Citation
Mechanisms for genetically predetermined differential quantitative expression of HLA-A and -B antigens

Material Information

Title:
Mechanisms for genetically predetermined differential quantitative expression of HLA-A and -B antigens
Creator:
Liu, Kui, 1965-
Publication Date:
Language:
English
Physical Description:
ix, 87 leaves : ill. ; 29 cm.

Subjects

Subjects / Keywords:
Antigens ( jstor )
Cell lines ( jstor )
Gels ( jstor )
Genes ( jstor )
HLA A antigens ( jstor )
HLA antigens ( jstor )
Messenger RNA ( jstor )
Polymerase chain reaction ( jstor )
Reverse transcriptase polymerase chain reaction ( jstor )
RNA ( jstor )
Base Sequence ( mesh )
Department of Pathology, Immunology and Laboratory Medicine thesis Ph.D ( mesh )
Dissertations, Academic -- College of Medicine -- Department of Pathology, Immunology and Laboratory Medicine -- UF ( mesh )
Gene Expression ( mesh )
Gene Expression Regulation ( mesh )
Genes, MHC Class I ( mesh )
HLA-A Antigens ( mesh )
HLA-B Antigens ( mesh )
Molecular Sequence Data ( mesh )
Organ Specificity ( mesh )
Research ( mesh )
Genre:
bibliography ( marcgt )
non-fiction ( marcgt )

Notes

Thesis:
Thesis (Ph.D.)--University of Florida, 1998.
Bibliography:
Bibliography: leaves 73-86.
General Note:
Typescript.
General Note:
Vita.
Statement of Responsibility:
by Kui Liu.

Record Information

Source Institution:
University of Florida
Holding Location:
University of Florida
Rights Management:
The University of Florida George A. Smathers Libraries respect the intellectual property rights of others and do not claim any copyright interest in this item. This item may be protected by copyright but is made available here under a claim of fair use (17 U.S.C. §107) for non-profit research and educational purposes. Users of this work have responsibility for determining copyright status prior to reusing, publishing or reproducing this item for purposes other than what is allowed by fair use or other copyright exemptions. Any reuse of this item in excess of fair use or other copyright exemptions requires permission of the copyright holder. The Smathers Libraries would like to learn more about this item and invite individuals or organizations to contact the RDS coordinator (ufdissertations@uflib.ufl.edu) with any additional information they can provide.
Resource Identifier:
029684586 ( ALEPH )
49847400 ( OCLC )

Downloads

This item has the following downloads:


Full Text










MECHANISMS FOR GENETICALLY PREDETERMINED DIFFERENTIAL
QUANTITATIVE EXPRESSION OF HLA-A AND -B ANTIGENS













By

Kui Liu
















A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLQRIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 1998














ACKNOWLEDGMENTS



I would like to express my appreciation to Dr. Kuo-Jang Kao, Chairman of my supervisory committee, for his guidance, support, understanding, encouragement and friendship. I would like to thank the members of my supervisory committee, Drs. Wayne McCormack, Juan Scornik, Maurice Swanson and Edward Wakeland for their very helpful discussions and suggestions. I would like to thank Ms. Sandra Donahue for her technical assistance. I would also like to thank Dr. Michael A. Frohman for his help in the RACE experiments.

I greatly appreciate the understanding from my parents, the love from my wife and my son, Liying and Alan.














TABLE OF CONTENTS


Due

ACKNOWLEDGMENTS .......................................................................... ii

L IST O F T A B L E S ................................................................................... v

L IST O F F IG U R E S ................................................................................ vi

A B S T R A C T ........................................................................................ v iii

CHAPTERS

I IN T R O D U C T IO N .......................................................................... I

Biochemistry of Class I HLA Molecules ................................................ I
Organization Of Class I HLA Genes ..................................................... I
Polymorphism and Phenotypes of Class I HLA Antigens ............................ 2
Function of Class I HLA Antigens ................................................... ... 4
Association of Class I HLA Antigens with Diseases ................................... 6
Controlling Steps in Gene Expression ................................................... 7
Regulation of Quantitative Class I HLA Gene Expression ............................ 9
Functional Importance of Quantitative Expression of HLA Antigens .............. I I
Quantitative Differential Expression of HLA-A and -B antigens ................... 12

2 MEASUREMENT OF RELATIVE QUANTITIES OF DIFFERENT
HLA-A AND -B MRNAS IN CELLS BY REVERSE TRANSCRIPTION
-POLYMERASE CHAIN REACTION AND DENATURING
GRADIENT GEL ELECTROPHORESIS ............................................. 15

In tro d u ctio n ................................................................................. 15
M aterials and M ethods .................................................................... 16
R e su lts ....................................................................................... 2 1
D iscu ssion .................................................................................. 2 7

3 MECHANISMS FOR DIFFERENTIAL QUANTITATIVE
EXPRESSION OF HLA-A AND -B ANTIGENS IN
LYMPHOBLASTOID, CELL LINES ................................................... 30

In tro du ctio n ................................................................................. 3 0
M aterials and M eth ods .................................................................... 32
R e su lts ...................................................... ................................ 3 8
D iscu ssio n .................................................................................. 4 7




iii








4 IN VITRO TRANSLATION STUDY OF HLA-A24 AND -B60 MRNAS ....... 53

Introdu ction ................................................................................. 53
Materials and Methods .................................................................... 53
R e su lts ....................................................................................... 5 8
D isc u ssio n .... ............................................................................. 6 4

5 SUMMARY AND FUTURE DIRECTION ............................................ 68

R E F E R E N C E S ...................................................................................... 73

BIOGRAPHICAL SKETCH ...................................................................... 87










































iv














LIST OF TABLES

Table page

1. Relative quantities of HLA-A and -B mRNAs in lymphoblastoid cell lines measured by RT-PCR/DGGE and S 1 nuclease protection assay ................. 26
2. Relative quantities of HLA proteins and mRNAs in ten different lymphoblastoid cell lines (L C L s) ....................................................................... 40

3. 5' end sequences of HLA-A24 and -B60 mRNAs .................................... 59

4. Contribution of different controlling steps to the regulation of differential
quantitative expression of different HLA-A and -B antigens in the studied
L C L s .................................................................................. 7 2

































V














LIST OF FIGURES

Figure page

1. General organization for class I HLA genes ....................................... 2

2. Optimal cycles for quantitative RT-PCR ............................................. 22

3. HLA RT-PCR products measured as a function of different amounts of
total cytoplasm ic RN A ............................................................... 23

4. Identification of RT-PCR products of different HLA-A and -B mRNAs
by D G G E .............................................................................. 24

5. DGGE separation of RT-PCR products of HLA-A and -B mRNAs
isolated from LCLs carrying heterozygous HLA-A and -B antigens ............. 24

6. Validation of using RT-PCR and DGGE for measuring relative
quantities of different HLA m RN As .................................................. 25

7. Quantitation of HLA-A24 and -B60 mRNAs in 9075 lymphoblastoid
cell line using S 1 nuclease protection assay ......................................... 26

8. Turnover of 35S-methionine-labeled HLA-A and -B proteins in
lymphoblastoid cell lines (LCLs) ................................................... 39

9. IEF-immunoblot of HLA-A and -B antigens from nine different
lym phoblastoid cell lines ........................................................... 41

10. The effect of DRB treatment on HLA mRNA levels ............................ 43

11. Turnover of HLA-A and -B mRNAs in LCLs .................................... 44

12. PCR-based nuclear run-on in four LCLs .......................................... 45

13. Presence of abundant unspliced HLA transcripts in nuclei ..................... 45

14. Experimental design for study of HLA mRNA production ........................ 46

15. Measurements of the relative quantities of nuclear and cytoplasmic HLA-A and -B transcripts by using quantitative RT-PCR/DGGE and
phosphor imaging in seven lymphoblastoid cell lines ............. ........... 49

16. The 3'-UTR sequences for HLA-A24 and -B60 mRNAs ....................... 60





vi








17. Cloning of HLA-A24 and -B60 heavy chain cDNAs by PCR ...................62

18. In vitro translation study of HLA-A24 and HLA-B60 mRNAs ..................63




















































vii














Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy

MECHANISMS FOR GENETICALLY PREDETERMINED DIFFERENTIAL
QUANTITATIVE EXPRESSION OF HLA-A AND -B ANTIGENS By

Kui Liu

December 1998


Chairman: Dr. Kuo-Jang Kao
Major Department: Department of Pathology, Immunology and Laboratory Medicine


Earlier studies have shown that different specific HLA-A and -B antigens are

differentially expressed in cells. Their relative quantities are genetically predetermined and inherited according to Mendelian law. To investigate the mechanisms responsible for the quantitative differential expression of HLA antigens, a simple and reliable method using RT-PCR and DGGE was developed to measure the relative quantities of HLA-A and -B mRNAs in cells. When the relative quantities of different HLA-A and -B proteins expressed in ten different HLA-phenotyped lymphoblastoid cell lines (LCLs) were correlated with the relative amounts of their respective mRNAs in cytoplasm, it was shown that HLA protein levels are proportional to their mRNA levels except for the cell lines that were positive for HLA-A24 and -B7. This finding suggests that different protein translational efficiencies could play some role in affecting differential expression of HLA antigens. An in vitro translation study using HLA-A24 and -B60 mRNAs supports the hypothesis that HLA-A24 mRNAs are more efficient in synthesizing HLA heavy chains. To determine the stability of different HLA-A and -B antigens expressed in HLA-phenotyped LCLs, it was found that different HLA-A and -B antigens have


viii









similar turnover rates. Measurement of the relative quantities of HLA-A and -B mRNAs in seven LCLs before and after treatment with DRB, an inhibitor of RNA polymerase II, showed that different specific HLA-A and -B mRNAs in five LCLs have the same turnover rates and that HLA-A and -B mRNAs are not proportionally degraded in the other two LCLs. Measurement of the relative quantities of different HLA-A and -B premRNAs in nuclei showed that they are not proportional to those of mature cytoplasmic mRNAs in five of seven HLA-phenotyped LCLs. All these findings indicate that the quantitative differential expression of HLA-A and -B antigens is regulated by a combination of multiple steps. These steps include gene transcription, pre-mRNA splicing, mRNA degradation and/or mRNA translation, depending on specific HLA alleles in different individuals. Despite the complexity of regulating the differential quantitative expression of HLA antigens, all the aforementioned mechanisms are encoded in the sequences of HLA gene. These findings support the earlier observations that relative quantities of different HLA-A and -B antigens are genetically predetermined, and directly linked to HLA-A and -B genes and inherited according to Mendelian laws.

























ix













CHAPTER 1
INTRODUCTION



Biochemistry of Class I HLA Molecules



Class I HLA molecules are polymorphic membrane glycoproteins and consist of two noncovalently associated polypeptide chains -- a heavy chain of 44 kD encoded by the classical class I HLA genes (HLA-A, -B, and -C) and an invariant light chain of 12 kD encoded by a non-MHC gene, 12 microglobulin (12m) (Srivastava et al., 1985). The HLA heavy chain is a type II transmembrane protein comprising a cytoplasmic carboxyl terminal domain, a transmembrane segment, and three extracellular domains known as l, o2 and c3. The cl and the c2 domains contain most polymorphic amino acid sequences and form a binding groove for antigenic peptides. This peptide-binding groove consists of an eight-stranded antiparallel 1-sheet flanked by two parallel strands of U.helices (Bjorkman and Parham, 1990). The binding groove can accommodate antigenic peptides of eight to ten amino acids in a flexible, extended conformation (Falk et al., 1991). However, an earlier study also showed that peptides consisting of twelve amino acids can bind to class I HLA molecules (Bednarek et al., 1991).



Organization Of Class I HLA Genes


Genes for class I HLA heavy chains are located on the short arm of chromosome 6, and the gene for 1P2m is on chromosome 15. There are three loci for classical class I HLA genes. All three functional HLA class I genes share a very similar genomic



1





2

organization and are responsible for encoding HLA-A, -B, and -C heavy chains. Each class I HLA gene consists of eight exons, and the exon-intron organization reflects the domain structure of the molecule (Figure 1). The exon 1 encodes the 5'-untranslated region (5'-UTR) and the signal sequence, and the exons 2, 3 and 4 encode the al, X2, and 3 (immunoglobulin-like extracellular region) domains of HLA heavy chains, respectively. The transmembrane region (TM) is encoded by exon 5, and the cytoplasmic tail (CY 1 and CY2) and the 3'-untranslated region (3'-UTR) are encoded by exons 6-8 (Srivastava et al., 1985; Ways et al., 1985). There are only minor differences among HLA-A, -B and -C genes at these three different loci. HLA-B genes, unlike HLA-A and -C genes, do not have coding sequences in exon 8. HLA-C genes contain extra three nucleotides in exon 5 (Davidson et al., 1985; Strachan et al., 1984). These three nucleotides are not present in HLA-A and -B genes. In addition to these three functional classical HLA class I genes, there are also three nonclassical HLA class I genes, HLA-E, -F and -G, and several pseudogenes (Le Bouteiller, 1994).



Sexton I intron

1 2 3 4 5 6 7 8
HLA gene a/ / rd //////=

promoter
HLA class protein TM- transmembrane domain
HLA class Iprotein axl Ia2 Ia3 domai
CY- cytoplasmic domain

Figure 1 General organization for class I HLA genes



Polymorphism and Phenotypes of Class I HLA Antigens



One of the important features of class I HLA gene products is a high degree of polymorphism. At present, there are at least 86 alleles for HLA-A locus, 186 alleles for





3

HLA-B locus, and 46 alleles for HLA-C locus (Bodmer et al., 1997; Mason and Parham, 1998). The structural basis of allelic polymorphism has been well characterized by direct comparison of protein and nucleotide sequences (Parham et al., 1995; Parham et al., 1988). The observed protein polymorphism is due to amino acid substitutions. Most polymorphic amino acid residues are confined to the peptide-binding region in ccl and u,2 domains and contribute to varying peptide-binding specificities of class I HLA molecules (Parham et al., 1988). The HLA polymorphism is therefore responsible for presenting large numbers of diverse antigenic peptides restricted to specific HLA molecules (Bjorkman and Parham, 1990). Despite significant degrees of variations in nucleotide and amino acid sequences, HLA alleles at the same locus are evolutionally more closely related to one another than HLA alleles at other loci.

Traditionally, phenotypes of class I HLA antigens are determined serologically. This approach is based on complement-mediated lymphocytotoxicity and was originally developed by Terasaki and McClelland (Terasaki et al., 1978). In this assay, peripheral blood lymphocytes are incubated with an antiserum containing specific anti-HLA antibodies. The binding of antibodies to lymphocytes is then detected by adding heterologous complement. Subsequent cell death induced by the activated complement is scored after staining with eosin-Y or other vital dyes. Although the microlymphocytotoxicity assay for typing HLA antigens is sensitive and convenient, this assay suffers from cross-reactivity and limited specificity of typing sera.

Another technique that has been used to identify the phenotypes of class I HLA

antigens is isoelectric focusing (IEF) gel electrophoresis (Yang, 1989). In this method, the HLA class I antigens are digested with neuraminidase and separated on IEF gels based on their isoelectric points. The separated HLA heavy chains are then detected by class I HLA specific antibody. This technique is able to resolve the subtypes of various HLA antigens that can not be differentiated by the lymphocytotoxicity assay. However, some HLA





4

subtypes remain unresolvable by IEF gel electrophoresis. The IEF approach is also technically cumbersome.

More recently, molecular biology techniques have been applied to DNA sequencebased HLA typing (Allen et al., 1994; Bidwell, 1994; Gao et al., 1994; Oh et al., 1993; Tiercy et al., 1994). Three commonly used approaches are: (1)locus-specific PCR followed by hybridization with sequence-specific oligonucleotides; (2) one-step PCR with sequence-specific primers; (3) locus-specific PCR followed by DNA sequencing (Bidwell, 1994). These typing methods provide the most accurate results. However, these new techniques are laborious.



Function of Class I HLA Antigens


Functionally, class I HLA antigens play important roles in the host immune system. They are expressed on almost all cells including anucleated red blood cells and platelets (de Villartay et al., 1985; Everett et al., 1987; Mueller-Eckhardt et al., 1985; Rivera and Scornik, 1986). After being synthesized, HLA heavy chain and 32m form heterodimers in the endoplasmic reticulum (ER), where they are loaded with peptides generated from cytosol by the proteasome. The proteasome is a multisubunit ATP-dependent protease that plays the major role in normal turnover of cytosolic proteins (Pamer and Cresswell, 1998; Tanaka et al., 1997). The peptides generated by the proteasome are translocated into the ER by the transporter associated with antigen processing (TAP), which is a heterodimeric protein that belongs to the ATP-binding cassette transporter family (Momburg and Hammerling, 1998). Before binding with the antigenic peptide, a transient complex containing a class I heavy chain and a 132m is assembled onto the TAP molecule by successive interactions with the ER chaperones calnexin, calreticulin and tapasin. The current model suggests that, before binding antigenic peptides, newly synthesized HLA heavy chains first bind calnexin. After 32m binds, calnexin is exchanged for calreticulin.





5


Then tapsin mediates the association of the HLA class I heavy chain-132m-calreticulin complex wilh TAP which provides the peptides for the assembly of class I HLA antigen. After binding of the antigenic peptide, the HLA molecules are transported to the cell surface (Pamer and Cresswell, 1998). The misfolded class I heavy chains without 32massociation or peptide-binding are translocated to the cytoplasm and degraded by the proteasome (Hughes et al., 1997).

The antigen peptides presented by class I HLA molecules include peptides of host and non-host cellular proteins. The latter include the proteins derived from invading virus, bacterium, or protozoan parasite. The presentation of pathogen-encoded or host tumor antigenic peptides by class I HLA molecules on cells plays a crucial role in immune elimination of tumor cells or pathogen-infected cells by CD8' T cells (Bjorkman et al., 1987; Monaco, 1992). The presentation of peptides by class I MHC molecules in the thymus also plays a crucial role in the selection and maturation of CD8 T cells. During this process, the CD8' T cells bearing the T cell receptors with high affinity to self antigens are negatively selected, whereas those with lower affinity to self antigens in the context of self MHC molecules are positively selected to mature and leave the thymus to populate peripheral lymphoid tissues (Robey and Fowlkes, 1994).

In addition, the expression of class I HLA molecules on cells has been implicated in protecting host cells from destruction by autologous natural killer cells (Ciccone et al., 1994; Kaufman et al., 1993; Litwin et al., 1993). The existence of inhibitory NK cell receptors for polymorphic classical HLA class I molecules prevents the attack of normal host cells by NK cells and could be responsible for elimination of the cells lacking sufficient expression of HLA class I molecules (Lanier, 1998). It has also been shown that peptides derived from signal sequences of HLA class I heavy chains can be presented to NK cells by a non-classical HLA class I molecule, HLA-E (Braud et al., 1998).

Due to the highly polymorphic nature of class I HLA antigens, they are responsible for the immune rejection of allografts in transplant recipients (Hood et al., 1983).





6

Although HLA matching between recipient and donor does not in itself completely prevent rejection of allografts, it significantly improves the clinical outcome for allogeneic organ transplantation. Despite the proven success of matching HLA antigens for transplantation, unrelated individuals who are serologically typed as HLA-identical often do not share identical HLA antigens due to limited availability to differentiate various HLA subtypes by serological assays (Mantovani et al., 1995; Speiser et al., 1996). The use of molecular biology techniques for HLA typing at the level of DNA sequence will further prevent mismatches and may improve the results for allograft transplantation.


Association of Class I HLA Antigens with Diseases


Owing to their role in antigen presentation, class I HLA molecules are closely involved in the pathogenesis of various clinical conditions, which include infectious, autoimmune and neoplastic diseases. The association of certain HLA alleles with diseases has also been documented (Hall and Bowness, 1996; Hill, 1998). One of the strongest associations is the association of HLA-B27 with ankylosing spondylitis. It has been shown that HLA-B2701, 02, 04 and 05 are associated with the development of ankylosing spondylitis (Breur-Vriesendorp et al., 1987; D'Amato et al., 1995; Hill et al., 1991a; Lopez-Larrea et al., 1995). Associations of HLA-B51 with Behcet's disease, HLA-B52 and HLA-B3902 with Takayasu's arteritis, HLA-A2902 with birdshot retinitis, and HLAB27 with reactive arthritis have also been reported (Brewerton et al., 1974; Laitinen et al., 1977; LeHoang et al., 1992; Mizuki et al., 1993; Mizuki et al., 1992; Toivanen et al., 1994; Yoshida et al., 1993). The underlying pathogenic mechanisms for these associations are still unclear. It is likely that their roles may be associated with peptide binding specificity by different HLA molecules and/or by thymic selection of specific T cell repertoire responsible for the diseases (Hall and Bowness, 1996).





7


For infectious diseases, HLA-B53 has been shown to be associated with the

protection from severe malaria (Hill et al., 1991 b). It is likely that HLA-B53 molecules may confer the resistance by presenting a plasmodium-derived peptide to CTL for mounting an effective immune response (Hill et al., 1991 a; Hill et al., 1992). Undoubtedly, further understanding of the functional importance of HLA antigens in determining host defense and disease susceptibility will be made in the near future when more information becomes available.



Controlling Steps in Gene Expression



The mechanism for gene expression has been extensively studied. Gene expression can be controlled at multiple steps, including gene transcription, pre-mRNA processing, mRNA trafficking, mRNA degradation, mRNA translation, and protein turnover. It is generally believed that gene transcription is the most critical step in controlling gene expression. Gene transcription can be regulated by many cis-acting elements and transacting factors (Olave et al., 1997; Yanofsky, 1992). The TATA box in the promoters of various genes is crucial because it serves as a common recognition site for transcription factor TFIID and for the assembly of the RNA polymerase II initiation complex. There are also enhancers and silencers that bind various trans-regulating factors. To initiate transcription of a gene, at least six different transcription factors together with RNA polymerase II are required to form a transcriptionally competent preinitiation complex (Olave et al., 1997; Yanofsky, 1992). Regulation of transcription therefore can be accomplished by controlling assembly of the preinitiation complex or the catalytic efficiency of RNA polymerase II during initiation, elongation, or termination (Hampsey, 1998). The detailed mechanisms for transcription and its regulation remain to be elucidated.

Processing of pre-mRNA by capping, splicing, editing and polyadenylation is also important in regulating availability of mature mRNA for protein synthesis. For pre-mRNA





8


splicing, the assembly of a spliceosome, consisting of a pre-mRNA, protein factors and small nuclear ribonucleoproteins (snRNPs), is required (Moore and Sharp, 1993). Thus, the splicing of pre-mRNA is regulated through assembly of the spliceosome. In some cases, pre-mRNAs can be spliced in alternative ways leading to the production of different isoforms of proteins (Hodges and Bernstein, 1994). It appears that alternative splicing in many systems is controlled through regulation of the amount, the distribution, and/or the activity of constitutive splicing factors in cells (Bernstein and Hodges, 1997). It has also been demonstrated that alternative splicing can be affected by differences in the strength of competing 3' and 5' splice sites, large distances between polypyrimidine tracts and 3' splice sites, size of the involved exon, steric constraints on splicing factor binding, and alternative polyadenylation sites (Balvay et al., 1993; Brady and Wold, 1987; Carstens et al., 1998; Elrick et al., 1998; Eperon et al., 1988; Furdon and Kole, 1988; Heinrichs et al., 1998; Jin et al., 1998; Lim and Sharp, 1998; Nelson and Green, 1990; Norbury and Fried, 1987; Peterson et al., 1994; Solnick, 1985; Solnick and Lee, 1987; Sterner and Berget, 1993; Watakabe et al., 1989).

Gene expression is also regulated by degradation and stability of mRNA. After export of mRNA from the nucleus to the cytoplasm, the stability and turnover of mRNA can contribute significantly to the control of gene expression through regulation of the available mRNA for protein synthesis (Ross, 1995). Different mRNAs can have different intrinsic rates of turnover (Cabrera et al., 1984; Carneiro and Schibler, 1984). Many examples for regulation of gene expression by modulation of mRNA decay have been documented (Caponigro and Parker, 1996; Ross, 1995). Stability of mRNA can regulated by cis-acting elements within the mRNA molecule. These cis-acting elements serve as recognition sites for various regulatory proteins including poly(A)-binding protein (PABP), AU-rich element (AURE)-binding proteins (AUBPs) and other proteins that bind to the 3'UTRs or coding regions of mRNAs (Beelman and Parker, 1995; Ross, 1995; Ross, 1996; Sachs, 1993). The aforementioned cis-elements can positively or negatively modulate





9


mRNA stability, and are present throughout the mRNA molecule in 5'-UTR, the coding region and 3'-UTR (Tharun and Parker, 1997).

Translation of mRNA is another step in regulating gene expression, and it can be regulated by modulating the rate of translational initiation and/or sequestering mRNAs in translationally inaccessible messenger ribonucleoprotein (mRNP) (Curtis et al., 1995). The concentration of active initiation factors and the primary sequence of the 5'-UTR have been shown to influence the rate of mRNA translation (Devarajan et al., 1992; Hess and Duncan, 1994; Kanaji et al., 1998; Lincoln et al., 1998; Thach, 1992). The sequence flanking the translation initiator AUG, 5' cap, the secondary structure in the 5'-UTR, the presence of alternative translation initiation sites and the length of 5'-UTR have been shown to determine the intrinsic translational efficiency of mRNAs (Bhasker et al., 1993; Falcone and Andrews, 1991; Gallie, 1991; Gallie and Tanguay, 1994; Gambacurta et al., 1993; Gray and Hentze, 1994; Iizuka et al., 1994; Ito et al., 1990; Lawson et al., 1986; Lopez-Casillas and Kim, 1991; Pinto et al., 1992; Rao and Howells, 1993; Sedman et al., 1990; Yun et al., 1996). The poly(A) tail at the 3' ends of eukaryotic mRNAs also can serve as an enhancer for mRNA translation (Jacobson, 1996).

Therefore, it is of interest to learn how these different controlling steps are involved in regulating differential quantitative expression of various specific HLA-A and -B antigens in cells.



Regulation of Quantitative Class I HLA Gene Expression



The expression of class I HLA genes in cells is regulated both positively and

negatively by the interaction of different trans-acting factors with cis-regulatory elements at the genomic level as mentioned earlier. This subject has been reviewed in detail previously (David-Watine et al., 1990). The molecular mechanisms for regulating the expression of class I MHC genes has only been partially elucidated. The transcription of class I HLA





10


genes is controlled by different regulatory elements in the 5-flanking region. The cisregulatory elements that have been identified include promoter sequences (TATA box, CCAAT box), the class I regulatory elements (CRE/enhancer A), KB enhancer elements, an interferon response sequence (IRS), the negative regulatory element (NRE), and the R x R3 binding motif. Various trans-acting factors for these elements have also been described (Blanar et al., 1989; Driggers et al., 1990; Kieran et al., 1990; Waring et al., 1995; Yano et al., 1987).

As mentioned earlier, alternative splicing of pre-mRNAs may regulate gene

expression by diverting some of the gene transcripts into synthesizing different forms of proteins. It has been shown that class I HLA antigens are present in water-soluble form in plasma (Charlton and Zmijewski, 1970; Kao, 1987; Krangel, 1987; Rood et al., 1970). Further biochemical analysis demonstrated that the 39-kD water-soluble form of class I HLA heavy chain is the translation product of an alternatively spliced HLA mRNA without exon 5 (Haga et al., 1991). Because exon 5 encodes the transmembrane domain, the protein product of the mRNA without transmembrane domain is secreted into extracellular fluids. The presence of high concentrations of water-soluble form of HLA antigens has been associated with HLA-A24 phenotype (Adamashvili et al., 1996; Kao et al., 1988; Krangel, 1987). At present, it is not known how alternative splicing could affect HLA expression on cells. Because the alternatively spliced HLA transcripts are only present in low quantities in cells (Haga et al., 1991), it is unlikely that alternative splicing plays a significant role in regulating quantitative HLA expression.

The assembly and transportation of the class I HLA-p2m-peptide complex also can affect the expression of class I HLA antigens on the cell surface. It has been shown that class I HLA antigens are absent on the cell surface of f32m-deficient cells, and that the expression of class I HLA antigens can be restored after the cells are transfected with 132m (Ljunggren et al., 1990; Powis et al., 1991; Tarleton et al., 1992). Because the antigenic peptides are essential for the assembly of class I HLA antigens, both generation of





11


antigenic peptides in the cytoplasm and transportation of these peptides into ER are critical for the expression of class I HLA antigens. Inhibition of proteasomes can result in reduced availability of binding peptides and lead to decreased expression of class I MHC antigens on the cell surface (Benham and Neefjes, 1997; Grant et al., 1995). Mutation of TAPs can decrease the expression of HLA antigens by limiting the supply of antigenic peptides. Transfection of these mutant cells with native forms of TAP cDNAs is able to restore the normal expression of class I HLA antigens (Hughes et al., 1997). However, the availability of 32m or antigenic peptides does not appear to play a significant role in regulating quantitative expression of class I HLA in normal cells. For instances, polymorphism of TAPs does not affect quantitative expression of class I HLA (Daniel et al., 1997), and expression of different HLA-A and -B antigens in cells is proportionally upregulated during viral infection, interferon stimulation or transformation by EBV virus (Shieh and Kao, 1995). These findings suggest that antigenic peptides are present in abundance and readily available in ER for binding by different specific HLA-A and -B antigens. Therefore, the availability of antigenic peptide is not a rate-limiting step in controlling HLA expression in cells with normal functional proteasomes and TAPs. Although a great deal of information has been gained in how HLA expression is regulated in general, it is not known how different HLA-A and -B antigens are proportionally upregulated in cells in response to interferon or infection by certain viruses.


Functional Importance of Quantitative Expression of HLA Antigens



Many recent studies have concentrated on identifying the antigenic peptides that

bind to HLA molecules and little attention has been paid to potential functional importance of quantitative expression of HLA antigens. Earlier study (Bukowski and Welsh, 1985a) suggested that the upregulation of HLA expression during influenza virus infection could enhance the susceptibility of infected cells to CTLs. To further investigate the potential





12


quantitative importance of HLA antigens in determining the susceptibility to CTLs, Shieh and Kao conducted a series experiments and demonstrated a linear quantitative correlation between HLA-A2 antigens expressed on target cells and the susceptibility of these cells to HLA-A2 restricted CTLs (Shieh et al., 1996). These findings support the potential quantitative importance of HLA antigens. The importance of quantitative HLA expression is also supported by the findings that tumor cells or virus-infected cells can escape immune surveillance through down regulation of HLA expression (Bodmer et al., 1993; Honma et al., 1994; Ruiz-Cabello et al., 1991). In contrast, treatment with IFN-7 to restore MHC class I expression enhances the susceptibility of these cells to CTLs (Peltenburg et al., 1993; Versteeg et al., 1988; Versteeg et al., 1989b).

It has been known that during infection by certain viruses, such as adenovirus,

herpes simplex virus (HSV), human immunodeficiency virus (HIV) and cytomegalovirus (CMV), the expression of class I HLA antigens is greatly reduced (Anderson et al., 1985; Ehrlich et al., 1989; Gosgusev et al., 1988; Hill et al., 1995; Howcroft et al., 1993; Walev et al., 1992). The reduced expression of HLA antigens may contribute to the successful evasion of viruses from host cellular immune response. All of these findings support the functional importance of quantitative expression of HLA antigens. Both increased and reduced expression of HLA expression can influence the host susceptibility, severity and recovery from various clinical conditions as described above.



Quantitative Differential Expression of HLA-A and -B antigens



The regulation of quantitative expression of class I HLA antigens has been widely studied (Bishara et al., 1988; Gerrard et al., 1988; Girdlestone and Milstein, 1988; Hakem et al., 1989; Leeuwenberg et al., 1987; Masucci et al., 1989; Masucci et al., 1987; Ohlen et al., 1989; Shimizu and DeMars, 1989; Versteeg et al., 1989a; Zachow and Orr, 1989). The reported studies suggested that the expression of different HLA-A and -B genes are





13


differentially expressed and upregulated. However, most of these studies were conducted using tumor cell lines or cells transformed with class I ULA cDNA constructs or genes. For this reason, results obtained from these studies can not be extrapolated to native LILAA and -B genes in normal cells.

When the quantitative expression of native HLA genes was studied, it was found that the relative quantities of HLA-A and -B antigens in different types of cells of an individual are the same and remain unchanged over time (Kao, 1989; Kao and Riley, 1993). These findings suggest that the relative amounts of different class I LILA antigens expressed on cells are genetically predetermined. Subsequent studies of comparing the quantitative expression of different specific HLA antigens in members of different HLA phenotyped families confirmed that the differential quantitative expression of HLA-A and

-B antigens is linked directly to class I HLA genes and follows Mendelian inheritance (Kao and Riley, 1993). In addition, it was found that the relative amounts of different specific LILA antigens are proportionally amplified during up-regulated expression of total class I HLA antigens by interferon treatment, EBV transformation or infection with influenza viruses (Shich et al., 1996; Shieh and Kao, 1995). Because the amount of HLA antigens expressed on cells has been shown to proportionally affect the susceptibility of cells to cytotoxic T lymphocytes (Shieh et al., 1996), and the quantities of each specific HLA antigen expressed on cells may influence disease susceptibility, severity and recovery as discussed earlier, it is of importance to learn what mechanisms are employed to control the genetically predetermined quantitative differential expression of HLA-A and -B antigens. The goal of my dissertation research is to determine how varied quantitative expression of HLA antigens on cells of an individual is controlled by gene transcription, mRNA turnover, mRNA translation, and/or protein degradation. Specifically, experiments are conducted (t) to determine whether different HLA-A and -B proteins in cells are proportionally degraded; (2) to determine whether the relative quantities of HLA-A and -B antigens expressed in cells are proportionally correlated with the levels of mRNAs for these





14


antigens; (3) to determine whether mRNAs for different HLA-A and -B antigens in cells have the same stabilities; and (4) to determine whether different HLA-A and -B mRNAs are differentially produced.














CHAPTER 2
MEASUREMENT OF RELATIVE QUANTITIES OF DIFFERENT HLA-A AND -B
MRNAS IN CELLS BY REVERSE TRANSCRIPTION-POLYMERASE CHAIN
REACTION AND DENATURING GRADIENT GEL ELECTROPHORESIS


Introduction



As discussed in Chapter 1, class I HLA antigens are polymorphic membrane

glycoproteins that consist of a 44-kD heavy chain and a 12-kD invariant P32-microglobulin (Ploegh et a., 1981). The genes encoding HLA heavy chains are located at three different loci (A, B, C) of chromosome 6 (Ploegh et al., 1981). Functionally, class I HLA antigens play important roles in presenting antigen peptides to CD8' cytotoxic T cells (Zinkernagel and Doherty, 1979) and are essential for the development of CD8 CTLs in the thymus (Koller et al., 1990; Zijstra et al., 1990). The quantity of HLA antigens expressed on cells also play an important role in determining the susceptibility of virus-infected cells to CTLs (Bukowski and Welsh, 1985b; Shieh et al., 1996). Moreover, HLA-A and -B antigens are expressed in different quantities in cells according to Mendelian inheritance (Kao and Riley, 1993).

However, the molecular basis for the genetically predetermined differential

quantitative expression of class I HLA-A and -B antigens in cells remain unknown. In order to address this question, it is necessary to develop a method for measuring the relative quantities of different HLA-A and -B mRNAs in cells. Although several methods for quantitation of specific mRNAs are available including northern blot, S 1 nuclease or ribonuclease protection assay and quantitative reverse transcription-polymerase chain reaction (RT-PCR), none of these methods could be easily applied to our study due to technical complexity and/or problems of cross hybridization resulting from high degrees of 15





16


sequence homology for HLA mRNAs. We therefore exploited the simplicity of quantitative RT-PCR and the high resolution power of denaturing gradient gel electrophoresis (DGGE) to develop a simple and reliable method for measurement of the relative quantities of different HLA-A and -B mRNAs in cells. The procedures and the validation of this method are described herein.


Materials and Methods



Lymphoblastoid Cell Lines and RNA preparation

EBV-transformed lymphoblastoid cell lines (LCLs) with well characterized class I HLA phenotypes were obtained from the American Society for Histocompatibility and Immunogenetics Cell Repository (Yang et al., 1989) or developed in our laboratory (Shieh and Kao, 1995). These cell lines were maintained in RPMI 1640 medium (Life Technologies, Grand Island, NY) containing 10% fetal calf serum, 1% antibioticantimycotic solution and 40 gg/ml gentamycin. Total cytoplasmic RNA was isolated using the RNAeasy Total RNA Kit (QIAGEN Inc., Chatsworth, CA) according to the manufacturer's protocol.


Reverse Transcription of mRNAs

First-strand HLA cDNAs were prepared by reverse transcription of total

cytoplasmic RNA in 50 pl reverse transcription buffer containing 1.5 RM HLA-specific primers, 0.5 mM dNTP, 10 pM DTT, 100 U rRNasin (Promega Corp., Madison, WI) and 500 units M-MLV reverse transcriptase (Life Technologies, Grand Island, NY) at 370C for 2 hours. Thereafter, the reverse transcriptase was inactivated by heating at 990C for 5 min. The primer (5'-TTG AGA CAG AGA TGG AGA CA-3'), which is complementary to a nucleotide sequence conserved among all class I HLA-A, -B, and -C mRNAs in the 3'untranslated region (UTR) nucleotide sequence (Davidson et al., 1985), was used to





17


prepare the first-strand HLA cDNA containing the whole coding region. The synthesized cDNAs were subsequently used as templates for PCR to obtain the whole coding sequences for cloning. Another primer (5'-ACA GCT CC(A,G) (A,G)TG A (C,T)C ACA-3'), which is specific and complementary only to the nucleotide sequences of exon 5 of all class I HLA-A and -B genes, but not to those of HLA-C genes, was used to synthesize the first-strand HLA cDNA. The HLA-A and -B cDNAs then were used for quantitative RT-PCR to determine the relative amounts of different HLA-A and -B mRNAs by DGGE and phosphor imaging analysis. The use of this primer enables us to avoid possible interference by HLA-C mRNAs.


Polymerase Chain Reaction (PCR) and TA cloning

To obtain the whole coding sequences of class I HLA cDNA for cloning, a pair of primers that are specific for all class I HLA mRNAs and encompass the 5'-UTR and the 3'UTR nucleotide sequences of HLA mRNAs (Ennis et al., 1990) were used for PCR. The sequences of this pair of primers are 5'-GAA TCT CCC CAG ACG CCG AG-3' and 5'TCA GTC CCT CAC AAG ACA GC-3', respectively. The cDNA templates for PCR were prepared as described in the previous section. The PCR was performed in buffer containing 10 mM Tris-HC1, 1.5 mM MgCl2, 50 mM KC1, pH 8.3, supplemented with 0.2 mM of each dNTP, 0.5 gM of each primer and 2.5 units of Taq DNA polymerase (Boehringer Mannheim, Indianapolis, IN) in a volume of 100 [l for 25 cycles. Each cycle consisted of 94C denaturation for 1 min, 65C annealing for 1 sec and 72'C extension for

1.5 min. PCR products were cloned into a PCRTmII plasmid vector using a TA Cloning Kit (Invitrogen, San Diego). HLA specificities of the plasmids isolated from these TA clones were determined by automated DNA sequencing using Taq DyeDeoxyTM Terminator Cycle Sequencing Kit ( Applied Biosystems, Inc., Foster City, CA). The primer sequence for DNA sequencing is 5'-GCG ATG TAA TCC TTG CCG-3' and complementary to the nucleotides 429-446 of class I HLA coding sequence.





18


The nucleotide sequences of the primers used for quantitative PCR are 5'-CGC CGT GGA TAG AGC AGG-3' and 5'-GCG ATG TAA TCC TTG CCG-3', which are complementary to the conserved antisense and sense nucleotide sequences in exon 2 and exon 3 of all class I HLA mRNAs, respectively. Quantitative PCR was performed using the same conditions as described above in a volume of 50 jtl except annealing at 60'C for

0.5 min, extending at 72C for 1 min and amplified for 18 cycles. The HLA-A and -B cDNA prepared from cytoplasmic RNA was used as templates. 2P Labeling of The Primer for Quantitative PCR

Four hundred picomoles of a primer was labeled with 54 pmoles of [y-32P]ATP

(3000 Ci/mmol, 10mCi/ml) (Amersham Life Science, Inc., Arlington Heights, IL) in 80 1l pH 7.6 buffer containing 70 mM Tris-HC1, 10 mM MgCl2, 5 mM DTT and 40 units of T4 kinase (Promega, Madison, WI) at 37C for 1 hour. The free nucleotides were removed by Sephadex G-25 filtration. Specific activity of the labeled primer was about l x 10' cpm/pmole.



DGGE

DGGE was performed in 1 mm thick 6% polyacrylamide (acrylamide:

bisacrylamide = 19:1) gel using D-GENEm Denaturing Gradient Gel Electrophoresis System (Bio-Rad Laboratories, Hercules, CA). The polyacrylamide gel contained a linearly increasing denaturant gradient from 40% to 60%. The 100% denaturant contains 7 M urea and 40% (w/v) deionized formamide. Electrophoresis was performed at 60'C, 165 V for 2 to 34 hours in 40 mM Tris-acetate, pH 8.0, containing 1 mM EDTA (TAE). After electrophoresis, the gels were stained with ethidium bromide and photographed by using a Polaroid camera or Gel Print 2000i system (Bio Photonic, Corp., Ann Arbor, MI), or dried for autoradiography and phosphor imaging analysis. PCR product of each HLA-A or





19


-B mRNA in DGGE gel was identified by using PCR products prepared from the plasmids containing cloned HLA-cDNAs of known specificity.



Preparation of HLA mRNA Standards

HLA-A and -B cDNAs cloned in the PCRrmII vector (Invitrogen, San Diego, CA) were used for in vitro synthesis of the RNA standards. Five micrograms of plasmid was digested with 20 units of BamH I in a volume of 100 p.l at 37C for 2 hours. After confirmation of complete digestion by agarose gel electrophoresis, linearized plasmids were isolated by phenol/chloroform extraction and ethanol precipitation. One microgram of linearized plasmids were used as templates for in vitro transcription in a volume of 20 p.l at 37C for 4 hours using T7 RNA polymerase according to the manufacturer's protocol (MEGAscriptTM In Vitro Transcription Kits) (Ambion Inc., Austin, TX). After 4 hours incubation, 2 units RNase-free DNase I was added and incubated at 37C for 30 minutes to degrade the template DNA. The in vitro synthesized RNA transcripts were recovered with phenol/chloroform extraction and isopropanol precipitation. Free nucleotides were removed by RNeasy spin column separation (QIAGEN Inc., Chatsworth, CA) and ethanol precipitation. The concentrations of the synthesized RNA standards were measured by absorbance at 260 nm. These transcripts were used as standards for quantitative RT-PCR and S I nuclease protection assay.


S 1 Nuclease Protection (SNP) Assay for Quantitation of HLA-A and -B mRNAs in Lymphoblastoid Cell Lines

The DNA probes for S 1 nuclease protection assays were generated from plasmids in which the coding sequence 218-446 of HLA-A or -B mRNA was cloned. DNA containing this partial HLA-A or -B nucleotide sequence and the flanking polycloning site sequences in the vector was amplified using PCR with a pair of primers flanking the polycloning sites. The PCR products were then purified by agarose electrophoresis and





20


TM
Sephaglas BandPrep Purification Kit (Pharmacia LKB ), and used as templates for probe synthesis. The probes were synthesized by using an anti-sense primer that is complementary to the coding sequence between nucleotide 429 and 446 of HLA-A and -B mRNA, a Prime-A-Probe DNA labeling Kit (Ambion, Inc., Austin, TX) and labeled with [a2p]dATP. After gel purification, the DNA probes were used for quantitative S 1 nuclease protection assay using S 1-Assay Kit (Ambion, Inc., Austin, TX) according to the manufacturer's instruction. HLA-A and -B RNA transcripts synthesized from the cloned cDNAs were used to construct standard curves. For quantitation of HLA mRNAs, 0.5-1 tg of total cytoplasmic RNA was assayed in triplicates. The S 1 nuclease-digestion products were separated using a 6% denaturing polyacrylamide gel (8M urea). The protected DNA fragments were quantified by phosphor imaging. The amount of specific HLA-mRNA was determined from the standard curve.



Autoradiography, Phosphor Imaging and Densitometry

For autoradiography, the gels were exposed to Fuji Medical X-ray film (Fuji Photo Film Co., Ltd., Japan) for 3 hours (DGGE) or 48 hours (SNP assay) at -70'C. For phosphor imaging, the gels were exposed to a Phosphorscreen (Molecular Dynamics, Inc., Sunnyvale, CA) for 3 hours (DGGE) or 24 hours (SNP assay) at room temperature. The radioactivity of each specific DNA band was quantified using ImageQuant software (Molecular Dynamics, Inc., Sunnyvale, CA). For quantitation of DNA in agarose gels by densitometry, photographs of gels were scanned with a 600 dpi Microtek grayscale scanner ( Microtek, Inc., Torrance, CA) and analyzed by Collage 3.0 software (Fotodyne Inc., New Berlin, WI).





21


Results



Optimization of Quantitative RT-PCR

Although the amount of PCR products doubles after each cycle of PCR

amplification, it is known that the efficiency of amplification decreases with increasing numbers of amplification cycles. The reduced efficiency leads to uneven amplification and loss of proportional quantitative correlation between PCR products and original template numbers (Gause and Adamovicz, 1994). We therefore studied the amounts of PCR products as a function of PCR cycle numbers. The PCR products were measured using 32P-labeled primer, agarose gel electrophoresis and scintillation counting. It was found that the amounts of PCR products were increased logarithmically with the PCR cycle number as expected up to 18 cycles (Figure 2). After 18 cycles, the PCR began to generate less than the expected amounts of amplified products. Therefore, the cycles used for all our quantitative RT-PCR reactions for cytoplasmic HLA-A and -B mRNAs were 18.

Next, we studied the PCR products as a function of templates prepared from

different quantities of total cytoplasmic RNA. The amounts of RT-PCR products were measured according to fluorescent intensity in agarose gel by scanning densitometry and were linearly correlated with the quantities of templates prepared from 2.5 tg to 15 tg of total cytoplasmic RNA (Figure 3). The results of this experiment indicate that 15 [tg total cytoplasmic RNA can be used for quantitation of HLA mRNAs.


Separation and Identification of RT-PCR Products of Different HLA-A and -B mRNAs by DGGE

After quantitative amplification, PCR products of the polymorphic region of

different specific HLA-A and -B mRNAs were analyzed by DGGE. As shown in Figure 4, this technique successfully separated RT-PCR products of different HLA-A and -B mRNAs. To identify the HLA specificity of each DNA band in denaturing gradient gels, we cloned HLA cDNAs from the same cell lines into plasmids. These plasmids were used





22







o6



10
1.9006

CC 104 90 8.


.f... ....... 9005
090
E3 susan
Ideal
10 31
14 16 18 20 22
PCR Cycles

Figure 2 Optimal cycles for quantitative RT-PCR. The amounts of RT-PCR products for HLA-A and -B mRNAs were studied as a function of PCR cycles. The PCR products were measured by using a y2P end-labeled primer and scintillation counting of DNA products cut from agarose gels. The ideal relationship between PCR products and PCR cycles is shown as dotted line. Total cytoplasmic RNA (10g) from four lymphoblastoid cell lines were studied, 9067 (o), 9068 (x), 9005 (A) and SH (DJ).


as templates for PCR amplification. The PCR products of known HLA specificities were run on the same denaturing gradient gel to determine the identity of each unknown DNA band. As shown in Figure 4B, HLA specificity of each DNA band can be easily identified. When the same approach was applied to three HLA heterozygous LCLs, RTPCR products of different HLA-A and -B mRNAs were well resolved (Figure 5).


Measurement of Relative Quantities of Different HLA-A and -B mRNAs in The Same Sample by RT-PCR and DGGE

To determine whether RT-PCR and DGGE can be applied to measure the relative quantities of different HLA-A and -B mRNAs in a RNA sample, the following validation study was performed. First, the HLA-A24 and -B60 mRNA transcripts were generated by in vitro transcription from HLA cDNA plasmids and used as templates. The integrity of





23





40

)
30*0.
ocn
CL W"
4 20CL-a
'La)
r=0.981

0
L


0 5 10 15 20
RNA (gg)
Figure 3 HLA RT-PCR products measured as a function of different amounts of total cytoplasmic RNA. PCR was performed for 18 cycles. The PCR products were identified by agarose gel electrophoresis and ethidium bromide staining, and quantified by densitometry. Simple regression analysis shows a good linear correlation between the two parameters up to 15 gg cytoplasmic RNA.


these transcripts were confirmed by formaldehyde agarose gel electrophoresis which showed that these transcripts were of the expected correct size. The purified transcripts were quantified by absorbance at 260 nm wavelength. These two RNA transcripts were mixed in different ratios (4:1, 2:1, 1:1, 1:2,1:4) at a total amount of 1.5 ng and used for RT-PCR. The results shown in Figure 6 demonstrate that the relative amounts of RT-PCR products for HLA-A24 and -B60 mRNAs were linearly correlated with the relative quantities of the mRNA standards in the reverse transcription mixtures. The same results were obtained when different HLA mRNAs were used (data not shown). These results indicate that RT-PCR/DGGE and phosphor imaging quantitation can be used to determine the relative quantities of different HLA-A and -B mRNAs in the same sample.





24


(A) := = = =
0 0N 0 -4
( b p ) CD 1 "4 ",4 O U'
400
300

200



(B)
9005 9027 9067 9068 9075
A3 B27 A29 B44 A2 B27 A2 B35 A24 B60







Figure 4 Identification of RT-PCR products of different HLA-A and -B mRNAs by DGGE. (A) Polyacrylamide gel (6%) electrophoresis of RT-PCR products of HLA-A and
-B mRNAs from five different HLA-A and -B homozygous LCLs. The identification number of each cell line is shown at the top of each lane. (B) Separation of the RT-PCR products of each cell line in DGGE polyacrylamide gel (middle lane of each small panel). After staining with ethidium bromide, HLA specificity of each DNA band in the PCR products was identified using the PCR product generated from the plasmid containing HLA-cDNA of known specificity from the same cell line (left and right lanes of each small panel).



B7 A2 SH A3 B44 B7 A2 CG A3 B45 B35 All DC A24 B60








Figure 5 DGGE separation of RT-PCR products of HLA-A and -B mRNAs isolated from LCLs carrying heterozygous HLA-A and -B antigens. The left and the right two lanes of each panel are RT-PCR products from plasmids containing HLA cDNAs of known specificities cloned from the same cell line.





25

5

C4O2
rr
CO
-


(11 1
0 2




0
0 1 2 3 4 5
A24:B60 (RNA)

A24:B60 1:4 1:2 1:1 2:1 4:1
B 60 440 AM WVO*-0




Figure 6 Validation of using RT-PCR and DGGE for measuring relative quantities of different HLA mRNAs. Samples containing different relative amounts of HLA-A24 and B60 RNA were used as templates for quantitative RT-PCR. These RNAs were synthesized by in vitro transcription. The total amount of HLA-A24 and -B60 RNAs for each RT-PCR reaction was 1.5 ng. The RT-PCR products were separated by DGGE and quantified by phosphor imaging analysis. The bottom panel shows the autoradiograph of the DGGE gel used for quantitative analysis by phosphor imaging. Measurements of Relative Quantities of Different HLA-A and -B mRNAs in LCLs by RTPCR/DGGE and S I Nuclease Protection Assay

To further establish the validity of the RT-PCR/DGGE method, we also determined the relative amounts of HLA-A and -B mRNAs in four LCLs using S 1 nuclease protection assay. The results were compared with those obtained by using the RT-PCR/DGGE method. Standards for S I nuclease protection assay were prepared from the HLA-cDNAs cloned in plasmids. Representative results of using S 1 nuclease protection assay for quantitation of HLA-A24 and -B60 mRNAs are shown in Figure 7. We then determined the relative quantities of individual HLA-A and -B mRNAs in four lymphoblastoid cell lines. The results summarized in Table 1 show a good correlation between two assays.





26



(A) (B)
6 3
5 0
0x 5 2
3 "cCc
L 2 -U)
.(pg) Sample 0.. (pg) Sample
a- 1 200 100 50 10 triplicate 0 200 100 50 10 triplicate
z
0 0
0 10 200 300 0 1 o 200 300
A24 RNA standard (pg) B60 RNA standard (pg)

Figure 7 Quantitation of HLA-A24 and -B60 mRNAs in 9075 lymphoblastoid cell line using S 1 nuclease protection assay. Panel (A) and (B) show the standard curves for the quantitation of HLA-A24 and -B60 mRNAs. The insets are autoradiographs of standards and triplicates of a RNA sample from 9075 cell line. The same amount of total cytoplasmic RNA was used for quantitation of HLA-A24 and -B60 mRNAs. The amounts of HLA-A and -B mRNAs were determined from the standard curves and used to calculate their relative quantities.


Table 1 Relative quantities of HLA-A and -B mRNAs in lymphoblastoid cell lines measured by RT-PCR/DGGE and S 1 nuclease protection assay


LCL HLA Relative Quantities of HLA-A and -B mRNAs (%, Mean + SD)
RT-PCR/DGGE S1 Nuclease Protection
Assay
9027 A29 63 4 (4)* 64 11 (2)
B44 37 4 (4) 36 11 (2)
9067 A2 63 5 (4) 62 4 (2)
B27 37 5 (4) 38 4 (2)
9068 A2 60 2 (4) 58 1 (2)
B35 40 2 (4) 42 + 1 (2)
9075 A24 41 6 (4) 38 6 (3)
B60 59 6 (4) 62 6 (3)

*: Number of experiments performed on different dates.





27


Discussion


For quantitation of different specific mRNAs, the commonly used methods include northern blot, S 1 nuclease or ribonuclease protection assay, and quantitative RT-PCR (Wiesner and Zak, 1991). The advantages of using northern blot approach are that the integrity of mRNA can be assessed and several rounds of hybridization can be performed using the same blot. However, this method is semi-quantitative and not sensitive. The northern blot method is also complicated by the problem of cross hybridization resulting from high degree of sequence homology and the same size of HLA mRNAs. The second approach to quantify specific mRNAs is S I nuclease or ribonuclease protection assay. This method is based on solution hybridization and is more sensitive and precise than the northern blot technique. Nevertheless, this approach requires laborious preparation of specific probes and RNA standards. The involvement of several rounds of nucleic acid precipitation by ethanol also introduces variability. The third approach to measure quantities of different HLA mRNAs is quantitative RT-PCR (Gause and Adamovicz, 1994). This is a simple and sensitive quantitative method. The method can be used for large numbers of samples. However, RT-PCR methods alone can not be applied for quantitation of different specific mRNAs that would produce the same size of PCR products in the same incubation. We therefore developed a simple and precise method for measuring the relative quantities of different HLA-A and -B mRNAs in cells using a combined approach involving quantitative RT-PCR, DGGE and phosphor imaging.


The use of quantitative RT-PCR allowed us to have a sensitive technique to amplify different target HLA mRNAs in the same PCR incubation. In order to ensure that cDNA templates of different HLA-A and -B mRNAs were proportionally amplified, the same pair of primers was used for all HLA-A and -B cDNAs. The DGGE technique (Myers et al., 1985) then was used to separate the same size of the amplified PCR products according to minor differences of their nucleotide sequences. The amount of PCR product of each





28


specific HLA mRNA is quantified by phosphor imaging technique. Although the single strand conformation polymorphism (SSCP) technique (Orita et al., 1989) is another powerful method to separate RT-PCR HLA products, we did not adopt this technique because DNA bands separated in gels of SSCP can not be visualized by simple ethidium bromide staining and incomplete denaturation of DNA samples prior to SCCP gel electrophoresis could introduce quantitative imprecision.

According to the results of our study, the amount of PCR product for each specific HLA mRNA after 18 cycles of amplification appeared sufficient to be detected by ethidium bromide staining (Figs. 3 and 4). Nevertheless, the ethidium bromide staining method and densitometry were not used for quantitation of RT-PCR products separated in DGGE gels. The reason for not using this simple quantitative method is that the same amounts of PCR products for different HLA mRNAs are not equally stained by ethidium bromide in DGGE gels (data not shown). This finding of differential staining likely resulted from different degrees of DNA denaturation in DGGE gels. Consequently, the same amounts of DNA do not bind the same quantities of ethidium bromide. We therefore used primers end-labeled with 7-32p for PCR and phosphor imaging for quantitation of each specific PCR product in DGGE gel.

After optimizing our assay condition, two different approaches were used to

validate the RT-PCR/DGGE method for quantitation of different specific HLA-A and -B mRNAs in cells. The first approach was to study samples containing known amounts of different HLA-A and -B RNA transcripts (Figure 6). The second approach was to confirm the results of our method by S I nuclease protection assay (Figure 7). The results of these two approaches (Figure 6 and Table I) indeed support the validity of our assay method. However, our method, unlike an S I nuclease protection assay, yielded relative but not absolute quantities of different HLA-A and -B mRNAs. If absolute amounts of specific HLA mRNAs need to be determined, a separate measurement of total HLA-A and -B mRNAs can be made by additional quantitative RT-PCR (Gilliland et al., 1990;





29


Prendergast et al., 1992). The exact amount of each specific HLA-A or -B mRNA then can be calculated from the results of relative quantities of different specific HLA mRNAs and the total HLA mRNAs. Therefore, the newly established RT-PCR/DGGE method will be useful to study the mechanisms of normal or altered differential quantitative expression of HLA-A and -B antigens in normal and neoplastic cells under different physiological or pathological conditions (i.e. cytokine stimulation, viral infection and malignant transformation). Because there are many other duplicated and highly conserved genes (Greig et al., 1993; Li et al., 1995; Spicer et al., 1995; Watkins, 1995), the results our study also demonstrate that the RT-PCR/DGGE method should be useful for studying the differential quantitative expression of these genes in cells.

In view of the extreme polymorphic nature of class I HLA antigens, we expect that the protocol described in this report may not resolve certain combinations of HLA phenotypes due to limited differences in nucleotide sequences (e.g. HLA-B60 and B61). If this situation occurs, a different set of primers can be selected for RT-PCR, and DGGE conditions (i.e. gradients of denaturing agent and/or temperature of gel electrophoresis) can be modified to resolve the PCR products of different HLA mRNAs. In addition to the eight cell lines studied by us (Figure 4 and 5), we have successfully used the protocol described in this report to determine the relative quantities of different HLA-A and -B mRNAs in three additional HLA-phenotyped LCLs. These three cell lines are 9001 (A24 and B7), 9003 (A24 and B5 1), and 9044 (A24, B51 and B63). However, we were unable to resolve HLA-A2/A11 and B60/B61 in two additional cell lines by our protocol without modification. Because HLA-A and -B antigens that have been studied by us are present in relatively high frequencies in the general population, the results of our study indicate that the protocol reported herein should be applicable to many HLA-phenotyped cells. By using this validated approach, we are able to measure the relative quantities of HLA-A and B mRNAs in subsequent studies as described in the next chapter.














CHAPTER 3
MECHANISMS FOR DIFFERENTIAL QUANTITATIVE EXPRESSION OF HLA-A AND -B ANTIGENS IN LYMPHOBLASTOID CELL LINES



Introduction




As discussed in Chapter 1, class I HLA molecules are polymorphic membrane glycoproteins and consist of a 44-kD heavy chain encoded by the classical class I HLA genes (HLA-A, -B, and -C) and a 12-kD invariant light chain (p32m) encoded by a nonMHC gene (Bjorkman and Parham, 1990). The allelic polymorphism of heavy chains is responsible for different peptide-binding specificities of class I HLA molecules and is functionally important in providing HLA-restricted immune responses (Bjorkman and Parham, 1990).

Previous studies have shown that different class I HLA genes are differentially expressed, and the relative quantities of HLA-A and -B antigens expressed in different types of cells are the same in an individual (Kao and Riley, 1993). The relative quantities of HLA-A and -B antigens expressed on cells remain constant over time (Kao, 1989; Shieh and Kao, 1995). Subsequent studies of comparing the quantitative expression of different specific HLA antigens in members of HLA phenotyped families indicated that the differential quantitative expression of HLA-A and -B antigens is linked directly to class I HLA genes and follows Mendelian inheritance (Kao and Riley, 1993). In addition, it was found that the relative amounts of different specific HLA antigens are proportionally amplified during up-regulated expression of total class I HLA antigens induced by interferon treatment or infection with influenza virus (Shieh and Kao, 1995). Because the amount of HLA antigens expressed on cells has been shown to determine the susceptibility 30





31


of cells to cytotoxic T lymphocytes (Shieh et al., 1996), these findings support the potential functional importance of genetically predetermined quantitative HLA expression in determining the susceptibility of cells to cytotoxic T cells, which may influence the morbidity or recovery of an individual from various infection by intracellular pathogens. For this reason, it would be important to gain further understanding of how differential expression of HLA antigens is regulated.

The quantitative HLA protein expression in cells is determined by the rates of

protein synthesis and degradation, and the synthesis of protein is regulated by the amount of available HLA-mRNA and the protein translation efficiency. For HLA expression, it is also determined by availability of antigen peptides and f2m for correct folding and stabilization. However, available results support that the availability of antigenic peptides and 132m is not the rate-limiting step in normal cells (Shieh and Kao, 1995). Although numerous studies on regulation of HLA expression have been reported (Bishara et al., 1988; Blanar et al., 1989; Driggers et al., 1990; Gerrard et al., 1988; Girdlestone and Milstein, 1988; Hakem et al., 1989; Masucci et al., 1987; Versteeg et al., 1989a; Zachow and Orr, 1989), most of them have only focused on the transcription step affected by variations in the promoter sequences of different HLA-A and -B genes. Studies also showed that certain sequence variations in the introns contribute to the varied quantitative expression of certain class I HLA antigen (Laforet, 1997; Magor et al., 1997). Although the results of these studies indicate that sequence variations of HLA genes could directly influence protein expression, most of these studies have been conducted by using tumor cell lines or cells transfected with class I HLA cDNA constructs or genes. Therefore, results obtained from these studies are insufficient and do not necessarily explain the molecular basis of genetically pre-determined quantitative differential expression of HLA antigens in human cells. For this reason, we decided to study how different regulatory steps of protein expression are involved in determining the quantitative differential expression of HLA antigens.





32


Because earlier studies have shown that the relative quantities of different HLA-A and -B antigens in EBV-transformed lymphoblastoid cell lines are the same as their parental B lymphocytes (Shieh and Kao, 1995), and homozygous cell lines with well characterized HLA phenotypes are readily available (Prasad and Yang, 1996; Yang et al., 1989), we chose EBV-transformed lymphoblastoid cell lines for our study. The study described herein shows that different steps, including transcription, splicing, mRNA degradation, and possibly translation, are involved in regulation of the expression of each HLA antigen. Despite the complex regulatory mechanisms for HLA expression, the results of our study showed that HLA gene sequences are responsible for all the studied regulatory steps and the differential quantitative expression of HLA antigens is directly determined by HLA genes.


Materials and Methods


Lymphoblastoid Cell Lines and RNA Preparation

EBV-transformed LCLs with well characterized class I HLA phenotypes were obtained from American Society for Histocompatibility and Immunogenetics Cell Repository (Prasad and Yang, 1996; Yang et al., 1989) or developed in our laboratory (Shieh and Kao, 1995). These cell lines were maintained in RPMI 1640 medium (Life Technologies, Grand Island, NY) containing 10% fetal calf serum, 1 % antibioticantimycotic solution and 40 gg/ml gentamycin.


Isolation of Nuclei and Preparation of RNA

The nuclei of lymphoblastoid cells were prepared by using the method described by Mullner et al. (1997). Briefly, 200 million cells were lysed in 12 ml of lysis buffer containing 150 mM sucrose, 0.25 mM EGTA, 1 mM EDTA, 60 mM KC1, 15 mM NaC1,

0.15 mM spermine, 0.5 mM spermidine, 15 mM HEPES pH 7.5, 14 mM 3-





33


mercaptoethanol and 0.2% NP-40. The homogenate was diluted with 12 ml of buffer II, which contains 2 M sucrose, 0.25 mM EGTA, 1 mM EDTA, 60 mM KC1, 15 mM NaC1,

0.15 mM spermine, 0.5 mM spermidine, 15 mM HEPES pH 7.5 and 14 mM 3mercaptoethanol. This diluted homogenate was layered over a cushion of buffer II representing 1/3 of the volume of the centrifuge tube. After centrifugation at 30,000g for 45 min at 40C in a rotor with swing-out buckets, the supernatant containing the cytoplasm was saved for isolation of cytoplasmic RNA. The sucrose layer was removed and the pellet containing nuclei was resuspended in the storage buffer containing 20 mM Tris-HCI pH 8.0, 75 mM NaC1, 0.5 mM EDTA, 50% glycerol, 0.85 mM DTT and 125 mM phenylmethylsulfonyl fluoride (PMSF) at a concentration of 1 x 10' nuclei/pl. Total nuclear RNA and cytoplasmic RNA were isolated using the RNAeasy Total RNA Kit (QIAGEN Inc., Chatsworth, CA) according to the manufacturer's protocol. Remnant DNA in the RNA preparation was removed by RNase-free DNase I digestion for 1 hr at 370C.


Reverse Transcription and Polymerase Chain Reaction (RT-PCR) of Nuclear RNA

The reverse transcription was performed as described in Chapter 2 except that 0.5 gg total nuclear RNA was used for each reverse transcription reaction. Five microliters of the reverse transcription products were used as templates for PCR as described in Chapter 2 for 26 cycles using primers designed based on the sequences of HLA-A and -B exon 2 and intron 2. In this condition, PCR amplification efficiency is still in the linear range. The primer sequences are 5'-GCT CCC ACT CCA TGA GGT ATT TC-3' and 5'-GAA AAT GAA ACC GGG TAA AGG CGC-3'. The PCR products were separated by agarose gel electrophoresis and isolated by using Quick Gel Extraction Kit (QIAGEN Inc., Chatsworth, CA). Two nanograms of these PCR products were then used as templates for a second round PCR of 8 cycles, which amplifies the exon 2 sequences in the linear range of amplification efficiency. The primer sequences for the second round PCR are 5'- GCT CCC ACT CCA TGA GGT ATT TC -3' and 5'- CCT CGC TCT GGT TGT AGT AGC -





34


3'. Therefore, these PCR products are generated only from the HLA-A and -B transcripts containing intron 2. Another PCR was also performed to amplify the HLA-A and -B transcripts in which intron 2 has been spliced. The primer sequences for this PCR are 5'CGC CGT GGA TAG AGC AGG-3' (nucleotides 218-235 in exon 2) and 5'- GCG ATG TAA TCC TTG CCG-3' (nucleotides 429-446 in exon 3).


Determination of The Relative Quantities of cytoplasmic HLA-A and -B mRNAs Using RT-PCR/DGGE and Phosphor Imaging

The method is the same as that described in details in Chapter 2. Briefly, firststrand HLA cDNAs were prepared by reverse transcription of 10 gg of total cytoplasmic RNA using the primer (5'-ACA GCT CC(A,G) (A,G)TG A (C,T)C ACA-3') which is specific and complementary only to the nucleotide sequences of exon 5 of all class I HLAA and -B genes, but not to those of HLA-C genes. After inactivation of reverse transcriptase by heating at 99C for 5 min, the HLA-A and -B cDNAs were used for quantitative RT-PCR to determine the relative amounts of different HLA-A and -B mRNAs by DGGE and phosphor imaging analysis.

The nucleotide sequences of the primers used for quantitative PCR in amplifying the coding sequence 218-446 are 5'-CGC CGT GGA TAG AGC AGG-3' and 5'-GCG ATG TAA TCC TTG CCG-3', which are complementary to the conserved antisense and sense nucleotide sequences in exon 2 and exon 3 of all class I HLA mRNAs, respectively. The amplified products encompass the coding sequence 218-446. Quantitative PCR was performed for 18 cycles. One primer was end-labeled with [y-32P]ATP, and the HLA-A and -B cDNA prepared from cytoplasmic RNA was used as templates.


Denaturing Gradient Gel Electrophoresis (DGGE)

DGGE was performed in 1 mm thick 6% polyacrylamide (acrylamide:

bisacrylamide = 19:1) gel using D-GENETM Denaturing Gradient Gel Electrophoresis





35


System (Bio-Rad Laboratories, Hercules, CA). The polyacrylamide gel contained a linearly increasing denaturant gradient from 40% to 60%. The 100% denaturant contains 7 M urea and 40% (w/v) deionized formamide. Electrophoresis was performed at 60'C, 165 V for 1.5 to 3.5 hours in 40 mM Tris-acetate, pH 8.0, containing 1 mM EDTA (TAE). After electrophoresis, the gels were dried for autoradiography and phosphor imaging analysis. PCR product of each HLA-A or -B mRNA in DGGE gel was identified by using PCR products prepared from the plasmids containing cloned HLA-cDNAs of known specificity.


IEF-PAGE and Immunoblotting for Measuring The Relative Ouantities of HLA-A and -B Antigens in LCLs.

One million EBV-transformed lymphoblastoid cells were solubilized in 2 ml Triton X-114 (TX-114) (Sigma, St. Louis, MO, USA) containing buffer at 4C. After phase separation of TX-114 detergent at 37C, the extracted membrane proteins in TX-114 detergent phase were treated with 300 ptl of neuraminidase (2.5 U/ml, Type X; Sigma) at 37'C for 6 hours under constant mixing in a Thermomixer 5436 (Eppendorf, Hamberg, Germany) to avoid phase separation. After neuraminidase digestion the detergent phase was collected and diluted with an equal volume of IEF buffer for IEF-PAGE. After IEFPAGE, the IEF gels were washed and proteins in the gels were electrophoretically transferred to Immobilon membrane (Millipore, Bedford, MA, USA) at 40 volts for 45 minutes. Thereafter, the Western blots were blocked with 5% nonfat milk and incubated sequentially with 171.4 anti-HLA heavy-chain mAb and alkaline phosphatase conjugate of rabbit anti-mouse IgG antibody. The detailed procedures were reported previously (Kao and Riley, 1993).


Immunoprecipitation of Pulse-chase Radiolabeled HLA Antigens from LCLs

EBV-transformed human lymphoblastoid cell lines (DC, 9001, 9027, 9028, 9067, 9068, 9075) were cultured in RPMI-1640 medium (GIBCO BRL Life Technologies,





36


Grand Island, NY) containing 10% newborn calf serum (GIBCO BRL), 1% antibioticantimycotic solution (Sigma Co., St. Louis, MO), and 0.1% gentamycin (Sigma). Fifteen million lymphoblastoid cells at log phase were harvested and washed twice with 10 ml PBS. The cells were resuspended in 3 ml methionine-free RPMI-1640 with 10% dialyzed FCS. The cell suspension was then incubated with 300 [tCi "S- methionine (Amersham Life Science, Inc., Arlington Heights, IL) at 37C for 2 hours. Cells were harvested, washed twice with ice-cold PBS, and suspended in 3 ml regular RPMI- 1640 with 10% FCS. Three million of these cells were chased with 1 mM unlabeled methionine at 37C for 0 or 18 hours. The cells were collected and washed twice with ice-cold PBS. These cells were then solubilized with 3 ml TX-1 14 containing solubilization buffer on ice for 15 min. After centrifugation at 10,000g for 10 min at 4C the supernatant was collected and freezed at -70'C until use.

For immunoprecipitation, the harvested supernatant was preincubated with 20 gI of 10% washed staphylococus A (Sigma) suspended in TX-1 14 containing buffer on ice for 60 min. After removal of staphylococcus A by centrifugation at 10,000g for 5 min at 4C, the supernatant was incubated with 15 gtg of W6/32 anti-HLA monoclonal antibody at 4C overnight. Thereafter, the immune complexes were precipitated by mixing with 30 tl of 10% staphylococcus A and incubation at 4C for 2 hr. After centrifugation at 10,000g for

5 min at 4'C, the staphylococcus A pellet was washed sequentially with PBS containing

0.25 M NaCl and 0.1% NP-40, and PBS containing 0.1% NP-40. The washed staphylococcus A pellet was resuspended in 100 [tl of 12.5 units/ml type X neuraminidase at pH 6.0 and 37C for 6 hr. After centrifugation at 10,000g for 10 minutes, the HLA antigens were eluted by resuspending the staphylococcus A pellet in 40 [tl of lx IEF sample buffer with 2-mercaptoethanol and incubation at room temperature for 10 min. After centrifugation at 10,000g for 5 min, the supernatant was harvested and used for IEFPAGE which is followed by phosphor imaging and autoradiography.





37


Treatment of LCLs with 5,6-dichloro- I -beta-D-ribofuranosylbenzimidazole (DRB)

Five million of EBV-transformed lymphoblastoid cells were treated with 25 pg/ml DRB in RPMI 1640 complemented with 5% FCS for 0 or 23 hours. Total cytoplasmic RNA was extracted and 2 pg of the RNA was used for reverse transcription as described above in a total volume of 30 gl. The relative quantities of HLA-A and -B mRNAs were determined by quantitative PCR/DGGE and phosphor imaging as described above.


Nuclear run-on

Ten million nuclei of LCLs were incubated for 30 min at 26C in 250 pl of a buffer containing 83 mM (NH4)2SO4, 87 mM Tris-HCI (pH 7.9), 4 mM MgCI2, 4 mM MnC12, 24 mM NaC1, 0.2 mM EDTA, 3 mM PMSF, 0.9 mM DTT, 0.75 mM each NTP, 10 mM creatine phosphate, 0.15 mg/ml creatine phosphokinase and 20% glycerol. The reaction was stopped by adding 50 units of DNase I and incubating for another 2 min at 26'C. Then the denaturing buffer containing guanidinium thiocyanate to be used in RNA preparation was immediately added into the mixture, and the nuclear RNA was extracted as described above.


Autoradiography, phosphor imaging and densitometry

For autoradiography, the gels were exposed to Fuji Medical X-ray film (Fuji Photo Film Co., Ltd., Japan) for 3 hr (DGGE) or to Kodak Biomax MR film (Kodak Scientific Imaging Systems, Rochester, NY) for 48 hr (IEF-PAGE) at -70'C. For phosphor imaging, the DGGE gels were exposed to a Phosphorscreen (Molecular Dynamics, Inc., Sunnyvale, CA) for 3 hours at room temperature. The radioactivity of each specific DNA band was quantified using ImageQuant software (Molecular Dynamics, Inc., Sunnyvale, CA). For quantitation of HLA protein by densitometry, immunoblots or X-ray films were scanned with a 600 dpi Microtek grayscale scanner ( Microtek, Inc., Torrance, CA) and analyzed by Collage 3.0 software (Fotodyne Inc., New Berlin, WI).





38


Results



Degradation of Different HLA-A and -B Antigens in Cells

Because the steady state protein levels are determined by rates of degradation and synthesis, we first studied whether different HLA-A and -B antigens are proportionally degraded, after synthesis using pulse-chase experiments in five different lymphoblastoid cell lines. The HLA proteins in cells were pulse-labeled with 35S-methionine for 2 hours and chased with excess amount of cold methionine for 18 hours. The HLA proteins were immunoprecipitated with W6/32 monoclonal antibody, which recognizes the native form of class I HLA antigens. After neuraminidase digestion, different HLA-A and -B proteins were separated by IEF gel electrophoresis. The relative quantities of each 35S-labeled HLA-A and -B protein was measured by autoradiography and densitometry. The results of this study in these five cell lines with homozygous HLA-A and -B antigens show that the relative quantities of 35S-methionine labeled HLA-A and -B proteins remain similar after 18 hr chase with cold methionine (Figure 8). The differences of relative amounts of HLA-A and -B antigens before and after cold chase were within the experimental variation, and were not significant. Thus, this finding indicated that different specific HLA-A and -B proteins have similar stabilities and are degraded proportionally.


The Relative Quantities of Different HLA-A and -B Proteins Generally Are Proportionally Correlated with That of Their mRNAs.

Because different HLA-A and -B proteins have similar degradation rates in these studied cell lines, we then determined whether the relative quantities of different HLA-A and -B proteins are correlated with those of their respective mRNAs. The relative quantities of different HLA-A and -B proteins were measured by IEF gel electrophoresis, immunoblotting and densitometric analysis (Kao and Riley 1993). The relative quantities of their mRNAs were determined by RT-PCR/DGGE and phosphor imaging (Liu and Kao 1997). The results shown in Table 2 indicate that the relative quantities of different HLA-A





39



(A)

9001 9027 9028 9067 9068

0 18 0 18 0 18 0 18 0 18
A2 A2
A2902m- 4otPm-AMO 02m-'! ap P2rw ,
j32m- f32m
B60
B35
B61
A24 A24
B44
B7
~B27- .40:





(B)

I
<1.4
1.2

U' I118 hr1
0.8
.I
0.6
0.4
0.2
inC/ 0
co 1
9001 9027 9028- 9028- 9067 9068 B60 B61

LCL

Figure 8 Turnover of 3sS-methionine-labeled HLA-A and -B proteins in lymphoblastoid cell lines (LCLs). (A) Autoradiographs of 1D-IEF gel. EBV-transformed lymphoblastoid cell were pulse-labeled with [35S]methionine for 2 hours and chased with cold methionine for 0 hour (0) or 18 hours (18). The immunoprecipitated HLA proteins were separated by IEF gel electrophoresis. (B) The relative quantities of [3S]methionine-labeled HLA-A and
-B proteins before and after 18-hour cold methionine chase. The quantities of [35S]methionine-labeled HLA-A and -B proteins were determined by scanning densitometry.Each bar represents the mean value of two experiments. The variation between these two experiments is less than 15%.





40

Table 2 Relative quantities of HLA proteins and mRNAs in ten different lymphoblastoid cell lines (LCLs)

LCL Phenotype Relative Quantity of Protein Relative Quantity of mRNA (%)
(%) (MeanSD) (n) (MeanSD) (n)

9005 A3 36 6 (5)* 35 5 (4)*
B27 64 + 6 (5) 65 5 (4)
9027 A29 61 5 (9) 63 4 (4)
B44 39 5 (9) 37 4 (4)
9067 A2 62 6 (6) 63 5 (4)
B27 38 6 (6) 37 5 (4)
9068 A2 64 3 (4) 60 2 (4)
B35 36 3 (4) 40 2 (4)
SH A2 28 7 (4) 48 3 (2)
A3 20 6 (4) 13 1 (2)
B7+B44 52 10 (4) B7 27 + 1 (2)
B44 13 2 (2)

CG A2-var 22 4 (4) 41 1 (2)
A3 15 7 (4) 15 1 (2)
B7 47 7 (4) 28 1 (2)
B45 16 4 (4) 15 1 (2)
9075 A24 63 3 (5) 41 + 6 (4)
B60 37 3 (5) 59 6 (4)
DC All 25 + 4 (5) 13 3 (5)
A24 48 4 (5) 26 3 (5)
B35 14 4 (5) 28 3 (5)
B60 14 2 (5) 31 7 (5)
9001 A24 51 5 (3) 42 6 (4)
B7 49 + 5 (3) 58 6 (4)

9028 A24 67 + 8 (3) 40 3 (2)
B60+B61t 33 8 (3) 60 3 (2)

1: The relative quantities of HLA-A and -B proteins were measured by IEF gel electrophoresis, immunoblotting and scanning densitometry. The relative quantities of HLA-A and -B mRNAs were measured by quantitative RT-PCR/DGGE and phosphor imaging. Relative quantity of HLA-A or -B = (quantity of HLA-A or -B/(quantity of HLAA + quantity of HLA-B)) x 100%.
*: Number of independent measurements. : HLA-B7 and-B44 proteins can not be separated by IEF-PAGE. They were quantified together.
t: RT-PCR products of HLA-B60 and B61 mRNAs can not be separated by DGGE. They were measured together.





