Citation
The Role of beta 1,4-galactosyltransferase in murine salivary gland development

Material Information

Title:
The Role of beta 1,4-galactosyltransferase in murine salivary gland development
Creator:
Oxford, Gregory E
Publication Date:
Language:
English
Physical Description:
xiii, 150 leaves : ill. ; 29 cm.

Subjects

Subjects / Keywords:
Acinar cells ( jstor )
Antibodies ( jstor )
Cells ( jstor )
Fetal development ( jstor )
Integrins ( jstor )
Messenger RNA ( jstor )
Morphogenesis ( jstor )
Receptors ( jstor )
Reverse transcriptase polymerase chain reaction ( jstor )
Salivary glands ( jstor )
Department of Oral Biology thesis Ph.D ( mesh )
Dissertations, Academic -- College of Medicine -- Department of Oral Biology -- UF ( mesh )
Mice ( mesh )
Morphogenesis ( mesh )
N-Acetyllactosamine Synthase -- physiology ( mesh )
Research ( mesh )
Salivary Glands -- embryology ( mesh )
Genre:
bibliography ( marcgt )
non-fiction ( marcgt )

Notes

Thesis:
Thesis (Ph.D.)--University of Florida, 1998.
Bibliography:
Bibliography: leaves 126-148.
General Note:
Typescript.
General Note:
Vita.
Statement of Responsibility:
by Gregory E. Oxford.

Record Information

Source Institution:
University of Florida
Holding Location:
University of Florida
Rights Management:
The University of Florida George A. Smathers Libraries respect the intellectual property rights of others and do not claim any copyright interest in this item. This item may be protected by copyright but is made available here under a claim of fair use (17 U.S.C. §107) for non-profit research and educational purposes. Users of this work have responsibility for determining copyright status prior to reusing, publishing or reproducing this item for purposes other than what is allowed by fair use or other copyright exemptions. Any reuse of this item in excess of fair use or other copyright exemptions requires permission of the copyright holder. The Smathers Libraries would like to learn more about this item and invite individuals or organizations to contact the RDS coordinator (ufdissertations@uflib.ufl.edu) with any additional information they can provide.
Resource Identifier:
029721354 ( ALEPH )
51651300 ( OCLC )

Downloads

This item has the following downloads:


Full Text












THE ROLE OF BETA 1,4-GALACTOSYLTRANSFERASE IN MURINE
SALIVARY GLAND DEVELOPMENT













BY


GREGORY E. OXFORD










A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 1998



























This dissertation is dedicated to my wife, Isabell, and my children, Mitchell, Allison and Leslie. They each provided me with the strength to carry on and complete this course of study. Their sacrifices were greater than armies and their tears sweeter than wine. I will forever be grateful for their support.









The important thing is not to stop questioning. Curiosity has its own reason for existing. One cannot help but bein awe when he contemplates the mysteries of eternity, of life, of the marvelous structure of reality. It is enough if one tries merely to comprehend a little of this mystery everyday. Never lose a holy curiosity.

-Albert Einstein













ACKNOWLEDGMENTS



Over the past four years Dr. Michael G. Humphreys-Beher has been my mentor, colleague and friend, and I will be forever grateful for the unwavering support and guidance he afforded me. Dr. Humphreys-Beher introduced me to the rigors of science, the significance of certainty and necessity of inquiry. His insight and direction was instrumental and crucial in my creation and design of this project.

Additional thanks are directed to the members of my committee: Dr. Arnold S. Bleiweis, Chairman of the Department of Oral Biology, who was essential in my seeking an education at this fine institution--Dr. Bleiweis has developed one of the finest group of researchers available anywhere; Dr. Gregory S. Schultz, whose knowledge and understanding of science is only surpassed by his passion for teaching;, and Dr. William P. McArthur who selflessly spent countless individual hours developing my appreciation of the science and utility of immunologic techniques.

Numerous others have played invaluable roles in this process. Drs. Jeff Hillman and Anne Progulske-Fox as well as the entire faculty of the Department of Oral Biology were instrumental in my early stages of investigation. Additionally, I thank Dr. Nasser Chegini, and the entire staff of



iii








the Institute for Wound Research at the University of Florida for assistance with the immunohistochemical evaluation of samples. Dr. Amen Peck of the Department of Pathology and his laboratory personnel especially Ms. Janet Cornelius, I thank for their timeless help with cell isolation and flow cytometry.

Drs. Shawn Macauley, Heather Allison, and Chris Robinson also provided countless hours of personal tutelage during this course. Mr. Micah Kerr, Jason Brayer, and Amy Shawley each provided me with additional knowledge, crucial to the completion of this project. Also the members of the Humphreys-Beher laboratory that made the seemingly endless days (and nights) at the bench enjoyable.

Lastly, I acknowledge the sacrifice imparted on my family during this process. I wish to thank my beloved wife and children, my parents, my inlaws, my sister in-law, Mona, and my Lord and Savior, Jesus Christ through whom all things are possible.





















iv













TABLE OF CONTENTS

page

ACKNOWLEDGMENTS ................................................................................ iii

L IS T O F F IG U R E S ....................................................................................... v iii

A B S T R A C T ........................................................................................... ... .. x i

CHAPTERS
1 INTRODUCTION
S alivary G la nd s ................................................................ ... .. 1
Form and Function of Salivary Glands ................................. 4
Acinus and ductal cells .............................................. 4
Serous and mucinous glands ................................... 4
Development of the Salivary Gland ..................................... 6
Morphogenesis and cytodifferentiation ................... 7
Functional coupling of the salivary gland .............. 10
Role of ECM in Salivary Gland Development .................... 15
L a m in in ................................................................. ...... 1 5
Integrin composition ................................................. 19
Integrins as ECM receptors .................. 20
Integrins influence on growth .................. 23

Glycosyltransferases ............................................................... 25
The P1,4-galactosyltransf erase GalTase .......................... 28
Cell-Surface GalTase ........................................................... 33
GalTase's Role in Development .......................................... 34
Cell-cell interactions ................................................ 35
Cell-surface receptors for GalTase interaction ....... 37
A Role for GalTase in Cellular Proliferation ............ ...... 37
GalTase and the epidermal growth factor-receptor ...................... 39
GalTase as a cell adhesion molecule ...................... 40
GalTase's role in cell-matrix interactions ................ 41

Statement of the Problem ........................................................ 42





V








2 MATERIALS AND METHODS ..................................................... 46
Normal in vivoDevelopment ................................................... 46
Selection of Developmental Markers ................................... 46
A m ylase (A M Y ) ........................................................... 4 7
C ystatin (C Y S ) .......................................................... 4 7
Epidermal growth factor(EGF) ................. 47
G a lT a se (G T ) .............................................................. 4 8
G 3 P D H ....................................................................... 4 8
Lysozym e (LYS ) ....................................................... 49
M ucin (M U C ) .............................................................. 4 9
Nerve growth factor(NGF) ................... 51
Parotid secretory protein .................... 51
Messenger RNA Profile of Fetal Submandibular Gland
D evelopm ent ................................................. 5 1
C ollectio n of tissues ................................................. 52
Isolation of poly (A)+ messenger RNA ...................... 52
Micro-Fast Track technique .................. 53
RT -PC R Procedures ............................................................. 53
Design and synthesis of RT-PCR primers ............... 55
Standardized RT reaction ................... 55
Standardized PCR reaction .................. 57
Relative Quantification of mRNA Transcription Levels ....... 57
Separation and photographing of
RT-PCR products ........................................... 57
Relative quantification of RT-PCR products ........... 58
Cell-Surface GalTase Enzymatic Activity Profile
of Developing Acinar Cells ............................. 58
Isolation of intact acinar cells .................................... 58
Lactate dehydrogenase control procedures ........... 59
Cell-surface enzymatic activity ................ 60
Histologic and Immunohistochemical Evaluation
of D evelopm ent ............................................... 60
Flow Cytometric Evaluation of Cell-Surface
GalTase During Development ...................... 62

Organ Culture(in vitro) Development ................................. 64
Fetal Salivary Gland Organ Culture System ...................... 64
Selection of Organ Culture Perturbants .............................. 65
A lpha-lactalbum in ................................................... 65
Anti-GalTase antibody .............................................. 66
Anti-laminin antibody ............................................... 66
P retre atm e nt ............................................................. 6 6
T yro pho stin .............................................................. 6 7
C o n tro ls ....................................... .............................. 6 7




vi








Evaluation of Organ Culture System Experiments .......... 67 Morphologic evaluation ................................. 69
Messenger RNA profile ................................. 69
Cell-Surface GalTase enzymatic activity .........69 Statistical analysis ........... .............. 70

3 RESULTS ............................................................. 71
Normal in vivo Development ........................... 71
Messenger RNA Profile of Fetal Submandibular
Gland Development ..............................71
Determination of RT-PCR Preferred Conditions
and Fidelity....................................... 71
Relative Quantification of mRNA Transcription Levels ....72 Cell-surface GalTase Enzymatic Activity Profile............ 86
Histologic and Immunohistochemical Analysis ..........86
Flow Cytometric Evaluation of Cell-Surface
GalTase During Development ................ 89

Evaluation of Organ Culture (in vitro) Experiments............ 92
Control in vitro Development of Fetal Submandibular
Glands.. ....................................... 92
Experimental in vitro Development of Fetal
Submandibular Glands ........................ 100

4 DISCUSSION ........................................................ 105

5 OTHER STUDIES.................................................... 119

REFERENCES................................................................... 126

BIOGRAPHICAL SKETCH ..................................................... 149

















vii













LIST OF FIGURES

Figure Page

1 1 General Structure of Salivary Glands ............................. 5

1 2 Schematic Representation of Basement
M em braneC hanges ........................................................ 9

1 3 The Schematic of Salivary P3-adrenergic Receptors .... .... 13

1 4 The Activation of the Salivary Cholinergic Receptors ...... 14

1 -5 M odel of Lam inin-1 ......................................................... 16

1 6 Schematic of Integrin-Matrix Interactions ....................... 22

1 7 Schematic Diagram of Integrin-Growth
Factor Interactions ........................................................... 24

1 8 The Role of Golgi GalTase .............................................. 27

1 9 The General Structure of Cell-Surface GalTase ........... 31

1 -10 The Genomic Sequence for Murine
3 1,4-galactosyltransf erase ........................................... 32

1 -11 Potential Mechanisms for GalTase Cell-Cell
Inte ra ctio n s ............... ..................... ........................... .... 3 6

1 -12 Model of GalTase Mediated Migration ............................. 43

2 1 The General Scheme for Semi-Quantification
o f m R N A .......................................................................... 5 4

2 2 The General Scheme for Immunohistochemistry ........... 63

2 3 The General Scheme for Organ Culture ......................... 68




viii








3 1 Confirmation of GalTase RT-PCR Products .................... 73

3 2 Gel Electrophoresis Separation of
GalTase RT-PCR Products ....................... 75

3 3 Developmental Expression of Amylase mRNA ............. 78

3 4 Developmental Expression of Cystatin mRNA .............. 79

3 5 Developmental Expression of EGF mRNA ..................... 80

3 6 Developmental Expression of GalTase mRNA .............. 81

3 7 Developmental Expression of Lysozyme mRNA ............ 82

3 8 Developmental Expression of Mucin mRNA ................... 83

3 9 Developmental Expression of NGF mRNA ..................... 84

3 10 Developmental Expression of PSP mRNA ..................... 85

3 11 Histologic Evaluation of Normal Development. .............. 88

3 12 Immunohistochemical Analysis of GalTase
E xp re ssio n ................................................................. ..... 9 0

3- 13 Flow Cytometric Evaluation of Cell-Surface
G a lT a se ....................................................................... ... 9 1

3 14 Representative Photomicrographs of a Fetal Mouse
Submandibular Gland Grown in in vitro Organ Culture
fo r 0 60 H o u rs .............................................................. 9 4

3 15 Expression of 0 60 hour mRNA Levels
of Markers of Terminal Acinar Cell Differentiation .......... 95

3 16 Expression of 0 60 hour mRNA Levels of
Developmental Markers of Ductal Cell Differentiation ...... 96

3 17 Photomicrographs of Representative Fetal Mouse
Submandibular Gland 0 60 Hour Organ Culture ........... 97

3 18 Relative Quantification of in vitro mRNA
E x p re ss io n ........................................................................ 9 8



ix








3 19 Representative Photomicrograph of Results After
36 Hours in Organ Culture With Addition of
A nti-G alT ase A ntibody ......................................................... 101

3 20 Photomicrographs of Representative 0 60 Hour
Tyrphostin O rgan C ulture ............................................. 104

4- 1 Suggested Integrin-GalTase-Actin Model ....................... 115








































x













Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy

THE ROLE OF BETA 1,4-GALACTOSYLTRANSFERASE IN MURINE SALIVARY GLAND DEVELOPMENT

By

Gregory E. Oxford

December 1998

Chairman: Michael G. Humphreys-Beher, Ph.D. Major Department: Oral Biology

Previous investigators have speculated that cell-surface 11,4galactosyltransferase (GalTase) may play an important role in development due to its known biochemical interactions in differentiating and migrating cells. The ability of GalTase to bind N-acetylglucosamine (GIcNAc) residues found on adjacent cells or E8 domains of laminin, found in the extracellular matrix (ECM), is pivotal for these functions.

To evaluate the role of GalTase in in utero salivary gland development, tissues were harvested from CD1 mice from fetal days 13 through 18, neonates and adults. Evaluation of cell-surface GalTase, and other developmental markers, was accomplished by messenger ribonucleic acid (mRNA) expression levels as determined by reverse transcription polymerase





xi








chain reaction (RT-PCR), GalTase enzymatic activity assay, immunohistochemistry and flow cytometry.

This study also utilized the fetal mouse salivary organ culture system to evaluate the role of GalTase in morphodifferentiation. Submandibular glands were harvested at fetal day 13 from CD1 mice and cultured for 60 hours in wells laminin coating. Additions to the media included; nothing, 1X PBS, alactalbumin, anti-GalTase and anti-laminin antibodies, and tyrphostin. Laminin wells were pretreated with bovine galactosyltransferase to modify the GIcNAc residues and eliminate the GalTase substrate. In vitro morphologic development, expression, and activity of cell-surface GalTase was evaluated with photomicrographs, mRNA expression, enzymatic activity, immunohistochemistry and flow cytometry.

Evaluation of in utero mRNA expression, and cell-surface enzymatic activity provided a concordance of GalTase in development. Additionally the in utero expression of mRNA of developmental proteins evaluated peaked at fetal day 16 for 7 of the 8 proteins.

Salivary organs cultured without laminin (plastic wells, anti-laminin antibody or pretreated wells) demonstrated retarded in vitro growth with altered branching morphogenesis and acinar cell proliferation yet similar GalTase mRNA expression. Glands cultured in agents interfering with GalTase-laminin interactions (a-lactalbumin, anti-GalTase) presented altered in vitro morphologic development with less cohesive acinar cell clusters but



xii








similar branching. Furthermore, the GalTase cell-surface activity was inhibited by these agents but without significant reduction in GalTase mRNA. These studies suggest that cell-surface GalTase may be an important mediator of normal cellular interactions, participating in branching morphogenesis and acinar cell proliferation during fetal salivary gland development.







































xiii













CHAPTER ONE
INTRODUCTION



Salivary Glands

An intriguing question in animal development is how epithelium changes shape during morphogenesis and then assumes differentiated function. Traditionally few tissues have been utilized to evaluate morphologic developmental processes and they include lung, mammary and salivary gland tissues. These tissues provide excellent model systems because they develope characteristic morphologic structures that allow for easily identifiable alterations from normal development. Of particular interest to me, because of my training in dentistry, was the salivary gland.

The primary role of the salivary glands is the production of saliva. Healthy humans typically produce approximately 500 1500 mL of whole saliva per day. More than 90% of this saliva comes from the three major salivary glands (Zachariasen, 1996). The saliva is typically thought to be different for each of the major salivary glands. In the mouse, for instance, we know that the submandibular gland produces almost all of the growth factor, epidermal growth factor (EGF) (Cohen, 1962). It is known today that ductal cells are the primary producers of EGF and NGF.





1





2

Saliva is a complex fluid that contains two major components: the macromolecules, typically contained within the secretory granules, and the salivary fluid. The salivary macromolecules include mucins, enzymes, immunoglobulins, growth factors, and other biological active materials. The salivary fluid is typically produced by the acinar cells. Salivary glands, and ultimately saliva, play an important role in the maintenance of the overall health of oral and other tissues. Saliva has many important functions which include: 1) lubrication of the oral tissues to assist in mastication, swallowing and speaking, 2) digestion of ingested nutrients, 3) buffering the acidity of the oral environment, 4) cleansing, 5) formation of the dental pellicle, 6) remineralization of the tooth surface, 7) source of anti-microbial protection against oral infections, 8) protection of the oral mucosa, and 9) regeneration of oral soft tissues (Table 1 1) (Zachariasen, 1996; Izutsu, 1990). Thus, the salivary glands and ultimately saliva play a vital role in homeoregulation of health in the oral cavity.

The oral cavity is preserved and protected by secretions from salivary glands. Salivary glands are typically divided into major or minor glands. Major salivary glands deliver their secretions via extraglandular secretory ducts and have been termed extrinsic while minor glands typically lie within the lamina propria of the oral tissues and empty their products directly into the oral cavity and have thus been termed intrinsic (Dobrosielski-Vergona, 1993).





3







Major Functions of Saliva Function Salivary Components Responsible


Lubrication Water, Mucins, Proline-rich Proteins

Digestion Amylase, Lipase, Proteases

Buffering HC3, PC4

Cleansing Water

Formation of Dental Pellicle Mucins, PRPs, Amylase

Remineralization Ca, P, Statherin, Anionic Proteins

Antimicrobial Lactoperoxidase, Lactoferrin, sigA

Protection of the Mucosa Water, Electrolytes, Mucin

Regeneration Growth factors





Table 1 1. Major Functions of Saliva. Saliva is a complex biological fluid
that has several important functions. Saliva plays a wide assortment of roles in maintaining the homeostasis of the oral cavity. This table
illustrates some of the known roles associated with saliva to date.





4

Form and Function of Salivary Glands

There are three bilaterally paired major salivary glands in most mammals (including man, primates, rats and mice); the parotid, the submandibular and the sublingual. There are also numerous minor salivary glands located throughout the oral cavity found within the lips, palate and mucosal tissues. The structure of salivary glands is common to all and consist of a collection of differentiated cells with specialized functions (Figure 1 1). Acinus and ductal cells.

The major cell types found in salivary tissues are the acinar and ductal cells. Acinar cells, found within the secretory endpieces, produce the majority of the salivary products and fluid while ductal cells carry the acinar secretions to the oral cavity. Acinar cells have a pyramidal shape with multiple secretory granules. Salivary gland acinar cells are thought to arise from the pluri-potential intercalated cells (Eversole, 1971). There are also various forms of ductal cells: the intercalated, granular convoluted and striated secretory ductal cells. The ductal cells, like the acinar cells, secrete macromolecules into the saliva (granular convoluted and striated secretory duct) as well as resorb water and electrolytes (granular convoluted duct) (Gresik etal., 1985).

Serous and mucinous glands.

Early investigations in salivary gland research used hematoxylin and eosin staining of salivary gland secretory endpieces to detect two types of cells: the acinar cells producing serous products and the acinar cells





5








acinar cell


granular convoluted tubule











striated secretory duct intercalated duct






Figure 1 -1. General Structure of Salivary Glands. Acinar cells are depicted
here as terminal endpiece secretory units. There are three different types of ductal cells; intercalated, granular convoluted tubule (which is responsible for the production -of EGF and NGF), and striated secretory
ductal cells.





6


producing mucinous products. This lead to the original description of the major salivary glands as either serous (parotid gland) or mucinous (submandibular and sublingual gland) depending on the secretory products. Serous cells typically produce a proteinacous product with very little mucin. Mucinous cells produce acidic and neutral glycoconjugates with lectin-like qualities known as mucins. Development of immunohistochemical staining technology later suggested that a seromucinous cell type was also present (Munger, 1964). Thus, today we describe the parotid gland as a seromucinous gland (Dobrosielski-Vergona, 1993).



Development of the Salivary Gland

While much has been elucidated in recent years regarding salivary gland function very little has been investigated regarding their normal morphodifferentiation and cytodifferentiation. Never-the-less there are four recognized stages in the development of salivary glands which are: 1) morphogenesis the initiation of the characteristic architecture of clefts and branching; 2) cytodifferentiation the differentiation of rudimentary salivary glands into several cell types leading to the synthesis, storage, and secretion of salivary-specific proteins; 3) development of the stimulus/secretion coupling system; and 4) the anatomical coupling of the sympathetic nerves to begin the secretion of salivary fluids and proteins (Cutler, 1973). Full, functional and complete physiologic development is only achieved once the salivary glands are anatomically connected to the nervous system which





7


ultimately activates the secretory system. Activation of cell-surface receptors of the secretory cells, in response to neural stimuli, results in exocytosis of secretory granule proteins and the production of saliva. These developmental phases are partially coupled and independently regulated and must follow the proper sequence for normal development to occur. Researchers have shown that secretory cell differentiation can not occur until branching morphogenesis has been established (Spooner and Faubion, 1980; Cutler, 1980) and that neural integration will not occur until secretory cell development is complete (Cutler, 1980; Bottaro and Cutler, 1984; Cutler, 1990 for full review). Morphocenesis and cytodifferentiation.

Chievitz initially investigated salivary gland development in pigs (Chievitz, 1885) while Moral was an early investigator of salivary glands in the mouse (Moral, 1916 and Moral 1919). Later Redman and Sreebny, and Cutler and Chaudhry and more recently Nakanishi provided extensive histologic and physiologic studies on ECM expression in embryonic development of rodent salivary glands (Redman and Sreebny, 1970a Redman and Sreebny, 1970b; Cutler and Chaudhry, 1973a; Cutler and Chaudhry, 1973b; Cutler and Chaudhry, 1974; Nakanishi and Ishii, 1989). Recently Macauley provided information regarding some of the molecular aspects of ECM expression in utero for fetal mouse salivary gland development (Macauley et al., 1997). Some discrepancies arose as a result of these reports due to the fact that they identified developmental day "one" differently. To maintain consistency with other reports from our laboratory we





8

have utilized the designations of Cutler and Chaudhry where the day after mating is designated fetal day one (Cutler and Chaudhry, 1973a).

The earliest evidence of submandibular gland development in the mouse begins on late fetal day 11 when specific cells of the primitive oral epithelium form a focal clustering which pushes into the surrounding mesenchyme (Nakanishi et al., 1986). This salivary gland anlage continues to proliferate as a thin layer of oriented mesenchyme which buds from the surrounding mandibular mesenchyme on fetal day 12 and develops the characteristic club-shaped structure surrounded by a basement membrane (morphogenesis). The glands begin to resemble the familiar stalk and branch morphology and can be removed by microdissection on day 13 (Figure 1 2). Only after this branching morphogenesis has occurred can the differentiation of secretory cells take place (cytodifferentiation). Glandular development requires the coordinated spatial and temporal reorganization and distribution of extracellular matrix (ECM) components to achieve morphodifferentiation. The mesenchymal capsule and specifically the ECM molecule components are thought to play an important role in the development of the epithelial portion of the submandibular gland. Removal of the mesenchymal capsule, thus preventing this interaction, reduced or eliminated the epithelial branching morphogenesis (Borghese, 1950; Grobstein, 1953a, 1953b, 1953c). Researchers then suggested that collagen was a stabilizing component of the ECM and participated in mediating cell growth and branching morphogenesis. Similarly, Spooner and Faubion (Spooner and Faubion, 1977) and Nakanishi







9



















degenerating basal lamina





mitotic activity mesenchyrne basal lamina







epithelial cell



type I
collagen




















Figure 1 2. Schematic Representation of Basement Membrane Changes.
This figure represents the changes seen in the basement membrane during murine submandibular gland development. Day 12

demonstrates the invagination of the primitive oral epithelium forming

the "epithelial bud". Day 13 represents the familiar "stalk and branch"





10

et al. (Nakanishi et al., 1986), effectively inhibited in vitro branching morphogenesis of salivary gland rudiments by the addition of collagenases (L-azetidine 2-carboxylic acid or c,cc'-dipyridyl). More recently, Nakanishi and Ishii (Nakanishi and Ishii, 1989) used antibodies for specific collagens (I, II, III, IV) to evaluate the interrelationship between these tissues. Their work suggested that early clefting of the salivary gland rudiment at day 12 and 13 was associated with collagen III localization while collagen I was equally distributed throughout epithelial and mesenchymal tissues and type IV collagen was limited to the basement membrane. Cumulatively, these studies have suggested a model where the mesenchymal cells produce collagen which imparts mechanical forces and strain on the epithelial lobule and this initiates cleft formation (Nakanishi and Ishii, 1989). From this it is believed that mesenchymal tissues may be either permissive or instructive in their relationship with epithelium (Wessells, 1977).

Acinar cell differentiation can take place only after branching morphogenesis has occurred. Cytodifferentiation occurs when secretory proteins are packaged into secretory granules by mature exocrine cells.

Functional coupling of the salivary gland.

The next stages of development of the salivary gland involves coupling of the developing gland with the nervous system. Early investigators operated under the assumption that salivary fluid production was driven by hydrostatic perfusion. According to Burgen and Emmelin, Ludwig first, and later Young and van Lennep demonstrated increased salivary flow in dogs even when





11

submandibular duct pressures were experimentally increased to exceed the arterial pressures, effectively dispelling this theory (Bergen and Emmelin, 1961; Young and van Lennep, 1979). It has now been shown that salivary fluid production occurs via an osmotic gradient which is associated with two separate NaCI transport mechanisms (Novak and Young, 1986; Nauntofte and Poulsen, 1986). Salivary fluid is formed when NaCI is transported from the extracellular basolateral space, across the acinar cell, and into the acinar lumen. This movement of NaCI results in an osmotic gradient that then draws water from the extracellular space, which is replaced with fluids and NaCI from the gland's blood supply.

The salivary fluid flow is controlled by both sympathetic and parasympathetic innervation, and acinar cells have receptors for both systems. Sympathetic nerves release the agonist norepinephrine which interacts with both a and P adrenergic receptors. Parasympathetic nerves release the agonist acetylcholine which binds to the muscarinic cholinergic receptors (Allende, 1988). The structure of the adrenergic and muscarinic cholinergic receptors is similar and consists of an extracellular domain, seven transmembrane spanning domains, and a cytoplasmic terminus (Lefkowitz and Caron, 1988).

An activated p-adrenergic receptor can interact with a heterodimeric membrane bound G-protein (G-proteins bind guanine nucleotides and consist of 3 subunits, a [which binds the guanine phosphate], 3, and y). This





12


interaction causes the dissociation of the GTP-a subunit which can then associate with the catalytic portion of the adenylate cyclase and cause increased cellular cyclic adenosine monophosphate (cAMP). This increase in cellular cAMP activates protein kinase activity and leads to phosphorylation events that ultimately result in exocytosis of the salivary proteins stored in secretory granules through fusion of granules to the plasma membrane (Figure 1 3).

Activation of the a-adrenergic receptor provides a feedback mechanism by binding to the inhibitory G protein (G) so that GTP is exchanged for GDP which results in the dissociation of the GTP- a subunit. This dissociated GTPa subunit then binds to the catalytic domain of adenylate cyclase, effectively preventing [3-adrenergic stimulated binding (Figure 1 3).

The activated cholinergic receptor, coupled with phospholipase C PLC), leads to hydrolysis of phosphatidylinositol-4,5-bisphosphate into inositol 1,4,5-triphosphate (IP3) and diacylglycerol (DG) (Gallagher, 1988). IP3, combined with IP4 (a calmodulin-dependent, phosphorylated IP3), leads to opening of Na, K, and Cl channels which ultimately ends with fluid and electrolyte secretion (Figure 1 4). IP3 initiates the release of intracellular Ca2+ which allows DG to activate PKC. PKC can stimulate the fusion of secretory granules with the plasma membrane and release a minimal amount of saliva protein.





13












p-adrenergic G protein
receptor a-adrenergic or
muscarinic receptor
lumen





................... ~~~~. ... ......i: .. :....... -..." :: Ji!i:i? :!:i ... .


exocytosis










Figure 1 3. The Schematic of Salivary P-adrenergic Receptors. Regulation
of adenylate cyclase activity of the acinar cells stimulate
phosphorylation events leading to exocytosis of secretory proteins of
the secretory granules.





14









G protein Ca2+ K+
cholinergic
receptor




lumen"% '-'-l---en






fusion of the secretory granule
to the plasma membrane






Figure 1 4. The Activation of Salivary Cholinergic Receptors. The activation
of the cholinergic receptors through acetylcholine lead to elevation of
C2+ ions which in turn regulate the fluid secretion from the salivary
gland acinar cells. Intracellular Ca2 ions allow DG to activate PKC, which stimulates the fusion of secretory granules to the plasma
membrane and release of saliva protein.





15

Role of ECM in Salivary Gland Development

Thin layers of ECM known as basement membranes separate epithelial cells and connective tissue. The epithelial-mesenchymal interaction is thought to be achieved through the action of ECM components located in the basement membrane. The biological importance of the epithelialmesenchymal interaction was first recognized by Grobstein (Grobstein, 1953a, 1953b, 1953c). It is thought today that many components of the basement membrane are biologically active through their activation of growth factor receptor signaling pathways. These components include collagen, proteoglycan, fibronectin, and laminin (Trelstad, 1984). Laminin.

Laminins are extracellular glycoproteins that are the major component of basement membrane in most tissues and are synthesized by a variety of cell types including fibroblast, epithelial and endothelial cells (Campbell and Terranova, 1988; Paulsson, 1992). Laminin was first isolated from the murine Engelbreth-Holm-Swarm tumor (Timpl, et al., 1979) and there have been at least 11 isoforms isolated to date (Burgeson et al., 1994 Miner et al., 1997). Laminin-1 is considered to be a major glycoprotein of the basement membrane. Laminin-1 is a cross-linked molecule composed of three separate chains, al (400 kDa), P31, and y2 (200 kDa), which assembles as a triplestranded cross-like structure connected by disulfide bonds (Beck et al., 1990; Timpl, 1989) (Figure 1 5). Collagen binds to the short arms (Rao et al., 1982; Terranova etal., 1983; Charonis etal., 1985, 1986) while heparin binds to





16





CLI1

El Domain(1i) E4 Domain(28)



NH2 NH2









G Domain

E8 Domain (20)
COOH



E3 Domain (6) .i~iiii:i... .....








Figure 1 5. Model of Laminin-1. This model of laminin-1 illustrates the
various laminin fragments. Laminin chains al, 131, and yl chains and their putative biologically active domains. El 4, El, E8, and E3 represents elastase fragments while the numbers in parentheses
represent potential N-glycosylation sites.





17

the terminal globule of the long arm, and the inner and outer globules of the short arms (Sakashita et al., 1980; Ott et al., 1982).

Specific peptide domains of laminin molecules have been associated with various functions in vivo such as assisting attachment of epithelial cells to basement membrane, promoting cell migration and regulating cell proliferation (Dragoo et al., 1991; Panayotou et al., 1989; Reh et al., 1987; Sweeney etal., 1990; Mecham, 1991; Tomaselli et al., 1990). Recent reports indicate that basement membranes of acinar and ductal cells contain different laminin isoforms that may be associated with cell differentiation and function (Strassburger et aL, 1998). Components of the laminin a1 chain have been reported to be essential for branching morphogenesis and cell spreading. Using monoclonal antibodies to the E3 domain of the laminin cl chain, Kadoya and coworkers, demonstrated inhibition of branching morphogenesis in a 13 day fetal salivary gland organ culture (Kadoya etaL, 1995, 1997, 1998, Miner etaL, 1997). Similarly, Begovac has demonstrated that the E8 domain is crucial for cell spreading. Using the rat pleochromocytoma (PC12) cell model revealed that these cells failed to develop neurite outgrowths on laminin when cultured with E8-reactive antibodies, demonstrating that a principle neurite binding site resides in the E8 domain of laminin and appears to be responsible forthe spreading (Begovac etaL, 1991). Eckstein and Shur subsequently demonstrated that laminin induced a 3 fold increase in the level of cell-surface 131,4-Galactosyltransferase on migrating mesenchymal cells





18


which is preferentially localized to the leading edge of the lamellipodia (Eckstein and Shur, 1989).

Oliver et al., confirmed the requirement of ECM, specifically laminin, for the maintenance of acinar cell phenotype in immortalized cell line cultures (Oliver, et al., 1987). Oliver and co-workers demonstrated that immortalized exocrine acinar cells grown without access to laminin, on a reconstituted basement membrane gel, failed to maintain the acinar cell characteristics. Cutler examined the effects of polyclonal or monoclonal antibodies directed against extracellular matrix components on in vitro cultured developing rat submandibular gland rudiments (Culter, 1990). When these 16 day rat submandibular gland rudiments were cultured in the presence of anti-laminin antibodies they grew at the same rate as control rudiments but branching morphogenesis and secretory cell differentiation was retarded. When rudiments were cultured in the presence of anti-collagen antibody only 1 of 29 glands demonstrated branching morphogenesis and none (0 of 29) had secretory differentiation of the secretory endpieces. These results suggest that type IV collagen as well as laminin are involved in the regulation of salivary gland morphogenesis and that the process of branching morphogenesis and secretory cell differentiation within salivary glands are partially coupled but independently regulated.

Additionally, alterations in the morphology of the basement membrane have been reported in duct-ligated salivary glands with failure of the membrane to retain its differentiation and secretory activity, suggesting that





19


laminin plays a role in maintaining glandular morphology (Emmelin et al., 1974). It is now known that laminin promotes a wide array of developmental activities including cellular adhesion, migration, differentiation, proliferation, neurite outgrowth and tumor growth (Hoffman et aL, 1996).

Several classes of cell-surface receptors have been shown to interact with the functional domains of laminin. One class that interacts with laminin is the heterodimeric cell surface receptor integrins. These integrins consist of non-covalently associated at and p subunits (Hynes, 1987). Intecqrin composition.

The integrins comprise a family of heterodimeric receptors composed of a single c and 3 subunit. To date 16 ot chains and 8 3 chains have been identified (Hynes, 1992). The a chains may associate with a variety of different P3 subunits leading to the possibility of more than 20 different permutations. Nonetheless, several subgroupings of integrins have been noted. Integrins containing the (31 chain are largely involved in interactions between cell surfaces and ECM molecules such as collagens, laminin and fibronectin (Garratt and Humphries, 1987; Hynes, 1987). The (32 chain integrins appear to be affiliated with inflammatory cells and are thus termed the "leukocyte integrins" while the (33 chain integrins are associated with cells of the vascular system (Hynes, 1992). Both subunits consist of a large extracellular domain, a transmembrane domain, and a short cytoplasmic domain. Unlike growth factor receptors, they do not have tyrosine kinase





20

domains yet they mimic growth factor signal transduction events such as Ca++ mobilization, activation of PLC-y, and the mitogen activated protein kinase (MAPK) cascade, and tyrosine phosphorylation of p125FAK (Juliano and Haskill, 1993). Downstream signal transduction events associated with integrins seem to intersect with the Ras pathway, particularly the activation of MAP kinases.

The general structure of an integrin receptor consists of several components. The a subunits range in size from 1200 to 1800 amino acids. The N-terminus contains 7 repeating domains that are cation binding domains for Ca++, Mg** and calmodulin (Tuckwell and Humphries, 1993). The transmembrane and intracellular domains are relatively short, around 30 amino acids, and are well conserved. The P3 subunits are smaller than the a subunits (= 800 amino acids) and also have a region of 4 repeated sequences with EGF-like domains. The a and p subunits must associate with each other through noncovalent interactions to gain effective ligand-binding (Hogervorst etal., 1990; Loftus etal., 1990; Giancotti, etal., 1992). Inteqrins as ECM receptors.

Integrins bind to components of the ECM including laminin. The initial response to ligand binding to the integrin receptor is clustering of the integrin a and p subunits which then triggers formation of cytoplasmic complexes involving cytoskeletal proteins. Cytoskeketal proteins talin and ca-actinin bind the cytoplasmic tail of the P subunit, then initiate binding of zyxin, paxillin, and





21


vinculin. This whole complex will then bind tensin. Tensin and a-actinin, when in this arrangement appear structurally capable of binding and inducing cytoskeletal actin filament rearrangements (Lafrenie and Yamada, 1996). Thus, integrin receptors play a role in overall cellular architecture and cell motility. Binding to extracellular ligands can also activate protein kinase C (PKC), cytoplasmic tyrosine kinases including growth factor receptors, and MAPKs (Howe, et al, 1998; Kornberg, 1998). Thus, integrins may play an important role in signaling events leading to cell growth (Figure 1 6).

A primary ligand of integrin receptors is laminin. Expression patterns of cell-surface collagen and laminin integrin receptor ca subunits has been studied during morphogenesis (Wu and Santoro, 1996). Alpha 1 has been found around endothelial and smooth cells of airways and large blood vessels while a2 and a6 (but not a3) were found in conjunction with mesenchymal cells. Epithelial cells expressed all three isotypes. Yao et al. demonstrated that a7pl31 integrin receptor mediates cell adhesion and migration on specific laminin isoforms (Yao et al., 1996). By using monoclonal antibodies generated against a7 subunit, adhesion and migration of transfected cells was blocked on laminin-1 substrates. Confounding the situation, it has recently been shown that a cell activated via the EGF-R demonstrates increased phosphorylation of the integrin 134 subunit at multiple tyrosine residues which leads to migration on laminin surfaces (Mainiero et al., 1996).





22




ECM




integrin 'AACell-surface
receptor GalTase

plasma membrane
Ras Srcytosol











actin cytoskeleton

Wear ne urlane




DNA
replication cell division

Figure 1 -6. Schematic of Integrin-Matrix Interactions. Ligand binding of
integrin to ECM induces clustering of integrin a and P subunits which triggers formation of cytoplasmic complexes of cytoskeletal proteins.
Cytoskeletal proteins talin, ci-actinin bind the P subunits cytoplasmic tail then bind zyxin, paxillin, and vinculin which then bind tensin. Tensin
and a-actinin can bind to cytoskeletal actin filaments. Aggregation of integrin receptors also leads to phosphorylation of Focal Adhesion Kinases (FAKs) which can then lead to signal transduction mechanisms. GalTase is also known to localize with actin cytoskeleton
suggesting that GalTase may also be involved.





23

Integrins influence on growth.

The integrins are also thought to play a more direct role in signal transduction for cell growth. It is known that when cells are bound to ECM proteins their signal transduction cascade, through activated RTK (receptor tyrosine kinase), via Ras, RAF, MEK (MAPK kinase), to MAPK, is intact (Burridge et al., 1988). Additionally, FAKs (focal adhesion kinases) have been isolated that bind to cytoplasmic tails of the integrin receptors. These FAKs have binding sites for Src, which may then phosphorylate Grb2, that bind Ras. Ras, once activated by SOS, may interact with Raf and lead to signal transduction. When cells are non-adherent and the cytoskeletal arraignment less rigid, signal transmission can be interrupted, due to the fact that some of the Raf activators are membrane bound disrupting the cascade. In this way integrins are thought to play a role in signal transduction by stabilizing the cytoskeletal spatial arrangements of components necessary for signal transduction (Figure 1 6) (Howe etal. 1998).

A second mechanism in which integrins are thought to play a role in signal transduction is by physically associating with growth factor receptors, and these are actively being investigated. Activation of RTKs sets up a signal transduction cascade that parallels many of those previously discussed. Down stream signal transduction associated elements of activated RTKs include PLCy (phospholipase C gamma), SOS and GAP (GTPase activating protein), which assist in controlling the activity of Ras proteins, Raf and MEK/MAPK (Figure 1 7).





24




ECM 2
: I cysteine rich
Cell-surface dmcysteine rich
GalTase Integrin
receptor Receptor
Receptor

plasma membrane Ras cytosol
FAK
SOS Src ra
aF
PLCy
SOS
COOH









nuclear membrane




DNA in
replication / cell division

Figure 1 7. Schematic Diagram of Integrin-Growth Factor Interactions.
Activation of tyrosine kinase receptors (growth factor receptors) leads to phosphorylation and activation events including Phospholipase C gamma (PLCy), SOS, GTPase Activating Proteins (GAP), which play a pivotal role in activating Ras proteins in the MAP kinase signal transduction cascades. Cell-surface GalTase is known to induce EGFR mediated signal transduction via cytosolic tyrosine kinase. This
pathway parallels those of integrin dependent cascades.





25

Glycosyltransferases

Another cell surface receptor of laminin is p31,4-galactosyltransferase. Beta 1,4-galactosyltransferase (GalTase) is a member of a family of enzymes termed glycosyltransferases. Cell-surface GalTase is not the only membranebound glycosyltransferase, in fact conservative estimates suggest that there may be more than 100 membrane-bound enzymes that participate in glycoprotein biosynthesis alone (Russo et aL., 1990). A partial listing of glycosyltransferases involved in glycoprotein or glycolipid synthesis, and their donor substrates, is seen in Table 1 2. Roseman first reported cell-surface expression of glycosyltransferases and suggested their involvement in cellular activities including growth control (Roseman, 1970). Since that report numerous glycosyltransferases have been identified as having the ability to be expressed on the cell-surface including GalTase, fucosyltransferase and sialyltransferase. To date the presence of GalTase on the surface of cells has been verified by immunofluorescence microscopy (Lopez and Shur, 1987), flow cytometry (Marchase et al., 1987), immunoelectron microscopy (Suganuma etal., 1991), and detection of enzyme activity on purified plasma membranes (Lopez et al., 1991; Neely, 1988; Purushotham et al., 1992b).

Glycosyltransferases are traditionally found as membrane bound enzymes in the rough endoplasmic reticulum and Golgi complex, where they participate enzymatically in glycoconjugate biosynthesis and post-translational modification of proteins and lipids (Figure 1 8). The biosynthesis of glycoproteins requires the attachment of oligosaccharide chains to the





26



Glycosyltransferases of Glycoprotein and Glycolipid Synthesis

Glycosyltransferase Donor Sequence Formed


Galactosyltransferases
GIcNAc P31,4-GT UDP-Gal Gal 31,4 GIcNAc-R

Gal c1,3-GT UDP-Gal Gal al,3 Gal 131,4 GIcNAc-R


Sialytransferases
Gal ot2,6-ST CMP-NeuAc NeuAc o2,6 Gal 131,4 GIcNAc-R


Fucosyltransferases
GIcNAc al,3-FT GDP-Fuc Fuc ol ,3
GIcNAc-R
Gal 31,4

Gal ol,2-FT GDP-Fuc Fuc cal,2 Gal 31,4 GIcNAc-R
Fuc cl,2 Gal 131,3 GalNAc-R


N-Acetylgalactosaminyltransferases
Gal al,3-GalNAcT UDP-GalNAc Gal NAc xl,3
Gal-R
Fuc 1,2





Table 1 2. A partial listing of glycosyltransferases involved in glycoprotein
and glycolipid synthesis. Abbreviations combine the acceptor sugar (Gal galactose; GIc glucose; Fuc fucose), the linkage formed, the glycosyltransferase family to which the complex belongs, and R represents the remainder of the glycoprotein (Adapted from Paulson
and Colley, 1989).





27








UMP UDP-galactose
Pi


Pi UMP UPgahtse cytosol




apparatus











Figure 1 8. The Role of Golgi GalTase. GalTase is typically found within the
Golgi apparatus where it functions enzymatically to participate in glycoconjugate biosynthesis. GalTase transfers the sugar UDP-Gal to
the polypeptide backbone via the GIcNAc residue.





28

polypeptide backbone. This linkage may occur via a hydroxyl group or an amino group. Attachment of the oligosaccharide moiety to a hydroxyl group of the amino acids serine or threonine are called O-glycoside or Nacetylgalactosamine linkages (GalNAc). The attachment via the amino group of asparagine is called an N-glycoside or N-acetylglucosamine (GIcNAc) linkage.



The 031,4-galactosyltransferase GalTase

GalTase selectively glycosylates GIcNAc substrates to form lactosamine (below) (Kornfeld and Kornfeld, 1985).


31,4 GalTase
UDP Gal .- Gal GIcNAc



Using the energy of the nucleotide phosphodiester bond, these enzymes may also catalyze transfer a single sugar residue from UDP-Gal to terminal GIcNAc glycoside acceptors after mannose branching has occurred as illustrated below.


GIcNAc Man
,Man GIcNAc GIcNAc
GIcNAc Man/



(* p1,4-galactosyltransferase functions at these GIcNAc residues, to transfer gal after mannose branching has occurred.)





29

In non-lactating tissues GalTase catalyzes the incorporation of galactose at the beta 1,4 linkage to GIcNAc residues at the nonreducing termini (Brew etaL, 1968; Hill and Brew, 1975). GalTase may additionally be found as soluble forms in milk (thus the term "the milk enzyme"), amniotic fluid, cerebrospinal fluid, saliva, urine, colostrum, and serum and can synthesize lactose at a very high affinity, due to the presence of the milk protein cclactalbumin, according to the following biochemical reaction (Schachter and Roden, 1973; Ebner, 1973).




P1 ,4 GatTase
free glu + UDP Gal g Gal Glu (lactose)
(glucose) ca-Iactaibumin disaccharide




Results of competitive inhibition studies suggested that the aXlactalbumin molecule, found often in lactating tissues, induces a conformational alteration of the GalTase enzyme that prevents exposure of the active binding site (Do et al., 1995). These studies demonstrated that atlactalbumin induces a 1000 fold decrease in the enzyme's capacity to transfer Gal from UDP-Gal to the acceptor GIcNAc. Instead the preferred substrate becomes Glu (Kornfeld and Kornfeld, 1985).

Researchers at the Structural Biology Section of the Division of Biological Sciences at the National Cancer Institute have reported that the major binding regions for sugar acceptor and sugar-nucleotide donors lie in





30

the N and C terminal halves of the catalytic portion of the protein, respectively, and the two binding surfaces overlap at the catalytic site. Currently, this group is also investigating the three dimensional structure of this enzyme by X-ray crystallography.

Glycoproteins are structurally distinguishable from other proteins by the presence of oligosaccharide side chains that are covalently attached to the polypeptide backbone. Glycoproteins are ubiquitous and fulfill a variety of biological functions from fertilization, morula compaction, tissue organization to cell migration (Shur and Bennett, 1979; Shur and Hall, 1982b; Shur, 1984; Eckstein and Shur, 1989). This diversity of characteristic chemical and physical properties appear to stem partially from the three dimensional structure and conformational alterations these oligosaccharide side chain ligands impart such as during attachment and migration (Poulsen and Colley, 1989). It is also known that glycosylation patterns fluctuate during many biologic events such as growth, development or disease (Penno et aL, 1989; Passaniti and Hart, 1990).

The general structure of cell-surface GalTase has been elucidated and consist of several common features including; an N-terminal cytoplasmic tail, a transmembrane domain, a stem region and a C-terminal catalytic domain facing the lumen (Figure 1 9). The gene encoding murine GalTase was isolated and characterized in 1988 (Figure 1 10) (Shaper et al., 1988). The localization of the gene for GalTase has been mapped to a position in the centromeric region of the mouse chromosome 9 (Shaper et al., 1990).





31
















catalytic domain

..... ... .... .. .....!: i?: !:


transmembrane COOH

lumen









cytoplasmic tail






Figure 1 9. The General Structure of Cell-Surface GalTase. The general
structure of cell-surface GalTase is depicted here. GalTase has a short cytoplasmic amino terminal tail, a single transmembrane spanning
domain, and a long lumenal catalytic carboxyl domain.








32







CCCCCTCTTA AAGOOGOGGC GGGAAGATGA GGTTTCGTGA GCAGT-rCCTG GGCGGCAGCG CCGCGATGOC

GGGCGOGACC CTGOAGOGGG OCTGCCGOCT GOTCGTGGCC GTCTGCGCGC TGCACCTCGG CGTCACCCTC

GTCTATTACC TCTCTGGCCG CGATCTGAGO GGCCTGOCCC AGTTGGTCGG AGTCTCCTCT ACACTGCAGG

GCGGCACGAA OGGCGCCGCA GCCAGCAAGC AGCCCCCAGG AGAGCAGCGG CCGCGGGGTG CGCGGCCGCC

GOCTCCTTTA GGCGTCTCCC CGAAGCCTCG CCCGGGTOTO GACTCCAGOC CTGGTGCAGO TTCTGGCCOC
GGCTTGAAGA GCAACTTGTC TTCGrrGOCA GTGCCCACCA CCACTGGACT GTTGTCGCTG CCAGCTTGCC

CTGAGGAGTC CCCGCTGCTC GTTGGCCCCA TGCTGATTGA CTTTAATATT GCTGTGGATC TGGAGCTTTT

GGCAAAGAAG AACCCAGAGA TAAAGACGGG CGGCCGT-rAG TCCOCCAAG GACTGTGTCT CTCCTOACAA

GGTGGCCATC ATCATCCCAT TCCGTAACCG GCAGGAGCAT CTCAAATACT GGCTGTATTA TTTGCATCCC

ATCCTTCAGC GCOAGCAACT CGACTATGGC ATCTACGTCA TCAATCAGGC TGGAGACACC ATGT-rCAATC

GAGCTAAGOT GCTCAATATT GGCTTTCAAG AGGCCTTGAA GGACTATGAT TACAACTGCT TTGTGTTCAG
TGATGTGGAC CTCAT-FCCGA TGGACGACCG TAATGCCTAC AGGTGTTTTT CGCAGCCACG GCACATTTCT

GTTGCAATGG ACAAGTTCGG GTTTAGOCTG CCATATGTTC AGTATTTTGG AGGTGTCTCT GCTCTCAGTA

AACAACAGTT TCTTGCCATC AATGGATTCC CTAATAATTA TTGGGGTTGG GGAGGAGAA GATGACGACA

TTTTTAACAGA TTAGTTCATA AAGGGATGTC TATATCACGT CCAAATGCT GTAGTAGGGA GGTGTCGAAT

GATCCGGCAT TCAAGAGACA AGAAAAATGA GCOCAATCCT CAGAGGTTTG ACCGGATCGC ACATACAAAG

GAAACGATGC GCTTCGATGG TTTGAACTCA CTTACCTACA AGGTGTTGGA TGTACAGAGA TACCCGTTAT

ATACCCAAAT CACAGTGGAC ATCGGGACAC MAGATAGGA TTTTTAGrAC CAATAAGA A CCTCA8AATG


GCOGGAGAC CTCAGATATG TGTCTCTGCO AGTTGACTGG GCTG- I' GTCCCT CrCATTTGTA CAGTCJGAAT

GAGAGTTCTT CTTATCATTC AGACGTCCCT CCAGATGCCO AGGGTGAGTG TAACATTTAC CACAACCTG

GCTOGGCACT GGATGAAATT CTACAAGGTG AGTGGAGTGT AAAACTGGTC AGCCCTTGGA GAGACTTOTT

GGTTGTGTCA CCCCCAAAGA GTCAGAACTG TACACAG-FTC AAAACTTA,3T GACTGTGGGT CACAT7CCCA

CTGTTGAAAC TGCTAAATTG TGACCTGGG GAAGC;ACTTT GCTTTAGTCG GTGATGTTCG TACTTGGTGA

CAAATTGAG CTGCTGCTGG ATTCAGATTG ACAAGATT_ T CTTGGATTTT TTTTTTATAC GAAAATCAA

ATTTOAATC AGTCTCGTGC TOTGTCCOTT TACATOGGTA TGCGACTATT ACAATCACTG TGTGTGTGTC

TTTTCTTAGC AAAGGCGTT TTAAAACTTG AGCCTGGACC TTGGGGTCCT GTAGTGTGTG GATTCCAAGG

CCTTGCCCTC AGAGCAGGGG CCTGGGCACT CTCACTOACG TGGCCTGTCT CCAGATCCCT GTCTGATTTC

TGAATGTAAA GAGGCTTTTT GTTTTGTTTT TGTTTTTGTT TTTAGAAGCA GTTCGTAGTA TTTGAAAGAA

TAAATCAAGT TTTGATTATG CTATAGGTTG ATTTTTGTGT TGATCCAAAT CAGAATAGCT ATTGAGTGTT

TAAGTOATGA


33




Figure 1 10. The Genomic Sequence for Murine P 1, 4-galactosyltransf erase.

Nucleotide sequence of cDNA encoding GalTase, as reported by Shaper et aL, 1988, is found at marine chromosome 9p2l. Two putative start ATG coons that correspond to the long (cell-surface) and short (Golgi) forms of GalTase are shown. The underlined sequence is the putative transmembrane domain while the bold underline regions depict the upstream (5) and downstream (3') primers, which produce a 673 bp product. Additionally the putative TAG stop codon and the restriction site for Ava 11 that produces a single cut within the predicted RT-PCR product ( I. ) are shown. The highlighted sequence within the shaded open reading frame corresponds with the DNA gel sequence on

page 71, confirming the fidelity of our primers.





33

Subsequent reports from the same laboratory demonstrated that the gene encodes two similar, but not identical proteins (Russo et al., 1990).

The long form of the gene encodes for a 402 amino acid protein while the short form encodes for a 389 amino acid protein. The two GalTase proteins have identical catalytic and transmembrane domains, but differ in their cytoplasmic domains as a result of two in-frame putative start sites. Teasdale et al. reported that approximately ten percent of the total cellular GalTase is expressed on the cell-surface as determined by flow cytometric data of stablely transfected cells (Teasdale et al., 1992). The transmembrane domain of the shorter, more abundant 389 amino acid protein, contains the signal and required cysteine and histidine residues for retention in the Golgi (Nilsson et al., 1991; Aoki et al., 1992 Teasdale et aL, 1992) while the long form with its unique 13 amino acid extension is transported to the cell-surface (Lopez et al., 1991).

Cell-surface GalTase.

GalTase has been suggested to play a role in many different biological functions when localized to the plasma membrane. GalTase is thought to be involved in cell-cell activities such as fertilization (Shur and Neely, 1988; Shur and Hall, 1982a; Shur and Hall, 1982b; Lopez etal., 1985; Benau and Storey, 1988; Benau et al., 1990) and proliferation through the EGF-R:GT interaction (Purushotham et al., 1992a; Kidd etal., 1991; Marchase et al., 1987, 1988); and cell-matrix interactions with neurite outgrowth (Begovac and Shur, 1990; Thomas et a/., 1990; Riopelle and Dow, 1991; Begovac et al., 1991),





34

mammary epithelial cell reorganization (Barcellos-Hoff, 1992), and collagen attachment (Babiarz and Cullen, 1992). While most of the research has been directed toward investigating GalTase's role in cell migration (Eckstein and Shur, 1989 Eckstein and Shur, 1992; Runyan etal., 1986 Runyan et al., 1988; Shur, 1983; Shur, 1977; Hathaway and Shur, 1992) it is clear cell-surface GalTase has the potential to be involved in a variety of different cellular functions.



GalTase's Role in Development

As previously stated more than 100 glycosyltransferases have been isolated, yet the focus continues to be on GalTase. The prime reasons for interest in GalTase is two fold. First was the preferential localization of GalTase on migrating or developing cells (Shur, 1977). The second reason was evidence of specific elevation of GalTase activity levels in mutant mouse sperm cells (Shur and Bennett, 1979; Shur, 1983). They found that sperm cells with a mutation in the T/t-complex on chromosome 17 lead to increased cell-surface GalTase expression. These sperm were developmentally immature and it interfered with normal fertilization. It has also been shown that metastatic cells demonstrate increases in cell-surface GalTase when compared to their non-metastatic variants (Chatterjee and Kim, 1977; Maga et al., 1997).





35

Cell-cell interactions.

Researchers have continued to investigate the potential that GalTase may play a role in growth and development since Roseman reported cellsurface expression of GalTase and described its cellular interactions (Roseman, 1970). Some discussion ensued when researchers demonstrated that UDP-Gal (the nucleotide sugar for galactose) inhibited growth of cultured cells (Roth et al., 1977; Klohs et al., 1982). Roth had initially suggested that this contact inhibition was a result of cell-surface GalTase. Klohs and coworkers later demonstrated that this inhibition was associated with GalTase in serum of their cultures.

The specific recognition and binding of cell-surface GalTase to their glycoconjugate substrates (GIcNAc residues) on adjacent cell-surfaces suggested GalTase may play a role in cell-cell adhesion. This was later confirmed by Scully and co-workers, when they demonstrated spatial and temporal expression of cell-surface GalTase during mouse spermatogenesis (Scully et a., 1987). This group showed there was a 77-fold increase in relative density of cell-surface density of GalTase at the anterior portion of a sperm head that was associated with an egg cell-surface glycoprotein. The stability of this GalTase:substrate complex was ensured because sugar nucleotides are typically absent in the extracellular fluid. The sperm-egg adhesions could be dissociated however by the addition of UDP-gal which catalytically separated the sperm GalTase from its galactosylated substrate





36


















GIcNAc residue
alTase















Figure 1 11. Potential Mechanisms for GalTase Cell-Cell Interactions.
Schematic representation of the potential association of cell-surface GalTase in cell-cell interactions as described by Shur, 1991. The cellsurface GalTase on each cell recognize GIcNAc residue substrate on
adjacent cells and binds in a lectin like fashion.





37

(Shur and Neely, 1988). Shur suggested a model for this potential lectin-like capacity of GalTase (Figure 1 11). Numerous researchers have now confirmed, in a variety of different cell types, that GalTase does function in cellcell interactions. Table 1 3 is a partial listing of these tissues and researchers.

Cell-surface receptors for GalTase interaction.

Indirect immuno-fluorescence has localized GalTase to areas of intercellular contact in most of the tissues listed. More detailed analysis of GalTase substrates in F9 cells lead Maillet and Shur (Maillet and Shur, 1993) to conclude that there were three dominant substrates. One substrate is LAMP-i, a membrane glycoprotein previously thought to be expressed only on lysosomes. LAMP-1 was isolated however from cell surfaces in tissues that were in various stages of tumor metastasis (Chen et al, 1985). A second major substrate of GalTase was found to be a cadherin member of the cell adhesion family, uvomorulin, that is known to mediate intercellular adhesion in homotypic tissues (Kemler et al., 1989). The third dominant substrate of cell-surface GalTase is laminin (Mecham, 1991). This suggests that multiple cell adhesion molecules and their substrates may cooperate to achieve their desired result.



A Role for GalTase in Cellular Proliferation

The previously described research indicates that GalTase participates in a lectin-like capacity to mediate cell-cell and cell-matrix interaction by





38






Studies Evaluating the Role of GalTase
in Cell-Cell Interactions

Cell Interaction Researcher, Report Date


Spermatocyte Pratt et al., 1993

Embryonal carcinoma Shur, 1983; Maillet and Shur, 1993

Morula compaction Bayna et al., 1988

Uterine epithelium Dutt et al., 1987

Ectoplacental cone Hathaway et al., 1989

Neural retina Roth etal., 1971

Condrogenic condensation Chatterjee etaaL, 1978 Shur, 1983

Growth control Roth and White, 1992;
Humphreys-Beher et al., 1987; Purushotham et al., 1992a




Table 1 3. Summary of research evaluating GalTase's role in cell-cell
interactions. A wide variety of different cell types have been
investigated.





39

binding to GlcNAc substrates on surface or matrix glycoproteins. Cell-surface GalTase has also been implicated as a participant in cell division by its association with the Epidermal Growth Factor Receptor (EGF-R) suggesting GalTase may play a more active role in proliferation. GalTase and the epidermal growth factor-receptor.

Salivary gland acinar cell growth, regulated by cell-surface GalTase, is thought to occur by the activation of the phosphotyrosine second messenger signaling pathway that is initiated by receptor intrinsic tyrosine kinase activity through interaction of the transferase with the carbohydrate moieties of the epidermal growth factor receptor (EGF-R) (Purushotham et al, 1992b). GalTase does not appear to directly mediate signal transduction itself but rather utilizes the EGF-R pathway (Nakagawa etal., 1991) (Figure 1 -7).

Chronic administration of the (3-adrenergic receptor agonist, isoproteronol (ISO), results in hyperplastic and hypertrophic gland enlargement (Schneyer, 1962). The Humphreys-Beher laboratory first demonstrated that this chronic ISO treatment also resulted in increased messenger RNA (mRNA) expression for GalTase (Humphreys-Beher et al., 1984) and that ultimately hyperplastic and hypertrophic gland enlargement and acinar cell growth in vivo and in vitro was dependent on surface expression of the enzyme (Marchase et al., 1988).

GalTase interacts with the carbohydrate moiety of the EGF-R and stimulates the tyrosine phosphorylation cascade which ultimately leads to cell division. Antagonists of this process include specific GalTase substrates, or





40

antibody to the EGF-R which have been shown to inhibit gland enlargement by steric hindrance between cell surface GalTase and EGF-R, thus interfering with the intra-cellular or intercellular signals for growth and thus inhibit cell proliferation (Humphreys-Beher etal., 1987).

The targeting of GalTase to the cell surface is associated with the expression of a novel kinase, the GalTase-associated kinase (GTA-kinase or GTA-K), which specifically phosphorylates GalTase. Previous reports by Kidd et al., and Macauley et al., demonstrated that there is a peak in expression of GTA-kinase associated with morphogenic development of fetal mouse submandibular glands at fetal day 16 (Kidd et al., 1991; Macauley et al., 1997). Thus the association of the cell-surface expression of GalTase and the onset of morphodifferentiation of salivary glands as a possible mediator of growth control has lead to this research. GalTase as a cell adhesion molecule.

Over the last few years evidence has clearly implicated a role for cell adhesion receptors in signal transduction processes that lead to regulation of cell growth and differentiation (Rosales et al., 1995). Typically this signal transduction has involved both cell adhesion molecules (CAMs) as well as integrins, both of which have been shown to involve activation of tyrosine kinases (Juliano and Haskill, 1993). CAMs role in signal transduction have been shown to be closely associated with cytoskeleton. Previous reports have shown GalTase to be associated with actin cytoskeleton elements during migration of cells on laminin surfaces (Appeddu et al., 1991, Appeddu and





41

Shur, 1994). CAMs, integrins and apparently GalTase allow anchorage of the cell to the extracellular matrix and initiates various signal transduction processes. Integrin or CAM mediated signaling can affect cellular events including motility, cell division, differentiation and apoptosis (Howe et al., 1998; Gullberg and Ekblom, 1995; Juliano, 1996; Yao etal., 1996; Woodard et al., 1998).

GalTase's role in cell-matrix interactions.

The finding of increased GalTase expression on the surface of virtually all migrating cells in both mouse and chick embryos, with its surface expression correlating with the onset of migration (Shur, 1977), suggested that GalTase may also participate in cell-matrix interactions. GalTase also functions as a receptor for ECM components, specifically laminin (Scully et al., 1987; Mecham, 1991). Laminin, unlike other components of the extracellular matrix contains GIcNAc residues. Fibronectin contains no such residues and thus demonstrates no such GalTase substrate activity. The GIcNAc residues of laminin have been shown to be an excellent substrate for GalTase (Stryer, 1988) and induces a 3-fold increase in surface GalTase expression on the lamellipodia facilitating cell spreading and migration (Eckstein and Shur, 1989). This interaction of GalTase with ECM has been shown to be associated with the cytoskelton. GalTase is not involved in the initial cell adhesion to laminin (Hynes, 1987). The initial cell attachment to laminin is mediated by other receptors, such as the integrins (Hall et al., 1990). Shur suggested a model for this GalTase associated adhesion and migration (Shur,





42

1983). In his model the adhesion of the cell to the membrane occurs via enzymatic binding of GalTase to the GIcNAc residues of the ECM laminin (Figure 1 12). Studies such as these, has suggested that GalTase may play a more active role than initially thought in the processes of morphodifferentiation and ultimately cytodifferentiation. Table 1 4 is a partial listing of these tissues/cells and researchers.



Statement of the Problem

A paradoxical situation now appears to exist where specific integrins are known to cause cellular attachment to laminin and this may be tissue specific. Simultaneously GalTase is also known to bind to laminin via GIcNAc residues in a lectin like fashion. Confounding the situation, GalTase is known to induce activation of the phosphotyrosine second messenger signaling pathway that is initiated by receptor intrinsic tyrosine kinase activity through interaction of the transferase with the carbohydrate moieties of the EGF-R. Additionally, we now have evidence that EGF-R stimulation leads to phosphorylation events controlling intracellular signaling for cell growth. There now appears to be a dichotomy of activities during morphogenesis and cell migration in which GalTase may play a substantial role. To investigate this situation, a strategy was devised to first evaluate GalTase expression and activity during normal growth and development utilizing the murine salivary gland as a tissue model for development. To relate our information from in vitro to normal development we first evaluated a group of salivary proteins





43













colocalization of migrating cell
cell-surface G ...... clealTase
with cytoskeld ..et.. .. cell-surface Galase
actin fibrils

GIcNAc residues
on ECM

ECM













Figure 1 12. Model of GalTase Mediated Migration. A representation of
Shur's 1993 model for GalTase's role in adhesion and migration (Appeddu and Shur, 1994). The adhesion of the cell to the membrane occurs via enzymatic binding of GalTase to the GIcNAc residues of the ECM laminin. In this model new cytoskeleton associations are formed with GalTase and the rate of migration is inversely related to the cellsurface GalTAse concentration.





44







Studies Evaluating the Role of GalTase
in Cell-Matrix Interactions

Cellular Activity Researcher, Report Date


Trophoblast outgrowth Romagnano and Babiarz, 1990

Cell migration Eckstein and Shur, 1989, 1992;
Runyan etal., 1986, 1988; Shur, 1977; Shur etaL, 1983; Hathaway and Shur, 1992

Neurite outgrowth Begovac and Shur, 1990;
Begovac etal., 1991; Thomas etal., 1990; Riopelle and Dow, 1991


Mammary epithelium Barcellos-Hoff, 1992
reorganization

Collagen reattachment Barbiarz and Cullen, 1992





Table 1 4. Summary of Research Evaluating GalTase's Role in Cell-Matrix
Interactions. A wide variety of different cell types and activities have
been investigated.





45

including GalTase, and their mRNA expression during development as little investigation has occurred to describe the fetal expression of salivary proteins. Subsequently, we utilized the salivary gland rudiment in an organ system, to specifically evaluate the role GalTase may play, and potential interactions that may occur, between GalTase, laminin and the integrin receptor during development.













CHAPTER TWO
MATERIALS AND METHODS


Normal in vivo Development

To investigate the role of GalTase in fetal mouse salivary gland development we first examined some of the parameters associated with normal growth in vivo, as there is a paucity of information regarding this in fetal mouse salivary gland research and literature. Initially we defined some of the salivary gland proteins, including GalTase, and evaluated their expression during gestation and beyond. Having obtained the information on expression patterns associated with these proteins in vivo, it allowed us to evaluate how well the in vitro organ culture system we used mimics in vivo development, and to further elucidate role of GalTase.



Selection of Developmental Markers

To define some of the parameters associated with normal growth and development we decided to evaluate the mRNA expression of a variety of proteins associated with a differentiating mouse salivary gland including serous and mutinous, acinar, and ductal cells. Table 2 1 provides a list of the proteins we investigated. Each of the salivary developmental proteins that we evaluated will now be discussed in alphabetical order.



46





47


Amylase (AMY).

Amylase is a functional product of a differentiated salivary gland acinar cell and thought to be confined to parotid serous cells. Amylase is expressed in salivary glands, liver and pancreas tissue, the expression of which is determined by 2 separate genes; Amy-1 locus is transcribed in the salivary glands and liver, while expression of Amy-2 is limited to the pancreas (Schibler et al., 1982; Darlington et at, 1986). Amylase mRNA expression is reported to be coordinated with PSP levels and appears to remain at a constant ratio (Poulsen etal., 1986).

Cystatin (CYS).

Cystatin is the least investigated protein of those analyzed in this account, other than the experimental protein GalTase. Cystatin is a cysteine protease inhibitor which belongs to a family of mammalian cysteine proteinase inhibitors. Some reports suggest that cystatin may be temporally expressed during development and it may be absent in the adult (Cox and Shaw, 1992). Cystatin is inducible by ISO which activates the betaadrenergic receptor adenylate cyclase cAMP pathway (Hoffman et at., 1996). Cystatin was evaluated as a final differentiated functional marker of acinar cells of serous and mucinous glands. Epidermal growth factor (EGF).

EGF, as previously stated, was first isolated from submandibular glands of mice. It is now known that EGF is synthesized in the granular convoluted tubule or intralobular ductal cells of the salivary gland (Gattone et at., 1992;





48


Watson et al., 1985). In the mouse the majority of EGF is synthesized in the submandibular gland while in the human the main source of EGF is the parotid gland (Thesleff et aL, 1988) with no statistically significant sexual dimorphism (Dagogo etal., 1985). EGF immunocytological reactivity was first detected in 18 20 day postpartum mice (Salido et al., 1990) while EGF mRNA expression has been reported in fetal tissues (Gresik et al., 1997; Kashimata and Gresik, 1997). The EGF-R, on the other hand, appears to be expressed prior to the initiation of protein production and can be detected in the mouse at neonate day 10 (Durban et al., 1995). GalTase (GT).

GalTase has been described fully in Chapter One of this text. GalTase was the experimental protein that we were investigating. To date no one has characterized the expression and functionality of cell-surface GalTase during the development of the fetal mouse salivary gland. G3PDH.

The housekeeping gene glycerol 3-phosphate dehydrogenase (G3PDH) was utilized as our control standard for mRNA expression. Initial studies demonstrated that G3PDH provided a more predictable standardized expression during fetal gland development than did the previously used standard of 13-actin. Recent studies have indicated that very little G3PDH is membrane bound in the intact cell perhaps allowing better standardization of expression levels (Rich etal., 1984).





49


Lysozyme (LYS).

Lysozyme is thought to be a low level terminal salivary gland product of well differentiated acinar cells. Lysozyme is inherently an antimicrobial protein thought to have a role in maintaining the overall microbial levels. Lysozyme mRNA has been reported in the salivary gland of mice (Maga et al., 1994). Like cystatin and mucin, lysozyme was used to evaluated differentiated function of acinar cells from both serous and mucinous glands. Mucin (MUC).

Mucin is a terminal differentiated functional product from mucinous acinar cells of the submandibular and sublingual glands. It has been used previously to evaluate the functional development of fetal mouse salivary glands that were stimulated with glucocorticoids (Jaskoll et aL., 1994). In that study they found that glucocorticoid receptors were functional as early as fetal day 14 and that glucocorticoid administration stimulated acinar cell mucin production, as determined by immunolocalization, in glands of fetal day 17 mice. Another report demonstrated mucin localization even in the parotid gland tissues (Vreugdenhil et al., 1982). The production of mucin in the adult mouse appears to demonstrate a diurnal variation by as much as 20 fold, as determined by radioimmunoassay (Denny and Denny, 1984). Mucin also appears to have been well conserved throughout mammalian species (Pemberton et al., 1992). Mucin was used as a terminal differentiated functional marker for mucinous acinar cells.





50












Salivary Proteins Investigated

Cell type Serous Mucinous


Acinar AMY, CYS, LYS, CYS, LYS, MUC,
GT, PSP GT

Ductal EGF, NGF EGF, NGF











Table 2 1. Salivary Gland Developmental Proteins. The salivary gland
developmental proteins investigated in this report are listed and categorically divided based on cell and gland type; Amylase (AMY), Cystatin (CYS), Epidermal Growth Factor (EGF), GalTase (GT), Lysozyme (LYS), Mucin (MUC), Nerve Growth Factor (NGF), and
Parotid Secretory Protein (PSP).





51


Nerve growth factor (NGF).

NGF, much like EGF, is synthesized by the granular convoluted tubule cells and striated ductal cells of the mouse submandibular gland (Siminoski et al., 1993; Hazen-Martin et al, 1987). The mRNA expression of NGF also seems to parallel that of EGF (Wilson et al., 1986). NGF together with EGF may be used to evaluate ductal cell development. Parotid secretory protein (PSP).

PSP is a major secretory protein of the adult mouse and rat parotid gland, not the submandibular gland. As a secretory protein PSP is synthesized by the acinar cells (Shaw etal, 1986; Madsen and Hjorth, 1985). PSP was originally thought to only be transcribed and expressed in the parotid (Shaw and Schibler, 1986), however recent reports have found PSP transcripts in other tissues (Robinson et al., 1997; Oxford et al., 1998a). PSP is now known to be expressed in rodent submandibular tissues from fetal days out to 5 days after birth and then appears to be turned off (Mirels and Ball, 1992).



Messenger RNA Profile of Fetal Submandibular Gland Development

A concordance of mRNA expression, of a variety of developmental markers, and cell-surface GalTase activity during the fetal development of the submandibular gland was accomplished. This provided previously unpublished information regarding gestational molecular development and





52


cell-surface GalTase activity which was used to evaluate our organ culture system.

Collection of tissues.

Submandibular glands were harvested from pregnant female CD1 mice (Jackson Labs, Wilmington, MA) that had timed pregnancies. A minimum of 15

-20 submandibular glands were aspectically harvested by microdissection techniques utilizing a Zeiss (f = 125) fiberoptic stereo operating microscope (Carl Zeiss GBH, West Germany) from embryos at each gestational developmental day 13, 14, 15, 16, 17, 18, neonates, and adult. All procedures were performed in accordance with protocols approved by the Animal Care and Use Committee of the University of Florida. Exact time of morphologic development was confirmed by the methods of Kaufman and only morphologically correct specimens were used (Kaufman, 1994). Isolation of poly (A)' messenger RNA.

A distinct problem encountered in evaluating protein or mRNA expression in the fetal tissues or dissected organs is the minute quantity of sample obtained. The advent of reverse transcription polymerase chain reaction (RT-PCR) techniques provides a high level of sensitivity that allows detection of 0.1 to 1.0 pg of target sequences, which fortunately is the approximate size of an average mRNA molecule. Veres et aL first published reports of utilizing RT-PCR to amplify mRNA in a study evaluating the effect of point mutagenesis in the mouse ornithine transcarbamylase gene (Veres et aL, 1987). We utilized RT-PCR amplification of mRNA transcripts to provide a





53


concordance of fetal mouse submandibular gland development. Messenger RNA was isolated from harvested tissues with the Micro-Fast Track mRNA Isolation Kit described below (Invitrogen Corporation, Carlsbad, CA). Micro-Fast Track technique.

Tissues from each gestational day were pooled and then incubated for 15 20 minutes with 1 mL Micro-Fast Track Lysis Buffer preheated to 450C. A final 6 mM NaCI solution was obtained by the addition of 5M NaCI solution to each tube, then an oligo (dT) cellulose tablet was added. The RNA is then allowed to adsorb to the cellulose tablet for 15 minutes at room temperature using a rocking platform. The oligo-dT cellulose slurry with adsorbed poly(A) RNA was eluted with stock buffer, ethanol precipitated, resuspended in 100 pl sterile DEPC-treated water and quantified by absorbence at 260 nm using a LKB Biochrom UltraSpec Il spectrophotometer (Biochrom Corporation, Cambridge, England).



RT-PCR Procedures

DNA was synthesized from the mRNA isolated from each time period utilizing RT-PCR amplification. The use of RT-PCR techniques has become standard in research for expressing patterns of proteins and mRNA in tissue or cellular components. Figure 2 1 illustrates the scheme of RT-PCR technology employed during this investigation.





54




submandibular glands were harvested from mice fetal day 13, 14, 15, 16, 17, 18, neonate, and adult
harvested SMG .
I tissues are pooled


Isolation of mRNA rr with Micro-Fast Trac





Densitometric evaluation FT reaction of mRNA expression




Amplification of each of the
experimental salivary gland
developmental prteins $

PCR amplficaton




Separation with gel Polaroid photograph of
electrophoresis gel electrophoresis



control G3PDH
amplification
running in parallel !








Figure 2 1. The General Scheme for Semi-Quantification of mRNA. The
scheme utilized in these series of experiments to quantitate the mRNA (Tarnuzzer etal., 1996). Quantification of amplicons was accomplished
after scanning the polaroid photographs and the use of densitometry.





55


Design and synthesis of RT-PCR primers.

Oligonucleotide 5' and 3' primers for the determination of mRNA expression of the selected developmental markers were designed utilizing computerized sequence analysis of human, mouse and rat sequences available through GenBankTM (National Library of Science, Bethesda, MD) and synthesized at the University of Florida Sequencing Core Facility (Gainesville, FL). Primers were designed to span introns and produce amplified PCR products between 500 800 base pairs, and thus differentiate the amplification of mRNA from potential contaminating genomic DNA. The oligonucleotide primers designed, synthesized and utilized in these experiments are listed in Table 2 2. The location of the primers on the GalTase gene was illustrated in Figure 1 9. Standardized RT reaction.

A series of standardized 20 pl RT reactions were completed. Each reaction contained 1.5 mM MgCI2, 10 mM Tris-HCI (pH 8.3) buffer, 80 pM dNTPs, 50 U/mL human placental ribonuclease inhibitor, 200 U/mg RNA Maloney murine leukemia virus reverse transcriptase (MMLV-RT), from GeneAmp'R' (Perkin Elmer, Branchburg, NJ) and were incubated with 1.0 pg of isolated RNA at 250C for 10 minutes, 420C for 60 minutes and 940C for 5 minutes in a Biometra Uno-Thermoblock thermocycler (Biometra Incorporated, Tampa, FL).





56










RT-PCR Primers for Salivary Proteins


Protein 5' Primer 3' Primer Product Size

AMY TGCTGCTTTCCCTCATTGG TGCAAGATCCAGAAGGCCAGA 377

CYS GCCGTCCTGGGCGTGGCCTGG CTGGCGGTGCCCTCCAGAGCC 380 EGF TAAGCCGAGACCGGAAGTACT AGTCTGTTCCATCAAAATGCA 376 GT TCACAGTGGACATCGGGACAC CCACAATAAAAATACATAGGA 673

G 3 P D H TGAAGGTCGGTGTGAACGGATTTGGC CATGTAGGCCATGAGGTCCACCAC 983 LYS TCCTGACTCTGGGACTCCTCC TCAGACTCCOCAGTTCCGAAT 385 MUC GTATAAGATGTGCCCTCCAGG TAGGTATGGCTGTAGAGGTGC 385 NGF GCATCAGAAATCCAAGCGTCC TAACCCTTGTTGAAGCAGGCG 381 PSP ATGTTCCAACTTGGAAGCC GAGGGCAAGTTGTACCTG 382





Table 2 2. RT-PCR Primers Designed for These Experiments. The RT-PCR
primers that were designed and synthesized to use in these experiments evaluating the fetal mouse submandibular gland
development are listed with their expected product size.





57


Standardized PCR reaction.

Standardized 100 pL PCR amplification reactions were performed containing 50 pmoles of each of the oligonucleotide 5' and 3' PCR primers, 1.5 mM MgCl2, 10 mM Tris-HCI (pH 8.3) buffer, 20 pL of completed RT product and 0.5 pL Taq polymerase. Amplifications of the reagents for 50 cycles of 940C for 1.5 minutes, 590C for 2 minutes, 720C for 3 minutes was followed by 10 minutes at 720C for final extension of the product. PCR products were separated by agarose gel electrophoresis for visualization of cellular PCR amplicons.



Relative Quantification of mRNA Transcription Levels

Relative quantification for mRNA expression levels was obtained by comparative analysis of GalTase RT-PCR products to control G3PDH products using a densitometric analysis as described below. Separation and photographing of RT-PCR products.

RT-PCR products were separated on 1.5% high melting agarose (Fisher Scientific Incorporated, Pittsburgh, PA) gels containing 25 ng/mL ethidium bromide, at 75V constant current for 1.5 hours. At this point amplicons were clearly discernible. Each agarose gel was then photographed in a standardized manner for 1.5 seconds using a Polaroid MP-4 Land camera and Polaroid Type 57 film (Polaroid Corporation, Bedford, MA).





58


Relative quantification of RT-PCR products.

Polaroid photographs of the agarose gel separated RT-PCR products were then scanned on a Hewlett-Packard ScanJet llcx MP digital scanner (Hewlett-Packard Company, Rockville, MD). Band intensities were digitized using NIH-Image v 1.54 (National Institutes of Health, Bethesda, MD) as described by Tarnuzzer et al. (Tarnuzzer et al., 1996) to provide densitometric data, and were subsequently normalized for their nucleotide content. This provided a relative semi-quantification of product mRNA to a standardized expression of G3PDH mRNA.



Cell-surface GalTase Enzymatic Activity Profile of Developing Acinar Cells

Cell-surface GalTase enzymatic activity was also determined during normal development of the mouse submandibular gland. Acinar cells harvested from developing fetal submandibular glands at the same gestational time points (13, 14, 15, 16, 17, 18, neonate, and adult), were utilized to determine the cell-surface GalTase activity. Isolation of intact acinar cells.

Acinar cells were isolated according to a modification of methods described by Purushotham (Purushotham et al., 1992a). Submandibular glands from each time point were identified by gross morphology, dissected free of other tissues, pooled in a digestion solution containing 1X Hank's balanced salt solution (HBSS), DNase I Type II and Collagenase IV (Sigma Chemical Company, St. Louis, MO), and shaken in a 370C H20 bath for 15





59


minutes. The supernatant was then collected and placed in ice cold stop solution containing 1 mL sterile 1X HBSS and 2% fetal calf serum, then centrifuged at 200 x g in a Fisher Scientific centrifuge Model 26 KM (Fisher Scientific Incorporated, Pittsburgh, PA) to pellet isolated cells. Pelleted cells were then resuspend in 1X HBSS and cell density was determined by hemacytometry (American Optical Company, Buffalo, NY). Lactate dehydroqenase control procedures.

A lactate dehydrogenase (LDH) activity assay (Humphreys-Beher et al., 1984) was performed to confirm that isolated acinar cells were intact and that the GalTase activity determined represented activity from cell-surface localized enzyme not Golgi retained forms. These assays were run in duplicate utilizing a Lactate Dehydrogenase Procedure kit (Sigma Diagnostics Procedure No. 500, Sigma Chemical Company, St. Louis, MO).

The assay for lactate dehydrogenase colorimetrically determines the enzymatic activity. One mL pyruvate substrate (pyruvate 0.75 mM/L in buffer, pH 7.5 and 2X NADH [|-Nicotinamide adenine dinucleotide reduced form]) was added to a volume of 100,000 acinar cells at 370C. After exactly 30 minutes 1.0 mL of Sigma Color Reagent (2,4-dinitrophenyldyhydrazine 20% in 1 N hydrochloric acid) was added. The OD was determined spectrophotometrically at 525 nm after mixing gently for 20 minutes at room temperature with 10.0 mL 0.40 N Na(OH)2. The LDH activity of each sample was calculated from a standard curve that was generated for absorbence (OD) of varying concentrations of lysed cells to LDH activity. LDH activity was





60


measured in B-B Units/mL (Berger-Broida unit is amount of LDH that will reduce 4.8 x 10-4 mM of pyruvate/minute at 250C). Cell-surface enzymatic activity.

