Citation
Molecular genetics of the Angelman syndrome

Material Information

Title:
Molecular genetics of the Angelman syndrome
Creator:
Lossie, Amy C., 1967-
Publication Date:
Language:
English
Physical Description:
viii, 104 leaves : ill. ; 29 cm.

Subjects

Subjects / Keywords:
Alleles ( jstor )
Angelman syndrome ( jstor )
Chromosomes ( jstor )
DNA ( jstor )
Exons ( jstor )
Genes ( jstor )
Genetic mutation ( jstor )
Hum ( jstor )
Methylation ( jstor )
Phenotypes ( jstor )
Angelman Syndrome -- classification ( mesh )
Angelman Syndrome -- etiology ( mesh )
Angelman Syndrome -- genetics ( mesh )
DNA Methylation ( mesh )
Department of Molecular Genetics and Microbiology thesis Ph.D ( mesh )
Dissertations, Academic -- College of Medicine -- Department of Molecular Genetics and Microbiology -- UF ( mesh )
Genomic Imprinting ( mesh )
Phenotype -- classification ( mesh )
Research ( mesh )
Genre:
bibliography ( marcgt )
non-fiction ( marcgt )

Notes

Thesis:
Thesis (Ph.D.)--University of Florida, 2000.
Bibliography:
Bibliography: leaves 87-102.
General Note:
Typescript.
General Note:
Vita.
Statement of Responsibility:
by Amy C. Lossie.

Record Information

Source Institution:
University of Florida
Holding Location:
University of Florida
Rights Management:
The University of Florida George A. Smathers Libraries respect the intellectual property rights of others and do not claim any copyright interest in this item. This item may be protected by copyright but is made available here under a claim of fair use (17 U.S.C. §107) for non-profit research and educational purposes. Users of this work have responsibility for determining copyright status prior to reusing, publishing or reproducing this item for purposes other than what is allowed by fair use or other copyright exemptions. Any reuse of this item in excess of fair use or other copyright exemptions requires permission of the copyright holder. The Smathers Libraries would like to learn more about this item and invite individuals or organizations to contact the RDS coordinator (ufdissertations@uflib.ufl.edu) with any additional information they can provide.
Resource Identifier:
025672693 ( ALEPH )
70280053 ( OCLC )

Downloads

This item has the following downloads:


Full Text












MOLECULAR GENETICS OF THE ANGELMAN SYNDROME













By

AMY C. LOSSIE




















A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2000





















This dissertation is dedicated to
C. Andrew Gtomski
for his unending belief, encouragement and support















ACKNOWLEDGEMENTS


I would first like to thank my parents and grandparents for their never-ending encouragement and support, for never accepting mediocrity and for providing me with excellent examples of hard work and dedication. It truly took a village to raise me. I credit Andy's family for believing in me and understanding when I took away their son and brother. I am grateful to both of our families for quietly supporting us. Your generosity touched my heart many times.

With the utmost esteem and gratitude, I thank my mentor, Daniel J. DriscoLt, who always said "yes" when I asked, at 6:30 PM, if he "had a minute." I owe many of my scientific associations to Dan, who entrusted me to interact and forge valuable collaborations with prominent scientists around the world. In addition, Dan provided me with abundant resources, plenty of bench space and several undergraduate students to help with my work.

I especially want to acknowledge the AngeLman patients and their families who have given so much of themselves for research. I thank my advocate, Peggy Wallace, who has helped me to become a human geneticist. In addition, I appreciated Cami Brannan's advice on my research and my transition back to mouse genetics. I am also grateful to Tom Yang who has given me a "good challenge" now and then. I wish to thank Michelle Whitney for always listening, and Fatih Boyar for giving me a different perspective. I am grateful for Sue and Rodney who made my first year memorable. In addition, I am grateful for the help and advice from the other graduate students, postdocs and undergraduate students who have passed through the tab.
















TABLE OF CONTENTS




ACKNOWLEDGEMENTS .............................................................. III

ABSTRACT OF DISSERTATION PRESENTED TO THE GRADUATE SCHOOL................ VII

INTRODUCTION .....................................................................1

Genomic Imprinting Is an Epigenetic Phenomenon ................................ 1

Genomic Imprinting and Beckwith -Wiedemann Syndrome ..........................3
Clinical Features of Beckwith -Wiedemann Syndrome........................... 3
Imprinted Genes in BWS....................................................... 3
Imprinting Mechanisms of Igf2 and H-19 .........................................4

The Angelman and Prader-Willi Syndromes ....................................... 4
Clinical Features of AS and PWS................................................ 5
Molecular Mechanisms of AS and PWS.........................................6
Genes Involved in AS and PWS ................................................. 6
Mouse Models of PWS ......................................................... 7
Mouse Models of AS ........................................................... 9
DNA MethyLation: An Epigenetic Mark ........................................ 10
Structure and Function of the AS/PWS Imprinting Center...................... 10

UBE3A and the Ubiquitination Pathway........................................... 12

~-TRANSMISSION OF ANGELMAN SYNDROME BY AN AFFECTED MOTHER.................. 21

Introduction.................................................................... 21

Methods........................................................................ 22
Subjects..................................................................... 22
Microsatellite Analysis .......................................................23
DNA Methylation Analyses .................................................... 23
RT-PCR ...................................................................... 24

Results .........................................................................24
Genetic Analysis ............................................................. 24
DNA Methylation Analyses .................................................... 25
Gene Expression ............................................................. 26

iv









Discussion ....................................................................................... 26

MOLECULAR ANALYSES AND GENOTYPE- PH EN OTYPE-CORRELATION S AMONG THE FIVE CLASSES OF ANGELMAN SYNDROME ............................................................. 34

Introduction .................................................................................... 34

Materials and Methods ........................................................................ 36
Patient Repository ......................................................................... 36
Southern Analysis ........................................................................... 37
BESS T -Scan ................................................................................. 38
Sequence Analysis .......................................................................... 38
Prim ers ...................................................................................... 38
Statistical Analyses ......................................................................... 39

Results .......................................................................................... 40
-Molecular Classes of AngeLman Syndrome ............................................... 40
M utation Analysis ........................................................................... 41
DNA Methylation of 5' UBE3A ............................................................. 41
Summary of all Published UBE3A Mutations ............................................. 42
Genotype- Phenotype Correlations ....................................................... 42

Discussion ....................................................................................... 45
M utations in UBE3A ........................................................................ 45
Genotype- Phenotype Correlations ....................................................... 50

DNA METHYLATION AND EXPRESSION ANALYSES OF UBE3A IN THE HUMAN BRAIN ......... 59

Introduction .................................................................................... 59

M aterials and M ethods ........................................................................ 61
Human Subjects and Tissue Samples ..................................................... 61
RNA Isolation ................................................................................ 61
RT -PC R ....................................................................................... 62
DNA M ethylation ............... ............................................................ 63

Results .......................................................................................... 64
U80A Does Not Demonstrate a DNA Methylation Imprint ............................ 64
Expression Analysis of U80A and the Antisense Transcript in the Brain ............ 64

Discussion ....................................................................................... 65

CONCLUSIONS AND DISCUSSION .................................................................. 71

M olecular Classes of AS ....................................................................... 72
C lass I Patients ............................................................................. 73
C lass 11 Patients ............................................................................. 73
C lass III Patients ............................................................................ 74
Class IV Patients ............................................................................ 75
Class V Patients ............................................................................. 75
v









Genotype- phenotype Correlations among the Five Classes of AS ........................ 76

What is the Epigenetic "Mark? ................................................................ 78
DNA M ethylation ............................................................................ 79
Cis-acting Elem ents ........................................................................ 80
Chrom atin Structure ....................................................................... 80
DNA Replication Tim ing ................................................................... 81

Models for Imprinted Expression ............................................................. 82

Future Directions .............................................................................. 85

REFEREN C ES ........................................................................................ 87

BIOGRAPHICAL SKETCH ......................................................................... 103





































Vi

















Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy MOLECULAR GENETICS OF THE ANGELMAN SYNDROME By

Amy C. Lossie

December, 2000


Chair: Daniel J. Driscoll, Ph.D., M.D.
Major Department: Molecular Genetics and Microbiology



Genomic imprinting is a parent-of -origin epigenetic phenomenon that is intimately involved in development, cancer and several genetic disorders, including Angelman syndrome (AS). AS is a severe neurobehavioral disorder characterized by four cardinal features: 1) severe developmental delay; 2) profound speech impairment; 3) a characteristic movement disorder; and 4) an AS-specific behavior, which includes an inappropriately happy affect. My studies revealed that AS is caused by 5 molecular mechanisms: Class 1) 4 Mb deletions; Class 11) paternal UPD; Class I11) imprinting defects; Class IV) intragenic mutations in UBE3A, the E3 ubiquitin protein ligase 3A gene; and Class V) no known defects. Our statistical models demonstrated that several significant phenotypic differences occur among the five molecular classes. Patients can be separated into four phenotypic groups: Class I, Classes 11 and 111, Class IV, and Class V. Class I patients are the most severely affected, while Classes 11 and III vii









are the least. Class I patients comprise a contiguous gene disorder, with haploinsufficiency of multiple genes exacerbating the Lack of the maternal UBE3A gene. Multiple clinical distinctions can be made between the classes, with differences most striking in pigmentation; growth parameters; achievement of developmental milestones; and severity, frequency and age at onset of seizures.

Initial experiments showed that imprinted expression of UBE3A was limited to the brain in humans, and revealed the presence of a brain-specific antisense transcript that overlapped the 3' end of UBE3A. In our studies, RT-PCR analyses of UBE3A and its antisense transcript demonstrated discordant imprinted expression of the two genes in several regions of the human brain. UBE3A was preferentially expressed from the maternal allele, white the antisense transcript was preferentially expressed from the paternal a[lele. In addition, DNA methylation analysis revealed that 5' UBE3A does not demonstrate a DNA methylation imprint. ALl tissues, even those that demonstrated imprinted expression of UBE3A, are unmethylated in the promoter region of the gene. The lack of a DNA methyLation imprint at UBE3A and the observation of discordant imprinted expression of the two genes support a role for the antisense transcript in the regulation of imprinted expression of UBE3A.



















viii
















INTRODUCTION


Genomic Imprinting Is an Epigenetic Phenomenon


Epigenetic phenomena are implicated in several diseases, cancer, X chromosome inactivation and genomic imprinting. In addition, epigenetic events such as DNA methyLation and histone acetylation play major roles in the regulation of gene expression. Epigenetic effects occur when the primary genetic material is heritabLy altered in somatic and/or germ cells, causing changes in expression, without the creation of a mutational event in the DNA.

One of the most familiar epigenetic processes is genomic imprinting, which occurs when one aLLeLe of an imprinted gene is transcriptionally activated or silenced in a parent-of-origin dependent manner. The parental origin of the alLeLe determines whether an imprinted gene will be expressed; some imprinted genes are only expressed from the paternal aLLele, while others are expressed exclusively from the maternal copy.

Two of the most extreme examples of genomic imprinting are the complete hydatidiform mole and ovarian teratoma (Kajii et at., 1984; Ohama et aL., 1981; Ohama et aL., 1985). Hydatidaform moles occur when an anucLear egg is fertilized by either one or two haploid sperm, with duplication of the entire haploid genome occurring when a single sperm fertilizes the egg. Hydatidaform moles, which are completely androgenetic (Ag), give rise to hyperplastic extraembryonic growth with little or no fetal development. In situ activation and duplication of the maternal DNA

1







2

of an unfertilized oocyte produces an ovarian teratoma, which is completely parthenogenetic (Pg), having two complete copies of the maternal genome. Although ovarian teratomas have very Little extraembryonic development, they can develop into a disorganized but welt-differentiated tumor that often reveals remnants of mesenchymat and endodermal structures.

Elegant experiments in the 1980s revealed the consequences of uniparental mammalian development in the mouse. PronucLear transfer experiments showed that androgenetic and parthenogenetic embryos failed to develop to term (Barton et al., 1984; McGrath and Solter, 1984). These mice closely resembled their human counterparts, complete hydatidaform moles and ovarian teratomas, and demonstrated that the paternal germ line was required for differentiation of extraembryonic tissues, while the maternal genome was necessary for embryonic development.

Subsequent examination of mice with uniparentat disomy (UPD) for various chromosomal regions revealed the presence of 10 imprinted domains on seven mouse chromosomes: 2, 6, 7, 11, 12, 17 and the X (John and Surani, 1996). In humans, UPD of chromosomes 2, 7, 11, 14, 15, 16, and 20 has also been shown to cause aberrant phenotypes (Ledbetter and Engel, 1995). To date, over 35 imprinted genes and 21 imprinted syndromes have been identified in human and mouse (Falls et at., 1999; Nicholls, 2000). These genes are involved in fetal and placental growth, cell proliferation and neurobehavior. Two large clusters of imprinted genes reside on human chromosomes 11p15.5 and 15q11-13. Genes in the Beckwith-Wiedemann syndrome region on 11p15.5 have been shown to be involved in fetal growth and cell proliferation, while the Angetman/Prader-WitLi syndrome (AS/PWS) region on 15ql 1-13 contains imprinted genes that influence neurobehavior. A review of these two systems follows.









Genomic Imprinting and Beckwith-Wiedemann Syndrome


Clinical Features of Beckwith-Wiedemann Syndrome

Beckwith-Wiedemann syndrome (BWS) is a mutti-faceted genetic disorder characterized by fetal and neonatal overgrowth, macroglossia and abdominal wall defects. Additional common features include hemihypertrophy, genitourinary abnormalities, organomegaLy and Wilm's tumor (Maher and Reik, 2000). Three major types of BWS patients have been identified: patients with chromosome anomalies, sporadic cases or familial inheritance. The finding of a significant percentage of sporadic patients with partial paternal UPD for chromosome 11p and the presence of duplications, inversions and breakpoints of balanced transLocations have localized the genes for BWS to 11p15.5 (Maher and Reik, 2000). Ten imprinted genes have been mapped to this region, which is flanked by non-imprinted genes, and at Least two genes within the cluster demonstrate biaLlelic expression, subdividing the cluster into two imprinted domains (Figure 1-1).


Imprinted Genes in BWS

The CDKN1C, KvLQT1, IGF2 and H19 genes from 11p15.5 have been the most studied, and it appears that both pf these groups of imprinted genes are involved in the pathogenesis of BWS. Recent experiments suggest that these two regions are under the control of two distinct imprinting centers (Lee et at., 1999b; Reik et at., 1995; Smitinich et at., 1999). The majority of sporadic BWS patients show toss of imprinting (LOI) at IGF2, identified by the activation of both parental alletes (Maher and Reik, 2000). Two mechanisms are associated with LOI at IGF2. In the first, LOI at IGF2 was accompanied by a change in the epigenotype of H19, which silenced the maternal H19 allele (Reik et at., 1995). In the second, the H19 epigenotype was







4

normal, but the DNA methylation imprint on the maternal attele of KvLQT1 became unmethytated, inducing expression of the KvLQT1 antisense transcript, LITI (Brown et at., 1996; Smilinich et at., 1999). Therefore, these observations show that disruption of the epigenotype at either H19 or KvLQTI can cause LOI of IGF2 in patients with BWS.


Imprinting Mechanisms of 1gf2 and H19

An elegant series of experiments by several groups has helped to tease out the important elements of imprinted expression of 1gf2 and H19 in the mouse (reviewed in Brannan and Bartotomei, 1999). Subsequent experiments have revealed the mechanism of imprinted expression of these two genes (Figure 1-2; Bell and Felsenfeld, 2000; Drewell et at., 2000; Hark et at., 2000; Ishihara et at., 2000; Szabo et at., 2000). These tatter experiments revealed that the differentialy methyLated region Located at 5' H19 was a boundary element that when unmethylated, bound a repressor protein, preventing the 1gf2 gene from being activated by upstream enhancers.

The identification of the mechanism for imprinted expression of Igf2/H19 is a first for imprinted genes. It will be interesting to discover how mutations in upstream genes can also disrupt imprinting Of If2. Perhaps there are two Levels of control in this region: local and regional, with long-range interactions occurring between KvLQT1 and IGF2. It will also be interesting to determine what phenotypic effects other imprinted genes in this region have on subsets of BWS patients.


The Angelman and Prader-Willi Syndromes


Research over the last five years has yielded many clues as to the factors necessary for genomic imprinting of the Angetman (AS) and Prader-WitLi (PWS)






5

syndromes. Novel imprinted genes have been identified on 15q11-13, mutations in the E6 ubiquitin protein-ligase gene, UBE3A, were found in several patients with AS, new methods of transmission of AS and PWS were identified, and studies of patients with imprinting defects revealed that the imprinting center consisted of separate AS and PWS components. In addition, multiple mouse models of AS and PWS were created and null mutations of several imprinted genes were generated in the mouse. Clinical Features of AS and PWS

The Angelman and Prader-Willi syndromes delineate the second major cluster of imprinted genes in the human. Although both syndromes are associated with 4 Mb interstitial deletions of chromosome 15q11-13, AS and PWS are very different clinical neurobehavioral disorders. AS is characterized by severe mental retardation, profound speech impairment, a movement and balance disorder and an AS-specific behavior which includes an inappropriately happy affect interspersed with paroxysms of laughter (Williams et at., 1995a; Williams et at., 2000). In stark contrast, PWS is initially characterized by neonatal hypotonia and failure to thrive. However at 18 to 36 months of age, patients become hyperphagic, eventually leading to morbid obesity. They also have mild mental retardation, hypogonadism, small hands and feet and a characteristic behavior which includes lethargy, aggressiveness and obsessivecompulsive disorder (Holm et al., 1993).

(The differential phenotype depends upon the parental transmission of the 15q11-13 defect with normal development requiring biparental genetic contribution of 15q11-13.1 eAS is caused by a lackof maternal contribution, while lack of paternal contribution from 15q11-13 results in PWS.







6

Molecular Mechanisms of AS and PWS

The genetics of the AS and PWS syndromes are very complex; multiple different chromosome 15 defects occur in these two distinct syndromes (Figure 1-3). Loss or inactivation of at least one 15q11-13 gene occurs in both the AS and PWS syndromes, with maternal deficiencies giving rise to AS children and paternal deficits causing PWS (Figure 1-3). Five major molecular classes of AS patients have been identified: I) 4 Mb maternal deletions of 15q11-13; II) paternal uniparental disomies (UPD); III) imprinting defects (ID); IV) patients with mutations in a single gene, UBE3A and V) patients with no known defects. Prader-Willi patients have been identified who belong in the first three classes: paternal deletions of 15q11-13, maternal UPDs and ID. No single gene mutations have been found in PWS patients, suggesting that PWS is part of a contiguous gene syndrome with inactivation of at least two genes necessary for the full phenotype to develop.


Genes Involved in AS and PWS

This past year has been exciting in the AS/PWS field. Nine novel imprinted genes and transcripts were localized to the 15q11-13 imprinted domain (Boccaccio et al., 1999; Farber et at., 2000; Lee et al., 2000; Lee and Wevrick, 2000), with 18 paternally expressed transcripts having been mapped to the AS/PWS imprinted domain to date: cen-MKRN3, MKRN3-AS, W1-15987, NDN, MAGEL2, IC transcript, SNURFSNRPN, PAR5, W1-15028, W1-13791, IPW, PAR1, stSG12920, stSG3346/stsN21972, BCD1279, A005C48 and UBE3A-AS-tel. Although no sequence mutations have been found in any of these genes in PWS patients, expression studies indicate that PWS patients do not express MKRN3, MKRN3-AS, W1-15987, NDN, MAGEL2, IC transcript, SNURF-SNRPN, PAR5, Wi1-15028, W1-13791, PAR1, stSG12920, stSG3346/stsN21972, or A005C48 in lymphobtasts, skin fibrobtasts or human brain (Figure 1-4A, B).







7

Interestingly, IPW demonstrates imprinted expression in lymphoblast and skin fibroblast cell lines, but bialtelic expression in human brain. All of these genes and transcripts could potentially be involved in the etiology of PWS.

Only one gene in the AS/PWS imprinted domain, UBE3A, demonstrates a maternal-only expression imprint (Rougeulle et at., 1997; Vu and Hoffman, 1997). However, unlike most of the paternally expressed 15q11-13 genes, imprinted expression of UBE3A is restricted to brain (Figure 1-4A, B). Mouse studies revealed that tissue-specific imprinted expression of Ube3a was restricted to the Purkinje cells of the cerebellum, the CA2 and CA3 regions of the hippocampus and the mitral cell layer of the olfactory bulb (Albrecht et aL., 1997; Sutcliffe et al., 1996). In the human, much Less is known about the tissue specificity of imprinted expression of UBE3A. Al studies in the adult have relied on RT-PCR analysis from a single frontal cortex sample, and have shown that UBE3A imprinted expression varies within this tissue (Lee and Wevrick, 2000; Rougeutle et al., 1997). Research on human fetal brain demonstrated biased expression, but could not determine if the preferentially expressed atele was maternal or paternal in origin (Vu and Hoffman, 1997). Mouse Models of PWS

Mouse models of all the molecularr classes of PWS (deletions, UPD and imprinting defects) have been created. Two mouse models have been generated with large 7C deletions. One deletion, which occurred serendipitousLy by insertional mutagenesis, resulted in a mouse with a transgene-induced deletion of the entire orthologous region (Gabriel et al., 1999). When the TgPws/A(de[) was passed through the paternal germ[ine, transgenic progeny showed neonatal Lethality, and failed to express several PWS candidate genes, including Snurf, Snrpn and Ndn. The second deletion model was caused by a targeted disruption that extended from exon 2 of SnurflSnrpn






8

to exon 8 of Ube3a (Tsai et at., 1999b). Paternal transmission of this deletion resulted in a less severe phenotype than the previous model; 50% of neonates survived past 12 days, and 20% survived past weaning. Although smaller than their wild type littermates, surviving deletion mice (male and female) were fertile, unlike most individuals with PWS.

A mouse model of PWS patients with UPD has also been generated. These mice, which had maternal UPD for mouse chromosome 7C, were the first murine model to recapitulate features of PWS (Cattanach et at., 1992). Similar to infants with PWS, these mice exhibited severe faiture-to-thrive. Untreated, the mice died within seven days of birth. Expression analysis revealed a complete absence of Snrpn in these mice.

Targeted disruption of the PWS imprinting center (PWS-IC) has produced a mouse model of imprinting defects (ID; Yang et at., 1998). Paternal inheritance of this 42 kb IC deletion resulted in a mouse with a phenotype characterized by neonatal lethality and tack of expression of several paternal-only expressed genes within chromosome 7C. This important mouse model demonstrated that the PWS-IC was functionally conserved between mouse and human and provided a valuable model to study the mechanisms of imprinting in the mouse.

In addition, several studies have reported on the effects of disruption of three paternal-only expressed genes within 7C. An intragenic deletion of Snrpn (Yang et al., 1998) or a disruption of exon 2 of Snurf (Tsai et at., 1999b) produced normal mice, indicating that disruption of either Snurf or Snrpn was not sufficient to cause features of PWS. Targeted deletion of Ndn has resulted in two different outcomes. In one study, mice homozygous for a null mutation in Ndn were fully viable and did not develop any features common to PWS, including hypogonadism, infertility or obesity







9

(Tsai et at., 1999a). However in a second study, mice that inherited a mutated Ndn alele on the paternally inherited chromosome demonstrated early post-natal Lethality (Gerard et at., 1999). These authors believe that the genetic background influenced the Lethal phenotype.


Mouse Models of AS

To date, four mouse models of three Classes of AS (deletions, UPD and. Ube3a mutations) have been created. In addition, an alternative AS model was also created from mice deficient in GABAI33. A deletion mouse was generated by maternal transmission of the Tgpws/A(deI) transgenic mouse (Gabriel et al., 1999). Initial experiments revealed that this mouse model demonstrated imprinted expression of Ube3a in the cerebellum. A second deletion mouse has also been identified (Johnson et al., 1995). This mouse model exhibited a radiation -induced deletion that extended from Ube3a to the p locus. Mice with paternal UPD for mouse chromosome 7C demonstrated AS-like features including an ataxic gait, EEG abnormalities, reduced brain weight and late onset obesity (Cattanach et at., 1997). Targeted disruption of the maternal allele of Ube3a resulted in mice that were very similar to the UPID model, with poor motor skills, inducible seizures and context-dependent Learning problems (Jiang et at., 1998). Mite homozygous for a null mutation in GABAB3 also displayed several features of AS (DeLorey et al., 1998), although heterozygotes were not statistically different from wild type littermates. These mice had several features common to individuals with AS including: abnormal EEG patterns, seizures, learning and memory deficits, poor motor skills, hyperactivity and a disturbed rest-activity cycle.







10

DNA Methylation: An Epigenetic Mark

DNA methylation analysis, first proposed by Driscoll and colleagues (1992), is now widely used by researchers and diagnostic laboratories to detect parental contributions based on the differential DNA methylation imprints associated with imprinted genes. Several sites in 15q11-13 including the MKRN3 locus (Driscoll et at., 1992), NDN (Jay et at., 1997), intron 7 of SNRPN (Glenn et a[., 1993b) and the CpG island of 5' SNRPN (Glenn et at., 1996; Kubota et at., 1996b; Sutcliffe et at., 1994) display parent-specific DNA methylation imprints in peripheral blood leukocytes and other tissues (Figure 1-4).

These imprints have been utilized to reliably diagnose AS and PWS patients who have deletions, UPD and ID (Clayton-Smith et at., 1993; Driscoll et at., 1992; Glenn et at., 1993a; Glenn et at., 1996). DNA methylation analysis of AS and PWS patients has Led to the discovery of patients with defects in the imprinting process (ID). ID patients have biparentaL inheritance of chromosome 15 with no evidence of the common 4 Mb interstitial deletion, but still show uniparental DNA methyLation imprints at loci extending over a 2 Mb region of 15q11-13 (Glenn et a[., 1993a). About 50% of all AS and PWS patients with imprinting defects have microdeletions within the imprinting center (IC), which is located at the 5' end of SNRPN on 15q11-13 (Nicholls et al., 1998). The remaining ID patients have no detectable mutations, and are thought to have defects in the process of erasing and/or resetting the epigenotype in the germ line or somatic tissues (Buiting et at., 1998).


Structure and Function of the AS/PWS Imprinting Center

During each generation, the parental epigenetic mark must be erased in the germ tine and reset according to the sex of the offspring, ensuring that each successive generation will receive the correct parental imprint in germ cells and







11

somatic tissue. Mistakes in the imprinting process would be detrimental, causing disease in subsequent generations based upon parental inheritance (Figure 1-5). Imprinting defects are responsible for 3-5% of all AS and PWS patients and disable the epigenetic switch from mate to female or female to mate, respectively. These deletions range from 6 to 200 kb and can regulate DNA methylation and expression imprints of genes located at Least 1 Mb from the IC.

The identification AS and PWS individuals with imprinting defects Launched a new field of research in an attempt to further understand the mechanisms of imprinted expression within 15q11-13 (Glenn et at., 1993a; Reis et at., 1994). Delineation of the deletion breakpoints in several ID patients localized the critical region for the iC to the promoter proximal region of SNRPN (Figure 1-4A; Buiting et at., 1995; Saitoh et at., 1997; Saitoh et at., 1996). The IC extends 150 kb centromeric to the SNRPN gene and encodes a transcript that contains alternatively spliced upstream exons of SNRPN (Dittrich et at., 1996). Although the IC transcript is not abundantly expressed, it demonstrates tissue-specific paternal-only expression, and is thought to be involved in the establishment of imprinted expression along 15q1 1-13.

Analysis of Class III AS and PWS individuals with deletions in the IC revealed that the imprinting center functions as a bipartite structure. Characterization of these deletion breakpoints narrowed the smallest region of deletion overlap (SRO) for the AS and PWS regions of the imprinting center (Figure 1-4A) to 0.9 and 4.3 kb, respectively (Buiting et at., 1999). ALL AS patients with IC mutations delete exon 5 of the IC transcript, while all PWS patients with IC mutations have deletions that extend into exon 1 of SNRPN.






12

UBE3A and the Ubiquitination Pathway


The involvement of UBE3A in the etiology of AS is now very well documented. Several laboratories have demonstrated protein truncating mutations of UBE3A in muttipte AS patients (Baumer et at., 1999; Fang et at., 1999; Fung et at., 1998; Kishino et at., 1997; Lossie et at., 1998; Malzac et at., 1998; Matsuura et at., 1997; Minassian et at., 1998; Moncla et at., 1999a; Russo et at., 2000; van den Ouweland et at., 1999). Furthermore, maternal transmission of a targeted disruption of Ube3a resulted in a mouse that displayed several features of AS including motor dysfunction, inducible seizures and teaming deficits (Jiang et at., 1998).

The ubiquitin pathway is a very important cellular process, controlling the degradation of almost every type of protein, including regulators of the celt cycte, transcription factors, tumor suppressors and DNA repair enzymes (Ciechanover et at., 2000). In addition, ubiquitination is involved in the etiology of several diseases. Angelman syndrome, caused by lack of the E3 ubiquitin protein tigase gene, was the first human disease attributed to mutations in the ubiquitination pathway. Other diseases now ascribed to defects in ubiquitination include Liddle's syndrome, a severe form of familial hypertension and several specific cancers. In addition, evidence suggests that the ubiquitinatiori pathway is involved in the pathogenesis of Spinocerebetar Ataxia type-i, DiGeorge Syndrome and Cystic Fibrosis as well as Late onset Atzheimer's, Parkinson's and Huntington diseases.

The process of protein ubiquitination is complex, specific and rapid. Multiple genes, which utilize different ubiquitin pathways, give the system its specificity and complexity (Ciechanover et at., 2000). The E3 enzymes, which are the most diverse, consist of at least six different families; each family processes proteins in slightly different ways. The gene responsible for Angetman syndrome, UBE3A, is involved in







13

the transfer of an activated ubiquitin molecule to the protein substrate. UBE3A is the founding member of the HECT-domain (homologous to E6AP carboxyL terminus) family of E3 ligases. These proteins act as intermediaries between the E2 ubiquitin conjugating enzymes and the targeted substrate. This suggests that accumulation of a specific protein in certain regions of the brain is the main cause of the AS phenotype. However, patients with AS do not demonstrate a phenotype consistent other protein storage disorders.

UBE3A is involved in the transfer of ubiquitin moieties to proteins targeted for degradation via the 26S proteosome. It was cloned in 1993 by its ability, in conjunction with the E6 oncoprotein of the cancer-associated human papiLlomaviruses (HPV), to deactivate the p53 tumor-suppressor protein (Huibregtse et al., 1993a). In HPV16 infected cells, the E6/UBE3A protein complex selectively bound p53 and targeted it for degradation via the ubiquitination pathway. Three functional domains of UBE3A have been identified: an E6 protein binding site, a p53 binding site and a HECT domain, which is necessary for ubiquitination (Huibregtse et at., 1993b).

Protein ubiquitination via the HECT family of protein Ligases requires the combined efforts of multipLe enzymes (Figure 1-6; Ciechanover et at., 2000). El activates the ubiquitin moiety, which then attaches to an E2 enzyme via a high-energy thioester bond. The E2 enzyme interacts with one HECT domain family member, transferring the ubiquitin molecule to the E3. The complex containing ubiquitin, as well as the E2 and E3 enzymes then follows one of two known paths. In the first pathway, the protein substrate binds the complex, and a single ubiquitin moiety is attached. In the alternative pathway, the complex requires the interaction of an ancillary protein, such as p53, for target recognition. With the help of the E4 enzyme,






14

the ubiquitin chains polymerize, targeting the proteins for degradation via the 26S proteosome (Koegl et at., 1999).

The following chapters describe my work on the molecular genetics and pathogenetic mechanisms of Angelman syndrome.








15










NAP2 IMPT1 KvLQT1/LIT1 TAPA1 ASCL2
M IPL CDKN1C TSSCA4 TSSC6 INS IGF2 H19 L23
TEL



















Figure 1-1. Imprinted genes on 11p15.5. This map illustrates the genes (top) that map to the Beckwith-Wiedemann syndrome region on human chromosome 11, with the imprinting status of the human genes depicted. The maternal (M) and paternal (P) alleles as well as expression profiles of biallelic (LII), maternal (E ) and paternal(m) genes are indicated. Arrows indicate location of transcription start site and direction of transcription. Figure not drawn to scale.








16










IgfH19mat








H 9EPat














Figure 1-2. Genomic imprinting of H19 and Igf2 in the mouse. The Igf2 and H19 genes are shown. The differentially methylated region (DMR) of H19 is Located 5' to the transcriptional start site. On the maternal chromosome (Mat), the DMR is unmethytated (white lollipops), which facilitates binding of the CTCF protein. This interaction allows the enhancers (E) to interact with H19, but prohibits interactions between the enhancers and the Igf2 promoter. On the paternal chromosome (Pat), the DMR is methytated. CTCF cannot bind, and the enhancers preferentially interact with the promoter of Igf2, inducing expression.








17


I II III IV V

P PP PM(P)PM PM












68% 7% 3% 11% 11%

PM MM P(M) P PM PM












70% 25% 5% 0% 0%
Deletion UPD ID Sgl Gene Unknown


Figure 1-3. Molecular classes of AS and PWS in the UF repository. A total 93 AS families (104 patients) and 69 PWS families were analyzed. Familial cases were counted as one case per family. The maternal (M) and paternal (P) chromosomes are indicated. Percentages of patients in each molecular class are noted. Class 1) 4Mb interstitial deletions of 15ql 1-ql 3; Class II) patients with uniparental disomy of chromosome 15; Class III) patients who have imprinting defects, which cause changes the epigenotype along 15ql 1-13; Class IV) patients with mutations in a single gene, UBE3A (X); Class V) patients with no detectable molecular defect.








18


A.
PWS -AS
S -IC ")
MAGEL2 IC Transcript
MKRN3 NDN BD exons SNRPN IPW UBE3A

C T
lb 1la 2 3 4 5
MKRN3-AS AS-lC PWS-IC UBE3A-AS

B.
M--- ---- -/+ +
P++ + + + + + + + +/C.
RN4RR SNRPN
ZNF127 NDN PW71 Y48.5 5'CpG intron 7 IPW UBE3A
M
M I I M ~ m~, -" r
P



Figure 1-4. DNA methylation and expression imprints in 15q1 1-13. This figure depicts the DNA methylation and expression imprints of severat imprinted genes on 15q11-13. A) Overview of the AS/PWS imprinted domain. The chromosomal regions of the Prader-Witlli and Angelman syndromes are indicated by bold arrows (top). The extent of the imprinting center (IC) is also shown. The AS/PWS domain is depicted as a line, with the orientation of the centromere (C) and telomere (T) noted (not to scale). Relative positions of genes and transcripts are indicated above the line, while antisense transcripts are shown below. Arrows demonstrate transcriptional orientation. The SROs for the AS-IC and PWS-IC are shown below the chromosome. B) Expression imprints of selected 15q1l113 genes. Overall imprinted expression profiles of the maternal (M) and paternal (P) alleles are depicted. Active (+) and silenced (-) chromosomes are indicated. Tissue-specific imprinting is also indicated (+/-). C) DNA methylation imprints of select Loci along the AS/PWS imprinted domain. Maternal imprints (M) are shown above the solid line, while paternal imprints (P) are revealed below. Gene and Locus names are shown. Methylated ( U) and unmethylated ( O) alleles are indicated. This figure does not distinguish between partially and fully methylated Loci.








19


































AS AS





Figure 1-5. Inheritance of an imprinting defect. Silent transmission and inheritance of an imprinting defect in Angetman syndrome over four generations. Females (circles) and males (squares) are shown in each generation. Paternal (P) chromosomes are black, while maternal
(M) chromosomes are grey. Imprinting mutations are depicted with appropriate epigenotypes in parenthesis. Affected siblings are denoted with a grey circle or box.








20











E3C HECT



D.


EUb E3 HEC
E2

Ub 0 F.












Figure 1-6. The ubiquitination pathway involving the HECT family of ubiquitin protein-ligases. A) Ubquitin is activated and bound by the E ubiquitin-activating enzyme. B) The El enzyme transfers the activated ubiquitin to an E2 ubiquitin-conjugating enzyme. Several E2 enzymes are known to interact with UBE3A. C) A member of the HECT family



bound to its target protein, the ubiquitin-E2-E3 complex transfers the activated ubiquitin moiety to its substrate. F) The E4 protein then aids in polymerization of ubiquitin molecules on the substrate. The protein then is degraded via the 265 proteosome.
















TRANSMISSION OF ANGELMAN SYNDROME BY AN AFFECTED MOTHER


Introduction


The Angelman syndrome (AS) is a severe developmental and neurobehavioral disorder characterized by four cardinal features: 1) severe developmental delay; 2) profound speech impairment; 3) a movement and balance disorder and 4) an ASspecific behavior which includes frequent and inappropriate laughter, a happy affect and an easily excitable personality (Williams et at., 1995a; Williams et al., 2000). Most AS cases arise de novo, the consequences of large deletions from the maternally derived 15q11-13 (Williams et at., 2000). AS has also been diagnosed in patients with paternal uniparental disomy, imprinting defects on maternal 15q11-13 and maternally inherited mutations in the 3A ubiquitin protein ligase gene, UBE3A (Glenn et at., 1997). The Prader-Willi syndrome (PWS) is a separate, distinct neurobehavioral syndrome also associated with 15q11-13 deletions. However, the deficiency in PWS is always paternal in origin (Glenn et'al., 1997). Al of the cardinal features of AS can be caused by mutations in the UBE3A gene (Kishino et al., 1997; Matsuura et at., 1997), which shows imprinted expression in specific regions of the mammalian brain (Albrecht et aL., 1997; Rougeulle et al., 1997; Vu and Hoffman, 1997).

Individuals with AS achieve puberty normally, with both mates and females having normal secondary sexual characteristics, including normal menses in females (Williams et a[., 1995b). However, there have been no documented cases of reproduction in either mates or females with AS. In this report, we present the first 21






22

documented case of reproduction in an individual with AS that resulted in the maternal transmission of a 15q11-13 deletion to a fetus, which was electively terminated at 16 weeks gestation (Lossie and Drisco[L, 1999).


Methods

Subjects

The proband is now a 15 year old female with AS who has been followed intermittently in the UF Genetics clinic since 22 months of age. RecentLy, the family recontacted the Genetics service due to the proband's unexpected pregnancy. Highresolution chromosomal analysis in the past demonstrated a 15q11-13 deletion in the proband, which DNA polymorphism and methytation studies subsequently confirmed (Williams et at., 1989).

This family was initiaLLy reported in 1989 when the concern was raised that the proband's mother, who was of normal intelligence, could be mosaic for or also have a submicroscopic deletion of 15q11-13 because she displayed brachycephaLy, hearing Loss, an enlarged foramen magnum and mild ataxia. However, extensive molecular analyses of peripheral blood and skin fibroblasts failed to reveal any abnormalities in 15q1 1-13 in the mother of the proband.

The proband has classic AS features with severe mental retardation, an ASspecific behavior, a complete lack of speech, and a movement disorder characterized by ataxia. An abnormal EEG and seizures were also noted at 22 months. She began walking at 3 years, and her severe truncal ataxia has improved with age. The proband also has microcephaLy with a head circumference of Less than -2 standard deviations, relative prognathism, a protruding tongue, excessive drooling and an inappropriately happy affect with excessive Laughter. Menarche began at 11.5 years. A head CT and MRI were only remarkable for an enlarged foramen magnum.






23

The family decided to terminate the pregnancy at 15-16 weeks gestation. The termination was by suction dilatation and curettage. Identifiable fetal tissue was dissected, immediately frozen in liquid nitrogen and stored at -70*C. Due to the suction procedure, the only intact brain samples obtained were the eyes. Tissue was procured with the approval of the family and the University of Florida Institutionat Review Board.


Microsatellite Analysis

DNA was extracted from peripheral blood leukocytes (PBL) and whole tissue according to standard techniques (Driscoll and Migeon, 1990). PCR amplification of the D15S817, D15S128, ACTIN (ACTC), D15S175 and D15S87 loci (Research Genetics) was as previously described (Colman et al., 1996). DNA Methylation Analyses

Southern Blot. DNA methylation analyses were performed within 15q11-13 at SNRPN (Glenn et al., 1996) and NECDIN (NDN), and in 11p15 (KvDMR1; Smilinich et at., 1999) according to published protocols. DNA methylation analysis of NDN was at a novel Bss HII site (AC Lossie, RD Nicholls, DJ Driscoll, unpublished data), which is Located within the same Hind III fragment as the published imprinted Eag I site (Jay et at., 1997). Specific conditions for each locus are shown in Table 2-1.



Table 2-1. Conditions for Southern blots Gene Ijg DNA RE RE % Gel Vohrs Wash C
SNRPN 5 Xba I Not I 0.8 550 65
NECDIN 10 Hind III Bss HII 1 1000 70
KvLQT1 5 Eco RI Not 1 1 850 65
Specific restriction enzymes (RE) and voltehours (V.hrs) for each locus are noted






24

Methylation Specific PCR (MSP). MSP relies on the selective ability of sodium bisutfite to convert unmethylated cytosine to uracil, white leaving methylated cytosine untouched. During PCR amplification, uracil is converted to thymidine, providing a method to distinguish between the methytated and unmethytated alleges. MSP at 5' SNRPN was done according to the manufacturers recommendations (Oncor) using primers developed by Kubota and colleagues (Kubota et at., 1997). RT-PCR

mRNA was isolated from fetat eye and lymphobtast celt tines using the Potytract System 1000 mRNA extraction kit (Promega). cDNAs were reverse-transcribed from 20200 ng of mRNA using the SuperscriptTM Amptification kit (Gibco). RT-PCR analysis of UBE3A was accomplished using previously published primers that amplify an 1150 bp fragment from exons 3 to 9 (formerly U1 to 3) of UBE3A (Matsuura et at., 1997). A 738 bp fragment of SNRPN was amplified using primers specific for exon 2 (5'TTGGCACACCAGCTGGTACT-3') through exon 5 (5'-CACCTGAGACGAACTACAG-3') in a standard reaction with a 57'C annealing temperature. Amplification products were size fractionated by get electrophoresis, Southern blotted and visualized by autoradiography.


Results

Genetic Analysis

The proband, fetus and parents of the proband were genotyped by microsatettite analysis of toci (see map Figure 2-1A) within (D15S817 and D15S128; Christian et at., 1998) and distal to 15q11-13 (ACTIN, D15Si175 and D15S87). Within 15q1 1-13, the proband and fetus lacked a maternal genetic contribution (Figure 2-1B). At D155S128, the proband and fetus only amplified the paternally inherited allele.







25

Although the proband was non-informative at D15S817, the fetus showed exclusive amplification of the paternally derived allele. However, the proband and fetus were heterozygous at several loci distaL to 15q13, including D155175, ACTIN (Figure 2-1C) and D15S87 (data not shown). Therefore, both the proband and fetus have maternally inherited deletions which are restricted to 15ql 1-13. DNA Methylation Analyses

DNA methylation analysis is a powerful diagnostic tool that takes advantage of the differential methylation found in imprinted regions of the genome. The AS/PWS imprinted domain contains several Loci that display parent-of-origin methytation imprints (Glenn et a!., 1997). SNRPN and NDN are two of several paternally expressed genes within 15q11-13 which are preferentially methytated on the repressed maternal allele (Glenn et at., 1996; Jay et at., 1997; Sutcliffe et al., 1994).

Two methods can assess DNA methylation at 5' SNRPN: Southern analysis and MSP (Glenn et at., 1996; Kubota et at., 1997; Kubota et al., 1996b; Sutcliffe et al., 1994). Southern analysis reveals a 4.3 kb maternal and a 0.9 kb paternal band in the parents and normal controls. However, the proband and fetus only have the 0.9 kb paternal band (Figure 2-2), confirming the Lack of a maternal 5' SNRPN altele in these samples. In accordance with SoOthern analysis, MSP analysis of parental PBL and normal fetal eye DNA shows both the maternal and paternal PCR amplification products. However, PBL DNA from the proband and eye DNA from the fetus exclusively amplified the paternal chromosome 15 (Figure 2-3).

Previous methylation studies of the CpG island associated with NDN revealed a parent-specific DNA methylation imprint from DNA digested with Hind III and Eag I (Jay et at., 1997). A Bss HII methylation imprint is also present in this 2.6 kb Hind III fragment (AC Lossie, RD Nicholls, DJ Driscoll, unpublished data). NDN hybridizes to







26

three fragments in control samples: a 2.6 kb maternal-specific, a 1.7 kb constant and a 1.3 kb paternal-specific fragment (Figure 2-4). Normal PBL and fetal eye DNA reveal both the maternal and paternal diagnostic bands. However, PBL DNA from individuals with PWS reveals the predominance of the methylated 2.6 kb fragment, while NDN hybridized to the paternal-specific unmethylated 1.3 kb fragment in patients with AS. DNA from the parents of the AS proband demonstrates normal biparental methylation, white AS methylation imprints are apparent in PBL DNA from the proband with AS and eye tissue from the fetus with AS.

A differentially methylated region near an antisense transcript of the KvLQT1 gene in the Beckwith-Wiedemann syndrome region on chromosome 11 was also examined (Smilinich et at., ). Normal individuals have 4.3 and 2.7 kb diagnostic bands, which correspond with the methylated and unmethylated alleges, respectively. All of our samples showed normal DNA methylation imprints at this non-chromosome 15 differentially methylated site (data not shown). Gene Expression

RT-PCR analyses of AS fetal eye, normal fetal eye and PWS Lymphoblast cells revealed a 1.4 kb transcript from exons 4 to 9 of UBE3A in all tissues (Figure 5). However, as expected, SNRPN wa's only expressed in the AS and normal tissues; the PWS sample failed to amplify SNRPN (Glenn et at., 1996).


Discussion

The presence of AS-specific DNA methytation imprints and absence of a maternal contribution of proximal 15q demonstrates that the patient with AS passed her 15q11-13 deletion to her fetus. These findings conclusively demonstrate that females with AS are capable of reproduction and show that the previously observed







27

tack of reproduction is most likely due to social/cognitive behavior versus physiological reasons. Therefore, appropriate appraisal of the reproductive risks should be part of the genetic counseling given to AS families.

Studies by Gabriel and colleagues (Gabriel et at., 1999) of a mouse deletion model for the AS/PWS imprinted region support our findings. Their model, a transgene insertion/deletion (TgPws/A(de()) of the orthologous region on mouse chromosome 7C, correlates well with our findings in this patient with AS, as a large murine chromosomal deletion can also be passed through the maternal germ line. Mice that inherit the maternal deletion have many of the characteristics found in individuals with Angelman syndrome.

The ability of an AS mouse to pass on either a normal or deleted chromosome 7C allows a closer examination of the role that replication timing and homologous association play in the establishment and transmission of the chromosome 15q11-13 imprint (Kitsberg et a., 1993; LaSalle and LaLande, 1996). In the mouse model for AS, maternal transmission of a large deletion encompassing the imprinted domain failed to interrupt proper imprint establishment of the normal AS/PWS chromosomal region (Gabriel et al., 1999). These findings demonstrate that during murine gametogenesis the imprinting on both homologues must be established and transmitted in cis, and that neither replication timing nor homologous association are required for establishment or transmission of the imprint. In addition, these data strongly suggest that inheritance of a normal chromosome 15 from a mother with AS would result in normal development in her offspring.

Evidence for imprinted expression of the UBE3A gene is limited. Murine studies demonstrate that imprinted expression is limited to the CA2 and CA3 regions of the hippocampus, the mitral cell layer of the olfactory bulb and Purkinje cels of the






28

cerebellum (Albrecht et at., 1997). In humans, evidence is less precise. Imprinted expression of UBE3A was observed in adult frontal cortex and fetal brain (Rougeutte et at., 1997; Vu and Hoffman, 1997). Since the eyes originate from the lateral aspects of the forebrain during fetal development, it was possible that fetal eye would also show imprinted expression. However, no difference in the expression of UBE3A was observed between normal and AS fetal eye samples.

Imprinted genes in other chromosomal regions also show DNA methyLation imprints (Razin and Cedar, 1994). To determine if interruption of the imprinting process in the AS/PWS region can alter DNA methyLation imprints at loci on Ilp15, we examined KvDMR1, a differentially methylated site associated with an antisense transcript of KvLQT1 (Smilinich et at., 1999). All samples showed normal DNA methylation, indicating that the establishment and transmission of the 11p15 DNA methylation imprint occurs independently from the AS/PWS region.

In conclusion, our findings establish that the AngeLman syndrome can be transmitted through a female with AS, imply that the Prader-WilLi syndrome could also be transmitted through a male with AS and illustrate the need for informed reproductive counseling for parents of AS patients.








29


A.

MKRN3 S817 SNRPN P ACTIN S87
C EN -4J
CEN 7-- o----o-T EL
NDN S128 UBE3A S175


B. C.








D15S128 D15S175

-I
~-llI


-III I



1234 1 2 3 4

D15S817 ACTIN




Figure 2-1. Microsatellite Analysis of Chromosome 15. A) deletion breakpoints flanking 15q11-13, individual loci, centromere (CEN) and telomere (TEL) are noted. B) Microsate[lite analysis of loci within 15q11-13 and C) Microsatellite analysis of loci distal to 15q11-13. The pedigree shows the father of the proband (lane 1), AS proband (lane 2), proband's fetus (lane 3) and mother of the proband (lane 4). Note the lack of a maternal contribution within 15q 1-13 for the proband and fetus at D15S128, and for the fetus at D15S817. However, distal to 15q1 1-13, there is a biparental contribution at ACTIN and D155175. The father of the AS fetus is unknown.








30








NL AS PW __4.3- -MAT











0.9- ,. -PAT



1 2 3 4 5 6 7 8 9 1011







Figure 2-2. DNA methylation analysis of 5' SNRPN. Digestion of DNA with Xba I and Not I reveals diagnostic bands of 4.3 kb (methylated, maternal) and 0.9 kb (unmethylated, paternal). PBL DNA from normal individuals reveals both the 4.3 kb and 0.9 kb normal methylation profile (lanes 1, 2, 10, 11). Patients with AS only have the 0.9 kb unmethytated fragments (Lanes 3 and 4), while individuals with PWS have the
4.3 kb methylated allele (lanes 5 and 6). Eye DNA from the fetus (lanes 7 and 8) and PBL DNA from the AS proband (lane 9) reveal ASspecific DNA methylation imprints, while PBL DNA from the parents shows maternal- and paternal-specific bands (lanes 10 and 11 ).








31






0_0




bp PW E C
174- -Mat
104-_ -Pat

1 2 3 4 5 6 7 8















Figure 2-3. MSP analysis of 5' SNRPN. PBL (lanes 1, 2, 3,
5, and 6) and fetal eye DNAs (lanes 4 and 7) are shown. The
pedigree shows the positions of each family member. Normal individuals (lanes 1, 2 and 7) amplified the 174 bp
methytated and 104 bp unmethytated products. The
proband and fetus exclusively amplified the unmethylated aLlete, while two patients with PWS (lanes 5 and 6) amplified only the methylated allele. PW (Prader-WiLLi), normal
fetal eye (E) and water control (C) are indicated.








32










kb NL AS PW NE1.7


1..- Pat

1 2 3 4 5 6 7 8 9 10 11 12















Figure 2-4. DNA methylation analysis of NDN. Digestion of DNA with Bss HII and Hind III reveals diagnostic bands of 2.6 kb (methylated, maternal) and 1.3 kb (unmethylated, paternal), and a constant band of 1.7 kb. PBL DNA from normal individuals (lanes 1, 2, 11, 12) and normal fetal eye (lane 7) shows the normal methylation profile. Patients with AS (lanes 3 and 4) have the 1.3 kb paternal diagnostic band, while individuals with PWS (lanes 5 and 6) predominantly have the 2.6 kb methylated, maternal fragment. Eye DNA from the fetus and PBL DNA from the proband reveal AS-specific DNA methylation imprints (Lanes 8, 9 and 10).







33








Fetal Eye LB
NL AS PWS
RT + + +
UBE3A

SNRPN















Figure 2-5. Expression analysis of UBE3A and SNRPN. A Southern blot of RT-PCR products from UBE3A exons 3 to 9 (1150 bp) and SNRPN exons 2 to 5 (738 bp) is shown. The membrane was hybridized with the same RT-PCR products. Reactions with (+) and without (-) RT are noted. UBE3A and SNRPN transcripts are present in normal (lanes 1 and 2) and AS fetal eye (lanes 3 and 4). However, only UBE3A is expressed in LymphobLast cells from a patient with PWS (Lanes 5 and 6). Extra bands are due to alternative splicing of UBE3A.















MOLECULAR ANALYSES AND GENOTYPE-PHENOTYPE-CORRELATIONS AMONG THE FIVE CLASSES OF ANGELMAN SYNDROME


Introduction


The Angetman (AS) and Prader-Willi (PWS) syndromes, two distinct neurobehavioral disorders, are the best-studied examples of genomic imprinting in humans. In these imprinted disorders, the parental origin of the chromosome 15 abnormality determines the phenotype. PWS occurs from the lack of critical paternally expressed 15q11-13 sequences, while multiple mechanisms that disrupt the maternally inherited E3 ubiquitin protein-ligase gene (UBE3A) cause AS (Glenn et at., 1997; Williams et al., 2000).

AS is a severe developmental and neurobehavioral disorder that occurs with a frequency of -1/15,000 (Clayton-Smith et al., 1993). First documented by Harry Angelman (1965), AS is now diagnosed by four cardinal features: severe developmental delay and mental retardation; profound speech impairment; a movement and balance disorder and an AS-specific behavior which includes frequent, inappropriate daughter, a happy affect and an easily excitable personality. Other common features include seizures, microcephaty, abnormal EEG patterns, sleep disturbances, hypopigmentation and strabismus (Williams et at., 1995a; Williams et at., 2000).

Five major molecular mechanisms are known to cause AS: I) 4 Mb maternallyderived deletions of 15q11-13; II) paternal uniparental disomies (UPD); III) imprinting defects (ID); IV) patients with intragenic mutations in UBE3A; and V) patients with no



34






35

known defects on chromosome 15. Although patients in Classes I-III can be easily diagnosed by DNA methyLation analyses along the 15q11-13 imprinted domain (GLenn et al., 1997), individuals from Classes IV and V demonstrate normal DNA methytation at the diagnostic loci. DNA methylation analysis takes advantage of the differential methylation found in imprinted regions of the genome and easily resolves the maternal and paternal alleles. SNRPN, the most reliable Locus for AS diagnosis, is one of several paternal-only expressed genes in 15q11-13 whose promoter region is preferentially methytated on the repressed maternal allele (GLenn et al., 1996; Kubota et at., 1996b; Sutcliffe et at., 1994).

The discovery of maternally inherited mutations in Class IV patients first established a role for UBE3A in the etiology of AS (Kishino et at., 1997; Matsuura et at., 1997). Subsequent mutation analysis of patients with normal DNA methylation identified an overall UBE3A mutation rate of 14-38% in sporadic AS patients (Baumer et al., 1999; Fang et at., 1999; MaLzac et al., 1998; Moncta et al., 1999a; Russo et at., 2000). Although cell Lines from AS patients failed to show imprinted expression of UBE3A (Nakao et al., 1994), demonstration of brain-specific imprinting by RT-PCR in the human confirmed the role of UBE3A in the etiology of AS (RougeuLte et at., 1997).

The phenotype associated with Class I patients is welt documented (Saitoh et at., 1994; Smith et al., 1996). These individuals have a classical AS phenotype with alt patients having the four cardinal features of AS as well as a very high incidence of severe, early-onset seizures, microcephaly and hypopigmentation. White patients from Classes II, III and IV displayed the four cardinal features of AS, these individuals often exhibited atypical features that ameliorated the AS phenotype. ALt studies showed that patients with UPD and imprinting defects (ID) were Less Likely to present with hypopigmentation or microcephaLy (Burger et at., 1996; Fridman et at., 2000b;







36

Gi(Llessen -Kaesbach et at., 1999; Saitoh et at., 1999; Smith et at., 1997). In addition, some studies revealed that patients from Classes 11 and III had fewer seizures, early onset obesity and better motor skills (Fridman et at., 2000b; Gi [Lessen -Kaesbach et at., 1999; Smith et at., 1997). Moncta and colleagues (1999b) reported that UBE3A mutation patients had a more severe phenotype than the UPD) and ID patients. Like the deletion group, Class IV patients were more likely to present with hypopigmentation and seizures.

Individually, these studies have given us clues to the ctinicaL variances that occur among the first four classes of AS patients. However, a single comprehensive investigation of alt molecular classes of Angelman syndrome would provide researchers, clinicians and families a valuable resource to aid in the prediction of a phenotypic outcome give a particular genotype or molecular class. In this study, we report on the molecular and clinical analyses of 104 classical AS patients from the University of Florida AS repository. We present the first comprehensive analysis of genotype- phenotype correlations among all five molecular classes of AS. In our study, we report the highest UBE3A mutation frequency to date and demonstrate striking differences among the five classes in growth parameters; achievement of developmental milestones; and severity, frequency and age at onset of seizures.


Materials and Methods

Patient Repository

Over the last 11 years, we have accumulated a Large AS repository totaling 146 individuals from 134 Angelman families. Each patient was clinically examined by geneticists at the University of Florida, evaluated for 22 individual criteria and given an AS rating of one through five based on clinical impression before any Laboratory tests were performed. We restricted this study to the 104/146 classical AS patients






37

(93 families) who demonstrated a classical AS phenotype. The remaining 42 "AS-like" patients exhibit some but not all of the four cardinal features of AS and were excluded from further investigation. Blood and tissue were procured with the approval of the families and the University of Florida Institutional Review Board.

Once a clinical diagnosis of AS was determined, DNA from each patient was analyzed by molecular and cytogenetic tests in order to determine the class in which each AS patient belonged. DNA methylation analyses at the MKRN3, PW71 and 5' SNRPN loci were used to separate patients in Classes I-III (abnormal DNA methylation) from individuals in Classes IV and V, who had normal methylation (Dittrich et at., 1993; Driscoll et al., 1992; Glenn et al., 1996; Kubota et al., 1996b; Sutcliffe et al., 1994). DNA dosing, high-resolution chromosome and fluorescence in situ hybridization (FISH) studies detected patients with large interstitial deletions (Class I), while microsatellite and RFLP analyses separated patients in Class II from individuals in Class III (Christian et al., 1998; Miturangura et al., 1993).

Patients with normal DNA methylation were then tested for UBE3A mutations by a combination of Southern blot, BESS T-Scan and direct sequence analyses. Patients with intragenic UBE3A mutations were placed into Class IV, while those with no detectable chromosome 15 abnormalities were put into Class V. Southern Analysis

Southern blots were done according to standard conditions (Lossie and Driscoll, 1999). To detect possible genomic rearrangements, cDNA probes were made by RTPCR from the 5' UBE3A cDNA primers (forward primer 5'-ACCAGCTCCTCAGAAGTTT GGCGAAA-3' and reverse primer 5'-TCTCCATCATTCTCCGAATCTGGTC-3') and 3' UBE3A cDNA primers (forward primer 5'-TTGCAAAGCGATGAGCAAGCTACC-3' and reverse primer 5'-TGGGACACTATCACCACCCAA-3'). A 2.7 kb Eco RI to Not I fragment from







38

cosmid 24 (Sutcliffe et at., 1994), which is located at 5' UBE3A, was used for DNA methylation analyses and to detect genomic rearrangements. BESS T-Scan

We analyzed genomic DNA from patients following the procedures outlined in the BESS T-Scan mutation detection kit (Epicentre, Madison, WI) using primers (Table 3-1) corresponding to exons 6, 10, 11, 12, and 16. Cleaved products were size fractionated on 6% acrylamide, 6M urea and 30% (vlv) formamide sequencing gels according to standard protocols. Putative mutations were verified by sequence analysis.


Sequence Analysis

Abnormal PCR products from BESS T-scan analyses were cloned into a TA vector (Ctontech) and sequenced using universal primers and regular dye terminators (ABI, Perkin Elmer). We designed coding region and intronic primers that would amplify individual exons of UBE3A (Table 3-2). PCR products were purified by the High Pure PCR Purification Kit (Roche) and sequenced directly using a 1/4 reaction of the Big Dye terminators (ABI, Perkin Elmer). Completed sequencing reactions were purified by either repeated ethanol precipitation or by sepharose columns (Edge Scientific), dried under vacuum, resuspended and fractionated on either an ABI 377 or ABI 373A automated sequencer. Sequence analysis was performed with the Sequencher program (Gene Codes Corporation).


Primers

Primers for BESS-T (Table 3-1) and direct sequence analysis (Table 3-2) were designed to amplify the entire UBE3A coding region (exons 6-16).









39


Table 3-1. BESS-T Primers
Exon Primer Direction Location Size
6 TGCCAGUG--GTTTATTTTT Forward Exon 187
ACCAGCCTTGTGGGTAAG Reverse Exon
7 GGAGAACCTCAGTCTGACGAC Forward Exon 38
ATTCGGCTAGCTTCAATGTC Reverse Exon
8 GCAGCTGCAAAGCATCTAAT Forward Exon 284
TCAATTCTAGCGCCTTTCTT Reverse Exon
10 GCAATCATCTTCTTTTCATGTT Forward Intron 194
CGACACCATAATCACATTAC Reverse Intron
11 TGTTCACATACGATGAATCTACA Forward Exon 192
CTCCCAAGTCACGAAAAGTT Reverse Exon
12 TCAGAGTTTAAAAGAMATTGGA Forward Exon 155
TCCTG7MCATTTGTAATTGG Reverse Exon
13 GAATTTGTCAATCTTTATTCTGACT Forward Exon 155
CGGCTTCCACATATAAGCA Reverse Exon
14 AGATTTCCAAGCACTAGAAGAAA Forward Exon 67
AATCAGAACAGAGTCCCTGG Reverse Exon
15 GT-rCTGGGAAATCGTTCATT Forward Exon 137
CTGTGTCTGGGCCATM Reverse Exon
16 ACCATGACTTACAGTTTTCCT Forward Intron 189
TGGGACACTATCACCACCAA Reverse Intron



Table 3-2. Sequencing Primers
Exon Primer Direction Location Size
7 TATGGCCACCTGATCTGAC Forward Intron 345
TTCCTATCTCCCAT7rACTGC Reverse Intron
8 GCTTGACTAACTTTTGCCTTG Forward Intron 443
ATCTCCCACATGGT-MCAG Reverse Intron
GCAGCTGCAAAGCATCTAAT Forward Exon
TCAATrCTAGCGCCTTTCT-r Reverse Exon
9 AACAGCTATGACCATGCAACAGAGTAAACATACATATT Forward Intron 1401
GTAAAACGACGGCCAGTCACTGAACTGTATCAT Reverse Intron
ATrAGGCCCTGATGATGTGT Forward Exon
CCAGATATTCAGGACTGTGGA Reverse Exon
10 TTGTTTCCTAATCCTACTCCTFG Forward Intron 352
ACCAAATCCTTCT M GCTG Reverse Intron
11 GGACATTGTTTTCTCAAGTGC Forward Intron 559
TAAAAATGTCCCCCTTTGAG Reverse Intron
12 TGTTGTATTTTGTAGTTCTATGG Forward Intron 257
TTAATGAAGAGACAAAATGTGAC Reverse Intron
13/14 GAAGTTCTTGTGATTAATGT Forward Intron 404
CCCTFTGGTGAATCAAATCTTCC Reverse Intron
GAATTTGTCAATCTTTATTCTGACT Forward Exon
AATCAGAACAGAGTCCCTG6 Reverse Exon
15 TTCAGGATAAATTTGCTTGG Forward Intron 416
AAAATCACGAATGTGCTCAG Reverse Intron








Statistical Analyses


Descriptive statistics were calcuLated as a percentage or by the mean


standard deviation. ALI outcome variables were modeLed as a function of age at


evaluation, birth weight, moLecular class (1, 11, 111, IV and V), gestational age, maternaL







40

age, paternal age, race (Caucasian, Hispanic and Other), and sex. Outcome variables consisted of continuous, binary and ordinal measures, and were modeled using analysis of covariance (ANCOVA), logistic regression and ordinal logistic regression, respectively. For binary and ordinal outcome variables with limited sample size, we employed the exact chi-square test. Odds ratios were used to summarize the binary and ordinal outcomes. ALl tests were two-sided and considered significant at aLpha=O.05. ALl statistical analyses were performed using SAS 6.12 (SAS Institute, Cary, NC).


Results


Molecular Classes of Angelman Syndrome

Each patient was assigned a molecular class based upon results from highresolution chromosome, FISH, UBE3A mutation as well as DNA dosing, methylation and polymorphism analyses along 15q11-13 (Table 3-3). The vast majority (63) of our


Table 3-3. Molecular Classes of Angelman Syndrome
Class Molecular Defect Patients %
1 1 5qI- 13 Deletion 63 68
II Uniparental Disomy (UPD) 7 7
III Imprinting Defect (ID) 3 3
IV UBE3A Mutation 10 11
V Unknown 10 11



classical families were deleted for the entire 4 Mb AS/PWS imprinted domain (Class I). In seven cases AS occurred via paternal UPD of chromosome 15 (Class 11), and three families had imprinting defects (Class 1I1). Intragenic mutations in UBE3A occurred in ten of our classical patients (Class IV), while the remaining 10 had no detectable chromosome 15 abnormality (Class V).







41

Mutation Analysis

Initially, a molecular confirmation of AS could not be made in 20/93 families using cytogenetic, DNA methytation or DNA polymorphism tests. Furthermore, Southern blot analysis of the UBE3A cDNA determined that genomic rearrangements did not occur in any of these patients (data not shown). Sequence analysis of the UBE3A coding region in these 20 families revealed intragenic mutations in 10 families (15 patients). We detected six deletions that resulted in frameshifts, three nonsense mutations and one missense mutation (Figure 3-1). In patients with normal DNA methyLation, we found a 50% mutation detection rate with 3/4 familial (75%) and 7/16 sporadic cases (44%) harboring mutations within the UBE3A gene.

One patient was heterozygous for a previously unidentified expressed polymorphism (A1144G transition) in exon 9. Another common polymorphism occurred in intron 6 at the site of a poly T tract. Several patients and normal individuals were heterozygous, having runs of either nine (p) or ten (q) thymidines at in intron 6. We examined 134 normal chromosomes and found that p=0.83 and q=0.17. In addition, one AS-like patient had a paternally inherited 14 bp deletion of the 3' UTR, which appeared to be similar, but not identical, to that identified by Fung and colleagues (1998). No disease-associated mutation was found in this individual. In addition, BESS T-Scan detected one individual who was homozygous for a previously identified expressed polymorphism in exon 6 (Vu and Hoffman, 1997). DNA Methylation of 5' UBE3A

Although we identified disease-causing mutations in 50% of our patients who had normal DNA methyLation at 5' SNRPN, the cause of AS in the remainder of our classical Angelman syndrome patients was unknown. We postulated that disruption of







42

the normal UBE3A DNA methylation pattern in Class V patients could be a potential cause of AS in these patients.

We isolated a 2.7 kb Not I-Eco RI fragment from the CpG island at 5' UBE3A (Figure 3-2A) and tested for parent-of-origin DNA methylation imprints in DNA from PBL, AS brain, normal brain and germ cells from both sexes. As expected, the 2.7 kb genomic probe detected a 5.1 kb fragment when the DNA was digested with Eco RI alone. However, when DNA was digested with both Eco RI and Not I, the probe only hybridized to a 2.7 kb fragment, indicating that the CpG island at 5' UBE3A was unmethylated on both alleges in all tissues examined (Figure 3-2B). We next examined PBL DNA from Class V patients. The 2.7 kb probe only detected the unmethylated fragment, indicating that the CpG island was also unmethylated in these individuals (Figure 3-2C).


Summary of all Published UBE3A Mutations

To date, UBE3A mutations have been identified in 51 AS families (Baumer et al., 1999; Fang et at., 1999; Fung et al., 1998; Kishino et al., 1997; Malzac et al., 1998; Matsuura et al., 1997; Russo et al., 2000; van den Ouweland et al., 1999). Forty-five are unique mutations; no true hot spots have been identified (Figure 3-3). Most mutations are novel, with nO more than three unrelated individuals sharing a common error. Although defects have been found in virtually all protein-coding exons, most cluster in exons 9 and 16 (Figure 3-3). Insertions, deletions and nonsense mutations are the predominant defects.


Genotype-Phenotype Correlations

We analyzed phenotypic data on 61 patients from the University of Florida AS repository. We included all of our patients from Classes II-V and randomly chose 20







43

Class I patients for phenotype comparisons. We also included 77 additional patients (Classes II, I1 and IV) in our statistical models (Bottani et at., 1994; Dan et at., 2000; Dupont et at., 1999; Freeman et at., 1993; Fridman et at., 2000a; Fridman et at., 2000b; Fridman et at., 1998; Fung et at., 1998; Gillessen-Kaesbach et at., 1995; Gitlessen-Kaesbach et at., 1999; Greger et at., 1997; Gyftodimou et at., 1999; Laan et at., 1999; Malcolm et at., 1991; Minassian et at., 1998; Moncla et at., 1999a; Moncla et at., 1999b; Ohta et at., 1999; Prasad and Wagstaff, 1997; Reis et at., 1994; Robinson et at., 1993; Russo et at., 2000; Saitoh et at., 1997; Saitoh et at., 1999; Smeets et at., 1992; Smith et at., 1994; Smith et a[., 1997; Smith et at., 1998; Tonk et at., 1996). We compared the results of statistical models established between our patients and the combined data set (Tables 3-4, 3-5 and 3-6). Deletion patients (Class I) had the most classical phenotype. However, patients from Classes Il-V exhibited some atypical features. Differences were most striking in growth parameters, development of motor skills, seizures and pigmentation.

Statistical analysis of body mass index (BMI) revealed that patients from Classes II, I1 and IV were bigger and heavier than the deletions and Class V patients (Figure 34A; Table 3-4), for both UF patients (P=0.0042) and the combined data set (p=0.0167). Statistical models also demonstrated that less than 15% of individuals from Classes II and III had microcephaly, whereas more than 55% of patients from the other three classes had a head circumference less than the 3rd percentile (Figure 3-5B; Table 3-4; p=.0415).

The mean age to walk for Class I was 4.6 +/- 2.1 (p=.0001), while the mean age to walk for patients from Classes II-V varied from 2.4 +/- 0.9 (Class III) to 2.8 +/- 0.9 (Class IV; Figure 3-4C; Table 3-5). Onset of seizures also depended upon moLecular class (Figure 3-4D; Table 3-5). Seizures started very early in Class I and V patients (1.9










44


+I- 1.1 and 1.4 +I- 0.9, respectively) compared to Classes II, III and IV (4.9 /- 3.4, 5.5


+I- 5.0 and 2.7 +I- 1.4, respectively; p=.0028).




Table 3-4. Clinical and growth data
Class I Class II Class III Class IV Class V
UF UF All UF All UF All UF
Speech (21) (7) (27) (7) (20) (15) (46) (11)
0 words 71 44 43 40 60 33 82
3 words 29 43 15 14 15 27 26 9
3-10 words 43 33 43 30 13 41 9
> 10 words 14 8 15
Seizure Onset (20) (3) (14) (2) (9) (12) (24) (5)
1 year 10 7 33 17 13 40
1-2 yrs 40 33 14 23 8 4 20
2-3 yrs 25 14 50 11 25 29 40
3-4 yrs 25 50 29
> 4 yrs 67 65 50 33 25
Seizure Severity (21) (7) (26) (7) (18) (15) (32) (10)
Severe 29 4 14 6 33 19 10
Moderate 62 14 8 11 20 22 30
Mild 9 29 23 14 22 33 44 20
None 57 65 72 61 14 15 40
Length (21) (7) (28) (7) (17) (15) (30) (9)
< 5 % 42 7 30 12 7 10
5-20% 5 11 14 12 20 10 56
21-40% 14 43 18 14 18 46 27 22
41-60% 19 14 14 14 23 13 33
61-80% 10 18 14 23 7 17 22
81-95% 10 14 21 14 6 7 3
>95% 29 11 6
Weight (21) (7) (27) (7) (15) (15) (28) (9)
<5% 18 4 11
5-20% 14 7 29 13 13 7 33
21-40% 24 14 4 11
41-60% 24 14 15 27 14 34
61-80% 10 14 15 29 13 13 18
81-95% 14 22 20 27 18
>95% 10 44 33 42 54 20 43 11
BMI (kg/mz) (21) (7) (17) (7) (14) (13) (13) (9)
<5% 10 8 8 11
5-20% 10 8 8 33
21-40% 24 6
41-60% 18 14 6 8 8 34
61-80% 18 14 12 57 29 31 31 11
81-95% 10 29 29 7 14 14 11
>95% 10 43 47 43 64 31 31
Head Circum (20) (6) (27) (7) (19) (15) (32) (9)
<5% 60 15 11 53 56 60
5-20% 10 33 11 14 5 10
21-40% 20 17 30 29 26 27 16 20
41-60% 10 33 18 14 21 20 12 10
61-80% 17 15 29 21
81-95% 4 14 5 16
>95% 7 11
All parameters are statistically significant in UF and combined data sets (p0.0S)




In the UF patient population, significant seizures occurred in 19/21 deletion


patients, but only in 1/7 UPD, 1/7 ID, 8/15 UBE3A mutation and 4/10 Class V patients


(p=9.96X105). Similar findings were observed in the combined data set (p=8.26X10-8;


Table 3-6). In addition, 90% of Class I patients were hypopigmented compared to








45


family members (p=3.33X108). However, less than 25% of Classes II-IV and only 44% of


patients in Class V showed evidence of hypopigmentation (Table 3-6).



Table 3-5. Clinical data: means
Class I Class II Class III Class IV Class V
UF UF All UF All UF All UF
Age to sity 1.30.6 0.90.3 0.90.2 0.70.1 0.80.3 1.00.4 1.00.4 1.00.4
Age to walk* 4.62.1 2.50.7 2.60.9 2.91.2 2.41.0 2.81.0 2.80.9 2.6+0.8
First seizure' 1.91.1 4.93.4 4.83.2 5.54.9 3.43.5 2.71.4 4.44.9 1.40.9
Birth weight 3.10.5 3.80.2 3.50.5 3.60.6 3.50.7 3.20.5 3.20.4 3.60.5
Maternal age 27.35.2 35.07.1 30.27.5 29.66.6 29.16.2 25.94.1 25.94.1 26.33.9
Paternal age 29.85.9 35.08.4 33.37.6 29.66.9 29.46.4 27.53.3 27.53.3 33.09.1
Gestational age 39.21.4 39.02.0 39.71.1 38.41.6 37.52.1 39.81.4 39.81.3 39.70.8
Age at last visit 10.94.9 9.63.4 8.96.5 14.86.0 10.65.8 17.310.3 17.311.0 12.311.7
'Significant in UF data only
'Significant in combined data set only
*Significant in UF and combined data sets





Table 3-6. Clinical data: percentages
Class I Class II Class III Class IV Class V
UF UF All UF All UF All UF
Walk by 5 yrs* 50 (20) 100 (7) 96 (25) 86 (7) 94 (18) 93 (15) 97 (35) 100 (7)
Feeding Problems 70 (20) 80 (5) 75 (12) 100 (5) 83 (18) 80 (10) 46 (24) 63 (8) Simple commands* 53 (17) 100 (4) 91 (11) 100 (7) 100 (13) 100 (13) 100 (13) 100 (5) Seizures' 100 (21) 43 (7) 45 (31) 29 (7) 59 (27) 53 (15) 73 (48) 60 (10)
Significant Seizures* 90 (21) 14 (7) 12 (26) 14 (7) 17 (18) 53 (15) 41 (41) 40 (10) Hypopigmented* 90 (21) 17 (6) 20 (20) 0 (7) 14 (22) 15 (13) 23 (43) 44 (9)
*Significant in both data sets
SSignificant in UF set only




Discussion



Mutations in UBE3A


We have accumulated an AS repository of 104 classical Angelman patients from


93 different families, each of whom has been studied extensively by us at the clinical


and molecular Levels. Previous mutation analyses by other Laboratories revealed a


very low UBE3A mutation detection rate (5-38%) in sporadic patients with normal DNA


methyLation at 5' SNRPN (Baumer et at., 1999; Fang et at., 1999; MaLzac et at., 1998;


MoncLa et a[., 1999a; Russo et at., 2000; van den OuweLand et al., 1999). Five







46

explanations can account for the paucity of UBE3A mutations in these patients: 1. Patients from these studies do not have AS, but instead have disorders that mimic AS; 2. Many UBE3A mutations occur in non-coding regions; 3. UBE3A can be inactivated by other mechanisms; 4. Other genes in the ubiquitin pathway (genome wide) also cause an AS phenotype; 5. Angelm an -associated mutations occur in other 15q1 1-13 genes.

One goal of our study was to further narrow these possibilities and try to establish whether or not other AS genes existed. Therefore, we restricted our mutation analysis to 20 AS families seen by University of Florida geneticists, eliminating patients with mimicking conditions. We hypothesized that if only one AS gene existed, then 60-80% of our classical AS patients would have intragenic UBE3A mutations. We would not expect to find mutations in 100% of our patients because some mutations will invariably lie in non-coding regions of the gene. Overall, we found mutations in 50% of our 20 classical AS patients; 44% of our sporadic cases (7/16) and 75% (3/4) of our familial cases had mutations within UBE3A. Although we have found the highest UBE3A mutation detection rate in sporadic patients who have AS, the Lower than expected frequency suggests that alternative explanations must exist for the Lack UBE3A mutations in the remaining sporadic Class V patients.

The simplest explanation for the relative lack of mutations in patients with normal DNA methylation at 5' SNRPN is that multiple mutations occur outside of the coding region. Although formally a possibility, only two patients have been found with lesions that disrupt either the UBE3A gene or an upstream element (Greger et a[., 1997; Greger et al., 1994). Furthermore, no mutations have been reported in the 5' UTR of UBE3A and Southern analysis of our patients failed to detect genomic rearrangements in our 20 families.







47

In the 5' region of imprinted genes, the repressed allele is usually methylated, while the expressed allele is unmethylated. In cancer, DNA methylation of the promoter region has been shown to inactivate tumor suppressor genes, while demethylation of promoters can lead to activation of proto-oncogenes (Tycko, 2000). With the exception and Mash2, and now UBE3A, the promoter regions of imprinted genes show differential methylation based on the parental origin of the chromosome (Glenn et al., 1997; Razin and Cedar, 1994; Tilghman, 1999). In addition, demethylation has been shown to occur in long-term cell culture (LaSale et al., 1998), reactivating the maternal allele of SNRPN (Saitoh and Wada, 2000). Several paternalonly expressed genes within the AS/PWS imprinted domain display parent-of-origin DNA methylation imprints in peripheral blood leukocyte (PBL) DNA (Driscoll et at., 1992; Glenn et at., 1996; Jay et al., 1997; Jong et al., 1999; Kubota et al., 1996a; Sutcliffe et al., 1994). However, when we examined the CpG island at 5' UBE3A we found no evidence for a DNA methylation imprint in DNA derived from PBL, brain tissues or germ cells. Both the maternal and paternal alleges were completely unmethylated, even in tissues that had previously revealed imprinted expression of UBE3A (Lossie and Driscoll unpublished data; Rougeulle et al., 1997; Vu and Hoffman, 1997).

It is generally accepted that DNA methylation of promoter regions is closely associated with transcriptional repression (Bird and Wolffe, 1999). Although no one is certain how DNA methylation serves to repress transcription, candidates include direct blockage of transcription factors to their binding sites, alteration of local chromatin structure through histone interactions and interplay among methylated DNA, hyperacetylated histones and various DNA binding proteins, such as MeCP2 (Bird and Wotffe, 1999). With the exception of brain, UBE3A is expressed biallelically in all







48

tissues examined (Rougeuttlle et at., 1997; Vu and Hoffman, 1997). Our data demonstrate that 5' UBE3A is normally unmethylated in a variety of tissues. Therefore, we hypothesized that methylation of the maternal CpG island at 5' UBE3A could repress transcription of the maternal allele of UBE3A in Class V patients. However, Southern analysis revealed that Class V patients are completely unmethylated at 5' UBE3A in PBL DNA, indicating that they do not inactivate UBE3A by inappropriate methylation. To fully eliminate this possibility brain DNA from Class V patients needs to be examined.

So far, our experiments have suggested that mutations in UBE3A are not the sole cause of Angelman syndrome; additional factors must also be involved. The most obvious candidates are other genes in the ubiquitin pathway, an extremely complex cascade that initiates when ubiquitin is activated at its C-terminus by the Elactivating enzyme (Ciechanover et al., 2000; Wilkinson, 2000). Once activated, the ubiquitin molecule is transferred to one of about twelve E2 ubiquitin-conjugating enzymes via a high-energy thiot-ester bond. Next, an E2 enzyme pairs with one of several dozen E3 ubiquitin-protein ligases, forming a complex that transfers activated ubiquitin first to the E3 enzyme then subsequently to the targeted protein. The E4 enzyme then polymerizes the ubiquitin, producing a multi-ubiquitinated protein that is recognized and degraded by the 265 proteosome. This E2-E3 interaction is very specific; UBE3A (an E3 enzyme) will form complexes with the ubiquitin-conjugating enzymes UbcH7 and UbcH8, but not UbcH5 or UbcH6 (Kumar et al., 1997). Furthermore, the temporal and spatial expression patterns of some E3 tigases may add an additional layer of precision targeting (Anan et al., 1998).

Any protein that interacts with UBE3A in this cascade and all proteins that UBE3A targets for degradation are good candidates for patients grouped in Class V. So







49

far, four proteins have been identified as substrates for UBE3A-mediated degradation: p53, HHR23A, the Src family kinase B~k and UBE3A itself. It is not clear how any of these genes could be involved in the etiology of AS, and given the complexity of the ubiquitin system, identification of the specific AS gene or genes involved is a very daunting task.

Alternatively, other 15q11-13 genes may play important roles in the etiology of Class V patients. UBE3A is a complex gene subject to tissue-specific imprinting and alternative splicing (Albrecht et aL., 1997; Kishino and Wagstaff, 1998; Rougeulle et at., 1997; Vu and Hoffman, 1997; Yamamoto et at., 1997). In certain cell types in human and mouse brain, UBE3A is preferentially expressed from the maternal chromosome. It is not clear from the present data if the human UBE3A gene shows global but leaky imprinted expression or demonstrates tightly regulated cell-specific imprinted expression where some cells types are imprinted, while neighboring cells are not. Making the discovery of the mechanism of imprinted expression of UBE3A even more difficult is the detection of an antisense transcript that overlaps the last six exons of UBE3A (RougeuLle et al., 1998).

The UBE3A antisense transcript is a good AS candidate, as it exhibits an expression profile that hauntingly mirrors UBE3A imprinted expression, as the paternal-only expressed antisense transcript is only active in the tissues that also show imprinted expression of UBE3A. The paternaL-only expressed antisense transcript has only been demonstrated to be active in the tissues that also show imprinted expression of UBE3A (Rougeutle et al., 1998). One can envision a scenario whereby expression of the antisense transcript from the paternal chromosome specifically inactivates the paternal UBE3A aLlete in cis (Brannan and Bartolomei, 1999; Rougeu[Le et al., 1998). According to this model, if the antisense transcript were activated biaLleLically in the







50

brain, both the maternal and paternal alleges of UBE3A would be repressed. It would be interesting to determine if Class V patients demonstrated biallelic expression of the UBE3A antisense transcript in brain.


