Citation
Identification of a virulence function in herpes simplex virus type l mapping to the latency associated transcript locus

Material Information

Title:
Identification of a virulence function in herpes simplex virus type l mapping to the latency associated transcript locus
Creator:
Gary, Lee William
Publication Date:
Language:
English
Physical Description:
ix, 79 leaves : ill. ; 29 cm.

Subjects

Subjects / Keywords:
Animal models ( jstor )
Human herpesvirus 1 ( jstor )
Infections ( jstor )
Neurons ( jstor )
Phenotypes ( jstor )
Promoter regions ( jstor )
Rabbits ( jstor )
Simplexvirus ( jstor )
Virulence ( jstor )
Viruses ( jstor )
Genre:
bibliography ( marcgt )
theses ( marcgt )
non-fiction ( marcgt )

Notes

Thesis:
Thesis (Ph. D.)--University of Florida, 2004.
Bibliography:
Includes bibliographical references.
General Note:
Printout.
General Note:
Vita.
Statement of Responsibility:
by Lee William Gary.

Record Information

Source Institution:
University of Florida
Rights Management:
The University of Florida George A. Smathers Libraries respect the intellectual property rights of others and do not claim any copyright interest in this item. This item may be protected by copyright but is made available here under a claim of fair use (17 U.S.C. §107) for non-profit research and educational purposes. Users of this work have responsibility for determining copyright status prior to reusing, publishing or reproducing this item for purposes other than what is allowed by fair use or other copyright exemptions. Any reuse of this item in excess of fair use or other copyright exemptions requires permission of the copyright holder. The Smathers Libraries would like to learn more about this item and invite individuals or organizations to contact the RDS coordinator (dissertations@uflib.ufl.edu) with any additional information they can provide.
Resource Identifier:
880637454 ( OCLC )
ocn880637454

Downloads

This item has the following downloads:


Full Text










IDENTIFICATION OF A VIRULENCE FUNCTION IN HERPES SIMPLEX VIRUS-
TYPE I MAPPING TO THE LATENCY ASSOCIATED TRANSCRIPT LOCUS














By

LEE WILLIAM GARY













A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY

UNIVERSITY OF FLORIDA

2004



















Copyright 2004

by

Lee William Gary














ACKNOWLEDGMENTS

I would like to thank my parents, Bill and Barbara, for their endless support and

encouragement. I also appreciate the support of Jia Liu, Karen Johnstone, Jason Liem,

Chuck Peek and many other friends at the University of Florida. My advisor, David

Bloom, made this work possible and I greatly appreciate his expertise and patience.




































iii



















TABLE OF CONTENTS

Page

ACKNOWLEDGEMENTS................................... ..............................iii

LIST OF TABLES .................. ....................... ................................vi

LIST OF FIGURES.......................................................................... vii

ABSTRACT......................................... ...... .......................................viii

CHAPTER

1 INTRODUCTION......... ...................................... ...... ....... .... 1

General Characteristics of HSV-1........................... ..................... 1
Viral Infections in Human Host................................................... 3
Animal Models ................................ ...................... ........... 5
LAT Mutants and Phenotypes..................................... ............. 8
Establishment ......................................... ........................ 9
Reactivation............ ... ..................................................... 10
Other Regulatory Regions of LAT........... ... ............. .................. 12
Neuronal Survival and Apoptosis.................................................. 13

2 METHODS............ .................................................................21

LAT Recombinant Viruses ......................... ....... ...................... 26
17A480R.......... ...................................................... 26
17APstA480....................................................... ....... 27
Analyses In Vivo and Cell Culture................................................29
Virulence Determination in Mouse Model............................. 29
Tissue Restriction......................................................... 30
Time Course Experiments................................................. 30





iv









3 R E SU LT S ................................................. .......................... 35

LDso/pfu Evaluation................................................................ 36
Tissue Restriction................................................................. 38
Cell Specific Replication Deficiency.......................................... 39
Additional LAT Recombinant Viruses........................................... 41
17A480R.................................................................. 41
17APstA480................................................................ 42

4 DISCUSSION.........................................................................53

Virulence Phenotype and Nervous System Restriction..................... 57
Cell Culture Phenotype................................................................58
LAT Mutants and Multiple Regulatory Functions............................59
Mechanism................. .............................................................61
Lytic Promoter in the LAT Region ................................... 62
Transcriptional Permissivity.............................................. 63
ICPO Enhancer................. ....................................... 64

LIST OF REFERENCES..................................................................66

BIOGRAPHICAL SKETCH............................................................. 79




























v














LIST OF TABLES

Table page

1-1. Analysis of the 5' LAT deletions on reactivation in the rabbit eye model........ 19

1-2. The ratio of HSV to actin DNA in rabbit trigeminal ganglia latently infected with
17A307 and 17A307R mutants of HSV-1......................................... 20

3-1. LD 50 values............................................................................... 44




































vi














LIST OF FIGURES

Figure page

1-1. Schematic of the LAT gene and the position of 17APst, 17A307, 17A480 and
17A489 recombinant viruses.......................................................... 17

1-2. Large LAT deletions used for virulence indications...............................18

2-1. 17A480R construction.................................................... ......... 32

2-2. Dot blot hybridization of second round plaque purification of 17A480R........ 33

2-3. Dot blot hybridization of second round plaque purification of 17APstA480......34

3-1. Reduced corneal pathology of 17A307 in the rabbit eye model........ ....... 43

3-2. Infectious virus recovered from mouse feet at 2 days post-infection.............. 45

3-3. Virus production in dorsal root ganglia at 3 and 5 days post-infection ..........46

3-4. Virus production in spinal cord at 5 and 7 days post-infection..................... 47

3-5. Virus production in brain at 7 days post-infection....................................48

3-6. 17A307 and 17A480 multi-step time course in PC-12 cells...................... 49

3-7. 17A480R multi-step time course in PC-12 cells......................................50

3-8. Multi-step time course in rabbit skin cells............................................51

3-9. Single step time course in PC-12 cells................................................52

4-1. Separate genetic regions of the LAT locus............................................65








vii













Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy

IDENTIFICATION OF A VIRULENCE FUNCTION IN HERPES SIMPLEX VIRUS-
TYPE I MAPPING TO THE LATENCY ASSOCIATED TRANSCRIPT LOCUS

By

Lee William Gary

May 2004

Chair: David C. Bloom
Major Department: Molecular Genetics and Microbiology

Two Herpes Simplex Virus type 1 (HSV-1) strain 17syn+ recombinants (17A307

and 17A480) possessing contiguous deletions spanning the 3' region of the Latency

Associated Transcript (LAT) exon 1 and the 5' portion of the LAT intron were analysed

for virulence in mouse footpad (f.p.) model. While the 17syn+ (parent) and 17APst (LAT

promoter mutant) yielded LD5o/pfu values of 3.25 x 102 and 5.11 x 102 respectively,

17A307 and 17A480 had LDso/pfu values of>7.0 x 104. A second independent

recombinant and a rescue (17A307a and 17A307aR) were constructed and yielded f.p.

LD50 values of>7.0 x 104 and 3.17 x 102 respectively, confirming that deletions within

this region of the LAT locus resulted in a dramatic reduction in virulence. Replication of

the recombinants was indistinguishable from wild-type 17syn+ and rescue viruses when

tested on rabbit skin cells but demonstrate 10-fold reduction in viral yields on PC-12 cells

as measured by multi-step growth curves. Significantly, the attenuation in virulence

displayed by 17A307 and 17A480 is not observed for the LAT promoter mutant, 17APst,,


viii








suggesting that the phenotype is independent of the LAT latent promoter (LAP1). In

addition, 17A480 possesses a wild-type reactivation in the rabbit eye model suggesting

that the virulence and reactivation phenotypes are genetically separable.














































ix













CHAPTER 1
INTRODUCTION

General Characteristics of HSV-1

Herpes Simplex Virus-type I (HSV-1) is a widely prevalent human pathogen that is

nuclear replicating, enveloped particle within an icosahedral capsid containing an

amorphous tegument (Roizman et al., 1974). The genome of HSV-1 is a double stranded

DNA molecule of 152 kb, encoding more than 70 protein products (Becker et al., 1968;

Kieffet al., 1971; McGeoch et al., 1985; McGeoch et al., 1988). Regions of the genome

are rich in repetitive sequence, whereas other areas contain mostly unique sequence. The

HSV-1 genome also has a high GC content in comparison to other viruses (Becker et al.,

1968; Kieffet al., 1971; McGeoch et al., 1988). HSV-1 is an alphaherpesvirus and as

such is neurotropic with rapid replication capabilities and exhibits a broad host and cell

range (Jamieson et al., 1974). While HSV-1 is able to infect a wide spectrum of different

mammalian cell types, the ability to replicate and establish a latent infection within

neurons is central to HSV-1's biology (Dotti et al., 1987; Dotti et al., 1990). Because

most neurons divide infrequently and consequently rarely express proteins necessary for

DNA replication, HSV-1 encodes specialized functions for existing within the highly

differentiated cells (Caradonna et al., 1981; Honess et al., 1974; Honess et al., 1975;

Huszer et al., 1981; Preston et al., 1984).

Attachment and entry of infectious viral particles involve interaction between

several cellular membrane glycoproteins and receptors (Baines et al., 1991; Cai et al.,

1988; Forrester et al., 1992; Javier et al., 1988; Johnson et al., 1986; Longnecker et al.,


1





2

1987; Longnecker et al., 1987; Roop et al., 1993). Once viral particles have entered the

cell, the nucleocapsid is transported to the nucleus to deposit viral DNA (Batterson et al.,

1983; Tognan et al., 1981). Along with the viral genome is the VP16 protein, which

functions in enhancing viral immediate-early gene transcription (Campbell et al., 1984;

Heine et al., 1974; Spear et al., 1972). HSV-1 encodes five immediate-early genes that

are expressed prior to viral protein production: ICPO, ICP4, ICP22, ICP27 and ICP47

(Mackem et al., 1982; Mackem et al., 1982; Post et al., 1981). The ICPO and ICP4

proteins initiate and regulate viral transcription (Everett et al., 1984; Everett et al., 1984;

Everett et al., 1987; Gelman et al., 1985; Gelman et al., 1986; Gelman et al., 1987;

O'Hare et al., 1985). ICP27 is also active in gene expression but acts at the level of RNA

transport from the nucleus into the cytoplasm (Sandri-Goldman et al., 1994). In order for

HSV-1 to replicate in neurons, which are non-dividing cells, the virus encodes many of

its own enzymes for DNA replication (Caradonna et al., 1981; Honess et al., 1974;

Honess et al., 1975; Huszer et al., 1981; Preston et al., 1984). These products are

generally included among the early genes of HSV-1.

Seven early genes are required for viral replication in all cell types and conditions:

DNA polymerase, DNA binding proteins, ORI binding protein and the helicase/primer

trimer (Chartrand et al., 1980; Coen et al., 1984; Hay et al., 1976; Honess et al., 1984).

A few other key early genes that include thymidine kinase, ribonucleotide reductase and

dUTPase are encoded and allow for replication in the neuronal environment (Caradonna

et al., 1981; Honess et al., 1974; Honess et al., 1975; Huszer et al., 1981; Preston et al.,

1984). Late genes begin to be expressed during DNA replication and are divided into 2

subclasses: leaky-late and strict late (Costa et al., 1985; Dennis et al., 1984; Everett et al.,





3

1984; Guzowski et al., 1993). The leaky-late gene products can be transcribed prior to

the conclusion of replication but strict late genes are only transcribed after replication has

completed. Regardless of these differences, late genes are mainly the structural products

of HSV-1 and include glycoproteins and capsid proteins.

Viral Infections in the Human Host

The majority of the U.S. and World population is infected with HSV-1. In most

cases, the virus does not induce a severe acute infection, but for a small percentage, it can

cause blindness or encephalitic death. Individuals infected with HSV-1 harbor a lifelong

latent infection in sensory and autonomic neurons, with occasional recurrences of an

acute infection at the site of initial infection. Latent infection of neurons results in the

replicative silencing of the HSV-1 genome. For the establishment of latency, after entry

of virus, a dramatic repression of gene expression must occur. Transcription of most

HSV-1 genes must be silenced, or restricted to very low levels with few transcripts being

expressed or detectable. During the maintenance stage of latency, the genome is present

as an episome within the nucleus of the cell (Mellerick et al., 1987; Rock et al., 1983;

Rock et al., 1985). Maintenance of HSV-1 latency involves the potential for latent

genomes to reactivate and produce infectious virus upon appropriate stimulus.

Reactivation from latency is believed to be a rare event and results in the reappearance of

infectious virus from sensory ganglia that travels back to the initial site of infection in the

epithelia. Clinical reactivation results in a lesion with detectable infectious virus.

Reactivation also has been determined to occur subclinically, with HSV-1 genomes

detected by PCR in the epithelia. It is unclear whether reactivation is lytic to neurons, but

the multiple occurrences of reactivation in the human population makes neuronal

destruction upon reactivation unlikely (Corey et al., 1996). It is more plausible that





4

reactivating neurons produce very low levels of infectious virus with high levels of

replication occurring in other cell types of the nervous system, or exclusively in the

epithelia. Lesions in the periphery form at a rate and with cytopathology that coincides

with rapid virus replication in cell culture (Stevens et al., 1975; Whitley et al., 1993).

In a suitable host, the immune system is an important regulator of HSV-1 severity.

During an HSV-1 infection in peripheral tissue, CD4+ cells function to activate and

recruit macrophages (Nash et al., 1993). CD4+ cells have also been shown to serve as

cytotoxic lymphocytes (CTLs) in culture. Important immunological players in the

nervous system are significantly different than other infected regions of the host during a

HSV-1 infection. CD8+ cells and IgG function to limit viral spread and severity of

infection (Kapoor et al., 1982; Simmons et al., 1987). It is important to note that infected

neurons are not targeted by CTLs and that their action in the nervous tissue appears to be

limited to non-neuronal cells. Although the involvement of the immune system functions

to reduce the severity of acute infection, it has been difficult to determine how the stages

of latency are affected by immune regulators. In many ways, sensory neurons are

immune privileged cells. With regard to regulation of the latent infection, most attention

has been directed away from the immune system and toward viral gene regulation and

expression.

In a latent infection of neurons, the latency-associated transcript is the only viral

RNA produced at readily detectable levels (Figure 1-1). The latency-associated transcript

(LAT) gene is positioned in the long repeat regions of the viral genome and is thus

diploid. During latency, two poly(A)- LAT products can be observed and have molecular

sizes of 2.0 and 1.5 kb (Spivack et al., 1998a; Spivack et al., 1998b; Wagner et al., 1988;





5

Wechsler et al., 1988). These products have been shown to be nuclear-localized, stable

introns (Farrell et al., 1994; Zabolotny et al., 1997) and are spliced from an 8.3 kb

primary transcript (Farrell et al., 1991). Stability of the introns is hypothesized to be due

to nonconsensus A or G branch point sequence and inhibits debranching of the lariat in

vivo (Rodahl et al., 1997; Tahl-Singer et al., 1997; Zabolotny et al., 1997). The 1.5 kb

intron is only observed in neurons, and is believed to be an alternative splice product of

the 2 kb intron (Zabolotny et al., 1997). The LAT promoter itself contains several

neuron-specific expression elements (Farrell et al., 1994; Morrow et al., 1994; Zwaagstra

et al., 1991), consistent with its high-level of expression in these cells (Dobson et al.,

1989). Further, in animal models, the LAT promoter demonstrates greater activity in

neurons and is specifically more active in neurons not expressing acute antigens

(Margolis et al., 1992). Since the LAT is the only viral transcript abundantly transcribed

during latency, its role in the establishment, maintenance and reactivation from latency in

the mammalian host has been sought. Because latency can only be established in vivo,

the use of animal models is required.

Animal Models

Several animal models are used in HSV-1 research that mimic the acute and latent

infections occurring in the human population. The mouse footpad model allows the study

of both acute and latent infections. In this model, the epidermis of the footpad is infected

which allows acute replication in this tissue. Infectious virus enters the nervous system

by infiltration of nerve termini located in the epidermis. Virus then travels by fast axonal

transport into dorsal root ganglia (DRG). In the sensory neurons of the DRG the virus

progresses down one of two paths: 1) acute replication and virus production may ensue;

or 2) genomes are silenced and latency is established. With a high viral dose, highly





6

virulent viral strain, or a virulence sensitive mouse strain, acute infection will spread to

the central nervous system where death of the animal may occur by encephalitis. The

mouse footpad model is especially useful for acute virulence experiments due to efficient

infection of epidermis and progression into the peripheral and central nervous systems. It

allows the study of both neuroinvasion and neurovirulence of HSV-1 strains and mutants

(Izumi et al., 1988; Izumi et al., 1990; Thompson et al., 1986). Neuroinvasion is the

ability of a virus to enter into and travel through the nervous system and is measured by

peripheral inoculation of the virus. Neurovirulence measures the ability of the virus to

replicate within neurons and is assessed by the lethality of viruses and their ability to

induce encephalitis.

The mouse footpad model is also utilized for latent analysis ofHSV-1, since the

virus efficiently establishes a latent infection in DRG. Reactivation can be studied in the

mouse model by the physical removal of DRG and incubation in cell culture media in a

process known as explant cultivation. Infectious virus is induced to emerge from these

sensory neurons and by placement upon a cell monolayer in culture the virus can be

readily detected (explant co-cultivation). Another mouse model for the study of HSV

latency and reactivation is the hyperthermic stress model. This model involves acute

infection of the cornea. After addition of virus on the cornea, HSV-1 then travels via

sensory axons to the trigeminal ganglion (TG) where a latent infection is established in

sensory neurons. Once a latent infection is established, latent virus can be reactivated by

placing the live infected mouse in a hyperthermic water bath set at 43C for 10 minutes.

Approximately 22 hours later, the TG are removed, sectioned and assayed for the

presence of virus by immunohistochemical methods (Sawtell and Thompson 1992). This





7

approach, and co-cultivation, does not adequately substitute for clinical reactivation since

virus detection in nervous tissue is very different from viral recovery in the periphery that

occurs in true reactivation. The mouse models have been useful in that they have

identified several aspects of the latent infection in vivo: identification of the neuron as

the site of latency, understanding of axonal transport of virus through the sciatic nerve,

the ability of non-replicating viruses to establish latent infections and characterization of

transcripts expressed during the stages of latency (Dobson et al., 1989; Kristensson et al.,

1971; Kwon et al., 1982; McLennan et al., 1980; Stevens et al., 1987; Wagner et al.,

1988).

Although the mouse models allow for the analysis of HSV-1 latency, the best

animal model would be one that allows reactivation to occur spontaneously but also

allows induction of reactivation with proper stress stimulus. Also, an ideal model would

result in the production of acute lesions at the periphery with the appearance of detectable

infectious virus. The mouse models require the physical removal of ganglia to detect

infectious virus. Latent infection and reactivation can also be induced in the TG of

rabbits upon corneal infection (Nesburn et al., 1967). From this discovery, the

spontaneous and inducible rabbit eye models were developed and function as superior

models for the study of reactivation since they allow for the detection of virus in the eye

after reactivation from the rabbit TG. The spontaneous model involves the detection of

random reactivation events by the sampling of tear film. The epinephrine-induced rabbit

eye model is one degree closer to the natural infection in humans than the spontaneous

model in that it is stress inducible. In this model, virus can be induced to reactivate by

application of current and epinephrine to the eye (Berman et al., 1985; Hill et al., 1986;





8

Hill et al., 1987a; Hill et al., 1987b; Kwon et al., 1981; Kwon et al., 1982). Viral

genomes within neurons of the TG reactivate and travel to the initial site of infection, the

eye. This model more closely mirrors the natural human infection in that infectious virus

can be recovered at the tissue initially infected with HSV-1 upon appropriate stress

stimuli. The rabbit models also are more discriminating than the mouse models in which

LAT mutants reactivate. Both the mouse model and the rabbit eye model have made it

possible to better understand the impact of the LAT upon the various stages of latency.

LAT Mutants and Phenotypes

From the use of animal models, the LAT has been shown to affect establishment

and reactivation phenotypes of latency. It has been proposed that the LAT may function

most directly on establishment and subsequently influence reactivation indirectly due to

decreased efficiency of establishment (Sawtell and Thompson 1992; Sawtell 1998;

Sawtell et al., 1998; Thompson and Sawtell 1997). When assayed with promoter reporter

viruses, it was determined that establishment of latent infections and the initiation of a

productive infection occur with the same kinetics (Margolis et al., 1992). This work also

identified four classes of neurons in the ophthalmic division of the trigeminal ganglion

that are susceptible to HSV-1 infection. These neuronal classes include substance P+,

CGRP+, LD2+ and SSEA-3+ neurons with the SSEA-3 (stage-specific embryonic

antigen 3) neurons to be the major class of these four to harbor a latent infection.

Additionally, with a similar reporter construct, the LAT promoter was shown to be most

active in both neuron number and intensity of staining during the acute stage of infection.

In this system, peak expression occurs in mouse trigeminal ganglia at 5-8 days post-

infection in concordance with the end of lytic infection and suggests a role in the

establishment of latency (Thompson and Sawtell 1997).





9



Establishment

As proposed by Sawtell and Thompson, the LAT is hypothesized to act upon the

latent HSV-1 infection at the establishment stage of latency. It has been shown that some

LAT mutants exhibit a reduction in the ability to establish a latent infection. In latently

infected neurons, the number of viral genomes has been calculated to exist in the range of

10-100 (Cabrera et al., 1980; Efstathiou et al., 1986; Hill et al., 1996; Rock et al., 1983;

Sawtell et al., 1997), although it is important to point out that the number of latently

infected neurons that express LAT is less than 30% of the total neurons that contain latent

genomes (Ecob-Prince et al., 1995; Ecob-Prince et al., 1993; Gressens et al., 1994; Hill et

al., 1996; Maggioncalda et al., 1996; Mehta et al., 1995). A LAT negative mutant,

KOS/62 derived from the KOS strain of HSV-1, was reported to have a reduced

reactivation phenotype and was attributed to a minor impairment of this mutant to

establish a latent infection. The number of latently infected neurons with the KOS/62

mutant was measurably lower than mice infected with the parental KOS (Sawtell and

Thompson 1992). In the comparison of latent genome numbers in neurons between high

reactivating strains of HSV-1 and low reactivators, a low reactivating strain, KOS, was

present in lower amounts than the strains 17syn+ and McKrae (Sawtell et al., 1998). In

support of the establishment findings, other laboratories have reported slight decreases in

establishment with LAT-negative mutants in murine eye models (Devi-Rao et al., 1994).

Indirect support for the role of LAT in establishment comes from the finding that LAT

expression in mouse DRG occurs at the end of lytic replication in neurons (Sawtell and

Thompson 1992).





10

Although some LAT mutations do alter the establishment of latency, these effects

are very low in magnitude. Also, most LAT mutants do not demonstrate measurable

establishment phenotypes and are not evident in both the mouse and the rabbit (Bloom et

al., 1994; Bloom et al., 1996; Jarman et al., 2002; Pemg et al., 1996). Specifically, the

establishment differences that have been reported are seen to occur only in the mouse,

and at most reflect 2 4 fold less viral DNA in the ganglia (Thompson and Sawtell

2001). Current understanding cannot rule out the action of the LAT on the establishment

of latency. It is possible that LAT does act in establishment and the lower levels of

establishment that have been observed may be due to an effect of LAT on down

regulating viral mRNA production in neurons (Garber et al., 1997).

Reactivation

The involvement of the LAT in any of the stages of HSV-1 latency has been shown

most conclusively for the reactivation phenotype in the epinephrine-induced rabbit eye

model. Initially, a HSV-1 mutant (X10-13) containing a large deletion encompassing the

LAT promoter and downstream region of the gene displayed a low level of reactivation in

the rabbit eye model (Hill et al., 1990). The reactivation phenotype was restored by use

of an EcoRI J+K subgenomic clone encompassing the LAT locus (Hill et al., 1990). A

smaller, engineered deletion of the core promoter (17APst) of LAT displayed a severe

reduction in reactivation (Bloom et al., 1994) and another group supported this finding

with a similar but independently constructed mutant (Pemg et al., 1994). In addition to

deletions that included the LAT promoter, it was shown that only a limited region of the

LAT primary transcript is required for efficient induced reactivation. Bloom et al.

(Bloom et al., 1996) showed that insertions of polyadenylation signals between the cap







site and the 3' end of LAT resulting in termination 1,500 base pairs from the cap site had

no impact upon reactivation (Bloom et al., 1996) and accumulation of the 2.0 kb LAT

intron has also been shown to not be required for reactivation (Jarman et al., 2002). The

17A348 mutant which contains a mutation engineered into the 5' region of exon 1 did

exhibit severe decreases in reactivation (Bloom et al., 1996). Another mutant, 17ASty,

partially overlaps the 17A348 mutant and is also reactivation impaired (Hill et al., 1996).

These mutations in exon 1 do not affect the transcriptional activity of the LAT promoter

and do not reduce the expression of the LAT introns. From these findings in the

epinephrine-induced rabbit eye model, the reactivation critical region (RCR) of LAT has

been mapped to the 5'region of exon 1 of the LAT gene.

Mutations in 5'region of exon 1 result in a dramatic reduction in the frequency of

induced, and spontaneous virus shedding in the tear film of infected rabbits. LAT null

mutants have also been shown to reactivate at reduced frequency in TG of mice (Sawtell

and Thompson 1992; Thompson and Sawtell 1997). With regard to mechanism, one

hypothesis is that the LAT gene may function directly to promote viral reactivation. LAT

has been shown to be actively transcribed in neurons during the latent state, which would

suggest a role in maintenance or reactivation. Examination of the sequence of LAT exon

1 found a surprisingly large occurrence of CpG motifs that suggested that LAT gene

transcription could be controlled by methylation (Bloom et al., 1996). It was shown,

however, that expression of the LAT gene is not influenced by a methylation mechanism

(Kubat et al., 2004). It is possible that LAT+ cells may only represent a small fraction of

latent neurons and could play a repressive role on reactivation. Recent data from our lab

suggest that the LAT is actively down-regulated 0.5-4.0 hours post-explant co-cultivation





12

and this may be due in part to a change in the acetylation profile of the region

(O'Neil/Kubat, in preparation). One could speculate that active LAT expression is not

compatible with reactivation, and its downregulation may in turn stimulate, or allow the

downstream, opposite strand regulatory protein, ICPO to be transcribed and initiate a lytic

cascade. Clearly, the LAT region has important regulatory implications for the regulation

of lytic and latent infections, and these will be discussed in further detail in the following

sections.

Other Regulatory Regions of LAT

The promoter responsible for expression of the 8.3 kb primary LAT transcript has

been shown to possess multiple control elements including cyclic AMP response

elements (CRE), CAT box, Spl, USF, YY1 and AP-2 sites (Kenny et al., 1994; Soares et

al., 1996; Wechsler et al., 1988; Wechsler et al., 1989; Zwaagstra et al., 1991). This

latent promoter has enhanced promoter activity in cells of neuronal origin (Zwaagstra et

al., 1990). It has been suggested that the LAT gene may encode an alternative, or

cryptic, downstream promoter element separate from the latent promoter that may be

active during acute viral replication (Nicosia et al., 1994; Goins et al., 1994). This

alternative promoter has been indicated by transient transfection assays and roughly

localizes to a region 5' of the 2.0 LAT intron splice donor site. The presence of a

neuronal enhancer approximately 60 base pairs downstream of the transcription start site

has been identified (Soares et al., 1996). This promoter has been incorrectly labeled as a

second latent promoter. It is clear that the promoter is active during the lytic infection

and not during latency (Soares et al., 1996). This region may play a very important role

in the acute phase of HSV-1 infection and the characterization of this downstream region





13

of the LAT gene may help to explain early events in latency or the reactivation from a

latent infection.

Neuronal Survival and Apoptosis

The region responsible for the reactivation phenotype of LAT has been well

mapped but the LAT gene may contain other regulatory motifs that control establishment

or functions in the acute infection. LAT may also play a role in neuronal survival and

apoptosis (for review see Bloom 2004). Portions of the LAT gene have been shown to

inhibit neuronal cell death and may function through suppression of receptor-mediated

(caspase-8) and mitochondrial-mediated (caspase-9) pathways. Results from in vivo

studies demonstrate that a large deletion of the promoter extending into the LAT intron

are reduced in establishment levels and cause a significant loss of sensory neurons (Perng

et al., 2000; Thompson and Sawtell 1997). Transient transfection of IMR-90 and CV-1

cells with a plasmid containing the 3' region of the LAT exon and most of the intron was

able to protect the majority of cells from ceramide, or fumonisin Bi-induced apoptosis

(Perng et al., 2000; Thompson et al., 2000). Expression of the bovine herpesvirus 1 LAT

(Perng et al., 2002) or portions of the HSV-1 LAT gene inhibit chemically induced

apoptosis in cell culture (Perng et al., 2002).

The anti-apoptotic effects of large portions of the LAT expressed by transfection

are also cell specific. In culture, the LAT is unable to protect 293, or COS-7 cells from

apoptosis (Inman et al., 2001). It is clear that the LAT does induce apoptosis in certain

cell lines using transient transfection assays with high multiplicities of infection and high

expression levels (Perng et al., 2000). These results indicate that the LAT may play a

role in apoptosis but it has not been conclusively shown to occur in vivo. It was reported

that LAT(-) viruses induce extensive apoptosis in rabbit TG (Perng et al., 2000) and that





14

the LAT gene promotes neuronal survival by reducing apoptosis. The apopotosis results

have been questioned due to incompatible reagents used in the p85 PARP and TUNEL

assays used to suggest an in vivo apoptotic role for the LAT (Thompson and Sawtell

2000). Another large LAT deletion mutant (17-AH) when used in the infection of the

mouse eye model showed a depletion of over half the TG neurons. Apoptosis in HSV-1

infected ganglia during lytic infection has been demonstrated. The 17N/H mutant

overlaps the impairment engineered in the 17-AH mutant but extends further into the

intron. Use of this mutant resulted in the loss of neurons as measured by an increase in

TUNEL-positive TG neurons (Ahmed et al., 2002), though the total numbers of TUNEL-

positive cells were low.

The LAT has been proposed to promote neuronal survival and consequently leads

to high levels of establishment (Thompson and Sawtell 2001). If this is true, then LAT(-)

viruses would be expected to demonstrate a reduced level of replication in sensory

ganglia and would have altered virulence phenotypes in the mouse. A possible reason

that this has not been observed is due to the impairment of several regulatory regions in

the construction of most of the relatively large LAT deletion mutants reported in the

literature. The LAT has been shown to influence reactivation, establishment, apoptosis in

cell culture and may affect neuronal survival. The reactivation phenotypes associated

with the LAT have been well mapped but the positions of other regulatory regions in the

LAT region are still uncertain. Mutants that have been used to show anti-apoptotic

include very large deletions that also affect the region of LAT known to function in

reactivation. To identify and characterize the motifs of LAT involved in the lytic





15

infection, it is necessary to construct discrete mutations beyond the reactivation critical

region.

The 17A307, 17A307R, 17A480 and 17A489 mutants (Figure 1-1) were generated

in the lab of Dr. Ed Wagner (U. C. Irvine). Characterization of these viruses with respect

to latency was performed by Dr. Jim Hill (L.S.U. Eye Center) by use of the epinephrine-

induced rabbit eye model. The 17A307, 17A307R, 17A480 and 17A489 mutants were

tested for reactivation differences in comparion to 17syn+ (parental) and 17APst

(promoter mutant). From these experiments, it was determined that 17A307 was reduced

in its ability to reactivate in the rabbit model in comparison to its rescue, 17A307R, and

17syn+. Mutants 17A480 and 17A489 did not display a reactivation restriction. All

results are shown in Table 1-1. Establishment was also determined by quantitative PCR

in rabbit TG with no significant difference detected between 17A307 and 17A307R (see

Table 1-2).

Based on these data we hypothesized that a downstream portion of LAT outside of

the reactivation critical region influences the acute infection. We demonstrated here that

mutation of this region of LAT results in a decrease in virulence in the mouse model.

Additionally, we believe that the HSV-1 recombinants with the large LAT deletions used

by Sawtell and Thompson as well as Wechsler (Figure 1-2) mask dramatic virulence

effects due to the impairment of multiple regulatory elements of the LAT locus. To

examine the possibility that LAT influences acute infection and/or early times in the

latent infection, we generated an additional series of mutants in a region of LAT 3' of the

reactivation critical region. These mutants allowed us to test the involvement of the 3'

end ofexon 1 and the intron upon latent and acute phenotypes of HSV-1. From the





16

secondary promoter and apoptosis/neuronal protection findings described above, regions

of the LAT gene neighboring the reactivation critical region may act in the acute

infection ofHSV-1. This action may be through a trans-mediated effect from lytic

transcription, or it may be mediated in cis as an enhancer function. An enhancer scenario

is quite possible, since the reactivation function of the LAT gene is hypothesized to

operate in a similar manner (Wagner and Bloom 1997). The small, downstream deletions

of viruses 17A307, 17A307R, 17A480, 17A480R and a double mutant 17APstA480 allow

the determination of virulence properties of the LAT locus without also impairing other

defined regulatory functions of LAT that may mask a full virulence effect. The results

presented in the following chapters put forth a case for two distinct genetic elements

within the LAT gene: one (controlled by the LAP1 or latent promoter) that seems to act

as a facilitator of reactivation; and a second that may encompass the LAP2 promoter that

exerts its influence on virulence during the acute phase of the infection. The data

presented here demonstrating the dramatic reduction in virulence in the mouse following

deletion of a region spanning the 3' end of the 5'exon and the first several hundred bases

of the region encoding the LAT intron is the first description of a major virulence

phenotype mapping to the LAT gene. Our results also indicate that this phenotype is

independent of the LAT promoter (LAP1). Finally, as discussed in detail in the last

chapter, we hypothesize that the deletion of these two distinct genetic elements in vivo

results in a phenotype distinct from deletion of either element individually, suggesting

these elements work together in regulating some aspect of acute replication.





17









RL UL RL Rs Us Rs



--..-------------- 8.3 kb primary LAT transcript
---------------- -- ---_-------..--

exon 1 ------
intron

17A307
17APst
17A480

17A489

Figure 1-1. Schematic of the LAT gene and the position of 17APst, 17A307, 17A480 and
17A489 recombinant viruses. The location of the LAT primary transcript is
shown along with its location in the HSV-1 genome. The promoter, exoni
and the 5' intron of LAT are depicted at the bottom of the figure along with
recombinant LAT viruses.





18




RL UL RL Rs Us Rs






S8.3 kb primary transcript

exon 1
intron



dLAT2903 (Pemg 2000)




17A-H (Thompson 2001) Region of Mutation
Region of Mutation |



Figure 1-2. Large LAT deletions used for virulence indications. An impact of the LAT
locus upon virulence has been implied by use of a couple of LAT deletion viruses. These
deletion viruses delete a large portion of the LAT locus and possibly remove several
regulatory regions in the LAT gene.





19

Table 1-1. Analysis of the 5' LAT deletions on reactivation in the rabbit eye modela

Positive Positive Total positive
Recombinant rabbits /total eyes/total eyes swabs/total swabs
rabbits


17syn+ 5/5 (100%) 8/9 (89%) 24/72 (33%)


17APst 2/8 (25%) 2/16 (13%) 5/105 (5%)


17A307b 2/8(25%) 3/16 (19%) 6/112 (5.4%)


17A307R(Rescue) 4/4 (100%) 5/8 (63%) 14/64 (22%)


17A480 8/8 (100%) 12/16 (75%) 27/70 (39%)


17A489 4/5 (80%) 6/10 (60%) 29/70(41%)


aReactivation was measured by the level of infectious virus by plaque assay detected
from tear film of infected rabbits. In this model, the rabbit eye is infected with HSV-1
with the virus traveling to the TG and establishing a latent infection. Reactivation is
stimulated by the administration of epinephrine and current to the rabbit eye. Infectious
virus is then detectable at the initial site of infection, the eye.
bIontophoresis was performed once a day for three consecutive days. Eye swabs were
performed for 7 consecutive days.
c17A307 is significantly different from 17syn+.





20

Table 1-2. The ratio of HSV to actin DNA in rabbit trigeminal ganglia
latently infected with 17A307 and 17A307R mutants of HSV-la
Rabbit infected with Ratio HSV to Rabbit infected with Ratio HSV
17A307 Tattoo(side) Actin DNA 17A307R Tattoo(side) to Actin
DNA
G2(od) 0.57 G23(od) 0.51
G2(os) 0.25 G23(os) 0.34
G3(od) 0.83 G24(od) 0.37
G3(os) 0.42 G24(os) 0.64
G4(od) 0.5 G28(od) 0.19
G4(os) 0.31 G28(os) 0.522
G6(od) 0.5 G32(od) 0.46
G6(os) 0.41 G32(os) 0.59
G8(od) 0.5 G34(od) 0.38
G8(os) 0.42 G34(os) 0.63
G9(od) 0.52 G35(od) 0.29
G9(os) 0.58 G35(os) 0.44
G1O(od) 0.36
G1O(os) 0.48
Average ratio = 0.480.14 Average ratio = 0.450.14
aThe 17A307 LAT recombinant virus was tested by semiquantitative PCR from
differences in establishment in comparison to its rescue, 17A307R. Values were plotted
for the HSV-1 gene DNA polymerase as a ratio to cellular rabbit actin DNA. From
measurement of the ratios between 17A307 and 17A307R, no detectable differences in
establishment were observed.












CHAPTER 2
METHODS

Technical details of the experiments used to generate the data presented in this

work are discussed in this chapter. The experiments were aimed at the generation of viral

recombinants and use of these mutants for characterization pertaining to virulence and

latency of HSV-1 in cell culture and animal models. This characterization involved

assessing virulence in the mouse model along with supportive replication data obtained

from cell culture assays. The examination of reactivation from and establishment of

latency were carried out at the LSU Eye Center by Drs. Jim Hill and Jeannette Loutsch,

and these results are summarized in chapter 1 (Table 1-1 and 1-2). In the determination

of virulence, the methods of creating viral recombinants by transfection, growth of

mutants in culture and infection and viral quantification from the animal models are

presented here in full.

Viral recombinants were constructed by use of homologous recombination in cell

culture. Recombinants were produced by either co-transfection of HSV-1 virion DNA

with a PCR fragment for recombining into full length genomic DNA (i.e. 17A480R), or

by co-infection with two HSV-1 LAT mutants (i.e. 17APstA480). The full length viral

genomic DNA was prepared in cell culture. A group of 8-10 T-150 flasks were infected

with the HSV-1 parental, or mutant strain of choice, at a multiplicity of infection (MOI)

of 0.01. Infections were maintained and monitored for 3 days until the cells were

completely detached. At this point, the suspension was removed and pelleted in a high

speed centrifuge at 16,000 x g for 40 minutes at 4C. The supernatant was removed and

21





22

the pellet was resuspended in 10 mL ofhypotonic lysis buffer (10 mM Tris pH 8.0, 10

mM EDTA, 0.5% NP-40 and 0.25% deoxycholic acid). This subsequent suspension was

vortexed, incubated briefly on ice and centrifuged at 3000 x g for 10 minutes at 40C to

pellet the nuclei from the fraction containing the viral DNA. After centrifugation, the

supernatant was removed and treated with a protein degradation solution (1% sodium

dodecyl sulfate and 1 mg/mL Proteinase K) at 500C for 1 hour. An additional 1 mg of

Proteinase K was added and the incubation was repeated an addition hour at 37"C to

further digest the protein in the sample. After this treatment, the solution was extracted

with sequentially with equal volumes of phenol, phenol/chloroform and chloroform. To

precipitate the full length viral DNA, the solution was treated with a 0.1 volume of 3M

sodium acetate and carefully layered with 25 mL of cold 95% ethanol. The DNA was

precipitated at the aqueous/ethanol mixing interface with moderate rotation by hand.

Once an appropriate amount of genomic DNA was visible, it was removed by spooling,

washed briefly with 70% ethanol, dried, resuspended in 100-500 pl of sterile water. The

DNA was quantified spectrophotometrically and the genomic quality of the DNA was

assessed by electrophoresis on an agarose gel. Full length viral DNA was then ready for

use in transfections to produce recombinant HSV-1 mutants.

Transfections utilized varying ratios of genomic DNA with a fixed amount of

plasmid, or PCR generated DNA where applicable. For this procedure, 60 mm2 dishes of

rabbit skins cells at 50% confluency were serum starved (1.5% calf serum, MEM)

overnight at 31.5"C in 5% CO2. The viral genomic DNA was used in a range of of 1, 2,

4, 8, 16 and 32 jg in addition to a 2 |jg amount ofrecombining DNA per dish. Each

transfection mix was prepared in a final volume of 225 jil of TNE buffer (10 mM Tris pH





23

7.4, 1 mM EDTA and 0.1 M NaCI). Upon dilution of the DNA into TNE, 25 ptl of CaCl2

was added per mix. DNA was precipitated by the administration of 250 pl of 2X HEPES

along with CO2 for pH adjustment. This DNA solution was incubated at room

temperature for 30 minutes. The transfection mix was then added to the dishes and

incubated at 25"C for 20-30 minutes. Media in a 5 mL volume was applied to the dishes

and transferred to 37C for 4 hours. The media was then aspirated and the cells were

hypotonically shocked with 1-2 mL of shock buffer (1X HEPES, 20% dextrose) for 60

seconds. The cells were briefly washed and 5 mL of media was added to the dishes.

Once these transfections were performed, viral infection was allowed to persist to full

cytopathic effect, usually 2-3 days post-infection. After the monolayer was depleted and

detached due to viral infection, any remaining cells were scraped and the entire solution

was vortexed and stored at -80C. This viral stock was frozen (-80C) and rapidly

thawed (37C) twice before isolating individual plaques.

Viruses produced from the transfections were detected and isolated by plaque

purification. Confluent 60 mm2 dishes of RS cells were infected with a series of dilutions

ranging from 10-3 to 10"8 in order to obtain dishes with well-isolated plaques. After a 1

hour inoculation, the infected dishes were covered with an overlay consisting of 1X 5%

calf serum MEM and 0.8% agarose. This solid overlay allowed the maintenance of the

monolayer during the infection and functioned to limit spread of virus through the

monolayer, allowing for discrete plaque formation and subsequent plaque isolation.

Infections were maintained and monitored for 2-3 days. Once plaques were visible, the

dishes were stained for 3 hours with neutral red at a 1:30 dilution. The neutral red stain

was absorbed by living cells and consequently left the plaques white. This contrast





24

allowed for easy visibility of plaques for picking with a Pasteur pipette. The plaques

were picked and each individual plaque was transferred to its own well of a 96 well plate

containing 200 pl of media per well. This plate was then frozen and thawed twice (-

800C/370C) and a 50 p volume was used per well to infect a 96 well plate that was

previously seeded with RS cells. Infection of this plate was allowed to proceed for 2-3

days (until 100% CPE) and was then frozen at -80C.

The recombinant viruses were screened by dot blot hybridization after each round

of plaque purification to determine the proper mutation has been engineered. In this

approach each 96 well plate that was infected with individual isolates per well was

thawed at 370C prior to the transfer for hybridization. On the bottom piece of the dot blot

apparatus, 3 layers of Whatman paper were applied followed by a section of Hybond

nitrocellulose membrane. The Whatman paper and the membrane were saturated with

solution C [(2X SSPE (0.36M sodium chloride, 0.02M sodium monophosphate, 0.002M

ethylene diaminotetraacetate)]. The dot blot apparatus was then sealed tightly and a

vacuum was applied. At this point, 50 pl of inoculum from each well of the 96 well plate

was transferred through the holes in the top of the dot blot apparatus and onto the

membrane. Each well in the dot blot manifold was subsequently washed with 200 pl of

fresh solution A (1.5M sodium chloride, 0.1N sodium hydroxide) followed by an equal

application of solution B (0.2M Tris, pH 7.5) and solution C. The nitrocellulose

membrane was then removed and baked in a vacuum oven for 1-2 hours at 80C. The

DNA was then covalently attached to the membrane and ready for labeling with

radioactive 32P [a-dCTP] probe.





25

Probes were created using the portion of DNA that identified the presence of the

proper mutation in the recombinant virus. To make the probe, 25 ng of DNA was diluted

to a total of 45 1l in TE (10mM Tris ImM EDTA, pH 8.0) and boiled in a water bath for

5 minutes. The DNA was then quickly transferred to ice and incubated for 5 minutes.

After this period, the DNA solution was added to a reaction tube from the RediprimeTM II

Random Prime Labelling System (Amersham Biosciences). A 50 LCi amount of32P [a-

dCTP] was also added and the reaction was performed at 37C for 10 minutes. The

reaction was quenched with the introduction of 5 ul of 0.2M EDTA. This probe was then

boiled for 5 minutes, placed on ice for 5 minutes and ready for use. Prior to the addition

of the probe to the hybridization, the blot itself was pre-hybridized at 63 C for 1 hour in a

shaking water bath to reduce nonspecific DNA labeling. After the pre-hybridization step,

the probe was added and the blot hybridized overnight at 630C. The next day, the blot

was washed twice with solution 1 (0.3M sodium chloride, 0.06M Tris-HCl pH 8.0,

0.002M EDTA) at 250C for 5 minutes, twice with solution 2 (0.3M sodium chloride,

0.06M Tris-HCl pH 8.0, 0.002M EDTA, 4% SDS) at 630C for 15 minutes and finally

twice with solution 3 (0.03M sodium chloride, 0.006M Tris-HCI pH 8.0, 0.0002M

EDTA) at 250C for 15 minutes. The blot was then dried briefly and covered with plastic

wrap before being exposed 8-12 hours on a Phosphor screen. Hybridization was then

visualized using a STORM phosphoimager (Molecular Dynamics, Sunnyvale, CA) in

order to identify the presence of the proper recombinant virus. This concludes the

general aspects of transfection and hybridization approaches used. The specific details of

the 17A480R and the 17APstA480 construction are described next.





26

LAT Recombinant Viruses

The HSV-1 recombinants 17APst, 17A307, 17A307a, 17A307R, 17A480, 17A480R

and 17APstA480 were all engineered by homologous recombination. Plasmids

containing the mutated regions were transfected into rabbit skin cells along with full

length 17syn+ HSV-1 genomic DNA. 17A307, 17A307a, 17A307R, 17A480 and 17A489

were constructed in the laboratory of Dr. Ed Wagner at U.C. Irvine. These recombinants

replaced portions of the LAT gene with stuffer DNA sequence and consequently retained

the size and spacing of the LAT gene. 17A480 and 17A489 contain inserted DNA from

the lacZ gene into the either the PpmuI-SfiI site for 17A480, or the SfiI-HpaI location for

17A489. The mutants 17A307 and 17A307a also contain stuffer sequences. 17A307 has

a polyadenylation sequence from SV-40, whereas the native DNA for 17A307a has been

replaced with a polyadenylation sequence from rabbit P-globin. The mutant 17APst is a

202 base pair clean deletion of DNA between the Pst I sites in the core latency promoter

of the LAT gene. This mutant was created in the Stevens lab at UCLA and has been

described previously (Bloom et al., 1994).

17A480R

For in vivo and cell culture experiments, it was critical to make two additional LAT

mutants. First, the fact that the phenotypes for the 17A480 were the result of the 480 bp

deletion was confirmed by the construction of a rescue of this virus (17A480R). This

rescue was generated by homologous recombination using a 1.2 kb DNA PCR product.

The PCR reaction was performed with oligonucleotides 17AB1R

(5'GAGATGAACACTCGGGGTTAC 3') and 17AB2R

(5'CGGACTBACCTGGCCTCTGG 3'). These primers begin at positions 119,181 and





27

120,347, respectively, in the 17syn+ genome and are shown schematically (Figure 2-1).

The amplified DNA was co-transfected with full length 17A480 DNA into RS cells. At

3-4 days post transfection, the cells were lysed by 2 rapid freeze/thaw (-800C/370C)

cycles and plated onto confluent 60 mm2 dishes of RS cells at varying dilutions of 10.3 to

10-8. These dishes were overlayed with a solution containing 0.8% SeaKem Agarose and

1X 5% calf serum MEM for 3 days. At this time, cells were stained with neutral red and

plaques were observed by absence of stain. Approximately 300 well-isolated plaques

were picked and tested by dot blot hybridization for the presence of the restored wild-

type sequence at the PpmuI-SfiI location (Figure 2-2). The HSV-1 viruses 17syn+ and

17A480 were included on the blots to serve as positive and negative controls,

respectively. Several positive plaques were detected after the first round of plaque

purification. Five of these positive samples were diluted and infected onto confluent 60

mm2 dishes ofRS cells. After the third round of purification, all plaques were positive.

To guarantee the purity of the 17A480R plaques, a couple of plaques were carried out for

a fourth round of purification which again yielded complete positives.

17APstA480

Another recombinant virus, 17APstA480, was engineered to complete the analysis

of the genetic basis of the virulence phenotype within the LAT locus in the mouse model.

As the name implies, this mutant contains mutations in both the latent promoter of the

LAT (APst) coupled with a mutation in the 5' portion of the LAT intron (A480). This

mutant was constructed by performing a co-infection of 17APst with 17A480 at an m.o.i.

of 3.0 for each virus in a T-75 flask of confluent rabbit skin cells. Plaque purified

isolates were tested by dot blot hybridization. In each round of plaque purification, each





28

96 well plate was blotted onto membrane in duplicate. One blot was tested with a probe

for the lacZ DNA present in the 480 region of the 17A480 mutation, and the other blot

was tested for the presence of the LAT promoter region (202 bp PstI fragment) from

wild-type HSV-1 strain 17syn+. If both mutations were correct in the 17APstA480 virus,

then plaque isolates would be positive when hybridized with the lacZ probe and negative

with the Pst region probe (Figure 2-3). Critical controls included in this analysis were the

inclusion of 17A480 and 17APst. In use of the lacZ probe, the 17A480 control produced a

positive signal and the 17APst remained negative. For the use of the Pst probe, the same

was also true, since the 17A480 mutant retained wild-type sequence at the latent promoter

and the 17APst mutant had the 202 bp PstI region removed.

In performing dual probing of 17APstA480 possible plaque isolates, a few viruses

were determined positive for the lacZ fragment and negative for the PstI fragment in

comparison to controls. After the first round of screening, a few properly hybridizing

isolates were selected and subjected to another round of plaque-purification. From the

second round of selection, approximately 30% of isolates produced desired hybridization

signals. Two of these samples were selected and put through another round of

purification. At this third round, 100% of samples were lacZ fragment-positive and PstI

fragment negative. To be certain of purity, two samples were taken into a fourth round of

purification and resulted again in 100% of isolates positive for lacZ and negative for the

PstI fragment. To prove that the PstI fragment-negative control contained adequate viral

DNA to be detected, it was included as a control in the final round of the 17A480R

plaque purification. This sample produced signal intensity equal to the other positive

control, 17syn+.





29

Analyses In Vivo and Cell Culture

The LAT mutants 17APst, 17A307, 17A307a, 17A307R, 17A480, 17A480R and

17APstA480 were tested for virulence phenotypes in the mouse model. After determining

the phenotypes of these mutants in vivo, they were also characterized using a cell culture

system. The cell culture experiments involved two different cell lines, PC-12 cells and

RS cells. These cell types and their experimental usage is described later in this chapter.

Virulence Determination in Mouse Model

The virulence determination of the engineered LAT mutants was performed by

LD5o/pfu analysis. For these experiments, female 4-6 week old out-bred Swiss Webster

mice were used. Virulence was measured by footpad infection and by direct intracranial

inoculation. For the footpad infection, each footpad of anesthetized mice was injected 4

hours pre-infection with 50 pl 10% (w/v) sodium chloride. At the appropriate time, mice

were then sedated with 0.010-0.020 mL of a cocktail containing xylazine (7.5-11.5

mg/kg), acetamine (2.5-3.75 mg/kg) and ketamine (30-45 mg/kg). The keratinized layer

of the footpad was then removed with mild abrasion using an emery board, and viral

dilutions (in MEM with 5% CS) were applied onto the ventral footpad surface in volumes

of 50 pl. The mice were then placed back into their cages in an inverted manner to allow

virus absorption and monitored until they regained consciousness and became active.

Infected mice were then observed twice daily until hind limb paralysis ensued in which

case they were euthanized, or until they died from encephalitic HSV-1 infection. After

two weeks, mice were scored for lethality and LDso/pfu values were assessed by the Reed

and Muench method (Reed and Muench 1938). Surviving mice were assessed for the

presence of latent virus by PCR.





30

Mice were also tested for virulence phenotypes by direct intracranial infection with

the appointed LAT mutants. These mice were sedated in the same manner as the footpad

experiments. Infection was performed by direct administration of virus into the left

cerebral hemisphere in volumes of 20 L of inoculum by use of a 1.0 mL syringe and a 27

gauge needle. These mice were also observed until conscious and active and were

checked twice daily for signs of nervous system impairment, or encephalitic death.

Tissue Restriction

The relative ability of the LAT recombinants to replicate in the feet, DRG, spinal

cord and brain was assessed following footpad inoculation. This analysis was performed

as a time course and for each time point, tissue and virus, samples were examined in

replicates of 3. The time points tested included 2, 3, 5 and 7 days post footpad

inoculation. At each of these times, all 4 of the designated tissues were removed and

homogenized in MEM containing 5% calf serum. The homogenates were diluted and

titered on confluent 24 well plates of RS cells in the presence of technical grade human

IgG to prevent viral spread through the monolayer. Plaques were counted at 2-3 days

post-infection and viral levels were calculated for each virus and tissue for the 4 time

points.

Time Course Experiments

Mutants 17APst, 17A307, 17A307a, 17A307R, 17A480 and 17A480R were tested

for infectious virus production in cell culture along with parental virus 17syn+.

Infectious virus levels were assessed in RS and PC-12 cells (rat pheochromocytoma cells)

in both multi-step and single step growth curves. The PC-12 cells are developmentally

linked to neurons and represent a specific cell type of the nervous system (Pizer et al.,





31

1978; Rubenstein et al., 1983). For the multistep growth curves, cells were infected at a

multiplicity of infection of 0.001 and infections were terminated and quantified by plaque

titration at hours 8, 24, 48, 72 and 96 hours post-infection. Each time point virus-' was

performed in triplicate. The single step growth curves were carried out in a similar

manner but with a higher multiplicity of infection (3.0). The time points were also

different and included 0, 3, 6, 12 and 18 hours post-infection. For this experiment,

samples were also tested in triplicate with titrations being performed on RS cells in the

presence of human IgG. Resulting plaques were counted and infectious virus levels were

thus quantitated.

The experimental techniques described in this chapter were used to test the HSV-1

LAT mutants 17APst, 17A307, 17A307a, 17A307R, 17A480, 17A480R, RHA-6 and

17APstA480 along with parental control, 17syn+ in the mouse model. These experiments

were aimed at the determination of the role of the 3' portion of LAT exon 1, and to

determine if a phenotype can be attributed to the 5' intron. The next chapter is dedicated

to the report of virulence, tissue restriction and cell specific infectious virus reduction

phenotypes obtained for these mutants.





32


RL UL RL Rs Us Rs

................ ....
Intron(s)

Latency associated
transcripts







119181 119502 119981 120347

PstI PstI 17A480 (Ppmu SftI)
....................... I ........................ I '

I I 480 bp
Sty I Sty I 321 bp 366 bp'


splice donor
119,463


Figure 2-1. 17A480R construction. The 17A480R recombinant virus was made by
co-transfection of a PCR amplified portion of the parental virus, 17syn+,
between genomic base pairs 119,181 and 120,347 and genomic 17A480
DNA. The 17A480R recombinant was screened by dot blot
hybridization.





33




















17syn+ 17A480

Figure 2-2. Dot blot hybridization of second round plaque purification of 17A480R. This
figure demonstrates that by the second round of plaque purification, most of
the viruses are positive for the region of the LAT gene corresponding to the
region that was altered in the 17A480 recombinant.






34

A.



















17A480 17APst
B.





















17A480 17APst

Figure 2-3. Dot blot hybridization of second round plaque purification of 17APstA480.
A) The blot at the top of the page was probed with a lacZ probe. B) The
bottom blot was probed with a Pst probe in order to identify 17APstA480
recombinants.












CHAPTER 3
RESULTS

In our pursuit to further understand the function of the LAT locus in HSV

biology, we made recombinant virus 17A307 deleted of a 307 bp fragment in the 3'

region ofexon 1 (Figure 1-1). The native region of HSV-1 LAT exon 1 was removed by

homologous recombination and replaced with DNA stuffer from a SV40 polyadenylation

sequence. This recombinant virus contained alterations 3' of a region that mapped to the

general region that we had evidence was involved in reactivation. To test the impact of

this portion of the LAT on reactivation from latency, we utilized the epinephrine-induced

reactivation rabbit eye model. Results showed that the 17A307 recombinant virus

exhibits a reduced reactivation phenotype (Table 1-1).

Additionally, it was observed that the 17A307 displayed reduced cornea scarring in

comparison to 17syn+ (parental virus) and 17APst (promoter mutant) at early times post

infection (Figure 3-1). This indicated that the 17A307 recombinant was altered in

pathogenesis due to the 307 bp deletion, or due to secondary mutations outside of the

LAT region. To test this second possibility, a second 17A307 virus was engineered

(17A307a). This recombinant is the same as the original 17A307, except that it contained

a stuffer sequence from the rabbit j globin gene (rabbit B-globin poly A region). Along

with the 17A307a recombinant, a corresponding rescue was made, 17A307aR. These

viruses were once again tested in the epinephrine-induced rabbit eye model for

reactivation effects and demonstrated reduced reactivation (Table 1-1). These results



35





36

indicated that the 17A307 virus was not only restricted in reactivation, but unlike the

LAT promoter mutant 17APst, had alterations in corneal pathology suggesting that it

might possess attenuated virulence or pathogenesis properties.

The mouse footpad model was used to test the virulence profile of the 17A307

recombinants. The rabbit model is a superior model for reactivation due to its close

parallel to the natural infection as described in chapter 1. For virulence studies, however,

the mouse footpad model is more useful due to the ability to infect larger sample sizes,

while also conserving many characteristics of natural HSV infection. The footpad

infection allows initial infection of the epidermis of the foot. Virus then enters the

peripheral nervous system via nerve termini present in the epidermis. Once in the

nervous system, virions progress to the body of the neurons in the dorsal root ganglia

(drg). From the DRG, HSV can then enter the central nervous system and progress

through the spinal cord to the brain. Infection in the CNS can lead to death resulting

from encephalitis.

LDso/pfu Evaluation

Initially, the 17A307 recombinant viruses were tested for virulence by LDso

(calculation of viral dose in plaque forming units required to kill 50% of animals in a

group) in comparison to 17syn+ (parental), 17APst and 17A307aR. Results in the mouse

showed that the 17A307 viruses did display a dramatic virulence phenotype. It is

important to note that the 17A307 mutation principally alters the 3' end of exon 1 but it

also changes the first 6 base pairs of the splice donor site. Additionally, the stuffer DNA

is a polyadenylation signal in the case of each 17A307 recombinant and the virulence

results could have been due to a RNA mediated effect. To answer these questions, I set





37

out to create additional 17A307 recombinants that do not mutate the splice donor site, or

any portion of the intron. I also planned to insert the polyadenylation sequences in each

orientation to test for a RNA directional effect. Prior to engineering and testing these

new 17A307 recombinants, we wanted to repeat the LDso experiments with the inclusion

of additional controls.

The LAT recombinants 17A307, 17A307a, 17A307aR, 17A480 and 17A489

(Figure 1-1) were analyzed for virulence phenotypes by use of the mouse footpad model

(Table 3-1). These viruses were used to infect the rear footpad of out-bred Swiss

Webster mice along with control viruses, 17syn+ (parental), 17APst (promoter mutant)

and RHA-6, which contains a polyadenylation signal at a HpaI site in the middle of the

intron. The footpad of out-bred Swiss Webster mice was infected with mutants 17A307,

17A307a, 17A307aR, 17A480, 17A489 and RHA-6 in varying dilutions (see Methods)

with 10 mice virus -1 dilution"'. In comparison to 17syn+ (parental), 17APst (promoter

mutant) and each rescuant virus included in the experiment, mutants 17A307, 17A307a

and 17A480 expressed dramatically increased LDso/pfu levels by mouse footpad

infection. Each of these displayed a greater than 500 fold increase in LDso/pfu levels

(Table 3-1). The virulence phenotype for the 17A480 recombinant made the creation of

the new 17A307 recombinants described above unnecessary. The 17A480 mutation

resides entirely in the intron and retains the splice donor site. This virus also contains a

lacZ DNA stuffer and its effect argues against the orientation of the polyadenylation

sequence having an impact in the 17A307 recombinants. It is important to recognize that

the 17A489 mutant had an equal virulence profile to 17syn+ and 17APst, which identifies

the 3' boundary of the virulence region due to the lack of virulence phenotype for





38

17A489. Results from the footpad infections indicate that 17A307, 17A307a and 17A480

are impaired in either neuroinvasion, or neurovirulence.

To determine if 17A307 and 17A307a were deficient in neurovirulence, the LAT

mutants were used to infect the mouse by intracranial inoculation along with 17syn+ and

17APst. These results showed that the 17A307 and 17A307a viruses were also restricted

in virulence measured by LDso/pfu upon direct inoculation into the mouse brain (Table 3-

1). Taken together, the footpad and intracranial LDso/pfu values show that mutants

17A307, 17A307a and 17A480 are greatly impaired in virulence in the mouse and that the

results are due to a neurovirulence phenotype and not likely due to a defect in

neuroinvasion or an inability to enter the central nervous system.

Tissue Restriction

To identify whether the 17A307, 17A307a and 17A480 mutants display a general

reduction in replication in the mouse causative of a virulence phenotype, several tissues

along the infection pathway from the foot were tested for production of infectious virus.

Tissues included the foot, DRG, spinal cord and brain with the inclusion of 17syn+,

17APst, 17A307a, 17A307aR, 17A480 viruses as controls. Infectious virus was assayed

for these tissues at 2, 3, 5 and 7 days post infection at an initial dose of 104 pfu virus"-

time-'. Each virus, time point and tissue was examined in triplicate.