The GalTase activity was measured using a modification of an assay previously described by Humphreys-Beher et al. (Humphreys-Beher et aL, 1984). Intact acinar cells (100,000) were incubated with UDP-[14C]-galactose (Amersham Corporation, Chicago, IL), and ovalbumin as the oligosaccharide substrate. After incubation at 370C for 2 hours the reaction was terminated by the addition of ice cold trichloroacetic acid (TCA). After washing with 10% TCA and 95% EtOH, the precipitate was recovered on Whatman Glass Microfibre 1.5 [M diameter filters (Whatman Incorporated, Clifton, NJ) with a Millipore vacuum filtration system (Millipore Corporation, Bedford, MA). Filters were then placed in scintillation vials containing 10 mL ScintiVerse BD Cocktail (Fischer Scientific, Pittsburgh, PA), allowed to dark adapt for not less than 30 minutes before the recovered 14C was determined on a Beckman LS 3801 Beta Spectrometer scintillation counter (Beckman Instruments Incorporated, Schauberg, IL).



Histologic and Immunohistochemical Evaluation of Development

Immunohistochemical detection of GalTase was performed as previously described by Yamamoto and co-workers (Yamamoto et aL., 1997). Salivary glands were dissected from representative fetal developmental days





61


13 and 17 and embedded in paraffin for histologic and immunohistochemical analysis. Standard 5 micron sections were cut from embedded tissues from each day, placed on clean glass slides and standard histologic examination of the sections was performed after staining with hematoxilin and eosin. Additional sections were deparaffinized through a series of graded alcohol washes, then washed for 5 minutes with phosphate-buffered saline (PBS, pH 7.1), for immunohistochemical analysis. Sections were incubated at room temperature for 1 hour with normal goat serum for blocking and then washed again with PBS prior to a 2 hour incubation with the primary antibody (Sepharose gel exclusion chromatography purified, mouse anti-human GalTase monoclonal IgG antibody, a generous gift from Dr. Kurt J. Isselbacher, Department of Medicine, Harvard Medical School, Boston, MA). The cross reactivity of this particular antibody with mouse and rat antigen has been previously reported (Podolsky and Isselbacher, 1984). Further incubation with goat anti-mouse biotinylated secondary IgG antibody was followed by a series of PBS washes prior to further incubations with ABC reagent (streptavidin horseradish peroxidase produces the avidin biotinylated complex). Chromatogenic reaction was developed by addition of DAB (3,3'Diaminobenzedine) for 5 10 minutes. Finally, sections were rehydrated through a series of graded alcohol washes. The immuno-stained sections and standard histologic sections were then photographed at 1 OX with an Olympus BH-2 microscope (Olympus Camera Incorporated, Flushing, NY) with and without Normarski interference contrast optics, respectively, using KodaColor





62


35mm Print Film ISO 100/210 (Eastman Kodak Company, Rochester, NY) at constant aperture and exposure (Figure 2 2). Control sections were stained after incubation with normal mouse nonimmune serum, antibody IgG isotype control, and without addition of primary antibody.



Flow Cytometric Evaluation of Cell-surface GalTase During Development

Flow cytometry of 10,000 fetal mouse salivary gland acinar cells was also utilized to evaluate alterations in cell-surface GalTase expression from representative developmental days. Again, fetal mouse salivary gland acinar cells were harvested from anatomically correct representative developmental days 13 and 17. Monoclonal anti-GalTase IgG antibody (and control nonimmune normal mouse serum) were added at a concentration of 1:20 dilution of the initial solution. The incubation was carried out on ice and in the dark for 30 minutes, washed three times in a 10 mL volume of fetal calf serum containing buffer, and then centrifuged at 500 X g for 10 minutes at 40C. FITC (fluoroscein isothiocyanate-conjugated) labelled anti-mouse IgG antibody raised in goat (1:20) was then added to the cells. Cell-surface labeling of fetal submandibular gland acinar cells was confirmed by use of a Becton-Dickinson FACStar fluorescence-activated cell sorter with a 2W argon ion laser at a wavelength of 488 nm (Becton Dickinson Company, Franklin Lakes, NJ). Cells incubated with normal mouse nonimmune serum, antibody IgG isotype control, and without addition of primary antibody served as controls.







63





tissues are pooled and fixed
--- .. .O/N in 4% paraformaldehyde 13d fetal SMG
tissues are harvested

tissues are dehydrated in series of ethanol washes and xylene then embedded in paraffin




I

z:!ii;:;:ii:i:i:i::::::!i:i.... ~ i .... ...

paraffin blocks were sectioned at 5 microns and dried slides were rehydrated with 3% H202 blocking of nonspecific binding with normal goat serum




...... ..:ii::iii:i iiii:i~ ...... .

incubate sections with primary antibody (anti-GalTase IgG antibody) for 2 hours
then wash 3 X with PBS


I



incubate sections for 1 hour with biotinylated secondary antibody
(goat anti-mouse IgG)
then wash 3 X with PBS






incubate sections with streptavidin horseradish peroxidase (ABC) then stain with DAB for 5 10 minutes wash sections with water dehydrate in graded alcohol and xyxlene coverslip and photograph




Figure 2 2. The General Scheme for Immunohistochemistry. The flow chart
above provides the general scheme of the immunohistochemical
analysis used in these studies (Yamamoto etal., 1997).





64


Organ Culture (in vitro) Development

To evaluate the role of GalTase in fetal mouse submandibular gland development we chose to utilize a mouse organ culture system. Rodent salivary gland organ cultures have been used for many years in the evaluation of growth and development (Borghese, 1950; Grobstein, 1953a, 1953b, 1953c; Lawson, 1970, 1972, 1974; Bernfield and Banerjee, 1972a, 1972b, 1982; Bernfield and Wessells, 1970; Bernfield etal., 1984; Cohn et aL, 1977; Spooner and Faubion, 1977, 1985, 1986).



Fetal Salivary Gland Organ Culture System

Female CD1 mice were again used to provide timed pregnancies. Submandibular glands were harvested from embryos, with the approval of the Animal Care and Use Committee of the University of Florida, at morphologically verified day 13 of gestational development, by microdissection techniques as described above.

Each submandibular gland harvested was cultured separately in a 11.3 mm diameter well of a 48 well polystrene culture plate without coating (Costar Corporation, Cambridge, MA) or in a well of a 48 well culture plate coated with mouse laminin (Biocoat Cellware, Bedford, MA). Organ cultures were maintained at 37)C and 95% 02 / 5% CO2 in a Forma Scientific 1600 automatic incubator (Forma Scientific Incorporated, Marietta, OH). Each well contained 0.75 mL of warmed (37C) Filton-Jackson modified BGJb media (Gibco BRL, Grand Island, NY), a chemically defined media, supplemented





65


with L-glutamine, 50 Units pen/strep/mL and 25 mg ascorbic acid/50 mL as previously described by Jaskoll etal. (Jaskoll et al., 1994). The organ culture system was continued for 60 hours with the addition of 0.50 mL fresh, warmed, sterile media every 24 hours.



Selection of Organ Culture Perturbants

The evaluation of GalTase's role in development was assessed by addition of different GalTase or laminin specific substrates to the media. Additions to the media included; nothing, 1X PBS, ca-lactalbumin, anti-laminin and anti-GalTase antibodies, and tyrphostin; additionally 15 laminin wells were pretreated with bovine galactosyltransferase. Each of these agents is described below.

Alpha-lactalbumin.

The use of the protein modifier, ca-lactalbumin, has been described previously as a specific inhibitor of 131,4-galactosyltransferase activity (Roth et al., 1971a, 1971b; Chatterjee et al., 1978; Shur, 1984; Humphreys-Beher et al., 1987). Alpha-lactalbumin is a substrate modifier protein that conformationally prevents GalTase from binding to the specific enzyme substrate GIcNAc. Alpha-lactalbumin (Sigma Chemical Company, St. Louis, MO) has been utilized by numerous investigators to limit cell-surface GalTase's activity. We used 5 mg/mL c-lactalbumin (- 1 mmol/L) as described





66


by previous investigators (Barcellos-Hoff, 1992) as a perturbant in our culture system.

Anti-GalTase antibody.

The anti-GalTase antibody utilized in these experiments was a mouse anti-human GalTase, affinity purified, monoclonal IgG antibody (Dr. Kurt J. Isselbacher, Harvard Medical School, Boston, MA). Preliminary studies, including parallel nonimmune serum controls, were used to determine the optimal concentration (1:20) that was necessary to disrupt development in the culture system of these studies.

Anti-laminin antibody.

Anti-laminin antibody added to the media in these studies was a rabbit anti-mouse laminin, al and 31 chain, polyclonal IgG antibody (Upstate Biotechnology Incorporated, Lake Placid, NY or Chemicon International Incorporated, Temachula, CA). Anti-laminin antibody was also added to the media at a 1:20 dilution.

Pretreatment.

Bovine GalTase (Sigma Chemical Company, St. Louis, MO) and UDPGal was used to modify the terminal GIcNAc residues of laminin in the coated wells. Each laminin coated well was incubated for 2 hours at 370C with 1/10 Unit bovine galactosyltransferase (= 20 jig/mL) and 2 mmol/L UDP-Gal (Sigma Chemical Company, St. Louis, MO), washed 3 times with sterile PBS immediately prior to adding 0.5 mL of warmed, filter sterilized BGJb media and





67


the organ for culturing. The manufacturer reports that one unit of bovine galactosyltransf erase will transfer 1.0 Rmole of galactose from UDPGal/minute at pH 8.4 at 300C.

Tyrphostin.

Tyrphostin-1 was added to the media to evaluate the relationship between GalTase and the integrin receptor by blocking the tyrosine kinase signal transduction events. Tyrophostin-1 is a specific EGF-R tyrosine kinase inhibitor, ([4-methoxybenzlidene] malononitrile; Sigma Chemical Co., St. Louis, MO) and thus inhibits EGF-R signal transduction events (Glaser et al., 1993; Yura et al., 1995). Again preliminary studies were employed to determine the optimal concentration (1:50) needed to block development in vitro compared to control cultures.

Controls.

Five organs were cultured with the addition of nothing or sterile 1 X PBS to the media, for each experiment. These organs served as the controls for morphometric comparison. Figure 2 3 diagramatically provides the overall scheme utilized in these studies.



Evaluation of Organ Culture System Experiments

Five glands were cultured with each condition for the morphologic evaluation of the culturing experiments, and photomicrographs were obtained as described below. A minimum of 2 glands, cultured in parallel, without the






68






13d fetal SMG tissues are harvested

13d fetal 8MG .






+ Ln + Ln + Ln + Ln + Ln + Ln + Ln Ln
+0 + PBS + aLa + Ab-Ln + Ab-GT + tyro-P + pretx +0


5 x 13d fetal mouse SMG were cultured in each condition for x 60 h in
BGJb media. Photomicrographs were obtained at 0, 12, 24, 36, 48
and 60 hours





organ culture tissues
were pooled








mRNA collected for RT-PCR fl acinar cells were isolated for cellbased quantificationJU surface GalTase activity assay






Figure 2 -3. The General Scheme for Organ Culture. This diagram
represents the general scheme of the fetal mouse salivary gland
organ culture system used in these series of in vitro experiments.





69


addition of a modifying agent, served as controls for each experimental condition. Each experiment was reproduced on 3 separate occasions. Eighteen glands were cultured with each condition for the evaluation of mRNA expression patterns and cell-surface GalTase enzymatic activity. Pooled tissues were collected from 3 glands at each time point, and utilized for evaluation. A minimum of 2 glands were again cultured in parallel, without the addition of a modifying agent, to serve as controls and each experiment was reproduced on 3 separate occasions.

Morphologic evaluation.

Photographic documentation of gland morphogenesis was obtained at 1OX magnification using a Nikon ELWD 0.3 inverted photomicroscope (Nikon Incorporated, Instrument Division, Garden City, NJ) and KodaColor print film at 0, 12, 24, 36, 48, and 60 hours.

Messengqer RNA profile.

Messenger RNA was harvested from pooled tissues utilizing the MicroFast Track system as previously described in this text (page 50), and RT-PCR amplification of GalTase was accomplished. Quantification of GalTase mRNA was obtained for each culturing time point. Cell-surface GalTase enzymatic activity.

Acinar cells were isolated as described previously and the cell-surface GalTase enzymatic activity was determined for 100,000 cells. Control lactate dehydrogenase activity assays were also completed.





70


Statistical analysis.

Statistical analysis was completed by repeated analysis of variance (ANOVA) for general linear models with a value of p < 0.01, p < 0.02 and p < 0.05. The statistical computation was performed utilizing the SAS statistical system (SAS Institute Incorporated, Cary, NC).













CHAPTER THREE
RESULTS


Normal in vivo Development

Submandibular glands were harvested at fetal days 13, 14, 15, 16, 17, 18, neonate, and adult from CD1 mice, as described in the Materials and Methods. A minimum of 15 20 submandibular glands from each pregnant animal at each time point were collected for each procedure: mRNA quantification and cell-surface GalTase enzymatic activity assays. Separate animals provided glands such that experiments were repeated on 5 separate occasions.



Messenger RNA Profile of Fetal Submandibular Gland Development

Messenger RNA was obtained from the collected tissues with the MicroFast Track Isolation Kit and quantitated with a spectrophotometer. The concentration of mRNA collected from pooled tissues ranged from 94 pg/RL to 570 pg/[tL.



Determination of RT-PCR Preferred Conditions and Fidelity

Oligonucleotide primers for the selected salivary gland developmental markers were synthesized as designed. A series of RT-PCR reactions with


71





72


purified adult mouse RNA were completed to define the conditions that produced the most reproducible results. A variety of different conditions were evaluated and several components of these reactions emerged as critical factors. Maintaining a consistent MgCI2, concentration (1.5 mM in the RT and POR reactions) was a crucial component for consistent results. Additionally, as anticipated, the annealing temperature was also a critical factor in obtaining effective results. We utilized 5900 as a standard temperature for the annealing temperature during the PCR amplification procedure as it was effective with each set of primers to generate a single band.

Products from these reactions were separated by 1.5% agarose gel electrophoresis. Amplified DNA was extracted with a QlAquicko Gel Extraction Kit (Quigen Incorporated, San Clarita, CA) and evaluated by restriction endonuclease digestion analyses, DNA sequencing, and immunoblotting to ensure the fidelity of the newly constructed primers. Each primer set was confirmed to produce the predicted product. A replication of a portion of the DNA sequencing gel and restriction endonuclease digestion gel for GalTase products demonstrating the accuracy of the derived product is depicted in Figure 3 -1.



Relative Quantification of mRNA Transcription Levels

RT-PCH reactions with primer sets for each developmental protein was completed for each time point from fetal day 13 through adult. Simultaneously,






73









.., c e ~O Ae, a e c e \. S e c ur e oa c,, A A e9 c',k r' e 'e a




p tT T s o s 90--s
~e~\Ca V~ e0

A C G T T T


A A
04T T goe 0~c5

T T

T G
A A
C C
j G G
T T
C c undigested GalTase Ava II digested
C C RT-PCR product GalTase products
C C 1 2 3 4 5 6 78
o C
C C
A A G G
A A 673 575
T T G G C C C C
-.-C C
A A
G G 98
G G G Go
T T G G
A A
Q G G
T T G G
T T A A
SA A
C C



Figure 3 1. Confirmation of GalTase RT-PCR Products. Panel A represents
a portion of the DNA sequencing gel obtained by polyacrylamide gel
electrophoresis of the gel extracted RT-PCR product from the GalTase
reaction confirming the GalTAse sequence as illustrated on page 32 of
this text. Panel B represents the agarose gel electrophoresis
separation of the restriction endonuclease digested product of the
GalTase RT-PCR product confirming the appropriate sized product for
GalTase.





74


RT-PCR amplification of G3PDH was accomplished in parallel with each experiment for comparative analysis. RT-PCR reactions were repeated on 5 separate occasions. Polaroid photographs of the separated RT-PCR product served as the raw data.

Quantification of mRNA expression was completed by scanning each polaroid photograph and digitizing the intensity of each amplicon with the NIH Image v 1.54 program.

An example of the calculation of the ratio of the GalTase / G3PDH mRNA for the 13 day amplicon of Figure 3 2 follows. The polaroid photograph (Figure 3 2 is a reproduction of same) of the gel electrophoresis separated RT-PCR reaction product was scanned, and the intensity of the 13 day amplicon was digitized to provide densitometric data. The area of this amplicon was determined to be 326 (Table 3 1) while the control amplicon was determined to be 277 units. The area was then normalized by dividing each area by the number of amino acid residues of their respective product (326 /673 = 0.484 for GalTase; 277 /983 = 0.282 for G3PDH ). The ratio of GalTase / G3PDH was then determined by dividing normalized GalTase by normalized G3PDH (0.484/0.282 = 1.719 ) which gave a ratio of GalTase to G3PDH per reaction. Conceivably this ratio could be extrapolated to a copy number per cell based on the report by Bradhorst and McConkey of a mean total RNA per mammalian cell of 26 pg (Bradhorst and McConkey, 1974) and reported copies of G3PDH mRNA per cell. For the purposes of these experiments however this was not necessary.





75
















z
z
E z >
Z TT





mG3PDH 983










Figure 3 2. Gel Electrophoresis Separation of GalTase RT-PCR Products.
The gel electrophoresis separated products of the RT-PCR reaction completed for GalTase are demonstrated here. In the upper panel, Lane 1 represents the negative control lane (RT-PCR reaction run without any sample RNA); Lanes 2 8 represent fetal days 13 18; Lane 9 was a positive control lane, RT-PCR reaction with liver RNA (a
rich source of GalTase).
The lower panel demonstrates amplicons from the control RTPCR reactions of the same tissues, at the same time points, for the
housekeeping gene G3PDH.





76









i Me GT. GT1673, G3,PDH G3 1983 GT IG3

0 RINA 0.000 0.000 0.000 0.000 0.000

13 d 326.000 0.484 277.000 0.282 ~7$?

14 d 398.000 0.591 315.000 0.320 i4.

15 di 432.000 0.642 302.000 0,307 29 16 d 734.000 1.091 329.000 0.335 ~~5%

17 d 569.000 0.845 359.000 0.365 18 di 509.000 0.756 374.000 0.380

U14 740.000 1.100 319.000 0.325

Liver RNA 756.000 1.123 281.000 0.286 3.930




Table 3 1. Calculation of Semi-Quantitative GalTase Expression. This table
represents the data and calculation of normalized amplicon intensity of the RT-PCR reaction depicted in Figure 3 1. Time points evaluated are fetal days 13 18 and neonate animals (NN). As previously stated no mRNA (0 mHNA) served as the negative control and liver tissue was used for the positive control. The area of each amplicon is seen (Column 1 and 3), normalized for their respective amino acid length (Column 2 and 4) then a ratio generated for GalTase / G3PDH per
reaction and time point (Column 5).





77


As previously stated, these experiments were repeated on 5 separate occasions, and these ratios from each time point, for each mRNA were averaged. Figures 3 3 through 3 10 represent the averaged results of the 5 data sets for each of the developmental protein mRNA evaluated. Each panel consist of a negative control lane (1), where no mRNA was used in the RTPCR reaction, as well as a positive control lane (9), utilizing adult mouse liver mRNA. Lanes 2 8 represent the results from RT-PCR reactions with mHNA from fetal days 13 18, and neonate, respectively.

Examination of the mRNA data presented in the previous figures demonstrated an overall trend of increased salivary protein mRNA transcription, relative to G3PDH, over the developmental time periods evaluated. Additionally, when considering the prenatal development days only (fetal day 13, 14, 15, 16, 17, and 18) 7 of 8 proteins demonstrated a expression peak at fetal day 16. Contradictory, only amylase expression demonstrated a peak at fetal day 18. While most of these salivary proteins did demonstrate a peak at fetal day 16 only GalTase and mucin demonstrated a degree of statistical significance (P < 0.05).

Proteins associated with ductal tissues (EGF and NGF) appeared to have a consistent expression pattern throughout development while those proteins associated with acinar cell terminal differentiation (amylase, cystatin, lysozyme and mucin) appeared to show a trend of increased expression as the tissues matured. GalTase expression followed the general pattern of increasing expression with tissue maturity.





78














10 9
8 O AMY/G3PDH(1)
z
M: 7
E O AMY/G3PDH(2)
6
0 AMY/G3PDH(3)
0.
5
4O A AMY/G3PDH(4)
zmo
a3 AMY/G3PDH(5)
2 A AMean
2
11

0


o "a >
0 z

Time




Figure 3 3. Developmental Expression of Amylase mRNA. This graph
represents the amount of amylase mRNA produced relative to G3PDH.
Lane 1 is a negative control (RT-PCR reaction using no mRNA) while Lane 9 is a positive control (RT-PCR reaction using adult mouse liver mRNA). Each graph represents the average of 5 separate experiments and the bars represent the mean for each time point (fetal days 13 18,
neonate [NN]).
During the fetal days there is minimal transcription of the
amylase gene. There is a 230% increase in transcription from fetal to neonate time periods. This data corroborates previous reports that
amylase production parallels PSP (Poulsen etal., 1986).





79














10 9

8 CYS/G3PDH(1)
z
a1 7E 0 CYS/G3PDH(2)

S6
0 CYS/G3PDH(3)
a
oA CYS/G3PDH(4)
4
"3 CYS/G3PDH(5)
E
( 2 Mean


0'
z z z
oZ ce. P,0 r4

E E Ei E E e E E E v"a >

Time




Figure 3 4. Developmental Expression of Cystatin mRNA. Cystatin mRNA
transcription rates, relative to G3PDH, in general are very low although there is a 214% increase from the neonatal stage to adult. Previous investigators had found a temporal expression pattern during development (Cox and Shaw, 1992). Fetal transcription rates
demonstrate a peak, albeit small, at day 16.





80













10

9

8 O EGF/G3PDH(1)
z
I 7: 7-0' EGF/G3PDH(2)
: 6
0 EGF/G3PDH(3)
5
~A
A EGF/G3PDH(4)
4
S3 EGF/G3PDH(5)
2 Mean

1
0

0 t--f0








Figure 3 5. Developmental Expression of EGF mRNA. Previous
investigators had reported EGF-R protein at neonate day 10, EGF at neonate day 18 20 (Salido et al., 1990), and EGF transcription in utereo (Kashimata and Gresik, 1997; Gresik et al., 1997). This report corroborates these findings. EGF mRNA, relative to G3PDH, represented the greatest overall transcription rate of all the proteins evaluated in this report. In general, EGF transcription rates paralleled those of NGF, another ductal product. Transcription in fetal days was almost 2 fold higher than the average of all the other proteins and also
reached an in utero peak at fetal day 16.





81














10

9

8- O GT/G3PDH(1)
z
7E O GT/G3PDH(2)
6
A 0 GT/G3PDH(3)
a.
5
4- 50 GT/G3PDH(4)
z
4-0

a 3- 0 GT/G3PDH(5)
E 3
2- [ Mean

1





-f in C 00 z

Time




Figure 3 6. Developmental Expression of GalTase mRNA. GalTase mRNA
transcription during fetal development tends to parallel those of ductal cell products, EGF and NGF, suggesting a role for GalTase during branching morphogenesis. A fetal GalTase mRNA transcription peak occurs at day 16, and there is small increase in transcription rates after
birth.





82













10 9
8 LYS/G3PDH(1)
z
S7
= 0 LYS/G3PDH(2)
6
a 6 0 LYS/G3PDH(3)
91
c 5
4 A LYS/G3PDH(4)
4
z 3 LYS/G3PDH(5)
E









Time
Figure 3 7. Developmental Expression of Lysozyme mRNA. Lysozyme







mRNA transcription, relative to G3PDH, was generally very low throughout fetal development. The finding of fetal lysozyme mRNA transcription confirms previous reports by Maga etal (1994). After birth the transcription rates increased significantly when compared to early
staes of development ( <0.01
1 A N




Time




Figure 3 7. Developmental Expression of Lysozyme mRNA. Lysozyme
mRNA transcription, relative to G3PDH, was generally very low throughout fetal development. The finding of fetal lysozyme mRNA transcription confirms previous reports by Maga et al. (1994). After birth the transcription rates increased significantly when compared to early
stages of development (p < 0.01).






83














10

9

S8 MUCIG3PDH(1)
z
r 7E MUC/G3PDH(2)
I 6a 0O MUC/G3PDH(3)
CL
., 5
A MUC/G3PDH(4) 4
z
3 3- MUC/G3PDH(5)
E
2 Mean
1


z z z z z z z z z
0 :
Z 7$ 71- 0 u

Time




Figure 3 8. Developmental Expression of Mucin mRNA. Mucin is a terminal
product of the well differentiated mucinous submandibular gland. Low transcription levels of mucin mRNA, compared to G3PDH, are seen during the fetal stage with significant increases found in the neonate compared to fetal day 18 (p < 0.05). Mucin mRNA was first detected at fetal day 15 which confirms reports of fetal mucin mRNA detection
(Jaskol etal., 1994).





84














10

9
8 NGF/G3PDH(1)
z
QC 7
E O NGF/G3PDH(2)
S6
0 0 NGF/G3PDH(3)
IL
cM 5
A NGF/G3PDH(4) S4
z
3- M NGF/G3PDH(5)
E
ii A mea
2 Mean
2



zz
041

z zz z z z z z



Time




Figure 3 9. Developmental Expression of NGF mRNA. NGF, like EGF, is a
product of the salivary granular convoluted duct cells (Gresik et al., 1985), and parallels EGF transcription as previously reported (Wilson et al., 1986), but lower at each time point. NGF transcription rates were generally elevated compared to terminal product transcripts (AMY, MUC, LYS) which appears to follow the general developmental scheme where nervous systems coupling follows morphogenesis and cytodifferentiation (Cutler, 1973). NGF and EGF are anticipated to decrease in adult ages (Gresik and Azmitia, 1980). NGF transcription
was the most constant of all the proteins evaluated.






85














10 9

< 80- PSP/G3PDH(1)
z
n- 7
: O PSP/G3PDH(2)
66 0 PSP/G3PDH(3)
5

A PSP/G3PDH(4) 44
z
3 PSP/G3PDH(5)

a- 2- Mean


0
1



Z
C4N C4C X C
0 z

Time




Figure 3 10. Developmental Expression of PSP mRNA. Initial reports
indicated that PSP was found in the parotid gland only (Madsen and Hjorth, 1985; Shaw et al., 1986; Shaw and Schibler, 1986). Recently investigators, using PSP specific antisera in Western blot analyses, localized PSP in the submandibular glands of neonate mice as well (Mirels et al., 1998). In our analysis no PSP mRNA transcription was detected in fetal gland tissues until fetal day 16 and only minute
amounts were found until the neonate stages and beyond.





86


Cell-surface GalTase Enzymatic Activity Profile

To evaluate cell-surface expression and activity of the protein we employed the GalTase enzymatic activity assay. Tissues were collected from each time point, 100,000 cells isolated and cell-surface GalTase activity evaluated on 3 separate occasions. Mean GalTase activity for the 3 experiments, was reported as nanomoles galactose incorporated / h / 106 cells. The lactate dehydrogenase (LDH) activity assay was performed simultaneously to determine leakage of cytoplasmic constituents. LDH activity was never > 5% of the LDH activity of the control lysed cells and was not considered significant. The results of the GalTase activity are reported in Table 3 2. Generally the cell-surface activity of GalTase seems to parallel the mRNA expression pattern seen during development. Again there was a peak at fetal day 16 although it does not appear as pronounced as the mRNA pattern and was not statistically significant (p < 0.05).



Histologqic and Immunohistochemical Analysis

Hematoxilin and eosin staining of representative fetal developmental days 13 and 17 demonstrate a general increase in architecture and organization (Figure 3 11). The fetal day 13 section demonstrated a few localized islands of acinar cells at the leading edges of glandular development and a few, but well developed, ductal structures throughout. By fetal day 17 the acinar cells have greatly proliferated and the glandular structure is a well defined network.





87










Cell-Surface GalTase Activity

Time Enzymatic Activity
(fetal days) (nm Galactose incorporated / 100,000 cells / hour)


13 d 0.0008t 0.0006

14 d 0.0013t 0.0004

15 d 0.0011 t 0.0002



17 d 0.0015 0.0005

18 d 0.0015 -. 0.0003
Neonate 0.0025 0.0010

Adult 0.0040 0.0006




Table 3 2. Cell-surface GalTase Activity. The cell-surface activity was
measured from 100,00 intact acinar cells from fetal day 13 18, neonate, and adult mouse submandibular tissues. The numeric values represent the amount of UDP-['4C]-galactose incorporated /100,000
acinar cells/ hour standard deviation.




Full Text
xml version 1.0 encoding UTF-8
REPORT xmlns http:www.fcla.edudlsmddaitss xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.fcla.edudlsmddaitssdaitssReport.xsd
INGEST IEID EV1XZRR1N_40FAUR INGEST_TIME 2014-08-28T21:47:33Z PACKAGE AA00025021_00001
AGREEMENT_INFO ACCOUNT UF PROJECT UFDC
FILES



PAGE 1

7+( 52/( 2) %(7$ *$/$&726
PAGE 2

7KLV GLVVHUWDWLRQ LV GHGLFDWHG WR P\ ZLIH ,VDEHOO DQG P\ FKLOGUHQ 0LWFKHOO $OOLVRQ DQG /HVOLH 7KH\ HDFK SURYLGHG PH ZLWK WKH VWUHQJWK WR FDUU\ RQ DQG FRPSOHWH WKLV FRXUVH RI VWXG\ 7KHLU VDFULILFHV ZHUH JUHDWHU WKDQ DUPLHV DQG WKHLU WHDUV VZHHWHU WKDQ ZLQH ZLOO IRUHYHU EH JUDWHIXO IRU WKHLU VXSSRUW 7KH LPSRUWDQW WKLQJ LV QRW WR VWRS TXHVWLRQLQJ &XULRVLW\ KDV LWV RZQ UHDVRQ IRU H[LVWLQJ 2QH FDQQRW KHOS EXW EH LQ DZH ZKHQ KH FRQWHPSODWHV WKH P\VWHULHV RI HWHUQLW\ RI OLIH RI WKH PDUYHORXV VWUXFWXUH RI UHDOLW\ ,W LV HQRXJK LI RQH WULHV PHUHO\ WR FRPSUHKHQG D OLWWOH RI WKLV P\VWHU\ HYHU\GD\ 1HYHU ORVH D KRO\ FXULRVLW\ $OEHUW (LQVWHLQ

PAGE 3

$&.12:/('*0(176 2YHU WKH SDVW IRXU \HDUV 'U 0LFKDHO +XPSKUH\V%HKHU KDV EHHQ P\ PHQWRU FROOHDJXH DQG IULHQG DQG ZLOO EH IRUHYHU JUDWHIXO IRU WKH XQZDYHULQJ VXSSRUW DQG JXLGDQFH KH DIIRUGHG PH 'U +XPSKUH\V%HKHU LQWURGXFHG PH WR WKH ULJRUV RI VFLHQFH WKH VLJQLILFDQFH RI FHUWDLQW\ DQG QHFHVVLW\ RI LQTXLU\ +LV LQVLJKW DQG GLUHFWLRQ ZDV LQVWUXPHQWDO DQG FUXFLDO LQ P\ FUHDWLRQ DQG GHVLJQ RI WKLV SURMHFW $GGLWLRQDO WKDQNV DUH GLUHFWHG WR WKH PHPEHUV RI P\ FRPPLWWHH 'U $UQROG 6 %OHLZHLV &KDLUPDQ RI WKH 'HSDUWPHQW RI 2UDO %LRORJ\ ZKR ZDV HVVHQWLDO LQ P\ VHHNLQJ DQ HGXFDWLRQ DW WKLV ILQH LQVWLWXWLRQf§'U %OHLZHLV KDV GHYHORSHG RQH RI WKH ILQHVW JURXS RI UHVHDUFKHUV DYDLODEOH DQ\ZKHUH 'U *UHJRU\ 6 6FKXOW] ZKRVH NQRZOHGJH DQG XQGHUVWDQGLQJ RI VFLHQFH LV RQO\ VXUSDVVHG E\ KLV SDVVLRQ IRU WHDFKLQJ DQG 'U :LOOLDP 3 0F$UWKXU ZKR VHOIOHVVO\ VSHQW FRXQWOHVV LQGLYLGXDO KRXUV GHYHORSLQJ P\ DSSUHFLDWLRQ RI WKH VFLHQFH DQG XWLOLW\ RI LPPXQRORJLF WHFKQLTXHV 1XPHURXV RWKHUV KDYH SOD\HG LQYDOXDEOH UROHV LQ WKLV SURFHVV 'UV -HII +LOOPDQ DQG $QQH 3URJXOVNH)R[ DV ZHOO DV WKH HQWLUH IDFXOW\ RI WKH 'HSDUWPHQW RI 2UDO %LRORJ\ ZHUH LQVWUXPHQWDO LQ P\ HDUO\ VWDJHV RI LQYHVWLJDWLRQ $GGLWLRQDOO\ WKDQN 'U 1DVVHU &KHJLQL DQG WKH HQWLUH VWDII RI

PAGE 4

WKH ,QVWLWXWH IRU :RXQG 5HVHDUFK DW WKH 8QLYHUVLW\ RI )ORULGD IRU DVVLVWDQFH ZLWK WKH LPPXQRKLVWRFKHPLFDO HYDOXDWLRQ RI VDPSOHV 'U $PHQ 3HFN RI WKH 'HSDUWPHQW RI 3DWKRORJ\ DQG KLV ODERUDWRU\ SHUVRQQHO HVSHFLDOO\ 0V -DQHW &RUQHOLXV WKDQN IRU WKHLU WLPHOHVV KHOS ZLWK FHOO LVRODWLRQ DQG IORZ F\WRPHWU\ 'UV 6KDZQ 0DFDXOH\ +HDWKHU $OOLVRQ DQG &KULV 5RELQVRQ DOVR SURYLGHG FRXQWOHVV KRXUV RI SHUVRQDO WXWHODJH GXULQJ WKLV FRXUVH 0U 0LFDK .HUU -DVRQ %UD\HU DQG $P\ 6KDZOH\ HDFK SURYLGHG PH ZLWK DGGLWLRQDO NQRZOHGJH FUXFLDO WR WKH FRPSOHWLRQ RI WKLV SURMHFW $OVR WKH PHPEHUV RI WKH +XPSKUH\V%HKHU ODERUDWRU\ WKDW PDGH WKH VHHPLQJO\ HQGOHVV GD\V DQG QLJKWVf DW WKH EHQFK HQMR\DEOH /DVWO\ DFNQRZOHGJH WKH VDFULILFH LPSDUWHG RQ P\ IDPLO\ GXULQJ WKLV SURFHVV ZLVK WR WKDQN P\ EHORYHG ZLIH DQG FKLOGUHQ P\ SDUHQWV P\ LQn ODZV P\ VLVWHU LQODZ 0RQD DQG P\ /RUG DQG 6DYLRU -HVXV &KULVW WKURXJK ZKRP DOO WKLQJV DUH SRVVLEOH ,9

PAGE 5

7$%/( 2) &217(176 SDJH $&.12:/('*0(176 LLL /,67 2) ),*85(6 YLOL $%675$&7 [L &+$37(56 ,1752'8&7,21 6DOLYDU\ *ODQGV )RUP DQG )XQFWLRQ RI 6DOLYDU\ *ODQGV $FLQXV DQG GXFWDO FHOOV 6HURXV DQG PXFLQRXV JODQGV 'HYHORSPHQW RI WKH 6DOLYDU\ *ODQG 0RUSKRJHQHVLV DQG F\WRGLIIHUHQWLDWLRQ )XQFWLRQDO FRXSOLQJ RI WKH VDOLYDU\ JODQG 5ROH RI (&0 LQ 6DOLYDU\ *ODQG 'HYHORSPHQW /DPLQLQ ,QWHJULQ FRPSRVLWLRQ ,QWHJULQV DV (&0 UHFHSWRUV ,QWHJULQV LQIOXHQFH RQ JURZWK *O\FRV\OWUDQVIHUDVHV 7KH JDODFWRV\OWUDQVIHUDVH *DO7DVH &HOO6XUIDFH *DO7 DVH *DO7DVHfV 5ROH LQ 'HYHORSPHQW &HOOFHOO LQWHUDFWLRQV &HOOVXUIDFH UHFHSWRUV IRU *DO7DVH LQWHUDFWLRQ $ 5ROH IRU *DO7DVH LQ &HOOXODU 3UROLIHUDWLRQ *DO7DVH DQG WKH HSLGHUPDO JURZWK IDFWRUUHFHSWRU *DO7DVH DV D FHOO DGKHVLRQ PROHFXOH *DO7DVHfV UROH LQ FHOOPDWUL[ LQWHUDFWLRQV 6WDWHPHQW RI WKH 3UREOHP Y

PAGE 6

0$7(5,$/6 $1' 0(7+2'6 1RUPDO LQ YLYR 'HYHORSPHQW 6HOHFWLRQ RI 'HYHORSPHQWDO 0DUNHUV $P\ODVH $0
PAGE 7

(YDOXDWLRQ RI 2UJDQ &XOWXUH 6\VWHP ([SHULPHQWV 0RUSKRORJLF HYDOXDWLRQ 0HVVHQJHU 51$ SURILOH &HOO6XUIDFH *DO7DVH HQ]\PDWLF DFWLYLW\ 6WDWLVWLFDO DQDO\VLV 5(68/76 1RUPDO LQ YLYR 'HYHORSPHQW 0HVVHQJHU 51$ 3URILOH RI )HWDO 6XEPDQGLEXODU *ODQG 'HYHORSPHQW 'HWHUPLQDWLRQ RI 573&5 3UHIHUUHG &RQGLWLRQV DQG )LGHOLW\ 5HODWLYH 2XDQWLILFDWLRQ RI P51$ 7UDQVFULSWLRQ /HYHOV &HOOVXUIDFH *DO7DVH (Q]\PDWLF $FWLYLW\ 3URILOH +LVWRORJLF DQG ,PPXQRKLVWRFKHPLFDO $QDO\VLV )ORZ &\WRPHWULF (YDOXDWLRQ RI &HOO6XUIDFH *DO7DVH 'XULQJ 'HYHORSPHQW (YDOXDWLRQ RI 2UJDQ &XOWXUH LQ YLWURf ([SHULPHQWV &RQWURO LQ YLWUR 'HYHORSPHQW RI )HWDO 6XEPDQGLEXODU *ODQGV ([SHULPHQWDO LQ YLWUR 'HYHORSPHQW RI )HWDO 6XEPDQGLEXODU *ODQGV ',6&866,21 27+(5 678',(6 5()(5(1&(6 %,2*5$3+,&$/6.(7&+ YLL

PAGE 8

/,67 2) ),*85(6 )LJXUH 3DJH *HQHUDO 6WUXFWXUH RI 6DOLYDU\ *ODQGV 6FKHPDWLF 5HSUHVHQWDWLRQ RI %DVHPHQW 0HPEUDQH &KDQJHV 7KH 6FKHPDWLF RI 6DOLYDU\ SDGUHQHUJLF 5HFHSWRUV 7KH $FWLYDWLRQ RI WKH 6DOLYDU\ &KROLQHUJLF 5HFHSWRUV 0RGHO RI /DPLQLQ 6FKHPDWLF RI ,QWHJULQ0DWUL[ ,QWHUDFWLRQV 6FKHPDWLF 'LDJUDP RI ,QWHJULQ*URZWK )DFWRU ,QWHUDFWLRQV 7KH 5ROH RI *ROJL *DO7DVH 7KH *HQHUDO 6WUXFWXUH RI &HOO6XUIDFH *DO7DVH 7KH *HQRPLF 6HTXHQFH IRU 0XULQH S JDODFWRV\OWUDQVIHUDVH 3RWHQWLDO 0HFKDQLVPV IRU *DO7DVH &HOO&HOO ,QWHUDFWLRQV 0RGHO RI *DO7DVH 0HGLDWHG 0LJUDWLRQ 7KH *HQHUDO 6FKHPH IRU 6HPL*XDQWLILFDWLRQ RIP51$ 7KH *HQHUDO 6FKHPH IRU ,PPXQRKLVWRFKHPLVWU\ 7KH *HQHUDO 6FKHPH IRU 2UJDQ &XOWXUH YLLL

PAGE 9

&RQILUPDWLRQ RI *DO7DVH 573&5 3URGXFWV *HO (OHFWURSKRUHVLV 6HSDUDWLRQ RI *DO7DVH 573&5 3URGXFWV 'HYHORSPHQWDO ([SUHVVLRQ RI $P\ODVH P51$ 'HYHORSPHQWDO ([SUHVVLRQ RI &\VWDWLQ P51$ 'HYHORSPHQWDO ([SUHVVLRQ RI (*) P51$ 'HYHORSPHQWDO ([SUHVVLRQ RI *DO7DVH P51$ 'HYHORSPHQWDO ([SUHVVLRQ RI /\VR]\PH P51$ 'HYHORSPHQWDO ([SUHVVLRQ RI 0XFLQ P51$ 'HYHORSPHQWDO ([SUHVVLRQ RI 1*) P51$ 'HYHORSPHQWDO ([SUHVVLRQ RI 363 P51$ +LVWRORJLF (YDOXDWLRQ RI 1RUPDO 'HYHORSPHQW ,PPXQRKLVWRFKHPLFDO $QDO\VLV RI *DO7DVH ([SUHVVLRQ )ORZ &\WRPHWULF (YDOXDWLRQ RI &HOO6XUIDFH *DO7DVH 5HSUHVHQWDWLYH 3KRWRPLFURJUDSKV RI D )HWDO 0RXVH 6XEPDQGLEXODU *ODQG *URZQ LQ LQ YLWUR 2UJDQ &XOWXUH IRU +RXUV ([SUHVVLRQ RI KRXU P51$ /HYHOV RI 0DUNHUV RI 7HUPLQDO $FLQDU &HOO 'LIIHUHQWLDWLRQ ([SUHVVLRQ RI KRXU P51$ /HYHOV RI 'HYHORSPHQWDO 0DUNHUV RI 'XFWDO &HOO 'LIIHUHQWLDWLRQ 3KRWRPLFURJUDSKV RI 5HSUHVHQWDWLYH )HWDO 0RXVH 6XEPDQGLEXODU *ODQG +RXU 2UJDQ &XOWXUH 5HODWLYH 4XDQWLILFDWLRQ RI LQ YLWUR P51$ ([SUHVVLRQ L[

PAGE 10

5HSUHVHQWDWLYH 3KRWRPLFURJUDSK RI 5HVXOWV $IWHU +RXUV LQ 2UJDQ &XOWXUH :LWK $GGLWLRQ RI $QWL*DO7DVH $QWLERG\ 3KRWRPLFURJUDSKV RI 5HSUHVHQWDWLYH +RXU 7\USKRVWLQ 2UJDQ &XOWXUH 6XJJHVWHG ,QWHJULQ*DO7DVH$FWLQ 0RGHO [

PAGE 11

$EVWUDFW RI 'LVVHUWDWLRQ 3UHVHQWHG WR WKH *UDGXDWH 6FKRRO RI WKH 8QLYHUVLW\ RI )ORULGD LQ 3DUWLDO )XOILOOPHQW RI WKH 5HTXLUHPHQWV IRU WKH 'HJUHH RI 'RFWRU RI 3KLORVRSK\ 7+( 52/( 2) %(7$ *$/$&726
PAGE 12

&KDLQ UHDFWLRQ 573&5f *DO7DVH HQ]\PDWLF DFWLYLW\ DVVD\ LPPXQRKLVWRFKHPLVWU\ DQG IORZ F\WRPHWU\ 7KLV VWXG\ DOVR XWLOL]HG WKH IHWDO PRXVH VDOLYDU\ RUJDQ FXOWXUH V\VWHP WR HYDOXDWH WKH UROH RI *DO7DVH LQ PRUSKRGLIIHUHQWLDWLRQ 6XEPDQGLEXODU JODQGV ZHUH KDUYHVWHG DW IHWDO GD\ IURP &' PLFH DQG FXOWXUHG IRU KRXUV LQ ZHOOV s ODPLQLQ FRDWLQJ $GGLWLRQV WR WKH PHGLD LQFOXGHG QRWKLQJ ; 3%6 m ODFWDOEXPLQ DQWL*DO7DVH DQG DQWLODPLQLQ DQWLERGLHV DQG W\USKRVWLQ /DPLQLQ ZHOOV ZHUH SUHWUHDWHG ZLWK ERYLQH JDODFWRV\OWUDQVIHUDVH WR PRGLI\ WKH *,F1$F UHVLGXHV DQG HOLPLQDWH WKH *DO7DVH VXEVWUDWH ,Q YLWUR PRUSKRORJLF GHYHORSPHQW H[SUHVVLRQ DQG DFWLYLW\ RI FHOOVXUIDFH *DO7DVH ZDV HYDOXDWHG ZLWK SKRWRPLFURJUDSKV P51$ H[SUHVVLRQ HQ]\PDWLF DFWLYLW\ LPPXQRKLVWRFKHPLVWU\ DQG IORZ F\WRPHWU\ (YDOXDWLRQ RI LQ WHUR P51$ H[SUHVVLRQ DQG FHOOVXUIDFH HQ]\PDWLF DFWLYLW\ SURYLGHG D FRQFRUGDQFH RI *DO7DVH LQ GHYHORSPHQW $GGLWLRQDOO\ WKH LQ WHUR H[SUHVVLRQ RI P51$ RI GHYHORSPHQWDO SURWHLQV HYDOXDWHG SHDNHG DW IHWDO GD\ IRU RI WKH SURWHLQV 6DOLYDU\ RUJDQV FXOWXUHG ZLWKRXW ODPLQLQ SODVWLF ZHOOV DQWLODPLQLQ DQWLERG\ RU SUHWUHDWHG ZHOOVf GHPRQVWUDWHG UHWDUGHG LQ YLWUR JURZWK ZLWK DOWHUHG EUDQFKLQJ PRUSKRJHQHVLV DQG DFLQDU FHOO SUROLIHUDWLRQ \HW VLPLODU *DO7DVH P51$ H[SUHVVLRQ *ODQGV FXOWXUHG LQ DJHQWV LQWHUIHULQJ ZLWK *DO7DVHODPLQLQ LQWHUDFWLRQV DODFWDOEXPLQ DQWL*DO7DVHf SUHVHQWHG DOWHUHG LQ YLWUR PRUSKRORJLF GHYHORSPHQW ZLWK OHVV FRKHVLYH DFLQDU FHOO FOXVWHUV EXW ;,,

PAGE 13

VLPLODU EUDQFKLQJ )XUWKHUPRUH WKH *DO7DVH FHOOVXUIDFH DFWLYLW\ ZDV LQKLELWHG E\ WKHVH DJHQWV EXW ZLWKRXW VLJQLILFDQW UHGXFWLRQ LQ *DO7DVH P51$ 7KHVH VWXGLHV VXJJHVW WKDW FHOOVXUIDFH *DO7DVH PD\ EH DQ LPSRUWDQW PHGLDWRU RI QRUPDO FHOOXODU LQWHUDFWLRQV SDUWLFLSDWLQJ LQ EUDQFKLQJ PRUSKRJHQHVLV DQG DFLQDU FHOO SUROLIHUDWLRQ GXULQJ IHWDO VDOLYDU\ JODQG GHYHORSPHQW

PAGE 14

&+$37(5 21( ,1752'8&7,21 6DOLYDU\ *ODQGV $Q LQWULJXLQJ TXHVWLRQ LQ DQLPDO GHYHORSPHQW LV KRZ HSLWKHOLXP FKDQJHV VKDSH GXULQJ PRUSKRJHQHVLV DQG WKHQ DVVXPHV GLIIHUHQWLDWHG IXQFWLRQ 7UDGLWLRQDOO\ IHZ WLVVXHV KDYH EHHQ XWLOL]HG WR HYDOXDWH PRUSKRORJLF GHYHORSPHQWDO SURFHVVHV DQG WKH\ LQFOXGH OXQJ PDPPDU\ DQG VDOLYDU\ JODQG WLVVXHV 7KHVH WLVVXHV SURYLGH H[FHOOHQW PRGHO V\VWHPV EHFDXVH WKH\ GHYHORSH FKDUDFWHULVWLF PRUSKRORJLF VWUXFWXUHV WKDW DOORZ IRU HDVLO\ LGHQWLILDEOH DOWHUDWLRQV IURP QRUPDO GHYHORSPHQW 2I SDUWLFXODU LQWHUHVW WR PH EHFDXVH RI P\ WUDLQLQJ LQ GHQWLVWU\ ZDV WKH VDOLYDU\ JODQG 7KH SULPDU\ UROH RI WKH VDOLYDU\ JODQGV LV WKH SURGXFWLRQ RI VDOLYD +HDOWK\ KXPDQV W\SLFDOO\ SURGXFH DSSUR[LPDWHO\ P/ RI ZKROH VDOLYD SHU GD\ 0RUH WKDQ b RI WKLV VDOLYD FRPHV IURP WKH WKUHH PDMRU VDOLYDU\ JODQGV =DFKDULDVHQ f 7KH VDOLYD LV W\SLFDOO\ WKRXJKW WR EH GLIIHUHQW IRU HDFK RI WKH PDMRU VDOLYDU\ JODQGV ,Q WKH PRXVH IRU LQVWDQFH ZH NQRZ WKDW WKH VXEPDQGLEXODU JODQG SURGXFHV DOPRVW DOO RI WKH JURZWK IDFWRU HSLGHUPDO JURZWK IDFWRU (*)f &RKHQ f ,W LV NQRZQ WRGD\ WKDW GXFWDO FHOOV DUH WKH SULPDU\ SURGXFHUV RI (*) DQG 1*)

PAGE 15

6DOLYD LV D FRPSOH[ IOXLG WKDW FRQWDLQV WZR PDMRU FRPSRQHQWV WKH PDFURPROHFXOHV W\SLFDOO\ FRQWDLQHG ZLWKLQ WKH VHFUHWRU\ JUDQXOHV DQG WKH VDOLYDU\ IOXLG 7KH VDOLYDU\ PDFURPROHFXOHV LQFOXGH PXFLQV HQ]\PHV LPPXQRJOREXOLQV JURZWK IDFWRUV DQG RWKHU ELRORJLFDO DFWLYH PDWHULDOV 7KH VDOLYDU\ IOXLG LV W\SLFDOO\ SURGXFHG E\ WKH DFLQDU FHOOV 6DOLYDU\ JODQGV DQG XOWLPDWHO\ VDOLYD SOD\ DQ LPSRUWDQW UROH LQ WKH PDLQWHQDQFH RI WKH RYHUDOO KHDOWK RI RUDO DQG RWKHU WLVVXHV 6DOLYD KDV PDQ\ LPSRUWDQW IXQFWLRQV ZKLFK LQFOXGH f OXEULFDWLRQ RI WKH RUDO WLVVXHV WR DVVLVW LQ PDVWLFDWLRQ VZDOORZLQJ DQG VSHDNLQJ f GLJHVWLRQ RI LQJHVWHG QXWULHQWV f EXIIHULQJ WKH DFLGLW\ RI WKH RUDO HQYLURQPHQW f FOHDQVLQJ f IRUPDWLRQ RI WKH GHQWDO SHOOLFOH f UHPLQHUDOL]DWLRQ RI WKH WRRWK VXUIDFH f VRXUFH RI DQWLPLFURELDO SURWHFWLRQ DJDLQVW RUDO LQIHFWLRQV f SURWHFWLRQ RI WKH RUDO PXFRVD DQG f UHJHQHUDWLRQ RI RUDO VRIW WLVVXHV 7DEOH f =DFKDULDVHQ ,]XWVX f 7KXV WKH VDOLYDU\ JODQGV DQG XOWLPDWHO\ VDOLYD SOD\ D YLWDO UROH LQ KRPHRUHJXODWLRQ RI KHDOWK LQ WKH RUDO FDYLW\ 7KH RUDO FDYLW\ LV SUHVHUYHG DQG SURWHFWHG E\ VHFUHWLRQV IURP VDOLYDU\ JODQGV 6DOLYDU\ JODQGV DUH W\SLFDOO\ GLYLGHG LQWR PDMRU RU PLQRU JODQGV 0DMRU VDOLYDU\ JODQGV GHOLYHU WKHLU VHFUHWLRQV YLD H[WUDJODQGXODU VHFUHWRU\ GXFWV DQG KDYH EHHQ WHUPHG H[WULQVLF ZKLOH PLQRU JODQGV W\SLFDOO\ OLH ZLWKLQ WKH ODPLQD SURSULD RI WKH RUDO WLVVXHV DQG HPSW\ WKHLU SURGXFWV GLUHFWO\ LQWR WKH RUDO FDYLW\ DQG KDYH WKXV EHHQ WHUPHG LQWULQVLF 'REURVLHOVNL9HUJRQD f

PAGE 16

0DMRU )XQFWLRQV RI 6DOLYD )XQFWLRQ 6DOLYDU\ &RPSRQHQWV 5HVSRQVLEOH /XEULFDWLRQ :DWHU 0XFLQV 3UROLQHULFK 3URWHLQV 'LJHVWLRQ $P\ODVH /LSDVH 3URWHDVHV %XIIHULQJ +&2V 3 &OHDQVLQJ :DWHU )RUPDWLRQ RI 'HQWDO 3HOOLFOH 0XFLQV 353V $P\ODVH 5HPLQHUDOL]DWLRQ &D 3 6WDWKHULQ $QLRQLF 3URWHLQV $QWLPLFURELDO /DFWRSHUR[LGDVH /DFWRIHUULQ VOJ$ 3URWHFWLRQ RI WKH 0XFRVD :DWHU (OHFWURO\WHV 0XFLQ 5HJHQHUDWLRQ *URZWK IDFWRUV 7DEOH 0DMRU )XQFWLRQV RI 6DOLYD 6DOLYD LV D FRPSOH[ ELRORJLFDO IOXLG WKDW KDV VHYHUDO ,PSRUWDQW IXQFWLRQV 6DOLYD SOD\V D ZLGH DVVRUWPHQW RI UROHV ,Q PDLQWDLQLQJ WKH KRPHRVWDVLV RI WKH RUDO FDYLW\ 7KLV WDEOH LOOXVWUDWHV VRPH RI WKH NQRZQ UROHV DVVRFLDWHG ZLWK VDOLYD WR GDWH

PAGE 17

)RUP DQG )XQFWLRQ RI 6DOLYDU\ *ODQGV 7KHUH DUH WKUHH ELODWHUDOO\ SDLUHG PDMRU VDOLYDU\ JODQGV LQ PRVW PDPPDOV LQFOXGLQJ PDQ SULPDWHV UDWV DQG PLFHf WKH SDURWLG WKH VXEPDQGLEXODU DQG WKH VXEOLQJXDO 7KHUH DUH DOVR QXPHURXV PLQRU VDOLYDU\ JODQGV ORFDWHG WKURXJKRXW WKH RUDO FDYLW\ IRXQG ZLWKLQ WKH OLSV SDODWH DQG PXFRVDO WLVVXHV 7KH VWUXFWXUH RI VDOLYDU\ JODQGV LV FRPPRQ WR DOO DQG FRQVLVW RI D FROOHFWLRQ RI GLIIHUHQWLDWHG FHOOV ZLWK VSHFLDOL]HG IXQFWLRQV )LJXUH f $FLQXV DQG GXFWDO FHOOV 7KH PDMRU FHOO W\SHV IRXQG LQ VDOLYDU\ WLVVXHV DUH WKH DFLQDU DQG GXFWDO FHOOV $FLQDU FHOOV IRXQG ZLWKLQ WKH VHFUHWRU\ HQGSLHFHV SURGXFH WKH PDMRULW\ RI WKH VDOLYDU\ SURGXFWV DQG IOXLG ZKLOH GXFWDO FHOOV FDUU\ WKH DFLQDU VHFUHWLRQV WR WKH RUDO FDYLW\ $FLQDU FHOOV KDYH D S\UDPLGDO VKDSH ZLWK PXOWLSOH VHFUHWRU\ JUDQXOHV 6DOLYDU\ JODQG DFLQDU FHOOV DUH WKRXJKW WR DULVH IURP WKH SOXULSRWHQWLDO LQWHUFDODWHG FHOOV (YHUVROH f 7KHUH DUH DOVR YDULRXV IRUPV RI GXFWDO FHOOV WKH LQWHUFDODWHG JUDQXODU FRQYROXWHG DQG VWULDWHG VHFUHWRU\ GXFWDO FHOOV 7KH GXFWDO FHOOV OLNH WKH DFLQDU FHOOV VHFUHWH PDFURPROHFXOHV LQWR WKH VDOLYD JUDQXODU FRQYROXWHG DQG VWULDWHG VHFUHWRU\ GXFWf DV ZHOO DV UHVRUE ZDWHU DQG HOHFWURO\WHV JUDQXODU FRQYROXWHG GXFWf *UHVLN HWDO f 6HURXV DQG PXFLQRXV JODQGV (DUO\ LQYHVWLJDWLRQV LQ VDOLYDU\ JODQG UHVHDUFK XVHG KHPDWR[\OLQ DQG HRVLQ VWDLQLQJ RI VDOLYDU\ JODQG VHFUHWRU\ HQGSLHFHV WR GHWHFW WZR W\SHV RI FHOOV WKH DFLQDU FHOOV SURGXFLQJ VHURXV SURGXFWV DQG WKH DFLQDU FHOOV

PAGE 18

DFLQDU FHOO )LJXUH *HQHUDO 6WUXFWXUH RI 6DOLYDU\ *ODQGV $FLQDU FHOOV DUH GHSLFWHG KHUH DV WHUPLQDO HQGSLHFH VHFUHWRU\ XQLWV 7KHUH DUH WKUHH GLIIHUHQW W\SHV RI GXFWDO FHOOV LQWHUFDODWHG JUDQXODU FRQYROXWHG WXEXOH ZKLFK LV UHVSRQVLEOH IRU WKH SURGXFWLRQ RI (*) DQG 1*)f DQG VWULDWHG VHFUHWRU\ GXFWDO FHOOV

PAGE 19

SURGXFLQJ PXFLQRXV SURGXFWV 7KLV OHDG WR WKH RULJLQDO GHVFULSWLRQ RI WKH PDMRU VDOLYDU\ JODQGV DV HLWKHU VHURXV SDURWLG JODQGf RU PXFLQRXV VXEPDQGLEXODU DQG VXEOLQJXDO JODQGf GHSHQGLQJ RQ WKH VHFUHWRU\ SURGXFWV 6HURXV FHOOV W\SLFDOO\ SURGXFH D SURWHLQDFRXV SURGXFW ZLWK YHU\ OLWWOH PXFLQ 0XFLQRXV FHLOV SURGXFH DFLGLF DQG QHXWUDO JO\FRFRQMXJDWHV ZLWK OHFWLQOLNH TXDOLWLHV NQRZQ DV PXFLQV 'HYHORSPHQW RI LPPXQRKLVWRFKHPLFDO VWDLQLQJ WHFKQRORJ\ ODWHU VXJJHVWHG WKDW D VHURPXFLQRXV FHOO W\SH ZDV DOVR SUHVHQW 0XQJHU f 7KXV WRGD\ ZH GHVFULEH WKH SDURWLG JODQG DV D VHURPXFLQRXV JODQG 'REURVLHOVNL9HUJRQD f 'HYHORSPHQW RI WKH 6DOLYDU\ *ODQG :KLOH PXFK KDV EHHQ HOXFLGDWHG LQ UHFHQW \HDUV UHJDUGLQJ VDOLYDU\ JODQG IXQFWLRQ YHU\ OLWWOH KDV EHHQ LQYHVWLJDWHG UHJDUGLQJ WKHLU QRUPDO PRUSKRGLIIHUHQWLDWLRQ DQG F\WRGLIIHUHQWLDWLRQ 1HYHUWKHOHVV WKHUH DUH IRXU UHFRJQL]HG VWDJHV LQ WKH GHYHORSPHQW RI VDOLYDU\ JODQGV ZKLFK DUH f PRUSKRJHQHVLV WKH LQLWLDWLRQ RI WKH FKDUDFWHULVWLF DUFKLWHFWXUH RI FOHIWV DQG EUDQFKLQJ f F\WRGLIIHUHQWLDWLRQ WKH GLIIHUHQWLDWLRQ RI UXGLPHQWDU\ VDOLYDU\ JODQGV LQWR VHYHUDO FHOO W\SHV OHDGLQJ WR WKH V\QWKHVLV VWRUDJH DQG VHFUHWLRQ RI VDOLYDU\VSHFLILF SURWHLQV f GHYHORSPHQW RI WKH VWLPXOXVVHFUHWLRQ FRXSOLQJ V\VWHP DQG f WKH DQDWRPLFDO FRXSOLQJ RI WKH V\PSDWKHWLF QHUYHV WR EHJLQ WKH VHFUHWLRQ RI VDOLYDU\ IOXLGV DQG SURWHLQV &XWOHU f )XOO IXQFWLRQDO DQG FRPSOHWH SK\VLRORJLF GHYHORSPHQW LV RQO\ DFKLHYHG RQFH WKH VDOLYDU\ JODQGV DUH DQDWRPLFDOO\ FRQQHFWHG WR WKH QHUYRXV V\VWHP ZKLFK

PAGE 20

XOWLPDWHO\ DFWLYDWHV WKH VHFUHWRU\ V\VWHP $FWLYDWLRQ RI FHOOVXUIDFH UHFHSWRUV RI WKH VHFUHWRU\ FHOOV LQ UHVSRQVH WR QHXUDO VWLPXOL UHVXOWV LQ H[RF\WRVLV RI VHFUHWRU\ JUDQXOH SURWHLQV DQG WKH SURGXFWLRQ RI VDOLYD 7KHVH GHYHORSPHQWDO SKDVHV DUH SDUWLDOO\ FRXSOHG DQG LQGHSHQGHQWO\ UHJXODWHG DQG PXVW IROORZ WKH SURSHU VHTXHQFH IRU QRUPDO GHYHORSPHQW WR RFFXU 5HVHDUFKHUV KDYH VKRZQ WKDW VHFUHWRU\ FHOO GLIIHUHQWLDWLRQ FDQ QRW RFFXU XQWLO EUDQFKLQJ PRUSKRJHQHVLV KDV EHHQ HVWDEOLVKHG 6SRRQHU DQG )DXELRQ &XWOHU f DQG WKDW QHXUDO LQWHJUDWLRQ ZLOO QRW RFFXU XQWLO VHFUHWRU\ FHOO GHYHORSPHQW LV FRPSOHWH &XWOHU %RWWDUR DQG &XWOHU &XWOHU IRU IXOO UHYLHZf 0RUSKRJHQHVLV DQG F\WRGLIIHUHQWLDWLRQ &KLHYLW] LQLWLDOO\ LQYHVWLJDWHG VDOLYDU\ JODQG GHYHORSPHQW LQ SLJV &KLHYLW] f ZKLOH 0RUDO ZDV DQ HDUO\ LQYHVWLJDWRU RI VDOLYDU\ JODQGV LQ WKH PRXVH 0RUDO DQG 0RUDO f /DWHU 5HGPDQ DQG 6UHHEQ\ DQG &XWOHU DQG &KDXGKU\ DQG PRUH UHFHQWO\ 1DNDQLVKL SURYLGHG H[WHQVLYH KLVWRORJLF DQG SK\VLRORJLF VWXGLHV RQ (&0 H[SUHVVLRQ LQ HPEU\RQLF GHYHORSPHQW RI URGHQW VDOLYDU\ JODQGV 5HGPDQ DQG 6UHHEQ\ D 5HGPDQ DQG 6UHHEQ\ E &XWOHU DQG &KDXGKU\ D &XWOHU DQG &KDXGKU\ E &XWOHU DQG &KDXGKU\ 1DNDQLVKL DQG ,VKLL f 5HFHQWO\ 0DFDXOH\ SURYLGHG LQIRUPDWLRQ UHJDUGLQJ VRPH RI WKH PROHFXODU DVSHFWV RI (&0 H[SUHVVLRQ LQ WHUR IRU IHWDO PRXVH VDOLYDU\ JODQG GHYHORSPHQW 0DFDXOH\ HW DO f 6RPH GLVFUHSDQFLHV DURVH DV D UHVXOW RI WKHVH UHSRUWV GXH WR WKH IDFW WKDW WKH\ LGHQWLILHG GHYHORSPHQWDO GD\ fRQHf GLIIHUHQWO\ 7R PDLQWDLQ FRQVLVWHQF\ ZLWK RWKHU UHSRUWV IURP RXU ODERUDWRU\ ZH

PAGE 21

KDYH XWLOL]HG WKH GHVLJQDWLRQV RI &XWOHU DQG &KDXGKU\ ZKHUH WKH GD\ DIWHU PDWLQJ LV GHVLJQDWHG IHWDO GD\ RQH &XWOHU DQG &KDXGKU\ Df 7KH HDUOLHVW HYLGHQFH RI VXEPDQGLEXODU JODQG GHYHORSPHQW LQ WKH PRXVH EHJLQV RQ ODWH IHWDO GD\ ZKHQ VSHFLILF FHOOV RI WKH SULPLWLYH RUDO HSLWKHOLXP IRUP D IRFDO FOXVWHULQJ ZKLFK SXVKHV LQWR WKH VXUURXQGLQJ PHVHQFK\PH 1DNDQLVKL HWD f 7KLV VDOLYDU\ JODQG DQODJH FRQWLQXHV WR SUROLIHUDWH DV D WKLQ OD\HU RI RULHQWHG PHVHQFK\PH ZKLFK EXGV IURP WKH VXUURXQGLQJ PDQGLEXODU PHVHQFK\PH RQ IHWDO GD\ DQG GHYHORSV WKH FKDUDFWHULVWLF FOXEVKDSHG VWUXFWXUH VXUURXQGHG E\ D EDVHPHQW PHPEUDQH PRUSKRJHQHVLVf 7KH JODQGV EHJLQ WR UHVHPEOH WKH IDPLOLDU VWDON DQG EUDQFK PRUSKRORJ\ DQG FDQ EH UHPRYHG E\ PLFURGLVVHFWLRQ RQ GD\ )LJXUH f 2QO\ DIWHU WKLV EUDQFKLQJ PRUSKRJHQHVLV KDV RFFXUUHG FDQ WKH GLIIHUHQWLDWLRQ RI VHFUHWRU\ FHOOV WDNH SODFH F\WRGLIIHUHQWLDWLRQf *ODQGXODU GHYHORSPHQW UHTXLUHV WKH FRRUGLQDWHG VSDWLDO DQG WHPSRUDO UHRUJDQL]DWLRQ DQG GLVWULEXWLRQ RI H[WUDFHOOXODU PDWUL[ (&0f FRPSRQHQWV WR DFKLHYH PRUSKRGLIIHUHQWLDWLRQ 7KH PHVHQFK\PDO FDSVXOH DQG VSHFLILFDOO\ WKH (&0 PROHFXOH FRPSRQHQWV DUH WKRXJKW WR SOD\ DQ LPSRUWDQW UROH LQ WKH GHYHORSPHQW RI WKH HSLWKHOLDO SRUWLRQ RI WKH VXEPDQGLEXODU JODQG 5HPRYDO RI WKH PHVHQFK\PDO FDSVXOH WKXV SUHYHQWLQJ WKLV LQWHUDFWLRQ UHGXFHG RU HOLPLQDWHG WKH HSLWKHOLDO EUDQFKLQJ PRUSKRJHQHVLV %RUJKHVH *UREVWHLQ D E Ff 5HVHDUFKHUV WKHQ VXJJHVWHG WKDW FROODJHQ ZDV D VWDELOL]LQJ FRPSRQHQW RI WKH (&0 DQG SDUWLFLSDWHG LQ PHGLDWLQJ FHOO JURZWK DQG EUDQFKLQJ PRUSKRJHQHVLV 6LPLODUO\ 6SRRQHU DQG )DXELRQ 6SRRQHU DQG )DXELRQ f DQG 1DNDQLVKL

PAGE 22

GHJHQHUDWLQJ EDVDO ODPLQD )LJXUH 6FKHPDWLF 5HSUHVHQWDWLRQ RI %DVHPHQW 0HPEUDQH &KDQJHV 7KLV ILJXUH UHSUHVHQWV WKH FKDQJHV VHHQ LQ WKH EDVHPHQW PHPEUDQH GXULQJ PXULQH VXEPDQGLEXODU JODQG GHYHORSPHQW 'D\ GHPRQVWUDWHV WKH LQYDJLQDWLRQ RI WKH SULPLWLYH RUDO HSLWKHOLXP IRUPLQJ WKH HSLWKHOLDO EXGf 'D\ UHSUHVHQWV WKH IDPLOLDU fVWDON DQG EUDQFKf

PAGE 23

HW DO 1DNDQLVKL HW DL f HIIHFWLYHO\ LQKLELWHG ,Q YLWUR EUDQFKLQJ PRUSKRJHQHVLV RI VDOLYDU\ JODQG UXGLPHQWV E\ WKH DGGLWLRQ RI FROODJHQDVHV /D]HWLGLQH FDUER[\OLF DFLG RU DDfGLS\ULG\Of 0RUH UHFHQWO\ 1DNDQLVKL DQG ,VKLL 1DNDQLVKL DQG ,VKLL f XVHG DQWLERGLHV IRU VSHFLILF FROODJHQV ,, ,,, ,9f WR HYDOXDWH WKH LQWHUUHODWLRQVKLS EHWZHHQ WKHVH WLVVXHV 7KHLU ZRUN VXJJHVWHG WKDW HDUO\ FOHIWLQJ RI WKH VDOLYDU\ JODQG UXGLPHQW DW GD\ DQG ZDV DVVRFLDWHG ZLWK FROODJHQ ,,, ORFDOL]DWLRQ ZKLOH FROODJHQ ZDV HTXDOO\ GLVWULEXWHG WKURXJKRXW HSLWKHOLDO DQG PHVHQFK\PDO WLVVXHV DQG W\SH ,9 FROODJHQ ZDV OLPLWHG WR WKH EDVHPHQW PHPEUDQH &XPXODWLYHO\ WKHVH VWXGLHV KDYH VXJJHVWHG D PRGHO ZKHUH WKH PHVHQFK\PDO FHOOV SURGXFH FROODJHQ ZKLFK LPSDUWV PHFKDQLFDO IRUFHV DQG VWUDLQ RQ WKH HSLWKHOLDO OREXOH DQG WKLV LQLWLDWHV FOHIW IRUPDWLRQ 1DNDQLVKL DQG ,VKLL f )URP WKLV LW LV EHOLHYHG WKDW PHVHQFK\PDO WLVVXHV PD\ EH HLWKHU SHUPLVVLYH RU LQVWUXFWLYH LQ WKHLU UHODWLRQVKLS ZLWK HSLWKHOLXP :HVVHOOV f $FLQDU FHOO GLIIHUHQWLDWLRQ FDQ WDNH SODFH RQO\ DIWHU EUDQFKLQJ PRUSKRJHQHVLV KDV RFFXUUHG &\WRGLIIHUHQWLDWLRQ RFFXUV ZKHQ VHFUHWRU\ SURWHLQV DUH SDFNDJHG LQWR VHFUHWRU\ JUDQXOHV E\ PDWXUH H[RFULQH FHOOV )XQFWLRQDO FRXSOLQJ RI WKH VDOLYDU\ JODQG 7KH QH[W VWDJHV RI GHYHORSPHQW RI WKH VDOLYDU\ JODQG LQYROYHV FRXSOLQJ RI WKH GHYHORSLQJ JODQG ZLWK WKH QHUYRXV V\VWHP (DUO\ LQYHVWLJDWRUV RSHUDWHG XQGHU WKH DVVXPSWLRQ WKDW VDOLYDU\ IOXLG SURGXFWLRQ ZDV GULYHQ E\ K\GURVWDWLF SHUIXVLRQ $FFRUGLQJ WR %XUJHQ DQG (PPHOLQ /XGZLJ ILUVW DQG ODWHU
PAGE 24

VXEPDQGLEXODU GXFW SUHVVXUHV ZHUH H[SHULPHQWDOO\ LQFUHDVHG WR H[FHHG WKH DUWHULDO SUHVVXUHV HIIHFWLYHO\ GLVSHOOLQJ WKLV WKHRU\ %HUJHQ DQG (PPHOLQ ZKLFK ELQGV WKH JXDQLQH SKRVSKDWH@ S DQG \f 7KLV

PAGE 25

LQWHUDFWLRQ FDXVHV WKH GLVVRFLDWLRQ RI WKH *73D VXEXQLW ZKLFK FDQ WKHQ DVVRFLDWH ZLWK WKH FDWDO\WLF SRUWLRQ RI WKH DGHQ\ODWH F\FODVH DQG FDXVH LQFUHDVHG FHOOXODU F\FOLF DGHQRVLQH PRQRSKRVSKDWH F$03f 7KLV LQFUHDVH LQ FHOOXODU F$03 DFWLYDWHV SURWHLQ NLQDVH DFWLYLW\ DQG OHDGV WR SKRVSKRU\ODWLRQ HYHQWV WKDW XOWLPDWHO\ UHVXOW LQ H[RF\WRVLV RI WKH VDOLYDU\ SURWHLQV VWRUHG LQ VHFUHWRU\ JUDQXOHV WKURXJK IXVLRQ RI JUDQXOHV WR WKH SODVPD PHPEUDQH )LJXUH f $FWLYDWLRQ RI WKH DDGUHQHUJLF UHFHSWRU SURYLGHV D IHHGEDFN PHFKDQLVP E\ ELQGLQJ WR WKH LQKLELWRU\ SURWHLQ *cf VR WKDW *73 LV H[FKDQJHG IRU *'3 ZKLFK UHVXOWV LQ WKH GLVVRFLDWLRQ RI WKH *73 D VXEXQLW 7KLV GLVVRFLDWHG *73 D VXEXQLW WKHQ ELQGV WR WKH FDWDO\WLF GRPDLQ RI DGHQ\ODWH F\FODVH HIIHFWLYHO\ SUHYHQWLQJ SDGUHQHUJLF VWLPXODWHG ELQGLQJ )LJXUH f 7KH DFWLYDWHG FKROLQHUJLF UHFHSWRU FRXSOHG ZLWK SKRVSKROLSDVH & 3/&f OHDGV WR K\GURO\VLV RI SKRVSKDWLG\OLQRVLWROELVSKRVSKDWH LQWR LQRVLWRO WULSKRVSKDWH ,3f DQG GLDF\OJO\FHURO '*f *DOODJKHU f ,3 FRPELQHG ZLWK ,3 D FDOPRGXOLQGHSHQGHQW SKRVSKRU\ODWHG ,3f OHDGV WR RSHQLQJ RI 1D DQG &O FKDQQHOV ZKLFK XOWLPDWHO\ HQGV ZLWK IOXLG DQG HOHFWURO\WH VHFUHWLRQ )LJXUH f ,3 LQLWLDWHV WKH UHOHDVH RI LQWUDFHOOXODU &D ZKLFK DOORZV '* WR DFWLYDWH 3.& 3.& FDQ VWLPXODWH WKH IXVLRQ RI VHFUHWRU\ JUDQXOHV ZLWK WKH SODVPD PHPEUDQH DQG UHOHDVH D PLQLPDO DPRXQW RI VDOLYD SURWHLQ

PAGE 26

H[RF\WRVLV )LJXUH 7KH 6FKHPDWLF RI 6DOLYDU\ DGUHQHUJLF 5HFHSWRUV 5HJXODWLRQ RI DGHQ\ODWH F\FODVH DFWLYLW\ RI WKH DFLQDU FHOOV VWLPXODWH SKRVSKRU\ODWLRQ HYHQWV OHDGLQJ WR H[RF\WRVLV RI VHFUHWRU\ SURWHLQV RI WKH VHFUHWRU\ JUDQXOHV

PAGE 27

)LJXUH 7KH $FWLYDWLRQ RI 6DOLYDU\ &KROLQHUJLF 5HFHSWRUV 7KH DFWLYDWLRQ RI WKH FKROLQHUJLF UHFHSWRUV WKURXJK DFHW\OFKROLQH OHDG WR HOHYDWLRQ RI &D LRQV ZKLFK LQ WXUQ UHJXODWH WKH IOXLG VHFUHWLRQ IURP WKH VDOLYDU\ JODQG DFLQDU FHOOV ,QWUDFHOOXODU &D LRQV DOORZ '* WR DFWLYDWH 3.& ZKLFK VWLPXODWHV WKH IXVLRQ RI VHFUHWRU\ JUDQXOHV WR WKH SODVPD PHPEUDQH DQG UHOHDVH RI VDOLYD SURWHLQ

PAGE 28

5ROH RI (&0 LQ 6DOLYDU\ *ODQG 'HYHORSPHQW 7KLQ OD\HUV RI (&0 NQRZQ DV EDVHPHQW PHPEUDQHV VHSDUDWH HSLWKHOLDO FHOOV DQG FRQQHFWLYH WLVVXH 7KH HSLWKHOLDOPHVHQFK\PDO LQWHUDFWLRQ LV WKRXJKW WR EH DFKLHYHG WKURXJK WKH DFWLRQ RI (&0 FRPSRQHQWV ORFDWHG LQ WKH EDVHPHQW PHPEUDQH 7KH ELRORJLFDO LPSRUWDQFH RI WKH HSLWKHOLDO PHVHQFK\PDO LQWHUDFWLRQ ZDV ILUVW UHFRJQL]HG E\*UREVWHLQ *UREVWHLQ D E Ff ,W LV WKRXJKW WRGD\ WKDW PDQ\ FRPSRQHQWV RI WKH EDVHPHQW PHPEUDQH DUH ELRORJLFDOO\ DFWLYH WKURXJK WKHLU DFWLYDWLRQ RI JURZWK IDFWRU UHFHSWRU VLJQDOLQJ SDWKZD\V 7KHVH FRPSRQHQWV LQFOXGH FROODJHQ SURWHRJO\FDQ ILEURQHFWLQ DQG ODPLQLQ 7UHOVWDG f /DPLQLQ /DPLQLQV DUH H[WUDFHOOXODU JO\FRSURWHLQV WKDW DUH WKH PDMRU FRPSRQHQW RI EDVHPHQW PHPEUDQH LQ PRVW WLVVXHV DQG DUH V\QWKHVL]HG E\ D YDULHW\ RI FHOO W\SHV LQFOXGLQJ ILEUREODVW HSLWKHOLDO DQG HQGRWKHOLDO FHOOV &DPSEHOO DQG 7HUUDQRYD 3DXOVVRQ f /DPLQLQ ZDV ILUVW LVRODWHG IURP WKH PXULQH (QJHOEUHWK+ROP6ZDUP WXPRU 7LPSO HW DO f DQG WKHUH KDYH EHHQ DW OHDVW LVRIRUPV LVRODWHG WR GDWH %XUJHVRQ HW DO 0LQHU HW DO f /DPLQLQ LV FRQVLGHUHG WR EH D PDMRU JO\FRSURWHLQ RI WKH EDVHPHQW PHPEUDQH /DPLQLQ LV D FURVVOLQNHG PROHFXOH FRPSRVHG RI WKUHH VHSDUDWH FKDLQV D N'Df > DQG \ N'Df ZKLFK DVVHPEOHV DV D WULSOH VWUDQGHG FURVVOLNH VWUXFWXUH FRQQHFWHG E\ GLVXOILGH ERQGV %HFN HW DO 7LPSO f )LJXUH f &ROODJHQ ELQGV WR WKH VKRUW DUPV 5DR HW DO 7HUUDQRYD HWDO &KDURQLV HWD f ZKLOH KHSDULQ ELQGV WR

PAGE 29

* 'RPDLQ )LJXUH 0RGHO RI /DPLQLQ 7KLV PRGHO RI ODPLQLQ LOOXVWUDWHV WKH YDULRXV ODPLQLQ IUDJPHQWV /DPLQLQ FKDLQV D SL DQG \ FKDLQV DQG WKHLU SXWDWLYH ELRORJLFDOO\ DFWLYH GRPDLQV ( ( ( DQG ( UHSUHVHQWV HODVWDVH IUDJPHQWV ZKLOH WKH QXPEHUV LQ SDUHQWKHVHV UHSUHVHQW SRWHQWLDO $JO\FRV\ODWLRQ VLWHV

PAGE 30

WKH WHUPLQDO JOREXOH RI WKH ORQJ DUP DQG WKH LQQHU DQG RXWHU JOREXOHV RI WKH VKRUW DUPV 6DNDVKLWD HWDO &0 HWDO f 6SHFLILF SHSWLGH GRPDLQV RI ODPLQLQ PROHFXOHV KDYH EHHQ DVVRFLDWHG ZLWK YDULRXV IXQFWLRQV LQ YLYR VXFK DV DVVLVWLQJ DWWDFKPHQW RI HSLWKHOLDO FHOOV WR EDVHPHQW PHPEUDQH SURPRWLQJ FHOO PLJUDWLRQ DQG UHJXODWLQJ FHOO SUROLIHUDWLRQ 'UDJRR HWDO 3DQD\RWRX HWDO 5HK HWDO 6ZHHQH\ HWDO 0HFKDP 7RPDVHOOL HW DO f 5HFHQW UHSRUWV LQGLFDWH WKDW EDVHPHQW PHPEUDQHV RI DFLQDU DQG GXFWDO FHOOV FRQWDLQ GLIIHUHQW ODPLQLQ LVRIRUPV WKDW PD\ EH DVVRFLDWHG ZLWK FHOO GLIIHUHQWLDWLRQ DQG IXQFWLRQ 6WUDVVEXUJHU HWDO f &RPSRQHQWV RI WKH ODPLQLQ D FKDLQ KDYH EHHQ UHSRUWHG WR EH HVVHQWLDO IRU EUDQFKLQJ PRUSKRJHQHVLV DQG FHOO VSUHDGLQJ 8VLQJ PRQRFORQDO DQWLERGLHV WR WKH ( GRPDLQ RI WKH ODPLQLQ D FKDLQ .DGR\D DQG FRZRUNHUV GHPRQVWUDWHG LQKLELWLRQ RI EUDQFKLQJ PRUSKRJHQHVLV LQ D GD\ IHWDO VDOLYDU\ JODQG RUJDQ FXOWXUH .DGR\D HWDO 0LQHU HWDO f 6LPLODUO\ %HJRYDF KDV GHPRQVWUDWHG WKDW WKH ( GRPDLQ LV FUXFLDO IRU FHOO VSUHDGLQJ 8VLQJ WKH UDW SOHRFKURPRF\WRPD 3&f FHOO PRGHO UHYHDOHG WKDW WKHVH FHOOV IDLOHG WR GHYHORS QHXULWH RXWJURZWKV RQ ODPLQLQ ZKHQ FXOWXUHG ZLWK (UHDFWLYH DQWLERGLHV GHPRQVWUDWLQJ WKDW D SULQFLSOH QHXULWH ELQGLQJ VLWH UHVLGHV LQ WKH ( GRPDLQ RI ODPLQLQ DQG DSSHDUV WR EH UHVSRQVLEOH IRU WKH VSUHDGLQJ %HJRYDF HWDO f (FNVWHLQ DQG 6KXU VXEVHTXHQWO\ GHPRQVWUDWHG WKDW ODPLQLQ LQGXFHG D IROG LQFUHDVH LQ WKH OHYHO RI FHOOVXUIDFH *DODFWRV\OWUDQVIHUDVH RQ PLJUDWLQJ PHVHQFK\PDO FHOOV