Genotype-Phenotype Correlations

The second major goal of this study was to establish phenotypic profiles for each molecular class so physicians could accurately diagnose AS and be able to predict outcomes for the families of patients with Angelman syndrome. Recent studies have shown that UPD (Fridman et al., 2000b; Smith et at., 1997) and ID (Burger et al., 1996; Gillessen-Kaesbach et al., 1999; Saitoh et at., 1999) patients have less severe phenotypes than the deletions. In addition, Moncla and colleagues (1999b) revealed that as a group, non-deletion patients (Classes II-IV) were also less severely affected. However, genotype-phenotype correlations have only revealed differences among the first four classes in head circumference and frequency of seizures (Moncla et al., 1999b). Furthermore, no previous studies have reported on the phenotype associated with Class V patients.

Genotype-phenotype analyses of our patients revealed that all five classes had the four cardinal features of AS: severe developmental delay; profound speech impediment; the AS-specific movement disorder; and the characteristic Angelman behavior. Furthermore, some classes have additional characteristics that are often associated with the Angelman syndrome, such as seizures, microcephaly and hypopigmentation. Out of 22 separate parameters, 16 demonstrated statistical differences among the five classes, at p<0.05. Our patients correlate welt with those in the literature, with similar findings in 13/16 categories. Our statistical models demonstrated that the five classes could be separated into four phenotypic groups: Class I; Classes II and III; Class IV; and Class V. Multiple clinical distinctions can be







51

made between the classes, with differences most striking in pigmentation; growth parameters; achievement of developmental milestones; and severity, frequency and age at onset of seizures.

We found that deletion patients as a group have the most classical and severe phenotype. They achieve developmental milestones later and to a Lesser degree than the other classes, and are Less Likely to follow simple commands. Class I patients have the highest incidence of severe seizures (90%) and hypopigmentation (90%) of all five classes. In addition, deletion patients tended to have a complete absence of speech (100%), a normal BMI distribution and severe microcephaLy.

In contrast, UPD and ID patients (who have indistinguishable phenotypes) are much less severely affected. They have low incidences of hypopigmentation (:5 20%), microcephaly and severe seizures (< 20%). In addition, about 50% of UPD and ID patients from our repository can speak a few words. Patients in Classes 11 and III are Larger, heavier and often have better coordination. These two groups have very high BMI indices. More than 70% of these individuals are above the 80th percentile for their age group.

Our data correlate well with that of Fridman and coleagues (2000b) who compared 19 AS patients with UPD from multiple studies to 21 deletion patients (Class 1). Their analysis showed that Class 11 patients also displayed a milder phenotype similar to our observations. The Class 11 patients were heavier, walked earlier and were less Likely to have seizures, microcephaly or a complete Lack of speech. Analyses of Class III patients from other studies revealed that patients with imprinting mutations also had a milder phenotype. They were less likely to have microcephaly and often had normal pigmentation (Burger et at., 1996; Saitoh et at., 1999). In addition, some studies revealed that patients from Classes 11 and III had fewer







52

seizures, early onset obesity and better motor skills (Fridman et at., 2000b; GillessenKaesbach et at., 1999; Smith et at., 1997).

UBE3A mutation patients fall somewhere in the middle. They are statistically similar to deletion patients with 53% of patients having significant or recurring seizures, early onset of seizures in most patients, a complete absence of speech in more than 85% of patients and a high incidence of microcephaly. However, statistically, Class IV patients are similar to UPD and ID patients in the development of motor skills, ability to follow simple commands, pigmentation and development of obesity. Moncla and colleagues (1999b) examined Class IV patients individually for head circumference and seizures. They also concluded that UBE3A mutation patients had high incidences of seizures and microcephaly.

Class V patients are very interesting. Although these patients have no detectable chromosome 15 abnormality, statistically they are most similar to the deletion patients. Class V patients have normal height, weight and BMI distributions, similar to that observed in Class I patients. They also typically present with a complete absence of speech, early onset of seizures, hypopigmentation and microcephaly. However, Class V patients walk about two years earlier than deletion patients, and their seizures are less likely to be recurring or as severe as those observed in patients from Class 1.

Since Class V patients tend to have a more severe phenotype than that observed in Classes 11, 111 and IV, it is likely that disruption of more than one gene is causative of AS in these patients. Perhaps Class V patients have a mutation in an upstream gene on 15q1 1-13 that affects not only UBE3A, but also additional genes that give rise to a more severe AS phenotype in these individuals. A good candidate gene would be the UBE3A antisense transcript. Alternatively, Class V individuals may have







53

mutations in other genes in the ubiquitination pathway. Since the phenotype is severe, we would predict that the mutation would be in a gene that controlled the degradation of multiple proteins.

Our data indicate that Class I patients comprise a contiguous gene disorder, with hapLoinsufficiency of multiple genes exacerbating the Lack of the maternally expressed UBE3A gene. Patients in Classes II and III have the least severe and most atypical phenotype, suggesting that a double dose of the paternal-only expressed genes may be ameliorating the AS phenotype in UPD and ID patients. Alternatively, the moderate phenotype associated with UBE3A mutation patients may suggest that haptoinsufficiency of UBE3A may be detrimental during development and into adulthood. Additionally, UBE3A protein levels may be tightly regulated in the central nervous system and peripheral tissues. It is likely that a combination of the double dose of the paternally expressed genes and haptoinsufficiency of UBE3A both contribute to the differences in phenotype observed between Classes II and III and Class IV patients. Of all four non-deletion classes, the patients with no detectable chromosome 15 abnormality most closely resemble Class I patients.

One puzzling finding is that over 50% of UPD, ID and UBE3A mutation patients become extremely obese by puberty. These findings strongly insinuate that the three classes must share a common genetic mechanism for this observation. The UPD and ID patients suggest that a double dose of a paternal gene or genes could cause the obesity. However, this explanation does not account for the UBE3A mutation patients. Is it possible that disruption of the maternalty-inherited UBE3A gene can stabilize a protein that is responsible for the obesity phenotype or activate the maternal allele of a paternally expressed gene?







54

This integrated study of the differing genotype-phenotype correlations found among all classes of AngeLman syndrome patients reveals that distinct clinical subgroups exist. Although mutations in UBE3A are sufficient to cause the four cardinal features of Angelman syndrome as well as recurrent seizures and microcephaty, other 15q11-13 genes must contribute to the development of motor skills, severity of seizures, cognition, growth and obesity.








55


A.
A B CD EFGH JK

1 2 3 4 5 6 7 8 9 10 11 12 13 15 16

B.

Site Gene Mutation Predicted Protein Inheritance Patient A G648A C21Y Maternal AS179P
B 980 del 2 frameshift Maternal AS181P1
B 980 del 2 frameshift Maternal AS181 P2
C 1522 del 2 frameshift Maternal AS180P1
C 1522 del 2 frameshift Maternal AS180P2
D 1521 del A frameshift de novo AS106P
E C1835T R417X de novo AS178P
F 1930 del 2 frameshift Maternal AS141P
G C2030T R482X de novo AS194P
H A2033T R483X Maternal AS169P1
H A2033T R483X Maternal AS169P2
H A2033T R483X Maternal AS169P3
H A2033T R483X Maternal AS169P4
J 3092 del A frameshift de novo AS101P
K 3093 del 4 frameshift de novo AS1 52P




Figure 3-1. UBE3A mutations in AS patients from the UF repository. A) Genomic organization of UBE3A. UBE3A spans 120 kb of genomic DNA. Gene is shown to scale. Exons (E[]) are numbered numerically from 1-16. Translation (ATG) initiation sites are depicted. The primary translation initiation site begins in exon 8. The location of each mutation is indicated by a letter (A-K). B) Description of mutations. The mutation from each family (A-K) is shown in column 2. Column 3 describes the predicted protein changes, while column 4 shows the inheritance of the mutation.








56



A.
B(2)N B G(5)
GG

1 7 8 9 10 15 16
N N Antisense Transcript
-2.7 kb E 10 kb a
Probe
B. C.
PBL AS Brain Germ Cells
E NL A P FOcCSxNBT S OvOv- kb Class V AS Patients


2 7- 0
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23








Figure 3-2. DNA methylation analysis of 5' UBE3A. A) Genomic structure of UBE3A and the 5' CpG island (0.5 kb black bar) drawn to scale. Selected restriction enzyme sites are shown: Eco RI (E), Not I (N), BssH II (B), Eag I
(G). The location of the 2.7 kb Not 1-Eco RI probe is shown, as is the position of the 5.1 kb Eco RI fragment that surrounds the CpG island. The extent of overlap of the antisense transcript is also shown. If the CpG island is methylated, the 2.7 kb probe wilL hybridize to a 5.1 kb fragment on genomic DNA digested with Eco RI and Not I. If the CpG island is unmethylated, the probe with hybridize to itself, revealing a 2.7 kb fragment. B) Southern blot of normal (NL), AS (A) and PWS (P) genomic DNA from peripheral blood leukocytes (PBL); frontal cortex (F), occipital lobe (Oc), cerebellum (C) and coronal section (Sx) from AS brain; frontal cortex from normal brain; adult testis (T); sperm (S); and fetal ovary (Ov) digested with Eco RI and Not I. DNA from normal PBL was also digested with Eco RI alone as a control (E). When digested with Eco RI and Not I, the
2.7 kb probe only hybridized to a 2.7 kb fragment, indicating that the CpG island was unmethylated. C) Southern blot of PBL genomic DNA from Class V patients digested with Eco RI and Not I reveals that the UBE3A CpG island is unmethylated in all patients.










57



Ln
c .


E
0
76
0- LO j
E 4
o B
Ln on
cz 0
4- cu
cz -0
0 m E c 4" "W U
0 E 4U j d
-&- CY) Qj -0
0-0-0. cz 0 -0 w
0 0 4

W 4- 0 E X 4-J M U
U) 7F Z CL
70 -a U) LLJ (o u =3 a)
U) IE5 E
(D a) (D a) Q;
> am 0
E E E u a) L'I
as cz cd Cd o E
0 E
4 E 0 4-j
E
0 4-J -0 Q) 0-0- = 0 CJ M
Ln iz
E
Ln CZ
or-- U0 M
(u
LA .- =3
4-1
0
Uj 4-J
LA
(D
4-J
-T Ln 0', co < 4-J Q) C:
c m E. 0 co
0 C r U I -,
0 0 o .0 45 c: X,
E 4- 0 'Z 4-1 C: 0
a) ro
U) o E
o (D
E cu
cz 0 4-J > 4-J
-I.- 4--J 'Z Q) = 0
-0 co
E E E 4-J
cz cz E cz = _C 4-J U
ro E 3: -0
c- LL
(3) = : -C r,
0 CL 0 u 0
0 U) CO -Z
4 c cu 0) .LO VI Z3 4-J
CL 0 4- fo
4- 0 .0 0 0 z 0 c C)- -0 U
0 c .- c
4-1 >
-z 0
CL -Z
.r (a C: U U Q)
E tcn: 2 u -o 4-) ce) =3 CO 4-J 0


06
0 0
E X
on 0 E
>, CO I
LZ 4- V) 4-1












58


U




w u E~ W
on 4

o
(U) M~ E EOi M_ U 4-1 > .- 0c 4a-1 4-1 ;
0 V) 4





4--J Ln Ln =C>


0t E


0 75 -,-0 CUi< 0 U, (


-J 4


0 c





00
Z LA


4.

0~ o uco CO
Li- .- u9 '


C o a)) on> CO C




4 fl o 4___ _o_ Ln u~

8~S o o ) V


4- (



(U U
















DNA METHYLATION AND EXPRESSION ANALYSES OF UBE3A IN THE HUMAN BRAIN


Introduction


The Angelman (AS) and Prader-Willi (PWS) syndromes, two distinct neurobehavioral disorders, are the best-studied examples of genomic imprinting in humans. AS is characterized by severe developmental delay, a profound speech impairment, as welt as AS-specific movement and behavioral disorders (Williams et al., 1995b). In stark contrast, patients with PWS initially present with infantile hypotonia and failure to thrive. However, by 18 to 36 months of age, individuals with PWS display several unique characteristics including mild to moderate mental retardation, early onset obesity caused partially by hyperphagia, an obsessive-compulsive disorder, and hypogonadism (Holm et al., 1993). In these very different imprinted disorders, the parental origin of the chromosome 15 abnormality determines the phenotype. PWS occurs from the lack of critical paternally expressed 15q11-13 sequences, while multipLe mechanisms that disrupt the maternally inherited E3 ubiquitin protein-ligase gene (UBE3A) cause AS.

In the AS/PWS imprinted domain, at least nine known genes and several newly identified imprinted transcripts have been shown to be expressed exclusively from the paternal allele (Dittrich et at., 1993; Driscolt et at., 1992; Glenn et al., 1996; Gray et at., 1999; Jay et at., 1997; Jong et at., 1999; Kubota et at., 1996b; Lee and Wevrick, 2000; Rougeulle et at., 1998; Sutcliffe et al., 1994). These genes include MKRN3, MKRN3-AS, MAGEL2, NDN, SNURF-SNRPN, IPW and the UBE3A antisense transcript.

59







60

With the exception of IPW, all of these genes exhibit imprinted expression in all tissues examined (Lee and Wevrick, 2000). Only the Ange.man gene, UBE3A, demonstrated preferential expression from the maternal allele, which was limited to the brain (Albrecht et at., 1997; Nakao et a[., 1994; Rougeutle et at., 1997; Vu and Hoffman, 1997). Studies in mice revealed that imprinted expression of Ube3a was cell-specific, as whole mouse brain failed to show maternal-only transcription (Sutcliffe et at., 1997). Further experiments revealed that complete imprinted expression of Ube3a was limited to the CA2 and CA3 regions of the hippocampus, mitral cell layer of the olfactory bulb and purkinje celts in the cerebellum (Albrecht et at., 1997). However, other brain regions demonstrated biased transcription from the maternal allele.

The promoter regions of imprinted genes show differential methylation based on the parental origin of the chromosome (Razin and Cedar, 1994). In the 5' region of imprinted genes, the repressed, maternal alleles are heavily methylated, while the expressed, paternal alleges are undermethylated. DNA methylation of promoter regions is closely associated with transcriptional repression and has been shown to inactivate tumor suppressor genes, while demethylation of promoters can lead to activation of proto-oncogenes (Baytin et al., 1998; Feinberg, 2000; Tycko, 2000). In addition, demethyLation has been shown to occur in Long-term cell culture, reactivating the maternal alleles of SNRPN and MKRN3 (Saitoh and Wada, 2000). Several paternal-only expressed genes within the AS/PWS imprinted domain display parent-of-origin DNA methylation imprints in peripheral blood leukocyte (PBL) DNA (Boccaccio et a[., 1999; Driscoll et at., 1992; Glenn et al., 1996; Jay et at., 1997; Jong et at., 1999; Kubota et aL., 1996a; Lee et at., 2000; Sutcliffe et al., 1994). However, when we examined the CpG island at 5' UBE3A we found no evidence for a DNA







61

methytation imprint in DNA derived from PBL, brain tissues or germ cells (Lossie et at., in preparation). Both the maternal and paternal alleles were completely unmethylated, even in tissues that had previously revealed imprinted expression of UBE3A.

DNA methylation analyses of the paternally expressed genes suggested that methytation of the promoter regions on the maternal altetes was responsible for imprinted expression. However, no DNA methylation imprint has been shown to exist at UBE3A. Therefore, we wanted to test whether specific cell types in the human brain demonstrated imprinted expression of UBE3A and determine if some of these imprinted tissues also demonstrated DNA methylation imprints at the CpG island located in the promoter of UBE3A.


Materials and Methods

Human Subjects and Tissue Samples

All patients with AS and PWS were deletions with a classical phenotype (Holm et at., 1993; Williams et at., 1995a). Tissues from patients with AS were obtained from the University of Florida Brain Bank, white tissue samples from the PWS and control subjects were obtained from the University of Miami Brain Bank (1889, 1199, 2144 and 2803). These studies were approved by the institutional review board at the University of Florida and informed consent was obtained from alt patients and/or parents.


RNA Isolation

Formalin Fixed Paraffin Embedded Samples (FFPE). On day one, tissue sections were deparaffinized in subsequent 15 min. xylene washes of 5 and 2 ml at 37C. Each wash was followed by centrifugation at 10,500 g for 15 min and removal of






62

supernatant. Xylenes were removed by two 100% ethanol washes (5 and 2 ml) at 37C for 30 min. each. A 30 min. centrifugation step at 10,500 g followed each ethanol wash. Pellets were dried briefly before the addition of 2 ml RNA lysis buffer (0.2 M Tris-HCI, pH 7.5, 0.2 M NaCt, 1.5 mM MgCL2 and 2% SDS) and 100 p1 Proteinase K (10 mg/ml). Samples were homogenized with a tissumizer, and incubated at 42'C overnight. Another 0.5 ml of RNA lysis buffer and 100 pl of Proteinase K were added each day for 3 successive days. Nucleic acids were purified by phenol/chloroform extraction and ethanol precipitated. Genomic DNA was removed by DNase I (Roche) digestion. Five pg of total nucleic acids were incubated at 37C with 100 U of DNAse I for 60 min. in 1X PCR buffer (Roche), purified by phenol/chloroform extraction and ethanol precipitation.

Fresh Frozen Tissues. RNA was isolated from fresh frozen tissues according to established protocols (Chomczynski and Sacchi, 1987). RT-PCR

cDNAs (total, UBE3A and UBE3A antisense) were generated from 250 ng of fresh frozen and FFPE total RNA according to standard procedures (Life Technologies) using either random hexamers or previously published primers (Rougeulle et at., 1998). PCR products from UBE3A, the UBE3A antisense transcript, SNURF-SNRPN and the transferrin receptor (TR) were amplified, size fractionated by gel electrophoresis, blotted and hybridized with one of the primers used for PCR. PCR primers from exons 13 and 14 and exon 16 were used to amplify UBE3A and the UBE3A antisense transcript, respectively (Lossie et alt., in preparation). SNURF-SNRPN primers from exons 1-3 (previously -1 to 1) have been previously published (Glenn et at., 1996). Primers were designed to amplify a 299 bp product from the TR, to control for transcript levels. The forward primer, which starts at nucleotide 346, is 5'-GCTACTTG







63

GGCTATTGTAAAGGG-3', while the reverse primer is 5'-ACGCCAGACTTTGCTGAGTT-3' and ends at nucleotide 644 of the TR. One primer from each PCR reaction was labeled by kinasing (Promega) 400 ng in a standard reaction containing 40 pCi 32P ydATP (Amersham). Labeled primers were hybridized to Southern blots of PCR products overnight at TH in 6 X SSCP, 0.1% SDS, 1 X Denhardt's and 20 mg/ml single stranded salmon sperm DNA. TH is Tm minus 5*C. the oligo in 2 X SSCP; 0.1% SDS. Excess probe was removed by two 15 min. washes in preheated, freshly prepared hybridization buffer. Products were visualized by autoradiography. DNA Methylation

Methylation Specific PCR. Sodium bisutfite treatment of genomic DNA from fresh frozen tissues and subsequent methylation analysis of SNRPN was done according to previous protocols (Kubota et al., 1997; Lossie and Driscoltt, 1999). Two sets of primers were designed to assess the methylation status of both Not I sites in the UBE3A CpG island. At the proximal end of the CpG island (more 5') the primers are as follows: methylated primer set (M1F 5'-CGTCGCGGTCGCGAGATT-3' and M1R 5'ACGCGCCGAATCGACAAAA), unmethylated primer set (U1F 5'-GTGTTGTGGTTGTGAGAT TTGTG-3' and U1R 5'-ACAAACACCCACACTAACAAATAACT-3'). The primer sets that amplify the distal CpG island are as follows: methylated primer set (M2F 5'-GATAGGTA GCGGCGGTTGGCGACGAA-3' and M2R 5'-GCGCCTAAACTACGACGACCGCCTCA-3', unmethylated primer set (U2F 5'-GAATGTTGGGATTTTGGTGGT-3' and U2R 5'AAACTACAACAACCACCTCACTAATCA-3'). PCR products were stained with ethidium bromide and visualized on an Eagle Eye II photodocumentation system (Stratagene).

Southern Analysis. Southern analysis of SNRPN and UBE3A were performed according to published protocols (Glenn et al., 1993b; Lossie et al., in preparation).







64

Results


UBE3A Does Not Demonstrate a DNA Methylation Imprint

In our previous analysis of the different classes of Angelman syndrome patients, we demonstrated that UBE3A was unmethylated in all tissues examined, including four distinct regions of the human brain (Figure 3-2). Interestingly, one region, frontal cortex, had previously been shown to demonstrate imprinted expression of UBE3A. We developed a novel PCR based assay to assess the DNA methylation status of UBE3A by sodium bisulfite.

We designed four sets primers to amplify the proximal and distal regions of the UBE3A CpG island (Figure 4-1A). At both the proximal and distal ends of the CpG island, PCR products were only generated from the unmethytated primers in all AS, PWS and control samples (Figure 4-1B). A PCR product from the methylated primers was amplified in cosmid DNA treated with Sssl CpG methylase (Figure 4-1B). As a control, the same brain tissues were assayed for methylation status at 5' SNRPN (Figure 4-1C). In the AS brain tissues, only the unmethylated SNRPN alleLe was amplified, while only the methyLated allele was amplified in PWS brain samples. Both alleles were present in control samples.


Expression Analysis of UBE3A and the Antisense Transcript in the Brain

To date, the only region of the human brain proven to show imprinted expression of either UBE3A or the antisense transcript is the frontal cortex (Rougeulle et at., 1997). However, mouse studies suggest that other distinct regions of the human brain may also demonstrate imprinted expression of UBE3A (Albrecht et a[., 1997). We examined imprinted expression of UBE3A, the antisense transcript and SNURF-SNRPN in brain tissues from AS, PWS and control individuals.






65

We assessed imprinted expression of UBE3A and the antisense transcript by strand-specific RT-PCR (Figure 4-2A). Three cDNA pools were generated from each 250 ng total RNA sample: total cDNA derived from random hexamers, UBE3A sense and UBE3A antisense transcripts. SNRPN and the transferrin receptor were amplified from the total cDNA pool. PCR primers from exons 13 and 14 were used to amplify the UBE3A gene, while primers from introns 12 and 14 amplified the UBE3A antisense transcript. UBE3A was predominantly expressed in PWS brain samples (maternal expression), and the UBE3A antisense transcript was predominantly expressed from the paternal allele, as it was observed in AS, but not PWS brains (Figure 4-2B). Prolonged exposure of the UBE3A Southern revealed that UBE3A was expressed at very low levels in atll three AS brain samples. However, SNRPN was only expressed from the AS samples. UBE3A, the antisense transcript, SNRPN and the TR were expressed in cDNA pools from control brains (data not shown).


Discussion

DNA methylation of promoter regions is closely associated with transcriptional repression (Bird and Wolffe, 1999). With the exception of Mash2, and now UBE3A, all well-studied imprinted genes display parent-of-origin methylation imprints (Glenn et at., 1997; Razin and Cedar, 1994; Tilghman, 1999), including atll of the weltcharacterized paternally expressed genes within 15q11-13. The maternal alltteles of MKRN3 (Driscotll et at., 1992), NDN (Jay et al., 1997) and SNURF-SNRPN (Glenn et at., 1996; Sutcliffe et at., 1994) demonstrate preferentially methylation in the promoter regions. In addition, several anonymous CpG sites within the AS/PWS imprinted domain also demonstrate DNA methylation imprints. The best studied of these is PW71 (Dittrich et at., 1993), but several sites within the imprinting center (IC) also demonstrate DNA methytation imprints (Farber et al., 1999). Including SNURF-SNRPN,







66

ten sites within the IC show differential methylation between the parental chromosomes. Nine of these CpGs are preferentially methylated on the maternal

allele.

DNA methylation of the promoter regions of the paternally expressed genes within the AS/PWS imprinted domain correlates well with what is presently known about methylation-induced repression (Bird and Wolffe, 1999). Data from the present study suggest that imprinted expression of UBE3A occurs via a novel mechanism. One possible reason for the lack of a DNA methylation imprint in UBE3A could have been that differential methyLation only occurred in discreet regions of the human brain. However, we would expect that the regions demonstrating imprinted expressed would also reveal a DNA methylation imprint. It is clear from our present studies that no DNA methylation imprint exists at the CpG island at 5' UBE3A in six different brain regions, although some of these tissues demonstrate imprinted expression of UBE3A. Therefore, it is unlikely that repression of UBE3A occurs by DNA methylation at the promoter.

An alternative explanation for imprinted expression of UBE3A stemmed from the discovery of a brain-specific UBE3A antisense transcript (Rougeulle et at., 1998). Examination of frontal cortex from single AS and PWS samples revealed that UBE3A was preferentially expressed from the maternal allele, while the antisense transcript was preferentially expressed from the paternal allele. However, amplification of the 3' UTR revealed biallelic expression of UBE3A using the same AS sample (Lee and Wevrick, 2000). Since strand-specific reverse transcription was not done, biallelic expression was expected in this reaction. It is important to note that both transcripts are expressed at low levels (5-10% ) from the repressed alleges (Rougeulle et at., 1998). The authors postulated that co-expression of UBE3A and the antisense







67

transcript from the same chromosome would result in silencing of the UBE3A gene in cis, accounting for the maternal-only expression of UBE3A in brain.

Given that UBE3A was completely unmethylated in all tissues examined, this was an attractive hypothesis. In order to test this possibility, we analyzed imprinted expression of UBE3A and the antisense transcript in two AS patients (paternal only), two PWS individuals (maternal only) and two normal controls (biparental). Our studies supported this model, revealing that UBE3A was preferentially expressed from the maternal allele in several regions of the human brain including frontal cortex, hippocampus and cerebellum while the antisense transcript was only expressed from the paternal allele.

The lack of a DNA methylation imprint at 5' UBE3A combined with the discordant expression of the UBE3A sense and antisense transcripts suggest that DNA methylation of the promoter region of UBE3A does not account for imprinted expression. Our data support an alternative mechanism of imprinted expression of UBE3A. We believe that expression of the antisense transcript results in repression of UBE3A, in cis. This could occur through multiple mechanisms, which depend upon nuclear localization of the antisense transcript. If the antisense transcript remains localized to the expressed allele, in a scenario similar to Xist, then RNA interference would be a good candidate for repression of UBE3A. However, if the antisense transcript can diffuse throughout the nucleus (e. g. act in trans), an alternative mechanism would have to account for the allele-specific repression. Perhaps expression of the antisense transcript can cause changes in chromatin structure that precludes expression of UBE3A.

Further studies examining DNA methylation and imprinted expression in additional regions of the human brain will help us to better understand the mechanism







68

of imprinted expression of UBE3A, and demonstrate which regions in the human brain are important in the AS phenotype.









69


A. Proximal Distal
Not I Not I
5' 3'
M1F 1-209bp M1R M2F 204bp M2R U1F 166 bp U1R U2F- 175bp -U2R


B.

AS PWS Control
S F B OTeOv F HOvB F H B F H YOv B F H Y BrTeS TeMW
proximal


distal



C.
AS PWS Control
SFBO F H B FH B FHYB FHYAPNLW
bp
174- M

104- P




Figure 4-1. Methylation analysis of brain DNA. A. Scale Map of UBE3A. exon 1. The proximal and distal regions assayed as well as Not I sites are indicated. Primer designations (methylated = M and unmethylated = U) are located below their positions and amplification product sizes are shown. B. Methylation specific PCR at UBE3A. PCR products from the proximal and distal regions are indicated. Brain regions and germ cells are denoted: Coronal section (S), Frontal cortex (F), Cerebellum (B), Occipital lobe (0), Hippocampus (H), Hypothalamus (Y), Brain (Br), Testis (Te), Ovary (Ov) and Sperm (Sp). Cosmid DNA treated with Sss I methylase (M) and water (W) controls are indicated. C. Methylation specific PCR at 5' SNRPN. The maternal, methylated (M) and paternal, unmethylated (P) alleles are shown. Sizes (bp) of each fragment are also indicated. AS, PWS and Control brain regions are the same as above. Control PBL DNAs are also noted: AS (A), PWS (P) and control (NL).








70


A.
UBE3A


3 5 6 1

Antisense transcript
B.
AS Brain PWS Brain
FC CSx FC FC HI FC CB HI
RT- + -+ -+-+ -+ -+ -+-+

UBE3A


UBE3A-AS


SNRPN


TR




Figure 4-2. Imprinted expression of UBE3A in brain. A. Map of UBE3A and the antisense transcript. Relevent exons are numbered. Primers used for RT reactions are designated (*). Remaining primers were used for PCR. B. RT-PCR analysis. Regions of the brain are noted: frontal cortex (FC), Coronal section (CSx), Hippocampus (Hi) and Cerebellum (CB). Primers from exons 13 and 14 were used to amplify UBE3A. Primers from intron 15 and exon 16 were used to amplify the antisense transcript. Exons 1-3 of SNRPN were analyzed. Strand-specific primers were used to amplify UBE3A (4 and 6) and the antisense transcript (3). The transferrin receptor (TR) was used as a control.
















CONCLUSIONS AND DISCUSSION


The past six years have seen very exciting developments occur in Angetman syndrome research. Since early 1997, the field has progressed at a very fast pace. During the past four years, the AS gene (UBE3A) has been cloned (Kishino et at., 1997; Matsuura et at., 1997). Within seven months of the report of mutations in UBE3A in several AS patients, imprinted expression of UBE3A was demonstrated in human and mouse brain (Albrecht et at., 1997; Rougeutle et aL., 1997; Vu and Hoffman, 1997). Angetman syndrome was the first human disease shown to be caused by mutations in the ubiquitin pathway, and has paved the way for the cloning of additional disease genes, including the discovery of mutations in another E3 ligase in the non-agoutiLethal a18H mouse (Perry et at., 1998). This mouse displays the itchy phenotype, characterized in part by constant itching due to hyperplasia of the forestomach epithelia, and revealed that the ubiquitin pathway was critical for immune response. Several new genes and transcripts have bseen Localized to the AS/PWS domain (Lee and Wevrick, 2000), including an antisense transcript was found to overlap the 3' end of UBE3A (RougeuLLe et at., 1998). Five mouse models of AS have also been generated to help in the study of the mechanisms of imprinted expression of UBE3A (Cattanach et at., 1997; DeLorey et at., 1998; Gabriel et at., 1998; Jiang et at., 1998; Johnson et at., 1995). Analyses of AS and PWS patients have demonstrated that the imprinting center (IC) consists of separate AS and PWS domains, although the mechanisms of imprinted expression of the maternal and paternal genes has yet to be discovered.



71







72

In addition to these discoveries, my research has revealed several new findings. During the study of one of our AS deletion patients, we discovered that female AS patients have the ability to reproduce (Lossie and Driscoll, 1999). This important discovery has serious implications for families and caretakers of AS patients, and implies that social cognitive behaviors, not physiological defects, prevent most AS patients from reproduction. Studies of the different molecular classes of AS have revealed multiple new findings. I have shown that there are five molecular classes of AS, but four phenotypic AS groups (Lossie et al., in preparation). This research has also revealed that the fifth class of AS patients has a more severe phenotype than the UPD, ID or UBE3A mutation patients, implying that multiple genes may be disrupted in these patients. I have examined several regions of the brain, but found no evidence of a DNA methylation imprint associated with UBE3A. Out of all of the _> 35 known imprinted genes, Mash2 is the only other known transcript without a DNA methyLation imprint (TiLghman, 1999). In addition, my RT-PCR analyses of UBE3A and the antisense transcript suggest that imprinted expression of UBE3A is regulated in cis by the antisense transcript, suggesting that a novel mechanism underlies imprinted expression of UBE3A in the brain.


Molecular Classes of AS

Results of my analysis of AS patients from the University of Florida repository demonstrates that five major molecular mechanisms cause AS: Class I) 4 Mb maternally inherited deletions of 15q11-13; Class II) paternal uniparental disomies (UPD); Class III) imprinting defects (ID); Class IV) patients with intragenic mutations in UBE3A; and Class V) patients with no known defects.







73

Class I Patients

The advent of high resolution chromosome analysis in the Late 1980s allowed the Localization of the AS gene to human chromosome 15 by the detection of 3-5 Mb interstitial deletions of 15q11-q13 in several AS patients (Kaplan et at., 1987; Magenis et at., 1987). Initial observances indicated that the AS deletion was identical to that seen in Prader-Witti syndrome. However, evidence soon indicated that in Class I AS patients, the deletion was always maternally inherited (Knoll et at., 1989; Zackowski et at., 1993), white PWS deletions were always of paternal origin (Butter et at., 1986; Knott et at., 1989).

Deletion patients have the most severe phenotype and represent a contiguous gene disorder, with haploinsufficiency of several non-imprinted genes along 15q11-13 exacerbating the phenotype. Some striking differences between Class I individuals and the other patients are the frequency and severity of seizures. All Class I patients have seizures, and 90% have recurring bouts of epilepsy. The most obvious genes affecting seizures in deletion patients are the three GABA receptors, which are located about 2 Mb distal to UBE3A. Mice with null mutations in Gaba3 recapitulate several of the AS characteristics, including balance abnormalities, seizures, abnormal EEG patterns, steep disturbances and learning defects (DeLorey et at., 1998). However, mice heterozygous for the disruption have wild type features. It would be interesting to study the phenotype of mice with disruptions in all three GABA receptors. In addition to seizures, most deletion patients are hypopigmented, microcephalic and have poorly developed motor skills.


Class II Patients

Uniparental disomy of chromosome 15 also occurs in both syndromes-maternal UPD in PWS (Class II; (Mascari et at., 1992; Nicholls et at., 1989) and paternal UPD in







74

AS patients (Class 11; (Malcolm et at., 1991; Nicholls et at., 1992). The identification of AS patients with UPD of chromosome 15 conclusively demonstrated that AS was an imprinted disorder, as absence of the maternally derived 15q11-13 chromosomal region resulted in the Angelman syndrome phenotype.

In the UF patient repository, 7 % of patients had paternal UPD for chromosome 15 (Lossie et at., in preparation). Hypopigmentation only occurred in 20% of UPD patients, and Less than 15% of UPD patients suffered from recurring episodes of epilepsy or microcephaly. In addition, 96% of Class 11 patients could walk by five years of age, twice the frequency observed in deletion patients. These patients had a much less severe phenotype than the deletion patients, indicating that twofold expression of the paternal-only genes may be ameliorating the AS phenotype. Class III Patients

A third subset of AS and PWS patients (ID patients) have mutations in the mechanism(s) involved in the imprint process. Mutations and spontaneous defects in the imprinting center (IC) cause the maternal chromosome to adopt a paternal epigenotype along 15q11-13, with these individuals having paternal DNA methylation and expression imprints (Glenn et at., 1993a; Reis et at., 1994). About 50% of Class III AS patients have detectable micrddeletions in the imprinting center. The remaining Class III AS patients have no detectable mutations, but show an AS epigenotype across the 2 Mb imprinted domain (Buiting et at., 1998). Recently the AS smallest region of overlap (SRO) for the IC region has been narrowed to 0.9 kb, while the PWS-SRO in the IC has been narrowed to 4.3 kb (Buiting et al., 1999).

Although they a different molecular mechanism causes AS in IC and UPD patients, statistically the two classes have indistinguishable phenotypes. This







75

observation demonstrates that the only imprinted domain on chromosome 15 is the AS/PWS region.


Class IV Patients

Several patients have biparental inheritance of chromosome 15 with normal DNA methyLation at several Loci within the AS/PWS imprinted domain. Mutation analysis of UBE3A, revealed protein truncating mutations in several AS individuals (Kishino et at., 1997; Matsuura et at., 1997). Mutation analysis of UF patients revealed the existence of five molecular classes, as only 44% of sporadic patients with normal methylation had intragenic mutations within UBE3A (Lossie et at., in preparation). Mutations, which were mostly protein truncating, were found throughout the coding region, with clusters in the HECT domain and in exon 9.

As a group, UBE3A mutation patients achieve developmental milestones faster, are more likely to follow simple commands, have less severe seizures that begin at a later age and are heavier than deletion patients. However, unlike UPD and ID patients, individuals from Class IV tend to have a higher incidence of significant or recurring seizures and often display microcephaly. Moncla and colleagues (1999b) examined Class IV patients individually for head circumference and seizures. They also concluded that UBE3A mutation patients had high incidences of seizures and microcephaly.


Class V Patients

Previous studies showed that the majority of patients with normal DNA methyLation do not have detectable abnormalities on chromosome 15 (Fang et al., 1999; MaLzac et at., 1998). In UF patients, about 10 % of all classical AS patients fall into this group. Not much is known about the etiology of AS in these patients. It has







76

been postulated that they have mutations in other genes in the ubiquitin pathway or in UBE3A substrates. Alternatively, they could have disruptions in other 15q11-13 genes that interfere with UBE3A expression.

Class V patients are very interesting. They were not significantly different from deletion patients across several phenotypic categories. Class V patients have normal height, weight and BMI distributions, similar to that observed in Class I patients. They also typically present with a complete absence of speech, early onset of seizures, hypopigmentation and microcephaly. However, Class V patients walk about two years earlier than deletion patients, and their seizures are less likely to be recurring or as severe as those observed in patients from Class 1. Since Class V patients tend to have a more severe phenotype than that observed in Classes II, 111 and IV, it is likely that disruption of more than one gene is causative of AS in these patients. That they closely resemble UPD, ID and UBE3A mutation patients in their type and severity of seizures indicates that UBE3A may also be disrupted in these patients. Class V patients also had a higher frequency of hypopigmentation compared with Classes 11, 111 and IV. Maybe these phenotypes can yield clues as to the mechanism(s) involved in the pathogenesis of AS in these individuals.


Genotype-phenotype Correlations among the Five Classes of AS

Several articles in recent literature have compared the phenotypes associated with patients from Classes 11 and III with Class I individuals (Burger et al., 1996; Fridman et at., 2000b; GilRessen- Kaesbach et al., 1999; Saitoh et aL., 1997; Saitoh et al., 1999; Trent et at., 1997). However, extensive genotype/ phenotype correlations among the first four classes of AS patients has been limited (Moncla et at., 1999b), and no studies have examined the phenotype associated with Class V patients.







77

Genotype/ phenotype analyses of our patients revealed that all 5 classes of patients had the four cardinal features of AS: severe developmental delay and/or mental retardation; severe speech impediment; an unsteady, ataxic gait with uplifted hands; and the characteristic happy affect. Furthermore, some Classes have additional characteristics that are often associated with the Angelman syndrome, such as seizures, microcephaLy and hypopigmentation. Our statistical models demonstrated that distinct phenotypic differences occur amongst the molecular classes. The five classes of patients can be separated into four phenotypic groups: Class 1, Classes 11 and 111, Class IV, and Class V. Overall, Class I patients are the most severely affected, while Classes 11 and III are the Least. Classes IV and V differ from each other at several criteria, but fall between Class I and Classes 11 and III in severity. Multiple clinical distinctions can be made between the classes, with differences most striking in pigmentation; growth parameters; achievement of developmental milestones; and severity, frequency and age at onset of seizures.

Our data indicate that Class I patients comprise a contiguous gene disorder, with haploinsufficiency of multiple genes exacerbating the lack of the maternally expressed UBE3A gene. Patients in Classes 11 and III have the Least severe and most atypical phenotype, suggesting that a double dose of the paternal.-only expressed genes may be ameliorating the AS phenotype in UPD and ID patients. Alternatively, the more severe phenotype associated with UBE3A mutation patients could indicate that haploinsufficiency of UBE3A may be detrimental during development and into adulthood. Additionally, UBE3A protein levels may be tightly regulated in the central nervous system and peripheral tissues. It is Likely that a combination of the double dose of the paternally expressed genes and hapLoinsufficiency of UBE3A both







78

contribute to the differences in phenotype observed between Classes II and III and Class IV patients.

Of all four non-detetion classes, the patients with no detectable chromosome 15 abnormality most closely resemble Class I patients. Perhaps Class V patients have a mutation in an upstream gene on 15q11-13 that affects not only UBE3A, but also additional genes that give rise to a more severe AS phenotype in these individuals. A good candidate gene would be the UBE3A antisense transcript. Alternatively, Class V individuals may have mutations in other genes in the ubiquitination pathway. Since the phenotype is severe, we would predict that the mutation would be in a gene that controlled the degradation of multiple proteins.


What is the Epigenetic "Mark?"

Imprinted genes display several distinguishing characteristics: differential methylation and allele-specific expression patterns between the maternal and paternal alleges, the presence of non-coding and/or antisense RNA transcripts, asynchronous DNA replication timing, GC rich sequences, and direct repeats (Glenn et at., 1997; Razin and Cedar, 1994; Sleutels et at., 2000). In addition, genomic imprinting can impart transcriptional changes in a single gene or alter expression patterns of groups of genes across tevera[ megabases (Mb; Glenn et at., 1997). Recent attention has focused on determining the mechanism that establishes the epigenetic mark, or imprint, between the maternal and paternal alleges. Multiple mechanisms have been proposed to perform this tagging, including DNA methyLation, chromatin structure, cis-acting elements and DNA replication timing. Human and murine studies indicate that the mechanisms involved in imprinting must be able to: 1.) Set the imprint in the gametes; 2.) Maintain this epigenetic modification in somatic tissues; 3.) Alter the expression or repression of imprinted genes and 4.) Erase the imprint







79

during gametogenesis and reset it according to the sex of the offspring (Driscolt, 1994).


DNA Methylation

DNA methylation is a good candidate for the establishment and maintenance of the imprint. After replication, hemi-methyLated DNA is recognized by the maintenance DNA methyltransferase protein, which methyLates the daughter strand, propagating the methyLation status of the allele. Driscoll et al., (1992) were the first to propose DNA methylation as a diagnostic tool for identifying imprinted genes. With the exception of UBE3A and Mash2, all imprinted genes display differential methylation sites that show parent-of-origin methylation imprints (Glenn et at., 1997; Razin and Cedar, 1994; Tilghman, 1999). Targeted disruption of the DNA methyltransferase gene (Dnmtl) in mice provided initial evidence for the role of DNA methylation in genomic imprinting (Li et al., 1993). Inactivation of Dnmtl repressed the normally active Igf2r, Igf2 and Kvlqtl alleles and activated the repressed copies of the H19, Xist, Cdklc and Snrpn genes (Caspary et al., 1998; Li et aL, 1993; Shemer et al., 1997). In order for DNA methylation to be accepted as an "imprinting mark," one must identify imprints that are established in the germ line and maintained somatically during and after development. In addition, these tags should escape the global wave of demethyLation that occurs during early embryogenesis (Brandeis et al., 1993; Szabo and Mann, 1995; Tada et at., 1997). To date, gametic imprints have been identified in five genes: SNRPN (human and mouse), MKRN3, Igf2r, H19 and Gnas (Glenn et al., 1996; Jones et at., 1996; Jong et al., 1999; Liu et at., 2000; Shemer et at., 1997; St6ger et at., 1993; Tremblay et at., 1995). My studies demonstrated that DNA methylation was not responsible for imprinted expression of UBE3A, as no methylation imprint was found in any tissue (Lossie et al., in preparation).







80

Cis-acting Elements

In addition to primary DNA methylation imprints, other cis-acting elements can be found in multiple imprinted regions. These elements often have tong-range effects, and differential DNA methylation appears to be a common factor in these cisacting elements. For example, within the 2 Mb imprinted domain on human chromosome 15q11-13, the Prader-Witli syndrome imprinting center (PWS-IC) controls the establishment and maintenance of imprinted expression of the paternally expressed genes along the entire imprinted domain (Bietinska et at., 2000). Additional studies from this region indicate that there is also a separate Angelman syndrome imprinting center (AS-IC) that potentially works in the same manner on the homologous chromosome (Buiting et at., 1995; Farber et at., 1999; Saitoh et at., 1996). Similar imprinting centers have also been identified in the Igf2/H19 imprinted region on mouse chromosome 7C (Birger et al., 1999; Hark et at., 2000; Khosla et at., 1999; Sasaki et at., 2000; Szabo et al., 2000). It will be interesting to determine if patients with mutations in the PWS IC (PWS ID patients) or AS IC (AS ID patients) express the UBE3A antisense transcript.


Chromatin Structure

Although it is evident that DNA methyLation plays an important role in the establishment of the primary imprint, other factors are probably in the allele-specific repression. Several experiments have demonstrated a significant correlation between DNA methylation at CpG islands and transcriptional silencing (Ng and Bird, 1999). Experiments using the herpes simplex virus thymidine kinase (HSV TK) gene gave the initial clues that DNA methylation could be tied to chromatin structure (Buschhausen et at., 1987). When naked DNA (methylated or unmethylated) was microinjected into rodent cells, it took over eight hours for HSV TK to be silenced in cells containing






81

methylated DNA. However, when in vitro assembled chromatin was introduced, HSV TK was inactive. Recent studies have been able to intimately connect DNA methylation with chromatin structure (Ng and Bird, 1999). The discovery that the CpG binding protein, MeCP2, bound DNA in a methylation-dependent mechanism and inhibited transcription gave the first clues that the two processes were linked (Nan et at., 1997; Nan et at., 1996). Subsequent experiments by several groups revealed that the transcriptional repression domain of MeCP2 recruits Sin3A and the histone deacetyLase complex, inducing histone deacetylation and transcriptional silencing (Ng and Bird, 1999).

Identification of a gene that shows differential chromatin structure between the maternal and paternal aleles in the context of DNA methytation and expression imprints would provide good evidence of a connection between DNA methytation, chromatin structure and imprinted expression. In vivo chromatin studies revealed that the unmethyLated expressed alleles of Snrpn, H19 and U2afl-rsl were hypersensitive to in vivo nuctease digestion, insinuating that a DNA methyLation imprint was linked to an open chromatin conformation (FeiL et at., 1995; Hark and Tilghman, 1998; Khosta et aL., 1999; Schweizer et at., 1999; Shibata et at., 1996; Szabo et at., 1998). In addition, analysis of histone acetyLation by chromatin immunoprecipitation demonstrates that the inactive alleles of I/f2 and H 19 (maternal and paternal, respectively) are enriched for hypoacetylated histones, a hallmark of repressed genes (Pedone et al., 1999).


DNA Replication Timing

Another potential candidate for the imprinting signal is DNA replication timing. The maternal and paternal homoLogues of most genes replicate synchronously during S phase of the cell cycle (Glenn et at., 1997). In contrast, the homologous gene regions







82

of imprinted domains have been shown to replicate asynchronously, with the paternal allele usually replicating earlier than the maternal homologue (Argyriou-Tirita et al., 1996; Izumikawa et at., 1991; Kitsberg et at., 1993; Knoll et at., 1994; LaSalle and Lalande, 1995; Lin et al., 1995; Simon et at., 1999; Smrzka et at., 1995; White et al., 1996; Wutz et al., 1998). Further analysis of the imprinted 15q11-13 domain has shown a homologous association between the maternal and paternal homologues in normal lymphoblast cell Lines (LaSalle and LaLande, 1995). However, asynchronous DNA replication timing does not appear to correlate with changes in imprinting of IGF2 or H19 in patients with Beckwith-Wiedemann syndrome (Squire et at., 2000). In addition, asynchronously replicating domains often extend past the imprinting clusters (Glenn et at., 1997).


Models for Imprinted Expression


In an intriguing model brought upon by studies of the mouse Aprt locus, Turcker has postulated that CpG islands themselves are targets for de novo methylation, probably by a Dnmt3 or Dnmt3a methyltransferase (Turker, 1999). After the initial methylation at discreet foci, regional methylation of a CpG island would spread bidirectionally through maintenance methylation, a replication-dependent process requiring Dnmtl. The methylation status of the CpG island would remain in flux; methyLation would compete with demethylation to produce a stable methylation pattern. Other recent experiments have led (Antequera and Bird, 1999) to propose a mechanism for why CpG islands are often found at gene promoters. They believe that CpG islands serve dual routes, acting both as origins of replication and as promoters for genes that are active at totipotent stages of development. If these models from nonimprinted loci prove true in imprinted regions, then DNA methylation could be the







83

epigenetic mark of imprinted genes, linking DNA replication, chromatin structure, cisacting elements and imprinted expression.

Several models have been proposed for the function of the IC. The first model proposed that the paternal component of the IC (PWS-IC) controlled the maternal to paternal epigenotype switch, while the maternal component of the IC (AS-IC) regulated the paternal to maternal switch (Dittrich et at., 1996). However, this model requires activation of the maternal allele during gametogenesis. Although no maternal expression has been detected in fetal brain or lung, fetal oocytes and primordial germ cells have not been examined (Buiting et al., 1999). It is possible that the IC contains germ cell-specific transcripts that are maternal in origin.

In an alternative explanation, the PWS-IC regulates expression of the paternally expressed genes in 15q11-13, white the AS-IC represses activation of the PWS-IC (Figure 1-41; Brannan and BartoLomei, 1999). On the paternal chromosome, the PWSIC activates transcription of the paternally expressed genes along the 2 Mb imprinted domain, which includes the UBE3A antisense transcript (Figure 1-4A, B). Patients with mutations in the PWS-IC would fail to activate paternal gene expression, causing PWS. In oogenesis and somatic tissue, the AS-IC represses the PWS-IC, silencing the paternally expressed genes. AS patients with imprinting defects would fail to inactivate the PWS-IC, causing biallelic expression of the paternal-only genes. One prediction of this model would be that UBE3A would only demonstrate imprinted expression in tissues where the UBE3A antisense transcript was concurrently expressed. In support of this model, the UBE3A antisense transcript is only expressed in brain, the one tissue that demonstrates imprinted expression of UBE3A (Rougeulle et at., 1998; Rougeulle et al., 1997). In addition, recent experiments demonstrated that UBE3A was preferentially expressed from the maternal alLeLe, white the antisense







84

transcript was preferentially expressed from the paternal a[lele in several regions of the human brain (Lossie et al., in preparation). A second prediction of this model is that an IC deletion on the maternal chromosome that extended from the AS-IC through the PWS-IC would not give an AS phenotype because the paternally expressed genes would not become activated, due to a lack of a PWS-IC. In agreement with this model, none of the AS-IC deletion patients deletes the PWS-IC.

My preliminary experiments suggest that the antisense transcript plays a role in the regulation of imprinted expression of UBE3A. One possible mechanism for this regulation would be through RNA interference due to double stranded RNA interactions. In order for this mechanism to apply, the antisense transcript must not be able to diffuse throughout the nucleus. If it could, then both the maternal and paternal atleles of UBE3A would be repressed. If the UBE3A antisense transcript does diffuse throughout the nucleus, then changes in higher order nuclear structure could be a mechanism for imprinted expression of UBE3A. It is possible that the nuclear localization of UBE3A is different in brain than other tissues. This localization could set up epigenetic differences in chromatin structure on the maternal and paternal chromosomes, provide different microenvironments for distribution of transcription factors and ultimately result in preferential expression from the maternal allele in brain.

Interestingly, PWCR1, a small nucLeoLar (sno) RNA has been mapped within 1 Mb of UBE3A (de Los Santos et al., 2000). Like most of the genes within the AS/PWS domain, PWCR1 is preferentially expressed from the paternal allele and is expressed at high levels in brain. Within a 50 kb stretch at the PWCR1 locus, 25 copies of genes with high homology to PWCR1 are found. It is possible that the presence of these and/or other noncoding RNAs are responsible for establishing precise nuclear







85

architecture. This would not be surprising, since noncoding RNAs and antisense transcripts appear to play a major roll in epigenetic gene silencing. For example, the noncoding Tsix transcript, which is also antisense to Xist, has been shown to be involved in the epigenetic regulation of X-inactivation (Lee et at., 1999a). In addition, the roX RNAs have been shown to facilitate the male specific hypertranscription on the paternal X chromosome in Drosophila (Kelley et at., 1999).


Future Directions


My studies suggest that mutations in UBE3A are not the sole cause of Angelman syndrome; additional factors must also be involved. The next Logical step in better understanding the etiology of AS is to identify all of the substrates that UBE3A targets for degradation. Any protein that interacts with UBE3A in this cascade and all proteins that UBE3A targets for degradation are good candidates for patients grouped in Class V. So far, four proteins have been identified as substrates for UBE3A-mediated degradation: p53, HHR23A, the Src family kinase BIk and UBE3A itself. Perhaps an even more intriguing future exploration is to determine if other 15q11-13 genes may play important roles in the etiology of Class V patients. Possible candidates are the UBE3A antisense transcript and the sense transcript Located downstream of UBE3A. These genes then need to be tested for their possible involvement in AS. It is not clear how any of these genes could be involved in the etiology of AS, and given the complexity of the ubiquitin system, identification of the specific AS gene or genes involved is a very daunting task.

In addition to determining the etiology of AS in Class V patients, my recent studies on imprinted expression of UBE3A and the antisense transcript suggest that imprinted expression of UBE3A is complicated. To better understand the biology, the







86

next logical step would be to examine more regions of the brain to try to establish the tissue-specificity of imprinted expression of UBE3A and the antisense transcript. I think my research indicates that a comprehensive in situ analysis of all regions of the brain would greatly help to answer whether or not the antisense transcript can regulate imprinted expression of UBE3A.
















REFERENCES


Albrecht, U., Sutcliffe, J. S., Cattanach, B. M., Beechey, C. V., Armstrong, D., EicheLe, G., and Beaudet, A. L. (1997). Imprinted expression of the murine Angelman syndrome gene, Ube3a, in hippocampal and Purkinje neurons. Nat Genet 17, 75-8.

Anan, T., Nagata, Y., Koga, H., Honda, Y., Yabuki, N., Miyamoto, C., Kuwano, A., Matsuda, I., Endo, F., Saya, H., and Nakao, M. (1998). Human ubiquitin-protein Ligase Nedd4: expression, subcellular localization and selective interaction with ubiquitinconjugating enzymes. Genes Cells 3, 751-63.

Angelman, H. (1965). "Puppet" children: A report on three cases. Dev Med Child Neurol 7, 681-8.

Antequera, F., and Bird, A. (1999). CpG islands as genomic footprints of promoters that are associated with replication origins. Curr Biot 9, R661-7.

Argyriou-Tirita, A., Romanakis, K., Kroisel, P., and Haas, O. A. (1996). Asynchronous replication patterns of imprinted genes in triploid cells. Acta Genet Med Gemellot 45, 207-12.

Barton, S. C., Surani, M. A., and Norris, M. L. (1984). Role of paternal and maternal genomes in mouse development. Nature 311, 374-6.

Baumer, A., Balmer, D., and Schinzel, A. (1999). Screening for UBE3A gene mutations in a group of Angelman syndrome patients selected according to non-stringent clinical criteria. Hum Genet 105, 598-602.

Baylin, S. B., Herman, J. G., Graff, J. R., Vertino, P. M., and Issa, J. P. (1998).
Alterations in DNA methylation: a fundamental aspect of neoplasia. Adv Cancer Res 72, 141-96.

Betll, A. C., and Felsenfeld, G. (2000). Methylation of a CTCF-dependent boundary controls imprinted expression of the Igf2 gene. Nature 405, 482-5.

Bietinska, B., Blaydes, S. M., Buiting, K., Yang, T., Krajewska-Watasek, M., Horsthemke, B., and Brannan, C. I. (2000). De novo deletions of SNRPN exon 1 in early human and mouse embryos result in a paternal to maternal imprint switch. Nat Genet 25, 74-8.

Bird, A. P., and Wolffe, A. P. (1999). Methylation-induced repression--belts, braces, and chromatin. Cell 99, 451-4.

87







88


Birger, Y., Shemer, R., Perk, J., and Razin, A. (1999). The imprinting box of the mouse Igf2r gene. Nature 397, 84-8.

Boccaccio, I., Glatt-Deeley, H., Watrin, F., Roecket, N., Lalande, M., and Muscatetlli, F. (1999). The human MAGEL2 gene and its mouse homologue are paternally expressed and mapped to the Prader-Willi region. Hum Mol Genet 8, 2497-505.

Bottani, A., Robinson, W. P., DeLozier-Blanchet, C. D., Engel, E., Morris, M. A., Schmitt, B., Thun-Hohenstein, L., and Schinzel, A. (1994). Angelman syndrome due to paternal uniparental disomy of chromosome 15: a milder phenotype? Am J Med Genet 51, 35-40.

Brandeis, M., Ariel, M., and Cedar, H. (1993). Dynamics of DNA methylation during development. Bioessays 15, 709-13.

Brannan, C. I., and Bartolomei, M. S. (1999). Mechanisms of genomic imprinting. Curr Opin Genet Dev 9, 164-70.

Brown, K. W., Villar, A. J., Bickmore, W., Clayton-Smith, J., Catchpoote, D., Maher, E. R., and Reik, W. (1996). Imprinting mutation in the Beckwith-Wiedemann syndrome leads to bialletic IGF2 expression through an H19-independent pathway. Hum Mol Genet 5, 2027-32.

Buiting, K., Dittrich, B., Gross, S., Lich, C., Farber, C., Buchholz, T., Smith, E., Reis, A., Burger, J., Nothen, M. M., Barth-Witte, U., Janssen, B., Abeliovich, D., Lerer, I., van den Ouweland, A. M., Halley, D. J., Schrander-Stumpel, C., Smeets, H., Meinecke, P., Malcolm, S., Gardner, A., Lalande, M., Nicholls, R. D., Friend, K., Schutze, A., Matthijs, G., Kokkonen, J., Hilbert, P., Van Maldergem, L., Glover, G., CarbonetL, P., WitLems, P., Gitessen-Kaesbach, G., and Horsthemke, B. (1998). Sporadic imprinting defects in Prader-Willi syndrome and Angelman syndrome: implications for imprintswitch models, genetic counseling, and prenatal diagnosis. Am J Hum Genet 63, 17080.

Buiting, K., Lich, C., Cottrell, S., Barnicoat, A., and Horsthemke, B. (1999). A 5-kb imprinting center deletion in a family with Angelman syndrome reduces the shortest region of deletion overlap to 880 bp. Hum Genet 105, 665-6.

Buiting, K., Saitoh, S., Gross, S., Dittrich, B., Schwartz, S., Nicholtls, R. D., and Horsthemke, B. (1995). Inherited microdeLetions in the Angelman and Prader-Willi Syndromes define an imprinting center on human chromosome 15. Nat Genet 9, 395400.

Burger, J., Kunze, J., Sperling, K., and Reis, A. (1996). Phenotypic differences in Angelman syndrome patients: imprinting mutations show less frequently microcephaly and hypopigmentation than deletions. Am J Med Genet 66, 221-6.

Buschhausen, G., Wittig, B., Graessmann, M., and Graessmann, A. (1987). Chromatin structure is required to block transcription of the methylated herpes simplex virus thymidine kinase gene. Proc Natt Acad Sci U S A 84, 1177-81.







89


Butler, M. G., Meaney, R. J., and Palmer, C. G. (1986). Clinical and cytogenetic survey of 39 individuals with Prader-Labhart-Willi syndrome. Am J Med Genet 23, 798-809.

Caspary, T., Cleary, M. A., Baker, C. C., Guan, X. J., and Tilghman, S. M. (1998). Multiple mechanisms regulate imprinting of the mouse distal chromosome 7 gene cluster. Mol Cell Biot 18, 3466-74.

Cattanach, B. M., Barr, J. A., Beechey, C. V., Martin, J., NoebeLs, J., and Jones, J. (1997). A candidate model for Angelman syndrome in the mouse. Mamm Genome 8, 472-8.

Cattanach, B. M., Barr, J. A., Evans, E. P., Burtenshaw, M., Beechey, C. V., Leff, S. E., Brannan, C. I., Copeland, N. G., Jenkins, N. A., and Jones, J. (1992). A candidate mouse model for Prader-Willi syndrome which shows an absence of Snrpn expression. Nat Genet 2, 270-4.

Chomczynski, P., and Sacchi, N. (1987). Single-step method of RNA isolation by acid guanidinium thiocyanate-phenoL-chloroform extraction. Anal Biochem 162, 156-9.

Christian, S. L., Bhatt, N. K., Martin, S. A., Sutcliffe, J. S., Kubota, T., Huang, B., Mutirangura, A., Chinault, A. C., Beaudet, A. L., and Ledbetter, D. H. (1998). Integrated YAC contig map of the Prader-WillilAngeLman region on chromosome 15q11-q13 with average STS spacing of 35 kb. Genome Res 8, 146-57.

Ciechanover, A., Orian, A., and Schwartz, A. L. (2000). The ubiquitin-mediated proteotytic pathway: mode of action and clinical implications. J Cell Biochem Suppl 34, 40-51.

Clayton-Smith, J., Driscotll, D. J., Waters, M. F., Webb, T., Andrews, T., Pembrey, M. E., Malcolm, S., and Nicholls, R. D. (1993). Differences in methylation patterns within the D15S9 region of chromosome 15q11-q13 in first cousins with Angelman and PraderWilli syndromes. Am J Med Genet 47, 683-6.

Colman, S. D., Rasmussen, S. A., Ho, V. T., Abernathy, C. R., and Wallace, M. R. (1996). Somatic mosaicism in a patient with neurofibromatosis type 1. Am J Hum Genet 58, 484-90.

Dan, B., Boyd, S. G., Christiaens, F., Courtens, W., Van Maldergem, L., and Kahn, A. (2000). Atypical features in Angelman syndrome due to imprinting defect of uniparental disomy of chromosome 15. Neuropediatrics 31, 109-10.

de Los Santos, T., Schweizer, J., Rees, C. A., and Francke, U. (2000). Small Evolutionarily Conserved RNA, Resembling C/D Box Small NucLeoLar RNA, Is Transcribed from PWCR1, a Novel Imprinted Gene in the Prader- Willi Deletion Region, Which Is Highly Expressed in Brain. Am J Hum Genet 67, 1067-82.

DeLorey, T. M., Handforth, A., Anagnostaras, S. G., Homanics, G. E., Minassian, B. A., Asatourian, A., Fanselow, M. S., Delgado-Escueta, A., Ellison, G. D., and Otsen, R. W. (1998). Mice lacking the beta3 subunit of the GABAA receptor have the epilepsy







90

phenotype and many of the behavioral characteristics of angetman syndrome. J Neurosci 18, 8505-14.

Dittrich, B., Buiting, K., Gross, S., and Horsthemke, B. (1993). Characterization of a methylation imprint in the Prader-Willi syndrome chromosome region. Hum Mol Genet 2, 1995-9.

Dittrich, B., Buiting, K., Korn, B., Rickard, S., Buxton, J., Saitoh, S., Nicholls, R. D., Poustka, A., Winterpacht, A., Zabel, B., and Horsthemke, B. (1996). Imprint switching on human chromosome 15 may involve alternative transcripts of the SNRPN gene. Nat Genet 14, 163-70.

Drewelt, R. A., Brenton, J. D., Ainscough, J. F., Barton, S. C., Hilton, K. J., Arney, K.
L., Dandolo, L., and Surani, M. A. (2000). Deletion of a silencer element disrupts H19 imprinting independently of a DNA methylation epigenetic switch. Development 127, 3419-28.

Driscoll, D. J. (1994). Genomic Imprinting in Humans. Mol Genet Med 4, 37-77.

Driscoll, D. J., and Migeon, B. R. (1990). Sex difference in methylation of single-copy genes in human meiotic germ cells: implications for X chromosome inactivation, parental imprinting, and origin of CpG mutations. Somat Cell Mol Genet 16, 267-82.

Driscoll, D. J., Waters, M. F., Williams, C. A., Zori, R. T., Glenn, C. C., Avidano, K. M.,
and Nicholls, R. D. (1992). A DNA methylation imprint, determined by the sex of the parent, distinguishes the Angelman and Prader-Willi syndromes. Genomics 13, 917-24.

Dupont, J. M., Le Tessier, D., Rabineau, D., Cuisset, L., Vasseur, C., Jeanpierre, M., Delpech, M., Pinton, F., Ponsot, G., and Denavit, M. F. (1999). Unexpected Angelman syndrome molecular defect in a girl displaying clinical features of Prader-Willi syndrome. J Med Genet 36, 652-4.

Falls, J. G., Pulford, D. J., Wylie, A. A., and Jirtle, R. L. (1999). Genomic imprinting: implications for human disease. Am J PathoL 154, 635-47.

Fang, P., Lev-Lehman, E., Tsai, TP. F., Matsuura, T., Benton, C. S., Sutcliffe, J. S., Christian, S. L., Kubota, T., Halley, D. J., Meijers-Heijboer, H., Langlois, S., Graham Jr, J. M., Beuten, J., Willems, P. J., Ledbetter, D. H., and Beaudet, A. L. (1999). The spectrum of mutations in UBE3A causing angeLman syndrome. Hum Mot Genet 8, 12935.

Farber, C., Dittrich, B., Buiting, K., and Horsthemke, B. (1999). The chromosome 15 imprinting centre (IC) region has undergone multiple duplication events and contains an upstream exon of SNRPN that is deleted in a[ll angelman syndrome patients with an IC microdeletion. Hum Mol Genet 8, 337-43.

Farber, C., Gross, S., Neesen, J., Buiting, K., and Horsthemke, B. (2000). Identification of a testis-specific gene (C15orf2) in the Prader-Willi syndrome region on chromosome 15. Genomics 65, 174-83.







91

Feil, R., Handel, M. A., Allen, N. D., and Reik, W. (1995). Chromatin structure and imprinting: developmental control of DNase-I sensitivity in the mouse insulin-like growth factor 2 gene. Dev Genet 17, 240-52.

Feinberg, A. P. (2000). DNA methylation, genomic imprinting and cancer. Curr Top Microbiot Immunot 249, 87-99.

Freeman, S. B., May, K. M., Pettay, D., Fernhoff, P. M., and Hassold, T. J. (1993). Paternal uniparental disomy in a child with a balanced 15;15 translocation and Angelman syndrome. Am J Med Genet 45, 625-30.

Fridman, C., Santos, M., Ferrari, I., and Koiffmann, C. P. (2000a). A further Angelman syndrome patient with UPD15 due to paternal meiosis II nondisjunction. Clin Genet 57, 86-7.

Fridman, C., Varela, M. C., Kok, F., Diament, A., and Koiffmann, C. P. (2000b). Paternal UPD15: further genetic and clinical studies in four angelman syndrome patients. Am J Med Genet 92, 322-7.

Fridman, C., Varela, M. C., Nicholls, R. D., and Koiffmann, C. P. (1998). Unusual clinical features in an Angelman syndrome patient with uniparental disomy due to a translocation 15q15q. Clin Genet 54, 303-8.

Fung, D. C., Yu, B., Cheong, K. F., Smith, A., and Trent, R. J. (1998). UBE3A "mutations" in two unrelated and phenotypically different Angelman syndrome patients. Hum Genet 102, 487-92.

Gabriel, J. M., Higgins, M. J., Gebuhr, T. C., Shows, T. B., Saitoh, S., and Nicholls, R. D. (1998). A model system to study genomic imprinting of human genes. Proc Nat[ Acad Sci U S A 95, 14857-62.

Gabriel, J. M., Merchant, M., Ohta, T., Ji, Y., Caldwell, R. G., Ramsey, M. J., Tucker, J. D., Longnecker, R., and Nicholls, R. D. (1999). A transgene insertion creating a heritable chromosome deletion mouse model of Prader-Willi and Angelman syndromes. Proc Nat Acad Sci USA 96, 9258-63.

Gerard, M., Hernandez, L., Wevrick, R., and Stewart, C. L. (1999). Disruption of the mouse necdin gene results in early post-natal lethatity. Nat Genet 23, 199-202.

Gillessen-Kaesbach, G., Albrecht, B., Passarge, E., and Horsthemke, B. (1995). Further patient with Angelman syndrome due to paternal disomy of chromosome 15 and a milder phenotype. Am J Med Genet 56, 328-9.

Gillessen-Kaesbach, G., Demuth, S., Thiele, H., Theile, U., Lich, C., and Horsthemke, B. (1999). A previously unrecognised phenotype characterised by obesity, muscular hypotonia, and ability to speak in patients with Angelman syndrome caused by an imprinting defect. Eur J Hum Genet 7, 638-44.







92

Glenn, C. C., Driscoll, D. J., Yang, T. P., and Nicholls, R. D. (1997). Genomic imprinting: potential function and mechanisms revealed by the Prader-Willi and Angelman syndromes. Mot Hum Reprod 3, 321-32.

Glenn, C. C., Nichotts, R. D., Saitoh, S., Niikawa, N., Robinson, W. P., Schinzel, A., Horsthemke, B., and Driscoll, D. J. (1993a). Modification of 15q11-q13 methylation imprints in unique Angelman and Prader-Willi patients. Hum Mol Genet 2, 1377-82.

Glenn, C. C., Porter, K. A., Jong, M., Nicholls, R. D., and Driscoll, D. J. (1993b). Functional imprinting and epigenetic modifications of the human SNRPN gene. Hum Mol Genet 2, 2001-5.

Glenn, C. C., Saitoh, S., Jong, M. T., Filbrandt, M. M., Surti, U., Driscolltt, D. J., and Nichotts, R. D. (1996). Gene structure, DNA methylation, and imprinted expression of the human SNRPN gene. Am J Hum Genet 58, 335-46.

Gray, T. A., Saitoh, S., and Nicholls, R. D. (1999). An imprinted, mammalian bicistronic transcript encodes two independent proteins. Proc Natt Acad Sci U S A 96, 5616-21.

Greger, V., Knottll, J. H. M., Wagstaff, J., Woolf, E., Lieske, P., Glatt, H., Benn, P. A., Rosengren, S. S., and Lalande, M. (1997). Angelman syndrome associated with an inversion of chromosome 15q11.2q24.3. Am J Hum Genet 60, 574-80.

Greger, V., Reis, A., and Lalande, M. (1994). The critical region for Angelman syndrome lies between D15S122 and D15S113. Am J Med Genet 53, 396-8.

Gyftodimou, J., Karadima, G., Pandelia, E., Vassitopoulos, D., and Petersen, M. B. (1999). Angetman syndrome with uniparental disomy due to paternal meiosis 11 nondisjunction. Ctin Genet 55, 483-6.

Hark, A. T., Schoenherr, C. J., Katz, D. J., Ingram, R. S., Levorse, J. M., and Tilghman, S. M. (2000). CTCF mediates methylation-sensitive enhancer-blocking activity at the H19/Igf2 locus. Nature 405, 486-9.

Hark, A. T., and Tilghman, S. M. (1998). Chromatin conformation of the H19 epigenetic mark. Hum Mol Genet 7, 1979-85.

Holm, V. A., Cassidy, S. B., Butter, M. G., Hanchett, J. M., Greenswag, L. R., Whitman, B. Y., and Greenberg, F. (1993). Prader-Willi syndrome: consensus diagnostic criteria. Pediatrics 91, 398-402.

Huibregtse, J. M., Scheffner, M., and Howley, P. M. (1993a). Cloning and expression of the cDNA for E6-AP, a protein that mediates the interaction of the human papiLttomavirus E6 oncoprotein with p53. Mol Col Biot 13, 775-84.

Huibregtse, J. M., Scheffner, M., and Howley, P. M. (1993b). Localization of the E6-AP regions that direct human papillomavirus E6 binding, association with p53, and ubiquitination of associated proteins. Mol Cell Biot 13, 4918-27.




Full Text

PAGE 1

02/(&8/$5 *(1(7,&6 2) 7+( $1*(/0$1 6<1'520( %\ $0< & /266,( $ ',66(57$7,21 35(6(17(' 72 7+( *5$'8$7( 6&+22/ 2) 7+( 81,9(56,7< 2) )/25,'$ ,1 3$57,$/ )8/),//0(17 2) 7+( 5(48,5(0(176 )25 7+( '(*5(( 2) '2&725 2) 3+,/2623+< 81,9(56,7< 2) )/25,'$

PAGE 2

7KLV GLVVHUWDWLRQ LV GHGLFDWHG WR & $QGUHZ *ORPVNL IRU KLV XQHQGLQJ EHOLHI HQFRXUDJHPHQW DQG VXSSRUW

PAGE 3

$&.12:/('*(0(176 ZRXOG ILUVW OLNH WR WKDQN P\ SDUHQWV DQG JUDQGSDUHQWV IRU WKHLU QHYHUHQGLQJ HQFRXUDJHPHQW DQG VXSSRUW IRU QHYHU DFFHSWLQJ PHGLRFULW\ DQG IRU SURYLGLQJ PH ZLWK H[FHOOHQW H[DPSOHV RI KDUG ZRUN DQG GHGLFDWLRQ ,W WUXO\ WRRN D YLOODJH WR UDLVH PH FUHGLW $QG\fV IDPLO\ IRU EHOLHYLQJ LQ PH DQG XQGHUVWDQGLQJ ZKHQ WRRN DZD\ WKHLU VRQ DQG EURWKHU DP JUDWHIXO WR ERWK RI RXU IDPLOLHV IRU TXLHWO\ VXSSRUWLQJ XV
PAGE 4

7$%/( 2) &217(176 $&.12:/('*(0(176 ,OO $%675$&7 2) ',66(57$7,21 35(6(17(' 72 7+( *5$'8$7( 6&+22/ 9,, ,1752'8&7,21 *HQRPLF ,PSULQWLQJ ,V DQ (SLJHQHWLF 3KHQRPHQRQ *HQRPLF ,PSULQWLQJ DQG %HFNZLWK:LHGHPDQQ 6\QGURPH &OLQLFDO )HDWXUHV RI %HFNZLWK:LHGHPDQQ 6\QGURPH ,PSULQWHG *HQHV LQ %:6 ,PSULQWLQJ 0HFKDQLVPV RI ,JI DQG + 7KH $QJHOPDQ DQG 3UDGHU:LOOL 6\QGURPHV &OLQLFDO )HDWXUHV RI $6 DQG 3:6 0ROHFXODU 0HFKDQLVPV RI $6 DQG 3:6 *HQHV ,QYROYHG LQ $6 DQG 3:6 0RXVH 0RGHOV RI 3:6 0RXVH 0RGHOV RI $6 '1$ 0HWK\ODWLRQ $Q (SLJHQHWLF 0DUN 6WUXFWXUH DQG )XQFWLRQ RI WKH $63:6 ,PSULQWLQJ &HQWHU 8%($ DQG WKH 8ELTXLWLQDWLRQ 3DWKZD\ A75$160,66,21 2) $1*(/0$1 6<1'520( %< $1 $))(&7(' 027+(5 ,QWURGXFWLRQ 0HWKRGV 6XEMHFWV 0LFURVDWHOOLWH $QDO\VLV '1$ 0HWK\ODWLRQ $QDO\VHV 573&5 5HVXOWV *HQHWLF $QDO\VLV '1$ 0HWK\ODWLRQ $QDO\VHV *HQH ([SUHVVLRQ LY

PAGE 5

'LVFXVVLRQ 02/(&8/$5 $1$/<6(6 $1' *(127<3(3+(127<3(&255(/$7,216 $021* 7+( ),9( &/$66(6 2) $1*(/0$1 6<1'520( ,QWURGXFWLRQ 0DWHULDOV DQG 0HWKRGV 3DWLHQW 5HSRVLWRU\ 6RXWKHUQ $QDO\VLV %(66 76FDQ 6HTXHQFH $QDO\VLV 3ULPHUV 6WDWLVWLFDO $QDO\VHV 5HVXOWV f§0ROHFXODU &ODVVHV RI $QJHOPDQ 6\QGURPH 0XWDWLRQ $QDO\VLV '1$ 0HWK\ODWLRQ RI f 8%($ 6XPPDU\ RI DOO 3XEOLVKHG 8%($ 0XWDWLRQV *HQRW\SH3KHQRW\SH &RUUHODWLRQV 'LVFXVVLRQ 0XWDWLRQV LQ 8%($ *HQRW\SH3KHQRW\SH &RUUHODWLRQV '1$ 0(7+
PAGE 6

*HQRW\SHSKHQRW\SH &RUUHODWLRQV DPRQJ WKH )LYH &ODVVHV RI $6 :KDW LV WKH (SLJHQHWLF 0DUN"f '1$ 0HWK\ODWLRQ &VDFWLQJ (OHPHQWV &KURPDWLQ 6WUXFWXUH '1$ 5HSOLFDWLRQ 7LPLQJ 0RGHOV IRU ,PSULQWHG ([SUHVVLRQ )XWXUH 'LUHFWLRQV 5()(5(1&(6 %,2*5$3+,&$/ 6.(7&+ YL

PAGE 7

$EVWUDFW RI 'LVVHUWDWLRQ 3UHVHQWHG WR WKH *UDGXDWH 6FKRRO RI WKH 8QLYHUVLW\ RI )ORULGD LQ 3DUWLDO )XOILOOPHQW RI WKH 5HTXLUHPHQWV IRU WKH 'HJUHH RI 'RFWRU RI 3KLORVRSK\ 02/(&8/$5 *(1(7,&6 2) 7+( $1*(/0$1 6<1'520( %\ $P\ & /RVVLH 'HFHPEHU &KDLU 'DQLHO 'ULVFROO 3K' 0' 0DMRU 'HSDUWPHQW 0ROHFXODU *HQHWLFV DQG 0LFURELRORJ\ *HQRPLF LPSULQWLQJ LV D SDUHQWRIRULJLQ HSLJHQHWLF SKHQRPHQRQ WKDW LV LQWLPDWHO\ LQYROYHG LQ GHYHORSPHQW FDQFHU DQG VHYHUDO JHQHWLF GLVRUGHUV LQFOXGLQJ $QJHOPDQ V\QGURPH $6f $6 LV D VHYHUH QHXUREHKDYLRUDO GLVRUGHU FKDUDFWHUL]HG E\ IRXU FDUGLQDO IHDWXUHV f VHYHUH GHYHORSPHQWDO GHOD\ f SURIRXQG VSHHFK LPSDLUPHQW f D FKDUDFWHULVWLF PRYHPHQW GLVRUGHU DQG f DQ $6VSHFLILF EHKDYLRU ZKLFK LQFOXGHV DQ LQDSSURSULDWHO\ KDSS\ DIIHFW 0\ VWXGLHV UHYHDOHG WKDW $6 LV FDXVHG E\ PROHFXODU PHFKDQLVPV &ODVV ,f 0E GHOHWLRQV &ODVV ,,f SDWHUQDO 83' &ODVV ,,,f LPSULQWLQJ GHIHFWV &ODVV ,9f LQWUDJHQLF PXWDWLRQV LQ 8%($ WKH ( XELTXLWLQ SURWHLQ OLJDVH $ JHQH DQG &ODVV 9f QR NQRZQ GHIHFWV 2XU VWDWLVWLFDO PRGHOV GHPRQVWUDWHG WKDW VHYHUDO VLJQLILFDQW SKHQRW\SLF GLIIHUHQFHV RFFXU DPRQJ WKH ILYH PROHFXODU FODVVHV 3DWLHQWV FDQ EH VHSDUDWHG LQWR IRXU SKHQRW\SLF JURXSV &ODVV &ODVVHV ,, DQG ,,, &ODVV ,9 DQG &ODVV 9 &ODVV SDWLHQWV DUH WKH PRVW VHYHUHO\ DIIHFWHG ZKLOH &ODVVHV ,, DQG ,,, YLL

PAGE 8

DUH WKH OHDVW &ODVV SDWLHQWV FRPSULVH D FRQWLJXRXV JHQH GLVRUGHU ZLWK KDSORLQVXIILFLHQF\ RI PXOWLSOH JHQHV H[DFHUEDWLQJ WKH ODFN RI WKH PDWHUQDO 8%($ JHQH 0XOWLSOH FOLQLFDO GLVWLQFWLRQV FDQ EH PDGH EHWZHHQ WKH FODVVHV ZLWK GLIIHUHQFHV PRVW VWULNLQJ LQ SLJPHQWDWLRQ JURZWK SDUDPHWHUV DFKLHYHPHQW RI GHYHORSPHQWDO PLOHVWRQHV DQG VHYHULW\ IUHTXHQF\ DQG DJH DW RQVHW RI VHL]XUHV ,QLWLDO H[SHULPHQWV VKRZHG WKDW LPSULQWHG H[SUHVVLRQ RI 8%($ ZDV OLPLWHG WR WKH EUDLQ LQ KXPDQV DQG UHYHDOHG WKH SUHVHQFH RI D EUDLQVSHFLILF DQWLVHQVH WUDQVFULSW WKDW RYHUODSSHG WKH f HQG RI 8%($ ,Q RXU VWXGLHV 573&5 DQDO\VHV RI 8%($ DQG LWV DQWLVHQVH WUDQVFULSW GHPRQVWUDWHG GLVFRUGDQW LPSULQWHG H[SUHVVLRQ RI WKH WZR JHQHV LQ VHYHUDO UHJLRQV RI WKH KXPDQ EUDLQ 8%($ ZDV SUHIHUHQWLDOO\ H[SUHVVHG IURP WKH PDWHUQDO DOOHOH ZKLOH WKH DQWLVHQVH WUDQVFULSW ZDV SUHIHUHQWLDOO\ H[SUHVVHG IURP WKH SDWHUQDO DOOHOH ,Q DGGLWLRQ '1$ PHWK\ODWLRQ DQDO\VLV UHYHDOHG WKDW f 8%($ GRHV QRW GHPRQVWUDWH D '1$ PHWK\ODWLRQ LPSULQW $OO WLVVXHV HYHQ WKRVH WKDW GHPRQVWUDWHG LPSULQWHG H[SUHVVLRQ RI 8%($ DUH XQPHWK\ODWHG LQ WKH SURPRWHU UHJLRQ RI WKH JHQH 7KH ODFN RI D '1$ PHWK\ODWLRQ LPSULQW DW 8%($ DQG WKH REVHUYDWLRQ RI GLVFRUGDQW LPSULQWHG H[SUHVVLRQ RI WKH WZR JHQHV VXSSRUW D UROH IRU WKH DQWLVHQVH WUDQVFULSW LQ WKH UHJXODWLRQ RI LPSULQWHG H[SUHVVLRQ RI 8%($ YLLL

PAGE 9

,1752'8&7,21 *HQRPLF ,PSULQWLQJ ,V DQ (SLJHQHWLF 3KHQRPHQRQ (SLJHQHWLF SKHQRPHQD DUH LPSOLFDWHG LQ VHYHUDO GLVHDVHV FDQFHU ; FKURPRVRPH LQDFWLYDWLRQ DQG JHQRPLF LPSULQWLQJ ,Q DGGLWLRQ HSLJHQHWLF HYHQWV VXFK DV '1$ PHWK\ODWLRQ DQG KLVWRQH DFHW\ODWLRQ SOD\ PDMRU UROHV LQ WKH UHJXODWLRQ RI JHQH H[SUHVVLRQ (SLJHQHWLF HIIHFWV RFFXU ZKHQ WKH SULPDU\ JHQHWLF PDWHULDO LV KHULWDEO\ DOWHUHG LQ VRPDWLF DQGRU JHUP FHOOV FDXVLQJ FKDQJHV LQ H[SUHVVLRQ ZLWKRXW WKH FUHDWLRQ RI D PXWDWLRQDO HYHQW LQ WKH '1$ 2QH RI WKH PRVW IDPLOLDU HSLJHQHWLF SURFHVVHV LV JHQRPLF LPSULQWLQJ ZKLFK RFFXUV ZKHQ RQH DOOHOH RI DQ LPSULQWHG JHQH LV WUDQVFULSWLRQDOO\ DFWLYDWHG RU VLOHQFHG LQ D SDUHQWRIRULJLQ GHSHQGHQW PDQQHU 7KH SDUHQWDO RULJLQ RI WKH DOOHOH GHWHUPLQHV ZKHWKHU DQ LPSULQWHG JHQH ZLOO EH H[SUHVVHG VRPH LPSULQWHG JHQHV DUH RQO\ H[SUHVVHG IURP WKH SDWHUQDO DOOHOH ZKLOH RWKHUV DUH H[SUHVVHG H[FOXVLYHO\ IURP WKH PDWHUQDO FRS\ 7ZR RI WKH PRVW H[WUHPH H[DPSOHV RI JHQRPLF LPSULQWLQJ DUH WKH FRPSOHWH K\GDWLGLIRUP PROH DQG RYDULDQ WHUDWRPD .DMLL HW DO 2KDPD HW DO 2KDPD HW DO f +\GDWLGDIRUP PROHV RFFXU ZKHQ DQ DQXFOHDU HJJ LV IHUWLOL]HG E\ HLWKHU RQH RU WZR KDSORLG VSHUP ZLWK GXSOLFDWLRQ RI WKH HQWLUH KDSORLG JHQRPH RFFXUULQJ ZKHQ D VLQJOH VSHUP IHUWLOL]HV WKH HJJ +\GDWLGDIRUP PROHV ZKLFK DUH FRPSOHWHO\ DQGURJHQHWLF $Jf JLYH ULVH WR K\SHUSODVWLF H[WUDHPEU\RQLF JURZWK ZLWK OLWWOH RU QR IHWDO GHYHORSPHQW ,Q VLWX DFWLYDWLRQ DQG GXSOLFDWLRQ RI WKH PDWHUQDO '1$

