Citation
Progesterone and corticosteroid interaction during pregnancy in ewes

Material Information

Title:
Progesterone and corticosteroid interaction during pregnancy in ewes
Creator:
Hua, Yi
Publication Date:
Language:
English
Physical Description:
viii, 105 leaves : ill. ; 29 cm.

Subjects

Subjects / Keywords:
Corticosteroids ( jstor )
Ewes ( jstor )
Hippocampus ( jstor )
Messenger RNA ( jstor )
Plasmas ( jstor )
Pregnancy ( jstor )
Rats ( jstor )
Receptors ( jstor )
Sheep ( jstor )
Steroids ( jstor )
Corticotropin ( mesh )
Hydrocortisone -- physiology ( mesh )
Pregnancy ( mesh )
Progesterone -- physiology ( mesh )
Receptors, Glucocorticoid ( mesh )
Receptors, Mineralocorticoid ( mesh )
Sheep ( mesh )
Genre:
bibliography ( marcgt )
theses ( marcgt )
non-fiction ( marcgt )

Notes

Thesis:
Thesis (Ph. D.)--University of Florida, 2002.
Bibliography:
Includes bibliographical references (leaves 86-104).
General Note:
Typescript.
General Note:
Vita.
Statement of Responsibility:
by Yi Hua.

Record Information

Source Institution:
University of Florida
Rights Management:
The University of Florida George A. Smathers Libraries respect the intellectual property rights of others and do not claim any copyright interest in this item. This item may be protected by copyright but is made available here under a claim of fair use (17 U.S.C. §107) for non-profit research and educational purposes. Users of this work have responsibility for determining copyright status prior to reusing, publishing or reproducing this item for purposes other than what is allowed by fair use or other copyright exemptions. Any reuse of this item in excess of fair use or other copyright exemptions requires permission of the copyright holder. The Smathers Libraries would like to learn more about this item and invite individuals or organizations to contact the RDS coordinator (ufdissertations@uflib.ufl.edu) with any additional information they can provide.
Resource Identifier:
53985010 ( OCLC )
ocm53985010

Downloads

This item has the following downloads:


Full Text










PROGESTERONE AND CORTICOSTEROID INTERACTION DURING
PREGNANCY IN EWES












By

YI HUA













A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY

UNIVERSITY OF FLORIDA

2002





























A dedication to my parents, for their love and believing in me.















ACKNOWLEDGMENTS

First of all, I would like to thank my mentors, Dr. Charles Wood and Dr. Maureen

Keller-Wood for their immeasurable guidance, support and dedication to my doctoral

training. They are role models both in academic life and in real life for me. Their

enthusiastic attitude to science and their keen insight always inspired me when I felt in

the darkness of my research.

I am also very thankful to my committee members: Dr. Colin Sumners, Dr. Paul Oh

and Dr. Rosalia Simmen. They gave me a lot of intellectual advice for my project and

they were always there to help when I had any questions.

I thank Dr. Elaine Sumners for her help and patience. She taught me the techniques

step by step when I first came to the lab and gave me daily-basis trouble shooting for the

experiments.

My appreciation also goes to all the members in the lab for their encouragement,

support and friendship which made me confident and felt like I was part of a big family.

I thank my sister from the bottom of my heart for her support and taking care of our

parents during the hard times which made this dissertation possible.

Finally, my deep appreciation goes to my husband for his support, understanding and

love in every single aspect, which helped me achieve this height.








iii
















TABLE OF CONTENTS
page

ACKNOWLEDGMENTS............................................................................................ iii

A B ST R A C T ................................................................................................................ vii

CHAPTER

1 INTRODUCTION.................................................................................................... 1

2 LITERATURE REVIEW......................................................................................... 3

2.1 Corticosteroid and Corticosteroid Receptor.............................................................. 3
2.1.1 General Introduction................................................................................ 3
2.1.2 Pharmacological Characterization...........................................................4
2.1.3 Localization ............................................................................................... 5
2.1.4. Isoform s.................................................................................................... 6
2.1.4.1. Isoforms of GR............................................................................. 6
2.1.4.2 Isoforms of MR ............................................................................. 7
2.1.5 Genetic Characterization of MR and GR .................................... ............ 8
2.1.6 Mechanisms of Action............................................................................. 9
2.1.6.1 Genomic actions............................................................................ 9
2.1.6.2 Nongenomic action ...................................... .............................. 11
2.1.7 Specificity in Mineraloccorticoid verus Glucocorticoid Action .................. 11
2.1.8 MR/GR Mediated Physiological Function of Glucocorticoids................... 13
2.1.9 Regulation of Receptors ............................................................................. 14
2.1.10 11 P-Hydroxysteroid Dehydrogenase (11 3-HSD) ................................... 16
2.2 Corticosteroid and HPA Axis.......................................................................... 17
2.2.1 Introduction ............................................................................................. 17
2.2.2 Fast Feedback ................................................................................................ 18
2.2.3 Intermediate and Slow Feedback........................................................... 19
2.3 Hippocampus and Its Connection ................................................................... 20
2.3.1 Role of Hippocampus in HPA Regulation................................... .......... 20
2.3.2 Hippocampus and Its Connection...............................................................21
2.4 Physiological Adaptation During Pregnancy ...................................... ........... 22
2.4.1 Changes in Cardiovascular Function in Pregnancy................................... 22
2.4.2 Changes in Regulation of Cortisol and ACTH During Pregnancy................ 23
2.4.2.1 Basal activity ............................................................................... 23
2.4.2.2 Feedback sensitivity .................................................................... 24
2.4.3 Role of Ovarian/Placental Steroid ............................................ .......... ... 25



iv









2.4.3.1 E strogen........................................................................................... 25
2.4.3.2 Progesterone................................................................................... 26
2.4.4 Significance of Elevated Cortisol in Pregnancy.......................................... 27
2.5 Corticosteroids Effects on Serotonin Receptors................................. ............. 27
2.6 Animal Models.................................................................................................. 29
2.7 Significance....................................................................................................... 30
2.8 O bjectives.......................................................................................................... 31

3 GENERAL MATERIALS AND METHODS ........................................ ........... .. 36

3.1 A nim al C are ...................................................................................................... 36
3.2 General Surgical Procedure............................................................................. 36
3.2.1 Adrenalectomy and Ovariectomy.......................................................... 36
3.2.2 Vascular Catheterization ................................... .................................. 37
3.3 Chronic Steroid Implantation.......................................................................... 37
3.4 Tissue Collection............................................................................................... 37
3.5 Collecting Blood Samples and Measurement.................................... ............ 38
3.5.1 Sampling and Storage................................... .........................................38
3.5.2 Hormones: Cortisol, Aldosterone and Progesterone ................................. 38
3.5.3 Free Cortisol and Progesterone ............................................... ............ 39
3.6 Receptor Binding Assays ................................................................................ 39
3.6.1 General Methodology............................................................................ 39
3.6.1.1 Tissue preparation ...................................... ................................. 39
3.6.1.2 Incubation.................................................................................... 40
3.6.1.3 Separation of bound from free .......................................................... 42
3.6.2 Saturation Binding Analysis..................................................................... 42
3.6.3 Total Receptor Availability ................................................................... 43
3.7 Western Blot Analysis....................................................................................... 44
3.7.1 Tissue Preparation ................................................................................. 44
3.7.2 Electrophoresis and Transfer.................................................................... 44
3.7.3 MR Western Blotting Method ............................................................... 44
3.7.4 GR Western Blotting Method............................................................. 45
3.7.5 P-actin Western Blotting Method........................................... ............... 46
3.8 R T -PC R ............................................................................................................. 46
3.9 Statistic Analysis............................................................................................... 46

4 R T -PC R ................................................................ . ............. ........................................ 48

4.1 Semi-Quantitative RT-PCR ............................................................................ 49
4.1.1 RNA Extraction and Sample Preparation.................................................49
4.1.2 Primer Design..........................................................................................49
4.1.3 Semi-quantitative RT-PCR.................................................................... 50
4.1.4 PCR Product Purification and Sequencing............................... ............. 51
4.2 Real-Time RT-PCR........................................................................................... 52
4.2.1 RNA Extraction and Sample Preparation................................ ........... ... 52
4.2.2 Primer and Probe Design...................................................................... 53
4.2.3 Real-time RT-PCR ................................................................................ 54


v









4.2.3.1 M ixture .......................................................................................... 54
4.2.3.2 Primer, probe and starting RNA concentration............................... 54
4.2.3.3 RT-PCR cycles............................................................................ 55
4.2.4 Expression of Data ................................................................................ 55
4.3 Corticosteroid Receptor Regulation in Sheep after Acute Adrenalectomy.............55
4.3.1 Introduction ............................................................................................. 55
4.3.2 M ethods ................................................................................................... 56
4.3.3 R esults ..................................................................................................... 57
4.3.3.1 Semi-Quantitative analysis of mRNA for MR and GR................... 57
4.3.3.2 Sequence of PCR product of MR and GR......................................... 57
4.3.4 D iscussion ..................................................................................................... 58
4.4 MR Expression in Late-Gestation Ovine Fetal Lung............................ ........... 59
4.4.1 Introduction ............................................................................................. 59
4.4.2 M ethods ................................................................................................... 60
4.4.3 R esults ..................................................................................................... 60
4.4.4 D iscussion ............................................................................................... 60

5 ALTERATION OF MINERALOCORTICOID RECEPTOR FUNCTION BY
PREGNANCY AND PROGESTERONE................................................................. 66

5.1 Introduction ....................................................................................................... 66
5.2 Materials and Methods...................................................................................... 67
5.3 R esults ............................................................................................................ . 69
5.3.1 Cortisol, Progesterone and Aldosterone Level in Plasma ........................... 69
5.3.2 Total Available Receptor Binding at MR and GR in Hippocampus............. 69
5.3.3 Apparent Kd of MR with Cortisol in Hippocampus ..................................... 70
5.3.4 MR and GR Protein Levels and mRNA Expression in Hippocampus.......... 71
5.3.5 5-HT1A Receptor mRNA Level in Hippocampus...................................... 71
5.4 D iscussion ..................................................................................................... . . 72

6 SUMMARY AND CONCLUSIONS................................................................... 84

LIST OF REFERENCES ............................................................................................ 86

BIOGRAPHICAL SKETCH........................................................................................... 105















vi















Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy

PROGESTERONE AND CORTICOSTEROIDS INTERACTION DURING
PREGNANCY IN EWES
By

Yi Hua



December, 2002


Chair: Charles E.Wood
Cochair: Maureen Keller-Wood
Major Department: Physiology and Functional Genomics

Adrenal steroids are critical hormones for the maintenance of body homeostasis.

Cortisol and adrenalcorticotropic hormone (ACTH) are strictly regulated by a closed

feedback loop. During pregnancy, both plasma ACTH and cortisol levels increase in

sheep as well as in humans. This increased level of cortisol is important and necessary for

maternal and fetal normal health. Previous results showed that the set point for regulation

of ACTH and cortisol has been increased during pregnancy. This dissertation is trying to

explain why this set point can be increased and how it works.

Studies in rats showed that ACTH level is controlled by a dual receptor system. At

basal level of cortisol, it is controlled by mineralocorticoid receptor (MR) which has high

affinity and low capacity for corticosteroid. In stimulated situations when cortisol level

increases, it is controlled by glucocorticoid receptor (GR) which has low affinity and high




vii









capacity. I hypothesize that during pregnancy, with high level of progesterone, MR

function decreases and GR function keeps normal. I hypothesize progesterone acts as an

antagonist of cortisol at MR and/or reduces MR number in the pregnant state and it acts

with cortisol at GR as a partial agonist which results in the combined effects of

progesterone and cortisol. To test these hypotheses, we studied pregnant or progesterone-

treated nonpregnant ewes with sham adrenalectomy or adrenalectomy. Receptor binding

studies showed that there was a significant relationship between the plasma progesterone

concentration and the availability of MR, and between the plasma progesterone

concentration and the apparent Kd of MR for cortisol. There was a significant increase in

MR availability and Kd for cortisol in hippocampal cytosol in pregnant ewes as

compared to nonpregnant ewes whether they were sham- adrenalectomized or

adrenalectomized. The apparent Kd was also increased in the progesterone-treated,

nonpregnant adrenalectomized ewes relative to the nonpregnant adrenalectomized ewes

without progesterone treatment. There were no differences in hippocampal GR binding.

In addition, using Western blot and real-time RT-PCR, we measured the protein and

mRNA expression in hippocampus for MR as well as GR. No significant difference had

been detected.

These studies support the hypothesis that increased progesterone during pregnancy

reduces MR-mediated effects of cortisol, resulting in decreased feedback effects in the

hippocampus at the basal level of cortisol. In addition, GR-mediated effects of cortisol

haven't been changed by progesterone so that a feedback effects at the stimulated level of

cortisol during pregnancy are the same as in nonpregnant state.






viii














CHAPTER 1
INTRODUCTION

The adrenal steroid hormones are critical for maintenance of body homeostasis. The

concentrations of adrenocorticotropic hormone (ACTH) and cortisol, the major

glucocorticoid in human and sheep, are tightly regulated by a negative feedback loop axis

(Dallman et al., 1987b). However, during pregnancy, both maternal cortisol and ACTH

levels are increased in sheep, as well as in humans (Bell et al., 1991; Carr et al., 1981).

Previous studies in our laboratory in sheep showed that the set point for the feedback

regulation of basal plasma cortisol is increased during pregnancy (Keller-Wood, 1998).

This would allow the basal plasma concentration of cortisol to be maintained at a higher

level without suppression of ACTH, whereas further increases in cortisol concentration

would suppress plasma ACTH concentration, as it does in nonpregnant sheep. However,

the mechanism of the normal pregnancy-induced increase in set point for cortisol is

unknown.

Regulation of ACTH is thought to involve both corticosteroid receptor subtypes, the

mineralocorticoid receptor (MR) and the glucocorticoid receptor (GR). Whereas MR has

a high affiity for cortisol and is almost fully occupied at the basal concentration of

cortisol, GR has a lower affmity for cortisol, but higher capacity (de Kloet and Reul,

1987). We estimate that approximately 90% of MR, but only 30% of GR are occupied at

the basal steroid level in adrenal intact ewes. This difference in affinity and occupancy of

the two receptor subtypes has led to the hypothesis that MR are more involved in the

regulation of the basal concentration of cortisol, whereas GR participate in the feedback


1






2

regulation when the cortisol concentration increases (Bradbury et al., 1994;Reul et al.,

1987). The localization of MR and GR is also consistent with MR effects mediating

tonic, basal control of the axis, and GR mediating control of stimulated responses. GR is

distributed in all the brain regions, but MR has highest abundance in the hippocampus

(Herman et al., 1989a;Reul and DeKloet, 1985), suggesting that whereas glucocorticoid

feedback is exerted at multiple sites (including hypothalamus and pituitary), MR-

mediated feedback effects occur primarily in the hippocampus, which regulates basal

ACTH through inhibitory connections to the paraventricular nucleus (PVN) (Herman and

Cullinan, 1997).

It has been shown that progesterone can antagonize MR-mediated effects in vivo

(Wambach and Higgins, 1979;Spence et al., 1989) and in vitro (Jones et al.,

1977;Rupprecht et al., 1993). Progesterone has very high affinity for the human MR, but

progesterone exerts very low transcriptional activity after binding MR (Rupprecht et al.,

1993b). Progesterone also binds to human GR with an affinity similar to that of cortisol,

and exerts moderate activity after binding, suggesting that progesterone can act as partial

agonist at human GR. Progesterone has an approximately equal affinity compared to

cortisol at the ovine MR and lower affinity for ovine GR. Studies in rats have suggested

that progesterone treatment in vivo alters corticosterone binding at MR (Carey et al.,

1995). We therefore hypothesized that during pregnancy or during chronic progesterone

treatment, progesterone will act as an antagonist to cortisol binding at MR, reducing MR

availability and increasing the apparent Kd of MR for cortisol in hippocampal cytosol.














CHAPTER 2
LITERATURE REVIEW

Corticosteroids are hormones secreted from cortex of adrenal gland. They have

tremendous effects on different systems. Corticosteroid hormone action involves binding

to two intracellular receptors. Both of these two receptors can bind with corticosteroids.

However, they show a lot of differences in their pharmacological and physiological

characteristics. This dissertation is based on the hypothesis that elevated ovarian steroids,

especially the progesterone, contribute to the adaptation of pregnancy by decreasing

feedback effects at the basal level of cortisol without interfering with the feedback effects

when the level of cortisol are increased after stress or stimulation. This chapter reviews

the current knowledge about corticosteroids, their receptors and their regulation,

physiological adaptation during pregnancy, ovarian steroids' effects on corticosteroid

receptor and potential mechanisms for set point adaptation by progesterone.

2.1 Corticosteroid and Corticosteroid Receptor

2.1.1 General Introduction

Corticosteroids are synthesized in the adrenal gland and participate in the regulation of

physiological processes in a variety of organ systems (Miller, 1995). They exert a wide

range of functions throughout the body to keep the homeostasis of the body and respond

to stress or stimulus from internal or external environment. There are two types of

corticosteroid receptors, through which corticosteroids modulate their target tissues. The

two receptors co-localize in many tissues (McEwen et al., 1986). These receptors not

only mediate the physiological effects of corticosteroids, but also participate in the


3






4

feedback loop that regulates plasma levels of cortisol (Bradbury et al., 1994;Reul and

DeKloet, 1985).

2.1.2 Pharmacological Characterization

Corticosteroid receptor type I, also called the mineralocorticoid receptor (MR), have

high affinity with corticosteroids and low capacity (de Kloet and Reul, 1987). In different

species, its affinity with these hormones shows variation. The affinity's rank order for the

major circulating corticosteroids (corticosterone, cortisol, and aldosterone) is as follows.

In the rat and the mouse, which uses corticosterone as the principal corticosteroid, MR

displays a high affinity for aldosterone and corticosterone (~0.5 nM) and a lower affinity

for cortisol (Reul and DeKloet, 1985). In the dog, which like humans and sheep uses

cortisol as the principal corticosteroid, the MR also has a very high affmity for

corticosterone (~0.05nM) and a lower affinity (~0.2nM) for cortisol and aldosterone

(Reul et al., 1990). In human, MR binds those steroids with similar order: high affinity

for corticosterone (<0.0lnM), lower affinity for cortisol(0.13nM) and aldosterone

(0.09nM) (Rupprecht et al., 1993b). In Dr. Keller-Wood's lab, we characterized the

binding affiity in sheep. Ovine MR has similar high affinity for aldosterone (0.17 nM)

and cortisol (0.19nM). Because of its high affinity with corticosteroids, MR is almost

fully occupied at the basal concentration of cortisol. It is thought to mediate tonic actions

of corticosteroid.

Corticosteroid receptor type II, also called the glucocorticoid receptor (GR), has lower

affinity with glucocorticoid compared with MR and higher capacity. The parallel

experiments showed that in the rat, the GR has a relatively high affinity (but lower than

the MR) for corticosterone (~5nM) and even lower affinity for cortisol and aldosterone

(-20nM) (Reul and DeKloet, 1985). In the dog, the GR has an equal but lower affinity






5

than the MR for corticosterone and cortisol (~5nM) and two-fold lower affinity for

aldosteorne (-10nM) (Reul et al., 1990). In human, the GR has a lower affinity for

cortisol (15nM) than MR and much lower affinity for corticosterone (40nM) and

aldosterone (63nM) (Rupprecht et al., 1993b). In sheep, the GR's affinity for cortisol is

also lower than MR (0.7nM) and its affinity for aldosterone is even lower (10.2nM).

Therefore, GR is much less occupied at basal level of cortisol, but occupation increases

with the increase of cortisol concentration after internal or external stimulation. So, GR

shows its effects more when the cortisol level is relatively high. In our lab, we measured

and estimated that approximately 90% of MR and 30% of GR are occupied at the basal

steroid level in adrenal intact ewes. This difference in affinity and occupancy of the two

receptor subtypes has led to the hypothesis that MR is more involved in the regulation of

the basal level of cortisol at the feedback sites, while GR participates in the feedback

regulation when cortisol level increases (Bradbury et al., 1994;Reul et al., 1987).

2.1.3 Localization

By in situ hybridization and immunohistochemistry, different labs localized the MR

and GR in central nervous system and peripheral tissues. GR is widely expressed in most

cell types whereas MR expression is restricted to epithelial cells in kidney, colon and the

salivary glands, and non-epithelial cells in brain and heart (Reichardt and Schutz, 1998).

In the periphery, access of cortisol and corticosterone to MR is prevented by a pre-

receptor mechanism (see section on 11 1-HSD) and as a consequence,

cortisol/corticosterone binding to MR mainly plays a role in the brain. In the brain, GR is

widely distributed in a large number of CNS nuclei with higher concentrations in regions

involved in the stress response such as the paraventricular nucleus (PVN) of the






6

hypothalamus, anterior pituitary and in the hippocmapus (Herman et al., 1989a;Reul and

DeKloet, 1986;Van Eekelen et al., 1988). The distribution of MR is somewhat more

limited with the highest abundance in pyramidal neurons of the hippocampus (Herman et

al., 1989a;Reul and DeKloet, 1985), suggesting that whereas GR-mediated feedback is

exerted at multiple sites (including pituitary and hypothalamus, especially PVN), MR-

mediated feedback effects occur primarily in the hippocampus. The localization of MR

and GR is consistent with MR effects mediating tonic, basal control of the axis, and GR

mediating control of stimulated responses. Both MR and GR mRNA exhibit highest

levels of expression in the limbic system, most notably in the hippocampal formation.

However, within hippocampal formation, GR and MR show wide differences in relative

level of abundance. GR mRNA has highest levels in CA1, intermediate levels in dentate

gyrus (DG), and low levels in CA3, whereas MR signal is heaviest in CA2, CA3, is

approximately equal in intensity in CAl and DG (Aronsson et al., 1988;Arriza et al.,

1988;Herman et al., 1989a;Sousa et al., 1989;Van Eekelen et al., 1988;Yang et al., 1988).

The picture emerging from these reports is that both the concentration of circulating

corticoids and the cellular availability of the corticosteroid receptor subtypes are critical

in determining how individual cells interpret the corticoid signals

2.1.4. Isoforms

2.1.4.1. Isoforms of GR

In human, there are at least two isoforms of GR that have been identified, GRa and

GRP. They are the product of alternative splicing of the 3'-end of the GR (hGR), which

encodes the ligand binding domain (Encio and Detera-Wadleigh, 1991;Hollenberg et al.,

1985). Translation of GRa and GR3 produces two proteins identical in the first 727 N-







7

terminal amino acids containing the transactivation and DNA-binding domains. The only

difference is in their carboxy-terminal; as a result, GRa binds cortisol while GRO does

not (Oakley et al., 1996). GRa's activity is inhibited by GRO (Oakley et al., 1996). In rat

GR pre-mRNA lacks this splice site (Otto et al., 1997).

2.1.4.2 Isoforms of MR

Expression of the human MR gene may result in the formation of at least four

transcripts, which are derived from two different promoters (Arriza et al., 1987;Kwak et

al., 1993;Zennaro et al., 1995). The two main transcripts, MRa and MR3, are different in

5'-untranslated exon 1 and so they have identical amino acids. In rat, a MRy transcript

derived from exon 1 is detectable in very low amounts. There is also another splice

variant in MR, which is between exon 3 and 4. It creates a 12bp difference in mRNA and

4 amino acids in protein (Bloem et al., 1995). These four amino acids are in the two zinc

finger domains of the DNA-binding domain. A low abundance had been detected for this

splice variant in hippocampus in human and rat (Bloem et al., 1995). Since the difference

is in the DNA binding domain, it is quite possible that this splice variant would have

aberrant functional properties.

In ovine, the MR has not been cloned, but a 942 base pair segment of the ovine GR

corresponding to residues 143-453 of the human GR (80% identity) has been cloned

(Yang et al., 1992).

The availability of multiple isoforms of MR and GR indicates that the physiological

function of the steroid receptors is very complicated. Each receptor isoform would be

expected to have a different rank order of affinity for the endogenous ligands and each






8

ligand receptor complex would be expected to bind various genetic response elements

with varying affinity and efficacy.

2.1.5 Genetic Characterization of MR and GR

The amino acid sequences of the two proteins are highly homologous and their

structural and functional domains are similar (Arriza et al., 1987). Both receptors are

considered to be divided into functional domains designated domains A through F. The

DNA-binding domain is mapped to the well conserved middle region (C domain) of the

receptor. The less conserved carboxy-terminal E/F domain is the ligand binding domain.

The amino terminus is A/B domain. The amino terminal region contains an autonomous

activation function, AF-1. It was thought to be a key element in transactivation together

with AF-2, which is located at carboxy-terminal domains. The amino terminus varies in

size and bares no structural homology among the MR and GR. In human, the N-terminal

region of MR and GR has only 15% homology. This difference seems to be a critical

determinant for the different efficiency in stimulating gene expression by MR and

GR(Arriza et al., 1987;Arriza et al., 1988;Hollenberg et al., 1985;Rupprecht et al.,

1993b). In the GR, this region contains a stronger transactivation function than MR and is

necessary for efficient stimulation of gene transcription (Danielsen et al., 1987;Giguere et

al., 1986;Hollenberg and Evans, 1988). It has been shown that MR exerts a less

pronounced stimulation of transcription rate than the GR and does not show synergistic

activity on promoters containing two copies of a pallindromic binding site (Rupprecht et

al., 1993a). However, the carboxy-terminal ligand binding domain (57% identity in

human) and the cysteine rich zinc finger DNA binding domain (94% identity in human)

are highly homologous (Arriza et al., 1987) (Fig 2-1). These structural similarities allow

the two receptors to have similar steroid binding and activation profiles (Rupprecht et al.,






9

and to bind closely related DNA target sequences (Arriza et al., 1987). In addition, the

ligand-binding domain contains sequences responsible for heat-shock protein

interactions, nuclear translocation, dimerization and transcription activation function

(AF-2) (Hollenberg and Evans, 1988).

2.1.6 Mechanisms of Action

2.1.6.1 Genomic actions

2.1.6.1.1 DNA binding dependent mechanism

Corticosteroid receptors are nuclear receptors, which are ligand inducible transcription

factors that specifically regulate the expression of target genes. They reside in cytosol

associated with heat shock proteins (hsp)(two molecules of hsp90, one hsp70, one hsp56,

and an immunophilin) (Hutchison et al., 1994;Nathan and Lindquist, 1995;Smith and

Toft, 1993) Glucocorticoids can cross plasma membranes freely. After binding with the

ligand, the receptors will dissociate from heat shock proteins and form dimers (either

homodimer of MRMR/ GRGR or heterodimer of MRGR). The ligand-receptor complex

will then translocate into the nucleus where it binds to pallindromic consensus elements

on promoter sequences of target genes to have effects on the gene transcription

(Aronsson et al., 1988;Eriksson and Wrange, 1990). Depending on either the nature of

the DNA consensus sequence or interactions with other transcription factors, the steroid -

receptor complex can act as either positive or negative regulators of gene expression

(Drouin et al., 1989;Pearce and Yamamoto, 1993;Tsai et al., 1988). Numerous studies

showed that they act at the level of DNA to enhance recruitment of the preinitiation

complex of general transcription factors (GTFs) at target promoters. Liganded receptors

recruit members of the SRC (steroid receptor-coactivator) family, a group of structurally






10

and functionally related transcriptional coactivators. Receptors also interact with the

transcriptional cointegrators p300 and CBP, which are proposed to integrate diverse

afferent signals at hormone-regulated promoters (McKenna et al., 1999).

2.1.6.1.2 DNA binding independent mechanism

Apart from DNA binding-dependent mechanisms of GR and MR's function, DNA

binding-independent mechanisms are also used by both GR and MR. The studies of

targeted disruption of the GR DNA binding domain suggested that trancriptional

regulation by GR is achieved via DNA-binding dependent as well as independent

mechanims (Jonat et al., 1990;Schule et al., 1990;Yang-Yen et al., 1990). It is the cross-

talk between GR, MR and other transcription factors, such as activating protein 1(AP-1),

nuclear factor-KB(NF-KB), cAMP-response element binding protein(CREB), GATA-1

and Stat-5 (Caldenhoven et al., 1995;Imai et al., 1993;Stocklin et al., 1996). And we also

know now that not only repression can be exerted by GR/MR via protein-protein

interaction, but also activation can be exerted in this way.

By the studies of receptor with mutation at different region, especially a lot of studies

done with GR, it has been suggested that the HPA axis represents a physiological system

involving different modes of action. On the level of hypothalamus, repression of

corticotropin-releasing factor (CRF) synthesis by the GR is independent of receptor DNA

binding (Reichardt et al., 1998). Since mice with a targeted disruption of the GR gene

showed a dramatic upregulation of CRF in the median eminence (Kretz et al., 1999),

protein-protein interaction is most likely responsible for CRF repression. Possible targets

for such cross-talk are the transcription factors CREB and Nur77; for both, the CRF

promoter contains response elements (Murphy and Conneely, 1997;Seasholtz et al.,









1988). On the level of pituitary, DNA binding is required for repression of the POMC

gene (Reichardt et al., 1998). Obviously, binding of the GR to the negative GRE (nGRE)

in the promoter (Drouin et al., 1993) is a prerequisite for repression of basal POMC gene

transcription. DNA-binding-independent mechanisms are responsible for repression of

secretion (Reichardt et al., 2000)

2.1.6.2 Nongenomic action

While genomic steroid effects are characterized by their delayed onset of action since

time is needed for new protein production, and their sensitivity to blockers of

transcription and protein synthesis, the rapid action of steroids has been less widely

recognized, and characterized in detail. These nongenomic steroid effects are likely to be

transmitted via specific membrane receptors for steroids (Christ and Wehling,

1998;Picard, 1998;Wehling, 1997). Nongenomic steroid actions are mainly characterized

by short delay of onset (within 1-2 minutes). Investigators have used steroid coupled with

macromolecules, such as bovine serum albumin, which prevent the steroid from entering

the cell, to study this action. However, endocytosis resulting in the uptake of active

steroid into the cell might obscure the conclusion. We still do not completely understand

how or if nongenomic actions influence the HPA axis. One thing that should be kept in

mind is that the mechanism of corticosteroid receptor function might be more

complicated than what we have understood so far.

2.1.7 Specificity in Mineraloccorticoid verus Glucocorticoid Action

As described above, MR and GR share considerable structural and functional

homology, especially at their ligand binding domain and DNA binding domain. MR and

GR bind as dimers to common glucocorticoid-response elements (GRE), which comprise

or approximate the nucleotide sequence GCTACAnnnTGTTCT. No specific






12

mineralocrticoid-response element has been identified so far. However, MR and GR can

elicit markedly different physiological effects, even in cells expressing both receptors.