PAGE 31

ZKLFK LV SUHIHUHQWLDOO\ ORFDOL]HG WR WKH OHDGLQJ HGJH RI WKH ODPHOOLSRGLD (FNVWHLQ DQG 6KXU f 2OLYHU HWDO FRQILUPHG WKH UHTXLUHPHQW RI (&0 VSHFLILFDOO\ ODPLQLQ IRU WKH PDLQWHQDQFH RI DFLQDU FHOO SKHQRW\SH LQ LPPRUWDOL]HG FHOO OLQH FXOWXUHV 2OLYHU HWDO f 2OLYHU DQG FRZRUNHUV GHPRQVWUDWHG WKDW LPPRUWDOL]HG H[RFULQH DFLQDU FHOOV JURZQ ZLWKRXW DFFHVV WR ODPLQLQ RQ D UHFRQVWLWXWHG EDVHPHQW PHPEUDQH JHO IDLOHG WR PDLQWDLQ WKH DFLQDU FHOO FKDUDFWHULVWLFV &XWOHU H[DPLQHG WKH HIIHFWV RI SRO\FORQDO RU PRQRFORQDO DQWLERGLHV GLUHFWHG DJDLQVW H[WUDFHOOXODU PDWUL[ FRPSRQHQWV RQ LQ YLWUR FXOWXUHG GHYHORSLQJ UDW VXEPDQGLEXODU JODQG UXGLPHQWV &XOWHU f :KHQ WKHVH GD\ UDW VXEPDQGLEXODU JODQG UXGLPHQWV ZHUH FXOWXUHG LQ WKH SUHVHQFH RI DQWLODPLQLQ DQWLERGLHV WKH\ JUHZ DW WKH VDPH UDWH DV FRQWURO UXGLPHQWV EXW EUDQFKLQJ PRUSKRJHQHVLV DQG VHFUHWRU\ FHOO GLIIHUHQWLDWLRQ ZDV UHWDUGHG :KHQ UXGLPHQWV ZHUH FXOWXUHG LQ WKH SUHVHQFH RI DQWLFROODJHQ DQWLERG\ RQO\ RI JODQGV GHPRQVWUDWHG EUDQFKLQJ PRUSKRJHQHVLV DQG QRQH RI f KDG VHFUHWRU\ GLIIHUHQWLDWLRQ RI WKH VHFUHWRU\ HQGSLHFHV 7KHVH UHVXOWV VXJJHVW WKDW W\SH ,9 FROODJHQ DV ZHOO DV ODPLQLQ DUH LQYROYHG LQ WKH UHJXODWLRQ RI VDOLYDU\ JODQG PRUSKRJHQHVLV DQG WKDW WKH SURFHVV RI EUDQFKLQJ PRUSKRJHQHVLV DQG VHFUHWRU\ FHOO GLIIHUHQWLDWLRQ ZLWKLQ VDOLYDU\ JODQGV DUH SDUWLDOO\ FRXSOHG EXW LQGHSHQGHQWO\ UHJXODWHG $GGLWLRQDOO\ DOWHUDWLRQV LQ WKH PRUSKRORJ\ RI WKH EDVHPHQW PHPEUDQH KDYH EHHQ UHSRUWHG LQ GXFWOLJDWHG VDOLYDU\ JODQGV ZLWK IDLOXUH RI WKH PHPEUDQH WR UHWDLQ LWV GLIIHUHQWLDWLRQ DQG VHFUHWRU\ DFWLYLW\ VXJJHVWLQJ WKDW

PAGE 32

ODPLQLQ SOD\V D UROH LQ PDLQWDLQLQJ JODQGXODU PRUSKRORJ\ (PPHOLQ HW DO f ,W LV QRZ NQRZQ WKDW ODPLQLQ SURPRWHV D ZLGH DUUD\ RI GHYHORSPHQWDO DFWLYLWLHV LQFOXGLQJ FHOOXODU DGKHVLRQ PLJUDWLRQ GLIIHUHQWLDWLRQ SUROLIHUDWLRQ QHXULWH RXWJURZWK DQG WXPRU JURZWK +RIIPDQ HWDO f 6HYHUDO FODVVHV RI FHOOVXUIDFH UHFHSWRUV KDYH EHHQ VKRZQ WR LQWHUDFW ZLWK WKH IXQFWLRQDO GRPDLQV RI ODPLQLQ 2QH FODVV WKDW LQWHUDFWV ZLWK ODPLQLQ LV WKH KHWHURGLPHULF FHOO VXUIDFH UHFHSWRU LQWHJULQV 7KHVH LQWHJULQV FRQVLVW RI QRQFRYDOHQWO\ DVVRFLDWHG D DQG VXEXQLWV +\QHV f ,QWHTULQ FRPSRVLWLRQ 7KH LQWHJULQV FRPSULVH D IDPLO\ RI KHWHURGLPHULF UHFHSWRUV FRPSRVHG RI D VLQJOH D DQG c VXEXQLW 7R GDWH D FKDLQV DQG FKDLQV KDYH EHHQ LGHQWLILHG +\QHV f 7KH D FKDLQV PD\ DVVRFLDWH ZLWK D YDULHW\ RI GLIIHUHQW VXEXQLWV OHDGLQJ WR WKH SRVVLELOLW\ RI PRUH WKDQ GLIIHUHQW SHUPXWDWLRQV 1RQHWKHOHVV VHYHUDO VXEJURXSLQJV RI LQWHJULQV KDYH EHHQ QRWHG ,QWHJULQV FRQWDLQLQJ WKH FKDLQ DUH ODUJHO\ LQYROYHG LQ LQWHUDFWLRQV EHWZHHQ FHOO VXUIDFHV DQG (&0 PROHFXOHV VXFK DV FROODJHQV ODPLQLQ DQG ILEURQHFWLQ *DUUDWW DQG +XPSKULHV +\QHV f 7KH FKDLQ LQWHJULQV DSSHDU WR EH DIILOLDWHG ZLWK LQIODPPDWRU\ FHOOV DQG DUH WKXV WHUPHG WKH fOHXNRF\WH LQWHJULQVf ZKLOH WKH FKDLQ LQWHJULQV DUH DVVRFLDWHG ZLWK FHOOV RI WKH YDVFXODU V\VWHP +\QHV f %RWK VXEXQLWV FRQVLVW RI D ODUJH H[WUDFHOOXODU GRPDLQ D WUDQVPHPEUDQH GRPDLQ DQG D VKRUW F\WRSODVPLF GRPDLQ 8QOLNH JURZWK IDFWRU UHFHSWRUV WKH\ GR QRW KDYH W\URVLQH NLQDVH

PAGE 33

GRPDLQV \HW WKH\ PLPLF JURZWK IDFWRU VLJQDO WUDQVGXFWLRQ HYHQWV VXFK DV &DA PRELOL]DWLRQ DFWLYDWLRQ RI 3/&\ DQG WKH PLWRJHQ DFWLYDWHG SURWHLQ NLQDVH 0$3.f FDVFDGH DQG W\URVLQH SKRVSKRU\ODWLRQ RI S)$. -XOLDQR DQG +DVNLOO f 'RZQVWUHDP VLJQDO WUDQVGXFWLRQ HYHQWV DVVRFLDWHG ZLWK LQWHJULQV VHHP WR LQWHUVHFW ZLWK WKH 5DV SDWKZD\ SDUWLFXODUO\ WKH DFWLYDWLRQ RI 0$3 NLQDVHV 7KH JHQHUDO VWUXFWXUH RI DQ LQWHJULQ UHFHSWRU FRQVLVWV RI VHYHUDO FRPSRQHQWV 7KH D VXEXQLWV UDQJH LQ VL]H IURP WR DPLQR DFLGV 7KH 1WHUPLQXV FRQWDLQV UHSHDWLQJ GRPDLQV WKDW DUH FDWLRQ ELQGLQJ GRPDLQV IRU &D 0J DQG FDOPRGXOLQ 7XFNZHOO DQG +XPSKULHV f 7KH WUDQVPHPEUDQH DQG LQWUDFHOOXODU GRPDLQV DUH UHODWLYHO\ VKRUW DURXQG DPLQR DFLGV DQG DUH ZHOO FRQVHUYHG 7KH S VXEXQLWV DUH VPDOOHU WKDQ WKH D VXEXQLWV m DPLQR DFLGVf DQG DOVR KDYH D UHJLRQ RI UHSHDWHG VHTXHQFHV ZLWK (*)OLNH GRPDLQV 7KH D DQG S VXEXQLWV PXVW DVVRFLDWH ZLWK HDFK RWKHU WKURXJK QRQFRYDOHQW LQWHUDFWLRQV WR JDLQ HIIHFWLYH OLJDQGELQGLQJ +RJHUYRUVW HWDO /RIWXV HWDO *LDQFRWWL HWDO f ,QWHJULQV DV (&0 UHFHSWRUV ,QWHJULQV ELQG WR FRPSRQHQWV RI WKH (&0 LQFOXGLQJ ODPLQLQ 7KH LQLWLDO UHVSRQVH WR OLJDQG ELQGLQJ WR WKH LQWHJULQ UHFHSWRU LV FOXVWHULQJ RI WKH LQWHJULQ D DQG VXEXQLWV ZKLFK WKHQ WULJJHUV IRUPDWLRQ RI F\WRSODVPLF FRPSOH[HV LQYROYLQJ F\WRVNHOHWDO SURWHLQV &\WRVNHNHWDO SURWHLQV WDOLQ DQG DDFWLQLQ ELQG WKH F\WRSODVPLF WDLO RI WKH S VXEXQLW WKHQ LQLWLDWH ELQGLQJ RI ]\[LQ SD[LOOLQ DQG

PAGE 34

YLQFXOLQ 7KLV ZKROH FRPSOH[ ZLOO WKHQ ELQG WHQVLQ 7HQVLQ DQG DDFWLQLQ ZKHQ LQ WKLV DUUDQJHPHQW DSSHDU VWUXFWXUDOO\ FDSDEOH RI ELQGLQJ DQG LQGXFLQJ F\WRVNHOHWDO DFWLQ ILODPHQW UHDUUDQJHPHQWV /DIUHQLH DQG
PAGE 35

)LJXUH 6FKHPDWLF RI ,QWHJULQ0DWUL[ ,QWHUDFWLRQV /LJDQG ELQGLQJ RI LQWHJULQ WR (&0 LQGXFHV FOXVWHULQJ RI LQWHJULQ D DQG S VXEXQLWV ZKLFK WULJJHUV IRUPDWLRQ RI F\WRSODVPLF FRPSOH[HV RI F\WRVNHOHWDO SURWHLQV &\WRVNHOHWDO SURWHLQV WDOLQ DDFWLQLQ ELQG WKH S VXEXQLWV F\WRSODVPLF WDLO WKHQ ELQG ]\[LQ SD[LOOLQ DQG YLQFXOLQ ZKLFK WKHQ ELQG WHQVLQ 7HQVLQ DQG DDFWLQLQ FDQ ELQG WR F\WRVNHOHWDO DFWLQ ILODPHQWV $JJUHJDWLRQ RI LQWHJULQ UHFHSWRUV DOVR OHDGV WR SKRVSKRU\ODWLRQ RI )RFDO $GKHVLRQ .LQDVHV )$.Vf ZKLFK FDQ WKHQ OHDG WR VLJQDO WUDQVGXFWLRQ PHFKDQLVPV *DO7DVH LV DOVR NQRZQ WR ORFDOL]H ZLWK DFWLQ F\WRVNHOHWRQ VXJJHVWLQJ WKDW *DO7DVH PD\ DOVR EH LQYROYHG

PAGE 36

,QWHTULQV LQIOXHQFH RQ JURZWK 7KH LQWHJULQV DUH DOVR WKRXJKW WR SOD\ D PRUH GLUHFW UROH LQ VLJQDO WUDQVGXFWLRQ IRU FHOO JURZWK ,W LV NQRZQ WKDW ZKHQ FHOOV DUH ERXQG WR (&0 SURWHLQV WKHLU VLJQDO WUDQVGXFWLRQ FDVFDGH WKURXJK DFWLYDWHG 57. UHFHSWRU W\URVLQH NLQDVHf YLD 5DV 5$) 0(. 0$3. NLQDVHf WR 0$3. LV LQWDFW %XUULGJH HWD f $GGLWLRQDOO\ )$.V IRFDO DGKHVLRQ NLQDVHVf KDYH EHHQ LVRODWHG WKDW ELQG WR F\WRSODVPLF WDLOV RI WKH LQWHJULQ UHFHSWRUV 7KHVH )$.V KDYH ELQGLQJ VLWHV IRU 6UF ZKLFK PD\ WKHQ SKRVSKRU\ODWH *UE WKDW ELQG 5DV 5DV RQFH DFWLYDWHG E\ 626 PD\ LQWHUDFW ZLWK 5DI DQG OHDG WR VLJQDO WUDQVGXFWLRQ :KHQ FHOOV DUH QRQDGKHUHQW DQG WKH F\WRVNHOHWDO DUUDLJQPHQW OHVV ULJLG VLJQDO WUDQVPLVVLRQ FDQ EH LQWHUUXSWHG GXH WR WKH IDFW WKDW VRPH RI WKH 5DI DFWLYDWRUV DUH PHPEUDQH ERXQG GLVUXSWLQJ WKH FDVFDGH ,Q WKLV ZD\ LQWHJULQV DUH WKRXJKW WR SOD\ D UROH LQ VLJQDO WUDQVGXFWLRQ E\ VWDELOL]LQJ WKH F\WRVNHOHWDO VSDWLDO DUUDQJHPHQWV RI FRPSRQHQWV QHFHVVDU\ IRU VLJQDO WUDQVGXFWLRQ )LJXUH f )ORZH HWDO f $ VHFRQG PHFKDQLVP LQ ZKLFK LQWHJULQV DUH WKRXJKW WR SOD\ D UROH LQ VLJQDO WUDQVGXFWLRQ LV E\ SK\VLFDOO\ DVVRFLDWLQJ ZLWK JURZWK IDFWRU UHFHSWRUV DQG WKHVH DUH DFWLYHO\ EHLQJ LQYHVWLJDWHG $FWLYDWLRQ RI 57.V VHWV XS D VLJQDO WUDQVGXFWLRQ FDVFDGH WKDW SDUDOOHOV PDQ\ RI WKRVH SUHYLRXVO\ GLVFXVVHG 'RZQ VWUHDP VLJQDO WUDQVGXFWLRQ DVVRFLDWHG HOHPHQWV RI DFWLYDWHG 57.V LQFOXGH 3/&\ SKRVSKROLSDVH & JDPPDf 626 DQG *$3 *73DVH DFWLYDWLQJ SURWHLQf ZKLFK DVVLVW LQ FRQWUROOLQJ WKH DFWLYLW\ RI 5DV SURWHLQV 5DI DQG 0(.0$3. )LJXUH f

PAGE 37

0$3. )LJXUH 6FKHPDWLF 'LDJUDP RI ,QWHJULQ*URZWK )DFWRU ,QWHUDFWLRQV $FWLYDWLRQ RI W\URVLQH NLQDVH UHFHSWRUV JURZWK IDFWRU UHFHSWRUVf OHDGV WR SKRVSKRU\ODWLRQ DQG DFWLYDWLRQ HYHQWV LQFOXGLQJ 3KRVSKROLSDVH & JDPPD 3/&\f 626 *73DVH $FWLYDWLQJ 3URWHLQV *$3f ZKLFK SOD\ D SLYRWDO UROH LQ DFWLYDWLQJ 5DV SURWHLQV LQ WKH 0$3 NLQDVH VLJQDO WUDQVGXFWLRQ FDVFDGHV &HOOVXUIDFH *DO7DVH LV NQRZQ WR LQGXFH (*) 5 PHGLDWHG VLJQDO WUDQVGXFWLRQ YLD F\WRVROLF W\URVLQH NLQDVH 7KLV SDWKZD\ SDUDOOHOV WKRVH RI LQWHJULQ GHSHQGHQW FDVFDGHV

PAGE 38

*OYFRVYOWUDQVIHUDVHV $QRWKHU FHOO VXUIDFH UHFHSWRU RI ODPLQLQ LV _JDODFWRV\OWUDQVIHUDVH %HWD JDODFWRV\OWUDQVIHUDVH *DO7DVHf LV D PHPEHU RI D IDPLO\ RI HQ]\PHV WHUPHG JO\FRV\OWUDQVIHUDVHV &HOOVXUIDFH *DO7DVH LV QRW WKH RQO\ PHPEUDQH ERXQG JO\FRV\OWUDQVIHUDVH LQ IDFW FRQVHUYDWLYH HVWLPDWHV VXJJHVW WKDW WKHUH PD\ EH PRUH WKDQ PHPEUDQHERXQG HQ]\PHV WKDW SDUWLFLSDWH LQ JO\FRSURWHLQ ELRV\QWKHVLV DORQH 5XVVR HW DO f $ SDUWLDO OLVWLQJ RI JO\FRV\OWUDQVIHUDVHV LQYROYHG LQ JO\FRSURWHLQ RU JO\FROLSLG V\QWKHVLV DQG WKHLU GRQRU VXEVWUDWHV LV VHHQ LQ 7DEOH 5RVHPDQ ILUVW UHSRUWHG FHOOVXUIDFH H[SUHVVLRQ RI JO\FRV\OWUDQVIHUDVHV DQG VXJJHVWHG WKHLU LQYROYHPHQW LQ FHOOXODU DFWLYLWLHV LQFOXGLQJ JURZWK FRQWURO 5RVHPDQ f 6LQFH WKDW UHSRUW QXPHURXV JO\FRV\OWUDQVIHUDVHV KDYH EHHQ LGHQWLILHG DV KDYLQJ WKH DELOLW\ WR EH H[SUHVVHG RQ WKH FHOOVXUIDFH LQFOXGLQJ *DO7DVH IXFRV\OWUDQVIHUDVH DQG VLDO\OWUDQVIHUDVH 7R GDWH WKH SUHVHQFH RI *DO7DVH RQ WKH VXUIDFH RI FHOOV KDV EHHQ YHULILHG E\ LPPXQRIOXRUHVFHQFH PLFURVFRS\ /RSH] DQG 6KXU f IORZ F\WRPHWU\ 0DUFKDVH HW DO f LPPXQRHOHFWURQ PLFURVFRS\ 6XJDQXPD HW DO f DQG GHWHFWLRQ RI HQ]\PH DFWLYLW\ RQ SXULILHG SODVPD PHPEUDQHV /RSH] HW DO 1HHO\ 3XUXVKRWKDP HW DO Ef *O\FRV\OWUDQVIHUDVHV DUH WUDGLWLRQDOO\ IRXQG DV PHPEUDQH ERXQG HQ]\PHV LQ WKH URXJK HQGRSODVPLF UHWLFXOXP DQG *ROJL FRPSOH[ ZKHUH WKH\ SDUWLFLSDWH HQ]\PDWLFDOO\ LQ JO\FRFRQMXJDWH ELRV\QWKHVLV DQG SRVWWUDQVODWLRQDO PRGLILFDWLRQ RI SURWHLQV DQG OLSLGV )LJXUH f 7KH ELRV\QWKHVLV RI JO\FRSURWHLQV UHTXLUHV WKH DWWDFKPHQW RI ROLJRVDFFKDULGH FKDLQV WR WKH

PAGE 39

*O\FRV\OWUDQVIHUDVHV RI *O\FRSURWHLQ DQG *O\FROLSLG 6\QWKHVLV *O\FRV\OWUDQVIHUDVH 'RQRU 6HTXHQFH )RUPHG *DODFWRVYOWUDQVIHUDVHV *,F1$F >*7 8'3*DO *DO *,F1$F5 *DO m*7 8'3*DO *DO D *DO > *,F1$F5 6LDOYWUDQVIHUDVHV *DO D67 &031HX$F 1HX$F D *DO > *,F1$F5 )XFRVYOWUDQVIHUDVHV *,F1$F D)7 *'3)XF )XF D *,F1$F5 *DO *DO D)7 *'3)XF )XF F[ *DO *OF1$F5 )XF [ *DO *DO1$F5 $$FHW\OTDODFWRVDPLQ\OWUDQVIHUDVHV *DO D*DO1$F7 8'3*DO1$F *DO 1$F D *DO5 )XF D 7DEOH $ SDUWLDO OLVWLQJ RI JO\FRV\OWUDQVIHUDVHV LQYROYHG LQ JO\FRSURWHLQ DQG JO\FROLSLG V\QWKHVLV $EEUHYLDWLRQV FRPELQH WKH DFFHSWRU VXJDU *DO JDODFWRVH *OF JOXFRVH )XF IXFRVHf WKH OLQNDJH IRUPHG WKH JO\FRV\OWUDQVIHUDVH IDPLO\ WR ZKLFK WKH FRPSOH[ EHORQJV DQG 5 UHSUHVHQWV WKH UHPDLQGHU RI WKH JO\FRSURWHLQ $GDSWHG IURP 3DXOVRQ DQG &ROOH\ f

PAGE 40

F\WRVRO 8'3JDODFWRVH 803 )LJXUH 7KH 5ROH RI *ROJL *DO7DVH *DO7DVH LV W\SLFDOO\ IRXQG ZLWKLQ WKH *ROJL DSSDUDWXV ZKHUH LW IXQFWLRQV HQ]\PDWLFDOO\ WR SDUWLFLSDWH LQ JO\FRFRQMXJDWH ELRV\QWKHVLV *DO7DVH WUDQVIHUV WKH VXJDU 8'3*DO WR WKH SRO\SHSWLGH EDFNERQH YLD WKH *,F1$F UHVLGXH

PAGE 41

SRO\SHSWLGH EDFNERQH 7KLV OLQNDJH PD\ RFFXU YLD D K\GUR[\O JURXS RU DQ DPLQR JURXS $WWDFKPHQW RI WKH ROLJRVDFFKDULGH PRLHW\ WR D K\GUR[\O JURXS RI WKH DPLQR DFLGV VHULQH RU WKUHRQLQH DUH FDOOHG 2JO\FRVLGH RU 1 DFHW\OJDODFWRVDPLQH OLQNDJHV *DO1$Ff 7KH DWWDFKPHQW YLD WKH DPLQR JURXS RI DVSDUDJLQH LV FDOOHG DQ 1JO\FRVLGH RU 1DFHW\OJOXFRVDPLQH *,F1$Ff OLQNDJH 7KH %TDODFWRV\OWUDQVIHUDVH *DO7DVH *DO7DVH VHOHFWLYHO\ JO\FRV\ODWHV *,F1$F VXEVWUDWHV WR IRUP ODFWRVDPLQH EHORZf .RUQIHOG DQG .RUQIHOG f *DO7DVH 8'3 *DO *DO *,F1$F 8VLQJ WKH HQHUJ\ RI WKH QXFOHRWLGH SKRVSKRGLHVWHU ERQG WKHVH HQ]\PHV PD\ DOVR FDWDO\]H WUDQVIHU D VLQJOH VXJDU UHVLGXH IURP 8'3*DO WR WHUPLQDO *,F1$F JO\FRVLGH DFFHSWRUV DIWHU PDQQRVH EUDQFKLQJ KDV RFFXUUHG DV LOOXVWUDWHG EHORZ *,F1$F 0DQ 0DQ *,F1$F *,F1$F r *,F1$F 0DQ r JDODFWRV\OWUDQVIHUDVH IXQFWLRQV DW WKHVH *,F1$F UHVLGXHV WR WUDQVIHU JDO DIWHU PDQQRVH EUDQFKLQJ KDV RFFXUUHGf

PAGE 42

,Q QRQODFWDWLQJ WLVVXHV *DO7DVH FDWDO\]HV WKH LQFRUSRUDWLRQ RI JDODFWRVH DW WKH EHWD OLQNDJH WR *,F1$F UHVLGXHV DW WKH QRQUHGXFLQJ WHUPLQL %UHZ HWDO +LOO DQG %UHZ f *DO7DVH PD\ DGGLWLRQDOO\ EH IRXQG DV VROXEOH IRUPV LQ PLON WKXV WKH WHUP fWKH PLON HQ]\PHff DPQLRWLF IOXLG FHUHEURVSLQDO IOXLG VDOLYD XULQH FRORVWUXP DQG VHUXP DQG FDQ V\QWKHVL]H ODFWRVH DW D YHU\ KLJK DIILQLW\ GXH WR WKH SUHVHQFH RI WKH PLON SURWHLQ D ODFWDOEXPLQ DFFRUGLQJ WR WKH IROORZLQJ ELRFKHPLFDO UHDFWLRQ 6FKDFKWHU DQG 5RGHQ (EQHU f *DO7 DVH IUHHJOX 8'3*DO } JOXFRVHf DODFWDLEXPLQ *DO *OX ODFWRVHf GLVDFFKDULGH 5HVXOWV RI FRPSHWLWLYH LQKLELWLRQ VWXGLHV VXJJHVWHG WKDW WKH D ODFWDOEXPLQ PROHFXOH IRXQG RIWHQ LQ ODFWDWLQJ WLVVXHV LQGXFHV D FRQIRUPDWLRQDO DOWHUDWLRQ RI WKH *DO7DVH HQ]\PH WKDW SUHYHQWV H[SRVXUH RI WKH DFWLYH ELQGLQJ VLWH 'R HW DW f 7KHVH VWXGLHV GHPRQVWUDWHG WKDW D ODFWDOEXPLQ LQGXFHV D IROG GHFUHDVH LQ WKH HQ]\PHfV FDSDFLW\ WR WUDQVIHU *DO IURP 8'3*DO WR WKH DFFHSWRU *,F1$F ,QVWHDG WKH SUHIHUUHG VXEVWUDWH EHFRPHV *OX .RUQIHOG DQG .RUQIHOG f 5HVHDUFKHUV DW WKH 6WUXFWXUDO %LRORJ\ 6HFWLRQ RI WKH 'LYLVLRQ RI %LRORJLFDO 6FLHQFHV DW WKH 1DWLRQDO &DQFHU ,QVWLWXWH KDYH UHSRUWHG WKDW WKH PDMRU ELQGLQJ UHJLRQV IRU VXJDU DFFHSWRU DQG VXJDUQXFOHRWLGH GRQRUV OLH LQ

PAGE 43

WKH 1 DQG & WHUPLQDO KDOYHV RI WKH FDWDO\WLF SRUWLRQ RI WKH SURWHLQ UHVSHFWLYHO\ DQG WKH WZR ELQGLQJ VXUIDFHV RYHUODS DW WKH FDWDO\WLF VLWH &XUUHQWO\ WKLV JURXS LV DOVR LQYHVWLJDWLQJ WKH WKUHH GLPHQVLRQDO VWUXFWXUH RI WKLV HQ]\PH E\ ;UD\ FU\VWDOORJUDSK\ *O\FRSURWHLQV DUH VWUXFWXUDOO\ GLVWLQJXLVKDEOH IURP RWKHU SURWHLQV E\ WKH SUHVHQFH RI ROLJRVDFFKDULGH VLGH FKDLQV WKDW DUH FRYDOHQWO\ DWWDFKHG WR WKH SRO\SHSWLGH EDFNERQH *O\FRSURWHLQV DUH XELTXLWRXV DQG IXOILOO D YDULHW\ RI ELRORJLFDO IXQFWLRQV IURP IHUWLOL]DWLRQ PRUXOD FRPSDFWLRQ WLVVXH RUJDQL]DWLRQ WR FHOO PLJUDWLRQ 6KXU DQG %HQQHWW 6KXU DQG +DOO E 6KXU (FNVWHLQ DQG 6KXU f 7KLV GLYHUVLW\ RI FKDUDFWHULVWLF FKHPLFDO DQG SK\VLFDO SURSHUWLHV DSSHDU WR VWHP SDUWLDOO\ IURP WKH WKUHH GLPHQVLRQDO VWUXFWXUH DQG FRQIRUPDWLRQDO DOWHUDWLRQV WKHVH ROLJRVDFFKDULGH VLGH FKDLQ OLJDQGV LPSDUW VXFK DV GXULQJ DWWDFKPHQW DQG PLJUDWLRQ 3RXOVHQ DQG &ROOH\ f ,W LV DOVR NQRZQ WKDW JO\FRV\ODWLRQ SDWWHUQV IOXFWXDWH GXULQJ PDQ\ ELRORJLF HYHQWV VXFK DV JURZWK GHYHORSPHQW RU GLVHDVH 3HQQR HW DO 3DVVDQLWL DQG +DUW f 7KH JHQHUDO VWUXFWXUH RI FHOOVXUIDFH *DO7DVH KDV EHHQ HOXFLGDWHG DQG FRQVLVW RI VHYHUDO FRPPRQ IHDWXUHV LQFOXGLQJ DQ 1WHUPLQDO F\WRSODVPLF WDLO D WUDQVPHPEUDQH GRPDLQ D VWHP UHJLRQ DQG D &WHUPLQDO FDWDO\WLF GRPDLQ IDFLQJ WKH OXPHQ )LJXUH f 7KH JHQH HQFRGLQJ PXULQH *DO7DVH ZDV LVRODWHG DQG FKDUDFWHUL]HG LQ )LJXUH f 6KDSHU HW DO f 7KH ORFDOL]DWLRQ RI WKH JHQH IRU *DO7DVH KDV EHHQ PDSSHG WR D SRVLWLRQ LQ WKH FHQWURPHULF UHJLRQ RI WKH PRXVH FKURPRVRPH 6KDSHU HWD f

PAGE 44

F\WRSODVPLF WDLO WUDQVPHPEUDQH GRPDLQ FDWDO\WLF GRPDLQ OXPHQ )LJXUH 7KH *HQHUDO 6WUXFWXUH RI &HOO6XUIDFH *DO7DVH 7KH JHQHUDO VWUXFWXUH RI FHOOVXUIDFH *DO7DVH LV GHSLFWHG KHUH *DO7DVH KDV D VKRUW F\WRSODVPLF DPLQR WHUPLQDO WDLO D VLQJOH WUDQVPHPEUDQH VSDQQLQJ GRPDLQ DQG D ORQJ OXPHQDO FDWDO\WLF FDUER[\O GRPDLQ

PAGE 45

&&&&&7&77$ $$*&&*&**& ***$$*$7*$ **777&*7*$ *&$*77&&7* **&**&$*&* &&*&*$7*&& ***&*&*$&& &7*&$*&*** &&7*&&*&&7 *&7&*7**&& *7&7*&*&*& 7*&$&&7&** &*7&$&&&7& *7 &7 $77 $&& 7&7&7**&&* &*$7&7*$*& &*&&7*&&&& $*77**7&** $*7&7&&7&7 $&$&7*&$** *&**&$&*$$ &**&*&&*&$ *&&$*&$$*& $*&&&&&$** $*$*&$*&** &&*&****7* &*&**&&*&& *&&7&&777$ **&*7&7&&& &*$$*&&7&* &&&***7&7& *$&7&&$*&& &7**7*&$*& 77&7**&&&& **&77*$$*$ *&$$&77*7& 77&*77*&&$ *7*&&&$&&$ &&$&7 **$&7 *77*7&*&7* &&$*&77*&& &7*$**$*7& &&&*&7*&7& *77**&&&&$ 7*&7*$77*$ &777$$7$77 *&7*7**$7& 7**$*&7777 **&$$$*$$* $$&&&$*$*$ 7$$$*$&*** &**&&*77$& 7&&&&&$$* *$&7*7*7&7 &7&&7&$&$$ **7**&&$7& $7&$7&&&$7 7&&*7$$&&* *&$**$*&$7 &7&$$$7$&7 **&7*7$77$ 777*&$7&&& $7&&77&$*& *&&$*&$$&7 &*$&7$7**& $7&7$&*7&$ 7&$$7&$**& 7**$*$&$&& $7*77&$$7& *$*&7$$*&7 *&7&$$7$77 **&777&$$* $**&&77*$$ **$&7$7*$7 7$&$$&7*&7 77*7*77&$* 7*$7*7**$& &7&$77&&*$ 7**$&*$&&* 7$$7*&&7$& $**7*77777 &*&$*&&$&* *&$&$777&7 *77*&$$7** $&$$*77&** *777$*&&7* &&$7$7*77& $*7$7777** $**7*7&7&7 *&7&7&$*7$ $$&$$&$*77 7&77*&&$7& $$7**$77&& &7$$7$$77$ 77****77** **$**$*$$ *$7*$&*$&$ 77777$$&$*$ 77$*77&$7$ $$**&$7*7& 7$7$7&$&*7 &&$$$7*&7 *7 $*7$***$ **7*7&*$$7 *$7&&**&$7 7&$$*$*$&$ $*$$$$$7*$ *&&&$$7&&7 &$*$**777* $&&**$7&*& $&$7$&$$$* *$$$&*$7*& *&77&*$7** 777*$$&7&$ &77$&&7$&$ $**7*77**$ 7*7$&$*$*$ 7$&&&*77$7 $7$&&&$$$7 &$&$*7**$& $7&***$&$& &*$*$7$*&$ 77777$*7$& &$$7$$*$*$ &&7*$*$$7* *&&**$*$& &7&$*$7$7* 7*7&7&7*&& $*77 *$&7** *&7*n _n *7&&&7 &7*$777*7 $ ‘ *$*7&7*$$7 *$&$*77&77 &77$7&$77& $*$&*7&&&7 &&$*$7*&&& $***7*$*7* 7$$&$777$& &&$&$$&&7* *&7&**&$&7 **$7*$$$77 &7$&$$**7* $*7**$*7*7 $$$$&7**7& $*&&&77**$ *$*$&77&77 **77*7*7&$ &&&&&$$$*$ *7&$*$$&7* 7$&$&$*77& $$$$&77$*7 *$&7*7***7 &$&$77&&&$ &7*77*$$$& 7*&7$$$77* 7*$&&7*** *$$**$&777 *&777$*7&* *7*$7*77&* 7$&77**7*$ &$$$77*$* &7*&7*&7** $77&$*$77* $&$$*$7777 &77**$7777 777777$7$& *$$$$7*$$ $$777&$$7& $*7&7&*7*& 7&7*7&&&77 7$&$7&**7$ 7*&*$&7$77 $&$$7&$&7* 7*7*7*7*7& 7777&77$*& $$$**&*77 77$$$$&77* $*&&7**$&& 77****7&&7 *7$*7*7*7* *$77&&$ $** &&77*&&&7& ƒ*ƒ*&$**** &&7 ***&$&7 &7&$&7&$&* 7**&&7*7&7 &&$*$7&&&7 *7&7*$777& 7*$$7*7$$$ *$**&77777 *7777*7777 7*77777*77 WW7$*DDJFD *77&*7$*7$ 777*$$$*$$ 7$$$7&$$*7 777*$77$7* &7$7$**77* $77777*7*7 7*$7&&$$$7 &$*$$7$*&7 $77*$*7*77 7$$*7&$7*$ f )LJXUH 7KH *HQRPLF 6HTXHQFH IRU 0XULQH _JDODFWRV\OWUDQVIHUDVH 1XFOHRWLGH VHTXHQFH RI F'1$ HQFRGLQJ *DO7DVH DV UHSRUWHG E\ 6KDSHU HWDO LV IRXQG DW PXULQH FKURPRVRPH S 7ZR SXWDWLYH VWDUW $7* FRGRQV WKDW FRUUHVSRQG WR WKH ORQJ FHOOVXUIDFHf DQG VKRUW *ROJLf IRUPV RI *DO7DVH DUH VKRZQ 7KH XQGHUOLQHG VHTXHQFH LV WKH SXWDWLYH WUDQVPHPEUDQH GRPDLQ ZKLOH WKH EROG XQGHUOLQH UHJLRQV GHSLFW WKH XSVWUHDP ff DQG GRZQVWUHDP ff SULPHUV ZKLFK SURGXFH D ES SURGXFW $GGLWLRQDOO\ WKH SXWDWLYH 7$* VWRS FRGRQ DQG WKH UHVWULFWLRQ VLWH IRU $YD ,, WKDW SURGXFHV D VLQJOH FXW ZLWKLQ WKH SUHGLFWHG 573&5 SURGXFW f DUH VKRZQ 7KH KLJKOLJKWHG VHTXHQFH ZLWKLQ WKH VKDGHG RSHQ UHDGLQJ IUDPH FRUUHVSRQGV ZLWK WKH '1$ JHO VHTXHQFH RQ SDJH FRQILUPLQJ WKH ILGHOLW\ RI RXU SULPHUV

PAGE 46

6XEVHTXHQW UHSRUWV IURP WKH VDPH ODERUDWRU\ GHPRQVWUDWHG WKDW WKH JHQH HQFRGHV WZR VLPLODU EXW QRW LGHQWLFDO SURWHLQV 5XVVR HWD f 7KH ORQJ IRUP RI WKH JHQH HQFRGHV IRU D DPLQR DFLG SURWHLQ ZKLOH WKH VKRUW IRUP HQFRGHV IRU D DPLQR DFLG SURWHLQ 7KH WZR *DO7DVH SURWHLQV KDYH LGHQWLFDO FDWDO\WLF DQG WUDQVPHPEUDQH GRPDLQV EXW GLIIHU LQ WKHLU F\WRSODVPLF GRPDLQV DV D UHVXOW RI WZR LQIUDPH SXWDWLYH VWDUW VLWHV 7HDVGDOH HW DW UHSRUWHG WKDW DSSUR[LPDWHO\ WHQ SHUFHQW RI WKH WRWDO FHOOXODU *DO7DVH LV H[SUHVVHG RQ WKH FHOOVXUIDFH DV GHWHUPLQHG E\ IORZ F\WRPHWULF GDWD RI VWDEOHO\ WUDQVIHFWHG FHOOV 7HDVGDOH HW DO f 7KH WUDQVPHPEUDQH GRPDLQ RI WKH VKRUWHU PRUH DEXQGDQW DPLQR DFLG SURWHLQ FRQWDLQV WKH VLJQDO DQG UHTXLUHG F\VWHLQH DQG KLVWLGLQH UHVLGXHV IRU UHWHQWLRQ LQ WKH *ROJL 1LOVVRQ HW DO $RNL HW DO 7HDVGDOH HW DO f ZKLOH WKH ORQJ IRUP ZLWK LWV XQLTXH DPLQR DFLG H[WHQVLRQ LV WUDQVSRUWHG WR WKH FHOOVXUIDFH /RSH] HWDO f &HOOVXUIDFH *DO7DVH *DO7DVH KDV EHHQ VXJJHVWHG WR SOD\ D UROH LQ PDQ\ GLIIHUHQW ELRORJLFDO IXQFWLRQV ZKHQ ORFDOL]HG WR WKH SODVPD PHPEUDQH *DO7DVH LV WKRXJKW WR EH LQYROYHG LQ FHOOFHOO DFWLYLWLHV VXFK DV IHUWLOL]DWLRQ 6KXUDQG 1HHO\ 6KXU DQG +DOO D 6KXU DQG +DOO E /RSH] HWDO %HQDX DQG 6WRUH\ %HQDX HW DO f DQG SUROLIHUDWLRQ WKURXJK WKH (*)5*7 LQWHUDFWLRQ 3XUXVKRWKDP HWDO D .LGG HWDO 0DUFKDVH HW DO f DQG FHOOPDWUL[ LQWHUDFWLRQV ZLWK QHXULWH RXWJURZWK %HJRYDF DQG 6KXU 7KRPDV HW DO 5LRSHOOH DQG 'RZ %HJRYDF HW DO f

PAGE 47

PDPPDU\ HSLWKHOLDO FHOO UHRUJDQL]DWLRQ %DUFHOORV+RII f DQG FROODJHQ DWWDFKPHQW %DELDU] DQG &XOOHQ f :KLOH PRVW RI WKH UHVHDUFK KDV EHHQ GLUHFWHG WRZDUG LQYHVWLJDWLQJ *DO7DVHfV UROH LQ FHOO PLJUDWLRQ (FNVWHLQ DQG 6KXU (FNVWHLQ DQG 6KXU 5XQ\DQ HWDO 5XQ\DQ HWD 6KXU 6KXU +DWKDZD\ DQG 6KXU f LW LV FOHDU FHOOVXUIDFH *DO7DVH KDV WKH SRWHQWLDO WR EH LQYROYHG LQ D YDULHW\ RI GLIIHUHQW FHOOXODU IXQFWLRQV *DO7DVHfV 5ROH LQ 'HYHORSPHQW $V SUHYLRXVO\ VWDWHG PRUH WKDQ JO\FRV\OWUDQVIHUDVHV KDYH EHHQ LVRODWHG \HW WKH IRFXV FRQWLQXHV WR EH RQ *DO7DVH 7KH SULPH UHDVRQV IRU LQWHUHVW LQ *DO7DVH LV WZR IROG )LUVW ZDV WKH SUHIHUHQWLDO ORFDOL]DWLRQ RI *DO7DVH RQ PLJUDWLQJ RU GHYHORSLQJ FHOOV 6KXU f 7KH VHFRQG UHDVRQ ZDV HYLGHQFH RI VSHFLILF HOHYDWLRQ RI *DO7DVH DFWLYLW\ OHYHOV LQ PXWDQW PRXVH VSHUP FHOOV 6KXU DQG %HQQHWW 6KXU f 7KH\ IRXQG WKDW VSHUP FHOOV ZLWK D PXWDWLRQ LQ WKH 7WFRPSOH[ RQ FKURPRVRPH OHDG WR LQFUHDVHG FHOOVXUIDFH *DO7DVH H[SUHVVLRQ 7KHVH VSHUP ZHUH GHYHORSPHQWDOO\ LPPDWXUH DQG LW LQWHUIHUHG ZLWK QRUPDO IHUWLOL]DWLRQ ,W KDV DOVR EHHQ VKRZQ WKDW PHWDVWDWLF FHOOV GHPRQVWUDWH LQFUHDVHV LQ FHOOVXUIDFH *DO7DVH ZKHQ FRPSDUHG WR WKHLU QRQPHWDVWDWLF YDULDQWV &KDWWHUMHH DQG .LP 0DJD HW DO f

PAGE 48

&HOOFHOO LQWHUDFWLRQV 5HVHDUFKHUV KDYH FRQWLQXHG WR LQYHVWLJDWH WKH SRWHQWLDO WKDW *DO7DVH PD\ SOD\ D UROH LQ JURZWK DQG GHYHORSPHQW VLQFH 5RVHPDQ UHSRUWHG FHOO VXUIDFH H[SUHVVLRQ RI *DO7DVH DQG GHVFULEHG LWV FHOOXODU LQWHUDFWLRQV 5RVHPDQ f 6RPH GLVFXVVLRQ HQVXHG ZKHQ UHVHDUFKHUV GHPRQVWUDWHG WKDW 8'3*DO WKH QXFOHRWLGH VXJDU IRU JDODFWRVHf LQKLELWHG JURZWK RI FXOWXUHG FHOOV 5RWK HW DO .ORKV HW DO f 5RWK KDG LQLWLDOO\ VXJJHVWHG WKDW WKLV FRQWDFW LQKLELWLRQ ZDV D UHVXOW RI FHOOVXUIDFH *DO7DVH .ORKV DQG FRn ZRUNHUV ODWHU GHPRQVWUDWHG WKDW WKLV LQKLELWLRQ ZDV DVVRFLDWHG ZLWK *DO7DVH LQ VHUXP RI WKHLU FXOWXUHV 7KH VSHFLILF UHFRJQLWLRQ DQG ELQGLQJ RI FHOOVXUIDFH *DO7DVH WR WKHLU JO\FRFRQMXJDWH VXEVWUDWHV *,F1$F UHVLGXHVf RQ DGMDFHQW FHOOVXUIDFHV VXJJHVWHG *DO7DVH PD\ SOD\ D UROH LQ FHOOFHOO DGKHVLRQ 7KLV ZDV ODWHU FRQILUPHG E\ 6FXOO\ DQG FRZRUNHUV ZKHQ WKH\ GHPRQVWUDWHG VSDWLDO DQG WHPSRUDO H[SUHVVLRQ RI FHOOVXUIDFH *DO7DVH GXULQJ PRXVH VSHUPDWRJHQHVLV 6FXOO\ HW DO f 7KLV JURXS VKRZHG WKHUH ZDV D IROG LQFUHDVH LQ UHODWLYH GHQVLW\ RI FHOOVXUIDFH GHQVLW\ RI *DO7DVH DW WKH DQWHULRU SRUWLRQ RI D VSHUP KHDG WKDW ZDV DVVRFLDWHG ZLWK DQ HJJ FHOOVXUIDFH JO\FRSURWHLQ 7KH VWDELOLW\ RI WKLV *DO7DVHVXEVWUDWH FRPSOH[ ZDV HQVXUHG EHFDXVH VXJDU QXFOHRWLGHV DUH W\SLFDOO\ DEVHQW LQ WKH H[WUDFHOOXODU IOXLG 7KH VSHUPHJJ DGKHVLRQV FRXOG EH GLVVRFLDWHG KRZHYHU E\ WKH DGGLWLRQ RI 8'3JDO ZKLFK FDWDO\WLFDOO\ VHSDUDWHG WKH VSHUP *DO7DVH IURP LWV JDODFWRV\ODWHG VXEVWUDWH

PAGE 49

*,F1$F UHVLGXH )LJXUH 3RWHQWLDO 0HFKDQLVPV IRU *DO7DVH &HOO&HOO ,QWHUDFWLRQV 6FKHPDWLF UHSUHVHQWDWLRQ RI WKH SRWHQWLDO DVVRFLDWLRQ RI FHOOVXUIDFH *DO7DVH LQ FHOOFHOO LQWHUDFWLRQV DV GHVFULEHG E\ 6KXU 7KH FHOO VXUIDFH *DO7DVH RQ HDFK FHOO UHFRJQL]H *,F1$F UHVLGXH VXEVWUDWH RQ DGMDFHQW FHOOV DQG ELQGV LQ D OHFWLQ OLNH IDVKLRQ

PAGE 50

6KXU DQG 1HHO\ f 6KXU VXJJHVWHG D PRGHO IRU WKLV SRWHQWLDO OHFWLQOLNH FDSDFLW\ RI *DO7DVH )LJXUH f 1XPHURXV UHVHDUFKHUV KDYH QRZ FRQILUPHG LQ D YDULHW\ RI GLIIHUHQW FHOO W\SHV WKDW *DO7DVH GRHV IXQFWLRQ LQ FHOOn FHOO LQWHUDFWLRQV 7DEOH LV D SDUWLDO OLVWLQJ RI WKHVH WLVVXHV DQG UHVHDUFKHUV &HOOVXUIDFH UHFHSWRUV IRU *DO7DVH LQWHUDFWLRQ ,QGLUHFW LPPXQRIOXRUHVFHQFH KDV ORFDOL]HG *DO7DVH WR DUHDV RI LQWHUFHOOXODU FRQWDFW LQ PRVW RI WKH WLVVXHV OLVWHG 0RUH GHWDLOHG DQDO\VLV RI *DO7DVH VXEVWUDWHV LQ ) FHOOV OHDG 0DLOOHW DQG 6KXU 0DLOOHW DQG 6KXU f WR FRQFOXGH WKDW WKHUH ZHUH WKUHH GRPLQDQW VXEVWUDWHV 2QH VXEVWUDWH LV /$03 D PHPEUDQH JO\FRSURWHLQ SUHYLRXVO\ WKRXJKW WR EH H[SUHVVHG RQO\ RQ O\VRVRPHV /$03 ZDV LVRODWHG KRZHYHU IURP FHOO VXUIDFHV LQ WLVVXHV WKDW ZHUH LQ YDULRXV VWDJHV RI WXPRU PHWDVWDVLV &KHQ HW DO f $ VHFRQG PDMRU VXEVWUDWH RI *DO7DVH ZDV IRXQG WR EH D FDGKHULQ PHPEHU RI WKH FHOO DGKHVLRQ IDPLO\ XYRPRUXOLQ WKDW LV NQRZQ WR PHGLDWH LQWHUFHOOXODU DGKHVLRQ LQ KRPRW\SLF WLVVXHV .HPOHU HW DO f 7KH WKLUG GRPLQDQW VXEVWUDWH RI FHOOVXUIDFH *DO7DVH LV ODPLQLQ 0HFKDP f 7KLV VXJJHVWV WKDW PXOWLSOH FHOO DGKHVLRQ PROHFXOHV DQG WKHLU VXEVWUDWHV PD\ FRRSHUDWH WR DFKLHYH WKHLU GHVLUHG UHVXOW $ 5ROH IRU *DO7DVH LQ &HOOXODU 3UROLIHUDWLRQ 7KH SUHYLRXVO\ GHVFULEHG UHVHDUFK LQGLFDWHV WKDW *DO7DVH SDUWLFLSDWHV LQ D OHFWLQOLNH FDSDFLW\ WR PHGLDWH FHOOFHOO DQG FHOOPDWUL[ LQWHUDFWLRQ E\

PAGE 51

6WXGLHV (YDOXDWLQJ WKH 5ROH RI *DO7DVH LQ &H(L&HO( ,QWHUDFWLRQV &HOO ,QWHUDFWLRQ 5HVHDUFKHU 5HSRUW 'DWH 6SHUPDWRF\WH 3UDWW HWDO (PEU\RQDO FDUFLQRPD 6KXU 0DLOOHW DQG 6KXU 0RUXOD FRPSDFWLRQ %D\QD HWDO 8WHULQH HSLWKHOLXP 'XWW HWDO (FWRSODFHQWDO FRQH +DWKDZD\ HWDO 1HXUDO UHWLQD 5RWK HWDO &RQGURJHQLF FRQGHQVDWLRQ &KDWWHUMHH HWDO 6KXU *URZWK FRQWURO 5RWK DQG :KLWH +XPSKUH\V%HKHU HWDO 3XUXVKRWKDP HWDO D 7DEOH 6XPPDU\ RI UHVHDUFK HYDOXDWLQJ *DO7DVHfV UROH LQ FHOOFHOO LQWHUDFWLRQV $ ZLGH YDULHW\ RI GLIIHUHQW FHOO W\SHV KDYH EHHQ LQYHVWLJDWHG

PAGE 52

ELQGLQJ WR *,F1$F VXEVWUDWHV RQ VXUIDFH RU PDWUL[ JO\FRSURWHLQV &HOOVXUIDFH *DO7DVH KDV DOVR EHHQ LPSOLFDWHG DV D SDUWLFLSDQW LQ FHOO GLYLVLRQ E\ LWV DVVRFLDWLRQ ZLWK WKH (SLGHUPDO *URZWK )DFWRU 5HFHSWRU (*)5f VXJJHVWLQJ *DO7DVH PD\ SOD\ D PRUH DFWLYH UROH LQ SUROLIHUDWLRQ *DO7DVH DQG WKH HSLGHUPDO JURZWK IDFWRUUHFHSWRU 6DOLYDU\ JODQG DFLQDU FHOO JURZWK UHJXODWHG E\ FHOOVXUIDFH *DO7DVH LV WKRXJKW WR RFFXU E\ WKH DFWLYDWLRQ RI WKH SKRVSKRW\URVLQH VHFRQG PHVVHQJHU VLJQDOLQJ SDWKZD\ WKDW LV LQLWLDWHG E\ UHFHSWRU LQWULQVLF W\URVLQH NLQDVH DFWLYLW\ WKURXJK LQWHUDFWLRQ RI WKH WUDQVIHUDVH ZLWK WKH FDUERK\GUDWH PRLHWLHV RI WKH HSLGHUPDO JURZWK IDFWRU UHFHSWRU (*)5f 3XUXVKRWKDP HW DO Ef *DO7DVH GRHV QRW DSSHDU WR GLUHFWO\ PHGLDWH VLJQDO WUDQVGXFWLRQ LWVHOI EXW UDWKHU XWLOL]HV WKH (*)5 SDWKZD\ 1DNDJDZD HWD f )LJXUH f &KURQLF DGPLQLVWUDWLRQ RI WKH SDGUHQHUJLF UHFHSWRU DJRQLVW LVRSURWHURQRO ,62f UHVXOWV LQ K\SHUSODVWLF DQG K\SHUWURSKLF JODQG HQODUJHPHQW 6FKQH\HU f 7KH )OXPSKUH\V%HKHU ODERUDWRU\ ILUVW GHPRQVWUDWHG WKDW WKLV FKURQLF ,62 WUHDWPHQW DOVR UHVXOWHG LQ LQFUHDVHG PHVVHQJHU 51$ P51$f H[SUHVVLRQ IRU *DO7DVH )OXPSKUH\V%HKHU HW DO f DQG WKDW XOWLPDWHO\ K\SHUSODVWLF DQG K\SHUWURSKLF JODQG HQODUJHPHQW DQG DFLQDU FHOO JURZWK ,Q YLYR DQG LQ YLWUR ZDV GHSHQGHQW RQ VXUIDFH H[SUHVVLRQ RI WKH HQ]\PH 0DUFKDVH HWDO f *DO7DVH LQWHUDFWV ZLWK WKH FDUERK\GUDWH PRLHW\ RI WKH (*)5 DQG VWLPXODWHV WKH W\URVLQH SKRVSKRU\ODWLRQ FDVFDGH ZKLFK XOWLPDWHO\ OHDGV WR FHOO GLYLVLRQ $QWDJRQLVWV RI WKLV SURFHVV LQFOXGH VSHFLILF *DO7DVH VXEVWUDWHV RU

PAGE 53

DQWLERG\ WR WKH (*)5 ZKLFK KDYH EHHQ VKRZQ WR LQKLELW JODQG HQODUJHPHQW E\ VWHULF KLQGUDQFH EHWZHHQ FHOO VXUIDFH *DO7DVH DQG (*)5 WKXV LQWHUIHULQJ ZLWK WKH LQWUDFHOOXODU RU LQWHUFHOOXODU VLJQDOV IRU JURZWK DQG WKXV LQKLELW FHOO SUROLIHUDWLRQ +XPSKUH\V%HKHU HWDO f 7KH WDUJHWLQJ RI *DO7DVH WR WKH FHOO VXUIDFH LV DVVRFLDWHG ZLWK WKH H[SUHVVLRQ RI D QRYHO NLQDVH WKH *DO7DVHDVVRFLDWHG NLQDVH *7$NLQDVH RU *7$.f ZKLFK VSHFLILFDOO\ SKRVSKRU\ODWHV *DO7DVH 3UHYLRXV UHSRUWV E\ .LGG HWDO DQG 0DFDXOH\ HWDO GHPRQVWUDWHG WKDW WKHUH LV D SHDN LQ H[SUHVVLRQ RI *7$NLQDVH DVVRFLDWHG ZLWK PRUSKRJHQLF GHYHORSPHQW RI IHWDO PRXVH VXEPDQGLEXODU JODQGV DW IHWDO GD\ .LGG HW DO 0DFDXOH\ HW DO f 7KXV WKH DVVRFLDWLRQ RI WKH FHOOVXUIDFH H[SUHVVLRQ RI *DO7DVH DQG WKH RQVHW RI PRUSKRGLIIHUHQWLDWLRQ RI VDOLYDU\ JODQGV DV D SRVVLEOH PHGLDWRU RI JURZWK FRQWURO KDV OHDG WR WKLV UHVHDUFK *DO7DVH DV D FHOO DGKHVLRQ PROHFXOH 2YHU WKH ODVW IHZ \HDUV HYLGHQFH KDV FOHDUO\ LPSOLFDWHG D UROH IRU FHOO DGKHVLRQ UHFHSWRUV LQ VLJQDO WUDQVGXFWLRQ SURFHVVHV WKDW OHDG WR UHJXODWLRQ RI FHOO JURZWK DQG GLIIHUHQWLDWLRQ 5RVDOHV HW DO f 7\SLFDOO\ WKLV VLJQDO WUDQVGXFWLRQ KDV LQYROYHG ERWK FHOO DGKHVLRQ PROHFXOHV &$0Vf DV ZHOO DV LQWHJULQV ERWK RI ZKLFK KDYH EHHQ VKRZQ WR LQYROYH DFWLYDWLRQ RI W\URVLQH NLQDVHV -XOLDQR DQG +DVNLOO f &$0V UROH LQ VLJQDO WUDQVGXFWLRQ KDYH EHHQ VKRZQ WR EH FORVHO\ DVVRFLDWHG ZLWK F\WRVNHOHWRQ 3UHYLRXV UHSRUWV KDYH VKRZQ *DO7DVH WR EH DVVRFLDWHG ZLWK DFWLQ F\WRVNHOHWRQ HOHPHQWV GXULQJ PLJUDWLRQ RI FHOOV RQ ODPLQLQ VXUIDFHV $SSHGGX HW DO $SSHGGX DQG

PAGE 54

6KXU f &$0V LQWHJULQV DQG DSSDUHQWO\ *DO7DVH DOORZ DQFKRUDJH RI WKH FHOO WR WKH H[WUDFHOOXODU PDWUL[ DQG LQLWLDWHV YDULRXV VLJQDO WUDQVGXFWLRQ SURFHVVHV ,QWHJULQ RU &$0 PHGLDWHG VLJQDOLQJ FDQ DIIHFW FHOOXODU HYHQWV LQFOXGLQJ PRWLOLW\ FHOO GLYLVLRQ GLIIHUHQWLDWLRQ DQG DSRSWRVLV +RZH HW DW *XOOEHUJ DQG (NEORP -XOLDQR
PAGE 55

f ,Q KLV PRGHO WKH DGKHVLRQ RI WKH FHOO WR WKH PHPEUDQH RFFXUV YLD HQ]\PDWLF ELQGLQJ RI *DO7DVH WR WKH *,F1$F UHVLGXHV RI WKH (&0 ODPLQLQ )LJXUH f 6WXGLHV VXFK DV WKHVH KDV VXJJHVWHG WKDW *DO7DVH PD\ SOD\ D PRUH DFWLYH UROH WKDQ LQLWLDOO\ WKRXJKW LQ WKH SURFHVVHV RI PRUSKRGLIIHUHQWLDWLRQ DQG XOWLPDWHO\ F\WRGLIIHUHQWLDWLRQ 7DEOH LV D SDUWLDO OLVWLQJ RI WKHVH WLVVXHVFHOOV DQG UHVHDUFKHUV 6WDWHPHQW RI WKH 3UREOHP $ SDUDGR[LFDO VLWXDWLRQ QRZ DSSHDUV WR H[LVW ZKHUH VSHFLILF LQWHJULQV DUH NQRZQ WR FDXVH FHOOXODU DWWDFKPHQW WR ODPLQLQ DQG WKLV PD\ EH WLVVXH VSHFLILF 6LPXOWDQHRXVO\ *DO7DVH LV DOVR NQRZQ WR ELQG WR ODPLQLQ YLD *,F1$F UHVLGXHV LQ D OHFWLQ OLNH IDVKLRQ &RQIRXQGLQJ WKH VLWXDWLRQ *DO7DVH LV NQRZQ WR LQGXFH DFWLYDWLRQ RI WKH SKRVSKRW\URVLQH VHFRQG PHVVHQJHU VLJQDOLQJ SDWKZD\ WKDW LV LQLWLDWHG E\ UHFHSWRU LQWULQVLF W\URVLQH NLQDVH DFWLYLW\ WKURXJK LQWHUDFWLRQ RI WKH WUDQVIHUDVH ZLWK WKH FDUERK\GUDWH PRLHWLHV RI WKH (*)5 $GGLWLRQDOO\ ZH QRZ KDYH HYLGHQFH WKDW (*)5 VWLPXODWLRQ OHDGV WR SKRVSKRU\ODWLRQ HYHQWV FRQWUROOLQJ LQWUDFHOOXODU VLJQDOLQJ IRU FHOO JURZWK 7KHUH QRZ DSSHDUV WR EH D GLFKRWRP\ RI DFWLYLWLHV GXULQJ PRUSKRJHQHVLV DQG FHOO PLJUDWLRQ LQ ZKLFK *DO7DVH PD\ SOD\ D VXEVWDQWLDO UROH 7R LQYHVWLJDWH WKLV VLWXDWLRQ D VWUDWHJ\ ZDV GHYLVHG WR ILUVW HYDOXDWH *DO7DVH H[SUHVVLRQ DQG DFWLYLW\ GXULQJ QRUPDO JURZWK DQG GHYHORSPHQW XWLOL]LQJ WKH PXULQH VDOLYDU\ JODQG DV D WLVVXH PRGHO IRU GHYHORSPHQW 7R UHODWH RXU LQIRUPDWLRQ IURP LQ YLWUR WR QRUPDO GHYHORSPHQW ZH ILUVW HYDOXDWHG D JURXS RI VDOLYDU\ SURWHLQV

PAGE 56

)LJXUH 0RGHO RI *DO7DVH 0HGLDWHG 0LJUDWLRQ $ UHSUHVHQWDWLRQ RI 6KXUfV PRGHO IRU *DO7DVHfV UROH LQ DGKHVLRQ DQG PLJUDWLRQ $SSHGGX DQG 6KXU f 7KH DGKHVLRQ RI WKH FHOO WR WKH PHPEUDQH RFFXUV YLD HQ]\PDWLF ELQGLQJ RI *DO7DVH WR WKH *,F1$F UHVLGXHV RI WKH (&0 ODPLQLQ ,Q WKLV PRGHO QHZ F\WRVNHOHWRQ DVVRFLDWLRQV DUH IRUPHG ZLWK *DO7DVH DQG WKH UDWH RI PLJUDWLRQ LV LQYHUVHO\ UHODWHG WR WKH FHOO VXUIDFH *DO7$VH FRQFHQWUDWLRQ

PAGE 57

6WXGLHV (YDOXDWLQJ WKH 5ROH RI *DO7DVH LQ &HOO0DWUL[ ,QWHUDFWLRQV &HOOXODU $FWLYLW\ 5HVHDUFKHU 5HSRUW 'DWH 7URSKREODVW RXWJURZWK 5RPDJQDQR DQG %DELDU] &HOO PLJUDWLRQ (FNVWHLQ DQG 6KXU 5XQ\DQ HWDO 6KXU 6KXU HWDO +DWKDZD\ DQG 6KXU 1HXULWH RXWJURZWK %HJRYDF DQG 6KXU %HJRYDF HWDO 7KRPDV HWDO 5LRSHOOH DQG 'RZ 0DPPDU\ HSLWKHOLXP UHRUJDQL]DWLRQ %DUFHOORV+RII &ROODJHQ UHDWWDFKPHQW %DUELDU] DQG &XOOHQ 7DEOH 6XPPDU\ RI 5HVHDUFK (YDOXDWLQJ *DO7DVHfV 5ROH LQ &HOO0DWUL[ ,QWHUDFWLRQV $ ZLGH YDULHW\ RI GLIIHUHQW FHOO W\SHV DQG DFWLYLWLHV KDYH EHHQ LQYHVWLJDWHG

PAGE 58

LQFOXGLQJ *DO7DVH DQG WKHLU P51$ H[SUHVVLRQ GXULQJ GHYHORSPHQW DV OLWWOH LQYHVWLJDWLRQ KDV RFFXUUHG WR GHVFULEH WKH IHWDO H[SUHVVLRQ RI VDOLYDU\ SURWHLQV 6XEVHTXHQWO\ ZH XWLOL]HG WKH VDOLYDU\ JODQG UXGLPHQW LQ DQ RUJDQ V\VWHP WR VSHFLILFDOO\ HYDOXDWH WKH UROH *DO7DVH PD\ SOD\ DQG SRWHQWLDO LQWHUDFWLRQV WKDW PD\ RFFXU EHWZHHQ *DO7DVH ODPLQLQ DQG WKH LQWHJULQ UHFHSWRU GXULQJ GHYHORSPHQW

PAGE 59

&+$37(5 7:2 0$7(5,$/6 $1' 0(7+2'6 1RUPDO LQ YLYR 'HYHORSPHQW 7R LQYHVWLJDWH WKH UROH RI *DO7DVH LQ IHWDO PRXVH VDOLYDU\ JODQG GHYHORSPHQW ZH ILUVW H[DPLQHG VRPH RI WKH SDUDPHWHUV DVVRFLDWHG ZLWK QRUPDO JURZWK LQ YLYR DV WKHUH LV D SDXFLW\ RI LQIRUPDWLRQ UHJDUGLQJ WKLV LQ IHWDO PRXVH VDOLYDU\ JODQG UHVHDUFK DQG OLWHUDWXUH ,QLWLDOO\ ZH GHILQHG VRPH RI WKH VDOLYDU\ JODQG SURWHLQV LQFOXGLQJ *DO7DVH DQG HYDOXDWHG WKHLU H[SUHVVLRQ GXULQJ JHVWDWLRQ DQG EH\RQG +DYLQJ REWDLQHG WKH LQIRUPDWLRQ RQ H[SUHVVLRQ SDWWHUQV DVVRFLDWHG ZLWK WKHVH SURWHLQV LQ YLYR LW DOORZHG XV WR HYDOXDWH KRZ ZHOO WKH LQ YLWUR RUJDQ FXOWXUH V\VWHP ZH XVHG PLPLFV LQ YLYR GHYHORSPHQW DQG WR IXUWKHU HOXFLGDWH UROH RI *DO7DVH 6HOHFWLRQ RI 'HYHORSPHQWDO 0DUNHUV 7R GHILQH VRPH RI WKH SDUDPHWHUV DVVRFLDWHG ZLWK QRUPDO JURZWK DQG GHYHORSPHQW ZH GHFLGHG WR HYDOXDWH WKH P51$ H[SUHVVLRQ RI D YDULHW\ RI SURWHLQV DVVRFLDWHG ZLWK D GLIIHUHQWLDWLQJ PRXVH VDOLYDU\ JODQG LQFOXGLQJ VHURXV DQG PXFLQRXV DFLQDU DQG GXFWDO FHOOV 7DEOH SURYLGHV D OLVW RI WKH SURWHLQV ZH LQYHVWLJDWHG (DFK RI WKH VDOLYDU\ GHYHORSPHQWDO SURWHLQV WKDW ZH HYDOXDWHG ZLOO QRZ EH GLVFXVVHG LQ DOSKDEHWLFDO RUGHU

PAGE 60

$P\ODVH $0
PAGE 61

:DWVRQ HW DL f ,Q WKH PRXVH WKH PDMRULW\ RI (*) LV V\QWKHVL]HG LQ WKH VXEPDQGLEXODU JODQG ZKLOH LQ WKH KXPDQ WKH PDLQ VRXUFH RI (*) LV WKH SDURWLG JODQG 7KHVOHII HW DL f ZLWK QR VWDWLVWLFDOO\ VLJQLILFDQW VH[XDO GLPRUSKLVP 'DJRJR HWDL f (*) LPPXQRF\WRORJLFDO UHDFWLYLW\ ZDV ILUVW GHWHFWHG LQ GD\ SRVWSDUWXP PLFH 6DOLGR HW DO f ZKLOH (*) P51$ H[SUHVVLRQ KDV EHHQ UHSRUWHG LQ IHWDO WLVVXHV *UHVLN HW DO .DVKLPDWD DQG *UHVLN f 7KH (*)5 RQ WKH RWKHU KDQG DSSHDUV WR EH H[SUHVVHG SULRU WR WKH LQLWLDWLRQ RI SURWHLQ SURGXFWLRQ DQG FDQ EH GHWHFWHG LQ WKH PRXVH DW QHRQDWH GD\ 'XUEDQ HW DO f *DOODVH *7f *DO7DVH KDV EHHQ GHVFULEHG IXOO\ LQ &KDSWHU 2QH RI WKLV WH[W *DO7DVH ZDV WKH H[SHULPHQWDO SURWHLQ WKDW ZH ZHUH LQYHVWLJDWLQJ 7R GDWH QR RQH KDV FKDUDFWHUL]HG WKH H[SUHVVLRQ DQG IXQFWLRQDOLW\ RI FHOOVXUIDFH *DO7DVH GXULQJ WKH GHYHORSPHQW RI WKH IHWDO PRXVH VDOLYDU\ JODQG *3'+ 7KH KRXVHNHHSLQJ JHQH JO\FHURO SKRVSKDWH GHK\GURJHQDVH *3'+f ZDV XWLOL]HG DV RXU FRQWURO VWDQGDUG IRU P51$ H[SUHVVLRQ ,QLWLDO VWXGLHV GHPRQVWUDWHG WKDW *3'+ SURYLGHG D PRUH SUHGLFWDEOH VWDQGDUGL]HG H[SUHVVLRQ GXULQJ IHWDO JODQG GHYHORSPHQW WKDQ GLG WKH SUHYLRXVO\ XVHG VWDQGDUG RI SDFWLQ 5HFHQW VWXGLHV KDYH LQGLFDWHG WKDW YHU\ OLWWOH *3'+ LV PHPEUDQH ERXQG LQ WKH LQWDFW FHOO SHUKDSV DOORZLQJ EHWWHU VWDQGDUGL]DWLRQ RI H[SUHVVLRQ OHYHOV 5LFK HW DO f

PAGE 62

/\VR]\PH /<6f /\VR]\PH LV WKRXJKW WR EH D ORZ OHYHO WHUPLQDO VDOLYDU\ JODQG SURGXFW RI ZHOO GLIIHUHQWLDWHG DFLQDU FHOOV /\VR]\PH LV LQKHUHQWO\ DQ DQWLPLFURELDO SURWHLQ WKRXJKW WR KDYH D UROH LQ PDLQWDLQLQJ WKH RYHUDOO PLFURELDO OHYHOV /\VR]\PH P51$ KDV EHHQ UHSRUWHG LQ WKH VDOLYDU\ JODQG RI PLFH 0DJD HW D f /LNH F\VWDWLQ DQG PXFLQ O\VR]\PH ZDV XVHG WR HYDOXDWHG GLIIHUHQWLDWHG IXQFWLRQ RI DFLQDU FHOOV IURP ERWK VHURXV DQG PXFLQRXV JODQGV 0XFLQ 08&f 0XFLQ LV D WHUPLQDO GLIIHUHQWLDWHG IXQFWLRQDO SURGXFW IURP PXFLQRXV DFLQDU FHOOV RI WKH VXEPDQGLEXODU DQG VXEOLQJXDO JODQGV ,W KDV EHHQ XVHG SUHYLRXVO\ WR HYDOXDWH WKH IXQFWLRQDO GHYHORSPHQW RI IHWDO PRXVH VDOLYDU\ JODQGV WKDW ZHUH VWLPXODWHG ZLWK JOXFRFRUWLFRLGV -DVNROO HW DO f ,Q WKDW VWXG\ WKH\ IRXQG WKDW JOXFRFRUWLFRLG UHFHSWRUV ZHUH IXQFWLRQDO DV HDUO\ DV IHWDO GD\ DQG WKDW JOXFRFRUWLFRLG DGPLQLVWUDWLRQ VWLPXODWHG DFLQDU FHOO PXFLQ SURGXFWLRQ DV GHWHUPLQHG E\ LPPXQRLRFDOL]DWLRQ LQ JODQGV RI IHWDO GD\ PLFH $QRWKHU UHSRUW GHPRQVWUDWHG PXFLQ ORFDOL]DWLRQ HYHQ LQ WKH SDURWLG JODQG WLVVXHV 9UHXJGHQKL HWDO f 7KH SURGXFWLRQ RI PXFLQ LQ WKH DGXOW PRXVH DSSHDUV WR GHPRQVWUDWH D GLXUQDO YDULDWLRQ E\ DV PXFK DV IROG DV GHWHUPLQHG E\ UDGLRLPPXQRDVVD\ 'HQQ\ DQG 'HQQ\ f 0XFLQ DOVR DSSHDUV WR KDYH EHHQ ZHOO FRQVHUYHG WKURXJKRXW PDPPDOLDQ VSHFLHV 3HPEHUWRQ HW DO f 0XFLQ ZDV XVHG DV D WHUPLQDO GLIIHUHQWLDWHG IXQFWLRQDO PDUNHU IRU PXFLQRXV DFLQDU FHOOV

PAGE 63

6DOLYDU\ 3URWHLQV ,QYHVWLJDWHG &HOO W\SH 6HURXV 0XFLQRXV $FLQDU $0< &<6 /<6 &<6 /<6 08& *7 363 *7 'XFWDO (*) 1*) (*) 1*) 7DEOH 6DOLYDU\ *ODQG 'HYHORSPHQWDO 3URWHLQV 7KH VDOLYDU\ JODQG GHYHORSPHQWDO SURWHLQV LQYHVWLJDWHG LQ WKLV UHSRUW DUH OLVWHG DQG FDWHJRULFDOO\ GLYLGHG EDVHG RQ FHOO DQG JODQG W\SH $P\ODVH $0
PAGE 64

1HUYH JURZWK IDFWRU 1*)f 1*) PXFK OLNH (*) LV V\QWKHVL]HG E\ WKH JUDQXODU FRQYROXWHG WXEXOH FHOOV DQG VWULDWHG GXFWDO FHOOV RI WKH PRXVH VXEPDQGLEXODU JODQG 6LPLQRVNL HW DO +D]HQ0DUWLQ HW DO f 7KH P51$ H[SUHVVLRQ RI 1*) DOVR VHHPV WR SDUDOOHO WKDW RI (*) :LOVRQ HW DO f 1*) WRJHWKHU ZLWK (*) PD\ EH XVHG WR HYDOXDWH GXFWDO FHOO GHYHORSPHQW 3DURWLG VHFUHWRU\ SURWHLQ 363f 363 LV D PDMRU VHFUHWRU\ SURWHLQ RI WKH DGXOW PRXVH DQG UDW SDURWLG JODQG QRW WKH VXEPDQGLEXODU JODQG $V D VHFUHWRU\ SURWHLQ 363 LV V\QWKHVL]HG E\ WKH DFLQDU FHOOV 6KDZ HWDO 0DGVHQ DQG +MRUWK f 363 ZDV RULJLQDOO\ WKRXJKW WR RQO\ EH WUDQVFULEHG DQG H[SUHVVHG LQ WKH SDURWLG 6KDZ DQG 6FKLEOHU f KRZHYHU UHFHQW UHSRUWV KDYH IRXQG 363 WUDQVFULSWV LQ RWKHU WLVVXHV 5RELQVRQ HW DO 2[IRUG HW DO Df 363 LV QRZ NQRZQ WR EH H[SUHVVHG LQ URGHQW VXEPDQGLEXODU WLVVXHV IURP IHWDO GD\V RXW WR GD\V DIWHU ELUWK DQG WKHQ DSSHDUV WR EH WXUQHG RII 0LULV DQG %DOO f 0HVVHQJHU 51$ 3URILOH RI )HWDO 6XEPDQGLEXODU *ODQG 'HYHORSPHQW $ FRQFRUGDQFH RI P51$ H[SUHVVLRQ RI D YDULHW\ RI GHYHORSPHQWDO PDUNHUV DQG FHOOVXUIDFH *DO7DVH DFWLYLW\ GXULQJ WKH IHWDO GHYHORSPHQW RI WKH VXEPDQGLEXODU JODQG ZDV DFFRPSOLVKHG 7KLV SURYLGHG SUHYLRXVO\ XQSXEOLVKHG LQIRUPDWLRQ UHJDUGLQJ JHVWDWLRQDO PROHFXODU GHYHORSPHQW DQG

PAGE 65

FHOOVXUIDFH *DO7DVH DFWLYLW\ ZKLFK ZDV XVHG WR HYDOXDWH RXU RUJDQ FXOWXUH V\VWHP &ROOHFWLRQ RI WLVVXHV 6XEPDQGLEXODU JODQGV ZHUH KDUYHVWHG IURP SUHJQDQW IHPDOH &' PLFH -DFNVRQ /DEV :LOPLQJWRQ 0$fWKDW KDG WLPHG SUHJQDQFLHV $ PLQLPXP RI VXEPDQGLEXODU JODQGV ZHUH DVSHFWLFDOO\ KDUYHVWHG E\ PLFURGLVVHFWLRQ WHFKQLTXHV XWLOL]LQJ D =HLVV I f ILEHURSWLF VWHUHR RSHUDWLQJ PLFURVFRSH &DUO =HLVV *%+ :HVW *HUPDQ\f IURP HPEU\RV DW HDFK JHVWDWLRQDO GHYHORSPHQWDO GD\ QHRQDWHV DQG DGXOW $OO SURFHGXUHV ZHUH SHUIRUPHG LQ DFFRUGDQFH ZLWK SURWRFROV DSSURYHG E\ WKH $QLPDO &DUH DQG 8VH &RPPLWWHH RI WKH 8QLYHUVLW\ RI )ORULGD ([DFW WLPH RI PRUSKRORJLF GHYHORSPHQW ZDV FRQILUPHG E\ WKH PHWKRGV RI .DXIPDQ DQG RQO\ PRUSKRORJLFDOO\ FRUUHFW VSHFLPHQV ZHUH XVHG .DXIPDQ f ,VRODWLRQ RI SRO\ $f PHVVHQJHU 51$ $ GLVWLQFW SUREOHP HQFRXQWHUHG LQ HYDOXDWLQJ SURWHLQ RU P51$ H[SUHVVLRQ LQ WKH IHWDO WLVVXHV RU GLVVHFWHG RUJDQV LV WKH PLQXWH TXDQWLW\ RI VDPSOH REWDLQHG 7KH DGYHQW RI UHYHUVH WUDQVFULSWLRQ SRO\PHUDVH FKDLQ UHDFWLRQ 573&5f WHFKQLTXHV SURYLGHV D KLJK OHYHO RI VHQVLWLYLW\ WKDW DOORZV GHWHFWLRQ RI WR SJ RI WDUJHW VHTXHQFHV ZKLFK IRUWXQDWHO\ LV WKH DSSUR[LPDWH VL]H RI DQ DYHUDJH P51$ PROHFXOH 9HUHV HW DO ILUVW SXEOLVKHG UHSRUWV RI XWLOL]LQJ 573&5 WR DPSOLI\ P51$ LQ D VWXG\ HYDOXDWLQJ WKH HIIHFW RI SRLQW PXWDJHQHVLV LQ WKH PRXVH RUQLWKLQH WUDQVFDUEDP\ODVH JHQH 9HUHV HW DO f :H XWLOL]HG 573&5 DPSOLILFDWLRQ RI P51$ WUDQVFULSWV WR SURYLGH D

PAGE 66

FRQFRUGDQFH RI IHWDO PRXVH VXEPDQGLEXODU JODQG GHYHORSPHQW 0HVVHQJHU 51$ ZDV LVRODWHG IURP KDUYHVWHG WLVVXHV ZLWK WKH 0LFUR)DVW 7UDFNp P51$ ,VRODWLRQ .LW GHVFULEHG EHORZ ,QYLWURJHQ &RUSRUDWLRQ &DUOVEDG &$f 0LFUR)DVW 7 UDFNp WHFKQLTXH 7LVVXHV IURP HDFK JHVWDWLRQDO GD\ ZHUH SRROHG DQG WKHQ LQFXEDWHG IRU PLQXWHV ZLWK P/ 0LFUR)DVW 7UDFNp /\VLV %XIIHU SUHKHDWHG WR r& $ ILQDO P0 1D&, VROXWLRQ ZDV REWDLQHG E\ WKH DGGLWLRQ RI 0 1D&O VROXWLRQ WR HDFK WXEH WKHQ DQ ROLJR G7f FHOOXORVH WDEOHW ZDV DGGHG 7KH 51$ LV WKHQ DOORZHG WR DGVRUE WR WKH FHOOXORVH WDEOHW IRU PLQXWHV DW URRP WHPSHUDWXUH XVLQJ D URFNLQJ SODWIRUP 7KHROLJRG7 FHOOXORVH VOXUU\ ZLWK DGVRUEHG SRO\$f 51$ ZDV HOXWHG ZLWK VWRFN EXIIHU HWKDQRO SUHFLSLWDWHG UHVXVSHQGHG LQ cM, VWHULOH '(3&WUHDWHG ZDWHU DQG TXDQWLILHG E\ DEVRUEHQFH DW QP XVLQJ D /.% %LRFKURP 8OWUD6SHF ,,p VSHFWURSKRWRPHWHU %LRFKURP &RUSRUDWLRQ &DPEULGJH (QJODQGf 573&5 3URFHGXUHV '1$ ZDV V\QWKHVL]HG IURP WKH P51$ LVRODWHG IURP HDFK WLPH SHULRG XWLOL]LQJ 573&5 DPSOLILFDWLRQ 7KH XVH RI 573&5 WHFKQLTXHV KDV EHFRPH VWDQGDUG LQ UHVHDUFK IRU H[SUHVVLQJ SDWWHUQV RI SURWHLQV DQG P51$ LQ WLVVXH RU FHOOXODU FRPSRQHQWV )LJXUH LOOXVWUDWHV WKH VFKHPH RI 573&5 WHFKQRORJ\ HPSOR\HG GXULQJ WKLV LQYHVWLJDWLRQ