PAGE 10

RI DQ XQIHUWLOL]HG RRF\WH SURGXFHV DQ RYDULDQ WHUDWRPD ZKLFK LV FRPSOHWHO\ SDUWKHQRJHQHWLF 3Jf KDYLQJ WZR FRPSOHWH FRSLHV RI WKH PDWHUQDO JHQRPH $OWKRXJK RYDULDQ WHUDWRPDV KDYH YHU\ OLWWOH H[WUDHPEU\RQLF GHYHORSPHQW WKH\ FDQ GHYHORS LQWR D GLVRUJDQL]HG EXW ZHOOGLIIHUHQWLDWHG WXPRU WKDW RIWHQ UHYHDOV UHPQDQWV RI PHVHQFK\PDO DQG HQGRGHUPDO VWUXFWXUHV (OHJDQW H[SHULPHQWV LQ WKH V UHYHDOHG WKH FRQVHTXHQFHV RI XQLSDUHQWDO PDPPDOLDQ GHYHORSPHQW LQ WKH PRXVH 3URQXFOHDU WUDQVIHU H[SHULPHQWV VKRZHG WKDW DQGURJHQHWLF DQG SDUWKHQRJHQHWLF HPEU\RV IDLOHG WR GHYHORS WR WHUP %DUWRQ HW DO 0F*UDWK DQG 6ROWHU f 7KHVH PLFH FORVHO\ UHVHPEOHG WKHLU KXPDQ FRXQWHUSDUWV FRPSOHWH K\GDWLGDIRUP PROHV DQG RYDULDQ WHUDWRPDV DQG GHPRQVWUDWHG WKDW WKH SDWHUQDO JHUP OLQH ZDV UHTXLUHG IRU GLIIHUHQWLDWLRQ RI H[WUDHPEU\RQLF WLVVXHV ZKLOH WKH PDWHUQDO JHQRPH ZDV QHFHVVDU\ IRU HPEU\RQLF GHYHORSPHQW 6XEVHTXHQW H[DPLQDWLRQ RI PLFH ZLWK XQLSDUHQWDO GLVRP\ 83'f IRU YDULRXV FKURPRVRPDO UHJLRQV UHYHDOHG WKH SUHVHQFH RI LPSULQWHG GRPDLQV RQ VHYHQ PRXVH FKURPRVRPHV DQG WKH ; -RKQ DQG 6XUDQL f ,Q KXPDQV 83' RI FKURPRVRPHV DQG KDV DOVR EHHQ VKRZQ WR FDXVH DEHUUDQW SKHQRW\SHV /HGEHWWHU DQG (QJHO f 7R GDWH RYHU LPSULQWHG JHQHV DQG LPSULQWHG V\QGURPHV KDYH EHHQ LGHQWLILHG LQ KXPDQ DQG PRXVH )DOOV HW DO 1LFKROOV f 7KHVH JHQHV DUH LQYROYHG LQ IHWDO DQG SODFHQWDO JURZWK FHOO SUROLIHUDWLRQ DQG QHXUREHKDYLRU 7ZR ODUJH FOXVWHUV RI LPSULQWHG JHQHV UHVLGH RQ KXPDQ FKURPRVRPHV S DQG T *HQHV LQ WKH %HFNZLWK:LHGHPDQQ V\QGURPH UHJLRQ RQ S KDYH EHHQ VKRZQ WR EH LQYROYHG LQ IHWDO JURZWK DQG FHOO SUROLIHUDWLRQ ZKLOH WKH $QJHOPDQ3UDGHU:LOOL V\QGURPH $63:6f UHJLRQ RQ T FRQWDLQV LPSULQWHG JHQHV WKDW LQIOXHQFH QHXUREHKDYLRU $ UHYLHZ RI WKHVH WZR V\VWHPV IROORZV

PAGE 11

*HQRPLF ,PSULQWLQJ DQG %HFNZLWK:LHGHPDQQ 6\QGURPH &OLQLFDO )HDWXUHV RI %HFNZLWK:LHGHPDQQ 6\QGURPH %HFNZLWK:LHGHPDQQ V\QGURPH %:6f LV D PXOWLIDFHWHG JHQHWLF GLVRUGHU FKDUDFWHUL]HG E\ IHWDO DQG QHRQDWDO RYHUJURZWK PDFURJORVVLD DQG DEGRPLQDO ZDOO GHIHFWV $GGLWLRQDO FRPPRQ IHDWXUHV LQFOXGH KHPLK\SHUWURSK\ JHQLWRXULQDU\ DEQRUPDOLWLHV RUJDQRPHJDO\ DQG :LOPfV WXPRU 0DKHU DQG 5HLN f 7KUHH PDMRU W\SHV RI %:6 SDWLHQWV KDYH EHHQ LGHQWLILHG SDWLHQWV ZLWK FKURPRVRPH DQRPDOLHV VSRUDGLF FDVHV RU IDPLOLDO LQKHULWDQFH 7KH ILQGLQJ RI D VLJQLILFDQW SHUFHQWDJH RI VSRUDGLF SDWLHQWV ZLWK SDUWLDO SDWHUQDO 83' IRU FKURPRVRPH S DQG WKH SUHVHQFH RI GXSOLFDWLRQV LQYHUVLRQV DQG EUHDNSRLQWV RI EDODQFHG WUDQVORFDWLRQV KDYH ORFDOL]HG WKH JHQHV IRU %:6 WR S 0DKHU DQG 5HLN f 7HQ LPSULQWHG JHQHV KDYH EHHQ PDSSHG WR WKLV UHJLRQ ZKLFK LV IODQNHG E\ QRQLPSULQWHG JHQHV DQG DW OHDVW WZR JHQHV ZLWKLQ WKH FOXVWHU GHPRQVWUDWH ELDOOHOLF H[SUHVVLRQ VXEGLYLGLQJ WKH FOXVWHU LQWR WZR LPSULQWHG GRPDLQV )LJXUH f ,PSULQWHG *HQHV LQ %:6 7KH &'.1& .Y/47, ,*) DQG + JHQHV IURP S KDYH EHHQ WKH PRVW VWXGLHG DQG LW DSSHDUV WKDW ERWK SI WKHVH JURXSV RI LPSULQWHG JHQHV DUH LQYROYHG LQ WKH SDWKRJHQHVLV RI %:6 5HFHQW H[SHULPHQWV VXJJHVW WKDW WKHVH WZR UHJLRQV DUH XQGHU WKH FRQWURO RI WZR GLVWLQFW LPSULQWLQJ FHQWHUV /HH HW DO E 5HLN HW DO 6PLOLQLFK HW DO f 7KH PDMRULW\ RI VSRUDGLF %:6 SDWLHQWV VKRZ ORVV RI LPSULQWLQJ /2,f DW ,*) LGHQWLILHG E\ WKH DFWLYDWLRQ RI ERWK SDUHQWDO DOOHOHV 0DKHU DQG 5HLN f 7ZR PHFKDQLVPV DUH DVVRFLDWHG ZLWK /2, DW ,*) ,Q WKH ILUVW /2, DW ,*) ZDV DFFRPSDQLHG E\ D FKDQJH LQ WKH HSLJHQRW\SH RI + ZKLFK VLOHQFHG WKH PDWHUQDO + DOOHOH 5HLN HW DO f ,Q WKH VHFRQG WKH + HSLJHQRW\SH ZDV

PAGE 12

QRUPDO EXW WKH '1$ PHWK\ODWLRQ LPSULQW RQ WKH PDWHUQDO DOOHOH RI .Y/47, EHFDPH XQPHWK\ODWHG LQGXFLQJ H[SUHVVLRQ RI WKH .Y/47, DQWLVHQVH WUDQVFULSW /,7 %URZQ HW DO 6PLOLQLFK HW DO f 7KHUHIRUH WKHVH REVHUYDWLRQV VKRZ WKDW GLVUXSWLRQ RI WKH HSLJHQRW\SH DW HLWKHU +L RU .Y/47, FDQ FDXVH /2, RI ,*) LQ SDWLHQWV ZLWK %:6 ,PSULQWLQJ 0HFKDQLVPV RI ,JI DQG + $Q HOHJDQW VHULHV RI H[SHULPHQWV E\ VHYHUDO JURXSV KDV KHOSHG WR WHDVH RXW WKH LPSRUWDQW HOHPHQWV RI LPSULQWHG H[SUHVVLRQ RI ,JI DQG + LQ WKH PRXVH UHYLHZHG LQ %UDQQDQ DQG %DUWRORPHL f 6XEVHTXHQW H[SHULPHQWV KDYH UHYHDOHG WKH PHFKDQLVP RI LPSULQWHG H[SUHVVLRQ RI WKHVH WZR JHQHV )LJXUH %HOO DQG )HOVHQIHOG 'UHZHOO HW DO )ODUN HW DO ,VKLKDUD HW DO 6]DER HW DO f 7KHVH ODWWHU H[SHULPHQWV UHYHDOHG WKDW WKH GLIIHUHQWLDOO\ PHWK\ODWHG UHJLRQ ORFDWHG DW f + ZDV D ERXQGDU\ HOHPHQW WKDW ZKHQ XQPHWK\ODWHG ERXQG D UHSUHVVRU SURWHLQ SUHYHQWLQJ WKH J JHQH IURP EHLQJ DFWLYDWHG E\ XSVWUHDP HQKDQFHUV 7KH LGHQWLILFDWLRQ RI WKH PHFKDQLVP IRU LPSULQWHG H[SUHVVLRQ RI ,JI+ LV D ILUVW IRU LPSULQWHG JHQHV ,W ZLOO EH LQWHUHVWLQJ WR GLVFRYHU KRZ PXWDWLRQV LQ XSVWUHDP JHQHV FDQ DOVR GLVUXSW LPSULQWLQJ I ,JI 3HUKDSV WKHUH DUH WZR OHYHOV RI FRQWURO LQ WKLV UHJLRQ ORFDO DQG UHJLRQDO ZLWK ORQJUDQJH LQWHUDFWLRQV RFFXUULQJ EHWZHHQ .Y/47, DQG ,*) ,W ZLOO DOVR EH LQWHUHVWLQJ WR GHWHUPLQH ZKDW SKHQRW\SLF HIIHFWV RWKHU LPSULQWHG JHQHV LQ WKLV UHJLRQ KDYH RQ VXEVHWV RI %:6 SDWLHQWV 7KH $QJHOPDQ DQG 3UDGHU:LOOL 6\QGURPHV 5HVHDUFK RYHU WKH ODVW ILYH \HDUV KDV \LHOGHG PDQ\ FOXHV DV WR WKH IDFWRUV QHFHVVDU\ IRU JHQRPLF LPSULQWLQJ RI WKH $QJHOPDQ $6f DQG 3UDGHU:LOOL 3:6f

PAGE 13

V\QGURPHV 1RYHO LPSULQWHG JHQHV KDYH EHHQ LGHQWLILHG RQ T PXWDWLRQV LQ WKH ( XELTXLWLQ SURWHLQOLJDVH JHQH 8%($ ZHUH IRXQG LQ VHYHUDO SDWLHQWV ZLWK $6 QHZ PHWKRGV RI WUDQVPLVVLRQ RI $6 DQG 3:6 ZHUH LGHQWLILHG DQG VWXGLHV RI SDWLHQWV ZLWK LPSULQWLQJ GHIHFWV UHYHDOHG WKDW WKH LPSULQWLQJ FHQWHU FRQVLVWHG RI VHSDUDWH $6 DQG 3:6 FRPSRQHQWV ,Q DGGLWLRQ PXOWLSOH PRXVH PRGHOV RI $6 DQG 3:6 ZHUH FUHDWHG DQG QXOO PXWDWLRQV RI VHYHUDO LPSULQWHG JHQHV ZHUH JHQHUDWHG LQ WKH PRXVH &OLQLFDO )HDWXUHV RI $6 DQG 3:6 7KH $QJHOPDQ DQG 3UDGHU:LOOL V\QGURPHV GHOLQHDWH WKH VHFRQG PDMRU FOXVWHU RI LPSULQWHG JHQHV LQ WKH KXPDQ $OWKRXJK ERWK V\QGURPHV DUH DVVRFLDWHG ZLWK 0E LQWHUVWLWLDO GHOHWLRQV RI FKURPRVRPH T $6 DQG 3:6 DUH YHU\ GLIIHUHQW FOLQLFDO QHXUREHKDYLRUDO GLVRUGHUV $6 LV FKDUDFWHUL]HG E\ VHYHUH PHQWDO UHWDUGDWLRQ SURIRXQG VSHHFK LPSDLUPHQW D PRYHPHQW DQG EDODQFH GLVRUGHU DQG DQ $6VSHFLILF EHKDYLRU ZKLFK LQFOXGHV DQ LQDSSURSULDWHO\ KDSS\ DIIHFW LQWHUVSHUVHG ZLWK SDUR[\VPV RI ODXJKWHU :LOOLDPV HW DO D :LOOLDPV HW DO f ,Q VWDUN FRQWUDVW 3:6 LV LQLWLDOO\ FKDUDFWHUL]HG E\ QHRQDWDO K\SRWRQLD DQG IDLOXUH WR WKULYH +RZHYHU DW WR PRQWKV RI DJH SDWLHQWV EHFRPH K\SHUSKDJLF HYHQWXDOO\ OHDGLQJ WR PRUELG REHVLW\ 7KH\ DOVR KDYH PLOG PHQWDO UHWDUGDWLRQ K\SRJRQDGLVP VPDOO KDQGV DQG IHHW DQG D FKDUDFWHULVWLF EHKDYLRU ZKLFK LULFOXGHV OHWKDUJ\ DJJUHVVLYHQHVV DQG REVHVVLYH FRPSXOVLYH GLVRUGHU +ROP HW DO f 7KH GLIIHUHQWLDO SKHQRW\SH GHSHQGV XSRQ WKH SDUHQWDO WUDQVPLVVLRQ RI WKH T GHIHFW ZLWK QRUPDO GHYHORSPHQW UHTXLULQJ ELSDUHQWDO JHQHWLF FRQWULEXWLRQ RI T >$6 LV FDXVHG E\ D ODFN RI PDWHUQDO FRQWULEXWLRQ ZKLOH ODFN RI SDWHUQDO FRQWULEXWLRQ IURP T UHVXOWV LQ 3:6

PAGE 14

0ROHFXODU 0HFKDQLVPV RI $6 DQG 3:6 7KH JHQHWLFV RI WKH $6 DQG 3:6 V\QGURPHV DUH YHU\ FRPSOH[ PXOWLSOH GLIIHUHQW FKURPRVRPH GHIHFWV RFFXU LQ WKHVH WZR GLVWLQFW V\QGURPHV )LJXUH f /RVV RU LQDFWLYDWLRQ RI DW OHDVW RQH T JHQH RFFXUV LQ ERWK WKH $6 DQG 3:6 V\QGURPHV ZLWK PDWHUQDO GHILFLHQFLHV JLYLQJ ULVH WR $6 FKLOGUHQ DQG SDWHUQDO GHILFLWV FDXVLQJ 3:6 )LJXUH f )LYH PDMRU PROHFXODU FODVVHV RI $6 SDWLHQWV KDYH EHHQ LGHQWLILHG ,f 0E PDWHUQDO GHOHWLRQV RI T ,,f SDWHUQDO XQLSDUHQWDO GLVRPLHV 83'f ,,,f LPSULQWLQJ GHIHFWV ,'f ,9f SDWLHQWV ZLWK PXWDWLRQV LQ D VLQJOH JHQH 8%($ DQG 9f SDWLHQWV ZLWK QR NQRZQ GHIHFWV 3UDGHU:LOOL SDWLHQWV KDYH EHHQ LGHQWLILHG ZKR EHORQJ LQ WKH ILUVW WKUHH FODVVHV SDWHUQDO GHOHWLRQV RI T PDWHUQDO 83'V DQG ,' 1R VLQJOH JHQH PXWDWLRQV KDYH EHHQ IRXQG LQ 3:6 SDWLHQWV VXJJHVWLQJ WKDW 3:6 LV SDUW RI D FRQWLJXRXV JHQH V\QGURPH ZLWK LQDFWLYDWLRQ RI DW OHDVW WZR JHQHV QHFHVVDU\ IRU WKH IXOO SKHQRW\SH WR GHYHORS *HQHV ,QYROYHG LQ $6 DQG 3:6 7KLV SDVW \HDU KDV EHHQ H[FLWLQJ LQ WKH $63:6 ILHOG 1LQH QRYHO LPSULQWHG JHQHV DQG WUDQVFULSWV ZHUH ORFDOL]HG WR WKH T LPSULQWHG GRPDLQ %RFFDFFLR HW DO )DUEHU HW DO /HH HW DO /HH DQG :HYULFN f ZLWK SDWHUQDOO\ H[SUHVVHG WUDQVFULSWV KDYLQJ EHHQ PDSSHG WR WKH $63:6 LPSULQWHG GRPDLQ WR GDWH FHQ0.51 0.51$6 : 1'1 0$*(/ & WUDQVFULSW 6185) 61531 3$5 : : ,3: 3$5 VW6* VW6*VWV1 %&' $& DQG 8%($$6WH> $OWKRXJK QR VHTXHQFH PXWDWLRQV KDYH EHHQ IRXQG LQ DQ\ RI WKHVH JHQHV LQ 3:6 SDWLHQWV H[SUHVVLRQ VWXGLHV LQGLFDWH WKDW 3:6 SDWLHQWV GR QRW H[SUHVV 0.51 0.51$6 : 1'1 0$*(/ & WUDQVFULSW 6185)61531 3$5 : : 3$5 VW6* VW6*VWV1 RU $& LQ O\PSKREODVWV VNLQ ILEUREODVWV RU KXPDQ EUDLQ )LJXUH $ %f

PAGE 15

,QWHUHVWLQJO\ ,3: GHPRQVWUDWHV LPSULQWHG H[SUHVVLRQ LQ O\PSKREODVW DQG VNLQ ILEUREODVW FHOO OLQHV EXW ELDOOHOLF H[SUHVVLRQ LQ KXPDQ EUDLQ $OO RI WKHVH JHQHV DQG WUDQVFULSWV FRXOG SRWHQWLDOO\ EH LQYROYHG LQ WKH HWLRORJ\ RI 3:6 2QO\ RQH JHQH LQ WKH $63:6 LPSULQWHG GRPDLQ 8%($ GHPRQVWUDWHV D PDWHUQDORQO\ H[SUHVVLRQ LPSULQW 5RXJHXOOH HW DO 9X DQG +RIIPDQ f +RZHYHU XQOLNH PRVW RI WKH SDWHUQDOO\ H[SUHVVHG T JHQHV LPSULQWHG H[SUHVVLRQ RI 8%($ LV UHVWULFWHG WR EUDLQ )LJXUH $ %f 0RXVH VWXGLHV UHYHDOHG WKDW WLVVXHVSHFLILF LPSULQWHG H[SUHVVLRQ RI 8EHD ZDV UHVWULFWHG WR WKH 3XUNLQMH FHOOV RI WKH FHUHEHOOXP WKH &$ DQG &$ UHJLRQV RI WKH KLSSRFDPSXV DQG WKH PLWUDO FHOO OD\HU RI WKH ROIDFWRU\ EXOE $OEUHFKW HW DO 6XWFOLIIH HW DO f ,Q WKH KXPDQ PXFK OHVV LV NQRZQ DERXW WKH WLVVXH VSHFLILFLW\ RI LPSULQWHG H[SUHVVLRQ RI 8%($ $OO VWXGLHV LQ WKH DGXOW KDYH UHOLHG RQ 573&5 DQDO\VLV IURP D VLQJOH IURQWDO FRUWH[ VDPSOH DQG KDYH VKRZQ WKDW 8%($ LPSULQWHG H[SUHVVLRQ YDULHV ZLWKLQ WKLV WLVVXH /HH DQG :HYULFN 5RXJHXOOH HW DO f 5HVHDUFK RQ KXPDQ IHWDO EUDLQ GHPRQVWUDWHG ELDVHG H[SUHVVLRQ EXW FRXOG QRW GHWHUPLQH LI WKH SUHIHUHQWLDOO\ H[SUHVVHG DOOHOH ZDV PDWHUQDO RU SDWHUQDO LQ RULJLQ 9X DQG +RIIPDQ f 0RXVH 0RGHOV RI 3:6 0RXVH PRGHOV RI DOO WKHfPROHFXODU FODVVHV RI 3:6 GHOHWLRQV 83' DQG LPSULQWLQJ GHIHFWVf KDYH EHHQ FUHDWHG 7ZR PRXVH PRGHOV KDYH EHHQ JHQHUDWHG ZLWK ODUJH & GHOHWLRQV 2QH GHOHWLRQ ZKLFK RFFXUUHG VHUHQGLSLWRXVO\ E\ LQVHUWLRQDO PXWDJHQHVLV UHVXOWHG LQ D PRXVH ZLWK D WUDQVJHQHLQGXFHG GHOHWLRQ RI WKH HQWLUH RUWKRORJRXV UHJLRQ *DEULHO HW DO f :KHQ WKH 7J3:6$6GHO! :DV SDVVHG WKURXJK WKH SDWHUQDO JHUPOLQH WUDQVJHQLF SURJHQ\ VKRZHG QHRQDWDO OHWKDOLW\ DQG IDLOHG WR H[SUHVV VHYHUDO 3:6 FDQGLGDWH JHQHV LQFOXGLQJ 6QXUI 6QUSQ DQG 1GQ 7KH VHFRQG GHOHWLRQ PRGHO ZDV FDXVHG E\ D WDUJHWHG GLVUXSWLRQ WKDW H[WHQGHG IURP H[RQ RI 6QXUI6QUSQ

PAGE 16

WR H[RQ RI 8EHD 7VDL HW DO Ef 3DWHUQDO WUDQVPLVVLRQ RI WKLV GHOHWLRQ UHVXOWHG LQ D OHVV VHYHUH SKHQRW\SH WKDQ WKH SUHYLRXV PRGHO b RI QHRQDWHV VXUYLYHG SDVW GD\V DQG b VXUYLYHG SDVW ZHDQLQJ $OWKRXJK VPDOOHU WKDQ WKHLU ZLOG W\SH OLWWHUPDWHV VXUYLYLQJ GHOHWLRQ PLFH PDOH DQG IHPDOHf ZHUH IHUWLOH XQOLNH PRVW LQGLYLGXDOV ZLWK 3:6 $ PRXVH PRGHO RI 3:6 SDWLHQWV ZLWK 83' KDV DOVR EHHQ JHQHUDWHG 7KHVH PLFH ZKLFK KDG PDWHUQDO 83' IRU PRXVH FKURPRVRPH & ZHUH WKH ILUVW PXULQH PRGHO WR UHFDSLWXODWH IHDWXUHV RI 3:6 &DWWDQDFK HW DO f 6LPLODU WR LQIDQWV ZLWK 3:6 WKHVH PLFH H[KLELWHG VHYHUH IDLOXUHWRWKULYH 8QWUHDWHG WKH PLFH GLHG ZLWKLQ VHYHQ GD\V RI ELUWK ([SUHVVLRQ DQDO\VLV UHYHDOHG D FRPSOHWH DEVHQFH RI 6QUSQ LQ WKHVH PLFH 7DUJHWHG GLVUXSWLRQ RI WKH 3:6 LPSULQWLQJ FHQWHU 3:6,&f KDV SURGXFHG D PRXVH PRGHO RI LPSULQWLQJ GHIHFWV ,'
PAGE 17

7VDL HW DO Df +RZHYHU LQ D VHFRQG VWXG\ PLFH WKDW LQKHULWHG D PXWDWHG 1GQ DOOHOH RQ WKH SDWHUQDOO\ LQKHULWHG FKURPRVRPH GHPRQVWUDWHG HDUO\ SRVWQDWDO OHWKDOLW\ *HUDUG HW DO f 7KHVH DXWKRUV EHOLHYH WKDW WKH JHQHWLF EDFNJURXQG LQIOXHQFHG WKH OHWKDO SKHQRW\SH 0RXVH 0RGHOV RI $6 7R GDWH IRXU PRXVH PRGHOV RI WKUHH &ODVVHV RI $6 GHOHWLRQV 83' DQG 8EHD PXWDWLRQVf KDYH EHHQ FUHDWHG ,Q DGGLWLRQ DQ DOWHUQDWLYH $6 PRGHO ZDV DOVR FUHDWHG IURP PLFH GHILFLHQW LQ *$%$ $ GHOHWLRQ PRXVH ZDV JHQHUDWHG E\ PDWHUQDO WUDQVPLVVLRQ RI WKH 7J3:6$6GHOf WUDQVJHQLF PRXVH *DEULHO HW DO f ,QLWLDO H[SHULPHQWV UHYHDOHG WKDW WKLV PRXVH PRGHO GHPRQVWUDWHG LPSULQWHG H[SUHVVLRQ RI 8EHD LQ WKH FHUHEHOOXP $ VHFRQG GHOHWLRQ PRXVH KDV DOVR EHHQ LGHQWLILHG -RKQVRQ HW DO f 7KLV PRXVH PRGHO H[KLELWHG D UDGLDWLRQLQGXFHG GHOHWLRQ WKDW H[WHQGHG IURP 8EHD WR WKH S ORFXV 0LFH ZLWK SDWHUQDO 83' IRU PRXVH FKURPRVRPH & GHPRQVWUDWHG $6OLNH IHDWXUHV LQFOXGLQJ DQ DWD[LF JDLW ((* DEQRUPDOLWLHV UHGXFHG EUDLQ ZHLJKW DQG ODWH RQVHW REHVLW\ &DWWDQDFK HW DO f 7DUJHWHG GLVUXSWLRQ RI WKH PDWHUQDO DOOHOH RI 8EHD UHVXOWHG LQ PLFH WKDW ZHUH YHU\ VLPLODU WR WKH 83' PRGHO ZLWK SRRU PRWRU VNLOOV LQGXFLEOH VHL]XUHV DQG FRQWH[WGHSHQGHQW OHDUQLQJ SUREOHPV -LDQJ HW DO f 0LWH KRPR]\JRXV IRU D QXOO PXWDWLRQ LQ *$%$(! DOVR GLVSOD\HG VHYHUDO IHDWXUHV RI $6 'H/RUH\ HW DO f DOWKRXJK KHWHUR]\JRWHV ZHUH QRW VWDWLVWLFDOO\ GLIIHUHQW IURP ZLOG W\SH OLWWHUPDWHV 7KHVH PLFH KDG VHYHUDO IHDWXUHV FRPPRQ WR LQGLYLGXDOV ZLWK $6 LQFOXGLQJ DEQRUPDO ((* SDWWHUQV VHL]XUHV OHDUQLQJ DQG PHPRU\ GHILFLWV SRRU PRWRU VNLOOV K\SHUDFWLYLW\ DQG D GLVWXUEHG UHVWDFWLYLW\ F\FOH

PAGE 18

'1$ 0HWK\ODWLRQ $Q (SLJHQHWLF 0DUN '1$ PHWK\ODWLRQ DQDO\VLV ILUVW SURSRVHG E\ 'ULVFROO DQG FROOHDJXHV f LV QRZ ZLGHO\ XVHG E\ UHVHDUFKHUV DQG GLDJQRVWLF ODERUDWRULHV WR GHWHFW SDUHQWDO FRQWULEXWLRQV EDVHG RQ WKH GLIIHUHQWLDO '1$ PHWK\ODWLRQ LPSULQWV DVVRFLDWHG ZLWK LPSULQWHG JHQHV 6HYHUDO VLWHV LQ T LQFOXGLQJ WKH 0.51 ORFXV 'ULVFROO HW DO f 1'1 -D\ HW DO f LQWURQ RI 61531 *OHQQ HW DO Ef DQG WKH &S* LVODQG RI f 61531 *OHQQ HW DO .XERWD HW DO E 6XWFOLIIH HW DO f GLVSOD\ SDUHQWVSHFLILF '1$ PHWK\ODWLRQ LPSULQWV LQ SHULSKHUDO EORRG OHXNRF\WHV DQG RWKHU WLVVXHV )LJXUH f 7KHVH LPSULQWV KDYH EHHQ XWLOL]HG WR UHOLDEO\ GLDJQRVH $6 DQG 3:6 SDWLHQWV ZKR KDYH GHOHWLRQV 83' DQG ,' &OD\WRQ6PLWK HW DO 'ULVFROO HW DO *OHQQ HW DO D *OHQQ HW DO f '1$ PHWK\ODWLRQ DQDO\VLV RI $6 DQG 3:6 SDWLHQWV KDV OHG WR WKH GLVFRYHU\ RI SDWLHQWV ZLWK GHIHFWV LQ WKH LPSULQWLQJ SURFHVV ,'f ,' SDWLHQWV KDYH ELSDUHQWDO LQKHULWDQFH RI FKURPRVRPH ZLWK QR HYLGHQFH RI WKH FRPPRQ 0E LQWHUVWLWLDO GHOHWLRQ EXW VWLOO VKRZ XQLSDUHQWDO '1$ PHWK\ODWLRQ LPSULQWV DW ORFL H[WHQGLQJ RYHU D 0E UHJLRQ RI T *OHQQ HW DO Df $ERXW b RI DOO $6 DQG 3:6 SDWLHQWV ZLWK LPSULQWLQJ GHIHFWV KDYH PLFURGHOHWLRQV ZLWKLQ WKH LPSULQWLQJ FHQWHU ,&f ZKLFK LV ORFDWHG DW WKH f HQG RI 61531 RQ T 1LFKROOV HW DO f 7KH UHPDLQLQJ ,' SDWLHQWV KDYH QR GHWHFWDEOH PXWDWLRQV DQG DUH WKRXJKW WR KDYH GHIHFWV LQ WKH SURFHVV RI HUDVLQJ DQGRU UHVHWWLQJ WKH HSLJHQRW\SH LQ WKH JHUP OLQH RU VRPDWLF WLVVXHV %XLWLQJ HW DO f 6WUXFWXUH DQG )XQFWLRQ RI WKH $63:6 ,PSULQWLQJ &HQWHU 'XULQJ HDFK JHQHUDWLRQ WKH SDUHQWDO HSLJHQHWLF PDUN PXVW EH HUDVHG LQ WKH JHUP OLQH DQG UHVHW DFFRUGLQJ WR WKH VH[ RI WKH RIIVSULQJ HQVXULQJ WKDW HDFK VXFFHVVLYH JHQHUDWLRQ ZLOO UHFHLYH WKH FRUUHFW SDUHQWDO LPSULQW LQ JHUP FHOOV DQG

PAGE 19

VRPDWLF WLVVXH 0LVWDNHV LQ WKH LPSULQWLQJ SURFHVV ZRXOG EH GHWULPHQWDO FDXVLQJ GLVHDVH LQ VXEVHTXHQW JHQHUDWLRQV EDVHG XSRQ SDUHQWDO LQKHULWDQFH )LJXUH f ,PSULQWLQJ GHIHFWV DUH UHVSRQVLEOH IRU b RI DOO $6 DQG 3:6 SDWLHQWV DQG GLVDEOH WKH HSLJHQHWLF VZLWFK IURP PDOH WR IHPDOH RU IHPDOH WR PDOH UHVSHFWLYHO\ 7KHVH GHOHWLRQV UDQJH IURP WR NE DQG FDQ UHJXODWH '1$ PHWK\ODWLRQ DQG H[SUHVVLRQ LPSULQWV RI JHQHV ORFDWHG DW OHDVW 0E IURP WKH ,& 7KH LGHQWLILFDWLRQ $6 DQG 3:6 LQGLYLGXDOV ZLWK LPSULQWLQJ GHIHFWV ODXQFKHG D QHZ ILHOG RI UHVHDUFK LQ DQ DWWHPSW WR IXUWKHU XQGHUVWDQG WKH PHFKDQLVPV RI LPSULQWHG H[SUHVVLRQ ZLWKLQ T *OHQQ HW DO D 5HLV HW DO f 'HOLQHDWLRQ RI WKH GHOHWLRQ EUHDNSRLQWV LQ VHYHUDO ,' SDWLHQWV ORFDOL]HG WKH FULWLFDO UHJLRQ IRU WKH ,& WR WKH SURPRWHU SUR[LPDO UHJLRQ RI 61531 )LJXUH $ %XLWLQJ HW DO 6DLWRK HW DO 6DLWRK HW DO f 7KH ,& H[WHQGV NE FHQWURPHULF WR WKH 61531 JHQH DQG HQFRGHV D WUDQVFULSW WKDW FRQWDLQV DOWHUQDWLYHO\ VSOLFHG XSVWUHDP H[RQV RI 61531 'LWWULFK HW DO f $OWKRXJK WKH ,& WUDQVFULSW LV QRW DEXQGDQWO\ H[SUHVVHG LW GHPRQVWUDWHV WLVVXHVSHFLILF SDWHUQDORQO\ H[SUHVVLRQ DQG LV WKRXJKW WR EH LQYROYHG LQ WKH HVWDEOLVKPHQW RI LPSULQWHG H[SUHVVLRQ DORQJ T $QDO\VLV RI &ODVV ,,, $6 DQG 3:6 LQGLYLGXDOV ZLWK GHOHWLRQV LQ WKH ,& UHYHDOHG WKDW WKH LPSULQWLQJ FHQWHU IXQFWLRQV DV D ELSDUWLWH VWUXFWXUH &KDUDFWHUL]DWLRQ RI WKHVH GHOHWLRQ EUHDNSRLQWV QDUURZHG WKH VPDOOHVW UHJLRQ RI GHOHWLRQ RYHUODS 652f IRU WKH $6 DQG 3:6 UHJLRQV RI WKH LPSULQWLQJ FHQWHU )LJXUH $f WR DQG NE UHVSHFWLYHO\ %XLWLQJ HW DO f $OO $6 SDWLHQWV ZLWK ,& PXWDWLRQV GHOHWH H[RQ RI WKH ,& WUDQVFULSW ZKLOH DOO 3:6 SDWLHQWV ZLWK ,& PXWDWLRQV KDYH GHOHWLRQV WKDW H[WHQG LQWR H[RQ RI 61531

PAGE 20

8%($ DQG WKH 8ELTXLWLQDWLRQ 3DWKZD\ 7KH LQYROYHPHQW RI 8%($ LQ WKH HWLRORJ\ RI $6 LV QRZ YHU\ ZHOO GRFXPHQWHG 6HYHUDO ODERUDWRULHV KDYH GHPRQVWUDWHG SURWHLQ WUXQFDWLQJ PXWDWLRQV RI 8%($ LQ PXOWLSOH $6 SDWLHQWV %DXPHU HW DO )DQJ HW DO )XQJ HW DO .LVKLQR HW DO /RVVLH HW DO 0DO]DF HW DO 0DWVXXUD HW DO 0LQDVVLDQ HW DO 0RQGD HW DO D 5XVVR HW DO YDQ GHQ 2XZHODQG HW DO f )XUWKHUPRUH PDWHUQDO WUDQVPLVVLRQ RI D WDUJHWHG GLVUXSWLRQ RI 8EHD UHVXOWHG LQ D PRXVH WKDW GLVSOD\HG VHYHUDO IHDWXUHV RI $6 LQFOXGLQJ PRWRU G\VIXQFWLRQ LQGXFLEOH VHL]XUHV DQG OHDUQLQJ GHILFLWV -LDQJ HW DO f 7KH XELTXLWLQ SDWKZD\ LV D YHU\ LPSRUWDQW FHOOXODU SURFHVV FRQWUROOLQJ WKH GHJUDGDWLRQ RI DOPRVW HYHU\ W\SH RI SURWHLQ LQFOXGLQJ UHJXODWRUV RI WKH FHOO F\FOH WUDQVFULSWLRQ IDFWRUV WXPRU VXSSUHVVRUV DQG '1$ UHSDLU HQ]\PHV &LHFKDQRYHU HW DO f ,Q DGGLWLRQ XELTXLWLQDWLRQ LV LQYROYHG LQ WKH HWLRORJ\ RI VHYHUDO GLVHDVHV $QJHOPDQ V\QGURPH FDXVHG E\ ODFN RI WKH ( XELTXLWLQ SURWHLQ OLJDVH JHQH ZDV WKH ILUVW KXPDQ GLVHDVH DWWULEXWHG WR PXWDWLRQV LQ WKH XELTXLWLQDWLRQ SDWKZD\ 2WKHU GLVHDVHV QRZ DVFULEHG WR GHIHFWV LQ XELTXLWLQDWLRQ LQFOXGH /LGGOHfV V\QGURPH D VHYHUH IRUP RI IDPLOLDO K\SHUWHQVLRQ DQG VHYHUDO VSHFLILF FDQFHUV ,Q DGGLWLRQ HYLGHQFH VXJJHVWV WKDW WKH XELTXLWLQDWLR SDWKZD\ LV LQYROYHG LQ WKH SDWKRJHQHVLV RI 6SLQRFHUHEHOODU $WD[LD W\SH 'L*HRUJH 6\QGURPH DQG &\VWLF )LEURVLV DV ZHOO DV ODWH RQVHW $O]KHLPHUfV 3DUNLQVRQfV DQG +XQWLQJWRQ GLVHDVHV 7KH SURFHVV RI SURWHLQ XELTXLWLQDWLRQ LV FRPSOH[ VSHFLILF DQG UDSLG 0XOWLSOH JHQHV ZKLFK XWLOL]H GLIIHUHQW XELTXLWLQ SDWKZD\V JLYH WKH V\VWHP LWV VSHFLILFLW\ DQG FRPSOH[LW\ &LHFKDQRYHU HW DO f 7KH ( HQ]\PHV ZKLFK DUH WKH PRVW GLYHUVH FRQVLVW RI DW OHDVW VL[ GLIIHUHQW IDPLOLHV HDFK IDPLO\ SURFHVVHV SURWHLQV LQ VOLJKWO\ GLIIHUHQW ZD\V 7KH JHQH UHVSRQVLEOH IRU $QJHOPDQ V\QGURPH 8%($ LV LQYROYHG LQ

PAGE 21

WKH WUDQVIHU RI DQ DFWLYDWHG XELTXLWLQ PROHFXOH WR WKH SURWHLQ VXEVWUDWH 8%($ LV WKH IRXQGLQJ PHPEHU RI WKH +(&7GRPDLQ KRPRORJRXV WR ($3 FDUER[\O WHUPLQXVf IDPLO\ RI ( OLJDVHV 7KHVH SURWHLQV DFW DV LQWHUPHGLDULHV EHWZHHQ WKH ( XELTXLWLQ FRQMXJDWLQJ HQ]\PHV DQG WKH WDUJHWHG VXEVWUDWH 7KLV VXJJHVWV WKDW DFFXPXODWLRQ RI D VSHFLILF SURWHLQ LQ FHUWDLQ UHJLRQV RI WKH EUDLQ LV WKH PDLQ FDXVH RI WKH $6 SKHQRW\SH +RZHYHU SDWLHQWV ZLWK $6 GR QRW GHPRQVWUDWH D SKHQRW\SH FRQVLVWHQW RWKHU SURWHLQ VWRUDJH GLVRUGHUV 8%($ LV LQYROYHG LQ WKH WUDQVIHU RI XELTXLWLQ PRLHWLHV WR SURWHLQV WDUJHWHG IRU GHJUDGDWLRQ YLD WKH 6 SURWHRVRPH ,W ZDV FORQHG LQ E\ LWV DELOLW\ LQ FRQMXQFWLRQ ZLWK WKH ( RQFRSURWHLQ RI WKH FDQFHUDVVRFLDWHG KXPDQ SDSLOORPDYLUXVHV +39f WR GHDFWLYDWH WKH S WXPRUVXSSUHVVRU SURWHLQ +XLEUHJWVH HW DO Df ,Q +39 LQIHFWHG FHOOV WKH (8%($ SURWHLQ FRPSOH[ VHOHFWLYHO\ ERXQG S DQG WDUJHWHG LW IRU GHJUDGDWLRQ YLD WKH XELTXLWLQDWLRQ SDWKZD\ 7KUHH IXQFWLRQDO GRPDLQV RI 8%($ KDYH EHHQ LGHQWLILHG DQ ( SURWHLQ ELQGLQJ VLWH D S ELQGLQJ VLWH DQG D +(&7 GRPDLQ ZKLFK LV QHFHVVDU\ IRU XELTXLWLQDWLRQ +XLEUHJWVH HW DO Ef 3URWHLQ XELTXLWLQDWLRQ YLD WKH +(&7 IDPLO\ RI SURWHLQ OLJDVHV UHTXLUHV WKH FRPELQHG HIIRUWV RI PXOWLSOH HQ]\PHV )LJXUH &LHFKDQRYHU HW DO f ( DFWLYDWHV WKH XELTXLWLQ PRLHW\ ZKLFK WKHQ DWWDFKHV WR DQ ( HQ]\PH YLD D KLJKHQHUJ\ WKLRHVWHU ERQG 7KH ( HQ]\PH LQWHUDFWV ZLWK RQH +(&7 GRPDLQ IDPLO\ PHPEHU WUDQVIHUULQJ WKH XELTXLWLQ PROHFXOH WR WKH ( 7KH FRPSOH[ FRQWDLQLQJ XELTXLWLQ DV ZHOO DV WKH ( DQG ( HQ]\PHV WKHQ IROORZV RQH RI WZR NQRZQ SDWKV ,Q WKH ILUVW SDWKZD\ WKH SURWHLQ VXEVWUDWH ELQGV WKH FRPSOH[ DQG D VLQJOH XELTXLWLQ PRLHW\ LV DWWDFKHG ,Q WKH DOWHUQDWLYH SDWKZD\ WKH FRPSOH[ UHTXLUHV WKH LQWHUDFWLRQ RI DQ DQFLOODU\ SURWHLQ VXFK DV S IRU WDUJHW UHFRJQLWLRQ :LWK WKH KHOS RI WKH ( HQ]\PH

PAGE 22

WKH XELTXLWLQ FKDLQV SRO\PHUL]H WDUJHWLQJ WKH SURWHLQV IRU GHJUDGDWLRQ YLD WKH 6 SURWHRVRPH .RHJO HW DO f 7KH IROORZLQJ FKDSWHUV GHVFULEH P\ ZRUN RQ WKH PROHFXODU JHQHWLFV DQG SDWKRJHQHWLF PHFKDQLVPV RI $QJHOPDQ V\QGURPH

PAGE 23

1$3 ,037 .Y/47/,7 0 7$3$ $6&/ 766& )LJXUH ,PSULQWHG JHQHV RQ S 7KLV PDS LOOXVWUDWHV WKH JHQHV WRSf WKDW PDS WR WKH %HFNZLWK:LHGHPDQQ V\QGURPH UHJLRQ RQ KXPDQ FKURPRVRPH ZLWK WKH LPSULQWLQJ VWDWXV RI WKH KXPDQ JHQHV GHSLFWHG 7KH PDWHUQDO 0f DQG SDWHUQDO 3f DOOHOHV DV ZHOO DV H[SUHVn VLRQ SURILOHV RI ELDOOHOLF Â’f PDWHUQDO Â’ f DQG SDWHUQDO+f JHQHV DUH LQGLFDWHG $UURZV LQGLFDWH ORFDWLRQ RI WUDQVFULSWLRQ VWDUW VLWH DQG GLUHFWLRQ RI WUDQVFULSWLRQ )LJXUH QRW GUDZQ WR VFDOH

PAGE 24

0DW )LJXUH *HQRPLF LPSULQWLQJ RI + DQG ,JI LQ WKH PRXVH 7KH ,JI DQG + JHQHV DUH VKRZQ 7KH GLIIHUHQWLDOO\ PHWK\ODWHG UHJLRQ '05f RI + LV ORFDWHG f WR WKH WUDQVFULSWLRQDO VWDUW VLWH 2Q WKH PDWHUQDO FKURPRVRPH 0DWf WKH '05 LV XQPHWK\ODWHG ZKLWH OROOLSRSVf ZKLFK IDFLOLWDWHV ELQGLQJ RI WKH &7&) SURWHLQ 7KLV LQWHUDFn WLRQ DOORZV WKH HQKDQFHUV (f WR LQWHUDFW ZLWK + EXW SURKLELWV LQWHUn DFWLRQV EHWZHHQ WKH HQKDQFHUV DQG WKH ,JI SURPRWHU 2Q WKH SDWHUn QDO FKURPRVRPH 3DWf WKH '05 LV PHWK\ODWHG &7&) FDQQRW ELQG DQG WKH HQKDQFHUV SUHIHUHQWLDOO\ LQWHUDFW ZLWK WKH SURPRWHU RI ,JI LQGXFLQJ H[SUHVVLRQ

PAGE 25

, 3 0 Z b ,, ,,, ,9 9 S S 3 03f 30 30 b b 30 00 30f 3 X b b 'HOHWLRQ 83' b ,' ? I ? b 3 0 I M ? Rb b 3 0 Rb 6JO *HQH 8QNQRZQ )LJXUH 0ROHFXODU FODVVHV RI $6 DQG 3:6 LQ WKH 8) UHSRVLWRU\ $ WRWDO $6 IDPLOLHV SDWLHQWVf DQG 3:6 IDPLOLHV ZHUH DQDO\]HG )DPLOLDO FDVHV ZHUH FRXQWHG DV RQH FDVH SHU IDPLO\ 7KH PDWHUQDO 0f DQG SDWHUQDO 3f FKURPRVRPHV DUH LQGLFDWHG 3HUFHQWDJHV RI SDWLHQWV LQ HDFK PROHFXODU FODVV DUH QRWHG &ODVV ,f 0E LQWHUVWLWLDO GHOHWLRQV RI T T &ODVV ,,f SDWLHQWV ZLWK XQLSDUHQWDO GLVRP\ RI FKURPRVRPH &ODVV ,,,f SDWLHQWV ZKR KDYH LPSULQWLQJ GHIHFWV ZKLFK FDXVH FKDQJHV WKH HSLJHQR W\SH DORQJ T &ODVV ,9f SDWLHQWV ZLWK PXWDWLRQV LQ D VLQJOH JHQH 8%($ ;f &ODVV 9f SDWLHQWV ZLWK QR GHWHFWDEOH PROHFXODU GHIHFW

PAGE 26

$ 3:6 f§ ,& 0$*(/ 0.51 1'1 ,& 7UDQVFULSW %' H[RQV RE U '4' 61531 ,3: ]]L]K $6 8%($ E 0.51$6 $6,& 3:6,& 8%($$6 % 3 f§ f§ f§ & 5155 =1) 1'1 3: < 61531 n&S* LQWURQ ,3: +%f§% 8%($ )LJXUH '1$ PHWK\ODWLRQ DQG H[SUHVVLRQ LPSULQWV LQ T 7KLV ILJXUH GHSLFWV WKH '1$ PHWK\ODWLRQ DQG H[SUHVVLRQ LPSULQWV RI VHYHUn DO LPSULQWHG JHQHV RQ T $f 2YHUYLHZ RI WKH $63:6 LPSULQWHG GRPDLQ 7KH FKURPRVRPDO UHJLRQV RI WKH 3UDGHU:LOOL DQG $QJHOPDQ V\Qn GURPHV DUH LQGLFDWHG E\ EROG DUURZV WRSf 7KH H[WHQW RI WKH LPSULQWLQJ FHQWHU ,&f LV DOVR VKRZQ 7KH $63:6 GRPDLQ LV GHSLFWHG DV D OLQH ZLWK WKH RULHQWDWLRQ RI WKH FHQWURPHUH &f DQG WHORPHUH 7f QRWHG QRW WR VFDOHf 5HODWLYH SRVLWLRQV RI JHQHV DQG WUDQVFULSWV DUH LQGLFDWHG DERYH WKH OLQH ZKLOH DQWLVHQVH WUDQVFULSWV DUH VKRZQ EHORZ $UURZV GHPRQn VWUDWH WUDQVFULSWLRQDO RULHQWDWLRQ 7KH 652V IRU WKH $6,& DQG 3:6,& DUH VKRZQ EHORZ WKH FKURPRVRPH %f ([SUHVVLRQ LPSULQWV RI VHOHFWHG T JHQHV 2YHUDOO LPSULQWHG H[SUHVVLRQ SURILOHV RI WKH PDWHUQDO 0f DQG SDWHUQDO 3f DOOHOHV DUH GHSLFWHG $FWLYH f DQG VLOHQFHG f§f FKURPRn VRPHV DUH LQGLFDWHG 7LVVXHVSHFLILF LPSULQWLQJ LV DOVR LQGLFDWHG f§f &f '1$ PHWK\ODWLRQ LPSULQWV RI VHOHFW ORFL DORQJ WKH $63:6 LPSULQWHG GRPDLQ 0DWHUQDO LPSULQWV 0f DUH VKRZQ DERYH WKH VROLG OLQH ZKLOH SDWHUQDO LPSULQWV 3f DUH UHYHDOHG EHORZ *HQH DQG ORFXV QDPHV DUH VKRZQ 0HWK\ODWHG ‘f DQG XQPHWK\ODWHG ’f DOOHOHV DUH LQGLFDWHG 7KLV ILJXUH GRHV QRW GLVWLQJXLVK EHWZHHQ SDUWLDOO\ DQG IXOO\ PHWK\ODWHG ORFL

PAGE 27

$6 $6 )LJXUH ,QKHULWDQFH RI DQ LPSULQWLQJ GHIHFW 6LOHQW WUDQVPLVVLRQ DQG LQKHULWDQFH RI DQ LPSULQWLQJ GHIHFW LQ $QJHOPDQ V\QGURPH RYHU IRXU JHQHUDWLRQV )HPDOHV FLUFOHVf DQG PDOHV VTXDUHVf DUH VKRZQ LQ HDFK JHQHUDWLRQ 3DWHUQDO 3f FKURPRVRPHV DUH EODFN ZKLOH PDWHUQDO 0f FKURPRVRPHV DUH JUH\ ,PSULQWLQJ PXWDWLRQV DUH GHSLFWHG ZLWK DSSURSULDWH HSLJHQRW\SHV LQ SDUHQWKHVLV $IIHFWHG VLEOLQJV DUH GHQRWHG ZLWK D JUH\ FLUFOH RU ER[

PAGE 28

)LJXUH 7KH XELTXLWLQDWLRQ SDWKZD\ LQYROYLQJ WKH +(&7 IDPLO\ RI XELTXLWLQ SURWHLQOLJDVHV $f 8ETXLWLQ LV DFWLYDWHG DQG ERXQG E\ WKH ( XELTXLWLQDFWLYDWLQJ HQ]\PH %f 7KH ( HQ]\PH WUDQVIHUV WKH DFWLYDWHG XELTXLWLQ WR DQ ( XELTXLWLQFRQMXJDWLQJ HQ]\PH 6HYHUDO ( HQ]\PHV DUH NQRZQ WR LQWHUDFW ZLWK 8%($ &f $ PHPEHU RI WKH +(&7 IDPLO\ ELQGV WR LWV ( FRQMXJDWLQJ HQ]\PH 'f 7KH DFWLYH XELTXLWLQ FRPSOH[ HLWKHU UHFRJQL]HV D VSHFLILF VXEVWUDWH RU UHTXLUHV WKH KHOS RI DQ DQFLOODU\ SURWHLQ HJ WKH ( SURWHLQ IURP +39f WR ELQG LWV VXEVWUDWH (f 2QFH ERXQG WR LWV WDUJHW SURWHLQ WKH XELTXLWLQ(( FRPSOH[ WUDQVIHUV WKH DFWLYDWHG XELTXLWLQ PRLHW\ WR LWV VXEVWUDWH )f 7KH ( SURWHLQ WKHQ DLGV LQ SRO\PHUL]DWLRQ RI XELTXLWLQ PROHFXOHV RQ WKH VXEVWUDWH 7KH SURWHLQ WKHQ LV GHJUDGHG YLD WKH 6 SURWHRVRPH

PAGE 29

75$160,66,21 2) $1*(/0$1 6<1'520( %< $1 $))(&7(' 027+(5 ,QWURGXFWLRQ 7KH $QJHOPDQ V\QGURPH $6f LV D VHYHUH GHYHORSPHQWDO DQG QHXUREHKDYLRUDO GLVRUGHU FKDUDFWHUL]HG E\ IRXU FDUGLQDO IHDWXUHV f VHYHUH GHYHORSPHQWDO GHOD\ f SURIRXQG VSHHFK LPSDLUPHQW f D PRYHPHQW DQG EDODQFH GLVRUGHU DQG f DQ $6 VSHFLILF EHKDYLRU ZKLFK LQFOXGHV IUHTXHQW DQG LQDSSURSULDWH ODXJKWHU D KDSS\ DIIHFW DQG DQ HDVLO\ H[FLWDEOH SHUVRQDOLW\ :LOOLDPV HW DO D :LOOLDPV HW DO f 0RVW $6 FDVHV DULVH GH QRYR WKH FRQVHTXHQFHV RI ODUJH GHOHWLRQV IURP WKH PDWHUQDOO\ GHULYHG T :LOOLDPV HW DO f $6 KDV DOVR EHHQ GLDJQRVHG LQ SDWLHQWV ZLWK SDWHUQDO XQLSDUHQWDO GLVRP\ LPSULQWLQJ GHIHFWV RQ PDWHUQDO T DQG PDWHUQDOO\ LQKHULWHG PXWDWLRQV LQ WKH $ XELTXLWLQ SURWHLQ OLJDVH JHQH 8%($ *OHQQ HW DO f 7KH 3UDGHU:LOOL V\QGURPH 3:6f LV D VHSDUDWH GLVWLQFW QHXUREHKDYLRUDO V\QGURPH DOVR DVVRFLDWHG ZLWK T GHOHWLRQV +RZHYHU WKH GHILFLHQF\ LQ 3:6 LV DOZD\V SDWHUQDO LQ RULJLQ *OHQQ HW DO f $OO RI WKH FDUGLQDO IHDWXUHV RI $6 FDQ EH FDXVHG E\ PXWDWLRQV LQ WKH 8%($ JHQH .LVKLQR HW DO 0DWVXXUD HW DO f ZKLFK VKRZV LPSULQWHG H[SUHVVLRQ LQ VSHFLILF UHJLRQV RI WKH PDPPDOLDQ EUDLQ $OEUHFKW HW DO 5RXJHXOOH HW DO 9X DQG +RIIPDQ f ,QGLYLGXDOV ZLWK $6 DFKLHYH SXEHUW\ QRUPDOO\ ZLWK ERWK PDOHV DQG IHPDOHV KDYLQJ QRUPDO VHFRQGDU\ VH[XDO FKDUDFWHULVWLFV LQFOXGLQJ QRUPDO PHQVHV LQ IHPDOHV :LOOLDPV HW DO Ef +RZHYHU WKHUH KDYH EHHQ QR GRFXPHQWHG FDVHV RI UHSURGXFWLRQ LQ HLWKHU PDOHV RU IHPDOHV ZLWK $6 ,Q WKLV UHSRUW ZH SUHVHQW WKH ILUVW

PAGE 30

GRFXPHQWHG FDVH RI UHSURGXFWLRQ LQ DQ LQGLYLGXDO ZLWK $6 WKDW UHVXOWHG LQ WKH PDWHUQDO WUDQVPLVVLRQ RI D T GHOHWLRQ WR D IHWXV ZKLFK ZDV HOHFWLYHO\ WHUPLQDWHG DW ZHHNV JHVWDWLRQ /RVVLH DQG 'ULVFROO f 0HWKRGV 6XEMHFWV 7KH SUREDQG LV QRZ D \HDU ROG IHPDOH ZLWK $6 ZKR KDV EHHQ IROORZHG LQWHUPLWWHQWO\ LQ WKH 8) *HQHWLFV FOLQLF VLQFH PRQWKV RI DJH 5HFHQWO\ WKH IDPLO\ UHFRQWDFWHG WKH *HQHWLFV VHUYLFH GXH WR WKH SUREDQGfV XQH[SHFWHG SUHJQDQF\ +LJK UHVROXWLRQ FKURPRVRPDO DQDO\VLV LQ WKH SDVW GHPRQVWUDWHG D T GHOHWLRQ LQ WKH SUREDQG ZKLFK '1$ SRO\PRUSKLVP DQG PHWK\ODWLRQ VWXGLHV VXEVHTXHQWO\ FRQILUPHG :LOOLDPV HW DO f 7KLV IDPLO\ ZDV LQLWLDOO\ UHSRUWHG LQ ZKHQ WKH FRQFHUQ ZDV UDLVHG WKDW WKH SUREDQGfV PRWKHU ZKR ZDV RI QRUPDO LQWHOOLJHQFH FRXOG EH PRVDLF IRU RU DOVR KDYH D VXEPLFURVFRSLF GHOHWLRQ RI T EHFDXVH VKH GLVSOD\HG EUDFK\FHSKDO\ KHDULQJ ORVV DQ HQODUJHG IRUDPHQ PDJQXP DQG PLOG DWD[LD +RZHYHU H[WHQVLYH PROHFXODU DQDO\VHV RI SHULSKHUDO EORRG DQG VNLQ ILEUREODVWV IDLOHG WR UHYHDO DQ\ DEQRUPDOLWLHV LQ T LQ WKH PRWKHU RI WKH SUREDQG 7KH SUREDQG KDV FODVVLF $6 IHDWXUHV ZLWK VHYHUH PHQWDO UHWDUGDWLRQ DQ $6 VSHFLILF EHKDYLRU D FRPSOHWH ODFN RI VSHHFK DQG D PRYHPHQW GLVRUGHU FKDUDFWHUL]HG E\ DWD[LD $Q DEQRUPDO ((* DQG VHL]XUHV ZHUH DOVR QRWHG DW PRQWKV 6KH EHJDQ ZDONLQJ DW \HDUV DQG KHU VHYHUH WUXQFDO DWD[LD KDV LPSURYHG ZLWK DJH 7KH SUREDQG DOVR KDV PLFURFHSKDO\ ZLWK D KHDG FLUFXPIHUHQFH RI OHVV WKDQ VWDQGDUG GHYLDWLRQV UHODWLYH SURJQDWKLVP D SURWUXGLQJ WRQJXH H[FHVVLYH GURROLQJ DQG DQ LQDSSURSULDWHO\ KDSS\ DIIHFW ZLWK H[FHVVLYH ODXJKWHU 0HQDUFKH EHJDQ DW \HDUV $ KHDG &7 DQG 05, ZHUH RQO\ UHPDUNDEOH IRU DQ HQODUJHG IRUDPHQ PDJQXP

PAGE 31

7KH IDPLO\ GHFLGHG WR WHUPLQDWH WKH SUHJQDQF\ DW ZHHNV JHVWDWLRQ 7KH WHUPLQDWLRQ ZDV E\ VXFWLRQ GLODWDWLRQ DQG FXUHWWDJH ,GHQWLILDEOH IHWDO WLVVXH ZDV GLVVHFWHG LPPHGLDWHO\ IUR]HQ LQ OLTXLG QLWURJHQ DQG VWRUHG DW r& 'XH WR WKH VXFWLRQ SURFHGXUH WKH RQO\ LQWDFW EUDLQ VDPSOHV REWDLQHG ZHUH WKH H\HV 7LVVXH ZDV SURFXUHG ZLWK WKH DSSURYDO RI WKH IDPLO\ DQG WKH 8QLYHUVLW\ RI )ORULGD ,QVWLWXWLRQDO 5HYLHZ %RDUG 0LFURVDWHOOLWH $QDO\VLV '1$ ZDV H[WUDFWHG IURP SHULSKHUDO EORRG OHXNRF\WHV 3%/f DQG ZKROH WLVVXH DFFRUGLQJ WR VWDQGDUG WHFKQLTXHV 'ULVFROO DQG 0LJHRQ f 3&5 DPSOLILFDWLRQ RI WKH '6 '6 $&7,1 $&7&f '6 DQG '6 ORFL 5HVHDUFK *HQHWLFVf ZDV DV SUHYLRXVO\ GHVFULEHG &ROPDQ HW DO f '1$ 0HWK\ODWLRQ $QDO\VHV 6RXWKHUQ %ORW '1$ PHWK\ODWLRQ DQDO\VHV ZHUH SHUIRUPHG ZLWKLQ T DW 61531 *OHQQ HW DO f DQG 1(&',1 1'1f DQG LQ S .Y'05, 6PLOLQLFK HW DO f DFFRUGLQJ WR SXEOLVKHG SURWRFROV '1$ PHWK\ODWLRQ DQDO\VLV RI 1'1 ZDV DW D QRYHO %VV +OO VLWH $& /RVVLH 5' 1LFKROOV ''ULVFROO XQSXEOLVKHG GDWDf ZKLFK LV ORFDWHG ZLWKLQ WKH VDPH +LQG ,,, IUDJPHQW DV WKH SXEOLVKHG LPSULQWHG (DJ VLWH -D\ HW DO f 6SHFLILF FRQGLWLRQV IRU HDFK ORFXV DUH VKRZQ LQ 7DEOH 7DEOH &RQGLWLRQV IRU 6RXWKHUQ EORWV *HQH SJ '1$ 5( 5( b *HO 9KUV :DVK & 61531 ;ED 1RW 1(&',1 +LQG ,,, %VV +OO .Y/47 (FR 5O 1RW 6SHFLILF UHVWULFWLRQ HQ]\PHV 5(f DQG YROW}KRXUV 9mKUVf IRU HDFK ORFXV DUH QRWHG

PAGE 32

0HWK\ODWLRQ 6SHFLILF 3&5 063f 063 UHOLHV RQ WKH VHOHFWLYH DELOLW\ RI VRGLXP ELVXOILWH WR FRQYHUW XQPHWK\ODWHG F\WRVLQH WR XUDFLO ZKLOH OHDYLQJ PHWK\ODWHG F\WRVLQH XQWRXFKHG 'XULQJ 3&5 DPSOLILFDWLRQ XUDFLO LV FRQYHUWHG WR WK\PLGLQH SURYLGLQJ D PHWKRG WR GLVWLQJXLVK EHWZHHQ WKH PHWK\ODWHG DQG XQPHWK\ODWHG DOOHOHV 063 DW f 61531 ZDV GRQH DFFRUGLQJ WR WKH PDQXIDFWXUHUV UHFRPPHQGDWLRQV 2QFRUf XVLQJ SULPHUV GHYHORSHG E\ .XERWD DQG FROOHDJXHV .XERWD HW DO f 573&5 P51$ ZDV LVRODWHG IURP IHWDO H\H DQG O\PSKREODVW FHOO OLQHV XVLQJ WKH 3RO\WUDFW 6\VWHP P51$ H[WUDFWLRQ NLW 3URPHJDf F'1$V ZHUH UHYHUVHWUDQVFULEHG IURP QJ RI P51$ XVLQJ WKH 6XSHUVFULSWr1 $PSOLILFDWLRQ NLW *LEFRf 573&5 DQDO\VLV RI 8%($ ZDV DFFRPSOLVKHG XVLQJ SUHYLRXVO\ SXEOLVKHG SULPHUV WKDW DPSOLI\ DQ ES IUDJPHQW IURP H[RQV WR IRUPHUO\ 8 WR f RI 8%($ 0DWVXXUD HW DO f $ ES IUDJPHQW RI 61531 ZDV DPSOLILHG XVLQJ SULPHUV VSHFLILF IRU H[RQ f 77**&$&$&&$*&7**7$&7ff WKURXJK H[RQ f&$&&7*$*$&*$$&7$&$*ff LQ D VWDQGDUG UHDFWLRQ ZLWK D r& DQQHDOLQJ WHPSHUDWXUH $PSOLILFDWLRQ SURGXFWV ZHUH VL]H IUDFWLRQDWHG E\ JHO HOHFWURSKRUHVLV 6RXWKHUQ EORWWHG DQG YLVXDOL]HG E\ DXWRUDGLRJUDSK\ 5HVXOWV *HQHWLF $QDO\VLV 7KH SUREDQG IHWXV DQG SDUHQWV RI WKH SUREDQG ZHUH JHQRW\SHG E\ PLFURVDWHOOLWH DQDO\VLV RI ORFL VHH PDS )LJXUH $f ZLWKLQ '6 DQG '6 &KULVWLDQ HW DO f DQG GLVWDO WR T $&7,1 '6 DQG '6f :LWKLQ T WKH SUREDQG DQG IHWXV ODFNHG D PDWHUQDO JHQHWLF FRQWULEXWLRQ )LJXUH %f $W '6 WKH SUREDQG DQG IHWXV RQO\ DPSOLILHG WKH SDWHUQDOO\ LQKHULWHG DOOHOH

PAGE 33

$OWKRXJK WKH SUREDQG ZDV QRQLQIRUPDWLYH DW '6 WKH IHWXV VKRZHG H[FOXVLYH DPSOLILFDWLRQ RI WKH SDWHUQDOO\ GHULYHG DOOHOH +RZHYHU WKH SUREDQG DQG IHWXV ZHUH KHWHUR]\JRXV DW VHYHUDO ORFL GLVWDO WR T LQFOXGLQJ '6 $&7,1 )LJXUH &f DQG '6 GDWD QRW VKRZQf 7KHUHIRUH ERWK WKH SUREDQG DQG IHWXV KDYH PDWHUQDOO\ LQKHULWHG GHOHWLRQV ZKLFK DUH UHVWULFWHG WR T '1$ 0HWK\ODWLRQ $QDO\VHV '1$ PHWK\ODWLRQ DQDO\VLV LV D SRZHUIXO GLDJQRVWLF WRRO WKDW WDNHV DGYDQWDJH RI WKH GLIIHUHQWLDO PHWK\ODWLRQ IRXQG LQ LPSULQWHG UHJLRQV RI WKH JHQRPH 7KH $63:6 LPSULQWHG GRPDLQ FRQWDLQV VHYHUDO ORFL WKDW GLVSOD\ SDUHQWRIRULJLQ PHWK\ODWLRQ LPSULQWV *OHQQ HW DO f 61531 DQG 1'1 DUH WZR RI VHYHUDO SDWHUQDOO\ H[SUHVVHG JHQHV ZLWKLQ T ZKLFK DUH SUHIHUHQWLDOO\ PHWK\ODWHG RQ WKH UHSUHVVHG PDWHUQDO DOOHOH *OHQQ HW DO -D\ HW DO 6XWFOLIIH HW DO f 7ZR PHWKRGV FDQ DVVHVV '1$ PHWK\ODWLRQ DW f 61531 6RXWKHUQ DQDO\VLV DQG 063 *OHQQ HW DO .XERWD HW DO .XERWD HW DO E 6XWFOLIIH HW DO f 6RXWKHUQ DQDO\VLV UHYHDOV D NE PDWHUQDO DQG D NE SDWHUQDO EDQG LQ WKH SDUHQWV DQG QRUPDO FRQWUROV +RZHYHU WKH SUREDQG DQG IHWXV RQO\ KDYH WKH NE SDWHUQDO EDQG )LJXUH f FRQILUPLQJ WKH ODFN RI D PDWHUQDO f 61531 DOOHOH LQ WKHVH VDPSOHV ,Q DFFRUGDQFH ZLWK 6RXWKHUQ DQDO\VLV 063 DQDO\VLV RI SDUHQWDO 3%/ DQG QRUPDO IHWDO H\H '1$ VKRZV ERWK WKH PDWHUQDO DQG SDWHUQDO 3&5 DPSOLILFDWLRQ SURGXFWV +RZHYHU 3%/ '1$ IURP WKH SUREDQG DQG H\H '1$ IURP WKH IHWXV H[FOXVLYHO\ DPSOLILHG WKH SDWHUQDO FKURPRVRPH )LJXUH f 3UHYLRXV PHWK\ODWLRQ VWXGLHV RI WKH &S* LVODQG DVVRFLDWHG ZLWK 1'1 UHYHDOHG D SDUHQWVSHFLILF '1$ PHWK\ODWLRQ LPSULQW IURP '1$ GLJHVWHG ZLWK +LQG ,,, DQG IDJ -D\ HW DO f $ %VV +OO PHWK\ODWLRQ LPSULQW LV DOVR SUHVHQW LQ WKLV NE +LQG ,,, IUDJPHQW $& /RVVLH 5' 1LFKROOV ''ULVFROO XQSXEOLVKHG GDWDf 1'1 K\EULGL]HV WR

PAGE 34

WKUHH IUDJPHQWV LQ FRQWURO VDPSOHV D NE PDWHUQDOVSHFLILF D NE FRQVWDQW DQG D NE SDWHUQDOVSHFLILF IUDJPHQW )LJXUH f 1RUPDO 3%/ DQG IHWDO H\H '1$ UHYHDO ERWK WKH PDWHUQDO DQG SDWHUQDO GLDJQRVWLF EDQGV +RZHYHU 3%/ '1$ IURP LQGLYLGXDOV ZLWK 3:6 UHYHDOV WKH SUHGRPLQDQFH RI WKH PHWK\ODWHG NE IUDJPHQW ZKLOH 1'1 K\EULGL]HG WR WKH SDWHUQDOVSHFLILF XQPHWK\ODWHG NE IUDJPHQW LQ SDWLHQWV ZLWK $6 '1$ IURP WKH SDUHQWV RI WKH $6 SUREDQG GHPRQVWUDWHV QRUPDO ELSDUHQWDO PHWK\ODWLRQ ZKLOH $6 PHWK\ODWLRQ LPSULQWV DUH DSSDUHQW LQ 3%/ '1$ IURP WKH SUREDQG ZLWK $6 DQG H\H WLVVXH IURP WKH IHWXV ZLWK $6 $ GLIIHUHQWLDOO\ PHWK\ODWHG UHJLRQ QHDU DQ DQWLVHQVH WUDQVFULSW RI WKH .Y/47, JHQH LQ WKH %HFNZLWK:LHGHPDQQ V\QGURPH UHJLRQ RQ FKURPRVRPH ZDV DOVR H[DPLQHG 6PLOLQLFK HW DO f 1RUPDO LQGLYLGXDOV KDYH DQG NE GLDJQRVWLF EDQGV ZKLFK FRUUHVSRQG ZLWK WKH PHWK\ODWHG DQG XQPHWK\ODWHG DOOHOHV UHVSHFWLYHO\ $OO RI RXU VDPSOHV VKRZHG QRUPDO '1$ PHWK\ODWLRQ LPSULQWV DW WKLV QRQFKURPRVRPH GLIIHUHQWLDOO\ PHWK\ODWHG VLWH GDWD QRW VKRZQf *HQH ([SUHVVLRQ 573&5 DQDO\VHV RI $6 IHWDO H\H QRUPDO IHWDO H\H DQG 3:6 O\PSKREODVW FHOOV UHYHDOHG D NE WUDQVFULSW IURP H[RQV WR RI 8%($ LQ DOO WLVVXHV )LJXUH f +RZHYHU DV H[SHFWHG 61531 ZDV RQO\ H[SUHVVHG LQ WKH $6 DQG QRUPDO WLVVXHV WKH 3:6 VDPSOH IDLOHG WR DPSOLI\ 61531 *OHQQ HW DO f 'LVFXVVLRQ 7KH SUHVHQFH RI $6VSHFLILF '1$ PHWK\ODWLRQ LPSULQWV DQG DEVHQFH RI D PDWHUQDO FRQWULEXWLRQ RI SUR[LPDO T GHPRQVWUDWHV WKDW WKH SDWLHQW ZLWK $6 SDVVHG KHU T GHOHWLRQ WR KHU IHWXV 7KHVH ILQGLQJV FRQFOXVLYHO\ GHPRQVWUDWH WKDW IHPDOHV ZLWK $6 DUH FDSDEOH RI UHSURGXFWLRQ DQG VKRZ WKDW WKH SUHYLRXVO\ REVHUYHG

PAGE 35

ODFN RI UHSURGXFWLRQ LV PRVW OLNHO\ GXH WR VRFLDOFRJQLWLYH EHKDYLRU YHUVXV SK\VLRORJLFDO UHDVRQV 7KHUHIRUH DSSURSULDWH DSSUDLVDO RI WKH UHSURGXFWLYH ULVNV VKRXOG EH SDUW RI WKH JHQHWLF FRXQVHOLQJ JLYHQ WR $6 IDPLOLHV 6WXGLHV E\ *DEULHO DQG FROOHDJXHV *DEULHO HW DO f RI D PRXVH GHOHWLRQ PRGHO IRU WKH $63:6 LPSULQWHG UHJLRQ VXSSRUW RXU ILQGLQJV 7KHLU PRGHO D WUDQVJHQH LQVHUWLRQGHOHWLRQ 7JSZV$6GHOff RI WKH RUWKRORJRXV UHJLRQ RQ PRXVH FKURPRVRPH & FRUUHODWHV ZHOO ZLWK RXU ILQGLQJV LQ WKLV SDWLHQW ZLWK $6 DV D ODUJH PXULQH FKURPRVRPDO GHOHWLRQ FDQ DOVR EH SDVVHG WKURXJK WKH PDWHUQDO JHUP OLQH 0LFH WKDW LQKHULW WKH PDWHUQDO GHOHWLRQ KDYH PDQ\ RI WKH FKDUDFWHULVWLFV IRXQG LQ LQGLYLGXDOV ZLWK $QJHOPDQ V\QGURPH 7KH DELOLW\ RI DQ $6 PRXVH WR SDVV RQ HLWKHU D QRUPDO RU GHOHWHG FKURPRVRPH & DOORZV D FORVHU H[DPLQDWLRQ RI WKH UROH WKDW UHSOLFDWLRQ WLPLQJ DQG KRPRORJRXV DVVRFLDWLRQ SOD\ LQ WKH HVWDEOLVKPHQW DQG WUDQVPLVVLRQ RI WKH FKURPRVRPH T LPSULQW .LWVEHUJ HW DO /D6DOOH DQG /DODQGH f ,Q WKH PRXVH PRGHO IRU $6 PDWHUQDO WUDQVPLVVLRQ RI D ODUJH GHOHWLRQ HQFRPSDVVLQJ WKH LPSULQWHG GRPDLQ IDLOHG WR LQWHUUXSW SURSHU LPSULQW HVWDEOLVKPHQW RI WKH QRUPDO $63:6 FKURPRVRPDO UHJLRQ *DEULHO HW DO f 7KHVH ILQGLQJV GHPRQVWUDWH WKDW GXULQJ PXULQH JDPHWRJHQHVLV WKH LPSULQWLQJ RQ ERWK KRPRORJXHV PXVW EH HVWDEOLVKHG DQG WUDQVPLWWHG LQ FLV DQG WKDW QHLWKHU UHSOLFDWLRQ WLPLQJ QRU KRPRORJRXV DVVRFLDWLRQ DUH UHTXLUHG IRU HVWDEOLVKPHQW RU WUDQVPLVVLRQ RI WKH LPSULQW ,Q DGGLWLRQ WKHVH GDWD VWURQJO\ VXJJHVW WKDW LQKHULWDQFH RI D QRUPDO FKURPRVRPH IURP D PRWKHU ZLWK $6 ZRXOG UHVXOW LQ QRUPDO GHYHORSPHQW LQ KHU RIIVSULQJ (YLGHQFH IRU LPSULQWHG H[SUHVVLRQ RI WKH 8%($ JHQH LV OLPLWHG 0XULQH VWXGLHV GHPRQVWUDWH WKDW LPSULQWHG H[SUHVVLRQ LV OLPLWHG WR WKH &$ DQG &$ UHJLRQV RI WKH KLSSRFDPSXV WKH PLWUDO FHOO OD\HU RI WKH ROIDFWRU\ EXOE DQG 3XUNLQMH FHOOV RI WKH

PAGE 36

FHUHEHOOXP $OEUHFKW HW DO f ,Q KXPDQV HYLGHQFH LV OHVV SUHFLVH ,PSULQWHG H[SUHVVLRQ RI 8%($ ZDV REVHUYHG LQ DGXOW IURQWDO FRUWH[ DQG IHWDO EUDLQ 5RXJHXOOH HW DO 9X DQG +RIIPDQ f 6LQFH WKH H\HV RULJLQDWH IURP WKH ODWHUDO DVSHFWV RI WKH IRUHEUDLQ GXULQJ IHWDO GHYHORSPHQW LW ZDV SRVVLEOH WKDW IHWDO H\H ZRXOG DOVR VKRZ LPSULQWHG H[SUHVVLRQ +RZHYHU QR GLIIHUHQFH LQ WKH H[SUHVVLRQ RI 8%($ ZDV REVHUYHG EHWZHHQ QRUPDO DQG $6 IHWDO H\H VDPSOHV ,PSULQWHG JHQHV LQ RWKHU FKURPRVRPDO UHJLRQV DOVR VKRZ '1$ PHWK\ODWLRQ LPSULQWV 5D]LQ DQG &HGDU f 7R GHWHUPLQH LI LQWHUUXSWLRQ RI WKH LPSULQWLQJ SURFHVV LQ WKH $63:6 UHJLRQ FDQ DOWHU '1$ PHWK\ODWLRQ LPSULQWV DW ORFL RQ S ZH H[DPLQHG .Y'05, D GLIIHUHQWLDOO\ PHWK\ODWHG VLWH DVVRFLDWHG ZLWK DQ DQWLVHQVH WUDQVFULSW RI .Y/47, 6PLOLQLFK HW DO f $OO VDPSOHV VKRZHG QRUPDO '1$ PHWK\ODWLRQ LQGLFDWLQJ WKDW WKH HVWDEOLVKPHQW DQG WUDQVPLVVLRQ RI WKH S '1$ PHWK\ODWLRQ LPSULQW RFFXUV LQGHSHQGHQWO\ IURP WKH $63:6 UHJLRQ ,Q FRQFOXVLRQ RXU ILQGLQJV HVWDEOLVK WKDW WKH $QJHOPDQ V\QGURPH FDQ EH WUDQVPLWWHG WKURXJK D IHPDOH ZLWK $6 LPSO\ WKDW WKH 3UDGHU:LOOL V\QGURPH FRXOG DOVR EH WUDQVPLWWHG WKURXJK D PDOH ZLWK $6 DQG LOOXVWUDWH WKH QHHG IRU LQIRUPHG UHSURGXFWLYH FRXQVHOLQJ IRU SDUHQWV RI $6 SDWLHQWV

PAGE 37

$ &(1 0.51 6 61531 $&7,1 << ?Y! 6 1'1 6 8%($ 6 7(/ % 9 L LL LQ '6 '6 F '6 $&7,1 )LJXUH 0LFURVDWHOOLWH $QDO\VLV RI &KURPRVRPH $f GHOHWLRQ EUHDNSRLQWV IODQNLQJ T LQGLYLGXDO ORFL FHQWURPHUH &(1f DQG WHORPHUH 7(/f DUH QRWHG %f 0LFURVDWHOOLWH DQDO\VLV RI ORFL ZLWKLQ T DQG &f 0LFURVDWHOOLWH DQDO\VLV RI ORFL GLVWDO WR T 7KH SHGLJUHH VKRZV WKH IDWKHU RI WKH SUREDQG ODQH f $6 SUREDQG ODQH f SUREDQGfV IHWXV ODQH f DQG PRWKHU RI WKH SUREDQG ODQH f 1RWH WKH ODFN RI D PDWHUQDO FRQWULEXWLRQ ZLWKLQ T IRU WKH SUREDQG DQG IHWXV DW '6 DQG IRU WKH IHWXV DW '6 +RZHYHU GLVWDO WR T WKHUH LV D ELSDUHQWDO FRQWULEXWLRQ DW $&7,1 DQG '6 7KH IDWKHU RI WKH $6 IHWXV LV XQNQRZQ

PAGE 38

‘6‹} ,3 0$7 )LJXUH '1$ PHWK\ODWLRQ DQDO\VLV RI f 61531 'LJHVWLRQ RI '1$ ZLWK ;ED DQG 1RW UHYHDOV GLDJQRVWLF EDQGV RI NE PHWK\ODWHG PDWHUQDOf DQG NE XQPHWK\ODWHG SDWHUQDOf 3%/ '1$ IURP QRUPDO LQGLYLGXDOV UHYHDOV ERWK WKH NE DQG NE QRUPDO PHWK\ODWLRQ SURn ILOH ODQHV f 3DWLHQWV ZLWK $6 RQO\ KDYH WKH NE XQPHWKn \ODWHG IUDJPHQWV ODQHV DQG f ZKLOH LQGLYLGXDOV ZLWK 3:6 KDYH WKH NE PHWK\ODWHG DOOHOH ODQHV DQG f (\H '1$ IURP WKH IHWXV ODQHV DQG f DQG 3%/ '1$ IURP WKH $6 SUREDQG ODQH f UHYHDO $6 VSHFLILF '1$ PHWK\ODWLRQ LPSULQWV ZKLOH 3%/ '1$ IURP WKH SDUHQWV VKRZV PDWHUQDO DQG SDWHUQDOVSHFLILF EDQGV ODQHV DQG f

PAGE 39

)LJXUH 063 DQDO\VLV RI f 61531 3%/ ODQHV DQG f DQG IHWDO H\H '1$V ODQHV DQG f DUH VKRZQ 7KH SHGLJUHH VKRZV WKH SRVLWLRQV RI HDFK IDPLO\ PHPEHU 1RUn PDO LQGLYLGXDOV ODQHV DQG f DPSOLILHG WKH ES PHWK\ODWHG DQG ES XQPHWK\ODWHG SURGXFWV 7KH SUREDQG DQG IHWXV H[FOXVLYHO\ DPSOLILHG WKH XQPHWK\ODWHG DOOHOH ZKLOH WZR SDWLHQWV ZLWK 3:6 ODQHV DQG f DPSOLn ILHG RQO\ WKH PHWK\ODWHG DOOHOH 3: 3UDGHU:LOOLf QRUPDO IHWDO H\H (f DQG ZDWHU FRQWURO &f DUH LQGLFDWHG

PAGE 40

2U2 NE 1/ $6 3: 1( L :N 7UW0L:UU PPPP ZU P ZP nfPP PP 0DW 4 m0WWIHt. c+.DIH L R ‘ r f§ 3RW )LJXUH '1$ PHWK\ODWLRQ DQDO\VLV RI 1'1 'LJHVWLRQ RI '1$ ZLWK %VV +OO DQG +LQG ,,, UHYHDOV GLDJQRVWLF EDQGV RI NE PHWK\ODWHG PDWHUQDOf DQG NE XQPHWK\ODWHG SDWHUQDOf DQG D FRQVWDQW EDQG RI NE 3%/ '1$ IURP QRUPDO LQGLYLGXDOV ODQHV f DQG QRUPDO IHWDO H\H ODQH f VKRZV WKH QRUPDO PHWK\ODWLRQ SURILOH 3DWLHQWV ZLWK $6 ODQHV DQG f KDYH WKH NE SDWHUQDO GLDJQRVWLF EDQG ZKLOH LQGLYLGXDOV ZLWK 3:6 ODQHV DQG f SUHGRPLQDQWO\ KDYH WKH NE PHWK\ODWHG PDWHUQDO IUDJPHQW (\H '1$ IURP WKH IHWXV DQG 3%/ '1$ IURP WKH SUREDQG UHYHDO $6VSHFLILF '1$ PHWK\ODWLRQ LPSULQWV ODQHV DQG f