There are several mechanisms may be involved in delivering the specificity. First, it is

determined by the actions of 11 B-HSD (see detail in section of 11 P-HSD). Second,

different tissue may express different types of receptors, either MR or GR which deliver

the specificity by receptor availability. Beyond that, Pearce and Yamamoto also showed

that MR and GR mediate different effects at plfG, a 25-nucleotide "composite response

element" containing both a low-affinity GRE and an AP1 binding site. The API binding

site binds heterodimers of c-Fos and c-Jun (or c-Jun homodimers). An activated (ligand-

bound) GR can block c-Jun-c-Fos-enhanced transcription from the composite response

element, but an activated MR can not (Pearce and Yamamoto, 1993). With the use of

chimeras of MR-GR, a segment of the N-terminal region of GR (amino acids 105-440)

was shown to be required for this repression. Thus, the distinct physiological effects

mediated by MR and GR may be determined by differential interactions ofnonreceptor

factors with specific receptor domains at composite response elements. In tissues where

MR and GR are co-localized, such as lymphocytes, muscle and kidney cells and various

areas of the brain, especially the hippocampus, it has been shown that MR and GR can

form a heterodimer and might be more active than MR or GR homodimers (Trapp et al.,

1994). For homodimers of GRGR and MRMR, their transcription activities are different,

too. Usually, MR exerts a less pronounced sitmulation of transcription rate than the GR

and does not show synergistic activity on two copies of GRE as shown by GR (Rupprecht

et al., 1993a). This difference is thought to be due to the genetic structure difference at

the least conserved amino-terminal region of MR and GR.






13

Some evidence suggests intrinsic receptor properties also contribute to the ability of

this differentiation. Although the MR binds corticosterone and cortisol with a high

affinity, the aldosterone-MR complex is more potent than the cortisol/corticosterone-MR

complex since the half maximal effective dose is approximately 100-fold lower (Lombes

et al., 1994;Rupprecht et al., 1993b). Aldosterone dissociates more slowly from MR than

does cortisol, indicating that the stability of the aldosteorne-MR complex is higher than

that of the cortisol-MR complex (Hellal-Levy et al., 1999;Hellal-Levy et al.,

2000;Lombes et al., 1990) and this slow off-rate of aldosterone from MR is responsible

for its high efficiency in stimulating MR transcriptional activity.

2.1.8 MR/GR Mediated Physiological Function of Glucocorticoids

Glucocrticoids are of major importance for maintaining cellular and humoral

homeostasis. They exert these functions by MR and GR.

In the periphery, one of the well-established functions assigned to glucocorticoids is

the control of carbohydrate and lipid metabolism. For example, the glucocorticoids

induce glucose synthesis by activation of gluconeogenesis, and important genes involved

in this process such as glucose-6-phosphatase, phosphoenolpyruvate

carboxykinase(PEPCK), and tyrosine aminotransferase (TAT) have been shown to be

direct targets of glucocorticoids (Ruppert et al., 1990). In the lung, glucocorticoids are

able to promote maturation during development, and in the adrenal gland, they are

involved in the biosynthesis of catecholamines. Furthermore, glucocorticoids participate

in the suppression of inflammatory reactions, which is achieved by repressing mRNA

expression of cytokines and regulation of lymphocyte migration (Barnes and Adcock,

1993).Additionally, glucocorticoids are able to induce apoptosis ofthymocytes






14

(Chapman et al., 1996), and in the erythroid compartment they are involved in long-term

proliferation of erythroblasts (Wessely et al., 1997).

In the central nervous system, glucocorticoids are involved in the negative feedback

regulation of the HPA-axis, but they also have tremendous effects on behavior, learning,

and memory (McEwen and Sapolsky, 1995;McGaugh et al., 1996;Sapolsky, 1996). Both

receptor species are present during development, implying ability for these transcription

factors to interact with neuronal differentiation, growth, and viability. Cognitive process,

electrophysiological properties of hippocampal neurons, and anxiety clearly involve

glucocorticoid action, and both the GR and the MR may contribute to these effects.

Hipppocampus is a key site for these functions. Brain MR and GR also appear to regulate

neural control of blood pressure (Gomez-Sanchez and Gomez-Sanchez, 1992;Kageyama

and Bravo, 1988;Peysner et al., 1990). Some evidence suggests that brain MR modulate

sympathetic outflow and it is possibly mediated by the brain renin-angiotensin system

(Takahashi et al., 1983;Van den Berg et al., 1994b;Van den Berg et al., 1994a). Currently

available data suggest activation of central MR increases sympathetic outflow and central

GR decreases or does not control sympathetic outflow to the vascular system (Gomez-

Sanchez et al., 1990;van den Berg et al., 1990). For the effects on HPA-axis, it was

proposed that MR mediates the tonic inhibitory control of the hippocampus in HPA

activity, whereas GR mediates the negative feedback of elevated glucocorticoid levels to

restrain HPA drive (de Kloet and Reul, 1987)(see detail in section 2.3 hippocampus and

its connection).

2.1.9 Regulation of Receptors

Corticosteroid receptors levels are regulated at multiple levels including mRNA and

protein (Oakley and Cidlowski, 1993;Schmidt and Meyer, 1994) At the protein level,






15

steroid receptors undergo hormone dependent hyperphosphorylation (Orti et al.,

1992;Weigel, 1996). Recent studies showed that phosphorylation status plays an

important role in receptor's stability and turnover (Webster et al., 1997). It is a major

signal in ubiquitination and proteosome mediated degradation and thus regulates the

number of receptors in cytosol and their ability to transactivate (Wallace and Cidlowski,

2001). Phosphorylation is thought to be the signal to allow substrate recognition by

enzymes in the ubiquitination pathway. Poly-ubiquitination of a protein is recognized by

the multi-subunit protein complex known as the proteasome, which degrades the protein

into small peptides and amino acids. This is at least part of the reasons for ligand

dependent down-regulation of the receptors. Studies examining the half-life of the GR

protein, separate from any ligand affects on RNA, have shown that ligand occupation of

the receptor significantly decreases GR protein half-life from eighteen hours to nine

hours (Dong et al., 1988;Hoeck et al., 1989). Phospho-deficient mutant of mouse GR

does not undergo ligand dependent down-regulation (Webster et al., 1997)

At mRNA level, many studies showed that glucocorticoid treatment significantly

decreased mRNA level of GR and MR in many different tissues (Burstein et al.,

1994;Dong et al., 1988;Okret et al., 1986). Also, adrenalectomy-induced steroid depletion

elicits reliable increases in the GR mRNA from 40-100%, as measured in different labs

by a variety of methods, including Northern, RNAse protection, and in situ hybridization

analyses (Herman et al., 1989a;Herman, 1993;Kalinyak et al., 1987;Patel et al.,

1992;Peiffer et al., 1991;Reul et al., 1989;Sheppard et al., 1990). Adrenalectomy effects

on MR mRNA expression are smaller, falling in the 25-50% range (Herman et al.,

1989a;Herman, 1993;Patel et al., 1992;Reul et al., 1989)






16


2.1.10 11 P-Hydroxysteroid Dehydrogenase (11 P-HSD)

There is an enzyme called 11 3-Hydroxysteroid dehydrogenase (11 0-HSD). It plays

an important role in controlling the local tissue concentration of cortisol. Two distinct

isoforms of 11 P-HSD have been identified, 11 P-HSD type 1 and type 2. (Michael et al.,

1997;Tetsuka et al., 1997). 11 3-HSD type 2 primarily catalyzes the reaction in one

direction, resulting in the conversion of physiological glucocorticoids (cortisol in human

and sheep, corticosterone in rats) to inactive 11-keto products (cortisone, 11-

dehydrocorticosterone) (Seckl, 1993). 11 P-HSD type 1 is bi-directional (Monder and

White, 1993) and has a relatively low affinity (in the uM range) for cortisol and

corticosterone. It appears to proceed in the direction favoring conversion of cortisone to

cortisol or 11-dehydrocorticosterone to corticosterone at physiological glucocorticoid

concentration (Mercer et al., 1993;Michael et al., 1997;Monder and Lakshmi, 1989;Seckl,

1993). As a result, 11 P-HSD type 1 appears to inactivate glucocorticoids only when

circulating concentrations are high (Seckl, 1993). This isoform exists in the liver of most

species and the brain of species including the sheep and human (Seckl, 1993). The

relative expression of the two types of 11 3-HSD in specific organs modifies cortisol

exposure by interconversion between active and inactive glucocorticoids. Cortisone or

11-dehydrocorticosterone do not bind to or activate receptors, and thus controls

corticosteroids access to receptors in a tissue specific manner. 11 3-HSD type 2

colocalizes with MR, protects MR from cortisol and lets MR combine with aldosterone in

the kidney of most species (Funder, 1996), so that in the kidney, most of MRs are

occupied by aldosterone instead of cortisol. Deficiency of 11 P-HSD type 2 in humans

leads to the syndrome of apparent mineralocorticoid excess (SAME), in which cortisol






17

illicitly occupies MR, causing sodium retension, hypokalemia, and hypertension. In rats

this enzyme is also present in the brain (Lakshmi et al., 1991), but in ewes, there is no

detectable 11 P-HSD type 2 activity in brain. In the ovine brain it is thought that

conversion is in the opposite direction, from cortisone to cortisol (Kim et al., 1995) and it

is catalyzed by 11 I-HSD type 1. This results in the possibility that MR is not protected

in the brain and cortisol can have an action via MR in the brains of sheep.

2.2 Corticosteroid and HPA Axis

2.2.1 Introduction

Glucocorticoid secretion of the adrenal cortex is stimulated by pituitary release of

ACTH, which is one of the end products generated from the large precursor molecule,

pro-opiomelanocortin (POMC). ACTH, in turn, is under the control of a number of

hypothalamic releasing and inhibiting factors, of which CRF and vasopressin (VP) are

the best known. Both peptides are colocalized in parvocellular neurons of the

paraventricular nucleus (PVN) which project to the median eminence and release the

peptides in the portal vessel system (Plotsky et al., 1991). The parvocellular PVN neurons

receive information from numerous brain regions, such as nuclei of limbic system, brain

stem nuclei and the suprachiasmatic nuclues. Hypothalamic PVN appears to be the

crucial focus for central regulation of the HPA axis.

Levels of corticosteroids are tightly regulated by the closed feedback loop of HPA axis

(Fig 2-2). It is regulated at a set point by cortisol negative feedback on ACTH and CRF

(Dallman et al., 1987a). Small physiological increases in plasma cortisol suppress ACTH

in a logarithmic manner (Keller-Wood and Dallman, 1984). The pituitary corticotrophs

and the parvocellular PVN are well-established targets for the suppressive action of high






18

amounts of endogenous corticosterone or cortisol and exogenous synthetic

glucocorticoids on stress-induced HPA activity(Dallman et al., 1987a;Keller-Wood and

Dallman, 1984). GR are abundant in these cells and thought to be involved in this

feedback regulation after stress or stimulation. As described above in section of receptor

localization, MR doesn't show a high expression in these areas. It has highest abundance

in hippocampus. Hippocampus is also an important site in cortisol feedback regulation

since the PVN neurons of hypothalamus receive input from hippocampal neurons.

Hippocampal MRs are important in terms of exerting inhibitory tone over the HPA axis

(see detail in section 2.3 hippocampus and its connection).

There appear to be three major time frames of corticosteroid action: fast (seconds to

minutes), intermediate (hours) and slow (hours to days). These time frames probably are

the consequence of three separate mechanisms of corticosteroid action at feedback-

sensitive sites. MR and GR mediate intermediate and slow feedback inhibition of the axis

in the hippocampus (Jacobson and Sapolsky, 1991), hypothalamus, pituitary, and perhaps

even the adrenal itself (Keller-Wood and Dallman, 1984). The receptors involved in fast

feedback inhibition are unknown.

2.2.2 Fast Feedback

The time of occurrence of fast feedback is not compatible with a nuclear site of

corticosteroid action, and protein synthesis is not required. Dallman and Yates also

postulated that this fast feedback is rate sensitive (Dallman and Yates, 1969).

Glucocorticoid feedback inhibition has been demonstrated to have rapid effects on both

stimulated CRF secretion (Vermes et al., 1977) and stimulated ACTH secretion

(Buckingham and Hodges, 1977;Vale and River, 1977). Although the mechanism of fast

inhibition is unknown, the rapidity of the effect suggests that the effect is on hormone






19


release and not hormone synthesis, and that protein synthesis is not involved. Some

studies suggest that fast feedback acts to stabilize the cell membrane and that fast

feedback involves Ca++ fluxes.

2.2.3 Intermediate and Slow Feedback

Intermediate and slow feedback inhibition requires genomic events and protein

synthesis (Keller-Wood and Dallman, 1984). While intermediate feedback inhibits the

release of ACTH and the synthesis and release of CRF, slow feedback inhibits both the

synthesis and release of CRF and ACTH (Keller-Wood and Dallman, 1984).

Intermediate (and fast) feedback would be expected to occur under physiological

conditions when increases in plasma corticosteroids are produced in response to moderate

or punctuate stress. While slow feedback would only occur under pathological conditions

or under pharmacological treatment of corticosteroids when increased corticosteroid can

be kept for at least several days. Under normal conditions, therefore, decrease in POMC

mRNA synthesis or pituitary ACTH content would not be expected to occur following

moderate stress.(Keller-Wood and Dallman, 1984).

These three feedbacks have their specific roles in regulation of the HPA axis

respectively. Fast, rate sensitive feedback controls the rate and magnitude of ACTH in

response to a stress or stimulation. Delayed or intermediate feedback may limit the

response of the system to repeated stimulus within a relatively short period of time

(hours), while slow feedback limit the response to repeated stimulus during prolonged

period of time (days).(Keller-Wood and Dallman, 1984)






20


2.3 Hippocampus and Its Connection

2.3.1 Role of Hippocampus in HPA Regulation

The importance of maintaining glucocorticoid secretion with tolerable limits requires

an efficient mechanism. This process appears to be accomplished by multiple pathways.

As described above, PVN is an important negative feedback site in HPA axis. However,

feedback at the PVN or pituitary can not account for all aspects of HPA inhibition. A lot

of evidence supports the existence of neuronal inhibitory pathways working in parallel

with steroid feedback. Furthermore, total or anterior deafferentations of the PVN increase

the expression of mRNA of CRF and AVP (Herman et al., 1990), indicating that the one

or more neuronal inhibitory pathways are also required for maintenance of basal HPA

tone.

Neuronal mediated inhibition of the HPA axis might emanate from several sources.

Perhaps the most intensely studied of these has been the hippocampus. The hippocampus

has been implicated in the neuronal regulation of the HPA axis activity by several

different research groups (Feldman and Conforti, 1980;Herman et al., 1989b;Jacobson

and Sapolsky, 1991;Magarinos et al., 1987;Sapolsky et al., 1984). Implication of the

hippocampus as a suprahypothalamic site mediating glucocorticoid feedback inhibition of

the HPA axis was suggested by the demonstration that the hippocampus exhibits the

highest brain levels of glucocorticoid binding and high-affinity receptors of

glucocorticoid (Herman, 1993;Jacobson and Sapolsky, 1991). Both lesion and electrical

stimulation studies suggest an overall inhibitory influence of the hippocampus on HPA

activity (Jacobson and Sapolsky, 1991). Dorsal hippocampectomy or transection of the

fornix elevates the basal HPA activity at the circadian trough in particular, and CRF

mRNA and VP mRNA expression in the morning.(Herman et al., 1989b). Conversely,






21

stimulation of the hippocampal formation results in decreased HPA activity in both rat

and human (Jacobson and Sapolsky, 1991). The effect of hippocampal manipulation on

the HPA axis is "state dependent," varying both during the day and with or without

stress, suggesting a modulatory role for corticosteroids (Canny et al., 1989;De Kloet et

al., 1991 ;Jacobson and Sapolsky, 1991). Hippocampal MRs, which have higher affinity

with corticosteroid compared to GR, are important in terms of control of inhibitory tone

over the HPA axis. This effect of corticosteroid via MRs is modulated by GRs that

become progressively occupied after stress, which also negatively feed back on the PVN

(Fig.2-3).

2.3.2 Hippocampus and Its Connection

It is generally accepted that hippocampal formation plays a key role in animals'

reactivity to novelty and provides an essential contribution to learning and memory

(Gray, 1987).

Anatomically, the hippocampus has two major outputs: multisynaptic pathways to the

cerebral cortex and a massive descending projection directly to the lateral septum of the

basal ganglia. It has been shown that the descending output is organized in such a way

that different hippocampal regions map in an orderly way onto hypothalamic systems

mediating the expression of different classes of goal-oriented behavior (Risold and

Swanson, 1996). This mapping is characterized by a unidirectional hippocampo-lateral

septal projection and then by bidirectional lateral septo-hypothalamic projections, all

topographically organized. The bed nucleus of the stria terminalis (BST) may convey

excitation of the HPA axis. This limbic forebrain structure links regions such as the

amygdala and hippocampus with hypothalamic and brainstem regions controlling vital






22

homeostatic functions, such as the PVN (Cullinan et al., 1993;Moga et al., 1989;Weller

and Smith, 1982).

In summary, hippocampus plays an important role in regulation of HPA axis. Under

basal conditions, MRs mediate tonic inhibitory effects of in HPA activity, whereas under

condition of elevated cortisol level, the GR mediates the negative feedback to restrain

HPA drive (de Kloet and Reul, 1987). Hippocampus has its input to PVN of

hypothalamus via GABA containing neurons. It has its inhibitory effects by stimulating

GABAnergic neurons.

2.4 Physiological Adaptation During Pregnancy

Pregnancy involves profound changes in the hormones and tissues of the reproductive

axis and tract. However, pregnancy also induces changes in cardiovascular function and

in hormones involved in regulating pressure, volume and blood flow, including the renin-

angiotensin system, vasopressin and the HPA axis.

2.4.1 Changes in Cardiovascular Function in Pregnancy

During pregnancy blood volume is increased by 20-50% and cardiac output is

increased proportionately. Mean arterial pressure is decreased, reflecting decreased

peripheral resistance (Christianson, 1976;Metcalfe and Parer, 1966). This is accompanied

by a decrease in vascular responses to pressor agents (Longo, 1983). There is evidence in

a number of species that baroreflex control of blood pressure is altered in the pregnant

state (Brooks and Keil, 1994;Crandall and Heesch, 1990;Heesch and Rogers,

1995;Humphreys and Joels, 1977;Ismay et al., 1979); the baroreceptors regulate pressure

about the lower set-point with reduced sensitivity. Hormone responses to hypotension

and to hemorrhage are altered by pregnancy (Brooks and Keil, 1994); there is a decreased

response to hypotension, but the response to volume loss occurs with a smaller percent






23

loss in pregnant subjects. These results are consistent with a reset of regulated blood

volume to a higher level and reset of blood pressure to a lower level in the pregnant state.

The alterations in regulated blood pressure, volume, and baroreflex regulation in the

pregnant state likely represents a combination of effects of many hormones (Longo,

1983). The estrogen, progesterone and cortisol's effects on the renin-angiotensin system,

nitric oxide, uteroplacental circulation may all contribute to these changes.

2.4.2 Changes in Regulation of Cortisol and ACTH During Pregnancy

2.4.2.1 Basal activity

During pregnancy, both plasma maternal ACTH and cortisol increased in sheep as

well as in human (Bell et al., 1991;Carr et al., 1981). The plasma cortisol level is almost

doubled compared with nonpregnant sheep. Both total and free cortisol concentrations are

also increased. Previous studies in Dr. Keller-Wood's lab showed that in sheep the set

point for the feedback regulation of basal plasma cortisol is increased during pregnancy

(Keller-Wood, 1998). The mechanism of the normal pregnancy induced increase in set

point for cortisol remains unknown. Although elevated concentrations of plasma

corticosteroid binding globulin (CBG) may contribute to the elevation in plasma cortisol

in women, CBG concentration does not increase in the pregnant ewe and the

concentration of the free plasma cortisol is increased in both species during pregnancy

(Keller-Wood, 1996). Extrapituitary secretion of ACTH or corticotropin-releasing

hormone (CRF) has been proposed by a number of investigators as a stimulus to

adrenocortical secretion in pregnancy (Campbell et al., 1987;Rees et al., 1975), however,

in humans the CRF in plasma during pregnancy is bound to a protein (Orth and Mount,

1987;Suda et al., 1988)so that only a small proportion is biologically active. In sheep, Dr.

Keller-Wood' lab found that there was no net secretion of ACTH or CRF from the






24

placenta under basal conditions or during hypoxia induced by maternal inhalation of a

hypoxic gas mixture. Therefore, neither extra pituitary secretion of ACTH nor extra

hypothalamic secretion of CRF seem to adequately explain the change in ACTH or free

cortisol in pregnancy (Allolio et al., 1990;Keller-Wood and Wood, 1991a;Keller-Wood

and Wood, 1991b), or the change in relationship between cortisol and ACTH.

2.4.2.2 Feedback sensitivity

During pregnancy the feedback regulation of HPA axis has been attenuated. Evidence

also suggests the ability of dexamethasone to reduce free cortisol concentrations be

attenuated in the pregnant women (Nolten and Rueckert, 1981;Odagiri et al., 1988).

However, pregnancy does not reduce the absolute suppression of ACTH by a two-hour

infusion of cortisol in the sheep (Keller-Wood, 1996). Decreasing cortisol to levels less

than normal for pregnancy (but similar to those of nonpregnant subjects ) can

dramatically increase plasma ACTH. Increase in cortisol, to levels similar to those during

stress, decreases ACTH concentration in pregnant animals to the same extent as in

nonpregnant animals(Keller-Wood and Wood, 2001). These results suggested that during

pregnancy, the regulation of ACTH by cortisol at basal levels, but not the effects of

elevated or stimulus-induced increases in cortisol, is altered. The HPA axis feedback still

exists, but it has been set at a higher level. Since MR is the high affinity receptor that is

activated by basal concentration of cortisol, the inability of low concentrations of cortisol

to decrease ACTH suggests that the MR-mediated mechanism, rather than the GR-

mediated mechanism, may be altered during pregnancy.






25


2.4.3 Role of Ovarian/Placental Steroid

2.4.3.1 Estrogen

Estrogens appear to cause generalized increases in basal ACTH and ACTH responses

to stimuli. For examples, female rats tend to have higher circulating levels of both ACTH

and corticosterone than male rats and in cycling female rats, the HPA axis is significantly

more responsive during proestrus (when estradiol levels are highest) than during estrous

or diestrous (Viau and Meaney, 1991). Estrogens increase activity of the axis by

increasing hypothalamic CRF expression (Hiroshige and Wada-Okada, 1973), adrenal

responsiveness to ACTH (Kitay, 1975), and attenuating the glucocorticoid feedback

signal (Burgess and Handa, 1992;Redei et al., 1994). Although estrogens have been

shown to decrease corticosterone binding capacity at MR in the hippocampus and

estrogen treatment can cause a decrease in the mRNA for MR in the CA2 region of the

hippocampus (Carey et al., 1995), the progesterone appeared to attenuate the effects of

estrogen on both MR binding capacity and mRNA (Carey et al., 1995), suggesting that in

the pregnant state these effects of estrogen may not be expressed. In summary, the

activating effects of estrogens may play a role in the adaptation of the axis to pregnancy,

but since absolute feedback sensitivity is not reduced during ovine pregnancy, the effects

of estrogens on feedback do not appear to be physiologically relevant to pregnancy.

Further, ACTH and cortisol levels in pregnancy also do not appear to temporally follow

the pattern of increase in estrogens, particularly in sheep in whom an increase in cortisol

occurs before 90 days, but the increase in estrogens (primarily estrone) is small within the

last 1-2 weeks of pregnancy.






26

2.4.3.2 Progesterone

Progesterone's effects on HPA axis is the theme of this whole dissertation. Evidence

suggests that progesterone could antagonize feedback regulation of the HPA axis and has

been thought to act as an anti-corticosteroid. Progesterone administration reduces the

hypertensive effect of aldosterone (Landau and Lugibihl, 1958). In relatively high doses,

progesterone also appears to antagonize corticoid inhibition of CRF and ACTH secretion

(Abou-Samra et al., 1984;Duncan and Duncan, 1979;Jones and Hillhouse, 1976). In the

absence of cortisol, progesterone appears to have partial agonist activity to inhibit CRF

and ACTH (Buckingham, 1982;Vale et al., 1978). In Dr. Keller-Wood's lab, data have

shown that acute treatment with progesterone reduced the inhibition of ACTH produced

by infusion of cortisol (Keller-Wood et al., 1988). This effect was found with an infusion

of progesterone that increased plasma progesterone to concentrations within the

physiological range.

It has been shown that progesterone can antagonize MR-mediated effects in vivo

(Spence et al., 1989;Wambach and Higgins, 1979) and in vitro (Jones et al.,

1977;Rupprecht et al., 1993b). Progesterone has very high affinity for the human MR,

but progesterone exerts very low transcriptional activity after binding MR (Rupprecht et

al., 1993b). Progesterone also binds to human GR with an affinity similar to that of

cortisol, and exerts moderate activity after binding, suggesting that progesterone can act

as partial agonist at human GR. Progesterone has an approximately equal affinity

compared to cortisol at the ovine MR and lower affinity for ovine GR. Studies in rats

have suggested that progesterone treatment in vivo alters corticosterone binding at MR

(Carey et al., 1995). We therefore hypothesized that during pregnancy or during chronic

progesterone treatment, progesterone will act as an antagonist to cortisol binding at MR,






27

reducing MR availability and increasing the apparent Kd of MR for cortisol. The first

region we studied is hippocampus in this dissertation. As described above, hippocampus

is one of the most important sites which regulates the tonic activity of HPA axis.

Hypothalamus, pituitary, brainstem and kidney are also important and will be studied in

the future.

2.4.4 Significance of Elevated Cortisol in Pregnancy

The elevated cortisol is necessary and critical for normal pregnancy. In experiments in

pregnant ewes in Dr. Keller-Wood's lab, we have found that there was an increased

incidence of fetal loss and abortion when ewes were adrenalectomized and replaced with

cortisol to levels less than normal for pregnant ewes (i.e. normal for nonpregnant ewes).

We are currently studying the role of reduced maternal cortisol on fetal volume

homeostasis and growth.

In human, cases of hyper- or hypocorticism in pregnant women are relatively rare

because these conditions are also associated with infertility. However, it has been

observed that woman with untreated hyper- or hypocorticism during pregnancy appears

to have increased incidence of fetal death or abortionn (Aron et al., 1990;O'Shaughnessy

and Hackett, 1984;Osler, 1962;Pickard et al., 1990). When Addison's disease presents

during pregnancy there appears to be a decrease in birth weight relative to gestational age

(O'Shaughnessy and Hackett, 1984;Osler, 1962), and an increased risk of maternal death,

particularly in late gestation, during labor or in the immediate peripartum period (Drucker

et al., 1984;Seaward et al., 1989).

2.5 Corticosteroids Effects on Serotonin Receptors

Serotonin (5-hydroxytryptamine, 5-HT) neurotransmitter system and the HPA axis

have a reciprocal regulatory function in the feedback management of an organism's






28

response to stress. Serotonergic cell bodies are located in the raphe and project to many

brain areas, including the hippocampus, hypothalamus and cortex. 5-HT receptors are G-

protein coupled receptors. Seven distinct families of 5-HT receptors (5-HT 1-5-HT7) have

been identified so far. Subpopulations have been described for several of these. At least

15 subpopulations have been cloned. The 5-HT1A receptor is a somatodendritic

autoreceptor in raphe neurons that mediates a reduction in firing rate. The 5-HT1A

receptor is also found postsynaptically in brain nuclei receiving 5-HT axon projections. It

is strongly expressed in the hippocampus, septum, and other limbic areas (Albert et al.,

1990;Pompeiano et al., 1992) and functions as a key regulator of the limbic system. It has

been shown that 5-HT1A receptor is suppressed by corticosteroids.(Neumaier et al.,

2000;Nishi and Azmitia, 1996;Wissink et al., 2000). Electrophysiological studies have

demonstrated suppression of 5-HT induced hyperpolariation with CAl pyramidal cells

after brief application of steroids which act at MR and GR (Joels and de Kloet, 1994).

Furthermore, corticosteroids removal by bilateral adrenalectomy (ADX) results in an

increase in brain hippocampal 5-HT1A receptor mRNA expression (Chalmers et al.,

1993;Chalmers and Watson, 1991;Meijer and de Kloet, 1994). Using MR- and GR-

selective ligands (in rat) and gene knockout approaches (in mouse) (Meijer et al.,

1997;Meijer and de Kloet, 1995;Nishi and Azmitia, 1996), MR (primarily) and GR have

been implicated in negative regulation of 5-HT1A gene expression, but the precise

mechanism remains unclear. Dysregulation of the serotonergic system and abnormalities

of the HPA axis function have been implicated to be involved in neuropsychiatric

disorders, such as major depression, anxiety, and related disorders. For example, gene






29

knockout of the 5-HT1A receptor gene results in mice with increase anxiety-related

behaviors (Heisler et al., 1998;Parks et al., 1998;Ramboz et al., 1998).

In this project, we use 5-HT1A receptor as an indicator for MR or GR mediated

effects in hippocampus. Since we proposed that progesterone acts as an antagonist of

cortisol at MR to reduce the action of cortisol in brain, we expected to see that the

suppression effects of cortisol at 5-HT 1A receptor would be reduced.

2.6 Animal Models

Sheep are widely used in endocrine physiological studies, in particular in the study of

reproductive and adrenal gland control mechanisms. Sheep also offer a good model for

maternal physiology during pregnancy. In sheep, as in humans, the maternal adrenal

cortex is more active in secretion of cortisol during pregnancy than during the

nonpregnant state. During ovine and human pregnancy, maternal plasma cortisol

concentration approximately doubles (Bell et al., 1991;Nolten and Rueckert, 1981). On

the other hand, the fetal adrenal cortex is inactive as a source of corticosteroids until late

gestation. It has been calculated, in ovine and primate models, that transfer of cortisol

from the mother to the fetus, therefore, accounts for most (90 to 95%) plasma cortisol

measured in the fetus before the time of fetal adrenal gland maturation (approximately

0.8 of gestation (Hennessy et al., 1982;Pepe and Albrecht, 1984), approximately day 125

in sheep). In fact, fetal adrenalectomy before that time does not appreciably reduce

cortisol concentration in the fetal circulation (Ray et al., 1988). Study of the role of high

maternal cortisol concentration as a mediator of maternal and fetal cardiovascular and

fluid homeostasis is therefore of interest. Also, there are several aspects of the HPA in

sheep are similar to human physiology, for example, secretion of cortisol as the major

"glucocorticoid" hormone by the adrenal, and the inability to survive after adrenalectomy






30

without corticosteroid replacement. Further, the average gestation period for sheep is

about 150 days, which is much longer than rats or mice and long enough to allow chronic

adaptation of pregnancy to occur.

2.7 Significance

Inadequate control of glucocorticoid responses may lead to a severe threat to the

health and well-being of the organism. Hypersecretion of glucocorticoids can promote the

development of physiologic and psychological dysfunction. For example, inappropriate

regulation of stress has been implicated in the pathogenesis of systemic disease (such as

colitis, asthma, hypertension)(McEwen and Stellar, 1993), affective disorders (such as

depression, post-traumatic stress disorder)(Charey et al., 1993;Kathol et al., 1989)and

neurodegenerative disease (such as Alzheimer's disease).(Landfield and Eldridge, 1991).