41


and -B proteins are proportional to those of their mRNAs in the 9005, 9027, 9067 and 9068 cell lines, since different HLA proteins have similar stability, these results suggest that in these cell lines different HLA-A and -B mRNAs have similar protein synthesis rates. However, the relative quantities of HLA-A and -B proteins are not proportionally correlated with their mRNAs in HLA-A24 positive cell lines (9028, 9075 and DC). It appears that proteins are expressed in higher quantities relative to their mRNA transcripts in these cell lines. This phenomenon was also observed in HLA-B7 positive cell lines (SH and CG) but not in the 9001 cell line, which is homozygous for HLA-A24 and -B7. These results suggest that both HLA-A24 and -B7 mRNAs may be more efficient in synthesizing HLA proteins. This possibility is further substantiated by the predominance of HLA-A24 and -B7 protein bands on JEF gel (Figure 9). A relative large number of HLA-A24 positive cell lines were studied in order to substantiate our initial observation.



V r- r- o .
C:1 Cj (0 COrCD3 CD C)3 C: C:)











A2
A29
A29 B60 B60

44 B A24
AM B07 644
B27 = ffAll
027 A3.2 A3.2


Figure 9 IEF-immunoblot of HLA-A and -B antigens from nine different lymphoblastoid cell lines. The lower diagram shows the specificities of these antigens. The relative amounts of HLA proteins are determined by scanning densitometry.





42


Different HLA-A and -B mRNAs Have Similar Stabilities

Because the steady state of HLA mRNA is regulated by both HLA mRNA

production and degradation, whether different HLA-A and -B mRNAs have the same stabilities could be a factor in determining their differential quantities. By using DRB to inhibit mRNA synthesis, we performed HLA mRNA degradation studies in seven lymphoblastoid cell lines. First we studied the inhibition of HLA mRNA as a function of different concentrations of DRB (Figure 1 OA) and found that 25 jig/ml of DRB can maximally inhibit HLA mRNA synthesis. We also conducted a time course study (Figure lOB) and found that, in order to detect significant degradation of HLA mRNA, 24-hour incubation is sufficient. On the basis of these studies, we studied the relative quantities of HLA-A and -B mRNAs after 23-hour treatment with 25 jig/ml of DRB. The relative quantities of HLA-A and -B mRNAs in these cells before and after DRB treatment were measured by using RT-PCRIDGGE and phosphor imaging. The results summarized in Figure I I show that different HLA-A and -B mRNAs are proportionally degraded in five of the seven studied cell lines. A slight difference between the stabilities of HLA-A and -B mRNAs was noted in the 9027 and 9067 cell lines. Our results indicated mRNA stability is not a major factor influencing the differential expression of HLA-A and -B antigens in majority of cell lines. However, this mechanism is optional in some cell lines.


Pre-mRNA Splicing Is An Important Factor Determining The Quantitative Differential Expression of HLA-A and -B Antigens

Because different HLA-A and -B mRNAs have similar stabilities in many LCLs, it is likely that HLA-A and -B mRNAs are differentially produced. The mRNA production rates are determined by transcription and/or pre-mRNA splicing rates. Our original plan was to use PCR-based nuclear run-on to determine whether HLA-A and -B genes are differentially transcribed. Isolated nuclei were incubated with or without NTPs. Then nuclear RNA was extracted and RT-PCR was performed to amplify the unspliced transcripts. The difference of the measurements from these two incubations should





43


(A)


DRB (gg/ml) 0 10 20 50


B44

A29 .

18SRNA O@O*

(B)


DRB(25 jig/mi) No DRB


Time (hr) 0 9 24 48 24 48

B44




18S RNA *w *0# *


Figure 10 The effect of DRB treatment on HLA mRNA levels. (A) Treatment of 9027 LCL with different concentrations of DRB for 23 hours. After treatment of cells with different concentrations of DRB, two micrograms of total cytoplasmic RNA were used as template for Quantitative RT-PCR to amplify HLA-A and -B mRNAs. The RT-PCR products of HLA-A and -B mRNAs were separated by DGGE and quantified by phosphor imaging. The dot blot of 18S ribosomal RNA in 0.2 gg of each RNA sample was also performed to determine whether RNA from same number of cells were used in RT-PCR.
(B) Treatment of 9027 LCL with 25 jig/jil of DRB for different times. After treatment of cells with different concentrations of DRB, two micrograms of total cytoplasmic RNA were used as template for Quantitative RT-PCR to amplify HLA-A and -B mRNAs. The RTPCR products of HLA-A and -B mRNAs were separated by DGGE and quantified by phosphor imaging. The slot blot of 18S ribosomal RNA in 0.2 jig of each RNA sample was also performed to determine whether RNA from same number of cells were used in RT-PCR.





44


(A) 9001 9005 9028 9068 DC 9027 9067

0 23 0 23 0 23 0 23 0 23 0 23 0 23
B60 B35 B35- B44A24. A- +61 6'4
B7. B27- A24A A24 > A29 B27(B) ,


C3i 0 h E 23 h
2- T


T
7..1 TT


0 .......
9001 9005 9028 9068 DC 9027 9067
LCL

Figure 11 Turnover of HLA-A and -B mRNAs in LCLs. (A) Phosphor images of DGGE gels for measuring the relative quantities of HLA-A and -B mRNAs before and after 23 hour DRB treatment. (B) Ratios (meanSD) of HLA-A to -B mRNAs in different lymphoblastoid cell lines before and after 23 hr inhibition with 25 gg/ml of DRB. Each value represents the mean of two or three separate measurements were performed for each determination. *: p < 0.05.


represent the newly synthesized transcripts. The results of PCR-based nuclear run-on from

4 cell lines shows that there was only a small increase in the amount of unspliced transcripts (Figure 12). The difference represents less than 20%, suggesting a relatively large pre-existing pool of unspliced HLA transcripts. This observation was further supported by the results from RT-PCR of nuclear RNA, in which the sequences spanning exon 2 and exon 3 were amplified (Figure 13). Due to this large pre-existing pool, we were unable to reliably study the differential transcription of HLA genes by using the PCRbased nuclear run-on approach. The results also suggest that HLA pre-mRNA splicing could be a rate-limiting step in regulating the differential HLA mRNA production. To investigate whether the relative quantities of different HLA-A and -B transcripts are determined by splicing, transcription, or both, we decided to measure the relative amounts





45


9005 9027 9067 9068

M (-) (+) (-) (+) (-) (+) (-) (+) M
-1000
1000
Xef-i 700 700
HLAe.w e a**.... 525
525-; 500
50040 400 ..

Figure 12 PCR-based nuclear run-on in four LCLs. Nuclear run-on reaction with (+) or without (-) NTPs, the HLA-A and -B nuclear transcripts were used for quantitative RTPCR. The PCR primers, 5'- TGG GCG GGT GAG TGC GGG GTC-3' and 5'-GAA AAT GAA ACC GGG TAA AGG CGC-3', correspond to the sequences of HLA gene in intron 1 and intron 2, respectively. In vitro synthesized Xef-1 mRNA added before RNA extraction as an exogenous control was also quantified by RT-PCR. M: DNA markers.




(bp) M 9001 9005 9016 9027 9028 9067 9068 DC M (bp) 525 525
500 500
400 400

300 300


200_ 200

Unspliced exon 2 intron 2 exon 3
Unspliced 1 II

I <490 bp I

exon 2 exon 3
Spliced
229 bp

Figure 13 Presence of abundant unspliced HLA transcripts in nuclei. Agarose gel electrophoresis shows two sizes (229 bp and 490 bp) of RT-PCR products from HLA nuclear transcripts. The light bands (sightly shorter than 490 bp) are likely the RT-PCR products of unspliced nuclear HLA transcripts with shorter intron 2. Sequences of the PCR primers correspond to sequences of exon 2 and 3 of HLA genes.


of HLA-A and -B transcripts before and after splicing in nuclei. The relative quantities of

HLA-A and -B transcripts in cytoplasm and nuclei were determined by RT-PCR/DGGE





46


and phosphor imaging. Three different groups of transcripts were studied (Figure 14). The first group are the prespliced transcripts with intact intron 2 in nuclei (Group I). The



Total nuclear RNA Total cytoplasmic RNA
(pre-mRNA) spliced mRNA
... tZZZ3--. _"i z T,---:i ,

RTPCR RT-PCR RT-PCR
DNA fragment
(exon 2 + partial intron 2)

PCR

DNA fragment DNA fragment DNA fragment
(Exon 2) (partial exon 2 + partial exon 3) (partial exon 2 + partial exon 3)




DGGE DGGE DGGE

Figure 14 Experimental design for study of HLA mRNA production.


second group of transcripts are the spliced transcripts without intron 2 in nuclei (Group II). The third group are the mature mRNA transcripts in cytoplasm (Group III). Because we were able to separate RT-PCR products generated from exon 2 or exon 2 and exon 3 of HLA-A and -B transcripts by using DGGE, this approach provided us with a simple way to study whether pre-mRNA splicing plays any critical role in determining the quantitative differential expression of HLA-A and -B antigens. To amplify the first groupof HLA-A and -B transcripts in which intron 2 has not been spliced, we first used a pair of primers complementary to the 5' end of exon 2 and a sequence in intron 2. The amplified products were generated from the transcripts containing intron 2. These PCR products were purified and used as template for second round of PCR to amplify the HLA-A and -B exon 2 sequences, which were separated by DGGE and quantified by phosphor imaging. For





47

amplifying Group II and Group III of HLA-A and -B transcripts, the protocols described in chapter 2 are used, in which the PCR products only include partial exon 2 and partial exon

3. The results of this study in nine lymphoblastoid cell lines are shown in Figure 15.

Our results show that in cell lines 9027, 9067, the relative quantities of HLA-A and

-B transcripts are the same for all three groups of transcripts. For the 9005 cell line, which is homozygous for HLA-A3 and -B27, the relative quantities of HLA-A3 transcripts prior to splicing is greater than that of spliced transcripts in nuclei and cytoplasm. This finding suggest unequal rates of splicing for HLA-A and -B mRNAs (Figure 15). The same finding was obtained for all A24-positive cell lines (9001, 9028, 9075, and DC). Our results demonstrated that nuclear splicing of HLA pre-mRNAs could play a major role influencing the quantitative differential expression of HLA-A and -B antigens.



Discussion



The primary purpose of this study is to determine the roles of gene transcription, splicing, mRNA turnover and translation in regulation of genetically pre-determined differential expression of different HLA-A and -B antigens. The results of our studies show that regulation of the quantitative differential expression of different HLA-A and -B antigens is determined by combinations of multiple steps that include HLA gene transcription, pre-mRNA processing, mRNA turnover and/or mRNA translation. In all of these steps, gene transcription and pre-mRNA processing appear to play the major roles for majority of different HLA-A and -B antigens. Turnover and translation of HLA mRNAs are involved for a few specific HLA-A and -B alleles. Despite the complexity of regulatory mechanisms for HLA expression, all are directly linked to the coding and noncoding nucleotide sequences of HLA genes. This finding supports an earlier report that differential quantitative expression is directly linked to HLA genes and follows Mendelian laws (Kao and Riley, 1993).


























Figure 15 Measurements of the relative quantities of nuclear and cytoplasmic HLA-A and B transcripts by using quantitative RT-PCR/DGGE and phosphor imaging in seven lymphoblastoid cell lines, nu: unspliced nuclear HLA-A and -B transcripts. ns: spliced nuclear HLA-A and -B transcripts. c: cytoplasmic HLA-A and -B mRNAs. Each value represents the meanSD of three separate experiments. *: Two separate experiments for 9075 cell line.





49



9001 9005
nu ns c nu ns c

A -A24 AA3
B 7 -- 7
--B27
A24(%)737 364 456 A3(%) 516 364 343
B7(%) 277 644 556 B27(%)496 644 663

9027 9028
nu ns C nu ns c

B44A24 A24
A29 B60
_A9+61(%) 2516 454 556 A24(%) 7516 544 456 B44(%) 431 491 473 A29(%) 571 511 533


9067 DC
nu ns c nu ns c

-t s A2 A2f! B35


B27BB60
A24-A24 A2(%)5915 551 545 All-
B27(%)4115 451 465 B35(%)229 36+5 30+9

9075 B60(%) 193 23+3 27+3
n A24(%)334 252 28+4
A11(%)258 161 152 ill@: 'B60

B60 li

A24- A24
B60(%)251* 601* 582* A24(%)751* 401* 422*





50


In our study, we used the validated RT-PCR/DGGE and phosphor imaging to measure the relative quantities of HLA-A and -B mRNAs (Chapter 2). This approach allows us to avoid complications of cross-hybridization and the variations in specific activity of probes that are frequently encountered in northern blot. For measuring the relative quantities of different specific HLA-A and -B antigens, cytoplasmic mRNAs were used as templates and the primer complementary to a sequence in exon 5 shared by HLA-A and -B mRNAs were used to prepare cDNAs. This sequence encodes part of transmembrane domain of all HLA-A and -B proteins. Therefore, only the relative quantities of the HLA mRNAs encoding the whole length HLA transmembrane heavy chains were measured. For measuring the relative amounts of different HLA-A and -B proteins, the use of TX 114 to solubilize cells, which only extracts the transmembrane proteins (Bordier, 1981), allows us to quantify the relative amounts of intact transmembrane HLA-A and -B antigens by IEF-PAGE and immunoblotting. The aforementioned two approaches made it possible for us to determine whether the relative amounts of different HLA-A and -B antigens are proportionally correlated with those of their mRNAs. The results shown in Table 2 indicate that, for most of the studied LCLs, HLA-A and -B protein levels are proportionally correlated with their mRNA levels, except for those positive with HLA-A24 or -B7. Because different HLA proteins have similar turnover rates (Figure 8), these results indicated that rates of mRNA production play important roles in determining HLA protein levels. In addition, the results suggest that HLA-A24 and -B7 mRNAs are more efficient in protein translation and that differential translation of mRNAs for certain HLA antigens plays a role in determining HLA expression.

Next, we studied the role of stability of different HLA-A and -B mRNAs in

influencing the quantitative differential expression of different ELA-A and -B antigens. This study was accomplished by measuring changes of relative quantities of different HLAA and -B mRNAs before and after treatment of cells with DRB, an inhibitor of RNA





51


polymerase II, for 23 hours. The results showed that HLA-A and -B mRNAs are proportionally degraded in five out of seven cell lines studied. Similar observation was made previously by other inhibitors using HLA-A and -B transgenes (McCutcheon et al., 1995). However, our study showed that stability of HLA-A and -B mRNAs in two cell lines appear to have slightly different turnover rates in three separate experiments. This finding suggests that varying stability for HLA-A and -B mRNAs could play some role in determining quantitative differential expression for certain HLA-A and -B antigens. The molecular basis for the observed different turnover rates is not known and remains to be investigated.

Because the steady state mRNA levels are determined by both mRNA degradation and production, and, in most cases, different HLA-A and -B mRNAs in cell lines studied have similar turnover rates, it is likely that differential production of HLA-A and -B mRNAs could be a primary determining factor for regulating differential expression of different HLA-A and -B antigens. We then studied how gene transcription contributes to the regulation of quantitative differential expression of HLA-A and -B genes. The initial nuclear run-on study showed that the newly synthesized HLA transcripts contribute only approximately 20% of the total prespliced HLA transcripts in nuclei (Figure 12). Due to the low quantity of newly synthesized HLA transcripts, we were unable to reliably determine the relative rate of transcription for different HLA-A and -B genes in cells. This finding also indicates that the processing of HLA pre-mRNAs is a critical rate-limiting step in the production of mature HLA mRNAs.

We then directed our effort to investigate whether differential splicing plays an important role in determining differential production of mature HLA-A and -B mRNAs. For this study, we used RT-PCR/DGGE and phosphor imaging to measure the relative quantities of HLA-A and -B transcripts before and after splicing of intron 2. The measurements were compared with those of mature cytoplasmic HLA mRNAs. The results suggested that nuclear HLA transcripts containing intron 2 can be proportionally or





52


differentially spliced, depending on the HLA alleles. Because it is more difficult to consistently generate sufficient quantities of first-strand HLA cDNA containing more introns and the amplicon of exon 2 of HLA gene is crucial for quantitation by DGGE, we limited our study of prespliced mRNA transcripts to those containing intron 2. The results of this study showed that the relative quantities of spliced mRNAs for various HLA-A or B genes in nuclei and cytoplasm are about the same for all cell lines included in our study. In contrast, the relative quantities of HLA transcripts containing intron 2 for various HLAA and -B genes are quite different from those of the spliced HLA-A and -B transcripts in nuclei and cytoplasm of some cell lines (Figure 15). Thus the results indicated that differential splicing of HLA transcripts plays a major role in determining differential quantitative expression of HLA-A and -B genes in cells.

Interestingly, in those cell lines showing differential splicing of HLA-A and -B premRNAs, the relative quantities of unspliced HLA-A pre-mRNAs in nuclei of all these cells are higher than those of unspliced HLA-B pre-mRNAs, although the relative quantities of mature HLA-A mRNAs in most of these cell lines are lower than that of HLA-B mRNAs. This finding further supports the importance of differential splicing in regulating quantitative expression of HLA-A and -B genes. However, in cell lines showing proportional splicing of HLA-A and -B pre-mRNAs, the relative quantities of unspliced HLA-A pre-mRNAs and mature HLA-A mRNAs are higher than those of unspliced HLAB pre-mRNAs and mature HLA-B mRNAs, respectively. These observations coincide with an earlier report that the basal level transcription of the HLA-A gene tends to be more efficient than that of the HLA-B gene due to the existence of a second NF-cB binding motif in the promoter of HLA-A gene (Girdlestone et al. 1993). These results also suggest that transcription of HLA gene is another major factor determining the quantitative differential expression of HLA-A and -B antigens. The mechanisms underlying the differential transcription and/or splicing and their contribution to the quantitative differential expression of HLA-A and -B antigens remain to be further defined.














CHAPTER 4
IN VITRO TRANSLATION STUDY OF HLA-A24 AND -B60 MRNAS



Introduction


As discussed in Chapter 3, quantitative differential expression of HLA-A and -B antigens is regulated by a combination of different steps that include gene transcription, pre-mRNA splicing, mRNA degradation, and translation. For mRNA translation, it appears that mRNAs for HLA-A24 and -B7 are more efficient in protein synthesis (Table 2). This finding suggests that translation of HLA mRNA could be an additional unique step in regulating expression of HLA antigen for certain specific alleles. Therefore, it is of interest to determine whether HLA-A24 mRNA is indeed more efficient in translation. For my study, I have focused on HLA-A24 protein synthesis because I have consistently found that HLA-A24 antigens are always more intensely expressed in all the studied HLA-A24 positive cell lines in spite of relatively low levels of mRNA.



Materials and Methods



Lymphoblastoid Cell Lines and RNA Preparation

EBV-transformed lymphoblastoid cell lines (LCLs) were selected from those described in Chapter 3. These cell lines were maintained in RPMI 1640 medium (Life Technologies, Grand Island, NY) containing 10% fetal calf serum, 1% antibioticantimycotic solution and 40 gg/ml gentamycin.





53





54

Rapid Amplification of HLA-A And -B cDNA Ends (RACE)

The 5' RACE is performed based on the protocol described by Frohman (1994) with some modification. Fifty micrograms of total cytoplasmic RNAs prepared from the selected cell lines were dephosphorylated with 3.5 units of calf intestinal phosphatase (CIP) (Boehringer Mannheim, Indianapolis, IN) in 50 gl of a buffer containing 50 mM Tris-HC1, 0.1 mM EDTA, pH 8.5, 1 mM DTT, 1 unit/gl RNasin at 50'C for 1 hour. After digestion with 50 gg/ml of proteinase K at 37oC for 30 minutes, the mixture was extracted with phenol/chloroform and the RNA was precipitated with 1/10 volume of 3 M sodium acetate and 2.5 volumes of ethanol. Thirty-eight micrograms of the dephosphorylated RNA was then decapped with 5 units of Tobacco acid pyrophosphatase (Epicentre, Madison, WI) in 50 pl of a buffer containing 50 mM sodium acetate, pH 6.0, 1 mM EDTA, 0.1% P3mercaptoethanol, 0.01% Triton X-100, 1 unit/pl of RNasin and 2 mM ATP at 37C for 1 hour. The RNA was extracted with phenol/chloroform and precipitated with ethanol as described above. The decapped RNA was then ligated to an RNA oligonucleotide that was generated by in vitro transcription from plasmid pGbx- 1 (kindly provided by Dr. Michael A. Frohman) and contains 132 nucleotides (Frohman, 1994). The ligation was carried out with 30 units of T4 RNA ligase (Epicentre, Madison, WI) in 30 pl of a mixture containing 33 mM Tris-HC1, pH 7.8, 66 mM potassium acetate, 10 mM MgCl2, 0.5 mM DTT, I unit/pgl RNasin, 0.1 mM ATP, 4 plg of RNA oligonucleotide and 10 gg of decapped RNA at 17'C for 16 hours. After extraction and precipitation, 6 pg of the ligation products were then used as templates for reverse transcription in 20 pl of a mixture containing 50 mM Tris-HC1, pH 8.3, 75 mM KC1, 3 mM MgCl2, 1 mM dNTPs, 0.01 M DTT, 0.5 unit of RNasin, 250 ng antisense-specific primer (5'-ACA GCT CCA(G) A(G)TG AC(T)C ACA-3') complementary to nucleotides 960-979 (in exon 5) of HLA-A and -B coding sequences and 200 units of MMLV reverse transcriptase at 37C for 60 minutes, 42C for 30 minutes and 50'C for 10 minutes. After inactivation of the reverse transcriptase, 5 p1l of the RT mixture was directly used as template for PCR in 100 pl of a buffer containing 20





55

mM Tris-HC1, pH 8.0, 2mM MgCI2, 10 mM KC1, 6mM (NH4)2SO4, 0.1% Triton X100, 10 gg/ml BSA, 0.2 mM dNTPs, 0.5 gM of each primer and 5 units of native Pfu DNA polymerase (Stratagene) for 35 cycles. Each cycle consisted of 94C denaturation for 1 min, 60'C annealing for 1 sec and 72'C extension for 1 min. The sense primer sequence is 5'- CCA AGA CTC ACT GGG TAC TGC-3' and corresponds to nucleotides 62-82 of the RNA oligonucleotide. The antisense primer sequence is 5'-GCG ATG TAA TCC TTG CCG-3' and complementary to the coding sequence at nucleotides 429-446 of class I HLA mRNA. The PCR products containing 5' end sequences of HLA mRNA were directly cloned into a plasmid the pCR-Script Amp cloning vector (Stratagene, La Jolla, CA) according the manufacturer's protocol. Sequences of the cloned PCR products were determined by automated DNA sequencing.

The 3' RACE is also performed based on the protocol described by Frohman

(1994). Briefly, 5 gg of total cytoplasmic RNA prepared from the 9075 or DC cell line was reverse transcribed in 30 gl of a buffer containing 50 mM Tris-HC1, pH 8.3, 75 mM KC1, 3 mM MgCl2, 1 mM dNTPs, 0.01 M DTT, 0.5 unit of RNasin, 2 gg anchor primer (5'-CCA GTG AGC AGA GTG ACG AGG ACT CGA GCT CAA GCT TTT TTT TTT TTT TTT T-3') and 200 units of M-MLV reverse transcriptase at 37'C for 60 minutes, 42C for 30 minutes and 50'C for 10 minutes. After inactivation of the reverse transcriptase, 5 gl of the RT mixture was directly used as template for polymerase chain reaction (PCR) in 100 gl of a buffer containing containing 20 mM Tris-HCI, pH 8.0, 2 mM MgCl2, 10 mM KCI, 6 mM (NH4)2SO4, 0.1% Triton X-100, 10 gg/ml BSA, 0.2 mM dNTPs, 0.5 qM of each primer and 5 units of native Pfu DNA polymerase (Stratagene, La Jolla, CA) for 35 cycles. Each cycle consisted of 94'C denaturation for 1 min, 60'C annealing for 1 sec and 720C extension for 4 min. The PCR primer sequences are 5'-CGC CGT GGA TAG AGC AGG-3' (sense) and 5'-CCA GTG AGC AGA GTG ACG-3' (antisense). The sense primer corresponds to the coding sequence 218-235 of class I HLA mRNA, and the antisense primer corresponds to the 5' end of anchor primer. The PCR





56

products were then used as template for the nested PCR in which each cycle consisted of 94C denaturation for 1 min, 60'C annealing for 1 sec and 72C extension for 2 min. The primer sequences for the nested PCR are 5'- GCT GGC CTG GTT CTC CTT GG-3' (sense, corresponding to nucleotides 937-956 of HLA-A24 coding sequence) or 5'- GCT GTG GTG GTG CCT TCT GG-3' (sense, corresponding to nucleotides 808-827 of HLAB60 coding sequence), and 5'- GAG GAC TCG AGC TCA AGC-3' (antisense, corresponding to a sequence in anchor primer). The products of the nested PCR were directly cloned into the pCR-Script Amp cloning vector (Stratagene, La Jolla, CA) according the manufacturer's protocol. The 3-end sequence was determined by automated DNA sequencing.



Cloning of Full-length HLA-A24 and -B60 cDNAs By PCR

For cloning the whole length HLA cDNA, a PCR technique based on splicing by overlap extension (SOE) (Horton et al., 1989) was used. The 5' fragment of HLA cDNA was amplified from plasmid by using PCR in which a T7 promoter was incorporated into the 5' end for use in the subsequent synthesis of HLA transcripts. The 3' end sequence and a coding sequence were prepared also amplified from plasmids by using PCR, and the PCR products of these two fragments were mixed and used as templates for SOE PCR in which these two fragments with overlap sequences were jointed together to form the 3' fragment. Pfu DNA polymerase (Stratagene, La Jolla, CA) was used in PCR to reduce the possibility of misincorporation mutations in the PCR products. Standard PCR conditions were used for the amplification of template DNA fragments to be used in the subsequent SOE reactions (30 cycles of 1 min at 94C, 30 sec at 60'C, and 2 min at 72C following the final cycle, an additional 16-min incubation at 72C). The PCR products corresponding to the 3' end HLA cDNA fragments and overlapping with the 5' end HLA cDNA fragments were purified by preparative agarose gel electrophoresis. The full-length HLA cDNAs were generated by another round of SOE PCR in which the 5' fragment and 3' fragment





57

were mixed and used as templates. The final PCR products contained a T7 promoter, the whole length HLA cDNA sequence and a poly(A) tail followed by a Hind III restriction site and an anchor sequence. The anchor sequence was removed by digestion of the PCR products with Hind III (Boehringer Mannheim, Indianapolis, IN). The whole length HLA heavy chain cDNA was then generated. The different fragments of HLA-cDNA used for SOE-PCR are shown in Figure 17.


Synthesis of Capped HLA-A24 and -B60 mRNAs by In Vitro Transcription

Five hundred nanograms of whole length HLA cDNA fragments generated as described above were used as templates for in vitro transcription in a volume of 20 gl at 370C for 3 hours using T7 RNA polymerase according to the manufacturer's protocol (mMachinemrnMessageTM In Vitro Transcription Kits) (Ambion Inc., Austin, TX) to synthesize capped HLA mRNA. After 3 hours incubation, 7.5 units RNase-free DNase I was added and incubated at 37C for 60 minutes to degrade the template DNA. The in vitro synthesized RNA transcripts were recovered with LiC1 precipitation and further cleaned using an RNeasy spin column (QIAGEN Inc., Chatsworth, CA). The concentrations of the synthesized RNA were measured by absorbance at 260 nm.


Synthesis of HLA-A24 and -B60 Proteins by In Vitro Translation

After heating to 67oC for 10 min, 25 ng/pl of HLA-A or -B mRNAs transcribed in vitro were translated at 30'C for 2 hours in a 25 pl reaction mixture containing 17.5 pl of nuclease-treated rabbit reticulocyte lysate (Promega, Madison, WI), 20 units of RNasin, 20 RM amino acids minus methionine, and 20 gCi [35S]methionine (Amersham Life Science, Inc., Arlington Heights, IL). Five microliters of each translation reaction mixture were analyzed by conventional SDS-PAGE (10% acrylamide) followed by fixation and autoradiography or phosphor imaging of the dried gel. The translation products were also analyzed by SDS-PAGE followed by immunoblotting with 171.4 anti-HLA-A and -B





58


heavy chain (Hc) monoclonal antibody (mAb) (Kao et al., 1990) and autoradiography to confirm that they are HLA heavy chains.


Autoradiography and Phosphor Imaging

For autoradiography, the SDS-PAGE gels were exposed to Kodak Biomax MR film (Kodak Scientific Imaging Systems, Rochester, NY) with an intensifying screen for 24 hr at -70'C. For phosphor imaging, the gels were exposed to a Phosphorscreen (Molecular Dynamics, Inc., Sunnyvale, CA) for 48 hours at room temperature. The radioactivity of each specific protein band was quantified using ImageQuant software (Molecular Dynamics, Inc., Sunnyvale, CA).



Results



Cloning of HLA-A24 and -B60 cDNA Ends by RACE PCR

Although coding sequences for many class I HLA genes have been documented (Mason and Parham 1998), the non-coding sequences at 5' end or 3' end of class I HLA mRNAs are available only for a few HLA genes, not including HLA-A24 or -B60 (Srivastava et al., 1985). In order to obtain the full-length HLA-A24 and -B60 cDNAs, we first obtained the 5' and 3' end sequences of HLA-A24 and -B60 cDNAs by RACE PCR. The RACE protocol we used allowed us to amplify only the 5' end with intact 5'-UTR (Frohman 1994). The cloned 5'-UTR sequences of HLA-A24 and -B60 are shown in Table 3. After comparing the 5'-UTRs of the cloned HLA-A24 and -B60 mRNAs, we found two types of 5'-UTRs for HLA-A24 mRNAs. One has 40 nucleotides and the other has 22 nucleotides (Table 3). The cloned 5'-UTR sequence of HLA-B60 only consists of 21 nucleotides. So far, the long 5'-UTR was not found in 5'-end clones of HLA-A2,-B7 and -B35 mRNAs and may be unique for HLA-A24. After comparing these sequences with the published 5'-UTR sequences of HLA-A and -B mRNAs, it was found that the





59

Table 3 5' end sequences of HLA-A24 and -B60 mRNAs


HLA 5' end sequence*
A24
(long) 5'-ACGCACCCACCGGGACUCAGAUUCUCCCCAGACGCCGAGGAUGGCCGUCAUGGCG-3' A24 5'-AGAUUCUCCCCAGACGCCGAGGAUGGCCGUCAUGGCG-3'

B60 5'-AGAAUCUCCUCAGACGCCGAG AUGCGGGUCACGGCA-3'

*Coding sequence is underlined.



short 5'-UTRs of HLA-A24 and -B60 mRNAs are highly similar to those of other HLA-A and -B mRNAs.

The 3'-UTR sequences of HLA-A24 and -B60 mRNAs were also obtained (Figure 16) There is about 15% difference between the 3'-UTR sequence of HLA-A24 mRNA and that of HLA-B60 mnRNA throughout the 3' trail of about 430-nucleotides.


Cloning of Full-length HLA-A24 and -B60 heavy chain cDNAs by PCR

Because we were unsuccessful in using PCR to directly generate the full-length

cDNA, the full-length HLA cDNAs were constructed using a PCR technique based on SOE (Horton et al., 1989). We first cloned part of HLA coding sequences, the 5' end sequences and the 3' end sequences of HLA-A24 (Figure 17A) and -B60 (Figure 17B) into plasmids. The HLA cDNA fragments with overlap sequences were then amplified from the plasmids and spliced together by using SOE PCR (Figure 17). A T7 promoter was incorporated into the 5' end of each HLA cDNA. Poly(A)7 at the 3' end was followed by a Hind III restriction site and an anchor sequence. After digestion of the final PCR products with Hind III, the whole length HLA-A 24 and -B60 heavy chain cDNAs were used as templates for in vitro transcription to synthesize capped HLA mRNAs for translation study.






60


>A24 AAAGUGUGAG ACAGCUGCCU UGUGUGGGAC UGAGAGGCAA GAGUUGUUC:
>B60 --CC---- -------U -- ----UA----- -----U---G --U--C---A


>A24 CUGCCCUUCC CUUUGUGACU UGAAGAACC: CUGACUU:UG UUUCUGCAAA
>B60 :---- :--- ------- -C----G--U ---G-A-C-C --------->A24 GGCACCUGCA UGUGUCUGUG UUCAUGUAGG CAUAAUGUGA GGAGGUGGGG
>B60 --------A- ------- C- -C-C---UA- -C-------- --------A>A24 AGACCACCCC ACCCCCAUGU CCACCAUGAC CC:UCUUCCC ACGCUGACCU
>B60 ---- :-G--- ------G -------UG---- --C-G-----U -------->A24 GUGCUCCCUC CCCAAUCAUC UUUCCUGUUG CAGAGAGGUG GGGCUGAGGU
>B60 ---UU- ---- ----G ----- ----U ----C ------------ ------:-A>A24 GUCUCCAUCU CUGUCUCAAC UUCAUGGUGC ACUGAGCUGU AACUUCUUCC
>B60 UC---------- ---------- --U---:--- ---------C --------A>A24 UUCCCUAUU: AAAAUUAGAA CCUGAGUAUA AAUUUACUUU CUCAAAUUCU
>B60 -------C-G ------A---- U---- A ---- ----GU--- -------AU>A24 UGCCAUGAGA GGUUGAUGAG UUAAUUAAAG GAGAAGAUUC CUAAAAUUUG
>B60 ---U------ --------GA ---------U A--UCA---- --GG----->A24 AGAGACAAAA UAAAUGGAAC ACAUGAGAAC CUUC
>B60 -A---GC--- ----:-:-:- :-: ------- ---Figure 16 The 3'-UTR sequences for HLA-A24 and -B60 mRNAs. ":" denotes a deletion introduced to maximize the homology.


In Vitro Translation study of HLA-A24 and -B60 mRNAs

After digestion with Hind III, the HLA-A24 and -B60 cDNA constructs were used to prepare capped HLA mRNA by in vitro transcription. The same amounts of capped HLA-A24 and -B60 mRNAs (25 ng/tl) were used for sythesizing HLA-A24 and -B60 proteins by in vitro translation in the rabbit reticulocyte system. The same amounts of translation mixtures were analyzed by SDS-PAGE, phosphor imaging and immunoblotting. The results shown in Figure 18 indicate that more HLA-A24 heavy chains were synthesized from HLA-A24 mRNAs than HLA-B60 heavy chains from HLA B60 mRNAs. In addition, the long HLA-A24 mRNA is shown to be more efficient than




























Figure 17 Cloning of HLA-A24 and -B60 heavy chain cDNAs by PCR. (A) PCR fragments of HLA-A24 cDNAs. One is with short UTR (HLA-A24), and the other is with longer UTR (HLA-A24L). Fragment 1 (Frag 1) corresponds to a HLA mRNA sequence from +251 to +1122 (A in first ATG initiation codon is designated as +1.). Fragment 2 (Frag 2) corresponds to the sequence from +937 to the anchor sequence. 5' fragment (Frag 5') represents a T7 promoter plus the sequence from -22 (for HLA-A24) or -40 (for HLA-A24L) to +340. (B) PCR fragments of HLA-B60 cDNAs. Fragment 1 (Frag 1) correponds to a HLA mRNA sequence from +218 to +1122 (A in first ATG initiation codon is designated as +1.). Fragment 2 (Frag 2) corresponds to the sequence from +808 to the anchor sequence. 5' fragment (Frag 5') represents a T7 promoter plus the sequence from -22 to +340. M: DNA markers.





62


(A)
(kb) M Frag 3' Frag 5' HLA-A24 Frag 5' HLA-A24 m (b
Frag 1 Frag 2 (Frag 1+2) (Frag 5'+3') (Frag 5'+3') M (b
2.0 -2.0
1.5 1.5










Hind III
T7 5'UTRI 3'UTR (n-log Fragi110

!-Q 4 Frag 2
[1 Frag 5' -1HFrag 3' HLA-A24 oDNA


(B)
(kb) M Fag1 Fg2 Frag 3' Frag 5' HLA-B360 IM (kb)
(k)Fa rg2 (Frag 1+2) (Frag 5'+3')














Hind III
T7 5'UTR I3'UTR (n

104 rag IFrag 2


i-rag ~ Frag 3, r

HLA -16U CUNA





63



(A) BK A24L A24 B60 HLA (B) BK A24L A24 B60





(C) 300

O
c10

0 200

-W


100 E J



0
A24L A24 B60
HLA mRNA

Figure 18 In vitro translation study of HLA-A24 and HLA-B60 mRNAs.
(A) Representative immunoblot of a SDS-PAGE gel for newly synthesized heavy chains of HLA-A24 and -B60. The [35S]methionine-labeled HLA-A24 and -B60 proteins generated by in vitro translation of long HLA-A24 (A24L), short HLA-A24 (A24) and HLA-B60 (B60) mRNAs were analyzed by SDS-PAGE and immunoblotting. The protein bands on the blot membrane was quantified by phosphor imaging. BK: control reaction mixture without addition of HLA mRNAs. HLA: purified HLA heavy chain. Two bands with 44 kD and 40 kD were shown in the purified HLA heavy chain. The 40 kD represent the degraded HLA. (B) Phosphor image of the immunoblot in (A). (C) The relative quantities of HLA proteins synthesized by in vitro translation of HLA-A24L, HLA-A24 and HLAB60 mRNAs:
Relative quantity of HLA-A24 proteins synthesized by short HLA-A24 mRNAs is designated as 100%;
Relative quantity of HLA-A24 proteins synthesized by long HLA-A24 mRNAs = [(phosphor density of A24L)/(phosphor density of A24)] x 100%; Relative quantities of HLA-B60 proteins synthesized HLA-B60 mRNAs = [(phosphor density of B60 x 9)/(phosphor density of A24 x 5)] x 100%. Each value represents the mean of four separate measurements. Because HLA-B60 protein has fewer methionine residues (5/molecule) than HLA-A24 protein (9/molecule), the quantity of HLA-B60 protein determined by phosphor imaging was calibrated based on its number of methionine residues.





64


the short HLA-A24 mRNA in synthesizing HLA-A24 heavy chains. HLA heavy chains were identified based on molecular weight and immunoblotting with 171.4 anti-HLA-Hc mAb (Kao et al., 1990) (Figure 18). The amounts of HLA heavy chains produced by different mRNAs in four separate experiments were quantified and normalized according to their methionine contents against HLA heavy chains synthesized from the short HLA-A24 mRNAs. The results shown in Figure 18C indicated that the efficiency of HLA heavy chain synthesis were 174%, 100% and 59% for long HLA-A24 mRNA, short HLA-A24 mRNA and HLA-B60 mRNA, respectively.



Discussion



The primary goal of this study was to determine whether HLA-A24 mRNA is more efficient in protein translation as suggested by our earlier quantitative correlation study between cytoplasmic HLA mRNA and HLA protein expression (Table 2 in Chapter 3). To accomplish this goal we studied the in vitro protein translation of HLA-A24 and -B60 mRNAs from the 9075 cell line. This cell line was chosen for our study because of the consistent reverse correlation observed between relative quantities of HLA-A24 and -B60 mRNAs and that of HLA-A24 and -B60 proteins.

Although the gene sequences of class I HLA have been documented (Mason and Parham 1998) and the regulatory elements of the promoter region have been identified (Cereb and Yang 1994), there are few reports on the initiation sites of the transcription of HLA genes. Also, the reported 5'-UTR sequences are often incomplete. In order to obtain the full-length HLA cDNA for our in vitro protein translation study, the sequence information of 5' UTR and 3'-UTR for HLA-A24 and -B60 mRNAs had to be obtained. By using the RACE technique, we were able to obtain 5'-UTR and 3'-UTR sequences and to clone the full-length HLA cDNAs. In the 5' RACE approach, we first dephosphorylated all the degraded mRNA with CIP to render them inert during the ensuing ligation reaction.





65


Then, the intact capped mRNAs were treated with tobacco acid pyrophosphatase. This treatment makes them active for the subsequent ligation with an RNA anchor oligonucleotide (Frohman, 1994). By using this approach, we identified two types of HLA-A24 mRNA with two different lengths of 5'-UTRs (Table 3). Although we did not find any HLA-B60 mRNA with long 5'-UTR, this possibility have not been excluded.

Results of the translation study in rabbit reticulocyte lysate system using HLA-A24 and -B60 mRNAs synthesized in vitro indeed demonstrated that HLA-A24 transcripts are more efficient than HLA-B60 mRNAs in synthesizing HLA proteins. The newly synthesized HLA heavy chains are identified based on molecular weight and immunoreactivity to an anti-HLA-heavy chain monoclonal antibody. Although there is some nonspecific binding of 171.4 mAb to other proteins present in rabbit reticulocyte lysate, the inclusion of a control mixture of rabbit reticulocyte lysate enabled us to identify the newly synthesized HLA-heavy chains. We did not observe any nonspecific binding of 171.4 to molecular weight standards. The reasons for the observed high background on our immunoblot are not clear. To obtain more accurate quantitative results, the newly synthesized HLA heavy chains were measured by phosphor imaging (Figure 18B). The results shown in Figure 18C indicated that long HLA-A24 transcript is more efficient than the short HLA-A24 transcript and that the short HLA-A24 transcripts are about 2 times more efficient than HLA-B60 transcripts in making HLA heavy chains. Based on our previous measurements of the relative quantities of HLA-A24 and -B60 mRNAs (41% vs. 59%) in the 9075 cell line, and the protein translation efficiency determined by the present study, we predict that relative quantities of HLA-A24 and -B60 proteins in the 9075 cell line will be 54% vs. 46%. This calculation, however, did not take into consideration of a small percentage of HLA-A24 transcripts that are present in long form, which are about 3-4 times more efficient than HLA-B60 transcripts in protein translation. Thus, the calculated values are close to the relative quantities of HLA-A24 and -B60 proteins (63% vs. 37%) observed in the 9075 cell line.





66


Although our results showed that HLA-A24 transcripts are more efficient in protein translation in the rabbit reticulocyte lysate system, the exact mechanism for this finding is not clear. When the 5' end sequences of HLA-A24 and -B60 mRNAs are compared, the following features are noticed: (1) There are two AUG codons, separated by 6 nucleotide residues at the beginning of coding sequence for HLA-A24 mRNA (Table 1). The translation may be initiated at either of these two codons (Srivastava et al., 1985), whereas only the first AUG is found at the beginning of HLA-B60 mRNA coding sequence. (2) The 5'-UTR of HLA-B60 mRNA has a one-nucleotide deletion immediately before the first AUG codon comparing to that of HLA-A24 mRNA. (3) No exact Kozak sequence GCCA(G)CCAUGG (Kozak, 1984; Kozak, 1986; Kozak, 1987) is found in the 5'-UTR of either HLA-A24 or HLA-B60. However, the sequence proximal to the second AUG codon of HLA-A24 mRNA (GCCGTCAUGG) is more similar to the Kozak sequence than the sequence proximal to the first AUG codon of HLA-B60 codon (GCCGAGAUGC). It is likely that these differences may contribute to the enhanced protein translation efficiency by HLA-A24 mRNA. Moreover, there are about 10% and 15% difference between HLA-A and -B in coding sequences and 3'-UTR, respectively. Because the 3'-UTR could also play some role in regulating mRNA translation (Jacobson and Peltz, 1996), the possible effect of 3'-UTR on the observed differential translation of HLA-A24 and -B60 mRNAs could not be excluded.

In this study, we also found that the long HLA-A24 mRNA is more efficient for protein translation than the short form. This finding indicated that the long 5'-UTR may enhance the protein translation initiation. The mechanism for the enhanced translation of long HLA-A24 mRNA is not clear. Because no secondary structures are found within this long 5'-UTR, it is likely that the longer 5'-UTR can accumulate extra 40S ribosomal subunits, which may account for its translational advantage (Kozak, 1991).

Because the rabbit reticulocyte lysate system had been shown to be efficient for in vitro protein translation and was commercially available (Pelham and Jackson, 1976;





67


Shields and Blobel, 1978), this system was chosen for our study. However, the rabbit reticulocyte lysate is a heterologous system, and the results obtained from this system may not represent the actual situation in human lymphoblastoid cells. At present, the exact mechanism responsible for the enhanced HLA-A24 protein translation has yet to be further elucidated. Nevertheless, the results of this study suggested that different protein translation rates could contribute to genetically predetermined differential quantitative expression of HLA-A and -B antigens.














CHAPTER 5
SUMMARY AND FUTURE DIRECTION



Earlier studies have shown that different specific HLA-A and -B antigens are

differentially expressed in cells. Their relative quantities are genetically predetermined and inherited according to Mendelian law (Kao and Riley, 1993). In order to determine the regulatory mechanisms underlying the observed phenomenon, we first studied the turnover of HLA proteins in lymphoblastoid cell lines and found that different HLA-A and -B antigens are proportionally degraded. When the relative quantities of HLA proteins were correlated with those of HLA mRNAs, it was found that, in most of the studied cell lines, the relative quantities of different HLA-A and -B proteins are proportional to those of their respective mRNAs.

In addition, different HLA-A and -B proteins have similar stabilities (Figure 8) and the levels of different HLA-A and -B proteins are proportional to their mRNA levels in most lymphoblastoid cell lines. These findings indicate that the availability of functional HLA mRNAs determines the differential quantitative expression of HLA antigens. Because the steady-state levels of HLA mRNAs are regulated by mRNA production and degradation, the involvement of both steps in regulating the differential quantitative expression of HLA antigens was studied. First, we measured the relative quantities of different HLA-A and -B mRNAs before and after the cells were treated with DRB, an inhibitor of RNA polymerase II. The results of this study showed that different HLA-A and -B mRNAs were proportionally degraded in five out of seven cell lines studied, and that the stabilities of HLA-A and -B mRNAs in the remaining two cell lines appear to have slightly different turnover rates. This finding suggests that the varying stability for HLA-A



68





69


and -B mRNAs only plays a minor role in determining differential quantitative expression for certain HLA-A and -B antigens.

Next, we studied the role of mRNA production. The results of our PCR-based

nuclear run-on study showed that newly synthesized HLA transcripts only account for less than 20% of total HLA pre-mRNAs. The presence of relatively large amount of premRNA suggests that pre-mRNA splicing could be a rate-limiting step in regulating HLA mRNA production. This finding also prevents us from accurately measuring the newly synthesized HLA transcripts by using a PCR-based nuclear run-on method. We therefore performed experiments to determine the relative quantities of unspliced HLA-A and -B transcripts and those of spliced HLA-A and -B transcripts. It was found that different HLA-A and -B pre-mRNAs in nuclei are not proportional to their mature cytoplasmic mRNAs in five of seven HLA-phenotyped lymphoblastoid cell lines. The differences are quite significant for some of the cell lines. These results suggest that the splicing of premRNA and gene transcription are critical in regulating the genetically predetermined differential expression of HLA-A and -B antigens in different cell lines.

Although the relative quantities of different HLA-A and -B antigens are proportional to the relative amounts of their respective mRNAs in most lumphoblastoid cell lines, in cell lines positive for the HLA-A24 or -B7, the HLA-A24 and -B7 proteins appear to be overexpressed. This observation suggests that mRNAs for certain HLA antigens may be more efficient in synthesizing HLA heavy chains. We therefore selected the 9075 cell line, which is positive for HLA-A24 and -B60, to study whether translation of mRNA plays a role in influencing the differential quantitative expression of HLA-A and -B antigens. In vitro translation studies indicated that HLA-A24 and -B60 mRNAs synthesized in vitro indeed have different translation rates. Our results showed that HLA-A24 mRNA is more efficient than HLA-B 60 mRNA in synthesizing HLA proteins. This observation supported the hypothesis that differential mRNA translation could play a role in determining the differential quantitative expression of HLA antigens for certain HLA phenotypes.





70


In summary (Table 4), the results of my study indicate that the quantitative differential expression of HLA-A and -B antigens is determined by combinations of multiple steps. These steps include gene transcription, pre-mRNA splicing, mRNA degradation, andlor mRNA translation depending on specific HLA alleles in different individuals. Among them, gene transcription and pre-mRNA splicing play the most prominent roles. For certain specific HLA antigens, i.e. HLA-A24, protein translation also plays a significant role.



Table 4 Contribution of different controlling steps to the regulation of differential
quantitative expression of different HLA-A and -B antigens in the studied LCLs. LCL HLA-A&-B Gene Pre-mRNA mRNA nRNA protein
Phenotypes transcription* splicing turnover translation turnover 9005 A3, B27 +? + ND

9027 A29, B44 + +

9067 A2, B27 + +

9068 A2, B35 +? ND

SH A2, A3, +? ND ND + ND
B7, B44,

CG A2-var, A3, +? ND ND + ND
B,7, B45

9075 A24, B60 +? + + ND
DC A11, A24, +? + + ND
B35, B60

9001 A24, B7 +? + +

9028 A24, B60, +? + +
B61

+: plays a role in determining the differential quantitative expression of HLA-A and -B
antigens in this LCL.
-: does not play a role in determining the differential quantitative expression of HLA-A and
-B antigens in this LCL.
*: Conclusion for this step is inferred from studies of other steps. ND: not determined.





71


The differential quantitative expression of class 1 HLA antigens could also be regulated by other steps, including the association of HLA heavy chain with 132m or chaperones, the availability of antigenic peptides, and the transportation of the assembled antigens to the cell surface. Although all of these additional potential regulatory steps have not been studied, they are not likely to play significant roles in regulating the observed differential quantitative expression. If these additional steps were important in regulating the differential expression of HLA antigens, we would not have observed the proportional correlation between the relative amounts of HLA-A and -B proteins and those of their respective I-LA-A and -B mRNAs in most cell lines (Table 2).

Although the research works presented in this dissertation have identified the critical steps for regulating differential quantitative expression of HLA antigens, the exact molecular mechanisms directly responsible for differential gene transcription, differential pre-mRNA splicing, and differential protein translation remain to be elucidated. The sequence differences among different HLA-A and -B genes scattered in both coding and non-coding regions could be involved in regulating the genetically predetermined differential quantitative expression of HLA-A and -B antigens. Therefore, it would be of interest to determine how 5'-UTR, 3'-UTR and/or coding sequences determine the observed different efficiencies in protein translation by different HLA mRNAs. This study can be conducted by constructing different HLA-A24-B360 cDNA hybrids and performing the in vitro translation study. By switching the 5'-UTR of HLA-A24 mRNA to that of HLA-B60 mRNA, for example, we will be able to learn whether the sequence difference in their 5'-UTRs plays a certain role in regulating the observed differential translation. To investigate how HLA-A and -B pre-mRNAs are spliced differentially, northern blot of the nuclear RNAs with probes derived from different introns could be used to determine whether introns of different HLA pre-mRNAs are spliced following the same order or not. It is also important to identify the specific sequence(s) responsible for the observed differential splicing of HLA-A and -B pre-mRNAs. Further comparative study on genomic





72


structures of HLA-A and -B genes from unrelated individuals will enable us to answer the questions regarding the underlying mechanisms for differential gene transcription. A deeper understanding of these different regulatory steps will allow us to further elucidate the biological and genetical importance of differential quantitative expression of HLA antigens in deten-nining varying disease susceptibilities such as immune surveillance of tumor cells and recovery from virus infection in the future.














REFERENCES



Adamashvili, I. M., Fraser, P. A., and McDonald, J. C. (1996). "Association of serum concentration of soluble class I HLA with HLA allotypes [see comments]." Transplantation, 61(6), 984-7.

Allen, M., Liu, L., and Gyllensten, U. (1994). "A comprehensive polymerase chain reaction-oligonucleotide typing system for the HLA class I A locus." Hum Immunol, 40(1), 25-32.

Anderson, M., Paabo, S., and Nilsson, T. (1985). "Impaired intracellular transport of class I MHC antigens as a possible means for adenoviruses to evade immune surveillance." Cell, 43, 215-222.

Balvay, L., Libri, D., and Fiszman, M. Y. (1993). "Pre-mRNA secondary structure and the regulation of splicing." Bioessays, 15(3), 165-9.

Bednarek, M. A., Engl, S. A., Gammon, M. C., Lindquist, J. A., Porter, G., Williamson, A. R., and Zweerink, H. J. (1991). "Soluble HLA-A2.1 restricted peptides that are recognized by influenza virus specific cytotoxic T lymphocytes." JImmunol Methods, 139(1), 41-7.

Beelman, C. A., and Parker, R. (1995). "Degradation of mRNA in eukaryotes." Cell, 81(2), 179-83.

Benham, A. M., and Neefjes, J. J. (1997). "Proteasome activity limits the assembly of MHC class I molecules after IFN-gamma stimulation." J Immunol, 159(12), 5896-904.

Bernstein, S. I., and Hodges, D. (1997). "Constitutive and alternative mRNA splicing." mRNA Metabolism & Post-transcriptional Gene Regulation, J. B. Harford and D. R. Morris, eds., Wiley-Liss, Inc., New York, NY, 43-60.

Bhasker, C. R., Burgiel, G., Neupert, B., Emery-Goodman, A., Kuhn, L. C., and May, B. K. (1993). "The putative iron-responsive element in the human erythroid 5aminolevulinate synthase mRNA mediates translational control." J Biol Chem, 268(17), 12699-705.

Bidwell, J. (1994). "Advances in DNA-based HLA-typing methods." Immunol Today, 15(7), 303-7.

Bishara, A., Nelken, D., and Brautbar, C. (1988). "Differential expression of HLA class-I antigens on B and T lymphocytes obtained from human lymphoid tissues." Immunobiology, 177(1), 76-81.

Bjorkman, P. J., and Parham, P. (1990). "Structure, function, and diversity of class I major histocompatibility complex molecules." Annu Rev Biochem, 59, 253-288.


73





74

Bjorkman, P. J., Saper, M. A., Samraoui, B., Bennett, W. S., Strominger, J. L., and Wiley, D. C. (1987). "The foreign antigen binding site and T cell recognition regions of class I histocompatibility antigens." Nature, 329, 512.

Blanar, M. A., Baldwin, A. S., Flavell, R. A., and Sharp, P. A. (1989). "A gammainterferon-induced factor that binds the interferon response sequence of the MHC class I gene H-2Kb." EMBO J, 8, 1139.

Bodmer, J. G., Marsh, S. G., Albert, E. D., Bodmer, W. F., Bontrop, R. E., Charron, D., Dupont, B., Erlich, H. A., Fauchet, R., Mach, B., Mayr, W. R., Parham, P., Sasazuki, T., Schreuder, G. M., Strominger, J. L., Svejgaard, A., and Terasaki, P. I. (1997). "Nomenclature for factors of the HLA system, 1996." Tissue Antigens, 49(3 Pt 2), 297-321.

Bodmer, W. F., Browning, M. J., Krausa, P., Rowan, A., Bicknell, D. C., and Bodmer, J. G. (1993). "Tumor escape from immune response by variation in HLA expression and other mechanisms." Ann N YAcad Sci, 690, 42-9.

Bordier, C. (1981). "Phase separation of integral membrane proteins in Triton X-114 solution." J Biol Chem, 256(4), 1604-7.

Brady, H. A., and Wold, W. S. (1987). "Identification of a novel sequence that governs both polyadenylation and alternative splicing in region E3 of adenovirus." Nucleic Acids Res, 15(22), 9397-416.

Braud, V. M., Allan, D. S., O'Callaghan, C. A., Soderstrom, K., D'Andrea, A., Ogg, G. S., Lazetic, S., Young, N. T., Bell, J. I., Phillips, J. H., Lanier, L. L., and McMichael, A. J. (1998). "HLA-E binds to natural killer cell receptors CD94/NKG2A, B and C." Nature, 391(6669), 795-799.

Breur-Vriesendorp, B. S., Dekker-Saeys, A. J., and Ivanyi, P. (1987). "Distribution of HLA-B27 subtypes in patients with ankylosing spondylitis: the disease is associated with a common determinant of the various B27 molecules." Ann Rheum Dis, 46(5), 353-6.

Brewerton, D. A., Cafrey, M., Nicholls, A., and James, D. C. (1974). "Proceedings: Histocompatibility antigen (HL-A 27) and its relation to disease." Ann Rheum Dis, 33(4), 406-7.

Bukowski, J. F., and Welsh, R. M. (1985a). "Interferon enhances the susceptibility of virus infected fibroblasts to cytotoxic T cells." J Exp Med, 161(1), 257-62.

Bukowski, J. F., and Welsh, R. M. (1985b). "Interferon enhances the susceptibility of virus-infected fibroblasts to cytotoxic T cells." JExp Med, 161, 257.

Cabrera, C. V., Lee, J. J., Ellison, J. W., Britten, R. J., and Davidson, E. H. (1984).
"Regulation of cytoplasmic mRNA prevalence in sea urchin embryos. Rates of appearance and turnover for specific sequences." J Mol Biol, 174(1), 85-111.

Caponigro, G., and Parker, R. (1996). "Mechanisms and control of mRNA turnover in Saccharomyces cerevisiae." Microbiol Rev, 60(1), 233-49.

Carneiro, M., and Schibler, U. (1984). "Accumulation of rare and moderately abundant mRNAs in mouse L-cells is mainly post-transcriptionally regulated." JMol Biol, 178(4), 869-80.





75


Carstens, R. P., McKeehan, W. L., and Garcia-Blanco, M. A. (1998). "An intronic sequence element mediates both activation and repression of rat fibroblast growth factor receptor 2 pre-mRNA splicing." Mol Cell Biol, 18(4), 2205-17.

Cereb, N., and Yang, S. Y. (1994). "The regulatory complex of HLA class I promotors exhibits locus-specific conservation with limited allelic variation." J Immunol, 152, 3873.

Charlton, R. K., and Zmijewski, C. M. (1970). "Soluble HL-A7 antigen: localization in the beta-lipoprotein fraction of human serum." Science, 170(958), 636-7.

Ciccone, E., Pende, D., Vitale, M., Nanni, L., Di-Donato, C., Bottino, C., Morelli, L., Viale, O., Amoroso, A., and Moretta, A. e.-a. (1994). "Self class I molecules protect normal cells from lysis mediated by autologous natural killer cells." Eur J Immunol, 24(4), 1003-1006.

Curtis, D., Lehmann, R., and Zamore, P. D. (1995). "Translational regulation in development." Cell, 81(2), 171-8.

D'Amato, M., Fiorillo, M. T., Carcassi, C., Mathieu, A., Zuccarelli, A., Bitti, P. P., Tosi, R., and Sorrentino, R. (1995). "Relevance of residue 116 of HLA-B27 in determining susceptibility to ankylosing spondylitis." Eur J Immunol, 25(11), 3199-201.

Daniel, S., Caillat-Zucman, S., Hammer, J., Bach, J. F., and van Endert, P. M. (1997). "Absence of functional relevance of human transporter associated with antigen processing polymorphism for peptide selection." J Immunol, 159(5), 2350-7.

David-Watine, B., Israel, A., and Kourilsky, P. (1990). "The regulation and expression of MHC class I genes." Immunol Today, 11, 286-292.

Davidson, W. F., Kress, M., Khoury, G., and Jay, G. (1985). "Comparison of HLA class I gene sequences: Derivation of locus-specific oligonucleotide probes specific for HLA-A, HLA-B, and HLA-C genes." J Biol Chem, 260(25), 13414-13423.

de Villartay, J. P., Rouger, P., Muller, J. Y., and Salmon, C. (1985). "HLA antigens on peripheral red blood cells: analysis by flow cytofluorometry using monoclonal antibodies." Tissue Antigens, 26(1), 12-9.

Devarajan, P., Gilmore-Hebert, M., and Benz, E. J., Jr. (1992). "Differential translation of the Na,K-ATPase subunit mRNAs." J Biol Chem, 267(31), 22435-9.

Driggers, P. H., Ennist, D. L., Gleason, S. L., Mak, W., Marks, M. S., Livi, B.-Z.,
Flanagan, J. R., Appella, E., and Ozato, K. (1990). "An interferon g-regulated protein that binds the interferon-inducible enhancer-element of major histocompatibility complex class I genes." Proc Natl Acad Sci USA, 87, 3743-7.

Ehrlich, R., Sharrow, S., Maguire, J. E., and Singer, D. S. (1989). "Expression of a class I MHC transgene: effects of in vivo a/b interferon treatment." Immunogenetics, 30, 18.

Elrick, L. L., Humphrey, M. B., Cooper, T. A., and Berget, S. M. (1998). "A short sequence within two purine-rich enhancers determines 5' splice site specificity." Mol Cell Biol, 18(1), 343-52.





76


Ennis, P. D., Zemmour, J., Salter, R. D., and Parham, P. (1990). "Rapid cloning of HLA-A, B cDNA by using the polymerase chain reaction: frequency and nature of errors produced in amplification." Proc Natl Acad Sci USA, 87(7), 2833-7.

Eperon, L. P., Graham, I. R., Griffiths, A. D., and Eperon, I. C. (1988). "Effects of RNA secondary structure on alternative splicing of pre-mRNA: is folding limited to a region behind the transcribing RNA polymerase?" Cell, 54(3), 393-401.

Everett, E. T., Kao, K. J., and Scornik, J. C. (1987). "Class I HLA molecules on human erythrocytes. Quantitation and transfusion effects." Transplantation, 44(1), 123-9.

Falcone, D., and Andrews, D. W. (1991). "Both the 5' untranslated region and the sequences surrounding the start site contribute to efficient initiation of translation in vitro." Mol Cell Biol, 11(5), 2656-64.

Falk, K., Rotzschke, O., Stevanovic, S., Jung, G., and Rammensee, H. G. (1991). "Allele-specific motifs revealed by sequencing of self-peptides eluted from MHC moecules." Nature, 351, 290-296.

Frohman, M. A. (1994). "On beyond classic RACE (rapid amplification of cDNA ends)." PCR Methods Appl, 4(1), S40-58.

Furdon, P. J., and Kole, R. (1988). "The length of the downstream exon and the substitution of specific sequences affect pre-mRNA splicing in vitro." Mol Cell Biol, 8(2), 860-6.

Gallie, D. R. (1991). "The cap and poly(A) tail function synergistically to regulate mRNA translational efficiency." Genes Dev, 5(11), 2108-16.

Gallie, D. R., and Tanguay, R. (1994). "Poly(A) binds to initiation factors and increases cap-dependent translation in vitro." JBiol Chem, 269(25), 17166-73.

Gambacurta, A., Piro, M. C., and Ascoli, F. (1993). "Differential in vitro translation of the precursors of bovine pancreatic trypsin inhibitor and its isoinhibitor II is controlled by the 5'-end region of their mRNAs." Biochim Biophys Acta, 1174(3), 267-73.

Gao, X., Jakobsen, I. B., and Serjeantson, S. W. (1994). "Characterization of the HLA-A polymorphism by locus-specific polymerase chain reaction amplification and oligonucleotide hybridization." Hum Immunol, 41(4), 267-79.

Gause, W. C., and Adamovicz, J. (1994). "Use of the PCR to quantitate gene expression." PCR Methods Appl., 3, S123.

Gerrard, T. L., Dye, r. D. R., Zoon, K. C., zur-Nedden, D., and Siegel, J. P. (1988).
"Modulation of class I and class II histocompatibility antigens on human T cell lines by IFN-gamma." J Immunol, 140(10), 3450-5.

Gilliland, G., Perrin, S., and Bunn, H. F. (1990). "Competitive PCR for quantitation of mRNA." PCR Protocols: A Guide to Methods and Applications, M. A. Innis, D. H. Gelfand, J. J. Sninsky, and T. J. White, eds., Academic Press, San Diego, CA, 60.

Girdlestone, J., Isamat, M., Gewert, D., and Milstein, C. (1993). "Transcriptional regulation of HLA-A and -B: differential binding of members of the Rel and IRF families of transcription factors." Proc Natl Acad Sci US A, 90(24), 11568-72.





77

Girdlestone, J., and Milstein, C. (1988). "Differential expression and interferon response of HLA class I genes in thymocyte lines and response variants." Eur J Immunol, I18(1), 139-43.

Gosgusev, J., Teutsch, B., Morin, M. T., Mongiat, F., Hagenau, F., Suskind, G., and Rabotti, G. F. (1988). "Inhibition of HLA class I antigen and mRNA expression induced by Rous sarcoma virus in transformed human fibroblasts." Proc Natl Acad Sci USA, 85, 203.

Grant, E. P., Michalek, M. T., Goldberg, A. L., and Rock, K. L. (1995). "Rate of antigen degradation by the ubiquitin-proteasome pathway influences MHC class I presentation." J Immunol, 155(8), 3750-8.

Gray, N. K., and Hentze, M. W. (1994). "Regulation of protein synthesis by mRNA structure." Mol Biol Rep, 19(3), 195-200.

Greig, G. M., Sharp, C. B., Carrel, L., and Willard, H. F. (1993). "Duplicated zinc finger protein genes on the proximal short arm of the human X chromosome: Isolation, characterization and X-inactivation studies." Hum Mol Genet, 2, 1611.

Haga, J. A., She, J. X., and Kao, K. J. (1991). "Biochemical characterization of 39-kDa class I histocompatibility antigen in plasma. A secretable membrane protein derived from transmembrane domain deletion." J Biol Chem, 266(6), 3695-701.

Hakem, R., Le-Bouteiller, P., Barad, M., Trujillo, M., Mercier, P., Wietzerbin, J., and Lemonnier, F. A. (1989). "IFN-mediated differential regulation of the expression of HLAB7 and HLA-A3 class I genes." J Immunol, 142(1), 297-305.

Hall, F. C., and Bowness, P. (1996). "HLA and disease: from molecular function to disease association?" HLA and MHC: genes, molecules and function, M. Browning and A. McMichael, eds., BIOS Scientific Publishers Ltd, Oxford, UK, 353-381.

Hampsey, M. (1998). "Molecular genetics of the RNA polymerase II general transcriptional machinery." Microbiol Mol Biol Rev, 62(2), 465-503.

Heinrichs, V., Ryner, L. C., and Baker, B. S. (1998). "Regulation of sex-specific selection of fruitless 5' splice sites by transformer and transformer-2." Mol Cell Biol, 18(1), 450-8.

Hess, M. A., and Duncan, R. F. (1994). "RNA/protein interactions in the 5'-untranslated leader of HSP70 mRNA in Drosophila lysates. Lack of evidence for specific protein binding." J Biol Chem, 269(14), 10913-22.

Hill, A., Jugovic, P., York, I., Russ, G., Bennink, J., Yewdell, J., Ploegh, H., and Johnson, D. (1995). "Herpes simplex virus turns off the TAP to evade host immunity." Nature, 375(6530), 411-5.

Hill, A. V. (1998). "The immunogenetics of human infectious diseases [In Process Citation]." Annu Rev Immunol, 16, 593-617.

Hill, A. V., Allsopp, C. E., Kwiatkowski, D., Anstey, N. M., Greenwood, B. M., and McMichael, A. J. (1991a). "HLA class I typing by PCR: HLA-B27 and an African B27 subtype [see comments]." Lancet, 337(8742), 640-2.





78


Hill, A. V., Allsopp, C. E., Kwiatkowski, D., Anstey, N. M., Twumasi, P., Rowe, P. A., Bennett, S., Brewster, D., McMichael, A. J., and Greenwood, B. M. (1991b). "Common west African HLA antigens are associated with protection from severe malaria [see comments]." Nature, 352(6336), 595-600.

Hill, A. V., Elvin, J., Willis, A. C., Aidoo, M., Allsopp, C. E., Gotch, F. M., Gao, X.
M., Takiguchi, M., Greenwood, B. M., Townsend, A. R. (1992). "Molecular analysis of the association of HLA-B53 and resistance to severe malaria [see comments]." Nature, 360(6403), 434-9.

Hodges, D., and Bernstein, S. I. (1994). "Genetic and biochemical analysis of alternative RNA splicing." Adv Genet, 31, 207-81.

Honma, S., Tsukada, S., Honda, S., Nakamura, M., Takakuwa, K., Maruhashi, T., Kodama, S., Kanazawa, K., Takahashi, T., and Tanaka, K. (1994). "Biological-clinical significance of selective loss of HLA-class-I allelic product expression in squamous-cell carcinoma of the uterine cervix." Int J Cancer, 57(5), 650-5.

Hood, L., Steinmetz, M., and Malissen, B. (1983). "Genes of the major histocompatibility complex of the mouse." Annu Rev Immunol, 1, 529-568.

Horton, R. M., Hunt, H. D., Ho, S. N., Pullen, J. K., and Pease, L. R. (1989).
"Engineering hybrid genes without the use of restriction enzymes: gene splicing by overlap extension." Gene, 77(1), 61-8.

Howcroft, T. K., Strebel, K., Martin, M. A., and Singer, D. S. (1993). "Repression of MHC class I gene promoter activity by two-exon Tat of HIV." Science, 260(5112), 13202.

Hughes, E. A., Hammond, C., and Cresswell, P. (1997). "Misfolded major histocompatibility complex class I heavy chains are translocated into the cytoplasm and degraded by the proteasome." Proc Natl Acad Sci US A, 94(5), 1896-901.

lizuka, N., Najita, L., Franzusoff, A., and Sarnow, P. (1994). "Cap-dependent and capindependent translation by internal initiation of mRNAs in cell extracts prepared from Saccharomyces cerevisiae." Mol Cell Biol, 14(11), 7322-30.

Ito, K., Kashiwagi, K., Watanabe, S., Kameji, T., Hayashi, S., and Igarashi, K. (1990). "Influence of the 5'-untranslated region of ornithine decarboxylase mRNA and spermidine on ornithine decarboxylase synthesis." JBiol Chem, 265(22), 13036-41.

Jacobson, A. (1996). "Poly(A) Metabolism and Translation: The Closed-loop Model." Translational Control, J. W. B. Hershey, M. B. Mathews, and N. Sonenberg, eds., Cold Spring Harbor Laboratory Press, Cold Spring Harbor Laboratory, New York, 451-480.

Jacobson, A., and Peltz, S. W. (1996). "Interrelationships of the pathways of mRNA decay and translation in eukaryotic cells." Annu Rev Biochem, 65, 693-739.

Jin, W., Huang, E. S. C., Bi, W., and Cote, G. J. (1998). "Exon sequence is required for regulated RNA splicing of the human fibroblast growth factor receptor-1 alpha-exon [In Process Citation]." JBiol Chem, 273(26), 16170-6.

Kanaji, T., Okamura, T., Osaki, K., Kuroiwa, M., Shimoda, K., Hamasaki, N., and Niho, Y. (1998). "A common genetic polymorphism (46 C to T substitution) in the 5'-





79


untranslated region of the coagulation factor XII gene is associated with low translation efficiency and decrease in plasma factor XII level." Blood, 91(6), 2010-4.

Kao, K. J. (1987). "Plasma and platelet HLA in normal individuals: Quantitation by competitive enzyme-linked immunoassay." Blood, 70, 282.

Kao, K. J. (1989). "Stability of platelet and plasma HLA concentrations in healthy adults or random-donor platelet concentrates." Transfusion, 29(4), 328-31.

Kao, K. J., and Riley, W. J. (1993). "Genetic predetermination of quantitative expression of HLA antigens in platelets and mononuclear leukocytes." Hum Immunol, 38(4), 343-50.

Kao, K. J., Scornik, J. C., and McQueen, C. F. (1990). "Evaluation of individual specifities of class I HLA on platelets by a newly developed monoclomal antibody." Human Immunology, 27(4), 285-97.

Kao, K. J., Scornik, J. C., Riley, W. J., and McQueen, C. F. (1988). "Association between HLA phenotype and HLA concentration in plasma or platelets." Human Immunology, 21, 115.

Kaufman, D. S., Schoon, R. A., and Leibson, P. J. (1993). "MHC class I expression on tumor targets inhibits natural killer cell-mediated cytotoxicity without interfering with target recognition." J Immunol, 150(4), 1429-1436.

Kieran, M., Blank, V., Logeat, F., Vandekerckhove, J., Lottspeich, F., LeBail, O., Urban, M. B., Kourilsky, P., Baeuerle, P. A., and Isreal, A. (1990). "The DNA binding subunit of NF-kB is identical to factor KBF1 and homologous to the rel oncogene product." Cell, 62, 1019.

Koller, B. H., Marrak, P., and Kappler, J. W. (1990). "Normal development of mice deficient in B2M, MHC class I proteins and CD8+T cells." Science, 248(4960), 1227-30.

Kozak, M. (1984). "Point mutations close to the AUG initiator codon affect the efficiency of translation of rat preproinsulin in vivo." Nature, 308(5956), 241-6.

Kozak, M. (1986). "Point mutations define a sequence flanking the AUG initiator codon that modulates translation by eukaryotic ribosomes." Cell, 44(2), 283-92.

Kozak, M. (1987). "At least six nucleotides preceding the AUG initiator codon enhance translation in mammalian cells." J Mol Biol, 196(4), 947-50.

Kozak, M. (1991). "Effects of long 5' leader sequences on initiation by eukaryotic ribosomes in vitro." Gene Expr, 1(2), 117-25.

Krangel, M. S. (1987). "Two forms of HLA class I molecules in human plasma." Hum Immunol, 20(2), 155-65.

Laforet, M., Froelich, N., Parissiadis, A., Bausinger, H., Pfeiffer, B., Tongio, M.M. (1997). "An intronic mutation responsible for a low level of expression of an HLA-A*24 allele." Tissue Antigens, 50(4), 340-346.

Laitinen, O., Leirisalo, M., and Skylv, G. (1977). "Relation between HLA-B27 and clinical features in patients with yersinia arthritis." Arthritis Rheum, 20(5), 1121-4.





80

Lanier, L. L. (1998). "NK cell receptors." Annu Rev Immunol, 16, 359-93.

Lawson, T. G., Ray, B. K., Dodds, J. T., Grifo, J. A., Abramson, R. D., Merrick, W.
C., Betsch, D. F., Weith, H. L., and Thach, R. E. (1986). "Influence of 5' proximal secondary structure on the translational efficiency of eukaryotic mRNAs and on their interaction with initiation factors." JBiol Chem, 261(30), 13979-89.

Le Bouteiller, P. (1994). "HLA class I chromosomal region, genes, and products: facts and questions." Crit Rev Immunol, 14(2), 89-129.

Leeuwenberg, J. F., van-Damme, J., Jeunhomme, G. M., and W.A., B. (1987). "Interferon beta 1, an intermediate in the tumor necrosis factor alpha-induced increased MHC class I expression and an autocrine regulator of the constitutive MHC class I expression." J Exp Med, 166(4), 1180-5.

LeHoang, P., Ozdemir, N., Benhamou, A., Tabary, T., Edelson, C., Betuel, H., Semiglia, R., and Cohen, J. H. (1992). "HLA-A29.2 subtype associated with birdshot retinochoroidopathy." Am J Ophthalmol, 113(1), 33-5.

Li, H., Grenet, J., Valentine, M., Lahti, J. M., and Kidd, V. J. (1995). "Structure and expression of chicken protein kinase PITSLRE-encoding genes." Gene, 153(2), 237-42.

Lim, L. P., and Sharp, P. A. (1998). "Alternative splicing of the fibronectin EIIIB exon depends on specific TGCATG repeats [In Process Citation]." Mol Cell Biol, 18(7), 39006.

Lincoln, A. J., Monczak, Y., Williams, S. C., and Johnson, P. F. (1998). "Inhibition of CCAAT/enhancer-binding protein alpha and beta translation by upstream open reading frames." J Biol Chem, 273(16), 9552-60.

Litwin, V., Gumperz, J., Parham, P., Phillips, J. H., and Lanier, L. L. (1993). "Specificity of HLA class I antigen recognition by human NK clones: evidence for clonal heterogeneity, protection by self and non-self alleles, and influence of the target cell type." J Exp Med, 178(4), 1321-1336.

Liu, K., and Kao, K. J. (1997). "Measurement of relative quantities of different HLA-A and -B mRNAs in cells by reverse transcription-polymerase chain reaction and denaturing gradient gel electrophoresis." J Immunol Methods, 203(1), 67-75.

Ljunggren, H. G., Sturmhofel, K., Wolpert, E., Hammerling, G. J., and Karre, K. (1990). "Transfection of beta 2-microglobulin restores IFN-mediated protection from natural killer cell lysis in YAC-1 lymphoma variants." J Immunol, 145(1), 380-6.

Lopez-Casillas, F., and Kim, K. H. (1991). "The 5' untranslated regions of acetylcoenzyme A carboxylase mRNA provide specific translational control in vitro." Eur J Biochem, 201(1), 119-27.

Lopez-Larrea, C., Gonzalez-Roces, S., Pena, M., Dominguez, O., Coto, E., Alvarez, V., Moreno, M., Hernandez, O., Burgos-Vargas, R., and Gorodezky, C. (1995). "Characterization of B27 haplotypes by oligotyping and genomic sequencing in the Mexican Mestizo population with ankylosing spondylitis: juvenile and adult onset." Hum Immunol, 43(3), 174-80.





81


Magor, K. E., Taylor, E. J., Shen, S. Y., Martinez-Naves, E., Valiante, N. M., Wells, R.
S., Gumperz, J. E., Adams, E. J., Little, A. M., Williams, F., Middleton, D., Gao, X., McCluskey, J., Parham, P., and Lienert-Weidenbach, K. (1997). "Natural inactivation of a common HLA allele (A*2402) has occurred on at least three separate occasions." J Immunol, 158(11), 5242-5250.

Mantovani, V., Martinelli, G., Bragliani, M., Buzzi, M., Selva, P., Collina, E., Farabegoli, P., Rosti, G. A., Bandini, G., Tura, S., and et al. (1995). "Molecular analysis of HLA genes for the selection of unrelated bone marrow donor." Bone Marrow Transplant, 16(3), 329-35.

Mason, P. M., and Parham, P. (1998). "HLA class I region sequences, 1998." Tissue Antigens, 51(4 Pt 2), 417-66.