PAGE 41

)HWDO (\H /% 1/ $6 3:6 57 8%($ f§ Z 61531 P )LJXUH ([SUHVVLRQ DQDO\VLV RI 8%($ DQG 61531 $ 6RXWKHUQ EORW RI 573&5 SURGXFWV IURP 8%($ H[RQV WR ESf DQG 61531 H[RQV WR ESf LV VKRZQ 7KH PHPEUDQH ZDV K\EULGL]HG ZLWK WKH VDPH 573&5 SURGXFWV 5HDFWLRQV ZLWK f DQG ZLWKRXW f 57 DUH QRWHG 8%($ DQG 61531 WUDQVFULSWV DUH SUHVHQW LQ QRUPDO ODQHV DQG f DQG $6 IHWDO H\H ODQHV DQG f +RZHYHU RQO\ 8%($ LV H[SUHVVHG LQ O\PSKREODVW FHOOV IURP D SDWLHQW ZLWK 3:6 ODQHV DQG f ([WUD EDQGV DUH GXH WR DOWHUQDWLYH VSOLFLQJ RI 8%($

PAGE 42

02/(&8/$5 $1$/<6(6 $1' *(127<3(3+(127<3(&255(/$7,216 $021* 7+( ),9( &/$66(6 2) $1*(/0$1 6<1'520( ,QWURGXFWLRQ 7KH $QJHOPDQ $6f DQG 3UDGHU:LOOL 3:6f V\QGURPHV WZR GLVWLQFW QHXUREHKDYLRUDO GLVRUGHUV DUH WKH EHVWVWXGLHG H[DPSOHV RI JHQRPLF LPSULQWLQJ LQ KXPDQV ,Q WKHVH LPSULQWHG GLVRUGHUV WKH SDUHQWDO RULJLQ RI WKH FKURPRVRPH DEQRUPDOLW\ GHWHUPLQHV WKH SKHQRW\SH 3:6 RFFXUV IURP WKH ODFN RI FULWLFDO SDWHUQDOO\ H[SUHVVHG T VHTXHQFHV ZKLOH PXOWLSOH PHFKDQLVPV WKDW GLVUXSW WKH PDWHUQDOO\ LQKHULWHG ( XELTXLWLQ SURWHLQOLJDVH JHQH 8%($f FDXVH $6 *OHQQ HW DO :LOOLDPV HW DO f $6 LV D VHYHUH GHYHORSPHQWDO DQG QHXUREHKDYLRUDO GLVRUGHU WKDW RFFXUV ZLWK D IUHTXHQF\ RI &OD\WRQ6PLWK HW DO f )LUVW GRFXPHQWHG E\ +DUU\ $QJHOPDQ f $6 LV QRZ GLDJQRVHG E\ IRXU FDUGLQDO IHDWXUHV VHYHUH GHYHORSPHQWDO GHOD\ DQG PHQWDO UHWDUGDWLRQ SURIRXQG VSHHFK LPSDLUPHQW D PRYHPHQW DQG EDODQFH GLVRUGHU DQG DQ $6VSHFLILF EHKDYLRU ZKLFK LQFOXGHV IUHTXHQW LQDSSURSULDWH ODXJKWHU D KDSS\ DIIHFW DQG DQ HDVLO\ H[FLWDEOH SHUVRQDOLW\ 2WKHU FRPPRQ IHDWXUHV LQFOXGH VHL]XUHV PLFURFHSKDO\ DEQRUPDO ((* SDWWHUQV VOHHS GLVWXUEDQFHV K\SRSLJPHQWDWLRQ DQG VWUDELVPXV :LOOLDPV HW DO D :LOOLDPV HW DO f )LYH PDMRU PROHFXODU PHFKDQLVPV DUH NQRZQ WR FDXVH $6 ,f 0E PDWHUQDOO\ GHULYHG GHOHWLRQV RI T ,,f SDWHUQDO XQLSDUHQWDO GLVRPLHV 83'f ,,,f LPSULQWLQJ GHIHFWV ,'f ,9f SDWLHQWV ZLWK LQWUDJHQLF PXWDWLRQV LQ 8%($ DQG 9f SDWLHQWV ZLWK QR

PAGE 43

NQRZQ GHIHFWV RQ FKURPRVRPH $OWKRXJK SDWLHQWV LQ &ODVVHV OOOO FDQ EH HDVLO\ GLDJQRVHG E\ '1$ PHWK\ODWLRQ DQDO\VHV DORQJ WKH T LPSULQWHG GRPDLQ *OHQQ HW DO f LQGLYLGXDOV IURP &ODVVHV ,9 DQG 9 GHPRQVWUDWH QRUPDO '1$ PHWK\ODWLRQ DW WKH GLDJQRVWLF ORFL '1$ PHWK\ODWLRQ DQDO\VLV WDNHV DGYDQWDJH RI WKH GLIIHUHQWLDO PHWK\ODWLRQ IRXQG LQ LPSULQWHG UHJLRQV RI WKH JHQRPH DQG HDVLO\ UHVROYHV WKH PDWHUQDO DQG SDWHUQDO DOOHOHV 61531 WKH PRVW UHOLDEOH ORFXV IRU $6 GLDJQRVLV LV RQH RI VHYHUDO SDWHUQDORQO\ H[SUHVVHG JHQHV LQ T ZKRVH SURPRWHU UHJLRQ LV SUHIHUHQWLDOO\ PHWK\ODWHG RQ WKH UHSUHVVHG PDWHUQDO DOOHOH *OHQQ HW DO .XERWD HW DO E 6XWFOLIIH HW DO f 7KH GLVFRYHU\ RI PDWHUQDOO\ LQKHULWHG PXWDWLRQV LQ &ODVV ,9 SDWLHQWV ILUVW HVWDEOLVKHG D UROH IRU 8%($ LQ WKH HWLRORJ\ RI $6 .LVKLQR HW DO 0DWVXXUD HW DO f 6XEVHTXHQW PXWDWLRQ DQDO\VLV RI SDWLHQWV ZLWK QRUPDO '1$ PHWK\ODWLRQ LGHQWLILHG DQ RYHUDOO 8%($ PXWDWLRQ UDWH RI b LQ VSRUDGLF $6 SDWLHQWV %DXPHU HW DO )DQJ HW DO 0DO]DF HW DO 0RQGD HW DO D 5XVVR HW DO f $OWKRXJK FHOO OLQHV IURP $6 SDWLHQWV IDLOHG WR VKRZ LPSULQWHG H[SUHVVLRQ RI 8%($ 1DNDR HW DO f GHPRQVWUDWLRQ RI EUDLQVSHFLILF LPSULQWLQJ E\ 573&5 LQ WKH KXPDQ FRQILUPHG WKH UROH RI 8%($ LQ WKH HWLRORJ\ RI $6 5RXJHXOOH HW DO f 7KH SKHQRW\SH DVVRFLDWHG ZLWK &ODVV SDWLHQWV LV ZHOO GRFXPHQWHG 6DLWRK HW DO 6PLWK HW DO f 7KHVH LQGLYLGXDOV KDYH D FODVVLFDO $6 SKHQRW\SH ZLWK DOO SDWLHQWV KDYLQJ WKH IRXU FDUGLQDO IHDWXUHV RI $6 DV ZHOO DV D YHU\ KLJK LQFLGHQFH RI VHYHUH HDUO\RQVHW VHL]XUHV PLFURFHSKDO\ DQG K\SRSLJPHQWDWLRQ :KLOH SDWLHQWV IURP &ODVVHV ,, ,,, DQG ,9 GLVSOD\HG WKH IRXU FDUGLQDO IHDWXUHV RI $6 WKHVH LQGLYLGXDOV RIWHQ H[KLELWHG DW\SLFDO IHDWXUHV WKDW DPHOLRUDWHG WKH $6 SKHQRW\SH $OO VWXGLHV VKRZHG WKDW SDWLHQWV ZLWK 83' DQG LPSULQWLQJ GHIHFWV ,'f ZHUH OHVV OLNHO\ WR SUHVHQW ZLWK K\SRSLJPHQWDWLRQ RU PLFURFHSKDO\ %XUJHU HW DO )ULGPDQ HW DO E

PAGE 44

*LOOHVVHQ.DHVEDFK HW DO 6DLWRK HW DW 6PLWK HW DW f ,Q DGGLWLRQ VRPH VWXGLHV UHYHDOHG WKDW SDWLHQWV IURP &ODVVHV ,, DQG ,,, KDG IHZHU VHL]XUHV HDUO\ RQVHW REHVLW\ DQG EHWWHU PRWRU VNLOOV )ULGPDQ HW DO E *LOOHVVHQ.DHVEDFK HW DO 6PLWK HW DO f 0RQGD DQG FROOHDJXHV Ef UHSRUWHG WKDW 8%($ PXWDWLRQ SDWLHQWV KDG D PRUH VHYHUH SKHQRW\SH WKDQ WKH 83' DQG ,' SDWLHQWV /LNH WKH GHOHWLRQ JURXS &ODVV ,9 SDWLHQWV ZHUH PRUH OLNHO\ WR SUHVHQW ZLWK K\SRSLJPHQWDWLRQ DQG VHL]XUHV ,QGLYLGXDOO\ WKHVH VWXGLHV KDYH JLYHQ XV FOXHV WR WKH FOLQLFDO YDULDQFHV WKDW RFFXU DPRQJ WKH ILUVW IRXU FODVVHV RI $6 SDWLHQWV +RZHYHU D VLQJOH FRPSUHKHQVLYH LQYHVWLJDWLRQ RI DOO PROHFXODU FODVVHV RI $QJHOPDQ V\QGURPH ZRXOG SURYLGH UHVHDUFKHUV FOLQLFLDQV DQG IDPLOLHV D YDOXDEOH UHVRXUFH WR DLG LQ WKH SUHGLFWLRQ RI D SKHQRW\SLF RXWFRPH JLYH D SDUWLFXODU JHQRW\SH RU PROHFXODU FODVV ,Q WKLV VWXG\ ZH UHSRUW RQ WKH PROHFXODU DQG FOLQLFDO DQDO\VHV RI FODVVLFDO $6 SDWLHQWV IURP WKH 8QLYHUVLW\ RI )ORULGD $6 UHSRVLWRU\ :H SUHVHQW WKH ILUVW FRPSUHKHQVLYH DQDO\VLV RI JHQRW\SHSKHQRW\SH FRUUHODWLRQV DPRQJ DOO ILYH PROHFXODU FODVVHV RI $6 ,Q RXU VWXG\ ZH UHSRUW WKH KLJKHVW 8%($ PXWDWLRQ IUHTXHQF\ WR GDWH DQG GHPRQVWUDWH VWULNLQJ GLIIHUHQFHV DPRQJ WKH ILYH FODVVHV LQ JURZWK SDUDPHWHUV DFKLHYHPHQW RI GHYHORSPHQWDO PLOHVWRQHV DQG VHYHULW\ IUHTXHQF\ DQG DJH DW RQVHW RI VHL]XUHV 0DWHULDOV DQG 0HWKRGV 3DWLHQW 5HSRVLWRU\ 2YHU WKH ODVW \HDUV ZH KDYH DFFXPXODWHG D ODUJH $6 UHSRVLWRU\ WRWDOLQJ LQGLYLGXDOV IURP $QJHOPDQ IDPLOLHV (DFK SDWLHQW ZDV FOLQLFDOO\ H[DPLQHG E\ JHQHWLFLVWV DW WKH 8QLYHUVLW\ RI )ORULGD HYDOXDWHG IRU LQGLYLGXDO FULWHULD DQG JLYHQ DQ $6 UDWLQJ RI RQH WKURXJK ILYH EDVHG RQ FOLQLFDO LPSUHVVLRQ EHIRUH DQ\ ODERUDWRU\ WHVWV ZHUH SHUIRUPHG :H UHVWULFWHG WKLV VWXG\ WR WKH FODVVLFDO $6 SDWLHQWV

PAGE 45

IDPLOLHVf ZKR GHPRQVWUDWHG D FODVVLFDO $6 SKHQRW\SH 7KH UHPDLQLQJ $6OLNHf SDWLHQWV H[KLELW VRPH EXW QRW DOO RI WKH IRXU FDUGLQDO IHDWXUHV RI $6 DQG ZHUH H[FOXGHG IURP IXUWKHU LQYHVWLJDWLRQ %ORRG DQG WLVVXH ZHUH SURFXUHG ZLWK WKH DSSURYDO RI WKH IDPLOLHV DQG WKH 8QLYHUVLW\ RI )ORULGD ,QVWLWXWLRQDO 5HYLHZ %RDUG 2QFH D FOLQLFDO GLDJQRVLV RI $6 ZDV GHWHUPLQHG '1$ IURP HDFK SDWLHQW ZDV DQDO\]HG E\ PROHFXODU DQG F\WRJHQHWLF WHVWV LQ RUGHU WR GHWHUPLQH WKH FODVV LQ ZKLFK HDFK $6 SDWLHQW EHORQJHG '1$ PHWK\ODWLRQ DQDO\VHV DW WKH 0.51 3: DQG f 61531 ORFL ZHUH XVHG WR VHSDUDWH SDWLHQWV LQ &ODVVHV OOOO DEQRUPDO '1$ PHWK\ODWLRQf IURP LQGLYLGXDOV LQ &ODVVHV ,9 DQG 9 ZKR KDG QRUPDO PHWK\ODWLRQ 'LWWULFK HW DO 'ULVFROO HW DO *OHQQ HW DO .XERWD HW DO E 6XWFOLIIH HW DO f '1$ GRVLQJ KLJKUHVROXWLRQ FKURPRVRPH DQG IOXRUHVFHQFH LQ VLWX K\EULGL]DWLRQ ),6+f VWXGLHV GHWHFWHG SDWLHQWV ZLWK ODUJH LQWHUVWLWLDO GHOHWLRQV &ODVV ,f ZKLOH PLFURVDWHOOLWH DQG 5)/3 DQDO\VHV VHSDUDWHG SDWLHQWV LQ &ODVV ,, IURP LQGLYLGXDOV LQ &ODVV ,,, &KULVWLDQ HW DO 0LWXUDQJXUD HW DO f 3DWLHQWV ZLWK QRUPDO '1$ PHWK\ODWLRQ ZHUH WKHQ WHVWHG IRU 8%($ PXWDWLRQV E\ D FRPELQDWLRQ RI 6RXWKHUQ EORW %(66 76FDQ DQG GLUHFW VHTXHQFH DQDO\VHV 3DWLHQWV ZLWK LQWUDJHQLF 8%($ PXWDWLRQV ZHUH SODFHG LQWR &ODVV ,9 ZKLOH WKRVH ZLWK QR GHWHFWDEOH FKURPRVRPH DEQRUPDOLWLHV ZHUH SXW LQWR &ODVV 9 6RXWKHUQ $QDO\VLV 6RXWKHUQ EORWV ZHUH GRQH DFFRUGLQJ WR VWDQGDUG FRQGLWLRQV /RVVLH DQG 'ULVFROO f 7R GHWHFW SRVVLEOH JHQRPLF UHDUUDQJHPHQWV F'1$ SUREHV ZHUH PDGH E\ 57 3&5 IURP WKH f 8%($ F'1$ SULPHUV IRUZDUG SULPHU f$&&$*&7&&7&$*$$*777 **&*$$$f DQG UHYHUVH SULPHU f7&7&&$7&$77&7&&*$$7&7**7&ff DQG f 8%($ F'1$ SULPHUV IRUZDUG SULPHU f77*&$$$*&*$7*$*&$$*&7$&&f DQG UHYHUVH SULPHU f7***$&$&7$7&$&&$&&&$$ff $ NE (FR 5O WR 1RW IUDJPHQW IURP

PAGE 46

FRVPLG 6XWFOLIIH HW DO f ZKLFK LV ORFDWHG DW f 8%($ ZDV XVHG IRU '1$ PHWK\ODWLRQ DQDO\VHV DQG WR GHWHFW JHQRPLF UHDUUDQJHPHQWV %(66 76FDQ :H DQDO\]HG JHQRPLF '1$ IURP SDWLHQWV IROORZLQJ WKH SURFHGXUHV RXWOLQHG LQ WKH %(66 76FDQ PXWDWLRQ GHWHFWLRQ NLW (SLFHQWUH 0DGLVRQ :Of XVLQJ SULPHUV 7DEOH f FRUUHVSRQGLQJ WR H[RQV DQG &OHDYHG SURGXFWV ZHUH VL]H IUDFWLRQDWHG RQ b DFU\ODPLGH 0 XUHD DQG b YYf IRUPDPLGH VHTXHQFLQJ JHOV DFFRUGLQJ WR VWDQGDUG SURWRFROV 3XWDWLYH PXWDWLRQV ZHUH YHULILHG E\ VHTXHQFH DQDO\VLV 6HTXHQFH $QDO\VLV $EQRUPDO 3&5 SURGXFWV IURP %(66 7VFDQ DQDO\VHV ZHUH FORQHG LQWR D 7$ YHFWRU &ORQWHFKf DQG VHTXHQFHG XVLQJ XQLYHUVDO SULPHUV DQG UHJXODU G\H WHUPLQDWRUV $%, 3HUNLQ (OPHUf :H GHVLJQHG FRGLQJ UHJLRQ DQG LQWURQLF SULPHUV WKDW ZRXOG DPSOLI\ LQGLYLGXDO H[RQV RI 8%($ 7DEOH f 3&5 SURGXFWV ZHUH SXULILHG E\ WKH +LJK 3XUH 3&5 3XULILFDWLRQ .LW 5RFKHf DQG VHTXHQFHG GLUHFWO\ XVLQJ D UHDFWLRQ RI WKH %LJ '\H WHUPLQDWRUV $%, 3HUNLQ (OPHUf &RPSOHWHG VHTXHQFLQJ UHDFWLRQV ZHUH SXULILHG E\ HLWKHU UHSHDWHG HWKDQRO SUHFLSLWDWLRQ RU E\ VHSKDURVH FROXPQV (GJH 6FLHQWLILFf GULHG XQGHU YDFXXP UHVXVSHQGHG DQG IUDFWLRQDWHG RQ HLWKHU DQ $%, RU $%, $ DXWRPDWHG VHTXHQFHU 6HTXHQFH DQDO\VLV ZDV SHUIRUPHG ZLWK WKH 6HTXHQFKHU SURJUDP *HQH &RGHV &RUSRUDWLRQf 3ULPHUV 3ULPHUV IRU %(667 7DEOH f DQG GLUHFW VHTXHQFH DQDO\VLV 7DEOH f ZHUH GHVLJQHG WR DPSOLI\ WKH HQWLUH 8%($ FRGLQJ UHJLRQ H[RQV f

PAGE 47

7DEOH %(667 3ULPHUV ([RQ 3ULPHU 'LUHFWLRQ /RFDWLRQ 6L]H 7*&&$*&$**O,,$, , $&&$*&&77*7***7$$* )RUZDUG 5HYHUVH ([RQ ([RQ **$*$$&&7&$*7&7*$&*$& $77&**&7$*&77&$$7*7& )RUZDUG 5HYHUVH ([RQ ([RQ *&$*&7*&$$$*&$7&7$$7 7&$$77&7$*&*&&777&77 )RUZDUG 5HYHUVH ([RQ ([RQ *&$$7&$7&77&7777&$7*77 &*$&$&&$7$$7&$&$77$& )RUZDUG 5HYHUVH ,QWURQ ,QWURQ 7*77&$&$7$&*$7*$$7&7$&$ &7&&&$$*7&$&*$$$$*77 )RUZDUG 5HYHUVH ([RQ ([RQ 7&$*$*777$$$$*$777$77**$ 7&&7*7777&$777*7$$77** )RUZDUG 5HYHUVH ([RQ ([RQ *$$777*7&$$7&777$77&7*$&7 &**&77&&$&$7 $7 $$*&$ )RUZDUG 5HYHUVH ([RQ ([RQ $*$777&&$$*&$&7$*$$*$$$ $$7&$*$$&$*$*7&&&7** )RUZDUG 5HYHUVH ([RQ ([RQ *77&7***$$$7&*77&$77 &7*7*7&7***&&$7777 )RUZDUG 5HYHUVH ([RQ ([RQ $&&$7*$&77$&$*7777&&7 7***$&$&7$7&$&&$&&$$ )RUZDUG 5HYHUVH ,QWURQ ,QWURQ 7DEOH 6HTXHQFLQJ 3ULPHUV ([RQ 3ULPHU 'LUHFWLRQ /RFDWLRQ 6L]H 7$7**&&$&&7*$7&7*$& 77&&7 $7&7&&&$777 $&7*& )RUZDUG 5HYHUVH ,QWURQ ,QWURQ *&77*$&7$$&7777*&&77* $7&7&&&$&$7**7777&$* )RUZDUG 5HYHUVH ,QWURQ ,QWURQ *&$*&7*&$$$*&$7&7$$7 7&$$77&7$*&*&&777&77 )RUZDUG 5HYHUVH ([RQ ([RQ $$&$* &7$7* $&&$7* &$$&$* $*7$$$&$7$& $7 $77 *7 $$$$&*$&**&&$*7&$&7*$$&7*7$7&$7 )RUZDUG 5HYHUVH ,QWURQ ,QWURQ $77$**&&&7*$7*$7*7*7 &&$*$7$77&$**$&7*7**$ )RUZDUG 5HYHUVH ([RQ ([RQ 77*777&&7$$7&&7$&7&&77* $&&$$$7&&77&7777*&7* )RUZDUG 5HYHUVH ,QWURQ ,QWURQ **$&$77*7777&7&$$*7*& 7$$$$$7*7&&&&&777*$* )RUZDUG 5HYHUVH ,QWURQ ,QWURQ 7*77*7$7777*7$*77&7$7** 77$$7*$$*$*$&$$$$7*7*$& )RUZDUG 5HYHUVH ,QWURQ ,QWURQ *$$*77&77*7*$77$$7*7 &&&777**7*$$7&$$$7&77&& )RUZDUG 5HYHUVH ,QWURQ ,QWURQ *$$777*7&$$7&777$77&7*$&7 $$7&$*$$&$*$*7&&&7** )RUZDUG 5HYHUVH ([RQ ([RQ 77&$**$7$$$777*&77** $$$$7 &$&* $$7*7*&7&$* )RUZDUG 5HYHUVH ,QWURQ ,QWURQ 6WDWLVWLFDO $QDO\VHV 'HVFULSWLYH VWDWLVWLFV ZHUH FDOFXODWHG DV D SHUFHQWDJH RU E\ WKH PHDQ VWDQGDUG GHYLDWLRQ $OO RXWFRPH YDULDEOHV ZHUH PRGHOHG DV D IXQFWLRQ RI DJH DW HYDOXDWLRQ ELUWK ZHLJKW PROHFXODU FODVV ,, ,,, ,9 DQG 9f JHVWDWLRQDO DJH PDWHUQDO

PAGE 48

DJH SDWHUQDO DJH UDFH &DXFDVLDQ +LVSDQLF DQG 2WKHUf DQG VH[ 2XWFRPH YDULDEOHV FRQVLVWHG RI FRQWLQXRXV ELQDU\ DQG RUGLQDO PHDVXUHV DQG ZHUH PRGHOHG XVLQJ DQDO\VLV RI FRYDULDQFH $1&29$f ORJLVWLF UHJUHVVLRQ DQG RUGLQDO ORJLVWLF UHJUHVVLRQ UHVSHFWLYHO\ )RU ELQDU\ DQG RUGLQDO RXWFRPH YDULDEOHV ZLWK OLPLWHG VDPSOH VL]H ZH HPSOR\HG WKH H[DFW FKLVTXDUH WHVW 2GGV UDWLRV ZHUH XVHG WR VXPPDUL]H WKH ELQDU\ DQG RUGLQDO RXWFRPHV $OO WHVWV ZHUH WZRVLGHG DQG FRQVLGHUHG VLJQLILFDQW DW DOSKD $OO VWDWLVWLFDO DQDO\VHV ZHUH SHUIRUPHG XVLQJ 6$6 6$6 ,QVWLWXWH &DU\ 1&f 5HVXOWV 0ROHFXODU &ODVVHV RI $QJHOPDQ 6\QGURPH (DFK SDWLHQW ZDV DVVLJQHG D PROHFXODU FODVV EDVHG XSRQ UHVXOWV IURP KLJK UHVROXWLRQ FKURPRVRPH ),6+ 8%($ PXWDWLRQ DV ZHOO DV '1$ GRVLQJ PHWK\ODWLRQ DQG SRO\PRUSKLVP DQDO\VHV DORQJ T 7DEOH f 7KH YDVW PDMRULW\ f RI RXU 7DEOH 0ROHFXODU &ODVVHV RI $QJHOPDQ 6\QGURPH &ODVV 0ROHFXODU 'HIHFW 3DWLHQWV b T 'HOHWLRQ ,, 8QLSDUHQWDO 'LVRP\ 83'f ,,, ,PSULQWLQJ 'HIHFW ,'f ,9 8%($ 0XWDWLRQ 9 8QNQRZQ FODVVLFDO IDPLOLHV ZHUH GHOHWHG IRU WKH HQWLUH 0E $63:6 LPSULQWHG GRPDLQ &ODVV ,f ,Q VHYHQ FDVHV $6 RFFXUUHG YLD SDWHUQDO 83' RI FKURPRVRPH &ODVV ,,f DQG WKUHH IDPLOLHV KDG LPSULQWLQJ GHIHFWV &ODVV ,,,f ,QWUDJHQLF PXWDWLRQV LQ 8%($ RFFXUUHG LQ WHQ RI RXU FODVVLFDO SDWLHQWV &ODVV ,9f ZKLOH WKH UHPDLQLQJ KDG QR GHWHFWDEOH FKURPRVRPH DEQRUPDOLW\ &ODVV 9f

PAGE 49

0XWDWLRQ $QDO\VLV ,QLWLDOO\ D PROHFXODU FRQILUPDWLRQ RI $6 FRXOG QRW EH PDGH LQ IDPLOLHV XVLQJ F\WRJHQHWLF '1$ PHWK\ODWLRQ RU '1$ SRO\PRUSKLVP WHVWV )XUWKHUPRUH 6RXWKHUQ EORW DQDO\VLV RI WKH 8%($ F'1$ GHWHUPLQHG WKDW JHQRPLF UHDUUDQJHPHQWV GLG QRW RFFXU LQ DQ\ RI WKHVH SDWLHQWV GDWD QRW VKRZQf 6HTXHQFH DQDO\VLV RI WKH 8%($ FRGLQJ UHJLRQ LQ WKHVH IDPLOLHV UHYHDOHG LQWUDJHQLF PXWDWLRQV LQ IDPLOLHV SDWLHQWVf :H GHWHFWHG VL[ GHOHWLRQV WKDW UHVXOWHG LQ IUDPHVKLIWV WKUHH QRQVHQVH PXWDWLRQV DQG RQH PLVVHQVH PXWDWLRQ )LJXUH f ,Q SDWLHQWV ZLWK QRUPDO '1$ PHWK\ODWLRQ ZH IRXQG D b PXWDWLRQ GHWHFWLRQ UDWH ZLWK IDPLOLDO bf DQG VSRUDGLF FDVHV bf KDUERULQJ PXWDWLRQV ZLWKLQ WKH 8%($ JHQH 2QH SDWLHQW ZDV KHWHUR]\JRXV IRU D SUHYLRXVO\ XQLGHQWLILHG H[SUHVVHG SRO\PRUSKLVP $* WUDQVLWLRQf LQ H[RQ $QRWKHU FRPPRQ SRO\PRUSKLVP RFFXUUHG LQ LQWURQ DW WKH VLWH RI D SRO\ 7 WUDFW 6HYHUDO SDWLHQWV DQG QRUPDO LQGLYLGXDOV ZHUH KHWHUR]\JRXV KDYLQJ UXQV RI HLWKHU QLQH Sf RU WHQ Tf WK\PLGLQHV DW LQ LQWURQ :H H[DPLQHG QRUPDO FKURPRVRPHV DQG IRXQG WKDW S DQG T ,Q DGGLWLRQ RQH $6OLNH SDWLHQW KDG D SDWHUQDOO\ LQKHULWHG ES GHOHWLRQ RI WKH f 875 ZKLFK DSSHDUHG WR EH VLPLODU EXW QRW LGHQWLFDO WR WKDW LGHQWLILHG E\ )XQJ DQG FROOHDJXHV f 1R GLVHDVHDVVRFLDWHG PXWDWLRQ ZDV IRXQG LQ WKLV LQGLYLGXDO ,Q DGGLWLRQ %(66 76FDQ GHWHFWHG RQH LQGLYLGXDO ZKR ZDV KRPR]\JRXV IRU D SUHYLRXVO\ LGHQWLILHG H[SUHVVHG SRO\PRUSKLVP LQ H[RQ 9X DQG +RIIPDQ f '1$ 0HWK\ODWLRQ RI f 8%($ $OWKRXJK ZH LGHQWLILHG GLVHDVHFDXVLQJ PXWDWLRQV LQ b RI RXU SDWLHQWV ZKR KDG QRUPDO '1$ PHWK\ODWLRQ DW f 61531 WKH FDXVH RI $6 LQ WKH UHPDLQGHU RI RXU FODVVLFDO $QJHOPDQ V\QGURPH SDWLHQWV ZDV XQNQRZQ :H SRVWXODWHG WKDW GLVUXSWLRQ RI

PAGE 50

WKH QRUPDO 8%($ '1$ PHWK\ODWLRQ SDWWHUQ LQ &ODVV 9 SDWLHQWV FRXOG EH D SRWHQWLDO FDXVH RI $6 LQ WKHVH SDWLHQWV :H LVRODWHG D NE 1RW ,(FR 5O IUDJPHQW IURP WKH &S* LVODQG DW f 8%($ )LJXUH $f DQG WHVWHG IRU SDUHQWRIRULJLQ '1$ PHWK\ODWLRQ LPSULQWV LQ '1$ IURP 3%/ $6 EUDLQ QRUPDO EUDLQ DQG JHUP FHOOV IURP ERWK VH[HV $V H[SHFWHG WKH NE JHQRPLF SUREH GHWHFWHG D NE IUDJPHQW ZKHQ WKH '1$ ZDV GLJHVWHG ZLWK (FR 5O DORQH +RZHYHU ZKHQ '1$ ZDV GLJHVWHG ZLWK ERWK (FR 5O DQG 1RW WKH SUREH RQO\ K\EULGL]HG WR D NE IUDJPHQW LQGLFDWLQJ WKDW WKH &S* LVODQG DW f 8%($ ZDV XQPHWK\ODWHG RQ ERWK DOOHOHV LQ DOO WLVVXHV H[DPLQHG )LJXUH %f :H QH[W H[DPLQHG 3%/ '1$ IURP &ODVV 9 SDWLHQWV 7KH NE SUREH RQO\ GHWHFWHG WKH XQPHWK\ODWHG IUDJPHQW LQGLFDWLQJ WKDW WKH &S* LVODQG ZDV DOVR XQPHWK\ODWHG LQ WKHVH LQGLYLGXDOV )LJXUH &f 6XPPDU\ RI DOO 3XEOLVKHG 8%($ 0XWDWLRQV 7R GDWH 8%($ PXWDWLRQV KDYH EHHQ LGHQWLILHG LQ $6 IDPLOLHV %DXPHU HW DO )DQJ HW DO )XQJ HW DO .LVKLQR HW DO 0DO]DF HW DO 0DWVXXUD HW DO 5XVVR HW DO YDQ GHQ 2XZHODQG HW DO f )RUW\ILYH DUH XQLTXH PXWDWLRQV QR WUXH KRW VSRWV KDYH EHHQ LGHQWLILHG )LJXUH f 0RVW PXWDWLRQV DUH QRYHO ZLWK QR PRUH WKDQ WKUHH XQUHODWHG LQGLYLGXDOV VKDULQJ D FRPPRQ HUURU $OWKRXJK GHIHFWV KDYH EHHQ IRXQG LQ YLUWXDOO\ DOO SURWHLQFRGLQJ H[RQV PRVW FOXVWHU LQ H[RQV DQG )LJXUH f ,QVHUWLRQV GHOHWLRQV DQG QRQVHQVH PXWDWLRQV DUH WKH SUHGRPLQDQW GHIHFWV *HQRW\SH3KHQRW\SH &RUUHODWLRQV :H DQDO\]HG SKHQRW\SLF GDWD RQ SDWLHQWV IURP WKH 8QLYHUVLW\ RI )ORULGD $6 UHSRVLWRU\ :H LQFOXGHG DOO RI RXU SDWLHQWV IURP &ODVVHV OO9 DQG UDQGRPO\ FKRVH

PAGE 51

&ODVV SDWLHQWV IRU SKHQRW\SH FRPSDULVRQV :H DOVR LQFOXGHG DGGLWLRQDO SDWLHQWV &ODVVHV ,, ,,, DQG ,9f LQ RXU VWDWLVWLFDO PRGHOV %RWWDQL HW DO 'DQ HW DO 'XSRQW HW DO )UHHPDQ HW DO )ULGPDQ HW DO D )ULGPDQ HW DO E )ULGPDQ HW DO )XQJ HW DO *LOOHVVHQ.DHVEDFK HW DO *LOOHVVHQ.DHVEDFK HW DO *UHJHU HW DO *\IWRGLPRX HW DO /DDQ HW DO 0DOFROP HW DO 0LQDVVLDQ HW DO 0RQGD HW DO D 0RQGD HW DO E 2KWD HW DO 3UDVDG DQG :DJVWDII 5HLV HW DO 5RELQVRQ HW DO 5XVVR HW DO 6DLWRK HW DO 6DLWRK HW DO 6PHHWV HW DO 6PLWK HW DO 6PLWK HW DO 6PLWK HW DO 7RQN HW DO f :H FRPSDUHG WKH UHVXOWV RI VWDWLVWLFDO PRGHOV HVWDEOLVKHG EHWZHHQ RXU SDWLHQWV DQG WKH FRPELQHG GDWD VHW 7DEOHV DQG f 'HOHWLRQ SDWLHQWV &ODVV ,f KDG WKH PRVW FODVVLFDO SKHQRW\SH +RZHYHU SDWLHQWV IURP &ODVVHV OO9 H[KLELWHG VRPH DW\SLFDO IHDWXUHV 'LIIHUHQFHV ZHUH PRVW VWULNLQJ LQ JURZWK SDUDPHWHUV GHYHORSPHQW RI PRWRU VNLOOV VHL]XUHV DQG SLJPHQWDWLRQ 6WDWLVWLFDO DQDO\VLV RI ERG\ PDVV LQGH[ %0,f UHYHDOHG WKDW SDWLHQWV IURP &ODVVHV ,, ,,, DQG ,9 ZHUH ELJJHU DQG KHDYLHU WKDQ WKH GHOHWLRQV DQG &ODVV 9 SDWLHQWV )LJXUH $ 7DEOH f IRU ERWK 8) SDWLHQWV 3 f DQG WKH FRPELQHG GDWD VHW S f 6WDWLVWLFDO PRGHOV DOVR GHPRQVWUDWHG WKDW OHVV WKDQ b RI LQGLYLGXDOV IURP &ODVVHV ,, DQG ,,, KDG PLFURFHSKDO\ ZKHUHDV PRUH WKDQ b RI SDWLHQWV IURP WKH RWKHU WKUHH FODVVHV KDG D KHDG FLUFXPIHUHQFH OHVV WKDQ WKH UG SHUFHQWLOH )LJXUH % 7DEOH S f 7KH PHDQ DJH WR ZDON IRU &ODVV ZDV S f ZKLOH WKH PHDQ DJH WR ZDON IRU SDWLHQWV IURP &ODVVHV OO9 YDULHG IURP &ODVV ,,,f WR &ODVV ,9 )LJXUH & 7DEOH f 2QVHW RI VHL]XUHV DOVR GHSHQGHG XSRQ PROHFXODU FODVV )LJXUH 7DEOH f 6HL]XUHV VWDUWHG YHU\ HDUO\ LQ &ODVV DQG 9 SDWLHQWV

PAGE 52

DQG UHVSHFWLYHO\f FRPSDUHG WR &ODVVHV ,, ,,, DQG ,9 DQG UHVSHFWLYHO\ S f 7DEOH &OLQLFDO DQG JURZWK GDWD &ODVV &ODVV ,, &ODVV ,,, &ODVV ,9 &ODVV 9 8) 8) $OO 8) $OO 8) $OO 8) 6SHHFK f f f f f f f f ZRUGV r ZRUGV ZRUGV r ZRUGV r r r r r 6HL]XUH 2QVHW f f f f f f f f \HDU r r \UV r \UV r \UV r r r r r \UV r r r 6HL]XUH 6HYHULW\ f f f f f f f f 6HYHUH r 0RGHUDWH r 0LOG 1RQH r /HQJWK f f f f f f f f b r r b r b b r b r b r !b r r r r r :HLJKW f f f f f f f f b r r r r r b r b r r r r b r r b r b r r r !b %0, NJPf f f f f f f f f b r r r r b r r r r b r r r r r r b r r b b r !b r +HDG &LUFXP f f f f f f f f b r r b r r b b b r r r r b r r r r !b r r r r r r $OO SDUDPHWHUV DUH VWDWLVWLFDOO\ VLJQLILFDQW LQ 8) DQG FRPELQHG GDWD VHWV Sf ,Q WKH 8) SDWLHQW SRSXODWLRQ VLJQLILFDQW VHL]XUHV RFFXUUHG LQ GHOHWLRQ SDWLHQWV EXW RQO\ LQ 83' ,' 8%($ PXWDWLRQ DQG &ODVV 9 SDWLHQWV S ; 2nf 6LPLODU ILQGLQJV ZHUH REVHUYHG LQ WKH FRPELQHG GDWD VHW S ; 7DEOH f ,Q DGGLWLRQ b RI &ODVV SDWLHQWV ZHUH K\SRSLJPHQWHG FRPSDUHG WR

PAGE 53

IDPLO\ PHPEHUV S ; f +RZHYHU OHVV WKDQ b RI &ODVVHV OO,9 DQG RQO\ b RI SDWLHQWV LQ &ODVV 9 VKRZHG HYLGHQFH RI K\SRSLJPHQWDWLRQ 7DEOH f 7DEOH &OLQLFDO GDWD PHDQV &ODVV 8) &ODVV ,, 8) $OO &ODVV ,,, 8) $OO &ODVV ,9 8) $OO &ODVV 9 8) $JH WR VLWY s $JH WR ZDONr s s s s )LUVW VHL]XUH s s s s %LUWK ZHLJKW s s 0DWHUQDO DJH s s s s 3DWHUQDO DJH s s s s *HVWDWLRQDO DJH s s s $JH DW ODVW YLVLW s s s nn6LJQLILFDQW LQ 8) GDWD RQO\ 6LJQLILFDQW LQ FRPELQHG GDWD VHW RQO\ n6LJQLILFDQW LQ 8) DQG FRPELQHG GDWD VHWV 7DEOH &OLQLFDO GDWD SHUFHQWDJHV &ODVV 8) &ODVV ,, 8) $OO &ODVV ,,, 8) $OO &ODVV ,9 8) $OO &ODVV 9 8) :DON E\ \UVr f f f f f f f f )HHGLQJ 3UREOHPV f f f f f f f f 6LPSOH FRPPDQGVr f f f f f f f f 6HL]XUHV f f f f f f f f 6LJQLILFDQW 6HL]XUHVr f f f f f f f f +\SRSLJPHQWHGr f f f If f f f e/ f6LJQLILFDQW LQ ERWK GDWD VHWV 6LJQLILFDQW LQ 8) VHW RQO\ 'LVFXVVLRQ 0XWDWLRQV LQ 8%($ :H KDYH DFFXPXODWHG DQ $6 UHSRVLWRU\ RI FODVVLFDO $QJHOPDQ SDWLHQWV IURP GLIIHUHQW IDPLOLHV HDFK RI ZKRP KDV EHHQ VWXGLHG H[WHQVLYHO\ E\ XV DW WKH FOLQLFDO DQG PROHFXODU OHYHOV 3UHYLRXV PXWDWLRQ DQDO\VHV E\ RWKHU ODERUDWRULHV UHYHDOHG D YHU\ ORZ 8%($ PXWDWLRQ GHWHFWLRQ UDWH bf LQ VSRUDGLF SDWLHQWV ZLWK QRUPDO '1$ PHWK\ODWLRQ DW f 61531 %DXPHU HW DO )DQJ HW DO 0DO]DF HW DO 0RQGD HW DO D 5XVVR HW DO YDQ GHQ 2XZHODQG HW DO f )LYH

PAGE 54

H[SODQDWLRQV FDQ DFFRXQW IRU WKH SDXFLW\ RI 8%($ PXWDWLRQV LQ WKHVH SDWLHQWV 3DWLHQWV IURP WKHVH VWXGLHV GR QRW KDYH $6 EXW LQVWHDG KDYH GLVRUGHUV WKDW PLPLF $6 0DQ\ 8%($ PXWDWLRQV RFFXU LQ QRQFRGLQJ UHJLRQV 8%($ FDQ EH LQDFWLYDWHG E\ RWKHU PHFKDQLVPV 2WKHU JHQHV LQ WKH XELTXLWLQ SDWKZD\ JHQRPH ZLGHf DOVR FDXVH DQ $6 SKHQRW\SH $QJHOPDQDVVRFLDWHG PXWDWLRQV RFFXU LQ RWKHU T JHQHV 2QH JRDO RI RXU VWXG\ ZDV WR IXUWKHU QDUURZ WKHVH SRVVLELOLWLHV DQG WU\ WR HVWDEOLVK ZKHWKHU RU QRW RWKHU $6 JHQHV H[LVWHG 7KHUHIRUH ZH UHVWULFWHG RXU PXWDWLRQ DQDO\VLV WR $6 IDPLOLHV VHHQ E\ 8QLYHUVLW\ RI )ORULGD JHQHWLFLVWV HOLPLQDWLQJ SDWLHQWV ZLWK PLPLFNLQJ FRQGLWLRQV :H K\SRWKHVL]HG WKDW LI RQO\ RQH $6 JHQH H[LVWHG WKHQ b RI RXU FODVVLFDO $6 SDWLHQWV ZRXOG KDYH LQWUDJHQLF 8%($ PXWDWLRQV :H ZRXOG QRW H[SHFW WR ILQG PXWDWLRQV LQ b RI RXU SDWLHQWV EHFDXVH VRPH PXWDWLRQV ZLOO LQYDULDEO\ OLH LQ QRQFRGLQJ UHJLRQV RI WKH JHQH 2YHUDOO ZH IRXQG PXWDWLRQV LQ b RI RXU FODVVLFDO $6 SDWLHQWV b RI RXU VSRUDGLF FDVHV f DQG b f RI RXU IDPLOLDO FDVHV KDG PXWDWLRQV ZLWKLQ 8%($ $OWKRXJK ZH KDYH IRXQG WKH KLJKHVW 8%($ PXWDWLRQ GHWHFWLRQ UDWH LQ VSRUDGLF SDWLHQWV ZKR KDYH $6 WKH ORZHU WKDQ H[SHFWHG IUHTXHQF\ VXJJHVWV WKDW DOWHUQDWLYH H[SODQDWLRQV PXVW H[LVW IRU WKH ODFN 8%($ PXWDWLRQV LQ WKH UHPDLQLQJ VSRUDGLF &ODVV 9 SDWLHQWV 7KH VLPSOHVW H[SODQDWLRQ IRU WKH UHODWLYH ODFN RI PXWDWLRQV LQ SDWLHQWV ZLWK QRUPDO '1$ PHWK\ODWLRQ DW f 61531 LV WKDW PXOWLSOH PXWDWLRQV RFFXU RXWVLGH RI WKH FRGLQJ UHJLRQ $OWKRXJK IRUPDOO\ D SRVVLELOLW\ RQO\ WZR SDWLHQWV KDYH EHHQ IRXQG ZLWK OHVLRQV WKDW GLVUXSW HLWKHU WKH 8%($ JHQH RU DQ XSVWUHDP HOHPHQW *UHJHU HW DO *UHJHU HW DO f )XUWKHUPRUH QR PXWDWLRQV KDYH EHHQ UHSRUWHG LQ WKH f 875 RI 8%($ DQG 6RXWKHUQ DQDO\VLV RI RXU SDWLHQWV IDLOHG WR GHWHFW JHQRPLF UHDUUDQJHPHQWV LQ RXU IDPLOLHV

PAGE 55

,Q WKH f UHJLRQ RI LPSULQWHG JHQHV WKH UHSUHVVHG DOOHOH LV XVXDOO\ PHWK\ODWHG ZKLOH WKH H[SUHVVHG DOOHOH LV XQPHWK\ODWHG ,Q FDQFHU '1$ PHWK\ODWLRQ RI WKH SURPRWHU UHJLRQ KDV EHHQ VKRZQ WR LQDFWLYDWH WXPRU VXSSUHVVRU JHQHV ZKLOH GHPHWK\ODWLRQ RI SURPRWHUV FDQ OHDG WR DFWLYDWLRQ RI SURWRRQFRJHQHV 7\FNR f :LWK WKH H[FHSWLRQ DQG 0DVK DQG QRZ 8%($ WKH SURPRWHU UHJLRQV RI LPSULQWHG JHQHV VKRZ GLIIHUHQWLDO PHWK\ODWLRQ EDVHG RQ WKH SDUHQWDO RULJLQ RI WKH FKURPRVRPH *OHQQ HW DO 5D]LQ DQG &HGDU 7LOJKPDQ f ,Q DGGLWLRQ GHPHWK\ODWLRQ KDV EHHQ VKRZQ WR RFFXU LQ ORQJWHUP FHOO FXOWXUH /D6DOOH HW DO f UHDFWLYDWLQJ WKH PDWHUQDO DOOHOH RI 61531 6DLWRK DQG :DGD f 6HYHUDO SDWHUQDO RQO\ H[SUHVVHG JHQHV ZLWKLQ WKH $63:6 LPSULQWHG GRPDLQ GLVSOD\ SDUHQWRIRULJLQ '1$ PHWK\ODWLRQ LPSULQWV LQ SHULSKHUDO EORRG OHXNRF\WH 3%/f '1$ 'ULVFROO HW DO *OHQQ HW DO -D\ HW DO -RQJ HW DO .XERWD HW DO D 6XWFOLIIH HW DO f +RZHYHU ZKHQ ZH H[DPLQHG WKH &S* LVODQG DW f 8%($ ZH IRXQG QR HYLGHQFH IRU D '1$ PHWK\ODWLRQ LPSULQW LQ '1$ GHULYHG IURP 3%/ EUDLQ WLVVXHV RU JHUP FHOOV %RWK WKH PDWHUQDO DQG SDWHUQDO DOOHOHV ZHUH FRPSOHWHO\ XQPHWK\ODWHG HYHQ LQ WLVVXHV WKDW KDG SUHYLRXVO\ UHYHDOHG LPSULQWHG H[SUHVVLRQ RI 8%($ /RVVLH DQG 'ULVFROO XQSXEOLVKHG GDWD 5RXJHXOOH HW DO 9X DQG +RIIPDQ f ,W LV JHQHUDOO\ DFFHSWHG WKDW '1$ PHWK\ODWLRQ RI SURPRWHU UHJLRQV LV FORVHO\ DVVRFLDWHG ZLWK WUDQVFULSWLRQDO UHSUHVVLRQ %LUG DQG :ROIIH f $OWKRXJK QR RQH LV FHUWDLQ KRZ '1$ PHWK\ODWLRQ VHUYHV WR UHSUHVV WUDQVFULSWLRQ FDQGLGDWHV LQFOXGH GLUHFW EORFNDJH RI WUDQVFULSWLRQ IDFWRUV WR WKHLU ELQGLQJ VLWHV DOWHUDWLRQ RI ORFDO FKURPDWLQ VWUXFWXUH WKURXJK KLVWRQH LQWHUDFWLRQV DQG LQWHUSOD\ DPRQJ PHWK\ODWHG '1$ K\SHUDFHW\ODWHG KLVWRQHV DQG YDULRXV '1$ ELQGLQJ SURWHLQV VXFK DV 0H&3 %LUG DQG :ROIIH f :LWK WKH H[FHSWLRQ RI EUDLQ 8%($ LV H[SUHVVHG ELDOOHOLFDOO\ LQ DOO

PAGE 56

WLVVXHV H[DPLQHG 5RXJHXOOH HW DO 9X DQG +RIIPDQ f 2XU GDWD GHPRQVWUDWH WKDW f 8%($ LV QRUPDOO\ XQPHWK\ODWHG LQ D YDULHW\ RI WLVVXHV 7KHUHIRUH ZH K\SRWKHVL]HG WKDW PHWK\ODWLRQ RI WKH PDWHUQDO &S* LVODQG DW f 8%($ FRXOG UHSUHVV WUDQVFULSWLRQ RI WKH PDWHUQDO DOOHOH RI 8%($ LQ &ODVV 9 SDWLHQWV +RZHYHU 6RXWKHUQ DQDO\VLV UHYHDOHG WKDW &ODVV 9 SDWLHQWV DUH FRPSOHWHO\ XQPHWK\ODWHG DW f 8%($ LQ 3%/ '1$ LQGLFDWLQJ WKDW WKH\ GR QRW LQDFWLYDWH 8%($ E\ LQDSSURSULDWH PHWK\ODWLRQ 7R IXOO\ HOLPLQDWH WKLV SRVVLELOLW\ EUDLQ '1$ IURP &ODVV 9 SDWLHQWV QHHGV WR EH H[DPLQHG 6R IDU RXU H[SHULPHQWV KDYH VXJJHVWHG WKDW PXWDWLRQV LQ 8%($ DUH QRW WKH VROH FDXVH RI $QJHOPDQ V\QGURPH DGGLWLRQDO IDFWRUV PXVW DOVR EH LQYROYHG 7KH PRVW REYLRXV FDQGLGDWHV DUH RWKHU JHQHV LQ WKH XELTXLWLQ SDWKZD\ DQ H[WUHPHO\ FRPSOH[ FDVFDGH WKDW LQLWLDWHV ZKHQ XELTXLWLQ LV DFWLYDWHG DW LWV &WHUPLQXV E\ WKH ( DFWLYDWLQJ HQ]\PH &LHFKDQRYHU HW DO :LONLQVRQ f 2QFH DFWLYDWHG WKH XELTXLWLQ PROHFXOH LV WUDQVIHUUHG WR RQH RI DERXW WZHOYH ( XELTXLWLQFRQMXJDWLQJ HQ]\PHV YLD D KLJKHQHUJ\ WKLROHVWHU ERQG 1H[W DQ ( HQ]\PH SDLUV ZLWK RQH RI VHYHUDO GR]HQ ( XELTXLWLQSURWHLQ OLJDVHV IRUPLQJ D FRPSOH[ WKDW WUDQVIHUV DFWLYDWHG XELTXLWLQ ILUVW WR WKH ( HQ]\PH WKHQ VXEVHTXHQWO\ WR WKH WDUJHWHG SURWHLQ 7KH ( HQ]\PH WKHQ SRO\PHUL]HV WKH XELTXLWLQ SURGXFLQJ D PXOWLXELTXLWLQDWHG SURWHLQ WKDW LV UHFRJQL]HG DQG GHJUDGHG E\ WKH 6 SURWHRVRPH 7KLV (( LQWHUDFWLRQ LV YHU\ VSHFLILF 8%($ DQ ( HQ]\PHf ZLOO IRUP FRPSOH[HV ZLWK WKH XELTXLWLQFRQMXJDWLQJ HQ]\PHV 8EF+ DQG 8EF+ EXW QRW 8EF+ RU 8EF+ .XPDU HW DO f )XUWKHUPRUH WKH WHPSRUDO DQG VSDWLDO H[SUHVVLRQ SDWWHUQV RI VRPH ( OLJDVHV PD\ DGG DQ DGGLWLRQDO OD\HU RI SUHFLVLRQ WDUJHWLQJ $QDQ HW DO f $Q\ SURWHLQ WKDW LQWHUDFWV ZLWK 8%($ LQ WKLV FDVFDGH DQG DOO SURWHLQV WKDW 8%($ WDUJHWV IRU GHJUDGDWLRQ DUH JRRG FDQGLGDWHV IRU SDWLHQWV JURXSHG LQ &ODVV 9 6R

PAGE 57

IDU IRXU SURWHLQV KDYH EHHQ LGHQWLILHG DV VXEVWUDWHV IRU 8%($PHGLDWHG GHJUDGDWLRQ S ++5$ WKH 6UF IDPLO\ NLQDVH %ON DQG 8%($ LWVHOI ,W LV QRW FOHDU KRZ DQ\ RI WKHVH JHQHV FRXOG EH LQYROYHG LQ WKH HWLRORJ\ RI $6 DQG JLYHQ WKH FRPSOH[LW\ RI WKH XELTXLWLQ V\VWHP LGHQWLILFDWLRQ RI WKH VSHFLILF $6 JHQH RU JHQHV LQYROYHG LV D YHU\ GDXQWLQJ WDVN $OWHUQDWLYHO\ RWKHU T JHQHV PD\ SOD\ LPSRUWDQW UROHV LQ WKH HWLRORJ\ RI &ODVV 9 SDWLHQWV 8%($ LV D FRPSOH[ JHQH VXEMHFW WR WLVVXHVSHFLILF LPSULQWLQJ DQG DOWHUQDWLYH VSOLFLQJ $OEUHFKW HW DO .LVKLQR DQG :DJVWDII 5RXJHXOOH HW DO 9X DQG +RIIPDQ
PAGE 58

EUDLQ ERWK WKH PDWHUQDO DQG SDWHUQDO DOOHOHV RI 8%($ ZRXOG EH UHSUHVVHG ,W ZRXOG EH LQWHUHVWLQJ WR GHWHUPLQH LI &ODVV 9 SDWLHQWV GHPRQVWUDWHG ELDOOHOLF H[SUHVVLRQ RI WKH 8%($ DQWLVHQVH WUDQVFULSW LQ EUDLQ *HQRW\SH3KHQRW\SH &RUUHODWLRQV 7KH VHFRQG PDMRU JRDO RI WKLV VWXG\ ZDV WR HVWDEOLVK SKHQRW\SLF SURILOHV IRU HDFK PROHFXODU FODVV VR SK\VLFLDQV FRXOG DFFXUDWHO\ GLDJQRVH $6 DQG EH DEOH WR SUHGLFW RXWFRPHV IRU WKH IDPLOLHV RI SDWLHQWV ZLWK $QJHOPDQ V\QGURPH 5HFHQW VWXGLHV KDYH VKRZQ WKDW 83' )ULGPDQ HW DO E 6PLWK HW DO f DQG ,' %XUJHU HW DO *LOOHVVHQ.DHVEDFK HW DO 6DLWRK HW DO f SDWLHQWV KDYH OHVV VHYHUH SKHQRW\SHV WKDQ WKH GHOHWLRQV ,Q DGGLWLRQ 0RQGD DQG FROOHDJXHV Ef UHYHDOHG WKDW DV D JURXS QRQGHOHWLRQ SDWLHQWV &ODVVHV OO,9f ZHUH DOVR OHVV VHYHUHO\ DIIHFWHG +RZHYHU JHQRW\SHSKHQRW\SH FRUUHODWLRQV KDYH RQO\ UHYHDOHG GLIIHUHQFHV DPRQJ WKH ILUVW IRXU FODVVHV LQ KHDG FLUFXPIHUHQFH DQG IUHTXHQF\ RI VHL]XUHV 0RQGD HW DO Ef )XUWKHUPRUH QR SUHYLRXV VWXGLHV KDYH UHSRUWHG RQ WKH SKHQRW\SH DVVRFLDWHG ZLWK &ODVV 9 SDWLHQWV *HQRW\SHSKHQRW\SH DQDO\VHV RI RXU SDWLHQWV UHYHDOHG WKDW DOO ILYH FODVVHV KDG WKH IRXU FDUGLQDO IHDWXUHV RI $6 VHYHUH GHYHORSPHQWDO GHOD\ SURIRXQG VSHHFK LPSHGLPHQW WKH $6VSHFLILF PRYPHQW GLVRUGHU DQG WKH FKDUDFWHULVWLF $QJHOPDQ EHKDYLRU )XUWKHUPRUH VRPH FODVVHV KDYH DGGLWLRQDO FKDUDFWHULVWLFV WKDW DUH RIWHQ DVVRFLDWHG ZLWK WKH $QJHOPDQ V\QGURPH VXFK DV VHL]XUHV PLFURFHSKDO\ DQG K\SRSLJPHQWDWLRQ 2XW RI VHSDUDWH SDUDPHWHUV GHPRQVWUDWHG VWDWLVWLFDO GLIIHUHQFHV DPRQJ WKH ILYH FODVVHV DW S 2XU SDWLHQWV FRUUHODWH ZHOO ZLWK WKRVH LQ WKH OLWHUDWXUH ZLWK VLPLODU ILQGLQJV LQ FDWHJRULHV 2XU VWDWLVWLFDO PRGHOV GHPRQVWUDWHG WKDW WKH ILYH FODVVHV FRXOG EH VHSDUDWHG LQWR IRXU SKHQRW\SLF JURXSV &ODVV &ODVVHV ,, DQG ,,, &ODVV ,9 DQG &ODVV 9 0XOWLSOH FOLQLFDO GLVWLQFWLRQV FDQ EH

PAGE 59

PDGH EHWZHHQ WKH FODVVHV ZLWK GLIIHUHQFHV PRVW VWULNLQJ LQ SLJPHQWDWLRQ JURZWK SDUDPHWHUV DFKLHYHPHQW RI GHYHORSPHQWDO PLOHVWRQHV DQG VHYHULW\ IUHTXHQF\ DQG DJH DW RQVHW RI VHL]XUHV :H IRXQG WKDW GHOHWLRQ SDWLHQWV DV D JURXS KDYH WKH PRVW FODVVLFDO DQG VHYHUH SKHQRW\SH 7KH\ DFKLHYH GHYHORSPHQWDO PLOHVWRQHV ODWHU DQG WR D OHVVHU GHJUHH WKDQ WKH RWKHU FODVVHV DQG DUH OHVV OLNHO\ WR IROORZ VLPSOH FRPPDQGV &ODVV L SDWLHQWV KDYH WKH KLJKHVW LQFLGHQFH RI VHYHUH VHL]XUHV bf DQG K\SRSLJPHQWDWLRQ bf RI DOO ILYH FODVVHV ,Q DGGLWLRQ GHOHWLRQ SDWLHQWV WHQGHG WR KDYH D FRPSOHWH DEVHQFH RI VSHHFK bf D QRUPDO %0, GLVWULEXWLRQ DQG VHYHUH PLFURFHSKDO\ ,Q FRQWUDVW 83' DQG ,' SDWLHQWV ZKR KDYH LQGLVWLQJXLVKDEOH SKHQRW\SHVf DUH PXFK OHVV VHYHUHO\ DIIHFWHG 7KH\ KDYH ORZ LQFLGHQFHV RI K\SRSLJPHQWDWLRQ bf PLFURFHSKDO\ DQG VHYHUH VHL]XUHV bf ,Q DGGLWLRQ DERXW b RI 83' DQG ,' SDWLHQWV IURP RXU UHSRVLWRU\ FDQ VSHDN D IHZ ZRUGV 3DWLHQWV LQ &ODVVHV ,, DQG ,,, DUH ODUJHU KHDYLHU DQG RIWHQ KDYH EHWWHU FRRUGLQDWLRQ 7KHVH WZR JURXSV KDYH YHU\ KLJK %0, LQGLFHV 0RUH WKDQ b RI WKHVH LQGLYLGXDOV DUH DERYH WKH WK SHUFHQWLOH IRU WKHLU DJH JURXS 2XU GDWD FRUUHODWH ZHOO ZLWK WKDW RI )ULGPDQ DQG FROOHDJXHV Ef ZKR FRPSDUHG $6 SDWLHQWV ZLWK 83' IURP PXOWLSOH VWXGLHV WR GHOHWLRQ SDWLHQWV &ODVV ,f 7KHLU DQDO\VLV VKRZHG WKDW &ODVV ,, SDWLHQWV DOVR GLVSOD\HG D PLOGHU SKHQRW\SH VLPLODU WR RXU REVHUYDWLRQV 7KH &ODVV ,, SDWLHQWV ZHUH KHDYLHU ZDONHG HDUOLHU DQG ZHUH OHVV OLNHO\ WR KDYH VHL]XUHV PLFURFHSKDO\ RU D FRPSOHWH ODFN RI VSHHFK $QDO\VHV RI &ODVV ,,, SDWLHQWV IURP RWKHU VWXGLHV UHYHDOHG WKDW SDWLHQWV ZLWK LPSULQWLQJ PXWDWLRQV DOVR KDG D PLOGHU SKHQRW\SH 7KH\ ZHUH OHVV OLNHO\ WR KDYH PLFURFHSKDO\ DQG RIWHQ KDG QRUPDO SLJPHQWDWLRQ %XUJHU HW DO 6DLWRK HW DO f ,Q DGGLWLRQ VRPH VWXGLHV UHYHDOHG WKDW SDWLHQWV IURP &ODVVHV ,, DQG ,,, KDG IHZHU

PAGE 60

VHL]XUHV HDUO\ RQVHW REHVLW\ DQG EHWWHU PRWRU VNLOOV )ULGPDQ HW DO E *LOOHVVHQ .DHVEDFK HW DO 6PLWK HW DO f 8%($ PXWDWLRQ SDWLHQWV IDOO VRPHZKHUH LQ WKH PLGGOH 7KH\ DUH VWDWLVWLFDOO\ VLPLODU WR GHOHWLRQ SDWLHQWV ZLWK b RI SDWLHQWV KDYLQJ VLJQLILFDQW RU UHFXUULQJ VHL]XUHV HDUO\ RQVHW RI VHL]XUHV LQ PRVW SDWLHQWV D FRPSOHWH DEVHQFH RI VSHHFK LQ PRUH WKDQ b RI SDWLHQWV DQG D KLJK LQFLGHQFH RI PLFURFHSKDO\ +RZHYHU VWDWLVWLFDOO\ &ODVV ,9 SDWLHQWV DUH VLPLODU WR 83' DQG ,' SDWLHQWV LQ WKH GHYHORSPHQW RI PRWRU VNLOOV DELOLW\ WR IROORZ VLPSOH FRPPDQGV SLJPHQWDWLRQ DQG GHYHORSPHQW RI REHVLW\ 0RQGD DQG FROOHDJXHV Ef H[DPLQHG &ODVV ,9 SDWLHQWV LQGLYLGXDOO\ IRU KHDG FLUFXPIHUHQFH DQG VHL]XUHV 7KH\ DOVR FRQFOXGHG WKDW 8%($ PXWDWLRQ SDWLHQWV KDG KLJK LQFLGHQFHV RI VHL]XUHV DQG PLFURFHSKDO\ &ODVV 9 SDWLHQWV DUH YHU\ LQWHUHVWLQJ $OWKRXJK WKHVH SDWLHQWV KDYH QR GHWHFWDEOH FKURPRVRPH DEQRUPDOLW\ VWDWLVWLFDOO\ WKH\ DUH PRVW VLPLODU WR WKH GHOHWLRQ SDWLHQWV &ODVV 9 SDWLHQWV KDYH QRUPDO KHLJKW ZHLJKW DQG %0, GLVWULEXWLRQV VLPLODU WR WKDW REVHUYHG LQ &ODVV SDWLHQWV 7KH\ DOVR W\SLFDOO\ SUHVHQW ZLWK D FRPSOHWH DEVHQFH RI VSHHFK HDUO\ RQVHW RI VHL]XUHV K\SRSLJPHQWDWLRQ DQG PLFURFHSKDO\ +RZHYHU &ODVV 9 SDWLHQWV ZDON DERXW WZR \HDUV HDUOLHU WKDQ GHOHWLRQ SDWLHQWV DQG WKHLU VHL]XUHV DUH OHVV OLNHO\ WR EH UHFXUULQJ RU DV VHYHUH DV WKRVH REVHUYHG LQ SDWLHQWV IURP &ODVV 6LQFH &ODVV 9 SDWLHQWV WHQG WR KDYH D PRUH VHYHUH SKHQRW\SH WKDQ WKDW REVHUYHG LQ &ODVVHV ,, ,,, DQG ,9 LW LV OLNHO\ WKDW GLVUXSWLRQ RI PRUH WKDQ RQH JHQH LV FDXVDWLYH RI $6 LQ WKHVH SDWLHQWV 3HUKDSV &ODVV 9 SDWLHQWV KDYH D PXWDWLRQ LQ DQ XSVWUHDP JHQH RQ T WKDW DIIHFWV QRW RQO\ 8%($ EXW DOVR DGGLWLRQDO JHQHV WKDW JLYH ULVH WR D PRUH VHYHUH $6 SKHQRW\SH LQ WKHVH LQGLYLGXDOV $ JRRG FDQGLGDWH JHQH ZRXOG EH WKH 8%($ DQWLVHQVH WUDQVFULSW $OWHUQDWLYHO\ &ODVV 9 LQGLYLGXDOV PD\ KDYH

PAGE 61

PXWDWLRQV LQ RWKHU JHQHV LQ WKH XELTXLWLQDWLRQ SDWKZD\ 6LQFH WKH SKHQRW\SH LV VHYHUH ZH ZRXOG SUHGLFW WKDW WKH PXWDWLRQ ZRXOG EH LQ D JHQH WKDW FRQWUROOHG WKH GHJUDGDWLRQ RI PXOWLSOH SURWHLQV 2XU GDWD LQGLFDWH WKDW &ODVV SDWLHQWV FRPSULVH D FRQWLJXRXV JHQH GLVRUGHU ZLWK KDSORLQVXIILFLHQF\ RI PXOWLSOH JHQHV H[DFHUEDWLQJ WKH ODFN RI WKH PDWHUQDOO\ H[SUHVVHG 8%($ JHQH 3DWLHQWV LQ &ODVVHV ,, DQG ,,, KDYH WKH OHDVW VHYHUH DQG PRVW DW\SLFDO SKHQRW\SH VXJJHVWLQJ WKDW D GRXEOH GRVH RI WKH SDWHUQDORQO\ H[SUHVVHG JHQHV PD\ EH DPHOLRUDWLQJ WKH $6 SKHQRW\SH LQ 83' DQG ,' SDWLHQWV $OWHUQDWLYHO\ WKH PRGHUDWH SKHQRW\SH DVVRFLDWHG ZLWK 8%($ PXWDWLRQ SDWLHQWV PD\ VXJJHVW WKDW KDSORLQVXIILFLHQF\ RI 8%($ PD\ EH GHWULPHQWDO GXULQJ GHYHORSPHQW DQG LQWR DGXOWKRRG $GGLWLRQDOO\ 8%($ SURWHLQ OHYHOV PD\ EH WLJKWO\ UHJXODWHG LQ WKH FHQWUDO QHUYRXV V\VWHP DQG SHULSKHUDO WLVVXHV ,W LV OLNHO\ WKDW D FRPELQDWLRQ RI WKH GRXEOH GRVH RI WKH SDWHUQDOO\ H[SUHVVHG JHQHV DQG KDSORLQVXIILFLHQF\ RI 8%($ ERWK FRQWULEXWH WR WKH GLIIHUHQFHV LQ SKHQRW\SH REVHUYHG EHWZHHQ &ODVVHV ,, DQG ,,, DQG &ODVV ,9 SDWLHQWV 2I DOO IRXU QRQGHOHWLRQ FODVVHV WKH SDWLHQWV ZLWK QR GHWHFWDEOH FKURPRVRPH DEQRUPDOLW\ PRVW FORVHO\ UHVHPEOH &ODVV SDWLHQWV 2QH SX]]OLQJ ILQGLQJ LV WKDW RYHU b RI 83' ,' DQG 8%($ PXWDWLRQ SDWLHQWV EHFRPH H[WUHPHO\ REHVH E\ SXEHUW\ 7KHVH ILQGLQJV VWURQJO\ LQVLQXDWH WKDW WKH WKUHH FODVVHV PXVW VKDUH D FRPPRQ JHQHWLF PHFKDQLVP IRU WKLV REVHUYDWLRQ 7KH 83' DQG ,' SDWLHQWV VXJJHVW WKDW D GRXEOH GRVH RI D SDWHUQDO JHQH RU JHQHV FRXOG FDXVH WKH REHVLW\ +RZHYHU WKLV H[SODQDWLRQ GRHV QRW DFFRXQW IRU WKH 8%($ PXWDWLRQ SDWLHQWV ,V LW SRVVLEOH WKDW GLVUXSWLRQ RI WKH PDWHUQDOO\LQKHULWHG 8%($ JHQH FDQ VWDELOL]H D SURWHLQ WKDW LV UHVSRQVLEOH IRU WKH REHVLW\ SKHQRW\SH RU DFWLYDWH WKH PDWHUQDO DOOHOH RI D SDWHUQDOO\ H[SUHVVHG JHQH"

PAGE 62

7KLV LQWHJUDWHG VWXG\ RI WKH GLIIHULQJ JHQRW\SHSKHQRW\SH FRUUHODWLRQV IRXQG DPRQJ DOO FODVVHV RI $QJHOPDQ V\QGURPH SDWLHQWV UHYHDOV WKDW GLVWLQFW FOLQLFDO VXEJURXSV H[LVW $OWKRXJK PXWDWLRQV LQ 8%($ DUH VXIILFLHQW WR FDXVH WKH IRXU FDUGLQDO IHDWXUHV RI $QJHOPDQ V\QGURPH DV ZHOO DV UHFXUUHQW VHL]XUHV DQG PLFURFHSKDO\ RWKHU T JHQHV PXVW FRQWULEXWH WR WKH GHYHORSPHQW RI PRWRU VNLOOV VHYHULW\ RI VHL]XUHV FRJQLWLRQ JURZWK DQG REHVLW\

PAGE 63

$ >KKPKf§Rf§WEf§ % &'()*+ L L QU f§f§02K Rf§ % 6LWH *HQH 0XWDWLRQ 3UHGLFWHG 3URWHLQ ,QKHULWDQFH 3DWLHQW $ *$ &< 0DWHUQDO $63 % GHO IUDPHVKLIW 0DWHUQDO $63 % GHO IUDPHVKLIW 0DWHUQDO $63 & GHO IUDPHVKLIW 0DWHUQDO $63 & GHO IUDPHVKLIW 0DWHUQDO $63 GHO $ IUDPHVKLIW GH QRYR $63 ( &7 5; GH QRYR $63 ) GHO IUDPHVKLIW 0DWHUQDO $63 &7 5; GH QRYR $63 + $7 5; 0DWHUQDO $63 (O $7 5; 0DWHUQDO $63 + $7 5; 0DWHUQDO $63 + $7 5; 0DWHUQDO $63 GHO $ IUDPHVKLIW GH QRYR $63 GHO IUDPHVKLIW GH QRYR $63 )LJXUH 8%($ PXWDWLRQV LQ $6 SDWLHQWV IURP WKH 8) UHSRVLWRU\ $f *HQRPLF RUJDQL]DWLRQ RI 8%($ 8%($ VSDQV NE RI JHQRPLF '1$ *HQH LV VKRZQ WR VFDOH ([RQV ’ f DUH QXPEHUHG QXPHULFDOO\ IURP 7UDQVODWLRQ $7*f LQLWLDWLRQ VLWHV DUH GHSLFWHG 7KH SULPDU\ WUDQVODWLRQ LQLWLDWLRQ VLWH EHJLQV LQ H[RQ 7KH ORFDWLRQ RI HDFK PXWDn WLRQ LV LQGLFDWHG E\ D OHWWHU $.f %f 'HVFULSWLRQ RI PXWDWLRQV 7KH PXWDWLRQ IURP HDFK IDPLO\ $.f LV VKRZQ LQ FROXPQ &ROXPQ GHVFULEHV WKH SUHGLFWHG SURWHLQ FKDQJHV ZKLOH FROXPQ VKRZV WKH LQKHULWDQFH RI WKH PXWDWLRQ

PAGE 64

$ % & 3%/ $6 %UDLQ *HUP &HOOV &ODVV 9 $6 3DWLHQWV f ‘ cIWSLJZ Q U A LQ F )LJXUH '1$ PHWK\ODWLRQ DQDO\VLV RI f 8%($ $f *HQRPLF VWUXFWXUH RI 8%($ DQG WKH f &S* LVODQG NE EODFN EDUf GUDZQ WR VFDOH 6HOHFWHG UHVWULFWLRQ HQ]\PH VLWHV DUH VKRZQ (FR 5O (f 1RW 1f %VV+ ,, %f )DJ *f 7KH ORFDWLRQ RI WKH NE 1RW O(FR 5O SUREH LV VKRZQ DV LV WKH SRVLn WLRQ RI WKH NE (FR 5O IUDJPHQW WKDW VXUURXQGV WKH &S* LVODQG 7KH H[WHQW RI RYHUODS RI WKH DQWLVHQVH WUDQVFULSW LV DOVR VKRZQ ,I WKH &S* LVODQG LV PHWK\ODWHG WKH NE SUREH ZLOO K\EULGL]H WR D NE IUDJPHQW RQ JHQRPLF '1$ GLJHVWHG ZLWK (FR 5O DQG 1RW ,I WKH &S* LVODQG LV XQPHWK\ODWHG WKH SUREH ZLWK K\EULGL]H WR LWVHOI UHYHDOLQJ D NE IUDJPHQW %f 6RXWKHUQ EORW RI QRUPDO 1/f $6 $f DQG 3:6 3f JHQRPLF '1$ IURP SHULSKHUDO EORRG OHXNRF\WHV 3%/f IURQWDO FRUWH[ )f RFFLSLWDO OREH 2Ff FHUHEHOOXP &f DQG FRURQDO VHFWLRQ 6[f IURP $6 EUDLQ IURQWDO FRUWH[ IURP QRUPDO EUDLQ DGXOW WHVWLV 7f VSHUP 6f DQG IHWDO RYDU\ 2Yf GLJHVWHG ZLWK (FR 5O DQG 1RW '1$ IURP QRUPDO 3%/ ZDV DOVR GLJHVWHG ZLWK (FR 5O DORQH DV D FRQWURO (f :KHQ GLJHVWHG ZLWK (FR 5O DQG 1RW WKH NE SUREH RQO\ K\EULGL]HG WR D NE IUDJPHQW LQGLFDWLQJ WKDW WKH &S* LVODQG ZDV XQPHWK\ODWHG &f 6RXWKHUQ EORW RI 3%/ JHQRPLF '1$ IURP &ODVV 9 SDWLHQWV GLJHVWHG ZLWK (FR 5O DQG 1RW UHYHDOV WKDW WKH 8%($ &S* LVODQG LV XQPHWK\ODWHG LQ DOO SDWLHQWV

PAGE 65

< 2XW RI IUDPH LQVHUWLRQ $ 2XW RI IUDPH GHOHWLRQ A 6SOLFLQJ PXWDWLRQ ‘ 2XW RI IUDPH GHOHWLRQLQVHUWLRQ f 1RQVHQVH PXWDWLRQ 2 0LVVHQVH PXWDWLRQ ,QIUDPH LQVHUWLRQ 4 ,QIUDPH GHOHWLRQ — ,QIUDPH GHOHWLRQHORQJDWHG SURWHLQ 3XWDWLYH VSOLFLQJ PXWDWLRQ )LJXUH 6XPPDU\ RI DOO SXEOLVKHG PXWDWLRQV LQ 8%($ *HQH LV VKRZQ WR VFDOH ([RQV DUH QXPEHUHG QXPHULFDOO\ IURP 7UDQVFULSWLRQ DUURZf DQG WUDQVODWLRQ $7*f VWDUW VLWHV DUH QRWHG 7KH SULPDU\ WUDQVODWLRQ LQLWLDWLRQ VLWH EHJLQV LQ H[RQ 7KH ORFDWLRQ RI HDFK PXWDWLRQ LV LQGLFDWHG E\ D V\PERO )LOOHG V\PEROV LQGLFDWH SURWHLQWUXQFDWLQJ PXWDWLRQV 6\PEROV DUH VWDFNHG DW SRVLWLRQV ZKHUH WZR QRQUHODWHG LQGLYLGXDOV VKDUH D FRPPRQ PXWDWLRQ 7KHUH DUH WRWDO PXWDn WLRQV LQ XQUHODWHG LQGLYLGLXDOV )RUW\ILYH PXWDWLRQV DUH XQLTXH )DPLOLDO PXWDWLRQV DUH FRXQWHG RQFH 0RVW PXWDWLRQV f DUH SURWHLQ WUXQFDWLQJ DQG FOXVWHU LQ H[RQV DQG 87

PAGE 66

)LJXUH 0HDQ %0, +& DJH WR ZDON DQG RQVHW RI VHL]XUHV %R[HV VKRZ WKH H[WHQW RI b RI WKH SDWLHQWV ZKLOH EDUV 7f GHSLFW WKH UDQJH 0HGLDQ f PHDQ f RXWOLHUV DQG H[WUHPH RXWOLHUV $ DUH VKRZQ A6WDWLVWLFDOO\ VLJQLILFDQW LQ 8) DQG FRPELQHG GDWD VHWV i6WDWLVWLFDOO\ VLJQLILFDQW LQ 8) GDWD RQO\ 0ROHFXODU FODVV O9f LV VKRZQ DW WKH ERWWRP RI HDFK JUDSK 7KH SHUFHQWLOHV $ DQG %f DQG DJH LQ \HDUV & DQG 'f DUH VKRZQ DW OHIW $f %RG\ PDVV LQGH[ SHUFHQWLOHV %f +HDG FLUFXPIHUHQFH SHUFHQWLOHV &f 0HDQ DJH WR ZDON 'f 0HDQ DJH DW RQVHW RI VHL]XUHV 8

PAGE 67

'1$ 0(7+
PAGE 68

:LWK WKH H[FHSWLRQ RI ,3: DOO RI WKHVH JHQHV H[KLELW LPSULQWHG H[SUHVVLRQ LQ DOO WLVVXHV H[DPLQHG /HH DQG :HYULFN f 2QO\ WKH $QJHOPDQ JHQH 8%($ GHPRQVWUDWHG SUHIHUHQWLDO H[SUHVVLRQ IURP WKH PDWHUQDO DOOHOH ZKLFK ZDV OLPLWHG WR WKH EUDLQ $OEUHFKW HW DO 1DNDR HW DO 5RXJHXOOH HW DO 9X DQG +RIIPDQ f 6WXGLHV LQ PLFH UHYHDOHG WKDW LPSULQWHG H[SUHVVLRQ RI 8EHD ZDV FHOOVSHFLILF DV ZKROH PRXVH EUDLQ IDLOHG WR VKRZ PDWHUQDORQO\ WUDQVFULSWLRQ 6XWFOLIIH HW DO f )XUWKHU H[SHULPHQWV UHYHDOHG WKDW FRPSOHWH LPSULQWHG H[SUHVVLRQ RI 8EHD ZDV OLPLWHG WR WKH &$ DQG &$ UHJLRQV RI WKH KLSSRFDPSXV PLWUDO FHOO OD\HU RI WKH ROIDFWRU\ EXOE DQG SXUNLQMH FHOOV LQ WKH FHUHEHOOXP $OEUHFKW HW DO f +RZHYHU RWKHU EUDLQ UHJLRQV GHPRQVWUDWHG ELDVHG WUDQVFULSWLRQ IURP WKH PDWHUQDO DOOHOH 7KH SURPRWHU UHJLRQV RI LPSULQWHG JHQHV VKRZ GLIIHUHQWLDO PHWK\ODWLRQ EDVHG RQ WKH SDUHQWDO RULJLQ RI WKH FKURPRVRPH 5D]LQ DQG &HGDU f ,Q WKH f UHJLRQ RI LPSULQWHG JHQHV WKH UHSUHVVHG PDWHUQDO DOOHOHV DUH KHDYLO\ PHWK\ODWHG ZKLOH WKH H[SUHVVHG SDWHUQDO DOOHOHV DUH XQGHUPHWK\ODWHG '1$ PHWK\ODWLRQ RI SURPRWHU UHJLRQV LV FORVHO\ DVVRFLDWHG ZLWK WUDQVFULSWLRQDO UHSUHVVLRQ DQG KDV EHHQ VKRZQ WR LQDFWLYDWH WXPRU VXSSUHVVRU JHQHV ZKLOH GHPHWK\ODWLRQ RI SURPRWHUV FDQ OHDG WR DFWLYDWLRQ RI SURWRRQFRJHQHV %D\OLQ HW DO )HLQEHUJ 7\FNR f ,Q DGGLWLRQ GHPHWK\ODWLRQ KDV EHHQ VKRZQ WR RFFXU LQ ORQJWHUP FHOO FXOWXUH UHDFWLYDWLQJ WKH PDWHUQDO DOOHOHV RI 61531 DQG 0.51 6DLWRK DQG :DGD f 6HYHUDO SDWHUQDORQO\ H[SUHVVHG JHQHV ZLWKLQ WKH $63:6 LPSULQWHG GRPDLQ GLVSOD\ SDUHQWRIRULJLQ '1$ PHWK\ODWLRQ LPSULQWV LQ SHULSKHUDO EORRG OHXNRF\WH 3%/f '1$ %RFFDFFLR HW DO 'ULVFROO HW DO *OHQQ HW DO -D\ HW DO -RQJ HW DO .XERWD HW DO D /HH HW DO 6XWFOLIIH HW DO f +RZHYHU ZKHQ ZH H[DPLQHG WKH &S* LVODQG DW f 8%($ ZH IRXQG QR HYLGHQFH IRU D '1$

PAGE 69

PHWK\ODWLRQ LPSULQW LQ '1$ GHULYHG IURP 3%/ EUDLQ WLVVXHV RU JHUP FHOOV /RVVLH HW DO LQ SUHSDUDWLRQf %RWK WKH PDWHUQDO DQG SDWHUQDO DOOHOHV ZHUH FRPSOHWHO\ XQPHWK\ODWHG HYHQ LQ WLVVXHV WKDW KDG SUHYLRXVO\ UHYHDOHG LPSULQWHG H[SUHVVLRQ RI 8%($ '1$ PHWK\ODWLRQ DQDO\VHV RI WKH SDWHUQDOO\ H[SUHVVHG JHQHV VXJJHVWHG WKDW PHWK\ODWLRQ RI WKH SURPRWHU UHJLRQV RQ WKH PDWHUQDO DOOHOHV ZDV UHVSRQVLEOH IRU LPSULQWHG H[SUHVVLRQ +RZHYHU QR '1$ PHWK\ODWLRQ LPSULQW KDV EHHQ VKRZQ WR H[LVW DW 8%($ 7KHUHIRUH ZH ZDQWHG WR WHVW ZKHWKHU VSHFLILF FHOO W\SHV LQ WKH KXPDQ EUDLQ GHPRQVWUDWHG LPSULQWHG H[SUHVVLRQ RI 8%($ DQG GHWHUPLQH LI VRPH RI WKHVH LPSULQWHG WLVVXHV DOVR GHPRQVWUDWHG '1$ PHWK\ODWLRQ LPSULQWV DW WKH &S* LVODQG ORFDWHG LQ WKH SURPRWHU RI 8%($ 0DWHULDOV DQG 0HWKRGV +XPDQ 6XEMHFWV DQG 7LVVXH 6DPSOHV $OO SDWLHQWV ZLWK $6 DQG 3:6 ZHUH GHOHWLRQV ZLWK D FODVVLFDO SKHQRW\SH +ROP HW DO :LOOLDPV HW DO Df 7LVVXHV IURP SDWLHQWV ZLWK $6 ZHUH REWDLQHG IURP WKH 8QLYHUVLW\ RI )ORULGD %UDLQ %DQN ZKLOH WLVVXH VDPSOHV IURP WKH 3:6 DQG FRQWURO VXEMHFWV ZHUH REWDLQHG IURP WKH 8QLYHUVLW\ RI 0LDPL %UDLQ %DQN DQG f 7KHVH VWXGLHV ZHUH DSSURYHG E\ WKH LQVWLWXWLRQDO UHYLHZ ERDUG DW WKH 8QLYHUVLW\ RI )ORULGD DQG LQIRUPHG FRQVHQW ZDV REWDLQHG IURP DOO SDWLHQWV DQGRU SDUHQWV 51$ ,VRODWLRQ )RUPDOLQ )L[HG 3DUDIILQ (PEHGGHG 6DPSOHV ))3(f 2Q GD\ RQH WLVVXH VHFWLRQV ZHUH GHSDUDIILQL]HG LQ VXEVHTXHQW PLQ [\OHQH ZDVKHV RI DQG PO DW r& (DFK ZDVK ZDV IROORZHG E\ FHQWULIXJDWLRQ DW J IRU PLQ DQG UHPRYDO RI

