWDJH LQGXFHG GRXEO\FKDUJHG JO\FRSHSWLGH IUDJPHQW LRQV DOVR FRUURERUDWHG WKH DERYH LQWHUSUHWDWLRQ $ PLOG 7)$ K\GURO\VLV H[SHULPHQW RQ D UHPDLQLQJ VPDOO TXDQWLW\ RI VDPSOH VKRZHG WKH GLVDSSHDUDQFH RI WKH P] WULSO\FKDUJHG VLJQDO WRJHWKHU ZLWK WKH RWKHU GRXEO\FKDUJHG LRQV H[FHSWLQJ P] DQG D ZHDN WULSO\FKDUJHG VLJQDO DW P]

PAGE 51

VXJJHVWLQJ DV GR WKH 0606 GDWD WKDW WKH VDFFKDULGH LV D OLQHDU PROHFXOH ZLWK )XF PLGn FKDLQ 7DNLQJ DOO WKH 06 DQG 0606 GDWD LQWR FRQVLGHUDWLRQ WKH VWUXFWXUH RI WKH IXFRJO\FRSHSWLGH ZDV DVVLJQHG DV 1')7+H[Q!+H[!)XFf§!+H[+H[1$FfK\GUR[\3 ((((4,5. 6XEVHTXHQW (GPDQ GHJUDGDWLRQ VHTXHQFLQJ RQ D SPRO VDPSOH FRQILUPHG WKH HQWLUH VHTXHQFH RI UHVLGXHV H[FHSW IRU D EODQN DW F\FOH H[SHFWHG WR EH 3UR 0$/',72)06 $QDO\VLV RI WKH )XFRJO\FRSHSWLGH 7KH 0$/', VSHFWUXP FRQWDLQHG D PDMRU >0+@ VLJQDO DW P] )LJ $f ZKLFK ZDV HTXLYDOHQW WR WKH WULSO\FKDUJHG LRQ DW P] LQ WKH 472) VSHFWUXP ,Q DGGLWLRQ D VHULHV RI ORZ DEXQGDQFH LRQV ZHUH REVHUYHG DW P] DQG FRQVLVWHQW ZLWK VHTXHQWLDO ORVV RI +H[ +H[ )XF +H[ DQG +H[1$F UHVSHFWLYHO\ 7KH ORZ DEXQGDQFH LRQV DSSHDUHG WR EH IUDJPHQWDWLRQ SURGXFWV RI WKH P] LRQ UHVXOWLQJ IURP VLPLODU IUHTXHQF\ RI VFLVVLRQ RI HDFK RI WKH JO\FRVLGLF OLQNDJHV 'HOO f UDWKHU WKDQ LQFRPSOHWHO\ JO\FRV\ODWHG VSHFLHV EHFDXVH OHVVJO\FRV\ODWHG SHSWLGHV HOXWHG ODWHU IURP WKH 53FROXPQ VHH EHORZf 7KH P] LRQ ZDV QRW VHHQ LQ D VLPLODU DQDO\VLV RI 53IUDFWLRQDWHG SHSWLGHV )LJ f RI UHFRPELQDQW 6NSO LVRODWHG IURP ( FROL GDWD QRW VKRZQf VKRZLQJ WKDW LW ZDV VSHFLILF WR WKH SURWHLQ H[SUHVVHG LQ 'LFW\RVWHOLXP 6XJDU &RPSRVLWLRQ $QDO\VLV RI 6NSOFP\F 7R GHWHUPLQH LWV PRQRVDFFKDULGH FRPSRVLWLRQ 6NSO ZDV LVRODWHG IURP WKH 6, IUDFWLRQ RI D GLVFRLGHXP VWUDLQ +:f JHQHWLFDOO\ PRGLILHG WR RYHUH[SUHVV XQGHU WKH FRQWURO RI WKH LQGXFLEOH GLVFRLGLQ SURPRWHU D IRUP RI WKH SURWHLQ ZLWK D FP\FHSLWRSH WDJ QHDU LWV &WHUPLQXV 7KH VXJDUV RI SXULILHG 6NSOFP\F ZHUH H[DPLQHG E\ *&06

PAGE 52

$+H[ +H[ GHR[\+H[ +H[ +H[1$F 2+3UR r f§ $f§ f§ %>*DOD @ +H[ GHR[\+H[ +H[ +H[1$F 2+3UR &>*DODO *DODO ` GHR[\+H[ +H[ +H[1$F 2+3UR If_ OLULfI '>*DOD *DODO)XFDO @ +H[ +H[1$F 2+3UR 0DVV P]f )LJXUH 0$/',72)06 DQDO\VLV RI 6NSO JO\FRSHSWLGHV IURP QRUPDO VWUDLQ $[ $ 0DVV VSHFWUD RI WKH IUDFWLRQ IXFRJO\FRSHSWLGH IURP )LJ LVRODWHG IURP WKH QRUPDO VWUDLQ $[ ,Q DGGLWLRQ WR WKH SULPDU\ LRQ D VHULHV RI ORZ DEXQGDQFH IUDJPHQW LRQV FRUUHVSRQGLQJ WR VHOHFWLYH JO\FRVLGLF VFLVVLRQV RI WKH JO\FDQ FKDLQ DUH QRWHG % 7UHDWPHQW RI WKH IUDFWLRQ IXFRJO\FRSHSWLGH ZLWK ;PDQLKRWLV DOf§!JDODFWRVLGDVH & 7UHDWPHQW RI WKH IUDFWLRQ IXFRJO\FRSHSWLGH ZLWK JUHHQ FRIIHH EHDQ DJDODFWRVLGDVH 7UHDWPHQW RI WKH IUDFWLRQ IXFRJO\FRSHSWLGH ZLWK JUHHQ FRIIHH EHDQ DJDODFWRVLGDVH DQG ;PDQLKRWLV DOf§!IXFRVLGDVH 6WUXFWXUHV VXJJHVWHG E\ WKH H[SHULPHQWDO UHVXOW VKRZQ DQG RWKHU UHVXOWV DUH JLYHQ LQ HDFK SDQHO LQ EUDFNHWV

PAGE 53

$EVRUEDQFH PLO $EVRUEDQFH PLO b% )LJXUH )UDFWLRQDWLRQ RI HQGR/\V& JHQHUDWHG 6NSO+LV SHSWLGHV $ 3XULILHG UHFRPELQDQW 6NSO 6NSO+LVf IURP (FROL ZDV UHGXFHGDON\ODWHG DQG IXUWKHUHG SXULILHG RYHU WKH 53+3/& 7KH ILUVW SHDN Df ZDV XVHG IRU (QGR/\V& GLJHVWLRQ % (QGR/\V & GLJHVWHG 6NSO+LV ZHUH IUDFWLRQDWHG RYHU WKH 53+3/& 7KH IUDFWLRQV FRQWDLQLQJ SHSWLGH SHDN ZLWK QP DEVRUEDQFH ZHUH VXEMHFWHG IRU 0$/',72) PDVV VSHFWURPHWU\ 6NSOSHSWLGH ZLWK D SUHGLFWHG P] ZDV HOXWHG DW PLQ

PAGE 54

DIWHU PHWKDQRO\VLV UH1DFHW\ODWLRQ DQG IRUPDWLRQ RI 706GHULYDWLYHV 7R DFKLHYH WKH VHQVLWLYLW\ UHTXLUHG WR DQDO\]H QPRO RI 6NSOFP\F VSOLWOHVV LQMHFWLRQ DQG VHOHFWHG LRQ PRQLWRULQJ ZDV HPSOR\HG )XF QPROf *DO QPROf DQG *OF1$F QPROf ZHUH WKH WKUHH PRVW DEXQGDQW VXJDUV GHWHFWHG )LJ f DQG WKHLU ORZ OHYHOV LQGLFDWHG WKDW RYHUH[SUHVVHG 6NSO ZDV XQGHUJO\FRV\ODWHG )XF DQG *DO ZHUH SUHYLRXVO\ GHWHFWHG DIWHU 0 7)$ K\GURO\VLV .R]DURY HW DO f EXW *OF1$F ZDV QRW 7KH VWURQJHU DFLG FRQGLWLRQV RI PHWKDQRO\VLV ZHUH SUREDEO\ UHTXLUHG WR OLEHUDWH *OF1$F IURP LWV OLQNDJH ZLWK K\GUR[\SUROLQH DQG ;\O LV QRW IRXQG LQ WKH IXFRJO\FRSHSWLGH DFFRUGLQJ WR WKH 06 UHVXOWV 7KXV WKH *&06 GDWD VKRZHG WKDW WKH GHR[\+H[ UHVLGXH LGHQWLILHG E\ 06 ZDV /)XF DV VXJJHVWHG E\ PHWDEROLF ODEHOLQJ DQG VKRZHG WKDW DOO WKHH +H[ UHVLGXHV ZHUH *DO DQG WKDW WKH +H[1$F ZDV *OF1$F ([RJO\FRVLGDVH 'LJHVWLRQ RI )XFRJO\FRSHSWLGH 7R DVVLJQ OLQNDJHV WKH IXFRJO\FRSHSWLGH ZDV WUHDWHG ZLWK H[RJO\FRVLGDVHV DQG DQDO\]HG E\ 0$/',72)06 7KH PDVV RI WKH JO\FRSHSWLGH ZDV UHGXFHG E\ *DO UHVLGXHV WR P] f DIWHU WUHDWPHQW ZLWK WKH QRQVSHFLILF JUHHQ FRIIHH EHDQ D' JDODFWRVLGDVH )LJ &f EXW ZDV QRW DOWHUHG E\ QRQVSHFLILF ERYLQH NLGQH\ > JDODFWRVLGDVH VZHHW DOPRQG JOXFRVLGDVH RU ERYLQH NLGQH\ DIXFRVLGDVH )XUWKHUPRUH RQH *DO UHVLGXH ZDV VXVFHSWLEOH WR UHPRYDO E\ ; PDQLKRWLV DOf§}JDODFWRVLGDVH )LJ %f EXW QRW UHFRPELQDQW *O\NR DOf§!JDODFWRVLGDVH VKRZLQJ WKDW LW ZDV DOf§! OLQNHG )XF ZDV VXVFHSWLEOH WR UHPRYDO \LHOGLQJ P] f RQO\ DIWHU UHPRYDO RI WKH D

PAGE 55

)LJXUH *&06 DQDO\VLV RI 6NSOFP\F WRWDO VXJDUV 6WDQGDUG VDPSOH FRQWDLQLQJ QPRO RI WKH LQGLFDWHG VXJDUV QPRO 6NSOFP\F ZLWK QPRO RI DGGHG PDQQLWRO 0DQ2+f DV DQ LQWHUQDO VWDQGDUG DQG EODQN VDPSOH ZHUH VXEMHFWHG WR PHWKDQRO\VLV UH 1DFHW\ODWLRQ DQG 706GHULYLWL]DWLRQ DQG DQDO\]HG LQ VSOLWOHVV PRGH RQ D 6KLPDG]X 43*&06 ZRUNVWDWLRQ

PAGE 56

OLQNHG *DO UHVLGXHV DV VKRZQ E\ GRXEOH HQ]\PH GLJHVWLRQ H[SHULPHQWV HPSOR\LQJ WKH D JDODFWRVLGDVH DQG HLWKHU QRQVSHFLILF ERYLQH NLGQH\ DIXFRVLGDVH R[ ; PDQLKRWLV DO f§! /IXFRVLGDVH )LJ 'f 6LQFH )XF GRHV QRW FRQWDLQ D OLQNDJH VLWH WKLV PHDQV WKDW )XF ZDV FDSSHG E\ D *DODOf§!*DO GLVDFFKDULGH DQG WKH GLVDFFKDULGH ZDV DOLQNHG WR /)XF 7KHVH UHVXOWV LQGLFDWH WKDW WKH RXWHU VXJDUV IRUP D OLQHDU WULVDFFKDULGH *DODOf§!*DODO f§!)XFDO f§! LQ DFFRUG ZLWK WKH 06 GDWD $ WLPH FRXUVH 0$/',72)06 DQDO\VLV GXULQJ PLOG DFLG K\GURO\VLV RI WKH IXFRJO\FRSHSWLGH \LHOGHG D PDVV GHFUHDVH RI )OH[ UHVLGXHV DQG RQH GHR[\+H[ UHVLGXH P] WR P] f ZLWK QR LQWHUPHGLDWHV GHWHFWHG )LJ f DV DOVR VHHQ LQ WKH FRUUHVSRQGLQJ 472) H[SHULPHQW VHH DERYHf FRQILUPLQJ WKDW WKH RXWHU *DODOLQNHG UHVLGXHV ZHUH DWWDFKHG WR WKH DFLGODELOH LQWHUQDO )XF UHVLGXH ZKRVH PRUH UDSLG UHOHDVH UHVXOWHG LQ WKH VLPXOWDQHRXV ORVV RI DOO WKUHH VXJDUV 0$/',72)06 $QDO\VLV RI $IXFRV\ODWHG*O\FRSHSWLGH 7KH FRUH UHJLRQ RI WKH JO\FDQ ZDV H[DPLQHG LQ D PXWDQW VWUDLQ +/f ZKLFK GRHV QRW V\QWKHVL]H *'3)XF DQG GRHV QRW IXFRV\ODWH 6NSO .R]DURY HW DK f ,W ZDV SUHGLFWHG WKDW WKLV VWUDLQ ZRXOG SURGXFH WKH WUXQFDWHG VXJDU FKDLQ *DOA*OF1$F LI DOWHUQDWLYH SURFHVVLQJ GLG QRW RFFXU +/ 6NSO SXULILHG IURP SRRO ,, RI WKH 6, IUDFWLRQ UHVROYHG LQWR FORVHO\ VSDFHG SHDNV GXULQJ 53+3/& HDFK \LHOGLQJ VLPLODU UHVXOWV )LJ $f (DFK SHDN ZDV GLJHVWHG ZLWK HQGR/\V& DQG IUDFWLRQDWHG RQ D &&53))3/& FROXPQ )LJ ,%f DQG DOO SHSWLGH SHDNV ZHUH H[DPLQHG E\ 0$/', 72)06 ,RQV ZLWK P] YDOXHV FRUUHVSRQGLQJ WR HDFK RI WKH SUHGLFWHG XQPRGLILHG

PAGE 57

m D Oe D 0 7)$ K &2 fFM 1 R m0 0 7)$ K O c &2 P _O D PL 1 && _L FT n‘ &' Fe c c 2W _ V 1 1 0 7)$ K 1 &n ; R K f f c X Lf§Lf§ Lf§Lf§Lf§UaLf§Lf§Lf§ L , )LJXUH $ WLPH FRXUVH 0$/',72)06 DQDO\VLV RI 6NSO IXFRJO\FRSHSWLGH DIWHU PLOG DFLG K\GURO\VLV 7KH IXFRJO\FRSHSWLGH IUDFWLRQ ZDV WUHDWHG ZLWK 0 7)$ DW r& $W LQGLFDWHG WLPHV WKH DOLTXRWV ZHUH VXEMHFWHG WR 0$/',72)06

PAGE 58

)LJXUH )UDFWLRQDWLRQ RI HQGR/\V& JHQHUDWHG DIXFRV\ODWHG 6NSO SHSWLGHV $ 7KH LPPXQRDIILQLW\ SXULILHG 6NSO IURP DIXFRV\ODWLRQ PXWDQW VWUDLQ +/ ZDV UHGXFHG DON\ODWHG DQG IXUWKHUHG SXULILHG RYHU WKH 53+3/& 7ZR HOXWHG SHDNV D DQG Ef \LHOG VLPLODU UHVXOWV DIWHU GLJHVWLRQ ZLWK (QGR/\V& % 3HDN E ZDV GLJHVWHG ZLWK HQGR/\V& DQG IUDFWLRQDWHG RQ D && 53+3/& 7KH HOXWHG IUDFWLRQV ZHUH VXEMHFWHG WR 0$/', 72) 06 7KH 6NSO SHSWLGH ZDV IRXQG LQ SHDNV DQG

PAGE 59

SHSWLGHV ZLWK 0U YDOXHV ZHUH GHWHFWHG LQFOXGLQJ WKH XQPRGLILHG SHSWLGH P] f )LJ &f ,Q DGGLWLRQ WKH H[SHFWHG *DOf§!*OF1$Ff§!SHSWLGH LRQ P] f ZDV DEXQGDQW )LJ $f LQ DQ HDUOLHU HOXWLQJ 53IUDFWLRQ 1R LRQV ZKLFK PLJKW UHSUHVHQW RWKHU JO\FRV\ODWHG GHULYDWLYHV RI SHSWLGH ZHUH GHWHFWHG 7KH DFFXPXODWLRQ RI WKLV GLVDFFKDULGH ZKLFK FRUUHVSRQGHG WR WKH WZR FRUH VXJDUV RI WKH ZLOGW\SH SHQWDVDFFKDULGH FRQILUPHG WKDW WKH DGGLWLRQ RI WKH WZR DOLQNHG *DO UHVLGXHV GHSHQGV RQ )XF :KHQ WKH GLVDFFKDULGHf§!SHSWLGH ZDV WUHDWHG ZLWK $ PDQLKRWLV SLf§! JDODFWRVLGDVH RU RWKHU SJDODFWRVLGDVHV FDSDEOH RI FOHDYLQJ WKLV OLQNDJH DQ LRQ FRUUHVSRQGLQJ WR WKH ORVV RI RQH +H[ UHVLGXH P] f DSSHDUHG LQ SODFH RI WKH SDUHQW LRQ )LJ %f 7KH D JDODFWRVLGDVHV KDG QR HIIHFW 7KH OLQNLQJ *OF1$F UHVLGXH ZDV QRW UHOHDVHG LQ GRXEOH GLJHVWLRQ E\ ERYLQH NLGQH\ SJDODFWRVLGDVH DQG MDFN EHDQ 3KH[RVDPLQLGDVH 7KH *DLSLf§}+H[1$F GLVDFFKDULGH IRXQG RQ +/ 6NSO LV DVVXPHG WR EH HTXLYDOHQW WR WKH FRUH GLVDFFKDULGH RI WKH QRUPDO 6NSO SHQWDVDFFKDULGH EHFDXVH WKH SUHYLRXVO\ FKDUDFWHUL]HG 6NSOIXFRV\OWUDQVIHUDVH :HVW HW DK f ZKLFK IXFRV\ODWHV +/ 6NSO LQ YLWUR GHSHQGV RQ D *DLSLf§!+H[1$F DFFHSWRU 7DNLQJ DOO RI WKH HYLGHQFH WRJHWKHU WKH VXJDU VHTXHQFH ZDV DVVLJQHG DV *DOSDO f§!'*DOSDO +!/)XFSDO f§!'*DOSS A'*OF1$F}+\3UR &RQILJXUDWLRQV DQG WKH DVVLJQPHQW RI *DO DQG )XF DV S\UDQRVH IRUPV ZHUH EDVHG RQ WKH H[RJO\FRVLGDVH VSHFLILFLWLHV 7KLV VWUXFWXUH ZDV GHULYHG IURP DERXW SPRO RI SXULILHG IXFRJO\FRSHSWLGH 0HWKRGV ZKLFK UHTXLUH VXEVWDQWLDOO\ ODUJHU DPRXQWV RI VXJDUV ZLOO EH

PAGE 60

$ +H[+H[1$F 2+3UR % >*DOILO @ +H[1$F 2+3UR : & 3UR ‘ ‘ f§, f§ 0DVV P]f )LJXUH 0$/',72)06 DQDO\VLV RI 6NSO JO\FRSHSWLGHV IURP DIXFRV\ODWLRQ VWUDLQ +/ $ 0DVV VSHFWUD RI 53+3/& SHDN IURP )LJ FRQWDLQLQJ WKH JO\FRSHSWLGHO LVRODWHG IURP WKH DIXFRV\ODWLRQ PXWDQW VWUDLQ +/ $ 1R WUHDWPHQW % 7UHDWPHQW ZLWK;PDQLKRWLV _Of§!JDODFWRVLGDVH 7KH VWUXFWXUH VXJJHVWHG E\ WKH H[SHULPHQWDO UHVXOW LV JLYHQ LQ D EUDFNHW & $ ODWHU HOXWLQJ SHDN FRQWDLQLQJ WKH XQPRGLILHG SHSWLGH

PAGE 61

QHFHVVDU\ WR GHWHUPLQH WKH H[DFW OLQNDJH RI WKH VHFRQG DOLQNHG *DO UHVLGXH DQG WKH FRQILJXUDWLRQ RI WKH *OF1$Ff§!+\3UR OLQNDJH *O\FRV\ODWLRQ +HWHURJHQHLW\ 'HWHFWLRQ RI WKH XQPRGLILHG SHSWLGH LQ WKH IXFRV\ODWLRQ PXWDQW VXJJHVWHG WKDW K\GUR[\ODWLRQ RI 3URO WKH ILUVW VWHS LQ WKH JO\FRV\ODWLRQ SDWKZD\ LV UDWHOLPLWLQJ DQG SRVVLEO\ UHJXODWRU\ 6LPLODUO\ 0$/',72)06 DQDO\VLV RI 53IUDFWLRQV IURP HQGR /\V& UHOHDVHG SHSWLGHV IURP SRRO RI 6NSO IURP QRUPDO FHOOV \LHOGHG LRQV FRUUHVSRQGLQJ RQO\ WR WKH SHQWDVDFFKDULGHf§!SHSWLGH P] f DQG XQPRGLILHG SHSWLGH P] f ,W UHPDLQV WR EH GHWHUPLQHG ZKHWKHU 3URO K\GUR[\ODWLRQ RFFXUV RQ SURGXFWV RI ERWK 6NSO JHQHV DV HDFK DUH SUHVHQW LQ SRRO DQG SRRO ,, DV VKRZQ SUHYLRXVO\ E\ (GPDQ GHJUDGDWLRQ :HVW HW DO f DQG FRQILUPHG KHUH E\ 06 7R FKDUDFWHUL]H WKH JO\FRV\ODWLRQ SDWKZD\ IXUWKHU 6NSOFP\F ZDV H[SUHVVHG DW DQ HOHYDWHG OHYHO LQ VWUDLQ +: (QGR/\V& JHQHUDWHG SHSWLGHV ZHUH IUDFWLRQDWHG E\ 53 +3/& )LJ f DQG DQDO\]HG E\ 0$/',72)06 \LHOGLQJ DEXQGDQW >0+@ LRQV RI DQG LQ VXFFHVVLYH IUDFWLRQV )LJ f 7KHVH FRUUHVSRQGHG WR PXOWLSOH JO\FRIRUPV LQFOXGLQJ WKH IXOOOHQJWK SHQWDVDFFKDULGH WKH SHQWDVDFFKDULGH PLQXV RQH RU WZR RI WKH RXWHU DOLQNHG *DO UHVLGXHV WKH K\GUR[\ODWHG EXW XQJO\FRV\ODWHG SHSWLGH DQG WKH XQPRGLILHG SHSWLGH 7KHVH ILQGLQJV ZHUH FRQVLVWHQW ZLWK WKH PRQRVDFFKDULGH FRPSRVLWLRQ UHVXOWV VKRZQ )LJ f f )XF DQG *OF1$F ZHUH SUHVHQW DW HTXDO OHYHOV DV H[SHFWHG VLQFH QR PRQR DQG GLVDFFKDULGH LQWHUPHGLDWHV ZHUH GHWHFWHG f 7KH *DO)XF UDWLR ZDV LQGLFDWLQJ WKDW WKHUH LV RQ DYHUDJH RQH DOLQNHG *DO WKH

PAGE 62

$ 53& b% % 53& $8 b% )LJXUH )UDFWLRQDWLRQ RI HQGR/\V& JHQHUDWHG 6NSOFP\F SHSWLGHV $ 7KH LPPXQRDIILQLW\ SXULILHG 6NSOFP\F IURP WKH RYHUH[SUHVVLRQ VWUDLQ +: ZDV UHGXFHGDON\ODWHG DQG IXUWKHUHG SXULILHG RYHU WKH 53+3/& 7KH ILUVW SHDN Df ZDV XVHG IRU HQGR/\V& GLJHVWLRQ % (QGRO\V& GLJHVWHG 6NSOFP\F SHSWLGHV ZHUH IUDFWLRQDWHG RYHU WKH 53+3/& 7KH IUDFWLRQV FRQWDLQLQJ SHSWLGH SHDNV ZLWK QP DEVRUEDQFH ZHUH VXEMHFWHG IRU 0$/',72) PDVV VSHFWURPHWU\ 7KH 6NSO SHSWLGH ZDV IRXQG LQ WKH SHDNV DQG

PAGE 63

0DVV P]f )LJXUH 7KH PDVV VSHFWUD RI HQGR/\V& JHQHUDWHG 6NSOFP\F SHSWLGHV 7KH 0$/',72) PDVV VSHFWUD RI 6NSOFP\F SHSWLGHV VKRZ PXOWLSOH JO\FRIRUPV RI WKH SHSWLGH LQFOXGLQJ FRPSOHWHO\ JO\FRV\ODWHG SHSWLGH P] f DQG KH[RVHV SHSWLGHV P] DQG P] f XQJO\FRV\ODWHGK\GUR[\ODWHG SHSWLGH P] f DQG XQPRGLILHG SHSWLGH P] f

PAGE 64

RWKHU EHLQJ OLQNHGf ZKLFK FRUUHODWHG ZLWK WKH GHWHFWLRQ RI JO\FRSHSWLGHV FRQWDLQLQJ RU RXWHU *DO UHVLGXHV f 2QO\ b RI WKH SURWHLQ ZDV JO\FRV\ODWHG ZKLFK FRUUHODWHG ZLWK WKH KLJK OHYHOV RI XQPRGLILHG DQG K\GUR[\ODWHG IRUPV RI SHSWLGH GHWHFWHG 7KH UHVXOWV LQGLFDWHG WKDW VHFRQGDU\ WR 3UR K\GUR[\ODWLRQ DWWDFKPHQW RI WKH UHGXFLQJ WHUPLQDO *OF1$F DQG WKH RXWHU DOLQNHG *DO UHVLGXHV ZHUH WKH QH[W PRVW UDWH OLPLWLQJ VXJJHVWLQJ WKDW WKH HQ]\PHV ZKLFK DGG WKHVH VXJDUV PD\ SRWHQWLDOO\ UHJXODWH WKH VWUXFWXUH RI WKH 3UR JO\FDQ DW RWKHU VWDJHV RI WKH OLIH F\FOH 'LVFXVVLRQ 7KH PDVV VSHFWURPHWULF DQDO\VHV 7DEOH f VXJJHVWHG WKDW WKH 6NSO JO\FDQ FRQVLVWV RI D OLQHDU SHQWDVDFFKDULGH DWWDFKHG WR D +\3UR DW SRVLWLRQ 7KH DWWDFKPHQW VLWH ZDV FRQILUPHG E\ (GPDQ GHJUDGDWLRQ 7KH H[RJO\FRVLGDVH VWXGLHV DQG VXJDU DQDO\VHV FRQILUPHG WKH OLQHDU PRGHO DQG VKRZHG WKH VHTXHQFH WR EH '*DOSDO!'*DO[[O}/ )XFSDOf§!'*DOS>Of§!'*OF1$F}+\3URO 6XEVWDQWLDOO\ JUHDWHU DPRXQWV RI WKH IXFRJO\FRSHSWLGH ZLOO EH QHFHVVDU\ WR GHWHUPLQH WKH OLQNDJH SRVLWLRQ RI WKH VHFRQG D OLQNHG *DO UHVLGXH DQG WKH FRQILJXUDWLRQ RI WKH *OF1$Ff§!+\3UR OLQNDJH 7KH FRUH WULVDFFKDULGH )XFDOf§}*DO_Of§!*OF1$F LV HTXLYDOHQW WR EORRG JURXS + W\SH f H[SUHVVHG E\ PDPPDOLDQ FHOOV *UHHQZHOO f $OWKRXJK LQWHUQDO )XF OLQNDJHV KDYH EHHQ IRXQG LQ JO\FRSURWHLQV =KDQJ HW DO +DUULV HW DK f WKH RXWHU *DODOf§!*DODOA)XF FDS VWUXFWXUH KDV QRW EHHQ SUHYLRXVO\ GHVFULEHG +RZHYHU WKLV VXJDU FKDLQ LV QRW LPPXQRJHQLF LQ PLFH .R]DURY HW DO f XQOLNH RWKHU 'LFW\RVWHOLXP

PAGE 65

7DEOH 0$/',72)06 P] YDOXHV IRU HQGR/\V&GHULYHG JO\FRSHSWLGHV 6DPSOH 6WUDLQ +3/& SHDND 0HDVXUHG P] 'HULYHG VWUXFWXUH >+@JO\FRSHSWLGH $[ IU +H[GHR[\+H[+H[+H[1$F23UR E +H[GHR[\),H[)OH[+H[1$F23UR E GHR[\+H[+H[+H[1$F23UR E +H[+H[1$F23UR E +H[1$F23UR E +23UR 6NSO,, SHSWLGHV +/ SNOO +H[+H[1$F23UR +H[1$F23UR SN 3UR 6NSO+LV SHSWLGHV (FROL SN 3UR 6NSO, SHSWLGHV $[ SN +H[GHR[\+H[+H[+H[1$F23UR SN 3UR 6NSOFP\F ), : SN +H[GHR[\+H[+H[+H[1$F23UR SHSWLGHV SN +H[GHR[\+H[+H[+H[1$F23UR GHR[\+H[+H[+H[1$F23UR SN +23UR SN 3UR )UDFWLRQ RU SHDN EDVHG RQ$ WUDFLQJVf QXPEHUV DUH FRQVLVWHQW RQO\ ZLWKLQ D JLYHQ H[SHULPHQW 7KH VWUXFWXUH JLYHQ LV EDVHG RQ WKH PDVV RI WKH SDUHQW LRQ DV 0+ DQG WKH P] YDOXHV RI WKH GDXJKWHU LRQ VHW 7KHVH DUH GHFRPSRVLWLRQ LRQV LQ WKH 0$/',72)06 DQDO\VLV

PAGE 66

VXJDU SURWHLQ FRQMXJDWHV :HVW HW DO )UHH]H f VXJJHVWLQJ WKDW D VLPLODU VWUXFWXUH PD\ EH H[SUHVVHG LQ PDPPDOV 7KH OLQNDJH DPLQR DFLG K\GUR[\SUROLQH LV SRVVLEO\ K\GUR[\ODWHG EDVHG RQ WKH VSHFLILFLW\ RI D 6NSO8'3*OF1$F *OF1$F WUDQVIHUDVH DFWLYLW\ ZKLFK KDV EHHQ GHWHFWHG DQG SDUWLDOO\ SXULILHG &KDSWHU f K\GUR[\ODWLRQ LV SK\ORJHQHWLFDOO\ XELTXLWRXV DQG 2+3UR KDV EHHQ IRXQG WR EH GHULYDWL]HG ZLWK $UD RU *DO LQ SODQWV DQG DOJDH )LQFKHU HW DK $OOHQ HW DK f EXW VXEVWLWXWLRQ E\ *OF1$F KDV QRW EHHQ GHVFULEHG SUHYLRXVO\ 7KH GRXEOHQHJDWLYH FKDUJH SUHYLRXVO\ DWWULEXWHG WR WKH VXJDU PRLHW\ DIWHU DWWHPSWHG HOLPLQDWLRQ *RQ]DOH]
PAGE 67

&XUUHQW HYLGHQFH VXJJHVWV WKDW 6NSO LV SDUWLDOO\ PRGLILHG LQ WKH F\WRVRO E\ D QRYHO ELRV\QWKHWLF SDWKZD\ 7KH HQ]\PH ZKLFK DGGV )XF LV OLNHO\ WR EH WKH SUHYLRXVO\ FKDUDFWHUL]HG F\WRVROLF IXFRV\OWUDQVIHUDVH F)7DVHf 7KH F)7DVH IXFRV\ODWHV 6NSO LQ YLWUR ZLWK D VXEPLFURPRODU .P :HVW HW DK f DQG FDWDO\]HV IRUPDWLRQ RI WKH VDPH )XF OLQNDJH RQ WKH VDPH DFFHSWRU GLVDFFKDULGH :HVW HW DO 7ULQFKHU DQG %R]]DUUR f DV WKH SUHVHQW UHVXOWV VKRZ RFFXU QDWXUDOO\ LQ 6NSO 7KH F)7DVH LV OLNHO\ WR UHVLGH LQ WKH F\WRSODVPLF FRPSDUWPHQW RI WKH FHOO DV LW ZDV SXULILHG IURP WKH F\WRVROLF IUDFWLRQ DQG LWV VXEPLFURPRODU .P IRU *'3)XF LV PRUH FKDUDFWHULVWLF RI F\WRSODVPLF FRPSDUHG WR *ROJL JO\FRV\OWUDQVIHUDVHV :HVW HW DO f 5HFHQW VWXGLHV RQ 3UR K\GUR[\ODVH DQG *OF1$F7DVH DFWLYLWLHV ZKLFK PRGLI\ RYHUH[SUHVVHG 6NSOFP\F DQG V\QWKHWLF SHSWLGHV VXJJHVW WKDW WKH\ DOVR UHVLGH LQ WKH F\WRSODVPLF FRPSDUWPHQW 7KHVH HQ]\PHV PD\ FRQVWLWXWH D KLWKHUWR XQUHFRJQL]HG FRPSOH[ SDWKZD\ RI 2JO\FRV\ODWLRQ ORFDOL]HG LQ WKH F\WRSODVP QRW WKH VHFUHWRU\ SDWKZD\ ZKLFK DWWDFKHV VXJDUV WR 6NSO LQFUHPHQWDOO\ UDWKHU WKDQ HQ EORF $OWKRXJK JO\FRV\ODWLRQ KHWHURJHQHLW\ ZDV QRW REVHUYHG LQ 6NSO IURP FHOOV DW WKH HQG RI WKH JURZWK SKDVH DFFXPXODWLRQ RI LQFRPSHOHWHO\ JO\FRV\ODWHG FKDLQV LQ WKH RYHUH[SUHVVLRQ VWUDLQ UDLVHV WKH SRVVLELOLW\ RI WKH H[SUHVVLRQ RI JO\FRIRUPV DW 3UR DW RWKHU VWDJHV RI WKH OLIH F\FOH 3UR LV ORFDWHG ZLWKLQ WKH KLJKO\ FRQVHUYHG &WHUPLQDO GRPDLQ RI WKH 6NSO DPLQR DFLG VHTXHQFH :HVW HW DO f 7KH &WHUPLQDO GRPDLQ VHTXHQFHV DUH LGHQWLFDO LQ WKH WZR 'LFW\RVWHOLXP 6NSO JHQHV DQG D 3UR DW WKH HTXLYDOHQW SRVLWLRQ RI 3URO LV SUHVHQW LQ HDFK RI WKH QXPHURXV \HDVW IXQJDO SODQW DQG SODQW YLUDO JHQHV FORQHG WR GDWH 7DEOH f 2I WKH QLQH 6NSO JHQHV VXJJHVWHG E\ '1$ VHTXHQFLQJ GDWD WR H[LVW LQ

PAGE 68

7DEOH 3K\ORJHQHWLF FRPSDULVRQ RI VHTXHQFHV VXUURXQGLQJ 3URO 'LFWYRVWHOLXP D D 10,5*.73(( ,5.L)1,.1' )73((((4,5 .(1(:&('.* JQ GLVFRLGHXP 10,.*.73(( ,5.7)1,.1' )7H(((D495 .(14:&((. + VDSLHQV (0,5*563(( ,557)1,Y1' )76(((DDO5 5(1(:D('5 6 FHUHYLVLDH 10,.*.63(( ,5.7)1,41' )73((('4,5 5(1(:$(( ( QLGXODQV '0,.*.73(( ,5.7)1,.1' )73(((((95 5(14:DI( 3 YXOJDULV '5,5*.73(4 ,5HY)JOH1' /763(((DD$O D(KV:WKOY3 LHG\ &KORUHOOD 9LUXV '0,.*.73(( ,5W7)1,.1' )76(((((95 5(14:DI( $ WKDOLDQD 10,.*.63(( ,557)1,.1' )76((((4,5 .(1D$:&(' & HOHJDQV Df 10,.*.63G( ,55D)1,.G' )7D((U(4,5 .(1D:&'' & HOHJDQV F f L0/ *571( 9.OP/UYJJY H663V'(('VO H'YOHO(YGY G & HOHJDQV Ef TQ35HLL' JL YQG((((4SY \SYNN&NQKW Q & HOHJDQV Gf QV$.*.QD(( 05HO) J LSHSZ(4SVW VWDW:G' & HOHJDQV Hf (/,5*.6W(( ,5.,
PAGE 69

&DHQRUKDEGLWLV HOHJDQV WKUHH DUH KLJKO\ KRPRORJRXV WR 'LFW\RVWHOLXP 6NSO LQ WKLV UHJLRQ DQG WZR RI WKHVH KDYH WKH HTXLYDOHQW RI 3UR :HVW HW DO f 7KXV WKLV NH\ 3UR UHVLGXH PD\ EH PRGLILHG LQ RWKHU RUJDQLVPV DV ZHOO 7KH NQRZQ PRXVH JXLQHD SLJ DQG KXPDQ F'1$V HQFRGH QHDUO\ LGHQWLFDO SURWHLQV &KHQ HW DO =KDQJ HW DO 'HPHWULFN HW DO /LDQJ HW DO f DQG ODFN WKLV 3UR UHVLGXH GHVSLWH D KLJK GHJUHH RI VLPLODULW\ !bf ZLWK WKH 'LFW\RVWHOLXP VHTXHQFH LQ WKH &WHUPLQDO GRPDLQ 2WKHU PDPPDOLDQ 6NSO ORFL &KHQ HW DO 'HPHWULFN HW DO /LDQJ HW DO f PD\ FRQWDLQ WKH HTXLYDOHQW RI 3UR RU 6NSO PD\ EH PRGLILHG RQ D VHFRQG QHDUE\ 73(( VHTXHQFH PRWLI OLNH WKDW FRQWDLQLQJ 3UR 7KH VWUXFWXUDO HYLGHQFH VKRZQ KHUH DGGV 6NSO WR WKH VKRUW OLVW RI H[DPSOHV WKDW FRPSOH[ JO\FRV\ODWLRQ GRHV LQ IDFW RFFXU RQ F\WRSODVPLF DQG QXFOHDU SURWHLQV DV KDV RIWHQ EHHQ SRVWXODWHG EDVHG RQ LQGLUHFW HYLGHQFH 0HGLQD DQG +DOWLZDQJHU f ,W KDV EHHQ ZHOOGRFXPHQWHG LQ WKH SDVW GHFDGH WKDW PDQ\ F\WRSODVPLFQXFOHDU SURWHLQV DUH PRQRJO\FRV\ODWHG E\ *OF1$F RQ 6HU RU 7KU UHVLGXHV +RZHYHU WKH RQO\ JHQHUDOO\ DFFHSWHG H[DPSOHV RI ROLJRJO\FRV\ODWLRQ DUH DQ LQFRPSOHWHO\ GHILQHG SDQHXNDU\RWLF *F3 PRGLILFDWLRQ RI SKRVSKRJOXFRPXWDVH 0DUFKDVH HW DO f DOVR NQRZQ DV SDUDIXVLQ DQG JO\FRJHQLQ WKH SULPHU IRU JO\FRJHQ $ORQVR HW DO f 7KH QRYHO *OF1$Ff§!+\3UR OLQNDJH LQ 6NSO LV GLVWLQFW IURP WKH *OF1$Ff§!6HU7KU +DUW f *OFf§!7\U $ORQVR HW DO f DQG SRVVLEOH 0DQf§}6HU7KU 0DUFKDVH HW DO f OLQNDJHV IRXQG LQ WKH RWKHU F\WRSODVPLFQXFOHDU SURWHLQV DQG KDV QRW EHHQ GHWHFWHG RQ SURWHLQV PRGLILHG LQ WKH VHFUHWRU\ SDWKZD\ 7KRXJK RWKHU SURWHLQV LQ WKH F\WRSODVPLF

PAGE 70

IUDFWLRQ DSSHDU WR EH PHWDEROLFDOO\ODEHOOHG E\ >+@)XF 6NSO DSSHDUV WR EH D PDMRU UHFLSLHQW RI F)7DVHPHGLDWHG IXFRV\ODWLRQ ERWK LQ YLYR DQG LQ YLWUR *RQ]DOH]
PAGE 71

XELTXLWLQDWLRQ RU SKRVSKRU\ODWLRQ RI VHOHFWHG WDUJHW SURWHLQV LQ UHVSRQVH WR HJ FKDQJHV LQ WKH QXWULWLRQDO GLIIHUHQWLDWLRQ RU FHOO F\FOH VWDWXV RI WKH FHOO 7KH QHZ NQRZOHGJH RI JO\FDQ VWUXFWXUH DQG DWWDFKPHQW QRZ UHQGHUV WKH IXQFWLRQ RI 6NSO JO\FRV\ODWLRQ VXVFHSWLEOH WR JHQHWLF LQYHVWLJDWLRQ

PAGE 72

&+$37(5 &+$5$&7(5,=$7,21 2) 6.3*/&1$& 75$16)(5$6( ,QWURGXFWLRQ 6NSO LV IRXQG LQ WKH F\WRSODVPLF 6&) SURWHLQ FRPSOH[ ZKLFK KHOSV WDUJHW FHOO F\FOH DQG RWKHU SURWHLQV IRU XELTXLWLQDWLRQ ,Q 'LFW\RVWHOLXP 6NSO LV YDULDEO\ PRGLILHG E\ DQ XQXVXDO OLQHDU SHQWDVDFFKDULGH *DODO*DODO)XFDO*DOO*OF1$F DWWDFKHG WR D K\GUR[\SUROLQH +\3URf UHVLGXH DW DPLQR DFLG SRVLWLRQ 7HQJXPQXD\ HW DO f7KH SHQWDVDFFKDULGH VWUXFWXUH RI 6NSO LQGLFDWHV D QRYHO JO\FRV\ODWLRQ SDWKZD\ +\3URJO\FRV\ODWLRQf 7KLV SDWKZD\ LV SUHGLFWHG WR FRQWDLQ D QRYHO VHW RI HQ]\PHV LQFOXGLQJ SURO\OK\GUR[\ODVH *OF1$FWUDQVIHUDVH IXFRV\OWUDQVIHUDVH DQG WKUHH GLVWLQFW JDODFWRV\OWUDQVIHUDVHV 2QO\ RQH RI WKHVH HQ]\PHV WKH IXFRV\OWUDQVIHUDVH F)7DVHf KDV EHHQ SXULILHG IURP D F\WRVROLF SUHSDUDWLRQ RI 'LFW\RVWHOLXP DQG FKDUDFWHUL]HG :HVW HW DO f 7KLV F)7DVH KDV FKDUDFWHULVWLFV RI D F\WRVROLF HQ]\PH DOWKRXJK DOO RWKHU NQRZQ HXNDU\RWLF IXFRV\OWUDQVIHUDVHV UHVLGH LQ WKH JROJL FRPSDUWPHQW 'LVUXSWLRQ RI RQH RI WKH ILUVW WZR NH\ HQ]\PHV 6NS SURO\OK\GUR[\ODVH DQG 6NSO*OF1$FWUDQVIHUDVH ZRXOG FRPSOHWHO\ HOLPLQDWH WKH 6NSOJO\FRV\ODWLRQ DQG DOORZ XV WR VWXG\ WKH LPSRUWDQFH DQG IXQFWLRQ RI WKH JO\FDQ 7R DFKLHYH WKH JRDO DQ HQ]\PH SXULILFDWLRQ LV UHTXLUHG LQ RUGHU WR JHW WKH F'1$ VHTXHQFHV ,Q WKLV VWXG\ D 8'31 DFHW\OJOXFRVDPLQH 6NSO1DFHW\OJOXFRVDPLQ\OWUDQVIHUDVH *OF1$FWUDQVIHUDVHf WKH HQ]\PH UHVSRQVLEOH IRU WKH DWWDFKPHQW RI WKH ILUVW VXJDU WR WKH +\3UR UHVLGXH KDV EHHQ SXULILHG IURP WKH F\WRVRO RI 'LFW\RVWHOLXP VWUDLQ +: RYHU '($( SKHQ\O 5HDFWLYH

PAGE 73

5HG 6XSHUGH[ G803 DQG 8'3*OF1$F FROXPQV 7KH DFWLYLW\ EHKDYHG DV D VLQJOH FRPSRQHQW ZLWK DQ DSSDUHQW 0U RI 7KH JO\FRVLGLF OLQNDJH ZDV DONDOLUHVLVWDQW DQG ZDV UHFRYHUHG DV *OF1+ DIWHU DFLG K\GURO\VLV FRQVLVWHQW ZLWK D OLQNDJH WR +\3UR $FWLYLW\ RI WKH SXULILHG HQ]\PH ZDV GHSHQGHQW RQ '77 DQG 0J&O ,WV DSSDUHQW .P IRU 8'3*OF1$F ZDV _L0 7KH SUHVHQFH RI WKLV HQ]\PH LQ WKH F\WRVROLF IUDFWLRQ LWV UHTXLUHPHQW IRU D UHGXFLQJ HQYLURQPHQW DQG LWV H[FHHGLQJO\ KLJK DIILQLW\ IRU LWV GRQRU VXEVWUDWH 8'3*OF1$F VWURQJO\ VXJJHVW WKDW WKH *OF1$FWUDQVIHUDVH JO\FRV\ODWHV 6NSO LQ WKH F\WRSODVP 7KH 6NSO*OF1$FWUDQVIHUDVH DQG WKH SUHYLRXVO\ GHVFULEHG 6NSOIXFRV\OWUDQVIHUDVH DSSHDU WR EHORQJ WR D JO\FRV\ODWLRQ SDWKZD\ ZKLFK LV QRYHO ZLWK UHVSHFW WR WKH VWUXFWXUH IRUPHG DQG LWV FRPSDUWPHQWDOL]DWLRQ LQ WKH F\WRVRO UDWKHU WKDQ LQ WKH VHFUHWRU\ SDWKZD\ RI WKH FHOO 7KH FKDUDFWHULVWLFV RI WKH HQ]\PH JLYH XV D EHWWHU NQRZOHGJH DERXW WKH PHFKDQLVP RI 6NSO JO\FRV\ODWLRQ DQG LWV FRPSDUWPHQWDOL]DWLRQ 2QFH WKH F'1$ VHTXHQFHV RI WKH HQ]\PH LV NQRZQ ZH ZLOO EH DEOH WR VFUHHQ JHQRPLF DQG F'1$ GDWDEDVHV DQG H[SORUH ZKHWKHU D VLPLODU SDWKZD\ H[LVWV LQ RWKHU VSHFLHV 0RUHRYHU LW ZLOO EH SRVVLEOH WR FUHDWH D *OF1$FWUDQVIHUDVH FRH[SUHVVLRQ DQG D *OF1$FWUDQVIHUDVH NQRFNRXW VWUDLQ WR YHULI\ WKDW LW LV WKH UHDO HQ]\PH LQ YLYR 0DWHULDOV DQG 0HWKRGV *,F1$F7UDQVIHUDVH $VVD\ 6XEVWUDWHV 6NSOFP\F ZDV SXULILHG IURP VWUDLQ +: WKURXJK WKH P$E ) DIILQLW\ FROXPQ VWHS DV GHVFULEHG FKDSWHU f 7KH UHFRPELQDQW 6NSO+LV ZDV SXULILHG WKURXJK D QLFNHO PHWDO FKHODWLQJ FROXPQ DV GHVFULEHG FKDSWHU f DQG IXUWKHU SXULILHG RQ D

PAGE 74

P$E ) DIILQLW\ FROXPQ 7KH SXULILHG SURWHLQV ZHUH FRQFHQWUDWHG LQ DQ XOWUDILOWUDWLRQ FRQFHQWUDWRU &HQWULSOXV $PLFRQf WR WKH ILQDO FRQFHQWUDWLRQ RI S0 IRU 6NSOF P\F DQG S0 IRU 6NSO+LV DOLTXRWHG DQG NHSW DV VWRFN VROXWLRQV DW r& 7ZR V\QWKHWLF SHSWLGHV .,)1,.')73((((4,5.(1(: DQG .,)1,.1')7K\ GUR[\3UR (((4,5.(1(: ZKLFK FRUUHVSRQGHG WR WKH DPLQR DFLG RI 6NSO ZHUH V\QWKHVL]HG E\ WKH ,&%5 3URWHLQ &RUH 8QLYHUVLW\ RI )ORULGD 7KH GULHG SHSWLGHV ZHUH UHFRQVWLWXWHG LQ P0 ),(3(61D2+ S+ DW WKH FRQFHQWUDWLRQ RI PJPO DQG NHSW DV VWRFN VROXWLRQV DW r& 8'3>+@*F1$F LQ ZKLFK >+@ ZDV DWWDFKHG WR & RI WKH JOXFRVDPLQH JURXS ZDV IURP 'XSRQW 1(1 ,W KDG D VSHFLILF DFWLYLW\ RI &LPPRO *OF1$FWUDQVIHUDVH DFWLYLW\ *OF1$FWUDQVIHUDVH DFWLYLW\ ZDV DVVD\HG DV WKH WUDQVIHU RI >+@*F1$F IURP 8'3>+@*F1$F WR 6NSOFP\F RU V\QWKHWLF SHSWLGHV 7\SLFDOO\ HDFK DVVD\ FRQWDLQHG S0 6NSOFP\F P0 +(3(61D2+ S+ f P0 0J&O P0 $73 P0 '77 PJPO %6$ DQG S0 8'3>+@*F1$F LQ D WRWDO YROXPH RI SL LQ PO PLFURWXEHV $IWHU HQ]\PH IUDFWLRQV ZHUH DGGHG WKH UHDFWLRQV ZHUH LQFXEDWHG DW r& IRU K DQG VWRSSHG E\ GLOXWLQJ ZLWK SL RI ; /6% FRQWDLQLQJ SJ RI VR\EHDQ WU\SVLQ LQKLELWRU 6LJPDf DQG IUR]HQ DW r& 7U\SVLQ LQKLELWRU KDV DQ 0U RI DQG VHUYHG DV D PDUNHU IRU WKH SRVLWLRQ RI 6NSOFP\F $IWHU ERLOLQJ IRU PLQ HDFK VDPSOH ZDV UHVROYHG RQ D bb 6'63$*( JHO 7KH JHO ZDV VWDLQHG ZLWK &RRPDVVLH %OXH 5 b LQ b PHWKDQRO b DFHWLF DFLGf IRU K GHVWDLQHG b PHWKDQRO b DFHWLF DFLGf RYHUQLJKW DQG ULQVHG LQ GLVWLOOHG +2 IRU K 7KH JHO VOLFH IURP HDFK ODQH ZDV FXW IURP WKH UHJLRQ FRQWDLQLQJ 6NSOFP\F

PAGE 75

N'Df RU V\QWKHWLF SHSWLGHV ZLWK WZR DGGLWLRQDO VOLFHV PP DERYH DQG PP EHORZ 7KH JHO VOLFHV ZHUH H[WUDFWHG LQ b 76 5HVHDUFK 3URGXFWV ,QWHUQDWLRQDO 0W 3URVSHFW ,/f b 332 b GLPHWK\O 32323 LQ WROXHQH VFLQWDQDO\VLV JUDGHf $IWHU K >+@LQFRUSRUDWLRQ ZDV GHWHUPLQHG E\ VFLQWLOODWLRQ FRXQWLQJ %HFNPDQ /6f >+@LQFRUSRUDWLRQ LQWR 6NSOFP\F ZDV IRXQG LQ WKH VOLFHV RI N'D DQG RQH VOLFH DERYH 7KH WHVW RI 6NSO+LV DV D VXEVWUDWH ZDV SHUIRUPHG LQ D VLPLODU ZD\ H[FHSW JHO VOLFHV ZHUH H[FLVHG IURP WKH N'D UHJLRQ 7KH WHVW RI RSWLPXP S+ IRU *OF1$FWUDQVIHUDVH DFWLYLW\ ZDV SHUIRUPHG E\ FKDQJLQJ WKH EXIIHU ZLWK GHVDOWLQJ 3' FROXPQV )LYH 3' FROXPQV ZHUH HTXLOLEUDWHG ZLWK P0 7ULV+&O ZLWK GLIIHUHQW S+ DQG PHDVXUHG DW r& 6, _LO ZDV ORDGHG RQ HDFK FROXPQ DQG PO IUDFWLRQV ZHUH FROOHFWHG DW r& )UDFWLRQV FRQWDLQLQJ WKH KLJKHVW DFWLYLW\ ZHUH WHVWHG 3URWHLQ &RQFHQWUDWLRQ 'HWHUPLQDWLRQ 3URWHLQ FRQFHQWUDWLRQ ZDV GHWHUPLQHG E\ D FRPPHUFLDO PRGLILFDWLRQ RI D &RRPDVVLH %OXH G\H ELQGLQJ PHWKRG 6HGPDN DQG *URVVEHUJ f DFFRUGLQJ WKH PDQXIDFWXUHUfV SURWRFRO 3LHUFH 5RFNIRUG ,/f 2QH PO RI D GLOXWHG VDPSOH ZDV PL[HG ZLWK PO RI WKH UHDJHQW $IWHU PLQ DEVRUEDQFH DW QP ZDV PHDVXUHG DQG WKH SURWHLQ FRQFHQWUDWLRQ ZDV FDOFXODWHG IURP D VWDQGDUG FXUYH RI ERYLQH VHUXP DOEXPLQ 7R GHWHUPLQH WKH SURWHLQ FRQFHQWUDWLRQ RI WKH GHVDOWHG DIILQLW\ SXULILHG *OF1$FWUDQVIHUDVH IUDFWLRQ SL RI VDPSOH ZDV GULHG GRZQ DFLG K\GURO\]HG DQG VXEMHFWHG WR DPLQR DFLG FRPSRVLWLRQ DQDO\VLV DW WKH ,&%5 3URWHLQ &KHPLVWU\ &RUH /DERUDWRU\ XVLQJ QRUOHXFLQH DV DQ LQWHUQDO VWDQGDUG 7RWDO SURWHLQ ZDV FDOFXODWHG EDVHG RQ WKH PRODU FRQWHQW RI DPLQR

PAGE 76

DFLGV 3UHSDUDWLRQ RI WKH +JG803 5HVLQ 6\QWKHVLV RI +JG803 +JG803 ZDV V\QWKHVL]HG DV GHVFULEHG 0HLNOH HW DO =HQJ HW DO f ZLWK VRPH PRGLILFDWLRQV )LIWHHQ PO RI P0 G803 LQ PO RI 0 1D2$F EXIIHU S+ SUHSDUHG E\ DGMXVWLQJ S+ RI 0 1D2$& ZLWK 0 DFHWLF DFLGf ZDV DGGHG GURSZLVH WR PO RI P0 +JDFHWDWH LQ 0 1D2$F EXIIHU S+ 7KH SURFHVV ZDV SHUIRUPHG LQ D OLJKW SURWHFWHG FRQWDLQHU VLQFH +JDFHWDWH LV YHU\ OLJKW VHQVLWLYH 7KH PL[WXUH ZDV LQFXEDWHG DW r& IRU K $IWHU FRROLQJ GRZQ WR URRP WHPSHUDWXUH PJ PPROf RI /L&O ZDV DGGHG WR FRQYHUW WKH H[FHVV +J LQWR +J&O (WK\O DFHWDWH H[WUDFWLRQ ZDV SHUIRUPHG WLPHV E\ PL[LQJ WKH UHDFWLRQ PL[WXUH ZLWK DQ HTXDO YRO RI FROG HWK\O DFHWDWH LQ D SKDVHVHSDUDWLRQ IODVN DQG WKH ORZHU DTXHRXV SKDVH ZDV FROOHFWHG )LYH PO DOLTXRWV RI WKH DTXHRXV SKDVH LQ &RUH[ FHQWULIXJH WXEHV ZHUH HDFK GLOXWHG ZLWK PO RI LFHFROG DEVROXWH HWKDQRO WR SUHFLSLWDWH +JG803 7KH SUHFLSLWDWH ZDV DOORZHG WR GHYHORS DW r& RYHUQLJKW 7KH SUHFLSLWDWH ZDV FROOHFWHG E\ FHQWULIXJDWLRQ LQ D 66 URWRU DW USP IRU PLQ $IWHU WKH HWKDQRO ZDV GLVFDUGHG WKH SHOOHW LQ HDFK WXEH ZDV ZDVKHG ZLWK D PL[WXUH RI HWK\O DFHWDWHHWKDQRO f 7KH SHOOHWV ZHUH FROOHFWHG E\ FHQWULIXJDWLRQ GLVVROYHG LQ PO +2 DQG ORDGHG RQWR D &KHOH[ UHVLQ EHG YRO PO %LRUDGf WR UHPRYH UHVLGXDO +J 7KH IORZWKURXJK FRQWDLQLQJ +JG803 ZDV FROOHFWHG DQG XVHG IRU WKH FRXSOLQJ UHDFWLRQ 7KH \LHOG RI G803 PHUFXUDWLRQ ZDV HVWLPDWHG IURP WKH VKLIW RI PD[LPXP DEVRUEDQFH IURP QP WR QP $EVRUEDQFHV ZHUH FRPSDUHG WR WKH PRODU H[WLQFWLRQ FRHIILFLHQWV RI 8'3 0D[ $ 722 [ f DQG +J8'3 0D[ $ [ f DW S+ $OO VROXWLRQV LQ WKLV