Since the footpad is the initial site of infection in our model, it was critical to

determine if these mutants were impaired in virion production in this tissue. Upon

analyzing this tissue for plaque production, a significant difference in viral production

was not seen in the feet at any times tested (Figure 3-2). From previous data in our lab,

we know at the doses employed that 2 days post-infection is the peak of infectious virus





39

production in the feet (Jarman et al., 1999). The lack of a difference between 17A307

and 17A480 in comparison to 17syn+ (parental), 17APst and 17A307R demonstrates that

the mutants do not display a general replication defect in mouse tissue.

Infection in the footpad allows for the virus to enter the nervous system via nerve

termini in the epidermis. From the feet, virus progresses into the nervous system and

virus can be detected in the DRG. In examining the DRG, the 17A307 mutant does

display a reduction in infectious virus levels evident at 3 and 5 days post-infection (d.p.i.)

(Figure 3-3). Interestingly, 17A480 does not demonstrate a restriction at 3 d.p.i. and only

shows a possible reduction at 5 d.p.i. Both of these mutants, however, are restricted in

infectious virus production in the next tissue in the path of infection, the spinal cord.

Results from spinal cord show that both 17A307 and 17A480 have lower viral values in

comparison to 17syn+ (parental), 17APst, 17A307aR and 17A480R (Figure 3-4). Further

analysis reveals that 17A307 and 17A480 are also lower in abundance in brain tissue

(Figure 3-5). Values shown for these mutants only involve one positive sample for each

of the LAT virulence recombinant viruses, therefore, the brain restriction may be even

greater than depicted in the graph shown. Collectively, the tissue experiments display a

restriction in infectious virus production for 17A307 and 17A480 that is specific for

nervous tissue. These tissue restriction results show that the virulence deficient measured

by LD50 is due to a reduction of 17A307 and 17A480 for infectious virus production in

the nervous system.

Cell Specific Replication Deficiency

The tissue restriction results clearly demonstrate an impairment of infectious virus

production that is specific for nervous tissue. To identify a possible cell specific





40

phenotype for 17A307 and 17A480, replication of these viruses was tested by time course

in PC-12 cells and in rabbit skin cells. These LAT mutants were tested along with

17syn+, 17APst, 17A307R and 17A480R. The first experiment involved a multi-step time

course performed in PC-12 cells. The multi-step growth curves were performed with a

viral multiplicity of infection (m.o.i.) of 0.001 for each virus. A low dose of virus

administered, in addition to monitoring time points over several days, allows the

identification of subtle replication differences.

In the first experiments with 17A307 and 17A480, as early as 24 hours post-

infection, a 8-10 fold reduction in infectious virus was seen for both 17A307 and 17A480

in PC-12 cells (Figure 3-6). This decrease was also seen at 48, 72 and 96 hours post

infection. The experiment was repeated with 17A307 and 17A480 being tested in the

same experiment along with a few additional controls. As with the previous experiments,

17syn+ and 17A307R were included as controls but I additionally tested 17APst

(promoter mutant) along with 17A480R in the multi-step growth curve (Figure 3-7). The

17APst recombinant virus was shown to lack a virulence phenotype in the mouse but it

was important to compare a LAT recombinant with an alteration in a region of LAT that

is expected not to contain a cell specific replication function. In these experiments, an 8-

10 fold reduction was again observed for 17A307 and 17A480 (Figure 3-7). The 17syn+,

17APst and 17A480R viruses were not restricted in the production of infectious virus on

PC-12 cells. Multi-step growth curves were also performed in rabbit skin cells (Figure 3-

8) to test for a general growth restriction in cell culture. These results did not yield a

noticeable difference in virus production as compared with controls (Figure 3-8).





41

A single step growth curve was also conducted in PC-12 cells utilizing a higher

m.o.i (3.0) and shorter time points: 0, 3, 6, 12, 18 hours post-infection (Figure 3-9). This

experiment tested for dramatic replication differences due to the higher dose of virus and

the shorter time points. From these results, a difference between LAT mutants and

controls is not clearly evident. Together, these data show that a cell specific replication

effect is seen for the 17A307 and 17A480 LAT mutants at low multiplicities of infection.

The phenotype is only observed in PC-12 cells and is lacking in rabbit skin cells. From

these data, I hypothesize that the neuronal restriction of 17A307 and 17A480 in nervous

tissue is the result of growth restriction in neurons.

Additional LAT Recombinant Viruses

In addition to the LAT recombinants engineered by our collaborator, Dr. Wagner

(17A307, 17A307a, 17A307aR, 17A480 and 17A489), it was necessary to construct two

additional mutants. One necessary recombinant virus was 17A480R, which enables

validation of the findings for 17A480. Another mutant, 17APstA480, was also

constructed and is beneficial in understanding the different regulatory regions of the LAT

locus as described below.

17A480R

To verify the results observed for the 17A480 mutant in vivo and in cell culture,

the mutation was restored in a 17A480R recombinant virus. Restoration of biological

function was observed by multi-step time course on PC-12 cells (Figure 3-7). This

mutant is also being characterized for virulence properties in the mouse footpad model.





42

17APstA480

Another recombinant, 17APstA480, was also engineered to compare the findings

for the 17A480 with a recombinant that included a deletion in a different region of the

LAT locus. As shown by LD5o and tissue restriction experiments, 17A480 is greatly

reduced in virulence, while a deletion of the core latent promoter (17APst) is

indistinguishable from parental virus (17syn+). This led us to believe that the LAT locus

contains different regulatory regions and the impairment of more than one of these

regions may mask a severe phenotype. The 17APstA480 virus was a critical recombinant

for testing this hypothesis. Our expectation is to see an intermediate virulence phenotype

residing between what we observed for 17A480 and 17APst. In this virus, as the name

implies, the 480 mutation was coupled with a clean deletion in the latent core promoter.

The resulting mutant has impairments in two potentially different regulatory regions of

LAT. This will enable us to compare its phenotypes with other mutants in the literature

that contain very large deletions in the LAT locus (Perng et al., 2000; Thompson and

Sawtell 2001). These experiments are currently in progress.






43


3


25






9 -V----- -17''
o ---6-4-07A



0




PI3 PI5 P17 P110 PI12 P114 PI17 P119 PI 21 P124 PI27
days post-infection


Mean Values ( Standard Error of the Mean) (data points as plotted above):


meansem 17syn+ 17APst 17A307
PI 3 1.310.079 1.310.082 1.060.038
PI 5 1.920.078 1.860.089 1.530.049
PI 7 2.630.168 2.50.171 1.670.09
PI 10 1.180.193 0.980.184 0.810.156
PI 12 1.060.193 0.710.146 0.780.16
P 14 0.880.171 0.60.144 0.770.186
PI 17 0.0.840.178 0.390.084 0.610.206
PI 19 0.70.155 0.490.072 0.540.217
PI 21 0.660.153 0.470.028 0.660.199
PI 24 0.60.128 0.390.043 0.630.202
PI 27 0.550.124 0.410.093 0.540.216


Figure 3-1. Reduced corneal pathology of 17A307 in the rabbit eye model. The graph at
the top of the figure is a measurement of the severity of pathology of HSV-1
infection in the rabbit cornea. This was measured by slit lamp which
measures the number of dendrites and the severity of their pathology in the
cornea. These values closely compare with infectious virus levels. Values
below the graph are the raw data that are plotted above. The graph indicates
that 17A307 may have a virulence deficient phenotype.





44

Table 3-1. LD5o values*a
LD50/pfu Values for LAT Mutants

"_I "Route of Infection
Virus Footpad Intracranial
17syn+ 3.25 x 102 6.30 x 10'
17APst 5.11 x 102 9.30 x 10'
17A307 >7.0 x 104 >1.17 x 103
17A307a >7.0 x 104 9.63 x 102
17A307aR 3.17 x 102 9.10 x 10'
17A480 >4.0 x 104
17A489 1.10x 102
RHA-6 3.67 x 102
*This is a modified LD5o analysis. Mice were euthanized once they demonstrated an
infection of the central nervous system and a consequent impairment of motor function.
aThe values were recorded as a dose sufficient to induce lethality for half the mice in a
group. Two routes of infection were used in this experiment: footpad and intracranial.






45


1.00E+08


1.OOE+07


1.00E+06


1.00E+05


1.00E+04


1.00E+03


1.00E+02


1.00E+01


1.00E+0 00
17syn+ 17dPst 17d307 17d307R 17d480
Viruses


Figure 3-2. Infectious virus recovered from mouse feet at 2 days post-infection. Feet
were homogenized and tested for infectious virus by plaque assay on RS cells.
Values are recorded as pfu/g tissue.






46


A
A1.OOE+07


1.00E+06


1.00E+05


1.00E+04

B.
1.00E+03


1.00E+02


1.00E+01


1.00E+00
17syn+ 17dPst 17d307 17d307R 17d480
Viruses


B.
1.00E+07


1.OOE+06


1.00E+05


1.00E+04


1.00E+03


1.00E+02


1.00E+01


1.00E+00
17syn+ 17dPst 17d307 17d307R 17d480
Viruses

Figure 3-3. Virus production in dorsal root ganglia at 3 and 5 days post-infection. DRG
were homogenized and tested for infectious virus by plaque assay on RS cells.
Values are recorded as pfu/g tissue. A) The graph at the top is for 3 days post-
infection. B) The bottom is for DRG at 5 d.p.i. The difference between
17A307 and 17A307R is statistically significant P=0.0018 (unpaired t test,
Welsch corrected)






47


A.
1.OOE+08


1.OOE+07









0.
1.OOE+06



1.00E+02
1.00E+03 -


1.00E+02


1.00E+01


1.00E+00
17syn+ 17dPst 17d307 17d307R 17d480
Viruses






B.
1.00E+08

1.00E+07
1.OOE+07 -

1.00E+06

1.00E+05

M 1.00E+04
4-
0.
1.00E+03

1.00E+02

1.00E+01

1.00E+00
17syn+ 17dPst 17d307 17d307R 17d480
Viruses


Figure 3-4. Virus production in spinal cord at 5 and 7 days post-infection. A) Spinal
cord infectious virus levels at 5 dpi (P=0.002). B) Spinal cord at 7 dpi
(P=0.0030).






48


1.00E+08

1.00E+07

1.00E+06

1.00E+05 -

3 1.00E+04

1.00E+03

1.00E+02

1.00E+01

1.OOE+00
17syn+ 17dPst 17d307 17d307R 17d480
Viruses


Figure 3-5. Virus production in brain at 7 days post-infection. Mouse brains were
homogenized and tittered for infectious virus by plaque assay on RS cells.
Values are plotted as pfu/g tissue. The difference between 17A307 and
17A307R is statistically significant (P=0.009) and the difference between
17A480 and 17syn+ is also statistically significant (P-0.0022) as measured by
unpaired t test (Welsch corrected).






49



A. OE+08


1.00E+07


1.00E+06


1.00E+05


E
E 1.00E+04 -______ 017d307
m17d307R

1.00E+03


1.00E+02


1.00E+01


1.00E+00
8 24 48 72 96
Hour Pot-Infection



B. 1.00m0


1.00E408


I.00E+07


1.00E+06


5r 1.00E-05
E 17d480
I17syn+
1.OOE+04


1.00E+03


1.00E+02


1.00E+01


1.00E00
8 24 48 72 96
Houm Post-Infection

Figure 3-6. 17A307 and 17A480 multi-step time courses in PC-12 cells. A) 17A307 is
statistically different than 17A307R (P=0.0019). B) 17A480 is statistically
different than 17syn+ (P0.0232).






50


1.00E+07


1.00E+06


1.00E+05


1.00E+04. 17syn+
I E04 7dPs
017dP30
E 017007
eA17d307R
m1Td4O0R


1.00E+02


1.00E+01


1.00E+00









(parental) and 17APst (promoter deletion). 17A307 was statistically different
from 17A307R (P=0.02 at 24 hpi, P0.0069 at 48 hpi, P=0.0010 at 72 hpi) and
17A480 differed significantly from 17A480R (P=0.0364 at 24 hpi, Pm.0149
at 48 hpi, P=0.002 at 72 hpi).







51


1.00E+09----------------------- _________
1.00E+08


I.OoE+08


1.00E+07


1.00E+06


1.00E+05
S17d307

S1.OE+04 17d307aR













Hours Post4nfection



Figure 3-8. Multi-step time course in rabbit skin cells. This is a comparison of infectious
virus production of 17A307, 17A307a and 17A307aR on RS cells. All 3
viruses produce high levels of infectious virus on RS cells.
1.OOE+03


1 .OE+02


1.00E+O01



8 24 48 72 96
Hours Post-ctlon



Figure 3-8. Multi-step time course in rabbit skin cells. This is a comparison of infectious
virus production of 17A307, 17A307a and 17A307aR on RS cells. All 3
viruses produce high levels of infectious virus on RS cells.






52



1.00E+09


1.00E+08


1.00E+07





1.00E+05
E 7I17syn+
E 0170307
1.00E+04 7d307R


1.00E+03


1.00E+02


1.00E+01


1.00E+00
0 3 6 12 18
Hours Pout-lnfMd l



Figure 3-9. Single step time course in PC-12 cells. 17A307 was compared to 17A307R
along with 17syn+ in a single step growth curve utilizing an initial MOI of
3.0.












CHAPTER 4
DISCUSSION

The influence of the LAT gene upon dictating the outcome of the latent phase of

the HSV-1 infection is clear. Uncertainty, however, begins with understanding: 1)

whether LAT acts primarily at the level of establishing a latent infection and helping to

either suppress viral replication and prevent cell death, or 2) whether it exerts its primary

influence as a mediator of reactivation from latency. Another difficulty in dissecting the

LAT gene's role has been linking the biologically diverse functions attributed to the LAT

region with the LAT RNA itself, and whether different regions of the gene may actually

have different functions. LAT promoter mutants have been seen to have different

phenotypes than larger deletions that include the promoter and downstream transcript-

encoding sequence. The goal of this study was to utilize recombinant virology to attempt

to define the genetic basis for LAT phenotypes that might go beyond just controlling

reactivation.

Viruses with alterations in the LAT region exhibit severe impairment of

reactivation in both the induced and the spontaneous rabbit eye models, and in mouse

models involving infection of either the footpad or the cornea. Specifically, mutations in

the promoter and/or the 5' region of exon 1 have most discriminately resulted in severe

reactivation deficiencies in rabbit models (Bloom et al., 1994; Bloom et al., 1996; Perng

et al., 1994; Perng et al., 1996; Trousdale et al., 1991). It has been debated whether these

effects are due to decreased reactivation, or are the result of decreased establishment of

LAT mutants. With respect to early events in HSV-1 latency, the LAT gene has been


53





54

proposed to enhance the efficiency of establishment (Pemg et al., 2000; Thompson and

Sawtell 1997). These studies were performed with relatively large LAT deletions, so

while one cannot rule out that a portion of the LAT gene may act upon establishment

these data are not consistent with the observation that LAT promoter mutants do not

show impaired establishment, and instead seem to act primarily at the level of

reactivation. In addition to LAT promoter mutants, concise, small mutations (200-400

bp) in the LAT promoter and/or the 5' region of exon 1 result in a dramatic reduction

(70-100%) in reactivating virus in the absence of any detectable differences in

establishment (Bloom et al., 1994; Bloom et al., 1996).

It has been argued by Sawtell and Thompson that the LAT mediates its effects on

the establishment phase of the latent infection (Sawtell and Thompson 1992; Thompson

and Sawtell 1997). To test for an establishment decrease, they tested 17syn+ (parental)

along with 17-AH, which is a deletion of the LAT promoter, exon 1 and half of the 2.0 kb

intron in comparison to its rescue, 17-AHR (Thompson and Sawtell 2001). These viruses

were tested for a measurable difference in establishment in the mouse TG after corneal

infection. In these experiments, they report a decrease of approximately 33% in viral

DNA detected in TG for the 17-AH mutant in comparison to parental virus and 17-AHR.

They argue that these results demonstrate an establishment decrease sufficient to

facilitate the reactivation reductions in their experiments and reported by others (Bloom

et al., 1994; Perng et al., 1994; Perng et al., 1996).

A biological mechanism hypothesized to result in establishment decreases is a

difference in neuronal survival, or apoptosis, for LAT mutants in comparison to parental

HSV-1. Sawtell and Thompson produced data suggesting a role of LAT in protecting





55

neurons during the establishment of latency (Thompson and Sawtell 2001). A difference

in viral DNA levels in ganglia between the LAT(-) mutant, 17-AH, and its rescue, 17-

AHR was reported. This difference is proposed to occur due to a inhibition of apoptosis

and an increase of surviving neurons. In the determination of neuronal survival, it was

reported that 17-AH has a 2-fold reduction in total latent neurons in comparison to its

rescue (Thompson and Sawtell 2001). These viruses were also tested for differences in

their relative replication in mouse TG following coreal infection. Interestingly, no

detectable replication differences were observed in cornea or ganglia. If these viruses do

express neuronal survival phenotypes, one would expect to see a replication difference

between LAT(-) and LAT(+) viruses. A virulence phenotype would also be expected if

LAT plays a role in neuronal survival and/or apoptosis in vivo.

A portion of the LAT gene has been shown by Wechsler (Pemg et al., 2000) to

stimulate apoptosis in transient transfection in cell culture through suppression of

receptor-mediated (caspase-8) and mitochondrial-mediated (caspase-9) pathways (Pemg

et al., 2000). Results in vivo with the large LAT mutants demonstrated a reduction in

establishment levels leading to a significant loss of sensory neurons (Perng et al., 2000;

Thompson and Sawtell 1997). Transient transfection of IMR-90 and CV-1 cells with a

plasmid containing the 3' region of the LAT exon and most of the intron was able to

protect the majority of cells from ceramide, or fumonisin Bi-induced apoptosis (Pemg et

al., 2000; Thompson and Sawtell 2000). Expression of the bovine herpesvirus 1 LAT

(Jones et al., 1996) or portions of the HSV-1 LAT gene inhibit chemically induced

apoptosis in cell culture (Jones et al., 2001; Perng et al., 2000).





56

The LAT effects on apoptosis appear to be cell specific. In culture, LAT is unable

to protect 293, or COS-7 cells from apoptosis (Inman et al., 2001). It is clear that LAT

does induce apoptosis in certain cell lines using transient transfection assays with high

multiplicities of infection and high expression levels (Pemg et al., 2000). These results

are very interesting but it is uncertain if LAT plays an apoptotic role in the context of

whole virus and in animal models. These findings were used to develop the hypothesis of

an apoptotic function of LAT in TG, and that LAT mutants result in greater levels of

apoptosis within sensory ganglia. Unfortunately, an apoptotic role of LAT has not been

adequately proven in whole virus or in animal models. The neuronal survival and

apoptosis results present a potential additional role of the LAT locus upon the acute

infection and the establishment of latency, although the mutants used in these

experiments do not adequately allow the identification of a virulence function distinct

from latency phenotypes.

Analysis of a series ofHSV recombinants containing deletions in the region known

to be required for reactivation identified a deletion that exhibited decreased pathology in

the rabbit eye during the acute infection. We hypothesized that this might represent a

separate function encoded by the LAT region and sought to study this recombinant's

virulence in the well-defined mouse model. LDso analysis and infectious virus production

in neuronal and non-neuronal tissues revealed that this mutant was dramatically restricted

in virulence. Additional analyses also included 17A480 and 17A489, which have been

described previously (Jarman et al., 2002) and involve mutations in the 5' region of the

LAT intron. Analysis of the LAT mutants 17A307 and 17A480, and their rescues, in the

mouse model revealed a dramatic impact of this region of the LAT gene on the acute





57

infection ofHSV-1. From the LDso/pfu values from both a footpad route of infection and

from an intracranial infection, a greater than 500 fold reduction occurs in the 17A307 and

17A480 mutants in comparison to 17syn+ (parental), 17APst (promoter mutant),

17A307R and 17A489. The dramatic reduction in virulence by each route of infection

proves a neurovirulence phenotype for these viruses and is not simply due to a

neuroinvasive effect. Some virulence effects have been reported for LAT mutants

(Thompson and Sawtell 2001; Perng et al., 2000) but none have exhibited such severe

deviations from wild-type and rescuant viruses. These data demonstrate a virulence

function of HSV-1 localized to the 3' region of exon 1 and the 5' intron of the latency

associated transcript locus.

Virulence Phenotype and Nervous Tissue Restriction

The LD5o/pfu determinations of 17A307 and 17A480 were a test of their ability to

induce encephalitis in the mouse model. In addressing the basis for this impairment,

spinal cord and brain were also analyzed for relative viral yields in these tissues by

plaque assay. Titrations of these tissues again showed restriction in replication in

nervous tissue for 17A307 and 17A480. Both of these LAT mutants were dramatically

restricted in viral yields in the spinal cord and in the brain. These results could possibly

be due to an initial restriction in the DRG, which would lead to lower seeding of the

spinal cord and consequently the brain. This is unlikely, though, because direct

intracranial inoculations and LDso/pfu determinations also showed a significant reduction

in virulence as occurred with the footpad route of infection, suggesting that the restriction

in the nervous tissue is more general.





58

Two possible explanations for the decreased virulence of 17A307 and 17A480 in

the mouse model are either a global restriction of these mutants to replicate in murine

tissue, or a tissue specific replication phenotype in neurons. In testing both epidermal

and nervous tissue infected in the mouse footpad model and the successive path of

infection in the nervous system, it was determined that the virulence phenotype is the

caused by a tissue specific restriction of the downstream LAT mutants. After footpad

infection, 17A307 and 17A480 are indistinguishable in infectious virus levels in

comparison to 17A307R, 17syn+ and 17APst proving that these mutations do not have a

general replication restriction in vivo. These LAT mutants were equal in p.f.u.

production at 2 days post-infection, which has been shown previously in our lab to be the

peak time of HSV-1 infection in the mouse footpad model (Jarman et al., 1999). After

infection of the foot, virus then enters the peripheral nervous system by entering

innervating nerve termini in the epidermis. Virus then travels via the sciatic nerve to the

dorsal root ganglia. In examing DRG for virus production, 17A307 was decreased in

infectious virus load at 3 days post-infection. Interestingly, 17A480 did not display a

detectable reduction in infectious levels at 3 days but did have a significant restriction by

5 days post-infection. 17A307 was restricted at this time point as well for dorsal root

ganglia. The virulence effects of 17A307 and 17A480 in the mouse are due to tissue

specific restriction of these mutants in nervous tissue.

Cell Culture Phenotype

A nervous tissue restriction was clearly observed in the mouse model but it was

uncertain whether this effect was caused by a neuronal cell type, or from supporting cells

in ganglia. To test for a cell specific replication impairment, 17A307 and 17A480





59

mutants were analyzed for replication in PC-12 cells (pheochromocytoma cells) and RS

cells in time course experiments. The PC-12 cells were chosen due their close

developmental relationship with neurons. Both the PC-12 cells and the RS cells were

tested for infection virus production in multistep and single step growth curves. From

these experiments, 17A307 and 17A480 each displayed an 8-10 fold restriction in plaque

forming unit production on PC-12 cells by 48 hours post-infection at low multiplicities of

infection in comparison to 17syn+, 17APst, 17A307R and 17A480R. When compared in

the RS cells, all viruses tested replicated to indistinguishable levels. This result was not

unexpected due to what was seen for replication values from feet in the tissue restriction

experiments. Together, these results indicate that the restriction specific for nervous

tissue is due to reduced replication, or at least decreased infectious virus production, in

neurons.

As mentioned previously, from initial characterization of these mutants, a severe

reduction in epinephrine-induced reactivation in the rabbit eye model was evident for

17A307. In contrast, 17A480 did not exhibit a reactivation phenotype in comparison to

17syn+ (parental), or 17APst (latent promoter mutant). The region altered in the 17A307

mutant may include the 3' region of the reactivation critical portion of the LAT locus and

a virulence region. The 17A480 shows a separation of virulence from reactivation

providing evidence for another regulatory region of the LAT gene.

LAT Mutants and Multiple Regulatory Functions

Many of the LAT mutants described in the literature involve mutation of a very

large portion (>lkb) of the LAT locus. Two of these mutants are dLAT2903 and 17-AH

and each involves mutation of the latent promoter, exon 1 and half of the 2.0 intron





60

(Pemg et al., 1994; Thompson and Sawtell 2001). Examination of these mutants failed to

reveal dramatic virulence phenotypes. These viruses do show latent phenotypes as

described by other mutants that engineered changes into the 5' portion of exonl (Bloom

et al., 1994; Perng et al., 1994). The mutant dLAT2903 is indistinguishable from parental

or its rescue in cell culture replication, corneal replication or p.f.u. production in the TG

of the rabbit (Perng et al., 2001). Similarly, no replication differences were observed for

17-AH in cell culture, cornea and TG (Thompson and Sawtell 2001). The fact that these

recombinants do not display a clear virulence effect in animal models, coupled with the

data shown here for the 17A307 and 17A480 LAT recombinants, suggests that the LAT

locus contains several distinct regulatory regions (Figure 4-1). These regions are

involved in different stages of HSV-1 infection in the mouse model. The recombinant

viruses 17A307 and 17A480 display severe virulence reductions in the mouse footpad

model.

Another interesting phenotype for these mutants is their difference in reactivation

abilities in the epinephrine-induced rabbit eye model. Reactivation is significantly

reduced for 17A307 and, as observed in this report, the mutant also shows decreased

virulence. From the establishment hypothesis of Sawtell and Thompson, it may seem

that 17A307 is simply inhibited in its ability to protect neurons and consequently results

in lower virulence in the acute infection and lower genome levels for the ability to

reactivate. The problem with this interpretation stems from the acute and latent

phenotypes of the 17A480 mutant. This virus does display a virulence phenotype as

observed for 17A307 but is devoid of a reactivation phenotype. Therefore, the virulence

phenotype cannot be explained by a lower amount of DNA seeding the ganglia.





61

Together, these data argue for the presence of a virulence region in the LAT locus clear

and distinct from a reactivation critical region (Figure 4-1). The virulence phenotypes for

the dLAT2903 and 17-AH viruses are not severe and the net result of deleting a large

region of LAT encompassing multiple genetic elements may be a phenotype that is less

severe than deleting single elements individually.

My hypothesis is that mutation of a combination of potentially opposing regulatory

regions may result in the masking of a clear acute phenotype. To address this possibility,

we engineered a mutant that removes the core element of the latent promoter along with

the exchange of a 480 bp region of the 5' intron of LAT with a lacZ stuffer sequence.

This mutant, 17APstA480, as the name suggests is simply the combination of the 17APst

and the 17A480 mutants. The virulence characteristics of this mutant are currently being

examined.

Establishment differences were seen with large LAT deletions but the regulatory

element was not well defined. The apoptosis and neuronal survival results were obtained

using mutants with a large region of shared sequence removed. From comparison of the

mutants, and what has been shown for the involvement of the 5' region ofexon 1 in

reactivation, it would seem that the region of the LAT locus involved in establishment,

neuronal survival and possibly apoptosis maps to the 3' region of exon 1 and the 5'

portion of the intron. Our data shows that small, concise mutations in this region of the

LAT locus do result in dramatic virulence results.

Mechanism

From the virulence data for the recombinants 17A307 and 17A480, it is clear that

a downstream region of LAT involving the end ofexon 1 and the beginning of the 2.0 kb





62

intron is acting upon the severity of acute infection and possibly the establishment of

latency. This region may function to protect neurons in vivo as proposed by Thompson

and Sawtell (Thompson and Sawtell 2001). On the molecular level, a few possible

mechanisms can be envisioned. First, it is possible that this region of the LAT locus

involves a secondary promoter. Another potential mechanism is through differential

transcriptional permissivity of the LAT region. Lastly, the LAT locus may encode an

enhancer/silencer region functioning to regulate the ICPO promoter.

Lytic Promoter in the LAT Region

A second promoter in the LAT gene was identified by use of transient

transfections in cell culture (Goins et al., 1994). Sequence involving exon 1 was able to

drive transcription of a lacZ reporter in Vero cells and was designated as LAP2 (Goins et

al., 1994). Discovery of this promoter resulted in its unfortunate designation as a latent

promoter. In its initial characterization, the secondary promoter was shown to be

transcriptionally active in Vero cells and consequently demonstrates its ability to express

RNA during a lytic infection.

Since the data for 17A480 demonstrates a function for this area of the LAT gene

upon the acute infection and does not result in a detectable reactivation phenotype, the

secondary promoter would be expected to be active during an acute infection. Therefore,

the LAT locus would have separate, opposing promoters: one functioning in a latent

infection to act upon reactivation and one operating in the acute infection in ganglia.

Multiple other transcripts have been proposed for the LAT region but have not been well

mapped and their kinetics and cell specific expression are poorly understood. Our lab has

detected expression of a RNA molecule in this region from a latent promoter mutant





63

(17APst) and mapping of this potential transcript is currently underway. The use of

another promoter in the LAT locus is possible due to the opposing virulence and

reactivation phenotypes seen for 17APst (LAP1 mutant) and the 17A480 mutant. If only

a primary 8.5 kb transcript is expressed, and a subsequently spliced intron, than it would

be unusual that removal of a downstream region (i.e. A480) would give a virulence

phenotype when removal of its core promoter (APst) does not affect the acute infection.

This argues strongly that they are separate and perhaps opposing elements.

Transcriptional Permissivity

It is also possible to model an action from a transcription accessibility hypothesis.

During latency, we know that LAT is the only abundantly expressed gene of HSV-1. The

other genes of HSV-1 are tightly repressed. In examination of the mechanism for this

dramatic difference, our lab showed that the LAT region is present in a transcriptionally

permissive state during latency as seen with histone acetylation data (Kubat et al., 2004).

The severity of acute infection may also result from alterations in the transcriptional

accessibility of the LAT and surrounding genes. It is possible that the region deleted in

the 17A307 and 17A480 mutant comprises a key site for the transcriptional permissivity

of LAT and possibly the neighboring, antisense gene, ICPO. Influence on ICPO is

especially likely, since is functions as a key transcriptional activator of all 3 classes of

HSV-1 genes. The LAT virulence locus could function to dock transcription factors,

which exert their effects upon either the latent LAT promoter, or possibly the ICPO

promoter. An impairment of this region to recruit the binding of cellular, or viral factors

present explicitly in ganglia, which are involved in ICPO expression, would result in a

decrease in replication and severity of infection.





64

ICPO Enhancer

Another possible mechanism for the virulence region of LAT is through

transcriptional regulation of the ICPO promoter. It may not simply function through a

transcriptional permissivity hypothesis as described above but could directly enhance the

expression of ICPO. During the lytic infection, the enhancer encoded in the LAT locus

would increase expression from the ICPO promoter directly by a looping mechanism.

Additionally, I hypothesize this occurs in a neuron-specific manner. In acute infection,

the enhancer would associate with transcription factors present in neurons to promote

expression of ICPO. The mutations introduced into the LAT locus in the 17A307 and

17A480 recombinant impair this enhancer function. ICPO is consequently lower in

neuronal tissue and leads to a general decrease in HSV-1 gene expression. This decrease

causes lower viral production and a milder infection in the mouse model. An enhancer

function involving the LAT locus and neuronal specific factors would explain why the

virulence effects were specific for nervous tissue. Future experiments are aimed at

determining if a secondary promoter is active in the LAT locus and mapping of

subsequent RNA molecules. Additionally, our lab will analyze the ICPO promoter region

for differences in transcription with the virulence mutants, and for possible changes in

transcriptional permissivity.






65








HSV-1 Genome

,S S









Exon 1




17ASty 348bp

17A348


17A307


17A480
489bp

17A489
SRegion of mutation
M Reactivation
M Virulence


Figure 4-1. Separate genetic regions of the LAT locus. This is a representation of the
virulence data presented in this manuscript along with known reactivation data
for the LAT region. The combination of the reactivation and virulence
phenotypes identified for LAT recombinant viruses enabled the modeling of
separate regulatory regions ofthe LAT locus as shown in this figure.
17A*s 1T^y ".



























separate regulatory regions of the LAT locus as shown in this figure.










LIST OF REFERENCES

Ahmed, M., M. Lock, C. G. Miller and N. W. Fraser, 2002, Regions of the herpes
simplex virus type 1 latency-associated transcript that protect cells from apoptosis
in vitro and protect neuronal cells in vivo, J Virol 76(2): 717-29.

Baines, J. D., P. L. Ward, G. Campadelli-Fiume and B. Roizman, 1991, The UL20 gene
of herpes simplex virus 1 encodes a function necessary for viral egress, J Virol
65(12): 6414-24.

Batterson, W. and B. Roizman, 1983, Characterization of the herpes simplex virion-
associated factor responsible for the induction of alpha genes, J Virol 46(2): 371-7.

Becker, Y., H. Dym and I. Sarov, 1968, Herpes simplex virus DNA, Virology 36(2): 184-
92.

Berman, E. J. and J. M. Hill, 1985, Spontaneous ocular shedding of HSV-1 in latently
infected rabbits, Invest Ophthalmol Vis Sci 26(4): 587-90.

Bhattacharjee, P. S., R. K. Tran, M. E. Myles, K. Maruyama, A. Mallakin, D. C. Bloom
and J. M. Hill, 2003, Overlapping subdeletions within a 348-bp in the 5' exon of the
LAT region that facilitates epinephrine-induced reactivation of HSV-1 in the rabbit
ocular model do not further define a functional element, Virology 312(1): 151-8.

Bloom, D. C., G. B. Devi-Rao, J. M. Hill, J. G. Stevens and E. K. Wagner, 1994,
Molecular analysis of herpes simplex virus type 1 during epinephrine-induced
reactivation of latently infected rabbits in vivo, J Virol 68(3): 1283-92.

Bloom, D. C., N. T. Maidment, A. Tan, V. B. Dissette, L. T. Feldman and J. G. Stevens,
1995, Long-term expression of a reporter gene from latent herpes simplex virus in
the rat hippocampus, Brain Res Mol Brain Res 31(1-2): 48-60.

Bloom, D. C., J. M. Hill, G. Devi-Rao, E. K. Wagner, L. T. Feldman and J. G. Stevens,
1996, A 348-base-pair region in the latency-associated transcript facilitates herpes
simplex virus type 1 reactivation, J Virol 70(4): 2449-59.

Bloom, D. C., J. G. Stevens, J. M. Hill and R. K. Tran, 1997, Mutagenesis of a cAMP
response element within the latency-associated transcript promoter of HSV-1
reduces adrenergic reactivation, Virology 236(1): 202-7.

Bloom, D. C. and R. G. Jarman, 1998, Generation and use of recombinant reporter
viruses for study of herpes simplex virus infections in vivo, Methods 16(1): 117-25.

Bloom, D. C., 2004, Hsv Lat and Neuronal Survival, Int Rev Immunol 23(1-2): 187-198.




66





67

Cabrera, C. V., C. Wohlenberg, H. Openshaw, M. Rey-Mendez, A. Puga and A. L.
Notkins, 1980, Herpes simplex virus DNA sequences in the CNS of latently
infected mice, Nature 288(5788): 288-90.

Cai, W. H., B. Gu and S. Person, 1988, Role of glycoprotein B of herpes simplex virus
type 1 in viral entry and cell fusion, J Virol 62(8): 2596-604.

Campbell, M. E., J. W. Palfreyman and C. M. Preston, 1984, Identification of herpes
simplex virus DNA sequences which encode a trans-acting polypeptide responsible
for stimulation of immediate early transcription, J Mol Biol 180(1): 1-19.

Caradonna, S. J. and Y. C. Cheng, 1981, Induction of uracil-DNA glycosylase and dUTP
nucleotidohydrolase activity in herpes simplex virus-infected human cells, J Biol
Chem 256(19): 9834-7.

Chartrand, P., C. S. Crumpacker, P. A. Schaffer and N. M. Wilkie, 1980, Physical and
genetic analysis of the herpes simplex virus DNA polymerase locus, Virology
103(2): 311-26.

Coen, D. M., D. P. Aschman, P. T. Gelep, M. J. Retondo, S. K. Weller and P. A.
Schaffer, 1984, Fine mapping and molecular cloning of mutations in the herpes
simplex virus DNA polymerase locus, J Virol 49(1): 236-47.

Corey, L., A. Wald and L. G. Davis, 1996, Subclinical shedding of HSV: its potential for
reduction by antiviral therapy, Adv Exp Med Biol 394:11-6.

Costa, R. H., K. G. Draper, G. Devi-Rao, R. L. Thompson and E. K. Wagner, 1985,
Virus-induced modification of the host cell is required for expression of the
bacterial chloramphenicol acetyltransferase gene controlled by a late herpes
simplex virus promoter (VP5), J Virol 56(1): 19-30.

Dennis, D. and J. R. Smiley, 1984, Transactivation of a late herpes simplex virus
promoter, Mol Cell Biol 4(3): 544-51.

Devi-Rao, G. B., D. C. Bloom, J. G. Stevens and E. K. Wagner, 1994, Herpes simplex
virus type 1 DNA replication and gene expression during explant-induced
reactivation of latently infected murine sensory ganglia, J Virol 68(3): 1271-82

Devi-Rao, G. B., J. S. Aguilar, M. K. Rice, H. H. Garza, Jr., D. C. Bloom, J. M. Hill and
E. K. Wagner, 1997, Herpes simplex virus genome replication and transcription
during induced reactivation in the rabbit eye, J Virol 71(9): 7039-47.

Dobson, A. T., F. Sederati, G. Devi-Rao, W. M. Flanagan, M. J. Farrell, J. G. Stevens, E.
K. Wagner and L. T. Feldman, 1989, Identification of the latency-associated
transcript promoter by expression of rabbit beta-globin mRNA in mouse sensory
nerve ganglia latently infected with a recombinant herpes simplex virus, J Virol
63(9): 3844-51.





68

Drolet, B. S., G. C. Perng, J. Cohen, S. M. Slanina, A. Yukht, A. B. Nesburn and S. L.
Wechsler, 1998, The region of the herpes simplex virus type 1 LAT gene involved
in spontaneous reactivation does not encode a functional protein, Virology 242(1):
221-32.

Drolet, B. S., G. C. Perng, R. J. Villosis, S. M. Slanina, A. B. Nesburn and S. L.
Wechsler, 1999, Expression of the first 811 nucleotides of the herpes simplex virus
type 1 latency-associated transcript (LAT) partially restores wild-type spontaneous
reactivation to a LAT-null mutant, Virology 253(1): 96-106.

Ecob-Prince, M. S., C. M. Preston, F. J. Rixon, K. Hassan and P. G. Kennedy, 1993,
Neurons containing latency-associated transcripts are numerous and widespread in
dorsal root ganglia following footpad inoculation of mice with herpes simplex virus
type 1 mutant in1814, J Gen Virol 74( Pt 6): 985-94.

Ecob-Prince, M. S., K. Hassan, M. T. Denheen and C. M. Preston, 1995, Expression of
beta-galactosidase in neurons of dorsal root ganglia which are latently infected with
herpes simplex virus type 1, J Gen Virol 76( Pt 6): 1527-32.

Efstathiou, S., A. C. Minson, H. J. Field, J. R. Anderson and P. Wildy, 1986, Detection of
herpes simplex virus-specific DNA sequences in latently infected mice and in
humans, J Virol 57(2): 446-55.

Everett, R. D., 1984, A detailed analysis of an HSV-1 early promoter: sequences involved
in trans-activation by viral immediate-early gene products are not early-gene
specific, Nucleic Acids Res 12(7): 3037-56.

Everett, R. D., 1984, Trans activation of transcription by herpes virus products:
requirement for two HSV-1 immediate-early polypeptides for maximum activity,
Embo J 3(13): 3135-41.

Everett, R. D., 1987, A detailed mutational analysis ofVmwl 10, a trans-acting
transcriptional activator encoded by herpes simplex virus type 1, Embo J 6(7):
2069-76.

Farrell, M. J., T. P. Margolis, W. A. Gomes and L. T. Feldman, 1994, Effect of the
transcription start region of the herpes simplex virus type 1 latency-associated
transcript promoter on expression of productively infected neurons in vivo, J Virol
68(9): 5337-43.

Forrester, A., H. Farrell, G. Wilkinson, J. Kaye, N. Davis-Poynter and T. Minson, 1992,
Construction and properties of a mutant of herpes simplex virus type 1 with
glycoprotein H coding sequences deleted, J Virol 66(1): 341-8.

Gelman, I. H. and S. Silverstein, 1985, Identification of immediate early genes from
herpes simplex virus that transactivate the virus thymidine kinase gene, Proc Natl
Acad Sci U S A 82(16): 5265-9.





69

Gelman, I. H. and S. Silverstein, 1986, Co-ordinate regulation of herpes simplex virus
gene expression is mediated by the functional interaction of two immediate early
gene products, J Mol Biol 191(3): 395-409.

Gelman, I. H. and S. Silverstein, 1987, Herpes simplex virus immediate-early promoters
are responsive to virus and cell trans-acting factors, J Virol 61(7): 2286-96.

Goins, W. F., L. R. Sternberg, K. D. Croen, P. R. Krause, R. L. Hendricks, D. J. Fink, S.
E. Straus, M. Levine and J. C. Glorioso, 1994, A novel latency-active promoter is
contained within the herpes simplex virus type 1 UL flanking repeats, J Virol
68(4): 2239-52.

Gressens, P. and J. R. Martin, 1994, HSV-2 DNA persistence in astrocytes of the
trigeminal root entry zone: double labeling by in situ PCR and
immunohistochemistry, J Neuropathol Exp Neurol 53(2): 127-35.

Guzowski, J. F. and E. K. Wagner, 1993, Mutational analysis of the herpes simplex virus
type 1 strict late UL38 promoter/leader reveals two regions critical in
transcriptional regulation, J Virol 67(9): 5098-108.

Hay, J., H. Moss, A. T. Jamieson and M. C. Timbury, 1976, Herpesvirus proteins: DNA
polymerase and pyrimidine deoxynucleoside kinase activities in temperature-
sensitive mutants of herpes simplex virus type 2, J Gen Virol 31(1): 65-73.

Henderson, G., W. Peng, L. Jin, G. C. Perg, A. B. Nesburn, S. L. Wechsler and C.
Jones, 2002, Regulation of caspase 8- and caspase 9-induced apoptosis by the
herpes simplex virus type 1 latency-associated transcript, J Neurovirol 8 Suppl 2:
103-11.

Heine, J. W., R. W. Honess, E. Cassai and B. Roizman, 1974, Proteins specified by
herpes simplex virus. XII. The virion polypeptides of type 1 strains, J Virol 14(3):
640-51.

Hill, J. M., J. B. Dudley, Y. Shimomura and H. E. Kaufman, 1986, Quantitation and
kinetics of induced HSV-1 ocular shedding, Curr Eye Res 5(3): 241-6.

Hill, J. M., Y. Haruta and D. S. Rootman, 1987, Adrenergically induced recurrent HSV-1
corneal epithelial lesions, Curr Eye Res 6(8): 1065-71.

Hill, T. J., 1987, Ocular pathogenicity of herpes simplex virus, Curr Eye Res 6(1): 1-7.

Hill, J. M., Y. Shimomura, J. B. Dudley, E. Berman, Y. Haruta, B. S. Kwon and L. J.
Maguire, 1987, Timolol induces HSV-1 ocular shedding in the latently infected
rabbit, Invest Ophthalmol Vis Sci 28(3): 585-90.

Hill, J. M., F. Sedarati, R. T. Javier, E. K. Wagner and J. G. Stevens, 1990, Herpes
simplex virus latent phase transcription facilitates in vivo reactivation, Virology
174(1): 117-25.





70

Hill, J. M., B. M. Gebhardt, R. Wen, A. M. Bouterie, H. W. Thompson, R. J.
O'Callaghan, W. P. Halford and H. E. Kaufman, 1996, Quantitation of herpes
simplex virus type 1 DNA and latency-associated transcripts in rabbit trigeminal
ganglia demonstrates a stable reservoir of viral nucleic acids during latency, J Virol
70(5): 3137-41.

Hill, J. M., H. H. Garza, Jr., Y. H. Su, R. Meegalla, L. A. Hanna, J. M. Loutsch, H. W.
Thompson, E. D. Varnell, D. C. Bloom and T. M. Block, 1997, A 437-base-pair
deletion at the beginning of the latency-associated transcript promoter significantly
reduced adrenergically induced herpes simplex virus type 1 ocular reactivation in
latently infected rabbits, J Virol 71(9): 6555-9.

Honess, R. W., D. J. Purifoy, D. Young, R. Gopal, N. Cammack and P. O'Hare, 1984,
Single mutations at many sites within the DNA polymerase locus of herpes simplex
viruses can confer hypersensitivity to aphidicolin and resistance to phosphonoacetic
acid, J Gen Virol 65 (Pt 1): 1-17.

Honess, R. W. and B. Roizman, 1974, Regulation ofherpesvirus macromolecular
synthesis. I. Cascade regulation of the synthesis of three groups of viral proteins, J
Virol 14(1): 8-19.

Honess, R. W. and B. Roizman, 1975, Regulation ofherpesvirus macromolecular
synthesis: sequential transition ofpolypeptide synthesis requires functional viral
polypeptides, Proc Natl Acad Sci U S A 72(4): 1276-80.

Huszar, D. and S. Bacchetti, 1981, Partial purification and characterization of the
ribonucleotide reductase induced by herpes simplex virus infection of mammalian
cells, J Virol 37(2): 580-8.

Inman, M., L. Lovato, A. Doster and C. Jones, 2001, A mutation in the latency-related
gene of bovine herpesvirus 1 leads to impaired ocular shedding in acutely infected
calves, J Virol 75(18): 8507-15.

Inman, M., G. C. Pemg, G. Henderson, H. Ghiasi, A. B. Nesburn, S. L. Wechsler and C.
Jones, 2001, Region of herpes simplex virus type 1 latency-associated transcript
sufficient for wild-type spontaneous reactivation promotes cell survival in tissue
culture, J Virol 75(8): 3636-46.

Izumi, K. M. and J. G. Stevens, 1988, Two thymidine kinase deficient herpes simplex
viruses exhibit unexpected virulence properties, Microb Pathog 4(2): 145-53.


Izumi, K. M. and J. G. Stevens, 1990, Molecular and biological characterization of a
herpes simplex virus type 1 (HSV-1) neuroinvasiveness gene, J Exp Med 172(2):
487-96.

Jamieson, A. T., G. A. Gentry and J. H. Subak-Sharpe, 1974, Induction of both thymidine
and deoxycytidine kinase activity by herpes viruses, J Gen Virol 24(3): 465-80.





71

Jarman, R. G., E. K. Wagner and D. C. Bloom, 1999, LAT expression during an acute
HSV infection in the mouse, Virology 262(2): 384-97.

Jarman, R. G., J. M. Loutsch, G. B. Devi-Rao, M. E. Marquart, M. P. Banaszak, X.
Zheng, J. M. Hill, E. K. Wagner and D. C. Bloom, 2002, The region of the HSV-1
latency-associated transcript required for epinephrine-induced reactivation in the
rabbit does not include the 2.0-kb intron, Virology 292(1): 59-69.

Javier, R. T., K. M. Izumi and J. G. Stevens, 1988, Localization of a herpes simplex virus
neurovirulence gene dissociated from high-titer virus replication in the brain, J
Virol 62(4): 1381-7.

Jin, L., W. Peng, G. C. Perng, D. J. Brick, A. B. Nesbur, C. Jones and S. L. Wechsler,
2003, Identification of herpes simplex virus type 1 latency-associated transcript
sequences that both inhibit apoptosis and enhance the spontaneous reactivation
phenotype, J Virol 77(11): 6556-61.

Johnson, P. A. and R. D. Everett, 1986, The control of herpes simplex virus type-1 late
gene transcription: a 'TATA-box'/cap site region is sufficient for fully efficient
regulated activity, Nucleic Acids Res 14(21): 8247-64.

Kapoor, A. K., A. A. Nash, P. Wildy, J. Phelan, C. S. McLean and H. J. Field, 1982,
Pathogenesis of herpes simplex virus in congenitally athymic mice: the relative
roles of cell-mediated and humoral immunity, J Gen Virol 60(Pt 2): 225-33.

Kenny, J. J., F. C. Krebs, H. T. Hartle, A. E. Gartner, B. Chatton, J. M. Leiden, J. P.
Hoeffler, P. C. Weber and B. Wigdahl, 1994, Identification of a second
ATF/CREB-like element in the herpes simplex virus type 1 (HSV-1) latency-
associated transcript (LAT) promoter, Virology 200(1): 220-35.

Kieff, E. D., S. L. Bachenheimer and B. Roizman, 1971, Size, composition, and structure
of the deoxyribonucleic acid of herpes simplex virus subtypes 1 and 2., J Virol
8(2): 125-32.

Kristensson, K., E. Lycke and J. Sjostrand, 1970, Transport of herpes simplex virus in
peripheral nerves, Acta Physiol Scand: 13-4.

Kubat, N. J., R. K. Tran, P. McAnany and D. C. Bloom, 2004, Specific histone tail
modification and not DNA methylation is a determinant of herpes simplex virus
type 1 latent gene expression, J Virol 78(3): 1139-49.

Kwon, B. S., L. P. Gangarosa, K. D. Burch, J. deBack and J. M. Hill, 1981, Induction of
ocular herpes simplex virus shedding by iontophoresis of epinephrine into rabbit
cornea, Invest Ophthalmol Vis Sci 21(3): 442-9.

Kwon, B. S., L. P. Gangarosa, Sr., K. Green and J. M. Hill, 1982, Kinetics of ocular
herpes simplex virus shedding induced by epinephrine iontophoresis, Invest
Ophthalmol Vis Sci 22(6): 818-21.





72

Longnecker, R., S. Chatterjee, R. J. Whitley and B. Roizman, 1987, Identification of a
herpes simplex virus 1 glycoprotein gene within a gene cluster dispensable for
growth in cell culture, Proc Natl Acad Sci U S A 84(12): 4303-7.

Longnecker, R. and B. Roizman, 1987, Clustering of genes dispensable for growth in
culture in the S component of the HSV-1 genome, Science 236(4801): 573-6.

Loutsch, J. M., G. C. Perg, J. M. Hill, X. Zheng, M. E. Marquart, T. M. Block, H.
Ghiasi, A. B. Nesburn and S. L. Wechsler, 1999, Identical 371-base-pair deletion
mutations in the LAT genes of herpes simplex virus type 1 McKrae and 17syn+
result in different in vivo reactivation phenotypes, J Virol 73(1): 767-71.

Mackem, S. and B. Roizman, 1982, Differentiation between alpha promoter and regulator
regions of herpes simplex virus 1: the functional domains and sequence of a
movable alpha regulator, Proc Natl Acad Sci U S A 79(16): 4917-21.

Mackem, S. and B. Roizman, 1982, Regulation of alpha genes of herpes simplex virus:
the alpha 27 gene promoter-thymidine kinase chimera is positively regulated in
converted L cells, J Virol 43(3): 1015-23.

Maggioncalda, J., A. Mehta, O. Bagasra, N. W. Fraser and T. M. Block, 1996, A herpes
simplex virus type 1 mutant with a deletion immediately upstream of the LAT
locus establishes latency and reactivates from latently infected mice with normal
kinetics, J Neurovirol 2(4): 268-78.

Margolis, T. P., C. R. Dawson and J. H. LaVail, 1992, Herpes simplex viral infection of
the mouse trigeminal ganglion. Immunohistochemical analysis of cell populations,
Invest Ophthalmol Vis Sci 33(2): 259-67.

Margolis, T. P., D. C. Bloom, A. T. Dobson, L. T. Feldman and J. G. Stevens, 1993,
Decreased reporter gene expression during latent infection with HSV LAT
promoter constructs, Virology 197(2): 585-92.

Marquart, M. E., X. Zheng, R. K. Tran, H. W. Thompson, D. C. Bloom and J. M. Hill,
2001, A cAMP response element within the latency-associated transcript promoter
of HSV-1 facilitates induced ocular reactivation in a mouse hyperthermia model,
Virology 284(1): 62-9.

McGeoch, D. J., 1985, On the predictive recognition of signal peptide sequences, Virus
Res 3(3): 271-86.

McGeoch, D. J., A. Dolan, S. Donald and F. J. Rixon, 1985, Sequence determination and
genetic content of the short unique region in the genome of herpes simplex virus
type 1, J Mol Biol 181(1): 1-13.

McLennan, J. L. and G. Darby, 1980, Herpes simplex virus latency: the cellular location
of virus in dorsal root ganglia and the fate of the infected cell following virus
activation, J Gen Virol 51(Pt 2): 233-43.





73

Mehta, A., J. Maggioncalda, O. Bagasra, S. Thikkavarapu, P. Saikumari, T. Valyi-Nagy,
N. W. Fraser and T. M. Block, 1995, In situ DNA PCR and RNA hybridization
detection of herpes simplex virus sequences in trigeminal ganglia of latently
infected mice, Virology 206(1): 633-40.

Mellerick, D. M. and N. W. Fraser, 1987, Physical state of the latent herpes simplex virus
genome in a mouse model system: evidence suggesting an episomal state, Virology
158(2): 265-75.

Morrow, J. A. and F. J. Rixon, 1994, Analysis of sequences important for herpes simplex
virus type 1 latency-associated transcript promoter activity during lytic infection of
tissue culture cells, J Gen Virol 75 (Pt 2): 309-16.

Mott, K. R., N. Osorio, L. Jin, D. J. Brick, J. Naito, J. Cooper, G. Henderson, M. Inman,
C. Jones, S. L. Wechsler and G. C. Perg, 2003, The bovine herpesvirus-1 LR
ORF2 is critical for this gene's ability to restore the high wild-type reactivation
phenotype to a herpes simplex virus-1 LAT null mutant, J Gen Virol 84(Pt 11):
2975-85.

Nash, A. A., and P. Cambouropoulos, 1993, The immune system response to herpes
simplex virus, Semin, Virol 4:181-186

Nesburn, A. B., J. H. Elliott and H. M. Leibowitz, 1967, Spontaneous reactivation of
experimental herpes simplex keratitis in rabbits, Arch Ophthalmol 78(4): 523-9.

Nicosia, M., J. M. Zabolotny, R. P. Lirette and N. W. Fraser, 1994, The HSV-1 2-kb
latency-associated transcript is found in the cytoplasm comigrating with ribosomal
subunits during productive infection, Virology 204(2): 717-28.

O'Hare, P. and G. S. Hayward, 1985, Evidence for a direct role for both the 175,000- and
110,000-molecular-weight immediate-early proteins of herpes simplex virus in the
transactivation of delayed-early promoters, J Virol 53(3): 751-60.

Peng, W., G. Henderson, G. C. Pemg, A. B. Nesburn, S. L. Wechsler and C. Jones, 2003,
The gene that encodes the herpes simplex virus type 1 latency-associated transcript
influences the accumulation of transcripts (Bcl-x(L) and Bcl-x(S)) that encode
apoptotic regulatory proteins, J Virol 77(19): 10714-8.

Perng, G. C., E. C. Dunkel, P. A. Geary, S. M. Slanina, H. Ghiasi, R. Kaiwar, A. B.
Nesburn and S. L. Wechsler, 1994, The latency-associated transcript gene of herpes
simplex virus type 1 (HSV-1) is required for efficient in vivo spontaneous
reactivation of HSV-1 from latency, J Virol 68(12): 8045-55.

Perng, G. C., J. C. Zwaagstra, H. Ghiasi, R. Kaiwar, D. J. Brown, A. B. Nesburn and S.
L. Wechsler, 1994, Similarities in regulation of the HSV-1 LAT promoter in
corneal and neuronal cells, Invest Ophthalmol Vis Sci 35(7): 2981-9.





74

Pemg, G. C., H. Ghiasi, S. M. Slanina, A. B. Nesbum and S. L. Wechsler, 1996, The
spontaneous reactivation function of the herpes simplex virus type 1 LAT gene
resides completely within the first 1.5 kilobases of the 8.3-kilobase primary
transcript, J Virol 70(2): 976-84.

Pemg, G. C., S. M. Slanina, H. Ghiasi, A. B. Nesburn and S. L. Wechsler, 1996, A 371-
nucleotide region between the herpes simplex virus type 1 (HSV-1) LAT promoter
and the 2-kilobase LAT is not essential for efficient spontaneous reactivation of
latent HSV-1, J Virol 70(3): 2014-8.

Perg, G. C., K. Chokephaibulkit, R. L. Thompson, N. M. Sawtell, S. M. Slanina, H.
Ghiasi, A. B. Nesbum and S. L. Wechsler, 1996, The region of the herpes simplex
virus type 1 LAT gene that is colinear with the ICP34.5 gene is not involved in
spontaneous reactivation, J Virol 70(1): 282-91.

Perng, G. C., S. M. Slanina, A. Yukht, B. S. Drolet, W. Keleher, Jr., H. Ghiasi, A. B.
Nesburn and S. L. Wechsler, 1999, A herpes simplex virus type 1 latency-
associated transcript mutant with increased virulence and reduced spontaneous
reactivation, J Virol 73(2): 920-9.

Perng, G. C., S. M. Slanina, A. Yukht, H. Ghiasi, A. B. Nesbum and S. L. Wechsler,
2000, The latency-associated transcript gene enhances establishment of herpes
simplex virus type 1 latency in rabbits, J Virol 74(4): 1885-91.

Perg, G. C., C. Jones, J. Ciacci-Zanella, M. Stone, G. Henderson, A. Yukht, S. M.
Slanina, F. M. Hofman, H. Ghiasi, A. B. Nesburn and S. L. Wechsler, 2000, Virus-
induced neuronal apoptosis blocked by the herpes simplex virus latency-associated
transcript, Science 287(5457): 1500-3.

Pemg, G. C., S. M. Slanina, H. Ghiasi, A. B. Nesburn and S. L. Wechsler, 2001, The
effect of latency-associated transcript on the herpes simplex virus type 1 latency-
reactivation phenotype is mouse strain-dependent, J Gen Virol 82(Pt 5): 1117-22.

Perg, G. C., D. Esmaili, S. M. Slanina, A. Yukht, H. Ghiasi, N. Osorio, K. R. Mott, B.
Maguen, L. Jin, A. B. Nesbum and S. L. Wechsler, 2001, Three herpes simplex
virus type 1 latency-associated transcript mutants with distinct and asymmetric
effects on virulence in mice compared with rabbits, J Virol 75(19): 9018-28.

Pemg, G. C., B. Maguen, L. Jin, K. R. Mott, J. Kurylo, L. BenMohamed, A. Yukht, N.
Osorio, A. B. Nesburn, G. Henderson, M. Inman, C. Jones and S. L. Wechsler,
2002, A novel herpes simplex virus type 1 transcript (AL-RNA) antisense to the 5'
end of the latency-associated transcript produces a protein in infected rabbits, J
Virol 76(16): 8003-10.





75

Pemg, G. C., B. Maguen, L. Jin, K. R. Mott, N. Osorio, S. M. Slanina, A. Yukht, H.
Ghiasi, A. B. Nesburn, M. Inman, G. Henderson, C. Jones and S. L. Wechsler,
2002, A gene capable of blocking apoptosis can substitute for the herpes simplex
virus type 1 latency-associated transcript gene and restore wild-type reactivation
levels, J Virol 76(3): 1224-35.

Pizer, L. I., S. U. Kim, P. Nystrom and V. C. Coates, 1978, Herpes simplex virus
replication in pheochromocytoma cell line that responds to nerve growth factor,
Acta Neuropathol (Berl) 44(1): 9-14

Post, L. E. and B. Roizman, 1981, A generalized technique for deletion of specific genes
in large genomes: alpha gene 22 of herpes simplex virus 1 is not essential for
growth, Cell 25(1): 227-32.

Powell, K. L., R. Mirkovic and R. J. Courtney, 1977, Comparative analysis of
polypeptides induced by type 1 and type 2 strains of herpes simplex virus,
Intervirology 8(1): 18-29.

Preston, V. G. and F. B. Fisher, 1984, Identification of the herpes simplex virus type 1
gene encoding the dUTPase, Virology 138(1): 58-68.

Reed, L. J. and H. Muench, 1938, A simple method of estimating fifty percent endpoints,
Am. J. Hyg. 27: 493-497

Rock, D. L. and N. W. Fraser, 1983, Detection ofHSV-1 genome in central nervous
system of latently infected mice, Nature 302(5908): 523-5.

Rock, D. L. and N. W. Fraser, 1985, Latent herpes simplex virus type 1 DNA contains
two copies of the virion DNA joint region, J Virol 55(3): 849-52.

Rock, D. L., A. B. Nesburn, H. Ghiasi, J. Ong, T. L. Lewis, J. R. Lokensgard and S. L.
Wechsler, 1987, Detection of latency-related viral RNAs in trigeminal ganglia of
rabbits latently infected with herpes simplex virus type 1, J Virol 61(12): 3820-6.

Rodahl, E. and L. Haarr, 1997, Analysis of the 2-kilobase latency-associated transcript
expressed in PC12 cells productively infected with herpes simplex virus type 1:
evidence for a stable, nonlinear structure, J Virol 71(2): 1703-7.

Roop, C., L. Hutchinson and D. C. Johnson, 1993, A mutant herpes simplex virus type 1
unable to express glycoprotein L cannot enter cells, and its particles lack
glycoprotein H, J Virol 67(4): 2285-97.


Rubenstein, R. and R. W. Price, 1983, Replication ofthymidine kinase deficient herpes
simplex virus type 1 in neuronal cell culture: infection of the PC 12 cell, Arch
Virol 78(1-2): 49-64.





76

Sandri-Goldin, R. M., 1994, Properties of an HSV-1 regulatory protein that appears to
impair host cell splicing, Infect Agents Dis 3(2-3): 59-67.

Sawtell, N. M. and R. L. Thompson, 1992, Herpes simplex virus type 1 latency-
associated transcription unit promotes anatomical site-dependent establishment and
reactivation from latency, J Virol 66(4): 2157-69.

Sawtell, N. M., 1997, Comprehensive quantification of herpes simplex virus latency at
the single-cell level, J Virol 71(7): 5423-31.