PAGE 70

VXSHUQDWDQW ;\OHQHV ZHUH UHPRYHG E\ WZR b HWKDQRO ZDVKHV DQG POf DW r& IRU PLQ HDFK $ PLQ FHQWULIXJDWLRQ VWHS DW J IROORZHG HDFK HWKDQRO ZDVK 3HOOHWV ZHUH GULHG EULHIO\ EHIRUH WKH DGGLWLRQ RI PO 51$ O\VLV EXIIHU 0 7ULV+&O S+ 0 1D&O P0 0J&O DQG b 6'6f DQG SL 3URWHLQDVH PJPOf 6DPSOHV ZHUH KRPRJHQL]HG ZLWK D WLVVXPL]HU DQG LQFXEDWHG DW r& RYHUQLJKW $QRWKHU PO RI 51$ O\VLV EXIIHU DQG SL RI 3URWHLQDVH ZHUH DGGHG HDFK GD\ IRU VXFFHVVLYH GD\V 1XFOHLF DFLGV ZHUH SXULILHG E\ SKHQROFKORURIRUP H[WUDFWLRQ DQG HWKDQRO SUHFLSLWDWHG *HQRPLF '1$ ZDV UHPRYHG E\ '1DVH 5RFKHf GLJHVWLRQ )LYH SJ RI WRWDO QXFOHLF DFLGV ZHUH LQFXEDWHG DW r& ZLWK 8 RI '1$VH IRU PLQ LQ ; 3&5 EXIIHU 5RFKHf SXULILHG E\ SKHQROFKORURIRUP H[WUDFWLRQ DQG HWKDQRO SUHFLSLWDWLRQ )UHVK )UR]HQ 7LVVXHV 51$ ZDV LVRODWHG IURP IUHVK IUR]HQ WLVVXHV DFFRUGLQJ WR HVWDEOLVKHG SURWRFROV &KRPF]\QVNL DQG 6DFFKL f 573&5 F'1$V WRWDO 8%($ DQG 8%($ DQWLVHQVHf ZHUH JHQHUDWHG IURP QJ RI IUHVK IUR]HQ DQG ))3( WRWDO 51$ DFFRUGLQJ WR VWDQGDUG SURFHGXUHV /LIH 7HFKQRORJLHVf XVLQJ HLWKHU UDQGRP KH[DPHUV RU SUHYLRXVO\ SXEOLVKHG SULPHUV 5RXJHXOOH HW DO f 3&5 SURGXFWV IURP 8%($ WKH 8%($ DQWLVHQVH WUDQVFULSW 6185)61531 DQG WKH WUDQVIHUULQ UHFHSWRU 75f ZHUH DPSOLILHG VL]H IUDFWLRQDWHG E\ JHO HOHFWURSKRUHVLV EORWWHG DQG K\EULGL]HG ZLWK RQH RI WKH SULPHUV XVHG IRU 3&5 3&5 SULPHUV IURP H[RQV DQG DQG H[RQ ZHUH XVHG WR DPSOLI\ 8%($ DQG WKH 8%($ DQWLVHQVH WUDQVFULSW UHVSHFWLYHO\ /RVVLH HW DO LQ SUHSDUDWLRQf 6185)61531 SULPHUV IURP H[RQV SUHYLRXVO\ WR f KDYH EHHQ SUHYLRXVO\ SXEOLVKHG *OHQQ HW DO f 3ULPHUV ZHUH GHVLJQHG WR DPSOLI\ D ES SURGXFW IURP WKH 75 WR FRQWURO IRU WUDQVFULSW OHYHOV 7KH IRUZDUG SULPHU ZKLFK VWDUWV DW QXFOHRWLGH LV f*&7$&77*

PAGE 71

**&7$77*7$$$***f ZKLOH WKH UHYHUVH SULPHU LV f$&*&&$*$&777*&7*$*77f DQG HQGV DW QXFOHRWLGH RI WKH 75 2QH SULPHU IURP HDFK 3&5 UHDFWLRQ ZDV ODEHOHG E\ NLQDVLQJ 3URPHJDf QJ LQ D VWDQGDUG UHDFWLRQ FRQWDLQLQJ S&L 3 \G$73 $PHUVKDPf /DEHOHG SULPHUV ZHUH K\EULGL]HG WR 6RXWKHUQ EORWV RI 3&5 SURGXFWV RYHUQLJKW DW 7+ LQ ; 66&3 b 6'6 ; 'HQKDUGWfV DQG PJPO VLQJOH VWUDQGHG VDOPRQ VSHUP '1$ 7+ LV 7P PLQXV r& WKH ROLJR LQ ; 66&3 b 6'6 ([FHVV SUREH ZDV UHPRYHG E\ WZR PLQ ZDVKHV LQ SUHKHDWHG IUHVKO\ SUHSDUHG K\EULGL]DWLRQ EXIIHU 3URGXFWV ZHUH YLVXDOL]HG E\ DXWRUDGLRJUDSK\ '1$ 0HWK\ODWLRQ 0HWK\ODWLRQ 6SHFLILF 3&5 6RGLXP ELVXOILWH WUHDWPHQW RI JHQRPLF '1$ IURP IUHVK IUR]HQ WLVVXHV DQG VXEVHTXHQW PHWK\ODWLRQ DQDO\VLV RI 61531 ZDV GRQH DFFRUGLQJ WR SUHYLRXV SURWRFROV .XERWD HW DO /RVVLH DQG 'ULVFROO f 7ZR VHWV RI SULPHUV ZHUH GHVLJQHG WR DVVHVV WKH PHWK\ODWLRQ VWDWXV RI ERWK 1RW VLWHV LQ WKH 8%($ &S* LVODQG $W WKH SUR[LPDO HQG RI WKH &S* LVODQG PRUH ff WKH SULPHUV DUH DV IROORZV PHWK\ODWHG SULPHU VHW 0) f&*7&*&**7&*&*$*$77f DQG 05 f $&*&*&&*$$7&*$&$$$$f XQPHWK\ODWHG SULPHU VHW 8) f*7*77*7**77*7*$*$7 77*7*f DQG 85 f$&$$$&$&&&$&$&7$$&$$$7$$&7ff 7KH SULPHU VHWV WKDW DPSOLI\ WKH GLVWDO &S* LVODQG DUH DV IROORZV PHWK\ODWHG SULPHU VHW 0) f*$7$**7$ *&**&**77**&*$&*$$f DQG 05 f*&*&&7$$$&7$&*$&*$&&*&&7&$f XQPHWK\ODWHG SULPHU VHW 8) f*$$7*77***$O , O**7**7f DQG 85 f $$$&7$&$$&$$&&$&&7&$&7$$7&$ff 3&5 SURGXFWV ZHUH VWDLQHG ZLWK HWKLGLXP EURPLGH DQG YLVXDOL]HG RQ DQ (DJOH (\H ,, SKRWRGRFXPHQWDWLRQ V\VWHP 6WUDWDJHQHf 6RXWKHUQ $QDO\VLV 6RXWKHUQ DQDO\VLV RI 61531 DQG 8%($ ZHUH SHUIRUPHG DFFRUGLQJ WR SXEOLVKHG SURWRFROV *OHQQ HW DO E /RVVLH HW DO LQ SUHSDUDWLRQf

PAGE 72

5HVXOWV 8%($ 'RHV 1RW 'HPRQVWUDWH D '1$ 0HWK\ODWLRQ ,PSULQW ,Q RXU SUHYLRXV DQDO\VLV RI WKH GLIIHUHQW FODVVHV RI $QJHOPDQ V\QGURPH SDWLHQWV ZH GHPRQVWUDWHG WKDW 8%($ ZDV XQPHWK\ODWHG LQ DOO WLVVXHV H[DPLQHG LQFOXGLQJ IRXU GLVWLQFW UHJLRQV RI WKH KXPDQ EUDLQ )LJXUH f ,QWHUHVWLQJO\ RQH UHJLRQ IURQWDO FRUWH[ KDG SUHYLRXVO\ EHHQ VKRZQ WR GHPRQVWUDWH LPSULQWHG H[SUHVVLRQ RI 8%($ :H GHYHORSHG D QRYHO 3&5 EDVHG DVVD\ WR DVVHVV WKH '1$ PHWK\ODWLRQ VWDWXV RI 8%($ E\ VRGLXP ELVXOILWH :H GHVLJQHG IRXU VHWV SULPHUV WR DPSOLI\ WKH SUR[LPDO DQG GLVWDO UHJLRQV RI WKH 8%($ &S* LVODQG )LJXUH $f $W ERWK WKH SUR[LPDO DQG GLVWDO HQGV RI WKH &S* LVODQG 3&5 SURGXFWV ZHUH RQO\ JHQHUDWHG IURP WKH XQPHWK\ODWHG SULPHUV LQ DOO $6 3:6 DQG FRQWURO VDPSOHV )LJXUH %f $ 3&5 SURGXFW IURP WKH PHWK\ODWHG SULPHUV ZDV DPSOLILHG LQ FRVPLG '1$ WUHDWHG ZLWK 6VVO &S* PHWK\ODVH )LJXUH %f $V D FRQWURO WKH VDPH EUDLQ WLVVXHV ZHUH DVVD\HG IRU PHWK\ODWLRQ VWDWXV DW f 61531 )LJXUH &f ,Q WKH $6 EUDLQ WLVVXHV RQO\ WKH XQPHWK\ODWHG 61531 DOOHOH ZDV DPSOLILHG ZKLOH RQO\ WKH PHWK\ODWHG DOOHOH ZDV DPSOLILHG LQ 3:6 EUDLQ VDPSOHV %RWK DOOHOHV ZHUH SUHVHQW LQ FRQWURO VDPSOHV ([SUHVVLRQ $QDO\VLV RI 8%($ DQG WKH $QWLVHQVH 7UDQVFULSW LQ WKH %UDLQ 7R GDWH WKH RQO\ UHJLRQ RI WKH KXPDQ EUDLQ SURYHQ WR VKRZ LPSULQWHG H[SUHVVLRQ RI HLWKHU 8%($ RU WKH DQWLVHQVH WUDQVFULSW LV WKH IURQWDO FRUWH[ 5RXJHXOOH HW DO f +RZHYHU PRXVH VWXGLHV VXJJHVW WKDW RWKHU GLVWLQFW UHJLRQV RI WKH KXPDQ EUDLQ PD\ DOVR GHPRQVWUDWH LPSULQWHG H[SUHVVLRQ RI 8%($ $OEUHFKW HW DO f :H H[DPLQHG LPSULQWHG H[SUHVVLRQ RI 8%($ WKH DQWLVHQVH WUDQVFULSW DQG 6185)61531 LQ EUDLQ WLVVXHV IURP $6 3:6 DQG FRQWURO LQGLYLGXDOV

PAGE 73

:H DVVHVVHG LPSULQWHG H[SUHVVLRQ RI 8%($ DQG WKH DQWLVHQVH WUDQVFULSW E\ VWUDQGVSHFLILF 573&5 )LJXUH $f 7KUHH F'1$ SRROV ZHUH JHQHUDWHG IURP HDFK QJ WRWDO 51$ VDPSOH WRWDO F'1$ GHULYHG IURP UDQGRP KH[DPHUV 8%($ VHQVH DQG 8%($ DQWLVHQVH WUDQVFULSWV 61531 DQG WKH WUDQVIHUULQ UHFHSWRU ZHUH DPSOLILHG IURP WKH WRWDO F'1$ SRRO 3&5 SULPHUV IURP H[RQV DQG ZHUH XVHG WR DPSOLI\ WKH 8%($ JHQH ZKLOH SULPHUV IURP LQWURQV DQG DPSOLILHG WKH 8%($ DQWLVHQVH WUDQVFULSW 8%($ ZDV SUHGRPLQDQWO\ H[SUHVVHG LQ 3:6 EUDLQ VDPSOHV PDWHUQDO H[SUHVVLRQf DQG WKH 8%($ DQWLVHQVH WUDQVFULSW ZDV SUHGRPLQDQWO\ H[SUHVVHG IURP WKH SDWHUQDO DOOHOH DV LW ZDV REVHUYHG LQ $6 EXW QRW 3:6 EUDLQV )LJXUH %f 3URORQJHG H[SRVXUH RI WKH 8%($ 6RXWKHUQ UHYHDOHG WKDW 8%($ ZDV H[SUHVVHG DW YHU\ ORZ OHYHOV LQ DOO WKUHH $6 EUDLQ VDPSOHV +RZHYHU 61531 ZDV RQO\ H[SUHVVHG IURP WKH $6 VDPSOHV 8%($ WKH DQWLVHQVH WUDQVFULSW 61531 DQG WKH 75 ZHUH H[SUHVVHG LQ F'1$ SRROV IURP FRQWURO EUDLQV GDWD QRW VKRZQf 'LVFXVVLRQ '1$ PHWK\ODWLRQ RI SURPRWHU UHJLRQV LV FORVHO\ DVVRFLDWHG ZLWK WUDQVFULSWLRQDO UHSUHVVLRQ %LUG DQG :ROIIH f :LWK WKH H[FHSWLRQ RI 0DVK DQG QRZ 8%($ DOO ZHOOVWXGLHG LPSULQWHG JHQHV GLVSOD\ SDUHQWRIRULJLQ PHWK\ODWLRQ LPSULQWV *OHQQ HW DO 5D]LQ DQG &HGDU 7LOJKPDQ f LQFOXGLQJ DOO RI WKH ZHOO FKDUDFWHUL]HG SDWHUQDOO\ H[SUHVVHG JHQHV ZLWKLQ T 7KH PDWHUQDO DOOHOHV RI 0.51 'ULVFROO HW DO f 1'1 -D\ HW DO f DQG 6185)61531 *OHQQ HW DO 6XWFOLIIH HW DO f GHPRQVWUDWH SUHIHUHQWLDOO\ PHWK\ODWLRQ LQ WKH SURPRWHU UHJLRQV ,Q DGGLWLRQ VHYHUDO DQRQ\PRXV &S* VLWHV ZLWKLQ WKH $63:6 LPSULQWHG GRPDLQ DOVR GHPRQVWUDWH '1$ PHWK\ODWLRQ LPSULQWV 7KH EHVW VWXGLHG RI WKHVH LV 3: 'LWWULFK HW DO f EXW VHYHUDO VLWHV ZLWKLQ WKH LPSULQWLQJ FHQWHU ,&f DOVR GHPRQVWUDWH '1$ PHWK\ODWLRQ LPSULQWV )DUEHU HW DO f ,QFOXGLQJ 6185)61531

PAGE 74

WHQ VLWHV ZLWKLQ WKH & VKRZ GLIIHUHQWLDO PHWK\ODWLRQ EHWZHHQ WKH SDUHQWDO FKURPRVRPHV 1LQH RI WKHVH &S*V DUH SUHIHUHQWLDOO\ PHWK\ODWHG RQ WKH PDWHUQDO DOOHOH '1$ PHWK\ODWLRQ RI WKH SURPRWHU UHJLRQV RI WKH SDWHUQDOO\ H[SUHVVHG JHQHV ZLWKLQ WKH $63:6 LPSULQWHG GRPDLQ FRUUHODWHV ZHOO ZLWK ZKDW LV SUHVHQWO\ NQRZQ DERXW PHWK\ODWLRQLQGXFHG UHSUHVVLRQ %LUG DQG :ROIIH f 'DWD IURP WKH SUHVHQW VWXG\ VXJJHVW WKDW LPSULQWHG H[SUHVVLRQ RI 8%($ RFFXUV YLD D QRYHO PHFKDQLVP 2QH SRVVLEOH UHDVRQ IRU WKH ODFN RI D '1$ PHWK\ODWLRQ LPSULQW LQ 8%($ FRXOG KDYH EHHQ WKDW GLIIHUHQWLDO PHWK\ODWLRQ RQO\ RFFXUUHG LQ GLVFUHHW UHJLRQV RI WKH KXPDQ EUDLQ +RZHYHU ZH ZRXOG H[SHFW WKDW WKH UHJLRQV GHPRQVWUDWLQJ LPSULQWHG H[SUHVVHG ZRXOG DOVR UHYHDO D '1$ PHWK\ODWLRQ LPSULQW ,W LV FOHDU IURP RXU SUHVHQW VWXGLHV WKDW QR '1$ PHWK\ODWLRQ LPSULQW H[LVWV DW WKH &S* LVODQG DW f 8%($ LQ VL[ GLIIHUHQW EUDLQ UHJLRQV DOWKRXJK VRPH RI WKHVH WLVVXHV GHPRQVWUDWH LPSULQWHG H[SUHVVLRQ RI 8%($ 7KHUHIRUH LW LV XQOLNHO\ WKDW UHSUHVVLRQ RI 8%($ RFFXUV E\ '1$ PHWK\ODWLRQ DW WKH SURPRWHU $Q DOWHUQDWLYH H[SODQDWLRQ IRU LPSULQWHG H[SUHVVLRQ RI 8%($ VWHPPHG IURP WKH GLVFRYHU\ RI D EUDLQVSHFLILF 8%($ DQWLVHQVH WUDQVFULSW 5RXJHXOOH HW DO f ([DPLQDWLRQ RI IURQWDO FRUWH[ IURP VLQJOH $6 DQG 3:6 VDPSOHV UHYHDOHG WKDW 8%($ ZDV SUHIHUHQWLDOO\ H[SUHVVHG IURP WKH PDWHUQDO DOOHOH ZKLOH WKH DQWLVHQVH WUDQVFULSW ZDV SUHIHUHQWLDOO\ H[SUHVVHG IURP WKH SDWHUQDO DOOHOH +RZHYHU DPSOLILFDWLRQ RI WKH f 875 UHYHDOHG ELDOOHOLF H[SUHVVLRQ RI 8%($ XVLQJ WKH VDPH $6 VDPSOH /HH DQG :HYULFN f 6LQFH VWUDQGVSHFLILF UHYHUVH WUDQVFULSWLRQ ZDV QRW GRQH ELDOOHOLF H[SUHVVLRQ ZDV H[SHFWHG LQ WKLV UHDFWLRQ ,W LV LPSRUWDQW WR QRWH WKDW ERWK WUDQVFULSWV DUH H[SUHVVHG DW ORZ OHYHOV b f IURP WKH UHSUHVVHG DOOHOHV 5RXJHXOOH HW DO f 7KH DXWKRUV SRVWXODWHG WKDW FRH[SUHVVLRQ RI 8%($ DQG WKH DQWLVHQVH

PAGE 75

WUDQVFULSW IURP WKH VDPH FKURPRVRPH ZRXOG UHVXOW LQ VLOHQFLQJ RI WKH 8%($ JHQH LQ FV DFFRXQWLQJ IRU WKH PDWHUQDORQO\ H[SUHVVLRQ RI 8%($ LQ EUDLQ *LYHQ WKDW 8%($ ZDV FRPSOHWHO\ XQPHWK\ODWHG LQ DOO WLVVXHV H[DPLQHG WKLV ZDV DQ DWWUDFWLYH K\SRWKHVLV ,Q RUGHU WR WHVW WKLV SRVVLELOLW\ ZH DQDO\]HG LPSULQWHG H[SUHVVLRQ RI 8%($ DQG WKH DQWLVHQVH WUDQVFULSW LQ WZR $6 SDWLHQWV SDWHUQDO RQO\f WZR 3:6 LQGLYLGXDOV PDWHUQDO RQO\f DQG WZR QRUPDO FRQWUROV ELSDUHQWDOf 2XU VWXGLHV VXSSRUWHG WKLV PRGHO UHYHDOLQJ WKDW 8%($ ZDV SUHIHUHQWLDOO\ H[SUHVVHG IURP WKH PDWHUQDO DOOHOH LQ VHYHUDO UHJLRQV RI WKH KXPDQ EUDLQ LQFOXGLQJ IURQWDO FRUWH[ KLSSRFDPSXV DQG FHUHEHOOXP ZKLOH WKH DQWLVHQVH WUDQVFULSW ZDV RQO\ H[SUHVVHG IURP WKH SDWHUQDO DOOHOH 7KH ODFN RI D '1$ PHWK\ODWLRQ LPSULQW DW f 8%($ FRPELQHG ZLWK WKH GLVFRUGDQW H[SUHVVLRQ RI WKH 8%($ VHQVH DQG DQWLVHQVH WUDQVFULSWV VXJJHVW WKDW '1$ PHWK\ODWLRQ RI WKH SURPRWHU UHJLRQ RI 8%($ GRHV QRW DFFRXQW IRU LPSULQWHG H[SUHVVLRQ 2XU GDWD VXSSRUW DQ DOWHUQDWLYH PHFKDQLVP RI LPSULQWHG H[SUHVVLRQ RI 8%($ :H EHOLHYH WKDW H[SUHVVLRQ RI WKH DQWLVHQVH WUDQVFULSW UHVXOWV LQ UHSUHVVLRQ RI 8%($ LQ FLV 7KLV FRXOG RFFXU WKURXJK PXOWLSOH PHFKDQLVPV ZKLFK GHSHQG XSRQ QXFOHDU ORFDOL]DWLRQ RI WKH DQWLVHQVH WUDQVFULSW ,I WKH DQWLVHQVH WUDQVFULSW UHPDLQV ORFDOL]HG WR WKH H[SUHVVHG DOOHOH LQ D VFHQDULR VLPLODU WR ;LVW WKHQ 51$ LQWHUIHUHQFH ZRXOG EH D JRRG FDQGLGDWH IRU UHSUHVVLRQ RI 8%($ +RZHYHU LI WKH DQWLVHQVH WUDQVFULSW FDQ GLIIXVH WKURXJKRXW WKH QXFOHXV H J DFW LQ WUDQVf DQ DOWHUQDWLYH PHFKDQLVP ZRXOG KDYH WR DFFRXQW IRU WKH DOOHOHVSHFLILF UHSUHVVLRQ 3HUKDSV H[SUHVVLRQ RI WKH DQWLVHQVH WUDQVFULSW FDQ FDXVH FKDQJHV LQ FKURPDWLQ VWUXFWXUH WKDW SUHFOXGHV H[SUHVVLRQ RI 8%($ )XUWKHU VWXGLHV H[DPLQLQJ '1$ PHWK\ODWLRQ DQG LPSULQWHG H[SUHVVLRQ LQ DGGLWLRQDO UHJLRQV RI WKH KXPDQ EUDLQ ZLOO KHOS XV WR EHWWHU XQGHUVWDQG WKH PHFKDQLVP

PAGE 76

RI LPSULQWHG H[SUHVVLRQ RI 8%($ DQG GHPRQVWUDWH ZKLFK UHJLRQV LQ WKH KXPDQ EUDLQ DUH LPSRUWDQW LQ WKH $6 SKHQRW\SH

PAGE 77

$ 3UR[LPDO 'LVWDO n 1RW O 1RW / 0) f 8) ‘ f§ ES f§ 05 ‘ ES f§ 85 0) 8) ES f§ ES ‘ 05 85 % $6 3:6 &RQWURO 6 )%27H2Y)+2Y% )+% )+<2Y% )+<%U 7H6S7H 0 : f§ f§ fPLPP PP F $6 3:6 &RQWURO 0 3 )LJXUH 0HWK\ODWLRQ DQDO\VLV RI EUDLQ '1$ $ 6FDOH 0DS RI 8%($ H[RQ 7KH SUR[LPDO DQG GLVWDO UHJLRQV DVVD\HG DV ZHOO DV 1RW VLWHV DUH LQGLFDWHG 3ULPHU GHVLJQDWLRQV PHWK\ODWHG 0 DQG XQPHWK\ODWHG 8f DUH ORFDWHG EHORZ WKHLU SRVLWLRQV DQG DPSOLILFDWLRQ SURGXFW VL]HV DUH VKRZQ % 0HWK\ODWLRQ VSHFLILF 3&5 DW 8%($ 3&5 SURGXFWV IURP WKH SUR[LPDO DQG GLVWDO UHJLRQV DUH LQGLFDWHG %UDLQ UHJLRQV DQG JHUP FHOOV DUH GHQRWHG &RURQDO VHFWLRQ 6f )URQWDO FRUWH[ )f &HUHEHOOXP %f 2FFLSLWDO OREH 2f +LSSRFDPSXV +f +\SRWKDODPXV
PAGE 78

$ 8%($ $QWLVHQVH WUDQVFULSW % $6 %UDLQ 3:6 %UDLQ )& &6[ )& )& +, )& &% +, 57 f§ 8%($ Pr 8%($$6 L0 61531 P 75 ‘ )LJXUH ,PSULQWHG H[SUHVVLRQ RI 8%($ LQ EUDLQ $ 0DS RI 8%($ DQG WKH DQWLVHQVH WUDQVFULSW 5HOHYHQW H[RQV DUH QXPEHUHG 3ULPHUV XVHG IRU 57 UHDFWLRQV DUH GHVLJQDWHG rf 5HPDLQLQJ SULPHUV ZHUH XVHG IRU 3&5 % 573&5 DQDO\VLV 5HJLRQV RI WKH EUDLQ DUH QRWHG IURQWDO FRUWH[ )&f &RURQDO VHFWLRQ &6[f +LSSRFDPSXV +Lf DQG &HUHEHOOXP &%f 3ULPHUV IURP H[RQV DQG ZHUH XVHG WR DPSOLI\ 8%($ 3ULPHUV IURP LQWURQ DQG H[RQ ZHUH XVHG WR DPSOLI\ WKH DQWLVHQVH WUDQVFULSW ([RQV RI 61531 ZHUH DQDO\]HG 6WUDQGVSHFLILF SULPHUV ZHUH XVHG WR DPSOLI\ 8%($ DQG f DQG WKH DQWLVHQVH WUDQVFULSW f 7KH WUDQVIHUULQ UHFHSWRU 75f ZDV XVHG DV D FRQWURO

PAGE 79

&21&/86,216 $1' ',6&866,21 7KH SDVW VL[ \HDUV KDYH VHHQ YHU\ H[FLWLQJ GHYHORSPHQWV RFFXU LQ $QJHOPDQ V\QGURPH UHVHDUFK 6LQFH HDUO\ WKH ILHOG KDV SURJUHVVHG DW D YHU\ IDVW SDFH 'XULQJ WKH SDVW IRXU \HDUV WKH $6 JHQH 8%($f KDV EHHQ FORQHG .LVKLQR HW DO 0DWVXXUD HW DO f :LWKLQ VHYHQ PRQWKV RI WKH UHSRUW RI PXWDWLRQV LQ 8%($ LQ VHYHUDO $6 SDWLHQWV LPSULQWHG H[SUHVVLRQ RI 8%($ ZDV GHPRQVWUDWHG LQ KXPDQ DQG PRXVH EUDLQ $OEUHFKW HW DO 5RXJHXOOH HW DO 9X DQG +RIIPDQ f $QJHOPDQ V\QGURPH ZDV WKH ILUVW KXPDQ GLVHDVH VKRZQ WR EH FDXVHG E\ PXWDWLRQV LQ WKH XELTXLWLQ SDWKZD\ DQG KDV SDYHG WKH ZD\ IRU WKH FORQLQJ RI DGGLWLRQDO GLVHDVH JHQHV LQFOXGLQJ WKH GLVFRYHU\ RI PXWDWLRQV LQ DQRWKHU ( OLJDVH LQ WKH QRQDJRXWL OHWKDO D+ PRXVH 3HUU\ HW DO f 7KLV PRXVH GLVSOD\V WKH LWFK\ SKHQRW\SH FKDUDFWHUL]HG LQ SDUW E\ FRQVWDQW LWFKLQJ GXH WR K\SHUSODVLD RI WKH IRUHVWRPDFK HSLWKHOLD DQG UHYHDOHG WKDW WKH XELTXLWLQ SDWKZD\ ZDV FULWLFDO IRU LPPXQH UHVSRQVH 6HYHUDO QHZ JHQHV DQG WUDQVFULSWV KDYH EVHHQ ORFDOL]HG WR WKH $63:6 GRPDLQ /HH DQG :HYULFN f LQFOXGLQJ DQ DQWLVHQVH WUDQVFULSW ZDV IRXQG WR RYHUODS WKH f HQG RI 8%($ 5RXJHXOOH HW DO f )LYH PRXVH PRGHOV RI $6 KDYH DOVR EHHQ JHQHUDWHG WR KHOS LQ WKH VWXG\ RI WKH PHFKDQLVPV RI LPSULQWHG H[SUHVVLRQ RI 8%($ &DWWDQDFK HW DO 'H/RUH\ HW DO *DEULHO HW DO -LDQJ HW DO -RKQVRQ HW DO f $QDO\VHV RI $6 DQG 3:6 SDWLHQWV KDYH GHPRQVWUDWHG WKDW WKH LPSULQWLQJ FHQWHU ,&f FRQVLVWV RI VHSDUDWH $6 DQG 3:6 GRPDLQV DOWKRXJK WKH PHFKDQLVPV RI LPSULQWHG H[SUHVVLRQ RI WKH PDWHUQDO DQG SDWHUQDO JHQHV KDV \HW WR EH GLVFRYHUHG

PAGE 80

,Q DGGLWLRQ WR WKHVH GLVFRYHULHV P\ UHVHDUFK KDV UHYHDOHG VHYHUDO QHZ ILQGLQJV 'XULQJ WKH VWXG\ RI RQH RI RXU $6 GHOHWLRQ SDWLHQWV ZH GLVFRYHUHG WKDW IHPDOH $6 SDWLHQWV KDYH WKH DELOLW\ WR UHSURGXFH /RVVLH DQG 'ULVFROO f 7KLV LPSRUWDQW GLVFRYHU\ KDV VHULRXV LPSOLFDWLRQV IRU IDPLOLHV DQG FDUHWDNHUV RI $6 SDWLHQWV DQG LPSOLHV WKDW VRFLDO FRJQLWLYH EHKDYLRUV QRW SK\VLRORJLFDO GHIHFWV SUHYHQW PRVW $6 SDWLHQWV IURP UHSURGXFWLRQ 6WXGLHV RI WKH GLIIHUHQW PROHFXODU FODVVHV RI $6 KDYH UHYHDOHG PXOWLSOH QHZ ILQGLQJV KDYH VKRZQ WKDW WKHUH DUH ILYH PROHFXODU FODVVHV RI $6 EXW IRXU SKHQRW\SLF $6 JURXSV /RVVLH HW DO LQ SUHSDUDWLRQf 7KLV UHVHDUFK KDV DOVR UHYHDOHG WKDW WKH ILIWK FODVV RI $6 SDWLHQWV KDV D PRUH VHYHUH SKHQRW\SH WKDQ WKH 83' ,' RU 8%($ PXWDWLRQ SDWLHQWV LPSO\LQJ WKDW PXOWLSOH JHQHV PD\ EH GLVUXSWHG LQ WKHVH SDWLHQWV KDYH H[DPLQHG VHYHUDO UHJLRQV RI WKH EUDLQ EXW IRXQG QR HYLGHQFH RI D '1$ PHWK\ODWLRQ LPSULQW DVVRFLDWHG ZLWK 8%($ 2XW RI DOO RI WKH NQRZQ LPSULQWHG JHQHV 0DVK LV WKH RQO\ RWKHU NQRZQ WUDQVFULSW ZLWKRXW D '1$ PHWK\ODWLRQ LPSULQW 7LOJKPDQ f ,Q DGGLWLRQ P\ 573&5 DQDO\VHV RI 8%($ DQG WKH DQWLVHQVH WUDQVFULSW VXJJHVW WKDW LPSULQWHG H[SUHVVLRQ RI 8%($ LV UHJXODWHG LQ FLV E\ WKH DQWLVHQVH WUDQVFULSW VXJJHVWLQJ WKDW D QRYHO PHFKDQLVP XQGHUOLHV LPSULQWHG H[SUHVVLRQ RI 8%($ LQ WKH EUDLQ 0ROHFXODU &ODVVHV RI $6 5HVXOWV RI P\ DQDO\VLV RI $6 SDWLHQWV IURP WKH 8QLYHUVLW\ RI )ORULGD UHSRVLWRU\ GHPRQVWUDWHV WKDW ILYH PDMRU PROHFXODU PHFKDQLVPV FDXVH $6 &ODVV ,f 0E PDWHUQDOO\ LQKHULWHG GHOHWLRQV RI T &ODVV ,,f SDWHUQDO XQLSDUHQWDO GLVRPLHV 83'f &ODVV ,,,f LPSULQWLQJ GHIHFWV ,'f &ODVV ,9f SDWLHQWV ZLWK LQWUDJHQLF PXWDWLRQV LQ 8%($ DQG &ODVV 9f SDWLHQWV ZLWK QR NQRZQ GHIHFWV

PAGE 81

&ODVV 3DWLHQWV 7KH DGYHQW RI KLJK UHVROXWLRQ FKURPRVRPH DQDO\VLV LQ WKH ODWH V DOORZHG WKH ORFDOL]DWLRQ RI WKH $6 JHQH WR KXPDQ FKURPRVRPH E\ WKH GHWHFWLRQ RI 0E LQWHUVWLWLDO GHOHWLRQV RI T T LQ VHYHUDO $6 SDWLHQWV .DSODQ HW DO 0DJHQLV HW DO f ,QLWLDO REVHUYDQFHV LQGLFDWHG WKDW WKH $6 GHOHWLRQ ZDV LGHQWLFDO WR WKDW VHHQ LQ 3UDGHU:LOOL V\QGURPH +RZHYHU HYLGHQFH VRRQ LQGLFDWHG WKDW LQ &ODVV $6 SDWLHQWV WKH GHOHWLRQ ZDV DOZD\V PDWHUQDOO\ LQKHULWHG .QROO HW DO =DFNRZVNL HW DO f ZKLOH 3:6 GHOHWLRQV ZHUH DOZD\V RI SDWHUQDO RULJLQ %XWOHU HW DO .QROO HW DO f 'HOHWLRQ SDWLHQWV KDYH WKH PRVW VHYHUH SKHQRW\SH DQG UHSUHVHQW D FRQWLJXRXV JHQH GLVRUGHU ZLWK KDSORLQVXIILFLHQF\ RI VHYHUDO QRQLPSULQWHG JHQHV DORQJ T H[DFHUEDWLQJ WKH SKHQRW\SH 6RPH VWULNLQJ GLIIHUHQFHV EHWZHHQ &ODVV LQGLYLGXDOV DQG WKH RWKHU SDWLHQWV DUH WKH IUHTXHQF\ DQG VHYHULW\ RI VHL]XUHV $OO &ODVV SDWLHQWV KDYH VHL]XUHV DQG b KDYH UHFXUULQJ ERXWV RI HSLOHSV\ 7KH PRVW REYLRXV JHQHV DIIHFWLQJ VHL]XUHV LQ GHOHWLRQ SDWLHQWV DUH WKH WKUHH *$%$ UHFHSWRUV ZKLFK DUH ORFDWHG DERXW 0E GLVWDO WR 8%($ 0LFH ZLWK QXOO PXWDWLRQV LQ *DEDIW UHFDSLWXODWH VHYHUDO RI WKH $6 FKDUDFWHULVWLFV LQFOXGLQJ EDODQFH DEQRUPDOLWLHV VHL]XUHV DEQRUPDO ((* SDWWHUQV VOHHS GLVWXUEDQFHV DQG OHDUQLQJ GHIHFWV 'H/RUH\ HW DO f +RZHYHU PLFH KHWHUR]\JRXV IRU WKH GLVUXSWLRQ KDYH ZLOG W\SH IHDWXUHV ,W ZRXOG EH LQWHUHVWLQJ WR VWXG\ WKH SKHQRW\SH RI PLFH ZLWK GLVUXSWLRQV LQ DOO WKUHH *$%$ UHFHSWRUV ,Q DGGLWLRQ WR VHL]XUHV PRVW GHOHWLRQ SDWLHQWV DUH K\SRSLJPHQWHG PLFURFHSKDOLF DQG KDYH SRRUO\ GHYHORSHG PRWRU VNLOOV &ODVV ,, 3DWLHQWV 8QLSDUHQWDO GLVRP\ RI FKURPRVRPH DOVR RFFXUV LQ ERWK V\QGURPHVPDWHUQDO 83' LQ 3:6 &ODVV ,, 0DVFDUL HW DO 1LFKROOV HW DO f DQG SDWHUQDO 83' LQ

PAGE 82

$6 SDWLHQWV &ODVV ,, 0DOFROP HW DO 1LFKROOV HW DO f 7KH LGHQWLILFDWLRQ RI $6 SDWLHQWV ZLWK 83' RI FKURPRVRPH FRQFOXVLYHO\ GHPRQVWUDWHG WKDW $6 ZDV DQ LPSULQWHG GLVRUGHU DV DEVHQFH RI WKH PDWHUQDOO\ GHULYHG T FKURPRVRPDO UHJLRQ UHVXOWHG LQ WKH $QJHOPDQ V\QGURPH SKHQRW\SH ,Q WKH 8) SDWLHQW UHSRVLWRU\ b RI SDWLHQWV KDG SDWHUQDO 83' IRU FKURPRVRPH /RVVLH HW DO LQ SUHSDUDWLRQf +\SRSLJPHQWDWLRQ RQO\ RFFXUUHG LQ b RI 83' SDWLHQWV DQG OHVV WKDQ b RI 83' SDWLHQWV VXIIHUHG IURP UHFXUULQJ HSLVRGHV RI HSLOHSV\ RU PLFURFHSKDO\ ,Q DGGLWLRQ b RI &ODVV ,, SDWLHQWV FRXOG ZDON E\ ILYH \HDUV RI DJH WZLFH WKH IUHTXHQF\ REVHUYHG LQ GHOHWLRQ SDWLHQWV 7KHVH SDWLHQWV KDG D PXFK OHVV VHYHUH SKHQRW\SH WKDQ WKH GHOHWLRQ SDWLHQWV LQGLFDWLQJ WKDW WZRIROG H[SUHVVLRQ RI WKH SDWHUQDORQO\ JHQHV PD\ EH DPHOLRUDWLQJ WKH $6 SKHQRW\SH &ODVV ,,, 3DWLHQWV $ WKLUG VXEVHW RI $6 DQG 3:6 SDWLHQWV ,' SDWLHQWVf KDYH PXWDWLRQV LQ WKH PHFKDQLVPVf LQYROYHG LQ WKH LPSULQW SURFHVV 0XWDWLRQV DQG VSRQWDQHRXV GHIHFWV LQ WKH LPSULQWLQJ FHQWHU ,&f FDXVH WKH PDWHUQDO FKURPRVRPH WR DGRSW D SDWHUQDO HSLJHQRW\SH DORQJ T ZLWK WKHVH LQGLYLGXDOV KDYLQJ SDWHUQDO '1$ PHWK\ODWLRQ DQG H[SUHVVLRQ LPSULQWV *OHQQ HW DO D 5HLV HW DO f $ERXW b RI &ODVV ,,, $6 SDWLHQWV KDYH GHWHFWDEOH PLFURnGHOHWLRQV LQ WKH LPSULQWLQJ FHQWHU 7KH UHPDLQLQJ &ODVV ,,, $6 SDWLHQWV KDYH QR GHWHFWDEOH PXWDWLRQV EXW VKRZ DQ $6 HSLJHQRW\SH DFURVV WKH 0E LPSULQWHG GRPDLQ %XLWLQJ HW DO f 5HFHQWO\ WKH $6 VPDOOHVW UHJLRQ RI RYHUODS 652f IRU WKH ,& UHJLRQ KDV EHHQ QDUURZHG WR NE ZKLOH WKH 3:6652 LQ WKH ,& KDV EHHQ QDUURZHG WR NE %XLWLQJ HW DO f $OWKRXJK WKH\ D GLIIHUHQW PROHFXODU PHFKDQLVP FDXVHV $6 LQ ,& DQG 83' SDWLHQWV VWDWLVWLFDOO\ WKH WZR FODVVHV KDYH LQGLVWLQJXLVKDEOH SKHQRW\SHV 7KLV

PAGE 83

REVHUYDWLRQ GHPRQVWUDWHV WKDW WKH RQO\ LPSULQWHG GRPDLQ RQ FKURPRVRPH LV WKH $63:6 UHJLRQ &ODVV ,9 3DWLHQWV 6HYHUDO SDWLHQWV KDYH ELSDUHQWDO LQKHULWDQFH RI FKURPRVRPH ZLWK QRUPDO '1$ PHWK\ODWLRQ DW VHYHUDO ORFL ZLWKLQ WKH $63:6 LPSULQWHG GRPDLQ 0XWDWLRQ DQDO\VLV RI 8%($ UHYHDOHG SURWHLQ WUXQFDWLQJ PXWDWLRQV LQ VHYHUDO $6 LQGLYLGXDOV .LVKLQR HW D/ 0DWVXXUD HW DO f 0XWDWLRQ DQDO\VLV RI 8) SDWLHQWV UHYHDOHG WKH H[LVWHQFH RI ILYH PROHFXODU FODVVHV DV RQO\ b RI VSRUDGLF SDWLHQWV ZLWK QRUPDO PHWK\ODWLRQ KDG LQWUDJHQLF PXWDWLRQV ZLWKLQ 8%($ /RVVLH HW DO LQ SUHSDUDWLRQf 0XWDWLRQV ZKLFK ZHUH PRVWO\ SURWHLQ WUXQFDWLQJ ZHUH IRXQG WKURXJKRXW WKH FRGLQJ UHJLRQ ZLWK FOXVWHUV LQ WKH +(&7 GRPDLQ DQG LQ H[RQ $V D JURXS 8%($ PXWDWLRQ SDWLHQWV DFKLHYH GHYHORSPHQWDO PLOHVWRQHV IDVWHU DUH PRUH OLNHO\ WR IROORZ VLPSOH FRPPDQGV KDYH OHVV VHYHUH VHL]XUHV WKDW EHJLQ DW D ODWHU DJH DQG DUH KHDYLHU WKDQ GHOHWLRQ SDWLHQWV +RZHYHU XQOLNH 83' DQG ,' SDWLHQWV LQGLYLGXDOV IURP &ODVV ,9 WHQG WR KDYH D KLJKHU LQFLGHQFH RI VLJQLILFDQW RU UHFXUULQJ VHL]XUHV DQG RIWHQ GLVSOD\ PLFURFHSKDO\ 0RQGD DQG FROOHDJXHV Ef H[DPLQHG &ODVV ,9 SDWLHQWV LQGLYLGXDOO\ IRU KHDG FLUFXPIHUHQFH DQG VHL]XUHV 7KH\ DOVR FRQFOXGHG WKDW 8%($ PXWDWLRQ SDWLHQWV KDG KLJK LQFLGHQFHV RI VHL]XUHV DQG PLFURFHSKDO\ &ODVV 9 3DWLHQWV 3UHYLRXV VWXGLHV VKRZHG WKDW WKH PDMRULW\ RI SDWLHQWV ZLWK QRUPDO '1$ PHWK\ODWLRQ GR QRW KDYH GHWHFWDEOH DEQRUPDOLWLHV RQ FKURPRVRPH )DQJ HW DO 0DO]DF HW DO f ,Q 8) SDWLHQWV DERXW b RI DOO FODVVLFDO $6 SDWLHQWV IDOO LQWR WKLV JURXS 1RW PXFK LV NQRZQ DERXW WKH HWLRORJ\ RI $6 LQ WKHVH SDWLHQWV ,W KDV

PAGE 84

EHHQ SRVWXODWHG WKDW WKH\ KDYH PXWDWLRQV LQ RWKHU JHQHV LQ WKH XELTXLWLQ SDWKZD\ RU LQ 8%($ VXEVWUDWHV $OWHUQDWLYHO\ WKH\ FRXOG KDYH GLVUXSWLRQV LQ RWKHU T JHQHV WKDW LQWHUIHUH ZLWK 8%($ H[SUHVVLRQ &ODVV 9 SDWLHQWV DUH YHU\ LQWHUHVWLQJ 7KH\ ZHUH QRW VLJQLILFDQWO\ GLIIHUHQW IURP GHOHWLRQ SDWLHQWV DFURVV VHYHUDO SKHQRW\SLF FDWHJRULHV &ODVV 9 SDWLHQWV KDYH QRUPDO KHLJKW ZHLJKW DQG %0, GLVWULEXWLRQV VLPLODU WR WKDW REVHUYHG LQ &ODVV SDWLHQWV 7KH\ DOVR W\SLFDOO\ SUHVHQW ZLWK D FRPSOHWH DEVHQFH RI VSHHFK HDUO\ RQVHW RI VHL]XUHV K\SRSLJPHQWDWLRQ DQG PLFURFHSKDO\ +RZHYHU &ODVV 9 SDWLHQWV ZDON DERXW WZR \HDUV HDUOLHU WKDQ GHOHWLRQ SDWLHQWV DQG WKHLU VHL]XUHV DUH OHVV OLNHO\ WR EH UHFXUULQJ RU DV VHYHUH DV WKRVH REVHUYHG LQ SDWLHQWV IURP &ODVV 6LQFH &ODVV 9 SDWLHQWV WHQG WR KDYH D PRUH VHYHUH SKHQRW\SH WKDQ WKDW REVHUYHG LQ &ODVVHV ,, ,,, DQG ,9 LW LV OLNHO\ WKDW GLVUXSWLRQ RI PRUH WKDQ RQH JHQH LV FDXVDWLYH RI $6 LQ WKHVH SDWLHQWV 7KDW WKH\ FORVHO\ UHVHPEOH 83' ,' DQG 8%($ PXWDWLRQ SDWLHQWV LQ WKHLU W\SH DQG VHYHULW\ RI VHL]XUHV LQGLFDWHV WKDW 8%($ PD\ DOVR EH GLVUXSWHG LQ WKHVH SDWLHQWV &ODVV 9 SDWLHQWV DOVR KDG D KLJKHU IUHTXHQF\ RI K\SRSLJPHQWDWLRQ FRPSDUHG ZLWK &ODVVHV ,, ,,, DQG ,9 0D\EH WKHVH SKHQRW\SHV FDQ \LHOG FOXHV DV WR WKH PHFKDQLVPVf LQYROYHG LQ WKH SDWKRJHQHVLV RI $6 LQ WKHVH LQGLYLGXDOV *HQRW\SHSKHQRW\SH &RUUHODWLRQV DPRQJ WKH )LYH &ODVVHV RI $6 6HYHUDO DUWLFOHV LQ UHFHQW OLWHUDWXUH KDYH FRPSDUHG WKH SKHQRW\SHV DVVRFLDWHG ZLWK SDWLHQWV IURP &ODVVHV ,, DQG ,,, ZLWK &ODVV LQGLYLGXDOV %XUJHU HW DO )ULGPDQ HW DO E *LOOHVVHQ.DHVEDFK HW DO 6DLWRK HW DO 6DLWRK HW DO 7UHQW HW DO f +RZHYHU H[WHQVLYH JHQRW\SHSKHQRW\SH FRUUHODWLRQV DPRQJ WKH ILUVW IRXU FODVVHV RI $6 SDWLHQWV KDV EHHQ OLPLWHG 0RQGD HW DO Ef DQG QR VWXGLHV KDYH H[DPLQHG WKH SKHQRW\SH DVVRFLDWHG ZLWK &ODVV 9 SDWLHQWV

PAGE 85

*HQRW\SHSKHQRW\SH DQDO\VHV RI RXU SDWLHQWV UHYHDOHG WKDW DOO FODVVHV RI SDWLHQWV KDG WKH IRXU FDUGLQDO IHDWXUHV RI $6 VHYHUH GHYHORSPHQWDO GHOD\ DQGRU PHQWDO UHWDUGDWLRQ VHYHUH VSHHFK LPSHGLPHQW DQ XQVWHDG\ DWD[LF JDLW ZLWK XSOLIWHG KDQGV DQG WKH FKDUDFWHULVWLF KDSS\ DIIHFW )XUWKHUPRUH VRPH &ODVVHV KDYH DGGLWLRQDO FKDUDFWHULVWLFV WKDW DUH RIWHQ DVVRFLDWHG ZLWK WKH $QJHOPDQ V\QGURPH VXFK DV VHL]XUHV PLFURFHSKDO\ DQG K\SRSLJPHQWDWLRQ 2XU VWDWLVWLFDO PRGHOV GHPRQVWUDWHG WKDW GLVWLQFW SKHQRW\SLF GLIIHUHQFHV RFFXU DPRQJVW WKH PROHFXODU FODVVHV 7KH ILYH FODVVHV RI SDWLHQWV FDQ EH VHSDUDWHG LQWR IRXU SKHQRW\SLF JURXSV &ODVV &ODVVHV ,, DQG ,,, &ODVV ,9 DQG &ODVV 9 2YHUDOO &ODVV SDWLHQWV DUH WKH PRVW VHYHUHO\ DIIHFWHG ZKLOH &ODVVHV ,, DQG ,,, DUH WKH OHDVW &ODVVHV ,9 DQG 9 GLIIHU IURP HDFK RWKHU DW VHYHUDO FULWHULD EXW IDOO EHWZHHQ &ODVV DQG &ODVVHV ,, DQG ,,, LQ VHYHULW\ 0XOWLSOH FOLQLFDO GLVWLQFWLRQV FDQ EH PDGH EHWZHHQ WKH FODVVHV ZLWK GLIIHUHQFHV PRVW VWULNLQJ LQ SLJPHQWDWLRQ JURZWK SDUDPHWHUV DFKLHYHPHQW RI GHYHORSPHQWDO PLOHVWRQHV DQG VHYHULW\ IUHTXHQF\ DQG DJH DW RQVHW RI VHL]XUHV 2XU GDWD LQGLFDWH WKDW &ODVV SDWLHQWV FRPSULVH D FRQWLJXRXV JHQH GLVRUGHU ZLWK KDSORLQVXIILFLHQF\ RI PXOWLSOH JHQHV H[DFHUEDWLQJ WKH ODFN RI WKH PDWHUQDOO\ H[SUHVVHG 8%($ JHQH 3DWLHQWV LQ &ODVVHV ,, DQG ,,, KDYH WKH OHDVW VHYHUH DQG PRVW DW\SLFDO SKHQRW\SH VXJJHVWLQJ WKDW D GRXEOH GRVH RI WKH SDWHUQDORQO\ H[SUHVVHG JHQHV PD\ EH DPHOLRUDWLQJ WKH $6 SKHQRW\SH LQ 83' DQG ,' SDWLHQWV $OWHUQDWLYHO\ WKH PRUH VHYHUH SKHQRW\SH DVVRFLDWHG ZLWK 8%($ PXWDWLRQ SDWLHQWV FRXOG LQGLFDWH WKDW KDSORLQVXIILFLHQF\ RI 8%($ PD\ EH GHWULPHQWDO GXULQJ GHYHORSPHQW DQG LQWR DGXOWKRRG $GGLWLRQDOO\ 8%($ SURWHLQ OHYHOV PD\ EH WLJKWO\ UHJXODWHG LQ WKH FHQWUDO QHUYRXV V\VWHP DQG SHULSKHUDO WLVVXHV ,W LV OLNHO\ WKDW D FRPELQDWLRQ RI WKH GRXEOH GRVH RI WKH SDWHUQDOO\ H[SUHVVHG JHQHV DQG KDSORLQVXIILFLHQF\ RI 8%($ ERWK

PAGE 86

FRQWULEXWH WR WKH GLIIHUHQFHV LQ SKHQRW\SH REVHUYHG EHWZHHQ &ODVVHV ,, DQG ,,, DQG &ODVV ,9 SDWLHQWV 2I DOO IRXU QRQGHOHWLRQ FODVVHV WKH SDWLHQWV ZLWK QR GHWHFWDEOH FKURPRVRPH DEQRUPDOLW\ PRVW FORVHO\ UHVHPEOH &ODVV SDWLHQWV 3HUKDSV &ODVV 9 SDWLHQWV KDYH D PXWDWLRQ LQ DQ XSVWUHDP JHQH RQ T WKDW DIIHFWV QRW RQO\ 8%($ EXW DOVR DGGLWLRQDO JHQHV WKDW JLYH ULVH WR D PRUH VHYHUH $6 SKHQRW\SH LQ WKHVH LQGLYLGXDOV $ JRRG FDQGLGDWH JHQH ZRXOG EH WKH 8%($ DQWLVHQVH WUDQVFULSW $OWHUQDWLYHO\ &ODVV 9 LQGLYLGXDOV PD\ KDYH PXWDWLRQV LQ RWKHU JHQHV LQ WKH XELTXLWLQDWLRQ SDWKZD\ 6LQFH WKH SKHQRW\SH LV VHYHUH ZH ZRXOG SUHGLFW WKDW WKH PXWDWLRQ ZRXOG EH LQ D JHQH WKDW FRQWUROOHG WKH GHJUDGDWLRQ RI PXOWLSOH SURWHLQV :KDW LV WKH (SLJHQHWLF 0DUN"f ,PSULQWHG JHQHV GLVSOD\ VHYHUDO GLVWLQJXLVKLQJ FKDUDFWHULVWLFV GLIIHUHQWLDO PHWK\ODWLRQ DQG DOOHOHVSHFLILF H[SUHVVLRQ SDWWHUQV EHWZHHQ WKH PDWHUQDO DQG SDWHUQDO DOOHOHV WKH SUHVHQFH RI QRQFRGLQJ DQGRU DQWLVHQVH 51$ WUDQVFULSWV DV\QFKURQRXV '1$ UHSOLFDWLRQ WLPLQJ *& ULFK VHTXHQFHV DQG GLUHFW UHSHDWV *OHQQ HW DO 5D]LQ DQG &HGDU 6OHXWHOV HW DO f ,Q DGGLWLRQ JHQRPLF LPSULQWLQJ FDQ LPSDUW WUDQVFULSWLRQDO FKDQJHV LQ D VLQJOH JHQH RU DOWHU H[SUHVVLRQ SDWWHUQV RI JURXSV RI JHQHV DFURVV 6HYHUDO PHJDEDVHV 0E *OHQQ HW DO f 5HFHQW DWWHQWLRQ KDV IRFXVHG RQ GHWHUPLQLQJ WKH PHFKDQLVP WKDW HVWDEOLVKHV WKH HSLJHQHWLF PDUN RU LPSULQW EHWZHHQ WKH PDWHUQDO DQG SDWHUQDO DOOHOHV 0XOWLSOH PHFKDQLVPV KDYH EHHQ SURSRVHG WR SHUIRUP WKLV WDJJLQJ LQFOXGLQJ '1$ PHWK\ODWLRQ FKURPDWLQ VWUXFWXUH FVDFWLQJ HOHPHQWV DQG '1$ UHSOLFDWLRQ WLPLQJ +XPDQ DQG PXULQH VWXGLHV LQGLFDWH WKDW WKH PHFKDQLVPV LQYROYHG LQ LPSULQWLQJ PXVW EH DEOH WR f 6HW WKH LPSULQW LQ WKH JDPHWHV f 0DLQWDLQ WKLV HSLJHQHWLF PRGLILFDWLRQ LQ VRPDWLF WLVVXHV f $OWHU WKH H[SUHVVLRQ RU UHSUHVVLRQ RI LPSULQWHG JHQHV DQG f (UDVH WKH LPSULQW

PAGE 87

GXULQJ JDPHWRJHQHVLV DQG UHVHW LW DFFRUGLQJ WR WKH VH[ RI WKH RIIVSULQJ 'ULVFROO f '1$ 0HWK\ODWLRQ '1$ PHWK\ODWLRQ LV D JRRG FDQGLGDWH IRU WKH HVWDEOLVKPHQW DQG PDLQWHQDQFH RI WKH LPSULQW $IWHU UHSOLFDWLRQ KHPLPHWK\ODWHG '1$ LV UHFRJQL]HG E\ WKH PDLQWHQDQFH '1$ PHWK\OWUDQVIHUDVH SURWHLQ ZKLFK PHWK\ODWHV WKH GDXJKWHU VWUDQG SURSDJDWLQJ WKH PHWK\ODWLRQ VWDWXV RI WKH DOOHOH 'ULVFROO HW DO f ZHUH WKH ILUVW WR SURSRVH '1$ PHWK\ODWLRQ DV D GLDJQRVWLF WRRO IRU LGHQWLI\LQJ LPSULQWHG JHQHV :LWK WKH H[FHSWLRQ RI 8%($ DQG 0DVK DOO LPSULQWHG JHQHV GLVSOD\ GLIIHUHQWLDO PHWK\ODWLRQ VLWHV WKDW VKRZ SDUHQWRIRULJLQ PHWK\ODWLRQ LPSULQWV *OHQQ HW DO 5D]LQ DQG &HGDU 7LOJKPDQ f 7DUJHWHG GLVUXSWLRQ RI WKH '1$ PHWK\OWUDQVIHUDVH JHQH 'QPWOf LQ PLFH SURYLGHG LQLWLDO HYLGHQFH IRU WKH UROH RI '1$ PHWK\ODWLRQ LQ JHQRPLF LPSULQWLQJ /L HW DO f ,QDFWLYDWLRQ RI 'QPWO UHSUHVVHG WKH QRUPDOO\ DFWLYH ,JIU ,JI DQG .YOTWO DOOHOHV DQG DFWLYDWHG WKH UHSUHVVHG FRSLHV RI WKH + ;LVW &GNOF DQG 6QUSQ JHQHV &DVSDU\ HW DO /L HW DO 6KHPHU HW DO f ,Q RUGHU IRU '1$ PHWK\ODWLRQ WR EH DFFHSWHG DV DQ LPSULQWLQJ PDUNf RQH PXVW LGHQWLI\ LPSULQWV WKDW DUH HVWDEOLVKHG LQ WKH JHUP OLQH DQG PDLQWDLQHG VRPDWLFDOO\ GXULQJ DQG DIWHU GHYHORSPHQW ,Q DGGLWLRQ WKHVH WDJV VKRXOG HVFDSH WKH JOREDO ZDYH RI GHPHWK\ODWLRQ WKDW RFFXUV GXULQJ HDUO\ HPEU\RJHQHVLV %UDQGLV HW DO 6]DER DQG 0DQQ 7DGD HW DO f 7R GDWH JDPHWLF LPSULQWV KDYH EHHQ LGHQWLILHG LQ ILYH JHQHV 61531 KXPDQ DQG PRXVHf 0.51 ,JIU + DQG *QDV *OHQQ HW DO -RQHV HW DO -RQJ HW DO /LX HW DO 6KHPHU HW DO 6WRJHU HW DO 7UHPEOD\ HW DO f 0\ VWXGLHV GHPRQVWUDWHG WKDW '1$ PHWK\ODWLRQ ZDV QRW UHVSRQVLEOH IRU LPSULQWHG H[SUHVVLRQ RI 8%($ DV QR PHWK\ODWLRQ LPSULQW ZDV IRXQG LQ DQ\ WLVVXH /RVVLH HW DO LQ SUHSDUDWLRQf

PAGE 88

&LVDFWLQJ (OHPHQWV ,Q DGGLWLRQ WR SULPDU\ '1$ PHWK\ODWLRQ LPSULQWV RWKHU FLVDFWLQJ HOHPHQWV FDQ EH IRXQG LQ PXOWLSOH LPSULQWHG UHJLRQV 7KHVH HOHPHQWV RIWHQ KDYH ORQJUDQJH HIIHFWV DQG GLIIHUHQWLDO '1$ PHWK\ODWLRQ DSSHDUV WR EH D FRPPRQ IDFWRU LQ WKHVH FLV DFWLQJ HOHPHQWV )RU H[DPSOH ZLWKLQ WKH 0E LPSULQWHG GRPDLQ RQ KXPDQ FKURPRVRPH T WKH 3UDGHU:LOOL V\QGURPH LPSULQWLQJ FHQWHU 3:6,&f FRQWUROV WKH HVWDEOLVKPHQW DQG PDLQWHQDQFH RI LPSULQWHG H[SUHVVLRQ RI WKH SDWHUQDOO\ H[SUHVVHG JHQHV DORQJ WKH HQWLUH LPSULQWHG GRPDLQ %LHOLQVND HW DO f $GGLWLRQDO VWXGLHV IURP WKLV UHJLRQ LQGLFDWH WKDW WKHUH LV DOVR D VHSDUDWH $QJHOPDQ V\QGURPH LPSULQWLQJ FHQWHU $6,&f WKDW SRWHQWLDOO\ ZRUNV LQ WKH VDPH PDQQHU RQ WKH KRPRORJRXV FKURPRVRPH %XLWLQJ HW DO )DUEHU HW DO 6DLWRK HW DO f 6LPLODU LPSULQWLQJ FHQWHUV KDYH DOVR EHHQ LGHQWLILHG LQ WKH ,JI+ LPSULQWHG UHJLRQ RQ PRXVH FKURPRVRPH & %LUJHU HW DO +DUN HW DO .KRVOD HW DO 6DVDNL HW DO 6]DER HW DO f ,W ZLOO EH LQWHUHVWLQJ WR GHWHUPLQH LI SDWLHQWV ZLWK PXWDWLRQV LQ WKH 3:6 ,& 3:6 ,' SDWLHQWVf RU $6 ,& $6 ,' SDWLHQWVf H[SUHVV WKH 8%($ DQWLVHQVH WUDQVFULSW &KURPDWLQ 6WUXFWXUH $OWKRXJK LW LV HYLGHQW WKDW '1$ PHWK\ODWLRQ SOD\V DQ LPSRUWDQW UROH LQ WKH HVWDEOLVKPHQW RI WKH SULPDU\ LPSULQW RWKHU IDFWRUV DUH SUREDEO\ LQ WKH DOOHOHVSHFLILF UHSUHVVLRQ 6HYHUDO H[SHULPHQWV KDYH GHPRQVWUDWHG D VLJQLILFDQW FRUUHODWLRQ EHWZHHQ '1$ PHWK\ODWLRQ DW &S* LVODQGV DQG WUDQVFULSWLRQDO VLOHQFLQJ 1J DQG %LUG f ([SHULPHQWV XVLQJ WKH KHUSHV VLPSOH[ YLUXV WK\PLGLQH NLQDVH +9 7.f JHQH JDYH WKH LQLWLDO FOXHV WKDW '1$ PHWK\ODWLRQ FRXOG EH WLHG WR FKURPDWLQ VWUXFWXUH %XVFKKDXVHQ HW DO f :KHQ QDNHG '1$ PHWK\ODWHG RU XQPHWK\ODWHGf ZDV PLFURLQMHFWHG LQWR URGHQW FHOOV LW WRRN RYHU HLJKW KRXUV IRU +69 7. WR EH VLOHQFHG LQ FHOOV FRQWDLQLQJ

PAGE 89

PHWK\ODWHG '1$ +RZHYHU ZKHQ LQ YLWUR DVVHPEOHG FKURPDWLQ ZDV LQWURGXFHG +69 7. ZDV LQDFWLYH 5HFHQW VWXGLHV KDYH EHHQ DEOH WR LQWLPDWHO\ FRQQHFW '1$ PHWK\ODWLRQ ZLWK FKURPDWLQ VWUXFWXUH 1J DQG %LUG f 7KH GLVFRYHU\ WKDW WKH &S* ELQGLQJ SURWHLQ 0H&3 ERXQG '1$ LQ D PHWK\ODWLRQGHSHQGHQW PHFKDQLVP DQG LQKLELWHG WUDQVFULSWLRQ JDYH WKH ILUVW FOXHV WKDW WKH WZR SURFHVVHV ZHUH OLQNHG 1DQ HW DO 1DQ HW DO f 6XEVHTXHQW H[SHULPHQWV E\ VHYHUDO JURXSV UHYHDOHG WKDW WKH WUDQVFULSWLRQDO UHSUHVVLRQ GRPDLQ RI 0H&3 UHFUXLWV 6LQ$ DQG WKH KLVWRQH GHDFHW\ODVH FRPSOH[ LQGXFLQJ KLVWRQH GHDFHW\ODWLRQ DQG WUDQVFULSWLRQDO VLOHQFLQJ 1J DQG %LUG f ,GHQWLILFDWLRQ RI D JHQH WKDW VKRZV GLIIHUHQWLDO FKURPDWLQ VWUXFWXUH EHWZHHQ WKH PDWHUQDO DQG SDWHUQDO DOOHOHV LQ WKH FRQWH[W RI '1$ PHWK\ODWLRQ DQG H[SUHVVLRQ LPSULQWV ZRXOG SURYLGH JRRG HYLGHQFH RI D FRQQHFWLRQ EHWZHHQ '1$ PHWK\ODWLRQ FKURPDWLQ VWUXFWXUH DQG LPSULQWHG H[SUHVVLRQ ,Q YLYR FKURPDWLQ VWXGLHV UHYHDOHG WKDW WKH XQPHWK\ODWHG H[SUHVVHG DOOHOHV RI 6QUSQ + DQG 8DIUV ZHUH K\SHUVHQVLWLYH WR LQ YLYR QXFOHDVH GLJHVWLRQ LQVLQXDWLQJ WKDW D '1$ PHWK\ODWLRQ LPSULQW ZDV OLQNHG WR DQ RSHQ FKURPDWLQ FRQIRUPDWLRQ )HLO HW DO +DUN DQG 7LOJKPDQ .KRVOD HW DO 6FKZHL]HU HW DO 6KLEDWD HW DO 6]DER HW DO f ,Q DGGLWLRQ DQDO\VLV RI KLVWRQH DFHW\ODWLRQ E\ FKURPDWLQ LPPXQRSUHFLSLWDWLRQ  GHPRQVWUDWHV WKDW WKH LQDFWLYH DOOHOHV RI OJ DQG + PDWHUQDO DQG SDWHUQDO UHVSHFWLYHO\f DUH HQULFKHG IRU K\SRDFHW\ODWHG KLVWRQHV D KDOOPDUN RI UHSUHVVHG JHQHV 3HGRQH HW DO f '1$ 5HSOLFDWLRQ 7LPLQJ $QRWKHU SRWHQWLDO FDQGLGDWH IRU WKH LPSULQWLQJ VLJQDO LV '1$ UHSOLFDWLRQ WLPLQJ 7KH PDWHUQDO DQG SDWHUQDO KRPRORJXHV RI PRVW JHQHV UHSOLFDWH V\QFKURQRXVO\ GXULQJ 6 SKDVH RI WKH FHOO F\FOH *OHQQ HW DO f ,Q FRQWUDVW WKH KRPRORJRXV JHQH UHJLRQV

PAGE 90

RI LPSULQWHG GRPDLQV KDYH EHHQ VKRZQ WR UHSOLFDWH DV\QFKURQRXVO\ ZLWK WKH SDWHUQDO DOOHOH XVXDOO\ UHSOLFDWLQJ HDUOLHU WKDQ WKH PDWHUQDO KRPRORJXH $UJ\ULRX7LULWD HW DO ,]XPLNDZD HW DO .LWVEHUJ HW DO .QROO HW DO /D6DOOH DQG /DODQGH /LQ HW DO 6LPRQ HW DO 6PU]ND HW DO :KLWH HW DO :XW] HW DO f )XUWKHU DQDO\VLV RI WKH LPSULQWHG T GRPDLQ KDV VKRZQ D KRPRORJRXV DVVRFLDWLRQ EHWZHHQ WKH PDWHUQDO DQG SDWHUQDO KRPRORJXHV LQ QRUPDO O\PSKREODVW FHOO OLQHV /D6DOOH DQG /DODQGH f +RZHYHU DV\QFKURQRXV '1$ UHSOLFDWLRQ WLPLQJ GRHV QRW DSSHDU WR FRUUHODWH ZLWK FKDQJHV LQ LPSULQWLQJ RI ,*) RU +L LQ SDWLHQWV ZLWK %HFNZLWK:LHGHPDQQ V\QGURPH 6TXLUH HW DO f ,Q DGGLWLRQ DV\QFKURQRXVO\ UHSOLFDWLQJ GRPDLQV RIWHQ H[WHQG SDVW WKH LPSULQWLQJ FOXVWHUV *OHQQ HW DO f 0RGHOV IRU ,PSULQWHG ([SUHVVLRQ ,Q DQ LQWULJXLQJ PRGHO EURXJKW XSRQ E\ VWXGLHV RI WKH PRXVH $SUW ORFXV 7XUFNHU KDV SRVWXODWHG WKDW &S* LVODQGV WKHPVHOYHV DUH WDUJHWV IRU GH QRYR PHWK\ODWLRQ SUREDEO\ E\ D 'QPW RU 'QPWD PHWK\OWUDQVIHUDVH 7XUNHU f $IWHU WKH LQLWLDO PHWK\ODWLRQ DW GLVFUHHW IRFL UHJLRQDO PHWK\ODWLRQ RI D &S* LVODQG ZRXOG VSUHDG ELGLUHFWLRQDOO\ WKURXJK PDLQWHQDQFH PHWK\ODWLRQ D UHSOLFDWLRQGHSHQGHQW SURFHVV UHTXLULQJ 'QPWO 7KH PHWK\ODWLRQ VWDWXV RI WKH &S* LVODQG ZRXOG UHPDLQ LQ IOX[ PHWK\ODWLRQ ZRXOG FRPSHWH ZLWK GHPHWK\ODWLRQ WR SURGXFH D VWDEOH PHWK\ODWLRQ SDWWHUQ 2WKHU UHFHQW H[SHULPHQWV KDYH OHG $QWHTXHUD DQG %LUG f WR SURSRVH D PHFKDQLVP IRU ZK\ &S* LVODQGV DUH RIWHQ IRXQG DW JHQH SURPRWHUV 7KH\ EHOLHYH WKDW &S* LVODQGV VHUYH GXDO UROHV DFWLQJ ERWK DV RULJLQV RI UHSOLFDWLRQ DQG DV SURPRWHUV IRU JHQHV WKDW DUH DFWLYH DW WRWLSRWHQW VWDJHV RI GHYHORSPHQW ,I WKHVH PRGHOV IURP QRQ LPSULQWHG ORFL SURYH WUXH LQ LPSULQWHG UHJLRQV WKHQ '1$ PHWK\ODWLRQ FRXOG EH WKH

PAGE 91

HSLJHQHWLF PDUN RI LPSULQWHG JHQHV OLQNLQJ '1$ UHSOLFDWLRQ FKURPDWLQ VWUXFWXUH DV DFWLQJ HOHPHQWV DQG LPSULQWHG H[SUHVVLRQ 6HYHUDO PRGHOV KDYH EHHQ SURSRVHG IRU WKH IXQFWLRQ RI WKH & 7KH ILUVW PRGHO SURSRVHG WKDW WKH SDWHUQDO FRPSRQHQW RI WKH & 3:6,&f FRQWUROOHG WKH PDWHUQDO WR SDWHUQDO HSLJHQRW\SH VZLWFK ZKLOH WKH PDWHUQDO FRPSRQHQW RI WKH & $6,&f UHJXODWHG WKH SDWHUQDO WR PDWHUQDO VZLWFK 'LWWULFK HW DO f +RZHYHU WKLV PRGHO UHTXLUHV DFWLYDWLRQ RI WKH PDWHUQDO DOOHOH GXULQJ JDPHWRJHQHVLV $OWKRXJK QR PDWHUQDO H[SUHVVLRQ KDV EHHQ GHWHFWHG LQ IHWDO EUDLQ RU OXQJ IHWDO RRF\WHV DQG SULPRUGLDO JHUP FHOOV KDYH QRW EHHQ H[DPLQHG %XLWLQJ HW DO f ,W LV SRVVLEOH WKDW WKH ,& FRQWDLQV JHUP FHOOVSHFLILF WUDQVFULSWV WKDW DUH PDWHUQDO LQ RULJLQ ,Q DQ DOWHUQDWLYH H[SODQDWLRQ WKH 3:6,& UHJXODWHV H[SUHVVLRQ RI WKH SDWHUQDOO\ H[SUHVVHG JHQHV LQ T ZKLOH WKH $6,& UHSUHVVHV DFWLYDWLRQ RI WKH 3:6,& )LJXUH % %UDQQDQ DQG %DUWRORPHL f 2Q WKH SDWHUQDO FKURPRVRPH WKH 3:6 ,& DFWLYDWHV WUDQVFULSWLRQ RI WKH SDWHUQDOO\ H[SUHVVHG JHQHV DORQJ WKH 0E LPSULQWHG GRPDLQ ZKLFK LQFOXGHV WKH 8%($ DQWLVHQVH WUDQVFULSW )LJXUH $ %f 3DWLHQWV ZLWK PXWDWLRQV LQ WKH 3:6,& ZRXOG IDLO WR DFWLYDWH SDWHUQDO JHQH H[SUHVVLRQ FDXVLQJ 3:6 ,Q RRJHQHVLV DQG VRPDWLF WLVVXH WKH $6,& UHSUHVVHV WKH 3:6,& VLOHQFLQJ WKH SDWHUQDOO\ H[SUHVVHG JHQHV $6 SDWLHQWV ZLWK LPSULQWLQJ GHIHFWV ZRXOG IDLO WR LQDFWLYDWH WKH 3:6,& FDXVLQJ ELDOOHOLF H[SUHVVLRQ RI WKH SDWHUQDORQO\ JHQHV 2QH SUHGLFWLRQ RI WKLV PRGHO ZRXOG EH WKDW 8%($ ZRXOG RQO\ GHPRQVWUDWH LPSULQWHG H[SUHVVLRQ LQ WLVVXHV ZKHUH WKH 8%($ DQWLVHQVH WUDQVFULSW ZDV FRQFXUUHQWO\ H[SUHVVHG ,Q VXSSRUW RI WKLV PRGHO WKH 8%($ DQWLVHQVH WUDQVFULSW LV RQO\ H[SUHVVHG LQ EUDLQ WKH RQH WLVVXH WKDW GHPRQVWUDWHV LPSULQWHG H[SUHVVLRQ RI 8%($ 5RXJHXOOH HW DO 5RXJHXOOH HW DO f ,Q DGGLWLRQ UHFHQW H[SHULPHQWV GHPRQVWUDWHG WKDW 8%($ ZDV SUHIHUHQWLDOO\ H[SUHVVHG IURP WKH PDWHUQDO DOOHOH ZKLOH WKH DQWLVHQVH

PAGE 92

WUDQVFULSW ZDV SUHIHUHQWLDOO\ H[SUHVVHG IURP WKH SDWHUQDO DOOHOH LQ VHYHUDO UHJLRQV RI WKH KXPDQ EUDLQ /RVVLH HW DO LQ SUHSDUDWLRQf $ VHFRQG SUHGLFWLRQ RI WKLV PRGHO LV WKDW DQ & GHOHWLRQ RQ WKH PDWHUQDO FKURPRVRPH WKDW H[WHQGHG IURP WKH $6,& WKURXJK WKH 3:6,& ZRXOG QRW JLYH DQ $6 SKHQRW\SH EHFDXVH WKH SDWHUQDOO\ H[SUHVVHG JHQHV ZRXOG QRW EHFRPH DFWLYDWHG GXH WR D ODFN RI D 3:6,& ,Q DJUHHPHQW ZLWK WKLV PRGHO QRQH RI WKH $6,& GHOHWLRQ SDWLHQWV GHOHWHV WKH 3:6,& 0\ SUHOLPLQDU\ H[SHULPHQWV VXJJHVW WKDW WKH DQWLVHQVH WUDQVFULSW SOD\V D UROH LQ WKH UHJXODWLRQ RI LPSULQWHG H[SUHVVLRQ RI 8%($ 2QH SRVVLEOH PHFKDQLVP IRU WKLV UHJXODWLRQ ZRXOG EH WKURXJK 51$ LQWHUIHUHQFH GXH WR GRXEOH VWUDQGHG 51$ LQWHUDFWLRQV ,Q RUGHU IRU WKLV PHFKDQLVP WR DSSO\ WKH DQWLVHQVH WUDQVFULSW PXVW QRW EH DEOH WR GLIIXVH WKURXJKRXW WKH QXFOHXV ,I LW FRXOG WKHQ ERWK WKH PDWHUQDO DQG SDWHUQDO DOOHOHV RI 8%($ ZRXOG EH UHSUHVVHG ,I WKH 8%($ DQWLVHQVH WUDQVFULSW GRHV GLIIXVH WKURXJKRXW WKH QXFOHXV WKHQ FKDQJHV LQ KLJKHU RUGHU QXFOHDU VWUXFWXUH FRXOG EH D PHFKDQLVP IRU LPSULQWHG H[SUHVVLRQ RI 8%($ ,W LV SRVVLEOH WKDW WKH QXFOHDU ORFDOL]DWLRQ RI 8%($ LV GLIIHUHQW LQ EUDLQ WKDQ RWKHU WLVVXHV 7KLV ORFDOL]DWLRQ FRXOG VHW XS HSLJHQHWLF GLIIHUHQFHV LQ FKURPDWLQ VWUXFWXUH RQ WKH PDWHUQDO DQG SDWHUQDO FKURPRVRPHV SURYLGH GLIIHUHQW PLFURHQYLURQPHQWV IRU GLVWULEXWLRQ RI WUDQVFULSWLRQ IDFWRUV DQG XOWLPDWHO\ UHVXOW LQ SUHIHUHQWLDO H[SUHVVLRQ IURP WKH PDWHUQDO DOOHOH LQ EUDLQ ,QWHUHVWLQJO\ 3:&5 D VPDOO QXFOHRODU VQRf 51$ KDV EHHQ PDSSHG ZLWKLQ 0E RI 8%($ GH /RV 6DQWRV HW DO f /LNH PRVW RI WKH JHQHV ZLWKLQ WKH $63:6 GRPDLQ 3:&5 LV SUHIHUHQWLDOO\ H[SUHVVHG IURP WKH SDWHUQDO DOOHOH DQG LV H[SUHVVHG DW KLJK OHYHOV LQ EUDLQ :LWKLQ D NE VWUHWFK DW WKH 3:&5 ORFXV FRSLHV RI JHQHV ZLWK KLJK KRPRORJ\ WR 3:&5 DUH IRXQG ,W LV SRVVLEOH WKDW WKH SUHVHQFH RI WKHVH DQGRU RWKHU QRQFRGLQJ 51$V DUH UHVSRQVLEOH IRU HVWDEOLVKLQJ SUHFLVH QXFOHDU

PAGE 93

DUFKLWHFWXUH 7KLV ZRXOG QRW EH VXUSULVLQJ VLQFH QRQFRGLQJ 51$V DQG DQWLVHQVH WUDQVFULSWV DSSHDU WR SOD\ D PDMRU UROO LQ HSLJHQHWLF JHQH VLOHQFLQJ )RU H[DPSOH WKH QRQFRGLQJ 7VL[ WUDQVFULSW ZKLFK LV DOVR DQWLVHQVH WR ;LVW KDV EHHQ VKRZQ WR EH LQYROYHG LQ WKH HSLJHQHWLF UHJXODWLRQ RI ;LQDFWLYDWLRQ /HH HW DO Df ,Q DGGLWLRQ WKH UR; 51$V KDYH EHHQ VKRZQ WR IDFLOLWDWH WKH PDOH VSHFLILF K\SHUWUDQVFULSWLRQ RQ WKH SDWHUQDO ; FKURPRVRPH LQ 'URVRSKLOD .HOOH\ HW DO f )XWXUH 'LUHFWLRQV 0\ VWXGLHV VXJJHVW WKDW PXWDWLRQV LQ 8%($ DUH QRW WKH VROH FDXVH RI $QJHOPDQ V\QGURPH DGGLWLRQDO IDFWRUV PXVW DOVR EH LQYROYHG 7KH QH[W ORJLFDO VWHS LQ EHWWHU XQGHUVWDQGLQJ WKH HWLRORJ\ RI $6 LV WR LGHQWLI\ DOO RI WKH VXEVWUDWHV WKDW 8%($ WDUJHWV IRU GHJUDGDWLRQ $Q\ SURWHLQ WKDW LQWHUDFWV ZLWK 8%($ LQ WKLV FDVFDGH DQG DOO SURWHLQV WKDW 8%($ WDUJHWV IRU GHJUDGDWLRQ DUH JRRG FDQGLGDWHV IRU SDWLHQWV JURXSHG LQ &ODVV 9 6R IDU IRXU SURWHLQV KDYH EHHQ LGHQWLILHG DV VXEVWUDWHV IRU 8%($PHGLDWHG GHJUDGDWLRQ S +),5$ WKH 6UF IDPLO\ NLQDVH %ON DQG 8%($ LWVHOI 3HUKDSV DQ HYHQ PRUH LQWULJXLQJ IXWXUH H[SORUDWLRQ LV WR GHWHUPLQH LI RWKHU T JHQHV PD\ SOD\ LPSRUWDQW UROHV LQ WKH HWLRORJ\ RI &ODVV 9 SDWLHQWV 3RVVLEOH FDQGLGDWHV DUH WKH 8%($ DQWLVHQVH WUDQVFULSW DQG WKH VHQVH WUDQVFULSW ORFDWHG GRZQVWUHDP RI 8%($ 7KHVH JHQHV WKHQ QHHG WR EH WHVWHG IRU WKHLU SRVVLEOH LQYROYHPHQW LQ $6 ,W LV QRW FOHDU KRZ DQ\ RI WKHVH JHQHV FRXOG EH LQYROYHG LQ WKH HWLRORJ\ RI $6 DQG JLYHQ WKH FRPSOH[LW\ RI WKH XELTXLWLQ V\VWHP LGHQWLILFDWLRQ RI WKH VSHFLILF $6 JHQH RU JHQHV LQYROYHG LV D YHU\ GDXQWLQJ WDVN ,Q DGGLWLRQ WR GHWHUPLQLQJ WKH HWLRORJ\ RI $6 LQ &ODVV 9 SDWLHQWV P\ UHFHQW VWXGLHV RQ LPSULQWHG H[SUHVVLRQ RI 8%($ DQG WKH DQWLVHQVH WUDQVFULSW VXJJHVW WKDW LPSULQWHG H[SUHVVLRQ RI 8%($ LV FRPSOLFDWHG 7R EHWWHU XQGHUVWDQG WKH ELRORJ\ WKH

PAGE 94

QH[W ORJLFDO VWHS ZRXOG EH WR H[DPLQH PRUH UHJLRQV RI WKH EUDLQ WR WU\ WR HVWDEOLVK WKH WLVVXHVSHFLILFLW\ RI LPSULQWHG H[SUHVVLRQ RI 8%($ DQG WKH DQWLVHQVH WUDQVFULSW WKLQN P\ UHVHDUFK LQGLFDWHV WKDW D FRPSUHKHQVLYH LQ VLWX DQDO\VLV RI DOO UHJLRQV RI WKH EUDLQ ZRXOG JUHDWO\ KHOS WR DQVZHU ZKHWKHU RU QRW WKH DQWLVHQVH WUDQVFULSW FDQ UHJXODWH LPSULQWHG H[SUHVVLRQ RI 8%($