PAGE 67

YeGL? KDUYHVWHG 60* f iIHV! VXEPDQGLEXODU JODQGV ZHUH KDUYHVWHG IURP PLFH IHWDO GD\ QHRQDWH DQG DGXOW WLVVXHV DUH SRROHG ,VRODWLRQ RI P51$ ZLWK 0LFUR)DVW 7UDF 57 UHDFWLRQ $PSOLILFDWLRQ RI HDFK RI WKH H[SHULPHQWDO VDOLYDU\ JODQG GHYHORSPHQWDO SUWHLQV 6HSDUDWLRQ ZLWK JHO HOHFWURSKRUHVLV FRQWURO *3'+ DPSOLILFDWLRQ UXQQLQJ LQ SDUDOOHO 3&5 DPSOLILFDWLRQ n 'HQVLWRPHWULF HYDOXDWLRQ RI P51$ H[SUHVVLRQ 3RODURLG SKRWRJUDSK RI JHO HOHFWURSKRUHVLV )LJXUH 7KH *HQHUDO 6FKHPH IRU 6HPL4XDQWLILFDWLRQ RI P51$ 7KH VFKHPH XWLOL]HG LQ WKHVH VHULHV RI H[SHULPHQWV WR TXDQWLWDWH WKH P51$ 7DUQX]]HU HWDO f 4XDQWLILFDWLRQ RI DPSOLFRQV ZDV DFFRPSOLVKHG DIWHU VFDQQLQJ WKH 3RODURLG SKRWRJUDSKV DQG WKH XVH RI GHQVLWRPHWU\

PAGE 68

'HVLJQ DQG V\QWKHVLV RI 573&5 SULPHUV 2OLJRQXFOHRWLGH f DQG f SULPHUV IRU WKH GHWHUPLQDWLRQ RI P51$ H[SUHVVLRQ RI WKH VHOHFWHG GHYHORSPHQWDO PDUNHUV ZHUH GHVLJQHG XWLOL]LQJ FRPSXWHUL]HG VHTXHQFH DQDO\VLV RI KXPDQ PRXVH DQG UDW VHTXHQFHV DYDLODEOH WKURXJK *HQ%DQNr1 1DWLRQDO /LEUDU\ RI 6FLHQFH %HWKHVGD 0'f DQG V\QWKHVL]HG DW WKH 8QLYHUVLW\ RI )ORULGD 6HTXHQFLQJ &RUH )DFLOLW\ *DLQHVYLOOH )/f 3ULPHUV ZHUH GHVLJQHG WR VSDQ LQWURQV DQG SURGXFH DPSOLILHG 3&5 SURGXFWV EHWZHHQ EDVH SDLUV DQG WKXV GLIIHUHQWLDWH WKH DPSOLILFDWLRQ RI P51$ IURP SRWHQWLDO FRQWDPLQDWLQJ JHQRPLF '1$ 7KH ROLJRQXFOHRWLGH SULPHUV GHVLJQHG V\QWKHVL]HG DQG XWLOL]HG LQ WKHVH H[SHULPHQWV DUH OLVWHG LQ 7DEOH 7KH ORFDWLRQ RI WKH SULPHUV RQ WKH *DO7DVH JHQH ZDV LOOXVWUDWHG LQ )LJXUH 6WDQGDUGL]HG 57 UHDFWLRQ $ VHULHV RI VWDQGDUGL]HG cM, 57 UHDFWLRQV ZHUH FRPSOHWHG (DFK UHDFWLRQ FRQWDLQHG P0 0J&, P0 7ULV+&, S)+ f EXIIHU cM0 G173V 8P/ KXPDQ SODFHQWDO ULERQXFOHDVH LQKLELWRU 8PJ 51$ 0DORQH\ PXULQH OHXNHPLD YLUXV UHYHUVH WUDQVFULSWDVH 00/957f IURP *HQH$PSp 3HUNLQ (OPHU %UDQFKEXUJ 1-f DQG ZHUH LQFXEDWHG ZLWK YJ RI LVRODWHG 51$ DW r& IRU PLQXWHV r& IRU PLQXWHV DQG r& IRU PLQXWHV LQ D %LRPHWUDp 8QR7KHUPREORFN WKHUPRF\FOHU %LRPHWUD ,QFRUSRUDWHG 7DPSD )/f

PAGE 69

573&5 3ULPHUV IRU 6DOLYDU\ 3URWHLQV 3URWHLQ f 3ULPHU f 3ULPHU 3URGXFW 6L]H $0< 7 *&7 *&777 &&&7 &$77** 7 *&$$*$7&&$*$$**&&$*$ &<6 *&&*7 &&7 ***&*7 **&&7** &7**&**7 *&&&7 &&$*$*&& (*) 7 $$*&&*$*$&&**$$*7 $&7 $*7&7 *77 &&$7 &$$$$7 *&$ *7 7 &$&$*7 **$&$7 &***$&$& &&$&$$7 $$$$$7 $&$7 $**$ 3 + 7*$$**7&**7*7*$$&**$777**& &$7 *7 $**&&$7*$**7&&$&&$& /<6 7 &&7 *$&7 &7 ***$&7 &&7 && 7&$*$&7&&*&$*77&&*$$7 08& *7 $7 $$*$7 *7 *&&&7 &&$** 7 $**7 $7 **&7 *7 $* $**7 *& 1*) *&$7 &$*$ $ $7 && $$*&*7 && 7 $$&&&77 *77 $$*&$**&* 363 $7 *77 &&$$&77** $$*&& $***&$$*77 *7 $&&7 7DEOH 573&5 3ULPHUV 'HVLJQHG IRU 7KHVH ([SHULPHQWV 7KH 573&5 SULPHUV WKDW ZHUH GHVLJQHG DQG V\QWKHVL]HG WR XVH LQ WKHVH H[SHULPHQWV HYDOXDWLQJ WKH IHWDO PRXVH VXEPDQGLEXODU JODQG GHYHORSPHQW DUH OLVWHG ZLWK WKHLU H[SHFWHG SURGXFW VL]H

PAGE 70

6WDQGDUGL]HG 3&5 UHDFWLRQ 6WDQGDUGL]HG cM/ 3&5 DPSOLILFDWLRQ UHDFWLRQV ZHUH SHUIRUPHG FRQWDLQLQJ SPROHV RI HDFK RI WKH ROLJRQXFOHRWLGH f DQG f 3&5 SULPHUV P0 0J&, P0 7ULV+&, S+ f EXIIHU Y/RI FRPSOHWHG 57 SURGXFW DQG cM/ 7DT SRO\PHUDVH $PSOLILFDWLRQV RI WKH UHDJHQWV IRU F\FOHV RI r& IRU PLQXWHV r& IRU PLQXWHV r& IRU PLQXWHV ZDV IROORZHG E\ PLQXWHV DW r& IRU ILQDO H[WHQVLRQ RI WKH SURGXFW 3&5 SURGXFWV ZHUH VHSDUDWHG E\ DJDURVH JHO HOHFWURSKRUHVLV IRU YLVXDOL]DWLRQ RI FHOOXODU 3&5 DPSOLFRQV 5HODWLYH 4XDQWLILFDWLRQ RI P51$ 7UDQVFULSWLRQ /HYHOV 5HODWLYH TXDQWLILFDWLRQ IRU P51$ H[SUHVVLRQ OHYHOV ZDV REWDLQHG E\ FRPSDUDWLYH DQDO\VLV RI *DOODVH 573&5 SURGXFWV WR FRQWURO *3'+ SURGXFWV XVLQJ D GHQVLWRPHWULF DQDO\VLV DV GHVFULEHG EHORZ 6HSDUDWLRQ DQG SKRWRJUDSKLQJ RI 573&5 SURGXFWV 573&5 SURGXFWV ZHUH VHSDUDWHG RQ b KLJK PHOWLQJ DJDURVH )LVKHU 6FLHQWLILF ,QFRUSRUDWHG 3LWWVEXUJK 3$f JHOV FRQWDLQLQJ QJP/ HWKLGLXP EURPLGH DW 9 FRQVWDQW FXUUHQW IRU KRXUV $W WKLV SRLQW DPSOLFRQV ZHUH FOHDUO\ GLVFHUQLEOH (DFK DJDURVH JHO ZDV WKHQ SKRWRJUDSKHG LQ D VWDQGDUGL]HG PDQQHU IRU VHFRQGV XVLQJ D 3RODURLGp 03 /DQG FDPHUD DQG 3RODURLGp 7\SH ILOP 3RODURLG &RUSRUDWLRQ %HGIRUG 0$f

PAGE 71

5HODWLYH TXDQWLILFDWLRQ RI 573&5 SURGXFWV 3RODURLG SKRWRJUDSKV RI WKH DJDURVH JHO VHSDUDWHG 573&5 SURGXFWV ZHUH WKHQ VFDQQHG RQ D +HZOHWW3DFNDUG 6FDQ-HW ,OH[p 03 GLJLWDO VFDQQHU +HZOHWW3DFNDUG &RPSDQ\ 5RFNYLOOH 0'f %DQG LQWHQVLWLHV ZHUH GLJLWL]HG XVLQJ 1,+OPDJH Y 1DWLRQDO ,QVWLWXWHV RI +HDOWK %HWKHVGD 0'f DV GHVFULEHG E\ 7DUQX]]HU HWDO 7DUQX]]HU HWD f WR SURYLGH GHQVLWRPHWULF GDWD DQG ZHUH VXEVHTXHQWO\ QRUPDOL]HG IRU WKHLU QXFOHRWLGH FRQWHQW 7KLV SURYLGHG D UHODWLYH VHPLTXDQWLILFDWLRQ RI SURGXFW P51$ WR D VWDQGDUGL]HG H[SUHVVLRQ RI *3'+ P51$ &HOOVXUIDFH *DO7DVH (Q]\PDWLF $FWLYLW\ 3URILOH RI 'HYHORSLQJ $FLQDU &HOOV &HOOVXUIDFH *DO7DVH HQ]\PDWLF DFWLYLW\ ZDV DOVR GHWHUPLQHG GXULQJ QRUPDO GHYHORSPHQW RI WKH PRXVH VXEPDQGLEXODU JODQG $FLQDU FHOOV KDUYHVWHG IURP GHYHORSLQJ IHWDO VXEPDQGLEXODU JODQGV DW WKH VDPH JHVWDWLRQDO WLPH SRLQWV QHRQDWH DQG DGXOWf ZHUH XWLOL]HG WR GHWHUPLQH WKH FHOOVXUIDFH *DO7DVH DFWLYLW\ ,VRODWLRQ RI LQWDFW DFLQDU FHOOV $FLQDU FHOOV ZHUH LVRODWHG DFFRUGLQJ WR D PRGLILFDWLRQ RI PHWKRGV GHVFULEHG E\ 3XUXVKRWKDP 3XUXVKRWKDP HW DO Df 6XEPDQGLEXODU JODQGV IURP HDFK WLPH SRLQW ZHUH LGHQWLILHG E\ JURVV PRUSKRORJ\ GLVVHFWHG IUHH RI RWKHU WLVVXHV SRROHG LQ D GLJHVWLRQ VROXWLRQ FRQWDLQLQJ ; +DQNfV EDODQFHG VDOW VROXWLRQ +%66f '1DVH 7\SH ,, DQG &ROODJHQDVH ,9 6LJPD &KHPLFDO &RPSDQ\ 6W /RXLV 02f DQG VKDNHQ LQ D r& + EDWK IRU

PAGE 72

PLQXWHV 7KH VXSHUQDWDQW ZDV WKHQ FROOHFWHG DQG SODFHG LQ LFH FROG VWRS VROXWLRQ FRQWDLQLQJ POB VWHULOH ; +%66 DQG b IHWDO FDOI VHUXP WKHQ FHQWULIXJHG DW [ J LQ D )LVKHU 6FLHQWLILF FHQWULIXJH 0RGHO .0 )LVKHU 6FLHQWLILF ,QFRUSRUDWHG 3LWWVEXUJK 3$f WR SHOOHW LVRODWHG FHOOV 3HOOHWHG FHOOV ZHUH WKHQ UHVXVSHQG LQ ; 3,%66 DQG FHOO GHQVLW\ ZDV GHWHUPLQHG E\ KHPDF\WRPHWU\ $PHULFDQ 2SWLFDO &RPSDQ\ %XIIDOR 1S1LFRWLQDPLGH DGHQLQH GLQXFOHRWLGH UHGXFHG IRUP@f ZDV DGGHG WR D YROXPH RI DFLQDU FHOOV DW r& $IWHU H[DFWO\ PLQXWHV P/ RI 6LJPD &RORU 5HDJHQW GLQLWURSKHQ\OG\K\GUD]LQH b LQ 1 K\GURFKORULF DFLGf ZDV DGGHG 7KH 2' ZDV GHWHUPLQHG VSHFWURSKRWRPHWULFDOO\ DW QP DIWHU PL[LQJ JHQWO\ IRU PLQXWHV DW URRP WHPSHUDWXUH ZLWK P/ 1 1D2+f 7KH /'+ DFWLYLW\ RI HDFK VDPSOH ZDV FDOFXODWHG IURP D VWDQGDUG FXUYH WKDW ZDV JHQHUDWHG IRU DEVRUEHQFH 2'f RI YDU\LQJ FRQFHQWUDWLRQV RI O\VHG FHOOV WR /'+ DFWLYLW\ /'+ DFWLYLW\ ZDV

PAGE 73

PHDVXUHG LQ %% 8QLWVP/ %HUJHU%URLGD XQLW LV DPRXQW RI /'+ WKDW ZLOO UHGXFH [ f P0 RI S\UXYDWHPLQXWH DW r&f &HOOVXUIDFH HQ]\PDWLF DFWLYLW\ 7KH *DO7DVH DFWLYLW\ ZDV PHDVXUHG XVLQJ D PRGLILFDWLRQ RI DQ DVVD\ SUHYLRXVO\ GHVFULEHG E\ +XPSKUH\V%HKHU HW DO +XPSKUH\V%HKHU HW DO f ,QWDFW DFLQDU FHOOV f ZHUH LQFXEDWHG ZLWK 8'3>&@JDODFWRVH $PHUVKDP &RUSRUDWLRQ &KLFDJR ,/f DQG RYDOEXPLQ DV WKH ROLJRVDFFKDULGH VXEVWUDWH $IWHU LQFXEDWLRQ DWr&IRU KRXUV WKH UHDFWLRQ ZDV WHUPLQDWHG E\ WKH DGGLWLRQ RI LFH FROG WULFKORURDFHWLF DFLG 7&$f $IWHU ZDVKLQJ ZLWK b 7&$ DQG b (W2+ WKH SUHFLSLWDWH ZDV UHFRYHUHG RQ :KDWPDQ *ODVV 0LFURILEUH c[0 GLDPHWHU ILOWHUV :KDWPDQ ,QFRUSRUDWHG &OLIWRQ 1-f ZLWK D 0LOOLSRUHp YDFXXP ILOWUDWLRQ V\VWHP 0LOOLSRUH &RUSRUDWLRQ %HGIRUG 0$f )LOWHUV ZHUH WKHQ SODFHG LQ VFLQWLOODWLRQ YLDOV FRQWDLQLQJ POB 6FLQWL9HUVHp %' &RFNWDLO )LVFKHU 6FLHQWLILF 3LWWVEXUJK 3$f DOORZHG WR GDUN DGDSW IRU QRW OHVV WKDQ PLQXWHV EHIRUH WKH UHFRYHUHG & ZDV GHWHUPLQHG RQ D %HFNPDQ /6 %HWD 6SHFWURPHWHU VFLQWLOODWLRQ FRXQWHU %HFNPDQ ,QVWUXPHQWV ,QFRUSRUDWHG 6FKDXEHUJ ,/f +LVWRORJLF DQG ,PPXQRKLVWRFKHPLFDO (YDOXDWLRQ RI 'HYHORSPHQW ,PPXQRKLVWRFKHPLFDO GHWHFWLRQ RI *DO7DVH ZDV SHUIRUPHG DV SUHYLRXVO\ GHVFULEHG E\
PAGE 74

DQG DQG HPEHGGHG LQ SDUDIILQ IRU KLVWRORJLF DQG LPPXQRKLVWRFKHPLFDO DQDO\VLV 6WDQGDUG PLFURQ VHFWLRQV ZHUH FXW IURP HPEHGGHG WLVVXHV IURP HDFK GD\ SODFHG RQ FOHDQ JODVV VOLGHV DQG VWDQGDUG KLVWRORJLF H[DPLQDWLRQ RI WKH VHFWLRQV ZDV SHUIRUPHG DIWHU VWDLQLQJ ZLWK KHPDWR[LOLQ DQG HRVLQ $GGLWLRQDO VHFWLRQV ZHUH GHSDUDIILQL]HG WKURXJK D VHULHV RI JUDGHG DOFRKRO ZDVKHV WKHQ ZDVKHG IRU PLQXWHV ZLWK SKRVSKDWHEXIIHUHG VDOLQH 3%6 S+ f IRU LPPXQRKLVWRFKHPLFDO DQDO\VLV 6HFWLRQV ZHUH LQFXEDWHG DW URRP WHPSHUDWXUH IRU KRXU ZLWK QRUPDO JRDW VHUXP IRU EORFNLQJ DQG WKHQ ZDVKHG DJDLQ ZLWK 3%6 SULRU WR D KRXU LQFXEDWLRQ ZLWK WKH SULPDU\ DQWLERG\ 6HSKDURVH JHO H[FOXVLRQ FKURPDWRJUDSK\ SXULILHG PRXVH DQWLKXPDQ *DO7DVH PRQRFORQDO ,J* DQWLERG\ D JHQHURXV JLIW IURP 'U .XUW ,VVHOEDFKHU 'HSDUWPHQW RI 0HGLFLQH +DUYDUG 0HGLFDO 6FKRRO %RVWRQ 0$f 7KH FURVV UHDFWLYLW\ RI WKLV SDUWLFXODU DQWLERG\ ZLWK PRXVH DQG UDW DQWLJHQ KDV EHHQ SUHYLRXVO\ UHSRUWHG 3RGROVN\ DQG ,VVHOEDFKHU f )XUWKHU LQFXEDWLRQ ZLWK JRDW DQWLPRXVH ELRWLQ\ODWHG VHFRQGDU\ ,J* DQWLERG\ ZDV IROORZHG E\ D VHULHV RI 3%6 ZDVKHV SULRU WR IXUWKHU LQFXEDWLRQV ZLWK $%& UHDJHQW VWUHSWDYLGLQ KRUVHUDGLVK SHUR[LGDVH SURGXFHV WKH DYLGLQ ELRWLQ\ODWHG FRPSOH[f &KURPDWRJHQLF UHDFWLRQ ZDV GHYHORSHG E\ DGGLWLRQ RI '$% f 'LDPLQREHQ]HGLQHf IRU PLQXWHV )LQDOO\ VHFWLRQV ZHUH UHK\GUDWHG WKURXJK D VHULHV RI JUDGHG DOFRKRO ZDVKHV 7KH LPPXQRVWDLQHG VHFWLRQV DQG VWDQGDUG KLVWRORJLF VHFWLRQV ZHUH WKHQ SKRWRJUDSKHG DW ; ZLWK DQ 2O\PSXV %+ PLFURVFRSH 2O\PSXV &DPHUD ,QFRUSRUDWHG )OXVKLQJ 1
PAGE 75

PP 3ULQW )LOP ,62 r (DVWPDQ .RGDN &RPSDQ\ 5RFKHVWHU 1
PAGE 76

G IHWDO 60* WLVVXHV DUH KDUYHVWHG Y WLVVXHV DUH SRROHG DQG IL[HG 21 LQ b SDUDIRUPDOGHK\GH WLVVXHV DUH GHK\GUDWHG LQ VHULHV RI HWKDQRO ZDVKHV DQG [\OHQH WKHQ HPEHGGHG LQ SDUDIILQ SDUDIILQ EORFNV ZHUH VHFWLRQHG DW PLFURQV VOLGHV ZHUH UHK\GUDWHG ZLWK b + EORFNLQJ RI QRQVSHFLILF ELQGLQJ ZLWK QRUPDO DQG GULHG JRDW VHUXP LQFXEDWH VHFWLRQV ZLWK VWUHSWDYLGLQ KRUVHUDGLVK SHUR[LGDVH $%&f WKHQ VWDLQ ZLWK '$% IRU PLQXWHV ZDVK VHFWLRQV ZLWK ZDWHU GHK\GUDWH LQ JUDGHG DOFRKRO DQG [\[OHQH FRYHUVOLS DQG SKRWRJUDSK )LJXUH 7KH *HQHUDO 6FKHPH IRU ,PPXQRKLVWRFKHPLVWU\ 7KH IORZ FKDUW DERYH SURYLGHV WKH JHQHUDO VFKHPH RI WKH LPPXQRKLVWRFKHPLFDO DQDO\VLV XVHG LQ WKHVH VWXGLHV
PAGE 77

2UJDQ &XOWXUH LQ YLWURf 'HYHORSPHQW 7R HYDOXDWH WKH UROH RI *DO7DVH LQ IHWDO PRXVH VXEPDQGLEXODU JODQG GHYHORSPHQW ZH FKRVH WR XWLOL]H D PRXVH RUJDQ FXOWXUH V\VWHP 5RGHQW VDOLYDU\ JODQG RUJDQ FXOWXUHV KDYH EHHQ XVHG IRU PDQ\ \HDUV LQ WKH HYDOXDWLRQ RI JURZWK DQG GHYHORSPHQW %RUJKHVH *UREVWHLQ D E F /DZVRQ %HUQILHOG DQG %DQHUMHH D E %HUQILHOG DQG :HVVHOOV %HUQILHOG HWDO &RKQ HWD 6SRRQHU DQG )DXELRQ f )HWDO 6DOLYDU\ *ODQG 2UJDQ &XOWXUH 6\VWHP )HPDOH &' PLFH ZHUH DJDLQ XVHG WR SURYLGH WLPHG SUHJQDQFLHV 6XEPDQGLEXODU JODQGV ZHUH KDUYHVWHG IURP HPEU\RV ZLWK WKH DSSURYDO RI WKH $QLPDO &DUH DQG 8VH &RPPLWWHH RI WKH 8QLYHUVLW\ RI )ORULGD DW PRUSKRORJLFDOO\ YHULILHG GD\ RI JHVWDWLRQDO GHYHORSPHQW E\ PLFURGLVVHFWLRQ WHFKQLJXHV DV GHVFULEHG DERYH (DFK VXEPDQGLEXODU JODQG KDUYHVWHG ZDV FXOWXUHG VHSDUDWHO\ LQ D PP GLDPHWHU ZHOO RI D ZHOO SRO\VWUHQH FXOWXUH SODWH ZLWKRXW FRDWLQJ &RVWDU &RUSRUDWLRQ &DPEULGJH 0$f RU LQ D ZHOO RI D ZHOO FXOWXUH SODWH FRDWHG ZLWK PRXVH ODPLQLQ %LRFRDW &HOOZDUH %HGIRUG 0$f 2UJDQ FXOWXUHV ZHUH PDLQWDLQHG DW r& DQG b b & LQ D )RUPD 6FLHQWLILF DXWRPDWLF LQFXEDWRU )RUPD 6FLHQWLILF ,QFRUSRUDWHG 0DULHWWD 2+f (DFK ZHOO FRQWDLQHG P/ RI ZDUPHG r&f )LOWRQ-DFNVRQ PRGLILHG %*-E PHGLD *LEFR %5/ *UDQG ,VODQG 1
PAGE 78

ZLWK /JOXWDPLQH 8QLWV SHQVWUHSP/ DQG PJ DVFRUELF DFLG P/ DV SUHYLRXVO\ GHVFULEHG E\ -DVNROO HWDO -DVNROO HW DO f 7KH RUJDQ FXOWXUH V\VWHP ZDV FRQWLQXHG IRU KRXUV ZLWK WKH DGGLWLRQ RI P/ IUHVK ZDUPHG VWHULOH PHGLD HYHU\ KRXUV 6HOHFWLRQ RI 2UJDQ &XOWXUH 3HUWXUEDQWV 7KH HYDOXDWLRQ RI *DO7DVHfV UROH LQ GHYHORSPHQW ZDV DVVHVVHG E\ DGGLWLRQ RI GLIIHUHQW *DO7DVH RU ODPLQLQ VSHFLILF VXEVWUDWHV WR WKH PHGLD $GGLWLRQV WR WKH PHGLD LQFOXGHG QRWKLQJ ; 3%6 DODFWDOEXPLQ DQWLODPLQLQ DQG DQWL*DO7DVH DQWLERGLHV DQG W\USKRVWLQ DGGLWLRQDOO\ ODPLQLQ ZHOOV ZHUH SUHWUHDWHG ZLWK ERYLQH JDODFWRV\OWUDQVIHUDVH (DFK RI WKHVH DJHQWV LV GHVFULEHG EHORZ $OSKDODFWDOEXPLQ 7KH XVH RI WKH SURWHLQ PRGLILHU DODFWDOEXPLQ KDV EHHQ GHVFULEHG SUHYLRXVO\ DV D VSHFLILF LQKLELWRU RI SJDODFWRV\OWUDQVIHUDVH DFWLYLW\ 5RWK HW DO D E &KDWWHUMHH HW DO 6KXU +XPSKUH\V%HKHU HW DO f $OSKDODFWDOEXPLQ LV D VXEVWUDWH PRGLILHU SURWHLQ WKDW FRQIRUPDWLRQDOO\ SUHYHQWV *DO7DVH IURP ELQGLQJ WR WKH VSHFLILF HQ]\PH VXEVWUDWH *,F1$F $OSKDODFWDOEXPLQ 6LJPD &KHPLFDO &RPSDQ\ 6W /RXLV 02f KDV EHHQ XWLOL]HG E\ QXPHURXV LQYHVWLJDWRUV WR OLPLW FHOOVXUIDFH *DO7DVHfV DFWLYLW\ :H XVHG PJP/ DODFWDOEXPLQ } PPRO/f DV GHVFULEHG

PAGE 79

E\ SUHYLRXV LQYHVWLJDWRUV %DUFHOORV+RII f DVD SHUWXUEDQW LQ RXU FXOWXUH V\VWHP $QWL*DO7DVH DQWLERG\ 7KH DQWL*DO7DVH DQWLERG\ XWLOL]HG LQ WKHVH H[SHULPHQWV ZDV D PRXVH DQWLKXPDQ *DO7DVH DIILQLW\ SXULILHG PRQRFORQDO ,J* DQWLERG\ 'U .XUW ,VVHOEDFKHU +DUYDUG 0HGLFDO 6FKRRO %RVWRQ 0$f 3UHOLPLQDU\ VWXGLHV LQFOXGLQJ SDUDOOHO QRQLPPXQH VHUXP FRQWUROV ZHUH XVHG WR GHWHUPLQH WKH RSWLPDO FRQFHQWUDWLRQ f WKDW ZDV QHFHVVDU\ WR GLVUXSW GHYHORSPHQW LQ WKH FXOWXUH V\VWHP RI WKHVH VWXGLHV $QWLODPLQLQ DQWLERG\ $QWLODPLQLQ DQWLERG\ DGGHG WR WKH PHGLD LQ WKHVH VWXGLHV ZDV D UDEELW DQWLPRXVH ODPLQLQ m DQG FKDLQ SRO\FORQDO ,J* DQWLERG\ 8SVWDWH %LRWHFKQRORJ\ ,QFRUSRUDWHG /DNH 3ODFLG 1< RU &KHPLFRQ ,QWHUQDWLRQDO ,QFRUSRUDWHG 7HPDFKXOD &$f $QWLODPLQLQ DQWLERG\ ZDV DOVR DGGHG WR WKH PHGLD DW D GLOXWLRQ 3UHWUHDWPHQW %RYLQH *DO7DVH 6LJPD &KHPLFDO &RPSDQ\ 6W /RXLV 02f DQG 8'3 *DO ZDV XVHG WR PRGLI\ WKH WHUPLQDO *,F1$F UHVLGXHV RI ODPLQLQ LQ WKH FRDWHG ZHOOV (DFK ODPLQLQ FRDWHG ZHOO ZDV LQFXEDWHG IRU KRXUV DW r& ZLWK 8QLW ERYLQH JDODFWRV\OWUDQVIHUDVH m [JP/f DQG PPRO/ 8'3*DO 6LJPD &KHPLFDO &RPSDQ\ 6W /RXLV 02f ZDVKHG WLPHV ZLWK VWHULOH 3%6 LPPHGLDWHO\ SULRU WR DGGLQJ P/ RI ZDUPHG ILOWHU VWHULOL]HG %*-E PHGLD DQG

PAGE 80

WKH RUJDQ IRU FXOWXULQJ 7KH PDQXIDFWXUHU UHSRUWV WKDW RQH XQLW RI ERYLQH JDODFWRV\OWUDQVIHUDVH ZLOO WUDQVIHU >LPROH RI JDODFWRVH IURP 8'3 *DOPLQXWH DW S+ DW r& 7\USKRVWLQ 7\USKRVWLQ ZDV DGGHG WR WKH PHGLD WR HYDOXDWH WKH UHODWLRQVKLS EHWZHHQ *DO7DVH DQG WKH LQWHJULQ UHFHSWRU E\ EORFNLQJ WKH W\URVLQH NLQDVH VLJQDO WUDQVGXFWLRQ HYHQWV 7\URSKRVWLQ LV D VSHFLILF (*)5 W\URVLQH NLQDVH LQKLELWRU >PHWKR[\EHQ]OLGHQH@ PDORQRQLWULOH 6LJPD &KHPLFDO &R 6W /RXLV 02f DQG WKXV LQKLELWV (*)5 VLJQDO WUDQVGXFWLRQ HYHQWV *ODVHU HW DO
PAGE 81

G IHWDO 60* WLVVXHV DUH KDUYHVWHG Y G IHWDO 60* [ G IHWDO PRXVH 60* ZHUH FXOWXUHG LQ HDFK FRQGLWLRQ IRU [ K LQ %*-E PHGLD 3KRWRPLFURJUDSKV ZHUH REWDLQHG DW DQG KRXUV f§ P51$ FROOHFWHG IRU 573&5 EDVHG TXDQWLILFDWLRQ DFLQDU FHOOV ZHUH LVRODWHG IRU FHOO VXUIDFH *DO7DVH DFWLYLW\ DVVD\ )LJXUH 7KH *HQHUDO 6FKHPH IRU 2UJDQ &XOWXUH 7KLV GLDJUDP UHSUHVHQWV WKH JHQHUDO VFKHPH RI WKH IHWDO PRXVH VDOLYDU\ JODQG RUJDQ FXOWXUH V\VWHP XVHG LQ WKHVH VHULHV RI LQ YLWUR H[SHULPHQWV

PAGE 82

DGGLWLRQ RI D PRGLI\LQJ DJHQW VHUYHG DV FRQWUROV IRU HDFK H[SHULPHQWDO FRQGLWLRQ (DFK H[SHULPHQW ZDV UHSURGXFHG RQ VHSDUDWH RFFDVLRQV (LJKWHHQ JODQGV ZHUH FXOWXUHG ZLWK HDFK FRQGLWLRQ IRU WKH HYDOXDWLRQ RI P51$ H[SUHVVLRQ SDWWHUQV DQG FHOOVXUIDFH *DO7DVH HQ]\PDWLF DFWLYLW\ 3RROHG WLVVXHV ZHUH FROOHFWHG IURP JODQGV DW HDFK WLPH SRLQW DQG XWLOL]HG IRU HYDOXDWLRQ $ PLQLPXP RI JODQGV ZHUH DJDLQ FXOWXUHG LQ SDUDOOHO ZLWKRXW WKH DGGLWLRQ RI D PRGLI\LQJ DJHQW WR VHUYH DV FRQWUROV DQG HDFK H[SHULPHQW ZDV UHSURGXFHG RQ VHSDUDWH RFFDVLRQV 0RUSKRORJLF HYDOXDWLRQ 3KRWRJUDSKLF GRFXPHQWDWLRQ RI JODQG PRUSKRJHQHVLV ZDV REWDLQHG DW ; PDJQLILFDWLRQ XVLQJ D 1LNRQp (/:' LQYHUWHG SKRWRPLFURVFRSH 1LNRQ ,QFRUSRUDWHG ,QVWUXPHQW 'LYLVLRQ *DUGHQ &LW\ 1-f DQG .RGD&RORUp SULQW ILOP DW DQG KRXUV 0HVVHQJHU 51$ SURILOH 0HVVHQJHU 51$ ZDV KDUYHVWHG IURP SRROHG WLVVXHV XWLOL]LQJ WKH 0LFUR )DVW 7UDFNp V\VWHP DV SUHYLRXVO\ GHVFULEHG LQ WKLV WH[W SDJH f DQG 573&5 DPSOLILFDWLRQ RI *DO7DVH ZDV DFFRPSOLVKHG 4XDQWLILFDWLRQ RI *DO7DVH P51$ ZDV REWDLQHG IRU HDFK FXOWXULQJ WLPH SRLQW &HOOVXUIDFH *DO7DVH HQ]\PDWLF DFWLYLW\ $FLQDU FHOOV ZHUH LVRODWHG DV GHVFULEHG SUHYLRXVO\ DQG WKH FHOOVXUIDFH *DO7DVH HQ]\PDWLF DFWLYLW\ ZDV GHWHUPLQHG IRU FHOOV &RQWURO ODFWDWH GHK\GURJHQDVH DFWLYLW\ DVVD\V ZHUH DOVR FRPSOHWHG

PAGE 83

6WDWLVWLFDO DQDO\VLV 6WDWLVWLFDO DQDO\VLV ZDV FRPSOHWHG E\ UHSHDWHG DQDO\VLV RI YDULDQFH $129$f IRU JHQHUDO OLQHDU PRGHOV ZLWK D YDOXH RI S S DQG S 7KH VWDWLVWLFDO FRPSXWDWLRQ ZDV SHUIRUPHG XWLOL]LQJ WKH 6$6 VWDWLVWLFDO V\VWHP 6$6 ,QVWLWXWH ,QFRUSRUDWHG &DU\ 1&f

PAGE 84

&+$37(5 7+5(( 5(68/76 1RUPDO LQ YLYR 'HYHORSPHQW 6XEPDQGLEXODU JODQGV ZHUH KDUYHVWHG DW IHWDO GD\V QHRQDWH DQG DGXOW IURP &' PLFH DV GHVFULEHG LQ WKH 0DWHULDOV DQG 0HWKRGV $ PLQLPXP RI VXEPDQGLEXODU JODQGV IURP HDFK SUHJQDQW DQLPDO DW HDFK WLPH SRLQW ZHUH FROOHFWHG IRU HDFK SURFHGXUH P51$ TXDQWLILFDWLRQ DQG FHOOVXUIDFH *DO7DVH HQ]\PDWLF DFWLYLW\ DVVD\V 6HSDUDWH DQLPDOV SURYLGHG JODQGV VXFK WKDW H[SHULPHQWV ZHUH UHSHDWHG RQ VHSDUDWH RFFDVLRQV 0HVVHQJHU 51$ 3URILOH RI )HWDO 6XEPDQGLEXODU *ODQG 'HYHORSPHQW 0HVVHQJHU 51$ ZDV REWDLQHG IURP WKH FROOHFWHG WLVVXHV ZLWK WKH 0LFUR )DVW 7UDFNp ,VRODWLRQ .LW DQG TXDQWLWDWHG ZLWK D VSHFWURSKRWRPHWHU 7KH FRQFHQWUDWLRQ RI P51$ FROOHFWHG IURP SRROHG WLVVXHV UDQJHG IURP SJc[/ WR SJ>L/ 'HWHUPLQDWLRQ RI 573&5 3UHIHUUHG &RQGLWLRQV DQG )LGHOLW\ 2OLJRQXFOHRWLGH SULPHUV IRU WKH VHOHFWHG VDOLYDU\ JODQG GHYHORSPHQWDO PDUNHUV ZHUH V\QWKHVL]HG DV GHVLJQHG $ VHULHV RI 573&5 UHDFWLRQV ZLWK

PAGE 85

SXULILHG DGXOW PRXVH 51$ ZHUH FRPSOHWHG WR GHILQH WKH FRQGLWLRQV WKDW SURGXFHG WKH PRVW UHSURGXFLEOH UHVXOWV $ YDULHW\ RI GLIIHUHQW FRQGLWLRQV ZHUH HYDOXDWHG DQG VHYHUDO FRPSRQHQWV RI WKHVH UHDFWLRQV HPHUJHG DV FULWLFDO IDFWRUV 0DLQWDLQLQJ D FRQVLVWHQW 0J&, FRQFHQWUDWLRQ P0 LQ WKH 57 DQG 3&5 UHDFWLRQVf ZDV D FUXFLDO FRPSRQHQW IRU FRQVLVWHQW UHVXOWV $GGLWLRQDOO\ DV DQWLFLSDWHG WKH DQQHDOLQJ WHPSHUDWXUH ZDV DOVR D FULWLFDO IDFWRU LQ REWDLQLQJ HIIHFWLYH UHVXOWV :H XWLOL]HG r& DV D VWDQGDUG WHPSHUDWXUH IRU WKH DQQHDOLQJ WHPSHUDWXUH GXULQJ WKH 3&5 DPSOLILFDWLRQ SURFHGXUH DV LW ZDV HIIHFWLYH ZLWK HDFK VHW RI SULPHUV WR JHQHUDWH D VLQJOH EDQG 3URGXFWV IURP WKHVH UHDFWLRQV ZHUH VHSDUDWHG E\ b DJDURVH JHO HOHFWURSKRUHVLV $PSOLILHG '1$ ZDV H[WUDFWHG ZLWK D 4,$TXLFNp *HO ([WUDFWLRQ .LW 4XLJHQ ,QFRUSRUDWHG 6DQ &ODULWD &$f DQG HYDOXDWHG E\ UHVWULFWLRQ HQGRQXFOHDVH GLJHVWLRQ DQDO\VHV '1$ VHTXHQFLQJ DQG LPPXQREORWWLQJ WR HQVXUH WKH ILGHOLW\ RI WKH QHZO\ FRQVWUXFWHG SULPHUV (DFK SULPHU VHW ZDV FRQILUPHG WR SURGXFH WKH SUHGLFWHG SURGXFW $ UHSOLFDWLRQ RI D SRUWLRQ RI WKH '1$ VHTXHQFLQJ JHO DQG UHVWULFWLRQ HQGRQXFOHDVH GLJHVWLRQ JHO IRU *DO7DVH SURGXFWV GHPRQVWUDWLQJ WKH DFFXUDF\ RI WKH GHULYHG SURGXFW LV GHSLFWHG LQ )LJXUH 5HODWLYH 4XDQWLILFDWLRQ RI P51$ 7UDQVFULSWLRQ /HYHOV 573&5 UHDFWLRQV ZLWK SULPHU VHWV IRU HDFK GHYHORSPHQWDO SURWHLQ ZDV FRPSOHWHG IRU HDFK WLPH SRLQW IURP IHWDO GD\ WKURXJK DGXOW 6LPXOWDQHRXVO\

PAGE 86

HAFH $ $ 7 7 & & $ $ 7 7 7 7 & & $ $ * $ $ & & * 7 7 & & F F F F 7 7 & & & & $ $ * $ $ 7 7 * & & F F F F $ $ * * * 7 7 * $ $ * 7 7 * 7 7 $ $ $ $ & & 7?A Fr QHAn StH 6Hrn 6HA}7!H RR9f % XQGLJHVWHG *DO7DVH $YD ,, GLJHVWHG 573&5 SURGXFW *DO7DVH SURGXFWV )LJXUH &RQILUPDWLRQ RI *DO7DVH 573&5 3URGXFWV 3DQHO $ UHSUHVHQWV D SRUWLRQ RI WKH '1$ VHTXHQFLQJ JHO REWDLQHG E\ SRO\DFU\ODPLGH JHO HOHFWURSKRUHVLV RI WKH JHO H[WUDFWHG 573&5 SURGXFW IURP WKH *DO7DVH UHDFWLRQ FRQILUPLQJ WKH *DO7$VH VHTXHQFH DV LOOXVWUDWHG RQ SDJH RI WKLV WH[W 3DQHO % UHSUHVHQWV WKH DJDURVH JHO HOHFWURSKRUHVLV VHSDUDWLRQ RI WKH UHVWULFWLRQ HQGRQXFOHDVH GLJHVWHG SURGXFW RI WKH *DO7DVH 573&5 SURGXFW FRQILUPLQJ WKH DSSURSULDWH VL]HG SURGXFW IRU *DO7DVH

PAGE 87

573&5 DPSOLILFDWLRQ RI *3'+ ZDV DFFRPSOLVKHG LQ SDUDOOHO ZLWK HDFK H[SHULPHQW IRU FRPSDUDWLYH DQDO\VLV 573&5 UHDFWLRQV ZHUH UHSHDWHG RQ VHSDUDWH RFFDVLRQV 3RODURLG SKRWRJUDSKV RI WKH VHSDUDWHG 573&5 SURGXFW VHUYHG DV WKH UDZ GDWD 4XDQWLILFDWLRQ RI P51$ H[SUHVVLRQ ZDV FRPSOHWHG E\ VFDQQLQJ HDFK 3RODURLG SKRWRJUDSK DQG GLJLWL]LQJ WKH LQWHQVLW\ RI HDFK DPSOLFRQ ZLWK WKH 1,+ ,PDJH Y SURJUDP $Q H[DPSOH RI WKH FDOFXODWLRQ RI WKH UDWLR RI WKH *DO7DVH *3'+ P51$ IRU WKH GD\ DPSOLFRQ RI )LJXUH IROORZV 7KH SRODURLG SKRWRJUDSK )LJXUH LV D UHSURGXFWLRQ RI VDPHf RI WKH JHO HOHFWURSKRUHVLV VHSDUDWHG 573&5 UHDFWLRQ SURGXFW ZDV VFDQQHG DQG WKH LQWHQVLW\ RI WKH GD\ DPSOLFRQ ZDV GLJLWL]HG WR SURYLGH GHQVLWRPHWULF GDWD 7KH DUHD RI WKLV DPSOLFRQ ZDV GHWHUPLQHG WR EH 7DEOH f ZKLOH WKH FRQWURO DPSOLFRQ ZDV GHWHUPLQHG WR EH XQLWV 7KH DUHD ZDV WKHQ QRUPDOL]HG E\ GLYLGLQJ HDFK DUHD E\ WKH QXPEHU RI DPLQR DFLG UHVLGXHV RI WKHLU UHVSHFWLYH SURGXFW IRU *DO7DVH IRU *3'+ f 7KH UDWLR RI *DO7DVH *3'+ ZDV WKHQ GHWHUPLQHG E\ GLYLGLQJ QRUPDOL]HG *DO7DVH E\ QRUPDOL]HG *3'+ f ZKLFK JDYH D UDWLR RI *DO7DVH WR *3'+ SHU UHDFWLRQ &RQFHLYDEO\ WKLV UDWLR FRXOG EH H[WUDSRODWHG WR D FRS\ QXPEHU SHU FHOO EDVHG RQ WKH UHSRUW E\ %UDGKRUVW DQG 0F&RQNH\ RI D PHDQ WRWDO 51$ SHU PDPPDOLDQ FHOO RI SJ %UDGKRUVW DQG 0F&RQNH\ f DQG UHSRUWHG FRSLHV RI *3'+ P51$ SHU FHOO )RU WKH SXUSRVHV RI WKHVH H[SHULPHQWV KRZHYHU WKLV ZDV QRW QHFHVVDU\

PAGE 88

)LJXUH *HO (OHFWURSKRUHVLV 6HSDUDWLRQ RI *DOODVH 573&5 3URGXFWV 7KH JHO HOHFWURSKRUHVLV VHSDUDWHG SURGXFWV RI WKH 573&5 UHDFWLRQ FRPSOHWHG IRU *DO7DVH DUH GHPRQVWUDWHG KHUH ,Q WKH XSSHU SDQHO /DQH UHSUHVHQWV WKH QHJDWLYH FRQWURO ODQH 573&5 UHDFWLRQ UXQ ZLWKRXW DQ\ VDPSOH 51$f /DQHV UHSUHVHQW IHWDO GD\V /DQH ZDV D SRVLWLYH FRQWURO ODQH 573&5 UHDFWLRQ ZLWK OLYHU 51$ D ULFK VRXUFH RI *DO7DVHf 7KH ORZHU SDQHO GHPRQVWUDWHV DPSOLFRQV IURP WKH FRQWURO 57 3&5 UHDFWLRQV RI WKH VDPH WLVVXHV DW WKH VDPH WLPH SRLQWV IRU WKH KRXVHNHHSLQJ JHQH *3'+

PAGE 89

&ROXPQ 7LPH *7 *7 *3'+ *7* 51$ G 7 G G G G G ‘7,1 /LYHU 51$ 7DEOH &DOFXODWLRQ RI 6HPL4XDQWLWDWLYH *DO7DVH ([SUHVVLRQ 7KLV WDEOH UHSUHVHQWV WKH GDWD DQG FDOFXODWLRQ RI QRUPDOL]HG DPSOLFRQ LQWHQVLW\ RI WKH 573&5 UHDFWLRQ GHSLFWHG LQ )LJXUH 7LPH SRLQWV HYDOXDWHG DUH IHWDO GD\V DQG QHRQDWH DQLPDOV 11f $V SUHYLRXVO\ VWDWHG QR P51$ P51$f VHUYHG DV WKH QHJDWLYH FRQWURO DQG OLYHU WLVVXH ZDV XVHG IRU WKH SRVLWLYH FRQWURO 7KH DUHD RI HDFK DPSOLFRQ LV VHHQ &ROXPQ DQG f QRUPDOL]HG IRU WKHLU UHVSHFWLYH DPLQR DFLG OHQJWK &ROXPQ DQG f WKHQ D UDWLR JHQHUDWHG IRU *DO7DVH *3'+ SHU UHDFWLRQ DQG WLPH SRLQW &ROXPQ f

PAGE 90

$V SUHYLRXVO\ VWDWHG WKHVH H[SHULPHQWV ZHUH UHSHDWHG RQ VHSDUDWH RFFDVLRQV DQG WKHVH UDWLRV IURP HDFK WLPH SRLQW IRU HDFK P51$ ZHUH DYHUDJHG )LJXUHV WKURXJK UHSUHVHQW WKH DYHUDJHG UHVXOWV RI WKH GDWD VHWV IRU HDFK RI WKH GHYHORSPHQWDO SURWHLQ P51$ HYDOXDWHG (DFK SDQHO FRQVLVW RI D QHJDWLYH FRQWURO ODQH f ZKHUH QR P51$ ZDV XVHG LQ WKH 57 3&5 UHDFWLRQ DV ZHOO DV D SRVLWLYH FRQWURO ODQH f XWLOL]LQJ DGXOW PRXVH OLYHU P51$ /DQHV UHSUHVHQW WKH UHVXOWV IURP 573&5 UHDFWLRQV ZLWK P51$ IURP IHWDO GD\V DQG QHRQDWH UHVSHFWLYHO\ ([DPLQDWLRQ RI WKH P51$ GDWD SUHVHQWHG LQ WKH SUHYLRXV ILJXUHV GHPRQVWUDWHG DQ RYHUDOO WUHQG RI LQFUHDVHG VDOLYDU\ SURWHLQ P51$ WUDQVFULSWLRQ UHODWLYH WR *3'+ RYHU WKH GHYHORSPHQWDO WLPH SHULRGV HYDOXDWHG $GGLWLRQDOO\ ZKHQ FRQVLGHULQJ WKH SUHQDWDO GHYHORSPHQW GD\V RQO\ IHWDO GD\ DQG f RI SURWHLQV GHPRQVWUDWHG D H[SUHVVLRQ SHDN DW IHWDO GD\ &RQWUDGLFWRU\ RQO\ DP\ODVH H[SUHVVLRQ GHPRQVWUDWHG D SHDN DW IHWDO GD\ :KLOH PRVW RI WKHVH VDOLYDU\ SURWHLQV GLG GHPRQVWUDWH D SHDN DW IHWDO GD\ RQO\ *DO7DVH DQG PXFLQ GHPRQVWUDWHG D GHJUHH RI VWDWLVWLFDO VLJQLILFDQFH 3 f 3URWHLQV DVVRFLDWHG ZLWK GXFWDO WLVVXHV (*) DQG 1*)f DSSHDUHG WR KDYH D FRQVLVWHQW H[SUHVVLRQ SDWWHUQ WKURXJKRXW GHYHORSPHQW ZKLOH WKRVH SURWHLQV DVVRFLDWHG ZLWK DFLQDU FHOO WHUPLQDO GLIIHUHQWLDWLRQ DP\ODVH F\VWDWLQ O\VR]\PH DQG PXFLQf DSSHDUHG WR VKRZ D WUHQG RI LQFUHDVHG H[SUHVVLRQ DV WKH WLVVXHV PDWXUHG *DO7DVH H[SUHVVLRQ IROORZHG WKH JHQHUDO SDWWHUQ RI LQFUHDVLQJ H[SUHVVLRQ ZLWK WLVVXH PDWXULW\

PAGE 91

Â’ $0<*3'+f R $0<*3'+f R $0<*3'+f $ $0<*3'+f 6L $0<*3'+f 0 0HDQ 7LPH )LJXUH 'HYHORSPHQWDO ([SUHVVLRQ RI $P\ODVH P51$ 7KLV JUDSK UHSUHVHQWV WKH DPRXQW RI DP\ODVH P51$ SURGXFHG UHODWLYH WR *3'+ /DQH LV D QHJDWLYH FRQWURO 573&5 UHDFWLRQ XVLQJ QR P51$f ZKLOH /DQH LV D SRVLWLYH FRQWURO 573&5 UHDFWLRQ XVLQJ DGXOW PRXVH OLYHU P51$f (DFK JUDSK UHSUHVHQWV WKH DYHUDJH RI VHSDUDWH H[SHULPHQWV DQG WKH EDUV UHSUHVHQW WKH PHDQ IRU HDFK WLPH SRLQW IHWDO GD\V QHRQDWH >11@f 'XULQJ WKH IHWDO GD\V WKHUH LV PLQLPDO WUDQVFULSWLRQ RI WKH DP\ODVH JHQH 7KHUH LV D b LQFUHDVH LQ WUDQVFULSWLRQ IURP IHWDO WR QHRQDWH WLPH SHULRGV 7KLV GDWD FRUURERUDWHV SUHYLRXV UHSRUWV WKDW DP\ODVH SURGXFWLRQ SDUDOOHOV 363 3RXOVHQ HWDO f

PAGE 92

Â’ &<6*3'+f R &<6*3'+f R &<6*3'+f $ &<6*3'+f &<6*3'+f X 0HDQ 7LPH )LJXUH 'HYHORSPHQWDO ([SUHVVLRQ RI &\VWDWOQ P51$ &\VWDWLQ P51$ WUDQVFULSWLRQ UDWHV UHODWLYH WR *3'+ ,Q JHQHUDO DUH YHU\ ORZ DOWKRXJK WKHUH LV D b LQFUHDVH IURP WKH QHRQDWDO VWDJH WR DGXOW 3UHYLRXV LQYHVWLJDWRUV KDG IRXQG D WHPSRUDO H[SUHVVLRQ SDWWHUQ GXULQJ GHYHORSPHQW &R[ DQG 6KDZ f )HWDO WUDQVFULSWLRQ UDWHV GHPRQVWUDWH D SHDN DOEHLW VPDOO DW GD\

PAGE 93

7LPH Â’ (*)*3'+f 2 (*)*3'+f 2 (*)*3'+f $ (*)*3'+f (*)*3'+f 0HDQ )LJXUH 'HYHORSPHQWDO ([SUHVVLRQ RI (*) P51$ 3UHYLRXV LQYHVWLJDWRUV KDG UHSRUWHG (*)5 SURWHLQ DW QHRQDWH GD\ (*) DW QHRQDWH GD\ 6DOLGR HW DO f DQG (*) WUDQVFULSWLRQ LQ XWHUDR .DVKLPDWD DQG *UHVLN *UHVLN HW DO f 7KLV UHSRUW FRUURERUDWHV WKHVH ILQGLQJV (*) P51$ UHODWLYH WR *3'+ UHSUHVHQWHG WKH JUHDWHVW RYHUDOO WUDQVFULSWLRQ UDWH RI DOO WKH SURWHLQV HYDOXDWHG LQ WKLV UHSRUW ,Q JHQHUDO (*) WUDQVFULSWLRQ UDWHV SDUDOOHOHG WKRVH RI 1*) DQRWKHU GXFWDO SURGXFW 7UDQVFULSWLRQ LQ IHWDO GD\V ZDV DOPRVW IROG KLJKHU WKDQ WKH DYHUDJH RI DO WKH RWKHU SURWHLQV DQG DOVR UHDFKHG DQ LQ WHUR SHDN DW IHWDO GD\

PAGE 94

] LU ( R 4 RR 2 FH ( + 2 7LPH Â’ *7*3'+f R *7*3'+f R *7*3'+f $ *7*3'+f P *7*3'+f + 0HDQ )LJXUH 'HYHORSPHQWDO ([SUHVVLRQ RI *DO7DVH P51$ *DO7DVH P51$ WUDQVFULSWLRQ GXULQJ IHWDO GHYHORSPHQW WHQGV WR SDUDOOHO WKRVH RI GXFWDO FHOO SURGXFWV (*) DQG 1*) VXJJHVWLQJ D UROH IRU *DO7DVH GXULQJ EUDQFKLQJ PRUSKRJHQHVLV $ IHWDO *DO7DVH P51$ WUDQVFULSWLRQ SHDN RFFXUV DW GD\ DQG WKHUH LV VPDOO LQFUHDVH LQ WUDQVFULSWLRQ UDWHV DIWHU ELUWK

PAGE 95

7LPH Â’ /<6*3'+f R /<6*3'+f R /<6*3'+f $ /<6*3'+f D /<6*3'+f 0HDQ )LJXUH 'HYHORSPHQWDO ([SUHVVLRQ RI /\VR]\PH P51$ /\VR]\PH P51$ WUDQVFULSWLRQ UHODWLYH WR *3'+ ZDV JHQHUDOO\ YHU\ ORZ WKURXJKRXW IHWDO GHYHORSPHQW 7KH ILQGLQJ RI IHWDO O\VR]\PH P51$ WUDQVFULSWLRQ FRQILUPV SUHYLRXV UHSRUWV E\ 0DJD HWDO f $IWHU ELUWK WKH WUDQVFULSWLRQ UDWHV LQFUHDVHG VLJQLILFDQWO\ ZKHQ FRPSDUHG WR HDUO\ VWDJHV RI GHYHORSPHQW S f

PAGE 96

7LPH Â’ 08&*3'+f 2 08&*3'+f 2 08&*3'+f $ 08&*3'+f % 08&*3'+f 0HDQ )LJXUH 'HYHORSPHQWDO ([SUHVVLRQ RI 0XFLQ P51$ 0XFLQ LV D WHUPLQDO SURGXFW RI WKH ZHOO GLIIHUHQWLDWHG PXFLQRXV VXEPDQGLEXODU JODQG /RZ WUDQVFULSWLRQ OHYHOV RI PXFLQ P51$ FRPSDUHG WR *3'+ DUH VHHQ GXULQJ WKH IHWDO VWDJH ZLWK VLJQLILFDQW LQFUHDVHV IRXQG LQ WKH QHRQDWH FRPSDUHG WR IHWDO GD\ S f 0XFLQ P51$ ZDV ILUVW GHWHFWHG DW IHWDO GD\ ZKLFK FRQILUPV UHSRUWV RI IHWDO PXFLQ P51$ GHWHFWLRQ -DVNRO HWDO f

PAGE 97

Â’ 1*)*3'+4f 2 1*)*3'+f 2 1*)*3'+f $ 1*)*3'+f F6 1*)*3'+f 8OL 0HDQ )LJXUH 'HYHORSPHQWDO ([SUHVVLRQ RI 1*) P51$ 1*) OLNH (*) LV D SURGXFW RI WKH VDOLYDU\ JUDQXODU FRQYROXWHG GXFW FHOOV *UHVLN HW DO f DQG SDUDOOHOV (*) WUDQVFULSWLRQ DV SUHYLRXVO\ UHSRUWHG :LOVRQ HW DO f EXW ORZHU DW HDFK WLPH SRLQW 1*) WUDQVFULSWLRQ UDWHV ZHUH JHQHUDOO\ HOHYDWHG FRPSDUHG WR WHUPLQDO SURGXFW WUDQVFULSWV $0< 08& /<6f ZKLFK DSSHDUV WR IROORZ WKH JHQHUDO GHYHORSPHQWDO VFKHPH ZKHUH QHUYRXV V\VWHPV FRXSOLQJ IROORZV PRUSKRJHQHVLV DQG F\WRGLIIHUHQWLDWLRQ &XWOHU f 1*) DQG (*) DUH DQWLFLSDWHG WR GHFUHDVH LQ DGXOW DJHV *UHVLN DQG $]PLWLD f 1*) WUDQVFULSWLRQ ZDV WKH PRVW FRQVWDQW RI DOO WKH SURWHLQV HYDOXDWHG LR 4& e [ D D FR 2 ] FF ( // ] RAS & ] ] ] = = ] ] R 4& e 6 V e e e 6 6 D RQ 7 U r7 &2 7 7f+ Uar ] 7LPH

PAGE 98

7LPH Â’ 363*3'+f R 363*3'+f R 363*3'+f $ 363*3'+f P 363*3'+f 0HDQ )LJXUH 'HYHORSPHQWDO ([SUHVVLRQ RI 363 P51$ ,QLWLDO UHSRUWV LQGLFDWHG WKDW 363 ZDV IRXQG LQ WKH SDURWLG JODQG RQO\ 0DGVHQ DQG +MRUWK 6KDZ HW DO 6KDZ DQG 6FKLEOHU f 5HFHQWO\ LQYHVWLJDWRUV XVLQJ 363 VSHFLILF DQWLVHUD LQ :HVWHUQ EORW DQDO\VHV ORFDOL]HG 363 LQ WKH VXEPDQGLEXODU JODQGV RI QHRQDWH PLFH DV ZHOO 0LULV HW DO f ,Q RXU DQDO\VLV QR 363 P51$ WUDQVFULSWLRQ ZDV GHWHFWHG LQ IHWDO JODQG WLVVXHV XQWLO IHWDO GD\ DQG RQO\ PLQXWH DPRXQWV ZHUH IRXQG XQWLO WKH QHRQDWH VWDJHV DQG EH\RQG

PAGE 99

&HOOVXUIDFH *DO7DVH (Q]\PDWLF $FWLYLW\ 3URILOH 7R HYDOXDWH FHOOVXUIDFH H[SUHVVLRQ DQG DFWLYLW\ RI WKH SURWHLQ ZH HPSOR\HG WKH *DO7DVH HQ]\PDWLF DFWLYLW\ DVVD\ 7LVVXHV ZHUH FROOHFWHG IURP HDFK WLPH SRLQW FHOOV LVRODWHG DQG FHOOVXUIDFH *DO7DVH DFWLYLW\ HYDOXDWHG RQ VHSDUDWH RFFDVLRQV 0HDQ *DO7DVH DFWLYLW\ IRU WKH H[SHULPHQWV ZDV UHSRUWHG DV QDQRPROHV JDODFWRVH LQFRUSRUDWHG K FHOOV 7KH ODFWDWH GHK\GURJHQDVH /'+f DFWLYLW\ DVVD\ ZDV SHUIRUPHG VLPXOWDQHRXVO\ WR GHWHUPLQH OHDNDJH RI F\WRSODVPLF FRQVWLWXHQWV /'+ DFWLYLW\ ZDV QHYHU b RI WKH /'+ DFWLYLW\ RI WKH FRQWURO O\VHG FHOOV DQG ZDV QRW FRQVLGHUHG VLJQLILFDQW 7KH UHVXOWV RI WKH *DO7DVH DFWLYLW\ DUH UHSRUWHG LQ 7DEOH *HQHUDOO\ WKH FHOOVXUIDFH DFWLYLW\ RI *DO7DVH VHHPV WR SDUDOOHO WKH P51$ H[SUHVVLRQ SDWWHUQ VHHQ GXULQJ GHYHORSPHQW $JDLQ WKHUH ZDV D SHDN DW IHWDO GD\ DOWKRXJK LW GRHV QRW DSSHDU DV SURQRXQFHG DV WKH P51$ SDWWHUQ DQG ZDV QRW VWDWLVWLFDOO\ VLJQLILFDQW S f +LVWRORJLF DQG ,PPXQRKLVWRFKHPLFDO $QDO\VLV +HPDWR[LOLQ DQG HRVLQ VWDLQLQJ RI UHSUHVHQWDWLYH IHWDO GHYHORSPHQWDO GD\V DQG GHPRQVWUDWH D JHQHUDO LQFUHDVH LQ DUFKLWHFWXUH DQG RUJDQL]DWLRQ )LJXUH f 7KH IHWDO GD\ VHFWLRQ GHPRQVWUDWHG D IHZ ORFDOL]HG LVODQGV RI DFLQDU FHOOV DW WKH OHDGLQJ HGJHV RI JODQGXODU GHYHORSPHQW DQG D IHZ EXW ZHOO GHYHORSHG GXFWDO VWUXFWXUHV WKURXJKRXW %\ IHWDO GD\ WKH DFLQDU FHOOV KDYH JUHDWO\ SUROLIHUDWHG DQG WKH JODQGXODU VWUXFWXUH LV D ZHOO GHILQHG QHWZRUN

PAGE 100

&HOO6XUIDFH *DO7DVH $FWLYLW\ 7LPH (Q]\PDWLF $FWLYLW\ IHWDO GD\Vf QP *DODFWRVH LQFRUSRUDWHG FHOOV KRXUf G s G s G s G s G s G s 1HRQDWH s $GXOW s 7DEOH &HOOVXUIDFH *DO7DVH $FWLYLW\ 7KH FHOOVXUIDFH DFWLYLW\ ZDV PHDVXUHG IURP LQWDFW DFLQDU FHOOV IURP IHWDO GD\ QHRQDWH DQG DGXOW PRXVH VXEPDQGLEXODU WLVVXHV 7KH QXPHULF YDOXHV UHSUHVHQW WKH DPRXQW RI 8'3>&@JDODFWRVH LQFRUSRUDWHG DFLQDU FHOOV KRXU s VWDQGDUG GHYLDWLRQ

PAGE 101

SULPRUGLDO DFLQDU FHOOV PHVHQFK\PDO FDSVXOH SULPRUGLDO VDOLYDU\ GXFW RUJDQL]HG V\VWHP RI VDOLYDU\ JODQG GXFWV ZHOO GHILQHG DFLQDU FHOO FOXVWHUV )LJXUH +LVWRORJLF (YDOXDWLRQ RI 1RUPDO 'HYHORSPHQW +HPDWR[LOLQ DQG HRVLQ VWDLQLQJ RI UHSUHVHQWDWLYH IHWDO GHYHORSPHQWDO GD\V DQG )HWDO GD\ VHFWLRQ GHPRQVWUDWHV IHZ LVRODWHG LPPDWXUH DFLQDU FHOO LVODQGV WKURXJKRXW WKH IHWDO JODQG DQG IHZ ZHOO GHILQHG GXFWDO VWUXFWXUHV %\ IHWDO GD\ WKH DFLQDU FHOOV KDYH SUROLIHUDWHG DQG WKH GXFWDO VWUXFWXUHV KDYH GHYHORSHG D RUJDQL]HG QHWZRUN

PAGE 102

,PPXQRKLVWRFKHPLVWU\ ZDV SHUIRUPHG WR HYDOXDWH WKH H[SUHVVLRQ SDWWHUQ RI *DO7DVH LQ GHYHORSLQJ IHWDO VXEPDQGLEXODU JODQGV )LJXUH GHPRQVWUDWHV D JHQHUDO LQFUHDVH LQ *DO7DVH WKURXJK WKH LQFUHDVLQJ VWDJHV RI WKH VXEPDQGLEXODU JODQG GHYHORSPHQW 2Q IHWDO GD\ WKHUH LV OLWWOH RU QR VWDLQLQJ RI WKH DFLQDU FHOOV LQ WKH GHYHORSLQJ VDOLYDU\ JODQG EXG 6RPH QRQVSHFLILF VWDLQLQJ RI WKH PHVHQFK\PDO FDSVXOH GRHV DSSHDU $W IHWDO GD\ VRPH LP PL XQR UHDFWLYH VLWHV ZLWKLQ WKH DFLQDU FHOO FOXVWHUV EHJLQ WR DSSHDU ZLWK VWDLQLQJ IURP WKH PRQRFORQDO DQWL*DO7DVH DQWLERG\ 7KH PP X QR UHDFWLYH LQWHQVLW\ RI WKH DFLQDU FOXVWHUV LQFUHDVHV DV GRHV WKH RYHUDOO LPPXQRKLVWRFKHPLFDO VWDLQLQJ ZLWK WKH PDWXUDWLRQ RI WKH WLVVXH IURP GD\V DQG 'XULQJ WKH ODWHU VWDJHV RI IHWDO JODQG PDWXUDWLRQ IHWDO GD\V DQG f LPPXQRUHDFWLYH *DO7DVH ZDV PRVW VWURQJO\ DVVRFLDWHG ZLWK DQG PRVW FRQFHQWUDWHG LQ WKH DFLQDU FHOO FOXVWHUV DOWKRXJK LW ZDV DOVR JHQHUDOO\ SUHVHQW WKURXJKRXW WKH JODQGXODU VWUXFWXUH &RQWURO WLVVXHV ZKLFK ZHUH WUHDWHG ZLWK QRQLPPXQH VHUXP DQWLERG\ LVRW\SH DQG VHFRQGDU\ DQWLERG\ DORQH ZHUH URXWLQHO\ ZLWKRXW LPPXQRUHDFWLYH VWDLQLQJ )ORZ &\WRPHWULF (YDOXDWLRQ RI &HOOVXUIDFH *DO7DVH 'XULQJ 'HYHORSPHQW )ORZ F\WRPHWU\ RI IHWDO PRXVH VDOLYDU\ JODQG DFLQDU FHOOV SHU HYHQW ZDV DOVR XWLOL]HG WR HYDOXDWH DOWHUDWLRQV LQ FHOOVXUIDFH *DO7DVH H[SUHVVLRQ IURP UHSUHVHQWDWLYH IHWDO GHYHORSPHQWDO GD\V DQG )LJXUH SURYLGHV HYLGHQFH RI LQFUHDVHG FHOOVXUIDFH *DO7DVH H[SUHVVLRQ IURP GHYHORSLQJ IHWDO WLVVXHV IURP IHWDO GD\ WR )ORZ F\WRPHWU\ VWXGLHV

PAGE 103

)LJXUH ,PPXQRKLVWRFKHPLFDO $QDO\VLV RI *DO7DVH ([SUHVVLRQ 7KLV SDQHO UHSUHVHQWV WKH LPPXQRKLVWRFKHPLFDO VWDLQLQJ RI IHWDO PRXVH VXEPDQGLEXODU JODQGV ZLWK PRXVH DQWLKXPDQ *DO7DVH PRQRFORQDO DQWLERG\ 7KHUH LV HYLGHQFH RI D JHQHUDO LQFUHDVHG LPPXQRUHDFWLYLW\ RI WKH WLVVXHV IURP IHWDO GD\ WR

PAGE 104

)LJXUH )ORZ &\WRPHWULF (YDOXDWLRQ RI &HOO6XUIDFH *DO7DVH )ORZ F\WRPHWU\ ZDV SHUIRUPHG RQ LQWDFW IHWDO DFLQDU FHOOV SHU HYHQW 7KH SHDN UHSUHVHQWHG E\ $ LV IURP FHOOV SDUW RI WKH f WKDW ZHUH QRW ODEHOOHG 3HDN % UHSUHVHQWV WKH FHOOV WKDW ZHUH ERXQG E\ WKH QRQLPPXQH VHUXP RI QRUPDO PLFH ZKLOH SHDN & LV WKH FHOOV WKDW ZHUH ODEHOOHG ZLWK WKH PRQRFORQDO DQWL*DO7DVH ,J* DQWLERG\ ,QFUHDVHG ),7& IOXRUHVFHQFH RI DQWL*DO7DVH DQWLERG\ ODEHOOHG FHOOV LV VHHQ IURP IHWDO GD\ WR DV HYLGHQFHG E\ WKH VKLIW LQ WKH ODEHOHG DFLQDU FHOOV QRWH WKH OLQH LQGLFDWLQJ WKH QXPEHU RI ODEHOOHG *DO7DVH FHOOVf FRUURERUDWLQJ FHOO VXUIDFH HQ]\PDWLF DFWLYLW\ UHVXLWV

PAGE 105

XWLOL]HG FRQWURO VDPSOHV ZLWK SULPDU\ DQWLERG\ RQO\ QRQLPPXQH VHUXP s SULPDU\ DQG VHFRQGDU\ DQWLERGLHV ,J* LVRW\SH FODVV FRQWURO s SULPDU\ DQG VHFRQGDU\ DQWLERGLHV DQG VHFRQGDU\ DQWLERG\ DORQH $GXOW OLYHU FHOOV ZHUH DOVR KDUYHVWHG WR VHUYH DV SRVLWLYH FRQWUROV (YDOXDWLRQ RI 2UJDQ &XOWXUH LQ YLWURf ([SHULPHQWV 7KH PRXVH RUJDQ FXOWXUH V\VWHP ZDV XVHG WR HYDOXDWH WKH UROH RI *DO7DVH LQ IHWDO PRXVH VXEPDQGLEXODU JODQG GHYHORSPHQW (DFK G IHWDO PRXVH VXEPDQGLEXODU JODQG ZDV DVHSHWLFDOO\ KDUYHVWHG DQG FXOWXUHG VHSDUDWHO\ LQ ODPLQLQ FRDWHG ZHOOV ZLWK PHGLD DW r& IRU KRXUV (YDOXDWLRQ RI *DO7DVHfV UROH LQ GHYHORSPHQW ZDV GHWHUPLQHG E\ DGGLWLRQV RI VXEVWUDWHV DODFWDOEXPLQ DQWL*DO7DVH DQWLERG\ DQWLODPLQLQ DQWLERG\ DQG W\USKRVWLQf WR WKH PHGLD DQG SUHWUHDWPHQW RI ODPLQLQ FRDWHG ZHOOV ZLWK ERYLQH *DO7DVH 7KH PHGLD DORQH DQG DGGLWLRQ RI VWHULOH ; 3%6 VHUYHG DV FRQWUROV )LYH JODQGV ZHUH HYDOXDWHG ZLWK HDFK FRQGLWLRQ DQG HDFK H[SHULPHQW ZDV UHSURGXFHG RQ VHSDUDWH RFFDVLRQV )LIWHHQ DGGLWLRQDO JODQGV ZHUH FXOWXUHG VLPLODUO\ EXW RQ SODVWLF ZHOOV ZLWKRXW ODPLQLQ FRDWLQJ &RQWURO LQ YLWUR 'HYHORSPHQW RI )HWDO 6XEPDQGLEXODU *ODQGV ,Q YLWUR GHYHORSPHQW RI G IHWDO PRXVH VXEPDQGLEXODU JODQGV JURZQ LQ FXOWXUH RQ ODPLQLQFRDWHG SODWHV IRU KRXUV DSSHDU WR PLPLF QRUPDO EUDQFKLQJ PRUSKRJHQHVLV DQG SUROLIHUDWLRQ DV SUHYLRXVO\ REVHUYHG IRU ,Q YLYR

PAGE 106

GHYHORSPHQW 1DNDQLVNL DQG ,VKLL f 7KHUH ZDV D PRUSKRORJLF EXUVW DIWHU KRXUV ,Q FXOWXUH IRU RI JODQGV bf S f ZKHUH WKH GHYHORSLQJ JODQG GHPRQVWUDWHG VWUXFWXUDO EUDQFKLQJ ZLWK WHUPLQDO DFLQDU FHOOV WKDW DSSHDUHG IXOO DQG URXQGHG LQ IDPLOLDU JUDSHOLNH FOXVWHUV )LJXUH f 7KH H[SUHVVLRQ RI P51$ OHYHOV IURP HDFK GHYHORSPHQWDO PDUNHU WKDW UHSUHVHQWHG WHUPLQDO DFLQDU FHOO GLIIHUHQWLDWLRQ DP\ODVH PXFLQ O\VR]\PH DQG 363 )LJXUH f GHPRQVWUDWHG OHYHOV WKDW ZHUH ORZHU WKDQ WKH SURGXFWV RI WKH GXFWDO FHOOV (*) 1*) DQG F\VWDWLQ )LJXUH f *DO7DVH P51$ H[SUHVVLRQ IROORZHG WKH SDWWHUQ RI GHYHORSPHQWDO SURWHLQV DVVRFLDWHG GXFWDO FHOOV DQG UHDFKHG SHDN OHYHOV DW KRXUV LQ PHGLD DORQH ZLWK DQ DPSOLFRQ LQWHQVLW\ UDWLR RI s XQLWV IRU *DO7DVH ZKHQ FRPSDUHG WR *3'+ P51$ )LJXUHV SDQHO $f 7KH FHOOVXUIDFH *DO7DVH DFWLYLW\ DV PHDVXUHG E\ D VWDQGDUG HQ]\PH DVVD\ GHPRQVWUDWHG D SHDN DFWLYLW\ OHYHO RI s Q0 JDO LQFRUSRUDWHG FHOOVKRXU DW WKH KRXU WLPH SRLQW LQ FXOWXUH 7DEOH URZ f 7KHUH ZDV D GUDPDWLF LQFUHDVH LQ FHOO VXUIDFH HQ]\PDWLF DFWLYLW\ VHHQ DW WKH KRXU WLPH SRLQW FRPSDUHG WR DFWLYLW\ DW RU KRXU S f %HWZHHQ DQG KRXUV LQ FXOWXUH WKH OHYHOV RI *DO7DVH P51$ DQG SURWHLQ UHPDLQHG FRQVWDQW 2UJDQV FXOWXUHG ZLWK WKH DGGLWLRQ RI ; 3%6 SDUDOOHOHG WKHVH UHVXOWV IRU DOO SDUDPHWHUV ,Q FRQWUDVW DOO >b@f IHWDO RUJDQ FXOWXUHV JURZQ RQ SODVWLF UHVXOWHG LQ JODQGV WKDW IDLOHG WR GHPRQVWUDWH QRUPDO EUDQFKLQJ PRUSKRJHQHVLV DQG DFLQDU FHOO SUROLIHUDWLRQ )LJXUH SDQHO %f %UDQFKLQJ

PAGE 107

)LJXUH 5HSUHVHQWDWLYH 3KRWRPLFURJUDSKV RI )HWDO 0RXVH 6XEPDQGLEXODU *ODQG *URZQ LQ LQ YLWUR 2UJDQ &XOWXUH IRU )ORXUV )HWDO GD\ &'f VXEPDQGLEXODU JODQG FXOWXUHG RQ D ODPLQLQ FRDWHG ZHOO ZLWK %*-E PHGLD 6XEPDQGLEXODU RUJDQ GHPRQVWUDWHV QRUPDO EUDQFKLQJ PRUSKRJHQHVLV

PAGE 108

)LJXUH ([SUHVVLRQ RI KRXU P51$ /HYHOV RI 0DUNHUV RI 7HUPLQDO $FLQDU &HOO 'LIIHUHQWLDWLRQ (DFK SDQHO UHSUHVHQWV WKH UDWLR RI HDFK VHOHFWHG PDUNHUfV P51$ WR *3'+ P51$ UDWLR REWDLQHG RYHU WKH KRXU FXOWXUH SHULRG LQ PHGLD ZLWKRXW EORFNLQJ DJHQWV RI VHSDUDWH H[SHULPHQWV ,QGLYLGXDO GDWD SRLQWV DUH VKRZQ Â’ f ZKLOH WKH VKDGHG FROXPQV DUH WKH PHDQ IURP HDFK WLPH SRLQW &ROXPQ UHSUHVHQWV WKH QHJDWLYH FRQWURO UHVXOWV P51$f ZKLOH FROXPQ UHSUHVHQWV WKH SRVLWLYH FRQWURO UHVXOWV DGXOW P51$f 3DQHOV $ % & DQG UHSUHVHQW DP\ODVH $0
PAGE 109

&<6 P51$ *3'+ P51$ (*) P51$ *3'+ P51$ ) 7 ] FQ ( [ 4 4B FR 2 = WU ( /Ln HV ] + 7LPH )LJXUH ([SUHVVLRQ RI KRXU P51$ /HYHOV RI 'HYHORSPHQWDO 0DUNHUV RI 'XFWDO &HOO 'LIIHUHQWLDWLRQ 3DQHOV ( + UHSUHVHQW DYHUDJHG P51$ WR *3'+ OHYHOV RI GXFWDO FHOO GLIIHUHQWLDWLRQ PDUNHUV $JDLQ LQGLYLGXDO GDWD SRLQWV DUH VKRZQ Â’ f ZKLOH WKH VKDGHG FROXPQV DUH WKH PHDQ IURP HDFK WLPH SRLQW 3DQHOV ( ) DQG + UHSUHVHQW (*) 1*) F\VWDWLQ &<6f DQG *DO7DVH *7f UHVSHFWLYHO\ (DFK RI WKH GXFWDO FHOO SURGXFWV ZHUH JUHDWHU WKDQ DQ\ RI WKH DFLQDU FHOO SURGXFWV DW HYHU\ WLPH SRLQW %RWK JURXSV RI LQ YLWUR P51$ H[SUHVVLRQ SDWWHUQV GXFWDO DV ZHOO DV DFLQDU FHOO PDUNHUVf VHHP WR PLPLF WKH LQ YLYR GHYHORSPHQWDO SDWWHUQ

PAGE 110

)LJXUH 3KRWRPLFURJUDSKV RI 5HSUHVHQWDWLYH )HWDO 0RXVH 6XEPDQGLEXODU *ODQG +RXU 2UJDQ &XOWXUH )HWDO GD\ &'f VXEPDQGLEXODU JODQGV ZHUH FXOWXUHG LQ ODPLQLQ FRDWHG ZHOOV ZLWK %*-E PHGLD IRU KRXUV $GGLWLRQV WR WKH PHGLD LQFOXGHG QRWKLQJ SDQHO $f JURZQ RQ SODVWLF ZLWK QR DGGLWLRQ WR WKH PHGLD SDQHO %f DGGLWLRQ RI DODFWDOEXPLQ SDQHO &f DQWL*DO7DVH DQWLERG\ SDQHO 'f DQWLODPLQLQ DQWLERG\ SDQHO (f DQG SUHWUHDWPHQW RI WKH ZHOO ZLWK ERYLQH JDO DFWRV\OW UDQVI HUDVH SDQHO )f

PAGE 111

f§L U -6 ; ; A r D V V r 7LPH 7LPH 7LPH )LJXUH 5HODWLYH 4XDQWLILFDWLRQ RI LQ YLWUR P51$ ([SUHVVLRQ 3DQHO $ UHSUHVHQWV UHODWLYH TXDQWLILFDWLRQ RI LQ YLWUR OHYHOV RI *DO7DVH P51$ H[SUHVVLRQ IURP RUJDQV FXOWXUHG RQ ODPLQLQ FRDWHG ZHOOV ZLWK PHGLD DORQH 3DQHO % UHSUHVHQWV UHODWLYH P51$ OHYHOV IURP RUJDQV FXOWXUHG RQ SODVWLF ZLWK QR DGGLWLRQ WR WKH PHGLD 3DQHO & ) UHSUHVHQW UHODWLYH P51$ OHYHOV REWDLQHG IURP RUJDQV FXOWXUHG RQ ODPLQLQ ZLWK DGGLWLRQV WR WKH PHGLD RI DODFWDOEXPLQ SDQHO &f DQWL*DO7DVH DQWLERG\ SDQHO 'f DQWLODPLQLQ DQWLERG\ SDQHO (f DQG SUHWUHDWPHQW RI WKH ZHOO ZLWK ERYLQH JDODFWRV\OWUDQVIHUDVH SDQHO )f 7LVVXHV ZHUH KDUYHVWHG DQG 573&5 HYDOXDWLRQ RI *DO7DVH P51$ FRPSOHWHG IRU HDFK WLPH SRLQW $OO YDOXHV DUH H[SUHVVHG DV *DO7DVH GHQVLWURPHWULF YDOXH WR *3'+ GHQVLWURPHWULF YDOXH DQG WKH EDUV UHSUHVHQW WKH UDQJH LQ YDOXHV

PAGE 112

f I L >I /Hn n U Un SB Mn f &RQWUROf s s s s s s _I 3ODVWLFf s s s s s s DODFW s s s s s s DQWL *DO7DVH s s s s s s DQWL ODPLQLQ s s s s s s SUHn WUHDWPHQW s s s s s s 7DEOH &HOOVXUIDFH *DO7DVH $FWLYLW\ RI LQ YLWUR 2UJDQ &XOWXUHV &HOO VXUIDFH *DO7DVH DFWLYLW\ H[SUHVVHG DV PHDQ RI Q0 JDO LQFRUSRUDWHG FHOOVKRXU s 6' IRU VHSDUDWH H[SHULPHQWDO UHVXOWVf IURP WLVVXHV KDUYHVWHG DIWHU FXOWXULQJ LQ ODPLQLQ ZHOOV H[FHSW URZ f ZLWK WKH IROORZLQJ DGGLWLRQV WR WKH PHGLD PHGLD DORQH URZ f JURZQ RQ SODVWLF ZLWK QR DGGLWLRQ WR WKH PHGLD URZ f DGGLWLRQ RI D ODFWDOEXPLQ URZ f DQWL*DO7DVH DQWLERG\ URZ f DQWLODPLQLQ DQWLERG\ URZ f DQG SUHWUHDWPHQW RI WKH ZHOO ZLWK ERYLQH JDODFWRV\OWUDQVIHUDVH URZ f