Also, the increase of levels of cortisol and ACTH is very important for normal maternal

and fetal homeostasis. Hyper- or hypocorticism during pregnancy may result in an

increased incidence of fetal death or abortion (Aron et al., 1990;O'Shaughnessy and

Hackett, 1984;Pickard et al., 1990). Risk of maternal death also increases significantly

according to clinic case reports and animal experiments (Drucker et al., 1984;Seaward et

al., 1989). The adrenocortical system is very critical for the maintenance of

cardiovascular homeostasis (Loriaux, 1990;Mantero and Boscaro, 1992). Increases or

decreases in adrenocortical activity may lead animals or human beings to suffer from

disturbance of the cardiovascular system. In the clinic, these disturbances are shown in

Cushing's and Addison's diseases. In Cushing's disease, which is a hypercortisolism

state, patients have symptoms of hypertension, and the blood volume increases which

leads to edema. In Addison's disease, patients have symptoms of hypotension, caused by

decreased glucocorticoid effects on vascular reactivity which can be reversed by cortisol






31

replacement, and a decreased cardiac output caused by decreased blood volume.

Understanding the action of progesterone and cortisol is critical for understanding many

common symptoms during pregnancy, such as edema (fluid retention) and reduced

glucose tolerance which are the signs ofhypercorticism with glucocorticoid action, but

absent signs with mineralocorticoid action. While another interesting but not very

common pathophysiological symptom during pregnancy in some women is increased

blood pressure. Severe increases in blood pressure may lead to eclampsia which may be

very dangerous for maternal and fetal life. In some severe situations, pregnancy will have

to be stopped. After delivery, the increased blood pressure may decrease to normal level

spontaneously. The mechanism of eclampsia remains unknown until now, but changes in

HPA axis with interaction of placental steroid may play a role on it. It is important that

we understand the interaction between progesterone and cortisol during pregnancy in

order to understand the change in regulation of ACTH and the role of elevated

corticosteroids in the creation of a new homeostasis during pregnancy.

2.8 Objectives

In summary of this literature review, concentrations of cortisol, aldosterone, and

ACTH increase during pregnancy. Specifically, the increases in cortisol and aldosterone

secretion during pregnancy are important for the normal pregnancy adaptation.

Importantly, cortisol expands the blood volume during pregnancy because of both

glucocorticoid and mineralocorticoid effects at the kidney and in the vasculature. Both

cortisol and aldosterone also act in specific hypothalamic and brainstem nuclei to affect

both cardiovascular and endocrine function. The physiological changes in cardiovascular

function are critical for providing the maternal environment necessary for proper fetal

development. Cortisol is normally under negative feedback control. This negative






32

feedback mechanism is altered in pregnancy, allowing chronic increases in cortisol

secretion rate. I have hypothesized that the placental steroid progesterone acts to cause

the changes in regulation of the hypothalamus-pituitary-adrenal axis which result in the

increased plasma cortisol levels and contributes to the changes in cardiovascular

homeostasis in pregnancy. Cortisol and aldosterone exert glucocorticoid and

mineralocorticoid effects via action at MR and GR. Cortisol and other steroids, such as

progesterone, bind to both GR and MR. There is in vitro evidence that progesterone acts

as mineralocorticoid receptor antagonist, and I hypothesize that this results in decreased

MR mediated action, although the plasma concentration of cortisol and aldosterone

increases. It allows the effect of decreased blood pressure in the presence of increased

aldosterone and cortisol and causes a reduced negative feedback on basal ACTH (which,

in turn, allows chronic increases in plasma cortisol concentration). I will investigate the

action of these steroids using a molecular biology approach to the study of the steroid

receptors. Specifically I will test the following hypotheses:

1. Progesterone acts as an antagonist of cortisol at MR and/or reduces MR number in

the pregnant state to reduce the action of cortisol in brain.

2. Progesterone doesn't interfere with cortisol effect at GR, but as an agonist results in

the combined effect of progesterone and cortisol at GR.






33













A/B C D E
1 602 670 734 984



15% 4% 6% 57 %


hGR
1 420 488528 777














Fig. 2-1: Schematic representation of the structures of the human MR (hMR) and
GR (hGR) with the percentage of amino acid identity appearing between each of
the domains (A-E); the figure has been adapted from Arriza et al., 1987.







34












amygdala
hippocampus





CRF





PRL

POMC


ACTH-
release

adrenal cortex






glucocorticoids





nemarrw)

inmune system)

(adrenal medulla)



Fig. 2-2: Control ofglucocorticoid secretion by HPA axis. The figure has been
adapted from Reichardt et al., 2000.






35











() Hypothalamus


Hippocampus CRH/AVP


< > Pituitary

Basal Tone / P t
ACTH




Cortisol/Corticosterone Adrenal gland









Fig. 2-3: Hippocampal regulations of HPA axis














CHAPTER 3
GENERAL MATERIALS AND METHODS

3.1 Animal Care

The ewes were housed and studied in the Health Science Center Animal Resources

Department. They were maintained in a controlled environment (12-hour light/dark cycle

and a constant 19C-210C temperature).

3.2 General Surgical Procedure

The ewes used in the experiments were surgically prepared according to the following

protocols. Before surgery, food was withheld from the ewe for 24 hours. Before and

during surgery, the ewe is anesthetized with halothane (0.5 2.0%) in oxygen. All

surgery were performed in the surgery suite of the Health Center Animal Resources

Department. All ewes were treated with ampicillin (750 mg im) for 5 days post-

operatively and on each experimental day. All animals were allowed at least 5 days to

recover from surgery before study.

3.2.1 Adrenalectomy and Ovariectomy

Adrenalectomy, ovariectomy or sham adrenalectomy were performed according to

previously published protocols (Bell et al., 1991;Keller-Wood et al., 1998;Pecins-

Thompson and Keller-Wood, 1994). Briefly, adrenal glands or ovaries were isolated

through a midline abdominal incision, the vascular supply was ligated, and adrenal glands

or ovaries were removed.






36






37

3.2.2 Vascular Catheterization

All ewes had polyvinylchloride catheters (0.090" OD, 0.050" ID) implanted into the

femoral artery and vein at the femoral triangle for steroid delivery and blood sampling.

This method has been previously described in detail (Bell et al., 1991). Briefly, an

incision was made in the femoral triangle, and the artery and vein were exposed. Each

vessel was ligated distally, and a 0.05mm catheter was advanced approximately 10 inches

into the descending aorta or inferior vena cava. Each catheter was secure with surgical

ties, filled with heparinized saline, plugged with a sterile nail, and routed subcutaneously

with a trocar to exit the flank. When not in use, the exteriorized catheters were stored in a

paper pocket and protected by a spandage wrap.

3.3 Chronic Steroid Implantation

In adrenalectomized ewes, cortisol was replaced to the normal nonpregnant level (2-5

ng/ml) by implanting pellets of cortisol hemisuccinate (estimated release of 0.5 mg/kg/d;

Inovative Research, Sarasota, FL). Aldosterone was replaced by infusion of

approximately 3ig/kg/d. Ewes were treated with progesterone by placement of

subcutaneous implants for 60 days prior to adrenalectomy. Ewes were treated with

25mg/d for 30 days, followed by treatment with 67mg/d for the next 30 days, and

117mg/d from the time of adrenalectomy through the time of sacrifice.

3.4 Tissue Collection

The ewes were killed with an intravenous overdose ofpentobarbital under basal

conditions ( at least 3 days after the last experiment). As rapidly as possible, their carotid

arteries were cannulated, jugular veins were cut, and their brains were perfused with

approximately 3L ice-cold isotonic saline containing 10% (v/v) dimethyl sulfoxide






38

(DMSO, Sigma, St. Louis, MO). This served to protect the receptors during freezing and

to remove any blood-borne corticosteroid-binding globulin (CBG) (MacLusky et al.,

1986). The brains were quickly removed, and specific brain areas were disseccted and

frozen in liquid nitrogen. Then they were stored at -800C until assay. All studies were

approved by the Institutional Animal Care and Use Committee of the University of

Florida and were in compliance with NIH guidelines for the use of animals in research.

3.5 Collecting Blood Samples and Measurement

3.5.1 Sampling and Storage

At the time of sacrifice (immediately prior to the injection of pentobarbital), a blood

sample was taken for measurements of plasma cortisol, aldosterone and progesterone.

Blood samples were collected in tubes containing sodium EDTA (0.015 M, for analysis

of hormones). The whole blood samples were placed on ice until the end of the

experiment. Samples were then centrifuged, and plasma aliquots were stored at -200C

until analysis.

3.5.2 Hormones: Cortisol, Aldosterone and Progesterone

Plasma cortisol was measured by radioimmunoassay with an antibody raised in our

laboratory (Wood et al., 1993). The lower limit of detection in the assay is 0.4 ng/ml

using an 0.05ml aliquot of plasma. Plasma progesterone and aldosterone were measured

by radioimmunoassay using kits obtained from Diagnostic Products Corp. (Los Angeles,

CA). The lower limit of detection of the progesterone assay is 100 pg/ml using a 0.1 ml

aliquot of plasma. The antibody used does not bind the adrenal steroids. The lower limit

of detection of the aldosterone assay is 12.5 pg/ml using 400ul plasma.






39

3.5.3 Free Cortisol and Progesterone

Free cortisol and progesterone were estimated using a modification of the equilibrium

dialysis method of Hammond (Hammond et al., 1980). Aliquots of plasma were

incubated at 390C with 3H-cortisol or 3H-progesterone and 14C-glucose for one hour, and

bound and free steroid were separated by centrifugation at 800 g for 2 minutes at 390C

using 30,000 MW exclusion filters (Centrifree; Millipore Corp, Bedford, MA); although

the separation method was modified, the requirement for equilibrium was maintained by

adjusting separation conditions so that only a small quantity of the total volume was

filtered (approximately 35 [l out of 400 pl ). The relative ratio of 3HW4C in filtrate (lower

chamber) as compared to the non-filtered sample (upper chamber of filtration device) is

an estimate of the percent free steroid in the sample.

3.6 Receptor Binding Assays

Receptor binding assays were performed with 3H-cortisol, using a modification of the

method used by Reul et al for determination of binding in brain (Reul and DeKloet,

1985).

3.6.1 General Methodology

3.6.1.1 Tissue preparation

Cytosol was prepared from hippocampus according to previously published protocols

(Roesch and Keller-Wood, 1999).Briefly, hippocampus was homogenized using a motor-

driven Teflon pestle and glass tube (Wheaton Science Products) in a reducing

homogenization buffer (RHB) which contained 10 mM Tris-HCL, pH 7.4, 10 mM

sodium molybdate, 2mM ethylenediaminetetraacetic acid, 10% (v/v) glycerol, 4 mM

dithiothreitol and 4mM 3-mercaptoethanol. The components of this buffer have been






40

shown to stabilze corticosteroid receptor (Hubbard and Kalimi, 1982). The homogenate

was centrifuged at 35,000x g for 75 minutes at 40C to obtain a cytosolic fraction

(supernatant). Aliquots of cytosol were stored at -800C until assayed. Protein content of

the cytosol was measured with a Bradford assay kit (Biorad, Hercules, CA) using bovine

serum albumin as the standard. The binding experiments were carried out essentially as

previously described (Reul et al., 1990), as modified in our laboratory (Roesch and

Keller-Wood, 1999)

3.6.1.2 Incubation

Cortisol is the major adrenal steroid of sheep (and humans) and binds to MR, GR and

CBG. GR receptor binding was measured as the difference between binding in the

absence and presence of 1.25 pM RU 28362, a specific GR agonist (Roussel-Uclaf,

Romainville, France). MR was measured as the difference between binding in the

presence of 1.25 gpM RU 28362 and 12.5 pM dexamethasone, which binds to both MR

and GR, but not CBG. The MR and GR are calculated in this indirect way because of

the lack of a high affinity, MR-specific ligands. CBG binding was defined as the

difference between binding in the presence of 12.5 pgM dexamethasone and 12.5 pM

cortisol. In this case the cortisol is in excess so the only remaining binding should be

nonspecific. The table below showed the detailed binding status in each tube and how to

calculate the binding data for MR, GR and CBG. This calculation method was originally

generated by Reul and De Kloet (Reul and DeKloet, 1985).






41


Expected binding by H-cortisol

Tube contents GR MR CBG NSB

3H-cortisol X X X X


3H-cortisol + X X X

50x RU 28362

SH-cortisol + X X

500x

dexamethasone

H-cortisol + X

500x cortisol



Note: NSB= non specific binding
X in the cell stands for the binding by 3H-cortisol at the specific site
Calculation Equations:

Specific GR binding = total binding ( of 3H-cortisol )-binding in the
presence of excess RU28362

Specific MR binding = binding in the presence of excess RU28362-
binding in the presence of excess of dexamethasone

Specific CBG binding = binding in the presence of excess dexamethasone-
binding in the presence of excess cortisol

Steroid ligands were made fresh from stock ethanol solutions, dried in glass tubes in

Jouan evaporating centrifuge (Jouan Inc, Winchester, VA) and then resuspended in

binding buffer (RHB). The solvent of the 3H-cortisol (Amersham, Arlington Heights, IL)

was evaporated under a gentle air stream and diluted in binding buffer before addition to

the tubes. All components of the binding reaction were mixed in the glass tubes with






42


addition of 200-250 pg cytosol being the last step. Final volume was 200 ul in each tube.

Binding was allowed to proceed for overnight at 40C.

3.6.1.3 Separation of bound from free

Receptor-bound and free ligand were separated on LH-20 Sephadex columns at 40C as

previously described (Roesch and Keller-Wood, 1999). Chromatography columns were

prepared by plugging 5ml PYREXT serological pipettes (Coring, Inc.) with 3 mm

diameter borosilicate beads (Kimble Glass Company). The columns were filled to a

height of 8 cm with Sephadex LH-20 (Pharmacia Biotech, Uppsala, Sweden)

reconstituted in RHB. For separation of bound from free, 200 ul of the incubate was

loaded to the top of the column bed, washed into the column bed with 100 ul buffer.

Receptor-bound radioactivity eluted in 1 ml of binding buffer was counted in a liquid

scintillation counter (Beckman LS 3801, Beckman Inc., Fullerton, CA) with 4.5 ml

scintillant (Scintisafe 30 Fisher). Counts were expressed as femtomoles of 3H-cortisol

specifically bound per milligram protein. After each use, the columns were washed with

15 volumes of methanol and 15 volumes of RHB. During the buffer RHB re-equilibration

portion of the wash, the bead bed was agitated and allowed to resettle. Columns were

maintained at 40C.

3.6.2 Saturation Binding Analysis

These experiments were performed to determine the binding affinity (Kd) of MR in

the hippocampus of sheep during pregnancy and with various levels of progesterone.

Bmax values were also determined to confirm the Bmax value, or total available binding,

determined using a single, saturation dose of cortisol (see below).






43

Saturation binding curves were generated for three ewes in each treatment group

(n=15 ewes total). In these experiments cytosol from each hippocampus was incubated

with increasing concentrations of 3H-cortisol from 0.05 nM to 35 nM. Four tubes were

assayed at each concentration. Two contained 50-fold RU 28362 (2.5 nM to 1.75 giM)

and two 500-fold dexamethasone (25 nM to 17.5 gM). The difference between the mean

binding in these two sets of tubes at each 3H-cortisol concentration was specific binding

at MR.

Saturation binding isotherms were calculated by non-linear regression analysis of the

binding data (Graphpad Prism, Graphpad Software, Inc, San Diego, CA). The binding

affinity (Kd) and maximal binding capacity (Bmax) were determined from this curve. The

equation of the curve was Y = BmaxX / Kd + X; where Bmax is the maximal binding and Kd

is the concentration of ligand required to reach half-maximal binding.

3.6.3 Total Receptor Availability

Total available receptors measurements are indicative of the degree of activation of

GR and MR. They reflect the number of receptors that had not been activated in vivo by

steroid, so are inversely proportional to the number of activated receptors. This is because

the assay conditions used prevent the recycling of MR or GR from the conformation

following receptor activation to the receptor conformation required for ligand binding.

Total available receptor were measured in all 25 of the ewes studied (n=5 per group)

using a single saturating concentration of 3H-cortisol (25 nM) as previously described.

MR, GR, CBG and NSB were determined in triplicate tubes (12 tubes per hippocampus)

and the mean of the triplicates used for analysis. CBG binding was always less than 10






44

fmol/mg protein and was not significantly altered by any of the treatments, hence it is not

reported here.

3.7 Western Blot Analysis

An aliquot of the cytosolic preparations from hippocampus of individual ewes was

analyzed by Western blot for the total amount of GR and MR proteins present in the

preparation. This allowed differentiation of changes in the level of 3H-cortisol binding

due to increases in receptor protein from increases in the level of available receptor.

3.7.1 Tissue Preparation

Tissues were prepared in the same way as in receptor binding assay. Prior to gel

electrophoresis, samples were diluted in Laemmli (Laemmli, 1970) reducing loading

buffer (0.0625M Tris-HCL, 10% glycerol (v/v), 2% SDS (w/v), 0.72 M (3-

mercaptoethanol and 0.001% bromophenol blue) and heated in boiling water for 5

minutes.

3.7.2 Electrophoresis and Transfer

60 lpg (for MR) or 40 ptg (for GR) of cytosol protein prepared from hippocampus was

separated by size on 7.5% Tris-HCl gels (Biorad, Hercules, CA) by SDS-PAGE at 200

V. After electrophoresis, the proteins were transferred to 0.45 pm nitrocellulose

membranes (Biorad, Hercules, CA) for 1 hour at 100V. The membrane was washed

once with phosphate buffered saline containing 0.5% Tween 20 (PBST) and left to dry

overnight. The membrane was wetted with PBST on the day of staining.

3.7.3 MR Western Blotting Method

For detection of MR the blot was blocked in 5% non-fat dried milk in PBST

containing 1 % bovine serum albumin (Sigma #7638, Sigma, St. Louis MO) for 3 hours

at room temperature. Primary antibody (N17, SC 6860, Santa Cruz Biotechnologies Inc.,






45


Santa Cruz, CA) at a final concentration of 0.4 pg IgG/ml (1: 500) in blocking solution

was incubated with the blot for overnight at 40C. The blot was washed once for 10

minutes and twice for 5 minutes in PBST, then incubated with peroxidase linked

secondary antibody (SC 2350) at a dilution of 1:5000 in PBST:1% BSA for 1.5 hours at

room temperature. The blot was rinsed and then washed five times (once for 15 minutes

and four times for 5 minutes) in PBST. After washing, MR bands were visualized with an

enhanced chemiluminescence kit (NEN Renaissance, NEN Life Sciences, Boston, MA)

according to the manufacturer's directions. Films (Kodak Biomax ML) were developed

and the bands quantified on densitometer and image analysis software (BioRad GS 710

linked to Quantity One software, Bio-Rad). Preliminary experiments defined the antibody

conditions used in these determinations and also showed that the amount of protein

loaded in each lane on these gels was approximately in the center of the dynamic range of

band detection. This ensured that any changes in the amount of MR (or GR, as described

below) protein in a sample compared to control could be readily detected. Preliminary

blocking experiments with cognate peptide decreased the intensity of the band,

suggesting that it was specific.

3.7.4 GR Western Blotting Method

GR protein bands were detected using similar methodology as that used for MR,

except the blot was blocked in 7.5% non-fat dried milk in PBST overnight at 40C. Anti-

GR antibody (PAI-511, Affinity BioReagents, Golden, CO) at 0.5 jtg/ml in blocking

solution was incubated with the blot overnight at 40C. Previous studies in these labs have

shown that this antibody recognizes a 97 kD protein in sheep hypothalamus and pituitary,

and is specific, as it was preabsorbed by immunizing peptide (Saoud and Wood, 1996).






46


3.7.5 P-actin Western Blotting Method

A P-actin antibody was used to reprobe the membrane after MR and GR bands were

detected to assure that equal amounts of protein was loaded in each lane and equally

transferred to the membrane. After quantification of the MR or GR bands the membrane

was stripped at 570C for 20 minutes with 2% SDS, 62.5mM Tris-HCL PH=6.8 and

100mM /f-mercaptoethonol. Then it was washed with PBST 6 times for 5 minutes each.

The membrane was blocked in 10% non-fat dried milk in PBST. 1% BSA at room

temperature for 2 hours. Anti /f-actin antibody (A5441, Sigma, St.Louis, Missouri) at

1:100,000 in PBST 1%BSA was incubated with the blot for 1 hour at room temperature.

The blot was then incubated with peroxidase linked secondary antibody (A9044) at a

dilution of 1:16,000 in PBST. 1% BSA for 1 hours at room temperature. After washing,

P-actin bands were detected using similar methodology as that used for MR and GR

3.8 RT-PCR

See Chapter 4 for details.

3.9 Statistic Analysis

The values of hormone concentration, Bmax of MR/GR, and Kd of MR were

analyzed by analysis of variance (ANOVA). Individual means were compared by

Newman-Keuls multiple comparison test. For Western blotting, samples from the two

adrenal-intact groups were loaded in one gel, and the samples from adrenalectomized

groups were run in another gel. The results of densitometric analysis of the blots for MR

and GR were analyzed by unpaired t test for two groups of adrenal intact ewes and by

ANOVA for the three groups of adrenalectomizd ewes. The ACt calculated from real-

time RT-PCR was analyzed by ANOVA; the fold change is not a linear variable so that







47


data is not normally distributed and cannot be analyzed by ANOVA. The null hypothesis

was rejected when P<0.05.














CHAPTER 4
RT-PCR

RT-PCR is an important tool for detecting or quantitating the mRNA in tissues or

cells. It has been widely used in numerous areas. A number of widely used procedures

exist for detecting and determining the abundance of a particular mRNA in a total or poly

(A) RNA sample. Four methods are most frequently used, they are nuclease protection

assay, northern blot, in situ hybridization and RT-PCR. Each of them has inherent

advantages and limitations. In general, Northern analysis is the only method that provides

information about transcript size, whereas nuclease protection assays are the easiest way

to simultaneously examine multiple messages. In situ hybridization is used to localize

expression of a particular gene within a tissue or cell type, and RT-PCR is the most

sensitive method for detecting and quantitating gene expression. In my project, I chose

RT-PCR because of following two reasons. First, as described above, RT-PCR is the

most sensitive method for detecting and quantitating gene expression. My goal in this

research project is quantitating MR and GR mRNA in certain brain area. Second, it is a

well-developed technique in Dr. Keller-Wood's lab. Both semi-quantitative RT-PCR and

real-time PCR are used in this project. By semi-quantitative PCR, we also got the part of

the sequence for ovine MR, which is necessary in primer and probe design for real-time

PCR. This chapter described the methodology in detail for both semi-quantitative RT-

PCR and real-time RT-PCR and some data obtained in the process of developing the

method.




48






49


4.1 Semi-Quantitative RT-PCR

4.1.1 RNA Extraction and Sample Preparation

Total RNA was extracted from 150-200mg of tissue with Trizol(GIBCO/BRL, Grand

Island, NY) following the manufacturer's recommended method. Tissues were

homogenized in Trizol, then extracted with chloroform(0.2ml/ ml Trizol). The RNA was

precipitated from aqueous phase by the addition ofisopropanol (0.5ml/ ml Trizol) and

pelleted by centrifugation at 12,000g for 10min. After washing the pellets in 75%

ethanol, the RNA was dissolved in 200ul HPLC water. The integrity of RNA was

assessed by 1% non-denaturing agarose gel electrophoresis and visualization of the 18s

and 28s ribosomal RNA bands with ethidium bromide staining.

4.1.2 Primer Design

PCR primers for regular PCR for MR were designed using published human DNA

sequences (Arriza et al., 1987) with the aid of the Primer Design software and

synthesized by a commercial vendor (Gemini Biotechnology, Alachua, FL). Primers for

GR were similarly designed using published ovine RNA sequences (Yang et al., 1992).

The expression of the MR gene was determined by amplification of 277 bp region of

the MR cDNA sequence (4846-5122) (Arriza et al., 1987).

The sense upstream primer sequence:

5'-GGCACTGATGCAATGTATGG-3'

The antisense downstream primer sequence:

5'-GTAATGTTGCCTGCATGGTG-3'.

The expression of GR was determined by amplification of a 275 bp region of the ovine

GR cDNA sequence (301-575) (Yang et al., 1992).

The sense upstream primer sequence:






50

5'-GGAAGCTCGAATGAGGACTG-3'

The antisense downstream primer sequence:

5'-TGTCCCCCAGAGGTACTCAC-3'.

RT-PCR for MR and GR produced products whose sizes were consistent with the

predicted products, respectively.

As a positive control for each RNA preparation, an ovine 3-actin sequence was also

amplified simutaneously in adjacent tube.

The sense upstream primer of ovine 3-actin cDNA sequence:

5'-GAGAAGATGACCCAGATCATGT-3'

The antisense downstream primer sequence:

5'-TCCATGCCCAGGAAGGAAG-3'

4.1.3 Semi-quantitative RT-PCR

Total RNA (1 [pg) was treated with 1U DNase (Promega) at a temperature of 370C for

30 min. The DNase reaction was stopped by incubation at 750C for 5 min before cooling

to 40C. The RNA was then reverse transcribed in buffer containing 50 U of MuLV

reverse transcriptase, ImM each dNTP, 20 U RNase inhibitor and 50 pmol of

oligo(dT)15 primer in a total volume of 20 gl according to the manufacturer's protocol

(Perkin-Elmer Gene Amp PCR Core Kit, Perkin-Elmer Co., Foster City, CA).

Preliminary experiments determined the PCR conditions necessary for amplification of

product to be in the linear range. Briefly, the mixture was incubated for 10 minutes at

250C, then for 30 minutes at 420C. The RT reaction was stopped by incubation at 950C

for 5 minutes. The cDNA sample (10 pJl) was used for amplification by specific primer

for MR and GR. PCR reactions were carried out in 1X PCR buffer containing 1.0 mM






51


MgC12, 0.2 mM each dNTP, 0.15 gjM primers and 1.25 U of Taq DNA polymerase. The

cycling program was 95C for 30 seconds for denaturation, 55C for 1 minute for

annealing and 720C for 1 minute for elongation for 31 cycles. After the end of 31st cycle,

we allowed an additional 10 minutes for extension. The PCR bands were separated by

electrophoresis on 1% agarose gels containing ethidium bromide and visualized under

UV transillumination. The density of PCR bands were determined using a densitometer

and image analysis software (Bio-Rad, Hercules, CA).

4.1.4 PCR Product Purification and Sequencing

To get the primer and probe for real-time PCR, the specific ovine sequence of MR and

GR had to be obtained. Ovine GR sequence was available in published paper (Yang et al.,

1992), but the ovine MR sequence was not available. We sequenced the PCR product of

MR from regular RT-PCR and used that piece of sequence to design the primer and probe

for real-time PCR of MR RNA.

At the end of the PCR cycle, the solution of PCR product was collected and purified

by Wizard PCR Preps DNA Purification System (Promega, Madison, WI). According to

the protocol, the PCR reaction was transferred to a clean microcentrifuge tube, 100 pl of

direct Purification Buffer was added into 30-300 pl of the PCR reaction, and then 1 ml of

resin was added and vortexed. The mixture was filtered through a Minicolumn, and 2ml

of 80% isopropanol was used to washed the column. The Minicolumn was then

transferred to a 1.5ml microcentrifuge tube and centrifuged it for 2 minutes at 10,000 x g

to dry the resin. Finally, the DNA in the column was eluted with 50 pl of water with a 20

seconds spin at 10,000 x g.







52

The purified DNA was sent to Interdisciplinary Center for Biotechnology Research

(ICBR) at the University of Florida for sequencing. The sequences obtained were

compared to the previously published ovine GR sequence and the human MR sequence

(ovine MR sequence has not been completely cloned and sequenced) using BLAST. The

results of the BLAST search showed the PCR product for GR was 100% homologous to

the published ovine glucocorticoid receptor sequence (Yang et al., 1992). The PCR

product for MR was 90% homologous to the human MR (Arriza et al., 1987). This

confirmed the PCR products were from GR and MR mRNA.

4.2 Real-Time RT-PCR

4.2.1 RNA Extraction and Sample Preparation

RNA extraction from tissue for real-time RT-PCR is the same as that used for regular

RT-PCR, except that the RNA pellet after ethanol washing was dissolved in 200ul

RNAsecure Resuspension Solution (Ambion, Inc. Austin, TX). The RNAsecure

Resuspension Solution helped to stabilize RNA and to prevent RNA degradation in thaw-

freezing cycle and sample handling procedure. After that, RNA was immediately treated

with DNase (Promega)(lU/ug RNA) at a temperature of 370C for 30 min in the presence

of reaction buffer. The DNase activity was stopped by incubation at 650C for 10 min by

adding stop solution (half volume of DNase) before cooling to 40C. Then the quantity of

total RNA extracted was measured spectrophotometrically. The RNA was stored in many

aliquots and for use in the real-time RT-PCR.







53

4.2.2 Primer and Probe Design

PCR primers and Taqman probe specific for the ovine mineralocorticoid receptor was

designed using Primer Express software (Applied Biosystems) according to the sequence

which was obtained from regular RT-PCR in our lab.

Forward primer: ATTTCACTGAGTACCTGTTGATTATCATC

Reverse Primer: GGGAAACTTAATATGATTGCACTAAATAAA

TaqMan Probe: CTTTTCCAAGATTAATTTGGCCTCTATTCAAAGCA

The probes and primers used to detect MR mRNA will recognize all 3 subtypes of MR

found in rat hippocampus (Kwak et al., 1993), which vary in the 5' untranslated region,

and will also recognize the MR+4 mRNA splice variant found in human brain which has

12 additional base pairs between exons 3 and 4 in the DNA binding domain (Wickert et

al., 2000).

PCR primers and Taqman probe specific for the ovine glucocorticoid receptor was

designed using the same software according to the sequence which has been cloned and

published at Genebank(Yang et al., 1992).

Forward primer: ACTGCCCCAAGTGAAAACAGA

Reverse Primer: GCCCAGTTTCTCCTGCTTAATTAC

TaqMan Probe: AAAGAAGATTTTATCGAACTCTGCACCCCTGG

The GR primer and probe will recognize both splice variants of human GR, which

occur in sequences encoding for the carboxy terminus of the peptide (Oakley et al., 1996)

The 18s rRNA primer and probe were from TaqMan ribosomal RNA control reagents

(Applied Biosystems).






54

4.2.3 Real-time RT-PCR

4.2.3.1 Mixture

The reaction was performed in an ABI Prism 5700 sequence detector (Applied

Biosystems) using a Taqman One-Step RT-PCR Master Mix Reagents kit (Applied

Biosystems) and following the protocol laid out therein except that the reaction volume

was 25 ul. 2.5ul RNA was mixed with 12.5 ul 2X master mix 0.625ul 40X multiScribe

reverse transcriptase/RNase inhibitor mix, forward primer, reverse primer and Taqman

probe with addition of water in a total volume of 25 ul.