PAGE 95

5()(5(1&(6 $OEUHFKW 8 6XWFOLIIH 6 &DWWDQDFK % 0 %HHFKH\ & 9 $UPVWURQJ (LFKHOH DQG %HDXGHW $ / f ,PSULQWHG H[SUHVVLRQ RI WKH PXULQH $QJHOPDQ V\QGURPH JHQH 8EHD LQ KLSSRFDPSDO DQG 3XUNLQMH QHXURQV 1DW *HQHW $QDQ 7 1DJDWD < .RJD + +RQGD <
PAGE 96

%LUJHU < 6KHPHU 5 3HUN DQG 5D]LQ $ f 7KH LPSULQWLQJ ER[ RI WKH PRXVH ,JIU JHQH 1DWXUH %RFFDFFLR *ODWW'HHOH\ + :DWULQ ) 5RHFNHO 1 /DODQGH 0 DQG 0XVFDWHOOL ) f 7KH KXPDQ 0$*(/ JHQH DQG LWV PRXVH KRPRORJXH DUH SDWHUQDOO\ H[SUHVVHG DQG PDSSHG WR WKH 3UDGHU:LOOL UHJLRQ +XP 0RO *HQHW %RWWDQL $ 5RELQVRQ : 3 'H/R]LHU%ODQFKHW & (QJHO ( 0RUULV 0 $ 6FKPLWW % 7KXQ+RKHQVWHLQ / DQG 6FKLQ]HO $ f $QJHOPDQ V\QGURPH GXH WR SDWHUQDO XQLSDUHQWDO GLVRP\ RI FKURPRVRPH D PLOGHU SKHQRW\SH" $P 0HG *HQHW %UDQGLV 0 $ULHO 0 DQG &HGDU + f '\QDPLFV RI '1$ PHWK\ODWLRQ GXULQJ GHYHORSPHQW %LRHVVD\V %UDQQDQ & DQG %DUWRORPHL 0 6 f 0HFKDQLVPV RI JHQRPLF LPSULQWLQJ &XUU 2SLQ *HQHW 'HY %URZQ : 9LOODU $ %LFNPRUH : &OD\WRQ6PLWK &DWFKSRROH 0DKHU ( 5 DQG 5HLN : f ,PSULQWLQJ PXWDWLRQ LQ WKH %HFNZLWK:LHGHPDQQ V\QGURPH OHDGV WR ELDOOHOLF ,*) H[SUHVVLRQ WKURXJK DQ +LQGHSHQGHQW SDWKZD\ +XP 0RO *HQHW %XLWLQJ 'LWWULFK % *URVV 6 /LFK & )DUEHU & %XFKKRO] 7 6PLWK ( 5HLV $ %XUJHU 1RWKHQ 0 0 %DUWK:LWWH 8 -DQVVHQ % $EHOLRYLFK /HUHU YDQ GHQ 2XZHODQG $ 0 +DOOH\ 6FKUDQGHU6WXPSHO & 6PHHWV + 0HLQHFNH 3 0DOFROP 6 *DUGQHU $ /DODQGH 0 1LFKROOV 5 )ULHQG 6FKXO]H $ 0DWWKLMV .RNNRQHQ +LOEHUW 3 9DQ 0DOGHUJHP / *ORYHU &DUERQHOO 3 :LOOHPV 3 *LOOHVVHQ.DHVEDFK DQG +RUVWKHPNH % f 6SRUDGLF LPSULQWLQJ GHIHFWV LQ 3UDGHU:LOOL V\QGURPH DQG $QJHOPDQ V\QGURPH LPSOLFDWLRQV IRU LPSULQW VZLWFK PRGHOV JHQHWLF FRXQVHOLQJ DQG SUHQDWDO GLDJQRVLV $P +XP *HQHW %XLWLQJ /LFK & &RWWUHOO 6 %DUQLFRDW $ DQG +RUVWKHPNH % f $ NE LPSULQWLQJ FHQWHU GHOHWLRQ LQ D IDPLO\ ZLWK $QJHOPDQ V\QGURPH UHGXFHV WKH VKRUWHVW UHJLRQ RI GHOHWLRQ RYHUODS WR ES +XP *HQHW %XLWLQJ 6DLWRK 6 *URVV 6 'LWWULFK % 6FKZDUW] 6 1LFKROOV 5 DQG +RUVWKHPNH % f ,QKHULWHG PLFURGHOHWLRQV LQ WKH $QJHOPDQ DQG 3UDGHU:LOOL 6\QGURPHV GHILQH DQ LPSULQWLQJ FHQWHU RQ KXPDQ FKURPRVRPH 1DW *HQHW %XUJHU .XQ]H 6SHUOLQJ DQG 5HLV $ f 3KHQRW\SLF GLIIHUHQFHV LQ $QJHOPDQ V\QGURPH SDWLHQWV LPSULQWLQJ PXWDWLRQV VKRZ OHVV IUHTXHQWO\ PLFURFHSKDO\ DQG K\SRSLJPHQWDWLRQ WKDQ GHOHWLRQV $P 0HG *HQHW %XVFKKDXVHQ :LWWLJ % *UDHVVPDQQ 0 DQG *UDHVVPDQQ $ f &KURPDWLQ VWUXFWXUH LV UHTXLUHG WR EORFN WUDQVFULSWLRQ RI WKH PHWK\ODWHG KHUSHV VLPSOH[ YLUXV WK\PLGLQH NLQDVH JHQH 3URF 1DWO $FDG 6FL 86$

PAGE 97

%XWOHU 0 0HDQH\ 5 DQG 3DOPHU & f &OLQLFDO DQG F\WRJHQHWLF VXUYH\ RI LQGLYLGXDOV ZLWK 3UDGHU/DEKDUW:LOOL V\QGURPH $P 0HG *HQHW &DVSDU\ 7 &OHDU\ 0 $ %DNHU & & *XDQ ; DQG 7LOJKPDQ 6 0 f 0XOWLSOH PHFKDQLVPV UHJXODWH LPSULQWLQJ RI WKH PRXVH GLVWDO FKURPRVRPH JHQH FOXVWHU 0RO &HOO %LRO &DWWDQDFK % 0 %DUU $ %HHFKH\ & 9 0DUWLQ 1RHEHOV DQG -RQHV f $ FDQGLGDWH PRGHO IRU $QJHOPDQ V\QGURPH LQ WKH PRXVH 0DPP *HQRPH &DWWDQDFK % 0 %DUU $ (YDQV ( 3 %XUWHQVKDZ 0 %HHFKH\ & 9 /HII 6 ( %UDQQDQ & &RSHODQG 1 -HQNLQV 1 $ DQG -RQHV f $ FDQGLGDWH PRXVH PRGHO IRU 3UDGHU:LOOL V\QGURPH ZKLFK VKRZV DQ DEVHQFH RI 6QUSQ H[SUHVVLRQ 1DW *HQHW &KRPF]\QVNL 3 DQG 6DFFKL 1 f 6LQJOHVWHS PHWKRG RI 51$ LVRODWLRQ E\ DFLG JXDQLGLQLXP WKLRF\DQDWHSKHQROFKORURIRUP H[WUDFWLRQ $QDO %LRFKHP &KULVWLDQ 6 / %KDWW 1 0DUWLQ 6 $ 6XWFOLIIH 6 .XERWD 7 +XDQJ % 0XWLUDQJXUD $ &KLQDXOW $ & %HDXGHW $ / DQG /HGEHWWHU + f ,QWHJUDWHG <$& FRQWLJ PDS RI WKH 3UDGHU:LOOL$QJHOPDQ UHJLRQ RQ FKURPRVRPH T T ZLWK DYHUDJH 676 VSDFLQJ RI NE *HQRPH 5HV &LHFKDQRYHU $ 2ULDQ $ DQG 6FKZDUW] $ / f 7KH XELTXLWLQPHGLDWHG SURWHRO\WLF SDWKZD\ PRGH RI DFWLRQ DQG FOLQLFDO LPSOLFDWLRQV &HOO %LRFKHP 6XSSO &OD\WRQ6PLWK 'ULVFROO :DWHUV 0 ) :HEE 7 $QGUHZV 7 3HPEUH\ 0 ( 0DOFROP 6 DQG 1LFKROOV 5 f 'LIIHUHQFHV LQ PHWK\ODWLRQ SDWWHUQV ZLWKLQ WKH '6 UHJLRQ RI FKURPRVRPH TT LQ ILUVW FRXVLQV ZLWK $QJHOPDQ DQG 3UDGHU :LOOL V\QGURPHV $P 0HG *HQHW &ROPDQ 6 5DVPXVVHQ 6 $ +R 9 7 $EHUQDWK\ & 5 DQG :DOODFH 0 5 f 6RPDWLF PRVDLFLVP LQ D SDWLHQW ZLWK QHXURILEURPDWRVLV W\SH $P +XP *HQHW 'DQ % %R\G 6 &KULVWLDHQV ) &RXUWHQV : 9DQ 0DOGHUJHP / DQG .DKQ $ f $W\SLFDO IHDWXUHV LQ $QJHOPDQ V\QGURPH GXH WR LPSULQWLQJ GHIHFW RI XQLSDUHQWDO GLVRP\ RI FKURPRVRPH 1HXURSHGLDWULFV GH /RV 6DQWRV 7 6FKZHL]HU 5HHV & $ DQG )UDQFNH 8 f 6PDOO (YROXWLRQDULO\ &RQVHUYHG 51$ 5HVHPEOLQJ &' %R[ 6PDOO 1XFOHRODU 51$ ,V 7UDQVFULEHG IURP 3:&5 D 1RYHO ,PSULQWHG *HQH LQ WKH 3UDGHU :LOOL 'HOHWLRQ 5HJLRQ :KLFK ,V +LJKO\ ([SUHVVHG LQ %UDLQ $P +XP *HQHW 'H/RUH\ 7 0 +DQGIRUWK $ $QDJQRVWDUDV 6 +RPDQLFV ( 0LQDVVLDQ % $ $VDWRXULDQ $ )DQVHORZ 0 6 'HOJDGR(VFXHWD $ (OOLVRQ DQG 2OVHQ 5 : f 0LFH ODFNLQJ WKH EHWD VXEXQLW RI WKH *$%$$ UHFHSWRU KDYH WKH HSLOHSV\

PAGE 98

SKHQRW\SH DQG PDQ\ RI WKH EHKDYLRUDO FKDUDFWHULVWLFV RI DQJHOPDQ V\QGURPH 1HXURVFL 'LWWULFK % %XLWLQJ *URVV 6 DQG +RUVWKHPNH % f &KDUDFWHUL]DWLRQ RI D PHWK\ODWLRQ LPSULQW LQ WKH 3UDGHU:LOOL V\QGURPH FKURPRVRPH UHJLRQ +XP 0RO *HQHW 'LWWULFK % %XLWLQJ .RUQ % 5LFNDUG 6 %X[WRQ 6DLWRK 6 1LFKROOV 5 3RXVWND $ :LQWHUSDFKW $ =DEHO % DQG +RUVWKHPNH % f ,PSULQW VZLWFKLQJ RQ KXPDQ FKURPRVRPH PD\ LQYROYH DOWHUQDWLYH WUDQVFULSWV RI WKH 61531 JHQH 1DW *HQHW 'UHZHOO 5 $ %UHQWRQ $LQVFRXJK ) %DUWRQ 6 & +LOWRQ $UQH\ / '£QGROR / DQG 6XUDQL 0 $ f 'HOHWLRQ RI D VLOHQFHU HOHPHQW GLVUXSWV + LPSULQWLQJ LQGHSHQGHQWO\ RI D '1$ PHWK\ODWLRQ HSLJHQHWLF VZLWFK 'HYHORSPHQW 'ULVFROO f *HQRPLF ,PSULQWLQJ LQ +XPDQV 0RO *HQHW 0HG 'ULVFROO DQG 0LJHRQ % 5 f 6H[ GLIIHUHQFH LQ PHWK\ODWLRQ RI VLQJOHFRS\ JHQHV LQ KXPDQ PHLRWLF JHUP FHOOV LPSOLFDWLRQV IRU ; FKURPRVRPH LQDFWLYDWLRQ SDUHQWDO LPSULQWLQJ DQG RULJLQ RI &S* PXWDWLRQV 6RPDW &HOO 0RO *HQHW 'ULVFROO :DWHUV 0 ) :LOOLDPV & $ =RUL 5 7 *OHQQ & & $YLGDQR 0 DQG 1LFKROOV 5 f $ '1$ PHWK\ODWLRQ LPSULQW GHWHUPLQHG E\ WKH VH[ RI WKH SDUHQW GLVWLQJXLVKHV WKH $QJHOPDQ DQG 3UDGHU:LOOL V\QGURPHV *HQRPLFV 'XSRQW 0 /H 7HVVLHU 5DELQHDX &XLVVHW / 9DVVHXU & -HDQSLHUUH 0 'HOSHFK 0 3LQWQ ) 3RQVRW DQG 'HQDYLW 0 ) f 8QH[SHFWHG $QJHOPDQ V\QGURPH PROHFXODU GHIHFW LQ D JLUO GLVSOD\LQJ FOLQLFDO IHDWXUHV RI 3UDGHU:LOOL V\QGURPH 0HG *HQHW )DOOV 3XOIRUG :\OLH $ $ DQG -LUWOH 5 / f *HQRPLF LPSULQWLQJ LPSOLFDWLRQV IRU KXPDQ GLVHDVH $P 3DWKRO )DQJ 3 /HY/HKPDQ ( 7VDL 9 ) 0DWVXXUD 7 %HQWRQ & 6 6XWFOLIIH 6 &KULVWLDQ 6 / .XERWD 7 +DOOH\ 0HLMHUV+HLMERHU + /DQJORLV 6 *UDKDP -U 0 %HXWHQ :LOOHPV 3 /HGEHWWHU + DQG %HDXGHW $ / f 7KH VSHFWUXP RI PXWDWLRQV LQ 8%($ FDXVLQJ DQJHOPDQ V\QGURPH +XP 0RO *HQHW )DUEHU & 'LWWULFK % %XLWLQJ DQG +RUVWKHPNH % f 7KH FKURPRVRPH LPSULQWLQJ FHQWUH ,&f UHJLRQ KDV XQGHUJRQH PXOWLSOH GXSOLFDWLRQ HYHQWV DQG FRQWDLQV DQ XSVWUHDP H[RQ RI 61531 WKDW LV GHOHWHG LQ DOO DQJHOPDQ V\QGURPH SDWLHQWV ZLWK DQ ,& PLFURGHOHWLRQ +XP 0RO *HQHW )DUEHU & *URVV 6 1HHVHQ %XLWLQJ DQG +RUVWKHPNH % f ,GHQWLILFDWLRQ RI D WHVWLVVSHFLILF JHQH &RUIf LQ WKH 3UDGHU:LOOL V\QGURPH UHJLRQ RQ FKURPRVRPH *HQRPLFV

PAGE 99

)H8 5 +DQGHO 0 $ $OOHQ 1 DQG 5HLN : f &KURPDWLQ VWUXFWXUH DQG LPSULQWLQJ GHYHORSPHQWDO FRQWURO RI '1DVHO VHQVLWLYLW\ LQ WKH PRXVH LQVXOLQOLNH JURZWK IDFWRU JHQH 'HY *HQHW )HLQEHUJ $ 3 f '1$ PHWK\ODWLRQ JHQRPLF LPSULQWLQJ DQG FDQFHU &XUU 7RS 0LFURELRO ,PPXQRO )UHHPDQ 6 % 0D\ 0 3HWWD\ )HUQKRII 3 0 DQG +DVVROG 7 f 3DWHUQDO XQLSDUHQWDO GLVRP\ LQ D FKLOG ZLWK D EDODQFHG WUDQVORFDWLRQ DQG $QJHOPDQ V\QGURPH $P 0HG *HQHW )ULGPDQ & 6DQWRV 0 )HUUDUL DQG .RLIIPDQQ & 3 Df $ IXUWKHU $QJHOPDQ V\QGURPH SDWLHQW ZLWK 83' GXH WR SDWHUQDO PHLRVLV ,, QRQGLVMXQFWLRQ &OLQ *HQHW )ULGPDQ & 9DUHOD 0 & .RN ) 'LDPHQW $ DQG .RLIIPDQQ & 3 Ef 3DWHUQDO 83' IXUWKHU JHQHWLF DQG FOLQLFDO VWXGLHV LQ IRXU DQJHOPDQ V\QGURPH SDWLHQWV $P 0HG *HQHW )ULGPDQ & 9DUHOD 0 & 1LFKROOV 5 DQG .RLIIPDQQ & 3 f 8QXVXDO FOLQLFDO IHDWXUHV LQ DQ $QJHOPDQ V\QGURPH SDWLHQW ZLWK XQLSDUHQWDO GLVRP\ GXH WR D WUDQVORFDWLRQ TT &OLQ *HQHW )XQJ &
PAGE 100

*OHQQ & & 'ULVFROO
PAGE 101

,VKLKDUD +DWDQR 1 )XUXXPL + .DWR 5 ,ZDNL 7 0LXUD -LQQR < DQG 6DVDNL + f &RPSDUDWLYH JHQRPLF VHTXHQFLQJ LGHQWLILHV QRYHO WLVVXHVSHFLILF HQKDQFHUV DQG VHTXHQFH HOHPHQWV IRU PHWK\ODWLRQVHQVLWLYH IDFWRUV LPSOLFDWHG LQ ,JI+ LPSULQWLQJ *HQRPH 5HV ,]XPLNDZD < 1DULWRPL DQG +LUD\DPD f 5HSOLFDWLRQ DV\QFKURQ\ EHWZHHQ KRPRORJV T F\WRJHQHWLF HYLGHQFH IRU JHQRPLF LPSULQWLQJ +XP *HQHW -D\ 3 5RXJHXOOH & 0DVVDFULHU $ 0RQGD $ 0DWWHL 0 0DO]DF 3 5RHFNHO 1 7DYLDX[ 6 /HIUDQF / &DX 3 %HUWD 3 /DODQGH 0 DQG 0XVFDWHOOL ) f 7KH KXPDQ QHFGLQ JHQH 1'1 LV PDWHUQDOO\ LPSULQWHG DQG ORFDWHG LQ WKH 3UDGHU:LOOL V\QGURPH FKURPRVRPDO UHJLRQ 1DW *HQHW -LDQJ < + $UPVWURQJ $OEUHFKW 8 $WNLQV & 0 1RHEHOV / (LFKHOH 6ZHDWW DQG %HDXGHW $ / f 0XWDWLRQ RI WKH $QJHOPDQ XELTXLWLQ OLJDVH LQ PLFH FDXVHV LQFUHDVHG F\WRSODVPLF S DQG GHILFLWV RI FRQWH[WXDO OHDUQLQJ DQG ORQJn WHUP SRWHQWLDWLRQ 1HXURQ -RKQ 5 0 DQG 6XUDQL 0 $ f ,PSULQWHG JHQHV DQG UHJXODWLRQ RI JHQH H[SUHVVLRQ E\ HSLJHQHWLF LQKHULWDQFH &XUU 2SLQ &HOO %LRO -RKQVRQ 6WXEEV / &XOLDW & 7 0RQWJRPHU\ & 6 5XVVHOO / % DQG 5LQFKLN ( 0L f 0ROHFXODU DQDO\VLV RI PXWDWLRQV DW WKH PRXVH SLQNH\HG GLOXWLRQ Sf ORFXV *HQHWLFV -RQHV 7RZQVHQG 0 6 *OHQLVWHU 3 + -RQJ 0 7 & -RQHV / 1LFKROOV 5 DQG &DWWDQDFK % 0 f 'LIIHUHQWLDO LPSULQWLQJ RI WKH VHQVHDQWLVHQVH JHQHV =QI DQG 'Q GXULQJ GHYHORSPHQW LQ WKH PRXVH XQSXEOLVKHG GDWD -RQJ 0 7 *UD\ 7 $ -L < *OHQQ & & 6DLWRK 6 'ULVFROO DQG 1LFKROOV 5 f $ QRYHO LPSULQWHG JHQH HQFRGLQJ D 5,1* ]LQFILQJHU SURWHLQ DQG RYHUODSSLQJ DQWLVHQVH WUDQVFULSW LQ WKH 3UDGHU:LOOL V\QGURPH FULWLFDO UHJLRQ +XP 0RO *HQHW .DMLL 7 .XUDVKLJH + 2KDPD DQG 8FKLQR ) f ;< DQG ;; FRPSOHWH PROHV FOLQLFDO DQG PRUSKRORJLF FRUUHODWLRQV $P 2EVWHW *\QHFRO .DSODQ / & :KDUWRQ 5 (OLDV ( 0DQGHOO ) 'RQORQ 7 DQG /DWW 6 $ f &OLQLFDO KHWHURJHQHLW\ DVVRFLDWHG ZLWK GHOHWLRQV LQ WKH ORQJ DUP RI FKURPRVRPH UHSRUW RI QHZ FDVHV DQG WKHLU SRVVLEOH JHQHWLF VLJQLILFDQFHV $P 0HG *HQHW .HOOH\ 5 / 0HOOHU 9 + *RUGDG]H 3 5 5RPDQ 'DYLV 5 / DQG .XURGD 0 f (SLJHQHWLF VSUHDGLQJ RI WKH 'URVRSKLOD GRVDJH FRPSHQVDWLRQ FRPSOH[ IURP UR; 51$ JHQHV LQWR IODQNLQJ FKURPDWLQ &HOO .KRVOD 6 $LWFKLVRQ $ *UHJRU\ 5 $OOHQ 1 DQG )HLO 5 f 3DUHQWDO DOOHOH VSHFLILF FKURPDWLQ FRQILJXUDWLRQ LQ D ERXQGDU\ LPSULQWLQJFRQWURO HOHPHQW XSVWUHDP RI WKH PRXVH + JHQH 0RO &HOO %LRO

PAGE 102

.LVKLQR 7 /DODQGH 0 DQG :DJVWDII f 8%($($3 PXWDWLRQV FDXVH $QJHOPDQ V\QGURPH 1DW *HQHW .LVKLQR 7 DQG :DJVWDII f *HQRPLF RUJDQL]DWLRQ RI WKH 8%($($3 JHQH DQG UHODWHG SVHXGRJHQHV *HQRPLFV .LWVEHUJ 6HOLJ 6 %UDQGLV 0 'ULVFROO 1LFKROOV 5 DQG &HGDU + f $OOHOH VSHFLILF UHSOLFDWLRQ WLPLQJ RI LPSULQWHG JHQH UHJLRQV 1DWXUH .QROO + 1LFKROOV 5 0DJHQLV 5 ( JUDKDP 0 /DODQGH 0 DQG /DWW 6 $ f $QJHOPDQ DQG 3UDGHU:LOOL V\QGURPHV VKDUH D FRPPRQ FKURPRVRPH GHOHWLRQ EXW GLIIHU LQ SDUHQWDO RULJLQ RI WKH GHOHWLRQ $P 0HG *HQHW .QROO + 0 &KHQJ 6 DQG /DODQGH 0 f $OOHOH VSHFLILFLW\ RI '1$ UHSOLFDWLRQ WLPLQJ LQ WKH $QJHOPDQ3UDGHU:LOOL V\QGURPH LPSULQWHG FKURPRVRPDO UHJLRQ 1DW *HQHW .RHJO 0 +RSSH 7 6FKOHQNHU 6 8OULFK + 0D\HU 7 8 DQG -HQWVFK 6 f $ QRYHO XELTXLWLQDWLRQ IDFWRU ( LV LQYROYHG LQ PXOWLXELTXLWLQ FKDLQ DVVHPEO\ &HOO .XERWD 7 $UDGK\D 6 0DFKD 0 6PLWK $ & 6XUK / & 6DWLVK 9HUS 0 6 1HH + / -RKQVRQ $ &KULVWDQ 6 / DQG /HGEHWWHU + Df $QDO\VLV RI SDUHQW RI RULJLQ VSHFLILF '1$ PHWK\ODWLRQ DW 61531 DQG 3: LQ WLVVXHV LPSOLFDWLRQ IRU SUHQDWDO GLDJQRVLV 0HG *HQHW .XERWD 7 'DV 6 &KULVWLDQ 6 / %D\OLQ 6 % +HUPDQ DQG /HGEHWWHU + f 0HWK\ODWLRQVSHFLILF 3&5 VLPSOLILHV LPSULQWLQJ DQDO\VLV 1DW *HQHW .XERWD 7 6XWFOLIIH $UDGK\D 6 *LOOHVVHQ.DHVEDFK &KULVWLDQ 6 +RUVWKHPNH % %HDXGHW $ DQG /HGEHWWHU Ef 9DOLGDWLRQ VWXGLHV RI 61531 PHWK\ODWLRQ DV D GLDJQRVWLF WHVW IRU 3UDGHU:LOOL V\QGURPH $P 0HG *HQHW .XPDU 6 .DR : + DQG +RZOH\ 3 0 f 3K\VLFDO LQWHUDFWLRQ EHWZHHQ VSHFLILF ( DQG +HFW ( HQ]\PHV GHWHUPLQHV IXQFWLRQDO FRRSHUDWLYLW\ %LRO &KHP /DDQ / $ Y +DHULQJHQ $ DQG %URXZHU 2 ) f $QJHOPDQ V\QGURPH D UHYLHZ RI FOLQLFDO DQG JHQHWLF DVSHFWV &OLQ 1HXURO 1HXURVXUJ /D6DOOH 0 DQG /DODQGH 0 f 'RPDLQ RUJDQL]DWLRQ RI DOOHOHVSHFLILF UHSOLFDWLRQ ZLWKLQ WKH *$%5% JHQH FOXVWHU UHTXLUHV D ELSDUHQWDO T FRQWULEXWLRQ 1DW *HQHW /D6DOOH 0 DQG /DODQGH 0 f +RPRORJRXV DVVRFLDWLRQ RI RSSRVLWHO\ LPSULQWHG FKURPRVRPDO GRPDLQV 6FLHQFH

PAGE 103

/D6DOOH 0 5LWFKLH 5 *ODWW + DQG /DODQGH 0 f &ORQDO KHWHURJHQHLW\ DW DOOHOLF PHWK\ODWLRQ VLWHV GLDJQRVWLF IRU 3UDGHU :LOOL DQG $QJHOPDQ V\QGURPHV 3URF 1DWO $FDG 6FL 8 6 $ /HGEHWWHU + DQG (QJHO ( f 8QLSDUHQWDO GLVRP\ LQ KXPDQV GHYHORSPHQW RI DQ LPSULQWLQJ PDS DQG LWV LPSOLFDWLRQV IRU SUHQDWDO GLDJQRVLV +XP 0RO *HQHW /HH 7 'DYLGRZ / 6 DQG :DUVKDZVN\ Df 7VL[ D JHQH DQWLVHQVH WR ;LVW DW WKH ;LQDFWLYDWLRQ FHQWUH 1DW *HQHW /HH 0 3 'H%DXQ 0 5 0LWVX\D *DORQHN + / %UDQGHQEXUJ 6 2VKLPXUD 0 DQG )HLQEHUJ $ 3 Ef /RVV RI LPSULQWLQJ RI D SDWHUQDOO\ H[SUHVVHG WUDQVFULSW ZLWK DQWLVHQVH RULHQWDWLRQ WR .9/47 RFFXUV IUHTXHQWO\ LQ %HFNZLWK:LHGHPDQQ V\QGURPH DQG LV LQGHSHQGHQW RI LQVXOLQOLNH JURZWK IDFWRU ,, LPSULQWLQJ 3URF 1DWO $FDG 6FL 8 6 $ /HH 6 .R]ORY 6 +HUQDQGH] / &KDPEHUODLQ 6 %UDQQDQ & 6WHZDUW & / DQG :HYULFN 5 f ([SUHVVLRQ DQG LPSULQWLQJ RI 0$*(/ VXJJHVW D UROH LQ SUDGHU ZLOOL V\QGURPH DQG WKH KRPRORJRXV PXULQH LPSULQWLQJ SKHQRW\SH +XP 0RO *HQHW /HH 6 DQG :HYULFN 5 f ,GHQWLILFDWLRQ RI QRYHO LPSULQWHG WUDQVFULSWV LQ WKH 3UDGHU:LOOL V\QGURPH DQG $QJHOPDQ V\QGURPH GHOHWLRQ UHJLRQ IXUWKHU HYLGHQFH IRU UHJLRQDO LPSULQWLQJ FRQWURO $P +XP *HQHW /L ( %HDUG & DQG -DHQLVFK 5 f 5ROH IRU '1$ PHWK\ODWLRQ LQ JHQRPLF LPSULQWLQJ 1DWXUH /LQ 0 6 =KDQJ $ DQG )XMLPRWR $ f $V\QFKURQRXV '1$ UHSOLFDWLRQ EHWZHHQ T T KRPRORJV F\WRJHQHWLF HYLGHQFH IRU PDWHUQDO LPSULQWLQJ DQG GHOD\HG UHSOLFDWLRQ +XP *HQHW /LX
PAGE 104

DQDO\VHV DQG JHQRW\SHSKHQRWR\SH FRUUHODWLRQV DPRQJ WKH ILYH FODVVHV RI DQJHOPDQ V\QGURPH 0DJHQLV 5 ( %URZQ 0 /DF\ $ %XGGHQ 6 DQG /D)UDQFKL 6 f ,V $QJHOPDQ V\QGURPH DQ DOWHUQDWH UHVXOW RI GHOfT Tf" $P 0HG *HQHW 0DKHU ( 5 DQG 5HLN : f %HFNZLWK:LHGHPDQQ V\QGURPH LPSULQWLQJ LQ FOXVWHUV UHYLVLWHG &OLQ ,QYHVW 0DOFROP 6 &OD\WRQ6PLWK 1LFKROV 0 5REE 6 :HEE 7 $UPRXU $ / -HIIUH\V $ DQG 3HPEUH\ 0 ( f 8QLSDUHQWDO SDWHUQDO GLVRP\ LQ $QJHOPDQfV V\QGURPH /DQFHW 0DO]DF 3 :HEEHU + 0RQGD $ *UDKDP 0 .XNROLFK 0 :LOOLDPV & 3DJRQ 5 $ 5DPVGHOO / $ .LVKLQR 7 DQG :DJVWDII f 0XWDWLRQ DQDO\VLV RI 8%($ LQ $QJHOPDQ V\QGURPH SDWLHQWV $P +XP *HQHW 0DVFDUL 0 *RWWOLHE : 5RJDQ 3 %XWOHU 0 $UPRXU -HIIUH\V $ :DOOHU /VGGD 5 / DQG 1LFKROOV 5 f )UHTXHQF\ RI XQLSDUHQWDO GLVRP\ LQ 3UDGHU:LOOL V\QGURPH DQG LPSOLFDWLRQV IRU PROHFXODU GLDJQRVLV 1HZ (QJ 0HG 0DWVXXUD 7 6XWFOLIIH 6 )DQJ 3 *DOMDDUG 5 -LDQJ < + %HQWRQ & 6 5RPPHQV 0 DQG %HDXGHW $ / f 'H QRYR WUXQFDWLQJ PXWDWLRQV LQ ($3 XELTXLWLQSURWHLQ OLJDVH JHQH 8%($f LQ $QJHOPDQ V\QGURPH 1DW *HQHW 0F*UDWK DQG 6ROWHU f &RPSOHWLRQ RI PRXVH HPEU\RJHQHVLV UHTXLUHV ERWK PDWHUQDO DQG SDWHUQDO JHQRPHV &HOO 0LQDVVLDQ % $ 'H/RUH\ 7 0 2OVHQ 5 : 3KLOLSSDUW 0 %URQVWHLQ < =KDQJ 4 *XHUULQL 5 9DQ 1HVV 3 /LYHW 0 2 DQG 'HOJDGR(VFXHWD $ 9 f $QJHOPDQ V\QGURPH FRUUHODWLRQV EHWZHHQ HSLOHSV\ SKHQRW\SHV DQG JHQRW\SHV $QQ 1HXURO 0LWXUDQJXUD $ *UHHQEHUJ )f %XWOHU 0 0DOFROP 6 1LFKROOV 5 &KDNUDYDUWL $ DQG /HGEHWWHU + f 0XOWLSOH[ 3&5 RI WKUHH GLQXFOHRWLGH UHSHDWV LQ WKH 3UDGHU:LOOL$QJHOPDQ FULWLFDO UHJLRQ T Tf 0ROHFXODU GLDJQRVLV DQG PHFKDQLVP RI XQLSDUHQWDO GLVRP\ +XP 0RO *HQHW 0RQGD $ 0DO]DF 3 /LYHW 0 2 9RHOFNHO 0 $ 0DQFLQL 'HODUR]LHUH & 3KLOLS 1 DQG 0DWWHL ) Df $QJHOPDQ V\QGURPH UHVXOWLQJ IURP 8%($ PXWDWLRQV LQ SDWLHQWV IURP HLJKW IDPLOLHV FOLQLFDO PDQLIHVWDWLRQV DQG JHQHWLF FRXQVHOOLQJ 0HG *HQHW 0RQGD $ 0DO]DF 3 9RHOFNHO 0 $ $XTXLHU 3 *LUDUGRW / 0DWWHL 0 3KLOLS 1 0DWWHL ) /DODQGH 0 DQG /LYHW 0 2 Ef 3KHQRW\SHJHQRW\SH FRUUHODWLRQ LQ GHOHWLRQ DQG QRQGHOHWLRQ $QJHOPDQ V\QGURPH SDWLHQWV (XU +XP *HQHW

PAGE 105

1DNDR 0 6XWFOLIIH 6 'XUWVFKL % 0XWLUDQJXUD $ /HGEHWWHU + DQG %HDXGHW $ / f ,PSULQWLQJ DQDO\VLV RI WKUHH JHQHV LQ WKH 3UDGHU:LOOL$QJHOPDQ UHJLRQ 61531 (DVVRFLDWHG SURWHLQ DQG 3$5 '6(f +XP 0RO *HQ 1DQ ; &DPSR\ ) DQG %LUG $ f 0H&3 LV D WUDQVFULSWLRQDO UHSUHVVRU ZLWK DEXQGDQW ELQGLQJ VLWHV LQ JHQRPLF FKURPDWLQ &HOO 1DQ ; 7DWH 3 /L ( DQG %LUG $ f '1$ PHWK\ODWLRQ VSHFLILHV FKURPRVRPDO ORFDOL]DWLRQ RI 0H&3 0RO &HOO %LRO 1J + + DQG %LUG $ f '1$ PHWK\ODWLRQ DQG FKURPDWLQ PRGLILFDWLRQ &XUU 2SLQ *HQHW 'HY 1LFKROOV 5 f 7KH LPSDFW RI JHQRPLF LPSULQWLQJ IRU QHXUREHKDYLRUDO DQG GHYHORSPHQWDO GLVRUGHUV &OLQ ,QYHVW 1LFKROOV 5 .QROO + %XWOHU 0 .DUDP 6 DQG /DODQGH 0 f *HQHWLF LPSULQWLQJ VXJJHVWHG E\ PDWHUQDO XQLSDUHQWDO KHWHURGLVRP\ LQ QRQGHOHWLRQ 3UDGHU :LOOL V\QGURPH 1DWXUH 1LFKROOV 5 3DL 6 *RWWOLHE : DQG &DQW ( 6 f 3DWHUQDO XQLSDUHQWDO GLVRP\ LQ $QJHOPDQ V\QGURPH $QQ 1HXURO 1LFKROOV 5 6DLWRK 6 DQG +RUVWKHPNH % f ,PSULQWLQJ LQ 3UDGHU:LOOL DQG $QJHOPDQ V\QGURPHV 7UHQGV *HQHW 2KDPD .DMLL 7 2NDPRWR ( )XNXGD < ,PDL]XPL 7VXNDKDUD 0 .RED\DVKL DQG +DJLZDUD f 'LVSHUPLF RULJLQ RI ;< K\GDWLGLIRUP PROHV 1DWXUH 2KDPD 1RPXUD 2NDPRWR ( )XNXGD < ,KDUD 7 DQG )XMLZDUD $ f 2ULJLQ RI LPPDWXUH WHUDWRPD RI WKH RYDU\ $P 2EVWHW *\QHFRO 2KWD 7 %XLWLQJ .RNNRQHQ + 0F&DQGOHVV 6 +HHJHU 6 /HLVWL + 'ULVFROO &DVVLG\ 6 % +RUVWKHPNH % DQG 1LFKROOV 5 f 0ROHFXODU PHFKDQLVP RI DQJHOPDQ V\QGURPH LQ WZR ODUJH IDPLOLHV LQYROYHV DQ LPSULQWLQJ PXWDWLRQ $P +XP *HQHW 3HGRQH 3 9 3LNDDUW 0 &HUUDWR ) 9HUQXFFL 0 8QJDUR 3 %UXQL & % DQG 5LFFLR $ f 5ROH RI KLVWRQH DFHW\ODWLRQ DQG '1$ PHWK\ODWLRQ LQ WKH PDLQWHQDQFH RI WKH LPSULQWHG H[SUHVVLRQ RI WKH + DQG ,JI JHQHV )(%6 /HWW 3HUU\ : / +XVWDG & 0 6ZLQJ $ 2n6XOOLYDQ 7 1 -HQNLQV 1 $ DQG &RSHODQG 1 f 7KH LWFK\ ORFXV HQFRGHV D QRYHO XELTXLWLQ SURWHLQ OLJDVH WKDW LV GLVUXSWHG LQ D+ PLFH 1DW *HQHW 3UDVDG & DQG :DJVWDII f *HQRW\SH DQG SKHQRW\SH LQ $QJHOPDQ V\QGURPH FDXVHG E\ SDWHUQDO 83' $P 0HG *HQHW

PAGE 106

5D]LQ $ DQG &HGDU + f '1$ PHWK\ODWLRQ DQG JHQRPLF LPSULQWLQJ &HOO 5HLN : %URZQ : 6FKQHLG + /H %RXF < %LFNPRUH : DQG 0DKHU ( 5 f ,PSULQWLQJ PXWDWLRQV LQ WKH %HFNZLWK:LHGHPDQQ V\QGURPH VXJJHVWHG E\ DOWHUHG LPSULQWLQJ SDWWHUQ LQ WKH ,*)+ GRPDLQ +XP 0RO *HQHW 5HLV $ 'LWWULFK % *UHJHU 9 %XLWLQJ /DODQGH 0 *LOOHVVHQ.DHVEDFK $QYUHW 0 DQG +RUVWKHPNH % f ,PSULQWLQJ PXWDWLRQV VXJJHVWHG E\ DEQRUPDO '1$ PHWK\ODWLRQ SDWWHUQV LQ IDPLOLDO $QJHOPDQ DQG 3UDGHU:LOOL V\QGURPHV $P +XP *HQHW 5RELQVRQ : 3 :DJVWDII %HUQDVFRQL ) %DFFLFKHWWL & $UWLIRQL / )UDQ]RQL ( 6XVODN / 6KLK / < $YLY + DQG 6FKLQ]HO $ $ f 8QLSDUHQWDO GLVRP\ H[SODLQV WKH RFFXUUHQFH RI WKH $QJHOPDQ RU 3UDGHU :LOOL V\QGURPH LQ SDWLHQWV ZLWK DQ DGGLWLRQDO VPDOO LQY GXSf FKURPRVRPH 0HG *HQHW 5RXJHXOOH & &DUGRVR & )RQWHV 0 &ROOHDX[ / DQG /DODQGH 0 f $Q LPSULQWHG DQWLVHQVH 51$ RYHUODSV 8%($ DQG D VHFRQG PDWHUQDOO\ H[SUHVVHG WUDQVFULSW 1DW *HQHW 5RXJHXOOH & *ODWW + DQG /DODQGH 0 f 7KH $QJHOPDQ V\QGURPH FDQGLGDWH JHQH 8%($($3 LV LPSULQWHG LQ EUDLQ 1DW *HQHW 5XVVR 6 &RJOLDWL ) 9LUL 0 &DYDOOHUL ) 6HOLFRUQL $ 7XUROOD / %HOOL 6 5RPHR $ DQG /DUL]]D / f 1RYHO PXWDWLRQV RI XELTXLWLQ SURWHLQ OLJDVH $ JHQH LQ ,WDOLDQ SDWLHQWV ZLWK $QJHOPDQ V\QGURPH +XP 0XWDW 6DLWRK 6 %XLWLQJ &DVVLG\ 6 % &RQUR\ 0 'ULVFROO *DEULHO 0 *LOOHVVHQ.DHVEDFK *OHQQ & & *UHHQVZDJ / 5 +RUVWKHPNH % .RQGR .XZDMLPD 1LLNDZD 0 5RJDQ 3 6FKZDUW] 6 6HLS :LOOLDPV & $ DQG 1LFKROOV 5 f &OLQLFDO VSHFWUXP DQG PROHFXODU GLDJQRVLV RI $QJHOPDQ DQG 3UDGHU:LOOL V\QGURPH SDWLHQWV ZLWK DQ LPSULQWLQJ PXWDWLRQ $P 0HG *HQHW 6DLWRK 6 %XLWLQJ 5RJDQ 3n. %X[WRQ / 'ULVFROO $UQHPDQQ .RQLJ 5 0DOFROP 6 +RUVWKHPNH % DQG 1LFKROOV 5 f 0LQLPDO GHILQLWLRQ RI WKH LPSULQWLQJ FHQWHU DQG IL[DWLRQ RI D FKURPRVRPH T T HSLJHQRW\SH E\ LPSULQWLQJ PXWDWLRQV 31$6 6DLWRK 6 +DUDGD 1 -LQQR < +DVKLPRWR ,PDL]XPL .XURNL < )XNXVKLPD < 6XJLPRWR 7 5HQHGR 0 :DJVWDII DQG HW DO f 0ROHFXODU DQG FOLQLFDO VWXG\ RI $QJHOPDQ V\QGURPH SDWLHQWV $P 0HG *HQHW 6DLWRK 6 DQG :DGD 7 f 3DUHQWRI2ULJLQ 6SHFLILF +LVWRQH $FHW\ODWLRQ DQG 5HDFWLYDWLRQ RI D .H\ ,PSULQWHG *HQH /RFXV LQ 3UDGHU:LOOL 6\QGURPH $P +XP *HQHW

PAGE 107

6DLWRK 6 :DGD 7 .XQR 7 .LP & 2KDVKL + +DVKLPRWR DQG 1LLNDZD 1 f &OLQLFDO FKDUDFWHULVWLFV RI $QJHOPDQ V\QGURPH SDWLHQWV ZLWK D QRQ,& GHOHWHG LPSULQWLQJ PXWDWLRQ &OLQ *HQHW 6DVDNL + ,VKLKDUD DQG .DWR 5 f 0HFKDQLVPV RI ,JI+ LPSULQWLQJ '1$ PHWK\ODWLRQ FKURPDWLQ DQG ORQJ GLVWDQFH JHQH UHJXODWLRQ %LRFKHP 7RN\Rf 6FKZHL]HU =\QJHU DQG )UDQFNH 8 f ,Q YLYR QXFOHDVH K\SHUVHQVLWLYLW\ VWXGLHV UHYHDO PXOWLSOH VLWHV RI SDUHQWDO RULJLQGHSHQGHQW GLIIHUHQWLDO FKURPDWLQ FRQIRUPDWLRQ LQ WKH NE 61531 WUDQVFULSWLRQ XQLW +XP 0RO *HQHW 6KHPHU 5 %LUJHU < 5LJJV $ DQG 5D]LQ $ f 6WUXFWXUH RI WKH LPSULQWHG PRXVH 6QUSQ JHQH DQG HVWDEOLVKPHQW RI LWV SDUHQWDOVSHFLILF PHWK\ODWLRQ SDWWHUQ 3URF 1DWO $FDG 6FL 8 6 $ 6KLEDWD +
PAGE 108

6PLWK $ :LOHV & +DDQ ( 0F*LOO :DOODFH 'L[RQ 6HOE\ 5 &ROOH\ $ 0DUNV 5 DQG 7UHQW 5 f &OLQLFDO IHDWXUHV LQ SDWLHQWV ZLWK $QJHOPDQ V\QGURPH UHVXOWLQJ IURP '1$ GHOHWLRQ 0HG *HQHW 6PU]ND 2 : )DH 6WRJHU 5 .XU]EDXHU 5 )LVFKHU ) +HQQ 7 :HLWK $ DQG %DUORZ 3 f &RQVHUYDWLRQ RI D PDWHUQDOVSHFLILF PHWK\ODWLRQ VLJQDO DW WKH KXPDQ ,*)5 ORFXV +XP 0RO *HQHW 6TXLUH $ /L 0 3HUOLNRZVNL 6 )HL < / %D\DQL =KDQJ = 0 DQG :HNVEHUJ 5 f $OWHUDWLRQV RI + LPSULQWLQJ DQG ,*) UHSOLFDWLRQ WLPLQJ DUH LQIUHTXHQW LQ %HFNZLWK:LHGHPDQQ V\QGURPH *HQRPLFV 6WRJHU 5 .XELFND 3 /LX &* .DIUL 7 5D]LQ $ &HGDU + DQG %DUORZ 3 f 0DWHUQDOVSHFLILF PHWK\ODWLRQ RI WKH LPSULQWHG PRXVHJU ORFXV LGHQWLILHV WKH H[SUHVVHG ORFXV DV FDUU\LQJ WKH LPSULQWLQJ VLJQDO &HOO 6XWFOLIIH 6 *DOMDDUG 5-LDQJ <+ .XERWD 7 )DQJ 3 0DWVXUUD 7 /HGEHWWHU + &DWWDQDFK % DQG %HDXGHW $ / f 7KH $QJHOPDQ V\QGURPH FULWLFDO UHJLRQ LV QDUURZHG WR NE DQG LQFOXGHV WKH 8%($ JHQH ,Q 7KH $PHULFDQ 6RFLHW\ RI +XPDQ *HQHWLFV 0 3HWHU + %\HUV HG 6DQ )UDQFLVFR &$ 7KH 8QLYHUVLW\ RI &KLFDJR 3UHVVf 6XWFOLIIH 6 -LDQJ < + *DOLMDDUG 5 0DWVXXUD 7 )DQJ 3 .XERWD 7 &KULVWLDQ 6 / %UHVVOHU &DWWDQDFK % /HGEHWWHU + DQG %HDXGHW $ / f 7KH ($3 XELTXLWLQSURWHLQ OLJDVH 8%($f JHQH LV ORFDOL]HG ZLWKLQ D QDUURZHG $QJHOPDQ V\QGURPH FULWLFDO UHJLRQ *HQRPH 5HV 6XWFOLIIH 6 1DNDR 0 &KULVWLDQ 6 2UVWDYLN + 7RPPHUXS 1 /HGEHWWHU + DQG %HDXGHW $ / f 'HOHWLRQV RI D GLIIHUHQWLDOO\ PHWK\ODWHG &S* LVODQG DW WKH 61531 JHQH GHILQH D SXWDWLYH LPSULQWLQJ FRQWURO UHJLRQ 1DW *HQHW 6]DER 3 7DQJ 6 + 5HQWVHQGRUM $ 3IHLIHU 3 DQG 0DQQ 5 f 0DWHUQDOVSHFLILF IRRWSULQWV DW SXWDWLYH &7&) VLWHV LQ WKH + LPSULQWLQJ FRQWURO UHJLRQ JLYH HYLGHQFH IRU LQVXODWRU IXQFWLRQ &XUU %LRO 6]DER 3 ( DQG 0DQQ 5 f %LDOOHOLF H[SUHVVLRQ RI LPSULQWHG JHQHV LQ WKH PRXVH JHUP OLQH LPSOLFDWLRQV IRU HUDVXUH HVWDEOLVKPHQW DQG PHFKDQLVPV RI JHQRPLF LPSULQWLQJ *HQHV 'HY 6]DER 3 ( 3IHLIHU 3 DQG 0DQQ 5 f &KDUDFWHUL]DWLRQ RI QRYHO SDUHQW VSHFLILF HSLJHQHWLF PRGLILFDWLRQV XSVWUHDP RI WKH LPSULQWHG PRXVH + JHQH 0RO &HOO %LRO 7DGD 0 7DGD 7 /HIHEYUH / %DUWRQ 6 & DQG 6XUDQL 0 $ f (PEU\RQLF JHUP FHOOV LQGXFH HSLJHQHWLF UHSURJUDPPLQJ RI VRPDWLF QXFOHXV LQ K\EULG FHOOV (PER 7LOJKPDQ 6 0 f 7KH VLQV RI WKH IDWKHUV DQG PRWKHUV JHQRPLF LPSULQWLQJ LQ PDPPDOLDQ GHYHORSPHQW &HOO

PAGE 109

7RQN 9 6FKXOW] 5 $ &KULVWLDQ 6 / .XERWD 7 /HGEHWWHU + DQG :LOVRQ 1 f 5REHUWVRQLDQ TTf WUDQVORFDWLRQ LQ D FKLOG ZLWK $QJHOPDQ V\QGURPH HYLGHQFH RI XQLSDUHQWDO GLVRP\ $P 0HG *HQHW 7UHPEOD\ 6DDP 5 ,QJUDP 5 6 7LOJKPDQ 6 0 DQG %DUWRORPHL 0 6 f $ SDWHUQDOVSHFLILF PHWK\ODWLRQ LPSULQW PDUNV WKH DOOHOHV RI WKH PRXVH + JHQH 1DW *HQHW 7UHQW 5 6KHIILHOG / 'HQJ = 0 .LP : 6 1DVVLI 1 7 5\FH & :RRGV & 0LFKDHOLV 5 & 7DUOHWRQ DQG 6PLWK $ f 7KH HOXVLYH $QJHOPDQ V\QGURPH FULWLFDO UHJLRQ 0HG *HQHW 7VDL 7 ) $UPVWURQJ DQG %HDXGHW $ / Df 1HFGLQGHILFLHQW PLFH GR QRW VKRZ OHWKDOLW\ RU WKH REHVLW\ DQG LQIHUWLOLW\ RI 3UDGHU:LOOL V\QGURPH 1DW *HQHW 7VDL 7 ) -LDQJ < + %UHVVOHU $UPVWURQJ DQG %HDXGHW $ / Ef 3DWHUQDO GHOHWLRQ IURP 6QUSQ WR 8EHD LQ WKH PRXVH FDXVHV K\SRWRQLD JURZWK UHWDUGDWLRQ DQG SDUWLDO OHWKDOLW\ DQG SURYLGHV HYLGHQFH IRU D JHQH FRQWULEXWLQJ WR 3UDGHU:LOOL V\QGURPH )OXP 0RO *HQHW 7XUNHU 0 6 f 7KH HVWDEOLVKPHQW DQG PDLQWHQDQFH RI '1$ PHWK\ODWLRQ SDWWHUQV LQ PRXVH VRPDWLF FHOOV 6HPLQ &DQFHU %LRO 7\FNR % f (SLJHQHWLF JHQH VLOHQFLQJ LQ FDQFHU &OLQ ,QYHVW YDQ GHQ 2XZHODQG $ 0 %DNNHU 3 / +DOOH\ DQG &DWVPDQ%HUUHYRHWV & ( f $QJHOPDQ V\QGURPH $6 SKHQRW\SH FRUUHODWHG ZLWK VSHFLILF ((* SDWWHUQ PD\ UHVXOW LQ D KLJK GHWHFWLRQ UDWH RI PXWDWLRQV LQ WKH 8%($ JHQH 0HG *HQHW 9X 7 + DQG +RIIPDQ $ 5 f ,PSULQWLQJ RI WKH $QJHOPDQ V\QGURPH JHQH 8%($ LV UHVWULFWHG WR EUDLQ 1DW *HQHW :KLWH / 0 5RJDQ 3 1LFKROOV 5 :X % / .RUI % DQG .QROO + f $OOHOHVSHFLILF UHSOLFDWLRQ RI T T ORFL D GLDJQRVWLF WHVW IRU GHWHFWLRQ RI XQLSDUHQWDO GLVRP\ $P +XP *HQHW :LONLQVRQ f 8ELTXLWLQDWLRQ DQG GHXELTXLWLQDWLRQ WDUJHWLQJ RI SURWHLQV IRU GHJUDGDWLRQ E\ WKH SURWHDVRPH 6HPLQ &HOO 'HY %LRO :LOOLDPV & $ $QJHOPDQ + &OD\WRQ6PLWK 'ULVFROO +HQGULFNVRQ ( .QROO + 0DJHQLV 5 ( 6FKLQ]HO $ :DJVWDII :KLGGHQ ( 0 DQG =RUL 5 7 Df $QJHOPDQ V\QGURPH FRQVHQVXV IRU GLDJQRVWLF FULWHULD $QJHOPDQ 6\QGURPH )RXQGDWLRQ $P 0HG *HQHW :LOOLDPV & $ +HQGULFNVRQ ( &DQWX ( 6 DQG 'RQORQ 7 $ f $QJHOPDQ V\QGURPH LQ D GDXJKWHU ZLWK GHOf TTf DVVRFLDWHG ZLWK EUDFK\FHSKDO\ KHDULQJ ORVV HQODUJHG IRUDPHQ PDJQXP DQG DWD[LD LQ WKH PRWKHU $P 0HG *HQHW

PAGE 110

:LOOLDPV & $ /RVVLH $ & DQG 'ULVFROO f $QJHOPDQ 6\QGURPH *HQH&OLQLFVf :LOOLDPV & $ =RUL 5 7 +HQGULFNVRQ 6WDONHU + 0DUXP 7 :KLGGHQ ( DQG 'ULVFROO Ef $QJHOPDQ 6\QGURPH &XUUHQW 3UREOHPV LQ 3HGLDWULFV :XW] $ 6PU]ND 2 : DQG %DUORZ 3 f 0DNLQJ VHQVH RI LPSULQWLQJ WKH PRXVH DQG KXPDQ ,*)5 ORFL 1RYDUWLV )RXQG 6\PS
PAGE 111

%,2*5$3+,&$/ 6.(7&+ $P\ /RVVLH ZDV ERP RQ $XJXVW LQ .DODPD]RR 0LFKLJDQ *URZLQJ XS RQ 7KUHH 0LOH /DNH LQ QHDUE\ 3DZ 3DZ $P\fV HDUO\ FKLOGKRRG ZDV VSHQW HQMR\LQJ WKH RXWGRRUV ZKHUH VKH GHYHORSHG DQ LQWHQVH FXULRVLW\ RI QDWXUH DQG ORYH RI ZDWHU ,Q KLJK VFKRRO $P\ ZDV GLDJQRVHG ZLWK D UDUH ELUWK GHIHFW 7KLV ZDV D PDMRU WXUQLQJ SRLQW LQ $P\fV OLIH /XFNLO\ KHU IULHQGV DQG IDPLO\ ZHUH FRPSOHWHO\ VXSSRUWLYH RI KHU GXULQJ WKLV KDUG WLPH 6KH UHOLHG KHDYLO\ RQ KHU EHVW IULHQG $QG\ *ORPVNL ZKR KDV WR WKLV GD\ UHPDLQHG KHU VWDXQFK DOO\ 'XULQJ KHU H[WHQVLYH KRVSLWDO VWD\ $P\ ZDV H[SRVHG WR PHGLFDO UHVHDUFK IRU WKH ILUVW WLPH DQG VKH GHYHORSHG DQ LQWHQVH GHVLUH WR OHDUQ ZKDW FDXVHG KHU ELUWK GHIHFW $P\ HQWHUHG 7KH 8QLYHUVLW\ RI 0LFKLJDQ LQ 6KH OLYHG D IXOO OLIH LQ FROOHJH ,Q DGGLWLRQ WR KHU VWXGLHV LQ FHOOXODU DQG PROHFXODU ELRORJ\ VKH IRXQG SOHQW\ RI WLPH WR KDYH IXQ 6KH VSHQW IRRWEDOO 6DWXUGD\V DW WKH %LJ +RXVH FKHHULQJ RQ WKH :ROYHULQHV DQG IRXQG D MRE ZRUNLQJ LQ D PROHFXODU SKDUPDFRORJ\ ODE $P\ UHDOL]HG WKDW VKH ORYHG WKH EHQFK PRUH WKDQ ERRNV $ORQJ ZLWK KHU ODE PDWH -RDQ 7D\ORU $P\ VSHQW PDQ\ HYHQLQJV DQG ZHHNHQGV ILQLVKLQJ H[SHULPHQWV 7KH IULHQGV VKH PDGH GXULQJ WKLV WLPH LQ KHU OLIH JUHDWO\ LQIOXHQFHG KHU FDUHHU FKRLFHV 7KURXJK H[DPSOH -RDQ VKRZHG $P\ WKDW VKH FRXOG IROORZ KHU GUHDP DQG EHFRPH DQ DFDGHPLF VFLHQWLVW $IWHU JUDGXDWLQJ ZLWK D %6 LQ $P\ OHIW SKDUPDFRORJ\ DQG HQWHUHG WKH ILHOG RI JHQHWLFV :RUNLQJ ZLWK 'U 6DOO\ &DPSHU $P\ OHDUQHG WKH IXQGDPHQWDOV RI *HQHWLFV UHVHDUFK 6KH ZRUNHG KDUG DQG HDUQHG WKH UHVSHFW RI 'U &DPSHU ZKR JDYH $P\ WKH

PAGE 112

RSSRUWXQLW\ WR GHVLJQ KHU RZQ H[SHULPHQWV DQG ZULWH KHU RZQ SDSHUV ,Q 6DOO\fV ODE $P\ OHDUQHG WKDW LW WRRN EORRG VZHDW DQG WRWDO GHYRWLRQ WR EH D VXFFHVVIXO JUDGXDWH VWXGHQW ,Q WKH VXPPHU RI $P\ HQWHUHG 'U 'DQ 'ULVFROOfV ODERUDWRU\ DV D JUDGXDWH VWXGHQW LQ WKH &HQWHU IRU 0DPPDOLDQ *HQHWLFV 6KH KDV VSHQW WKH SDVW ILYH DQG D KDOI \HDUV UHVHDUFKLQJ JHQRPLF LPSULQWLQJ LQ WKH $QJHOPDQ V\QGURPH $P\ JUHZ VFLHQWLILFDOO\ XQGHU WKH GLUHFWLRQ RI 'U 'ULVFROO ZKR ZDV KHU PHQWRU LQ HYHU\ PHDQLQJ RI WKH ZRUG 'U 'ULVFROO IXQQHOHG YDOXDEOH UHVRXUFHV LQWR $P\fV UHVHDUFK HQDEOLQJ KHU WR VXFFHVVIXOO\ FRPSOHWH KHU VWXGLHV $P\ ZLOO QHYHU IRUJHW WKDW GHYRWLRQ $P\ LQWHQGV WR HDUQ KHU 3K IURP WKH 8QLYHUVLW\ RI )ORULGD LQ WKH IDOO RI 8SRQ FRPSOHWLRQ RI KHU GLVVHUWDWLRQ $P\ ZLOO FRQWLQXH KHU VFLHQWLILF WUDLQLQJ LQ WKH ODERUDWRU\ RI 'U 0RQLFD -XVWLFH DW %D\ORU &ROOHJH RI 0HGLFLQH $P\ SODQV WR VWXG\ GHYHORSPHQWDO JHQHWLFV XVLQJ WKH PRXVH DV D PRGHO V\VWHP +HU UHVHDUFK ZLOO IRFXV RQ FKDUDFWHUL]DWLRQ RI RQH PXWDWLRQ RI DQ DOOHOH VHULHV RI 2G] 7KLV LQWHUHVWLQJ PXWDWLRQ PD\ DOVR EH VXEMHFW WR JHQRPLF LPSULQWLQJ $P\ LQWHQGV WR XVH KHU NQRZOHGJH RI LPSULQWLQJ WR IXUWKHU WKH XQGHUVWDQGLQJ RI 2G] LQ WKH PRXVH +HU ORQJ WHUP JRDOV DUH WR GHYHORS D VWURQJ DFDGHPLF UHVHDUFK ODERUDWRU\ LQ KXPDQ DQG PRXVH JHQHWLFV ZKHUH VKH ZLOO HGXFDWH DQG WUDLQ \RXQJ VFLHQWLVWV

PAGE 113

L FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DUMGMV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RIA%RHWR. RI 3KLORVRSK\ ; 'DQLHO 'ULVFROO &KDLU $VVRFLDWH 3URIHVVRU RI 3HGLDWULF *HQHWLFV FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ &DPLO\QQ %UDQQDQ $VVLVWDQW 3URIHVVRU RI 0ROHFXODU *HQHWLFV DQG 0LFURELRORJ\ FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ 0DUJDUHW )& :DOODFH $VVRFLDWH 3URIHVVRU RI %LRFKHPLVWU\ DQG 0ROHFXODU %LRORJ\ FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWRU RI SKLORVRSK\ 7KRPDV 3

xml version 1.0 encoding UTF-8
REPORT xmlns http:www.fcla.edudlsmddaitss xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.fcla.edudlsmddaitssdaitssReport.xsd
INGEST IEID EOTHBN3JI_DEB7A9 INGEST_TIME 2014-08-12T21:05:37Z PACKAGE AA00024833_00001
AGREEMENT_INFO ACCOUNT UF PROJECT UFDC
FILES


MOLECULAR GENETICS OF THE ANGELMAN SYNDROME
By
AMY C. LOSSIE
A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY
UNIVERSITY OF FLORIDA
2000

This dissertation is dedicated to
C. Andrew Glomski
for his unending belief, encouragement and support

ACKNOWLEDGEMENTS
I would first like to thank my parents and grandparents for their never-ending
encouragement and support, for never accepting mediocrity and for providing me with
excellent examples of hard work and dedication. It truly took a village to raise me. I
credit Andy’s family for believing in me and understanding when I took away their son
and brother. I am grateful to both of our families for quietly supporting us. Your
generosity touched my heart many times.
With the utmost esteem and gratitude, I thank my mentor, Daniel J. Driscoll,
who always said "yes” when I asked, at 6:30 PM, if he "had a minute.” I owe many of
my scientific associations to Dan, who entrusted me to interact and forge valuable
collaborations with prominent scientists around the world. In addition, Dan provided
me with abundant resources, plenty of bench space and several undergraduate
students to help with my work.
I especially want to acknowledge the Angelman patients and their families who
have given so much of themselves Tor research. I thank my advocate, Peggy Wallace,
who has helped me to become a human geneticist. In addition, I appreciated Cami
Brannan’s advice on my research and my transition back to mouse genetics. I am also
grateful to Tom Yang who has given me a "good challenge” now and then. I wish to
thank Michelle Whitney for always listening, and Fatih Boyar for giving me a different
perspective. I am grateful for Sue and Rodney who made my first year memorable. In
addition, I am grateful for the help and advice from the other graduate students, post¬
docs and undergraduate students who have passed through the lab.
iii

TABLE OF CONTENTS
ACKNOWLEDGEMENTS Ill
ABSTRACT OF DISSERTATION PRESENTED TO THE GRADUATE SCHOOL VII
INTRODUCTION 1
Genomic Imprinting Is an Epigenetic Phenomenon 1
Genomic Imprinting and Beckwith-Wiedemann Syndrome 3
Clinical Features of Beckwith-Wiedemann Syndrome 3
Imprinted Genes in BWS 3
Imprinting Mechanisms of Igf2 and H19 4
The Angelman and Prader-Willi Syndromes 4
Clinical Features of AS and PWS 5
Molecular Mechanisms of AS and PWS 6
Genes Involved in AS and PWS 6
Mouse Models of PWS 7
Mouse Models of AS 9
DNA Methylation: An Epigenetic Mark 10
Structure and Function of the AS/PWS Imprinting Center 10
UBE3A and the Ubiquitination Pathway 12
^-TRANSMISSION OF ANGELMAN SYNDROME BY AN AFFECTED MOTHER 21
Introduction 21
Methods 22
Subjects 22
Microsatellite Analysis 23
DNA Methylation Analyses 23
RT-PCR 24
Results 24
Genetic Analysis 24
DNA Methylation Analyses 25
Gene Expression 26
iv

Discussion
26
MOLECULAR ANALYSES AND GENOTYPE-PHENOTYPE-CORRELATIONS AMONG THE FIVE
CLASSES OF ANGELMAN SYNDROME 34
Introduction 34
Materials and Methods 36
Patient Repository 36
Southern Analysis 37
BESS T-Scan 38
Sequence Analysis 38
Primers 38
Statistical Analyses 39
Results 40
—Molecular Classes of Angelman Syndrome 40
Mutation Analysis 41
DNA Methylation of 5’ UBE3A 41
Summary of all Published UBE3A Mutations 42
Genotype-Phenotype Correlations 42
Discussion 45
Mutations in UBE3A 45
Genotype-Phenotype Correlations 50
DNA METHYLATION AND EXPRESSION ANALYSES OF UBE3A IN THE HU/VAN BRAIN 59
Introduction 59
Materials and Methods 61
Human Subjects and Tissue Samples 61
RNA Isolation 61
RT-PCR 62
DNA Methylation 63
Results 64
UBE3A Does Not Demonstrate a DNA Methylation Imprint 64
Expression Analysis of UBE3A and the Antisense Transcript in the Brain 64
Discussion 65
CONCLUSIONS AND DISCUSSION 71
Molecular Classes of AS 72
Class I Patients 73
Class II Patients 73
Class III Patients 74
Class IV Patients 75
Class V Patients 75
v

Genotype-phenotype Correlations among the Five Classes of AS 76
What is the Epigenetic "Mark?” 78
DNA Methylation 79
C/'s-acting Elements 80
Chromatin Structure 80
DNA Replication Timing 81
Models for Imprinted Expression 82
Future Directions 85
REFERENCES 87
BIOGRAPHICAL SKETCH 103
vi

Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy
MOLECULAR GENETICS OF THE ANGELMAN SYNDROME
By
Amy C. Lossie
December, 2000
Chair: Daniel J. Driscoll, Ph.D., M.D.
Major Department: Molecular Genetics and Microbiology
Genomic imprinting is a parent-of-origin epigenetic phenomenon that is
intimately involved in development, cancer and several genetic disorders, including
Angelman syndrome (AS). AS is a severe neurobehavioral disorder characterized by
four cardinal features: 1) severe developmental delay; 2) profound speech
impairment; 3) a characteristic movement disorder; and 4) an AS-specific behavior,
which includes an inappropriately happy affect. My studies revealed that AS is caused
by 5 molecular mechanisms: Class I) 4 Mb deletions; Class II) paternal UPD; Class III)
imprinting defects; Class IV) intragenic mutations in UBE3A, the E3 ubiquitin protein
ligase 3A gene; and Class V) no known defects. Our statistical models demonstrated
that several significant phenotypic differences occur among the five molecular classes.
Patients can be separated into four phenotypic groups: Class I, Classes II and III, Class
IV, and Class V. Class I patients are the most severely affected, while Classes II and III
vii

are the least. Class I patients comprise a contiguous gene disorder, with
haploinsufficiency of multiple genes exacerbating the lack of the maternal UBE3A
gene. Multiple clinical distinctions can be made between the classes, with differences
most striking in pigmentation; growth parameters; achievement of developmental
milestones; and severity, frequency and age at onset of seizures.
Initial experiments showed that imprinted expression of UBE3A was limited to
the brain in humans, and revealed the presence of a brain-specific antisense transcript
that overlapped the 3’ end of UBE3A. In our studies, RT-PCR analyses of UBE3A and its
antisense transcript demonstrated discordant imprinted expression of the two genes in
several regions of the human brain. UBE3A was preferentially expressed from the
maternal allele, while the antisense transcript was preferentially expressed from the
paternal allele. In addition, DNA methylation analysis revealed that 5’ UBE3A does not
demonstrate a DNA methylation imprint. All tissues, even those that demonstrated
imprinted expression of UBE3A, are unmethylated in the promoter region of the gene.
The lack of a DNA methylation imprint at UBE3A and the observation of discordant
imprinted expression of the two genes support a role for the antisense transcript in
the regulation of imprinted expression of UBE3A.
viii

INTRODUCTION
Genomic Imprinting Is an Epigenetic Phenomenon
Epigenetic phenomena are implicated in several diseases, cancer, X
chromosome inactivation and genomic imprinting. In addition, epigenetic events such
as DNA methylation and histone acetylation play major roles in the regulation of gene
expression. Epigenetic effects occur when the primary genetic material is heritably
altered in somatic and/or germ cells, causing changes in expression, without the
creation of a mutational event in the DNA.
One of the most familiar epigenetic processes is genomic imprinting, which
occurs when one allele of an imprinted gene is transcriptionally activated or silenced
in a parent-of-origin dependent manner. The parental origin of the allele determines
whether an imprinted gene will be expressed; some imprinted genes are only
expressed from the paternal allele, while others are expressed exclusively from the
maternal copy.
Two of the most extreme examples of genomic imprinting are the complete
hydatidiform mole and ovarian teratoma (Kajii et al., 1984; Ohama et al., 1981;
Ohama et al., 1985). Hydatidaform moles occur when an anuclear egg is fertilized by
either one or two haploid sperm, with duplication of the entire haploid genome
occurring when a single sperm fertilizes the egg. Hydatidaform moles, which are
completely androgenetic (Ag), give rise to hyperplastic extraembryonic growth with
little or no fetal development. In situ activation and duplication of the maternal DNA
1

2
of an unfertilized oocyte produces an ovarian teratoma, which is completely
parthenogenetic (Pg), having two complete copies of the maternal genome. Although
ovarian teratomas have very little extraembryonic development, they can develop into
a disorganized but well-differentiated tumor that often reveals remnants of
mesenchymal and endodermal structures.
Elegant experiments in the 1980s revealed the consequences of uniparental
mammalian development in the mouse. Pronuclear transfer experiments showed that
androgenetic and parthenogenetic embryos failed to develop to term (Barton et al.,
1984; McGrath and Solter, 1984). These mice closely resembled their human
counterparts, complete hydatidaform moles and ovarian teratomas, and demonstrated
that the paternal germ line was required for differentiation of extraembryonic tissues,
while the maternal genome was necessary for embryonic development.
Subsequent examination of mice with uniparental disomy (UPD) for various
chromosomal regions revealed the presence of 10 imprinted domains on seven mouse
chromosomes: 2, 6, 7, 11, 12, 17 and the X (John and Surani, 1996). In humans, UPD
of chromosomes 2, 7, 11, 14, 15, 16, and 20 has also been shown to cause aberrant
phenotypes (Ledbetter and Engel, 1995). To date, over 35 imprinted genes and 21
imprinted syndromes have been identified in human and mouse (Falls et al., 1999;
Nicholls, 2000). These genes are involved in fetal and placental growth, cell
proliferation and neurobehavior. Two large clusters of imprinted genes reside on
human chromosomes 11 p15.5 and 15q 11-13. Genes in the Beckwith-Wiedemann
syndrome region on 11 p15.5 have been shown to be involved in fetal growth and cell
proliferation, while the Angelman/Prader-Willi syndrome (AS/PWS) region on 15q11 -13
contains imprinted genes that influence neurobehavior. A review of these two systems
follows.

3
Genomic Imprinting and Beckwith-Wiedemann Syndrome
Clinical Features of Beckwith-Wiedemann Syndrome
Beckwith-Wiedemann syndrome (BWS) is a multi-faceted genetic disorder
characterized by fetal and neonatal overgrowth, macroglossia and abdominal wall
defects. Additional common features include hemihypertrophy, genitourinary
abnormalities, organomegaly and Wilm’s tumor (Maher and Reik, 2000). Three major
types of BWS patients have been identified: patients with chromosome anomalies,
sporadic cases or familial inheritance. The finding of a significant percentage of
sporadic patients with partial paternal UPD for chromosome 11 p and the presence of
duplications, inversions and breakpoints of balanced translocations have localized the
genes for BWS to 11 p15.5 (Maher and Reik, 2000). Ten imprinted genes have been
mapped to this region, which is flanked by non-imprinted genes, and at least two
genes within the cluster demonstrate biallelic expression, subdividing the cluster into
two imprinted domains (Figure 1-1).
Imprinted Genes in BWS
The CDKN1C, KvLQTI, IGF2 and H19 genes from 11 p15.5 have been the most
studied, and it appears that both pf these groups of imprinted genes are involved in
the pathogenesis of BWS. Recent experiments suggest that these two regions are
under the control of two distinct imprinting centers (Lee et al., 1999b; Reik et al.,
1995; Smilinich et al., 1999). The majority of sporadic BWS patients show loss of
imprinting (LOI) at IGF2, identified by the activation of both parental alleles (Maher
and Reik, 2000). Two mechanisms are associated with LOI at IGF2. In the first, LOI at
IGF2 was accompanied by a change in the epigenotype of H19, which silenced the
maternal H19 allele (Reik et al., 1995). In the second, the H19 epigenotype was

4
normal, but the DNA methylation imprint on the maternal allele of KvLQTI became
unmethylated, inducing expression of the KvLQTI antisense transcript, LIT1 (Brown et
al., 1996; Smilinich et al., 1999). Therefore, these observations show that disruption
of the epigenotype at either Hi9 or KvLQTI can cause LOI of IGF2 in patients with
BWS.
Imprinting Mechanisms of Igf2 and H19
An elegant series of experiments by several groups has helped to tease out the
important elements of imprinted expression of Igf2 and H19 in the mouse (reviewed in
Brannan and Bartolomei, 1999). Subsequent experiments have revealed the
mechanism of imprinted expression of these two genes (Figure 1-2; Bell and
Felsenfeld, 2000; Drewell et al., 2000; Flark et al., 2000; Ishihara et al., 2000; Szabo
et al., 2000). These latter experiments revealed that the differentially methylated
region located at 5’ H19 was a boundary element that when unmethylated, bound a
repressor protein, preventing the /g/2 gene from being activated by upstream
enhancers.
The identification of the mechanism for imprinted expression of Igf2/H19 is a
first for imprinted genes. It will be interesting to discover how mutations in upstream
genes can also disrupt imprinting óf Igf2. Perhaps there are two levels of control in
this region: local and regional, with long-range interactions occurring between KvLQTI
and IGF2. It will also be interesting to determine what phenotypic effects other
imprinted genes in this region have on subsets of BWS patients.
The Angelman and Prader-Willi Syndromes
Research over the last five years has yielded many clues as to the factors
necessary for genomic imprinting of the Angelman (AS) and Prader-Willi (PWS)

5
syndromes. Novel imprinted genes have been identified on 15q11-13, mutations in the
E6 ubiquitin protein-ligase gene, UBE3A, were found in several patients with AS, new
methods of transmission of AS and PWS were identified, and studies of patients with
imprinting defects revealed that the imprinting center consisted of separate AS and
PWS components. In addition, multiple mouse models of AS and PWS were created
and null mutations of several imprinted genes were generated in the mouse.
Clinical Features of AS and PWS
The Angelman and Prader-Willi syndromes delineate the second major cluster
of imprinted genes in the human. Although both syndromes are associated with 4 Mb
interstitial deletions of chromosome 15q11-13, AS and PWS are very different clinical
neurobehavioral disorders. AS is characterized by severe mental retardation, profound
speech impairment, a movement and balance disorder and an AS-specific behavior
which includes an inappropriately happy affect interspersed with paroxysms of
laughter (Williams et al., 1995a; Williams et al., 2000). In stark contrast, PWS is
initially characterized by neonatal hypotonia and failure to thrive. However at 18 to
36 months of age, patients become hyperphagic, eventually leading to morbid obesity.
They also have mild mental retardation, hypogonadism, small hands and feet and a
characteristic behavior which iricludes lethargy, aggressiveness and obsessive-
compulsive disorder (Holm et al., 1993).
The differential phenotype depends upon the parental transmission of the
15q11-13 defect with normal development requiring biparental genetic contribution of
I
15q 11-13., [AS is caused by a lack of maternal contribution, while lack of paternal
contribution from 15q11-13 results in PWS.

6
Molecular Mechanisms of AS and PWS
The genetics of the AS and PWS syndromes are very complex; multiple different
chromosome 15 defects occur in these two distinct syndromes (Figure 1-3). Loss or
inactivation of at least one 15q11-13 gene occurs in both the AS and PWS syndromes,
with maternal deficiencies giving rise to AS children and paternal deficits causing PWS
(Figure 1-3). Five major molecular classes of AS patients have been identified: I) 4 Mb
maternal deletions of 15q11-13; II) paternal uniparental disomies (UPD); III) imprinting
defects (ID); IV) patients with mutations in a single gene, UBE3A and V) patients with
no known defects. Prader-Willi patients have been identified who belong in the first
three classes: paternal deletions of 15q11-13, maternal UPDs and ID. No single gene
mutations have been found in PWS patients, suggesting that PWS is part of a
contiguous gene syndrome with inactivation of at least two genes necessary for the
full phenotype to develop.
Genes Involved in AS and PWS
This past year has been exciting in the AS/PWS field. Nine novel imprinted
genes and transcripts were localized to the 15q11 -13 imprinted domain (Boccaccio et
al., 1999; Farber et al., 2000; Lee et al., 2000; Lee and Wevrick, 2000), with 18
paternally expressed transcripts having been mapped to the AS/PWS imprinted domain
to date: cen-MKRN3, MKRN3-AS, W1-15987, NDN, MAGEL2, 1C transcript, SNURF-
SNRPN, PAR5, W1-15028, W1-13791, IPW, PAR1, stSG12920, stSG3346/stsN21972,
BCD1279, A005C48 and UBE3A-AS-te[. Although no sequence mutations have been
found in any of these genes in PWS patients, expression studies indicate that PWS
patients do not express MKRN3, MKRN3-AS, W1 -15987, NDN, MAGEL2, 1C transcript,
SNURF-SNRPN, PAR5, W1-15028, W1 -13791, PAR1, stSG12920, stSG3346/stsN21972, or
A005C48 in lymphoblasts, skin fibroblasts or human brain (Figure 1-4A, B).

7
Interestingly, IPW demonstrates imprinted expression in lymphoblast and skin
fibroblast cell lines, but biallelic expression in human brain. All of these genes and
transcripts could potentially be involved in the etiology of PWS.
Only one gene in the AS/PWS imprinted domain, UBE3A, demonstrates a
maternal-only expression imprint (Rougeulle et al., 1997; Vu and Hoffman, 1997).
However, unlike most of the paternally expressed 15q11-13 genes, imprinted
expression of UBE3A is restricted to brain (Figure 1-4A, B). Mouse studies revealed
that tissue-specific imprinted expression of Ube3a was restricted to the Purkinje cells
of the cerebellum, the CA2 and CA3 regions of the hippocampus and the mitral cell
layer of the olfactory bulb (Albrecht et al., 1997; Sutcliffe et al., 1996). In the
human, much less is known about the tissue specificity of imprinted expression of
UBE3A. All studies in the adult have relied on RT-PCR analysis from a single frontal
cortex sample, and have shown that UBE3A imprinted expression varies within this
tissue (Lee and Wevrick, 2000; Rougeulle et al., 1997). Research on human fetal brain
demonstrated biased expression, but could not determine if the preferentially
expressed allele was maternal or paternal in origin (Vu and Hoffman, 1997).
Mouse Models of PWS
Mouse models of all the‘molecular classes of PWS (deletions, UPD and
imprinting defects) have been created. Two mouse models have been generated with
large 7C deletions. One deletion, which occurred serendipitously by insertional
mutagenesis, resulted in a mouse with a transgene-induced deletion of the entire
orthologous region (Gabriel et al., 1999). When the TgPWS/AS Was passed through the
paternal germline, transgenic progeny showed neonatal lethality, and failed to express
several PWS candidate genes, including Snurf, Snrpn and Ndn. The second deletion
model was caused by a targeted disruption that extended from exon 2 of Snurf/Snrpn

8
to exon 8 of Ube3a (Tsai et al., 1999b). Paternal transmission of this deletion resulted
in a less severe phenotype than the previous model; 50% of neonates survived past 12
days, and 20% survived past weaning. Although smaller than their wild type
littermates, surviving deletion mice (male and female) were fertile, unlike most
individuals with PWS.
A mouse model of PWS patients with UPD has also been generated. These
mice, which had maternal UPD for mouse chromosome 7C, were the first murine
model to recapitulate features of PWS (Cattanach et al., 1992). Similar to infants with
PWS, these mice exhibited severe failure-to-thrive. Untreated, the mice died within
seven days of birth. Expression analysis revealed a complete absence of Snrpn in
these mice.
Targeted disruption of the PWS imprinting center (PWS-IC) has produced a
mouse model of imprinting defects (ID; Yang et al., 1998). Paternal inheritance of this
42 kb IC deletion resulted in a mouse with a phenotype characterized by neonatal
lethality and lack of expression of several paternal-only expressed genes within
chromosome 7C. This important mouse model demonstrated that the PWS-IC was
functionally conserved between mouse and human and provided a valuable model to
study the mechanisms of imprinting in the mouse.
In addition, several studies have reported on the effects of disruption of three
paternal-only expressed genes within 7C. An intragenic deletion of Snrpn (Yang et al.,
1998) or a disruption of exon 2 of Snurf (Tsai et al., 1999b) produced normal mice,
indicating that disruption of either Snurf or Snrpn was not sufficient to cause features
of PWS. Targeted deletion of Ndn has resulted in two different outcomes. In one
study, mice homozygous for a null mutation in Ndn were fully viable and did not
develop any features common to PWS, including hypogonadism, infertility or obesity

9
(Tsai et al., 1999a). However in a second study, mice that inherited a mutated Ndn
allele on the paternally inherited chromosome demonstrated early post-natal lethality
(Gerard et al., 1999). These authors believe that the genetic background influenced
the lethal phenotype.
Mouse Models of AS
To date, four mouse models of three Classes of AS (deletions, UPD and Ube3a
mutations) have been created. In addition, an alternative AS model was also created
from mice deficient in GABAÍÍ3. A deletion mouse was generated by maternal
transmission of the jgPW5/AS(del> transgenic mouse (Gabriel et al., 1999). Initial
experiments revealed that this mouse model demonstrated imprinted expression of
Ube3a in the cerebellum. A second deletion mouse has also been identified (Johnson
et al., 1995). This mouse model exhibited a radiation-induced deletion that extended
from Ube3a to the p locus. Mice with paternal UPD for mouse chromosome 7C
demonstrated AS-like features including an ataxic gait, EEG abnormalities, reduced
brain weight and late onset obesity (Cattanach et al., 1997). Targeted disruption of
the maternal allele of Ube3a resulted in mice that were very similar to the UPD
model, with poor motor skills, inducible seizures and context-dependent learning
problems (Jiang et al., 1998). Mite homozygous for a null mutation in GABAE>3 also
displayed several features of AS (DeLorey et al., 1998), although heterozygotes were
not statistically different from wild type littermates. These mice had several features
common to individuals with AS including: abnormal EEG patterns, seizures, learning
and memory deficits, poor motor skills, hyperactivity and a disturbed rest-activity
cycle.