PAGE 77

SURFHGXUH ZHUH GHJDVVHG DQG IUHH RI UHGXFLQJ UHDJHQWV &RXSOLQJ RI +JG803 WR 7KLRSURS\O 6HSKDURVH % 7KLRSURS\O 6HSKDURVH % JHO ZDV SUHSDUHG DFFRUGLQJ WR WKH PDQXIDFWXUHUfV SURWRFRO 3KDUPDFLD %LRWHFKf DV IROORZV 7KH GULHG PDWHULDO ZDV VZROOHQ LQ P0 7ULV+&O 0 1D&O S+ DW URRP WHPSHUDWXUH RYHUQLJKW DQG ZDVKHG RQ D %XFKQHU IXQQHO ZLWK D ODUJH DPRXQW RI +2 7KH IUHH WKLRO JURXS ZDV UHOHDVHG E\ VXVSHQGLQJ JHO LQ b ZYf '77 LQ 0 1D+& P0 GLVRGLXP ('7$ S+ IRU K 7KH JHO ZDV ZDVKHG ZLWK D ODUJH DPRXQW RI 0 1D&O 0 DFHWLF DFLG P0 GLVRGLXP('7$ IROORZHG E\ +2 7KH FRXSOLQJ UHDFWLRQ ZLWK +JG803 ZDV SHUIRUPHG E\ UHVXVSHQGLQJ WKH JHO LQ WKH &KHOH[ IORZWKURXJK ZLWK JHQWOH PL[LQJ RQ D VKDNLQJ SODWIRUP IRU K DW URRP WHPSHUDWXUH 7KH XQUHDFWHG WKLRO JURXS ZDV LQDFWLYDWHG LQ 0 F\VWHLQH LQ P0 7ULV +&O S+ 7KH \LHOG RI WKH FRXSOLQJ UHDFWLRQ ZDV GHWHUPLQHG IURP WKH GHFUHDVH RI DEVRUEDQFH DW QP 3UHSDUDWLRQ RI $PLQRDOO\O8'3*OF1$F6HSKDURVH IRU $IILQLW\ &KURPDWRJUDSK\ 6\QWKHVLV RI DPLQRDOO\O8'3*OF1$F $PLQRfDOO\O8'3*OF1$F ZDV V\QWKHVL]HG IURP +J8'3*OF1$F DV GHVFULEHG =HQJ HW DO f ZLWK VRPH PRGLILFDWLRQV 6\QWKHVLV RI +J8'3*OF1$F ZDV SHUIRUPHG LQ D VLPLODU PDQQHU WR WKH V\QWKHVLV RI +JG803 H[FHSW WKH &KHOH[ UHVLQ VWHS ZDV RPLWWHG 7KH +J8'3 *OF1$F SUHFLSLWDWH ZDV GLVVROYHG LQ 0 1D2$F EXIIHU S+ WR WKH ILQDO FRQFHQWUDWLRQ RI P0 7ZHQW\ PO RI +J8'3*OF1$F VROXWLRQ ZDV PL[HG ZLWK PO RI IUHVKO\ SUHSDUHG 0 DOO\ODPLQHDFHWDWH S+ 7R PDNH 0 DOO\ODPLQHDFHWDWH S+ PO RI DOO\ODPLQH LV GLVVROYHG LQ PO RI 1 DFHWLF DFLG RQ LFH 7KH

PAGE 78

FRQGHQVDWLRQ UHDFWLRQ RI DOO\ODPLQH ZLWK QXFOHRWLGH VXJDU ZDV LQLWLDWHG E\ DGGLQJ QXFOHRWLGH HTXLYDOHQW RI .A3G&8 6LJPD$OGULFKf LQ PO +2 7KH UHDFWLRQ ZDV PDLQWDLQHG DW URRP WHPSHUDWXUH RQ D VKDNLQJ SODWIRUP IRU K 7KH EODFN PHWDO GHSRVLW ZDV UHPRYHG E\ ILOWUDWLRQ WKRXJK D PLFURQ V\ULQJH ILOWHU WZLFH 7KH \LHOG RI WKH UHDFWLRQ ZDV GHWHUPLQHG IURP WKH DEVRUEDQFH DW QP ; KInFPnf 7KH \HOORZ ILOWUDWH ZDV GLOXWHG ZLWK YRO RI +2 DQG DSSOLHG WR D '($(6HSKDURVH )DVW )ORZ FROXPQ FP [ FPf SUHWUHDWHG ZLWK 0 1D+&&I DQG HTXLOLEUDWHG ZLWK RI +2 7KHQ WKH FROXPQ ZDV ZDVKHG ZLWK )(2 XQWLO WKH $ UHWXUQHG WR EDVHOLQH DPLQRfDOO\O8'3*OF1$F ZDV HOXWHG ZLWK D JUDGLHQW RI P0 WULHWK\ODPPRQLXP ELFDUERQDWH 7($%f S+ SUHSDUHG IURP PO RI +2 DQG PO RI P0 7($% S+ 7HQ PO IUDFWLRQV ZHUH FROOHFWHG 7($% EXIIHU ZDV SUHSDUHG E\ DGMXVWLQJ WKH S+ RI P0 7($ LQ +2 ZLWK &2 &RXSOLQJ UHDFWLRQ RI DPLQRfDOO\O8'3*OF1$F WR 1+6DFWLYDWHG 6HSKDURVH )DVW)ORZ 7KH IUDFWLRQV FRQWDLQLQJ DPLQRfDOO\O8'3*OF1$F ZHUH SRROHG DQG GULHG XQGHU YDFXXP FHQWULIXJDWLRQ 7KH GULHG PDWHULDO ZDV GLVVROYHG LQ DQK\GURXV GLPHWK\OIRUPDPLGH VWRUHG LQ PROHFXODU VLHYHV SRUH GLDPHWHU DQJVWURP 6LJPDf DQG WKH S+ ZDV DGMXVWHG WR ZLWK 7($ 7KH S+ RI WKH VROXWLRQ ZDV PHDVXUHG ZLWK S+ SDSHU 6LJPDf DQG KLJKHU S+ UHVXOWHG LQ LQVROXELOL]DWLRQ 7ZR PO RI 1+6 DFWLYDWHG 6HSKDURVH )DVW )ORZ JHO ZDV ZDVKHG ZLWK PO RI GLPHWK\OIRUPDPLGH RQ D %XFKQHU IXQQHO DQG WKH JHO ZDV UHVXVSHQGHG LQ WKH DPLQRfDOO\O8'3*OF1$F VROXWLRQ 7KH FRXSOLQJ UHDFWLRQ ZDV SHUIRUPHG IRU K ZLWK JHQWOH PL[LQJ RQ D VKDNLQJ SODWIRUP DW URRP WHPSHUDWXUH KRZHYHU WKH PD[LPXP RI FRXSOLQJ UHDFWLRQ GHWHUPLQHG

PAGE 79

E\ WKH GHFUHDVH RI DEVRUEDQFH DW QP RFFXUUHG LQ K 7KH XQUHDFWHG 1+6 JURXS ZDV LQDFWLYDWHG LQ 0 DPLQRHWKDQRO LQ P0 7ULV+&O S+ IRU K 2QH PO JHO ZDV SDFNHG LQ D +5 FROXPQ 3KDUPDFLDf 7KH FROXPQ ZDV LQVWDOOHG LQ D 6PDUW V\VWHP +3/& DQG ZDV UXQ H[WHQVLYHO\ ZLWK GHJDVVHG P0 7ULV+&O S+ IROORZHG E\ 0 ERULF DFLG S+ DQG VWRUHG LQ 0 1D&O b WKLPHURVRO LQ P0 +(3(6 1D2+ S+ f *OF1$F7UDQVIHUDVH 3XULILFDWLRQ &HOO O\VLV DQG '($(6HSKDURVH )DVW)ORZ FKURPDWRJUDSK\ &HOO O\VLV ZDV SHUIRUPHG DQG WKH ILQDO 6, VXSHUQDWDQW ZDV SXPSHG RQWR D '($(6HSKDURVH )DVW )ORZ FROXPQ HTXLOLEUDWHG LQ P0 +(3(61D2+ S+ f P0 '77 P0 0J&O P0 GLVRGLXP('7$ b JO\FHURO DV GHVFULEHG FKDSWHU f 6NSO ZDV UHWDLQHG LQ WKH FROXPQ ZKHUHDV *OF1$FWUDQVIHUDVH DFWLYLW\ ZDV IRXQG SULPDULO\ LQ WKH ZDVK IUDFWLRQV $PPRQLXP VXOIDWH SUHFLSLWDWLRQ 1+f6 XOWUDSXUH ,&1f ZDV DGGHG WR WKH ZDVK IUDFWLRQV IURP '($(6HSKDURVH FROXPQ WR WKH ILQDO FRQFHQWUDWLRQ RI b VDWXUDWLRQ ZLWK VWLUULQJ DW r& IRU PLQ 7KH VDPSOH ZDV FHQWULIXJHG LQ D *6$ URWRU DW USP IRU PLQ 7KH *OF1$FWUDQVIHUDVH DFWLYLW\ LQ WKH VXSHUQDWDQW ZDV SUHFLSLWDWHG E\ LQFUHDVLQJ 1+f6 WR b VDWXUDWLRQ 7KH SHOOHW ZDV FROOHFWHG E\ FHQWULIXJDWLRQ LQ D *6$ URWRU DW USP IRU PLQ DQG GLVVROYHG LQ PO RI b VDWXUDWHG 1+f6 P0 +(3(61D2+ S+ f P0 0J&O P0 GLVRGLXP ('7$ P0 '77 b YYf JO\FHURO 3KHQ\O6HSKDURVH )DVW)ORZ ORZVXEf FKURPDWRJUDSK\ 7KH DPPRQLXP VXOIDWH SUHFLSLWDWHG VDPSOH ZDV DSSOLHG WR D SKHQ\O6HSKDURVH )DVW )ORZ ORZVXEf

PAGE 80

FROXPQ FP [ FPf SUHHTXLOLEUDWHG ZLWK b VDWXUDWHG 1+f6 P0 +(3(61D2+ S+ f P0 0J&O P0 GLVRGLXP ('7$ P0 '77 b YYf JO\FHURO DW r& DW WKH IORZ UDWH RI POK 7KH FROXPQ ZDV ZDVKHG ZLWK WKH VDPH EXIIHU XQWLO WKH $R GURSSHG EHORZ b RI LWV PD[LPXP *OF1$FWUDQVIHUDVH DFWLYLW\ ZDV HOXWHG E\ D GHFUHDVLQJ JUDGLHQW RI VDWXUDWHG 1+f6 IURP b WR b SUHSDUHG IURP PO RI WKH HTXLOLEUDWLRQ EXIIHU DQG PO RI WKH VDPH EXIIHU ZLWKRXW 1+f6 )UDFWLRQV ZHUH VWRUHG DW r& 5HDFWLYH 5HG FKURPDWRJUDSK\ 5HDFWLYH 5HG )DVW )ORZ FP [ FPf ZDV HTXLOLEUDWHG ZLWK P0 +(3(61D2+ S+ f P0 0J&O P0 GLVRGLXP ('7$ P0 '77 b YYf JO\FHURO 7KH SKHQ\O6HSKDURVH IUDFWLRQV FRQWDLQLQJ *OF1$FWUDQVIHUDVH DFWLYLWLHV ZHUH SRROHG DQG ORDGHG RQWR WKH FROXPQ DW r& DQG DW WKH IORZ UDWH RI POK 7KH FROXPQ ZDV ZDVKHG ZLWK WKH HTXLOLEUDWLRQ EXIIHU XQWLO WKH $ GURSSHG WR ZLWKLQ b RI EDVHOLQH 7KH FROXPQ ZDV HOXWHG E\ DQ DSSOLFDWLRQ RI D 0 1D&O JUDGLHQW SUHSDUHG IURP PO RI WKH HTXLOLEUDWLRQ EXIIHU DQG PO RI 0 1D&O LQ WKH VDPH EXIIHU 6L[ PO IUDFWLRQV ZHUH FROOHFWHG DQG VWRUHG DW r& 6XSHUGH[ +3/& FKURPDWRJUDSK\ $ 6XSHUGH[ f +3/& FROXPQ 3KDUPDFLD %LRWHFKf ZDV HTXLOLEUDWHG ZLWK P0 +(3(61D2+ S+ f P0 0J&O P0 GLVRGLXP ('7$ b YYf JO\FHURO DW r& RQ DQ /.% *7L +3/& V\VWHP 7KH 5HDFWLYH 5HG IUDFWLRQV FRQWDLQLQJ *OF1$FWUDQVIHUDVH DFWLYLW\ ZHUH SRROHG FRQFHQWUDWHG LQ &HQWULSOXV XOWUDILOWUDWLRQ FDUWULGJHV WR OHVV WKDQ PO DQG ORDGHG RQWR

PAGE 81

WKH FROXPQ YLD D PO LQMHFWLRQ ORRS 7KH LVRFUDWLF UXQ RI WKH VDPH EXIIHU ZDV SHUIRUPHG DW WKH IORZ UDWH RI POPLQ DQG PO IUDFWLRQV ZHUH FROOHFWHG DQG VWRUHG DW r& 7KH 0U ZDV FDOFXODWHG EDVHG RQ KRUVH VSOHHQ DSRIHUULWLQ f \HDVW DOFRKRO GHK\GURJHQDVH f ERYLQH VHUXP DOEXPLQ f DQG VR\EHDQ WU\SVLQ LQKLELWRU f +JG803 FKURPDWRJUDSK\ 7KH 6XSHUGH[ IUDFWLRQV FRQWDLQLQJ *OF1$F WUDQVIHUDVH DFWLYLW\ ZHUH SRROHG DQG ORDGHG RQWR +JG803 FROXPQ EHG YRO POf '77 ZDV DGGHG LQWR WKH IORZWKURXJK WR WKH ILQDO FRQFHQWUDWLRQ RI P0 7KH IORZWKURXJK ZDV FRQFHQWUDWHG LQ D &HQWULSOXV FDUWULGJH WR OHVV WKDQ PO $IWHU XVH WKH FROXPQ ZDV FOHDQHG ZLWK P0 G803 DQG VWRUHG LQ 0 1D&O b WKLPHURVRO LQ P0 +(3(61D2+ S+ f $PLQRDOO\O8'3*OF1$F DIILQLW\ FKURPDWRJUDSK\ 7KH DPLQRDOO\O8'3 *OF1$F +5 FROXPQ ZDV FRQQHFWHG WR D VKRUW DGDSWRU LQ D 6PDUW +3/& V\VWHP DQG ZDV HTXLOLEUDWHG ZLWK b 7ZHHQ P0 '77 P0 +(3(61D2+ S+ f P0 0J&O P0 GLVRGLXP ('7$ b YYf JO\FHURO 7KH FRQFHQWUDWHG IORZWKURXJK IURP +JG803 FROXPQ ZDV ORDGHG RQWR WKH FROXPQ YLD D PO LQMHFWLRQ ORRS DW /OOPLQ $IWHU PLQ WKH FROXPQ ZDV HOXWHG E\ D JUDGLHQW RI P0 803 LQ WKH HTXLOLEUDWLRQ EXIIHU DW SOPLQ ,Q RUGHU WR LGHQWLI\ HQ]\PH DFWLYLW\ DQ DOLTXRW IURP WKH IUDFWLRQV FRQWDLQLQJ 803 ZHUH GHVDOWHG LQ XOWUDILOWUDWLRQ FRQFHQWUDWRUV 0LFURFRQ $PLFRQf DV IROORZV 2QH KXQGUHG TO RI HOXWHG IUDFWLRQV ZDV GLOXWHG ZLWK _OO RI P0 '77 P0 +(3(61D2+ S+ f P0 0J&O P0 GLVRGLXP ('7$ b YYf JO\FHURO LQ D 0LFURFRQ GHYLFH DQG FHQWULIXJHG DW J IRU PLQ 1HZ EXIIHU

PAGE 82

ZDV DGGHG DQG WKH ILOWUDWH ZDV GLVFDUGHG 7KH SURFHVV ZDV UHSHDWHG WLPHV WR UHGXFH WKH 803 FRQFHQWUDWLRQ WR OHVV WKDQ S0 7KH IUDFWLRQV FRQWDLQLQJ DFWLYLWLHV ZHUH SRROHG FRQFHQWUDWHG LQ D &HQWULFRQ FDUWULGJH DQG GHVDOWHG RQ D )DVW 'HVDOWLQJ 3& FROXPQ 6PDUW V\VWHP +3/&f $Q LVRFUDWLF UXQ RI P0 +(3(61D2+ S+ f P0 0J&E P0 GLVRGLXP ('7$ P0 '77 ZDV SHUIRUPHG DW WKH IORZ UDWH RI SOPLQ )UDFWLRQV RI SL ZHUH FROOHFWHG 7KH *OF1$FWUDQVIHUDVH DFWLYLW\ FDPH RXW LQ IUDFWLRQV ZKLFK ZHUH SRROHG DQG XVHG IRU VXEVHTXHQW VWXGLHV +LJKS+ $QLRQ([FKDQJH &KURPDWRJUDSK\ RI WKH $FLG +\GURO\VLV 'HULYDWLYHV RI >+@*OF1$F6NSO *OF1$FWUDQVIHUDVH DVVD\V XVLQJ WKH DPLQRDOO\O8'3*OF1$FDIIPLW\SXULILHG *OF1$FWUDQVIHUDVH ZHUH SHUIRUPHG DV GHVFULEHG 7KH JHO VOLFHV FRQWDLQLQJ >+@*OF1$F 6NSO ZHUH ULQVHG ZLWK ILOWHUHG +2 0LQFHG JHO VOLFHV ZHUH K\GURO\]HG LQ PO RI 0 7)$ DW r& IRU K 7KH VROXEOH SDUW ZDV GULHG E\ YDFXXP FHQWULIXJDWLRQ DQG UHVXVSHQGHG LQ PO PHWKDQRO ZLWK YRUWH[LQJ 7KLV SURFHVV ZDV UHSHDWHG WZLFH 7KH UDGLRDFWLYH SURGXFWV ZHUH UHFRQVWLWXWHG LQ SL RI SP ILOWHUHG ZDWHU PL[HG ZLWK QPRO RI 'JOXFRVDPLQH *,&1+f DQG FKURPDWRJUDSKHG RQ D 'LRQH[ 3$ +3/& FROXPQ HTXLOLEUDWHG LQ P0 1D2+ DW POPLQ 7KH IORZWKURXJK IUDFWLRQV ZHUH FRXQWHG IRU >+@UDGLRDFWLYLW\ GLUHFWO\ XVLQJ 6FLQWLYHUVH+3 VFLQWLOODWLRQ FRFNWDLO 5HGXFWLYH $ONDOLQH 'HJUDGDWLRQ RI >+@*OF1$F6NSO *OF1$FWUDQVIHUDVH DVVD\V XVLQJ WKH DPLQRDOO\O8'3*OF1$FDIILQLW\SXULILHG HQ]\PH ZHUH SHUIRUPHG DV GHVFULEHG 7KH JHO VOLFHV FRQWDLQLQJ >+@*OF1$F6NSO ZHUH ULQVHG ZLWK ILOWHUHG +2 7KH HOLPLQDWLRQ RI JHO VOLFHV ZDV SHUIRUPHG ZLWK WKH DGGLWLRQ

PAGE 83

RI DQ HTXDO YRO RI 0 1D%OU/W LQ 0 1D2+ LQ PO 5HDFWLYLDOV $IWHU LQFXEDWLRQ DW r& IRU K WKH VXSHUQDWDQW ZDV WUDQVIHUUHG LQWR D SRO\SURS\OHQH WXEH QHXWUDOL]HG ZLWK DQ HTXDO YRO RI 0 DFHWLF DFLG LQ PHWKDQRO DQG GULHG XQGHU YDFXXP FHQWULIXJDWLRQ 7KH UDGLRDFWLYH UHVLGXH ZDV GLVVROYHG LQ PO RI +2 DGMXVWHG WKH S+ WR ZLWK DPLQR PHWK\O SURSDQRO GHWHUPLQHG E\ VSRWWLQJ >LO RI WKH VDPSOH RQ S+ SDSHU DQG ORDGHG RQWR PO 'RZH[ VWURQJ DQLRQ H[FKDQJH UHVLQ SUHDFWLYDWHG ZLWK PO RI 0 +& DQG HTXLOLEUDWHG ZLWK PO RI +2 7KH IORZWKURXJK ZDV FROOHFWHG DQG DQ DOLTXRW ZDV PHDVXUHG IRU >+@ XVLQJ 6FLQWLYHUVH+3 VFLQWLOODWLRQ FRFNWDLO 5HVXOWV *OF1$F7UDQVIHUDVH $FWLYLW\ WKDW 0RGLILHG 6NSO ZDV )RXQG LQ WKH 6 )UDFWLRQ RI 'LFW\RVWHOLXP 7KH PRQRVDFFKDULGH FRPSRVLWLRQ DQDO\VLV )LJ f RI 6NSOFP\F LVRODWHG IURP RYHUH[SUHVVLRQ VWUDLQ +: GHWHFWHG RQO\ RQHVL[WK RI WKH H[SHFWHG DPRXQW RI )XF DQG *OF1$F 7HQJXPQXD\ HW DO f 7KLV ILQGLQJ VXJJHVWHG WKDW 6NSOFP\F ZDV XQGHUJO\FRV\ODWHG ZKLFK ZDV VXSSRUWHG E\ WKH 0$/',72)06 GDWD RI 6NSOF P\F SHSWLGHO 7KH HQGRO\VLQ& GLJHVWHG 6NSOFP\F SHSWLGHV ZHUH VHSDUDWHG RQ D UHYHUVH SKDVH +3/& )LJ f DQG WKH HOXWHG IUDFWLRQV ZHUH VXEMHFWHG WR 0$/',72) 06 VWXG\ 7KH PDVV VSHFWUD RI SHSWLGH VKRZHG VHULHV RI P] DQG LQGLFDWLQJ YDULRXV VWDJHV RI JO\FRV\ODWLRQ )LJ f 2QH RI WKHVH SHSWLGHV KDG DQ P] ZKLFK FRUUHVSRQGHG WR WKH K\GUR[\ODWHGXQJO\FRV\ODWHG6NSO SHSWLGHO 7KLV ILQGLQJ LQGLFDWHG WKDW 6NSOFP\F VKRXOG FRQWDLQ D K\GUR[\ODWHG IRUP ZKLFK FRXOG EH D VXLWDEOH VXEVWUDWH IRU D *OF1$FWUDQVIHUDVH SUHGLFWHG WR DWWDFK WKH ILUVW VXJDU RQ WR WKH K\GUR[\SUROLQH UHVLGXH 7R WHVW WKH K\SRWKHVLV DQ DVVD\ IRU WKH

PAGE 84

*OF1$FWUDQVIHUDVH ZDV GHYHORSHG EDVHG RQ D WUDQVIHU RI >+@ IURP 8'3>+@*F1$F WR 6NSOFP\F 7KH UHDFWLRQV ZHUH UHVROYHG E\ 6'63$*( DQG >+@ LQFRUSRUDWLRQ LQWR JHO VOLFHV FRQWDLQLQJ 6NSOFP\F ZDV PHDVXUHG *OF1$FWUDQVIHUDVH DFWLYLWLHV ZHUH WHVWHG LQ FUXGH 6, IURP WKH QRUPDO VWUDLQ $[ DQG IURP WKH RYHUH[SUHVVLRQ VWUDLQ +: )LJ f ,Q WKH DEVHQFH RI 6NSOFP\F LQFRUSRUDWLRQ RI >+@ LQWR $[6 ZDV IRXQG WKURXJKRXW WKH JHO LQGLFDWLQJ WKDW PXOWLSOH SURWHLQV FRXOG WDNH XS >+@*F1$F +RZHYHU LQ WKH SUHVHQFH RI 6NSOFP\F LQFUHDVHG LQFRUSRUDWLRQ ZDV IRXQG LQ WKH N'D UHJLRQ RI WKH JHO DV H[SHFWHG IRU 6NSOFP\F ,Q FRQWUDVW LQ +:6 LQFRUSRUDWLRQ RI >7,@*OF1$F LQWR WKH UHJLRQ RI WKH JHO FRQWDLQLQJ 6NSOFP\F ZDV IRXQG ZLWK D UHODWLYHO\ KLJK OHYHO DQG ZDV VWLPXODWHG RQO\ VOLJKWO\ E\ DGGHG 6NSOFP\F VXJJHVWLQJ WKDW HQGRJHQRXV 6NSOFP\F KDG QHDUO\ VDWXUDWHG WKH HQ]\PH LQ YLWUR 7KH K\SRWKHVLV ZDV VXSSRUWHG E\ WKH ILQGLQJ WKDW WKH DGGLWLRQ RI D 6NSO P$E ) JUHDWO\ LQKLELWHG LQFRUSRUDWLRQ )LJ f 7R JDLQ IXUWKHU HYLGHQFH WKDW >+@*F1$F ZDV LQFRUSRUDWHG LQWR 6NSO D V\QWKHWLF SHSWLGH FRUUHVSRQGLQJ WR UHVLGXHV RI 6NSO ZLWK K\GUR[\SUROLQH DW WKH HTXLYDOHQW UHVLGXH ZDV DGGHG WR WKH UHDFWLRQV LQ DGGLWLRQ WR $[6 RU +: 6 )LJ f 7KH 6'63$*( DQDO\VHV VKRZHG WKDW WKH UHJLRQ RI WKH JHO FRQWDLQLQJ WKH SHSWLGH LQFRUSRUDWHG VXEVWDQWLDO OHYHOV RI >+@ LQ ERWK VWUDLQV ,Q +:6 WKHUH ZDV OHVV >+@LQFRUSRUDWLRQ LQ WKH 6NSO UHJLRQ VXJJHVWLQJ WKDW WKH SHSWLGH DQG HQGRJHQRXV 6NSO ZHUH FRPSHWLWLYH DV DFFHSWRU VXEVWUDWHV FRPSDUH )LJ DQG f 7R DGGUHVV ZKHWKHU WKH DWWDFKPHQW RI >+@*F1$F RFFXUHG DW WKH K\GUR[\SUROLQH +LVWDJJHG UHFRPELQDQW 6NS IURP (FROL 6NSO+LVf LQ ZKLFK 3URO ZDV QRW

PAGE 85

$;6 +:6 N'D t N'D ’ ZLWKRXW 6NSFP\R N'D ‘% 6L ZLWK 6NSFP\F N'D FM N'D N'D P N'D N'D f§f§f§ ( N'D P N'D ( N'D ( 7 N'D PPPf§ $FWLYLW\ SPRLJPKf $FWLYLW\ SPRLJPKf )LJXUH 7UDQVIHU RI >+@ IURP 8'3>+@*F1$F LQWR 6 IUDFWLRQV RI QRUPDO VWUDLQ $[ DQG 6NSORYHUH[SUHVVLRQ VWUDLQ +: 6, IUDFWLRQV IURP QRUPDO VWUDLQ $[ DQG RYHUH[SUHVVLRQ VWUDLQ +: ZHUH LQFXEDWHG ZLWK _O0 8'3>+@*F1$F LQ DUHDFWLRQ PL[WXUH FRQWDLQLQJ PP 7ULV+&O S+ f P0 0J&( P0 0Q&) P0 $73 DQG P0 1D) LQ WKH DEVHQFH RU SUHVHQFH RI ML0 6NSOFP\F $IWHU K LQFXEDWLRQ DW r& WKH VDPSOHV ZHUH GLOXWHG ZLWK /6% ERLOHG DQG UHVROYHG E\ 6'6 3$*( $IWHU VWDLQLQJ DQG GHVWDLQLQJ SURWHLQV LQ JHO VOLFHV ZHUH H[WUDFWHG DQG PHDVXUHG IRU >+@ LQFRUSRUDWLRQ 7KH LQFRUSRUDWLRQ LQWR 6NSOFRQWDLQLQJ JHO VOLFHV ZLWK WKH 0U RI N'D ZDV JUHDWHU LQ VWUDLQ +: WKDQ WKRVH RI VWUDLQ $[ GXH WR WKH KLJKHU OHYHO RI HQGRJHQRXV 6NSO VXEVWUDWH ,Q WKH SUHVHQFH RI 6NSOFP\F >+@ LQFRUSRUDWLRQ LQ 6NSOFRQWDLQLQJ JHO VOLFHV ZDV LQFUHDVHG LQ ERWK VWUDLQV

PAGE 86

N'D N'D N'D N'D N'D N'D N'D N'D N'D N'D N'D SHSWLGH EDQG .'D 7 $FWLYLW\ SPROJPKf )LJXUH 7UDQVIHU RI >+@ IURP 8'3>+@*F1$F LQWR 6 IUDFWLRQV RI QRUPDO VWUDLQ $[ DQG RYHUH[SUHVVLRQ VWUDLQ +: LQ WKH SUHVHQFH RI 6NSOSHSWLGH 6, IUDFWLRQV IURP QRUPDO VWUDLQ $[ DQG RYHUH[SUHVVLRQ VWUDLQ +: ZHUH LQFXEDWHG ZLWK S0 8'3>+@*F1$F LQ WKH SUHVHQFH RU DEVHQFH RI P0 V\QWKHWLF 6NSOSHSWLGH DQG *OF1$FWUDQVIHUDVH DVVD\V ZHUH SHUIRUPHG DV GHVFULEHG LQ )LJ ,QFUHDVHG LQFRUSRUDWLRQ LQ SHSWLGH FRQWDLQLQJ JHO VOLFHV ZDV DSSDUHQW LQ ERWK VWUDLQV ,Q FRPSDULVRQ WR )LJ >+@LQFRUSRUDWLRQ LQWR WKH SHSWLGH DQG HQGRJHQRXV 6NSOFP\F LQ +:6 ZHUH FRPSHWLWLYH ZLWK HDFK RWKHU

PAGE 87

6\QWKHWLF SHSWLGH P$E ) )LJXUH ,QKLELWLRQ RI *,F1$FWUDQVIHUDVH DFWLYLWLHV E\ V\QWKHWLF SHSWLGH DQG DQWL6NSODQWLERG\ 6, IUDFWLRQV IURP RYHUH[SUHVVLRQ VWUDLQ +: ZHUH DVVD\HG IRU *,F1$FWUDQVIHUDVH DFWLYLW\ DV GHVFULEHG LQ )LJ LQ WKH DEVHQFH RU SUHVHQFH RI SL RI P$E) DVFLWHV ZKLFK LV VSHFLILF WR 6NSO 7KH P$E) LQKLELWHG LQFRUSRUDWLRQ LQ ERWK HQGRJHQRXV 6NSOFP\F DQG V\QWKHWLF SHSWLGH VXJJHVWLQJ WKH VSHFLILFLW\ RI ERWK VXEVWUDWHV

PAGE 88

)LJXUH *OF1$FWUDQVIHUDVH DFWLYLW\ LV VSHFLILF IRU 6NSOFP\F 6, IURP QRUPDO VWUDLQ $[ DQG RYHUH[SUHVVLRQ VWUDLQ +: ZHUH DVVD\HG IRU WKH *OF1$FWUDQVIHUDVH DFWLYLWLHV LQ WKH DEVHQFH RU SUHVHQFH RI _R0 6NSOFP\F RU _O0 UHFRPELQDQW 6NSO IURP (FROL 6NSO+LVf DV GHVFULEHG LQ )LJ 2QO\ 6NSOFP\F ZKLFK FRQWDLQV WKH XQJO\FRV\ODWHGK\GUR[\ODWHG IRUP RI 6NSO FDQ VWLPXODWH WKH *OF1$FWUDQIHUDVH DFWLYLWLHV LQ ERWK $[6 DQG +:6

PAGE 89

K\GUR[\ODWHG ZDV WHVWHG DV D VXEVWUDWH 7KH UHVXOW )LJ f VKRZHG WKDW 6NSO+LV FRXOG QRW VWLPXODWH WKH HQ]\PH DFWLYLW\ VXJJHVWLQJ WKDW >+@*F1$F ZDV DWWDFKHG WR WKH K\GUR[\SUROLQH UHVLGXH 7KHVH GDWD ZHUH VXSSRUWHG E\ WKH HYLGHQFH WKDW V\QWKHWLF SHSWLGH ZLWK 3UR LQ SODFH RI +\3UR FRXOG QRW VWLPXODWH HQ]\PH DFWLYLW\ GDWD QRW VKRZQf 7R DGGUHVV WKH FRPSDUWPHQWDOL]DWLRQ RI WKH HQ]\PH DFWLYLW\ *OF1$FWUDQVIHUDVH DFWLYLWLHV ZHUH WHVWHG LQ 3, IUDFWLRQ IURP $[ VWUDLQ DQG 3, WUHDWHG ZLWK b 7ZHHQ )LJ f 7KH >+@LQFRUSRUDWLRQ LQ 3, WUHDWHG ZLWK 7ZHHQ ZDV H[SHFWHGO\ KLJKHU WKDQ WKDW RI 3, GXH WR WKH OHDNDJH RI PHPEUDQH ERXQG SURWHLQV 7KH LQFRUSRUDWLRQ LQ ERWK 3, IUDFWLRQV ZDV KLJKHU WKDQ WKDW RI 6, FRPSDUH )LJ DQG f LQGLFDWLQJ PRUH SURWHLQV UHVLGLQJ LQ 3 FRXOG XSWDNH > +-*OF1$F +RZHYHU LQ 3, IUDFWLRQV WKH LQFRUSRUDWLRQ LQ >+@LQFRUSRUDWLRQ LQ WKH N'D UHJLRQ RI WKH JHO ZDV QRW LQFUHDVHG ZKHQ 6NSOFP\F ZDV DGGHG 7KH GHSHQGHQFH RI HQ]\PH DFWLYLWLHV RQ S+ ZDV WHVWHG DIWHU HQ]\PH EXIIHU ZDV UHSODFHG E\ JHO ILOWUDWLRQ )LJ f 7KH KLJKHVW DFWLYLW\ ZDV IRXQG DW S+ DQG S+ ZDV FKRVHQ DV WKH DVVD\ S+ LQ VXEVHTXHQW VWXGLHV 3XULILFDWLRQ 6WHS $QLRQ ([FKDQJH &KURPDWRJUDSK\ RQ '($( )DVW)ORZ 7KH 6, SUHSDUDWLRQ IURP RYHUH[SUHVVLRQ VWUDLQ +: ZDV ORDGHG RQWR '($( )DVW)ORZ 6HSKDURVH DW S+ DQG HOXWHG ZLWK D JUDGLHQW RI 0 1D&O *OF1$F WUDQVIHUDVH DFWLYLW\ ZDV IRXQG LQ WKH ZDVK IUDFWLRQV )LJ f VXJJHVWLQJ WKDW WKH HQ]\PH ZDV ERXQG ZHDNO\ WR WKH FROXPQ 7KH UHVXOW ZDV UHSURGXFLEOH ZKHQ WKH EXIIHU ZDV UHSODFHG ZLWK P0 7ULV+&O ,P0 '77 S+ 6LQFH WKH WRWDO DFWLYLW\ LQ 6 FRXOG

PAGE 90

SL RR 3b7ZHHQ R $FWLYLW\ SPROJPKf $FWLYLW\ SPROJPKf )LJXUH 7UDQVIHU RI >+@ IURP 8'3>+@*F1$F LQWR 3 IUDFWLRQV RI QRUPDO VWUDLQ $[ LQ WKH SUHVHQFH RI 6NSOFP\F 7KH 3, IUDFWLRQ IURP QRUPDO VWUDLQ $[ ZDV GLOXWHG WLPHV ZLWK 0 VXFURVH LQ P0 7ULV+&O S+ f $Q DOLTXRW RI GLOXWHG 3, ZDV WUHDWHG ZLWK b 7ZHHQ WR PHDVXUH SRWHQWLDO ODWHQW DFWLYLW\ *OF1$FWUDQVIHUDVH DVVD\V RI 3, DQG 37ZHHQ ZHUH SHUIRUPHG DV GHVFULEHG LQ )LJ ([RJHQRXV 6NSOFP\F GLG QRW VWLPXODWH LQFRUSRUDWLRQ LQ 3 IUDFWLRQV

PAGE 91

GSP S+ )LJXUH 7KH HIIHFWV RI S+ RQ 6NSO*OF1$FWUDQVIHUDVH DFWLYLW\ 6, IUDFWLRQV IURP +: ZHUH DSSOLHG WR 3' FROXPQV SUHHTXLOLEUDWHG ZLWK P0 7ULV+&O ZLWK GLIIHUHQW S+ *OF1$FWUDQVIHUDVH DFWLYLW\ LQ 3' IUDFWLRQV ZKLFK FRQWDLQHG WKH KLJKHVW DFWLYLW\ ZDV DVVD\HG 7KH GDWD VKRZHG WKDW ORZ S+ LQKLELWHG DQG KLJK S+ VWLPXODWHG HQ]\PH DFWLYLW\

PAGE 92

( R 7 7 &0 &2 LQ &' U -& & & V] e [ & &2 &2 &2 &2 &2 &2 &2 &2 &2 &2 &2 &2 &2 &2 : 68 YX YX 98 99YX )LJXUH *OF1$FWUDQVIHUDVH DFWLYLWLHV LQ WKH IORZWKURXJK DQG ZDVK IUDFWLRQV IURP '($(6HSKDURVH +:6 ZDV SXPSHG RQWR D '($(6HSKDURVH FROXPQ 7ZHQW\ _LO DOLTXRWV RI WKH IORZWKURXJK WRWDO YRO POf DQG ZDVK IUDFWLRQV DSSUR[LPDWH WRWDO YRO PO HDFKf ZHUH DVVD\HG IRU *OF1$FWUDQVIHUDVH DFWLYLW\ 0DMRULW\ RI WKH HQ]\PH DFWLYLW\ ZDV IRXQG LQ WKH ZDVK IUDFWLRQV

PAGE 93

QRW EH GHWHUPLQHG GXH WR WKH SUHVHQFH RI DQ XQNQRZQ DPRXQW RI WKH HQGRJHQRXV VXEVWUDWH 6NSOFP\F WKH DFWLYLW\ LQ WKH ZDVK IUDFWLRQV ZDV WDNHQ DV b 7DEOH OLQH f 7R RSWLPL]H WKH DVVD\ FRQGLWLRQV RI WKH HQ]\PH WKH '($( ZDVK IUDFWLRQ ZDV FRQFHQWUDWHG LQ DQ XOWUDILOWUDWLRQ FHOO DQG WHVWHG IRU HQ]\PH DFWLYLW\ LQ WKH DEVHQFH RU SUHVHQFH RI YDULRXV FRQFHQWUDWLRQ RI 1D&O .& 0Q&I DQG &D&O 1D&O LQKLELWHG DFWLYLWLHV PRUH WKDQ .& )LJ f DQG ERWK 0Q&O DQG &D&O LQKLELWHG HQ]\PH DFWLYLW\ )LJf ,W LV QRWDEOH WKDW WKH DVVD\V FRQWDLQHG P0 0J&O DQG WKH HQ]\PH DFWLYLW\ ZDV SDUWLDOO\ LQKLELWHG DW 0J&O FRQFHQWUDWLRQ KLJKHU WKDQ P0 VHH EHORZf 3XULILFDWLRQ 6WHS $PPRQLXP 6XOIDWH 3UHFLSLWDWLRQ 7KH HQ]\PH DFWLYLW\ ZDV SXULILHG IXUWKHU E\ DPPRQLXP VXOIDWH IUDFWLRQDWLRQ $PPRQLXP VXOIDWH 1+f6f ZDV DGGHG WR WKH '($( ZDVK WR b VDWXUDWLRQ 7KH HQ]\PH DFWLYLW\ ZKLFK UHPDLQHG VROXEOH FRXOG EH SUHFLSLWDWHG E\ LQFUHDVLQJ 1+f6 WR b VDWXUDWLRQ 7KH SHOOHW ZDV FROOHFWHG DQG UHGLVVROYHG LQ b VDWXUDWHG 1+f6 LQ P0 +(3(61D2+ S+ f P0 0J&O P0 GLVRGLXP('7$ P0 '77 b JO\FHURO 6PDOO DOLTXRWV RI WKH HQ]\PH IUDFWLRQV FRQWDLQLQJ 1+f6 ZHUH GHVDOWHG LQ 0LFURFRQ GHYLFHV DQG WHVWHG IRU *OF1$FWUDQVIHUDVH DFWLYLW\ 7KH UHFRYHU\ RI HQ]\PH DFWLYLW\ LQ b VDWXUDWHG 1+f6 VXSHUQDWDQW DQG b VDWXUDWHG 1+f6 SHOOHW 7DEOH OLQH DQG f ZDV RQO\ b DQG b UHVSHFWLYHO\ 7KH DFWLYLWLHV PLJKW EH ORZHU WKDQ H[SHFWHG GXH WR LQKLELWLRQ E\ UHPDLQLQJ 1+f6 LQ WKH DVVD\V (Q]\PH DFWLYLW\ ZDV FRPSOHWHO\ UHFRYHUHG DIWHU 1+f6ZDV UHPRYHG E\ SXULILFDWLRQ RYHU D SKHQ\O6HSKDURVH FROXPQ VHH EHORZf

PAGE 94

7DEOH 3XULILFDWLRQ RI *OF1$FWUDQVIHUDVH DFWLYLW\ 3XULILFDWLRQ RI *OF1$F WUDQVIHUDVH DFWLYLW\ IURP WKH F\WRVRO RI 'LFW\RVWHOLXP VWUDLQ +: 6, H[WUDFW ZDV SUHSDUHG DQG DSSOLHG RQ '($(6HSKDURVH )DVW )ORZ 7KH ZDVK IUDFWLRQV ZHUH IXUWKHU SXULILHG RYHU SKHQ\O6HSKDURVH ORZ VXEf 5HDFWLYH 5HG 6XSHUGH[ +3/& G803 DQG 8'3*OF1$F FROXPQV 3UHSDUDWLRQ 3URWHLQ PJf 7RWDO DFWLYLW\ SPROKf
PAGE 95

2 &RQFHQWUDWLRQ 0f )LJXUH 7KH HIIHFWV RI 1D&O DQG .& RQ *OF1$FWUDQVIHUDVH DFWLYLW\ 7KH FRQFHQWUDWHG '($( ZDVK IUDFWLRQV ZHUH DVVD\HG IRU *OF1$FWUDQVIHUDVH DFWLYLW\ LQ WKH SUHVHQFH RI GLIIHUHQW FRQFHQWUDWLRQ RI 1D&O RU .& (DFK UHDFWLRQ FRQWDLQHG P0 0J&O P0 $73 P0 '77 PJPO %6$ DQG Q0 8'3*OF1$F 1D&O LQKLELWHG WKH DFWLYLW\ PRUH WKDQ .&

PAGE 96

2 &RQFHQWUDWLRQ P0f )LJXUH 7KH HIIHFWV RI &D&O DQG 0Q&O RQ *OF1$FWUDQVIHUDVH DFWLYLW\ 7KH FRQFHQWUDWHG '($( ZDVK IUDFWLRQ ZDV DVVD\HG IRU *OF1$FWUDQVIHUDVH DFWLYLW\ LQ WKH SUHVHQFH RI GLIIHUHQW FRQFHQWUDWLRQ RI &D&O DQG 0Q&O (DFK UHDFWLRQ FRQWDLQHG P0 0J&O P0 $73 P0 '77 PJPO %6$ DQG _O0 8'3*OF1$F %RWK &D&O DQG 0Q&O LQKLELW WKH DFWLYLW\

PAGE 97

3XULILFDWLRQ 6WHS +\GURSKRELF ,QWHUDFWLRQ &KURPDWRJUDSK\ RQ 3KHQ\O 6HSKDURVH/RZ6XEf )DVW)ORZ 7KH HQ]\PH DFWLYLW\ ZKLFK KDG EHHQ GLVVROYHG LQ b VDWXUDWHG 1+f6 ZDV ORDGHG RQWR D SKHQ\O6HSKDURVHORZVXE FROXPQ (Q]\PH DFWLYLW\ ERXQG WR WKH FROXPQ FRXOG EH HOXWHG E\ GHFUHDVLQJ WKH FRQFHQWUDWLRQ RI 1+f6 7KH HQ]\PH DFWLYLWLHV ZHUH IRXQG LQ ODWH IUDFWLRQV DV 1+f6 FRQFHQWUDWLRQ GLPLQLVKHG QHDU WR ]HUR )LJ f %DVHG RQ WKH SXULILFDWLRQ \LHOG 7DEOH OLQH f WKH DFWLYLW\ ZDV UHFRYHUHG FRPSOHWHO\ )XUWKHU HOXWLRQ ZLWK b HWK\OHQH JO\FRO GLG QRW \LHOG DQ\ PRUH DFWLYLW\ 3XULILFDWLRQ 6WHS 5HDFWLYH '\H &KURPDWRJUDSK\ RQ 5HDFWLYH 5HG )DVW )ORZ 7KH SKHQ\O6HSKDURVH IUDFWLRQV FRQWDLQLQJ *OF1$FWUDQVIHUDVH DFWLYLW\ ZHUH DSSOLHG WR D 5HDFWLYH 5HG IDVW IORZ FROXPQ $FWLYLW\ ERXQG WR WKH FROXPQ DQG HOXWHG LQ D JUDGLHQW RI 0 1D&O )LJ f $ .& JUDGLHQW ZDV QRW DV HIIHFWLYH VLQFH WKH HQ]\PH DFWLYLW\ ZDV HOXWHG EURDGO\ DFURVV WKH JUDGLHQW GDWD QRW VKRZQf 2QO\ b RI WKH DFWLYLW\ ZDV UHFRYHUHG IURP 5HDFWLYH 5HG SXULILFDWLRQ 7DEOH OLQH f 7KH VPDOO DPRXQW RI WKH DFWLYLW\ bf IRXQG LQ WKH IORZWKURXJK IUDFWLRQ FRXOG QRW H[SODLQ WKH VLJQLILFDQW ORVWV RI DFWLYLW\ )LJ f 7R WHVW IRU D SRWHQWLDO VXEXQLW ZKLFK PLJKW KDYH EHHQ VHSDUDWHG GXULQJ WKH SXULILFDWLRQ WKH IORZWKURXJK IUDFWLRQV PL[HG ZLWK WKH HOXWHG IUDFWLRQ ZHUH DVVD\HG IRU WKH DFWLYLW\ )LJ f 7KH DGGLWLRQ RI WKH IORZWKURXJK IUDFWLRQV WR WKH HOXWHG IUDFWLRQ FRXOG QRW UHFRYHU DQ\ PRUH DFWLYLW\ EXW LQVWHDG LQKLELWHG LW E\ b LQGLFDWLQJ WKDW DQ HVVHQWLDO FRIDFWRU GLG QRW VHHP WR EH VHSDUDWHG IURP WKH HQ]\PH XQOHVV LW ZDV HOXWHG DW D KLJKHU 1D&O FRQFHQWUDWLRQ RU VWLOO ERXQG WR WKH FROXPQ 7R WHVW IRU WKH SRVVLELOLW\ WKDW DQ HVVHQWLDO FRIDFWRU H[LVWHG DW DQ

PAGE 98

D &c 2 & e f Z Z 1+f6 VDWXUDWLRQ )LJXUH 3XULILFDWLRQ RI *OF1$FWUDQVIHUDVH RQ SKHQ\O6HSKDURVH ORZVXE FROXPQ *OF1$FWUDQVIHUDVH DFWLYLW\ LQ '($( ZDVK IUDFWLRQ ZDV SUHFLSLWDWHG ZLWK b VDWXUDWHG 1+A6&( DQG DSSOLHG RQWR D SKHQ\O6HSKDURVH ORZVXE FROXPQ SUHn HTXLOLEUDWHG ZLWK b VDWXUDWHG 1+(62 LQ P0 +(3(61D2+ S+ f P0 0J&K P0 ('7$ P0 '77 b JO\FHURO 7KH FROXPQ ZDV HOXWHG E\ GHFUHDVLQJ 1(((6&( FRQFHQWUDWLRQ GRZQ WR ]HUR 7KH HOXWHG IUDFWLRQV ZHUH WHVWHG IRU *OF1$F WUDQVIHUDVH DFWLYLW\

PAGE 99

R K8 : V F R )UDFWLRQ QXPEHU )LJXUH 3XULILFDWLRQ RI *OF1$FWUDQVIHUDVH RQ D 5HDFWLYH 5HG FROXPQ 7KH SKHQ\O6HSKDURVH HOXWHG IUDFWLRQV ZKLFK FRQWDLQHG *OF1$FWUDQVIHUDVH DFWLYLWLHV ZHUH SRROHG DQG ORDGHG RQWR D 5HDFWLYH 5HG FROXPQ 7KH FROXPQ ZDV HOXWHG E\ DQ DSSOLFDWLRQ RI 1D&O JUDGLHQW WR 0 7KH HOXWHG IUDFWLRQV ZHUH WHVWHG IRU *OF1$F WUDQVIHUDVH DFWLYLW\

PAGE 100

5HDFWLYH 5HG IU )ORZWKURXJK IU )ORZWKURXJK IU )LJXUH 5HDFWLYH 5HG IORZWKURXJK IUDFWLRQV FRXOG QRW UHVWRUH *OF1$F WUDQVIHUDVH DFWLYLW\ 5HDFWLYH5HG HOXWHG IUDFWLRQ ZKLFK FRQWDLQHG WKH KLJKHVW DFWLYLW\ ZDV DVVD\HG LQ WKH DEVHQFH RU SUHVHQFH RI IORZWKURXJK IUDFWLRQ DQG 7KH IORZWKURXJK IUDFWLRQ GLG QRW LQFUHDVH WKH *OF1$FWUDQVIHUDVH DFWLYLW\ EXW LQVWHDG LQKLELWHG LW

PAGE 101

HDUOLHU VWDJH RI SXULILFDWLRQ VLPLODU WHVW ZDV SHUIRUPHG E\ PL[LQJ WKH 5HDFWLYH 5HG SRRO ZLWK WKH SKHQ\O6HSKDURVH SRRO RU ZLWK WKH 6, IUDFWLRQ )LJ f 1R PRUH WKDQ DGGLWLYH UHVXOWV ZHUH REWDLQHG 7KXV WKHUH ZDV QR HYLGHQFH IRU WKH VHSDUDWLRQ RI HVVHQWLDO FRPSRQHQWV RQ WKH 5HDFWLYH5HG FROXPQ 3XULILFDWLRQ 6WHS *HO )LOWUDWLRQ &KURPDWRJUDSK\ RQ 6XSHUGH[ +3/& 7KH 5HDFWLYH5HG IUDFWLRQV ZHUH SRROHG DQG FRQFHQWUDWHG LQ D &HQWULSOXV FDUWULGJH 7KH FRQFHQWUDWHG HQ]\PH ZDV ORDGHG RQWR D 6XSHUGH[ +3/& JHO ILOWUDWLRQ FROXPQ '77 ZDV RPLWWHG DV D UHGXFLQJ DJHQW ZRXOG PRGLI\ WKH +JG803 6HSKDURVH UHVLQ WR EH XVHG LQ WKH QH[W VWHS RI SXULILFDWLRQ 2QO\ D VLQJOH SHDN RI HQ]\PH DFWLYLW\ ZDV IRXQG )LJ f ZLWK D UHFRYHU\ \LHOG RI b 7DEOH FRPSDUH OLQH DQG f 6LPLODU UHVXOWV ZHUH REWDLQHG IURP DQRWKHU H[SHULPHQW ZKLFK WKH UXQQLQJ EXIIHU DOVR FRQWDLQHG b 7ZHHQ %DVHG RQ FRPSDULVRQ WR WKH HOXWLRQ SRVLWLRQV RI JOREXODU SURWHLQV ZLWK NQRZQ PDVVHV WKH DSSDUHQW 0U RI WKH HQ]\PH ZDV HVWLPDWHG WR EH 7KH IUDFWLRQV RI 6XSHUGH[ SRRO ZHUH WHVWHG IRU DFWLYLW\ LQ WKH DEVHQFH RU SUHVHQFH RI YDULRXV FRQFHQWUDWLRQV RI '77 RU 0J&/ 7KH UHVXOWV VKRZHG WKDW *OF1$FWUDQVIHUDVH DFWLYLW\ ZDV DEVROXWHO\ GHSHQGHQW RQ '77 )LJ f ZLWK PD[LPXP DFWLYLW\ DW P0 '77 2YHU WKH UDQJH RI P0 P0 0J&/ \LHOGHG RSWLPDO DFWLYLW\ )LJ f ,QFRUSRUDWLRQ ZDV EORFNHG E\ P0 ('7$ )LJ f 7KH HQ]\PH DFWLYLW\ ZDV IRXQG WR EH XQVWDEOH XSRQ VWRUDJH DW r& )LJ f +RZHYHU LQFOXVLRQ RI b YYf 7ZHHQ RU 7ZHHQ SUHYHQWHG WKH ORVW RI DFWLYLW\ DQG LQ IDFW VWLPXODWHG DFWLYLW\ XS WR WZRIROG $OWKRXJK WKH RWKHU GHWHUJHQWV LQ WKLV WHVW FRXOG VWDELOL]H DFWLYLW\ WKH\ LQLWLDOO\ VXSSUHVVHG DFWLYLWLHV IRU XS WR b

PAGE 102

6XSHUGH[ SRRO 6 SKHQ\O6HS SRRO )LJXUH $[6 RU SKHQ\O6HSKDURVH IUDFWLRQ GLG QRW LQFUHDVH *OF1$F WUDQVIHUDVH DFWLYLW\ LQ WKH 5HDFWLYH5HG SXULILHG IUDFWLRQ 5HDFWLYH 5HG IUDFWLRQ ZDV DVVD\HG IRU *OF1$FWUDQVIHUDVH DFWLYLW\ LQ WKH DEVHQFH RU SUHVHQFH RI $[6 RU SKHQ\O6HSKDURVH IUDFWLRQ 1R PRUH WKDQ DGGLWLYH HIIHFWV RI 6, DQG SKHQ\O6HSKDURVH IUDFWLRQ ZHUH REWDLQHG

PAGE 103

0: VWDQGDUG N'Df ,, S 4 7 ? f§Lf§ fmmmmf U 9ROXPH POf )LJXUH 3XULILFDWLRQ RI *OF1$FWUDQVIHUDVH RQ D 6XSHUGH[ JHO ILOWUDWLRQ +3/& FROXPQ 7KH 5HDFWLYH 5HG HOXWHG IUDFWLRQV ZKLFK FRQWDLQHG *OF1$FWUDQVIHUDVH DFWLYLW\ ZHUH SRROHG FRQFHQWUDWHG LQ D &HQWULSOXV FDUWULGJH DQG IUDFWLRQDWHG RQ D 6XSHUGH[ +3/& FROXPQ $Q LVRFUDWLF UXQ ZLWK b 7ZHHQ LQ P0 +(3(6 1D2+ S+ f P0 0J&/ P0 ('7$ b JO\FHURO ZDV SHUIRUPHG DQG WKH IUDFWLRQV ZHUH WHVWHG IRU *OF1$FWUDQVIHUDVH DFWLYLW\ 7KH 0U ZDV FDOFXODWHG EDVHG RQ KRUVH VSOHHQ DSRIHUULWLQ f \HDVW DOFRKRO GHK\GURJHQDVH f ERYLQH VHUXP DOEXPLQ f DQG VR\EHDQ WU\SVLQ LQKLELWRU f