Masucci, M. G., Stam, N. J., Torsteinsdottir, S., eefjes, J. J., Klein, G., and Ploegh, H. L. (1989). "Allele-specific down-regulation of MHC class I antigens in Burkitt lymphoma lines." Cell Immunol, 120(2), 396-400.

Masucci, M. G., Torsteindottir, S., Colombani, J., Brautbar, C., Klein, E., and Klein, G. (1987). "Down-regulation of class I HLA antigens and of the Epstein-Barr virus-encoded latent membrane protein in Burkitt lymphoma lines." Proc Natl Acad Sci USA, 84(13), 4567-71.

McCutcheon, J. A., Gumperz, J., Smith, K. D., Lutz, C. T., and Parham, P. (1995). "Low HLA-C expression at cell surfaces correlates with increased turnover of heavy chain mRNA." J Exp Med, 181, 2085-2095.

Mizuki, N., Inoko, H., Ando, H., Nakamura, S., Kashiwase, K., Akaza, T., Fujino, Y., Masuda, K., Takiguchi, M., and Ohno, S. (1993). "Behcet's disease associated with one of the HLA-B51 subantigens, HLA-B* 5101." Am J Ophthalmol, 116(4), 406-9.

Mizuki, N., Ohno, S., Tanaka, H., Sugimura, K., Seki, T., Kera, J., Inaba, G., Tsuji, K., and Inoko, H. (1992). "Association of HLA-B51 and lack of association of class II alleles with Behcet's disease." Tissue Antigens, 40(1), 22-30.

Momburg, F., and Hammerling, G. J. (1998). "Generation and TAP-mediated transport of peptides for major histocompatibility complex class I molecules." Adv Immunol, 68, 191256.

Monaco, J. J. (1992). "A molecule model of MHC class I restricted antigen processing." Immunol Today, 13, 173.

Moore, M. J., and Sharp, P. A. (1993). "Evidence for two active sites in the spliceosome provided by stereochemistry of pre-mRNA splicing [see comments]." Nature, 365(6444), 364-8.

Mueller-Eckhardt, C., Mueller-Eckhardt, G., Willen-Ohff, H., Horz, A., Kuenzlen, E., O'Neill, G. J., and Schendel, D. J. (1985). "Immunogenicity of and immune response to the human platelet antigen Zwa is strongly associated with HLA-B8 and DR3." Tissue Antigens, 26(1), 71-6.

Muller, E. W., Seiser, C., and Garcia-Sanz, J. A. (1997). "Run-on assays." Immunology Methods Manual, I. Lefkovits, ed., Academic Press, San Diego, 439-443.





82


Myers, R. M., Fisher, S. G., Lerman, L. S., and Maniatis, T. (1985). "Nearly all single base substitutions in DNA fragments joined to a GC-clamp can be detected by denaturing gradient gel electrophoresis." Nucleic Acids Res, 13(9), 3131-45.

Nelson, K. K., and Green, M. R. (1990). "Mechanism for cryptic splice site activation during pre-mRNA splicing." Proc Nati Acad Sci US A, 87(16), 6253-7.

Norbury, C. J., and Fried, M. (1987). "Polyomavirus early region alternative poly(A) site: 3'-end heterogeneity and altered splicing pattern." J Virol, 61(12), 3754-8.

Oh, S., Fleischhauer, K., and Yang, S. Y. (1993). "Isoelectric focusing subtypes of HLAA can be defined by oligonucleotide typing." Tissue Antigens, 41, 135-142.

Ohlen, C., Bejarano, M. T., Gronberg, A., Torsteinsdottir, S., Franksson, L., Ljunggren, H. G., Klein, E., Klein, G., and Karre, K. (1989). "Studies of sublines selected for loss of HLA expression from an EBV-transformed lymphoblastoid cell line. Changes in sensitivity to cytotoxic T cells activated by allostimulation and natural killer cells activated by IFN or IL-2." J Immunol, 142(9), 3336-41.

Olave, I., Drapkin, R., and Reinberg, D. (1997). "Transcription and Transcriptional Control: An Overview." mRNA Metabolism & Post-Transcriptional Gene Regulation, J. B. Harford and D. R. Morris, eds., Wiley-Liss, Inc., New York.

Orita, M., Iwahana, H., Kanazawa, H., Hayashi, K., and Sekiya, T. (1989). "Detection of polymorphisms of human DNA by gel electrophoresis as single-strand conformation polymorphisms." Proc Natl Acad Sci USA, 86(8), 2766-70.

Pamer, E., and Cresswell, P. (1998). "Mechanisms of MHC class I--restricted antigen processing [In Process Citation]." Annu Rev Immunol, 16, 323-58.

Parham, P., Adams, E. J., and Arnett, K. L. (1995). "The origins of HLA-A,B,C polymorphism." Immunol Rev, 143, 141-80.

Parham, P., Lomen, C. E., Lawlor, D. A., Ways, J. P., Holmes, N., Coppin, H. L., Salter, R. D., Wan, A. M., and Ennis, P. D. (1988). "Nature of polymorphism in HLA-A,
-B and -C molecules." Proc Natl Acad Sci USA, 85(11), 4005-9.

Pelham, H. R., and Jackson, R. J. (1976). "An efficient mRNA-dependent translation system from reticulocyte lysates." Eur J Biochem, 67(1), 247-56.

Peltenburg, L. T., Dee, R., and Schrier, P. I. (1993). "Downregulation of HLA class I expression by c-myc in human melanoma is independent of enhancer A." Nucleic Acids Res, 21(5), 1179-85.

Peterson, M. L., Bryman, M. B., Peiter, M., and Cowan, C. (1994). "Exon size affects competition between splicing and cleavage- polyadenylation in the immunoglobulin mu gene." Mol Cell Biol, 14(1), 77-86.

Pinto, I., Na, J. G., Sherman, F., and Hampsey, M. (1992). "cis- and trans-acting suppressors of a translation initiation defect at the cyc I locus of Saccharomyces cerevisiae." Genetics, 132(1), 97-112.





83


Ploegh, H. L., Orr, H. T., and Strominger, J. L. (1981). "Major histocmpatibility antigens: the human (HLA-A,B,C) and murine (H-2K, H-2D) class I molecules." Cell, 24(2), 287-99.

Powis, S. J., Townsend, A. R., Deverson, E. V., Bastin, J., Butcher, G. W., and Howard, J. C. (1991). "Restoration of antigen presentation to the mutant cell line RMA-S by an MHC-linked transporter." Nature, 354(6354), 528-31.

Prasad, V. K., and Yang, S. Y. (1996). "Allele assignment for HLA-A, -B, and -C genes to the Tenth International Histocompatibility Workshop cell lines." Tissue Antigens, 47(6), 538-46.

Prendergast, J. A., Helgason, C. D., and Bleackley, R. C. (1992). "Quantitative polymerase chain reaction analysis of cytotoxic cell proteinase gene transcripts in T cells." J Biol Chem, 267(8), 5090-5.

Rao, S. M., and Howells, R. D. (1993). "cis-acting elements in the 5'-untranslated region of rat testis proenkephalin mRNA regulate translation of the precursor protein." J Biol Chem, 268(29), 22164-9.

Rivera, R., and Scornik, J. C. (1986). "HLA antigens on red cells. Implications for achieving low HLA antigen content in blood transfusions." Transfusion, 26(4), 375-81.

Robey, E., and Fowlkes, B. J. (1994). "Selective events in T cell development." Annu Rev Immunol, 12, 675-705.

Rood, J. J. v., Leeuwen, A. v., and Santen, M. C. v. (1970). "Anti HL-A2 inhibitor in normal human serum." Nature, 226(243), 366-7.

Ross, J. (1995). "mRNA stability in mammalian cells." Microbiol Rev, 59(3), 423-50.

Ross, J. (1996). "Control of messenger RNA stability in higher eukaryotes." Trends Genet, 12(5), 171-5.

Ruiz-Cabello, F., Klein, E., and Garrido, F. (1991). "MHC antigens on human tumors." Immunol Lett, 29(3), 181-9.

Sachs, A. B. (1993). "Messenger RNA degradation in eukaryotes." Cell, 74(3), 413-21.

Sedman, S. A., Gelembiuk, G. W., and Mertz, J. E. (1990). "Translation initiation at a downstream AUG occurs with increased efficiency when the upstream AUG is located very close to the 5' cap." J Virol, 64(1), 453-7.

Shieh, D. C., Gammon, M. C., Zweerink, H. J., and Kao, K. (1996). "Functional significance of varied quantitative and qualitative expression of HLA-A2.1 antigens in determining the susceptibility of cells to cytotoxic T lymphocytes." Hum Immunol, 46(1), 18-26.

Shieh, D. C., and Kao, K. J. (1995). "Proportional amplification of individual HLA-A and
-B antigens during upregulated expression of total class I HLA molecules." Hum Immunol, 42(2), 174-80.





84


Shields, D., and Blobel, G. (1978). "Efficient cleavage and segregation of nascent presecretory proteins in a reticulocyte lysate supplemented with microsomal membranes." J Biol Chem, 253(11), 3753-6.

Shimizu, Y., and DeMars, R. (1989). "Production of human cells expressing individual transferred HLA-A,-B,-C genes using an HLA-A,-B,-C null human cell line." J Immunol, 142(9), 3320-8.

Solnick, D. (1985). "Alternative splicing caused by RNA secondary structure." Cell, 43(3 Pt 2), 667-76.

Solnick, D., and Lee, S. I. (1987). "Amount of RNA secondary structure required to induce an alternative splice." Mol Cell Biol, 7(9), 3194-8.

Speiser, D. E., Tiercy, J. M., Rufer, N., Grundschober, C., Gratwohl, A., Chapuis, B., Helg, C., Loliger, C. C., Siren, M. K., Roosnek, E., and Jeannet, M. (1996). "High resolution FHLA matching associated with decreased mortality after unrelated bone marrow transplantation." Blood, 87(10), 4455-62.

Spicer, A. P., Seldin, M. F., and Gendler, S. J. (1995). Molecular cloning and chromosomal localization of the mouse decay-accelerating factor genes. Duplicated genes encode glycosylphosphatidylinositol-anchored and transmembrane forms." J Immunol, 155(6), 3079-91.

Srivastava, R., Duceman, B. W., Biro, P. A., Sood, A. K., and Weissman, S. M. (1985). "Molecular organization of the class I genes of human major histocompatibility complex." Immunol Rev, 84, 93-121.

Sterner, D. A., and Berget, S. M. (1993). "In vivo recognition of a vertebrate mini-exon as an exon-intron-exon unit." Mol Cell Biol, 13(5), 2677-87.

Strachan, T., Sodoyer, R., Damotte, M., and Jordan, B. R. (1984). "Complete nucleotide sequence of a functional class I HLA gene, HLA-A3: implications for the evolution of HLA genes." EMBO J.

Tanaka, K., Tanahashi, N., Tsurumi, C., Yokota, K. Y., and Shimbara, N. (1997). "Proteasomes and antigen processing." Adv Immunol, 64, 1-38.

Tarleton, R. L., Koller, B. H., Latour, A., and Postan, M. (1992). "Susceptibility of beta 2-microglobulin-deficient mice to Trypanosoma cruzi infection [see comments]." Nature, 356(6367), 338-40.

Terasaki, P. I., Brnoco, D., Park, M. S., Ozturk, G., and Iwaki, Y. (1978). "Microdroplet testing for HLA-A, -B, -C, and -D antigens." American Journal of Clinical Pathology, 69, 103.

Thach, R. E. (1992). "Cap recap: the involvement of eIF-4F in regulating gene expression." Cell, 68(2), 177-180.

Tharun, S., and Parker, R. (1997). "Mechanisms of mRNA Turnover in Eukaryotic Cells." mRNA Metabolism & Post-Transcriptional Gene Regulation, J. B. Harford and D. R. Morris, eds., Wiley-Liss, Inc., New York.





85


Tiercy, J. M., Djavad, N., Rufer, N., Speiser, D. E., Jeannet, M., and Roosnek, E. (1994). "Oligotyping of HLA-A2, -A3, and -B44 subtypes. Detection of subtype incompatibilities between patients and their serologically matched unrelated bone marrow donors." Hum Immunol, 41(3), 207-15.

Toivanen, P., Toivanen, A., and Brines, R. (1994). "When is an autoimmune disease not an autoimmune disease?" Immunol Today, 15(12), 556-9.

Versteeg, R., Kruse-Wolters, K. M., Plomp, A. C., van-Leeuwen, A., Stam, N. J., Ploegh, H. L., Ruiter, D. J., and Schrier, P. I. (1989a). "Suppression of class I human histocompatibility leukocyte antigen by c-myc is locus specific." J Exp Med, 170(3), 62135.

Versteeg, R., Noordermeer, I. A., Kruse-Wolters, M., Ruiter, D. J., and Schrier, P. I. (1988). "c-myc down-regulates class I HLA expression in human melanomas." Embo J, 7(4), 1023-9.

Versteeg, R., Peltenburg, L. T., Plomp, A. C., and Schrier, P. I. (1989b). "High expression of the c-myc oncogene renders melanoma cells prone to lysis by natural killer cells." J Immunol, 143(12), 4331-7.

Walev, I., Kunkel, J., Schwaeble, W., Weise, K., and Falke, D. (1992). "Relationship between HLA class I surface expression and different cytopathic effects produced ater herpes simplexvirus infetion in vitro." Arch Virol, 126, 303-11.

Waring, J. F., Radford, J. E., Burns, L. J., and Ginder, G. D. (1995). "The human leukocyte antigen A2 interferon-stimulated response element concensus sequence binds a nuclear factor required fpr constitutive expression." J Biol Chem, 270(20), 12276-12285.

Watakabe, A., Inoue, K., Sakamoto, H., and Shimura, Y. (1989). "A secondary structure at the 3' splice site affects the in vitro splicing reaction of mouse immunoglobulin mu chain pre-mRNAs." Nucleic Acids Res, 17(20), 8159-69.

Watkins, D. I. (1995). "The evolution of major histocompatibility class I genes in primates." Crit Rev Immunol, 15(1), 1-29.

Ways, J. P., Coppin, H. L., and Parham, P. (1985). "The complete promary structure of HLA-Bw58." J Biol Chem, 260, 11924-11933.

Wiesner, R. J., and Zak, R. (1991). "Quantitative approaches for studying gene expression." Am J Physiol, 260(4 Pt 1), L179-88.

Yang, S. Y. (1989). "Nomenclature for HLA-A and HLA-B alleles detected by one dimensional isoelectric focusing gel electrophoresis." Immunobiology of HLA, D. B, ed., Springer-verlag, New York, 54.

Yang, S. Y., Milford, E., Hammerling, U., and Dupont, B. (1989). "Description of the reference panel of B-lymphoblastoid cell lines for factors of the HLA system: the B-cell line panel designed for the tenth international histocompatibility workshop." Immunology of HLA, B. Dupont, ed., Springer-Verlag, New York, 11.

Yano, O., Kanellopoulos, J., Kieran, M., LeBail, O., Isreal, A., and Kourilsky, P. (1987). "Purification of KBF1, a common factor binding to both H-2 and beta-2 microglobulin enhancers." EMBO J, 6, 3317.





86


Yanofsky, C. (1992). "Transcriptional Regulation: Elegance in Design and Discovery." Transcriptional Regulation, S. L. McKnight and K. R. Yamamoto, eds., Cold Spring Harbor Laboratory Press, New York, 1-24.

Yoshida, M., Kimura, A., Katsuragi, K., Numano, F., and Sasazuki, T. (1993). "DNA typing of HLA-B gene in Takayasu's arteritis." Tissue Antigens, 42(2), 87-90.

Yun, D. F., Laz, T. M., Clements, J. M., and Sherman, F. (1996). "mRNA sequences influencing translation and the selection of AUG initiator codons in the yeast Saccharomyces cerevisiae." Mol Microbiol, 19(6), 1225-39.

Zachow, K. R., and Orr, H. T. (1989). "Regulation of HLA class I transcription in T cells." J Immunol, 143(10), 3385-9.

Zijstra, M., Bix, M., and Simistra, N. E. (1990). "B2 microglobulin deficient mice lack CD4-8+ cytolytic T cells." Nature, 344(6268), 742-6.

Zinkernagel, R. M., and Doherty, P. C. (1979). "MHC restricted cytotoxic T cells. Studies on the biological role of polymorphic major transplantation antigens determine Tcell restriction specificity function and responsiveness." Adv. Immunol., 27, 51-177.














BIOGRAPHICAL SKETCH



Kui Liu was born and raised in Liaoning, China, in 1965, the third child of

Xiuzhen Yu and Zhanyu Liu. He attended Shanghai Medical University in 1982, and graduated in 1987 with a Bachelor of Pharmacology. Then he entered the graduate school in Chinese Academy of Medical Sciences, and graduated with a Master of Science in Pharmacology in 1990. In the same year, he married Liying Chen. In August 1993, several months after they came to the United States, Kui entered the Ph.D. program in Department of Pathology, Immunology and Laboratory Medicine, University of Florida. In August 1996, their son, Alan Zonglin Liu, was born. After receiving his Ph.D. degree, Kul Liu will pursue a career in academic research.




























87









I certify that I have read this study and that in my opinion it conforms to
acceptable standards of scholarly presentation and is fully adequate, in scope and quality, as a dissertation for the degree of Doctor of Philosophy.



Kuo-Jang' Ka o, Chair
Professor of Pathology, Immunology and Laboratory Medicine


I certify that I have read this study and that in my opinion it conforms to
acceptable standards of scholarly presentation and is fully adequate, in scope and quality, as a dissertation for the degree of Doctor of Philosophy.




Associate Professor of Pathology, Immunology and Laboratory Medicine


I cer-tify that I have read this study and that in my opinion it conforms to
acceptable standards of scholarly presentation and is fully adequate, in scope and quality, as a dissertation for the degree of Doctor of Philosophy.



Juan-C,~ri
Professor of Pathology, Immunology and Laboratory Medicine


I certify that I have read this study and that in my opinion it conforms to
acceptable standards of scholarly presentation and is fully adequate, in scope and quality, as a dissertation for the degree of Doctor of Philosophy.



Maurice S. Swanson
Associate Professor of Molecular Genetics and Microbiology


I certify that I have read this study and that in my opinion it conforms to
acceptable standards of scholarly presentation and is fully adequate, in scope and quality, as a dissertation for the degree of Doctor of Philosophy.



Edward K. Wakeland
Professor of Pathology, Immunology and Laboratory Medicine









This dissertation was submitted to the Graduate Faculty of the College of Medicine and to the Graduate School and was accepted as partial fulfillment of the requirements for the degree of Doctor of Philosophy. December, 1998



Dean, rdae Soo




Full Text
MECHANISMS FOR GENETICALLY PREDETERMINED DIFFERENTIAL
QUANTITATIVE EXPRESSION OF HLA-A AND -B ANTIGENS
By
Kui Liu
A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLQRIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY
UNIVERSITY OF FLORIDA
1998

ACKNOWLEDGMENTS
I would like to express my appreciation to Dr. Kuo-Jang Kao, Chairman of my
supervisory committee, for his guidance, support, understanding, encouragement and
friendship. I would like to thank the members of my supervisory committee, Drs. Wayne
McCormack, Juan Scornik, Maurice Swanson and Edward Wakeland for their very
helpful discussions and suggestions. I would like to thank Ms. Sandra Donahue for her
technical assistance. I would also like to thank Dr. Michael A. Frohman for his help in
the RACE experiments.
I greatly appreciate the understanding from my parents, the love from my wife
and my son, Liying and Alan.
11

TABLE OF CONTENTS
page
ACKNOWLEDGMENTS ii
LIST OF TABLES v
LIST OF FIGURES vi
ABSTRACT viii
CHAPTERS
1 INTRODUCTION 1
Biochemistry of Class I HLA Molecules 1
Organization Of Class I HLA Genes 1
Polymorphism and Phenotypes of Class I HLA Antigens 2
Function of Class I HLA Antigens 4
Association of Class I HLA Antigens with Diseases 6
Controlling Steps in Gene Expression 7
Regulation of Quantitative Class I HLA Gene Expression 9
Functional Importance of Quantitative Expression of HLA Antigens 11
Quantitative Differential Expression of HLA-A and -B antigens 12
2 MEASUREMENT OF RELATIVE QUANTITIES OF DIFFERENT
HLA-A AND -B MRNAS IN CELLS BY REVERSE TRANSCRIPTION
-POLYMERASE CHAIN REACTION AND DENATURING
GRADIENT GEL ELECTROPHORESIS 15
Introduction 15
Materials and Methods 16
Results 21
Discussion 27
3 MECHANISMS FOR DIFFERENTIAL QUANTITATIVE
EXPRESSION OF HLA-A AND -B ANTIGENS IN
LYMPHOBLASTOID CELL LINES 30
Introduction 30
Materials and Methods 32
Results 38
Discussion 47
iii

4 IN VITRO TRANSLATION STUDY OF HLA-A24 AND -B60 MRNAS 53
Introduction 53
Materials and Methods 53
Results 58
Discussion 64
5 SUMMARY AND FUTURE DIRECTION 68
REFERENCES 73
BIOGRAPHICAL SKETCH 87
iv

LIST OF TABLES
Table page
1. Relative quantities of HLA-A and -B mRNAs in lymphoblastoid cell lines
measured by RT-PCR/DGGE and SI nuclease protection assay 26
2. Relative quantities of HLA proteins and mRNAs in ten different lymphoblastoid
cell lines (LCLs) 40
3. 5’ end sequences of HLA-A24 and -B60 mRNAs 59
4. Contribution of different controlling steps to the regulation of differential
quantitative expression of different HLA-A and -B antigens in the studied
LCLs 72
v

LIST OF FIGURES
Figure page
1. General organization for class I HLA genes 2
2. Optimal cycles for quantitative RT-PCR 22
3. HLA RT-PCR products measured as a function of different amounts of
total cytoplasmic RNA 23
4. Identification of RT-PCR products of different HLA-A and -B mRNAs
by DGGE 24
5. DGGE separation of RT-PCR products of HLA-A and -B mRNAs
isolated from LCLs carrying heterozygous HLA-A and -B antigens 24
6. Validation of using RT-PCR and DGGE for measuring relative
quantities of different HLA mRNAs 25
7. Quantitation of HLA-A24 and -B60 mRNAs in 9075 lymphoblastoid
cell line using SI nuclease protection assay 26
8. Turnover of 3;iS-methionine-labeled HLA-A and -B proteins in
lymphoblastoid cell lines (LCLs) 39
9. IEF-immunoblot of HLA-A and -B antigens from nine different
lymphoblastoid cell lines 41
10. The effect of DRB treatment on HLA mRNA levels 43
11. Turnover of HLA-A and -B mRNAs in LCLs 44
12. PCR-based nuclear run-on in four LCLs 45
13. Presence of abundant unspliced HLA transcripts in nuclei 45
14. Experimental design for study of HLA mRNA production 46
15. Measurements of the relative quantities of nuclear and cytoplasmic
HLA-A and -B transcripts by using quantitative RT-PCR/DGGE and
phosphor imaging in seven lymphoblastoid cell lines 49
16. The 3’-UTR sequences for HLA-A24 and -B60 mRNAs 60
vi

17. Cloning of HLA-A24 and -B60 heavy chain cDNAs by PCR 62
18. In vitro translation study of HLA-A24 and HLA-B60 mRNAs 63
vii

Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy
MECHANISMS FOR GENETICALLY PREDETERMINED DIFFERENTIAL
QUANTITATIVE EXPRESSION OF HLA-A AND -B ANTIGENS
By
Kui Liu
December 1998
Chairman: Dr. Kuo-Jang Kao
Major Department: Department of Pathology, Immunology and Laboratory Medicine
Earlier studies have shown that different specific HLA-A and -B antigens are
differentially expressed in cells. Their relative quantities are genetically predetermined
and inherited according to Mendelian law. To investigate the mechanisms responsible
for the quantitative differential expression of HLA antigens, a simple and reliable method
using RT-PCR and DGGE was developed to measure the relative quantities of HLA-A
and -B mRNAs in cells. When the relative quantities of different HLA-A and -B proteins
expressed in ten different HLA-phenotyped lymphoblastoid cell lines (LCLs) were
correlated with the relative amounts of their respective mRNAs in cytoplasm, it was
shown that HLA protein levels are proportional to their mRNA levels except for the cell
lines that were positive for HLA-A24 and -B7. This finding suggests that different
protein translational efficiencies could play some role in affecting differential expression
of HLA antigens. An in vitro translation study using HLA-A24 and -B60 mRNAs
supports the hypothesis that HLA-A24 mRNAs are more efficient in synthesizing HLA
heavy chains. To determine the stability of different HLA-A and -B antigens expressed
in HLA-phenotyped LCLs, it was found that different HLA-A and -B antigens have

similar turnover rates. Measurement of the relative quantities of ffLA-A and -B mRNAs
in seven LCLs before and after treatment with DRB, an inhibitor of RNA polymerase II,
showed that different specific HLA-A and -B mRNAs in five LCLs have the same
turnover rates and that HLA-A and -B mRNAs are not proportionally degraded in the
other two LCLs. Measurement of the relative quantities of different HLA-A and -B pre-
mRNAs in nuclei showed that they are not proportional to those of mature cytoplasmic
mRNAs in five of seven HLA-phenotyped LCLs. All these findings indicate that the
quantitative differential expression of HLA-A and -B antigens is regulated by a
combination of multiple steps. These steps include gene transcription, pre-mRNA
splicing, mRNA degradation and/or mRNA translation, depending on specific HLA
alleles in different individuals. Despite the complexity of regulating the differential
quantitative expression of HLA antigens, all the aforementioned mechanisms are encoded
in the sequences of HLA gene. These findings support the earlier observations that
relative quantities of different HLA-A and -B antigens are genetically predetermined, and
directly linked to HLA-A and -B genes and inherited according to Mendelian laws.
IX

CHAPTER 1
INTRODUCTION
Biochemistry of Class I HLA Molecules
Class I HLA molecules are polymorphic membrane glycoproteins and consist of
two noncovalently associated polypeptide chains — a heavy chain of 44 kD encoded by the
classical class I HLA genes (HLA-A, -B, and -C) and an invariant light chain of 12 kD
encoded by a non-MHC gene, p2 microglobulin (P2m) (Srivastava et al., 1985). The
HLA heavy chain is a type II transmembrane protein comprising a cytoplasmic carboxyl
terminal domain, a transmembrane segment, and three extracellular domains known as
al, a2 and a3. The al and the a2 domains contain most polymorphic amino acid
sequences and form a binding groove for antigenic peptides. This peptide-binding groove
consists of an eight-stranded antiparallel p-sheet flanked by two parallel strands of a-
helices (Bjorkman and Parham, 1990). The binding groove can accommodate antigenic
peptides of eight to ten amino acids in a flexible, extended conformation (Falk et al., 1991).
However, an earlier study also showed that peptides consisting of twelve amino acids can
bind to class I HLA molecules (Bednarek et al., 1991).
Organization Of Class I HLA Genes
Genes for class I HLA heavy chains are located on the short arm of chromosome
6, and the gene for p2m is on chromosome 15. There are three loci for classical class I
HLA genes. All three functional HLA class I genes share a very similar genomic
1

2
organization and are responsible for encoding HLA-A, -B, and -C heavy chains. Each
class IHLA gene consists of eight exons, and the exon-intron organization reflects the
domain structure of the molecule (Figure 1). The exon 1 encodes the 5’-untranslated
region (5’-UTR) and the signal sequence, and the exons 2, 3 and 4 encode the al, a2, and
a3 (immunoglobulin-like extracellular region) domains of HLA heavy chains, respectively.
The transmembrane region (TM) is encoded by exon 5, and the cytoplasmic tail (CY1 and
CY2) and the 3’-untranslated region (3’-UTR) are encoded by exons 6-8 (Srivastava et al.,
1985; Ways et al., 1985). There are only minor differences among HLA-A, -B and -C
genes at these three different loci. HLA-B genes, unlike HLA-A and -C genes, do not
have coding sequences in exon 8. HLA-C genes contain extra three nucleotides in exon 5
(Davidson et al., 1985; Strachan et al., 1984). These three nucleotides are not present in
HLA-A and -B genes. In addition to these three functional classical HLA class I genes,
there are also three nonclassical HLA class I genes, HLA-E, -F and -G, and several
pseudogenes (Le Bouteiller, 1994).
E23 exon â–¡ intron
HLA gene
CY- cytoplasmic domain
Figure 1 General organization for class I HLA genes
Polymorphism and Phenotypes of Class I HLA Antigens
One of the important features of class I HLA gene products is a high degree of
polymorphism. At present, there are at least 86 alleles for HLA-A locus, 186 alleles for

3
HLA-B locus, and 46 alleles for HLA-C locus (Bodmer et al., 1997; Mason and Parham,
1998). The structural basis of allelic polymorphism has been well characterized by direct
comparison of protein and nucleotide sequences (Parham et al., 1995; Parham et al.,
1988). The observed protein polymorphism is due to amino acid substitutions. Most
polymorphic amino acid residues are confined to the peptide-binding region in a 1 and a2
domains and contribute to varying peptide-binding specificities of class I HLA molecules
(Parham et al., 1988). The HLA polymorphism is therefore responsible for presenting
large numbers of diverse antigenic peptides restricted to specific HLA molecules (Bjorkman
and Parham, 1990). Despite significant degrees of variations in nucleotide and amino acid
sequences, HLA alleles at the same locus are evolutionally more closely related to one
another than HLA alleles at other loci.
Traditionally, phenotypes of class I HLA antigens are determined serologically.
This approach is based on complement-mediated lymphocytotoxicity and was originally
developed by Terasaki and McClelland (Terasaki et al., 1978). In this assay, peripheral
blood lymphocytes are incubated with an antiserum containing specific anti-HLA
antibodies. The binding of antibodies to lymphocytes is then detected by adding
heterologous complement. Subsequent cell death induced by the activated complement is
scored after staining with eosin-Y or other vital dyes. Although the
microlymphocytotoxicity assay for typing HLA antigens is sensitive and convenient, this
assay suffers from cross-reactivity and limited specificity of typing sera.
Another technique that has been used to identify the phenotypes of class I HLA
antigens is isoelectric focusing (IEF) gel electrophoresis (Yang, 1989). In this method, the
HLA class I antigens are digested with neuraminidase and separated on IEF gels based on
their isoelectric points. The separated HLA heavy chains are then detected by class I HLA
specific antibody. This technique is able to resolve the subtypes of various HLA antigens
that can not be differentiated by the lymphocytotoxicity assay. However, some HLA

4
subtypes remain unresolvable by IEF gel electrophoresis. The IEF approach is also
technically cumbersome.
More recently, molecular biology techniques have been applied to DNA sequence-
based HLA typing (Allen et ah, 1994; Bidwell, 1994; Gao et al., 1994; Oh et ah, 1993;
Tiercy et ah, 1994). Three commonly used approaches are: (l)locus-specific PCR
followed by hybridization with sequence-specific oligonucleotides; (2) one-step PCR with
sequence-specific primers; (3) locus-specific PCR followed by DNA sequencing (Bidwell,
1994). These typing methods provide the most accurate results. However, these new
techniques are laborious.
Function of Class 1 HLA Antigens
Functionally, class I HLA antigens play important roles in the host immune system.
They are expressed on almost all cells including anucleated red blood cells and platelets (de
Villartay et al., 1985; Everett et al., 1987; Mueller-Eckhardt et al., 1985; Rivera and
Scornik, 1986). After being synthesized, HLA heavy chain and [32m form heterodimers in
the endoplasmic reticulum (ER), where they are loaded with peptides generated from
cytosol by the proteasome. The proteasome is a multisubunit ATP-dependent protease that
plays the major role in normal turnover of cytosolic proteins (Pamer and Cresswell, 1998;
Tanaka et al., 1997). The peptides generated by the proteasome are translocated into the ER
by the transporter associated with antigen processing (TAP), which is a heterodimeric
protein that belongs to the ATP-binding cassette transporter family (Momburg and
Hammerling, 1998). Before binding with the antigenic peptide, a transient complex
containing a class I heavy chain and a [32m is assembled onto the TAP molecule by
successive interactions with the ER chaperones calnexin, calreticulin and tapasin. The
current model suggests that, before binding antigenic peptides, newly synthesized HLA
heavy chains first bind calnexin. After [32m binds, calnexin is exchanged for calreticulin.

5
Then tapsin mediates the association of the HLA class I heavy chain-P2m-calreticulin
complex with TAP which provides the peptides for the assembly of class I HLA antigen.
After binding of the antigenic peptide, the PILA molecules are transported to the cell surface
(Pamer and Cresswell, 1998). The misfolded class I heavy chains without (32m-
association or peptide-binding are translocated to the cytoplasm and degraded by the
proteasome (Hughes et al., 1997).
The antigen peptides presented by class I HLA molecules include peptides of host
and non-host cellular proteins. The latter include the proteins derived from invading virus,
bacterium, or protozoan parasite. The presentation of pathogen-encoded or host tumor
antigenic peptides by class I HLA molecules on cells plays a crucial role in immune
elimination of tumor cells or pathogen-infected cells by CD8+ T cells (Bjorkman et al.,
1987; Monaco, 1992). The presentation of peptides by class I MHC molecules in the
thymus also plays a crucial role in the selection and maturation of CD8+ T cells. During
this process, the CD8+ T cells bearing the T cell receptors with high affinity to self antigens
are negatively selected, whereas those with lower affinity to self antigens in the context of
self MHC molecules are positively selected to mature and leave the thymus to populate
peripheral lymphoid tissues (Robey and Fowlkes, 1994).
In addition, the expression of class I HLA molecules on cells has been implicated in
protecting host cells from destruction by autologous natural killer cells (Ciccone et al.,
1994; Kaufman et al., 1993; Litwin et al., 1993). The existence of inhibitory NK cell
receptors for polymorphic classical HLA class I molecules prevents the attack of normal
host cells by NK cells and could be responsible for elimination of the cells lacking
sufficient expression of HLA class I molecules (Lanier, 1998). It has also been shown that
peptides derived from signal sequences of HLA class I heavy chains can be presented to
NK cells by a non-classical HLA class I molecule, HLA-E (Braud et al., 1998).
Due to the highly polymorphic nature of class I HLA antigens, they are responsible
for the immune rejection of allografts in transplant recipients (Hood et al., 1983).

6
Although HLA matching between recipient and donor does not in itself completely prevent
rejection of allografts, it significantly improves the clinical outcome for allogeneic organ
transplantation. Despite the proven success of matching HLA antigens for transplantation,
unrelated individuals who are serologically typed as HLA-identical often do not share
identical HLA antigens due to limited availability to differentiate various HLA subtypes by
serological assays (Mantovani et al., 1995; Speiser et al., 1996). The use of molecular
biology techniques for HLA typing at the level of DNA sequence will further prevent
mismatches and may improve the results for allograft transplantation.
Association of Class 1 HLA Antigens with Diseases
Owing to their role in antigen presentation, class I HLA molecules are closely
involved in the pathogenesis of various clinical conditions, which include infectious,
autoimmune and neoplastic diseases. The association of certain HLA alleles with diseases
has also been documented (Hall and Bowness, 1996; Hill, 1998). One of the strongest
associations is the association of HLA-B27 with ankylosing spondylitis. It has been
shown that HLA-B2701, 02, 04 and 05 are associated with the development of ankylosing
spondylitis (Breur-Vriesendorp et al., 1987; D'Amato et ah, 1995; Hill et ah, 1991a;
Lopez-Larrea et ah, 1995). Associations of HLA-B51 with Behcet's disease, HLA-B52
and HLA-B3902 with Takayasu's arteritis, HLA-A2902 with birdshot retinitis, and HLA-
B27 with reactive arthritis have also been reported (Brewerton et ah, 1974; Laitinen et ah,
1977; LeHoang et ah, 1992; Mizuki et ah, 1993; Mizuki et ah, 1992; Toivanen et ah,
1994; Yoshida et ah, 1993). The underlying pathogenic mechanisms for these associations
are still unclear. It is likely that their roles may be associated with peptide binding
specificity by different HLA molecules and/or by thymic selection of specific T cell
repertoire responsible for the diseases (Hall and Bowness, 1996).

7
For infectious diseases, HLA-B53 has been shown to be associated with the
protection from severe malaria (Hill et ah, 1991b). It is likely that HLA-B53 molecules
may confer the resistance by presenting a plasmodium-derived peptide to CTL for
mounting an effective immune response (Hill et ah, 1991a; Hill et ah, 1992).
Undoubtedly, further understanding of the functional importance of HLA antigens in
determining host defense and disease susceptibility will be made in the near future when
more information becomes available.
Controlling Steps in Gene Expression
The mechanism for gene expression has been extensively studied. Gene expression
can be controlled at multiple steps, including gene transcription, pre-mRNA processing,
mRNA trafficking, mRNA degradation, mRNA translation, and protein turnover. It is
generally believed that gene transcription is the most critical step in controlling gene
expression. Gene transcription can be regulated by many cis-acting elements and trans¬
acting factors (Olave et ah, 1997; Yanofsky, 1992). The TATA box in the promoters of
various genes is crucial because it serves as a common recognition site for transcription
factor TFIII) and for the assembly of the RNA polymerase II initiation complex. There are
also enhancers and silencers that bind various trans-regulating factors. To initiate
transcription of a gene, at least six different transcription factors together with RNA
polymerase II are required to form a transcriptionally competent preinitiation complex
(Olave et ah, 1997; Yanofsky, 1992). Regulation of transcription therefore can be
accomplished by controlling assembly of the preinitiation complex or the catalytic efficiency
of RNA polymerase II during initiation, elongation, or termination (Hampsey, 1998). The
detailed mechanisms for transcription and its regulation remain to be elucidated.
Processing of pre-mRNA by capping, splicing, editing and polyadenylation is also
important in regulating availability of mature mRNA for protein synthesis. For pre-mRNA

8
splicing, the assembly of a spiiceosome, consisting of a pre-mRNA, protein factors and
small nuclear ribonucleoproteins (snRNPs), is required (Moore and Sharp, 1993). Thus,
the splicing of pre-mRNA is regulated through assembly of the spiiceosome. In some
cases, pre-mRNAs can be spliced in alternative ways leading to the production of different
isoforms of proteins (Hodges and Bernstein, 1994). It appears that alternative splicing in
many systems is controlled through regulation of the amount, the distribution, and/or the
activity of constitutive splicing factors in cells (Bernstein and Hodges, 1997). It has also
been demonstrated that alternative splicing can be affected by differences in the strength of
competing 3' and 51 splice sites, large distances between polypyrimidine tracts and 3'
splice sites, size of the involved exon, steric constraints on splicing factor binding, and
alternative polyadenylation sites (Balvay et al., 1993; Brady and Wold, 1987; Carstens et
al., 1998; Elrick et al., 1998; Eperon et al., 1988; Furdon and Kole, 1988; Heinrichs et al.,
1998; Jin et al., 1998; Lim and Sharp, 1998; Nelson and Green, 1990; Norbury and Fried,
1987; Peterson et al., 1994; Solnick, 1985; Solnick and Lee, 1987; Sterner and Berget,
1993; Watakabe et al., 1989).
Gene expression is also regulated by degradation and stability of mRNA. After
export of mRNA from the nucleus to the cytoplasm, the stability and turnover of mRNA
can contribute significantly to the control of gene expression through regulation of the
available mRNA for protein synthesis (Ross, 1995). Different mRNAs can have different
intrinsic rates of turnover (Cabrera et al., 1984; Carneiro and Schibler, 1984). Many
examples for regulation of gene expression by modulation of mRNA decay have been
documented (Caponigro and Parker, 1996; Ross, 1995). Stability of mRNA can regulated
by cis-acting elements within the mRNA molecule. These cis-acting elements serve as
recognition sites for various regulatory proteins including poly(A)-binding protein (PABP),
AU-rich element (AURE)-binding proteins (AUBPs) and other proteins that bind to the 3’-
UTRs or coding regions of mRNAs (Beelman and Parker, 1995; Ross, 1995; Ross, 1996;
Sachs, 1993). The aforementioned cis-elements can positively or negatively modulate

9
mRNA stability, and are present throughout the mRNA molecule in 5’-UTR, the coding
region and 3’-UTR (Tharun and Parker, 1997).
Translation of mRNA is another step in regulating gene expression, and it can be
regulated by modulating the rate of translational initiation and/or sequestering mRNAs in
translationally inaccessible messenger ribonucleoprotein (mRNP) (Curtis et ah, 1995).
The concentration of active initiation factors and the primary sequence of the 5’-UTR have
been shown to influence the rate of mRNA translation (Devarajan et al., 1992; Hess and
Duncan, 1994; Kanaji et ah, 1998; Lincoln et ah, 1998; Thach, 1992). The sequence
flanking the translation initiator AUG, 5' cap, the secondary structure in the 5'-UTR, the
presence of alternative translation initiation sites and the length of 5’-UTR have been
shown to determine the intrinsic translational efficiency of mRNAs (Bhasker et ah, 1993;
Falcone and Andrews, 1991; Gallie, 1991; Gallie and Tanguay, 1994; Gambacurta et ah,
1993; Gray and Hentze, 1994; Iizuka et ah, 1994; Ito et ah, 1990; Lawson et ah, 1986;
Lopez-Casillas and Kim, 1991; Pinto et ah, 1992; Rao and Howells, 1993; Sedman et ah,
1990; Yun et ah, 1996). The poly(A) tail at the 3' ends of eukaryotic mRNAs also can
serve as an enhancer for mRNA translation (Jacobson, 1996).
Therefore, it is of interest to learn how these different controlling steps are involved
in regulating differential quantitative expression of various specific HLA-A and -B antigens
in cells.
Regulation of Quantitative Class IHLA Gene Expression
The expression of class I HLA genes in cells is regulated both positively and
negatively by the interaction of different trans-acting factors with cis-regulatory elements at
the genomic level as mentioned earlier. This subject has been reviewed in detail previously
(David-Watine et ah, 1990). The molecular mechanisms for regulating the expression of
class I MHC genes has only been partially elucidated. The transcription of class I HLA

10
genes is controlled by different regulatory elements in the 5'-flanking region. The cis-
regulatory elements that have been identified include promoter sequences (TATA box,
CCAAT box), the class I regulatory elements (CRE/enhancer A), kB enhancer elements, an
interferon response sequence (IRS), the negative regulatory element (NRE), and the R x
R[3 binding motif. Various trans-acting factors for these elements have also been described
(Blanar et ah, 1989; Driggers et ah, 1990; Kieran et al., 1990; Waring et ah, 1995; Yano et
ah, 1987).
As mentioned earlier, alternative splicing of pre-mRNAs may regulate gene
expression by diverting some of the gene transcripts into synthesizing different forms of
proteins. It has been shown that class I HLA antigens are present in water-soluble form in
plasma (Charlton and Zmijewski, 1970; Kao, 1987; Krangel, 1987; Rood et ah, 1970).
Further biochemical analysis demonstrated that the 39-kD water-soluble form of class I
HLA heavy chain is the translation product of an alternatively spliced HLA mRNA without
exon 5 (Haga et ah, 1991). Because exon 5 encodes the transmembrane domain, the
protein product of the mRNA without transmembrane domain is secreted into extracellular
fluids. The presence of high concentrations of water-soluble form of HLA antigens has
been associated with HLA-A24 phenotype (Adamashvili et ah, 1996; Kao et ah, 1988;
Krangel, 1987). At present, it is not known how alternative splicing could affect HLA
expression on cells. Because the alternatively spliced HLA transcripts are only present in
low quantities in cells (Haga et ah, 1991), it is unlikely that alternative splicing plays a
significant role in regulating quantitative HLA expression.
The assembly and transportation of the class I HLA-P2m-peptide complex also can
affect the expression of class I HLA antigens on the cell surface. It has been shown that
class I HLA antigens are absent on the cell surface of (32m-deficient cells, and that the
expression of class I HLA antigens can be restored after the cells are transfected with P2m
(Ljunggren et ah, 1990; Powis et ah, 1991; Tarleton et ah, 1992). Because the antigenic
peptides are essential for the assembly of class I HLA antigens, both generation of

11
antigenic peptides in the cytoplasm and transportation of these peptides into ER are critical
for the expression of class I HLA antigens. Inhibition of proteasomes can result in reduced
availability of binding peptides and lead to decreased expression of class IMHC antigens
on the cell surface (Benham and Neefjes, 1997; Grant et ah, 1995). Mutation of TAPs can
decrease the expression of HLA antigens by limiting the supply of antigenic peptides.
Transfection of these mutant cells with native forms of TAP cDNAs is able to restore the
normal expression of class I HLA antigens (Hughes et al., 1997). However, the
availability of (32m or antigenic peptides does not appear to play a significant role in
regulating quantitative expression of class I HLA in normal cells. For instances,
polymorphism of TAPs does not affect quantitative expression of class I HLA (Daniel et
ah, 1997), and expression of different HLA-A and -B antigens in cells is proportionally
upregulated during viral infection, interferon stimulation or transformation by EBV virus
(Shieh and Kao, 1995). These findings suggest that antigenic peptides are present in
abundance and readily available in ER for binding by different specific HLA-A and -B
antigens. Therefore, the availability of antigenic peptide is not a rate-limiting step in
controlling HLA expression in cells with normal functional proteasomes and TAPs.
Although a great deal of information has been gained in how HLA expression is regulated
in general, it is not known how different HLA-A and -B antigens are proportionally
upregulated in cells in response to interferon or infection by certain viruses.
Functional Importance of Quantitative Expression of HLA Antigens
Many recent studies have concentrated on identifying the antigenic peptides that
bind to HLA molecules and little attention has been paid to potential functional importance
of quantitative expression of HLA antigens. Earlier study (Bukowski and Welsh, 1985a)
suggested that the upregulation of HLA expression during influenza virus infection could
enhance the susceptibility of infected cells to CTLs. To further investigate the potential

12
quantitative importance of HLA antigens in determining the susceptibility to CTLs, Shieh
and Kao conducted a series experiments and demonstrated a linear quantitative correlation
between HLA-A2 antigens expressed on target cells and the susceptibility of these cells to
HLA-A2 restricted CTLs (Shieh et ah, 1996). These findings support the potential
quantitative importance of HLA antigens. The importance of quantitative HLA expression
is also supported by the findings that tumor cells or virus-infected cells can escape immune
surveillance through down regulation of HLA expression (Bodmer et ah, 1993; Honma et
ah, 1994; Ruiz-Cabello et ah, 1991). In contrast, treatment with IFN-yto restore MHC
class I expression enhances the susceptibility of these cells to CTLs (Peltenburg et ah,
1993; Versteeg et ah, 1988; Versteeg et ah, 1989b).
It has been known that during infection by certain viruses, such as adenovirus,
herpes simplex virus (HSV), human immunodeficiency vims (HIV) and cytomegalovirus
(CMV), the expression of class I HLA antigens is greatly reduced (Anderson et ah, 1985;
Ehrlich et ah, 1989; Gosgusev et ah, 1988; Hill et ah, 1995; Howcroft et ah, 1993; Walev
et ah, 1992). The reduced expression of HLA antigens may contribute to the successful
evasion of viruses from host cellular immune response. All of these findings support the
functional importance of quantitative expression of HLA antigens. Both increased and
reduced expression of HLA expression can influence the host susceptibility, severity and
recovery from various clinical conditions as described above.
Quantitative Differential Expression of HLA-A and -B antigens
The regulation of quantitative expression of class I HLA antigens has been widely
studied (Bishara et ah, 1988; Gerrard et ah, 1988; Girdlestone and Milstein, 1988; Hakem
et ah, 1989; Leeuwenberg et ah, 1987; Masucci et ah, 1989; Masucci et ah, 1987; Ohlen et
ah, 1989; Shimizu and DeMars, 1989; Versteeg et ah, 1989a; Zachow and Orr, 1989).
The reported studies suggested that the expression of different HLA-A and -B genes are

13
differentially expressed and upregulated. However, most of these studies were conducted
using tumor cell lines or cells transformed with class IHLA cDNA constructs or genes.
For this reason, results obtained from these studies can not be extrapolated to native HLA-
A and -B genes in normal cells.
When the quantitative expression of native HLA genes was studied, it was found
that the relative quantities of HLA-A and -B antigens in different types of cells of an
individual are the same and remain unchanged over time (Kao, 1989; Kao and Riley,
1993). These findings suggest that the relative amounts of different class I HLA antigens
expressed on cells are genetically predetermined. Subsequent studies of comparing the
quantitative expression of different specific HLA antigens in members of different HLA
phenotyped families confirmed that the differential quantitative expression of HLA-A and
-B antigens is linked directly to class I HLA genes and follows Mendelian inheritance (Kao
and Riley, 1993). In addition, it was found that the relative amounts of different specific
HLA antigens are proportionally amplified during up-regulated expression of total class I
HLA antigens by interferon treatment, EBV transformation or infection with influenza
viruses (Shieh et al., 1996; Shieh and Kao, 1995). Because the amount of HLA antigens
expressed on cells has been shown to proportionally affect the susceptibility of cells to
cytotoxic T lymphocytes (Shieh et al., 1996), and the quantities of each specific HLA
antigen expressed on cells may influence disease susceptibility, severity and recovery as
discussed earlier, it is of importance to learn what mechanisms are employed to control the
genetically predetermined quantitative differential expression of HLA-A and -B antigens.
The goal of my dissertation research is to determine how varied quantitative expression of
HLA antigens on cells of an individual is controlled by gene transcription, mRNA
turnover, mRNA translation, and/or protein degradation. Specifically, experiments are
conducted (l) to determine whether different HLA-A and -B proteins in cells are
proportionally degraded; (2) to determine whether the relative quantities of HLA-A and -B
antigens expressed in cells are proportionally correlated with the levels of mRNAs for these

14
antigens; (3) to determine whether mRNAs for different HLA-A and -B antigens in cells
have the same stabilities; and (4) to determine whether different HLA-A and -B mRNAs
are differentially produced.

CHAPTER 2
MEASUREMENT OF RELATIVE QUANTITIES OF DIFFERENT HLA-A AND -B
MRNAS IN CELLS BY REVERSE TRANSCRIPTION-POLYMERASE CHAIN
REACTION AND DENATURING GRADIENT GEL ELECTROPHORESIS
Introduction
As discussed in Chapter 1, class I HLA antigens are polymorphic membrane
glycoproteins that consist of a 44-kD heavy chain and a 12-kD invariant p2-microglobulin
(Ploegh et ah, 1981). The genes encoding HLA heavy chains are located at three different
loci (A, B, C) of chromosome 6 (Ploegh et ah, 1981). Functionally, class I HLA antigens
play important roles in presenting antigen peptides to CD8+ cytotoxic T cells (Zinkernagel
and Doherty, 1979) and are essential for the development of CD8+ CTLs in the thymus
(Roller et ah, 1990; Zijstra et ah, 1990). The quantity of HLA antigens expressed on cells
also play an important role in determining the susceptibility of virus-infected cells to CTLs
(Bukowski and Welsh, 1985b; Shieh et ah, 1996). Moreover, HLA-A and -B antigens are
expressed in different quantities in cells according to Mendelian inheritance (Kao and Riley,
1993).
However, the molecular basis for the genetically predetermined differential
quantitative expression of class I HLA-A and -B antigens in cells remain unknown. In
order to address this question, it is necessary to develop a method for measuring the
relative quantities of different HLA-A and -B mRNAs in cells. Although several methods
for quantitation of specific mRNAs are available including northern blot, SI nuclease or
ribonuclease protection assay and quantitative reverse transcription-polymerase chain
reaction (RT-PCR), none of these methods could be easily applied to our study due to
technical complexity and/or problems of cross hybridization resulting from high degrees of
15

16
sequence homology for HLA mRNAs. We therefore exploited the simplicity of quantitative
RT-PCR and the high resolution power of denaturing gradient gel electrophoresis (DGGE)
to develop a simple and reliable method for measurement of the relative quantities of
different HLA-A and -B mRNAs in cells. The procedures and the validation of this method
are described herein.
Materials and Methods
Lymphoblastoid Cell Lines and RNA preparation
EBV-transformed lymphoblastoid cell lines (LCLs) with well characterized class I
HLA phenotypes were obtained from the American Society for Histocompatibility and
Immunogenetics Cell Repository (Yang et al., 1989) or developed in our laboratory (Shieh
and Kao, 1995). These cell lines were maintained in RPMI 1640 medium (Life
Technologies, Grand Island, NY) containing 10% fetal calf serum, 1 % antibiotic-
antimycotic solution and 40 ¡ig/ml gentamycin. Total cytoplasmic RNA was isolated using
the RNAeasy Total RNA Kit (QIAGEN Inc., Chatsworth, CA) according to the
manufacturer’s protocol.
Reverse Transcription of mRNAs
First-strand HLA cDNAs were prepared by reverse transcription of total
cytoplasmic RNA in 50 pi reverse transcription buffer containing 1.5 |lM HLA-specific
primers, 0.5 mM dNTP, 10 pM DTT, 100 U rRNasin (Promega Corp., Madison, WI) and
500 units M-MLV reverse transcriptase (Life Technologies, Grand Island, NY) at 37°C for
2 hours. Thereafter, the reverse transcriptase was inactivated by heating at 99°C for 5 min.
The primer (5’-TTG AGA CAG AGA TGG AGA CA-3’), which is complementary to a
nucleotide sequence conserved among all class I HLA-A, -B, and -C mRNAs in the 3'-
untranslated region (UTR) nucleotide sequence (Davidson et al., 1985), was used to

17
prepare the first-strand HLA cDNA containing the whole coding region. The synthesized
cDNAs were subsequently used as templates for PCR to obtain the whole coding
sequences for cloning. Another primer (5’-ACA GCT CC(A,G) (A,G)TG A (C,T)C
ACA-3’), which is specific and complementary only to the nucleotide sequences of exon 5
of all class I HLA-A and -B genes, but not to those of HLA-C genes, was used to
synthesize the first-strand HLA cDNA. The HLA-A and -B cDNAs then were used for
quantitative RT-PCR to determine the relative amounts of different HLA-A and -B mRNAs
by DGGE and phosphor imaging analysis. The use of this primer enables us to avoid
possible interference by HLA-C mRNAs.
Polymerase Chain Reaction (PCR) and TA cloning
To obtain the whole coding sequences of class I HLA cDNA for cloning, a pair of
primers that are specific for all class I HLA mRNAs and encompass the 5'-UTR and the 3'-
UTR nucleotide sequences of HLA mRNAs (Ennis et ah, 1990) were used for PCR. The
sequences of this pair of primers are 5’-GAA TCT CCC CAG ACG CCG AG-3’ and 5’-
TCA GTC CCT CAC AAG ACA GC-3\ respectively. The cDNA templates for PCR were
prepared as described in the previous section. The PCR was performed in buffer
containing 10 mM Tris-HCl, 1.5 mM MgCL, 50 mM KC1, pH 8.3, supplemented with 0.2
mM of each dNTP, 0.5 |lM of each primer and 2.5 units of Taq DNA polymerase
(Boehringer Mannheim, Indianapolis, IN) in a volume of 100 |il for 25 cycles. Each cycle
consisted of 94°C denaturation for 1 min, 65°C annealing for 1 sec and 72°C extension for
1.5 min. PCR products were cloned into a PCRâ„¢II plasmid vector using a TA Cloning
Kit (Invitrogen, San Diego). HLA specificities of the plasmids isolated from these TA
clones were determined by automated DNA sequencing using Taq DyeDeoxyâ„¢ Terminator
Cycle Sequencing Kit ( Applied Biosystems, Inc., Foster City, CA). The primer sequence
for DNA sequencing is 5’-GCG ATG TAA TCC TTG CCG-3’ and complementary to the
nucleotides 429-446 of class I HLA coding sequence.

18
The nucleotide sequences of the primers used for quantitative PCR are 5’-CGC
CGT GGA TAG AGC AGG-3’ and 5’-GCG ATG TAA TCC TTG CCG-3\ which are
complementary to the conserved antisense and sense nucleotide sequences in exon 2 and
exon 3 of all class I HLA mRNAs, respectively. Quantitative PCR was performed using
the same conditions as described above in a volume of 50 |ll except annealing at 60°C for
0.5 min, extending at 72°C for 1 min and amplified for 18 cycles. The HLA-A and -B
cDNA prepared from cytoplasmic RNA was used as templates.
—P Labeling of The Primer for Quantitative PCR
Four hundred picomoles of a primer was labeled with 54 pinoles of [y-32P]ATP
(3000 Ci/mmol, 10mCi/ml) (Amersham Life Science, Inc., Arlington Heights, IL) in 80 |ll
pH 7.6 buffer containing 70 mM Tris-HCl, 10 mM MgCl2, 5 raM DTT and 40 units of T4
kinase (Promega, Madison, WI) at 37°C for 1 hour. The free nucleotides were removed by
Sephadex G-25 filtration. Specific activity of the labeled primer was about lx 10'’
cpm/pmole.
DGGE
DGGE was performed in 1 mm thick 6% polyacrylamide (acrylamide:
bisacrylamide = 19:1) gel using D-GENEâ„¢ Denaturing Gradient Gel Electrophoresis
System (Bio-Rad Laboratories, Hercules, CA). The polyacrylamide gel contained a
linearly increasing denaturant gradient from 40% to 60%. The 100% denaturant contains 7
M urea and 40% (w/v) deionized formamide. Electrophoresis was performed at 60°C, 165
V for 2 to 3.4 hours in 40 mM Tris-acetate, pH 8.0, containing 1 mM EDTA (TAE). After
electrophoresis, the gels were stained with ethidium bromide and photographed by using a
Polaroid camera or Gel Print 2000i system (Bio Photonic, Corp., Ann Arbor, MI), or
dried for autoradiography and phosphor imaging analysis. PCR product of each HLA-A or

19
-B mRNA in DGGE gel was identified by using PCR products prepared from the plasmids
containing cloned HLA-cDNAs of known specificity.
Preparation of HLA mRNA Standards
HLA-A and -B cDNAs cloned in the PCRâ„¢II vector (Invitrogen, San Diego, CA)
were used for in vitro synthesis of the RNA standards. Five micrograms of plasmid was
digested with 20 units of BamH I in a volume of 100 pi at 37°C for 2 hours. After
confirmation of complete digestion by agarose gel electrophoresis, linearized plasmids were
isolated by phenol/chloroform extraction and ethanol precipitation. One microgram of
linearized plasmids were used as templates for in vitro transcription in a volume of 20 pi at
37°C for 4 hours using T7 RNA polymerase according to the manufacturer’s protocol
(MEGAscriptâ„¢ In Vitro Transcription Kits) (Ambion Inc., Austin, TX). After 4 hours
incubation, 2 units RNase-free DNase I was added and incubated at 37“C for 30 minutes to
degrade the template DNA. The in vitro synthesized RNA transcripts were recovered with
phenol/chloroform extraction and isopropanol precipitation. Free nucleotides were
removed by RNeasy spin column separation (QIAGEN Inc., Chatsworth, CA) and ethanol
precipitation. The concentrations of the synthesized RNA standards were measured by
absorbance at 260 nm. These transcripts were used as standards for quantitative RT-PCR
and S1 nuclease protection assay.
S1 Nuclease Protection (SNP) Assay for Quantitation of HLA-A and -B mRNAs in
Lymphoblastoid Cell Lines
The DNA probes for SI nuclease protection assays were generated from plasmids
in which the coding sequence 218-446 of HLA-A or -B mRNA was cloned. DNA
containing this partial HLA-A or -B nucleotide sequence and the flanking polycloning site
sequences in the vector was amplified using PCR with a pair of primers flanking the
polycloning sites. The PCR products were then purified by agarose electrophoresis and

20
Sephag]as1M BandPrep Purification Kit (Pharmacia LKB ), and used as templates for probe
synthesis. The probes were synthesized by using an anti-sense primer that is
complementary to the coding sequence between nucleotide 429 and 446 of HLA-A and -B
mRNA, a Prime-A-Probeâ„¢ DNA labeling Kit (Ambion, Inc., Austin, TX) and labeled
with [a-32P]dATP. After gel purification, the DNA probes were used for quantitative S1
nuclease protection assay using S1-Assay Kit (Ambion, Inc., Austin, TX) according to the
manufacturer’s instruction. HLA-A and -B RNA transcripts synthesized from the cloned
cDNAs were used to construct standard curves. For quantitation of HLA mRNAs, 0.5-1
|lg of total cytoplasmic RNA was assayed in triplicates. The S1 nuclease-digestion
products were separated using a 6% denaturing polyacrylamide gel (8M urea). The
protected DNA fragments were quantified by phosphor imaging. The amount of specific
HLA-mRNA was determined from the standard curve.
Autoradiography. Phosphor Imaging and Densitometry
For autoradiography, the gels were exposed to Fuji Medical X-ray film (Fuji Photo
Film Co., Ltd., Japan) for 3 hours (DGGE) or 48 hours (SNP assay) at -70°C. For
phosphor imaging, the gels were exposed to a Phosphorscreen (Molecular Dynamics, Inc.,
Sunnyvale, CA) for 3 hours (DGGE) or 24 hours (SNP assay) at room temperature. The
radioactivity of each specific DNA band was quantified using ImageQuant software
(Molecular Dynamics, Inc., Sunnyvale, CA). For quantitation of DNA in agarose gels by
densitometry, photographs of gels were scanned with a 600 dpi Microtek grayscale scanner
( Microtek, Inc., Torrance, CA) and analyzed by Collage 3.0 software (Fotodyne Inc.,
New Berlin, WI).

21
Results
Optimization of Quantitative RT-PCR
Although the amount of PCR products doubles after each cycle of PCR
amplification, it is known that the efficiency of amplification decreases with increasing
numbers of amplification cycles. The reduced efficiency leads to uneven amplification and
loss of proportional quantitative correlation between PCR products and original template
numbers (Gause and Adamovicz, 1994). We therefore studied the amounts of PCR
products as a function of PCR cycle numbers. The PCR products were measured using
32P-labeled primer, agarose gel electrophoresis and scintillation counting. It was found that
the amounts of PCR products were increased logarithmically with the PCR cycle number as
expected up to 18 cycles (Figure 2). After 18 cycles, the PCR began to generate less than
the expected amounts of amplified products. Therefore, the cycles used for all our
quantitative RT-PCR reactions for cytoplasmic HLA-A and -B mRNAs were <18.
Next, we studied the PCR products as a function of templates prepared from
different quantities of total cytoplasmic RNA. The amounts of RT-PCR products were
measured according to fluorescent intensity in agarose gel by scanning densitometry and
were linearly correlated with the quantities of templates prepared from 2.5 |LLg to 15 Ltg of
total cytoplasmic RNA (Figure 3). The results of this experiment indicate that <15 (ig total
cytoplasmic RNA can be used for quantitation of HLA mRNAs.
Separation and Identification of RT-PCR Products of Different HLA-A and -B mRNAs by
DGGE
After quantitative amplification, PCR products of the polymorphic region of
different specific HLA-A and -B mRNAs were analyzed by DGGE. As shown in Figure
4, this technique successfully separated RT-PCR products of different HLA-A and -B
mRNAs. To identify the HLA specificity of each DNA band in denaturing gradient gels,
we cloned HLA cDNAs from the same cell lines into plasmids. These plasmids were used

22
Figure 2 Optimal cycles for quantitative RT-PCR. The amounts of RT-PCR products for
HLA-A and -B mRNAs were studied as a function of PCR cycles. The PCR products
were measured by using a y-32P end-labeled primer and scintillation counting of DNA
products cut from agarose gels. The ideal relationship between PCR products and PCR
cycles is shown as dotted line. Total cytoplasmic RNA (10|lg) from four lymphoblastoid
cell lines were studied, 9067 (o), 9068 (x), 9005 (A) and SH (â–¡).
as templates for PCR amplification. The PCR products of known HLA specificities were
am on the same denaturing gradient gel to determine the identity of each unknown DNA
band. As shown in Figure 4B, HLA specificity of each DNA band can be easily
identified. When the same approach was applied to three HLA heterozygous LCLs, RT-
PCR products of different HLA-A and -B mRNAs were well resolved (Figure 5).
Measurement of Relative Quantities of Different HLA-A and -B mRNAs in The Same
Sample bv RT-PCR and DGGE
To determine whether RT-PCR and DGGE can be applied to measure the relative
quantities of different HLA-A and -B mRNAs in a RNA sample, the following validation
study was performed. First, the HLA-A24 and -B60 mRNA transcripts were generated by
in vitro transcription from HLA cDNA plasmids and used as templates. The integrity of

23
OT
+-'
O
3
Ti
O
i_
O.
cc
o
Q_
CC
Figure 3 HLA RT-PCR products measured as a function of different amounts of total
cytoplasmic RNA. PCR was performed for 18 cycles. The PCR products were identified
by agarose gel electrophoresis and ethidium bromide staining, and quantified by
densitometry. Simple regression analysis shows a good linear correlation between the two
parameters up to 15 |lg cytoplasmic RNA.
these transcripts were confirmed by formaldehyde agarose gel electrophoresis which
showed that these transcripts were of the expected correct size. The purified transcripts
were quantified by absorbance at 260 nm wavelength. These two RNA transcripts were
mixed in different ratios (4:1, 2:1, 1:1, 1:2,1:4) at a total amount of 1.5 ng and used for
RT-PCR. The results shown in Figure 6 demonstrate that the relative amounts of RT-PCR
products for HLA-A24 and -B60 mRNAs were linearly correlated with the relative
quantities of the mRNA standards in the reverse transcription mixtures. The same results
were obtained when different HLA mRNAs were used (data not shown). These results
indicate that RT-PCR/DGGE and phosphor imaging quantitation can be used to determine
the relative quantities of different HLA-A and -B mRNAs in the same sample.

24
Figure 4 Identification of RT-PCR products of different HLA-A and -B mRNAs by
DGGE. (A) Polyacrylamide gel (6%) electrophoresis of RT-PCR products of HLA-A and
-B mRNAs from five different HLA-A and -B homozygous LCLs. The identification
number of each cell line is shown at the top of each lane. (B) Separation of the RT-PCR
products of each cell line in DGGE polyacrylamide gel (middle lane of each small panel).
After staining with ethidium bromide, HLA specificity of each DNA band in the PCR
products was identified using the PCR product generated from the plasmid containing
HLA-cDNA of known specificity from the same cell line (left and right lanes of each small
panel).
B7 A2 SH A3 B44 B7 A2 CG A3 B45 B35 A1 1 DC A24 B60
Figure 5 DGGE separation of RT-PCR products of HLA-A and -B mRNAs isolated from
LCLs carrying heterozygous HLA-A and -B antigens. The left and the right two lanes of
each panel are RT-PCR products from plasmids containing HLA cDNAs of known
specificities cloned from the same cell line.

25
Figure 6 Validation of using RT-PCR and DGGE for measuring relative quantities of
different HLA mRNAs. Samples containing different relative amounts of HLA-A24 and -
B60 RNA were used as templates for quantitative RT-PCR. These RNAs were
synthesized by in vitro transcription. The total amount of HLA-A24 and -B60 RNAs for
each RT-PCR reaction was 1.5 ng. The RT-PCR products were separated by DGGE and
quantified by phosphor imaging analysis. The bottom panel shows the autoradiograph of
the DGGE gel used for quantitative analysis by phosphor imaging.
Measurements of Relative Quantities of Different HLA-A and -B mRNAs in LCLs by RT-
PCR/DGGE and S1 Nuclease Protection Assay
To further establish the validity of the RT-PCR/DGGE method, we also determined
the relative amounts of HLA-A and -B mRNAs in four LCLs using SI nuclease protection
assay. The results were compared with those obtained by using the RT-PCR/DGGE
method. Standards for SI nuclease protection assay were prepared from the HLA-cDNAs
cloned in plasmids. Representative results of using S1 nuclease protection assay for
quantitation of HLA-A24 and -B60 mRNAs are shown in Figure 7. We then determined
the relative quantities of individual HLA-A and -B mRNAs in four lymphoblastoid cell
lines. The results summarized in Table 1 show a good correlation between two assays.

26
Figure 7 Quantitation of HLA-A24 and -B60 mRNAs in 9075 lymphoblastoid cell line
using SI nuclease protection assay. Panel (A) and (B) show the standard curves for the
quantitation of HLA-A24 and -B60 mRNAs. The insets are autoradiographs of standards
and triplicates of a RNA sample from 9075 cell line. The same amount of total cytoplasmic
RNA was used for quantitation of HLA-A24 and -B60 mRNAs. The amounts of HLA-A
and -B mRNAs were determined from the standard curves and used to calculate their
relative quantities.
Table 1 Relative quantities of HLA-A and -B mRNAs in lymphoblastoid cell lines
measured by RT-PCR/DGGE and SI nuclease protection assay
LCL
HLA
Relative Quantities of HLA-A and -B mRNAs (%, Mean ± SD)
RT-PCR/DGGE S1 Nuclease Protection
Assay
9027
A29
63 ± 4 (4)*
64+11 (2)
B44
37 ± 4 (4)
36+11 (2)
9067
A2
63 ± 5 (4)
62 + 4 (2)
B27
37 ± 5 (4)
38 + 4 (2)
9068
A2
60 + 2 (4)
58 ± 1 (2)
B35
40 + 2 (4)
42 ± 1 (2)
9075
A24
41+6 (4)
38 + 6(3)
B60
59 + 6 (4)
62 + 6 (3)
*: Number of experiments performed on different dates.

27
Discussion
For quantitation of different specific mRNAs, the commonly used methods include
northern blot, SI nuclease or ribonuclease protection assay, and quantitative RT-PCR
(Wiesner and Zak, 1991). The advantages of using northern blot approach are that the
integrity of mRNA can be assessed and several rounds of hybridization can be performed
using the same blot. Flowever, this method is semi-quantitative and not sensitive. The
northern blot method is also complicated by the problem of cross hybridization resulting
from high degree of sequence homology and the same size of HLA mRNAs. The second
approach to quantify specific mRNAs is SI nuclease or ribonuclease protection assay.
This method is based on solution hybridization and is more sensitive and precise than the
northern blot technique. Nevertheless, this approach requires laborious preparation of
specific probes and RNA standards. The involvement of several rounds of nucleic acid
precipitation by ethanol also introduces variability. The third approach to measure
quantities of different HLA mRNAs is quantitative RT-PCR (Gause and Adamovicz,
1994). This is a simple and sensitive quantitative method. The method can be used for
large numbers of samples. However, RT-PCR methods alone can not be applied for
quantitation of different specific mRNAs that would produce the same size of PCR
products in the same incubation. We therefore developed a simple and precise method for
measuring the relative quantities of different HLA-A and -B mRNAs in cells using a
combined approach involving quantitative RT-PCR, DGGE and phosphor imaging.
The use of quantitative RT-PCR allowed us to have a sensitive technique to amplify
different target HLA mRNAs in the same PCR incubation. In order to ensure that cDNA
templates of different HLA-A and -B mRNAs were proportionally amplified, the same pair
of primers was used for all HLA-A and -B cDNAs. The DGGE technique (Myers et ah,
1985) then was used to separate the same size of the amplified PCR products according to
minor differences of their nucleotide sequences. The amount of PCR product of each

28
specific HLA mRNA is quantified by phosphor imaging technique. Although the single
strand conformation polymorphism (SSCP) technique (Orita et ah, 1989) is another
powerful method to separate RT-PCR HLA products, we did not adopt this technique
because DNA bands separated in gels of SSCP can not be visualized by simple ethidium
bromide staining and incomplete denaturation of DNA samples prior to SCCP gel
electrophoresis could introduce quantitative imprecision.
According to the results of our study, the amount of PCR product for each specific
HLA mRNA after 18 cycles of amplification appeared sufficient to be detected by ethidium
bromide staining (Figs. 3 and 4). Nevertheless, the ethidium bromide staining method and
densitometry were not used for quantitation of RT-PCR products separated in DGGE gels.
The reason for not using this simple quantitative method is that the same amounts of PCR
products for different HLA mRNAs are not equally stained by ethidium bromide in DGGE
gels (data not shown). This finding of differential staining likely resulted from different
degrees of DNA denaturation in DGGE gels. Consequently, the same amounts of DNA do
not bind the same quantities of ethidium bromide. We therefore used primers end-labeled
with y-32P for PCR and phosphor imaging for quantitation of each specific PCR product in
DGGE gel.
After optimizing our assay condition, two different approaches were used to
validate the RT-PCR/DGGE method for quantitation of different specific HLA-A and -B
mRNAs in cells. The first approach was to study samples containing known amounts of
different HLA-A and -B RNA transcripts (Figure 6). The second approach was to confirm
the results of our method by SI nuclease protection assay (Figure 7). The results of these
two approaches (Figure 6 and Table I) indeed support the validity of our assay method.
However, our method, unlike an SI nuclease protection assay, yielded relative but not
absolute quantities of different HLA-A and -B mRNAs. If absolute amounts of specific
HLA mRNAs need to be determined, a separate measurement of total HLA-A and -B
mRNAs can be made by additional quantitative RT-PCR (Gilliland et al., 1990;

29
Prendergast et al., 1992). The exact amount of each specific HLA-A or -B mRNA then can
be calculated from the results of relative quantities of different specific HLA mRNAs and
the total HLA mRNAs. Therefore, the newly established RT-PCR/DGGE method will be
useful to study the mechanisms of normal or altered differential quantitative expression of
HLA-A and -B antigens in normal and neoplastic cells under different physiological or
pathological conditions (i.e. cytokine stimulation, viral infection and malignant
transformation). Because there are many other duplicated and highly conserved genes
(Greig et al., 1993; Li et al., 1995; Spicer et al., 1995; Watkins, 1995), the results our
study also demonstrate that the RT-PCR/DGGE method should be useful for studying the
differential quantitative expression of these genes in cells.
In view of the extreme polymorphic nature of class I HLA antigens, we expect that
the protocol described in this report may not resolve certain combinations of HLA
phenotypes due to limited differences in nucleotide sequences (e.g. HLA-B60 and B61). If
this situation occurs, a different set of primers can be selected for RT-PCR, and DGGE
conditions (i.e. gradients of denaturing agent and/or temperature of gel electrophoresis) can
be modified to resolve the PCR products of different HLA mRNAs. In addition to the
eight cell lines studied by us (Figure 4 and 5), we have successfully used the protocol
described in this report to determine the relative quantities of different HLA-A and -B
mRNAs in three additional HLA-phenotyped LCLs. These three cell lines are 9001 (A24
and B7), 9003 (A24 and B51), and 9044 (A24, B51 and B63). However, we were unable
to resolve PILA-A2/A11 and B60/B61 in two additional cell lines by our protocol without
modification. Because HLA-A and -B antigens that have been studied by us are present in
relatively high frequencies in the general population, the results of our study indicate that
the protocol reported herein should be applicable to many HLA-phenotyped cells. By
using this validated approach, we are able to measure the relative quantities of HLA-A and -
B mRNAs in subsequent studies as described in the next chapter.

CHAPTER 3
MECHANISMS FOR DIFFERENTIAL QUANTITATIVE EXPRESSION OF HLA-A
AND -B ANTIGENS IN LYMPHOBLASTOID CELL LINES
Introduction
As discussed in Chapter 1, class I HLA molecules are polymorphic membrane
glycoproteins and consist of a 44-kD heavy chain encoded by the classical class I HLA
genes (HLA-A, -B, and -C) and a 12-kD invariant light chain ((32m) encoded by a non-
MHC gene (Bjorkman and Parham, 1990). The allelic polymorphism of heavy chains is
responsible for different peptide-binding specificities of class I HLA molecules and is
functionally important in providing HLA-restricted immune responses (Bjorkman and
Parham, 1990).
Previous studies have shown that different class I HLA genes are differentially
expressed, and the relative quantities of HLA-A and -B antigens expressed in different
types of cells are the same in an individual (Kao and Riley, 1993). The relative quantities of
HLA-A and -B antigens expressed on cells remain constant over time (Kao, 1989; Shieh
and Kao, 1995). Subsequent studies of comparing the quantitative expression of different
specific HLA antigens in members of HLA phenotyped families indicated that the
differential quantitative expression of HLA-A and -B antigens is linked directly to class I
HLA genes and follows Mendelian inheritance (Kao and Riley, 1993). In addition, it was
found that the relative amounts of different specific HLA antigens are proportionally
amplified during up-regulated expression of total class I HLA antigens induced by
interferon treatment or infection with influenza virus (Shieh and Kao, 1995). Because the
amount of HLA antigens expressed on cells has been shown to determine the susceptibility
30

31
of cells to cytotoxic T lymphocytes (Shieh et al., 1996), these findings support the potential
functional importance of genetically predetermined quantitative HLA expression in
determining the susceptibility of cells to cytotoxic T cells, which may influence the
morbidity or recovery of an individual from various infection by intracellular pathogens.
For this reason, it would be important to gain further understanding of how differential
expression of HLA antigens is regulated.
The quantitative HLA protein expression in cells is determined by the rates of
protein synthesis and degradation, and the synthesis of protein is regulated by the amount
of available HLA-mRNA and the protein translation efficiency. For HLA expression, it is
also determined by availability of antigen peptides and (32m for correct folding and
stabilization. However, available results support that the availability of antigenic peptides
and (32m is not the rate-limiting step in normal cells (Shieh and Kao, 1995). Although
numerous studies on regulation of HLA expression have been reported (Bishara et al.,
1988; Blanar et al., 1989; Driggers et al., 1990; Gerrard et al., 1988; Girdlestone and
Milstein, 1988; Hakem et al., 1989; Masucci et al., 1987; Versteeg et al., 1989a; Zachow
and Orr, 1989), most of them have only focused on the transcription step affected by
variations in the promoter sequences of different HLA-A and -B genes. Studies also
showed that certain sequence variations in the introns contribute to the varied quantitative
expression of certain class I HLA antigen (Laforet, 1997; Magor et al., 1997). Although
the results of these studies indicate that sequence variations of HLA genes could directly
influence protein expression, most of these studies have been conducted by using tumor
cell lines or cells transfected with class I HLA cDNA constructs or genes. Therefore,
results obtained from these studies are insufficient and do not necessarily explain the
molecular basis of genetically pre-determined quantitative differential expression of HLA
antigens in human cells. For this reason, we decided to study how different regulatory
steps of protein expression are involved in determining the quantitative differential
expression of HLA antigens.