10
DNA Methylation: An Epigenetic Mark
DNA methylation analysis, first proposed by Driscoll and colleagues (1992), is
now widely used by researchers and diagnostic laboratories to detect parental
contributions based on the differential DNA methylation imprints associated with
imprinted genes. Several sites in 15q11-13 including the MKRN3 locus (Driscoll et al.,
1992), NDN (Jay et al., 1997), intron 7 of SNRPN (Glenn et al., 1993b) and the CpG
island of 5’ SNRPN (Glenn et al., 1996; Kubota et al., 1996b; Sutcliffe et al., 1994)
display parent-specific DNA methylation imprints in peripheral blood leukocytes and
other tissues (Figure 1-4).
These imprints have been utilized to reliably diagnose AS and PWS patients who
have deletions, UPD and ID (Clayton-Smith et al., 1993; Driscoll et al., 1992; Glenn et
al., 1993a; Glenn et al., 1996). DNA methylation analysis of AS and PWS patients has
led to the discovery of patients with defects in the imprinting process (ID). ID patients
have biparental inheritance of chromosome 15 with no evidence of the common 4 Mb
interstitial deletion, but still show uniparental DNA methylation imprints at loci
extending over a 2 Mb region of 15q11-13 (Glenn et al., 1993a). About 50% of all AS
and PWS patients with imprinting defects have microdeletions within the imprinting
center (IC), which is located at the 5’ end of SNRPN on 15q 11-13 (Nicholls et al.,
1998). The remaining ID patients have no detectable mutations, and are thought to
have defects in the process of erasing and/or resetting the epigenotype in the germ
line or somatic tissues (Buiting et al., 1998).
Structure and Function of the AS/PWS Imprinting Center
During each generation, the parental epigenetic mark must be erased in the
germ line and reset according to the sex of the offspring, ensuring that each
successive generation will receive the correct parental imprint in germ cells and

11
somatic tissue. Mistakes in the imprinting process would be detrimental, causing
disease in subsequent generations based upon parental inheritance (Figure 1-5).
Imprinting defects are responsible for 3-5% of all AS and PWS patients and disable the
epigenetic switch from male to female or female to male, respectively. These
deletions range from 6 to 200 kb and can regulate DNA methylation and expression
imprints of genes located at least 1 Mb from the IC.
The identification AS and PWS individuals with imprinting defects launched a
new field of research in an attempt to further understand the mechanisms of
imprinted expression within 15q11-13 (Glenn et al., 1993a; Reis et al., 1994).
Delineation of the deletion breakpoints in several ID patients localized the critical
region for the IC to the promoter proximal region of SNRPN (Figure 1-4A; Buiting et al.,
1995; Saitoh et al., 1997; Saitoh et al., 1996). The IC extends 150 kb centromeric to
the SNRPN gene and encodes a transcript that contains alternatively spliced upstream
exons of SNRPN (Dittrich et al., 1996). Although the IC transcript is not abundantly
expressed, it demonstrates tissue-specific paternal-only expression, and is thought to
be involved in the establishment of imprinted expression along 15q11-13.
Analysis of Class III AS and PWS individuals with deletions in the IC revealed
that the imprinting center functions as a bipartite structure. Characterization of
these deletion breakpoints narrowed the smallest region of deletion overlap (SRO) for
the AS and PWS regions of the imprinting center (Figure 1-4A) to 0.9 and 4.3 kb,
respectively (Buiting et al., 1999). All AS patients with IC mutations delete exon 5 of
the IC transcript, while all PWS patients with IC mutations have deletions that extend
into exon 1 of SNRPN.

12
UBE3A and the Ubiquitination Pathway
The involvement of UBE3A in the etiology of AS is now very well documented.
Several laboratories have demonstrated protein truncating mutations of UBE3A in
multiple AS patients (Baumer et al., 1999; Fang et al., 1999; Fung et al., 1998; Kishino
et al., 1997; Lossie et al., 1998; Malzac et al., 1998; Matsuura et al., 1997; Minassian
et al., 1998; Monda et al., 1999a; Russo et al., 2000; van den Ouweland et al., 1999).
Furthermore, maternal transmission of a targeted disruption of Ube3a resulted in a
mouse that displayed several features of AS including motor dysfunction, inducible
seizures and learning deficits (Jiang et al., 1998).
The ubiquitin pathway is a very important cellular process, controlling the
degradation of almost every type of protein, including regulators of the cell cycle,
transcription factors, tumor suppressors and DNA repair enzymes (Ciechanover et al.,
2000). In addition, ubiquitination is involved in the etiology of several diseases.
Angelman syndrome, caused by lack of the E3 ubiquitin protein ligase gene, was the
first human disease attributed to mutations in the ubiquitination pathway. Other
diseases now ascribed to defects in ubiquitination include Liddle’s syndrome, a severe
form of familial hypertension and several specific cancers. In addition, evidence
suggests that the ubiquitinatioñ pathway is involved in the pathogenesis of
Spinocerebellar Ataxia type-1, DiGeorge Syndrome and Cystic Fibrosis as well as late
onset Alzheimer’s, Parkinson’s and Huntington diseases.
The process of protein ubiquitination is complex, specific and rapid. Multiple
genes, which utilize different ubiquitin pathways, give the system its specificity and
complexity (Ciechanover et al., 2000). The E3 enzymes, which are the most diverse,
consist of at least six different families; each family processes proteins in slightly
different ways. The gene responsible for Angelman syndrome, UBE3A, is involved in

13
the transfer of an activated ubiquitin molecule to the protein substrate. UBE3A is the
founding member of the HECT-domain (homologous to E6AP carboxyl terminus) family
of E3 ligases. These proteins act as intermediaries between the E2 ubiquitin
conjugating enzymes and the targeted substrate. This suggests that accumulation of a
specific protein in certain regions of the brain is the main cause of the AS phenotype.
However, patients with AS do not demonstrate a phenotype consistent other protein
storage disorders.
UBE3A is involved in the transfer of ubiquitin moieties to proteins targeted for
degradation via the 26S proteosome. It was cloned in 1993 by its ability, in
conjunction with the E6 oncoprotein of the cancer-associated human papillomaviruses
(HPV), to deactivate the p53 tumor-suppressor protein (Huibregtse et al., 1993a). In
HPV16 infected cells, the E6/UBE3A protein complex selectively bound p53 and
targeted it for degradation via the ubiquitination pathway. Three functional domains
of UBE3A have been identified: an E6 protein binding site, a p53 binding site and a
HECT domain, which is necessary for ubiquitination (Huibregtse et al., 1993b).
Protein ubiquitination via the HECT family of protein ligases requires the
combined efforts of multiple enzymes (Figure 1-6; Ciechanover et al., 2000). E1
activates the ubiquitin moiety, which then attaches to an E2 enzyme via a high-energy
thioester bond. The E2 enzyme interacts with one HECT domain family member,
transferring the ubiquitin molecule to the E3. The complex containing ubiquitin, as
well as the E2 and E3 enzymes then follows one of two known paths. In the first
pathway, the protein substrate binds the complex, and a single ubiquitin moiety is
attached. In the alternative pathway, the complex requires the interaction of an
ancillary protein, such as p53, for target recognition. With the help of the E4 enzyme,

14
the ubiquitin chains polymerize, targeting the proteins for degradation via the 26S
proteosome (Koegl et al., 1999).
The following chapters describe my work on the molecular genetics and
pathogenetic mechanisms of Angelman syndrome.

NAP2 IMPT1 KvLQT1/LIT1
M
TAPA1 ASCL2
TSSC6
Figure 1-1. Imprinted genes on 11p15.5. This map illustrates the
genes (top) that map to the Beckwith-Wiedemann syndrome region on
human chromosome 11, with the imprinting status of the human genes
depicted. The maternal (M) and paternal (P) alleles as well as expres¬
sion profiles of biallelic ( â–¡), maternal (â–¡ ) and paternal(H) genes
are indicated. Arrows indicate location of transcription start site and
direction of transcription. Figure not drawn to scale.

Figure 1-2. Genomic imprinting of H19 and Igf2 in the mouse. The
Igf2 and H19 genes are shown. The differentially methylated region
(DMR) of H19 is located 5’ to the transcriptional start site. On the
maternal chromosome (Mat), the DMR is unmethylated (white
lollipops), which facilitates binding of the CTCF protein. This interac¬
tion allows the enhancers (E) to interact with H19, but prohibits inter¬
actions between the enhancers and the Igf2 promoter. On the pater¬
nal chromosome (Pat), the DMR is methylated. CTCF cannot bind, and
the enhancers preferentially interact with the promoter of Igf2,
inducing expression.

17
I
P M
H
68%
P M
\\
II III IV V
P P P M(P) PM PM
n u H n
70%
Deletion UPD
\
f
/
V
7%
3%
117
11%
M M P(M) P PM PM
M
â–  ,
1
M
, .
M
>
f
/
\
257
0
5%
0%
0%
ID Sgi Gene Unknown
Figure 1-3. Molecular classes of AS and PWS in the UF repository. A
total 93 AS families (104 patients) and 69 PWS families were analyzed.
Familial cases were counted as one case per family. The maternal (M) and
paternal (P) chromosomes are indicated. Percentages of patients in each
molecular class are noted. Class I) 4Mb interstitial deletions of 15q11 -q13;
Class ¡I) patients with uniparental disomy of chromosome 15; Class III)
patients who have imprinting defects, which cause changes the epigeno-
type along 15q11-13; Class IV) patients with mutations in a single gene,
UBE3A (X); Class V) patients with no detectable molecular defect.

18
A.
PWS
— IC
MAGEL2
MKRN3 NDN
IC Transcript
BD exons
r
-D-QÜ-D-
SNRPN IPW
zzi-z/h-
AS-
UBE3A
1b
MKRN3-AS
2 3 4 5
AS-IC PWS-IC
UBE3A-AS
B.
P + + + + + +
+
—/ + — +
+ + + /—
C.
RN4RR
ZNF127 NDN PW71 Y48.5
SNRPN
5'CpG intron 7 IPW
H-H—B
UBE3A
Figure 1-4. DNA methylation and expression imprints in 15q11-13.
This figure depicts the DNA methylation and expression imprints of sever¬
al imprinted genes on 15q11-13. A) Overview of the AS/PWS imprinted
domain. The chromosomal regions of the Prader-Willi and Angelman syn¬
dromes are indicated by bold arrows (top). The extent of the imprinting
center (IC) is also shown. The AS/PWS domain is depicted as a line, with
the orientation of the centromere (C) and telomere (T) noted (not to
scale). Relative positions of genes and transcripts are indicated above
the line, while antisense transcripts are shown below. Arrows demon¬
strate transcriptional orientation. The SROs for the AS-IC and PWS-IC are
shown below the chromosome. B) Expression imprints of selected 15q11 -
13 genes. Overall imprinted expression profiles of the maternal (M) and
paternal (P) alleles are depicted. Active (+) and silenced (—) chromo¬
somes are indicated. Tissue-specific imprinting is also indicated (+/—).
C) DNA methylation imprints of select loci along the AS/PWS imprinted
domain. Maternal imprints (M) are shown above the solid line, while
paternal imprints (P) are revealed below. Gene and locus names are
shown. Methylated ( â– ) and unmethylated ( â–¡) alleles are indicated.
This figure does not distinguish between partially and fully methylated
loci.

19
AS AS
Figure 1-5. Inheritance of an imprinting defect. Silent transmission
and inheritance of an imprinting defect in Angelman syndrome over
four generations. Females (circles) and males (squares) are shown in
each generation. Paternal (P) chromosomes are black, while maternal
(M) chromosomes are grey. Imprinting mutations are depicted with
appropriate epigenotypes in parenthesis. Affected siblings are denoted
with a grey circle or box.

20
0
Figure 1-6. The ubiquitination pathway involving the HECT family of
ubiquitin protein-ligases. A) Ubquitin is activated and bound by the E1
ubiquitin-activating enzyme. B) The E1 enzyme transfers the activated
ubiquitin to an E2 ubiquitin-conjugating enzyme. Several E2 enzymes
are known to interact with UBE3A. C) A member of the HECT family
binds to its E2 conjugating enzyme. D) The active ubiquitin complex
either recognizes a specific substrate or requires the help of an ancillary
protein (e.g. the E6 protein from HPV) to bind its substrate. E) Once
bound to its target protein, the ubiquitin-E2-E3 complex transfers the
activated ubiquitin moiety to its substrate. F) The E4 protein then aids
in polymerization of ubiquitin molecules on the substrate. The protein
then is degraded via the 26S proteosome.

TRANSMISSION OF ANGELMAN SYNDROME BY AN AFFECTED MOTHER
Introduction
The Angelman syndrome (AS) is a severe developmental and neurobehavioral
disorder characterized by four cardinal features: 1) severe developmental delay; 2)
profound speech impairment; 3) a movement and balance disorder and 4) an AS-
specific behavior which includes frequent and inappropriate laughter, a happy affect
and an easily excitable personality (Williams et al., 1995a; Williams et al., 2000).
Most AS cases arise de novo, the consequences of large deletions from the maternally
derived 15q11-13 (Williams et al., 2000). AS has also been diagnosed in patients with
paternal uniparental disomy, imprinting defects on maternal 15q 11-13 and maternally
inherited mutations in the 3A ubiquitin protein ligase gene, UBE3A (Glenn et al.,
1997). The Prader-Willi syndrome (PWS) is a separate, distinct neurobehavioral
syndrome also associated with 15q11-13 deletions. However, the deficiency in PWS is
always paternal in origin (Glenn et al., 1997). All of the cardinal features of AS can be
caused by mutations in the UBE3A gene (Kishino et al., 1997; Matsuura et al., 1997),
which shows imprinted expression in specific regions of the mammalian brain (Albrecht
et al., 1997; Rougeulle et al., 1997; Vu and Hoffman, 1997).
Individuals with AS achieve puberty normally, with both males and females
having normal secondary sexual characteristics, including normal menses in females
(Williams et al., 1995b). However, there have been no documented cases of
reproduction in either males or females with AS. In this report, we present the first
21

22
documented case of reproduction in an individual with AS that resulted in the
maternal transmission of a 15q 11-13 deletion to a fetus, which was electively
terminated at 16 weeks gestation (Lossie and Driscoll, 1999).
Methods
Subjects
The proband is now a 15 year old female with AS who has been followed
intermittently in the UF Genetics clinic since 22 months of age. Recently, the family
recontacted the Genetics service due to the proband’s unexpected pregnancy. High-
resolution chromosomal analysis in the past demonstrated a 15q11-13 deletion in the
proband, which DNA polymorphism and methylation studies subsequently confirmed
(Williams et al., 1989).
This family was initially reported in 1989 when the concern was raised that the
proband’s mother, who was of normal intelligence, could be mosaic for or also have a
submicroscopic deletion of 15q11-13 because she displayed brachycephaly, hearing
loss, an enlarged foramen magnum and mild ataxia. However, extensive molecular
analyses of peripheral blood and skin fibroblasts failed to reveal any abnormalities in
15q11-13 in the mother of the proband.
The proband has classic AS features with severe mental retardation, an AS-
specific behavior, a complete lack of speech, and a movement disorder characterized
by ataxia. An abnormal EEG and seizures were also noted at 22 months. She began
walking at 3 years, and her severe truncal ataxia has improved with age. The proband
also has microcephaly with a head circumference of less than -2 standard deviations,
relative prognathism, a protruding tongue, excessive drooling and an inappropriately
happy affect with excessive laughter. Menarche began at 11.5 years. A head CT and
MRI were only remarkable for an enlarged foramen magnum.

23
The family decided to terminate the pregnancy at 15-16 weeks gestation. The
termination was by suction dilatation and curettage. Identifiable fetal tissue was
dissected, immediately frozen in liquid nitrogen and stored at -70°C. Due to the
suction procedure, the only intact brain samples obtained were the eyes. Tissue was
procured with the approval of the family and the University of Florida Institutional
Review Board.
Microsatellite Analysis
DNA was extracted from peripheral blood leukocytes (PBL) and whole tissue
according to standard techniques (Driscoll and Migeon, 1990). PCR amplification of
the D15S817, D15S128, ACTIN (ACTC), D15S175 and D15S87 loci (Research Genetics)
was as previously described (Colman et al., 1996).
DNA Methylation Analyses
Southern Blot. DNA methylation analyses were performed within 15q11-13 at
SNRPN (Glenn et al., 1996) and NECDIN (NDN), and in 11 p15 (KvDMRI; Smilinich et al.,
1999) according to published protocols. DNA methylation analysis of NDN was at a
novel Bss Hll site (AC Lossie, RD Nicholls, DJ Driscoll, unpublished data), which is
located within the same Hind III fragment as the published imprinted Eag I site (Jay et
al., 1997). Specific conditions for each locus are shown in Table 2-1.
Table 2-1. Conditions for Southern blots
Gene
pg DNA
RE
RE
% Gel
V.hrs
Wash "C
SNRPN
5
Xba I
Not I
0.8
550
65
NECDIN
10
Hind III
Bss Hll
1
1000
70
KvLQT 1
5
Eco Rl
Not I
1
850
65
Specific restriction enzymes (RE) and volt»hours (V«hrs) for each locus are noted

24
Methylation Specific PCR (MSP). MSP relies on the selective ability of sodium
bisulfite to convert unmethylated cytosine to uracil, while leaving methylated cytosine
untouched. During PCR amplification, uracil is converted to thymidine, providing a
method to distinguish between the methylated and unmethylated alleles. MSP at 5’
SNRPN was done according to the manufacturers recommendations (Oncor) using
primers developed by Kubota and colleagues (Kubota et al., 1997).
RT-PCR
mRNA was isolated from fetal eye and lymphoblast cell lines using the Polytract
System 1000 mRNA extraction kit (Promega). cDNAs were reverse-transcribed from 20-
200 ng of mRNA using the Superscriptâ„¢ Amplification kit (Gibco). RT-PCR analysis of
UBE3A was accomplished using previously published primers that amplify an 1150 bp
fragment from exons 3 to 9 (formerly U1 to 3) of UBE3A (Matsuura et al., 1997). A 738
bp fragment of SNRPN was amplified using primers specific for exon 2 (5’-
TTGGCACACCAGCTGGTACT-3’) through exon 5 (5’-CACCTGAGACGAACTACAG-3’) in a
standard reaction with a 57°C annealing temperature. Amplification products were
size fractionated by gel electrophoresis, Southern blotted and visualized by
autoradiography.
Results
Genetic Analysis
The proband, fetus and parents of the proband were genotyped by
microsatellite analysis of loci (see map Figure 2-1A) within (D15S817 and D15S128;
Christian et al., 1998) and distal to 15q11-13 (ACTIN, D15S175 and D15S87). Within
15q11-13, the proband and fetus lacked a maternal genetic contribution (Figure 2-1B).
At D15S128, the proband and fetus only amplified the paternally inherited allele.

25
Although the proband was non-informative at D15S817, the fetus showed exclusive
amplification of the paternally derived allele. However, the proband and fetus were
heterozygous at several loci distal to 15q13, including D15S175, ACTIN (Figure 2-1C)
and D15S87 (data not shown). Therefore, both the proband and fetus have maternally
inherited deletions which are restricted to 15q11-13.
DNA Methylation Analyses
DNA methylation analysis is a powerful diagnostic tool that takes advantage of
the differential methylation found in imprinted regions of the genome. The AS/PWS
imprinted domain contains several loci that display parent-of-origin methylation
imprints (Glenn et al., 1997). SNRPN and NDN are two of several paternally
expressed genes within 15q11-13 which are preferentially methylated on the repressed
maternal allele (Glenn et al., 1996; Jay et al., 1997; Sutcliffe et al., 1994).
Two methods can assess DNA methylation at 5’ SNRPN: Southern analysis and
MSP (Glenn et al., 1996; Kubota et al., 1997; Kubota et al., 1996b; Sutcliffe et al.,
1994). Southern analysis reveals a 4.3 kb maternal and a 0.9 kb paternal band in the
parents and normal controls. However, the proband and fetus only have the 0.9 kb
paternal band (Figure 2-2), confirming the lack of a maternal 5’ SNRPN allele in these
samples. In accordance with Southern analysis, MSP analysis of parental PBL and
normal fetal eye DNA shows both the maternal and paternal PCR amplification
products. However, PBL DNA from the proband and eye DNA from the fetus
exclusively amplified the paternal chromosome 15 (Figure 2-3).
Previous methylation studies of the CpG island associated with NDN revealed a
parent-specific DNA methylation imprint from DNA digested with Hind III and fag I (Jay
et al., 1997). A Bss Hll methylation imprint is also present in this 2.6 kb Hind III
fragment (AC Lossie, RD Nicholls, DJ Driscoll, unpublished data). NDN hybridizes to

26
three fragments in control samples: a 2.6 kb maternal-specific, a 1.7 kb constant and
a 1.3 kb paternal-specific fragment (Figure 2-4). Normal PBL and fetal eye DNA reveal
both the maternal and paternal diagnostic bands. However, PBL DNA from individuals
with PWS reveals the predominance of the methylated 2.6 kb fragment, while NDN
hybridized to the paternal-specific unmethylated 1.3 kb fragment in patients with AS.
DNA from the parents of the AS proband demonstrates normal biparental methylation,
while AS methylation imprints are apparent in PBL DNA from the proband with AS and
eye tissue from the fetus with AS.
A differentially methylated region near an antisense transcript of the KvLQTI gene in
the Beckwith-Wiedemann syndrome region on chromosome 11 was also examined
(Smilinich et al., ). Normal individuals have 4.3 and 2.7 kb diagnostic bands, which
correspond with the methylated and unmethylated alleles, respectively. All of our
samples showed normal DNA methylation imprints at this non-chromosome 15
differentially methylated site (data not shown).
Gene Expression
RT-PCR analyses of AS fetal eye, normal fetal eye and PWS lymphoblast cells
revealed a 1.4 kb transcript from exons 4 to 9 of UBE3A in all tissues (Figure 5).
However, as expected, SNRPN was only expressed in the AS and normal tissues; the
PWS sample failed to amplify SNRPN (Glenn et al., 1996).
Discussion
The presence of AS-specific DNA methylation imprints and absence of a
maternal contribution of proximal 15q demonstrates that the patient with AS passed
her 15q11-13 deletion to her fetus. These findings conclusively demonstrate that
females with AS are capable of reproduction and show that the previously observed

27
lack of reproduction is most likely due to social/cognitive behavior versus physiological
reasons. Therefore, appropriate appraisal of the reproductive risks should be part of
the genetic counseling given to AS families.
Studies by Gabriel and colleagues (Gabriel et al., 1999) of a mouse deletion
model for the AS/PWS imprinted region support our findings. Their model, a transgene
insertion/deletion (Tgpws/AS(del)) of the orthologous region on mouse chromosome 7C,
correlates well with our findings in this patient with AS, as a large murine
chromosomal deletion can also be passed through the maternal germ line. Mice that
inherit the maternal deletion have many of the characteristics found in individuals
with Angelman syndrome.
The ability of an AS mouse to pass on either a normal or deleted chromosome
7C allows a closer examination of the role that replication timing and homologous
association play in the establishment and transmission of the chromosome 15q11 -13
imprint (Kitsberg et al., 1993; LaSalle and Lalande, 1996). In the mouse model for AS,
maternal transmission of a large deletion encompassing the imprinted domain failed to
interrupt proper imprint establishment of the normal AS/PWS chromosomal region
(Gabriel et al., 1999). These findings demonstrate that during murine gametogenesis
the imprinting on both homologues must be established and transmitted in cis, and
that neither replication timing nor homologous association are required for
establishment or transmission of the imprint. In addition, these data strongly suggest
that inheritance of a normal chromosome 15 from a mother with AS would result in
normal development in her offspring.
Evidence for imprinted expression of the UBE3A gene is limited. Murine studies
demonstrate that imprinted expression is limited to the CA2 and CA3 regions of the
hippocampus, the mitral cell layer of the olfactory bulb and Purkinje cells of the

28
cerebellum (Albrecht et al., 1997). In humans, evidence is less precise. Imprinted
expression of UBE3A was observed in adult frontal cortex and fetal brain (Rougeulle et
al., 1997; Vu and Hoffman, 1997). Since the eyes originate from the lateral aspects of
the forebrain during fetal development, it was possible that fetal eye would also show
imprinted expression. However, no difference in the expression of UBE3A was
observed between normal and AS fetal eye samples.
Imprinted genes in other chromosomal regions also show DNA methylation
imprints (Razin and Cedar, 1994). To determine if interruption of the imprinting
process in the AS/PWS region can alter DNA methylation imprints at loci on 11 p15, we
examined KvDMRI, a differentially methylated site associated with an antisense
transcript of KvLQTI (Smilinich et al., 1999). All samples showed normal DNA
methylation, indicating that the establishment and transmission of the 11 p15 DNA
methylation imprint occurs independently from the AS/PWS region.
In conclusion, our findings establish that the Angelman syndrome can be
transmitted through a female with AS, imply that the Prader-Willi syndrome could also
be transmitted through a male with AS and illustrate the need for informed
reproductive counseling for parents of AS patients.

29
A.
CEN
(MKRN3 S817 SNRPN
ACTIN
YY
\v>-
S175
NDN
S128 UBE3A
S87
-^TEL
B.
V
-i
-ii
-in
D15S128
12 3 4
D15S817
c.
o
... ,, I
«ja-. — II
Ü “in
D15S175
12 3 4
ACTIN
Figure 2-1. Microsatellite Analysis of Chromosome 15. A) deletion
breakpoints flanking 15q11-13, individual loci, centromere (CEN) and
telomere (TEL) are noted. B) Microsatellite analysis of loci within
15q11-13 and C) Microsatellite analysis of loci distal to 15q11-13.
The pedigree shows the father of the proband (lane 1), AS proband
(lane 2), proband’s fetus (lane 3) and mother of the proband (lane
4). Note the lack of a maternal contribution within 15q11-13 for the
proband and fetus at D15S128, and for the fetus at D15S817.
However, distal to 15q11-13, there is a biparental contribution at
ACTIN and D15S175. The father of the AS fetus is unknown.

«Mí»1
-MAT
mmm ^ -pat
1 23456789 1011
Figure 2-2. DNA methylation analysis of 5’ SNRPN. Digestion of DNA
with Xba I and Not I reveals diagnostic bands of 4.3 kb (methylated,
maternal) and 0.9 kb (unmethylated, paternal). PBL DNA from normal
individuals reveals both the 4.3 kb and 0.9 kb normal methylation pro¬
file (lanes 1, 2, 10, 11). Patients with AS only have the 0.9 kb unmeth¬
ylated fragments (lanes 3 and 4), while individuals with PWS have the
4.3 kb methylated allele (lanes 5 and 6). Eye DNA from the fetus
(lanes 7 and 8) and PBL DNA from the AS proband (lane 9) reveal AS-
specific DNA methylation imprints, while PBL DNA from the parents
shows maternal- and paternal-specific bands (lanes 10 and 11).

31
Figure 2-3. MSP analysis of 5’ SNRPN. PBL (lanes 1, 2, 3,
5, and 6) and fetal eye DNAs (lanes 4 and 7) are shown. The
pedigree shows the positions of each family member. Nor¬
mal individuals (lanes 1, 2 and 7) amplified the 174 bp
methylated and 104 bp unmethylated products. The
proband and fetus exclusively amplified the unmethylated
allele, while two patients with PWS (lanes 5 and 6) ampli¬
fied only the methylated allele. PW (Prader-Willi), normal
fetal eye (E) and water control (C) are indicated.

32
kh NL AS
PW
U V- \¿
2 6 —
:#K.
f. |il'¿
1 .~7 —
mmm
1,3 — .mmmi 4HM» mmm
12 3 4
5 6
â– 
xieSS? - , . .i
3&a¿xsassT •i.wrt
n n +
I £“1 I
8 9 10 11 12
Figure 2-4. DNA methylation analysis of NDN. Digestion of DNA with
Bss Hll and Hind III reveals diagnostic bands of 2.6 kb (methylated,
maternal) and 1.3 kb (unmethylated, paternal), and a constant band
of 1.7 kb. PBL DNA from normal individuals (lanes 1,2,11,12) and
normal fetal eye (lane 7) shows the normal methylation profile.
Patients with AS (lanes 3 and 4) have the 1.3 kb paternal diagnostic
band, while individuals with PWS (lanes 5 and 6) predominantly have
the 2.6 kb methylated, maternal fragment. Eye DNA from the fetus
and PBL DNA from the proband reveal AS-specific DNA methylation
imprints (lanes 8, 9 and 10).

Fetal Eye LB
NL AS PWS
RT
+ -+-+-
UBE3A -
mum «NM»
W
SNRPN-
Figure 2-5. Expression analysis of UBE3A and SNRPN. A
Southern blot of RT-PCR products from UBE3A exons 3 to 9
(1150 bp) and SNRPN exons 2 to 5 (738 bp) is shown. The
membrane was hybridized with the same RT-PCR products.
Reactions with (+) and without (-) RT are noted. UBE3A and
SNRPN transcripts are present in normal (lanes 1 and 2) and
AS fetal eye (lanes 3 and 4). However, only UBE3A is
expressed in lymphoblast cells from a patient with PWS
(lanes 5 and 6). Extra bands are due to alternative splicing
of UBE3A.

MOLECULAR ANALYSES AND GENOTYPE-PHENOTYPE-CORRELATIONS AMONG THE FIVE
CLASSES OF ANGELMAN SYNDROME
Introduction
The Angelman (AS) and Prader-Willi (PWS) syndromes, two distinct
neurobehavioral disorders, are the best-studied examples of genomic imprinting in
humans. In these imprinted disorders, the parental origin of the chromosome 15
abnormality determines the phenotype. PWS occurs from the lack of critical
paternally expressed 15q11-13 sequences, while multiple mechanisms that disrupt the
maternally inherited E3 ubiquitin protein-ligase gene (UBE3A) cause AS (Glenn et al.,
1997; Williams et al., 2000).
AS is a severe developmental and neurobehavioral disorder that occurs with a
frequency of -1/15,000 (Clayton-Smith et al., 1993). First documented by Harry
Angelman (1965), AS is now diagnosed by four cardinal features: severe developmental
delay and mental retardation; profound speech impairment; a movement and balance
disorder and an AS-specific behavior which includes frequent, inappropriate laughter,
a happy affect and an easily excitable personality. Other common features include
seizures, microcephaly, abnormal EEG patterns, sleep disturbances, hypopigmentation
and strabismus (Williams et al., 1995a; Williams et al., 2000).
Five major molecular mechanisms are known to cause AS: I) 4 Mb maternally-
derived deletions of 15q11-13; II) paternal uniparental disomies (UPD); III) imprinting
defects (ID); IV) patients with intragenic mutations in UBE3A; and V) patients with no
34

35
known defects on chromosome 15. Although patients in Classes l-lll can be easily
diagnosed by DNA methylation analyses along the 15q11-13 imprinted domain (Glenn
et al., 1997), individuals from Classes IV and V demonstrate normal DNA methylation
at the diagnostic loci. DNA methylation analysis takes advantage of the differential
methylation found in imprinted regions of the genome and easily resolves the maternal
and paternal alleles. SNRPN, the most reliable locus for AS diagnosis, is one of several
paternal-only expressed genes in 15q11-13 whose promoter region is preferentially
methylated on the repressed maternal allele (Glenn et al., 1996; Kubota et al., 1996b;
Sutcliffe et al., 1994).
The discovery of maternally inherited mutations in Class IV patients first
established a role for UBE3A in the etiology of AS (Kishino et al., 1997; Matsuura et
al., 1997). Subsequent mutation analysis of patients with normal DNA methylation
identified an overall UBE3A mutation rate of 14-38% in sporadic AS patients (Baumer et
al., 1999; Fang et al., 1999; Malzac et al., 1998; Monda et al., 1999a; Russo et al.,
2000). Although cell lines from AS patients failed to show imprinted expression of
UBE3A (Nakao et al., 1994), demonstration of brain-specific imprinting by RT-PCR in
the human confirmed the role of UBE3A in the etiology of AS (Rougeulle et al., 1997).
The phenotype associated with Class I patients is well documented (Saitoh et
al., 1994; Smith et al., 1996). These individuals have a classical AS phenotype with all
patients having the four cardinal features of AS as well as a very high incidence of
severe, early-onset seizures, microcephaly and hypopigmentation. While patients
from Classes II, III and IV displayed the four cardinal features of AS, these individuals
often exhibited atypical features that ameliorated the AS phenotype. All studies
showed that patients with UPD and imprinting defects (ID) were less likely to present
with hypopigmentation or microcephaly (Burger et al., 1996; Fridman et al., 2000b;

36
Gillessen-Kaesbach et al., 1999; Saitoh et at., 1999; Smith et at., 1997). In addition,
some studies revealed that patients from Classes II and III had fewer seizures, early
onset obesity and better motor skills (Fridman et al., 2000b; Gillessen-Kaesbach et al.,
1999; Smith et al., 1997). Monda and colleagues (1999b) reported that UBE3A
mutation patients had a more severe phenotype than the UPD and ID patients. Like
the deletion group, Class IV patients were more likely to present with
hypopigmentation and seizures.
Individually, these studies have given us clues to the clinical variances that
occur among the first four classes of AS patients. However, a single comprehensive
investigation of all molecular classes of Angelman syndrome would provide
researchers, clinicians and families a valuable resource to aid in the prediction of a
phenotypic outcome give a particular genotype or molecular class. In this study, we
report on the molecular and clinical analyses of 104 classical AS patients from the
University of Florida AS repository. We present the first comprehensive analysis of
genotype-phenotype correlations among all five molecular classes of AS. In our study,
we report the highest UBE3A mutation frequency to date and demonstrate striking
differences among the five classes in growth parameters; achievement of
developmental milestones; and severity, frequency and age at onset of seizures.
Materials and Methods
Patient Repository
Over the last 11 years, we have accumulated a large AS repository totaling 146
individuals from 134 Angelman families. Each patient was clinically examined by
geneticists at the University of Florida, evaluated for 22 individual criteria and given
an AS rating of one through five based on clinical impression before any laboratory
tests were performed. We restricted this study to the 104/146 classical AS patients

37
(93 families) who demonstrated a classical AS phenotype. The remaining 42 "AS-like”
patients exhibit some but not all of the four cardinal features of AS and were excluded
from further investigation. Blood and tissue were procured with the approval of the
families and the University of Florida Institutional Review Board.
Once a clinical diagnosis of AS was determined, DNA from each patient was
analyzed by molecular and cytogenetic tests in order to determine the class in which
each AS patient belonged. DNA methylation analyses at the MKRN3, PW71 and 5’
SNRPN loci were used to separate patients in Classes l-lll (abnormal DNA methylation)
from individuals in Classes IV and V, who had normal methylation (Dittrich et al.,
1993; Driscoll et al., 1992; Glenn et al., 1996; Kubota et al., 1996b; Sutcliffe et al.,
1994). DNA dosing, high-resolution chromosome and fluorescence in situ hybridization
(FISH) studies detected patients with large interstitial deletions (Class I), while
microsatellite and RFLP analyses separated patients in Class II from individuals in Class
III (Christian et al., 1998; Miturangura et al., 1993).
Patients with normal DNA methylation were then tested for UBE3A mutations
by a combination of Southern blot, BESS T-Scan and direct sequence analyses.
Patients with intragenic UBE3A mutations were placed into Class IV, while those with
no detectable chromosome 15 abnormalities were put into Class V.
Southern Analysis
Southern blots were done according to standard conditions (Lossie and Driscoll,
1999). To detect possible genomic rearrangements, cDNA probes were made by RT-
PCR from the 5’ UBE3A cDNA primers (forward primer 5’-ACCAGCTCCTCAGAAGTTT
GGCGAAA-3’ and reverse primer 5’-TCTCCATCATTCTCCGAATCTGGTC-3’) and 3’ UBE3A
cDNA primers (forward primer 5’-TTGCAAAGCGATGAGCAAGCTACC-3’ and reverse
primer 5’-TGGGACACTATCACCACCCAA-3’). A 2.7 kb Eco Rl to Not I fragment from

38
cosmid 24 (Sutcliffe et al., 1994), which is located at 5’ UBE3A, was used for DNA
methylation analyses and to detect genomic rearrangements.
BESS T-Scan
We analyzed genomic DNA from patients following the procedures outlined in
the BESS T-Scan mutation detection kit (Epicentre, Madison, Wl) using primers (Table
3-1) corresponding to exons 6, 10, 11, 12, and 16. Cleaved products were size
fractionated on 6% acrylamide, 6M urea and 30% (v/v) formamide sequencing gels
according to standard protocols. Putative mutations were verified by sequence
analysis.
Sequence Analysis
Abnormal PCR products from BESS T-scan analyses were cloned into a TA vector
(Clontech) and sequenced using universal primers and regular dye terminators (ABI,
Perkin Elmer). We designed coding region and intronic primers that would amplify
individual exons of UBE3A (Table 3-2). PCR products were purified by the High Pure
PCR Purification Kit (Roche) and sequenced directly using a 1/4 reaction of the Big Dye
terminators (ABI, Perkin Elmer). Completed sequencing reactions were purified by
either repeated ethanol precipitation or by sepharose columns (Edge Scientific), dried
under vacuum, resuspended and fractionated on either an ABI 377 or ABI 373A
automated sequencer. Sequence analysis was performed with the Sequencher
program (Gene Codes Corporation).
Primers
Primers for BESS-T (Table 3-1) and direct sequence analysis (Table 3-2) were
designed to amplify the entire UBE3A coding region (exons 6-16).

39
Table 3-1. BESS-T Primers
Exon
Primer
Direction
Location
Size
6
TGCCAGCAGGlIIAI11 I I
ACCAGCCTTGTGGGTAAG
Forward
Reverse
Exon
Exon
187
7
GGAGAACCTCAGTCTGACGAC
ATTCGGCTAGCTTCAATGTC
Forward
Reverse
Exon
Exon
38
8
GCAGCTGCAAAGCATCTAAT
TCAATTCTAGCGCCTTTCTT
Forward
Reverse
Exon
Exon
284
10
GCAATCATCTTCTTTTCATGTT
CGACACCATAATCACATTAC
Forward
Reverse
Intron
Intron
194
11
TGTTCACATACGATGAATCTACA
CTCCCAAGTCACGAAAAGTT
Forward
Reverse
Exon
Exon
192
12
TCAGAGTTTAAAAGATTTATTGGA
TCCTGTTTTCATTTGTAATTGG
Forward
Reverse
Exon
Exon
155
13
GAATTTGTCAATCTTTATTCTGACT
CGGCTTCCACAT AT AAGCA
Forward
Reverse
Exon
Exon
155
14
AGATTTCCAAGCACTAGAAGAAA
AATCAGAACAGAGTCCCTGG
Forward
Reverse
Exon
Exon
67
15
GTTCTGGGAAATCGTTCATT
CTGTGTCTGGGCCATTTT
Forward
Reverse
Exon
Exon
137
16
ACCATGACTTACAGTTTTCCT
TGGGACACTATCACCACCAA
Forward
Reverse
Intron
Intron
189
Table 3-2. Sequencing Primers
Exon
Primer
Direction
Location
Size
7
TATGGCCACCTGATCTGAC
TTCCT ATCTCCCATTT ACTGC
Forward
Reverse
Intron
Intron
345
8
GCTTGACTAACTTTTGCCTTG
ATCTCCCACATGGTTTTCAG
Forward
Reverse
Intron
Intron
443
GCAGCTGCAAAGCATCTAAT
TCAATTCTAGCGCCTTTCTT
Forward
Reverse
Exon
Exon
9
AACAG CTATG ACCATG CAACAG AGTAAACATAC AT ATT
GT AAAACGACGGCCAGTCACTGAACTGTATCAT
Forward
Reverse
Intron
Intron
1401
ATTAGGCCCTGATGATGTGT
CCAGATATTCAGGACTGTGGA
Forward
Reverse
Exon
Exon
10
TTGTTTCCTAATCCTACTCCTTG
ACCAAATCCTTCTTTTGCTG
Forward
Reverse
Intron
Intron
352
11
GGACATTGTTTTCTCAAGTGC
TAAAAATGTCCCCCTTTGAG
Forward
Reverse
Intron
Intron
559
12
TGTTGTATTTTGTAGTTCTATGG
TTAATGAAGAGACAAAATGTGAC
Forward
Reverse
Intron
Intron
257
13/14 GAAGTTCTTGTGATTAATGT
CCCTTTGGTGAATCAAATCTTCC
Forward
Reverse
Intron
Intron
404
GAATTTGTCAATCTTTATTCTGACT
AATCAGAACAGAGTCCCTGG
Forward
Reverse
Exon
Exon
15 TTCAGGATAAATTTGCTTGG
AAAAT CACG AATGTGCTCAG
Forward
Reverse
Intron
Intron
416
Statistical Analyses
Descriptive statistics were calculated as a percentage or by the mean +/-
standard deviation. All outcome variables were modeled as a function of age at
evaluation, birth weight, molecular class (I, II, III, IV and V), gestational age, maternal

40
age, paternal age, race (Caucasian, Hispanic and Other), and sex. Outcome variables
consisted of continuous, binary and ordinal measures, and were modeled using analysis
of covariance (ANCOVA), logistic regression and ordinal logistic regression,
respectively. For binary and ordinal outcome variables with limited sample size, we
employed the exact chi-square test. Odds ratios were used to summarize the binary
and ordinal outcomes. All tests were two-sided and considered significant at
alpha=0.05. All statistical analyses were performed using SAS 6.12 (SAS Institute,
Cary, NC).
Results
Molecular Classes of Angelman Syndrome
Each patient was assigned a molecular class based upon results from high-
resolution chromosome, FISH, UBE3A mutation as well as DNA dosing, methylation and
polymorphism analyses along 15q11-13 (Table 3-3). The vast majority (63) of our
Table 3-3. Molecular Classes of Angelman Syndrome
Class Molecular Defect Patients %
I
15q11 -13 Deletion
63
68
II
Uniparental Disomy (UPD)
7
7
III
Imprinting Defect (ID)
3
3
IV
UBE3A Mutation
10
11
V
Unknown
10
11
classical families were deleted for the entire 4 Mb AS/PWS imprinted domain (Class I).
In seven cases AS occurred via paternal UPD of chromosome 15 (Class II), and three
families had imprinting defects (Class III). Intragenic mutations in UBE3A occurred in
ten of our classical patients (Class IV), while the remaining 10 had no detectable
chromosome 15 abnormality (Class V).

41
Mutation Analysis
Initially, a molecular confirmation of AS could not be made in 20/93 families
using cytogenetic, DNA methylation or DNA polymorphism tests. Furthermore,
Southern blot analysis of the UBE3A cDNA determined that genomic rearrangements
did not occur in any of these patients (data not shown). Sequence analysis of the
UBE3A coding region in these 20 families revealed intragenic mutations in 10 families
(15 patients). We detected six deletions that resulted in frameshifts, three nonsense
mutations and one missense mutation (Figure 3-1). In patients with normal DNA
methylation, we found a 50% mutation detection rate with 3/4 familial (75%) and 7/16
sporadic cases (44%) harboring mutations within the UBE3A gene.
One patient was heterozygous for a previously unidentified expressed
polymorphism (A1144G transition) in exon 9. Another common polymorphism occurred
in intron 6 at the site of a poly T tract. Several patients and normal individuals were
heterozygous, having runs of either nine (p) or ten (q) thymidines at in intron 6. We
examined 134 normal chromosomes and found that p=0.83 and q=0.17. In addition,
one AS-like patient had a paternally inherited 14 bp deletion of the 3’ UTR, which
appeared to be similar, but not identical, to that identified by Fung and colleagues
(1998). No disease-associated mutation was found in this individual. In addition, BESS
T-Scan detected one individual who was homozygous for a previously identified
expressed polymorphism in exon 6 (Vu and Hoffman, 1997).
DNA Methylation of 5’ UBE3A
Although we identified disease-causing mutations in 50% of our patients who
had normal DNA methylation at 5’ SNRPN, the cause of AS in the remainder of our
classical Angelman syndrome patients was unknown. We postulated that disruption of

42
the normal UBE3A DNA methylation pattern in Class V patients could be a potential
cause of AS in these patients.
We isolated a 2.7 kb Not I-Eco Rl fragment from the CpG island at 5’ UBE3A
(Figure 3-2A) and tested for parent-of-origin DNA methylation imprints in DNA from
PBL, AS brain, normal brain and germ cells from both sexes. As expected, the 2.7 kb
genomic probe detected a 5.1 kb fragment when the DNA was digested with Eco Rl
alone. However, when DNA was digested with both Eco Rl and Not I, the probe only
hybridized to a 2.7 kb fragment, indicating that the CpG island at 5’ UBE3A was
unmethylated on both alleles in all tissues examined (Figure 3-2B). We next examined
PBL DNA from Class V patients. The 2.7 kb probe only detected the unmethylated
fragment, indicating that the CpG island was also unmethylated in these individuals
(Figure 3-2C).
Summary of all Published UBE3A Mutations
To date, UBE3A mutations have been identified in 51 AS families (Baumer et
al., 1999; Fang et al., 1999; Fung et al., 1998; Kishino et al., 1997; Malzac et al.,
1998; Matsuura et al., 1997; Russo et al., 2000; van den Ouweland et al., 1999).
Forty-five are unique mutations; no true hot spots have been identified (Figure 3-3).
Most mutations are novel, with no more than three unrelated individuals sharing a
common error. Although defects have been found in virtually all protein-coding exons,
most cluster in exons 9 and 16 (Figure 3-3). Insertions, deletions and nonsense
mutations are the predominant defects.
Genotype-Phenotype Correlations
We analyzed phenotypic data on 61 patients from the University of Florida AS
repository. We included all of our patients from Classes ll-V and randomly chose 20

43
Class I patients for phenotype comparisons. We also included 77 additional patients
(Classes II, Ili and IV) in our statistical models (Bottani et al., 1994; Dan et al., 2000;
Dupont et al., 1999; Freeman et al., 1993; Fridman et al., 2000a; Fridman et al.,
2000b; Fridman et al., 1998; Fung et al., 1998; Gillessen-Kaesbach et al., 1995;
Gillessen-Kaesbach et al., 1999; Greger et al., 1997; Gyftodimou et al., 1999; Laan et
al., 1999; Malcolm et al., 1991; Minassian et al., 1998; Monda et al., 1999a; Monda et
al., 1999b; Ohta et al., 1999; Prasad and Wagstaff, 1997; Reis et al., 1994; Robinson
et al., 1993; Russo et al., 2000; Saitoh et al., 1997; Saitoh et al., 1999; Smeets et al.,
1992; Smith et al., 1994; Smith et al., 1997; Smith et al., 1998; Tonk et al., 1996).
We compared the results of statistical models established between our patients and
the combined data set (Tables 3-4, 3-5 and 3-6). Deletion patients (Class I) had the
most classical phenotype. However, patients from Classes ll-V exhibited some atypical
features. Differences were most striking in growth parameters, development of motor
skills, seizures and pigmentation.
Statistical analysis of body mass index (BMI) revealed that patients from Classes
II, III and IV were bigger and heavier than the deletions and Class V patients (Figure 3-
4A; Table 3-4), for both UF patients (P=0.0042) and the combined data set (p=0.0167).
Statistical models also demonstrated that less than 15% of individuals from Classes II
and III had microcephaly, whereas more than 55% of patients from the other three
classes had a head circumference less than the 3rd percentile (Figure 3-5B; Table 3-4;
p=.0415).
The mean age to walk for Class I was 4.6 +/- 2.1 (p=.0001), while the mean age
to walk for patients from Classes ll-V varied from 2.4 +/- 0.9 (Class III) to 2.8 +/- 0.9
(Class IV; Figure 3-4C; Table 3-5). Onset of seizures also depended upon molecular
class (Figure 3-4D; Table 3-5). Seizures started very early in Class I and V patients (1.9

44
+/- 1.1 and 1.4 +/- 0.9, respectively) compared to Classes II, III and IV (4.9 +/- 3.4, 5.5
+/- 5.0 and 2.7 +/- 1.4, respectively; p=.0028).
Table 3-4, Clinical and growth data
Class 1
Class II
Class III
Class IV
Class V
UF
UF
All
UF
All
UF
All
UF
Speech
(21)
(7)
(27)
(7)
(20)
(15)
(46)
(11)
0 words
71
*
44
43
40
60
33
82
< 3 words
29
43
15
14
15
27
26
9
3-10 words
*
43
33
43
30
13
41
9
> 10 words
*
14
8
*
15
*
*
*
Seizure Onset
(20)
(3)
(14)
(2)
(9)
(12)
(24)
(5)
< 1 year
10
*
7
*
33
17
13
40
1-2 yrs
40
33
14
*
23
8
4
20
2-3 yrs
25
*
14
50
11
25
29
40
3-4 yrs
25
*
*
*
*
50
29
*
> 4 yrs
*
67
65
50
33
*
25
*
Seizure Severity
(21)
(7)
(26)
(7)
(18)
(15)
(32)
(10)
Severe
29
*
4
14
6
33
19
10
Moderate
62
14
8
*
11
20
22
30
Mild
9
29
23
14
22
33
44
20
None
*
57
65
72
61
14
15
40
Length
(21)
(7)
(28)
(7)
(17)
(15)
(30)
(9)
<5%
42
*
7
30
12
7
10
*
5-20%
5
*
11
14
12
20
10
56
21-40%
14
43
18
14
18
46
27
22
41-60%
19
14
14
14
23
13
33
*
61-80%
10
*
18
14
23
7
17
22
81-95%
10
14
21
14
6
7
3
*
>95%
*
29
11
*
6
*
*
*
Weight
(21)
(7)
(27)
(7)
(15)
(15)
(28)
(9)
<5%
18
*
4
*
*
*
*
11
5-20%
14
*
7
29
13
13
7
33
21-40%
24
14
4
*
*
*
*
11
41-60%
24
14
15
*
*
27
14
34
61-80%
10
14
15
29
13
13
18
*
81-95%
*
14
22
*
20
27
18
*
>95%
10
44
33
42
54
20
43
11
BMI (kg/m2)
(21)
(7)
(17)
(7)
(14)
(13)
(13)
(9)
<5%
10
*
*
*
*
8
8
11
5-20%
10
*
*
*
*
8
8
33
21-40%
24
*
6
*
*
*
*
*
41-60%
18
14
6
*
*
8
8
34
61-80%
18
14
12
57
29
31
31
11
81-95%
10
29
29
*
7
14
14
11
>95%
10
43
47
43
64
31
31
*
Head Circum
(20)
(6)
(27)
(7)
(19)
(15)
(32)
(9)
<5%
60
*
15
*
11
53
56
60
5-20%
10
33
11
14
5
*
*
10
21-40%
20
17
30
29
26
27
16
20
41-60%
10
33
18
14
21
20
12
10
61-80%
*
17
15
29
21
*
*
*
81-95%
*
*
4
14
5
*
16
*
>95%
*
*
7
*
11
*
*
*
All parameters are statistically significant in UF and combined data sets (p<0.05)
In the UF patient population, significant seizures occurred in 19/21 deletion
patients, but only in 1/7 UPD, 1/7 ID, 8/15 UBE3A mutation and 4/10 Class V patients
(p=9.96X1 O'5). Similar findings were observed in the combined data set (p=8.26X10 8;
Table 3-6). In addition, 90% of Class I patients were hypopigmented compared to

45
family members (p=3.33X10 8). However, less than 25% of Classes ll-IV and only 44% of
patients in Class V showed evidence of hypopigmentation (Table 3-6).
Table 3-5. Clinical data: means
Class I
UF
Class II
UF All
Class III
UF All
Class IV
UF All
Class V
UF
Age to sitv
1.3+0.6
0.9+0.3
0.9+0.2
0.7±0.1
0.8+0.3
1.0+0.4
1.0+0.4
1.0+0.4
Age to walk*
4.6±2.1
2.5±0.7
2.6±0.9
2.9±1.2
2.4+1.0
2.8+1.0
2.8+0.9
2.6+0.8
First seizure5
1.9±1.1
4.9±3.4
4.8±3.2
5.5±4.9
3.4+3.5
2.7+1.4
4.4+4.9
1.4+0.9
Birth weight
3.1±0.5
3.8+0.2
3.5±0.5
3.6+0.6
3.5+0.7
3.2+0.5
3.2+0.4
3.6+0.5
Maternal age
27.3±5.2
35.0±7.1
30.2±7.5
29.6±6.6
29.1+6.2
25.9+4.1
25.9+4.1
26.3+3.9
Paternal age
29.8±5.9
35.0±8.4
33.3±7.6
29.6±6.9
29.4+6.4
27.5+3.3
27.5+3.3
33.0+9.1
Gestational age
39.2±1.4
39.0±2.0
39.7±1.1
38.4+1.6
37.5+2.1
39.8+1.4
39.8+1.3
39.7+0.8
Age at last visit
10.9±4.9
9.6±3.4
8.9±6.5
14.8+6.0
10.6+5.8
17.3+10.3
17.3+11.0
12.3+11.7
''Significant in UF data only
^Significant in combined data set only
'Significant in UF and combined data sets
Table 3-6. Clinical data: percentages
Class 1
UF
Class II
UF All
Class III
UF All
Class IV
UF All
Class V
UF
Walk by 5 yrs*
50
(20)
100
(7)
96
(25)
86
(7)
94
(18)
93
(15)
97
(35)
100
(7)
Feeding Problems
70
(20)
80
(5)
75
(12)
100
(5)
83
(18)
80
(10)
46
(24)
63
(8)
Simple commands*
53
(17)
100
(4)
91
(11)
100
(7)
100
(13)
100
(13)
100
(13)
100
(5)
Seizures5
100
(21)
43
(7)
45
(31)
29
(7)
59
(27)
53
(15)
73
(48)
60
(10)
Significant Seizures*
90
(21)
14
(7)
12
(26)
14
(7)
17
(18)
53
(15)
41
(41)
40
(10)
Hypopigmented*
90
(21)
17
(6)
20
(20)
0
f7)
14
(22)
15
(13)
23
(43)
44
<2L
'Significant in both data sets
Significant in UF set only
Discussion
Mutations in UBE3A
We have accumulated an AS repository of 104 classical Angelman patients from
93 different families, each of whom has been studied extensively by us at the clinical
and molecular levels. Previous mutation analyses by other laboratories revealed a
very low UBE3A mutation detection rate (5-38%) in sporadic patients with normal DNA
methylation at 5’ SNRPN (Baumer et al., 1999; Fang et al., 1999; Malzac et al., 1998;
Monda et al., 1999a; Russo et al., 2000; van den Ouweland et al., 1999). Five

46
explanations can account for the paucity of UBE3A mutations in these patients: 1.
Patients from these studies do not have AS, but instead have disorders that mimic AS;
2. Many UBE3A mutations occur in non-coding regions; 3. UBE3A can be inactivated by
other mechanisms; 4. Other genes in the ubiquitin pathway (genome wide) also cause
an AS phenotype; 5. Angelman-associated mutations occur in other 15q11-13 genes.
One goal of our study was to further narrow these possibilities and try to
establish whether or not other AS genes existed. Therefore, we restricted our
mutation analysis to 20 AS families seen by University of Florida geneticists,
eliminating patients with mimicking conditions. We hypothesized that if only one AS
gene existed, then 60-80% of our classical AS patients would have intragenic UBE3A
mutations. We would not expect to find mutations in 100% of our patients because
some mutations will invariably lie in non-coding regions of the gene. Overall, we
found mutations in 50% of our 20 classical AS patients; 44% of our sporadic cases (7/16)
and 75% (3/4) of our familial cases had mutations within UBE3A. Although we have
found the highest UBE3A mutation detection rate in sporadic patients who have AS,
the lower than expected frequency suggests that alternative explanations must exist
for the lack UBE3A mutations in the remaining sporadic Class V patients.
The simplest explanation for the relative lack of mutations in patients with
normal DNA methylation at 5’ SNRPN is that multiple mutations occur outside of the
coding region. Although formally a possibility, only two patients have been found with
lesions that disrupt either the UBE3A gene or an upstream element (Greger et al.,
1997; Greger et al., 1994). Furthermore, no mutations have been reported in the 5’
UTR of UBE3A and Southern analysis of our patients failed to detect genomic
rearrangements in our 20 families.

47
In the 5’ region of imprinted genes, the repressed allele is usually methylated,
while the expressed allele is unmethylated. In cancer, DNA methylation of the
promoter region has been shown to inactivate tumor suppressor genes, while
demethylation of promoters can lead to activation of proto-oncogenes (Tycko, 2000).
With the exception and Mash2, and now UBE3A, the promoter regions of imprinted
genes show differential methylation based on the parental origin of the chromosome
(Glenn et al., 1997; Razin and Cedar, 1994; Tilghman, 1999). In addition,
demethylation has been shown to occur in long-term cell culture (LaSalle et al., 1998),
reactivating the maternal allele of SNRPN (Saitoh and Wada, 2000). Several paternal-
only expressed genes within the AS/PWS imprinted domain display parent-of-origin
DNA methylation imprints in peripheral blood leukocyte (PBL) DNA (Driscoll et al.,
1992; Glenn et al., 1996; Jay et al., 1997; Jong et al., 1999; Kubota et al., 1996a;
Sutcliffe et al., 1994). However, when we examined the CpG island at 5’ UBE3A we
found no evidence for a DNA methylation imprint in DNA derived from PBL, brain
tissues or germ cells. Both the maternal and paternal alleles were completely
unmethylated, even in tissues that had previously revealed imprinted expression of
UBE3A (Lossie and Driscoll unpublished data; Rougeulle et al., 1997; Vu and Hoffman,
1997).
It is generally accepted that DNA methylation of promoter regions is closely
associated with transcriptional repression (Bird and Wolffe, 1999). Although no one is
certain how DNA methylation serves to repress transcription, candidates include direct
blockage of transcription factors to their binding sites, alteration of local chromatin
structure through histone interactions and interplay among methylated DNA,
hyperacetylated histones and various DNA binding proteins, such as MeCP2 (Bird and
Wolffe, 1999). With the exception of brain, UBE3A is expressed biallelically in all

48
tissues examined (Rougeulle et al., 1997; Vu and Hoffman, 1997). Our data
demonstrate that 5’ UBE3A is normally unmethylated in a variety of tissues.
Therefore, we hypothesized that methylation of the maternal CpG island at 5’ UBE3A
could repress transcription of the maternal allele of UBE3A in Class V patients.
However, Southern analysis revealed that Class V patients are completely
unmethylated at 5’ UBE3A in PBL DNA, indicating that they do not inactivate UBE3A by
inappropriate methylation. To fully eliminate this possibility brain DNA from Class V
patients needs to be examined.
So far, our experiments have suggested that mutations in UBE3A are not the
sole cause of Angelman syndrome; additional factors must also be involved. The most
obvious candidates are other genes in the ubiquitin pathway, an extremely complex
cascade that initiates when ubiquitin is activated at its C-terminus by the E1-
activating enzyme (Ciechanover et al., 2000; Wilkinson, 2000). Once activated, the
ubiquitin molecule is transferred to one of about twelve E2 ubiquitin-conjugating
enzymes via a high-energy thiol-ester bond. Next, an E2 enzyme pairs with one of
several dozen E3 ubiquitin-protein ligases, forming a complex that transfers activated
ubiquitin first to the E3 enzyme then subsequently to the targeted protein. The E4
enzyme then polymerizes the ubiquitin, producing a multi-ubiquitinated protein that is
recognized and degraded by the 26S proteosome. This E2-E3 interaction is very
specific; UBE3A (an E3 enzyme) will form complexes with the ubiquitin-conjugating
enzymes UbcH7 and UbcH8, but not UbcH5 or UbcH6 (Kumar et al., 1997).
Furthermore, the temporal and spatial expression patterns of some E3 ligases may add
an additional layer of precision targeting (Anan et al., 1998).
Any protein that interacts with UBE3A in this cascade and all proteins that
UBE3A targets for degradation are good candidates for patients grouped in Class V. So

49
far, four proteins have been identified as substrates for UBE3A-mediated degradation:
p53, HHR23A, the Src family kinase Blk and UBE3A itself. It is not clear how any of
these genes could be involved in the etiology of AS, and given the complexity of the
ubiquitin system, identification of the specific AS gene or genes involved is a very
daunting task.
Alternatively, other 15q11-13 genes may play important roles in the etiology of
Class V patients. UBE3A is a complex gene subject to tissue-specific imprinting and
alternative splicing (Albrecht et al., 1997; Kishino and Wagstaff, 1998; Rougeulle et
al., 1997; Vu and Hoffman, 1997; Yamamoto et al., 1997). In certain cell types in
human and mouse brain, UBE3A is preferentially expressed from the maternal
chromosome. It is not clear from the present data if the human UBE3A gene shows
global but leaky imprinted expression or demonstrates tightly regulated cell-specific
imprinted expression where some cells types are imprinted, while neighboring cells
are not. Making the discovery of the mechanism of imprinted expression of UBE3A
even more difficult is the detection of an antisense transcript that overlaps the last six
exons of UBE3A (Rougeulle et al., 1998).
The UBE3A antisense transcript is a good AS candidate, as it exhibits an
expression profile that hauntingly mirrors UBE3A imprinted expression, as the
paternal-only expressed antisense transcript is only active in the tissues that also show
imprinted expression of UBE3A. The paternal-only expressed antisense transcript has
only been demonstrated to be active in the tissues that also show imprinted expression
of UBE3A (Rougeulle et al., 1998). One can envision a scenario whereby expression of
the antisense transcript from the paternal chromosome specifically inactivates the
paternal UBE3A allele in cis (Brannan and Bartolomei, 1999; Rougeulle et al., 1998).
According to this model, if the antisense transcript were activated biallelically in the

50
brain, both the maternal and paternal alleles of UBE3A would be repressed. It would
be interesting to determine if Class V patients demonstrated biallelic expression of the
UBE3A antisense transcript in brain.
Genotype-Phenotype Correlations
The second major goal of this study was to establish phenotypic profiles for
each molecular class so physicians could accurately diagnose AS and be able to predict
outcomes for the families of patients with Angelman syndrome. Recent studies have
shown that UPD (Fridman et al., 2000b; Smith et al., 1997) and ID (Burger et al., 1996;
Gillessen-Kaesbach et al., 1999; Saitoh et al., 1999) patients have less severe
phenotypes than the deletions. In addition, Monda and colleagues (1999b) revealed
that as a group, non-deletion patients (Classes ll-IV) were also less severely affected.
However, genotype-phenotype correlations have only revealed differences among the
first four classes in head circumference and frequency of seizures (Monda et al.,
1999b). Furthermore, no previous studies have reported on the phenotype associated
with Class V patients.
Genotype-phenotype analyses of our patients revealed that all five classes had
the four cardinal features of AS: severe developmental delay; profound speech
impediment; the AS-specific movément disorder; and the characteristic Angelman
behavior. Furthermore, some classes have additional characteristics that are often
associated with the Angelman syndrome, such as seizures, microcephaly and
hypopigmentation. Out of 22 separate parameters, 16 demonstrated statistical
differences among the five classes, at p<0.05. Our patients correlate well with those
in the literature, with similar findings in 13/16 categories. Our statistical models
demonstrated that the five classes could be separated into four phenotypic groups:
Class I; Classes II and III; Class IV; and Class V. Multiple clinical distinctions can be

51
made between the classes, with differences most striking in pigmentation; growth
parameters; achievement of developmental milestones; and severity, frequency and
age at onset of seizures.
We found that deletion patients as a group have the most classical and severe
phenotype. They achieve developmental milestones later and to a lesser degree than
the other classes, and are less likely to follow simple commands. Class i patients have
the highest incidence of severe seizures (90%) and hypopigmentation (90%) of all five
classes. In addition, deletion patients tended to have a complete absence of speech
(100%), a normal BMI distribution and severe microcephaly.
In contrast, UPD and ID patients (who have indistinguishable phenotypes) are
much less severely affected. They have low incidences of hypopigmentation (< 20%),
microcephaly and severe seizures (< 20%). In addition, about 50% of UPD and ID
patients from our repository can speak a few words. Patients in Classes II and III are
larger, heavier and often have better coordination. These two groups have very high
BMI indices. More than 70% of these individuals are above the 80th percentile for their
age group.
Our data correlate well with that of Fridman and colleagues (2000b) who
compared 19 AS patients with UPD from multiple studies to 21 deletion patients (Class
I). Their analysis showed that Class II patients also displayed a milder phenotype
similar to our observations. The Class II patients were heavier, walked earlier and
were less likely to have seizures, microcephaly or a complete lack of speech. Analyses
of Class III patients from other studies revealed that patients with imprinting
mutations also had a milder phenotype. They were less likely to have microcephaly
and often had normal pigmentation (Burger et al., 1996; Saitoh et al., 1999). In
addition, some studies revealed that patients from Classes II and III had fewer

52
seizures, early onset obesity and better motor skills (Fridman et al., 2000b; Gillessen-
Kaesbach et al., 1999; Smith et al., 1997).
UBE3A mutation patients fall somewhere in the middle. They are statistically
similar to deletion patients with 53% of patients having significant or recurring
seizures, early onset of seizures in most patients, a complete absence of speech in
more than 85% of patients and a high incidence of microcephaly. However,
statistically, Class IV patients are similar to UPD and ID patients in the development of
motor skills, ability to follow simple commands, pigmentation and development of
obesity. Monda and colleagues (1999b) examined Class IV patients individually for
head circumference and seizures. They also concluded that UBE3A mutation patients
had high incidences of seizures and microcephaly.
Class V patients are very interesting. Although these patients have no
detectable chromosome 15 abnormality, statistically they are most similar to the
deletion patients. Class V patients have normal height, weight and BMI distributions,
similar to that observed in Class I patients. They also typically present with a
complete absence of speech, early onset of seizures, hypopigmentation and
microcephaly. However, Class V patients walk about two years earlier than deletion
patients, and their seizures are less likely to be recurring or as severe as those
observed in patients from Class I.
Since Class V patients tend to have a more severe phenotype than that
observed in Classes II, III and IV, it is likely that disruption of more than one gene is
causative of AS in these patients. Perhaps Class V patients have a mutation in an
upstream gene on 15q11-13 that affects not only UBE3A, but also additional genes that
give rise to a more severe AS phenotype in these individuals. A good candidate gene
would be the UBE3A antisense transcript. Alternatively, Class V individuals may have

53
mutations in other genes in the ubiquitination pathway. Since the phenotype is
severe, we would predict that the mutation would be in a gene that controlled the
degradation of multiple proteins.
Our data indicate that Class I patients comprise a contiguous gene disorder,
with haploinsufficiency of multiple genes exacerbating the lack of the maternally
expressed UBE3A gene. Patients in Classes II and III have the least severe and most
atypical phenotype, suggesting that a double dose of the paternal-only expressed
genes may be ameliorating the AS phenotype in UPD and ID patients. Alternatively,
the moderate phenotype associated with UBE3A mutation patients may suggest that
haploinsufficiency of UBE3A may be detrimental during development and into
adulthood. Additionally, UBE3A protein levels may be tightly regulated in the central
nervous system and peripheral tissues. It is likely that a combination of the double
dose of the paternally expressed genes and haploinsufficiency of UBE3A both
contribute to the differences in phenotype observed between Classes II and III and
Class IV patients. Of all four non-deletion classes, the patients with no detectable
chromosome 15 abnormality most closely resemble Class I patients.
One puzzling finding is that over 50% of UPD, ID and UBE3A mutation patients
become extremely obese by puberty. These findings strongly insinuate that the three
classes must share a common genetic mechanism for this observation. The UPD and ID
patients suggest that a double dose of a paternal gene or genes could cause the
obesity. However, this explanation does not account for the UBE3A mutation patients.
Is it possible that disruption of the maternally-inherited UBE3A gene can stabilize a
protein that is responsible for the obesity phenotype or activate the maternal allele of
a paternally expressed gene?

54
This integrated study of the differing genotype-phenotype correlations found
among all classes of Angelman syndrome patients reveals that distinct clinical
subgroups exist. Although mutations in UBE3A are sufficient to cause the four cardinal
features of Angelman syndrome as well as recurrent seizures and microcephaly, other
15q 11-13 genes must contribute to the development of motor skills, severity of
seizures, cognition, growth and obesity.

55
A.
[hhmhí—o-4—tb—í
B CDEFGH
i i nr
1 2 3 4 5 67 8
—0—M-Oh
10 11 12 13 15 16
J K
o4—
B.
Site
Gene Mutation
Predicted Protein
Inheritance
Patient
A
G648A
C21Y
Maternal
AS179P
B
980 del 2
frameshift
Maternal
AS181P1
B
980 del 2
frameshift
Maternal
AS181P2
C
1522 del 2
frameshift
Maternal
AS180P1
C.
1522 del 2
frameshift
Maternal
AS180P2
D
1521 del A
frameshift
de novo
AS106P
E
C1835T
R417X
de novo
AS178P
F
1930 del 2
frameshift
Maternal
AS141P
G
C2030T
R482X
de novo
AS194P
H
A2033T
R483X
Maternal
AS169P1
El
A2033T
R483X
Maternal
AS169P2
H
A2033T
R483X
Maternal
AS169P3
H
A2033T
R483X
Maternal
AS169P4
J
3092 del A
frameshift
de novo
AS101P
K
3093 del 4
frameshift
de novo
AS152P
Figure 3-1. UBE3A mutations in AS patients from the UF repository.
A) Genomic organization of UBE3A. UBE3A spans 120 kb of genomic
DNA. Gene is shown to scale. Exons (â–¡ ) are numbered numerically
from 1-16. Translation (ATG) initiation sites are depicted. The primary
translation initiation site begins in exon 8. The location of each muta¬
tion is indicated by a letter (A-K). B) Description of mutations. The
mutation from each family (A-K) is shown in column 2. Column 3
describes the predicted protein changes, while column 4 shows the
inheritance of the mutation.

56
A.
B.
C.
PBL
AS Brain Germ Cells
Class V AS Patients
.¡ftp-go
I
n - t
^ m c
I
1 2 3 4 5 6 7 8 9 10 11 12 13
14 15 16 17 18 19 20 21 22 23
Figure 3-2. DNA methylation analysis of 5’ UBE3A. A) Genomic structure
of UBE3A and the 5’ CpG island (0.5 kb black bar) drawn to scale. Selected
restriction enzyme sites are shown: Eco Rl (E), Not I (N), BssH II (B), Eag I
(G). The location of the 2.7 kb Not l-Eco Rl probe is shown, as is the posi¬
tion of the 5.1 kb Eco Rl fragment that surrounds the CpG island. The
extent of overlap of the antisense transcript is also shown. If the CpG
island is methylated, the 2.7 kb probe will hybridize to a 5.1 kb fragment
on genomic DNA digested with Eco Rl and Not I. If the CpG island is
unmethylated, the probe with hybridize to itself, revealing a 2.7 kb
fragment. B) Southern blot of normal (NL), AS (A) and PWS (P) genomic
DNA from peripheral blood leukocytes (PBL); frontal cortex (F), occipital
lobe (Oc), cerebellum (C) and coronal section (Sx) from AS brain; frontal
cortex from normal brain; adult testis (T); sperm (S); and fetal ovary (Ov)
digested with Eco Rl and Not I. DNA from normal PBL was also digested
with Eco Rl alone as a control (E). When digested with Eco Rl and Not I, the
2.7 kb probe only hybridized to a 2.7 kb fragment, indicating that the CpG
island was unmethylated. C) Southern blot of PBL genomic DNA from Class
V patients digested with Eco Rl and Not I reveals that the UBE3A CpG island
is unmethylated in all patients.

O A
I
▼▼
8
T¡T 1
AAO
1
O
1?
+
T Out of frame insertion
A Out of frame deletion
♦ Splicing mutation
â–  Out of frame deletion/insertion
• Nonsense mutation
O Missense mutation
% Inframe insertion
Q Inframe deletion
❖ Inframe deletion-elongated protein
+ Putative splicing mutation
Figure 3-3. Summary of all published mutations in UBE3A. Gene is shown to scale. Exons are numbered numerically
from 1-16. Transcription (arrow) and translation (ATG) start sites are noted. The primary translation initiation site begins
in exon 8. The location of each mutation is indicated by a symbol. Filled symbols indicate protein-truncating mutations.
Symbols are stacked at positions where two non-related individuals share a common mutation. There are 51 total muta¬
tions in unrelated individiuals. Forty-five mutations are unique. Familial mutations are counted once. Most mutations
(38/45) are protein truncating and cluster in exons 9 and 16.
UT

Figure 3-4. Mean BMI, HC, age to walk and onset of seizures. Boxes show the extent of 25-75 % of the patients, while bars
(T) depict the range. Median (-), mean (+), outliers ( and extreme outliers ( A are shown. ^Statistically significant in UF
and combined data sets. §Statistically significant in UF data only. Molecular class (l-V) is shown at the bottom of each graph.
The percentiles (A and B) and age in years (C and D) are shown at left. A) Body mass index percentiles. B) Head
circumference percentiles. C) Mean age to walk. D) Mean age at onset of seizures.
i_n
oo

DNA METHYLATION AND EXPRESSION ANALYSES OF UBE3A IN THE HUMAN BRAIN
Introduction
The Angelman (AS) and Prader-Willi (PWS) syndromes, two distinct
neurobehavioral disorders, are the best-studied examples of genomic imprinting in
humans. AS is characterized by severe developmental delay, a profound speech
impairment, as well as AS-specific movement and behavioral disorders (Williams et al.,
1995b). In stark contrast, patients with PWS initially present with infantile hypotonia
and failure to thrive. However, by 18 to 36 months of age, individuals with PWS
display several unique characteristics including mild to moderate mental retardation,
early onset obesity caused partially by hyperphagia, an obsessive-compulsive disorder,
and hypogonadism (Holm et al., 1993). In these very different imprinted disorders,
the parental origin of the chromosome 15 abnormality determines the phenotype.
PWS occurs from the lack of critical paternally expressed 15q11-13 sequences, while
multiple mechanisms that disrupt the maternally inherited E3 ubiquitin protein-ligase
gene (UBE3A) cause AS.
In the AS/PWS imprinted domain, at least nine known genes and several newly
identified imprinted transcripts have been shown to be expressed exclusively from the
paternal allele (Dittrich et al., 1993; Driscoll et al., 1992; Glenn et al., 1996; Gray et
al., 1999; Jay et al., 1997; Jong et al., 1999; Kubota et al., 1996b; Lee and Wevrick,
2000; Rougeulle et al., 1998; Sutcliffe et al., 1994). These genes include MKRN3,
MKRN3-AS, MAGEL2, NDN, SNURF-SNRPN, IPW and the UBE3A antisense transcript.
59

60
With the exception of IPW, all of these genes exhibit imprinted expression in all
tissues examined (Lee and Wevrick, 2000). Only the Angelman gene, UBE3A,
demonstrated preferential expression from the maternal allele, which was limited to
the brain (Albrecht et al., 1997; Nakao et al., 1994; Rougeulle et al., 1997; Vu and
Hoffman, 1997). Studies in mice revealed that imprinted expression of Ube3a was
cell-specific, as whole mouse brain failed to show maternal-only transcription
(Sutcliffe et al., 1997). Further experiments revealed that complete imprinted
expression of Ube3a was limited to the CA2 and CA3 regions of the hippocampus,
mitral cell layer of the olfactory bulb and purkinje cells in the cerebellum (Albrecht et
al., 1997). However, other brain regions demonstrated biased transcription from the
maternal allele.
The promoter regions of imprinted genes show differential methylation based
on the parental origin of the chromosome (Razin and Cedar, 1994). In the 5’ region of
imprinted genes, the repressed, maternal alleles are heavily methylated, while the
expressed, paternal alleles are undermethylated. DNA methylation of promoter
regions is closely associated with transcriptional repression and has been shown to
inactivate tumor suppressor genes, while demethylation of promoters can lead to
activation of proto-oncogenes (Baylin et al., 1998; Feinberg, 2000; Tycko, 2000). In
addition, demethylation has been shown to occur in long-term cell culture,
reactivating the maternal alleles of SNRPN and MKRN3 (Saitoh and Wada, 2000).
Several paternal-only expressed genes within the AS/PWS imprinted domain display
parent-of-origin DNA methylation imprints in peripheral blood leukocyte (PBL) DNA
(Boccaccio et al., 1999; Driscoll et al., 1992; Glenn et al., 1996; Jay et al., 1997; Jong
et al., 1999; Kubota et al., 1996a; Lee et al., 2000; Sutcliffe et al., 1994). However,
when we examined the CpG island at 5’ UBE3A we found no evidence for a DNA

61
methylation imprint in DNA derived from PBL, brain tissues or germ cells (Lossie et al.,
in preparation). Both the maternal and paternal alleles were completely
unmethylated, even in tissues that had previously revealed imprinted expression of
UBE3A.
DNA methylation analyses of the paternally expressed genes suggested that
methylation of the promoter regions on the maternal alleles was responsible for
imprinted expression. However, no DNA methylation imprint has been shown to exist
at UBE3A. Therefore, we wanted to test whether specific cell types in the human
brain demonstrated imprinted expression of UBE3A and determine if some of these
imprinted tissues also demonstrated DNA methylation imprints at the CpG island
located in the promoter of UBE3A.
Materials and Methods
Human Subjects and Tissue Samples
All patients with AS and PWS were deletions with a classical phenotype (Holm
et al., 1993; Williams et al., 1995a). Tissues from patients with AS were obtained
from the University of Florida Brain Bank, while tissue samples from the PWS and
control subjects were obtained from the University of Miami Brain Bank (1889, 1199,
2144 and 2803). These studies were approved by the institutional review board at the
University of Florida and informed consent was obtained from all patients and/or
parents.
RNA Isolation
Formalin Fixed Paraffin Embedded Samples (FFPE). On day one, tissue
sections were deparaffinized in subsequent 15 min. xylene washes of 5 and 2 ml at
37°C. Each wash was followed by centrifugation at 10,500 g for 15 min and removal of

62
supernatant. Xylenes were removed by two 100% ethanol washes (5 and 2 ml) at 37°C
for 30 min. each. A 30 min. centrifugation step at 10,500 g followed each ethanol
wash. Pellets were dried briefly before the addition of 2 ml RNA lysis buffer (0.2 M
Tris-HCl, pH 7.5, 0.2 M NaCl, 1.5 mM MgCl2 and 2% SDS) and 100 pi Proteinase K (10
mg/ml). Samples were homogenized with a tissumizer, and incubated at 42°C
overnight. Another 0.5 ml of RNA lysis buffer and 100 pi of Proteinase K were added
each day for 3 successive days. Nucleic acids were purified by phenol/chloroform
extraction and ethanol precipitated. Genomic DNA was removed by DNase I (Roche)
digestion. Five pg of total nucleic acids were incubated at 37°C with 100 U of DNAse I
for 60 min. in 1X PCR buffer (Roche), purified by phenol/chloroform extraction and
ethanol precipitation.
Fresh Frozen Tissues. RNA was isolated from fresh frozen tissues according to
established protocols (Chomczynski and Sacchi, 1987).
RT-PCR
cDNAs (total, UBE3A and UBE3A antisense) were generated from 250 ng of fresh
frozen and FFPE total RNA according to standard procedures (Life Technologies) using
either random hexamers or previously published primers (Rougeulle et al., 1998). PCR
products from UBE3A, the UBE3A antisense transcript, SNURF-SNRPN and the
transferrin receptor (TR) were amplified, size fractionated by gel electrophoresis,
blotted and hybridized with one of the primers used for PCR. PCR primers from exons
13 and 14 and exon 16 were used to amplify UBE3A and the UBE3A antisense
transcript, respectively (Lossie et al., in preparation). SNURF-SNRPN primers from
exons 1-3 (previously -1 to 1) have been previously published (Glenn et al., 1996).
Primers were designed to amplify a 299 bp product from the TR, to control for
transcript levels. The forward primer, which starts at nucleotide 346, is 5’-GCTACTTG

63
GGCTATTGTAAAGGG-3’, while the reverse primer is 5’-ACGCCAGACTTTGCTGAGTT-3’
and ends at nucleotide 644 of the TR. One primer from each PCR reaction was labeled
by kinasing (Promega) 400 ng in a standard reaction containing 40 pCi 32P ydATP
(Amersham). Labeled primers were hybridized to Southern blots of PCR products
overnight at TH in 6 X SSCP, 0.1% SDS, 1 X Denhardt’s and 20 mg/ml single stranded
salmon sperm DNA. TH is Tm minus 5°C. the oligo in 2 X SSCP; 0.1% SDS. Excess probe
was removed by two 15 min. washes in preheated, freshly prepared hybridization
buffer. Products were visualized by autoradiography.
DNA Methylation
Methylation Specific PCR. Sodium bisulfite treatment of genomic DNA from
fresh frozen tissues and subsequent methylation analysis of SNRPN was done according
to previous protocols (Kubota et al., 1997; Lossie and Driscoll, 1999). Two sets of
primers were designed to assess the methylation status of both Not I sites in the
UBE3A CpG island. At the proximal end of the CpG island (more 5’) the primers are as
follows: methylated primer set (M1F 5’-CGTCGCGGTCGCGAGATT-3’ and M1R 5’-
ACGCGCCGAATCGACAAAA), unmethylated primer set (U1F 5’-GTGTTGTGGTTGTGAGAT
TTGTG-3’ and U1R 5’-ACAAACACCCACACTAACAAATAACT-3’). The primer sets that
amplify the distal CpG island are as follows: methylated primer set (M2F 5’-GATAGGTA
GCGGCGGTTGGCGACGAA-3’ and M2R 5’-GCGCCTAAACTACGACGACCGCCTCA-3’,
unmethylated primer set (U2F 5’-GAATGTTGGGAl I I lGGTGGT-3’ and U2R 5’-
AAACTACAACAACCACCTCACTAATCA-3’). PCR products were stained with ethidium
bromide and visualized on an Eagle Eye II photodocumentation system (Stratagene).
Southern Analysis. Southern analysis of SNRPN and UBE3A were performed
according to published protocols (Glenn et al., 1993b; Lossie et al., in preparation).

64
Results
UBE3A Does Not Demonstrate a DNA Methylation Imprint
In our previous analysis of the different classes of Angelman syndrome patients,
we demonstrated that UBE3A was unmethylated in all tissues examined, including four
distinct regions of the human brain (Figure 3-2). Interestingly, one region, frontal
cortex, had previously been shown to demonstrate imprinted expression of UBE3A. We
developed a novel PCR based assay to assess the DNA methylation status of UBE3A by
sodium bisulfite.
We designed four sets primers to amplify the proximal and distal regions of the
UBE3A CpG island (Figure 4-1A). At both the proximal and distal ends of the CpG
island, PCR products were only generated from the unmethylated primers in all AS,
PWS and control samples (Figure 4-1B). A PCR product from the methylated primers
was amplified in cosmid DNA treated with Sssl CpG methylase (Figure 4-1B). As a
control, the same brain tissues were assayed for methylation status at 5’ SNRPN
(Figure 4-1C). In the AS brain tissues, only the unmethylated SNRPN allele was
amplified, while only the methylated allele was amplified in PWS brain samples. Both
alleles were present in control samples.
Expression Analysis of UBE3A and the Antisense Transcript in the Brain
To date, the only region of the human brain proven to show imprinted
expression of either UBE3A or the antisense transcript is the frontal cortex (Rougeulle
et al., 1997). However, mouse studies suggest that other distinct regions of the
human brain may also demonstrate imprinted expression of UBE3A (Albrecht et al.,
1997). We examined imprinted expression of UBE3A, the antisense transcript and
SNURF-SNRPN in brain tissues from AS, PWS and control individuals.