4.2.3.2 Primer, probe and starting RNA concentration

Initial experiments defined primer, probe and starting RNA concentration for the

mRNA being measured. For each gene, we optimized the primer concentration from 50-

900nM and probe concentration from 50-250nM. We select the primer and probe

concentration which gave the lowest Ct and highest ARn. After these optimizations, we

performed validation experiment by using increasing amount of RNA input for interested

gene and rRNA to verify that they had the same amplificatin efficiency. The final

concentrations of primer and probe for MR were: 400nM forward primer, 800nM reverse

primer and 150nM probe. The final concentrations of primer and probe for GR were: 900

nM each of forward and reverse primer, 100 nM probe. The final concentrations of

primer and probe for 18s rRNA, which was used as internal control for normolization of

the samples' variation were: 50nM each of forward primer and reverse primer, 200nM

probe. 100ng RNA was added for MR, 10ng RNA was added for GR and 0.5ng RNA

was added for rRNA in each reaction.






55


4.2.3.3 RT-PCR cycles

Reverse transcription was carried out at 480C for 30 min. Thermal cyclying for PCR

was initiated with incubation at 950C for 10 min for activation of AmpliTaq Gold DNA

polymerase. After this initial step, 40 cycles of PCR were performed. Each cycle

consisted of heating at 950C for 15s for melting and 600C for Imin for annealing and

extension.

4.2.4 Expression of Data

Each sample was analyzed in triplicate for MR, GR and rRNA. The data was

analyzed by calculating the threshold number of cycles (Ct), and determining ACt

between the mean Ct for each gene and the mean Ct for rRNA from the same sample;

differences among groups were analyzed by ANOVA using the ACt data. The fold

change in mRNA relative to control can then be calculated as 2-Act, where AACt=ACt in

each animal in the experimental group mean ACt in the control group( nonpregnant

adrenal intact ewes).

4.3 Corticosteroid Receptor Regulation in Sheep after Acute Adrenalectomy

4.3.1 Introduction

In these experiments, we measured the levels of mRNA for the MR and GR in

hippocampus and kidney to test whether receptor gene expression is increased under

conditions of acute withdrawal of adrenal steroids in adult female ewes. The reasons for

studying the effects of adrenalectomy in the sheep are as follows. First, we wanted to

examine the receptor regulation in the acute and complete absence of steroid in sheep.

There are similar studies in this area but no study has been done in species of sheep.

Second, it is part of the study of characterization of ovine corticosteroid receptors. In this






56

study, receptor-binding assay was used to estimate of the total number of receptors when

cortisol level was close to zero. This is a parameter difficult to directly determine for

steroid receptors because of the inability of activated receptors to rebind steroid under the

conditions used in binding assays (Chou and Luttge, 1988;Galigniana et al., 2000). This

provides both a maximum binding capacity for comparison with other, more physiologic

states, and allows an estimation of the percent occupancy of the MR and GR at

physiologic concentrations of steroid. Knowing whether there is a regulation of receptor

in condition of acute withdrawal of steroid or complete absence of steroid is a useful

information when interpretate the data from receptor-binding assay.

4.3.2 Methods

Ten adult female sheep of mixed breed were randomly assigned to two groups. The

first group was ovariectomized and sham-adrenalectomized ("adrenal-intact", ADI). The

second group was ovariectomized and adrenalectomized ("adrenalectomized", ADX)

according to previously published protocols (Keller-Wood et al., 1998). The

adrenalectomized ewes were maintained on replacement infusions of cortisol and

aldosterone for one week after surgery to allow them to recover from the surgical stress.

The replacement steroid infusions (0.33 mg/kg/d cortisol and 2.88 ig/kg/d aldosterone)

were then withdrawn from the adrenalectomized ewes and their blood pressure and blood

potassium levels were measured as previously described (Orbach et al., 2001). Once the

ewes showed signs of hypoadrenocorticism, defined as mean arterial blood pressure

below 75 mm Hg and /or serum potassium above 6 mEq/dL, the ewes were killed with an

overdose of pentobarbitol. Sham-adrenalectomized ewes were killed at the same time

after surgery as the adrenalectomized animals. Their brains were perfused with ice-cold







57

isotonic saline containing 10% (v/v) DMSO (Sigma, St.Louis, MO). This served to

protect the receptors during during freezing and to remove any blood borne

corticosteroid-binding globulin (CBG) (MacLusky et al., 1986). The brains were

dissected and frozen in a dry ice-acetone bath, and then stored at -800C until assay.

4.3.3 Results

4.3.3.1 Semi-Quantitative analysis of mRNA for MR and GR

MR and GR in hippocampus and kidney were compared between the ADX group and

control groups using semi-quantitative RT-PCR. Sequence analysis of the products

showed that the GR product was 100% homologous to the published ovine GR sequence.

The MR product was 90% identical to the human MR sequence. Hence we believe that

the PCR products were derived from the RNA for GR and MR.

There was no significant difference between steady-state mRNA levels in the

hippocampus of control or adrenalectomized ewes for either MR or GR (Figure 4-1;

relative optical densities MR: 0.920.29 in ADX versus 0.730.10 in ADI; GR:

0.900.10 in ADX versus 0.980.26 in ADI; n=5 in each group). There was also no

significant difference in steady-state levels of mRNA for either receptor in the kidneys of

these animals (GR: 0.950.12 in ADX and 1.040.10 in ADI; MR: 0.730.19 in ADX

and 0.900.15 in ADI; n=5 in each group; Figure 4-2).

4.3.3.2 Sequence of PCR product of MR and GR

Since no ovine MR has been cloned, we sent the products of the PCR reactions to

ICBR DNA sequencing core labs in the University of Florida. At the same time, we can

also check if the product is the product we expected.

The GR sequence obtained was:






58

AAGCCTCTTC TTTTACCGGA CGCTAAGCCT AAAATTAAAG

ATAATGGAGA TTTGATCTTA CCAAGTCCTA ACAGTGTGCC ACTGCCCCAA

GTGAAAACAG AAAAAGAAGA TTTTATCGAA CTCTGCACCC CTGGGGTAAT

TAAGCAGGAG AAACTGGGCC CAGTTTATTG TCAGGCCAGC TTTCCTGGGG

CCAACATAAT TGGCAATAAA ATGTCTGCCA TTTCTGTTCA TGGTGTGAGT

ACCTCTGGGG GACAA.

The MR sequence obtained was:

AGAAAAGGGT TGATCCCAGC GCTGCCATCT CCCGGCCTTG GGGCTCCCCA

GCTCTAGCTT TTAGGTTTTG GAAAAGAATA CGATTTCACT GAGTACCTGT

TGATTATCAT CACTTTTCCA AGATTAATTT GGCCTCTATT CAAAGCAGTT

TATTTAGTGC AATCATATTA AGTTTCCCCA AAGATATATA TATATATGTT

TGTGATTTGG GGCAAGAGAA AAAGCCATAC ATTGCATCAG TGC.

The sequences obtained were compared to the previously published ovine GR sequence

and the human MR sequence (ovine MR has not been completely cloned and sequenced)

using BLAST. The results of the BLAST search showed the PCR product for GR was

100% homologous to the published ovine glucocorticoid receptor sequence (Yang et al.,

1992). The PCR product for MR was 90% homologous to the human MR (Arriza et al.,

1987). This confirmed the PCR products were from GR and MR mRNA.

4.3.4 Discussion

Although upregulation of rodent hippocampal MR and GR mRNA after

adrenalectomy has been documented (Herman and Spencer, 1998;Patel et al., 1992), we

did not detect the changes in the adrenalectomized sheep. There might be several reasons

for this difference. First, it is possible that the regulation of the system may be different in

the two species. In addition, adrenalectomized rats can be maintained for at least two






59

weeks by supplying salt water to drink. However, increased sodium intake is not a

sufficient treatment for adrenalectomized sheep or human. Secondly, it is possible that

our method of examining a large portion of the hippocampus masked any regional

changes within the hippocampus. Some regions may have undergone upregulation of the

receptors due to lack of steroid, while other regions of the hippocampus, where steroid is

required to keep the cells viable, may have undergone apoptosis. It has been proposed

that MR mediate cell survival in the hippocampus, and adrenalectomy results in loss of

cells in dentate gyrus (Reagan and McEwen, 1997;Woolley et al., 1991). In this situation,

the average receptor number or message or protein would appear to be unchanged by

steroid, whereas in fact, regulation may have occurred in subregions.

4.4 MR Expression in Late-Gestation Ovine Fetal Lung

4.4.1 Introduction

The role of the glucocorticoid, such as cortisol and betamethasone in accelerating the

maturation of the lung and in production of surfactant is well known (Froh and Ballard,

1994). It has been widely used in clinics. GR has been found in fetal lungs late in

gestation and are localized in alveolar type II cells which produce surfactant, as well as

fibroblasts and epithelial cells. However, studies showed that corticosteroids may also

participate in reabsorption of lung liquid at birth in fetal sheep and guinea pigs.(Barker et

al., 1994; Harding, 1994). Aldosterone or cortisol alone both significantly decrease the

rate of lung liquid production. This effects of aldosterone and cortisol suggests that MR,

which has high affinity with aldosterone and cortisol, may mediate this effect.

In this study, we exam MR gene expression in the fetal lung by using both

semiquantitative RT-PCR and real-time RT-PCR. This is the part of the whole study

which also include examing the relative location of the Na/K ATPase isoform in lung. In






60

fetal lung, sodium reabsorption is thought to be dependent upon Na/K ATPase activity

acting in concert with luminal Na influx (Harding, 1994).

4.4.2 Methods

Lungs were collected from fetal sheep (120-125 days' gestation) at sacrifice.

Pulmonary tissue for analysis of mRNA was immediately snap-frozen in RNAse-free

tubes in a dry ice/acetone bath, and stored at -800C until analysis.

4.4.3 Results

We used both semiquantitative RT-PCR and real-time PCR technology to identify MR

mRNA in lungs collected from a large group of animals (120-131 day's gestation). MR

mRNA was detected in samples of four fetal lungs using semi-quantitative RT-PCR (Fig.

4-3). By real-time RT-PCR, MR mRNA was also identified in the lungs of eleven fetal

sheep (Fig.4-4 top left panel). In the fetal lungs, the generation of cDNA was

significantly greater than the generation of product in reaction in which there was no

added mRNA (Fig 4-4, "no RNA control"). MR mRNA was undetectable in the lungs of

seven pregnant ewes (Fig 4-4 top right panel). Product generation in samples from

maternal lungs was not different than that of the negative control. There was no influence

of fetal gestational age on the abundance of MR mRNA in the fetal lungs, normalized to

the abundance of 28S rRNA (Fig 4-4 bottom panel).

4.4.4 Discussion

The data from semi-quantitative RT-PCR is consistent with the data from real-time

RT-PCR. This implies that the method of real-time PCR works well and data is valid

since this is the first data obtained from real-time PCR in our laboratory. We also

measured mRNA of MR in many different tissues, including many different brain

regions. Most of them have detectable mRNA of MR. This implies that mRNA of MR is







61


undetectable in maternal lung is not a problem caused by tissue specific detection from

primer or probe.






62



Ethidium bromide-stained PCR products for MR, GR and P-actin
from ADI or ADX sheep hippocampus

STD 1A 1B 1C 2A 2B 2C 3A 3B 3C 4A 4B 4C















STD 5A 5B 5C 6A 6B 6C 7A 7B 7C 8A 8B

MR- and GR- specific PCR products in
hippocampus of ADI and ADX ewes

1.5-
Co =ADI
O C ADX

c 1.0-
o

0.5-


0.0
MR GR

Fig. 4-1: Total RNA isolated from hippocampus of adrenal-intact or adrenalectomized ewes
was subjected to RT-PCR with primers specific for MR,GR or 0-actin.
Top panel: gel showing RT-PCR products from 4 adrenal-intact (ADI) and 4
adrenalectomized (ADX) ewes. Odd numbered lanes are ADI, even numbers ADX. A=GR,
B=MR, C=P-actin. The arrow indicated the 500bp marker in a 100 bp ladder (Promega). The
PCR product for MR was 277 bp, for GR was 275 bp, and for P-actin was 461 bp.
Bottom panel: Mean data for ADI vs ADX animals, n=4 per group, normalized to P-actin.
The data shown in the top panel were normalized to p-actin in each individual ewe; the mean
normalized data is shown in this panel. There were no significant differences between ADI
and ADX ewes (by t test).








Ethidium bromide-stained PCR products for MR, GR and O-actin from ADI or ADX sheep kidney

STD AB C ABCABC A BCABC ABCA BCA BC A B CA B










4 ADI (n=5) ADX (n=5) -



MR- and GR- specific PCR products in Fig. 4-2: Total RNA isolated from kidney of adrenal-intact
kidney of ADI and ADX ewes or adrenalectomized ewes was subjected to RT-PCR with
primers specific for MR,GR or P-actin.
1.5- Top panel: gel showing RT-PCR products from 5 adrenal-
S" "- ADI intact (ADI) and 5 adrenalectomized (ADX) ewes. The
O ADX arrows beneath the scan indicate ADI and ADX ewes.
.- A=GR, B=MR, C=3-actin. The arrow indicated the 500bp
0 1.0 marker in a 100 bp ladder (Promega). The PCR product for
a. MR was 277 bp, for GR was 275 bp, and for P-actin was
o 1- 461 bp.
0.. 0.5- Bottom panel: Mean data for ADI vs ADX animals, n=5
O per group, normalized to P-actin. The data shown in the top
CO panel were normalized to P-actin in each individual ewe;
0.0 the mean normalized data is shown in this panel. There
MR GR were no significant differences between ADI and ADX
ewes (by t test).






64






































Fig. 4-3 : cDNA polymerase chain reaction product for MR, GR and P-actin mRNA.
Adjacent lanes demonstrate lack of product when P-actin primers are used after omission
of the reverse transcriptase (RT) reaction and after omission of mRNA.







65








21 02

n N RN 01
nO ." OD "-
0 10 20 3 4D s0 0 10 20 90 4 0 o
Cycle Nunber Cyde Number




Fetal MR mRNA in LUNG



4








120-125d 129-131d








Fig. 4-4: (top panel) Tapman fluorophore signal intensity (Rn) generated in response to
real-time PCR in fetal (left) and meternal (right) lung samples. MR mRNA was detected
in all samples of fetal lung (n=l 1) and in none of the samples of maternal lung (n=7). For
comparision, Rn in a reaction containing no mRNA is also plotted in the left panel.
(bottom panel) Differeces of cycle threshold of MR mRNA and 28s rRNA (ACt) for
ovine fetal lungs at two gestational ages (120-125, n=7 and 129-131 days, n=4),
demonstrating a similar abundance of MR mRNA in both groups.














CHAPTER 5
ALTERATION OF MINERALOCORTICOID RECEPTOR FUNCTION BY
PREGNANCY AND PROGESTERONE

5.1 Introduction

As described in the Literature Review, studies in our laboratory in sheep have shown

that the set point for the feedback regulation of basal plasma cortisol concentration is

increased during pregnancy(Keller-Wood, 1998). This would allow the basal plasma

concentration of cortisol to be maintained at a higher level without suppression of ACTH,

whereas further increases in cortisol concentration would suppress plasma ACTH

concentration, as it does in nonpregnant sheep. However, the mechanism of the normal

pregnancy-induced increase in set point for cortisol is still unknown.

Also as previously described in Literature Review, it has been shown that

progesterone can antagonize MR-mediated effects in vivo (Spence et al., 1989;Wambach

and Higgins, 1979) and in vitro (Jones et al., 1977;Rupprecht et al., 1993b). Progesterone

has very high affinity for the human MR, but it exerts very low transcriptional activity

after binding MR (Rupprecht et al., 1993b). In sheep, progesterone has an approximately

equal affinity compared to cortisol at the MR and lower affinity for ovine GR

(unpublished data).

We therefore hypothesized that elevated progesterone acts as an antagonist to cortisol

binding at MR, reducing MR availability and increasing the apparent Kd of MR for

cortisol in hippocampal cytosol. This results in the up-regulation of set-point for

regulation of cortisol during pregnancy since MR-mediated effects have been decreased.



66






67

To test our hypothesis, we used saturation binding assay to determine the Kd of MR

for cortisol in hippocampus and measured receptor availability for MR and GR. mRNA

and protein level were also measured for MR and GR. Finally, 5-HT1A receptor were

used as an indicator for MR/GR mediated action in hippocampus. Expression of 5-HTIA

receptor has been shown to be suppressed by cortisol in hippocampus. If progesterone

indeed antagonizes MR mediated effects of cortisol, this suppression would be

attenuated. Real-time PCR was used to meausre the mRNA of 5-HTIA receptor in

hippocampus.

5.2 Materials and Methods

In order to compare the effects of pregnancy and progesterone on mineralocorticoid

receptor mediated function, twenty-five adult female sheep, including ten pregnant and

fifteen nonpregnant, were studied in five experimental groups. Group (1) were

nonpregnant, sham-adrenalectomized and ovariectomized ewes. Group (2) were

pregnant, sham- adrenalectomized ewes. Group (3) were nonpregnant, adrenalectomized

and ovariectomized ewes. Group (4) were pregnant, adrenalectomized ewes. Group (5)

were nonpregnant, adrenalectomized ewes chronically treated with progesterone. Data

from one adrenalectomized pregnant ewe was excluded from analysis because both MR

and GR binding and protein levels were all markedly lower than all other animals (20-

40%), suggesting degradation of the receptors in the cytosol preparation.

The adrenalectomy and ovariectomy were performed according to previously

published protocols(Keller-Wood et al., 1998) as described in Methods(Pecins-Thompson

and Keller-Wood, 1994). Steroid implantation was performed to keep the cortisol and

aldosterone at a low, consistent level (2-5 ng/ml, 20-40pg/ml respectively). Ewes in






68


group 5 were also treated with progesterone to increase its level to that of the normal

pregnant sheep (O1ng/ml).

After collecting the hippocampal tissue, the plasma hormone levels were measured.

Receptor binding assay, Western blot and real-time RT-PCR were all done according to

the protocol described in Methods and RT-PCR chapters.

For this project, we did saturation binding assay followed by nonlinear regression

analysis for MR for three animals in each group. With increased concentration of 3H-

cortisol from 0.05 to 35 nM, the saturation binding curves were generated and the binding

affinity (Kd) of MR in the hippocampus and Bmax of MR were determined. For all

animals, we also measured total receptor availability for MR and GR using a single

saturating concentration of 3H-cortisol (25 nM) as previously described.

For real-time PCR for 5-HT1A receptor, the methodology was exactly the same as

measurement for MR and GR. A pair of primer was first designed according to human 5-

HT1A receptor sequence (448-624) in Genebank for regular RT-PCR.

Forward Primer: ACC CCA TCG ACT ACG TGA AC

Reverse Primer: CAG CGG GAT GTA GAA AGC TC

After sequencing the PCR product, we got a piece of 177bp sequence. The sequence was

compared with 5-HT1A receptor of human and other species by BLAST. It was 93%

homologous to the human 5-HTIA receptor. This confirmed the PCR product was from

5-HT1A receptor mRNA.

Then primer and probe for real-time PCR were designed according to this 177bp

sequence.

Forward primer: GCGCACCCCGGAAGA






69

Reverse primer: GTAAATAGTGTAGCCGTGGTCCTTGCT

Probe: CGGACCCGGACGCGTGCA

5.3 Results

5.3.1 Cortisol, Progesterone and Aldosterone Level in Plasma.

Plasma levels of cortisol, progesterone and aldosterone at the time of sacrifice were

shown in Table 5-1. In the cortisol-replaced adrenalectomized ewes, plasma cortisol

levels were similar (3-5 pg/ml) to those of the nonpregnant, adrenal-intact ewes. As

expected, plasma cortisol levels were higher in the pregnant adrenal intact group of ewes;

free cortisol levels also tended to be higher, however this difference was not significant.

Progesterone levels were low in nonpregnant, ovariectomized sheep, and both total and

free progesterone concentrations were increased in both groups of pregnant ewes.

Progesterone treatment increased plasma progesterone concentration to a level similar to

that in adrenal- intact pregnant ewes.

5.3.2 Total Available Receptor Binding at MR and GR in Hippocampus

The estimate of Bmax values for MR obtained by binding at a single saturating

concentration of 3H- cortisol was very similar to that obtained by saturation binding

experiments with multiple 3H- cortisol concentrations, confirming the validity of the

results (r=0.91, n=24). In the adrenal-intact ewes, there were significantly more MR sites

available in hippocampus from pregnant as compared to nonpregnant ewes (Figure 5-1,

lower right), despite the higher plasma cortisol concentrations in the pregnant ewes. In

the adrenalectomized ewes, there were also significantly more MR sites available in the

pregnant ewes as compared to the nonpregnant ewes (Figure 5-1, lower left). MR

availability in the nonpregnant adrenalectomized, progesterone-treated group was

intermediate between that in the pregnant and nonpregnant adrenalectomized groups, but







70

these differences were not statistically significant. There was, however, a statistically

significant relationship between total plasma progesterone concentration and MR

availability (r=0.57, p<0.003, n=24), and free plasma progesterone concentration and MR

availability (r=0.56, P<0.004; n=24).

There were no differences in Bmax for GR between pregnant and nonpregnant (85.2

10.3 vs 91.9 7.0 fmol/mg protein, respectively) adrenal-intact ewes, or among

nonpregnant, pregnant and nonpregnant-progesterone-treated ewes (90.5 10.4, 84.9 +

14.4, 93.3 6.9 fmol/mg protein, respectively)

5.3.3 Apparent Kd of MR with Cortisol in Hippocampus

To determine if progesterone was acting as an antagonist in vivo, we measured the

apparent Kd for 3H cortisol in hippocampal cytosols using a saturation binding assay

followed by nonlinear regression analysis (Figure 5-2). Pregnancy or progesterone

treatment increased the apparent Kd of MR in the adrenalectomized ewes (Figure 5-1,

upper left). There was also a significant difference in the apparent Kd of MR between

nonpregnant and pregnant adrenal-intact ewes (Figure 5-1, upper right). There was no

significant difference between the apparent Kd of MR in hippocampus of

adrenalectomized ewes who were pregnant versus progesterone treated. Overall, there

was a strong positive linear relationship between progesterone level and the apparent Kd

of MR using data from all 5 groups, indicating reduced affinity of cortisol at MR with

increasing total plasma progesterone concentrations (r =0.85, p<0.0001, n=15) or free

plasma progesterone concentrations (r =0.84, p<0.0001, n=15). There was not a

significant relationship between either total or free plasma cortisol concentration and the

apparent Kd (p=0.09 and p=0.27, respectively).







71


5.3.4 MR and GR Protein Levels and mRNA Expression in Hippocampus

Since we detected differences in receptor availability among the different groups of

sheep, we examined if these changes were partly due to changes in the total amount of

receptor protein or MR and GR gene expression. We used Western blot analysis to

measure the protein level of MR and GR in cytosol of hippocampus for each animal.

There was no significant difference between the nonpregnant intact group and pregnant

intact group (Figure 5-3 and Table 5-2). There was also no significant difference among

the three groups of adrenalectomized ewes (Table 5-2).

We also examined the mRNA expression for MR or GR using the real-time RT-PCR

method (Table 5-2). There was no significant difference among the groups in steady state

levels of MR or GR mRNA in hippocampus.

5.3.5 5-HT1A Receptor mRNA Level in Hippocampus

The cDNA product of the RT-PCR experiments was sequenced and the sequence

obtained was compared to the human 5-HTIA receptor sequences using BLAST.

the sequence obtained was:

CCCCGGCGCG CCGCTGCGCT CATCTCGCTC ACCTGGCTCA TTGGCTTCCT

CATCTCCATC CCGCCCATGC TGGGCTGGCG CACCCCGGAA GACCGCTCGG

ACCCGGACGC GTGCACTATC AGCAAGGACC ACGGCTACAC TATTTACTCC

ACCTTCGGAG CTTTCTACAT CCCGCTG.

We used real-time PCR to measure to mRNA level of 5-HT1A level in hippocampus.

There was no significant difference among the groups in steady state levels of 5-HT1A

receptor mRNA in hippocampus (Fig.5-4).






72


5.4 Discussion

An increased concentration of plasma progesterone, induced either by pregnancy or

progesterone administration, increased the number of available MR in sheep

hippocampus, and decreased the affinity of those sites for cortisol. These results support

and extend our previous observations that MR availability in the hippocampus is

increased during ovine pregnancy (Roesch and Keller-Wood, 1999). This increase in

availability is not predicted from consideration of plasma cortisol and aldosterone

concentrations, given that circulating free concentrations of both are increased in the

pregnant state. This suggested that another ligand antagonized cortisol binding to MR in

hippocampus during pregnancy. In present study, we used progesterone-treated ewes to

mimic the pregnant state to test the hypothesis that it is the progesterone during

pregnancy that caused this change. To avoid the possible confounding effects of

differences in plasma corticosteroids, the animals were adrenalectomized and treated with

a low dose of cortisol and aldosterone.

Since activated steroid receptors will not rebind ligand under the conditions used in

our assay, the measure of receptor availability in our study presumably reflects an inverse

change in receptor activation. This would suggest that progesterone reduce MR

occupancy and activation in hippocampus in vivo.. The affinity of MR for progesterone

is similar to that of cortisol and corticosterone (Rupprecht et al., 1993b); in the present

studies the estimated concentration of free progesterone during pregnancy is several fold

higher than that of cortisol or aldosterone. It would therefore be expected that

progesterone would competitively inhibit cortisol binding to MR. If progesterone acts as

an antagonist at MR, then the apparent Kd for the receptor for cortisol should be

increased. In this study, we found a significant positive linear relationship between the






73

plasma concentration of progesterone and both the apparent Kd of cortisol at MR and MR

availability. The analysis of the apparent Kd at MR showed a similar pattern as MR

availability. i.e. there was a greater concentration of cortisol required to achieve 50%

binding in pregnant intact ewes compared to nonpregnant intact ewes, and in pregnant

adrenalectomized ewes as compared to nonpregnant adrenalectomized and

ovariectomized ewes. The apparent Kd for MR and MR availability in nonpregnant

adrenalectomized ewes treated with progesterone was intermediate, however the

progesterone concentration was also intermediate.

An effect of progesterone has also been shown in rats after acute progesterone

treatment (Carey et al., 1995). The apparent Kd of corticosterone for MR was increased

in hippocampal cytosol obtained from rats 4h after injection with progesterone (Castren

et al., 1995). Studies in cells transfected with MR or GR and treated with various

steroids showed that progesterone is a potent antagonist at the human MR (Rupprecht et

al., 1993b), binding with high affinity, but resulting in little transcriptional activity.

Modeling of the human MR has also suggested that progesterone normally can bind in

the ligand binding pocket of the human MR, but will not allow the conformational

change necessary for transactivation (Geller et al., 2000); a mutation in one residue

within the binding pocket can result in constitutive transcriptional activity, and enhanced

transcriptional activity after progesterone binding. Women with this mutation are

hypertensive during pregnancy (Geller et al., 2000). These studies have suggested that

progesterone inhibition of MR-mediated actions can occur via antagonism of the

receptor. However, it is possible that progesterone also inhibits MR activity through

another mechanism. In other studies in cultured cells, progesterone inhibited the






74

transcriptional activity of MR through a progesterone receptor (PR-A) mediated effect

(McDonnell et al., 1994).

In sheep, the change in MR availability in the hippocampus during pregnancy or by

progesterone treatment cannot be accounted for by the increase in cortisol binding to

binding globulin, since corticosteroid binding globulin (CBG) levels do not increase

during pregnancy or with steroid treatments (Lindner, 1964;Rosenthal et al., 1969).

Consistent with this, there was no significant difference in the percentage of free cortisol

in plasma with pregnancy in this study, nor were the changes in MR availability or

apparent affinity related to concentrations of free cortisol. The change is also not

accounted for by an increase in metabolism of cortisol to cortisone by 11 3-

hydroxysteroid dehydrogenase. We have measured 11 1- hydroxysteroid dehydrogenase

activity in several brain regions and found that its activity was below or at the limit of

detection in hippocampus in nonpregnant or pregnant ewes (Kim et al., 1995).

Since availability of MR could also be increased by an effect of progesterone on the

synthesis or expression of MR, we also measured MR mRNA and protein levels for MR

in hippocampus following progesterone treatment and during pregnancy. Despite the

change in availability, the protein and mRNA levels were not significantly different

during pregnancy or with progesterone treatment. This suggests that the change in

availability is related to presence of a competitive antagonist, which would increase

apparent Kd, decrease MR activation and increase receptor availability, rather than to a

change in MR expression. However, it is possible that there are either regional or splice-

variant selective changes in MR and GR which would not be detected with the methods

used.






75

Although we did not find a change in MR expression or protein with pregnancy or

progesterone treatment, other studies using adrenalectomized animals without steroid

replacement or using cell culture systems have found changes in MR mRNA levels with

gonadal steroid administration. In cultures of hippocampal neurons, or neuroblastoma

cells, progesterone increases MR expression (Castren et al., 1995). Progesterone also

increased MR mRNA in hippocampus of adrenalectomized, ovariectomized rats after 2

days of administration if they were pre-treated with estrogen, suggesting that this effect is

mediated by progesterone receptors (Castren et al., 1995). However, other studies with 6

days of administration have shown that ovariectomy does not change MR mRNA or the

increase in MR expression after adrenalectomy; progesterone adminstration in the

adrenalectomized, ovariectomized rat also did not change the suppression of MR by high

dose corticosterone (Patchev and Almeida, 1996). However, progesterone blocked the

inhibitory effect of estradiol on MR mRNA; and no effect of progesterone occurred if the

rats were treated with high doses of corticosterone after adrenalectomy. In these studies

progesterone attenuated both the increase in GR mRNA after adrenalectomy and the

suppression of this increase by high dose corticosterone; this effect is consistent with

progesterone action as a weak agonist at GR, in this case modulating the GR

autoregulation. An interactive effect of progesterone with estradiol was also observed

with acute steroid administration over 4 hours in adrenalectomized, ovariectomized rats.

Whereas acute estrogen treatment decreased MR availability in hippocampus, and levels

of MR mRNA in the CA2 region of the hippocampus, progesterone with estradiol

increased both MR binding capacity and mRNA (Carey et al., 1995). Taken together

with the results of our study, these studies suggest that progesterone may modulate the







76

response to chronic, dramatic increases or decreases in corticosteroids, but in the

pregnant state, in the presence of both corticosteroids and estrogen, the overall effects of

progesterone on steady-state levels of MR mRNA and GR mRNA are minimal.

We did not detect any significant change of 5-HT1A receptor mRNA level in

hippocampus among five groups, while we expected that suppression of 5-HT1A receptor

by cortisol would be attenuated by progesterone if progesterone antagonize cortisol

effects in vivo in sheep. In three ADX groups, the levels of plasma cortisol are all at the

similar range. If progesterone antagonize MR mediated cortisol activity, the ewes with

higher progesterone level (group 4 and 5) would have a higher 5-HT1A receptor mRNA.