Sawtell, N. M., 1998, The probability of in vivo reactivation of herpes simplex virus type
1 increases with the number of latently infected neurons in the ganglia, J Virol
72(8): 6888-92.

Sawtell, N. M., D. K. Poon, C. S. Tansky and R. L. Thompson, 1998, The latent herpes
simplex virus type 1 genome copy number in individual neurons is virus strain
specific and correlates with reactivation, J Virol 72(7): 5343-50.

Sawtell, N. M., R. L. Thompson, L. R. Stanberry and D. I. Bernstein, 2001, Early
intervention with high-dose acyclovir treatment during primary herpes simplex
virus infection reduces latency and subsequent reactivation in the nervous system in
vivo, J Infect Dis 184(8): 964-71.

Schang, L. M., A. Hossain and C. Jones, 1996, The latency-related gene of bovine
herpesvirus 1 encodes a product which inhibits cell cycle progression, J Virol
70(6): 3807-14.

Simmons, A. and A. A. Nash, 1987, Effect of B cell suppression on primary infection and
reinfection of mice with herpes simplex virus, J Infect Dis 155(4): 649-54.

Soares, K., D. Y. Hwang, R. Ramakrishnan, M. C. Schmidt, D. J. Fink and J. C. Glorioso,
1996, cis-acting elements involved in transcriptional regulation of the herpes
simplex virus type 1 latency-associated promoter 1 (LAP1) in vitro and in vivo, J
Virol 70(8): 5384-94.

Spear, P. G. and B. Roizman, 1972, Proteins specified by herpes simplex virus. V.
Purification and structural proteins of the herpesvirion, J Virol 9(1): 143-59.

Speck, P. G. and A. Simmons, 1992, Synchronous appearance of antigen-positive and
latently infected neurons in spinal ganglia of mice infected with a virulent strain of
herpes simplex virus, J Gen Virol 73 (Pt 5): 1281-5.

Spivack, J. G. and N. W. Fraser, 1988, Expression of herpes simplex virus type 1 (HSV-
1) latency-associated transcripts and transcripts affected by the deletion in avirulent
mutant HFEM: evidence for a new class of HSV-1 genes, J Virol 62(9): 3281-7.





77

Spivack, J. G. and N. W. Fraser, 1988, Expression of herpes simplex virus type 1 latency-
associated transcripts in the trigeminal ganglia of mice during acute infection and
reactivation of latent infection, J Virol 62(5): 1479-85.

Stevens, J. G., 1975, Latent herpes simplex virus and the nervous system, Curr Top
Microbiol Immunol 70: 31-50.

Stevens, J. G., E. K. Wagner, G. B. Devi-Rao, M. L. Cook and L. T. Feldman, 1987,
RNA complementary to a herpesvirus alpha gene mRNA is prominent in latently
infected neurons, Science 235(4792): 1056-9.

Tal-Singer, R., T. M. Lasner, W. Podrzucki, A. Skokotas, J. J. Leary, S. L. Berger and N.
W. Fraser, 1997, Gene expression during reactivation of herpes simplex virus type
1 from latency in the peripheral nervous system is different from that during lytic
infection of tissue cultures, J Virol 71(7): 5268-76.

Thompson, R. L., M. L. Cook, G. B. Devi-Rao, E. K. Wagner and J. G. Stevens, 1986,
Functional and molecular analyses of the avirulent wild-type herpes simplex virus
type 1 strain KOS, J Virol 58(1): 203-11.


Thompson, R. L. and N. M. Sawtell, 1997, The herpes simplex virus type 1 latency-
associated transcript gene regulates the establishment of latency, J Virol 71(7):
5432-40.

Thompson, R. L. and N. M. Sawtell, 2000, Replication of herpes simplex virus type 1
within trigeminal ganglia is required for high frequency but not high viral genome
copy number latency, J Virol 74(2): 965-74.

Thompson, R. L. and N. M. Sawtell, 2001, Herpes simplex virus type 1 latency-
associated transcript gene promotes neuronal survival, J Virol 75(14): 6660-75.

Tognon, M., D. Furlong, A. J. Conley and B. Roizman, 1981, Molecular genetics of
herpes simplex virus. V. Characterization of a mutant defective in ability to form
plaques at low temperatures and in a viral fraction which prevents accumulation of
coreless capsids at nuclear pores late in infection, J Virol 40(3): 870-80.

Wagner, E. K. and D. C. Bloom, 1997, Experimental investigation of herpes simplex
virus latency, Clin Microbiol Rev 10(3): 419-43.

Wagner, E. K., W. M. Flanagan, G. Devi-Rao, Y. F. Zhang, J. M. Hill, K. P. Anderson
and J. G. Stevens, 1988, The herpes simplex virus latency-associated transcript is
spliced during the latent phase of infection, J Virol 62(12): 4577-85.

Wechsler, S. L., A. B. Nesburn, R. Watson, S. Slanina and H. Ghiasi, 1988, Fine
mapping of the major latency-related RNA of herpes simplex virus type 1 in
humans, J Gen Virol 69 (Pt 12): 3101-6.





78

Wechsler, S. L., A. B. Nesbum, R. Watson, S. M. Slanina and H. Ghiasi, 1988, Fine
mapping of the latency-related gene of herpes simplex virus type 1: alternative
splicing produces distinct latency-related RNAs containing open reading frames, J
Virol 62(11): 4051-8.

Wechsler, S. L., A. B. Nesburn, J. Zwaagstra and H. Ghiasi, 1989, Sequence of the
latency-related gene of herpes simplex virus type 1, Virology 168(1): 168-72.

Whitley, R. J., E. R. Kern, S. Chatterjee, J. Chou and B. Roizman, 1993, Replication,
establishment of latency, and induced reactivation of herpes simplex virus gamma
1 34.5 deletion mutants in rodent models, J Clin Invest 91(6): 2837-43.

Zabolotny, J. M., C. Krummenacher and N. W. Fraser, 1997, The herpes simplex virus
type 1 2.0-kilobase latency-associated transcript is a stable intron which branches at
a guanosine, J Virol 71(6): 4199-208.

Zwaagstra, J., H. Ghiasi, A. B. Nesburn and S. L. Wechsler, 1989, In vitro promoter
activity associated with the latency-associated transcript gene of herpes simplex
virus type 1, J Gen Virol 70 (Pt 8): 2163-9.

Zwaagstra, J. C., H. Ghiasi, S. M. Slanina, A. B. Nesburn, S. C. Wheatley, K. Lillycrop,
J. Wood, D. S. Latchman, K. Patel and S. L. Wechsler, 1990, Activity of herpes
simplex virus type 1 latency-associated transcript (LAT) promoter in neuron-
derived cells: evidence for neuron specificity and for a large LAT transcript, J Virol
64(10): 5019-28.

Zwaagstra, J. C., H. Ghiasi, A. B. Nesburn and S. L. Wechsler, 1991, Identification of a
major regulatory sequence in the latency associated transcript (LAT) promoter of
herpes simplex virus type 1 (HSV-1), Virology 182(1): 287-97.













BIOGRAPHICAL SKETCH

In the Fall of 1993, I started at Mars Hill College in Mars Hill, North Carolina. At

Mars Hill, I majored in biology with a chemistry minor and completed my Bachelor of

Science in May of 1997. I then entered into the Microbiology doctoral program at

Arizona State University in the Fall of 1997. After two years, my mentor accepted a

position at the University of Florida and I subsequently transferred to continue my

research. At the University of Florida, I entered into the Molecular Genetics and

Microbiology department and completed my Ph.D. in May of 2004.




























79








I certify that I have read this study and that in my opinion it conforms to
acceptable standards of scholarly presentation and is fully adequate, in scope and quality,
as a dissertation for the degree of Doctor of Philosophy.


David C. Bloom, Chair
Assistant Professor of Molecular Genetics
and Microbiology

I certify that I have read this study and that in my opinion it conforms to acceptable
standards of scholarly presentation and is fully adequate, in scope and quality, as a
dissertation for the degree of Doctor of Philosophy.


Rich Condit
Professor of Molecular Genetics and
Microbiology

I certify that I have read this study and that in my opinion it conforms to acceptable
standards of scholarly presentation and is fully adequate, in scope and quality, as a
dissertation for the degree of Doctor of Philosophy.


Sue Moyer
Professor of Molecular Genetics and
Microbiology

I certify that I have read this study and that in my opinion it conforms to acceptable
standards of scholarly presentation and is fully adequate, in scope an ality, as a
dissertation for the degree of Doctor of Philosophy./


Kevin Andnrsn
Associate Professor of Physiological
Sciences

This dissertation was submitted to the College of Medicine and to the Graduate
School and was accepted as partial fulfillment of the requirements for the degree of
Doctor of Philosophy.

May 2004 DM ed
Dean, College of Medicine



Dean, Gradte School




Full Text
9
Establishment
As proposed by Sawtell and Thompson, the LAT is hypothesized to act upon the
latent HSV-1 infection at the establishment stage of latency. It has been shown that some
LAT mutants exhibit a reduction in the ability to establish a latent infection. In latently
infected neurons, the number of viral genomes has been calculated to exist in the range of
10-100 (Cabrera et al., 1980; Efstathiou et al., 1986; Hill et al., 1996; Rock et al., 1983;
Sawtell et al., 1997), although it is important to point out that the number of latently
infected neurons that express LAT is less than 30% of the total neurons that contain latent
genomes (Ecob-Prince et al., 1995; Ecob-Prince et al., 1993; Gressens et al., 1994; Hill et
al., 1996; Maggioncalda et al., 1996; Mehta et al., 1995). A LAT negative mutant,
KOS/62 derived from the KOS strain of HSV-1, was reported to have a reduced
reactivation phenotype and was attributed to a minor impairment of this mutant to
establish a latent infection. The number of latently infected neurons with the KOS/62
mutant was measurably lower than mice infected with the parental KOS (Sawtell and
Thompson 1992). In the comparison of latent genome numbers in neurons between high
reactivating strains of HSV-1 and low reactivators, a low reactivating strain, KOS, was
present in lower amounts than the strains 17syn+ and McKrae (Sawtell et al., 1998). In
support of the establishment findings, other laboratories have reported slight decreases in
establishment with LAT-negative mutants in murine eye models (Devi-Rao et al., 1994).
Indirect support for the role of LAT in establishment comes from the finding that LAT
expression in mouse DRG occurs at the end of lytic replication in neurons (Sawtell and
Thompson 1992).


28
96 well plate was blotted onto membrane in duplicate. One blot was tested with a probe
for the lacZ DNA present in the 480 region of the 17A480 mutation, and the other blot
was tested for the presence of the LAT promoter region (202 bp PstI fragment) from
wild-type HSV-1 strain 17syn+. If both mutations were correct in the 17APstA480 virus,
then plaque isolates would be positive when hybridized with the lacZ probe and negative
with the Pst region probe (Figure 2-3). Critical controls included in this analysis were the
inclusion of 17A480 and 17APst. In use of the lacZ probe, the 17A480 control produced a
positive signal and the 17APst remained negative. For the use of the Pst probe, the same
was also true, since the 17A480 mutant retained wild-type sequence at the latent promoter
and the 17APst mutant had the 202 bp PstI region removed.
In performing dual probing of 17APstA480 possible plaque isolates, a few viruses
were determined positive for the lacZ fragment and negative for the PstI fragment in
comparison to controls. After the first round of screening, a few properly hybridizing
isolates were selected and subjected to another round of plaque-purification. From the
second round of selection, approximately 30% of isolates produced desired hybridization
signals. Two of these samples were selected and put through another round of
purification. At this third round, 100% of samples were lacZ fragment-positive and PstI
fragment negative. To be certain of purity, two samples were taken into a fourth round of
purification and resulted again in 100% of isolates positive for lacZ and negative for the
PstI fragment. To prove that the PstI fragment-negative control contained adequate viral
DNA to be detected, it was included as a control in the final round of the 17A480R
plaque purification. This sample produced signal intensity equal to the other positive
control, \lsyn+.


40
phenotype for 17A307 and 17A480, replication of these viruses was tested by time course
in PC-12 cells and in rabbit skin cells. These LAT mutants were tested along with
17syn+, 17APst, 17A307R and 17A480R. The first experiment involved a multi-step time
course performed in PC-12 cells. The multi-step growth curves were performed with a
viral multiplicity of infection (m.o.i.) of 0.001 for each virus. A low dose of virus
administered, in addition to monitoring time points over several days, allows the
identification of subtle replication differences.
In the first experiments with 17A307 and 17A480, as early as 24 hours post
infection, a 8-10 fold reduction in infectious virus was seen for both 17A307 and 17A480
in PC-12 cells (Figure 3-6). This decrease was also seen at 48, 72 and 96 hours post
infection. The experiment was repeated with 17A307 and 17A480 being tested in the
same experiment along with a few additional controls. As with the previous experiments,
\lsyn+ and 17A307R were included as controls but I additionally tested 17APst
(promoter mutant) along with 17A480R in the multi-step growth curve (Figure 3-7). The
17APst recombinant virus was shown to lack a virulence phenotype in the mouse but it
was important to compare a LAT recombinant with an alteration in a region of LAT that
is expected not to contain a cell specific replication function. In these experiments, an 8-
10 fold reduction was again observed for 17A307 and 17A480 (Figure 3-7). The 17syn+,
17APst and 17A480R viruses were not restricted in the production of infectious virus on
PC-12 cells. Multi-step growth curves were also performed in rabbit skin cells (Figure 3-
8) to test for a general growth restriction in cell culture. These results did not yield a
noticeable difference in virus production as compared with controls (Figure 3-8).


59
mutants were analyzed for replication in PC-12 cells (pheochromocytoma cells) and RS
cells in time course experiments. The PC-12 cells were chosen due their close
developmental relationship with neurons. Both the PC-12 cells and the RS cells were
tested for infection virus production in multistep and single step growth curves. From
these experiments, 17A307 and 17A480 each displayed an 8-10 fold restriction in plaque
forming unit production on PC-12 cells by 48 hours post-infection at low multiplicities of
infection in comparison to \lsyn+, 17APst, 17A307R and 17A480R. When compared in
the RS cells, all viruses tested replicated to indistinguishable levels. This result was not
unexpected due to what was seen for replication values from feet in the tissue restriction
experiments. Together, these results indicate that the restriction specific for nervous
tissue is due to reduced replication, or at least decreased infectious virus production, in
neurons.
As mentioned previously, from initial characterization of these mutants, a severe
reduction in epinephrine-induced reactivation in the rabbit eye model was evident for
17A307. In contrast, 17A480 did not exhibit a reactivation phenotype in comparison to
17syn+ (parental), or 17APst (latent promoter mutant). The region altered in the 17A307
mutant may include the 3 region of the reactivation critical portion of the LAT locus and
a virulence region. The 17A480 shows a separation of virulence from reactivation
providing evidence for another regulatory region of the LAT gene.
LAT Mutants and Multiple Regulatory Functions
Many of the LAT mutants described in the literature involve mutation of a very
large portion (>lkb) of the LAT locus. Two of these mutants are dLAT2903 and 17-AH
and each involves mutation of the latent promoter, exon 1 and half of the 2.0 intron


11
site and the 3 end of LAT resulting in termination 1,500 base pairs from the cap site had
no impact upon reactivation (Bloom et al, 1996) and accumulation of the 2.0 kb LAT
intron has also been shown to not be required for reactivation (Jarman et al, 2002). The
17A348 mutant which contains a mutation engineered into the 5 region of exon 1 did
exhibit severe decreases in reactivation (Bloom et al., 1996). Another mutant, 17ASty,
partially overlaps the 17A348 mutant and is also reactivation impaired (Hill et al., 1996).
These mutations in exon 1 do not affect the transcriptional activity of the LAT promoter
and do not reduce the expression of the LAT introns. From these findings in the
epinephrine-induced rabbit eye model, the reactivation critical region (RCR) of LAT has
been mapped to the 5region of exon 1 of the LAT gene.
Mutations in 5region of exon 1 result in a dramatic reduction in the frequency of
induced, and spontaneous virus shedding in the tear film of infected rabbits. LAT null
mutants have also been shown to reactivate at reduced frequency in TG of mice (Sawtell
and Thompson 1992; Thompson and Sawtell 1997). With regard to mechanism, one
hypothesis is that the LAT gene may function directly to promote viral reactivation. LAT
has been shown to be actively transcribed in neurons during the latent state, which would
suggest a role in maintenance or reactivation. Examination of the sequence of LAT exon
1 found a surprisingly large occurrence of CpG motifs that suggested that LAT gene
transcription could be controlled by methylation (Bloom et al., 1996). It was shown,
however, that expression of the LAT gene is not influenced by a methylation mechanism
(Kubat et al., 2004). It is possible that LAT+ cells may only represent a small fraction of
latent neurons and could play a repressive role on reactivation. Recent data from our lab
suggest that the LAT is actively down-regulated 0.5-4.0 hours post-explant co-cultivation


3 RESULTS 35
LD5o/pfu Evaluation 36
Tissue Restriction 38
Cell Specific Replication Deficiency 39
Additional LAT Recombinant Viruses 41
17A480R 41
17APstA480 42
4 DISCUSSION 53
Virulence Phenotype and Nervous System Restriction 57
Cell Culture Phenotype 58
LAT Mutants and Multiple Regulatory Functions 59
Mechanism 61
Lytic Promoter in the LAT Region 62
Transcriptional Permissivity 63
ICPO Enhancer 64
LIST OF REFERENCES 66
BIOGRAPHICAL SKETCH 79
v


43
days post-infection
Mean Values ( Standard Error of the Mean) (data points as plotted above):
meantsem
17syn+
17APst
17A307
PI 3
1.31 0.079
1.31 0.082
1.060.038
PI 5
1.920.078
1.860.089
1,530.049
PI 7
2.630.168
2.50.171
1.670.09
P110
1.180.193
0.980.184
0.81 0.156
P112
1.060.193
0.710.146
0.780.16
P114
0.880.171
0.60.144
0.770.186
P117
0.840.178
0.390.084
0.61 0.206
P119
0.70.155
0.490.072
0.540.217
PI 21
0.660.153
0.470.028
0.660.199
PI 24
0.60.128
0.390.043
0.630.202
PI 27
0.550.124
0.41 0.093
0.540.216
Figure 3-1. Reduced corneal pathology of 17A307 in the rabbit eye model. The graph at
the top of the figure is a measurement of the severity of pathology of HSV-1
infection in the rabbit comea. This was measured by slit lamp which
measures the number of dendrites and the severity of their pathology in the
comea. These values closely compare with infectious vims levels. Values
below the graph are the raw data that are plotted above. The graph indicates
that 17A307 may have a virulence deficient phenotype.


CHAPTER 3
RESULTS
In our pursuit to further understand the function of the LAT locus in HSV
biology, we made recombinant virus 17A307 deleted of a 307 bp fragment in the 3
region of exon 1 (Figure 1-1). The native region of HSV-1 LAT exon 1 was removed by
homologous recombination and replaced with DNA stuffer from a SV40 polyadenylation
sequence. This recombinant virus contained alterations 3 of a region that mapped to the
general region that we had evidence was involved in reactivation. To test the impact of
this portion of the LAT on reactivation from latency, we utilized the epinephrine-induced
reactivation rabbit eye model. Results showed that the 17A307 recombinant virus
exhibits a reduced reactivation phenotype (Table 1-1).
Additionally, it was observed that the 17A307 displayed reduced comea scarring in
comparison to \lsyn+ (parental virus) and 17APst (promoter mutant) at early times post
infection (Figure 3-1). This indicated that the 17A307 recombinant was altered in
pathogenesis due to the 307 bp deletion, or due to secondary mutations outside of the
LAT region. To test this second possibility, a second 17A307 virus was engineered
(17A307a). This recombinant is the same as the original 17A307, except that it contained
a stuffer sequence from the rabbit P globin gene (rabbit 13-globin poly A region). Along
with the 17A307a recombinant, a corresponding rescue was made, 17A307aR. These
viruses were once again tested in the epinephrine-induced rabbit eye model for
reactivation effects and demonstrated reduced reactivation (Table 1-1). These results
35


suggesting that the phenotype is independent of the LAT latent promoter (LAP1). In
addition, 17A480 possesses a wild-type reactivation in the rabbit eye model suggesting
that the virulence and reactivation phenotypes are genetically separable.
IX


CHAPTER 4
DISCUSSION
The influence of the LAT gene upon dictating the outcome of the latent phase of
the HSV-1 infection is clear. Uncertainty, however, begins with understanding: 1)
whether LAT acts primarily at the level of establishing a latent infection and helping to
either suppress viral replication and prevent cell death, or 2) whether it exerts its primary
influence as a mediator of reactivation from latency. Another difficulty in dissecting the
LAT genes role has been linking the biologically diverse functions attributed to the LAT
region with the LAT RNA itself, and whether different regions of the gene may actually
have different functions. LAT promoter mutants have been seen to have different
phenotypes than larger deletions that include the promoter and downstream transcript
encoding sequence. The goal of this study was to utilize recombinant virology to attempt
to define the genetic basis for LAT phenotypes that might go beyond just controlling
reactivation.
Viruses with alterations in the LAT region exhibit severe impairment of
reactivation in both the induced and the spontaneous rabbit eye models, and in mouse
models involving infection of either the footpad or the cornea. Specifically, mutations in
the promoter and/or the 5 region of exon 1 have most discriminately resulted in severe
reactivation deficiencies in rabbit models (Bloom et al., 1994; Bloom et al., 1996; Pemg
et al., 1994; Pemg et al., 1996; Trousdale et al., 1991). It has been debated whether these
effects are due to decreased reactivation, or are the result of decreased establishment of
LAT mutants. With respect to early events in HSV-1 latency, the LAT gene has been
53


5
Wechsler et ah, 1988). These products have been shown to be nuclear-localized, stable
introns (Farrell et ah, 1994; Zabolotny et al., 1997) and are spliced from an 8.3 kb
primary transcript (Farrell et al., 1991). Stability of the introns is hypothesized to be due
to nonconsensus A or G branch point sequence and inhibits debranching of the lariat in
vivo (Rodahl et ah, 1997; Tahl-Singer et ah, 1997; Zabolotny et ah, 1997). The 1.5 kb
intron is only observed in neurons, and is believed to be an alternative splice product of
the 2 kb intron (Zabolotny et ah, 1997). The LAT promoter itself contains several
neuron-specific expression elements (Farrell et ah, 1994; Morrow et ah, 1994; Zwaagstra
et ah, 1991), consistent with its high-level of expression in these cells (Dobson et ah,
1989). Further, in animal models, the LAT promoter demonstrates greater activity in
neurons and is specifically more active in neurons not expressing acute antigens
(Margolis et ah, 1992). Since the LAT is the only viral transcript abundantly transcribed
during latency, its role in the establishment, maintenance and reactivation from latency in
the mammalian host has been sought. Because latency can only be established in vivo,
the use of animal models is required.
Animal Models
Several animal models are used in HSV-1 research that mimic the acute and latent
infections occurring in the human population. The mouse footpad model allows the study
of both acute and latent infections. In this model, the epidermis of the footpad is infected
which allows acute replication in this tissue. Infectious virus enters the nervous system
by infiltration of nerve termini located in the epidermis. Virus then travels by fast axonal
transport into dorsal root ganglia (DRG). In the sensory neurons of the DRG the virus
progresses down one of two paths: 1) acute replication and virus production may ensue;
or 2) genomes are silenced and latency is established. With a high viral dose, highly


76
Sandri-Goldin, R. M., 1994, Properties of an HSV-1 regulatory protein that appears to
impair host cell splicing, Infect Agents Dis 3(2-3): 59-67.
Sawtell, N. M. and R. L. Thompson, 1992, Herpes simplex virus type 1 latency-
associated transcription unit promotes anatomical site-dependent establishment and
reactivation from latency, J Virol 66(4): 2157-69.
Sawtell, N. M., 1997, Comprehensive quantification of herpes simplex virus latency at
the single-cell level, J Virol 71(7): 5423-31.
Sawtell, N. M., 1998, The probability of in vivo reactivation of herpes simplex virus type
1 increases with the number of latently infected neurons in the ganglia, J Virol
72(8): 6888-92.
Sawtell, N. M., D. K. Poon, C. S. Tansky and R. L. Thompson, 1998, The latent herpes
simplex virus type 1 genome copy number in individual neurons is vims strain
specific and correlates with reactivation, J Virol 72(7): 5343-50.
Sawtell, N. M., R. L. Thompson, L. R. Stanberry and D. I. Bernstein, 2001, Early
intervention with high-dose acyclovir treatment during primary herpes simplex
vims infection reduces latency and subsequent reactivation in the nervous system in
vivo, J Infect Dis 184(8): 964-71.
Schang, L. M., A. Hossain and C. Jones, 1996, The latency-related gene of bovine
herpesvirus 1 encodes a product which inhibits cell cycle progression, J Virol
70(6): 3807-14.
Simmons, A. and A. A. Nash, 1987, Effect of B cell suppression on primary infection and
reinfection of mice with herpes simplex vims, J Infect Dis 155(4): 649-54.
Soares, K., D. Y. Hwang, R. Ramakrishnan, M. C. Schmidt, D. J. Fink and J. C. Glorioso,
1996, cis-acting elements involved in transcriptional regulation of the herpes
simplex vims type 1 latency-associated promoter 1 (LAP1) in vitro and in vivo, J
Virol 70(8): 5384-94.
Spear, P. G. and B. Roizman, 1972, Proteins specified by herpes simplex vims. V.
Purification and structural proteins of the herpesvirion, J Virol 9(1): 143-59.
Speck, P. G. and A. Simmons, 1992, Synchronous appearance of antigen-positive and
latently infected neurons in spinal ganglia of mice infected with a vimlent strain of
herpes simplex vims, J Gen Virol 73 (Pt 5): 1281-5.
Spivack, J. G. and N. W. Fraser, 1988, Expression of herpes simplex vims type 1 (HSV-
1) latency-associated transcripts and transcripts affected by the deletion in avimlent
mutant HFEM: evidence for a new class of HSV-1 genes, J Virol 62(9): 3281-7.


7
approach, and co-cultivation, does not adequately substitute for clinical reactivation since
virus detection in nervous tissue is very different from viral recovery in the periphery that
occurs in true reactivation. The mouse models have been useful in that they have
identified several aspects of the latent infection in vivo: identification of the neuron as
the site of latency, understanding of axonal transport of virus through the sciatic nerve,
the ability of non-replicating viruses to establish latent infections and characterization of
transcripts expressed during the stages of latency (Dobson et al., 1989; Kristensson et al,
1971; Kwon et al., 1982; McLennan et al., 1980; Stevens et al., 1987; Wagner et al.,
1988).
Although the mouse models allow for the analysis of HSV-1 latency, the best
animal model would be one that allows reactivation to occur spontaneously but also
allows induction of reactivation with proper stress stimulus. Also, an ideal model would
result in the production of acute lesions at the periphery with the appearance of detectable
infectious virus. The mouse models require the physical removal of ganglia to detect
infectious virus. Latent infection and reactivation can also be induced in the TG of
rabbits upon corneal infection (Nesbum et al., 1967). From this discovery, the
spontaneous and inducible rabbit eye models were developed and function as superior
models for the study of reactivation since they allow for the detection of virus in the eye
after reactivation from the rabbit TG. The spontaneous model involves the detection of
random reactivation events by the sampling of tear film. The epinephrine-induced rabbit
eye model is one degree closer to the natural infection in humans than the spontaneous
model in that it is stress inducible. In this model, virus can be induced to reactivate by
application of current and epinephrine to the eye (Berman et al., 1985; Hill et al., 1986;


33
\lsyn+ 17A480
Figure 2-2. Dot blot hybridization of second round plaque purification of 17A480R. This
figure demonstrates that by the second round of plaque purification, most of
the viruses are positive for the region of the LAT gene corresponding to the
region that was altered in the 17A480 recombinant.


57
infection of HSV-1. From the LD5o/pfu values from both a footpad route of infection and
from an intracranial infection, a greater than 500 fold reduction occurs in the 17A307 and
17A480 mutants in comparison to \lsyn+ (parental), 17APst (promoter mutant),
17A307R and 17A489. The dramatic reduction in virulence by each route of infection
proves a neurovirulence phenotype for these viruses and is not simply due to a
neuroinvasive effect. Some virulence effects have been reported for LAT mutants
(Thompson and Sawtell 2001; Pemg et al., 2000) but none have exhibited such severe
deviations from wild-type and rescuant viruses. These data demonstrate a virulence
function of HSV-1 localized to the 3 region of exon 1 and the 5 intron of the latency
associated transcript locus.
Virulence Phenotype and Nervous Tissue Restriction
The LD50/pfu determinations of 17A307 and 17A480 were a test of their ability to
induce encephalitis in the mouse model. In addressing the basis for this impairment,
spinal cord and brain were also analyzed for relative viral yields in these tissues by
plaque assay. Titrations of these tissues again showed restriction in replication in
nervous tissue for 17A307 and 17A480. Both of these LAT mutants were dramatically
restricted in viral yields in the spinal cord and in the brain. These results could possibly
be due to an initial restriction in the DRG, which would lead to lower seeding of the
spinal cord and consequently the brain. This is unlikely, though, because direct
intracranial inoculations and LDso/pfu determinations also showed a significant reduction
in virulence as occurred with the footpad route of infection, suggesting that the restriction
in the nervous tissue is more general.


62
intron is acting upon the severity of acute infection and possibly the establishment of
latency. This region may function to protect neurons in vivo as proposed by Thompson
and Sawtell (Thompson and Sawtell 2001). On the molecular level, a few possible
mechanisms can be envisioned. First, it is possible that this region of the LAT locus
involves a secondary promoter. Another potential mechanism is through differential
transcriptional permissivity of the LAT region. Lastly, the LAT locus may encode an
enhancer/silencer region functioning to regulate the ICPO promoter.
Lytic Promoter in the LAT Region
A second promoter in the LAT gene was identified by use of transient
transfections in cell culture (Goins et al., 1994). Sequence involving exon 1 was able to
drive transcription of a lacZ reporter in Vero cells and was designated as LAP2 (Goins et
al., 1994). Discovery of this promoter resulted in its unfortunate designation as a latent
promoter. In its initial characterization, the secondary promoter was shown to be
transcriptionally active in Vero cells and consequently demonstrates its ability to express
RNA during a lytic infection.
Since the data for 17A480 demonstrates a function for this area of the LAT gene
upon the acute infection and does not result in a detectable reactivation phenotype, the
secondary promoter would be expected to be active during an acute infection. Therefore,
the LAT locus would have separate, opposing promoters: one functioning in a latent
infection to act upon reactivation and one operating in the acute infection in ganglia.
Multiple other transcripts have been proposed for the LAT region but have not been well
mapped and their kinetics and cell specific expression are poorly understood. Our lab has
detected expression of a RNA molecule in this region from a latent promoter mutant


67
Cabrera, C. V., C. Wohlenberg, H. Openshaw, M. Rey-Mendez, A. Puga and A. L.
Notkins, 1980, Herpes simplex virus DNA sequences in the CNS of latently
infected mice, Nature 288(5788): 288-90.
Cai, W. H., B. Gu and S. Person, 1988, Role of glycoprotein B of herpes simplex vims
type 1 in viral entry and cell fusion, J Virol 62(8): 2596-604.
Campbell, M. E., J. W. Palfreyman and C. M. Preston, 1984, Identification of herpes
simplex vims DNA sequences which encode a trans-acting polypeptide responsible
for stimulation of immediate early transcription, J Mol Biol 180(1): 1-19.
Caradonna, S. J. and Y. C. Cheng, 1981, Induction of uracil-DNA glycosylase and dUTP
nucleotidohydrolase activity in herpes simplex vims-infected human cells, J Biol
Chem 256(19): 9834-7.
Chartrand, P., C. S. Crumpacker, P. A. Schaffer and N. M. Wilkie, 1980, Physical and
genetic analysis of the herpes simplex vims DNA polymerase locus, Virology
103(2): 311-26.
Coen, D. M., D. P. Aschman, P. T. Gelep, M. J. Retondo, S. K. Weller and P. A.
Schaffer, 1984, Fine mapping and molecular cloning of mutations in the herpes
simplex vims DNA polymerase locus, J Virol 49(1): 236-47.
Corey, L., A. Wald and L. G. Davis, 1996, Subclinical shedding of HSV: its potential for
reduction by antiviral therapy, Adv Exp Med Biol 394: 11-6.
Costa, R. H., K. G. Draper, G. Devi-Rao, R. L. Thompson and E. K. Wagner, 1985,
Vims-induced modification of the host cell is required for expression of the
bacterial chloramphenicol acetyltransferase gene controlled by a late herpes
simplex vims promoter (VP5), J Virol 56(1): 19-30.
Dennis, D. and J. R. Smiley, 1984, Transactivation of a late herpes simplex vims
promoter, Mol Cell Biol 4(3): 544-51.
Devi-Rao, G. B., D. C. Bloom, J. G. Stevens and E. K. Wagner, 1994, Herpes simplex
vims type 1 DNA replication and gene expression during explant-induced
reactivation of latently infected murine sensory ganglia, J Virol 68(3): 1271-82
Devi-Rao, G. B., J. S. Aguilar, M. K. Rice, H. H. Garza, Jr., D. C. Bloom, J. M. Hill and
E. K. Wagner, 1997, Herpes simplex vims genome replication and transcription
during induced reactivation in the rabbit eye, J Virol 71(9): 7039-47.
Dobson, A. T., F. Sederati, G. Devi-Rao, W. M. Flanagan, M. J. Farrell, J. G. Stevens, E.
K. Wagner and L. T. Feldman, 1989, Identification of the latency-associated
transcript promoter by expression of rabbit beta-globin mRNA in mouse sensory
nerve ganglia latently infected with a recombinant herpes simplex vims, J Virol
63(9): 3844-51.


Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy
IDENTIFICATION OF A VIRULENCE FUNCTION IN HERPES SIMPLEX VIRUS-
TYPE I MAPPING TO THE LATENCY ASSOCIATED TRANSCRIPT LOCUS
By
Lee William Gary
May 2004
Chair: David C. Bloom
Major Department: Molecular Genetics and Microbiology
Two Herpes Simplex Virus type 1 (HSV-1) strain \lsyn+ recombinants (17A307
and 17A480) possessing contiguous deletions spanning the 3 region of the Latency
Associated Transcript (LAT) exon 1 and the 5 portion of the LAT intron were analysed
for virulence in mouse footpad (f.p.) model. While the \lsyn+ (parent) and 17APst (LAT
promoter mutant) yielded LD5o/pfu values of 3.25 x 102 and 5.11 x 102 respectively,
17A307 and 17A480 had LDso/pfu values of >7.0 x 104. A second independent
recombinant and a rescue (17A307a and 17A307aR) were constructed and yielded f.p.
LD50 values of >7.0 x 104 and 3.17 x 102 respectively, confirming that deletions within
this region of the LAT locus resulted in a dramatic reduction in virulence. Replication of
the recombinants was indistinguishable from wild-type \lsyn+ and rescue viruses when
tested on rabbit skin cells but demonstrate 10-fold reduction in viral yields on PC-12 cells
as measured by multi-step growth curves. Significantly, the attenuation in virulence
displayed by 17A307 and 17A480 is not observed for the LAT promoter mutant, 17APst,
vin


41
A single step growth curve was also conducted in PC-12 cells utilizing a higher
m.o.i (3.0) and shorter time points: 0, 3, 6,12,18 hours post-infection (Figure 3-9). This
experiment tested for dramatic replication differences due to the higher dose of virus and
the shorter time points. From these results, a difference between LAT mutants and
controls is not clearly evident. Together, these data show that a cell specific replication
effect is seen for the 17A307 and 17A480 LAT mutants at low multiplicities of infection.
The phenotype is only observed in PC-12 cells and is lacking in rabbit skin cells. From
these data, I hypothesize that the neuronal restriction of 17A307 and 17A480 in nervous
tissue is the result of growth restriction in neurons.
Additional LAT Recombinant Viruses
In addition to the LAT recombinants engineered by our collaborator, Dr. Wagner
(17A307,17A307a, 17A307aR, 17A480 and 17A489), it was necessary to construct two
additional mutants. One necessary recombinant virus was 17A480R, which enables
validation of the findings for 17A480. Another mutant, 17APstA480, was also
constructed and is beneficial in understanding the different regulatory regions of the LAT
locus as described below.
17A480R
To verify the results observed for the 17A480 mutant in vivo and in cell culture,
the mutation was restored in a 17A480R recombinant virus. Restoration of biological
function was observed by multi-step time course on PC-12 cells (Figure 3-7). This
mutant is also being characterized for virulence properties in the mouse footpad model.


42
17APstA480
Another recombinant, 17APstA480, was also engineered to compare the findings
for the 17A480 with a recombinant that included a deletion in a different region of the
LAT locus. As shown by LD50 and tissue restriction experiments, 17A480 is greatly
reduced in virulence, while a deletion of the core latent promoter (17APst) is
indistinguishable from parental virus (17syrt+). This led us to believe that the LAT locus
contains different regulatory regions and the impairment of more than one of these
regions may mask a severe phenotype. The 17APstA480 virus was a critical recombinant
for testing this hypothesis. Our expectation is to see an intermediate virulence phenotype
residing between what we observed for 17A480 and 17APst. In this virus, as the name
implies, the 480 mutation was coupled with a clean deletion in the latent core promoter.
The resulting mutant has impairments in two potentially different regulatory regions of
LAT. This will enable us to compare its phenotypes with other mutants in the literature
that contain very large deletions in the LAT locus (Pemg et al., 2000; Thompson and
Sawtell 2001). These experiments are currently in progress.


BIOGRAPHICAL SKETCH
In the Fall of 1993,1 started at Mars Hill College in Mars Hill, North Carolina. At
Mars Hill, I majored in biology with a chemistry minor and completed my Bachelor of
Science in May of 1997. I then entered into the Microbiology doctoral program at
Arizona State University in the Fall of 1997. After two years, my mentor accepted a
position at the University of Florida and I subsequently transferred to continue my
research. At the University of Florida, I entered into the Molecular Genetics and
Microbiology department and completed my Ph.D. in May of 2004.
79


72
Longnecker, R., S. Chatteijee, R. J. Whitley and B. Roizman, 1987, Identification of a
herpes simplex virus 1 glycoprotein gene within a gene cluster dispensable for
growth in cell culture, Proc Natl Acad Sci U S A 84(12): 4303-7.
Longnecker, R. and B. Roizman, 1987, Clustering of genes dispensable for growth in
culture in the S component of the HSV-1 genome, Science 236(4801): 573-6.
Loutsch, J. M., G. C. Pemg, J. M. Hill, X. Zheng, M. E. Marquart, T. M. Block, H.
Ghiasi, A. B. Nesbum and S. L. Wechsler, 1999, Identical 371-base-pair deletion
mutations in the LAT genes of herpes simplex vims type 1 McKrae and 17syn+
result in different in vivo reactivation phenotypes, J Virol 73(1): 767-71.
Mackem, S. and B. Roizman, 1982, Differentiation between alpha promoter and regulator
regions of herpes simplex vims 1: the functional domains and sequence of a
movable alpha regulator, Proc Natl Acad Sci U S A 79(16): 4917-21.
Mackem, S. and B. Roizman, 1982, Regulation of alpha genes of herpes simplex vims:
the alpha 27 gene promoter-thymidine kinase chimera is positively regulated in
converted L cells, J Virol 43(3): 1015-23.
Maggioncalda, J., A. Mehta, O. Bagasra, N. W. Fraser and T. M. Block, 1996, A herpes
simplex vims type 1 mutant with a deletion immediately upstream of the LAT
locus establishes latency and reactivates from latently infected mice with normal
kinetics, J Neurovirol 2(4): 268-78.
Margolis, T. P., C. R. Dawson and J. H. LaVail, 1992, Herpes simplex viral infection of
the mouse trigeminal ganglion. Immunohistochemical analysis of cell populations,
Invest Ophthalmol Vis Sci 33(2): 259-67.
Margolis, T. P., D. C. Bloom, A. T. Dobson, L. T. Feldman and J. G. Stevens, 1993,
Decreased reporter gene expression during latent infection with HSV LAT
promoter constructs, Virology 197(2): 585-92.
Marquart, M. E., X. Zheng, R. K. Tran, H. W. Thompson, D. C. Bloom and J. M. Hill,
2001, A cAMP response element within the latency-associated transcript promoter
of HSV-1 facilitates induced ocular reactivation in a mouse hyperthermia model,
Virology 284(1): 62-9.
McGeoch, D. J., 1985, On the predictive recognition of signal peptide sequences, Vims
Res 3(3): 271-86.
McGeoch, D. J., A. Dolan, S. Donald and F. J. Rixon, 1985, Sequence determination and
genetic content of the short unique region in the genome of herpes simplex vims
type 1, JMol Biol 181(1): 1-13.
McLennan, J. L. and G. Darby, 1980, Herpes simplex vims latency: the cellular location
of vims in dorsal root ganglia and the fate of the infected cell following vims
activation, J Gen Virol 51(Pt 2): 233-43.


3
1984; Guzowski et al., 1993). The leaky-late gene products can be transcribed prior to
the conclusion of replication but strict late genes are only transcribed after replication has
completed. Regardless of these differences, late genes are mainly the structural products
of HSV-1 and include glycoproteins and capsid proteins.
Viral Infections in the Human Host
The majority of the U.S. and World population is infected with HSV-1. In most
cases, the virus does not induce a severe acute infection, but for a small percentage, it can
cause blindness or encephalitic death. Individuals infected with HSV-1 harbor a lifelong
latent infection in sensory and autonomic neurons, with occasional recurrences of an
acute infection at the site of initial infection. Latent infection of neurons results in the
replicative silencing of the HSV-1 genome. For the establishment of latency, after entry
of virus, a dramatic repression of gene expression must occur. Transcription of most
HSV-1 genes must be silenced, or restricted to very low levels with few transcripts being
expressed or detectable. During the maintenance stage of latency, the genome is present
as an episome within the nucleus of the cell (Mellerick et al., 1987; Rock et al., 1983;
Rock et al., 1985). Maintenance of HSV-1 latency involves the potential for latent
genomes to reactivate and produce infectious virus upon appropriate stimulus.
Reactivation from latency is believed to be a rare event and results in the reappearance of
infectious virus from sensory ganglia that travels back to the initial site of infection in the
epithelia. Clinical reactivation results in a lesion with detectable infectious virus.
Reactivation also has been determined to occur subclinically, with HSV-1 genomes
detected by PCR in the epithelia. It is unclear whether reactivation is lytic to neurons, but
the multiple occurrences of reactivation in the human population makes neuronal
destruction upon reactivation unlikely (Corey et al., 1996). It is more plausible that


37
out to create additional 17A307 recombinants that do not mutate the splice donor site, or
any portion of the intron. I also planned to insert the polyadenylation sequences in each
orientation to test for a RNA directional effect. Prior to engineering and testing these
new 17A307 recombinants, we wanted to repeat the LD50 experiments with the inclusion
of additional controls.
The LAT recombinants 17A307, 17A307a, 17A307aR, 17A480 and 17A489
(Figure 1-1) were analyzed for virulence phenotypes by use of the mouse footpad model
(Table 3-1). These viruses were used to infect the rear footpad of out-bred Swiss
Webster mice along with control viruses, \lsyn+ (parental), 17APst (promoter mutant)
and RHA-6, which contains a polyadenylation signal at a Hpal site in the middle of the
intron. The footpad of out-bred Swiss Webster mice was infected with mutants 17A307,
17A307a, 17A307aR, 17A480, 17A489 and RHA-6 in varying dilutions (see Methods)
with 10 mice virusdilution'1. In comparison to 1 lsyn+ (parental), 17APst (promoter
mutant) and each rescuant virus included in the experiment, mutants 17A307,17A307a
and 17A480 expressed dramatically increased LD50/pfu levels by mouse footpad
infection. Each of these displayed a greater than 500 fold increase in LDso/pfu levels
(Table 3-1). The virulence phenotype for the 17A480 recombinant made the creation of
the new 17A307 recombinants described above unnecessary. The 17A480 mutation
resides entirely in the intron and retains the splice donor site. This virus also contains a
lacZ DNA stuffer and its effect argues against the orientation of the polyadenylation
sequence having an impact in the 17A307 recombinants. It is important to recognize that
the 17A489 mutant had an equal virulence profile to 17,syn+ and 17APst, which identifies
the 3 boundary of the virulence region due to the lack of virulence phenotype for


49
17d307
17d307R
Hours Post-Infection
B. 1.00E+09
Hours Post-Infection
Figure 3-6. 17A307 and 17A480 multi-step time courses in PC-12 cells. A) 17A307 is
statistically different than 17A307R (P=0.0019). B) 17A480 is statistically
different than 17syn^ (P=0.0232).


63
(17APst) and mapping of this potential transcript is currently underway. The use of
another promoter in the LAT locus is possible due to the opposing virulence and
reactivation phenotypes seen for 17APst (LAP1 mutant) and the 17A480 mutant. If only
a primary 8.5 kb transcript is expressed, and a subsequently spliced intron, than it would
be unusual that removal of a downstream region (i.e. A480) would give a virulence
phenotype when removal of its core promoter (APst) does not affect the acute infection.
This argues strongly that they are separate and perhaps opposing elements.
Transcriptional Permissivity
It is also possible to model an action from a transcription accessibility hypothesis.
During latency, we know that LAT is the only abundantly expressed gene of HSV-1. The
other genes of HSV-1 are tightly repressed. In examination of the mechanism for this
dramatic difference, our lab showed that the LAT region is present in a transcriptionally
permissive state during latency as seen with histone acetylation data (Kubat et al., 2004).
The severity of acute infection may also result from alterations in the transcriptional
accessibility of the LAT and surrounding genes. It is possible that the region deleted in
the 17A307 and 17A480 mutant comprises a key site for the transcriptional permissivity
of LAT and possibly the neighboring, antisense gene, ICPO. Influence on ICPO is
especially likely, since is functions as a key transcriptional activator of all 3 classes of
HSV-1 genes. The LAT virulence locus could function to dock transcription factors,
which exert their effects upon either the latent LAT promoter, or possibly the ICPO
promoter. An impairment of this region to recruit the binding of cellular, or viral factors
present explicitly in ganglia, which are involved in ICPO expression, would result in a
decrease in replication and severity of infection.


17
UL
8,3 kb primary LAT transcript
17A489HHH
Figure 1-1. Schematic of the LAT gene and the position of 17APst, 17A307,17A480 and
17A489 recombinant viruses. The location of the LAT primary transcript is
shown along with its location in the HSV-1 genome. The promoter, exonl
and the 5 intron of LAT are depicted at the bottom of the figure along with
recombinant LAT viruses.


38
17A489. Results from the footpad infections indicate that 17A307,17A307a and 17A480
are impaired in either neuroinvasion, or neurovirulence.
To determine if 17A307 and 17A307a were deficient in neurovirulence, the LAT
mutants were used to infect the mouse by intracranial inoculation along with 17.syw+ and
17APst. These results showed that the 17A307 and 17A307a viruses were also restricted
in virulence measured by LD50/pfu upon direct inoculation into the mouse brain (Table 3-
1). Taken together, the footpad and intracranial LD50/pfu values show that mutants
17A307, 17A307a and 17A480 are greatly impaired in virulence in the mouse and that the
results are due to a neurovirulence phenotype and not likely due to a defect in
neuroinvasion or an inability to enter the central nervous system.
Tissue Restriction
To identify whether the 17A307,17A307a and 17A480 mutants display a general
reduction in replication in the mouse causative of a virulence phenotype, several tissues
along the infection pathway from the foot were tested for production of infectious virus.
Tissues included the foot, DRG, spinal cord and brain with the inclusion of \7syn+,
17APst, 17A307a, 17A307aR, 17A480 viruses as controls. Infectious virus was assayed
for these tissues at 2, 3, 5 and 7 days post infection at an initial dose of 104 pfu virus'1
time'1. Each virus, time point and tissue was examined in triplicate.
Since the footpad is the initial site of infection in our model, it was critical to
determine if these mutants were impaired in virion production in this tissue. Upon
analyzing this tissue for plaque production, a significant difference in viral production
was not seen in the feet at any times tested (Figure 3-2). From previous data in our lab,
we know at the doses employed that 2 days post-infection is the peak of infectious virus


19
Table 1-1. Analysis of the 5 LAT deletions on reactivation in the rabbit eye model*1
Recombinant
Positive
rabbits /total
rabbits
Positive
eyes/total eyes
Total positive
swabs/total swabs
17 syn+
5/5 (100%)
8/9 (89%)
24/72 (33%)
17APst
2/8 (25%)
2/16(13%)
5/105 (5%)
17A307b
2/8 (25%)
3/16 (19%)
6/112(5.4%)
17 A307R(Rescue)
4/4(100%)
5/8 (63%)
14/64 (22%)
17A480
8/8 (100%)
12/16 (75%)
27/70 (39%)
17A489
4/5 (80%)
6/10(60%)
29/70(41%)
Reactivation was measured by the level of infectious virus by plaque assay detected
from tear film of infected rabbits. In this model, the rabbit eye is infected with HSV-1
with the virus traveling to the TG and establishing a latent infection. Reactivation is
stimulated by the administration of epinephrine and current to the rabbit eye. Infectious
virus is then detectable at the initial site of infection, the eye.
bIontophoresis was performed once a day for three consecutive days. Eye swabs were
performed for 7 consecutive days.
C17A307 is significantly different from \lsyn+.


32
Ri
U,
Rl Rs Us Rs
Intron(s)
119181 H9502
Pst I
1
Pst I
J
1
1
1
17A480 (Ppmul
1
1
| j
Sty I 321 bp
480 bp
Sty I
119981 120347
I-Sfil)
366 bp^
splice donor
119,463
Figure 2-1. 17A480R construction. The 17A480R recombinant virus was made by
co-transfection of a PCR amplified portion of the parental virus, \lsyn+,
between genomic base pairs 119,181 and 120,347 and genomic 17A480
DNA. The 17A480R recombinant was screened by dot blot
hybridization.


I certify that I have read this study and that in my opinion it conforms to
acceptable standards of scholarly presentation and is fully adequate, in scope and quality,
as a dissertation for the degree of Doctor of Philosophy.
fXL
David C. Bloom, Chair
Assistant Professor of Molecular Genetics
and Microbiology
I certify that I have read this study and that in my opinion it conforms to acceptable
standards of scholarly presentation and is fully adequate, in scope and quality, as a
dissertation for the degree of Doctor of Philosophy.
Rich Condit
Professor of Molecular Genetics and
Microbiology
I certify that I have read this study and that in my opinion it conforms to acceptable
standards of scholarly presentation and is fully adequate, in scope and quality, as a
dissertation for the degree of Doctor of Philosophy.
<8
'U,
cMyH
Sue Moyer
Professor of Molecular Genetics and
Microbiology
I certify that I have read this study and that in my opinion it conforms to acceptable
standards of scholarly presentation and is fully adequate, in scope apdquality, as a
dissertation for the degree of Doctor of Philosophy.
Kevin Ariderson1'
Associate Professor of Physiological
Sciences
This dissertation was submitted to the College of Medicine and to the Graduate
School and was accepted as partial fulfillment of the requirements for the degree of
Doctor of Philosophy.
Dean, College of Medicine
May 2004


39
production in the feet (Jarman et al., 1999). The lack of a difference between 17A307
and 17A480 in comparison to \lsyn+ (parental), 17APst and 17A307R demonstrates that
the mutants do not display a general replication defect in mouse tissue.
Infection in the footpad allows for the virus to enter the nervous system via nerve
termini in the epidermis. From the feet, virus progresses into the nervous system and
virus can be detected in the DRG. In examining the DRG, the 17A307 mutant does
display a reduction in infectious virus levels evident at 3 and 5 days post-infection (d.p.i.)
(Figure 3-3). Interestingly, 17A480 does not demonstrate a restriction at 3 d.p.i. and only
shows a possible reduction at 5 d.p.i. Both of these mutants, however, are restricted in
infectious virus production in the next tissue in the path of infection, the spinal cord.
Results from spinal cord show that both 17A307 and 17A480 have lower viral values in
comparison to \lsyn+ (parental), 17APst, 17A307aR and 17A480R (Figure 3-4). Further
analysis reveals that 17A307 and 17A480 are also lower in abundance in brain tissue
(Figure 3-5). Values shown for these mutants only involve one positive sample for each
of the LAT virulence recombinant viruses, therefore, the brain restriction may be even
greater than depicted in the graph shown. Collectively, the tissue experiments display a
restriction in infectious virus production for 17A307 and 17A480 that is specific for
nervous tissue. These tissue restriction results show that the virulence deficient measured
by LD50 is due to a reduction of 17A307 and 17A480 for infectious virus production in
the nervous system.
Cell Specific Replication Deficiency
The tissue restriction results clearly demonstrate an impairment of infectious virus
production that is specific for nervous tissue. To identify a possible cell specific


16
secondary promoter and apoptosis/neuronal protection findings described above, regions
of the LAT gene neighboring the reactivation critical region may act in the acute
infection of HSV-1. This action may be through a tom-mediated effect from lytic
transcription, or it may be mediated in cis as an enhancer function. An enhancer scenario
is quite possible, since the reactivation function of the LAT gene is hypothesized to
operate in a similar manner (Wagner and Bloom 1997). The small, downstream deletions
of viruses 17A307, 17A307R, 17A480, 17A480R and a double mutant 17APstA480 allow
the determination of virulence properties of the LAT locus without also impairing other
defined regulatory functions of LAT that may mask a full virulence effect. The results
presented in the following chapters put forth a case for two distinct genetic elements
within the LAT gene: one (controlled by the LAP1 or latent promoter) that seems to act
as a facilitator of reactivation; and a second that may encompass the LAP2 promoter that
exerts its influence on virulence during the acute phase of the infection. The data
presented here demonstrating the dramatic reduction in virulence in the mouse following
deletion of a region spanning the 3 end of the 5exon and the first several hundred bases
of the region encoding the LAT intron is the first description of a major virulence
phenotype mapping to the LAT gene. Our results also indicate that this phenotype is
independent of the LAT promoter (LAP1). Finally, as discussed in detail in the last
chapter, we hypothesize that the deletion of these two distinct genetic elements in vivo
results in a phenotype distinct from deletion of either element individually, suggesting
these elements work together in regulating some aspect of acute replication.


34
17A480 17APst
17A480 17APst
Figure 2-3. Dot blot hybridization of second round plaque purification of 17APstA480.
A) The blot at the top of the page was probed with a lacZ probe. B) The
bottom blot was probed with a Pst probe in order to identify 17APstA480
recombinants.


64
ICPO Enhancer
Another possible mechanism for the virulence region of LAT is through
transcriptional regulation of the ICPO promoter. It may not simply function through a
transcriptional permissivity hypothesis as described above but could directly enhance the
expression of ICPO. During the lytic infection, the enhancer encoded in the LAT locus
would increase expression from the ICPO promoter directly by a looping mechanism.
Additionally, I hypothesize this occurs in a neuron-specific manner. In acute infection,
the enhancer would associate with transcription factors present in neurons to promote
expression of ICPO. The mutations introduced into the LAT locus in the 17A307 and
17A480 recombinant impair this enhancer function. ICPO is consequently lower in
neuronal tissue and leads to a general decrease in HSV-1 gene expression. This decrease
causes lower viral production and a milder infection in the mouse model. An enhancer
function involving the LAT locus and neuronal specific factors would explain why the
virulence effects were specific for nervous tissue. Future experiments are aimed at
determining if a secondary promoter is active in the LAT locus and mapping of
subsequent RNA molecules. Additionally, our lab will analyze the ICPO promoter region
for differences in transcription with the virulence mutants, and for possible changes in
transcriptional permissivity.


TABLE OF CONTENTS
Page
ACKNOWLEDGEMENTS iii
LIST OF TABLES vi
LIST OF FIGURES vii
ABSTRACT viii
CHAPTER
1 INTRODUCTION 1
General Characteristics of HSV-1 1
Viral Infections in Human Host 3
Animal Models 5
LAT Mutants and Phenotypes 8
Establishment 9
Reactivation 10
Other Regulatory Regions of LAT 12
Neuronal Survival and Apoptosis 13
2 METHODS 21
LAT Recombinant Viruses 26
17A480R 26
17APstA480 27
Analyses In Vivo and Cell Culture 29
Virulence Determination in Mouse Model 29
Tissue Restriction 30
Time Course Experiments 30
IV


60
(Pemg et al, 1994; Thompson and Sawtell 2001). Examination of these mutants failed to
reveal dramatic virulence phenotypes. These viruses do show latent phenotypes as
described by other mutants that engineered changes into the 5 portion of exon 1 (Bloom
et al., 1994; Pemg et al., 1994). The mutant dLAT2903 is indistinguishable from parental
or its rescue in cell culture replication, comeal replication or p.f.u. production in the TG
of the rabbit (Pemg et al., 2001). Similarly, no replication differences were observed for
17-AH in cell culture, comea and TG (Thompson and Sawtell 2001). The fact that these
recombinants do not display a clear virulence effect in animal models, coupled with the
data shown here for the 17A307 and 17A480 LAT recombinants, suggests that the LAT
locus contains several distinct regulatory regions (Figure 4-1). These regions are
involved in different stages of HSV-1 infection in the mouse model. The recombinant
viruses 17A307 and 17A480 display severe virulence reductions in the mouse footpad
model.
Another interesting phenotype for these mutants is their difference in reactivation
abilities in the epinephrine-induced rabbit eye model. Reactivation is significantly
reduced for 17A307 and, as observed in this report, the mutant also shows decreased
virulence. From the establishment hypothesis of Sawtell and Thompson, it may seem
that 17A307 is simply inhibited in its ability to protect neurons and consequently results
in lower virulence in the acute infection and lower genome levels for the ability to
reactivate. The problem with this interpretation stems from the acute and latent
phenotypes of the 17A480 mutant. This vims does display a virulence phenotype as
observed for 17A307 but is devoid of a reactivation phenotype. Therefore, the virulence
phenotype cannot be explained by a lower amount of DNA seeding the ganglia.


77
Spivack, J. G. and N. W. Fraser, 1988, Expression of herpes simplex virus type 1 latency-
associated transcripts in the trigeminal ganglia of mice during acute infection and
reactivation of latent infection, J Virol 62(5): 1479-85.
Stevens, J. G., 1975, Latent herpes simplex virus and the nervous system, Curr Top
Microbiol Immunol 70: 31-50.
Stevens, J. G., E. K. Wagner, G. B. Devi-Rao, M. L. Cook and L. T. Feldman, 1987,
RNA complementary to a herpesvirus alpha gene mRNA is prominent in latently
infected neurons, Science 235(4792): 1056-9.
Tal-Singer, R., T. M. Lasner, W. Podrzucki, A. Skokotas, J. J. Leary, S. L. Berger and N.
W. Fraser, 1997, Gene expression during reactivation of herpes simplex virus type
1 from latency in the peripheral nervous system is different from that during lytic
infection of tissue cultures, J Virol 71(7): 5268-76.
Thompson, R. L., M. L. Cook, G. B. Devi-Rao, E. K. Wagner and J. G. Stevens, 1986,
Functional and molecular analyses of the avirulent wild-type herpes simplex virus
type 1 strain KOS, J Virol 58(1): 203-11.
Thompson, R. L. and N. M. Sawtell, 1997, The herpes simplex virus type 1 latency-
associated transcript gene regulates the establishment of latency, J Virol 71(7):
5432-40.
Thompson, R. L. and N. M. Sawtell, 2000, Replication of herpes simplex virus type 1
within trigeminal ganglia is required for high frequency but not high viral genome
copy number latency, J Virol 74(2): 965-74.
Thompson, R. L. and N. M. Sawtell, 2001, Herpes simplex virus type 1 latency-
associated transcript gene promotes neuronal survival, J Virol 75(14): 6660-75.
Tognon, M., D. Furlong, A. J. Conley and B. Roizman, 1981, Molecular genetics of
herpes simplex virus. V. Characterization of a mutant defective in ability to form
plaques at low temperatures and in a viral fraction which prevents accumulation of
coreless capsids at nuclear pores late in infection, J Virol 40(3): 870-80.
Wagner, E. K. and D. C. Bloom, 1997, Experimental investigation of herpes simplex
virus latency, Clin Microbiol Rev 10(3): 419-43.
Wagner, E. K., W. M. Flanagan, G. Devi-Rao, Y. F. Zhang, J. M. Hill, K. P. Anderson
and J. G. Stevens, 1988, The herpes simplex virus latency-associated transcript is
spliced during the latent phase of infection, J Virol 62(12): 4577-85.
Wechsler, S. L., A. B. Nesbum, R. Watson, S. Slanina and H. Ghiasi, 1988, Fine
mapping of the major latency-related RNA of herpes simplex virus type 1 in
humans, J Gen Virol 69 (Pt 12): 3101-6.