32
Because earlier studies have shown that the relative quantities of different HLA-A
and -B antigens in EBV-transformed lymphoblastoid cell lines are the same as their parental
B lymphocytes (Shieh and Kao, 1995), and homozygous cell lines with well characterized
HLA phenotypes are readily available (Prasad and Yang, 1996; Yang et al., 1989), we
chose EBV-transformed lymphoblastoid cell lines for our study. The study described
herein shows that different steps, including transcription, splicing, mRNA degradation,
and possibly translation, are involved in regulation of the expression of each HLA antigen.
Despite the complex regulatory mechanisms for HLA expression, the results of our study
showed that HLA gene sequences are responsible for all the studied regulatory steps and
the differential quantitative expression of HLA antigens is directly determined by HLA
genes.
Materials and Methods
Lymphoblastoid Cell Lines and RNA Preparation
EBV-transformed LCLs with well characterized class I HLA phenotypes were
obtained from American Society for Histocompatibility and Immunogenetics Cell
Repository (Prasad and Yang, 1996; Yang et al., 1989) or developed in our laboratory
(Shieh and Kao, 1995). These cell lines were maintained in RPMI 1640 medium (Life
Technologies, Grand Island, NY) containing 10% fetal calf serum, 1 % antibiotic-
antimycotic solution and 40 (ig/ml gentamycin.
Isolation of Nuclei and Preparation of RNA
The nuclei of lymphoblastoid cells were prepared by using the method described by
Mullner et al. (1997). Briefly, 200 million cells were lysed in 12 ml of lysis buffer
containing 150 mM sucrose, 0.25 mM EGTA, 1 mM EDTA, 60 mM KC1, 15 mM NaCl,
0.15 mM spermine, 0.5 mM spermidine, 15 mM HEPES pH 7.5, 14 mM (3-

33
mercaptoethanol and 0.2% NP-40. The homogenate was diluted with 12 ml of buffer II,
which contains 2 M sucrose, 0.25 mM EGTA, 1 mM EDTA, 60 mM KC1, 15 mM NaCl,
0.15 mM spermine, 0.5 mM spermidine, 15 mM HEPES pH 7.5 and 14 mM (3-
mercaptoethanol. This diluted homogenate was layered over a cushion of buffer II
representing 1/3 of the volume of the centrifuge tube. After centrifugation at 30,000g for
45 min at 4°C in a rotor with swing-out buckets, the supernatant containing the cytoplasm
was saved for isolation of cytoplasmic RNA. The sucrose layer was removed and the
pellet containing nuclei was resuspended in the storage buffer containing 20 mM Tris-HCl
pH 8.0, 75 mM NaCl, 0.5 mM EDTA, 50% glycerol, 0.85 mM DTT and 125 mM
phenylmethylsulfonyl fluoride (PMSF) at a concentration of 1 x 105 nuclei/pl Total nuclear
RNA and cytoplasmic RNA were isolated using the RNAeasy Total RNA Kit (QIAGEN
Inc., Chatsworth, CA) according to the manufacturer’s protocol. Remnant DNA in the
RNA preparation was removed by RNase-free DNase I digestion for 1 hr at 37°C.
Reverse Transcription and Polymerase Chain Reaction (RT-PCR) of Nuclear RNA
The reverse transcription was performed as described in Chapter 2 except that 0.5
jig total nuclear RNA was used for each reverse transcription reaction. Five microliters of
the reverse transcription products were used as templates for PCR as described in Chapter
2 for 26 cycles using primers designed based on the sequences of HLA-A and -B exon 2
and intron 2. In this condition, PCR amplification efficiency is still in the linear range.
The primer sequences are 5'-GCT CCC ACT CCA TGA GGT ATT TC-3' and 5'-GAA
AAT GAA ACC GGG TAA AGG CGC-3'. The PCR products were separated by agarose
gel electrophoresis and isolated by using Quick Gel Extraction Kit (QIAGEN Inc.,
Chatsworth, CA). Two nanograms of these PCR products were then used as templates for
a second round PCR of 8 cycles, which amplifies the exon 2 sequences in the linear range
of amplification efficiency. The primer sequences for the second round PCR are 5'- GCT
CCC ACT CCA TGA GGT ATT TC -3' and 5'- CCT CGC TCT GGT TGT AGT AGC -

34
3'. Therefore, these PCR products are generated only from the HLA-A and -B transcripts
containing intron 2. Another PCR was also performed to amplify the HLA-A and -B
transcripts in which intron 2 has been spliced. The primer sequences for this PCR are 5'-
CGC CGT GGA TAG AGC AGG-3' (nucleotides 218-235 in exon 2) and 5’- GCG ATG
TAA TCC TTG CCG-3' (nucleotides 429-446 in exon 3).
Determination of The Relative Quantities of cytoplasmic HLA-A and -B mRNAs Using
RT-PCR/DGGE and Phosphor Imaging
The method is the same as that described in details in Chapter 2. Briefly, first-
strand HLA cDNAs were prepared by reverse transcription of 10 |Llg of total cytoplasmic
RNA using the primer (5*-ACA GCT CC(A,G) (A,G)TG A (C,T)C ACA-3’) which is
specific and complementary only to the nucleotide sequences of exon 5 of all class I HLA-
A and -B genes, but not to those of HLA-C genes. After inactivation of reverse
transcriptase by heating at 99°C for 5 min, the HLA-A and -B cDNAs were used for
quantitative RT-PCR to determine the relative amounts of different HLA-A and -B mRNAs
by DGGE and phosphor imaging analysis.
The nucleotide sequences of the primers used for quantitative PCR in amplifying
the coding sequence 218-446 are 5’-CGC CGT GGA TAG AGC AGG-3’ and 5’-GCG
ATG TAA TCC TTG CCG-3’, which are complementary to the conserved antisense and
sense nucleotide sequences in exon 2 and exon 3 of all class I HLA mRNAs, respectively.
The amplified products encompass the coding sequence 218-446. Quantitative PCR was
performed for 18 cycles. One primer was end-labeled with [y-32P]ATP, and the HLA-A
and -B cDNA prepared from cytoplasmic RNA was used as templates.
Denaturing Gradient Gel Electrophoresis ÍDGGE1
DGGE was performed in 1 mm thick 6% polyacrylamide (acrylamide:
bisacrylamide = 19:1) gel using D-GENEâ„¢ Denaturing Gradient Gel Electrophoresis

35
System (Bio-Rad Laboratories, Hercules, CA). The polyacrylamide gel contained a
linearly increasing denaturant gradient from 40% to 60%. The 100% denaturant contains 7
M urea and 40% (w/v) deionized formamide. Electrophoresis was performed at 60°C, 165
V for 1.5 to 3.5 hours in 40 mM Tris-acetate, pH 8.0, containing 1 mM EDTA (TAE).
After electrophoresis, the gels were dried for autoradiography and phosphor imaging
analysis. PCR product of each HLA-A or -B mRNA in DGGE gel was identified by using
PCR products prepared from the plasmids containing cloned HLA-cDNAs of known
specificity.
IEF-PAGE and Immunoblotting for Measuring The Relative Quantities of HLA-A and -B
Antigens in LCLs.
One million EBV-transformed lymphoblastoid cells were solubilized in 2 ml Triton
X-l 14 (TX-114) (Sigma, St. Louis, MO, USA) containing buffer at 4°C. After phase
separation of TX-114 detergent at 37°C, the extracted membrane proteins in TX-114
detergent phase were treated with 300 (ll of neuraminidase (2.5 U/ml, Type X; Sigma) at
37°C for 6 hours under constant mixing in a Thermomixer 5436 (Eppendorf, Hamberg,
Germany) to avoid phase separation. After neuraminidase digestion the detergent phase
was collected and diluted with an equal volume of IEF buffer for IEF-PAGE. After IEF-
PAGE, the IEF gels were washed and proteins in the gels were electrophoretically
transferred to Immobilon membrane (Millipore, Bedford, MA, USA) at 40 volts for 45
minutes. Thereafter, the Western blots were blocked with 5% nonfat milk and incubated
sequentially with 171.4 anti-HLA heavy-chain mAb and alkaline phosphatase conjugate of
rabbit anti-mouse IgG antibody. The detailed procedures were reported previously (Kao
and Riley, 1993).
Immunoprecipitation of Pulse-chase Radiolabeled HLA Antigens from LCLs
EBV-transformed human lymphoblastoid cell lines (DC, 9001,9027, 9028, 9067,
9068, 9075) were cultured in RPMI-1640 medium (GIBCO BRL Life Technologies,

36
Grand Island, NY) containing 10% newborn calf serum (GIBCO BRL), 1% antibiotic-
antimycotic solution (Sigma Co., St. Louis, MO), and 0.1 % gentamycin (Sigma). Fifteen
million lymphoblastoid cells at log phase were harvested and washed twice with 10 ml
PBS. The cells were resuspended in 3 ml methionine-free RPMI-1640 with 10%
dialyzed FCS. The cell suspension was then incubated with 300 pCi bS- methionine
(Amersham Life Science, Inc., Arlington Heights, IL) at 37°C for 2 hours. Cells were
harvested, washed twice with ice-cold PBS, and suspended in 3 ml regular RPMI-1640
with 10% FCS. Three million of these cells were chased with 1 rnM unlabeled methionine
at 37°C for 0 or 18 hours. The cells were collected and washed twice with ice-cold PBS.
These cells were then solubilized with 3 ml TX-114 containing solubilization buffer on ice
for 15 min. After centrifugation at 10,000g for 10 min at 4°C , the supernatant was
collected and freezed at -70°C until use.
For immunoprecipitation, the harvested supernatant was preincubated with 20 pi of
10% washed staphylococus A (Sigma) suspended in TX-114 containing buffer on ice for
60 min. After removal of staphylococcus A by centrifugation at 10,000g for 5 min at 4“C,
the supernatant was incubated with 15 pg of W6/32 anti-HLA monoclonal antibody at 4°C
overnight. Thereafter, the immune complexes were precipitated by mixing with 30 pi of
10% staphylococcus A and incubation at 4°C for 2 hr. After centrifugation at 10,000g for
5 min at 4°C, the staphylococcus A pellet was washed sequentially with PBS containing
0.25 M NaCl and 0.1% NP-40, and PBS containing 0.1% NP-40. The washed
staphylococcus A pellet was resuspended in 100 pi of 12.5 units/ml type X neuraminidase
at pH 6.0 and 37°C for 6 hr. After centrifugation at 10,000g for 10 minutes, the HLA
antigens were eluted by resuspending the staphylococcus A pellet in 40 pi of lx IEF
sample buffer with 2-mercaptoethanol and incubation at room temperature for 10 min.
After centrifugation at 10,000g for 5 min, the supernatant was harvested and used for IEF-
PAGE which is followed by phosphor imaging and autoradiography.

37
Treatment of LCLs with 5.6-dichloro-l-beta-D-ribofuranosvlbenzimidazole (DRB)
Five million of EBV-transformed lymphoblastoid cells were treated with 25 pg/ml
DRB in RPMI 1640 complemented with 5% FCS for 0 or 23 hours. Total cytoplasmic
RNA was extracted and 2 |lg of the RNA was used for reverse transcription as described
above in a total volume of 30 jil. The relative quantities of HLA-A and -B mRNAs were
determined by quantitative PCR/DGGE and phosphor imaging as described above.
Nuclear run-on
Ten million nuclei of LCLs were incubated for 30 min at 26°C in 250 pi of a buffer
containing 83 mM (NH4)2S04, 87 mM Tris-HCl (pH 7.9), 4 mM MgCl2, 4 mM MnCl2,
24 mM NaCl, 0.2 mM EDTA, 3 mM PMSF, 0.9 mM DTT, 0.75 mM each NTP, 10 mM
creatine phosphate, 0.15 mg/ml creatine phosphokinase and 20% glycerol. The reaction
was stopped by adding 50 units of DNase I and incubating for another 2 min at 26°C.
Then the denaturing buffer containing guanidinium thiocyanate to be used in RNA
preparation was immediately added into the mixture, and the nuclear RNA was extracted as
described above.
Autoradiographv. phosphor imaging and densitometry
For autoradiography, the gels were exposed to Fuji Medical X-ray film (Fuji Photo
Film Co., Ltd., Japan) for 3 hr (DGGE) or to Kodak Biomax MR film (Kodak Scientific
Imaging Systems, Rochester, NY) for 48 hr (IEF-PAGE) at -70°C. For phosphor
imaging, the DGGE gels were exposed to a Phosphorscreen (Molecular Dynamics, Inc.,
Sunnyvale, CA) for 3 hours at room temperature. The radioactivity of each specific DNA
band was quantified using ImageQuant software (Molecular Dynamics, Inc., Sunnyvale,
CA). For quantitation of HLA protein by densitometry, immunoblots or X-ray films were
scanned with a 600 dpi Microtek grayscale scanner ( Microtek, Inc., Torrance, CA) and
analyzed by Collage 3.0 software (Fotodyne Inc., New Berlin, WI).

38
Results
Degradation of Different HLA-A and -B Antigens in Cells
Because the steady state protein levels are determined by rates of degradation and
synthesis, we first studied whether different HLA-A and -B antigens are proportionally
degraded, after synthesis using pulse-chase experiments in five different lymphoblastoid
cell lines. The HLA proteins in cells were pulse-labeled with 35S-methionine for 2 hours
and chased with excess amount of cold methionine for 18 hours. The HLA proteins were
immunoprecipitated with W6/32 monoclonal antibody, which recognizes the native form of
class I HLA antigens. After neuraminidase digestion, different HLA-A and -B proteins
were separated by IEF gel electrophoresis. The relative quantities of each 3;,S-labeled
HLA-A and -B protein was measured by autoradiography and densitometry. The results of
this study in these five cell lines with homozygous HLA-A and -B antigens show that the
relative quantities of 35S-methionine labeled HLA-A and -B proteins remain similar after 18
hr chase with cold methionine (Figure 8). The differences of relative amounts of HLA-A
and -B antigens before and after cold chase were within the experimental variation, and
were not significant. Thus, this finding indicated that different specific HLA-A and -B
proteins have similar stabilities and are degraded proportionally.
The Relative Quantities of Different HLA-A and -B Proteins Generally Are Proportionally
Correlated with That of Their mRNAs.
Because different HLA-A and -B proteins have similar degradation rates in these
studied cell lines, we then determined whether the relative quantities of different HLA-A
and -B proteins are correlated with those of their respective mRNAs. The relative
quantities of different HLA-A and -B proteins were measured by IEF gel electrophoresis,
immunoblotting and densitometric analysis (Kao and Riley 1993). The relative quantities
of their mRNAs were determined by RT-PCR/DGGE and phosphor imaging (Liu and Kao
1997). The results shown in Table 2 indicate that the relative quantities of different HLA-A

39
9001
9027 9028
9067 9068
0 18
A2-
p2m-
B27~
[32m-
B60-
B61 “
A24-
A2 -
p2m-
B35-
B60 B61
LCL
Figure 8 Turnover of 35S-methionine-labeled HLA-A and -B proteins in lymphoblastoid
cell lines (LCLs). (A) Autoradiographs of 1D-IEF gel. EBV-transformed lymphoblastoid
cell were pulse-labeled with [35S]methionine for 2 hours and chased with cold methionine
for 0 hour (0) or 18 hours (18). The immunoprecipitated FILA proteins were separated by
IEF gel electrophoresis. (B) The relative quantities of [”S] methionine-labeled HLA-A and
-B proteins before and after 18-hour cold methionine chase. The quantities of
[35S] methionine-labeled HLA-A and -B proteins were determined by scanning
densitometry .Each bar represents the mean value of two experiments. The variation
between these two experiments is less than 15%.

40
Table 2 Relative quantities of HLA proteins and mRNAs in ten different lymphoblastoid
cell lines (LCLs)
LCL
Phenotype
Relative Quantity of Protein^
(%) (Mean±SD) (n)
Relative Quantity of mRNAlJ[ (%)
(Mean+SD) (n)
9005
A3
36 ±6 (5)*
35 + 5 (4)*
B27
64 ± 6 (5)
65 + 5 (4)
9027
A29
61 ± 5 (9)
63+4 (4)
B44
39 ± 5 (9)
37 + 4 (4)
9067
A2
62 + 6 (6)
63 + 5 (4)
B27
38 ±6 (6)
37 + 5 (4)
9068
A2
64 + 3 (4)
60 + 2 (4)
B35
36 + 3 (4)
40 + 2 (4)
SH
A2
28 + 7 (4)
48 + 3 (2)
A3
20 + 6 (4)
13 + 1 (2)
B7+B44§
52+ 10(4)
B7 27+ 1 (2)
B44 13 + 2(2)
CG
A2-var
22 + 4 (4)
41 ± 1 (2)
A3
15 + 7 (4)
15+ 1 (2)
B7
47+7 (4)
28 ± 1 (2)
B45
16 + 4 (4)
15 + 1 (2)
9075
A24
63 + 3 (5)
41 ±6 (4)
B60
37 + 3 (5)
59 + 6 (4)
DC
All
25 + 4 (5)
13 + 3 (5)
A24
48+4 (5)
26 + 3 (5)
B35
14 + 4(5)
28 + 3 (5)
B60
14 + 2(5)
31 ±7 (5)
9001
A24
51 ±5 (3)
42 + 6 (4)
B7
49 + 5 (3)
58+6 (4)
9028
A24
67 + 8 (3)
40 + 3 (2)
B60+B61t
33 + 8 (3)
60 + 3 (2)
f: The relative quantities of HLA-A and -B proteins were measured by IEF gel
electrophoresis, immunoblotting and scanning densitometry. The relative quantities of
HLA-A and -B mRNAs were measured by quantitative RT-PCR/DGGE and phosphor
imaging. Relative quantity of HLA-A or -B = (quantity of HLA-A or -B/(quantity of HLA-
A + quantity of HLA-B)) x 100%.
*: Number of independent measurements.
§: HLA-B7 and-B44 proteins can not be separated by IEF-PAGE. They were quantified
together.
t: RT-PCR products of HLA-B60 and B61 mRNAs can not be separated by DGGE. They
were measured together.

41
and -B proteins are proportional to those of their mRNAs in the 9005, 9027, 9067 and
9068 cell lines, since different HLA proteins have similar stability, these results suggest
that in these cell lines different HLA-A and -B mRNAs have similar protein synthesis
rates. However, the relative quantities of HLA-A and -B proteins are not proportionally
correlated with their mRNAs in HLA-A24 positive cell lines (9028, 9075 and DC). It
appears that proteins are expressed in higher quantities relative to their mRNA transcripts in
these cell lines. This phenomenon was also observed in HLA-B7 positive cell lines (SH
and CG) but not in the 9001 cell line, which is homozygous for HLA-A24 and -B7. These
results suggest that both HLA-A24 and -B7 mRNAs may be more efficient in synthesizing
HLA proteins. This possibility is further substantiated by the predominance of HLA-A24
and -B7 protein bands on IEF gel (Figure 9). A relative large number of HLA-A24
positive cell lines were studied in order to substantiate our initial observation.
iy>
r-
r-
o
C-J
co
CO
CD
CD
CD
CD
CD
7*T*'
-assgiy
CO L.'.
to r--
cd o
CD CD
o
o
X r-J
£—3
Figure 9 IEF-immunoblot of HLA-A and -B antigens from nine different lymphoblastoid
cell lines. The lower diagram shows the specificities of these antigens. The relative
amounts of HLA proteins are determined by scanning densitometry.

42
Different HLA-A and -B mRNAs Have Similar Stabilities
Because the steady state of HLA mRNA is regulated by both HLA mRNA
production and degradation, whether different HLA-A and -B mRNAs have the same
stabilities could be a factor in determining their differential quantities. By using DRB to
inhibit mRNA synthesis, we performed HLA mRNA degradation studies in seven
lymphoblastoid cell lines. First we studied the inhibition of HLA mRNA as a function of
different concentrations of DRB (Figure 10A) and found that 25 jlg/ml of DRB can
maximally inhibit HLA mRNA synthesis. We also conducted a time course study (Figure
10B) and found that, in order to detect significant degradation of HLA mRNA, 24-hour
incubation is sufficient. On the basis of these studies, we studied the relative quantities of
HLA-A and -B mRNAs after 23-hour treatment with 25 |ig/ml of DRB. The relative
quantities of HLA-A and -B mRNAs in these cells before and after DRB treatment were
measured by using RT-PCR/DGGE and phosphor imaging. The results summarized in
Figure 11 show that different HLA-A and -B mRNAs are proportionally degraded in five
of the seven studied cell lines. A slight difference between the stabilities of HLA-A and -B
mRNAs was noted in the 9027 and 9067 cell lines. Our results indicated mRNA stability is
not a major factor influencing the differential expression of HLA-A and -B antigens in
majority of cell lines. However, this mechanism is optional in some cell lines.
Pre-mRNA Splicing Is An Important Factor Determining The Quantitative Differential
Expression of HLA-A and -B Antigens
Because different HLA-A and -B mRNAs have similar stabilities in many LCLs, it
is likely that HLA-A and -B mRNAs are differentially produced. The mRNA production
rates are determined by transcription and/or pre-mRNA splicing rates. Our original plan
was to use PCR-based nuclear run-on to determine whether HLA-A and -B genes are
differentially transcribed. Isolated nuclei were incubated with or without NTPs. Then
nuclear RNA was extracted and RT-PCR was performed to amplify the unspliced
transcripts. The difference of the measurements from these two incubations should

43
DRB (¿ig/ml)
O 10 20 50
B44
A29
18S RNA
• •
• •
DRB(25 fig/ml)
No DRB
Time (hr)
0 9 24 48
24 48
B44
*
A29
*«ÉÍÉN* r|
18S RNA
Figure 10 The effect of DRB treatment on HLA mRNA levels. (A) Treatment of 9027
LCL with different concentrations of DRB for 23 hours. After treatment of cells with
different concentrations of DRB, two micrograms of total cytoplasmic RNA were used as
template for Quantitative RT-PCR to amplify HLA-A and -B mRNAs. The RT-PCR
products of HLA-A and -B mRNAs were separated by DGGE and quantified by phosphor
imaging. The dot blot of 18S ribosomal RNA in 0.2 fig of each RNA sample was also
performed to determine whether RNA from same number of cells were used in RT-PCR.
(B) Treatment of 9027 LCL with 25 |ig/|il of DRB for different times. After treatment of
cells with different concentrations of DRB, two micrograms of total cytoplasmic RNA were
used as template for Quantitative RT-PCR to amplify HLA-A and -B mRNAs. The RT-
PCR products of HLA-A and -B mRNAs were separated by DGGE and quantified by
phosphor imaging. The slot blot of 18S ribosomal RNA in 0.2 fig of each RNA sample
was also performed to determine whether RNA from same number of cells were used in
RT-PCR.

44
(A)
9001 9005
0 23 0 23
'
B7- -mm —• B27-i|fc 4«¡í
B60
+ 61-
A24
9028 9068
0 23 0 23
B35 -om -**•“
■ JjjjÉk,
DC
0 23
B35
B60 «Mp.
Ao mm
rv¿- «mp «Pip
A24 üj A29 ,
Al 1- -
9027
0 23
B44 -*mm
M M
9067
0 23
A2-J
(B)
â–  ;4ft:
Figure 11 Turnover of HLA-A and -B mRNAs in LCLs. (A) Phosphor images of DGGE
gels for measuring the relative quantities of HLA-A and -B mRNAs before and after 23
hour DRB treatment. (B) Ratios (mean±SD) of HLA-A to -B mRNAs in different
lymphoblastoid cell lines before and after 23 hr inhibition with 25 (ig/ml of DRB. Each
value represents the mean of two or three separate measurements were performed for each
determination. *: p < 0.05.
represent the newly synthesized transcripts. The results of PCR-based nuclear run-on from
4 cell lines shows that there was only a small increase in the amount of unspliced
transcripts (Figure 12). The difference represents less than 20%, suggesting a relatively
large pre-existing pool of unspliced HLA transcripts. This observation was further
supported by the results from RT-PCR of nuclear RNA, in which the sequences spanning
exon 2 and exon 3 were amplified (Figure 13). Due to this large pre-existing pool, we
were unable to reliably study the differential transcription of FILA genes by using the PCR-
based nuclear run-on approach. The results also suggest that HLA pre-mRNA splicing
could be a rate-limiting step in regulating the differential HLA mRNA production. To
investigate whether the relative quantities of different HLA-A and -B transcripts are
determined by splicing, transcription, or both, we decided to measure the relative amounts

45
Figure 12 PCR-based nuclear run-on in four LCLs. Nuclear run-on reaction with (+) or
without (-) NTPs, the HLA-A and -B nuclear transcripts were used for quantitative RT-
PCR. The PCR primers, 5’- TGG GCG GGT GAG TGC GGG GTC-3’ and 5’-GAA
AAT GAA ACC GGG TAA AGG CGC-3’, correspond to the sequences of HLA gene in
intron 1 and intron 2, respectively. In vitro synthesized Xef-1 mRNA added before RNA
extraction as an exogenous control was also quantified by RT-PCR. M: DNA markers.
(bp) M 9001 9005 9016 9027 9028 9067 9068 DC M (bp)
525 _
500 -
400 _
300 _
200 _
Unspliced
exon 2 exon 3
Spliced ~~~ i i
229 bp
Figure 13 Presence of abundant unspliced FILA transcripts in nuclei. Agarose gel
electrophoresis shows two sizes (229 bp and 490 bp) of RT-PCR products from HLA
nuclear transcripts. The light bands (sightly shorter than 490 bp) are likely the RT-PCR
products of unspliced nuclear HLA transcripts with shorter intron 2. Sequences of the
PCR primers correspond to sequences of exon 2 and 3 of HLA genes.
of HLA-A and -B transcripts before and after splicing in nuclei. The relative quantities of
HLA-A and -B transcripts in cytoplasm and nuclei were determined by RT-PCR/DGGE

46
and phosphor imaging. Three different groups of transcripts were studied (Figure 14). The
first group are the prespliced transcripts with intact intron 2 in nuclei (Group I). The
Total nuclear RNA
(pre-mRNA) spliced
-c
i i::
RT-PCR ^
DNA fragment
(exon 2 + partial intron 2)
RT-PCR
PCRJr
DNA fragment
(Exon 2)
Total cytoplasmic RNA
mRNA
~”l I ~~l
RT-PCR
t
DGGE
DNA fragment DNA fragment
(partial exon 2 + partial exon 3) (partial exon 2 + partial exon 3)
I I I I I I
♦
DGGE
t
DGGE
Figure 14 Experimental design for study of HLA mRNA production.
second group of transcripts are the spliced transcripts without intron 2 in nuclei (Group II).
The third group are the mature mRNA transcripts in cytoplasm (Group III). Because we
were able to separate RT-PCR products generated from exon 2 or exon 2 and exon 3 of
HLA-A and -B transcripts by using DGGE, this approach provided us with a simple way
to study whether pre-mRNA splicing plays any critical role in determining the quantitative
differential expression of HLA-A and -B antigens. To amplify the first groupof HLA-A
and -B transcripts in which intron 2 has not been spliced, we first used a pair of primers
complementary to the 5' end of exon 2 and a sequence in intron 2. The amplified products
were generated from the transcripts containing intron 2. These PCR products were purified
and used as template for second round of PCR to amplify the HLA-A and -B exon 2
sequences, which were separated by DGGE and quantified by phosphor imaging. For

47
amplifying Group II and Group III of HLA-A and -B transcripts, the protocols described in
chapter 2 are used, in which the PCR products only include partial exon 2 and partial exon
3. The results of this study in nine lymphoblastoid cell lines are shown in Figure 15.
Our results show that in cell lines 9027, 9067, the relative quantities of HLA-A and
-B transcripts are the same for all three groups of transcripts. For the 9005 cell line, which
is homozygous for HLA-A3 and -B27, the relative quantities of HLA-A3 transcripts prior
to splicing is greater than that of spliced transcripts in nuclei and cytoplasm. This finding
suggest unequal rates of splicing for HLA-A and -B mRNAs (Figure 15). The same
finding was obtained for all A24-positive cell lines (9001,9028, 9075, and DC). Our
results demonstrated that nuclear splicing of HLA pre-mRNAs could play a major role
influencing the quantitative differential expression of HLA-A and -B antigens.
Discussion
The primary purpose of this study is to determine the roles of gene transcription,
splicing, mRNA turnover and translation in regulation of genetically pre-determined
differential expression of different HLA-A and -B antigens. The results of our studies
show that regulation of the quantitative differential expression of different HLA-A and -B
antigens is detennined by combinations of multiple steps that include HLA gene
transcription, pre-mRNA processing, mRNA turnover and/or mRNA translation. In all of
these steps, gene transcription and pre-mRNA processing appear to play the major roles for
majority of different HLA-A and -B antigens. Turnover and translation of HLA mRNAs
are involved for a few specific HLA-A and -B alleles. Despite the complexity of regulatory
mechanisms for HLA expression, all are directly linked to the coding and noncoding
nucleotide sequences of HLA genes. This finding supports an earlier report that differential
quantitative expression is directly linked to HLA genes and follows Mendelian laws (Kao
and Riley, 1993).

Figure 15 Measurements of the relative quantities of nuclear and cytoplasmic HLA-A and -
B transcripts by using quantitative RT-PCR/DGGE and phosphor imaging in seven
lymphoblastoid cell lines, nu: unspliced nuclear HLA-A and -B transcripts, ns: spliced
nuclear HLA-A and -B transcripts, c: cytoplasmic HLA-A and -B mRNAs. Each value
represents the mean+SD of three separate experiments. *: Two separate experiments for
9075 cell line.

49
9001
mu ns c
A24(%)73+7 36±4 45±6
B7(%) 27±7 64±4 55¿6
9027
nu ns c
B44(%) 43± 1 49±1 47±3
A29(%) 57±1 51 ±1 53±3
9067
nu ns c
A2 (%) 59+15 55±1 54±5
B27(%) 41 ±1 5 45+1 46±5
9075
nu ns c
B60(%)25±1* 60±1* 58±2*
A24(%)75±1* 40±1* 42+2*
9005
mu ns c
A3(%) 51±6 36±4 34±3
B27(%) 49±6 64+4 66+3
9028
+61 (%) 25±16 45±4 55+6
A24(%)75±16 54±4 45+6
DC
nu ns c
A11 -
B35
-B60
A24
A11
B35(%) 22±9
B60(%) 1 9±3
A24(%)33+4
A11 (%)25+8
36±5 30±9
23±3 27±3
25±2 28±4
16 ±1 15±2

50
In our study, we used the validated RT-PCR/DGGE and phosphor imaging to
measure the relative quantities of HLA-A and -B mRNAs (Chapter 2). This approach
allows us to avoid complications of cross-hybridization and the variations in specific
activity of probes that are frequently encountered in northern blot. For measuring the
relative quantities of different specific HLA-A and -B antigens, cytoplasmic mRNAs were
used as templates and the primer complementary to a sequence in exon 5 shared by HLA-A
and -B mRNAs were used to prepare cDNAs. This sequence encodes part of
transmembrane domain of all HLA-A and -B proteins. Therefore, only the relative
quantities of the HLA mRNAs encoding the whole length HLA transmembrane heavy
chains were measured. For measuring the relative amounts of different HLA-A and -B
proteins, the use of TX114 to solubilize cells, which only extracts the transmembrane
proteins (Bordier, 1981), allows us to quantify the relative amounts of intact
transmembrane HLA-A and -B antigens by IEF-PAGE and immunoblotting. The
aforementioned two approaches made it possible for us to determine whether the relative
amounts of different HLA-A and -B antigens are proportionally correlated with those of
their mRNAs. The results shown in Table 2 indicate that, for most of the studied LCLs,
HLA-A and -B protein levels are proportionally correlated with their mRNA levels, except
for those positive with HLA-A24 or -B7. Because different HLA proteins have similar
turnover rates (Figure 8), these results indicated that rates of mRNA production play
important roles in determining HLA protein levels. In addition, the results suggest that
HLA-A24 and -B7 mRNAs are more efficient in protein translation and that differential
translation of mRNAs for certain HLA antigens plays a role in determining HLA
expression.
Next, we studied the role of stability of different HLA-A and -B mRNAs in
influencing the quantitative differential expression of different HLA-A and -B antigens.
This study was accomplished by measuring changes of relative quantities of different HLA-
A and -B mRNAs before and after treatment of cells with DRB, an inhibitor of RNA

51
polymerase II, for 23 hours. The results showed that HLA-A and -B mRNAs are
proportionally degraded in five out of seven cell lines studied. Similar observation was
made previously by other inhibitors using HLA-A and -B transgenes (McCutcheon et ah,
1995). However, our study showed that stability of HLA-A and -B mRNAs in two cell
lines appear to have slightly different turnover rates in three separate experiments. This
finding suggests that varying stability for HLA-A and -B mRNAs could play some role in
determining quantitative differential expression for certain HLA-A and -B antigens. The
molecular basis for the observed different turnover rates is not known and remains to be
investigated.
Because the steady state mRNA levels are determined by both mRNA degradation
and production, and, in most cases, different HLA-A and -B mRNAs in cell lines studied
have similar turnover rates, it is likely that differential production of HLA-A and -B
mRNAs could be a primary determining factor for regulating differential expression of
different HLA-A and -B antigens. We then studied how gene transcription contributes to
the regulation of quantitative differential expression of HLA-A and -B genes. The initial
nuclear run-on study showed that the newly synthesized HLA transcripts contribute only
approximately 20% of the total prespliced HLA transcripts in nuclei (Figure 12). Due to
the low quantity of newly synthesized HLA transcripts, we were unable to reliably
determine the relative rate of transcription for different HLA-A and -B genes in cells. This
finding also indicates that the processing of HLA pre-mRNAs is a critical rate-limiting step
in the production of mature HLA mRNAs.
We then directed our effort to investigate whether differential splicing plays an
important role in determining differential production of mature HLA-A and -B mRNAs.
For this study, we used RT-PCR/DGGE and phosphor imaging to measure the relative
quantities of HLA-A and -B transcripts before and after splicing of intron 2. The
measurements were compared with those of mature cytoplasmic HLA mRNAs. The results
suggested that nuclear HLA transcripts containing intron 2 can be proportionally or

52
differentially spliced, depending on the HLA alleles. Because it is more difficult to
consistently generate sufficient quantities of first-strand HLA cDNA containing more
introns and the amplicon of exon 2 of HLA gene is crucial for quantitation by DGGE, we
limited our study of prespliced mRNA transcripts to those containing intron 2. The results
of this study showed that the relative quantities of spliced mRNAs for various HLA-A or -
B genes in nuclei and cytoplasm are about the same for all cell lines included in our study.
In contrast, the relative quantities of HLA transcripts containing intron 2 for various HLA-
A and -B genes are quite different from those of the spliced HLA-A and -B transcripts in
nuclei and cytoplasm of some cell lines (Figure 15). Thus the results indicated that
differential splicing of HLA transcripts plays a major role in determining differential
quantitative expression of HLA-A and -B genes in cells.
Interestingly, in those cell lines showing differential splicing of HLA-A and -B pre-
mRNAs, the relative quantities of unspliced HLA-A pre-mRNAs in nuclei of all these cells
are higher than those of unspliced HLA-B pre-mRNAs, although the relative quantities of
mature HLA-A mRNAs in most of these cell lines are lower than that of HLA-B mRNAs.
This finding further supports the importance of differential splicing in regulating
quantitative expression of HLA-A and -B genes. However, in cell lines showing
proportional splicing of HLA-A and -B pre-mRNAs, the relative quantities of unspliced
HLA-A pre-mRNAs and mature HLA-A mRNAs are higher than those of unspliced HLA-
B pre-mRNAs and mature HLA-B mRNAs, respectively. These observations coincide
with an earlier report that the basal level transcription of the HLA-A gene tends to be more
efficient than that of the HLA-B gene due to the existence of a second NF-kB binding motif
in the promoter of HLA-A gene (Girdlestone et al. 1993). These results also suggest that
transcription of HLA gene is another major factor determining the quantitative differential
expression of HLA-A and -B antigens. The mechanisms underlying the differential
transcription and/or splicing and their contribution to the quantitative differential expression
of HLA-A and -B antigens remain to be further defined.

CHAPTER 4
IN VITRO TRANSLATION STUDY OF HLA-A24 AND -B60 MRNAS
Introduction
As discussed in Chapter 3, quantitative differential expression of HLA-A and -B
antigens is regulated by a combination of different steps that include gene transcription,
pre-mRNA splicing, mRNA degradation, and translation. For mRNA translation, it
appears that mRNAs for HLA-A24 and -B7 are more efficient in protein synthesis (Table
2). This finding suggests that translation of HLA mRNA could be an additional unique
step in regulating expression of HLA antigen for certain specific alleles. Therefore, it is of
interest to determine whether HLA-A24 mRNA is indeed more efficient in translation. For
my study, I have focused on HLA-A24 protein synthesis because I have consistently found
that HLA-A24 antigens are always more intensely expressed in all the studied HLA-A24
positive cell lines in spite of relatively low levels of mRNA.
Materials and Methods
Lymphoblastoid Cell Lines and RNA Preparation
EBV-transformed lymphoblastoid cell lines (LCLs) were selected from those
described in Chapter 3. These cell lines were maintained in RPMI 1640 medium (Life
Technologies, Grand Island, NY) containing 10% fetal calf serum, 1% antibiotic-
antimycotic solution and 40 jig/ml gentamycin.
53

54
Rapid Amplification of HLA-A And -B cDNA Ends (RACE)
The 5' RACE is performed based on the protocol described by Frohman (1994)
with some modification. Fifty micrograms of total cytoplasmic RNAs prepared from the
selected cell lines were dephosphorylated with 3.5 units of calf intestinal phosphatase (CIP)
(Boehringer Mannheim, Indianapolis, IN) in 50 |ll of a buffer containing 50 mM Tris-HCl,
0.1 mM EDTA, pH 8.5, 1 mM DTT, 1 unit/|il RNasin at 50°C for 1 hour. After digestion
with 50 (ig/ml of proteinase K at 37°C for 30 minutes, the mixture was extracted with
phenol/chloroform and the RNA was precipitated with 1/10 volume of 3 M sodium acetate
and 2.5 volumes of ethanol. Thirty-eight micrograms of the dephosphorylated RNA was
then decapped with 5 units of Tobacco acid pyrophosphatase (Epicentre, Madison, WI) in
50 pi of a buffer containing 50 mM sodium acetate, pH 6.0, 1 mM EDTA, 0.1% (3-
mercaptoethanol, 0.01% Triton X-100, 1 unit/pl of RNasin and 2 mM ATP at 37°C for 1
hour. The RNA was extracted with phenol/chloroform and precipitated with ethanol as
described above. The decapped RNA was then ligated to an RNA oligonucleotide that was
generated by in vitro transcription from plasmid pGbx-1 (kindly provided by Dr. Michael
A. Frohman) and contains 132 nucleotides (Frohman, 1994). The ligation was carried out
with 30 units of T4 RNA ligase (Epicentre, Madison, WI) in 30 (il of a mixture containing
33 mM Tris-HCl, pH 7.8, 66 mM potassium acetate, 10 mM MgCl2, 0.5 mM DTT, 1
unit/ptl RNasin, 0.1 mM ATP, 4 pg of RNA oligonucleotide and 10 pg of decapped RNA
at 17°C for 16 hours. After extraction and precipitation, 6 pg of the ligation products
were then used as templates for reverse transcription in 20 pi of a mixture containing 50
mM Tris-HCl, pH 8.3, 75 mM KC1, 3 mM MgCl2, 1 mM dNTPs, 0.01 M DTT, 0.5 unit
of RNasin, 250 ng antisense-specific primer (5’-ACA GCT CCA(G) A(G)TG AC(T)C
ACA-3’) complementary to nucleotides 960-979 (in exon 5) of HLA-A and -B coding
sequences and 200 units of MMLV reverse transcriptase at 37°C for 60 minutes, 42°C for
30 minutes and 50°C for 10 minutes. After inactivation of the reverse transcriptase, 5 pi of
the RT mixture was directly used as template for PCR in 100 pi of a buffer containing 20

55
mM Tris-HCl, pH 8.0, 2 mM MgCl2, 10 mM KC1, 6 mM (NH4)2S04, 0.1 % Triton X-
100, 10 pg/ml BSA, 0.2 mM dNTPs, 0.5 pM of each primer and 5 units of native Pfu
DNA polymerase (Stratagene) for 35 cycles. Each cycle consisted of 94°C denaturation
for 1 min, 60°C annealing for 1 sec and 72°C extension for 1 min. The sense primer
sequence is 5’- CCA AGA CTC ACT GGG TAC TGC-3’ and corresponds to nucleotides
62-82 of the RNA oligonucleotide. The antisense primer sequence is 5’-GCG ATG TAA
TCC TTG CCG-3’ and complementary to the coding sequence at nucleotides 429-446 of
class I HLA mRNA. The PCR products containing 5’ end sequences of HLA mRNA were
directly cloned into a plasmid the pCR-Script Amp cloning vector (Stratagene, La Jolla,
CA) according the manufacturer’s protocol. Sequences of the cloned PCR products were
determined by automated DNA sequencing.
The 3' RACE is also performed based on the protocol described by Frohman
(1994). Briefly, 5 |ig of total cytoplasmic RNA prepared from the 9075 or DC cell line
was reverse transcribed in 30 pi of a buffer containing 50 mM Tris-HCl, pH 8.3, 75 mM
KC1, 3 mM MgCl2, 1 mM dNTPs, 0.01 M DTT, 0.5 unit of RNasin, 2 pg anchor primer
(5’-CCA GTG AGC AGA GTG ACG AGG ACT CGA GCT CAA GCT TTT TTT TTT
TTT TTT T-3’) and 200 units of M-MLV reverse transcriptase at 37°C for 60 minutes,
42°C for 30 minutes and 50°C for 10 minutes. After inactivation of the reverse
transcriptase, 5 pi of the RT mixture was directly used as template for polymerase chain
reaction (PCR) in 100 pi of a buffer containing containing 20 mM Tris-HCl, pH 8.0, 2
mM MgCl2, 10 mM KC1, 6 mM (NH4)2S04, 0.1% Triton X-100, 10 pg/ml BSA, 0.2 mM
dNTPs, 0.5 pM of each primer and 5 units of native Pfu DNA polymerase (Stratagene, La
Jolla, CA) for 35 cycles. Each cycle consisted of 94°C denaturation for 1 min, 60°C
annealing for 1 sec and 72°C extension for 4 min. The PCR primer sequences are 5’-CGC
CGT GGA TAG AGC AGG-3’ (sense) and 5’-CCA GTG AGC AGA GTG ACG-3’
(antisense). The sense primer corresponds to the coding sequence 218-235 of class I HLA
mRNA, and the antisense primer corresponds to the 5’ end of anchor primer. The PCR

56
products were then used as template for the nested PCR in which each cycle consisted of
94°C denaturation for 1 min, 60°C annealing for 1 sec and 72°C extension for 2 min. The
primer sequences for the nested PCR are 5’- GCT GGC CTG GTT CTC CTT GG-3’
(sense, corresponding to nucleotides 937-956 of HLA-A24 coding sequence) or 5’- GCT
GTG GTG GTG CCT TCT GG-3’ (sense, corresponding to nucleotides 808-827 of HLA-
B60 coding sequence), and 5’- GAG GAC TCG AGC TCA AGC-3’ (antisense,
corresponding to a sequence in anchor primer). The products of the nested PCR were
directly cloned into the pCR-Script Amp cloning vector (Stratagene, La Jolla, CA)
according the manufacturer’s protocol. The 3'-end sequence was determined by automated
DNA sequencing.
Cloning of Full-length HLA-A24 and -B60 cDNAs By PCR
For cloning the whole length HLA cDNA, a PCR technique based on splicing by
overlap extension (SOE) (Horton et al., 1989) was used. The 5’ fragment of HLA cDNA
was amplified from plasmid by using PCR in which a T7 promoter was incorporated into
the 5’ end for use in the subsequent synthesis of HLA transcripts. The 3’ end sequence
and a coding sequence were prepared also amplified from plasmids by using PCR, and the
PCR products of these two fragments were mixed and used as templates for SOE PCR in
which these two fragments with overlap sequences were jointed together to form the 3’
fragment. Pfu DNA polymerase (Stratagene, La Jolla, CA) was used in PCR to reduce the
possibility of misincorporation mutations in the PCR products. Standard PCR conditions
were used for the amplification of template DNA fragments to be used in the subsequent
SOE reactions (30 cycles of 1 min at 94°C, 30 sec at 60°C, and 2 min at 72°C following the
final cycle, an additional 16-min incubation at 72°C). The PCR products corresponding to
the 3’ end HLA cDNA fragments and overlapping with the 5’ end HLA cDNA fragments
were purified by preparative agarose gel electrophoresis. The full-length HLA cDNAs
were generated by another round of SOE PCR in which the 5' fragment and 3' fragment

57
were mixed and used as templates. The final PCR products contained a T7 promoter, the
whole length HLA cDNA sequence and a poly(A) tail followed by a Hind III restriction site
and an anchor sequence. The anchor sequence was removed by digestion of the PCR
products with Hind III (Boehringer Mannheim, Indianapolis, IN). The whole length HLA
heavy chain cDNA was then generated. The different fragments of HLA-cDNA used for
SOE-PCR are shown in Figure 17.
Synthesis of Capped HLA-A24 and -B60 mRNAs by In Vitro Transcription
Five hundred nanograms of whole length HLA cDNA fragments generated as
described above were used as templates for in vitro transcription in a volume of 20 pi at
37“C for 3 hours using T7 RNA polymerase according to the manufacturer’s protocol
(mMachinemMessageâ„¢ In Vitro Transcription Kits) (Ambion Inc., Austin, TX) to
synthesize capped HLA mRNA. After 3 hours incubation, 7.5 units RNase-free DNase I
was added and incubated at 37°C for 60 minutes to degrade the template DNA. The in vitro
synthesized RNA transcripts were recovered with LiCl precipitation and further cleaned
using an RNeasy spin column (QIAGEN Inc., Chatsworth, CA). The concentrations of
the synthesized RNA were measured by absorbance at 260 nm.
Synthesis of HLA-A24 and -B60 Proteins by In Vitro Translation
After heating to 67°C for 10 min, 25 ng/pl of HLA-A or -B mRNAs transcribed in
vitro were translated at 30°C for 2 hours in a 25 pi reaction mixture containing 17.5 pi of
nuclease-treated rabbit reticulocyte lysate (Promega, Madison, WI), 20 units of RNasin,
20 pM amino acids minus methionine, and 20 pCi [35S]methionine (Amersham Life
Science, Inc., Arlington Heights, IL). Five microliters of each translation reaction mixture
were analyzed by conventional SDS-PAGE (10% acrylamide) followed by fixation and
autoradiography or phosphor imaging of the dried gel. The translation products were also
analyzed by SDS-PAGE followed by immunoblotting with 171.4 anti-HLA-A and -B

58
heavy chain (He) monoclonal antibody (mAb) (Kao et ah, 1990) and autoradiography to
confirm that they are HLA heavy chains.
Autoradiography and Phosphor Imaging
For autoradiography, the SDS-PAGE gels were exposed to Kodak Biomax MR
film (Kodak Scientific Imaging Systems, Rochester, NY) with an intensifying screen for
24 hr at -70°C. For phosphor imaging, the gels were exposed to a Phosphorscreen
(Molecular Dynamics, Inc., Sunnyvale, CA) for 48 hours at room temperature. The
radioactivity of each specific protein band was quantified using ImageQuant software
(Molecular Dynamics, Inc., Sunnyvale, CA).
Results
Cloning of HLA-A24 and -B60 cDNA Ends bv RACF PCR
Although coding sequences for many class I HLA genes have been documented
(Mason and Parham 1998), the non-coding sequences at 5’ end or 3’ end of class I HLA
mRNAs are available only for a few HLA genes, not including HLA-A24 or -B60
(Srivastava et ah, 1985). In order to obtain the full-length HLA-A24 and -B60 cDNAs, we
first obtained the 5' and 3' end sequences of HLA-A24 and -B60 cDNAs by RACE PCR.
The RACE protocol we used allowed us to amplify only the 5' end with intact 5’-UTR
(Frohman 1994). The cloned 5'-UTR sequences of HLA-A24 and -B60 are shown in
Table 3. After comparing the 5'-UTRs of the cloned HLA-A24 and -B60 mRNAs, we
found two types of 5’-UTRs for HLA-A24 mRNAs. One has 40 nucleotides and the other
has 22 nucleotides (Table 3). The cloned 5'-UTR sequence of HLA-B60 only consists of
21 nucleotides. So far, the long 5’-UTR was not found in 5’-end clones of HLA-A2,-B7
and -B35 mRNAs and may be unique for HLA-A24. After comparing these sequences
with the published 5'-UTR sequences of HLA-A and -B mRNAs, it was found that the

59
Table 3 5’ end sequences of HLA-A24 and -B60 mRNAs
HLA
5’ end sequence*
A24
(long)
5'ACGC.ACCCACCGGG ACUCAGAUUCUCCCCAGACGCCGAGGA U GGCCGUC A U GGCG-3 ’
A24
5 ’ - AG AUUCUCCCCAGACGCCG AGG A U GGCCGUCA U GGC.G-3 ’
B60
5 ’ -AGAAUCUCCUCAGACGCCGAG AUGCGGGUCACGGCA-3 ’
*Coding sequence is underlined.
short 5'-UTRs of HLA-A24 and -B60 mRNAs are highly similar to those of other HLA-A
and -B mRNAs.
The 3’-UTR sequences of HLA-A24 and -B60 mRNAs were also obtained (Figure
16) There is about 15% difference between the 3’-UTR sequence of HLA-A24 mRNA and
that of HLA-B60 mRNA throughout the 3’ trail of about 430-nucleotides.
Cloning of Full-length HLA-A24 and -B60 heavy chain cDNAs by PCR
Because we were unsuccessful in using PCR to directly generate the full-length
cDNA, the full-length FILA cDNAs were constructed using a PCR technique based on SOE
(Horton et al., 1989). We first cloned part of HLA coding sequences, the 5’ end
sequences and the 3’ end sequences of HLA-A24 (Figure 17A) and -B60 (Figure 17B) into
plasmids. The HLA cDNA fragments with overlap sequences were then amplified from the
plasmids and spliced together by using SOE PCR (Figure 17). A T7 promoter was
incorporated into the 5’ end of each HLA cDNA. Poly (A),7 at the 3’ end was followed by
a Hind III restriction site and an anchor sequence. After digestion of the final PCR
products with Hind III, the whole length HLA-A 24 and -B60 heavy chain cDNAs were
used as templates for in vitro transcription to synthesize capped HLA mRNAs for
translation study.

60
>A2 4
AAAGUGUGAG
ACAGCUGCCU
UGUGUGGGAC
UGAGAGGCAA
GAGUUGUUC:
>B 6 0
--CC
u—
U G
—U—C A
>A2 4
CUGCCCUUCC
CUUUGUGACU
UGAAGAACC:
CUGACUU:UG
UUUCUGCAAA
>B 6 0
—:-C-
—
-C G—U
G-A-C-C
—
>A2 4
GGCACCUGCA
UGUGUCUGUG
UUCAUGUAGG
CAUAAUGUGA
GGAGGUGGGG
> B 6 0
A-
c-
-C-C UA-
“C
A"
>A2 4
AGACCACCCC
ACCCCCAUGU
CCACCAUGAC
CC:UCUUCCC
ACGCUGACCU
>B 6 0
:-G—
G—
UG
—C-G
_U
>A2 4
GUGCUCCCUC
CCCAAUCAUC
UUUCCUGUUG
CAGAGAGGUG
GGGCUGAGGU
>B 6 0
U-U
G
U C
—
: -A-
>A2 4
GUCUCCAUCU
CUGUCUCAAC
UUCAUGGUGC
ACUGAGCUGU
AACUUCUUCC
>B 6 0
--U :
C
A-
>A2 4
UUCCCUAUU:
AAAAUUAGAA
CCUGAGUAUA
AAUUUACUUU
CUCAAAUUCU
>B 6 0
C-G
A— -
U A
GU
AU-
>A2 4
UGCCAUGAGA
GGUUGAUGAG
UUAAUUAAAG
GAGAAGAUUC
CUAAAAUUUG
>B 6 0
U
GA
U
A--UCA
--GG
> A2 4
AGAGACAAAA
UAAAUGGAAC
ACAUGAGAAC
cuuc
>B 6 0
-A GC
. _ .
—
Figure 16 The 3’-UTR sequences for HLA-A24 and -B60 mRNAs. denotes a deletion
introduced to maximize the homology.
In Vitro Translation study of HLA-A24 and -B60 mRNAs
After digestion with Hind III, the HLA-A24 and -B60 cDNA constructs were used
to prepare capped HLA mRNA by in vitro transcription. The same amounts of capped
HLA-A24 and -B60 mRNAs (25 ng/pil) were used for sythesizing HLA-A24 and -B60
proteins by in vitro translation in the rabbit reticulocyte system. The same amounts of
translation mixtures were analyzed by SDS-PAGE, phosphor imaging and
immunoblotting. The results shown in Figure 18 indicate that more HLA-A24 heavy
chains were synthesized from HLA-A24 mRNAs than HLA-B60 heavy chains from HLA
B60 mRNAs. In addition, the long HLA-A24 mRNA is shown to be more efficient than

Figure 17 Cloning of HLA-A24 and -B60 heavy chain cDNAs by PCR. (A) PCR
fragments of HLA-A24 cDNAs. One is with short UTR (HLA-A24), and the other is
with longer UTR (HLA-A24L). Fragment 1 (Frag 1) corresponds to a HLA mRNA
sequence from +251 to +1122 (A in first ATG initiation codon is designated as +1 .)•
Fragment 2 (Frag 2) corresponds to the sequence from +937 to the anchor sequence. 5’
fragment (Frag 5’) represents a T7 promoter plus the sequence from -22 (for FÜLA-A24)
or -40 (for HLA-A24L) to +340. (B) PCR fragments of HLA-B60 cDNAs. Fragment 1
(Frag 1) correponds to a HLA mRNA sequence from +218 to +1122 (A in first ATG
initiation codon is designated as +1.). Fragment 2 (Frag 2) corresponds to the sequence
from +808 to the anchor sequence. 5’ fragment (Frag 5’) represents a T7 promoter plus
the sequence from -22 to +340. M: DNA markers.

62
(A)
(kb)
2.0
1.5
1.0
0.5
Hind III
5’UTR|
3’UTR
3 I
I
Frag 1
h*-
-H
h*i-
b*-
Frag 2
Frag 5’
Frag 3’
-â–ºI
HLA-A24 cDNA
1.0
—1.0
0.5
0.5
(B)
(kb)
2.0
Frag 3’ Frag 5’ HLA-B60
Frag 1 Frag 2 (Frag 1+2) (Frag 5’+3’)
(kb)
-2.0
1.5
—1.5
T7 5’UTR
l I I
H&—
W-
â– i
i-rag i
ki
3’UTR
H Frag 2
Frag 3’
Hind III
l(An) J_
>4
Frag 5’
HLA -B60cDNA

63
(B)
BK A24L A24 B60
#¡•30*
HLA mRNA
Figure 18 In vitro translation study of HLA-A24 and HLA-B60 mRNAs.
(A) Representative immunoblot of a SDS-PAGE gel for newly synthesized heavy chains of
HLA-A24 and -B60. The [35S]methionine-labeled HLA-A24 and -B60 proteins generated
by in vitro translation of long HLA-A24 (A24L), short HLA-A24 (A24) and HLA-B60
(B60) mRNAs were analyzed by SDS-PAGE and immunoblotting. The protein bands on
the blot membrane was quantified by phosphor imaging. BK: control reaction mixture
without addition of HLA mRNAs. HLA: purified HLA heavy chain. Two bands with 44
kD and 40 kD were shown in the purified HLA heavy chain. The 40 kD represent the
degraded HLA. (B) Phosphor image of the immunoblot in (A). (C) The relative quantities
of HLA proteins synthesized by in vitro translation of HLA-A24L, HLA-A24 and HLA-
B60 mRNAs:
Relative quantity of HLA-A24 proteins synthesized by short HLA-A24 mRNAs is
designated as 100%;
Relative quantity of HLA-A24 proteins synthesized by long HLA-A24 mRNAs =
[(phosphor density of A24L)/(phosphor density of A24)] x 100%;
Relative quantities of HLA-B60 proteins synthesized HLA-B60 mRNAs = [(phosphor
density of B60 x 9)/(phosphor density of A24 x 5)] x 100%.
Each value represents the mean of four separate measurements. Because HLA-B60 protein
has fewer methionine residues (5/molecule) than HLA-A24 protein (9/molecule), the
quantity of HLA-B60 protein determined by phosphor imaging was calibrated based on its
number of methionine residues.

64
the short HLA-A24 mRNA in synthesizing HLA-A24 heavy chains. HLA heavy chains
were identified based on molecular weight and immunoblotting with 171.4 anti-HLA-Hc
mAb (Kao et ah, 1990) (Figure 18). The amounts of HLA heavy chains produced by
different mRNAs in four separate experiments were quantified and normalized according to
their methionine contents against HLA heavy chains synthesized from the short HLA-A24
mRNAs. The results shown in Figure 18C indicated that the efficiency of HLA heavy
chain synthesis were 174%, 100% and 59% for long HLA-A24 mRNA, short HLA-A24
mRNA and HLA-B60 mRNA, respectively.
Discussion
The primary goal of this study was to determine whether HLA-A24 mRNA is more
efficient in protein translation as suggested by our earlier quantitative correlation study
between cytoplasmic HLA mRNA and HLA protein expression (Table 2 in Chapter 3). To
accomplish this goal we studied the in vitro protein translation of HLA-A24 and -B60
mRNAs from the 9075 cell line. This cell line was chosen for our study because of the
consistent reverse correlation observed between relative quantities of HLA-A24 and -B60
mRNAs and that of HLA-A24 and -B60 proteins.
Although the gene sequences of class I HLA have been documented (Mason and
Parham 1998) and the regulatory elements of the promoter region have been identified
(Cereb and Yang 1994), there are few reports on the initiation sites of the transcription of
HLA genes. Also, the reported 5’-UTR sequences are often incomplete. In order to obtain
the full-length HLA cDNA for our in vitro protein translation study, the sequence
information of 5’ UTR and 3’-UTR for HLA-A24 and -B60 mRNAs had to be obtained.
By using the RACE technique, we were able to obtain 5’-UTR and 3’-UTR sequences and
to clone the full-length HLA cDNAs. In the 5’ RACE approach, we first dephosphorylated
all the degraded mRNA with CIP to render them inert during the ensuing ligation reaction.

65
Then, the intact capped mRNAs were treated with tobacco acid pyrophosphatase. This
treatment makes them active for the subsequent ligation with an RNA anchor
oligonucleotide (Frohman, 1994). By using this approach, we identified two types of
HLA-A24 mRNA with two different lengths of 5’-UTRs (Table 3). Although we did not
find any HLA-B60 mRNA with long 5’-UTR, this possibility have not been excluded.
Results of the translation study in rabbit reticulocyte lysate system using HLA-A24
and -B60 mRNAs synthesized in vitro indeed demonstrated that HLA-A24 transcripts are
more efficient than HLA-B60 mRNAs in synthesizing HLA proteins. The newly
synthesized HLA heavy chains are identified based on molecular weight and
immunoreactivity to an anti-HLA-heavy chain monoclonal antibody. Although there is
some nonspecific binding of 171.4 mAb to other proteins present in rabbit reticulocyte
lysate, the inclusion of a control mixture of rabbit reticulocyte lysate enabled us to identify
the newly synthesized HLA-heavy chains. We did not observe any nonspecific binding of
171.4 to molecular weight standards. The reasons for the observed high background on
our immunoblot are not clear. To obtain more accurate quantitative results, the newly
synthesized HLA heavy chains were measured by phosphor imaging (Figure 18B). The
results shown in Figure 18C indicated that long HLA-A24 transcript is more efficient than
the short HLA-A24 transcript and that the short HLA-A24 transcripts are about 2 times
more efficient than HLA-B60 transcripts in making HLA heavy chains. Based on our
previous measurements of the relative quantities of HLA-A24 and -B60 mRNAs (41% vs.
59%) in the 9075 cell line, and the protein translation efficiency determined by the present
study, we predict that relative quantities of HLA-A24 and -B60 proteins in the 9075 cell
line will be 54% vs. 46%. This calculation, however, did not take into consideration of a
small percentage of HLA-A24 transcripts that are present in long form, which are about 3-4
times more efficient than HLA-B60 transcripts in protein translation. Thus, the calculated
values are close to the relative quantities of HLA-A24 and -B60 proteins (63% vs. 37%)
observed in the 9075 cell line.

66
Although our results showed that HLA-A24 transcripts are more efficient in protein
translation in the rabbit reticulocyte lysate system, the exact mechanism for this finding is
not clear. When the 5' end sequences of HLA-A24 and -B60 mRNAs are compared, the
following features are noticed: (1) There are two AUG codons, separated by 6 nucleotide
residues at the beginning of coding sequence for HLA-A24 mRNA (Table 1). The
translation may be initiated at either of these two codons (Srivastava et ah, 1985), whereas
only the first AUG is found at the beginning of HLA-B60 mRNA coding sequence. (2)
The 5'-UTR of HLA-B60 mRNA has a one-nucleotide deletion immediately before the first
AUG codon comparing to that of HLA-A24 mRNA. (3) No exact Kozak sequence
GCCA(G)CCAUGG (Kozak, 1984; Kozak, 1986; Kozak, 1987) is found in the 5'-UTR
of either HLA-A24 or HLA-B60. However, the sequence proximal to the second AUG
codon of HLA-A24 mRNA (GCCGTCAUGG) is more similar to the Kozak sequence
than the sequence proximal to the first AUG codon of HLA-B60 codon
(GCCGAGAUGC). It is likely that these differences may contribute to the enhanced
protein translation efficiency by HLA-A24 mRNA. Moreover, there are about 10% and
15% difference between HLA-A and -B in coding sequences and 3’-UTR, respectively.
Because the 3’-UTR could also play some role in regulating mRNA translation (Jacobson
and Peltz, 1996), the possible effect of 3’-UTR on the observed differential translation of
HUA-A24 and -B60 mRNAs could not be excluded.
In this study, we also found that the long HLA-A24 mRNA is more efficient for
protein translation than the short form. This finding indicated that the long 5’-UTR may
enhance the protein translation initiation. The mechanism for the enhanced translation of
long HLA-A24 mRNA is not clear. Because no secondary structures are found within this
long 5’-UTR, it is likely that the longer 5-UTR can accumulate extra 40S ribosomal
subunits, which may account for its translational advantage (Kozak, 1991).
Because the rabbit reticulocyte lysate system had been shown to be efficient for in
vitro protein translation and was commercially available (Pelham and Jackson, 1976;

67
Shields and Blobel, 1978), this system was chosen for our study. However, the rabbit
reticulocyte lysate is a heterologous system, and the results obtained from this system may
not represent the actual situation in human lymphoblastoid cells. At present, the exact
mechanism responsible for the enhanced HLA-A24 protein translation has yet to be further
elucidated. Nevertheless, the results of this study suggested that different protein
translation rates could contribute to genetically predetermined differential quantitative
expression of HLA-A and -B antigens.

CHAPTER 5
SUMMARY AND FUTURE DIRECTION
Earlier studies have shown that different specific HLA-A and -B antigens are
differentially expressed in cells. Their relative quantities are genetically predetermined and
inherited according to Mendelian law (Kao and Riley, 1993). In order to determine the
regulatory mechanisms underlying the observed phenomenon, we first studied the turnover
of HLA proteins in lymphoblastoid cell lines and found that different HUA-A and -B
antigens are proportionally degraded. When the relative quantities of HLA proteins were
correlated with those of HLA mRNAs, it was found that, in most of the studied cell lines,
the relative quantities of different HLA-A and -B proteins are proportional to those of their
respective mRNAs.
In addition, different HLA-A and -B proteins have similar stabilities (Figure 8) and
the levels of different HLA-A and -B proteins are proportional to their mRNA levels in
most lymphoblastoid cell lines. These findings indicate that the availability of functional
HLA mRNAs determines the differential quantitative expression of HLA antigens.
Because the steady-state levels of HLA mRNAs are regulated by mRNA production and
degradation, the involvement of both steps in regulating the differential quantitative
expression of HLA antigens was studied. First, we measured the relative quantities of
different HLA-A and -B mRNAs before and after the cells were treated with DRB, an
inhibitor of RNA polymerase II. The results of this study showed that different HLA-A
and -B mRNAs were proportionally degraded in five out of seven cell lines studied, and
that the stabilities of HLA-A and -B mRNAs in the remaining two cell lines appear to have
slightly different turnover rates. This finding suggests that the varying stability for HLA-A
68

69
and -B mRNAs only plays a minor role in determining differential quantitative expression
for certain HLA-A and -B antigens.
Next, we studied the role of mRNA production. The results of our PCR-based
nuclear run-on study showed that newly synthesized HLA transcripts only account for less
than 20% of total HLA pre-mRNAs. The presence of relatively large amount of pre-
mRNA suggests that pre-mRNA splicing could be a rate-limiting step in regulating HLA
mRNA production. This finding also prevents us from accurately measuring the newly
synthesized HLA transcripts by using a PCR-based nuclear run-on method. We therefore
performed experiments to determine the relative quantities of unspliced HLA-A and -B
transcripts and those of spliced HLA-A and -B transcripts. It was found that different
HLA-A and -B pre-mRNAs in nuclei are not proportional to their mature cytoplasmic
mRNAs in five of seven HLA-phenotyped lymphoblastoid cell lines. The differences are
quite significant for some of the cell lines. These results suggest that the splicing of pre-
mRNA and gene transcription are critical in regulating the genetically predetermined
differential expression of HLA-A and -B antigens in different cell lines.
Although the relative quantities of different HLA-A and -B antigens are proportional
to the relative amounts of their respective mRNAs in most lumphobiastoid cell lines, in cell
lines positive for the HLA-A24 or -B7, the HLA-A24 and -B7 proteins appear to be
overexpressed. This observation suggests that mRNAs for certain HLA antigens may be
more efficient in synthesizing HLA heavy chains. We therefore selected the 9075 cell line,
which is positive for HLA-A24 and -B60, to study whether translation of mRNA plays a
role in influencing the differential quantitative expression of HLA-A and -B antigens. In
vitro translation studies indicated that HLA-A24 and -B60 mRNAs synthesized in vitro
indeed have different translation rates. Our results showed that HLA-A24 mRNA is more
efficient than HLA-B60 mRNA in synthesizing HLA proteins. This observation supported
the hypothesis that differential mRNA translation could play a role in determining the
differential quantitative expression of HLA antigens for certain HLA phenotypes.

70
In summary (Table 4), the results of my study indicate that the quantitative
differential expression of HLA-A and -B antigens is determined by combinations of
multiple steps. These steps include gene transcription, pre-mRNA splicing, mRNA
degradation, and/or mRNA translation depending on specific HLA alleles in different
individuals. Among them, gene transcription and pre-mRNA splicing play the most
prominent roles. For certain specific HLA antigens, i.e. HLA-A24, protein translation also
plays a significant role.
Table 4 Contribution of different controlling steps to the regulation of differential
quantitative expression of different HLA-A and -B antigens in the studied LCLs.
LCL
HLA-A&-B
Phenotypes
Gene
transcription*
Pre-mRNA
splicing
mRNA
turnover
mRNA
translation
protein
turnover
9005
A3, B27
+?
+
-
-
ND
9027
A29, B44
+
-
+
-
-
9067
A2, B27
+
-
+
-
-
9068
A2, B35
+?
ND
-
-
-
SH
A2, A3,
B7, B44,
+?
ND
ND
+
ND
CG
A2-var, A3,
B7, B45
+?
ND
ND
+
ND
9075
A24, B60
+?
+
-
+
ND
DC
All, A24,
B35, B60
+?
+
-
+
ND
9001
A24, B7
+?
+
â– 
+
-
9028
A24, B60,
B61
+?
+
-
+
-
+: plays a role in determining the differential quantitative expression of HLA-A and -B
antigens in this LCL.
does not play a role in determining the differential quantitative expression of HLA-A and
-B antigens in this LCL.
*: Conclusion for this step is inferred from studies of other steps.
ND: not determined.

71
The differential quantitative expression of class IHLA antigens could also be
regulated by other steps, including the association of HLA heavy chain with [32m or
chaperones, the availability of antigenic peptides, and the transportation of the assembled
antigens to the cell surface. Although all of these additional potential regulatory steps have
not been studied, they are not likely to play significant roles in regulating the observed
differential quantitative expression. If these additional steps were important in regulating
the differential expression of HLA antigens, we would not have observed the proportional
correlation between the relative amounts of HLA-A and -B proteins and those of then-
respective HLA-A and -B mRNAs in most cell lines (Table 2).
Although the research works presented in this dissertation have identified the critical
steps for regulating differential quantitative expression of HLA antigens, the exact
molecular mechanisms directly responsible for differential gene transcription, differential
pre-mRNA splicing, and differential protein translation remain to be elucidated. The
sequence differences among different HLA-A and -B genes scattered in both coding and
non-coding regions could be involved in regulating the genetically predetermined
differential quantitative expression of HLA-A and -B antigens. Therefore, it would be of
interest to determine how 5’-UTR, 3’-UTR and/or coding sequences determine the
observed different efficiencies in protein translation by different HLA mRNAs. This study
can be conducted by constructing different HLA-A24-B60 cDNA hybrids and performing
the in vitro translation study. By switching the 5’-UTR of HLA-A24 mRNA to that of
HLA-B60 mRNA, for example, we will be able to learn whether the sequence difference in
their 5’-UTRs plays a certain role in regulating the observed differential translation. To
investigate how HLA-A and -B pre-mRNAs are spliced differentially, northern blot of the
nuclear RNAs with probes derived from different introns could be used to determine
whether introns of different HLA pre-mRNAs are spliced following the same order or not.
It is also important to identify the specific sequence(s) responsible for the observed
differential splicing of HLA-A and -B pre-mRNAs. Further comparative study on genomic

72
structures of HLA-A and -B genes from unrelated individuals will enable us to answer the
questions regarding the underlying mechanisms for differential gene transcription. A
deeper understanding of these different regulatory steps will allow us to further elucidate
the biological and genetical importance of differential quantitative expression of HLA
antigens in determining varying disease susceptibilities such as immune surveillance of
tumor cells and recovery from virus infection in the future.

REFERENCES
Adamashvili, I. M., Fraser, P. A., and McDonald, J. C. (1996). “Association of serum
concentration of soluble class IHLA with HLA allotypes [see comments]”
Transplantation, 61(6), 984-7.
Allen, M., Liu, L., and Gyllensten, U. (1994). “A comprehensive polymerase chain
reaction-oligonucleotide typing system for the HLA class I A locus.” Hum Immunol,
40(1), 25-32.
Anderson, M., Paabo, S., and Nilsson, T. (1985). “Impaired intracellular transport of
class IMHC antigens as a possible means for adenoviruses to evade immune surveillance.”
Cell, 43, 215-222.
Balvay, L., Libri, D., and Fiszman, M. Y. (1993). “Pre-mRNA secondary structure and
the regulation of splicing.” Bioessays, 15(3), 165-9.
Bednarek, M. A., Engl, S. A., Gammon, M. C., Lindquist, J. A., Porter, G.,
Williamson, A. R., and Zweerink, H. J. (1991). “Soluble HLA-A2.1 restricted peptides
that are recognized by influenza virus specific cytotoxic T lymphocytes.” J Immunol
Methods, 139(1), 41-7.
Beelman, C. A., and Parker, R. (1995). “Degradation of mRNA in eukaryotes.” Cell,
81(2), 179-83.
Benham, A. M., and Neefjes, J. J. (1997). “Proteasome activity limits the assembly of
MHC class I molecules after IFN-gamma stimulation.” J Immunol, 159(12), 5896-904.
Bernstein, S. I., and Hodges, D. (1997). “Constitutive and alternative mRNA splicing.”
mRNA Metabolism & Post-transcriptional Gene Regulation, J. B. Harford and D. R.
Morris, eds., Wiley-Liss, Inc., New York, NY, 43-60.
Bhasker, C. R., Burgiel, G., Neupert, B., Emery-Goodman, A., Kuhn, L. C., and May,
B. K. (1993). “The putative iron-responsive element in the human erythroid 5-
aminolevulinate synthase mRNA mediates translational control.” J Biol Chem, 268(17),
12699-705.
Bidwell, J. (1994). “Advances in DNA-based HLA-typing methods.” Immunol Today,
15(7), 303-7.
Bishara, A., Nelken, D., and Brautbar, C. (1988). “Differential expression of HLA class-I
antigens on B and T lymphocytes obtained from human lymphoid tissues.”
Immunobiology, 177(1), 76-81.
Bjorkman, P. J., and Parham, P. (1990). “Structure, function, and diversity of class I
major histocompatibility complex molecules.” Anna Rev Biochem, 59, 253-288.
73

74
Bjorkman, P. J., Saper, M. A., Samraoui, B., Bennett, W. S., Strominger, J. L., and
Wiley, D. C. (1987). “The foreign antigen binding site and T cell recognition regions of
class I histocompatibility antigens.” Nature, 329, 512.
Blanar, M. A., Baldwin, A. S., Flavell, R. A., and Sharp, P. A. (1989). “A gamma-
interferon-induced factor that binds the interferon response sequence of the MHC class I
gene H-2Kb.” EMBO J, 8, 1139.
Bodmer, J. G., Marsh, S. G., Albert, E. D., Bodmer, W. F., Bontrop, R. E., Charron,
D., Dupont, B., Erlich, H. A., Fauchet, R., Mach, B., Mayr, W. R., Parham, P.,
Sasazuki, T., Schreuder, G. M., Strominger, J. L., Svejgaard, A., and Terasaki, P. I.
(1997). “Nomenclature for factors of the FILA system, 1996.” Tissue Antigens, 49(3 Pt
2), 297-321.
Bodmer, W. F., Browning, M. J., Krausa, P., Rowan, A., Bicknell, D. C., and Bodmer,
J. G. (1993). “Tumor escape from immune response by variation in HLA expression and
other mechanisms.” Ann N Y Acad Sci, 690, 42-9.
Bordier, C. (1981). “Phase separation of integral membrane proteins in Triton X-l 14
solution.” J Biol Chem, 256(4), 1604-7.
Brady, H. A., and Wold, W. S. (1987). “Identification of a novel sequence that governs
both polyadenylation and alternative splicing in region E3 of adenovirus.” Nucleic Acids
Res, 15(22), 9397-416.
Braud, V. M., Allan, D. S., O'Callaghan, C. A., Soderstrom, K., D'Andrea, A., Ogg, G.
S., Lazetic, S., Young, N. T., Bell, J. I., Phillips, J. H., Lanier, L. L., and McMichael,
A. J. (1998). “HLA-E binds to natural killer cell receptors CD94/NKG2A, B and C.”
Nature, 391(6669), 795-799.
Breur-Vriesendorp, B. S., Dekker-Saeys, A. J., and Ivanyi, P. (1987). “Distribution of
HLA-B27 subtypes in patients with ankylosing spondylitis: the disease is associated with a
common determinant of the various B27 molecules.” Ann Rheum Dis, 46(5), 353-6.
Brewerton, D. A., Cafrey, M., Nicholls, A., and James, D. C. (1974). “Proceedings:
Histocompatibility antigen (HL-A 27) and its relation to disease.” Ann Rheum Dis, 33(4),
406-7.
Bukowski, J. F., and Welsh, R. M. (1985a). “Interferon enhances the susceptibility of
virus infected fibroblasts to cytotoxic T cells.” J Exp Med, 161(1), 257-62.
Bukowski, J. F., and Welsh, R. M. (1985b). “Interferon enhances the susceptibility of
virus-infected fibroblasts to cytotoxic T cells.” J Exp Med, 161, 257.
Cabrera, C. V., Lee, J. J., Ellison, J. W., Britten, R. J., and Davidson, E. H. (1984).
“Regulation of cytoplasmic mRNA prevalence in sea urchin embryos. Rates of appearance
and turnover for specific sequences.” J Mol Biol, 174(1), 85-111.
Caponigro, G., and Parker, R. (1996). “Mechanisms and control of mRNA turnover in
Saccharomyces cerevisiae.” Microbiol Rev, 60(1), 233-49.
Carneiro, M., and Schibler, U. (1984). “Accumulation of rare and moderately abundant
mRNAs in mouse L-cells is mainly post-transcriptionally regulated.” J Mol Biol, 178(4),
869-80.

75
Carstens, R. P., McKeehan, W. L., and Garcia-Bianco, M. A. (1998). “An intronic
sequence element mediates both activation and repression of rat fibroblast growth factor
receptor 2 pre-mRNA splicing.” Mol Cell Biol, 18(4), 2205-17.
Cereb, N., and Yang, S. Y. (1994). “The regulatory complex of HLA class I promotors
exhibits locus-specific conservation with limited allelic variation.” J Immunol, 152, 3873.
Charlton, R. K., and Zmijewski, C. M. (1970). “Soluble HL-A7 antigen: localization in
the beta-lipoprotein fraction of human serum.” Science, 170(958), 636-7.
Ciccone, E., Pende, D., Vitale, M., Nanni, L., Di-Donato, C., Bottino, C., Morelli, L.,
Viale, O., Amoroso, A., and Moretta, A. e.-a. (1994). “Self class I molecules protect
normal cells from lysis mediated by autologous natural killer cells.” Ear J Immunol, 24(4),
1003-1006.
Curtis, D., Lehmann, R., and Zamore, P. D. (1995). “Translational regulation in
development.” Cell, 81(2), 171-8.
D'Amato, M., Fiorillo, M. T., Carcassi, C., Mathieu, A., Zuccarelli, A., Bitti, P. P.,
Tosí, R., and Sorrentino, R. (1995). “Relevance of residue 116 of HLA-B27 in
determining susceptibility to ankylosing spondylitis.” Ear J Immunol, 25(11), 3199-201.
Daniel, S., Caillat-Zucman, S., Hammer, J., Bach, J. F., and van Endert, P. M. (1997).
“Absence of functional relevance of human transporter associated with antigen processing
polymorphism for peptide selection.” J Immunol, 159(5), 2350-7.
David-Watine, B., Israel, A., and Kourilsky, P. (1990). “The regulation and expression of
MHC class I genes.” Immunol Today, 11,286-292.
Davidson, W. F., Kress, M., Khoury, G., and Jay, G. (1985). “Comparison of HLA
class I gene sequences: Derivation of locus-specific oligonucleotide probes specific for
HLA-A, HLA-B, and HLA-C genes.” J Biol Chem, 260(25), 13414-13423.
de Villartay, J. P., Rouger, P., Muller, J. Y., and Salmon, C. (1985). “HLA antigens on
peripheral red blood cells: analysis by flow cytofluorometry using monoclonal antibodies.”
Tissue Antigens, 26(1), 12-9.
Devarajan, P., Gilmore-Hebert, M., and Benz, E. J., Jr. (1992). “Differential translation
of the Na,K-ATPase subunit mRNAs.” J Biol Chem, 267(31), 22435-9.
Driggers, P. H., Ennist, D. L., Gleason, S. L., Mak, W., Marks, M. S., Livi, B.-Z.,
Flanagan, J. R., Appella, E., and Ozato, K. (1990). “An interferon g-regulated protein that
binds the interferon-inducible enhancer-element of major histocompatibility complex class I
genes.” Proc Natl Acad Sci USA, 87, 3743-7.
Ehrlich, R., Sharrow, S., Maguire, J. E., and Singer, D. S. (1989). “Expression of a
class I MHC transgene: effects of in vivo a/b interferon treatment.” Immunogenetics, 30,
18.
Elrick, L. L., Humphrey, M. B., Cooper, T. A., and Berget, S. M. (1998). “A short
sequence within two purine-rich enhancers determines 5' splice site specificity.” Mol Cell
Biol, 18(1), 343-52.