65
We assessed imprinted expression of UBE3A and the antisense transcript by
strand-specific RT-PCR (Figure 4-2A). Three cDNA pools were generated from each 250
ng total RNA sample: total cDNA derived from random hexamers, UBE3A sense and
UBE3A antisense transcripts. SNRPN and the transferrin receptor were amplified from
the total cDNA pool. PCR primers from exons 13 and 14 were used to amplify the
UBE3A gene, while primers from introns 12 and 14 amplified the UBE3A antisense
transcript. UBE3A was predominantly expressed in PWS brain samples (maternal
expression), and the UBE3A antisense transcript was predominantly expressed from
the paternal allele, as it was observed in AS, but not PWS brains (Figure 4-2B).
Prolonged exposure of the UBE3A Southern revealed that UBE3A was expressed at very
low levels in all three AS brain samples. However, SNRPN was only expressed from the
AS samples. UBE3A, the antisense transcript, SNRPN and the TR were expressed in
cDNA pools from control brains (data not shown).
Discussion
DNA methylation of promoter regions is closely associated with transcriptional
repression (Bird and Wolffe, 1999). With the exception of Mash2, and now UBE3A, all
well-studied imprinted genes display parent-of-origin methylation imprints (Glenn et
al., 1997; Razin and Cedar, 1994; Tilghman, 1999), including all of the well-
characterized paternally expressed genes within 15q11-13. The maternal alleles of
MKRN3 (Driscoll et al., 1992), NDN (Jay et al., 1997) and SNURF-SNRPN (Glenn et al.,
1996; Sutcliffe et al., 1994) demonstrate preferentially methylation in the promoter
regions. In addition, several anonymous CpG sites within the AS/PWS imprinted
domain also demonstrate DNA methylation imprints. The best studied of these is
PW71 (Dittrich et al., 1993), but several sites within the imprinting center (IC) also
demonstrate DNA methylation imprints (Farber et al., 1999). Including SNURF-SNRPN,

66
ten sites within the 1C show differential methylation between the parental
chromosomes. Nine of these CpGs are preferentially methylated on the maternal
allele.
DNA methylation of the promoter regions of the paternally expressed genes
within the AS/PWS imprinted domain correlates well with what is presently known
about methylation-induced repression (Bird and Wolffe, 1999). Data from the present
study suggest that imprinted expression of UBE3A occurs via a novel mechanism. One
possible reason for the lack of a DNA methylation imprint in UBE3A could have been
that differential methylation only occurred in discreet regions of the human brain.
However, we would expect that the regions demonstrating imprinted expressed would
also reveal a DNA methylation imprint. It is clear from our present studies that no
DNA methylation imprint exists at the CpG island at 5’ UBE3A in six different brain
regions, although some of these tissues demonstrate imprinted expression of UBE3A.
Therefore, it is unlikely that repression of UBE3A occurs by DNA methylation at the
promoter.
An alternative explanation for imprinted expression of UBE3A stemmed from
the discovery of a brain-specific UBE3A antisense transcript (Rougeulle et al., 1998).
Examination of frontal cortex from single AS and PWS samples revealed that UBE3A
was preferentially expressed from the maternal allele, while the antisense transcript
was preferentially expressed from the paternal allele. However, amplification of the
3’ UTR revealed biallelic expression of UBE3A using the same AS sample (Lee and
Wevrick, 2000). Since strand-specific reverse transcription was not done, biallelic
expression was expected in this reaction. It is important to note that both transcripts
are expressed at low levels (5-10% ) from the repressed alleles (Rougeulle et al.,
1998). The authors postulated that co-expression of UBE3A and the antisense

67
transcript from the same chromosome would result in silencing of the UBE3A gene in
c/s, accounting for the maternal-only expression of UBE3A in brain.
Given that UBE3A was completely unmethylated in all tissues examined, this
was an attractive hypothesis. In order to test this possibility, we analyzed imprinted
expression of UBE3A and the antisense transcript in two AS patients (paternal only),
two PWS individuals (maternal only) and two normal controls (biparental). Our studies
supported this model, revealing that UBE3A was preferentially expressed from the
maternal allele in several regions of the human brain including frontal cortex,
hippocampus and cerebellum while the antisense transcript was only expressed from
the paternal allele.
The lack of a DNA methylation imprint at 5’ UBE3A combined with the
discordant expression of the UBE3A sense and antisense transcripts suggest that DNA
methylation of the promoter region of UBE3A does not account for imprinted
expression. Our data support an alternative mechanism of imprinted expression of
UBE3A. We believe that expression of the antisense transcript results in repression of
UBE3A, in cis. This could occur through multiple mechanisms, which depend upon
nuclear localization of the antisense transcript. If the antisense transcript remains
localized to the expressed allele, in a scenario similar to Xist, then RNA interference
would be a good candidate for repression of UBE3A. However, if the antisense
transcript can diffuse throughout the nucleus (e. g. act in trans), an alternative
mechanism would have to account for the allele-specific repression. Perhaps
expression of the antisense transcript can cause changes in chromatin structure that
precludes expression of UBE3A.
Further studies examining DNA methylation and imprinted expression in
additional regions of the human brain will help us to better understand the mechanism

68
of imprinted expression of UBE3A, and demonstrate which regions in the human brain
are important in the AS phenotype.

A.
Proximal
Distal
5'
Not 1
l
Not I
L
M1F “
U1F â– 
— 209 bp — M1R
■166 bp — U1R
M2F-
U2F-
- 204 bp -
— 175 bp 1
â–  M2R
-U2R
B.
AS
PWS
Control
S FBOTeOvFHOvB FHB FHYOvB
- •«***. **** ->mmm mmm mmm mm* mmm mm* mm* mmm mm - — *****
H Y BrTeSpTe MW
Figure 4-1. Methylation analysis of brain DNA. A. Scale Map of UBE3A.
exon 1. The proximal and distal regions assayed as well as Not I sites are
indicated. Primer designations (methylated = M and unmethylated = U)
are located below their positions and amplification product sizes are
shown. B. Methylation specific PCR at UBE3A. PCR products from the
proximal and distal regions are indicated. Brain regions and germ cells are
denoted: Coronal section (S), Frontal cortex (F), Cerebellum (B), Occipital
lobe (O), Flippocampus (FI), Flypothalamus (Y), Brain (Br), Testis (Te),
Ovary (Ov) and Sperm (Sp). Cosmid DNA treated with Sss I methylase (M)
and water (W) controls are indicated. C. Methylation specific PCR at 5'
SNRPN. The maternal, methylated (M) and paternal, unmethylated (P)
alleles are shown. Sizes (bp) of each fragment are also indicated. AS,
PWS and Control brain regions are the same as above. Control PBL DNAs
are also noted: AS (A), PWS (P) and control (NL).

A.
UBE3A
Antisense transcript
B.
AS Brain PWS Brain
FC CSx FC FC HI FC CB HI
RT - +
UBE3A
UBE3A-AS
■¿amara,
SNRPN
m
life
m
TR
:
Figure 4-2. Imprinted expression of UBE3A in brain. A. Map of
UBE3A and the antisense transcript. Relevent exons are numbered.
Primers used for RT reactions are designated (*). Remaining primers
were used for PCR. B. RT-PCR analysis. Regions of the brain are
noted: frontal cortex (FC), Coronal section (CSx), Hippocampus (Hi)
and Cerebellum (CB). Primers from exons 13 and 14 were used to
amplify UBE3A. Primers from intron 15 and exon 16 were used to
amplify the antisense transcript. Exons 1 - 3 of SNRPN were analyzed.
Strand-specific primers were used to amplify UBE3A (4 and 6) and the
antisense transcript (3). The transferrin receptor (TR) was used as a
control.

CONCLUSIONS AND DISCUSSION
The past six years have seen very exciting developments occur in Angelman
syndrome research. Since early 1997, the field has progressed at a very fast pace.
During the past four years, the AS gene (UBE3A) has been cloned (Kishino et al., 1997;
Matsuura et al., 1997). Within seven months of the report of mutations in UBE3A in
several AS patients, imprinted expression of UBE3A was demonstrated in human and
mouse brain (Albrecht et al., 1997; Rougeulle et al., 1997; Vu and Hoffman, 1997).
Angelman syndrome was the first human disease shown to be caused by mutations in
the ubiquitin pathway, and has paved the way for the cloning of additional disease
genes, including the discovery of mutations in another E3 ligase in the non-agouti-
lethal a18H mouse (Perry et al., 1998). This mouse displays the itchy phenotype,
characterized in part by constant itching due to hyperplasia of the forestomach
epithelia, and revealed that the ubiquitin pathway was critical for immune response.
Several new genes and transcripts have bseen localized to the AS/PWS domain (Lee
and Wevrick, 2000), including an antisense transcript was found to overlap the 3’ end
of UBE3A (Rougeulle et al., 1998). Five mouse models of AS have also been generated
to help in the study of the mechanisms of imprinted expression of UBE3A (Cattanach
et al., 1997; DeLorey et al., 1998; Gabriel et al., 1998; Jiang et al., 1998; Johnson et
al., 1995). Analyses of AS and PWS patients have demonstrated that the imprinting
center (IC) consists of separate AS and PWS domains, although the mechanisms of
imprinted expression of the maternal and paternal genes has yet to be discovered.
71

72
In addition to these discoveries, my research has revealed several new findings.
During the study of one of our AS deletion patients, we discovered that female AS
patients have the ability to reproduce (Lossie and Driscoll, 1999). This important
discovery has serious implications for families and caretakers of AS patients, and
implies that social cognitive behaviors, not physiological defects, prevent most AS
patients from reproduction. Studies of the different molecular classes of AS have
revealed multiple new findings. I have shown that there are five molecular classes of
AS, but four phenotypic AS groups (Lossie et al., in preparation). This research has
also revealed that the fifth class of AS patients has a more severe phenotype than the
UPD, ID or UBE3A mutation patients, implying that multiple genes may be disrupted in
these patients. I have examined several regions of the brain, but found no evidence of
a DNA methylation imprint associated with UBE3A. Out of all of the > 35 known
imprinted genes, Mash2 is the only other known transcript without a DNA methylation
imprint (Tilghman, 1999). In addition, my RT-PCR analyses of UBE3A and the antisense
transcript suggest that imprinted expression of UBE3A is regulated in cis by the
antisense transcript, suggesting that a novel mechanism underlies imprinted
expression of UBE3A in the brain.
Molecular Classes of AS
Results of my analysis of AS patients from the University of Florida repository
demonstrates that five major molecular mechanisms cause AS: Class I) 4 Mb maternally
inherited deletions of 15q11-13; Class II) paternal uniparental disomies (UPD); Class III)
imprinting defects (ID); Class IV) patients with intragenic mutations in UBE3A; and
Class V) patients with no known defects.

73
Class I Patients
The advent of high resolution chromosome analysis in the late 1980s allowed
the localization of the AS gene to human chromosome 15 by the detection of 3-5 Mb
interstitial deletions of 15q11 -q13 in several AS patients (Kaplan et al., 1987; Magenis
et al., 1987). Initial observances indicated that the AS deletion was identical to that
seen in Prader-Willi syndrome. However, evidence soon indicated that in Class I AS
patients, the deletion was always maternally inherited (Knoll et al., 1989; Zackowski
et al., 1993), while PWS deletions were always of paternal origin (Butler et al., 1986;
Knoll et al., 1989).
Deletion patients have the most severe phenotype and represent a contiguous
gene disorder, with haploinsufficiency of several non-imprinted genes along 15q 11-13
exacerbating the phenotype. Some striking differences between Class I individuals and
the other patients are the frequency and severity of seizures. All Class I patients have
seizures, and 90% have recurring bouts of epilepsy. The most obvious genes affecting
seizures in deletion patients are the three GABA receptors, which are located about 2
Mb distal to UBE3A. Mice with null mutations in Gabaft3 recapitulate several of the AS
characteristics, including balance abnormalities, seizures, abnormal EEG patterns,
sleep disturbances and learning defects (DeLorey et al., 1998). However, mice
heterozygous for the disruption have wild type features. It would be interesting to
study the phenotype of mice with disruptions in all three GABA receptors. In addition
to seizures, most deletion patients are hypopigmented, microcephalic and have poorly
developed motor skills.
Class II Patients
Uniparental disomy of chromosome 15 also occurs in both syndromes-maternal
UPD in PWS (Class II; (Mascari et al., 1992; Nicholls et al., 1989) and paternal UPD in

74
AS patients (Class II; (Malcolm et al., 1991; Nicholls et al., 1992). The identification of
AS patients with UPD of chromosome 15 conclusively demonstrated that AS was an
imprinted disorder, as absence of the maternally derived 15q 11-13 chromosomal
region resulted in the Angelman syndrome phenotype.
In the UF patient repository, 7 % of patients had paternal UPD for chromosome
15 (Lossie et al., in preparation). Hypopigmentation only occurred in 20% of UPD
patients, and less than 15% of UPD patients suffered from recurring episodes of
epilepsy or microcephaly. In addition, 96% of Class II patients could walk by five years
of age, twice the frequency observed in deletion patients. These patients had a much
less severe phenotype than the deletion patients, indicating that twofold expression of
the paternal-only genes may be ameliorating the AS phenotype.
Class III Patients
A third subset of AS and PWS patients (ID patients) have mutations in the
mechanism(s) involved in the imprint process. Mutations and spontaneous defects in
the imprinting center (IC) cause the maternal chromosome to adopt a paternal
epigenotype along 15q11-13, with these individuals having paternal DNA methylation
and expression imprints (Glenn et al., 1993a; Reis et al., 1994). About 50% of Class III
AS patients have detectable micro'deletions in the imprinting center. The remaining
Class III AS patients have no detectable mutations, but show an AS epigenotype across
the 2 Mb imprinted domain (Buiting et al., 1998). Recently the AS smallest region of
overlap (SRO) for the IC region has been narrowed to 0.9 kb, while the PWS-SRO in the
IC has been narrowed to 4.3 kb (Buiting et al., 1999).
Although they a different molecular mechanism causes AS in IC and UPD
patients, statistically the two classes have indistinguishable phenotypes. This

75
observation demonstrates that the only imprinted domain on chromosome 15 is the
AS/PWS region.
Class IV Patients
Several patients have biparental inheritance of chromosome 15 with normal
DNA methylation at several loci within the AS/PWS imprinted domain. Mutation
analysis of UBE3A, revealed protein truncating mutations in several AS individuals
(Kishino et aL, 1997; Matsuura et al., 1997). Mutation analysis of UF patients revealed
the existence of five molecular classes, as only 44% of sporadic patients with normal
methylation had intragenic mutations within UBE3A (Lossie et al., in preparation).
Mutations, which were mostly protein truncating, were found throughout the coding
region, with clusters in the HECT domain and in exon 9.
As a group, UBE3A mutation patients achieve developmental milestones faster,
are more likely to follow simple commands, have less severe seizures that begin at a
later age and are heavier than deletion patients. However, unlike UPD and ID
patients, individuals from Class IV tend to have a higher incidence of significant or
recurring seizures and often display microcephaly. Monda and colleagues (1999b)
examined Class IV patients individually for head circumference and seizures. They
also concluded that UBE3A mutation patients had high incidences of seizures and
microcephaly.
Class V Patients
Previous studies showed that the majority of patients with normal DNA
methylation do not have detectable abnormalities on chromosome 15 (Fang et al.,
1999; Malzac et al., 1998). In UF patients, about 10 % of all classical AS patients fall
into this group. Not much is known about the etiology of AS in these patients. It has

76
been postulated that they have mutations in other genes in the ubiquitin pathway or in
UBE3A substrates. Alternatively, they could have disruptions in other 15q11-13 genes
that interfere with UBE3A expression.
Class V patients are very interesting. They were not significantly different
from deletion patients across several phenotypic categories. Class V patients have
normal height, weight and BMI distributions, similar to that observed in Class I
patients. They also typically present with a complete absence of speech, early onset
of seizures, hypopigmentation and microcephaly. However, Class V patients walk
about two years earlier than deletion patients, and their seizures are less likely to be
recurring or as severe as those observed in patients from Class I. Since Class V
patients tend to have a more severe phenotype than that observed in Classes II, III and
IV, it is likely that disruption of more than one gene is causative of AS in these
patients. That they closely resemble UPD, ID and UBE3A mutation patients in their
type and severity of seizures indicates that UBE3A may also be disrupted in these
patients. Class V patients also had a higher frequency of hypopigmentation compared
with Classes II, III and IV. Maybe these phenotypes can yield clues as to the
mechanism(s) involved in the pathogenesis of AS in these individuals.
Genotype-phenotype Correlations among the Five Classes of AS
Several articles in recent literature have compared the phenotypes associated
with patients from Classes II and III with Class I individuals (Burger et al., 1996;
Fridman et al., 2000b; Gillessen-Kaesbach et al., 1999; Saitoh et al., 1997; Saitoh et
al., 1999; Trent et al., 1997). However, extensive genotype/phenotype correlations
among the first four classes of AS patients has been limited (Monda et al., 1999b), and
no studies have examined the phenotype associated with Class V patients.

77
Genotype/phenotype analyses of our patients revealed that all 5 classes of
patients had the four cardinal features of AS: severe developmental delay and/or
mental retardation; severe speech impediment; an unsteady, ataxic gait with uplifted
hands; and the characteristic happy affect. Furthermore, some Classes have
additional characteristics that are often associated with the Angelman syndrome, such
as seizures, microcephaly and hypopigmentation. Our statistical models demonstrated
that distinct phenotypic differences occur amongst the molecular classes. The five
classes of patients can be separated into four phenotypic groups: Class I, Classes II and
III, Class IV, and Class V. Overall, Class I patients are the most severely affected,
while Classes II and III are the least. Classes IV and V differ from each other at several
criteria, but fall between Class I and Classes II and III in severity. Multiple clinical
distinctions can be made between the classes, with differences most striking in
pigmentation; growth parameters; achievement of developmental milestones; and
severity, frequency and age at onset of seizures.
Our data indicate that Class I patients comprise a contiguous gene disorder,
with haploinsufficiency of multiple genes exacerbating the lack of the maternally
expressed UBE3A gene. Patients in Classes II and III have the least severe and most
atypical phenotype, suggesting that a double dose of the paternal-only expressed
genes may be ameliorating the AS phenotype in UPD and ID patients. Alternatively,
the more severe phenotype associated with UBE3A mutation patients could indicate
that haploinsufficiency of UBE3A may be detrimental during development and into
adulthood. Additionally, UBE3A protein levels may be tightly regulated in the central
nervous system and peripheral tissues. It is likely that a combination of the double
dose of the paternally expressed genes and haploinsufficiency of UBE3A both

78
contribute to the differences in phenotype observed between Classes II and III and
Class IV patients.
Of all four non-deletion classes, the patients with no detectable chromosome
15 abnormality most closely resemble Class I patients. Perhaps Class V patients have a
mutation in an upstream gene on 15q11-13 that affects not only UBE3A, but also
additional genes that give rise to a more severe AS phenotype in these individuals. A
good candidate gene would be the UBE3A antisense transcript. Alternatively, Class V
individuals may have mutations in other genes in the ubiquitination pathway. Since
the phenotype is severe, we would predict that the mutation would be in a gene that
controlled the degradation of multiple proteins.
What is the Epigenetic "Mark?”
Imprinted genes display several distinguishing characteristics: differential
methylation and allele-specific expression patterns between the maternal and
paternal alleles, the presence of non-coding and/or antisense RNA transcripts,
asynchronous DNA replication timing, GC rich sequences, and direct repeats (Glenn et
al., 1997; Razin and Cedar, 1994; Sleutels et al., 2000). In addition, genomic
imprinting can impart transcriptional changes in a single gene or alter expression
patterns of groups of genes across Several megabases (Mb; Glenn et al., 1997). Recent
attention has focused on determining the mechanism that establishes the epigenetic
mark, or imprint, between the maternal and paternal alleles. Multiple mechanisms
have been proposed to perform this tagging, including DNA methylation, chromatin
structure, c/s-acting elements and DNA replication timing. Human and murine studies
indicate that the mechanisms involved in imprinting must be able to: 1.) Set the
imprint in the gametes; 2.) Maintain this epigenetic modification in somatic tissues;
3.) Alter the expression or repression of imprinted genes and 4.) Erase the imprint

79
during gametogenesis and reset it according to the sex of the offspring (Driscoll,
1994).
DNA Methylation
DNA methylation is a good candidate for the establishment and maintenance of
the imprint. After replication, hemi-methylated DNA is recognized by the
maintenance DNA methyltransferase protein, which methylates the daughter strand,
propagating the methylation status of the allele. Driscoll et al., (1992) were the first
to propose DNA methylation as a diagnostic tool for identifying imprinted genes. With
the exception of UBE3A and Mosh2, all imprinted genes display differential
methylation sites that show parent-of-origin methylation imprints (Glenn et al., 1997;
Razin and Cedar, 1994; Tilghman, 1999). Targeted disruption of the DNA
methyltransferase gene (Dnmtl) in mice provided initial evidence for the role of DNA
methylation in genomic imprinting (Li et al., 1993). Inactivation of Dnmtl repressed
the normally active Igf2r, Igf2 and Kvlqtl alleles and activated the repressed copies of
the H19, Xist, Cdklc and Snrpn genes (Caspary et al., 1998; Li et al., 1993; Shemer et
al., 1997). In order for DNA methylation to be accepted as an "imprinting mark,” one
must identify imprints that are established in the germ line and maintained
somatically during and after development. In addition, these tags should escape the
global wave of demethylation that occurs during early embryogenesis (Brandéis et al.,
1993; Szabo and Mann, 1995; Tada et al., 1997). To date, gametic imprints have been
identified in five genes: SNRPN (human and mouse), MKRN3, Igf2r, H19 and Gnas
(Glenn et al., 1996; Jones et al., 1996; Jong et al., 1999; Liu et al., 2000; Shemer et
al., 1997; Stoger et al., 1993; Tremblay et al., 1995). My studies demonstrated that
DNA methylation was not responsible for imprinted expression of UBE3A, as no
methylation imprint was found in any tissue (Lossie et al., in preparation).

80
Cis-acting Elements
In addition to primary DNA methylation imprints, other ds-acting elements can
be found in multiple imprinted regions. These elements often have long-range
effects, and differential DNA methylation appears to be a common factor in these ds-
acting elements. For example, within the 2 Mb imprinted domain on human
chromosome 15q11-13, the Prader-Willi syndrome imprinting center (PWS-IC) controls
the establishment and maintenance of imprinted expression of the paternally
expressed genes along the entire imprinted domain (Bielinska et al., 2000). Additional
studies from this region indicate that there is also a separate Angelman syndrome
imprinting center (AS-IC) that potentially works in the same manner on the
homologous chromosome (Buiting et al., 1995; Farber et al., 1999; Saitoh et al.,
1996). Similar imprinting centers have also been identified in the Igf2/H19 imprinted
region on mouse chromosome 7C (Birger et al., 1999; Hark et al., 2000; Khosla et al.,
1999; Sasaki et al., 2000; Szabo et al., 2000). It will be interesting to determine if
patients with mutations in the PWS IC (PWS ID patients) or AS IC (AS ID patients)
express the UBE3A antisense transcript.
Chromatin Structure
Although it is evident that DNA methylation plays an important role in the
establishment of the primary imprint, other factors are probably in the allele-specific
repression. Several experiments have demonstrated a significant correlation between
DNA methylation at CpG islands and transcriptional silencing (Ng and Bird, 1999).
Experiments using the herpes simplex virus thymidine kinase (H5V TK) gene gave the
initial clues that DNA methylation could be tied to chromatin structure (Buschhausen
et al., 1987). When naked DNA (methylated or unmethylated) was microinjected into
rodent cells, it took over eight hours for HSV TK to be silenced in cells containing

81
methylated DNA. However, when in vitro assembled chromatin was introduced, HSV
TK was inactive. Recent studies have been able to intimately connect DNA
methylation with chromatin structure (Ng and Bird, 1999). The discovery that the CpG
binding protein, MeCP2, bound DNA in a methylation-dependent mechanism and
inhibited transcription gave the first clues that the two processes were linked (Nan et
al., 1997; Nan et al., 1996). Subsequent experiments by several groups revealed that
the transcriptional repression domain of MeCP2 recruits Sin3A and the histone
deacetylase complex, inducing histone deacetylation and transcriptional silencing (Ng
and Bird, 1999).
Identification of a gene that shows differential chromatin structure between
the maternal and paternal alleles in the context of DNA methylation and expression
imprints would provide good evidence of a connection between DNA methylation,
chromatin structure and imprinted expression. In vivo chromatin studies revealed that
the unmethylated expressed alleles of Snrpn, H19 and U2af1-rs1 were hypersensitive
to in vivo nuclease digestion, insinuating that a DNA methylation imprint was linked to
an open chromatin conformation (Feil et al., 1995; Hark and Tilghman, 1998; Khosla et
al., 1999; Schweizer et al., 1999; Shibata et al., 1996; Szabo et al., 1998). In
addition, analysis of histone acetylation by chromatin immunoprecipitation
demonstrates that the inactive alleles of lg/2 and H1 9 (maternal and paternal,
respectively) are enriched for hypoacetylated histones, a hallmark of repressed genes
(Pedone et al., 1999).
DNA Replication Timing
Another potential candidate for the imprinting signal is DNA replication timing.
The maternal and paternal homologues of most genes replicate synchronously during S
phase of the cell cycle (Glenn et al., 1997). In contrast, the homologous gene regions

82
of imprinted domains have been shown to replicate asynchronously, with the paternal
allele usually replicating earlier than the maternal homologue (Argyriou-Tirita et al.,
1996; Izumikawa et al., 1991; Kitsberg et al., 1993; Knoll et al., 1994; LaSalle and
Lalande, 1995; Lin et al., 1995; Simon et al., 1999; Smrzka et al., 1995; White et al.,
1996; Wutz et al., 1998). Further analysis of the imprinted 15q 11-13 domain has
shown a homologous association between the maternal and paternal homologues in
normal lymphoblast cell lines (LaSalle and Lalande, 1995). However, asynchronous
DNA replication timing does not appear to correlate with changes in imprinting of IGF2
or Hi9 in patients with Beckwith-Wiedemann syndrome (Squire et al., 2000). In
addition, asynchronously replicating domains often extend past the imprinting clusters
(Glenn et al., 1997).
Models for Imprinted Expression
In an intriguing model brought upon by studies of the mouse Aprt locus,
Turcker has postulated that CpG islands themselves are targets for de novo
methylation, probably by a Dnmt3 or Dnmt3a methyltransferase (Turker, 1999). After
the initial methylation at discreet foci, regional methylation of a CpG island would
spread bidirectionally through maintenance methylation, a replication-dependent
process requiring Dnmtl. The methylation status of the CpG island would remain in
flux; methylation would compete with demethylation to produce a stable methylation
pattern. Other recent experiments have led (Antequera and Bird, 1999) to propose a
mechanism for why CpG islands are often found at gene promoters. They believe that
CpG islands serve dual roles, acting both as origins of replication and as promoters for
genes that are active at totipotent stages of development. If these models from non-
imprinted loci prove true in imprinted regions, then DNA methylation could be the

83
epigenetic mark of imprinted genes, Unking DNA replication, chromatin structure, as-
acting elements and imprinted expression.
Several models have been proposed for the function of the 1C. The first model
proposed that the paternal component of the 1C (PWS-IC) controlled the maternal to
paternal epigenotype switch, while the maternal component of the 1C (AS-IC)
regulated the paternal to maternal switch (Dittrich et al., 1996). However, this model
requires activation of the maternal allele during gametogenesis. Although no maternal
expression has been detected in fetal brain or lung, fetal oocytes and primordial germ
cells have not been examined (Buiting et al., 1999). It is possible that the IC contains
germ cell-specific transcripts that are maternal in origin.
In an alternative explanation, the PWS-IC regulates expression of the paternally
expressed genes in 15q11 -13, while the AS-IC represses activation of the PWS-IC
(Figure 1-4B; Brannan and Bartolomei, 1999). On the paternal chromosome, the PWS-
IC activates transcription of the paternally expressed genes along the 2 Mb imprinted
domain, which includes the UBE3A antisense transcript (Figure 1-4A, B). Patients with
mutations in the PWS-IC would fail to activate paternal gene expression, causing PWS.
In oogenesis and somatic tissue, the AS-IC represses the PWS-IC, silencing the
paternally expressed genes. AS patients with imprinting defects would fail to
inactivate the PWS-IC, causing biallelic expression of the paternal-only genes. One
prediction of this model would be that UBE3A would only demonstrate imprinted
expression in tissues where the UBE3A antisense transcript was concurrently
expressed. In support of this model, the UBE3A antisense transcript is only expressed
in brain, the one tissue that demonstrates imprinted expression of UBE3A (Rougeulle
et al., 1998; Rougeulle et al., 1997). In addition, recent experiments demonstrated
that UBE3A was preferentially expressed from the maternal allele, while the antisense

84
transcript was preferentially expressed from the paternal allele in several regions of
the human brain (Lossie et al., in preparation). A second prediction of this model is
that an 1C deletion on the maternal chromosome that extended from the AS-IC through
the PWS-IC would not give an AS phenotype because the paternally expressed genes
would not become activated, due to a lack of a PWS-IC. In agreement with this
model, none of the AS-IC deletion patients deletes the PWS-IC.
My preliminary experiments suggest that the antisense transcript plays a role in
the regulation of imprinted expression of UBE3A. One possible mechanism for this
regulation would be through RNA interference due to double stranded RNA
interactions. In order for this mechanism to apply, the antisense transcript must not
be able to diffuse throughout the nucleus. If it could, then both the maternal and
paternal alleles of UBE3A would be repressed. If the UBE3A antisense transcript does
diffuse throughout the nucleus, then changes in higher order nuclear structure could
be a mechanism for imprinted expression of UBE3A. It is possible that the nuclear
localization of UBE3A is different in brain than other tissues. This localization could
set up epigenetic differences in chromatin structure on the maternal and paternal
chromosomes, provide different microenvironments for distribution of transcription
factors and ultimately result in preferential expression from the maternal allele in
brain.
Interestingly, PWCR1, a small nucleolar (sno) RNA has been mapped within 1
Mb of UBE3A (de Los Santos et al., 2000). Like most of the genes within the AS/PWS
domain, PWCR1 is preferentially expressed from the paternal allele and is expressed at
high levels in brain. Within a 50 kb stretch at the PWCR1 locus, 25 copies of genes
with high homology to PWCR1 are found. It is possible that the presence of these
and/or other noncoding RNAs are responsible for establishing precise nuclear

85
architecture. This would not be surprising, since noncoding RNAs and antisense
transcripts appear to play a major roll in epigenetic gene silencing. For example, the
noncoding Tsix transcript, which is also antisense to Xist, has been shown to be
involved in the epigenetic regulation of X-inactivation (Lee et al., 1999a). In addition,
the roX RNAs have been shown to facilitate the male specific hypertranscription on the
paternal X chromosome in Drosophila (Kelley et al., 1999).
Future Directions
My studies suggest that mutations in UBE3A are not the sole cause of Angelman
syndrome; additional factors must also be involved. The next logical step in better
understanding the etiology of AS is to identify all of the substrates that UBE3A targets
for degradation. Any protein that interacts with UBE3A in this cascade and all proteins
that UBE3A targets for degradation are good candidates for patients grouped in Class
V. So far, four proteins have been identified as substrates for UBE3A-mediated
degradation: p53, HFIR23A, the Src family kinase Blk and UBE3A itself. Perhaps an even
more intriguing future exploration is to determine if other 15q 11-13 genes may play
important roles in the etiology of Class V patients. Possible candidates are the UBE3A
antisense transcript and the sense transcript located downstream of UBE3A. These
genes then need to be tested for their possible involvement in AS. It is not clear how
any of these genes could be involved in the etiology of AS, and given the complexity of
the ubiquitin system, identification of the specific AS gene or genes involved is a very
daunting task.
In addition to determining the etiology of AS in Class V patients, my recent
studies on imprinted expression of UBE3A and the antisense transcript suggest that
imprinted expression of UBE3A is complicated. To better understand the biology, the

86
next logical step would be to examine more regions of the brain to try to establish the
tissue-specificity of imprinted expression of UBE3A and the antisense transcript. I
think my research indicates that a comprehensive in situ analysis of all regions of the
brain would greatly help to answer whether or not the antisense transcript can
regulate imprinted expression of UBE3A.

REFERENCES
Albrecht, U., Sutcliffe, J. S., Cattanach, B. M., Beechey, C. V., Armstrong, D.,
Eichele, G., and Beaudet, A. L. (1997). Imprinted expression of the murine Angelman
syndrome gene, Ube3a, in hippocampal and Purkinje neurons. Nat Genet 17, 75-8.
Anan, T., Nagata, Y., Koga, H., Honda, Y., Yabuki, N., Miyamoto, C., Kuwano, A.,
Matsuda, I., Endo, F., Saya, H., and Nakao, M. (1998). Human ubiquitin-protein ligase
Nedd4: expression, subcellular localization and selective interaction with ubiquitin-
conjugating enzymes. Genes Cells 3, 751-63.
Angelman, H. (1965). "Puppet" children: A report on three cases. Dev Med Child
Neurol 7, 681-8.
Antequera, F., and Bird, A. (1999). CpG islands as genomic footprints of promoters
that are associated with replication origins. Curr Biol 9, R661-7.
Argyriou-Tirita, A., Romanakis, K., Kroisel, P., and Haas, 0. A. (1996). Asynchronous
replication patterns of imprinted genes in triploid cells. Acta Genet Med Gemellol 45,
207-12.
Barton, S. C., Surani, M. A., and Norris, M. L. (1984). Role of paternal and maternal
genomes in mouse development. Nature 311, 374-6.
Baumer, A., Balmer, D., and Schinzel, A. (1999). Screening for UBE3A gene mutations
in a group of Angelman syndrome patients selected according to non-stringent clinical
criteria. Hum Genet 105, 598-602.
Baylin, S. B., Herman, J. G., Graff, J. R., Vertino, P. M., and Issa, J. P. (1998).
Alterations in DNA methylation: a fundamental aspect of neoplasia. Adv Cancer Res
72, 141-96.
Bell, A. C., and Felsenfeld, G. (2000). Methylation of a CTCF-dependent boundary
controls imprinted expression of the Igf2 gene. Nature 405, 482-5.
Bielinska, B., Blaydes, S. M., Buiting, K., Yang, T., Krajewska-Walasek, M.,
Horsthemke, B., and Brannan, C. I. (2000). De novo deletions of SNRPN exon 1 in early
human and mouse embryos result in a paternal to maternal imprint switch. Nat Genet
25, 74-8.
Bird, A. P., and Wolffe, A. P. (1999). Methylation-induced repression--belts, braces,
and chromatin. Cell 99, 451-4.
87

88
Birger, Y., Shemer, R., Perk, J., and Razin, A. (1999). The imprinting box of the mouse
Igf2r gene. Nature 397, 84-8.
Boccaccio, I., Glatt-Deeley, H., Watrin, F., Roeckel, N., Lalande, M., and Muscatelli,
F. (1999). The human MAGEL2 gene and its mouse homologue are paternally expressed
and mapped to the Prader-Willi region. Hum Mol Genet 8, 2497-505.
Bottani, A., Robinson, W. P., DeLozier-Blanchet, C. D., Engel, E., Morris, M. A.,
Schmitt, B., Thun-Hohenstein, L, and Schinzel, A. (1994). Angelman syndrome due to
paternal uniparental disomy of chromosome 15: a milder phenotype? Am J Med Genet
51, 35-40.
Brandéis, M., Ariel, M., and Cedar, H. (1993). Dynamics of DNA methylation during
development. Bioessays 15, 709-13.
Brannan, C. I., and Bartolomei, M. S. (1999). Mechanisms of genomic imprinting. Curr
Opin Genet Dev 9, 164-70.
Brown, K. W., Villar, A. J., Bickmore, W., Clayton-Smith, J., Catchpoole, D., Maher, E.
R., and Reik, W. (1996). Imprinting mutation in the Beckwith-Wiedemann syndrome
leads to biallelic IGF2 expression through an H19-independent pathway. Hum Mol
Genet 5, 2027-32.
Buiting, K., Dittrich, B., Gross, S., Lich, C., Farber, C., Buchholz, T., Smith, E., Reis,
A., Burger, J., Nothen, M. M., Barth-Witte, U., Janssen, B., Abeliovich, D., Lerer, I.,
van den Ouweland, A. M., Halley, D. J., Schrander-Stumpel, C., Smeets, H., Meinecke,
P., Malcolm, S., Gardner, A., Lalande, M., Nicholls, R. D., Friend, K., Schulze, A.,
Matthijs, G., Kokkonen, J., Hilbert, P., Van Maldergem, L., Glover, G., Carbonell, P.,
Willems, P., Gillessen-Kaesbach, G., and Horsthemke, B. (1998). Sporadic imprinting
defects in Prader-Willi syndrome and Angelman syndrome: implications for imprint-
switch models, genetic counseling, and prenatal diagnosis. Am J Hum Genet 63, 170-
80.
Buiting, K., Lich, C., Cottrell, S., Barnicoat, A., and Horsthemke, B. (1999). A 5-kb
imprinting center deletion in a family with Angelman syndrome reduces the shortest
region of deletion overlap to 880 bp. Hum Genet 105, 665-6.
Buiting, K., Saitoh, S., Gross, S., Dittrich, B., Schwartz, S., Nicholls, R. D., and
Horsthemke, B. (1995). Inherited microdeletions in the Angelman and Prader-Willi
Syndromes define an imprinting center on human chromosome 15. Nat Genet 9, 395-
400.
Burger, J., Kunze, J., Sperling, K., and Reis, A. (1996). Phenotypic differences in
Angelman syndrome patients: imprinting mutations show less frequently microcephaly
and hypopigmentation than deletions. Am J Med Genet 66, 221-6.
Buschhausen, G., Wittig, B., Graessmann, M., and Graessmann, A. (1987). Chromatin
structure is required to block transcription of the methylated herpes simplex virus
thymidine kinase gene. Proc Natl Acad Sci USA 84, 1177-81.

89
Butler, M. G., Meaney, R. J., and Palmer, C. G. (1986). Clinical and cytogenetic survey
of 39 individuals with Prader-Labhart-Willi syndrome. Am J Med Genet 23, 798-809.
Caspary, T., Cleary, M. A., Baker, C. C., Guan, X. J., and Tilghman, S. M. (1998).
Multiple mechanisms regulate imprinting of the mouse distal chromosome 7 gene
cluster. Mol Cell Biol 18, 3466-74.
Cattanach, B. M., Barr, J. A., Beechey, C. V., Martin, J., Noebels, J., and Jones, J.
(1997). A candidate model for Angelman syndrome in the mouse. Mamm Genome 8,
472-8.
Cattanach, B. M., Barr, J. A., Evans, E. P., Burtenshaw, M., Beechey, C. V., Leff, S.
E., Brannan, C. I., Copeland, N. G., Jenkins, N. A., and Jones, J. (1992). A candidate
mouse model for Prader-Willi syndrome which shows an absence of Snrpn expression.
Nat Genet 2, 270-4.
Chomczynski, P., and Sacchi, N. (1987). Single-step method of RNA isolation by acid
guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 162, 156-9.
Christian, S. L, Bhatt, N. K., Martin, S. A., Sutcliffe, J. S., Kubota, T., Huang, B.,
Mutirangura, A., Chinault, A. C., Beaudet, A. L, and Ledbetter, D. H. (1998).
Integrated YAC contig map of the Prader-Willi/Angelman region on chromosome
15q11 -q13 with average STS spacing of 35 kb. Genome Res 8, 146-57.
Ciechanover, A., Orian, A., and Schwartz, A. L. (2000). The ubiquitin-mediated
proteolytic pathway: mode of action and clinical implications. J Cell Biochem Suppl
34, 40-51.
Clayton-Smith, J., Driscoll, D. J., Waters, M. F., Webb, T., Andrews, T., Pembrey, M.
E., Malcolm, S., and Nicholls, R. D. (1993). Differences in methylation patterns within
the D15S9 region of chromosome 15q11-q13 in first cousins with Angelman and Prader-
Willi syndromes. Am J Med Genet 47, 683-6.
Colman, S. D., Rasmussen, S. A., Ho, V. T., Abernathy, C. R., and Wallace, M. R.
(1996). Somatic mosaicism in a patient with neurofibromatosis type 1. Am J Hum
Genet 58, 484-90.
Dan, B., Boyd, S. G., Christiaens, F., Courtens, W., Van Maldergem, L., and Kahn, A.
(2000). Atypical features in Angelman syndrome due to imprinting defect of
uniparental disomy of chromosome 15. Neuropediatrics 31, 109-10.
de Los Santos, T., Schweizer, J., Rees, C. A., and Francke, U. (2000). Small
Evolutionarily Conserved RNA, Resembling C/D Box Small Nucleolar RNA, Is Transcribed
from PWCR1, a Novel Imprinted Gene in the Prader- Willi Deletion Region, Which Is
Highly Expressed in Brain. Am J Hum Genet 67, 1067-82.
DeLorey, T. M., Handforth, A., Anagnostaras, S. G., Homanics, G. E., Minassian, B. A.,
Asatourian, A., Fanselow, M. S., Delgado-Escueta, A., Ellison, G. D., and Olsen, R. W.
(1998). Mice lacking the beta3 subunit of the GABAA receptor have the epilepsy

90
phenotype and many of the behavioral characteristics of angelman syndrome. J
Neurosci 18, 8505-14.
Dittrich, B., Buiting, K., Gross, S., and Horsthemke, B. (1993). Characterization of a
methylation imprint in the Prader-Willi syndrome chromosome region. Hum Mol Genet
2, 1995-9.
Dittrich, B., Buiting, K., Korn, B., Rickard, S., Buxton, J., Saitoh, S., Nicholls, R. D.,
Poustka, A., Winterpacht, A., Zabel, B., and Horsthemke, B. (1996). Imprint switching
on human chromosome 15 may involve alternative transcripts of the SNRPN gene. Nat
Genet 14, 163-70.
Drewell, R. A., Brenton, J. D., Ainscough, J. F., Barton, S. C., Hilton, K. J., Arney, K.
L, Dándolo, L., and Surani, M. A. (2000). Deletion of a silencer element disrupts H19
imprinting independently of a DNA methylation epigenetic switch. Development 127,
3419-28.
Driscoll, D. J. (1994). Genomic Imprinting in Humans. Mol Genet Med 4, 37-77.
Driscoll, D. J., and Migeon, B. R. (1990). Sex difference in methylation of single-copy
genes in human meiotic germ cells: implications for X chromosome inactivation,
parental imprinting, and origin of CpG mutations. Somat Cell Mol Genet 16, 267-82.
Driscoll, D. J., Waters, M. F., Williams, C. A., Zori, R. T., Glenn, C. C., Avidano, K. M.,
and Nicholls, R. D. (1992). A DNA methylation imprint, determined by the sex of the
parent, distinguishes the Angelman and Prader-Willi syndromes. Genomics 13, 917-24.
Dupont, J. M., Le Tessier, D., Rabineau, D., Cuisset, L, Vasseur, C., Jeanpierre, M.,
Delpech, M., Pintón, F., Ponsot, G., and Denavit, M. F. (1999). Unexpected Angelman
syndrome molecular defect in a girl displaying clinical features of Prader-Willi
syndrome. J Med Genet 36, 652-4.
Falls, J. G., Pulford, D. J., Wylie, A. A., and Jirtle, R. L. (1999). Genomic imprinting:
implications for human disease. Am J Pathol 154, 635-47.
Fang, P., Lev-Lehman, E., Tsai, V. F., Matsuura, T., Benton, C. S., Sutcliffe, J. S.,
Christian, S. L, Kubota, T., Halley, D. J., Meijers-Heijboer, H., Langlois, S., Graham
Jr, J. M., Beuten, J., Willems, P. J., Ledbetter, D. H., and Beaudet, A. L. (1999). The
spectrum of mutations in UBE3A causing angelman syndrome. Hum Mol Genet 8, 129-
35.
Farber, C., Dittrich, B., Buiting, K., and Horsthemke, B. (1999). The chromosome 15
imprinting centre (IC) region has undergone multiple duplication events and contains
an upstream exon of SNRPN that is deleted in all angelman syndrome patients with an
IC microdeletion. Hum Mol Genet 8, 337-43.
Farber, C., Gross, S., Neesen, J., Buiting, K., and Horsthemke, B. (2000).
Identification of a testis-specific gene (C15orf2) in the Prader-Willi syndrome region on
chromosome 15. Genomics 65, 174-83.

91
Feil, R., Handel, M. A., Allen, N. D., and Reik, W. (1995). Chromatin structure and
imprinting: developmental control of DNase-l sensitivity in the mouse insulin-like
growth factor 2 gene. Dev Genet 17, 240-52.
Feinberg, A. P. (2000). DNA methylation, genomic imprinting and cancer. Curr Top
Microbiol Immunol 249, 87-99.
Freeman, S. B., May, K. M., Pettay, D., Fernhoff, P. M., and Hassold, T. J. (1993).
Paternal uniparental disomy in a child with a balanced 15; 15 translocation and
Angelman syndrome. Am J Med Genet 45, 625-30.
Fridman, C., Santos, M., Ferrari, I., and Koiffmann, C. P. (2000a). A further Angelman
syndrome patient with UPD15 due to paternal meiosis II nondisjunction. Clin Genet 57,
86-7.
Fridman, C., Varela, M. C., Kok, F., Diament, A., and Koiffmann, C. P. (2000b).
Paternal UPD15: further genetic and clinical studies in four angelman syndrome
patients. Am J Med Genet 92, 322-7.
Fridman, C., Varela, M. C., Nicholls, R. D., and Koiffmann, C. P. (1998). Unusual
clinical features in an Angelman syndrome patient with uniparental disomy due to a
translocation 15q15q. Clin Genet 54, 303-8.
Fung, D. C., Yu, B., Cheong, K. F., Smith, A., and Trent, R. J. (1998). UBE3A
"mutations" in two unrelated and phenotypically different Angelman syndrome
patients. Hum Genet 102, 487-92.
Gabriel, J. M., Higgins, M. J., Gebuhr, T. C., Shows, T. B., Saitoh, S., and Nicholls, R.
D. (1998). A model system to study genomic imprinting of human genes. Proc Natl
Acad Sci USA 95, 14857-62.
Gabriel, J. M., Merchant, M., Ohta, T., Ji, Y., Caldwell, R. G., Ramsey, M. J., Tucker,
J. D., Longnecker, R., and Nicholls, R. D. (1999). A transgene insertion creating a
heritable chromosome deletion mouse model of Prader-Willi and Angelman syndromes.
Proc Nat Acad Sci USA 96, 9258-63.
Gerard, M., Hernandez, L, Wevrick, R., and Stewart, C. L. (1999). Disruption of the
mouse necdin gene results in early post-natal lethality. Nat Genet 23, 199-202.
Gillessen-Kaesbach, G., Albrecht, B., Passarge, E., and Horsthemke, B. (1995). Further
patient with Angelman syndrome due to paternal disomy of chromosome 15 and a
milder phenotype. Am J Med Genet 56, 328-9.
Gillessen-Kaesbach, G., Demuth, S., Thiele, H., Theile, U., Lich, C., and Horsthemke,
B. (1999). A previously unrecognised phenotype characterised by obesity, muscular
hypotonia, and ability to speak in patients with Angelman syndrome caused by an
imprinting defect. Eur J Hum Genet 7, 638-44.

92
Glenn, C. C., Driscoll, D. J., Yang, T. P., and Nicholls, R. D. (1997). Genomic
imprinting: potential function and mechanisms revealed by the Prader-Willi and
Angelman syndromes. Mol Hum Reprod 3, 321-32.
Glenn, C. C., Nicholls, R. D., Saitoh, S., Niikawa, N., Robinson, W. P., Schinzel, A.,
Horsthemke, B., and Driscoll, D. J. (1993a). Modification of 15q 11 -q 13 methylation
imprints in unique Angelman and Prader-Willi patients. Hum Mol Genet 2, 1377-82.
Glenn, C. C., Porter, K. A., Jong, M., Nicholls, R. D., and Driscoll, D. J. (1993b).
Functional imprinting and epigenetic modifications of the human SNRPN gene. Hum
Mol Genet 2, 2001-5.
Glenn, C. C., Saitoh, S., Jong, M. T., Filbrandt, M. M., Surtí, U., Driscoll, D. J., and
Nicholls, R. D. (1996). Gene structure, DNA methylation, and imprinted expression of
the human SNRPN gene. Am J Hum Genet 58, 335-46.
Gray, T. A., Saitoh, S., and Nicholls, R. D. (1999). An imprinted, mammalian
bicistronic transcript encodes two independent proteins. Proc Natl Acad Sci U S A 96,
5616-21.
Greger, V., Knoll, J. H. M., Wagstaff, J., Woolf, E., Lieske, P., Glatt, H., Benn, P. A.,
Rosengren, S. S., and Lalande, M. (1997). Angelman syndrome associated with an
inversion of chromosome 15q11.2q24.3. Am J Hum Genet 60, 574-80.
Greger, V., Reis, A., and Lalande, M. (1994). The critical region for Angelman
syndrome lies between D15S122 and D15S113. Am J Med Genet 53, 396-8.
Gyftodimou, J., Karadima, G., Pandelia, E., Vassilopoulos, D., and Petersen, M. B.
(1999). Angelman syndrome with uniparental disomy due to paternal meiosis II
nondisjunction. Clin Genet 55, 483-6.
Hark, A. T., Schoenherr, C. J., Katz, D. J., Ingram, R. S., Levorse, J. M., and
Tilghman, S. M. (2000). CTCF mediates methylation-sensitive enhancer-blocking
activity at the H19/lgf2 locus. Nature 405, 486-9.
Hark, A. T., and Tilghman, S. M. (1998). Chromatin conformation of the H19
epigenetic mark. Hum Mol Genet 7, 1979-85.
Holm, V. A., Cassidy, S. B., Butler, M. G., Hanchett, J. M., Greenswag, L. R.,
Whitman, B. Y., and Greenberg, F. (1993). Prader-Willi syndrome: consensus
diagnostic criteria. Pediatrics 91, 398-402.
Huibregtse, J. M., Scheffner, M., and Howley, P. M. (1993a). Cloning and expression of
the cDNA for E6-AP, a protein that mediates the interaction of the human
papillomavirus E6 oncoprotein with p53. Mol Col Biol 13, 775-84.
Huibregtse, J. M., Scheffner, M., and Howley, P. M. (1993b). Localization of the E6-AP
regions that direct human papillomavirus E6 binding, association with p53, and
ubiquitination of associated proteins. Mol Cell Biol 13, 4918-27.

93
Ishihara, K., Hatano, N., Furuumi, H., Kato, R., Iwaki, T., Miura, K., Jinno, Y., and
Sasaki, H. (2000). Comparative genomic sequencing identifies novel tissue-specific
enhancers and sequence elements for methylation-sensitive factors implicated in
Igf2/H19 imprinting. Genome Res 10, 664-71.
Izumikawa, Y., Naritomi, K., and Hirayama, K. (1991). Replication asynchrony between
homologs 15q11.2: cytogenetic evidence for genomic imprinting. Hum Genet 87, 1-5.
Jay, P., Rougeulle, C., Massacrier, A., Monda, A., Mattei, M. G., Malzac, P., Roeckel,
N., Taviaux, S., Lefranc, J. L, Cau, P., Berta, P., Lalande, M., and Muscatelli, F.
(1997). The human necdin gene, NDN, is maternally imprinted and located in the
Prader-Willi syndrome chromosomal region. Nat Genet 17, 357-61.
Jiang, Y. H., Armstrong, D., Albrecht, U., Atkins, C. M., Noebels, J. L, Eichele, G.,
Sweatt, J. D., and Beaudet, A. L. (1998). Mutation of the Angelman ubiquitin ligase in
mice causes increased cytoplasmic p53 and deficits of contextual learning and long¬
term potentiation. Neuron 21, 799-811.
John, R. M., and Surani, M. A. (1996). Imprinted genes and regulation of gene
expression by epigenetic inheritance. Curr Opin Cell Biol 8, 348-53.
Johnson, D. K., Stubbs, L. J., Culiat, C. T., Montgomery, C. S., Russell, L. B., and
Rinchik, E. Mi. (1995). Molecular analysis of 36 mutations at the mouse pink-eyed
dilution (p) locus. Genetics 141, 1563-71.
Jones, J., Townsend, K. M. S., Glenister, P. H., Jong, M. T. C., Jones, L, Nicholls, R.
D., and Cattanach, B. M. (1996). Differential imprinting of the sense/antisense genes
Znf127 and Dn34, during development in the mouse, unpublished data.
Jong, M. T., Gray, T. A., Ji, Y., Glenn, C. C., Saitoh, S., Driscoll, D. J., and Nicholls,
R. D. (1999), A novel imprinted gene, encoding a RING zinc-finger protein, and
overlapping antisense transcript in the Prader-Willi syndrome critical region. Hum Mol
Genet 8, 783-93.
Kajii, T., Kurashige, H., Ohama, K., and Uchino, F. (1984). XY and XX complete moles:
clinical and morphologic correlations. Am J Obstet Gynecol 150, 57-64.
Kaplan, L. C., Wharton, R., Elias, E., Mandell, F., Donlon, T., and Latt, S. A. (1987).
Clinical heterogeneity associated with deletions in the long arm of chromosome 15:
report of 3 new cases and their possible genetic significances. Am J Med Genet 28, 45-
53.
Kelley, R. L., Meller, V. H., Gordadze, P. R., Roman, G., Davis, R. L, and Kuroda, M.
I. (1999). Epigenetic spreading of the Drosophila dosage compensation complex from
roX RNA genes into flanking chromatin. Cell 98, 513-22.
Khosla, S., Aitchison, A., Gregory, R., Allen, N. D., and Feil, R. (1999). Parental allele-
specific chromatin configuration in a boundary- imprinting-control element upstream
of the mouse H19 gene. Mol Cell Biol 19, 2556-66.

94
Kishino, T., Lalande, M., and Wagstaff, J. (1997). UBE3A/E6-AP mutations cause
Angelman syndrome. Nat Genet 15, 70-3.
Kishino, T., and Wagstaff, J. (1998). Genomic organization of the UBE3A/E6-AP gene
and related pseudogenes. Genomics 47, 101-7.
Kitsberg, D., Selig, S., Brandéis, M., Driscoll, D. J., Nicholls, R. D., and Cedar, H.
(1993). Allele specific replication timing of imprinted gene regions. Nature 364, 459-
63.
Knoll, J. H., Nicholls, R. D., Magenis, R. E., graham, J. M. J., Lalande, M., and Latt, S.
A. (1989). Angelman and Prader-Willi syndromes share a common chromosome 15
deletion but differ in parental origin of the deletion. Am J Med Genet 32, 285-90.
Knoll, J. H. M., Cheng, S. D., and Lalande, M. (1994). Allele specificity of DNA
replication timing in the Angelman/Prader-Willi syndrome imprinted chromosomal
region. Nat Genet 6, 41-6.
Koegl, M., Hoppe, T., Schlenker, S., Ulrich, H. D., Mayer, T. U., and Jentsch, S.
(1999). A novel ubiquitination factor, E4, is involved in multiubiquitin chain assembly.
Cell 96, 635-44.
Kubota, T., Aradhya, S., Macha, M., Smith, A. C., Surh, L. C., Satish, J., Verp, M. S.,
Nee, H. L., Johnson, A., Christan, S. L., and Ledbetter, D. H. (1996a). Analysis of
parent of origin specific DNA methylation at SNRPN and PW71 in tissues: implication
for prenatal diagnosis. J Med Genet 33, 1011-4.
Kubota, T., Das, S., Christian, S. L., Baylin, S. B., Herman, J. G., and Ledbetter, D. H.
(1997). Methylation-specific PCR simplifies imprinting analysis. Nat Genet 16, 16-7.
Kubota, T, Sutcliffe, J., Aradhya, S., Gillessen-Kaesbach, G., Christian, S.,
Horsthemke, B., Beaudet, A., and Ledbetter, D. (1996b). Validation studies of SNRPN
methylation as a diagnostic test for Prader-Willi syndrome. Am J Med Genet 66, 77-80.
Kumar, S., Kao, W. H., and Howley, P. M. (1997). Physical interaction between
specific E2 and Hect E3 enzymes determines functional cooperativity. J Biol Chem 272,
13548-54.
Laan, L. A., v Haeringen, A., and Brouwer, O. F. (1999). Angelman syndrome: a review
of clinical and genetic aspects. Clin Neurol Neurosurg 101, 161-70.
LaSalle, J. M., and Lalande, M. (1995). Domain organization of allele-specific
replication within the GABRB3 gene cluster requires a biparental 15q 11-13
contribution. Nat Genet 9, 386-94.
LaSalle, J. M., and Lalande, M. (1996). Homologous association of oppositely imprinted
chromosomal domains. Science 272, 725-8.

95
LaSalle, J. M., Ritchie, R. J., Glatt, H., and Lalande, M. (1998). Clonal heterogeneity
at allelic methylation sites diagnostic for Prader- Willi and Angelman syndromes. Proc
Natl Acad Sci U S A 95, 1675-80.
Ledbetter, D. H., and Engel, E. (1995). Uniparental disomy in humans: development of
an imprinting map and its implications for prenatal diagnosis. Hum Mol Genet 4, 1757-
64.
Lee, J. T., Davidow, L. S., and Warshawsky, D. (1999a). Tsix, a gene antisense to Xist
at the X-inactivation centre. Nat Genet 21, 400-4.
Lee, M. P., DeBaun, M. R., Mitsuya, K., Galonek, H. L., Brandenburg, S., Oshimura, M.,
and Feinberg, A. P. (1999b). Loss of imprinting of a paternally expressed transcript,
with antisense orientation to KVLQT1, occurs frequently in Beckwith-Wiedemann
syndrome and is independent of insulin-like growth factor II imprinting. Proc Natl Acad
Sci U S A 96, 5203-8.
Lee, S., Kozlov, S., Hernandez, L., Chamberlain, S. J., Brannan, C. I., Stewart, C. L.,
and Wevrick, R. (2000). Expression and imprinting of MAGEL2 suggest a role in prader-
willi syndrome and the homologous murine imprinting phenotype. Hum Mol Genet 9,
1813-9.
Lee, S., and Wevrick, R. (2000). Identification of novel imprinted transcripts in the
Prader-Willi syndrome and Angelman syndrome deletion region: further evidence for
regional imprinting control. Am J Hum Genet 66, 848-58.
Li, E., Beard, C., and Jaenisch, R. (1993). Role for DNA methylation in genomic
imprinting. Nature 366, 362-5.
Lin, M. S., Zhang, A., and Fujimoto, A. (1995). Asynchronous DNA replication between
15q 11.2q 12 homologs: cytogenetic evidence for maternal imprinting and delayed
replication. Hum Genet 96, 572-6.
Liu, J., Yu, S., Litman, D., Chen, W., and Weinstein, L. S. (2000). Identification of a
methylation imprint mark within the mouse Gnas locus. Mol Cell Biol 20, 5808-17.
Lossie, A. C., Amidon, D., Eskin, T., and Driscoll, D. J. (in preparation). DNA
methylation and expression imprints support a role for the antisense transcript in the
regulation of imprinted expression of UBE3A. .
Lossie, A. C., and Driscoll, D. J. (1999). Transmission of Angelman Syndrome by an
Affected Mother. Genetics in Medicine 1, 262-6.
Lossie, A. C., Sage, B. T., Boyar, F. Z., Filbrandt, M. M., Nicholls, R. D., Zori, R. T.,
Williams, C. A., and Driscoll, D. J. (1998). Mutation analysis of UBE3A in classical
Angelman syndrome patients. AJHG 63, 1931.
Lossie, A. C., Whitney, M. M., Amidon, D., Chen, P., Theriaque, D., Hutson, A., Zori,
R. T., Nicholls, R. D., Williams, C. A., and Driscoll, D. J. (in preparation). Molecular

96
analyses and genotype-phenotoype correlations among the five classes of angelman
syndrome.
Magenis, R. E., Brown, M. G., Lacy, D. A., Budden, S., and LaFranchi, S. (1987). Is
Angelman syndrome an alternate result of del(15)(q11 q13)? Am J Med Genet 28, 829-
38.
Maher, E. R., and Reik, W. (2000). Beckwith-Wiedemann syndrome: imprinting in
clusters revisited. J Clin Invest 105, 247-52.
Malcolm, S., Clayton-Smith, J., Nichols, M., Robb, S., Webb, T., Armour, J. A. L.,
Jeffreys, A. J., and Pembrey, M. E. (1991). Uniparental paternal disomy in Angelman’s
syndrome. Lancet 337, 694-7.
Malzac, P., Webber, H., Monda, A., Graham, J. M., Kukolich, M., Williams, C., Pagon,
R. A., Ramsdell, L. A., Kishino, T., and Wagstaff, J. (1998). Mutation analysis of UBE3A
in Angelman syndrome patients. Am J Hum Genet 62, 1353-60.
Mascari, M. J., Gottlieb, W., Rogan, P. K., Butler, M. G., Armour, J., Jeffreys, A.,
Waller, D., Lsdda, R. L., and Nicholls, R. D. (1992). Frequency of uniparental disomy
in Prader-Willi syndrome and implications for molecular diagnosis. New Eng J Med 326,
1599-607.
Matsuura, T., Sutcliffe, J. S., Fang, P., Galjaard, R. J., Jiang, Y. H., Benton, C. S.,
Rommens, J. M., and Beaudet, A. L. (1997). De novo truncating mutations in E6-AP
ubiquitin-protein ligase gene (UBE3A) in Angelman syndrome. Nat Genet 15, 74-7.
McGrath, J., and Solter, D. (1984). Completion of mouse embryogenesis requires both
maternal and paternal genomes. Cell 37, 179-83.
Minassian, B. A., DeLorey, T. M., Olsen, R. W., Philippart, M., Bronstein, Y., Zhang,
Q., Guerrini, R., Van Ness, P., Livet, M. O., and Delgado-Escueta, A. V. (1998).
Angelman syndrome: correlations between epilepsy phenotypes and genotypes. Ann
Neurol 43, 485-93.
Miturangura, A., Greenberg, F.,‘ Butler, M. G., Malcolm, S., Nicholls, R. D.,
Chakravarti, A., and Ledbetter, D. H. (1993). Multiplex PCR of three dinucleotide
repeats in the Prader-Willi/Angelman critical region (15q11 -q13): Molecular diagnosis
and mechanism of uniparental disomy. Hum Mol Genet 2, 143-51.
Monda, A., Malzac, P., Livet, M. O., Voelckel, M. A., Mancini, J., Delaroziere, J. C.,
Philip, N., and Mattei, J. F. (1999a). Angelman syndrome resulting from UBE3A
mutations in 14 patients from eight families: clinical manifestations and genetic
counselling. J Med Genet 36, 554-60.
Monda, A., Malzac, P., Voelckel, M. A., Auquier, P., Girardot, L., Mattei, M. G.,
Philip, N., Mattei, J. F., Lalande, M., and Livet, M. O. (1999b). Phenotype-genotype
correlation in 20 deletion and 20 non-deletion Angelman syndrome patients. Eur J Hum
Genet 7, 131-9.

97
Nakao, M., Sutcliffe, J. S., Durtschi, B., Mutirangura, A., Ledbetter, D. H., and
Beaudet, A. L. (1994). Imprinting analysis of three genes in the Prader-Willi/Angelman
region: SNRPN, E6-associated protein, and PAR-2 (D15S225E). Hum Mol Gen 3, 309-15.
Nan, X., Campoy, F. J., and Bird, A. (1997). MeCP2 is a transcriptional repressor with
abundant binding sites in genomic chromatin. Cell 88, 471-81.
Nan, X., Tate, P., Li, E., and Bird, A. (1996). DNA methylation specifies chromosomal
localization of MeCP2. Mol Cell Biol 16, 414-21.
Ng, H. H., and Bird, A. (1999). DNA methylation and chromatin modification. Curr Opin
Genet Dev 9, 158-63.
Nicholls, R. D. (2000). The impact of genomic imprinting for neurobehavioral and
developmental disorders. J Clin Invest 105, 413-8.
Nicholls, R. D., Knoll, J. H., Butler, M. G., Karam, S., and Lalande, M. (1989). Genetic
imprinting suggested by maternal uniparental heterodisomy in nondeletion Prader-
Willi syndrome. Nature 342, 281-5.
Nicholls, R. D., Pai, G. S., Gottlieb, W., and Cantú, E. S. (1992). Paternal uniparental
disomy in Angelman syndrome. Ann Neurol 32, 512-8.
Nicholls, R. D., Saitoh, S., and Horsthemke, B. (1998). Imprinting in Prader-Willi and
Angelman syndromes. Trends Genet 14, 194-200.
Ohama, K., Kajii, T., Okamoto, E., Fukuda, Y., Imaizumi, K., Tsukahara, M.,
Kobayashi, K., and Hagiwara, K. (1981). Dispermic origin of XY hydatidiform moles.
Nature 292, 551-2.
Ohama, K., Nomura, K., Okamoto, E., Fukuda, Y., Ihara, T., and Fujiwara, A. (1985).
Origin of immature teratoma of the ovary. Am J Obstet Gynecol 152, 896-900.
Ohta, T., Buiting, K., Kokkonen, H., McCandless, S., Heeger, S., Leisti, H., Driscoll, D.
J., Cassidy, S. B., Horsthemke, B., and Nicholls, R. D. (1999). Molecular mechanism of
angelman syndrome in two large families involves an imprinting mutation. Am J Hum
Genet 64, 385-96.
Pedone, P. V., Pikaart, M. J., Cerrato, F., Vernucci, M., Ungaro, P., Bruni, C. B., and
Riccio, A. (1999). Role of histone acetylation and DNA methylation in the maintenance
of the imprinted expression of the H19 and Igf2 genes. FEBS Lett 458, 45-50.
Perry, W. L., Hustad, C. M., Swing, D. A., O'Sullivan, T. N., Jenkins, N. A., and
Copeland, N. G. (1998). The itchy locus encodes a novel ubiquitin protein ligase that is
disrupted in a18H mice. Nat Genet 18, 143-6.
Prasad, C., and Wagstaff, J. (1997). Genotype and phenotype in Angelman syndrome
caused by paternal UPD 15. Am J Med Genet 70, 328-9.

98
Razin, A., and Cedar, H. (1994). DNA methylation and genomic imprinting. Cell 77,
473-6.
Reik, W., Brown, K. W., Schneid, H., Le Bouc, Y., Bickmore, W., and Maher, E. R.
(1995). Imprinting mutations in the Beckwith-Wiedemann syndrome suggested by
altered imprinting pattern in the IGF2-H19 domain. Hum Mol Genet 4, 2379-85.
Reis, A., Dittrich, B., Greger, V., Buiting, K., Lalande, M., Gillessen-Kaesbach, G.,
Anvret, M., and Horsthemke, B. (1994). Imprinting mutations suggested by abnormal
DNA methylation patterns in familial Angelman and Prader-Willi syndromes. Am J Hum
Genet 54, 741-7.
Robinson, W. P., Wagstaff, J., Bernasconi, F., Baccichetti, C., Artifoni, L, Franzoni,
E., Suslak, L, Shih, L. Y., Aviv, H., and Schinzel, A. A. (1993). Uniparental disomy
explains the occurrence of the Angelman or Prader- Willi syndrome in patients with an
additional small inv dup(15) chromosome. J Med Genet 30, 756-60.
Rougeulle, C., Cardoso, C., Fontes, M., Colleaux, L, and Lalande, M. (1998). An
imprinted antisense RNA overlaps UBE3A and a second maternally expressed
transcript. Nat Genet 19, 15-6.
Rougeulle, C., Glatt, H., and Lalande, M. (1997). The Angelman syndrome candidate
gene, UBE3A/E6-AP, is imprinted in brain. Nat Genet 17, 14-5.
Russo, S., Cogliati, F., Viri, M., Cavalleri, F., Selicorni, A., Turolla, L., Belli, S.,
Romeo, A., and Larizza, L. (2000). Novel mutations of ubiquitin protein ligase 3A gene
in Italian patients with Angelman syndrome. Hum Mutat 15, 387.
Saitoh, S., Buiting, K., Cassidy, S. B., Conroy, J. M., Driscoll, D. J., Gabriel, J. M.,
Gillessen-Kaesbach, G., Glenn, C. C., Greenswag, L. R., Horsthemke, B., Kondo, I.,
Kuwajima, K., Niikawa, M., Rogan, P. K., Schwartz, S., Seip, J., Williams, C. A., and
Nicholls, R. D. (1997). Clinical spectrum and molecular diagnosis of Angelman and
Prader-Willi syndrome patients with an imprinting mutation. Am J Med Genet 68, 195-
206.
Saitoh, S., Buiting, K., Rogan, P.'K., Buxton, J. L., Driscoll, D. J., Arnemann, J.,
Konig, R., Malcolm, S., Horsthemke, B., and Nicholls, R. D. (1996). Minimal definition
of the imprinting center and fixation of a chromosome 15q 11 -q 13 epigenotype by
imprinting mutations. PNAS 93, 7811-5.
Saitoh, S., Harada, N., Jinno, Y., Hashimoto, K., Imaizumi, K., Kuroki, Y., Fukushima,
Y., Sugimoto, T., Renedo, M., Wagstaff, J., and et al. (1994). Molecular and clinical
study of 61 Angelman syndrome patients. Am J Med Genet 52, 158-63.
Saitoh, S., and Wada, T. (2000). Parent-of-Origin Specific Histone Acetylation and
Reactivation of a Key Imprinted Gene Locus in Prader-Willi Syndrome. Am J Hum
Genet 66, 1958-62.

99
Saitoh, S., Wada, T., Kuno, T., Kim, K. C., Ohashi, H., Hashimoto, K., and Niikawa, N.
(1999). Clinical characteristics of Angelman syndrome patients with a non-IC- deleted
imprinting mutation. Clin Genet 55, 277-8.
Sasaki, H., Ishihara, K., and Kato, R. (2000). Mechanisms of Igf2/H19 imprinting: DNA
methylation, chromatin and long- distance gene regulation. J Biochem (Tokyo) 127,
711-5.
Schweizer, J., Zynger, D., and Francke, U. (1999). In vivo nuclease hypersensitivity
studies reveal multiple sites of parental origin-dependent differential chromatin
conformation in the 150 kb SNRPN transcription unit. Hum Mol Genet 8, 555-66.
Shemer, R., Birger, Y., Riggs, A. D., and Razin, A. (1997). Structure of the imprinted
mouse Snrpn gene and establishment of its parental-specific methylation pattern. Proc
Natl Acad Sci U S A 94, 10267-72.
Shibata, H., Yoshino, K., Sunahara, S., Gondo, Y., Katsuki, M., Ueda, T., Kamiya, M.,
Muramatsu, M., Murakami, Y., Kalcheva, I., Plass, C., Chapman, V. M., and
Hayashizaki, Y. (1996). Inactive allele-specific methylation and chromatin structure of
the imprinted gene U2af1-rs1 on mouse chromosome 11. Genomics 35, 248-52.
Simon, I., Tenzen, T., Reubinoff, B. E., Hillman, D., McCarrey, J. R., and Cedar, H.
(1999). Asynchronous replication of imprinted genes is established in the gametes and
maintained during development. Nature 401, 929-32.
Sleutels, F., Barlow, D. P., and Lyle, R. (2000). The uniqueness of the imprinting
mechanism. Curr Opin Genet Dev 10, 229-33.
Smeets, D. F., Hamel, B. C., Nelen, M. R., Smeets, H. J., Bollen, J. H., Smits, A. P.,
Ropers, H. H., and van Oost, B. A. (1992). Prader-Willi syndrome and Angelman
syndrome in cousins from a family with a translocation between chromosomes 6 and
15. N Engl J Med 326, 807-11.
Smilinich, N. J., Day, C. D., Fitzpatrick, G. V., Caldwell, G. M., Lossie, A. C., Cooper,
P. R., Smallwood, A. C., Joyce, J. A., Schofield, P. N., Reik, W., Nicholls, R. D.,
Weksberg, R., Driscoll, D. J., Maher, E. R., Shows, T. B., and Higgins, M. J. (1999). A
maternally methylated CpG-island in KvLQTI is associated with an antisense paternal
transcript and loss of imprinting in Beckwith-Wiedemann syndrome. Proc Natl Acad Sci
U S A 96, 8064-9.
Smith, A., Deng, Z. M., Beran, R., Woodage, T., and Trent, R. J. (1994). Familial
unbalanced translocation t(8;15)(p23.3;q11) with uniparental disomy in Angelman
syndrome. Hum Genet 93, 471-3.
Smith, A., Marks, R., Haan, E., Dixon, J., and Trent, R. J. (1997). Clinical features in
four patients with Angelman syndrome resulting from paternal uniparental disomy. J
Med Genet 34, 426-9.
Smith, A., Robson, L., and Buchholz, B. (1998). Normal growth in Angelman syndrome
due to paternal UPD. Clin Genet 53, 223-5.

100
Smith, A., Wiles, C., Haan, E., McGill, J., Wallace, G., Dixon, J., Selby, R., Colley, A.,
Marks, R., and Trent, R. J. (1996). Clinical features in 27 patients with Angelman
syndrome resulting from DNA deletion. J Med Genet 33, 107-12.
Smrzka, O. W., Fae, I., Stoger, R., Kurzbauer, R., Fischer, G. F., Henn, T., Weith, A.,
and Barlow, D. P. (1995). Conservation of a maternal-specific methylation signal at the
human IGF2R locus. Hum Mol Genet 4, 1945-52.
Squire, J. A., Li, M., Perlikowski, S., Fei, Y. L., Bayani, J., Zhang, Z. M., and
Weksberg, R. (2000). Alterations of H19 imprinting and IGF2 replication timing are
infrequent in Beckwith-Wiedemann syndrome. Genomics 65, 234-42.
Stoger, R., Kubicka, P., Liu, C.-G., Kafri, T., Razin, A., Cedar, H., and Barlow, D. P.
(1993). Maternal-specific methylation of the imprinted mouse/g/2r locus identifies the
expressed locus as carrying the imprinting signal. Cell 73, 61-71.
Sutcliffe, J. S., Galjaard, R.-J., Jiang, Y.-H., Kubota, T., Fang, P., Matsurra, T.,
Ledbetter, D. H., Cattanach, B., and Beaudet, A. L. (1996). The Angelman syndrome
critical region is narrowed to -200 kb and includes the UBE3A gene. In The American
Society of Human Genetics, M. D. Peter H. Byers, ed. (San Francisco, CA: The
University of Chicago Press).
Sutcliffe, J. S., Jiang, Y. H., Galijaard, R. J., Matsuura, T., Fang, P., Kubota, T.,
Christian, S. L., Bressler, J., Cattanach, B., Ledbetter, D. H., and Beaudet, A. L.
(1997). The E6-AP ubiquitin-protein ligase (UBE3A) gene is localized within a narrowed
Angelman syndrome critical region. Genome Res 7, 368-77.
Sutcliffe, J. S., Nakao, M., Christian, S., Orstavik, K. H., Tommerup, N., Ledbetter, D.
H., and Beaudet, A. L. (1994). Deletions of a differentially methylated CpG island at
the SNRPN gene define a putative imprinting control region. Nat Genet 8, 52-8.
Szabo, P., Tang, S. H., Rentsendorj, A., Pfeifer, G. P., and Mann, J. R. (2000).
Maternal-specific footprints at putative CTCF sites in the H19 imprinting control region
give evidence for insulator function. Curr Biol 10, 607-10.
Szabo, P. E., and Mann, J. R. (1995). Biallelic expression of imprinted genes in the
mouse germ line: implications for erasure, establishment, and mechanisms of genomic
imprinting. Genes Dev 9, 1857-68.
Szabo, P. E., Pfeifer, G. P., and Mann, J. R. (1998). Characterization of novel parent-
specific epigenetic modifications upstream of the imprinted mouse H19 gene. Mol Cell
Biol 18, 6767-76.
Tada, M., Tada, T., Lefebvre, L., Barton, S. C., and Surani, M. A. (1997). Embryonic
germ cells induce epigenetic reprogramming of somatic nucleus in hybrid cells. Embo J
16, 6510-20.
Tilghman, S. M. (1999). The sins of the fathers and mothers: genomic imprinting in
mammalian development. Cell 96, 185-93.

101
Tonk, V., Schultz, R. A., Christian, S. L, Kubota, T., Ledbetter, D. H., and Wilson, G.
N. (1996). Robertsonian (15q;15q) translocation in a child with Angelman syndrome:
evidence of uniparental disomy. Am J Med Genet 66, 426-8.
Tremblay, K. D., Saam, J. R., Ingram, R. S., Tilghman, S. M., and Bartolomei, M. S.
(1995). A paternal-specific methylation imprint marks the alleles of the mouse H19
gene. Nat Genet 9, 407-13.
Trent, R. J., Sheffield, L. J., Deng, Z. M., Kim, W. S., Nassif, N. T., Ryce, C., Woods,
C. G., Michaelis, R. C., Tarleton, J., and Smith, A. (1997). The elusive Angelman
syndrome critical region. J Med Genet 34, 714-8.
Tsai, T. F., Armstrong, D., and Beaudet, A. L. (1999a). Necdin-deficient mice do not
show lethality or the obesity and infertility of Prader-Willi syndrome. Nat Genet 22,
15-6.
Tsai, T. F., Jiang, Y. H., Bressler, J., Armstrong, D., and Beaudet, A. L. (1999b).
Paternal deletion from Snrpn to Ube3a in the mouse causes hypotonia, growth
retardation and partial lethality and provides evidence for a gene contributing to
Prader-Willi syndrome. Flum Mol Genet 8, 1357-64.
Turker, M. S. (1999). The establishment and maintenance of DNA methylation patterns
in mouse somatic cells. Semin Cancer Biol 9, 329-37.
Tycko, B. (2000). Epigenetic gene silencing in cancer. J Clin Invest 105, 401-7.
van den Ouweland, A. M., Bakker, P. L., Halley, D. J., and Catsman-Berrevoets, C. E.
(1999). Angelman syndrome: AS phenotype correlated with specific EEG pattern may
result in a high detection rate of mutations in the UBE3A gene. J Med Genet 36, 723-4.
Vu, T. H., and Hoffman, A. R. (1997). Imprinting of the Angelman syndrome gene,
UBE3A, is restricted to brain. Nat Genet 17, 12-3.
White, L. M., Rogan, P. K., Nicholls, R. D., Wu, B. L., Korf, B., and Knoll, J. H. (1996).
Allele-specific replication of 15ql 1 -q13 loci: a diagnostic test for detection of
uniparental disomy. Am J Hum Genet 59, 423-30.
Wilkinson, K. D. (2000). Ubiquitination and deubiquitination: targeting of proteins for
degradation by the proteasome. Semin Cell Dev Biol 11, 141-8.
Williams, C. A., Angelman, H., Clayton-Smith, J., Driscoll, D. J., Hendrickson, J. E.,
Knoll, J. H., Magenis, R. E., Schinzel, A., Wagstaff, J., Whidden, E. M., and Zori, R. T.
(1995a). Angelman syndrome: consensus for diagnostic criteria. Angelman Syndrome
Foundation. Am J Med Genet 56, 237-8.
Williams, C. A., Hendrickson, J. E., Cantu, E. S., and Donlon, T. A. (1989). Angelman
syndrome in a daughter with del(15) (q11q13) associated with brachycephaly, hearing
loss, enlarged foramen magnum, and ataxia in the mother. Am J Med Genet 32, 333-8.

102
Williams, C. A., Lossie, A. C., and Driscoll, D. J. (2000). Angelman Syndrome:
GeneClinics).
Williams, C. A., Zori, R. T., Hendrickson, J., Stalker, H., Marum, T., Whidden, E., and
Driscoll, D. J. (1995b). Angelman Syndrome. Current Problems in Pediatrics 25, 216-31.
Wutz, A., Smrzka, O. W., and Barlow, D. P. (1998). Making sense of imprinting the
mouse and human IGF2R loci. Novartis Found Symp 214, 251-9.
Yamamoto, Y., Huibregtse, J. M., and Howley, P. M. (1997). The human E6-AP gene
(UBE3A) encodes three potential protein isoforms generated by differential splicing.
Genomics 41, 263-6.
Yang, T., Adamson, T. E., Resnick, J. L., Leff, S., Wevrick, R., Francke, U., Jenkins,
N. A., Copeland, N. G., and Brannan, C. I. (1998). A mouse model for Prader-Willi
syndrome imprinting-centre mutations. Nat Genet 19, 25-31.
Zackowski, J. L., Nicholls, R. D., Gray, B. A., Bent-Williams, A., Gottlieb, W., Harris,
P. J., Waters, M. F., Driscoll, D. J., Zori, R. T., and Williams, C. A. (1993). Cytogenetic
and molecular analysis in Angelman syndrome. Am J Med Genet 46, 7-11.

BIOGRAPHICAL SKETCH
Amy Lossie was bom on August 15, 1967, in Kalamazoo, Michigan. Growing up
on Three Mile Lake in nearby Paw Paw, Amy’s early childhood was spent enjoying the
outdoors where she developed an intense curiosity of nature and love of water. In
high school, Amy was diagnosed with a rare birth defect. This was a major turning
point in Amy’s life. Luckily, her friends and family were completely supportive of her
during this hard time. She relied heavily on her best friend, Andy Glomski, who has to
this day remained her staunch ally. During her extensive hospital stay, Amy was
exposed to medical research for the first time, and she developed an intense desire to
learn what caused her birth defect.
Amy entered The University of Michigan in 1985. She lived a full life in college.
In addition to her studies in cellular and molecular biology, she found plenty of time to
have fun. She spent football Saturdays at the Big House cheering on the Wolverines
and found a job working in a molecular pharmacology lab. Amy realized that she
loved the bench more than books. Along with her lab mate, Joan Taylor, Amy spent
many evenings and weekends finishing experiments. The friends she made during this
time in her life greatly influenced her career choices. Through example, Joan showed
Amy that she could follow her dream and become an academic scientist. After
graduating with a BS in 1990, Amy left pharmacology and entered the field of
genetics. Working with Dr. Sally Camper, Amy learned the fundamentals of Genetics
research. She worked hard and earned the respect of Dr. Camper, who gave Amy the
103

104
opportunity to design her own experiments and write her own papers. In Sally’s lab,
Amy learned that it took blood, sweat and total devotion to be a successful graduate
student.
In the summer of 1995, Amy entered Dr. Dan Driscoll’s laboratory as a graduate
student in the Center for Mammalian Genetics. She has spent the past five and a half
years researching genomic imprinting in the Angelman syndrome. Amy grew
scientifically under the direction of Dr. Driscoll, who was her mentor in every meaning
of the word. Dr. Driscoll funneled valuable resources into Amy’s research, enabling
her to successfully complete her studies. Amy will never forget that devotion.
Amy intends to earn her Ph. D. from the University of Florida in the fall of
2000. Upon completion of her dissertation, Amy will continue her scientific training in
the laboratory of Dr. Monica Justice at Baylor College of Medicine. Amy plans to study
developmental genetics using the mouse as a model system. Her research will focus
on characterization of one mutation of an allele series of Odz4. This interesting
mutation may also be subject to genomic imprinting. Amy intends to use her
knowledge of imprinting to further the understanding of Odz4 in the mouse. Her long
term goals are to develop a strong academic research laboratory in human and mouse
genetics, where she will educate and train young scientists.

i certify that I have read this study and that in my opinion it conforms to
acceptable standards of scholarly presentation arjd-js fully adequate, in scope
and quality, as a dissertation for the degree of^poGtoK of Philosophy.
X
Daniel J. Driscoll, Chair
Associate Professor of Pediatric
Genetics
I certify that I have read this study and that in my opinion it conforms to
acceptable standards of scholarly presentation and is fully adequate, in scope
and quality, as a dissertation for the degree of Doctor of Philosophy.
Camilynn I. Brannan
Assistant Professor of Molecular
Genetics and Microbiology
I certify that I have read this study and that in my opinion it conforms to
acceptable standards of scholarly presentation and is fully adequate, in scope
and quality, as a dissertation for the degree of Doctor of Philosophy.
Margaret FC Wallace
Associate Professor of Biochemistry
and Molecular Biology
I certify that I have read this study and that in my opinion it conforms to
acceptable standards of scholarly presentation and is fully adequate, in scope
and quality, as a dissertation for the degree of Doctor of philosophy.
Thomas P. Yang
Professor of Bioch
Biology
istry dnd Molecular
This dissertation was submitted to the Graduate Faculty of the College
of Medicine and to the Graduate School and was accepted as partial fulfillment
of the requirements for the degree of Doctor of Philosophy.
Cjl^ s
v
December, 2000
Dean, College of Medicine
Dean, Graduate School