PAGE 113

PRUSKRJHQHVLV RI WKH JODQG ZDV OHVV IXOO\ GHYHORSHG DQG WKH WHUPLQDO DFLQDU FHOOV ZHUH VPDOOHU DQG PRUH FRPSDFW LQ DSSHDUDQFH &DUHIXO UHYLHZ RI WKH SKRWRPLFURJUDSKV GHPRQVWUDWHG YHU\ FRQGHQVHG \HW RUJDQL]HG WHUPLQDO DFLQDU FHOO FOXVWHUV *DO7DVH P51$ H[SUHVVLRQ OHYHOV ZHUH QRW VLJQLILFDQWO\ DOWHUHG UHODWLYH WR WLPH S f EXW ZHUH JUHDWHU WKDQ FRQWURO OHYHOV JURZQ RQ ODPLQLQ DW DOO WLPHV H[FHSW WKH LQLWLDO SKDVHV DQG KRXUf 7DEOH SDQHO %f 7KH FHOOVXUIDFH SURWHLQ DFWLYLW\ DW KRXU ZDV LQFUHDVHG b ZKHQ FRPSDUHG WR JODQGV JURZQ RQ ODPLQLQ 7DEOH URZ f ([SHULPHQWDO LQ YLWUR 'HYHORSPHQW RI )HWDO 6XEPDQGLEXODU *ODQGV 7R GHWHUPLQH WKH UROH RI FHOOVXUIDFH *DO7DVH LQ PHGLDWLQJ WKH HDUO\ PRUSKRJHQLF HYHQWV LQ IHWDO VDOLYDU\ JODQG GHYHORSPHQW WKH HIIHFWV RI D PRGLILHU RI VXEVWUDWH VSHFLILFLW\ DODFWDOEXPLQf RU LQKLELWRU RI *DO7DVH DFWLYLW\ DQWL*DO7DVH DQWLERG\f ZHUH HYDOXDWHG 2UJDQ FXOWXUHV WUHDWHG ZLWK WKHVH DJHQWV WR SULPDULO\ OLPLW WKH SRWHQWLDO FHOOFHOO LQWHUDFWLRQV EXW DOVR SRWHQWLDO FHOOPDWUL[ LQWHUDFWLRQV DSSHDUHG WR ODFN DQ RYHUDOO DGKHVLYHQHVV DQG RUJDQL]DWLRQ >b@ DODFWDOEXPLQ >b@ DQWL*DO7DVH DQWLERG\f LQ WKH GHYHORSLQJ WLVVXH )LJXUH SDQHOV & DQG UHVSHFWLYHO\f $OWKRXJK WKH JODQGV DSSHDU WR KDYH UHWDLQHG WKH DELOLW\ WR VSUHDG DQG GHPRQVWUDWHG D VLPLODU GHJUHH RI EUDQFKLQJ ZKHQ JURZQ RQ ODPLQLQ FRDWHG SODWHV WKHUH ZHUH IHZHU OHVV FRKHVLYH WHUPLQDO DFLQDU FHOO FOXVWHUV 7KRVH SUHVHQW ODFNHG D FOHDUO\ GHILQHG JUDSHOLNH FOXVWHU

PAGE 114

)LJXUH 5HSUHVHQWDWLYH 3KRWRPLFURJUDSK RI 5HVXOWV $IWHU +RXUV LQ 2UJDQ &XOWXUH :LWK $GGLWLRQ RI $QWL*DO7DVH $QWLERG\ (QKDQFHG LQVSHFWLRQ RI WKH G IHWDO VXEPDQGLEXODU JODQG FXOWXUHG LQ PHGLD DQWL*DO7DVH DQWLERG\ LOOXVWUDWHG DERYH DW WKH KRXU LQ YLWUR PRUSKRORJLF SHDN GHPRQVWUDWHG G\VIXQFWLRQDO GHYHORSPHQW UHSUHVHQWLQJ SRRU FHOOFHO DGKHVLYHQHVV DQG GLPLQLVKHG FHOOPDWUL[ DWWDFKPHQW

PAGE 115

PRUSKRORJ\ )LJXUHV f $GGLWLRQ RI DODFWDOEXPLQ DQG DQWL*DO7DVH DQWLERG\ WR WKH PHGLD UHVXOWHG LQ RQO\ PLQLPDO DOWHUDWLRQ RI P51$ H[SUHVVLRQ OHYHOV RYHU WKH KRXU H[SHULPHQWDWLRQ SHULRG \HW FHOOVXUIDFH HQ]\PDWLF DFWLYLW\ ZDV VLJQLILFDQWO\ GLPLQLVKHG VXJJHVWLQJ WKDW WKH FRQFHQWUDWLRQ RI WKHVH DJHQWV ZDV DGHTXDWHO\ VSHFLILF IRU *DO7DVH ELQGLQJ $GGLWLRQV RI D ODFWDOEXPLQ DQG DQWL*DO7DVH DQWLERG\ WR FXOWXUH PHGLD UHVXOWHG LQ UHGXFHG FHOOVXUIDFH *DO7DVH DFWLYLW\ OHYHOV RI b DQG b S f UHVSHFWLYHO\ DW WKH KRXU PRUSKRORJLF SHDN 7KH PHDQ FHOOVXUIDFH *DO7DVH HQ]\PDWLF DFWLYLW\ RYHU WKH KRXU FXOWXUH SHULRG ZDV UHGXFHG E\ b DQG b S f IROORZLQJ DODFWDOEXPLQ DQG DQWL*DO7DVH DQWLERG\ WUHDWPHQW UHVSHFWLYHO\ 7DEOH URZV DQG f 7KH DGGLWLRQ RI DQWLODPLQLQ DQWLERG\ WR UHGXFH WKH FHOOPDWUL[ LQWHUDFWLRQ UHVXOWHG LQ D VLPLODU JURZWK SDWWHUQ DV WKDW VHHQ ZLWK WKH RUJDQ FXOWXUHV JURZQ RQ SODVWLF )LJXUH SDQHO (f 7KH HQWLUH RUJDQ DSSHDUHG FRQGHQVHG >b@f DOWKRXJK EUDQFKLQJ GLG RFFXU 7KH WHUPLQDO DFLQDU FHOO FOXVWHUV GHYHORSHG ZLWK WKH VDPH IUHTXHQF\ DV FRQWUROV \HW ZHUH VLJQLILFDQWO\ VPDOOHU LQ VL]H $JDLQ *DO7DVH P51$ H[SUHVVLRQ OHYHOV ZHUH QRW DOWHUHG VLJQLILFDQWO\ E\ WKH DGGLWLRQ RI DQWLODPLQLQ DQWLERG\ QRU GLG LW KDYH D VLJQLILFDQW HIIHFW RQ WKH FHOOVXUIDFH *DO7DVH DFWLYLW\ OHYHOV ZKHQ FRPSDUHG WR FRQWUROV 7DEOH URZ f 7R HYDOXDWH WKH GLUHFW LQWHUDFWLRQ RI *DO7DVH ZLWK ODPLQLQ LQ JODQGXODU PRUSKRJHQHVLV WKH WHUPLQDO ROLJRVDFFKDULGH PRLHWLHV RI ODPLQLQ ZHUH

PAGE 116

PRGLILHG VR DV WR SUHVHQW D QRQLQWHUDFWLYH VXEVWUDWH ZLWK WKH FHOOVXUIDFH *DO7DVH DFWLYH VLWH 7KH SUHWUHDWPHQW RI WKH ODPLQLQ FRDWHG ZHOOV ZLWK ERYLQH *DO7DVH DQG 8'3JDO ZDV SHUIRUPHG WR HOLPLQDWH FHOOVXUIDFH *DO7DVH VXEVWUDWH RI WHUPLQDO *,F1$F UHVLGXHV RI ODPLQLQ 6KXU DQG (FNVWHLQ f 5HGXFLQJ WKH SRWHQWLDO LQWHUDFWLRQ EHWZHHQ WKH FHOOVXUIDFH *DO7DVH RI WKH RUJDQ FXOWXUH DQG *,F1$F UHVLGXHV RI ODPLQLQ UHVXOWHG LQ VXEPDQGLEXODU JODQGV WKDW DSSHDUHG PRUSKRORJLFDOO\ VLPLODU WR WKRVH JURZQ LQ WKH DEVHQFH RI ODPLQLQ SODVWLF ZHOOV RU DQWLODPLQLQ DQWLERG\ WUHDWHG ZHOOVf )LJXUH SDQHO )f 7KHVH RUJDQ FXOWXUHV GHPRQVWUDWHG DFLQDU FHOO SUROLIHUDWLRQ VLPLODU WR WKRVH RI RUJDQV JURZQ RQ SODVWLF )LJXUH SDQHO )f *DO7DVH P51$ H[SUHVVLRQ OHYHOV ZHUH JHQHUDOO\ JUHDWHU WKRXJK QRW VLJQLILFDQWO\ S f WKDQ QRUPDO FXOWXUHV RQ ODPLQLQ DIWHU WKH HDUO\ VWDJHV RU KRXUf RI LQ YLWUR FXOWXUH &HOOVXUIDFH *DO7DVH HQ]\PDWLF DFWLYLW\ ZDV DOVR VLPLODU WR WKRVH RI FRQWUROV JURZQ RQ ODPLQLQ 7DEOH URZ f 7\USKRVWLQ ZDV DGGHG WR WKH PHGLD WR IXUWKHU HYDOXDWH WKH SRWHQWLDO DFWLYDWLRQ RI WKH UHFHSWRU W\URVLQH NLQDVHV E\ FHOOVXUIDFH UHFHSWRUV ZLWK WKH (&0 *ODQGV FXOWXUHG LQ WKH SUHVHQFH RI W\USKRVWLQ WKH VSHFLILF W\URVLQH SKRVSKDWH LQKLELWRU GHPRQVWUDWHG PRUSKRORJLF GHYHORSPHQW VLPLODU WR WKH UHVXOW RI JODQGV FXOWXUHG ZLWK DQWL*DO7DVH DQWLERG\ RU F[ODFWDOEXPLQ )LJXUH f *HQHUDOO\ WKH RUJDQV FXOWXUHG LQ PHGLD ZLWK W\USKRVWLQ GHPRQVWUDWHG GLPLQLVKHG DFLQDU FHOO DGKHVLYHQHVV DQG SUROLIHUDWLRQ DV ZHOO DV GLPLQLVKHG EUDQFKLQJ LQ RI JODQGV FXOWXUHG bf Sf

PAGE 117

)LJXUH 3KRWRPLFURJUDSKV R 5HSUHVHQWDWLYH +RXU 7\USKRVWLQ 2UJDQ &XOWXUH 2UJDQ FXOWXUH UHVXOWV RI G IHWDO VXEPDQGLEXODU JODQG FXOWXUHG LQ PHGLD W\USKRVWLQ f RYHU WKH KRXU SHULRG 'HYHORSPHQW RI WKH RUJDQ LQ PHGLD WKDW VSHFLILFDOO\ LQKLELWV W\URVLQH NLQDVH VLJQDO WUDQVGXFWLRQ FOHDUO\ GHPRQVWUDWHV GHFUHDVHG DFLQDU FHOO SUROLIHUDWLRQ DQG EUDQFKLQJ PRUSKRJHQHVLV

PAGE 118

&+$37(5 )285 ',6&866,21 'HYHORSPHQW RI WKH PXULQH VDOLYDU\ JODQG LV D FRRUGLQDWHG WHPSRUR VSDWLDO SURFHVV WKDW LQYROYHV DFLQDU FHOO SUROLIHUDWLRQ DV ZHOO DV EUDQFKLQJ PRUSKRJHQHVLV &XWOHU f 7KLV SURFHVV LV WKRXJKW WR LQFOXGH LQWHUDFWLRQ RI FRPSRQHQWV RI WKH H[WUDFHOOXODU PDWUL[ FRQWDLQHG ZLWKLQ WKH VXUURXQGLQJ PHVHQFK\PDO FDSVXOH VSHFLILFDOO\ ODPLQLQ DQG WKH EXGGLQJ HSLWKHOLDO VDOLYDU\ JODQG RUJDQ %RUJKHVH *UREVWHLQ D 2OLYHU HWDO f 3UHYLRXV UHVHDUFKHUV LQ RXU ODERUDWRU\ KDYH SURYLGHG LQIRUPDWLRQ UHJDUGLQJ WKH H[SUHVVLRQ RI VRPH RI WKH SURWHLQV RI WKH PHVHQFK\PDO FRPSRQHQW GXULQJ GHYHORSPHQW 0DFDXOH\ HW DW f 6HYHUDO RI WKH PHVHQFK\PDO (&0 SURWHLQ PROHFXOHV GHPRQVWUDWHG D PD[LPDO H[SUHVVLRQ DW IHWDO GD\ LQ PLFH LQFOXGLQJ FROODJHQ Df FROODJHQ DOOOf DQG O\V\O R[LGDVH ZKLFK LQLWLDWHV WKH HQ]\PDWLF FURVVOLQNLQJ RI ERWK FROODJHQ DQG HODVWLQ LQ WKH (&0 .DJDQ f 003V DUH DOVR UHTXLUHG WR GHJUDGH WKH EDVHPHQW PHPEUDQH WR DOORZ LQYDJLQDWLRQ GXULQJ WKH EXGGLQJ RI WKH VDOLYDU\ JODQG RUJDQ HPEU\RORJLFDOO\ 1DNDQLVKL HWDO f 7KLV PDQXVFULSW SURYLGHV WKH ILUVW GHWDLOHG GHVFULSWLRQ RI VDOLYDU\ SURWHLQ P51$ H[SUHVVLRQ GXULQJ IHWDO VXEPDQGLEXODU JODQG GHYHORSPHQW 5HSRUWV IURP RWKHU UHVHDUFKHUV KDYH SURYLGHG JOLPSVHV DW WKH GHYHORSPHQWDO SURILOH

PAGE 119

RI WKH PXULQH VDOLYDU\ JODQG DQG FRUURERUDWLRQ RI WKHLU FRQWULEXWLRQV ZDV UHFRJQL]HG LQ WKH 5HVXOWV VHFWLRQ RI WKLV GLVVHUWDWLRQ IRU HDFK SURWHLQ RI LQWHUHVW 7KH VDOLYDU\ JODQG SURWHLQV VHOHFWHG IRU WKLV UHSRUW SURYLGHG D GLYHUVH JURXS RI GHYHORSPHQWDO PDUNHUV GHVLJQHG WR HYDOXDWH VSHFLILF WLVVXH W\SHV &OHDUO\ WKH GXFWDO FHOO WUDQVFULSWLRQ UDWHV IRU WKHLU VSHFLILF SURGXFWV (*) 1*)f UHSUHVHQWHG WKH JUHDWHVW OHYHOV WKURXJKRXW IHWDO GHYHORSPHQW ZLWK WKH FRQFRPLWDQWO\ VPDOOHVW LQFUHDVH DIWHU ELUWK 7KH WUDQVFULSWLRQ UDWHV RI WKH SURWHLQDFRXV SURGXFWV GHULYHG IURP WHUPLQDOO\ GLIIHUHQWLDWHG DFLQDU VHFUHWRU\ FHOOV $0< &<6 /<6 08& 363f ZDV YHU\ ORZ LI SUHVHQW DW DOO GXULQJ WKH HDUO\ VWDJHV RI IHWDO JODQG GHYHORSPHQW DQG LQFUHDVHG VLJQLILFDQWO\ GXULQJ WKH ILQDO VWDJHV RI IHWDO GHYHORSPHQW DQG DIWHU ELUWK &\WRGLIIHUHQWLDWLRQ RU HYROXWLRQ RI VSHFLDOL]HG VDOLYDU\VSHFLILF SURWHLQ V\QWKHVLV RI PXF PXFLQ DQG DP\ODVH RFFXUV DV D ILQDO VWDJH RI GHYHORSPHQW RQO\ DIWHU WKH VDOLYDU\ JODQG PRUSKRJHQHVLV LV HVWDEOLVKHG ,Q WKH PRXVH F\WRGLIIHUHQWLDWLRQ RFFXUV ODWH LQ IHWDO GHYHORSPHQW DURXQG IHWDO GD\ 3RXOVHQ HW DO f 2XU UHVXOWV FRQILUP WKHVH UHSRUWV ZLWK D PD[LPDO H[SUHVVLRQ RI DP\ODVH DQG PXFLQ RFFXUULQJ DIWHU ELUWK LQ WKH DGXOW PRXVH ([SUHVVLRQ OHYHOV RI WKH H[SHULPHQWDO SURWHLQ *DO7DVH DSSHDUHG WR JUDGXDOO\ LQFUHDVH LWV WUDQVFULSWLRQ DV ZHOO DV FHOOVXUIDFH DFWLYLW\ OHYHO GXULQJ GHYHORSPHQW ZLWK D VPDOO SHDN LQ ERWK DW JHVWDWLRQDO GD\ 7KLV JHVWDWLRQDO SHDN DW IHWDO GD\ ZDV D JHQHUDO SDWWHUQ IRXQG LQ RI WKH SURWHLQV HYDOXDWHG DQG FRUUHVSRQGV ZLWK D IHWDO SHDN H[SUHVVLRQ IRU *7$.LQDVH DQG

PAGE 120

ODPLQLQ % DQG % FKDLQ P51$ 0DFDXOH\ HW DO f &HUWDLQO\ WKLV GHPRQVWUDWHV D ZHOO FRRUGLQDWHG H[SUHVVLRQ SDWWHUQ RI D YDULHW\ RI GLIIHUHQW WUDQVFULSWV 3KRVSKRU\ODWLRQ DQG WKH HPHUJHQFH RI FHOOVXUIDFH *DO7DVH LV JRYHUQHG E\ *7$. ZKLFK DSSHDUV WR KDYH VRPH VHTXHQFH KRPRORJ\ ZLWK WKH FHOOF\FOH NLQDVH FGF %XQQHOO HW DO .HUU HW DO f $OVR WKH PHVHQFK\PDO FRPSRQHQW DW IHWDO GD\ LV SURGXFLQJ PD[LPDO OHYHOV RI QHZO\ V\QWKHVL]HG ODPLQLQ ZLWK ZKLFK *DO7DVH LV NQRZQ WR LQWHUDFW 7KH OXPHQDO ELQGLQJ RI WKH UHFHSWRU *DO7DVH GRPDLQ WR ODPLQLQ LV DFFRPSDQLHG E\ F\WRSODVPLF DVVRFLDWLRQ RI WKH FDWDO\WLF GRPDLQ ZLWK WKH F\WRVNHOHWDO HOHPHQW DFWLQ DV GHPRQVWUDWHG E\ (FNVWHLQ DQG 6KXU ZLWK D VHULHV RI GRXEOHVWDLQLQJ LPPXQRIOXRUHVFHQW VWXGLHV ZLWK DQWL*DO7DVH DQWLVHUXP DQG SKDOORLGLQ LQ %DOEF 7 ILEUREODVW (FNVWHLQ DQG 6KXU f 6WDELOL]DWLRQ RI WKH FHOO WR WKH (&0 YLD *DO7DVHODPLQLQ ELQGLQJ LQ D OHFWLQ OLNH IDVKLRQ DQG LQFUHDVHG ULJLGLW\ RI WKH F\WRVNHOHWDO VWUXFWXUH YLD *DO7DVHDFWLQ DVVRFLDWLRQV SURYLGHV DQ HQYLURQPHQW WKDW PD\ PD[LPL]H WKH WUDQVFULSWLRQ SRWHQWLDO IRU QXPHURXV RWKHU SURWHLQV DV ZHOO 7KXV D PRGHO LV HPHUJLQJ ZKHUH *DO7DVH WKURXJK LWV ELRFKHPLFDO LQWHUDFWLRQV ZLWK FDUERK\GUDWH PRLHWLHV H[WUDFHOOXODUO\ DQG LWV DVVRFLDWLRQV ZLWK DFWLQ LQWUDFHOOXODUO\ LV D PHGLDWRU RI FHOO F\FOH UHJXODWLRQ 7KH FRQFRUGDQFH RI VDOLYDU\ JODQG GHYHORSPHQWDO PDUNHU SURWHLQ P51$ H[SUHVVLRQ SUHVHQWHG KHUH DQG WKH FRUURERUDWLQJ FHOOVXUIDFH HQ]\PDWLF DFWLYLW\ KLVWRORJLF LPPXQRKLVWRFKHPLFDO DQG IORZ F\WRPHWULF GDWD LV LQ DJUHHPHQW ZLWK WKLV VXJJHVWHG PRGHO

PAGE 121

7R IXUWKHU LQYHVWLJDWH WKH LQWHUDFWLRQ RI *DO7DVH ZLWK WKH (&0 DQ RUJDQ FXOWXUH V\VWHP ZDV HPSOR\HG 5HPRYDO RI WKH SULPRUGLDO VDOLYDU\ JODQG WLVVXH LQFOXGLQJ WKH DFLQDU FHOO UXGLPHQWV IURP WKH GHYHORSLQJ GD\ IHWDO PRXVH DQG JURZLQJ WKHP XQGHU LQ YLWUR FXOWXUH FRQGLWLRQV RQ ODPLQLQ FRDWHG SODWHV IRU KRXUV UHVXOWHG LQ GHYHORSPHQW WKDW PLPLFNHG QRUPDO LQ YLYR DFLQDU FHOO SUROLIHUDWLRQ DV ZHOO DV EUDQFKLQJ PRUSKRJHQHVLV (YDOXDWLRQ RI WKH *DO7DVH P51$ WUDQVFULSWLRQ SURILOH UHYHDOHG D VLPLODU H[SUHVVLRQ SDWWHUQ DV VHHQ LQ YLYR $ SHDN LQ P51$ H[SUHVVLRQ DQG JODQG JURZWK RFFXUUHG DW KRXUV LQ FXOWXUH VLPLODU WR WKH SHDN VHHQ DW IHWDO GD\ 7KXV PRUSKRORJLFDOO\ DQG WUDQVFULSWLRQDOO\ WKLV RUJDQ V\VWHP IXQFWLRQHG DGHTXDWHO\ UHODWLYH WR WKH SDUDPHWHUV WKDW ZH HYDOXDWHG 7KH LQ YLWUR GHYHORSPHQW DQG P51$ H[SUHVVLRQ LV QRW DQ H[DFW UHSOLFDWLRQ RI LQ YLYR GHYHORSPHQW DV D IHWDO GD\ JODQG FXOWXUHG IRU KRXUV LV GHOD\HG GHYHORSPHQWDOA ZKHQ FRPSDUHG WR WKH LQ YLYR GD\ GD\ KRXUV GD\Vf JODQG ZKLFK DJDLQ VXJJHVW WKH QHFHVVLW\ RI WKH HQWLUH V\VWHP DQG HVSHFLDOO\ WKH PHVHQFK\PDO LQWHUDFWLRQ IRU PD[LPDO GHYHORSPHQW 'HYHORSLQJ GD\ IHWDO PRXVH VDOLYDU\ RUJDQV ZHUH DOVR FXOWXUHG RQ QRQFRDWHG SODVWLF SODWHV IRU KRXUV &XOWXULQJ RQ SODVWLF SODWHV SUHYHQWHG WKH QRUPDO DWWDFKPHQW DQG GHYHORSPHQW RI WKH VDOLYDU\ WLVVXH :H IRXQG WKDW RUJDQV FXOWXUHG RQ SODVWLF ZHOOV EXW RWKHUZLVH LGHQWLFDO FRQGLWLRQV UHVXOWHG LQ JODQGV ZLWK OHVV IXOO\ GHYHORSHG EUDQFKLQJ PRUSKRJHQHVLV DQG VPDOOHU FRQGHQVHG \HW KLVWRORJLFDOO\ RUJDQL]HG WHUPLQDO DFLQDU FHOOV ZKLOH *DO7DVH P51$ H[SUHVVLRQ OHYHOV DQG FHOOVXUIDFH HQ]\PDWLF DFWLYLW\ ZHUH JUHDWHU WKDQ

PAGE 122

FRQWUROV JURZQ RQ ODPLQLQ H[FHSW WKH LQLWLDO SKDVHV DQG KRXUVf WKRXJK QRW VLJQLILFDQWO\ S f $ SRVVLEOH H[SODQDWLRQ IRU WKLV VFHQDULR LV WKDW WKH FHOO LV DFWLYHO\ VHHNLQJ DSSURSULDWH VXEVWUDWH 8QGHU LGHDO FRQGLWLRQV RI VXEVWUDWH DYDLODELOLW\ RSWLPDO S+ DQG DGHTXDWH VSDFH FHOOV PLJUDWH DQG SUROLIHUDWH DV VHHQ LQ RXU FRQWURO FXOWXUHV &HOOVXUIDFH *DO7DVH KDV EHHQ SUHYLRXVO\ VKRZQ WR EH LQYROYHG LQ FHOO PLJUDWLRQ GXH WR LWV LQWHUDFWLRQ ZLWK FRPSRQHQWV RI WKH (&0 6KXU f 7KH DELOLW\ RI *DO7DVH WR IXQFWLRQ DV D UHFHSWRU IRU *,F1$F UHVLGXHV RI JO\FRSURWHLQ FRPSRQHQWV RI WKH (&0 KDYH FOHDUO\ HVWDEOLVKHG WKDW *DO7DVH FDQ LQIOXHQFH PLJUDWLRQ RI D ZLGH YDULHW\ RI FHOOV (FNVWHLQ DQG 6KXU f 6KXU DQG FRZRUNHUV KDYH GHPRQVWUDWHG WKDW PLJUDWLQJ FHLOV KDYH DQ LQFUHDVHG H[SUHVVLRQ RI FHOOVXUIDFH *DO7DVH )XUWKHUPRUH FHOO PLJUDWLRQ DQG GLIIHUHQWLDWLRQ ZDV GHSHQGHQW RQ WKH LQWHUDFWLRQ RI *DO7DVH ZLWK VXEVWUDWH ROLJRVDFFKDULGH PRLHWLHV RI WKH (&0 JO\FRSURWHLQ ODPLQLQ 2EVHUYDWLRQV RI FHOO PLJUDWLRQ RQ DOWHUQDWLYH (&0 FRPSRQHQW VXUIDFHV VXFK DV ILEURQHFWLQ GHPRQVWUDWHG WKDW FHOO IDLOHG WR PLJUDWH 5XQ\DQ HW DO f /DPLQLQ LV WKH RQO\ (&0 FRPSRQHQW WKDW GHPRQVWUDWHV WHUPLQDO RU DSSDUHQWO\ DYDLODEOH *,F1$F PRLHWLHV 6KXU f :KHQ RUJDQV ZHUH FXOWXUHG RQ SODVWLF ZH KDG HVWDEOLVKHG FRQGLWLRQV IRU WKH IHWDO UXGLPHQWV WKDW VXSSOLHG HYHU\WKLQJ H[FHSW VXEVWUDWH VXUIDFHV XSRQ ZKLFK FHOOV FRXOG VSUHDG RU PLJUDWH 2UJDQV FXOWXUHG RQ SODVWLF LQLWLDOO\ UHVHPEOH WKDW RI FRQWUROV JURZQ RQ ODPLQLQ DQG KRXUVf +RZHYHU IDLOXUH RI WKH FHOOVXUIDFH *DO7DVH UHFHSWRU WR GHWHFW DQG ELQG WR FDUERK\GUDWH PRLHWLHV RI ODPLQLQ LQ WKH (&0 XOWLPDWHO\ DOORZHG IRU LQFUHDVHG DYDLODELOLW\ RI UHFHSWRUV IRU

PAGE 123

WKH ROLJRVDFFKDULGHV IRXQG RQ DGMDFHQW FHOOVXUIDFHV DV WKH DOWHUQDWH VXEVWUDWH 7KLV PD\ XOWLPDWHO\ OHDG WR LQFUHDVHG FHOOFHOO LQWHUDFWLRQ ZKLFK XOWLPDWHO\ PD\ KDYH UHVXOWHG LQ WKH FRQGHQVHG FRPSDFW RUJDQ GHYHORSPHQW WKDW ZDV VHHQ :KHQ WKH VDOLYDU\ JODQG UXGLPHQWV ZHUH SUHYHQWHG IURP LQWHUDFWLRQ ZLWK ODPLQLQ E\ WKH LQFOXVLRQ RI DQWLODPLQLQ DQWLERG\ RU SUHJDODFWRV\ODWLRQ RI WKH ODPLQLQ FRDWHG ZHOO DFLQDU FHOO SUROLIHUDWLRQ FRQWLQXHG EXW EUDQFKLQJ PRUSKRJHQHVLV ZDV VLJQLILFDQWO\ GLPLQLVKHG LQGLFDWLQJ WKH UHTXLUHPHQW RI FHOO PDWUL[ LQWHUDFWLRQ IRU QRUPDO JODQG GHYHORSPHQW 2Q WKH RWKHU KDQG LQFOXVLRQ RI *DO7DVH VXEVWUDWH PRGLILHU DODFWDOEXPLQ RU DQWL*DO7DVH DQWLERG\ UHVXOWHG LQ VRPH GLPLQXWLRQ RI EUDQFKLQJ PRUSKRJHQHVLV EXW PRUH SURQRXQFHG LQKLELWLRQ DQG RUJDQL]DWLRQ RI DFLQDU FHOO FOXVWHUV GHPRQVWUDWLQJ *DL7DVHfV UROH LQ ERWK FHOOFHOO DV ZHOO DV FHOOPDWUL[ LQWHUDFWLRQV $ VHFRQG PHFKDQLVP E\ ZKLFK FHOOVXUIDFH *DO7DVH FRXOG LQIOXHQFH WLVVXH PRUSKRJHQHVLV LV WKURXJK UHJXODWLRQ RI FHOO SUROLIHUDWLRQ ,W KDV EHHQ GHPRQVWUDWHG WKDW FHOOVXUIDFH *DO7DVH ZKHQ MX[WDSRVHG WR WKH HSLGHUPDO JURZWK IDFWRU UHFHSWRU (*)5f FDQ LQGXFH DFWLYDWLRQ RI FHOOXODU SUROLIHUDWLRQ YLD UHFHSWRU W\URVLQH NLQDVH PHGLDWHG SURSDJDWLRQ RI SKRVSKRW\URVLQH VHFRQG PHVVHQJHU VLJQDO WUDQVGXFWLRQ SDWKZD\V IRU UHYLHZ VHH 3XUXVKRWKDP HW DO f ,Q YLWUR DQG LQ YLYR LQKLELWLRQ RI DFLQDU FHOO SUROLIHUDWLRQ FDQ EH DFFRPSOLVKHG WKURXJK WKH DGPLQLVWUDWLRQ RI WKH PRGLILHU SURWHLQ DODFWDOEXPLQ RU *DO7DVH DQWLERG\ LQ FRQMXQFWLRQ ZLWK LVRSURWHUHQRO ,62f WUHDWPHQW

PAGE 124

+XPSKUH\V%HKHU HW DO 0DUFKDVH HW DO f $ UHFHQW UHSRUW E\ %URYHUPDQ HW DO f KDV LQGLFDWHG WKDW ,62 WUHDWPHQW PHGLDWHG JODQG K\SHUWURSK\ PD\ LQ SDUW EH UHODWHG WR FHOOVXUIDFH *DO7DVH LQWHUDFWLRQ ZLWK (&0 ODPLQLQ 7KHUHIRUH WKH REVHUYDWLRQ RI UHGXFHG DFLQDU FHOO GHYHORSPHQW DQG SUROLIHUDWLRQ LQ WKH SUHVHQFH RI DODFWDOEXPLQ DQG DQWL*DO7DVH DQWLERG\ VXJJHVW WKDW FHOOVXUIDFH *DO7DVH PD\ EH SUHVHQW RQ FHOOV RI WKH GHYHORSLQJ IHWDO VXEPDQGLEXODU WLVVXH 7KH DFFHOHUDWHG IHWDO VDOLYDU\ JODQG PRUSKRJHQHVLV WDNLQJ SODFH EHWZHHQ KU ,Q YLWUR FRUUHODWHV ZLWK D GUDPDWLF LQFUHDVH LQ WKH LQ YLWUR H[SUHVVLRQ RI *DO7DVH P51$ DQG FHOOVXUIDFH *DO7DVH HQ]\PDWLF DFWLYLW\ 7KH GLVUXSWLRQ RI *DO7DVH LQWHUDFWLRQV ZLWK ODPLQLQ DSSHDU WR LQIOXHQFH WKH UDWH RI EUDQFKLQJ PRUSKRJHQHVLV ZKLOH GLVUXSWLRQ RI WKH SRWHQWLDO *DO7DVH LQWHUDFWLRQ ZLWK WKH RWKHU FHOOVXUIDFH VLJQDOOLQJ PROHFXOHV GLVUXSWV DFLQDU FHOO SUROLIHUDWLRQ 7KXV FHOOVXUIDFH *DO7DVH PD\ DOVR SDUWLFLSDWH LQ WKH UHJXODWLRQ RI EUDQFKLQJ PRUSKRJHQHVLV DV ZHOO DV DFLQDU FHOO SUROLIHUDWLRQ ,Q WKH DGXOW VDOLYDU\ JODQG SUROLIHUDWLRQ DSSHDUV WR EH PHGLDWHG E\ LQWHUDFWLRQ RI FHOOVXUIDFH *DO7DVH ZLWK WKH FDUERK\GUDWH PRLHWLHV RI WKH (*) 5 EULQJV DERXW DFWLYDWLRQ RI WKH W\URVLQH NLQDVH SKRVSKRU\ODWLRQ FDVFDGH ZKLFK UHVXOWV LQ FHOO GLYLVLRQ DQG SUROLIHUDWLRQ 3XUXVKRWKDP HW DO f )HWDO JODQGV FXOWXUHG LQ WKH W\URVLQH VLJQDO WUDQVGXFWLRQ LQKLELWRU W\USKRVWLQ ZKLFK VSHFLILFDOO\ SHUWXUEV WKH (*)5 VLJQDO WUDQVGXFWLRQ HYHQW UHVXOWV LQ RUJDQ FXOWXUHV DJDLQ GHPRQVWUDWLQJ D VLJQLILFDQW DOWHUDWLRQ LQ QRUPDO PRUSKRORJLF GHYHORSPHQW VXJJHVWLQJ *DO7DVH VLJQDO WUDQVGXFWLRQ PD\ RFFXU

PAGE 125

WKURXJK LQWHUDFWLRQ ZLWK WKH (*)5 &XPXODWLYHO\ WKHVH REVHUYDWLRQV VXJJHVW WKDW FHOOVXUIDFH *DO7DVH LV DQ LPSRUWDQW PHGLDWRU RI PRXVH VDOLYDU\ JODQG IHWDO GHYHORSPHQW WKURXJK FHOO(&0 DQG FHOOFHOO LQWHUDFWLRQV )XUWKHUPRUH EORFNLQJ FHOOVXUIDFH *DO7DVH DFWLYLW\ LQKLELWV VDOLYDU\ JODQG PRUSKRJHQHVLV LPSOLFDWLQJ *DO7DVH DV D FRPSRQHQW RI D UHFHSWRUPHGLDWHG VLJQDO WUDQVGXFWLRQ SDWKZD\ UHTXLUHG IRU QRUPDO PXULQH VDOLYDU\ JODQG PRUSKRGLIIHUHQWLDWLRQ ,Q VXPPDU\ WKHVH VWXGLHV KDYH VKRZQ WKDW FHOOVXUIDFH *DO7DVH LV FULWLFDOO\ LQYROYHG LQ QRUPDO PXULQH VXEPDQGLEXODU JODQG EUDQFKLQJ PRUSKRJHQHVLV DQG WKDW WKLV VDOLYDU\ JODQG RUJDQ FXOWXUH V\VWHP LV D YLDEOH PHFKDQLVP WR HYDOXDWH GHYHORSPHQWDO SURFHVVHV $GGLWLRQDOO\ WKLV VWXG\ GHPRQVWUDWHG WKDW WKHUH LV D SHDN LQ FHOOVXUIDFH *DO7DVH P51$ H[SUHVVLRQ DV ZHOO DV HQ]\PDWLF DFWLYLW\ DW IHWDO GD\ 7KLV FRUUHVSRQGV ZLWK WKH IHWDO SHDN H[SUHVVLRQ RI *7$. UHTXLUHG IRU *DO7DVH DFWLYDWLRQ 3HUKDSV PRVW LPSRUWDQWO\ WKLV UHVHDUFK FRQILUPV SUHYLRXV UHSRUWV WKDW FHOO VXUIDFH *DO7DVH DFWLYDWHV 57. VLJQDO WUDQVGXFWLRQ PHGLDWHG HYHQWV IRU JURZWK DQG GHYHORSPHQW 7KH LQWULFDF\ RI WKH LQWHUDFWLRQV LQYROYHG LQ FHOO PLJUDWLRQ DQG SUROLIHUDWLRQ LV SHUSOH[LQJ KRZHYHU LQ OLJKW RI RWKHU IDFWRUV ZKLFK PD\ EH IRXQG LQ WKH H[WUDFHOOXODU PDWUL[ UHFHSWRU VXFK DV WKH LQWHJULQV :H NQRZ WRGD\ WKDW FHOOVXUIDFH *DO7DVH LV QRW LQYROYHG LQ WKH LQLWLDO DWWDFKPHQW RI WKH FHOO WR WKH (&0 EXW UDWKHU WKLV DFWLYLW\ LV PHGLDWHG E\ FHOO DGKHVLRQ PROHFXOHV DQG LQWHJULQV
PAGE 126

GLIIHUHQW DIILQLWLHV IRU (&0
PAGE 127

*DO7DVH(*)5 DVVRFLDWLRQ ZLOO DOVR RFFXU 6LPXOWDQHRXVO\ WKH *DO7DVH F\WRSODVPLF GRPDLQ H[SHULHQFHV JUHDWHU DVVRFLDWLRQ RI *DO7DVH ZLWK WKH DFWLQ F\WRVNHOHWDO HOHPHQW DV VKRZQ E\ WKH FRORFDOL]DWLRQ RI *DO7DVH ZLWK WKH F\WRVNHOHWDO HOHPHQW DFWLQ (FNVWHLQ DQG 6KXU $SSHQGX DQG 6KXU f 8VLQJ D PROHFXODU VWUDWHJ\ WR SURGXFH D GRPLQDQW QHJDWLYH PXWDWLRQ D FHOOVXUIDFH *DO7DVH WKDW ODFNHG WKH IXQFWLRQDO FDWDO\WLF GRPDLQ ZDV SURGXFHG (YDQV HWDc f 6WDEOHO\ WUDQVIHFWHG 7 PRXVH ILEUREODVW GHPRQVWUDWHG GHFUHDVHG DVVRFLDWLRQ ZLWK DFWLQ F\WRVNHWHWRQ GHFUHDVHG PLJUDWLRQ DQG KLVWRORJLFDOO\ DSSHDUHG EDOOHG XS RQ WKH ODPLQLQ VXUIDFH ZLWK PLQLPDO FHOOFHOO DWWDFKPHQW VXJJHVWLQJ WKDW WKLV F\WRVNHOHWDO GRPDLQ RI WKH FHOOVXUIDFH *DO7DVH LV HVVHQWLDO IRU DWWDFKPHQW RI FHOO WR ODPLQLQ $SSHQGX DQG 6KXU HWD f 1HYHUWKHOHVV WKLV VWDELOL]HG DFWLQ ILODPHQW LV WKHQ PRUH DYDLODEOH IRU LQWHJULQ VXEXQLW ELQGLQJ )XUWKHUPRUH WKHUH LV HYLGHQFH RI JUHDWHU DFWLYDWLRQ RI WKH (*)5 OHDGLQJ WR LQFUHDVHG SKRVSKRU\ODWLRQ RI LQWHJULQ VXEXQLW ZKLFK WKHQ OHDGV WR PLJUDWLRQ RQ ODPLQLQ 0DLQLHUR HW DO f ,QIRUPDWLRQ WR GDWH VXJJHVW WKDW WKH LQWHJULQPHGLDWHG VLJQDO WUDQVGXFWLRQ SDWKZD\ PD\ EH FRPPRQ ZLWK WKH (*)5 0$3. FDVFDGH WKXV FRQIRUPLQJ WR FRPPRQO\ KHOG EHOLHIV WKDW WKH (*) V\VWHP PRGXODWHV IHWDO PRXVH VDOLYDU\ JODQG PRUSKRJHQHVLV DQG GHYHORSPHQW 1DQQ\ DQG .LQJ *UHVLN HW DO .DVKLPDWD DQG *UHVLN f

PAGE 128

0$3. )LJXUH 6XJJHVWHG ,QWHJULQ*DO7DVH$FWLQ 0RGHO 0RGHO IRU LQWHJULQ PHGLDWHG FHOOVXUIDFH *DO7DVH DQG DFWLQ FRQJUHJDWHG FHOO PLJUDWLRQ DQG FHOO SUROLIHUDWLRQ k 7KH LQLWLDO DGKHVLRQ RI WKH FHOO WR WKH (&0 LV PHGLDWHG E\ LQWHJULQV k F\WRSODVPLF FRPSOH[HV ELQG WR WKH SVXEXQLW RI WKH LQWHJULQ F\WRSODVPLF WDLO k LQWHJULQF\WRSODVPLF FRPSOH[ ELQGV WR DFWLQ k VWDEOH F\WRVNHOHWDO VWUXFWXUH ERXQG WR (&0 ODPLQLQ LQGXFHV LQFUHDVHG FHOOVXUIFH *DO7DVH H[SUHVVLRQ ZLWK LQFUHDVHG OLNHOLKRRG RI DVVRFLDWLQJ ZLWK (*)5 k *DO7DVH ELQGV DFWLQ DQG k LQFUHDVHV (*)LQWHJULQ W\URVLQH NLQDVH FDVFDGH ZKLFK XOWLPDWHO\ OHDGV WR 0$3. LQGXFHG QXFOHDU VLJQDO WUDQVGXFWLRQ IRU FHOO GLYLVLRQ

PAGE 129

7KLV PRGHO RI DQ LQWHJULQPHGLDWHG FHOOVXUIDFH JO\FRSURWHLQ DVVRFLDWHG F\WRVNHOHWDO FRPSOH[ VXJJHVWV D V\QHUJLVWLF FRRSHUDWLYH DVVRFLDWLRQ IRU FHOO PLJUDWLRQ DQG FHOO GLIIHUHQWLDWLRQ EHWZHHQ WKHVH GLYHUVH PROHFXOHV 7HOHRORJLFDOO\ LW LV ORJLFDO IRU D FHOO WR XVH ERWK SRVLWLRQDO LQIRUPDWLRQ UHJDUGLQJ LWV UHODWLRQVKLS WR WKH (&0 DV ZHOO DV DYDLODELOLW\ WR WKH JURZWK IDFWRU UHFHSWRU WR GHFLGH ZKHQ WR HQWHU LQWR WKH FHOO F\FOH IRU JURZWK DQG SUROLIHUDWLRQ 7KH PRGHO VXJJHVWHG SURYLGHV IRU DQ DVVHPEODJH RI ERWK ELRFKHPLFDO DQG SRVLWLRQDO ,QIRUPDWLRQ 0$3. DVVRFLDWHG VLJQDO WUDQVGXFWLRQ LV PHGLDWHG E\ RU XSVWUHDP UHJXODWRU\ SURPRWHUV VXFK DV WKH F$03 ELQGLQJ HOHPHQW 1)%NE RU F*03 WR QDPH D IHZ .OHPNH HW D f 7R GDWH QR XSVWUHDP WUDQVFULSWLRQDO UHJXODWRU\ UHJLRQV KDYH EHHQ PDSSHG IRU WKH *DO7DVH JHQH 5HYLHZ RI WKH NQRZQ XSVWUHDP f VHTXHQFHV RI WKH *DO7DVH DV UHSRUWHG WR *HQ%DQNr1 UHYHDOV QR UHFRJQL]DEOH SURPRWHU VHTXHQFHV UHVSRQVLYH WR NQRZQ 0$3. UHJLRQ $ ORJLFDO VWHS ZRXOG EH WKH HYDOXDWLRQ RI WKH UHVSRQVLYHQHVV RI *DO7DVH JHQH WR NQRZQ SURPRWHUV RI 0$3. UHJLRQ VHHP )XUWKHU LQYHVWLJDWLRQ RI WKLV SURSRVHG LQWHUUHODWLRQVKLS EHWZHHQ FHOO VXUIDFH *DO7DVH LQWHJUOQ UHFHSWRUV ODPLQLQ DQG DFWLQ F\WRVNHOHWDO HOHPHQWV DUH QHHGHG WR GHGXFH WKH H[DFW PHFKDQLVPV RI WKHVH DVVRFLDWLRQV DQG VLJQDO WUDQVGXFWLRQ $GGLWLRQDO LQ YLWUR VWXGLHV ZLWK XVH RI ERWK W\USKRVWLQ DV ZHOO DV DODFWDOEXPLQ FRXOG DOVR SURYLGH YHU\ YDOXDEOH LQIRUPDWLRQ ,W ZRXOG EH QDLYH WR VXJJHVW WKDW FHOOVXUIDFH *DO7DVH DORQH LV UHVSRQVLEOH IRU PRUSKRJHQHLV RI IHWDO PRXVH VDOLYDU\ JODQGV ,W VKRXOG EH

PAGE 130

DQWLFLSDWHG WKDW UHGXQGDQF\ H[LVWV LQ WKH GHYHORSPHQWDO FDVFDGH WR DOORZ IRU WUDQVFULSWLRQDO RU PXWDWLRQDO HUURUV $V SUHYLRXVO\ VWDWHG WKHUH KDYH EHHQ JUHDW WKDQ GLIIHUHQW PHPEUDQH ERXQG HQ]\PHV WKDW SDUWLFLSDWH LQ JO\FRSURWHLQ DQG JO\FROLSLG ELRV\QWKHVLV DORQH 5XVVR HW DO f 5HFHQWO\ D UHVHDUFK JURXS UHSRUWHG WKH GHYHORSPHQW RI D VHPLOHWKDO NQRFNRXW PRXVH SURGXFHG E\ JHQH WDUJHWLQJ WR GLVUXSW ERWK FHOOVXUIDFH DQG *ROJL IRUPV RI *DO7DVH $VDQR HW DO f 7KHLU *DO7DVHGHILFLHQW PLFH ZHUH UHSRUWHG WR EH fERUQ QRUPDOO\f EXW H[KLELWHG JURZWK UHWDUGDWLRQ ,QWHUHVWLQJO\ WKH\ UHSRUWHG HSLWKHOLDO FHOO SUROLIHUDWLRQ RI WKH VNLQ DQG VPDOO LQWHVWLQH KDOI RI WKH DQLPDOV GLHG EHIRUH ZHHNV RI DJH 1R PHQWLRQ ZDV PDGH RI WKH VDOLYDU\ JODQGV RU RUDO WLVVXHV (IIRUWV DUH FXUUHQWO\ XQGHUZD\ WR LQVWLWXWH FROODERUDWLYH LQYHVWLJDWLRQV ZLWK WKLV JURXS DQG DQLPDO PRGHO ,W ZRXOG EH LQWHUHVWLQJ WR IROORZ WKH VXEPDQGLEXODU JODQG GHYHORSPHQW DQG *DO7DVH H[SUHVVLRQ LQ WKHVH DQLPDOV DV ZHOO 3RWHQWLDO FOLQLFDO DSSOLFDWLRQV RI WKLV OLQH RI LQYHVWLJDWLRQ DUH H[FLWLQJ DV ZHOO *ODQGXODU K\SHUWURSK\ KDV EHHQ DVVRFLDWHG ZLWK LQFUHDVHG LQQHUYDWLRQV DQG GLHWDU\ DOWHUDWLRQV DQG WKH\ GHPRQVWUDWH LQFUHDVHG FHOOVXUIDFH *DO7DVH HQ]\PDWLF DFWLYLW\ 7UHDWPHQW DOWHUQDWLYHV WR SUHYHQW JODQGXODU K\SHUSODVLD FRXOG LQFOXGH DGPLQLVWUDWLRQ RI VSHFLILF VXEVWUDWHV RI *DO7DVH WR PHGLDWH FHOO JURZWK DQG SDURWLG JODQG K\SHUWURSK\ DQG DUH D UHDVRQDEOH FRQVLGHUDWLRQ LQ WKH IXWXUH 0RUH H[FLWLQJO\ *DO7DVH PD\ EH XWLOL]HG LQ D UHJHQHUDWLYH FDSDFLW\ WR LQGXFH JODQGXODU WLVVXH UHJHQHUDWLRQ LQ FHUWDLQ GLVHDVH VWDWHV VXFK DV LV VHHQ LQ DXWRLPPXQH GLVHDVHV RU IROORZLQJ UDGLDWLRQ LQGXFHG DWURSK\ $

PAGE 131

IXUWKHU FOLQLFDO DSSOLFDWLRQ RI WKLV RUJDQ FXOWXUH V\VWHP FRXOG EH XVHG DV D PRGHO WR VWXG\ WKH LQYDVLYH SURSHUWLHV DVVRFLDWHG ZLWK WXPRURJHQHVLV DV FHUWDLQ PRXVH QHRSODVWLF FHOOV KDYH VKRZQ HOHYDWHG FHOOVXUIDFH *DO7DVH HQ]\PHV &KDQWD HW DO f 8QGHUVWDQGLQJ WKH PHFKDQLVPV RI GHYHORSPHQW ZLOO DOORZ XV WR EHWWHU FRPSUHKHQG WKH SDWKRORJLF SURFHVVHV DQG WKXV FRQFHLYH WUHDWPHQW UHJLPHQV DV WKH D[LRP VXJJHVW fRQFRJHQHVLV UHFDSLWXODWHV RQWRJHQ\f

PAGE 132

&+$37(5 ),9( 27+(5 678',(6 7KH UHVHDUFK FRPSOHWHG DQG GHVFULEHG LQ WKH SUHFHGLQJ FKDSWHUV KDV SURYLGHG PH DQ RSSRUWXQLW\ WR GHYHORS ODERUDWRU\ VNLOOV WUDLQLQJ DQG UHVHDUFK FRPSHWHQFH LQ DQ HGXFDWLRQDO HQYLURQPHQW WKDW LV XQSDUDOOHOHG $V D WUDLQHG FOLQLFLDQ WKHQ VXUJHRQ KDG H[SHULHQFHG ILUVW KDQG WKH FOLQLFDO DVSHFWV RI ZRXQG KHDOLQJ \HW GHVLUHG WR GHOYH PRUH GHHSO\ LQWR WKH EDVLF VFLHQFH DVSHFWV RI GHYHORSPHQW JURZWK DQG UHSDLU 0\ LQWHUHVW LQ UHJHQHUDWLYH SHULRGRQWLFV KDG LJQLWHG P\ XUJH WR LQYHVWLJDWH WKH UROHV RI JURZWK IDFWRUV 7KLV H[SHULHQFH KDV SURYLGHG PH WKDW RSSRUWXQLW\ $GGLWLRQDOO\ DV D PHPEHU LQ WKH +XPSKUH\V%HKHU ODERUDWRU\ KDYH EHHQ JLYHQ H[WHQVLYH FROODERUDWLYH UHVHDUFK RSSRUWXQLWLHV WKDW KDYH UHVXOWHG LQ QXPHURXV SURMHFWV SXEOLVKHG PDQXVFULSWV DZDUGV DQG QDWLRQDO JUDQW IXQGLQJ IRU ZKLFK DP H[WUHPHO\ JUDWHIXO 0\ UHVHDUFK LQWR WKH FHOOVXUIDFH H[SUHVVLRQ RI WKH JO\FRV\OWUDQVIHUDVH *DO7DVH DQG LWV LQWHUDFWLRQ ZLWK WKH W\URVLQH NLQDVH JURZWK IDFWRU UHFHSWRU (*) OHDG PH WR LQYHVWLJDWH VDOLYDU\ (*) OHYHOV 6DOLYDU\ JODQGV RI PDPPDOV DUH NQRZQ WR V\QWKHVL]H DQG VHFUHWH FRSLRXV DPRXQWV RI JURZWK IDFWRUV LQFOXGLQJ (*) LQWR WKH RUDO FDYLW\ RQ D GDLO\ EDVLV ZLWK WKH SDURWLG JODQG EHLQJ WKH PDMRU VRXUFH RI (*) LQ KXPDQV UHODWLYH WR VXEPDQGLEXODU

PAGE 133

JODQG FRQWULEXWLRQ 7KHVOHII HWDO f )URP DQLPDO VWXGLHV LW LV HYLGHQW WKDW (*)LQ VDOLYD SOD\V DQ LPSRUWDQW UROH LQ ERWK RUDO DQG V\VWHPLF UDWHV RI ZRXQG KHDOLQJ +XWVRQ HW DO *RRGODG HW DO .RQWXUHN HW DW 1RJXFKL HWDO DE 'D\DQ HWDO f $GGLWLRQDOO\ ORFDO FHOOV DW WKH VLWH RI LQMXU\ DUH DOVR DEOH WR VHFUHWH JURZWK IDFWRUV WR DLG LQ ZRXQG KHDOLQJ $V D SDUWWLPH IDFXOW\ PHPEHU LQ WKH 'HSDUWPHQW RI 3HULRGRQWRORJ\ DQG &R'LUHFWRU RI RXU *UDGXDWH 3HULRGRQWRORJ\ 3URJUDP ZDV DEOH WR FRPELQH P\ FOLQLFDO DQG ODERUDWRU\ H[SHUWLVH LQ HYDOXDWLQJ WKH UROH RI VDOLYDU\ (*) :H PHDVXUHG WKH VDOLYDU\ OHYHOV RI (*) LQ SDWLHQWV WKDW ZHUH XQGHUJRLQJ UHTXLUHG SHULRGRQWDO VXUJHU\ 6DOLYDU\ (*) OHYHOV ZHUH GHWHUPLQHG IRU V\VWHPLFDOL\ KHDOWK\ LQGLYLGXDOV SUHVXUJLFDOO\ DQG SRVWVXUJLFDOO\ DW DQG KRXUV DQG DW DQG ZHHNV 7KUHH P/ RI XQVWLPXODWHG ZKROH VDOLYD REWDLQHG DW HDFK WLPH SRLQW ZDV XVHG WR PHDVXUH VDOLYDU\ (*) XVLQJ D 4XDQWLNLQHr1 +XPDQ (*) ,PPXQRDVVD\ 5 t 6\VWHPV 0LQQHDSROLV 01f 5HVXOWV GHPRQVWUDWHG D VWDWLVWLFDOO\ VLJQLILFDQW S f LQFUHDVH LQ VDOLYDGHULYHG (*)LQ ZKROH VDOLYD DW KRXUV SRVWVXUJLFDOO\ ZLWK D VHFRQG VPDOOHU SHDN DW KRXUV ZKHQ FRPSDUHG WR FRQWURO XQRSHUDWHG SDWLHQWV 2[IRUG HWDO Ef :H KDYH DOVR PRQLWRUHG VDOLYDU\ FRQFHQWUDWLRQV RI (*) LQ SDWLHQWV SULRU WR DQG IROORZLQJ MX[WDRUDO VXUJHU\ 7ZHQW\ILYH SDWLHQWV GLDJQRVHG ZLWK SDURWLG WXPRUV ZHUH VHOHFWHG IURP WKH 'HSDUWPHQW RI 2WRUKLQRODU\QJRORJ\ DW 6KDQGV +RVSLWDO DW WKH 8QLYHUVLW\ RI )ORULGD DQG +DXNHODQG 8QLYHUVLW\ +RVSLWDO LQ %HUJHQ 1RUZD\ 7KHVH WXPRUV FRQVLVWHG PDLQO\ RI SOHRPRUSKLF

PAGE 134

DGHQRPDV DQG PXFRHSLGHUPRLG FDUFLQRPDV 7KUHH P/ RI XQVWLPXODWHG ZKROH UHVWLQJ VDOLYD ZDV FROOHFWHG IURP HDFK SDWLHQW SUHVXUJLFDOO\ DQG DW KRXUV SRVWVXUJLFDOO\ IRU (*) TXDQWLILFDWLRQ 6DOLYDU\ OHYHOV RI (*) IRU WKHVH SDWLHQWV GHPRQVWUDWHG D b LQFUHDVH DW WKH KRXU SRVWVXUJLFDO PDUN ZKLFK ZDV VWDWLVWLFDOO\ VLJQLILFDQW S f $V ZLWK WKH SHULRGRQWDO VXUJHU\ SDWLHQWV WKH FRQFHQWUDWLRQ RI JURZWK IDFWRU UHWXUQHG WR FRQWURO YDOXHV E\ ZHHNV DIWHU VXUJHU\ 2[IRUG HWD Ff $OWKRXJK (*) FDQ EH SURGXFHG ORFDOO\ E\ FHOOV DW WKH VLWH RI LQMXU\ WKH LQFUHDVHV QRWHG LQ VDOLYD GR QRW DSSHDU WR EH WKH FRQVHTXHQFH RI VHUXP RU FHOOXODU FRQWULEXWLRQ :H VXUPLVH WKDW WUDQVLHQW LQFUHDVHV LQ VDOLYD OHYHOV RI (*) ZHUH D FRQVHTXHQFH RI V\QWKHVLV DQG VHFUHWLRQ IURP WKH VDOLYDU\ JODQGV LQ UHVSRQVH WR LQWURGXFWLRQ RI D ZRXQG WKURXJK VXUJLFDO WUDXPD RU D UHIOH[ UHVSRQVH WR WKH VWUHVV LQGXFHG WKURXJK WKH VXUJLFDO SURFHGXUH ,QFUHDVHG OHYHOV RI VDOLYDGHULYHG (*) DW WKH VLWH RI LQMXU\ PD\ SURPRWH LQFUHDVHG KHDOLQJ WKURXJK LWV ELQGLQJ WR WKH (*)5HFHSWRU DQG DFWLYDWLRQ RI SUROLIHUDWLRQ E\ WKH W\URVLQH NLQDVH SDWKZD\ ZKLFK PD\ LQGXFH D ZLGH YDULHW\ RI ELRORJLFDO HIIHFWV LQFOXGLQJ HSLWKHOLDO GHYHORSPHQW DQJLRJHQHVLV DQG LQKLELWLRQ RI JDVWULF DFLG UHOHDVH &DUSHQWHU DQG :DKO 6FKUHLEHU HW DW *UHJRU\ f 7KXV LW DSSHDUV WKDW WUDQVLHQW LQFUHDVH LQ VDOLYDU\ OHYHOV RI (*) LV D QDWXUDO UHVSRQVH WR ERWK LQWUDRUDO DQG MX[WDRUDO LQMXU\ WR SURPRWH ZRXQG KHDOLQJ 7KHVH ILQGLQJV KDYH VXSSOHPHQWHG VXJJHVWLRQV WKDW VDOLYDU\ (*) LV LPSRUWDQW WR UHJHQHUDWLRQ RI DQ RUDO ZRXQG $ FRPPRQ ILQGLQJ LQ XQFRQWUROOHG

PAGE 135

GLDEHWLFV LV WKH GLPLQLVKHG FDSDFLW\ IRU ZRXQG KHDOLQJ WKRXJKW WR EH FDXVHG E\ GHFUHDVHG YDVFXODULW\ DV D UHVXOW RI WKLFNHQLQJ RI WKH HSLWKHOLDO EDVHPHQW PHPEUDQH $V D UHVXOW GLDEHWLFV DUH DW D KLJKHU ULVN IRU SHULRGRQWLWLV *URVVL HW DL *HQFR f KDYH VXJJHVWHG D VHULHV RI H[SHULPHQWV WR LQYHVWLJDWH WKLV LQWHUDFWLRQ EHWZHHQ GLDEHWHV SHULRGRQWLWLV DQG VDOLYDGHULYHG JURZWK IDFWRUV IRU ZKLFK ZDV DZDUGHG WKH $$'5 :LOOLDP % &ODUN 3HULRGRQWDO 5HVHDUFK $ZDUG VSRQVRUHG E\ WKH 3URFWRU DQG *DPEOH &RPSDQ\f ,Q WKHVH H[SHULPHQWV RXU JURXS LV LQLWLDOO\ HYDOXDWLQJ WKH UDWH RI ZRXQG KHDOLQJ RI VWDQGDUGL]HG VRIW DQG KDUG WLVVXH LQWUDRUDO ZRXQGV LQ DQLPDOV ZLWK DQG ZLWKRXW VDOLYDU\GHULYHG (*) 7R DFFRPSOLVK WKLV KDOI f RI WKHVH DQLPDOV UHFHLYHG VXEPDQGLEXODU JODQG DEODWLRQ ZKLOH WKH RWKHU KDOI ZHUH VKDP RSHUDWHG +DOI RI HDFK JURXS WKHQ UHFHLYHG H[RJHQRXV VXSSOPHQWDWLRQ ZLWK (*) DG OLELWXP LQ WKHLU GULQNLQJ ZDWHU 7KH VHFRQG VWDJH RI WKHVH H[SHULPHQWV LQYROYHV WKH XVH RI VWUHSWR]RWRFLQLQGXFHG GLDEHWLF UDWV LQ D VLPLODU IDVKLRQ ZLWK VWDQGDUGL]HG VRIW DQG KDUG WLVVXH ZRXQGV ZLWK DQG ZLWKRXW VDOLYDU\GHULYHG (*) +LVWRPRUSKRPHWULF HYDOXDWLRQ RI WKH UDWH DQG GHJUHH RI ZRXQG KHDOLQJ ZLOO EH HYDOXDWHG ZLWK D VHPLDXWRPDWLF LPDJH DQDO\]HU FRXSOHG ZLWK D SKRWRPLFURVFRSH &ROODERUDWLYHO\ 'UV +XPSKUH\V%HKHU 3HFN DQG KDYH SURSRVHG WR IXUWKHU LQYHVWLJDWH WKH GLPLQLVKHG FDSDFLW\ RI ZRXQG KHDOLQJ LQFUHDVHG SHULRGRQWDO GLVHDVH DQG WKH SURJUHVVLYH ORVV RI JURZWK IDFWRUV IURP VDOLYD ZLWK WKH RQVHW RI GLDEHWHV :H KDYH UHFHQWO\ 6HSWHPEHU f EHHQ LQIRUPHG RI IXQGLQJ RI RXU UHVSRQVH WR D 5)$ IURP WKH 1DWLRQDO ,QVWLWXWHV RI

PAGE 136

+HDOWK WR LQYHVWLJDWH WKH FKDQJHV LQ JURZWK IDFWRU OHYHOV LQ SDWLHQW VDOLYD DQG VHUXP DIWHU VXUJLFDO SURFHGXUHV FRPSDUHG WR KHDOWK\ QRQGLDEHWLF FRQWUROV 6HFRQGO\ ZH LQWHQG WR GHWHUPLQH WKH LQIOXHQFH RI FKDQJHV RI JURZWK IDFWRU OHYHOV LQ VDOLYD RQ ZRXQG KHDOLQJ LQ WKH 12' PRXVH PRGHO IRU ,''0 DQG KRSHIXOO\ HVWDEOLVK WKH 12' PRXVH DV D YLDEOH PRGHO IRU WKLV DVSHFW RI GLDEHWHV $QG ILQDOO\ ZH H[SHFW WR HYDOXDWH WKH LPSDFW RI GHFUHDVHG OHYHOV RI VDOLYDGHULYHG JURZWK IDFWRUV RQ H[SHULPHQWDOO\ LQGXFHG VRIW DQG KDUG WLVVXH ZRXQGV LQ DQLPDOV 7KHVH UHVXOWV VKRXOG HOXFLGDWH PRUH IXOO\ WKH LPSRUWDQFH RI VDOLYDGHULYHG JURZWK IDFWRUV RQ V\VWHPLF KRPHRVWDVLV DQG ZRXQG UHSDLU HVSHFLDOO\ LQ WKH RUDO FDYLW\ 6DOLYDU\ JODQGV DUH PDMRU VRXUFH RI RWKHU JURZWK IDFWRUV DV ZHOO DV (*) DQG WKH\ LQFOXGH ,*), ,*),, 1*) 7*)D DQG 7*)_ &RVWLJDQ HW DO .HUU HW DO 0XUDNDPL HW DO 5\DQ HW DO 6PLWK DQG 3DWHO :DWVRQ HWDO
PAGE 137

VDOLYDGHULYHG JURZWK IDFWRUV WR LQIOXHQFH RUJDQ KRPHRVWDVLV DQG ZRXQG KHDOLQJ UHTXLUHV DEVRUSWLRQ WKURXJK WKH JDVWURLQWHVWLQDO WUDFW DQG GLVVHPLQDWLRQ YLD WKH FLUFXODWRU\ V\VWHP 3UHYLRXV UHVHDUFKHUV KDYH VKRZQ WKDW ELRORJLFDOO\ DFWLYH (*) LV GLVVHPLQDWHG LQ YDULRXV WLVVXHV ZKHQ DEVRUSWLRQ RFFXUV HLWKHU VXEOLQJXDOO\ RU JDVWURLQWHVWLQDOO\ 7KRUQEXUJ HW DW 3XUXVKRWKDP HW DO f 8VLQJ >,@,*), LQ D :HVWHUQEORW OLJDQG ELQGLQJ DVVD\ D VHULHV RI ELQGLQJ SURWHLQV ZHUH GHWHFWHG LQ WKH VHUXP EXW QRW WKH VDOLYD IURP %DOEF DQG GLDEHWLF 12' PLFH *DYDJH DGPLQLVWUDWLRQ RI ,,*), UHVXOWHG LQ VXEVWDQWLDO XSWDNH DQG V\VWHPLF RUJDQ GLVWULEXWLRQ 7KLV GLVSHUVHG ,,*) ZDV WKHQ WLVVXH H[WUDFWHG DQG VKRZQ WR UHWDLQ ELRORJLF DFWLYLW\ LQ DGRVH GHSHQGHQW UHVSRQVH LQ LQ YLYR FXOWXUHV ZLWK KXPDQ JLQJLYDO ILEUREODVW DV GHWHUPLQHG E\ D KRXU >+@WK\PLGLQH LQFRUSRUDWLRQ DVVD\ 7KLV VXJJHVWHG WKDW VDOLYD GHULYHG ,*)VPD\ EH DEVRUEHG IURP WKH RUDO DQG JDVWULF PXFRVD LQ D ELRORJLFDOO\ DFWLYH VWDWH ZLWKRXW WKH QHFHVVLW\ RI WKH ,*) ELQGLQJ SURWHLQV 1DNDJDZD HWDO f &RPSRQHQWV RWKHU WKDQ JURZWK IDFWRUV WKDW SDUWLFLSDWH LQ UHJXODWLQJ HQYLURQPHQWDO VLJQDOV WR GHWHUPLQH FHOO SUROLIHUDWLRQ RU FHOO GHDWK DQG DUH HVSHFLDOO\ LPSRUWDQW LQ WLVVXH UHPRGHOLQJ LQFOXGH WKH PDWUL[ PHWDOORSURWHLQDVHV 003Vf DQG WKHLU VXEVWUDWHV FRPSRQHQWV RI WKH (&0 KDYH EHHQ SHULSKHUDOO\ LQYROYHG LQ VWXGLHV HYDOXDWLQJ FKDQJHV LQ WKH OHYHOV RI WKHVH HQ]\PHV LQ VDOLYD DQG H[RFULQH JODQG O\VDWHV E\ 573&5 :H HYDOXDWHG WKH LPSRUWDQFH RI 003V LQ WKH GLVHDVH SURFHVV OHDGLQJ WR DXWRLPPXQH H[RFULQRSDWK\ XVLQJ 12' QRQREHVH GLDEHWLF PRGHO IRU ,''0f

PAGE 138

LPPXQRGHILFLHQW 12' 12'VFLGf DQG QRQGLDEHWLF 12'%+E PLFH IURP WR ZHHNV RI DJH WKDW ZHUH FRQWLQXRXVO\ WUHDWHG ZLWK WKH 003 LQKLELWRU *0p (OHYDWHG OHYHOV RI P51$ WUDQVFULSWV IRU WKH JHODWLQDVHV 003 DQG 00 3 ZHUH GHWHFWHG E\ 573&5 LQ WRWDO 51$ H[WUDFWHG IURP SDURWLG DQG VXEPDQGLEXODU JODQGV 'HVSLWH EHLQJ WUHDWHG ZLWK WKH 003 LQKLELWRU *0p DXWRLPPXQH H[RFULQRSDWK\ FRQWLQXHG VXJJHVWLQJ WKDW ZKLOH H[FHVVLYH 003 DFWLYLW\ LV SUHVHQW DV LW LV LQ DXWRLPPXQH GLVHDVH SURJUHVVLRQ LQ 12' PLFH LW PD\ LQ IDFW EH D VHFRQGDU\ HYHQW UHVXOWLQJ IURP DEHUUDQW DSRSWRWLF HYHQWV WKDW LQLWLDWH WKH H[RFULQH JODQG SDWKRORJ\
PAGE 139

5()(5(1&(6 $OOHQGH ( f *73PHGLDWHG PDFURPROHOFXOH LQWHUDFWLRQV 7KH FRPPRQ IHDWXUHV RI GLIIHUHQW V\VWHPV )$6(% -RXUQDO $RNL /HH 1
PAGE 140

%HFN +XQWHU DQG (QJHO f 6WUXFWXUH DQG IXQFWLRQ RI ODPLQLQ DQDWRP\ RI D PXOWLGRPDLQ JO\FRSURWHLQ )$6(% -RXUQDO %HJRYDF 3 & +DOO ( DQG 6KXU % f /DPLQLQ )UDJPHQW ( 0HGLDWHV 3& &HOO 1HXULWH 2XWJURZWK E\ %LQGLQJ WR &HOO6XUIDFH JDODFWRV\OWUDQVIHUDVH -RXUQDO RI &HOO %LRORJ\ %HJRYDF 3 & DQG 6KXU % f &HOO VXUIDFH JDODFWRV\OWUDQVIHUDVH PHGLDWHV WKH LQLWLDWLRQ RI QHXULWH RXWJURZWK RQ ODPLQLQ -RXUQDO RI &HOO %LRORJ\ %HQDX $ 0F*XLUH ( DQG 6WRUH\ % 7 f )XUWKHU FKDUDFWHUL]DWLRQ RI WKH PRXVH VSHUP VXUIDFH ]RQDELQGLQJ VLWH ZLWK JDODFWRV\ODWLRQ DFWLYLW\ 0ROHFXODU 5HSURGXFWLYH %LRORJ\ %HQDX $ DQG 6WRUH\ % 7 f 5HODWLRQVKLS EHWZHHQ WZR W\SHV RI PRXVH VSHUP VXUIDFH VLWHV WKDW PHGLDWH ELQGLQJ RI VSHUP WR WKH ]RQD SHOOXFLGD %LRORJLFDO 5HSURGXFWLRQ %HUQIHOG 0 DQG %DQHUMHH 6 Ef $FLG PXFRSO\VDFFKDULGH JO\FRVDPLQRJO\FDQf DW WKH HSLWKHOLDOPHVHQFK\PDO LQWHUIDFH RI PRXVH HPEU\R VDOLYDU\ JODQGV -RXUQDO RI &HOO %LRORJ\ %HUQIHOG 0 DQG %DQHUMHH 6 f 7KH WXUQRYHU RI EDVDO ODPLQD JO\FRVDPLQRJO\FDQ FRUUHODWHV ZLWK HSLWKHOLDO PRUSKRJHQHVLV 'HYHORSPHQWDO %LRORJ\ %HUQIHOG 0 %DQHUMHH 6 DQG &RKQ 5 + Df 'HSHQGHQFH RI VDOLYDU\ JODQG HSLWKHOLDO PRUSKRORJ\ DQG EUDQFKLQJ PRUSKRJHQHVLV XSRQ DFLG PXFRSRO\VDFFKDULGHSURWHLQ SURWHRJO\FDQf DW WKH HSLWKHOLDO VXUIDFH -RXUQDO RI &HOO %LRORJ\ %HUQIHOG 0 %DQHUMHH 6 .RGD DQG 5DSUDJHU $ & f 5HPRGHOLQJ RI WKH EDVHPHQW PHPEUDQH PRUSKRJHQHVLV DQG PDWXUDWLRQ ,Q f%DVHPHQW 0HPEUDQHV DQG &HOO 0RYHPHQWf 5 3RUWHU DQG :KHODQ (GLWRUVf SS 3LWWPDQ 3UHVV %DWK 3$ %HUQIHOG 0 DQG :HVVHOOV 1 f ,QWUD DQG H[WUDFHOOXODU FRQWURO RI HSLWKHOLDO PRUSKRJHQHVLV 'HYHORSPHQWDO %LRORJ\ 6XSSOHPHQWDO %RUJKHVH ( f ([SODQWDWLRQ H[SHULPHQWV RQ WKH LQIOXHQFH RI WKH FRQQHFWLYH WLVVXH FDSVXOH RQ WKH GHYHORSPHQW RI WKH HSLWKHOLDO SDUW RI WKH VXEPDQGLEXODU JODQG RI 0XV PXVFXOXV -RXUQDO RI $QDWRP\ /RQGRQf

PAGE 141

%RWWDUR % DQG &XWOHU / 6 f $Q HOHFWURSK\VLRORJLFDO VWXG\ RI WKH SRVWQDWDO GHYHORSPHQW RI WKH DXWRQRPLF LQQHUYDWLRQ RI WKH UDW VXEPDQGLEXODU JODQG $UFKLYHV RI 2UDO %LRORJ\ %UDGKRUVW 0 DQG 0F&RQNH\ ( f 6WDELOLW\ RI QXFOHDU 51$ LQ PDPPDOLDQ FHOOV -RXUQDO RI 0ROHFXODU %LRORJ\ %UHZ 9DQDPDQ 7 & DQG +LOO 5 / f %HWDO JDODFWRV\OWUDQVIHUDVH DV D *,F1$F UHVLGXH ELQGLQJ PHFKDQLVP LQ ODFWDWLQJ WLVVXHV 3URFHHGLQJV RI WKH 1DWLRQDO $FDGHP\ RI 6FLHQFHV 86$f %URYHUPDQ 5 / 1JX\HQ + GD 6LOYHLUD $ %ULQNOH\ / / 0DFDXOH\ 6 3 =HQJ 7
PAGE 142

&KDURQLV $ 6 7VLOLDEDU\ ( &
PAGE 143

&XWOHU / 6 f )XQFWLRQDO GLIIHUHQWLDWLRQ RI VDOLYDU\ JODQGV ,Q f+DQGERRN RI 3K\VLRORJ\6DOLYDU\ 3DQFUHDWLF *DVWULF DQG +HSWDELOODU\ 6HFUHWLRQf )RUWH (GLWRUf 9ROXPH SS $PHULFDQ 3K\VLRORJLF 6RFLHW\ 3UHVV 1HZ
PAGE 144

'UDJRR 1XUFRPEH 9 %DUWOHWW 3 f /DPLQLQ WKURXJK LWV ORQJ DUP ( IUDJPHQW SURPRWHV WKH SUROLIHUDWLRQ DQG GLIIHUHQWLDWLRQ RI PXULQH QHXURHSLWKHOLDO FHOOV ([SHULPHQWDO &HOO 5HVHDUFK 'XUEDQ ( 0 1DJSDOD 3 %DUUHWR 3 DQG 'XUEDQ ( f (PHUJHQFH RI VDOLYDU\ JODQG FHOO OLQHDJH GLYHUVLW\ VXJJHVWV D UROH IRU DQGURJHQLQGHSHQGHQW HSLGHUPDO JURZWK IDFWRU UHFHSWRU VLJQDOLQJ -RXUQDO RI &HOO 6FLHQFH f 'XWW $ 7DQJ 3 &DUVRQ ' f /DFWRVDPLQRJO\FDQV DUH LQYROYHG LQ XWHULQH HSLWKHOLDO FHOO DGKHVLRQ LQ YLWUR 'HYHORSPHQWDO %LRORJ\ (EQHU ( f /DFWDVH 6\QWKHWDVH ,Q 7KH (Q]\PHV 3 %R\HU (GLWRUf 9RL SS $FDGHPLF 3UHVV 1HZ
PAGE 145

*HQFR 5 f &XUUHQW YLHZ RI ULVN IDFWRUV IRU SHULRGRQWDO GLVHDVHV -RXUQDO RI 3HULRGRQWRORJ\ f 6XSSOHPHQWDO *KDQWD 9 +LUDPRWR 5 1 3DUNHU & $ .LGG 9 DQG +XPSKUH\V%HKHU 0 f ,Q YLWUR DQG LQ Y9RJURZWK FRQWURO RI WUDQVIRUPHG O\PSKRLG FHOOV H[SUHVVLQJ SODVPD PHPEUDQH JDODFWRV\OWUDQVIHUDVH 2QFRJHQH *LDQFRWWL ) 6WHSS 0 $ 6X]XNL 6 (QJYDOO ( 5XRVODKWL ( f 3URWHRO\WLF SURFHVVLQJ RI HQGRJHQRXV DQG UHFRPELQDQW LQWHJULQ VXEXQLW -RXUQDO RI &HOO %LRORJ\ *ODVHU % 6XQJ $ %DXHU DQG :HLFKPDQ % 0 f 5HJXODWLRQ RI HLFRVDQRLG ELRV\QWKHVLV LQ WKH PDFURSKDJH ,QYROYHPHQW RI SURWHLQ W\URVLQH SKRVSKRU\ODWLRQ DQG PRGXODWLRQ E\ VHOHFWLYH SURWHLQ W\RVLQH NLQDVH LQKLELWRUV %LRFKHPLFDO 3KDUPDFRORJ\f *RRGODG 5 $ :LOVRQ 7 /HQWRQ : *UHJRU\ + 0F&XOODJK DQG :ULJKW 1 $ f ,QWUDYHQRXV EXW QRW LQWUDJDVWULF XURJDVWURQ(*) LV WURSKLF WR WKH LQWHVWLQH RI SHUHQWHUDOO\ IHG UDWV *XW *UHJRU\ + f ,VRODWLRQ DQG VWUXFWXUH RI XURJDVWURQ DQG LWV UHODWLRQVKLS WR HSLGHUPDO JURZWK IDFWRU 1DWXUH /RQGRQf *UHVLN ( : DQG $]PLWLD ( & f $JH UHODWHG FKDQJHV LQ 1*) (*) DQG SWRUHDVH LQ WKH JUDQXODU FRQYROXWHG WXEXOHV RI WKH PRXVH VXEPDQGLEXODU JODQG $ PRUSKRORJLFDO DQG LPPXQRF\WRFKHPLFDO VWXG\ -RXUQDO RI *HUHQWRORJ\ f *UHVLN ( : .DVKLPDWD 0 .DGR\D < 0DWKHZV 5 DQG
PAGE 146

*UREVWHLQ & Ff 0RUSKRJHQHWLF LQWHUDFWLRQV EHWZHHQ HPEU\RQLF WLVVXHV VHSDUDWHG E\ D PHPEUDQH ILOWHU 1DWXUH *URVVL 6 6NUHSFLQVNL ) % 'H&DUR 7 5REHUWVRQ & +R $ : 'XQIRUG 5 DQG *HQFR 5 f 7UHDWPHQW RI SHULRGRWQDO GLVHDVH LQ GLDEHWLFV UHGXFHV JO\FDWHG KHPRJORELQ -RXUQDO RI 3HULRGRQWRORJ\f *XOOEHUJ DQG (NEORP 3 f ([WUDFHOOXODU PDWUL[ DQG LWV UHFHSWRUV GXULQJ GHYHORSPHQW ,QWHUQDWLRQDO -RXUQDO RI 'HYHORSPHQWDO %LRORJ\ f +DOO ( 5HLFKDUGW / ) &URZOH\ ( +ROOH\ % 0RH]]L + 6RQQHQEHUJ $ DQG 'DPNV\ & + f -RXUQDO RI &HOO %LRORJ\ +DWKDZD\ + 5RPDJQDQR / DQG %DELDU] % 6 f $QDO\VLV RI FHOO VXUIDFH JDODFWRV\OWUDQVIHUDVH DFWLYLW\ GXULQJ 0RXVH WURSKRHFWRGHUPDO GLIIHUHQWLDWLRQ 'HYHORSPHQWDO %LRORJ\ +DWKDZD\ + DQG 6KXU % f &HOO VXUIDFH JDODFWRV\OWUDQVIHUDVH IXQFWLRQV GXULQJ QHXUDO FUHVW FHOO PLJUDWLRQ DQG QHXUDODWLRQ LQ YLWUR -RXUQDO RI &HOOXODU %LRORJ\ +D]HQ0DUWLQ /DQGUHWK DQG 6LPSVRQ $ f ,PPXQRF\WRFKHPLFDO ORFDOL]DWLRQ RI QHUYH JURZWK IDFWRU LQ PRXVH VDOLYDU\ JODQGV -RXUQDO RI +LVWRFKHPLVWU\ f +LOO 5 / DQG %UHZ f $OSKD ODFWDOEXPLQ KDV WKH XQLTXH DELOLW\ WR DOWHU D JDODFWRV\OWUDQVIHUDVH VXEVWUDWH XWLOL]DWLRQ SURILOH $GYDQFHV LQ (Q]\PRORJLF $UHDV RI 0ROHFXODU %LRORJ\ $ +RIIPDQ 0 3 .LEEH\ 0 & /HWWHULR DQG .OHLQPDQ + f 5ROH RI ODPLQLQ DQG 7*)_ LQ DFLQDU GLIIHUHQWLDWLRQ RI D KXPDQ VXEPDQGLEXODU JODQG FHOO OLQH +6*f -RXUQDO RI &HOO 6FLHQFH +RJHUYRUVW 9 .XLNPDQ YRQ GHP %RUQH $ ( 6RQQHQEHUJ $ f &ORQLQJ DQG VHTXHQFH DQDO\VLV RI F'1$ DQ LQWHJULQ VXEXQLW WKDW FRQWDLQV D XQLTXH N' F\WRSODVPLF GRPDLQ -RXUQDO RI (PEU\RORJ\ +RZH $ $SOLQ $ ( $ODKDUL 6 DQG -XOLDQR 5 / f ,QWHJULQ 6LJQDOLQJ DQG FHOO JURZWK &XUUHQW 2SLQLRQ LQ &HOO %LRORJ\ f