There are several possible reasons to explain this discrepancy. First, in our experiment,

cortisol levels were at the range of normal nonpregnant level (2-5ng/ml). It is possible

that this level is too low to have the effects on 5-HTIA receptor gene expression.

Neumaier and his colleagues detected regulation of 5-HT1A receptor mRNA in rat in

hippocampus by corticosteroids at the level of 25-30 ng/ml (Neumaier et al., 2000). If no

regulation occurred at the low, normal level of cortisol, progesterone would not have

effects on 5-HT1A receptor mRNA. Seceond, no previous studies have been done on

sheep. Suppression of 5-HT1A receptor by corticosteroid were reported in rats or

cultured hippocampal cells. There might be species different on gene regulation. Third,

progesterone might have its own effects on 5-HT1A receptor by progesterone receptor.

Both cortisol and progesterone effects may work on gene regulation of 5-HT1A receptor

and net effects might be zero. Further studies need to be done to really explain the effects

of cortisol and progesterone action on this 5-HT1A receptor gene regulation.







77


In summary, we have found that the apparent Kd of cortisol at MR in the hippocampus

is increased by an increase in progesterone concentration, produced either by pregnancy

or progesterone treatment. The increase in apparent Kd is also reflected in an increase in

MR availability in hippocampus in pregnant ewes and in nonpregnant ewes with chronic

progesterone treatment. These changes are not related to the level of circulating cortisol,

and there was no change in GR availability in hippocampus. The change in MR

availability was not due to the level of receptors in vivo since neither mRNA nor protein

level of MR and GR changed. These data are consistent with competition of progesterone

with cortisol for binding at MR, resulting in fewer activated MR and more unactivated

MR available for ligand binding in the cytosolic assay. These studies therefore support

the hypothesis that increased progesterone during pregnancy reduces the MR-mediated

effects of cortisol. This action of progesterone may result in decreased cortisol feedback

effects in the hippocampus during pregnancy.







Table 5-1 Plasma hormone levels in five groups

Total Plasma Free Plasma Total Plasma Free Plasma Aldosterone
Cortisol Cortisol Progesterone Progesterone (pg/ml)
(ng/ml) nM (ng/ml) (nM)
Adrenal-Intact (sham)
Nonpregnant 5.4 1.7 2.1 0.8 2.2 + 2.0 6.1 + 5.6 35 14
ovariectomized
Pregnant 11.7 3.0* 3.4 0.9 14 2* 33 6* 26 5
Adrenalectomized
Nonpregnant 4.2 0.7 1.4 0.3 0.14 0.04 0.3 +0.1 21 4
ovariectomized
Pregnant 4.3 0.8 1.2 + 0.2 32 8* 69 22* 48 12
Nonpregnant + progesterone 3.6 0.5 1.9 0.3 12 4* 28 9* 59 12

00
Data expressed as mean SEM
* indicates different than nonpregnant






79




Table 5-2 MR and GR Protein and mRNA in hippocampus

Receptor Protein Receptor mRNA
OD*mm2)* (fold change)**
MR GR MR GR
Adrenal-Intact (sham)
Nonpregnant 0.64 0.05 14.9 2.1 1 (0.6-1.6) 1 (0.7-1.4)
Pregnant 0.66 + 0.05 13.4 3.2 0.4 (0.2-0.8) 0.6 (0.4-0.9)
Adrenalectomized
Nonpregnant 0.88 0.14 11.8 + 2.4 0.9 (0.6-2.3) 0.5 (0.3-0.7)
Pregnant 0.72 0.17 10.2 + 1.9 0.6 (0.4-1.1) 0.9 (0.7-1.0)
Nonpregnant + P4 1.11 0.22 13.0 1.4 0.9 (0.6-1.3 0.7 (0.5-0.8)

Data expressed as mean + SEM
* Data expressed as mean SEM of adjusted volume(OD*mm2) above background SEM
** Data for receptor mRNA are expressed as fold change relative to nonpregnant adrenal
intact; the range is indicated in parentheses.







80







1.5 1.5



1.0 1.0



0.5 0.5


0.0 0.0

30 30
r *
2 25 25
Q..
0)
E 20 20
U)
15 T : 15

X10 I1 | r10



0 01
o os-

NonPreg Preg NonPreg NonPreg Preg
ADX ADX ADX+P4 Intact Intact










Fig.5-1 MR binding parameters in ovine hippocampus with pregnancy or progesterone
treatment. Kd and Bmax of MR for cortisol in pregnant and nonpregnant adrenal-intact
ewes (right, upper and lower panels), and in pregnant, nonpregnant and nonpregnant,
progesterone-treated adrenalectomized (ADX) ewes (left, upper and lower panels).
Data are shown as mean SEM. indicates significantly different from nonpregnant
animals in same corticosteroid treatment group (ie adrenal-intact or ADX).









81







0 5 10 15 20
Bound
20-







0)

1'0 20 30 40
3H cortisol concentration (nM)






Bound
20-




10-





0 10 20 30 40
3H cortisol concentration (nM)






0 10 20
Bound
20-




10-




0 10 20 30 40

3H cortisol concentration (nM)


Fig.5-2: MR binding curves in representative nonpregnant (top), pregnant (middle), and
nonpregnant progesterone-treated (bottom)
adrenalectomized ewe.
At each upper-right corner, it is the Scatchard plot converted from nonlinear regression data.








INTACT ADX

1212121212 345345345345345

MR: 110 kDaf



GR: 97 kDa- .-*.* 7 i "

NP
4 NP P-- -P- + -NP- -P--
+P4


Figure 5-3: Western blot images for MR (top) and GR (bottom) in hippocampal cytosol.
Lanes in the MR immunoblot are identified as :
1, samples from nonpregnant adrenal-intact ewes
2, samples from pregnant adrenal-intact ewes
3, samples from nonpregnant adrenalectomized ewes
4, samples from pregnant adrenalectomized ewes
5, samples from nonpregnant progesterone-treated adrenalectomized ewes
Lanes in the GR immunoblot are idnetified as:
NP, nonpregnant; P, pregnant; NP+P4, nonpregnant progesterone-treated.
Samples from adrenal-intact ewes are shown in panels on the left, those from adrenalcetomized ewes on the right.






83



10.0-


7.5-


5.0-


2.5-


0.0
NP intact P intact




10.0-


7.5-


5.0-


2.5-


0.0
NP Adx P Adx NPAdx+P4


Fig. 5-4 5-HT1A receptor mRNA level measured by real-time RT-PCR in hippocampus.
Top panel: comparison ofmRNA in two adrenal intact groups. There was no significant
difference by unpaired t test
Bottom panel: comparison of mRNA in three ADX groups. There was no significant
difference by one way ANOVA.
Data was showed by delta Ct, which is the difference between Ct of 5-HT1A receptor and Ct
of rRNA from the same sample.














CHAPTER 6
SUMMARY AND CONCLUSIONS

The studies presented in this dissertation were designed to explain how the set point

for the feedback regulation of cortisol and ACTH can be increased during pregnancy in

sheep as well as in humans. We hypothesize that the changes in pregnancy result from a

decrease in cortisol action at the MR, but no decrease in action at the GR. we hypothesize

that these changes, and therefore the elevation of cortisol, are related to the increase in

plasma progesterone during pregnancy. The specific hypotheses in this dissertation are:

1. Progesterone acts as an antagonist of cortisol at MR and/or reduces MR number in

the pregnant state to reduce the mineralocorticoid action of cortisol in brain.

2. Progesterone doesn't interfere with cortisol effect at GR, but as partial agonist

results in the combined effect of progesterone and cortisol at GR.

By the data shown above, we found that the apparent Kd of cortisol at MR in the

hippocampus is increased by an increase in progesterone concentration, produced either

by pregnancy or progesterone treatment. The increase in apparent Kd is also reflected in

an increase in MR availability in hippocampus in pregnant ewes and in nonpregnant ewes

with chronic progesterone treatment. These changes are not related to the level of

circulating cortisol, and there was no change in GR availability in hippocampus. The

change in MR availability was not due to the level of receptors in vivo since neither

mRNA nor protein level of MR and GR changed. These data are consistent with

competition of progesterone with cortisol for binding at MR, resulting in fewer activated

MR and more unactivated MR available for ligand binding in the cytosolic assay. 5-


84







85


HT1A receptor data didn't show an increase in mRNA expression in ewes with high

progesterone level. There are several possible explanations for this negative result as I

stated in Chapter 5.

These studies therefore support the hypothesis that increased progesterone during

pregnancy reduces the MR-mediated effects of cortisol and progesterone doesn't interfere

the GR-mediated effects of cortisol. This action of progesterone may result in decreased

cortisol feedback effects at the basal level in the hippocampus during pregnancy.
















LIST OF REFERENCES


Abou-Samra,AB, B Loras, M Pugeat, J Tourniaire, J Bertrand, 1984, Demonstration of
an antigluccorticoid action of progesterone on the corticosterone inhibition ofb-
endorphin release by rat anterior pituitary in primary culture: Endocrinology, v. 115, p.
1471-1475.

Albert,PR, Q Y Zhou, H H Van Tol, J R Bunzow, O Civelli, 1990, Cloning, functional
expression, and mRNA tissue distribution of the rat 5-hydroxytryptaminelA receptor
gene: J Biol.Chem., v. 265, p. 5825-5832.

Allolio,B, J Hoffmann, E A Linton, W Winkelmann, M Kusche, H M Schulte, 1990,
Diurnal salivary cortisol patterns during pregnancy and after delivery: relationship to
plasma corticotrophin-releasing-hormone: Clin.Endocrinol.(Oxf), v. 33, p. 279-289.

Aron,DC, A M Schnall, L R Sheeler, 1990, Cushing's syndrome and pregnancy.:
American Journal of Obstetrics and Gynecology, v. 162, p. 244-252.

Aronsson,M, K Fuxe, Y Dong, L F Agnati, S Okret, J A Gustafsson, 1988, Localization
of glucocorticoid receptor mRNA in the male rat brain by in situ hybridization:
Proc.Natl.Acad.Sci.U.S.A, v. 85, p. 9331-9335.

Arriza,JL, R B Simerly, L W Swanson, R M Evans, 1988, The neuronal
mineralocorticoid receptor as a mediator of glucocorticoid response: Neuron, v. 1, p. 887-
900.

Arriza,JL, C Weinberger, G Cerelli, T M Glaser, B L Handelin, D E Housman, R M
Evans, 1987, Cloning of human mineralocorticoid receptor complementary DNA:
structural and functional kinship with the glucocorticoid receptor.: Science, v. 237, p.
268-275.

Barker,PM, D V Walters, M Markiewicz, L B Strang, 1994, Development of the lung
liquid resorptive mechanism in fetal sheep:synergism of triiodothyronine and
hydrocortisone: Journal of Physiology, v. 433, p. 435-449.

Barnes,PJ, I Adcock, 1993, Anti-inflammatory actions of steroids: molecular
mechanisms: Trends Pharmacol.Sci., v. 14, p. 436-441.



86






87

Bell,ME, C E Wood, W M Keller, 1991, Influence of reproductive state on pituitary-
adrenal activity in the ewe: Domest.Anim.Endocrinol., v. 8, p. 245-254.

Bloem,LJ, C Guo, J H Pratt, 1995, Identification of a splice variant of the rat and human
mineralocorticoid receptor genes: J.Steroid Biochem.Mol.Biol., v. 55, p. 159-162.

Bradbury,MJ, S F Akana, M F Dallman, 1994, Roles of type I and II corticosteroid
receptors in regulation of basal activity in the hypothalamo-pituitary-adrenal axis during
the diurnal trough and the peak: evidence for a nanadditive effect of combined receptor
occupation.: Endocrinology., v. 134, p. 1286-1296.

Brooks,VL, L C Keil, 1994, Changes in the baroreflex during pregnancy in conscious
dogs: heart rate and hormonal responses: Endocrinology, v. 135, p. 1894-1901.

Buckingham,JC, 1982, Effects of adrenocortical and gonadal steroids on the secretion in
vitro of corticotrophin and its hypothalamic releasing factor: J Endocrinol, v. 93, p. 123-
132.

Buckingham,JC, J R Hodges, 1977, The use of corticotrophin production by
adenohypophysial tissue in vitro for the detection and estimation of potential
corticotrophin releasing factors: J.Endocrinol., v. 72, p. 187-193.

Burgess,LH, R J Handa, 1992, Chronic estrogen-induced alterations in
adrenocorticotropin and corticosterone secretion, and glucocorticoid receptor-mediated
function in female rats.: Endocrinology, v. 131, p. 1261-1269.

Burnstein,KL, C M Jewell, M Sar, J A Cidlowski, 1994, Intragenic sequences of the
human glucocorticoid receptor complementary DNA mediate hormone-inducible receptor
messenger RNA down-regulation through multiple mechanisms: Molecular
Endocrinology, v. 8, p. 1764-1773.

Caldenhoven,E, T van Dijk, J A Raaijmakers, J W Lammers, L Koenderman, R P De
Groot, 1995, Activation of the STAT3/acute phase response factor transcription factor by
interleukin-5: J.Biol.Chem., v. 270, p. 25778-25784.

Campbell,EA, E A Linton, C D A Wolfe, P R Scraggs, M T Jones, P J Lowry, 1987,
Plasma corticotropin-releasing hormone concentrations during pregnancy and parturition:
Journal of Clinical Endocrinology and Metabolism, v. 64, p. 1054-1059.

Canny,BJ, J W Funder, I J Clarke, 1989, Glucocorticoids regulate ovine hypophysial
portal levels of corticotropin-releasing factor and arginine vasopressin in a stress-specific
manner: Endocrinology, v. 125, p. 2532-2539.






88

Carey,MP, C H Deterd, J deKonig, F Helmerhost, E R DeKloet, 1995, The influence of
ovarian steroids on hypothalamic-pituitary-adrenal regulation in the female rat.:
J.Endocrinol, v. 144, p. 311-321.

Carr,BR, C R Parker, J D Madden, P C MacDonald, J C Porter, 1981, Maternal
adrenocorticotropin and cortisol relationships throughout human pregnancy.: American
Journal of Obstetrics and Gynecology, v. 139, p. 416-422.

Castren,M, V K Patchev, 0 F Almeida, F Holsboer, T Trapp, E Castren, 1995,
Regulation of rat mineralocorticoid receptor expression in neurons by progesterone:
Endocrinology, v. 136, p. 3800-3806.

Chalmers,DT, S P Kwak, A Mansour, H Akil, S J Watson, 1993, Corticosteroids regulate
brain hippocampal 5-HT1A receptor mRNA expression: J Neurosci., v. 13, p. 914-923.

Chalmers,DT, S J Watson, 1991, Comparative anatomical distribution of 5-HTIA
receptor mRNA and 5-HT1A binding in rat brain--a combined in situ hybridisation/in
vitro receptor autoradiographic study: Brain Res., v. 561, p. 51-60.

Chapman,MS, D J Askew, U Kuscuoglu, R L Miesfeld, 1996, Transcriptional control of
steroid-regulated apoptosis in murine thymoma cells: Mol.Endocrinol., v. 10, p. 967-978.

Charney,DS, A Y Deutch, J H Krystal, S M Southwick, M Davis, 1993, Psychobiologic
mechanisms ofposttraumatic stress disorder: Arch.Gen.Psychiatry, v. 50, p. 295-305.

Chou,YC, W G Luttge, 1988, Activated type II receptors in brain cannot rebind
glucocorticoids: relationship to progesterone's antiglucocorticoid actions: Brain Research,
v. 440, p. 67-78.

Christ,M, M Wehling, 1998, Cardiovascular steroid actions: swift swallows or sluggish
snails?: Cardiovasc.Res., v. 40, p. 34-44.

Christianson,RE, 1976, Studies on blood pressure during pregnancy. I. Influence of parity
and age: Am.J.Obstet.Gynecol., v. 125, p. 509-513.

Crandall,ME, C M Heesch, 1990, Baroreflex control of sympathetic outflow in pregnant
rats: effects of captopril: Am.J.Physiol, v. 258, p. R1417-R1423.

Cullinan,WE, J P Herman, S J Watson, 1993, Ventral subicular interaction with the
hypothalamic paraventricular nucleus: evidence for a relay in the bed nucleus of the stria:
J.Comp Neurol., v. 332, p. 1-20.






89


Dallman,MF, S F Akana, C S Cascio, D N Darlington, L Jacobson, N Levin, 1987a,
Regulation of ACTH secretion: Variations on a theme of B.: Recent Progress in Hormone
Research, v. 43, p. 113-173.

Dallman,MF, S F Akana, L Jacobson, N Levin, C S Cascio, J Shinsako, 1987b,
Characterization of corticosterone feedback regulation of ACTH secretion.: Ann-N-Y-
Acad-Sci., v. 512, p. 402-414.

Dallman,MF, F E Yates, 1969, Dynamic asymmetries in the corticosteroid feedback path
and distribution-metabolism-binding elements of the adrenocortical system.PG:
Ann.N.Y.Acad.Sci., v. 156.

Danielsen,M, J P Northrop, J Jonklaas, G M Ringold, 1987, Domains of the
glucocorticoid receptor involved in specific and nonspecific deoxyribonucleic acid
binding, hormone activation, and transcriptional enhancement: Mol.Endocrinol, v. 1, p.
816-822.

de Kloet,ER, J M Reul, 1987, Feedback action and tonic influence of corticosteroids on
brain function: a concept arising from the heterogeneity of brain receptor systems:
Psychoneuroendocrinology, v. 12, p. 83-105.

De Kloet,ER, W Sutanto, N Rots, A van Haarst, B D van den, M Oitzl, A van Eekelen, D
Voorhuis, 1991, Plasticity and function of brain corticosteroid receptors during aging:
Acta Endocrinol.(Copenh), v. 125 Suppl 1, p. 65-72.

Dong,Y, L Poellinger, J A Gustafsson, S Okret, 1988, Regulation of glucocorticoid
receptor expression: evidence for transcriptional and posttranslational mechanisms:
Molecular Endocrinology, v. 2, p. 1256-1264.

Drouin,J, Y L Sun, M Chamberland, Y Gauthier, A De Lean, M Nemer, T J Schmidt,
1993, Novel glucocorticoid receptor complex with DNA element of the hormone-
repressed POMC gene: EMBO J, v. 12, p. 145-156.

Drouin,J, Y L Sun, M Nemer, 1989, Glucocorticoid repression of pro-opiomelanocortin
gene transcription: J.Steroid Biochem., v. 34, p. 63-69.

Drucker,D, S Shumak, A Angel, 1984, Schmidt's syndrome presenting with intrauterine
growth retardation and postpartum addisonian crisis: Am J Obstet Gynecol, v. 149, p.
229-230.

Duncan,MR, G R Duncan, 1979, An in vivo study of the action of antiglucocorticoids on
thymus weight ratio, antibody titre and the adrenal-pituitary-hypothalamus axis.PG -: J
Steroid Biochem., v. 10.






90

Encio,IJ, S D Detera-Wadleigh, 1991, The genomic structure of the human
glucocorticoid receptor: Journal of Biological Chemistry, v. 266, p. 7182-7188.

Eriksson,P, O Wrange, 1990, Protein-protein contacts in the glucocorticoid receptor
homodimer influence its DNA binding properties: J.Biol.Chem., v. 265, p. 3535-3542.

Feldman,S, N Conforti, 1980, Participation of the dorsal hippocampus in the
glucocorticoid feedback effect on adrenocortical activity: Neuroendocrinology, v. 30, p.
52-55.

Froh,DK, P L Ballard, 1994, Fetal Lung Maturation, in GD Thorburn and R Harding
(eds), Textbook of Fetal Physiology: Oxford, Oxford University Press, p. 168-185.

Funder,JW, 1996, Mineralocorticoid receptors and glucocorticoid receptors:
Clin.Endocrinol.(Oxf), v. 45, p. 651-656.

Galigniana,MD, G P Vicent, G Piwien-Pilipuk, G Burton, C P Lantos, 2000, Mechanism
of action of the potent sodium-retaining steroid 11, 19- oxidoprogesterone:
Mol.Pharmacol., v. 58, p. 58-70.

Geller,DS, A Farhi, N Pinkerton, M Fradley, M Moritz, A Spitzer, G Meinke, F T Tsai, P
B Sigler, R P Lifton, 2000, Activating mineralocorticoid receptor mutation in
hypertension exacerbated by pregnancy: Science, v. 289, p. 119-123.

Giguere,V, S M Hollenberg, M G Rosenfeld, R M Evans, 1986, Functional domains of
the human glucocorticoid receptor.: Cell, v. 55, p. 899-906.

Gomez-Sanchez,EP, C E Gomez-Sanchez, 1992, Central mineralocorticoid receptor
antagonism blocks hypertension in Dahl/S/JR rats.: American Journal of Physiology, v.
262, p. E96-E99.

Gomez-Sanchez,EP, M T Venkataraman, D Thwaites, C Fort, 1990, ICV infusion of
corticosterone antagonizes ICV-aldosterone hypertension.: American Journal of
Physiology, v. 258, p. E649-E653.

Gray,JA, 1987, The Psychology of Fear and Stress, University Press, Cambride, MA.

Hammond,GC, J A Nisker, L A Jones, P K Siiteri, 1980, Estimation of the percentage of
free steroid in undiluted serum by centrifugal ultrafiltration-dialysis.: Journal of
Biological Chemistry, v. 255, p. 5023-5025.

Harding,R, 1994, Development of the respiratory system, in GD Thorburn and R Harding
(eds), Textbook of Fetal Physiology: Oxford, Oxford University Press, p. 140-167.






91

Heesch,CM, R C Rogers, 1995, Effects of pregnancy and progesterone metabolites on
regulation of sympathetic outflow.: Clinical and Experimental Pharmacology and
Physiology, v. 22, p. 136-142.

Heisler,LK, H M Chu, T J Brennan, J A Danao, P Bajwa, L H Parsons, L H Tecott, 1998,
Elevated anxiety and antidepressant-like responses in serotonin 5-HT1A receptor mutant
mice: Proc.Natl.Acad.Sci.U.S.A, v. 95, p. 15049-15054.

Hellal-Levy,C, B Couette, J Fagart, A Souque, C Gomez-Sanchez, M Rafestin-Oblin,
1999, Specific hydroxylations determine selective corticosteroid recognition by human
glucocorticoid and mineralocorticoid receptors: FEBS Lett., v. 464, p. 9-13.

Hellal-Levy,C, J Fagart, A Souque, M E Rafestin-Oblin, 2000, Mechanistic aspects of
mineralocorticoid receptor activation: Kidney Int., v. 57, p. 1250-1255.

Hennessy,DP, J P Coghlan, K J Hardy, B A Scoggins, E M Wintour, 1982, The origin of
cortisol in the blood of fetal sheep.: Journal of Endocrinology, v. 95, p. 71-79.

Herman,JP, 1993, Regulation of adrenocorticosteroid receptor mRNA expression in the
central nervous system: Cell Mol.Neurobiol., v. 13, p. 349-372.

Herman,JP, W E Cullinan, 1997, Neurocircuitry of stress: central control of the
hypothalamo-pituitary-adrenocortical axis.: Trends in Neurosciences, v. 20, p. 78-84.

Herman,JP, P D Patel, H Akil, S J Watson, 1989a, Localization and regulation of
glucocorticoid and mineralocorticoid receptor messenger RNAs in the hippocampal
formation of the rat: Molecular Endocrinology, v. 3, p. 1886-1894.

Herman,JP, M K Schafer, E A Young, R Thompson, J Douglass, H Akil, S J Watson,
1989b, Evidence for hippocampal regulation of neuroendocrine neurons of the
hypothalamo-pituitary-adrenocortical axis: J.Neurosci., v. 9, p. 3072-3082.

Herman,JP, R Spencer, 1998, Regulation of hippocampal glucocorticoid receptor gene
transcription and protein expression in vivo: J.Neurosci., v. 18, p. 7462-7473.

Herman,JP, S J Wiegand, S J Watson, 1990, Regulation of basal corticotropin-releasing
hormone and arginine vasopressin messenger ribonucleic acid expression in the
paraventricular nucleus: effects of selective hypothalamic deafferentations:
Endocrinology, v. 127, p. 2408-2417.

Hiroshige,T, S Wada-Okada, 1973, Diurnal changes of hypothalamic content of
corticotropin-releasing activity in female rats at various stages of the estrous cycle:
Neuroendocrinology, v. 12, p. 316-319.






92

Hoeck,W, S Rusconi, B Groner, 1989, Down-regulation and phosphorylation of
glucocorticoid receptors in cultured cells. Investigations with a monospecific antiserum
against a bacterially expressed receptor fragment: J.Biol.Chem., v. 264, p. 14396-14402.

Hollenberg,SM, R M Evans, 1988, Multiple and cooperative trans-activation domains of
the human glucocorticoid receptor: Cell, v. 55, p. 899-906.

Hollenberg,SM, C Weinberger, E S Ong, G Cerelli, A Oro, R Lebo, E B Tompson, M G
Rosenfeld, R M Evans, 1985, Primary structure and expression of a functional human
glucocorticoid receptor cDNA.: Nature, v. 318, p. 635-641.

Hubbard,J, M Kalimi, 1982, Synergistic effect of molybdate plus dithiothreitol on
stabilization, reactivation, and partial purification of the kidney glucocorticoid receptor: J
Biol.Chem., v. 257, p. 14263-14270.

Humphreys,PW, N Joels, 1977, Changes in cardiac output and total peripheral resistance
during the carotid sinus baroreceptor reflex in the pregnant rabbit: J.Physiol, v. 272, p.
45-55.

Hutchison,KA, K D Dittmar, W B Pratt, 1994, All of the factors required for assembly of
the glucocorticoid receptor into a functional heterocomplex with heat shock protein 90
are preassociated in a self-sufficient protein folding structure, a "foldosome":
J.Biol.Chem., v. 269, p. 27894-27899.

Imai,E, J N Miner, J A Mitchell, K R Yamamoto, D K Granner, 1993, Glucocorticoid
receptor-cAMP response element-binding protein interaction and the response of the
phosphoenolpyruvate carboxykinase gene to glucocorticoids: J.Biol.Chem., v. 268, p.
5353-5356.

Ismay,MJA, E R Lumbers, A D Stevens, 1979, The action of angiotensin II on the
baroreflex response of the conscious ewe and the conscious fetus: Journal of Physiology,
v. 288, p. 467-479.

Jacobson,L, R Sapolsky, 1991, The role of the hippocampus in feedback regulation of the
hypothalamic-pituitary-adrenocortical axis: Endocr.Rev., v. 12, p. 118-134.

Joels,M, E R de Kloet, 1994, Mineralocorticoid and glucocorticoid receptors in the brain.
Implications for ion permeability and transmitter systems: Prog.Neurobiol., v. 43, p. 1-36.

Jonat,C, H J Rahmsdorf, K K Park, A C Cato, S Gebel, H Ponta, P Herrlich, 1990,
Antitumor promotion and antiinflammation: down-modulation ofAP-1 (Fos/Jun) activity
by glucocorticoid hormone: Cell, v. 62, p. 1189-1204.




Full Text
81
O 5 10 15 20
Bound
2-|
o
04 i 1 ,
0 10 20 30 40
3H cortisol concentration (nM)
60.
if 40
0 10 20
Bound
Fig.5-2: MR binding curves in representative nonpregnant (top), pregnant (middle), and
nonpregnant progesterone-treated (bottom)
adrenalectomized ewe.
At each upper-right comer, it is the Scatchard plot converted from nonlinear regression data.