10
Although some LAT mutations do alter the establishment of latency, these effects
are very low in magnitude. Also, most LAT mutants do not demonstrate measurable
establishment phenotypes and are not evident in both the mouse and the rabbit (Bloom et
al., 1994; Bloom et al., 1996; Jarman et al, 2002; Pemg et al., 1996). Specifically, the
establishment differences that have been reported are seen to occur only in the mouse,
and at most reflect 2-4 fold less viral DNA in the ganglia (Thompson and Sawtell
2001). Current understanding cannot rule out the action of the LAT on the establishment
of latency. It is possible that LAT does act in establishment and the lower levels of
establishment that have been observed may be due to an effect of LAT on down
regulating viral mRNA production in neurons (Garber et al., 1997).
Reactivation
The involvement of the LAT in any of the stages of HSV-1 latency has been shown
most conclusively for the reactivation phenotype in the epinephrine-induced rabbit eye
model. Initially, a HSV-1 mutant (X10-13) containing a large deletion encompassing the
LAT promoter and downstream region of the gene displayed a low level of reactivation in
the rabbit eye model (Hill et al., 1990). The reactivation phenotype was restored by use
of an EcoRI J+K subgenomic clone encompassing the LAT locus (Hill et al., 1990). A
smaller, engineered deletion of the core promoter (17APst) of LAT displayed a severe
reduction in reactivation (Bloom et al., 1994) and another group supported this finding
with a similar but independently constructed mutant (Pemg et al., 1994). In addition to
deletions that included the LAT promoter, it was shown that only a limited region of the
LAT primary transcript is required for efficient induced reactivation. Bloom et al.
(Bloom et al., 1996) showed that insertions of polyadenylation signals between the cap


24
allowed for easy visibility of plaques for picking with a Pasteur pipette. The plaques
were picked and each individual plaque was transferred to its own well of a 96 well plate
containing 200 pi of media per well. This plate was then frozen and thawed twice (-
80C/37C) and a 50 pi volume was used per well to infect a 96 well plate that was
previously seeded with RS cells. Infection of this plate was allowed to proceed for 2-3
days (until 100% CPE) and was then frozen at -80C.
The recombinant viruses were screened by dot blot hybridization after each round
of plaque purification to determine the proper mutation has been engineered. In this
approach each 96 well plate that was infected with individual isolates per well was
thawed at 37C prior to the transfer for hybridization. On the bottom piece of the dot blot
apparatus, 3 layers of Whatman paper were applied followed by a section of Hybond
nitrocellulose membrane. The Whatman paper and the membrane were saturated with
solution C [(2X SSPE (0.36M sodium chloride, 0.02M sodium monophosphate, 0.002M
ethylene diaminotetraacetate)]. The dot blot apparatus was then sealed tightly and a
vacuum was applied. At this point, 50 pi of inoculum from each well of the 96 well plate
was transferred through the holes in the top of the dot blot apparatus and onto the
membrane. Each well in the dot blot manifold was subsequently washed with 200 pi of
fresh solution A (1.5M sodium chloride, 0.1N sodium hydroxide) followed by an equal
application of solution B (0.2M Tris, pH 7.5) and solution C. The nitrocellulose
membrane was then removed and baked in a vacuum oven for 1-2 hours at 80 C. The
DNA was then covalently attached to the membrane and ready for labeling with
radioactive 32P [a-dCTP] probe.


6
virulent viral strain, or a virulence sensitive mouse strain, acute infection will spread to
the central nervous system where death of the animal may occur by encephalitis. The
mouse footpad model is especially useful for acute virulence experiments due to efficient
infection of epidermis and progression into the peripheral and central nervous systems. It
allows the study of both neuroinvasion and neurovirulence of HSV-1 strains and mutants
(Izumi et al., 1988; Izumi et al., 1990; Thompson et al., 1986). Neuroinvasion is the
ability of a virus to enter into and travel through the nervous system and is measured by
peripheral inoculation of the virus. Neurovirulence measures the ability of the virus to
replicate within neurons and is assessed by the lethality of viruses and their ability to
induce encephalitis.
The mouse footpad model is also utilized for latent analysis of HSV-1, since the
virus efficiently establishes a latent infection in DRG. Reactivation can be studied in the
mouse model by the physical removal of DRG and incubation in cell culture media in a
process known as explant cultivation. Infectious virus is induced to emerge from these
sensory neurons and by placement upon a cell monolayer in culture the virus can be
readily detected (explant co-cultivation). Another mouse model for the study of HSV
latency and reactivation is the hyperthermic stress model. This model involves acute
infection of the cornea. After addition of virus on the cornea, HSV-1 then travels via
sensory axons to the trigeminal ganglion (TG) where a latent infection is established in
sensory neurons. Once a latent infection is established, latent virus can be reactivated by
placing the live infected mouse in a hyperthermic water bath set at 43C for 10 minutes.
Approximately 22 hours later, the TG are removed, sectioned and assayed for the
presence of virus by immunohistochemical methods (Sawtell and Thompson 1992). This


4
reactivating neurons produce very low levels of infectious virus with high levels of
replication occurring in other cell types of the nervous system, or exclusively in the
epithelia. Lesions in the periphery form at a rate and with cytopathology that coincides
with rapid virus replication in cell culture (Stevens et al., 1975; Whitley et al., 1993).
In a suitable host, the immune system is an important regulator of HSV-1 severity.
During an HSV-1 infection in peripheral tissue, CD4+ cells function to activate and
recruit macrophages (Nash et al., 1993). CD4+ cells have also been shown to serve as
cytotoxic lymphocytes (CTLs) in culture. Important immunological players in the
nervous system are significantly different than other infected regions of the host during a
HSV-1 infection. CD8+ cells and IgG function to limit viral spread and severity of
infection (Kapoor et al., 1982; Simmons et al., 1987). It is important to note that infected
neurons are not targeted by CTLs and that their action in the nervous tissue appears to be
limited to non-neuronal cells. Although the involvement of the immune system functions
to reduce the severity of acute infection, it has been difficult to determine how the stages
of latency are affected by immune regulators. In many ways, sensory neurons are
immune privileged cells. With regard to regulation of the latent infection, most attention
has been directed away from the immune system and toward viral gene regulation and
expression.
In a latent infection of neurons, the latency-associated transcript is the only viral
RNA produced at readily detectable levels (Figure 1-1). The latency-associated transcript
(LAT) gene is positioned in the long repeat regions of the viral genome and is thus
diploid. During latency, two poly(A)- LAT products can be observed and have molecular
sizes of 2.0 and 1.5 kb (Spivack et al., 1998a; Spivack et al., 1998b; Wagner et al., 1988;


Copyright 2004
by
Lee William Gary


LIST OF FIGURES
Figure page
1-1. Schematic of the LAT gene and the position of 17APst, 17A307, 17A480 and
17A489 recombinant viruses 17
1-2. Large LAT deletions used for virulence indications 18
2-1. 17A480R construction 32
2-2. Dot blot hybridization of second round plaque purification of 17A480R 33
2-3. Dot blot hybridization of second round plaque purification of 17APstA480 34
3-1. Reduced corneal pathology of 17A307 in the rabbit eye model 43
3-2. Infectious virus recovered from mouse feet at 2 days post-infection 45
3-3. Virus production in dorsal root ganglia at 3 and 5 days post-infection 46
3-4. Virus production in spinal cord at 5 and 7 days post-infection 47
3-5. Virus production in brain at 7 days post-infection 48
3-6. 17A307 and 17A480 multi-step time course in PC-12 cells 49
3-7. 17A480R multi-step time course in PC-12 cells 50
3-8. Multi-step time course in rabbit skin cells 51
3-9. Single step time course in PC-12 cells 52
4-1. Separate genetic regions of the LAT locus 65
Vll


68
Drolet, B. S., G. C. Pemg, J. Cohen, S. M. Slanina, A. Yukht, A. B. Nesbum and S. L.
Wechsler, 1998, The region of the herpes simplex virus type 1 LAT gene involved
in spontaneous reactivation does not encode a functional protein, Virology 242(1)*
221-32.
Drolet, B. S., G. C. Pemg, R. J. Villosis, S. M. Slanina, A. B. Nesbum and S. L.
Wechsler, 1999, Expression of the first 811 nucleotides of the herpes simplex vims
type 1 latency-associated transcript (LAT) partially restores wild-type spontaneous
reactivation to a LAT-null mutant, Virology 253(1): 96-106.
Ecob-Prince, M. S., C. M. Preston, F. J. Rixon, K. Hassan and P. G. Kennedy, 1993,
Neurons containing latency-associated transcripts are numerous and widespread in
dorsal root ganglia following footpad inoculation of mice with herpes simplex vims
type 1 mutant ini 814, J Gen Virol 74( Pt 6): 985-94.
Ecob-Prince, M. S., K. Hassan, M. T. Denheen and C. M. Preston, 1995, Expression of
beta-galactosidase in neurons of dorsal root ganglia which are latently infected with
herpes simplex vims type 1, J Gen Virol 76( Pt 6): 1527-32.
Efstathiou, S., A. C. Minson, H. J. Field, J. R. Anderson and P. Wildy, 1986, Detection of
herpes simplex virus-specific DNA sequences in latently infected mice and in
humans, J Virol 57(2): 446-55.
Everett, R. D., 1984, A detailed analysis of an HSV-1 early promoter: sequences involved
in trans-activation by viral immediate-early gene products are not early-gene
specific, Nucleic Acids Res 12(7): 3037-56.
Everett, R. D., 1984, Trans activation of transcription by herpes vims products:
requirement for two HSV-1 immediate-early polypeptides for maximum activity,
Embo J 3(13): 3135-41.
Everett, R. D., 1987, A detailed mutational analysis of Vmwl 10, a trans-acting
transcriptional activator encoded by herpes simplex vims type 1, Embo J 6(7):
2069-76.
Farrell, M. J., T. P. Margolis, W. A. Gomes and L. T. Feldman, 1994, Effect of the
transcription start region of the herpes simplex vims type 1 latency-associated
transcript promoter on expression of productively infected neurons in vivo, J Virol
68(9): 5337-43.
Forrester, A., H. Farrell, G. Wilkinson, J. Kaye, N. Davis-Poynter and T. Minson, 1992,
Construction and properties of a mutant of herpes simplex vims type 1 with
glycoprotein H coding sequences deleted, J Virol 66(1): 341-8.
Gelman, I. H. and S. Silverstein, 1985, Identification of immediate early genes from
herpes simplex vims that transactivate the vims thymidine kinase gene, Proc Natl
Acad Sci U S A 82(16): 5265-9.


70
Hill, J. M., B. M. Gebhardt, R. Wen, A. M. Bouterie, H. W. Thompson, R. J.
O'Callaghan, W. P. Halford and H. E. Kaufinan, 1996, Quantitation of herpes
simplex virus type 1 DNA and latency-associated transcripts in rabbit trigeminal
ganglia demonstrates a stable reservoir of viral nucleic acids during latency J Virol
70(5): 3137-41.
Hill, J. M., H. H. Garza, Jr., Y. H. Su, R. Meegalla, L. A. Hanna, J. M. Loutsch, H. W.
Thompson, E. D. Vamell, D. C. Bloom and T. M. Block, 1997, A 437-base-pair
deletion at the beginning of the latency-associated transcript promoter significantly
reduced adrenergically induced herpes simplex virus type 1 ocular reactivation in
latently infected rabbits, J Virol 71(9): 6555-9.
Honess, R. W., D. J. Purifoy, D. Young, R. Gopal, N. Cammack and P. O'Hare, 1984,
Single mutations at many sites within the DNA polymerase locus of herpes simplex
viruses can confer hypersensitivity to aphidicolin and resistance to phosphonoacetic
acid, J Gen Virol 65 (Pt 1): 1-17.
Honess, R. W. and B. Roizman, 1974, Regulation of herpesvirus macromolecular
synthesis. I. Cascade regulation of the synthesis of three groups of viral proteins, J
Virol 14(1): 8-19.
Honess, R. W. and B. Roizman, 1975, Regulation of herpesvirus macromolecular
synthesis: sequential transition of polypeptide synthesis requires functional viral
polypeptides, Proc Natl Acad Sci U S A 72(4): 1276-80.
Huszar, D. and S. Bacchetti, 1981, Partial purification and characterization of the
ribonucleotide reductase induced by herpes simplex virus infection of mammalian
cells, J Virol 37(2): 580-8.
Inman, M., L. Lovato, A. Doster and C. Jones, 2001, A mutation in the latency-related
gene of bovine herpesvirus 1 leads to impaired ocular shedding in acutely infected
calves, J Virol 75(18): 8507-15.
Inman, M., G. C. Pemg, G. Henderson, H. Ghiasi, A. B. Nesbum, S. L. Wechsler and C.
Jones, 2001, Region of herpes simplex virus type 1 latency-associated transcript
sufficient for wild-type spontaneous reactivation promotes cell survival in tissue
culture, J Virol 75(8): 3636-46.
Izumi, K. M. and J. G. Stevens, 1988, Two thymidine kinase deficient herpes simplex
viruses exhibit unexpected virulence properties, Microb Pathog 4(2): 145-53.
Izumi, K. M. and J. G. Stevens, 1990, Molecular and biological characterization of a
herpes simplex virus type 1 (HSV-1) neuroinvasiveness gene, J Exp Med 172(2).
487-96.
Jamieson, A. T., G. A. Gentry and J. H. Subak-Sharpe, 1974, Induction of both thymidine
and deoxycytidine kinase activity by herpes viruses, J Gen Virol 24(3). 465-80.


78
Wechsler, S. L., A. B. Nesbum, R. Watson, S. M. Slanina and H. Ghiasi, 1988, Fine
mapping of the latency-related gene of herpes simplex virus type 1: alternative
splicing produces distinct latency-related RNAs containing open reading frames, J
Virol 62(11): 4051-8.
Wechsler, S. L., A. B. Nesbum, J. Zwaagstra and H. Ghiasi, 1989, Sequence of the
latency-related gene of herpes simplex virus type 1, Virology 168(1): 168-72.
Whitley, R. J., E. R. Kem, S. Chatteijee, J. Chou and B. Roizman, 1993, Replication,
establishment of latency, and induced reactivation of herpes simplex vims gamma
1 34.5 deletion mutants in rodent models, J Clin Invest 91(6): 2837-43.
Zabolotny, J. M., C. Krummenacher and N. W. Fraser, 1997, The herpes simplex vims
type 1 2.0-kilobase latency-associated transcript is a stable intron which branches at
a guanosine, J Virol 71(6): 4199-208.
Zwaagstra, J., H. Ghiasi, A. B. Nesbum and S. L. Wechsler, 1989, In vitro promoter
activity associated with the latency-associated transcript gene of herpes simplex
vims type 1, J Gen Virol 70 (Pt 8): 2163-9.
Zwaagstra, J. C., H. Ghiasi, S. M. Slanina, A. B. Nesbum, S. C. Wheatley, K. Lillycrop,
J. Wood, D. S. Latchman, K. Patel and S. L. Wechsler, 1990, Activity of herpes
simplex vims type 1 latency-associated transcript (LAT) promoter in neuron-
derived cells: evidence for neuron specificity and for a large LAT transcript, J Virol
64(10): 5019-28.
Zwaagstra, J. C., H. Ghiasi, A. B. Nesbum and S. L. Wechsler, 1991, Identification of a
major regulatory sequence in the latency associated transcript (LAT) promoter of
herpes simplex vims type 1 (HSV-1), Virology 182(1): 287-97.


27
120,347, respectively, in the 17syn+ genome and are shown schematically (Figure 2-1).
The amplified DNA was co-transfected with full length 17A480 DNA into RS cells. At
3-4 days post transfection, the cells were lysed by 2 rapid freeze/thaw (-80C/37C)
cycles and plated onto confluent 60 mm2 dishes of RS cells at varying dilutions of 10'3 to
10~8. These dishes were overlayed with a solution containing 0.8% SeaKem Agarose and
IX 5% calf serum MEM for 3 days. At this time, cells were stained with neutral red and
plaques were observed by absence of stain. Approximately 300 well-isolated plaques
were picked and tested by dot blot hybridization for the presence of the restored wild-
type sequence at the Ppmul-Sfil location (Figure 2-2). The HSV-1 viruses 17syn+ and
17A480 were included on the blots to serve as positive and negative controls,
respectively. Several positive plaques were detected after the first round of plaque
purification. Five of these positive samples were diluted and infected onto confluent 60
mm dishes of RS cells. After the third round of purification, all plaques were positive.
To guarantee the purity of the 17A480R plaques, a couple of plaques were carried out for
a fourth round of purification which again yielded complete positives.
17APstA480
Another recombinant virus, 17APstA480, was engineered to complete the analysis
of the genetic basis of the virulence phenotype within the LAT locus in the mouse model.
As the name implies, this mutant contains mutations in both the latent promoter of the
LAT (APst) coupled with a mutation in the 5 portion of the LAT intron (A480). This
mutant was constructed by performing a co-infection of 17APst with 17A480 at an m.o.i.
of 3.0 for each virus in a T-75 flask of confluent rabbit skin cells. Plaque purified
isolates were tested by dot blot hybridization. In each round of plaque purification, each


22
the pellet was resuspended in 10 mL of hypotonic lysis buffer (10 mM Tris pH 8.0, 10
mM EDTA, 0.5% NP-40 and 0.25% deoxycholic acid). This subsequent suspension was
vortexed, incubated briefly on ice and centrifuged at 3000 x g for 10 minutes at 4C to
pellet the nuclei from the fraction containing the viral DNA. After centrifugation, the
supernatant was removed and treated with a protein degradation solution (1% sodium
dodecyl sulfate and 1 mg/mL Proteinase K) at 50C for 1 hour. An additional 1 mg of
Proteinase K was added and the incubation was repeated an addition hour at 37C to
further digest the protein in the sample. After this treatment, the solution was extracted
with sequentially with equal volumes of phenol, phenol/chloroform and chloroform. To
precipitate the full length viral DNA, the solution was treated with a 0.1 volume of 3M
sodium acetate and carefully layered with 25 mL of cold 95% ethanol. The DNA was
precipitated at the aqueous/ethanol mixing interface with moderate rotation by hand.
Once an appropriate amount of genomic DNA was visible, it was removed by spooling,
washed briefly with 70% ethanol, dried, resuspended in 100-500 pi of sterile water. The
DNA was quantified spectrophotometrically and the genomic quality of the DNA was
assessed by electrophoresis on an agarose gel. Full length viral DNA was then ready for
use in transfections to produce recombinant HSV-1 mutants.
Transfections utilized varying ratios of genomic DNA with a fixed amount of
plasmid, or PCR generated DNA where applicable. For this procedure, 60 mm2 dishes of
rabbit skins cells at 50% confluency were serum starved (1.5% calf serum, MEM)
overnight at 31.5C in 5% C02. The viral genomic DNA was used in a range of of 1, 2,
4, 8,16 and 32 pg in addition to a 2 pg amount of recombining DNA per dish. Each
transfection mix was prepared in a final volume of 225 pi of TNE buffer (10 mM Tris pH


pfu/g
45
1.00E+08
1.00E+07
1.00E+06
1.00E+05
1.00E+04
1.00E+03
1.00E+02
1.00E+01
l.OOE+OO
17syn+
17dPst
17d307
Viruses
17d307R
17d480
Figure 3-2. Infectious virus recovered from mouse feet at 2 days post-infection. Feet
were homogenized and tested for infectious virus by plaque assay on RS cells.
Values are recorded as pfu/g tissue.


65
17A307
17A489
Region of mutation
Reactivation
Virulence
Figure 4-1. Separate genetic regions of the LAT locus. This is a representation of the
virulence data presented in this manuscript along with known reactivation data
for the LAT region. The combination of the reactivation and virulence
phenotypes identified for LAT recombinant viruses enabled the modeling of
separate regulatory regions of the LAT locus as shown in this figure.


2
1987; Longnecker et al., 1987; Roop et al., 1993). Once viral particles have entered the
cell, the nucleocapsid is transported to the nucleus to deposit viral DNA (Batterson et al.,
1983; Tognan et al., 1981). Along with the viral genome is the VP16 protein, which
functions in enhancing viral immediate-early gene transcription (Campbell et al., 1984;
Heine et al., 1974; Spear et al., 1972). HSV-1 encodes five immediate-early genes that
are expressed prior to viral protein production: ICPO, ICP4, ICP22, ICP27 and ICP47
(Mackem et al., 1982; Mackem et al., 1982; Post et al., 1981). The ICPO and ICP4
proteins initiate and regulate viral transcription (Everett et al., 1984; Everett et al., 1984;
Everett et al., 1987; Gelman et al., 1985; Gelman et al., 1986; Gelman et al., 1987;
OHare et al., 1985). ICP27 is also active in gene expression but acts at the level of RNA
transport from the nucleus into the cytoplasm (Sandri-Goldman et al., 1994). In order for
HSV-1 to replicate in neurons, which are non-dividing cells, the virus encodes many of
its own enzymes for DNA replication (Caradonna et al., 1981; Honess et al., 1974;
Honess et al., 1975; Huszer et al., 1981; Preston et al., 1984). These products are
generally included among the early genes of HSV-1.
Seven early genes are required for viral replication in all cell types and conditions:
DNA polymerase, DNA binding proteins, ORI binding protein and the helicase/primer
trimer (Chartrand et al., 1980; Coen et al., 1984; Hay et al., 1976; Honess et al., 1984).
A few other key early genes that include thymidine kinase, ribonucleotide reductase and
dUTPase are encoded and allow for replication in the neuronal environment (Caradonna
et al., 1981; Honess et al., 1974; Honess et al., 1975; Huszer et al., 1981; Preston et al.,
1984). Late genes begin to be expressed during DNA replication and are divided into 2
subclasses: leaky-late and strict late (Costa et al., 1985; Dennis et al., 1984; Everett et al.,


31
1978; Rubenstein et al, 1983). For the multistep growth curves, cells were infected at a
multiplicity of infection of 0.001 and infections were terminated and quantified by plaque
titration at hours 8, 24, 48, 72 and 96 hours post-infection. Each time point virus'1 was
performed in triplicate. The single step growth curves were carried out in a similar
manner but with a higher multiplicity of infection (3.0). The time points were also
different and included 0, 3, 6,12 and 18 hours post-infection. For this experiment,
samples were also tested in triplicate with titrations being performed on RS cells in the
presence of human IgG. Resulting plaques were counted and infectious virus levels were
thus quantitated.
The experimental techniques described in this chapter were used to test the HSV-1
LAT mutants 17APst, 17A307,17A307a, 17A307R, 17A480,17A480R, RHA-6 and
17APstA480 along with parental control, \lsyn+ in the mouse model. These experiments
were aimed at the determination of the role of the 3 portion of LAT exon 1, and to
determine if a phenotype can be attributed to the 5 intron. The next chapter is dedicated
to the report of virulence, tissue restriction and cell specific infectious virus reduction
phenotypes obtained for these mutants.


ACKNOWLEDGMENTS
I would like to thank my parents, Bill and Barbara, for their endless support and
encouragement. I also appreciate the support of Jia Liu, Karen Johnstone, Jason Liem,
Chuck Peek and many other friends at the University of Florida. My advisor, David
Bloom, made this work possible and I greatly appreciate his expertise and patience.


pfu/g
47
A,
1.00E+08
1.00E+07
1.00E+06
1.00E+05
1.00E+04
1.00E+03
1.00E+02
1.00E+01
l.OOE+OO
17syn+
17dPst
17d307
17d307R
17d480
Viruses
B.
Viruses
Figure 3-4. Virus production in spinal cord at 5 and 7 days post-infection. A) Spinal
cord infectious virus levels at 5 dpi (P=0.002). B) Spinal cord at 7 dpi
(P=0.0030).


LIST OF REFERENCES
Ahmed, M., M. Lock, C. G. Miller and N. W. Fraser, 2002, Regions of the herpes
simplex virus type 1 latency-associated transcript that protect cells from apoptosis
in vitro and protect neuronal cells in vivo, J Virol 76(2): 717-29.
Baines, J. D., P. L. Ward, G. Campadelli-Fiume and B. Roizman, 1991, The UL20 gene
of herpes simplex virus 1 encodes a function necessary for viral egress, J Virol
65(12): 6414-24.
Batterson, W. and B. Roizman, 1983, Characterization of the herpes simplex virion-
associated factor responsible for the induction of alpha genes, J Virol 46(2): 371-7.
Becker, Y., H. Dym and I. Sarov, 1968, Herpes simplex virus DNA, Virology 36(2): 184-
92.
Berman, E. J. and J. M. Hill, 1985, Spontaneous ocular shedding of HSV-1 in latently
infected rabbits, Invest Ophthalmol Vis Sci 26(4): 587-90.
Bhattacharjee, P. S., R. K. Tran, M. E. Myles, K. Maruyama, A. Mallakin, D. C. Bloom
and J. M. Hill, 2003, Overlapping subdeletions within a 348-bp in the 5' exon of the
LAT region that facilitates epinephrine-induced reactivation of HSV-1 in the rabbit
ocular model do not further define a functional element, Virology 312(1): 151-8.
Bloom, D. C., G. B. Devi-Rao, J. M. Hill, J. G. Stevens and E. K. Wagner, 1994,
Molecular analysis of herpes simplex virus type 1 during epinephrine-induced
reactivation of latently infected rabbits in vivo, J Virol 68(3): 1283-92.
Bloom, D. C., N. T. Maidment, A. Tan, V. B. Dissette, L. T. Feldman and J. G. Stevens,
1995, Long-term expression of a reporter gene from latent herpes simplex virus in
the rat hippocampus, Brain Res Mol Brain Res 31(1-2): 48-60,
Bloom, D. C., J. M. Hill, G. Devi-Rao, E. K. Wagner, L. T. Feldman and J. G. Stevens,
1996, A 348-base-pair region in the latency-associated transcript facilitates herpes
simplex virus type 1 reactivation, J Virol 70(4): 2449-59.
Bloom, D. C., J. G. Stevens, J. M. Hill and R. K. Tran, 1997, Mutagenesis of a cAMP
response element within the latency-associated transcript promoter of HSV-1
reduces adrenergic reactivation, Virology 236(1): 202-7.
Bloom, D. C. and R. G. Jarman, 1998, Generation and use of recombinant reporter
viruses for study of herpes simplex virus infections in vivo, Methods 16(1): 117-25.
Bloom, D. C., 2004, Hsv Lat and Neuronal Survival, Int Rev Immunol 23(1-2): 187-198.
66


13
of the LAT gene may help to explain early events in latency or the reactivation from a
latent infection.
Neuronal Survival and Apoptosis
The region responsible for the reactivation phenotype of LAT has been well
mapped but the LAT gene may contain other regulatory motifs that control establishment
or functions in the acute infection. LAT may also play a role in neuronal survival and
apoptosis (for review see Bloom 2004). Portions of the LAT gene have been shown to
inhibit neuronal cell death and may function through suppression of receptor-mediated
(caspase-8) and mitochondrial-mediated (caspase-9) pathways. Results from in vivo
studies demonstrate that a large deletion of the promoter extending into the LAT intron
are reduced in establishment levels and cause a significant loss of sensory neurons (Pemg
et al., 2000; Thompson and Sawtell 1997). Transient transfection of IMR-90 and CV-1
cells with a plasmid containing the 3 region of the LAT exon and most of the intron was
able to protect the majority of cells from ceramide, or fumonisin Bi-induced apoptosis
(Pemg et al., 2000; Thompson et al., 2000). Expression of the bovine herpesvirus 1 LAT
(Pemg et al., 2002) or portions of the HSV-1 LAT gene inhibit chemically induced
apoptosis in cell culture (Pemg et al., 2002).
The anti-apoptotic effects of large portions of the LAT expressed by transfection
are also cell specific. In culture, the LAT is unable to protect 293, or COS-7 cells from
apoptosis (Inman et al., 2001). It is clear that the LAT does induce apoptosis in certain
cell lines using transient transfection assays with high multiplicities of infection and high
expression levels (Pemg et al., 2000). These results indicate that the LAT may play a
role in apoptosis but it has not been conclusively shown to occur in vivo. It was reported
that LAT(-) viruses induce extensive apoptosis in rabbit TG (Pemg et al., 2000) and that


IDENTIFICATION OF A VIRULENCE FUNCTION IN HERPES SIMPLEX VIRUS-
TYPE I MAPPING TO THE LATENCY ASSOCIATED TRANSCRIPT LOCUS
By
LEE WILLIAM GARY
\
A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY
UNIVERSITY OF FLORIDA
2004


pfu/60 mm dish
52
17syn+
17cl307
17d307R
Hours Post-Infection
Figure 3-9. Single step time course in PC-12 cells. 17A307 was compared to 17A307R
along with llsyn^ in a single step growth curve utilizing an initial MOI of
3.0.


Probes were created using the portion of DNA that identified the presence of the
proper mutation in the recombinant virus. To make the probe, 25 ng of DNA was diluted
to a total of 45 pi in TE (lOmM Tris ImM EDTA, pH 8.0) and boiled in a water bath for
5 minutes. The DNA was then quickly transferred to ice and incubated for 5 minutes.
After this period, the DNA solution was added to a reaction tube from the Rediprime II
Random Prime Labelling System (Amersham Biosciences). A 50 pCi amount of 32P [a-
dCTP] was also added and the reaction was performed at 37C for 10 minutes. The
reaction was quenched with the introduction of 5 pi of 0.2M EDTA. This probe was then
boiled for 5 minutes, placed on ice for 5 minutes and ready for use. Prior to the addition
of the probe to the hybridization, the blot itself was pre-hybridized at 63 C for 1 hour in a
shaking water bath to reduce nonspecific DNA labeling. After the pre-hybridization step,
the probe was added and the blot hybridized overnight at 63C. The next day, the blot
was washed twice with solution 1 (0.3M sodium chloride, 0.06M Tris-HCl pH 8.0,
0.002M EDTA) at 25C for 5 minutes, twice with solution 2 (0.3M sodium chloride,
0.06M Tris-HCl pH 8.0, 0.002M EDTA, 4% SDS) at 63C for 15 minutes and finally
twice with solution 3 (0.03M sodium chloride, 0.006M Tris-HCl pH 8.0, 0.0002M
EDTA) at 25 C for 15 minutes. The blot was then dried briefly and covered with plastic
wrap before being exposed 8-12 hours on a Phosphor screen. Hybridization was then
visualized using a STORM phosphoimager (Molecular Dynamics, Sunnyvale, CA) in
order to identify the presence of the proper recombinant virus. This concludes the
general aspects of transfection and hybridization approaches used. The specific details of
the 17A480R and the 17APstA480 construction are described next.


CHAPTER 2
METHODS
Technical details of the experiments used to generate the data presented in this
work are discussed in this chapter. The experiments were aimed at the generation of viral
recombinants and use of these mutants for characterization pertaining to virulence and
latency of HSV-1 in cell culture and animal models. This characterization involved
assessing virulence in the mouse model along with supportive replication data obtained
from cell culture assays. The examination of reactivation from and establishment of
latency were carried out at the LSU Eye Center by Drs. Jim Hill and Jeannette Loutsch,
and these results are summarized in chapter 1 (Table 1-1 and 1-2). In the determination
of virulence, the methods of creating viral recombinants by transfection, growth of
mutants in culture and infection and viral quantification from the animal models are
presented here in full.
Viral recombinants were constructed by use of homologous recombination in cell
culture. Recombinants were produced by either co-transfection of HSV-1 virion DNA
with a PCR fragment for recombining into full length genomic DNA (i.e. 17A480R), or
by co-infection with two HSV-1 LAT mutants (i.e. 17APstA480). The full length viral
genomic DNA was prepared in cell culture. A group of 8-10 T-150 flasks were infected
with the HSV-1 parental, or mutant strain of choice, at a multiplicity of infection (MOI)
of 0.01. Infections were maintained and monitored for 3 days until the cells were
completely detached. At this point, the suspension was removed and pelleted in a high
speed centrifuge at 16,000 x g for 40 minutes at 4C. The supernatant was removed and
21


pfu/60 mm2 dish
51
1.00E+09
1.00E+08
1.00E+07
1.00E+06
1.00E+05
1.00E+04
1.00E+03
1.00E+02
1.00E+01
1.00E+00
Hours Post-Infection
Figure 3-8. Multi-step time course in rabbit skin cells. This is a comparison of infectious
virus production of 17A307, 17A307a and 17A307aR on RS cells. All 3
viruses produce high levels of infectious virus on RS cells.


29
Analyses In Vivo and Cell Culture
The LAT mutants 17APst, 17A307,17A307a, 17A307R, 17A480, 17A480R and
17APstA480 were tested for virulence phenotypes in the mouse model. After determining
the phenotypes of these mutants in vivo, they were also characterized using a cell culture
system. The cell culture experiments involved two different cell lines, PC-12 cells and
RS cells. These cell types and their experimental usage is described later in this chapter.
Virulence Determination in Mouse Model
The virulence determination of the engineered LAT mutants was performed by
LD50/pfu analysis. For these experiments, female 4-6 week old out-bred Swiss Webster
mice were used. Virulence was measured by footpad infection and by direct intracranial
inoculation. For the footpad infection, each footpad of anesthetized mice was injected 4
hours pre-infection with 50 pi 10% (w/v) sodium chloride. At the appropriate time, mice
were then sedated with 0.010-0.020 mL of a cocktail containing xylazine (7.5-11.5
mg/kg), acetamine (2.5-3.75 mg/kg) and ketamine (30-45 mg/kg). The keratinized layer
of the footpad was then removed with mild abrasion using an emery board, and viral
dilutions (in MEM with 5% CS) were applied onto the ventral footpad surface in volumes
of 50 pi. The mice were then placed back into their cages in an inverted manner to allow
virus absorption and monitored until they regained consciousness and became active.
Infected mice were then observed twice daily until hind limb paralysis ensued in which
case they were euthanized, or until they died from encephalitic HSV-1 infection. After
two weeks, mice were scored for lethality and LDso/pfu values were assessed by the Reed
and Muench method (Reed and Muench 1938). Surviving mice were assessed for the
presence of latent virus by PCR.


LIST OF TABLES
Table page
1-1. Analysis of the 5 LAT deletions on reactivation in the rabbit eye model 19
1-2. The ratio of HSV to actin DNA in rabbit trigeminal ganglia latently infected with
17A307 and 17A307R mutants ofHSV-1 20
3-1. LD50 values 44
vi


58
Two possible explanations for the decreased virulence of 17A307 and 17A480 in
the mouse model are either a global restriction of these mutants to replicate in murine
tissue, or a tissue specific replication phenotype in neurons. In testing both epidermal
and nervous tissue infected in the mouse footpad model and the successive path of
infection in the nervous system, it was determined that the virulence phenotype is the
caused by a tissue specific restriction of the downstream LAT mutants. After footpad
infection, 17A307 and 17A480 are indistinguishable in infectious vims levels in
comparison to 17A307R, \lsyn+ and 17APst proving that these mutations do not have a
general replication restriction in vivo. These LAT mutants were equal in p.f.u.
production at 2 days post-infection, which has been shown previously in our lab to be the
peak time of HSV-1 infection in the mouse footpad model (Jarman et al., 1999). After
infection of the foot, vims then enters the peripheral nervous system by entering
innervating nerve termini in the epidermis. Vims then travels via the sciatic nerve to the
dorsal root ganglia. In examing DRG for vims production, 17A307 was decreased in
infectious vims load at 3 days post-infection. Interestingly, 17A480 did not display a
detectable reduction in infectious levels at 3 days but did have a significant restriction by
5 days post-infection. 17A307 was restricted at this time point as well for dorsal root
ganglia. The vimlence effects of 17A307 and 17A480 in the mouse are due to tissue
specific restriction of these mutants in nervous tissue.
Cell Culture Phenotype
A nervous tissue restriction was clearly observed in the mouse model but it was
uncertain whether this effect was caused by a neuronal cell type, or from supporting cells
in ganglia. To test for a cell specific replication impairment, 17A307 and 17A480


pfu/60 mm dish
50
1.00E+07
1.00E+06
1.00E+05
1.00E+04
1.00E+03
1.00E+02
1.00E+01
1.00E+00
8 24 48 72
17syn+
17dPst
17d307
17d307R
17d480
17d480R
Hours Post-Infection
Figure 3-7. 17A480R multi-step time course in PC-12 cells. The LAT recombinants
17A307 and 17A480 were tested by multi-step growth curve in the same
experiment along with 17A307R and 17A480R with the addition of \lsyn+
(parental) and 17APst (promoter deletion). 17A307 was statistically different
from 17A307R (P=0.02 at 24 hpi, P=0.0069 at 48 hpi, P=0.0010 at 72 hpi) and
17A480 differed significantly from 17A480R (P=0.0364 at 24 hpi, P=0.0149
at 48 hpi, P=0.002 at 72 hpi).


Table 3-1. LD50 values*3
LD50/pfu Values for LAT Mutants
44
Route of Infection
Virus
Footpad
Intracranial
17syn+
3.25 x 102
6.30 x 101
17APst
5.11 x 102
9.30 x 101
17A307
>7.0 x 104
>1.17 x 103
17A307a
>7.0 x 104
9.63 x 102
17A307aR
3.17 x 102
9.10 x 101
17A480
>4.0 x 104
17A489
1.10 x 102
RHA-6
3.67 x 102
*This is a modified LD50 ana
ysis. Mice were euthanized once they demonstrated an
infection of the central nervous system and a consequent impairment of motor function.
aThe values were recorded as a dose sufficient to induce lethality for half the mice in a
group. Two routes of infection were used in this experiment: footpad and intracranial.


xml version 1.0 encoding UTF-8
REPORT xmlns http:www.fcla.edudlsmddaitss xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.fcla.edudlsmddaitssdaitssReport.xsd
INGEST IEID E3JLPOSWD_VJYDM4 INGEST_TIME 2014-11-07T19:30:35Z PACKAGE AA00024446_00001
AGREEMENT_INFO ACCOUNT UF PROJECT UFDC
FILES


30
Mice were also tested for virulence phenotypes by direct intracranial infection with
the appointed LAT mutants. These mice were sedated in the same manner as the footpad
experiments. Infection was performed by direct administration of virus into the left
cerebral hemisphere in volumes of 20 pi of inoculum by use of a 1.0 mL syringe and a 27
gauge needle. These mice were also observed until conscious and active and were
checked twice daily for signs of nervous system impairment, or encephalitic death.
Tissue Restriction
The relative ability of the LAT recombinants to replicate in the feet, DRG, spinal
cord and brain was assessed following footpad inoculation. This analysis was performed
as a time course and for each time point, tissue and virus, samples were examined in
replicates of 3. The time points tested included 2, 3, 5 and 7 days post footpad
inoculation. At each of these times, all 4 of the designated tissues were removed and
homogenized in MEM containing 5% calf serum. The homogenates were diluted and
titered on confluent 24 well plates of RS cells in the presence of technical grade human
IgG to prevent viral spread through the monolayer. Plaques were counted at 2-3 days
post-infection and viral levels were calculated for each virus and tissue for the 4 time
points.
Time Course Experiments
Mutants 17APst, 17A307,17A307a, 17A307R, 17A480 and 17A480R were tested
for infectious virus production in cell culture along with parental virus \lsyn+.
Infectious virus levels were assessed in RS and PC-12 cells (rat pheochromocytoma cells)
in both multi-step and single step growth curves. The PC-12 cells are developmentally
linked to neurons and represent a specific cell type of the nervous system (Pizer et al.,



PAGE 1

,'(17,),&$7,21 2) $ 9,58/(1&( )81&7,21 ,1 +(53(6 6,03/(; 9,586 7<3( 0$33,1* 72 7+( /$7(1&< $662&,$7(' 75$16&5,37 /2&86 %\ /(( :,//,$0 *$5< ? $ ',66(57$7,21 35(6(17(' 72 7+( *5$'8$7( 6&+22/ 2) 7+( 81,9(56,7< 2) )/25,'$ ,1 3$57,$/ )8/),//0(17 2) 7+( 5(48,5(0(176 )25 7+( '(*5(( 2) '2&725 2) 3+,/2623+< 81,9(56,7< 2) )/25,'$

PAGE 2

&RS\ULJKW E\ /HH :LOOLDP *DU\

PAGE 3

$&.12:/('*0(176 ZRXOG OLNH WR WKDQN P\ SDUHQWV %LOO DQG %DUEDUD IRU WKHLU HQGOHVV VXSSRUW DQG HQFRXUDJHPHQW DOVR DSSUHFLDWH WKH VXSSRUW RI -LD /LX .DUHQ -RKQVWRQH -DVRQ /LHP &KXFN 3HHN DQG PDQ\ RWKHU IULHQGV DW WKH 8QLYHUVLW\ RI )ORULGD 0\ DGYLVRU 'DYLG %ORRP PDGH WKLV ZRUN SRVVLEOH DQG JUHDWO\ DSSUHFLDWH KLV H[SHUWLVH DQG SDWLHQFH

PAGE 4

7$%/( 2) &217(176 3DJH $&.12:/('*(0(176 LLL /,67 2) 7$%/(6 YL /,67 2) ),*85(6 YLL $%675$&7 YLLL &+$37(5 ,1752'8&7,21 *HQHUDO &KDUDFWHULVWLFV RI +69 9LUDO ,QIHFWLRQV LQ +XPDQ +RVW $QLPDO 0RGHOV /$7 0XWDQWV DQG 3KHQRW\SHV (VWDEOLVKPHQW 5HDFWLYDWLRQ 2WKHU 5HJXODWRU\ 5HJLRQV RI /$7 1HXURQDO 6XUYLYDO DQG $SRSWRVLV 0(7+2'6 /$7 5HFRPELQDQW 9LUXVHV $5 $3VW$ $QDO\VHV ,Q 9LYR DQG &HOO &XOWXUH 9LUXOHQFH 'HWHUPLQDWLRQ LQ 0RXVH 0RGHO 7LVVXH 5HVWULFWLRQ 7LPH &RXUVH ([SHULPHQWV ,9

PAGE 5

5(68/76 /'RSIX (YDOXDWLRQ 7LVVXH 5HVWULFWLRQ &HOO 6SHFLILF 5HSOLFDWLRQ 'HILFLHQF\ $GGLWLRQDO /$7 5HFRPELQDQW 9LUXVHV $5 $3VW$ ',6&866,21 9LUXOHQFH 3KHQRW\SH DQG 1HUYRXV 6\VWHP 5HVWULFWLRQ &HOO &XOWXUH 3KHQRW\SH /$7 0XWDQWV DQG 0XOWLSOH 5HJXODWRU\ )XQFWLRQV 0HFKDQLVP /\WLF 3URPRWHU LQ WKH /$7 5HJLRQ 7UDQVFULSWLRQDO 3HUPLVVLYLW\ ,&32 (QKDQFHU /,67 2) 5()(5(1&(6 %,2*5$3+,&$/ 6.(7&+ Y

PAGE 6

/,67 2) 7$%/(6 7DEOH SDJH $QDO\VLV RI WKH f /$7 GHOHWLRQV RQ UHDFWLYDWLRQ LQ WKH UDEELW H\H PRGHO 7KH UDWLR RI +69 WR DFWLQ '1$ LQ UDEELW WULJHPLQDO JDQJOLD ODWHQWO\ LQIHFWHG ZLWK $ DQG $5 PXWDQWV RI+69 /' YDOXHV YL

PAGE 7

/,67 2) ),*85(6 )LJXUH SDJH 6FKHPDWLF RI WKH /$7 JHQH DQG WKH SRVLWLRQ RI $3VW $ $ DQG $ UHFRPELQDQW YLUXVHV /DUJH /$7 GHOHWLRQV XVHG IRU YLUXOHQFH LQGLFDWLRQV $5 FRQVWUXFWLRQ 'RW EORW K\EULGL]DWLRQ RI VHFRQG URXQG SODTXH SXULILFDWLRQ RI $5 'RW EORW K\EULGL]DWLRQ RI VHFRQG URXQG SODTXH SXULILFDWLRQ RI $3VW$ 5HGXFHG FRUQHDO SDWKRORJ\ RI $ LQ WKH UDEELW H\H PRGHO ,QIHFWLRXV YLUXV UHFRYHUHG IURP PRXVH IHHW DW GD\V SRVWLQIHFWLRQ 9LUXV SURGXFWLRQ LQ GRUVDO URRW JDQJOLD DW DQG GD\V SRVWLQIHFWLRQ 9LUXV SURGXFWLRQ LQ VSLQDO FRUG DW DQG GD\V SRVWLQIHFWLRQ 9LUXV SURGXFWLRQ LQ EUDLQ DW GD\V SRVWLQIHFWLRQ $ DQG $ PXOWLVWHS WLPH FRXUVH LQ 3& FHOOV $5 PXOWLVWHS WLPH FRXUVH LQ 3& FHOOV 0XOWLVWHS WLPH FRXUVH LQ UDEELW VNLQ FHOOV 6LQJOH VWHS WLPH FRXUVH LQ 3& FHOOV 6HSDUDWH JHQHWLF UHJLRQV RI WKH /$7 ORFXV 9OO

PAGE 8

$EVWUDFW RI 'LVVHUWDWLRQ 3UHVHQWHG WR WKH *UDGXDWH 6FKRRO RI WKH 8QLYHUVLW\ RI )ORULGD LQ 3DUWLDO )XOILOOPHQW RI WKH 5HTXLUHPHQWV IRU WKH 'HJUHH RI 'RFWRU RI 3KLORVRSK\ ,'(17,),&$7,21 2) $ 9,58/(1&( )81&7,21 ,1 +(53(6 6,03/(; 9,586 7<3( 0$33,1* 72 7+( /$7(1&< $662&,$7(' 75$16&5,37 /2&86 %\ /HH :LOOLDP *DU\ 0D\ &KDLU 'DYLG & %ORRP 0DMRU 'HSDUWPHQW 0ROHFXODU *HQHWLFV DQG 0LFURELRORJ\ 7ZR +HUSHV 6LPSOH[ 9LUXV W\SH +69f VWUDLQ ?OV\Q UHFRPELQDQWV $ DQG $f SRVVHVVLQJ FRQWLJXRXV GHOHWLRQV VSDQQLQJ WKH f UHJLRQ RI WKH /DWHQF\ $VVRFLDWHG 7UDQVFULSW /$7f H[RQ DQG WKH f SRUWLRQ RI WKH /$7 LQWURQ ZHUH DQDO\VHG IRU YLUXOHQFH LQ PRXVH IRRWSDG ISf PRGHO :KLOH WKH ?OV\Q SDUHQWf DQG $3VW /$7 SURPRWHU PXWDQWf \LHOGHG /'RSIX YDOXHV RI [ DQG [ UHVSHFWLYHO\ $ DQG $ KDG /'VRSIX YDOXHV RI [ $ VHFRQG LQGHSHQGHQW UHFRPELQDQW DQG D UHVFXH $D DQG $D5f ZHUH FRQVWUXFWHG DQG \LHOGHG IS /' YDOXHV RI [ DQG [ UHVSHFWLYHO\ FRQILUPLQJ WKDW GHOHWLRQV ZLWKLQ WKLV UHJLRQ RI WKH /$7 ORFXV UHVXOWHG LQ D GUDPDWLF UHGXFWLRQ LQ YLUXOHQFH 5HSOLFDWLRQ RI WKH UHFRPELQDQWV ZDV LQGLVWLQJXLVKDEOH IURP ZLOGW\SH ?OV\Q DQG UHVFXH YLUXVHV ZKHQ WHVWHG RQ UDEELW VNLQ FHOOV EXW GHPRQVWUDWH IROG UHGXFWLRQ LQ YLUDO \LHOGV RQ 3& FHOOV DV PHDVXUHG E\ PXOWLVWHS JURZWK FXUYHV 6LJQLILFDQWO\ WKH DWWHQXDWLRQ LQ YLUXOHQFH GLVSOD\HG E\ $ DQG $ LV QRW REVHUYHG IRU WKH /$7 SURPRWHU PXWDQW $3VW YLQ

PAGE 9

VXJJHVWLQJ WKDW WKH SKHQRW\SH LV LQGHSHQGHQW RI WKH /$7 ODWHQW SURPRWHU /$3f ,Q DGGLWLRQ $ SRVVHVVHV D ZLOGW\SH UHDFWLYDWLRQ LQ WKH UDEELW H\H PRGHO VXJJHVWLQJ WKDW WKH YLUXOHQFH DQG UHDFWLYDWLRQ SKHQRW\SHV DUH JHQHWLFDOO\ VHSDUDEOH ,;

PAGE 10

&+$37(5 ,1752'8&7,21 *HQHUDO &KDUDFWHULVWLFV RI +69 +HUSHV 6LPSOH[ 9LUXVW\SH +69f LV D ZLGHO\ SUHYDOHQW KXPDQ SDWKRJHQ WKDW LV QXFOHDU UHSOLFDWLQJ HQYHORSHG SDUWLFOH ZLWKLQ DQ LFRVDKHGUDO FDSVLG FRQWDLQLQJ DQ DPRUSKRXV WHJXPHQW 5RL]PDQ HW DO f 7KH JHQRPH RI +69 LV D GRXEOH VWUDQGHG '1$ PROHFXOH RI NE HQFRGLQJ PRUH WKDQ SURWHLQ SURGXFWV %HFNHU HW DO .LHII HW DO 0F*HRFK HW DO 0F*HRFK HW DO f 5HJLRQV RI WKH JHQRPH DUH ULFK LQ UHSHWLWLYH VHTXHQFH ZKHUHDV RWKHU DUHDV FRQWDLQ PRVWO\ XQLTXH VHTXHQFH 7KH +69 JHQRPH DOVR KDV D KLJK *& FRQWHQW LQ FRPSDULVRQ WR RWKHU YLUXVHV %HFNHU HW DO .LHII HW DO 0F*HRFK HW DO f +69 LV DQ DOSKDKHUSHVYLUXV DQG DV VXFK LV QHXURWURSLF ZLWK UDSLG UHSOLFDWLRQ FDSDELOLWLHV DQG H[KLELWV D EURDG KRVW DQG FHOO UDQJH -DPLHVRQ HW DO f :KLOH +69 LV DEOH WR LQIHFW D ZLGH VSHFWUXP RI GLIIHUHQW PDPPDOLDQ FHOO W\SHV WKH DELOLW\ WR UHSOLFDWH DQG HVWDEOLVK D ODWHQW LQIHFWLRQ ZLWKLQ QHXURQV LV FHQWUDO WR +69OfV ELRORJ\ 'RWWL HW DO 'RWWL HW DO f %HFDXVH PRVW QHXURQV GLYLGH LQIUHTXHQWO\ DQG FRQVHTXHQWO\ UDUHO\ H[SUHVV SURWHLQV QHFHVVDU\ IRU '1$ UHSOLFDWLRQ +69 HQFRGHV VSHFLDOL]HG IXQFWLRQV IRU H[LVWLQJ ZLWKLQ WKH KLJKO\ GLIIHUHQWLDWHG FHOOV &DUDGRQQD HW DO +RQHVV HW DO +RQHVV HW DO +XV]HU HW DO 3UHVWRQ HW DO f $WWDFKPHQW DQG HQWU\ RI LQIHFWLRXV YLUDO SDUWLFOHV LQYROYH LQWHUDFWLRQ EHWZHHQ VHYHUDO FHOOXODU PHPEUDQH JO\FRSURWHLQV DQG UHFHSWRUV %DLQHV HW DO &DL HW DO )RUUHVWHU HW DO -DYLHU HW DO -RKQVRQ HW DO /RQJQHFNHU HW DO

PAGE 11

/RQJQHFNHU HW DO 5RRS HW DO f 2QFH YLUDO SDUWLFOHV KDYH HQWHUHG WKH FHOO WKH QXFOHRFDSVLG LV WUDQVSRUWHG WR WKH QXFOHXV WR GHSRVLW YLUDO '1$ %DWWHUVRQ HW DO 7RJQDQ HW DO f $ORQJ ZLWK WKH YLUDO JHQRPH LV WKH 93 SURWHLQ ZKLFK IXQFWLRQV LQ HQKDQFLQJ YLUDO LPPHGLDWHHDUO\ JHQH WUDQVFULSWLRQ &DPSEHOO HW DO +HLQH HW DO 6SHDU HW DO f +69 HQFRGHV ILYH LPPHGLDWHHDUO\ JHQHV WKDW DUH H[SUHVVHG SULRU WR YLUDO SURWHLQ SURGXFWLRQ ,&32 ,&3 ,&3 ,&3 DQG ,&3 0DFNHP HW DO 0DFNHP HW DO 3RVW HW DO f 7KH ,&32 DQG ,&3 SURWHLQV LQLWLDWH DQG UHJXODWH YLUDO WUDQVFULSWLRQ (YHUHWW HW DO (YHUHWW HW DO (YHUHWW HW DO *HOPDQ HW DO *HOPDQ HW DO *HOPDQ HW DO 2f+DUH HW DO f ,&3 LV DOVR DFWLYH LQ JHQH H[SUHVVLRQ EXW DFWV DW WKH OHYHO RI 51$ WUDQVSRUW IURP WKH QXFOHXV LQWR WKH F\WRSODVP 6DQGUL*ROGPDQ HW DO f ,Q RUGHU IRU +69 WR UHSOLFDWH LQ QHXURQV ZKLFK DUH QRQGLYLGLQJ FHOOV WKH YLUXV HQFRGHV PDQ\ RI LWV RZQ HQ]\PHV IRU '1$ UHSOLFDWLRQ &DUDGRQQD HW DO +RQHVV HW DO +RQHVV HW DO +XV]HU HW DO 3UHVWRQ HW DO f 7KHVH SURGXFWV DUH JHQHUDOO\ LQFOXGHG DPRQJ WKH HDUO\ JHQHV RI +69 6HYHQ HDUO\ JHQHV DUH UHTXLUHG IRU YLUDO UHSOLFDWLRQ LQ DOO FHOO W\SHV DQG FRQGLWLRQV '1$ SRO\PHUDVH '1$ ELQGLQJ SURWHLQV 25, ELQGLQJ SURWHLQ DQG WKH KHOLFDVHSULPHU WULPHU &KDUWUDQG HW DO &RHQ HW DO +D\ HW DO +RQHVV HW DO f $ IHZ RWKHU NH\ HDUO\ JHQHV WKDW LQFOXGH WK\PLGLQH NLQDVH ULERQXFOHRWLGH UHGXFWDVH DQG G873DVH DUH HQFRGHG DQG DOORZ IRU UHSOLFDWLRQ LQ WKH QHXURQDO HQYLURQPHQW &DUDGRQQD HW DO +RQHVV HW DO +RQHVV HW DO +XV]HU HW DO 3UHVWRQ HW DO f /DWH JHQHV EHJLQ WR EH H[SUHVVHG GXULQJ '1$ UHSOLFDWLRQ DQG DUH GLYLGHG LQWR VXEFODVVHV OHDN\ODWH DQG VWULFW ODWH &RVWD HW DO 'HQQLV HW DO (YHUHWW HW DO

PAGE 12

*X]RZVNL HW DO f 7KH OHDN\ODWH JHQH SURGXFWV FDQ EH WUDQVFULEHG SULRU WR WKH FRQFOXVLRQ RI UHSOLFDWLRQ EXW VWULFW ODWH JHQHV DUH RQO\ WUDQVFULEHG DIWHU UHSOLFDWLRQ KDV FRPSOHWHG 5HJDUGOHVV RI WKHVH GLIIHUHQFHV ODWH JHQHV DUH PDLQO\ WKH VWUXFWXUDO SURGXFWV RI +69 DQG LQFOXGH JO\FRSURWHLQV DQG FDSVLG SURWHLQV 9LUDO ,QIHFWLRQV LQ WKH +XPDQ +RVW 7KH PDMRULW\ RI WKH 86 DQG :RUOG SRSXODWLRQ LV LQIHFWHG ZLWK +69 ,Q PRVW FDVHV WKH YLUXV GRHV QRW LQGXFH D VHYHUH DFXWH LQIHFWLRQ EXW IRU D VPDOO SHUFHQWDJH LW FDQ FDXVH EOLQGQHVV RU HQFHSKDOLWLF GHDWK ,QGLYLGXDOV LQIHFWHG ZLWK +69 KDUERU D OLIHORQJ ODWHQW LQIHFWLRQ LQ VHQVRU\ DQG DXWRQRPLF QHXURQV ZLWK RFFDVLRQDO UHFXUUHQFHV RI DQ DFXWH LQIHFWLRQ DW WKH VLWH RI LQLWLDO LQIHFWLRQ /DWHQW LQIHFWLRQ RI QHXURQV UHVXOWV LQ WKH UHSOLFDWLYH VLOHQFLQJ RI WKH +69 JHQRPH )RU WKH HVWDEOLVKPHQW RI ODWHQF\ DIWHU HQWU\ RI YLUXV D GUDPDWLF UHSUHVVLRQ RI JHQH H[SUHVVLRQ PXVW RFFXU 7UDQVFULSWLRQ RI PRVW +69 JHQHV PXVW EH VLOHQFHG RU UHVWULFWHG WR YHU\ ORZ OHYHOV ZLWK IHZ WUDQVFULSWV EHLQJ H[SUHVVHG RU GHWHFWDEOH 'XULQJ WKH PDLQWHQDQFH VWDJH RI ODWHQF\ WKH JHQRPH LV SUHVHQW DV DQ HSLVRPH ZLWKLQ WKH QXFOHXV RI WKH FHOO 0HOOHULFN HW DO 5RFN HW DO 5RFN HW DO f 0DLQWHQDQFH RI +69 ODWHQF\ LQYROYHV WKH SRWHQWLDO IRU ODWHQW JHQRPHV WR UHDFWLYDWH DQG SURGXFH LQIHFWLRXV YLUXV XSRQ DSSURSULDWH VWLPXOXV 5HDFWLYDWLRQ IURP ODWHQF\ LV EHOLHYHG WR EH D UDUH HYHQW DQG UHVXOWV LQ WKH UHDSSHDUDQFH RI LQIHFWLRXV YLUXV IURP VHQVRU\ JDQJOLD WKDW WUDYHOV EDFN WR WKH LQLWLDO VLWH RI LQIHFWLRQ LQ WKH HSLWKHOLD &OLQLFDO UHDFWLYDWLRQ UHVXOWV LQ D OHVLRQ ZLWK GHWHFWDEOH LQIHFWLRXV YLUXV 5HDFWLYDWLRQ DOVR KDV EHHQ GHWHUPLQHG WR RFFXU VXEFOLQLFDOO\ ZLWK +69 JHQRPHV GHWHFWHG E\ 3&5 LQ WKH HSLWKHOLD ,W LV XQFOHDU ZKHWKHU UHDFWLYDWLRQ LV O\WLF WR QHXURQV EXW WKH PXOWLSOH RFFXUUHQFHV RI UHDFWLYDWLRQ LQ WKH KXPDQ SRSXODWLRQ PDNHV QHXURQDO GHVWUXFWLRQ XSRQ UHDFWLYDWLRQ XQOLNHO\ &RUH\ HW DO f ,W LV PRUH SODXVLEOH WKDW

PAGE 13

UHDFWLYDWLQJ QHXURQV SURGXFH YHU\ ORZ OHYHOV RI LQIHFWLRXV YLUXV ZLWK KLJK OHYHOV RI UHSOLFDWLRQ RFFXUULQJ LQ RWKHU FHOO W\SHV RI WKH QHUYRXV V\VWHP RU H[FOXVLYHO\ LQ WKH HSLWKHOLD /HVLRQV LQ WKH SHULSKHU\ IRUP DW D UDWH DQG ZLWK F\WRSDWKRORJ\ WKDW FRLQFLGHV ZLWK UDSLG YLUXV UHSOLFDWLRQ LQ FHOO FXOWXUH 6WHYHQV HW DO :KLWOH\ HW DO f ,Q D VXLWDEOH KRVW WKH LPPXQH V\VWHP LV DQ LPSRUWDQW UHJXODWRU RI +69 VHYHULW\ 'XULQJ DQ +69 LQIHFWLRQ LQ SHULSKHUDO WLVVXH &' FHOOV IXQFWLRQ WR DFWLYDWH DQG UHFUXLW PDFURSKDJHV 1DVK HW DO f &' FHOOV KDYH DOVR EHHQ VKRZQ WR VHUYH DV F\WRWR[LF O\PSKRF\WHV &7/Vf LQ FXOWXUH ,PSRUWDQW LPPXQRORJLFDO SOD\HUV LQ WKH QHUYRXV V\VWHP DUH VLJQLILFDQWO\ GLIIHUHQW WKDQ RWKHU LQIHFWHG UHJLRQV RI WKH KRVW GXULQJ D +69 LQIHFWLRQ &' FHOOV DQG ,J* IXQFWLRQ WR OLPLW YLUDO VSUHDG DQG VHYHULW\ RI LQIHFWLRQ .DSRRU HW DO 6LPPRQV HW DO f ,W LV LPSRUWDQW WR QRWH WKDW LQIHFWHG QHXURQV DUH QRW WDUJHWHG E\ &7/V DQG WKDW WKHLU DFWLRQ LQ WKH QHUYRXV WLVVXH DSSHDUV WR EH OLPLWHG WR QRQQHXURQDO FHOOV $OWKRXJK WKH LQYROYHPHQW RI WKH LPPXQH V\VWHP IXQFWLRQV WR UHGXFH WKH VHYHULW\ RI DFXWH LQIHFWLRQ LW KDV EHHQ GLIILFXOW WR GHWHUPLQH KRZ WKH VWDJHV RI ODWHQF\ DUH DIIHFWHG E\ LPPXQH UHJXODWRUV ,Q PDQ\ ZD\V VHQVRU\ QHXURQV DUH LPPXQH SULYLOHJHG FHOOV :LWK UHJDUG WR UHJXODWLRQ RI WKH ODWHQW LQIHFWLRQ PRVW DWWHQWLRQ KDV EHHQ GLUHFWHG DZD\ IURP WKH LPPXQH V\VWHP DQG WRZDUG YLUDO JHQH UHJXODWLRQ DQG H[SUHVVLRQ ,Q D ODWHQW LQIHFWLRQ RI QHXURQV WKH ODWHQF\DVVRFLDWHG WUDQVFULSW LV WKH RQO\ YLUDO 51$ SURGXFHG DW UHDGLO\ GHWHFWDEOH OHYHOV )LJXUH f 7KH ODWHQF\DVVRFLDWHG WUDQVFULSW /$7f JHQH LV SRVLWLRQHG LQ WKH ORQJ UHSHDW UHJLRQV RI WKH YLUDO JHQRPH DQG LV WKXV GLSORLG 'XULQJ ODWHQF\ WZR SRO\$f /$7 SURGXFWV FDQ EH REVHUYHG DQG KDYH PROHFXODU VL]HV RI DQG NE 6SLYDFN HW DO D 6SLYDFN HW DO E :DJQHU HW DO