PAGE 104

'77 FRQFHQWUDWLRQ P0f )LJXUH 7KH *OF1$FWUDQVIHUDVH DFWLYLW\ LV GHSHQGHQW RQ '77 6XSHUGH[ SXULIHG HQ]\PH IUDFWLRQV ZHUH DVVD\HG IRU *OF1$FWUDQVIHUDVH DFWLYLW\ LQ WKH DEVHQFH RU SUHVHQFH RI YDULRXV FRQFHQWUDWLRQV RI '77 7KH HQ]\PH DFWLYLW\ DEVROXWHO\ UHTXLUHG '77 ZLWK WKH PD[LPXP DFWLYLW\ DW WKH '77 FRQFHQWUDWLRQ RI P0

PAGE 105

P0 0J&, P0 ('7$ FRQFHQWUDWLRQ P0f )LJXUH 7KH *OF1$FWUDQVIHUDVH DFWLYLW\ LV GHSHQGHQW RQ 0J&O 6XSHUGH[ SXULIHG HQ]\PH IUDFWLRQV ZHUH DVVD\HG IRU *OF1$FWUDQVIHUDVH DFWLYLW\ LQ WKH SUHVHQFH RI YDULRXV FRQFHQWUDWLRQ RI 0J&O 7KH ORZHVW 0J&O FRQFHQWUDWLRQ WHVWHG ZDV P0 GXH WR WKH SUHVHQFH RI 0J&O LQ HQ]\PH EXIIHU 7KH HQ]\PH DFWLYLW\ ZDV GHSHQGHQW RQ 0J&O ZLWK WKH PD[LPXP DFWLYLW\ DW WKH ILQDO 0J&O FRQFHQWUDWLRQ RI P0 ('7$ DW WKH FRQFHQWUDWLRQ RI P0 FRPSOHWHO\ LQKLELWHG WKH DFWLYLW\

PAGE 106

'HWHUJHQW b YYf )LJXUH 7KH HIIHFWV RI GHWHUJHQWV RQ *OF1$FWUDQVIHUDVH DFWLYLWLHV 7KH 6XSHUGH[ SXULILHG *OF1$FWUDQVIHUDVH SRRO ZDV VWRUHG DW r& LQ WKH DEVHQFH RU SUHVHQFH RI GLIIHUHQW NLQGV RI GHWHUJHQW DW b YY $W K DQG K DOLTXRWV RI HQ]\PHGHWHUJHQW PL[WXUH ZHUH WHVWHG IRU WKH *OF1$FWUDQVIHUDVH DFLWLYLW\ 7KH UHVXOWV VKRZHG WKDW HQ]\PH DFWLYLW\ ZDV VOLJKWO\ DFWLYDWHG LQ WKH SUHVHQFH RI 7ZHHQ RU 7ZHHQ DQG ZDV VWDELOL]HG IRU XS WR K

PAGE 107

7KH (IIHFWV RI 1XFOHRWLGH $QDORJXHV RQ *OF1$F7UDQVIHUDVH $FWLYLW\ 7R GHYHORS DQ DIILQLW\ SXULILFDWLRQ PHWKRG DQG D SKRWRSUREH IRU WKH HQ]\PH LW ZDV QHFHVVDU\ WR XQGHUVWDQG KRZ WKH HQ]\PH UHFRJQL]HG 8'3*OF1$F 7KH *OF1$F WUDQVIHUDVH DFWLYLW\ ZDV PHDVXUHG LQ WKH SUHVHQFH RI 8'3*OF1$F DQDORJXHV ZLWK VXEVWLWXWLRQ DW YDULRXV SRVLWLRQV 7KH 6XSHUGH[ SRRO ZDV DVVD\HG DV GHVFULEHG H[FHSW $73 ZDV RPLWWHG 7DEOH f ,Q WKH SUHVHQFH RI L0 8'3*OF1$F 803 8'3 873 WKLR803 %LR873 8'3*OF DQG XULGLQH VKRZHG FRQFHQWUDWLRQ GHSHQGHQW LQKLELWLRQ RI *OF1$FWUDQVIHUDVH DFWLYLW\ LQ WKH UDQJH RI P0 ,Q FRQWUDVW ffR LVRSURS\OLGHQHXULGLQH $73 DQG 8'3*DO1$F VKRZHG VWLPXODWRU\ HIIHFWV DW P0 ZLWK DSSDUHQW LQKLELWLRQ RFFXUULQJ RQO\ DW ,P0 8UDFLO VWLPXODWHG DFWLYLW\ DW ERWK FRQFHQWUDWLRQV G8'3 G803 8'3KH[DQRODPLQH DQG &73 KDG OLWWOH RU QR HIIHFW RYHU WKH WHVWHG FRQFHQWUDWLRQ UDQJH 7KHVH GDWD VXJJHVWHG WKDW WKH LQKLELWRU\ SRWHQWLDO RI 8'3*OF1$F DQDORJXHV ZDV GHFUHDVHG E\ VXEVWLWXWLRQV DW WKH fDQG f SRVLWLRQV RI ULERVH ffRLVRSURS\OLGHQH XULGLQH DQG GHR[\ 803f DQG QRQKRPRORJRXV VXEVWLWXWLRQV IRU *OF1$F 8'3 KH[DQRODPLQH 8'3*DO1$Ff )LJ f 7KH\ DOVR VXJJHVWHG WKDW WZR FRPPHUFLDOO\ DYDLODEOH UHVLQV 8'3KH[DQRODPLQH DQG 8'3DGLSDWH FRXOG EH LQHIIHFWLYH LQ FDSWXULQJ WKH *OF1$FWUDQVIHUDVH DFWLYLW\ ,Q FRQWUDVW HQ]\PH ELQGLQJ FRXOG WROHUDWH WKH PRGLILFDWLRQV DW WKH WKLR803f DQG %LR873f SRVLWLRQV RI XUDFLO JURXS 7KH UHDVRQ WKDW VRPH DQDORJXHV VWLPXODWHG DFWLYLW\ FRXOG EH H[SODLQHG E\ WKHLU FRPSHWLWLRQ ZLWK WKH VXEVWUDWH >+@8'3*F1$F LQ ELQGLQJ ZLWK VRPH QXFOHRWLGH ELQGLQJ IDFWRUV LQ WKH HQ]\PH SUHSDUDWLRQ

PAGE 108

7DEOH 5HODWLYH DFWLYLW\ RI WKH *OF1$FWUDQVIHUDVH LQ WKH SUHVHQFH RI GRQRU VXEVWUDWH DQDORJXHV 6XSHUGH[+3/&SXULILHG IUDFWLRQV ZHUH DVVD\HG DV GHVFULEHG EXW ZLWKRXW $73 LQ WKH SUHVHQFH RI 8'3>+@*F1$F IL0 6NSOFP\F DQG P0 P0 RU P0 QXFOHRWLGH DQDORJXHV ,QKLELWRU P0 P0 1RQH 803 8'3 873 WKLR803 %LR873 8'3*OF XULGLQH G803 $73 8'3*DO1$F f f RLVRSURS\ OLGHQHXULGLQH &73 8'3KH[DQRODPLQH G8'3 XUDFLO

PAGE 109

8'3KH[DQRODPLQH WKLRXULGLQH 8'3*DO1$F nnLVRSURS\OLGHQH XULGLQH )LJXUH 7KH FKHPLFDO VWUXFWXUH RI 8'3*OF1$F DQG WKH SRWHQWLDO HQ]\PH UHFRJQLWLRQ VLWHV WHVWHG E\ QXFOHRWLGH DQDORJXHV

PAGE 110

%DVHG RQ WKHVH GDWD DQ DIILQLW\ FROXPQ DQG D SKRWRDIILQLW\ SUREH ZHUH GHVLJQHG E\ PRGLI\LQJ WKH RU SRVLWLRQ RI WKH XUDFLO JURXS 3XULILFDWLRQ 6WHS +JG803 6HSKDURVH &KURPDWRJUDSK\ $ +JG803 UHVLQ ZDV V\QWKHVL]HG WR EH XVHG DV D SUHFROXPQ LQ DQ DWWHPSW WR FDSWXUH RWKHU QXFOHRWLGH ELQGLQJ SURWHLQV 7KH V\QWKHVLV RI +JG803 6HSKDURVH ZDV SHUIRUPHG LQ WZR VWHSV PHUFXUDWLRQ DW WKH SRVLWLRQ RI XULGLQH DQG FRXSOLQJ WKH +J PRLHW\ WR WKH VXOIXU JURXS RQ 7KLRSURS\O 6HSKDURVH )LJ f 7KH \LHOG RI PHUFXUDWLRQ PHDVXUHG E\ WKH VKLIW RI DEVRUEDQFH VSHFWUXP IURP QP WR ZDV DERXW b $IWHU WKH FRXSOLQJ UHDFWLRQ WKH OLJDQG FRQFHQWUDWLRQ SHU PO RI 6HSKDURVH ZDV DERXW SPROPO 6LQFH WKH +J6 ERQG LV VHQVLWLYH WR UHGXFLQJ UHDJHQWV WKH SUHYLRXV 6XSHUGH[ SXULILFDWLRQ VWHS ZDV SHUIRUPHG ZLWK '77IUHH EXIIHU 6XSHUGH[ SXULILHG IUDFWLRQV FRQWDLQLQJ *OF1$FWUDQVIHUDVH DFWLYLWLHV ZHUH SRROHG DQG ORDGHG RQ WR D +JG803 FROXPQ *OF1$FWUDQVIHUDVH DFWLYLW\ ZDV UHFRYHUHG LQ WKH IORZWKURXJK ZLWK b \LHOG 7DEOH FRPSDUH OLQH DQG f $IWHU SXULILFDWLRQ RYHU WKH G803 FROXPQ WKH VWLPXODWLRQ E\ XUDFLO IRXQG LQ 6XSHUGH[ SXULILHG HQ]\PH ZDV UHGXFHG IURP b WR b )LJ f 7KHVH GDWD VXJJHVWHG WKDW RWKHU SURWHLQV ZKLFK ELQG 8'3*OF1$F LQ WKH DVVD\ ZHUH VXFFHVVIXOO\ UHPRYHG 7KH +JG803 IORZWKURXJK IUDFWLRQ ZDV WHVWHG IRU *OF1$FWUDQVIHUDVH DFWLYLW\ RYHU D WLPH FRXUVH )LJ f $Q DFFXPXODWLRQ RI WKH UHDFWLRQ SURGXFW >+@*F1$F 6NSOFP\F ZDV IRXQG IRU XS WR K $Q LQLWLDO ODJ SKDVH RI PLQ ZDV REVHUYHG

PAGE 111

+2 2+ + )LJXUH 7KH VWUXFWXUH RI +JG8036HSKDURVH %

PAGE 112

Â’ 6XSHUGH[ SXULILHG Â’ G803 SXULILHG 8UDFLO FRQFHQWUDWLRQ P0f )LJXUH &RPSDUDWLYH HIIHFWV RI XUDFLO RQ 6XSHUGH[ SXULIHG DQG G803 6HSKDURVH SXULILHG *OF1$FWUDQVIHUDVH 6XSHUGH[ SXULILHG IUDFWLRQV DQG G803 6HSKDURVH IORZWKURXJK IUDFWLRQV ZHUH DVVD\HG IRU *OF1$FWUDQVIHUDVH DFWLYLW\ LQ WKH SUHVHQFH RI DQG P0 XUDFLO 7KH DFWLYDWLRQ HIIHFW RI XUDFLO IRXQG LQ WKH 6XSHUGH[ SXULILHG HQ]\PH ZDV GLPLQLVKHG DIWHU WKH HQ]\PH ZDV SXULILHG RYHU WKH +JG803 WKLRSURS\O 6HSKDURVH FROXPQ 7KH HQ]\PH DFWLYLW\ LQ G803 IORZWKURXJK ZDV VLPLODU WR WKDW RI 6XSHUGH[ SXULILHG IUDFWLRQ DIWHU VWLPXODWLRQ ZLWK XUDFLO VXJJHVWLQJ WKDW WKH G803 FROXPQ KDG FDSWXUHG RWKHU QRQVSHFLILF 8'3*OF1$F ELQGLQJ IDFWRUV

PAGE 113

7LPH PLQf )LJXUH 7LPH FRXUVH DQDO\VLV RI *OF1$FWUDQVIHUDVH DFWLYLW\ 7KH G803 IORZWKURXJK IUDFWLRQV ZHUH DVVD\HG IRU *OF1$FWUDQVIHUDVH DFWLYLW\ 7KH UHDFWLRQV ZHUH LQFXEDWHG DW r& IRU XS WR K 7KH SORW RI HQ]\PH DFWLYLW\ YV WLPH KDG D VLJPRLGDO FKDUDFWHULVWLF ZLWK DQ LQLWLDO ODJ SKDVH RI PLQ

PAGE 114

VXJJHVWLQJ WKH WLPH IRU WKH HQ]\PHVXEVWUDWH FRPSOH[ WR EH IRUPHG $Q LQFXEDWLRQ WLPH RI K ZDV FKRVHQ IRU VXEVHTXHQW NLQHWLF VWXGLHV 3XULILFDWLRQ 6WHS $IILQLW\ &KURPDWRJUDSK\ RQ DPLQRDOO\Of8'3*OF1$F 6HSKDURVH )DVW)ORZ 7KH SUHSDUDWLRQ RI DQ DIILQLW\ FROXPQ IRU WKH *OF1$FWUDQVIHUDVH VWDUWHG ZLWK WKH V\QWKHVLV RI +J8'3*OF1$F 7KH \LHOG RI PHUFXUDWLRQ ZDV DERXW b ,Q WKH VHFRQG VWHS WKH +JJURXS ZDV UHSODFHG E\ DOO\ ODPLQH ZLWK b \LHOG 7KH GHVLUHG SURGXFW DPLQRfDOO\O8'3*OF1$F KDV SUHYLRXVO\ EHHQ VKRZQ WR KDYH DEVRUEDQFH PD[LPXP DW DQG DQG PLQLPXP DW QP =HQJ HW DO W\SLFDO IRU D FRPSRXQG ZLWK DQ H[RF\FOLF GRXEOH ERQG ZLWK D S\ULPLGLQH ULQJ 7KH UHDFWLRQ SURGXFWV ZHUH DSSOLHG RYHU D '($()DVW )ORZ FROXPQ 7KUHH 89 DEVRUELQJ SHDNV ZHUH HOXWHG )LJ f 3HDN $ VKRZHG DQ DEVRUEDQFH SURILOH FKDUDFWHULVWLF RI DPLQRfDOO\O8'3*OF1$F ZKHUHDV SHDN & VKRZHG DQ DEVRUEDQFH PD[LPXP DW QP DQG ZDV PRVW OLNHO\ UHVLGXDO 8'3*OF1$F ,Q D VHSDUDWH H[SHULPHQW SHDN SUREDEO\ WKH XQUHDFWHG +J8'3 *OF1$F ZLWK DQ DEVRUEDQFH PD[LPXP DW QP DOVR DSSHDUHG 3XULILHG DPLQRfDOO\O8'3*OF1$F ZDV GULHG XQGHU YDFXXP FHQWULIXJDWLRQ DQG UHGLVVROYHG LQ DQK\GURXV GLPHWK\OIRUPDPLGH '0)f 7KHQ WKH S+ RI WKH VROXWLRQ ZDV DGMXVWHG WR ZLWK 7($ 7KH FRXSOLQJ UHDFWLRQ ZDV SHUIRUPHG E\ DF\ODWLRQ RI WKH WHUPLQDO 1+ JURXS ZLWK 1+6 DFWLYDWHG 6HSKDURVH LQ '0) )LJ f 7KH FRQFHQWUDWLRQ RI DPLQRfDOO\O8'3*OF1$F FDOFXODWHG IURP WKH GHFUHDVH RI $ ZDV DERXW SPROPO JHO 7KH +JG8036HSKDURVH IORZWKURXJK ZDV FRQFHQWUDWHG LQ D &HQWULSOXV FRQFHQWUDWRU DSSOLHG WR D DPLQRfDOO\O8'3*OF1$F6HSKDURVH FROXPQ DQG HOXWHG

PAGE 115

7($% S+ P0 9ROXPH POf ZDYHOHQJWK VFDQ )LJXUH &KURPDWRJUDSK\ RI WKH UHDFWLRQ SURGXFWV IURP DPLQRDOO\Of8'3 *OF1$F V\QWKHVLV DIWHU SXULILFDWLRQ RYHU D '($( 6HSKDURVH )DVW )ORZ FROXPQ 7KH UHDFWLRQ PL[WXUH ZDV GLOXWHG WLPHV ZLWK ZDWHU DQG DSSOLHG RQWR D '($( 6HSKDURVH IDVWIORZ FROXPQ $IWHU WKRURXJK ZDVKLQJ ZLWK ZDWHU ERXQG QXFOHRWLGHV ZHUH HOXWHG ZLWK D WR P0 JUDGLHQW RI 7($% S+ 7KH 89 VSHFWUD RI HOXWHG SHDN $ DQG SHDN & ZHUH FRPSDWLEOH ZLWK DPLQRDOO\Of8'3*OF1$F DQG 8'3*OF1$F UHVSHFWLYHO\ ZKHUHDV WKDW RI SHDN % ZDV XQLGHQWLILHG 3HDN ZLWK D 89 VSHFWUXP FKDUDFWHULVWLF RI +J8'3*OF1$F ZDV UHFRYHUHG ZLWK YDULDEOH \LHOG

PAGE 116

FKRK +1$F 2 2 ,, LL V 3232&+ 2+ 2+ 1+f§2[$$A+1 2 6HSKDURVH ODVW IORZ 2+ 2+ )LJXUH 7KH VWUXFWXUH RI DPLQRDOO\Of8'3*OF1$F 6HSKDURVH

PAGE 117

ZLWK DQ DVFHQGLQJ JUDGLHQW RI 803 WR P0 )LJ f (OXWHG IUDFWLRQV ZHUH GHVDOWHG LQ 0LFURFRQ FRQFHQWUDWRUV DQG WHVWHG IRU *OF1$FWUDQVIHUDVH DFWLYLW\ 7R UHPRYH 803 WKH HQ]\PH IUDFWLRQV FRQWDLQLQJ DFWLYLW\ ZHUH SRROHG FRQFHQWUDWHG LQ D 0LFURFRQ FRQFHQWUDWRU DQG GHVDOWHG RQ D )DVW 'HVDOWLQJ 3& FROXPQ 6PDUW V\VWHPf 7KH SXULILHG IUDFWLRQV ZLWK b UHFRYHU\ \LHOG ZHUH SRROHG DQG XVHG IRU WKH WHVW RI NLQHWLF SURSHUWLHV DQG SKRWRDIIPLW\ ODEHOLQJ 7KH HVWLPDWHG SXULILFDWLRQ IROG ZDV [ ZLWK WKH ILQDO \LHOG RI b 7DEOH f &KDUDFWHULVWLFV RI WKH $FFHSWRU 6XEVWUDWH 3URGXFW :KHQ LQ YLYR ODEHOHG >+@IXFRVH6NSO ZDV VXEMHFWHG WR UHGXFWLYH DONDOLQH GHJUDGDWLRQ D UDGLRODEHOHG SURGXFW ZDV IRUPHG ZKLFK KDG D FKDUJH RI DW S+ *RQ]DOHV+@*OF1$F6NSO ZDV SHUIRUPHG 7KH UHVXOW VKRZHG WKDW b RI WKH LQ YLWUR UDGLRDFWLYH SURGXFW ERXQG WR 'RZH[ UHVLQ DW S+ FRPSDUHG WR b ELQGLQJ RI WKH LQ YLYR ODEHOHG SURGXFW 7KHVH GDWD VXJJHVWHG WKDW WKH *OF1$F ZDV QRW OLQNHG WR 6HU RU 7KU VLQFH WKH H[SHFWHG UHDFWLRQ SURGXFW 1DFHW\O JOXFRVDPLQLWRO *OF1$FROf ZKLFK KDYH QHXWUDO FKDUJH ZRXOG QRW UHWDLQ LQ 'RZH[ UHVLQ ,Q FRQWUDVW WKH *OF1$F+\3UR OLQNDJH ZDV VHQVLWLYH WR DFLG K\GURO\VLV *HO VOLFHV FRQWDLQLQJ >+@*OF1$F6NSO IURP WKH LQ YLWUR DVVD\ RI SXULILHG *OF1$F WUDQVIHUDVH IUDFWLRQ ZHUH WUHDWHG ZLWK 0 7)$ IRU K DW r& 7ZHQW\ SHUFHQW RI WKH

PAGE 118

)LJXUH 3XULILFDWLRQ RI *OF1$FWUDQVIHUDVH DFWLYLW\ RQ DPLQRDOO\Of8'3 *OF1$F 6HSKDURVH 7KH G8036HSKDURVH IORZWKURXJK ZDV FRQFHQWUDWHG DQG DSSOLHG WR D DPLQRDOO\Of8'3*OF1$F 6HSKDURVH +3/& FROXPQ 7KH HQ]\PH DFWLYLW\ ZDV HOXWHG ZLWK D P0 803 JUDGLHQW (OXWHG IUDFWLRQV ZHUH GHVDOWHG LQ 0LFURFRQ FDUWULGJHV DQG WHVWHG IRU *OF1$FWUDQVIHUDVH DFWLYLW\

PAGE 119

WRWDO UDGLRDFWLYLW\ HOXWHG IURP WKH JHO ZDV ZDV FRFKURPDWRJUDSKHG ZLWK JOXFRVDPLQH *,&1+f RQ D 'LRQH[ 3$ +3/& FROXPQ )LJ f 7KHVH GDWD VXJJHVWHG WKDW LQFRUSRUDWHG UDGLRDFWLYLW\ ZDV *OF1$F VLQFH DFLG K\GURO\VLV ZRXOG EH H[SHFWHG WR GH1 DFHW\ODWH *OF1$F $FLG K\GURO\VLV ZLWK 0 +& IRU K DW r& JDYH VLPLODU UHVXOWV ZLWK RQO\ b UHFRYHU\ GDWD QRW VKRZQf VXJJHVWLQJ GHFRPSRVLWLRQ RI > +M*OF1+K E\ VWURQJ DFLG WUHDWPHQW 7R FRQILUP WKDW WKH >+@*F1$F ZDV DWWDFKHG RQWR WKH K\GUR[\SUROLQH V\QWKHWLF 6NSOSHSWLGH ZLWK K\GUR[\SUROLQH DW SRVLWLRQ DQG 6NSOSHSWLGH ZLWK 3UR DW WKLV SRVLWLRQ ZHUH WHVWHG DV DFFHSWRU VXEVWUDWHV 7KH UHVXOW VKRZHG WKDW RQO\ K\GUR[\SUROLQH SHSWLGH ZDV XWLOL]HG DV D VXEVWUDWH )LJ f /LNHZLVH UHFRPELQDQW 6NSO 6NSO+LVf LQ ZKLFK 3UR ZDV QRW K\GUR[\ODWHG IDLOHG WR JHW >+@*F1$F LQFRUSRUDWLRQ )LJ f ,QFUHDVLQJ WKH WKH DPRXQW RI HQ]\PH E\ IROG UHVXOWHG LQ b LQFUHDVH RI LQFRUSRUDWLRQ .LQHWLF 3URSHUWLHV RI WKH 6NSO*,F1$F7UDQVIHUDVH 7KH DIILQLW\ SXULILHG *OF1$FWUDQVIHUDVH DFWLYLW\ ZDV LQFXEDWHG ZLWK YDULRXV FRQFHQWUDWLRQV RI WKH +\ 3URSHSWLGH )LJ f 6NSOFP\F )LJ f DQG 8'3 >+@*F1$F )LJ f 7KH NLQHWLFV RI WKH DFWLYLW\ ZLWK UHVSHFW WR HDFK VXEVWUDWH ZDV REH\HG WR WKH 0LFKDHOLV0HQWHQ PRGHO DV VKRZQ E\ WKH OLQHDU IRUP RI WKH /LQHZHDYHU %XUN GRXEOH UHFLSURFDO SORWV 7KH OLQHDU UHJUHVVLRQ DQDO\VHV RI WKH GRXEOH UHFLSURFDO SORWV ZHUH ILWWHG WR VWUDLJKW OLQHV ZLWK U IRU +\ 3URSHSWLGH U IRU 6NSOFP\F DQG U IRU 8'3>+@*F1$F

PAGE 120

)LJXUH +LJKS+ DQLRQH[FKDQJH FKURPDWRJUDSK\ RI WKH DFLG K\GURO\VLV GHULYDWLYHV RI >+@*OF1$F6NSO *OF1DF WUDQVIHUDVH DVVD\ RI DIILQLW\ SXULILHG HQ]\PH ZDV SHUIRUPHG DV GHVFULEHG 7KH JHO VOLFH FRQWDLQLQJ >+@ODEHOHG 6NSOFP\F ZDV ULQVHG ZLWK SP ILOWHUHG ZDWHU DQG K\GURO\]HG LQ 0 7)$ DW r& IRU K 7KH VROXEOH SDUW ZDV GULHG XQGHU YDFXXP FHQWULIXJDWLRQ DQG ULQVHG ZLWK PHWKDQRO WZLFH 7KH UDGLRDFWLYH SURGXFW ZDV GLVVROYHG LQ SL RI SP ILOWHUHG ZDWHU FRQWDLQLQJ QPRO RI *F1+ DQG IUDFWLRQDWHG RQ D 'LRQH[3$+3/& FROXPQ $ $Q DPSHURPHWULF SURILOH RI VWDQGDUG VXJDUV % 7KH DPSHURPHWULF SURILOH RI WKH VDPSOH VKRZV WKH UHWHQWLRQ WLPH RI LQWHUQDO VWDQGDUG *OF17% & b RI WKH ORDGLQJ UDGLRDFWLYLW\ ZDV FRFKURPDWRJUDSKHG ZLWK *F1+

PAGE 121

6 )LJXUH .LQHWLF SURSHUWLHV RI WKH *OF1$FWUDQVIHUDVH ZLWK UHVSHFW WR WKH +\3UR SHSWLGH $ 7KH DIILQLW\ SXULILHG *OF1$FWUDQVIHUDVH ZDV LQFXEDWHG ZLWK YDULRXV FRQFHQWUDWLRQV RI 6NSO SHSWLGH LQ WKH SUHVHQFH RI _L0 8'3>+@*F1$F IRU OK 7KH DVVD\V ZHUH SHUIRUPHG LQ GXSOLFDWH % 'RXEOHUHFLSURFDO SORW RI WKH GDWD ZDV DSSUR[LPDWHG E\ D VWUDLJKW OLQH \ [ U f 7KH DSSDUHQW .P DQG 9PD[ RI WKH HQ]\PH IRU +\3URSHSWLGH ZDV P0 DQG SPROKPJ SURWHLQ UHVSHFWLYHO\ 3URSHSWLGH V\QWKHWLF 6NSO SHSWLGH +\3URSHSWLGH V\QWKHWLF 6NSO SHSWLGH ZLWK D K\GUR[\O JURXS DW WKH SRVLWLRQ RI 3UR

PAGE 122

6 )LJXUH .LQHWLF SURSHUWLHV RI WKH *OF1$FWUDQVIHUDVH ZLWK UHVSHFW WR 6NSOF P\F $ 7KH DIILQLW\ SXULILHG *OF1$FWUDQVIHUDVH SRRO ZDV LQFXEDWHG IRU K ZLWK YDULRXV FRQFHQWUDWLRQV RI 6NSOFP\F RU >L0 UHFRPELQDQW 6NSO 6NSO+LVf LQ WKH SUHVHQFH RI L0 8'3>+@*F1$F % 'RXEOHUHFLSURFDO SORW RI WKH GDWD LV ILWWHG WR D VWUDLJKW OLQH \ [ U f 7KH DSSDUHQW .P DQG 9PD[ RI WKH HQ]\PH IRU 6NSOFP\F ZDV _L0 DQG SPROKPJ SURWHLQ UHVSHFWLYHO\

PAGE 123

6 )LJXUH .LQHWLF SURSHUWLHV RI WKH *OF1$FWUDQVIHUDVH ZLWK UHVSHFW WR 8'3 *OF1$F $ 7KH DIILQLW\ SXULILHG *OF1$FWUDQVIHUDVH SRRO ZDV LQFXEDWHG IRU K ZLWK YDULRXV FRQFHQWUDWLRQV RI 8'3>+@*OF1$F LQ WKH SUHVHQFH RI ML0 6NSOFP\F7KH DVVD\V ZHUH SHUIRUPHG LQ GXSOLFDWH % 'RXEOHUHFLSURFDO SORW RI WKH GDWD LV ILWWHG WR D VWUDLJKW OLQH \ 222O[ U f 7KH DSSDUHQW .P DQG 9PD[ RI WKH HQ]\PH IRU 8'3*OF1$F ZDV L0 DQG SPROKPJ SURWHLQ UHVSHFWLYHO\

PAGE 124

7KH HVWLPDWHG .P RI WKH HQ]\PH ZLWK UHVSHFW WR WKH V\QWKHWLF SHSWLGH ZDV P0 ZLWK UHVSHFW WR 6NSOFP\F ZDV L0 DQG ZLWK UHVSHFW WR 8'3*OF1$F ZDV -0 7KH .P IRU 6NSOFP\F ZDV DQ XSSHU HVWLPDWH VLQFH QRW DOO 6NSOFP\F ZDV WKH WUXH VXEVWUDWH 7KH HVWLPDWHG 9PD[ RI WKH HQ]\PH ZLWK UHVSHFW WR WKH V\QWKHWLF SHSWLGH ZDV SPROKPJ ZLWK UHVSHFW WR 6NSOFP\F ZDV SPROKPJ DQG ZLWK UHVSHFW WR 8'3*OF1$F ZDV SPROKPJ 7KH KLJKHU 9PD[ IRU 6NSOFP\F FRPSDUHG WR WKDW RI 8'3*OF1$F FRXOG EH H[SODLQHG E\ WKH GLIIHUHQFH EHWZHHQ WKH UHODWLYH FRQFHQWUDWLRQ RI HDFK VXEVWUDWH WR LWV .P 7KH 8'3*OF1$F FRQFHQWUDWLRQ LQ WKH 6NSOF P\F VWXG\ ZDV [ .P ZKHUHDV WKH 6NSOFP\F FRQFHQWUDWLRQ LQ WKH 8'3*OF1$F VWXG\ ZDV RQO\ [ .P 'LVFXVVLRQ ,Q WKLV VWXG\ D 6NSO*OF1$FWUDQVIHUDVH ZDV SXULILHG IURP 6, IUDFWLRQ RI WKH RYHUH[SUHVVLRQ VWUDLQ +: $Q DVVD\ GHYHORSHG IRU 6NSO*OF1$FWUDQVIHUDVH ZDV EDVHG RQ WKH WUDQVIHU RI >+@*OF1$F IURP D GRQRU VXEVWUDWH 8'3>+@*OF1$F RQWR DFFHSWRU VXEVWUDWHV HLWKHU XQGHUJO\FRV\ODWHG 6NSOFP\F LVRODWHG IURP D 'LFW\RVWHOLXP RYHUH[SUHVVLRQ VWUDLQ RU D V\QWKHWLF 6NSO SHSWLGH ,Q WKH SUHVHQFH RI 6NSOFP\F DQ LQFUHDVH LQ WKH LQFRUSRUDWHG UDGLRDFWLYLW\ ZDV IRXQG LQ WKH 6 IUDFWLRQ EXW QRW LQ WKH GHWHUJHQW WUHDWHG RU XQWUHDWHG 3, SDUWLFXODWH IUDFWLRQ 7KH UHFRPELQDQW6NSO LVRODWHG IURP DQ ( FROL H[SUHVVLRQ VWUDLQ DQG WKH V\QWKHWLF SHSWLGH FRQWDLQLQJ 3UR LQ SODFH RI +\3UR IDLOHG WR DFWLYDWH WKH DFWLYLW\ 7KH LQFRUSRUDWLRQ RI >+@*OF1$F LQWR 6, IUDFWLRQ IURP ERWK $[ DQG +: VWUDLQ ZDV IRXQG LQ PXOWLSOH UHJLRQV RI WKH JHO LQGLFDWLQJ >+@LQFRUSRUDWLRQ LQ PXOWLSOH

PAGE 125

,OO SURWHLQV 7KHVH SURWHLQV PD\ EH 2*OF1$F SURWHLQV VLQFH WKH 2*OF1$FWUDQVIHUDVH UHVSRQVLEOH IRU DGGLQJ D VLQJOH *OF1$F RQWR 6HU RU 7KU UHVLGXHV RI PDQ\ QXFOHDU DQG F\WRSODVPLF SURWHLQV UHVLGHV LQ WKH 6, IUDFWLRQ DV ZHOO +RZHYHU LQ 6, IUDFWLRQ IURP +: VWUDLQ WKH N'D UHJLRQ VKRZHG KLJKHU LQFRUSRUDWLRQ WKDQ WKH UHVW RI WKH JHO GXH WR WKH SUHVHQFH RI HQGRJHQRXV XQJO\FRV\ODWHG 6NSOFP\F ,Q RUGHU WR DFKLHYH KLJKO\ SXULILHG HQ]\PH DIILQLW\ FKRPDWRJUDSK\ ZDV SHUIRUPHG RQ DPLQRDOO\Of8'3*OF1$F 6HSKDURVH IDVWIORZ 7KH 8'3*OF1$F UHVLQ ZDV V\QWKHVL]HG E\ D QRYHO PHWKRG ZKLFK LQYROYHG WKH FRXSOLQJ RI DPLQRDOO\O 8'3*OF1$F WR 1+6DFWLYDWHG 6HSKDURVH LQ WKH RUJDQLF VROYHQW GLPHWK\OIRUPDPLGH ,QLWLDOO\ +J8'3*OF1$F 6HSKDURVH ZDV VHOHFWHG DV DQ DIILQLW\ FROXPQ +J8'3 *OF1$F ZDV V\QWKHVL]HG DQG FRXSOHG WR 7KLRSURS\O 6HSKDURVH LQ D VLPLODU PDQQHU WR WKRVH RI +JG8036HSKDURVH 7KH OLJDQG FRQFHQWUDWLRQ RI +J8'3*OF1$F ZDV DERXW SPROPO ZKLFK ZDV KLJKHU WKDQ WKDW RI DPLQRDOO\Of8'3*OF1$F 6HSKDURVH _LPROPOf 2QO\ b RI WKH HQ]\PH DFWLYLW\ ZDV DEOH WR ELQG WR +J8'3 *OF1$F 6HSKDURVH HYHQ WKRXJK ERWK +JG8036HSKDURVH DQG DPLQRDOO\O8'3 *OF1$F 6HSKDURVH KDG 8'3*OF1$F DV D OLJDQG ZLWK WKH VDPH VSDFHU DWWDFKPHQW VLWH 7KH ILQGLQJ WKDW WKH HQ]\PH DFWLYLW\ ZDV ERXQG PRUH HIIHFWLYHO\ WR DPLQRDOO\O8'3 *OF1$F 6HSKDURVH FDQ EH H[SODLQHG E\ UHDVRQV )LUVW WKH VSDFHU DUP RI DPLQRDOO\O 8'3*OF1$F LV ORQJHU WKDQ WKDW RI +J8'3*OF1$F DQG SHUPLWV PRUH IUHHGRP IRU 8'3*OF1$F WR LQWHUDFW ZLWK WKH DFWLYH VLWH RQ WKH HQ]\PH 6HFRQG SXULILFDWLRQ RI WKH HQ]\PH RYHU WKH +J8'3*OF1$F 6HSKDURVH UHTXLUHV '77 IUHH EXIIHU ZKLFK FRXOG DIIHFW VXEVWUDWH ELQGLQJ

PAGE 126

,Q WKH ILQDO SUHSDUDWLRQ WKH ; IROG RI HQ]\PH SXULILFDWLRQ ZDV DFKLHYHG KRZHYHU WKH \LHOG ZDV RQO\ b 0RVW RI WKH DFWLYLW\ ORVW RFFXUUHG GXULQJ WKH VWHS RI 5HDFWLYH5HG SXULILFDWLRQ 6LQFH ZH FRXOG QRW ILQG HYLGHQFH RI RWKHU VXEXQLWV ORVV WKH ORZ SXULILFDWLRQ \LHOG PLJKW EH GXH WR WHFKQLFDO SUREOHPV +RZHYHU LQ DQRWKHU 5HDFWLYH5HG SXULILFDWLRQ H[SHULPHQW ZLWK D VPDOOHU DPRXQW RI ORDGLQJ VDPSOH PRVW RI WKH HQ]\PH DFWLYLW\ FRXOG EH UHFRYHUHG E\ HOXWLQJ WKH UHVLQ ZLWK 0 1D&O GDWD QRW VKRZQf 7KH VSHFLILFLW\ RI WKH HQ]\PH IRU 6NSO ZDV VXSSRUWHG E\ WKH ILQGLQJV WKDW DQWL 6NSOP$E DQG D V\QWKHWLF SHSWLGH ZLWK DPLQR DFLG VHTXHQFHV FRUUHVSRQGLQJ WR DPLQR DFLG UHVLGXHV RI 'LFW\RVWHOLXP 6NSO LQKLELWHG WKH LQFRUSRUDWLRQ LQWR 6NSO EXW QRW RWKHU SURWHLQV 7KH UHDVRQV WKDW UHFRPELQDQW 6NSO DQG 3HSWLGH ZLWK 3UR LQ SODFH RI +\3UR GLG QRW VWLPXODWH WKH DFWLYLW\ LQGLFDWHG WKDW WKH HQ]\PH UHTXLUHG SUROLQH K\GUR[\ODWLRQ IRU WKH DWWDFKPHQW VLWH RI *OF1$F 0RUHRYHU WKH ILQGLQJ WKDW WKH UHGXFWLYH DONDOLQH GHJUDGDWLRQ RI >+@*OF1$F6NSO SUHGRPLQDQWO\ \LHOGHG D FKDUJHG LQVWHDG RI QHXWUDO UDGLRDFWLYH GHULYDWLYH VWURQJO\ VXSSRUWHG WKLV QRYHO W\SH RI JO\FRVLGLFSHSWLGH OLQNDJH VLQFH +\3UR*OF1$F LV H[SHFWHG WR EH DONDOL UHVLVWDQW ,I *OF1$F ZDV DWWDFKHG WR 6HU RU 7KU LQVWHDG RI +\3UR WKH UHGXFWLYH DONDOLQH GHJUDGDWLRQ ZRXOG EH H[SHFWHG WR JHQHUDWH D QHXWUDO FKDUJHG UDGLRDFWLYH 1DFHW\O JOXFRVDPLQLWRO ZKLFK ZRXOG QRW EH UHWDLQHG E\ WKH 'RZH[ UHVLQ 7KH UDGLRDFWLYH VSHFLHV HOXWHG IURP >+@*OF1$F6NSO FRXOG EH D FKDUJHG SHSWLGH UHOHDVHG E\ WKH NQRZQ HIIHFW RI DONDOL WUHDWPHQW 7KH HVWLPDWHG .P RI WKH HQ]\PH IRU 6NSOFP\F LV DQ XSSHU OLPLW VLQFH WKH SHUFHQWDJH RI WKH WUXH VXEVWUDWH WKH K\GUR[\ ODWHGXQJO\FRV\ODWHG 6NSOFP\F LV QRW

PAGE 127

NQRZQ 6LQFH WKH VXJDU FRPSRVLWLRQ DQDO\VLV RI 6NSOFP\F VXJJHVWHG WKDW RQHVL[WK RI WKH SURWHLQ LV D FRPSOHWH JO\FRV\ODWHG IRUP 7HQJXPQXD\ HW DO f WKH DSSUR[LPDWH .P LQ UHVSHFW WR 6NSOFP\F VKRXOG EH ORZHU WKDQ S0 +LJKHU FRQFHQWUDWLRQ RI H[RJHQRXV 6NSOFP\F UHVXOWHG LQ GHFUHDVHG LQFRUSRUDWLRQ )LJ DQG f ZKLFK FDQ EH H[SODLQHG E\ WKH IHHGEDFN LQKLELWLRQ RI PRUH FRPSOHWHG JO\FRIRUPV SUHVHQWHG LQ 6NSOFP\F 2Q WKH RWKHU KDQG WKH .P RI WKH HQ]\PH IRU WKH SHSWLGH VXEVWUDWH LV PXFK KLJKHU P0f DQG WKH 9PD[ LV ORZHU WKDQ WKRVH RI 6NSOFP\F LQGLFDWLQJ WKH LPSRUWDQFH RI WHUWLDU\ VWUXFWXUH RI WKH SURWHLQ IRU HQ]\PH UHFRJQLWLRQ 7KH VXEPLFURPRODU .P RI WKH HQ]\PH IRU 8'3*OF1$F S0f LV ORZ LQ FRPSDULVRQ WR WKRVH RI RWKHU *OF1$FWUDQVIHUDVH HQ]\PHV RI WKH VHFUHWRU\ SDWKZD\ ZKLFK UDQJH IURP S0 %DR HW DO f WR P0 %HQGLDN DQG 6FKDFKWHU f 7KH KLJK DIILQLW\ IRU QXFOHRWLGH VXJDU LPSOLHV WKH F\WRVROLF FRPSDUWPHQWDWLRQ RI WKH HQ]\PH 7KH FRQFHQWUDWLRQ RI QXFOHRWLGH VXJDU LQ WKH F\WRSODVP LV EHOLHYHG WR EH ORZHU WKDQ WKDW RI WKH VHFUHWRU\ SDWKZD\ GXH WR WKH SUHVHQFH RI WKH QXFOHRWLGHVXJDUWUDQVSRUWHU DQG WKH ODUJHU YROXPH RI WKH F\WRSODVP *O\FRV\OWUDQVIHUDVHV ZKLFK IXQFWLRQ LQ WKH F\WRSODVP QHHG WR KDYH D KLJK DIILQLW\ IRU WKHLU QXFOHRWLGH VXJDUV 7KLV K\SRWKHVLV KDV EHHQ SURYHG WR EH WUXH IRU WKH 6NSOIXFRV\OWUDQVIHUDVH .P S0 IRU *'3IXFRVHf DQG WKH 2*OF1$FWUDQVIHUDVH .P S0 IRU 8'3*OF1$Ff

PAGE 128

&+$37(5 6800$5< $1' 3(563(&7,9(6 6WUXFWXUH DQG %LRJHQHVLV RI D 6NSO*O\FDQ 'LFW\RVWHOLXP 6NSO &RQWDLQV D 1RYHO 3HQWDVDFFKDULGH /LQNHG WR +\GUR[\SUROLQH 6NSO LV LQYROYHG LQ WKH XELTXLWLQDWLRQ RI FHUWDLQ FHOO F\FOH DQG QXWULWLRQDO UHJXODWRU\ SURWHLQV IRU UDSLG WXUQRYHU ,Q 'LFW\RVWHOLXP 6NSO LV D JO\FRSURWHLQ ZLWKLQ WKH F\WRSODVPLF FRPSDUWPHQW DQG KDV EHHQ NQRZQ WR EH PRGLILHG E\ DQ ROLJRVDFFKDULGH FRQWDLQLQJ )XF DQG *DO .R]DURY HW DO f ZKLFK LV XQXVXDO IRU D F\WRSODVPLF RU QXFOHDU SURWHLQ 7R HVWDEOLVK KRZ LW LV JO\FRV\ODWHG 6NSO ODEHOHG ZLWK >+@)XF ZDV SXULILHG WR KRPRJHQHLW\ DQG GLJHVWHG ZLWK HQGR/\V& $ VLQJOH UDGLRDFWLYH SHSWLGH ZDV IRXQG DIWHU GLPHQVLRQDO +3/& $QDO\VLV LQ D 472) PDVV VSHFWURPHWHU UHYHDOHG D SUHGRPLQDQW LRQ ZLWK D QRYHO PDVV 0606 DQDO\VLV \LHOGHG D VHW RI GDXJKWHU LRQV ZKLFK LGHQWLILHG WKH SHSWLGH DQG VKRZHG WKDW LW ZDV PRGLILHG DW 3UR $ VHFRQG VHULHV RI GDXJKWHU LRQV VKRZHG WKDW 3UR ZDV K\GUR[\ODWHG DQG GHULYDWL]HG ZLWK D SRWHQWLDOO\ OLQHDU SHQWDVDFFKDULGH +H[}+H[f§!)XFf§}+H[f§}+H[1$F!+\3URf 7KH DWWDFKPHQW VLWH ZDV FRQILUPHG E\ (GPDQ GHJUDGDWLRQ *&06 DQDO\VLV RI 706GHULYDWLYHV RI RYHUH[SUHVVHG 6NSO DIWHU PHWKDQRO\VLV VKRZHG WKH +H[1$F WR EH *OF1$F ([RJO\FRVLGDVH GLJHVWLRQV RI WKH JO\FRSHSWLGH IURP QRUPDO 6NSO DQG IURP D IXFRV\ODWLRQ PXWDQW IROORZHG E\ 0$/',72)06 DQDO\VLV VKRZHG WKDW WKH VXJDU FKDLQ FRQVLVWHG RI '*DOSDOf§!'*DO[[O}/)XFSDO'*DOS> A*OF1$F 0$/',72)06 DQDO\VLV RI DOO 6NSO SHSWLGHV UHVROYHG E\ 53+3/& VKRZHG WKDW 6NSO ZDV RQO\ SDUWLDOO\

PAGE 129

K\GUR[\ODWHG DW 3UR DQG WKDW DOO K\GUR[\ODWHG 6NSO ZDV FRPSOHWHO\ JO\FRV\ODWHG 7KH JO\FDQ VWUXFWXUH RI 6NSO VXJJHVWV WKH ORFDOL]DWLRQ RI D QRYHO JO\FRV\ODWLRQ SDWKZD\ LQ WKH F\WRSODVP 7KLV SDWKZD\ ZLOO UHTXLUH GLIIHUHQW HQ]\PHV LQFOXGLQJ SURO\OK\GUR[\ODVH *OF1$FWUDQVIHUDVH IXFRV\OWUDQVIHUDVH DQG WKUHH JDODFWRV\O WUDQVIHUDVHV 7KHVH HQ]\PHV DUH NQRZQ RQO\ WR UHVLGH ZLWKLQ WKH U(5 DQG *ROJL DSSDUDWXV QRW WKH F\WRSODVP ZKHUH 6NSO UHVLGHV :H K\SRWKHVL]H WKDW 6NSO LV PRGLILHG E\ D ELRV\QWKHWLF SDWKZD\ ZKLFK UHVHPEOHV SRVWWUDQVODWLRQDO PRGLILFDWLRQ SDWKZD\V RI WKH VHFUHWRU\ DSSDUDWXV EXW UHVLGHV LQ WKH F\WRVROLF FRPSDUWPHQW 7KH ILUVW WZR HQ]\PHV RI WKH SDWKZD\ SURO\OK\GUR[\ODVH DQG *OF1$FWUDQVIHUDVH DUH H[SHFWHG WR H[HUW FULWLFDO FRQWURO RYHU SODFLQJ WKH VWUXFWXUH RQ WDUJHW SURWHLQV 3URO\OK\GUR[\ODVH PXVW DFW ILUVW WR DOORZ WKH SHQWDVDFFKDULGH WR EH EXLOW 7KH ILQGLQJ WKDW DOO K\GUR[\ODWHG 6NSO LV JO\FRV\ODWHG VXJJHVWV WKH LPSRUWDQFH RI WKH SURO\OK\GUR[\ODVH DV D UHJXODWRU\ HQ]\PH LQ WKLV SDWKZD\ (YLGHQFH RI 6NSO3URO\OK\GUR[\ODVH $FWLYLW\ LQ WKH &\WRVRO $OO RI WKH NQRZQ SURO\OK\GUR[\ODVHV DUH IRXQG LQ WKH OXPHQ RI WKH U(5 ZKHUH WKH\ UHVLGH DV VROXEOH HQ]\PHV UHYLHZHG LQ .LYLULNNR DQG 3LKODMDQLHPL f 2QH W\SH RI SURO\OK\GUR[\ODVHV FDWDO\]HV WKH IRUPDWLRQ RI 2+WUDQVf3UR DW WKH SRO\SHSWLGH OHYHO $QRWKHU SURO\OK\GUR[\ODVH WKH YHUWHEUDWH 2+WUDQVfSURO\OK\GUR[\ODVH PRGLILHV RQO\ FHUWDLQ 3UR UHVLGXHV DGMDFHQW WR D 2+WUDQVf3UR ,Q PDPPDOV SURO\OK\GUR[\ODVH LV D WHWUDPHU ZLWK LGHQWLFDO DVXEXQLWV FDWDO\]LQJ 3UR K\GUR[\ODWLRQ DQG VXEXQLWV KDYLQJ SURWHLQ GLVXOILGH LVRPHUDVH 3',f DFWLYLW\

PAGE 130

7KH JO\FRV\ODWLRQ VLWH RI 6NSO VXJJHVWV WKH QRYHO SURO\OK\GUR[\ODVH DFWLYLW\ LQ 'LFW\RVWHOKLP 7KH 6NSOSURO\OK\GUR[\ODVH LV PRVW OLNHO\ D 2+SURO\OK\GUR[\ODVH VLQFH WKH +\3URSHSWLGH V\QWKHVL]HG ZLWK D +\3UR LQ SODFH RI 3UR KDV EHHQ LGHQWLILHG DV D VXEVWUDWH IRU 6NSO*OF1$FWUDQVIHUDVH DFWLYLW\ $ SURO\OK\GUR[\ODVH DVVD\ ZDV GHYHORSHG EDVHG RQ WKH NQRZOHGJH WKDW NQRZQ SURO\OK\GUR[\ODVHV RI WKH U(5 UHSODFH D SURWRQ ZLWK D K\GUR[\O JURXS UHVXOWLQJ LQ WKH IRUPDWLRQ RI +]2 IURP >+@3UR 5HFRPELQDQW 'LFW\RVWHOLXP 6NSO H[SUHVVHG LQ ( FROL 6NSO+LVf ZDV PHWDEROLFDOO\ODEHOHG ZLWK >+@3UR DQG SXULILHG IURP WKH VROXEOH IUDFWLRQ E\ LWV 1WHUPLQDO ROLJR+LV WDJ 7KH >+@6NSO+LV ZDV LQFXEDWHG ZLWK 6, DQG 3, IUDFWLRQV DW r& LQ WKH SUHVHQFH RI DVFRUELF DFLG DNHWRJOXWDUDWH '77 )H62W DQG FDWDODVH 7KH UHOHDVHG + ZDV PHDVXUHG E\ FROOHFWLQJ WKH IORZWKURXJK IUDFWLRQ IURP 'RZH[ :$ FROXPQV GLUHFWO\ LQWR VFLQWLOODWLRQ YLDOV 3HWHUNRIVN\ DQG 'L%ODVLR f ,QFXEDWLRQ RI WKH 6, IUDFWLRQ EXW QRW WKH 3, IUDFWLRQ ZLWK >f+@ 6NSO+LV UHOHDVHG + 5HOHDVH RI + DSSHDUHG WR EH IURP >+@6NSO+LV EHFDXVH LW ZDV LQKLELWHG E\ P$K ) DVFLWHV DQG E\ V\QWKHWLF SHSWLGH ZKLFK FRQWDLQHG IODQNLQJ VHTXHQFHV RI 3UR 7KH GDWD VXJJHVW WKDW WKH FUXGH VROXEOH IUDFWLRQ RI WKH FHOO FRQWDLQV DQ DFWLYLW\ ZKLFK FDQ K\GUR[\ ODWH 6NSO+LV $FWLYLW\ UHTXLUHG FRIDFWRUV RI D SURO\OK\GUR[\ODVH SUHYLRXVO\ LGHQWLILHG LQ WKH U(5 IUDFWLRQ RI FHOOV 2QH RI WKH SUREOHPV LQ WKLV DVVD\ LV WKH GHFRPSRVWLRQ RI >+@ODEHOHG6NSO+LV DIWHU VWRUDJH DW r&

PAGE 131

&KDUDFWHUL]DWLRQ RI 6NSO*OF1$F7UDQVIHUDVH *O\FRV\OWUDQVIHUDVHV DUH HQ]\PHV UHVSRQVLEOH IRU FDWDO\VLV RI WKH DGGLWLRQ RI PRQRVDFFKDULGH XQLWV WR DQ H[LVLWLQJ JO\FDQ FKDLQ RU WR D SHSWLGH RU OLSLG DFFHSWRU 'RQRU PRQRVDFFKDULGHV DUH FRPPRQO\ XWLOL]HG LQ DQ DFWLYDWHG IRUP HLWKHU DV D QXFOHRWLGH VXJDU HJ *'3IXFRVH RU DV D OLSLGOLQNHG GRQRU HJ GROLFKRO3JOXFRVH UHYLHZHG LQ 6HDUV DQG :RQJ f 0RVW RI SURWHLQ JO\FRV\OWUDQVIHUDVHV WKDW KDYH EHHQ FORQHG VR IDU DUH W\SH WZR PHPEUDQH SURWHLQV ZLWK VPDOO F\WRVROLF DPLQRWHUPLQDO GRPDLQV VLQJOH WUDQVPHPEUDQH VHJPHQWV OXPHQDO VWHP UHJLRQV DQG ODUJH FDUER[\OWHUPLQDO OXPHQDO GRPDLQV UHVSRQVLEOH IRU FDWDO\VLV 3DXOVRQ DQG &ROOH\ 6KDSHU HW DK f 5HFHQWO\ WKH F\WRVROLF HQ]\PH UHVSRQVLEOH IRU WKH DGGLWLRQ RI VLQJOH *OF1$F UHVLGXH WR WKH K\GUR[\O JURXSV RI VHULQH DQGRU WKUHRQLQH RI PDQ\ QXFOHDU DQG F\WRSODVPLF SURWHLQV 2*OF1$FWUDQVIHUDVHf KDV EHHQ SXULILHG +DOWLZDQJHU HW DK +DOWLZDQJHU HW DK f ,W LV D KHWHURWULPHU ZLWK D PROHFXODU ZHLJKW RI N'D FRQVLVWLQJ RI WZR DOSKD 0UO N'Df DQG RQH EHWD 0U N'Df VXEXQLWV 7KH DOSKD VXEXQLW KDV EHHQ FORQHG DQG ZDV IRXQG WR FRQWDLQ PXOWLSOH WHWUDWULFRSHSWLGH UHSHDWV .UHSSHO HW DK /XEDV HW DK f 7KH JO\FRVLGLF SHSWLGH OLQNDJH RI 6NSO *OF1$F+\3UR KDV QHYHU EHHQ LGHQWLILHG LQ RWKHU SURWHLQV 7KH QRYHO OLQNDJH LQGLFDWHV WKH SUHVHQFH RI D QRYHO *OF1$FWUDQVIHUDVH DFWLYLW\ LQ 'LFW\RVWHOLXP ,Q WKH VHFRQG SDUW RI P\ VWXG\ D 8'31DFHW\OJOXFRVDPLQH 6NSO1DFHW\OJOXFRVDPLQ\OWUDQVIHUDVH 6NSO*OF1$FWUDQVIHUDVHf DFWLYLW\ KDV EHHQ SXULILHG IURP WKH 6, IUDFWLRQ RI WKH 6NSO RYHUH[SUHVVLRQ VWUDLQ +: 7KH DFKLHYHPHQW LV EDVHG RQ WKH ILQGLQJ WKDW RYHUH[SUHVVHG 6NSO LV YDULDEO\ JO\FRV\ODWHG DQG