76
Ennis, P. D., Zemmour, J., Salter, R. D., and Parham, P. (1990). “Rapid cloning of
HLA-A, B cDNA by using the polymerase chain reaction: frequency and nature of errors
produced in amplification.” Proc Natl Acad Sci USA, 87(7), 2833-7.
Eperon, L. P., Graham, I. R., Griffiths, A. D., and Eperon, I. C. (1988). “Effects of
RNA secondary structure on alternative splicing of pre-mRNA: is folding limited to a
region behind the transcribing RNA polymerase?” Cell, 54(3), 393-401.
Everett, E. T., Kao, K. J., and Scornik, J. C. (1987). “Class I HLA molecules on human
erythrocytes. Quantitation and transfusion effects.” Transplantation, 44(1), 123-9.
Falcone, D., and Andrews, D. W. (1991). “Both the 5' untranslated region and the
sequences surrounding the start site contribute to efficient initiation of translation in vitro.”
Mol Cell Biol, 11(5), 2656-64.
Falk, K., Rotzschke, O., Stevanovic, S., Jung, G., and Rammensee, H. G. (1991).
“Allele-specific motifs revealed by sequencing of self-peptides eluted from MHC
moecules.” Nature, 351,290-296.
Frohman, M. A. (1994). “On beyond classic RACE (rapid amplification of cDNA ends)”
PCR Methods Appl, 4(1), S40-58.
Furdon, P. J., and Kole, R. (1988). “The length of the downstream exon and the
substitution of specific sequences affect pre-mRNA splicing in vitro.” Mol Cell Biol, 8(2),
860-6.
Gallie, D. R. (1991). “The cap and poly(A) tail function synergistically to regulate mRNA
translational efficiency.” Genes Dev, 5(11), 2108-16.
Gallie, D. R., and Tanguay, R. (1994). “Poly(A) binds to initiation factors and increases
cap-dependent translation in vitro.” J Biol Chem, 269(25), 17166-73.
Gambacurta, A., Piro, M. C., and Ascoli, F. (1993). “Differential in vitro translation of
the precursors of bovine pancreatic trypsin inhibitor and its isoinhibitor II is controlled by
the 5'-end region of their mRNAs.” Biochim Biophys Acta, 1174(3), 267-73.
Gao, X., Jakobsen, I. B., and Serjeantson, S. W. (1994). “Characterization of the HLA-A
polymorphism by locus-specific polymerase chain reaction amplification and
oligonucleotide hybridization.” Hum Immunol, 41 (4), 267-79.
Gause, W. C, and Adamovicz, J. (1994). “Use of the PCR to quantitate gene
expression.” PCR Methods Appl., 3, S123.
Gerrard, T. L., Dye, r. D. R., Zoon, K. C., zur-Nedden, D., and Siegel, J. P. (1988).
“Modulation of class I and class II histocompatibility antigens on human T cell lines by
IFN-gamma.” J Immunol, 140(10), 3450-5.
Gilliland, G., Perrin, S., and Bunn, H. F. (1990). “Competitive PCR for quantitation of
mRNA.” PCR Protocols: A Guide to Methods and Applications, M. A. Innis, D. H.
Gelfand, J. J. Sninsky, and T. J. White, eds., Academic Press, San Diego, CA, 60.
Girdlestone, J., Isamat, M., Gewert, D., and Milstein, C. (1993). “Transcriptional
regulation of HLA-A and -B: differential binding of members of the Rel and IRF families
of transcription factors.” Proc Natl Acad Sci USA, 90(24), 11568-72.

77
Girdlestone, J., and Milstein, C. (1988). “Differential expression and interferon response
of HLA class I genes in thymocyte lines and response variants.” Eur J Immunol, 18(1),
139-43.
Gosgusev, J., Teutsch, B., Morin, M. T., Mongiat, F., Hagenau, F., Suskind, G., and
Rabotti, G. F. (1988). “Inhibition of HLA class I antigen and mRNA expression induced
by Rous sarcoma virus in transformed human fibroblasts.” Proc Natl Acad Sci USA, 85,
203.
Grant, E. P., Michalek, M. T., Goldberg, A. L., and Rock, K. L. (1995). “Rate of
antigen degradation by the ubiquitin-proteasome pathway influences MHC class I
presentation.” J Immunol, 155(8), 3750-8.
Gray, N. K., and Hentze, M. W. (1994). “Regulation of protein synthesis by mRNA
structure.” Mol Biol Rep, 19(3), 195-200.
Greig, G. M., Sharp, C. B., Carrel, L., and Willard, H. F. (1993). “Duplicated zinc
finger protein genes on the proximal short arm of the human X chromosome: Isolation,
characterization and X-inactivation studies.” Hum Mol Genet, 2, 1611.
Haga, J. A., She, J. X., and Kao, K. J. (1991). “Biochemical characterization of 39-kDa
class I histocompatibility antigen in plasma. A secretable membrane protein derived from
transmembrane domain deletion.” J Biol Chem, 266(6), 3695-701.
Hakem, R., Le-Bouteiller, P., Barad, M., Trujillo, M., Mercier, P., Wietzerbin, J., and
Lemonnier, F. A. (1989). “IFN-mediated differential regulation of the expression of HLA-
B7 and HLA-A3 class I genes.” J Immunol, 142(1), 297-305.
Hall, F. C., and Bowness, P. (1996). “HLA and disease: from molecular function to
disease association?” HLA and MHC: genes, molecules and function, M. Browning and A.
McMichael, eds., BIOS Scientific Publishers Ltd, Oxford, UK, 353-381.
Hampsey, M. (1998). “Molecular genetics of the RNA polymerase II general
transcriptional machinery.” Microbiol Mol Biol Rev, 62(2), 465-503.
Heinrichs, V., Ryner, L. C., and Baker, B. S. (1998). “Regulation of sex-specific
selection of fruitless 5' splice sites by transformer and transformer-2.” Mol Cell Biol,
18(1), 450-8.
Hess, M. A., and Duncan, R. F. (1994). “RNA/protein interactions in the 5'-untranslated
leader of HSP70 mRNA in Drosophila lysates. Lack of evidence for specific protein
binding.” J Biol Chem, 269(14), 10913-22.
Hill, A., Jugovic, P., York, I., Russ, G., Bennink, J., Yewdell, J., Ploegh, H., and
Johnson, D. (1995). “Herpes simplex virus turns off the TAP to evade host immunity.”
Nature, 375(6530), 411-5.
Hill, A. V. (1998). “The immunogenetics of human infectious diseases [In Process
Citation].” Annu Rev Immunol, 16, 593-617.
Hill, A. V., Allsopp, C. E., Kwiatkowski, D., Anstey, N. M., Greenwood, B. M., and
McMichael, A. J. (1991a). “HLA class I typing by PCR: HLA-B27 and an African B27
subtype [see comments].” Lancet, 337(8742), 640-2.

78
Hill, A. V., Allsopp, C. E., Kwiatkowski, D., Anstey, N. M., Twumasi, P., Rowe, P.
A., Bennett, S., Brewster, D., McMichael, A. J., and Greenwood, B. M. (1991b).
“Common west African HLA antigens are associated with protection from severe malaria
[see comments].” Nature, 352(6336), 595-600.
Hill, A. V., Elvin, J., Willis, A. C, Aidoo, M., Allsopp, C. E., Gotch, F. M., Gao, X.
M., Takiguchi, M., Greenwood, B. M., Townsend, A. R. (1992). “Molecular analysis of
the association of HLA-B53 and resistance to severe malaria [see comments].” Nature,
360(6403), 434-9.
Hodges, D., and Bernstein, S. I. (1994). “Genetic and biochemical analysis of alternative
RNA splicing.” Adv Genet, 31, 207-81.
Honma, S., Tsukada, S., Honda, S., Nakamura, M., Takakuwa, K., Maruhashi, T.,
Kodama, S., Kanazawa, K., Takahashi, T., and Tanaka, K. (1994). “Biological-clinical
significance of selective loss of HLA-class-I allelic product expression in squamous-cell
carcinoma of the uterine cervix.” Int J Cancer, 57(5), 650-5.
Hood, L., Steinmetz, M., and Malissen, B. (1983). “Genes of the major histocompatibility
complex of the mouse.” Anna Rev Immunol, 1, 529-568.
Horton, R. M„ Hunt, H. D„ Ho, S. N„ Pullen, J. K„ and Pease, L. R. (1989).
“Engineering hybrid genes without the use of restriction enzymes: gene splicing by overlap
extension.” Gene, 77(1), 61-8.
Howcroft, T. K., Strebel, K., Martin, M. A., and Singer, D. S. (1993). “Repression of
MHC class I gene promoter activity by two-exon Tat of HIV.” Science, 260(5112), 1320-
2.
Hughes, E. A., Hammond, C., and Cresswell, P. (1997). “Misfolded major
histocompatibility complex class I heavy chains are translocated into the cytoplasm and
degraded by the proteasome.” Proc Natl Acad Sci USA, 94(5), 1896-901.
Iizuka, N., Najita, L., Franzusoff, A., and Sarnow, P. (1994). “Cap-dependent and cap-
independent translation by internal initiation of mRNAs in cell extracts prepared from
Saccharomyces cerevisiae.” Mol Cell Biol, 14(11), 7322-30.
Ito, K., Kashiwagi, K., Watanabe, S., Kameji, T., Hayashi, S., and Igarashi, K. (1990).
“Influence of the 5'-untranslated region of ornithine decarboxylase mRNA and spermidine
on ornithine decarboxylase synthesis.” J Biol Chem, 265(22), 13036-41.
Jacobson, A. (1996). “Poly(A) Metabolism and Translation: The Closed-loop Model.”
Translational Control, J. W. B. Hershey, M. B. Mathews, and N. Sonenberg, eds., Cold
Spring Harbor Laboratory Press, Cold Spring Harbor Laboratory, New York, 451-480.
Jacobson, A., and Peltz, S. W. (1996). “Interrelationships of the pathways of mRNA
decay and translation in eukaryotic cells.” Anna Rev Biochem, 65, 693-739.
Jin, W., Huang, E. S. C., Bi, W., and Cote, G. J. (1998). “Exon sequence is required for
regulated RNA splicing of the human fibroblast growth factor receptor-1 alpha-exon [In
Process Citation].” J Biol Chem, 273(26), 16170-6.
Kanaji, T.„ Okamura, T., Osaki, K., Kuroiwa, M., Shimoda, K., Hamasaki, N., and
Niho, Y. (1998). “A common genetic polymorphism (46 C to T substitution) in the 5'-

79
untranslated region of the coagulation factor XII gene is associated with low translation
efficiency and decrease in plasma factor XII level.” Blood, 91(6), 2010-4.
Kao, K. J. (1987). “Plasma and platelet HLA in normal individuals: Quantitation by
competitive enzyme-linked immunoassay.” Blood, 70, 282.
Kao, K. J. (1989). “Stability of platelet and plasma HLA concentrations in healthy adults
or random-donor platelet concentrates.” Transfusion, 29(4), 328-31.
Kao, K. J., and Riley, W. J. (1993). “Genetic predetermination of quantitative expression
of HLA antigens in platelets and mononuclear leukocytes.” Hum Immunol, 38(4), 343-50.
Kao, K. J., Scornik, J. C., and McQueen, C. F. (1990). “Evaluation of individual
specifities of class I HLA on platelets by a newly developed monoclomal antibody.”
Human Immunology, 27(4), 285-97.
Kao, K. J., Scornik, J. C., Riley, W. J., and McQueen, C. F. (1988). “Association
between HLA phenotype and HLA concentration in plasma or platelets.” Human
Immunology, 21, 115.
Kaufman, D. S., Schoon, R. A., and Leibson, P. J. (1993). “MHC class I expression on
tumor targets inhibits natural killer cell-mediated cytotoxicity without interfering with target
recognition.” J Immunol, 150(4), 1429-1436.
Kieran, M., Blank, V., Logeat, F., Vandekerckhove, J., Lottspeich, F., LeBail, O.,
Urban, M. B., Kourilsky, P., Baeuerle, P. A., and Isreal, A. (1990). “The DNA binding
subunit of NF-kB is identical to factor KBF1 and homologous to the rel oncogene
product.” Cell, 62, 1019.
Koller, B. H., Marrak, P., and Kappler, J. W. (1990). “Normal development of mice
deficient in B2M, MHC class I proteins and CD8+T cells.” Science, 248(4960), 1227-30.
Kozak, M. (1984). “Point mutations close to the AUG initiator codon affect the efficiency
of translation of rat preproinsulin in vivo.” Nature, 308(5956), 241-6.
Kozak, M. (1986). “Point mutations define a sequence flanking the AUG initiator codon
that modulates translation by eukaryotic ribosomes.” Cell, 44(2), 283-92.
Kozak, M. (1987). “At least six nucleotides preceding the AUG initiator codon enhance
translation in mammalian cells.” J Mol Biol, 196(4), 947-50.
Kozak, M. (1991). “Effects of long 5' leader sequences on initiation by eukaryotic
ribosomes in vitro.” Gene Expr, 1(2), 117-25.
Krangel, M. S. (1987). “Two forms of HLA class I molecules in human plasma.” Hum
Immunol, 20(2), 155-65.
Laforet, M., Froelich, N., Parissiadis, A., Bausinger, H., Pfeiffer, B., Tongio, M.M.
(1997). “An intronic mutation responsible for a low level of expression of an HLA-A*24
allele.” Tissue Antigens, 50(4), 340-346.
Laitinen, O., Leirisalo, M., and Skylv, G. (1977). “Relation between HLA-B27 and
clinical features in patients with yersinia arthritis.” Arthritis Rheum, 20(5), 1121-4.

80
Lanier, L. L. (1998). “NK cell receptors.” Anna Rev Immunol, 16, 359-93.
Lawson, T. G., Ray, B. K., Dodds, J. T., Grifo, J. A., Abramson, R. D., Merrick, W.
C., Betsch, D. F., Weith, H. L., and Thach, R. E. (1986). “Influence of 5' proximal
secondary structure on the translational efficiency of eukaryotic mRNAs and on their
interaction with initiation factors.” J Biol Chem, 261(30), 13979-89.
Le Bouteiller, P. (1994). “HLA class I chromosomal region, genes, and products: facts
and questions.” Crit Rev Immunol, 14(2), 89-129.
Leeuwenberg, J. F., van-Damme, J., Jeunhomme, G. M., and W.A., B. (1987).
“Interferon beta 1, an intermediate in the tumor necrosis factor alpha-induced increased
MHC class I expression and an autocrine regulator of the constitutive MHC class I
expression.” / Exp Med, 166(4), 1180-5.
LeHoang, P., Ozdemir, N., Benhamou, A., Tabary, T., Edelson, C., Betuel, H.,
Semiglia, R., and Cohen, J. H. (1992). “HLA-A29.2 subtype associated with birdshot
retinochoroidopathy.” Am J Ophthalmol, 113(1), 33-5.
Li, H., Grenet, J., Valentine, M., Lahti, J. M., and Kidd, V. J. (1995). “Structure and
expression of chicken protein kinase PITSLRE-encoding genes.” Gene, 153(2), 237-42.
Lim, L. P., and Sharp, P. A. (1998). “Alternative splicing of the fibronectin EIIIB exon
depends on specific TGCATG repeats [In Process Citation].” Mol Cell Biol, 18(7), 3900-
6.
Lincoln, A. J., Monczak, Y., Williams, S. C., and Johnson, P. F. (1998). “Inhibition of
CCAAT/enhancer-binding protein alpha and beta translation by upstream open reading
frames.” J Biol Chem, 273(16), 9552-60.
Litwin, V., Gumperz, J., Parham, P., Phillips, J. H., and Lanier, L. L. (1993).
“Specificity of HLA class I antigen recognition by human NK clones: evidence for clonal
heterogeneity, protection by self and non-self alleles, and influence of the target cell type.”
J Exp Med, 178(4), 1321-1336.
Liu, K., and Kao, K. J. (1997). “Measurement of relative quantities of different HLA-A
and -B mRNAs in cells by reverse transcription-polymerase chain reaction and denaturing
gradient gel electrophoresis.” J Immunol Methods, 203(1), 67-75.
Ljunggren, H. G., Sturmhofel, K., Wolpert, E., Hammerling, G. J., and Karre, K.
(1990). “Transfection of beta 2-micro globulin restores IFN-mediated protection from
natural killer cell lysis in YAC-1 lymphoma variants.” J Immunol, 145(1), 380-6.
Lopez-Casillas, F., and Kim, K. H. (1991). “The 5' untranslated regions of acetyl-
coenzyme A carboxylase mRNA provide specific translational control in vitro.” Eur J
Biochem, 201(1), 119-27.
Lopez-Larrea, C., Gonzalez-Roces, S., Pena, M., Dominguez, O., Coto, E., Alvarez, V.,
Moreno, M., Hernandez, O., Burgos-Vargas, R., and Gorodezky, C. (1995).
“Characterization of B27 haplotypes by oligotyping and genomic sequencing in the
Mexican Mestizo population with ankylosing spondylitis: juvenile and adult onset.” Hum
Immunol, 43(3), 174-80.

81
Magor, K. E., Taylor, E. J., Shen, S. Y., Martinez-Naves, E., Vallante, N. M., Wells, R.
S., Gumperz, J. E., Adams, E. J., Little, A. M., Williams, F., Middleton, D., Gao, X.,
McCluskey, J., Parham, P., and Lienert-Weidenbach, K. (1997). “Natural inactivation of
a common HLA allele (A*2402) has occurred on at least three separate occasions.” J
Immunol, 158(11), 5242-5250.
Mantovani, V., Martinelli, G., Bragliani, M., Buzzi, M., Selva, P., Collina, E.,
Farabegoli, P., Rosti, G. A., Bandini, G., Tura, S., and et al. (1995). “Molecular analysis
of HLA genes for the selection of unrelated bone marrow donor.” Bone Marrow
Transplant, 16(3), 329-35.
Mason, P. M., and Parham, P. (1998). “HLA class I region sequences, 1998.” Tissue
Antigens, 51(4 Pt 2), 417-66.
Masucci, M. G., Stam, N. J., Torsteinsdottir, S., eefjes, J. J., Klein, G., and Ploegh, H.
L. (1989). “Allele-specific down-regulation of MHC class I antigens in Burkitt lymphoma
lines.” Cell Immunol, 120(2), 396-400.
Masucci, M. G., Torsteindottir, S., Colombani, J., Brautbar, C., Klein, E., and Klein, G.
(1987). “Down-regulation of class I HLA antigens and of the Epstein-Barr virus-encoded
latent membrane protein in Burkitt lymphoma lines.” Proc Natl Acad Sci USA, 84(13),
4567-71.
McCutcheon, J. A., Gumperz, J., Smith, K. D., Lutz, C. T., and Parham, P. (1995).
“Low HLA-C expression at cell surfaces correlates with increased turnover of heavy chain
mRNA.” J Exp Med, 181, 2085-2095.
Mizuki, N., Inoko, H., Ando, H., Nakamura, S., Kashiwase, K., Akaza, T., Fujino, Y.,
Masuda, K., Takiguchi, M., and Ohno, S. (1993). “Behcet's disease associated with one
of the HLA-B51 subantigens, HLA-B* 5101.” Am J Ophthalmol, 116(4), 406-9.
Mizuki, N., Ohno, S., Tanaka, H., Sugimura, K., Seki, T., Kera, J., Inaba, G., Tsuji,
K., and Inoko, H. (1992). “Association of HLA-B51 and lack of association of class II
alleles with Behcet's disease.” Tissue Antigens, 40(1), 22-30.
Momburg, F., and Hammerling, G. J. (1998). “Generation and TAP-mediated transport of
peptides for major histocompatibility complex class I molecules.” Adv Immunol, 68, 191 -
256.
Monaco, J. J. (1992). “A molecule model of MHC class I restricted antigen processing.”
Immunol Today, 13, 173.
Moore, M. J., and Sharp, P. A. (1993). “Evidence for two active sites in the spliceosome
provided by stereochemistry of pre-mRNA splicing [see comments].” Nature, 365(6444),
364-8.
Mueller-Eckhardt, C., Mueller-Eckhardt, G., Willen-Ohff, H., Horz, A., Kuenzlen, E.,
O'Neill, G. J., and Schendel, D. J. (1985). “Immunogenicity of and immune response to
the human platelet antigen Zwa is strongly associated with HLA-B8 and DR3.” Tissue
Antigens, 26(1), 71-6.
Muller, E. W., Seiser, C., and Garcia-Sanz, J. A. (1997). “Run-on assays.” Immunology
Methods Manual, I. Lefkovits, ed., Academic Press, San Diego, 439-443.

82
Myers, R. M., Fisher, S. G., Lerman, L. S., and Maniatis, T. (1985). “Nearly all single
base substitutions in DNA fragments joined to a GC-clamp can be detected by denaturing
gradient gel electrophoresis.” Nucleic Acids Res, 13(9), 3131-45.
Nelson, K. K., and Green, M. R. (1990). “Mechanism for cryptic splice site activation
during pre-mRNA splicing.” Proc Natl Acad Sci USA, 87(16), 6253-7.
Norbury, C. J., and Fried, M. (1987). “Polyomavirus early region alternative poly(A) site:
3'-end heterogeneity and altered splicing pattern.” J Virol, 61(12), 3754-8.
Oh, S., Fleischhauer, K., and Yang, S. Y. (1993). “Isoelectric focusing subtypes of HLA-
A can be defined by oligonucleotide typing.” Tissue Antigens, 41,135-142.
Ohlen, C., Bejarano, M. T., Gronberg, A., Torsteinsdottir, S., Franksson, L., Ljunggren,
H. G., Klein, E., Klein, G., and Karre, K. (1989). “Studies of sublines selected for loss
of HLA expression from an EBV-transformed lymphoblastoid cell line. Changes in
sensitivity to cytotoxic T cells activated by allostimulation and natural killer cells activated
by IFN or IL-2.” ./ Immunol, 142(9), 3336-41.
Olave, I., Drapkin, R., and Reinberg, D. (1997). “Transcription and Transcriptional
Control: An Overview.” mRNA Metabolism & Post-Transcriptional Gene Regulation, J.
B. Harford and D. R. Morris, eds., Wiley-Liss, Inc., New York.
Orita, M., Iwahana, H., Kanazawa, H., Hayashi, K., and Sekiya, T. (1989). “Detection
of polymorphisms of human DNA by gel electrophoresis as single-strand conformation
polymorphisms.” Proc Natl Acad Sci USA, 86(8), 2766-70.
Pamer, E., and Cresswell, P. (1998). “Mechanisms of MHC class I—restricted antigen
processing [In Process Citation].” Annu Rev Immunol, 16, 323-58.
Parham, P., Adams, E. J., and Arnett, K. L. (1995). “The origins of HLA-A,B,C
polymorphism.” Immunol Rev, 143, 141-80.
Parham, P., Lomen, C. E., Lawlor, D. A., Ways, J. P., Holmes, N., Coppin, H. L.,
Salter, R. D., Wan, A. M., and Ennis, P. D. (1988). “Nature of polymorphism in HLA-A,
-B and -C molecules.” Proc Natl Acad Sci USA, 85(11), 4005-9.
Pelham, H. R., and Jackson, R. J. (1976). “An efficient mRNA-dependent translation
system from reticulocyte lysates.” Eur J Biochem, 67(1), 247-56.
Peltenburg, L. T., Dee, R., and Schrier, P. I. (1993). “Downregulation of HLA class I
expression by c-myc in human melanoma is independent of enhancer A.” Nucleic Acids
Res, 21(5), 1179-85.
Peterson, M. L., Bryman, M. B., Peiter, M., and Cowan, C. (1994). “Exon size affects
competition between splicing and cleavage- polyadenylation in the immunoglobulin mu
gene.” Mol Cell Biol, 14(1), 77-86.
Pinto, I., Na, J. G., Sherman, F., and Hampsey, M. (1992). “cis- and trans-acting
suppressors of a translation initiation defect at the cycl locus of Saccharomyces
cerevisiae.” Genetics, 132(1), 97-112.

83
Ploegh, H. L., Orr, H. T., and Strominger, J. L. (1981). “Major histocmpatibility
antigens: the human (HLA-A,B,C) and murine (H-2K, H-2D) class I molecules.” Cell,
24(2), 287-99.
Powis, S. J., Townsend, A. R., Deverson, E. V., Bastin, J., Butcher, G. W., and
Howard, J. C. (1991). “Restoration of antigen presentation to the mutant cell line RMA-S
by an MHC-linked transporter.” Nature, 354(6354), 528-31.
Prasad, V. K., and Yang, S. Y. (1996). “Allele assignment for HLA-A, -B, and -C genes
to the Tenth International Histocompatibility Workshop cell lines.” Tissue Antigens, 47(6),
538-46.
Prendergast, J. A., Helgason, C. D., and Bleackley, R. C. (1992). “Quantitative
polymerase chain reaction analysis of cytotoxic cell proteinase gene transcripts in T cells.” J
Biol Chem, 267(8), 5090-5.
Rao, S. M., and Howells, R. D. (1993). “cis-acting elements in the 5'-untranslated region
of rat testis proenkephalin mRNA regulate translation of the precursor protein.” J Biol
Chem, 268(29), 22164-9.
Rivera, R., and Scornik, J. C. (1986). “HLA antigens on red cells. Implications for
achieving low HLA antigen content in blood transfusions.” Transfusion, 26(4), 375-81.
Robey, E., and Fowlkes, B. J. (1994). “Selective events in T cell development.” Anna
Rev Immunol, 12, 675-705.
Rood, J. J. v., Leeuwen, A. v., and Santen, M. C. v. (1970). “Anti HL-A2 inhibitor in
normal human serum.” Nature, 226(243), 366-7.
Ross, J. (1995). “mRNA stability in mammalian cells.” Microbiol Rev, 59(3), 423-50.
Ross, J. (1996). “Control of messenger RNA stability in higher eukaryotes.” Trends
Genet, 12(5), 171-5.
Ruiz-Cabello, F., Klein, E., and Garrido, F. (1991). “MHC antigens on human tumors.”
Immunol Lett, 29(3), 181-9.
Sachs, A. B. (1993). “Messenger RNA degradation in eukaryotes.” Cell, 74(3), 413-21.
Sedman, S. A., Gelembiuk, G. W., and Mertz, J. E. (1990). “Translation initiation at a
downstream AUG occurs with increased efficiency when the upstream AUG is located
very close to the 5' cap.” J Virol, 64(1), 453-7.
Shieh, D. C., Gammon, M. C., Zweerink, H. J., and Kao, K. (1996). “Functional
significance of varied quantitative and qualitative expression of HLA-A2.1 antigens in
determining the susceptibility of cells to cytotoxic T lymphocytes.” Hum Immunol, 46(1),
18-26.
Shieh, D. C., and Kao, K. J. (1995). “Proportional amplification of individual HLA-A and
-B antigens during upregulated expression of total class I HLA molecules.” Hum
Immunol, 42(2), 174-80.

84
Shields, D., and Blobel, G. (1978). “Efficient cleavage and segregation of nascent
presecretory proteins in a reticulocyte lysate supplemented with microsomal membranes.” J
Biol Chem, 253(11), 3753-6.
Shimizu, Y., and DeMars, R. (1989). “Production of human cells expressing individual
transferred HLA-A,-B,-C genes using an HLA-A,-B,-C null human cell line.” J Immunol,
142(9), 3320-8.
Solnick, D. (1985). “Alternative splicing caused by RNA secondary structure.” Cell, 43(3
Pt 2), 667-76.
Solnick, D., and Lee, S. I. (1987). “Amount of RNA secondary structure required to
induce an alternative splice.” Mol Cell Biol, 7(9), 3194-8.
Speiser, D. E., Tiercy, J. M., Rufer, N., Grundschober, C., Gratwohl, A., Chapuis, B.,
Helg, C., Loliger, C. C., Siren, M. K., Roosnek, E., and Jeannet, M. (1996). “High
resolution HLA matching associated with decreased mortality after unrelated bone marrow
transplantation.” Blood, 87(10), 4455-62.
Spicer, A. P., Seldin, M. F., and Gendler, S. J. (1995). “ Molecular cloning and
chromosomal localization of the mouse decay-accelerating factor genes. Duplicated genes
encode glycosylphosphatidylinositol-anchored and transmembrane forms.” J Immunol,
155(6), 3079-91.
Srivastava, R., Duceman, B. W., Biro, P. A., Sood, A. K., and Weissman, S. M.
(1985). “Molecular organization of the class I genes of human major histocompatibility
complex.” Immunol Rev, 84, 93-121.
Sterner, D. A., and Berget, S. M. (1993). “In vivo recognition of a vertebrate mini-exon as
an exon-intron-exon unit.” Mol Cell Biol, 13(5), 2677-87.
Strachan, T., Sodoyer, R., Damotte, M., and Jordan, B. R. (1984). “Complete nucleotide
sequence of a functional class I HLA gene, HLA-A3: implications for the evolution of
HLA genes.” EM BO J.
Tanaka, K., Tanahashi, N., Tsurumi, C., Yokota, K. Y., and Shimbara, N. (1997).
“Proteasomes and antigen processing.” Adv Immunol, 64, 1-38.
Tarleton, R. L., Roller, B. H., Latour, A., and Postan, M. (1992). “Susceptibility of beta
2-microglobulin-deficient mice to Trypanosoma crazi infection [see comments].” Nature,
356(6367), 338-40.
Terasaki, P. I., Brnoco, D., Park, M. S., Ozturk, G., and Iwaki, Y. (1978).
“Microdroplet testing for HLA-A, -B, -C, and -D antigens.” American Journal of Clinical
Pathology, 69, 103.
Thach, R. L. (1992). “Cap recap: the involvement of eIF-4L in regulating gene
expression.” Cell, 68(2), 177-180.
Tharun, S., and Parker, R. (1997). “Mechanisms of mRNA Turnover in Eukaryotic
Cells.” mRNA Metabolism & Post-Transcriptional Gene Regulation, J. B. Harford and D.
R. Morris, eds., Wiley-Liss, Inc., New York.

85
Tiercy, J. M., Djavad, N., Rufer, N., Speiser, D. E., Jeannet, M., and Roosnek, E.
(1994). “Oligotyping of HLA-A2, -A3, and -B44 subtypes. Detection of subtype
incompatibilities between patients and their serologically matched unrelated bone marrow
donors.” Hum Immunol, 41(3), 207-15.
Toivanen, P., Toivanen, A., and Brines, R. (1994). “When is an autoimmune disease not
an autoimmune disease?” Immunol Today, 15(12), 556-9.
Versteeg, R., Kruse-Wolters, K. M., Plomp, A. C., van-Leeuwen, A., Stam, N. J.,
Ploegh, H. L., Ruiter, D. J., and Schrier, P. I. (1989a). “Suppression of class 1 human
histocompatibility leukocyte antigen by c-myc is locus specific.” J Exp Med, 170(3), 621-
35.
Versteeg, R., Noordermeer, I. A., Kruse-Wolters, M., Ruiter, D. J., and Schrier, P. I.
(1988). “c-myc down-regulates class I HLA expression in human melanomas.” Embo J,
7(4), 1023-9.
Versteeg, R., Peltenburg, L. T., Plomp, A. C., and Schrier, P. I. (1989b). “High
expression of the c-myc oncogene renders melanoma cells prone to lysis by natural killer
cellsr J Immunol, 143(12), 4331-7.
Walev, I., Kunkel, J., Schwaeble, W., Weise, K., and Falke, D. (1992). “Relationship
between HLA class I surface expression and different cytopathic effects produced ater
herpes simplexvirus infetion in vitro.” Arch Virol, 126, 303-11.
Waring, J. F., Radford, J. E., Burns, L. J., and Ginder, G. D. (1995). “The human
leukocyte antigen A2 interferon-stimulated response element concensus sequence binds a
nuclear factor required fpr constitutive expression.” J Biol Chem, 270(20), 12276-12285.
Watakabe, A., Inoue, K., Sakamoto, H., and Shimura, Y. (1989). “A secondary structure
at the 3' splice site affects the in vitro splicing reaction of mouse immunoglobulin mu chain
pre-mRNAs.” Nucleic Acids Res, 17(20), 8159-69.
Watkins, D. I. (1995). “The evolution of major histocompatibility class I genes in
primates.” Crit Rev Immunol, 15(1), 1-29.
Ways, J. P., Coppin, H. L., and Parham, P. (1985). “The complete promary structure of
HLA-Bw58.” J Biol Chem, 260, 11924-11933.
Wiesner, R. J., and Zak, R. (1991). “Quantitative approaches for studying gene
expression.” Am J Physiol, 260(4 Pt 1), L179-88.
Yang, S. Y. (1989). “Nomenclature for HLA-A and HLA-B alleles detected by one
dimensional isoelectric focusing gel electrophoresis.” Immunobiology of HLA, D. B, ed.,
Springer-verlag, New York, 54.
Yang, S. Y., Milford, E., Hammerling, U., and Dupont, B. (1989). “Description of the
reference panel of B-lymphoblastoid cell lines for factors of the HLA system: the B-cell line
panel designed for the tenth international histocompatibility workshop.” Immunology of
HLA, B. Dupont, ed., Springer-Verlag, New York, 11.
Yano, O., Kanellopoulos, J., Kieran, M., LeBail, O., Isreal, A., and Kourilsky, P.
(1987). “Purification of KBF1, a common factor binding to both H-2 and beta-2
microglobulin enhancers.” EMBO J, 6, 3317.

Yanofsky, C. (1992). “Transcriptional Regulation: Elegance in Design and Discovery.”
Transcriptional Regulation, S. L. McKnight and K. R. Yamamoto, eds., Cold Spring
Harbor Laboratory Press, New York, 1-24.
86
Yoshida, M., Kimura, A., Katsuragi, K., Numano, F., and Sasazuki, T. (1993). “DNA
typing of HLA-B gene in Takayasu's arteritis.” Tissue Antigens, 42(2), 87-90.
Yun, D. F., Laz, T. M., Clements, J. M., and Sherman, F. (1996). “mRNA sequences
influencing translation and the selection of AUG initiator codons in the yeast
Saccharomyces cerevisiae.” Mol Microbiol, 19(6), 1225-39.
Zachow, K- R., and Orr, H. T. (1989). “Regulation of HLA class I transcription in T
cells.” J Immunol, 143(10), 3385-9.
Zijstra, M., Bix, M., and Simistra, N. E. (1990). “B2 - microglobulin deficient mice lack
CD4-8+ cytolytic T cells.” Nature, 344(6268), 742-6.
Zinkernagel, R. M., and Doherty, P. C. (1979). “MHC restricted cytotoxic T cells.
Studies on the biological role of polymorphic major transplantation antigens determine T-
cell restriction specificity function and responsiveness.” Adv. Immunol., 27, 51-177.

BIOGRAPHICAL SKETCH
Kui Liu was born and raised in Liaoning, China, in 1965, the third child of
Xiuzhen Yu and Zhanyu Liu. He attended Shanghai Medical University in 1982, and
graduated in 1987 with a Bachelor of Pharmacology. Then he entered the graduate school
in Chinese Academy of Medical Sciences, and graduated with a Master of Science in
Pharmacology in 1990. In the same year, he married Liying Chen. In August 1993,
several months after they came to the United States, Kui entered the Ph.D. program in
Department of Pathology, Immunology and Laboratory Medicine, University of Florida.
In August 1996, their son, Alan Zonglin Liu, was bom. After receiving his Ph.D. degree,
Kui Liu will pursue a career in academic research.
87

I certify that I have read this study and that in my opinion it conforms to
acceptable standards of scholarly presentation and is fully adequate, in scope and quality,
as a dissertation for the degree of Doctor of Philosophy.
Kuo-Jang Kao, Chair
Professor of Pathology, Immunology and
Laboratory Medicine
I certify that I have read this study and that in my opinion it conforms to
acceptable standards of scholarly presentation and is fully adequate, in scope and quality,
as a dissertation for the degree of Doctor of Philosophy.
Wayi/e T. McCormack
Associate Professor of Pathology,
Immunology and Laboratory Medicine
I certify that I have read this study and that in my opinion it conforms to
acceptable standards of scholarly presentation and is fully adequate, in scope and quality,
as a dissertation for the degree of Doctor of Philosophy.
Professor of Pathology, Immunology and
Laboratory Medicine
I certify that I have read this study and that in my opinion it conforms to
acceptable standards of scholarly presentation and is fully adequate, in scope and quality,
as a dissertation for the degree of Doctor of Philosophy.
Maurice S. Swanson
Associate Professor of Molecular
Genetics and Microbiology
I certify that I have read this study and that in my opinion it conforms to
acceptable standards of scholarly presentation and is fully adequate, in scope and quality,
as a dissertation for the degree of Doctor of Philosophy.
Edward K. Wakeland
Professor of Pathology, Immunology and
Laboratory Medicine

This dissertation was submitted to the Graduate Faculty of the College of
Medicine and to the Graduate School and was accepted as partial fulfillment of the
requirements for the degree of Doctor of Philosophy.




PAGE 1

0(&+$1,606 )25 *(1(7,&$//< 35('(7(50,1(' ',))(5(17,$/ 48$17,7$7,9( (;35(66,21 2) +/$$ $1' % $17,*(16 %\ .XL /LX $ ',66(57$7,21 35(6(17(' 72 7+( *5$'8$7( 6&+22/ 2) 7+( 81,9(56,7< 2) )/45,'$ ,1 3$57,$/ )8/),//0(17 2) 7+( 5(48,5(0(176 )25 7+( '(*5(( 2) '2&725 2) 3+,/2623+< 81,9(56,7< 2) )/25,'$

PAGE 2

$&.12:/('*0(176 ZRXOG OLNH WR H[SUHVV P\ DSSUHFLDWLRQ WR 'U .XR-DQJ .DR &KDLUPDQ RI P\ VXSHUYLVRU\ FRPPLWWHH IRU KLV JXLGDQFH VXSSRUW XQGHUVWDQGLQJ HQFRXUDJHPHQW DQG IULHQGVKLS ZRXOG OLNH WR WKDQN WKH PHPEHUV RI P\ VXSHUYLVRU\ FRPPLWWHH 'UV :D\QH 0F&RUPDFN -XDQ 6FRUQLN 0DXULFH 6ZDQVRQ DQG (GZDUG :DNHODQG IRU WKHLU YHU\ KHOSIXO GLVFXVVLRQV DQG VXJJHVWLRQV ZRXOG OLNH WR WKDQN 0V 6DQGUD 'RQDKXH IRU KHU WHFKQLFDO DVVLVWDQFH ZRXOG DOVR OLNH WR WKDQN 'U 0LFKDHO $ )URKPDQ IRU KLV KHOS LQ WKH 5$&( H[SHULPHQWV JUHDWO\ DSSUHFLDWH WKH XQGHUVWDQGLQJ IURP P\ SDUHQWV WKH ORYH IURP P\ ZLIH DQG P\ VRQ /L\LQJ DQG $ODQ

PAGE 3

7$%/( 2) &217(176 SDJH $&.12:/('*0(176 LL /,67 2) 7$%/(6 Y /,67 2) ),*85(6 YL $%675$&7 YLLL &+$37(56 ,1752'8&7,21 %LRFKHPLVWU\ RI &ODVV +/$ 0ROHFXOHV 2UJDQL]DWLRQ 2I &ODVV +/$ *HQHV 3RO\PRUSKLVP DQG 3KHQRW\SHV RI &ODVV +/$ $QWLJHQV )XQFWLRQ RI &ODVV +/$ $QWLJHQV $VVRFLDWLRQ RI &ODVV +/$ $QWLJHQV ZLWK 'LVHDVHV &RQWUROOLQJ 6WHSV LQ *HQH ([SUHVVLRQ 5HJXODWLRQ RI 4XDQWLWDWLYH &ODVV +/$ *HQH ([SUHVVLRQ )XQFWLRQDO ,PSRUWDQFH RI 4XDQWLWDWLYH ([SUHVVLRQ RI +/$ $QWLJHQV 4XDQWLWDWLYH 'LIIHUHQWLDO ([SUHVVLRQ RI +/$$ DQG % DQWLJHQV 0($685(0(17 2) 5(/$7,9( 48$17,7,(6 2) ',))(5(17 +/$$ $1' % 051$6 ,1 &(//6 %< 5(9(56( 75$16&5,37,21 32/<0(5$6( &+$,1 5($&7,21 $1' '(1$785,1* *5$',(17 *(/ (/(&7523+25(6,6 ,QWURGXFWLRQ 0DWHULDOV DQG 0HWKRGV 5HVXOWV 'LVFXVVLRQ 0(&+$1,606 )25 ',))(5(17,$/ 48$17,7$7,9( (;35(66,21 2) +/$$ $1' % $17,*(16 ,1 /<03+2%/$672,' &(// /,1(6 ,QWURGXFWLRQ 0DWHULDOV DQG 0HWKRGV 5HVXOWV 'LVFXVVLRQ LLL

PAGE 4

,1 9,752 75$16/$7,21 678'< 2) +/$$ $1' % 051$6 ,QWURGXFWLRQ 0DWHULDOV DQG 0HWKRGV 5HVXOWV 'LVFXVVLRQ 6800$5< $1' )8785( ',5(&7,21 5()(5(1&(6 %,2*5$3+,&$/ 6.(7&+ LY

PAGE 5

/,67 2) 7$%/(6 7DEOH SDJH 5HODWLYH TXDQWLWLHV RI +/$$ DQG % P51$V LQ O\PSKREODVWRLG FHOO OLQHV PHDVXUHG E\ 573&5'**( DQG 6, QXFOHDVH SURWHFWLRQ DVVD\ 5HODWLYH TXDQWLWLHV RI +/$ SURWHLQV DQG P51$V LQ WHQ GLIIHUHQW O\PSKREODVWRLG FHOO OLQHV /&/Vf f HQG VHTXHQFHV RI +/$$ DQG % P51$V &RQWULEXWLRQ RI GLIIHUHQW FRQWUROOLQJ VWHSV WR WKH UHJXODWLRQ RI GLIIHUHQWLDO TXDQWLWDWLYH H[SUHVVLRQ RI GLIIHUHQW +/$$ DQG % DQWLJHQV LQ WKH VWXGLHG /&/V Y

PAGE 6

/,67 2) ),*85(6 )LJXUH SDJH *HQHUDO RUJDQL]DWLRQ IRU FODVV +/$ JHQHV 2SWLPDO F\FOHV IRU TXDQWLWDWLYH 573&5 +/$ 573&5 SURGXFWV PHDVXUHG DV D IXQFWLRQ RI GLIIHUHQW DPRXQWV RI WRWDO F\WRSODVPLF 51$ ,GHQWLILFDWLRQ RI 573&5 SURGXFWV RI GLIIHUHQW +/$$ DQG % P51$V E\ '**( '**( VHSDUDWLRQ RI 573&5 SURGXFWV RI +/$$ DQG % P51$V LVRODWHG IURP /&/V FDUU\LQJ KHWHUR]\JRXV +/$$ DQG % DQWLJHQV 9DOLGDWLRQ RI XVLQJ 573&5 DQG '**( IRU PHDVXULQJ UHODWLYH TXDQWLWLHV RI GLIIHUHQW +/$ P51$V 4XDQWLWDWLRQ RI +/$$ DQG % P51$V LQ O\PSKREODVWRLG FHOO OLQH XVLQJ 6, QXFOHDVH SURWHFWLRQ DVVD\ 7XUQRYHU RI 6PHWKLRQLQHODEHOHG +/$$ DQG % SURWHLQV LQ O\PSKREODVWRLG FHOO OLQHV /&/Vf ,()LPPXQREORW RI +/$$ DQG % DQWLJHQV IURP QLQH GLIIHUHQW O\PSKREODVWRLG FHOO OLQHV 7KH HIIHFW RI '5% WUHDWPHQW RQ +/$ P51$ OHYHOV 7XUQRYHU RI +/$$ DQG % P51$V LQ /&/V 3&5EDVHG QXFOHDU UXQRQ LQ IRXU /&/V 3UHVHQFH RI DEXQGDQW XQVSOLFHG +/$ WUDQVFULSWV LQ QXFOHL ([SHULPHQWDO GHVLJQ IRU VWXG\ RI +/$ P51$ SURGXFWLRQ 0HDVXUHPHQWV RI WKH UHODWLYH TXDQWLWLHV RI QXFOHDU DQG F\WRSODVPLF +/$$ DQG % WUDQVFULSWV E\ XVLQJ TXDQWLWDWLYH 573&5'**( DQG SKRVSKRU LPDJLQJ LQ VHYHQ O\PSKREODVWRLG FHOO OLQHV 7KH f875 VHTXHQFHV IRU +/$$ DQG % P51$V YL

PAGE 7

&ORQLQJ RI +/$$ DQG % KHDY\ FKDLQ F'1$V E\ 3&5 ,Q YLWUR WUDQVODWLRQ VWXG\ RI +/$$ DQG +/$% P51$V YLL

PAGE 8

$EVWUDFW RI 'LVVHUWDWLRQ 3UHVHQWHG WR WKH *UDGXDWH 6FKRRO RI WKH 8QLYHUVLW\ RI )ORULGD LQ 3DUWLDO )XOILOOPHQW RI WKH 5HTXLUHPHQWV IRU WKH 'HJUHH RI 'RFWRU RI 3KLORVRSK\ 0(&+$1,606 )25 *(1(7,&$//< 35('(7(50,1(' ',))(5(17,$/ 48$17,7$7,9( (;35(66,21 2) +/$$ $1' % $17,*(16 %\ .XL /LX 'HFHPEHU &KDLUPDQ 'U .XR-DQJ .DR 0DMRU 'HSDUWPHQW 'HSDUWPHQW RI 3DWKRORJ\ ,PPXQRORJ\ DQG /DERUDWRU\ 0HGLFLQH (DUOLHU VWXGLHV KDYH VKRZQ WKDW GLIIHUHQW VSHFLILF +/$$ DQG % DQWLJHQV DUH GLIIHUHQWLDOO\ H[SUHVVHG LQ FHOOV 7KHLU UHODWLYH TXDQWLWLHV DUH JHQHWLFDOO\ SUHGHWHUPLQHG DQG LQKHULWHG DFFRUGLQJ WR 0HQGHOLDQ ODZ 7R LQYHVWLJDWH WKH PHFKDQLVPV UHVSRQVLEOH IRU WKH TXDQWLWDWLYH GLIIHUHQWLDO H[SUHVVLRQ RI +/$ DQWLJHQV D VLPSOH DQG UHOLDEOH PHWKRG XVLQJ 573&5 DQG '**( ZDV GHYHORSHG WR PHDVXUH WKH UHODWLYH TXDQWLWLHV RI +/$$ DQG % P51$V LQ FHOOV :KHQ WKH UHODWLYH TXDQWLWLHV RI GLIIHUHQW +/$$ DQG % SURWHLQV H[SUHVVHG LQ WHQ GLIIHUHQW +/$SKHQRW\SHG O\PSKREODVWRLG FHOO OLQHV /&/Vf ZHUH FRUUHODWHG ZLWK WKH UHODWLYH DPRXQWV RI WKHLU UHVSHFWLYH P51$V LQ F\WRSODVP LW ZDV VKRZQ WKDW +/$ SURWHLQ OHYHOV DUH SURSRUWLRQDO WR WKHLU P51$ OHYHOV H[FHSW IRU WKH FHOO OLQHV WKDW ZHUH SRVLWLYH IRU +/$$ DQG % 7KLV ILQGLQJ VXJJHVWV WKDW GLIIHUHQW SURWHLQ WUDQVODWLRQDO HIILFLHQFLHV FRXOG SOD\ VRPH UROH LQ DIIHFWLQJ GLIIHUHQWLDO H[SUHVVLRQ RI +/$ DQWLJHQV $Q LQ YLWUR WUDQVODWLRQ VWXG\ XVLQJ +/$$ DQG % P51$V VXSSRUWV WKH K\SRWKHVLV WKDW +/$$ P51$V DUH PRUH HIILFLHQW LQ V\QWKHVL]LQJ +/$ KHDY\ FKDLQV 7R GHWHUPLQH WKH VWDELOLW\ RI GLIIHUHQW +/$$ DQG % DQWLJHQV H[SUHVVHG LQ +/$SKHQRW\SHG /&/V LW ZDV IRXQG WKDW GLIIHUHQW +/$$ DQG % DQWLJHQV KDYH

PAGE 9

VLPLODU WXUQRYHU UDWHV 0HDVXUHPHQW RI WKH UHODWLYH TXDQWLWLHV RI II/$$ DQG % P51$V LQ VHYHQ /&/V EHIRUH DQG DIWHU WUHDWPHQW ZLWK '5% DQ LQKLELWRU RI 51$ SRO\PHUDVH ,, VKRZHG WKDW GLIIHUHQW VSHFLILF +/$$ DQG % P51$V LQ ILYH /&/V KDYH WKH VDPH WXUQRYHU UDWHV DQG WKDW +/$$ DQG % P51$V DUH QRW SURSRUWLRQDOO\ GHJUDGHG LQ WKH RWKHU WZR /&/V 0HDVXUHPHQW RI WKH UHODWLYH TXDQWLWLHV RI GLIIHUHQW +/$$ DQG % SUH P51$V LQ QXFOHL VKRZHG WKDW WKH\ DUH QRW SURSRUWLRQDO WR WKRVH RI PDWXUH F\WRSODVPLF P51$V LQ ILYH RI VHYHQ +/$SKHQRW\SHG /&/V $OO WKHVH ILQGLQJV LQGLFDWH WKDW WKH TXDQWLWDWLYH GLIIHUHQWLDO H[SUHVVLRQ RI +/$$ DQG % DQWLJHQV LV UHJXODWHG E\ D FRPELQDWLRQ RI PXOWLSOH VWHSV 7KHVH VWHSV LQFOXGH JHQH WUDQVFULSWLRQ SUHP51$ VSOLFLQJ P51$ GHJUDGDWLRQ DQGRU P51$ WUDQVODWLRQ GHSHQGLQJ RQ VSHFLILF +/$ DOOHOHV LQ GLIIHUHQW LQGLYLGXDOV 'HVSLWH WKH FRPSOH[LW\ RI UHJXODWLQJ WKH GLIIHUHQWLDO TXDQWLWDWLYH H[SUHVVLRQ RI +/$ DQWLJHQV DOO WKH DIRUHPHQWLRQHG PHFKDQLVPV DUH HQFRGHG LQ WKH VHTXHQFHV RI +/$ JHQH 7KHVH ILQGLQJV VXSSRUW WKH HDUOLHU REVHUYDWLRQV WKDW UHODWLYH TXDQWLWLHV RI GLIIHUHQW +/$$ DQG % DQWLJHQV DUH JHQHWLFDOO\ SUHGHWHUPLQHG DQG GLUHFWO\ OLQNHG WR +/$$ DQG % JHQHV DQG LQKHULWHG DFFRUGLQJ WR 0HQGHOLDQ ODZV ,;

PAGE 10

&+$37(5 ,1752'8&7,21 %LRFKHPLVWU\ RI &ODVV +/$ 0ROHFXOHV &ODVV +/$ PROHFXOHV DUH SRO\PRUSKLF PHPEUDQH JO\FRSURWHLQV DQG FRQVLVW RI WZR QRQFRYDOHQWO\ DVVRFLDWHG SRO\SHSWLGH FKDLQV f§ D KHDY\ FKDLQ RI N' HQFRGHG E\ WKH FODVVLFDO FODVV +/$ JHQHV +/$$ % DQG &f DQG DQ LQYDULDQW OLJKW FKDLQ RI N' HQFRGHG E\ D QRQ0+& JHQH S PLFURJOREXOLQ 3Pf 6ULYDVWDYD HW DO f 7KH +/$ KHDY\ FKDLQ LV D W\SH ,, WUDQVPHPEUDQH SURWHLQ FRPSULVLQJ D F\WRSODVPLF FDUER[\O WHUPLQDO GRPDLQ D WUDQVPHPEUDQH VHJPHQW DQG WKUHH H[WUDFHOOXODU GRPDLQV NQRZQ DV DO D DQG D 7KH DO DQG WKH D GRPDLQV FRQWDLQ PRVW SRO\PRUSKLF DPLQR DFLG VHTXHQFHV DQG IRUP D ELQGLQJ JURRYH IRU DQWLJHQLF SHSWLGHV 7KLV SHSWLGHELQGLQJ JURRYH FRQVLVWV RI DQ HLJKWVWUDQGHG DQWLSDUDOOHO SVKHHW IODQNHG E\ WZR SDUDOOHO VWUDQGV RI D KHOLFHV %MRUNPDQ DQG 3DUKDP f 7KH ELQGLQJ JURRYH FDQ DFFRPPRGDWH DQWLJHQLF SHSWLGHV RI HLJKW WR WHQ DPLQR DFLGV LQ D IOH[LEOH H[WHQGHG FRQIRUPDWLRQ )DON HW DO f +RZHYHU DQ HDUOLHU VWXG\ DOVR VKRZHG WKDW SHSWLGHV FRQVLVWLQJ RI WZHOYH DPLQR DFLGV FDQ ELQG WR FODVV +/$ PROHFXOHV %HGQDUHN HW DO f 2UJDQL]DWLRQ 2I &ODVV +/$ *HQHV *HQHV IRU FODVV +/$ KHDY\ FKDLQV DUH ORFDWHG RQ WKH VKRUW DUP RI FKURPRVRPH DQG WKH JHQH IRU SP LV RQ FKURPRVRPH 7KHUH DUH WKUHH ORFL IRU FODVVLFDO FODVV +/$ JHQHV $OO WKUHH IXQFWLRQDO +/$ FODVV JHQHV VKDUH D YHU\ VLPLODU JHQRPLF

PAGE 11

RUJDQL]DWLRQ DQG DUH UHVSRQVLEOH IRU HQFRGLQJ +/$$ % DQG & KHDY\ FKDLQV (DFK FODVV ,+/$ JHQH FRQVLVWV RI HLJKW H[RQV DQG WKH H[RQLQWURQ RUJDQL]DWLRQ UHIOHFWV WKH GRPDLQ VWUXFWXUH RI WKH PROHFXOH )LJXUH f 7KH H[RQ HQFRGHV WKH fXQWUDQVODWHG UHJLRQ f875f DQG WKH VLJQDO VHTXHQFH DQG WKH H[RQV DQG HQFRGH WKH DO D DQG D LPPXQRJOREXOLQOLNH H[WUDFHOOXODU UHJLRQf GRPDLQV RI +/$ KHDY\ FKDLQV UHVSHFWLYHO\ 7KH WUDQVPHPEUDQH UHJLRQ 70f LV HQFRGHG E\ H[RQ DQG WKH F\WRSODVPLF WDLO &< DQG &
PAGE 12

+/$% ORFXV DQG DOOHOHV IRU +/$& ORFXV %RGPHU HW DO 0DVRQ DQG 3DUKDP f 7KH VWDLFWXUDO EDVLV RI DOOHOLF SRO\PRUSKLVP KDV EHHQ ZHOO FKDUDFWHUL]HG E\ GLUHFW FRPSDULVRQ RI SURWHLQ DQG QXFOHRWLGH VHTXHQFHV 3DUKDP HW DO 3DUKDP HW DO f 7KH REVHUYHG SURWHLQ SRO\PRUSKLVP LV GXH WR DPLQR DFLG VXEVWLWXWLRQV 0RVW SRO\PRUSKLF DPLQR DFLG UHVLGXHV DUH FRQILQHG WR WKH SHSWLGHELQGLQJ UHJLRQ LQ D DQG D GRPDLQV DQG FRQWULEXWH WR YDU\LQJ SHSWLGHELQGLQJ VSHFLILFLWLHV RI FODVV +/$ PROHFXOHV 3DUKDP HW DO f 7KH +/$ SRO\PRUSKLVP LV WKHUHIRUH UHVSRQVLEOH IRU SUHVHQWLQJ ODUJH QXPEHUV RI GLYHUVH DQWLJHQLF SHSWLGHV UHVWULFWHG WR VSHFLILF +/$ PROHFXOHV %MRUNPDQ DQG 3DUKDP f 'HVSLWH VLJQLILFDQW GHJUHHV RI YDULDWLRQV LQ QXFOHRWLGH DQG DPLQR DFLG VHTXHQFHV +/$ DOOHOHV DW WKH VDPH ORFXV DUH HYROXWLRQDOO\ PRUH FORVHO\ UHODWHG WR RQH DQRWKHU WKDQ +/$ DOOHOHV DW RWKHU ORFL 7UDGLWLRQDOO\ SKHQRW\SHV RI FODVV +/$ DQWLJHQV DUH GHWHUPLQHG VHURORJLFDOO\ 7KLV DSSURDFK LV EDVHG RQ FRPSOHPHQWPHGLDWHG O\PSKRF\WRWR[LFLW\ DQG ZDV RULJLQDOO\ GHYHORSHG E\ 7HUDVDNL DQG 0F&OHOODQG 7HUDVDNL HW DO f ,Q WKLV DVVD\ SHULSKHUDO EORRG O\PSKRF\WHV DUH LQFXEDWHG ZLWK DQ DQWLVHUXP FRQWDLQLQJ VSHFLILF DQWL+/$ DQWLERGLHV 7KH ELQGLQJ RI DQWLERGLHV WR O\PSKRF\WHV LV WKHQ GHWHFWHG E\ DGGLQJ KHWHURORJRXV FRPSOHPHQW 6XEVHTXHQW FHOO GHDWK LQGXFHG E\ WKH DFWLYDWHG FRPSOHPHQW LV VFRUHG DIWHU VWDLQLQJ ZLWK HRVLQ< RU RWKHU YLWDO G\HV $OWKRXJK WKH PLFURO\PSKRF\WRWR[LFLW\ DVVD\ IRU W\SLQJ +/$ DQWLJHQV LV VHQVLWLYH DQG FRQYHQLHQW WKLV DVVD\ VXIIHUV IURP FURVVUHDFWLYLW\ DQG OLPLWHG VSHFLILFLW\ RI W\SLQJ VHUD $QRWKHU WHFKQLTXH WKDW KDV EHHQ XVHG WR LGHQWLI\ WKH SKHQRW\SHV RI FODVV +/$ DQWLJHQV LV LVRHOHFWULF IRFXVLQJ ,()f JHO HOHFWURSKRUHVLV
PAGE 13

VXEW\SHV UHPDLQ XQUHVROYDEOH E\ ,() JHO HOHFWURSKRUHVLV 7KH ,() DSSURDFK LV DOVR WHFKQLFDOO\ FXPEHUVRPH 0RUH UHFHQWO\ PROHFXODU ELRORJ\ WHFKQLTXHV KDYH EHHQ DSSOLHG WR '1$ VHTXHQFH EDVHG +/$ W\SLQJ $OOHQ HW DK %LGZHOO *DR HW DO 2K HW DK 7LHUF\ HW DK f 7KUHH FRPPRQO\ XVHG DSSURDFKHV DUH OfORFXVVSHFLILF 3&5 IROORZHG E\ K\EULGL]DWLRQ ZLWK VHTXHQFHVSHFLILF ROLJRQXFOHRWLGHV f RQHVWHS 3&5 ZLWK VHTXHQFHVSHFLILF SULPHUV f ORFXVVSHFLILF 3&5 IROORZHG E\ '1$ VHTXHQFLQJ %LGZHOO f 7KHVH W\SLQJ PHWKRGV SURYLGH WKH PRVW DFFXUDWH UHVXOWV +RZHYHU WKHVH QHZ WHFKQLTXHV DUH ODERULRXV )XQFWLRQ RI &ODVV +/$ $QWLJHQV )XQFWLRQDOO\ FODVV +/$ DQWLJHQV SOD\ LPSRUWDQW UROHV LQ WKH KRVW LPPXQH V\VWHP 7KH\ DUH H[SUHVVHG RQ DOPRVW DOO FHOOV LQFOXGLQJ DQXFOHDWHG UHG EORRG FHOOV DQG SODWHOHWV GH 9LOODUWD\ HW DK (YHUHWW HW DK 0XHOOHU(FNKDUGW HW DK 5LYHUD DQG 6FRUQLN f $IWHU EHLQJ V\QWKHVL]HG +/$ KHDY\ FKDLQ DQG >P IRUP KHWHURGLPHUV LQ WKH HQGRSODVPLF UHWLFXOXP (5f ZKHUH WKH\ DUH ORDGHG ZLWK SHSWLGHV JHQHUDWHG IURP F\WRVRO E\ WKH SURWHDVRPH 7KH SURWHDVRPH LV D PXOWLVXEXQLW $73GHSHQGHQW SURWHDVH WKDW SOD\V WKH PDMRU UROH LQ QRUPDO WXUQRYHU RI F\WRVROLF SURWHLQV 3DPHU DQG &UHVVZHOO 7DQDND HW DK f 7KH SHSWLGHV JHQHUDWHG E\ WKH SURWHDVRPH DUH WUDQVORFDWHG LQWR WKH (5 E\ WKH WUDQVSRUWHU DVVRFLDWHG ZLWK DQWLJHQ SURFHVVLQJ 7$3f ZKLFK LV D KHWHURGLPHULF SURWHLQ WKDW EHORQJV WR WKH $73ELQGLQJ FDVVHWWH WUDQVSRUWHU IDPLO\ 0RPEXUJ DQG +DPPHUOLQJ f %HIRUH ELQGLQJ ZLWK WKH DQWLJHQLF SHSWLGH D WUDQVLHQW FRPSOH[ FRQWDLQLQJ D FODVV KHDY\ FKDLQ DQG D >P LV DVVHPEOHG RQWR WKH 7$3 PROHFXOH E\ VXFFHVVLYH LQWHUDFWLRQV ZLWK WKH (5 FKDSHURQHV FDOQH[LQ FDOUHWLFXOLQ DQG WDSDVLQ 7KH FXUUHQW PRGHO VXJJHVWV WKDW EHIRUH ELQGLQJ DQWLJHQLF SHSWLGHV QHZO\ V\QWKHVL]HG +/$ KHDY\ FKDLQV ILUVW ELQG FDOQH[LQ $IWHU >P ELQGV FDOQH[LQ LV H[FKDQJHG IRU FDOUHWLFXOLQ

PAGE 14

7KHQ WDSVLQ PHGLDWHV WKH DVVRFLDWLRQ RI WKH +/$ FODVV KHDY\ FKDLQ3PFDOUHWLFXOLQ FRPSOH[ ZLWK 7$3 ZKLFK SURYLGHV WKH SHSWLGHV IRU WKH DVVHPEO\ RI FODVV +/$ DQWLJHQ $IWHU ELQGLQJ RI WKH DQWLJHQLF SHSWLGH WKH +/$ PROHFXOHV DUH WUDQVSRUWHG WR WKH FHOO VXUIDFH 3DPHU DQG &UHVVZHOO f 7KH PLVIROGHG FODVV KHDY\ FKDLQV ZLWKRXW P DVVRFLDWLRQ RU SHSWLGHELQGLQJ DUH WUDQVORFDWHG WR WKH F\WRSODVP DQG GHJUDGHG E\ WKH SURWHDVRPH +XJKHV HW DO f 7KH DQWLJHQ SHSWLGHV SUHVHQWHG E\ FODVV +/$ PROHFXOHV LQFOXGH SHSWLGHV RI KRVW DQG QRQKRVW FHOOXODU SURWHLQV 7KH ODWWHU LQFOXGH WKH SURWHLQV GHULYHG IURP LQYDGLQJ YLUXV EDFWHULXP RU SURWR]RDQ SDUDVLWH 7KH SUHVHQWDWLRQ RI SDWKRJHQHQFRGHG RU KRVW WXPRU DQWLJHQLF SHSWLGHV E\ FODVV +/$ PROHFXOHV RQ FHOOV SOD\V D FUXFLDO UROH LQ LPPXQH HOLPLQDWLRQ RI WXPRU FHOOV RU SDWKRJHQLQIHFWHG FHOOV E\ &' 7 FHOOV %MRUNPDQ HW DO 0RQDFR f 7KH SUHVHQWDWLRQ RI SHSWLGHV E\ FODVV 0+& PROHFXOHV LQ WKH WK\PXV DOVR SOD\V D FUXFLDO UROH LQ WKH VHOHFWLRQ DQG PDWXUDWLRQ RI &' 7 FHOOV 'XULQJ WKLV SURFHVV WKH &' 7 FHOOV EHDULQJ WKH 7 FHOO UHFHSWRUV ZLWK KLJK DIILQLW\ WR VHOI DQWLJHQV DUH QHJDWLYHO\ VHOHFWHG ZKHUHDV WKRVH ZLWK ORZHU DIILQLW\ WR VHOI DQWLJHQV LQ WKH FRQWH[W RI VHOI 0+& PROHFXOHV DUH SRVLWLYHO\ VHOHFWHG WR PDWXUH DQG OHDYH WKH WK\PXV WR SRSXODWH SHULSKHUDO O\PSKRLG WLVVXHV 5REH\ DQG )RZONHV f ,Q DGGLWLRQ WKH H[SUHVVLRQ RI FODVV +/$ PROHFXOHV RQ FHOOV KDV EHHQ LPSOLFDWHG LQ SURWHFWLQJ KRVW FHOOV IURP GHVWUXFWLRQ E\ DXWRORJRXV QDWXUDO NLOOHU FHOOV &LFFRQH HW DO .DXIPDQ HW DO /LWZLQ HW DO f 7KH H[LVWHQFH RI LQKLELWRU\ 1. FHOO UHFHSWRUV IRU SRO\PRUSKLF FODVVLFDO +/$ FODVV PROHFXOHV SUHYHQWV WKH DWWDFN RI QRUPDO KRVW FHOOV E\ 1. FHOOV DQG FRXOG EH UHVSRQVLEOH IRU HOLPLQDWLRQ RI WKH FHOOV ODFNLQJ VXIILFLHQW H[SUHVVLRQ RI +/$ FODVV PROHFXOHV /DQLHU f ,W KDV DOVR EHHQ VKRZQ WKDW SHSWLGHV GHULYHG IURP VLJQDO VHTXHQFHV RI +/$ FODVV KHDY\ FKDLQV FDQ EH SUHVHQWHG WR 1. FHOOV E\ D QRQFODVVLFDO +/$ FODVV PROHFXOH +/$( %UDXG HW DO f 'XH WR WKH KLJKO\ SRO\PRUSKLF QDWXUH RI FODVV +/$ DQWLJHQV WKH\ DUH UHVSRQVLEOH IRU WKH LPPXQH UHMHFWLRQ RI DOORJUDIWV LQ WUDQVSODQW UHFLSLHQWV +RRG HW DO f

PAGE 15

$OWKRXJK +/$ PDWFKLQJ EHWZHHQ UHFLSLHQW DQG GRQRU GRHV QRW LQ LWVHOI FRPSOHWHO\ SUHYHQW UHMHFWLRQ RI DOORJUDIWV LW VLJQLILFDQWO\ LPSURYHV WKH FOLQLFDO RXWFRPH IRU DOORJHQHLF RUJDQ WUDQVSODQWDWLRQ 'HVSLWH WKH SURYHQ VXFFHVV RI PDWFKLQJ +/$ DQWLJHQV IRU WUDQVSODQWDWLRQ XQUHODWHG LQGLYLGXDOV ZKR DUH VHURORJLFDOO\ W\SHG DV +/$LGHQWLFDO RIWHQ GR QRW VKDUH LGHQWLFDO +/$ DQWLJHQV GXH WR OLPLWHG DYDLODELOLW\ WR GLIIHUHQWLDWH YDULRXV +/$ VXEW\SHV E\ VHURORJLFDO DVVD\V 0DQWRYDQL HW DO 6SHLVHU HW DO f 7KH XVH RI PROHFXODU ELRORJ\ WHFKQLTXHV IRU +/$ W\SLQJ DW WKH OHYHO RI '1$ VHTXHQFH ZLOO IXUWKHU SUHYHQW PLVPDWFKHV DQG PD\ LPSURYH WKH UHVXOWV IRU DOORJUDIW WUDQVSODQWDWLRQ $VVRFLDWLRQ RI &ODVV +/$ $QWLJHQV ZLWK 'LVHDVHV 2ZLQJ WR WKHLU UROH LQ DQWLJHQ SUHVHQWDWLRQ FODVV +/$ PROHFXOHV DUH FORVHO\ LQYROYHG LQ WKH SDWKRJHQHVLV RI YDULRXV FOLQLFDO FRQGLWLRQV ZKLFK LQFOXGH LQIHFWLRXV DXWRLPPXQH DQG QHRSODVWLF GLVHDVHV 7KH DVVRFLDWLRQ RI FHUWDLQ +/$ DOOHOHV ZLWK GLVHDVHV KDV DOVR EHHQ GRFXPHQWHG +DOO DQG %RZQHVV +LOO f 2QH RI WKH VWURQJHVW DVVRFLDWLRQV LV WKH DVVRFLDWLRQ RI +/$% ZLWK DQN\ORVLQJ VSRQG\OLWLV ,W KDV EHHQ VKRZQ WKDW +/$% DQG DUH DVVRFLDWHG ZLWK WKH GHYHORSPHQW RI DQN\ORVLQJ VSRQG\OLWLV %UHXU9ULHVHQGRUS HW DO 'n$PDWR HW DK +LOO HW DK D /RSH]/DUUHD HW DK f $VVRFLDWLRQV RI +/$% ZLWK %HKFHWnV GLVHDVH +/$% DQG +/$% ZLWK 7DND\DVXnV DUWHULWLV +/$$ ZLWK ELUGVKRW UHWLQLWLV DQG +/$ % ZLWK UHDFWLYH DUWKULWLV KDYH DOVR EHHQ UHSRUWHG %UHZHUWRQ HW DK /DLWLQHQ HW DK /H+RDQJ HW DK 0L]XNL HW DK 0L]XNL HW DK 7RLYDQHQ HW DK
PAGE 16

)RU LQIHFWLRXV GLVHDVHV +/$% KDV EHHQ VKRZQ WR EH DVVRFLDWHG ZLWK WKH SURWHFWLRQ IURP VHYHUH PDODULD +LOO HW DK Ef ,W LV OLNHO\ WKDW +/$% PROHFXOHV PD\ FRQIHU WKH UHVLVWDQFH E\ SUHVHQWLQJ D SODVPRGLXPGHULYHG SHSWLGH WR &7/ IRU PRXQWLQJ DQ HIIHFWLYH LPPXQH UHVSRQVH +LOO HW DK D +LOO HW DK f 8QGRXEWHGO\ IXUWKHU XQGHUVWDQGLQJ RI WKH IXQFWLRQDO LPSRUWDQFH RI +/$ DQWLJHQV LQ GHWHUPLQLQJ KRVW GHIHQVH DQG GLVHDVH VXVFHSWLELOLW\ ZLOO EH PDGH LQ WKH QHDU IXWXUH ZKHQ PRUH LQIRUPDWLRQ EHFRPHV DYDLODEOH &RQWUROOLQJ 6WHSV LQ *HQH ([SUHVVLRQ 7KH PHFKDQLVP IRU JHQH H[SUHVVLRQ KDV EHHQ H[WHQVLYHO\ VWXGLHG *HQH H[SUHVVLRQ FDQ EH FRQWUROOHG DW PXOWLSOH VWHSV LQFOXGLQJ JHQH WUDQVFULSWLRQ SUHP51$ SURFHVVLQJ P51$ WUDIILFNLQJ P51$ GHJUDGDWLRQ P51$ WUDQVODWLRQ DQG SURWHLQ WXUQRYHU ,W LV JHQHUDOO\ EHOLHYHG WKDW JHQH WUDQVFULSWLRQ LV WKH PRVW FULWLFDO VWHS LQ FRQWUROOLQJ JHQH H[SUHVVLRQ *HQH WUDQVFULSWLRQ FDQ EH UHJXODWHG E\ PDQ\ FLVDFWLQJ HOHPHQWV DQG WUDQVn DFWLQJ IDFWRUV 2ODYH HW DK
PAGE 17

VSOLFLQJ WKH DVVHPEO\ RI D VSLLFHRVRPH FRQVLVWLQJ RI D SUHP51$ SURWHLQ IDFWRUV DQG VPDOO QXFOHDU ULERQXFOHRSURWHLQV VQ513Vf LV UHTXLUHG 0RRUH DQG 6KDUS f 7KXV WKH VSOLFLQJ RI SUHP51$ LV UHJXODWHG WKURXJK DVVHPEO\ RI WKH VSLLFHRVRPH ,Q VRPH FDVHV SUHP51$V FDQ EH VSOLFHG LQ DOWHUQDWLYH ZD\V OHDGLQJ WR WKH SURGXFWLRQ RI GLIIHUHQW LVRIRUPV RI SURWHLQV +RGJHV DQG %HUQVWHLQ f ,W DSSHDUV WKDW DOWHUQDWLYH VSOLFLQJ LQ PDQ\ V\VWHPV LV FRQWUROOHG WKURXJK UHJXODWLRQ RI WKH DPRXQW WKH GLVWULEXWLRQ DQGRU WKH DFWLYLW\ RI FRQVWLWXWLYH VSOLFLQJ IDFWRUV LQ FHOOV %HUQVWHLQ DQG +RGJHV f ,W KDV DOVR EHHQ GHPRQVWUDWHG WKDW DOWHUQDWLYH VSOLFLQJ FDQ EH DIIHFWHG E\ GLIIHUHQFHV LQ WKH VWUHQJWK RI FRPSHWLQJ n DQG VSOLFH VLWHV ODUJH GLVWDQFHV EHWZHHQ SRO\S\ULPLGLQH WUDFWV DQG n VSOLFH VLWHV VL]H RI WKH LQYROYHG H[RQ VWHULF FRQVWUDLQWV RQ VSOLFLQJ IDFWRU ELQGLQJ DQG DOWHUQDWLYH SRO\DGHQ\ODWLRQ VLWHV %DOYD\ HW DO %UDG\ DQG :ROG &DUVWHQV HW DO (OULFN HW DO (SHURQ HW DO )XUGRQ DQG .ROH +HLQULFKV HW DO -LQ HW DO /LP DQG 6KDUS 1HOVRQ DQG *UHHQ 1RUEXU\ DQG )ULHG 3HWHUVRQ HW DO 6ROQLFN 6ROQLFN DQG /HH 6WHUQHU DQG %HUJHW :DWDNDEH HW DO f *HQH H[SUHVVLRQ LV DOVR UHJXODWHG E\ GHJUDGDWLRQ DQG VWDELOLW\ RI P51$ $IWHU H[SRUW RI P51$ IURP WKH QXFOHXV WR WKH F\WRSODVP WKH VWDELOLW\ DQG WXUQRYHU RI P51$ FDQ FRQWULEXWH VLJQLILFDQWO\ WR WKH FRQWURO RI JHQH H[SUHVVLRQ WKURXJK UHJXODWLRQ RI WKH DYDLODEOH P51$ IRU SURWHLQ V\QWKHVLV 5RVV f 'LIIHUHQW P51$V FDQ KDYH GLIIHUHQW LQWULQVLF UDWHV RI WXUQRYHU &DEUHUD HW DO &DUQHLUR DQG 6FKLEOHU f 0DQ\ H[DPSOHV IRU UHJXODWLRQ RI JHQH H[SUHVVLRQ E\ PRGXODWLRQ RI P51$ GHFD\ KDYH EHHQ GRFXPHQWHG &DSRQLJUR DQG 3DUNHU 5RVV f 6WDELOLW\ RI P51$ FDQ UHJXODWHG E\ FLVDFWLQJ HOHPHQWV ZLWKLQ WKH P51$ PROHFXOH 7KHVH FLVDFWLQJ HOHPHQWV VHUYH DV UHFRJQLWLRQ VLWHV IRU YDULRXV UHJXODWRU\ SURWHLQV LQFOXGLQJ SRO\$fELQGLQJ SURWHLQ 3$%3f $8ULFK HOHPHQW $85(fELQGLQJ SURWHLQV $8%3Vf DQG RWKHU SURWHLQV WKDW ELQG WR WKH f 875V RU FRGLQJ UHJLRQV RI P51$V %HHOPDQ DQG 3DUNHU 5RVV 5RVV 6DFKV f 7KH DIRUHPHQWLRQHG FLVHOHPHQWV FDQ SRVLWLYHO\ RU QHJDWLYHO\ PRGXODWH

PAGE 18

P51$ VWDELOLW\ DQG DUH SUHVHQW WKURXJKRXW WKH P51$ PROHFXOH LQ f875 WKH FRGLQJ UHJLRQ DQG f875 7KDUXQ DQG 3DUNHU f 7UDQVODWLRQ RI P51$ LV DQRWKHU VWHS LQ UHJXODWLQJ JHQH H[SUHVVLRQ DQG LW FDQ EH UHJXODWHG E\ PRGXODWLQJ WKH UDWH RI WUDQVODWLRQDO LQLWLDWLRQ DQGRU VHTXHVWHULQJ P51$V LQ WUDQVODWLRQDOO\ LQDFFHVVLEOH PHVVHQJHU ULERQXFOHRSURWHLQ P513f &XUWLV HW DK f 7KH FRQFHQWUDWLRQ RI DFWLYH LQLWLDWLRQ IDFWRUV DQG WKH SULPDU\ VHTXHQFH RI WKH f875 KDYH EHHQ VKRZQ WR LQIOXHQFH WKH UDWH RI P51$ WUDQVODWLRQ 'HYDUDMDQ HW DO +HVV DQG 'XQFDQ .DQDML HW DK /LQFROQ HW DK 7KDFK f 7KH VHTXHQFH IODQNLQJ WKH WUDQVODWLRQ LQLWLDWRU $8* n FDS WKH VHFRQGDU\ VWUXFWXUH LQ WKH n875 WKH SUHVHQFH RI DOWHUQDWLYH WUDQVODWLRQ LQLWLDWLRQ VLWHV DQG WKH OHQJWK RI f875 KDYH EHHQ VKRZQ WR GHWHUPLQH WKH LQWULQVLF WUDQVODWLRQDO HIILFLHQF\ RI P51$V %KDVNHU HW DK )DOFRQH DQG $QGUHZV *DOOLH *DOOLH DQG 7DQJXD\ *DPEDFXUWD HW DK *UD\ DQG +HQW]H ,L]XND HW DK ,WR HW DK /DZVRQ HW DK /RSH]&DVLOODV DQG .LP 3LQWR HW DK 5DR DQG +RZHOOV 6HGPDQ HW DK
PAGE 19