PAGE 14

:HFKVOHU HW DK f 7KHVH SURGXFWV KDYH EHHQ VKRZQ WR EH QXFOHDUORFDOL]HG VWDEOH LQWURQV )DUUHOO HW DK =DERORWQ\ HW DO f DQG DUH VSOLFHG IURP DQ NE SULPDU\ WUDQVFULSW )DUUHOO HW DO f 6WDELOLW\ RI WKH LQWURQV LV K\SRWKHVL]HG WR EH GXH WR QRQFRQVHQVXV $ RU EUDQFK SRLQW VHTXHQFH DQG LQKLELWV GHEUDQFKLQJ RI WKH ODULDW LQ YLYR 5RGDKO HW DK 7DKO6LQJHU HW DK =DERORWQ\ HW DK f 7KH NE LQWURQ LV RQO\ REVHUYHG LQ QHXURQV DQG LV EHOLHYHG WR EH DQ DOWHUQDWLYH VSOLFH SURGXFW RI WKH NE LQWURQ =DERORWQ\ HW DK f 7KH /$7 SURPRWHU LWVHOI FRQWDLQV VHYHUDO QHXURQVSHFLILF H[SUHVVLRQ HOHPHQWV )DUUHOO HW DK 0RUURZ HW DK =ZDDJVWUD HW DK f FRQVLVWHQW ZLWK LWV KLJKOHYHO RI H[SUHVVLRQ LQ WKHVH FHOOV 'REVRQ HW DK f )XUWKHU LQ DQLPDO PRGHOV WKH /$7 SURPRWHU GHPRQVWUDWHV JUHDWHU DFWLYLW\ LQ QHXURQV DQG LV VSHFLILFDOO\ PRUH DFWLYH LQ QHXURQV QRW H[SUHVVLQJ DFXWH DQWLJHQV 0DUJROLV HW DK f 6LQFH WKH /$7 LV WKH RQO\ YLUDO WUDQVFULSW DEXQGDQWO\ WUDQVFULEHG GXULQJ ODWHQF\ LWV UROH LQ WKH HVWDEOLVKPHQW PDLQWHQDQFH DQG UHDFWLYDWLRQ IURP ODWHQF\ LQ WKH PDPPDOLDQ KRVW KDV EHHQ VRXJKW %HFDXVH ODWHQF\ FDQ RQO\ EH HVWDEOLVKHG LQ YLYR WKH XVH RI DQLPDO PRGHOV LV UHTXLUHG $QLPDO 0RGHOV 6HYHUDO DQLPDO PRGHOV DUH XVHG LQ +69 UHVHDUFK WKDW PLPLF WKH DFXWH DQG ODWHQW LQIHFWLRQV RFFXUULQJ LQ WKH KXPDQ SRSXODWLRQ 7KH PRXVH IRRWSDG PRGHO DOORZV WKH VWXG\ RI ERWK DFXWH DQG ODWHQW LQIHFWLRQV ,Q WKLV PRGHO WKH HSLGHUPLV RI WKH IRRWSDG LV LQIHFWHG ZKLFK DOORZV DFXWH UHSOLFDWLRQ LQ WKLV WLVVXH ,QIHFWLRXV YLUXV HQWHUV WKH QHUYRXV V\VWHP E\ LQILOWUDWLRQ RI QHUYH WHUPLQL ORFDWHG LQ WKH HSLGHUPLV 9LUXV WKHQ WUDYHOV E\ IDVW D[RQDO WUDQVSRUW LQWR GRUVDO URRW JDQJOLD '5*f ,Q WKH VHQVRU\ QHXURQV RI WKH '5* WKH YLUXV SURJUHVVHV GRZQ RQH RI WZR SDWKV f DFXWH UHSOLFDWLRQ DQG YLUXV SURGXFWLRQ PD\ HQVXH RU f JHQRPHV DUH VLOHQFHG DQG ODWHQF\ LV HVWDEOLVKHG :LWK D KLJK YLUDO GRVH KLJKO\

PAGE 15

YLUXOHQW YLUDO VWUDLQ RU D YLUXOHQFH VHQVLWLYH PRXVH VWUDLQ DFXWH LQIHFWLRQ ZLOO VSUHDG WR WKH FHQWUDO QHUYRXV V\VWHP ZKHUH GHDWK RI WKH DQLPDO PD\ RFFXU E\ HQFHSKDOLWLV 7KH PRXVH IRRWSDG PRGHO LV HVSHFLDOO\ XVHIXO IRU DFXWH YLUXOHQFH H[SHULPHQWV GXH WR HIILFLHQW LQIHFWLRQ RI HSLGHUPLV DQG SURJUHVVLRQ LQWR WKH SHULSKHUDO DQG FHQWUDO QHUYRXV V\VWHPV ,W DOORZV WKH VWXG\ RI ERWK QHXURLQYDVLRQ DQG QHXURYLUXOHQFH RI +69 VWUDLQV DQG PXWDQWV ,]XPL HW DO ,]XPL HW DO 7KRPSVRQ HW DO f 1HXURLQYDVLRQ LV WKH DELOLW\ RI D YLUXV WR HQWHU LQWR DQG WUDYHO WKURXJK WKH QHUYRXV V\VWHP DQG LV PHDVXUHG E\ SHULSKHUDO LQRFXODWLRQ RI WKH YLUXV 1HXURYLUXOHQFH PHDVXUHV WKH DELOLW\ RI WKH YLUXV WR UHSOLFDWH ZLWKLQ QHXURQV DQG LV DVVHVVHG E\ WKH OHWKDOLW\ RI YLUXVHV DQG WKHLU DELOLW\ WR LQGXFH HQFHSKDOLWLV 7KH PRXVH IRRWSDG PRGHO LV DOVR XWLOL]HG IRU ODWHQW DQDO\VLV RI +69 VLQFH WKH YLUXV HIILFLHQWO\ HVWDEOLVKHV D ODWHQW LQIHFWLRQ LQ '5* 5HDFWLYDWLRQ FDQ EH VWXGLHG LQ WKH PRXVH PRGHO E\ WKH SK\VLFDO UHPRYDO RI '5* DQG LQFXEDWLRQ LQ FHOO FXOWXUH PHGLD LQ D SURFHVV NQRZQ DV H[SODQW FXOWLYDWLRQ ,QIHFWLRXV YLUXV LV LQGXFHG WR HPHUJH IURP WKHVH VHQVRU\ QHXURQV DQG E\ SODFHPHQW XSRQ D FHOO PRQROD\HU LQ FXOWXUH WKH YLUXV FDQ EH UHDGLO\ GHWHFWHG H[SODQW FRFXOWLYDWLRQf $QRWKHU PRXVH PRGHO IRU WKH VWXG\ RI +69 ODWHQF\ DQG UHDFWLYDWLRQ LV WKH K\SHUWKHUPLF VWUHVV PRGHO 7KLV PRGHO LQYROYHV DFXWH LQIHFWLRQ RI WKH FRUQHD $IWHU DGGLWLRQ RI YLUXV RQ WKH FRUQHD +69 WKHQ WUDYHOV YLD VHQVRU\ D[RQV WR WKH WULJHPLQDO JDQJOLRQ 7*f ZKHUH D ODWHQW LQIHFWLRQ LV HVWDEOLVKHG LQ VHQVRU\ QHXURQV 2QFH D ODWHQW LQIHFWLRQ LV HVWDEOLVKHG ODWHQW YLUXV FDQ EH UHDFWLYDWHG E\ SODFLQJ WKH OLYH LQIHFWHG PRXVH LQ D K\SHUWKHUPLF ZDWHU EDWK VHW DW r& IRU PLQXWHV $SSUR[LPDWHO\ KRXUV ODWHU WKH 7* DUH UHPRYHG VHFWLRQHG DQG DVVD\HG IRU WKH SUHVHQFH RI YLUXV E\ LPPXQRKLVWRFKHPLFDO PHWKRGV 6DZWHOO DQG 7KRPSVRQ f 7KLV

PAGE 16

DSSURDFK DQG FRFXOWLYDWLRQ GRHV QRW DGHTXDWHO\ VXEVWLWXWH IRU FOLQLFDO UHDFWLYDWLRQ VLQFH YLUXV GHWHFWLRQ LQ QHUYRXV WLVVXH LV YHU\ GLIIHUHQW IURP YLUDO UHFRYHU\ LQ WKH SHULSKHU\ WKDW RFFXUV LQ WUXH UHDFWLYDWLRQ 7KH PRXVH PRGHOV KDYH EHHQ XVHIXO LQ WKDW WKH\ KDYH LGHQWLILHG VHYHUDO DVSHFWV RI WKH ODWHQW LQIHFWLRQ LQ YLYR LGHQWLILFDWLRQ RI WKH QHXURQ DV WKH VLWH RI ODWHQF\ XQGHUVWDQGLQJ RI D[RQDO WUDQVSRUW RI YLUXV WKURXJK WKH VFLDWLF QHUYH WKH DELOLW\ RI QRQUHSOLFDWLQJ YLUXVHV WR HVWDEOLVK ODWHQW LQIHFWLRQV DQG FKDUDFWHUL]DWLRQ RI WUDQVFULSWV H[SUHVVHG GXULQJ WKH VWDJHV RI ODWHQF\ 'REVRQ HW DO .ULVWHQVVRQ HW DO .ZRQ HW DO 0F/HQQDQ HW DO 6WHYHQV HW DO :DJQHU HW DO f $OWKRXJK WKH PRXVH PRGHOV DOORZ IRU WKH DQDO\VLV RI +69 ODWHQF\ WKH EHVW DQLPDO PRGHO ZRXOG EH RQH WKDW DOORZV UHDFWLYDWLRQ WR RFFXU VSRQWDQHRXVO\ EXW DOVR DOORZV LQGXFWLRQ RI UHDFWLYDWLRQ ZLWK SURSHU VWUHVV VWLPXOXV $OVR DQ LGHDO PRGHO ZRXOG UHVXOW LQ WKH SURGXFWLRQ RI DFXWH OHVLRQV DW WKH SHULSKHU\ ZLWK WKH DSSHDUDQFH RI GHWHFWDEOH LQIHFWLRXV YLUXV 7KH PRXVH PRGHOV UHTXLUH WKH SK\VLFDO UHPRYDO RI JDQJOLD WR GHWHFW LQIHFWLRXV YLUXV /DWHQW LQIHFWLRQ DQG UHDFWLYDWLRQ FDQ DOVR EH LQGXFHG LQ WKH 7* RI UDEELWV XSRQ FRUQHDO LQIHFWLRQ 1HVEXP HW DO f )URP WKLV GLVFRYHU\ WKH VSRQWDQHRXV DQG LQGXFLEOH UDEELW H\H PRGHOV ZHUH GHYHORSHG DQG IXQFWLRQ DV VXSHULRU PRGHOV IRU WKH VWXG\ RI UHDFWLYDWLRQ VLQFH WKH\ DOORZ IRU WKH GHWHFWLRQ RI YLUXV LQ WKH H\H DIWHU UHDFWLYDWLRQ IURP WKH UDEELW 7* 7KH VSRQWDQHRXV PRGHO LQYROYHV WKH GHWHFWLRQ RI UDQGRP UHDFWLYDWLRQ HYHQWV E\ WKH VDPSOLQJ RI WHDU ILOP 7KH HSLQHSKULQHLQGXFHG UDEELW H\H PRGHO LV RQH GHJUHH FORVHU WR WKH QDWXUDO LQIHFWLRQ LQ KXPDQV WKDQ WKH VSRQWDQHRXV PRGHO LQ WKDW LW LV VWUHVV LQGXFLEOH ,Q WKLV PRGHO YLUXV FDQ EH LQGXFHG WR UHDFWLYDWH E\ DSSOLFDWLRQ RI FXUUHQW DQG HSLQHSKULQH WR WKH H\H %HUPDQ HW DO +LOO HW DO

PAGE 17

+LOO HW DO D +LOO HW DO E .ZRQ HW DO .ZRQ HW DO f 9LUDO JHQRPHV ZLWKLQ QHXURQV RI WKH 7* UHDFWLYDWH DQG WUDYHO WR WKH LQLWLDO VLWH RI LQIHFWLRQ WKH H\H 7KLV PRGHO PRUH FORVHO\ PLUURUV WKH QDWXUDO KXPDQ LQIHFWLRQ LQ WKDW LQIHFWLRXV YLUXV FDQ EH UHFRYHUHG DW WKH WLVVXH LQLWLDOO\ LQIHFWHG ZLWK +69 XSRQ DSSURSULDWH VWUHVV VWLPXOL 7KH UDEELW PRGHOV DOVR DUH PRUH GLVFULPLQDWLQJ WKDQ WKH PRXVH PRGHOV LQ ZKLFK /$7 PXWDQWV UHDFWLYDWH %RWK WKH PRXVH PRGHO DQG WKH UDEELW H\H PRGHO KDYH PDGH LW SRVVLEOH WR EHWWHU XQGHUVWDQG WKH LPSDFW RI WKH /$7 XSRQ WKH YDULRXV VWDJHV RI ODWHQF\ /$7 0XWDQWV DQG 3KHQRW\SHV )URP WKH XVH RI DQLPDO PRGHOV WKH /$7 KDV EHHQ VKRZQ WR DIIHFW HVWDEOLVKPHQW DQG UHDFWLYDWLRQ SKHQRW\SHV RI ODWHQF\ ,W KDV EHHQ SURSRVHG WKDW WKH /$7 PD\ IXQFWLRQ PRVW GLUHFWO\ RQ HVWDEOLVKPHQW DQG VXEVHTXHQWO\ LQIOXHQFH UHDFWLYDWLRQ LQGLUHFWO\ GXH WR GHFUHDVHG HIILFLHQF\ RI HVWDEOLVKPHQW 6DZWHOO DQG 7KRPSVRQ 6DZWHOO 6DZWHOO HW DO 7KRPSVRQ DQG 6DZWHOO f :KHQ DVVD\HG ZLWK SURPRWHU UHSRUWHU YLUXVHV LW ZDV GHWHUPLQHG WKDW HVWDEOLVKPHQW RI ODWHQW LQIHFWLRQV DQG WKH LQLWLDWLRQ RI D SURGXFWLYH LQIHFWLRQ RFFXU ZLWK WKH VDPH NLQHWLFV 0DUJROLV HW DO f 7KLV ZRUN DOVR LGHQWLILHG IRXU FODVVHV RI QHXURQV LQ WKH RSKWKDOPLF GLYLVLRQ RI WKH WULJHPLQDO JDQJOLRQ WKDW DUH VXVFHSWLEOH WR +69 LQIHFWLRQ 7KHVH QHXURQDO FODVVHV LQFOXGH VXEVWDQFH 3 &*53 /' DQG 66($ QHXURQV ZLWK WKH 66($ VWDJHVSHFLILF HPEU\RQLF DQWLJHQ f QHXURQV WR EH WKH PDMRU FODVV RI WKHVH IRXU WR KDUERU D ODWHQW LQIHFWLRQ $GGLWLRQDOO\ ZLWK D VLPLODU UHSRUWHU FRQVWUXFW WKH /$7 SURPRWHU ZDV VKRZQ WR EH PRVW DFWLYH LQ ERWK QHXURQ QXPEHU DQG LQWHQVLW\ RI VWDLQLQJ GXULQJ WKH DFXWH VWDJH RI LQIHFWLRQ ,Q WKLV V\VWHP SHDN H[SUHVVLRQ RFFXUV LQ PRXVH WULJHPLQDO JDQJOLD DW GD\V SRVWn LQIHFWLRQ LQ FRQFRUGDQFH ZLWK WKH HQG RI O\WLF LQIHFWLRQ DQG VXJJHVWV D UROH LQ WKH HVWDEOLVKPHQW RI ODWHQF\ 7KRPSVRQ DQG 6DZWHOO f

PAGE 18

(VWDEOLVKPHQW $V SURSRVHG E\ 6DZWHOO DQG 7KRPSVRQ WKH /$7 LV K\SRWKHVL]HG WR DFW XSRQ WKH ODWHQW +69 LQIHFWLRQ DW WKH HVWDEOLVKPHQW VWDJH RI ODWHQF\ ,W KDV EHHQ VKRZQ WKDW VRPH /$7 PXWDQWV H[KLELW D UHGXFWLRQ LQ WKH DELOLW\ WR HVWDEOLVK D ODWHQW LQIHFWLRQ ,Q ODWHQWO\ LQIHFWHG QHXURQV WKH QXPEHU RI YLUDO JHQRPHV KDV EHHQ FDOFXODWHG WR H[LVW LQ WKH UDQJH RI &DEUHUD HW DO (IVWDWKLRX HW DO +LOO HW DO 5RFN HW DO 6DZWHOO HW DO f DOWKRXJK LW LV LPSRUWDQW WR SRLQW RXW WKDW WKH QXPEHU RI ODWHQWO\ LQIHFWHG QHXURQV WKDW H[SUHVV /$7 LV OHVV WKDQ b RI WKH WRWDO QHXURQV WKDW FRQWDLQ ODWHQW JHQRPHV (FRE3ULQFH HW DO (FRE3ULQFH HW DO *UHVVHQV HW DO +LOO HW DO 0DJJLRQFDOGD HW DO 0HKWD HW DO f $ /$7 QHJDWLYH PXWDQW .26 GHULYHG IURP WKH .26 VWUDLQ RI +69 ZDV UHSRUWHG WR KDYH D UHGXFHG UHDFWLYDWLRQ SKHQRW\SH DQG ZDV DWWULEXWHG WR D PLQRU LPSDLUPHQW RI WKLV PXWDQW WR HVWDEOLVK D ODWHQW LQIHFWLRQ 7KH QXPEHU RI ODWHQWO\ LQIHFWHG QHXURQV ZLWK WKH .26 PXWDQW ZDV PHDVXUDEO\ ORZHU WKDQ PLFH LQIHFWHG ZLWK WKH SDUHQWDO .26 6DZWHOO DQG 7KRPSVRQ f ,Q WKH FRPSDULVRQ RI ODWHQW JHQRPH QXPEHUV LQ QHXURQV EHWZHHQ KLJK UHDFWLYDWLQJ VWUDLQV RI +69 DQG ORZ UHDFWLYDWRUV D ORZ UHDFWLYDWLQJ VWUDLQ .26 ZDV SUHVHQW LQ ORZHU DPRXQWV WKDQ WKH VWUDLQV V\Q DQG 0F.UDH 6DZWHOO HW DO f ,Q VXSSRUW RI WKH HVWDEOLVKPHQW ILQGLQJV RWKHU ODERUDWRULHV KDYH UHSRUWHG VOLJKW GHFUHDVHV LQ HVWDEOLVKPHQW ZLWK /$7QHJDWLYH PXWDQWV LQ PXULQH H\H PRGHOV 'HYL5DR HW DO f ,QGLUHFW VXSSRUW IRU WKH UROH RI /$7 LQ HVWDEOLVKPHQW FRPHV IURP WKH ILQGLQJ WKDW /$7 H[SUHVVLRQ LQ PRXVH '5* RFFXUV DW WKH HQG RI O\WLF UHSOLFDWLRQ LQ QHXURQV 6DZWHOO DQG 7KRPSVRQ f

PAGE 19

$OWKRXJK VRPH /$7 PXWDWLRQV GR DOWHU WKH HVWDEOLVKPHQW RI ODWHQF\ WKHVH HIIHFWV DUH YHU\ ORZ LQ PDJQLWXGH $OVR PRVW /$7 PXWDQWV GR QRW GHPRQVWUDWH PHDVXUDEOH HVWDEOLVKPHQW SKHQRW\SHV DQG DUH QRW HYLGHQW LQ ERWK WKH PRXVH DQG WKH UDEELW %ORRP HW DO %ORRP HW DO -DUPDQ HW DO 3HPJ HW DO f 6SHFLILFDOO\ WKH HVWDEOLVKPHQW GLIIHUHQFHV WKDW KDYH EHHQ UHSRUWHG DUH VHHQ WR RFFXU RQO\ LQ WKH PRXVH DQG DW PRVW UHIOHFW IROG OHVV YLUDO '1$ LQ WKH JDQJOLD 7KRPSVRQ DQG 6DZWHOO f &XUUHQW XQGHUVWDQGLQJ FDQQRW UXOH RXW WKH DFWLRQ RI WKH /$7 RQ WKH HVWDEOLVKPHQW RI ODWHQF\ ,W LV SRVVLEOH WKDW /$7 GRHV DFW LQ HVWDEOLVKPHQW DQG WKH ORZHU OHYHOV RI HVWDEOLVKPHQW WKDW KDYH EHHQ REVHUYHG PD\ EH GXH WR DQ HIIHFW RI /$7 RQ GRZQ UHJXODWLQJ YLUDO P51$ SURGXFWLRQ LQ QHXURQV *DUEHU HW DO f 5HDFWLYDWLRQ 7KH LQYROYHPHQW RI WKH /$7 LQ DQ\ RI WKH VWDJHV RI +69 ODWHQF\ KDV EHHQ VKRZQ PRVW FRQFOXVLYHO\ IRU WKH UHDFWLYDWLRQ SKHQRW\SH LQ WKH HSLQHSKULQHLQGXFHG UDEELW H\H PRGHO ,QLWLDOO\ D +69 PXWDQW ;f FRQWDLQLQJ D ODUJH GHOHWLRQ HQFRPSDVVLQJ WKH /$7 SURPRWHU DQG GRZQVWUHDP UHJLRQ RI WKH JHQH GLVSOD\HG D ORZ OHYHO RI UHDFWLYDWLRQ LQ WKH UDEELW H\H PRGHO +LOO HW DO f 7KH UHDFWLYDWLRQ SKHQRW\SH ZDV UHVWRUHG E\ XVH RI DQ (FR5, -. VXEJHQRPLF FORQH HQFRPSDVVLQJ WKH /$7 ORFXV +LOO HW DO f $ VPDOOHU HQJLQHHUHG GHOHWLRQ RI WKH FRUH SURPRWHU $3VWf RI /$7 GLVSOD\HG D VHYHUH UHGXFWLRQ LQ UHDFWLYDWLRQ %ORRP HW DO f DQG DQRWKHU JURXS VXSSRUWHG WKLV ILQGLQJ ZLWK D VLPLODU EXW LQGHSHQGHQWO\ FRQVWUXFWHG PXWDQW 3HPJ HW DO f ,Q DGGLWLRQ WR GHOHWLRQV WKDW LQFOXGHG WKH /$7 SURPRWHU LW ZDV VKRZQ WKDW RQO\ D OLPLWHG UHJLRQ RI WKH /$7 SULPDU\ WUDQVFULSW LV UHTXLUHG IRU HIILFLHQW LQGXFHG UHDFWLYDWLRQ %ORRP HW DO %ORRP HW DO f VKRZHG WKDW LQVHUWLRQV RI SRO\DGHQ\ODWLRQ VLJQDOV EHWZHHQ WKH FDS

PAGE 20

VLWH DQG WKH f HQG RI /$7 UHVXOWLQJ LQ WHUPLQDWLRQ EDVH SDLUV IURP WKH FDS VLWH KDG QR LPSDFW XSRQ UHDFWLYDWLRQ %ORRP HW DO f DQG DFFXPXODWLRQ RI WKH NE /$7 LQWURQ KDV DOVR EHHQ VKRZQ WR QRW EH UHTXLUHG IRU UHDFWLYDWLRQ -DUPDQ HW DO f 7KH $ PXWDQW ZKLFK FRQWDLQV D PXWDWLRQ HQJLQHHUHG LQWR WKH f UHJLRQ RI H[RQ GLG H[KLELW VHYHUH GHFUHDVHV LQ UHDFWLYDWLRQ %ORRP HW DO f $QRWKHU PXWDQW $6W\ SDUWLDOO\ RYHUODSV WKH $ PXWDQW DQG LV DOVR UHDFWLYDWLRQ LPSDLUHG +LOO HW DO f 7KHVH PXWDWLRQV LQ H[RQ GR QRW DIIHFW WKH WUDQVFULSWLRQDO DFWLYLW\ RI WKH /$7 SURPRWHU DQG GR QRW UHGXFH WKH H[SUHVVLRQ RI WKH /$7 LQWURQV )URP WKHVH ILQGLQJV LQ WKH HSLQHSKULQHLQGXFHG UDEELW H\H PRGHO WKH UHDFWLYDWLRQ FULWLFDO UHJLRQ 5&5f RI /$7 KDV EHHQ PDSSHG WR WKH fUHJLRQ RI H[RQ RI WKH /$7 JHQH 0XWDWLRQV LQ fUHJLRQ RI H[RQ UHVXOW LQ D GUDPDWLF UHGXFWLRQ LQ WKH IUHTXHQF\ RI LQGXFHG DQG VSRQWDQHRXV YLUXV VKHGGLQJ LQ WKH WHDU ILOP RI LQIHFWHG UDEELWV /$7 QXOO PXWDQWV KDYH DOVR EHHQ VKRZQ WR UHDFWLYDWH DW UHGXFHG IUHTXHQF\ LQ 7* RI PLFH 6DZWHOO DQG 7KRPSVRQ 7KRPSVRQ DQG 6DZWHOO f :LWK UHJDUG WR PHFKDQLVP RQH K\SRWKHVLV LV WKDW WKH /$7 JHQH PD\ IXQFWLRQ GLUHFWO\ WR SURPRWH YLUDO UHDFWLYDWLRQ /$7 KDV EHHQ VKRZQ WR EH DFWLYHO\ WUDQVFULEHG LQ QHXURQV GXULQJ WKH ODWHQW VWDWH ZKLFK ZRXOG VXJJHVW D UROH LQ PDLQWHQDQFH RU UHDFWLYDWLRQ ([DPLQDWLRQ RI WKH VHTXHQFH RI /$7 H[RQ IRXQG D VXUSULVLQJO\ ODUJH RFFXUUHQFH RI &S* PRWLIV WKDW VXJJHVWHG WKDW /$7 JHQH WUDQVFULSWLRQ FRXOG EH FRQWUROOHG E\ PHWK\ODWLRQ %ORRP HW DO f ,W ZDV VKRZQ KRZHYHU WKDW H[SUHVVLRQ RI WKH /$7 JHQH LV QRW LQIOXHQFHG E\ D PHWK\ODWLRQ PHFKDQLVP .XEDW HW DO f ,W LV SRVVLEOH WKDW /$7 FHOOV PD\ RQO\ UHSUHVHQW D VPDOO IUDFWLRQ RI ODWHQW QHXURQV DQG FRXOG SOD\ D UHSUHVVLYH UROH RQ UHDFWLYDWLRQ 5HFHQW GDWD IURP RXU ODE VXJJHVW WKDW WKH /$7 LV DFWLYHO\ GRZQUHJXODWHG KRXUV SRVWH[SODQW FRFXOWLYDWLRQ

PAGE 21

DQG WKLV PD\ EH GXH LQ SDUW WR D FKDQJH LQ WKH DFHW\ODWLRQ SURILOH RI WKH UHJLRQ 2f1HLO.XEDW LQ SUHSDUDWLRQf 2QH FRXOG VSHFXODWH WKDW DFWLYH /$7 H[SUHVVLRQ LV QRW FRPSDWLEOH ZLWK UHDFWLYDWLRQ DQG LWV GRZQUHJXODWLRQ PD\ LQ WXUQ VWLPXODWH RU DOORZ WKH GRZQVWUHDP RSSRVLWH VWUDQG UHJXODWRU\ SURWHLQ ,&32 WR EH WUDQVFULEHG DQG LQLWLDWH D O\WLF FDVFDGH &OHDUO\ WKH /$7 UHJLRQ KDV LPSRUWDQW UHJXODWRU\ LPSOLFDWLRQV IRU WKH UHJXODWLRQ RI O\WLF DQG ODWHQW LQIHFWLRQV DQG WKHVH ZLOO EH GLVFXVVHG LQ IXUWKHU GHWDLO LQ WKH IROORZLQJ VHFWLRQV 2WKHU 5HJXODWRU\ 5HJLRQV RI /$7 7KH SURPRWHU UHVSRQVLEOH IRU H[SUHVVLRQ RI WKH NE SULPDU\ /$7 WUDQVFULSW KDV EHHQ VKRZQ WR SRVVHVV PXOWLSOH FRQWURO HOHPHQWV LQFOXGLQJ F\FOLF $03 UHVSRQVH HOHPHQWV &5(f &$7 ER[ 6SO 86) << DQG $3 VLWHV .HQQ\ HW DO 6RDUHV HW DO :HFKVOHU HW DO :HFKVOHU HW DO =ZDDJVWUD HW DO f 7KLV ODWHQW SURPRWHU KDV HQKDQFHG SURPRWHU DFWLYLW\ LQ FHOOV RI QHXURQDO RULJLQ =ZDDJVWUD HW DO f ,W KDV EHHQ VXJJHVWHG WKDW WKH /$7 JHQH PD\ HQFRGH DQ DOWHUQDWLYH RU FU\SWLF GRZQVWUHDP SURPRWHU HOHPHQW VHSDUDWH IURP WKH ODWHQW SURPRWHU WKDW PD\ EH DFWLYH GXULQJ DFXWH YLUDO UHSOLFDWLRQ 1LFRVLD HW DO *RLQV HW DO f 7KLV DOWHUQDWLYH SURPRWHU KDV EHHQ LQGLFDWHG E\ WUDQVLHQW WUDQVIHFWLRQ DVVD\V DQG URXJKO\ ORFDOL]HV WR D UHJLRQ f RI WKH /$7 LQWURQ VSOLFH GRQRU VLWH 7KH SUHVHQFH RI D QHXURQDO HQKDQFHU DSSUR[LPDWHO\ EDVH SDLUV GRZQVWUHDP RI WKH WUDQVFULSWLRQ VWDUW VLWH KDV EHHQ LGHQWLILHG 6RDUHV HW DO f 7KLV SURPRWHU KDV EHHQ LQFRUUHFWO\ ODEHOHG DV D VHFRQG ODWHQW SURPRWHU ,W LV FOHDU WKDW WKH SURPRWHU LV DFWLYH GXULQJ WKH O\WLF LQIHFWLRQ DQG QRW GXULQJ ODWHQF\ 6RDUHV HW DO f 7KLV UHJLRQ PD\ SOD\ D YHU\ LPSRUWDQW UROH LQ WKH DFXWH SKDVH RI +69 LQIHFWLRQ DQG WKH FKDUDFWHUL]DWLRQ RI WKLV GRZQVWUHDP UHJLRQ

PAGE 22

RI WKH /$7 JHQH PD\ KHOS WR H[SODLQ HDUO\ HYHQWV LQ ODWHQF\ RU WKH UHDFWLYDWLRQ IURP D ODWHQW LQIHFWLRQ 1HXURQDO 6XUYLYDO DQG $SRSWRVLV 7KH UHJLRQ UHVSRQVLEOH IRU WKH UHDFWLYDWLRQ SKHQRW\SH RI /$7 KDV EHHQ ZHOO PDSSHG EXW WKH /$7 JHQH PD\ FRQWDLQ RWKHU UHJXODWRU\ PRWLIV WKDW FRQWURO HVWDEOLVKPHQW RU IXQFWLRQV LQ WKH DFXWH LQIHFWLRQ /$7 PD\ DOVR SOD\ D UROH LQ QHXURQDO VXUYLYDO DQG DSRSWRVLV IRU UHYLHZ VHH %ORRP f 3RUWLRQV RI WKH /$7 JHQH KDYH EHHQ VKRZQ WR LQKLELW QHXURQDO FHOO GHDWK DQG PD\ IXQFWLRQ WKURXJK VXSSUHVVLRQ RI UHFHSWRUPHGLDWHG FDVSDVHf DQG PLWRFKRQGULDOPHGLDWHG FDVSDVHf SDWKZD\V 5HVXOWV IURP LQ YLYR VWXGLHV GHPRQVWUDWH WKDW D ODUJH GHOHWLRQ RI WKH SURPRWHU H[WHQGLQJ LQWR WKH /$7 LQWURQ DUH UHGXFHG LQ HVWDEOLVKPHQW OHYHOV DQG FDXVH D VLJQLILFDQW ORVV RI VHQVRU\ QHXURQV 3HPJ HW DO 7KRPSVRQ DQG 6DZWHOO f 7UDQVLHQW WUDQVIHFWLRQ RI ,05 DQG &9 FHOOV ZLWK D SODVPLG FRQWDLQLQJ WKH f UHJLRQ RI WKH /$7 H[RQ DQG PRVW RI WKH LQWURQ ZDV DEOH WR SURWHFW WKH PDMRULW\ RI FHOOV IURP FHUDPLGH RU IXPRQLVLQ %LLQGXFHG DSRSWRVLV 3HPJ HW DO 7KRPSVRQ HW DO f ([SUHVVLRQ RI WKH ERYLQH KHUSHVYLUXV /$7 3HPJ HW DO f RU SRUWLRQV RI WKH +69 /$7 JHQH LQKLELW FKHPLFDOO\ LQGXFHG DSRSWRVLV LQ FHOO FXOWXUH 3HPJ HW DO f 7KH DQWLDSRSWRWLF HIIHFWV RI ODUJH SRUWLRQV RI WKH /$7 H[SUHVVHG E\ WUDQVIHFWLRQ DUH DOVR FHOO VSHFLILF ,Q FXOWXUH WKH /$7 LV XQDEOH WR SURWHFW RU &26 FHOOV IURP DSRSWRVLV ,QPDQ HW DO f ,W LV FOHDU WKDW WKH /$7 GRHV LQGXFH DSRSWRVLV LQ FHUWDLQ FHOO OLQHV XVLQJ WUDQVLHQW WUDQVIHFWLRQ DVVD\V ZLWK KLJK PXOWLSOLFLWLHV RI LQIHFWLRQ DQG KLJK H[SUHVVLRQ OHYHOV 3HPJ HW DO f 7KHVH UHVXOWV LQGLFDWH WKDW WKH /$7 PD\ SOD\ D UROH LQ DSRSWRVLV EXW LW KDV QRW EHHQ FRQFOXVLYHO\ VKRZQ WR RFFXU LQ YLYR ,W ZDV UHSRUWHG WKDW /$7f YLUXVHV LQGXFH H[WHQVLYH DSRSWRVLV LQ UDEELW 7* 3HPJ HW DO f DQG WKDW

PAGE 23

WKH /$7 JHQH SURPRWHV QHXURQDO VXUYLYDO E\ UHGXFLQJ DSRSWRVLV 7KH DSRSRWRVLV UHVXOWV KDYH EHHQ TXHVWLRQHG GXH WR LQFRPSDWLEOH UHDJHQWV XVHG LQ WKH S 3$53 DQG 781(/ DVVD\V XVHG WR VXJJHVW DQ LQ YLYR DSRSWRWLF UROH IRU WKH /$7 7KRPSVRQ DQG 6DZWHOO f $QRWKHU ODUJH /$7 GHOHWLRQ PXWDQW $+f ZKHQ XVHG LQ WKH LQIHFWLRQ RI WKH PRXVH H\H PRGHO VKRZHG D GHSOHWLRQ RI RYHU KDOI WKH 7* QHXURQV $SRSWRVLV LQ +69 LQIHFWHG JDQJOLD GXULQJ O\WLF LQIHFWLRQ KDV EHHQ GHPRQVWUDWHG 7KH 1+ PXWDQW RYHUODSV WKH LPSDLUPHQW HQJLQHHUHG LQ WKH $+ PXWDQW EXW H[WHQGV IXUWKHU LQWR WKH LQWURQ 8VH RI WKLV PXWDQW UHVXOWHG LQ WKH ORVV RI QHXURQV DV PHDVXUHG E\ DQ LQFUHDVH LQ 781(/SRVLWLYH 7* QHXURQV $KPHG HW DO f WKRXJK WKH WRWDO QXPEHUV RI 781(/ SRVLWLYH FHOOV ZHUH ORZ 7KH /$7 KDV EHHQ SURSRVHG WR SURPRWH QHXURQDO VXUYLYDO DQG FRQVHTXHQWO\ OHDGV WR KLJK OHYHOV RI HVWDEOLVKPHQW 7KRPSVRQ DQG 6DZWHOO f ,I WKLV LV WUXH WKHQ /$7f YLUXVHV ZRXOG EH H[SHFWHG WR GHPRQVWUDWH D UHGXFHG OHYHO RI UHSOLFDWLRQ LQ VHQVRU\ JDQJOLD DQG ZRXOG KDYH DOWHUHG YLUXOHQFH SKHQRW\SHV LQ WKH PRXVH $ SRVVLEOH UHDVRQ WKDW WKLV KDV QRW EHHQ REVHUYHG LV GXH WR WKH LPSDLUPHQW RI VHYHUDO UHJXODWRU\ UHJLRQV LQ WKH FRQVWUXFWLRQ RI PRVW RI WKH UHODWLYHO\ ODUJH /$7 GHOHWLRQ PXWDQWV UHSRUWHG LQ WKH OLWHUDWXUH 7KH /$7 KDV EHHQ VKRZQ WR LQIOXHQFH UHDFWLYDWLRQ HVWDEOLVKPHQW DSRSWRVLV LQ FHOO FXOWXUH DQG PD\ DIIHFW QHXURQDO VXUYLYDO 7KH UHDFWLYDWLRQ SKHQRW\SHV DVVRFLDWHG ZLWK WKH /$7 KDYH EHHQ ZHOO PDSSHG EXW WKH SRVLWLRQV RI RWKHU UHJXODWRU\ UHJLRQV LQ WKH /$7 UHJLRQ DUH VWLOO XQFHUWDLQ 0XWDQWV WKDW KDYH EHHQ XVHG WR VKRZ DQWLDSRSWRWLF LQFOXGH YHU\ ODUJH GHOHWLRQV WKDW DOVR DIIHFW WKH UHJLRQ RI /$7 NQRZQ WR IXQFWLRQ LQ UHDFWLYDWLRQ 7R LGHQWLI\ DQG FKDUDFWHUL]H WKH PRWLIV RI /$7 LQYROYHG LQ WKH O\WLF

PAGE 24

LQIHFWLRQ LW LV QHFHVVDU\ WR FRQVWUXFW GLVFUHWH PXWDWLRQV EH\RQG WKH UHDFWLYDWLRQ FULWLFDO UHJLRQ 7KH $ $5 $ DQG $ PXWDQWV )LJXUH f ZHUH JHQHUDWHG LQ WKH ODE RI 'U (G :DJQHU 8 & ,UYLQHf &KDUDFWHUL]DWLRQ RI WKHVH YLUXVHV ZLWK UHVSHFW WR ODWHQF\ ZDV SHUIRUPHG E\ 'U -LP +LOO /68 (\H &HQWHUf E\ XVH RI WKH HSLQHSKULQH LQGXFHG UDEELW H\H PRGHO 7KH $ $5 $ DQG $ PXWDQWV ZHUH WHVWHG IRU UHDFWLYDWLRQ GLIIHUHQFHV LQ FRPSDULRQ WR OV\Q SDUHQWDOf DQG $3VW SURPRWHU PXWDQWf )URP WKHVH H[SHULPHQWV LW ZDV GHWHUPLQHG WKDW $ ZDV UHGXFHG LQ LWV DELOLW\ WR UHDFWLYDWH LQ WKH UDEELW PRGHO LQ FRPSDULVRQ WR LWV UHVFXH $5 DQG V\Q 0XWDQWV $ DQG $ GLG QRW GLVSOD\ D UHDFWLYDWLRQ UHVWULFWLRQ $OO UHVXOWV DUH VKRZQ LQ 7DEOH (VWDEOLVKPHQW ZDV DOVR GHWHUPLQHG E\ TXDQWLWDWLYH 3&5 LQ UDEELW 7* ZLWK QR VLJQLILFDQW GLIIHUHQFH GHWHFWHG EHWZHHQ $ DQG $5 VHH 7DEOH f %DVHG RQ WKHVH GDWD ZH K\SRWKHVL]HG WKDW D GRZQVWUHDP SRUWLRQ RI /$7 RXWVLGH RI WKH UHDFWLYDWLRQ FULWLFDO UHJLRQ LQIOXHQFHV WKH DFXWH LQIHFWLRQ :H GHPRQVWUDWHG KHUH WKDW PXWDWLRQ RI WKLV UHJLRQ RI /$7 UHVXOWV LQ D GHFUHDVH LQ YLUXOHQFH LQ WKH PRXVH PRGHO $GGLWLRQDOO\ ZH EHOLHYH WKDW WKH +69 UHFRPELQDQWV ZLWK WKH ODUJH /$7 GHOHWLRQV XVHG E\ 6DZWHOO DQG 7KRPSVRQ DV ZHOO DV :HFKVOHU )LJXUH f PDVN GUDPDWLF YLUXOHQFH HIIHFWV GXH WR WKH LPSDLUPHQW RI PXOWLSOH UHJXODWRU\ HOHPHQWV RI WKH /$7 ORFXV 7R H[DPLQH WKH SRVVLELOLW\ WKDW /$7 LQIOXHQFHV DFXWH LQIHFWLRQ DQGRU HDUO\ WLPHV LQ WKH ODWHQW LQIHFWLRQ ZH JHQHUDWHG DQ DGGLWLRQDO VHULHV RI PXWDQWV LQ D UHJLRQ RI /$7 f RI WKH UHDFWLYDWLRQ FULWLFDO UHJLRQ 7KHVH PXWDQWV DOORZHG XV WR WHVW WKH LQYROYHPHQW RI WKH f HQG RI H[RQ DQG WKH LQWURQ XSRQ ODWHQW DQG DFXWH SKHQRW\SHV RI +69 )URP WKH

PAGE 25

VHFRQGDU\ SURPRWHU DQG DSRSWRVLVQHXURQDO SURWHFWLRQ ILQGLQJV GHVFULEHG DERYH UHJLRQV RI WKH /$7 JHQH QHLJKERULQJ WKH UHDFWLYDWLRQ FULWLFDO UHJLRQ PD\ DFW LQ WKH DFXWH LQIHFWLRQ RI +69 7KLV DFWLRQ PD\ EH WKURXJK D WRPPHGLDWHG HIIHFW IURP O\WLF WUDQVFULSWLRQ RU LW PD\ EH PHGLDWHG LQ FLV DV DQ HQKDQFHU IXQFWLRQ $Q HQKDQFHU VFHQDULR LV TXLWH SRVVLEOH VLQFH WKH UHDFWLYDWLRQ IXQFWLRQ RI WKH /$7 JHQH LV K\SRWKHVL]HG WR RSHUDWH LQ D VLPLODU PDQQHU :DJQHU DQG %ORRP f 7KH VPDOO GRZQVWUHDP GHOHWLRQV RI YLUXVHV $ $5 $ $5 DQG D GRXEOH PXWDQW $3VW$ DOORZ WKH GHWHUPLQDWLRQ RI YLUXOHQFH SURSHUWLHV RI WKH /$7 ORFXV ZLWKRXW DOVR LPSDLULQJ RWKHU GHILQHG UHJXODWRU\ IXQFWLRQV RI /$7 WKDW PD\ PDVN D IXOO YLUXOHQFH HIIHFW 7KH UHVXOWV SUHVHQWHG LQ WKH IROORZLQJ FKDSWHUV SXW IRUWK D FDVH IRU WZR GLVWLQFW JHQHWLF HOHPHQWV ZLWKLQ WKH /$7 JHQH RQH FRQWUROOHG E\ WKH /$3 RU ODWHQW SURPRWHUf WKDW VHHPV WR DFW DV D IDFLOLWDWRU RI UHDFWLYDWLRQ DQG D VHFRQG WKDW PD\ HQFRPSDVV WKH /$3 SURPRWHU WKDW H[HUWV LWV LQIOXHQFH RQ YLUXOHQFH GXULQJ WKH DFXWH SKDVH RI WKH LQIHFWLRQ 7KH GDWD SUHVHQWHG KHUH GHPRQVWUDWLQJ WKH GUDPDWLF UHGXFWLRQ LQ YLUXOHQFH LQ WKH PRXVH IROORZLQJ GHOHWLRQ RI D UHJLRQ VSDQQLQJ WKH f HQG RI WKH fH[RQ DQG WKH ILUVW VHYHUDO KXQGUHG EDVHV RI WKH UHJLRQ HQFRGLQJ WKH /$7 LQWURQ LV WKH ILUVW GHVFULSWLRQ RI D PDMRU YLUXOHQFH SKHQRW\SH PDSSLQJ WR WKH /$7 JHQH 2XU UHVXOWV DOVR LQGLFDWH WKDW WKLV SKHQRW\SH LV LQGHSHQGHQW RI WKH /$7 SURPRWHU /$3f )LQDOO\ DV GLVFXVVHG LQ GHWDLO LQ WKH ODVW FKDSWHU ZH K\SRWKHVL]H WKDW WKH GHOHWLRQ RI WKHVH WZR GLVWLQFW JHQHWLF HOHPHQWV LQ YLYR UHVXOWV LQ D SKHQRW\SH GLVWLQFW IURP GHOHWLRQ RI HLWKHU HOHPHQW LQGLYLGXDOO\ VXJJHVWLQJ WKHVH HOHPHQWV ZRUN WRJHWKHU LQ UHJXODWLQJ VRPH DVSHFW RI DFXWH UHSOLFDWLRQ

PAGE 26

8/ NE SULPDU\ /$7 WUDQVFULSW $+++ )LJXUH 6FKHPDWLF RI WKH /$7 JHQH DQG WKH SRVLWLRQ RI $3VW $$ DQG $ UHFRPELQDQW YLUXVHV 7KH ORFDWLRQ RI WKH /$7 SULPDU\ WUDQVFULSW LV VKRZQ DORQJ ZLWK LWV ORFDWLRQ LQ WKH +69 JHQRPH 7KH SURPRWHU H[RQO DQG WKH f LQWURQ RI /$7 DUH GHSLFWHG DW WKH ERWWRP RI WKH ILJXUH DORQJ ZLWK UHFRPELQDQW /$7 YLUXVHV

PAGE 27

8/ $+ 7KRPSVRQ f 5HJLRQ RI 0XWDWLRQ )LJXUH /DUJH /$7 GHOHWLRQV XVHG IRU YLUXOHQFH LQGLFDWLRQV $Q LPSDFW RI WKH /$7 ORFXV XSRQ YLUXOHQFH KDV EHHQ LPSOLHG E\ XVH RI D FRXSOH RI /$7 GHOHWLRQ YLUXVHV 7KHVH GHOHWLRQ YLUXVHV GHOHWH D ODUJH SRUWLRQ RI WKH /$7 ORFXV DQG SRVVLEO\ UHPRYH VHYHUDO UHJXODWRU\ UHJLRQV LQ WKH /$7 JHQH

PAGE 28

7DEOH $QDO\VLV RI WKH f /$7 GHOHWLRQV RQ UHDFWLYDWLRQ LQ WKH UDEELW H\H PRGHOr 5HFRPELQDQW 3RVLWLYH UDEELWV WRWDO UDEELWV 3RVLWLYH H\HVWRWDO H\HV 7RWDO SRVLWLYH VZDEVWRWDO VZDEV V\Q bf bf bf $3VW bf bf bf $E bf bf bf $55HVFXHf bf bf bf $ bf bf bf $ bf bf bf 5HDFWLYDWLRQ ZDV PHDVXUHG E\ WKH OHYHO RI LQIHFWLRXV YLUXV E\ SODTXH DVVD\ GHWHFWHG IURP WHDU ILOP RI LQIHFWHG UDEELWV ,Q WKLV PRGHO WKH UDEELW H\H LV LQIHFWHG ZLWK +69 ZLWK WKH YLUXV WUDYHOLQJ WR WKH 7* DQG HVWDEOLVKLQJ D ODWHQW LQIHFWLRQ 5HDFWLYDWLRQ LV VWLPXODWHG E\ WKH DGPLQLVWUDWLRQ RI HSLQHSKULQH DQG FXUUHQW WR WKH UDEELW H\H ,QIHFWLRXV YLUXV LV WKHQ GHWHFWDEOH DW WKH LQLWLDO VLWH RI LQIHFWLRQ WKH H\H E,RQWRSKRUHVLV ZDV SHUIRUPHG RQFH D GD\ IRU WKUHH FRQVHFXWLYH GD\V (\H VZDEV ZHUH SHUIRUPHG IRU FRQVHFXWLYH GD\V &$ LV VLJQLILFDQWO\ GLIIHUHQW IURP ?OV\Q

PAGE 29

7DEOH 7KH UDWLR RI +69 WR DFWLQ '1$ LQ UDEELW WULJHPLQDO JDQJOLD ODWHQWO\ LQIHFWHG ZLWK $ DQG $5 PXWDQWV RI +69O 5DEELW LQIHFWHG ZLWK $ 7DWWRRVLGHf 5DWLR +69 WR $FWLQ '1$ 5DEELW LQIHFWHG ZLWK $5 7DWWRRVLGHf 5DWLR +69 WR $FWLQ '1$ *RGf *RGf *RVf *RVf *RGf *RGf *RVf *RVf *RGf *RGf *RVf *RVf *RGf *RGf *RVf *RVf *RGf *RGf *RVf *RVf *RGf *RGf *RVf *RVf *RGf *RVf $YHUDJH UDWLR s $YHUDJH UDWLR s D7KH $ /$7 UHFRPELQDQW YLUXV ZDV WHVWHG E\ VHPLTXDQWLWDWLYH 3&5 IURP GLIIHUHQFHV LQ HVWDEOLVKPHQW LQ FRPSDULVRQ WR LWV UHVFXH $5 9DOXHV ZHUH SORWWHG IRU WKH +69O JHQH '1$ SRO\PHUDVH DV D UDWLR WR FHOOXODU UDEELW DFWLQ '1$ )URP PHDVXUHPHQW RI WKH UDWLRV EHWZHHQ $ DQG $5 QR GHWHFWDEOH GLIIHUHQFHV LQ HVWDEOLVKPHQW ZHUH REVHUYHG

PAGE 30

&+$37(5 0(7+2'6 7HFKQLFDO GHWDLOV RI WKH H[SHULPHQWV XVHG WR JHQHUDWH WKH GDWD SUHVHQWHG LQ WKLV ZRUN DUH GLVFXVVHG LQ WKLV FKDSWHU 7KH H[SHULPHQWV ZHUH DLPHG DW WKH JHQHUDWLRQ RI YLUDO UHFRPELQDQWV DQG XVH RI WKHVH PXWDQWV IRU FKDUDFWHUL]DWLRQ SHUWDLQLQJ WR YLUXOHQFH DQG ODWHQF\ RI +69 LQ FHOO FXOWXUH DQG DQLPDO PRGHOV 7KLV FKDUDFWHUL]DWLRQ LQYROYHG DVVHVVLQJ YLUXOHQFH LQ WKH PRXVH PRGHO DORQJ ZLWK VXSSRUWLYH UHSOLFDWLRQ GDWD REWDLQHG IURP FHOO FXOWXUH DVVD\V 7KH H[DPLQDWLRQ RI UHDFWLYDWLRQ IURP DQG HVWDEOLVKPHQW RI ODWHQF\ ZHUH FDUULHG RXW DW WKH /68 (\H &HQWHU E\ 'UV -LP +LOO DQG -HDQQHWWH /RXWVFK DQG WKHVH UHVXOWV DUH VXPPDUL]HG LQ FKDSWHU 7DEOH DQG f ,Q WKH GHWHUPLQDWLRQ RI YLUXOHQFH WKH PHWKRGV RI FUHDWLQJ YLUDO UHFRPELQDQWV E\ WUDQVIHFWLRQ JURZWK RI PXWDQWV LQ FXOWXUH DQG LQIHFWLRQ DQG YLUDO TXDQWLILFDWLRQ IURP WKH DQLPDO PRGHOV DUH SUHVHQWHG KHUH LQ IXOO 9LUDO UHFRPELQDQWV ZHUH FRQVWUXFWHG E\ XVH RI KRPRORJRXV UHFRPELQDWLRQ LQ FHOO FXOWXUH 5HFRPELQDQWV ZHUH SURGXFHG E\ HLWKHU FRWUDQVIHFWLRQ RI +69 YLULRQ '1$ ZLWK D 3&5 IUDJPHQW IRU UHFRPELQLQJ LQWR IXOO OHQJWK JHQRPLF '1$ LH $5f RU E\ FRLQIHFWLRQ ZLWK WZR +69 /$7 PXWDQWV LH $3VW$f 7KH IXOO OHQJWK YLUDO JHQRPLF '1$ ZDV SUHSDUHG LQ FHOO FXOWXUH $ JURXS RI 7 IODVNV ZHUH LQIHFWHG ZLWK WKH +69 SDUHQWDO RU PXWDQW VWUDLQ RI FKRLFH DW D PXOWLSOLFLW\ RI LQIHFWLRQ 02,f RI ,QIHFWLRQV ZHUH PDLQWDLQHG DQG PRQLWRUHG IRU GD\V XQWLO WKH FHOOV ZHUH FRPSOHWHO\ GHWDFKHG $W WKLV SRLQW WKH VXVSHQVLRQ ZDV UHPRYHG DQG SHOOHWHG LQ D KLJK VSHHG FHQWULIXJH DW [ J IRU PLQXWHV DW r& 7KH VXSHUQDWDQW ZDV UHPRYHG DQG

PAGE 31

WKH SHOOHW ZDV UHVXVSHQGHG LQ P/ RI K\SRWRQLF O\VLV EXIIHU P0 7ULV S+ P0 ('7$ b 13 DQG b GHR[\FKROLF DFLGf 7KLV VXEVHTXHQW VXVSHQVLRQ ZDV YRUWH[HG LQFXEDWHG EULHIO\ RQ LFH DQG FHQWULIXJHG DW [ J IRU PLQXWHV DW r& WR SHOOHW WKH QXFOHL IURP WKH IUDFWLRQ FRQWDLQLQJ WKH YLUDO '1$ $IWHU FHQWULIXJDWLRQ WKH VXSHUQDWDQW ZDV UHPRYHG DQG WUHDWHG ZLWK D SURWHLQ GHJUDGDWLRQ VROXWLRQ b VRGLXP GRGHF\O VXOIDWH DQG PJP/ 3URWHLQDVH .f DW r& IRU KRXU $Q DGGLWLRQDO PJ RI 3URWHLQDVH ZDV DGGHG DQG WKH LQFXEDWLRQ ZDV UHSHDWHG DQ DGGLWLRQ KRXU DW r& WR IXUWKHU GLJHVW WKH SURWHLQ LQ WKH VDPSOH $IWHU WKLV WUHDWPHQW WKH VROXWLRQ ZDV H[WUDFWHG ZLWK VHTXHQWLDOO\ ZLWK HTXDO YROXPHV RI SKHQRO SKHQROFKORURIRUP DQG FKORURIRUP 7R SUHFLSLWDWH WKH IXOO OHQJWK YLUDO '1$ WKH VROXWLRQ ZDV WUHDWHG ZLWK D YROXPH RI 0 VRGLXP DFHWDWH DQG FDUHIXOO\ OD\HUHG ZLWK P/ RI FROG b HWKDQRO 7KH '1$ ZDV SUHFLSLWDWHG DW WKH DTXHRXVHWKDQRO PL[LQJ LQWHUIDFH ZLWK PRGHUDWH URWDWLRQ E\ KDQG 2QFH DQ DSSURSULDWH DPRXQW RI JHQRPLF '1$ ZDV YLVLEOH LW ZDV UHPRYHG E\ VSRROLQJ ZDVKHG EULHIO\ ZLWK b HWKDQRO GULHG UHVXVSHQGHG LQ SL RI VWHULOH ZDWHU 7KH '1$ ZDV TXDQWLILHG VSHFWURSKRWRPHWULFDOO\ DQG WKH JHQRPLF TXDOLW\ RI WKH '1$ ZDV DVVHVVHG E\ HOHFWURSKRUHVLV RQ DQ DJDURVH JHO )XOO OHQJWK YLUDO '1$ ZDV WKHQ UHDG\ IRU XVH LQ WUDQVIHFWLRQV WR SURGXFH UHFRPELQDQW +69 PXWDQWV 7UDQVIHFWLRQV XWLOL]HG YDU\LQJ UDWLRV RI JHQRPLF '1$ ZLWK D IL[HG DPRXQW RI SODVPLG RU 3&5 JHQHUDWHG '1$ ZKHUH DSSOLFDEOH )RU WKLV SURFHGXUH PP GLVKHV RI UDEELW VNLQV FHOOV DW b FRQIOXHQF\ ZHUH VHUXP VWDUYHG b FDOI VHUXP 0(0f RYHUQLJKW DW r& LQ b & 7KH YLUDO JHQRPLF '1$ ZDV XVHG LQ D UDQJH RI RI DQG SJ LQ DGGLWLRQ WR D SJ DPRXQW RI UHFRPELQLQJ '1$ SHU GLVK (DFK WUDQVIHFWLRQ PL[ ZDV SUHSDUHG LQ D ILQDO YROXPH RI SL RI 71( EXIIHU P0 7ULV S+

PAGE 32

P0 ('7$ DQG 0 1D&Of 8SRQ GLOXWLRQ RI WKH '1$ LQWR 71( SL RI &D&O ZDV DGGHG SHU PL[ '1$ ZDV SUHFLSLWDWHG E\ WKH DGPLQLVWUDWLRQ RI SL RI ; +(3(6 DORQJ ZLWK & IRU S+ DGMXVWPHQW 7KLV '1$ VROXWLRQ ZDV LQFXEDWHG DW URRP WHPSHUDWXUH IRU PLQXWHV 7KH WUDQVIHFWLRQ PL[ ZDV WKHQ DGGHG WR WKH GLVKHV DQG LQFXEDWHG DW r& IRU PLQXWHV 0HGLD LQ D P/ YROXPH ZDV DSSOLHG WR WKH GLVKHV DQG WUDQVIHUUHG WR r& IRU KRXUV 7KH PHGLD ZDV WKHQ DVSLUDWHG DQG WKH FHOOV ZHUH K\SRWRQLFDOO\ VKRFNHG ZLWK P/ RI VKRFN EXIIHU ,; +(3(6 b GH[WURVHf IRU VHFRQGV 7KH FHOOV ZHUH EULHIO\ ZDVKHG DQG P/ RI PHGLD ZDV DGGHG WR WKH GLVKHV 2QFH WKHVH WUDQVIHFWLRQV ZHUH SHUIRUPHG YLUDO LQIHFWLRQ ZDV DOORZHG WR SHUVLVW WR IXOO F\WRSDWKLF HIIHFW XVXDOO\ GD\V SRVWLQIHFWLRQ $IWHU WKH PRQROD\HU ZDV GHSOHWHG DQG GHWDFKHG GXH WR YLUDO LQIHFWLRQ DQ\ UHPDLQLQJ FHOOV ZHUH VFUDSHG DQG WKH HQWLUH VROXWLRQ ZDV YRUWH[HG DQG VWRUHG DW r& 7KLV YLUDO VWRFN ZDV IUR]HQ r&f DQG UDSLGO\ WKDZHG r&f WZLFH EHIRUH LVRODWLQJ LQGLYLGXDO SODTXHV 9LUXVHV SURGXFHG IURP WKH WUDQVIHFWLRQV ZHUH GHWHFWHG DQG LVRODWHG E\ SODTXH SXULILFDWLRQ &RQIOXHQW PP GLVKHV RI 56 FHOOV ZHUH LQIHFWHG ZLWK D VHULHV RI GLOXWLRQV UDQJLQJ IURP n WR n LQ RUGHU WR REWDLQ GLVKHV ZLWK ZHOOLVRODWHG SODTXHV $IWHU D KRXU LQRFXODWLRQ WKH LQIHFWHG GLVKHV ZHUH FRYHUHG ZLWK DQ RYHUOD\ FRQVLVWLQJ RI ,; b FDOI VHUXP 0(0 DQG b DJDURVH 7KLV VROLG RYHUOD\ DOORZHG WKH PDLQWHQDQFH RI WKH PRQROD\HU GXULQJ WKH LQIHFWLRQ DQG IXQFWLRQHG WR OLPLW VSUHDG RI YLUXV WKURXJK WKH PRQROD\HU DOORZLQJ IRU GLVFUHWH SODTXH IRUPDWLRQ DQG VXEVHTXHQW SODTXH LVRODWLRQ ,QIHFWLRQV ZHUH PDLQWDLQHG DQG PRQLWRUHG IRU GD\V 2QFH SODTXHV ZHUH YLVLEOH WKH GLVKHV ZHUH VWDLQHG IRU KRXUV ZLWK QHXWUDO UHG DW D GLOXWLRQ 7KH QHXWUDO UHG VWDLQ ZDV DEVRUEHG E\ OLYLQJ FHOOV DQG FRQVHTXHQWO\ OHIW WKH SODTXHV ZKLWH 7KLV FRQWUDVW

PAGE 33

DOORZHG IRU HDV\ YLVLELOLW\ RI SODTXHV IRU SLFNLQJ ZLWK D 3DVWHXU SLSHWWH 7KH SODTXHV ZHUH SLFNHG DQG HDFK LQGLYLGXDO SODTXH ZDV WUDQVIHUUHG WR LWV RZQ ZHOO RI D ZHOO SODWH FRQWDLQLQJ SL RI PHGLD SHU ZHOO 7KLV SODWH ZDV WKHQ IUR]HQ DQG WKDZHG WZLFH r&r&f DQG D SL YROXPH ZDV XVHG SHU ZHOO WR LQIHFW D ZHOO SODWH WKDW ZDV SUHYLRXVO\ VHHGHG ZLWK 56 FHOOV ,QIHFWLRQ RI WKLV SODWH ZDV DOORZHG WR SURFHHG IRU GD\V XQWLO b &3(f DQG ZDV WKHQ IUR]HQ DW r& 7KH UHFRPELQDQW YLUXVHV ZHUH VFUHHQHG E\ GRW EORW K\EULGL]DWLRQ DIWHU HDFK URXQG RI SODTXH SXULILFDWLRQ WR GHWHUPLQH WKH SURSHU PXWDWLRQ KDV EHHQ HQJLQHHUHG ,Q WKLV DSSURDFK HDFK ZHOO SODWH WKDW ZDV LQIHFWHG ZLWK LQGLYLGXDO LVRODWHV SHU ZHOO ZDV WKDZHG DW r& SULRU WR WKH WUDQVIHU IRU K\EULGL]DWLRQ 2Q WKH ERWWRP SLHFH RI WKH GRW EORW DSSDUDWXV OD\HUV RI :KDWPDQ SDSHU ZHUH DSSOLHG IROORZHG E\ D VHFWLRQ RI +\ERQG QLWURFHOOXORVH PHPEUDQH 7KH :KDWPDQ SDSHU DQG WKH PHPEUDQH ZHUH VDWXUDWHG ZLWK VROXWLRQ & >; 663( 0 VRGLXP FKORULGH 0 VRGLXP PRQRSKRVSKDWH 0 HWK\OHQH GLDPLQRWHWUDDFHWDWHf@ 7KH GRW EORW DSSDUDWXV ZDV WKHQ VHDOHG WLJKWO\ DQG D YDFXXP ZDV DSSOLHG $W WKLV SRLQW SL RI LQRFXOXP IURP HDFK ZHOO RI WKH ZHOO SODWH ZDV WUDQVIHUUHG WKURXJK WKH KROHV LQ WKH WRS RI WKH GRW EORW DSSDUDWXV DQG RQWR WKH PHPEUDQH (DFK ZHOO LQ WKH GRW EORW PDQLIROG ZDV VXEVHTXHQWO\ ZDVKHG ZLWK SL RI IUHVK VROXWLRQ $ 0 VRGLXP FKORULGH 1 VRGLXP K\GUR[LGHf IROORZHG E\ DQ HTXDO DSSOLFDWLRQ RI VROXWLRQ % 0 7ULV S+ f DQG VROXWLRQ & 7KH QLWURFHOOXORVH PHPEUDQH ZDV WKHQ UHPRYHG DQG EDNHG LQ D YDFXXP RYHQ IRU KRXUV DW & 7KH '1$ ZDV WKHQ FRYDOHQWO\ DWWDFKHG WR WKH PHPEUDQH DQG UHDG\ IRU ODEHOLQJ ZLWK UDGLRDFWLYH 3 >DG&73@ SUREH