PAGE 147

+XPSKUH\V%HKHU 0* ,PHO 0 -HQWRIW 1 *OHDVRQ 0 DQG &DUOVRQ 0 f ,VRODWLRQ DQG FKDUDFWHUL]DWLRQ RI 8'3JDODFWRVH 9DFHW\O JOXFRVDPLQH JDODFWRV\OWUDQVIHUDVH DFWLYLW\ LQGXFHG LQ UDW SDURWLG JODQGV WUHDWHG ZLWK LVRSURWHUHQRO -RXUQDO RI %LRORJLFDO &KHPLVWU\ +XPSKUH\V%HKHU 0 6FKQH\HU & $ .LGG 9 0DUFKDVH 5 % f ,VRSURWHUHQROPHGLDWHG 3DURWLG *ODQG +\SHUWURSK\ LV ,QKLELWHG E\ (IIHFWRUV RI _*DODFWRV\OWUDQVIHUDVH -RXUQDO RI %LRORJ\ &KHPLVWU\ +XPSKUH\V%HKHU 0 0DFDXOH\ 6 &KHJLQL 1 YDQ 6HWWHQ 3XUXVKRWDP 6WHZDUW & :KHHOHU 7 DQG 6FKXOW] f &KDUDFWHUL]DWLRQ RI WKH V\QWKHVLV DQG VHFUHWLRQ RI WUDQVIRUPLQJ JURZWK IDFWRU DOSKD IURP VDOLYDU\ JODQGV DQG VDOLYD (QGRFULQRORJ\A +XWVRQ 0 1LDOL 0 (YDQV DQG )RZOHU 5 f (IIHFW RI VDOLYDU\ JODQGV RQ ZRXQG KHDOLQJ LQ PLFH 1DWXUH /RQGRQf +\QHV 52 f ,QWHJULQV D IDPLO\ RI FHOO VXUIDFH UHFHSWRUV &HOO +\QHV 5 2 f ,QWHJULQV YHUVDWLOLW\ PRGXODWLRQ DQG VLJQDOOLQJ LQ FHOO DGKHVLRQ &HOO ,]XWVX 7 f 3K\VLRORJLFDO $VSHFWV RI 6DOLYDU\ *ODQG )XQFWLRQ &RPSHQGLXP RI &RQWLQXLQJ (GXFDWLRQ LQ 'HQWLVWU\ 6XSSOHPHQW 1R 6 6 -DVNROO 7 &KR\ + $ DQG 0HOQLFN 0 f *OXFRFRUWLFRLGV 7*)S DQG HPEU\RQLF PRXVH VDOLYDU\ JODQG PRUSKRJHQHVLV -RXUQDO RI &UDQLRIDFLDO *HQHWLF 'HYHORSPHQWDO %LRORJ\ -XOLDQR 5 f &RRSHUDWLRQ EHWZHHQ VROXEOH IDFWRUV DQG LQWHJULQFHOO DQFKRUDJH LQ WKH FRQWURO RI FHOO JURZWK DQG GLIIHUHQWLDWLRQ %LRHVVD\V f -XOLDQR 5 / DQG +DVNLOO 6 f 6LJQDO 7UDQVGXFWLRQ IURP WKH H[WUDFHOOXODU PDWUL[ -RXUQDO RI &HOO %ORORJ\? f .DXIPDQ 0 + f ,Q $Q $WODV RI 0RXVH 'HYHORSPHQW QG (GLWLRQ $FDGHPLF 3UHVV /RQGRQ (QJODQG .DGR\D < .DGR\D 'XUEHHM 0 +ROPYDOO 6RURNLQ / DQG (NEORP 3 f $QWLERGLHV DJDLQVW 'RPDLQ ( RI /DPLQLQ DQG ,QWHJULQ D 6XEXQLW 3HWXUE %UDQFKLQJ (SLWKHOLDO 0RUSKRJHQHVLV RI 6XEPDQGLEXODU *ODQG EXW E\ 'LIIHUHQW 0RGHV -RXUQDO RI &HOO %LRORJ\

PAGE 148

.DGR\D < 1RPL]X 0 6RURNLQ / 0
PAGE 149

.RQWXUHN 6 'HPELQVNL $ :DU]HFKD = %U]R]RZVNL 7 DQG *UHJRU\ + f 5ROH RI HSLGHUPDO JURZWK IDFWRU LQ KHDOLQJ RI FKURQLF JDVWURGXRGHQDO XOFHUV LQ UDWV *DVWURHQWHURORJ\ .RUQEHUJ / f )RFDO DGKHVLRQ NLQDVH DQG LWV SRWHQWLDO LQYROYHPHQW LQ WXPRU LQYDVLRQ DQG PHWDVWDVLV -RXUQDO RI +HDG DQG 1HFN &DQFHU LQ SUHVV .RUQIHOG 5 DQG .RUQIHOG 6 f $VVHPEO\ RI $VSDUDJLQHOLQNHG 2OLJRVDFFKDULGHV $QQXDO 5HYLHZV ,Q %ORFKHPOVWU\ /DIUHQLH 5 0 DQG
PAGE 150

0DFDXOH\ 6 3 7DUQX]]HU 5 : 6FKXOW] 6 &KHJLQL 1 2[IRUG ( DQG +XPSKUH\V%HKHU 0 f ([WUDFHOOXODU0DWUL[ *HQH ([SUHVVLRQ 'XULQJ 0RXVH 6XEPDQGLEXODU *ODQG 'HYHORSPHQW $UFKLYHV RI 2UDO %LRORJ\ f 0DF.D\ 6 / %HQQHWW 1 7 %ODQG DQG 6FKXOW] 6 f *URZWK IDFWRU WXPRU VXSSUHVVRUV DQG FDQFHU 3HUVSHFWLYHV LQ *HQHUDO 6XUJHU\ 0DGVHQ + 2 DQG +MRUWK 3 f 0ROHFXODU FORQLQJ RI PRXVH 363 P51$ 1XFOHLF $FLG 5HVHDUFK f 0DJD ( $ $QGHUVRQ % +XDQJ 0 & DQG 0XUUD\ f ([SUHVVLRQ RI KXPDQ O\VR]\PH P51$ LQ WKH PDPPDU\ JODQG RI WUDQVJHQLF PLFH 7UDQVJHQLF 5HVHDUFKf 0DJD 7 0L]XQR 0 7DQDND 6
PAGE 151

0LQHU + 3DWWRQ % / /HQW] 6 *LOEHUW 6QLGHU : -HQNLQV 1 $ &RSHODQG 1 6DQHV 5 f 7KH ODPLQLQ D FKDLQV ([SUHVVLRQ GHYHORSPHQWDO WUDQVLWLRQV DQG FKURPRVRPDO ORFDWLRQV RI D LGHQWLILFDWLRQ RI KHWHURGLPHULF ODPLQLQV DQG FORQLQJ RI D QRYHO D LVRIRUP -RXUQDO RI &HOO %LRORJ\ 0LULV / DQG %DOO : f 1HRQDWDO UDW VXEPDQGLEXODU JODQG SURWHLQ 60*$ DQG SDURWLG VHFUHWRU\ SURWHLQ DUH DOWHUQDWLYHO\ UHJXODWHG PHPEHUV RI D VDOLYDU\ JLDQG SURWHLQ PXOWLJHQH IDPLO\ -RXUQDO RI %LRORJLFDO &KHPLVWU\ f 0LULV / 0LUDQGD $ DQG %DOO : f &KDUDFWHUL]DWLRQ RI WKH UDW VDOLYDU\ JODQG %LPPXQRUHDFWLYH SURWHLQV %LRFKHPLFDO -RXUQDO 0RUDO + f =XU NHQQWQLV YRQ GHU VSHLFKHOGUXVHQHQWZLFNOXQJ GHU PDXV JO£QGXOD VXEPD[LOODULV =HLWVFKULIW IXU $QDWRPLH XQG (QWZLFNOXQJVJHVFKLFKWH 0RUDO + f =XU NHQQWQLV YRQ GHU VSHLFKHOGUXVHQHQWZLFNOXQJ GHU PDXV ,, JO£QGXOD SDURWLV =HLWVFKULIW IXU $QDWRPLH XQG (QWZLFNOXQJVJHVFKLFKWH 0XQJHU % / f +LVWRFKHPLFDO VWXGLHV RQ VHURPXFLQRXV DQG PXFRXV VHFUHWLQJ FHOOV RI KXPDQ VDOLYDU\ JODQGV $PHULFDQ -RXUQDO RI $QDWRP\ 0XUDNDPL 7DQLJXFKL + DQG %DED 6 f 3UHVHQFH RI LQVXOLQOLNH LPPXQRUHDFWLYLW\ DQG LWV ELRV\QWKHVLV LQ UDW DQG KXPDQ SDURWLG JODQG 'LDEHWORJLD 1DNDJDZD < *DPPLFKLD 3XUXVKRWKDP 6FKQH\HU & $ DQG +XPSKUH\V%HKHU 0 f (SLGHUPDO JURZWK IDFWRU DFWLYDWLRQ RI UDW SDURWLG JODQG DGHQ\ODWH F\FODVH DQG PHGLDWLRQ E\ D *73ELQGLQJ UHJXODWRU\ SURWHLQ %LRFKHPLFDO 3KDUPDFRORJ\ 1DNDJDZD < 2[IRUG ( ,VKLEDVKL
PAGE 152

1DNDQLVKL < 6XJLXUD ) .LVKL -O DQG +D\DNDZD 7 f &ROODJHQDVH LQKLELWRU VWLPXODWHV FOHIW IRUPDWLRQ GXULQJ HDUO\ PRUSKRJHQHVLV RI PRXVH VDOLYDU\ JODQG 'HYHORSPHQWDO %LRORJ\ 1DQQ\ / % DQG .LQJ / ( f f(SLGHUPDO *URZWK )DFWRU DQG 7UDQVIRUPLQJ *URZWK )DFWRUDf ,Q 7KH 0ROHFXODU DQG &HOOXODU %LRORJ\ RI :RXQG 5HSDLU VHFRQG (GLWLRQf SS 5 $ ) &ODUN (GLWRUf 3OHQXP 3UHVV 1HZ
PAGE 153

2[IRUG ( 1JX\HQ + 7 $OIRUG & ( 7DQDND < DQG +XPSKUH\V %HKHU 0 Ef (OHYDWHG 6DOLYDU\ (*) /HYHOV 6WLPXODWHG E\ 3HULRGRQWDO 6XUJHU\ -RXUQDO RI 3HULRGRQWRORJ\*4 2[IRUG ( 1JX\HQ + 7 1DQQL 0 $OIRUG =HOOHV 7 -RQVVRQ 5 2ORIVVRQ DQG +XPSKUH\V%HKHU 0 f (OHYDWHG /HYHOV RI +XPDQ 6DOLYDU\ (*) )ROORZLQJ 2UDO DQG -X[WD2UDO 6XUJHU\ -RXUQDO RI 2UDO DQG 0D[LOORIDFLDO 6XUJHU\ F $FFHSWHG IRU SXEOLFDWLRQf 3DQD\RWRX (QG 3 $XPDLOOH\ 0 7LPSO 5 DQG (QJHO f 'RPDLQV RI ODPLQLQ ZLWK JURZWK IDFWRU DFWLYLW\ &HOO 3DVVDQLWL $ DQG +DUW : f 0HWDVWDVLV$VVRFLDWHG 0XULQH 0HODQRPD &HOO 6XUIDFH DO DWR V\OWUDQVI HUDVH &KDUDFWHUL]DWLRQ RI (Q]\PDWLF $FWLYLW\ DQG ,GHQWLILFDWLRQ RI WKH 0DMRU 6XUIDFH 6XEVWUDWHV -RXUQDO RI &DQFHU 5HVHDUFK 3DXOVVRQ 0 f %DVHPHQW PHPEUDQH SURWHLQV VWUXFWXUH DVVHPEO\ DQG FHOOXODU LQWHUDFWLRQV &ULWLFDO 5HYLHZV LQ %LRFKHPLVWU\ DQG 0ROHFXODU %LRORJ\ 3DXOVRQ & DQG &ROOH\ f *O\FRV\OWUDQVIHUDVHV -RXUQDO RI %LRORJLFDO &KHPLVWU\ f 3HPEHUWRQ / 7D\ORU3DSDGLPLWULRX DQG *HQGOHU 6 f $QWLERGLHV WR WKH F\WRSODVPLF GRPDLQ RI WKH 08& PXFLQ VKRZ FRQVHUYDWLRQ WKURXJKRXW PDPPDOV %LRFKHPLFDO %LRSK\VLFDO 5HVHDUFK &RPPXQLFDWLRQV f 3HQQR 0 % 3DVVDQLWL $ )ULHGPDQ 5 +DUW : -RUGDQ & .XPDU 6 DQG 6FRWW $ ) f ,Q YLWUR *DODFWRV\ODWLRQ RI D N'D *O\FRSURWHLQ E\ DQ (QGRJHQRXV &HOO6XUIDFH *DODWRV\OWUDQVIHUDVH &RUUHODWHV ZLWK WKH ,QYDVL\HQHVV RI $GUHQDO &DUFLQRPD &HOOV 3URFHHGLQJV RI WKH 1DWLRQDO $FDGHP\ RI 6FLHQFH 86$f 3RGROVN\ DQG ,VVHOEDFKHU f &KDUDFWHUL]DWLRQ RI PRQRFORQDO DQWLERGLHV WR VHUXP JDODFWRV\OWUDQVIHUDVH 3URFHHGLQJV RI WKH 1DWLRQDO $FDGHP\ RI 6FLHQFH 86$f 3RXOVHQ DQG &ROOH\ f *O\FRV\OWUDQVIHUDVHV $ 0LQLUHYLHZ -RXUQDO RI %LRORJLFDO &KHPLVWU\ f 3RXOVHQ -DNREVHQ % 0LNNHOVHQ % 0 +DUPDUN 1LHOVHQ 7 DQG +MRUWK 3 f &RRUGLQDWLRQ RI PXULQH SDURWLG VHFUHWRU\ SURWHLQ DQG VDOLYDU\ DP\ODVH H[SUHVVLRQ -RXUQDO RI (PEU\RORJ\ f

PAGE 154

3UDWW 6 $ 6FXOO\ 1 ) DQG 6KXU % f $QDO\VLV RI &HOO6XUIDFH *DODFWRV\OIUDQVIHUDVH $FWLYLW\ 'XULQJ 0RXVH 7URSKRHFWRGHUPDO 'LIIHUHQWLDWLRQ 'HYHORSPHQWDO %LRORJ\ 3XUXVKRWKDP 5 %RORJQD 1DNDJDZD < DQG +XPSKUH\V%HKHU 0 Df ,VRODWLRQ DQG FKDUDFWHUL]DWLRQ RI D QHZ &DFDOPRGXOLQGHSHQGHQW SURWHLQ NLQDVH IURP LVRSURWHUHQROVWLPXODWHG SUROLIHUDWLQJ UDW DFLQDU FHOOV %LRFKHPLFDO &HOOXODU %LRORJ\ 3XUXVKRWKDP 'XQQ : $ 6FKQH\HU & $ DQG +XPSKUH\V%HKHU 0 Ef $ QRYHO PHFKDQLVP IRU LVRSUHQDOLQHVWLPXODWHG SUROLIHUDWLRQ RI UDW SDURWLG DFLQDU FHOOV LQYROYLQJ WKH HSLGHUPDO JURZWK IDFWRU UHFHSWRU DQG FHOO VXUIDFH JDODFWRV\OIUDQVIHUDVH %LRFKHPLFDO -RXUQDO 3XUXVKRWKDP 5 2IIHQPOOHU %XL $ 7 =HOOHV 7 %OD]VHN 6FKXOW] 6 DQG +XPSKUH\V%HKHU 0 f $EVRUSWLRQ RI HSLGHUPDO JURZWK IDFWRU RFFXUV WKURXJK WKH JDVWURLQWHVWLQDO WUDFW DQG RUDO FDYLW\ LQ DGXOW UDWV $PHULFDQ -RXUQDO RI 3K\VLRORJ\ * 5DR & 1 0DUJXOLHV 7 6 7UDOND 9 3 7HUUDQRYD $ 0DGUL $ DQG /LRWWD / $ f ,VRODWLRQ RI D VXEXQLW RI ODPLQLQ DQG LWV UROH LQ PROHFXODU VWUXFWXUH DQG WXPRU FHOO DWWDFKPHQW -RXUQDO RI %LRORJLFDO &KHPLVWU\ 5HGPDQ 5 6 DQG 6UHHEQ\ / 0 Df 7KH SUHQDWDO SKDVH RI PRUSKRVLV RI WKH UDW SDURWLG JODQG 7KH $QDWRPLFDO 5HFRUG 5HGPDQ 5 6 DQG 6UHHEQ\ / 0 Ef 3UROLIHUDWLYH EHKDYLRU RI GLIIHUHQWLDWLQJ FHOOV LQ WKH GHYHORSLQJ UDW SDURWLG JODQG -RXUQDO RI &HOO %LRORJ\ 5LFK 7 'DZVRQ $ 3 DQG 3U\RU 6 f *,\FHUDOGHK\GH SKRVSKDWH GHK\GURJHQDVH UHOHDVHIURP HU\WKURF\WHV GXULQJ KDHPRO\VLV 1R HYLGHQFH IRU VXEVWDQWLDO ELQGLQJ RI WKH HQ]\PH WR WKH PHPEUDQH LQ WKH LQWDFW FHOO -RXUQDO RI %LRFKHPLVWU\ f 5HK 7 1DJ\ 7 DQG *UHWWRQ + f 5HWLQDO SLJPHQWHG HSLWKHOLDO FHOOV LQGXFHG WR WUDQVGLIIHUHQWLDWH WR QHXURQV E\ ODPLQLQ 1DWXUH 5LRSHOOH 5 DQG 'RZ ( f 1HXULWH IRUPDWLRQ RQ ODPLQLQ (IIHFWV RI D JDODFWRV\OWUDQVIHUDVH RQ SULPDU\ VHQVRU\ QHXURQV %UDLQ 5HVHDUFK

PAGE 155

5RELQVRQ & 3 %RXQRXV $OIRUG & ( 1JX\HQ + 1DQQL 0 3HFN $ % DQG +XPSKUH\V%HKHU 0 f 363 H[SUHVVLRQ LQ PXULQH ODFULPDO JODQGV DQG IXQFWLRQ DV D EDFWHULD ELQGLQJ SURWHLQ LQ H[RFULQH VHFUHWLRQV $PHULFDQ -RXUQDO RI 3K\VLRORJ\ f * 5RELQVRQ & 3
PAGE 156

5XQ\DQ 5 % 9HUVDORYLF DQG 6KXU % f )XQFWLRQDOO\ GLVWLQFW ODPLQLQ UHFHSWRUV PHGLDWH FHOO DGKHVLRQ DQG VSUHDGLQJ WKH UHTXLUHPHQW IRU VXUIDFH JDODFWRV\OWUDQVIHUDVH LQ VSUHDGLQJ -RXUQDO &HOOXODU %LRORJ\ 5XVVR 5 1 6KDSHU 1 / DQG 6KDSHU + f %RYLQH JDODFWRV\OWUDQVIHUDVH 7ZR VHWV RI P51$ 7UDQVFULSWV (QFRGH 7ZR )RUPV RI WKH 3URWHLQ ZLWK 'LIIHUHQW $PLQRWHUPLQDO 'RPDLQV -RXUQDO RI %LRORJLFDO &KHPLVWU\ 5\DQ 0DQWOH 7 0F4XDLG 6 DQG &RVWLJDQ f 6DOLYDU\ LQVXOLQn OLNH JURZWK IDFWRU RULJLQDWHV IURP ORFDO V\QWKHVLV -RXUQDO RI (QGRFULQRORJ\ 6DNDVKLWD 6 ( (QJYDOO ( DQG 5XRVODKWL ( f 7KH EDHPHQW PHPEUDQH SURWHLQ ODPLQLQ ELQGV WR KHSDULQ )HGHUDO (XURSHDQ %LRFKHPLFDO 6RFLHW\ /HWWHU 6DOLGR ( & /DNVKPDQDQ 6KDSLUR / )LVKHU $ %DUDMDV / f ([SUHVVLRQ RI HSLGHUPDO JURZWK IDFWRU LQ WKH NLGQH\ DQG VXEPDQGLEXODU JODQG GXULQJ PRXVH SRVWQDWDO GHYHORSPHQW $Q LPPXQRF\WRFKHPLFDO DQG LQ VLWX K\EULGL]DWLRQ VWXG\ 'LIIHUHQWLDWLRQ f 6FKDFKWHU ), DQG 5RGHQ / f 7KH ELRV\QWKHVLV RI DQLPDO JO\FRSURWHLQV ,Q 0HWDEROLF &RQMXJDWLRQ DQG 0HWDEROLF )O\GURO\VLV : + )LVFKPDQ (GLWRUf SS $FDGHPLF 3UHVV 1HZ
PAGE 157

6KDSHU 1 / +ROOLV ) 'RXJODV .LUVFK 5 6KDSHU + f &KDUDFWHUL]DWLRQ RI WKH )XOO /HQJWK F'1$ IRU 0XULQH JDODFWRV\OWUDQVIHUDVH 1RYHO IHDWXUHV DW WKH f (QG 3UHGLFW 7ZR 7UDQVODWLRQDO 6WDUW 6LWHV DW 7ZR ,Q)UDPH $8*V -RXUQDO RI %LRORJLFDO &KHPLVWU\ 6KDSHU 1 / 6KDSHU + 3H\VHU 0 .R]DN & $ f /RFDOL]DWLRQ RI WKH JHQH IRU EHWD JDODFWRV\OWUDQVIHUDVH WR D SRVLWLRQ LQ WKH FHQWURPHULF UHJLRQ RI PRXVH FKURPRVRPH &\WRJHQHWLF &HOO *HQHWLFV 6KDZ 3 DQG 6FKLEOHU 8 f 6WUXFWXUH DQG H[SUHVVLRQ RI WKH SDURWLG VHFUHWRU\ SURWHLQ JHQH RI PRXVH -RXUQDO RI 0ROHFXODU %LRORJ\ f 6KDZ 36RUGDW % DQG 6FKLEOHU 8 f 'HYHORSPHQWDO FRRUGLQDWLRQ RI DOSKDDP\ODVH DQG 363 JHQH H[SUHVVLRQ GXULQJ PRXVH SDURWLG JODQG GLIIHUHQWLDWLRQ LV FRQWUROOHG SRVWWUDQVFULSWLRQDOO\ &Hf 6KXU % f &HOO VXUIDFH JOFRV\OWUDQVIHUDVHV LQ JDVWUXODWLQJ FKLFN HPEU\RV 7HPSRUDOO\ DQG VSDWLDOO\ VSHFLILF SDWWHUQV RI IRXU HQGRJHQRXV JO\FRV\OWUDQVIHUDVH DFWLYLWLHV 'HYHORSPHQWDO %LRORJ\ 6KXU % f (PEU\RQDO &DUFLQRPD &HOO $GKHVLRQ 7KH 5ROH RI 6XUIDFH *DLDHWRV\OWUDQVIHUDLV DQG LWV 2. /D*WRVDPLQRJO\*DQ 6XEVWUDWH 'HYHORSPHQWDO %LRORJ\ 6KXU % f &HOOVXUIDFH JDODFWRV\OWUDQVIHUVHV LQ JDVWUXODWLQJ FKLFN HPEU\RV 7HPSRUDOO\ DQG VSDWLDOO\ VSHFLILF SDWWHUQV RI IRXU HQGRJHQRXV JO\FRV\OWUDQVI HUDVH DFWLYLWLHV 'HYHORSPHQWDO %LRORJ\ 6KXU % f 0LQL 5HYLHZ &HOO VXUIDFH _JDODFWRV\OWUDQVIHUDVH WZHQW\ \HDUV ODWH *O\FRELRORJ\ f 6KXU % DQG %HQQHWW f $ VSHFLILF GHIHFW LQ JDODFWRV\OWUDQVIHUDVH UHJXODWLRQ RQ VSHUP EHDULQJ PXWDQW DOOHOHV RI WKH 7WORFXV 'HYHORSPHQWDO %LR ORJ\ 6KXU % DQG +DOO 1 Df 6SHUP VXUIDFH JDODFWRV\OWUDQVIHUDVH DFWLYDWHV GXULQJ LQ YLWUR FDSDFLWDURQ -RXUQDO RI &HOOXODU %LRORJ\ 6KXU % DQG +DOO 1 Ef $ UROH IRU PRXVH VSHUP VXUIDFH JDODFWRV\OWUDQVIHUDVH LQ VSHUP ELQGLQJ WR WKH HJJ ]RQD SHOOXFLGD -RXUQDO RI &HOOXODU %LRORJ\

PAGE 158

6KXU % DQG 1HHO\ & $ f 3ODVPD PHPEUDQH DVVRFLDWLRQ SXULILFDWLRQ DQG FKDUDFWHULVWLF RI PRXVH VSHUP JDODFWRV\OWUDQVIHUDVH -RXUQDO RI %LRORJLFDO &KHPLVWU\ 6LPLQRVNL %HUQDQNH DQG 0XUSK\ 5 $ f 1HUYH JURZWK IDFWRU DQG HSLGHUPDO JURZWK IDFWRU LQ PRXVH VXEPDQGLEXODU JODQGV LGHQWLFDO GLXUQDO FKDQJHV DQG UDWHV RI VHFUHWDJRJXHLQGXFHG V\QWKHVLV (QGRFULQRORJ\ f 6PLWK 3 DQG 3DWHO f ,PPXQRFKHPLFDO VWXGLHV RI WKH LQVXOLQOLNH PDWHULDO LQ WKH SDURWLG JODQG RI UDWV 'LDEHWHV 6SRRQHU % 6 %DVVHWW DQG 6WRNHV % f 6XOIDWHG JO\FRVDPLQRJO\FDQ GHSRVLWLRQ DQG SURFHVVLQJ DW WKH EDVDO HSLWKHOLDO VXUIDFH LQ EUDQFKLQJ DQG '[\ORVLGHLQKLELWHG HPEU\RQLF VDOLYDU\ JODQGV 'HYHORSPHQWDO %LRORJ\ 6SRRQHU % 6 DQG )DXELRQ 0 f &ROODJHQ LQYROYHPHQW LQ EUDQFKLQJ PRUSKRJHQHVLV RI HPEU\RQLF OXQJ DQG VDOLYDU\ JODQG 'HYHORSPHQWDO %LRORJ\ 6SRRQHU % 6 7KRPSVRQ3OHWVKHU + 6WRNHV % DQG %DVVHWW f ([WUDFHOOXODU PDWUL[ LQYROYHPHQW LQ HSLWKHOLDO EUDQFKLQJ PRUSKRJHQHVLV ,Q f7KH FHOO VXUIDFH LQ GHYHORSPHQW DQG &DQFHUf 0 6WHLQEHUJ (GLWRUf 9ROXPH SS 3OHQXP 3UHVV 1HZ
PAGE 159

7DUQX]]HU 5 0DFDXOH\ 6 )DUPHULH : &DEHOODUD 6 f &RPSHWLWLYH 51$ WHPSODWHV IRU WKH GHWHFWLRQ DQG TXDQWLILFDWLRQ RI JURZWK IDFWRUV F\WRNLQHV H[WUDFHOOXODU PDWUL[ FRPSRQHQWV DQG PDWUL[ PHWDOORSURWHLQDVHV E\ 573&5 %LR7HFKQLTXHV 7HDVGDOH 5 'f$JRVWDUR *OHHVRQ 3 $ f 7KH 6LJQDO IRU *ROJL 5HWHQWLRQ RI %RYLQH JDODFWRV\OWUDQVIHUDVH LV LQ WKH 7UDQVPHPEUDQH 'RPDLQ -RXUQDO RI %LRORJLFDO &KHPLVWU\ 7HUUDQRYD 9 3 5DR & 1 .DOHELF 7 0DUJXOLHV 0 DQG /LRWWD / $ f /DPLQLQ UHFHSWRU RQ KXPDQ EUHDVW FDUFLQRPD FHOOV 3URFHHGLQJV RI WKH 1DWLRQDO $FDGHP\ RI 6FLHQFHV 86$f 7KHVOHII 9LLQLNND / 6D[HQ / /HKWRQHQ ( DQG 3HUKHHQWXSD f 7KH SDURWLG JODQG LV WKH PDLQ VRXUFH RI KXPDQ HSLGHUPDO JURZWK IDFWRU /LIH 6FLHQFHVf 7KRPDV : $ 6FKDHIIHU $ : DQG 7UHDGZD\ 5 0 f *DODFWRV\OWUDQVIHUDVH'HSHQGHQFH RI QHXULWH RXWJURZWK RQ VXEVWUDWXPERXQG ODPLQLQ 'HYHORSPHQW 7KRUQEXUJ : 0DWULVLDQ / 0DJXQ % DQG .ROGRYVN\ 2 f *DVWURLQWHVWLQDO DEVRUSWLRQ RI HSLGHUPDO JURZWK IDFWRU LQ VXFNOLQJ UDWV $PHULFDQ -RXUQDO RI 3K\VLRORJ\ * 7KRUQEXUJ : 5DR 5 0DWULVLDQ / 0DJXQ % DQG .ROGRYVN\ 2 f (IIHFW RI PDWXUDWLRQ RQ JDVWURLQWHVWLQDO DEVRUSWLRQ RI HSLGHUPDO JURZWK IDFWRU LQ UDWV $PHULFDQ -RXUQDO RI 3K\VLRORJ\ * 7LPSO 5 f 6WUXFWXUH DQG ELRORJLFDO DFWLYLW\ RI EDVHPHQW PHPEUDQH SURWHLQV (XURSHDQ -RXUQDO RI %LRFKHPLVWU\ 7LPSO 5 5KRGH + *HKURQ5REH\ 3 5HQQDUG 6 )RLGDUW 0 0DUWLQ 5 f /DPLQLQD JO\FRSURWHLQ IURP EDVHPHQW PHPEUDQH -RXUQDO RI %LRORJLFDO &KHPLVWU\ 7RPDVHOOL +DOO ( )OLHU / $ *HKOVHQ 5 7XUQHU & &DUERQHWWR 6 DQG 5HLFKDUG / ) f $ QHXURQDO FHOO OLQH 3&f H[SUHVVHV WZR _FODVV LQWHJULQV D_DQG DS WKDW UHFRJQL]H GLIIHUHQW QHXULWH RXWJURZWKSURPRWLQJ GRPDLQV LQ ODPLQLQ 1HXURQ 7UHOVWDG 5 / f 7KH UROH RI H[WUDFHOOXODU PDWUL[ LQ GHYHORSPHQW $ODQ 5 /LVV (GLWRUf 1HZ
PAGE 160

7XFNZHOO 6 DQG +XPSKULHV 0 f 0ROHFXODU DQG FHOOXODU ELRORJ\ RI LQWHJULQV &ULWLFDO UHYLHZ RI 2QFRORJLF +HPDWRORJ\ 9HUHV *LEEV 5 6FKHUHHU 6 DQG &DVNH\ & f 7KH PROHFXODU EDVLV RI WKH VSDUVHIXU PRXVH PXWDWLRQ 6FLHQFH 9UHXJGHQKLO $ 3 1LHXZ$PHURQJHQ $ 9 GH/DQJH / DQG 5RXNHPD 3 $ f /RFDOL]DWLRQ RI DP\ODVH DQG PXFLQV LQ WKH PDMRU VDOLYDU\ JODQGV RI WKH PRXVH +LVWRFKHPLFDL -RXUQDO f :DWVRQ $ < $QGHUVRQ 6LPLQRVNL 0ROH ( DQG 0XUSK\ 5 $ f &HOOXODU DQG VXEFHOOXODU FRORFDOL]DWLRQ RI QHUYH JURZWK IDFWRU DQG HSLGHUPDO JURZWK IDFWRU LQ PRXVH VXEPDQGLEXODU JODQGV $QDWRPLFDO 5HFRUG f :HVVHOOV 1 f 7KH UROH RI PHVHQFK\PH ,Q 7LVVXH LQWHUDFWLRQV LQ GHYHORSPHQW 1 :HVVHOOV (GLWRUf SS %HQMDPLQ&XPPLQJV 3XEOLVKHUV 0HQOR 3DUN &$ :LOVRQ 3 $ 6FRWW 3HQVFKRZ &RJKODQ DQG 5XVK 5 $ f ,GHQWLILFDWLRQ DQG TXDQWLILFDWLRQ RI P51$IRU QHUYH JURZWK IDFWRU LQ KLVWRORJLFDO SUHSDUDWLRQV /HWWHUV RI 1HXURVFLHQFH f :RRGDUG $ *DUFLDFXWH & /HRQJ 0 0DGUL 6HVVD : DQG /DQJXLQR / f 7KH V\QHUJLVWLF DFWLYLW\ RI DOSKDY LQWHJULQ DQG 3'*) UHFHSWRU LQFUHDVHV FHOO PLJUDWLRQ -RXUQDO RI &HOO 6FLHQFH f :X ( DQG 6DQWRUR 6 $ f 'LIIHUHQWLDO H[SUHVVLRQ RI LQWHJULQ DOSKD VXEXQLWV VXSSRUWV GLVWLQFW UROHV GXULQJ OXQJ EUDQFKLQJ PRUSKRJHQHVLV 'HYHORSPHQWDO '\QDPLFV f
PAGE 161


PAGE 162

%,2*5$3+,&$/ 6.(7&+ *UHJRU\ ( 2[IRUG LV WKH ILUVW VRQ RI &ODUHQFH DQG $QQH 2[IRUG $V D FKLOG 'U 2[IRUG ZDV DIIRUGHG WKH RSSRUWXQLW\ WR VSHQG PDQ\ \HDUV DEURDG GXH WR KLV IDWKHUfV HPSOR\PHQW +H UHWXUQHG WR WKH VWDWHV WR DWWHQG FROOHJH 'U 2[IRUG FRPSOHWHG KLV XQGHUJUDGXDWH DV ZHOO DV GHQWDO SURIHVVLRQDO VWXGLHV DW (PRU\ 8QLYHUVLW\ LQ $WODQWD *HRUJLD +H WKHQ HQWHUHG WKH 8QLWHG 6WDWHV 1DY\ ZKHUH KH UHDFKHG WKH UDQN RI &RPPDQGHU LQ RQO\ \HDUV RI VHUYLFH E\ DFFHOHUDWHG SURPRWLRQV 'U 2[IRUG UHFHLYHG KLV VXUJLFDO WUDLQLQJ LQ SHULRGRQWRORJ\ DW WKH 1DYDO +RVSLWDO %HWKHVGD DQG FRPSOHWHG D UHVHDUFK VWXG\ HYDOXDWLQJ UHJHQHUDWLYH SHULRGRQWDO WHFKQLTXHV $IWHU KLV UHVLGHQF\ KH FRPSOHWHG KLV 0DVWHU RI 6FLHQFH GHJUHH SULRU WR SXUVXLQJ D 3K' DW WKH 8QLYHUVLW\ RI )ORULGD &ROOHJH RI 0HGLFLQH 'U 2[IRUGfV UHVHDUFK LQWHUHVWV GDWH WR GHQWDO VFKRRO ZKHUH KH ZDV LQYROYHG LQ SURMHFWV HYDOXDWLQJ WKH FKHPRWDFWLF GHIHFWV DVVRFLDWHG ZLWK SRO\PRUSKRQXFOHDU OHXNRF\WHV LQ MXYHQLOH SHULRGRQWLWLV LQ WKH ODERUDWRU\ RI 'U 7KRPDV 9DQ '\NH +LV FXUUHQW UHVHDUFK LQ WKH ODERUDWRU\ RI 'U 0LFKDHO +XPSKUH\V%HKHU LQYROYHG WKH HYDOXDWLRQ RI D FHOOVXUIDFH JO\FRV\OWUDQVIHUDVH _JDODFWRV\OWUDQVIHUDVH DQG LWV H[SUHVVLRQ DQG UROH LQ PRUSKRJHQHVLV DQG GHYHORSPHQW XVLQJ WKH PRXVH VDOLYDU\ JODQG DV DQ

PAGE 163

RUJDQ FXOWXUH V\VWHP $GGLWLRQDO VWXGLHV HYDOXDWLQJ VDOLYDU\ OHYHOV RI JURZWK IDFWRUV KDV FRPELQHG KLV FOLQLFDO DQG ODERUDWRU\ H[SHUWLVH +H KDV DOVR EHHQ LQYROYHG LQ RWKHU FOLQLFDO SHULRGRQWDO UHVHDUFK DW WKH 8QLYHUVLW\ DV D FDOLEUDWHG FOLQLFDO H[DPLQHU IRU WKH 3HULRGRQWDO 'LVHDVH 5HVHDUFK &HQWHU DW WKH 8QLYHUVLW\ RI )ORULGD &ROOHJH RI 'HQWLVWU\ DQG DV &R'LUHFWRU RI WKH *UDGXDWH 3HULRGRQWRORJ\ 3URJUDP DW WKH &ROOHJH RI 'HQWLVWU\ 'U 2[IRUG LV D UHFRJQL]HG H[SHUW LQ WKH ILHOG RI SHULRGRQWRORJ\ +H UHFHLYHG KLV 'LSOPDWH VWDWXV E\ DFKLHYLQJ ERDUG FHUWLILFDWLRQ LQ +H LV DOVR DQ ([SHUW :LWQHVV IRU WKH 6WDWH RI )ORULGD %RDUG RI 'HQWLVWU\ 'HSDUWPHQW RI %XVLQHVV DQG 3URIHVVLRQDO 5HJXODWLRQ IRU ZKLFK KH HYDOXDWHV SHULRGRQWDO FDVHV +H LV D PHPEHU RI QXPHURXV VRFLHWLHV DQG RUJDQL]DWLRQV DQG OHFWXUHV QDWLRQDOO\ DQG LQWHUQDWLRQDOO\ +H LV DQ DXWKRU RQ QXPHURXV SXEOLFDWLRQV RQ D ZLGH YDULHW\ RI VFLHQWLILF DQG FOLQLFDO WRSLFV )ROORZLQJ JUDGXDWLRQ IURP WKLV SURJUDP 'U 2[IRUG GHVLUHV WR FRQWLQXH KLV LQYROYHPHQW LQ UHVHDUFK WHDFKLQJ DQG FOLQLFDO SUDFWLFH RI SHULRGRQWLFV

PAGE 164

, FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'SFWRU RI 3KLORVRSK\ 0LFKDHO +XPSKUH\6%HKHU &KDLUPDQ 3URIHVVRU RI 2UDO %LRORJ\ FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWSI RI 3KLORVRSK\ $UQROG 6 %OHLZHLV *UDGXDWH 5HVHDUFK 3URIHVVRU RI 2UDO %LRORJ\ FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ N  D /B G 4L n8OIFAUA :LOOLDP 3 0F$UWKXU 3URIHVVRU RI 2UDO %LRORJ\ FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWRU KLOSVRSK\ *UHJRU\ 6A6FK\MI] 3URIHVVRU RI %LRFKHPLVWU\ DK %LRORJ\ 7KLV GLVVHUWDWLRQ ZDV VXEPLWWHG WR WKH *UDGXDWH )DFXOW\ RI WKH &ROOHJH RI 0HGLFLQH DQG WR WKH *UDGXDWH 6FKRRO DQG ZDV DFFHSWHG DV SDUWLDO IXOILOOPHQW RI WKH UHTXLUHPHQWV IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ 'HFHPEHU


THE ROLE OF BETA 1,4-GALACTOSYLTRANSFERASE IN MURINE
SALIVARY GLAND DEVELOPMENT
BY
GREGORY E. OXFORD
A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY
UNIVERSITY OF FLORIDA
1998

This dissertation is dedicated to my wife, Isabell, and my children,
Mitchell, Allison and Leslie. They each provided me with the strength to carry
on and complete this course of study. Their sacrifices were greater than armies
and their tears sweeter than wine. I will forever be grateful for their support.
The important thing is not to stop questioning. Curiosity has
its own reason for existing. One cannot help but be in awe
when he contemplates the mysteries of eternity of life, of
the marvelous structure of reality. It is enough if one tries
merely to comprehend a little of this mystery everyday.
Never lose a holy curiosity.
-Albert Einstein

ACKNOWLEDGMENTS
Over the past four years Dr. Michael G. Humphreys-Beher has been my
mentor, colleague and friend, and I will be forever grateful for the unwavering
support and guidance he afforded me. Dr. Humphreys-Beher introduced me
to the rigors of science, the significance of certainty and necessity of inquiry.
His insight and direction was instrumental and crucial in my creation and
design of this project.
Additional thanks are directed to the members of my committee: Dr.
Arnold S. Bleiweis, Chairman of the Department of Oral Biology, who was
essential in my seeking an education at this fine institution—Dr. Bleiweis has
developed one of the finest group of researchers available anywhere; Dr.
Gregory S. Schultz, whose knowledge and understanding of science is only
surpassed by his passion for teaching; and Dr. William P. McArthur who
selflessly spent countless individual hours developing my appreciation of the
science and utility of immunologic techniques.
Numerous others have played invaluable roles in this process. Drs.
Jeff Hillman and Anne Progulske-Fox as well as the entire faculty of the
Department of Oral Biology were instrumental in my early stages of
investigation. Additionally, I thank Dr. Nasser Chegini, and the entire staff of

the Institute for Wound Research at the University of Florida for assistance with
the immunohistochemical evaluation of samples. Dr. Amen Peck of the
Department of Pathology and his laboratory personnel especially Ms. Janet
Cornelius, I thank for their timeless help with cell isolation and flow cytometry.
Drs. Shawn Macauley, Heather Allison, and Chris Robinson also
provided countless hours of personal tutelage during this course. Mr. Micah
Kerr, Jason Brayer, and Amy Shawley each provided me with additional
knowledge, crucial to the completion of this project. Also the members of the
Humphreys-Beher laboratory that made the seemingly endless days (and
nights) at the bench enjoyable.
Lastly, I acknowledge the sacrifice imparted on my family during this
process. I wish to thank my beloved wife and children, my parents, my in¬
laws, my sister in-law, Mona, and my Lord and Savior, Jesus Christ through
whom all things are possible.
IV

TABLE OF CONTENTS
page
ACKNOWLEDGMENTS iii
LIST OF FIGURES vili
ABSTRACT xi
CHAPTERS
1 INTRODUCTION
Salivary Glands 1
Form and Function of Salivary Glands 4
Acinus and ductal cells 4
Serous and mucinous glands 4
Development of the Salivary Gland 6
Morphogenesis and cytodifferentiation 7
Functional coupling of the salivary gland 10
Role of ECM in Salivary Gland Development 15
Laminin 15
Integrin composition 19
Integrins as ECM receptors 20
Integrins influence on growth 23
Glycosyltransferases 25
The (31,4-galactosyltransferase - GalTase 28
Cell-Surface GalT ase 33
GalTase’s Role in Development 34
Cell-cell interactions 35
Cell-surface receptors for GalTase interaction 37
A Role for GalTase in Cellular Proliferation 37
GalTase and the epidermal growth
factor-receptor 39
GalTase as a cell adhesion molecule 40
GalTase’s role in cell-matrix interactions 41
Statement of the Problem 42
v

2 MATERIALS AND METHODS 46
Normal in vivo Development 46
Selection of Developmental Markers 46
Amylase (AMY) 47
Cystatin (CYS) 47
Epidermal growth factor (EGF) 47
GalTase (GT) 48
G3PDH 48
Lysozyme (LYS) 49
Mucin (MUC) 49
Nerve growth factor(NGF) 51
Parotid secretory protein 51
Messenger RNA Profile of Fetal Submandibular Gland
Development 51
Collection of tissues 52
Isolation of poly (A)+ messenger RNA 52
Micro-Fast Track® technique 53
RT-PCR Procedures 53
Design and synthesis of RT-PCR primers 55
Standardized RT reaction 55
Standardized PCR reaction 57
Relative Ouantification of mRNA Transcription Levels 57
Separation and photographing of
RT-PCR products 57
Relative quantification of RT-PCR products 58
Cell-Surface GalTase Enzymatic Activity Profile
of Developing Acinar Cells 58
Isolation of intact acinar cells 58
Lactate dehydrogenase control procedures 59
Cell-surface enzymatic activity 60
Histologic and Immunohistochemical Evaluation
of Development 60
Flow Cytometric Evaluation of Cell-Surface
GalTase During Development 62
Organ Culture(/n vitro) Development 64
Fetal Salivary Gland Organ Culture System 64
Selection of Organ Culture Perturbants 65
Alpha-lactalbumin 65
Anti-GalTase antibody 66
Anti-laminin antibody 66
Pretreatment 66
Tyrophostin 67
Controls 67
vi

Evaluation of Organ Culture System Experiments 67
Morphologic evaluation 69
Messenger RNA profile 69
Cell-Surface GalTase enzymatic activity 69
Statistical analysis 70
3 RESULTS 71
Normal in vivo Development 71
Messenger RNA Profile of Fetal Submandibular
Gland Development 71
Determination of RT-PCR Preferred Conditions
and Fidelity 71
Relative Quantification of mRNA Transcription Levels 72
Cell-surface GalTase Enzymatic Activity Profile 86
Histologic and Immunohistochemical Analysis 86
Flow Cytometric Evaluation of Cell-Surface
GalTase During Development 89
Evaluation of Organ Culture (in vitro) Experiments 92
Control in vitro Development of Fetal Submandibular
Glands 92
Experimental in vitro Development of Fetal
Submandibular Glands 100
4 DISCUSSION 105
5 OTHER STUDIES 119
REFERENCES 126
BIOGRAPHICALSKETCH 149
vii

LIST OF FIGURES
Figure Page
1 -1 General Structure of Salivary Glands 5
1 - 2 Schematic Representation of Basement
Membrane Changes 9
1 - 3 The Schematic of Salivary p-adrenergic Receptors 13
1 - 4 The Activation of the Salivary Cholinergic Receptors 14
1-5 Model of Laminin-1 16
1-6 Schematic of Integrin-Matrix Interactions 22
1 - 7 Schematic Diagram of Integrin-Growth
Factor Interactions 24
1-8 The Role of Golgi GalTase 27
1-9 The General Structure of Cell-Surface GalTase 31
1 -10 The Genomic Sequence for Murine
p 1,4-galactosyltransferase 32
1 -11 Potential Mechanisms for GalTase Cell-Cell
Interactions 36
1-12 Model of GalTase Mediated Migration 43
2 -1 The General Scheme for Semi-Ouantification
ofmRNA 54
2 - 2 The General Scheme for Immunohistochemistry 63
2-3 The General Scheme for Organ Culture 68
viii

3 - 1 Confirmation of GalTase RT-PCR Products 73
3 - 2 Gel Electrophoresis Separation of
GalTase RT-PCR Products 75
3-3 Developmental Expression of Amylase mRNA 78
3 - 4 Developmental Expression of Cystatin mRNA 79
3-5 Developmental Expression of EGF mRNA 80
3 - 6 Developmental Expression of GalTase mRNA 81
3 - 7 Developmental Expression of Lysozyme mRNA 82
3 - 8 Developmental Expression of Mucin mRNA 83
3 - 9 Developmental Expression of NGF mRNA 84
3-10 Developmental Expression of PSP mRNA 85
3-11 Histologic Evaluation of Normal Development 88
3-12 Immunohistochemical Analysis of GalTase
Expression 90
3-13 Flow Cytometric Evaluation of Cell-Surface
GalTase 91
3-14 Representative Photomicrographs of a Fetal Mouse
Submandibular Gland Grown in in vitro Organ Culture
for 0-60 Hours 94
3-15 Expression of 0 - 60 hour mRNA Levels
of Markers of Terminal Acinar Cell Differentiation 95
3-16 Expression of 0 - 60 hour mRNA Levels of
Developmental Markers of Ductal Cell Differentiation 96
3-17 Photomicrographs of Representative Fetal Mouse
Submandibular Gland 0 - 60 Hour Organ Culture 97
3-18 Relative Quantification of in vitro mRNA
Expression 98
ix

3-19 Representative Photomicrograph of Results After
36 Hours in Organ Culture With Addition of
Anti-GalTase Antibody 101
3 - 20 Photomicrographs of Representative 0 - 60 Hour
Tyrphostin Organ Culture 104
4 - 1 Suggested Integrin-GalTase-Actin Model 115
x

Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy
THE ROLE OF BETA 1,4-GALACTOSYLTRANSFERASE IN MURINE
SALIVARY GLAND DEVELOPMENT
By
Gregory E. Oxford
December 1998
Chairman: Michael G. Humphreys-Beher, Ph.D.
Major Department: Oral Biology
Previous investigators have speculated that cell-surface (31,4-
galactosyltransferase (GalTase) may play an important role in development
due to its known biochemical interactions in differentiating and migrating cells.
The ability of GalTase to bind A/-acetylglucosamine (GIcNAc) residues found
on adjacent cells or E8 domains of laminin, found in the extracellular matrix
(ECM), is pivotal for these functions.
To evaluate the role of GalTase In in útero salivary gland development,
tissues were harvested from CD1 mice from fetal days 13 through 18,
neonates and adults. Evaluation of cell-surface GalTase, and other
developmental markers, was accomplished by messenger ribonucleic acid
(mRNA) expression levels as determined by reverse transcription polymerase
XI

Chain reaction (RT-PCR), GalTase enzymatic activity assay,
immunohistochemistry and flow cytometry.
This study also utilized the fetal mouse salivary organ culture system to
evaluate the role of GalTase in morphodifferentiation. Submandibular glands
were harvested at fetal day 13 from CD1 mice and cultured for 60 hours in
wells ± laminin coating. Additions to the media included; nothing, 1X PBS, «-
lactalbumin, anti-GalTase and anti-laminin antibodies, and tyrphostin.
Laminin wells were pretreated with bovine galactosyltransferase to modify the
GIcNAc residues and eliminate the GalTase substrate. In vitro morphologic
development, expression, and activity of cell-surface GalTase was evaluated
with photomicrographs, mRNA expression, enzymatic activity,
immunohistochemistry and flow cytometry.
Evaluation of in útero mRNA expression, and cell-surface enzymatic
activity provided a concordance of GalTase in development. Additionally the
in útero expression of mRNA of developmental proteins evaluated peaked at
fetal day 16 for 7 of the 8 proteins.
Salivary organs cultured without laminin (plastic wells, anti-laminin
antibody or pretreated wells) demonstrated retarded in vitro growth with
altered branching morphogenesis and acinar cell proliferation yet similar
GalTase mRNA expression. Glands cultured in agents interfering with
GalTase-laminin interactions (a-lactalbumin, anti-GalTase) presented altered
in vitro morphologic development with less cohesive acinar cell clusters but
XII

similar branching. Furthermore, the GalTase cell-surface activity was inhibited
by these agents but without significant reduction in GalTase mRNA. These
studies suggest that cell-surface GalTase may be an important mediator of
normal cellular interactions, participating in branching morphogenesis and
acinar cell proliferation during fetal salivary gland development.

CHAPTER ONE
INTRODUCTION
Salivary Glands
An intriguing question in animal development is how epithelium
changes shape during morphogenesis and then assumes differentiated
function. Traditionally few tissues have been utilized to evaluate morphologic
developmental processes and they include lung, mammary and salivary gland
tissues. These tissues provide excellent model systems because they
develope characteristic morphologic structures that allow for easily identifiable
alterations from normal development. Of particular interest to me, because of
my training in dentistry, was the salivary gland.
The primary role of the salivary glands is the production of saliva.
Healthy humans typically produce approximately 500 - 1500 mL of whole
saliva per day. More than 90% of this saliva comes from the three major
salivary glands (Zachariasen, 1996). The saliva is typically thought to be
different for each of the major salivary glands. In the mouse, for instance, we
know that the submandibular gland produces almost all of the growth factor,
epidermal growth factor (EGF) (Cohen, 1962). It is known today that ductal
cells are the primary producers of EGF and NGF.
1

2
Saliva is a complex fluid that contains two major components: the
macromolecules, typically contained within the secretory granules, and the
salivary fluid. The salivary macromolecules include mucins, enzymes,
immunoglobulins, growth factors, and other biological active materials. The
salivary fluid is typically produced by the acinar cells. Salivary glands, and
ultimately saliva, play an important role in the maintenance of the overall
health of oral and other tissues. Saliva has many important functions which
include: 1) lubrication of the oral tissues to assist in mastication, swallowing
and speaking, 2) digestion of ingested nutrients, 3) buffering the acidity of the
oral environment, 4) cleansing, 5) formation of the dental pellicle, 6)
remineralization of the tooth surface, 7) source of anti-microbial protection
against oral infections, 8) protection of the oral mucosa, and 9) regeneration
of oral soft tissues (Table 1 - 1) (Zachariasen, 1996; Izutsu, 1990). Thus, the
salivary glands and ultimately saliva play a vital role in homeoregulation of
health in the oral cavity.
The oral cavity is preserved and protected by secretions from salivary
glands. Salivary glands are typically divided into major or minor glands.
Major salivary glands deliver their secretions via extraglandular secretory
ducts and have been termed extrinsic while minor glands typically lie within
the lamina propria of the oral tissues and empty their products directly into the
oral cavity and have thus been termed intrinsic (Dobrosielski-Vergona, 1993).

3
Major Functions of Saliva
Function
Salivary Components Responsible
Lubrication
Water, Mucins, Proline-rich Proteins
Digestion
Amylase, Lipase, Proteases
Buffering
HCOs, P04
Cleansing
Water
Formation of Dental Pellicle Mucins, PRPs, Amylase
Remineralization
Ca, P, Statherin, Anionic Proteins
Antimicrobial
Lactoperoxidase, Lactoferrin, slgA
Protection of the Mucosa
Water, Electrolytes, Mucin
Regeneration
Growth factors
Table 1-1. Major Functions of Saliva. Saliva is a complex biological fluid
that has several Important functions. Saliva plays a wide assortment of
roles In maintaining the homeostasis of the oral cavity. This table
illustrates some of the known roles associated with saliva to date.

4
Form and Function of Salivary Glands
There are three bilaterally paired major salivary glands in most mammals
(including man, primates, rats and mice); the parotid, the submandibular and
the sublingual. There are also numerous minor salivary glands located
throughout the oral cavity found within the lips, palate and mucosal tissues.
The structure of salivary glands is common to all and consist of a collection of
differentiated cells with specialized functions (Figure 1-1).
Acinus and ductal cells.
The major cell types found in salivary tissues are the acinar and ductal
cells. Acinar cells, found within the secretory endpieces, produce the majority
of the salivary products and fluid while ductal cells carry the acinar
secretions to the oral cavity. Acinar cells have a pyramidal shape with
multiple secretory granules. Salivary gland acinar cells are thought to arise
from the pluri-potential intercalated cells (Eversole, 1971). There are also
various forms of ductal cells: the intercalated, granular convoluted and striated
secretory ductal cells. The ductal cells, like the acinar cells, secrete
macromolecules into the saliva (granular convoluted and striated secretory
duct) as well as resorb water and electrolytes (granular convoluted duct)
(Gresik etal., 1985).
Serous and mucinous glands.
Early investigations in salivary gland research used hematoxylin and
eosin staining of salivary gland secretory endpieces to detect two types of
cells: the acinar cells producing serous products and the acinar cells

5
acinar cell
Figure 1-1. General Structure of Salivary Glands. Acinar cells are depicted
here as terminal endpiece secretory units. There are three different
types of ductal cells; intercalated, granular convoluted tubule (which is
responsible for the production of EGF and NGF), and striated secretory
ductal cells.

6
producing mucinous products. This lead to the original description of the
major salivary glands as either serous (parotid gland) or mucinous
(submandibular and sublingual gland) depending on the secretory products.
Serous cells typically produce a proteinacous product with very little mucin.
Mucinous ceils produce acidic and neutral glycoconjugates with lectin-like
qualities known as mucins. Development of immunohistochemical staining
technology later suggested that a seromucinous cell type was also present
(Munger, 1964). Thus, today we describe the parotid gland as a
seromucinous gland (Dobrosielski-Vergona, 1993).
Development of the Salivary Gland
While much has been elucidated in recent years regarding salivary
gland function very little has been investigated regarding their normal
morphodifferentiation and cytodifferentiation. Never-the-less there are four
recognized stages in the development of salivary glands which are: 1)
morphogenesis - the initiation of the characteristic architecture of clefts and
branching; 2) cytodifferentiation - the differentiation of rudimentary salivary
glands into several cell types leading to the synthesis, storage, and secretion
of salivary-specific proteins; 3) development of the stimulus/secretion
coupling system; and 4) the anatomical coupling of the sympathetic nerves -
to begin the secretion of salivary fluids and proteins (Cutler, 1973). Full,
functional and complete physiologic development is only achieved once the
salivary glands are anatomically connected to the nervous system which

7
ultimately activates the secretory system. Activation of cell-surface receptors
of the secretory cells, in response to neural stimuli, results in exocytosis of
secretory granule proteins and the production of saliva. These developmental
phases are partially coupled and independently regulated and must follow the
proper sequence for normal development to occur. Researchers have shown
that secretory cell differentiation can not occur until branching morphogenesis
has been established (Spooner and Faubion, 1980; Cutler, 1980) and that
neural integration will not occur until secretory cell development is complete
(Cutler, 1980; Bottaro and Cutler, 1984; Cutler, 1990 for full review).
Morphogenesis and cytodifferentiation.
Chievitz initially investigated salivary gland development in pigs
(Chievitz, 1885) while Moral was an early investigator of salivary glands in the
mouse (Moral, 1916 and Moral 1919). Later Redman and Sreebny, and
Cutler and Chaudhry and more recently Nakanishi provided extensive
histologic and physiologic studies on ECM expression in embryonic
development of rodent salivary glands (Redman and Sreebny, 1970a
Redman and Sreebny, 1970b; Cutler and Chaudhry, 1973a; Cutler and
Chaudhry, 1973b; Cutler and Chaudhry, 1974; Nakanishi and Ishii, 1989).
Recently Macauley provided information regarding some of the molecular
aspects of ECM expression in útero for fetal mouse salivary gland
development (Macauley et ai, 1997). Some discrepancies arose as a result
of these reports due to the fact that they identified developmental day “one”
differently To maintain consistency with other reports from our laboratory we

8
have utilized the designations of Cutler and Chaudhry where the day after
mating is designated fetal day one (Cutler and Chaudhry, 1973a).
The earliest evidence of submandibular gland development in the
mouse begins on late fetal day 11 when specific cells of the primitive oral
epithelium form a focal clustering which pushes into the surrounding
mesenchyme (Nakanishi eta!., 1986). This salivary gland anlage continues to
proliferate as a thin layer of oriented mesenchyme which buds from the
surrounding mandibular mesenchyme on fetal day 12 and develops the
characteristic club-shaped structure surrounded by a basement membrane
(morphogenesis). The glands begin to resemble the familiar stalk and branch
morphology and can be removed by microdissection on day 13 (Figure 1 - 2).
Only after this branching morphogenesis has occurred can the differentiation
of secretory cells take place (cytodifferentiation). Glandular development
requires the coordinated spatial and temporal reorganization and distribution
of extracellular matrix (ECM) components to achieve morphodifferentiation.
The mesenchymal capsule and specifically the ECM molecule components
are thought to play an important role in the development of the epithelial
portion of the submandibular gland. Removal of the mesenchymal capsule,
thus preventing this interaction, reduced or eliminated the epithelial branching
morphogenesis (Borghese, 1950; Grobstein, 1953a, 1953b, 1953c).
Researchers then suggested that collagen was a stabilizing component of the
ECM and participated in mediating cell growth and branching morphogenesis.
Similarly, Spooner and Faubion (Spooner and Faubion, 1977) and Nakanishi

9
degenerating
basal lamina
Figure 1 - 2. Schematic Representation of Basement Membrane Changes.
This figure represents the changes seen in the basement membrane
during murine submandibular gland development. Day 12
demonstrates the invagination of the primitive oral epithelium forming
the "epithelial bud”. Day 13 represents the familiar “stalk and branch”

10
et al. (Nakanishi et ai, 1986), effectively inhibited In vitro branching
morphogenesis of salivary gland rudiments by the addition of collagenases
(L-azetidine 2-carboxylic acid or a.a’-dipyridyl). More recently, Nakanishi and
Ishii (Nakanishi and Ishii, 1989) used antibodies for specific collagens (I, II, III,
IV) to evaluate the interrelationship between these tissues. Their work
suggested that early clefting of the salivary gland rudiment at day 12 and 13
was associated with collagen III localization while collagen I was equally
distributed throughout epithelial and mesenchymal tissues and type IV
collagen was limited to the basement membrane. Cumulatively, these
studies have suggested a model where the mesenchymal cells produce
collagen which imparts mechanical forces and strain on the epithelial lobule
and this initiates cleft formation (Nakanishi and Ishii, 1989). From this it is
believed that mesenchymal tissues may be either permissive or instructive in
their relationship with epithelium (Wessells, 1977).
Acinar cell differentiation can take place only after branching
morphogenesis has occurred. Cytodifferentiation occurs when secretory
proteins are packaged into secretory granules by mature exocrine cells.
Functional coupling of the salivary gland.
The next stages of development of the salivary gland involves coupling
of the developing gland with the nervous system. Early investigators operated
under the assumption that salivary fluid production was driven by hydrostatic
perfusion. According to Burgen and Emmelin, Ludwig first, and later Young
and van Lennep demonstrated increased salivary flow in dogs even when

11
submandibular duct pressures were experimentally increased to exceed the
arterial pressures, effectively dispelling this theory (Bergen and Emmelin,
1961; Young and van Lennep, 1979). It has now been shown that salivary
fluid production occurs via an osmotic gradient which is associated with two
separate NaCI transport mechanisms (Novak and Young, 1986; Nauntofte
and Poulsen, 1986). Salivary fluid is formed when NaCI is transported from
the extracellular basolateral space, across the acinar cell, and into the acinar
lumen. This movement of NaCI results in an osmotic gradient that then draws
water from the extracellular space, which is replaced with fluids and NaCI from
the gland’s blood supply.
The salivary fluid flow is controlled by both sympathetic and para¬
sympathetic innervation, and acinar cells have receptors for both systems.
Sympathetic nerves release the agonist norepinephrine which interacts with
both a and (3 adrenergic receptors. Parasympathetic nerves release the
agonist acetylcholine which binds to the muscarinic cholinergic receptors
(Allende, 1988). The structure of the adrenergic and muscarinic cholinergic
receptors is similar and consists of an extracellular domain, seven
transmembrane spanning domains, and a cytoplasmic terminus (Lefkowitz
and Caron, 1988).
An activated [3-adrenergic receptor can interact with a heterodimeric
membrane bound G-protein (G-proteins bind guanine nucleotides and consist
of 3 subunits, a [which binds the guanine phosphate], |3, and y). This

12
interaction causes the dissociation of the GTP-a subunit which can then
associate with the catalytic portion of the adenylate cyclase and cause
increased cellular cyclic adenosine monophosphate (cAMP). This increase in
cellular cAMP activates protein kinase activity and leads to phosphorylation
events that ultimately result in exocytosis of the salivary proteins stored in
secretory granules through fusion of granules to the plasma membrane
(Figure 1 - 3).
Activation of the a-adrenergic receptor provides a feedback mechanism
by binding to the inhibitory G protein (G¡) so that GTP is exchanged for GDP
which results in the dissociation of the GTP- a subunit. This dissociated GTP-
a subunit then binds to the catalytic domain of adenylate cyclase, effectively
preventing p-adrenergic stimulated binding (Figure 1 -3).
The activated cholinergic receptor, coupled with phospholipase C
PLC), leads to hydrolysis of phosphatidylinositol-4,5-bisphosphate into
inositol 1,4,5-triphosphate (IP3) and diacylglycerol (DG) (Gallagher, 1988).
IP3, combined with IP4 (a calmodulin-dependent, phosphorylated IP3), leads to
opening of Na, K, and Cl channels which ultimately ends with fluid and
electrolyte secretion (Figure 1 - 4). IP3 initiates the release of intracellular
Ca2+ which allows DG to activate PKC. PKC can stimulate the fusion of
secretory granules with the plasma membrane and release a minimal amount
of saliva protein.

13
exocytosis
Figure 1 - 3. The Schematic of Salivary (3-adrenergic Receptors. Regulation
of adenylate cyclase activity of the acinar cells stimulate
phosphorylation events leading to exocytosis of secretory proteins of
the secretory granules.

14
Figure 1 - 4. The Activation of Salivary Cholinergic Receptors. The activation
of the cholinergic receptors through acetylcholine lead to elevation of
Ca2+ ions which in turn regulate the fluid secretion from the salivary
gland acinar cells. Intracellular Ca2+ ions allow DG to activate PKC,
which stimulates the fusion of secretory granules to the plasma
membrane and release of saliva protein.

15
Role of ECM in Salivary Gland Development
Thin layers of ECM known as basement membranes separate epithelial
cells and connective tissue. The epithelial-mesenchymal interaction is
thought to be achieved through the action of ECM components located in the
basement membrane. The biological importance of the epithelial-
mesenchymal interaction was first recognized byGrobstein (Grobstein, 1953a,
1953b, 1953c). It is thought today that many components of the basement
membrane are biologically active through their activation of growth factor
receptor signaling pathways. These components include collagen,
proteoglycan, fibronectin, and laminin (Trelstad, 1984).
Laminin.
Laminins are extracellular glycoproteins that are the major component
of basement membrane in most tissues and are synthesized by a variety of
cell types including fibroblast, epithelial and endothelial cells (Campbell and
Terranova, 1988; Paulsson, 1992). Laminin was first isolated from the murine
Engelbreth-Holm-Swarm tumor (Timpl, et al., 1979) and there have been at
least 11 isoforms isolated to date (Burgeson et al., 1994 Miner et al., 1997).
Laminin-1 is considered to be a major glycoprotein of the basement
membrane. Laminin-1 is a cross-linked molecule composed of three separate
chains, a1 (400 kDa), [31, and y2 (200 kDa), which assembles as a triple-
stranded cross-like structure connected by disulfide bonds (Beck et al., 1990;
Timpl, 1989) (Figure 1 - 5). Collagen binds to the short arms (Rao et al., 1982;
Terranova etal., 1983; Charonis eta!., 1985, 1986) while heparin binds to

16
G Domain
Figure 1 - 5. Model of Laminin-1. This model of laminin-1 illustrates the
various laminin fragments. Laminin chains a1, pi, and y1 chains and
their putative biologically active domains. E1 - 4, E1, E8, and E3
represents elastase fragments while the numbers in parentheses
represent potential A/-glycosylation sites.

17
the terminal globule of the long arm, and the inner and outer globules of the
short arms (Sakashita etal., 1980; Ott etal., 1982).
Specific peptide domains of laminin molecules have been associated
with various functions in vivo such as assisting attachment of epithelial cells to
basement membrane, promoting cell migration and regulating cell
proliferation (Dragoo etal., 1991; Panayotou etal., 1989; Reh etal., 1987;
Sweeney etal., 1990; Mecham, 1991; Tomaselli et al., 1990). Recent reports
indicate that basement membranes of acinar and ductal cells contain different
laminin isoforms that may be associated with cell differentiation and function
(Strassburger etal., 1998). Components of the laminin a1 chain have been
reported to be essential for branching morphogenesis and cell spreading.
Using monoclonal antibodies to the E3 domain of the laminin a1 chain,
Kadoya and coworkers, demonstrated inhibition of branching morphogenesis
in a 13 day fetal salivary gland organ culture (Kadoya etal., 1995, 1997, 1998,
Miner etal., 1997). Similarly, Begovac has demonstrated that the E8 domain
is crucial for cell spreading. Using the rat pleochromocytoma (PC12) cell
model revealed that these cells failed to develop neurite outgrowths on
laminin when cultured with E8-reactive antibodies, demonstrating that a
principle neurite binding site resides in the E8 domain of laminin and appears
to be responsible for the spreading (Begovac etal., 1991). Eckstein and Shur
subsequently demonstrated that laminin induced a 3 fold increase in the level
of cell-surface (31,4-Galactosyltransferase on migrating mesenchymal cells

18
which is preferentially localized to the leading edge of the lamellipodia
(Eckstein and Shur, 1989).
Oliver etal., confirmed the requirement of ECM, specifically laminin, for
the maintenance of acinar cell phenotype in immortalized cell line cultures
(Oliver, etal., 1987). Oliver and co-workers demonstrated that immortalized
exocrine acinar cells grown without access to laminin, on a reconstituted
basement membrane gel, failed to maintain the acinar cell characteristics.
Cutler examined the effects of polyclonal or monoclonal antibodies directed
against extracellular matrix components on in vitro cultured developing rat
submandibular gland rudiments (Culter, 1990). When these 16 day rat
submandibular gland rudiments were cultured in the presence of anti-laminin
antibodies they grew at the same rate as control rudiments but branching
morphogenesis and secretory cell differentiation was retarded. When
rudiments were cultured in the presence of anti-collagen antibody only 1 of 29
glands demonstrated branching morphogenesis and none (0 of 29) had
secretory differentiation of the secretory endpieces. These results suggest
that type IV collagen as well as laminin are involved in the regulation of
salivary gland morphogenesis and that the process of branching
morphogenesis and secretory cell differentiation within salivary glands are
partially coupled but independently regulated.
Additionally, alterations in the morphology of the basement membrane
have been reported in duct-ligated salivary glands with failure of the
membrane to retain its differentiation and secretory activity, suggesting that

19
laminin plays a role in maintaining glandular morphology (Emmelin et al.,
1974). It is now known that laminin promotes a wide array of developmental
activities including cellular adhesion, migration, differentiation, proliferation,
neurite outgrowth and tumor growth (Hoffman etal., 1996).
Several classes of cell-surface receptors have been shown to interact
with the functional domains of laminin. One class that interacts with laminin is
the heterodimeric cell surface receptor integrins. These integrins consist of
non-covalently associated a and (3 subunits (Hynes, 1987).
Inteqrin composition.
The integrins comprise a family of heterodimeric receptors composed of
a single a and |3 subunit. To date 16 a chains and 8 |3 chains have been
identified (Hynes, 1992). The a chains may associate with a variety of
different |3 subunits leading to the possibility of more than 20 different
permutations. Nonetheless, several subgroupings of integrins have been
noted. Integrins containing the (31 chain are largely involved in interactions
between cell surfaces and ECM molecules such as collagens, laminin and
fibronectin (Garratt and Humphries, 1987; Hynes, 1987). The |32 chain
integrins appear to be affiliated with inflammatory cells and are thus termed
the “leukocyte integrins” while the (33 chain integrins are associated with cells
of the vascular system (Hynes, 1992). Both subunits consist of a large
extracellular domain, a transmembrane domain, and a short cytoplasmic
domain. Unlike growth factor receptors, they do not have tyrosine kinase

20
domains yet they mimic growth factor signal transduction events such as Ca^
mobilization, activation of PLC-y, and the mitogen activated protein kinase
(MAPK) cascade, and tyrosine phosphorylation of p125FAK (Juliano and
Haskill, 1993). Downstream signal transduction events associated with
integrins seem to intersect with the Ras pathway, particularly the activation of
MAP kinases.
The general structure of an integrin receptor consists of several
components. The a subunits range in size from 1200 to 1800 amino acids.
The N-terminus contains 7 repeating domains that are cation binding domains
for Ca++, Mg++ and calmodulin (Tuckwell and Humphries, 1993). The
transmembrane and intracellular domains are relatively short, around 30
amino acids, and are well conserved. The p subunits are smaller than the a
subunits (= 800 amino acids) and also have a region of 4 repeated sequences
with EGF-like domains. The a and p subunits must associate with each other
through noncovalent interactions to gain effective ligand-binding (Hogervorst
etal., 1990; Loftus etal., 1990; Giancotti, etal., 1992).
Integrins as ECM receptors.
Integrins bind to components of the ECM including laminin. The initial
response to ligand binding to the integrin receptor is clustering of the integrin
a and (3 subunits which then triggers formation of cytoplasmic complexes
involving cytoskeletal proteins. Cytoskeketal proteins talin and a-actinin bind
the cytoplasmic tail of the p subunit, then initiate binding of zyxin, paxillin, and

21
vinculin. This whole complex will then bind tensin. Tensin and a-actinin,
when in this arrangement appear structurally capable of binding and inducing
cytoskeletal actin filament rearrangements (Lafrenie and Yamada, 1996).
Thus, integrin receptors play a role in overall cellular architecture and cell
motility. Binding to extracellular ligands can also activate protein kinase C
(PKC), cytoplasmic tyrosine kinases including growth factor receptors, and
MAPKs (Howe, et al., 1998; Kornberg, 1998). Thus, integrins may play an
important role in signaling events leading to cell growth (Figure 1 - 6).
A primary ligand of integrin receptors is laminin. Expression patterns of
cell-surface collagen and laminin integrin receptor a subunits has been
studied during morphogenesis (Wu and Santoro, 1996). Alpha 1 has been
found around endothelial and smooth cells of airways and large blood vessels
while a2 and a6 (but not a3) were found in conjunction with mesenchymal
cells. Epithelial cells expressed all three isotypes. Yao et al. demonstrated
that a7p1 integrin receptor mediates cell adhesion and migration on specific
laminin isoforms (Yao et al., 1996). By using monoclonal antibodies
generated against a7 subunit, adhesion and migration of transfected cells was
blocked on laminin-1 substrates. Confounding the situation, it has recently
been shown that a cell activated via the EGF-R demonstrates increased
phosphorylation of the integrin |34 subunit at multiple tyrosine residues which
leads to migration on laminin surfaces (Mainiero eta!., 1996).

22
Figure 1 - 6. Schematic of Integrin-Matrix Interactions. Ligand binding of
integrin to ECM induces clustering of integrin a and p subunits which
triggers formation of cytoplasmic complexes of cytoskeletal proteins.
Cytoskeletal proteins talin, a-actinin bind the p subunits cytoplasmic tail
then bind zyxin, paxillin, and vinculin which then bind tensin. Tensin
and a-actinin can bind to cytoskeletal actin filaments. Aggregation of
integrin receptors also leads to phosphorylation of Focal Adhesion
Kinases (FAKs) which can then lead to signal transduction
mechanisms. GalTase is also known to localize with actin cytoskeleton
suggesting that GalTase may also be involved.

23
Inteqrins influence on growth.
The integrins are also thought to play a more direct role in signal
transduction for cell growth. It is known that when cells are bound to ECM
proteins their signal transduction cascade, through activated RTK (receptor
tyrosine kinase), via Ras, RAF, MEK (MAPK kinase), to MAPK, is intact
(Burridge etal., 1988). Additionally, FAKs (focal adhesion kinases) have been
isolated that bind to cytoplasmic tails of the integrin receptors. These FAKs
have binding sites for Src, which may then phosphorylate Grb2, that bind Ras.
Ras, once activated by SOS, may interact with Raf and lead to signal
transduction. When cells are non-adherent and the cytoskeletal arraignment
less rigid, signal transmission can be interrupted, due to the fact that some of
the Raf activators are membrane bound disrupting the cascade. In this way
integrins are thought to play a role in signal transduction by stabilizing the
cytoskeletal spatial arrangements of components necessary for signal
transduction (Figure 1 - 6) (Flowe etal. 1998).
A second mechanism in which integrins are thought to play a role in
signal transduction is by physically associating with growth factor receptors,
and these are actively being investigated. Activation of RTKs sets up a signal
transduction cascade that parallels many of those previously discussed.
Down stream signal transduction associated elements of activated RTKs
include PLCy (phospholipase C gamma), SOS and GAP (GTPase activating
protein), which assist in controlling the activity of Ras proteins, Raf and
MEK/MAPK (Figure 1 -7).

24
Integrin
receptor
Cell-surface
GalTase
cysteine rich
domains
EGF
Receptor
MAPK
Figure 1 - 7. Schematic Diagram of Integrin-Growth Factor Interactions.
Activation of tyrosine kinase receptors (growth factor receptors) leads to
phosphorylation and activation events including Phospholipase C
gamma (PLCy), SOS, GTPase Activating Proteins (GAP), which play a
pivotal role in activating Ras proteins in the MAP kinase signal
transduction cascades. Cell-surface GalTase is known to induce EGF-
R mediated signal transduction via cytosolic tyrosine kinase. This
pathway parallels those of integrin dependent cascades.

25
Glvcosvltransferases
Another cell surface receptor of laminin is |31,4-galactosyltransferase.
Beta 1,4-galactosyltransferase (GalTase) is a member of a family of enzymes
termed glycosyltransferases. Cell-surface GalTase is not the only membrane-
bound glycosyltransferase, in fact conservative estimates suggest that there
may be more than 100 membrane-bound enzymes that participate in
glycoprotein biosynthesis alone (Russo et al., 1990). A partial listing of
glycosyltransferases involved in glycoprotein or glycolipid synthesis, and their
donor substrates, is seen in Table 1 - 2. Roseman first reported cell-surface
expression of glycosyltransferases and suggested their involvement in cellular
activities including growth control (Roseman, 1970). Since that report
numerous glycosyltransferases have been identified as having the ability to
be expressed on the cell-surface including GalTase, fucosyltransferase and
sialyltransferase. To date the presence of GalTase on the surface of cells has
been verified by immunofluorescence microscopy (Lopez and Shur, 1987),
flow cytometry (Marchase et al., 1987), immunoelectron microscopy
(Suganuma et al., 1991), and detection of enzyme activity on purified plasma
membranes (Lopez et al., 1991; Neely, 1988; Purushotham et al., 1992b).
Glycosyltransferases are traditionally found as membrane bound
enzymes in the rough endoplasmic reticulum and Golgi complex, where they
participate enzymatically in glycoconjugate biosynthesis and post-translational
modification of proteins and lipids (Figure 1 - 8). The biosynthesis of
glycoproteins requires the attachment of oligosaccharide chains to the

26
Glycosyltransferases of Glycoprotein and
Glycolipid Synthesis
Glycosyltransferase
Donor
Sequence Formed
Galactosvltransferases
GIcNAc [31,4-GT
UDP-Gal
Gal (31,4 GIcNAc-R
Gal «1,3-GT
UDP-Gal
Gal a1,3 Gal [31,4 GIcNAc-R
Sialvtransferases
Gal a2,6-ST
CMP-NeuAc
NeuAc a2,6 Gal [31,4 GIcNAc-R
Fucosvltransferases
GIcNAc a1,3-FT
GDP-Fuc
Fuc a1,3
GIcNAc-R
Gal (31,4
Gal a1,2-FT
GDP-Fuc
Fuc cx1,2 Gal (31,4 GlcNAc-R
Fuc (x1,2 Gal |31,3 GalNAc-R
A/-Acetylqalactosaminyltransferases
Gal a1,3-GalNAcT UDP-GalNAc
Gal NAc a1,3
Gal-R
Fuc a1,2
Table 1-2. A partial listing of glycosyltransferases involved in glycoprotein
and glycolipid synthesis. Abbreviations combine the acceptor sugar
(Gal - galactose; Glc - glucose; Fuc - fucose), the linkage formed, the
glycosyltransferase family to which the complex belongs, and R
represents the remainder of the glycoprotein (Adapted from Paulson
and Colley, 1989).

27
cytosol
UDP-galactose
UMP
Figure 1 - 8. The Role of Golgi GalTase. GalTase Is typically found within the
Golgi apparatus where it functions enzymatically to participate in
glycoconjugate biosynthesis. GalTase transfers the sugar UDP-Gal to
the polypeptide backbone via the GIcNAc residue.

28
polypeptide backbone. This linkage may occur via a hydroxyl group or an
amino group. Attachment of the oligosaccharide moiety to a hydroxyl group of
the amino acids serine or threonine are called O-glycoside or N-
acetylgalactosamine linkages (GalNAc). The attachment via the amino group
of asparagine is called an N-glycoside or N-acetylglucosamine (GIcNAc)
linkage.
The B1.4-qalactosyltransferase - GalTase
GalTase selectively glycosylates GIcNAc substrates to form
lactosamine (below) (Kornfeld and Kornfeld, 1985).
|31,4 GalTase
UDP - Gal
Gal - GIcNAc
Using the energy of the nucleotide phosphodiester bond, these
enzymes may also catalyze transfer a single sugar residue from UDP-Gal to
terminal GIcNAc glycoside acceptors after mannose branching has occurred
as illustrated below.
GIcNAc - Man
Man - GIcNAc - GIcNAc
* GIcNAc - Man
(* (31,4-galactosyltransferase functions at these GIcNAc residues, to transfer
gal after mannose branching has occurred.)

29
In non-lactating tissues GalTase catalyzes the Incorporation of
galactose at the beta 1,4 linkage to GIcNAc residues at the nonreducing
termini (Brew etal., 1968; Hill and Brew, 1975). GalTase may additionally be
found as soluble forms in milk (thus the term “the milk enzyme”), amniotic fluid,
cerebrospinal fluid, saliva, urine, colostrum, and serum and can synthesize
lactose at a very high affinity, due to the presence of the milk protein a-
lactalbumin, according to the following biochemical reaction (Schachter and
Roden, 1973; Ebner, 1973).
.(31,4 GalT ase
freeglu + UDP-Gal »
(glucose) a-lactaibumin
Gal - Glu (lactose)
disaccharide
Results of competitive inhibition studies suggested that the a-
lactalbumin molecule, found often in lactating tissues, induces a
conformational alteration of the GalTase enzyme that prevents exposure of the
active binding site (Do et at., 1995). These studies demonstrated that a-
lactalbumin induces a 1000 fold decrease in the enzyme’s capacity to transfer
Gal from UDP-Gal to the acceptor GIcNAc. Instead the preferred substrate
becomes Glu (Kornfeld and Kornfeld, 1985).
Researchers at the Structural Biology Section of the Division of
Biological Sciences at the National Cancer Institute have reported that the
major binding regions for sugar acceptor and sugar-nucleotide donors lie in

30
the N and C terminal halves of the catalytic portion of the protein, respectively,
and the two binding surfaces overlap at the catalytic site. Currently, this group
is also investigating the three dimensional structure of this enzyme by X-ray
crystallography.
Glycoproteins are structurally distinguishable from other proteins by the
presence of oligosaccharide side chains that are covalently attached to the
polypeptide backbone. Glycoproteins are ubiquitous and fulfill a variety of
biological functions from fertilization, morula compaction, tissue organization
to cell migration (Shur and Bennett, 1979; Shur and Hall, 1982b; Shur, 1984;
Eckstein and Shur, 1989). This diversity of characteristic chemical and
physical properties appear to stem partially from the three dimensional
structure and conformational alterations these oligosaccharide side chain
ligands impart such as during attachment and migration (Poulsen and Colley,
1989). It is also known that glycosylation patterns fluctuate during many
biologic events such as growth, development or disease (Penno et al., 1989;
Passaniti and Hart, 1990).
The general structure of cell-surface GalTase has been elucidated and
consist of several common features including; an N-terminal cytoplasmic tail, a
transmembrane domain, a stem region and a C-terminal catalytic domain
facing the lumen (Figure 1 - 9). The gene encoding murine GalTase was
isolated and characterized in 1988 (Figure 1 -10) (Shaper et al., 1988). The
localization of the gene for GalTase has been mapped to a position in the
centromeric region of the mouse chromosome 9 (Shaper eta!., 1990).

31
cytoplasmic tail
transmembrane
domain
catalytic domain
lumen
Figure 1 - 9. The General Structure of Cell-Surface GalTase. The general
structure of cell-surface GalTase is depicted here. GalTase has a short
cytoplasmic amino terminal tail, a single transmembrane spanning
domain, and a long lumenal catalytic carboxyl domain.