PAGE 132

RQH RI LWV JO\FRIRUP D K\GUR[\ODWHGXQJO\FRV\ODWHG 6NSO FDQ EH XVHG DV DQ DFFHSWRU VXEVWUDWH LQ DQ DVVD\ IRU WKH H[SHFWHG *OF1$FWUDQVIHUDVH DFWLYLW\ 7KH *OF1$FWUDQVIHUDVH DFWLYLW\ EHKDYHG DV D VLQJOH FRPSRQHQW DIWHU SXULILFDWLRQ RYHU D '($( SKHQ\O6HSKDURVH 5HDFWLYH 5HG 6XSHUGH[ G803 DQG 8'3*OF1$F FROXPQ 7KH SXULILHG DFWLYLW\ KDV DQ DSSDUHQW 0U RI DQG DQ DSSDUHQW .P RI IRU 8'3*OF1$F DQG ZDV '77 GHSHQGHQW )RU UHDVRQV WKDW WKH HQ]\PH DFWLYLW\ ZDV IRXQG LQ WKH F\WRVROLF IUDFWLRQ DQG WKH DFWLYLW\ UHTXLUHG D UHGXFLQJ HQYLURQPHQW ZH VXJJHVW WKDW WKH JO\FRV\ODWLRQ SURFHVV RI 6NSO RFFXUV LQ WKH F\WRVROLF FRPSDUWPHQW &KDUDFWHUL]DWLRQ RI WKH 6NSO)XFRV\OWUDQVIHUDVH ,Q DGGLWLRQ WR 6NSO*OF1$FWUDQVIHUDVH D 6NSOIXFRV\OWUDQVIHUDVH F)7DVHf DFWLYLW\ DEOH WR DWWDFK )XF WR WKH FRUH GLVDFFKDULGH *DLSLf§!*OF1$Ff§!+\3URf KDV EHHQ SXULILHG IURP WKH F\WRVROLF FRPSDUWPHQW RI 'LFW\RVWHOLXP :HVW HW DO f ,WV DVVD\ ZDV EDVHG RQ WKH WUDQVIHU RI > (IMIXFRVH IRUP *'3> +@IXFRVH WR *DOSO*OF1$F>SDUDQLWURSKHQ\O SDUDQLWURSKHQ\OODFWR$nELRVLGH RU S13/1%f ZKLFK ZDV GHWHUPLQHG E\ DGVRUSWLRQ RQWR D &O 6HS3DN FDUWULGJH IROORZHG E\ HOXWLRQ ZLWK PHWKDQRO 3DOFLF HW DK f 7KH DFWLYLW\ EHKDYHG DV D VLQJOH FRPSRQHQW GXULQJ SXULILFDWLRQ RYHU '($( SKHQ\O 5HDFWLYH %OXH *'3DGLSDWH *'3KH[DQRODPLQH DQG 6XSHUGH[ FROXPQ 7KH SXULILHG DFWLYLW\ SRVVHVVHG DQ DSSDUHQW 0U RI [ ZDV 0J GHSHQGHQW ZLWK D QHXWUDO S+ RSWLPXP DQG H[KLELWHG D .P IRU *'3IXFRVH RI S0 D .P IRU S13/1% RI P0 DQG D 9PD[ IRU S13/1% RI QPROPLQPJ SURWHLQ 6'6SRO\DFU\ODPLGH JHO HOHFWURSKRUHVLV DQDO\VLV RI WKH 6XSHUGH[ HOXWLRQ SURILOH LGHQWLILHG D SRO\SHSWLGH ZLWK DQ DSSDUHQW 0U RI [ ZKLFK FRHOXWHG ZLWK WKH F)7DVH

PAGE 133

DFWLYLW\ DQG FRXOG EH VSHFLILFDOO\ SKRWRODEHOOHG ZLWK WKH GRQRU VXEVWUDWH LQKLELWRU *'3 KH[DQRODPLQ\OD]LGR,VDOLF\ODWH $IXFRV\ODWLRQ JO\FRIRUP RI 6NSO SXULILHG IURP WKH F\WRVRO RI WKH PXWDQW VWUDLQ +/ ZDV IRXQG WR EH D VXEVWUDWH IRU WKH F)7DVH ZKLFK H[KLELWHG DQ DSSDUHQW .P RI OS0 DQG DQ DSSDUHQW 9PD[ RI QPROPLQPJ SURWHLQ F)7DVH DFWLYLW\ ZDV QRW LQKLELWHG E\ UHFRPELQDQW 6NSO VXJJHVWLQJ WKDW DFFHSWRU VXEVWUDWH VSHFLILFLW\ LV EDVHG SULPDULO\ RQ FDUERK\GUDWH UHFRJQLWLRQ (YLGHQFH RI *DODFWRV\OWUDQVIHUDVH $FWLYLW\ LQ WKH &\WRVRO RI 'LFW\RVWHOLXP $ JDODFWRV\OWUDQVIHUDVH DFWLYLW\ ZKLFK FDQ WUDQVIHU *DO IURP 8'3*DO WR WKH WULVDFFKDULGH FRUH )XFDOf§!*DO_O}*OF1$F KDV EHHQ LGHQWLILHG LQ WKH 6, IUDFWLRQ RI 'LFW\RVWHOLXP 8VLQJ D VLPLODU PHWKRG WR F)7DVH DQ DVVD\ ZDV GHYHORSHG EDVHG RQ WKH WUDQVIHU RI >+@*DO IURP 8'3>+@*DO WR )XFDOf§!*DLSLf§!*OF1$F>SDUDQLWURSKHQ\O FRXUWHV\ RI 'U .KXVKL 0DWWDf (DFK UHDFWLRQ FRQWDLQHG _LJ DFFHSWRU VXEVWUDWH S0 8'3*DO P0 0J&O P0 0Q&O P0 $73 P0 1D) LQ P0 7ULV+&O S+ f LQ WKH ILQDO YRO RI SL 'XULQJ WKH SXULILFDWLRQ RI 6, RYHU D '($(6HSKDURVH FROXPQ *DODFWRV\OWUDQVIHUDVH DFWLYLW\ ZDV IRXQG LQ WKH IORZWKURXJK IUDFWLRQ EHIRUH WKH DSSHDUDQFH RI 6NSO*OF1$FWUDQVIHUDVH DFWLYLW\ VXJJHVWLQJ WKDW WKH DFWLYLW\ VKRXOG UHVLGH LQ WKH F\WRVRO DV ZHOO 7KH (IIHFWV RI 'LFW\RVWHOLXP 6NSO RQ $FWLQ 3RO\PHUL]DWLRQ (YHQ WKRXJK WKH IXQFWLRQ RI 6NSOJO\FDQ LV QRW \HW NQRZQ VRPH RI RXU SUHOLPLQDU\ UHVXOWV VXJJHVW WKH LPSRUWDQFH RI 6NSO JO\FRV\ODWLRQ DQG DFWLQ ELQGLQJ 7KLV ZRUN ZDV LQ FROODERUDWLRQ ZLWK 'U 0LFKDHO 5 %XEE 'HSDUWPHQW RI 0HGLFLQH 8QLYHUVLW\ RI )ORULGD &RPSDULVRQ RI WKH 6NSO VHTXHQFHV IURP PXOWLSOH RUJDQLVPV

PAGE 134

UHYHDOV D FRQVHUYHG UHJLRQ ZKLFK UHVHPEOHV WKH DFWLQELQGLQJ PRWLI RI 3K\VDUXP SURILOLQ ,Q RUGHU WR GHPRQVWUDWH WKH HIIHFWV RI 6NSO DQG DFWLQ SRO\PHUL]DWLRQ )DIIPLW\ SXULILHG6NSOFP\F 6NSO+LV DQG 53+3/& SXULILHG UHGXFHGDON\ODWHG 6NSOFP\F ZHUH GLDO\]HG DJDLQVW EXIIHU P0 7ULV+&O S+ P0 $73 P0 '77 P0 &D&E b 1D1Vf FRQFHQWUDWHG LQ D FRQFHQWUDWRU ZLWK D 0: FXWRII N'D &HQWULFRQf DQG DGGHG LQ DFWLQSRO\PHUL]DWLRQ DVVD\V )LJ f 2QO\ 6NSOFP\F LQKLELWV DFWLQ SRO\PHUL]DWLRQ DV D EDUEHGHQG DFWLQ ELQGLQJ SURWHLQ ,QWHUHVWLQJO\ UHGXFWLYH DON\ODWLRQ RI WKH SURWHLQ EORFNV DFWLYLW\ DQG 6NSO+LV H[SUHVVHG DQG LVRODWHG LQ (FROL LV LQDFWLYH %HFDXVH WKH PDLQ GLIIHUHQFH EHWZHHQ WKH 6NSOFP\F DQG 6NSO+LV LV WKH SUHVHQFH RI WKH ROLJRVDFFKDULGH RQ WKH 'LFW\RVWHOLXP H[SUHVVHG IRUP WKLV ILQGLQJ VXJJHVWV WKH UROH RI 6NSOJO\FDQ RQ DFWLQ ELQGLQJ 0RUHRYHU VLQFH 6NSO LV YDULDEO\ JO\FRV\ODWHG GLIIHUHQW 6NSO JO\FRIRUPV PD\ KDYH GLIIHUHQW IXQFWLRQV LQ WHUPV RI DFWLQ ELQGLQJ DQG WKH UHJXODWLRQ RI DFWLQ DVVHPEO\ 3UHSDUDWLRQ RI 6NSOFP\F &RH[SUHVVLRQ 6WUDLQV &RQVWUXFWLRQ RI D 3ODVPLG (QFRGLQJ 6NSOFP\F 7R IXUWKHU VWXG\ WKH ORFDOL]DWLRQ DFWLQLQWHUDFWLRQ DQG JO\FDQ IXQFWLRQ RI 6NSO DQ HIIRUW KDV EHHQ PDGH WR H[SUHVV 6NSOFP\F PXWDQW GHULYDWLYHV LQFOXGLQJ RQH ZLWK D 3$ VXEVWLWXWLRQ 7KH VWXG\ ZDV DLPHG WR JHQHUDWH 6NSOFP\F FRH[SUHVVLRQ VWUDLQV IURP GLIIHUHQW SODVPLGV 7KH SODVPLGV DIWHU WUDQVIRUPDWLRQ LQWR 'LFW\RVWHOLXP ZHUH H[SHFWHG WR H[SUHVV GLVWLQFW IRUPV RI 6NSOFP\F S HQFRGHG 6NSO IURP ISDO F'1$ ZLWK D FP\F WDJ DW &WHUPLQDO S HQFRGHG ISDO 6NSOFP\F F'1$ LQ ZKLFK WKH

PAGE 135

)LJXUH ,QKLELWLRQ RI DFWLQ SRO\PHUL]DWLRQ E\ 'LFW\RVWHOLXP 6NSO 5DEELW VNHOHWDO PXVFOH DFWLQ P0f b ODEHOHG ZLWK S\UHQ\O LRGRDFHWDPLGH S\UHQH DFWLQf ZLWK HLWKHU Â’f RU $f P0 6NSO ZDV SRO\PHUL]HG E\ WKH DGGLWLRQ RI P0 0J&IW 7KH VDPH WLPH FRXUVH RI SRO\PHUL]DWLRQ ZDV GHWHUPLQHG XVLQJ P0 6NSO DIWHU IXUWKHU SXULILFDWLRQ RQ D '($(+3/& FROXPQ 2f 8SRQ SRO\PHUL]DWLRQ RI S\UHQH DFWLQ WKH TXDQWXP \LHOG RI IOXRUHVFHQFH LQWHQVLW\ LQFUHDVHV WKLUW\IROG ZLWK WKH LQFUHDVH LQ IOXRUHVFHQFH SURSRUWLRQDO WR WKH DPRXQW RI ILODPHQWRXV DFWLQ 7KH LQKLELWLRQ VHHQ LQ WKH SUHVHQFH RI 6NSO FRXOG EH UHODWHG WR LQKLELWLRQ RI WKH QXFOHDWLRQ RU WKH HORQJDWLRQ RI DFWLQ ILODPHQWV 7KH ILQDO VWHDG\ VWDWH YDOXH RI IOXRUHVFHQFH ZDV QRW LQIOXHQFHG E\ 6NSO VXJJHVWLQJ WKDW 6NSO GRHV QRW VHTXHVWHU PRQRPHULF DFWLQ ,Q WKH LQVHW UHFRPELQDQW 6NSO IURP (FROL $f DQG 6NSO WUHDWHG ZLWK UHGXFWLYH DON\ODWLRQ 2f KDYH D SRO\PHUL]DWLRQ WLPH FRXUVH WKDW LV QRW GLIIHUHQW IURP WKDW RI D FRQWURO ZLWKRXW 6NSO Â’f

PAGE 136

JO\FDQ DWWDFKPHQW VLWH 3UR ZDV UHSODFHG E\ $OD $OD ZDV FKRVHQ VLQFH DQ $OD DW WKH HTXLYDOHQW SRVLWLRQ ZDV IRXQG LQ D 6NSO JHQH LQ &HOHJDQV S HQFRGHG 6NSO IURP ISD F'1$ ZLWK D FP\F WDJ DW &WHUPLQDO S HQFRGHG ISDO 6NSOFP\F F'1$ LQ ZKLFK WKUHH DPLQR DFLGV LQ WKH SXWDWLYH DFWLQ ELQGLQJ PRWLI 9767,/(.9/'<&5f /\V9DO/HX ZHUH UHSODFHG E\ $OD6HU6HU ,Q RUGHU WR FUHDWH D IXOOOHQJWK 6NSO F'1$ ZLWK WKH &WHUPLQXV HQFRGLQJ WKH KXPDQ FP\F HSLWRSH (4./,6(('/ WKH RSHQ UHDGLQJ IUDPH RI 6NSO ZDV DPSOLILHG E\ SRO\PHUDVH FKDLQ UHDFWLRQ 3&5f XVLQJ 'LFW\RVWHOLXP ISDO JHQRPLF '1$ DV WKH WHPSODWH DQG ROLJRQXFOHRWLGHV &: DQG &: DV SULPHUV 7DEOH f 7KH HSLWRSH FRGLQJ UHJLRQ ZDV FRQWDLQHG LQ &: 7KH UHDFWLRQ FRQWDLQHG QJ RI WKH WHPSODWH _O0 RI HDFK SULPHU P0 G173 P0 7ULV+&O S+ f P0 .& b 7ULWRQ ; P0 0J&K DQG 8 RI 7DT '1$ SRO\PHUDVH 3URPHJD 0DGLVRQ :,f LQ WKH WRWDO YRO RI _LO DQG WKH 3&5 ZDV SHUIRUPHG DW r& PLQ r& PLQ DQG r& PLQ IRU F\FOHV 7KH 3&5 SURGXFW ZDV OLJDWHG LQWR WKH EOXQW YHFWRU S7%OXH 1RYDJHQ 0DGLVRQ :,f DQG FORQHG LQWR '+D 0&5 FHOOV *LEFR %5/ *DLWKHUVEXUJ 0'f 7KH SODVPLG FRQWDLQHG .SQ DQG 6DF UHVWULFWLRQ VLWHV ZKLFK ZHUH XVHG WR VXEFORQH WKH LQVHUW LQWR WKH S9(,,G$7* %OXVFK HW DO f GRZQVWUHDP RI WKH GLVFRLGLQ SURPRWHU 7KH VHTXHQFH RI WKH SODVPLG S ZDV YHULILHG E\ VHTXHQFLQJ WKH SODVPLG '1$ ,Q 9LWUR 6LWH'LUHFWHG 0XWDJHQHVLV RI S 7KUHH VHWV RI 3&5 ZHUH SHUIRUPHG XVLQJ WKH 6NSOFP\F SODVPLG S DV WKH WHPSODWH DQG WKUHH VHWV RI ROLJRQXFOHRWLGHV &: DQG &: &: DQG &: DQG

PAGE 137

7DEOH 7KH ROLJRQXFOHRWLGH SULPHUV XVHG WR SUHSDUH 6NSOFP\F SODVPLGV 3ULPHU 3ODVPLG 6HTXHQFHV &: S f *$& 7*$ *&7 &*$ **$ 7&& $$$ 7$$ $$7 $$$ $$$ $7* 7&7 77$ *77 $$$ 77$ *$$ 7&7 f &: S f *$* *$7 &&* $*& 7*$ 7$7 777 7$$ 77* $*$ 7&7 7&7 7&7 *$$ $7$ $*& 777 7*7 7&* 777 &&$ &&7 77$ 7&7 7&$ & f &: S f &$$ *$$ &*$ &77 7$& 7*& $*$ $*$ $*$ $*$ $& f &: S f *77 &77 &77 &77 &7* &$* 7$$ $*7 &*7 7&7 7* f &: S f **7 *$$ 7&$ *$7 *&* &&$ $77 &&$ 77$ & f &: S f *7$ $7* *$$ 77* *&* &$7 &7* $77 &$& & f &: S f *&$ &7$ 777 7$* $$* &77 &77 &7* $&7 $77 *&$ *$& f &: S f *7& 7*& $$7 $*7 &$* $$* $$* &77 &7$ $$$ 7$* 7*& f 7KH HSLWRSH FRGLQJ UHJLRQ IRU FP\F VHTXHQFHV (4./,6(('/ LQ &: LV XQGHUOLQHG

PAGE 138

&: DQG &: 7DEOH f DV SULPHUV LQ RUGHU WR SUHSDUH PXWDQW 6NSOFP\F SODVPLGV S S DQG S UHVSHFWLYHO\ 7KH SULPHUV &: DQG &: ZHUH GHVLJQHG WR FUHDWH D 3VW UHVWULFWLRQ VLWH DQG FKDQJH WKH HQFRGLQJ F'1$ IURP 3UR WR $OD 7KH SULPHUV &: DQG &: ZHUH GHVLJQHG WR FUHDWH D +KD UHVWULFWLRQ VLWH DQG FKDQJH WKH HQFRGLQJ F'1$ IURP 6HU WR $OD 7KH SULPHUV &: DQG &: ZHUH GHVLJQHG WR FUHDWH DQ H[WUD +LQGOOO UHVWULFWLRQ VLWH DQG FKDQJH WKH HQFRGLQJ F'1$ IURP /\V9DO /HX WR $OD6HU6HU 7KH UHDFWLRQV FRQWDLQHG QJ RI FLUFXODU S S0 RI HDFK SULPHU P0 G173 P0 7ULV+&O S+ f P0 0J&O P0 0J6 P0 .& P0 1+f6 b 7ULWRQ ; PJ %6$ DQG 8 RI FORQHG SIX '1$ SRO\PHUDVH 6WUDWHJHQH /D -ROOD &$f LQ D WRWDO YRO RI SL DQG ZHUH SHUIRUPHG DW r& PLQ r& PLQ DQG r& PLQ IRU F\FOHV 7KH 3&5 SURGXFWV ZHUH WUHDWHG ZLWK 'SQ DQG FORQHG LQWR WKH '+D 0&5 FHOO 7KH VHTXHQFHV RI WKH SODVPLGV S S DQG S ZHUH YHULILHG E\ VHTXHQFLQJ WKH SODVPLG '1$ 7UDQVIRUPDWLRQ RI 'LFW\RVWHOLXP 6WUDLQ $[ 7KLV ZRUN ZDV SHUIRUPHG ZLWK DVVLVWDQFH IURP .DWKU\Q 7 'REVRQ 7KH SODVPLGV ZHUH WUDQVIRUPHG LQWR 'LFW\RVWHOLXP VWUDLQ $[ E\ D &D3 SUHFLSLWDWLRQ PHWKRG 5HEVWHLQ HW DO f DQG FRORQLHV ZHUH VHOHFWHG LQ WKH SUHVHQFH RI SJPO )RU HDFK WUDQVIRUPDWLRQ DSSUR[LPDWHO\ [ $[ FHOOV ZHUH JURZQ LQ WKH GDUN DW r& RYHUQLJKW RQ D WLVVXH FXOWXUH GLVK LQ %LV7ULV +/ b %LV7ULV b SURWHRVH SHSWRQH b WKLRWRQH( SHSWRQH b \HDVW H[WUDFW S+ f FRQWDLQLQJ SJPO DPSLFLOOLQ SJPO DPSKRWHULFLQ % QJPO YLWDPLQ % DQG P0 IROLF DFLG 2Q WKH QH[W GD\ WKH PHGLD ZDV UHSODFHG ZLWK IUHVK %LV7ULV +/ SOXV DGGLWLRQVf 7HQ SJ RI WKH

PAGE 139

SODVPLGV ZDV GLOXWHG ZLWK P0 &D&A LQ +%6 Jb JOXFRVH Jb 1D&O Jb .& Jb 1D+3+ Jb +(3(61D2+ S+ f DQG WKH '1$ ZDV DOORZHG WR SUHFLSLWDWH DW URRP WHPSHUDWXUH IRU PLQ 7KH PHGLD ZDV DVSLUDWHG IURP WKH GLVKHV DQG PO RI WKH SODVPLG VXVSHQVLRQ ZDV DGGHG GURSZLVH WR FRYHU WKH FHOOV $IWHU PLQ PO RI %LV7ULV +/ ZLWK DGGLWLRQVf ZDV DGGHG DQG WKH FHOOV ZHUH DOORZHG WR DGKHUH WR WKH SODWH IRU K 7KH PHGLD ZDV GLVFDUGHG DQG WKH FHOOV ZHUH WUHDWHG ZLWK b JO\FHURO LQ +%6 IRU PLQ EHIRUH UHSODFLQJ ZLWK +/ 2Q WKH QH[W GD\ DQG HYHU\ GD\V DIWHUZDUG WKH PHGLD ZDV UHSODFHG ZLWK IUHVK +/ FRQWDLQLQJ SJPO RI 7KH FHOOV ZHUH FORQHG E\ GLOXWLQJ LQ VXVSHQVLRQ RI .OHEVLHOOD DHURJHQHV DQG VSUHDGLQJ RQ 60 SODWHV ,VRODWHG FRORQLHV ZHUH WUDQVIHUHG WR +/ FRQWDLQLQJ 7KH FXOWXUH ZDV FHQWULIXJHG DQG WKH FHOO SHOOHWV ZHUH UHVXVSHQGHG LQ /6% ERLOHG IRU PLQ DQG UHVROYHG RQ D b JUDGLHQW 6'6SRO\DFU\ODPLGH JHO 7KH SURWHLQ ZDV HOHFWURWUDQVIHUHG RQWR _L0 QLWURFHOOXORVH PHPEUDQHV 3RVLWLYH FORQHV ZHUH LGHQWLILHG E\ :HVWHUQ EORW DQDO\VLV RI WKH PHPEUDQHV ZLWK PRQRFORQDO DQWLERG\ ( DJDLQVW WKH FP\F HSLWRSH $IWHU VFUHHQLQJ PRUH WKDQ FRORQLHV IURP HDFK WUDQVIRUPDQW ZH FRXOG QRW LGHQWLI\ WKH RYHUH[SUHVVLRQ 6NSOFP\F FORQH IURP S DQG S ,Q FRQWUDVW WKH FORQLQJ RI RYHUH[SUHVVLRQ 6NSOFP\F IURP S ZKLFK KDG WKH VHTXHQFH KRPRORJRXV WR ISD ZDV DFFRPSOLVKHG LQ WKH ILUVW URXQG RI VFUHHQLQJ 7KHVH ILQGLQJV VXJJHVW WKDW WKH OHYHO RIISD? HQFRGHG 6NSO LV PRUH VWULFWO\ FRQWUROOHG WKDQ WKDW RIISDO ,W DOVR LPSOLHV WKDW RQH RU ERWK DPLQR DFLG PXWDWLRQVf LQ +: VWUDLQ PLJKW EH LPSRUWDQW IRU WKH UHJXODWLRQ RI 6NSO H[SUHVVLRQ OHYHO

PAGE 140

)XWXUH 'LUHFWLRQ ,Q WKLV VWXG\ WKH +\3URJO\FRV\ODWLRQ SDWKZD\ KDV EHHQ SURSRVHG DQG WKH H[LVWHQFH DQG SURSHUWLHV RI 6NSO*OF1$FWUDQVIHUDVH HQ]\PH LQ WKLV SDWKZD\ KDYH EHHQ FKDUDFWHUL]HG 7KH ORQJ WHUP JRDO RI WKLV VWXG\ LV WR XQGHUVWDQG KRZ WKLV FDUERK\GUDWH VWUXFWXUH LV LPSRUWDQW IRU WKH IXQFWLRQ RI 6NSO DQG WR GHPRQVWUDWH ZKHWKHU WKLV QRYHO SDWKZD\ H[LVWV LQ RWKHU HXNDU\RWHV ,Q RUGHU WR UHDFK WKH JRDO ZH PXVW ILUVW XQGHUVWDQG KRZ WKH VWUXFWXUH LV V\QWKHVL]HG LQ WHUPV RI VSHFLILFLW\ DQG FRPSDUWPHQWDOL]DWLRQ RI WKH HQ]\PHV ZKLFK DUH UHVSRQVLEOH IRU LWV ELRV\QWKHVLV 7KH *OF1$FWUDQVIHUDVH DFWLYLW\ ZKLFK LV VSHFLILF IRU 6NSO KDV EHHQ SXULILHG IURP WKH F\WRVROLF IUDFWLRQ RI WKH FHOO 7R FRQFOXGH WKDW WKH HQ]\PH LV ORFDOL]HG LQ WKH F\WRVRO EDVHG RQO\ RQ WKH FHOO IUDFWLRQDWLRQ UHVXOW FDQ EH PLVOHDGLQJ EHFDXVH RUJDQHOOHV PD\ O\VH GXULQJ IUDFWLRQDWLRQ +RZHYHU WKH ILQGLQJV WKDW WKH HQ]\PH DFWLYLW\ UHTXLUHV UHGXFLQJ HQYLURQPHQW DQG KDV D YHU\ ORZ DSSDUHQW .P IRU 8'3*OF1$F VXSSRUW WKH K\SRWKHVLV WKDW WKLV QHZ PRGLILFDWLRQ SDWKZD\ ORFDOL]HV LQ WKH F\WRVROLF FRPSDUWPHQW RI 'LFW\RVWHOLXP ,Q RUGHU WR GHPRQVWUDWH WKH FRPSDUWPHQWDOL]DWLRQ WKH XQLYHUVDO H[LVWHQFH DQG WKH LPSRUWDQFH RI HDFK VWHS LQ WKLV +\3URJO\FRV\ODWLRQ SDWKZD\ LW LV LPSRUWDQW WR SXULI\ VL[ HQ]\PHV LQ WKLV SDWKZD\ WR KRPRJHQHLW\ FKDUDFWHUL]H WKHLU NLQHWLFV DQG VSHFLILFLW\ DQG FORQH WKHLU F'1$V $W WKLV SRLQW RQO\ WKH SXULILFDWLRQ RI WKH 6NSO*OF1$FWUDQVIHUDVH DQG 6NSOF)7DVH KDYH EHHQ GHVFULEHG 7R FORQH WKH F'1$V IRU WKHVH HQ]\PHV ZH QHHG WR REWDLQ SJ TXDQWLWLHV RI WKH SURWHLQ DQG JHQHUDWH LQWHUQDO SHSWLGHV ZKLFK ZLOO EH UHFRYHUHG E\ 53+3/& 7KHVH SHSWLGHV ZLOO WKHQ EH VHTXHQFHG E\ (GPDQ GHJUDGDWLRQ RU

PAGE 141

E\ 472)06 7KH VHTXHQFHV REWDLQHG ZLOO WKHQ EH XVHG WR GHVLJQ GHJHQHUDWH ROLJRQXFORWLGH SUREHV ZKLFK ZLOO EH XVHG IRU D 3&5EDVHG VWUDWHJ\ WR REWDLQ LQWHUYHQLQJ VHTXHQFHV 7KH REWDLQHG 3&5 SURGXFWV ZLOO EH XVHG DV SUREHV WR VFUHHQ IRU WKH 'LFW\RVWHOLXP IXOOOHQJWK F'1$V 6LQFH D SURWHLQ ZKLFK WUDQVORFDWHV WR WKH VHFUHWRU\ FRPSDUWPHQW W\SLFDOO\ FRQWDLQV D SURWHLQ PRWLI UHVSRQVLEOH IRU WKLV WDUJHWWLQJ WKH VLJQDO PRWLI LV SUHGLFWHG WR EH DEVHQW IURP WKH F'1$V RI 6NSO*OF1$F WUDQVIHUDVH DQG 6NSO F)7DVH 6LQFH WKH 6NSO VHTXHQFHV VXUURXQGLQJ 3UR LV KLJKO\FRQVHUYHG LW LV XQOLNHO\ WKDW WKLV JO\FDQ VWUXFWXUH HYROYHG RQO\ IRU 'LFW\RVWHOLXP 6NSO :KHQ WKH HQ]\PH JHQH VHTXHQFHV DUH NQRZQ LW ZLOO EH SRVVLEOH WR VFUHHQ WKH SXEOLF GDWDEDVHV IRU JHQRPLF F'1$ DQG (6:7 VHTXHQFHV ZKLFK PLJKW PDWFK VXIILFLHQWO\ WR VXJJHVW WKH LGHQWLW\ RI FRXQWHUSDUWV LQ RWKHU RUJDQLVPV 7KLV ZLOO EH DQ LPSRUWDQW ZD\ WR H[SORUH WKH JHQHUDOL]DWLRQ RI WKH +\3UR JO\FRV\ODWLRQ SDWKZD\ LQ RWKHU RUJDQLVPV ,I WKH SDWKZD\ H[LVWV LQ \HDVWV WKH IXQFWLRQ RI 6NSO JO\FRV\ODWLRQ FDQ EH WHVWHG JHQHWLFDOO\ HYHQ LI LW LV OHWKDO 'LVUXSWLRQ RI RQH RI WZR NH\ HQ]\PHV SURO\OK\GUR[\ODVH WKDW PRGLILHV 3UR DQG *OF1$FWUDQVIHUDVH ZKLFK FDWDO\]H WKH ILUVW VXJDU DWWDFKPHQW RQWR WKH K\GUR[\SUROLQH ZLOO FRPSOHWHO\ HOLPLQDWH WKH JO\FRV\ODWLRQ SURFHVV DQG HQDEOH XV WR VWXG\ WKH IXQFWLRQ RI 6NSO JO\FDQ 7KH FORQLQJ RI D 6NSOFP\F FRH[SUHVVLRQ VWUDLQ LQ ZKLFK WKH JO\FDQ DWWDFKPHQW VLWH 3UR LV UHSODFHG ZLWK $OD LV XQGHU LQYHVWLJDWLRQ ,I LW LV VXFFHVVIXO ZH ZLOO EH DEOH WR VWXG\ WKH ORFDOL]DWLRQ RI WKH XQJO\FRV\ODWHG 6NSOFP\F LQ YLYR 0RUHRYHU LW ZLOO EH SRVVLEOH WR SXULILHG WKH XQJO\FRV\ODWHG SURWHLQ IRU DFWLQ LQWHUDFWLRQ VWXG\ DQG LGHQWLI\LQJ RWKHU JO\FDQV RI 6NSO

PAGE 142

5()(5(1&(6 $EHLMRQ & DQG +LUVFKEHUJ &% f 7RSRJUDSK\ RI JO\FRV\ODWLRQ UHDFWLRQV LQ WKH HQGRSODVPLF UHWLFXOXP 7,%6 $OOHQ $ 'HVDL 1 1 1HXEHUJHU $ DQG &UHHWK -0 f 3URSHUWLHV RI SRWDWR OHFWLQ DQG WKH QDWXUH RI LWV JO\FRSURWHLQ OLQNDJHV %LRFKHP $OOHQ f 'HWHUPLQDWLRQ RI SHSWLGH VHTXHQFHV ,Q :RUN 76 DQG %XUGRQ 5+ HGVf /DERUDWRU\ 7HFKQLTXHV LQ %LRFKHPLVWU\ DQG 0ROHFXODU %LRORJ\ 6HTXHQFLQJ RI 3URWHLQV DQG 3HSWLGHV (OVHYLHU1RUWK+ROODQG %LRFKHPLFDO 3UHVV $PVWHUGDP 7KH 1HWKHUODQGV SS $ORQVR 0' /RPDNR /RPDNR :0 DQG :KHODQ :-f $ QHZ ORRN DW WKH ELRJHQHVLV RI JO\FRJHQ )$6(% %DL & 6HQ 3 +RIPDQQ 0D / *RHEO 0 +DUSHU -: DQG (OOHGJH 6f 6.3 FRQQHFWV FHOO F\FOH UHJXODWRUV WR WKH XELTXLWLQ SURWHRO\VLV PDFKLQHU\ WKURXJK D QRYHO PRWLI WKH )ER[ &HOO %DLOH\ 5% DQG :RRGZRUG $ f ,VRODWLRQ DQG FKDUDFWHUL]DWLRQ RI D SOHLRWURSLF JOXFRVH UHSUHVVLRQ UHVLVWDQW PXWDQW RI 6DFFKDURP\FHV FHUHYLVLDH 0RO *HQ *HQHW %DR 0 (OPHQGRUI %RRWK -/ 'UDNH 55 DQG &DQILHOG :0 f %RYLQH 8'3$DFHW\OJOXFRVDPLQH/\VRVRPDOHQ]\PH $DFHW\OJOXFRVPLQH SKRVSKRWUDQVIHUDVH HQ]\PDWLF FKDUDFWHUL]DWLRQ DQG LGHQWLILFDWLRQ RI WKH FDWDO\WLF VXEXQLW -%LRO&KHP ,OO %DUUDO < -HQWVFK 6 DQG 0DQQ & f F\FOLQ WXUQRYHU DQG QXWULHQW XSWDNH DUH FRQWUROOHG E\ D FRPPRQ SDWKZD\ LQ \HDVW *HQHV 'HY %HQGLDN % DQG 6FKDFKWHU + f &RQWURO RI *O\FRSURWHLQ 6\QWKHVLV NLQHWLF PHFKDQLVP VXEVWUDWH VSHFLILFLW\ DQG LQKLELWLRQ FKDUDFWHULVWLFV RI 8'3M9 DFHW\JOXFRVDPLQHD'PDQQRVLGH 1DFHW\OJOXFRVDPLQ\OWUDQVIHUDVH ,, IURP UDW OLYHU %LRO &KHP %OXVFK 0RUDQGLQL 3 DQG 1HOOHQ : f 7UDQVFULSWLRQDO UHJXODWLRQ E\ IRODWH LQGXFLEOH JHQH H[SUHVVLRQ LQ 'LFW\RVWHOLXP WUDQVIRUPDQWV GXULQJ JURZWK DQG HDUO\ GHYHORSPHQW 1XFOHLF $FLGV 5HV

PAGE 143

%RXUGRQ 0$ .UXVLXV 7 &DPSEHOO 6 6FKZDUW] 1% DQG 5XRVODKWL ( f 3URF 1DWO $FDG 6FL 86$ &KDNUDERUW\ $ 6DKD %RVH $ &KDWWHUMHH 0 DQG *XSWD 1. f 5HJXODWLRQ RI H,) DOSKDVXEXQLW SKRVSKRU\ODWLRQ LQ UHWLFXORF\WH O\VDWH %LRFKHPLVWU\ &KHQ + 7KDOPDQQ $GDPV -& $YUDKDP .% &RSHODQG 1* -HQNLQV 1$ %HLHU '5 &RUH\ '3 7KDOPDQQ 5 DQG 'X\N *0 f F'1$ FORQLQJ WLVVXH GLVWULEXWLRQ DQG FKURPRVRPDO ORFDOL]DWLRQ RI 2FS D JHQH HQFRGLQJ D SXWDWLYH WUDQVFULSWLRQDVVRFLDWHG IDFWRU SUHGRPLQDQWO\ H[SUHVVHG LQ WKH DXGLWRU\ RUJDQV *HQRPLFV &KRX 7< +DUW *: DQG 'DQJ &9 f &P\F LV JO\FRV\ODWHG DW WKUHRQLQH D NQRZ SKRVSKRU\ODWLRQ VLWH DQG D PXWDWLRQDO KRW VSRW LQ O\PSKRPDV %LRO &KHP &ODXVHQ + DQG %HQQHWW (3f $ IDPLO\ RI 8'3*$O1$F SRO\SHSWLGH 1 DFHW\OJDODFWRVDPLQ\OWUDQVIHUDVHV FRQWURO WKH LQLWLDWLRQ RI PXFLQW\SH 2OLQNHG JO\FRV\ODWLRQ *O\FRELRORJ\ &RQQHOO\ & DQG +LHWHU 3 f %XGGLQJ \HDVW 6.3 HQFRGHV DQG HYROXWLRQDULO\ FRQVHUYHG NLQHWRFKRUH SURWHLQ UHTXLUHG IRU FHOO F\FOH SURJUHVVLRQ &HOO 'DJKHU 6 ) :DQJ / DQG 3DWWHUVRQ 5 f ,GHQWLILFDWLRQ RI JDOHFWLQ DV D IDFWRU LQ SUHP51$ VSOLFLQJ 3URF 1DWO $FDG 6FL 86$ 'DOH 50. 0DUWLQ ( /LYLQJVWRQ '& DQG :DUG '& f 'LUHFW FRYDOHQW PHUFXUDWLRQ RI QXFOHRWLGHV DQG SRO\QXFOHRWLGHV %LRFKHP 'HOO $ f )$%0DVV VSHFWURPHWU\ RI FDUERK\GUDWHV $GY &DUE &KHP %LRFKHP 'HPHWULFN =KDQJ + DQG %HDFK + f &KURPRVRPDO PDSSLQJ RI WKH JHQHV IRU WKH KXPDQ &'.F\FOLQ $DVVRFLDWHG SURWHLQV SO 6.3$ DQG 6.3%f DQG S 6.3f &\WRJHQHW &HOO *HQHW 'HVKDLHV 5&KDX 9 DQG .LUVFKQHU 0 f 8ELTXLWLQDWLRQ RI WKH F\FOLQ &OQS E\ D &GFSGHSHQGHQW SDWKZD\ (0%2 'H\ 1% %RXQHOLV 3 *ULW] 7$ %HGZHOO '0 DQG 0DUFKDVH 5%f 7KH JO\FRV\ODWLRQ RI SKRVSKRJO\FRPXWDVH LV PRGXODWHG E\ FDUERQ VRXUFH DQG KHDW VKRFN LQ 6DFFKDURP\FHV FHUHYLVLDH -%LRO&KHP

PAGE 144

'UXU\ /6 3HUNLQV DQG 'LIIOH\ -); f 7KH &GF SDWKZD\ WDUJHWV &GFS IRU SURWHRO\VLV LQ EXGGLQJ \HDVW (0%2 'XDQ '5 3DXVH $ %XUJUHVV : $VR 7 &KHQ '<7 *DUUHWW .3 &RQDZD\ 5& &RQDZD\ -: /LQHKDQ :0 DQG .ODXVQHU 5' f ,QKLELWLRQ RI WUDQVFULSWLRQDO HORQJDWLRQ E\ WK 9+/ WXPRU VXSSUHVVRU SURWHLQ 6FLHQFH 'XEHQGRUII -: DQG 6WXGLHU ): f &RQWUROOLQJ EDVDO H[SUHVVLRQ LQ DQ LQGXFLEOH 7 H[SUHVVLRQ V\VWHP E\ EORFNLQJ WKH WDUJHW 7 SURPRWHU ZLWK ODF UHSUHVVRU 0RO %LRO (OZRRG 3 & 5HLG : 0DUFHOO 3 $OOHQ 5 + DQG .ROKRXVH ) f 'HWHUPLQDWLRQ RI WKH FDUERK\GUDWH FRPSRVLWLRQ RI PDPPDOLDQ JO\FRSURWHLQV E\ FDSLOODU\ JDV FKURPDWRJUDSK\PDVV VSHFWURPHWU\ $QDO %LRFKHP )HOGPDQ 505 &RUUHOO && .DSODQ .% DQG 'HVKDLHV 5f $ FRPSOH[ RI &GFS 6NSOS DQG &GFS&XOOLQ FDWDO\]HV XELTXLWLQDWLRQ RI WKH SKRVSKRU\ODWHG &'. LQKLELWRU 6LFOS &HOO )HUJXVRQ 7 ) 9R]HQLOHN DQG :HVW & 0 f 7KH GLIIHUHQWLDWLRQ RI D FHOO VRUWLQJ PXWDQW RI 'LFW\RVWHOLXP GLVFRLGHXP 'HY *URZWK 'LIIHUHQ )LHOG 0& DQG :DLQZULJKW /f 0ROHFXODU FORQLQJ RI HXNDU\RWLF JO\FRSURWHLQ DQG JO\FROLSLG JO\FRV\OWUDQVIHUDVHV D VXUYH\ *O\FRELRORJ\ )LQFKHU % 6DZ\HU : + DQG 6WRQH % $ f &KHPLFDO DQG SK\VLFDO SURSHUWLHV RI DQ DUDELQRJDODFWDQSHSWLGH IURP ZKHDW HQGRVSHUP %LRFKHP )OLFN -6 DQG -RKQVWRQ 0 f *55 RI 6DFFKDURP\FHV FHUHYLVLDH LV UHTXLUHG IRU JO\FRVH UHSUHVVLRQ DQG HQFRGHV D SURWHLQ ZLWK OHXFLQHULFK UHSHDWV 0RO &HOO %LRO )UHH]H + + f 'LFW\RVWHOLXP GLVFRLGHXP JO\FRSURWHLQV XVLQJ D PRGHO V\VWHP IRU RUJDQLVPLF JO\FRELRORJ\ LQ 0RQWUHXLO 9OLHJHQWKDUW -)* DQG 6FKDFKWHU + (GVf *O\FRSURWHLQV ,, (OVHYLHU 6FLHQFH $PVWHUGDP 7KH 1HWKHUODQGV SS *RHEO 0
PAGE 145

*UHHQZHOO 3 f %ORRG JURXS DQWLJHQV PROHFXOHV VHHNLQJ D IXQFWLRQ *O\FRFRQMXJDWH *UHLV .' DQG +DUW *: f 1XFOHDU DQG F\WRSODVPLF JO\FRSURWHLQV LQ 0RQWUHXLO 9OLHJHQWKDUW -)* DQG 6FKDFKWHU + (GVf *O\FRSURWHLQV ,, (OVHYLHU 6FLHQFH $PVWHUGDP 7KH 1HWKHUODQGV SS *XVWDIVRQ */ DQG 0LOQHU /$ f 2FFXUUHQFH RI 1DFHW\OJOXFRVDPLQH SKRVSKDWH LQ 3URWHLQDVH IURP 'LFW\RVWHOLXP GLVFRLGHXP %LRO &KHP +DOWLZDQJHU 56 %ORPEHUJ 0$ DQG +DUW *: Df *O\FRV\ODWLRQ RI QXFOHDU DQG F\WRSODVPLF SURWHLQV -%LRO&KHP +DOWLZDQJHU 56 .HOO\ :* 5RTXHPRUH (3 %ORPEHUJ 0$ 'RQJ /<' .UHSSHO / &KRX 7< DQG +DUW *: Ef *O\FRV\ODWLRQ RI QXFOHDU DQG F\WRSODVPLF SURWHLQV LV XELTXLWRXV DQG G\QDPLF %LRFKHP 6RF 7UDQV +DUSHU -: $GDPL :HL 1 .H\RPDUVL DQG (OOHGJH 6f 7KH S &GN LQWHUDFWLQJ SURWHLQ &LSO LV D SRWHQW LQKLELWRU RI F\FOLQGHSHQGHQW NLQDVHV &HOO +DUULV 5 YDQ +DOEHHN + *OXVKND %DVD / /LQJ 9 7 6PLWK DQG 6SHOOPDQ 0 : f ,GHQWLILFDWLRQ DQG VWUXFWXUDO DQDO\VLV RI WKH WHWUDVDFFKDULGH 1HX$F DOSKDf§!f*DO EHWDOf§!f*OF1$F EHWDOf§!f)XF DOSKD A2OLQNHG WR VHULQH RI KXPDQ IDFWRU ,; %LRFKHPLVWU\ +DUULV 5DQG 6SHOOPDQ 0: f 2OLQNHG IXFRVH DQG RWKHU SRVWWUDQVODWLRQDO PRGLILFDWLRQV XQLTXH WR (*) PRGXOHV *O\FRELRORJ\ +DUW *: f *O\FRV\ODWLRQ &XUU 2S &HOO ELRO +DUW : f '\QDPLF 2OLQNHG JO\FRV\ODWLRQ RI QXFOHDU DQG F\WRVNHOHWDO SURWHLQV $QQX 5HY %LRFKHP +DUW : +DOWLZDQJHU 5 6 +ROW DQG .HOO\ : f *O\FRV\ODWLRQ LQ WKH QXFOHXV DQG F\WRSODVP $QQX 5HY %LRFKHP +DUW : .UHSSHO / &RPHU ) / $UQROG & 6 6QRZ 0
PAGE 146

+HHVH3HFN $ &ROHP $ %RUNVHQLRXV 2 1 +DUW : DQG 5DLNKHO 1 9 f 3ODQW QXFOHDU SRUH FRPSOH[ SURWHLQV DUH PRGLILHG E\ QRYHO ROLJRVDFFKDULGHV ZLWK WHUPLQDO 1DFHW\OJOXFRVDPLQH 3ODQW &HOO +HQFKR] 6 &KL < &DWDULQ % +HUVNRZLW] 'HVKDLHV 5DQG 3HWHU 0 f 3KRVSKRU\ODWLRQ DQG XELTXLWLQGHSHQGHQW GHJUDGDWLRQ RI WKH F\FOLQGHSHQGHQW NLQDVH LQKLELWRU )DUOS LQ EXGGLQJ \HDVW *HQHV t 'HY +HUVNR $ f 5ROHV RI XELTXLWLQPHGLDWHG SURWHRO\VLV LQ FHOO F\FOH FRQWURO &XUU 2SLQ &HOO %LRO +RFKVWUDVVHU 0 f 8ELTXLWLQGHSHQGHQW SURWHLQ GHJUDGDWLRQ $QQX 5HY *HQHW ,QJUDP & 'R\OH 6 &DUSHQWHU 5 6FKXOW] ( $ 6LPRQ 5 DQG &RHQ ( 6 f 'XDO UROH IRU ILPEULDWD LQ UHJXODWLQJ IORUDO KRPHRWLF JHQHV DQG FHOO GLYLVLRQ LQ $QWLUUKLQXP (0%2 -DFRE 6 DQG 6FXGGHU 3 f *O\FRVLGDVHV LQ VWUXFWXUDO DQDO\VLV 0HWK (Q] -XQJ ( )XFLQL 3 6WHZDUW 0 1RHJHO $ $ DQG 6FKOHLFKHU 0 f /LQNLQJ PLFURILODPHQWV WR LQWUDFHOOXODU PHPEUDQHV WKH DFWLQELQGLQJ DQG YHVLFOHDVVRFLDWHG SURWHLQ FRPLWLQ H[KLELWV D PDQQRVHVSHFLILF OHFWLQ DFWLYLW\ (0%2 -XVW 6HO]HU +RIPDQQ ) *UHHQ $ DQG $NWRULHV Df ,QDFWLYDWLRQ RI 5DV E\ &ORVWULGLXP VRUGHOOLL OHWKDO WR[LQFDWDO\]HG JOXFRV\ODWLRQ %LRO &KHP -XVW 6HO]HU :LOP 0 YRQ (LFKHO6WUHLEHU & 0DQQ 0 DQG $NWRULHV Ef *OXFRV\ODWLRQ RI UKR SURWHLQV E\ &ORVWULGLXP GLIILFLOH WR[LQ % 1DWXUH .DSODQ .% +\PDQ $$ DQG 6RUJHU 3. f 5HJXODWLQJ WKH \HDVW NLQHWRFKRUH E\ XELTXLWLQGHSHQGHQW GHJUDGDWLRQ DQG 6NSOSPHGLDWHG SKRVSKRU\ODWLRQ &HOO .DVDL DQG +LUDED\DVKL f *DOHFWLQV D IDPLO\ RI DQLPDO OHFWLQV WKDW GHFLSKHU JO\FRFRGHV %LRFKHP 7RN\R .DWVXUL / (VKOHPDQ -5 :XQQHU :+ DQG 6KDNLQ(VKOHPDQ 6+ f 7KH K\GUR[\ DPLQR DFLG LQ DQ DVQ;6HU7KU VHTXRQ FDQ LQIOXHQFH 1OLQNHG FRUH JO\FRV\ODWLRQ HIILFLHQF\ DQG WKH OHYHO RI H[SUHVVLRQ RI D FHOO VXUIDFH JO\FRSURWHLQ %LRO &KHP

PAGE 147

.LVKL 7 6HQR 7
PAGE 148

/LV]WZDQ 0DUWL $ 6XWWHUOXW\ + *VWDLJHU 0 :LUEHODXHU DQG .UHN : f $VVRFLDWLRQ RI KXPDQ &8/ DQG XELTXLWLQFRQMXJDWLQJ HQ]\PH &'& ZLWK WKH )ER[ SURWHLQ S 6.3f HYLGHQFH IRU HYROXWLRQDU\ FRQVHUYDWLRQ LQ WKH VXEXQLW FRPSRVLWLRQ RI WKH &'&6&) SDWKZD\ (0%2 /RQHUJDQ 0 ,OLRSRXORV 2 2KK 0 .DPXUD 7 &RQDZD\ 5 & &RQDZD\ : DQG .DHOLQ : f 5HJXODWLRQ RI K\SR[LDLQGXFLEOH P51$V E\ WKH YRQ +LSSHO /LQGDX WXPRU VXSSUHVVRU SURWHLQ UHTXLUHV ELQGLQJ WR FRPSOH[HV FRQWDLQLQJ HORQJLQV %& DQG &XO 0RO &HOO %LRO /XEDV : $ )UDQN : .UDXVH 0 DQG +DQRYHU $ f 2OLQNHG *OF1$F WUDQVIHUDVH LV D FRQVHUYHG QXFOHRF\WRSODVPLF SURWHLQ FRQWDLQLQJ WHWUDWULFRSHSWLGH UHSHDWV %LRO &KHP 0DKHU (5 DQG .DHOLQ :* -U f YRQ +LSSHO/LQGDX GLVHDVH 0HGLFLQH 0DUFKDVH 5 % %RXQHOLV 3 %UXPOH\ / 0 'H\ 1 % %URZQH % $XJHU )ULW] 7 $ .XOHV]D 3 DQG %HGZHOO 0 f 3KRVSKRJOXFRPXWDVH LQ 6DFFKDURP\FHV FHUHYLVLDH LV D F\WRSODVPLF JO\FRSURWHLQ DQG WKH DFFHSWRU IRU D *OFSKRVSKRWUDQVIHUDVH %LRO &KHP 0HGLQD / DQG +DOWLZDQJHU 5 6 f 69 ODUJH 7 DQWLJHQ LV PRGLILHG ZLWK 2 OLQNHG 1DFHW\OJOXFRVDPLQH EXW QRW ZLWK RWKHU IRUPV RI JO\FRV\ODWLRQ *O\FRELRORJ\ 0HKWD '3 ,FKLNDZD 0 6DOLPDWK 3 (WFKLVRQ -5 +DDN 5 0DQ]L $ DQG )UHH]H ++ f $ O\VRVRPDO SURWHLQDVH IURP 'LFW\RVWHOLXP GLVFRLGHXP FRQWDLQV 1 DFHW\OJOXFRVDPLQH SKRVSKDWH ERXQG WR VHULQH EXW QRW PDQQRVHSKRVSKDWH RQ 1 OLQNHG ROLJRVDFFKDULGHV %LRO &KHP 0HLNOH 31J .7 -RKQVRQ ( +RRJHQUDDG 1DQG 6WRQH %$ f 7KH JOXFDQ V\QWKDVH IURP /ROLXP PXOWLIORUXP %LRO &KHP 0RUULV + 5 3£QLFR 0 %DUEHU 0 %RUGROL 5 6 6HGJZLFN 5 DQG 7\OHU $ f )DVW DWRP ERPEDUGPHQW D QHZ PDVV VSHFWURPHWULF PHWKRG IRU SHSWLGH VHTXHQFH DQDO\VLV %LRFKHP %LRSK\V 5HV &RPP 0RUULV + 5 3D[WRQ 7 'HOO $ /DQJKRPH %HUJ 0 %RUGROL 5 6 +R\HV DQG %DWHPDQ 5 + f +LJK VHQVLWLYLW\ FROOLVLRQDOO\DFWLYDWHG GHFRPSRVLWLRQ WDQGHP PDVV VSHFWURPHWU\ RQ D QRYHO TXDGUXSROHRUWKRJRQDODFFHOHUDWLRQ WLPHRIIOLJKW PDVV VSHFWURPHWHU 5DSLG &RPP 0DVV 6SHFWURP

PAGE 149

0RUULV + 5 3D[WRQ 7 3£QLFR 0 0F'RZHOO 5 DQG 'HOO $ f $ QRYHO JHRPHWU\ PDVV VSHFWURPHWHU WKH 472) IRU ORZIHPWRPROHDWWRPROHUDQJH ELRSRO\PHU VHTXHQFLQJ 3URWHLQ &KHP 1DVP\WK f $W WKH KHDUW RI WKH EXGGLQJ \HDVW FHOO F\FOH 7UHQGV *HQHW r 1DWRUII 5 %DOLQVND 0 DQG 3DV]HZVNL $ f $W OHDVW IRXU UHJXODWRU\ JHQHV FRQWURO VXOSKXU PHWDEROLWH UHSUHVVLRQ LQ $VSHUJLOOXV QLGXODQV 0RO *HQ *HQHW 1XJURKR 77 DQG 0HQGHQKDOO 0' f $Q LQKLELWRU RI \HDVW F\FOLQGHSHQGHQW SURWHLQ NLQDVH SOD\V DQ LPSRUWDQW UROH LQ HQVXULQJ WKH JHQRPLF LQWHJULW\ RI GDXJKWHU FHOOV 0RO &HO %LRO 2SGHQDNNHU 5XGG 30 3RQWLQJ &3 DQG 'ZHN 5$ f &RQFHSWV DQG SULQFLSOHV RI JO\FRELRORJ\ )$6(%•]FDQ 6 DQG -RKQVWRQ 0 f 7KUHH GLIIHUHQW UHJXODWRU\ PHFKDQLVPV HQDEOH \HDVW KH[RVH WUDQVSRUWHU +;7f JHQHV WR EH LQGXFHG E\ GLIIHUHQW OHYHOV RI JOXFRVH 0RO &HOO %LRO 3DOFLF 00 +HHU]H /' 6ULYDVWDYD 23 DQG +LQGVJDXO 2 f $ ELVXEVWUDWH DQDORJ LQKLELWRU IRU DOSKD f§!fIXFRV\OWUDQVIHUDVH %LRO &KHP 3DXOVRQ -& DQG &ROOH\ .f *O\FRV\OWUDQVIHUDVHV 6WUXFWXUH ORFDOL]DWLRQ DQG FRQWURO RI FHOO W\SHVSHFLILF JO\FRV\ODWLRQ %LRO &KHP 3HWHUNRIVN\ % DQG 'L%ODVLR 5 f 0RGLILFDWLRQ RI WKH WULWLXPUHOHDVH DVVD\V IRU SURO\O DQG O\V\O K\GUR[\ODVHV XVLQJ 'RZH[ FROXPQV $QDO %LRFKHP 3LVDQR $ 5HGPRQG -: :LOOLDPV ./ DQG *RROH\ $$ f *O\FRV\ODWLRQ VLWHV LGHQWLILHG E\ VROLGSKDVH (GPDQ GHJUDGDWLRQOLQNHG JO\FRV\ODWLRQ PRWLIV RQ KXPDQ JO\FRSKRULQ $ *O\FRELRORJ\ 3LWFKHU 6P\WKH & &DPSEHOO '* DQG &RKHQ 3 f ,GHQWLILFDWLRQ RI WKH N'D VXEXQLW RI UDEELW VNHOHWDO PXVFOH JO\FRJHQ V\QWKDVH DV JO\FRJHQLQ (XU%LRFKHP 3OXPPHU 7+ 7DUHQWLQR $/ DQG +DXHU &5 f 1RYHO VSHFLILF 2JO\FRV\ODWLRQ RI VHFUHWHG )ODYREDFWHULXP PHQLQJRVHSWLFXP SURWHLQV %LRO &KHP 3URFNRS '.LYLULNNR ., 7XGHUPDQ / DQG *X]PDQ 1$ f 0HGLFDO SURJUHVV 7KH ELRV\QWKHVLV RI FROODJHQ DQG LWV GLVRUGHUV 1(QJO-0HG