PAGE 34

3UREHV ZHUH FUHDWHG XVLQJ WKH SRUWLRQ RI '1$ WKDW LGHQWLILHG WKH SUHVHQFH RI WKH SURSHU PXWDWLRQ LQ WKH UHFRPELQDQW YLUXV 7R PDNH WKH SUREH QJ RI '1$ ZDV GLOXWHG WR D WRWDO RI SL LQ 7( O2P0 7ULV ,P0 ('7$ S+ f DQG ERLOHG LQ D ZDWHU EDWK IRU PLQXWHV 7KH '1$ ZDV WKHQ TXLFNO\ WUDQVIHUUHG WR LFH DQG LQFXEDWHG IRU PLQXWHV $IWHU WKLV SHULRG WKH '1$ VROXWLRQ ZDV DGGHG WR D UHDFWLRQ WXEH IURP WKH 5HGLSULPHr1 ,, 5DQGRP 3ULPH /DEHOOLQJ 6\VWHP $PHUVKDP %LRVFLHQFHVf $ S&L DPRXQW RI 3 >D G&73@ ZDV DOVR DGGHG DQG WKH UHDFWLRQ ZDV SHUIRUPHG DW r& IRU PLQXWHV 7KH UHDFWLRQ ZDV TXHQFKHG ZLWK WKH LQWURGXFWLRQ RI SL RI 0 ('7$ 7KLV SUREH ZDV WKHQ ERLOHG IRU PLQXWHV SODFHG RQ LFH IRU PLQXWHV DQG UHDG\ IRU XVH 3ULRU WR WKH DGGLWLRQ RI WKH SUREH WR WKH K\EULGL]DWLRQ WKH EORW LWVHOI ZDV SUHK\EULGL]HG DW r& IRU KRXU LQ D VKDNLQJ ZDWHU EDWK WR UHGXFH QRQVSHFLILF '1$ ODEHOLQJ $IWHU WKH SUHK\EULGL]DWLRQ VWHS WKH SUREH ZDV DGGHG DQG WKH EORW K\EULGL]HG RYHUQLJKW DW r& 7KH QH[W GD\ WKH EORW ZDV ZDVKHG WZLFH ZLWK VROXWLRQ 0 VRGLXP FKORULGH 0 7ULV+&O S+ 0 ('7$f DW r& IRU PLQXWHV WZLFH ZLWK VROXWLRQ 0 VRGLXP FKORULGH 0 7ULV+&O S+ 0 ('7$ b 6'6f DW r& IRU PLQXWHV DQG ILQDOO\ WZLFH ZLWK VROXWLRQ 0 VRGLXP FKORULGH 0 7ULV+&O S+ 0 ('7$f DW r& IRU PLQXWHV 7KH EORW ZDV WKHQ GULHG EULHIO\ DQG FRYHUHG ZLWK SODVWLF ZUDS EHIRUH EHLQJ H[SRVHG KRXUV RQ D 3KRVSKRU VFUHHQ +\EULGL]DWLRQ ZDV WKHQ YLVXDOL]HG XVLQJ D 67250 SKRVSKRLPDJHU 0ROHFXODU '\QDPLFV 6XQQ\YDOH &$f LQ RUGHU WR LGHQWLI\ WKH SUHVHQFH RI WKH SURSHU UHFRPELQDQW YLUXV 7KLV FRQFOXGHV WKH JHQHUDO DVSHFWV RI WUDQVIHFWLRQ DQG K\EULGL]DWLRQ DSSURDFKHV XVHG 7KH VSHFLILF GHWDLOV RI WKH $5 DQG WKH $3VW$ FRQVWUXFWLRQ DUH GHVFULEHG QH[W

PAGE 35

/$7 5HFRPELQDQW 9LUXVHV 7KH +69 UHFRPELQDQWV $3VW $$D $5 $$5 DQG $3VW$ ZHUH DOO HQJLQHHUHG E\ KRPRORJRXV UHFRPELQDWLRQ 3ODVPLGV FRQWDLQLQJ WKH PXWDWHG UHJLRQV ZHUH WUDQVIHFWHG LQWR UDEELW VNLQ FHOOV DORQJ ZLWK IXOO OHQJWK ?OV\Q +69 JHQRPLF '1$ $ $D $5 $ DQG $ ZHUH FRQVWUXFWHG LQ WKH ODERUDWRU\ RI 'U (G :DJQHU DW 8& ,UYLQH 7KHVH UHFRPELQDQWV UHSODFHG SRUWLRQV RI WKH /$7 JHQH ZLWK VWXIIHU '1$ VHTXHQFH DQG FRQVHTXHQWO\ UHWDLQHG WKH VL]H DQG VSDFLQJ RI WKH /$7 JHQH $ DQG $ FRQWDLQ LQVHUWHG '1$ IURP WKH ODF= JHQH LQWR WKH HLWKHU WKH 3SPXO6ILO VLWH IRU $ RU WKH 6ILO+SDO ORFDWLRQ IRU $ 7KH PXWDQWV $ DQG $D DOVR FRQWDLQ VWXIIHU VHTXHQFHV $ KDV D SRO\DGHQ\ODWLRQ VHTXHQFH IURP 69 ZKHUHDV WKH QDWLYH '1$ IRU $D KDV EHHQ UHSODFHG ZLWK D SRO\DGHQ\ODWLRQ VHTXHQFH IURP UDEELW JORELQ 7KH PXWDQW $3VW LV D EDVH SDLU FOHDQ GHOHWLRQ RI '1$ EHWZHHQ WKH 3VW VLWHV LQ WKH FRUH ODWHQF\ SURPRWHU RI WKH /$7 JHQH 7KLV PXWDQW ZDV FUHDWHG LQ WKH 6WHYHQV ODE DW 8&/$ DQG KDV EHHQ GHVFULEHG SUHYLRXVO\ %ORRP HW DO f $5 )RU LQ YLYR DQG FHOO FXOWXUH H[SHULPHQWV LW ZDV FULWLFDO WR PDNH WZR DGGLWLRQDO /$7 PXWDQWV )LUVW WKH IDFW WKDW WKH SKHQRW\SHV IRU WKH $ ZHUH WKH UHVXOW RI WKH ES GHOHWLRQ ZDV FRQILUPHG E\ WKH FRQVWUXFWLRQ RI D UHVFXH RI WKLV YLUXV $5f 7KLV UHVFXH ZDV JHQHUDWHG E\ KRPRORJRXV UHFRPELQDWLRQ XVLQJ D NE '1$ 3&5 SURGXFW 7KH 3&5 UHDFWLRQ ZDV SHUIRUPHG ZLWK ROLJRQXFOHRWLGHV $%5 f*$*$7*$$&$&7&****77$& ff DQG $%5 f&**$&7%$&&7**&&7&7** ff 7KHVH SULPHUV EHJLQ DW SRVLWLRQV DQG

PAGE 36

UHVSHFWLYHO\ LQ WKH V\Q JHQRPH DQG DUH VKRZQ VFKHPDWLFDOO\ )LJXUH f 7KH DPSOLILHG '1$ ZDV FRWUDQVIHFWHG ZLWK IXOO OHQJWK $ '1$ LQWR 56 FHOOV $W GD\V SRVW WUDQVIHFWLRQ WKH FHOOV ZHUH O\VHG E\ UDSLG IUHH]HWKDZ r&r&f F\FOHV DQG SODWHG RQWR FRQIOXHQW PP GLVKHV RI 56 FHOOV DW YDU\LQJ GLOXWLRQV RI n WR a 7KHVH GLVKHV ZHUH RYHUOD\HG ZLWK D VROXWLRQ FRQWDLQLQJ b 6HD.HP $JDURVH DQG ,; b FDOI VHUXP 0(0 IRU GD\V $W WKLV WLPH FHOOV ZHUH VWDLQHG ZLWK QHXWUDO UHG DQG SODTXHV ZHUH REVHUYHG E\ DEVHQFH RI VWDLQ $SSUR[LPDWHO\ ZHOOLVRODWHG SODTXHV ZHUH SLFNHG DQG WHVWHG E\ GRW EORW K\EULGL]DWLRQ IRU WKH SUHVHQFH RI WKH UHVWRUHG ZLOG W\SH VHTXHQFH DW WKH 3SPXO6ILO ORFDWLRQ )LJXUH f 7KH +69 YLUXVHV V\Q DQG $ ZHUH LQFOXGHG RQ WKH EORWV WR VHUYH DV SRVLWLYH DQG QHJDWLYH FRQWUROV UHVSHFWLYHO\ 6HYHUDO SRVLWLYH SODTXHV ZHUH GHWHFWHG DIWHU WKH ILUVW URXQG RI SODTXH SXULILFDWLRQ )LYH RI WKHVH SRVLWLYH VDPSOHV ZHUH GLOXWHG DQG LQIHFWHG RQWR FRQIOXHQW PP GLVKHV RI 56 FHOOV $IWHU WKH WKLUG URXQG RI SXULILFDWLRQ DOO SODTXHV ZHUH SRVLWLYH 7R JXDUDQWHH WKH SXULW\ RI WKH $5 SODTXHV D FRXSOH RI SODTXHV ZHUH FDUULHG RXW IRU D IRXUWK URXQG RI SXULILFDWLRQ ZKLFK DJDLQ \LHOGHG FRPSOHWH SRVLWLYHV $3VW$ $QRWKHU UHFRPELQDQW YLUXV $3VW$ ZDV HQJLQHHUHG WR FRPSOHWH WKH DQDO\VLV RI WKH JHQHWLF EDVLV RI WKH YLUXOHQFH SKHQRW\SH ZLWKLQ WKH /$7 ORFXV LQ WKH PRXVH PRGHO $V WKH QDPH LPSOLHV WKLV PXWDQW FRQWDLQV PXWDWLRQV LQ ERWK WKH ODWHQW SURPRWHU RI WKH /$7 $3VWf FRXSOHG ZLWK D PXWDWLRQ LQ WKH f SRUWLRQ RI WKH /$7 LQWURQ $f 7KLV PXWDQW ZDV FRQVWUXFWHG E\ SHUIRUPLQJ D FRLQIHFWLRQ RI $3VW ZLWK $ DW DQ PRL RI IRU HDFK YLUXV LQ D 7 IODVN RI FRQIOXHQW UDEELW VNLQ FHOOV 3ODTXH SXULILHG LVRODWHV ZHUH WHVWHG E\ GRW EORW K\EULGL]DWLRQ ,Q HDFK URXQG RI SODTXH SXULILFDWLRQ HDFK

PAGE 37

ZHOO SODWH ZDV EORWWHG RQWR PHPEUDQH LQ GXSOLFDWH 2QH EORW ZDV WHVWHG ZLWK D SUREH IRU WKH ODF= '1$ SUHVHQW LQ WKH UHJLRQ RI WKH $ PXWDWLRQ DQG WKH RWKHU EORW ZDV WHVWHG IRU WKH SUHVHQFH RI WKH /$7 SURPRWHU UHJLRQ ES 3VW, IUDJPHQWf IURP ZLOGW\SH +69 VWUDLQ V\Q ,I ERWK PXWDWLRQV ZHUH FRUUHFW LQ WKH $3VW$ YLUXV WKHQ SODTXH LVRODWHV ZRXOG EH SRVLWLYH ZKHQ K\EULGL]HG ZLWK WKH ODF= SUREH DQG QHJDWLYH ZLWK WKH 3VW UHJLRQ SUREH )LJXUH f &ULWLFDO FRQWUROV LQFOXGHG LQ WKLV DQDO\VLV ZHUH WKH LQFOXVLRQ RI $ DQG $3VW ,Q XVH RI WKH ODF= SUREH WKH $ FRQWURO SURGXFHG D SRVLWLYH VLJQDO DQG WKH $3VW UHPDLQHG QHJDWLYH )RU WKH XVH RI WKH 3VW SUREH WKH VDPH ZDV DOVR WUXH VLQFH WKH $ PXWDQW UHWDLQHG ZLOGW\SH VHTXHQFH DW WKH ODWHQW SURPRWHU DQG WKH $3VW PXWDQW KDG WKH ES 3VW, UHJLRQ UHPRYHG ,Q SHUIRUPLQJ GXDO SURELQJ RI $3VW$ SRVVLEOH SODTXH LVRODWHV D IHZ YLUXVHV ZHUH GHWHUPLQHG SRVLWLYH IRU WKH ODF= IUDJPHQW DQG QHJDWLYH IRU WKH 3VW, IUDJPHQW LQ FRPSDULVRQ WR FRQWUROV $IWHU WKH ILUVW URXQG RI VFUHHQLQJ D IHZ SURSHUO\ K\EULGL]LQJ LVRODWHV ZHUH VHOHFWHG DQG VXEMHFWHG WR DQRWKHU URXQG RI SODTXHSXULILFDWLRQ )URP WKH VHFRQG URXQG RI VHOHFWLRQ DSSUR[LPDWHO\ b RI LVRODWHV SURGXFHG GHVLUHG K\EULGL]DWLRQ VLJQDOV 7ZR RI WKHVH VDPSOHV ZHUH VHOHFWHG DQG SXW WKURXJK DQRWKHU URXQG RI SXULILFDWLRQ $W WKLV WKLUG URXQG b RI VDPSOHV ZHUH ODF= IUDJPHQWSRVLWLYH DQG 3VW, IUDJPHQW QHJDWLYH 7R EH FHUWDLQ RI SXULW\ WZR VDPSOHV ZHUH WDNHQ LQWR D IRXUWK URXQG RI SXULILFDWLRQ DQG UHVXOWHG DJDLQ LQ b RI LVRODWHV SRVLWLYH IRU ODF= DQG QHJDWLYH IRU WKH 3VW, IUDJPHQW 7R SURYH WKDW WKH 3VW, IUDJPHQWQHJDWLYH FRQWURO FRQWDLQHG DGHTXDWH YLUDO '1$ WR EH GHWHFWHG LW ZDV LQFOXGHG DV D FRQWURO LQ WKH ILQDO URXQG RI WKH $5 SODTXH SXULILFDWLRQ 7KLV VDPSOH SURGXFHG VLJQDO LQWHQVLW\ HTXDO WR WKH RWKHU SRVLWLYH FRQWURO ?OV\Q

PAGE 38

$QDO\VHV ,Q 9LYR DQG &HOO &XOWXUH 7KH /$7 PXWDQWV $3VW $$D $5 $ $5 DQG $3VW$ ZHUH WHVWHG IRU YLUXOHQFH SKHQRW\SHV LQ WKH PRXVH PRGHO $IWHU GHWHUPLQLQJ WKH SKHQRW\SHV RI WKHVH PXWDQWV LQ YLYR WKH\ ZHUH DOVR FKDUDFWHUL]HG XVLQJ D FHOO FXOWXUH V\VWHP 7KH FHOO FXOWXUH H[SHULPHQWV LQYROYHG WZR GLIIHUHQW FHOO OLQHV 3& FHOOV DQG 56 FHOOV 7KHVH FHOO W\SHV DQG WKHLU H[SHULPHQWDO XVDJH LV GHVFULEHG ODWHU LQ WKLV FKDSWHU 9LUXOHQFH 'HWHUPLQDWLRQ LQ 0RXVH 0RGHO 7KH YLUXOHQFH GHWHUPLQDWLRQ RI WKH HQJLQHHUHG /$7 PXWDQWV ZDV SHUIRUPHG E\ /'SIX DQDO\VLV )RU WKHVH H[SHULPHQWV IHPDOH ZHHN ROG RXWEUHG 6ZLVV :HEVWHU PLFH ZHUH XVHG 9LUXOHQFH ZDV PHDVXUHG E\ IRRWSDG LQIHFWLRQ DQG E\ GLUHFW LQWUDFUDQLDO LQRFXODWLRQ )RU WKH IRRWSDG LQIHFWLRQ HDFK IRRWSDG RI DQHVWKHWL]HG PLFH ZDV LQMHFWHG KRXUV SUHLQIHFWLRQ ZLWK SL b ZYf VRGLXP FKORULGH $W WKH DSSURSULDWH WLPH PLFH ZHUH WKHQ VHGDWHG ZLWK P/ RI D FRFNWDLO FRQWDLQLQJ [\OD]LQH PJNJf DFHWDPLQH PJNJf DQG NHWDPLQH PJNJf 7KH NHUDWLQL]HG OD\HU RI WKH IRRWSDG ZDV WKHQ UHPRYHG ZLWK PLOG DEUDVLRQ XVLQJ DQ HPHU\ ERDUG DQG YLUDO GLOXWLRQV LQ 0(0 ZLWK b &6f ZHUH DSSOLHG RQWR WKH YHQWUDO IRRWSDG VXUIDFH LQ YROXPHV RI SL 7KH PLFH ZHUH WKHQ SODFHG EDFN LQWR WKHLU FDJHV LQ DQ LQYHUWHG PDQQHU WR DOORZ YLUXV DEVRUSWLRQ DQG PRQLWRUHG XQWLO WKH\ UHJDLQHG FRQVFLRXVQHVV DQG EHFDPH DFWLYH ,QIHFWHG PLFH ZHUH WKHQ REVHUYHG WZLFH GDLO\ XQWLO KLQG OLPE SDUDO\VLV HQVXHG LQ ZKLFK FDVH WKH\ ZHUH HXWKDQL]HG RU XQWLO WKH\ GLHG IURP HQFHSKDOLWLF +69 LQIHFWLRQ $IWHU WZR ZHHNV PLFH ZHUH VFRUHG IRU OHWKDOLW\ DQG /'VRSIX YDOXHV ZHUH DVVHVVHG E\ WKH 5HHG DQG 0XHQFK PHWKRG 5HHG DQG 0XHQFK f 6XUYLYLQJ PLFH ZHUH DVVHVVHG IRU WKH SUHVHQFH RI ODWHQW YLUXV E\ 3&5

PAGE 39

0LFH ZHUH DOVR WHVWHG IRU YLUXOHQFH SKHQRW\SHV E\ GLUHFW LQWUDFUDQLDO LQIHFWLRQ ZLWK WKH DSSRLQWHG /$7 PXWDQWV 7KHVH PLFH ZHUH VHGDWHG LQ WKH VDPH PDQQHU DV WKH IRRWSDG H[SHULPHQWV ,QIHFWLRQ ZDV SHUIRUPHG E\ GLUHFW DGPLQLVWUDWLRQ RI YLUXV LQWR WKH OHIW FHUHEUDO KHPLVSKHUH LQ YROXPHV RI SL RI LQRFXOXP E\ XVH RI D P/ V\ULQJH DQG D JDXJH QHHGOH 7KHVH PLFH ZHUH DOVR REVHUYHG XQWLO FRQVFLRXV DQG DFWLYH DQG ZHUH FKHFNHG WZLFH GDLO\ IRU VLJQV RI QHUYRXV V\VWHP LPSDLUPHQW RU HQFHSKDOLWLF GHDWK 7LVVXH 5HVWULFWLRQ 7KH UHODWLYH DELOLW\ RI WKH /$7 UHFRPELQDQWV WR UHSOLFDWH LQ WKH IHHW '5* VSLQDO FRUG DQG EUDLQ ZDV DVVHVVHG IROORZLQJ IRRWSDG LQRFXODWLRQ 7KLV DQDO\VLV ZDV SHUIRUPHG DV D WLPH FRXUVH DQG IRU HDFK WLPH SRLQW WLVVXH DQG YLUXV VDPSOHV ZHUH H[DPLQHG LQ UHSOLFDWHV RI 7KH WLPH SRLQWV WHVWHG LQFOXGHG DQG GD\V SRVW IRRWSDG LQRFXODWLRQ $W HDFK RI WKHVH WLPHV DOO RI WKH GHVLJQDWHG WLVVXHV ZHUH UHPRYHG DQG KRPRJHQL]HG LQ 0(0 FRQWDLQLQJ b FDOI VHUXP 7KH KRPRJHQDWHV ZHUH GLOXWHG DQG WLWHUHG RQ FRQIOXHQW ZHOO SODWHV RI 56 FHOOV LQ WKH SUHVHQFH RI WHFKQLFDO JUDGH KXPDQ ,J* WR SUHYHQW YLUDO VSUHDG WKURXJK WKH PRQROD\HU 3ODTXHV ZHUH FRXQWHG DW GD\V SRVWLQIHFWLRQ DQG YLUDO OHYHOV ZHUH FDOFXODWHG IRU HDFK YLUXV DQG WLVVXH IRU WKH WLPH SRLQWV 7LPH &RXUVH ([SHULPHQWV 0XWDQWV $3VW $$D $5 $ DQG $5 ZHUH WHVWHG IRU LQIHFWLRXV YLUXV SURGXFWLRQ LQ FHOO FXOWXUH DORQJ ZLWK SDUHQWDO YLUXV ?OV\Q ,QIHFWLRXV YLUXV OHYHOV ZHUH DVVHVVHG LQ 56 DQG 3& FHOOV UDW SKHRFKURPRF\WRPD FHOOVf LQ ERWK PXOWLVWHS DQG VLQJOH VWHS JURZWK FXUYHV 7KH 3& FHOOV DUH GHYHORSPHQWDOO\ OLQNHG WR QHXURQV DQG UHSUHVHQW D VSHFLILF FHOO W\SH RI WKH QHUYRXV V\VWHP 3L]HU HW DO

PAGE 40

5XEHQVWHLQ HW DO f )RU WKH PXOWLVWHS JURZWK FXUYHV FHOOV ZHUH LQIHFWHG DW D PXOWLSOLFLW\ RI LQIHFWLRQ RI DQG LQIHFWLRQV ZHUH WHUPLQDWHG DQG TXDQWLILHG E\ SODTXH WLWUDWLRQ DW KRXUV DQG KRXUV SRVWLQIHFWLRQ (DFK WLPH SRLQW YLUXVn ZDV SHUIRUPHG LQ WULSOLFDWH 7KH VLQJOH VWHS JURZWK FXUYHV ZHUH FDUULHG RXW LQ D VLPLODU PDQQHU EXW ZLWK D KLJKHU PXOWLSOLFLW\ RI LQIHFWLRQ f 7KH WLPH SRLQWV ZHUH DOVR GLIIHUHQW DQG LQFOXGHG DQG KRXUV SRVWLQIHFWLRQ )RU WKLV H[SHULPHQW VDPSOHV ZHUH DOVR WHVWHG LQ WULSOLFDWH ZLWK WLWUDWLRQV EHLQJ SHUIRUPHG RQ 56 FHOOV LQ WKH SUHVHQFH RI KXPDQ ,J* 5HVXOWLQJ SODTXHV ZHUH FRXQWHG DQG LQIHFWLRXV YLUXV OHYHOV ZHUH WKXV TXDQWLWDWHG 7KH H[SHULPHQWDO WHFKQLTXHV GHVFULEHG LQ WKLV FKDSWHU ZHUH XVHG WR WHVW WKH +69 /$7 PXWDQWV $3VW $$D $5 $$5 5+$ DQG $3VW$ DORQJ ZLWK SDUHQWDO FRQWURO ?OV\Q LQ WKH PRXVH PRGHO 7KHVH H[SHULPHQWV ZHUH DLPHG DW WKH GHWHUPLQDWLRQ RI WKH UROH RI WKH f SRUWLRQ RI /$7 H[RQ DQG WR GHWHUPLQH LI D SKHQRW\SH FDQ EH DWWULEXWHG WR WKH f LQWURQ 7KH QH[W FKDSWHU LV GHGLFDWHG WR WKH UHSRUW RI YLUXOHQFH WLVVXH UHVWULFWLRQ DQG FHOO VSHFLILF LQIHFWLRXV YLUXV UHGXFWLRQ SKHQRW\SHV REWDLQHG IRU WKHVH PXWDQWV

PAGE 41

5L 8 5O 5V 8V 5V ,QWURQVf + 3VW 3VW $ 3SPXO M 6W\ n ES ES 6W\ ,6ILOf ESA VSOLFH GRQRU )LJXUH $5 FRQVWUXFWLRQ 7KH $5 UHFRPELQDQW YLUXV ZDV PDGH E\ FRWUDQVIHFWLRQ RI D 3&5 DPSOLILHG SRUWLRQ RI WKH SDUHQWDO YLUXV ?OV\Q EHWZHHQ JHQRPLF EDVH SDLUV DQG DQG JHQRPLF $ '1$ 7KH $5 UHFRPELQDQW ZDV VFUHHQHG E\ GRW EORW K\EULGL]DWLRQ

PAGE 42

?OV\Q $ )LJXUH 'RW EORW K\EULGL]DWLRQ RI VHFRQG URXQG SODTXH SXULILFDWLRQ RI $5 7KLV ILJXUH GHPRQVWUDWHV WKDW E\ WKH VHFRQG URXQG RI SODTXH SXULILFDWLRQ PRVW RI WKH YLUXVHV DUH SRVLWLYH IRU WKH UHJLRQ RI WKH /$7 JHQH FRUUHVSRQGLQJ WR WKH UHJLRQ WKDW ZDV DOWHUHG LQ WKH $ UHFRPELQDQW

PAGE 43

$ $3VW $ $3VW )LJXUH 'RW EORW K\EULGL]DWLRQ RI VHFRQG URXQG SODTXH SXULILFDWLRQ RI $3VW$ $f 7KH EORW DW WKH WRS RI WKH SDJH ZDV SUREHG ZLWK D ODF= SUREH %f 7KH ERWWRP EORW ZDV SUREHG ZLWK D 3VW SUREH LQ RUGHU WR LGHQWLI\ $3VW$ UHFRPELQDQWV

PAGE 44

&+$37(5 5(68/76 ,Q RXU SXUVXLW WR IXUWKHU XQGHUVWDQG WKH IXQFWLRQ RI WKH /$7 ORFXV LQ +69 ELRORJ\ ZH PDGH UHFRPELQDQW YLUXV $ GHOHWHG RI D ES IUDJPHQW LQ WKH f UHJLRQ RI H[RQ )LJXUH f 7KH QDWLYH UHJLRQ RI +69 /$7 H[RQ ZDV UHPRYHG E\ KRPRORJRXV UHFRPELQDWLRQ DQG UHSODFHG ZLWK '1$ VWXIIHU IURP D 69 SRO\DGHQ\ODWLRQ VHTXHQFH 7KLV UHFRPELQDQW YLUXV FRQWDLQHG DOWHUDWLRQV f RI D UHJLRQ WKDW PDSSHG WR WKH JHQHUDO UHJLRQ WKDW ZH KDG HYLGHQFH ZDV LQYROYHG LQ UHDFWLYDWLRQ 7R WHVW WKH LPSDFW RI WKLV SRUWLRQ RI WKH /$7 RQ UHDFWLYDWLRQ IURP ODWHQF\ ZH XWLOL]HG WKH HSLQHSKULQHLQGXFHG UHDFWLYDWLRQ UDEELW H\H PRGHO 5HVXOWV VKRZHG WKDW WKH $ UHFRPELQDQW YLUXV H[KLELWV D UHGXFHG UHDFWLYDWLRQ SKHQRW\SH 7DEOH f $GGLWLRQDOO\ LW ZDV REVHUYHG WKDW WKH $ GLVSOD\HG UHGXFHG FRPHD VFDUULQJ LQ FRPSDULVRQ WR ?OV\Q SDUHQWDO YLUXVf DQG $3VW SURPRWHU PXWDQWf DW HDUO\ WLPHV SRVW LQIHFWLRQ )LJXUH f 7KLV LQGLFDWHG WKDW WKH $ UHFRPELQDQW ZDV DOWHUHG LQ SDWKRJHQHVLV GXH WR WKH ES GHOHWLRQ RU GXH WR VHFRQGDU\ PXWDWLRQV RXWVLGH RI WKH /$7 UHJLRQ 7R WHVW WKLV VHFRQG SRVVLELOLW\ D VHFRQG $ YLUXV ZDV HQJLQHHUHG $Df 7KLV UHFRPELQDQW LV WKH VDPH DV WKH RULJLQDO $ H[FHSW WKDW LW FRQWDLQHG D VWXIIHU VHTXHQFH IURP WKH UDEELW 3 JORELQ JHQH UDEELW JORELQ SRO\ $ UHJLRQf $ORQJ ZLWK WKH $D UHFRPELQDQW D FRUUHVSRQGLQJ UHVFXH ZDV PDGH $D5 7KHVH YLUXVHV ZHUH RQFH DJDLQ WHVWHG LQ WKH HSLQHSKULQHLQGXFHG UDEELW H\H PRGHO IRU UHDFWLYDWLRQ HIIHFWV DQG GHPRQVWUDWHG UHGXFHG UHDFWLYDWLRQ 7DEOH f 7KHVH UHVXOWV

PAGE 45

LQGLFDWHG WKDW WKH $ YLUXV ZDV QRW RQO\ UHVWULFWHG LQ UHDFWLYDWLRQ EXW XQOLNH WKH /$7 SURPRWHU PXWDQW $3VW KDG DOWHUDWLRQV LQ FRPHDO SDWKRORJ\ VXJJHVWLQJ WKDW LW PLJKW SRVVHVV DWWHQXDWHG YLUXOHQFH RU SDWKRJHQHVLV SURSHUWLHV 7KH PRXVH IRRWSDG PRGHO ZDV XVHG WR WHVW WKH YLUXOHQFH SURILOH RI WKH $ UHFRPELQDQWV 7KH UDEELW PRGHO LV D VXSHULRU PRGHO IRU UHDFWLYDWLRQ GXH WR LWV FORVH SDUDOOHO WR WKH QDWXUDO LQIHFWLRQ DV GHVFULEHG LQ FKDSWHU )RU YLUXOHQFH VWXGLHV KRZHYHU WKH PRXVH IRRWSDG PRGHO LV PRUH XVHIXO GXH WR WKH DELOLW\ WR LQIHFW ODUJHU VDPSOH VL]HV ZKLOH DOVR FRQVHUYLQJ PDQ\ FKDUDFWHULVWLFV RI QDWXUDO +69 LQIHFWLRQ 7KH IRRWSDG LQIHFWLRQ DOORZV LQLWLDO LQIHFWLRQ RI WKH HSLGHUPLV RI WKH IRRW 9LUXV WKHQ HQWHUV WKH SHULSKHUDO QHUYRXV V\VWHP YLD QHUYH WHUPLQL SUHVHQW LQ WKH HSLGHUPLV 2QFH LQ WKH QHUYRXV V\VWHP YLULRQV SURJUHVV WR WKH ERG\ RI WKH QHXURQV LQ WKH GRUVDO URRW JDQJOLD GUJf )URP WKH '5* +69 FDQ WKHQ HQWHU WKH FHQWUDO QHUYRXV V\VWHP DQG SURJUHVV WKURXJK WKH VSLQDO FRUG WR WKH EUDLQ ,QIHFWLRQ LQ WKH &16 FDQ OHDG WR GHDWK UHVXOWLQJ IURP HQFHSKDOLWLV /'SIX (YDOXDWLRQ ,QLWLDOO\ WKH $ UHFRPELQDQW YLUXVHV ZHUH WHVWHG IRU YLUXOHQFH E\ /' FDOFXODWLRQ RI YLUDO GRVH LQ SODTXH IRUPLQJ XQLWV UHTXLUHG WR NLOO b RI DQLPDOV LQ D JURXSf LQ FRPSDULVRQ WR ?OV\Q SDUHQWDOf $3VW DQG $D5 5HVXOWV LQ WKH PRXVH VKRZHG WKDW WKH $ YLPVHV GLG GLVSOD\ D GUDPDWLF YLUXOHQFH SKHQRW\SH ,W LV LPSRUWDQW WR QRWH WKDW WKH $ PXWDWLRQ SULQFLSDOO\ DOWHUV WKH f HQG RI H[RQ EXW LW DOVR FKDQJHV WKH ILUVW EDVH SDLUV RI WKH VSOLFH GRQRU VLWH $GGLWLRQDOO\ WKH VWXIIHU '1$ LV D SRO\DGHQ\ODWLRQ VLJQDO LQ WKH FDVH RI HDFK $ UHFRPELQDQW DQG WKH YLUXOHQFH UHVXOWV FRXOG KDYH EHHQ GXH WR D 51$ PHGLDWHG HIIHFW 7R DQVZHU WKHVH TXHVWLRQV VHW

PAGE 46

RXW WR FUHDWH DGGLWLRQDO $ UHFRPELQDQWV WKDW GR QRW PXWDWH WKH VSOLFH GRQRU VLWH RU DQ\ SRUWLRQ RI WKH LQWURQ DOVR SODQQHG WR LQVHUW WKH SRO\DGHQ\ODWLRQ VHTXHQFHV LQ HDFK RULHQWDWLRQ WR WHVW IRU D 51$ GLUHFWLRQDO HIIHFW 3ULRU WR HQJLQHHULQJ DQG WHVWLQJ WKHVH QHZ $ UHFRPELQDQWV ZH ZDQWHG WR UHSHDW WKH /' H[SHULPHQWV ZLWK WKH LQFOXVLRQ RI DGGLWLRQDO FRQWUROV 7KH /$7 UHFRPELQDQWV $ $D $D5 $ DQG $ )LJXUH f ZHUH DQDO\]HG IRU YLUXOHQFH SKHQRW\SHV E\ XVH RI WKH PRXVH IRRWSDG PRGHO 7DEOH f 7KHVH YLUXVHV ZHUH XVHG WR LQIHFW WKH UHDU IRRWSDG RI RXWEUHG 6ZLVV :HEVWHU PLFH DORQJ ZLWK FRQWURO YLUXVHV ?OV\Q SDUHQWDOf $3VW SURPRWHU PXWDQWf DQG 5+$ ZKLFK FRQWDLQV D SRO\DGHQ\ODWLRQ VLJQDO DW D +SDO VLWH LQ WKH PLGGOH RI WKH LQWURQ 7KH IRRWSDG RI RXWEUHG 6ZLVV :HEVWHU PLFH ZDV LQIHFWHG ZLWK PXWDQWV $ $D $D5 $ $ DQG 5+$ LQ YDU\LQJ GLOXWLRQV VHH 0HWKRGVf ZLWK PLFH YLUXVGLOXWLRQn ,Q FRPSDULVRQ WR OV\Q SDUHQWDOf $3VW SURPRWHU PXWDQWf DQG HDFK UHVFXDQW YLUXV LQFOXGHG LQ WKH H[SHULPHQW PXWDQWV $$D DQG $ H[SUHVVHG GUDPDWLFDOO\ LQFUHDVHG /'SIX OHYHOV E\ PRXVH IRRWSDG LQIHFWLRQ (DFK RI WKHVH GLVSOD\HG D JUHDWHU WKDQ IROG LQFUHDVH LQ /'VRSIX OHYHOV 7DEOH f 7KH YLUXOHQFH SKHQRW\SH IRU WKH $ UHFRPELQDQW PDGH WKH FUHDWLRQ RI WKH QHZ $ UHFRPELQDQWV GHVFULEHG DERYH XQQHFHVVDU\ 7KH $ PXWDWLRQ UHVLGHV HQWLUHO\ LQ WKH LQWURQ DQG UHWDLQV WKH VSOLFH GRQRU VLWH 7KLV YLUXV DOVR FRQWDLQV D ODF= '1$ VWXIIHU DQG LWV HIIHFW DUJXHV DJDLQVW WKH RULHQWDWLRQ RI WKH SRO\DGHQ\ODWLRQ VHTXHQFH KDYLQJ DQ LPSDFW LQ WKH $ UHFRPELQDQWV ,W LV LPSRUWDQW WR UHFRJQL]H WKDW WKH $ PXWDQW KDG DQ HTXDO YLUXOHQFH SURILOH WR V\Q DQG $3VW ZKLFK LGHQWLILHV WKH f ERXQGDU\ RI WKH YLUXOHQFH UHJLRQ GXH WR WKH ODFN RI YLUXOHQFH SKHQRW\SH IRU

PAGE 47

$ 5HVXOWV IURP WKH IRRWSDG LQIHFWLRQV LQGLFDWH WKDW $$D DQG $ DUH LPSDLUHG LQ HLWKHU QHXURLQYDVLRQ RU QHXURYLUXOHQFH 7R GHWHUPLQH LI $ DQG $D ZHUH GHILFLHQW LQ QHXURYLUXOHQFH WKH /$7 PXWDQWV ZHUH XVHG WR LQIHFW WKH PRXVH E\ LQWUDFUDQLDO LQRFXODWLRQ DORQJ ZLWK V\Z DQG $3VW 7KHVH UHVXOWV VKRZHG WKDW WKH $ DQG $D YLUXVHV ZHUH DOVR UHVWULFWHG LQ YLUXOHQFH PHDVXUHG E\ /'SIX XSRQ GLUHFW LQRFXODWLRQ LQWR WKH PRXVH EUDLQ 7DEOH f 7DNHQ WRJHWKHU WKH IRRWSDG DQG LQWUDFUDQLDO /'SIX YDOXHV VKRZ WKDW PXWDQWV $ $D DQG $ DUH JUHDWO\ LPSDLUHG LQ YLUXOHQFH LQ WKH PRXVH DQG WKDW WKH UHVXOWV DUH GXH WR D QHXURYLUXOHQFH SKHQRW\SH DQG QRW OLNHO\ GXH WR D GHIHFW LQ QHXURLQYDVLRQ RU DQ LQDELOLW\ WR HQWHU WKH FHQWUDO QHUYRXV V\VWHP 7LVVXH 5HVWULFWLRQ 7R LGHQWLI\ ZKHWKHU WKH $$D DQG $ PXWDQWV GLVSOD\ D JHQHUDO UHGXFWLRQ LQ UHSOLFDWLRQ LQ WKH PRXVH FDXVDWLYH RI D YLUXOHQFH SKHQRW\SH VHYHUDO WLVVXHV DORQJ WKH LQIHFWLRQ SDWKZD\ IURP WKH IRRW ZHUH WHVWHG IRU SURGXFWLRQ RI LQIHFWLRXV YLUXV 7LVVXHV LQFOXGHG WKH IRRW '5* VSLQDO FRUG DQG EUDLQ ZLWK WKH LQFOXVLRQ RI ?V\Q $3VW $D $D5 $ YLUXVHV DV FRQWUROV ,QIHFWLRXV YLUXV ZDV DVVD\HG IRU WKHVH WLVVXHV DW DQG GD\V SRVW LQIHFWLRQ DW DQ LQLWLDO GRVH RI SIX YLUXVn WLPHn (DFK YLUXV WLPH SRLQW DQG WLVVXH ZDV H[DPLQHG LQ WULSOLFDWH 6LQFH WKH IRRWSDG LV WKH LQLWLDO VLWH RI LQIHFWLRQ LQ RXU PRGHO LW ZDV FULWLFDO WR GHWHUPLQH LI WKHVH PXWDQWV ZHUH LPSDLUHG LQ YLULRQ SURGXFWLRQ LQ WKLV WLVVXH 8SRQ DQDO\]LQJ WKLV WLVVXH IRU SODTXH SURGXFWLRQ D VLJQLILFDQW GLIIHUHQFH LQ YLUDO SURGXFWLRQ ZDV QRW VHHQ LQ WKH IHHW DW DQ\ WLPHV WHVWHG )LJXUH f )URP SUHYLRXV GDWD LQ RXU ODE ZH NQRZ DW WKH GRVHV HPSOR\HG WKDW GD\V SRVWLQIHFWLRQ LV WKH SHDN RI LQIHFWLRXV YLUXV

PAGE 48

SURGXFWLRQ LQ WKH IHHW -DUPDQ HW DO f 7KH ODFN RI D GLIIHUHQFH EHWZHHQ $ DQG $ LQ FRPSDULVRQ WR ?OV\Q SDUHQWDOf $3VW DQG $5 GHPRQVWUDWHV WKDW WKH PXWDQWV GR QRW GLVSOD\ D JHQHUDO UHSOLFDWLRQ GHIHFW LQ PRXVH WLVVXH ,QIHFWLRQ LQ WKH IRRWSDG DOORZV IRU WKH YLUXV WR HQWHU WKH QHUYRXV V\VWHP YLD QHUYH WHUPLQL LQ WKH HSLGHUPLV )URP WKH IHHW YLUXV SURJUHVVHV LQWR WKH QHUYRXV V\VWHP DQG YLUXV FDQ EH GHWHFWHG LQ WKH '5* ,Q H[DPLQLQJ WKH '5* WKH $ PXWDQW GRHV GLVSOD\ D UHGXFWLRQ LQ LQIHFWLRXV YLUXV OHYHOV HYLGHQW DW DQG GD\V SRVWLQIHFWLRQ GSLf )LJXUH f ,QWHUHVWLQJO\ $ GRHV QRW GHPRQVWUDWH D UHVWULFWLRQ DW GSL DQG RQO\ VKRZV D SRVVLEOH UHGXFWLRQ DW GSL %RWK RI WKHVH PXWDQWV KRZHYHU DUH UHVWULFWHG LQ LQIHFWLRXV YLUXV SURGXFWLRQ LQ WKH QH[W WLVVXH LQ WKH SDWK RI LQIHFWLRQ WKH VSLQDO FRUG 5HVXOWV IURP VSLQDO FRUG VKRZ WKDW ERWK $ DQG $ KDYH ORZHU YLUDO YDOXHV LQ FRPSDULVRQ WR ?OV\Q SDUHQWDOf $3VW $D5 DQG $5 )LJXUH f )XUWKHU DQDO\VLV UHYHDOV WKDW $ DQG $ DUH DOVR ORZHU LQ DEXQGDQFH LQ EUDLQ WLVVXH )LJXUH f 9DOXHV VKRZQ IRU WKHVH PXWDQWV RQO\ LQYROYH RQH SRVLWLYH VDPSOH IRU HDFK RI WKH /$7 YLUXOHQFH UHFRPELQDQW YLUXVHV WKHUHIRUH WKH EUDLQ UHVWULFWLRQ PD\ EH HYHQ JUHDWHU WKDQ GHSLFWHG LQ WKH JUDSK VKRZQ &ROOHFWLYHO\ WKH WLVVXH H[SHULPHQWV GLVSOD\ D UHVWULFWLRQ LQ LQIHFWLRXV YLUXV SURGXFWLRQ IRU $ DQG $ WKDW LV VSHFLILF IRU QHUYRXV WLVVXH 7KHVH WLVVXH UHVWULFWLRQ UHVXOWV VKRZ WKDW WKH YLUXOHQFH GHILFLHQW PHDVXUHG E\ /' LV GXH WR D UHGXFWLRQ RI $ DQG $ IRU LQIHFWLRXV YLUXV SURGXFWLRQ LQ WKH QHUYRXV V\VWHP &HOO 6SHFLILF 5HSOLFDWLRQ 'HILFLHQF\ 7KH WLVVXH UHVWULFWLRQ UHVXOWV FOHDUO\ GHPRQVWUDWH DQ LPSDLUPHQW RI LQIHFWLRXV YLUXV SURGXFWLRQ WKDW LV VSHFLILF IRU QHUYRXV WLVVXH 7R LGHQWLI\ D SRVVLEOH FHOO VSHFLILF

PAGE 49

SKHQRW\SH IRU $ DQG $ UHSOLFDWLRQ RI WKHVH YLUXVHV ZDV WHVWHG E\ WLPH FRXUVH LQ 3& FHOOV DQG LQ UDEELW VNLQ FHOOV 7KHVH /$7 PXWDQWV ZHUH WHVWHG DORQJ ZLWK V\Q $3VW $5 DQG $5 7KH ILUVW H[SHULPHQW LQYROYHG D PXOWLVWHS WLPH FRXUVH SHUIRUPHG LQ 3& FHOOV 7KH PXOWLVWHS JURZWK FXUYHV ZHUH SHUIRUPHG ZLWK D YLUDO PXOWLSOLFLW\ RI LQIHFWLRQ PRLf RI IRU HDFK YLUXV $ ORZ GRVH RI YLUXV DGPLQLVWHUHG LQ DGGLWLRQ WR PRQLWRULQJ WLPH SRLQWV RYHU VHYHUDO GD\V DOORZV WKH LGHQWLILFDWLRQ RI VXEWOH UHSOLFDWLRQ GLIIHUHQFHV ,Q WKH ILUVW H[SHULPHQWV ZLWK $ DQG $ DV HDUO\ DV KRXUV SRVWn LQIHFWLRQ D IROG UHGXFWLRQ LQ LQIHFWLRXV YLUXV ZDV VHHQ IRU ERWK $ DQG $ LQ 3& FHOOV )LJXUH f 7KLV GHFUHDVH ZDV DOVR VHHQ DW DQG KRXUV SRVW LQIHFWLRQ 7KH H[SHULPHQW ZDV UHSHDWHG ZLWK $ DQG $ EHLQJ WHVWHG LQ WKH VDPH H[SHULPHQW DORQJ ZLWK D IHZ DGGLWLRQDO FRQWUROV $V ZLWK WKH SUHYLRXV H[SHULPHQWV ?OV\Q DQG $5 ZHUH LQFOXGHG DV FRQWUROV EXW DGGLWLRQDOO\ WHVWHG $3VW SURPRWHU PXWDQWf DORQJ ZLWK $5 LQ WKH PXOWLVWHS JURZWK FXUYH )LJXUH f 7KH $3VW UHFRPELQDQW YLUXV ZDV VKRZQ WR ODFN D YLUXOHQFH SKHQRW\SH LQ WKH PRXVH EXW LW ZDV LPSRUWDQW WR FRPSDUH D /$7 UHFRPELQDQW ZLWK DQ DOWHUDWLRQ LQ D UHJLRQ RI /$7 WKDW LV H[SHFWHG QRW WR FRQWDLQ D FHOO VSHFLILF UHSOLFDWLRQ IXQFWLRQ ,Q WKHVH H[SHULPHQWV DQ IROG UHGXFWLRQ ZDV DJDLQ REVHUYHG IRU $ DQG $ )LJXUH f 7KH V\Q $3VW DQG $5 YLUXVHV ZHUH QRW UHVWULFWHG LQ WKH SURGXFWLRQ RI LQIHFWLRXV YLUXV RQ 3& FHOOV 0XOWLVWHS JURZWK FXUYHV ZHUH DOVR SHUIRUPHG LQ UDEELW VNLQ FHOOV )LJXUH f WR WHVW IRU D JHQHUDO JURZWK UHVWULFWLRQ LQ FHOO FXOWXUH 7KHVH UHVXOWV GLG QRW \LHOG D QRWLFHDEOH GLIIHUHQFH LQ YLUXV SURGXFWLRQ DV FRPSDUHG ZLWK FRQWUROV )LJXUH f

PAGE 50

$ VLQJOH VWHS JURZWK FXUYH ZDV DOVR FRQGXFWHG LQ 3& FHOOV XWLOL]LQJ D KLJKHU PRL f DQG VKRUWHU WLPH SRLQWV KRXUV SRVWLQIHFWLRQ )LJXUH f 7KLV H[SHULPHQW WHVWHG IRU GUDPDWLF UHSOLFDWLRQ GLIIHUHQFHV GXH WR WKH KLJKHU GRVH RI YLUXV DQG WKH VKRUWHU WLPH SRLQWV )URP WKHVH UHVXOWV D GLIIHUHQFH EHWZHHQ /$7 PXWDQWV DQG FRQWUROV LV QRW FOHDUO\ HYLGHQW 7RJHWKHU WKHVH GDWD VKRZ WKDW D FHOO VSHFLILF UHSOLFDWLRQ HIIHFW LV VHHQ IRU WKH $ DQG $ /$7 PXWDQWV DW ORZ PXOWLSOLFLWLHV RI LQIHFWLRQ 7KH SKHQRW\SH LV RQO\ REVHUYHG LQ 3& FHOOV DQG LV ODFNLQJ LQ UDEELW VNLQ FHOOV )URP WKHVH GDWD K\SRWKHVL]H WKDW WKH QHXURQDO UHVWULFWLRQ RI $ DQG $ LQ QHUYRXV WLVVXH LV WKH UHVXOW RI JURZWK UHVWULFWLRQ LQ QHXURQV $GGLWLRQDO /$7 5HFRPELQDQW 9LUXVHV ,Q DGGLWLRQ WR WKH /$7 UHFRPELQDQWV HQJLQHHUHG E\ RXU FROODERUDWRU 'U :DJQHU $$D $D5 $ DQG $f LW ZDV QHFHVVDU\ WR FRQVWUXFW WZR DGGLWLRQDO PXWDQWV 2QH QHFHVVDU\ UHFRPELQDQW YLUXV ZDV $5 ZKLFK HQDEOHV YDOLGDWLRQ RI WKH ILQGLQJV IRU $ $QRWKHU PXWDQW $3VW$ ZDV DOVR FRQVWUXFWHG DQG LV EHQHILFLDO LQ XQGHUVWDQGLQJ WKH GLIIHUHQW UHJXODWRU\ UHJLRQV RI WKH /$7 ORFXV DV GHVFULEHG EHORZ $5 7R YHULI\ WKH UHVXOWV REVHUYHG IRU WKH $ PXWDQW LQ YLYR DQG LQ FHOO FXOWXUH WKH PXWDWLRQ ZDV UHVWRUHG LQ D $5 UHFRPELQDQW YLUXV 5HVWRUDWLRQ RI ELRORJLFDO IXQFWLRQ ZDV REVHUYHG E\ PXOWLVWHS WLPH FRXUVH RQ 3& FHOOV )LJXUH f 7KLV PXWDQW LV DOVR EHLQJ FKDUDFWHUL]HG IRU YLUXOHQFH SURSHUWLHV LQ WKH PRXVH IRRWSDG PRGHO

PAGE 51

$3VW$ $QRWKHU UHFRPELQDQW $3VW$ ZDV DOVR HQJLQHHUHG WR FRPSDUH WKH ILQGLQJV IRU WKH $ ZLWK D UHFRPELQDQW WKDW LQFOXGHG D GHOHWLRQ LQ D GLIIHUHQW UHJLRQ RI WKH /$7 ORFXV $V VKRZQ E\ /' DQG WLVVXH UHVWULFWLRQ H[SHULPHQWV $ LV JUHDWO\ UHGXFHG LQ YLUXOHQFH ZKLOH D GHOHWLRQ RI WKH FRUH ODWHQW SURPRWHU $3VWf LV LQGLVWLQJXLVKDEOH IURP SDUHQWDO YLUXV V\UWf 7KLV OHG XV WR EHOLHYH WKDW WKH /$7 ORFXV FRQWDLQV GLIIHUHQW UHJXODWRU\ UHJLRQV DQG WKH LPSDLUPHQW RI PRUH WKDQ RQH RI WKHVH UHJLRQV PD\ PDVN D VHYHUH SKHQRW\SH 7KH $3VW$ YLUXV ZDV D FULWLFDO UHFRPELQDQW IRU WHVWLQJ WKLV K\SRWKHVLV 2XU H[SHFWDWLRQ LV WR VHH DQ LQWHUPHGLDWH YLUXOHQFH SKHQRW\SH UHVLGLQJ EHWZHHQ ZKDW ZH REVHUYHG IRU $ DQG $3VW ,Q WKLV YLUXV DV WKH QDPH LPSOLHV WKH PXWDWLRQ ZDV FRXSOHG ZLWK D FOHDQ GHOHWLRQ LQ WKH ODWHQW FRUH SURPRWHU 7KH UHVXOWLQJ PXWDQW KDV LPSDLUPHQWV LQ WZR SRWHQWLDOO\ GLIIHUHQW UHJXODWRU\ UHJLRQV RI /$7 7KLV ZLOO HQDEOH XV WR FRPSDUH LWV SKHQRW\SHV ZLWK RWKHU PXWDQWV LQ WKH OLWHUDWXUH WKDW FRQWDLQ YHU\ ODUJH GHOHWLRQV LQ WKH /$7 ORFXV 3HPJ HW DO 7KRPSVRQ DQG 6DZWHOO f 7KHVH H[SHULPHQWV DUH FXUUHQWO\ LQ SURJUHVV

PAGE 52

GD\V SRVWLQIHFWLRQ 0HDQ 9DOXHV s 6WDQGDUG (UURU RI WKH 0HDQf GDWD SRLQWV DV SORWWHG DERYHf PHDQWVHP V\Q $3VW $ 3, s s s 3, s s s 3, s s s 3 s s s 3 s s s 3 s s s 3 s s s 3 s s s 3, s s s 3, s s s 3, s s s )LJXUH 5HGXFHG FRUQHDO SDWKRORJ\ RI $ LQ WKH UDEELW H\H PRGHO 7KH JUDSK DW WKH WRS RI WKH ILJXUH LV D PHDVXUHPHQW RI WKH VHYHULW\ RI SDWKRORJ\ RI +69 LQIHFWLRQ LQ WKH UDEELW FRPHD 7KLV ZDV PHDVXUHG E\ VOLW ODPS ZKLFK PHDVXUHV WKH QXPEHU RI GHQGULWHV DQG WKH VHYHULW\ RI WKHLU SDWKRORJ\ LQ WKH FRPHD 7KHVH YDOXHV FORVHO\ FRPSDUH ZLWK LQIHFWLRXV YLPV OHYHOV 9DOXHV EHORZ WKH JUDSK DUH WKH UDZ GDWD WKDW DUH SORWWHG DERYH 7KH JUDSK LQGLFDWHV WKDW $ PD\ KDYH D YLUXOHQFH GHILFLHQW SKHQRW\SH

PAGE 53

7DEOH /' YDOXHVr /'SIX 9DOXHV IRU /$7 0XWDQWV 5RXWH RI ,QIHFWLRQ 9LUXV )RRWSDG ,QWUDFUDQLDO V\Q [ [ $3VW [ [ $ [ [ $D [ [ $D5 [ [ $ [ $ [ 5+$ [ r7KLV LV D PRGLILHG /' DQD \VLV 0LFH ZHUH HXWKDQL]HG RQFH WKH\ GHPRQVWUDWHG DQ LQIHFWLRQ RI WKH FHQWUDO QHUYRXV V\VWHP DQG D FRQVHTXHQW LPSDLUPHQW RI PRWRU IXQFWLRQ D7KH YDOXHV ZHUH UHFRUGHG DV D GRVH VXIILFLHQW WR LQGXFH OHWKDOLW\ IRU KDOI WKH PLFH LQ D JURXS 7ZR URXWHV RI LQIHFWLRQ ZHUH XVHG LQ WKLV H[SHULPHQW IRRWSDG DQG LQWUDFUDQLDO

PAGE 54

SIXJ ( ( ( ( ( ( ( ( O22(22 V\Q G3VW G 9LUXVHV G5 G )LJXUH ,QIHFWLRXV YLUXV UHFRYHUHG IURP PRXVH IHHW DW GD\V SRVWLQIHFWLRQ )HHW ZHUH KRPRJHQL]HG DQG WHVWHG IRU LQIHFWLRXV YLUXV E\ SODTXH DVVD\ RQ 56 FHOOV 9DOXHV DUH UHFRUGHG DV SIXJ WLVVXH

PAGE 55

9LUXVHV % 4 ( ( ( ( ( ( ( O22(22 V\Q G3VW G G5 G 9LUXVHV )LJXUH 9LUXV SURGXFWLRQ LQ GRUVDO URRW JDQJOLD DW DQG GD\V SRVWLQIHFWLRQ '5* ZHUH KRPRJHQL]HG DQG WHVWHG IRU LQIHFWLRXV YLUXV E\ SODTXH DVVD\ RQ 56 FHOOV 9DOXHV DUH UHFRUGHG DV SIXJ WLVVXH $f 7KH JUDSK DW WKH WRS LV IRU GD\V SRVWn LQIHFWLRQ %f 7KH ERWWRP LV IRU '5* DW GSL 7KH GLIIHUHQFH EHWZHHQ $ DQG $5 LV VWDWLVWLFDOO\ VLJQLILFDQW 3 XQSDLUHG W WHVW :HOVFK FRUUHFWHGf

PAGE 56

SIXJ $ ( ( ( ( ( ( ( ( O22(22 V\Q G3VW G G5 G 9LUXVHV % 9LUXVHV )LJXUH 9LUXV SURGXFWLRQ LQ VSLQDO FRUG DW DQG GD\V SRVWLQIHFWLRQ $f 6SLQDO FRUG LQIHFWLRXV YLUXV OHYHOV DW GSL 3 f %f 6SLQDO FRUG DW GSL 3 f

PAGE 57

SIXJ ( ( ( ( ( ( ( ( O22(22 )LJXUH 9LUXV SURGXFWLRQ LQ EUDLQ DW GD\V SRVWLQIHFWLRQ 0RXVH EUDLQV ZHUH KRPRJHQL]HG DQG WLWWHUHG IRU LQIHFWLRXV YLUXV E\ SODTXH DVVD\ RQ 56 FHOOV 9DOXHV DUH SORWWHG DV SIXJ WLVVXH 7KH GLIIHUHQFH EHWZHHQ $ DQG $5 LV VWDWLVWLFDOO\ VLJQLILFDQW 3f DQG WKH GLIIHUHQFH EHWZHHQ $ DQG ?OV\Q LV DOVR VWDWLVWLFDOO\ VLJQLILFDQW 3f DV PHDVXUHG E\ XQSDLUHG W WHVW :HOVFK FRUUHFWHGf V\Q G3VW G G5 G 9LUXVHV

PAGE 58

’ G ‘ G5 +RXUV 3RVW,QIHFWLRQ % ( +RXUV 3RVW,QIHFWLRQ )LJXUH $ DQG $ PXOWLVWHS WLPH FRXUVHV LQ 3& FHOOV $f $ LV VWDWLVWLFDOO\ GLIIHUHQW WKDQ $5 3 f %f $ LV VWDWLVWLFDOO\ GLIIHUHQW WKDQ V\QA 3 f

PAGE 59

SIX PP GLVK ( ( ( ( ( ( ( ( ‘ V\Q ‘ G3VW ’ G ‘ G5 ’ G ‘ G5 +RXUV 3RVW,QIHFWLRQ )LJXUH $5 PXOWLVWHS WLPH FRXUVH LQ 3& FHOOV 7KH /$7 UHFRPELQDQWV $ DQG $ ZHUH WHVWHG E\ PXOWLVWHS JURZWK FXUYH LQ WKH VDPH H[SHULPHQW DORQJ ZLWK $5 DQG $5 ZLWK WKH DGGLWLRQ RI ?OV\Q SDUHQWDOf DQG $3VW SURPRWHU GHOHWLRQf $ ZDV VWDWLVWLFDOO\ GLIIHUHQW IURP $5 3 DW KSL 3 DW KSL 3 DW KSLf DQG $ GLIIHUHG VLJQLILFDQWO\ IURP $5 3 DW KSL 3 DW KSL 3 DW KSLf

PAGE 60

SIX PP GLVK ( ( ( ( ( ( ( ( ( ( +RXUV 3RVW,QIHFWLRQ )LJXUH 0XOWLVWHS WLPH FRXUVH LQ UDEELW VNLQ FHOOV 7KLV LV D FRPSDULVRQ RI LQIHFWLRXV YLUXV SURGXFWLRQ RI $ $D DQG $D5 RQ 56 FHOOV $OO YLUXVHV SURGXFH KLJK OHYHOV RI LQIHFWLRXV YLUXV RQ 56 FHOOV

PAGE 61

SIX PP GLVK ‘ V\Q ’ FO ‘ G5 +RXUV 3RVW,QIHFWLRQ )LJXUH 6LQJOH VWHS WLPH FRXUVH LQ 3& FHOOV $ ZDV FRPSDUHG WR $5 DORQJ ZLWK OOV\QA LQ D VLQJOH VWHS JURZWK FXUYH XWLOL]LQJ DQ LQLWLDO 02, RI