13
Some evidence suggests intrinsic receptor properties also contribute to the ability of
this differentiation. Although the MR binds corticosterone and cortisol with a high
affinity, the aldosterone-MR complex is more potent than the cortisol/corticosterone-MR
complex since the half maximal effective dose is approximately 100-fold lower (Lombes
et al., 1994;Rupprecht et al., 1993b). Aldosterone dissociates more slowly from MR than
does cortisol, indicating that the stability of the aldosteome-MR complex is higher than
that of the cortisol-MR complex (Hellal-Levy et al., 1999;Hellal-Levy et al.,
2000;Lombes et al., 1990) and this slow off-rate of aldosterone from MR is responsible
for its high efficiency in stimulating MR transcriptional activity.
2.1.8 MR/GR Mediated Physiological Function of Glucocorticoids
Glucocrticoids are of major importance for maintaining cellular and humoral
homeostasis. They exert these functions by MR and GR.
In the periphery, one of the well-established functions assigned to glucocorticoids is
the control of carbohydrate and lipid metabolism. For example, the glucocorticoids
induce glucose synthesis by activation of gluconeogenesis, and important genes involved
in this process such as glucose-6-phosphatase, phosphoenolpyruvate
carboxykinase(PEPCK), and tyrosine aminotransferase (TAT) have been shown to be
direct targets of glucocorticoids (Ruppert et al., 1990). In the lung, glucocorticoids are
able to promote maturation during development, and in the adrenal gland, they are
involved in the biosynthesis of catecholamines. Furthermore, glucocorticoids participate
in the suppression of inflammatory reactions, which is achieved by repressing mRNA
expression of cytokines and regulation of lymphocyte migration (Barnes and Adcock,
1993). Additionally, glucocorticoids are able to induce apoptosis of thymocytes


9
and to bind closely related DNA target sequences (Arriza et al., 1987). In addition, the
ligand-binding domain contains sequences responsible for heat-shock protein
interactions, nuclear translocation, dimerization and transcription activation function
(AF-2) (Hollenberg and Evans, 1988).
2.1.6 Mechanisms of Action
2.1.6.1 Genomic actions
2.1.6.1.1 DNA binding dependent mechanism
Corticosteroid receptors are nuclear receptors, which are ligand inducible transcription
factors that specifically regulate the expression of target genes. They reside in cytosol
associated with heat shock proteins (hsp)(two molecules of hsp90, one hsp70, one hsp56,
and an immunophilin) (Hutchison et al., 1994;Nathan and Lindquist, 1995;Smith and
Toft, 1993). Glucocorticoids can cross plasma membranes freely. After binding with the
ligand, the receptors will dissociate from heat shock proteins and form dimers (either
homodimer of MRMR/ GRGR or heterodimer of MRGR). The ligand-receptor complex
will then translocate into the nucleus where it binds to pallindromic consensus elements
on promoter sequences of target genes to have effects on the gene transcription
(Aronsson et al., 1988;Eriksson and Wrange, 1990). Depending on either the nature of
the DNA consensus sequence or interactions with other transcription factors, the steroid -
receptor complex can act as either positive or negative regulators of gene expression
(Drouin et al., 1989;Pearce and Yamamoto, 1993;Tsai et al., 1988). Numerous studies
showed that they act at the level of DNA to enhance recruitment of the preinitiation
complex of general transcription factors (GTFs) at target promoters. Liganded receptors
recruit members of the SRC (steroid receptor-coactivator) family, a group of structurally


18
amounts of endogenous corticosterone or cortisol and exogenous synthetic
glucocorticoids on stress-induced HPA activity(Dallman et al., 1987a;Keller-Wood and
Dallman, 1984). GR are abundant in these cells and thought to be involved in this
feedback regulation after stress or stimulation. As described above in section of receptor
localization, MR doesnt show a high expression in these areas. It has highest abundance
in hippocampus. Hippocampus is also an important site in cortisol feedback regulation
since the PVN neurons of hypothalamus receive input from hippocampal neurons.
Hippocampal MRs are important in terms of exerting inhibitory tone over the HPA axis
(see detail in section 2.3 hippocampus and its connection).
There appear to be three major time frames of corticosteroid action: fast (seconds to
minutes), intermediate (hours) and slow (hours to days). These time frames probably are
the consequence of three separate mechanisms of corticosteroid action at feedback-
sensitive sites. MR and GR mediate intermediate and slow feedback inhibition of the axis
in the hippocampus (Jacobson and Sapolsky, 1991), hypothalamus, pituitary, and perhaps
even the adrenal itself (Keller-Wood and Dallman, 1984). The receptors involved in fast
feedback inhibition are unknown.
2.2.2 Fast Feedback
The time of occurrence of fast feedback is not compatible with a nuclear site of
corticosteroid action, and protein synthesis is not required. Dallman and Yates also
postulated that this fast feedback is rate sensitive (Dallman and Yates, 1969).
Glucocorticoid feedback inhibition has been demonstrated to have rapid effects on both
stimulated CRF secretion (Vermes et al., 1977) and stimulated ACTH secretion
(Buckingham and Hodges, 1977;Vale and River, 1977). Although the mechanism of fast
inhibition is unknown, the rapidity of the effect suggests that the effect is on hormone


This dissertation was submitted to the Graduate Faculty of the College of
Medicine and to the Graduate School and was accepted as partial fulfillment of the
requirements for the degree of Doctor of Philosophy.
December 2002
luna/ J- klhamL^
Dean, College of Medicine


10
and functionally related transcriptional coactivators. Receptors also interact with the
transcriptional cointegrators p300 and CBP, which are proposed to integrate diverse
afferent signals at hormone-regulated promoters (McKenna et al., 1999).
2.1.6.1.2 DNA binding independent mechanism
Apart from DNA binding-dependent mechanisms of GR and MRs function, DNA
binding-independent mechanisms are also used by both GR and MR. The studies of
targeted disruption of the GR DNA binding domain suggested that trancriptional
regulation by GR is achieved via DNA-binding dependent as well as independent
mechanims (Jonat et al., 1990;Schule et al., 1990;Yang-Yen et al., 1990). It is the cross
talk between GR, MR and other transcription factors, such as activating protein l(AP-l),
nuclear factor-kB(NF-kB), cAMP-response element binding protein(CREB), GATA-1
and Stat-5 (Caldenhoven et al., 1995;Imai et al., 1993;Stocklin et al., 1996). And we also
know now that not only repression can be exerted by GR/MR via protein-protein
interaction, but also activation can be exerted in this way.
By the studies of receptor with mutation at different region, especially a lot of studies
done with GR, it has been suggested that the HPA axis represents a physiological system
involving different modes of action. On the level of hypothalamus, repression of
corticotropin-releasing factor (CRF) synthesis by the GR is independent of receptor DNA
binding (Reichardt et al., 1998). Since mice with a targeted disruption of the GR gene
showed a dramatic upregulation of CRF in the median eminence (Kretz et al., 1999),
protein-protein interaction is most likely responsible for CRF repression. Possible targets
for such cross-talk are the transcription factors CREB and Nur77; for both, the CRF
promoter contains response elements (Murphy and Conneely, 1997;Seasholtz et al.,


26
2.4.3.2 Progesterone
Progesterones effects on HPA axis is the theme of this whole dissertation. Evidence
suggests that progesterone could antagonize feedback regulation of the HPA axis and has
been thought to act as an anti-corticosteroid. Progesterone administration reduces the
hypertensive effect of aldosterone (Landau and Lugibihl, 1958). In relatively high doses,
progesterone also appears to antagonize corticoid inhibition of CRF and ACTH secretion
(Abou-Samra et al., 1984;Duncan and Duncan, 1979;Jones and Hillhouse, 1976). In the
absence of cortisol, progesterone appears to have partial agonist activity to inhibit CRF
and ACTH (Buckingham, 1982;Vale et al., 1978). In Dr. Keller-Woods lab, data have
shown that acute treatment with progesterone reduced the inhibition of ACTH produced
by infusion of cortisol (Keller-Wood et al., 1988). This effect was found with an infusion
of progesterone that increased plasma progesterone to concentrations within the
physiological range.
It has been shown that progesterone can antagonize MR-mediated effects in vivo
(Spence et al., 1989;Wambach and Higgins, 1979) and in vitro (Jones et al.,
1977;Rupprecht et al., 1993b). Progesterone has very high affinity for the human MR,
but progesterone exerts very low transcriptional activity after binding MR (Rupprecht et
al., 1993b). Progesterone also binds to human GR with an affinity similar to that of
cortisol, and exerts moderate activity after binding, suggesting that progesterone can act
as partial agonist at human GR. Progesterone has an approximately equal affinity
compared to cortisol at the ovine MR and lower affinity for ovine GR. Studies in rats
have suggested that progesterone treatment in vivo alters corticosterone binding at MR
(Carey et al., 1995). We therefore hypothesized that during pregnancy or during chronic
progesterone treatment, progesterone will act as an antagonist to cortisol binding at MR,


50
5 -GGAAGCTCGAATGAGGACTG-3
The antisense downstream primer sequence:
5 -TGTCCCCC AGAGGTACTC AC-3 .
RT-PCR for MR and GR produced products whose sizes were consistent with the
predicted products, respectively.
As a positive control for each RNA preparation, an ovine (3-actin sequence was also
amplified simutaneously in adjacent tube.
The sense upstream primer of ovine (3-actin cDNA sequence:
5 -GAGAAGATGACCCAGATCATGT-3
The antisense downstream primer sequence:
5 -TCCATGCCCAGGAAGGAAG-3
4.1.3 Semi-quantitative RT-PCR
Total RNA (1 jig) was treated with 1U DNase (Promega) at a temperature of 37C for
30 min. The DNase reaction was stopped by incubation at 75C for 5 min before cooling
to 4C. The RNA was then reverse transcribed in buffer containing 50 U of MuLV
reverse transcriptase, ImM each dNTP, 20 U RNase inhibitor and 50 pmol of
oligo(dT)15 primer in a total volume of 20 ju.1 according to the manufacturers protocol
(Perkin-Elmer Gene Amp PCR Core Kit, Perkin-Elmer Co., Foster City, CA ).
Preliminary experiments determined the PCR conditions necessary for amplification of
product to be in the linear range. Briefly, the mixture was incubated for 10 minutes at
25C, then for 30 minutes at 42C. The RT reaction was stopped by incubation at 95C
for 5 minutes. The cDNA sample (10 pi) was used for amplification by specific primer
for MR and GR. PCR reactions were carried out in IX PCR buffer containing 1.0 mM


37
3.2.2 Vascular Catheterization
All ewes had polyvinylchloride catheters (0.090" OD, 0.050" ID) implanted into the
femoral artery and vein at the femoral triangle for steroid delivery and blood sampling.
This method has been previously described in detail (Bell et al., 1991). Briefly, an
incision was made in the femoral triangle, and the artery and vein were exposed. Each
vessel was ligated distally, and a 0.05mm catheter was advanced approximately 10 inches
into the descending aorta or inferior vena cava. Each catheter was secure with surgical
ties, filled with heparinized saline, plugged with a sterile nail, and routed subcutaneously
with a trocar to exit the flank. When not in use, the exteriorized catheters were stored in a
paper pocket and protected by a spandage wrap.
3.3 Chronic Steroid Implantation
In adrenalectomized ewes, cortisol was replaced to the normal nonpregnant level (2-5
ng/ml) by implanting pellets of cortisol hemisuccinate (estimated release of 0.5 mg/kg/d;
Inovative Research, Sarasota, FL). Aldosterone was replaced by infusion of
approximately 3|ig/kg/d. Ewes were treated with progesterone by placement of
subcutaneous implants for 60 days prior to adrenalectomy. Ewes were treated with
25mg/d for 30 days, followed by treatment with 67mg/d for the next 30 days, and
117mg/d from the time of adrenalectomy through the time of sacrifice.
3.4 Tissue Collection
The ewes were killed with an intravenous overdose of pentobarbital under basal
conditions ( at least 3 days after the last experiment). As rapidly as possible, their carotid
arteries were cannulated, jugular veins were cut, and their brains were perfused with
approximately 3L ice-cold isotonic saline containing 10% (v/v) dimethyl sulfoxide


BIOGRAPHICAL SKETCH
Yi Hua got her M.D. from China Medical University in 1997. After one year of
residency training at the Department of Anesthesiology in Peking Union Medical College
Hospital, she came to the United States to pursue her Ph.D. Yi worked with Dr. Charles
Wood and Dr. Maureen Keller-Wood in the Department of Physiology and Functional
Genomics. She completed her Ph.D. training in the area of neuroendocrinology in the fall
of 2002. Her next goal is to become a certified physician in the United States.
105


ACKNOWLEDGMENTS
First of all, I would like to thank my mentors, Dr. Charles Wood and Dr. Maureen
Keller-Wood for their immeasurable guidance, support and dedication to my doctoral
training. They are role models both in academic life and in real life for me. Their
enthusiastic attitude to science and their keen insight always inspired me when I felt in
the darkness of my research.
I am also very thankful to my committee members: Dr. Colin Sumners, Dr. Paul Oh
and Dr. Rosalia Simmen. They gave me a lot of intellectual advice for my project and
they were always there to help when I had any questions.
I thank Dr. Elaine Sumners for her help and patience. She taught me the techniques
step by step when I first came to the lab and gave me daily-basis trouble shooting for the
experiments.
My appreciation also goes to all the members in the lab for their encouragement,
support and friendship which made me confident and felt like I was part of a big family.
I thank my sister from the bottom of my heart for her support and taking care of our
parents during the hard times which made this dissertation possible.
Finally, my deep appreciation goes to my husband for his support, understanding and
love in every single aspect, which helped me achieve this height.
iii


TABLE OF CONTENTS
page
ACKNOWLEDGMENTS iii
ABSTRACT vii
CHAPTER
1 INTRODUCTION 1
2 LITERATURE REVIEW 3
2.1 Corticosteroid and Corticosteroid Receptor 3
2.1.1 General Introduction 3
2.1.2 Pharmacological Characterization 4
2.1.3 Localization 5
2.1.4. Isoforms 6
2.1.4.1. Isoforms of GR 6
2.1.4.2Isoforms of MR 7
2.1.5 Genetic Characterization of MR and GR 8
2.1.6 Mechanisms of Action 9
2.1.6.1 Genomic actions 9
2.1.6.2 Nongenomic action 11
2.1.7 Specificity in Mineraloccorticoid veras Glucocorticoid Action 11
2.1.8 MR/GR Mediated Physiological Function of Glucocorticoids 13
2.1.9 Regulation of Receptors 14
2.1.10 11 (3-Hydroxysteroid Dehydrogenase (11 p-HSD) 16
2.2 Corticosteroid and HPA Axis 17
2.2.1 Introduction 17
2.2.2 Fast Feedback 18
2.2.3 Intermediate and Slow Feedback 19
2.3 Hippocampus and Its Connection 20
2.3.1 Role of Hippocampus in HPA Regulation 20
2.3.2 Hippocampus and Its Connection 21
2.4 Physiological Adaptation During Pregnancy 22
2.4.1 Changes in Cardiovascular Function in Pregnancy 22
2.4.2 Changes in Regulation of Cortisol and ACTH During Pregnancy 23
2.4.2.1 Basal activity 23
2.4.2.2 Feedback sensitivity 24
2.4.3 Role of Ovarian/Placental Steroid 25
IV


47
data is not normally distributed and cannot be analyzed by ANOVA. The null hypothesis
was rejected when P<0.05.


Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy
PROGESTERONE AND CORTICOSTEROIDS INTERACTION DURING
PREGNANCY IN EWES
By
Yi Hua
December, 2002
Chair: Charles E.Wood
Cochair: Maureen Keller-Wood
Major Department: Physiology and Functional Genomics
Adrenal steroids are critical hormones for the maintenance of body homeostasis.
Cortisol and adrenalcorticotropic hormone (ACTH) are strictly regulated by a closed
feedback loop. During pregnancy, both plasma ACTE! and cortisol levels increase in
sheep as well as in humans. This increased level of cortisol is important and necessary for
maternal and fetal normal health. Previous results showed that the set point for regulation
of ACTH and cortisol has been increased during pregnancy. This dissertation is trying to
explain why this set point can be increased and how it works.
Studies in rats showed that ACTH level is controlled by a dual receptor system. At
basal level of cortisol, it is controlled by mineralocorticoid receptor (MR) which has high
affinity and low capacity for corticosteroid. In stimulated situations when cortisol level
increases, it is controlled by glucocorticoid receptor (GR) which has low affinity and high
vii


6
hypothalamus, anterior pituitary and in the hippocmapus (Herman et al., 1989a;Reul and
DeKloet, 1986;Van Eekelen et ah, 1988). The distribution of MR is somewhat more
limited with the highest abundance in pyramidal neurons of the hippocampus (Herman et
ah, 1989a;Reul and DeKloet, 1985), suggesting that whereas GR-mediated feedback is
exerted at multiple sites (including pituitary and hypothalamus, especially PVN), MR-
mediated feedback effects occur primarily in the hippocampus. The localization of MR
and GR is consistent with MR effects mediating tonic, basal control of the axis, and GR
mediating control of stimulated responses. Both MR and GR mRNA exhibit highest
levels of expression in the limbic system, most notably in the hippocampal formation.
However, within hippocampal formation, GR and MR show wide differences in relative
level of abundance. GR mRNA has highest levels in CA1, intermediate levels in dentate
gyrus (DG), and low levels in CA3, whereas MR signal is heaviest in CA2, CA3, is
approximately equal in intensity in CA1 and DG (Aronsson et ah, 1988;Arriza et ah,
1988;Herman et ah, 1989a;Sousa et ah, 1989;Van Eekelen etah, 1988;Yang et ah, 1988).
The picture emerging from these reports is that both the concentration of circulating
corticoids and the cellular availability of the corticosteroid receptor subtypes are critical
in determining how individual cells interpret the corticoid signals
2.1.4. Isoforms
2.I.4.I. Isoforms of GR
In human, there are at least two isoforms of GR that have been identified, GRa and
GR(3. They are the product of alternative splicing of the 3-end of the GR (hGR), which
encodes the ligand binding domain (Encio and Detera-Wadleigh, 1991;Hollenberg et ah,
1985). Translation of GRa and GR(3 produces two proteins identical in the first 727 N-


52
The purified DNA was sent to Interdisciplinary Center for Biotechnology Research
(ICBR) at the University of Florida for sequencing. The sequences obtained were
compared to the previously published ovine GR sequence and the human MR sequence
(ovine MR sequence has not been completely cloned and sequenced) using BLAST. The
results of the BLAST search showed the PCR product for GR was 100% homologous to
the published ovine glucocorticoid receptor sequence (Yang et al., 1992). The PCR
product for MR was 90% homologous to the human MR (Arriza et al., 1987). This
confirmed the PCR products were from GR and MR mRNA.
4.2 Real-Time RT-PCR
4.2.1 RNA Extraction and Sample Preparation
RNA extraction from tissue for real-time RT-PCR is the same as that used for regular
RT-PCR, except that the RNA pellet after ethanol washing was dissolved in 200ul
RNAsecure Resuspension Solution (Ambion, Inc. Austin, TX). The RNAsecure
Resuspension Solution helped to stabilize RNA and to prevent RNA degradation in thaw
freezing cycle and sample handling procedure. After that, RNA was immediately treated
with DNase (Promega)(lU/ug RNA) at a temperature of 37C for 30 min in the presence
of reaction buffer. The DNase activity was stopped by incubation at 65C for 10 min by
adding stop solution (half volume of DNase) before cooling to 4C. Then the quantity of
total RNA extracted was measured spectrophotometrically. The RNA was stored in many
aliquots and for use in the real-time RT-PCR.


72
5.4 Discussion
An increased concentration of plasma progesterone, induced either by pregnancy or
progesterone administration, increased the number of available MR in sheep
hippocampus, and decreased the affinity of those sites for cortisol. These results support
and extend our previous observations that MR availability in the hippocampus is
increased during ovine pregnancy (Roesch and Keller-Wood, 1999). This increase in
availability is not predicted from consideration of plasma cortisol and aldosterone
concentrations, given that circulating free concentrations of both are increased in the
pregnant state. This suggested that another ligand antagonized cortisol binding to MR in
hippocampus during pregnancy. In present study, we used progesterone-treated ewes to
mimic the pregnant state to test the hypothesis that it is the progesterone during
pregnancy that caused this change. To avoid the possible confounding effects of
differences in plasma corticosteroids, the animals were adrenalectomized and treated with
a low dose of cortisol and aldosterone.
Since activated steroid receptors will not rebind ligand under the conditions used in
our assay, the measure of receptor availability in our study presumably reflects an inverse
change in receptor activation. This would suggest that progesterone reduce MR
occupancy and activation in hippocampus in vivo.. The affinity of MR for progesterone
is similar to that of cortisol and corticosterone (Rupprecht et al., 1993b); in the present
studies the estimated concentration of free progesterone during pregnancy is several fold
higher than that of cortisol or aldosterone. It would therefore be expected that
progesterone would competitively inhibit cortisol binding to MR. If progesterone acts as
an antagonist at MR, then the apparent Kd for the receptor for cortisol should be
increased. In this study, we found a significant positive linear relationship between the


22
homeostatic functions, such as the PVN (Cullinan et al., 1993;Moga et al., 1989;Weller
and Smith, 1982).
In summary, hippocampus plays an important role in regulation of HP A axis. Under
basal conditions, MRs mediate tonic inhibitory effects of in HPA activity, whereas under
condition of elevated cortisol level, the GR mediates the negative feedback to restrain
HPA drive (de Kloet and Reul, 1987). Hippocampus has its input to PVN of
hypothalamus via GABA containing neurons. It has its inhibitory effects by stimulating
GAB Anergic neurons.
2.4 Physiological Adaptation During Pregnancy
Pregnancy involves profound changes in the hormones and tissues of the reproductive
axis and tract. However, pregnancy also induces changes in cardiovascular function and
in hormones involved in regulating pressure, volume and blood flow, including the renin-
angiotensin system, vasopressin and the HPA axis.
2.4.1 Changes in Cardiovascular Function in Pregnancy
During pregnancy blood volume is increased by 20-50% and cardiac output is
increased proportionately. Mean arterial pressure is decreased, reflecting decreased
peripheral resistance (Christianson, 1976;Metcalfe and Parer, 1966). This is accompanied
by a decrease in vascular responses to pressor agents (Longo, 1983). There is evidence in
a number of species that baroreflex control of blood pressure is altered in the pregnant
state (Brooks and Keil, 1994;Crandall and Heesch, 1990;Heesch and Rogers,
1995;Humphreys and Joels, 1977;Ismay et al., 1979); the baroreceptors regulate pressure
about the lower set-point with reduced sensitivity. Hormone responses to hypotension
and to hemorrhage are altered by pregnancy (Brooks and Keil, 1994); there is a decreased
response to hypotension, but the response to volume loss occurs with a smaller percent


74
transcriptional activity of MR through a progesterone receptor (PR-A) mediated effect
(McDonnell et al., 1994).
In sheep, the change in MR availability in the hippocampus during pregnancy or by
progesterone treatment cannot be accounted for by the increase in cortisol binding to
binding globulin, since corticosteroid binding globulin (CBG) levels do not increase
during pregnancy or with steroid treatments (Lindner, 1964;Rosenthal et al., 1969).
Consistent with this, there was no significant difference in the percentage of free cortisol
in plasma with pregnancy in this study, nor were the changes in MR availability or
apparent affinity related to concentrations of free cortisol. The change is also not
accounted for by an increase in metabolism of cortisol to cortisone by 113-
hydroxysteroid dehydrogenase. We have measured 11 (3- hydroxysteroid dehydrogenase
activity in several brain regions and found that its activity was below or at the limit of
detection in hippocampus in nonpregnant or pregnant ewes (Kim et al., 1995).
Since availability of MR could also be increased by an effect of progesterone on the
synthesis or expression of MR, we also measured MR mRNA and protein levels for MR
in hippocampus following progesterone treatment and during pregnancy. Despite the
change in availability, the protein and mRNA levels were not significantly different
during pregnancy or with progesterone treatment. This suggests that the change in
availability is related to presence of a competitive antagonist, which would increase
apparent Kd, decrease MR activation and increase receptor availability, rather than to a
change in MR expression. However, it is possible that there are either regional or splice-
variant selective changes in MR and GR which would not be detected with the methods
used.


29
knockout of the 5-HT1A receptor gene results in mice with increase anxiety-related
behaviors (Heisler et al., 1998;Parks et ah, 1998;Ramboz et ah, 1998).
In this project, we use 5-HT1A receptor as an indicator for MR or GR mediated
effects in hippocampus. Since we proposed that progesterone acts as an antagonist of
cortisol at MR to reduce the action of cortisol in brain, we expected to see that the
suppression effects of cortisol at 5-HT1A receptor would be reduced.
2.6 Animal Models
Sheep are widely used in endocrine physiological studies, in particular in the study of
reproductive and adrenal gland control mechanisms. Sheep also offer a good model for
maternal physiology during pregnancy. In sheep, as in humans, the maternal adrenal
cortex is more active in secretion of cortisol during pregnancy than during the
nonpregnant state. During ovine and human pregnancy, maternal plasma cortisol
concentration approximately doubles (Bell et ah, 1991;Nolten and Rueckert, 1981). On
the other hand, the fetal adrenal cortex is inactive as a source of corticosteroids until late
gestation. It has been calculated, in ovine and primate models, that transfer of cortisol
from the mother to the fetus, therefore, accounts for most (90 to 95%) plasma cortisol
measured in the fetus before the time of fetal adrenal gland maturation (approximately
0.8 of gestation (Hennessy et ah, 1982;Pepe and Albrecht, 1984), approximately day 125
in sheep). In fact, fetal adrenalectomy before that time does not appreciably reduce
cortisol concentration in the fetal circulation (Ray et ah, 1988). Study of the role of high
maternal cortisol concentration as a mediator of maternal and fetal cardiovascular and
fluid homeostasis is therefore of interest. Also, there are several aspects of the HPA in
sheep are similar to human physiology, for example, secretion of cortisol as the major
glucocorticoid hormone by the adrenal, and the inability to survive after adrenalectomy


33
hMR
A/B C D E
Fig. 2-1: Schematic representation of the structures of the human MR (hMR) and
GR (hGR) with the percentage of amino acid identity appearing between each of
the domains (A-E); the figure has been adapted from Arriza et al., 1987.


58
AAGCCTCTTC TTTTACCGGA CGCTAAGCCT AAAATTAAAG
AT A AT GG AG A TTTGATCTTA CCAAGTCCTA ACAGTGTGCC ACTGCCCCAA
GTGAAAACAG AAAAAGAAGA TTTTATCGAA CTCTGCACCC CTGGGGTAAT
TAAGCAGGAG AAACTGGGCC CAGTTTATTG TCAGGCCAGC TTTCCTGGGG
CCAACATAAT TGGCAATAAA ATGTCTGCCA TTTCTGTTCA TGGTGTGAGT
ACCTCTGGGG GACAA.
The MR sequence obtained was:
AGAAAAGGGT TGATCCCAGC GCTGCCATCT CCCGGCCTTG GGGCTCCCCA
GCTCTAGCTT TTAGGTTTTG GAAAAGAATA CGATTTCACT GAGTACCTGT
TGATTATCAT CACTTTTCCA AGATTAATTT GGCCTCTATT CAAAGCAGTT
TATTTAGTGC AATCATATTA AGTTTCCCCA AAG AT AT AT A TATATATGTT
TGTGATTTGG GGCAAGAGAA AAAGCCATAC ATTGCATCAG TGC.
The sequences obtained were compared to the previously published ovine GR sequence
and the human MR sequence (ovine MR has not been completely cloned and sequenced)
using BLAST. The results of the BLAST search showed the PCR product for GR was
100% homologous to the published ovine glucocorticoid receptor sequence (Yang et al.,
1992). The PCR product for MR was 90% homologous to the human MR (Arriza et al.,
1987). This confirmed the PCR products were from GR and MR mRNA.
4.3.4 Discussion
Although upregulation of rodent hippocampal MR and GR mRNA after
adrenalectomy has been documented (Herman and Spencer, 1998;Patel et al., 1992), we
did not detect the changes in the adrenalectomized sheep. There might be several reasons
for this difference. First, it is possible that the regulation of the system may be different in
the two species. In addition, adrenalectomized rats can be maintained for at least two


56
study, receptor-binding assay was used to estimate of the total number of receptors when
cortisol level was close to zero. This is a parameter difficult to directly determine for
steroid receptors because of the inability of activated receptors to rebind steroid under the
conditions used in binding assays (Chou and Luttge, 1988;Galigniana et al., 2000). This
provides both a maximum binding capacity for comparison with other, more physiologic
states, and allows an estimation of the percent occupancy of the MR and GR at
physiologic concentrations of steroid. Knowing whether there is a regulation of receptor
in condition of acute withdrawal of steroid or complete absence of steroid is a useful
information when interprtate the data from receptor-binding assay.
4.3.2 Methods
Ten adult female sheep of mixed breed were randomly assigned to two groups. The
first group was ovariectomized and sham-adrenalectomized (adrenal-intact, ADI). The
second group was ovariectomized and adrenalectomized (adrenalectomized, ADX)
according to previously published protocols (Keller-Wood et al., 1998). The
adrenalectomized ewes were maintained on replacement infusions of cortisol and
aldosterone for one week after surgery to allow them to recover from the surgical stress.
The replacement steroid infusions (0.33 mg/kg/d cortisol and 2.88 pg/kg/d aldosterone)
were then withdrawn from the adrenalectomized ewes and their blood pressure and blood
potassium levels were measured as previously described (Orbach et al., 2001). Once the
ewes showed signs of hypoadrenocorticism, defined as mean arterial blood pressure
below 75 mm Hg and /or serum potassium above 6 mEq/dL, the ewes were killed with an
overdose of pentobarbitol. Sham-adrenalectomized ewes were killed at the same time
after surgery as the adrenalectomized animals. Their brains were perfused with ice-cold


2
regulation when the cortisol concentration increases (Bradbury et al., 1994;Reul et al.,
1987). The localization of MR and GR is also consistent with MR effects mediating
tonic, basal control of the axis, and GR mediating control of stimulated responses. GR is
distributed in all the brain regions, but MR has highest abundance in the hippocampus
(Herman et ah, 1989a;Reul and DeKloet, 1985), suggesting that whereas glucocorticoid
feedback is exerted at multiple sites (including hypothalamus and pituitary), MR-
mediated feedback effects occur primarily in the hippocampus, which regulates basal
ACTH through inhibitory connections to the paraventricular nucleus (PVN) (Herman and
Cullinan, 1997).
It has been shown that progesterone can antagonize MR-mediated effects in vivo
(Wambach and Higgins, 1979;Spence et ah, 1989) and in vitro (Jones et ah,
1977;Rupprecht et ah, 1993). Progesterone has very high affinity for the human MR, but
progesterone exerts very low transcriptional activity after binding MR (Rupprecht et ah,
1993b). Progesterone also binds to human GR with an affinity similar to that of cortisol,
and exerts moderate activity after binding, suggesting that progesterone can act as partial
agonist at human GR. Progesterone has an approximately equal affinity compared to
cortisol at the ovine MR and lower affinity for ovine GR. Studies in rats have suggested
that progesterone treatment in vivo alters corticosterone binding at MR (Carey et ah,
1995). We therefore hypothesized that during pregnancy or during chronic progesterone
treatment, progesterone will act as an antagonist to cortisol binding at MR, reducing MR
availability and increasing the apparent Kd of MR for cortisol in hippocampal cytosol.


5
than the MR for corticosterone and cortisol (~5nM) and two-fold lower affinity for
aldosteome (~10nM) (Reul et al., 1990). In human, the GR has a lower affinity for
cortisol (15nM) than MR and much lower affinity for corticosterone (40nM) and
aldosterone (63nM) (Rupprecht et al., 1993b). In sheep, the GRs affinity for cortisol is
also lower than MR (0.7nM) and its affinity for aldosterone is even lower (10.2nM).
Therefore, GR is much less occupied at basal level of cortisol, but occupation increases
with the increase of cortisol concentration after internal or external stimulation. So, GR
shows its effects more when the cortisol level is relatively high. In our lab, we measured
and estimated that approximately 90% of MR and 30% of GR are occupied at the basal
steroid level in adrenal intact ewes. This difference in affinity and occupancy of the two
receptor subtypes has led to the hypothesis that MR is more involved in the regulation of
the basal level of cortisol at the feedback sites, while GR participates in the feedback
regulation when cortisol level increases (Bradbury et al., 1994;Reul et al., 1987).
2.1.3 Localization
By in situ hybridization and immunohistochemistry, different labs localized the MR
and GR in central nervous system and peripheral tissues. GR is widely expressed in most
cell types whereas MR expression is restricted to epithelial cells in kidney, colon and the
salivary glands, and non-epithelial cells in brain and heart (Reichardt and Schtz, 1998).
In the periphery, access of cortisol and corticosterone to MR is prevented by a pre
receptor mechanism (see section on 11 (3-HSD) and as a consequence,
cortisol/corticosterone binding to MR mainly plays a role in the brain. In the brain, GR is
widely distributed in a large number of CNS nuclei with higher concentrations in regions
involved in the stress response such as the paraventricular nucleus (PVN) of the


80
c
'o
O
1
Q_
O)
E
To
o
o
E
x
CD
E
C
CC.
ADX ADX ADX+P4
NonPreg Preg
Intact Intact
Fig.5-1 MR binding parameters in ovine hippocampus with pregnancy or progesterone
treatment. Kd and Bmax of MR for cortisol in pregnant and nonpregnant adrenal-intact
ewes (right, upper and lower panels), and in pregnant, nonpregnant and nonpregnant,
progesterone-treated adrenalectomized (ADX) ewes (left, upper and lower panels).
Data are shown as mean SEM. indicates significantly different from nonpregnant
animals in same corticosteroid treatment group (ie adrenal-intact or ADX).