JHQHV LV FRQWUROOHG E\ GLIIHUHQW UHJXODWRU\ HOHPHQWV LQ WKH nIODQNLQJ UHJLRQ 7KH FLV UHJXODWRU\ HOHPHQWV WKDW KDYH EHHQ LGHQWLILHG LQFOXGH SURPRWHU VHTXHQFHV 7$7$ ER[ &&$$7 ER[f WKH FODVV UHJXODWRU\ HOHPHQWV &5(HQKDQFHU $f N% HQKDQFHU HOHPHQWV DQ LQWHUIHURQ UHVSRQVH VHTXHQFH ,56f WKH QHJDWLYH UHJXODWRU\ HOHPHQW 15(f DQG WKH 5 [ 5> ELQGLQJ PRWLI 9DULRXV WUDQVDFWLQJ IDFWRUV IRU WKHVH HOHPHQWV KDYH DOVR EHHQ GHVFULEHG %ODQDU HW DK 'ULJJHUV HW DK .LHUDQ HW DO :DULQJ HW DK PSHSWLGH FRPSOH[ DOVR FDQ DIIHFW WKH H[SUHVVLRQ RI FODVV +/$ DQWLJHQV RQ WKH FHOO VXUIDFH ,W KDV EHHQ VKRZQ WKDW FODVV +/$ DQWLJHQV DUH DEVHQW RQ WKH FHOO VXUIDFH RI PGHILFLHQW FHOOV DQG WKDW WKH H[SUHVVLRQ RI FODVV +/$ DQWLJHQV FDQ EH UHVWRUHG DIWHU WKH FHOOV DUH WUDQVIHFWHG ZLWK >P /MXQJJUHQ HW DK 3RZLV HW DK 7DUOHWRQ HW DK f %HFDXVH WKH DQWLJHQLF SHSWLGHV DUH HVVHQWLDO IRU WKH DVVHPEO\ RI FODVV +/$ DQWLJHQV ERWK JHQHUDWLRQ RI

PAGE 20

DQWLJHQLF SHSWLGHV LQ WKH F\WRSODVP DQG WUDQVSRUWDWLRQ RI WKHVH SHSWLGHV LQWR (5 DUH FULWLFDO IRU WKH H[SUHVVLRQ RI FODVV +/$ DQWLJHQV ,QKLELWLRQ RI SURWHDVRPHV FDQ UHVXOW LQ UHGXFHG DYDLODELOLW\ RI ELQGLQJ SHSWLGHV DQG OHDG WR GHFUHDVHG H[SUHVVLRQ RI FODVV ,0+& DQWLJHQV RQ WKH FHOO VXUIDFH %HQKDP DQG 1HHIMHV *UDQW HW DK f 0XWDWLRQ RI 7$3V FDQ GHFUHDVH WKH H[SUHVVLRQ RI +/$ DQWLJHQV E\ OLPLWLQJ WKH VXSSO\ RI DQWLJHQLF SHSWLGHV 7UDQVIHFWLRQ RI WKHVH PXWDQW FHOOV ZLWK QDWLYH IRUPV RI 7$3 F'1$V LV DEOH WR UHVWRUH WKH QRUPDO H[SUHVVLRQ RI FODVV +/$ DQWLJHQV +XJKHV HW DO f +RZHYHU WKH DYDLODELOLW\ RI P RU DQWLJHQLF SHSWLGHV GRHV QRW DSSHDU WR SOD\ D VLJQLILFDQW UROH LQ UHJXODWLQJ TXDQWLWDWLYH H[SUHVVLRQ RI FODVV +/$ LQ QRUPDO FHOOV )RU LQVWDQFHV SRO\PRUSKLVP RI 7$3V GRHV QRW DIIHFW TXDQWLWDWLYH H[SUHVVLRQ RI FODVV +/$ 'DQLHO HW DK f DQG H[SUHVVLRQ RI GLIIHUHQW +/$$ DQG % DQWLJHQV LQ FHOOV LV SURSRUWLRQDOO\ XSUHJXODWHG GXULQJ YLUDO LQIHFWLRQ LQWHUIHURQ VWLPXODWLRQ RU WUDQVIRUPDWLRQ E\ (%9 YLUXV 6KLHK DQG .DR f 7KHVH ILQGLQJV VXJJHVW WKDW DQWLJHQLF SHSWLGHV DUH SUHVHQW LQ DEXQGDQFH DQG UHDGLO\ DYDLODEOH LQ (5 IRU ELQGLQJ E\ GLIIHUHQW VSHFLILF +/$$ DQG % DQWLJHQV 7KHUHIRUH WKH DYDLODELOLW\ RI DQWLJHQLF SHSWLGH LV QRW D UDWHOLPLWLQJ VWHS LQ FRQWUROOLQJ +/$ H[SUHVVLRQ LQ FHOOV ZLWK QRUPDO IXQFWLRQDO SURWHDVRPHV DQG 7$3V $OWKRXJK D JUHDW GHDO RI LQIRUPDWLRQ KDV EHHQ JDLQHG LQ KRZ +/$ H[SUHVVLRQ LV UHJXODWHG LQ JHQHUDO LW LV QRW NQRZQ KRZ GLIIHUHQW +/$$ DQG % DQWLJHQV DUH SURSRUWLRQDOO\ XSUHJXODWHG LQ FHOOV LQ UHVSRQVH WR LQWHUIHURQ RU LQIHFWLRQ E\ FHUWDLQ YLUXVHV )XQFWLRQDO ,PSRUWDQFH RI 4XDQWLWDWLYH ([SUHVVLRQ RI +/$ $QWLJHQV 0DQ\ UHFHQW VWXGLHV KDYH FRQFHQWUDWHG RQ LGHQWLI\LQJ WKH DQWLJHQLF SHSWLGHV WKDW ELQG WR +/$ PROHFXOHV DQG OLWWOH DWWHQWLRQ KDV EHHQ SDLG WR SRWHQWLDO IXQFWLRQDO LPSRUWDQFH RI TXDQWLWDWLYH H[SUHVVLRQ RI +/$ DQWLJHQV (DUOLHU VWXG\ %XNRZVNL DQG :HOVK Df VXJJHVWHG WKDW WKH XSUHJXODWLRQ RI +/$ H[SUHVVLRQ GXULQJ LQIOXHQ]D YLUXV LQIHFWLRQ FRXOG HQKDQFH WKH VXVFHSWLELOLW\ RI LQIHFWHG FHOOV WR &7/V 7R IXUWKHU LQYHVWLJDWH WKH SRWHQWLDO

PAGE 21

TXDQWLWDWLYH LPSRUWDQFH RI +/$ DQWLJHQV LQ GHWHUPLQLQJ WKH VXVFHSWLELOLW\ WR &7/V 6KLHK DQG .DR FRQGXFWHG D VHULHV H[SHULPHQWV DQG GHPRQVWUDWHG D OLQHDU TXDQWLWDWLYH FRUUHODWLRQ EHWZHHQ +/$$ DQWLJHQV H[SUHVVHG RQ WDUJHW FHOOV DQG WKH VXVFHSWLELOLW\ RI WKHVH FHOOV WR +/$$ UHVWULFWHG &7/V 6KLHK HW DK f 7KHVH ILQGLQJV VXSSRUW WKH SRWHQWLDO TXDQWLWDWLYH LPSRUWDQFH RI +/$ DQWLJHQV 7KH LPSRUWDQFH RI TXDQWLWDWLYH +/$ H[SUHVVLRQ LV DOVR VXSSRUWHG E\ WKH ILQGLQJV WKDW WXPRU FHOOV RU YLUXVLQIHFWHG FHOOV FDQ HVFDSH LPPXQH VXUYHLOODQFH WKURXJK GRZQ UHJXODWLRQ RI +/$ H[SUHVVLRQ %RGPHU HW DK +RQPD HW DK 5XL]&DEHOOR HW DK f ,Q FRQWUDVW WUHDWPHQW ZLWK ,)1\WR UHVWRUH 0+& FODVV H[SUHVVLRQ HQKDQFHV WKH VXVFHSWLELOLW\ RI WKHVH FHOOV WR &7/V 3HOWHQEXUJ HW DK 9HUVWHHJ HW DK 9HUVWHHJ HW DK Ef ,W KDV EHHQ NQRZQ WKDW GXULQJ LQIHFWLRQ E\ FHUWDLQ YLUXVHV VXFK DV DGHQRYLUXV KHUSHV VLPSOH[ YLUXV +69f KXPDQ LPPXQRGHILFLHQF\ YLPV +,9f DQG F\WRPHJDORYLUXV &09f WKH H[SUHVVLRQ RI FODVV +/$ DQWLJHQV LV JUHDWO\ UHGXFHG $QGHUVRQ HW DK (KUOLFK HW DK *RVJXVHY HW DK +LOO HW DK +RZFURIW HW DK :DOHY HW DK f 7KH UHGXFHG H[SUHVVLRQ RI +/$ DQWLJHQV PD\ FRQWULEXWH WR WKH VXFFHVVIXO HYDVLRQ RI YLUXVHV IURP KRVW FHOOXODU LPPXQH UHVSRQVH $OO RI WKHVH ILQGLQJV VXSSRUW WKH IXQFWLRQDO LPSRUWDQFH RI TXDQWLWDWLYH H[SUHVVLRQ RI +/$ DQWLJHQV %RWK LQFUHDVHG DQG UHGXFHG H[SUHVVLRQ RI +/$ H[SUHVVLRQ FDQ LQIOXHQFH WKH KRVW VXVFHSWLELOLW\ VHYHULW\ DQG UHFRYHU\ IURP YDULRXV FOLQLFDO FRQGLWLRQV DV GHVFULEHG DERYH 4XDQWLWDWLYH 'LIIHUHQWLDO ([SUHVVLRQ RI +/$$ DQG % DQWLJHQV 7KH UHJXODWLRQ RI TXDQWLWDWLYH H[SUHVVLRQ RI FODVV +/$ DQWLJHQV KDV EHHQ ZLGHO\ VWXGLHG %LVKDUD HW DK *HUUDUG HW DK *LUGOHVWRQH DQG 0LOVWHLQ +DNHP HW DK /HHXZHQEHUJ HW DK 0DVXFFL HW DK 0DVXFFL HW DK 2KOHQ HW DK 6KLPL]X DQG 'H0DUV 9HUVWHHJ HW DK D =DFKRZ DQG 2UU f 7KH UHSRUWHG VWXGLHV VXJJHVWHG WKDW WKH H[SUHVVLRQ RI GLIIHUHQW +/$$ DQG % JHQHV DUH

PAGE 22

GLIIHUHQWLDOO\ H[SUHVVHG DQG XSUHJXODWHG +RZHYHU PRVW RI WKHVH VWXGLHV ZHUH FRQGXFWHG XVLQJ WXPRU FHOO OLQHV RU FHOOV WUDQVIRUPHG ZLWK FODVV ,+/$ F'1$ FRQVWUXFWV RU JHQHV )RU WKLV UHDVRQ UHVXOWV REWDLQHG IURP WKHVH VWXGLHV FDQ QRW EH H[WUDSRODWHG WR QDWLYH +/$ $ DQG % JHQHV LQ QRUPDO FHOOV :KHQ WKH TXDQWLWDWLYH H[SUHVVLRQ RI QDWLYH +/$ JHQHV ZDV VWXGLHG LW ZDV IRXQG WKDW WKH UHODWLYH TXDQWLWLHV RI +/$$ DQG % DQWLJHQV LQ GLIIHUHQW W\SHV RI FHOOV RI DQ LQGLYLGXDO DUH WKH VDPH DQG UHPDLQ XQFKDQJHG RYHU WLPH .DR .DR DQG 5LOH\ f 7KHVH ILQGLQJV VXJJHVW WKDW WKH UHODWLYH DPRXQWV RI GLIIHUHQW FODVV +/$ DQWLJHQV H[SUHVVHG RQ FHOOV DUH JHQHWLFDOO\ SUHGHWHUPLQHG 6XEVHTXHQW VWXGLHV RI FRPSDULQJ WKH TXDQWLWDWLYH H[SUHVVLRQ RI GLIIHUHQW VSHFLILF +/$ DQWLJHQV LQ PHPEHUV RI GLIIHUHQW +/$ SKHQRW\SHG IDPLOLHV FRQILUPHG WKDW WKH GLIIHUHQWLDO TXDQWLWDWLYH H[SUHVVLRQ RI +/$$ DQG % DQWLJHQV LV OLQNHG GLUHFWO\ WR FODVV +/$ JHQHV DQG IROORZV 0HQGHOLDQ LQKHULWDQFH .DR DQG 5LOH\ f ,Q DGGLWLRQ LW ZDV IRXQG WKDW WKH UHODWLYH DPRXQWV RI GLIIHUHQW VSHFLILF +/$ DQWLJHQV DUH SURSRUWLRQDOO\ DPSOLILHG GXULQJ XSUHJXODWHG H[SUHVVLRQ RI WRWDO FODVV +/$ DQWLJHQV E\ LQWHUIHURQ WUHDWPHQW (%9 WUDQVIRUPDWLRQ RU LQIHFWLRQ ZLWK LQIOXHQ]D YLUXVHV 6KLHK HW DO 6KLHK DQG .DR f %HFDXVH WKH DPRXQW RI +/$ DQWLJHQV H[SUHVVHG RQ FHOOV KDV EHHQ VKRZQ WR SURSRUWLRQDOO\ DIIHFW WKH VXVFHSWLELOLW\ RI FHOOV WR F\WRWR[LF 7 O\PSKRF\WHV 6KLHK HW DO f DQG WKH TXDQWLWLHV RI HDFK VSHFLILF +/$ DQWLJHQ H[SUHVVHG RQ FHOOV PD\ LQIOXHQFH GLVHDVH VXVFHSWLELOLW\ VHYHULW\ DQG UHFRYHU\ DV GLVFXVVHG HDUOLHU LW LV RI LPSRUWDQFH WR OHDUQ ZKDW PHFKDQLVPV DUH HPSOR\HG WR FRQWURO WKH JHQHWLFDOO\ SUHGHWHUPLQHG TXDQWLWDWLYH GLIIHUHQWLDO H[SUHVVLRQ RI +/$$ DQG % DQWLJHQV 7KH JRDO RI P\ GLVVHUWDWLRQ UHVHDUFK LV WR GHWHUPLQH KRZ YDULHG TXDQWLWDWLYH H[SUHVVLRQ RI +/$ DQWLJHQV RQ FHOOV RI DQ LQGLYLGXDO LV FRQWUROOHG E\ JHQH WUDQVFULSWLRQ P51$ WXUQRYHU P51$ WUDQVODWLRQ DQGRU SURWHLQ GHJUDGDWLRQ 6SHFLILFDOO\ H[SHULPHQWV DUH FRQGXFWHG Of WR GHWHUPLQH ZKHWKHU GLIIHUHQW +/$$ DQG % SURWHLQV LQ FHOOV DUH SURSRUWLRQDOO\ GHJUDGHG f WR GHWHUPLQH ZKHWKHU WKH UHODWLYH TXDQWLWLHV RI +/$$ DQG % DQWLJHQV H[SUHVVHG LQ FHOOV DUH SURSRUWLRQDOO\ FRUUHODWHG ZLWK WKH OHYHOV RI P51$V IRU WKHVH

PAGE 23

DQWLJHQV f WR GHWHUPLQH ZKHWKHU P51$V IRU GLIIHUHQW +/$$ DQG % DQWLJHQV LQ FHOOV KDYH WKH VDPH VWDELOLWLHV DQG f WR GHWHUPLQH ZKHWKHU GLIIHUHQW +/$$ DQG % P51$V DUH GLIIHUHQWLDOO\ SURGXFHG

PAGE 24

&+$37(5 0($685(0(17 2) 5(/$7,9( 48$17,7,(6 2) ',))(5(17 +/$$ $1' % 051$6 ,1 &(//6 %< 5(9(56( 75$16&5,37,2132/<0(5$6( &+$,1 5($&7,21 $1' '(1$785,1* *5$',(17 *(/ (/(&7523+25(6,6 ,QWURGXFWLRQ $V GLVFXVVHG LQ &KDSWHU FODVV +/$ DQWLJHQV DUH SRO\PRUSKLF PHPEUDQH JO\FRSURWHLQV WKDW FRQVLVW RI D N' KHDY\ FKDLQ DQG D N' LQYDULDQW SPLFURJOREXOLQ 3ORHJK HW DK f 7KH JHQHV HQFRGLQJ +/$ KHDY\ FKDLQV DUH ORFDWHG DW WKUHH GLIIHUHQW ORFL $ % &f RI FKURPRVRPH 3ORHJK HW DK f )XQFWLRQDOO\ FODVV +/$ DQWLJHQV SOD\ LPSRUWDQW UROHV LQ SUHVHQWLQJ DQWLJHQ SHSWLGHV WR &' F\WRWR[LF 7 FHOOV =LQNHUQDJHO DQG 'RKHUW\ f DQG DUH HVVHQWLDO IRU WKH GHYHORSPHQW RI &' &7/V LQ WKH WK\PXV 5ROOHU HW DK =LMVWUD HW DK f 7KH TXDQWLW\ RI +/$ DQWLJHQV H[SUHVVHG RQ FHOOV DOVR SOD\ DQ LPSRUWDQW UROH LQ GHWHUPLQLQJ WKH VXVFHSWLELOLW\ RI YLUXVLQIHFWHG FHOOV WR &7/V %XNRZVNL DQG :HOVK E 6KLHK HW DK f 0RUHRYHU +/$$ DQG % DQWLJHQV DUH H[SUHVVHG LQ GLIIHUHQW TXDQWLWLHV LQ FHOOV DFFRUGLQJ WR 0HQGHOLDQ LQKHULWDQFH .DR DQG 5LOH\ f +RZHYHU WKH PROHFXODU EDVLV IRU WKH JHQHWLFDOO\ SUHGHWHUPLQHG GLIIHUHQWLDO TXDQWLWDWLYH H[SUHVVLRQ RI FODVV +/$$ DQG % DQWLJHQV LQ FHOOV UHPDLQ XQNQRZQ ,Q RUGHU WR DGGUHVV WKLV TXHVWLRQ LW LV QHFHVVDU\ WR GHYHORS D PHWKRG IRU PHDVXULQJ WKH UHODWLYH TXDQWLWLHV RI GLIIHUHQW +/$$ DQG % P51$V LQ FHOOV $OWKRXJK VHYHUDO PHWKRGV IRU TXDQWLWDWLRQ RI VSHFLILF P51$V DUH DYDLODEOH LQFOXGLQJ QRUWKHUQ EORW 6, QXFOHDVH RU ULERQXFOHDVH SURWHFWLRQ DVVD\ DQG TXDQWLWDWLYH UHYHUVH WUDQVFULSWLRQSRO\PHUDVH FKDLQ UHDFWLRQ 573&5f QRQH RI WKHVH PHWKRGV FRXOG EH HDVLO\ DSSOLHG WR RXU VWXG\ GXH WR WHFKQLFDO FRPSOH[LW\ DQGRU SUREOHPV RI FURVV K\EULGL]DWLRQ UHVXOWLQJ IURP KLJK GHJUHHV RI

PAGE 25

VHTXHQFH KRPRORJ\ IRU +/$ P51$V :H WKHUHIRUH H[SORLWHG WKH VLPSOLFLW\ RI TXDQWLWDWLYH 573&5 DQG WKH KLJK UHVROXWLRQ SRZHU RI GHQDWXULQJ JUDGLHQW JHO HOHFWURSKRUHVLV '**(f WR GHYHORS D VLPSOH DQG UHOLDEOH PHWKRG IRU PHDVXUHPHQW RI WKH UHODWLYH TXDQWLWLHV RI GLIIHUHQW +/$$ DQG % P51$V LQ FHOOV 7KH SURFHGXUHV DQG WKH YDOLGDWLRQ RI WKLV PHWKRG DUH GHVFULEHG KHUHLQ 0DWHULDOV DQG 0HWKRGV /\PSKREODVWRLG &HOO /LQHV DQG 51$ SUHSDUDWLRQ (%9WUDQVIRUPHG O\PSKREODVWRLG FHOO OLQHV /&/Vf ZLWK ZHOO FKDUDFWHUL]HG FODVV +/$ SKHQRW\SHV ZHUH REWDLQHG IURP WKH $PHULFDQ 6RFLHW\ IRU +LVWRFRPSDWLELOLW\ DQG ,PPXQRJHQHWLFV &HOO 5HSRVLWRU\
PAGE 26

SUHSDUH WKH ILUVWVWUDQG +/$ F'1$ FRQWDLQLQJ WKH ZKROH FRGLQJ UHJLRQ 7KH V\QWKHVL]HG F'1$V ZHUH VXEVHTXHQWO\ XVHG DV WHPSODWHV IRU 3&5 WR REWDLQ WKH ZKROH FRGLQJ VHTXHQFHV IRU FORQLQJ $QRWKHU SULPHU f$&$ *&7 &&$*f $*f7* $ &7f& $&$ff ZKLFK LV VSHFLILF DQG FRPSOHPHQWDU\ RQO\ WR WKH QXFOHRWLGH VHTXHQFHV RI H[RQ RI DOO FODVV +/$$ DQG % JHQHV EXW QRW WR WKRVH RI +/$& JHQHV ZDV XVHG WR V\QWKHVL]H WKH ILUVWVWUDQG +/$ F'1$ 7KH +/$$ DQG % F'1$V WKHQ ZHUH XVHG IRU TXDQWLWDWLYH 573&5 WR GHWHUPLQH WKH UHODWLYH DPRXQWV RI GLIIHUHQW +/$$ DQG % P51$V E\ '**( DQG SKRVSKRU LPDJLQJ DQDO\VLV 7KH XVH RI WKLV SULPHU HQDEOHV XV WR DYRLG SRVVLEOH LQWHUIHUHQFH E\ +/$& P51$V 3RO\PHUDVH &KDLQ 5HDFWLRQ 3&5f DQG 7$ FORQLQJ 7R REWDLQ WKH ZKROH FRGLQJ VHTXHQFHV RI FODVV +/$ F'1$ IRU FORQLQJ D SDLU RI SULPHUV WKDW DUH VSHFLILF IRU DOO FODVV +/$ P51$V DQG HQFRPSDVV WKH n875 DQG WKH n 875 QXFOHRWLGH VHTXHQFHV RI +/$ P51$V (QQLV HW DK f ZHUH XVHG IRU 3&5 7KH VHTXHQFHV RI WKLV SDLU RI SULPHUV DUH f*$$ 7&7 &&& &$* $&* &&* $*f DQG f 7&$ *7& &&7 &$& $$* $&$ *&? UHVSHFWLYHO\ 7KH F'1$ WHPSODWHV IRU 3&5 ZHUH SUHSDUHG DV GHVFULEHG LQ WKH SUHYLRXV VHFWLRQ 7KH 3&5 ZDV SHUIRUPHG LQ EXIIHU FRQWDLQLQJ P0 7ULV+&O P0 0J&/ P0 .& S+ VXSSOHPHQWHG ZLWK P0 RI HDFK G173 _O0 RI HDFK SULPHU DQG XQLWV RI 7DT '1$ SRO\PHUDVH %RHKULQJHU 0DQQKHLP ,QGLDQDSROLV ,1f LQ D YROXPH RI _LO IRU F\FOHV (DFK F\FOH FRQVLVWHG RI r& GHQDWXUDWLRQ IRU PLQ r& DQQHDOLQJ IRU VHF DQG r& H[WHQVLRQ IRU PLQ 3&5 SURGXFWV ZHUH FORQHG LQWR D 3&5r1,, SODVPLG YHFWRU XVLQJ D 7$ &ORQLQJ .LW ,QYLWURJHQ 6DQ 'LHJRf +/$ VSHFLILFLWLHV RI WKH SODVPLGV LVRODWHG IURP WKHVH 7$ FORQHV ZHUH GHWHUPLQHG E\ DXWRPDWHG '1$ VHTXHQFLQJ XVLQJ 7DT '\H'HR[\r1 7HUPLQDWRU &\FOH 6HTXHQFLQJ .LW $SSOLHG %LRV\VWHPV ,QF )RVWHU &LW\ &$f 7KH SULPHU VHTXHQFH IRU '1$ VHTXHQFLQJ LV f*&* $7* 7$$ 7&& 77* &&*f DQG FRPSOHPHQWDU\ WR WKH QXFOHRWLGHV RI FODVV +/$ FRGLQJ VHTXHQFH

PAGE 27

7KH QXFOHRWLGH VHTXHQFHV RI WKH SULPHUV XVHG IRU TXDQWLWDWLYH 3&5 DUH f&*& &*7 **$ 7$* $*& $**f DQG f*&* $7* 7$$ 7&& 77* &&*? ZKLFK DUH FRPSOHPHQWDU\ WR WKH FRQVHUYHG DQWLVHQVH DQG VHQVH QXFOHRWLGH VHTXHQFHV LQ H[RQ DQG H[RQ RI DOO FODVV +/$ P51$V UHVSHFWLYHO\ 4XDQWLWDWLYH 3&5 ZDV SHUIRUPHG XVLQJ WKH VDPH FRQGLWLRQV DV GHVFULEHG DERYH LQ D YROXPH RI _OO H[FHSW DQQHDOLQJ DW r& IRU PLQ H[WHQGLQJ DW r& IRU PLQ DQG DPSOLILHG IRU F\FOHV 7KH +/$$ DQG % F'1$ SUHSDUHG IURP F\WRSODVPLF 51$ ZDV XVHG DV WHPSODWHV f§3 /DEHOLQJ RI 7KH 3ULPHU IRU 4XDQWLWDWLYH 3&5 )RXU KXQGUHG SLFRPROHV RI D SULPHU ZDV ODEHOHG ZLWK SLQROHV RI >\3@$73 &LPPRO P&LPOf $PHUVKDP /LIH 6FLHQFH ,QF $UOLQJWRQ +HLJKWV ,/f LQ _OO S+ EXIIHU FRQWDLQLQJ P0 7ULV+&O P0 0J&O UD0 '77 DQG XQLWV RI 7 NLQDVH 3URPHJD 0DGLVRQ :,f DW r& IRU KRXU 7KH IUHH QXFOHRWLGHV ZHUH UHPRYHG E\ 6HSKDGH[ ILOWUDWLRQ 6SHFLILF DFWLYLW\ RI WKH ODEHOHG SULPHU ZDV DERXW O[ nf FSPSPROH '**( '**( ZDV SHUIRUPHG LQ PP WKLFN b SRO\DFU\ODPLGH DFU\ODPLGH ELVDFU\ODPLGH f JHO XVLQJ '*(1(r1 'HQDWXULQJ *UDGLHQW *HO (OHFWURSKRUHVLV 6\VWHP %LR5DG /DERUDWRULHV +HUFXOHV &$f 7KH SRO\DFU\ODPLGH JHO FRQWDLQHG D OLQHDUO\ LQFUHDVLQJ GHQDWXUDQW JUDGLHQW IURP b WR b 7KH b GHQDWXUDQW FRQWDLQV 0 XUHD DQG b ZYf GHLRQL]HG IRUPDPLGH (OHFWURSKRUHVLV ZDV SHUIRUPHG DW r& 9 IRU WR KRXUV LQ P0 7ULVDFHWDWH S+ FRQWDLQLQJ P0 ('7$ 7$(f $IWHU HOHFWURSKRUHVLV WKH JHOV ZHUH VWDLQHG ZLWK HWKLGLXP EURPLGH DQG SKRWRJUDSKHG E\ XVLQJ D 3RODURLG FDPHUD RU *HO 3ULQW L V\VWHP %LR 3KRWRQLF &RUS $QQ $UERU 0,f RU GULHG IRU DXWRUDGLRJUDSK\ DQG SKRVSKRU LPDJLQJ DQDO\VLV 3&5 SURGXFW RI HDFK +/$$ RU

PAGE 28

% P51$ LQ '**( JHO ZDV LGHQWLILHG E\ XVLQJ 3&5 SURGXFWV SUHSDUHG IURP WKH SODVPLGV FRQWDLQLQJ FORQHG +/$F'1$V RI NQRZQ VSHFLILFLW\ 3UHSDUDWLRQ RI +/$ P51$ 6WDQGDUGV +/$$ DQG % F'1$V FORQHG LQ WKH 3&5r1,, YHFWRU ,QYLWURJHQ 6DQ 'LHJR &$f ZHUH XVHG IRU LQ YLWUR V\QWKHVLV RI WKH 51$ VWDQGDUGV )LYH PLFURJUDPV RI SODVPLG ZDV GLJHVWHG ZLWK XQLWV RI %DP+ LQ D YROXPH RI SL DW r& IRU KRXUV $IWHU FRQILUPDWLRQ RI FRPSOHWH GLJHVWLRQ E\ DJDURVH JHO HOHFWURSKRUHVLV OLQHDUL]HG SODVPLGV ZHUH LVRODWHG E\ SKHQROFKORURIRUP H[WUDFWLRQ DQG HWKDQRO SUHFLSLWDWLRQ 2QH PLFURJUDP RI OLQHDUL]HG SODVPLGV ZHUH XVHG DV WHPSODWHV IRU LQ YLWUR WUDQVFULSWLRQ LQ D YROXPH RI SL DW r& IRU KRXUV XVLQJ 7 51$ SRO\PHUDVH DFFRUGLQJ WR WKH PDQXIDFWXUHUfV SURWRFRO 0(*$VFULSWr1 ,Q 9LWUR 7UDQVFULSWLRQ .LWVf $PELRQ ,QF $XVWLQ 7;f $IWHU KRXUV LQFXEDWLRQ XQLWV 51DVHIUHH '1DVH ZDV DGGHG DQG LQFXEDWHG DW f& IRU PLQXWHV WR GHJUDGH WKH WHPSODWH '1$ 7KH LQ YLWUR V\QWKHVL]HG 51$ WUDQVFULSWV ZHUH UHFRYHUHG ZLWK SKHQROFKORURIRUP H[WUDFWLRQ DQG LVRSURSDQRO SUHFLSLWDWLRQ )UHH QXFOHRWLGHV ZHUH UHPRYHG E\ 51HDV\ VSLQ FROXPQ VHSDUDWLRQ 4,$*(1 ,QF &KDWVZRUWK &$f DQG HWKDQRO SUHFLSLWDWLRQ 7KH FRQFHQWUDWLRQV RI WKH V\QWKHVL]HG 51$ VWDQGDUGV ZHUH PHDVXUHG E\ DEVRUEDQFH DW QP 7KHVH WUDQVFULSWV ZHUH XVHG DV VWDQGDUGV IRU TXDQWLWDWLYH 573&5 DQG 6 QXFOHDVH SURWHFWLRQ DVVD\ 6 1XFOHDVH 3URWHFWLRQ 613f $VVD\ IRU 4XDQWLWDWLRQ RI +/$$ DQG % P51$V LQ /\PSKREODVWRLG &HOO /LQHV 7KH '1$ SUREHV IRU 6, QXFOHDVH SURWHFWLRQ DVVD\V ZHUH JHQHUDWHG IURP SODVPLGV LQ ZKLFK WKH FRGLQJ VHTXHQFH RI +/$$ RU % P51$ ZDV FORQHG '1$ FRQWDLQLQJ WKLV SDUWLDO +/$$ RU % QXFOHRWLGH VHTXHQFH DQG WKH IODQNLQJ SRO\FORQLQJ VLWH VHTXHQFHV LQ WKH YHFWRU ZDV DPSOLILHG XVLQJ 3&5 ZLWK D SDLU RI SULPHUV IODQNLQJ WKH SRO\FORQLQJ VLWHV 7KH 3&5 SURGXFWV ZHUH WKHQ SXULILHG E\ DJDURVH HOHFWURSKRUHVLV DQG

PAGE 29

6HSKDJ@DV0 %DQG3UHS 3XULILFDWLRQ .LW 3KDUPDFLD /.% f DQG XVHG DV WHPSODWHV IRU SUREH V\QWKHVLV 7KH SUREHV ZHUH V\QWKHVL]HG E\ XVLQJ DQ DQWLVHQVH SULPHU WKDW LV FRPSOHPHQWDU\ WR WKH FRGLQJ VHTXHQFH EHWZHHQ QXFOHRWLGH DQG RI +/$$ DQG % P51$ D 3ULPH$3UREHr1 '1$ ODEHOLQJ .LW $PELRQ ,QF $XVWLQ 7;f DQG ODEHOHG ZLWK >D3@G$73 $IWHU JHO SXULILFDWLRQ WKH '1$ SUREHV ZHUH XVHG IRU TXDQWLWDWLYH 6 QXFOHDVH SURWHFWLRQ DVVD\ XVLQJ 6$VVD\ .LW $PELRQ ,QF $XVWLQ 7;f DFFRUGLQJ WR WKH PDQXIDFWXUHUfV LQVWUXFWLRQ +/$$ DQG % 51$ WUDQVFULSWV V\QWKHVL]HG IURP WKH FORQHG F'1$V ZHUH XVHG WR FRQVWUXFW VWDQGDUG FXUYHV )RU TXDQWLWDWLRQ RI +/$ P51$V _OJ RI WRWDO F\WRSODVPLF 51$ ZDV DVVD\HG LQ WULSOLFDWHV 7KH 6 QXFOHDVHGLJHVWLRQ SURGXFWV ZHUH VHSDUDWHG XVLQJ D b GHQDWXULQJ SRO\DFU\ODPLGH JHO 0 XUHDf 7KH SURWHFWHG '1$ IUDJPHQWV ZHUH TXDQWLILHG E\ SKRVSKRU LPDJLQJ 7KH DPRXQW RI VSHFLILF +/$P51$ ZDV GHWHUPLQHG IURP WKH VWDQGDUG FXUYH $XWRUDGLRJUDSK\ 3KRVSKRU ,PDJLQJ DQG 'HQVLWRPHWU\ )RU DXWRUDGLRJUDSK\ WKH JHOV ZHUH H[SRVHG WR )XML 0HGLFDO ;UD\ ILOP )XML 3KRWR )LOP &R /WG -DSDQf IRU KRXUV '**(f RU KRXUV 613 DVVD\f DW r& )RU SKRVSKRU LPDJLQJ WKH JHOV ZHUH H[SRVHG WR D 3KRVSKRUVFUHHQ 0ROHFXODU '\QDPLFV ,QF 6XQQ\YDOH &$f IRU KRXUV '**(f RU KRXUV 613 DVVD\f DW URRP WHPSHUDWXUH 7KH UDGLRDFWLYLW\ RI HDFK VSHFLILF '1$ EDQG ZDV TXDQWLILHG XVLQJ ,PDJH4XDQW VRIWZDUH 0ROHFXODU '\QDPLFV ,QF 6XQQ\YDOH &$f )RU TXDQWLWDWLRQ RI '1$ LQ DJDURVH JHOV E\ GHQVLWRPHWU\ SKRWRJUDSKV RI JHOV ZHUH VFDQQHG ZLWK D GSL 0LFURWHN JUD\VFDOH VFDQQHU 0LFURWHN ,QF 7RUUDQFH &$f DQG DQDO\]HG E\ &ROODJH VRIWZDUH )RWRG\QH ,QF 1HZ %HUOLQ :,f

PAGE 30

5HVXOWV 2SWLPL]DWLRQ RI 4XDQWLWDWLYH 573&5 $OWKRXJK WKH DPRXQW RI 3&5 SURGXFWV GRXEOHV DIWHU HDFK F\FOH RI 3&5 DPSOLILFDWLRQ LW LV NQRZQ WKDW WKH HIILFLHQF\ RI DPSOLILFDWLRQ GHFUHDVHV ZLWK LQFUHDVLQJ QXPEHUV RI DPSOLILFDWLRQ F\FOHV 7KH UHGXFHG HIILFLHQF\ OHDGV WR XQHYHQ DPSOLILFDWLRQ DQG ORVV RI SURSRUWLRQDO TXDQWLWDWLYH FRUUHODWLRQ EHWZHHQ 3&5 SURGXFWV DQG RULJLQDO WHPSODWH QXPEHUV *DXVH DQG $GDPRYLF] f :H WKHUHIRUH VWXGLHG WKH DPRXQWV RI 3&5 SURGXFWV DV D IXQFWLRQ RI 3&5 F\FOH QXPEHUV 7KH 3&5 SURGXFWV ZHUH PHDVXUHG XVLQJ 3ODEHOHG SULPHU DJDURVH JHO HOHFWURSKRUHVLV DQG VFLQWLOODWLRQ FRXQWLQJ ,W ZDV IRXQG WKDW WKH DPRXQWV RI 3&5 SURGXFWV ZHUH LQFUHDVHG ORJDULWKPLFDOO\ ZLWK WKH 3&5 F\FOH QXPEHU DV H[SHFWHG XS WR F\FOHV )LJXUH f $IWHU F\FOHV WKH 3&5 EHJDQ WR JHQHUDWH OHVV WKDQ WKH H[SHFWHG DPRXQWV RI DPSOLILHG SURGXFWV 7KHUHIRUH WKH F\FOHV XVHG IRU DOO RXU TXDQWLWDWLYH 573&5 UHDFWLRQV IRU F\WRSODVPLF +/$$ DQG % P51$V ZHUH 1H[W ZH VWXGLHG WKH 3&5 SURGXFWV DV D IXQFWLRQ RI WHPSODWHV SUHSDUHG IURP GLIIHUHQW TXDQWLWLHV RI WRWDO F\WRSODVPLF 51$ 7KH DPRXQWV RI 573&5 SURGXFWV ZHUH PHDVXUHG DFFRUGLQJ WR IOXRUHVFHQW LQWHQVLW\ LQ DJDURVH JHO E\ VFDQQLQJ GHQVLWRPHWU\ DQG ZHUH OLQHDUO\ FRUUHODWHG ZLWK WKH TXDQWLWLHV RI WHPSODWHV SUHSDUHG IURP _QJ WR /WJ RI WRWDO F\WRSODVPLF 51$ )LJXUH f 7KH UHVXOWV RI WKLV H[SHULPHQW LQGLFDWH WKDW LJ WRWDO F\WRSODVPLF 51$ FDQ EH XVHG IRU TXDQWLWDWLRQ RI +/$ P51$V 6HSDUDWLRQ DQG ,GHQWLILFDWLRQ RI 573&5 3URGXFWV RI 'LIIHUHQW +/$$ DQG % P51$V E\ '**( $IWHU TXDQWLWDWLYH DPSOLILFDWLRQ 3&5 SURGXFWV RI WKH SRO\PRUSKLF UHJLRQ RI GLIIHUHQW VSHFLILF +/$$ DQG % P51$V ZHUH DQDO\]HG E\ '**( $V VKRZQ LQ )LJXUH WKLV WHFKQLTXH VXFFHVVIXOO\ VHSDUDWHG 573&5 SURGXFWV RI GLIIHUHQW +/$$ DQG % P51$V 7R LGHQWLI\ WKH +/$ VSHFLILFLW\ RI HDFK '1$ EDQG LQ GHQDWXULQJ JUDGLHQW JHOV ZH FORQHG +/$ F'1$V IURP WKH VDPH FHOO OLQHV LQWR SODVPLGV 7KHVH SODVPLGV ZHUH XVHG

PAGE 31

)LJXUH 2SWLPDO F\FOHV IRU TXDQWLWDWLYH 573&5 7KH DPRXQWV RI 573&5 SURGXFWV IRU +/$$ DQG % P51$V ZHUH VWXGLHG DV D IXQFWLRQ RI 3&5 F\FOHV 7KH 3&5 SURGXFWV ZHUH PHDVXUHG E\ XVLQJ D \3 HQGODEHOHG SULPHU DQG VFLQWLOODWLRQ FRXQWLQJ RI '1$ SURGXFWV FXW IURP DJDURVH JHOV 7KH LGHDO UHODWLRQVKLS EHWZHHQ 3&5 SURGXFWV DQG 3&5 F\FOHV LV VKRZQ DV GRWWHG OLQH 7RWDO F\WRSODVPLF 51$ _OJf IURP IRXU O\PSKREODVWRLG FHOO OLQHV ZHUH VWXGLHG Rf [f $f DQG 6+ Â’f DV WHPSODWHV IRU 3&5 DPSOLILFDWLRQ 7KH 3&5 SURGXFWV RI NQRZQ +/$ VSHFLILFLWLHV ZHUH DP RQ WKH VDPH GHQDWXULQJ JUDGLHQW JHO WR GHWHUPLQH WKH LGHQWLW\ RI HDFK XQNQRZQ '1$ EDQG $V VKRZQ LQ )LJXUH % +/$ VSHFLILFLW\ RI HDFK '1$ EDQG FDQ EH HDVLO\ LGHQWLILHG :KHQ WKH VDPH DSSURDFK ZDV DSSOLHG WR WKUHH +/$ KHWHUR]\JRXV /&/V 57 3&5 SURGXFWV RI GLIIHUHQW +/$$ DQG % P51$V ZHUH ZHOO UHVROYHG )LJXUH f 0HDVXUHPHQW RI 5HODWLYH 4XDQWLWLHV RI 'LIIHUHQW +/$$ DQG % P51$V LQ 7KH 6DPH 6DPSOH EY 573&5 DQG '**( 7R GHWHUPLQH ZKHWKHU 573&5 DQG '**( FDQ EH DSSOLHG WR PHDVXUH WKH UHODWLYH TXDQWLWLHV RI GLIIHUHQW +/$$ DQG % P51$V LQ D 51$ VDPSOH WKH IROORZLQJ YDOLGDWLRQ VWXG\ ZDV SHUIRUPHG )LUVW WKH +/$$ DQG % P51$ WUDQVFULSWV ZHUH JHQHUDWHG E\ LQ YLWUR WUDQVFULSWLRQ IURP +/$ F'1$ SODVPLGV DQG XVHG DV WHPSODWHV 7KH LQWHJULW\ RI

PAGE 32

27 n 2 7L 2 LB 2 FF R 4B && )LJXUH ),/$ 573&5 SURGXFWV PHDVXUHG DV D IXQFWLRQ RI GLIIHUHQW DPRXQWV RI WRWDO F\WRSODVPLF 51$ 3&5 ZDV SHUIRUPHG IRU F\FOHV 7KH 3&5 SURGXFWV ZHUH LGHQWLILHG E\ DJDURVH JHO HOHFWURSKRUHVLV DQG HWKLGLXP EURPLGH VWDLQLQJ DQG TXDQWLILHG E\ GHQVLWRPHWU\ 6LPSOH UHJUHVVLRQ DQDO\VLV VKRZV D JRRG OLQHDU FRUUHODWLRQ EHWZHHQ WKH WZR SDUDPHWHUV XS WR M[J F\WRSODVPLF 51$ WKHVH WUDQVFULSWV ZHUH FRQILUPHG E\ IRUPDOGHK\GH DJDURVH JHO HOHFWURSKRUHVLV ZKLFK VKRZHG WKDW WKHVH WUDQVFULSWV ZHUH RI WKH H[SHFWHG FRUUHFW VL]H 7KH SXULILHG WUDQVFULSWV ZHUH TXDQWLILHG E\ DEVRUEDQFH DW QP ZDYHOHQJWK 7KHVH WZR 51$ WUDQVFULSWV ZHUH PL[HG LQ GLIIHUHQW UDWLRV f DW D WRWDO DPRXQW RI QJ DQG XVHG IRU 573&5 7KH UHVXOWV VKRZQ LQ )LJXUH GHPRQVWUDWH WKDW WKH UHODWLYH DPRXQWV RI 573&5 SURGXFWV IRU +/$$ DQG % P51$V ZHUH OLQHDUO\ FRUUHODWHG ZLWK WKH UHODWLYH TXDQWLWLHV RI WKH P51$ VWDQGDUGV LQ WKH UHYHUVH WUDQVFULSWLRQ PL[WXUHV 7KH VDPH UHVXOWV ZHUH REWDLQHG ZKHQ GLIIHUHQW +/$ P51$V ZHUH XVHG GDWD QRW VKRZQf 7KHVH UHVXOWV LQGLFDWH WKDW 573&5'**( DQG SKRVSKRU LPDJLQJ TXDQWLWDWLRQ FDQ EH XVHG WR GHWHUPLQH WKH UHODWLYH TXDQWLWLHV RI GLIIHUHQW +/$$ DQG % P51$V LQ WKH VDPH VDPSOH

PAGE 33

)LJXUH ,GHQWLILFDWLRQ RI 573&5 SURGXFWV RI GLIIHUHQW +/$$ DQG % P51$V E\ '**( $f 3RO\DFU\ODPLGH JHO bf HOHFWURSKRUHVLV RI 573&5 SURGXFWV RI +/$$ DQG % P51$V IURP ILYH GLIIHUHQW +/$$ DQG % KRPR]\JRXV /&/V 7KH LGHQWLILFDWLRQ QXPEHU RI HDFK FHOO OLQH LV VKRZQ DW WKH WRS RI HDFK ODQH %f 6HSDUDWLRQ RI WKH 573&5 SURGXFWV RI HDFK FHOO OLQH LQ '**( SRO\DFU\ODPLGH JHO PLGGOH ODQH RI HDFK VPDOO SDQHOf $IWHU VWDLQLQJ ZLWK HWKLGLXP EURPLGH +/$ VSHFLILFLW\ RI HDFK '1$ EDQG LQ WKH 3&5 SURGXFWV ZDV LGHQWLILHG XVLQJ WKH 3&5 SURGXFW JHQHUDWHG IURP WKH SODVPLG FRQWDLQLQJ +/$F'1$ RI NQRZQ VSHFLILFLW\ IURP WKH VDPH FHOO OLQH OHIW DQG ULJKW ODQHV RI HDFK VPDOO SDQHOf % $ 6+ $ % % $ &* $ % % $ '& $ % )LJXUH '**( VHSDUDWLRQ RI 573&5 SURGXFWV RI +/$$ DQG % P51$V LVRODWHG IURP /&/V FDUU\LQJ KHWHUR]\JRXV +/$$ DQG % DQWLJHQV 7KH OHIW DQG WKH ULJKW WZR ODQHV RI HDFK SDQHO DUH 573&5 SURGXFWV IURP SODVPLGV FRQWDLQLQJ +/$ F'1$V RI NQRZQ VSHFLILFLWLHV FORQHG IURP WKH VDPH FHOO OLQH

PAGE 34

)LJXUH 9DOLGDWLRQ RI XVLQJ 573&5 DQG '**( IRU PHDVXULQJ UHODWLYH TXDQWLWLHV RI GLIIHUHQW +/$ P51$V 6DPSOHV FRQWDLQLQJ GLIIHUHQW UHODWLYH DPRXQWV RI +/$$ DQG % 51$ ZHUH XVHG DV WHPSODWHV IRU TXDQWLWDWLYH 573&5 7KHVH 51$V ZHUH V\QWKHVL]HG E\ LQ YLWUR WUDQVFULSWLRQ 7KH WRWDO DPRXQW RI +/$$ DQG % 51$V IRU HDFK 573&5 UHDFWLRQ ZDV QJ 7KH 573&5 SURGXFWV ZHUH VHSDUDWHG E\ '**( DQG TXDQWLILHG E\ SKRVSKRU LPDJLQJ DQDO\VLV 7KH ERWWRP SDQHO VKRZV WKH DXWRUDGLRJUDSK RI WKH '**( JHO XVHG IRU TXDQWLWDWLYH DQDO\VLV E\ SKRVSKRU LPDJLQJ 0HDVXUHPHQWV RI 5HODWLYH 4XDQWLWLHV RI 'LIIHUHQW +/$$ DQG % P51$V LQ /&/V E\ 57 3&5'**( DQG 6 1XFOHDVH 3URWHFWLRQ $VVD\ 7R IXUWKHU HVWDEOLVK WKH YDOLGLW\ RI WKH 573&5'**( PHWKRG ZH DOVR GHWHUPLQHG WKH UHODWLYH DPRXQWV RI +/$$ DQG % P51$V LQ IRXU /&/V XVLQJ 6, QXFOHDVH SURWHFWLRQ DVVD\ 7KH UHVXOWV ZHUH FRPSDUHG ZLWK WKRVH REWDLQHG E\ XVLQJ WKH 573&5'**( PHWKRG 6WDQGDUGV IRU 6, QXFOHDVH SURWHFWLRQ DVVD\ ZHUH SUHSDUHG IURP WKH +/$F'1$V FORQHG LQ SODVPLGV 5HSUHVHQWDWLYH UHVXOWV RI XVLQJ 6 QXFOHDVH SURWHFWLRQ DVVD\ IRU TXDQWLWDWLRQ RI +/$$ DQG % P51$V DUH VKRZQ LQ )LJXUH :H WKHQ GHWHUPLQHG WKH UHODWLYH TXDQWLWLHV RI LQGLYLGXDO +/$$ DQG % P51$V LQ IRXU O\PSKREODVWRLG FHOO OLQHV 7KH UHVXOWV VXPPDUL]HG LQ 7DEOH VKRZ D JRRG FRUUHODWLRQ EHWZHHQ WZR DVVD\V

PAGE 35

$f B F LQ 2f n nIf A [ n f ff§ ( R 6= R V] &/ 4B 6 $ 51$ VWDQGDUG SJf %f % 51$ VWDQGDUG SJf )LJXUH 4XDQWLWDWLRQ RI +/$$ DQG % P51$V LQ O\PSKREODVWRLG FHOO OLQH XVLQJ 6, QXFOHDVH SURWHFWLRQ DVVD\ 3DQHO $f DQG %f VKRZ WKH VWDQGDUG FXUYHV IRU WKH TXDQWLWDWLRQ RI +/$$ DQG % P51$V 7KH LQVHWV DUH DXWRUDGLRJUDSKV RI VWDQGDUGV DQG WULSOLFDWHV RI D 51$ VDPSOH IURP FHOO OLQH 7KH VDPH DPRXQW RI WRWDO F\WRSODVPLF 51$ ZDV XVHG IRU TXDQWLWDWLRQ RI +/$$ DQG % P51$V 7KH DPRXQWV RI +/$$ DQG % P51$V ZHUH GHWHUPLQHG IURP WKH VWDQGDUG FXUYHV DQG XVHG WR FDOFXODWH WKHLU UHODWLYH TXDQWLWLHV 7DEOH 5HODWLYH TXDQWLWLHV RI +/$$ DQG % P51$V LQ O\PSKREODVWRLG FHOO OLQHV PHDVXUHG E\ 573&5'**( DQG 6, QXFOHDVH SURWHFWLRQ DVVD\ /&/ +/$ 5HODWLYH 4XDQWLWLHV RI +/$$ DQG % P51$V b 0HDQ s 6'f 573&5'**( 6 1XFOHDVH 3URWHFWLRQ $VVD\ $ s fr f % s f f $ s f f % s f f $ f s f % f s f $ f f % f f r 1XPEHU RI H[SHULPHQWV SHUIRUPHG RQ GLIIHUHQW GDWHV

PAGE 36

'LVFXVVLRQ )RU TXDQWLWDWLRQ RI GLIIHUHQW VSHFLILF P51$V WKH FRPPRQO\ XVHG PHWKRGV LQFOXGH QRUWKHUQ EORW 6, QXFOHDVH RU ULERQXFOHDVH SURWHFWLRQ DVVD\ DQG TXDQWLWDWLYH 573&5 :LHVQHU DQG =DN f 7KH DGYDQWDJHV RI XVLQJ QRUWKHUQ EORW DSSURDFK DUH WKDW WKH LQWHJULW\ RI P51$ FDQ EH DVVHVVHG DQG VHYHUDO URXQGV RI K\EULGL]DWLRQ FDQ EH SHUIRUPHG XVLQJ WKH VDPH EORW )ORZHYHU WKLV PHWKRG LV VHPLTXDQWLWDWLYH DQG QRW VHQVLWLYH 7KH QRUWKHUQ EORW PHWKRG LV DOVR FRPSOLFDWHG E\ WKH SUREOHP RI FURVV K\EULGL]DWLRQ UHVXOWLQJ IURP KLJK GHJUHH RI VHTXHQFH KRPRORJ\ DQG WKH VDPH VL]H RI +/$ P51$V 7KH VHFRQG DSSURDFK WR TXDQWLI\ VSHFLILF P51$V LV 6, QXFOHDVH RU ULERQXFOHDVH SURWHFWLRQ DVVD\ 7KLV PHWKRG LV EDVHG RQ VROXWLRQ K\EULGL]DWLRQ DQG LV PRUH VHQVLWLYH DQG SUHFLVH WKDQ WKH QRUWKHUQ EORW WHFKQLTXH 1HYHUWKHOHVV WKLV DSSURDFK UHTXLUHV ODERULRXV SUHSDUDWLRQ RI VSHFLILF SUREHV DQG 51$ VWDQGDUGV 7KH LQYROYHPHQW RI VHYHUDO URXQGV RI QXFOHLF DFLG SUHFLSLWDWLRQ E\ HWKDQRO DOVR LQWURGXFHV YDULDELOLW\ 7KH WKLUG DSSURDFK WR PHDVXUH TXDQWLWLHV RI GLIIHUHQW +/$ P51$V LV TXDQWLWDWLYH 573&5 *DXVH DQG $GDPRYLF] f 7KLV LV D VLPSOH DQG VHQVLWLYH TXDQWLWDWLYH PHWKRG 7KH PHWKRG FDQ EH XVHG IRU ODUJH QXPEHUV RI VDPSOHV +RZHYHU 573&5 PHWKRGV DORQH FDQ QRW EH DSSOLHG IRU TXDQWLWDWLRQ RI GLIIHUHQW VSHFLILF P51$V WKDW ZRXOG SURGXFH WKH VDPH VL]H RI 3&5 SURGXFWV LQ WKH VDPH LQFXEDWLRQ :H WKHUHIRUH GHYHORSHG D VLPSOH DQG SUHFLVH PHWKRG IRU PHDVXULQJ WKH UHODWLYH TXDQWLWLHV RI GLIIHUHQW +/$$ DQG % P51$V LQ FHOOV XVLQJ D FRPELQHG DSSURDFK LQYROYLQJ TXDQWLWDWLYH 573&5 '**( DQG SKRVSKRU LPDJLQJ 7KH XVH RI TXDQWLWDWLYH 573&5 DOORZHG XV WR KDYH D VHQVLWLYH WHFKQLTXH WR DPSOLI\ GLIIHUHQW WDUJHW +/$ P51$V LQ WKH VDPH 3&5 LQFXEDWLRQ ,Q RUGHU WR HQVXUH WKDW F'1$ WHPSODWHV RI GLIIHUHQW +/$$ DQG % P51$V ZHUH SURSRUWLRQDOO\ DPSOLILHG WKH VDPH SDLU RI SULPHUV ZDV XVHG IRU DOO +/$$ DQG % F'1$V 7KH '**( WHFKQLTXH 0\HUV HW DK f WKHQ ZDV XVHG WR VHSDUDWH WKH VDPH VL]H RI WKH DPSOLILHG 3&5 SURGXFWV DFFRUGLQJ WR PLQRU GLIIHUHQFHV RI WKHLU QXFOHRWLGH VHTXHQFHV 7KH DPRXQW RI 3&5 SURGXFW RI HDFK

PAGE 37

VSHFLILF +/$ P51$ LV TXDQWLILHG E\ SKRVSKRU LPDJLQJ WHFKQLTXH $OWKRXJK WKH VLQJOH VWUDQG FRQIRUPDWLRQ SRO\PRUSKLVP 66&3f WHFKQLTXH 2ULWD HW DK f LV DQRWKHU SRZHUIXO PHWKRG WR VHSDUDWH 573&5 +/$ SURGXFWV ZH GLG QRW DGRSW WKLV WHFKQLTXH EHFDXVH '1$ EDQGV VHSDUDWHG LQ JHOV RI 66&3 FDQ QRW EH YLVXDOL]HG E\ VLPSOH HWKLGLXP EURPLGH VWDLQLQJ DQG LQFRPSOHWH GHQDWXUDWLRQ RI '1$ VDPSOHV SULRU WR 6&&3 JHO HOHFWURSKRUHVLV FRXOG LQWURGXFH TXDQWLWDWLYH LPSUHFLVLRQ $FFRUGLQJ WR WKH UHVXOWV RI RXU VWXG\ WKH DPRXQW RI 3&5 SURGXFW IRU HDFK VSHFLILF +/$ P51$ DIWHU F\FOHV RI DPSOLILFDWLRQ DSSHDUHG VXIILFLHQW WR EH GHWHFWHG E\ HWKLGLXP EURPLGH VWDLQLQJ )LJV DQG f 1HYHUWKHOHVV WKH HWKLGLXP EURPLGH VWDLQLQJ PHWKRG DQG GHQVLWRPHWU\ ZHUH QRW XVHG IRU TXDQWLWDWLRQ RI 573&5 SURGXFWV VHSDUDWHG LQ '**( JHOV 7KH UHDVRQ IRU QRW XVLQJ WKLV VLPSOH TXDQWLWDWLYH PHWKRG LV WKDW WKH VDPH DPRXQWV RI 3&5 SURGXFWV IRU GLIIHUHQW +/$ P51$V DUH QRW HTXDOO\ VWDLQHG E\ HWKLGLXP EURPLGH LQ '**( JHOV GDWD QRW VKRZQf 7KLV ILQGLQJ RI GLIIHUHQWLDO VWDLQLQJ OLNHO\ UHVXOWHG IURP GLIIHUHQW GHJUHHV RI '1$ GHQDWXUDWLRQ LQ '**( JHOV &RQVHTXHQWO\ WKH VDPH DPRXQWV RI '1$ GR QRW ELQG WKH VDPH TXDQWLWLHV RI HWKLGLXP EURPLGH :H WKHUHIRUH XVHG SULPHUV HQGODEHOHG ZLWK \3 IRU 3&5 DQG SKRVSKRU LPDJLQJ IRU TXDQWLWDWLRQ RI HDFK VSHFLILF 3&5 SURGXFW LQ '**( JHO $IWHU RSWLPL]LQJ RXU DVVD\ FRQGLWLRQ WZR GLIIHUHQW DSSURDFKHV ZHUH XVHG WR YDOLGDWH WKH 573&5'**( PHWKRG IRU TXDQWLWDWLRQ RI GLIIHUHQW VSHFLILF +/$$ DQG % P51$V LQ FHOOV 7KH ILUVW DSSURDFK ZDV WR VWXG\ VDPSOHV FRQWDLQLQJ NQRZQ DPRXQWV RI GLIIHUHQW +/$$ DQG % 51$ WUDQVFULSWV )LJXUH f 7KH VHFRQG DSSURDFK ZDV WR FRQILUP WKH UHVXOWV RI RXU PHWKRG E\ 6, QXFOHDVH SURWHFWLRQ DVVD\ )LJXUH f 7KH UHVXOWV RI WKHVH WZR DSSURDFKHV )LJXUH DQG 7DEOH ,f LQGHHG VXSSRUW WKH YDOLGLW\ RI RXU DVVD\ PHWKRG +RZHYHU RXU PHWKRG XQOLNH DQ 6, QXFOHDVH SURWHFWLRQ DVVD\ \LHOGHG UHODWLYH EXW QRW DEVROXWH TXDQWLWLHV RI GLIIHUHQW +/$$ DQG % P51$V ,I DEVROXWH DPRXQWV RI VSHFLILF +/$ P51$V QHHG WR EH GHWHUPLQHG D VHSDUDWH PHDVXUHPHQW RI WRWDO +/$$ DQG % P51$V FDQ EH PDGH E\ DGGLWLRQDO TXDQWLWDWLYH 573&5 *LOOLODQG HW DO

PAGE 38

3UHQGHUJDVW HW DO f 7KH H[DFW DPRXQW RI HDFK VSHFLILF +/$$ RU % P51$ WKHQ FDQ EH FDOFXODWHG IURP WKH UHVXOWV RI UHODWLYH TXDQWLWLHV RI GLIIHUHQW VSHFLILF +/$ P51$V DQG WKH WRWDO +/$ P51$V 7KHUHIRUH WKH QHZO\ HVWDEOLVKHG 573&5'**( PHWKRG ZLOO EH XVHIXO WR VWXG\ WKH PHFKDQLVPV RI QRUPDO RU DOWHUHG GLIIHUHQWLDO TXDQWLWDWLYH H[SUHVVLRQ RI +/$$ DQG % DQWLJHQV LQ QRUPDO DQG QHRSODVWLF FHOOV XQGHU GLIIHUHQW SK\VLRORJLFDO RU SDWKRORJLFDO FRQGLWLRQV LH F\WRNLQH VWLPXODWLRQ YLUDO LQIHFWLRQ DQG PDOLJQDQW WUDQVIRUPDWLRQf %HFDXVH WKHUH DUH PDQ\ RWKHU GXSOLFDWHG DQG KLJKO\ FRQVHUYHG JHQHV *UHLJ HW DO /L HW DO 6SLFHU HW DO :DWNLQV f WKH UHVXOWV RXU VWXG\ DOVR GHPRQVWUDWH WKDW WKH 573&5'**( PHWKRG VKRXOG EH XVHIXO IRU VWXG\LQJ WKH GLIIHUHQWLDO TXDQWLWDWLYH H[SUHVVLRQ RI WKHVH JHQHV LQ FHOOV ,Q YLHZ RI WKH H[WUHPH SRO\PRUSKLF QDWXUH RI FODVV +/$ DQWLJHQV ZH H[SHFW WKDW WKH SURWRFRO GHVFULEHG LQ WKLV UHSRUW PD\ QRW UHVROYH FHUWDLQ FRPELQDWLRQV RI +/$ SKHQRW\SHV GXH WR OLPLWHG GLIIHUHQFHV LQ QXFOHRWLGH VHTXHQFHV HJ +/$% DQG %f ,I WKLV VLWXDWLRQ RFFXUV D GLIIHUHQW VHW RI SULPHUV FDQ EH VHOHFWHG IRU 573&5 DQG '**( FRQGLWLRQV LH JUDGLHQWV RI GHQDWXULQJ DJHQW DQGRU WHPSHUDWXUH RI JHO HOHFWURSKRUHVLVf FDQ EH PRGLILHG WR UHVROYH WKH 3&5 SURGXFWV RI GLIIHUHQW +/$ P51$V ,Q DGGLWLRQ WR WKH HLJKW FHOO OLQHV VWXGLHG E\ XV )LJXUH DQG f ZH KDYH VXFFHVVIXOO\ XVHG WKH SURWRFRO GHVFULEHG LQ WKLV UHSRUW WR GHWHUPLQH WKH UHODWLYH TXDQWLWLHV RI GLIIHUHQW +/$$ DQG % P51$V LQ WKUHH DGGLWLRQDO +/$SKHQRW\SHG /&/V 7KHVH WKUHH FHOO OLQHV DUH $ DQG %f $ DQG %f DQG $ % DQG %f +RZHYHU ZH ZHUH XQDEOH WR UHVROYH 3,/$$$ DQG %% LQ WZR DGGLWLRQDO FHOO OLQHV E\ RXU SURWRFRO ZLWKRXW PRGLILFDWLRQ %HFDXVH +/$$ DQG % DQWLJHQV WKDW KDYH EHHQ VWXGLHG E\ XV DUH SUHVHQW LQ UHODWLYHO\ KLJK IUHTXHQFLHV LQ WKH JHQHUDO SRSXODWLRQ WKH UHVXOWV RI RXU VWXG\ LQGLFDWH WKDW WKH SURWRFRO UHSRUWHG KHUHLQ VKRXOG EH DSSOLFDEOH WR PDQ\ +/$SKHQRW\SHG FHOOV %\ XVLQJ WKLV YDOLGDWHG DSSURDFK ZH DUH DEOH WR PHDVXUH WKH UHODWLYH TXDQWLWLHV RI +/$$ DQG % P51$V LQ VXEVHTXHQW VWXGLHV DV GHVFULEHG LQ WKH QH[W FKDSWHU

PAGE 39

&+$37(5 0(&+$1,606 )25 ',))(5(17,$/ 48$17,7$7,9( (;35(66,21 2) +/$$ $1' % $17,*(16 ,1 /<03+2%/$672,' &(// /,1(6 ,QWURGXFWLRQ $V GLVFXVVHG LQ &KDSWHU FODVV +/$ PROHFXOHV DUH SRO\PRUSKLF PHPEUDQH JO\FRSURWHLQV DQG FRQVLVW RI D N' KHDY\ FKDLQ HQFRGHG E\ WKH FODVVLFDO FODVV +/$ JHQHV +/$$ % DQG &f DQG D N' LQYDULDQW OLJKW FKDLQ Pf HQFRGHG E\ D QRQ 0+& JHQH %MRUNPDQ DQG 3DUKDP f 7KH DOOHOLF SRO\PRUSKLVP RI KHDY\ FKDLQV LV UHVSRQVLEOH IRU GLIIHUHQW SHSWLGHELQGLQJ VSHFLILFLWLHV RI FODVV +/$ PROHFXOHV DQG LV IXQFWLRQDOO\ LPSRUWDQW LQ SURYLGLQJ +/$UHVWULFWHG LPPXQH UHVSRQVHV %MRUNPDQ DQG 3DUKDP f 3UHYLRXV VWXGLHV KDYH VKRZQ WKDW GLIIHUHQW FODVV +/$ JHQHV DUH GLIIHUHQWLDOO\ H[SUHVVHG DQG WKH UHODWLYH TXDQWLWLHV RI +/$$ DQG % DQWLJHQV H[SUHVVHG LQ GLIIHUHQW W\SHV RI FHOOV DUH WKH VDPH LQ DQ LQGLYLGXDO .DR DQG 5LOH\ f 7KH UHODWLYH TXDQWLWLHV RI +/$$ DQG % DQWLJHQV H[SUHVVHG RQ FHOOV UHPDLQ FRQVWDQW RYHU WLPH .DR 6KLHK DQG .DR f 6XEVHTXHQW VWXGLHV RI FRPSDULQJ WKH TXDQWLWDWLYH H[SUHVVLRQ RI GLIIHUHQW VSHFLILF +/$ DQWLJHQV LQ PHPEHUV RI +/$ SKHQRW\SHG IDPLOLHV LQGLFDWHG WKDW WKH GLIIHUHQWLDO TXDQWLWDWLYH H[SUHVVLRQ RI +/$$ DQG % DQWLJHQV LV OLQNHG GLUHFWO\ WR FODVV +/$ JHQHV DQG IROORZV 0HQGHOLDQ LQKHULWDQFH .DR DQG 5LOH\ f ,Q DGGLWLRQ LW ZDV IRXQG WKDW WKH UHODWLYH DPRXQWV RI GLIIHUHQW VSHFLILF +/$ DQWLJHQV DUH SURSRUWLRQDOO\ DPSOLILHG GXULQJ XSUHJXODWHG H[SUHVVLRQ RI WRWDO FODVV +/$ DQWLJHQV LQGXFHG E\ LQWHUIHURQ WUHDWPHQW RU LQIHFWLRQ ZLWK LQIOXHQ]D YLUXV 6KLHK DQG .DR f %HFDXVH WKH DPRXQW RI +/$ DQWLJHQV H[SUHVVHG RQ FHOOV KDV EHHQ VKRZQ WR GHWHUPLQH WKH VXVFHSWLELOLW\

PAGE 40

RI FHOOV WR F\WRWR[LF 7 O\PSKRF\WHV 6KLHK HW DO f WKHVH ILQGLQJV VXSSRUW WKH SRWHQWLDO IXQFWLRQDO LPSRUWDQFH RI JHQHWLFDOO\ SUHGHWHUPLQHG TXDQWLWDWLYH +/$ H[SUHVVLRQ LQ GHWHUPLQLQJ WKH VXVFHSWLELOLW\ RI FHOOV WR F\WRWR[LF 7 FHOOV ZKLFK PD\ LQIOXHQFH WKH PRUELGLW\ RU UHFRYHU\ RI DQ LQGLYLGXDO IURP YDULRXV LQIHFWLRQ E\ LQWUDFHOOXODU SDWKRJHQV )RU WKLV UHDVRQ LW ZRXOG EH LPSRUWDQW WR JDLQ IXUWKHU XQGHUVWDQGLQJ RI KRZ GLIIHUHQWLDO H[SUHVVLRQ RI +/$ DQWLJHQV LV UHJXODWHG 7KH TXDQWLWDWLYH +/$ SURWHLQ H[SUHVVLRQ LQ FHOOV LV GHWHUPLQHG E\ WKH UDWHV RI SURWHLQ V\QWKHVLV DQG GHJUDGDWLRQ DQG WKH V\QWKHVLV RI SURWHLQ LV UHJXODWHG E\ WKH DPRXQW RI DYDLODEOH +/$P51$ DQG WKH SURWHLQ WUDQVODWLRQ HIILFLHQF\ )RU +/$ H[SUHVVLRQ LW LV DOVR GHWHUPLQHG E\ DYDLODELOLW\ RI DQWLJHQ SHSWLGHV DQG P IRU FRUUHFW IROGLQJ DQG VWDELOL]DWLRQ +RZHYHU DYDLODEOH UHVXOWV VXSSRUW WKDW WKH DYDLODELOLW\ RI DQWLJHQLF SHSWLGHV DQG P LV QRW WKH UDWHOLPLWLQJ VWHS LQ QRUPDO FHOOV 6KLHK DQG .DR f $OWKRXJK QXPHURXV VWXGLHV RQ UHJXODWLRQ RI +/$ H[SUHVVLRQ KDYH EHHQ UHSRUWHG %LVKDUD HW DO %ODQDU HW DO 'ULJJHUV HW DO *HUUDUG HW DO *LUGOHVWRQH DQG 0LOVWHLQ +DNHP HW DO 0DVXFFL HW DO 9HUVWHHJ HW DO D =DFKRZ DQG 2UU f PRVW RI WKHP KDYH RQO\ IRFXVHG RQ WKH WUDQVFULSWLRQ VWHS DIIHFWHG E\ YDULDWLRQV LQ WKH SURPRWHU VHTXHQFHV RI GLIIHUHQW +/$$ DQG % JHQHV 6WXGLHV DOVR VKRZHG WKDW FHUWDLQ VHTXHQFH YDULDWLRQV LQ WKH LQWURQV FRQWULEXWH WR WKH YDULHG TXDQWLWDWLYH H[SUHVVLRQ RI FHUWDLQ FODVV +/$ DQWLJHQ /DIRUHW 0DJRU HW DO f $OWKRXJK WKH UHVXOWV RI WKHVH VWXGLHV LQGLFDWH WKDW VHTXHQFH YDULDWLRQV RI +/$ JHQHV FRXOG GLUHFWO\ LQIOXHQFH SURWHLQ H[SUHVVLRQ PRVW RI WKHVH VWXGLHV KDYH EHHQ FRQGXFWHG E\ XVLQJ WXPRU FHOO OLQHV RU FHOOV WUDQVIHFWHG ZLWK FODVV +/$ F'1$ FRQVWUXFWV RU JHQHV 7KHUHIRUH UHVXOWV REWDLQHG IURP WKHVH VWXGLHV DUH LQVXIILFLHQW DQG GR QRW QHFHVVDULO\ H[SODLQ WKH PROHFXODU EDVLV RI JHQHWLFDOO\ SUHGHWHUPLQHG TXDQWLWDWLYH GLIIHUHQWLDO H[SUHVVLRQ RI +/$ DQWLJHQV LQ KXPDQ FHOOV )RU WKLV UHDVRQ ZH GHFLGHG WR VWXG\ KRZ GLIIHUHQW UHJXODWRU\ VWHSV RI SURWHLQ H[SUHVVLRQ DUH LQYROYHG LQ GHWHUPLQLQJ WKH TXDQWLWDWLYH GLIIHUHQWLDO H[SUHVVLRQ RI +/$ DQWLJHQV

PAGE 41

%HFDXVH HDUOLHU VWXGLHV KDYH VKRZQ WKDW WKH UHODWLYH TXDQWLWLHV RI GLIIHUHQW +/$$ DQG % DQWLJHQV LQ (%9WUDQVIRUPHG O\PSKREODVWRLG FHOO OLQHV DUH WKH VDPH DV WKHLU SDUHQWDO % O\PSKRF\WHV 6KLHK DQG .DR f DQG KRPR]\JRXV FHOO OLQHV ZLWK ZHOO FKDUDFWHUL]HG +/$ SKHQRW\SHV DUH UHDGLO\ DYDLODEOH 3UDVDG DQG
PAGE 42

PHUFDSWRHWKDQRO DQG b 13 7KH KRPRJHQDWH ZDV GLOXWHG ZLWK PO RI EXIIHU ,, ZKLFK FRQWDLQV 0 VXFURVH P0 (*7$ P0 ('7$ P0 .& P0 1D&O P0 VSHUPLQH P0 VSHUPLGLQH P0 +(3(6 S+ DQG P0 PHUFDSWRHWKDQRO 7KLV GLOXWHG KRPRJHQDWH ZDV OD\HUHG RYHU D FXVKLRQ RI EXIIHU ,, UHSUHVHQWLQJ RI WKH YROXPH RI WKH FHQWULIXJH WXEH $IWHU FHQWULIXJDWLRQ DW J IRU PLQ DW r& LQ D URWRU ZLWK VZLQJRXW EXFNHWV WKH VXSHUQDWDQW FRQWDLQLQJ WKH F\WRSODVP ZDV VDYHG IRU LVRODWLRQ RI F\WRSODVPLF 51$ 7KH VXFURVH OD\HU ZDV UHPRYHG DQG WKH SHOOHW FRQWDLQLQJ QXFOHL ZDV UHVXVSHQGHG LQ WKH VWRUDJH EXIIHU FRQWDLQLQJ P0 7ULV+&O S+ P0 1D&O P0 ('7$ b JO\FHURO P0 '77 DQG P0 SKHQ\OPHWK\OVXOIRQ\O IOXRULGH 306)f DW D FRQFHQWUDWLRQ RI [ QXFOHLSO 7RWDO QXFOHDU 51$ DQG F\WRSODVPLF 51$ ZHUH LVRODWHG XVLQJ WKH 51$HDV\ 7RWDO 51$ .LW 4,$*(1 ,QF &KDWVZRUWK &$f DFFRUGLQJ WR WKH PDQXIDFWXUHUfV SURWRFRO 5HPQDQW '1$ LQ WKH 51$ SUHSDUDWLRQ ZDV UHPRYHG E\ 51DVHIUHH '1DVH GLJHVWLRQ IRU KU DW r& 5HYHUVH 7UDQVFULSWLRQ DQG 3RO\PHUDVH &KDLQ 5HDFWLRQ 573&5f RI 1XFOHDU 51$ 7KH UHYHUVH WUDQVFULSWLRQ ZDV SHUIRUPHG DV GHVFULEHG LQ &KDSWHU H[FHSW WKDW MLJ WRWDO QXFOHDU 51$ ZDV XVHG IRU HDFK UHYHUVH WUDQVFULSWLRQ UHDFWLRQ )LYH PLFUROLWHUV RI WKH UHYHUVH WUDQVFULSWLRQ SURGXFWV ZHUH XVHG DV WHPSODWHV IRU 3&5 DV GHVFULEHG LQ &KDSWHU IRU F\FOHV XVLQJ SULPHUV GHVLJQHG EDVHG RQ WKH VHTXHQFHV RI +/$$ DQG % H[RQ DQG LQWURQ ,Q WKLV FRQGLWLRQ 3&5 DPSOLILFDWLRQ HIILFLHQF\ LV VWLOO LQ WKH OLQHDU UDQJH 7KH SULPHU VHTXHQFHV DUH n*&7 &&& $&7 &&$ 7*$ **7 $77 7&n DQG n*$$ $$7 *$$ $&& *** 7$$ $** &*&n 7KH 3&5 SURGXFWV ZHUH VHSDUDWHG E\ DJDURVH JHO HOHFWURSKRUHVLV DQG LVRODWHG E\ XVLQJ 4XLFN *HO ([WUDFWLRQ .LW 4,$*(1 ,QF &KDWVZRUWK &$f 7ZR QDQRJUDPV RI WKHVH 3&5 SURGXFWV ZHUH WKHQ XVHG DV WHPSODWHV IRU D VHFRQG URXQG 3&5 RI F\FOHV ZKLFK DPSOLILHV WKH H[RQ VHTXHQFHV LQ WKH OLQHDU UDQJH RI DPSOLILFDWLRQ HIILFLHQF\ 7KH SULPHU VHTXHQFHV IRU WKH VHFRQG URXQG 3&5 DUH n *&7 &&& $&7 &&$ 7*$ **7 $77 7& n DQG n &&7 &*& 7&7 **7 7*7 $*7 $*&

PAGE 43

n 7KHUHIRUH WKHVH 3&5 SURGXFWV DUH JHQHUDWHG RQO\ IURP WKH +/$$ DQG % WUDQVFULSWV FRQWDLQLQJ LQWURQ $QRWKHU 3&5 ZDV DOVR SHUIRUPHG WR DPSOLI\ WKH +/$$ DQG % WUDQVFULSWV LQ ZKLFK LQWURQ KDV EHHQ VSOLFHG 7KH SULPHU VHTXHQFHV IRU WKLV 3&5 DUH n &*& &*7 **$ 7$* $*& $**n QXFOHRWLGHV LQ H[RQ f DQG f *&* $7* 7$$ 7&& 77* &&*n QXFOHRWLGHV LQ H[RQ f 'HWHUPLQDWLRQ RI 7KH 5HODWLYH 4XDQWLWLHV RI F\WRSODVPLF +/$$ DQG % P51$V 8VLQJ 573&5'**( DQG 3KRVSKRU ,PDJLQJ 7KH PHWKRG LV WKH VDPH DV WKDW GHVFULEHG LQ GHWDLOV LQ &KDSWHU %ULHIO\ ILUVW VWUDQG +/$ F'1$V ZHUH SUHSDUHG E\ UHYHUVH WUDQVFULSWLRQ RI _/OJ RI WRWDO F\WRSODVPLF 51$ XVLQJ WKH SULPHU r$&$ *&7 &&$*f $*f7* $ &7f& $&$ff ZKLFK LV VSHFLILF DQG FRPSOHPHQWDU\ RQO\ WR WKH QXFOHRWLGH VHTXHQFHV RI H[RQ RI DOO FODVV +/$ $ DQG % JHQHV EXW QRW WR WKRVH RI +/$& JHQHV $IWHU LQDFWLYDWLRQ RI UHYHUVH WUDQVFULSWDVH E\ KHDWLQJ DW r& IRU PLQ WKH +/$$ DQG % F'1$V ZHUH XVHG IRU TXDQWLWDWLYH 573&5 WR GHWHUPLQH WKH UHODWLYH DPRXQWV RI GLIIHUHQW +/$$ DQG % P51$V E\ '**( DQG SKRVSKRU LPDJLQJ DQDO\VLV 7KH QXFOHRWLGH VHTXHQFHV RI WKH SULPHUV XVHG IRU TXDQWLWDWLYH 3&5 LQ DPSOLI\LQJ WKH FRGLQJ VHTXHQFH DUH f&*& &*7 **$ 7$* $*& $**f DQG f*&* $7* 7$$ 7&& 77* &&*f ZKLFK DUH FRPSOHPHQWDU\ WR WKH FRQVHUYHG DQWLVHQVH DQG VHQVH QXFOHRWLGH VHTXHQFHV LQ H[RQ DQG H[RQ RI DOO FODVV +/$ P51$V UHVSHFWLYHO\ 7KH DPSOLILHG SURGXFWV HQFRPSDVV WKH FRGLQJ VHTXHQFH 4XDQWLWDWLYH 3&5 ZDV SHUIRUPHG IRU F\FOHV 2QH SULPHU ZDV HQGODEHOHG ZLWK >\3@$73 DQG WKH +/$$ DQG % F'1$ SUHSDUHG IURP F\WRSODVPLF 51$ ZDV XVHG DV WHPSODWHV 'HQDWXULQJ *UDGLHQW *HO (OHFWURSKRUHVLV W2**( '**( ZDV SHUIRUPHG LQ PP WKLFN b SRO\DFU\ODPLGH DFU\ODPLGH ELVDFU\ODPLGH f JHO XVLQJ '*(1(r1 'HQDWXULQJ *UDGLHQW *HO (OHFWURSKRUHVLV