PAGE 150

5HEVWHLQ 3 :HHNV DQG 6SLHJHOPDQ % f $OWHUHG PRUSKRORJ\ RI YHJHWDWLYH DPRHEDH LQGXFHG E\ LQFUHDVHG H[SUHVVLRQ RI WKH 'LFW\RVWHOLXP GLVFRLGHXP UDVUHODWHG JHQH UDSO 'HY *HQHW 6FKDIHU $ DQG 6RUUHOO 0 f +XPDQ NHUDWLQRF\WHV FRQWDLQ NHUDWLQ ILODPHQWV WKDW DUH JO\FRV\ODWHG ZLWK NHUDWDQ VXOIDWH ([S &HOO 5HV 6FKZRE ( %RKP 7 0HQGHQKDOO 0 DQG 1DVP\WK f 7KH %W\SH F\FOLQ NLQDVH LQKLELWRU SVLFL FRQWUROV WKH *O6 WUDQVLWLRQ LQ 6DFFKDURP\FHV FHUHYLVLDH &HOO 6HDUV 3 DQG :RQJ &+ f (Q]\PH DFWLRQ LQ JO\FRSURWHLQ V\QWKHVLV &HOO 0RO /LIH 6FL 6HGPDN -DQG *URVVEHUJ 6( f $ UDSLG VHQVLWLYH DQG YHUVDWLOH DVVD\ IRU SURWHLQ XVLQJ &RRPDVVLH %ULOOLDQW %OXH $QDO %LRFKHP 6HO]HU +RIPDQQ ) 5H[ :LOP 0 0DQQ 0 -XVW DQG $NWRULHV f &ORVWULGLXP QRY\L DOSKDWR[LQFDWDO\]HG LQFRUSRUDWLRQ RI *OF1$F LQWR 5KR VXEIDPLO\ SURWHLQV %LRO &KHP 6KDUSHU -+ +ROOLV *) DQG 6KDSHU 1/ f *HQRPLF VWUXFWXUH RI PXULQH EHWD JDODFWRV\OWUDQVIHUDVH %LRFKLPLH 6KLEDWD 6 7DNHGD 7 DQG1DWRUL < f 7KH VWUXFWXUH RI QHSKULWRJHQRVLGH $ QHSKULWRJHQLF JO\FRSHSWLGH ZLWK DOSKD1JO\FRVLGLF OLQNDJH -%LRO&KHP 6NRZ\UD &UDLJ ./ 7\HUV 0 (OOHGJH 6DQG +DUSHU -: f )ER[ SURWHLQV DUH UHFHSWRUV WKDW UHFUXLW SKRVSKRU\ODWHG VXEVWUDWHG WR WKH 6&) XELTXLWLQOLJDVH FRPSOH[ &HOO 6RUJHU 3. 'RKHQ\ .) +LHWHU 3 .RSVNL .0 +XIIDNHU 7& DQG +\PDQ $$ f 7ZR JHQHV UHTXLUHG IRU WKH ELQGLQJ RI DQ HVVHQWLDO 6 FHUHYLVLDH NLQHWRFKRUH FRPSOH[ WR '1$ 3URF 1DWO $FDG 6FL 86$ 6RZGHQ 0RUULVRQ 6FKRILHOG 3XWW : DQG (GZDUGV < f $ QRYHO F'1$ ZLWK KRPRORJ\ WR DQ 51$ SRO\PHUDVH ,, HORQJDWLRQ IDFWRU PDSV WR KXPDQ FKURPRVRPH T 7&(%/f DQG WR PRXVH FKURPRVRPH 7FHEOOf *HQRPLFV 6WHPPDQQ 2 DQG /HFKQHU f 7KH 6FHUHYLVLDH NLQHWRFKRUH FRQWDLQV D F\FOLQ &'. FRPSOH[LQJ KRPRORJ DV LGHQWLILHG E\ LQ YLWUR UHFRQVWLWXWLRQ (0%2

PAGE 151

6WXGLHU ): f 8VH RI EDFWHULRSKDJH 7 O\VR]\PH WR LPSURYH DQ LQGXFLEOH 7 H[SUHVVLRQ V\VWHP 0RO %LRO 7HQJXPQXD\ 3 0RUULV +5 'HOO $ 3£QLFR 0 3D[WRQ 7 DQG :HVW &0 f 7KH F\WRSODVPLF )ER[ ELQGLQJ SURWHLQ 6.3 FRQWDLQV D QRYHO SHQWDVDFFKDULGH OLQNHG WR K\GUR[\SUROLQH LQ 'LFW\RVWHOLXP %LRO &KHP 7ULQFKHUD 0 DQG %R]]DUUR 6 f 'LFW\RVWHOLXP F\WRVROLF IXFRV\OWUDQVIHUDVH V\QWKHVL]HV + W\SH WULVDFFKDULGH LQ YLWUR )(%6 /HWW 7\HUV 0 7RNLZD 1DVK 5 DQG )XWFKHU % f 7KH &OQ&GF NLQDVH FRPSOH[ RI 6FHUHYLVLDH LV UHJXODWHG E\ SURWHRO\VLV DQG SKRVSKRU\ODWLRQ (0%2 8UR&RVWH ( )RQWD & +HWH\ ) 3HUUHW ) 'HOLVOH 0 % &DSXW DQG ,PEHUW 0 f ([SUHVVLRQ RI 6NSO P51$ DQG SURWHLQ LQ UDW EUDLQ GXULQJ SRVWQDWDO GHYHORSPHQW 1HXURUHSRUW 9DUNL $ f %LRORJLFDO UROHV RI ROLJRVDFFKDULGHV DOO WKH WKHRULHV DUH FRUUHFW *O\FRELRORJ\ 9HUPD 5 $QQDQ 56 +XGGOHVWRQ 0&DUU 6$ 5H\QDUG DQG 'HVKDLHV 5Df 3KRVSKRU\ODWLRQ RI 6LFOS E\ &GN UHTXLUHG IRU LWV GHJUDGDWLRQ DQG HQWU\ LQWR 6 3KDVH 6FLHQFH 9HUPD 5 )HOGPDQ 505 DQG 'HVKDLHV 5Ef 6,& LV XELTXLWLQDWHG LQ YLWUR E\ D SDWKZD\ WKDW UHTXLUHV &'& &'& DQG &\FOLQ&'. DFWLYLWLHV 0RO %LRO &HOO 9H\QD 1$ -D\ -& 6ULVRPVDS & %RXQHOLV 3 DQG 0DUFKDVH 5% f 7KH DGGLWLRQ RI JOXFRVH SKRVSKDWH WR WKH F\WRSODVPLF JO\FRSURWHLQ SKRVSKRJOXFRPXWDVH LV PRGXODWHG E\ LQWUDFHOOXODU FDOFLXP LQ 3& FHOOV DQG UDW FRUWLFDO V\QDSWRVRPHV -1HXURFKHP 9OLHJHQWKDUW -)* DQG 0RQWUHXLO f 3ULPDU\ VWUXFWXUH RI JO\FRSURWHLQ JO\FDQV ,Q 0RQWUHXLO 6FKDFKWHU + DQG 9OLHJHQWKDUW -)* HGVf *O\FRSURWHLQV (OVHYLHU $PVWHUGDP 7KH 1HWKHUODQGV SS :HVW & 0 (UGRV : DQG 'DYLV 5 f *O\FRDQWLJHQ H[SUHVVLRQ LV UHJXODWHG ERWKH WHPSRUDOO\ DQG VSDWLDOO\ GXULQJ GHYHORSPHQW LQ WKH FHOOXODU VOLPH PROGV 'LFW\RVWHOLXP GLVFRLGHXP DQG PXFRURLGHV 0RO &HOO %LRFKHP :HVW &0 .R]DURY ( DQG 7HQJXPQXD\ 3 f 7KH F\WRVROLF JO\FRSURWHLQ 6.3 RI 'LFW\RVWHOLXP GLVFRLGHXP LV HQFRGHG E\ WZR JHQHV UHVXOWLQJ LQ D SRO\PRUSKLVPQ DW D VLQJOH DPLQR DFLG SRVLWLRQ *HQH

PAGE 152

:HVW &0 6FRWW:DUG 7 7HQJXPQXD\ 3 YDQ GHU :HL + .R]DURY ( DQG +X\QK $ f 3XULILFDWLRQ DQG FKDUDFWHUL]DWLRQ RI DQ DO/IXFRV\OWUDQVIHUDVH ZKLFK PRGLILHV WKH F\WRVROLF SURWHLQ 6.3 IURP WKH F\WRVRO RI 'LFW\RVWHOLXP -%LRO&KHP
PAGE 153

%,2*5$3+,&$/ 6.(7&+ 'U 3DWDQD 7HQJXPQXD\ ZDV ERP RQ 'HFHPEHU LQ %DQJNRN 7KDLODQG +H JUDGXDWHG DQ 0' ZLWK WKH ILUVW FODVV KRQRU IURP WKH &KXODORQJNRP 8QLYHUVLW\ %DQJNRN 7KDLODQG LQ DQG UHFHLYHG WKH 7KDL ERDUG FHUWLILFDWHV LQ ,QWHUQDO 0HGLFLQH DQG LQ 1HSKURORJ\ LQ DQG UHVSHFWLYHO\ +H HQWHUHG WKH &HOO DQG 'HYHORSPHQWDO %LRORJ\ 3URJUDP 'HSDUWPHQW RI $QDWRP\ DQG &HOO %LRORJ\ 8QLYHUVLW\ RI )ORULGD LQ -DQXDU\ DQG EHFDPH D 3K' FDQGLGDWH LQ )HEXDU\ +H FRPSOHWHG WKH UHTXLUHPHQWV IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ LQ 'HFHPEHU

PAGE 154

, FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ MEMXN[ f0 &KULVWRSKHU 0 :HVW &KDLU $VVRFLDWH 3URIHVVRU RI $QDWRP\ DQG &HOO %LRORJ\ FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ \Mn MPr *XGUXQ 6 %HQQHWW 5HVHDUFK 3URIHVVRU RI $QDWRP\ DQG &HOO %LRORJ\ FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ :LOOLDP $ 'XQQ -U $VVRFLDWH 3URIHVVRU RI $QDWRP\ DQG &HOO %LRORJ\ FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ -HIIUH\ +DUULVR $:GMWDQW 3URIHVVRU RI 3KDUPDFRORJ\ DQG 7KHUDSHXWLFV 7KLV GLVVHUWDWLRQ ZDV VXEPLWWHG WR WKH *UDGXDWH )DFXOW\ RI WKH &ROOHJH RI 0HGLFLQH DQG WR WKH *UDGXDWH 6FKRRO DQG ZDV DFFHSWHG DV SDUWLDO IXOILOOPHQW RI WKH UHTXLUHPHQWV IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ 'HFHPEHU 'HDQ &ROOHJH RI 0HGLFLQH 'HDQ *UDGXDWH 6FKRRO


xml version 1.0 encoding UTF-8
REPORT xmlns http:www.fcla.edudlsmddaitss xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.fcla.edudlsmddaitssdaitssReport.xsd
INGEST IEID E4KH6146T_ORBXM6 INGEST_TIME 2014-08-28T20:53:08Z PACKAGE AA00025055_00001
AGREEMENT_INFO ACCOUNT UF PROJECT UFDC
FILES


STRUCTURE OF A SKP1-GLYCAN AND BIOGENESIS OF ITS PEPTIDE
LINKAGE IN DICTYOSTELIUM
By
PATANA TENG-UMNUAY
A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY
UNIVERSITY OF FLORIDA
1998

ACKNOWLEDGEMENTS
I would like to acknowledge my supervisor, Dr. Christopher M. West, for
allowing me to be a part of this interesting project and for his time and guidance. I would
also like to thank other members of my committee, Dr. Jeffrey K. Harrison, Dr. Gudrun
S. Bennett, and Dr. William A. Dunn, for their time and advice.
In addition, I would like to acknowledge the scientists who helped me in this
project, Drs. Howard R. Morris, Anne Dell, Maria Pánico, and Thanai Paxton for their Q-
TOF-MS study on the fucoglycopeptide, Dr. Michael R. Bubb for bringing us an idea of
the actin binding motif and for his work on Skpl-actin interaction, Ms. Hanke van der
Wei for her assistance and the preliminary work on purifying glycopeptide, Dr. Emil
Kozarov for preparing the HW120 strain and the recombinant Skpl-His, Mr.Toby Scott-
Ward for sharing his time with me on the fucosyltransferase project, Miss Kathryn T.
Dobson for helping me screening Skpl-c-myc co-expression colonies, and Mr. Benjamin
G. Luttge, Ms. Bonita Werts, Mr. Ryan Frankel, and Mr. Slim Sassi for their help in the
GlcNAc-transferase project.
I would like to express my gratitude to Dr. Nancy D. Denslow and the scientists
at the University of Florida ICBR Protein Chemistry Core Laboratory, Ms. Sara E.
Petruska for showing me how to use MALDI-TOF-MS instrument, Mr. Edy Segura for
the Edman degradation sequencing, and Mr. Alfred Chung for preparing the synthetic
u

peptides. Dr. David Rentz and Mr. James B. Parker at the University of Florida ICBR
Glycobiology Core Laboratory are acknowledged for their assistance in the GC-MS and
the Dionex-HPLC.
I would like to thank faculty members, secretaries, and graduate students in the
Department of Anatomy and Cell Biology for their valuable friendship and for being an
important part of my education. I also acknowledge my professor at the Chulalongkorn
University, Dr. Visit Sitprija, for inspiring me to become a scientist.
Finally, I would like to thank my mother for believing in me, for teaching me to be
a strong person, and for telling me not to give up my dream. Without her understanding
and support, I would not be able to achieve my goal.

TABLE OF CONTENT
page
ACKNOWLEDGMENTS ii
LIST OF TABLES vii
LIST OF FIGURES viii
LIST OF ABBREVIATIONS xi
ABSTRACT xiii
CHAPTERS
1 INTRODUCTION
Protein Glycosylation 1
Dictyostelium Skpl, a Marker Protein for a Novel Glycosylation Pathway 5
Skpl is a Highly Conserved Protein with Multiple Cytoplasmic/Nuclear
Functions 5
Skpl Mediates its Actions through an F-box Motif 7
Skpl Mediates Ubiquitin-Dependent Proteolysis of Cell Cycle and Other
Proteins through SCF complex 10
Skpl Mediates Phosphorylation of a Kinetochore Protein through an F-box
Motif which is Important for Kinetochore Assembly 12
The Possible Role of Skpl in von Hippel-Lindau Disease 13
The Importance of Skpl-Glycosylation Study 14
The Characteristics and Compartmentalization of Skpl-Glycosylation 15
2 THE GLYCOSIDIC LINKAGE AND STRUCTURE OF SKP1 GLYCAN
Introduction 17
Materials and Methods 19
Cells 19
Construction of Skpl-c-myc Overexpression Strain HW120 19
Preparation of Recombinant Dictyostelium Skpl (Skpl-His) 20
iv

Purification of Skpl 21
Metabolic Labeling of Skpl 23
Monosaccharide Composition Analysis of Skpl-c-myc 23
Purification of Glycosylated Peptides 23
Matrix-Assisted Laser Desorption Time-of-Flight (MALDI-TOF) Mass
Spectrometry 24
Q-TOF Mass Spectrometry 24
Exoglycosidase Digestion of Skpl Glycopeptides 24
Mild Acid Hydrolysis of the Fucoglycopeptide 26
Results 26
Skpl Contained Only a Single Fucoglycopeptide 26
Edman Degradation of Fucoglycopeptide Yielded the Sequence of
Peptide 139-151 28
Q-TOF MS Analysis Directly Demonstrated the Attachment of
Pentasaccharide at Pro 143 28
MALDI-TOF MS Analysis of the Fucoglycopeptide 37
Sugar Composition Analysis of Skpl-c-myc 37
Exoglycosidase Digestion of Fucoglycopeptide 40
MALDI-TOF-MS Analysis of Afucosylated-Glycopeptide 42
Glycosylation Heterogeneity 47
Discussion 50
3 CHARACTERIZATION OF SKP1-GLCNAC TRANSFERASE
Introduction 58
Materials and Methods 59
GlcNAc-Transferase Assay 59
Protein Concentration Determination 61
Preparation of 5-Hg-dUMP Resin 62
Preparation of Aminoallyl-UDP-GlcNAc-Sepharose for Affinity
Chromatography 63
GlcNAc-Transferase Purification 65
High-pH Anion-Exchange Chromatography of the Acid Hydrolysis
Derivatives of [3H]GlcNAc-Skpl 68
The Reductive Alkaline Degradation of [3H]GlcNAc-Skpl 68
Results 69
GlcNAc-Transferase Activity that Modified Skpl was Found in
the SI00 Fraction of Dictyostelium 69
Purification Step 1: Anion Exchange Chromatography on DEAE
Fast-Flow 75
v

Purification Step 2: Ammonium Sulfate Precipitation 79
Purification Step 3: Hydrophobic Interaction Chromatography on
Phenyl-Sepharose-(Low-Sub) Fast-Flow 83
Purification Step 4: Reactive Dye Chromatography on Reactive Red-120
Fast-Flow 83
Purification Step 5: Gel Filtration Chromatography on Superdex HPLC 87
The Effects of Nucleotide Analogues on GlcNAc-Transferase Activity 93
Purification Step 6: 5-Hg-dUMP-Sepharose 6B Chromatography 96
Purification Step 7: affinity Chromatography on
5-(-3-aminoallyl)-UDP-GlcNAc Sepharose-4 Fast-Flow 100
Characteristics of the Acceptor Substrate Product 103
Kinetic Properites of the Skpl-GlcNAc-Transferase 105
Discussion 110
4 SUMMARY AND PERSPECTIVES
Structure and Biogenesis of a Skpl-Glycan 114
Dictyostelium Skpl Contains a Novel Pentasaccharide Linked to
Hydro xyproline 114
Evidence of Skpl-Prolylhydroxylase Activity in the Cytosol 115
Characterization of Cytosolic Skpl-GlcNAc-Transferase 117
Characterization of Cytosolic Skpl-Fucosyltransferase 118
Evidence of Skpl-Galactosyltransferase in the Cytosol of Dictyostelium 119
The Effects of Dictyostelium Skpl on Actin Polymerization 119
Preparation of Skpl-c-myc Co-expression Strains 120
Construction of a Plasmid Encoding Skpl-c-myc 120
In Vitro Site-Directed Mutagenesis of p48 122
Transformation of Dictyostelium Strain Ax3 124
Future Direction 126
REFERENCES 128
BIOGRAPHICAL SKETCH 139
vi

LIST OF TABLES
Table page
1.1. Glycosidic peptide linkage 3
1.2. Amino acid sequences of Skpl at positions 35-40 9
2.1. Exoglycosidase treatments of glycopeptides 25
2.2 Predicted m/z values of endo-Lys-C derived Skpl peptides 29
2.3 MALDI-TOF-MS m/z values for endo-lys-c-derived glycopeptides 51
2.4 Phylogenetic comparison of sequences surrounding Pro 143 54
3.1 Purification of GlcNAc-transferase activity 80
3.2 Relative activity of the GlcNAc-transferase in the presence of donor
substrate analogues 94
4.1 The oligonucleotide primers used to prepare Skp 1 -c-myc plasmids 123
Vll

LIST OF FIGURES
Figure page
1.1 Genomic map of the regions surrounding the fpal and fpa2 genes 8
2.1. Purification of the [3FI]fucoglycopeptide from Skpl 27
2.2 Q-TOF MS analysis of Skpl fucoglycopeptide 30
2.3 MS/MS collisionally activated decomposition spectrum of m/z 829.42+++ 31
2.4 Parts of the MS/MS spectrum shown in Fig. 2.3 expanded to show lower
mass region containing peptide-derived fragment ions more clearly 33
2.5 Parts of the MS/MS spectrum shown in Fig. 2.3 expanded to show higher
mass region containing peptide-derived fragment ions more clearly 34
2.6 Predicted masses of N and C terminal sequence ions of the
fucoglycopeptide 35
2.7 MALDI-TOF-MS analysis of Skpl glycopeptides from normal strain Ax3 38
2.8 Fractionation of endo-Lys-C generated Skpl-His peptides 39
2.9 GC-MS analysis of Skpl-c-myc total sugars 41
2.10 A time course MALDI-TOF-MS analysis of Skpl fucoglycopeptide
after mild acid hydrolysis 43
2.11 Fractionation of endo-Lys-C generated afucosylated Skpl peptides 44
2.12 MALDI-TOF-MS analysis of Skpl glycopeptides from
afucosylation strain HL250 46
2.13 Fractionation of endo-Lys-C generated Skpl-c-myc peptides 48
2.14 The mass spectra of endo-Lys-C generated Skpl-c-myc peptides 49
3.1 Transfer of [3H] from UDP-[3H]-GlcNAc into SI00 fractions of normal strain
Ax3 and overexpression strain HW120 71
3.2 Transfer of [3H] from UDP-[3H]G1cNAc into S100 fractions of normal strain Ax3
and overexpression strain HW120 in the presence of Skpl-peptide 133-155 72
3.3 Inhibition of GlcNAc-transferase activities by synthetic peptide 133-155 and
anti-Skpl-antibody 73
3.4 GlcNAc-transferase activity is specific for Skpl-c-myc 74
vm

3.5 Transfer of [3H] from UDP-[3H]-G1cNAc into PI 00 fractions of normal strain
Ax3 in the presence of Skpl-c-myc 76
3.6 The effects of pH on Skpl-GlcNAc-transferase activity 77
3.7 GlcNAc-transferase activities in the flowthrough and wash fractions from
DEAE-Sepharose 78
3.8 The effects of NaCl and KC1 on GlcNAc-transferase activity 81
3.9 The effects of CaCl2 and MnCl2 on GlcNAc-transferase activity 82
3.10 Purification of GlcNAc-transferase on phenyl-Sepharose low-sub column 84
3.11 Purification of GlcNAc-transferase on a Reactive Red-120 column 85
3.12 Reactive Red flowthrough fractions could not restore GlcNAc-transferase
activity 86
3.13 Ax3-S100 or phenyl-Sepharose fraction did not increase GlcNAc-transferase
activity in the Reactive-Red purified fraction 88
3.14 Purification of GlcNAc-transferase on a Superdex gel filtration HPLC
column 89
3.15 The GlcNAc-transferase activity is dependent on DTT 90
3.16 The GlcNAc-transferase activity is dependent on MgCl2 91
3.17 The effects of detergents on GlcNAc-transferase activities 92
3.18 The chemical structure of UDP-GlcNAc and the potential enzyme recognition
sites tested by nucleotide analogues 95
3.19 The structure of 5-Hg-dUMP-Sepharose 6B 97
3.20 The effects of uracil on Superdex purifed and dUMP-Sepharose purified
GlcNAc-transferase 98
3.21 Time course analysis of GlcNAc-transferase activity 99
3.22 Chromatography of the reaction products from 5-(3-aminoallyl)-UDP-GlcNAc
synthesis after purification over a DEAE Sepharose Fast Flow column 101
3.23 The structure of 5-(3-aminoallyl)-UDP-GlcNAc Sepharose 4 102
3.24 Purification of GlcNAc-transferase activity on 5-(3-aminoallyl)-UDP-GlcNAc
Sepharose 104
3.25 High-pH anion-exchange chromatography of the acid hydrolysis derivatives
of [3H]GlcNAc-Skpl 106
ix

3.26 Kinetic properties of the GlcNAc-transferase with respect to the HyPro
peptide 107
3.27 Kinetic properties of the GlcNAc-transferase with respect to
Skpl-c-myc 108
3.28 Kinetic properties of the GlcNAc-transferase with respect to
UDP-GlcNAc 109
4.1 Inhibition of actin polymerization by Dictyostelium Skp 1 121
x

LIST OF ABBREVIATIONS
Ara
arabinose
ATP
adenine 5’-triphosphate
Bio-11-UTP
5 -(N- [N-biotinyl-e-aminocaproy 1] -3 -aminoally l)-2 ’ -UTP
cFTase
cytosolic fucosyltransferase
CTP
cytosine 5’-triphosphate
Da
dalton
DEAE
diethylaminoethyl
DMF
N,l\p -dimethylformamide
DTT
dithiothreitol
dUDP
2’-deoxy-uridine 5’-diphosphate
dUMP
2 ’ -deoxy-uridine 5 ’ -monophosphate
EDTA
ethylenediamine-tetraacetic acid
Gal
D-galactose
GalNAc
N-acetylgalactosamine
GC-MS
gas chromatography mass spectrometry
Glc
D-glucose
GlcNAc
N-acetyl-D-glucosamine
h2o
water
HC1
hydrochloric acid
HEPES
N-(2-Hydroxyethyl)piperazine-N’-(2-ethanesulfonic acid)
Hg(2+)
mercury
HgCl
mercury chloride
HPLC
high pressure liquid chromatography
KC1
potassium chloride
LiCl
lithium chloride
LSB
Lammeli sample buffer
mAb
monoclonal antibody
MALDI-TOF MS
matrix-assisted laser desorption time-of-flight mass spectrometry
Man
mannose
MeCN
acetonitrile
Mr
molecular weight
NaBH4
sodium borohydride
NaCl
sodium chloride
NaOAC
sodium acetate
NaOH
sodium hydroxide
NHS
N-hydroxysuccinimide
xi

(NH4)2S04
ammonium sulfate
ORF
open reading frame
PAGE
polyacrylamide gel electrophoresis
PCR
polymerase chain reaction
POPOP (dimethyl)
l,4-Bis(2-(4-Methyl-5-Phenyloxazoyl))Benzene
PPO
2,5-Diphenyloxazole
Q-TOF MS
quadrupole time-of-flight mass spectrometry
Rha
rhamnose
RP-HPLC
reversed phase-high pressure liquid chromatography
SDS
sodium dodecyl sulfate
TEA
triethylamine
TEAB
triethylamine-bicarbonate
TFA
trifluoroacetic acid
TMS
trimethylsilyl
UDP
uridine 5’-diphosphate
UMP
uridine 5’-monophosphate
UTP
uridine 5’-triphosphate
Xyl
xylose
XU

Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy
STRUCTURE OF A SKP1-GLYCAN AND BIOGENESIS OF ITS PEPTIDE
LINKAGE IN DICTYOSTELIUM
By
Patana Teng-umnuay
December, 1998
Chairman: Christopher M. West, Ph.D.
Major Department: Anatomy and Cell Biology
Skpl is involved in the ubiquitination of certain cell cycle and other proteins. In
Dictyostelium discoideum, Skpl has an unusual 0-linked carbohydrate modification.
Based on Edman degradation, MALDI-TOF-MS, Q-TOF-MS-MS decomposition, acid
hydrolysis, and exoglycosidase studies of Skpl-glycopeptides from both normal cells and
a fucosylation mutant, and the sugar composition of the protein determined by GC/MS
analysis of TMS-derivatives of methanolysates, the glycan is concluded to consist of a
linear pentasaccharide (Galal-6Galal-Fucal-2Gal(3l -3GlcNAc) attached to a
hydroxyproline at codon 143, which lies in a highly conserved region of the protein. The
structure of the pentasaccharide and its glycosidic peptide linkage indicate a novel
pathway of protein glycosylation which is predicted to consist of six novel enzymes
including a prolyl-hydroxylase and five glycosyltransferases. An assay was developed for

the GlcNAc-transferase responsible for the attachment of the first sugar to the HyPro
residue, using UDP-[3H]G1cNAc as a donor, and underglycosylated Skpl isolated from a
Dictyostelium overexpression strain or a synthetic peptide as an acceptor. Skpl-GlcNAc-
transferase activity was found in the SI00 fraction but not in the PI00 particulate
fraction. The recombinant Skpl from E.coli and the synthetic peptide containing Pro in
place of HyPro were inactive. The radioactivity was recovered as GlcNH2 after acid
hydrolysis, indicating the incorporation of GlcNAc. Incorporated GlcNAc could not be
released by ^-elimination, indicating the attachment to HyPro. The GlcNAc-transferase
activity was purified to 17,000 folds with 14% yield from the cytosolic SI00 fraction
over DEAE, phenyl, Reactive Red, Superdex, dUMP, and UDP-GlcNAc columns. The
enzyme behaved as a single component with an apparent Mr of 33,000 and apparent Km
for UDP-GlcNAc of 0.16 pM. Activity of the enzyme was absolutely dependent on
DTT. The presence of this enzyme in the cytosolic fraction, its requirement for a
reducing environment, and its high affinity for UDP-GlcNAc strongly suggest that the
GlcNAc-transferase glycosylates Skpl in the cytoplasm. The Skpl-GlcNAc-transferase
and the previously described Skpl-fucosyltransferase appear to belong to a glycosylation
pathway which is novel with respect to the structure formed and its
compartmentalization in the cytoplasm rather than in the secretory pathway.
xiv

CHAPTER 1
INTRODUCTION
Protein Glycosylation
Glycosylation, the construction of oligosaccharide side chains of proteins and
lipids, is the most common and the most diverse type of protein posttranslational
modification. It is known to occur in every eukaryotic organisms and in some prokaryotic
organisms including many species of archaebacteria and eubacteria (reviewed in Hart,
1992, Opdenakker et ah, 1993). In an individual glycoprotein, more than one
carbohydrate attachment is often present and each attachment site may contain different
glycans. This microheterogeneity generates multiple glycoforms which may have different
physical and biochemical properties and may lead to different functions.
Glycans are conjugated to proteins by three types of covalent linkages: A-linked,
O-linked, and phosphate-linked glycosylation. The most well known A-glycosidic
linkages are formed between N-acetylglucosamine and the amido group of L-asparagine. It
is initiated in the rER by the en bloc transfer of a Glc3Man9GlcNAc2 precursor from a
dolichol carrier onto the nitrogen in the asparagine of nascent polypeptides. The
oligosaccharide structures are later modified in the ER and in the Golgi apparatus
(reviewed in Komfeld & Komfeld, 1985, Abeijon & Hirschberg, 1992). The asparagine
which is the attachment site for the GlcNAc residue is a part of a consensus motif, Asn-
X-Ser/Thr, where X may be any amino acid except proline. The Asn-X-Thr motif is
more commonly utilized compared to the Asn-X-Ser motif (Kasturi et al., 1995). The
1

2
exception to this motif is nephritogenoside, in which glucose is A-linked to the sequence
Asn-Pro-Leu (Shibata et al, 1988). Other iV-linked monosaccharides were discovered in
bacterial glycoproteins including glucose, N-acetylgalactosamine and rhamnose (Lis and
Sharon, 1993).
O-glycosidic linkages are formed between oligosaccharide side chains and the
hydroxyl group of serine, threonine, tyrosine, hydroxylysine, or hydroxyproline. Most of
the O-linked glycosylation pathways also occur in the secretory pathway. The
oligosaccharide side chains are linked through the oxygen of hydroxyl group of serine,
threonine, tyrosine, hydroxylysine, or hydroxyproline by sequential enzymatic additions
of monosaccharides directly to the protein, beginning with N-acetyl-galactosamine in
mucin-type glycans. In contrast to A-linked glycosylation, different types of O-linked
glycosidic-peptide linkages have been identified (Table 1.1). Whereas the existence of
specific motifs for the acceptor site has been identified in most of O-glycosylproteins
(Bourdon et al., 1987; Harris and Spellman, 1993; Pisano et al., 1993; Plummer et al.,
1995, Prockop et al., 1979), the consensus motifs of O-linked glycosylation in the
secretory pathway are less defined which might be explained by different types of
GalNAc-transferases (reviewed in Clausen & Bennett, 1996).
Recently, a new type of carbohydrate-peptide linkage named
phosphoglycosylation has been demonstrated in Proteinase I isolated form Dictyostelium
discoideum. It contains G1cNAc-1-P04 linked to serine (Gustafson and Milner, 1980).
Thereafter, 2 other cystein proteinases from D.discoideum were also shown to posses
GlcNAc-1- P04 phosphoglycosylation (Mehta et al., 1996). Besides D. discoideum,

3
Table 1.1 Glycosidic peptide linkage (modified from Vliegenthart and Montreuil, 1995)
Type of glycoprotein
Amino acid
Reducing terminus
monosaccharide
N-dvcosvlnroteins
Secretory type
Asn
(3-GlcNAc
Bacterial proteins
Asn
(3-GalNAc
Bacterial proteins
Asn
a/(3-Glc
Bacterial proteins
Asn
L-Rha
O-elvcosvlnroteins
Mucin type glycoproteins
Ser/Thr
oc-GalNAc
Cytosolic proteins
Ser/Thr
(3-GlcNAc
Yeast proteins
Ser/Thr
Man
Rat tissues
Ser/Thr
a-L-Fuc
Proteoglycan
Ser
P-xyi
Worm collagen
Ser
a-Gal
Factor IX
Ser
[3-Glc
Collagen
OH-Lys
(3-Gal
Extensin
OH-Pro
(3-L-Araf
Algae proteins
OH-Pro
(3-Gal
Skpl
OH-Pro
GlcNAc
Glycogenin
Tyr
a-Glc
Clostridium protein
Tyr
(3-Glc

4
other examples of phosphoglycosylation were also identified in Leishmania secreted acid
phosphatases, and Trypanosoma cruzi cell surface glycoproteins (reviewed in Haynes,
1998).
Even though glycosylation was first localized in the endoplasmic reticulum and
the Golgi complex of eukaryotic cells, it has been shown that the cytosol is a site of a
simple form of glycosylation: the attachment of single N-acetylglucosamine residues in O-
linkage to serines and/or threonines on multiples sites of nuclear and cytoplasmic proteins
(termed O-GlcNAc) (reviewed in Haltiwanger et al., 1992b, Hart 1997). The first O-
GlcNAc proteins to be identified were the nuclear pore proteins. Thereafter, an increasing
number of O-GlcNAc proteins in cytosolic and nucleoplasmic compartments have been
recognized. The model that (9-GlcNAc occurs in the cytosol has been confirmed by the
finding that a UDP-GlcNAc:polypeptide O-GlcNAc glycosyltransferase enzyme can be
purified from a cytosolic preparation of the liver (Haltiwanger et al., 1992a). Besides O-
GlcNAc proteins, other known cytosolic proteins which contain carbohydrate include
glycogenin, phosphoglucomutase, and Dictyostelium Skpl. Glycogenin is a precursor for
glycogen synthesis. Its tyrosine residue is attached with glucose. After a glycogen
synthesis is completed, the protein buries itself inside the glycogen molecule (Pitcher et
al., 1987, reviewed in Alonso et al., 1995). Phosphoglucomutase or parafusin is a cytosoic
enzyme catalyzing the converting reaction of glucose-1-P04 into glucose-6- P04. Its
glycan consists of Man capped by Glc-1-P04 (Dey et al. 1994, Marchase et al., 1993,
Veyna et al., 1994).

5
Dictyostelium Skpl, a Marker Protein for a Novel Glycosylation Pathway
In Dictyostelium discoideum, Skpl (S phase kinase-associated protein 1 or
suppressor of kinetochore protein 1) was discovered in the mutant strain HL250 which is
defective in the ability to make GDP-fucose from GDP-mannose and consequently, is
unable to carry out any fucosylation (Gonzales-Yanes et al., 1992). When exogenous
fucose was given, HL250 cells could synthesize GDP-fucose via a salvage pathway.
Treatment of HL250 vegetative cells with 3H-fucose showed that majority of 3H-fucose
was incorporated into a single protein, Skpl (previously known as FP21).
In a cytosolic preparation of Dictyostelium discoideum, Skpl was present in both
the SI00 which is a cytosolic fraction after centrifugation at 100,000 g, and the PI00
which is a particle fraction. The P100-Skpl was salt but not detergent extractable. These
data are relevant to immunofluorescence studies using antibody against Skpl showing the
localization of Skpl in the cytosol, on the membrane of large vesicle-like structures, and
in the membrane ruffle. The cytosolic-localization of Skpl raised the possibility of a
novel pathway of glycosylation in the cytosolic compartment of eukaryotic cells.
Skpl is a Highly Conserved Protein with Multiple Cytoplasmic/Nuclear Functions
Skpl is an evolutionarily conserved protein expressed in all eukaryotic organisms.
Skpl homologs have been found in Saccharomyces cerevisiae, Homo sapiens, Cavia
porcellus (OCP-II), Emericella nidulans (SconC), Arabidopsis thaliana, Phaseolus
vulgaris, Caenorhabditis elegans, chlorella virus (PBCV-1) genome, and many others.
The sequence analysis of homologs of Skpl gene shows more than 60% identity in
pairwise comparisons. The cellular compartmentation of Skpl appears to be varied

6
depending on the tissue or cell type. The localization of Skpl indicates multiple proposed
functions in both nuclei and cytoplasm.
In human transformed fibroblasts, Skpl was copurified with Skp2-cyclin A-Cdk2
complex and was named Skpl for S phase kinase-associated protein (Zhang et al., 1995).
Skpl is indirectly associated with cyclin A by binding to a F-box motif on Skp2p. Even
though the function of Skpl in mammalian cells seems to be cell cycle regulatory, the
expression of Skpl in the cytosol of the inner ear organ of Corti in guinea pig (Chen et al.,
1995) and in rat brain neurons which do not express cyclin A and CDKs (Uro-Coste et
al., 1997) implicates other functions of Skpl.
In E. nidulans, the Skpl homolog, SconC, is important in sulphur metabolite
repression, a condition when the addition of methionine to the growth medium reduces
the utilization of less favored sulphur sources such as sulphate (Natorff et al., 1993).
Most of the known functions of Skpl came from studies in yeast. In S. cerevisiae,
Skpl homolog was identified as a cyclin F binding protein using the two-hybrid system
(Harper et al., 1993). It was also independently identified as a component of S. cerevisiae
kinetochore binding protein, Cbf3p, and was coincidentally named Skpl for suppressor
of kinetochore protein 1 (Stemmann and Lechner, 1996).
Different temperature-sensitive alleles of Skpl show that Skpl is required for cell
cycle progression at both the Gl/S and G2/M checkpoints. In one study, the mutation of
lie to Asn at codonl72 (Skpl-3) caused haploid cells to arrest with a G1 DNA content
whereas the mutation of Leu to Ser at codonl46 (Skpl-4) caused haploid cells to arrest
with a G2 DNA content with an increased rate of chromosome missegregation (Connelly

7
and Hieter, 1996). In another study, the temperature sensitive mutant carrying two
mutations resulting in G160E and R167K changes caused cells to arrest with a G1 DNA
content whereas the mutant with L8G change caused cells to arrest in both G1 and G2
(Bai et ah, 1996). It is notable that all of these amino acids where the mutation occured are
well-conserved among species including D. discoideum.
S.cerevisiae Skpl has a 28 amino acid insertion (codon 37-64) when aligned with
the other homologs of Skpl. Since a plasmid construct with an in-frame deletion of the 28
amino acids could rescue a null mutation of Skpl and high level of expression of the
human gene can complement the Skpl temperature sensitive mutant, the amino acid
insertion in the yeast protein seems not to be critically important (Bai et al., 1996).
In Dictyosteliwn, Skpl is encoded by 2 genes named fpa 1 and fpdl which are well-
conserved (Fig. 1.1, West et ah, 1997). The coding regions of both genes differ by 33
nucleotides and a short intron within the codon33 in fpal. Both genes encode identical
proteins except a single amino acid Ser/Ala at the codon 39. The amino acid sequencing of
Skpl detected both A and S at codon 39 indicating that both genes were expressed (Table
1.2, West et ah, 1997). In comparison to Dictyosteliwn, there appears to be 1 gene in S.
cerevisiae, more than 7 genes in C. elegan, and 2 loci in mammalian cells (Chen et ah,
1995, Demetrick et ah, 1996).
Skpl Mediates its Actions through an F-box Motif
Sequence comparison of Skpl-interacting proteins (Skp2 and cyclin F) revealed an
important motif, F-box, as a Skpl binding site (Bai et ah, 1996). The examples of F-box
proteins include Cdc4, cyclin F, Skp2, Grrl, Scon-2, and other undefined sequences

8
fpa 1
4
AB1R1
R1 V
B1 A
4-4
3.1 4.3
fpa2
N
-4.0
VV NB1X1
B1
4-
-1.7 -1.0
0 / \ 0.7 1.0 1.1
0.34 0.55
R1B1
-4
4.5 kb
Figure 1.1 Genomic map of the regions surrounding the fpal and fpa2 genes. The
regions corresponding to the cDNA offpal are represented by the boxes. Distances are
given in kb from the start of the fpal cDNA. N= Ndel, A=Accl. Bl~BstBI, Rl=2?coRI,
V= EcoRV, Xl= BstXI. (West et al., 1997)

9
Table 1.2 Amino acid sequences of Skpl at positions 35-40
Amino acid Position
35
36
37
38
39
40
Gly
5.73
0.95
0.24
0.00
0.09
0.00
Glu
0.00
5.12
0.54
0.00
0.15
0.00
Ser
0.07
0.00
1.85
0.14
0.45
0.00
Asp
0.07
0.00
0.00
3.85
0.51
0.17
Ala
0.02
0.00
0.02
0.00
2.46
0.49
Pro
0.00
0.14
0.00
0.00
0.01
3.02
Skpl sequence
G
E
S
D
A/S
P
fpa\ sequence
G
E
s
D
S
P
fpal sequence
G
E
s
D
A
P
Amino acid sequence of the Mr 10,600 CNBr fragment isolated from total Skpl isolated
from the soluble S100 fraction. Amino acid yields for cycles 5-10, corresponding to
positions 35-40 of the intact protein, are given. In addition, both gene products are found
in both soluble (I & II) Skpl pools (West et al., 1997).

10
from Genebank database. Besides the F-box motif, these proteins usually contain either
WD-40 repeats such as Cdc4 or leucine-rich repeats such as Skp2, Grrl, and p58 (Bai et
al., 1996; Kaplan et al., 1997). The role of F-box proteins have been demonstrated in the
ubiquitination of Sicl and Clnl (Feldman et al., 1997; Skowyra et al., 1997), and the
phosphorylation of p58, a subunit of a kinetochore binding protein, CbfBp (Kaplan et
al., 1997).
Skpl Mediates Ubiquitin-Dependent Proteolysis of Cell Cycle and Other Proteins
through SCF Complex
Controlled intracellular proteolysis is important for many cell functions. One of
the processes, ubiquitination, is composed of series of enzymatic reactions required for
the attachment of a multiubiquitin chain on a target protein (reviewed in Hochstrasser,
1996). The first step is the activation of ubiquitin by the ubiquitin-activating enzyme
(El) resulting in the formation of an El-ubiquitin thiol ester. In the second step,
ubiquitin-conjugating enzymes (E2) mediate the transfer of ubiquitin from El-ubiquitin
complex to a substrate protein. This step usually requires an E3-enzyme (ubiquitin-
protein ligase) for the substrate specificity. Then, ubiquitinated proteins are degraded by
a specific multiprotein protease complex, the 26S protease.
Ubiquitin-dependent proteolysis is essential for two steps of cell cycle, G1 to S-
phase, and metaphase to anaphase. Substrates for the ubiquitin proteolytic pathway
include cyclins, which are positive regulators of cyclin-dependent kinases (Cdks), and
Cdk inhibitors, which are negative regulators. In S. cerevisiae, Cdc 28 (Cdk 2,4,5, and 6 in
higher eukaryotes) is activated in G1 phase by the G1 cyclins, Clnl,2, and 3 (cyclin C, D,

11
and E in higher eukaryotes) and in S through M phase by the mitotic cyclins, Clbl-Clb6
(reviewed in Nasmyth, 1996). Whereas mitotic cyclins degradation are regulated by E3
ubiquitin ligase called the anaphase promoting complex (APC), G1 cyclins and Cdk
inhibitors are requlated by E3 ubiquitin ligase complex which recognizes phosphorylated
substrate (reviewed in Hershko, 1997). One of the E3 ubiquitin ligase complex composed
of Skpl, Cdc53 (Cullin) and the F-box protein (SCF complex) has been shown to regulate
ubiquitin-dependent degradation of many G1 cyclins and Cdk inhibitors (reviewed in
Krek, 1998).
The entry into S-phase requires the activation of the Clb/Cdc28 kinase complex.
These kinase complexes are initially inactive due to the presence of high levels of the S-
phase Cdk inhibitor, Sicl (Nugroho and Mendenhall, 1994; Schwob et al., 1994) which is
synthesized in late mitosis. G1 cyclin-dependent kinase proteins (Clns/Cdc28)
phosphorylate Sicl (Verma et al., 1997a), which triggers the degradation of Sicl (Verma et
al., 1997b). The degradation of phosphorylated Sicl is controlled by E2 ubiquitin-
conjugating enzyme, Cdc34 (Goebl et al., 1988; Schwob et al., 1994), and E3 ubiquitin
ligase complex formed by three other proteins, Skpl, Cdc53, and F-box protein/Cdc4
(Schwob et al., 1994; Bai et al., 1996).
Similar to Sic 1, the degradation of G1 cyclins, Clns, also require Cdc34, Skpl, and
Cdc53. However, the F-box component of SCF complex for Clns degradation process is
Grrl instead of Cdc4 (Barral et al., 1995) indicating the role of F-box protein on substrate
specificity. Grrl binds phosphorylated Clns and Grrl/Clns is connected to other
ubiquitination regulatory proteins through Skpl ( Li and Johnston, 1997; Skowyra et al.,

12
1997; Kishi et al, 1998). GRR1 was initially identified as a gene required for glucose
repression in S. cerevisiae (Flick and Johnston, 1991). Mutations in GRR1 relieve
repression of many glucose-repressed genes (Bailey and Wood word, 1984; Flick and
Johnston, 1991) and prevent glucose induction of hexose transporter (HXT) genes
(Ózcan and Johnston, 1995). Interestingly, the binding of Skpl to Grrl is regulated by
the presence of glucose in the media and Skpl interacts with Grrl and Cdc53 to mediate
the glucose-induced HXT genes by an unknown mechanism which does not require Cdc34
(Li and Johnston, 1997).
The example of Sicl and Clns degradation indicates that one of the molecular
mechanisms of Skpl is to link an F-box protein and its target to Cdc53 for ubiquitin
dependent proteolysis. Besides Sicl and Clns, other regulatory proteins have been shown
to be degraded by the SCF pathway, including the Cln/Cdc28 inhibitor Farl (Henchoz et
ah, 1997), the replication protein Cdc6 (Drury et al., 1997), and the transcription factor
Gcn4 (Komitzer et al., 1994).
Skpl Mediates Phosphorylation of a Kinetochore Protein through an F-box Motif
which is Important for Kinetochore Assembly
Skpl has other functions that are not related to proteolysis as well. Skpl was
independently identified as a component of S. cerevisiae kinetochore binding protein,
Cbf3 (Stemmann and Lechner, 1996). Cbf3 is a 240 kDa multicomponent protein that
specifically binds to CDEIII, a conserved element of the centromere DNA sequence
(lechner and carbon, 1991), Cbf3 is composed of 4 subunits, p23 (Skpl), p58, p64, and
pi 10 (Lechner and Carbon, 1991; Stemmann and Lechner, 1996). All four components are

13
important for Cbf3 assembly and CDEIII binding (Lechner, 1994; Sorger et al., 1995;
Kaplan et al., 1997). Yeast cells carrying the Skpl mutation arrest in G2 and exhibit an
increased rate of chromosome loss (Connelly and Hieter, 1996).
Active Cbf3p can be formed from purifed p64, pi 10 and activated p58. Skpl
activates p58 by an interaction with the F-box motif on p58 and mediates p58
phosphorylation. Recombinant Skpl alone was inactive in reconstituting the CDEIII
binding activities of Cbf3p in Skpl-4 strain but recombinant p58 isolated from insect cells
coexpressed with Skpl and p58 could restore the activities indicating the requirement of
interaction between Skpl and p58 (Kaplan et al., 1997). Because Skpl does not contain
any protein kinase motif, an unidentified kinase in Skpl-p58 complex is required for p58
phosphorylation.
The Possible Role of Skpl in von Hippel-Lindau Disease
Von Hippel-Lindau (VHL) disease is a hereditary syndrome characterized by the
development of vascular tumors of the central nervous system, retina, kidney,
pheochromocytomas, pancreatic islet cell tumors, and benign cysts in multiple organs.
The defect occurs by germ line mutations of the tumor suppressor gene, VHL (reviewed
in Maher and Kaelin, 1997). The VHL gene product, pVHL, blocks the binding of elongin
A to elongin B and elongin C resulting in the inhibition of elongin activity (Duan et al.,
1995). The elongin activity is important for stabilizing hypoxia-inducible mRNAs
including vascular endothelial growth factor (VEGF) and Glutl glucose transporter and
pVHL is a negative regulator. The role of SCF complex in von Hippel-Lindau disease has
been investigated, based on the findings that elongin A is an F-box protein, elongin B

14
contains a region which is similar to ubiquitin and elongin C contains a region which is
homologous to Skpl. Recently, cullin (Cul2), another component of SCF complex has
been shown to interact with elongins B/C and pVHL (Lonergan et al., 1998). The
similarity of pVHL-elongins B/C-Cul2 and SCF complex suggests the possible role of
Skpl on the regulation of hypoxia-inducible mRNA by pVHL.
The Importance of Skpl-Glycosylation Study
As described above, Skpl is an essential, multifunctional protein involved in
metabolite repression, kinetochore assembly, and cell cycle control in fungi, yeast, and
mammalian cells. A putative mechanism of Skpl is to target F-box proteins and their
complexes for specific activities, which can explain how the protein is associated with
such diverse functions. Skpl binding to the F-box motif in Cdc4 and Grrl connects Sicl
and Cln to the ubiquitin degradation complex, respectively. Another example is the
binding of Skpl to p58 which leads to the activation of p58 by phosphorylation
indicating that Skpl connects p58 to an unidentified kinase. Since many cytosolic and
nuclei proteins have been found to contain the F-box motif, additional protein-complexes
and functions of Skpl will likely be discovered.
In Dictyostelium, the finding that Skpl contains fucose, which is unusual for a
cytosolic protein, has made Skpl a model for the study of a novel protein O-
glycosylation pathway. It is yet to be proved whether glycosylation of Skpl occurs in
other cell types. Structural heterogeneity mediated by glycosylation of Skpl may be
important for the specificity of Skpl-protein interaction. Moreover, the carbohydrate
structure may be important for cytosolic localization which consequently regulates Skpl

15
function in the nucleus.
Glycosylation in the secretory pathway of certain proteins has been shown to be
important for protein folding, targeting, and/or ligand binding (reviewed in Varki, 1993). In
addition, there is evidence that cytosolic glycosylation may have regulatory functions.
Clostridial toxins inactivate Rho subfamily members of GTP-binding proteins by
glycosylation (Just et al., 1995a; Just et al, 1995b). O-GlcNAc modifications are found to
be dynamic and their attachment sites are indistinguishable from or close to those used by
various protein kinases suggesting the competition of 0-GlcNAcylation with
phosphorylation (Chou et al., 1995; reviewed in Greis and Hart, 1997). Another example
of the importance of cytosolic glycosylation is demonstrated in the 0-GlcNAc protein,
p67. Inactivation of eIF-2 kinase is dependent on the glycosylation state of p67.
Deglycosylation of p67 activates eIF-2 kinase resulting in an inhibition of the translation
factor, eIF-2a (Chakraborty et al., 1994).
The Characteristics and Compartmentalization of Skpl-Glycosylation
Indirect lines of evidence suggest that the glycosylation process of Skpl occurs in
the cytosolic compartment. First, a fucosyltransferase (cFTase) which can fucosylate
Skpl has been purified from the SI00 of Dictyostelium (West et al., 1996). Moreover, the
Skpl cDNA does not encode a targeting sequence essential for translocation into the
secretory pathway. Finally, the Skpl sequence contains the consensus motif for iV-linked
glycosylation at amino acid residue 45, Asn45-Val-Thr, but it is not A-glycosylated.
These reasons imply that Skpl remains in the cytoplasm after translation and is not
translocated into the ER.

16
It will be impossible to study the importance of the cytosolic-fucosylation
pathway of Skpl unless its glycan structure and biosynthesis are characterized.
To support the future structure and function investigations of the Skpl glycan, the nature
of the previously identified cytosolic fucosylation in Dictyostelium was determined in this
study. The Skpl glycan has been identified as a linear pentasaccharide (Galal-6Galal-
Fucal-2Gal(3l-3GlcNAc) attached to a hydroxyproline at codonl43. The construction of
this unusual structure is predicted to require six enzymes including one prolylhydroxylase
and six glycosyltransferases. The Skpl-GlcNAc-transferase, the enzyme responsible for
the attachment of the first sugar, GlcNAc, has been purified from the cytosol of
Dictyostelium. Its activity is dependent on the presence of reducing reagent and has a
submicromolar Km for the substrate, UDP-GlcNAc. These findings support the
hypothesis that this new glycosylation pathway resides in the cytosolic compartment of
the cell.

CHAPTER 2
THE GLYCOSIDIC-PEPTIDE LINKAGE AND STRUCTURE OF SKP1 GLYCAN
Introduction
Skpl is found in a multiprotein complex with cullin (a cdc53 homologue) and an
F-box containing protein to form the SCF complex, named as an acronym of the
participating proteins. When this complex contains an E2 enzyme, it is responsible for
ubiqutinating various target proteins, depending on the identity of the F-box protein.
Targets for subsequent degradation identified in Saccharomyces cerevisiae include cell
cycle proteins such as the S-phase kinase inhibitor Sicl and G1 cyclins, and proteins
specific to the nutrition of the cell (Bai et ah, 1996; Skowra et ah, 1997; Feldman et ah,
1997; Li and Johnston, 1997). The SCF complex has also been implicated in
phosphorylation of kinetochore proteins (Kaplan et ah, 1997), and another distantly
related complex affects mRNA metabolism (Lonergan et ah, 1998). An SCF complex with
Cyclin A and Cdk2 has been detected in mammalian cells and its abundance appears
increased in transformed cells (Zhang et al, 1995; Lisatwan et ah, 1998). Skpl itself is
abundantly and dynamically expressed in the mouse embryo (Sowden et ah, 1995) and
central nervous system including post-mitotic neurons (Uro-coste et ah, 1997) and at
very high concentrations in the inner ear organ of Corti (Chen et ah, 1995; Yoho et ah,
1997), where it comprises up to 5% of total protein in the cytoplasm. The expression of
several Skpl genes in plants appears to be governed by morphogenetic boundaries
(Ingram et ah, 1997). Thus Skpl is expressed ubiquitously in eukaryotes, and its role may
17

18
be to facilitate the selection of other proteins for specific posttranslational modification.
Binding of Skpl to different proteins may be regulated structurally, as it is encoded
by multiple genes in multicellular organisms (Chen et al., 1995; Bai et al., 1996; Demetrick
et al., 1996; Liang et al., 1997; West et al., 1997). Skpl structure is also altered by
glycosylation in Dictyostelium discoideum (Gonzalez-Yanes et al., 1992; Kozarov et al.,
1995), which may regulate its activity. Because complex glycosylation of
cytoplasmic/nuclear proteins is unusual, we embarked on a study to establish the
structure of the carbohydrate modification as a first step in investigating its function.
In order to determine the structure and site of attachment of the previously
described Skpl fuco-oligosaccharide(s) (Gonzalez-Yanes et al., 1992; Kozarov et al.,
1995), mass spectrometric approaches were employed. Key to the success of the this
methodology was the newly developed Q-TOF MS (Morris et al., 1996; Moris et al.,
1997), which permitted MS-MS studies to be performed on the pmol quantities of
material available from native sources. This recently designed instrument comprises a
quadrupole with collision cell followed by an orthogonal acceleration time-of-flight (TOF)
analyzer which confers a high degree of sensitivity and accuracy to the mass
measurements. The ability of this instrument to sequence both the peptide and
oligosaccharide chains of a Skpl fucoglycopeptide suggested that it consists of a linear
pentasccharide, D-Galpal,6-D-Galpal,-L-Fucpal,2-D-Galp(3l,3GlcNAc, attached to
hydroxylated Pro 143. The sugar sequence was established from exoglycosidase studies
using MALDI-TOF-MS and sugar analyses on genetically-overexpressed material. The
protein attachment site was then confirmed by Edman degradation.