30
without corticosteroid replacement. Further, the average gestation period for sheep is
about 150 days, which is much longer than rats or mice and long enough to allow chronic
adaptation of pregnancy to occur.
2.7 Significance
Inadequate control of glucocorticoid responses may lead to a severe threat to the
health and well-being of the organism. Hypersecretion of glucocorticoids can promote the
development of physiologic and psychological dysfunction. For example, inappropriate
regulation of stress has been implicated in the pathogenesis of systemic disease (such as
colitis, asthma, hypertension)(McEwen and Stellar, 1993), affective disorders (such as
depression, post-traumatic stress disorder)(Chamey et al., 1993;Kathol et al., 1989)and
neurodegenerative disease (such as Alzheimers disease).(Landfield and Eldridge, 1991).
Also, the increase of levels of cortisol and ACTH is very important for normal maternal
and fetal homeostasis. Hyper- or hypocorticism during pregnancy may result in an
increased incidence of fetal death or abortion (Aron et al., 1990;O'Shaughnessy and
Hackett, 1984;Pickard et al., 1990). Risk of maternal death also increases significantly
according to clinic case reports and animal experiments (Drucker et al., 1984;Seaward et
al., 1989). The adrenocortical system is very critical for the maintenance of
cardiovascular homeostasis (Loriaux, 1990;Mantero and Boscaro, 1992). Increases or
decreases in adrenocortical activity may lead animals or human beings to suffer from
disturbance of the cardiovascular system. In the clinic, these disturbances are shown in
Cushings and Addison's diseases. In Cushings disease, which is a hypercortisolism
state, patients have symptoms of hypertension, and the blood volume increases which
leads to edema. In Addison's disease, patients have symptoms of hypotension, caused by
decreased glucocorticoid effects on vascular reactivity which can be reversed by cortisol


83
10.0-1
NP Adx P Adx
NPAdx+P4
Fig. 5-4 5-HT1A receptor mRNA level measured by real-time RT-PCR in hippocampus.
Top panel: comparison of mRNA in two adrenal intact groups. There was no significant
difference by unpaired t test
Bottom panel: comparison of mRNA in three ADX groups. There was no significant
difference by one way ANOVA.
Data was showed by delta Ct, which is the difference between Ct of 5-HT1A receptor and Ct
of rRNA from the same sample.


76
response to chronic, dramatic increases or decreases in corticosteroids, but in the
pregnant state, in the presence of both corticosteroids and estrogen, the overall effects of
progesterone on steady-state levels of MR mRNA and GR mRNA are minimal.
We did not detect any significant change of 5-HT1A receptor mRNA level in
hippocampus among five groups, while we expected that suppression of 5-HT1A receptor
by cortisol would be attenuated by progesterone if progesterone antagonize cortisol
effects in vivo in sheep. In three ADX groups, the levels of plasma cortisol are all at the
similar range. If progesterone antagonize MR mediated cortisol activity, the ewes with
higher progesterone level (group 4 and 5) would have a higher 5-HT1A receptor mRNA.
There are several possible reasons to explain this discrepancy. First, in our experiment,
cortisol levels were at the range of normal nonpregnant level (2-5ng/ml). It is possible
that this level is too low to have the effects on 5-HT1A receptor gene expression.
Neumaier and his colleagues detected regulation of 5-HT1A receptor mRNA in rat in
hippocampus by corticosteroids at the level of 25-30 ng/ml (Neumaier et al., 2000). If no
regulation occurred at the low, normal level of cortisol, progesterone would not have
effects on 5-HT1A receptor mRNA. Seceond, no previous studies have been done on
sheep. Suppression of 5-HT1A receptor by corticosteroid were reported in rats or
cultured hippocampal cells. There might be species different on gene regulation. Third,
progesterone might have its own effects on 5-HT1A receptor by progesterone receptor.
Both cortisol and progesterone effects may work on gene regulation of 5-HT1A receptor
and net effects might be zero. Further studies need to be done to really explain the effects
of cortisol and progesterone action on this 5-HT1A receptor gene regulation.


OD PCR product/OD
P-actin (arbitrary units)
Ethidium bromide-stained PCR products for MR, GR and P-actin from ADI or ADX sheep kidney
STD AB C ABCABC A BCABC ABCABCABCABCAB
<4 ADI (n=5)
-4
ADX (n=5)

MR- and GR- specific PCR products in
kidney of ADI and ADX ewes
ADI
ADX
Fig. 4-2: Total RNA isolated from kidney of adrenal-intact
or adrenalectomized ewes was subjected to RT-PCR with
primers specific for MR,GR or P-actin.
Top panel: gel showing RT-PCR products from 5 adrenal-
intact (ADI) and 5 adrenalectomized (ADX) ewes. The
arrows beneath the scan indicate ADI and ADX ewes.
A=GR, B=MR C=P-actin. The arrow indicated the 500bp
marker in a 100 bp ladder (Promega). The PCR product for
MR was 277 bp, for GR was 275 bp, and for P-actin was
461 bp.
Bottom panel: Mean data for ADI vs ADX animals, n=5
per group, normalized to P-actin. The data shown in the top
panel were normalized to P-actin in each individual ewe;
the mean normalized data is shown in this panel. There
were no significant differences between ADI and ADX
ewes (by t test).
OS
u>


99
Pompeiano,M, J M Palacios, G Mengod, 1992, Distribution and cellular localization of
mRNA coding for 5-HT1A receptor in the rat brain: correlation with receptor binding: J
Neurosci., v. 12, p. 440-453.
Ramboz,S, R Oosting, D A Amara, H F Kung, P Blier, M Mendelsohn, J J Mann, D
Brunner, R Hen, 1998, Serotonin receptor 1A knockout: an animal model of anxiety-
related disorder: Proc.Natl.Acad.Sci.U.S.A, v. 95, p. 14476-14481.
Ray,ND, C S Turner, N M Rawashdeh, J C Rose, 1988, Ovine fetal adrenal gland and
cardiovascular function.: American Journal of Physiology, v. 254, p. R706-R710.
Reagan,LP, B S McEwen, 1997, Controversies surrounding glucocorticoid-mediated cell
death in the hippocampus: J.Chem.Neuroanat., v. 13, p. 149-167.
Redei,E, L Li, I Halasz, R F McGivem, F Aird, 1994, Fast glucocorticoid feedback
inhibition of ACTH secretion in the ovariectomized rat: effect of chronic estrogen and
progesterone.PG -: Neuroendocrinology, v. 60.
Rees,LH, C W Burke, T Chard, S W Evans, A T Letchworth, 1975, Possible placental
origin of ACTH in normal human pregnancy: Nature, v. 254, p. 620-622.
Reichardt,HM, K H Kaestner, J Tuckermann, O Kretz, O Wessely, R Bock, P Gass, W
Schmid, P Herrlich, P Angel, G Schtz, 1998, DNA binding of the glucocorticoid
receptor is not essential for survival: Cell, v. 93, p. 531-541.
Reichardt,HM, G Schtz, 1998, Glucocorticoid signallingmultiple variations of a
common theme: Mol.Cell Endocrinol., v. 146, p. 1-6.
Reichardt,HM, F Tronche, S Berger, C Kellendonk, G Schtz, 2000, New insights into
glucocorticoid and mineralocorticoid signaling: lessons from gene targeting:
Adv.Pharmacol., v. 47, p. 1-21.
Reul,JM, E R de Kloet, F J van Sluijs, A Rijnberk, J Rothuizen, 1990, Binding
characteristics of mineralocorticoid and glucocorticoid receptors in dog brain and
pituitary: Endocrinology, v. 127, p. 907-915.
Reul,JM, P T Pearce, J W Funder, Z S Krozowski, 1989, Type I and type II corticosteroid
receptor gene expression in the rat: effect of adrenalectomy and dexamethasone
administration: Molecular Endocrinology, v. 3, p. 1674-1680.
Reul,JMH, E R DeKloet, 1985, Two receptor system for corticosterone in rat brain:
microdistribution and differential occupation.: Endocrinology, v. 117, p. 2505-2511.


67
To test our hypothesis, we used saturation binding assay to determine the Kd of MR
for cortisol in hippocampus and measured receptor availability for MR and GR. mRNA
and protein level were also measured for MR and GR. Finally, 5-HT1A receptor were
used as an indicator for MR/GR mediated action in hippocampus. Expression of 5-HT1A
receptor has been shown to be suppressed by cortisol in hippocampus. If progesterone
indeed antagonizes MR mediated effects of cortisol, this suppression would be
attenuated. Real-time PCR was used to meausre the mRNA of 5-HT1A receptor in
hippocampus.
5.2 Materials and Methods
In order to compare the effects of pregnancy and progesterone on mineralocorticoid
receptor mediated function, twenty-five adult female sheep, including ten pregnant and
fifteen nonpregnant, were studied in five experimental groups. Group (1) were
nonpregnant, sham-adrenalectomized and ovariectomized ewes. Group (2) were
pregnant, sham- adrenalectomized ewes. Group (3) were nonpregnant, adrenalectomized
and ovariectomized ewes. Group (4) were pregnant, adrenalectomized ewes. Group (5)
were nonpregnant, adrenalectomized ewes chronically treated with progesterone. Data
from one adrenalectomized pregnant ewe was excluded from analysis because both MR
and GR binding and protein levels were all markedly lower than all other animals (20-
40%), suggesting degradation of the receptors in the cytosol preparation.
The adrenalectomy and ovariectomy were performed according to previously
published protocols(Keller-Wood et al., 1998) as described in Methods(Pecins-Thompson
and Keller-Wood, 1994). Steroid implantation was performed to keep the cortisol and
aldosterone at a low, consistent level (2-5 ng/ml, 20-40pg/ml respectively). Ewes in


88
Carey,MP, C H Deterd, J deKonig, F Helmerhost, E R DeKloet, 1995, The influence of
ovarian steroids on hypothalamic-pituitary-adrenal regulation in the female rat.:
J.Endocrinol, v. 144, p. 311-321.
Carr,BR, C R Parker, J D Madden, P C MacDonald, J C Porter, 1981, Maternal
adrenocorticotropin and cortisol relationships throughout human pregnancy.: American
Journal of Obstetrics and Gynecology, v. 139, p. 416-422.
Castren,M, V K Patchev, O F Almeida, F Holsboer, T Trapp, E Castren, 1995,
Regulation of rat mineralocorticoid receptor expression in neurons by progesterone:
Endocrinology, v. 136, p. 3800-3806.
Chalmers,DT, S P Kwak, A Mansour, H Akil, S J Watson, 1993, Corticosteroids regulate
brain hippocampal 5-HT1A receptor mRNA expression: J Neurosci., v. 13, p. 914-923.
Chalmers,DT, S J Watson, 1991, Comparative anatomical distribution of 5-HT1A
receptor mRNA and 5-HT1A binding in rat braina combined in situ hybridisation/in
vitro receptor autoradiographic study: Brain Res., v. 561, p. 51-60.
Chapman,MS, D J Askew, U Kuscuoglu, R L Miesfeld, 1996, Transcriptional control of
steroid-regulated apoptosis in murine thymoma cells: Mol.Endocrinol., v. 10, p. 967-978.
Chamey,DS, A Y Deutch, J H Krystal, S M Southwick, M Davis, 1993, Psychobiologic
mechanisms of posttraumatic stress disorder: Arch.Gen.Psychiatry, v. 50, p. 295-305.
Chou,YC, W G Luttge, 1988, Activated type II receptors in brain cannot rebind
glucocorticoids: relationship to progesterone's antiglucocorticoid actions: Brain Research,
v. 440, p. 67-78.
Christ,M, M Wehling, 1998, Cardiovascular steroid actions: swift swallows or sluggish
snails?: Cardiovasc.Res., v. 40, p. 34-44.
Christianson,RE, 1976, Studies on blood pressure during pregnancy. I. Influence of parity
and age: Am.J.Obstet.Gynecol., v. 125, p. 509-513.
Crandall,ME, C M Heesch, 1990, Baroreflex control of sympathetic outflow in pregnant
rats: effects of captopril: Am.J.Physiol, v. 258, p. R1417-R1423.
Cullinan,WE, J P Herman, S J Watson, 1993, Ventral subicular interaction with the
hypothalamic paraventricular nucleus: evidence for a relay in the bed nucleus of the stria:
J.Comp Neurol., v. 332, p. 1-20.


35
Hypothalamus
Fig. 2-3: Hippocampal regulations of HPA axis


91
Heesch,CM, R C Rogers, 1995, Effects of pregnancy and progesterone metabolites on
regulation of sympathetic outflow.: Clinical and Experimental Pharmacology and
Physiology, v. 22, p. 136-142.
Heisler,LK, H M Chu, T J Brennan, J A Danao, P Bajwa, L H Parsons, L H Tecott, 1998,
Elevated anxiety and antidepressant-like responses in serotonin 5-HT1A receptor mutant
mice: Proc.Natl.Acad.Sci.U.S.A, v. 95, p. 15049-15054.
Hellal-Levy,C, B Couette, J Fagart, A Souque, C Gomez-Sanchez, M Rafestin-Oblin,
1999, Specific hydroxylations determine selective corticosteroid recognition by human
glucocorticoid and mineralocorticoid receptors: FEBS Lett., v. 464, p. 9-13.
Hellal-Levy,C, J Fagart, A Souque, M E Rafestin-Oblin, 2000, Mechanistic aspects of
mineralocorticoid receptor activation: Kidney Int., v. 57, p. 1250-1255.
Hennessy,DP, J P Coghlan, K J Hardy, B A Scoggins, E M Wintour, 1982, The origin of
cortisol in the blood of fetal sheep.: Journal of Endocrinology, v. 95, p. 71-79.
Herman,JP, 1993, Regulation of adrenocorticosteroid receptor mRNA expression in the
central nervous system: Cell Mol.Neurobiol., v. 13, p. 349-372.
Herman, JP, W E Cullinan, 1997, Neurocircuitry of stress: central control of the
hypothalamo-pituitary-adrenocortical axis.: Trends in Neurosciences, v. 20, p. 78-84.
Herman,JP, P D Patel, H Akil, S J Watson, 1989a, Localization and regulation of
glucocorticoid and mineralocorticoid receptor messenger RNAs in the hippocampal
formation of the rat: Molecular Endocrinology, v. 3, p. 1886-1894.
Herman,JP, M K Schafer, E A Young, R Thompson, J Douglass, H Akil, S J Watson,
1989b, Evidence for hippocampal regulation of neuroendocrine neurons of the
hypothalamo-pituitary-adrenocortical axis: J.Neurosci., v. 9, p. 3072-3082.
Herman, JP, R Spencer, 1998, Regulation of hippocampal glucocorticoid receptor gene
transcription and protein expression in vivo: J.Neurosci., v. 18, p. 7462-7473.
Herman, JP, S J Wiegand, S J Watson, 1990, Regulation of basal corticotropin-releasing
hormone and arginine vasopressin messenger ribonucleic acid expression in the
paraventricular nucleus: effects of selective hypothalamic deafferentations:
Endocrinology, v. 127, p. 2408-2417.
Hiroshige,T, S Wada-Okada, 1973, Diurnal changes of hypothalamic content of
corticotropin-releasing activity in female rats at various stages of the estrous cycle:
Neuroendocrinology, v. 12, p. 316-319.


32
feedback mechanism is altered in pregnancy, allowing chronic increases in cortisol
secretion rate. I have hypothesized that the placental steroid progesterone acts to cause
the changes in regulation of the hypothalamus-pituitary-adrenal axis which result in the
increased plasma cortisol levels and contributes to the changes in cardiovascular
homeostasis in pregnancy. Cortisol and aldosterone exert glucocorticoid and
mineralocorticoid effects via action at MR and GR. Cortisol and other steroids, such as
progesterone, bind to both GR and MR. There is in vitro evidence that progesterone acts
as mineralocorticoid receptor antagonist, and I hypothesize that this results in decreased
MR mediated action, although the plasma concentration of cortisol and aldosterone
increases. It allows the effect of decreased blood pressure in the presence of increased
aldosterone and cortisol and causes a reduced negative feedback on basal ACTH (which,
in turn, allows chronic increases in plasma cortisol concentration). I will investigate the
action of these steroids using a molecular biology approach to the study of the steroid
receptors. Specifically I will test the following hypotheses:
1. Progesterone acts as an antagonist of cortisol at MR and/or reduces MR number in
the pregnant state to reduce the action of cortisol in brain.
2. Progesterone doesnt interfere with cortisol effect at GR, but as an agonist results in
the combined effect of progesterone and cortisol at GR.


46
3.7.5 (3-actin Western Blotting Method
A (3-actin antibody was used to reprobe the membrane after MR and GR bands were
detected to assure that equal amounts of protein was loaded in each lane and equally
transferred to the membrane. After quantification of the MR or GR bands the membrane
was stripped at 57C for 20 minutes with 2% SDS, 62.5mM Tris-HCL PH=6.8 and
lOOmM /?-mercaptoethonol. Then it was washed with PBST 6 times for 5 minutes each.
The membrane was blocked in 10% non-fat dried milk in PBST. 1% BSA at room
temperature for 2 hours. Anti /Tactin antibody (A5441, Sigma, St.Louis, Missouri) at
1:100,000 in PBST 1%BSA was incubated with the blot for 1 hour at room temperature.
The blot was then incubated with peroxidase linked secondary antibody (A9044) at a
dilution of 1:16,000 in PBST. 1% BSA for 1 hours at room temperature. After washing,
(3-actin bands were detected using similar methodology as that used for MR and GR
3.8 RT-PCR
See Chapter 4 for details.
3.9 Statistic Analysis
The values of hormone concentration, Bmax of MR/GR, and Kd of MR were
analyzed by analysis of variance (ANOVA). Individual means were compared by
Newman-Keuls multiple comparison test. For Western blotting, samples from the two
adrenal-intact groups were loaded in one gel, and the samples from adrenalectomized
groups were run in another gel. The results of densitometric analysis of the blots for MR
and GR were analyzed by unpaired t test for two groups of adrenal intact ewes and by
ANOVA for the three groups of adrenalectomizd ewes. The ACt calculated from real
time RT-PCR was analyzed by ANOVA; the fold change is not a linear variable so that


51
MgC12, 0.2 mM each dNTP, 0.15 p,M primers and 1.25 U ofTaq DNA polymerase. The
cycling program was 95C for 30 seconds for denaturation, 55C for 1 minute for
annealing and 72C for 1 minute for elongation for 31 cycles. After the end of 31st cycle,
we allowed an additional 10 minutes for extension. The PCR bands were separated by
electrophoresis on 1% agarose gels containing ethidium bromide and visualized under
UV transillumination. The density of PCR bands were determined using a densitometer
and image analysis software (Bio-Rad, Hercules, CA).
4.1.4 PCR Product Purification and Sequencing
To get the primer and probe for real-time PCR, the specific ovine sequence of MR and
GR had to be obtained. Ovine GR sequence was available in published paper (Yang et al.,
1992), but the ovine MR sequence was not available. We sequenced the PCR product of
MR from regular RT-PCR and used that piece of sequence to design the primer and probe
for real-time PCR of MR RNA.
At the end of the PCR cycle, the solution of PCR product was collected and purified
by Wizard PCR Preps DNA Purification System (Promega, Madison, WI). According to
the protocol, the PCR reaction was transferred to a clean microcentrifuge tube, 100 pi of
direct Purification Buffer was added into 30-300 pi of the PCR reaction, and then 1 ml of
resin was added and vortexed. The mixture was filtered through a Minicolumn, and 2ml
of 80% isopropanol was used to washed the column. The Minicolumn was then
transferred to a 1.5ml microcentrifuge tube and centrifuged it for 2 minutes at 10,000 x g
to dry the resin. Finally, the DNA in the column was eluted with 50 pi of water with a 20
seconds spin at 10,000 x g.


A dedication to my parents, for their love and believing in me.


59
weeks by supplying salt water to drink. However, increased sodium intake is not a
sufficient treatment for adrenalectomized sheep or human. Secondly, it is possible that
our method of examining a large portion of the hippocampus masked any regional
changes within the hippocampus. Some regions may have undergone upregulation of the
receptors due to lack of steroid, while other regions of the hippocampus, where steroid is
required to keep the cells viable, may have undergone apoptosis. It has been proposed
that MR mediate cell survival in the hippocampus, and adrenalectomy results in loss of
cells in dentate gyrus (Reagan and McEwen, 1997;Woolley et al., 1991). In this situation,
the average receptor number or message or protein would appear to be unchanged by
steroid, whereas in fact, regulation may have occurred in subregions.
4.4 MR Expression in Late-Gestation Ovine Fetal Lung
4.4.1 Introduction
The role of the glucocorticoid, such as cortisol and betamethasone in accelerating the
maturation of the lung and in production of surfactant is well known (Froh and Ballard,
1994). It has been widely used in clinics. GR has been found in fetal lungs late in
gestation and are localized in alveolar type II cells which produce surfactant, as well as
fibroblasts and epithelial cells. However, studies showed that corticosteroids may also
participate in reabsorption of lung liquid at birth in fetal sheep and guinea pigs.(Barker et
al., 1994; Harding, 1994). Aldosterone or cortisol alone both significantly decrease the
rate of lung liquid production. This effects of aldosterone and cortisol suggests that MR ,
which has high affinity with aldosterone and cortisol, may mediate this effect.
In this study, we exam MR gene expression in the fetal lung by using both
semiquantitative RT-PCR and real-time RT-PCR. This is the part of the whole study
which also include examing the relative location of the Na/K ATPase isoform in lung. In


CHAPTER 5
ALTERATION OF MINERALOCORTICOID RECEPTOR FUNCTION BY
PREGNANCY AND PROGESTERONE
5.1 Introduction
As described in the Literature Review, studies in our laboratory in sheep have shown
that the set point for the feedback regulation of basal plasma cortisol concentration is
increased during pregnancy(Keller-Wood, 1998). This would allow the basal plasma
concentration of cortisol to be maintained at a higher level without suppression of ACTH,
whereas further increases in cortisol concentration would suppress plasma ACTH
concentration, as it does in nonpregnant sheep. However, the mechanism of the normal
pregnancy-induced increase in set point for cortisol is still unknown.
Also as previously described in Literature Review, it has been shown that
progesterone can antagonize MR-mediated effects in vivo (Spence et al., 1989;Wambach
and Higgins, 1979) and in vitro (Jones et al., 1977;Rupprecht et al., 1993b). Progesterone
has very high affinity for the human MR, but it exerts very low transcriptional activity
after binding MR (Rupprecht et al., 1993b). In sheep, progesterone has an approximately
equal affinity compared to cortisol at the MR and lower affinity for ovine GR
(unpublished data).
We therefore hypothesized that elevated progesterone acts as an antagonist to cortisol
binding at MR, reducing MR availability and increasing the apparent Kd of MR for
cortisol in hippocampal cytosol. This results in the up-regulation of set-point for
regulation of cortisol during pregnancy since MR-mediated effects have been decreased.
66


95
Lombes,M, S Kenouch, A Souque, N Farman, M E Rafestin-Oblin, 1994, The
mineralocorticoid receptor discriminates aldosterone from glucocorticoids independently
of the 11 beta-hydroxysteroid: Endocrinology, v. 135, p. 834-840.
Longo,LD, 1983, Maternal blood volume and cardiac output during pregnancy: a
hypothesis of endocrinologic control: American Journal of Physiology, p. R720-R729.
Loriaux,DL, 1990, Adrenocortical Insufficiency, in KL Becker (ed), Principles and
Practice of Endocrinology and Metabolism: Philadelphia, JB Lippincott Co., p. 600-604.
MacLusky,NJ, E J Roy, M Shanabrough, A J Eisenfeld, 1986, Preservation of steroid
receptors in frozen brain and pituitary tissue: use of the cryoprotective agent,
dimethylsulfoxide: J.Neurosci.Methods, v. 16, p. 131-140.
Magarinos,AM, G Somoza, A F De Nicola, 1987, Glucocorticoid negative feedback and
glucocorticoid receptors after hippocampectomy in rats: Horm.Metab Res., v. 19, p. 105-
109.
Mantero,F, M Boscaro, 1992, Glucocorticoid-dependent hypertension: J Steroid
Biochem.Mol.Biol., v. 43, p. 409-413.
McDonnell,DP, M M Shahbaz, E Vegeto, M E Goldman, 1994, The human progesterone
receptor A-form functions as a transcriptional modulator of mineralocorticoid receptor
transcriptional activity: J.Steroid Biochem.Mol.Biol., v. 48, p. 425-432.
McEwen,BS, E R de Kloet, W Rostene, 1986, Adrenal steroid receptors and actions in
the nervous system: Physiol Rev., v. 66, p. 1121-1188.
McEwen,BS, R M Sapolsky, 1995, Stress and cognitive function: Curr.Opin.Neurobiol.,
v. 5, p.205-216.
McEwen,BS, E Stellar, 1993, Stress and the individual. Mechanisms leading to disease:
Arch.Intem.Med., v. 153, p. 2093-2101.
McGaugh,JL, L Cahill, B Roozendaal, 1996, Involvement of the amygdala in memory
storage: interaction with other brain systems: Proc.Natl.Acad.Sci.U.S.A, v. 93, p. 13508-
13514.
McKenna,NJ, J Xu, Z Nawaz, S Y Tsai, M J Tsai, B W O'Malley, 1999, Nuclear receptor
coactivators: multiple enzymes, multiple complexes, multiple functions: J.Steroid
Biochem.Mol.Biol., v. 69, p. 3-12.


16
2.1.10 11 P-Hydroxysteroid Dehydrogenase (11 P-HSD)
There is an enzyme called 11 P-Hydroxysteroid dehydrogenase (11 P-HSD). It plays
an important role in controlling the local tissue concentration of cortisol. Two distinct
isoforms of 11 P-HSD have been identified, 11 P-HSD type 1 and type 2. (Michael et al.,
1997;Tetsuka et al., 1997). 11 P-HSD type 2 primarily catalyzes the reaction in one
direction, resulting in the conversion of physiological glucocorticoids (cortisol in human
and sheep, corticosterone in rats) to inactive 11-keto products (cortisone, 11-
dehydrocorticosterone) (Seckl, 1993). 11 P-HSD type 1 is bi-directional (Monder and
White, 1993) and has a relatively low affinity (in the uM range) for cortisol and
corticosterone. It appears to proceed in the direction favoring conversion of cortisone to
cortisol or 11-dehydrocorticosterone to corticosterone at physiological glucocorticoid
concentration (Mercer et al., 1993;Michael et al., 1997;Monder and Lakshmi, 1989;Seckl,
1993). As a result, 11 P-HSD type 1 appears to inactivate glucocorticoids only when
circulating concentrations are high (Seckl, 1993). This isoform exists in the liver of most
species and the brain of species including the sheep and human (Seckl, 1993). The
relative expression of the two types of 11 P-HSD in specific organs modifies cortisol
exposure by interconversion between active and inactive glucocorticoids. Cortisone or
11-dehydrocorticosterone do not bind to or activate receptors, and thus controls
corticosteroids access to receptors in a tissue specific manner. 11 P-HSD type 2
colocalizes with MR, protects MR from cortisol and lets MR combine with aldosterone in
the kidney of most species (Funder, 1996), so that in the kidney, most of MRs are
occupied by aldosterone instead of cortisol. Deficiency of 11 P-HSD type 2 in humans
leads to the syndrome of apparent mineralocorticoid excess (SAME), in which cortisol


17
illicitly occupies MR, causing sodium retension, hypokalemia, and hypertension. In rats
this enzyme is also present in the brain (Lakshmi et al., 1991), but in ewes, there is no
detectable 11 (3-HSD type 2 activity in brain. In the ovine brain it is thought that
conversion is in the opposite direction, from cortisone to cortisol (Kim et al., 1995) and it
is catalyzed by 11 (3-HSD type 1. This results in the possibility that MR is not protected
in the brain and cortisol can have an action via MR in the brains of sheep.
2.2 Corticosteroid and HPA Axis
2.2.1 Introduction
Glucocorticoid secretion of the adrenal cortex is stimulated by pituitary release of
ACTH, which is one of the end products generated from the large precursor molecule,
pro-opiomelanocortin (POMC). ACTH, in turn, is under the control of a number of
hypothalamic releasing and inhibiting factors, of which CRF and vasopressin (VP) are
the best known. Both peptides are colocalized in parvocellular neurons of the
paraventricular nucleus (PVN) which project to the median eminence and release the
peptides in the portal vessel system (Plotsky et al., 1991). The parvocellular PVN neurons
receive information from numerous brain regions, such as nuclei of limbic system, brain
stem nuclei and the suprachiasmatic nuclues. Hypothalamic PVN appears to be the
crucial focus for central regulation of the HPA axis.
Levels of corticosteroids are tightly regulated by the closed feedback loop of HPA axis
(Fig 2-2). It is regulated at a set point by cortisol negative feedback on ACTH and CRF
(Dallman et al., 1987a). Small physiological increases in plasma cortisol suppress ACTH
in a logarithmic manner (Keller-Wood and Dallman, 1984). The pituitary corticotrophs
and the parvocellular PVN are well-established targets for the suppressive action of high


54
4.2.3 Real-time RT-PCR
4.2.3.1 Mixture
The reaction was performed in an ABI Prism 5700 sequence detector (Applied
Biosystems) using a Taqman One-Step RT-PCR Master Mix Reagents kit (Applied
Biosystems) and following the protocol laid out therein except that the reaction volume
was 25 ul. 2.5ul RNA was mixed with 12.5 ul 2X master mix 0.625ul 40X multiScribe
reverse transcriptase/RNase inhibitor mix, forward primer, reverse primer and Taqman
probe with addition of water in a total volume of 25 ul.
4.2.3.2 Primer, probe and starting RNA concentration
Initial experiments defined primer, probe and starting RNA concentration for the
mRNA being measured. For each gene, we optimized the primer concentration from 50-
900nM and probe concentration from 50-250nM. We select the primer and probe
concentration which gave the lowest Ct and highest ARn. After these optimizations, we
performed validation experiment by using increasing amount of RNA input for interested
gene and rRNA to verify that they had the same amplificatin efficiency. The final
concentrations of primer and probe for MR were: 400nM forward primer, 800nM reverse
primer and 150nM probe. The final concentrations of primer and probe for GR were: 900
nM each of forward and reverse primer, 100 nM probe. The final concentrations of
primer and probe for 18s rRNA, which was used as internal control for normolization of
the samples variation were: 50nM each of forward primer and reverse primer, 200nM
probe. lOOng RNA was added for MR, lOng RNA was added for GR and 0.5ng RNA
was added for rRNA in each reaction.