32
55 -
CCCCCTCTTA
AAGCCGCGGC
GGGAAGATGA
GGTTTCGTGA
GCAGTTCCTG
GGCGGCAGCG
CCGCGATGCC
GGGCGCGACC
CTGCAGCGGG
CCTGCCGCCT
GCTCGTGGCC
GTCTGCGCGC
TGCACCTCGG
CGTCACCCTC
GT CT ATT ACC
TCTCTGGCCG
CGATCTGAGC
CGCCTGCCCC
AGTTGGTCGG
AGTCTCCTCT
ACACTGCAGG
GCGGCACGAA
CGGCGCCGCA
GCCAGCAAGC
AGCCCCCAGG
AGAGCAGCGG
CCGCGGGGTG
CGCGGCCGCC
GCCTCCTTTA
GGCGTCTCCC
CGAAGCCTCG
CCCGGGTCTC
GACTCCAGCC
CTGGTGCAGC
TTCTGGCCCC
GGCTTGAAGA
GCAACTTGTC
TTCGTTGCCA
GTGCCCACCA
CCACT GGACT
GTTGTCGCTG
CCAGCTTGCC
CTGAGGAGTC
CCCGCTGCTC
GTTGGCCCCA
TGCTGATTGA
CTTTAATATT
GCTGTGGATC
TGGAGCTTTT
GGCAAAGAAG
AACCCAGAGA
TAAAGACGGG
CGGCCGTTAC
TCCCCCAAG
GACTGTGTCT
CTCCTCACAA
GGTGGCCATC
ATCATCCCAT
TCCGTAACCG
GCAGGAGCAT
CTCAAATACT
GGCTGTATTA
TTTGCATCCC
ATCCTTCAGC
GCCAGCAACT
CGACTATGGC
ATCTACGTCA
TCAATCAGGC
TGGAGACACC
ATGTTCAATC
GAGCTAAGCT
GCTCAATATT
GGCTTTCAAG
AGGCCTTGAA
GGACTATGAT
TACAACTGCT
TTGTGTTCAG
TGATGTGGAC
CTCATTCCGA
TGGACGACCG
TAATGCCTAC
AGGTGTTTTT
CGCAGCCACG
GCACATTTCT
GTTGCAATGG
ACAAGTTCGG
GTTTAGCCTG
CCATATGTTC
AGTATTTTGG
AGGTGTCTCT
GCTCTCAGTA
AACAACAGTT
TCTTGCCATC
AATGGATTCC
CTAATAATTA
TTGGGGTTGG
GGAGGAGAA
GATGACGACA
TTTTTAACAGA
TTAGTTCATA
AAGGCATGTC
TATATCACGT
CCAAATGCT
GT AGTAGGGA
GGTGTCGAAT
GATCCGGCAT
TCAAGAGACA
AGAAAAATGA
GCCCAATCCT
CAGAGGTTTG
ACCGGATCGC
ACATACAAAG
GAAACGATGC
GCTTCGATGG
TTTGAACTCA
CTTACCTACA
AGGTGTTGGA
TGTACAGAGA
TACCCGTTAT
ATACCCAAAT
CACAGTGGAC
ATCGGGACAC
CGAGATAGCA
TTTTTAGTAC
CAATAAGAGA
CCTGAGAATG
GCC6GAGAC
CTCAGATATG
TGTCTCTGCC
AGTT GACTGG
GCTG' |' GTCCCT
CTCATTTGT A
; â– ; ga.gtgtgaat
GACAGTTCTT
CTTATCATTC
AGACGTCCCT
CCAGATGCCC
AGGGTGAGTG
TAACATTTAC
CCACAACCTG
GCTCGGCACT
GGATGAAATT
CTACAAGGTG
AGTGGAGTGT
AAAACTGGTC
AGCCCTTGGA
GAGACTTCTT
GGTTGTGTCA
CCCCCAAAGA
GTCAGAACTG
TACACAGTTC
AAAACTTAGT
GACTGTGGGT
CACATTCCCA
CTGTTGAAAC
TGCTAAATTG
TGACCTGGG
GAAGGACTTT
GCTTTAGTCG
GTGATGTTCG
TACTTGGTGA
CAAATTGAG
CTGCTGCTGG
ATTCAGATTG
ACAAGATTTT
CTTGGATTTT
TTTTTTATAC
GAAAATGAA
AATTTCAATC
AGTCTCGTGC
TCTGTCCCTT
TACATCGGTA
TGCGACTATT
ACAATCACTG
TGTGTGTGTC
TTTTCTTAGC
AAAGGCGTT
TTAAAACTTG
AGCCTGGACC
TTGGGGTCCT
GTAGTGTGTG
GATTCCA AGG
CCTTGCCCTC
AGAGCAGGGG
CCT GGGCACT
CTCACTCACG
TGGCCTGTCT
CCAGATCCCT
GTCTGATTTC
TGAATGTAAA
GAGGCTTTTT
GTTTTGTTTT
TGTTTTTGTT
ttTAGaagca
GTTCGTAGTA
TTTGAAAGAA
TAAATCAAGT
TTTGATTATG
CTATAGGTTG
ATTTTTGTGT
TGATCCAAAT
CAGAATAGCT
ATTGAGTGTT
TAAGTCATGA
-3’
Figure 1 -10. The Genomic Sequence for Murine |31,4-galactosyltransferase.
Nucleotide sequence of cDNA encoding GalTase, as reported by
Shaper etal., 1988, is found at murine chromosome 9p21. Two putative
start ATG codons that correspond to the long (cell-surface) and short
(Golgi) forms of GalTase are shown. The underlined sequence is the
putative transmembrane domain while the bold underline regions
depict the upstream (5’) and downstream (3’) primers, which produce a
673 bp product. Additionally the putative TAG stop codon and the
restriction site for Ava II that produces a single cut within the predicted
RT-PCR product ( | ) are shown. The highlighted sequence within the
shaded open reading frame corresponds with the DNA gel sequence on
page 71, confirming the fidelity of our primers.

33
Subsequent reports from the same laboratory demonstrated that the gene
encodes two similar, but not identical proteins (Russo eta!., 1990).
The long form of the gene encodes for a 402 amino acid protein while
the short form encodes for a 389 amino acid protein. The two GalTase
proteins have identical catalytic and transmembrane domains, but differ in
their cytoplasmic domains as a result of two in-frame putative start sites.
Teasdale et al. reported that approximately ten percent of the total cellular
GalTase is expressed on the cell-surface as determined by flow cytometric
data of stablely transfected cells (Teasdale et al., 1992). The transmembrane
domain of the shorter, more abundant 389 amino acid protein, contains the
signal and required cysteine and histidine residues for retention in the Golgi
(Nilsson et al., 1991; Aoki et al., 1992 Teasdale et al., 1992) while the long
form with its unique 13 amino acid extension is transported to the cell-surface
(Lopez etal., 1991).
Cell-surface GalTase.
GalTase has been suggested to play a role in many different biological
functions when localized to the plasma membrane. GalTase is thought to be
involved in cell-cell activities such as fertilization (Shurand Neely, 1988; Shur
and Hall, 1982a; Shur and Hall, 1982b; Lopez etal., 1985; Benau and Storey,
1988; Benau et al., 1990) and proliferation through the EGF-R:GT interaction
(Purushotham etal., 1992a; Kidd etal., 1991; Marchase et al., 1987, 1988);
and cell-matrix interactions with neurite outgrowth (Begovac and Shur, 1990;
Thomas et al., 1990; Riopelle and Dow, 1991; Begovac et al., 1991),

34
mammary epithelial cell reorganization (Barcellos-Hoff, 1992), and collagen
attachment (Babiarz and Cullen, 1992). While most of the research has been
directed toward investigating GalTase’s role in cell migration (Eckstein and
Shur, 1989 Eckstein and Shur, 1992; Runyan etal., 1986 Runyan et at., 1988;
Shur, 1983; Shur, 1977; Hathaway and Shur, 1992) it is clear cell-surface
GalTase has the potential to be involved in a variety of different cellular
functions.
GalTase’s Role in Development
As previously stated more than 100 glycosyltransferases have been
isolated, yet the focus continues to be on GalTase. The prime reasons for
interest in GalTase is two fold. First was the preferential localization of
GalTase on migrating or developing cells (Shur, 1977). The second reason
was evidence of specific elevation of GalTase activity levels in mutant mouse
sperm cells (Shur and Bennett, 1979; Shur, 1983). They found that sperm
cells with a mutation in the T/t-complex on chromosome 17 lead to increased
cell-surface GalTase expression. These sperm were developmentally
immature and it interfered with normal fertilization. It has also been shown
that metastatic cells demonstrate increases in cell-surface GalTase when
compared to their non-metastatic variants (Chatterjee and Kim, 1977; Maga et
al., 1997).

35
Cell-cell interactions.
Researchers have continued to investigate the potential that GalTase
may play a role in growth and development since Roseman reported cell-
surface expression of GalTase and described its cellular interactions
(Roseman, 1970). Some discussion ensued when researchers demonstrated
that UDP-Gal (the nucleotide sugar for galactose) inhibited growth of cultured
cells (Roth et al., 1977; Klohs et al., 1982). Roth had initially suggested that
this contact inhibition was a result of cell-surface GalTase. Klohs and co¬
workers later demonstrated that this inhibition was associated with GalTase in
serum of their cultures.
The specific recognition and binding of cell-surface GalTase to their
glycoconjugate substrates (GIcNAc residues) on adjacent cell-surfaces
suggested GalTase may play a role in cell-cell adhesion. This was later
confirmed by Scully and co-workers, when they demonstrated spatial and
temporal expression of cell-surface GalTase during mouse spermatogenesis
(Scully et al., 1987). This group showed there was a 77-fold increase in
relative density of cell-surface density of GalTase at the anterior portion of a
sperm head that was associated with an egg cell-surface glycoprotein. The
stability of this GalTase:substrate complex was ensured because sugar
nucleotides are typically absent in the extracellular fluid. The sperm-egg
adhesions could be dissociated however by the addition of UDP-gal which
catalytically separated the sperm GalTase from its galactosylated substrate

36
GIcNAc residue
Figure 1 -11. Potential Mechanisms for GalTase Cell-Cell Interactions.
Schematic representation of the potential association of cell-surface
GalTase in cell-cell interactions as described by Shur, 1991. The cell-
surface GalTase on each cell recognize GIcNAc residue substrate on
adjacent ceils and binds in a lectin like fashion.

37
(Shur and Neely, 1988). Shur suggested a model for this potential lectin-like
capacity of GalTase (Figure 1 -11). Numerous researchers have now
confirmed, in a variety of different cell types, that GalTase does function in cell¬
cell interactions. Table 1 - 3 is a partial listing of these tissues and
researchers.
Cell-surface receptors for GalTase interaction.
Indirect immuno-fluorescence has localized GalTase to areas of
intercellular contact in most of the tissues listed. More detailed analysis of
GalTase substrates in F9 cells lead Maillet and Shur (Maillet and Shur, 1993)
to conclude that there were three dominant substrates. One substrate is
LAMP-1, a membrane glycoprotein previously thought to be expressed only
on lysosomes. LAMP-1 was isolated however from cell surfaces in tissues
that were in various stages of tumor metastasis (Chen et al, 1985). A second
major substrate of GalTase was found to be a cadherin member of the cell
adhesion family, uvomorulin, that is known to mediate intercellular adhesion
in homotypic tissues (Kemler et al., 1989). The third dominant substrate of
cell-surface GalTase is laminin (Mecham, 1991). This suggests that multiple
cell adhesion molecules and their substrates may cooperate to achieve their
desired result.
A Role for GalTase in Cellular Proliferation
The previously described research indicates that GalTase participates
in a lectin-like capacity to mediate cell-cell and cell-matrix interaction by

38
Studies Evaluating the Role of GalTase
in CeEi-CeBI Interactions
Cell Interaction
Researcher, Report Date
Spermatocyte
Pratt etal., 1993
Embryonal carcinoma
Shur, 1983; Maillet and Shur, 1993
Morula compaction
Bayna etal., 1988
Uterine epithelium
Dutt etal., 1987
Ectoplacental cone
Hathaway etal., 1989
Neural retina
Roth etal., 1971
Condrogenic condensation
Chatterjee etal., 1978
Shur, 1983
Growth control
Roth and White, 1992;
Humphreys-Beher etal., 1987;
Purushotham etal., 1992a
Table 1-3. Summary of research evaluating GalTase’s role in cell-cell
interactions. A wide variety of different cell types have been
investigated.

39
binding to GIcNAc substrates on surface or matrix glycoproteins. Cell-surface
GalTase has also been implicated as a participant in cell division by its
association with the Epidermal Growth Factor Receptor (EGF-R) suggesting
GalTase may play a more active role in proliferation.
GalTase and the epidermal growth factor-receptor.
Salivary gland acinar cell growth, regulated by cell-surface GalTase, is
thought to occur by the activation of the phosphotyrosine second messenger
signaling pathway that is initiated by receptor intrinsic tyrosine kinase activity
through interaction of the transferase with the carbohydrate moieties of the
epidermal growth factor receptor (EGF-R) (Purushotham et al., 1992b).
GalTase does not appear to directly mediate signal transduction itself but
rather utilizes the EGF-R pathway (Nakagawa eta!., 1991) (Figure 1 - 7).
Chronic administration of the p-adrenergic receptor agonist,
isoproteronol (ISO), results in hyperplastic and hypertrophic gland
enlargement (Schneyer, 1962). The Flumphreys-Beher laboratory first
demonstrated that this chronic ISO treatment also resulted in increased
messenger RNA (mRNA) expression for GalTase (Flumphreys-Beher et al.,
1984) and that ultimately hyperplastic and hypertrophic gland enlargement
and acinar cell growth In vivo and in vitro was dependent on surface
expression of the enzyme (Marchase etal., 1988).
GalTase interacts with the carbohydrate moiety of the EGF-R and
stimulates the tyrosine phosphorylation cascade which ultimately leads to cell
division. Antagonists of this process include specific GalTase substrates, or

40
antibody to the EGF-R which have been shown to inhibit gland enlargement
by steric hindrance between cell surface GalTase and EGF-R, thus interfering
with the intra-cellular or intercellular signals for growth and thus inhibit cell
proliferation (Humphreys-Beher etal., 1987).
The targeting of GalTase to the cell surface is associated with the
expression of a novel kinase, the GalTase-associated kinase (GTA-kinase or
GTA-K), which specifically phosphorylates GalTase. Previous reports by Kidd
etal., and Macauley etal., demonstrated that there is a peak in expression of
GTA-kinase associated with morphogenic development of fetal mouse
submandibular glands at fetal day 16 (Kidd et al., 1991; Macauley et al.,
1997). Thus the association of the cell-surface expression of GalTase and the
onset of morphodifferentiation of salivary glands as a possible mediator of
growth control has lead to this research.
GalTase as a cell adhesion molecule.
Over the last few years evidence has clearly implicated a role for cell
adhesion receptors in signal transduction processes that lead to regulation of
cell growth and differentiation (Rosales et al., 1995). Typically this signal
transduction has involved both cell adhesion molecules (CAMs) as well as
integrins, both of which have been shown to involve activation of tyrosine
kinases (Juliano and Haskill, 1993). CAMs role in signal transduction have
been shown to be closely associated with cytoskeleton. Previous reports
have shown GalTase to be associated with actin cytoskeleton elements during
migration of cells on laminin surfaces (Appeddu et al., 1991, Appeddu and

41
Shur, 1994). CAMs, integrins and apparently GalTase allow anchorage of the
cell to the extracellular matrix and initiates various signal transduction
processes. Integrin or CAM mediated signaling can affect cellular events
including motility, cell division, differentiation and apoptosis (Howe et at.,
1998; Gullberg and Ekblom, 1995; Juliano, 1996; Yao etal., 1996; Woodard et
at., 1998).
GalTase’s role in cell-matrix interactions.
The finding of increased GalTase expression on the surface of virtually
all migrating cells in both mouse and chick embryos, with its surface
expression correlating with the onset of migration (Shur, 1977), suggested
that GalTase may also participate in cell-matrix interactions. GalTase also
functions as a receptor for ECM components, specifically laminin (Scully et a/.,
1987; Mecham, 1991). Laminin, unlike other components of the extracellular
matrix contains GIcNAc residues. Fibronectin contains no such residues and
thus demonstrates no such GalTase substrate activity. The GIcNAc residues
of laminin have been shown to be an excellent substrate for GalTase (Stryer,
1988) and induces a 3-fold increase in surface GalTase expression on the
lamellipodsa facilitating cell spreading and migration (Eckstein and Shur,
1989). This interaction of GalTase with ECM has been shown to be
associated with the cytoskelton. GalTase is not involved in the initial cell
adhesion to laminin (Hynes, 1987). The initial cell attachment to laminin is
mediated by other receptors, such as the integrins (Hall et at., 1990). Shur
suggested a model for this GalTase associated adhesion and migration (Shur,

42
1983). In his model the adhesion of the cell to the membrane occurs via
enzymatic binding of GalTase to the GIcNAc residues of the ECM laminin
(Figure 1 -12). Studies such as these, has suggested that GalTase may play
a more active role than initially thought in the processes of
morphodifferentiation and ultimately cytodifferentiation. Table 1 - 4 is a partial
listing of these tissues/cells and researchers.
Statement of the Problem
A paradoxical situation now appears to exist where specific integrins
are known to cause cellular attachment to laminin and this may be tissue
specific. Simultaneously GalTase is also known to bind to laminin via GIcNAc
residues in a lectin like fashion. Confounding the situation, GalTase is known
to induce activation of the phosphotyrosine second messenger signaling
pathway that is initiated by receptor intrinsic tyrosine kinase activity through
interaction of the transferase with the carbohydrate moieties of the EGF-R.
Additionally, we now have evidence that EGF-R stimulation leads to
phosphorylation events controlling intracellular signaling for cell growth.
There now appears to be a dichotomy of activities during morphogenesis and
cell migration in which GalTase may play a substantial role. To investigate
this situation, a strategy was devised to first evaluate GalTase expression and
activity during normal growth and development utilizing the murine salivary
gland as a tissue model for development. To relate our information from in
vitro to normal development we first evaluated a group of salivary proteins

colocalization of
cell-surface
with
actin
migrating cell
cell-surface GalTase
GIcNAc residues
on ECM
f f
Figure 1-12. Model of GalTase Mediated Migration. A representation of
Shur’s 1993 model for GalTase’s role in adhesion and migration
(Appeddu and Shur, 1994). The adhesion of the cell to the membrane
occurs via enzymatic binding of GalTase to the GIcNAc residues of the
ECM laminin. In this model new cytoskeleton associations are formed
with GalTase and the rate of migration is inversely related to the cell-
surface GalTAse concentration.

44
Studies Evaluating the Role of GalTase
in Cell-Matrix interactions
Cellular Activity
Researcher, Report Date
Trophoblast outgrowth
Romagnano and Babiarz, 1990
Cell migration
Eckstein and Shur, 1989, 1992;
Runyan etal., 1986, 1988;
Shur, 1977; Shur etal., 1983;
Hathaway and Shur, 1992
Neurite outgrowth
Begovac and Shur, 1990;
Begovac etal., 1991; Thomas etal., 1990;
Riopelle and Dow, 1991
Mammary epithelium
reorganization
Barcellos-Hoff, 1992
Collagen reattachment
Barbiarz and Cullen, 1992
Table 1 -4. Summary of Research Evaluating GalTase’s Role in Cell-Matrix
Interactions. A wide variety of different cell types and activities have
been investigated.

45
including GalTase, and their mRNA expression during development as little
investigation has occurred to describe the fetal expression of salivary proteins.
Subsequently, we utilized the salivary gland rudiment in an organ system, to
specifically evaluate the role GalTase may play, and potential interactions that
may occur, between GalTase, laminin and the integrin receptor during
development.

CHAPTER TWO
MATERIALS AND METHODS
Normal in vivo Development
To investigate the role of GalTase in fetal mouse salivary gland
development we first examined some of the parameters associated with
normal growth in vivo, as there is a paucity of information regarding this in
fetal mouse salivary gland research and literature. Initially we defined some
of the salivary gland proteins, including GalTase, and evaluated their
expression during gestation and beyond. Having obtained the information on
expression patterns associated with these proteins in vivo, it allowed us to
evaluate how well the in vitro organ culture system we used mimics in vivo
development, and to further elucidate role of GalTase.
Selection of Developmental Markers
To define some of the parameters associated with normal growth and
development we decided to evaluate the mRNA expression of a variety of
proteins associated with a differentiating mouse salivary gland including
serous and mucinous, acinar, and ductal cells. Table 2 - 1 provides a list of
the proteins we investigated. Each of the salivary developmental proteins that
we evaluated will now be discussed in alphabetical order.
46

47
Amylase (AMY).
Amylase is afunctional product of a differentiated salivary gland acinar
cell and thought to be confined to parotid serous cells. Amylase is expressed
in salivary glands, liver and pancreas tissue, the expression of which is
determined by 2 separate genes; Amy-1 locus is transcribed in the salivary
glands and liver, while expression of Amy-2 is limited to the pancreas
(Schibler et al., 1982; Darlington et al., 1986). Amylase mRNA expression is
reported to be coordinated with PSP levels and appears to remain at a
constant ratio (Poulsen eta!., 1986).
Cvstatin (CYS).
Cystatin is the least investigated protein of those analyzed in this
account, other than the experimental protein GalTase. Cystatin is a cysteine
protease inhibitor which belongs to a family of mammalian cysteine
proteinase inhibitors. Some reports suggest that cystatin may be temporally
expressed during development and it may be absent in the adult (Cox and
Shaw, 1992). Cystatin is inducible by ISO which activates the beta-
adrenergic receptor - adenylate cyclase - cAMP pathway (Hoffman et al.,
1996). Cystatin was evaluated as a final differentiated functional marker of
acinar cells of serous and mucinous glands.
Epidermal growth factor (EGF).
EGF, as previously stated, was first isolated from submandibular glands
of mice. It is now known that EGF is synthesized in the granular convoluted
tubule or intralobular ductal cells of the salivary gland (Gattone et al., 1992;

48
Watson et ai, 1985). In the mouse the majority of EGF is synthesized in the
submandibular gland while in the human the main source of EGF is the
parotid gland (Thesleff et ai, 1988) with no statistically significant sexual
dimorphism (Dagogo etai, 1985). EGF immunocytological reactivity was first
detected in 18 - 20 day postpartum mice (Salido et al., 1990) while EGF
mRNA expression has been reported in fetal tissues (Gresik et al., 1997;
Kashimata and Gresik, 1997). The EGF-R, on the other hand, appears to be
expressed prior to the initiation of protein production and can be detected in
the mouse at neonate day 10 (Durban et al., 1995).
GalTase (GT).
GalTase has been described fully in Chapter One of this text. GalTase
was the experimental protein that we were investigating. To date no one has
characterized the expression and functionality of cell-surface GalTase during
the development of the fetal mouse salivary gland.
G3PDH.
The housekeeping gene glycerol 3-phosphate dehydrogenase
(G3PDH) was utilized as our control standard for mRNA expression. Initial
studies demonstrated that G3PDH provided a more predictable standardized
expression during fetal gland development than did the previously used
standard of p-actin. Recent studies have indicated that very little G3PDH is
membrane bound in the intact cell perhaps allowing better standardization of
expression levels (Rich et al., 1984).

49
Lysozyme (LYS).
Lysozyme is thought to be a low level terminal salivary gland product of
well differentiated acinar cells. Lysozyme is inherently an antimicrobial
protein thought to have a role in maintaining the overall microbial levels.
Lysozyme mRNA has been reported in the salivary gland of mice (Maga et a/.,
1994). Like cystatin and mucin, lysozyme was used to evaluated
differentiated function of acinar cells from both serous and mucinous glands.
Mucin (MUC).
Mucin is a terminal differentiated functional product from mucinous
acinar cells of the submandibular and sublingual glands. It has been used
previously to evaluate the functional development of fetal mouse salivary
glands that were stimulated with glucocorticoids (Jaskoll et al., 1994). In that
study they found that glucocorticoid receptors were functional as early as fetal
day 14 and that glucocorticoid administration stimulated acinar cell mucin
production, as determined by immunolocalization, in glands of fetal day 17
mice. Another report demonstrated mucin localization even in the parotid
gland tissues (Vreugdenhi! etal., 1982). The production of mucin in the adult
mouse appears to demonstrate a diurnal variation by as much as 20 fold, as
determined by radioimmunoassay (Denny and Denny, 1984). Mucin also
appears to have been well conserved throughout mammalian species
(Pemberton et al., 1992). Mucin was used as a terminal differentiated
functional marker for mucinous acinar cells.

50
Salivary Proteins Investigated
Cell type
Serous
Mucinous
Acinar
AMY, CYS, LYS,
CYS, LYS, MUC,
GT, PSP
GT
Ductal
EGF, NGF
EGF, NGF
Table 2-1. Salivary Gland Developmental Proteins. The salivary gland
developmental proteins investigated in this report are listed and
categorically divided based on cell and gland type; Amylase (AMY),
Cystatin (CYS), Epidermal Growth Factor (EGF), GalTase (GT),
Lysozyme (LYS), Mucin (MUC), Nerve Growth Factor (NGF), and
Parotid Secretory Protein (PSP).

51
Nerve growth factor (NGF).
NGF, much like EGF, is synthesized by the granular convoluted tubule
cells and striated ductal cells of the mouse submandibular gland (Siminoski et
al., 1993; Hazen-Martin et al., 1987). The mRNA expression of NGF also
seems to parallel that of EGF (Wilson et al., 1986). NGF together with EGF
may be used to evaluate ductal cell development.
Parotid secretory protein (PSP).
PSP is a major secretory protein of the adult mouse and rat parotid
gland, not the submandibular gland. As a secretory protein PSP is
synthesized by the acinar cells (Shaw etal., 1986; Madsen and Hjorth, 1985).
PSP was originally thought to only be transcribed and expressed in the
parotid (Shaw and Schibler, 1986), however recent reports have found PSP
transcripts in other tissues (Robinson et al., 1997; Oxford et al., 1998a). PSP
is now known to be expressed in rodent submandibular tissues from fetal days
out to 5 days after birth and then appears to be turned off (Miréis and Ball,
1992).
Messenger RNA Profile of Fetal Submandibular Gland Development
A concordance of mRNA expression, of a variety of developmental
markers, and cell-surface GalTase activity during the fetal development of the
submandibular gland was accomplished. This provided previously
unpublished information regarding gestational molecular development and

52
cell-surface GalTase activity which was used to evaluate our organ culture
system.
Collection of tissues.
Submandibular glands were harvested from pregnant female CD1 mice
(Jackson Labs, Wilmington, MA)that had timed pregnancies. A minimum of 15
- 20 submandibular glands were aspectically harvested by microdissection
techniques utilizing a Zeiss (f = 125) fiberoptic stereo operating microscope
(Carl Zeiss GBH, West Germany) from embryos at each gestational
developmental day 13, 14, 15, 16, 17, 18, neonates, and adult. All procedures
were performed in accordance with protocols approved by the Animal Care
and Use Committee of the University of Florida. Exact time of morphologic
development was confirmed by the methods of Kaufman and only
morphologically correct specimens were used (Kaufman, 1994).
Isolation of poly (A)+ messenger RNA.
A distinct problem encountered in evaluating protein or mRNA
expression in the fetal tissues or dissected organs is the minute quantity of
sample obtained. The advent of reverse transcription polymerase chain
reaction (RT-PCR) techniques provides a high level of sensitivity that allows
detection of 0.1 to 1.0 pg of target sequences, which fortunately is the
approximate size of an average mRNA molecule. Veres et al. first published
reports of utilizing RT-PCR to amplify mRNA in a study evaluating the effect of
point mutagenesis in the mouse ornithine transcarbamylase gene (Veres et
al., 1987). We utilized RT-PCR amplification of mRNA transcripts to provide a

53
concordance of fetal mouse submandibular gland development. Messenger
RNA was isolated from harvested tissues with the Micro-Fast Track® mRNA
Isolation Kit described below (Invitrogen Corporation, Carlsbad, CA).
Micro-Fast T rack® technique.
Tissues from each gestational day were pooled and then incubated for
15-20 minutes with 1 mL Micro-Fast Track® Lysis Buffer preheated to 45°C. A
final 6 mM NaCI solution was obtained by the addition of 5M NaCl solution to
each tube, then an oligo (dT) cellulose tablet was added. The RNA is then
allowed to adsorb to the cellulose tablet for 15 minutes at room temperature
using a rocking platform. Theoligo-dT cellulose slurry with adsorbed poly(A)+
RNA was eluted with stock buffer, ethanol precipitated, resuspended in 100 ¡jI
sterile DEPC-treated water and quantified by absorbence at 260 nm using a
LKB Biochrom UltraSpec II® spectrophotometer (Biochrom Corporation,
Cambridge, England).
RT-PCR Procedures
DNA was synthesized from the mRNA isolated from each time period
utilizing RT-PCR amplification. The use of RT-PCR techniques has become
standard in research for expressing patterns of proteins and mRNA in tissue or
cellular components. Figure 2 - 1 illustrates the scheme of RT-PCR
technology employed during this investigation.

54
,¿v£di\
harvested SMG «:*$??■
submandibular glands were harvested from
mice fetal day 13,14, 15, 16, 17, 18, neonate,
and adult
tissues are pooled
Isolation of mRNA
with Micro-Fast Trac
RT reaction
Amplification of each of the
experimental salivary gland
developmental prteins
Separation with gel
electrophoresis
control G3PDH
amplification
running in parallel
Densitometric evaluation
of mRNA expression
Polaroid photograph of
gel electrophoresis
Figure 2-1. The General Scheme for Semi-Quantification of mRNA. The
scheme utilized in these series of experiments to quantitate the mRNA
(Tarnuzzer etal., 1996). Quantification of amplicons was accomplished
after scanning the Polaroid photographs and the use of densitometry.

55
Design and synthesis of RT-PCR primers.
Oligonucleotide 5’ and 3’ primers for the determination of mRNA
expression of the selected developmental markers were designed utilizing
computerized sequence analysis of human, mouse and rat sequences
available through GenBankâ„¢ (National Library of Science, Bethesda, MD)
and synthesized at the University of Florida Sequencing Core Facility
(Gainesville, FL). Primers were designed to span introns and produce
amplified PCR products between 500 - 800 base pairs, and thus differentiate
the amplification of mRNA from potential contaminating genomic DNA. The
oligonucleotide primers designed, synthesized and utilized in these
experiments are listed in Table 2 - 2. The location of the primers on the
GalTase gene was illustrated in Figure 1 - 9.
Standardized RT reaction.
A series of standardized 20 ¡jI RT reactions were completed. Each
reaction contained 1.5 mM MgCI2, 10 mM Tris-HCI (pFH 8.3) buffer, 80 ¡jM
dNTPs, 50 U/mL human placental ribonuclease inhibitor, 200 U/mg RNA
Maloney murine leukemia virus reverse transcriptase (MMLV-RT), from
GeneAmp® (Perkin Elmer, Branchburg, NJ) and were incubated with 1.0 /vg of
isolated RNA at 25°C for 10 minutes, 42°C for 60 minutes and 94°C for 5
minutes in a Biometra® Uno-Thermoblock thermocycler (Biometra
Incorporated, Tampa, FL).

56
RT-PCR Primers for Salivary Proteins
Protein
5’ Primer
3’ Primer Product Size
AMY
T GCT GCTTT CCCTCATTGG
T GCAAGATCCAGAAGGCCAGA
377
CYS
GCCGT CCT GGGCGT GGCCTGG
CTGGCGGT GCCCT CCAGAGCC
380
EGF
T AAGCCGAGACCGGAAGT ACT
AGTCT GTT CCAT CAAAAT GCA
376
GT
T CACAGT GGACAT CGGGACAC
CCACAAT AAAAAT ACAT AGGA
673
G 3 P D HI TGAAGGTCGGTGTGAACGGATTTGGC
CAT GT AGGCCATGAGGTCCACCAC
983
LYS
T CCT GACT CT GGGACT CCT CC
TCAGACTCCGCAGTTCCGAAT
385
MUC
GT AT AAGAT GT GCCCT CCAGG
T AGGT AT GGCT GT AG AGGT GC
385
NGF
GCAT CAGA A AT CC AAGCGT CC
T AACCCTT GTT G AAGCAGGCG
381
PSP
AT GTT CCAACTTGG AAGCC
G AGGGCAAGTT GT ACCT G
382
Table 2 - 2.
RT-PCR Primers Designed for These Experiments. The RT-PCR
primers that were designed and synthesized to use in these
experiments evaluating the fetal mouse submandibular gland
development are listed with their expected product size.

57
Standardized PCR reaction.
Standardized 100 ¡jL PCR amplification reactions were performed
containing 50 pmoles of each of the oligonucleotide 5’ and 3’ PCR primers,
1.5 mM MgCI2,10 mM Tris-HCI (pH 8.3) buffer, 20/vLof completed RT product
and 0.5 ¡jL Taq polymerase. Amplifications of the reagents for 50 cycles of
94°C for 1.5 minutes, 59°C for 2 minutes, 72°C for 3 minutes was followed by
10 minutes at 72°C for final extension of the product. PCR products were
separated by agarose gel electrophoresis for visualization of cellular PCR
amplicons.
Relative Quantification of mRNA Transcription Levels
Relative quantification for mRNA expression levels was obtained by
comparative analysis of Gallase RT-PCR products to control G3PDH products
using a densitometric analysis as described below.
Separation and photographing of RT-PCR products.
RT-PCR products were separated on 1.5% high melting agarose
(Fisher Scientific Incorporated, Pittsburgh, PA) gels containing 25 ng/mL
ethidium bromide, at 75V constant current for 1.5 hours. At this point
amplicons were clearly discernible. Each agarose gel was then
photographed in a standardized manner for 1.5 seconds using a Polaroid®
MP-4 Land camera and Polaroid® Type 57 film (Polaroid Corporation,
Bedford, MA).

58
Relative quantification of RT-PCR products.
Polaroid photographs of the agarose gel separated RT-PCR products
were then scanned on a Hewlett-Packard ScanJet Ilex® MP digital scanner
(Hewlett-Packard Company, Rockville, MD). Band intensities were digitized
using NIH-lmage v 1.54 (National Institutes of Health, Bethesda, MD) as
described by Tarnuzzer etal. (Tarnuzzer eta!., 1996) to provide densitometric
data, and were subsequently normalized for their nucleotide content. This
provided a relative semi-quantification of product mRNA to a standardized
expression of G3PDH mRNA.
Cell-surface GalTase Enzymatic Activity Profile of Developing Acinar Cells
Cell-surface GalTase enzymatic activity was also determined during
normal development of the mouse submandibular gland. Acinar cells
harvested from developing fetal submandibular glands at the same
gestational time points (13, 14, 15, 16, 17, 18, neonate, and adult), were
utilized to determine the cell-surface GalTase activity.
Isolation of intact acinar cells.
Acinar cells were isolated according to a modification of methods
described by Purushotham (Purushotham et al., 1992a). Submandibular
glands from each time point were identified by gross morphology, dissected
free of other tissues, pooled in a digestion solution containing 1X Hank’s
balanced salt solution (HBSS), DNase I Type II and Collagenase IV (Sigma
Chemical Company, St. Louis, MO), and shaken in a 37°C H20 bath for 15

59
minutes. The supernatant was then collected and placed in ice cold stop
solution containing 1 ml_ sterile 1X HBSS and 2% fetal calf serum, then
centrifuged at 200 x g in a Fisher Scientific centrifuge Model 26 KM (Fisher
Scientific Incorporated, Pittsburgh, PA) to pellet isolated cells. Pelleted cells
were then resuspend in 1X PIBSS and cell density was determined by
hemacytometry (American Optical Company, Buffalo, NY).
Lactate dehydrogenase control procedures.
A lactate dehydrogenase (LDH) activity assay (Humphreys-Beher et at.,
1984) was performed to confirm that isolated acinar cells were intact and that
the GalTase activity determined represented activity from cell-surface
localized enzyme not Golgi retained forms. These assays were run in
duplicate utilizing a Lactate Dehydrogenase Procedure kit (Sigma Diagnostics
Procedure No. 500, Sigma Chemical Company, St. Louis, MO).
The assay for lactate dehydrogenase colorimetrically determines the
enzymatic activity. One mL pyruvate substrate (pyruvate 0.75 mM/L in buffer,
pH 7.5 and 2X NADH [p-Nicotinamide adenine dinucleotide reduced form])
was added to a volume of 100,000 acinar cells at 37°C. After exactly 30
minutes 1.0 mL of Sigma Color Reagent (2,4-dinitrophenyldyhydrazine 20%
in 1 N hydrochloric acid) was added. The OD was determined
spectrophotometrically at 525 nm after mixing gently for 20 minutes at room
temperature with 10.0 mL 0.40 N Na(OH)2. The LDH activity of each sample
was calculated from a standard curve that was generated for absorbence (OD)
of varying concentrations of lysed cells to LDH activity. LDH activity was

60
measured in B-B Units/mL (Berger-Broida unit is amount of LDH that will
reduce 4.8 x 10‘4 mM of pyruvate/minute at 25°C).
Cell-surface enzymatic activity.
The GalTase activity was measured using a modification of an assay
previously described by Humphreys-Beher et al. (Humphreys-Beher et al.,
1984). Intact acinar cells (100,000) were incubated with UDP-[14C]-galactose
(Amersham Corporation, Chicago, IL), and ovalbumin as the oligosaccharide
substrate. After incubation at37°Cfor2 hours the reaction was terminated by
the addition of ice cold trichloroacetic acid (TCA). After washing with 10%
TCA and 95% EtOH, the precipitate was recovered on Whatman Glass
Microfibre 1.5 ¡xM diameter filters (Whatman Incorporated, Clifton, NJ) with a
Millipore® vacuum filtration system (Millipore Corporation, Bedford, MA).
Filters were then placed in scintillation vials containing 10 ml_ ScintiVerse®
BD Cocktail (Fischer Scientific, Pittsburgh, PA), allowed to dark adapt for not
less than 30 minutes before the recovered 14C was determined on a Beckman
LS 3801 Beta Spectrometer scintillation counter (Beckman Instruments
Incorporated, Schauberg, IL).
Histologic and Immunohistochemical Evaluation of Development
Immunohistochemical detection of GalTase was performed as
previously described by Yamamoto and co-workers (Yamamoto et al., 1997).
Salivary glands were dissected from representative fetal developmental days

61
13 and 17 and embedded in paraffin for histologic and immunohistochemical
analysis. Standard 5 micron sections were cut from embedded tissues from
each day, placed on clean glass slides and standard histologic examination of
the sections was performed after staining with hematoxilin and eosin.
Additional sections were deparaffinized through a series of graded alcohol
washes, then washed for 5 minutes with phosphate-buffered saline (PBS, pH
7.1), for immunohistochemical analysis. Sections were incubated at room
temperature for 1 hour with normal goat serum for blocking and then washed
again with PBS prior to a 2 hour incubation with the primary antibody
(Sepharose gel exclusion chromatography purified, mouse anti-human
GalTase monoclonal IgG antibody, a generous gift from Dr. Kurt J. Isselbacher,
Department of Medicine, Harvard Medical School, Boston, MA). The cross
reactivity of this particular antibody with mouse and rat antigen has been
previously reported (Podolsky and Isselbacher, 1984). Further incubation with
goat anti-mouse biotinylated secondary IgG antibody was followed by a series
of PBS washes prior to further incubations with ABC reagent (streptavidin
horseradish peroxidase - produces the avidin biotinylated complex).
Chromatogenic reaction was developed by addition of DAB (3,3’-
Diaminobenzedine) for 5 - 10 minutes. Finally, sections were rehydrated
through a series of graded alcohol washes. The immuno-stained sections and
standard histologic sections were then photographed at 10X with an Olympus
BH-2 microscope (Olympus Camera Incorporated, Flushing, NY) with and
without Normarski interference contrast optics, respectively, using KodaColor®

62
35mm Print Film ISO 100/21° (Eastman Kodak Company, Rochester, NY) at
constant aperture and exposure (Figure 2 - 2). Control sections were stained
after incubation with normal mouse nonimmune serum, antibody IgG isotype
control, and without addition of primary antibody.
Flow Cytometric Evaluation of Cell-surface GalTase During Development
Flow cytometry of 10,000 fetal mouse salivary gland acinar cells was
also utilized to evaluate alterations in cell-surface GalTase expression from
representative developmental days. Again, fetal mouse salivary gland acinar
cells were harvested from anatomically correct representative developmental
days 13 and 17. Monoclonal anti-GalTase IgG antibody (and control
nonimmune normal mouse serum) were added at a concentration of 1:20
dilution of the initial solution. The incubation was carried out on ice and in the
dark for 30 minutes, washed three times in a 10 mL volume of fetal calf serum
containing buffer, and then centrifuged at 500 X g for 10 minutes at 4°C. FITC
(fluoroscein isothiocyanate-conjugated) labelled anti-mouse IgG antibody
raised in goat (1:20) was then added to the cells. Cell-surface labeling of fetal
submandibular gland acinar cells was confirmed by use of a Becton-Dickinson
FACStar® fluorescence-activated cell sorter with a 2W argon ion laser at a
wavelength of 488 nm (Becton Dickinson Company, Franklin Lakes, NJ).
Cells incubated with normal mouse nonimmune serum, antibody IgG isotype
control, and without addition of primary antibody served as controls.

63
13d fetal SMG
tissues are harvested
v
tissues are pooled and fixed
O/N in 4% paraformaldehyde
tissues are dehydrated in series
of ethanol washes and xylene
then embedded in paraffin
paraffin blocks were sectioned at 5 microns
slides were rehydrated with 3% H2C>2
blocking of nonspecific binding with normal
and dried
goat serum
incubate sections with streptavidin horseradish peroxidase (ABC)
then stain with DAB for 5 -10 minutes
wash sections with water
dehydrate in graded alcohol and xyxlene
coverslip and photograph
Figure 2 - 2. The General Scheme for Immunohistochemistry. The flow chart
above provides the general scheme of the immunohistochemical
analysis used in these studies (Yamamoto etal., 1997).

64
Organ Culture (in vitro) Development
To evaluate the role of GalTase in fetal mouse submandibular gland
development we chose to utilize a mouse organ culture system. Rodent
salivary gland organ cultures have been used for many years in the
evaluation of growth and development (Borghese, 1950; Grobstein, 1953a,
1953b, 1953c; Lawson, 1970, 1972, 1974; Bernfield and Banerjee, 1972a,
1972b, 1982; Bernfield and Wessells, 1970; Bernfield etal., 1984; Cohn eta!.,
1977; Spooner and Faubion, 1977, 1985, 1986).
Fetal Salivary Gland Organ Culture System
Female CD1 mice were again used to provide timed pregnancies.
Submandibular glands were harvested from embryos, with the approval of the
Animal Care and Use Committee of the University of Florida, at
morphologically verified day 13 of gestational development, by
microdissection technigues as described above.
Each submandibular gland harvested was cultured separately in a 11.3
mm diameter well of a 48 well polystrene culture plate without coating (Costar
Corporation, Cambridge, MA) or in a well of a 48 well culture plate coated with
mouse laminin (Biocoat Cellware, Bedford, MA). Organ cultures were
maintained at 37°C and 95% 02 / 5% C02 in a Forma Scientific 1600
automatic incubator (Forma Scientific Incorporated, Marietta, OH). Each well
contained 0.75 mL of warmed (37°C) Filton-Jackson modified BGJb media
(Gibco BRL, Grand Island, NY), a chemically defined media, supplemented

65
with L-glutamine, 50 Units pen/strep/mL and 25 mg ascorbic acid/50 mL as
previously described by Jaskoll etal. (Jaskoll et al., 1994). The organ culture
system was continued for 60 hours with the addition of 0.50 mL fresh, warmed,
sterile media every 24 hours.
Selection of Organ Culture Perturbants
The evaluation of GalTase’s role in development was assessed by
addition of different GalTase or laminin specific substrates to the media.
Additions to the media included; nothing, 1X PBS, a-lactalbumin, anti-laminin
and anti-GalTase antibodies, and tyrphostin; additionally 15 laminin wells
were pretreated with bovine galactosyltransferase. Each of these agents is
described below.
Alpha-lactalbumin.
The use of the protein modifier, a-lactalbumin, has been described
previously as a specific inhibitor of pi ,4-galactosyltransferase activity (Roth et
al., 1971a, 1971b; Chatterjee et al., 1978; Shur, 1984; Humphreys-Beher et
al., 1987). Alpha-lactalbumin is a substrate modifier protein that
conformationally prevents GalTase from binding to the specific enzyme
substrate GIcNAc. Alpha-lactalbumin (Sigma Chemical Company, St. Louis,
MO) has been utilized by numerous investigators to limit cell-surface
GalTase’s activity. We used 5 mg/mL a-lactalbumin (» 1 mmol/L) as described

66
by previous investigators (Barcellos-Hoff, 1992) asa perturbant in our culture
system.
Anti-GalTase antibody.
The anti-GalTase antibody utilized in these experiments was a mouse
anti-human GalTase, affinity purified, monoclonal IgG antibody (Dr. Kurt J.
Isselbacher, Harvard Medical School, Boston, MA). Preliminary studies,
including parallel nonimmune serum controls, were used to determine the
optimal concentration (1:20) that was necessary to disrupt development in the
culture system of these studies.
Anti-laminin antibody.
Anti-laminin antibody added to the media in these studies was a rabbit
anti-mouse laminin, «1 and (31 chain, polyclonal IgG antibody (Upstate
Biotechnology Incorporated, Lake Placid, NY or Chemicon International
Incorporated, Temachula, CA). Anti-laminin antibody was also added to the
media at a 1:20 dilution.
Pretreatment.
Bovine GalTase (Sigma Chemical Company, St. Louis, MO) and UDP-
Gal was used to modify the terminal GIcNAc residues of laminin in the coated
wells. Each laminin coated well was incubated for 2 hours at 37°C with 1/10
Unit bovine galactosyltransferase (« 20 (xg/mL) and 2 mmol/L UDP-Gal
(Sigma Chemical Company, St. Louis, MO), washed 3 times with sterile PBS
immediately prior to adding 0.5 mL of warmed, filter sterilized BGJb media and

67
the organ for culturing. The manufacturer reports that one unit of bovine
galactosyltransferase will transfer 1.0 [imole of galactose from UDP-
Gal/minute at pH 8.4 at 30°C.
Tyrphostin.
Tyrphostin-1 was added to the media to evaluate the relationship
between GalTase and the integrin receptor by blocking the tyrosine kinase
signal transduction events. Tyrophostin-1 is a specific EGF-R tyrosine kinase
inhibitor, ([4-methoxybenzlidene] malononitrile; Sigma Chemical Co., St.
Louis, MO) and thus inhibits EGF-R signal transduction events (Glaser et a!.,
1993; Yura et a/., 1995). Again preliminary studies were employed to
determine the optimal concentration (1:50) needed to block development in
vitro compared to control cultures.
Controls.
Five organs were cultured with the addition of nothing or sterile 1X PBS
to the media, for each experiment. These organs served as the controls for
morphometric comparison. Figure 2 - 3 diagramatically provides the overall
scheme utilized in these studies.
Evaluation of Organ Culture System Experiments
Five glands were cultured with each condition for the morphologic
evaluation of the culturing experiments, and photomicrographs were obtained
as described below. A minimum of 2 glands, cultured in parallel, without the

68
13d fetal SMG tissues are harvested
13d fetal SMG
5 x 13d fetal mouse SMG were cultured in each condition for x 60 h in
BGJb media. Photomicrographs were obtained at 0, 12, 24, 36, 48
and 60 hours
*11*
organ culture tissues
were pooled
mRNA collected for RT-PCR
based quantification
acinar cells were isolated for cell-
surface GalTase activity assay
Figure 2 - 3. The Genera! Scheme for Organ Culture. This diagram
represents the general scheme of the fetal mouse salivary gland
organ culture system used in these series of in vitro experiments.

69
addition of a modifying agent, served as controls for each experimental
condition. Each experiment was reproduced on 3 separate occasions.
Eighteen glands were cultured with each condition for the evaluation of mRNA
expression patterns and cell-surface GalTase enzymatic activity. Pooled
tissues were collected from 3 glands at each time point, and utilized for
evaluation. A minimum of 2 glands were again cultured in parallel, without the
addition of a modifying agent, to serve as controls and each experiment was
reproduced on 3 separate occasions.
Morphologic evaluation.
Photographic documentation of gland morphogenesis was obtained at
10X magnification using a Nikon® ELWD 0.3 inverted photomicroscope (Nikon
Incorporated, Instrument Division, Garden City, NJ) and KodaColor® print film
at 0, 12, 24, 36, 48, and 60 hours.
Messenger RNA profile.
Messenger RNA was harvested from pooled tissues utilizing the Micro-
Fast Track® system as previously described in this text (page 50), and RT-PCR
amplification of GalTase was accomplished. Quantification of GalTase mRNA
was obtained for each culturing time point.
Cell-surface GalTase enzymatic activity.
Acinar cells were isolated as described previously and the cell-surface
GalTase enzymatic activity was determined for 100,000 cells. Control lactate
dehydrogenase activity assays were also completed.

70
Statistical analysis.
Statistical analysis was completed by repeated analysis of variance
(ANOVA) for general linear models with a value of p < 0.01, p < 0.02 and p <
0.05. The statistical computation was performed utilizing the SAS statistical
system (SAS Institute Incorporated, Cary, NC).

CHAPTER THREE
RESULTS
Normal in vivo Development
Submandibular glands were harvested at fetal days 13, 14, 15, 16, 17,
18, neonate, and adult from CD1 mice, as described in the Materials and
Methods. A minimum of 15 - 20 submandibular glands from each pregnant
animal at each time point were collected for each procedure: mRNA
quantification and cell-surface GalTase enzymatic activity assays. Separate
animals provided glands such that experiments were repeated on 5 separate
occasions.
Messenger RNA Profile of Fetal Submandibular Gland Development
Messenger RNA was obtained from the collected tissues with the Micro-
Fast Track® Isolation Kit and quantitated with a spectrophotometer. The
concentration of mRNA collected from pooled tissues ranged from 94 pg/¡xL to
570 pg/[iL.
Determination of RT-PCR Preferred Conditions and Fidelity
Oligonucleotide primers for the selected salivary gland developmental
markers were synthesized as designed. A series of RT-PCR reactions with
71

72
purified adult mouse RNA were completed to define the conditions that
produced the most reproducible results. A variety of different conditions were
evaluated and several components of these reactions emerged as critical
factors. Maintaining a consistent MgCI2, concentration (1.5 mM in the RT and
PCR reactions) was a crucial component for consistent results. Additionally,
as anticipated, the annealing temperature was also a critical factor in
obtaining effective results. We utilized 59°C as a standard temperature for the
annealing temperature during the PCR amplification procedure as it was
effective with each set of primers to generate a single band.
Products from these reactions were separated by 1.5% agarose gel
electrophoresis. Amplified DNA was extracted with a QIAquick® Gel Extraction
Kit (Quigen Incorporated, San Clarita, CA) and evaluated by restriction
endonuclease digestion analyses, DNA sequencing, and immunoblotting to
ensure the fidelity of the newly constructed primers. Each primer set was
confirmed to produce the predicted product. A replication of a portion of the
DNA sequencing gel and restriction endonuclease digestion gel for GalTase
products demonstrating the accuracy of the derived product is depicted in
Figure 3 -1.
Relative Quantification of mRNA Transcription Levels
RT-PCR reactions with primer sets for each developmental protein was
completed for each time point from fetal day 13 through adult. Simultaneously,

73
üe^ce
A A
T T
C C
A A
T T
T T
C C
A A
G G
A A
C C
G G
T T
C C
c c
c c
T T
C C
C C
A A
G G
A A
T T
G G
C C
c c
c c
A A
G G
G G
G G
T T
G G
A A
G G
T T
G G
T T
A A
A A
C C
T2\^
^cfes9°°Ó
c° ne^'
p&9e
Se°1'
«*?£ **<:<*«*
a,oV)
B
undigested GalTase Ava II digested
RT-PCR product GalTase products
673
575
98
Figure 3-1. Confirmation of GalTase RT-PCR Products. Panel A represents
a portion of the DNA sequencing gel obtained by polyacrylamide gel
electrophoresis of the gel extracted RT-PCR product from the GalTase
reaction confirming the GalTAse sequence as illustrated on page 32 of
this text. Panel B represents the agarose gel electrophoresis
separation of the restriction endonuclease digested product of the
GalTase RT-PCR product confirming the appropriate sized product for
GalTase.

74
RT-PCR amplification of G3PDH was accomplished in parallel with each
experiment for comparative analysis. RT-PCR reactions were repeated on 5
separate occasions. Polaroid photographs of the separated RT-PCR product
served as the raw data.
Quantification of mRNA expression was completed by scanning each
Polaroid photograph and digitizing the intensity of each amplicon with the NIH
Image v1.54 program.
An example of the calculation of the ratio of the GalTase / G3PDH
mRNA for the 13 day amplicon of Figure 3 - 2 follows. The polaroid
photograph (Figure 3 - 2 is a reproduction of same) of the gel electrophoresis
separated RT-PCR reaction product was scanned, and the intensity of the 13
day amplicon was digitized to provide densitometric data. The area of this
amplicon was determined to be 326 (Table 3-1) while the control amplicon
was determined to be 277 units. The area was then normalized by dividing
each area by the number of amino acid residues of their respective product
( 326 / 673 = 0.484 - for GalTase; 277 /983 = 0.282 - for G3PDH ). The ratio of
GalTase /G3PDH was then determined by dividing normalized GalTase by
normalized G3PDH ( 0.484 / 0.282 = 1.719 ) which gave a ratio of GalTase to
G3PDH per reaction. Conceivably this ratio could be extrapolated to a copy
number per cell based on the report by Bradhorst and McConkey of a mean
total RNA per mammalian cell of 26 pg (Bradhorst and McConkey, 1974) and
reported copies of G3PDH mRNA per cell. For the purposes of these
experiments however this was not necessary.

75
Figure 3 - 2. Gel Electrophoresis Separation of Gallase RT-PCR Products.
The gel electrophoresis separated products of the RT-PCR reaction
completed for GalTase are demonstrated here, in the upper panel,
Lane 1 represents the negative control lane (RT-PCR reaction run
without any sample RNA); Lanes 2 - 8 represent fetal days 13 - 18;
Lane 9 - was a positive control lane, RT-PCR reaction with liver RNA (a
rich source of GalTase).
The lower panel demonstrates amplicons from the control RT-
PCR reactions of the same tissues, at the same time points, for the
housekeeping gene G3PDH.

76
Column 1 2 3 4 5
Time
GT
GT / 673
G3PDH
G3/983
GT/G3
0 RNA
0.000
0.000
0.000
0.000
0.000
13 d
326.000
0.484
277.000
0.282
1./19
14 d
398.000
0.591
315.000
0.320
1.845
15 d
432.000
0.642
302.000
0.307
2.089 -
16 d
734.000
1.091
329.000
0.335
3.259
17 d
569.000
0.845
359.000
0.365
2.315
18 d
509.000
0.756
374.000
0.380
1.998
NN
740.000
1.100
319.000
0.325
3.388
Liver RNA
756.000
1.123
281.000
0.286
3.930
Table 3-1. Calculation of Semi-Quantitative GalTase Expression. This table
represents the data and calculation of normalized amplicon intensity of
the RT-PCR reaction depicted in Figure 3-1. Time points evaluated
are fetal days 13-18 and neonate animals (NN). As previously stated
no mRNA (0 mRNA) served as the negative control and liver tissue was
used for the positive control. The area of each amplicon is seen
(Column 1 and 3), normalized for their respective amino acid length
(Column 2 and 4) then a ratio generated for GalTase / G3PDH per
reaction and time point (Column 5).

77
As previously stated, these experiments were repeated on 5 separate
occasions, and these ratios from each time point, for each mRNA were
averaged. Figures 3 - 3 through 3-10 represent the averaged results of the 5
data sets for each of the developmental protein mRNA evaluated. Each panel
consist of a negative control lane (1), where no mRNA was used in the RT-
PCR reaction, as well as a positive control lane (9), utilizing adult mouse liver
mRNA. Lanes 2 - 8 represent the results from RT-PCR reactions with mRNA
from fetal days 13-18, and neonate, respectively.
Examination of the mRNA data presented in the previous figures
demonstrated an overall trend of increased salivary protein mRNA
transcription, relative to G3PDH, over the developmental time periods
evaluated. Additionally, when considering the prenatal development days
only (fetal day 13, 14, 15, 16, 17, and 18) 7 of 8 proteins demonstrated a
expression peak at fetal day 16. Contradictory, only amylase expression
demonstrated a peak at fetal day 18. While most of these salivary proteins did
demonstrate a peak at fetal day 16 only GalTase and mucin demonstrated a
degree of statistical significance (P < 0.05).
Proteins associated with ductal tissues (EGF and NGF) appeared to
have a consistent expression pattern throughout development while those
proteins associated with acinar cell terminal differentiation (amylase, cystatin,
lysozyme and mucin) appeared to show a trend of increased expression as
the tissues matured. GalTase expression followed the general pattern of
increasing expression with tissue maturity.

78
Time
â–¡ AMY/G3PDH(1)
O AMY/G3PDH(2)
O AMY/G3PDH0)
A AMY/G3PDH(4)
Si AMY/G3PDH(5)
11 Mean
Figure 3 - 3. Developmental Expression of Amylase mRNA. This graph
represents the amount of amylase mRNA produced relative to G3PDH.
Lane 1 is a negative control (RT-PCR reaction using no mRNA) while
Lane 9 is a positive control (RT-PCR reaction using adult mouse liver
mRNA). Each graph represents the average of 5 separate experiments
and the bars represent the mean for each time point (fetal days 13 - 18,
neonate [NN]).
During the fetal days there is minimal transcription of the
amylase gene. There is a 230% increase in transcription from fetal to
neonate time periods. This data corroborates previous reports that
amylase production parallels PSP (Poulsen etal., 1986).

79
â–¡
CYS/G3PDH(1)
o
CYS/G3PDH(2)
o
CYS/G3PDH(3)
A
CYS/G3PDH(4)
m
CYS/G3PDH(5)
Ü
Mean
Time
Figure 3 - 4. Developmental Expression of Cystatln mRNA. Cystatin mRNA
transcription rates, relative to G3PDH, in general are very low although
there is a 214% increase from the neonatal stage to adult. Previous
investigators had found a temporal expression pattern during
development (Cox and Shaw, 1992). Fetal transcription rates
demonstrate a peak, albeit small, at day 16.

80
Time
â–¡ EGF/G3PDH(1)
O EGF/G3PDH(2)
O EGF/G3PDH(3)
A EGF/G3PDH(4)
83 EGF/G3PDH(5)
WM Mean
Figure 3 - 5. Developmental Expression of EGF mRNA. Previous
investigators had reported EGF-R protein at neonate day 10, EGF at
neonate day 18-20 (Salido et al., 1990), and EGF transcription in
uterao (Kashimata and Gresik, 1997; Gresik et al., 1997). This report
corroborates these findings. EGF mRNA, relative to G3PDH,
represented the greatest overall transcription rate of all the proteins
evaluated in this report. In general, EGF transcription rates paralleled
those of NGF, another ductal product. Transcription in fetal days was
almost 2 fold higher than the average of al! the other proteins and also
reached an in útero peak at fetal day 16.

81
Time
â–¡
GT/G3PDH(1)
o
GT/G3PDH(2)
o
GT/G3PDH(3)
A
GT/G3PDH(4)
m
GT/G3PDH(5)
n
Mean
Figure 3 - 6. Developmental Expression of GalTase mRNA. GalTase mRNA
transcription during fetal development tends to parallel those of ductal
cell products, EGF and NGF, suggesting a role for GalTase during
branching morphogenesis. A fetal GalTase mRNA transcription peak
occurs at day 16, and there is small increase in transcription rates after
birth.

82
Time
â–¡
LYS/G3PDH(1)
o
LYS/G3PDH(2)
o
LYS/G3PDH(3)
A
LYS/G3PDH(4)
eh
LYS/G3PDH(5)
Ü
Mean
Figure 3 - 7. Developmental Expression of Lysozyme mRNA. Lysozyme
mRNA transcription, relative to G3PDH, was generally very low
throughout fetal development. The finding of fetal lysozyme mRNA
transcription confirms previous reports by Maga etal. (1994). After birth
the transcription rates increased significantly when compared to early
stages of development (p < 0.01).

83
Time
â–¡ MUC/G3PDH(1)
O MUC/G3PDH(2)
O MUC/G3PDH(3)
A MUC/G3PDH(4)
B MUC/G3PDH(5)
Mean
Figure 3 - 8. Developmental Expression of Mucin mRNA. Mucin is a terminal
product of the well differentiated mucinous submandibular gland. Low
transcription levels of mucin mRNA, compared to G3PDH, are seen
during the fetal stage with significant increases found in the neonate
compared to fetal day 18 (p < 0.05). Mucin mRNA was first detected at
fetal day 15 which confirms reports of fetal mucin mRNA detection
(Jaskol etal., 1994).

84
â–¡ NGF/G3PDHQ)
O NGF/G3PDH(2)
O NGF/G3PDH(3)
A NGF/G3PDH(4)
cS NGF/G3PDH(5)
Uli Mean
Figure 3 - 9. Developmental Expression of NGF mRNA. NGF, like EGF, is a
product of the salivary granular convoluted duct cells (Gresik et al.,
1985), and parallels EGF transcription as previously reported (Wilson et
al., 1986), but lower at each time point. NGF transcription rates were
generally elevated compared to terminal product transcripts (AMY,
MUC, LYS) which appears to follow the general developmental
scheme where nervous systems coupling follows morphogenesis and
cytodifferentiation (Cutler, 1973). NGF and EGF are anticipated to
decrease in adult ages (Gresik and Azmitia, 1980). NGF transcription
was the most constant of all the proteins evaluated.
io-
QC
E
x
a
a.
co
O
<
z
X
E
LL
0
z
9-
8-
7
6-
5-
4-
3-
2-
1 -
o-Kp-
<
<
<
C
<
<
<
z
Z
z
z
Z
Z
z
QC
C4
QC
QC
PC
PC
£4
s
S
s
£
£
£
E
â– a
cn
-a
on
T3
r-
T3
CO
T3
2;
r-H
r~*
1—1
1-4
Z
Time

85
Time
â–¡
PSP/G3PDH(1)
o
PSP/G3PDH(2)
o
PSP/G3PDH(3)
A
PSP/G3PDH(4)
m
PSP/G3PDH(5)
Ü
Mean
Figure 3-10. Developmental Expression of PSP mRNA. Initial reports
indicated that PSP was found in the parotid gland only (Madsen and
Hjorfh, 1985; Shaw et al., 1986; Shaw and Schibler, 1986). Recently
investigators, using PSP specific antisera in Western blot analyses,
localized PSP in the submandibular glands of neonate mice as well
(Miréis et al., 1998). In our analysis no PSP mRNA transcription was
detected in fetal gland tissues until fetal day 16 and only minute
amounts were found until the neonate stages and beyond.

86
Cell-surface GalTase Enzymatic Activity Profile
To evaluate cell-surface expression and activity of the protein we
employed the GalTase enzymatic activity assay. Tissues were collected from
each time point, 100,000 cells isolated and cell-surface GalTase activity
evaluated on 3 separate occasions. Mean GalTase activity for the 3
experiments, was reported as nanomoles galactose incorporated / h / 106
cells. The lactate dehydrogenase (LDH) activity assay was performed
simultaneously to determine leakage of cytoplasmic constituents. LDH activity
was never > 5% of the LDH activity of the control lysed cells and was not
considered significant. The results of the GalTase activity are reported in
Table 3 - 2. Generally the cell-surface activity of GalTase seems to parallel
the mRNA expression pattern seen during development. Again there was a
peak at fetal day 16 although it does not appear as pronounced as the mRNA
pattern and was not statistically significant (p < 0.05).
Histologic and Immunohistochemical Analysis
Hematoxilin and eosin staining of representative fetal developmental
days 13 and 17 demonstrate a general increase in architecture and
organization (Figure 3-11). The fetal day 13 section demonstrated a few
localized islands of acinar cells at the leading edges of glandular
development and a few, but well developed, ductal structures throughout. By
fetal day 17 the acinar cells have greatly proliferated and the glandular
structure is a well defined network.

87
Cell-Surface GalTase Activity
Time Enzymatic Activity
(fetal days) (nm Galactose incorporated /100,000 cells / hour)
13d
0.0008 ±
0.0006
14 d
0.0013 ±
0.0004
15 d
0.0011 ±
0.0002
16 d
0.0017 *
0.0002
17 d
0.0015 ±
0.0005
18 d
0.0015 ±
0.0003
Neonate
0.0025 ±
0.0010
Adult
0.0040 ±
0.0006
Table 3 - 2. Cell-surface GalTase Activity. The cell-surface activity was
measured from 100,00 intact acinar cells from fetal day 13 - 18,
neonate, and adult mouse submandibular tissues. The numeric values
represent the amount of UDP-[14C]-galactose incorporated / 100,000
acinar cells/ hour ± standard deviation.

88
primordial acinar cells
mesenchymal capsule
primordial salivary duct
organized system of
salivary gland ducts
well defined acinar
cell clusters
Figure 3-11. Histologic Evaluation of Normal Development. Hematoxilin and
eosin staining of representative fetal developmental days 13 and 17.
Fetal day 13 section demonstrates few isolated immature acinar cell
islands throughout the fetal gland and few, well defined ductal
structures. By fetal day 17 the acinar cells have proliferated and the
ductal structures have developed a organized network.

89
Immunohistochemistry was performed to evaluate the expression
pattern of GalTase in developing fetal submandibular glands. Figure 3-12
demonstrates a general increase in GalTase through the increasing stages of
the submandibular gland development. On fetal day 13 there is little or no
staining of the acinar cells in the developing salivary gland bud. Some
nonspecific staining of the mesenchymal capsule does appear. At fetal day
14 some im mi uno reactive sites within the acinar cell clusters begin to appear
with staining from the monoclonal anti-GalTase antibody. The immuno-
reactive intensity of the acinar clusters increases, as does the overall
immunohistochemical staining, with the maturation of the tissue from days 15
and 16. During the later stages of fetal gland maturation (fetal days 17 and
18) immunoreactive GalTase was most strongly associated with, and most
concentrated in, the acinar cell clusters although it was also generally present
throughout the glandular structure. Control tissues which were treated with
nonimmune serum, antibody isotype, and secondary antibody alone were
routinely without immunoreactive staining.
Flow Cytometric Evaluation of Cell-surface GalTase During Development
Flow cytometry of 10,000 fetal mouse salivary gland acinar cells per
event was also utilized to evaluate alterations in cell-surface GalTase
expression from representative fetal developmental days 13 and 17. Figure 3
- 13 provides evidence of increased cell-surface GalTase expression from
developing fetal tissues from fetal day 13 to 17. Flow cytometry studies

90
Figure 3-12. Immunohistochemical Analysis of GalTase Expression. This
panel represents the immunohistochemical staining of fetal mouse
submandibular glands with mouse anti-human GalTase monoclonal
antibody. There is evidence of a general increased immunoreactivity of
the tissues from fetal day 13 to 18.

91
Figure 3-13. Flow Cytometric Evaluation of Cell-Surface GalTase. Flow
cytometry was performed on 10,000 intact fetal acinar cells per event.
The peak represented by A is from cells (part of the 10,000) that were
not labelled. Peak B represents the cells that were bound by the
nonimmune serum of normal mice, while peak C is the cells that were
labelled with the monoclonal anti-GalTase IgG antibody. Increased
FITC fluorescence of anti-GalTase antibody labelled cells is seen from
fetal day 13 to 17 as evidenced by the shift in the labeled acinar cells
(note the line indicating the number of labelled GalTase cells)
corroborating cell surface enzymatic activity resuits.

92
utilized control samples with primary antibody only, nonimmune serum ±
primary and secondary antibodies, IgG isotype class control ± primary and
secondary antibodies, and secondary antibody alone. Adult liver cells were
also harvested to serve as positive controls.
Evaluation of Organ Culture (in vitro) Experiments
The mouse organ culture system was used to evaluate the role of
GalTase in fetal mouse submandibular gland development. Each 13d fetal
mouse submandibular gland was asepetically harvested and cultured
separately in laminin coated wells with media at 37°C for 60 hours. Evaluation
of GalTase’s role in development was determined by additions of substrates
(a-lactalbumin, anti-GalTase antibody, anti-laminin antibody, and tyrphostin)
to the media, and pretreatment of laminin coated wells with bovine GalTase.
The media alone and addition of sterile 1X PBS served as controls. Five
glands were evaluated with each condition and each experiment was
reproduced on 3 separate occasions. Fifteen additional glands were cultured
similarly but on plastic wells without laminin coating.
Control in vitro Development of Fetal Submandibular Glands.
in vitro development of 13d fetal mouse submandibular glands, grown
in culture on laminin-coated plates, for 60 hours appear to mimic normal
branching morphogenesis and proliferation as previously observed for in vivo

93
development (Nakaniski and Ishii, 1989). There was a morphologic burst after
36 hours In culture for 12 of 15 glands (80%) (p< 0.05), where the developing
gland demonstrated structural branching with terminal acinar cells that
appeared full and rounded in familiar grape-like clusters (Figure 3-14). The
expression of mRNA levels from each developmental marker that represented
terminal acinar cell differentiation (amylase, mucin, lysozyme, and PSP -
Figure 3-15) demonstrated levels that were lower than the products of the
ductal cells (EGF, NGF, and cystatin - Figure 3 - 16). GalTase mRNA
expression followed the pattern of developmental proteins associated ductal
cells and reached peak levels at 36 hours in media alone with an amplicon
intensity ratio of 6.395 ±0.17 units for GalTase when compared to G3PDH
mRNA (Figures 3-18, panel A). The cell-surface GalTase activity, as
measured by a standard enzyme assay, demonstrated a peak activity level of
0.0017 ± 0.0002 nM gal incorporated/100,000 cells/hour at the 36 hour time
point in culture (Table 3 - 3, row 1). There was a dramatic increase in cell-
surface enzymatic activity seen at the 36 hour time point compared to activity
at 12 or 24 hour (p < 0.01). Between 36 and 60 hours in culture the levels of
GalTase mRNA and protein remained constant. Organs cultured with the
addition of 1X PBS paralleled these results for all parameters.
In contrast, all (15/15 [100%]) fetal organ cultures grown on plastic
resulted in glands that failed to demonstrate normal branching morphogenesis
and acinar cell proliferation (Figure 3-17, panel B). Branching

94
Figure 3-14. Representative Photomicrographs of Fetal Mouse
Submandibular Gland Grown in in vitro Organ Culture for 0 - 60 Hours.
Fetal day 13 (CD1) submandibular gland cultured on a laminin coated
well with BGJb media. Submandibular organ demonstrates normal
branching morphogenesis.

AMY mRNA / G3PDH mRNA
95
Figure 3-15. Expression of 0 - 60 hour mRNA Levels of Markers of Terminal
Acinar Cell Differentiation. Each panel represents the ratio of each
selected marker’s mRNA to G3PDH mRNA ratio, obtained over the 0 -
60 hour culture period, in media without blocking agents, of 3 separate
experiments. Individual data points are shown (â–¡, 0, 0) while the
shaded columns are the mean from each time point. Column 1
represents the negative control results (0 mRNA) while column 8
represents the positive control results (adult mRNA). Panels A, B, C,
and D represent amylase (AMY), mucin (MUC), lysozyme (LYS), and
partoid secretory product (PSP) respectively. Generally low levels of
each of these products was found in útero confirming previous reports
of acinar cell differentiation after birth.

CYS mRNA / G3PDH mRNA EGF mRNA / G3PDH mRNA
96
H
Time
9 -
Figure 3-16. Expression of 0 - 60 hour mRNA Levels of Developmental
Markers of Ductal Cell Differentiation. Panels E - H represent averaged
mRNA to G3PDH levels of ductal cell differentiation markers. Again
individual data points are shown (â–¡, 0, 0) while the shaded columns
are the mean from each time point. Panels E, F, G, and H represent
EGF, NGF, cystatin (CYS) and GalTase (GT) respectively. Each of the
ductal cell products were greater than any of the acinar cell products at
every time point. Both groups of in vitro mRNA expression patterns
(ductal as well as acinar cell markers) seem to mimic the in vivo
developmental pattern.

97
48 h 60 h
24 h 36 h
Figure 3-17. Photomicrographs of Representative Fetal Mouse
Submandibular Gland 0 - 60 Hour Organ Culture. Fetal day 13 (CD1)
submandibular glands were cultured in laminin coated wells with BGJb
media for 0 - 60 hours. Additions to the media included; nothing (panel
A); grown on plastic with no addition to the media (panel B); addition of
a-lactalbumin (panel C); anti-GalTase antibody (panel D); anti-laminin
antibody (panel E); and pre-treatment of the well with bovine
gal actosylt ransf erase (panel F).

98
JS -3 .3 JS ^
° a s s $ §
Time
Time
Time
Figure 3-18. Relative Quantification of in vitro mRNA Expression. Panel A
represents relative quantification of in vitro levels of GalTase mRNA
expression from organs cultured on laminin coated wells with media
alone. Panel B represents relative mRNA levels from organs cultured
on plastic with no addition to the media. Panel C - F represent relative
mRNA levels obtained from organs cultured on laminin with additions to
the media of: a-lactalbumin (panel C); anti-GalTase antibody (panel D);
anti-laminin antibody (panel E); and pre-treatment of the well with
bovine galactosyltransferase (panel F). Tissues were harvested and
RT-PCR evaluation of GalTase mRNA completed for each time point.
All values are expressed as GalTase densitrometric value to G3PDH
densitrometric value and the bars represent the range in values.

99
(o-ijr • •:
map
mm- fiSc
0
(Control)
0.0011
± 0.0001
0.0012
± 0.0002
0.0013
± 0.0001
0.0017
± 0.0002
0.0014
± 0.0007
0.0015
± 0.0007
0
|f; (Plastic)
0.0013
± 0.0004
0.0016
± 0.0002
0.0013
± 0.0001
0.0022
± 0.0003
0.0016
± 0.0003
0.0016
± 0.0002
a-!act
0.0003
± 0.0001
0.0002
± 0.0001
0.0002
± 0.0001
0.0002
± 0.0001
0.0003
± 0.0001
0.0003
± 0.0001
anti-
GalTase
0.0005
± 0.0001
0.0005
± 0.0001
0.0005
± 0.0001
0.0005
± 0.0001
0.0006
± 0.0001
0.0006
± 0.0001
anti-
laminin
0.0009
± 0.0002
0.0013
± 0.0001
0.0012
± 0.0002
0.0021
± 0.0003
0.0020
± 0.0003
0.0013
± 0.0003
pre¬
treatment
0.0010
± 0.0001
0.0014
± 0.0006
0.0010
± 0.0001
0.0012
± 0.0001
0.0013
± 0.0003
0.0015
± 0.0001
Table 3 - 3. Cell-surface GalTase Activity of in vitro Organ Cultures. Cell-
surface GalTase activity (expressed as mean of nM gal
incorporated/100,000 cells/hour ± SD for 3 separate experimental
results), from tissues harvested after culturing in laminin wells (except
row 2) with the following additions to the media: media alone (row 1);
grown on plastic with no addition to the media (row 2); addition of a-
lactalbumin (row 3); anti-GalTase antibody (row 4); anti-laminin
antibody (row 5); and pre-treatment of the well with bovine
galactosyltransferase (row 6).

100
morphogenesis of the gland was less fully developed and the terminal acinar
cells were smaller and more compact in appearance. Careful review of the
photomicrographs demonstrated very condensed yet organized terminal
acinar cell clusters. GalTase mRNA expression levels were not significantly
altered relative to time (p > 0.05) but were greater than control levels grown on
laminin at all times except the initial phases (0 and 12 hour) (Table 3-17,
panel B). The cell-surface protein activity at 36 hour was increased 130%
when compared to glands grown on laminin (Table 3 - 3, row 2).
Experimental in vitro Development of Fetal Submandibular Glands
To determine the role of cell-surface GalTase in mediating the early
morphogenic events in fetal salivary gland development, the effects of a
modifier of substrate specificity (a-lactalbumin) or inhibitor of GalTase activity
(anti-GalTase antibody) were evaluated. Organ cultures treated with these
agents, to primarily limit the potential cell-cell interactions, but also potential
cell-matrix interactions, appeared to lack an overall adhesiveness and
organization (14/15 [93%] - a-lactalbumin; 12/15 [80%] - anti-GalTase
antibody) in the developing tissue (Figure 3-17, panels C and D
respectively). Although the glands appear to have retained the ability to
spread, and demonstrated a similar degree of branching when grown on
laminin coated plates, there were fewer, less cohesive, terminal acinar cell
clusters. Those present lacked a clearly defined grape-like cluster

101
Figure 3-19. Representative Photomicrograph of Results After 36 Hours in
Organ Culture With Addition of Anti-GalTase Antibody. Enhanced
inspection of the 13d fetal submandibular gland cultured in media +
anti-GalTase antibody, illustrated above at the 36 hour in vitro
morphologic peak, demonstrated dysfunctional development
representing poor cell-cell adhesiveness and diminished cell-matrix
attachment.

102
morphology (Figures - 19). Addition of a-lactalbumin and anti-GalTase
antibody to the media resulted in only minimal alteration of mRNA expression
levels over the 60 hour experimentation period, yet cell-surface enzymatic
activity was significantly diminished suggesting that the concentration of these
agents was adequately specific for GalTase binding. Additions of a-
lactalbumin and anti-GalTase antibody to culture media resulted in reduced
cell-surface GalTase activity levels of 89.6% and 71.0% (p < 0.01) respectively
at the 36 hour morphologic peak. The mean cell-surface GalTase enzymatic
activity over the 60 hour culture period was reduced by 81.3% and 60.3%
(p < 0.01) following a-lactalbumin and anti-GalTase antibody treatment,
respectively (Table 3 - 3, rows 3 and 4).
The addition of anti-laminin antibody to reduce the cell-matrix
interaction, resulted in a similar growth pattern as that seen with the organ
cultures grown on plastic (Figure 3 -17, panel E). The entire organ appeared
condensed (15/15 [100%]) although branching did occur. The terminal acinar
cell clusters developed with the same frequency as controls, yet were
significantly smaller in size. Again, GalTase mRNA expression levels were not
altered significantly by the addition of anti-laminin antibody, nor did it have a
significant effect on the cell-surface GalTase activity levels when compared to
controls (Table 3 - 3, row 5).
To evaluate the direct interaction of GalTase with laminin, in glandular
morphogenesis, the terminal oligosaccharide moieties of laminin were

103
modified so as to present a non-interactive substrate with the cell-surface
GalTase active site. The pretreatment of the laminin coated wells with bovine
GalTase and UDP-gal was performed to eliminate cell-surface GalTase
substrate of terminal GIcNAc residues of laminin (Shur and Eckstein, 1977).
Reducing the potential interaction between the cell-surface GalTase of the
organ culture and GIcNAc residues of laminin resulted in submandibular
glands that appeared morphologically similar to those grown in the absence
of laminin (plastic wells or anti-laminin antibody treated wells) (Figure 3-17,
panel F). These organ cultures demonstrated acinar cell proliferation similar
to those of organs grown on plastic (Figure 3-18, panel F). GalTase mRNA
expression levels were generally greater, though not significantly (p > 0.05),
than normal cultures on laminin, after the early stages (0, 12 or 24 hour) of in
vitro culture. Cell-surface GalTase enzymatic activity was also similar to those
of controls grown on laminin (Table 3 - 3, row 6).
Tyrphostin-1 was added to the media to further evaluate the potential
activation of the receptor tyrosine kinases by cell-surface receptors with the
ECM. Glands cultured in the presence of tyrphostin, the specific tyrosine
phosphate inhibitor, demonstrated morphologic development similar to the
result of glands cultured with anti-GalTase antibody or a-lactalbumin (Figure 3
- 20). Generally the organs cultured in media with tyrphostin-1 demonstrated
diminished acinar cell adhesiveness and proliferation as well as diminished
branching in 10 of 15 glands cultured (66%) (p<0.05).

104
Figure 3 - 20. Photomicrographs oí Representative 0 - 60 Hour Tyrphostin
Organ Culture. Organ culture results of 13d fetal submandibular gland
cultured in media + tyrphostin-1 (1:50) over the 60 hour period.
Development of the organ in media that specifically inhibits tyrosine
kinase signal transduction clearly demonstrates decreased acinar cell
proliferation and branching morphogenesis.

CHAPTER FOUR
DISCUSSION
Development of the murine salivary gland is a coordinated temporo-
spatial process that involves acinar cell proliferation as well as branching
morphogenesis (Cutler, 1989). This process is thought to include interaction
of components of the extracellular matrix contained within the surrounding
mesenchymal capsule, specifically laminin, and the budding epithelial salivary
gland organ (Borghese, 1950; Grobstein, 1953a; Oliver, etal., 1987).
Previous researchers in our laboratory have provided information
regarding the expression of some of the proteins of the mesenchymal
component during development (Macauley et at., 1997). Several of the
mesenchymal ECM protein molecules demonstrated a maximal expression at
fetal day 16 in mice including collagen a2(1), collagen a2(lll) and iysyl
oxidase, which initiates the enzymatic crosslinking of both collagen and
elastin in the ECM (Kagan, 1986). MMPs are also required to degrade the
basement membrane to allow invagination during the budding of the salivary
gland organ embryologically (Nakanishi etal., 1986).
This manuscript provides the first detailed description of salivary protein
mRNA expression during fetal submandibular gland development. Reports
from other researchers have provided glimpses at the developmental profile
105

106
of the murine salivary gland and corroboration of their contributions was
recognized in the Results section of this dissertation for each protein of
interest.
The salivary gland proteins selected for this report provided a diverse
group of developmental markers designed to evaluate specific tissue types.
Clearly the ductal cell transcription rates for their specific products (EGF, NGF)
represented the greatest levels throughout fetal development with the
concomitantly smallest increase after birth. The transcription rates of the
proteinacous products derived from terminally differentiated acinar secretory
cells (AMY, CYS, LYS, MUC, PSP) was very low, if present at all, during the
early stages of fetal gland development, and increased significantly during the
final stages of fetal development and after birth. Cytodifferentiation, or
evolution of specialized salivary-specific protein synthesis of muc-1 mucin and
amylase, occurs as a final stage of development, only after the salivary gland
morphogenesis is established. In the mouse, cytodifferentiation occurs late in
fetal development around fetal day 18 (Poulsen et al., 1986). Our results
confirm these reports with a maximal expression of amylase and mucin
occurring after birth in the adult mouse.
Expression levels of the experimental protein GalTase appeared to
gradually increase its transcription, as well as cell-surface activity level during
development, with a small peak in both at gestational day 16. This gestational
peak, at fetal day 16, was a general pattern, found in 7 of the 8 proteins
evaluated and corresponds with a fetal peak expression for GTA-Kinase and

107
laminin B1 and B2 chain mRNA (Macauley et al., 1997). Certainly this
demonstrates a well coordinated expression pattern of a variety of different
transcripts
Phosphorylation, and the emergence of cell-surface GalTase, is
governed by GTA-K, which appears to have some sequence homology with
the cell-cycle kinase, cdc2 (Bunnell et al., 1990; Kerr et al., 1994). Also the
mesenchymal component, at fetal day 16, is producing maximal levels of
newly synthesized laminin, with which GalTase is known to interact. The
lumenal binding of the receptor GalTase domain to laminin is accompanied by
cytoplasmic association of the catalytic domain with the cytoskeletal element
actin, as demonstrated by Eckstein and Shur, with a series of double-staining
immunofluorescent studies with anti-GalTase antiserum and phalloidin in
Balb/c 3T3 fibroblast (Eckstein and Shur, 1992). Stabilization of the cell to the
ECM, via GalTase-laminin binding in a lectin like fashion, and increased
rigidity of the cytoskeletal structure, via GalTase-actin associations, provides
an environment that may maximize the transcription potential for numerous
other proteins as well. Thus a model is emerging where GalTase, through its
biochemical interactions with carbohydrate moieties extracellularly, and its
associations with actin intracellularly, is a mediator of cell cycle regulation.
The concordance of salivary gland developmental marker protein mRNA
expression presented here, and the corroborating cell-surface enzymatic
activity, histologic, immuno-histochemical, and flow cytometric data, is in
agreement with this suggested model.