19
These results reinforce the model that complex 0-1 inked glycosylation occurs in the
eukaryotic cytoplasmic compartment. While there has been much circumstantial evidence
to support this model (Hart et al., 1989), it has remained controversial (Medina and
Haltiwanger, 1998). In contrast, simple glycosylation, in the form of GlcNAc O-linked to
residues of Ser or Thr, is well established in this compartment (Hart, 1997). The sugar
structures which have been described to date on cytoplasmic/nuclear proteins are
generally distinctive from those produced in the secretory pathway, suggesting that there
may be fundamental differences in the biogenesis and function of these modifications.
Materials and Methods
Cells
Strains Ax3 and HL250 were grown at 22°C in HL-5 medium on a gyratory shaker.
In 6 liter flasks, cells grew to a density of 6-10 x 107per ml, which is referred to as
stationary phase. Ax3 is a normal strain and HL250, derived from Ax3 by chemical
mutagenesis, is unable to synthesize GDP-Fuc from GDP-Man and thus incorporates
negligible Fuc into protein (Gonzalez-Yanes et al., 1992; Kozarov et al., 1995).
Construction of Skpl-c-myc Overexpression Strain HW120
A full-length cDNA from the fpal gene with a decapeptide encoding the human c-
myc epitope, EQKLISEEDL (Kolodziej, et al., 1991), inserted between codons 161 and
162 near the C-terminus was prepared by PCR and cloned into pT7Blue (Novagen). The
cDNA was subcloned into pVEIIAATG (Rebstein et al., 1993) under the control of the
inducible discoidin promoter and the actin 8 terminator. The plasmid was transformed

20
into D. discoidewn by a CaPC>4 precipitation method and selected in the presence of 15
mg/ml G418 (Ferguson et al., 1994). Strain HW120 was a clone which produced Skpl-c-
myc at higher levels than its companion strains based on Western blot analysis with mAb
9E10 against the c-myc epitope. Skpl-c-myc contained two missense mutations, T194C
and A305G resulting in amino acid substitutions I34T and D71G, introduced by the PCR
reaction and confirmed by MS analysis of its peptides (data not shown).
Preparation of Recombinant Dictyostelium Skpl (Skpl-His)
The open reading frame of Skpl was amplified using Dictyostelium DNA as the
template and oligonucleotides, S’tgctctcgagctcggatccattttgtgatgctgtttgtaSf and
5’gactgagctcgaggatccaatgtctttagttaaattagaatctt3’ as primers in a polymerase chain reaction,
these primers contained BamYil restriction sites which were used to clone the amplified
DNA into the BamHI restriction site of the inducible (Dubendorff and studier, 1991;
Studier, 1991) expression vector pET19b (Novagen, Madison, WI), downstream of the
T7 RNA polymerase transcription element such that an oligo-His tag was introduced at
the NH2 terminus. The deduced NFE-terminal sequence of Skpl-His is
MGHHHHHHHHHHSSGHIDDDDKHMLEDP followed by the natural Skpl
sequence, which was verified by sequencing of the plasmid DNA and contained 2
nonsense mutations. Expression host Escherichia coli BL21(DE3) cells carrying a lysogen
with a copy of the T7 RNA polymerase gene under lacUV5 control were transformed
under carbenicillin selection. After induction with isopropyl-1-thio-p-D-
galactopyranoside, expressing colonies were examined. Inclusion bodies were not
observed. Skpl-His was isolated from a single colony under nondenaturing conditions

21
using an affinity column consisting of nickel cations immobilized on Sepharose 6B,
essentially as described (Hochuli et al., 1988). Purified protein was exhaustively dialyzed
against 50 mM HEPES-NaOH (pH 7.4) and concentrated in a centrifugal ultrafiltration
concentrator (10-kDa molecular mass cut-off). Purified protein was shown to be
recognized in a Western blot by monoclonal antibodies 3F9 and 4E1 confirming its
identity as Skpl.
Purification of Skpl
Cell lysis. D. discoideum strains Ax3, HL250 or HW120 were grown to stationary
phase in HL-5 medium. After washing once in ice-cold water, cells were resuspended in
50 mM Tris-HCl, 0.25 M sucrose, pH 7.4 containing protease inhibitors (10 ftg/ml
leupeptin, 10 ¡ig/ml aprotinin, 1.0 mM phenylmethylsulfonyl fluoride). The suspension
was suctioned though a bed of glass wool, and lysed by forced passage though a 47 mm
diameter Nuclepore filter with 5 |im diameter pores mounted on the end of a 60 ml
syringe. The lysate was centrifuged at 4,000 x g for 2 min, and the supernatant was
centrifuged at 100,000 x g for 60 min. All procedures were performed at 0-4°C.
DEAE-Sepharose-Fast-Flow chromatography. The final SI00 supernatant was
pumped onto a 450 ml DEAE-Sepharose Fast Flow Column (4.6 x 28 cm) pre¬
equilibrated in 50 mM HEPES-NaOH (pH7.4), 15% glycerol, 5 mM MgCl2, 0.1 mM
disodiumEDTA, 1.0 mM DTT and the column was washed with the equilibration buffer
until the A280 dropped below 1% of its maximum. Skpl was eluted in a linear gradient of
0-0.25 M NaCl, consisting of 2.5 x column bed volumn of equilibration buffer and 2.5 x

22
column bed volumn of 0.25 M NaCl in the same buffer. Analysis of fractions using a
mAb 3F9 ELISA/dot blot assay revealed that Skpl from Ax3 and HL250 were
fractionated into pools-I and -II (Kozarov et ah, 1995). Skpl-c-myc from strain HW120
was eluted after pool-II.
Phenyl-Sepharose 6 Fast-Flow chromatography. DEAE pools were pumped
onto a phenyl-Sepharose 6 Fast Flow (high-sub) column pre-equilibrated in 15%
saturated (NH4)2S04, 85 mM NH4OAc and the column was washed with the
equilibration buffer until the A28O dropped below 1% of its maximum. Skpl was eluted
by a decreasing gradient of (NH4)2S04, consisting of 2.5 x column bed vol. of starting
buffer and 2.5 x column bed vol of 2 mM NH4OAc, pH 7.4.
Monoclonal antibody 3F9 affinity chromatography. Phenyl-Sepharose pools
were applied to immobilized rabbit IgG (pre-column) and mAb 3F9 columns, which were
connected in series and pre-equilibrated in PBS. After loading of the sample, the mAb 3F9
column was disconnected and washed with the same buffer until all nonbound protein
was washed out. The column was eluted with 0.1 M glycine-HCl, pH 2.5. The eluted
fractions were collected into 1.5 ml tubes containing 100 (il of 1M Tris, natural pH.
Reversed-phase high-performance liquid chromatography. In some cases, Skpl
was reduced and carboxamidomethylated. The protein was partially dried down in a
speed-vac, brought to 7.5 mM DTT in 8 M urea, 0.4 M NH4HCO3, pH 7.9, heated to
50°C for 15 min, and incubated at 22°C in 17 mM iodoacetamide for 15 min in the dark.
The carboxamidomethylated protein was further purified on a C2/C18 (PC 3.2/3) RP-

23
HPLC column on a Pharmacia SmartSystem HPLC and eluted with a gradient of 0% (v/v)
MeCN in 0.1% (v/v) TFA to 100% MeCN in 0.085% TFA. The peak which contained
more than 80% of total Skpl was examined further. Recombinant Skpl (fpal) containing
an N-terminal oligo-His tag was isolated from E. coli as described (Kozarov et ah, 1995),
and further purified on a RP-column as above.
Metabolic Labeling of Skpl
A 200 ml culture of Ax3 cells was grown for 3 generations in 0.05 mCi/ml [3FI]Fuc
in HL-5. Skpl was isolated in the same manner except the phenyl-Sepharose step was
omitted. Purified radiolabeled Skpl was pooled with unlabeled Skpl.
Monosaccharide Composition Analysis of Skpl-c-myc
Two nmol of mannitol was added as an internal standard to 1.5 nmol of Skpl-c-
myc. The sample subjected to methanolysis, re-N-acetylation, and TMS-derivitization as
described (Elwood et ah, 1988), and analyzed in splitless mode on a 0.32 mm x 30 m
SPB-1 column (Supelco) on a Shimadzu QP-5000 GC/MS workstation. Peaks were
analyzed with selected ion monitoring at m/z 204 for the neutral sugars and m/z 173 for
the N-acetylated amino sugars.
Purification of Glycosylated Peptides
Carboxamidomethylated Skpl was digested with endo-Lys-C from Achomobacter
lyticus (Wako) in the presence of 2 M urea in 0.2 M Tris-HCl, pH 7.4, using an
enzyme:substrate ratio of 1:200 (mokmol), at 30°C for 18 h. Peptides from metabolically-
labeled Skpl were fractionated on a Superdex Peptide HR10/30 HPLC column
(Pharmacia) in 6 M urea in 50 mM NaCl, 50 mM Tris-HCl, pH 7.2, on an LKB GTi

24
HPLC system at 0.5 ml/min. Radioactive fractions were applied to a 4.6 x 150 mm, 3.5
mm particle Cg column (Zorbax) and eluted with a gradient of 5% (v/v) MeCN in 0.1%
(v/v) TFA to 40% MeCN in 0.085% TFA at a flow rate of 1 ml/min. Peptides (25 pmol)
were subjected to Edman degradation on an ABI model 494 Precise sequenator. Non-
radiolabeled endo-Lys-C peptides were fractionated directly a Cg (Zorbac) or C2/C18 (PC
2.1/2; Smart System, Pharmacia) RP-columns as above.
Matrix-Assisted Laser Desorption Time-of-Flight (MALDI-TOF) Mass
Spectrometry
Samples were mixed with an equal volume of saturated a-cyano-4-hydroxycinnamic
acid (Aldrich) in 70% acetonitrile. One pi (2-3 pmol) was deposited on a sample plate and
allowed to air dry. Spectra were collected on a PerSeptive Biosystem Voyager RP
MALDI-TOF-MS operated in the positive ion and linear modes.
Q-TOF Mass Spectrometry
Samples from RP-fractions were introduced directly into the Q-TOF MS
(Micromass, UK) via a nanospray device. Primary and secondary ion spectra were
collected in the positive ion mode.
Exoglycosidase Digestion of Skpl Glycopeptides
Approximate 15 pmol of glycopeptide from RP-fractions was partially dried by
vacuum centrifugation, diluted to a final volume of 2.5 pi in a buffer containing the
exoglycosidase (see Table 2-1), incubated at 37°C for 18 h, and processed for MALDI-
TOF-MS.

25
Table 2.1 Exoglycosidase treatments of glycopeptides
Pentasaccharide—^peptide substrate
(initial mass m/z 2017)
Enzyme
Specificity
Source
Buffer b
m/z
a-galactosidase (10 mU/pl)
Galal,2,3,4,6
green coffee
j
bean (B-M)
50 mM (NH4)2PC>4
pH 6.0
2165
(-2 hex)
a-galactosidase (10 uU/ul)
Galal,3
recombinant
(Glyko)
20 mM (NH4)2PC>4
pH 6.0
2487
a-galactosidase (lOpU/pl)
Gala 1,3/6
X.manihotis
(NEB)
20 mM (NH4)2PC>4
pH 6.0
2327
(-1 hex)
(3-glucosidase (10 mU/pl)
Glu/Gal/Fuc|3
sweet almond
(B-M)
20 mM (NH4)2PC>4
pH 5.0
2487
a-fticosidase (2.5 mU/pl)
Fucal.2/3/4/6
bovine kidney
(B-M)
20 mM (NH4)2PC>4
pH 5.0
2487
a-galactosidase (10 mU/pl)
+ a-fucosidase (100mU/pl)
Galal,2,3,4,6
+Fucal,2
green coffee
bean (B-M)^ +
X.manihotis
(NEB)
50 mM (NH4)2P04
pH 6.0
2017
(-2 hex,
- Idhex)
Disaccharide—^peptide substrate
(initial mass m/z 2017)
Enzyme
Specificity
Source
Buffer k
m/z
[3-galactosidase (4 mU/pl)
Gal(3l,3/4>6
bovine kidney
(OGS)
25 mM NH4OAC
pH 6.0
1855
(-1 hex)
[3-galactosidase (4.8 mU/pl)
Gal[3l,3/6
recombinant
(Glyko)
20 mM (NH4)2P04
pH 5.0
1855
(-1 hex)
[3-galactosidase (4.8 mU/ul)
Gal[3l,3
X.manihotis
(NEB)
20 mM (NH4)2P04
pH 5.0
1855
(-1 hex)
[3-galactosidase (4 mU/ul )+
[3-HexNAcase (6.5 mU/pl)
Gal|3l,3/4>6
+GlcNAc/
GalNAc|3
bovine kidney
(OGS) +
jack bean (V-
Labs)
20 mM (NH4)2P04
pH 5.0
1855
(-1 hex)
a B-M = Boehinger-Mannheim, NEB = New England Biolabs, OGS = Oxford
GlycoSciences.
b All reactions were incubated at 37°C for 18 h.
c Glycopeptides purified by RP-HPLC were analyzed by MALDI-TOF-MS before and
after treatment. All reactions were complete, that is, >95% of the parental ion was lost
and replaced by the major ion whose mass is described by the loss of one or more hex
or deoxyhex (dhex) units.
d a-galactosidase activity was purified from contaminating (3-galactosidase activity as
described (Jacob and Scudder, 1994).

26
Mild Acid Hydrolysis of the Fucoglycopeptide
Approximate 20 pmol of the fucoglycopeptide was partially dried down in a
vacuum centrifuge, reconstituted in 10 |il of 0.05 M TFA, and incubated at 95°C for up
to 6 h.
Results
Skpl Contained Only a Single Fucoglycopeptide
To investigate the glycosylation of Skpl, normal cells (strain Ax3) were
metabolically labeled with [3H]Fuc, SI00 was extracted and purified by DEAE anion
exchange chromatography. Skpl was separated into 2 pools as described (Kozarov et al.,
1995; West et al., 1996). Skpl pool II was further purified to homogeneity by phenyl
Sepharose chromatography and mAb 3F9 affinity chromatography. A pooled preparation
of labeled and unlabeled material was denatured in urea, reduced and alkylated with
iodoacetamide, and digested with endo-Lys-C in the presence of 2 M urea. When
fractionated on a Superdex Peptide gel filtration column in the presence of 6 M urea,
radioactivity eluted as a single peak centered at fraction 23 (Fig. 2.1 A), which was further
fractionated on a C8-reversed-phase (RP) HPLC column, again yielding a single
radioactive peak centered at fraction 35 (Fig. 2.IB) which did not absorb at 280 nm and
contained 30% of the original radioactivity. These results suggested that Skpl contained
only a single fucoglycopeptide. A parallel experiment using unlabeled preparation showed
an identical absorbance peak at fraction 35. Unlabeled purified peptide was used for MS
analysis and Edman degradation.

27
Figure 2.1 Purification of the [3H]fucoglycopeptide from Skpl. The normal strain
Ax3 was metabolically labeled with [3H]Fuc, and Skpl pool II was purified from the
SI00 fraction to homogeneity. Reduced and alkylated Skpl was digested with Endo-Lys-
C, and peptides were resolved on a Superdex Peptide gel filtration column (A). The
radioactive fraction 23 was chomatographed on a C8-reversed phase column, which
resolved 4 peptides (B). One of these, centered at fraction 35, was radioactive and did not
absorb at 280 nm. This Skpl fucoglycopeptide was used for most of the structural
studies.

28
Edman Degradation of Fucoglycopeptide Yielded the Sequence of Peptide 139-151
Edman degradation of unlabeled peptide fraction 35 yield the sequence
NDFTEEEEQIRK, which corresponded to that predicted for peptide 139-151 (Table
2.2) except that no signal was detected at the position of Pro 143. This finding suggested
that Pro 143 was modified which could be explained if Pro 143 was glycosylated (Allen,
1981).
Q-TOF-MS Analysis Directly Demonstrates the Attachment of the
Pentasaccharide at Prol43
This work was in collaboration with Dr. Eloward R. Morris and Prof. Anne Dell at
the Department of Biochemistry, Imperial College, London. The HPLC fraction (#35)
containing the putative fucoglycopeptide was subjected to tandem mass spectrometry on
a Q-TOF mass spectrometer. Analysis of a few picomoles in the MS-only mode gave a
major [M+3H]3+ signal at m/z 829.42 (Fig. 2.2, including inset). Note the resolved natural
abundance l3C isotopes at m/z 829.70 and 830.03 showing that this signal is triply-
charged. It therefore derives from a molecule of mass 2485 Da. A series of doubly-charged
ions were also apparent in the spectrum, separated by sugar mass differences (m/z 1244,
1163, 1081, 1008 and 927). The ion at m/z 1244 is the [M+2H]2+ ion corresponding to
the [M+3H]3+ at m/z 829.42, and the mass differences from this correspond to intervals
of Flex, Hex, Fuc and Hex respectively.
MS/MS of the m/z 829 [M+3H]3+ ion using argon gas and 50 eV collision energy
produced the spectrum shown in Fig. 2.3. Interestingly, the spectrum shows the
formation (from m/z 829) of a number of doubly-charged ions at m/z 826, 927, 1009,

29
Table 2.2 Predicted m/z values of endo-Lys-C derived Skpl peptides
Peptide
Sequence
Predicted mass (m/z)
2-5
SLVK
447
6-12
LESSDEK
808
13-18
VFEIEK
765
19-28
EIAC*MSVTIK
1153
29-53
NMIEDIGESDS(A)PIPLPNVTSTILEK
2714
54-72
VLDYC*RHHHQHSPQGDDK
2328
73
K
147
74-76
DEK
391
77-90
RLDDIPPYDRDFC*K
1812
91-109
VDQPTLFELILAANYLDIK
2177
110-117
PLLDVTC*K
947
118-126
TVANMIRGK
990
127-133
TPEEIRK
873
134-138
IFNIK
635
139-151
NDFTPEEEEQIRK
1636
152-159
ENEWC*EDK
1111
160-162
GGN
247
* assume single C has carboxyamidomethyl substituent

30
n/z
Figure 2.2 Q-TOF MS analysis of Skpl fucoglycopeptide. A partial ES mass
spectrum of fraction 35 from Fig. 1 is presented, showing doubly and triply-charged ions.
The triply-charged ion at m/z 829 is expanded in the inset to show the isotope pattern.

31
91.05
Peptide
I
HexNAc
[M+2H]24
927.92
927.45
N
Peptide
[M+2H]2+
826.41
825.90'
230.10
255.12377.17
478.20 j
JL MifJL*
1Ó0 2Ó0 3Ó0 ' 400 500 6Ó0 7Ó0 8ÓI
Peptide
I
HexNAc, Hex
2+
928.42 [M+2HJ
^ ..1008.94
,1008.46
,1009.43
Peptide
I
HexNAc, Hex, Fuc
ÍM+2HJ2*
y”9
1081.48 1173.57
'1081.98
y"9
I
/ HexNAc
,.1174.54
^.162.62
Peptide
[M+HJ +
1651.79
1650.78—
1376.61
Peptide
I
HexNAc
[M+HJ+
I0 "'' 9Ó0' ‘' 10Ó0 1100 ''' 12Ó0 1300 14W>" 1500 ''' 1 é'oO jÍÓÓ'' 1800 19'00 ''' 2obo
Figure 2.3 MS/MS collisionally activated decomposition spectrum of m/z
829.42+++. There is evidence in the MS and MS/MS spectra of minor variants in
structure, but the data are consistent with the major molecular species present
corresponding to the structure described in the text.

32
1081 and 1163 separated by sugar mass differences of HexNAc, Hex, Fuc and Hex
respectively, suggesting a stepwise stripping of these sugars from a linear oligosaccharide
attached to the glycopeptide. These data confirm that, in the MS spectrum shown in Fig.
2.2, the labeled doubly-charged ions were formed in that case by cone-voltage induced
fragmentation from a true quasimolecular ion at m/z 829. The doubly-charged ion at m/z
826 (Fig. 2.3) showed no evidence of further sugar loss and is interpreted as the remaining
peptide backbone. This is confirmed by the presence of a major singly-charged
quasimolecular ion signal at m/z 1651 [M+H]+ for the peptide. A search for this mass in
the gene derived sequence finds nothing, but the peptide identity can be determined from
the presence of N- and C-terminal sequence ions (Morris et ah, 1981) (Fig. 2.6, b and y"
respectively) in the low mass range of the spectrum. This shows the presence of a C-
terminal Lys in the molecule via an ion at m/z 147 which is extended via signals at m/z
303 (y2"), 416 (y3"), 544 (y4"), 673 (y5") and 802 (y6") (Figs. 2.3 and 2.4) to give the
sequence ...EEQL/IRK. Note the relatively high intensity of the m/z 544 isotope peak at
m/z 545 (Fig. 2.4) showing that the Q residue is partially deamidated. This is observed in
all ions containing that residue and also accounts for the high intensity of the 1651.79
satellite to the quasimolecular ion signal in Fig. 2.3. The partial sequence determined from
the C-terminal (y") ions is further complemented by N-terminal (b) ions at m/z 230, 377
and 478 corresponding to a (230)-F-T sequence. The sequence ion data thus lock the
peptide portion of the molecule onto residues 139-151 in the sequence
(NDFTPEEEEQIRK) except that the mass found in the Q-TOF MS/MS collision
spectrum is 16 Da higher than that predicted for the peptide (1635 [M+H]+). This is

33
Figure 2.4 Parts of the MS/MS spectrum shown in Fig. 2.3 expanded to show lower
mass region containing peptide-derived fragment ions more clearly.

34
Figure 2.5 Parts of the MS/MS spectrum shown in Fig. 2.3 expanded to show
higher mass region containing peptide-derived fragment ions more clearly.

35
bl b2 b3 b4 b5 b6 b7 b8 b9 blO bl I bl2
115.05 230.08 377,15 478.19 591.24 720.28 849.32 978.36 1107.41 1235.47 1348.55 1504.65
1536.71 1421.68 1274.61 1173.56 1060.52 931.48 802.44 673.39 544.35 416.29 303.21 147.11
y" 12 y"ll y"10 y"9 y"8 y"7 y"6 y"5 y"4 y"3 y"2 y"l
Figure 2.6 Predicted masses of N and C terminal sequence ions of the
fucoglycopeptide.

36
interpreted as a post-translational hydroxylation of one of the amino acids present, and
this could not be at the C-terminal Lys residue, already assigned in the fragmentation data.
Screening the higher mass fragments in the spectrum alows a clear assignment of
where the 16 Da increment is attached via the signals at m/z 1060 and 1173 in Fig. 2.5.
These show that the Pro C-terminal sequence ion, y9", is 16 Da higher than the
theoretical value for the sequence (1057 Da), showing that it is a HyPro in this position.
The signals at m/z 1274 and 1421 complete a series showing -F-T-P(OH)- in the
sequence.
Importantly, Fig. 2.5 also allows assignment of the attachment site of the
carbohydrate to the peptide. The signal at m/z 1376 is a FlexNAc residue away from the
m/z 1173 ion showing that the carbohydrate is attached via a HexNAc residue to the
HyPro and not, as may have been expected, to the Thr residue. A further signal at m/z
1477 extends this ion series to the ylO" sequence ion TP(OH)EEEEQIRK substituted
with HexNAc on the HyPro. The signal at m/z 1538 corresponds to the y9" ion with a
Hex-HexNAc substituent, and the sugar sequence data assigned from the doubly-charged
ions at m/z 826, 927, 1008, 1081, 1163 and 1244 (Figs. 2.2 and 2.3) now overlaps the
singly-charged MS/MS glycopeptide data giving confirmation of the sequence. MS/MS
data on several of the cone-voltage induced doubly-charged glycopeptide fragment ions
also corroborated the above interpretation.
A mild TFA hydrolysis experiment on a remaining small quantity of sample
showed the disappearance of the m/z 829 triply-charged signal together with the other
doubly-charged ions, excepting m/z 1008 and a weak triply-charged signal at m/z 672,

37
suggesting, as do the MS/MS data, that the saccharide is a linear molecule with Fuc mid¬
chain.
Taking all the MS and MS-MS data into consideration the structure of the
fucoglycopeptide was assigned as NDFT(Hex-n>Hex->Fuc—>Hex-4HexNAc)hydroxyP-
EEEEQIRK. Subsequent Edman degradation sequencing on a 20 pmol sample confirmed
the entire sequence of 13 residues, except for a blank at cycle 5, expected to be Pro.
MALDI-TOF-MS Analysis of the Fucoglycopeptide
The MALDI spectrum contained a major [M+H]+ signal at m/z 2487 (Fig. 2.1 A)
which was equivalent to the triply-charged ion at m/z 829.70 in the Q-TOF spectrum. In
addition, a series of low abundance ions were observed at m/z 2326, 2164, 2017, 1855 and
1652 consistent with sequential loss of Hex, Hex, Fuc, Hex and HexNAc respectively.
The low abundance ions appeared to be fragmentation products of the m/z 2487 ion
resulting from similar frequency of scission of each of the glycosidic linkages (Dell, 1983)
rather than incompletely glycosylated species, because less-glycosylated peptides eluted
later from the RP-column (see below). The m/z 2487 ion was not seen in a similar
analysis of RP-fractionated peptides (Fig. 2.8) of recombinant Skpl isolated from E. coli
(data not shown), showing that it was specific to the protein expressed in Dictyostelium.
Sugar Composition Analysis of Skpl-c-myc
To determine its monosaccharide composition, Skpl was isolated from the SI00
fraction of a D. discoideum strain (HW120) genetically modified to overexpress, under the
control of the inducible discoidin promoter, a form of the protein with a c-myc-epitope
tag near its C-terminus. The sugars of purified Skpl-c-myc were examined by GC/MS

38
A.Hex- Hex- deoxyHex- Hex- HexNAc- OHPro
2487
1653 1855 2017 2164 2326
* — A— —,
B.[Gala! ,6]- Hex- deoxyHex- Hex- HexNAc- OHPro
2325
2487
C.[Galal ,6- Galal ]- deoxyHex- Hex- HexNAc- OHPro
2163
- ■! Í'.I■
D.[Gala!,6- GalalFucal ,2]- Hex- HexNAc- OHPro
2017
—,—
1600
1800
2000 2200 2400
Mass (m/z)
Figure 2.7 MALDI-TOF-MS analysis of Skpl glycopeptides from normal strain
Ax3. A. Mass spectra of the fraction 35 fucoglycopeptide from Fig. 2.1, isolated from the
normal strain Ax3. In addition to the primary ion, a series of low abundance fragment ions
corresponding to selective glycosidic scissions of the glycan chain are noted. B. Treatment
of the fraction 35 fucoglycopeptide with X.manihotis al—>3/6-galactosidase.
C. Treatment of the fraction 35 fucoglycopeptide with green coffee bean a-galactosidase.
D. Treatment of the fraction 35 fucoglycopeptide with green coffee bean a-galactosidase
and X.manihotis al—>2-fucosidase. Structures suggested by the experimental result
shown and other results are given in each panel in brackets.

Absorbance 215 mil Absorbance 280 mil
39
Figure 2.8 Fractionation of endo-Lys-C generated Skpl-His peptides. A. Purified
recombinant Skpl (Skpl-His) from E.coli was reduced-alkylated and furthered purified
over the RP-HPLC. The first peak (a) was used for Endo-Lys-C digestion. B. Endo-Lys-
C digested Skpl-His were fractionated over the RP-HPLC. The fractions containing
peptide peak with 215 nm absorbance were subjected for MALDI-TOF mass
spectrometry. Skpl-peptide 139-151 with a predicted m/z 1636 was eluted at 5.5 min.

40
after methanolysis, re-N-acetylation, and formation of TMS-derivatives. To achieve the
sensitivity required to analyze 1.5 nmol of Skpl-c-myc, splitless injection and selected
ion monitoring was employed. Fuc (0.33 nmol), Gal (0.70 nmol), and GlcNAc (0.32
nmol) were the three most abundant sugars detected (Fig. 2.9), and their low levels
indicated that overexpressed Skpl was under-glycosylated. Fuc and Gal were previously
detected after 2M TFA hydrolysis (Kozarov et al., 1995), but GlcNAc was not. The
stronger acid conditions of methanolysis were probably required to liberate GlcNAc from
its linkage with hydroxyproline, and Xyl is not found in the fucoglycopeptide according
to the MS results. Thus the GC/MS data showed that the deoxyHex residue identified by
MS was L-Fuc as suggested by metabolic labeling, and showed that all thee Hex residues
were Gal and that the HexNAc was GlcNAc.
Exoglycosidase Digestion of Fucoglycopeptide
To assign linkages, the fucoglycopeptide was treated with exoglycosidases and
analyzed by MALDI-TOF-MS. The mass of the glycopeptide was reduced by 2 Gal
residues (to m/z 2163) after treatment with the non-specific green coffee bean a-D-
galactosidase (Fig. 2.7C), but was not altered by non-specific bovine kidney [3-
galactosidase, sweet almond (3-glucosidase, or bovine kidney a-fucosidase. Furthermore,
one Gal residue was susceptible to removal by X. manihotis al—»3/6-galactosidase (Fig.
2.7B) but not recombinant Glyko al—>3-galactosidase, showing that it was al—>6-
linked. Fuc was susceptible to removal (yielding m/z 2017) only after removal of the a-

41
Figure 2.9 GC-MS analysis of Skpl-c-myc total sugars. Standard sample containing 2
nmol of the indicated sugars, 1.5 nmol Skpl-c-myc with 2 nmol of added mannitol
(ManOH) as an internal standard, and blank sample were subjected to methanolysis, re-
N-acetylation, and TMS-derivitization, and analyzed in splitless mode on a Shimadzu
QP-5000GC/MS workstation.

42
linked Gal residues, as shown by double enzyme digestion experiments employing the a-
galactosidase and either non-specific bovine kidney a-fucosidase ox X. manihotis al —>2-
L-fucosidase (Fig. 2.7D). Since Fuc does not contain a 6-linkage site, this means that Fuc
was capped by a Galal—>6Gal disaccharide, and the disaccharide was a-linked to L-Fuc.
These results indicate that the outer sugars form a linear trisaccharide,
Galal—>6Galal —>Fucal —>2, in accord with the MS data.
A time course MALDI-TOF-MS analysis during mild acid hydrolysis of the
fucoglycopeptide yielded a mass decrease of 2 Flex residues and one deoxyHex residue
(m/z 2487 to m/z 2017) with no intermediates detected (Fig. 2.10), as also seen in the
corresponding Q-TOF experiment (see above), confirming that the outer Gala-linked
residues were attached to the acid-labile internal Fuc residue, whose more rapid release
resulted in the simultaneous loss of all three sugars.
MALDI-TOF-MS Analysis of Afucosylated-Glycopeptide
The core region of the glycan was examined in a mutant strain (HL250) which
does not synthesize GDP-Fuc and does not fucosylate Skpl (Kozarov et ah, 1995). It
was predicted that this strain would produce the truncated sugar chain Gal^GlcNAc if
alternative processing did not occur. HL250 Skpl purified from pool II of the SI 00
fraction resolved into 2 closely spaced peaks during RP-HPLC, each yielding similar
results (Fig. 2.11 A). Each peak was digested with endo-Lys-C and fractionated on a
C2/C18-RP-FFPLC column (Fig. 2.1 IB), and all peptide peaks were examined by MALDI-
TOF-MS. Ions with m/z values corresponding to each of the predicted unmodified 139-

43
0.05 M TFA, 0 h
0.05 M TFA, 2 h
ij gjj <\J j
0.05 M TFA, 4 h
i—i—r
i—i—r
1500
2000
1I I i T"
2500 3000
Figure 2.10 A time course MALDI-TOF-MS analysis of Skpl fucoglycopeptide
after mild acid hydrolysis. The fucoglycopeptide fraction 35 was treated with 0.05 M
TFA at 95°C. At indicated times, the aliquots were subjected to MALDI-TOF-MS.

44
Figure 2.11 Fractionation of endo-Lys-C generated afucosylated Skpl peptides. A.
The immunoaffinity purified Skpl from afucosylation mutant strain HL250 was reduced-
alkylated and furthered purified over the RP-HPLC. Two eluted peaks (a and b) yield
similar results after digestion with Endo-Lys-C. B. Peak b was digested with endo-Lys-C
and fractionated on a C2/C18 RP-HPLC. The eluted fractions were subjected to MALDI-
TOF MS. The Skpl peptide 139-151 was found in peaks 11, 12, and 14.

45
151 peptides with Mr values >600 were detected, including the unmodified peptide (m/z
1636) (Fig. 2.12C). In addition, the expected Gal—>GlcNAc—>peptide ion (m/z 2017) was
abundant (Fig. 2.12A) in an earlier eluting RP-fraction. No ions which might represent
other glycosylated derivatives of peptide 139-151 were detected. The accumulation of this
disaccharide, which corresponded to the two core sugars of the wild-type
pentasaccharide, confirmed that the addition of the two a-linked Gal residues depends on
Fuc. When the disaccharide—>peptide was treated with A manihotis pi—>3 galactosidase
or other p-galactosidases capable of cleaving this linkage, an ion corresponding to the loss
of one Hex residue (m/z 1855) appeared in place of the parent ion (Fig. 2.12B). The a-
galactosidases had no effect. The linking GlcNAc residue was not released in double
digestion by bovine kidney p-galactosidase and jack bean P-hexosaminidase. The
Gaipi—»3HexNAc disaccharide found on HL250 Skpl is assumed to be equivalent to the
core disaccharide of the normal Skpl pentasaccharide, because the previously
characterized Skpl-fucosyltransferase (West et ah, 1996) which fucosylates HL250 Skpl
in vitro depends on a Gaipi—>3HexNAc acceptor.
Taking all of the evidence together, the sugar sequence was assigned as D-
Galpal —>6-D-Galpal -H>L-Fucpal —>2-D-Galpp 1 -^3-D-GlcNAc-»HyPro 143.
Configurations and the assignment of Gal and Fuc as pyranose forms were based on the
exoglycosidase specificities. This structure was derived from about 50 pmol of purified
fucoglycopeptide. Methods which require substantially larger amounts of sugars will be

46
A. Hex-HexNAc- OHPro
2017
B. [Galfil ,3]- HexNAc- OHPro
1855
J W
C. Pro
1636
â–  â–  .. .jJ
—I 1—
1600 1800
1 1 1
2000 2200 2400
Mass (m/z)
Figure 2.12 MALDI-TOF-MS analysis of Skpl glycopeptides from afucosylation
strain HL250. A. Mass spectra of RP-HPLC peak #12 from Fig. 2.11 containing the
glycopeptidel39-151 isolated from the afucosylation mutant strain HL250. A. No
treatment. B. Treatment withX.manihotis |3l—>3galactosidase. The structure suggested
by the experimental result is given in a bracket. C. A later eluting peak #14 containing the
unmodified peptide.

47
necessary to determine the exact linkage of the second a-linked Gal residue and the
configuration of the GlcNAc—>HyPro linkage.
Glycosylation Heterogeneity
Detection of the unmodified peptide in the fucosylation mutant suggested that
hydroxylation of Prol43, the first step in the glycosylation pathway, is rate-limiting and
possibly regulatory. Similarly, MALDI-TOF-MS analysis of RP-fractions from endo-
Lys-C released peptides from pool I of Skpl from normal cells yielded ions
corresponding only to the pentasaccharide—>peptide (m/z 2487) and unmodified
peptide 139-151 (m/z 1637). It remains to be determined whether Prol43 hydroxylation
occurs on products of both Skpl genes, as each are present in pool I and pool II, as
shown previously by Edman degradation (West et al., 1997) and confirmed here by MS.
To characterize the glycosylation pathway further, Skpl-c-myc was expressed at an
elevated level in strain HW120. Endo-Lys-C generated peptides were fractionated by RP-
HPLC (Fig. 2.13) and analyzed by MALDI-TOF-MS, yielding abundant [M+H]+ ions of
2487, 2327, 2165, 1652 and 1636 in successive fractions (Fig. 2.14). These corresponded
to multiple glycoforms, including the full-length pentasaccharide, the pentasaccharide
minus one or two of the outer a-linked Gal residues, the hydroxylated but unglycosylated
peptide, and the unmodified peptide. These findings were consistent with the
monosaccharide composition results shown (Fig. 2.9): 1) Fuc and GlcNAc were present
at equal levels, as expected since no mono- and disaccharide intermediates were detected.
2) The Gal:Fuc ratio was 2.1, indicating that there is on average one a-linked Gal (the

48
A. RPC 3.2
%B
100
80
60
40
20
B. RPC 2.1
AU
%B
50
40
30
20
10
Figure 2.13 Fractionation of endo-Lys-C generated Skpl-c-myc peptides. A. The
immunoaffinity purified Skp-l-c-myc from the overexpression strain HW120 was
reduced-alkylated and furthered purified over the RP-HPLC. The first peak (a) was used
for endo-Lys-C digestion. B. Endo-lys-C digested Skpl-c-myc peptides were fractionated
over the RP-HPLC. The fractions containing peptide peaks with 215 nm absorbance
were subjected for MALDI-TOF mass spectrometry. The Skpl peptide 139-151 was
found in the peaks 14, 15, 17, and 19.

49
Mass (m/z)
Figure 2.14 The mass spectra of endo-Lys-C generated Skpl-c-myc peptides. The
MALDI-TOF mass spectra of Skpl-c-myc peptides show multiple glycoforms of the
peptide 139-151 including completely glycosylated peptide (m/z 2487), -1 and -2 hexoses
peptides (m/z 2325 and m/z 2163), unglycosylated-hydroxylated peptide (m/z 1653), and
unmodified peptide (m/z 1636).

50
other being (3-linked), which correlated with the detection of glycopeptides containing 0, 1
or 2 outer Gal residues. 3) Only 22% of the protein was glycosylated, which correlated
with the high levels of unmodified and hydroxylated forms of peptide 139-151 detected.
The results indicated that, secondary to Pro hydroxylation, attachment of the reducing
terminal GlcNAc and the outer a-linked Gal residues were the next most rate limiting,
suggesting that the enzymes which add these sugars may potentially regulate the structure
of the Pro 143 glycan at other stages of the life cycle.
Discussion
The mass spectrometric analyses (Table 2.3) suggested that the Skpl glycan
consists of a linear pentasaccharide attached to a HyPro at position 143. The attachment
site was confirmed by Edman degradation. The exoglycosidase studies and sugar analyses
confirmed the linear model and showed the sequence to be D-Galpal->6-D-Gal/xxl-»L-
Fucpal—>2-D-Galp(3l—>3-D-GlcNAc-»HyProl43. Substantially greater amounts of the
fucoglycopeptide will be necessary to determine the linkage position of the second a-
linked Gal residue, and the configuration of the GlcNAc—>HyPro linkage. The core
trisaccharide, Fucal—»2Gal|3l—>3GlcNAc, is equivalent to blood group H (type 1)
expressed by mammalian cells (Greenwell, 1997). Although internal Fuc linkages have
been found in glycoproteins (Zhang et al., 1997; Harris et ah, 1993), the outer
Galal—>6Galal^Fuc cap structure has not been previously described. However, this
sugar chain is not immunogenic in mice (Kozarov et al., 1995), unlike other Dictyostelium

51
Table 2.3 MALDI-TOF-MS m/z values for endo-Lys-C-derived glycopeptides
Sample
Strain
HPLC
peaka
Measured
m/z
Derived structure
[3H]glycopeptide
Ax3
fr.35
2487
Hex2deoxyHexHexHexNAcOPro
2325b
HexdeoxyFIexHexHexNAcOPro
2163b
deoxyHexHexHexNAcOPro
2017b
HexHexNAcOPro
1855b
HexNAcOPro
1653b
HOPro
Skpl-II peptides
HL250
pk.ll,
2017
HexHexNAcOPro
1855
HexNAcOPro
pk.14
1636
Pro
Skpl-His peptides
E.coli
pk. 18
1636
Pro
Skpl-I peptides
Ax3
pk. 23
2487
Hex2deoxyHexHexHexNAcOPro
pk. 25
1636
Pro
Skpl-c-myc
FI W120
pk. 14
2487
Hex2deoxyHexHexHexNAcOPro
peptides
pk. 15
2325
HexdeoxyHexHexHexNAcOPro
2163
deoxyHexHexHexNAcOPro
pk. 17
1652
HOPro
pk. 19
1636
Pro
Fraction or peak (based onA214 tracings) numbers are consistent only within a given
experiment.
The structure given is based on the mass of the parent ion as MH+ and the m/z values
of the daughter ion set.
These are decomposition ions in the MALDI-TOF-MS analysis.

52
sugar protein conjugates (West et al., 1986; Freeze, 1997), suggesting that a similar
structure may be expressed in mammals. The linkage amino acid, hydroxyproline, is
possibly 4-hydroxylated based on the specificity of a Skpl:UDP-GlcNAc GlcNAc-
transferase activity which has been detected and partially purified (Chapter 3). 4-
hydroxylation is phylogenetically ubiquitous and 4-OH-Pro has been found to be
derivatized with Ara or Gal in plants and algae (Fincher et ah, 1972; Allen et ah, 1978)
but substitution by GlcNAc has not been described previously. The double-negative
charge previously attributed to the sugar moiety after attempted (5-elimination (Gonzalez-
Yanes et ah, 1992) may have resulted from base-catalyzed scission of the adjacent E-E
peptide bond, as sugar—>Hy Pro linkages are known to be alkali-resistant (Fincher et ah,
1972; Allen et ah, 1978). GlcNAc was not previously detected in Skpl (Kozarov et al.,
1995), probably because methanolysis is more effective than 2 M TFA in causing its
release from HyPro.
The aforementioned structures homologous to the Skpl oligosaccharide are
synthesized in either the rER or the Golgi apparatus, and then expressed on the cell
surface or secreted. However, Skpl is not secreted, but rather is located and functions in
the cytoplasm and nucleus (Kozarov et al., 1995; Bai et al., 1996; Yoho et al., 1997).
These data imply that known enzymes directing the synthesis of the homologous
structures would not be accessible to Skpl, unless Skpl transiently visits the lumen of
the secretory pathway.

53
Current evidence suggests that Skpl is partially modified in the cytosol by a novel
biosynthetic pathway. The enzyme which adds Fuc is likely to be the previously
characterized cytosolic fucosyltransferase (cFTase). The cFTase fucosylates Skpl in
vitro with a submicromolar Km (West et ah, 1996), and catalyzes formation of the same
Fuc linkage on the same acceptor disaccharide (West et al., 1996; Trincher, and Bozzarro,
1996) as the present results show occur naturally in Skpl. The cFTase is likely to reside
in the cytoplasmic compartment of the cell as it was purified from the cytosolic fraction
and its submicromolar Km for GDP-(3Fuc is more characteristic of cytoplasmic compared
to Golgi glycosyltransferases (West et al., 1996). Recent studies on Pro hydroxylase and
GlcNAcTase activities which modify overexpressed Skpl-c-myc and synthetic peptides
suggest that they also reside in the cytoplasmic compartment. These enzymes may
constitute a hitherto unrecognized complex pathway of O-glycosylation localized in the
cytoplasm, not the secretory pathway, which attaches sugars to Skpl incrementally
rather than en bloc. Although glycosylation heterogeneity was not observed in Skpl from
cells at the end of the growth phase, accumulation of incompeletely glycosylated chains in
the overexpression strain raises the possibility of the expression of glycoforms at Pro 143
at other stages of the life cycle.
Pro 143 is located within the highly conserved C-terminal domain of the Skpl
amino acid sequence (West et al., 1997). The C-terminal domain sequences are identical in
the two Dictyostelium Skpl genes, and a Pro at the equivalent position of Prol43 is
present in each of the numerous yeast, fungal, plant and plant viral genes cloned to date
(Table 2.4). Of the nine Skpl genes suggested by DNA sequencing data to exist in

54
Table 2.4 Phylogenetic comparison of sequences surrounding Prol43
121
131
141
151
161
Dictvostelium
a. a.
NMIRGKTPEE
IRKiFNIKND
FTSEEEEQIR
KENEWCEDKG
gn
D.
discoideum
NMIKGKTPEE
IRKTFNIKND
FTeEEEaQVR
KENQWCEEK
H.
sapiens
EMIRGRSPEE
IRRTFNIvND
FTSEEEaalR
RENEWaEDR
S.
cerevisiae
NMIKGKSPEE
IRKTFNIQND
FTÍPEEEDQIR
RENEWAEE
E.
nidulans
DMIKGKTPEE
IRKTFNIKND
FTÍPEEEEEVR
RENQWafE
P.
vulgaris
DRIRGKTPEQ
IRevFgleND
LTSPEEEaaAl
aEhsWthlvP
iedy
Chlorella Virus
DMIKGKTPEE
IRtTFNIKND
FTSEEEEEVR
RENQWafE
A.
thaliana
NMIKGKSPEE
IRRTFNIKND
FTSEEEEQIR
KENaAWCED
C.
elegans
(a)
NMIKGKSPdE
IRRaFNIKdD
FTaEErEQIR
KENaWCDD
C.
elegans
( c )
iML GRT1NE
VKlmLrvggv
eSÍPsDEEDsl
eDvlelEvdv
d. . .
C.
elegans
(b)
qnPReiiD
gi
vndEEEEQpv ypvkkCknht
n. . .
C.
elegans
(d)
nsAKGKnaEE
MRelF g
ipepwEQpst
statWdD
C.
elegans
(e)
ELIRGKStEE
IRKIYglRsD
eegmEEalan
ggegtsamtf
t. . .
C.
elegans
(f)
NMAKGKTtaE
LReiFalntD
eadaaEEtaa
Raaaeva
C.
elecrans
(g)
Note: upper case letters denote similar residues; lower case denotes non-conserved
residues.

55
Caenorhabditis elegans, three are highly homologous to Dictyostelium Skpl in this region,
and two of these have the equivalent of Pro 143 (West et al. 1997). Thus this key Pro
residue may be modified in other organisms as well. The known mouse, guinea pig and
human cDNAs encode nearly identical proteins (Chen et al., 1995; Zhang et al., 1995;
Demetrick et al., 1996; Liang et al., 1997) and lack this Pro residue, despite a high degree
of similarity (>80%) with the Dictyostelium sequence in the C-terminal domain. Other
mammalian Skpl loci (Chen et al., 1995; Demetrick et al., 1996; Liang et al., 1997) may
contain the equivalent of Pro 143, or Skpl may be modified on a second, nearby TPEE
sequence motif like that containing Pro 143.
The structural evidence shown here adds Skpl to the short list of examples that
complex glycosylation does in fact occur on cytoplasmic and nuclear proteins, as has
often been postulated based on indirect evidence (Medina and Haltiwanger, 1998). It has
been well-documented in the past decade that many cytoplasmic/nuclear proteins are
monoglycosylated by GlcNAc on Ser or Thr residues. However, the only generally
accepted examples of oligo-glycosylation are an incompletely defined, pan-eukaryotic
G1c-1-P04 modification of phosphoglucomutase (Marchase et al., 1993), also known as
parafusin, and glycogenin, the primer for glycogen (Alonso et al., 1995). The novel
GlcNAc—>HyPro linkage in Skpl is distinct from the GlcNAc—>Ser/Thr (Hart, 1997),
Glc—>Tyr (Alonso et al., 1995), and possible Man—»Ser/Thr (Marchase et al., 1993)
linkages found in the other cytoplasmic/nuclear proteins, and has not been detected on
proteins modified in the secretory pathway. Though other proteins in the cytoplasmic

56
fraction appear to be metabolically-labelled by [3H]Fuc, Skpl appears to be a major
recipient of cFTase-mediated fucosylation both in vivo and in vitro (Gonzalez-Yanes et
al., 1992; Kozarov et al., 1995). Further studies are required to determine whether the
other fucoproteins in this fraction reside in the cytoplasmic/nuclear compartment prior to
cell lysis. The availability of the newly designed Q-TOF-MS is expected to make it more
practical to investigate the posttranslational modifications of other lower abundance
intracellular proteins, which must be isolated from natural sources to analyze their
posttranslational modifications.
Cytoplasmic glycosylation can have dramatic consequences, as highlighted by a
Clostridial enzyme toxin which applies Glc or GlcNAc to a specific Thr residue of
cytoplasmic rho and cdc42 proteins resulting in major effects on the actin cytoskeleton
(Selzer et al., 1996). The function of the Skpl pentasaccharide modification is not likely
to involve competition with phosphorylation as proposed for the simple GlcNAc
monosaccharide modification of many cytoplasmic/nuclear proteins (Hart, 1997). Instead,
it may serve as a ligand for a cytoplasmic/nuclear carbohydrate-binding protein (Jung et
al., 1996; Kasai and Hirabayashi, 1996), or as a steric shield. The observation that the
pentasaccharide modification appears to be completed on all pool I and pool II Skpl
proteins whose Pro 143 residues are hydroxylated supports the model that it is a ligand
for a receptor, which must be structurally rich and constant. Skpl subpopulations
differing with respect to the pentasaccharide—>HyPro modification might vary in their
ability to interact with specific F-box containing proteins, thereby potentially regulating

57
ubiquitination or phosphorylation of selected target proteins in response to, e.g., changes
in the nutritional, differentiation, or cell cycle status of the cell. The new knowledge of
glycan structure and attachment now renders the function of Skpl glycosylation
susceptible to genetic investigation.