PAGE 44

6\VWHP %LR5DG /DERUDWRULHV +HUFXOHV &$f 7KH SRO\DFU\ODPLGH JHO FRQWDLQHG D OLQHDUO\ LQFUHDVLQJ GHQDWXUDQW JUDGLHQW IURP b WR b 7KH b GHQDWXUDQW FRQWDLQV 0 XUHD DQG b ZYf GHLRQL]HG IRUPDPLGH (OHFWURSKRUHVLV ZDV SHUIRUPHG DW r& 9 IRU WR KRXUV LQ P0 7ULVDFHWDWH S+ FRQWDLQLQJ P0 ('7$ 7$(f $IWHU HOHFWURSKRUHVLV WKH JHOV ZHUH GULHG IRU DXWRUDGLRJUDSK\ DQG SKRVSKRU LPDJLQJ DQDO\VLV 3&5 SURGXFW RI HDFK +/$$ RU % P51$ LQ '**( JHO ZDV LGHQWLILHG E\ XVLQJ 3&5 SURGXFWV SUHSDUHG IURP WKH SODVPLGV FRQWDLQLQJ FORQHG +/$F'1$V RI NQRZQ VSHFLILFLW\ ,()3$*( DQG ,PPXQREORWWLQJ IRU 0HDVXULQJ 7KH 5HODWLYH 4XDQWLWLHV RI +/$$ DQG % $QWLJHQV LQ /&/V 2QH PLOOLRQ (%9WUDQVIRUPHG O\PSKREODVWRLG FHOOV ZHUH VROXELOL]HG LQ PO 7ULWRQ ;O 7;f 6LJPD 6W /RXLV 02 86$f FRQWDLQLQJ EXIIHU DW r& $IWHU SKDVH VHSDUDWLRQ RI 7; GHWHUJHQW DW r& WKH H[WUDFWHG PHPEUDQH SURWHLQV LQ 7; GHWHUJHQW SKDVH ZHUH WUHDWHG ZLWK OO RI QHXUDPLQLGDVH 8PO 7\SH ; 6LJPDf DW r& IRU KRXUV XQGHU FRQVWDQW PL[LQJ LQ D 7KHUPRPL[HU (SSHQGRUI +DPEHUJ *HUPDQ\f WR DYRLG SKDVH VHSDUDWLRQ $IWHU QHXUDPLQLGDVH GLJHVWLRQ WKH GHWHUJHQW SKDVH ZDV FROOHFWHG DQG GLOXWHG ZLWK DQ HTXDO YROXPH RI ,() EXIIHU IRU ,()3$*( $IWHU ,() 3$*( WKH ,() JHOV ZHUH ZDVKHG DQG SURWHLQV LQ WKH JHOV ZHUH HOHFWURSKRUHWLFDOO\ WUDQVIHUUHG WR ,PPRELORQ PHPEUDQH 0LOOLSRUH %HGIRUG 0$ 86$f DW YROWV IRU PLQXWHV 7KHUHDIWHU WKH :HVWHUQ EORWV ZHUH EORFNHG ZLWK b QRQIDW PLON DQG LQFXEDWHG VHTXHQWLDOO\ ZLWK DQWL+/$ KHDY\FKDLQ P$E DQG DONDOLQH SKRVSKDWDVH FRQMXJDWH RI UDEELW DQWLPRXVH ,J* DQWLERG\ 7KH GHWDLOHG SURFHGXUHV ZHUH UHSRUWHG SUHYLRXVO\ .DR DQG 5LOH\ f ,PPXQRSUHFLSLWDWLRQ RI 3XOVHFKDVH 5DGLRODEHOHG +/$ $QWLJHQV IURP /&/V (% 9WUDQ VIRUPHG KXPDQ O\PSKREODVWRLG FHOO OLQHV '& f ZHUH FXOWXUHG LQ 530, PHGLXP *,%&2 %5/ /LIH 7HFKQRORJLHV

PAGE 45

*UDQG ,VODQG 1
PAGE 46

7UHDWPHQW RI /&/V ZLWK GLFKORUROEHWD'ULERIXUDQRVYOEHQ]LPLGD]ROH '5%f )LYH PLOOLRQ RI (%9WUDQVIRUPHG O\PSKREODVWRLG FHOOV ZHUH WUHDWHG ZLWK SJPO '5% LQ 530, FRPSOHPHQWHG ZLWK b )&6 IRU RU KRXUV 7RWDO F\WRSODVPLF 51$ ZDV H[WUDFWHG DQG _OJ RI WKH 51$ ZDV XVHG IRU UHYHUVH WUDQVFULSWLRQ DV GHVFULEHG DERYH LQ D WRWDO YROXPH RI MLO 7KH UHODWLYH TXDQWLWLHV RI +/$$ DQG % P51$V ZHUH GHWHUPLQHG E\ TXDQWLWDWLYH 3&5'**( DQG SKRVSKRU LPDJLQJ DV GHVFULEHG DERYH 1XFOHDU UXQRQ 7HQ PLOOLRQ QXFOHL RI /&/V ZHUH LQFXEDWHG IRU PLQ DW r& LQ SL RI D EXIIHU FRQWDLQLQJ P0 1+f6 P0 7ULV+&O S+ f P0 0J&O P0 0Q&O P0 1D&O P0 ('7$ P0 306) P0 '77 P0 HDFK 173 P0 FUHDWLQH SKRVSKDWH PJPO FUHDWLQH SKRVSKRNLQDVH DQG b JO\FHURO 7KH UHDFWLRQ ZDV VWRSSHG E\ DGGLQJ XQLWV RI '1DVH DQG LQFXEDWLQJ IRU DQRWKHU PLQ DW r& 7KHQ WKH GHQDWXULQJ EXIIHU FRQWDLQLQJ JXDQLGLQLXP WKLRF\DQDWH WR EH XVHG LQ 51$ SUHSDUDWLRQ ZDV LPPHGLDWHO\ DGGHG LQWR WKH PL[WXUH DQG WKH QXFOHDU 51$ ZDV H[WUDFWHG DV GHVFULEHG DERYH $XWRUDGLRJUDSKY SKRVSKRU LPDJLQJ DQG GHQVLWRPHWU\ )RU DXWRUDGLRJUDSK\ WKH JHOV ZHUH H[SRVHG WR )XML 0HGLFDO ;UD\ ILOP )XML 3KRWR )LOP &R /WG -DSDQf IRU KU '**(f RU WR .RGDN %LRPD[ 05 ILOP .RGDN 6FLHQWLILF ,PDJLQJ 6\VWHPV 5RFKHVWHU 1
PAGE 47

5HVXOWV 'HJUDGDWLRQ RI 'LIIHUHQW +/$$ DQG % $QWLJHQV LQ &HOOV %HFDXVH WKH VWHDG\ VWDWH SURWHLQ OHYHOV DUH GHWHUPLQHG E\ UDWHV RI GHJUDGDWLRQ DQG V\QWKHVLV ZH ILUVW VWXGLHG ZKHWKHU GLIIHUHQW +/$$ DQG % DQWLJHQV DUH SURSRUWLRQDOO\ GHJUDGHG DIWHU V\QWKHVLV XVLQJ SXOVHFKDVH H[SHULPHQWV LQ ILYH GLIIHUHQW O\PSKREODVWRLG FHOO OLQHV 7KH +/$ SURWHLQV LQ FHOOV ZHUH SXOVHODEHOHG ZLWK 6PHWKLRQLQH IRU KRXUV DQG FKDVHG ZLWK H[FHVV DPRXQW RI FROG PHWKLRQLQH IRU KRXUV 7KH +/$ SURWHLQV ZHUH LPPXQRSUHFLSLWDWHG ZLWK : PRQRFORQDO DQWLERG\ ZKLFK UHFRJQL]HV WKH QDWLYH IRUP RI FODVV +/$ DQWLJHQV $IWHU QHXUDPLQLGDVH GLJHVWLRQ GLIIHUHQW +/$$ DQG % SURWHLQV ZHUH VHSDUDWHG E\ ,() JHO HOHFWURSKRUHVLV 7KH UHODWLYH TXDQWLWLHV RI HDFK 6ODEHOHG +/$$ DQG % SURWHLQ ZDV PHDVXUHG E\ DXWRUDGLRJUDSK\ DQG GHQVLWRPHWU\ 7KH UHVXOWV RI WKLV VWXG\ LQ WKHVH ILYH FHOO OLQHV ZLWK KRPR]\JRXV +/$$ DQG % DQWLJHQV VKRZ WKDW WKH UHODWLYH TXDQWLWLHV RI 6PHWKLRQLQH ODEHOHG +/$$ DQG % SURWHLQV UHPDLQ VLPLODU DIWHU KU FKDVH ZLWK FROG PHWKLRQLQH )LJXUH f 7KH GLIIHUHQFHV RI UHODWLYH DPRXQWV RI +/$$ DQG % DQWLJHQV EHIRUH DQG DIWHU FROG FKDVH ZHUH ZLWKLQ WKH H[SHULPHQWDO YDULDWLRQ DQG ZHUH QRW VLJQLILFDQW 7KXV WKLV ILQGLQJ LQGLFDWHG WKDW GLIIHUHQW VSHFLILF +/$$ DQG % SURWHLQV KDYH VLPLODU VWDELOLWLHV DQG DUH GHJUDGHG SURSRUWLRQDOO\ 7KH 5HODWLYH 4XDQWLWLHV RI 'LIIHUHQW +/$$ DQG % 3URWHLQV *HQHUDOO\ $UH 3URSRUWLRQDOO\ &RUUHODWHG ZLWK 7KDW RI 7KHLU P51$V %HFDXVH GLIIHUHQW +/$$ DQG % SURWHLQV KDYH VLPLODU GHJUDGDWLRQ UDWHV LQ WKHVH VWXGLHG FHOO OLQHV ZH WKHQ GHWHUPLQHG ZKHWKHU WKH UHODWLYH TXDQWLWLHV RI GLIIHUHQW +/$$ DQG % SURWHLQV DUH FRUUHODWHG ZLWK WKRVH RI WKHLU UHVSHFWLYH P51$V 7KH UHODWLYH TXDQWLWLHV RI GLIIHUHQW +/$$ DQG % SURWHLQV ZHUH PHDVXUHG E\ ,() JHO HOHFWURSKRUHVLV LPPXQREORWWLQJ DQG GHQVLWRPHWULF DQDO\VLV .DR DQG 5LOH\ f 7KH UHODWLYH TXDQWLWLHV RI WKHLU P51$V ZHUH GHWHUPLQHG E\ 573&5'**( DQG SKRVSKRU LPDJLQJ /LX DQG .DR f 7KH UHVXOWV VKRZQ LQ 7DEOH LQGLFDWH WKDW WKH UHODWLYH TXDQWLWLHV RI GLIIHUHQW +/$$

PAGE 48

>P % % $ $ SP % % % /&/ )LJXUH 7XUQRYHU RI 6PHWKLRQLQHODEHOHG +/$$ DQG % SURWHLQV LQ O\PSKREODVWRLG FHOO OLQHV /&/Vf $f $XWRUDGLRJUDSKV RI ',() JHO (%9WUDQVIRUPHG O\PSKREODVWRLG FHOO ZHUH SXOVHODEHOHG ZLWK >6@PHWKLRQLQH IRU KRXUV DQG FKDVHG ZLWK FROG PHWKLRQLQH IRU KRXU f RU KRXUV f 7KH LPPXQRSUHFLSLWDWHG ),/$ SURWHLQV ZHUH VHSDUDWHG E\ ,() JHO HOHFWURSKRUHVLV %f 7KH UHODWLYH TXDQWLWLHV RI >f6@ PHWKLRQLQHODEHOHG +/$$ DQG % SURWHLQV EHIRUH DQG DIWHU KRXU FROG PHWKLRQLQH FKDVH 7KH TXDQWLWLHV RI >6@ PHWKLRQLQHODEHOHG +/$$ DQG % SURWHLQV ZHUH GHWHUPLQHG E\ VFDQQLQJ GHQVLWRPHWU\ (DFK EDU UHSUHVHQWV WKH PHDQ YDOXH RI WZR H[SHULPHQWV 7KH YDULDWLRQ EHWZHHQ WKHVH WZR H[SHULPHQWV LV OHVV WKDQ b

PAGE 49

7DEOH 5HODWLYH TXDQWLWLHV RI +/$ SURWHLQV DQG P51$V LQ WHQ GLIIHUHQW O\PSKREODVWRLG FHOO OLQHV /&/Vf /&/ 3KHQRW\SH 5HODWLYH 4XDQWLW\ RI 3URWHLQA bf 0HDQs6'f Qf 5HODWLYH 4XDQWLW\ RI P51$O-> bf 0HDQ6'f Qf $ s fr fr % s f f $ s f f % s f f $ f f % s f f $ f f % f f 6+ $ f f $ f f %%i f % f % f &* $YDU f s f $ f f % f s f % f f $ f s f % f f '& $OO f f $ f f % f f % f s f $ s f f % f f $ f f %%W f f I 7KH UHODWLYH TXDQWLWLHV RI +/$$ DQG % SURWHLQV ZHUH PHDVXUHG E\ ,() JHO HOHFWURSKRUHVLV LPPXQREORWWLQJ DQG VFDQQLQJ GHQVLWRPHWU\ 7KH UHODWLYH TXDQWLWLHV RI +/$$ DQG % P51$V ZHUH PHDVXUHG E\ TXDQWLWDWLYH 573&5'**( DQG SKRVSKRU LPDJLQJ 5HODWLYH TXDQWLW\ RI +/$$ RU % TXDQWLW\ RI +/$$ RU %TXDQWLW\ RI +/$ $ TXDQWLW\ RI +/$%ff [ b r 1XPEHU RI LQGHSHQGHQW PHDVXUHPHQWV i +/$% DQG% SURWHLQV FDQ QRW EH VHSDUDWHG E\ ,()3$*( 7KH\ ZHUH TXDQWLILHG WRJHWKHU W 573&5 SURGXFWV RI +/$% DQG % P51$V FDQ QRW EH VHSDUDWHG E\ '**( 7KH\ ZHUH PHDVXUHG WRJHWKHU

PAGE 50

DQG % SURWHLQV DUH SURSRUWLRQDO WR WKRVH RI WKHLU P51$V LQ WKH DQG FHOO OLQHV VLQFH GLIIHUHQW +/$ SURWHLQV KDYH VLPLODU VWDELOLW\ WKHVH UHVXOWV VXJJHVW WKDW LQ WKHVH FHOO OLQHV GLIIHUHQW +/$$ DQG % P51$V KDYH VLPLODU SURWHLQ V\QWKHVLV UDWHV +RZHYHU WKH UHODWLYH TXDQWLWLHV RI +/$$ DQG % SURWHLQV DUH QRW SURSRUWLRQDOO\ FRUUHODWHG ZLWK WKHLU P51$V LQ +/$$ SRVLWLYH FHOO OLQHV DQG '&f ,W DSSHDUV WKDW SURWHLQV DUH H[SUHVVHG LQ KLJKHU TXDQWLWLHV UHODWLYH WR WKHLU P51$ WUDQVFULSWV LQ WKHVH FHOO OLQHV 7KLV SKHQRPHQRQ ZDV DOVR REVHUYHG LQ +/$% SRVLWLYH FHOO OLQHV 6+ DQG &*f EXW QRW LQ WKH FHOO OLQH ZKLFK LV KRPR]\JRXV IRU +/$$ DQG % 7KHVH UHVXOWV VXJJHVW WKDW ERWK +/$$ DQG % P51$V PD\ EH PRUH HIILFLHQW LQ V\QWKHVL]LQJ +/$ SURWHLQV 7KLV SRVVLELOLW\ LV IXUWKHU VXEVWDQWLDWHG E\ WKH SUHGRPLQDQFH RI +/$$ DQG % SURWHLQ EDQGV RQ ,() JHO )LJXUH f $ UHODWLYH ODUJH QXPEHU RI +/$$ SRVLWLYH FHOO OLQHV ZHUH VWXGLHG LQ RUGHU WR VXEVWDQWLDWH RXU LQLWLDO REVHUYDWLRQ L\! U U &' &FR &' &' &' &' &' &' &2 /n WR U R R &' &' 2 R ; R U! OM )LJXUH ,()LPPXQREORW RI +/$$ DQG % DQWLJHQV IURP QLQH GLIIHUHQW O\PSKREODVWRLG FHOO OLQHV 7KH ORZHU GLDJUDP VKRZV WKH VSHFLILFLWLHV RI WKHVH DQWLJHQV 7KH UHODWLYH DPRXQWV RI +/$ SURWHLQV DUH GHWHUPLQHG E\ VFDQQLQJ GHQVLWRPHWU\

PAGE 51

'LIIHUHQW +/$$ DQG % P51$V +DYH 6LPLODU 6WDELOLWLHV %HFDXVH WKH VWHDG\ VWDWH RI +/$ P51$ LV UHJXODWHG E\ ERWK +/$ P51$ SURGXFWLRQ DQG GHJUDGDWLRQ ZKHWKHU GLIIHUHQW +/$$ DQG % P51$V KDYH WKH VDPH VWDELOLWLHV FRXOG EH D IDFWRU LQ GHWHUPLQLQJ WKHLU GLIIHUHQWLDO TXDQWLWLHV %\ XVLQJ '5% WR LQKLELW P51$ V\QWKHVLV ZH SHUIRUPHG +/$ P51$ GHJUDGDWLRQ VWXGLHV LQ VHYHQ O\PSKREODVWRLG FHOO OLQHV )LUVW ZH VWXGLHG WKH LQKLELWLRQ RI +/$ P51$ DV D IXQFWLRQ RI GLIIHUHQW FRQFHQWUDWLRQV RI '5% )LJXUH $f DQG IRXQG WKDW MOJPO RI '5% FDQ PD[LPDOO\ LQKLELW +/$ P51$ V\QWKHVLV :H DOVR FRQGXFWHG D WLPH FRXUVH VWXG\ )LJXUH %f DQG IRXQG WKDW LQ RUGHU WR GHWHFW VLJQLILFDQW GHJUDGDWLRQ RI +/$ P51$ KRXU LQFXEDWLRQ LV VXIILFLHQW 2Q WKH EDVLV RI WKHVH VWXGLHV ZH VWXGLHG WKH UHODWLYH TXDQWLWLHV RI +/$$ DQG % P51$V DIWHU KRXU WUHDWPHQW ZLWK _LJPO RI '5% 7KH UHODWLYH TXDQWLWLHV RI +/$$ DQG % P51$V LQ WKHVH FHOOV EHIRUH DQG DIWHU '5% WUHDWPHQW ZHUH PHDVXUHG E\ XVLQJ 573&5'**( DQG SKRVSKRU LPDJLQJ 7KH UHVXOWV VXPPDUL]HG LQ )LJXUH VKRZ WKDW GLIIHUHQW +/$$ DQG % P51$V DUH SURSRUWLRQDOO\ GHJUDGHG LQ ILYH RI WKH VHYHQ VWXGLHG FHOO OLQHV $ VOLJKW GLIIHUHQFH EHWZHHQ WKH VWDELOLWLHV RI +/$$ DQG % P51$V ZDV QRWHG LQ WKH DQG FHOO OLQHV 2XU UHVXOWV LQGLFDWHG P51$ VWDELOLW\ LV QRW D PDMRU IDFWRU LQIOXHQFLQJ WKH GLIIHUHQWLDO H[SUHVVLRQ RI +/$$ DQG % DQWLJHQV LQ PDMRULW\ RI FHOO OLQHV +RZHYHU WKLV PHFKDQLVP LV RSWLRQDO LQ VRPH FHOO OLQHV 3UHP51$ 6SOLFLQJ ,V $Q ,PSRUWDQW )DFWRU 'HWHUPLQLQJ 7KH 4XDQWLWDWLYH 'LIIHUHQWLDO ([SUHVVLRQ RI +/$$ DQG % $QWLJHQV %HFDXVH GLIIHUHQW +/$$ DQG % P51$V KDYH VLPLODU VWDELOLWLHV LQ PDQ\ /&/V LW LV OLNHO\ WKDW +/$$ DQG % P51$V DUH GLIIHUHQWLDOO\ SURGXFHG 7KH P51$ SURGXFWLRQ UDWHV DUH GHWHUPLQHG E\ WUDQVFULSWLRQ DQGRU SUHP51$ VSOLFLQJ UDWHV 2XU RULJLQDO SODQ ZDV WR XVH 3&5EDVHG QXFOHDU UXQRQ WR GHWHUPLQH ZKHWKHU +/$$ DQG % JHQHV DUH GLIIHUHQWLDOO\ WUDQVFULEHG ,VRODWHG QXFOHL ZHUH LQFXEDWHG ZLWK RU ZLWKRXW 173V 7KHQ QXFOHDU 51$ ZDV H[WUDFWHG DQG 573&5 ZDV SHUIRUPHG WR DPSOLI\ WKH XQVSOLFHG WUDQVFULSWV 7KH GLIIHUHQFH RI WKH PHDVXUHPHQWV IURP WKHVH WZR LQFXEDWLRQV VKRXOG

PAGE 52

'5% LJPOf 2 % $ 6 51$ f f f m '5% ILJPOf 1R '5% 7LPH KUf % 0.0nn V Z} $ !0M_MM‹‹1Nf 6 51$ )LJXUH 7KH HIIHFW RI '5% WUHDWPHQW RQ +/$ P51$ OHYHOV $f 7UHDWPHQW RI /&/ ZLWK GLIIHUHQW FRQFHQWUDWLRQV RI '5% IRU KRXUV $IWHU WUHDWPHQW RI FHOOV ZLWK GLIIHUHQW FRQFHQWUDWLRQV RI '5% WZR PLFURJUDPV RI WRWDO F\WRSODVPLF 51$ ZHUH XVHG DV WHPSODWH IRU 4XDQWLWDWLYH 573&5 WR DPSOLI\ +/$$ DQG % P51$V 7KH 573&5 SURGXFWV RI +/$$ DQG % P51$V ZHUH VHSDUDWHG E\ '**( DQG TXDQWLILHG E\ SKRVSKRU LPDJLQJ 7KH GRW EORW RI 6 ULERVRPDO 51$ LQ ILJ RI HDFK 51$ VDPSOH ZDV DOVR SHUIRUPHG WR GHWHUPLQH ZKHWKHU 51$ IURP VDPH QXPEHU RI FHOOV ZHUH XVHG LQ 573&5 %f 7UHDWPHQW RI /&/ ZLWK _LJ_LO RI '5% IRU GLIIHUHQW WLPHV $IWHU WUHDWPHQW RI FHOOV ZLWK GLIIHUHQW FRQFHQWUDWLRQV RI '5% WZR PLFURJUDPV RI WRWDO F\WRSODVPLF 51$ ZHUH XVHG DV WHPSODWH IRU 4XDQWLWDWLYH 573&5 WR DPSOLI\ +/$$ DQG % P51$V 7KH 57 3&5 SURGXFWV RI +/$$ DQG % P51$V ZHUH VHSDUDWHG E\ '**( DQG TXDQWLILHG E\ SKRVSKRU LPDJLQJ 7KH VORW EORW RI 6 ULERVRPDO 51$ LQ ILJ RI HDFK 51$ VDPSOH ZDV DOVR SHUIRUPHG WR GHWHUPLQH ZKHWKHU 51$ IURP VDPH QXPEHU RI FHOOV ZHUH XVHG LQ 573&5

PAGE 53

$f '& ,N L‹I % % % Sr % fmDSL" % Wr 0‹ $ A % mSIH f§ $ P DS G__ MP $$] 5553 m363 % $ $ $ m‘} rrr $mr £r 53 P 8 %f /&/ )LJXUH 7XUQRYHU RI +/$$ DQG % P51$V LQ /&/V $f 3KRVSKRU LPDJHV RI '**( JHOV IRU PHDVXULQJ WKH UHODWLYH TXDQWLWLHV RI +/$$ DQG % P51$V EHIRUH DQG DIWHU KRXU '5% WUHDWPHQW %f 5DWLRV PHDQs6'f RI +/$$ WR % P51$V LQ GLIIHUHQW O\PSKREODVWRLG FHOO OLQHV EHIRUH DQG DIWHU KU LQKLELWLRQ ZLWK LJPO RI '5% (DFK YDOXH UHSUHVHQWV WKH PHDQ RI WZR RU WKUHH VHSDUDWH PHDVXUHPHQWV ZHUH SHUIRUPHG IRU HDFK GHWHUPLQDWLRQ r S UHSUHVHQW WKH QHZO\ V\QWKHVL]HG WUDQVFULSWV 7KH UHVXOWV RI 3&5EDVHG QXFOHDU UXQRQ IURP FHOO OLQHV VKRZV WKDW WKHUH ZDV RQO\ D VPDOO LQFUHDVH LQ WKH DPRXQW RI XQVSOLFHG WUDQVFULSWV )LJXUH f 7KH GLIIHUHQFH UHSUHVHQWV OHVV WKDQ b VXJJHVWLQJ D UHODWLYHO\ ODUJH SUHH[LVWLQJ SRRO RI XQVSOLFHG +/$ WUDQVFULSWV 7KLV REVHUYDWLRQ ZDV IXUWKHU VXSSRUWHG E\ WKH UHVXOWV IURP 573&5 RI QXFOHDU 51$ LQ ZKLFK WKH VHTXHQFHV VSDQQLQJ H[RQ DQG H[RQ ZHUH DPSOLILHG )LJXUH f 'XH WR WKLV ODUJH SUHH[LVWLQJ SRRO ZH ZHUH XQDEOH WR UHOLDEO\ VWXG\ WKH GLIIHUHQWLDO WUDQVFULSWLRQ RI ),/$ JHQHV E\ XVLQJ WKH 3&5 EDVHG QXFOHDU UXQRQ DSSURDFK 7KH UHVXOWV DOVR VXJJHVW WKDW +/$ SUHP51$ VSOLFLQJ FRXOG EH D UDWHOLPLWLQJ VWHS LQ UHJXODWLQJ WKH GLIIHUHQWLDO +/$ P51$ SURGXFWLRQ 7R LQYHVWLJDWH ZKHWKHU WKH UHODWLYH TXDQWLWLHV RI GLIIHUHQW +/$$ DQG % WUDQVFULSWV DUH GHWHUPLQHG E\ VSOLFLQJ WUDQVFULSWLRQ RU ERWK ZH GHFLGHG WR PHDVXUH WKH UHODWLYH DPRXQWV

PAGE 54

)LJXUH 3&5EDVHG QXFOHDU UXQRQ LQ IRXU /&/V 1XFOHDU UXQRQ UHDFWLRQ ZLWK f RU ZLWKRXW f 173V WKH +/$$ DQG % QXFOHDU WUDQVFULSWV ZHUH XVHG IRU TXDQWLWDWLYH 57 3&5 7KH 3&5 SULPHUV f 7** *&* **7 *$* 7*& *** *7&f DQG f*$$ $$7 *$$ $&& *** 7$$ $** &*&f FRUUHVSRQG WR WKH VHTXHQFHV RI +/$ JHQH LQ LQWURQ DQG LQWURQ UHVSHFWLYHO\ ,Q YLWUR V\QWKHVL]HG ;HI P51$ DGGHG EHIRUH 51$ H[WUDFWLRQ DV DQ H[RJHQRXV FRQWURO ZDV DOVR TXDQWLILHG E\ 573&5 0 '1$ PDUNHUV 8QVSOLFHG H[RQ LQWURQ H[RQ ES H[RQ H[RQ 6SOLFHG aaa L ES )LJXUH 3UHVHQFH RI DEXQGDQW XQVSOLFHG ),/$ WUDQVFULSWV LQ QXFOHL $JDURVH JHO HOHFWURSKRUHVLV VKRZV WZR VL]HV ES DQG ESf RI 573&5 SURGXFWV IURP +/$ QXFOHDU WUDQVFULSWV 7KH OLJKW EDQGV VLJKWO\ VKRUWHU WKDQ ESf DUH OLNHO\ WKH 573&5 SURGXFWV RI XQVSOLFHG QXFOHDU +/$ WUDQVFULSWV ZLWK VKRUWHU LQWURQ 6HTXHQFHV RI WKH 3&5 SULPHUV FRUUHVSRQG WR VHTXHQFHV RI H[RQ DQG RI +/$ JHQHV RI +/$$ DQG % WUDQVFULSWV EHIRUH DQG DIWHU VSOLFLQJ LQ QXFOHL 7KH UHODWLYH TXDQWLWLHV RI +/$$ DQG % WUDQVFULSWV LQ F\WRSODVP DQG QXFOHL ZHUH GHWHUPLQHG E\ 573&5'**(

PAGE 55

DQG SKRVSKRU LPDJLQJ 7KUHH GLIIHUHQW JURXSV RI WUDQVFULSWV ZHUH VWXGLHG )LJXUH f 7KH ILUVW JURXS DUH WKH SUHVSOLFHG WUDQVFULSWV ZLWK LQWDFW LQWURQ LQ QXFOHL *URXS ,f 7KH 7RWDO QXFOHDU 51$ SUHP51$f VSOLFHG F L L 573&5 A '1$ IUDJPHQW H[RQ SDUWLDO LQWURQ f 573&5 3&5-U '1$ IUDJPHQW ([RQ f 7RWDO F\WRSODVPLF 51$ P51$ afO aaO 573&5 W '**( '1$ IUDJPHQW '1$ IUDJPHQW SDUWLDO H[RQ SDUWLDO H[RQ f SDUWLDO H[RQ SDUWLDO H[RQ f , , , A '**( W '**( )LJXUH ([SHULPHQWDO GHVLJQ IRU VWXG\ RI +/$ P51$ SURGXFWLRQ VHFRQG JURXS RI WUDQVFULSWV DUH WKH VSOLFHG WUDQVFULSWV ZLWKRXW LQWURQ LQ QXFOHL *URXS ,,f 7KH WKLUG JURXS DUH WKH PDWXUH P51$ WUDQVFULSWV LQ F\WRSODVP *URXS ,,,f %HFDXVH ZH ZHUH DEOH WR VHSDUDWH 573&5 SURGXFWV JHQHUDWHG IURP H[RQ RU H[RQ DQG H[RQ RI +/$$ DQG % WUDQVFULSWV E\ XVLQJ '**( WKLV DSSURDFK SURYLGHG XV ZLWK D VLPSOH ZD\ WR VWXG\ ZKHWKHU SUHP51$ VSOLFLQJ SOD\V DQ\ FULWLFDO UROH LQ GHWHUPLQLQJ WKH TXDQWLWDWLYH GLIIHUHQWLDO H[SUHVVLRQ RI +/$$ DQG % DQWLJHQV 7R DPSOLI\ WKH ILUVW JURXSRI +/$$ DQG % WUDQVFULSWV LQ ZKLFK LQWURQ KDV QRW EHHQ VSOLFHG ZH ILUVW XVHG D SDLU RI SULPHUV FRPSOHPHQWDU\ WR WKH n HQG RI H[RQ DQG D VHTXHQFH LQ LQWURQ 7KH DPSOLILHG SURGXFWV ZHUH JHQHUDWHG IURP WKH WUDQVFULSWV FRQWDLQLQJ LQWURQ 7KHVH 3&5 SURGXFWV ZHUH SXULILHG DQG XVHG DV WHPSODWH IRU VHFRQG URXQG RI 3&5 WR DPSOLI\ WKH +/$$ DQG % H[RQ VHTXHQFHV ZKLFK ZHUH VHSDUDWHG E\ '**( DQG TXDQWLILHG E\ SKRVSKRU LPDJLQJ )RU

PAGE 56

DPSOLI\LQJ *URXS ,, DQG *URXS ,,, RI +/$$ DQG % WUDQVFULSWV WKH SURWRFROV GHVFULEHG LQ FKDSWHU DUH XVHG LQ ZKLFK WKH 3&5 SURGXFWV RQO\ LQFOXGH SDUWLDO H[RQ DQG SDUWLDO H[RQ 7KH UHVXOWV RI WKLV VWXG\ LQ QLQH O\PSKREODVWRLG FHOO OLQHV DUH VKRZQ LQ )LJXUH 2XU UHVXOWV VKRZ WKDW LQ FHOO OLQHV WKH UHODWLYH TXDQWLWLHV RI +/$$ DQG % WUDQVFULSWV DUH WKH VDPH IRU DOO WKUHH JURXSV RI WUDQVFULSWV )RU WKH FHOO OLQH ZKLFK LV KRPR]\JRXV IRU +/$$ DQG % WKH UHODWLYH TXDQWLWLHV RI +/$$ WUDQVFULSWV SULRU WR VSOLFLQJ LV JUHDWHU WKDQ WKDW RI VSOLFHG WUDQVFULSWV LQ QXFOHL DQG F\WRSODVP 7KLV ILQGLQJ VXJJHVW XQHTXDO UDWHV RI VSOLFLQJ IRU +/$$ DQG % P51$V )LJXUH f 7KH VDPH ILQGLQJ ZDV REWDLQHG IRU DOO $SRVLWLYH FHOO OLQHV DQG '&f 2XU UHVXOWV GHPRQVWUDWHG WKDW QXFOHDU VSOLFLQJ RI +/$ SUHP51$V FRXOG SOD\ D PDMRU UROH LQIOXHQFLQJ WKH TXDQWLWDWLYH GLIIHUHQWLDO H[SUHVVLRQ RI +/$$ DQG % DQWLJHQV 'LVFXVVLRQ 7KH SULPDU\ SXUSRVH RI WKLV VWXG\ LV WR GHWHUPLQH WKH UROHV RI JHQH WUDQVFULSWLRQ VSOLFLQJ P51$ WXUQRYHU DQG WUDQVODWLRQ LQ UHJXODWLRQ RI JHQHWLFDOO\ SUHGHWHUPLQHG GLIIHUHQWLDO H[SUHVVLRQ RI GLIIHUHQW +/$$ DQG % DQWLJHQV 7KH UHVXOWV RI RXU VWXGLHV VKRZ WKDW UHJXODWLRQ RI WKH TXDQWLWDWLYH GLIIHUHQWLDO H[SUHVVLRQ RI GLIIHUHQW +/$$ DQG % DQWLJHQV LV GHWHQQLQHG E\ FRPELQDWLRQV RI PXOWLSOH VWHSV WKDW LQFOXGH +/$ JHQH WUDQVFULSWLRQ SUHP51$ SURFHVVLQJ P51$ WXUQRYHU DQGRU P51$ WUDQVODWLRQ ,Q DOO RI WKHVH VWHSV JHQH WUDQVFULSWLRQ DQG SUHP51$ SURFHVVLQJ DSSHDU WR SOD\ WKH PDMRU UROHV IRU PDMRULW\ RI GLIIHUHQW +/$$ DQG % DQWLJHQV 7XUQRYHU DQG WUDQVODWLRQ RI +/$ P51$V DUH LQYROYHG IRU D IHZ VSHFLILF +/$$ DQG % DOOHOHV 'HVSLWH WKH FRPSOH[LW\ RI UHJXODWRU\ PHFKDQLVPV IRU +/$ H[SUHVVLRQ DOO DUH GLUHFWO\ OLQNHG WR WKH FRGLQJ DQG QRQFRGLQJ QXFOHRWLGH VHTXHQFHV RI +/$ JHQHV 7KLV ILQGLQJ VXSSRUWV DQ HDUOLHU UHSRUW WKDW GLIIHUHQWLDO TXDQWLWDWLYH H[SUHVVLRQ LV GLUHFWO\ OLQNHG WR +/$ JHQHV DQG IROORZV 0HQGHOLDQ ODZV .DR DQG 5LOH\ f

PAGE 57

)LJXUH 0HDVXUHPHQWV RI WKH UHODWLYH TXDQWLWLHV RI QXFOHDU DQG F\WRSODVPLF +/$$ DQG % WUDQVFULSWV E\ XVLQJ TXDQWLWDWLYH 573&5'**( DQG SKRVSKRU LPDJLQJ LQ VHYHQ O\PSKREODVWRLG FHOO OLQHV QX XQVSOLFHG QXFOHDU +/$$ DQG % WUDQVFULSWV QV VSOLFHG QXFOHDU +/$$ DQG % WUDQVFULSWV F F\WRSODVPLF +/$$ DQG % P51$V (DFK YDOXH UHSUHVHQWV WKH PHDQ6' RI WKUHH VHSDUDWH H[SHULPHQWV r 7ZR VHSDUDWH H[SHULPHQWV IRU FHOO OLQH

PAGE 58

PX QV F $bf s s %bf s s  PX QV F %bf s s s $bf s s s PX QV F $ bf s s %bf s s QX QV F %bfsr sr sr $bfsr sr r PX QV F $bf s s s %bf s % bf s s $bfs s '& QX QV F %bf s %bf s $bf $ bf s s s s s s s s

PAGE 59

,Q RXU VWXG\ ZH XVHG WKH YDOLGDWHG 573&5'**( DQG SKRVSKRU LPDJLQJ WR PHDVXUH WKH UHODWLYH TXDQWLWLHV RI +/$$ DQG % P51$V &KDSWHU f 7KLV DSSURDFK DOORZV XV WR DYRLG FRPSOLFDWLRQV RI FURVVK\EULGL]DWLRQ DQG WKH YDULDWLRQV LQ VSHFLILF DFWLYLW\ RI SUREHV WKDW DUH IUHTXHQWO\ HQFRXQWHUHG LQ QRUWKHUQ EORW )RU PHDVXULQJ WKH UHODWLYH TXDQWLWLHV RI GLIIHUHQW VSHFLILF +/$$ DQG % DQWLJHQV F\WRSODVPLF P51$V ZHUH XVHG DV WHPSODWHV DQG WKH SULPHU FRPSOHPHQWDU\ WR D VHTXHQFH LQ H[RQ VKDUHG E\ +/$$ DQG % P51$V ZHUH XVHG WR SUHSDUH F'1$V 7KLV VHTXHQFH HQFRGHV SDUW RI WUDQVPHPEUDQH GRPDLQ RI DOO +/$$ DQG % SURWHLQV 7KHUHIRUH RQO\ WKH UHODWLYH TXDQWLWLHV RI WKH +/$ P51$V HQFRGLQJ WKH ZKROH OHQJWK +/$ WUDQVPHPEUDQH KHDY\ FKDLQV ZHUH PHDVXUHG )RU PHDVXULQJ WKH UHODWLYH DPRXQWV RI GLIIHUHQW +/$$ DQG % SURWHLQV WKH XVH RI 7; WR VROXELOL]H FHOOV ZKLFK RQO\ H[WUDFWV WKH WUDQVPHPEUDQH SURWHLQV %RUGLHU f DOORZV XV WR TXDQWLI\ WKH UHODWLYH DPRXQWV RI LQWDFW WUDQVPHPEUDQH +/$$ DQG % DQWLJHQV E\ ,()3$*( DQG LPPXQREORWWLQJ 7KH DIRUHPHQWLRQHG WZR DSSURDFKHV PDGH LW SRVVLEOH IRU XV WR GHWHUPLQH ZKHWKHU WKH UHODWLYH DPRXQWV RI GLIIHUHQW +/$$ DQG % DQWLJHQV DUH SURSRUWLRQDOO\ FRUUHODWHG ZLWK WKRVH RI WKHLU P51$V 7KH UHVXOWV VKRZQ LQ 7DEOH LQGLFDWH WKDW IRU PRVW RI WKH VWXGLHG /&/V +/$$ DQG % SURWHLQ OHYHOV DUH SURSRUWLRQDOO\ FRUUHODWHG ZLWK WKHLU P51$ OHYHOV H[FHSW IRU WKRVH SRVLWLYH ZLWK +/$$ RU % %HFDXVH GLIIHUHQW +/$ SURWHLQV KDYH VLPLODU WXUQRYHU UDWHV )LJXUH f WKHVH UHVXOWV LQGLFDWHG WKDW UDWHV RI P51$ SURGXFWLRQ SOD\ LPSRUWDQW UROHV LQ GHWHUPLQLQJ +/$ SURWHLQ OHYHOV ,Q DGGLWLRQ WKH UHVXOWV VXJJHVW WKDW +/$$ DQG % P51$V DUH PRUH HIILFLHQW LQ SURWHLQ WUDQVODWLRQ DQG WKDW GLIIHUHQWLDO WUDQVODWLRQ RI P51$V IRU FHUWDLQ +/$ DQWLJHQV SOD\V D UROH LQ GHWHUPLQLQJ +/$ H[SUHVVLRQ 1H[W ZH VWXGLHG WKH UROH RI VWDELOLW\ RI GLIIHUHQW +/$$ DQG % P51$V LQ LQIOXHQFLQJ WKH TXDQWLWDWLYH GLIIHUHQWLDO H[SUHVVLRQ RI GLIIHUHQW +/$$ DQG % DQWLJHQV 7KLV VWXG\ ZDV DFFRPSOLVKHG E\ PHDVXULQJ FKDQJHV RI UHODWLYH TXDQWLWLHV RI GLIIHUHQW +/$ $ DQG % P51$V EHIRUH DQG DIWHU WUHDWPHQW RI FHOOV ZLWK '5% DQ LQKLELWRU RI 51$

PAGE 60

SRO\PHUDVH ,, IRU KRXUV 7KH UHVXOWV VKRZHG WKDW +/$$ DQG % P51$V DUH SURSRUWLRQDOO\ GHJUDGHG LQ ILYH RXW RI VHYHQ FHOO OLQHV VWXGLHG 6LPLODU REVHUYDWLRQ ZDV PDGH SUHYLRXVO\ E\ RWKHU LQKLELWRUV XVLQJ +/$$ DQG % WUDQVJHQHV 0F&XWFKHRQ HW DK f +RZHYHU RXU VWXG\ VKRZHG WKDW VWDELOLW\ RI +/$$ DQG % P51$V LQ WZR FHOO OLQHV DSSHDU WR KDYH VOLJKWO\ GLIIHUHQW WXUQRYHU UDWHV LQ WKUHH VHSDUDWH H[SHULPHQWV 7KLV ILQGLQJ VXJJHVWV WKDW YDU\LQJ VWDELOLW\ IRU +/$$ DQG % P51$V FRXOG SOD\ VRPH UROH LQ GHWHUPLQLQJ TXDQWLWDWLYH GLIIHUHQWLDO H[SUHVVLRQ IRU FHUWDLQ +/$$ DQG % DQWLJHQV 7KH PROHFXODU EDVLV IRU WKH REVHUYHG GLIIHUHQW WXUQRYHU UDWHV LV QRW NQRZQ DQG UHPDLQV WR EH LQYHVWLJDWHG %HFDXVH WKH VWHDG\ VWDWH P51$ OHYHOV DUH GHWHUPLQHG E\ ERWK P51$ GHJUDGDWLRQ DQG SURGXFWLRQ DQG LQ PRVW FDVHV GLIIHUHQW +/$$ DQG % P51$V LQ FHOO OLQHV VWXGLHG KDYH VLPLODU WXUQRYHU UDWHV LW LV OLNHO\ WKDW GLIIHUHQWLDO SURGXFWLRQ RI +/$$ DQG % P51$V FRXOG EH D SULPDU\ GHWHUPLQLQJ IDFWRU IRU UHJXODWLQJ GLIIHUHQWLDO H[SUHVVLRQ RI GLIIHUHQW +/$$ DQG % DQWLJHQV :H WKHQ VWXGLHG KRZ JHQH WUDQVFULSWLRQ FRQWULEXWHV WR WKH UHJXODWLRQ RI TXDQWLWDWLYH GLIIHUHQWLDO H[SUHVVLRQ RI +/$$ DQG % JHQHV 7KH LQLWLDO QXFOHDU UXQRQ VWXG\ VKRZHG WKDW WKH QHZO\ V\QWKHVL]HG +/$ WUDQVFULSWV FRQWULEXWH RQO\ DSSUR[LPDWHO\ b RI WKH WRWDO SUHVSOLFHG +/$ WUDQVFULSWV LQ QXFOHL )LJXUH f 'XH WR WKH ORZ TXDQWLW\ RI QHZO\ V\QWKHVL]HG +/$ WUDQVFULSWV ZH ZHUH XQDEOH WR UHOLDEO\ GHWHUPLQH WKH UHODWLYH UDWH RI WUDQVFULSWLRQ IRU GLIIHUHQW +/$$ DQG % JHQHV LQ FHOOV 7KLV ILQGLQJ DOVR LQGLFDWHV WKDW WKH SURFHVVLQJ RI +/$ SUHP51$V LV D FULWLFDO UDWHOLPLWLQJ VWHS LQ WKH SURGXFWLRQ RI PDWXUH +/$ P51$V :H WKHQ GLUHFWHG RXU HIIRUW WR LQYHVWLJDWH ZKHWKHU GLIIHUHQWLDO VSOLFLQJ SOD\V DQ LPSRUWDQW UROH LQ GHWHUPLQLQJ GLIIHUHQWLDO SURGXFWLRQ RI PDWXUH +/$$ DQG % P51$V )RU WKLV VWXG\ ZH XVHG 573&5'**( DQG SKRVSKRU LPDJLQJ WR PHDVXUH WKH UHODWLYH TXDQWLWLHV RI +/$$ DQG % WUDQVFULSWV EHIRUH DQG DIWHU VSOLFLQJ RI LQWURQ 7KH PHDVXUHPHQWV ZHUH FRPSDUHG ZLWK WKRVH RI PDWXUH F\WRSODVPLF +/$ P51$V 7KH UHVXOWV VXJJHVWHG WKDW QXFOHDU +/$ WUDQVFULSWV FRQWDLQLQJ LQWURQ FDQ EH SURSRUWLRQDOO\ RU

PAGE 61

GLIIHUHQWLDOO\ VSOLFHG GHSHQGLQJ RQ WKH +/$ DOOHOHV %HFDXVH LW LV PRUH GLIILFXOW WR FRQVLVWHQWO\ JHQHUDWH VXIILFLHQW TXDQWLWLHV RI ILUVWVWUDQG +/$ F'1$ FRQWDLQLQJ PRUH LQWURQV DQG WKH DPSOLFRQ RI H[RQ RI +/$ JHQH LV FUXFLDO IRU TXDQWLWDWLRQ E\ '**( ZH OLPLWHG RXU VWXG\ RI SUHVSOLFHG P51$ WUDQVFULSWV WR WKRVH FRQWDLQLQJ LQWURQ 7KH UHVXOWV RI WKLV VWXG\ VKRZHG WKDW WKH UHODWLYH TXDQWLWLHV RI VSOLFHG P51$V IRU YDULRXV +/$$ RU % JHQHV LQ QXFOHL DQG F\WRSODVP DUH DERXW WKH VDPH IRU DOO FHOO OLQHV LQFOXGHG LQ RXU VWXG\ ,Q FRQWUDVW WKH UHODWLYH TXDQWLWLHV RI +/$ WUDQVFULSWV FRQWDLQLQJ LQWURQ IRU YDULRXV +/$ $ DQG % JHQHV DUH TXLWH GLIIHUHQW IURP WKRVH RI WKH VSOLFHG +/$$ DQG % WUDQVFULSWV LQ QXFOHL DQG F\WRSODVP RI VRPH FHOO OLQHV )LJXUH f 7KXV WKH UHVXOWV LQGLFDWHG WKDW GLIIHUHQWLDO VSOLFLQJ RI +/$ WUDQVFULSWV SOD\V D PDMRU UROH LQ GHWHUPLQLQJ GLIIHUHQWLDO TXDQWLWDWLYH H[SUHVVLRQ RI +/$$ DQG % JHQHV LQ FHOOV ,QWHUHVWLQJO\ LQ WKRVH FHOO OLQHV VKRZLQJ GLIIHUHQWLDO VSOLFLQJ RI +/$$ DQG % SUH P51$V WKH UHODWLYH TXDQWLWLHV RI XQVSOLFHG +/$$ SUHP51$V LQ QXFOHL RI DOO WKHVH FHOOV DUH KLJKHU WKDQ WKRVH RI XQVSOLFHG +/$% SUHP51$V DOWKRXJK WKH UHODWLYH TXDQWLWLHV RI PDWXUH +/$$ P51$V LQ PRVW RI WKHVH FHOO OLQHV DUH ORZHU WKDQ WKDW RI +/$% P51$V 7KLV ILQGLQJ IXUWKHU VXSSRUWV WKH LPSRUWDQFH RI GLIIHUHQWLDO VSOLFLQJ LQ UHJXODWLQJ TXDQWLWDWLYH H[SUHVVLRQ RI +/$$ DQG % JHQHV +RZHYHU LQ FHOO OLQHV VKRZLQJ SURSRUWLRQDO VSOLFLQJ RI +/$$ DQG % SUHP51$V WKH UHODWLYH TXDQWLWLHV RI XQVSOLFHG +/$$ SUHP51$V DQG PDWXUH +/$$ P51$V DUH KLJKHU WKDQ WKRVH RI XQVSOLFHG +/$ % SUHP51$V DQG PDWXUH +/$% P51$V UHVSHFWLYHO\ 7KHVH REVHUYDWLRQV FRLQFLGH ZLWK DQ HDUOLHU UHSRUW WKDW WKH EDVDO OHYHO WUDQVFULSWLRQ RI WKH +/$$ JHQH WHQGV WR EH PRUH HIILFLHQW WKDQ WKDW RI WKH +/$% JHQH GXH WR WKH H[LVWHQFH RI D VHFRQG 1)N% ELQGLQJ PRWLI LQ WKH SURPRWHU RI +/$$ JHQH *LUGOHVWRQH HW DO f 7KHVH UHVXOWV DOVR VXJJHVW WKDW WUDQVFULSWLRQ RI +/$ JHQH LV DQRWKHU PDMRU IDFWRU GHWHUPLQLQJ WKH TXDQWLWDWLYH GLIIHUHQWLDO H[SUHVVLRQ RI +/$$ DQG % DQWLJHQV 7KH PHFKDQLVPV XQGHUO\LQJ WKH GLIIHUHQWLDO WUDQVFULSWLRQ DQGRU VSOLFLQJ DQG WKHLU FRQWULEXWLRQ WR WKH TXDQWLWDWLYH GLIIHUHQWLDO H[SUHVVLRQ RI +/$$ DQG % DQWLJHQV UHPDLQ WR EH IXUWKHU GHILQHG

PAGE 62

&+$37(5 ,1 9,752 75$16/$7,21 678'< 2) +/$$ $1' % 051$6 ,QWURGXFWLRQ $V GLVFXVVHG LQ &KDSWHU TXDQWLWDWLYH GLIIHUHQWLDO H[SUHVVLRQ RI +/$$ DQG % DQWLJHQV LV UHJXODWHG E\ D FRPELQDWLRQ RI GLIIHUHQW VWHSV WKDW LQFOXGH JHQH WUDQVFULSWLRQ SUHP51$ VSOLFLQJ P51$ GHJUDGDWLRQ DQG WUDQVODWLRQ )RU P51$ WUDQVODWLRQ LW DSSHDUV WKDW P51$V IRU +/$$ DQG % DUH PRUH HIILFLHQW LQ SURWHLQ V\QWKHVLV 7DEOH f 7KLV ILQGLQJ VXJJHVWV WKDW WUDQVODWLRQ RI +/$ P51$ FRXOG EH DQ DGGLWLRQDO XQLTXH VWHS LQ UHJXODWLQJ H[SUHVVLRQ RI +/$ DQWLJHQ IRU FHUWDLQ VSHFLILF DOOHOHV 7KHUHIRUH LW LV RI LQWHUHVW WR GHWHUPLQH ZKHWKHU +/$$ P51$ LV LQGHHG PRUH HIILFLHQW LQ WUDQVODWLRQ )RU P\ VWXG\ KDYH IRFXVHG RQ +/$$ SURWHLQ V\QWKHVLV EHFDXVH KDYH FRQVLVWHQWO\ IRXQG WKDW +/$$ DQWLJHQV DUH DOZD\V PRUH LQWHQVHO\ H[SUHVVHG LQ DOO WKH VWXGLHG +/$$ SRVLWLYH FHOO OLQHV LQ VSLWH RI UHODWLYHO\ ORZ OHYHOV RI P51$ 0DWHULDOV DQG 0HWKRGV /\PSKREODVWRLG &HOO /LQHV DQG 51$ 3UHSDUDWLRQ (%9WUDQVIRUPHG O\PSKREODVWRLG FHOO OLQHV /&/Vf ZHUH VHOHFWHG IURP WKRVH GHVFULEHG LQ &KDSWHU 7KHVH FHOO OLQHV ZHUH PDLQWDLQHG LQ 530, PHGLXP /LIH 7HFKQRORJLHV *UDQG ,VODQG 1
PAGE 63

5DSLG $PSOLILFDWLRQ RI +/$$ $QG % F'1$ (QGV 5$&(f 7KH n 5$&( LV SHUIRUPHG EDVHG RQ WKH SURWRFRO GHVFULEHG E\ )URKPDQ f ZLWK VRPH PRGLILFDWLRQ )LIW\ PLFURJUDPV RI WRWDO F\WRSODVPLF 51$V SUHSDUHG IURP WKH VHOHFWHG FHOO OLQHV ZHUH GHSKRVSKRU\ODWHG ZLWK XQLWV RI FDOI LQWHVWLQDO SKRVSKDWDVH &,3f %RHKULQJHU 0DQQKHLP ,QGLDQDSROLV ,1f LQ _OO RI D EXIIHU FRQWDLQLQJ P0 7ULV+&O P0 ('7$ S+ P0 '77 XQLW_LO 51DVLQ DW r& IRU KRXU $IWHU GLJHVWLRQ ZLWK LJPO RI SURWHLQDVH DW r& IRU PLQXWHV WKH PL[WXUH ZDV H[WUDFWHG ZLWK SKHQROFKORURIRUP DQG WKH 51$ ZDV SUHFLSLWDWHG ZLWK YROXPH RI 0 VRGLXP DFHWDWH DQG YROXPHV RI HWKDQRO 7KLUW\HLJKW PLFURJUDPV RI WKH GHSKRVSKRU\ODWHG 51$ ZDV WKHQ GHFDSSHG ZLWK XQLWV RI 7REDFFR DFLG S\URSKRVSKDWDVH (SLFHQWUH 0DGLVRQ :,f LQ SL RI D EXIIHU FRQWDLQLQJ P0 VRGLXP DFHWDWH S+ P0 ('7$ b PHUFDSWRHWKDQRO b 7ULWRQ ; XQLWSO RI 51DVLQ DQG P0 $73 DW r& IRU KRXU 7KH 51$ ZDV H[WUDFWHG ZLWK SKHQROFKORURIRUP DQG SUHFLSLWDWHG ZLWK HWKDQRO DV GHVFULEHG DERYH 7KH GHFDSSHG 51$ ZDV WKHQ OLJDWHG WR DQ 51$ ROLJRQXFOHRWLGH WKDW ZDV JHQHUDWHG E\ LQ YLWUR WUDQVFULSWLRQ IURP SODVPLG S*E[ NLQGO\ SURYLGHG E\ 'U 0LFKDHO $ )URKPDQf DQG FRQWDLQV QXFOHRWLGHV )URKPDQ f 7KH OLJDWLRQ ZDV FDUULHG RXW ZLWK XQLWV RI 7 51$ OLJDVH (SLFHQWUH 0DGLVRQ :,f LQ LO RI D PL[WXUH FRQWDLQLQJ P0 7ULV+&O S+ P0 SRWDVVLXP DFHWDWH P0 0J&O P0 '77 XQLWSWO 51DVLQ P0 $73 SJ RI 51$ ROLJRQXFOHRWLGH DQG SJ RI GHFDSSHG 51$ DW r& IRU KRXUV $IWHU H[WUDFWLRQ DQG SUHFLSLWDWLRQ SJ RI WKH OLJDWLRQ SURGXFWV ZHUH WKHQ XVHG DV WHPSODWHV IRU UHYHUVH WUDQVFULSWLRQ LQ SL RI D PL[WXUH FRQWDLQLQJ P0 7ULV+&O S+ P0 .& P0 0J&O P0 G173V 0 '77 XQLW RI 51DVLQ QJ DQWLVHQVHVSHFLILF SULPHU f$&$ *&7 &&$*f $*f7* $&7f& $&$ff FRPSOHPHQWDU\ WR QXFOHRWLGHV LQ H[RQ f RI +/$$ DQG % FRGLQJ VHTXHQFHV DQG XQLWV RI 00/9 UHYHUVH WUDQVFULSWDVH DW r& IRU PLQXWHV r& IRU PLQXWHV DQG r& IRU PLQXWHV $IWHU LQDFWLYDWLRQ RI WKH UHYHUVH WUDQVFULSWDVH SL RI WKH 57 PL[WXUH ZDV GLUHFWO\ XVHG DV WHPSODWH IRU 3&5 LQ SL RI D EXIIHU FRQWDLQLQJ

PAGE 64

P0 7ULV+&O S+ P0 0J&O P0 .& P0 1+f6 b 7ULWRQ ; SJPO %6$ P0 G173V S0 RI HDFK SULPHU DQG XQLWV RI QDWLYH 3IX '1$ SRO\PHUDVH 6WUDWDJHQHf IRU F\FOHV (DFK F\FOH FRQVLVWHG RI r& GHQDWXUDWLRQ IRU PLQ r& DQQHDOLQJ IRU VHF DQG r& H[WHQVLRQ IRU PLQ 7KH VHQVH SULPHU VHTXHQFH LV f &&$ $*$ &7& $&7 *** 7$& 7*&f DQG FRUUHVSRQGV WR QXFOHRWLGHV RI WKH 51$ ROLJRQXFOHRWLGH 7KH DQWLVHQVH SULPHU VHTXHQFH LV f*&* $7* 7$$ 7&& 77* &&*f DQG FRPSOHPHQWDU\ WR WKH FRGLQJ VHTXHQFH DW QXFOHRWLGHV RI FODVV +/$ P51$ 7KH 3&5 SURGXFWV FRQWDLQLQJ f HQG VHTXHQFHV RI +/$ P51$ ZHUH GLUHFWO\ FORQHG LQWR D SODVPLG WKH S&56FULSW $PS FORQLQJ YHFWRU 6WUDWDJHQH /D -ROOD &$f DFFRUGLQJ WKH PDQXIDFWXUHUfV SURWRFRO 6HTXHQFHV RI WKH FORQHG 3&5 SURGXFWV ZHUH GHWHUPLQHG E\ DXWRPDWHG '1$ VHTXHQFLQJ 7KH n 5$&( LV DOVR SHUIRUPHG EDVHG RQ WKH SURWRFRO GHVFULEHG E\ )URKPDQ f %ULHIO\ SJ RI WRWDO F\WRSODVPLF 51$ SUHSDUHG IURP WKH RU '& FHOO OLQH ZDV UHYHUVH WUDQVFULEHG LQ SL RI D EXIIHU FRQWDLQLQJ P0 7ULV+&O S+ P0 .& P0 0J&O P0 G173V 0 '77 XQLW RI 51DVLQ SJ DQFKRU SULPHU f&&$ *7* $*& $*$ *7* $&* $** $&7 &*$ *&7 &$$ *&7 777 777 777 777 777 7ff DQG XQLWV RI 00/9 UHYHUVH WUDQVFULSWDVH DW r& IRU PLQXWHV r& IRU PLQXWHV DQG r& IRU PLQXWHV $IWHU LQDFWLYDWLRQ RI WKH UHYHUVH WUDQVFULSWDVH SL RI WKH 57 PL[WXUH ZDV GLUHFWO\ XVHG DV WHPSODWH IRU SRO\PHUDVH FKDLQ UHDFWLRQ 3&5f LQ SL RI D EXIIHU FRQWDLQLQJ FRQWDLQLQJ P0 7ULV+&O S+ P0 0J&O P0 .& P0 1+f6 b 7ULWRQ ; SJPO %6$ P0 G173V S0 RI HDFK SULPHU DQG XQLWV RI QDWLYH 3IX '1$ SRO\PHUDVH 6WUDWDJHQH /D -ROOD &$f IRU F\FOHV (DFK F\FOH FRQVLVWHG RI r& GHQDWXUDWLRQ IRU PLQ r& DQQHDOLQJ IRU VHF DQG r& H[WHQVLRQ IRU PLQ 7KH 3&5 SULPHU VHTXHQFHV DUH f&*& &*7 **$ 7$* $*& $**f VHQVHf DQG f&&$ *7* $*& $*$ *7* $&*f DQWLVHQVHf 7KH VHQVH SULPHU FRUUHVSRQGV WR WKH FRGLQJ VHTXHQFH RI FODVV +/$ P51$ DQG WKH DQWLVHQVH SULPHU FRUUHVSRQGV WR WKH f HQG RI DQFKRU SULPHU 7KH 3&5

PAGE 65

SURGXFWV ZHUH WKHQ XVHG DV WHPSODWH IRU WKH QHVWHG 3&5 LQ ZKLFK HDFK F\FOH FRQVLVWHG RI r& GHQDWXUDWLRQ IRU PLQ r& DQQHDOLQJ IRU VHF DQG r& H[WHQVLRQ IRU PLQ 7KH SULPHU VHTXHQFHV IRU WKH QHVWHG 3&5 DUH f *&7 **& &7* *77 &7& &77 **f VHQVH FRUUHVSRQGLQJ WR QXFOHRWLGHV RI +/$$ FRGLQJ VHTXHQFHf RU f *&7 *7* *7* *7* &&7 7&7 **f VHQVH FRUUHVSRQGLQJ WR QXFOHRWLGHV RI +/$ % FRGLQJ VHTXHQFHf DQG f *$* *$& 7&* $*& 7&$ $*&f DQWLVHQVH FRUUHVSRQGLQJ WR D VHTXHQFH LQ DQFKRU SULPHUf 7KH SURGXFWV RI WKH QHVWHG 3&5 ZHUH GLUHFWO\ FORQHG LQWR WKH S&56FULSW $PS FORQLQJ YHFWRU 6WUDWDJHQH /D -ROOD &$f DFFRUGLQJ WKH PDQXIDFWXUHUfV SURWRFRO 7KH nHQG VHTXHQFH ZDV GHWHUPLQHG E\ DXWRPDWHG '1$ VHTXHQFLQJ &ORQLQJ RI )XOOOHQJWK +/$$ DQG % F'1$V %\ 3&5 )RU FORQLQJ WKH ZKROH OHQJWK +/$ F'1$ D 3&5 WHFKQLTXH EDVHG RQ VSOLFLQJ E\ RYHUODS H[WHQVLRQ 62(f +RUWRQ HW DO f ZDV XVHG 7KH f IUDJPHQW RI +/$ F'1$ ZDV DPSOLILHG IURP SODVPLG E\ XVLQJ 3&5 LQ ZKLFK D 7 SURPRWHU ZDV LQFRUSRUDWHG LQWR WKH f HQG IRU XVH LQ WKH VXEVHTXHQW V\QWKHVLV RI +/$ WUDQVFULSWV 7KH f HQG VHTXHQFH DQG D FRGLQJ VHTXHQFH ZHUH SUHSDUHG DOVR DPSOLILHG IURP SODVPLGV E\ XVLQJ 3&5 DQG WKH 3&5 SURGXFWV RI WKHVH WZR IUDJPHQWV ZHUH PL[HG DQG XVHG DV WHPSODWHV IRU 62( 3&5 LQ ZKLFK WKHVH WZR IUDJPHQWV ZLWK RYHUODS VHTXHQFHV ZHUH MRLQWHG WRJHWKHU WR IRUP WKH f IUDJPHQW 3IX '1$ SRO\PHUDVH 6WUDWDJHQH /D -ROOD &$f ZDV XVHG LQ 3&5 WR UHGXFH WKH SRVVLELOLW\ RI PLVLQFRUSRUDWLRQ PXWDWLRQV LQ WKH 3&5 SURGXFWV 6WDQGDUG 3&5 FRQGLWLRQV ZHUH XVHG IRU WKH DPSOLILFDWLRQ RI WHPSODWH '1$ IUDJPHQWV WR EH XVHG LQ WKH VXEVHTXHQW 62( UHDFWLRQV F\FOHV RI PLQ DW r& VHF DW r& DQG PLQ DW r& IROORZLQJ WKH ILQDO F\FOH DQ DGGLWLRQDO PLQ LQFXEDWLRQ DW r&f 7KH 3&5 SURGXFWV FRUUHVSRQGLQJ WR WKH f HQG +/$ F'1$ IUDJPHQWV DQG RYHUODSSLQJ ZLWK WKH f HQG +/$ F'1$ IUDJPHQWV ZHUH SXULILHG E\ SUHSDUDWLYH DJDURVH JHO HOHFWURSKRUHVLV 7KH IXOOOHQJWK +/$ F'1$V ZHUH JHQHUDWHG E\ DQRWKHU URXQG RI 62( 3&5 LQ ZKLFK WKH n IUDJPHQW DQG n IUDJPHQW

PAGE 66

ZHUH PL[HG DQG XVHG DV WHPSODWHV 7KH ILQDO 3&5 SURGXFWV FRQWDLQHG D 7 SURPRWHU WKH ZKROH OHQJWK +/$ F'1$ VHTXHQFH DQG D SRO\$f WDLO IROORZHG E\ D +LQG ,,, UHVWULFWLRQ VLWH DQG DQ DQFKRU VHTXHQFH 7KH DQFKRU VHTXHQFH ZDV UHPRYHG E\ GLJHVWLRQ RI WKH 3&5 SURGXFWV ZLWK +LQG ,,, %RHKULQJHU 0DQQKHLP ,QGLDQDSROLV ,1f 7KH ZKROH OHQJWK +/$ KHDY\ FKDLQ F'1$ ZDV WKHQ JHQHUDWHG 7KH GLIIHUHQW IUDJPHQWV RI +/$F'1$ XVHG IRU 62(3&5 DUH VKRZQ LQ )LJXUH 6\QWKHVLV RI &DSSHG +/$$ DQG % P51$V E\ ,Q 9LWUR 7UDQVFULSWLRQ )LYH KXQGUHG QDQRJUDPV RI ZKROH OHQJWK +/$ F'1$ IUDJPHQWV JHQHUDWHG DV GHVFULEHG DERYH ZHUH XVHG DV WHPSODWHV IRU LQ YLWUR WUDQVFULSWLRQ LQ D YROXPH RI SL DW f& IRU KRXUV XVLQJ 7 51$ SRO\PHUDVH DFFRUGLQJ WR WKH PDQXIDFWXUHUfV SURWRFRO P0DFKLQHP0HVVDJHr1 ,Q 9LWUR 7UDQVFULSWLRQ .LWVf $PELRQ ,QF $XVWLQ 7;f WR V\QWKHVL]H FDSSHG +/$ P51$ $IWHU KRXUV LQFXEDWLRQ XQLWV 51DVHIUHH '1DVH ZDV DGGHG DQG LQFXEDWHG DW r& IRU PLQXWHV WR GHJUDGH WKH WHPSODWH '1$ 7KH LQ YLWUR V\QWKHVL]HG 51$ WUDQVFULSWV ZHUH UHFRYHUHG ZLWK /L&O SUHFLSLWDWLRQ DQG IXUWKHU FOHDQHG XVLQJ DQ 51HDV\ VSLQ FROXPQ 4,$*(1 ,QF &KDWVZRUWK &$f 7KH FRQFHQWUDWLRQV RI WKH V\QWKHVL]HG 51$ ZHUH PHDVXUHG E\ DEVRUEDQFH DW QP 6\QWKHVLV RI +/$$ DQG % 3URWHLQV E\ ,Q 9LWUR 7UDQVODWLRQ $IWHU KHDWLQJ WR r& IRU PLQ QJSO RI +/$$ RU % P51$V WUDQVFULEHG LQ YLWUR ZHUH WUDQVODWHG DW r& IRU KRXUV LQ D SL UHDFWLRQ PL[WXUH FRQWDLQLQJ SL RI QXFOHDVHWUHDWHG UDEELW UHWLFXORF\WH O\VDWH 3URPHJD 0DGLVRQ :,f XQLWV RI 51DVLQ S0 DPLQR DFLGV PLQXV PHWKLRQLQH DQG S&L >6@PHWKLRQLQH $PHUVKDP /LIH 6FLHQFH ,QF $UOLQJWRQ +HLJKWV ,/f )LYH PLFUROLWHUV RI HDFK WUDQVODWLRQ UHDFWLRQ PL[WXUH ZHUH DQDO\]HG E\ FRQYHQWLRQDO 6'63$*( b DFU\ODPLGHf IROORZHG E\ IL[DWLRQ DQG DXWRUDGLRJUDSK\ RU SKRVSKRU LPDJLQJ RI WKH GULHG JHO 7KH WUDQVODWLRQ SURGXFWV ZHUH DOVR DQDO\]HG E\ 6'63$*( IROORZHG E\ LPPXQREORWWLQJ ZLWK DQWL+/$$ DQG %

PAGE 67

KHDY\ FKDLQ +Hf PRQRFORQDO DQWLERG\ P$Ef .DR HW DK f DQG DXWRUDGLRJUDSK\ WR FRQILUP WKDW WKH\ DUH +/$ KHDY\ FKDLQV $XWRUDGLRJUDSK\ DQG 3KRVSKRU ,PDJLQJ )RU DXWRUDGLRJUDSK\ WKH 6'63$*( JHOV ZHUH H[SRVHG WR .RGDN %LRPD[ 05 ILOP .RGDN 6FLHQWLILF ,PDJLQJ 6\VWHPV 5RFKHVWHU 1
PAGE 68

7DEOH f HQG VHTXHQFHV RI +/$$ DQG % P51$V +/$ f HQG VHTXHQFHr $ ORQJf $&*&$&&&$&&***$&8&$*$88&8&&&&$*$&*&&* $** $ 8 **&&*8& $ 8 **&* f $ f $* $88&8&&&&$*$&*&&*$** $ 8 **&&*W -&$ 8 **&* f % f$*$$8&8&&8&$*$&*&&*$* $8 *&***8&$&**&$ f A&RGLQJ VHTXHQFH LV XQGHUOLQHG VKRUW n875V RI +/$$ DQG % P51$V DUH KLJKO\ VLPLODU WR WKRVH RI RWKHU +/$$ DQG % P51$V 7KH f875 VHTXHQFHV RI +/$$ DQG % P51$V ZHUH DOVR REWDLQHG )LJXUH f 7KHUH LV DERXW b GLIIHUHQFH EHWZHHQ WKH f875 VHTXHQFH RI +/$$ P51$ DQG WKDW RI +/$% P51$ WKURXJKRXW WKH f WUDLO RI DERXW QXFOHRWLGHV &ORQLQJ RI )XOOOHQJWK +/$$ DQG % KHDY\ FKDLQ F'1$V E\ 3&5 %HFDXVH ZH ZHUH XQVXFFHVVIXO LQ XVLQJ 3&5 WR GLUHFWO\ JHQHUDWH WKH IXOOOHQJWK F'1$ WKH IXOOOHQJWK +/$ F'1$V ZHUH FRQVWUXFWHG XVLQJ D 3&5 WHFKQLTXH EDVHG RQ 62( +RUWRQ HW DO f :H ILUVW FORQHG SDUW RI +/$ FRGLQJ VHTXHQFHV WKH f HQG VHTXHQFHV DQG WKH f HQG VHTXHQFHV RI +/$$ )LJXUH $f DQG % )LJXUH %f LQWR SODVPLGV 7KH +/$ F'1$ IUDJPHQWV ZLWK RYHUODS VHTXHQFHV ZHUH WKHQ DPSOLILHG IURP WKH SODVPLGV DQG VSOLFHG WRJHWKHU E\ XVLQJ 62( 3&5 /LJXUH f $ 7 SURPRWHU ZDV LQFRUSRUDWHG LQWR WKH f HQG RI HDFK +/$ F'1$ 3RO\$fQ DW WKH f HQG ZDV IROORZHG E\ D +LQG ,,, UHVWULFWLRQ VLWH DQG DQ DQFKRU VHTXHQFH $IWHU GLJHVWLRQ RI WKH ILQDO 3&5 SURGXFWV ZLWK +LQG ,,, WKH ZKROH OHQJWK +/$$ DQG % KHDY\ FKDLQ F'1$V ZHUH XVHG DV WHPSODWHV IRU LQ YLWUR WUDQVFULSWLRQ WR V\QWKHVL]H FDSSHG +/$ P51$V IRU WUDQVODWLRQ VWXG\

PAGE 69

!$ $$$*8*8*$* $&$*&8*&&8 8*8*8***$& 8*$*$**&$$ *$*88*88& !% && Xf§ 8 f§8f§& $ !$ &8*&&&88&& &888*8*$&8 8*$$*$$&& &8*$&888* 888&8*&$$$ !% f§& f§ & *f§8 *$&& f§ !$ **&$&&8*&$ 8*8*8&8*8* 88&$8*8$** &$8$$8*8*$ **$**8**** % $ F && 8$ f& $ !$ $*$&&$&&&& $&&&&&$8*8 &&$&&$8*$& &&8&88&&& $&*&8*$&&8 !% *f§ 8* f§&* B8 !$ *8*&8&&&8& &&&$$8&$8& 888&&8*88* &$*$*$**8* ***&8*$**8 !% 88 8 & f§ $ !$ *8&8&&$8&8 &8*8&8&$$& 88&$8**8*& $&8*$*&8*8 $$&88&88&& !% 8 & $ !$ 88&&&8$88 $$$$88$*$$ &&8*$*8$8$ $$888$&888 &8&$$$88&8 !% &* $ 8 $ *8 $8 !$ 8*&&$8*$*$ **88*$8*$* 88$$88$$$* *$*$$*$88& &8$$$$888* !% 8 *$ 8 $8&$ ** $ $*$*$&$$$$ 8$$$8**$$& $&$8*$*$$& FXXF !% $ *& B f§ )LJXUH 7KH f875 VHTXHQFHV IRU +/$$ DQG % P51$V GHQRWHV D GHOHWLRQ LQWURGXFHG WR PD[LPL]H WKH KRPRORJ\ ,Q 9LWUR 7UDQVODWLRQ VWXG\ RI +/$$ DQG % P51$V $IWHU GLJHVWLRQ ZLWK +LQG ,,, WKH +/$$ DQG % F'1$ FRQVWUXFWV ZHUH XVHG WR SUHSDUH FDSSHG +/$ P51$ E\ LQ YLWUR WUDQVFULSWLRQ 7KH VDPH DPRXQWV RI FDSSHG +/$$ DQG % P51$V QJSOf ZHUH XVHG IRU V\WKHVL]LQJ +/$$ DQG % SURWHLQV E\ LQ YLWUR WUDQVODWLRQ LQ WKH UDEELW UHWLFXORF\WH V\VWHP 7KH VDPH DPRXQWV RI WUDQVODWLRQ PL[WXUHV ZHUH DQDO\]HG E\ 6'63$*( SKRVSKRU LPDJLQJ DQG LPPXQREORWWLQJ 7KH UHVXOWV VKRZQ LQ )LJXUH LQGLFDWH WKDW PRUH +/$$ KHDY\ FKDLQV ZHUH V\QWKHVL]HG IURP +/$$ P51$V WKDQ +/$% KHDY\ FKDLQV IURP +/$ % P51$V ,Q DGGLWLRQ WKH ORQJ +/$$ P51$ LV VKRZQ WR EH PRUH HIILFLHQW WKDQ

PAGE 70

)LJXUH &ORQLQJ RI +/$$ DQG % KHDY\ FKDLQ F'1$V E\ 3&5 $f 3&5 IUDJPHQWV RI +/$$ F'1$V 2QH LV ZLWK VKRUW 875 +/$$f DQG WKH RWKHU LV ZLWK ORQJHU 875 +/$$/f )UDJPHQW )UDJ f FRUUHVSRQGV WR D +/$ P51$ VHTXHQFH IURP WR $ LQ ILUVW $7* LQLWLDWLRQ FRGRQ LV GHVLJQDWHG DV ff )UDJPHQW )UDJ f FRUUHVSRQGV WR WKH VHTXHQFH IURP WR WKH DQFKRU VHTXHQFH f IUDJPHQW )UDJ ff UHSUHVHQWV D 7 SURPRWHU SOXV WKH VHTXHQFH IURP IRU )/$$f RU IRU +/$$/f WR %f 3&5 IUDJPHQWV RI +/$% F'1$V )UDJPHQW )UDJ f FRUUHSRQGV WR D +/$ P51$ VHTXHQFH IURP WR $ LQ ILUVW $7* LQLWLDWLRQ FRGRQ LV GHVLJQDWHG DV f )UDJPHQW )UDJ f FRUUHVSRQGV WR WKH VHTXHQFH IURP WR WKH DQFKRU VHTXHQFH f IUDJPHQW )UDJ ff UHSUHVHQWV D 7 SURPRWHU SOXV WKH VHTXHQFH IURP WR 0 '1$ PDUNHUV

PAGE 71

$f NEf +LQG ,,, f875_ f875 )UDJ Kr + KrL Er )UDJ )UDJ f )UDJ f , +/$$ F'1$ f§ %f NEf )UDJ f )UDJ f +/$% )UDJ )UDJ )UDJ f )UDJ fff NEf f§ 7 f875 %%,_ +rf§ Kr UUDJ NO f875 + )UDJ )UDJ f +LQG ,,, O$Qf -B A )UDJ f N +/$ %F'1$