PAGE 62

&+$37(5 ',6&866,21 7KH LQIOXHQFH RI WKH /$7 JHQH XSRQ GLFWDWLQJ WKH RXWFRPH RI WKH ODWHQW SKDVH RI WKH +69 LQIHFWLRQ LV FOHDU 8QFHUWDLQW\ KRZHYHU EHJLQV ZLWK XQGHUVWDQGLQJ f ZKHWKHU /$7 DFWV SULPDULO\ DW WKH OHYHO RI HVWDEOLVKLQJ D ODWHQW LQIHFWLRQ DQG KHOSLQJ WR HLWKHU VXSSUHVV YLUDO UHSOLFDWLRQ DQG SUHYHQW FHOO GHDWK RU f ZKHWKHU LW H[HUWV LWV SULPDU\ LQIOXHQFH DV D PHGLDWRU RI UHDFWLYDWLRQ IURP ODWHQF\ $QRWKHU GLIILFXOW\ LQ GLVVHFWLQJ WKH /$7 JHQHfV UROH KDV EHHQ OLQNLQJ WKH ELRORJLFDOO\ GLYHUVH IXQFWLRQV DWWULEXWHG WR WKH /$7 UHJLRQ ZLWK WKH /$7 51$ LWVHOI DQG ZKHWKHU GLIIHUHQW UHJLRQV RI WKH JHQH PD\ DFWXDOO\ KDYH GLIIHUHQW IXQFWLRQV /$7 SURPRWHU PXWDQWV KDYH EHHQ VHHQ WR KDYH GLIIHUHQW SKHQRW\SHV WKDQ ODUJHU GHOHWLRQV WKDW LQFOXGH WKH SURPRWHU DQG GRZQVWUHDP WUDQVFULSWn HQFRGLQJ VHTXHQFH 7KH JRDO RI WKLV VWXG\ ZDV WR XWLOL]H UHFRPELQDQW YLURORJ\ WR DWWHPSW WR GHILQH WKH JHQHWLF EDVLV IRU /$7 SKHQRW\SHV WKDW PLJKW JR EH\RQG MXVW FRQWUROOLQJ UHDFWLYDWLRQ 9LUXVHV ZLWK DOWHUDWLRQV LQ WKH /$7 UHJLRQ H[KLELW VHYHUH LPSDLUPHQW RI UHDFWLYDWLRQ LQ ERWK WKH LQGXFHG DQG WKH VSRQWDQHRXV UDEELW H\H PRGHOV DQG LQ PRXVH PRGHOV LQYROYLQJ LQIHFWLRQ RI HLWKHU WKH IRRWSDG RU WKH FRUQHD 6SHFLILFDOO\ PXWDWLRQV LQ WKH SURPRWHU DQGRU WKH f UHJLRQ RI H[RQ KDYH PRVW GLVFULPLQDWHO\ UHVXOWHG LQ VHYHUH UHDFWLYDWLRQ GHILFLHQFLHV LQ UDEELW PRGHOV %ORRP HW DO %ORRP HW DO 3HPJ HW DO 3HPJ HW DO 7URXVGDOH HW DO f ,W KDV EHHQ GHEDWHG ZKHWKHU WKHVH HIIHFWV DUH GXH WR GHFUHDVHG UHDFWLYDWLRQ RU DUH WKH UHVXOW RI GHFUHDVHG HVWDEOLVKPHQW RI /$7 PXWDQWV :LWK UHVSHFW WR HDUO\ HYHQWV LQ +69 ODWHQF\ WKH /$7 JHQH KDV EHHQ

PAGE 63

SURSRVHG WR HQKDQFH WKH HIILFLHQF\ RI HVWDEOLVKPHQW 3HPJ HW DO 7KRPSVRQ DQG 6DZWHOO f 7KHVH VWXGLHV ZHUH SHUIRUPHG ZLWK UHODWLYHO\ ODUJH /$7 GHOHWLRQV VR ZKLOH RQH FDQQRW UXOH RXW WKDW D SRUWLRQ RI WKH /$7 JHQH PD\ DFW XSRQ HVWDEOLVKPHQW WKHVH GDWD DUH QRW FRQVLVWHQW ZLWK WKH REVHUYDWLRQ WKDW /$7 SURPRWHU PXWDQWV GR QRW VKRZ LPSDLUHG HVWDEOLVKPHQW DQG LQVWHDG VHHP WR DFW SULPDULO\ DW WKH OHYHO RI UHDFWLYDWLRQ ,Q DGGLWLRQ WR /$7 SURPRWHU PXWDQWV FRQFLVH VPDOO PXWDWLRQV ESf LQ WKH /$7 SURPRWHU DQGRU WKH f UHJLRQ RI H[RQ UHVXOW LQ D GUDPDWLF UHGXFWLRQ bf LQ UHDFWLYDWLQJ YLUXV LQ WKH DEVHQFH RI DQ\ GHWHFWDEOH GLIIHUHQFHV LQ HVWDEOLVKPHQW %ORRP HW DO %ORRP HW DO f ,W KDV EHHQ DUJXHG E\ 6DZWHOO DQG 7KRPSVRQ WKDW WKH /$7 PHGLDWHV LWV HIIHFWV RQ WKH HVWDEOLVKPHQW SKDVH RI WKH ODWHQW LQIHFWLRQ 6DZWHOO DQG 7KRPSVRQ 7KRPSVRQ DQG 6DZWHOO f 7R WHVW IRU DQ HVWDEOLVKPHQW GHFUHDVH WKH\ WHVWHG V\m SDUHQWDOf DORQJ ZLWK $+ ZKLFK LV D GHOHWLRQ RI WKH /$7 SURPRWHU H[RQ DQG KDOI RI WKH NE LQWURQ LQ FRPSDULVRQ WR LWV UHVFXH $+5 7KRPSVRQ DQG 6DZWHOO f 7KHVH YLUXVHV ZHUH WHVWHG IRU D PHDVXUDEOH GLIIHUHQFH LQ HVWDEOLVKPHQW LQ WKH PRXVH 7* DIWHU FRPHDO LQIHFWLRQ ,Q WKHVH H[SHULPHQWV WKH\ UHSRUW D GHFUHDVH RI DSSUR[LPDWHO\ b LQ YLUDO '1$ GHWHFWHG LQ 7* IRU WKH $+ PXWDQW LQ FRPSDULVRQ WR SDUHQWDO YLPV DQG $+5 7KH\ DUJXH WKDW WKHVH UHVXOWV GHPRQVWUDWH DQ HVWDEOLVKPHQW GHFUHDVH VXIILFLHQW WR IDFLOLWDWH WKH UHDFWLYDWLRQ UHGXFWLRQV LQ WKHLU H[SHULPHQWV DQG UHSRUWHG E\ RWKHUV %ORRP HW DO 3HPJ HW DO 3HPJ HW DO f $ ELRORJLFDO PHFKDQLVP K\SRWKHVL]HG WR UHVXOW LQ HVWDEOLVKPHQW GHFUHDVHV LV D GLIIHUHQFH LQ QHXURQDO VXUYLYDO RU DSRSWRVLV IRU /$7 PXWDQWV LQ FRPSDULVRQ WR SDUHQWDO +69 6DZWHOO DQG 7KRPSVRQ SURGXFHG GDWD VXJJHVWLQJ D UROH RI /$7 LQ SURWHFWLQJ

PAGE 64

QHXURQV GXULQJ WKH HVWDEOLVKPHQW RI ODWHQF\ 7KRPSVRQ DQG 6DZWHOO f $ GLIIHUHQFH LQ YLUDO '1$ OHYHOV LQ JDQJOLD EHWZHHQ WKH /$7f PXWDQW $+ DQG LWV UHVFXH $+5 ZDV UHSRUWHG 7KLV GLIIHUHQFH LV SURSRVHG WR RFFXU GXH WR D LQKLELWLRQ RI DSRSWRVLV DQG DQ LQFUHDVH RI VXUYLYLQJ QHXURQV ,Q WKH GHWHUPLQDWLRQ RI QHXURQDO VXUYLYDO LW ZDV UHSRUWHG WKDW $+ KDV D IROG UHGXFWLRQ LQ WRWDO ODWHQW QHXURQV LQ FRPSDULVRQ WR LWV UHVFXH 7KRPSVRQ DQG 6DZWHOO f 7KHVH YLUXVHV ZHUH DOVR WHVWHG IRU GLIIHUHQFHV LQ WKHLU UHODWLYH UHSOLFDWLRQ LQ PRXVH 7* IROORZLQJ FRPHDO LQIHFWLRQ ,QWHUHVWLQJO\ QR GHWHFWDEOH UHSOLFDWLRQ GLIIHUHQFHV ZHUH REVHUYHG LQ FRPHD RU JDQJOLD ,I WKHVH YLUXVHV GR H[SUHVV QHXURQDO VXUYLYDO SKHQRW\SHV RQH ZRXOG H[SHFW WR VHH D UHSOLFDWLRQ GLIIHUHQFH EHWZHHQ /$7f DQG /$7f YLUXVHV $ YLUXOHQFH SKHQRW\SH ZRXOG DOVR EH H[SHFWHG LI /$7 SOD\V D UROH LQ QHXURQDO VXUYLYDO DQGRU DSRSWRVLV LQ YLYR $ SRUWLRQ RI WKH /$7 JHQH KDV EHHQ VKRZQ E\ :HFKVOHU 3HPJ HW DO f WR VWLPXODWH DSRSWRVLV LQ WUDQVLHQW WUDQVIHFWLRQ LQ FHOO FXOWXUH WKURXJK VXSSUHVVLRQ RI UHFHSWRUPHGLDWHG FDVSDVHf DQG PLWRFKRQGULDOPHGLDWHG FDVSDVHf SDWKZD\V 3HPJ HW DO f 5HVXOWV LQ YLYR ZLWK WKH ODUJH /$7 PXWDQWV GHPRQVWUDWHG D UHGXFWLRQ LQ HVWDEOLVKPHQW OHYHOV OHDGLQJ WR D VLJQLILFDQW ORVV RI VHQVRU\ QHXURQV 3HPJ HW DO 7KRPSVRQ DQG 6DZWHOO f 7UDQVLHQW WUDQVIHFWLRQ RI ,05 DQG &9 FHOOV ZLWK D SODVPLG FRQWDLQLQJ WKH f UHJLRQ RI WKH /$7 H[RQ DQG PRVW RI WKH LQWURQ ZDV DEOH WR SURWHFW WKH PDMRULW\ RI FHOOV IURP FHUDPLGH RU IXPRQLVLQ %LLQGXFHG DSRSWRVLV 3HPJ HW DO 7KRPSVRQ DQG 6DZWHOO f ([SUHVVLRQ RI WKH ERYLQH KHUSHVYLUXV /$7 -RQHV HW DO f RU SRUWLRQV RI WKH +69 /$7 JHQH LQKLELW FKHPLFDOO\ LQGXFHG DSRSWRVLV LQ FHOO FXOWXUH -RQHV HW DO 3HPJ HW DO f

PAGE 65

7KH /$7 HIIHFWV RQ DSRSWRVLV DSSHDU WR EH FHOO VSHFLILF ,Q FXOWXUH /$7 LV XQDEOH WR SURWHFW RU &26 FHOOV IURP DSRSWRVLV ,QPDQ HW DO f ,W LV FOHDU WKDW /$7 GRHV LQGXFH DSRSWRVLV LQ FHUWDLQ FHOO OLQHV XVLQJ WUDQVLHQW WUDQVIHFWLRQ DVVD\V ZLWK KLJK PXOWLSOLFLWLHV RI LQIHFWLRQ DQG KLJK H[SUHVVLRQ OHYHOV 3HPJ HW DO f 7KHVH UHVXOWV DUH YHU\ LQWHUHVWLQJ EXW LW LV XQFHUWDLQ LI /$7 SOD\V DQ DSRSWRWLF UROH LQ WKH FRQWH[W RI ZKROH YLUXV DQG LQ DQLPDO PRGHOV 7KHVH ILQGLQJV ZHUH XVHG WR GHYHORS WKH K\SRWKHVLV RI DQ DSRSWRWLF IXQFWLRQ RI /$7 LQ 7* DQG WKDW /$7 PXWDQWV UHVXOW LQ JUHDWHU OHYHOV RI DSRSWRVLV ZLWKLQ VHQVRU\ JDQJOLD 8QIRUWXQDWHO\ DQ DSRSWRWLF UROH RI /$7 KDV QRW EHHQ DGHTXDWHO\ SURYHQ LQ ZKROH YLUXV RU LQ DQLPDO PRGHOV 7KH QHXURQDO VXUYLYDO DQG DSRSWRVLV UHVXOWV SUHVHQW D SRWHQWLDO DGGLWLRQDO UROH RI WKH /$7 ORFXV XSRQ WKH DFXWH LQIHFWLRQ DQG WKH HVWDEOLVKPHQW RI ODWHQF\ DOWKRXJK WKH PXWDQWV XVHG LQ WKHVH H[SHULPHQWV GR QRW DGHTXDWHO\ DOORZ WKH LGHQWLILFDWLRQ RI D YLUXOHQFH IXQFWLRQ GLVWLQFW IURP ODWHQF\ SKHQRW\SHV $QDO\VLV RI D VHULHV RI +69 UHFRPELQDQWV FRQWDLQLQJ GHOHWLRQV LQ WKH UHJLRQ NQRZQ WR EH UHTXLUHG IRU UHDFWLYDWLRQ LGHQWLILHG D GHOHWLRQ WKDW H[KLELWHG GHFUHDVHG SDWKRORJ\ LQ WKH UDEELW H\H GXULQJ WKH DFXWH LQIHFWLRQ :H K\SRWKHVL]HG WKDW WKLV PLJKW UHSUHVHQW D VHSDUDWH IXQFWLRQ HQFRGHG E\ WKH /$7 UHJLRQ DQG VRXJKW WR VWXG\ WKLV UHFRPELQDQWfV YLUXOHQFH LQ WKH ZHOOGHILQHG PRXVH PRGHO /' DQDO\VLV DQG LQIHFWLRXV YLUXV SURGXFWLRQ LQ QHXURQDO DQG QRQQHXURQDO WLVVXHV UHYHDOHG WKDW WKLV PXWDQW ZDV GUDPDWLFDOO\ UHVWULFWHG LQ YLUXOHQFH $GGLWLRQDO DQDO\VHV DOVR LQFOXGHG $ DQG $ ZKLFK KDYH EHHQ GHVFULEHG SUHYLRXVO\ -DUPDQ HW DO f DQG LQYROYH PXWDWLRQV LQ WKH UHJLRQ RI WKH /$7 LQWURQ $QDO\VLV RI WKH /$7 PXWDQWV $ DQG $ DQG WKHLU UHVFXHV LQ WKH PRXVH PRGHO UHYHDOHG D GUDPDWLF LPSDFW RI WKLV UHJLRQ RI WKH /$7 JHQH RQ WKH DFXWH

PAGE 66

LQIHFWLRQ RI +69 )URP WKH /'RSIX YDOXHV IURP ERWK D IRRWSDG URXWH RI LQIHFWLRQ DQG IURP DQ LQWUDFUDQLDO LQIHFWLRQ D JUHDWHU WKDQ IROG UHGXFWLRQ RFFXUV LQ WKH $ DQG $ PXWDQWV LQ FRPSDULVRQ WR ?OV\Q SDUHQWDOf $3VW SURPRWHU PXWDQWf $5 DQG $ 7KH GUDPDWLF UHGXFWLRQ LQ YLUXOHQFH E\ HDFK URXWH RI LQIHFWLRQ SURYHV D QHXURYLUXOHQFH SKHQRW\SH IRU WKHVH YLUXVHV DQG LV QRW VLPSO\ GXH WR D QHXURLQYDVLYH HIIHFW 6RPH YLUXOHQFH HIIHFWV KDYH EHHQ UHSRUWHG IRU /$7 PXWDQWV 7KRPSVRQ DQG 6DZWHOO 3HPJ HW DO f EXW QRQH KDYH H[KLELWHG VXFK VHYHUH GHYLDWLRQV IURP ZLOGW\SH DQG UHVFXDQW YLUXVHV 7KHVH GDWD GHPRQVWUDWH D YLUXOHQFH IXQFWLRQ RI +69 ORFDOL]HG WR WKH f UHJLRQ RI H[RQ DQG WKH f LQWURQ RI WKH ODWHQF\ DVVRFLDWHG WUDQVFULSW ORFXV 9LUXOHQFH 3KHQRW\SH DQG 1HUYRXV 7LVVXH 5HVWULFWLRQ 7KH /'SIX GHWHUPLQDWLRQV RI $ DQG $ ZHUH D WHVW RI WKHLU DELOLW\ WR LQGXFH HQFHSKDOLWLV LQ WKH PRXVH PRGHO ,Q DGGUHVVLQJ WKH EDVLV IRU WKLV LPSDLUPHQW VSLQDO FRUG DQG EUDLQ ZHUH DOVR DQDO\]HG IRU UHODWLYH YLUDO \LHOGV LQ WKHVH WLVVXHV E\ SODTXH DVVD\ 7LWUDWLRQV RI WKHVH WLVVXHV DJDLQ VKRZHG UHVWULFWLRQ LQ UHSOLFDWLRQ LQ QHUYRXV WLVVXH IRU $ DQG $ %RWK RI WKHVH /$7 PXWDQWV ZHUH GUDPDWLFDOO\ UHVWULFWHG LQ YLUDO \LHOGV LQ WKH VSLQDO FRUG DQG LQ WKH EUDLQ 7KHVH UHVXOWV FRXOG SRVVLEO\ EH GXH WR DQ LQLWLDO UHVWULFWLRQ LQ WKH '5* ZKLFK ZRXOG OHDG WR ORZHU VHHGLQJ RI WKH VSLQDO FRUG DQG FRQVHTXHQWO\ WKH EUDLQ 7KLV LV XQOLNHO\ WKRXJK EHFDXVH GLUHFW LQWUDFUDQLDO LQRFXODWLRQV DQG /'VRSIX GHWHUPLQDWLRQV DOVR VKRZHG D VLJQLILFDQW UHGXFWLRQ LQ YLUXOHQFH DV RFFXUUHG ZLWK WKH IRRWSDG URXWH RI LQIHFWLRQ VXJJHVWLQJ WKDW WKH UHVWULFWLRQ LQ WKH QHUYRXV WLVVXH LV PRUH JHQHUDO

PAGE 67

7ZR SRVVLEOH H[SODQDWLRQV IRU WKH GHFUHDVHG YLUXOHQFH RI $ DQG $ LQ WKH PRXVH PRGHO DUH HLWKHU D JOREDO UHVWULFWLRQ RI WKHVH PXWDQWV WR UHSOLFDWH LQ PXULQH WLVVXH RU D WLVVXH VSHFLILF UHSOLFDWLRQ SKHQRW\SH LQ QHXURQV ,Q WHVWLQJ ERWK HSLGHUPDO DQG QHUYRXV WLVVXH LQIHFWHG LQ WKH PRXVH IRRWSDG PRGHO DQG WKH VXFFHVVLYH SDWK RI LQIHFWLRQ LQ WKH QHUYRXV V\VWHP LW ZDV GHWHUPLQHG WKDW WKH YLUXOHQFH SKHQRW\SH LV WKH FDXVHG E\ D WLVVXH VSHFLILF UHVWULFWLRQ RI WKH GRZQVWUHDP /$7 PXWDQWV $IWHU IRRWSDG LQIHFWLRQ $ DQG $ DUH LQGLVWLQJXLVKDEOH LQ LQIHFWLRXV YLPV OHYHOV LQ FRPSDULVRQ WR $5 ?OV\Q DQG $3VW SURYLQJ WKDW WKHVH PXWDWLRQV GR QRW KDYH D JHQHUDO UHSOLFDWLRQ UHVWULFWLRQ LQ YLYR 7KHVH /$7 PXWDQWV ZHUH HTXDO LQ SIX SURGXFWLRQ DW GD\V SRVWLQIHFWLRQ ZKLFK KDV EHHQ VKRZQ SUHYLRXVO\ LQ RXU ODE WR EH WKH SHDN WLPH RI +69 LQIHFWLRQ LQ WKH PRXVH IRRWSDG PRGHO -DUPDQ HW DO f $IWHU LQIHFWLRQ RI WKH IRRW YLPV WKHQ HQWHUV WKH SHULSKHUDO QHUYRXV V\VWHP E\ HQWHULQJ LQQHUYDWLQJ QHUYH WHUPLQL LQ WKH HSLGHUPLV 9LPV WKHQ WUDYHOV YLD WKH VFLDWLF QHUYH WR WKH GRUVDO URRW JDQJOLD ,Q H[DPLQJ '5* IRU YLPV SURGXFWLRQ $ ZDV GHFUHDVHG LQ LQIHFWLRXV YLPV ORDG DW GD\V SRVWLQIHFWLRQ ,QWHUHVWLQJO\ $ GLG QRW GLVSOD\ D GHWHFWDEOH UHGXFWLRQ LQ LQIHFWLRXV OHYHOV DW GD\V EXW GLG KDYH D VLJQLILFDQW UHVWULFWLRQ E\ GD\V SRVWLQIHFWLRQ $ ZDV UHVWULFWHG DW WKLV WLPH SRLQW DV ZHOO IRU GRUVDO URRW JDQJOLD 7KH YLPOHQFH HIIHFWV RI $ DQG $ LQ WKH PRXVH DUH GXH WR WLVVXH VSHFLILF UHVWULFWLRQ RI WKHVH PXWDQWV LQ QHUYRXV WLVVXH &HOO &XOWXUH 3KHQRW\SH $ QHUYRXV WLVVXH UHVWULFWLRQ ZDV FOHDUO\ REVHUYHG LQ WKH PRXVH PRGHO EXW LW ZDV XQFHUWDLQ ZKHWKHU WKLV HIIHFW ZDV FDXVHG E\ D QHXURQDO FHOO W\SH RU IURP VXSSRUWLQJ FHOOV LQ JDQJOLD 7R WHVW IRU D FHOO VSHFLILF UHSOLFDWLRQ LPSDLUPHQW $ DQG $

PAGE 68

PXWDQWV ZHUH DQDO\]HG IRU UHSOLFDWLRQ LQ 3& FHOOV SKHRFKURPRF\WRPD FHOOVf DQG 56 FHOOV LQ WLPH FRXUVH H[SHULPHQWV 7KH 3& FHOOV ZHUH FKRVHQ GXH WKHLU FORVH GHYHORSPHQWDO UHODWLRQVKLS ZLWK QHXURQV %RWK WKH 3& FHOOV DQG WKH 56 FHOOV ZHUH WHVWHG IRU LQIHFWLRQ YLUXV SURGXFWLRQ LQ PXOWLVWHS DQG VLQJOH VWHS JURZWK FXUYHV )URP WKHVH H[SHULPHQWV $ DQG $ HDFK GLVSOD\HG DQ IROG UHVWULFWLRQ LQ SODTXH IRUPLQJ XQLW SURGXFWLRQ RQ 3& FHOOV E\ KRXUV SRVWLQIHFWLRQ DW ORZ PXOWLSOLFLWLHV RI LQIHFWLRQ LQ FRPSDULVRQ WR ?OV\Q $3VW $5 DQG $5 :KHQ FRPSDUHG LQ WKH 56 FHOOV DOO YLUXVHV WHVWHG UHSOLFDWHG WR LQGLVWLQJXLVKDEOH OHYHOV 7KLV UHVXOW ZDV QRW XQH[SHFWHG GXH WR ZKDW ZDV VHHQ IRU UHSOLFDWLRQ YDOXHV IURP IHHW LQ WKH WLVVXH UHVWULFWLRQ H[SHULPHQWV 7RJHWKHU WKHVH UHVXOWV LQGLFDWH WKDW WKH UHVWULFWLRQ VSHFLILF IRU QHUYRXV WLVVXH LV GXH WR UHGXFHG UHSOLFDWLRQ RU DW OHDVW GHFUHDVHG LQIHFWLRXV YLUXV SURGXFWLRQ LQ QHXURQV $V PHQWLRQHG SUHYLRXVO\ IURP LQLWLDO FKDUDFWHUL]DWLRQ RI WKHVH PXWDQWV D VHYHUH UHGXFWLRQ LQ HSLQHSKULQHLQGXFHG UHDFWLYDWLRQ LQ WKH UDEELW H\H PRGHO ZDV HYLGHQW IRU $ ,Q FRQWUDVW $ GLG QRW H[KLELW D UHDFWLYDWLRQ SKHQRW\SH LQ FRPSDULVRQ WR V\Q SDUHQWDOf RU $3VW ODWHQW SURPRWHU PXWDQWf 7KH UHJLRQ DOWHUHG LQ WKH $ PXWDQW PD\ LQFOXGH WKH f UHJLRQ RI WKH UHDFWLYDWLRQ FULWLFDO SRUWLRQ RI WKH /$7 ORFXV DQG D YLUXOHQFH UHJLRQ 7KH $ VKRZV D VHSDUDWLRQ RI YLUXOHQFH IURP UHDFWLYDWLRQ SURYLGLQJ HYLGHQFH IRU DQRWKHU UHJXODWRU\ UHJLRQ RI WKH /$7 JHQH /$7 0XWDQWV DQG 0XOWLSOH 5HJXODWRU\ )XQFWLRQV 0DQ\ RI WKH /$7 PXWDQWV GHVFULEHG LQ WKH OLWHUDWXUH LQYROYH PXWDWLRQ RI D YHU\ ODUJH SRUWLRQ !ONEf RI WKH /$7 ORFXV 7ZR RI WKHVH PXWDQWV DUH G/$7 DQG $+ DQG HDFK LQYROYHV PXWDWLRQ RI WKH ODWHQW SURPRWHU H[RQ DQG KDOI RI WKH LQWURQ

PAGE 69

3HPJ HW DO 7KRPSVRQ DQG 6DZWHOO f ([DPLQDWLRQ RI WKHVH PXWDQWV IDLOHG WR UHYHDO GUDPDWLF YLUXOHQFH SKHQRW\SHV 7KHVH YLUXVHV GR VKRZ ODWHQW SKHQRW\SHV DV GHVFULEHG E\ RWKHU PXWDQWV WKDW HQJLQHHUHG FKDQJHV LQWR WKH f SRUWLRQ RI H[RQ %ORRP HW DO 3HPJ HW DO f 7KH PXWDQW G/$7 LV LQGLVWLQJXLVKDEOH IURP SDUHQWDO RU LWV UHVFXH LQ FHOO FXOWXUH UHSOLFDWLRQ FRPHDO UHSOLFDWLRQ RU SIX SURGXFWLRQ LQ WKH 7* RI WKH UDEELW 3HPJ HW DO f 6LPLODUO\ QR UHSOLFDWLRQ GLIIHUHQFHV ZHUH REVHUYHG IRU $+ LQ FHOO FXOWXUH FRPHD DQG 7* 7KRPSVRQ DQG 6DZWHOO f 7KH IDFW WKDW WKHVH UHFRPELQDQWV GR QRW GLVSOD\ D FOHDU YLUXOHQFH HIIHFW LQ DQLPDO PRGHOV FRXSOHG ZLWK WKH GDWD VKRZQ KHUH IRU WKH $ DQG $ /$7 UHFRPELQDQWV VXJJHVWV WKDW WKH /$7 ORFXV FRQWDLQV VHYHUDO GLVWLQFW UHJXODWRU\ UHJLRQV )LJXUH f 7KHVH UHJLRQV DUH LQYROYHG LQ GLIIHUHQW VWDJHV RI +69 LQIHFWLRQ LQ WKH PRXVH PRGHO 7KH UHFRPELQDQW YLUXVHV $ DQG $ GLVSOD\ VHYHUH YLUXOHQFH UHGXFWLRQV LQ WKH PRXVH IRRWSDG PRGHO $QRWKHU LQWHUHVWLQJ SKHQRW\SH IRU WKHVH PXWDQWV LV WKHLU GLIIHUHQFH LQ UHDFWLYDWLRQ DELOLWLHV LQ WKH HSLQHSKULQHLQGXFHG UDEELW H\H PRGHO 5HDFWLYDWLRQ LV VLJQLILFDQWO\ UHGXFHG IRU $ DQG DV REVHUYHG LQ WKLV UHSRUW WKH PXWDQW DOVR VKRZV GHFUHDVHG YLUXOHQFH )URP WKH HVWDEOLVKPHQW K\SRWKHVLV RI 6DZWHOO DQG 7KRPSVRQ LW PD\ VHHP WKDW $ LV VLPSO\ LQKLELWHG LQ LWV DELOLW\ WR SURWHFW QHXURQV DQG FRQVHTXHQWO\ UHVXOWV LQ ORZHU YLUXOHQFH LQ WKH DFXWH LQIHFWLRQ DQG ORZHU JHQRPH OHYHOV IRU WKH DELOLW\ WR UHDFWLYDWH 7KH SUREOHP ZLWK WKLV LQWHUSUHWDWLRQ VWHPV IURP WKH DFXWH DQG ODWHQW SKHQRW\SHV RI WKH $ PXWDQW 7KLV YLPV GRHV GLVSOD\ D YLUXOHQFH SKHQRW\SH DV REVHUYHG IRU $ EXW LV GHYRLG RI D UHDFWLYDWLRQ SKHQRW\SH 7KHUHIRUH WKH YLUXOHQFH SKHQRW\SH FDQQRW EH H[SODLQHG E\ D ORZHU DPRXQW RI '1$ VHHGLQJ WKH JDQJOLD

PAGE 70

7RJHWKHU WKHVH GDWD DUJXH IRU WKH SUHVHQFH RI D YLUXOHQFH UHJLRQ LQ WKH /$7 ORFXV FOHDU DQG GLVWLQFW IURP D UHDFWLYDWLRQ FULWLFDO UHJLRQ )LJXUH f 7KH YLUXOHQFH SKHQRW\SHV IRU WKH G/$7 DQG $+ YLUXVHV DUH QRW VHYHUH DQG WKH QHW UHVXOW RI GHOHWLQJ D ODUJH UHJLRQ RI /$7 HQFRPSDVVLQJ PXOWLSOH JHQHWLF HOHPHQWV PD\ EH D SKHQRW\SH WKDW LV OHVV VHYHUH WKDQ GHOHWLQJ VLQJOH HOHPHQWV LQGLYLGXDOO\ 0\ K\SRWKHVLV LV WKDW PXWDWLRQ RI D FRPELQDWLRQ RI SRWHQWLDOO\ RSSRVLQJ UHJXODWRU\ UHJLRQV PD\ UHVXOW LQ WKH PDVNLQJ RI D FOHDU DFXWH SKHQRW\SH 7R DGGUHVV WKLV SRVVLELOLW\ ZH HQJLQHHUHG D PXWDQW WKDW UHPRYHV WKH FRUH HOHPHQW RI WKH ODWHQW SURPRWHU DORQJ ZLWK WKH H[FKDQJH RI D ES UHJLRQ RI WKH f LQWURQ RI /$7 ZLWK D ODF= VWXIIHU VHTXHQFH 7KLV PXWDQW $3VW$ DV WKH QDPH VXJJHVWV LV VLPSO\ WKH FRPELQDWLRQ RI WKH $3VW DQG WKH $ PXWDQWV 7KH YLUXOHQFH FKDUDFWHULVWLFV RI WKLV PXWDQW DUH FXUUHQWO\ EHLQJ H[DPLQHG (VWDEOLVKPHQW GLIIHUHQFHV ZHUH VHHQ ZLWK ODUJH /$7 GHOHWLRQV EXW WKH UHJXODWRU\ HOHPHQW ZDV QRW ZHOO GHILQHG 7KH DSRSWRVLV DQG QHXURQDO VXUYLYDO UHVXOWV ZHUH REWDLQHG XVLQJ PXWDQWV ZLWK D ODUJH UHJLRQ RI VKDUHG VHTXHQFH UHPRYHG )URP FRPSDULVRQ RI WKH PXWDQWV DQG ZKDW KDV EHHQ VKRZQ IRU WKH LQYROYHPHQW RI WKH f UHJLRQ RI H[RQ LQ UHDFWLYDWLRQ LW ZRXOG VHHP WKDW WKH UHJLRQ RI WKH /$7 ORFXV LQYROYHG LQ HVWDEOLVKPHQW QHXURQDO VXUYLYDO DQG SRVVLEO\ DSRSWRVLV PDSV WR WKH f UHJLRQ RI H[RQ DQG WKH f SRUWLRQ RI WKH LQWURQ 2XU GDWD VKRZV WKDW VPDOO FRQFLVH PXWDWLRQV LQ WKLV UHJLRQ RI WKH /$7 ORFXV GR UHVXOW LQ GUDPDWLF YLUXOHQFH UHVXOWV 0HFKDQLVP )URP WKH YLUXOHQFH GDWD IRU WKH UHFRPELQDQWV $ DQG $ LW LV FOHDU WKDW D GRZQVWUHDP UHJLRQ RI /$7 LQYROYLQJ WKH HQG RI H[RQ DQG WKH EHJLQQLQJ RI WKH NE

PAGE 71

LQWURQ LV DFWLQJ XSRQ WKH VHYHULW\ RI DFXWH LQIHFWLRQ DQG SRVVLEO\ WKH HVWDEOLVKPHQW RI ODWHQF\ 7KLV UHJLRQ PD\ IXQFWLRQ WR SURWHFW QHXURQV LQ YLYR DV SURSRVHG E\ 7KRPSVRQ DQG 6DZWHOO 7KRPSVRQ DQG 6DZWHOO f 2Q WKH PROHFXODU OHYHO D IHZ SRVVLEOH PHFKDQLVPV FDQ EH HQYLVLRQHG )LUVW LW LV SRVVLEOH WKDW WKLV UHJLRQ RI WKH /$7 ORFXV LQYROYHV D VHFRQGDU\ SURPRWHU $QRWKHU SRWHQWLDO PHFKDQLVP LV WKURXJK GLIIHUHQWLDO WUDQVFULSWLRQDO SHUPLVVLYLW\ RI WKH /$7 UHJLRQ /DVWO\ WKH /$7 ORFXV PD\ HQFRGH DQ HQKDQFHUVLOHQFHU UHJLRQ IXQFWLRQLQJ WR UHJXODWH WKH ,&32 SURPRWHU /\WLF 3URPRWHU LQ WKH /$7 5HJLRQ $ VHFRQG SURPRWHU LQ WKH /$7 JHQH ZDV LGHQWLILHG E\ XVH RI WUDQVLHQW WUDQVIHFWLRQV LQ FHOO FXOWXUH *RLQV HW DO f 6HTXHQFH LQYROYLQJ H[RQ ZDV DEOH WR GULYH WUDQVFULSWLRQ RI D ODF= UHSRUWHU LQ 9HUR FHOOV DQG ZDV GHVLJQDWHG DV /$3 *RLQV HW DO f 'LVFRYHU\ RI WKLV SURPRWHU UHVXOWHG LQ LWV XQIRUWXQDWH GHVLJQDWLRQ DV D ODWHQW SURPRWHU ,Q LWV LQLWLDO FKDUDFWHUL]DWLRQ WKH VHFRQGDU\ SURPRWHU ZDV VKRZQ WR EH WUDQVFULSWLRQDOO\ DFWLYH LQ 9HUR FHOOV DQG FRQVHTXHQWO\ GHPRQVWUDWHV LWV DELOLW\ WR H[SUHVV 51$ GXULQJ D O\WLF LQIHFWLRQ 6LQFH WKH GDWD IRU $ GHPRQVWUDWHV D IXQFWLRQ IRU WKLV DUHD RI WKH /$7 JHQH XSRQ WKH DFXWH LQIHFWLRQ DQG GRHV QRW UHVXOW LQ D GHWHFWDEOH UHDFWLYDWLRQ SKHQRW\SH WKH VHFRQGDU\ SURPRWHU ZRXOG EH H[SHFWHG WR EH DFWLYH GXULQJ DQ DFXWH LQIHFWLRQ 7KHUHIRUH WKH /$7 ORFXV ZRXOG KDYH VHSDUDWH RSSRVLQJ SURPRWHUV RQH IXQFWLRQLQJ LQ D ODWHQW LQIHFWLRQ WR DFW XSRQ UHDFWLYDWLRQ DQG RQH RSHUDWLQJ LQ WKH DFXWH LQIHFWLRQ LQ JDQJOLD 0XOWLSOH RWKHU WUDQVFULSWV KDYH EHHQ SURSRVHG IRU WKH /$7 UHJLRQ EXW KDYH QRW EHHQ ZHOO PDSSHG DQG WKHLU NLQHWLFV DQG FHOO VSHFLILF H[SUHVVLRQ DUH SRRUO\ XQGHUVWRRG 2XU ODE KDV GHWHFWHG H[SUHVVLRQ RI D 51$ PROHFXOH LQ WKLV UHJLRQ IURP D ODWHQW SURPRWHU PXWDQW

PAGE 72

$3VWf DQG PDSSLQJ RI WKLV SRWHQWLDO WUDQVFULSW LV FXUUHQWO\ XQGHUZD\ 7KH XVH RI DQRWKHU SURPRWHU LQ WKH /$7 ORFXV LV SRVVLEOH GXH WR WKH RSSRVLQJ YLUXOHQFH DQG UHDFWLYDWLRQ SKHQRW\SHV VHHQ IRU $3VW /$3 PXWDQWf DQG WKH $ PXWDQW ,I RQO\ D SULPDU\ NE WUDQVFULSW LV H[SUHVVHG DQG D VXEVHTXHQWO\ VSOLFHG LQWURQ WKDQ LW ZRXOG EH XQXVXDO WKDW UHPRYDO RI D GRZQVWUHDP UHJLRQ LH $f ZRXOG JLYH D YLUXOHQFH SKHQRW\SH ZKHQ UHPRYDO RI LWV FRUH SURPRWHU $3VWf GRHV QRW DIIHFW WKH DFXWH LQIHFWLRQ 7KLV DUJXHV VWURQJO\ WKDW WKH\ DUH VHSDUDWH DQG SHUKDSV RSSRVLQJ HOHPHQWV 7UDQVFULSWLRQDO 3HUPLVVLYLW\ ,W LV DOVR SRVVLEOH WR PRGHO DQ DFWLRQ IURP D WUDQVFULSWLRQ DFFHVVLELOLW\ K\SRWKHVLV 'XULQJ ODWHQF\ ZH NQRZ WKDW /$7 LV WKH RQO\ DEXQGDQWO\ H[SUHVVHG JHQH RI +69 7KH RWKHU JHQHV RI +69 DUH WLJKWO\ UHSUHVVHG ,Q H[DPLQDWLRQ RI WKH PHFKDQLVP IRU WKLV GUDPDWLF GLIIHUHQFH RXU ODE VKRZHG WKDW WKH /$7 UHJLRQ LV SUHVHQW LQ D WUDQVFULSWLRQDOO\ SHUPLVVLYH VWDWH GXULQJ ODWHQF\ DV VHHQ ZLWK KLVWRQH DFHW\ODWLRQ GDWD .XEDW HW DO f 7KH VHYHULW\ RI DFXWH LQIHFWLRQ PD\ DOVR UHVXOW IURP DOWHUDWLRQV LQ WKH WUDQVFULSWLRQDO DFFHVVLELOLW\ RI WKH /$7 DQG VXUURXQGLQJ JHQHV ,W LV SRVVLEOH WKDW WKH UHJLRQ GHOHWHG LQ WKH $ DQG $ PXWDQW FRPSULVHV D NH\ VLWH IRU WKH WUDQVFULSWLRQDO SHUPLVVLYLW\ RI /$7 DQG SRVVLEO\ WKH QHLJKERULQJ DQWLVHQVH JHQH ,&32 ,QIOXHQFH RQ ,&32 LV HVSHFLDOO\ OLNHO\ VLQFH LV IXQFWLRQV DV D NH\ WUDQVFULSWLRQDO DFWLYDWRU RI DOO FODVVHV RI +69 JHQHV 7KH /$7 YLUXOHQFH ORFXV FRXOG IXQFWLRQ WR GRFN WUDQVFULSWLRQ IDFWRUV ZKLFK H[HUW WKHLU HIIHFWV XSRQ HLWKHU WKH ODWHQW /$7 SURPRWHU RU SRVVLEO\ WKH ,&32 SURPRWHU $Q LPSDLUPHQW RI WKLV UHJLRQ WR UHFUXLW WKH ELQGLQJ RI FHOOXODU RU YLUDO IDFWRUV SUHVHQW H[SOLFLWO\ LQ JDQJOLD ZKLFK DUH LQYROYHG LQ ,&32 H[SUHVVLRQ ZRXOG UHVXOW LQ D GHFUHDVH LQ UHSOLFDWLRQ DQG VHYHULW\ RI LQIHFWLRQ

PAGE 73

,&32 (QKDQFHU $QRWKHU SRVVLEOH PHFKDQLVP IRU WKH YLUXOHQFH UHJLRQ RI /$7 LV WKURXJK WUDQVFULSWLRQDO UHJXODWLRQ RI WKH ,&32 SURPRWHU ,W PD\ QRW VLPSO\ IXQFWLRQ WKURXJK D WUDQVFULSWLRQDO SHUPLVVLYLW\ K\SRWKHVLV DV GHVFULEHG DERYH EXW FRXOG GLUHFWO\ HQKDQFH WKH H[SUHVVLRQ RI ,&32 'XULQJ WKH O\WLF LQIHFWLRQ WKH HQKDQFHU HQFRGHG LQ WKH /$7 ORFXV ZRXOG LQFUHDVH H[SUHVVLRQ IURP WKH ,&32 SURPRWHU GLUHFWO\ E\ D ORRSLQJ PHFKDQLVP $GGLWLRQDOO\ K\SRWKHVL]H WKLV RFFXUV LQ D QHXURQVSHFLILF PDQQHU ,Q DFXWH LQIHFWLRQ WKH HQKDQFHU ZRXOG DVVRFLDWH ZLWK WUDQVFULSWLRQ IDFWRUV SUHVHQW LQ QHXURQV WR SURPRWH H[SUHVVLRQ RI ,&32 7KH PXWDWLRQV LQWURGXFHG LQWR WKH /$7 ORFXV LQ WKH $ DQG $ UHFRPELQDQW LPSDLU WKLV HQKDQFHU IXQFWLRQ ,&32 LV FRQVHTXHQWO\ ORZHU LQ QHXURQDO WLVVXH DQG OHDGV WR D JHQHUDO GHFUHDVH LQ +69 JHQH H[SUHVVLRQ 7KLV GHFUHDVH FDXVHV ORZHU YLUDO SURGXFWLRQ DQG D PLOGHU LQIHFWLRQ LQ WKH PRXVH PRGHO $Q HQKDQFHU IXQFWLRQ LQYROYLQJ WKH /$7 ORFXV DQG QHXURQDO VSHFLILF IDFWRUV ZRXOG H[SODLQ ZK\ WKH YLUXOHQFH HIIHFWV ZHUH VSHFLILF IRU QHUYRXV WLVVXH )XWXUH H[SHULPHQWV DUH DLPHG DW GHWHUPLQLQJ LI D VHFRQGDU\ SURPRWHU LV DFWLYH LQ WKH /$7 ORFXV DQG PDSSLQJ RI VXEVHTXHQW 51$ PROHFXOHV $GGLWLRQDOO\ RXU ODE ZLOO DQDO\]H WKH ,&32 SURPRWHU UHJLRQ IRU GLIIHUHQFHV LQ WUDQVFULSWLRQ ZLWK WKH YLUXOHQFH PXWDQWV DQG IRU SRVVLEOH FKDQJHV LQ WUDQVFULSWLRQDO SHUPLVVLYLW\

PAGE 74

$ $ 5HJLRQ RI PXWDWLRQ 5HDFWLYDWLRQ 9LUXOHQFH )LJXUH 6HSDUDWH JHQHWLF UHJLRQV RI WKH /$7 ORFXV 7KLV LV D UHSUHVHQWDWLRQ RI WKH YLUXOHQFH GDWD SUHVHQWHG LQ WKLV PDQXVFULSW DORQJ ZLWK NQRZQ UHDFWLYDWLRQ GDWD IRU WKH /$7 UHJLRQ 7KH FRPELQDWLRQ RI WKH UHDFWLYDWLRQ DQG YLUXOHQFH SKHQRW\SHV LGHQWLILHG IRU /$7 UHFRPELQDQW YLUXVHV HQDEOHG WKH PRGHOLQJ RI VHSDUDWH UHJXODWRU\ UHJLRQV RI WKH /$7 ORFXV DV VKRZQ LQ WKLV ILJXUH

PAGE 75

/,67 2) 5()(5(1&(6 $KPHG 0 0 /RFN & 0LOOHU DQG 1 : )UDVHU 5HJLRQV RI WKH KHUSHV VLPSOH[ YLUXV W\SH ODWHQF\DVVRFLDWHG WUDQVFULSW WKDW SURWHFW FHOOV IURP DSRSWRVLV LQ YLWUR DQG SURWHFW QHXURQDO FHOOV LQ YLYR 9LURO f %DLQHV 3 / :DUG &DPSDGHOOL)LXPH DQG % 5RL]PDQ 7KH 8/ JHQH RI KHUSHV VLPSOH[ YLUXV HQFRGHV D IXQFWLRQ QHFHVVDU\ IRU YLUDO HJUHVV 9LURO f %DWWHUVRQ : DQG % 5RL]PDQ &KDUDFWHUL]DWLRQ RI WKH KHUSHV VLPSOH[ YLULRQ DVVRFLDWHG IDFWRU UHVSRQVLEOH IRU WKH LQGXFWLRQ RI DOSKD JHQHV 9LURO f %HFNHU < + '\P DQG 6DURY +HUSHV VLPSOH[ YLUXV '1$ 9LURORJ\ f %HUPDQ ( DQG 0 +LOO 6SRQWDQHRXV RFXODU VKHGGLQJ RI +69 LQ ODWHQWO\ LQIHFWHG UDEELWV ,QYHVW 2SKWKDOPRO 9LV 6FL f %KDWWDFKDUMHH 3 6 5 7UDQ 0 ( 0\OHV 0DUX\DPD $ 0DOODNLQ & %ORRP DQG 0 +LOO 2YHUODSSLQJ VXEGHOHWLRQV ZLWKLQ D ES LQ WKH n H[RQ RI WKH /$7 UHJLRQ WKDW IDFLOLWDWHV HSLQHSKULQHLQGXFHG UHDFWLYDWLRQ RI +69 LQ WKH UDEELW RFXODU PRGHO GR QRW IXUWKHU GHILQH D IXQFWLRQDO HOHPHQW 9LURORJ\ f %ORRP & % 'HYL5DR 0 +LOO 6WHYHQV DQG ( :DJQHU 0ROHFXODU DQDO\VLV RI KHUSHV VLPSOH[ YLUXV W\SH GXULQJ HSLQHSKULQHLQGXFHG UHDFWLYDWLRQ RI ODWHQWO\ LQIHFWHG UDEELWV LQ YLYR 9LURO f %ORRP & 1 7 0DLGPHQW $ 7DQ 9 % 'LVVHWWH / 7 )HOGPDQ DQG 6WHYHQV /RQJWHUP H[SUHVVLRQ RI D UHSRUWHU JHQH IURP ODWHQW KHUSHV VLPSOH[ YLUXV LQ WKH UDW KLSSRFDPSXV %UDLQ 5HV 0RO %UDLQ 5HV f %ORRP & 0 +LOO 'HYL5DR ( :DJQHU / 7 )HOGPDQ DQG 6WHYHQV $ EDVHSDLU UHJLRQ LQ WKH ODWHQF\DVVRFLDWHG WUDQVFULSW IDFLOLWDWHV KHUSHV VLPSOH[ YLUXV W\SH UHDFWLYDWLRQ 9LURO f %ORRP & 6WHYHQV 0 +LOO DQG 5 7UDQ 0XWDJHQHVLV RI D F$03 UHVSRQVH HOHPHQW ZLWKLQ WKH ODWHQF\DVVRFLDWHG WUDQVFULSW SURPRWHU RI +69 UHGXFHV DGUHQHUJLF UHDFWLYDWLRQ 9LURORJ\ f %ORRP & DQG 5 -DUPDQ *HQHUDWLRQ DQG XVH RI UHFRPELQDQW UHSRUWHU YLUXVHV IRU VWXG\ RI KHUSHV VLPSOH[ YLUXV LQIHFWLRQV LQ YLYR 0HWKRGV f %ORRP & +VY /DW DQG 1HXURQDO 6XUYLYDO ,QW 5HY ,PPXQRO f

PAGE 76

&DEUHUD & 9 & :RKOHQEHUJ + 2SHQVKDZ 0 5H\0HQGH] $ 3XJD DQG $ / 1RWNLQV +HUSHV VLPSOH[ YLUXV '1$ VHTXHQFHV LQ WKH &16 RI ODWHQWO\ LQIHFWHG PLFH 1DWXUH f &DL : + % *X DQG 6 3HUVRQ 5ROH RI JO\FRSURWHLQ % RI KHUSHV VLPSOH[ YLPV W\SH LQ YLUDO HQWU\ DQG FHOO IXVLRQ 9LURO f &DPSEHOO 0 ( : 3DOIUH\PDQ DQG & 0 3UHVWRQ ,GHQWLILFDWLRQ RI KHUSHV VLPSOH[ YLPV '1$ VHTXHQFHV ZKLFK HQFRGH D WUDQVDFWLQJ SRO\SHSWLGH UHVSRQVLEOH IRU VWLPXODWLRQ RI LPPHGLDWH HDUO\ WUDQVFULSWLRQ 0RO %LRO f &DUDGRQQD 6 DQG < & &KHQJ ,QGXFWLRQ RI XUDFLO'1$ JO\FRV\ODVH DQG G873 QXFOHRWLGRK\GURODVH DFWLYLW\ LQ KHUSHV VLPSOH[ YLPVLQIHFWHG KXPDQ FHOOV %LRO &KHP f &KDUWUDQG 3 & 6 &UXPSDFNHU 3 $ 6FKDIIHU DQG 1 0 :LONLH 3K\VLFDO DQG JHQHWLF DQDO\VLV RI WKH KHUSHV VLPSOH[ YLPV '1$ SRO\PHUDVH ORFXV 9LURORJ\ f &RHQ 0 3 $VFKPDQ 3 7 *HOHS 0 5HWRQGR 6 :HOOHU DQG 3 $ 6FKDIIHU )LQH PDSSLQJ DQG PROHFXODU FORQLQJ RI PXWDWLRQV LQ WKH KHUSHV VLPSOH[ YLPV '1$ SRO\PHUDVH ORFXV 9LURO f &RUH\ / $ :DOG DQG / 'DYLV 6XEFOLQLFDO VKHGGLQJ RI +69 LWV SRWHQWLDO IRU UHGXFWLRQ E\ DQWLYLUDO WKHUDS\ $GY ([S 0HG %LRO &RVWD 5 + 'UDSHU 'HYL5DR 5 / 7KRPSVRQ DQG ( :DJQHU 9LPVLQGXFHG PRGLILFDWLRQ RI WKH KRVW FHOO LV UHTXLUHG IRU H[SUHVVLRQ RI WKH EDFWHULDO FKORUDPSKHQLFRO DFHW\OWUDQVIHUDVH JHQH FRQWUROOHG E\ D ODWH KHUSHV VLPSOH[ YLPV SURPRWHU 93f 9LURO f 'HQQLV DQG 5 6PLOH\ 7UDQVDFWLYDWLRQ RI D ODWH KHUSHV VLPSOH[ YLPV SURPRWHU 0RO &HOO %LRO f 'HYL5DR % & %ORRP 6WHYHQV DQG ( :DJQHU +HUSHV VLPSOH[ YLPV W\SH '1$ UHSOLFDWLRQ DQG JHQH H[SUHVVLRQ GXULQJ H[SODQWLQGXFHG UHDFWLYDWLRQ RI ODWHQWO\ LQIHFWHG PXULQH VHQVRU\ JDQJOLD 9LURO f 'HYL5DR % 6 $JXLODU 0 5LFH + + *DU]D -U & %ORRP 0 +LOO DQG ( :DJQHU +HUSHV VLPSOH[ YLPV JHQRPH UHSOLFDWLRQ DQG WUDQVFULSWLRQ GXULQJ LQGXFHG UHDFWLYDWLRQ LQ WKH UDEELW H\H 9LURO f 'REVRQ $ 7 ) 6HGHUDWL 'HYL5DR : 0 )ODQDJDQ 0 )DUUHOO 6WHYHQV ( :DJQHU DQG / 7 )HOGPDQ ,GHQWLILFDWLRQ RI WKH ODWHQF\DVVRFLDWHG WUDQVFULSW SURPRWHU E\ H[SUHVVLRQ RI UDEELW EHWDJORELQ P51$ LQ PRXVH VHQVRU\ QHUYH JDQJOLD ODWHQWO\ LQIHFWHG ZLWK D UHFRPELQDQW KHUSHV VLPSOH[ YLPV 9LURO f

PAGE 77

'UROHW % 6 & 3HPJ &RKHQ 6 0 6ODQLQD $
PAGE 78

*HOPDQ + DQG 6 6LOYHUVWHLQ &RRUGLQDWH UHJXODWLRQ RI KHUSHV VLPSOH[ YLUXV JHQH H[SUHVVLRQ LV PHGLDWHG E\ WKH IXQFWLRQDO LQWHUDFWLRQ RI WZR LPPHGLDWH HDUO\ JHQH SURGXFWV 0RO %LRO f *HOPDQ + DQG 6 6LOYHUVWHLQ +HUSHV VLPSOH[ YLUXV LPPHGLDWHHDUO\ SURPRWHUV DUH UHVSRQVLYH WR YLUXV DQG FHOO WUDQVDFWLQJ IDFWRUV 9LURO f *RLQV : ) / 5 6WHUQEHUJ &URHQ 3 5 .UDXVH 5 / +HQGULFNV )LQN 6 ( 6WUDXV 0 /HYLQH DQG & *ORULRVR $ QRYHO ODWHQF\DFWLYH SURPRWHU LV FRQWDLQHG ZLWKLQ WKH KHUSHV VLPSOH[ YLUXV W\SH 8/ IODQNLQJ UHSHDWV 9LURO f *UHVVHQV 3 DQG 5 0DUWLQ +69 '1$ SHUVLVWHQFH LQ DVWURF\WHV RI WKH WULJHPLQDO URRW HQWU\ ]RQH GRXEOH ODEHOLQJ E\ LQ VLWX 3&5 DQG LPPXQRKLVWRFKHPLVWU\ 1HXURSDWKRO ([S 1HXURO f *X]RZVNL ) DQG ( :DJQHU 0XWDWLRQDO DQDO\VLV RI WKH KHUSHV VLPSOH[ YLUXV W\SH VWULFW ODWH 8/ SURPRWHUOHDGHU UHYHDOV WZR UHJLRQV FULWLFDO LQ WUDQVFULSWLRQDO UHJXODWLRQ 9LURO f +D\ + 0RVV $ 7 -DPLHVRQ DQG 0 & 7LPEXU\ +HUSHVYLUXV SURWHLQV '1$ SRO\PHUDVH DQG S\ULPLGLQH GHR[\QXFOHRVLGH NLQDVH DFWLYLWLHV LQ WHPSHUDWXUH VHQVLWLYH PXWDQWV RI KHUSHV VLPSOH[ YLUXV W\SH *HQ 9LURO f +HQGHUVRQ : 3HQJ / -LQ & 3HPJ $ % 1HVEXP 6 / :HFKVOHU DQG & -RQHV 5HJXODWLRQ RI FDVSDVH DQG FDVSDVH LQGXFHG DSRSWRVLV E\ WKH KHUSHV VLPSOH[ YLUXV W\SH ODWHQF\DVVRFLDWHG WUDQVFULSW 1HXURYLURO 6XSSO +HLQH : 5 : +RQHVV ( &DVVDL DQG % 5RL]PDQ 3URWHLQV VSHFLILHG E\ KHUSHV VLPSOH[ YLUXV ;,, 7KH YLULRQ SRO\SHSWLGHV RI W\SH VWUDLQV 9LURO f +LOO 0 % 'XGOH\ < 6KLPRPXUD DQG + ( .DXIPDQ 4XDQWLWDWLRQ DQG NLQHWLFV RI LQGXFHG +69 RFXODU VKHGGLQJ &XUU (\H 5HV f +LOO 0 < +DUXWD DQG 6 5RRWPDQ $GUHQHUJLFDOO\ LQGXFHG UHFXUUHQW +69 FRUQHDO HSLWKHOLDO OHVLRQV &XUU (\H 5HV f +LOO 7 2FXODU SDWKRJHQLFLW\ RI KHUSHV VLPSOH[ YLUXV &XUU (\H 5HV f +LOO 0 < 6KLPRPXUD % 'XGOH\ ( %HUPDQ < +DUXWD % 6 .ZRQ DQG / 0DJXLUH 7LPRORO LQGXFHV +69 RFXODU VKHGGLQJ LQ WKH ODWHQWO\ LQIHFWHG UDEELW ,QYHVW 2SKWKDOPRO 9LV 6FL f +LOO 0 ) 6HGDUDWL 5 7 -DYLHU ( :DJQHU DQG 6WHYHQV +HUSHV VLPSOH[ YLUXV ODWHQW SKDVH WUDQVFULSWLRQ IDFLOLWDWHV LQ YLYR UHDFWLYDWLRQ 9LURORJ\ f

PAGE 79

+LOO 0 % 0 *HEKDUGW 5 :HQ $ 0 %RXWHULH + : 7KRPSVRQ 5 2n&DOODJKDQ : 3 +DOIRUG DQG + ( .DXILQDQ 4XDQWLWDWLRQ RI KHUSHV VLPSOH[ YLUXV W\SH '1$ DQG ODWHQF\DVVRFLDWHG WUDQVFULSWV LQ UDEELW WULJHPLQDO JDQJOLD GHPRQVWUDWHV D VWDEOH UHVHUYRLU RI YLUDO QXFOHLF DFLGV GXULQJ ODWHQF\ 9LURO f +LOO 0 + + *DU]D -U < + 6X 5 0HHJDOOD / $ +DQQD 0 /RXWVFK + : 7KRPSVRQ ( 9DPHOO & %ORRP DQG 7 0 %ORFN $ EDVHSDLU GHOHWLRQ DW WKH EHJLQQLQJ RI WKH ODWHQF\DVVRFLDWHG WUDQVFULSW SURPRWHU VLJQLILFDQWO\ UHGXFHG DGUHQHUJLFDOO\ LQGXFHG KHUSHV VLPSOH[ YLUXV W\SH RFXODU UHDFWLYDWLRQ LQ ODWHQWO\ LQIHFWHG UDEELWV 9LURO f +RQHVV 5 : 3XULIR\
PAGE 80

-DUPDQ 5 ( :DJQHU DQG & %ORRP /$7 H[SUHVVLRQ GXULQJ DQ DFXWH +69 LQIHFWLRQ LQ WKH PRXVH 9LURORJ\ f -DUPDQ 5 0 /RXWVFK % 'HYL5DR 0 ( 0DUTXDUW 0 3 %DQDV]DN ; =KHQJ 0 +LOO ( :DJQHU DQG & %ORRP 7KH UHJLRQ RI WKH +69 ODWHQF\DVVRFLDWHG WUDQVFULSW UHTXLUHG IRU HSLQHSKQQHLQGXFHG UHDFWLYDWLRQ LQ WKH UDEELW GRHV QRW LQFOXGH WKH NE LQWURQ 9LURORJ\ f -DYLHU 5 7 0 ,]XPL DQG 6WHYHQV /RFDOL]DWLRQ RI D KHUSHV VLPSOH[ YLUXV QHXURYLUXOHQFH JHQH GLVVRFLDWHG IURP KLJKWLWHU YLUXV UHSOLFDWLRQ LQ WKH EUDLQ 9LURO f -LQ / : 3HQJ & 3HPJ %ULFN $ % 1HVEXP & -RQHV DQG 6 / :HFKVOHU ,GHQWLILFDWLRQ RI KHUSHV VLPSOH[ YLUXV W\SH ODWHQF\DVVRFLDWHG WUDQVFULSW VHTXHQFHV WKDW ERWK LQKLELW DSRSWRVLV DQG HQKDQFH WKH VSRQWDQHRXV UHDFWLYDWLRQ SKHQRW\SH 9LURO f -RKQVRQ 3 $ DQG 5 (YHUHWW 7KH FRQWURO RI KHUSHV VLPSOH[ YLUXV W\SH ODWH JHQH WUDQVFULSWLRQ D n7$7$ER[nFDS VLWH UHJLRQ LV VXIILFLHQW IRU IXOO\ HIILFLHQW UHJXODWHG DFWLYLW\ 1XFOHLF $FLGV 5HV f .DSRRU $ $ $ 1DVK 3 :LOG\ 3KHODQ & 6 0F/HDQ DQG + )LHOG 3DWKRJHQHVLV RI KHUSHV VLPSOH[ YLUXV LQ FRQJHQLWDOO\ DWK\PLF PLFH WKH UHODWLYH UROHV RI FHOOPHGLDWHG DQG KXPRUDO LPPXQLW\ *HQ 9LURO 3W f .HQQ\ ) & .UHEV + 7 +DUWOH $ ( *DUWQHU % &KDWWRQ 0 /HLGHQ 3 +RHIIOHU 3 & :HEHU DQG % :LJGDKO ,GHQWLILFDWLRQ RI D VHFRQG $7)&5(%OLNH HOHPHQW LQ WKH KHUSHV VLPSOH[ YLUXV W\SH +69f ODWHQF\ DVVRFLDWHG WUDQVFULSW /$7f SURPRWHU 9LURORJ\ f .LHII ( 6 / %DFKHQKHLPHU DQG % 5RL]PDQ 6L]H FRPSRVLWLRQ DQG VWUXFWXUH RI WKH GHR[\ULERQXFOHLF DFLG RI KHUSHV VLPSOH[ YLUXV VXEW\SHV DQG 9LURO f .ULVWHQVVRQ ( /\FNH DQG 6MRVWUDQG 7UDQVSRUW RI KHUSHV VLPSOH[ YLUXV LQ SHULSKHUDO QHUYHV $FWD 3K\VLRO 6FDQG .XEDW 1 5 7UDQ 3 0F$QDQ\ DQG & %ORRP 6SHFLILF KLVWRQH WDLO PRGLILFDWLRQ DQG QRW '1$ PHWK\ODWLRQ LV D GHWHUPLQDQW RI KHUSHV VLPSOH[ YLUXV W\SH ODWHQW JHQH H[SUHVVLRQ 9LURO f .ZRQ % 6 / 3 *DQJDURVD %XUFK GH%DFN DQG 0 +LOO ,QGXFWLRQ RI RFXODU KHUSHV VLPSOH[ YLUXV VKHGGLQJ E\ LRQWRSKRUHVLV RI HSLQHSKULQH LQWR UDEELW FRUQHD ,QYHVW 2SKWKDOPRO 9LV 6FL f .ZRQ % 6 / 3 *DQJDURVD 6U *UHHQ DQG 0 +LOO .LQHWLFV RI RFXODU KHUSHV VLPSOH[ YLUXV VKHGGLQJ LQGXFHG E\ HSLQHSKULQH LRQWRSKRUHVLV ,QYHVW 2SKWKDOPRO 9LV 6FL f