CHAPTER 3
CHARACTERIZATION OF SKP1-GLCNAC TRANSFERASE
Introduction
Skpl is found in the cytoplasmic SCF protein complex which helps target cell
cycle and other proteins for ubiquitination. In Dictyostelium, Skpl is variably modified
by an unusual linear pentasaccharide; Galal-6Galal-Fucal-2Gal(3l-3GlcNAc, attached
to a hydroxyproline (HyPro) residue at amino acid position 143 (Teng-umnuay et al.,
1998).The pentasaccharide structure of Skpl indicates a novel glycosylation pathway
(HyPro-glycosylation). This pathway is predicted to contain a novel set of enzymes,
including, prolylhydroxylase, GlcNAc-transferase, fucosyltransferase, and three distinct
galactosyltransferases. Only one of these enzymes, the fucosyltransferase (cFTase), has
been purified from a cytosolic preparation of Dictyostelium and characterized (West et
al., 1996). This cFTase has characteristics of a cytosolic enzyme, although all other
known eukaryotic fucosyltransferases reside in the golgi compartment.
Disruption of one of the first two key enzymes, Skp 1 -prolylhydroxylase and
Skpl-GlcNAc-transferase, would completely eliminate the Skpl-glycosylation and allow
us to study the importance and function of the glycan. To achieve the goal, an enzyme
purification is required in order to get the cDNA sequences. In this study, a UDP-N-
acetylglucosamine: Skpl-N-acetylglucosaminyltransferase (GlcNAc-transferase), the
enzyme responsible for the attachment of the first sugar to the HyPro residue, has been
purified from the cytosol of Dictyostelium strain HW120 over DEAE, phenyl, Reactive
58

59
Red, Superdex, dUMP, and UDP-GlcNAc columns. The activity behaved as a single
component with an apparent Mr of -33,000. The glycosidic linkage was alkali-resistant
and was recovered as GlcNH2 after acid hydrolysis, consistent with a linkage to HyPro.
Activity of the purified enzyme was dependent on DTT and MgCl2. Its apparent
Km for UDP-GlcNAc was 0.16 |iM. The presence of this enzyme in the cytosolic
fraction, its requirement for a reducing environment, and its exceedingly high affinity for
its donor substrate UDP-GlcNAc, strongly suggest that the GlcNAc-transferase
glycosylates Skpl in the cytoplasm. The Skpl-GlcNAc-transferase and the previously
described Skpl-fucosyltransferase appear to belong to a glycosylation pathway which is
novel with respect to the structure formed and its compartmentalization in the cytosol
rather than in the secretory pathway of the cell.
The characteristics of the enzyme give us a better knowledge about the
mechanism of Skpl glycosylation and its compartmentalization. Once the cDNA
sequences of the enzyme is known, we will be able to screen genomic and cDNA
databases and explore whether a similar pathway exists in other species. Moreover, it will
be possible to create a GlcNAc-transferase co-expression and a GlcNAc-transferase
knock-out strain to verify that it is the real enzyme in vivo.
Materials and Methods
GIcNAc-Transferase Assay
Substrates. Skpl-c-myc was purified from strain HW120 through the mAb 3F9
affinity column step as described (chapter 2). The recombinant Skpl-His was purified
through a nickel metal chelating column as described (chapter 2) and further purified on a

60
mAb 3F9 affinity column. The purified proteins were concentrated in an ultrafiltration
concentrator (Centriplus-10, Amicon) to the final concentration of 11 pM for Skpl-c-
myc and 9 pM for Skpl-His, aliquoted, and kept as stock solutions at -80°C. Two
synthetic peptides, KIFNIKDFTPEEEEQIRKENEW and KIFNIKNDFT4-hy droxyPro-
EEEQIRKENEW, which corresponded to the amino acid 133-155 of Skpl, were
synthesized by the ICBR Protein Core, University of Florida. The dried peptides were
reconstituted in 50 mM FIEPES-NaOH, pH 7.4 at the concentration of 20 mg/ml and
kept as stock solutions at -80°C. UDP-[3H]G1cNAc in which [3H] was attached to C6 of
the glucosamine group was from Dupont NEN. It had a specific activity of 34.8 Ci/mmol.
GlcNAc-transferase activity. GlcNAc-transferase activity was assayed as the
transfer of [3H]G1cNAc from UDP-[3H]G1cNAc to Skpl-c-myc or synthetic peptides.
Typically, each assay contained 1 pM Skpl-c-myc, 50 mM HEPES-NaOH (pH 7.8), 5
mM MgCl2, 1 mM ATP, 5 mM DTT, 0.5 mg/ml BSA, and 0.657 pM UDP-[3H]G1cNAc
in a total volume of 35 pi in 1.6 ml microtubes. After enzyme fractions were added, the
reactions were incubated at 30°C for 1 h, and stopped by diluting with 35 pi of 2 X LSB
containing 2 pg of soybean trypsin inhibitor (Sigma) and frozen at -20°C. Trypsin
inhibitor has an Mr of 20,100 and served as a marker for the position of Skpl-c-myc.
After boiling for 3 min, each sample was resolved on a 7%-20% SDS-PAGE gel. The gel
was stained with Coomassie Blue R-250 (0.25% in 45% methanol, 10% acetic acid) for 1
h, destained (5% methanol, 7.5% acetic acid) overnight, and rinsed in distilled H2O for
0.5 - 1 h. The gel slice from each lane was cut from the region containing Skpl-c-myc

61
(21 kDa) or synthetic peptides with two additional slices, 4 mm above and 4 mm below.
The gel slices were extracted in 10% TS-2 (Research Products International, Mt.
Prospect, IL), 0.6% PPO, 0.015% dimethyl POPOP in toluene (scintanalysis grade). After
72 h, [3H]incorporation was determined by scintillation counting (Beckman LS6500).
[3H]incorporation into Skpl-c-myc was found in the slices of 21 kDa and one slice
above. The test of Skpl-His as a substrate was performed in a similar way except gel
slices were excised from the 24 kDa region.
The test of optimum pH for GlcNAc-transferase activity was performed by
changing the buffer with desalting PD 10 columns. Five PD 10 columns were equilibrated
with 50 mM Tris-HCl with different pH, 6.0, 6.5, 7.0, 7.5, and 8.0 measured at 22°C.
SI00 500 |il was loaded on each column and 1 ml fractions were collected at 4°C.
Fractions # 3, containing the highest activity, were tested.
Protein Concentration Determination
Protein concentration was determined by a commercial modification of a
Coomassie Blue dye binding method (Sedmak and Grossberg, 1977) according the
manufacturer’s protocol (Pierce, Rockford, IL). One ml of a diluted sample was mixed
with 1 ml of the reagent. After 5 min, absorbance at 595 nm was measured and the
protein concentration was calculated from a standard curve of bovine serum albumin. To
determine the protein concentration of the desalted affinity purified GlcNAc-transferase
fraction, 20 pi of sample was dried down, acid hydrolyzed, and subjected to amino acid
composition analysis at the ICBR Protein Chemistry Core Laboratory using norleucine as
an internal standard. Total protein was calculated based on the molar content of amino

62
acids.
Preparation of the 5-Hg-dUMP Resin
Synthesis of 5-Hg-dUMP. 5-Hg-dUMP was synthesized as described (Meikle et
al., 1991, Zeng et al. 1996) with some modifications. Fifteen ml of 20 mM dUMP in 15
ml of 0.5 M NaOAc buffer, pH 7.0 (prepared by adjusting pH of 0.5 M NaOAC with 0.5
M acetic acid) was added dropwise to 15 ml of 100 mM Hg-acetate in 0.5 M NaOAc
buffer, pH 7.0. The process was performed in a light protected container since Hg-acetate
is very light sensitive. The mixture was incubated at 50°C for 5 h. After cooling down to
room temperature, 148 mg (3.5 mmol) of LiCl was added to convert the excess Hg into
HgCF. Ethyl acetate extraction was performed 6 times by mixing the reaction mixture
with an equal vol of cold ethyl acetate in a phase-separation flask and the lower aqueous
phase was collected. Five ml aliquots of the aqueous phase in Corex centrifuge tubes
were each diluted with 20 ml of ice-cold absolute ethanol to precipitate 5-Hg-dUMP. The
precipitate was allowed to develop at 4°C overnight. The precipitate was collected by
centrifugation in a SS34 rotor at 7,500 rpm for 20 min. After the ethanol was discarded,
the pellet in each tube was washed with a mixture of ethyl acetate:ethanol (1:4). The
pellets were collected by centrifugation, dissolved in 50 ml H2O, and loaded onto a
1
Chelex-100 resin (bed vol 10 ml, Biorad) to remove residual Hg . The flowthrough,
containing 5Hg-dUMP, was collected and used for the coupling reaction. The yield of
dUMP mercuration was estimated from the shift of maximum absorbance from 260 nm to
267 nm. Absorbances were compared to the molar extinction coefficients of UDP (Max
A260 = TOO x 104) and 5-HgUDP (Max A267 = 1.08 x 104) at pH 7.5. All solutions in this

63
procedure were degassed and free of reducing reagents.
Coupling of 5-Hg-dUMP to Thiopropyl Sepharose 6B. Thiopropyl Sepharose
6B gel was prepared according to the manufacturer’s protocol (Pharmacia Biotech) as
follows. The dried material was swollen in 50 mM Tris-HCl, 0.1 M NaCl, pH 7.0, at
room temperature overnight and washed on a Buchner funnel with a large amount of
H2O. The free thiol group was released by suspending gel in 1% (w/v) DTT in 0.3 M
NaHC03, 1 mM disodium EDTA, pH 8.4 for 1 h. The gel was washed with a large
amount of 0.5 M NaCl, 0.1 M acetic acid, 1 mM disodiumEDTA followed by H2O. The
coupling reaction with 5-Hg-dUMP was performed by resuspending the gel in the
Chelex-100 flowthrough with gentle mixing on a shaking platform for 2 h at room
temperature. The unreacted thiol group was inactivated in 0.2 M cysteine in 10 mM Tris-
HCl, pH 7.4. The yield of the coupling reaction was determined from the decrease of
absorbance at 267 nm.
Preparation of Aminoallyl-UDP-GlcNAc-Sepharose for Affinity Chromatography
Synthesis of aminoallyl-UDP-GlcNAc. 5-(3-Amino)allyl-UDP-GlcNAc was
synthesized from 5-Hg-UDP-GlcNAc as described (Zeng et al., 1996) with some
modifications. Synthesis of 5-Hg-UDP-GlcNAc was performed in a similar manner to the
synthesis of 5-Hg-dUMP except the Chelex-100 resin step was omitted. The 5-Hg-UDP-
GlcNAc precipitate was dissolved in 0.5 M NaOAc buffer, pH 5.0 to the final
concentration of 20 mM. Twenty ml of 5-Hg-UDP-GlcNAc solution was mixed with 2.4
ml of freshly prepared 2 M allylamine-acetate, pH 6.0. To make 2 M allylamine-acetate,
pH 6.0, 0.75 ml of allylamine is dissolved in 4.25 ml of 17.4 N acetic acid on ice. The

64
condensation reaction of allylamine with nucleotide sugar was initiated by adding 1
nucleotide equivalent of K^PdCU (Sigma-Aldrich) in 1 ml H2O. The reaction was
maintained at room temperature on a shaking platform for 16 h.
The black metal deposit was removed by filtration though a 0.2 micron syringe
filter twice. The yield of the reaction was determined from the absorbance at 288 nm (7.1
X 103 Nf'cm'1). The yellow filtrate was diluted with 9 vol of H2O and applied to a
DEAE-Sepharose Fast Flow column (2.6 cm x 37 cm) pre-treated with 1 M NaHCCf and
equilibrated with 1 1 of H2O. Then the column was washed with FEO until the A280
returned to baseline. 5-(3-amino)allyl-UDP-GlcNAc was eluted with a gradient of 0 -
300 mM triethylammonium bicarbonate (TEAB), pH 7.7, prepared from 500 ml of H2O
and 500 ml of 300 mM TEAB, pH 7.7. Ten ml fractions were collected. TEAB buffer
was prepared by adjusting the pH of 300 mM TEA in H2O with CO2.
Coupling reaction of 5-(3-amino)allyl-UDP-GlcNAc to NHS-activated
Sepharose-4 Fast-Flow. The fractions containing 5-(3-amino)allyl-UDP-GlcNAc were
pooled and dried under vacuum centrifugation. The dried material was dissolved in
anhydrous dimethylformamide stored in molecular sieves (pore diameter 3 angstrom,
Sigma) and the pH was adjusted to 7.5 with TEA. The pH of the solution was measured
with pH paper (Sigma) and higher pH resulted in insolubilization. Two ml of NHS-
activated Sepharose-4 Fast Flow gel was washed with 10 ml of dimethylformamide on a
Buchner funnel and the gel was resuspended in the 5-(3-amino)allyl-UDP-GlcNAc
solution. The coupling reaction was performed for 24 h with gentle mixing on a shaking
platform at room temperature; however, the maximum of coupling reaction, determined

65
by the decrease of absorbance at 288 nm, occurred in 2 h. The unreacted NHS group was
inactivated in 1 M aminoethanol in 50 mM Tris-HCl, pH 7.8 for 2 h. One ml gel was
packed in a HR5/5 column (Pharmacia). The column was installed in a Smart system
HPLC and was run extensively with degassed 50 mM Tris-HCl, pH 7.8, followed by 0.1
M boric acid, pH 8.0, and stored in 2 M NaCl, 0.005% thimerosol in 50 mM HEPES-
NaOH (pH 7.8).
GlcNAc-Transferase Purification
Cell lysis and DEAE-Sepharose Fast-Flow chromatography. Cell lysis was
performed and the final SI00 supernatant was pumped onto a DEAE-Sepharose Fast
Flow column equilibrated in 50 mM HEPES-NaOH (pH 7.4), 1 mM DTT, 5 mM MgCE,
0.1 mM disodiumEDTA, 10% glycerol as described (chapter 2). Skpl was retained in the
column whereas GlcNAc-transferase activity was found primarily in the wash fractions.
Ammonium sulfate precipitation. (NH4)2S04 (ultrapure, ICN) was added to the
wash fractions from DEAE-Sepharose column to the final concentration of 25%
saturation with stirring at 4°C for 30 min. The sample was centrifuged in a GSA rotor at
10,000 rpm for 20 min. The GlcNAc-transferase activity in the supernatant was
precipitated by increasing (NH4)2S04 to 60% saturation. The pellet was collected by
centrifugation in a GSA rotor at 10,000 rpm for 20 min and dissolved in 300 ml of 25%
saturated (NH4)2S04, 50 mM HEPES-NaOH (pH 7.8), 5.0 mM MgCl2, 0.1 mM disodium
EDTA, 1 mM DTT, 15% (v/v) glycerol.
Phenyl-Sepharose Fast-Flow (low-sub) chromatography. The ammonium
sulfate precipitated sample was applied to a phenyl-Sepharose Fast Flow (low-sub)

66
column (2.6 cm x 20 cm) pre-equilibrated with 25% saturated (NH4)2S04, 50 mM
HEPES-NaOH (pH 7.8), 5.0 mM MgCl2, 0.1 mM disodium EDTA, 1 mM DTT, 15%
(v/v) glycerol at 4°C at the flow rate of 190 ml/h. The column was washed with the same
buffer until the A28o dropped below 1% of its maximum. GlcNAc-transferase activity
was eluted by a decreasing gradient of saturated (NH4)2S04 from 25% to 0% prepared
from 300 ml of the equilibration buffer and 300 ml of the same buffer without
(NH4)2S04. Fractions were stored at -80°C.
Reactive Red-120 chromatography. Reactive Red-120 Fast Flow (1.6 cm x 5
cm) was equilibrated with 50 mM HEPES-NaOH (pH 7.8), 5.0 mM MgCl2, 0.1 mM
disodium EDTA, 1 mM DTT, 15% (v/v) glycerol. The phenyl-Sepharose fractions
containing GlcNAc-transferase activities were pooled and loaded onto the column at 4°C
and at the flow rate of 80 ml/h. The column was washed with the equilibration buffer
until the A280 dropped to within 10% of baseline. The column was eluted by an
application of a 0 - 1.5 M NaCl gradient prepared from 75 ml of the equilibration buffer
and 75 ml of 1.5 M NaCl in the same buffer. Six ml fractions were collected and stored at
-80°C.
Superdex HPLC chromatography. A Superdex 200 (16/60) HPLC column
(Pharmacia Biotech) was equilibrated with 50 mM HEPES-NaOH (pH 7.8), 5.0 mM
MgCl2, 0.1 mM disodium EDTA, 15% (v/v) glycerol at 22°C on an LKB GTi HPLC
system. The Reactive Red fractions containing GlcNAc-transferase activity were pooled,
concentrated in Centriplus-10 ultrafiltration cartridges to less than 2 ml, and loaded onto

67
the column via a 2 ml injection loop. The isocratic run of the same buffer was performed
at the flow rate of 0.8 ml/min and 1.2 ml fractions were collected and stored at -80°C.
The Mr was calculated based on horse spleen apoferritin (443,000), yeast alcohol
dehydrogenase (150,000), bovine serum albumin (66,000), and soybean trypsin inhibitor
(20,100).
5-Hg-dUMP chromatography. The Superdex fractions containing GlcNAc-
transferase activity were pooled and loaded onto 5-Hg-dUMP column (bed vol 1 ml).
DTT was added into the flowthrough to the final concentration of 5 mM. The
flowthrough was concentrated in a Centriplus-10 cartridge to less than 2 ml. After use,
the column was cleaned with 5 mM dUMP and stored in 2 M NaCl, 0.005% thimerosol in
50 mM HEPES-NaOH (pH 7.8).
Aminoallyl-UDP-GlcNAc affinity chromatography. The aminoallyl-UDP-
GlcNAc HR.5/5 column was connected to a short adaptor in a Smart HPLC system and
was equilibrated with 0.1% Tween-80, 5 mM DTT, 50 mM HEPES-NaOH (pH 7.8), 5.0
mM MgCl2, 0.1 mM disodium EDTA, 15% (v/v) glycerol. The concentrated flowthrough
from 5Hg-dUMP column was loaded onto the column via a 2 ml injection loop at 100
ul/min. After 60 min, the column was eluted by a gradient of 0 - 2 mM UMP in the
equilibration buffer at 250 pl/min. In order to identify enzyme activity, an aliquot from
the fractions containing UMP were desalted in ultrafiltration concentrators (Microcon-10,
Amicon) as follows. One hundred ql of eluted fractions was diluted with 400 |ll of 5 mM
DTT, 50 mM HEPES-NaOH (pH 7.8), 5.0 mM MgCl2, 0.1 mM disodium EDTA, 15%
(v/v) glycerol in a Microcon-10 device and centrifuged at 6095 g for 20 min. New buffer

68
was added and the filtrate was discarded. The process was repeated 3 times to reduce the
UMP concentration to less than 20 pM. The fractions containing activities were pooled,
concentrated in a Centricon-10 cartridge, and desalted on a Fast Desalting PC3.2/10
column (Smart system HPLC). An isocratic run of 50 mM HEPES-NaOH (pH 7.8), 5
mM MgCb, 0.1 mM disodium EDTA, 5 mM DTT was performed at the flow rate of 100
pl/min. Fractions of 100 pi were collected. The GlcNAc-transferase activity came out in
fractions 3-6 which were pooled and used for subsequent studies.
High-pH Anion-Exchange Chromatography of the Acid Hydrolysis Derivatives of
[3H]GlcNAc-Skpl
GlcNAc-transferase assays using the aminoallyl-UDP-GlcNAc-affmity-purified
GlcNAc-transferase were performed as described. The gel slices containing [3H]GlcNAc-
Skpl were rinsed with filtered H2O. Minced gel slices were hydrolyzed in 1 ml of 4 M
TFA at 100°C for 4 h. The soluble part was dried by vacuum centrifugation and
resuspended in 1 ml methanol with vortexing. This process was repeated twice. The
radioactive products were reconstituted in 100 pi of 0.2 pm filtered water, mixed with 1
nmol of D-glucosamine (GICNH2), and chromatographed on a Dionex PA-10 HPLC
column equilibrated in 17 mM NaOH at 1 ml/min. The flowthrough fractions were
counted for [3H]radioactivity directly using Scintiverse-HP scintillation cocktail.
Reductive Alkaline Degradation of [3H]GlcNAc-Skpl
GlcNAc-transferase assays using the aminoallyl-UDP-GlcNAc-affmity-purifled
enzyme were performed as described. The gel slices containing [3H]GlcNAc-Skpl were
rinsed with filtered H2O. The (3-elimination of gel slices was performed with the addition

69
of an equal vol of 1M NaBlrLt in 0.2 M NaOH in 5 ml Reacti-vials. After incubation at
45°C for 20 h, the supernatant was transferred into a polypropylene tube, neutralized with
an equal vol of 1 M acetic acid in methanol, and dried under vacuum centrifugation. The
radioactive residue was dissolved in 2 ml of H2O, adjusted the pH to 9.5 with 2-amino-2-
methyl-1 propanol determined by spotting 5 [il of the sample on pH paper, and loaded
onto 1 ml Dowex-1 strong anion exchange resin pre-activated with 5 ml of 1 M HC1 and
equilibrated with 10 ml of H2O. The flowthrough was collected and an aliquot was
measured for [3H] using Scintiverse-HP scintillation cocktail.
Results
GlcNAc-Transferase Activity that Modified Skpl was Found in the S100 Fraction of
Dictyostelium
The monosaccharide composition analysis (Fig. 2.8) of Skpl-c-myc isolated
from overexpression strain HW120 detected only one-sixth of the expected amount of
Fuc and GlcNAc (Teng-umnuay et al., 1998). This finding suggested that Skpl-c-myc
was under-glycosylated which was supported by the MALDI-TOF-MS data of Skpl-c-
myc peptidel39-155. The endolysin-C digested Skpl-c-myc peptides were separated on a
reverse phase HPLC (Fig. 2.12) and the eluted fractions were subjected to MALDI-TOF
MS study. The mass spectra of peptide 139-155 showed series of m/z 2487, 2325, 2163,
1653, and 1636 indicating various stages of glycosylation (Fig. 2.13). One of these
peptides had an m/z 1652 which corresponded to the hydroxylated-unglycosylated-Skpl-
peptidel39-151. This finding indicated that Skpl-c-myc should contain a hydroxylated
form which could be a suitable substrate for a GlcNAc-transferase predicted to attach the
first sugar on to the hydroxyproline residue. To test the hypothesis, an assay for the

70
GlcNAc-transferase was developed, based on a transfer of [3H] from UDP-[3H]G1cNAc
to Skpl-c-myc. The reactions were resolved by SDS-PAGE, and [3H] incorporation into
gel slices containing Skpl-c-myc was measured. GlcNAc-transferase activities were
tested in crude SI00 from the normal strain Ax3 and from the overexpression strain
HW120 (Fig. 3.1). In the absence of Skpl-c-myc, incorporation of [3H] into Ax3-S100
was found throughout the gel indicating that multiple proteins could take up [3H]G1cNAc.
However, in the presence of Skpl-c-myc, increased incorporation was found in the 21-24
kDa region of the gel as expected for Skpl-c-myc. In contrast, in HW120-S100,
incorporation of [TI]GlcNAc into the region of the gel containing Skpl-c-myc was found
with a relatively high level and was stimulated only slightly by added Skpl-c-myc
suggesting that endogenous Skpl-c-myc had nearly saturated the enzyme in vitro. The
hypothesis was supported by the finding that the addition of a Skpl mAb 3F9 greatly
inhibited incorporation (Fig. 3.3).
To gain further evidence that [3H]G1cNAc was incorporated into Skpl, a synthetic
peptide corresponding to residues 133-155 of Skpl with 4-hydroxyproline at the
equivalent residue 143 was added to the reactions in addition to Ax3-S100 or HW120-
S100 (Fig. 3.2). The SDS-PAGE analyses showed that the region of the gel containing
the peptide incorporated substantial levels of [3H] in both strains. In HW120-S100, there
was less [3H]incorporation in the Skpl region suggesting that the peptide and endogenous
Skpl were competitive as acceptor substrates (compare Fig. 3.1 and 3.2).
To address whether the attachment of [3H]G1cNAc occured at the hydroxyproline,
His-tagged recombinant Skp-1 from E.coli (Skpl-His), in which Prol43 was not

71
AX3-S100 HW120-S100
116-205 kDa
E
97-116 kDa
â–¡ without Skp1-c-myc
66-97 kDa
â– B
1 10 with Skp1-c-myc
LMIII 11,1,1
45-66 kDa
Cjü
36-45 kDa
29-36 kDa
&
24-29 kDa
21-24 kDa
m ,
&
14-21 kDa
-
&
7-14 kDa
&
0.3-7 kDa
mk
1
<0.3 kDa
mmém—, . , . , .
400 300 200 100 0
0 100 200 300 400
Activity (pmoi/gm/h)
Activity (pmoi/gm/h)
Figure 3.1 Transfer of [3H] from UDP-[3H]-G1cNAc into S100 fractions of normal
strain Ax3 and Skpl-overexpression strain HW120. SI00 fractions from normal strain
Ax3 and overexpression strain HW120 were incubated with 0.6 |lM UDP-[3H]-G1cNAc
in areaction mixture containing 50 mm Tris-HCl (pH 7.4), 14 mM MgC^, 3 mM MnCF,
3 mM ATP, and 6 mM NaF in the absence or presence of 0.54 jiM Skpl-c-myc. After 2
h incubation at 30°C, the samples were diluted with LSB, boiled and resolved by SDS-
PAGE. After staining and destaining, proteins in gel slices were extracted and measured
for [3H] incorporation. The incorporation into Skpl-containing gel slices with the Mr of
21-24 kDa was greater in strain HW120 than those of strain Ax3 due to the higher level
of endogenous Skpl substrate. In the presence of Skpl-c-myc, [3H] incorporation in
Skpl-containing gel slices was increased in both strains.

72
Activity (pmol/gm/h)
Figure 3.2 Transfer of [3H] from UDP-[3H]G1cNAc into S100 fractions of normal
strain Ax3 and overexpression strain HW120 in the presence of Skpl-peptide 133-
155. SI00 fractions from normal strain Ax3 and overexpression strain HW120 were
incubated with 0.6 pM UDP-[3H]G1cNAc in the presence or absence of 0.18 mM
synthetic Skpl-peptide 133-155 and GlcNAc-transferase assays were performed as
described in Fig. 3.1. Increased incorporation in peptide containing gel slices was
apparent in both strains. In comparison to Fig. 3.1, [3H]incorporation into the peptide and
endogenous Skpl-c-myc in HW120-S100 were competitive with each other.

73
Synthetic peptide - +
mAb 3F9
Figure 3.3 Inhibition of GIcNAc-transferase activities by synthetic peptide 133-155
and anti-Skpl-antibody. SI00 fractions from overexpression strain HW120 were
assayed for GIcNAc-transferase activity as described in Fig. 3.1 in the absence or
presence of 2.5 pi of mAb3F9 ascites which is specific to Skpl. The mAb3F9 inhibited
incorporation in both endogenous Skpl-c-myc and synthetic peptide suggesting the
specificity of both substrates.

74
Figure 3.4 GlcNAc-transferase activity is specific for Skpl-c-myc. SI00 from normal
strain Ax3 and overexpression strain HW120 were assayed for the GlcNAc-transferase
activities in the absence or presence of 0.54 |o.M Skpl-c-myc or 0.54 |lM recombinant
Skpl from E.coli (Skpl-His) as described in Fig 3.1. Only Skpl-c-myc, which contains
the unglycosylated-hydroxylated form of Skpl, can stimulate the GlcNAc-tranferase
activities in both Ax3-S100 and HW120-S100.

75
hydroxylated, was tested as a substrate. The result (Fig. 3.4) showed that Skpl-His could
not stimulate the enzyme activity suggesting that [3H]G1cNAc was attached to the
hydroxyproline residue. These data were supported by the evidence that synthetic
peptide 133-155 with Pro in place of HyPro could not stimulate enzyme activity (data not
shown).
To address the compartmentalization of the enzyme activity, GlcNAc-transferase
activities were tested in PI00 fraction from Ax-3 strain and PI00 treated with 0.25%
Tween-80 (Fig. 3.5). The [3H]incorporation in PI00 treated with Tween-80 was
expectedly higher than that of PI 00 due to the leakage of membrane bound proteins.
The incorporation in both PI00 fractions was higher than that of SI00 (compare Fig 3.1
and 3.5) indicating more proteins residing in P100 could uptake [ HJGlcNAc. However,
in PI 00 fractions, the incorporation in [3H]incorporation in the 21-24kDa region of the
gel was not increased when Skpl-c-myc was added.
The dependence of enzyme activities on pH was tested after enzyme buffer was
replaced by gel filtration (Fig. 3.6). The highest activity was found at pH 7.5 - 8.0 and pH
7.8 was chosen as the assay pH in subsequent studies.
Purification Step 1: Anion Exchange Chromatography on DEAE Fast-Flow
The SI00 preparation from overexpression strain HW120 was loaded onto DEAE
Fast-Flow Sepharose at pH 7.4 and eluted with a gradient of 0 - 0.25 M NaCl. GlcNAc-
transferase activity was found in the wash fractions (Fig. 3.7) suggesting that the enzyme
was bound weakly to the column. The result was reproducible when the buffer was
replaced with 50 mM Tris-HCl, ImM DTT, pH 7.5. Since the total activity in S100 could

76
P100
P100/0.25%Tween- 80
Activity (pmol/gm/h)
Activity (pmol/gm/h)
Figure 3.5 Transfer of [3H] from UDP-[3H]-G1cNAc into P100 fractions of normal
strain Ax3 in the presence of Skpl-c-myc. The PI00 fraction from normal strain Ax3
was diluted 5 times with 0.25 M sucrose in 50 mM Tris-HCl (pH 7.4). An aliquot of
diluted PI00 was treated with 0.25% Tween-80 to measure potential latent activity.
GlcNAc-transferase assays of PI 00 and P100/Tween-80 were performed as described in
Fig. 3.1. Exogenous Skpl-c-myc did not stimulate incorporation in P100 fractions.

dpm
77
2000
6 6.5 7 7.5 8
pH
Figure 3.6 The effects of pH on Skpl-GlcNAc-transferase activity. SI00 fractions
from HW120 were applied to PD 10 columns pre-equilibrated with 50 mM Tris-HCl with
different pH. GlcNAc-transferase activity in PD-10 fractions 3 which contained the
highest activity was assayed. The data showed that low pH inhibited and high pH
stimulated enzyme activity.

78
14000
E
o.
"O
sz
O)
13
T-
CM
CO
"O-
in
CD
t'-
JC
-C
-C
sz
-£=
-C
sz
CO
CO
CO
CO
CO
CO
CO
O
CO
CO
CO
CO
CO
CO
CO
-C
-&—»
5
o
LL
5
£
£
£
£
£
Figure 3.7 GlcNAc-transferase activities in the flowthrough and wash fractions from
DEAE-Sepharose. HW120-S100 was pumped onto a DEAE-Sepharose column. Twenty
|il aliquots of the flowthrough (total vol = 800 ml) and wash fractions (approximate total
vol = 200 ml each) were assayed for GlcNAc-transferase activity. Majority of the enzyme
activity was found in the wash fractions.

79
not be determined due to the presence of an unknown amount of the endogenous
substrate, Skpl-c-myc, the activity in the wash fractions was taken as 100% (Table 3.1,
line 1).
To optimize the assay conditions of the enzyme, the DEAE wash fraction was
concentrated in an ultrafiltration cell, and tested for enzyme activity in the absence or
presence of various concentration of NaCl, KC1, MnCf, and CaCl2. NaCl inhibited
activities more than KC1 (Fig. 3.8) and both MnCl2 and CaCl2 inhibited enzyme activity
(Fig.3.9). It is notable that the assays contained 5 mM MgCl2 and the enzyme activity
was partially inhibited at MgCl2 concentration higher than 10 mM (see below).
Purification Step 2: Ammonium Sulfate Precipitation
The enzyme activity was purified further by ammonium sulfate fractionation.
Ammonium sulfate ((NH4)2S04) was added to the DEAE wash to 25% saturation. The
enzyme activity which remained soluble could be precipitated by increasing (NH4)2S04
to 60% saturation. The pellet was collected and redissolved in 25% saturated (NH4)2S04
in 50 mM HEPES-NaOH (pH 7.8), 5 mM MgCl2, 0.1 mM disodiumEDTA, 1 mM DTT,
15% glycerol. Small aliquots of the enzyme fractions containing (NH4)2S04 were
desalted in Microcon-10 devices and tested for GlcNAc-transferase activity. The
recovery of enzyme activity in 25% saturated (NH4)2S04 supernatant and 60% saturated
(NH4)2S04 pellet (Table 3.1, line 3 and 4) was only 81% and 50%, respectively. The
activities might be lower than expected due to inhibition by remaining (NH4)2S04 in the
assays. Enzyme activity was completely recovered after (NH4)2S04was removed by
purification over a phenyl-Sepharose column (see below).

80
Table 3.1 Purification of GlcNAc-transferase activity. Purification of GlcNAc-
transferase activity from the cytosol of Dictyostelium strain HW120. SI00 extract was
prepared and applied on DEAE-Sepharose Fast Flow. The wash fractions were further
purified over phenyl-Sepharose (low sub), Reactive Red-120, Superdex HPLC, dUMP,
and UDP-GlcNAc columns.
Preparation
Protein
(mg)
Total
activity
(pmol/h)
Yield
(%)
Specific
activity
(pmol/mg/h)
Purification
(fold)
1. S100
4431
480.84a
100
0.108
1
2. DEAE-Sepharose
1744
480.84
100
0.276
2.54
3. 25% Saturated (NH4)2S04 sup.
1603
388.18
80.73
0.242
2.23
4. 60% Saturated (NH4)2S04 pel.
745.5
242.79
50.49
0.326
3
5. Phenyl-Sepharose
161.6
759.99
158.05
4.703
43.3
6. Reactive Red-120 agarose
16.02
77.32
16.08
4.826
44.5
7. Superdex-HPLC
3.09
70.95
14.76
22.91
221
8. dUMP-Sepharose
2.25
70.41
14.64
31.29
288
9. UDP-GlcNAc-Sepharose
0.035
66.75
13.88
1887
17393
“Minimum estimate derived from the next stage of purification.

81
Figure 3.8 The effects of NaCl and KC1 on GlcNAc-transferase activity. The
concentrated DEAE wash fractions were assayed for GlcNAc-transferase activity in the
presence of different concentration of NaCl or KC1. Each reaction contained 5 mM
MgCl2, 3 mM ATP, 5 mM DTT, 0.5 mg/ml BSA, and 0.6 nM UDP-GlcNAc. NaCl
inhibited the activity more than KC1.

82
O 1 2.5 5 10
Concentration (mM)
Figure 3.9 The effects of CaCl2 and MnCl2 on GlcNAc-transferase activity. The
concentrated DEAE wash fraction was assayed for GlcNAc-transferase activity in the
presence of different concentration of CaCl2 and MnCl2. Each reaction contained 5 mM
MgCl2, 3 mM ATP, 5 mM DTT, 0.5 mg/ml BSA, and 0.6 (iM UDP-GlcNAc. Both CaCl2
and MnCl2 inhibit the activity.

83
Purification Step 3: Hydrophobic Interaction Chromatography on Phenyl-
Sepharose-(Low-Sub) Fast-Flow
The enzyme activity which had been dissolved in 25% saturated (NH4)2S04 was
loaded onto a phenyl-Sepharose-low-sub column. Enzyme activity bound to the column
could be eluted by decreasing the concentration of (NH4)2S04. The enzyme activities
were found in late fractions as (NH4)2S04 concentration diminished near to zero (Fig.
3.10). Based on the purification yield (Table 3.1, line 5), the activity was recovered
completely. Further elution with 50% ethylene glycol did not yield any more activity.
Purification Step 4: Reactive Dye Chromatography on Reactive Red-120 Fast Flow
The phenyl-Sepharose fractions containing GlcNAc-transferase activity were
applied to a Reactive Red-120 fast flow column. Activity bound to the column and eluted
in a gradient of 0-1.5 M NaCl (Fig. 3.11). A KC1 gradient was not as effective since the
enzyme activity was eluted broadly across the gradient (data not shown).
Only 16% of the activity was recovered from Reactive Red purification (Table
3.1, line 6). The small amount of the activity (2%) found in the flowthrough fraction
could not explain the significant losts of activity (Fig. 3.12). To test for a potential
subunit which might have been separated during the purification, the flowthrough
fractions mixed with the eluted fraction were assayed for the activity (Fig. 3.12). The
addition of the flowthrough fractions to the eluted fraction could not recover any more
activity but instead inhibited it by 45% indicating that an essential cofactor did not seem
to be separated from the enzyme unless it was eluted at a higher NaCl concentration or
still bound to the column. To test for the possibility that an essential cofactor existed at an

84
-a
c$
o
l-J
J3
C/5
£
i)
w
3
w
(NH4)2S04 saturation
1200
1000
800
600 1
400
200
0
Figure 3.10 Purification of GlcNAc-transferase on phenyl-Sepharose low-sub
column. GlcNAc-transferase activity in DEAE wash fraction was precipitated with 60%
saturated (NH^SCE and applied onto a phenyl-Sepharose low-sub column pre¬
equilibrated with 25% saturated (NEEESCE in 50 mM HEPES-NaOH (pH 7.8), 5 mM
MgCh, 0.1 mM EDTA, 1 mM DTT, 15% glycerol. The column was eluted by decreasing
(NH^SCE concentration down to zero. The eluted fractions were tested for GlcNAc-
transferase activity.

85
o
hJ
(U
J3
W
s
c
o
I 1
Fraction number
Figure 3.11 Purification of GlcNAc-transferase on a Reactive Red-120 column. The
pheny 1-Sepharose eluted fractions which contained GlcNAc-transferase activities were
pooled and loaded onto a Reactive Red-120 column. The column was eluted by an
application of NaCl gradient to 1.5 M. The eluted fractions were tested for GlcNAc-
transferase activity.

86
500
1 2 3 4 5
Reactive Red fr. 9
+
+
+
-
-
Flowthrough fr. 1
-
+
-
+
-
Flowthrough fr. 2
-
-
+
-
+
Figure. 3.12 Reactive Red flowthrough fractions could not restore GlcNAc-
transferase activity. Reactive-Red eluted fraction 9 which contained the highest activity
was assayed in the absence or presence of flowthrough fraction 1 and 2. The flowthrough
fraction did not increase the GlcNAc-transferase activity but instead inhibited it.

87
earlier stage of purification, similar test was performed by mixing the Reactive Red pool
with the phenyl-Sepharose pool or with the SI00 fraction (Fig. 3.13). No more than
additive results were obtained. Thus, there was no evidence for the separation of essential
components on the Reactive-Red 120 column.
Purification Step 5: Gel Filtration Chromatography on Superdex HPLC
The Reactive-Red-120 fractions were pooled and concentrated in a Centriplus-10
cartridge. The concentrated enzyme was loaded onto a Superdex HPLC gel filtration
column. DTT was omitted as a reducing agent would modify the Hg-dUMP Sepharose
resin to be used in the next step of purification. Only a single peak of enzyme activity
was found (Fig. 3.14) with a recovery yield of 92% (Table 3.1, compare line 6 and 7).
Similar results were obtained from another experiment which the running buffer also
contained 0.1% Tween-80. Based on comparison to the elution positions of globular
proteins with known masses, the apparent Mr of the enzyme was estimated to be 33,000.
The fractions of Superdex pool were tested for activity in the absence or presence
of various concentrations of DTT or MgCL. The results showed that GlcNAc-transferase
activity was absolutely dependent on DTT (Fig. 3.15) with maximum activity at 5-10
mM DTT. Over the range of 1-15 mM, 10 mM MgCL yielded optimal activity (Fig.
3.16). Incorporation was blocked by 5 mM EDTA (Fig 3.16).
The enzyme activity was found to be unstable upon storage at 4°C (Fig. 3.17).
However, inclusion of 0.1% (v/v) Tween-20 or Tween-80 prevented the lost of activity
and in fact stimulated activity up to two-fold. Although the other detergents in this test
could stabilize activity, they initially suppressed activities for up to 50%.

88
Superdex pool + + +
S100 + . +
phenyl-Sep. pool + . +
Figure 3.13 Ax3-S100 or phenyl-Sepharose fraction did not increase GlcNAc-
transferase activity in the Reactive-Red purified fraction. Reactive Red fraction was
assayed for GlcNAc-transferase activity in the absence or presence of Ax3-S100 or
phenyl-Sepharose fraction. No more than additive effects of SI00 and phenyl-Sepharose
fraction were obtained.

89
M.W. standard (kDa) 443 150 66 21
I II I
p
Q<
T3
5000 -|
4000 -
3000
2000 -
1000 -
0
/
, \
0
—i—
20
40
-•««««• r
60 80
Volume (ml)
100
120
140
Figure 3.14 Purification of GlcNAc-transferase on a Superdex gel filtration HPLC
column. The Reactive Red-120 eluted fractions which contained GlcNAc-transferase
activity were pooled, concentrated in a Centriplus-10 cartridge and fractionated on a
Superdex200 HPLC column. An isocratic run with 0.1% Tween-80 in 50 mM HEPES-
NaOH (pH 7.8), 5 mM MgCL, 0.1 mM EDTA, 15% glycerol was performed and the
fractions were tested for GlcNAc-transferase activity. The Mr was calculated based on
horse spleen apoferritin (443,000), yeast alcohol dehydrogenase (150,000), bovine serum
albumin (66,000), and soybean trypsin inhibitor (21,000).

90
0.3
DTT concentration (mM)
Figure 3.15 The GlcNAc-transferase activity is dependent on DTT. Superdex purifed
enzyme fractions were assayed for GlcNAc-transferase activity in the absence or
presence of various concentrations of DTT. The enzyme activity absolutely required DTT
with the maximum activity at the DTT concentration of 5-10 mM.

91
1 3 5 1 0 1 5 5 mM MgCI2
+ 5 mM EDTA
concentration (mM)
Figure 3.16 The GlcNAc-transferase activity is dependent on MgCl2. Superdex
purifed enzyme fractions were assayed for GlcNAc-transferase activity in the presence of
various concentration of MgCl2. The lowest MgCl2 concentration tested was 1 mM due to
the presence of MgCl2 in enzyme buffer. The enzyme activity was dependent on MgCl2
with the maximum activity at the final MgCl2 concentration of 5-10 mM. EDTA at the
concentration of 5 mM completely inhibited the activity.

92
Detergent (0.1% v/v)
Figure 3.17 The effects of detergents on GlcNAc-transferase activities. The Superdex
purified GlcNAc-transferase pool was stored at 4°C in the absence or presence of
different kinds of detergent at 0.1% v/v. At 0 h and 24 h, aliquots of enzyme-detergent
mixture were tested for the GlcNAc-transferase acitivity. The results showed that enzyme
activity was slightly activated in the presence of Tween-20 or Tween-80, and was
stabilized for up to 24 h.

93
The Effects of Nucleotide Analogues on GlcNAc-Transferase Activity
To develop an affinity purification method and a photoprobe for the enzyme, it
was necessary to understand how the enzyme recognized UDP-GlcNAc. The GlcNAc-
transferase activity was measured in the presence of UDP-GlcNAc analogues with
substitution at various positions. The Superdex pool was assayed as described except
ATP was omitted (Table 3.2). In the presence of 0.657 (iM UDP-GlcNAc, UMP, UDP,
UTP, 4thio-UMP, Bio-11-UTP, UDP-Glc, and uridine showed concentration dependent
inhibition of GlcNAc-transferase activity in the range of 0.1-1 mM. In contrast, 2’3’-o-
isopropylidene-uridine, ATP, and UDP-GalNAc showed stimulatory effects at 0.1 mM
with apparent inhibition occurring only at ImM. Uracil stimulated activity at both
concentrations. dUDP, dUMP, UDP-hexanolamine, and CTP had little or no effect over
the tested concentration range.
These data suggested that the inhibitory potential of UDP-GlcNAc analogues was
decreased by substitutions at the 2’and 3’ positions of ribose (2’3’-o-isopropylidene-
uridine and deoxy UMP) and non-homologous substitutions for GlcNAc (UDP-
hexanolamine, UDP-GalNAc) (Fig. 3.18). They also suggested that two commercially
available resins, UDP-hexanolamine and UDP-adipate, could be ineffective in capturing
the GlcNAc-transferase activity. In contrast, enzyme binding could tolerate the
modifications at the 4 (4thio-UMP) and 5 (Bio-11-UTP) positions of uracil group. The
reason that some analogues stimulated activity could be explained by their competition
with the substrate, [3H]UDP-G1cNAc, in binding with some nucleotide binding factors in
the enzyme preparation.

94
Table 3.2 Relative activity of the GlcNAc-transferase in the presence of donor
substrate analogues. Superdex-HPLC-purified fractions were assayed as described but
without ATP in the presence of 0.657 UDP[3H]G1cNAc, 1 pM Skpl-c-myc, and 0 mM,
0.1 mM, or 1 mM nucleotide analogues.
0
Inhibitor
0.1 mM
1 mM
None
1
UMP
.33
0
UDP
.59
.18
UTP
.83
.43
4thio-UMP
.42
.26
Bio-11-UTP
.62
.32
UDP-Glc
.70
.15
uridine
.85
.71
dUMP
.73
.71
ATP
1.48
.67
UDP-GalNAc
1.33
.69
2 ’ 3 ’ -o-isopropy lidene-uridine
1.20
.89
CTP
1.09
.81
UDP-hexanolamine
1.01
.76
dUDP
.91
.96
uracil
1.56
1.44

95
UDP-hexanolamine 4-thiouridine
UDP-GalNAc
2',3'-isopropylidene uridine
Figure 3.18 The chemical structure of UDP-GlcNAc and the potential enzyme
recognition sites tested by nucleotide analogues.

96
Based on these data, an affinity column and a photoaffinity probe were designed
by modifying the 4 or 5 position of the uracil group.
Purification Step 6: 5-Hg-dUMP Sepharose Chromatography
A 5-Hg-dUMP resin was synthesized to be used as a precolumn in an attempt to
capture other nucleotide binding proteins. The synthesis of 5-Hg-dUMP Sepharose was
performed in two steps, mercuration at the 5 position of uridine, and coupling the Hg-
moiety to the sulfur group on Thiopropyl Sepharose (Fig. 3.19). The yield of
mercuration, measured by the shift of absorbance spectrum from 260 nm to 267 was
about 71%. After the coupling reaction, the ligand concentration per ml of Sepharose was
about 53 pmol/ml.
Since the Hg-S bond is sensitive to reducing reagents, the previous Superdex
purification step was performed with DTT-free buffer. Superdex purified fractions
containing GlcNAc-transferase activities were pooled and loaded on to a 5-Hg-dUMP
column. GlcNAc-transferase activity was recovered in the flowthrough with 99% yield
(Table 3.1, compare line 7 and 8).
After purification over the dUMP column, the stimulation by uracil found in
Superdex purified enzyme was reduced from 40% to 9% (Fig. 3.20). These data
suggested that other proteins which bind UDP-GlcNAc in the assay were successfully
removed.
The Hg-dUMP flowthrough fraction was tested for GlcNAc-transferase activity
over a time course (Fig. 3.21). An accumulation of the reaction product, [3H]G1cNAc-
Skpl-c-myc, was found for up to 4 h. An initial lag phase of 15 min was observed

97
HO
OH H
Figure 3.19 The structure of 5-Hg-dUMP-Sepharose 6B

98
2.0-
â–¡ Superdex purified
ED dUMP purified
1.5-
0 0.1 1
Uracil concentration (mM)
Figure 3.20 Comparative effects of uracil on Superdex purifed and dUMP-
Sepharose purified GlcNAc-transferase. Superdex purified fractions and dUMP-
Sepharose flowthrough fractions were assayed for GlcNAc-transferase activity in the
presence of 0, 0.1, and 1 mM uracil. The activation effect of uracil found in the Superdex
purified enzyme was diminished after the enzyme was purified over the 5-Hg-dUMP-
thiopropyl Sepharose column. The enzyme activity in dUMP flowthrough was similar to
that of Superdex purified fraction after stimulation with uracil suggesting that the dUMP
column had captured other non-specific UDP-GlcNAc binding factors.

99
Time (min)
Figure 3.21 Time course analysis of GlcNAc-transferase activity. The dUMP
flowthrough fractions were assayed for GlcNAc-transferase activity. The reactions were
incubated at 30°C for up to 6 h. The plot of enzyme activity vs. time had a sigmoidal
characteristic with an initial lag phase of 15 min.

100
suggesting the time for the enzyme-substrate complex to be formed. An incubation time
of 1 h was chosen for subsequent kinetic studies.
Purification Step 7: Affinity Chromatography on 5-(3-aminoallyl)-UDP-GlcNAc
Sepharose Fast-Flow
The preparation of an affinity column for the GlcNAc-transferase started with the
synthesis of 5-Hg-UDP-GlcNAc. The yield of mercuration was about 70%. In the second
step, the 5-Hg-group was replaced by ally lamine with 63% yield. The desired product, 5-
(3-amino)allyl-UDP-GlcNAc, has previously been shown to have absorbance maximum
at 240 and 287 and minimum at 262 nm (Zeng et al., 1996 typical for a compound with
an exocyclic double bond with a pyrimidine ring. The reaction products were applied
over a DEAE-Fast Flow column. Three UV absorbing peaks were eluted (Fig. 3.22).
Peak A showed an absorbance profile characteristic of 5-(3-amino)allyl-UDP-GlcNAc
whereas peak C showed an absorbance maximum at 260 nm and was most likely residual
UDP-GlcNAc. In a separate experiment, peak D, probably the unreacted 5-Hg-UDP-
GlcNAc, with an absorbance maximum at 267 nm, also appeared.
Purified 5-(3-amino)allyl-UDP-GlcNAc was dried under vacuum centrifugation
and redissolved in anhydrous dimethylformamide (DMF). Then the pH of the solution
was adjusted to 7.5 with TEA. The coupling reaction was performed by acylation of the
terminal NH2 group with NHS activated Sepharose in DMF (Fig. 3.23). The
concentration of 5-(3-amino)allyl-UDP-GlcNAc, calculated from the decrease of A287,
was about 14 pmol/ml gel.
The 5Hg-dUMP-Sepharose flowthrough was concentrated in a Centriplus-10
concentrator, applied to a 5-(3-amino)allyl-UDP-GlcNAc-Sepharose column, and eluted

101
TEAB pH 7.7
300 mM
Volume (ml)
wavelength scan
Figure 3.22 Chromatography of the reaction products from 5-(3-aminoallyl)-UDP-
GlcNAc synthesis after purification over a DEAE Sepharose Fast Flow column. The
reaction mixture was diluted 10 times with water and applied onto a DEAE Sepharose
fast-flow column. After thorough washing with water, bound nucleotides were eluted
with a 0 to 300 mM gradient of TEAB, pH 7.7. The UV spectra of eluted peak A and
peak C were compatible with 5-(3-aminoallyl)-UDP-GlcNAc and UDP-GlcNAc,
respectively whereas that of peak B was unidentified. Peak D with a UV spectrum
characteristic of 5Hg-UDP-GlcNAc was recovered with variable yield.

ch2oh
HNAc
O O
ii n s
-P-O-P-O-CH2
OH OH
NH—OxAA/^HN-
O
Sepharose 4
last flow
OH OH
Figure 3.23 The structure of 5-(3-aminoallyl)-UDP-GlcNAc Sepharose 4

103
with an ascending gradient of UMP to 2 mM (Fig. 3.24). Eluted fractions were desalted
in Microcon-10 concentrators and tested for GlcNAc-transferase activity. To remove
UMP, the enzyme fractions containing activity were pooled, concentrated in a Microcon-
10 concentrator, and desalted on a Fast Desalting PC3.2/10 column (Smart system). The
purified fractions with 95% recovery yield were pooled and used for the test of kinetic
properties and photoaffmity labeling. The estimated purification fold was 1.7 x 104 with
the final yield of 14% (Table 3.1).
Characteristics of the Acceptor Substrate Product
When in vivo labeled [3H]fucose-Skpl was subjected to reductive alkaline
degradation, a radiolabeled product was formed which had a charge of-2 at pH 9.5
(Gonzales-Yanes et al., 1992). Since the fucoglycan is now known (Teng-umnuay et al.,
1998) and expected to be neutral, the negative charge must have been derived from
scission of polypeptide backbone. In order to determine whether the product of the Skpl -
GlcNAc-transferase assay would yield a similar derivative, reductive alkaline degradation
of gel slices containing [3H]GlcNAc-Skpl was performed. The result showed that 64% of
the in vitro radioactive product bound to Dowex-1 resin at pH 9.5, compared to 75%
binding of the in vivo labeled product. These data suggested that the GlcNAc was not
linked to Ser or Thr, since the expected reaction product, N-acetyl glucosaminitol
(GlcNAc-ol) which have neutral charge would not retain in Dowex resin.
In contrast, the GlcNAc-HyPro linkage was sensitive to acid hydrolysis. Gel
slices containing [3H]GlcNAc-Skpl from the in vitro assay of purified GlcNAc-
transferase fraction were treated with 4 M TFA for 4 h at 100°C. Twenty percent of the

104
Figure 3.24 Purification of GlcNAc-transferase activity on 5-(3-aminoallyl)-UDP-
GlcNAc Sepharose. The dUMP-Sepharose flowthrough was concentrated and applied to
a 5-(3-aminoallyl)-UDP-GlcNAc Sepharose HPLC column. The enzyme activity was
eluted with a 0-2 mM UMP gradient. Eluted fractions were desalted in Microcon-10
cartridges and tested for GlcNAc-transferase activity.

105
total radioactivity eluted from the gel was was co-chromatographed with glucosamine
(GICNH2) on a Dionex PA-10 HPLC column (Fig. 3.25). These data suggested that
incorporated radioactivity was GlcNAc, since acid hydrolysis would be expected to de-N-
acetylate GlcNAc. Acid hydrolysis with 6 M HC1 for 6 h at 120°C gave similar results
with only 3% recovery (data not shown) suggesting decomposition of [ HjGlcNHh by
strong acid treatment.
To confirm that the [3H]G1cNAc was attached onto the hydroxyproline 143,
synthetic Skpl-peptide 133-155 with 4-hydroxyproline at position 143 and Skpl-peptide
133-155 with Pro at this position were tested as acceptor substrates. The result showed
that only hydroxyproline 143-peptide was utilized as a substrate (Fig. 3.26). Likewise,
recombinant Skpl (Skpl-His), in which Pro was not hydroxylated, failed to get
[3H]G1cNAc incorporation (Fig. 3.27). Increasing the the amount of enzyme by 2 fold
resulted in 50% increase of incorporation.
Kinetic Properties of the Skpl-GIcNAc-Transferase
The affinity purified GlcNAc-transferase activity was incubated with various
concentrations of the Hy Pro-peptide (Fig. 3.26), Skpl-c-myc (Fig. 3.27), and UDP-
[3H]G1cNAc (Fig. 3.28). The kinetics of the activity with respect to each substrate was
obeyed to the Michaelis-Menten model as shown by the linear form of the Lineweaver-
Burk double reciprocal plots. The linear regression analyses of the double reciprocal plots
were fitted to straight lines with r = 0.96 for Hy Pro-peptide, r= 0.99 for Skpl-c-myc, and
r = 0.97 for UDP-[3H]G1cNAc.

106
Figure 3.25 High-pH anion-exchange chromatography of the acid hydrolysis
derivatives of [3H]GlcNAc-Skpl. GlcNac transferase assay of affinity purified enzyme
was performed as described. The gel slice containing [3H]-labeled Skpl-c-myc was
rinsed with 0.2 pm filtered water and hydrolyzed in 4 M TFA at 100°C for 4 h. The
soluble part was dried under vacuum centrifugation and rinsed with methanol twice. The
radioactive product was dissolved in 100 pi of 0.2 pm filtered water containing 1 nmol of
G1cNH2 and fractionated on a Dionex-PA10-HPLC column. A. An amperometric profile
of standard sugars. B. The amperometric profile of the sample shows the retention time of
internal standard, GlcNTB. C. 20% of the loading radioactivity was co-chromatographed
with G1cNH2.

107
1/S
Figure 3.26 Kinetic properties of the GlcNAc-transferase with respect to the HyPro
peptide. A. The affinity purified GlcNAc-transferase was incubated with various
concentrations of Skpl peptide 133-155 in the presence of 0.66 |iM UDP-[3H]G1cNAc
for lh. The assays were performed in duplicate. B. Double-reciprocal plot of the data was
approximated by a straight line (y = 0.016 + 0.023x, r = 0.96). The apparent Km and Vmax
of the enzyme for HyPro-peptide was 1.6 mM and 64 pmol/h/mg protein, respectively.
Pro-peptide = synthetic Skpl peptide 133-155. HyPro-peptide = synthetic Skpl peptide
133-155 with a hydroxyl group at the 4 position of Pro 143.

108
1/S
Figure 3.27 Kinetic properties of the GlcNAc-transferase with respect to Skpl-c-
myc. A. The affinity purified GlcNAc-transferase pool was incubated for 1 h with
various concentrations of Skpl-c-myc or 1 (iM recombinant Skpl (Skpl-His) in the
presence of 0.66 (iM UDP-[3H]G1cNAc. B. Double-reciprocal plot of the data is fitted to
a straight line (y = 0.005+ 0.003x, r = 0.99). The apparent Km and Vmax of the enzyme for
Skpl-c-myc was 0.56 |iM and 198 pmol/h/mg protein, respectively.

109
1/S
Figure 3.28 Kinetic properties of the GlcNAc-transferase with respect to UDP-
GlcNAc. A. The affinity purified GlcNAc-transferase pool was incubated for 1 h with
various concentrations of UDP-[3H]GlcNAc in the presence of 1 jiM Skpl-c-myc.The
assays were performed in duplicate. B. Double-reciprocal plot of the data is fitted to a
straight line (y = 0.008 + O.OOlx, r = 0.97). The apparent Km and Vmax of the enzyme for
UDP-GlcNAc was 0.16 (iM and 125 pmol/h/mg protein, respectively.

110
The estimated Km of the enzyme with respect to the synthetic peptide was
1.6 mM, with respect to Skpl-c-myc was 0.56 (iM, and with respect to UDP-GlcNAc
was 0.16 (J.M. The Km for Skpl-c-myc was an upper estimate since not all Skpl-c-myc
was the true substrate. The estimated Vmax of the enzyme with respect to the synthetic
peptide was 64 pmol/h/mg, with respect to Skpl-c-myc was 198 pmol/h/mg, and with
respect to UDP-GlcNAc was 125 pmol/h/mg. The higher Vmax for Skpl-c-myc compared
to that of UDP-GlcNAc could be explained by the difference between the relative
concentration of each substrate to its Km. The UDP-GlcNAc concentration in the Skpl-c-
myc study was 4x Km whereas the Skpl-c-myc concentration in the UDP-GlcNAc study
was only 2x Km.
Discussion
In this study, a Skpl-GlcNAc-transferase was purified from SI 00 fraction of the
overexpression strain HW120. An assay developed for Skpl-GlcNAc-transferase was
based on the transfer of [3H]GlcNAc from a donor substrate UDP-[3H]GlcNAc onto
acceptor substrates, either underglycosylated Skpl-c-myc isolated from a Dictyostelium
overexpression strain or a synthetic Skpl peptide. In the presence of Skpl-c-myc, an
increase in the incorporated radioactivity was found in the S100 fraction but not in the
detergent treated or untreated PI00 particulate fraction. The recombinant-Skpl isolated
from an E. coli expression strain, and the synthetic peptide containing Pro in place of
HyPro, failed to activate the activity.
The incorporation of [3H]GlcNAc into SI00 fraction from both Ax3 and HW120
strain was found in multiple regions of the gel indicating [3H]incorporation in multiple

Ill
proteins. These proteins may be O-GlcNAc proteins since the O-GlcNAc-transferase
responsible for adding a single GlcNAc onto Ser or Thr residues of many nuclear and
cytoplasmic proteins resides in the SI00 fraction as well. However, in SI00 fraction from
HW120 strain, the 21-24 kDa region showed higher incorporation than the rest of the gel
due to the presence of endogenous unglycosylated Skpl-c-myc.
In order to achieve highly purified enzyme, affinity chomatography was
performed on 5-(3-aminoallyl)-UDP-GlcNAc Sepharose4 fast-flow. The UDP-GlcNAc
resin was synthesized by a novel method which involved the coupling of aminoallyl-
UDP-GlcNAc to NHS-activated Sepharose in the organic solvent, dimethylformamide.
Initially, 5-Hg-UDP-GlcNAc Sepharose was selected as an affinity column. 5-Hg-UDP-
GlcNAc was synthesized and coupled to Thiopropyl Sepharose in a similar manner to
those of 5-Hg-dUMP-Sepharose. The ligand concentration of 5-Hg-UDP-GlcNAc was
about 18 pmol/ml which was higher than that of 5-(3-aminoallyl)-UDP-GlcNAc
Sepharose (14 |imol/ml). Only 10% of the enzyme activity was able to bind to 5Hg-UDP-
GlcNAc Sepharose, even though both 5-Hg-dUMP-Sepharose and aminoallyl-UDP-
GlcNAc Sepharose had UDP-GlcNAc as a ligand with the same spacer attachment site.
The finding that the enzyme activity was bound more effectively to aminoallyl-UDP-
GlcNAc Sepharose can be explained by 2 reasons. First, the spacer arm of aminoallyl-
UDP-GlcNAc is longer than that of 5Hg-UDP-GlcNAc and permits more freedom for
UDP-GlcNAc to interact with the active site on the enzyme. Second, purification of the
enzyme over the 5Hg-UDP-GlcNAc Sepharose requires DTT free buffer which could
affect substrate binding.