PAGE 72

+/$ P51$ )LJXUH ,Q YLWUR WUDQVODWLRQ VWXG\ RI +/$$ DQG +/$% P51$V $f 5HSUHVHQWDWLYH LPPXQREORW RI D 6'63$*( JHO IRU QHZO\ V\QWKHVL]HG KHDY\ FKDLQV RI +/$$ DQG % 7KH >6@PHWKLRQLQHODEHOHG +/$$ DQG % SURWHLQV JHQHUDWHG E\ LQ YLWUR WUDQVODWLRQ RI ORQJ +/$$ $/f VKRUW +/$$ $f DQG +/$% %f P51$V ZHUH DQDO\]HG E\ 6'63$*( DQG LPPXQREORWWLQJ 7KH SURWHLQ EDQGV RQ WKH EORW PHPEUDQH ZDV TXDQWLILHG E\ SKRVSKRU LPDJLQJ %. FRQWURO UHDFWLRQ PL[WXUH ZLWKRXW DGGLWLRQ RI +/$ P51$V +/$ SXULILHG +/$ KHDY\ FKDLQ 7ZR EDQGV ZLWK N' DQG N' ZHUH VKRZQ LQ WKH SXULILHG +/$ KHDY\ FKDLQ 7KH N' UHSUHVHQW WKH GHJUDGHG +/$ %f 3KRVSKRU LPDJH RI WKH LPPXQREORW LQ $f &f 7KH UHODWLYH TXDQWLWLHV RI +/$ SURWHLQV V\QWKHVL]HG E\ LQ YLWUR WUDQVODWLRQ RI +/$$/ +/$$ DQG +/$ % P51$V 5HODWLYH TXDQWLW\ RI +/$$ SURWHLQV V\QWKHVL]HG E\ VKRUW +/$$ P51$V LV GHVLJQDWHG DV b 5HODWLYH TXDQWLW\ RI +/$$ SURWHLQV V\QWKHVL]HG E\ ORQJ +/$$ P51$V >SKRVSKRU GHQVLW\ RI $/fSKRVSKRU GHQVLW\ RI $f@ [ b 5HODWLYH TXDQWLWLHV RI +/$% SURWHLQV V\QWKHVL]HG +/$% P51$V >SKRVSKRU GHQVLW\ RI % [ fSKRVSKRU GHQVLW\ RI $ [ f@ [ b (DFK YDOXH UHSUHVHQWV WKH PHDQ RI IRXU VHSDUDWH PHDVXUHPHQWV %HFDXVH +/$% SURWHLQ KDV IHZHU PHWKLRQLQH UHVLGXHV PROHFXOHf WKDQ +/$$ SURWHLQ PROHFXOHf WKH TXDQWLW\ RI +/$% SURWHLQ GHWHUPLQHG E\ SKRVSKRU LPDJLQJ ZDV FDOLEUDWHG EDVHG RQ LWV QXPEHU RI PHWKLRQLQH UHVLGXHV

PAGE 73

WKH VKRUW +/$$ P51$ LQ V\QWKHVL]LQJ +/$$ KHDY\ FKDLQV +/$ KHDY\ FKDLQV ZHUH LGHQWLILHG EDVHG RQ PROHFXODU ZHLJKW DQG LPPXQREORWWLQJ ZLWK DQWL+/$+F P$E .DR HW DK f )LJXUH f 7KH DPRXQWV RI +/$ KHDY\ FKDLQV SURGXFHG E\ GLIIHUHQW P51$V LQ IRXU VHSDUDWH H[SHULPHQWV ZHUH TXDQWLILHG DQG QRUPDOL]HG DFFRUGLQJ WR WKHLU PHWKLRQLQH FRQWHQWV DJDLQVW +/$ KHDY\ FKDLQV V\QWKHVL]HG IURP WKH VKRUW +/$$ P51$V 7KH UHVXOWV VKRZQ LQ )LJXUH & LQGLFDWHG WKDW WKH HIILFLHQF\ RI +/$ KHDY\ FKDLQ V\QWKHVLV ZHUH b b DQG b IRU ORQJ +/$$ P51$ VKRUW +/$$ P51$ DQG +/$% P51$ UHVSHFWLYHO\ 'LVFXVVLRQ 7KH SULPDU\ JRDO RI WKLV VWXG\ ZDV WR GHWHUPLQH ZKHWKHU +/$$ P51$ LV PRUH HIILFLHQW LQ SURWHLQ WUDQVODWLRQ DV VXJJHVWHG E\ RXU HDUOLHU TXDQWLWDWLYH FRUUHODWLRQ VWXG\ EHWZHHQ F\WRSODVPLF +/$ P51$ DQG +/$ SURWHLQ H[SUHVVLRQ 7DEOH LQ &KDSWHU f 7R DFFRPSOLVK WKLV JRDO ZH VWXGLHG WKH LQ YLWUR SURWHLQ WUDQVODWLRQ RI +/$$ DQG % P51$V IURP WKH FHOO OLQH 7KLV FHOO OLQH ZDV FKRVHQ IRU RXU VWXG\ EHFDXVH RI WKH FRQVLVWHQW UHYHUVH FRUUHODWLRQ REVHUYHG EHWZHHQ UHODWLYH TXDQWLWLHV RI +/$$ DQG % P51$V DQG WKDW RI +/$$ DQG % SURWHLQV $OWKRXJK WKH JHQH VHTXHQFHV RI FODVV +/$ KDYH EHHQ GRFXPHQWHG 0DVRQ DQG 3DUKDP f DQG WKH UHJXODWRU\ HOHPHQWV RI WKH SURPRWHU UHJLRQ KDYH EHHQ LGHQWLILHG &HUHE DQG
PAGE 74

7KHQ WKH LQWDFW FDSSHG P51$V ZHUH WUHDWHG ZLWK WREDFFR DFLG S\URSKRVSKDWDVH 7KLV WUHDWPHQW PDNHV WKHP DFWLYH IRU WKH VXEVHTXHQW OLJDWLRQ ZLWK DQ 51$ DQFKRU ROLJRQXFOHRWLGH )URKPDQ f %\ XVLQJ WKLV DSSURDFK ZH LGHQWLILHG WZR W\SHV RI +/$$ P51$ ZLWK WZR GLIIHUHQW OHQJWKV RI f875V 7DEOH f $OWKRXJK ZH GLG QRW ILQG DQ\ +/$% P51$ ZLWK ORQJ f875 WKLV SRVVLELOLW\ KDYH QRW EHHQ H[FOXGHG 5HVXOWV RI WKH WUDQVODWLRQ VWXG\ LQ UDEELW UHWLFXORF\WH O\VDWH V\VWHP XVLQJ +/$$ DQG % P51$V V\QWKHVL]HG LQ YLWUR LQGHHG GHPRQVWUDWHG WKDW +/$$ WUDQVFULSWV DUH PRUH HIILFLHQW WKDQ +/$% P51$V LQ V\QWKHVL]LQJ +/$ SURWHLQV 7KH QHZO\ V\QWKHVL]HG +/$ KHDY\ FKDLQV DUH LGHQWLILHG EDVHG RQ PROHFXODU ZHLJKW DQG LPPXQRUHDFWLYLW\ WR DQ DQWL+/$KHDY\ FKDLQ PRQRFORQDO DQWLERG\ $OWKRXJK WKHUH LV VRPH QRQVSHFLILF ELQGLQJ RI P$E WR RWKHU SURWHLQV SUHVHQW LQ UDEELW UHWLFXORF\WH O\VDWH WKH LQFOXVLRQ RI D FRQWURO PL[WXUH RI UDEELW UHWLFXORF\WH O\VDWH HQDEOHG XV WR LGHQWLI\ WKH QHZO\ V\QWKHVL]HG +/$KHDY\ FKDLQV :H GLG QRW REVHUYH DQ\ QRQVSHFLILF ELQGLQJ RI WR PROHFXODU ZHLJKW VWDQGDUGV 7KH UHDVRQV IRU WKH REVHUYHG KLJK EDFNJURXQG RQ RXU LPPXQREORW DUH QRW FOHDU 7R REWDLQ PRUH DFFXUDWH TXDQWLWDWLYH UHVXOWV WKH QHZO\ V\QWKHVL]HG +/$ KHDY\ FKDLQV ZHUH PHDVXUHG E\ SKRVSKRU LPDJLQJ )LJXUH %f 7KH UHVXOWV VKRZQ LQ )LJXUH & LQGLFDWHG WKDW ORQJ +/$$ WUDQVFULSW LV PRUH HIILFLHQW WKDQ WKH VKRUW +/$$ WUDQVFULSW DQG WKDW WKH VKRUW +/$$ WUDQVFULSWV DUH DERXW WLPHV PRUH HIILFLHQW WKDQ +/$% WUDQVFULSWV LQ PDNLQJ +/$ KHDY\ FKDLQV %DVHG RQ RXU SUHYLRXV PHDVXUHPHQWV RI WKH UHODWLYH TXDQWLWLHV RI +/$$ DQG % P51$V b YV bf LQ WKH FHOO OLQH DQG WKH SURWHLQ WUDQVODWLRQ HIILFLHQF\ GHWHUPLQHG E\ WKH SUHVHQW VWXG\ ZH SUHGLFW WKDW UHODWLYH TXDQWLWLHV RI +/$$ DQG % SURWHLQV LQ WKH FHOO OLQH ZLOO EH b YV b 7KLV FDOFXODWLRQ KRZHYHU GLG QRW WDNH LQWR FRQVLGHUDWLRQ RI D VPDOO SHUFHQWDJH RI +/$$ WUDQVFULSWV WKDW DUH SUHVHQW LQ ORQJ IRUP ZKLFK DUH DERXW WLPHV PRUH HIILFLHQW WKDQ +/$% WUDQVFULSWV LQ SURWHLQ WUDQVODWLRQ 7KXV WKH FDOFXODWHG YDOXHV DUH FORVH WR WKH UHODWLYH TXDQWLWLHV RI +/$$ DQG % SURWHLQV b YV bf REVHUYHG LQ WKH FHOO OLQH

PAGE 75

$OWKRXJK RXU UHVXOWV VKRZHG WKDW +/$$ WUDQVFULSWV DUH PRUH HIILFLHQW LQ SURWHLQ WUDQVODWLRQ LQ WKH UDEELW UHWLFXORF\WH O\VDWH V\VWHP WKH H[DFW PHFKDQLVP IRU WKLV ILQGLQJ LV QRW FOHDU :KHQ WKH n HQG VHTXHQFHV RI +/$$ DQG % P51$V DUH FRPSDUHG WKH IROORZLQJ IHDWXUHV DUH QRWLFHG f 7KHUH DUH WZR $8* FRGRQV VHSDUDWHG E\ QXFOHRWLGH UHVLGXHV DW WKH EHJLQQLQJ RI FRGLQJ VHTXHQFH IRU +/$$ P51$ 7DEOH f 7KH WUDQVODWLRQ PD\ EH LQLWLDWHG DW HLWKHU RI WKHVH WZR FRGRQV 6ULYDVWDYD HW DK f ZKHUHDV RQO\ WKH ILUVW $8* LV IRXQG DW WKH EHJLQQLQJ RI +/$% P51$ FRGLQJ VHTXHQFH f 7KH n875 RI +/$% P51$ KDV D RQHQXFOHRWLGH GHOHWLRQ LPPHGLDWHO\ EHIRUH WKH ILUVW $8* FRGRQ FRPSDULQJ WR WKDW RI +/$$ P51$ f 1R H[DFW .R]DN VHTXHQFH *&&$*f&&$8** .R]DN .R]DN .R]DN f LV IRXQG LQ WKH n875 RI HLWKHU +/$$ RU +/$% +RZHYHU WKH VHTXHQFH SUR[LPDO WR WKH VHFRQG $8* FRGRQ RI +/$$ P51$ *&&*7&$8**f LV PRUH VLPLODU WR WKH .R]DN VHTXHQFH WKDQ WKH VHTXHQFH SUR[LPDO WR WKH ILUVW $8* FRGRQ RI +/$% FRGRQ *&&*$*$8*&f ,W LV OLNHO\ WKDW WKHVH GLIIHUHQFHV PD\ FRQWULEXWH WR WKH HQKDQFHG SURWHLQ WUDQVODWLRQ HIILFLHQF\ E\ +/$$ P51$ 0RUHRYHU WKHUH DUH DERXW b DQG b GLIIHUHQFH EHWZHHQ +/$$ DQG % LQ FRGLQJ VHTXHQFHV DQG f875 UHVSHFWLYHO\ %HFDXVH WKH f875 FRXOG DOVR SOD\ VRPH UROH LQ UHJXODWLQJ P51$ WUDQVODWLRQ -DFREVRQ DQG 3HOW] f WKH SRVVLEOH HIIHFW RI f875 RQ WKH REVHUYHG GLIIHUHQWLDO WUDQVODWLRQ RI +8$$ DQG % P51$V FRXOG QRW EH H[FOXGHG ,Q WKLV VWXG\ ZH DOVR IRXQG WKDW WKH ORQJ +/$$ P51$ LV PRUH HIILFLHQW IRU SURWHLQ WUDQVODWLRQ WKDQ WKH VKRUW IRUP 7KLV ILQGLQJ LQGLFDWHG WKDW WKH ORQJ f875 PD\ HQKDQFH WKH SURWHLQ WUDQVODWLRQ LQLWLDWLRQ 7KH PHFKDQLVP IRU WKH HQKDQFHG WUDQVODWLRQ RI ORQJ +/$$ P51$ LV QRW FOHDU %HFDXVH QR VHFRQGDU\ VWUXFWXUHV DUH IRXQG ZLWKLQ WKLV ORQJ f875 LW LV OLNHO\ WKDW WKH ORQJHU 875 FDQ DFFXPXODWH H[WUD 6 ULERVRPDO VXEXQLWV ZKLFK PD\ DFFRXQW IRU LWV WUDQVODWLRQDO DGYDQWDJH .R]DN f %HFDXVH WKH UDEELW UHWLFXORF\WH O\VDWH V\VWHP KDG EHHQ VKRZQ WR EH HIILFLHQW IRU LQ YLWUR SURWHLQ WUDQVODWLRQ DQG ZDV FRPPHUFLDOO\ DYDLODEOH 3HOKDP DQG -DFNVRQ

PAGE 76

6KLHOGV DQG %OREHO f WKLV V\VWHP ZDV FKRVHQ IRU RXU VWXG\ +RZHYHU WKH UDEELW UHWLFXORF\WH O\VDWH LV D KHWHURORJRXV V\VWHP DQG WKH UHVXOWV REWDLQHG IURP WKLV V\VWHP PD\ QRW UHSUHVHQW WKH DFWXDO VLWXDWLRQ LQ KXPDQ O\PSKREODVWRLG FHOOV $W SUHVHQW WKH H[DFW PHFKDQLVP UHVSRQVLEOH IRU WKH HQKDQFHG +/$$ SURWHLQ WUDQVODWLRQ KDV \HW WR EH IXUWKHU HOXFLGDWHG 1HYHUWKHOHVV WKH UHVXOWV RI WKLV VWXG\ VXJJHVWHG WKDW GLIIHUHQW SURWHLQ WUDQVODWLRQ UDWHV FRXOG FRQWULEXWH WR JHQHWLFDOO\ SUHGHWHUPLQHG GLIIHUHQWLDO TXDQWLWDWLYH H[SUHVVLRQ RI +/$$ DQG % DQWLJHQV

PAGE 77

&+$37(5 6800$5< $1' )8785( ',5(&7,21 (DUOLHU VWXGLHV KDYH VKRZQ WKDW GLIIHUHQW VSHFLILF +/$$ DQG % DQWLJHQV DUH GLIIHUHQWLDOO\ H[SUHVVHG LQ FHOOV 7KHLU UHODWLYH TXDQWLWLHV DUH JHQHWLFDOO\ SUHGHWHUPLQHG DQG LQKHULWHG DFFRUGLQJ WR 0HQGHOLDQ ODZ .DR DQG 5LOH\ f ,Q RUGHU WR GHWHUPLQH WKH UHJXODWRU\ PHFKDQLVPV XQGHUO\LQJ WKH REVHUYHG SKHQRPHQRQ ZH ILUVW VWXGLHG WKH WXUQRYHU RI +/$ SURWHLQV LQ O\PSKREODVWRLG FHOO OLQHV DQG IRXQG WKDW GLIIHUHQW +8$$ DQG % DQWLJHQV DUH SURSRUWLRQDOO\ GHJUDGHG :KHQ WKH UHODWLYH TXDQWLWLHV RI +/$ SURWHLQV ZHUH FRUUHODWHG ZLWK WKRVH RI +/$ P51$V LW ZDV IRXQG WKDW LQ PRVW RI WKH VWXGLHG FHOO OLQHV WKH UHODWLYH TXDQWLWLHV RI GLIIHUHQW +/$$ DQG % SURWHLQV DUH SURSRUWLRQDO WR WKRVH RI WKHLU UHVSHFWLYH P51$V ,Q DGGLWLRQ GLIIHUHQW +/$$ DQG % SURWHLQV KDYH VLPLODU VWDELOLWLHV )LJXUH f DQG WKH OHYHOV RI GLIIHUHQW +/$$ DQG % SURWHLQV DUH SURSRUWLRQDO WR WKHLU P51$ OHYHOV LQ PRVW O\PSKREODVWRLG FHOO OLQHV 7KHVH ILQGLQJV LQGLFDWH WKDW WKH DYDLODELOLW\ RI IXQFWLRQDO +/$ P51$V GHWHUPLQHV WKH GLIIHUHQWLDO TXDQWLWDWLYH H[SUHVVLRQ RI +/$ DQWLJHQV %HFDXVH WKH VWHDG\VWDWH OHYHOV RI +/$ P51$V DUH UHJXODWHG E\ P51$ SURGXFWLRQ DQG GHJUDGDWLRQ WKH LQYROYHPHQW RI ERWK VWHSV LQ UHJXODWLQJ WKH GLIIHUHQWLDO TXDQWLWDWLYH H[SUHVVLRQ RI +/$ DQWLJHQV ZDV VWXGLHG )LUVW ZH PHDVXUHG WKH UHODWLYH TXDQWLWLHV RI GLIIHUHQW +/$$ DQG % P51$V EHIRUH DQG DIWHU WKH FHOOV ZHUH WUHDWHG ZLWK '5% DQ LQKLELWRU RI 51$ SRO\PHUDVH ,, 7KH UHVXOWV RI WKLV VWXG\ VKRZHG WKDW GLIIHUHQW +/$$ DQG % P51$V ZHUH SURSRUWLRQDOO\ GHJUDGHG LQ ILYH RXW RI VHYHQ FHOO OLQHV VWXGLHG DQG WKDW WKH VWDELOLWLHV RI +/$$ DQG % P51$V LQ WKH UHPDLQLQJ WZR FHOO OLQHV DSSHDU WR KDYH VOLJKWO\ GLIIHUHQW WXUQRYHU UDWHV 7KLV ILQGLQJ VXJJHVWV WKDW WKH YDU\LQJ VWDELOLW\ IRU +/$$

PAGE 78

DQG % P51$V RQO\ SOD\V D PLQRU UROH LQ GHWHUPLQLQJ GLIIHUHQWLDO TXDQWLWDWLYH H[SUHVVLRQ IRU FHUWDLQ +/$$ DQG % DQWLJHQV 1H[W ZH VWXGLHG WKH UROH RI P51$ SURGXFWLRQ 7KH UHVXOWV RI RXU 3&5EDVHG QXFOHDU UXQRQ VWXG\ VKRZHG WKDW QHZO\ V\QWKHVL]HG +/$ WUDQVFULSWV RQO\ DFFRXQW IRU OHVV WKDQ b RI WRWDO +/$ SUHP51$V 7KH SUHVHQFH RI UHODWLYHO\ ODUJH DPRXQW RI SUH P51$ VXJJHVWV WKDW SUHP51$ VSOLFLQJ FRXOG EH D UDWHOLPLWLQJ VWHS LQ UHJXODWLQJ +/$ P51$ SURGXFWLRQ 7KLV ILQGLQJ DOVR SUHYHQWV XV IURP DFFXUDWHO\ PHDVXULQJ WKH QHZO\ V\QWKHVL]HG +/$ WUDQVFULSWV E\ XVLQJ D 3&5EDVHG QXFOHDU UXQRQ PHWKRG :H WKHUHIRUH SHUIRUPHG H[SHULPHQWV WR GHWHUPLQH WKH UHODWLYH TXDQWLWLHV RI XQVSOLFHG +/$$ DQG % WUDQVFULSWV DQG WKRVH RI VSOLFHG +/$$ DQG % WUDQVFULSWV ,W ZDV IRXQG WKDW GLIIHUHQW +/$$ DQG % SUHP51$V LQ QXFOHL DUH QRW SURSRUWLRQDO WR WKHLU PDWXUH F\WRSODVPLF P51$V LQ ILYH RI VHYHQ +/$SKHQRW\SHG O\PSKREODVWRLG FHOO OLQHV 7KH GLIIHUHQFHV DUH TXLWH VLJQLILFDQW IRU VRPH RI WKH FHOO OLQHV 7KHVH UHVXOWV VXJJHVW WKDW WKH VSOLFLQJ RI SUH P51$ DQG JHQH WUDQVFULSWLRQ DUH FULWLFDO LQ UHJXODWLQJ WKH JHQHWLFDOO\ SUHGHWHUPLQHG GLIIHUHQWLDO H[SUHVVLRQ RI +/$$ DQG % DQWLJHQV LQ GLIIHUHQW FHOO OLQHV $OWKRXJK WKH UHODWLYH TXDQWLWLHV RI GLIIHUHQW +/$$ DQG % DQWLJHQV DUH SURSRUWLRQDO WR WKH UHODWLYH DPRXQWV RI WKHLU UHVSHFWLYH P51$V LQ PRVW OXPSKRELDVWRLG FHOO OLQHV LQ FHOO OLQHV SRVLWLYH IRU WKH +/$$ RU % WKH +/$$ DQG % SURWHLQV DSSHDU WR EH RYHUH[SUHVVHG 7KLV REVHUYDWLRQ VXJJHVWV WKDW P51$V IRU FHUWDLQ +/$ DQWLJHQV PD\ EH PRUH HIILFLHQW LQ V\QWKHVL]LQJ +/$ KHDY\ FKDLQV :H WKHUHIRUH VHOHFWHG WKH FHOO OLQH ZKLFK LV SRVLWLYH IRU +/$$ DQG % WR VWXG\ ZKHWKHU WUDQVODWLRQ RI P51$ SOD\V D UROH LQ LQIOXHQFLQJ WKH GLIIHUHQWLDO TXDQWLWDWLYH H[SUHVVLRQ RI +/$$ DQG % DQWLJHQV ,Q YLWUR WUDQVODWLRQ VWXGLHV LQGLFDWHG WKDW +/$$ DQG % P51$V V\QWKHVL]HG LQ YLWUR LQGHHG KDYH GLIIHUHQW WUDQVODWLRQ UDWHV 2XU UHVXOWV VKRZHG WKDW +/$$ P51$ LV PRUH HIILFLHQW WKDQ +/$% P51$ LQ V\QWKHVL]LQJ +/$ SURWHLQV 7KLV REVHUYDWLRQ VXSSRUWHG WKH K\SRWKHVLV WKDW GLIIHUHQWLDO P51$ WUDQVODWLRQ FRXOG SOD\ D UROH LQ GHWHUPLQLQJ WKH GLIIHUHQWLDO TXDQWLWDWLYH H[SUHVVLRQ RI +/$ DQWLJHQV IRU FHUWDLQ +/$ SKHQRW\SHV

PAGE 79

,Q VXPPDU\ 7DEOH f WKH UHVXOWV RI P\ VWXG\ LQGLFDWH WKDW WKH TXDQWLWDWLYH GLIIHUHQWLDO H[SUHVVLRQ RI +/$$ DQG % DQWLJHQV LV GHWHUPLQHG E\ FRPELQDWLRQV RI PXOWLSOH VWHSV 7KHVH VWHSV LQFOXGH JHQH WUDQVFULSWLRQ SUHP51$ VSOLFLQJ P51$ GHJUDGDWLRQ DQGRU P51$ WUDQVODWLRQ GHSHQGLQJ RQ VSHFLILF +/$ DOOHOHV LQ GLIIHUHQW LQGLYLGXDOV $PRQJ WKHP JHQH WUDQVFULSWLRQ DQG SUHP51$ VSOLFLQJ SOD\ WKH PRVW SURPLQHQW UROHV )RU FHUWDLQ VSHFLILF +/$ DQWLJHQV LH +/$$ SURWHLQ WUDQVODWLRQ DOVR SOD\V D VLJQLILFDQW UROH 7DEOH &RQWULEXWLRQ RI GLIIHUHQW FRQWUROOLQJ VWHSV WR WKH UHJXODWLRQ RI GLIIHUHQWLDO TXDQWLWDWLYH H[SUHVVLRQ RI GLIIHUHQW +/$$ DQG % DQWLJHQV LQ WKH VWXGLHG /&/V /&/ +/$$t% 3KHQRW\SHV *HQH WUDQVFULSWLRQr 3UHP51$ VSOLFLQJ P51$ WXUQRYHU P51$ WUDQVODWLRQ SURWHLQ WXUQRYHU $ % 1' $ % $ % $ % 1' 6+ $ $ % % 1' 1' 1' &* $YDU $ % % 1' 1' 1' $ % 1' '& $OO $ % % 1' $ % ‘ $ % % SOD\V D UROH LQ GHWHUPLQLQJ WKH GLIIHUHQWLDO TXDQWLWDWLYH H[SUHVVLRQ RI +/$$ DQG % DQWLJHQV LQ WKLV /&/ GRHV QRW SOD\ D UROH LQ GHWHUPLQLQJ WKH GLIIHUHQWLDO TXDQWLWDWLYH H[SUHVVLRQ RI +/$$ DQG % DQWLJHQV LQ WKLV /&/ r &RQFOXVLRQ IRU WKLV VWHS LV LQIHUUHG IURP VWXGLHV RI RWKHU VWHSV 1' QRW GHWHUPLQHG

PAGE 80

7KH GLIIHUHQWLDO TXDQWLWDWLYH H[SUHVVLRQ RI FODVV ,+/$ DQWLJHQV FRXOG DOVR EH UHJXODWHG E\ RWKHU VWHSV LQFOXGLQJ WKH DVVRFLDWLRQ RI +/$ KHDY\ FKDLQ ZLWK >P RU FKDSHURQHV WKH DYDLODELOLW\ RI DQWLJHQLF SHSWLGHV DQG WKH WUDQVSRUWDWLRQ RI WKH DVVHPEOHG DQWLJHQV WR WKH FHOO VXUIDFH $OWKRXJK DOO RI WKHVH DGGLWLRQDO SRWHQWLDO UHJXODWRU\ VWHSV KDYH QRW EHHQ VWXGLHG WKH\ DUH QRW OLNHO\ WR SOD\ VLJQLILFDQW UROHV LQ UHJXODWLQJ WKH REVHUYHG GLIIHUHQWLDO TXDQWLWDWLYH H[SUHVVLRQ ,I WKHVH DGGLWLRQDO VWHSV ZHUH LPSRUWDQW LQ UHJXODWLQJ WKH GLIIHUHQWLDO H[SUHVVLRQ RI +/$ DQWLJHQV ZH ZRXOG QRW KDYH REVHUYHG WKH SURSRUWLRQDO FRUUHODWLRQ EHWZHHQ WKH UHODWLYH DPRXQWV RI +/$$ DQG % SURWHLQV DQG WKRVH RI WKHLU UHVSHFWLYH +/$$ DQG % P51$V LQ PRVW FHOO OLQHV 7DEOH f $OWKRXJK WKH UHVHDUFK ZRUNV SUHVHQWHG LQ WKLV GLVVHUWDWLRQ KDYH LGHQWLILHG WKH FULWLFDO VWHSV IRU UHJXODWLQJ GLIIHUHQWLDO TXDQWLWDWLYH H[SUHVVLRQ RI +/$ DQWLJHQV WKH H[DFW PROHFXODU PHFKDQLVPV GLUHFWO\ UHVSRQVLEOH IRU GLIIHUHQWLDO JHQH WUDQVFULSWLRQ GLIIHUHQWLDO SUHP51$ VSOLFLQJ DQG GLIIHUHQWLDO SURWHLQ WUDQVODWLRQ UHPDLQ WR EH HOXFLGDWHG 7KH VHTXHQFH GLIIHUHQFHV DPRQJ GLIIHUHQW +/$$ DQG % JHQHV VFDWWHUHG LQ ERWK FRGLQJ DQG QRQFRGLQJ UHJLRQV FRXOG EH LQYROYHG LQ UHJXODWLQJ WKH JHQHWLFDOO\ SUHGHWHUPLQHG GLIIHUHQWLDO TXDQWLWDWLYH H[SUHVVLRQ RI +/$$ DQG % DQWLJHQV 7KHUHIRUH LW ZRXOG EH RI LQWHUHVW WR GHWHUPLQH KRZ f875 f875 DQGRU FRGLQJ VHTXHQFHV GHWHUPLQH WKH REVHUYHG GLIIHUHQW HIILFLHQFLHV LQ SURWHLQ WUDQVODWLRQ E\ GLIIHUHQW +/$ P51$V 7KLV VWXG\ FDQ EH FRQGXFWHG E\ FRQVWUXFWLQJ GLIIHUHQW +/$$% F'1$ K\EULGV DQG SHUIRUPLQJ WKH LQ YLWUR WUDQVODWLRQ VWXG\ %\ VZLWFKLQJ WKH f875 RI +/$$ P51$ WR WKDW RI +/$% P51$ IRU H[DPSOH ZH ZLOO EH DEOH WR OHDUQ ZKHWKHU WKH VHTXHQFH GLIIHUHQFH LQ WKHLU f875V SOD\V D FHUWDLQ UROH LQ UHJXODWLQJ WKH REVHUYHG GLIIHUHQWLDO WUDQVODWLRQ 7R LQYHVWLJDWH KRZ +/$$ DQG % SUHP51$V DUH VSOLFHG GLIIHUHQWLDOO\ QRUWKHUQ EORW RI WKH QXFOHDU 51$V ZLWK SUREHV GHULYHG IURP GLIIHUHQW LQWURQV FRXOG EH XVHG WR GHWHUPLQH ZKHWKHU LQWURQV RI GLIIHUHQW +/$ SUHP51$V DUH VSOLFHG IROORZLQJ WKH VDPH RUGHU RU QRW ,W LV DOVR LPSRUWDQW WR LGHQWLI\ WKH VSHFLILF VHTXHQFHVf UHVSRQVLEOH IRU WKH REVHUYHG GLIIHUHQWLDO VSOLFLQJ RI +/$$ DQG % SUHP51$V )XUWKHU FRPSDUDWLYH VWXG\ RQ JHQRPLF

PAGE 81

VWUXFWXUHV RI +/$$ DQG % JHQHV IURP XQUHODWHG LQGLYLGXDOV ZLOO HQDEOH XV WR DQVZHU WKH TXHVWLRQV UHJDUGLQJ WKH XQGHUO\LQJ PHFKDQLVPV IRU GLIIHUHQWLDO JHQH WUDQVFULSWLRQ $ GHHSHU XQGHUVWDQGLQJ RI WKHVH GLIIHUHQW UHJXODWRU\ VWHSV ZLOO DOORZ XV WR IXUWKHU HOXFLGDWH WKH ELRORJLFDO DQG JHQHWLFDO LPSRUWDQFH RI GLIIHUHQWLDO TXDQWLWDWLYH H[SUHVVLRQ RI +/$ DQWLJHQV LQ GHWHUPLQLQJ YDU\LQJ GLVHDVH VXVFHSWLELOLWLHV VXFK DV LPPXQH VXUYHLOODQFH RI WXPRU FHOOV DQG UHFRYHU\ IURP YLUXV LQIHFWLRQ LQ WKH IXWXUH

PAGE 82

5()(5(1&(6 $GDPDVKYLOL 0 )UDVHU 3 $ DQG 0F'RQDOG & f f$VVRFLDWLRQ RI VHUXP FRQFHQWUDWLRQ RI VROXEOH FODVV ,+/$ ZLWK +/$ DOORW\SHV >VHH FRPPHQWV@f 7UDQVSODQWDWLRQ f $OOHQ 0 /LX / DQG *\OOHQVWHQ 8 f f$ FRPSUHKHQVLYH SRO\PHUDVH FKDLQ UHDFWLRQROLJRQXFOHRWLGH W\SLQJ V\VWHP IRU WKH +/$ FODVV $ ORFXVf +XP ,PPXQRO f $QGHUVRQ 0 3DDER 6 DQG 1LOVVRQ 7 f f,PSDLUHG LQWUDFHOOXODU WUDQVSRUW RI FODVV ,0+& DQWLJHQV DV D SRVVLEOH PHDQV IRU DGHQRYLUXVHV WR HYDGH LPPXQH VXUYHLOODQFHf &HOO %DOYD\ / /LEUL DQG )LV]PDQ 0 < f f3UHP51$ VHFRQGDU\ VWUXFWXUH DQG WKH UHJXODWLRQ RI VSOLFLQJf %LRHVVD\V f %HGQDUHN 0 $ (QJO 6 $ *DPPRQ 0 & /LQGTXLVW $ 3RUWHU :LOOLDPVRQ $ 5 DQG =ZHHULQN + f f6ROXEOH +/$$ UHVWULFWHG SHSWLGHV WKDW DUH UHFRJQL]HG E\ LQIOXHQ]D YLUXV VSHFLILF F\WRWR[LF 7 O\PSKRF\WHVf ,PPXQRO 0HWKRGV f %HHOPDQ & $ DQG 3DUNHU 5 f f'HJUDGDWLRQ RI P51$ LQ HXNDU\RWHVf &HOO f %HQKDP $ 0 DQG 1HHIMHV f f3URWHDVRPH DFWLYLW\ OLPLWV WKH DVVHPEO\ RI 0+& FODVV PROHFXOHV DIWHU ,)1JDPPD VWLPXODWLRQf ,PPXQRO f %HUQVWHLQ 6 DQG +RGJHV f f&RQVWLWXWLYH DQG DOWHUQDWLYH P51$ VSOLFLQJf P51$ 0HWDEROLVP t 3RVWWUDQVFULSWLRQDO *HQH 5HJXODWLRQ % +DUIRUG DQG 5 0RUULV HGV :LOH\/LVV ,QF 1HZ
PAGE 83

%MRUNPDQ 3 6DSHU 0 $ 6DPUDRXL % %HQQHWW : 6 6WURPLQJHU / DQG :LOH\ & f f7KH IRUHLJQ DQWLJHQ ELQGLQJ VLWH DQG 7 FHOO UHFRJQLWLRQ UHJLRQV RI FODVV KLVWRFRPSDWLELOLW\ DQWLJHQVf 1DWXUH %ODQDU 0 $ %DOGZLQ $ 6 )ODYHOO 5 $ DQG 6KDUS 3 $ f f$ JDPPD LQWHUIHURQLQGXFHG IDFWRU WKDW ELQGV WKH LQWHUIHURQ UHVSRQVH VHTXHQFH RI WKH 0+& FODVV JHQH +.Ef (0%2 %RGPHU 0DUVK 6 $OEHUW ( %RGPHU : ) %RQWURS 5 ( &KDUURQ 'XSRQW % (UOLFK + $ )DXFKHW 5 0DFK % 0D\U : 5 3DUKDP 3 6DVD]XNL 7 6FKUHXGHU 0 6WURPLQJHU / 6YHMJDDUG $ DQG 7HUDVDNL 3 f f1RPHQFODWXUH IRU IDFWRUV RI WKH ),/$ V\VWHP f 7LVVXH $QWLJHQV 3W f %RGPHU : ) %URZQLQJ 0 .UDXVD 3 5RZDQ $ %LFNQHOO & DQG %RGPHU f f7XPRU HVFDSH IURP LPPXQH UHVSRQVH E\ YDULDWLRQ LQ +/$ H[SUHVVLRQ DQG RWKHU PHFKDQLVPVf $QQ 1 < $FDG 6FL %RUGLHU & f f3KDVH VHSDUDWLRQ RI LQWHJUDO PHPEUDQH SURWHLQV LQ 7ULWRQ ;O VROXWLRQf %LRO &KHP f %UDG\ + $ DQG :ROG : 6 f f,GHQWLILFDWLRQ RI D QRYHO VHTXHQFH WKDW JRYHUQV ERWK SRO\DGHQ\ODWLRQ DQG DOWHUQDWLYH VSOLFLQJ LQ UHJLRQ ( RI DGHQRYLUXVf 1XFOHLF $FLGV 5HV f %UDXG 9 0 $OODQ 6 2n&DOODJKDQ & $ 6RGHUVWURP 'n$QGUHD $ 2JJ 6 /D]HWLF 6
PAGE 84

&DUVWHQV 5 3 0F.HHKDQ : / DQG *DUFLD%LDQFR 0 $ f f$Q LQWURQLF VHTXHQFH HOHPHQW PHGLDWHV ERWK DFWLYDWLRQ DQG UHSUHVVLRQ RI UDW ILEUREODVW JURZWK IDFWRU UHFHSWRU SUHP51$ VSOLFLQJf 0RO &HOO %LRO f &HUHE 1 DQG
PAGE 85

(QQLV 3 =HPPRXU 6DOWHU 5 DQG 3DUKDP 3 f f5DSLG FORQLQJ RI +/$$ % F'1$ E\ XVLQJ WKH SRO\PHUDVH FKDLQ UHDFWLRQ IUHTXHQF\ DQG QDWXUH RI HUURUV SURGXFHG LQ DPSOLILFDWLRQf 3URF 1DWO $FDG 6FL 86$ f (SHURQ / 3 *UDKDP 5 *ULIILWKV $ DQG (SHURQ & f f(IIHFWV RI 51$ VHFRQGDU\ VWUXFWXUH RQ DOWHUQDWLYH VSOLFLQJ RI SUHP51$ LV IROGLQJ OLPLWHG WR D UHJLRQ EHKLQG WKH WUDQVFULELQJ 51$ SRO\PHUDVH"f &HOO f (YHUHWW ( 7 .DR DQG 6FRUQLN & f f&ODVV +/$ PROHFXOHV RQ KXPDQ HU\WKURF\WHV 4XDQWLWDWLRQ DQG WUDQVIXVLRQ HIIHFWVf 7UDQVSODQWDWLRQ f )DOFRQH DQG $QGUHZV : f f%RWK WKH n XQWUDQVODWHG UHJLRQ DQG WKH VHTXHQFHV VXUURXQGLQJ WKH VWDUW VLWH FRQWULEXWH WR HIILFLHQW LQLWLDWLRQ RI WUDQVODWLRQ LQ YLWURf 0RO &HOO %LRO f )DON 5RW]VFKNH 2 6WHYDQRYLF 6 -XQJ DQG 5DPPHQVHH + f f$OOHOHVSHFLILF PRWLIV UHYHDOHG E\ VHTXHQFLQJ RI VHOISHSWLGHV HOXWHG IURP 0+& PRHFXOHVf 1DWXUH )URKPDQ 0 $ f f2Q EH\RQG FODVVLF 5$&( UDSLG DPSOLILFDWLRQ RI F'1$ HQGVff 3&5 0HWKRGV $SSO f 6 )XUGRQ 3 DQG .ROH 5 f f7KH OHQJWK RI WKH GRZQVWUHDP H[RQ DQG WKH VXEVWLWXWLRQ RI VSHFLILF VHTXHQFHV DIIHFW SUHP51$ VSOLFLQJ LQ YLWURf 0RO &HOO %LRO f *DOOLH 5 f f7KH FDS DQG SRO\$f WDLO IXQFWLRQ V\QHUJLVWLFDOO\ WR UHJXODWH P51$ WUDQVODWLRQDO HIILFLHQF\f *HQHV 'HY f *DOOLH 5 DQG 7DQJXD\ 5 f f3RO\$f ELQGV WR LQLWLDWLRQ IDFWRUV DQG LQFUHDVHV FDSGHSHQGHQW WUDQVODWLRQ LQ YLWURf %LRO &KHP f *DPEDFXUWD $ 3LUR 0 & DQG $VFROL ) f f'LIIHUHQWLDO LQ YLWUR WUDQVODWLRQ RI WKH SUHFXUVRUV RI ERYLQH SDQFUHDWLF WU\SVLQ LQKLELWRU DQG LWV LVRLQKLELWRU ,, LV FRQWUROOHG E\ WKH nHQG UHJLRQ RI WKHLU P51$Vf %LRFKLP %LRSK\V $FWD f *DR ; -DNREVHQ % DQG 6HUMHDQWVRQ 6 : f f&KDUDFWHUL]DWLRQ RI WKH +/$$ SRO\PRUSKLVP E\ ORFXVVSHFLILF SRO\PHUDVH FKDLQ UHDFWLRQ DPSOLILFDWLRQ DQG ROLJRQXFOHRWLGH K\EULGL]DWLRQf +XP ,PPXQRO f *DXVH : & DQG $GDPRYLF] f f8VH RI WKH 3&5 WR TXDQWLWDWH JHQH H[SUHVVLRQf 3&5 0HWKRGV $SSO 6 *HUUDUG 7 / '\H U 5 =RRQ & ]XU1HGGHQ DQG 6LHJHO 3 f f0RGXODWLRQ RI FODVV DQG FODVV ,, KLVWRFRPSDWLELOLW\ DQWLJHQV RQ KXPDQ 7 FHOO OLQHV E\ ,)1JDPPDf ,PPXQRO f *LOOLODQG 3HUULQ 6 DQG %XQQ + ) f f&RPSHWLWLYH 3&5 IRU TXDQWLWDWLRQ RI P51$f 3&5 3URWRFROV $ *XLGH WR 0HWKRGV DQG $SSOLFDWLRQV 0 $ ,QQLV + *HOIDQG 6QLQVN\ DQG 7 :KLWH HGV $FDGHPLF 3UHVV 6DQ 'LHJR &$ *LUGOHVWRQH ,VDPDW 0 *HZHUW DQG 0LOVWHLQ & f f7UDQVFULSWLRQDO UHJXODWLRQ RI +/$$ DQG % GLIIHUHQWLDO ELQGLQJ RI PHPEHUV RI WKH 5HO DQG ,5) IDPLOLHV RI WUDQVFULSWLRQ IDFWRUVf 3URF 1DWO $FDG 6FL 86$ f

PAGE 86

*LUGOHVWRQH DQG 0LOVWHLQ & f f'LIIHUHQWLDO H[SUHVVLRQ DQG LQWHUIHURQ UHVSRQVH RI +/$ FODVV JHQHV LQ WK\PRF\WH OLQHV DQG UHVSRQVH YDULDQWVf (XU ,PPXQRO f *RVJXVHY 7HXWVFK % 0RULQ 0 7 0RQJLDW ) +DJHQDX ) 6XVNLQG DQG 5DERWWL ) f f,QKLELWLRQ RI +/$ FODVV DQWLJHQ DQG P51$ H[SUHVVLRQ LQGXFHG E\ 5RXV VDUFRPD YLUXV LQ WUDQVIRUPHG KXPDQ ILEUREODVWVf 3URF 1DWO $FDG 6FL 86$ *UDQW ( 3 0LFKDOHN 0 7 *ROGEHUJ $ / DQG 5RFN / f f5DWH RI DQWLJHQ GHJUDGDWLRQ E\ WKH XELTXLWLQSURWHDVRPH SDWKZD\ LQIOXHQFHV 0+& FODVV SUHVHQWDWLRQf ,PPXQRO f *UD\ 1 DQG +HQW]H 0 : f f5HJXODWLRQ RI SURWHLQ V\QWKHVLV E\ P51$ VWUXFWXUHf 0RO %LRO 5HS f *UHLJ 0 6KDUS & % &DUUHO / DQG :LOODUG + ) f f'XSOLFDWHG ]LQF ILQJHU SURWHLQ JHQHV RQ WKH SUR[LPDO VKRUW DUP RI WKH KXPDQ ; FKURPRVRPH ,VRODWLRQ FKDUDFWHUL]DWLRQ DQG ;LQDFWLYDWLRQ VWXGLHVf +XP 0RO *HQHW +DJD $ 6KH ; DQG .DR f f%LRFKHPLFDO FKDUDFWHUL]DWLRQ RI N'D FODVV KLVWRFRPSDWLELOLW\ DQWLJHQ LQ SODVPD $ VHFUHWDEOH PHPEUDQH SURWHLQ GHULYHG IURP WUDQVPHPEUDQH GRPDLQ GHOHWLRQf %LRO &KHP f +DNHP 5 /H%RXWHLOOHU 3 %DUDG 0 7UXMLOOR 0 0HUFLHU 3 :LHW]HUELQ DQG /HPRQQLHU ) $ f f,)1PHGLDWHG GLIIHUHQWLDO UHJXODWLRQ RI WKH H[SUHVVLRQ RI +/$ % DQG +/$$ FODVV JHQHVf ,PPXQRO f +DOO ) & DQG %RZQHVV 3 f f+/$ DQG GLVHDVH IURP PROHFXODU IXQFWLRQ WR GLVHDVH DVVRFLDWLRQ"f +/$ DQG 0+& JHQHV PROHFXOHV DQG IXQFWLRQ 0 %URZQLQJ DQG $ 0F0LFKDHO HGV %,26 6FLHQWLILF 3XEOLVKHUV /WG 2[IRUG 8. +DPSVH\ 0 f f0ROHFXODU JHQHWLFV RI WKH 51$ SRO\PHUDVH ,, JHQHUDO WUDQVFULSWLRQDO PDFKLQHU\f 0LFURELRO 0RO %LRO 5HY f +HLQULFKV 9 5\QHU / & DQG %DNHU % 6 f f5HJXODWLRQ RI VH[VSHFLILF VHOHFWLRQ RI IUXLWOHVV n VSOLFH VLWHV E\ WUDQVIRUPHU DQG WUDQVIRUPHUf 0RO &HOO %LRO f +HVV 0 $ DQG 'XQFDQ 5 ) f f51$SURWHLQ LQWHUDFWLRQV LQ WKH nXQWUDQVODWHG OHDGHU RI +63 P51$ LQ 'URVRSKLOD O\VDWHV /DFN RI HYLGHQFH IRU VSHFLILF SURWHLQ ELQGLQJf %LRO &KHP f +LOO $ -XJRYLF 3 ,Q 3URFHVV &LWDWLRQ@f $QQX 5HY ,PPXQRO +LOO $ 9 $OOVRSS & ( .ZLDWNRZVNL $QVWH\ 1 0 *UHHQZRRG % 0 DQG 0F0LFKDHO $ Df f+/$ FODVV W\SLQJ E\ 3&5 +/$% DQG DQ $IULFDQ % VXEW\SH >VHH FRPPHQWV@f /DQFHW f

PAGE 87

+LOO $ 9 $OOVRSS & ( .ZLDWNRZVNL $QVWH\ 1 0 7ZXPDVL 3 5RZH 3 $ %HQQHWW 6 %UHZVWHU 0F0LFKDHO $ DQG *UHHQZRRG % 0 Ef f&RPPRQ ZHVW $IULFDQ +/$ DQWLJHQV DUH DVVRFLDWHG ZLWK SURWHFWLRQ IURP VHYHUH PDODULD >VHH FRPPHQWV@f 1DWXUH f +LOO $ 9 (OYLQ :LOOLV $ & $LGRR 0 $OOVRSS & ( *RWFK ) 0 *DR ; 0 7DNLJXFKL 0 *UHHQZRRG % 0 7RZQVHQG $ 5 f f0ROHFXODU DQDO\VLV RI WKH DVVRFLDWLRQ RI +/$% DQG UHVLVWDQFH WR VHYHUH PDODULD >VHH FRPPHQWV@f 1DWXUH f +RGJHV DQG %HUQVWHLQ 6 f f*HQHWLF DQG ELRFKHPLFDO DQDO\VLV RI DOWHUQDWLYH 51$ VSOLFLQJf $GY *HQHW +RQPD 6 7VXNDGD 6 +RQGD 6 1DNDPXUD 0 7DNDNXZD 0DUXKDVKL 7 .RGDPD 6 .DQD]DZD 7DNDKDVKL 7 DQG 7DQDND f f%LRORJLFDOFOLQLFDO VLJQLILFDQFH RI VHOHFWLYH ORVV RI +/$FODVV, DOOHOLF SURGXFW H[SUHVVLRQ LQ VTXDPRXVFHOO FDUFLQRPD RI WKH XWHULQH FHUYL[f ,QW &DQFHU f +RRG / 6WHLQPHW] 0 DQG 0DOLVVHQ % f f*HQHV RI WKH PDMRU KLVWRFRPSDWLELOLW\ FRPSOH[ RI WKH PRXVHf $QQD 5HY ,PPXQRO +RUWRQ 5 0f +XQW + 'f +R 6 1f 3XOOHQ .f DQG 3HDVH / 5 f f(QJLQHHULQJ K\EULG JHQHV ZLWKRXW WKH XVH RI UHVWULFWLRQ HQ]\PHV JHQH VSOLFLQJ E\ RYHUODS H[WHQVLRQf *HQH f +RZFURIW 7 6WUHEHO 0DUWLQ 0 $ DQG 6LQJHU 6 f f5HSUHVVLRQ RI 0+& FODVV JHQH SURPRWHU DFWLYLW\ E\ WZRH[RQ 7DW RI +,9f 6FLHQFH f +XJKHV ( $ +DPPRQG & DQG &UHVVZHOO 3 f f0LVIROGHG PDMRU KLVWRFRPSDWLELOLW\ FRPSOH[ FODVV KHDY\ FKDLQV DUH WUDQVORFDWHG LQWR WKH F\WRSODVP DQG GHJUDGHG E\ WKH SURWHDVRPHf 3URF 1DWO $FDG 6FL 86$ f ,L]XND 1 1DMLWD / )UDQ]XVRII $ DQG 6DUQRZ 3 f f&DSGHSHQGHQW DQG FDS LQGHSHQGHQW WUDQVODWLRQ E\ LQWHUQDO LQLWLDWLRQ RI P51$V LQ FHOO H[WUDFWV SUHSDUHG IURP 6DFFKDURP\FHV FHUHYLVLDHf 0RO &HOO %LRO f ,WR .DVKLZDJL :DWDQDEH 6 .DPHML 7 +D\DVKL 6 DQG ,JDUDVKL f f,QIOXHQFH RI WKH nXQWUDQVODWHG UHJLRQ RI RUQLWKLQH GHFDUER[\ODVH P51$ DQG VSHUPLGLQH RQ RUQLWKLQH GHFDUER[\ODVH V\QWKHVLVf %LRO &KHP f -DFREVRQ $ f f3RO\$f 0HWDEROLVP DQG 7UDQVODWLRQ 7KH &ORVHGORRS 0RGHOf 7UDQVODWLRQDO &RQWURO : % +HUVKH\ 0 % 0DWKHZV DQG 1 6RQHQEHUJ HGV &ROG 6SULQJ +DUERU /DERUDWRU\ 3UHVV &ROG 6SULQJ +DUERU /DERUDWRU\ 1HZ ,Q 3URFHVV &LWDWLRQ@f %LRO &KHP f .DQDML 7 2NDPXUD 7 2VDNL .XURLZD 0 6KLPRGD +DPDVDNL 1 DQG 1LKR < f f$ FRPPRQ JHQHWLF SRO\PRUSKLVP & WR 7 VXEVWLWXWLRQf LQ WKH n

PAGE 88

XQWUDQVODWHG UHJLRQ RI WKH FRDJXODWLRQ IDFWRU ;,, JHQH LV DVVRFLDWHG ZLWK ORZ WUDQVODWLRQ HIILFLHQF\ DQG GHFUHDVH LQ SODVPD IDFWRU ;,, OHYHOf %ORRG f .DR f f3ODVPD DQG SODWHOHW +/$ LQ QRUPDO LQGLYLGXDOV 4XDQWLWDWLRQ E\ FRPSHWLWLYH HQ]\PHOLQNHG LPPXQRDVVD\f %ORRG .DR f f6WDELOLW\ RI SODWHOHW DQG SODVPD +/$ FRQFHQWUDWLRQV LQ KHDOWK\ DGXOWV RU UDQGRPGRQRU SODWHOHW FRQFHQWUDWHVf 7UDQVIXVLRQ f .DR DQG 5LOH\ : f f*HQHWLF SUHGHWHUPLQDWLRQ RI TXDQWLWDWLYH H[SUHVVLRQ RI +/$ DQWLJHQV LQ SODWHOHWV DQG PRQRQXFOHDU OHXNRF\WHVf +XP ,PPXQRO f .DR 6FRUQLN & DQG 0F4XHHQ & ) f f(YDOXDWLRQ RI LQGLYLGXDO VSHFLILWLHV RI FODVV +/$ RQ SODWHOHWV E\ D QHZO\ GHYHORSHG PRQRFORPDO DQWLERG\f +XPDQ ,PPXQRORJ\ f .DR 6FRUQLN & 5LOH\ : DQG 0F4XHHQ & ) f f$VVRFLDWLRQ EHWZHHQ +/$ SKHQRW\SH DQG +/$ FRQFHQWUDWLRQ LQ SODVPD RU SODWHOHWVf +XPDQ ,PPXQRORJ\ .DXIPDQ 6 6FKRRQ 5 $ DQG /HLEVRQ 3 f f0+& FODVV H[SUHVVLRQ RQ WXPRU WDUJHWV LQKLELWV QDWXUDO NLOOHU FHOOPHGLDWHG F\WRWR[LFLW\ ZLWKRXW LQWHUIHULQJ ZLWK WDUJHW UHFRJQLWLRQf ,PPXQRO f .LHUDQ 0 %ODQN 9 /RJHDW ) 9DQGHNHUFNKRYH /RWWVSHLFK ) /H%DLO 2 8UEDQ 0 % .RXULOVN\ 3 %DHXHUOH 3 $ DQG ,VUHDO $ f f7KH '1$ ELQGLQJ VXEXQLW RI 1)N% LV LGHQWLFDO WR IDFWRU .%) DQG KRPRORJRXV WR WKH UHO RQFRJHQH SURGXFWf &HOO .ROOHU % + 0DUUDN 3 DQG .DSSOHU : f f1RUPDO GHYHORSPHQW RI PLFH GHILFLHQW LQ %0 0+& FODVV SURWHLQV DQG &'7 FHOOVf 6FLHQFH f .R]DN 0 f f3RLQW PXWDWLRQV FORVH WR WKH $8* LQLWLDWRU FRGRQ DIIHFW WKH HIILFLHQF\ RI WUDQVODWLRQ RI UDW SUHSURLQVXOLQ LQ YLYRf 1DWXUH f .R]DN 0 f f3RLQW PXWDWLRQV GHILQH D VHTXHQFH IODQNLQJ WKH $8* LQLWLDWRU FRGRQ WKDW PRGXODWHV WUDQVODWLRQ E\ HXNDU\RWLF ULERVRPHVf &HOO f .R]DN 0 f f$W OHDVW VL[ QXFOHRWLGHV SUHFHGLQJ WKH $8* LQLWLDWRU FRGRQ HQKDQFH WUDQVODWLRQ LQ PDPPDOLDQ FHOOVf 0RO %LRO f .R]DN 0 f f(IIHFWV RI ORQJ n OHDGHU VHTXHQFHV RQ LQLWLDWLRQ E\ HXNDU\RWLF ULERVRPHV LQ YLWURf *HQH ([SU f .UDQJHO 0 6 f f7ZR IRUPV RI +/$ FODVV PROHFXOHV LQ KXPDQ SODVPDf +XP ,PPXQRO f /DIRUHW 0 )URHOLFK 1 3DULVVLDGLV $ %DXVLQJHU + 3IHLIIHU % 7RQJLR 00 f f$Q LQWURQLF PXWDWLRQ UHVSRQVLEOH IRU D ORZ OHYHO RI H[SUHVVLRQ RI DQ +/$$r DOOHOHf 7LVVXH $QWLJHQV f /DLWLQHQ 2 /HLULVDOR 0 DQG 6N\OY f f5HODWLRQ EHWZHHQ +/$% DQG FOLQLFDO IHDWXUHV LQ SDWLHQWV ZLWK \HUVLQLD DUWKULWLVf $UWKULWLV 5KHXP f

PAGE 89

/DQLHU / / f f1. FHOO UHFHSWRUVf $QQD 5HY ,PPXQRO /DZVRQ 7 5D\ % 'RGGV 7 *ULIR $ $EUDPVRQ 5 0HUULFN : & %HWVFK ) :HLWK + / DQG 7KDFK 5 ( f f,QIOXHQFH RI n SUR[LPDO VHFRQGDU\ VWUXFWXUH RQ WKH WUDQVODWLRQDO HIILFLHQF\ RI HXNDU\RWLF P51$V DQG RQ WKHLU LQWHUDFWLRQ ZLWK LQLWLDWLRQ IDFWRUVf %LRO &KHP f /H %RXWHLOOHU 3 f f+/$ FODVV FKURPRVRPDO UHJLRQ JHQHV DQG SURGXFWV IDFWV DQG TXHVWLRQVf &ULW 5HY ,PPXQRO f /HHXZHQEHUJ ) YDQ'DPPH -HXQKRPPH 0 DQG :$ % f f,QWHUIHURQ EHWD DQ LQWHUPHGLDWH LQ WKH WXPRU QHFURVLV IDFWRU DOSKDLQGXFHG LQFUHDVHG 0+& FODVV H[SUHVVLRQ DQG DQ DXWRFULQH UHJXODWRU RI WKH FRQVWLWXWLYH 0+& FODVV H[SUHVVLRQf ([S 0HG f /H+RDQJ 3 2]GHPLU 1 %HQKDPRX $ 7DEDU\ 7 (GHOVRQ & %HWXHO + 6HPLJOLD 5 DQG &RKHQ + f f+/$$ VXEW\SH DVVRFLDWHG ZLWK ELUGVKRW UHWLQRFKRURLGRSDWK\f $P 2SKWKDOPRO f /L + *UHQHW 9DOHQWLQH 0 /DKWL 0 DQG .LGG 9 f f6WUXFWXUH DQG H[SUHVVLRQ RI FKLFNHQ SURWHLQ NLQDVH 3,76/5(HQFRGLQJ JHQHVf *HQH f /LP / 3 DQG 6KDUS 3 $ f f$OWHUQDWLYH VSOLFLQJ RI WKH ILEURQHFWLQ (,,,% H[RQ GHSHQGV RQ VSHFLILF 7*&$7* UHSHDWV >,Q 3URFHVV &LWDWLRQ@f 0RO &HOO %LRO f /LQFROQ $ 0RQF]DN < :LOOLDPV 6 & DQG -RKQVRQ 3 ) f f,QKLELWLRQ RI &&$$7HQKDQFHUELQGLQJ SURWHLQ DOSKD DQG EHWD WUDQVODWLRQ E\ XSVWUHDP RSHQ UHDGLQJ IUDPHVf %LRO &KHP f /LWZLQ 9 *XPSHU] 3DUKDP 3 3KLOOLSV + DQG /DQLHU / / f f6SHFLILFLW\ RI +/$ FODVV DQWLJHQ UHFRJQLWLRQ E\ KXPDQ 1. FORQHV HYLGHQFH IRU FORQDO KHWHURJHQHLW\ SURWHFWLRQ E\ VHOI DQG QRQVHOI DOOHOHV DQG LQIOXHQFH RI WKH WDUJHW FHOO W\SHf ([S 0HG f /LX DQG .DR f f0HDVXUHPHQW RI UHODWLYH TXDQWLWLHV RI GLIIHUHQW +/$$ DQG % P51$V LQ FHOOV E\ UHYHUVH WUDQVFULSWLRQSRO\PHUDVH FKDLQ UHDFWLRQ DQG GHQDWXULQJ JUDGLHQW JHO HOHFWURSKRUHVLVf ,PPXQRO 0HWKRGV f /MXQJJUHQ + 6WXUPKRIHO :ROSHUW ( +DPPHUOLQJ DQG .DUUH f f7UDQVIHFWLRQ RI EHWD PLFUR JOREXOLQ UHVWRUHV ,)1PHGLDWHG SURWHFWLRQ IURP QDWXUDO NLOOHU FHOO O\VLV LQ <$& O\PSKRPD YDULDQWVf ,PPXQRO f /RSH]&DVLOODV ) DQG .LP + f f7KH n XQWUDQVODWHG UHJLRQV RI DFHW\O FRHQ]\PH $ FDUER[\ODVH P51$ SURYLGH VSHFLILF WUDQVODWLRQDO FRQWURO LQ YLWURf (XU %LRFKHP f /RSH]/DUUHD & *RQ]DOH]5RFHV 6 3HQD 0 'RPLQJXH] 2 &RWR ( $OYDUH] 9 0RUHQR 0 +HUQDQGH] 2 %XUJRV9DUJDV 5 DQG *RURGH]N\ & f f&KDUDFWHUL]DWLRQ RI % KDSORW\SHV E\ ROLJRW\SLQJ DQG JHQRPLF VHTXHQFLQJ LQ WKH 0H[LFDQ 0HVWL]R SRSXODWLRQ ZLWK DQN\ORVLQJ VSRQG\OLWLV MXYHQLOH DQG DGXOW RQVHWf +XP ,PPXQRO f

PAGE 90

0DJRU ( 7D\ORU ( 6KHQ 6 < 0DUWLQH]1DYHV ( 9DOODQWH 1 0 :HOOV 5 6 *XPSHU] ( $GDPV ( /LWWOH $ 0 :LOOLDPV ) 0LGGOHWRQ *DR ; 0F&OXVNH\ 3DUKDP 3 DQG /LHQHUW:HLGHQEDFK f f1DWXUDO LQDFWLYDWLRQ RI D FRPPRQ +/$ DOOHOH $rf KDV RFFXUUHG RQ DW OHDVW WKUHH VHSDUDWH RFFDVLRQVf ,PPXQRO f 0DQWRYDQL 9 0DUWLQHOOL %UDJOLDQL 0 %X]]L 0 6HOYD 3 &ROOLQD ( )DUDEHJROL 3 5RVWL $ %DQGLQL 7XUD 6 DQG HW DO f f0ROHFXODU DQDO\VLV RI +/$ JHQHV IRU WKH VHOHFWLRQ RI XQUHODWHG ERQH PDUURZ GRQRUf %RQH 0DUURZ 7UDQVSODQW f 0DVRQ 3 0 DQG 3DUKDP 3 f f+/$ FODVV UHJLRQ VHTXHQFHV f 7LVVXH $QWLJHQV 3W f 0DVXFFL 0 6WDP 1 7RUVWHLQVGRWWLU 6 HHIMHV .OHLQ DQG 3ORHJK + / f f$OOHOHVSHFLILF GRZQUHJXODWLRQ RI 0+& FODVV DQWLJHQV LQ %XUNLWW O\PSKRPD OLQHVf &HOO ,PPXQRO f 0DVXFFL 0 7RUVWHLQGRWWLU 6 &RORPEDQL %UDXWEDU & .OHLQ ( DQG .OHLQ f f'RZQUHJXODWLRQ RI FODVV +/$ DQWLJHQV DQG RI WKH (SVWHLQ%DUU YLUXVHQFRGHG ODWHQW PHPEUDQH SURWHLQ LQ %XUNLWW O\PSKRPD OLQHVf 3URF 1DWO $FDG 6FL 86$ f 0F&XWFKHRQ $ *XPSHU] 6PLWK /XW] & 7 DQG 3DUKDP 3 f f/RZ +/$& H[SUHVVLRQ DW FHOO VXUIDFHV FRUUHODWHV ZLWK LQFUHDVHG WXUQRYHU RI KHDY\ FKDLQ P51$f ([S 0HG 0L]XNL 1 ,QRNR + $QGR + 1DNDPXUD 6 .DVKLZDVH $ND]D 7 )XMLQR < 0DVXGD 7DNLJXFKL 0 DQG 2KQR 6 f f%HKFHWnV GLVHDVH DVVRFLDWHG ZLWK RQH RI WKH +/$% VXEDQWLJHQV +/$%r f $P 2SKWKDOPRO f 0L]XNL 1 2KQR 6 7DQDND + 6XJLPXUD 6HNL 7 .HUD ,QDED 7VXML DQG ,QRNR + f f$VVRFLDWLRQ RI +/$% DQG ODFN RI DVVRFLDWLRQ RI FODVV ,, DOOHOHV ZLWK %HKFHWnV GLVHDVHf 7LVVXH $QWLJHQV f 0RPEXUJ ) DQG +DPPHUOLQJ f f*HQHUDWLRQ DQG 7$3PHGLDWHG WUDQVSRUW RI SHSWLGHV IRU PDMRU KLVWRFRPSDWLELOLW\ FRPSOH[ FODVV PROHFXOHVf $GY ,PPXQRO 0RQDFR f f$ PROHFXOH PRGHO RI 0+& FODVV UHVWULFWHG DQWLJHQ SURFHVVLQJf ,PPXQRO 7RGD\ 0RRUH 0 DQG 6KDUS 3 $ f f(YLGHQFH IRU WZR DFWLYH VLWHV LQ WKH VSOLFHRVRPH SURYLGHG E\ VWHUHRFKHPLVWU\ RI SUHP51$ VSOLFLQJ >VHH FRPPHQWV@f 1DWXUH f 0XHOOHU(FNKDUGW & 0XHOOHU(FNKDUGW :LOOHQ2KII + +RU] $ .XHQ]OHQ ( 2n1HLOO DQG 6FKHQGHO f f,PPXQRJHQLFLW\ RI DQG LPPXQH UHVSRQVH WR WKH KXPDQ SODWHOHW DQWLJHQ =ZD LV VWURQJO\ DVVRFLDWHG ZLWK +/$% DQG '5f 7LVVXH $QWLJHQV f 0XOOHU ( : 6HLVHU & DQG *DUFLD6DQ] $ f f5XQRQ DVVD\Vf ,PPXQRORJ\ 0HWKRGV 0DQXDO /HINRYLWV HG $FDGHPLF 3UHVV 6DQ 'LHJR

PAGE 91

0\HUV 5 0 )LVKHU 6 /HUPDQ / 6 DQG 0DQLDWLV 7 f f1HDUO\ DOO VLQJOH EDVH VXEVWLWXWLRQV LQ '1$ IUDJPHQWV MRLQHG WR D *&FODPS FDQ EH GHWHFWHG E\ GHQDWXULQJ JUDGLHQW JHO HOHFWURSKRUHVLVf 1XFOHLF $FLGV 5HV f 1HOVRQ . DQG *UHHQ 0 5 f f0HFKDQLVP IRU FU\SWLF VSOLFH VLWH DFWLYDWLRQ GXULQJ SUHP51$ VSOLFLQJf 3URF 1DWO $FDG 6FL 86$ f 1RUEXU\ & DQG )ULHG 0 f f3RO\RPDYLUXV HDUO\ UHJLRQ DOWHUQDWLYH SRO\$f VLWH nHQG KHWHURJHQHLW\ DQG DOWHUHG VSOLFLQJ SDWWHUQf 9LURO f 2K 6 )OHLVFKKDXHU DQG ,Q 3URFHVV &LWDWLRQ@f $QQD 5HY ,PPXQRO 3DUKDP 3 $GDPV ( DQG $UQHWW / f f7KH RULJLQV RI +/$$%& SRO\PRUSKLVPf ,PPXQRO 5HY 3DUKDP 3 /RPHQ & ( /DZORU $ :D\V 3 +ROPHV 1 &RSSLQ + / 6DOWHU 5 :DQ $ 0 DQG (QQLV 3 f f1DWXUH RI SRO\PRUSKLVP LQ +/$$ % DQG & PROHFXOHVf 3URF 1DWO $FDG 6FL 86$ f 3HOKDP + 5 DQG -DFNVRQ 5 f f$Q HIILFLHQW P51$GHSHQGHQW WUDQVODWLRQ V\VWHP IURP UHWLFXORF\WH O\VDWHVf (XU %LRFKHP f 3HOWHQEXUJ / 7 'HH 5 DQG 6FKULHU 3 f f'RZQUHJXODWLRQ RI +/$ FODVV H[SUHVVLRQ E\ FP\F LQ KXPDQ PHODQRPD LV LQGHSHQGHQW RI HQKDQFHU $f 1XFOHLF $FLGV 5HV f 3HWHUVRQ 0 / %U\PDQ 0 % 3HLWHU 0 DQG &RZDQ & f f([RQ VL]H DIIHFWV FRPSHWLWLRQ EHWZHHQ VSOLFLQJ DQG FOHDYDJH SRO\DGHQ\ODWLRQ LQ WKH LPPXQRJOREXOLQ PX JHQHf 0RO &HOO %LRO f 3LQWR 1D 6KHUPDQ ) DQG +DPSVH\ 0 f fFLV DQG WUDQVDFWLQJ VXSSUHVVRUV RI D WUDQVODWLRQ LQLWLDWLRQ GHIHFW DW WKH F\FO ORFXV RI 6DFFKDURP\FHV FHUHYLVLDHf *HQHWLFV f

PAGE 92

3ORHJK + / 2UU + 7 DQG 6WURPLQJHU / f f0DMRU KLVWRFPSDWLELOLW\ DQWLJHQV WKH KXPDQ +/$$%&f DQG PXULQH +. +'f FODVV PROHFXOHVf &HOO f 3RZLV 6 7RZQVHQG $ 5 'HYHUVRQ ( 9 %DVWLQ %XWFKHU : DQG +RZDUG & f f5HVWRUDWLRQ RI DQWLJHQ SUHVHQWDWLRQ WR WKH PXWDQW FHOO OLQH 50$6 E\ DQ 0+&OLQNHG WUDQVSRUWHUf 1DWXUH f 3UDVDG 9 DQG
PAGE 93

6KLHOGV DQG %OREHO f f(IILFLHQW FOHDYDJH DQG VHJUHJDWLRQ RI QDVFHQW SUHVHFUHWRU\ SURWHLQV LQ D UHWLFXORF\WH O\VDWH VXSSOHPHQWHG ZLWK PLFURVRPDO PHPEUDQHVf %LRO &KHP f 6KLPL]X < DQG 'H0DUV 5 f f3URGXFWLRQ RI KXPDQ FHOOV H[SUHVVLQJ LQGLYLGXDO WUDQVIHUUHG +/$$%& JHQHV XVLQJ DQ +/$$%& QXOO KXPDQ FHOO OLQHf ,PPXQRO f 6ROQLFN f f$OWHUQDWLYH VSOLFLQJ FDXVHG E\ 51$ VHFRQGDU\ VWUXFWXUHf &HOO 3W f 6ROQLFN DQG /HH 6 f f$PRXQW RI 51$ VHFRQGDU\ VWUXFWXUH UHTXLUHG WR LQGXFH DQ DOWHUQDWLYH VSOLFHf 0RO &HOO %LRO f 6SHLVHU ( 7LHUF\ 0 5XIHU 1 *UXQGVFKREHU & *UDWZRKO $ &KDSXLV % +HOJ & /ROLJHU & & 6LUHQ 0 5RRVQHN ( DQG -HDQQHW 0 f f+LJK UHVROXWLRQ +/$ PDWFKLQJ DVVRFLDWHG ZLWK GHFUHDVHG PRUWDOLW\ DIWHU XQUHODWHG ERQH PDUURZ WUDQVSODQWDWLRQf %ORRG f 6SLFHU $ 3 6HOGLQ 0 ) DQG *HQGOHU 6 f f 0ROHFXODU FORQLQJ DQG FKURPRVRPDO ORFDOL]DWLRQ RI WKH PRXVH GHFD\DFFHOHUDWLQJ IDFWRU JHQHV 'XSOLFDWHG JHQHV HQFRGH JO\FRV\OSKRVSKDWLG\OLQRVLWRODQFKRUHG DQG WUDQVPHPEUDQH IRUPVf ,PPXQRO f 6ULYDVWDYD 5 'XFHPDQ % : %LUR 3 $ 6RRG $ DQG :HLVVPDQ 6 0 f f0ROHFXODU RUJDQL]DWLRQ RI WKH FODVV JHQHV RI KXPDQ PDMRU KLVWRFRPSDWLELOLW\ FRPSOH[f ,PPXQRO 5HY 6WHUQHU $ DQG %HUJHW 6 0 f f,Q YLYR UHFRJQLWLRQ RI D YHUWHEUDWH PLQLH[RQ DV DQ H[RQLQWURQH[RQ XQLWf 0RO &HOO %LRO f 6WUDFKDQ 7 6RGR\HU 5 'DPRWWH 0 DQG -RUGDQ % 5 f f&RPSOHWH QXFOHRWLGH VHTXHQFH RI D IXQFWLRQDO FODVV +/$ JHQH +/$$ LPSOLFDWLRQV IRU WKH HYROXWLRQ RI +/$ JHQHVf (0 %2 7DQDND 7DQDKDVKL 1 7VXUXPL & VHH FRPPHQWV@f 1DWXUH f 7HUDVDNL 3 %UQRFR 3DUN 0 6 2]WXUN DQG ,ZDNL < f f0LFURGURSOHW WHVWLQJ IRU +/$$ % & DQG DQWLJHQVf $PHULFDQ -RXUQDO RI &OLQLFDO 3DWKRORJ\ 7KDFK 5 / f f&DS UHFDS WKH LQYROYHPHQW RI H,)/ LQ UHJXODWLQJ JHQH H[SUHVVLRQf &HOO f 7KDUXQ 6 DQG 3DUNHU 5 f f0HFKDQLVPV RI P51$ 7XUQRYHU LQ (XNDU\RWLF &HOOVf P51$ 0HWDEROLVP t 3RVW7UDQVFULSWLRQDO *HQH 5HJXODWLRQ % +DUIRUG DQG 5 0RUULV HGV :LOH\/LVV ,QF 1HZ
PAGE 94

7LHUF\ 0 'MDYDG 1 5XIHU 1 6SHLVHU ( -HDQQHW 0 DQG 5RRVQHN ( f f2OLJRW\SLQJ RI +/$$ $ DQG % VXEW\SHV 'HWHFWLRQ RI VXEW\SH LQFRPSDWLELOLWLHV EHWZHHQ SDWLHQWV DQG WKHLU VHURORJLFDOO\ PDWFKHG XQUHODWHG ERQH PDUURZ GRQRUVf +XP ,PPXQRO f 7RLYDQHQ 3 7RLYDQHQ $ DQG %ULQHV 5 f f:KHQ LV DQ DXWRLPPXQH GLVHDVH QRW DQ DXWRLPPXQH GLVHDVH"f ,PPXQRO 7RGD\ f 9HUVWHHJ 5 .UXVH:ROWHUV 0 3ORPS $ & YDQ/HHXZHQ $ 6WDP 1 3ORHJK + / 5XLWHU DQG 6FKULHU 3 Df f6XSSUHVVLRQ RI FODVV KXPDQ KLVWRFRPSDWLELOLW\ OHXNRF\WH DQWLJHQ E\ FP\F LV ORFXV VSHFLILFf ([S 0HG f 9HUVWHHJ 5 1RRUGHUPHHU $ .UXVH:ROWHUV 0 5XLWHU DQG 6FKULHU 3 f fFP\F GRZQUHJXODWHV FODVV +/$ H[SUHVVLRQ LQ KXPDQ PHODQRPDVf (PER f 9HUVWHHJ 5 3HOWHQEXUJ / 7 3ORPS $ & DQG 6FKULHU 3 Ef f+LJK H[SUHVVLRQ RI WKH FP\F RQFRJHQH UHQGHUV PHODQRPD FHOOV SURQH WR O\VLV E\ QDWXUDO NLOOHU FHOOVf ,PPXQRO f :DOHY .XQNHO 6FKZDHEOH : :HLVH DQG )DONH f f5HODWLRQVKLS EHWZHHQ +/$ FODVV VXUIDFH H[SUHVVLRQ DQG GLIIHUHQW F\WRSDWKLF HIIHFWV SURGXFHG DWHU KHUSHV VLPSOH[YLUXV LQIHWLRQ LQ YLWURf $UFK 9LURO :DULQJ ) 5DGIRUG ( %XUQV / DQG *LQGHU f f7KH KXPDQ OHXNRF\WH DQWLJHQ $ LQWHUIHURQVWLPXODWHG UHVSRQVH HOHPHQW FRQFHQVXV VHTXHQFH ELQGV D QXFOHDU IDFWRU UHTXLUHG ISU FRQVWLWXWLYH H[SUHVVLRQf %LRO &KHP f :DWDNDEH $ ,QRXH 6DNDPRWR + DQG 6KLPXUD < f f$ VHFRQGDU\ VWUXFWXUH DW WKH n VSOLFH VLWH DIIHFWV WKH LQ YLWUR VSOLFLQJ UHDFWLRQ RI PRXVH LPPXQRJOREXOLQ PX FKDLQ SUHP51$Vf 1XFOHLF $FLGV 5HV f :DWNLQV f f7KH HYROXWLRQ RI PDMRU KLVWRFRPSDWLELOLW\ FODVV JHQHV LQ SULPDWHVf &ULW 5HY ,PPXQRO f :D\V 3 &RSSLQ + / DQG 3DUKDP 3 f f7KH FRPSOHWH SURPDU\ VWUXFWXUH RI +/$%Zf %LRO &KHP :LHVQHU 5 DQG =DN 5 f f4XDQWLWDWLYH DSSURDFKHV IRU VWXG\LQJ JHQH H[SUHVVLRQf $P 3K\VLRO 3W f /
PAGE 95


PAGE 96

%,2*5$3+,&$/ 6.(7&+ .XL /LX ZDV ERUQ DQG UDLVHG LQ /LDRQLQJ &KLQD LQ WKH WKLUG FKLOG RI ;LX]KHQ
PAGE 97

, FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ .XR-DQJ .DR &KDLU 3URIHVVRU RI 3DWKRORJ\ ,PPXQRORJ\ DQG /DERUDWRU\ 0HGLFLQH FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ :D\LH 7 0F&RUPDFN $VVRFLDWH 3URIHVVRU RI 3DWKRORJ\ ,PPXQRORJ\ DQG /DERUDWRU\ 0HGLFLQH FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ 3URIHVVRU RI 3DWKRORJ\ ,PPXQRORJ\ DQG /DERUDWRU\ 0HGLFLQH FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ 0DXULFH 6 6ZDQVRQ $VVRFLDWH 3URIHVVRU RI 0ROHFXODU *HQHWLFV DQG 0LFURELRORJ\ FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ (GZDUG :DNHODQG 3URIHVVRU RI 3DWKRORJ\ ,PPXQRORJ\ DQG /DERUDWRU\ 0HGLFLQH

PAGE 98

7KLV GLVVHUWDWLRQ ZDV VXEPLWWHG WR WKH *UDGXDWH )DFXOW\ RI WKH &ROOHJH RI 0HGLFLQH DQG WR WKH *UDGXDWH 6FKRRO DQG ZDV DFFHSWHG DV SDUWLDO IXOILOOPHQW RI WKH UHTXLUHPHQWV IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\


xml version 1.0 encoding UTF-8
REPORT xmlns http:www.fcla.edudlsmddaitss xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.fcla.edudlsmddaitssdaitssReport.xsd
INGEST IEID EYTYML7XV_TZCXJ7 INGEST_TIME 2014-08-28T19:37:30Z PACKAGE AA00024986_00001
AGREEMENT_INFO ACCOUNT UF PROJECT UFDC
FILES