PAGE 81

/RQJQHFNHU 5 6 &KDWWHLMHH 5 :KLWOH\ DQG % 5RL]PDQ ,GHQWLILFDWLRQ RI D KHUSHV VLPSOH[ YLUXV JO\FRSURWHLQ JHQH ZLWKLQ D JHQH FOXVWHU GLVSHQVDEOH IRU JURZWK LQ FHOO FXOWXUH 3URF 1DWO $FDG 6FL 8 6 $ f /RQJQHFNHU 5 DQG % 5RL]PDQ &OXVWHULQJ RI JHQHV GLVSHQVDEOH IRU JURZWK LQ FXOWXUH LQ WKH 6 FRPSRQHQW RI WKH +69 JHQRPH 6FLHQFH f /RXWVFK 0 & 3HPJ 0 +LOO ; =KHQJ 0 ( 0DUTXDUW 7 0 %ORFN + *KLDVL $ % 1HVEXP DQG 6 / :HFKVOHU ,GHQWLFDO EDVHSDLU GHOHWLRQ PXWDWLRQV LQ WKH /$7 JHQHV RI KHUSHV VLPSOH[ YLPV W\SH 0F.UDH DQG V\Q UHVXOW LQ GLIIHUHQW LQ YLYR UHDFWLYDWLRQ SKHQRW\SHV 9LURO f 0DFNHP 6 DQG % 5RL]PDQ 'LIIHUHQWLDWLRQ EHWZHHQ DOSKD SURPRWHU DQG UHJXODWRU UHJLRQV RI KHUSHV VLPSOH[ YLPV WKH IXQFWLRQDO GRPDLQV DQG VHTXHQFH RI D PRYDEOH DOSKD UHJXODWRU 3URF 1DWO $FDG 6FL 8 6 $ f 0DFNHP 6 DQG % 5RL]PDQ 5HJXODWLRQ RI DOSKD JHQHV RI KHUSHV VLPSOH[ YLPV WKH DOSKD JHQH SURPRWHUWK\PLGLQH NLQDVH FKLPHUD LV SRVLWLYHO\ UHJXODWHG LQ FRQYHUWHG / FHOOV 9LURO f 0DJJLRQFDOGD $ 0HKWD 2 %DJDVUD 1 : )UDVHU DQG 7 0 %ORFN $ KHUSHV VLPSOH[ YLPV W\SH PXWDQW ZLWK D GHOHWLRQ LPPHGLDWHO\ XSVWUHDP RI WKH /$7 ORFXV HVWDEOLVKHV ODWHQF\ DQG UHDFWLYDWHV IURP ODWHQWO\ LQIHFWHG PLFH ZLWK QRUPDO NLQHWLFV 1HXURYLURO f 0DUJROLV 7 3 & 5 'DZVRQ DQG + /D9DLO +HUSHV VLPSOH[ YLUDO LQIHFWLRQ RI WKH PRXVH WULJHPLQDO JDQJOLRQ ,PPXQRKLVWRFKHPLFDO DQDO\VLV RI FHOO SRSXODWLRQV ,QYHVW 2SKWKDOPRO 9LV 6FL f 0DUJROLV 7 3 & %ORRP $ 7 'REVRQ / 7 )HOGPDQ DQG 6WHYHQV 'HFUHDVHG UHSRUWHU JHQH H[SUHVVLRQ GXULQJ ODWHQW LQIHFWLRQ ZLWK +69 /$7 SURPRWHU FRQVWUXFWV 9LURORJ\ f 0DUTXDUW 0 ( ; =KHQJ 5 7UDQ + : 7KRPSVRQ & %ORRP DQG 0 +LOO $ F$03 UHVSRQVH HOHPHQW ZLWKLQ WKH ODWHQF\DVVRFLDWHG WUDQVFULSW SURPRWHU RI +69 IDFLOLWDWHV LQGXFHG RFXODU UHDFWLYDWLRQ LQ D PRXVH K\SHUWKHUPLD PRGHO 9LURORJ\ f 0F*HRFK 2Q WKH SUHGLFWLYH UHFRJQLWLRQ RI VLJQDO SHSWLGH VHTXHQFHV 9LPV 5HV f 0F*HRFK $ 'RODQ 6 'RQDOG DQG ) 5L[RQ 6HTXHQFH GHWHUPLQDWLRQ DQG JHQHWLF FRQWHQW RI WKH VKRUW XQLTXH UHJLRQ LQ WKH JHQRPH RI KHUSHV VLPSOH[ YLPV W\SH -0RO %LRO f 0F/HQQDQ / DQG 'DUE\ +HUSHV VLPSOH[ YLPV ODWHQF\ WKH FHOOXODU ORFDWLRQ RI YLPV LQ GRUVDO URRW JDQJOLD DQG WKH IDWH RI WKH LQIHFWHG FHOO IROORZLQJ YLPV DFWLYDWLRQ *HQ 9LURO 3W f

PAGE 82

0HKWD $ 0DJJLRQFDOGD 2 %DJDVUD 6 7KLNNDYDUDSX 3 6DLNXPDUL 7 9DO\L1DJ\ 1 : )UDVHU DQG 7 0 %ORFN ,Q VLWX '1$ 3&5 DQG 51$ K\EULGL]DWLRQ GHWHFWLRQ RI KHUSHV VLPSOH[ YLUXV VHTXHQFHV LQ WULJHPLQDO JDQJOLD RI ODWHQWO\ LQIHFWHG PLFH 9LURORJ\ f 0HOOHULFN 0 DQG 1 : )UDVHU 3K\VLFDO VWDWH RI WKH ODWHQW KHUSHV VLPSOH[ YLUXV JHQRPH LQ D PRXVH PRGHO V\VWHP HYLGHQFH VXJJHVWLQJ DQ HSLVRPDO VWDWH 9LURORJ\ f 0RUURZ $ DQG ) 5L[RQ $QDO\VLV RI VHTXHQFHV LPSRUWDQW IRU KHUSHV VLPSOH[ YLUXV W\SH ODWHQF\DVVRFLDWHG WUDQVFULSW SURPRWHU DFWLYLW\ GXULQJ O\WLF LQIHFWLRQ RI WLVVXH FXOWXUH FHOOV *HQ 9LURO 3W f 0RWW 5 1 2VRULR / -LQ %ULFN 1DLWR &RRSHU +HQGHUVRQ 0 ,QPDQ & -RQHV 6 / :HFKVOHU DQG & 3HPJ 7KH ERYLQH KHUSHVYLUXV /5 25) LV FULWLFDO IRU WKLV JHQHnV DELOLW\ WR UHVWRUH WKH KLJK ZLOGW\SH UHDFWLYDWLRQ SKHQRW\SH WR D KHUSHV VLPSOH[ YLUXV /$7 QXOO PXWDQW *HQ 9LURO 3W f 1DVK $ $ DQG 3 &DPERXURSRXORV 7KH LPPXQH V\VWHP UHVSRQVH WR KHUSHV VLPSOH[ YLUXV 6HPLQ 9LURO 1HVEXP $ % + (OOLRWW DQG + 0 /HLERZLW] 6SRQWDQHRXV UHDFWLYDWLRQ RI H[SHULPHQWDO KHUSHV VLPSOH[ NHUDWLWLV LQ UDEELWV $UFK 2SKWKDOPRO f 1LFRVLD 0 0 =DERORWQ\ 5 3 /LUHWWH DQG 1 : )UDVHU 7KH +69 NE ODWHQF\DVVRFLDWHG WUDQVFULSW LV IRXQG LQ WKH F\WRSODVP FRPLJUDWLQJ ZLWK ULERVRPDO VXEXQLWV GXULQJ SURGXFWLYH LQIHFWLRQ 9LURORJ\ f 2n+DUH 3 DQG 6 +D\ZDUG (YLGHQFH IRU D GLUHFW UROH IRU ERWK WKH DQG PROHFXODUZHLJKW LPPHGLDWHHDUO\ SURWHLQV RI KHUSHV VLPSOH[ YLUXV LQ WKH WUDQVDFWLYDWLRQ RI GHOD\HGHDUO\ SURPRWHUV 9LURO f 3HQJ : +HQGHUVRQ & 3HPJ $ % 1HVEXP 6 / :HFKVOHU DQG & -RQHV 7KH JHQH WKDW HQFRGHV WKH KHUSHV VLPSOH[ YLPV W\SH ODWHQF\DVVRFLDWHG WUDQVFULSW LQIOXHQFHV WKH DFFXPXODWLRQ RI WUDQVFULSWV %FO[/f DQG %FO[6ff WKDW HQFRGH DSRSWRWLF UHJXODWRU\ SURWHLQV 9LURO f 3HPJ & ( & 'XQNHO 3 $ *HDU\ 6 0 6ODQLQD + *KLDVL 5 .DLZDU $ % 1HVEXP DQG 6 / :HFKVOHU 7KH ODWHQF\DVVRFLDWHG WUDQVFULSW JHQH RI KHUSHV VLPSOH[ YLPV W\SH +69f LV UHTXLUHG IRU HIILFLHQW LQ YLYR VSRQWDQHRXV UHDFWLYDWLRQ RI +69 IURP ODWHQF\ 9LURO f 3HPJ & & =ZDDJVWUD + *KLDVL 5 .DLZDU %URZQ $ % 1HVEXP DQG 6 / :HFKVOHU 6LPLODULWLHV LQ UHJXODWLRQ RI WKH +69 /$7 SURPRWHU LQ FRPHDO DQG QHXURQDO FHOOV ,QYHVW 2SKWKDOPRO 9LV 6FL f

PAGE 83

3HPJ & + *KLDVL 6 0 6ODQLQD $ % 1HVEXP DQG 6 / :HFKVOHU 7KH VSRQWDQHRXV UHDFWLYDWLRQ IXQFWLRQ RI WKH KHUSHV VLPSOH[ YLUXV W\SH /$7 JHQH UHVLGHV FRPSOHWHO\ ZLWKLQ WKH ILUVW NLOREDVHV RI WKH NLOREDVH SULPDU\ WUDQVFULSW 9LURO f 3HPJ & 6 0 6ODQLQD + *KLDVL $ % 1HVEXP DQG 6 / :HFKVOHU $ QXFOHRWLGH UHJLRQ EHWZHHQ WKH KHUSHV VLPSOH[ YLPV W\SH +69f /$7 SURPRWHU DQG WKH NLOREDVH /$7 LV QRW HVVHQWLDO IRU HIILFLHQW VSRQWDQHRXV UHDFWLYDWLRQ RI ODWHQW +69 9LURO f 3HPJ & &KRNHSKDLEXONLW 5 / 7KRPSVRQ 1 0 6DZWHOO 6 0 6ODQLQD + *KLDVL $ % 1HVEXP DQG 6 / :HFKVOHU 7KH UHJLRQ RI WKH KHUSHV VLPSOH[ YLPV W\SH /$7 JHQH WKDW LV FROLQHDU ZLWK WKH ,&3 JHQH LV QRW LQYROYHG LQ VSRQWDQHRXV UHDFWLYDWLRQ 9LURO f 3HPJ & 6 0 6ODQLQD $
PAGE 84

3HPJ & % 0DJXHQ / -LQ 5 0RWW 1 2VRULR 6 0 6ODQLQD $
PAGE 85

6DQGUL*ROGLQ 5 0 3URSHUWLHV RI DQ +69 UHJXODWRU\ SURWHLQ WKDW DSSHDUV WR LPSDLU KRVW FHOO VSOLFLQJ ,QIHFW $JHQWV 'LV f 6DZWHOO 1 0 DQG 5 / 7KRPSVRQ +HUSHV VLPSOH[ YLUXV W\SH ODWHQF\ DVVRFLDWHG WUDQVFULSWLRQ XQLW SURPRWHV DQDWRPLFDO VLWHGHSHQGHQW HVWDEOLVKPHQW DQG UHDFWLYDWLRQ IURP ODWHQF\ 9LURO f 6DZWHOO 1 0 &RPSUHKHQVLYH TXDQWLILFDWLRQ RI KHUSHV VLPSOH[ YLUXV ODWHQF\ DW WKH VLQJOHFHOO OHYHO 9LURO f 6DZWHOO 1 0 7KH SUREDELOLW\ RI LQ YLYR UHDFWLYDWLRQ RI KHUSHV VLPSOH[ YLUXV W\SH LQFUHDVHV ZLWK WKH QXPEHU RI ODWHQWO\ LQIHFWHG QHXURQV LQ WKH JDQJOLD 9LURO f 6DZWHOO 1 0 3RRQ & 6 7DQVN\ DQG 5 / 7KRPSVRQ 7KH ODWHQW KHUSHV VLPSOH[ YLUXV W\SH JHQRPH FRS\ QXPEHU LQ LQGLYLGXDO QHXURQV LV YLPV VWUDLQ VSHFLILF DQG FRUUHODWHV ZLWK UHDFWLYDWLRQ 9LURO f 6DZWHOO 1 0 5 / 7KRPSVRQ / 5 6WDQEHUU\ DQG %HUQVWHLQ (DUO\ LQWHUYHQWLRQ ZLWK KLJKGRVH DF\FORYLU WUHDWPHQW GXULQJ SULPDU\ KHUSHV VLPSOH[ YLPV LQIHFWLRQ UHGXFHV ODWHQF\ DQG VXEVHTXHQW UHDFWLYDWLRQ LQ WKH QHUYRXV V\VWHP LQ YLYR ,QIHFW 'LV f 6FKDQJ / 0 $ +RVVDLQ DQG & -RQHV 7KH ODWHQF\UHODWHG JHQH RI ERYLQH KHUSHVYLUXV HQFRGHV D SURGXFW ZKLFK LQKLELWV FHOO F\FOH SURJUHVVLRQ 9LURO f 6LPPRQV $ DQG $ $ 1DVK (IIHFW RI % FHOO VXSSUHVVLRQ RQ SULPDU\ LQIHFWLRQ DQG UHLQIHFWLRQ RI PLFH ZLWK KHUSHV VLPSOH[ YLPV ,QIHFW 'LV f 6RDUHV < +ZDQJ 5 5DPDNULVKQDQ 0 & 6FKPLGW )LQN DQG & *ORULRVR FLVDFWLQJ HOHPHQWV LQYROYHG LQ WUDQVFULSWLRQDO UHJXODWLRQ RI WKH KHUSHV VLPSOH[ YLPV W\SH ODWHQF\DVVRFLDWHG SURPRWHU /$3f LQ YLWUR DQG LQ YLYR 9LURO f 6SHDU 3 DQG % 5RL]PDQ 3URWHLQV VSHFLILHG E\ KHUSHV VLPSOH[ YLPV 9 3XULILFDWLRQ DQG VWUXFWXUDO SURWHLQV RI WKH KHUSHVYLULRQ 9LURO f 6SHFN 3 DQG $ 6LPPRQV 6\QFKURQRXV DSSHDUDQFH RI DQWLJHQSRVLWLYH DQG ODWHQWO\ LQIHFWHG QHXURQV LQ VSLQDO JDQJOLD RI PLFH LQIHFWHG ZLWK D YLPOHQW VWUDLQ RI KHUSHV VLPSOH[ YLPV *HQ 9LURO 3W f 6SLYDFN DQG 1 : )UDVHU ([SUHVVLRQ RI KHUSHV VLPSOH[ YLPV W\SH +69 f ODWHQF\DVVRFLDWHG WUDQVFULSWV DQG WUDQVFULSWV DIIHFWHG E\ WKH GHOHWLRQ LQ DYLPOHQW PXWDQW +)(0 HYLGHQFH IRU D QHZ FODVV RI +69 JHQHV 9LURO f

PAGE 86

6SLYDFN DQG 1 : )UDVHU ([SUHVVLRQ RI KHUSHV VLPSOH[ YLUXV W\SH ODWHQF\ DVVRFLDWHG WUDQVFULSWV LQ WKH WULJHPLQDO JDQJOLD RI PLFH GXULQJ DFXWH LQIHFWLRQ DQG UHDFWLYDWLRQ RI ODWHQW LQIHFWLRQ 9LURO f 6WHYHQV /DWHQW KHUSHV VLPSOH[ YLUXV DQG WKH QHUYRXV V\VWHP &XUU 7RS 0LFURELRO ,PPXQRO 6WHYHQV ( :DJQHU % 'HYL5DR 0 / &RRN DQG / 7 )HOGPDQ 51$ FRPSOHPHQWDU\ WR D KHUSHVYLUXV DOSKD JHQH P51$ LV SURPLQHQW LQ ODWHQWO\ LQIHFWHG QHXURQV 6FLHQFH f 7DO6LQJHU 5 7 0 /DVQHU : 3RGU]XFNL $ 6NRNRWDV /HDU\ 6 / %HUJHU DQG 1 : )UDVHU *HQH H[SUHVVLRQ GXULQJ UHDFWLYDWLRQ RI KHUSHV VLPSOH[ YLUXV W\SH IURP ODWHQF\ LQ WKH SHULSKHUDO QHUYRXV V\VWHP LV GLIIHUHQW IURP WKDW GXULQJ O\WLF LQIHFWLRQ RI WLVVXH FXOWXUHV 9LURO f 7KRPSVRQ 5 / 0 / &RRN % 'HYL5DR ( :DJQHU DQG 6WHYHQV )XQFWLRQDO DQG PROHFXODU DQDO\VHV RI WKH DYLUXOHQW ZLOGW\SH KHUSHV VLPSOH[ YLUXV W\SH VWUDLQ .26 9LURO f 7KRPSVRQ 5 / DQG 1 0 6DZWHOO 7KH KHUSHV VLPSOH[ YLUXV W\SH ODWHQF\ DVVRFLDWHG WUDQVFULSW JHQH UHJXODWHV WKH HVWDEOLVKPHQW RI ODWHQF\ 9LURO f 7KRPSVRQ 5 / DQG 1 0 6DZWHOO 5HSOLFDWLRQ RI KHUSHV VLPSOH[ YLUXV W\SH ZLWKLQ WULJHPLQDO JDQJOLD LV UHTXLUHG IRU KLJK IUHTXHQF\ EXW QRW KLJK YLUDO JHQRPH FRS\ QXPEHU ODWHQF\ 9LURO f 7KRPSVRQ 5 / DQG 1 0 6DZWHOO +HUSHV VLPSOH[ YLUXV W\SH ODWHQF\ DVVRFLDWHG WUDQVFULSW JHQH SURPRWHV QHXURQDO VXUYLYDO 9LURO f 7RJQRQ 0 )XUORQJ $ &RQOH\ DQG % 5RL]PDQ 0ROHFXODU JHQHWLFV RI KHUSHV VLPSOH[ YLUXV 9 &KDUDFWHUL]DWLRQ RI D PXWDQW GHIHFWLYH LQ DELOLW\ WR IRUP SODTXHV DW ORZ WHPSHUDWXUHV DQG LQ D YLUDO IUDFWLRQ ZKLFK SUHYHQWV DFFXPXODWLRQ RI FRUHOHVV FDSVLGV DW QXFOHDU SRUHV ODWH LQ LQIHFWLRQ 9LURO f :DJQHU ( DQG & %ORRP ([SHULPHQWDO LQYHVWLJDWLRQ RI KHUSHV VLPSOH[ YLUXV ODWHQF\ &OLQ 0LFURELRO 5HY f :DJQHU ( : 0 )ODQDJDQ 'HYL5DR < ) =KDQJ 0 +LOO 3 $QGHUVRQ DQG 6WHYHQV 7KH KHUSHV VLPSOH[ YLUXV ODWHQF\DVVRFLDWHG WUDQVFULSW LV VSOLFHG GXULQJ WKH ODWHQW SKDVH RI LQIHFWLRQ 9LURO f :HFKVOHU 6 / $ % 1HVEXP 5 :DWVRQ 6 6ODQLQD DQG + *KLDVL )LQH PDSSLQJ RI WKH PDMRU ODWHQF\UHODWHG 51$ RI KHUSHV VLPSOH[ YLUXV W\SH LQ KXPDQV *HQ 9LURO 3W f

PAGE 87

:HFKVOHU 6 / $ % 1HVEXP 5 :DWVRQ 6 0 6ODQLQD DQG + *KLDVL )LQH PDSSLQJ RI WKH ODWHQF\UHODWHG JHQH RI KHUSHV VLPSOH[ YLUXV W\SH DOWHUQDWLYH VSOLFLQJ SURGXFHV GLVWLQFW ODWHQF\UHODWHG 51$V FRQWDLQLQJ RSHQ UHDGLQJ IUDPHV 9LURO f :HFKVOHU 6 / $ % 1HVEXP =ZDDJVWUD DQG + *KLDVL 6HTXHQFH RI WKH ODWHQF\UHODWHG JHQH RI KHUSHV VLPSOH[ YLUXV W\SH 9LURORJ\ f :KLWOH\ 5 ( 5 .HP 6 &KDWWHLMHH &KRX DQG % 5RL]PDQ 5HSOLFDWLRQ HVWDEOLVKPHQW RI ODWHQF\ DQG LQGXFHG UHDFWLYDWLRQ RI KHUSHV VLPSOH[ YLPV JDPPD GHOHWLRQ PXWDQWV LQ URGHQW PRGHOV &OLQ ,QYHVW f =DERORWQ\ 0 & .UXPPHQDFKHU DQG 1 : )UDVHU 7KH KHUSHV VLPSOH[ YLPV W\SH NLOREDVH ODWHQF\DVVRFLDWHG WUDQVFULSW LV D VWDEOH LQWURQ ZKLFK EUDQFKHV DW D JXDQRVLQH 9LURO f =ZDDJVWUD + *KLDVL $ % 1HVEXP DQG 6 / :HFKVOHU ,Q YLWUR SURPRWHU DFWLYLW\ DVVRFLDWHG ZLWK WKH ODWHQF\DVVRFLDWHG WUDQVFULSW JHQH RI KHUSHV VLPSOH[ YLPV W\SH *HQ 9LURO 3W f =ZDDJVWUD & + *KLDVL 6 0 6ODQLQD $ % 1HVEXP 6 & :KHDWOH\ /LOO\FURS :RRG 6 /DWFKPDQ 3DWHO DQG 6 / :HFKVOHU $FWLYLW\ RI KHUSHV VLPSOH[ YLPV W\SH ODWHQF\DVVRFLDWHG WUDQVFULSW /$7f SURPRWHU LQ QHXURQ GHULYHG FHOOV HYLGHQFH IRU QHXURQ VSHFLILFLW\ DQG IRU D ODUJH /$7 WUDQVFULSW 9LURO f =ZDDJVWUD & + *KLDVL $ % 1HVEXP DQG 6 / :HFKVOHU ,GHQWLILFDWLRQ RI D PDMRU UHJXODWRU\ VHTXHQFH LQ WKH ODWHQF\ DVVRFLDWHG WUDQVFULSW /$7f SURPRWHU RI KHUSHV VLPSOH[ YLPV W\SH +69f 9LURORJ\ f

PAGE 88

%,2*5$3+,&$/ 6.(7&+ ,Q WKH )DOO RI VWDUWHG DW 0DUV +LOO &ROOHJH LQ 0DUV +LOO 1RUWK &DUROLQD $W 0DUV +LOO PDMRUHG LQ ELRORJ\ ZLWK D FKHPLVWU\ PLQRU DQG FRPSOHWHG P\ %DFKHORU RI 6FLHQFH LQ 0D\ RI WKHQ HQWHUHG LQWR WKH 0LFURELRORJ\ GRFWRUDO SURJUDP DW $UL]RQD 6WDWH 8QLYHUVLW\ LQ WKH )DOO RI $IWHU WZR \HDUV P\ PHQWRU DFFHSWHG D SRVLWLRQ DW WKH 8QLYHUVLW\ RI )ORULGD DQG VXEVHTXHQWO\ WUDQVIHUUHG WR FRQWLQXH P\ UHVHDUFK $W WKH 8QLYHUVLW\ RI )ORULGD HQWHUHG LQWR WKH 0ROHFXODU *HQHWLFV DQG 0LFURELRORJ\ GHSDUWPHQW DQG FRPSOHWHG P\ 3K' LQ 0D\ RI

PAGE 89

, FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ I;/ 'DYLG & %ORRP &KDLU $VVLVWDQW 3URIHVVRU RI 0ROHFXODU *HQHWLFV DQG 0LFURELRORJ\ FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ 5LFK &RQGLW 3URIHVVRU RI 0ROHFXODU *HQHWLFV DQG 0LFURELRORJ\ FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ n8 F0\+ 6XH 0R\HU 3URIHVVRU RI 0ROHFXODU *HQHWLFV DQG 0LFURELRORJ\ FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DSGTXDOLW\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ .HYLQ $ULGHUVRQn $VVRFLDWH 3URIHVVRU RI 3K\VLRORJLFDO 6FLHQFHV 7KLV GLVVHUWDWLRQ ZDV VXEPLWWHG WR WKH &ROOHJH RI 0HGLFLQH DQG WR WKH *UDGXDWH 6FKRRO DQG ZDV DFFHSWHG DV SDUWLDO IXOILOOPHQW RI WKH UHTXLUHPHQWV IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ 'HDQ &ROOHJH RI 0HGLFLQH 0D\


15
infection, it is necessary to construct discrete mutations beyond the reactivation critical
region.
The 17A307, 17A307R, 17A480 and 17A489 mutants (Figure 1-1) were generated
in the lab of Dr. Ed Wagner (U. C. Irvine). Characterization of these viruses with respect
to latency was performed by Dr. Jim Hill (L.S.U. Eye Center) by use of the epinephrine-
induced rabbit eye model. The 17A307, 17A307R, 17A480 and 17A489 mutants were
tested for reactivation differences in comparion to 1 lsyn+ (parental) and 17APst
(promoter mutant). From these experiments, it was determined that 17A307 was reduced
in its ability to reactivate in the rabbit model in comparison to its rescue, 17A307R, and
17syn+. Mutants 17A480 and 17A489 did not display a reactivation restriction. All
results are shown in Table 1-1. Establishment was also determined by quantitative PCR
in rabbit TG with no significant difference detected between 17A307 and 17A307R (see
Table 1-2).
Based on these data we hypothesized that a downstream portion of LAT outside of
the reactivation critical region influences the acute infection. We demonstrated here that
mutation of this region of LAT results in a decrease in virulence in the mouse model.
Additionally, we believe that the HSV-1 recombinants with the large LAT deletions used
by Sawtell and Thompson as well as Wechsler (Figure 1-2) mask dramatic virulence
effects due to the impairment of multiple regulatory elements of the LAT locus. To
examine the possibility that LAT influences acute infection and/or early times in the
latent infection, we generated an additional series of mutants in a region of LAT 3 of the
reactivation critical region. These mutants allowed us to test the involvement of the 3
end of exon 1 and the intron upon latent and acute phenotypes of HSV-1. From the


73
Mehta, A., J. Maggioncalda, O. Bagasra, S. Thikkavarapu, P. Saikumari, T. Valyi-Nagy
N. W. Fraser and T. M. Block, 1995, In situ DNA PCR and RNA hybridization
detection of herpes simplex virus sequences in trigeminal ganglia of latently
infected mice, Virology 206(1): 633-40.
Mellerick, D. M. and N. W. Fraser, 1987, Physical state of the latent herpes simplex virus
genome in a mouse model system: evidence suggesting an episomal state, Virology
158(2): 265-75.
Morrow, J. A. and F. J. Rixon, 1994, Analysis of sequences important for herpes simplex
virus type 1 latency-associated transcript promoter activity during lytic infection of
tissue culture cells, J Gen Virol 75 (Pt 2): 309-16.
Mott, K. R., N. Osorio, L. Jin, D. J. Brick, J. Naito, J. Cooper, G. Henderson, M. Inman,
C. Jones, S. L. Wechsler and G. C. Pemg, 2003, The bovine herpesvirus-1 LR
ORF2 is critical for this gene's ability to restore the high wild-type reactivation
phenotype to a herpes simplex virus-1 LAT null mutant, J Gen Virol 84(Pt 11):
2975-85.
Nash, A. A., and P. Cambouropoulos, 1993, The immune system response to herpes
simplex virus, Semin, Virol 4: 181-186
Nesbum, A. B., J. H. Elliott and H. M. Leibowitz, 1967, Spontaneous reactivation of
experimental herpes simplex keratitis in rabbits, Arch Ophthalmol 78(4): 523-9.
Nicosia, M., J. M. Zabolotny, R. P. Lirette and N. W. Fraser, 1994, The HSV-1 2-kb
latency-associated transcript is found in the cytoplasm comigrating with ribosomal
subunits during productive infection, Virology 204(2): 717-28.
O'Hare, P. and G. S. Hayward, 1985, Evidence for a direct role for both the 175,000- and
110,000-molecular-weight immediate-early proteins of herpes simplex virus in the
transactivation of delayed-early promoters, J Virol 53(3): 751-60.
Peng, W., G. Henderson, G. C. Pemg, A. B. Nesbum, S. L. Wechsler and C. Jones, 2003,
The gene that encodes the herpes simplex vims type 1 latency-associated transcript
influences the accumulation of transcripts (Bcl-x(L) and Bcl-x(S)) that encode
apoptotic regulatory proteins, J Virol 77(19): 10714-8.
Pemg, G. C., E. C. Dunkel, P. A. Geary, S. M. Slanina, H. Ghiasi, R. Kaiwar, A. B.
Nesbum and S. L. Wechsler, 1994, The latency-associated transcript gene of herpes
simplex vims type 1 (HSV-1) is required for efficient in vivo spontaneous
reactivation of HSV-1 from latency, J Virol 68(12): 8045-55.
Pemg, G. C., J. C. Zwaagstra, H. Ghiasi, R. Kaiwar, D. J. Brown, A. B. Nesbum and S.
L. Wechsler, 1994, Similarities in regulation of the HSV-1 LAT promoter in
comeal and neuronal cells, Invest Ophthalmol Vis Sci 35(7): 2981-9.


36
indicated that the 17A307 virus was not only restricted in reactivation, but unlike the
LAT promoter mutant 17APst, had alterations in comeal pathology suggesting that it
might possess attenuated virulence or pathogenesis properties.
The mouse footpad model was used to test the virulence profile of the 17A307
recombinants. The rabbit model is a superior model for reactivation due to its close
parallel to the natural infection as described in chapter 1. For virulence studies, however,
the mouse footpad model is more useful due to the ability to infect larger sample sizes,
while also conserving many characteristics of natural HSV infection. The footpad
infection allows initial infection of the epidermis of the foot. Virus then enters the
peripheral nervous system via nerve termini present in the epidermis. Once in the
nervous system, virions progress to the body of the neurons in the dorsal root ganglia
(drg). From the DRG, HSV can then enter the central nervous system and progress
through the spinal cord to the brain. Infection in the CNS can lead to death resulting
from encephalitis.
LD50/pfu Evaluation
Initially, the 17A307 recombinant viruses were tested for virulence by LD50
(calculation of viral dose in plaque forming units required to kill 50% of animals in a
group) in comparison to \lsyn+ (parental), 17APst and 17A307aR. Results in the mouse
showed that the 17A307 vimses did display a dramatic virulence phenotype. It is
important to note that the 17A307 mutation principally alters the 3 end of exon 1 but it
also changes the first 6 base pairs of the splice donor site. Additionally, the stuffer DNA
is a polyadenylation signal in the case of each 17A307 recombinant and the virulence
results could have been due to a RNA mediated effect. To answer these questions, I set


74
Pemg, G. C., H. Ghiasi, S. M. Slanina, A. B. Nesbum and S. L. Wechsler, 1996, The
spontaneous reactivation function of the herpes simplex virus type 1 LAT gene
resides completely within the first 1.5 kilobases of the 8.3-kilobase primary
transcript, J Virol 70(2): 976-84.
Pemg, G. C., S. M. Slanina, H. Ghiasi, A. B. Nesbum and S. L. Wechsler, 1996, A 371-
nucleotide region between the herpes simplex vims type 1 (HSV-1) LAT promoter
and the 2-kilobase LAT is not essential for efficient spontaneous reactivation of
latent HSV-1, J Virol 70(3): 2014-8.
Pemg, G. C., K. Chokephaibulkit, R. L. Thompson, N. M. Sawtell, S. M. Slanina, H.
Ghiasi, A. B. Nesbum and S. L. Wechsler, 1996, The region of the herpes simplex
vims type 1 LAT gene that is colinear with the ICP34.5 gene is not involved in
spontaneous reactivation, J Virol 70(1): 282-91.
Pemg, G. C., S. M. Slanina, A. Yukht, B. S. Drolet, W. Keleher, Jr., H. Ghiasi, A. B.
Nesbum and S. L. Wechsler, 1999, A herpes simplex vims type 1 latency-
associated transcript mutant with increased vimlence and reduced spontaneous
reactivation, J Virol 73(2): 920-9.
Pemg, G. C., S. M. Slanina, A. Yukht, H. Ghiasi, A. B. Nesbum and S. L. Wechsler,
2000, The latency-associated transcript gene enhances establishment of herpes
simplex vims type 1 latency in rabbits, J Virol 74(4): 1885-91.
Pemg, G. C., C. Jones, J. Ciacci-Zanella, M. Stone, G. Henderson, A. Yukht, S. M.
Slanina, F. M. Hofinan, H. Ghiasi, A. B. Nesbum and S. L. Wechsler, 2000, Virus-
induced neuronal apoptosis blocked by the herpes simplex vims latency-associated
transcript, Science 287(5457): 1500-3.
Pemg, G. C., S. M. Slanina, H. Ghiasi, A. B. Nesbum and S. L. Wechsler, 2001, The
effect of latency-associated transcript on the herpes simplex vims type 1 latency-
reactivation phenotype is mouse strain-dependent, J Gen Virol 82(Pt 5): 1117-22.
Pemg, G. C., D. Esmaili, S. M. Slanina, A. Yukht, H. Ghiasi, N. Osorio, K. R. Mott, B.
Maguen, L. Jin, A. B. Nesbum and S. L. Wechsler, 2001, Three herpes simplex
vims type 1 latency-associated transcript mutants with distinct and asymmetric
effects on vimlence in mice compared with rabbits, J Virol 75(19): 9018-28.
Pemg, G. C., B. Maguen, L. Jin, K. R. Mott, J. Kurylo, L. BenMohamed, A. Yukht, N.
Osorio, A. B. Nesbum, G. Henderson, M. Inman, C. Jones and S. L. Wechsler,
2002, A novel herpes simplex vims type 1 transcript (AL-RNA) antisense to the 5'
end of the latency-associated transcript produces a protein in infected rabbits, J
Virol 76(16): 8003-10.


69
Gelman, I. H. and S. Silverstein, 1986, Co-ordinate regulation of herpes simplex virus
gene expression is mediated by the functional interaction of two immediate early
gene products, J Mol Biol 191(3): 395-409.
Gelman, I. H. and S. Silverstein, 1987, Herpes simplex virus immediate-early promoters
are responsive to virus and cell trans-acting factors, J Virol 61(7): 2286-96.
Goins, W. F., L. R. Sternberg, K. D. Croen, P. R. Krause, R. L. Hendricks, D. J. Fink, S.
E. Straus, M. Levine and J. C. Glorioso, 1994, A novel latency-active promoter is
contained within the herpes simplex virus type 1 UL flanking repeats, J Virol
68(4): 2239-52.
Gressens, P. and J. R. Martin, 1994, HSV-2 DNA persistence in astrocytes of the
trigeminal root entry zone: double labeling by in situ PCR and
immunohistochemistry, J Neuropathol Exp Neurol 53(2): 127-35.
Guzowski, J. F. and E. K. Wagner, 1993, Mutational analysis of the herpes simplex virus
type 1 strict late UL38 promoter/leader reveals two regions critical in
transcriptional regulation, J Virol 67(9): 5098-108.
Hay, J., H. Moss, A. T. Jamieson and M. C. Timbury, 1976, Herpesvirus proteins: DNA
polymerase and pyrimidine deoxynucleoside kinase activities in temperature-
sensitive mutants of herpes simplex virus type 2, J Gen Virol 31(1): 65-73.
Henderson, G., W. Peng, L. Jin, G. C. Pemg, A. B. Nesbum, S. L. Wechsler and C.
Jones, 2002, Regulation of caspase 8- and caspase 9-induced apoptosis by the
herpes simplex virus type 1 latency-associated transcript, J Neurovirol 8 Suppl 2:
103-11.
Heine, J. W., R. W. Honess, E. Cassai and B. Roizman, 1974, Proteins specified by
herpes simplex virus. XII. The virion polypeptides of type 1 strains, J Virol 14(3):
640-51.
Hill, J. M., J. B. Dudley, Y. Shimomura and H. E. Kaufman, 1986, Quantitation and
kinetics of induced HSV-1 ocular shedding, Curr Eye Res 5(3): 241-6.
Hill, J. M., Y. Haruta and D. S. Rootman, 1987, Adrenergically induced recurrent HSV-1
corneal epithelial lesions, Curr Eye Res 6(8): 1065-71.
Hill, T. J., 1987, Ocular pathogenicity of herpes simplex virus, Curr Eye Res 6(1): 1-7.
Hill, J. M., Y. Shimomura, J. B. Dudley, E. Berman, Y. Haruta, B. S. Kwon and L. J.
Maguire, 1987, Timolol induces HSV-1 ocular shedding in the latently infected
rabbit, Invest Ophthalmol Vis Sci 28(3): 585-90.
Hill, J. M., F. Sedarati, R. T. Javier, E. K. Wagner and J. G. Stevens, 1990, Herpes
simplex virus latent phase transcription facilitates in vivo reactivation, Virology
174(1): 117-25.


55
neurons during the establishment of latency (Thompson and Sawtell 2001). A difference
in viral DNA levels in ganglia between the LAT(-) mutant, 17-AH, and its rescue, 17-
AHR was reported. This difference is proposed to occur due to a inhibition of apoptosis
and an increase of surviving neurons. In the determination of neuronal survival, it was
reported that 17-AH has a 2-fold reduction in total latent neurons in comparison to its
rescue (Thompson and Sawtell 2001). These viruses were also tested for differences in
their relative replication in mouse TG following comeal infection. Interestingly, no
detectable replication differences were observed in comea or ganglia. If these viruses do
express neuronal survival phenotypes, one would expect to see a replication difference
between LAT(-) and LAT(+) viruses. A virulence phenotype would also be expected if
LAT plays a role in neuronal survival and/or apoptosis in vivo.
A portion of the LAT gene has been shown by Wechsler (Pemg et al., 2000) to
stimulate apoptosis in transient transfection in cell culture through suppression of
receptor-mediated (caspase-8) and mitochondrial-mediated (caspase-9) pathways (Pemg
et al., 2000). Results in vivo with the large LAT mutants demonstrated a reduction in
establishment levels leading to a significant loss of sensory neurons (Pemg et al., 2000;
Thompson and Sawtell 1997). Transient transfection of IMR-90 and CV-1 cells with a
plasmid containing the 3 region of the LAT exon and most of the intron was able to
protect the majority of cells from ceramide, or fumonisin Bi-induced apoptosis (Pemg et
al., 2000; Thompson and Sawtell 2000). Expression of the bovine herpesvirus 1 LAT
(Jones et al., 1996) or portions of the HSV-1 LAT gene inhibit chemically induced
apoptosis in cell culture (Jones et al., 2001; Pemg et al., 2000).


71
Jarman, R. G., E. K. Wagner and D. C. Bloom, 1999, LAT expression during an acute
HSV infection in the mouse, Virology 262(2): 384-97.
Jarman, R. G., J. M. Loutsch, G. B. Devi-Rao, M. E. Marquart, M. P. Banaszak, X.
Zheng, J. M. Hill, E. K. Wagner and D. C. Bloom, 2002, The region of the HSV-1
latency-associated transcript required for epinephnne-induced reactivation in the
rabbit does not include the 2.0-kb intron, Virology 292(1): 59-69.
Javier, R. T., K. M. Izumi and J. G. Stevens, 1988, Localization of a herpes simplex virus
neurovirulence gene dissociated from high-titer virus replication in the brain, J
Virol 62(4): 1381-7.
Jin, L., W. Peng, G. C. Pemg, D. J. Brick, A. B. Nesbum, C. Jones and S. L. Wechsler,
2003, Identification of herpes simplex virus type 1 latency-associated transcript
sequences that both inhibit apoptosis and enhance the spontaneous reactivation
phenotype, J Virol 77(11): 6556-61.
Johnson, P. A. and R. D. Everett, 1986, The control of herpes simplex virus type-1 late
gene transcription: a 'TATA-box'/cap site region is sufficient for fully efficient
regulated activity, Nucleic Acids Res 14(21): 8247-64.
Kapoor, A. K., A. A. Nash, P. Wildy, J. Phelan, C. S. McLean and H. J. Field, 1982,
Pathogenesis of herpes simplex virus in congenitally athymic mice: the relative
roles of cell-mediated and humoral immunity, J Gen Virol 60(Pt 2): 225-33.
Kenny, J. J., F. C. Krebs, H. T. Hartle, A. E. Gartner, B. Chatton, J. M. Leiden, J. P.
Hoeffler, P. C. Weber and B. Wigdahl, 1994, Identification of a second
ATF/CREB-like element in the herpes simplex virus type 1 (HSV-1) latency-
associated transcript (LAT) promoter, Virology 200(1): 220-35.
Kieff, E. D., S. L. Bachenheimer and B. Roizman, 1971, Size, composition, and structure
of the deoxyribonucleic acid of herpes simplex virus subtypes 1 and 2., J Virol
8(2): 125-32.
Kristensson, K., E. Lycke and J. Sjostrand, 1970, Transport of herpes simplex virus in
peripheral nerves, Acta Physiol Scand: 13-4.
Kubat, N. J., R. K. Tran, P. McAnany and D. C. Bloom, 2004, Specific histone tail
modification and not DNA methylation is a determinant of herpes simplex virus
type 1 latent gene expression, J Virol 78(3): 1139-49.
Kwon, B. S., L. P. Gangarosa, K. D. Burch, J. deBack and J. M. Hill, 1981, Induction of
ocular herpes simplex virus shedding by iontophoresis of epinephrine into rabbit
cornea, Invest Ophthalmol Vis Sci 21(3): 442-9.
Kwon, B. S., L. P. Gangarosa, Sr., K. Green and J. M. Hill, 1982, Kinetics of ocular
herpes simplex virus shedding induced by epinephrine iontophoresis, Invest
Ophthalmol Vis Sci 22(6): 818-21.


75
Pemg, G. C., B. Maguen, L. Jin, K. R. Mott, N. Osorio, S. M. Slanina, A. Yukht, H.
Ghiasi, A. B. Nesbum, M. Inman, G. Henderson, C. Jones and S. L. Wechsler,
2002, A gene capable of blocking apoptosis can substitute for the herpes simplex
virus type 1 latency-associated transcript gene and restore wild-type reactivation
levels, J Virol 76(3): 1224-35.
Pizer, L. I., S. U. Kim, P. Nystrom and V. C. Coates, 1978, Herpes simplex virus
replication in pheochromocytoma cell line that responds to nerve growth factor,
Acta Neuropathol (Berl) 44(1): 9-14
Post, L. E. and B. Roizman, 1981, A generalized technique for deletion of specific genes
in large genomes: alpha gene 22 of herpes simplex virus 1 is not essential for
growth, Cell 25(1): 227-32.
Powell, K. L., R. Mirkovic and R. J. Courtney, 1977, Comparative analysis of
polypeptides induced by type 1 and type 2 strains of herpes simplex virus,
Intervirology 8(1): 18-29.
Preston, V. G. and F. B. Fisher, 1984, Identification of the herpes simplex virus type 1
gene encoding the dUTPase, Virology 138(1): 58-68.
Reed, L. J. and H. Muench, 1938, A simple method of estimating fifty percent endpoints,
Am. J. Hyg. 27: 493-497
Rock, D. L. and N. W. Fraser, 1983, Detection of HSV-1 genome in central nervous
system of latently infected mice, Nature 302(5908): 523-5.
Rock, D. L. and N. W. Fraser, 1985, Latent herpes simplex virus type 1 DNA contains
two copies of the virion DNA joint region, J Virol 55(3): 849-52.
Rock, D. L., A. B. Nesbum, H. Ghiasi, J. Ong, T. L. Lewis, J. R. Lokensgard and S. L.
Wechsler, 1987, Detection of latency-related viral RNAs in trigeminal ganglia of
rabbits latently infected with herpes simplex vims type 1, J Virol 61(12): 3820-6.
Rodahl, E. and L. Haarr, 1997, Analysis of the 2-kilobase latency-associated transcript
expressed in PC 12 cells productively infected with herpes simplex vims type 1:
evidence for a stable, nonlinear structure, J Virol 71(2): 1703-7.
Roop, C., L. Hutchinson and D. C. Johnson, 1993, A mutant herpes simplex vims type 1
unable to express glycoprotein L cannot enter cells, and its particles lack
glycoprotein H, J Virol 67(4): 2285-97.
Rubenstein, R. and R. W. Price, 1983, Replication of thymidine kinase deficient herpes
simplex vims type 1 in neuronal cell culture: infection of the PC 12 cell, Arch
Virol 78(1-2): 49-64.


23
7.4, 1 mM EDTA and 0.1 M NaCl). Upon dilution of the DNA into TNE, 25 pi of CaCl2
was added per mix. DNA was precipitated by the administration of 250 pi of 2X HEPES
along with C02 for pH adjustment. This DNA solution was incubated at room
temperature for 30 minutes. The transfection mix was then added to the dishes and
incubated at 25C for 20-30 minutes. Media in a 5 mL volume was applied to the dishes
and transferred to 37C for 4 hours. The media was then aspirated and the cells were
hypotonically shocked with 1-2 mL of shock buffer (IX HEPES, 20% dextrose) for 60
seconds. The cells were briefly washed and 5 mL of media was added to the dishes.
Once these transfections were performed, viral infection was allowed to persist to full
cytopathic effect, usually 2-3 days post-infection. After the monolayer was depleted and
detached due to viral infection, any remaining cells were scraped and the entire solution
was vortexed and stored at -80C. This viral stock was frozen (-80C) and rapidly
thawed (37C) twice before isolating individual plaques.
Viruses produced from the transfections were detected and isolated by plaque
purification. Confluent 60 mm2 dishes of RS cells were infected with a series of dilutions
ranging from 10'3 to 10'8 in order to obtain dishes with well-isolated plaques. After a 1
hour inoculation, the infected dishes were covered with an overlay consisting of IX 5%
calf serum MEM and 0.8% agarose. This solid overlay allowed the maintenance of the
monolayer during the infection and functioned to limit spread of virus through the
monolayer, allowing for discrete plaque formation and subsequent plaque isolation.
Infections were maintained and monitored for 2-3 days. Once plaques were visible, the
dishes were stained for 3 hours with neutral red at a 1:30 dilution. The neutral red stain
was absorbed by living cells and consequently left the plaques white. This contrast


18
UL
17A-H (Thompson 2001)
Region of Mutation
Figure 1-2. Large LAT deletions used for virulence indications. An impact of the LAT
locus upon virulence has been implied by use of a couple of LAT deletion viruses. These
deletion viruses delete a large portion of the LAT locus and possibly remove several
regulatory regions in the LAT gene.


56
The LAT effects on apoptosis appear to be cell specific. In culture, LAT is unable
to protect 293, or COS-7 cells from apoptosis (Inman et al., 2001). It is clear that LAT
does induce apoptosis in certain cell lines using transient transfection assays with high
multiplicities of infection and high expression levels (Pemg et al., 2000). These results
are very interesting but it is uncertain if LAT plays an apoptotic role in the context of
whole virus and in animal models. These findings were used to develop the hypothesis of
an apoptotic function of LAT in TG, and that LAT mutants result in greater levels of
apoptosis within sensory ganglia. Unfortunately, an apoptotic role of LAT has not been
adequately proven in whole virus or in animal models. The neuronal survival and
apoptosis results present a potential additional role of the LAT locus upon the acute
infection and the establishment of latency, although the mutants used in these
experiments do not adequately allow the identification of a virulence function distinct
from latency phenotypes.
Analysis of a series of HSV recombinants containing deletions in the region known
to be required for reactivation identified a deletion that exhibited decreased pathology in
the rabbit eye during the acute infection. We hypothesized that this might represent a
separate function encoded by the LAT region and sought to study this recombinants
virulence in the well-defined mouse model. LD50 analysis and infectious virus production
in neuronal and non-neuronal tissues revealed that this mutant was dramatically restricted
in virulence. Additional analyses also included 17A480 and 17A489, which have been
described previously (Jarman et al., 2002) and involve mutations in the 5 region of the
LAT intron. Analysis of the LAT mutants 17A307 and 17A480, and their rescues, in the
mouse model revealed a dramatic impact of this region of the LAT gene on the acute


8
Hill et al, 1987a; Hill et al., 1987b; Kwon et al., 1981; Kwon et al., 1982). Viral
genomes within neurons of the TG reactivate and travel to the initial site of infection, the
eye. This model more closely mirrors the natural human infection in that infectious virus
can be recovered at the tissue initially infected with HSV-1 upon appropriate stress
stimuli. The rabbit models also are more discriminating than the mouse models in which
LAT mutants reactivate. Both the mouse model and the rabbit eye model have made it
possible to better understand the impact of the LAT upon the various stages of latency.
LAT Mutants and Phenotypes
From the use of animal models, the LAT has been shown to affect establishment
and reactivation phenotypes of latency. It has been proposed that the LAT may function
most directly on establishment and subsequently influence reactivation indirectly due to
decreased efficiency of establishment (Sawtell and Thompson 1992; Sawtell 1998;
Sawtell et al., 1998; Thompson and Sawtell 1997). When assayed with promoter reporter
viruses, it was determined that establishment of latent infections and the initiation of a
productive infection occur with the same kinetics (Margolis et al., 1992). This work also
identified four classes of neurons in the ophthalmic division of the trigeminal ganglion
that are susceptible to HSV-1 infection. These neuronal classes include substance P+,
CGRP+, LD2+ and SSEA-3+ neurons with the SSEA-3 (stage-specific embryonic
antigen 3) neurons to be the major class of these four to harbor a latent infection.
Additionally, with a similar reporter construct, the LAT promoter was shown to be most
active in both neuron number and intensity of staining during the acute stage of infection.
In this system, peak expression occurs in mouse trigeminal ganglia at 5-8 days post
infection in concordance with the end of lytic infection and suggests a role in the
establishment of latency (Thompson and Sawtell 1997).


61
Together, these data argue for the presence of a virulence region in the LAT locus clear
and distinct from a reactivation critical region (Figure 4-1). The virulence phenotypes for
the dLAT2903 and 17-AH viruses are not severe and the net result of deleting a large
region of LAT encompassing multiple genetic elements may be a phenotype that is less
severe than deleting single elements individually.
My hypothesis is that mutation of a combination of potentially opposing regulatory
regions may result in the masking of a clear acute phenotype. To address this possibility,
we engineered a mutant that removes the core element of the latent promoter along with
the exchange of a 480 bp region of the 5 intron of LAT with a lacZ stuffer sequence.
This mutant, 17APstA480, as the name suggests is simply the combination of the 17APst
and the 17A480 mutants. The virulence characteristics of this mutant are currently being
examined.
Establishment differences were seen with large LAT deletions but the regulatory
element was not well defined. The apoptosis and neuronal survival results were obtained
using mutants with a large region of shared sequence removed. From comparison of the
mutants, and what has been shown for the involvement of the 5 region of exon 1 in
reactivation, it would seem that the region of the LAT locus involved in establishment,
neuronal survival and possibly apoptosis maps to the 3 region of exon 1 and the 5
portion of the intron. Our data shows that small, concise mutations in this region of the
LAT locus do result in dramatic virulence results.
Mechanism
From the virulence data for the recombinants 17A307 and 17A480, it is clear that
a downstream region of LAT involving the end of exon 1 and the beginning of the 2.0 kb


54
proposed to enhance the efficiency of establishment (Pemg et al., 2000; Thompson and
Sawtell 1997). These studies were performed with relatively large LAT deletions, so
while one cannot rule out that a portion of the LAT gene may act upon establishment
these data are not consistent with the observation that LAT promoter mutants do not
show impaired establishment, and instead seem to act primarily at the level of
reactivation. In addition to LAT promoter mutants, concise, small mutations (200-400
bp) in the LAT promoter and/or the 5 region of exon 1 result in a dramatic reduction
(70-100%) in reactivating virus in the absence of any detectable differences in
establishment (Bloom et al., 1994; Bloom et al., 1996).
It has been argued by Sawtell and Thompson that the LAT mediates its effects on
the establishment phase of the latent infection (Sawtell and Thompson 1992; Thompson
and Sawtell 1997). To test for an establishment decrease, they tested 17sy+ (parental)
along with 17-AH, which is a deletion of the LAT promoter, exon 1 and half of the 2.0 kb
intron in comparison to its rescue, 17-AHR (Thompson and Sawtell 2001). These viruses
were tested for a measurable difference in establishment in the mouse TG after comeal
infection. In these experiments, they report a decrease of approximately 33% in viral
DNA detected in TG for the 17-AH mutant in comparison to parental vims and 17-AHR.
They argue that these results demonstrate an establishment decrease sufficient to
facilitate the reactivation reductions in their experiments and reported by others (Bloom
et al., 1994; Pemg et al., 1994; Pemg et al., 1996).
A biological mechanism hypothesized to result in establishment decreases is a
difference in neuronal survival, or apoptosis, for LAT mutants in comparison to parental
HSV-1. Sawtell and Thompson produced data suggesting a role of LAT in protecting


46
Viruses
B.
01
Q.
1.00E+07
1.00E+06
1.00E+05
1.00E+04
1.00E+03
1.00E+02
1.00E+01
l.OOE+OO
17syn+ 17dPst 17d307 17d307R 17d480
Viruses
Figure 3-3. Virus production in dorsal root ganglia at 3 and 5 days post-infection. DRG
were homogenized and tested for infectious virus by plaque assay on RS cells.
Values are recorded as pfu/g tissue. A) The graph at the top is for 3 days post
infection. B) The bottom is for DRG at 5 d.p.i. The difference between
17A307 and 17A307R is statistically significant P=0.0018 (unpaired t test,
Welsch corrected)


26
LAT Recombinant Viruses
The HSV-1 recombinants 17APst, 17A307,17A307a, 17A307R, 17A480,17A480R
and 17APstA480 were all engineered by homologous recombination. Plasmids
containing the mutated regions were transfected into rabbit skin cells along with full
length \lsyn+ HSV-1 genomic DNA. 17A307, 17A307a, 17A307R, 17A480 and 17A489
were constructed in the laboratory of Dr. Ed Wagner at U.C. Irvine. These recombinants
replaced portions of the LAT gene with stuffer DNA sequence and consequently retained
the size and spacing of the LAT gene. 17A480 and 17A489 contain inserted DNA from
the lacZ gene into the either the Ppmul-Sfil site for 17A480, or the Sfil-Hpal location for
17A489. The mutants 17A307 and 17A307a also contain stuffer sequences. 17A307 has
a polyadenylation sequence from SV-40, whereas the native DNA for 17A307a has been
replaced with a polyadenylation sequence from rabbit (3-globin. The mutant 17APst is a
202 base pair clean deletion of DNA between the Pst I sites in the core latency promoter
of the LAT gene. This mutant was created in the Stevens lab at UCLA and has been
described previously (Bloom et al., 1994).
17A480R
For in vivo and cell culture experiments, it was critical to make two additional LAT
mutants. First, the fact that the phenotypes for the 17A480 were the result of the 480 bp
deletion was confirmed by the construction of a rescue of this virus (17A480R). This
rescue was generated by homologous recombination using a 1.2 kb DNA PCR product.
The PCR reaction was performed with oligonucleotides 17AB1R
(5GAGATGAACACTCGGGGTTAC 3) and 17AB2R
(5CGGACTBACCTGGCCTCTGG 3). These primers begin at positions 119,181 and


CHAPTER 1
INTRODUCTION
General Characteristics of HSV-1
Herpes Simplex Virus-type I (HSV-1) is a widely prevalent human pathogen that is
nuclear replicating, enveloped particle within an icosahedral capsid containing an
amorphous tegument (Roizman et al., 1974). The genome of HSV-1 is a double stranded
DNA molecule of 152 kb, encoding more than 70 protein products (Becker et al., 1968;
Kieff et al., 1971; McGeoch et al., 1985; McGeoch et al., 1988). Regions of the genome
are rich in repetitive sequence, whereas other areas contain mostly unique sequence. The
HSV-1 genome also has a high GC content in comparison to other viruses (Becker et al.,
1968; Kieff et al., 1971; McGeoch et al., 1988). HSV-1 is an alphaherpesvirus and as
such is neurotropic with rapid replication capabilities and exhibits a broad host and cell
range (Jamieson et al., 1974). While HSV-1 is able to infect a wide spectrum of different
mammalian cell types, the ability to replicate and establish a latent infection within
neurons is central to HSV-ls biology (Dotti et al., 1987; Dotti et al., 1990). Because
most neurons divide infrequently and consequently rarely express proteins necessary for
DNA replication, HSV-1 encodes specialized functions for existing within the highly
differentiated cells (Caradonna et al., 1981; Honess et al., 1974; Honess et al., 1975;
Huszer et al., 1981; Preston et al., 1984).
Attachment and entry of infectious viral particles involve interaction between
several cellular membrane glycoproteins and receptors (Baines et al., 1991; Cai et al.,
1988; Forrester et al., 1992; Javier et al., 1988; Johnson et al., 1986; Longnecker et al.,
1


20
Table 1-2. The ratio of HSV to actin DNA in rabbit trigeminal ganglia
latently infected with 17A307 and 17A307R mutants of HSV-l8
Rabbit infected with
17A307 Tattoo(side)
Ratio HSV to
Actin DNA
Rabbit infected with
17A307R Tattoo(side)
Ratio HSV
to Actin
DNA
G2(od)
0.57
G23(od)
0.51
G2(os)
0.25
G23(os)
0.34
G3(od)
0.83
G24(od)
0.37
G3(os)
0.42
G24(os)
0.64
G4(od)
0.5
G28(od)
0.19
G4(os)
0.31
G28(os)
0.522
G6(od)
0.5
G32(od)
0.46
G6(os)
0.41
G32(os)
0.59
G8(od)
0.5
G34(od)
0.38
G8(os)
0.42
G34(os)
0.63
G9(od)
0.52
G35(od)
0.29
G9(os)
0.58
G35(os)
0.44
G10(od)
G10(os)
Average ratio =
0.36
0.48
0.480.14
Average ratio = 0.450.14
aThe 17A307 LAT recombinant virus was tested by semiquantitative PCR from
differences in establishment in comparison to its rescue, 17A307R. Values were plotted
for the HSV-l gene DNA polymerase as a ratio to cellular rabbit actin DNA. From
measurement of the ratios between 17A307 and 17A307R, no detectable differences in
establishment were observed.


14
the LAT gene promotes neuronal survival by reducing apoptosis. The apopotosis results
have been questioned due to incompatible reagents used in the p85 PARP and TUNEL
assays used to suggest an in vivo apoptotic role for the LAT (Thompson and Sawtell
2000). Another large LAT deletion mutant (17-AH) when used in the infection of the
mouse eye model showed a depletion of over half the TG neurons. Apoptosis in HSV-1
infected ganglia during lytic infection has been demonstrated. The 17N/H mutant
overlaps the impairment engineered in the 17-AH mutant but extends further into the
intron. Use of this mutant resulted in the loss of neurons as measured by an increase in
TUNEL-positive TG neurons (Ahmed et al., 2002), though the total numbers of TUNEL-
positive cells were low.
The LAT has been proposed to promote neuronal survival and consequently leads
to high levels of establishment (Thompson and Sawtell 2001). If this is true, then LAT(-)
viruses would be expected to demonstrate a reduced level of replication in sensory
ganglia and would have altered virulence phenotypes in the mouse. A possible reason
that this has not been observed is due to the impairment of several regulatory regions in
the construction of most of the relatively large LAT deletion mutants reported in the
literature. The LAT has been shown to influence reactivation, establishment, apoptosis in
cell culture and may affect neuronal survival. The reactivation phenotypes associated
with the LAT have been well mapped but the positions of other regulatory regions in the
LAT region are still uncertain. Mutants that have been used to show anti-apoptotic
include very large deletions that also affect the region of LAT known to function in
reactivation. To identify and characterize the motifs of LAT involved in the lytic


pfu/g
48
1.00E+08
1.00E+07
1.00E+06
1.00E+05
1.00E+04
1.00E+03
1.00E+02
1.00E+01
l.OOE+OO
Figure 3-5. Virus production in brain at 7 days post-infection. Mouse brains were
homogenized and tittered for infectious virus by plaque assay on RS cells.
Values are plotted as pfu/g tissue. The difference between 17A307 and
17A307R is statistically significant (P-0.009) and the difference between
17A480 and \lsyn+ is also statistically significant (P-0.0022) as measured by
unpaired t test (Welsch corrected).
17syn+ 17dPst 17d307 17d307R 17d480
Viruses


12
and this may be due in part to a change in the acetylation profile of the region
(ONeil/Kubat, in preparation). One could speculate that active LAT expression is not
compatible with reactivation, and its downregulation may in turn stimulate, or allow the
downstream, opposite strand regulatory protein, ICPO to be transcribed and initiate a lytic
cascade. Clearly, the LAT region has important regulatory implications for the regulation
of lytic and latent infections, and these will be discussed in further detail in the following
sections.
Other Regulatory Regions of LAT
The promoter responsible for expression of the 8.3 kb primary LAT transcript has
been shown to possess multiple control elements including cyclic AMP response
elements (CRE), CAT box, Spl, USF, YY1 and AP-2 sites (Kenny et al., 1994; Soares et
al., 1996; Wechsler et al., 1988; Wechsler et al., 1989; Zwaagstra et al., 1991). This
latent promoter has enhanced promoter activity in cells of neuronal origin (Zwaagstra et
al., 1990). It has been suggested that the LAT gene may encode an alternative, or
cryptic, downstream promoter element separate from the latent promoter that may be
active during acute viral replication (Nicosia et al., 1994; Goins et al., 1994). This
alternative promoter has been indicated by transient transfection assays and roughly
localizes to a region 5 of the 2.0 LAT intron splice donor site. The presence of a
neuronal enhancer approximately 60 base pairs downstream of the transcription start site
has been identified (Soares et al., 1996). This promoter has been incorrectly labeled as a
second latent promoter. It is clear that the promoter is active during the lytic infection
and not during latency (Soares et al., 1996). This region may play a very important role
in the acute phase of HSV-1 infection and the characterization of this downstream region