112
In the final preparation, the 1.7 X 104 fold of enzyme purification was achieved;
however, the yield was only 14%. Most of the activity lost occurred during the step of
Reactive-Red 120 purification. Since we could not find evidence of other subunits loss,
the low purification yield might be due to technical problems. However, in another
Reactive-Red purification experiment with a smaller amount of loading sample, most of
the enzyme activity could be recovered by eluting the resin with 0.5 - 1 M NaCl (data not
shown).
The specificity of the enzyme for Skpl was supported by the findings that anti-
Skpl-mAb, and a synthetic peptide with amino acid sequences corresponding to amino
acid residues 133-155 of Dictyostelium Skpl, inhibited the incorporation into Skpl but
not other proteins. The reasons that recombinant Skpl and Peptide 133-155 with Pro in
place of HyPro did not stimulate the activity indicated that the enzyme required proline
hydroxylation for the attachment site of GlcNAc. Moreover, the finding that the reductive
alkaline degradation of [3H]GlcNAc-Skpl predominantly yielded a charged instead of
neutral radioactive derivative strongly supported this novel type of glycosidic-peptide
linkage since HyPro-GlcNAc is expected to be alkali resistant. If GlcNAc was attached to
Ser or Thr instead of HyPro, the reductive alkaline degradation would be expected to
generate a neutral charged radioactive N-acetyl glucosaminitol which would not be
retained by the Dowex resin. The radioactive species eluted from [3H]GlcNAc-Skpl
could be a charged peptide released by the known effect of alkali treatment.
The estimated Km of the enzyme for Skpl-c-myc is an upper limit since the
percentage of the true substrate, the hydroxy lated-unglycosylated Skpl-c-myc, is not

113
known. Since the sugar composition analysis of Skpl-c-myc suggested that one-sixth of
the protein is a complete glycosylated form (Teng-umnuay et al., 1998), the approximate
Km in respect to Skpl-c-myc should be lower than 0.56 pM. Higher concentration of
exogenous Skpl-c-myc resulted in decreased incorporation (Fig. 3.26 and 3.27) which
can be explained by the feedback inhibition of more completed glycoforms presented in
Skpl-c-myc. On the other hand, the Km of the enzyme for the peptide substrate is much
higher (1.6 mM) and the Vmax is lower than those of Skpl-c-myc indicating the
importance of tertiary structure of the protein for enzyme recognition.
The submicromolar Km of the enzyme for UDP-GlcNAc (0.16 pM) is low in
comparison to those of other GlcNAc-transferase enzymes of the secretory pathway
which range from 30 pM (Bao et al., 1996) to 0.96 mM (Bendiak and Schachter, 1987).
The high affinity for nucleotide sugar implies the cytosolic compartmentation of the
enzyme. The concentration of nucleotide sugar in the cytoplasm is believed to be lower
than that of the secretory pathway due to the presence of the nucleotide-sugar-transporter
and the larger volume of the cytoplasm. Glycosyltransferases which function in the
cytoplasm need to have a high affinity for their nucleotide sugars. This hypothesis has
been proved to be true for the Skpl-fucosyltransferase (Km = 0.34 pM for GDP-fucose)
and the O-GlcNAc-transferase (Km = 0.5 pM for UDP-GlcNAc).

CHAPTER 4
SUMMARY AND PERSPECTIVES
Structure and Biogenesis of a Skpl-Glycan
Dictyostelium Skpl Contains a Novel Pentasaccharide Linked to Hydroxyproline
Skpl is involved in the ubiquitination of certain cell cycle and nutritional
regulatory proteins for rapid turnover. In Dictyostelium , Skpl is a glycoprotein within
the cytoplasmic compartment and has been known to be modified by an oligosaccharide
containing Fuc and Gal (Kozarov, et al, 1995), which is unusual for a cytoplasmic or
nuclear protein. To establish how it is glycosylated, Skpl labeled with [3H]Fuc was
purified to homogeneity and digested with endo-Lys-C. A single radioactive peptide was
found after 2-dimensional HPLC. Analysis in a Q-TOF mass spectrometer revealed a
predominant ion with a novel mass. MS/MS analysis yielded a set of daughter ions which
identified the peptide and showed that it was modified at Pro 143. A second series of
daughter ions showed that Pro 143 was hydroxylated and derivatized with a potentially
linear pentasaccharide, Hex-»Hex—>Fuc—»Hex—»HexNAc->(HyPro). The attachment
site was confirmed by Edman degradation. GC-MS analysis of TMS-derivatives of
overexpressed Skpl after methanolysis showed the HexNAc to be GlcNAc.
Exoglycosidase digestions of the glycopeptide from normal Skpl and from a fucosylation
mutant, followed by MALDI-TOF-MS analysis, showed that the sugar chain consisted of
D-Galpal —>6-D-Galpal-»L-Fucpal -»2-D-Galp[31 ^3GlcNAc. MALDI-TOF-MS
analysis of all Skpl peptides resolved by RP-HPLC showed that Skpl was only partially
114

115
hydroxylated at Pro 143, and that all hydroxylated Skpl was completely glycosylated.
The glycan structure of Skpl suggests the localization of a novel glycosylation
pathway in the cytoplasm. This pathway will require 6 different enzymes, including
prolylhydroxylase, GlcNAc-transferase, fucosyltransferase, and three galactosyl
transferases. These enzymes are known only to reside within the rER and Golgi
apparatus, not the cytoplasm where Skpl resides. We hypothesize that Skpl is modified
by a biosynthetic pathway which resembles posttranslational modification pathways of
the secretory apparatus, but resides in the cytosolic compartment. The first two enzymes
of the pathway, prolylhydroxylase and GlcNAc-transferase are expected to exert critical
control over placing the structure on target proteins. Prolylhydroxylase must act first to
allow the pentasaccharide to be built. The finding that all hydroxylated Skpl is
glycosylated suggests the importance of the prolylhydroxylase as a regulatory enzyme in
this pathway.
Evidence of Skpl-Prolylhydroxylase Activity in the Cytosol
All of the known prolylhydroxylases are found in the lumen of the rER where
they reside as soluble enzymes (reviewed in Kivirikko and Pihlajaniemi, 1997). One type
of prolylhydroxylases catalyzes the formation of 4-OH(trans)Pro at the polypeptide level.
Another prolylhydroxylase, the vertebrate 3-OH(trans)-prolylhydroxylase, modifies only
certain Pro residues adjacent to a 4-OH(trans)Pro. In mammals, prolylhydroxylase is a
tetramer with 2 identical a-subunits catalyzing Pro hydroxylation and 2 (3 subunits
having protein disulfide isomerase (PDI) activity.

116
The glycosylation site of Skpl suggests the novel prolylhydroxylase activity in
Dictyostelium. The Skpl-prolylhydroxylase is most likely a 4-OH-prolylhydroxylase
since the HyPro-peptide 133-155 synthesized with a 4-HyPro in place of Pro 143 has been
identified as a substrate for Skpl-GlcNAc-transferase activity.
A prolylhydroxylase assay was developed based on the knowledge that known
prolylhydroxylases of the rER replace a proton with a hydroxyl group resulting in the
formation of 3HiO from [3H]Pro. Recombinant Dictyostelium Skpl expressed in E. coli
(Skpl-His) was metabolically-labeled with [3,4-3H]Pro and purified from the soluble
fraction by its N-terminal oligo-His tag. The [3H]Skpl-His was incubated with SI00 and
PI 00 fractions at 30°C in the presence of ascorbic acid, a-ketoglutarate, DTT, FeSCfi,
and catalase. The released 3H2Ü was measured by collecting the flowthrough fraction
from Dowex 50W-A8 columns directly into scintillation vials (Peterkofsky and DiBlasio,
1975).
Incubation of the SI 00 fraction but not the PI 00 fraction with [’H] Skpl -His
released 3H20. Release of 3H20 appeared to be from [3H]Skpl-His because it was
inhibited by mAh 3F9 ascites and by synthetic peptide 133-155 which contained flanking
sequences of Pro 143. The data suggest that the crude soluble fraction of the cell contains
an activity which can hydroxy late Skpl-His. Activity required cofactors of a
prolylhydroxylase previously identified in the rER fraction of cells. One of the problems
in this assay is the decompostion of [3H]labeled-Skpl-His after storage at -80°C.

117
Characterization of Skpl-GlcNAc-Transferase
Glycosyltransferases are enzymes responsible for catalysis of the addition of
monosaccharide units to an exisiting glycan chain or to a peptide or lipid acceptor. Donor
monosaccharides are commonly utilized in an activated form, either as a nucleotide
sugar, e.g. GDP-fucose or as a lipid-linked donor, e.g. dolichol-P-glucose (reviewed in
Sears and Wong, 1998). Most of protein glycosyltransferases that have been cloned so far
are type two membrane proteins with small cytosolic amino-terminal domains, single
transmembrane segments, lumenal stem regions, and large carboxyl-terminal lumenal
domains responsible for catalysis (Paulson and Colley, 1989; Shaper et ah, 1988).
Recently, the cytosolic enzyme responsible for the addition of single GlcNAc
residue to the hydroxyl groups of serine and/or threonine of many nuclear and
cytoplasmic proteins (O-GlcNAc-transferase) has been purified (Haltiwanger et ah, 1990;
Haltiwanger et ah, 1992). It is a heterotrimer with a molecular weight of 350 kDa
consisting of two alpha (Mrl 10 kDa) and one beta (Mr 78 kDa) subunits. The alpha
subunit has been cloned and was found to contain multiple tetratricopeptide repeats
(Kreppel et ah, 1997; Lubas et ah, 1996).
The glycosidic peptide linkage of Skpl, GlcNAc-HyPro, has never been identified
in other proteins. The novel linkage indicates the presence of a novel GlcNAc-transferase
activity in Dictyostelium. In the second part of my study, a UDP-N-acetylglucosamine:
Skpl-N-acetylglucosaminyltransferase (Skpl-GlcNAc-transferase) activity has been
purified from the SI 00 fraction of the Skpl overexpression strain, HW120. The
achievement is based on the finding that overexpressed Skpl is variably glycosylated and

118
one of its glycoform, a hydroxylated-unglycosylated Skpl, can be used as an acceptor
substrate in an assay for the expected GlcNAc-transferase activity.
The GlcNAc-transferase activity behaved as a single component after purification
over a DEAE, phenyl-Sepharose, Reactive Red, Superdex, dUMP, and UDP-GlcNAc
column. The purified activity has an apparent Mr of 33,000 and an apparent Km of 0.16
for UDP-GlcNAc, and was DTT dependent. For reasons that the enzyme activity was
found in the cytosolic fraction and the activity required a reducing environment, we
suggest that the glycosylation process of Skpl occurs in the cytosolic compartment.
Characterization of the Skpl-Fucosyltransferase
In addition to Skpl-GlcNAc-transferase, a Skpl-fucosyltransferase (cFTase)
activity able to attach Fuc to the core disaccharide, Gaipi—>3GlcNAc—>(HyPro), has
been purified from the cytosolic compartment of Dictyostelium (West et al., 1996). Its
assay was based on the transfer of [ HJfucose form GDP-[ H]fucose to
Galpl,3GlcNAc[3-paranitrophenyl (paranitrophenyl-lacto-A'-bioside or pNP-LNB), which
was determined by adsorption onto a Cl8 Sep-Pak cartridge followed by elution with
methanol (Palcic et ah, 1988). The activity behaved as a single component during
purification over DEAE, phenyl, Reactive Blue-4, GDP-adipate, GDP-hexanolamine, and
Superdex column. The purified activity possessed an apparent Mr of 95 x 10 , was Mg
dependent with a neutral pH optimum, and exhibited a Km for GDP-fucose of 0.34 pM, a
Km for pNP-LNB of 0.6 mM, and a Vmax for pNP-LNB of 620 nmol/min/mg protein.
SDS-polyacrylamide gel electrophoresis analysis of the Superdex elution profile
identified a polypeptide with an apparent Mr of 85 x 103, which coeluted with the cFTase

119
activity and could be specifically photolabelled with the donor substrate inhibitor GDP-
hexanolaminyl-azido-125I-salicylate. Afucosylation glycoform of Skpl purified from the
cytosol of the mutant strain, HL250 was found to be a substrate for the cFTase, which
exhibited an apparent Km of 0.2 lpM and an apparent Vmax of 460 nmol/min/mg protein.
cFTase activity was not inhibited by recombinant Skpl, suggesting that acceptor
substrate specificity is based primarily on carbohydrate recognition.
Evidence of Galactosyltransferase Activity in the Cytosol of Dictyostelium
A galactosyltransferase activity which can transfer Gal from UDP-Gal to the
trisaccharide core, Fucal—>2Gal|3l-»3GlcNAc, has been identified in the SI00 fraction
of Dictyostelium. Using a similar method to cFTase, an assay was developed based on the
transfer of [3H]Gal from UDP-[3H]Gal to Fucal—>2Gaipi—>3GlcNAc[3-paranitrophenyl
(courtesy of Dr. Khushi Matta). Each reaction contained 3 |ig acceptor substrate, 0.5 pM
UDP-Gal, 5 mM MgCl2, 1 mM MnCl2, 1 mM ATP, 5 mM NaF in 50 mM Tris-HCl (pH
7.4) in the final vol of 50 pi. During the purification of SI00 over a DEAE-Sepharose
column, Galactosyltransferase activity was found in the flowthrough fraction before the
appearance of Skpl-GlcNAc-transferase activity suggesting that the activity should
reside in the cytosol as well.
The Effects of Dictyostelium Skpl on Actin Polymerization
Even though the function of Skpl-glycan is not yet known, some of our
preliminary results suggest the importance of Skpl glycosylation and actin binding. This
work was in collaboration with Dr. Michael R. Bubb, Department of Medicine,
University of Florida. Comparison of the Skpl sequences from multiple organisms

120
reveals a conserved region which resembles the actin-binding motif of Physarum profilin.
In order to demonstrate the effects of Skpl and actin polymerization, 3F9-affmity-
purified-Skpl-c-myc, Skpl-His, and RP-HPLC purified reduced-alkylated Skpl-c-myc
were dialyzed against buffer G (5 mM Tris-HCl, pH 7.8, 0.2 mM ATP, 0.2 mM DTT, 0.1
mM CaCb, 0.01% NaNs), concentrated in a concentrator with a M.W cut-off 10 kDa
(Centricon-10), and added in actin-polymerization assays (Fig. 4.1). Only Skpl-c-myc
inhibits actin polymerization as a barbed-end actin binding protein. Interestingly,
reductive alkylation of the protein blocks activity, and Skpl-His expressed and isolated
in E.coli is inactive. Because the main difference between the Skpl-c-myc and Skpl-His
is the presence of the oligosaccharide on the Dictyostelium expressed form, this finding
suggests the role of Skpl-glycan on actin binding. Moreover, since Skpl is variably
glycosylated, different Skpl glycoforms may have different functions in terms of actin
binding and the regulation of actin assembly.
Preparation of Skpl-c-myc Co-expression Strains
Construction of a Plasmid Encoding Skpl-c-myc
To further study the localization, actin-interaction, and glycan function of Skpl,
an effort has been made to express Skpl-c-myc mutant derivatives, including one with a
P143A substitution. The study was aimed to generate Skpl-c-myc co-expression strains
from 4 different plasmids. The plasmids after transformation into Dictyostelium , were
expected to express distinct forms of Skpl-c-myc. p48 encoded Skpl from fpal -cDNA
with a c-myc tag at C-terminal. p49 encoded fpal -Skpl-c-myc cDNA in which the

121
Figure 4.1 Inhibition of actin polymerization by Dictyostelium Skpl. Rabbit skeletal
muscle actin (2.2 mM), 4% labeled with pyrenyl iodo-acetamide (pyrene actin), with
either 0 (â–¡) or 2.0 (A) mM Skpl, was polymerized by the addition of 2 mM MgCft. The
same time course of polymerization was determined using 2.0 mM Skpl after further
purification on a DEAE-HPLC column (O). Upon polymerization of pyrene actin, the
quantum yield of fluorescence intensity increases thirty-fold, with the increase in
fluorescence proportional to the amount of filamentous actin. The inhibition seen in the
presence of Skpl could be related to inhibition of the nucleation or the elongation of actin
filaments. The final steady state value of fluorescence was not influenced by Skpl,
suggesting that Skpl does not sequester monomeric actin. In the inset, recombinant Skpl
from E.coli (A) and Skpl treated with reductive alkylation (O) have a polymerization
time course that is not different from that of a control without Skpl (â–¡).

122
glycan attachment site, Pro 143, was replaced by Ala. Ala was chosen since an Ala at the
equivalent position was found in a Skpl gene in C.elegans. p50 encoded Skpl from fpa2
-cDNA with a c-myc tag at C-terminal. p51 encoded fpal -Skpl-c-myc cDNA in which
three amino acids in the putative actin binding motif (46-VTSTILEKVLDYCR-59),
Lys53-Val-Leu55, were replaced by Ala-Ser-Ser.
In order to create a full-length Skpl cDNA with the C-terminus encoding the
human c-myc epitope, EQKLISEEDL, the open reading frame of Skpl was amplified by
polymerase chain reaction (PCR) using Dictyostelium fpal genomic DNA as the template
and oligonucleotides, CW13 and CW26, as primers (Table 4.1). The epitope coding
region was contained in CW26. The reaction contained 33 ng of the template, 0.1 |lM of
each primer, 0.25 mM dNTP, 10 mM Tris-HCl (pH 9.0), 50 mM KC1, 0.1% Triton X-
100, 3 mM MgCh, and 2.5 U of Taq DNA polymerase (Promega, Madison, WI) in the
total vol of 50 |il and the PCR was performed at 94°C, 1 min, 60°C, 2 min, and 72°C, 3
min for 30 cycles. The PCR product was ligated into the blunt vector, pT7Blue
(Novagen, Madison, WI) and cloned into DH5a MCR cells (Gibco BRL, Gaithersburg,
MD). The plasmid contained Kpn I and Sac I restriction sites which were used to
subclone the insert into the pVEIIdATG (Blusch et al., 1992) downstream of the
discoidin promoter. The sequence of the plasmid, p48, was verified by sequencing the
plasmid DNA.
In Vitro Site-Directed Mutagenesis of p48
Three sets of PCR were performed using the Skpl-c-myc plasmid, p48, as the
template and three sets of oligonucleotides, CW 89 and CW90, CW86 and CW 87, and

123
Table 4.1 The oligonucleotide primers used to prepare Skpl-c-myc plasmids
Primer
Plasmid
Sequences
CW13
p48
5’ GAC TGA GCT CGA GGA TCC AAA TAA AAT AAA AAA
ATG TCT TTA GTT AAA TTA GAA TCT 3’
CW26
p48
5’ GAG GAT CCG AGC TGA TAT TTT TAA TTG AGA TCT
TCT TCT GAA ATA AGC TTT TGT TCG TTT CCA CCT TTA
TCT TCA C 3’
CW89
p49
5’ CAA GAA CGA CTT TAC TGC AGA AGA AGA AGA AC 3’
CW90
p49
5’ GTT CTT CTT CTT CTG CAG TAA AGT CGT TCT TG 3’
CW86
p50
5’ GGT GAA TCA GAT GCG CCA ATT CCA TTA C 3’
CW87
p50
5’ GTA ATG GAA TTG GCG CAT CTG ATT CAC C 3’
CW94
p51
5’ GCA CTA TTT TAG AAG CTT CTT CTG ACT ATT GCA
GAC 3’
CW95
p51
5’ GTC TGC AAT AGT CAG AAG AAG CTT CTA AAA TAG
TGC 3’
The epitope coding region for c-myc sequences, EQKLISEEDL, in CW26 is underlined.

124
CW94 and CW95 (Table 4.1) as primers in order to prepare mutant Skpl-c-myc
plasmids, p49, p50, and p51, respectively. The primers CW89 and CW90 were designed
to create a Pst I restriction site and change the encoding cDNA from Pro 143 to Ala. The
primers CW86 and CW87 were designed to create a Hha I restriction site and change the
encoding cDNA from Ser39 to Ala. The primers CW94 and CW 95 were designed to
create an extra Hindlll restriction site and change the encoding cDNA from Lys53-Val-
Leu55 to Ala-Ser-Ser. The reactions contained 50 ng of circular p48, 0.3 pM of each
primer, 0.5 mM dNTP, 20 mM Tris-HCl (pH 8.0), 1.5 mM MgCl2, 2 mM MgS04, 10
mM KC1, 10 mM (NH4)2S04, 0.1% Triton X-100, 50 mg BSA, and 2.5 U of cloned pfu
DNA polymerase (Strategene, La Jolla, CA) in a total vol of 50 pi, and were performed at
94°C, 0.5 min, 55°C, 1 min, and 68°C, 14 min for 20 cycles. The PCR products were
treated with Dpn I and cloned into the DH5a MCR cell. The sequences of the plasmids,
p49, p50, and p51, were verified by sequencing the plasmid DNA.
Transformation of Dictyostelium Strain Ax3
This work was performed with assistance from Kathryn T. Dobson. The plasmids
were transformed into Dictyostelium strain Ax3 by a CaP04 precipitation method
(Rebstein et al., 1993) and colonies were selected in the presence of 20 pg/ml G418. For
each transformation, approximately 1 x 107 Ax3 cells were grown in the dark at 22°C
overnight on a tissue culture dish in Bis-Tris HL5 (0.21% Bis-Tris, 0.5% proteose
peptone, 0.5% thiotone-E peptone, 0.5% yeast extract, pH 7.1) containing 50 pg/ml
ampicillin, 0.5 pg/ml amphotericin B, 5 ng/ml vitamin B12, and 1 mM folic acid. On the
next day, the media was replaced with fresh Bis-Tris HL5 (plus additions). Ten pg of the

125
plasmids was diluted with 125 mM CaC^ in HBS (0.2 g% glucose, 1.6 g% NaCl, 0.074
g% KC1, 0.027 g% Na2HP04.2H20, 1 g% HEPES-NaOH, pH 7.05) and the DNA was
allowed to precipitate at room temperature for 30 min. The media was aspirated from the
dishes and 0.6 ml of the plasmid suspension was added dropwise to cover the cells. After
30 min, 10 ml of Bis-Tris HL5 (with additions) was added and the cells were allowed to
adhere to the plate for 6 h. The media was discarded and the cells were treated with 12%
glycerol in HBS for 3 min before replacing with HL5. On the next day and every 3 days
afterward, the media was replaced with fresh HL5 containing 20 pg/ml of G418. The
cells were cloned by diluting in suspension of Klebsiella aerogenes and spreading on SM
plates. Isolated colonies were transfered to HL5 containing G418. The culture was
centrifuged and the cell pellets were resuspended in LSB, boiled for 3 min, and resolved
on a 7-20% gradient SDS-polyacrylamide gel. The protein was electrotransfered onto
0.45 pM nitrocellulose membranes. Positive clones were identified by Western blot
analysis of the membranes with monoclonal antibody 9E10 against the c-myc epitope.
After screening more than 200 colonies from each transformant, we could not
identify the overexpression Skpl-c-myc clone from p48, 49, and p51. In contrast, the
cloning of overexpression Skpl-c-myc from p50 which had the sequence homologous to
fpa.2 was accomplished in the first round of screening. These findings suggest that the
level offpa\ encoded Skpl is more strictly controlled than that offpal. It also implies
that one or both amino acid mutation(s) in HW120 strain might be important for the
regulation of Skpl expression level.

126
Future Direction
In this study, the HyPro-glycosylation pathway has been proposed and the
existence and properties of Skpl-GlcNAc-transferase enzyme in this pathway have been
characterized. The long term goal of this study is to understand how this carbohydrate
structure is important for the function of Skpl and to demonstrate whether this novel
pathway exists in other eukaryotes. In order to reach the goal, we must first understand
how the structure is synthesized in terms of specificity and compartmentalization of the
enzymes which are responsible for its biosynthesis.
The GlcNAc-transferase activity which is specific for Skpl has been purified
from the cytosolic fraction of the cell. To conclude that the enzyme is localized in the
cytosol based only on the cell fractionation result can be misleading because organelles
may lyse during fractionation. However, the findings that the enzyme activity requires
reducing environment and has a very low apparent Km for UDP-GlcNAc support the
hypothesis that this new modification pathway localizes in the cytosolic compartment of
Dictyostelium.
In order to demonstrate the compartmentalization, the universal existence, and the
importance of each step in this HyPro-glycosylation pathway, it is important to purify six
enzymes in this pathway to homogeneity, characterize their kinetics and specificity, and
clone their cDNAs. At this point, only the purification of the Skpl-GlcNAc-transferase
and Skpl-cFTase have been described. To clone the cDNAs for these enzymes, we need
to obtain pg quantities of the protein and generate internal peptides which will be
recovered by RP-HPLC. These peptides will then be sequenced by Edman degradation or

127
by Q-TOF-MS. The sequences obtained will then be used to design degenerate
oligonuclotide probes which will be used for a PCR-based strategy to obtain intervening
sequences. The obtained PCR products will be used as probes to screen for the
Dictyosteliiim full-length cDNAs. Since a protein which translocates to the secretory
compartment typically contains a protein motif responsible for this targetting, the signal
motif is predicted to be absent from the cDNAs of Skpl-GlcNAc transferase and Skpl-
cFTase.
Since the Skpl sequences surrounding Pro 143 is highly-conserved, it is unlikely
that this glycan structure evolved only for Dictyostelium Skpl. When the enzyme gene
sequences are known, it will be possible to screen the public databases for genomic,
cDNA and ESWT sequences which might match sufficiently to suggest the identity of
counterparts in other organisms. This will be an important way to explore the
generalization of the HyPro glycosylation pathway in other organisms. If the pathway
exists in yeasts, the function of Skpl glycosylation can be tested genetically even if it is
lethal. Disruption of one of two key enzymes, prolylhydroxylase that modifies Pro 143
and GlcNAc-transferase which catalyze the first sugar attachment onto the
hydroxyproline, will completely eliminate the glycosylation process and enable us to
study the function of Skpl glycan. The cloning of a Skpl-c-myc co-expression strain in
which the glycan attachment site, Pro 143, is replaced with Ala is under investigation. If it
is successful, we will be able to study the localization of the un-glycosylated Skpl-c-myc
in vivo. Moreover, it will be possible to purified the un-glycosylated protein for actin-
interaction study and identifying other glycans of Skpl.

REFERENCES
Abeijon, C., and Hirschberg, C.B. (1992). Topography of glycosylation reactions in the
endoplasmic reticulum. TIBS 17,32-36.
Allen, A. K., Desai N. N., Neuberger, A., and Creeth, J.M. (1978). Properties of potato
lectin and the nature of its glycoprotein linkages. Biochem. J. 171, 665-674.
Allen, G. (1981). Determination of peptide sequences. In Work, T.S. and Burdon, R.H.
(eds), Laboratory Techniques in Biochemistry and Molecular Biology: Sequencing of
Proteins and Peptides. Elsevier/North-Holland Biochemical Press, Amsterdam, The
Netherlands, pp. 178-180.
Alonso, M.D., Lomako, J., Lomako, W.M., and Whelan, W.J.(1995). A new look at the
biogenesis of glycogen. FASEB J. 9, 1126-1137.
Bai, C., Sen, P., Hofmann, K., Ma, L., Goebl, M., Harper, J.W., and Elledge, S.J. (1996).
SKP1 connects cell cycle regulators to the ubiquitin proteolysis machinery through a
novel motif, the F-box. Cell 86, 263-274.
Bailey, R.B., and Woodword, A. (1984). Isolation and characterization of a pleiotropic
glucose repression resistant mutant of Saccharomyces cerevisiae. Mol. Gen. Genet. 193,
507-512.
Bao, M., Elmendorf, J., Booth, J.L., Drake, R.R., and Canfield, W.M. (1996). Bovine
UDP-A-acetylglucosamine:Lysosomal-enzyme A-acetylglucosmine-1 -
phosphotransferase: enzymatic characterization and identification of the catalytic subunit.
J.Biol.Chem. Ill, 31446-31451.
Barral, Y., Jentsch, S., and Mann, C., (1995). G1 cyclin turnover and nutrient uptake are
controlled by a common pathway in yeast. Genes Dev. 9, 399-409.
Bendiak, B. and Schachter, H. (1987). Control of Glycoprotein Synthesis: kinetic
mechanism, substrate specificity, and inhibition characteristics of UDP-jV-
acetyglucosamine:a-D-mannoside (31-2 N-acetylglucosaminyltransferase II from rat
liver. J. Biol. Chem. 262, 5784-5790.
Blusch, J., Morandini, P., and Nellen, W. (1992). Transcriptional regulation by folate:
inducible gene expression in Dictyostelium transformants during growth and early
development. Nucleic Acids Res. 20, 6235-6238.
128

129
Bourdon, M.A., Krusius, T., Campbell, S., Schwartz, N.B., and Ruoslahti, E. (1987).
Proc. Natl. Acad. Sci. USA. 84, 3194-3198.
Chakraborty, A., Saha, D., Bose, A., Chatterjee, M., and Gupta, N.K. (1994). Regulation
of eIF-2 alpha-subunit phosphorylation in reticulocyte lysate. Biochemistry 33, 6700-
6706.
Chen, H., Thalmann, I., Adams, J.C., Avraham, K.B., Copeland, N.G., Jenkins, N.A.,
Beier, D.R., Corey, D.P., Thalmann, R., and Duyk, G.M. (1995). cDNA cloning, tissue
distribution, and chromosomal localization of Ocp2, a gene encoding a putative
transcription-associated factor predominantly expressed in the auditory organs. Genomics
27, 389-398.
Chou, T.Y., Hart, G.W., and Dang, C.V. (1995). C-myc is glycosylated at threonine 58, a
know phosphorylation site and a mutational hot spot in lymphomas. J. Biol. Chem. 270,
18961-18965.
Clausen, H., and Bennett, E.P.(1996). A family of UDP-GAlNAc: polypeptide N-
acetylgalactosaminyl-transferases control the initiation of mucin-type O-linked
glycosylation. Glycobiology 6, 635-646.
Connelly, C., and Hieter, P. (1996). Budding yeast SKP1 encodes and evolutionarily
conserved kinetochore protein required for cell cycle progression. Cell 86, 275-285.
Dagher, S. F., Wang, J. L. and Patterson, R. J. (1995). Identification of galectin-3 as a
factor in pre-mRNA splicing. Proc. Natl. Acad. Sci., U.S.A. 92, 1213-1217.
Dale, R.M.K., Martin, E., Livingston, D.C., and Ward, D.C. ( 1975). Direct covalent
mercuration of nucleotides and polynucleotides. Biochem. 14, 2447-2469.
Dell, A. (1983). F.A.B.-Mass spectrometry of carbohydrates. Adv. Carb. Chem.
Biochem. 45, 19-72
Demetrick, D. J., Zhang, H., and Beach, D. H. (1996). Chromosomal mapping of the
genes for the human CDK2/cyclin A-associated proteins pl9 (SKP1A and SKP1B) and
p45 (SKP2). Cytogenet. Cell Genet. 73, 104-107.
Deshaies, R.J., Chau, V., and Kirschner, M. (1995). Ubiquitination of the G1 cyclin
Cln2p by a Cdc34p-dependent pathway. EMBO J. 14, 303-312.
Dey, N.B., Bounelis, P., Gritz, T.A., Bedwell, D.M., and Marchase, R.B.(1994). The
glycosylation of phosphoglycomutase is modulated by carbon source and heat shock in
Saccharomyces cerevisiae. J.Biol.Chem. 269, 27143-27148.

130
Drury, L.S., Perkins, G., and Diffley, J.F.X. (1997). The Cdc4/34/53 pathway targets
Cdcóp for proteolysis in budding yeast EMBO J. 16, 5966-5976.
Duan, D.R., Pause, A. Burgress, W., Aso, T., Chen, D.Y.T., Garrett, K.P., Conaway,
R.C., Conaway, J.W., Linehan, W.M., and Klausner, R.D. (1995). Inhibition of
transcriptional elongation by th VHL tumor suppressor protein. Science 269, 1402-1406.
Dubendorff, J.W. and Studier, F.W. (1991). Controlling basal expression in an inducible
T7 expression system by blocking the target T7 promoter with lac repressor. J. Mol. Biol.
5,45-59.
Elwood, P. C., Reid, W. K., Marcell, P. D., Allen, R. H. and Kolhouse, J. F. (1988).
Determination of the carbohydrate composition of mammalian glycoproteins by capillary
gas chromatography/mass spectrometry. Anal. Biochem. 175, 202-211.
Feldman, R.M.R., Correll, C.C., Kaplan, K.B., and Deshaies, R.J. (1997). A complex of
Cdc4p, Skplp, and Cdc53p/Cullin catalyzes ubiquitination of the phosphorylated CDK
inhibitor Siclp. Cell 91, 221-230.
Ferguson, T. F., Vozenilek, J. and West, C. M. (1994). The differentiation of a cell
sorting mutant of Dictyostelium discoideum. Dev. Growth Differen. 36, 597-604.
Field, M.C. and Wainwright, L.J. (1995). Molecular cloning of eukaryotic glycoprotein
and glycolipid glycosyltransferases: a survey. Glycobiology 5, 463-472.
Fincher, G. B., Sawyer W. H., and Stone, B. A. (1972). Chemical and physical properties
of an arabinogalactan-peptide from wheat endosperm. Biochem. J. 139, 535-545.
Flick, J.S., and Johnston, M. (1991). GRR1 of Saccharomyces cerevisiae is required for
glycose repression and encodes a protein with leucine-rich repeats. Mol. Cell. Biol. 11,
5101-5112.
Freeze, H. H. (1997). Dictyostelium discoideum glycoproteins using a model system for
organismic glycobiology. in Montreuil, J., Vliegenthart, J.F.G., and Schachter, H. (Eds)
Glycoproteins II Elsevier Science, Amsterdam, The Netherlands, pp.89-121.
Goebl, M.J., Yochem, J., Jentsch, S., McGrath, J.P., Varshavsky, A., and Byers, B.
(1988). The yeast cell cycle gene cdc34 encodes a ubiquitin-conjugating enzyme. Science
241, 1331-1334.
Gonzalez-Yanes, B., Cicero, J.M., Brown Jr., R.D., and West, C.M. (1992).
Characterization of a cytosolic fucosylation pathway in Dictyostelium. J.Biol.Chem. 267,
9595-9605.

131
Greenwell, P. (1997). Blood group antigens: molecules seeking a function.
Glycoconjugate J. 14, 159-173.
Greis, K.D. and Hart G.W. (1997). Nuclear and cytoplasmic glycoproteins, in Montreuil,
J., Vliegenthart, J.F.G., and Schachter, H. (Eds) Glycoproteins II Elsevier Science,
Amsterdam, The Netherlands, pp.33-54.
Gustafson, G.L. and Milner, L.A. (1980). Occurrence of N-acetylglucosamine -1-
phosphate in Proteinase I from Dictyostelium discoideum. J. Biol. Chem. 255, 7208-7210.
Haltiwanger, R.S., Blomberg, M.A., and Hart, G.W. (1992a). Glycosylation of nuclear
and cytoplasmic proteins. J.Biol.Chem. 267, 9005-9013.
Haltiwanger, R.S., Kelly, W.G., Roquemore, E.P., Blomberg, M.A., Dong, L.Y.D.,
Kreppel, L. Chou, T.Y. and Hart, G.W. (1992b). Glycosylation of nuclear and
cytoplasmic proteins is ubiquitous and dynamic. Biochem. Soc. Trans. 20, 264-269.
Harper, J.W., Adami, G., Wei, N., Keyomarsi, K., and Elledge, S.J. (1993). The p21 Cdk-
interacting protein Cipl is a potent inhibitor of G1 cyclin-dependent kinases. Cell 75,
805-816.
Harris, R. J., van Halbeek, H., Glushka, J., Basa, L. J., Ling, V. T., Smith, K. J., and
Spellman, M. W. (1993). Identification and structural analysis of the tetrasaccharide
NeuAc alpha(2—>6)Gal beta(l—>4)GlcNAc beta(l—>3)Fuc alpha 1-^O-linked to serine 61
of human factor IX. Biochemistry 32, 6539-6547.
Harris, R.J. and Spellman, M.W. (1993). O-linked fucose and other post-translational
modifications unique to EGF modules. Glycobiology 3, 219-224.
Hart, G.W. (1992). Glycosylation Curr. Op. Cell biol. 4, 1017-1023.
Hart, G. W. (1997). Dynamic O-linked glycosylation of nuclear and cytoskeletal proteins.
Annu. Rev. Biochem. 66, 315-335.
Hart, G. W., Haltiwanger, R. S., Holt, G. D., and Kelly, W. G. (1989). Glycosylation in
the nucleus and cytoplasm. Annu. Rev. Biochem. 58, 841-874.
Hart, G. W., Kreppel, L. K., Comer, F. L, Arnold, C. S., Snow, D. M., Ye, X., Cheng, X.,
DellaManna, D., Caine, D. S., Earles, B. J., Akimoto, Y., Cole, R. N., and Hayes, B. K.
(1996). O-GlcNAcylation of key nuclear and cytoskeletal proteins: reciprocity with O-
phosphorylation and putative roles in protein multimerization. Glycobiology 6, 711-716.
Haynes, P.A. (1998). Phosphoglycosylation: a new structural class of glycosylation?
Glycobiology 8, 1-5.

132
Heese-Peck, A., Colem, A., Borksenious, O. N., Hart, G. W., and Raikhel, N. V. (1996).
Plant nuclear pore complex proteins are modified by novel oligosaccharides with
terminal N-acetylglucosamine. Plant Cell 7, 1459-1471.
Henchoz, S., Chi, Y., Catarin, B., Herskowitz, I., Deshaies, R.J., and Peter, M, (1997).
Phosphorylation and ubiquitin-dependent degradation of the cyclin-dependent kinase
inhibitor Farlp in budding yeast. Genes & Dev. 11, 3046-3060.
Hersko, A. (1997). Roles of ubiquitin-mediated proteolysis in cell cycle control. Curr.
Opin. Cell. Biol. 9, 788-799.
Hochstrasser, M. (1996). Ubiquitin-dependent protein degradation. Annu. Rev. Genet. 30,
405-439.
Ingram, G. C., Doyle, S., Carpenter, R., Schultz, E. A., Simon, R., and Coen, E. S.
(1997). Dual role for fimbriata in regulating floral homeotic genes and cell division in
Antirrhinum. EMBO J. 16, 6521-6534.
Jacob, G. S., and Scudder, P. (1994). Glycosidases in structural analysis. Meth. Enz. 230,
280-299.
Jung, E., Fucini, P., Stewart, M., Noegel, A. A., and Schleicher, M. (1996). Linking
microfilaments to intracellular membranes: the actin-binding and vesicle-associated
protein comitin exhibits a mannose-specific lectin activity. EMBO J. 15, 1238-1246.
Just, I., Selzer, J., Hofmann, F., Green, G. A., and Aktories, K. (1995a). Inactivation of
Ras by Clostridium sordellii lethal toxin-catalyzed glucosylation. J. Biol. Chem. 271,
10149-10153.
Just, I., Selzer, J., Wilm, M., von Eichel-Streiber, C., Mann, M., and Aktories, K.
(1995b). Glucosylation of rho proteins by Clostridium difficile toxin B. Nature 375, 500-
503.
Kaplan, K.B., Hyman, A.A., and Sorger, P.K. (1997). Regulating the yeast kinetochore
by ubiquitin-dependent degradation and Skplp-mediated phosphorylation. Cell 91, 491-
500.
Kasai, K., and Hirabayashi, J. (1996). Galectins: a family of animal lectins that decipher
glycocodes. J. Biochem. Tokyo 119, 1-8.
Katsuri, L., Eshleman, J.R., Wunner, W.H., and Shakin-Eshleman, S.H. (1995). The
hydroxy amino acid in an asn-X-Ser/Thr sequon can influence N-linked core
glycosylation efficiency and the level of expression of a cell surface glycoprotein. J. Biol.
Chem. 270, 14756-14761.

133
Kishi, T., Seno, T., Yamao, F. (1998). Grrl functions in the ubiquitin pathway in
Saccharomyces cerevisiae through association with Skpl. Mol. Gen. Genet. 257, 143-
148.
Kivirikko, K.I. and Pihlajaniemi, T. (1998). Collagen hydroxylases and the protein
disulfide isomerase subunit of prolyl-4-hydroxylases. Adv. Enzymol. Relat. Areas Mol.
Biol. 72, 325-298.
Kolodziej, P. A., and Young, R. A. (1991). Epitope tagging and protein surveillance.
Meth. Enz. 194, 508-519.
Kornfeld, R., and Kornfeld, S. (1985). Assembly of asparagine-linked oligosaccharides.
Annu. Rev. Biochem. 54, 631-664.
Kornitzer, D., Raboy, B., Kulka, R.G., and Fink, G.R. (1994). Regulated degradation of
the transcription factor Gcn4. EMBOJ. 13, 6021-6030.
Kozarov, E., van der Wei, H., Field, M., Gritzali, M., Brown Jr., R.D., and West, C.M.
(1995). Characterization of SKP1, a cytosolic glycoprotein from Dictyostelium. JBiol.
Chem. 270, 3022-3030.
Krek, W. (1998). Proteolysis and the Gl-S transition: the SCF connection. Curr. Opin.
Genet. Dev. 8, 36-42.
Kreppel, L. K., Blomberg, M. A., and Hart, G. W. (1997). Dynamic glycosylation of
nuclear and cytosolic proteins. J. Biol. Chem. 272, 9308-9315.
Lechner, J. (1994). A zinc finger protein, essential for chromosome segregation,
constitutes a putative DNA binding subunit of the Saccharomyces cerevisiae kinetochore
complex Cbf3. EMBO J. 13,5203-5211.
Lechner, J., and Carbon, J. (1991). A 240 kd multisubunit protein complex, CBF3, is a
major component of the budding yeast centromere. Cell 64, 717-726.
Li, F. N., and Johnston, M. (1997). Grrl of Saccharomyces cerevisiae is connected to the
ubiquitin proteolysis machinery through Skpl: coupling glucose sensing to gene
expression and the cell cycle. EMBO J. 16, 5629-5638.
Liang, Y., Chen, H., Asher, Jr., J. H., Chang, C. C., and Friedman, T. B. (1997). Human
inner ear OCP2 cDNA maps to 5q22-5q35.2 with related sequences on chromosomes
4pl6.2-4pl4, 5pl3-5q22, 7pter-q22, 10 and 12pl3-12qter. Gene 184, 163-167.
Lis, H., and Sharon, N. (1993). Protein glycosylation: structural and functional aspect.
Eur.J. Biochem. 218, 1-27.

134
Lisztwan, J., Marti, A., Sutterluty, H., Gstaiger, M., Wirbelauer, and Krek, W. (1998).
Association of human CUL-1 and ubiquitin-conjugating enzyme CDC34 with the F-box
protein p45 (SKP2): evidence for evolutionary conservation in the subunit composition of
the CDC34-SCF pathway. EMBO J 17, 368-383.
Lonergan, K. M., Iliopoulos, O., Ohh, M., Kamura, T., Conaway, R. C., Conaway, J. W.,
and Kaelin, W. G. (1998). Regulation of hypoxia-inducible mRNAs by the von Hippel-
Lindau tumor suppressor protein requires binding to complexes containing elongins B/C
and Cul2. Mol. Cell. Biol. 18, 732-741.
Lubas, W. A., Frank, D. W., Krause, M., and Hanover, J. A. (1997). O-linked GlcNAc
transferase is a conserved nucleocytoplasmic protein containing tetratricopeptide repeats.
J. Biol. Chem. 272, 9316-9324.
Maher E.R. and Kaelin W.G. Jr. (1997). von Hippel-Lindau disease. Medicine 76, 381-
391.
Marchase, R. B., Bounelis, P., Brumley, L. M., Dey, N. B., Browne, B., Auger, D., Fritz,
T. A., Kulesza, P., and Bedwell, D. M. (1993). Phosphoglucomutase in Saccharomyces
cerevisiae is a cytoplasmic glycoprotein and the acceptor for a Glc-phosphotransferase. J.
Biol. Chem. 268, 8341-8349.
Medina, L., and Haltiwanger, R. S. (1998). SV40 large T antigen is modified with O-
linked N-acetylglucosamine but not with other forms of glycosylation. Glycobiology 8,
191-198.
Mehta, D.P., Ichikawa, M., Salimath, P., Etchison, J.R. Haak, R., Manzi, A., and Freeze,
H.H. (1996). A lysosomal proteinase from Dictyostelium discoideum contains N-
acetylglucosamine-1 -phosphate bound to serine but not mannose-6-phosphate on N-
linked oligosaccharides. J. Biol. Chem. 271, 10897-10903.
Meikle, P.J., Ng, K.T., Johnson, E., Hoogenraad, N.J., and Stone, B.A. (1991). The (3-
glucan synthase from Lolium multiflorum. J. Biol. Chem. 266, 22569-22581.
Morris, H. R., Pánico, M., Barber, M., Bordoli, R. S., Sedgwick, R. D., and Tyler, A.
(1981). Fast atom bombardment: a new mass spectrometric method for peptide sequence
analysis. Biochem. Biophys. Res. Comm. 101, 623-631.
Morris, H. R., Paxton, T., Dell, A., Langhome, J., Berg, M., Bordoli, R. S., Hoyes, J., and
Bateman, R. H. (1996). High sensitivity collisionally-activated decomposition tandem
mass spectrometry on a novel quadrupole/orthogonal-acceleration time-of-flight mass
spectrometer. Rapid Comm. Mass Spectrom. 10, 889-896.

135
Morris, H. R., Paxton, T., Pánico, M., McDowell, R., and Dell, A. (1997). A novel
geometry mass spectrometer, the Q-TOF, for low-femtomole/attomole-range biopolymer
sequencing. J. Protein Chem. 16, 469-479.
Nasmyth, K. (1996). At the heart of the budding yeast cell cycle. Trends. Genet. 12, 405-
412. *
Natorff, R., Balinska, M., and Paszewski, A. (1993). At least four regulatory genes
control sulphur metabolite repression in Aspergillus nidulans. Mol. Gen. Genet. 238:185-
192.
Nugroho, T.T., and Mendenhall, M.D. (1994). An inhibitor of yeast cyclin-dependent
protein kinase plays an important role in ensuring the genomic integrity of daughter cells.
Mol. Cel. Biol. 14, 3320-3328.
Opdenakker, G., Rudd, P.M., Ponting, C.P., and Dwek, R.A. (1993). Concepts and
principles of glycobiology. FASEBJ. 7, 1330-1337.
Ózcan, S. and Johnston, M. (1995). Three different regulatory mechanisms enable yeast
hexose transporter (HXT) genes to be induced by different levels of glucose. Mol. Cell.
Biol. 15, 1564-1572.
Palcic, M.M., Heerze, L.D., Srivastava O.P., and Hindsgaul, O. (1989). A bisubstrate
analog inhibitor for alpha (1—>2)-fucosyltransferase. J. Biol. Chem. 264, 17174-17181.
Paulson, J.C., and Colley, K.J. (1989). Glycosyltransferases: Structure, localization, and
control of cell type-specific glycosylation. J. Biol. Chem. 264, 17615-17618.
Peterkofsky, B. and DiBlasio R. (1975). Modification of the tritium-release assays for
prolyl and lysyl hydroxylases using Dowex-50 columns. Anal. Biochem. 66, 279-286.
Pisano, A., Redmond, J.W., Williams, K.L., and Gooley, A.A. (1993). Glycosylation sites
identified by solid-phase Edman degradation:0-linked glycosylation motifs on human
glycophorin A. Glycobiology 3, 429-435.
Pitcher, J., Smythe, C., Campbell, D.G., and Cohen, P. (1987). Identification of the 38-
kDa subunit of rabbit skeletal muscle glycogen synthase as glycogenin. Eur.J. Biochem.
169, 497-502.
Plummer, T.H., Tarentino, A.L., and Hauer, C.R. (1995). Novel, specific O-glycosylation
of secreted Flavobacterium meningosepticum proteins. J. Biol. Chem. 270, 13192-13196.
Prockop, D.J., Kivirikko, K.I., Tuderman, L., and Guzman, N.A. (1979). Medical
progress: The biosynthesis of collagen and its disorders. N.Engl.J.Med. 301, 13-23.

136
Rebstein, P. J., Weeks, G., and Spiegelman, G. B. (1993). Altered morphology of
vegetative amoebae induced by increased expression of the Dictyostelium discoideum
ras-related gene rapl. Dev. Genet. 14, 347-355.
Schafer, I. A., and Sorrell, J. M. (1993). Human keratinocytes contain keratin filaments
that are glycosylated with keratan sulfate. Exp. Cell Res. 207, 213-219.
Schwob, E., Bohm, T., Mendenhall, M. and Nasmyth, K. (1994). The B-type cyclin
kinase inhibitor p40sici controls the Gl/S transition in Saccharomyces cerevisiae. Cell
79, 233-244.
Sears, P. and Wong, C.H. (1998). Enzyme action in glycoprotein synthesis. Cell. Mol.
Life Sci. 54, 223-252.
Sedmak, J.J., and Grossberg, S.E. (1977). A rapid, sensitive, and versatile assay for
protein using Coomassie Brilliant Blue G250. Anal. Biochem. 79, 544-552.
Selzer, J., Hofmann, F., Rex, G., Wilm, M., Mann, M., Just, I., and Aktories, K. (1996).
Clostridium novyi alpha-toxin-catalyzed incorporation of GlcNAc into Rho subfamily
proteins./. Biol. Chem. 271,25173-25177.
Sharper, J.H., Hollis, G.F., and Shaper, N.L. (1988). Genomic structure of murine beta-
1,4-galactosyltransferase. Biochimie 70, 1683-1688.
Shibata, S., Takeda, T., andNatori, Y. (1988). The structure of nephritogenoside: A
nephritogenic glycopeptide with alpha-N-glycosidic linkage. J.Biol.Chem. 263, 12483 -
12485.
Skowyra, D., Craig, K.L., Tyers, M., Elledge, S.J., and Harper, J.W. (1997). F-box
proteins are receptors that recruit phosphorylated substrated to the SCF ubiquitin-ligase
complex. Cell 91, 209-219.
Sorger, P.K., Doheny, K.F., Hieter, P., Kopski, K.M., Huffaker, T.C., and Hyman, A.A.
(1995). Two genes required for the binding of an essential S. cerevisiae kinetochore
complex to DNA. Proc. Natl. Acad. Sci. USA 92, 12026-12030.
Sowden, J., Morrison, K., Schofield, J., Putt, W., and Edwards, Y. (1995). A novel cDNA
with homology to an RNA polymerase II elongation factor maps to human chromosome
5q31 9TCEB1L) and to mouse chromosome 11 (Tcebll). Genomics 29, 145-151.
Stemmann, O., and Lechner, J. (1996). The S. cerevisiae kinetochore contains a cyclin-
CDK complexing homolog, as identified by in vitro reconstitution. EMBO J. 15,3611-
3620.

137
Studier, F.W. (1991). Use of bacteriophage T7 lysozyme to improve an inducible T7
expression system. J. Mol. Biol. 219, 37-44.
Teng-umnuay, P., Morris, H.R., Dell, A., Pánico, M., Paxton, T., and West, C.M. (1998)
The cytoplasmic F-box binding protein SKP1 contains a novel pentasaccharide linked to
hydroxyproline in Dictyostelium. J. Biol. Chem. 273, 18242-18249.
Trinchera, M., and Bozzarro, S. (1996). Dictyostelium cytosolic fucosyltransferase
synthesizes H type 1 trisaccharide in vitro. FEBS Lett. 395, 68-72.
Tyers, M., Tokiwa, G., Nash, R., and Futcher, B. (1992). The Cln3-Cdc28 kinase
complex of S.cerevisiae is regulated by proteolysis and phosphorylation. EMBO J. 11,
1773-1784.
Uro-Coste, E., Fonta, C., Hetey, F., Perret, F., Delisle, M. B., Caput, D., and Imbert, M.
(1997). Expression of Skpl mRNA and protein in rat brain during postnatal development.
Neuroreport 8, 1675-1678.
Varki, A. (1993). Biological roles of oligosaccharides: all the theories are correct.
Glycobiology 3, 97-130.
Verma, R., Annan, R.S., Huddleston, M.J., Carr, S.A., Reynard, G., and Deshaies, R.J.
(1997a). Phosphorylation of Siclp by G1 Cdk required for its degradation and entry into
S Phase. Science 278, 455-460.
Verma R., Feldman, R.M.R., and Deshaies, R.J. (1997b). SIC1 is ubiquitinated in vitro
by a pathway that requires CDC4, CDC34, and Cyclin/CDK activities. Mol. Biol. Cell 8,
1427-1437.
Veyna, N.A., Jay, J.C., Srisomsap, C., Bounelis, P., and Marchase, R.B. (1994). The
addition of glucose-1 -phosphate to the cytoplasmic glycoprotein phosphoglucomutase is
modulated by intracellular calcium in PC 12 cells and rat cortical synaptosomes.
J.Neurochem. 62, 456-464.
Vliegenthart J.F.G. and Montreuil, J. (1995). Primary structure of glycoprotein glycans.
In Montreuil, J., Schachter, H., and Vliegenthart, J.F.G. (eds), Glycoproteins Elsevier,
Amsterdam, The Netherlands, pp. 13-28.
West, C. M., Erdos, G. W., and Davis, R. (1986). Glycoantigen expression is regulated
bothe temporally and spatially during development in the cellular slime molds
Dictyostelium discoideum and D. mucoroides. Mol. Cell. Biochem. 72, 121-140.
West, C.M., Kozarov, E., and Teng-umnuay, P. (1997). The cytosolic glycoprotein SKP1
of Dictyostelium discoideum is encoded by two genes resulting in a polymorphismn at a
single amino acid position. Gene 200, 1-10.

138
West, C.M., Scott-Ward, T., Teng-umnuay, P., van der Wei, H., Kozarov, E., and Huynh,
A. (1996). Purification and characterization of an al,2-L-fucosyltransferase, which
modifies the cytosolic protein SKP1, from the cytosol of Dictyostelium. J.Biol.Chem.
271, 12024-12035.
Yoho, E. R., Thomopoulos, G. N., Thalmann, I., Thalmann, R., and Schulte, B. A.
(1997). Localization of organ of Corti protein II in the adult and developing gerbil
cochlea. Hear. Res. 104,47-56.
Zeng, Y., shabalin, Y., Szumilo, T., Pastuszak, I., Drake, R.R., and Elbein A.D. (1996)
Synthesis of arylazide derivatives of UDP-GlcNAc and UDP-GalNAc and their use for
the affinity labeling of glycosyltransferases and the UDP-HexNAc pyrophosphorylase.
Anal. Biochem. 239, 99-106.
Zhang, H., Kobayashi, R., Galaktionov, K., and Beach, D. (1995). pl9Skpl and p45Skp2 are
essential elements of the cyclin A-CDK S-phase kinase. Cell 82, 915-925.
Zhang, Y., Iwasa, T., Tsuda, M., Kobata, A., and Takasaki S. (1997). A novel
monoantennary complex-type sugar chain found in octopus rhodopsin: occurrence of the
Gal beta 1—>4Fuc group linked to the proximal N-acetylglucosamine residue of the
trimannosyl core. Glycobiology 7, 1153-1158.

BIOGRAPHICAL SKETCH
Dr. Patana Teng-umnuay was bom on December 10, 1961, in Bangkok, Thailand.
He graduated an M.D. with the first class honor from the Chulalongkom University,
Bangkok, Thailand, in 1986, and received the Thai board certificates in Internal Medicine
and in Nephrology in 1990 and 1992, respectively. He entered the Cell and
Developmental Biology Program, Department of Anatomy and Cell Biology, University
of Florida, in January, 1994, and became a Ph.D. candidate in Febuary, 1995. He
completed the requirements for the degree of Doctor of Philosophy in December, 1998.
139

I certify that I have read this study and that in my opinion it conforms to
acceptable standards of scholarly presentation and is fully adequate, in scope and quality,
as a dissertation for the degree of Doctor of Philosophy.
(jbjukx jM cJ*Jr
Christopher M. West, Chair
Associate Professor of Anatomy and Cell Biology
I certify that I have read this study and that in my opinion it conforms to
acceptable standards of scholarly presentation and is fully adequate, in scope and quality,
as a dissertation for the degree of Doctor of Philosophy.
/
Gudrun S. Bennett
Research Professor of Anatomy and Cell Biology
I certify that I have read this study and that in my opinion it conforms to
acceptable standards of scholarly presentation and is fully adequate, in scope and quality,
as a dissertation for the degree of Doctor of Philosophy .
William A. Dunn, Jr.
Associate Professor of Anatomy and Cell Biology
I certify that I have read this study and that in my opinion it conforms to
acceptable standards of scholarly presentation and is fully adequate, in scope and quality,
as a dissertation for the degree of Doctor of Philosophy.
Jeffrey K. Harrison)
Assistant Professor of Pharmacology and
Therapeutics
This dissertation was submitted to the Graduate Faculty of the College of
Medicine and to the Graduate School and was accepted as partial fulfillment of the
requirements for the degree of Doctor of Philosophy
December 1998
Dean, College of Medicine
Dean, Graduate School