108
To further investigate the interaction of GalTase with the ECM, an organ
culture system was employed. Removal of the primordial salivary gland tissue
including the acinar cell rudiments from the developing 13 day fetal mouse,
and growing them under in vitro culture conditions on laminin coated plates for
60 hours, resulted in development that mimicked normal in vivo acinar cell
proliferation as well as branching morphogenesis. Evaluation of the GalTase
mRNA transcription profile revealed a similar expression pattern as seen in
vivo. A peak in mRNA expression and gland growth occurred at 36 hours in
culture, similar to the peak seen at fetal day 16. Thus morphologically and
transcriptionally this organ system functioned adequately, relative to the
parameters that we evaluated. The in vitro development and mRNA
expression is not an exact replication of in vivo development, as a fetal 13 day
gland cultured for 48 hours is delayed developmental^ when compared to the
in vivo 15 day (13 day + 48 hours = 15 days) gland which again suggest the
necessity of the entire system, and especially the mesenchymal interaction, for
maximal development.
Developing 13 day fetal mouse salivary organs were also cultured on
noncoated plastic plates for 60 hours. Culturing on plastic plates prevented
the normal attachment and development of the salivary tissue. We found that
organs cultured on plastic wells, but otherwise identical conditions, resulted in
glands with less fully developed branching morphogenesis and smaller,
condensed, yet histologically organized terminal acinar cells, while GalTase
mRNA expression levels and cell-surface enzymatic activity were greater than

109
controls grown on laminin (except the initial phases 0 and 12 hours), though
not significantly (p > 0.05). A possible explanation for this scenario is that the
cell is actively seeking appropriate substrate. Under ideal conditions of
substrate availability, optimal pH, and adequate space cells migrate and
proliferate, as seen in our control cultures. Cell-surface GalTase has been
previously shown to be involved in cell migration due to its interaction with
components of the ECM (Shur, 1977). The ability of GalTase to function as a
receptor for GIcNAc residues of glycoprotein components of the ECM have
clearly established that GalTase can influence migration of a wide variety of
cells (Eckstein and Shur, 1989). Shur and co-workers have demonstrated that
migrating ceils have an increased expression of cell-surface GalTase.
Furthermore, cell migration and differentiation was dependent on the
interaction of GalTase with substrate oligosaccharide moieties of the ECM
glycoprotein, laminin. Observations of cell migration on alternative ECM
component surfaces such as fibronectin demonstrated that cell failed to
migrate (Runyan et al., 1988). Laminin is the only ECM component that
demonstrates terminal, or apparently available, GIcNAc moieties (Shur, 1991).
When organs were cultured on plastic we had established conditions for the
fetal rudiments that supplied everything except substrate surfaces upon which
cells could spread or migrate. Organs cultured on plastic initially resemble
that of controls grown on laminin (0 and 12 hours). However, failure of the
cell-surface GalTase receptor to detect and bind to carbohydrate moieties of
laminin in the ECM ultimately allowed for increased availability of receptors for

110
the oligosaccharides found on adjacent cell-surfaces, as the alternate
substrate. This may ultimately lead to increased cell-cell interaction which
ultimately may have resulted in the condensed, compact, organ development
that was seen.
When the salivary gland rudiments were prevented from interaction with
laminin by the inclusion of anti-laminin antibody or pre-galactosylation of the
laminin coated well, acinar cell proliferation continued but branching
morphogenesis was significantly diminished indicating the requirement of cell-
matrix interaction for normal gland development. On the other hand, inclusion
of GalTase substrate modifier, a-lactalbumin, or anti-GalTase antibody,
resulted in some diminution of branching morphogenesis but more
pronounced inhibition and organization of acinar cell clusters, demonstrating
GaiTase’s role in both cell-cell as well as cell-matrix interactions.
A second mechanism by which cell-surface GalTase could influence
tissue morphogenesis is through regulation of cell proliferation. It has been
demonstrated that cell-surface GalTase, when juxtaposed to the epidermal
growth factor receptor (EGF-R), can induce activation of cellular proliferation
via receptor tyrosine kinase mediated propagation of phosphotyrosine second
messenger signal transduction pathways (for review see Purushotham et al.,
1995). In vitro and in vivo inhibition of acinar cell proliferation can be
accomplished through the administration of the modifier protein a-lactalbumin
or GalTase antibody, in conjunction with isoproterenol (ISO) treatment

111
(Humphreys-Beher et al., 1987, Marchase et al., 1988). A recent report by
Broverman et al. (1998) has indicated that ISO treatment mediated gland
hypertrophy may, in part, be related to cell-surface GalTase interaction with
ECM laminin. Therefore, the observation of reduced acinar cell development
and proliferation in the presence of a-lactalbumin and anti-GalTase antibody,
suggest that cell-surface GalTase may be present on cells of the developing
fetal submandibular tissue.
The accelerated fetal salivary gland morphogenesis taking place
between 36 - 60 hr in vitro correlates with a dramatic increase in the in vitro
expression of GalTase mRNA and cell-surface GalTase enzymatic activity.
The disruption of GalTase interactions with laminin appear to influence the
rate of branching morphogenesis while disruption of the potential GalTase
interaction with the other cell-surface signalling molecules disrupts acinar cell
proliferation. Thus, cell-surface GalTase may also participate in the regulation
of branching morphogenesis as well as acinar cell proliferation.
In the adult salivary gland, proliferation appears to be mediated by
interaction of cell-surface GalTase with the carbohydrate moieties of the EGF-
R brings about activation of the tyrosine kinase phosphorylation cascade
which results in cell division and proliferation (Purushotham et al., 1995).
Fetal glands cultured in the tyrosine signal transduction inhibitor, tyrphostin,
which specifically perturbs the EGF-R signal transduction event, results in
organ cultures again demonstrating a significant alteration in normal
morphologic development, suggesting GalTase signal transduction may occur

112
through interaction with the EGF-R. Cumulatively these observations suggest
that cell-surface GalTase is an important mediator of mouse salivary gland
fetal development through cell-ECM and cell-cell interactions. Furthermore,
blocking cell-surface GalTase activity inhibits salivary gland morphogenesis,
implicating GalTase as a component of a receptor-mediated signal
transduction pathway required for normal murine salivary gland
morphodifferentiation. In summary, these studies have shown that cell-surface
GalTase is critically involved in normal murine submandibular gland
branching morphogenesis and that this salivary gland organ culture system is
a viable mechanism to evaluate developmental processes. Additionally, this
study demonstrated that there is a peak in cell-surface GalTase mRNA
expression, as well as enzymatic activity, at fetal day 16. This corresponds
with the fetal peak expression of GTA-K, required for GalTase activation.
Perhaps most importantly this research confirms previous reports that cell-
surface GalTase activates RTK signal transduction mediated events for growth
and development.
The intricacy of the interactions involved in cell migration and
proliferation is perplexing however, in light of other factors which may be
found in the extracellular matrix receptor, such as the integrins. We know
today that cell-surface GalTase is not involved in the initial attachment of the
cell to the ECM, but rather this activity is mediated by cell adhesion molecules
and integrins. Yao et al. found that the binding of specific laminin isoforms
was mediated by different integrins suggesting that different integrins have

113
different affinities for ECM (Yao et al., 1996). The integrins may mediate the
binding, however, there may be sufficient lapses in attraction for binding as a
result of variable affinities of integrin:ECM isoforms. This may allow Gallase
mediated binding to participate in this process.
The initial binding of integrins to the laminin components of the ECM
ultimately results in formation of cytoplasmic complexes that can then bind
cytoskeletal actin filaments (Lafrenie and Yamada, 1996). It has been
proposed that this cytoskeletal stability allows for activation of EGF-R
cytoplasmic domains (Mainiero et al., 1996). It has been shown that integrin
binding to ECM ligand laminin results in cytoplasmic tyrosine kinase activity
following the general MAPK pathways of growth factor signal transduction.
Considering the heretofore mentioned studies, in concert with the information
of morphogenesis and mRNA expression gathered in these experiments I
suggest the following original model of interaction leading to cell migration
and proliferation (Figure 4 -1; repeated from page 23).
The initial adhesion of cells to matrix is mediated by the binding of
integrin receptors to laminin as described by Runyan and co-workers (Runyan
etal., 1988). As a result of this initial binding of integrin to laminin, cytoplasmic
complexes bind cytoskeletal actin filaments providing an increased
cytoskeletal stability that may allow for increased GalTase transcription and
translation. Accordingly Eckstein and Shur have demonstrated a 3 fold
increase in cell-surface GalTase on cells that were grown on laminin (Eckstein
and Shur, 1989). Thus, there is a concomitant increase in the likelihood that

114
GalTase:EGF-R association will also occur. Simultaneously, the GalTase
cytoplasmic domain experiences greater association of GalTase with the actin
cytoskeletal element, as shown by the colocalization of GalTase with the
cytoskeletal element actin (Eckstein and Shur, 1992; Appendu and Shur,
1994). Using a molecular strategy to produce a dominant negative mutation, a
cell-surface GalTase that lacked the functional catalytic domain was produced
(Evans eta¡., 1993). Stablely transfected 3T3 mouse fibroblast demonstrated
decreased association with actin cytosketeton, decreased migration, and
histologically appeared balled up on the laminin surface with minimal cell-cell
attachment suggesting that this cytoskeletal domain of the cell-surface
GalTase is essential for attachment of cell to laminin (Appendu and Shur etal.,
1994). Nevertheless, this stabilized actin filament is then more available for
integrin |3 subunit binding. Furthermore, there is evidence of greater
activation of the EGF-R leading to increased phosphorylation of integrin
subunit which then leads to migration on laminin (Mainiero et al., 1996).
Information to date suggest that the integrin-mediated signal transduction
pathway may be common with the EGF-R MAPK cascade thus conforming to
commonly held beliefs that the EGF system modulates fetal mouse salivary
gland morphogenesis and development (Nanny and King, 1994; Gresik et al.,
1997; Kashimata and Gresik, 1997).

115
MAPK
-2i2!aÃœaa!Srane
DNA
-Transcription of cell-surface GalTase
-Transcription of integrin receptor
replication / cell division
Figure 4-1. Suggested Integrin-GalTase-Actin Model. Model for integrin-
mediated, cell-surface GalTase , and actin congregated cell migration
and cell proliferation. © The initial adhesion of the cell to the ECM is
mediated by integrins; © cytoplasmic complexes bind to the psubunit of
the integrin cytoplasmic tail; © integrin-cytoplasmic complex binds to
actin; © stable cytoskeletal structure bound to ECM laminin induces
increased cell-surfce GalTase expression with increased likelihood of
associating with EGF-R; © GalTase binds actin and; © increases
EGF:integrin tyrosine kinase cascade which ultimately leads to MAPK
induced nuclear signal transduction for cell division.

116
This model of an integrin-mediated, cell-surface glycoprotein
associated, cytoskeletal complex suggests a synergistic, cooperative
association for cell migration and cell differentiation between these diverse
molecules. Teleologically it is logical for a cell to use both positional
information, regarding its relationship to the ECM; as well as availability to the
growth factor receptor, to decide when to enter into the cell cycle for growth
and proliferation. The model suggested provides for an assemblage of both
biochemical and positional Information.
MAPK associated signal transduction is mediated by 8 or 9 upstream
regulatory promoters such as the cAMP binding element, NFBkb, or cGMP to
name a few (Klemke et at., 1997). To date no upstream transcriptional
regulatory regions have been mapped for the GalTase gene. Review of the
known upstream 5’ sequences of the GalTase as reported to GenBank™
reveals no recognizable promoter sequences responsive to known MAPK
region. A logical step would be the evaluation of the responsiveness of
GalTase gene to known promoters of MAPK region seem.
Further investigation of this proposed interrelationship between cell-
surface GalTase, integrin receptors, laminin and actin cytoskeletal elements
are needed to deduce the exact mechanisms of these associations and signal
transduction. Additional in vitro studies with use of both tyrphostin-1 as well as
a-lactalbumin could also provide very valuable information.
It would be naive to suggest that cell-surface GalTase alone is
responsible for morphogeneis of fetal mouse salivary glands. It should be

117
anticipated that redundancy exists in the developmental cascade to allow for
transcriptional or mutational errors. As previously stated there have been
great than 100 different membrane bound enzymes that participate in
glycoprotein and glycolipid biosynthesis alone (Russo et al., 1990). Recently
a research group reported the development of a semi-lethal knockout mouse,
produced by gene targeting to disrupt both cell-surface and Golgi forms of
GalTase (Asano et al., 1998). Their GalTase-deficient mice were reported to
be “born normally” but exhibited growth retardation. Interestingly they
reported epithelial cell proliferation of the skin and small intestine; half of the
animals died before 4 weeks of age. No mention was made of the salivary
glands or oral tissues. Efforts are currently underway to institute collaborative
investigations with this group and animal model. It would be interesting to
follow the submandibular gland development and GalTase expression in
these animals as well.
Potential clinical applications of this line of investigation are exciting as
well. Glandular hypertrophy has been associated with increased innervations
and dietary alterations and they demonstrate increased cell-surface GalTase
enzymatic activity. Treatment alternatives to prevent glandular hyperplasia,
could include administration of specific substrates of GalTase to mediate cell
growth and parotid gland hypertrophy and are a reasonable consideration in
the future. More excitingly, GalTase may be utilized in a regenerative capacity
to induce glandular tissue regeneration in certain disease states, such as is
seen in autoimmune diseases, or following radiation induced atrophy. A

118
further clinical application of this organ culture system could be used as a
model to study the invasive properties associated with tumorogenesis, as
certain mouse neoplastic cells have shown elevated cell-surface GalTase
enzymes (Chanta et a!., 1989). Understanding the mechanisms of
development will allow us to better comprehend the pathologic processes and
thus conceive treatment regimens, as the axiom suggest, “oncogenesis
recapitulates ontogeny”.

CHAPTER FIVE
OTHER STUDIES
The research completed and described in the preceding chapters has
provided me an opportunity to develop laboratory skills, training and research
competence in an educational environment that is unparalleled. As a trained
clinician, then surgeon, I had experienced first hand the clinical aspects of
wound healing yet I desired to delve more deeply into the basic science
aspects of development, growth, and repair. My interest in regenerative
periodontics had ignited my urge to investigate the roles of growth factors.
This experience has provided me that opportunity. Additionally, as a member
in the Humphreys-Beher laboratory, I have been given extensive collaborative
research opportunities, that have resulted in numerous projects, published
manuscripts, awards and national grant funding for which I am extremely
grateful.
My research into the cell-surface expression of the glycosyltransferase
GalTase, and its interaction with the tyrosine kinase growth factor receptor
EGF, lead me to investigate salivary EGF levels. Salivary glands of mammals
are known to synthesize and secrete copious amounts of growth factors,
including EGF, into the oral cavity on a daily basis, with the parotid gland
being the major source of EGF in humans (8:1 relative to submandibular
119

120
gland contribution, Thesleff etal., 1988). From animal studies it is evident that
EGFin saliva plays an important role in both oral and systemic rates of wound
healing (Hutson et al, 1979; Goodlad et al., 1987; Konturek et a!., 1988;
Noguchi etal., 1991a,b,; Dayan etal., 1992). Additionally local cells at the site
of injury are also able to secrete growth factors to aid in wound healing.
As a part-time faculty member in the Department of Periodontology and
Co-Director of our Graduate Periodontology Program, I was able to combine
my clinical and laboratory expertise in evaluating the role of salivary EGF.
We measured the salivary levels of EGF in patients that were undergoing
required periodontal surgery. Salivary EGF levels were determined for 12
systemicaliy healthy individuals presurgically and post-surgically at 6, 12, 18,
24, 30, 36 and 42 hours and at 2 and 6 weeks. Three mL of unstimulated
whole saliva, obtained at each time point, was used to measure salivary EGF
using a Quantikineâ„¢ Human EGF Immunoassay (R & D Systems,
Minneapolis, MN). Results demonstrated a statistically significant (p < 0.01)
increase in saliva-derived EGFin whole saliva at 18 hours post-surgically with
a second smaller peak at 30 hours when compared to control unoperated
patients (Oxford etal., 1998b).
We have also monitored salivary concentrations of EGF in patients prior
to and following juxta-oral surgery. Twenty-five patients, diagnosed with
parotid tumors, were selected from the Department of Otorhinolaryngology at
Shands Hospital at the University of Florida and Haukeland University
Hospital in Bergen, Norway. These tumors consisted mainly of pleomorphic

121
adenomas and mucoepidermoid carcinomas. Three mL of unstimulated
whole resting saliva was collected from each patient presurgically and at 48
hours post-surgically for EGF quantification. Salivary levels of EGF for these
patients demonstrated a 40% increase at the 48 hour post-surgical mark
which was statistically significant (p < 0.02). As with the periodontal surgery
patients, the concentration of growth factor returned to control values by 2
weeks after surgery (Oxford eta/., 1998c).
Although EGF can be produced locally by cells at the site of injury, the
increases noted in saliva do not appear to be the consequence of serum or
cellular contribution. We surmise that transient increases in saliva levels of
EGF were a consequence of synthesis and secretion from the salivary glands
in response to introduction of a wound through surgical trauma or a reflex
response to the stress induced through the surgical procedure. Increased
levels of saliva-derived EGF at the site of injury may promote increased
healing through its binding to the EGF-Receptor and activation of proliferation
by the tyrosine kinase pathway which may induce a wide variety of biological
effects including epithelial development, angiogenesis and inhibition of
gastric acid release (Carpenter and Wahl, 1990; Schreiber et a/., 1986;
Gregory, 1975). Thus it appears that transient increase in salivary levels of
EGF is a natural response to both intra-oral and juxta-oral injury to promote
wound healing.
These findings have supplemented suggestions that salivary EGF is
important to regeneration of an oral wound. A common finding in uncontrolled

122
diabetics is the diminished capacity for wound healing, thought to be caused
by decreased vascularity as a result of thickening of the epithelial basement
membrane. As a result diabetics are at a higher risk for periodontitis (Grossi et
ai, 1997; Genco, 1996). I have suggested a series of experiments to
investigate this interaction between diabetes, periodontitis and saliva-derived
growth factors for which I was awarded the 1998 AADR William B. Clark
Periodontal Research Award (sponsored by the Proctor and Gamble
Company). In these experiments our group is initially evaluating the rate of
wound healing, of standardized soft and hard tissue intraoral wounds, in
animals with and without salivary-derived EGF. To accomplish this half (64) of
these animals received submandibular gland ablation, while the other half
were sham operated. Half of each group then received exogenous
supplmentation with EGF ad libitum in their drinking water. The second stage
of these experiments involves the use of streptozotocin-induced diabetic rats
in a similar fashion with standardized soft and hard tissue wounds with and
without salivary-derived EGF. Histomorphometric evaluation of the rate and
degree of wound healing will be evaluated with a semi-automatic image
analyzer coupled with a photomicroscope.
Collaboratively, Drs. Humphreys-Beher, Peck and I have proposed to
further investigate the diminished capacity of wound healing, increased
periodontal disease, and the progressive loss of growth factors from saliva
with the onset of diabetes. We have recently (September 1998) been
informed of funding of our response to a RFA, from the National Institutes of

123
Health, to investigate the changes in growth factor levels in patient saliva and
serum after surgical procedures, compared to healthy non-diabetic controls.
Secondly we intend to determine the influence of changes of growth factor
levels in saliva on wound healing in the NOD mouse model for IDDM and
hopefully establish the NOD mouse as a viable model for this aspect of
diabetes. And finally we expect to evaluate the impact of decreased levels of
saliva-derived growth factors on experimentally induced soft and hard tissue
wounds in animals. These results should elucidate more fully the importance
of saliva-derived growth factors on systemic homeostasis and wound repair
especially in the oral cavity.
Salivary glands are major source of other growth factors as well as EGF
and they include IGF-I, IGF-II, NGF, TGF-a and TGF-|3 (Costigan et al., 1988;
Kerr et al., 1995; Murakami, et al., 1992; Ryan et al., 1992; Smith and Patel,
1984; Watson etal., 1985; Yeh et al., 1989 Barka, 1980; Humphreys-Beher et
al., 1994). My interest in growth factors and their roles in maintenance of
health has not been limited to EGF. In collaborative efforts with other
members of our laboratory I have also investigated the growth factor IGF
(Nakagawa etal., 1997). IGFsfunction in an autocrine/paracrine like manner
to regulate proliferation of bone forming cells, and their appearance is
believed to be regulated by specific binding proteins, insulin-like growth factor
binding proteins (IGFBPs) I through 6, which are thought to be secreted by
organs such as pancreas, pituitary gland and renal glands. The abilities of

124
saliva-derived growth factors to influence organ homeostasis and wound
healing requires absorption through the gastrointestinal tract and
dissemination via the circulatory system. Previous researchers have shown
that biologically active EGF is disseminated in various tissues when
absorption occurs either sublingually or gastrointestinally (Thornburg et at.,
1984, 1987; Purushotham eta/., 1995). Using [125I]-IGF-I in a Western-blot
ligand binding assay, a series of binding proteins were detected in the serum,
but not the saliva, from Balb/c and diabetic NOD mice. Gavage administration
of 125I-IGFI resulted in substantial uptake and systemic organ distribution. This
dispersed 125I-IGF I was then tissue extracted and shown to retain biologic
activity in adose dependent response in in vivo cultures with human gingival
fibroblast as determined by a 4 hour [3H]-thymidine incorporation assay. This
suggested that saliva derived IGFsmay be absorbed from the oral and gastric
mucosa in a biologically active state without the necessity of the IGF binding
proteins (Nakagawa etal., 1997).
Components other than growth factors, that participate in regulating
environmental signals to determine cell proliferation or cell death, and are
especially important in tissue remodeling, include the matrix
metalloproteinases (MMPs) and their substrates, components of the ECM. I
have been peripherally involved in studies evaluating changes in the levels of
these enzymes in saliva and exocrine gland lysates by RT-PCR. We
evaluated the importance of MMPs in the disease process leading to
autoimmune exocrinopathy using NOD (non-obese diabetic model for IDDM),

125
immunodeficient NOD (NOD-scid), and non-diabetic NOD.B10.H2b mice from
7 to 20 weeks of age, that were continuously treated with the MMP inhibitor,
GM6001®. Elevated levels of mRNA transcripts for the gelatinases MMP-2 and
MM P-9 were detected by RT-PCR in total RNA extracted from parotid and
submandibular glands. Despite being treated with the MMP inhibitor
GM6001®, autoimmune exocrinopathy continued suggesting that while
excessive MMP activity is present, as it is in autoimmune disease progression
in NOD mice, it may, in fact, be a secondary event resulting from aberrant
apoptotic events that initiate the exocrine gland pathology (Yamachika et al.,
1998).
Thus my laboratory and research experience during these past four
and a half years has been quite diverse. The research described here
demonstrate that cell-surface GalTase may be part of an assortment of cell-
surface ligands or receptors that provide a redundancy in stimulating signal
transduction from the extracellular environment to the intracellular machinery.
Although these works have been extensive, further research into the exact
signal transduction mechanisms need further elucidation. Based on this
research it is my desire to pursue further studies that concentrate on
downstream signal transduction events associated with the GalTase binding.

REFERENCES
Allende, J. E. (1988). GTP-mediated macromolelcule interactions: The
common features of different systems. FASEB Journal2, 2356 - 2367.
Aoki, D., Lee, N., Yamaguchi, N., Dubois, C., Fukuda, M. N. (1992). Golgi
Retention of a Trans-Golgi Membrane Protein, Galactosyltransferase,
Requires Cysteine and Histidine Residues within the Membrane-Anchoring
Domain. Proceedings of the National Academy of Sciences (USA) 8 9, 4319 -
4323.
Appeddu, P. A., Evans, S. C., and Shur, B. D. (1991). Molecular analysis of
cell surface ¡31,4-galactosyltransferase function during lamellipodia formation
and cell migration on laminin. Journal of Cell Biology 11 5,121 -126.
Appeddu, P. A., and Shur, B. D. (1994). Molecular analysis of cell surface
¡31,4-galaciosyltransferase function during cell migration. Proceedings of the
National Academy of Sciences (USA) 9 1,2095 - 2099.
Asano, M., Furukawa, K., Kido, M., Matsumoto, S., Umesaki, Y., Kochibe, N.,
Iwakura, Y. (1998). Growth retardation and early death of beta 1,4-
galactosyltransferase knockout mice with augmented proliferation and
abnormal differentiation of epithelial cells. Journal of Embryology, 16(8),
1850 -1857
Babiarz, B., and Cullen, E. (1992). 3T3 cell surface galactosyltransferase is a
calcium-dependent adhesion molecule for collagen Type IV. Experimental
Cellular Research 2 03, 276 - 279.
Barcellos-Hoff, M. H. (1992). Mammary epithelial reorganization on
extracellular matrix is mediated by cell surface galactosyltransferase.
Experimental Cellular Research 2 01,225 - 234.
Barka, T. (1980). Biologically active polypeptides in the submandibular gland.
Journal of Histochemical Cytochemistry 2 8, 836 - 859.
Bayna, E. M., Shaper, J. H., and Shur, B. D. (1988). Temporally Specific
Involvement of Cell-Surface ¡31,4-galactosyltransferase During Mouse Embryo
Morula Compaction. Cell 5 3, 145 -157.
126

127
Beck, K., Hunter, I., and Engel, J. (1990). Structure and function of laminin:
anatomy of a multidomain glycoprotein. FASEB Journal4,148 - 160.
Begovac, P. C., Hall, D. E., and Shur, B. D. (1991). Laminin Fragment E8
Mediates PC12 Cell Neurite Outgrowth by Binding to Cell-Surface |31,4-
galactosyltransferase. Journal of Cell Biology1 1 3, 637 - 644.
Begovac, P. C. and Shur, B. D. (1990). Cell surface galactosyltransferase
mediates the initiation of neurite outgrowth on laminin. Journal of Cell Biology
1 1 0, 461 - 470.
Benau, D. A., McGuire, E. J., and Storey, B. T. (1990). Further characterization
of the mouse sperm surface zona-binding site with galactosylation activity.
Molecular Reproductive Biology 2 5, 393 - 399.
Benau, D. A., and Storey, B. T. (1988). Relationship between two types of
mouse sperm surface sites that mediate binding of sperm to the zona
pellucida. Biological Reproduction 3 9, 235 - 244.
Bernfeld, M., and Banerjee, S. D. (1972b). Acid mucoplysaccharide
(glycosaminoglycan) at the epithelial-mesenchymal interface of mouse
embryo salivary glands. Journal of Cell Biology 5 2, 664 - 673.
Bernfeld, M., and Banerjee, S. D. (1982). The turnover of basal lamina
glycosaminoglycan correlates with epithelial morphogenesis. Developmental
Biology 9 0, 291 -305.
Bernfeld, M., Banerjee, S. D., and Cohn, R. H. (1972a). Dependence of
salivary gland epithelial morphology and branching morphogenesis upon
acid mucopolysaccharide-protein (proteoglycan) at the epithelial surface.
Journal of Cell Biology 5 2, 674 - 689.
Bernfeld, M., Banerjee, S. D., Koda, J., and Raprager, A. C. (1984).
Remodeling of the basement membrane: morphogenesis and maturation. In
“Basement Membranes and Cell Movement” (R. Porter and J. Whelan,
Editors), pp. 179. Pittman Press, Bath, PA.
Bernfeld, M., and Wessells, N. K. (1970). Intra- and extracellular control of
epithelial morphogenesis. Developmental Biology Supplemental 4, 195 -
249.
Borghese, E. (1950). Explantation experiments on the influence of the
connective tissue capsule on the development of the epithelial part of the
submandibular gland of Mus musculus. Journal of Anatomy (London) 8 4, 303
-321.

128
Bottaro, B., and Cutler, L. S. (1984). An electrophysiological study of the
postnatal development of the autonomic innervation of the rat submandibular
gland. Archives of Oral Biology 2 9, 237 - 242.
Bradhorst, M., and McConkey, E. (1974). Stability of nuclear RNA in
mammalian cells. Journal of Molecular Biology 8 5, 451 - 463.
Brew, K., Vanaman, T. C., and Hill, R. L. (1968). Betal ,4-galactosyltransferase
as a GIcNAc residue binding mechanism in lactating tissues. Proceedings of
the National Academy of Sciences (USA) 5 9, 491 -497.
Broverman, R. L, Nguyen, K. H., da Silveira, A., Brinkley, L. L, Macauley, S.
P., Zeng, T., Yamamoto, H., Tarnuzzer, R. W., Schultz, G. S., Kerr, M., and
Humphreys-Beher, M. G. (1998). Changes in the expression of extracellular
matrix (ECM) and matrix metalloproteinases (MMP) of proliferating rat parotid
acinar cells. Journal of Dental Research 77(7), 1504-1514.
Bunnell, B., Heath, L. S., Adams, D. E., Lahti, J. M., Kidd, V. Y. (1990).
Increased expression of a 58 kDa protein kinase leads to changes in the CHO
cell cycle. Proceedings of the National Academy of Sciences (USA) 8 7, 7467
- 7471.
Burgen, A. S. V., and Emmelin, N. G. (1961). Physiology of the Salivary
Glands. Monographs of the Physiological Scoiety 8, 78.
Burgeson, R. E., Chiquet, M., Deutzmann, R., Ekblom, P., Engel, J., Kleinman,
H. K., Martin, G. R., Meneguzzi, G., Paulsson, M., Sanes, J., Timpl, R.,
Trygvasson, K., Yamada, Y., Yurchenco, P. D. (1994). A new nomenclature for
the laminins. Matrix Biology 1 4, 209 -211.
Burridge, K., Fath, K., Kelly, T., Nuckolls, G., and Turner, C. (1988). Focal
adhesion transmembrane junctions between the extracellular matrix and
cytoskeleton. Annual Review of Cell Biology 4; 487 - 525.
Campbell, J., and Terranova, V. (1988). Laminin: molecular organization and
biological function. Journal of Oral Pathology! 7, 309 - 323.
Carpenter, G., and Wahl, M. I. (1990). The epidermal growth factor family. In
Peptide Growth Factors and their receptors. (Carpenter, G., and Wahl, M. I.,
Editors), pp. 69 - 75. Springer-Verlag, New York, NY.
Charonis, A. S., Tsiliabary, E. C., Saku, T., and Furthmayr, H. (1986). Inhibition
of laminin self-assembly and interaction with type IV collagen antibodies to the
terminal domain of the long arm. Journal of Cell Biology1 03, 1689 -1697.

129
Charonis, A. S., Tsiliabary, E. C., Yurchenco, P. D., and Furthmayr, H. (1985).
Binding of iaminin to type IV collagen: a morphological study. Journal of Cell
Biology 1 0 0, 1848 - 1853.
Chatterjee, S. K., Bhattacharya, M.,and Barlow, J. J. (1978). An evaluation of
glycosyltransferase activity in gastrulating chick embryo. Biochemical,
Biophysical Research Communication 8 0, 826 - 832.
Chatterjee, S. K., and Kim, U. (1977). Galactosyltransferase activity in
metastasizing and nonmetastisizing rat mammary carcinomas and its possible
relationship with tumor cell surface antigen shedding. Journal of National
Cancer Institute 5 8, 273 - 280.
Chen, J. W., Murphy, T. L, Willingham, M. C., Pastan, I., and August, J. T.
(1985). Identification of two lysosomal membrane glycoproteins. Journal of
Cell Biology 101,85-95.
Chievitz, J. H. (1885). Beitrage zur entwickelungsgeschiete der
spiechldrusen. Archiv fur Anatomie und Entwicklungsgeschlchte. 1885, 401 -
436.
Cohen, S. (1962). Isolation of a mouse submaxillary gland protein
accelerating incisor eruption and eyelid opening in the newborn animal.
Journal of Biological Chemistry 237, 1555 - 1562.
Cohn, R. H., Banerjee, S. D., and Bernfeld, M. (1977). Basal lamina of
embryonic salivary gland epithelia. Nature of glycosaminoglycan and
organization of extracellular materials. Journal of Cell Biology 7 3, 464 - 478.
Costigan, D. C., Guyda, H. J., and Posner, B. (1988). Free insulin-like growth
factor I (IGF-I) and IGF-II in human saliva. Journal of Clinical Endocrinology
66, 1014 - 1018.
Cox, J. L, and Shaw, P. A. (1992). Structure, organization and regulation of a
rat cysteine proteinase inhibitor-encoding gene. Gene 110(2), 175 -180.
Cutler, L. S. (1973). Morphogenesis and Functional Differentiation of the Rat
Submandibular Gland In Vivo and In Vitro: Ultrastructural and Biochemical
Studies. Ph.D. Thesis, State University of New York at Buffalo, Buffalo, NY.
Cutler, L. S. (1980). The dependent and independent relationships between
cytodifferentiation and morphogenesisis in developing salivary gland
secretory cells. Anatomical Record 19 6, 341.

130
Cutler, L. S. (1989). Functional differentiation of salivary glands. In
“Handbook of Physiology:Salivary, Pancreatic, Gastric, and Heptabillary
Secretion” (J. Forte, Editor), Volume 3, pp. 413 - 420. American Physiologic
Society Press, New York, NY.
Cutler, L. S. (1990). The role of extracellular matrix in the morphogenesis and
differentiation of salivary glands. Advances in Dental Research 4, 27 - 33.
Cutler, L. S., and Chaudry, A. P. (1973a). Differentiation of the myoepithelial
cells in the rat submandibular gland in vivo and in vitro: an ultrastructural
study. Journal of Morphology 14 0, 229 - 240.
Cutler, L. S., and Chaudry, A. P. (1973b). Intercellular contacts at the
epithelial-mesenchymal interface during prenatal development of the rat
submandibular gland. Journal of Morphology 140, 343 - 354.
Cutler, L. S., and Chaudry, A. P. (1974). Cytodifferentiation of the acinar cells
of the rat submandibular gland. Developmental Biology 41, 31-41. Journal of
Morphology 14 0, 343 - 354.
Dagogo, J. S., Atkinson, S., Kendal-Taylor, P. (1985). Homologous
radioimmunoassay for epidermal growth factor in human saliva. Journal of
Immunoassay6(1), 125 - 136.
Darlington, G. J., Tsai, C. C., Samuelson, L. C., Gumucio, D. L, and Meisler,
M. H. (1986). Simultaneous expression of salivary gland and pancreatic
amylase genes in cultured mouse hepatoma cells. Molecular and Cellular
Biology6(4), 969-975.
Dayan, D., Bodner, L, and Horowitz, I. (1992). Effect of salivary hypofunction
on the healing of extraction wounds: a histomorphometric study in rats.
Journal of Oral and Maxillofacial Surgery 5 0, 354 - 358.
Denny, P. C., and Denny, P. A. (1984). Diurnal variation of sialomucin
concentration in female mouse submandibular glands measured by
radioimmunoassay. Archives of Oral Biology 29(12), 1033 -1040.
Do, K. Y., Do, S. I., and Cummings, R. D. (1995). Alpha-lactalbumin induces
bovine milk beta 1,4-galactosyltransferase to utilize UDP-GalNAc. Journal of
Biological Chemistry 270 (31), 18447 - 18451.
Dobrosielski-Vergona, K. (1993). Cytology, Histology, and Histochemistry of
Salivary Glands: An Overview. In “Biology of the Salivary Glands” (K.
Dobrosielski-Vergona, Editor), pp.16. CRC Press, Boca Raton, FL.

131
Dragoo, J., Nurcombe, V., Bartlett, P, (1991). Laminin through its long arm E8
fragment promotes the proliferation and differentiation of murine
neuroepithelial cells. Experimental Cell Research 19 2, 256 - 265.
Durban, E. M., Nagpala, P. G., Barreto, P. D., and Durban, E. (1995).
Emergence of salivary gland cell lineage diversity suggests a role for
androgen-independent epidermal growth factor receptor signaling. Journal of
Cell Science 1 08(6), 2205 - 2212.
Dutt, A., Tang, J. P., Carson, D. D. (1987). Lactosaminoglycans are involved
in uterine epithelial cell adhesion in vitro. Developmental Biology 11 9, 27 -
37.
Ebner, K. E. (1973). Lactase Synthetase. In The Enzymes (P. D. Boyer,
Editor), Voi 9, pp 363 -377. Academic Press, New York, NY.
Eckstein, D. J., and Shur, B. D. (1989). Laminin induces the expression of cell
surface galactosyltransferase to lamellipodia on migrating cells. Journal of
Cell Biology 1 08, 2507 - 2517.
Eckstein, D. J., and Shur, B. D. (1992). Cell surface 131,4-galactosyl-
transferase is associated with the detergent-insoluble cytoskeleton on
migrating mesenchymal cells. Experimental Cell Research 201,83 - 90.
Emmelin, N., Garret, J. R., Ohlin, P. (1974). Secretory activity and the
myoepithelial cells of salivary glands after ductal ligation in cats. Archives of
Oral Biology 1 9, 275 - 283.
Evans, S. C., Lopez, L. C., and Shur, B. D. (1993). Dominant negative
mutation in cell surface (31,4-galactosyltransferase inhibits cell-cell and cell-
matrix interactions. Journal of Cell Biology 1 2 0, 1045 -1057.
Eversole, L. R. (1971). Histogenic classification of salivary tumors. Archives of
Pathology 9 2, 433 - 443.
Gallagher, D. V. (1988). Control of calcium influx in cells without action
potentials. News in Physiological Sciences 3,244 - 249.
Garratt, A. N., and Humphries, M. J. (1987). Recent insights into ligand
binding, activation and signalling by integrin adhesion receptors. Acta
Anatomy (Basel) 1 5 4, 34 - 46.
Gattone, V. H., Sherman, D. A., Hinton, D. A., Niu, F. W., Topham, R. T., Klein,
R. M. (1992). Epidermal growth factor in the neonatal mouse salivary gland
and kidney. Biology of the Neonate 61 (1), 54 - 67.

132
Genco, R. J. (1996). Current view of risk factors for periodontal diseases.
Journal of Periodontology 67(10) Supplemental, 1041 - 1049.
Ghanta, V. K, Hiramoto, R. N., Parker, C. A., Kidd, V. J., and Humphreys-Beher,
M. G. (1989). In vitro and in vivo growth control of transformed lymphoid cells
expressing plasma membrane galactosyltransferase. Oncogene 4, 1337 -
1344.
Giancotti, F. G., Stepp, M. A., Suzuki, S., Engvall, E., Ruoslahti, E. (1992).
Proteolytic processing of endogenous and recombinant |34 integrin subunit.
Journal of Cell Biology 1 1 8, 951 - 963.
Glaser, K. B., Sung, A., Bauer, J., and Weichman, B. M. (1993). Regulation of
eicosanoid biosynthesis in the macrophage. Involvement of protein tyrosine
phosphorylation and modulation by selective protein tyosine kinase inhibitors.
Biochemical Pharmacology45(3), 711 - 721.
Goodlad, R. A., Wilson, T. J. G., Lenton, W., Gregory, H., McCullagh, K. G., and
Wright, N. A. (1987). Intravenous but not intragastric urogastron-EGF is
trophic to the intestine of perenterally fed rats. Gut 2 8, 37 - 43.
Gregory, H. (1975). Isolation and structure of urogastron and its relationship
to epidermal growth factor. Nature (London) 257, 325 - 327.
Gresik, E. W., and Azmitia, E. C. (1980). Age related changes in NGF, EGF
and ptorease in the granular convoluted tubules of the mouse submandibular
gland. A morphological and immunocytochemical study. Journal of
Gerentology 35(4), 520 -524.
Gresik, E. W., Kashimata, M., Kadoya, Y., Mathews, R., and Yamashina, S.
(1997). Expression of epidermal growth factor receptor in fetal mouse
submandibular gland detected by a biotinyltyramide-based catalyzed signal
amplification method. Journal of Histochemical Cytochemistry 45(1 2), 1651 -
1657.
Gresik, E. W., Schenkein, I., and der Noen, H., and Barka, T. (1985).
Hormonal regulation of epidermal growth factor and protease in the
submandibular gland of the adult mouse. Endocrinology 1 09, 924 -929.
Grobstein, C. (1953a). Analysis in vitro of the early organization of the
rudimentary mouse submandibular gland. Journal of Morphology 9 3, 19-43.
Grobstein, C. (1953b). Epithelial-mesenchymal specificity in the
morphogenesis of mouse submandibular rudiments in vitro. Journal of
Experimental Zoology1 24, 383 - 413.

133
Grobstein, C. (1953c). Morphogenetic interactions between embryonic
tissues separated by a membrane filter. Nature 17 2, 869 - 871.
Grossi, S. G., Skrepcinski, F. B., DeCaro, T., Robertson, D. C., Ho, A. W.,
Dunford, R. G., and Genco, R. J. (1997). Treatment of periodotnal disease in
diabetics reduces glycated hemoglobin. Journal of Periodontology68(8), 713
-719.
Gullberg, D., and Ekblom, P. (1995). Extracellular matrix and its receptors
during development. International Journal of Developmental Biology 3 9 (5),
845 - 854.
Hall, D. E., Reichardt, L. F., Crowley, E., Holley, B., Moezzi, H., Sonnenberg,
A., and Damksy, C. H. (1990). Journal of Cell Biologyi 10,2175-2184.
Hathaway, H. J., Romagnano, L, and Babiarz, B. S. (1989). Analysis of cell-
surface galactosyltransferase activity during Mouse trophoectodermal
differentitation. Developmental Biology A 34, 351 - 361.
Hathaway, H., and Shur, B. D. (1992). Cell surface (31,4-galactosyltransferase
functions during neural crest cell migration and neuralation in vitro. Journal of
Cellular Biology 1 1 7, 369 - 382.
Hazen-Martin, D. J., Landreth, G., and Simpson, J. A. (1987).
Immunocytochemical localization of nerve growth factor in mouse salivary
glands. Journal of Histochemistry 19(4), 210 - 216.
Hill, R. L, and Brew, K. (1975). Alpha lactalbumin has the unique ability to
alter a galactosyltransferase substrate utilization profile. Advances in
Enzymologic Areas of Molecular Biology A 3,411 - 490.
Hoffman, M. P., Kibbey, M. C., Letterio, J. J., and Kleinman, H. K. (1996). Role
of laminin-1 and TGF-|33 in acinar differentiation of a human submandibular
gland cell line (HSG). Journal of Cell Science 109, 2013 - 2021.
Hogervorst, V., Kuikman, I., von dem Borne, A. E. G., Sonnenberg, A. (1990).
Cloning and sequence analysis of |34 cDNA: an integrin subunit that contains
a unique 118 kD cytoplasmic domain. Journal of Embryology 9,765 - 774.
Howe, A., Aplin, A. E., Alahari, S. K., and Juliano, R. L. (1998). Integrin
Signaling and cell growth. Current Opinion in Cell Biology 10 (2), 220 - 231.

134
Humphreys-Beher, M.G., Imel, M., Jentoft, N., Gleason, M., and Carlson, D. M.
(1984). Isolation and characterization of UDP-galactose: /V-acetyl-
glucosamine 4(3-galactosyltransferase activity induced in rat parotid glands
treated with isoproterenol. Journal of Biological Chemistry 259, 5799 - 5802.
Humphreys-Beher, M. G., Schneyer, C. A, Kidd, V. J., Marchase, R. B. (1987).
Isoproterenol-mediated Parotid Gland Hypertrophy is Inhibited by Effectors of
4|3-Galactosyltransferase. Journal of Biology Chemistry 26 2,11706 -11713.
Humphreys-Beher, M. G., Macauley, S., Chegini, N., van Setten, G.,
Purushotam, K., Stewart, C., Wheeler, T. and Schultz, G. (1994).
Characterization of the synthesis and secretion of transforming growth factor
alpha from salivary glands and saliva. Endocrinology 1 34, 963 -970.
Hutson, J. M., Niali, M., Evans, D., and Fowler, R. (1979). Effect of salivary
glands on wound healing in mice. Nature (London) 279, 793 - 795.
Hynes, R.O. (1987). Integrins: a family of cell surface receptors. Cell 4 8, 549
-561.
Hynes, R. O. (1992). Integrins: versatility, modulation and signalling in cell
adhesion. Cell 6 9,11 -15.
Izutsu, K. T. (1990). Physiological Aspects of Salivary Gland Function.
Compendium of Continuing Education in Dentistry, Supplement No 1 3, S450
-S456.
Jaskoll, T., Choy, H. A., and Melnick, M. (1994). Glucocorticoids, TGF-p, and
embryonic mouse salivary gland morphogenesis. Journal of Craniofacial
Genetic Developmental Biology 1 4, 217 - 230.
Juliano, R. (1996). Cooperation between soluble factors and integrin-cell
anchorage in the control of cell growth and differentiation. Bioessays 1 8 (11),
911 -917.
Juliano, R. L, and Haskill, S. (1993). Signal Transduction from the
extracellular matrix. Journal of Cell Blology\ 20(3), 577 - 585.
Kaufman, M. H. (1994). In An Atlas of Mouse Development. 2nd Edition,
Academic Press, London, England.
Kadoya, Y., Kadoya, K., Durbeej, M., Holmvall, K., Sorokin, L, and Ekblom, P.
(1995). Antibodies against Domain E3 of Laminin-1 and Integrin a6 Subunit
Peturb Branching Epithelial Morphogenesis of Submandibular Gland, but by
Different Modes. Journal of Cell Biology 1 29, 521 - 534.

135
Kadoya, Y., Nomizu, M., Sorokin, L. M., Yamashina, S., and Yamada, Y.
(1998). Laminin a1 Chain G Domain Peptide, RKRLQVQLSIRT, Inhibits
Epithelial Branching Morphogenesis of Cultured Embryonic Mouse
Submandibular Gland. Developmental Dynamics 21 2, 394 - 402.
Kadoya, Y., Salmivirta, K., Talts, J. F., Kadoya, K., Mayer, U., Timpl, R., and
Elkblom, P. (1997). Importance of nidogen binding to laminin y1 for branching
epithelial morphogenesis of the submandibular gland. Development 124,
683-691.
Kagan, FI (1986). Characterization and regulation of lysl oxidase. In “Biology
of Extracellular Matrix”. (R, Mecham, Editor), Volume 1, pp. 321 -398.
Academic Press, Orlando, FL.
Kashimata, M., and Gresik, E. W. (1997). Epidermal growth factor system is a
physiologic regulator of development of the mouse fetal submandibular gland
and regulates expression of the alpha6-integrin subunit. Development 208,
149 -161.
Kemler, R , Ozawa, M., and Ringwald, M. (1989). Calcium dependent cell
adhesion molecules. Current Opinion in Cell Biology 1,892 - 897.
Kerr, M., Fischer, J. E., Purushotam, Gao, D., Nakagawa, Y., Maeda, N.,
Ghanta, V., Hiramoto, R., Chegini, N., and Humphreys-Beher, M. G. (1994).
Characterization of the synthesis and expression of the kinase from
transformed and normal rodent cells. Biochim Biophys Acta 1215, 375 - 387.
Kerr, M., Lee, A., Wang, P-L, Purushotam, K. R., Chegini, N., Yamamoto, FI.,
and Humphreys-Beher. (1995). Detection of insulin and insulin-like growth
factors I arid II in saliva and potential synthesis in the salivary glands of mice.
Effect of type I diabetes mellitus. Journal of Biochemical Pharmacology 4 9,
1521 -1531.
Kidd, V. J., Luouo, W., Xiang, J., Tu, F., Easton, J., McCune, S., and Snead, M.
S. (1991). Regulated expression of a cell division control-related protein
kinase during development. Cell Growth and Differentiation 2, 85 - 93.
Klemke, R. L, Cai, S., Giannini, A. L, Gallagher, P. J., de Lanerolle, P., and
Cheresh, D. A. (1997). Regulation of cell motility by mitogen-activated protein
kinase. Journal of Cell Biology 1 3 7, 481 - 492.
Klohs, W. D., Willison, J. R., and Weiser, M. M. (1982). UDP-galactose
inhibition of BALB/3 T12 cell growth. Experimental Cell Research 141, 365 -
374.

136
Konturek, S. J., Dembinski, A., Warzecha, Z., Brzozowski, T., and Gregory, H.
(1988). Role of epidermal growth factor in healing of chronic gastroduodenal
ulcers in rats. Gastroenterology 9 4,1300 - 1307.
Kornberg, L. J. (1998). Focal adhesion kinase and its potential involvement in
tumor invasion and metastasis. Journal of Head and Neck Cancer, in press.
Kornfeld, R., and Kornfeld, S. (1985). Assembly of Asparagine-linked
Oligosaccharides. Annual Reviews In Blochemlstry5 4, 631 - 664.
Lafrenie, R. M., and Yamada, K. M. (1996). Integrin-Dependent Signal
Transduction. Journal of Cellular Biochemistry 6 1, 543 - 553.
Lawson, K. A. (1970). Morphogenesis of functional differentiation of the rat
parotid gland in vivo and in vitro. Journal of Embryology and Experimental
Morphology27, 497 - 513.
Lawson, K. A. (1972). The role of mesenchyme in the morphogenesis and
functional differentiation of the rat salivary epithelium. Journal of Embryology
and Experimental Morphology 3 2, 411 - 424.
Lawson, K. A. (1974). Mesenchyme specificity in rodent salivary gland
development: the response of salivary epithelium to mesencyme in vitro.
Journal of Embryology and Experimental Morphology 3 2, 469 - 493.
Lefkowitz, R. J., and Caron, M. G. (1988). Adrenergic receptors: Models for
the the study of receptors coupled to guanine nucleotide regulatory proteins.
Journal of Biological Chemistry 2 63, 4993 - 4996.
Loftus, J. C., O’Toole, T. E., Plow, E. F., Glass, A., Frelinger, A. C., Ginsburg, M.
H. (1990). A ¡33 integrin mutation abolishes ligand binding and alters divalent
cation-dependent conformation. Science 249, 915 - 919.
Lopez, L. C., Bayna, E. M., Litoff, D., Shaper, N. L, Shaper, J. H., Shur, B. D.
(1985). The receptor function of mouse sperm surface galactosyltransferase
during fertilization. Journal Cellular Biology1 01, 1501 -1510.
Lopez, L. C., and Shur, B. D. (1987). Redistibution of the egg receptor on
sperm following the acrosome reaction. Journal of Cell Biology 1 05, 1663 -
1670.
Lopez, L. C., Youakim, A., Evans, S., and Shur, B. D. (1991). Evidence for a
molecular distinction between cell-surface and Golgi forms of 81,4-
galactosyltransferase. Journal of Biological Chemisry266, 5984 - 15991.

137
Macauley, S. P., Tarnuzzer, R. W., Schultz, G. S., Chegini, N., Oxford, G. E.,
and Humphreys-Beher, M. G. (1997). Extracellular-Matrix Gene Expression
During Mouse Submandibular Gland Development, Archives of Oral Biology
1997, 4 2(6), 443-454.
MacKay, S. L. D., Bennett, N. T, Bland, K. I., and Schultz, G. S. (1992). Growth
factor, tumor suppressors and cancer. Perspectives in General Surgery 3, 1 -
25.
Madsen, H. O., and Hjorth, J. P. (1985). Molecular cloning of mouse PSP
mRNA. Nucleic Acid Research 13(1), 1 -13.
Maga, E. A., Anderson, G. B., Huang, M. C., and Murray, J. D. (1994).
Expression of human lysozyme mRNA in the mammary gland of transgenic
mice. Transgenic Research3(1), 36 - 42.
Maga, T., Mizuno, M., Tanaka, S., Yoshinaga, F., Mikami, Y., Kihara, Y., Kiso,
T., Tomoda, J., and Tsuji, T. (1997). Assessment of UDP-galactosyl-
transferase activity in gastric mucosa of patients with chronic liver disease
using an enzyme-linked peanut agglutinin binding assay. Digestion 5 8, 4 -
12. '
Maillet, C. M., Shur, B. D. (1993). Uvomorulin, LAMP-1 and Laminin are
Substrates for Cell-Surface |31,4-galactosyltransferase on F9 Embryonal
Carcinoma Cells. Experimental Cell Research Developmental Biology 9 9,
360-372.
Mainiero, F., Pepe, A., Yeon, M., Ren, Y., Giancotti, F. G. (1996). The
intercellular functions of alpha6beta4 integrin are regulated by EGF. Journal
of Cell Biology 134 (1), 241 - 253.
Marchase, R., Kidd, V. J., Rivera, A. A., and Humphreys-Beher, M. G. (1988).
Cell surface expression of 46-galactosyltransferase accompanies rat parotid
acinar cell transition to growth. Journal of Cellular Biochemistry 3 6, 453 - 465.
Marchase, R., Kidd, and Woloski, B. M. (1987). Cell surface
galactosyltransferase and growth control. Journal of Cell Biology A 05, 103a.
Mecham, R. P. (1991). Receptors for laminin on mamalian cells. FASEB
Journal5, 2538-2546.

138
Miner, J. H., Patton, B. L, Lentz, S., Gilbert, D. J., Snider, W. D., Jenkins, N. A.,
Copeland, N. G., Sanes, J. R. (1997). The laminin a chains: Expression,
developmental transitions, and chromosomal locations of a1-5, identification
of heterodimeric laminins 8-11, and cloning of a novel a3 isoform. Journal of
Cell Biology 137, 685 - 701.
Miréis, L, and Ball, W. D. (1992). Neonatal rat submandibular gland protein
SMG-A and parotid secretory protein are alternatively regulated members of a
salivary giand protein multigene family. Journal of Biological Chemistry
267(4), 2679 -2687.
Miréis, L, Miranda, A. J., and Ball, W. D. (1998). Characterization of the rat
salivary gland B1-immunoreactive proteins. Biochemical Journal 330, 437 -
444.
Moral, H. (1916). Zur kenntnis von der speicheldrusenentwicklung der maus I.
glándula submaxillaris. Zeitschrift fur Anatomie und Entwicklungsgeschichte
5 3, 351 - 679.
Moral, H. (1919). Zur kenntnis von der speicheldrusenentwicklung der maus
II. glándula parotis. Zeitschrift fur Anatomie und Entwicklungsgeschichte 5 7,
51 -200.
Munger, B. L. (1964). Histochemical studies on seromucinous- and mucous-
secreting cells of human salivary glands. American Journal of Anatomy, 115,
411.
Murakami, K., Taniguchi, H., and Baba, S. (1992). Presence of insulin-like
immunoreactivity and its biosynthesis in rat and human parotid gland.
Diabetlogia 2 2, 358 - 361.
Nakagawa, Y., Gammichia, J., Purushotham, K. J., Schneyer, C. A., and
Humphreys-Beher, M. G. (1991). Epidermal growth factor activation of rat
parotid gland adenylate cyclase and mediation by a GTP-binding regulatory
protein. Biochemical Pharmacology 4 2, 2333 - 2341.
Nakagawa, Y., Oxford, G. E., Ishibashi, K., Yamamoto, H., Maeda, N., Bowen,
E., Brayer, J. amd Humphreys-Beher, M. G. (1997). Gastroinstestinal
absorption of insulin-like growth factor in the mouse in the absence of salivary
insulin-like growth factor binding protein. Biochemical Pharmacology 5 3, 233
-240.
Nakanishi, Y., and Ishii, T. (1989). Epithelial shape change in mouse
embryonic submandibular gland: modulation by extracellular matrix
components. Bio Essays 1 1, 163 -17.

139
Nakanishi, Y., Sugiura, F., Kishi, J-l., and Hayakawa, T. (1986). Collagenase
inhibitor stimulates cleft formation during early morphogenesis of mouse
salivary gland. Developmental Biology1 1 3, 201 - 206.
Nanny, L. B. and King, L. E. (1994). “Epidermal Growth Factor and
Transforming Growth Factor-a” In The Molecular and Cellular Biology of
Wound Repair (second Edition), pp. 171 -194. (R. A. F. Clark, Editor). Plenum
Press, New York, NY.
Nauntofte, B., and Poulsen, J. FI. (1986). Effects of Ca2+ and furosemide on Cl
transport and 02 uptake in rat parotid acini. American Journal of Physiology
251, C175 - C185.
Neely, C. A. (1988). Plasma membrane association, purification and
characterization of mouse sperm |31,4-galactosyltransferase. Journal of
Biological Chemistry 2 63, 17706 - 17714.
Nilsson, T , Lucocq, J. M., MacKay, D., Warren, G. (1991). The Membrane
Spanning Domain of |31,4-galactosyltransferase Specifies Trans Golgi
Localization. Journal of Embryology 1 0, 3567 -3575.
Noguchi, S., Ohba, Y., and Oka, T. (1991a). Effect of salivary epidermal
growth factor on wound healing of tongues in mice. Journal of Surgical
Research 3 3, 164 -169.
Noguchi, S., Ohba, Y., and Oka, T. (1991b). Influence of epidermal growth
factor on liver regeneration after partial hepatoectomy in mice. Journal of
Endocrinology 128, 425 - 431.
Novak, I., and Young, J. A. (1986). Two independent anion transport systems
in rabbit mandibular glands. Pflugers Archives4 07, 649 -656.
Oliver, C., Water, J. F., Tolbert, C. C. and Kleiman, FI. K. (1987). Growth of
exocrine acinar cells on a reconstituted basement membrane gel. In Vitro. Cell
Developmental Biology 2 3, 465-473.
Ott, U. E., Odermatt, E., Engel, J., Furthmayr, H., and Timpl, R. (1982).
Protease resistance and conformation of laminin. European Journal of
Biochemistry1 23, 63 - 72.
Oxford, G. E., and Humphreys-Beher, M. G. (1998a). The Role of |31,4-
galactosyltransferase as a Mediator of Salivary Gland Morphogenesis.
Developmental Biology (submitted for publication).

140
Oxford, G. E., Nguyen, K. H. T, Alford, C. E., Tanaka, Y., and Humphreys-
Beher, M. G. (1998b). Elevated Salivary EGF Levels Stimulated by
Periodontal Surgery. Journal of PeriodontologyGQ, 479 -484.
Oxford, G. E., Nguyen, K. H. T., Nanni. J. M., Alford, Zelles, T., Jonsson, R.,
Olofsson, J., and Humphreys-Beher, M. G. (1998). Elevated Levels of Human
Salivary EGF Following Oral and Juxta-Oral Surgery. Journal of Oral and
Maxillofacial Surgery (1998c Accepted for publication).
Panayotou, G., End, P., Aumailley, M., Timpl, R., and Engel, J. (1989).
Domains of laminin with growth factor activity. Cell5 6, 93 -101.
Passaniti, A., and Hart, G. W. (1990). Metastasis-Associated Murine
Melanoma Cell Surface G al ato syltransf erase: Characterization of Enzymatic
Activity and Identification of the Major Surface Substrates. Journal of Cancer
Research 5 0, 7261 -7271.
Paulsson, M. (1992). Basement membrane proteins: structure, assembly and
cellular interactions. Critical Reviews in Biochemistry and Molecular Biology
2 7, 93- 127.
Paulson, J. C., and Colley, K. J. (1989). Glycosyltransferases. Journal of
Biological Chemistry264 (30), 17615 - 17618.
Pemberton, L, Taylor-Papadimitriou, J., and Gendler, S. J. (1992). Antibodies
to the cytoplasmic domain of the MUC1 mucin show conservation throughout
mammals. Biochemical, Biophysical Research Communications 185(1), 167
-175.
Penno, M. B., Passaniti, A., Friedman, R., Hart, G. W., Jordan, C., Kumar, S.,
and Scott, A. F. (1989). In vitro Galactosylation of a 110kDa Glycoprotein by
an Endogenous Cell-Surface Galatosyltransferase Correlates with the
Invasiyenfiss of Adrenal Carcinoma Cells. Proceedings of the National
Academy of Science (USA) 8 6, 6057 - 6061.
Podolsky, D. K., and Isselbacher, K. J. (1984). Characterization of
monoclonal antibodies to serum galactosyltransferase. Proceedings of the
National Academy of Science (USA) 8 1,2529 - 2533.
Poulsen, K., and Colley, K. J. (1989). Glycosyltransferases: A Minireview
Journal of Biological Chemistry 264(30), 17615 -17618.
Poulsen, K., Jakobsen, B. K., Mikkelsen, B. M., Harmark, K., Nielsen, J. T., and
Hjorth, J. P. (1986). Coordination of murine parotid secretory protein and
salivary amylase expression. Journal of Embryology 5(8), 1891 - 1896.

141
Pratt, S. A , Scully, N. F., and Shur, B. D. (1993). Analysis of Cell-Surface
Galactosylfransferase Activity During Mouse Trophoectodermal
Differentiation. Developmental Biology 134, 351 - 361.
Purushotham, K. R., Bologna, J., Nakagawa, Y., and Humphreys-Beher, M. G.
(1992a). Isolation and characterization of a new Ca27calmodulin-dependent
protein kinase from isoproterenol-stimulated proliferating rat acinar cells.
Biochemical Cellular Biology 7 0, 250 -255.
Purushotham, K., Dunn, W. A., Schneyer, C. A., and Humphreys-Beher, M. G.
(1992b), A novel mechanism for isoprenaline-stimulated proliferation of rat
parotid acinar cells involving the epidermal growth factor receptor and cell
surface galactosylfransferase. Biochemical Journal 284, 767 - 776.
Purushotham, K. R., Offenmller, K., Bui, A. T., Zelles, T, Blazsek, J., Schultz, G.
S. and Humphreys-Beher, M. G. (1995). Absorption of epidermal growth
factor occurs through the gastrointestinal tract and oral cavity in adult rats.
American Journal of Physiology 2 69, G867 - G 873.
Rao, C. N., Margulies, T. S., Tralka, V. P., Terranova, J. A., Madri, J. A., and
Liotta, L. A. (1982). Isolation of a subunit of laminin and its role in molecular
structure and tumor cell attachment. Journal of Biological Chemistry 257,
9740 - 9744.
Redman, R. S., and Sreebny, L. M. (1970a). The prenatal phase of morphosis
of the rat parotid gland. The Anatomical Record 1 68,127 -137.
Redman, R. S., and Sreebny, L. M. (1970b). Proliferative behavior of
differentiating cells in the developing rat parotid gland. Journal of Cell Biology
4 6, 81 - 87.
Rich, G. T., Dawson, A. P., and Pryor, J. S. (1984). GIyceraldehyde-3-
phosphate dehydrogenase releasefrom erythrocytes during haemolysis. No
evidence for substantial binding of the enzyme to the membrane in the intact
cell. Journal of Biochemistry 221(1), 197 -202.
Reh, T., Nagy, T., and Gretton, H. (1987). Retinal pigmented epithelial cells
induced to transdifferentiate to neurons by laminin. Nature 33 0, 68 -71.
Riopelle, R. J., and Dow, K. E. (1991). Neurite formation on laminin: Effects of
a galactosyltransferase on primary sensory neurons. Brain Research 541,
265 - 272.

142
Robinson, C. P., Bounous, D. I., Alford, C. E., Nguyen, K. H., Nanni, J. M., Peck,
A. B., and Humphreys-Beher, M. G. (1997). PSP expression in murine
lacrimal glands and function as a bacteria binding protein in exocrine
secretions. American Journal of Physiology 27 2(4), G863 -G871.
Robinson, C. P., Yamamoto, H., Peck, A. B., and Humphreys-Beher, M. G.
(1996). Genetically programmed development of salivary gland abnormalities
in the NOD (nonobese diabetic)-scid mouse in the absence of detectable
lymphocytic infiltrate: a potential trigger for sialoadentitis of NOD mice. Clinical
Immunology and ImmunopathologyTQil), 50 -59.
Romagnano, L, and Babiarz, B. (1990). The role of murine cell surface
galactosyltransferase in trophoblastlaminin interactions in vitro.
Developmental Biology 141,254 - 261.
Rosales, C., O’Brien, V., Kornberg, L, and Juliano, R. (1995). Signal
Transduction by cell adhesion receptors. Biochemical Biophysical Acta 1242
(1), 77-98.
Roseman, S. (1970). The synthesis of complex carbohydrates by multi-
glycosyltransferase systems and their potential function in intracellular
adhesion. Chemical Physical Lipids 5, 270-297.
Roth, S., McGuire, E. J., and Roseman, S. (1971a). Evidence for cell-surface
gylcosyltransferases. Their potential role in cellular recognition. Journal of
Cell Biology 5 1,536 -547.
Roth, S., McGuire, E. J., and Roseman, S. (1971b). An assay for intercellular
adhesive specificity. Journal of Cell Biology 5 1, 525 - 535.
Roth, S., Roeike, M., and Dorsey, J. (1977). Cell surface glycosyltransferase
on malignant and non-malignant cells. In Growth, Kinetics and Biochemical
Regulation of Normal and Malignant Cells (B. Drewinko and R. M. Humphreys,
Editors), pp. 245 - 249. Williams and Wilkins Publishers, Baltimore, MD.
Roth, S., and White, D. (1992). Intercellular contact and cell-surface
galactosyl-transferase activity. Proceedings of National Academy of Science
(USA) 6 9, 485-489.
Runyan, R. B., Maxwell, G. D., and Shur, B. D. (1986). Evidence for a novel
enzymatic mechanism of neural crest cell migration on extracellular
glycoconjugate matrices. Journal Cellular Biology 1 02, 432 - 441.

143
Runyan, R. B., Versalovic, J., and Shur, B. D. (1988). Functionally distinct
laminin receptors mediate cell adhesion and spreading: the requirement for
surface galactosyltransferase in spreading. Journal Cellular Biology 107,
1863 -1871.
Russo, R. N., Shaper, N. L, and Shaper, J. H. (1990). Bovine (31,4-
galactosyltransferase: Two sets of mRNA Transcripts Encode Two Forms of
the Protein with Different Amino-terminal Domains. Journal of Biological
Chemistry 2 65, 3324 - 3331.
Ryan, J., Mantle, T., McQuaid, S., and Costigan, D. (1992). Salivary insulin¬
like growth factor I originates from local synthesis. Journal of Endocrinology
13 6, 85-90.
Sakashita, S. E., Engvall, E., and Ruoslahti, E. (1980). The baement
membrane protein laminin binds to heparin. Federal European Biochemical
Society Letter 1 1 6, 243 - 246.
Salido, E. C., Lakshmanan, J., Shapiro, L. J., Fisher, D. A., Barajas, L. (1990).
Expression of epidermal growth factor in the kidney and submandibular gland
during mouse postnatal development. An immunocytochemical and in situ
hybridization study. Differentiation. 45 (1), 38 - 43.
Schachter, FI., and Roden, L. (1973). The biosynthesis of animal
glycoproteins. In Metabolic Conjugation and Metabolic Flydrolysis (W. H.
Fischman, Editor), pp 1 -149. Academic Press, New York, NY.
Schibler, U., Flagenbuchle, O., Young, R. A., Tosí, M., Wellauer, P. K. (1982).
Tissue specific expression of mouse alpha-amylase genes. Advances in
Experimental Medical Biology 1 58, 381 - 385.
Schneyer, C. A. (1962). Salivary Gland Changes After Isoproterenol-induced
Enlargement. American Journal of Physiology 2 03, 232 - 246.
Schreiber, A. B., Winkler, M. E., Derynck, R. (1986). Transforming growth
factor a: a more potent angiogenic mediator than epidermal growth factor.
Science 232, 1250 - 1253.
Scully, N. F., Shaper, J. FI., and Shur, B. D. (1987). Spatial and temporal
expression of cell surface galactosyltransferase during mouse
spermatogenesis and epididymal maturation. Developmental Biology 124,
111-124'

144
Shaper, N L, Hollis, G. F., Douglas, J. G., Kirsch, I. R., Shaper, J. H. (1988).
Characterization of the Full Length cDNA for Murine (31,4-
galactosyltransferase. Novel features at the 5’ End Predict Two Translational
Start Sites at Two In-Frame AUGs. Journal of Biological Chemistry 2 63,
10420 -10428.
Shaper, N. L, Shaper, J. H., Peyser, M., Kozak, C. A. (1990). Localization of
the gene for beta 1,4-galactosyltransferase to a position in the centromeric
region of mouse chromosome 4. Cytogenetic Cell Genetics 5 4,172 -174.
Shaw, P, and Schibler, U. (1986). Structure and expression of the parotid
secretory protein gene of mouse. Journal of Molecular Biology 192(3), 567 -
576.
Shaw, P.,Sordat, B.,and Schibler, U. (1986). Developmental coordination of
alpha-amylase and PSP gene expression during mouse parotid gland
differentiation is controlled post-transcriptionally. Ce//47(1), 107 -112.
Shur, B. D. (1977). Cell surface glcosyltransferases in gastrulating chick
embryos. I.: Temporally and spatially specific patterns of four endogenous
glycosyltransferase activities. Developmental Biology 5 8, 23 - 39.
Shur, B. D. (1983). Embryonal Carcinoma Cell Adhesion: The Role of Surface
GalaetosyltFansferase and its ©OK I nctonammoglycan Substrate.
Developmental Biology 9 9, 360 - 372.
Shur, B. D. (1984). Cell-surface galactosyltransferses in gastrulating chick
embryos. I. Temporally and spatially specific patterns of four endogenous
glycosyltransf erase activities. Developmental Biology 9 1, 149 - 162.
Shur, B. D. (1991). Mini Review Cell surface |31,4-galactosyltransferase:
twenty years late. Glycobiology 1(6) 563 - 575.
Shur, B. D., and Bennett, D. (1979). A specific defect in galactosyltransferase
regulation on sperm bearing mutant alleles of the T/t-locus. Developmental
Biology 7 1, 243 - 259.
Shur, B. D., and Hall, N. G. (1982a). Sperm surface galactosyltransferase
activates during in vitro capacitaron. Journal of Cellular Biology 9 5, 567 -
573.
Shur, B. D., and Hall, N. G. (1982b). A role for mouse sperm surface
galactosyltransferase in sperm binding to the egg zona pellucida. Journal of
Cellular Biology 9 5, 574 - 579.

145
Shur, B. D., and Neely, C. A. (1988). Plasma membrane association,
purification and characteristic of mouse sperm (31,4-galactosyltransferase.
Journal of Biological Chemistry 263,17706 - 17714.
Siminoski, K., Bernanke, J., and Murphy, R. A. (1993). Nerve growth factor
and epidermal growth factor in mouse submandibular glands: identical diurnal
changes and rates of secretagogue-induced synthesis. Endocrinology
132(5), 2031 -2037.
Smith, P., and Patel, D. (1984). Immunochemical studies of the insulin-like
material in the parotid gland of rats. Diabetes 6 6, 661 - 666.
Spooner, B. S., Bassett, K., and Stokes, B. (1985). Sulfated
glycosaminoglycan deposition and processing at the basal epithelial surface
in branching and (3-D-xyloside-inhibited embryonic salivary glands.
Developmental Biology1 09,177 -183.
Spooner, B. S. and Faubion, J. M. (1977). Collagen involvement in branching
morphogenesis of embryonic lung and salivary gland. Developmental Biology
7 7, 84- 102.
Spooner, B. S., Thompson-Pletsher, H., Stokes, B. and Bassett, K. (1986).
Extracellular matrix involvement in epithelial branching morphogenesis. In
“The cell surface in development and Cancer” (M. Steinberg, Editor), Volume
3, pp. 225 - 260. Plenum Press, New York, NY.
Strassburger, S., Berndt, A., Hyckel, P., Katenkamp, D., Kosmehl, H. (1998).
Differential expression of laminin chains in the human major salivary glands.
Histochemical Journal, 3 0(2), 81 - 88.
Stryer, L. (1988). Introduction to Membranes. In Biochemistry: Chapter 12, pp
612. WB Saunders Co., Philladelphia, PA.
Suganuma, T., Muramatsu, H., Muramatsu, T., Ihida, D., Dawano, J. I., and
Murata, F. (1991). Subcellular localization of A/-acetylglucosamine 81,4-
galactosyltransferase revealed by immunoelectron microscopy. Journal of
Histochemical Cytochemistry 3 9, 299 - 309.
Sweeney, T.,Ogle, R.,and Little, C. (1990). Laminin potentiates differentiation
of PCC4uva embryonal carcinoma cells into neurons. Journal of Cell Science
9 7,23 -31.

146
Tarnuzzer, R., Macauley, S., Farmerie, W., Cabellara, S. (1996). Competitive
RNA templates for the detection and quantification of growth factors, cytokines,
extracellular matrix components, and matrix metalloproteinases by RT-PCR.
BioTechniques 2 0, 670 - 674.
Teasdale, R. D., D’Agostaro, G., Gleeson, P. A. (1992). The Signal for Golgi
Retention of Bovine (31,4-galactosyltransferase is in the Transmembrane
Domain. Journal of Biological Chemistry, 2 67, 4084 - 4096.
Terranova, V. P., Rao, C. N., Kalebic, T., Margulies, I. M., and Liotta, L. A.
(1983). Laminin receptor on human breast carcinoma cells. Proceedings of
the National Academy of Sciences (USA) 8 0, 444 - 448.
Thesleff, I., Viinikka, L., Saxen, L, Lehtonen, E., and Perheentupa, J. (1988).
The parotid gland is the main source of human epidermal growth factor. Life
Sciences43(1), 13 -18.
Thomas, W. A., Schaeffer, A. W., and Treadway, R. M. (1990).
Galactosyltransferase-Dependence of neurite outgrowth on substratum-bound
laminin. Development 11 0,1101 -1114.
Thornburg, W., Matrisian, L, Magun, B., and Koldovsky, O. (1984).
Gastrointestinal absorption of epidermal growth factor in suckling rats.
American Journal of Physiology 2 4 6, G80 - G85.
Thornburg, W., Rao, R. K., Matrisian, L, Magun, B., and Koldovsky, O. (1987).
Effect of maturation on gastrointestinal absorption of epidermal growth factor
in rats. American Journal of Physiology 253, G68 - G71.
Timpl, R. (1989). Structure and biological activity of basement membrane
proteins. European Journal of Biochemistry! 80, 487 - 502.
Timpl, R., Rhode, H., Gehron-Robey, P., Rennard, S. I., Foidart, J. M., Martin, G.
R. (1979). Laminin-a glycoprotein from basement membrane. Journal of
Biological Chemistry 254, 9933 -9937.
Tomaselli, K. J., Hall, D. E., Flier, L A., Gehlsen, K. R., Turner, D. C.,
Carbonetto, S., and Reichard, L. F. (1990). A neuronal cell line (PC12)
expresses two |31-class integrins - a1|31and a3p1 that recognize different
neurite outgrowth-promoting domains in laminin. Neuron 5,651 - 662.
Trelstad, R. L. (1984). The role of extracellular matrix in development. (Alan R.
Liss Editor), New York, NY.

147
Tuckwell, D. S., and Humphries, M. J. (1993). Molecular and cellular biology
of integrins. Critical review of Oncologic Hematology 1 5,149 -164.
Veres, G., Gibbs, R., Schereer, S., and Caskey, C. (1987). The molecular
basis of the sparse-fur mouse mutation. Science 237,415-417.
Vreugdenhil, A. P., Nieuw-Amerongen, A. V., deLange, G. L, and Roukema, P.
A. (1982). Localization of amylase and mucins in the major salivary glands of
the mouse. Histochemical Journal 14(5), 767 - 780.
Watson, A Y., Anderson, J. K., Siminoski, K., Mole, J. E., and Murphy, R. A.
(1985). Cellular and subcellular colocalization of nerve growth factor and
epidermal growth factor in mouse submandibular glands. Anatomical Record
213(3), 365 -376.
Wessells, N. K. (1977). The role of mesenchyme. In Tissue interactions in
development. (N. K. Wessells, Editor) pp 243. Benjamin-Cummings
Publishers, Menlo Park, CA.
Wilson, P. A., Scott, J., Penschow, J., Coghlan, J., and Rush, R. A. (1986).
Identification and quantification of mRNAfor nerve growth factor in histological
preparations. Letters of Neuroscience 64(3), 323 -329.
Woodard, A., Garciacute, C., Leong, M., Madri, J., Sessa, W., and Languino, L.
(1998). The synergistic activity of alphav(33 integrin and PDGF receptor
increases cell migration. Journal of Cell Science 1 1 1 (4), 469 - 478.
Wu, J. E., and Santoro, S. A. (1996). Differential expression of integrin alpha
subunits supports distinct roles during lung branching morphogenesis.
Developmental Dynamics206 (2), 169 - 181.
Yamachika, S., Nanni, J. M., Nguyen, K. H. T., Garcas, L, Lowrey, J. M.,
Robinson, C. P., Brayer, J., Oxford, G. E., da Silveria, A., Kerr, M., Peck, A. B.,
and Humphreys-Beher, M. G. (1998). Excessive synthesis of matrix
metalloproteinases in the exocrine tissues of the NOD mouse models for
Sjógrens syndrome. Journal of Rheumatology (Accepted for publication).
Yamamoto, H., Ishibashik., Nakagawa, Y., Maeda, N., Zeng, T., Robinson, C.
P., Oxford, G. E., Chegini, N., and Humphreys-Beher, M. G. (1997). Detection
of Alterations in the Levels of Neuropeptides and Salivary Gland Responses
in the Non-Obese Diabetic Mouse Model for Autoimmune Sialoadentitis.
Scandinavian Journal of Immunology A 5, 55 - 61.

148
Yao, C. C., Ziober, B. L, Squillace, R. M., and Kramer, R. H. (1996). Alpha 7
integrin mediates cell adhesion and migration on specific laminin isoforms.
Journal of Biological Chemistry 271 (41), 25598 - 25603.
Yeh, Y-C., Guh, J-Y, Yeh, J, and Yeh, H-W. (1989). Transforming growth factor
type alpha in normal human adult saliva. Molecular and Cellular
Endocrinology 6 7, 247 - 255.
Young, J. A., van Lennep, E. W. (1979). Transport of salivary and salt glands.
In Membrane Transport in Biology (G. Giebisch, Editor) pp. 563 - 692.
Springer-Verlag Publishers, New York, NY.
Yura, Y., Kusaka, J., Kondo, Y., Tsujimoto, H., Yoshida, H., and Sato, M.
(1995). Inhibitory effect of tyrophostin on the replication of herpes simplex
virus type 1. Archives of Virology 140(7), 1181 -1194.
Zachariasen, R. D. (1996). Diabetes Meliitus and Xerostomia. Compendium
Continuing Education in Dentistry Vo I XIII 4, 314 - 320.

BIOGRAPHICAL SKETCH
Gregory E. Oxford is the first son of Clarence and Anne Oxford. As a
child, Dr. Oxford was afforded the opportunity to spend many years abroad
due to his father’s employment. He returned to the states to attend college.
Dr. Oxford completed his undergraduate as well as dental professional
studies at Emory University in Atlanta, Georgia. He then entered the United
States Navy where he reached the rank of Commander in only 10 years of
service by accelerated promotions. Dr. Oxford received his surgical training in
periodontology at the Naval Hospital Bethesda and completed a research
study evaluating regenerative periodontal techniques. After his residency he
completed his Master of Science degree prior to pursuing a Ph.D. at the
University of Florida College of Medicine.
Dr. Oxford’s research interests date to dental school where he was
involved in projects evaluating the chemotactic defects associated with
polymorphonuclear leukocytes in juvenile periodontitis in the laboratory of Dr.
Thomas Van Dyke. His current research, in the laboratory of Dr. Michael G.
Humphreys-Beher, involved the evaluation of a cell-surface
glycosyltransferase, |31,4-galactosyltransferase, and its expression and role in
morphogenesis and development, using the mouse salivary gland as an
149

150
organ culture system. Additional studies evaluating salivary levels of growth
factors has combined his clinical and laboratory expertise. He has also been
involved in other clinical periodontal research at the University as a calibrated
clinical examiner for the Periodontal Disease Research Center at the
University of Florida College of Dentistry and as Co-Director of the Graduate
Periodontology Program at the College of Dentistry.
Dr. Oxford is a recognized expert in the field of periodontology. He
received his Diplómate status by achieving board certification in 1994. He is
also an Expert Witness for the State of Florida Board of Dentistry Department
of Business and Professional Regulation for which he evaluates periodontal
cases. He is a member of numerous societies and organizations and lectures
nationally and internationally. He is an author on numerous publications on a
wide variety of scientific and clinical topics. Following graduation from this
program Dr. Oxford desires to continue his involvement in research, teaching
and clinical practice of periodontics.

I certify that I have read this study and that in my opinion it conforms to
acceptable standards of scholarly presentation and is fully adequate, in scope
and quality, as a dissertation for the degree of Dpctor of Philosophy.
Michael G. HumphreyS/Beher, Chairman
Professor of Oral Biology
I certify that I have read this study and that in my opinion it conforms to
acceptable standards of scholarly presentation and is fully adequate, in scope
and quality, as a dissertation for the degree of Doctpf of Philosophy.
Arnold S. Bleiweis
Graduate Research Professor of Oral Biology
I certify that I have read this study and that in my opinion it conforms to
acceptable standards of scholarly presentation and is fully adequate, in scope
and quality, as a dissertation for the degree of Doctor of Philosophy.
íáaáÁ(/, [~Á4
William P. McArthur
Professor of Oral Biology
I certify that I have read this study and that in my opinion it conforms to
acceptable standards of scholarly presentation and is fully adequate, in scope
and quality, as a dissertation for the degree of Doctor pT^3hilpsophy.
Gregory S^Schyjfz
Professor of Biochemistry ah
Biology
This dissertation was submitted to the Graduate Faculty of the College
of Medicine and to the Graduate School and was accepted as partial
fulfillment of the requirements for the degree of Doctor of Philosophy.
December, 1998