57
isotonic saline containing 10% (v/v) DMSO (Sigma, St.Louis, MO). This served to
protect the receptors during during freezing and to remove any blood borne
corticosteroid-binding globulin (CBG) (MacLusky et al., 1986). The brains were
dissected and frozen in a dry ice-acetone bath, and then stored at -80C until assay.
4.3.3 Results
4.3.3.1 Semi-Quantitative analysis of mRNA for MR and GR
MR and GR in hippocampus and kidney were compared between the ADX group and
control groups using semi-quantitative RT-PCR. Sequence analysis of the products
showed that the GR product was 100% homologous to the published ovine GR sequence.
The MR product was 90% identical to the human MR sequence. Hence we believe that
the PCR products were derived from the RNA for GR and MR.
There was no significant difference between steady-state mRNA levels in the
hippocampus of control or adrenalectomized ewes for either MR or GR (Figure 4-1;
relative optical densities MR: 0.920.29 in ADX versus 0.730.10 in ADI; GR:
0.900.10 in ADX versus 0.980.26 in ADI; n=5 in each group). There was also no
significant difference in steady-state levels of mRNA for either receptor in the kidneys of
these animals (GR: 0.950.12 in ADX and 1.040.10 in ADI; MR: 0.730.19 in ADX
and 0.900.15 in ADI; n=5 in each group; Figure 4-2).
4.3.3.2 Sequence of PCR product of MR and GR
Since no ovine MR has been cloned, we sent the products of the PCR reactions to
ICBR DNA sequencing core labs in the University of Florida. At the same time, we can
also check if the product is the product we expected.
The GR sequence obtained was:


8
ligand receptor complex would be expected to bind various genetic response elements
with varying affinity and efficacy.
2.1.5 Genetic Characterization of MR and GR
The amino acid sequences of the two proteins are highly homologous and their
structural and functional domains are similar (Arriza et al., 1987). Both receptors are
considered to be divided into functional domains designated domains A through F. The
DNA-binding domain is mapped to the well conserved middle region (C domain) of the
receptor. The less conserved carboxy-terminal E/F domain is the ligand binding domain.
The amino terminus is A/B domain. The amino terminal region contains an autonomous
activation function, AF-1. It was thought to be a key element in transactivation together
with AF-2, which is located at carboxy-terminal domains. The amino terminus varies in
size and bares no structural homology among the MR and GR. In human, the N-terminal
region of MR and GR has only 15% homology. This difference seems to be a critical
determinant for the different efficiency in stimulating gene expression by MR and
GR(Arriza et al., 1987;Arriza et al., 1988;Hollenberg et al., 1985;Rupprecht et al.,
1993b). In the GR, this region contains a stronger transactivation function than MR and is
necessary for efficient stimulation of gene transcription (Danielsen et al., 1987;Giguere et
al., 1986;Hollenberg and Evans, 1988). It has been shown that MR exerts a less
pronounced stimulation of transcription rate than the GR and does not show synergistic
activity on promoters containing two copies of a pallindromic binding site (Rupprecht et
al., 1993a). However, the carboxy-terminal ligand binding domain (57% identity in
human) and the cysteine rich zinc finger DNA binding domain (94% identity in human)
are highly homologous (Arriza et al., 1987) (Fig 2-1). These structural similarities allow
the two receptors to have similar steroid binding and activation profiles (Rupprecht et al.,


44
fmol/mg protein and was not significantly altered by any of the treatments, hence it is not
reported here.
3.7 Western Blot Analysis
An aliquot of the cytosolic preparations from hippocampus of individual ewes was
analyzed by Western blot for the total amount of GR and MR proteins present in the
preparation. This allowed differentiation of changes in the level of 3H-cortisol binding
due to increases in receptor protein from increases in the level of available receptor.
3.7.1 Tissue Preparation
Tissues were prepared in the same way as in receptor binding assay. Prior to gel
electrophoresis, samples were diluted in Laemmli (Laemmli, 1970) reducing loading
buffer (0.0625M Tris-HCL, 10% glycerol (v/v), 2% SDS (w/v), 0.72 M (3-
mercaptoethanol and 0.001% bromophenol blue) and heated in boiling water for 5
minutes.
3.7.2 Electrophoresis and Transfer
60 pg (for MR) or 40 pg (for GR) of cytosol protein prepared from hippocampus was
separated by size on 7.5% Tris-HCl gels (Biorad, Hercules, CA) by SDS-PAGE at 200
V. After electrophoresis, the proteins were transferred to 0.45 pm nitrocellulose
membranes (Biorad, Hercules, CA) for 1 hour at 100V. The membrane was washed
once with phosphate buffered saline containing 0.5% Tween 20 (PBST) and left to dry
overnight. The membrane was wetted with PBST on the day of staining.
3.7.3 MR Western Blotting Method
For detection of MR the blot was blocked in 5% non-fat dried milk in PBST
containing 1 % bovine serum albumin (Sigma #7638, Sigma, St. Louis MO) for 3 hours
at room temperature. Primary antibody (N17, SC 6860, Santa Cruz Biotechnologies Inc.,


38
(DMSO, Sigma, St. Louis, MO). This served to protect the receptors during freezing and
to remove any blood-borne corticosteroid-binding globulin (CBG) (MacLusky et al.,
1986). The brains were quickly removed, and specific brain areas were disseccted and
frozen in liquid nitrogen. Then they were stored at -80C until assay. All studies were
approved by the Institutional Animal Care and Use Committee of the University of
Florida and were in compliance with NIH guidelines for the use of animals in research.
3.5 Collecting Blood Samples and Measurement
3.5.1 Sampling and Storage
At the time of sacrifice (immediately prior to the injection of pentobarbital), a blood
sample was taken for measurements of plasma cortisol, aldosterone and progesterone.
Blood samples were collected in tubes containing sodium EDTA (0.015 M, for analysis
of hormones). The whole blood samples were placed on ice until the end of the
experiment. Samples were then centrifuged, and plasma aliquots were stored at -20C
until analysis.
3.5.2 Hormones: Cortisol, Aldosterone and Progesterone
Plasma cortisol was measured by radioimmunoassay with an antibody raised in our
laboratory (Wood et al., 1993). The lower limit of detection in the assay is 0.4 ng/ml
using an 0.05ml aliquot of plasma. Plasma progesterone and aldosterone were measured
by radioimmunoassay using kits obtained from Diagnostic Products Corp. (Los Angeles,
CA). The lower limit of detection of the progesterone assay is 100 pg/ml using a 0.1 ml
aliquot of plasma. The antibody used does not bind the adrenal steroids. The lower limit
of detection of the aldosterone assay is 12.5 pg/ml using 400ul plasma.


70
these differences were not statistically significant. There was, however, a statistically
significant relationship between total plasma progesterone concentration and MR
availability (r=0.57, p<0.003, n=24), and free plasma progesterone concentration and MR
availability (r=0.56, P0.004; n=24).
There were no differences in Bmax for GR between pregnant and nonpregnant (85.2
10.3 vs 91.9 7.0 fmol/mg protein, respectively) adrenal-intact ewes, or among
nonpregnant, pregnant and nonpregnant-progesterone-treated ewes (90.5 10.4, 84.9
14.4, 93.3 6.9 fmol/mg protein, respectively)
5.3.3 Apparent Kd of MR with Cortisol in Hippocampus
To determine if progesterone was acting as an antagonist in vivo, we measured the
apparent Kd for 3H cortisol in hippocampal cytosols using a saturation binding assay
followed by nonlinear regression analysis (Figure 5-2). Pregnancy or progesterone
treatment increased the apparent Kd of MR in the adrenalectomized ewes (Figure 5-1,
upper left). There was also a significant difference in the apparent Kd of MR between
nonpregnant and pregnant adrenal-intact ewes (Figure 5-1, upper right). There was no
significant difference between the apparent Kd of MR in hippocampus of
adrenalectomized ewes who were pregnant versus progesterone treated. Overall, there
was a strong positive linear relationship between progesterone level and the apparent Kd
of MR using data from all 5 groups, indicating reduced affinity of cortisol at MR with
increasing total plasma progesterone concentrations (r =0.85, p<0.0001, n=15) or free
plasma progesterone concentrations (r =0.84, p<0.0001, n=15). There was not a
significant relationship between either total or free plasma cortisol concentration and the
apparent Kd (p=0.09 and p=0.27, respectively).


39
3.5.3 Free Cortisol and Progesterone
Free cortisol and progesterone were estimated using a modification of the equilibrium
dialysis method of Hammond (Hammond et al., 1980). Aliquots of plasma were
incubated at 39C with 3H-cortisol or 3H-progesterone and l4C-glucose for one hour, and
bound and free steroid were separated by centrifugation at 800 g for 2 minutes at 39C
using 30,000 MW exclusion filters (Centrifree; Millipore Corp, Bedford, MA); although
the separation method was modified, the requirement for equilibrium was maintained by
adjusting separation conditions so that only a small quantity of the total volume was
filtered (approximately 35 pi out of 400 pi). The relative ratio of 3H/I4C in filtrate (lower
chamber) as compared to the non-filtered sample (upper chamber of filtration device) is
an estimate of the percent free steroid in the sample.
3.6 Receptor Binding Assays
Receptor binding assays were performed with 3H-cortisol, using a modification of the
method used by Reul et al for determination of binding in brain (Reul and DeKloet,
1985).
3.6.1 General Methodology
3.6.1.1 Tissue preparation
Cytosol was prepared from hippocampus according to previously published protocols
(Roesch and Keller-Wood, 1999).Briefly, hippocampus was homogenized using a motor-
driven Teflon pestle and glass tube (Wheaton Science Products) in a reducing
homogenization buffer (RHB) which contained 10 mM Tris-HCL, pH 7.4, 10 mM
sodium molybdate, 2mM ethylenediaminetetraacetic acid, 10% (v/v) glycerol, 4 mM
dithiothreitol and 4mM (3-mercaptoethanol. The components of this buffer have been


101
Schmidt,TJ, A S Meyer, 1994, Autoregulation of corticosteroid receptors. How, when,
where, and why?: Receptor, v. 4, p. 229-257.
Schule,R, P Rangarajan, S Kliewer, L J Ransone, J Bolado, N Yang, I M Verma, R M
Evans, 1990, Functional antagonism between oncoprotein c-Jun and the glucocorticoid
receptor: Cell, v. 62, p. 1217-1226.
Seasholtz,AF, R C Thompson, J O Douglass, 1988, Identification of a cyclic adenosine
monophosphate-responsive element in the rat corticotropin-releasing hormone gene:
Mol.Endocrinol, v. 2, p. 1311-1319.
Seaward,PG, F Guidozzi, E W Sonnendecker, 1989, Addisonian crisis in pregnancy.
Case report: Br J Obstet Gynaecol, v. 96, p. 1348-1350.
SecklJR, 1993, 11 beta-hydroxysteroid dehydrogenase isoforms and their implications
for blood pressure regulation: Eur.J.Clin.Invest, v. 23, p. 589-601.
Sheppard,KE, J L Roberts, M Blum, 1990, Differential regulation of type II
corticosteroid receptor messenger ribonucleic acid expression in the rat anterior pituitary
and: Endocrinology, v. 127, p. 431-439.
Smith,DF, D O Toft, 1993, Steroid receptors and their associated proteins:
Mol.Endocrinol., v. 7, p. 4-11.
Sousa,RJ, N H Tannery, E M Lafer, 1989, In situ hybridization mapping of
glucocorticoid receptor messenger ribonucleic acid in rat brain: Molecular
Endocrinology, v. 3, p. 481-494.
Spence,CD, A F Reid, J P Coghlan, E H Mills, J A Whitworth, B A Scoggins, 1989,
Progesterone antagonizes development but not maintenance of ACTH-induced
hypertension in sheep.: Clinical and Experimental Pharmacology and Physiology, v. 16,
p. 659-669.
Stocklin,E, M Wissler, F Gouilleux, B Groner, 1996, Functional interactions between
Stat5 and the glucocorticoid receptor: Nature, v. 383, p. 726-728.
Suda,T, M Iwashita, F Tozawa, T Ushiyama, N Tomori, H Demura, K Shizume, 1988,
Characterization of corticotropin-releasing hormone binding protein in human plasma by
chemical cross-linking and its binding during pregnancy.: Journal of Clinical
Endocrinology and Metabolism, v. 67, p. 1278-1283.


90
EncioJJ, S D Detera-Wadleigh, 1991, The genomic structure of the human
glucocorticoid receptor: Journal of Biological Chemistry, v. 266, p. 7182-7188.
Eriksson,P, O Wrange, 1990, Protein-protein contacts in the glucocorticoid receptor
homodimer influence its DNA binding properties: J.Biol.Chem., v. 265, p. 3535-3542.
Feldman,S, N Conforti, 1980, Participation of the dorsal hippocampus in the
glucocorticoid feedback effect on adrenocortical activity: Neuroendocrinology, v. 30, p.
52-55.
Froh,DK, P L Ballard, 1994, Fetal Lung Maturation, in GD Thorbum and R Harding
(eds), Textbook of Fetal Physiology: Oxford, Oxford University Press, p. 168-185.
Funder,JW, 1996, Mineralocorticoid receptors and glucocorticoid receptors:
Clin.Endocrinol.(Oxf), v. 45, p. 651-656.
Galigniana,MD, G P Vicent, G Piwien-Pilipuk, G Burton, C P Lantos, 2000, Mechanism
of action of the potent sodium-retaining steroid 11, 19- oxidoprogesterone:
Mol.Pharmacol., v. 58, p. 58-70.
Geller,DS, A Farhi, N Pinkerton, M Fradley, M Moritz, A Spitzer, G Meinke, F T Tsai, P
B Sigler, R P Lifton, 2000, Activating mineralocorticoid receptor mutation in
hypertension exacerbated by pregnancy: Science, v. 289, p. 119-123.
Giguere,V, S M Hollenberg, M G Rosenfeld, R M Evans, 1986, Functional domains of
the human glucocorticoid receptor.: Cell, v. 55, p. 899-906.
Gomez-Sanchez,EP, C E Gomez-Sanchez, 1992, Central mineralocorticoid receptor
antagonism blocks hypertension in Dahl/S/JR rats.: American Journal of Physiology, v.
262, p. E96-E99.
Gomez-Sanchez,EP, M T Venkataraman, D Thwaites, C Fort, 1990, ICV infusion of
corticosterone antagonizes ICV-aldosterone hypertension.: American Journal of
Physiology, v. 258, p. E649-E653.
Gray,JA, 1987, The Psychology of Fear and Stress, University Press, Cambride, MA.
Hammond,GC, J A Nisker, L A Jones, P K Siiteri, 1980, Estimation of the percentage of
free steroid in undiluted serum by centrifugal ultrafiltration-dialysis.: Journal of
Biological Chemistry, v. 255, p. 5023-5025.
Harding,R, 1994, Development of the respiratory system, in GD Thorbum and R Harding
(eds), Textbook of Fetal Physiology: Oxford, Oxford University Press, p. 140-167.


104
Wood,CE, T A Cudd, C Kane, K Engelke, 1993, Fetal ACTH and blood pressure
responses to thromboxane mimetic U46619: American Journal of Physiology, v. 265, p.
R858-R862.
Woolley,CS, E Gould, R R Sakai, R L Spencer, B S McEwen, 1991, Effects of
aldosterone or RU28362 treatment on adrenalectomy-induced cell death in the dentate
gyrus of the adult rat: Brain Res., v. 554, p. 312-315.
Yang,G, M F Matocha, S I Rapoport, 1988, Localization of glucocorticoid receptor
messenger ribonucleic acid in hippocampus of rat brain using in situ hybridization:
Molecular Endocrinology, v. 2, p. 682-685.
Yang,K, G L Hammond, J R G Challis, 1992, Characterization of an ovine glucocorticoid
receptor cDNA and developmental changes in its mRNA levels in the fetal sheep
hypothalamus, pituitary, and adrenal gland.: J.Mol.Endocrinol., v. 8, p. 173-180.
Yang-Yen,HF, J C Chambard, Y L Sun, T Smeal, T J Schmidt, J Drouin, M Karin, 1990,
Transcriptional interference between c-Jun and the glucocorticoid receptor: mutual
inhibition of DNA binding due to direct protein-protein interaction: Cell, v. 62, p. 1205-
1215.
Zennaro,MC, M C Keightley, Y Kotelevtsev, G S Conway, F Soubrier, P J Fuller, 1995,
Human mineralocorticoid receptor genomic structure and identification of expressed
isoforms: Journal of Biological Chemistry, v. 270, p. 21016-21020.


79
Table 5-2 MR and GR Protein and mRNA in hippocampus
Receptor Protein
(OD*mm2)*
Receptor mRNA
(fold change)**
MR
GR
MR
GR
Adrenal-Intact (sham)
Nonpregnant
0.64 0.05
14.9 2.1
1 (0.6-1.6)
1 (0.7-1.4)
Pregnant
0.66 0.05
13.4 3.2
0.4 (0.2-0.8)
0.6 (0.4-0.9)
Adrenalectomized
Nonpregnant
0.88 0.14
11.8 2.4
0.9 (0.6-2.3)
0.5 (0.3-0.7)
Pregnant
0.72 0.17
10.2 1.9
0.6 (0.4-1.1)
0.9 (0.7-1.0)
Nonpregnant + P4
1.11 0.22
13.0 1.4
0.9 (0.6-1.3
0.7 (0.5-0.8)
Data expressed as mean SEM
* Data expressed as mean SEM of adjusted volume(OD*mm2) above background SEM
** Data for receptor mRNA are expressed as fold change relative to nonpregnant adrenal
intact; the range is indicated in parentheses.


41
Expected binding by 3H-cortisol
Tube contents
GR
MR
CBG
NSB
3H-cortisol
X
X
X
X
3H-cortisol +
50x RU 28362
X
X
X
JH-cortisol +
500x
dexamethasone
X
X
3H-cortisol +
500x cortisol
X
Note: NSB= non specific binding
X in the cell stands for the binding by 3H-cortisol at the specific site
Calculation Equations:
Specific GR binding = total binding ( of 3H-cortisol )-binding in the
presence of excess RU28362
Specific MR binding = binding in the presence of excess RU28362-
binding in the presence of excess of dexamethasone
Specific CBG binding = binding in the presence of excess dexamethasone-
binding in the presence of excess cortisol
Steroid ligands were made fresh from stock ethanol solutions, dried in glass tubes in
Jouan evaporating centrifuge (Jouan Inc, Winchester, VA) and then resuspended in
binding buffer (RHB). The solvent of the 3H-cortisol (Amersham, Arlington Heights, IL)
was evaporated under a gentle air stream and diluted in binding buffer before addition to
the tubes. All components of the binding reaction were mixed in the glass tubes with


INTACT
MR: 110 kDa
1212121212
ADX
345345345345345
GR: 97 kDa
* NP *P
OO
Figure 5-3: Western blot images for MR (top) and GR (bottom) in hippocampal cytosol.
Lanes in the MR immunoblot are identified as :
1, samples from nonpregnant adrenal-intact ewes
2, samples from pregnant adrenal-intact ewes
3, samples from nonpregnant adrenalectomized ewes
4, samples from pregnant adrenalectomized ewes
5, samples from nonpregnant progesterone-treated adrenalectomized ewes
Lanes in the GR immunoblot are idnetified as:
NP, nonpregnant; P, pregnant; NP+P4, nonpregnant progesterone-treated.
Samples from adrenal-intact ewes are shown in panels on the left, those from adrenalcetomized ewes on the right.


71
5.3.4 MR and GR Protein Levels and mRNA Expression in Hippocampus
Since we detected differences in receptor availability among the different groups of
sheep, we examined if these changes were partly due to changes in the total amount of
receptor protein or MR and GR gene expression. We used Western blot analysis to
measure the protein level of MR and GR in cytosol of hippocampus for each animal.
There was no significant difference between the nonpregnant intact group and pregnant
intact group (Figure 5-3 and Table 5-2). There was also no significant difference among
the three groups of adrenalectomized ewes (Table 5-2).
We also examined the mRNA expression for MR or GR using the real-time RT-PCR
method (Table 5-2). There was no significant difference among the groups in steady state
levels of MR or GR mRNA in hippocampus.
5.3.5 5-HT1A Receptor mRNA Level in Hippocampus
The cDNA product of the RT-PCR experiments was sequenced and the sequence
obtained was compared to the human 5-HT1A receptor sequences using BLAST,
the sequence obtained was:
CCCCGGCGCG CCGCTGCGCT CATCTCGCTC ACCTGGCTCA TTGGCTTCCT
CATCTCCATC CCGCCCATGC TGGGCTGGCG CACCCCGGAA GACCGCTCGG
ACCCGGACGC GTGCACTATC AGCAAGGACC ACGGCTACAC TATTTACTCC
ACCTTCGGAG CTTTCTACAT CCCGCTG.
We used real-time PCR to measure to mRNA level of 5-HT1A level in hippocampus.
There was no significant difference among the groups in steady state levels of 5-HT1A
receptor mRNA in hippocampus (Fig.5-4).


60
fetal lung, sodium reabsorption is thought to be dependent upon Na/K ATPase activity
acting in concert with luminal Na influx (Harding, 1994).
4.4.2 Methods
Lungs were collected from fetal sheep (120-125 days gestation) at sacrifice.
Pulmonary tissue for analysis of mRNA was immediately snap-frozen in RNAse-free
tubes in a dry ice/acetone bath, and stored at -80C until analysis.
4.4.3 Results
We used both semiquantitative RT-PCR and real-time PCR technology to identify MR
mRNA in lungs collected from a large group of animals (120-131 days gestation). MR
mRNA was detected in samples of four fetal lungs using semi-quantitative RT-PCR (Fig.
4-3). By real-time RT-PCR, MR mRNA was also identified in the lungs of eleven fetal
sheep (Fig.4-4 top left panel). In the fetal lungs, the generation of cDNA was
significantly greater than the generation of product in reaction in which there was no
added mRNA (Fig 4-4, no RNA control). MR mRNA was undetectable in the lungs of
seven pregnant ewes (Fig 4-4 top right panel). Product generation in samples from
maternal lungs was not different than that of the negative control. There was no influence
of fetal gestational age on the abundance of MR mRNA in the fetal lungs, normalized to
the abundance of 28S rRNA (Fig 4-4 bottom panel).
4.4.4 Discussion
The data from semi-quantitative RT-PCR is consistent with the data from real-time
RT-PCR. This implies that the method of real-time PCR works well and data is valid
since this is the first data obtained from real-time PCR in our laboratory. We also
measured mRNA of MR in many different tissues, including many different brain
regions. Most of them have detectable mRNA of MR. This implies that mRNA of MR is


28
response to stress. Serotonergic cell bodies are located in the raphe and project to many
brain areas, including the hippocampus, hypothalamus and cortex. 5-HT receptors are G-
protein coupled receptors. Seven distinct families of 5-HT receptors (5-HT1-5-HT7) have
been identified so far. Subpopulations have been described for several of these. At least
15 subpopulations have been cloned. The 5-HT 1A receptor is a somatodendritic
autoreceptor in raphe neurons that mediates a reduction in firing rate. The 5-HT 1A
receptor is also found postsynaptically in brain nuclei receiving 5-HT axon projections. It
is strongly expressed in the hippocampus, septum, and other limbic areas (Albert et al.,
1990;Pompeiano et al., 1992) and functions as a key regulator of the limbic system. It has
been shown that 5-HT 1A receptor is suppressed by corticosteroids.(Neumaier et al.,
2000;Nishi and Azmitia, 1996;Wissink et al., 2000). Electrophysiological studies have
demonstrated suppression of 5-HT induced hyperpolariation with CA1 pyramidal cells
after brief application of steroids which act at MR and GR (Joels and de Kloet, 1994).
Furthermore, corticosteroids removal by bilateral adrenalectomy (ADX) results in an
increase in brain hippocampal 5-HT 1A receptor mRNA expression (Chalmers et al.,
1993;Chalmers and Watson, 1991;Meijer and de Kloet, 1994). Using MR- and GR-
selective ligands (in rat) and gene knockout approaches (in mouse) (Meijer et al.,
1997;Meijer and de Kloet, 1995;Nishi and Azmitia, 1996), MR (primarily) and GR have
been implicated in negative regulation of 5-HT1A gene expression, but the precise
mechanism remains unclear. Dysregulation of the serotonergic system and abnormalities
of the HPA axis function have been implicated to be involved in neuropsychiatric
disorders, such as major depression, anxiety, and related disorders. For example, gene


75
Although we did not find a change in MR expression or protein with pregnancy or
progesterone treatment, other studies using adrenalectomized animals without steroid
replacement or using cell culture systems have found changes in MR mRNA levels with
gonadal steroid administration. In cultures of hippocampal neurons, or neuroblastoma
cells, progesterone increases MR expression (Castren et al., 1995). Progesterone also
increased MR mRNA in hippocampus of adrenalectomized, ovariectomized rats after 2
days of administration if they were pre-treated with estrogen, suggesting that this effect is
mediated by progesterone receptors (Castren et al., 1995). However, other studies with 6
days of administration have shown that ovariectomy does not change MR mRNA or the
increase in MR expression after adrenalectomy; progesterone adminstration in the
adrenalectomized, ovariectomized rat also did not change the suppression of MR by high
dose corticosterone (Patchev and Almeida, 1996). However, progesterone blocked the
inhibitory effect of estradiol on MR mRNA; and no effect of progesterone occurred if the
rats were treated with high doses of corticosterone after adrenalectomy. In these studies
progesterone attenuated both the increase in GR mRNA after adrenalectomy and the
suppression of this increase by high dose corticosterone; this effect is consistent with
progesterone action as a weak agonist at GR, in this case modulating the GR
autoregulation. An interactive effect of progesterone with estradiol was also observed
with acute steroid administration over 4 hours in adrenalectomized, ovariectomized rats.
Whereas acute estrogen treatment decreased MR availability in hippocampus, and levels
of MR mRNA in the CA2 region of the hippocampus, progesterone with estradiol
increased both MR binding capacity and mRNA (Carey et al., 1995). Taken together
with the results of our study, these studies suggest that progesterone may modulate the


27
reducing MR availability and increasing the apparent Kd of MR for cortisol. The first
region we studied is hippocampus in this dissertation. As described above, hippocampus
is one of the most important sites which regulates the tonic activity of HP A axis.
Hypothalamus, pituitary, brainstem and kidney are also important and will be studied in
the future.
2.4.4 Significance of Elevated Cortisol in Pregnancy
The elevated cortisol is necessary and critical for normal pregnancy. In experiments in
pregnant ewes in Dr. Keller-Woods lab, we have found that there was an increased
incidence of fetal loss and abortion when ewes were adrenalectomized and replaced with
cortisol to levels less than normal for pregnant ewes (i.e. normal for nonpregnant ewes).
We are currently studying the role of reduced maternal cortisol on fetal volume
homeostasis and growth.
In human, cases of hyper- or hypocorticism in pregnant women are relatively rare
because these conditions are also associated with infertility. However, it has been
observed that woman with untreated hyper- or hypocorticism during pregnancy appears
to have increased incidence of fetal death or abortionn (Aron et al., 1990;O'Shaughnessy
and Hackett, 1984;Osler, 1962;Pickard et al., 1990). When Addisons disease presents
during pregnancy there appears to be a decrease in birth weight relative to gestational age
(O'Shaughnessy and Hackett, 1984;Osler, 1962), and an increased risk of maternal death,
particularly in late gestation, during labor or in the immediate peripartum period (Drucker
et al., 1984;Seaward et al., 1989).
2.5 Corticosteroids Effects on Serotonin Receptors
Serotonin (5-hydroxytryptamine, 5-HT) neurotransmitter system and the HPA axis
have a reciprocal regulatory function in the feedback management of an organisms


87
Bell,ME, C E Wood, W M Keller, 1991, Influence of reproductive state on pituitary-
adrenal activity in the ewe: Domest.Anim.Endocrinol., v. 8, p. 245-254.
Bloem,LJ, C Guo, J H Pratt, 1995, Identification of a splice variant of the rat and human
mineralocorticoid receptor genes: J.Steroid Biochem.Mol.Biol., v. 55, p. 159-162.
Bradbury,MJ, S F Akana, M F Dallman, 1994, Roles of type I and II corticosteroid
receptors in regulation of basal activity in the hypothalamo-pituitary-adrenal axis during
the diurnal trough and the peak: evidence for a nanadditive effect of combined receptor
occupation.: Endocrinology., v. 134, p. 1286-1296.
Brooks,VL, L C Keil, 1994, Changes in the baroreflex during pregnancy in conscious
dogs: heart rate and hormonal responses: Endocrinology, v. 135, p. 1894-1901.
Buckingham, JC, 1982, Effects of adrenocortical and gonadal steroids on the secretion in
vitro of corticotrophin and its hypothalamic releasing factor: J Endocrinol, v. 93, p. 123-
132.
Buckingham, JC, J R Hodges, 1977, The use of corticotrophin production by
adenohypophysial tissue in vitro for the detection and estimation of potential
corticotrophin releasing factors: J.Endocrinol., v. 72, p. 187-193.
Burgess,LH, R J Handa, 1992, Chronic estrogen-induced alterations in
adrenocorticotropin and corticosterone secretion, and glucocorticoid receptor-mediated
function in female rats.: Endocrinology, v. 131, p. 1261-1269.
Bumstein,KL, C M Jewell, M Sar, J A Cidlowski, 1994, Intragenic sequences of the
human glucocorticoid receptor complementary DNA mediate hormone-inducible receptor
messenger RNA down-regulation through multiple mechanisms: Molecular
Endocrinology, v. 8, p. 1764-1773.
Caldenhoven,E, T van Dijk, J A Raaijmakers, J W Lammers, L Koenderman, R P De
Groot, 1995, Activation of the STAT3/acute phase response factor transcription factor by
interleukin-5: J.Biol.Chem., v. 270, p. 25778-25784.
Campbell,EA, E A Linton, C D A Wolfe, P R Scraggs, M T Jones, P J Lowry, 1987,
Plasma corticotropin-releasing hormone concentrations during pregnancy and parturition:
Journal of Clinical Endocrinology and Metabolism, v. 64, p. 1054-1059.
Canny,BJ, J W Funder, I J Clarke, 1989, Glucocorticoids regulate ovine hypophysial
portal levels of corticotropin-releasing factor and arginine vasopressin in a stress-specific
manner: Endocrinology, v. 125, p. 2532-2539.


PROGESTERONE AND CORTICOSTEROID INTERACTION DURING
PREGNANCY IN EWES
By
YI HUA
A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY
UNIVERSITY OF FLORIDA
2002


62
Ethidium bromide-stained PCR products for MR, GR and P-actin
from ADI or ADX sheep hippocampus
STD 5A 5B 5C 6A 6B 6C 7A 7B 7C 8A 8B
MR- and GR- specific PCR products in
hippocampus of ADI and ADX ewes
[ZZIADI
ADX
Fig. 4-1: Total RNA isolated from hippocampus of adrenal-intact or adrenalectomized ewes
was subjected to RT-PCR with primers specific for MR,GR or P-actin.
Top panel: gel showing RT-PCR products from 4 adrenal-intact (ADI) and 4
adrenalectomized (ADX) ewes. Odd numbered lanes are ADI, even numbers ADX. A=GR,
B=MR C=P-actin. The arrow indicated the 500bp marker in a 100 bp ladder (Promega). The
PCR product for MR was 277 bp, for GR was 275 bp, and for P-actin was 461 bp.
Bottom panel: Mean data for ADI vs ADX animals, n=4 per group, normalized to P-actin.
The data shown in the top panel were normalized to P-actin in each individual ewe; the mean
normalized data is shown in this panel. There were no significant differences between ADI
and ADX ewes (by t test).


77
In summary, we have found that the apparent Kd of cortisol at MR in the hippocampus
is increased by an increase in progesterone concentration, produced either by pregnancy
or progesterone treatment. The increase in apparent Kd is also reflected in an increase in
MR availability in hippocampus in pregnant ewes and in nonpregnant ewes with chronic
progesterone treatment. These changes are not related to the level of circulating cortisol,
and there was no change in GR availability in hippocampus. The change in MR
availability was not due to the level of receptors in vivo since neither mRNA nor protein
level of MR and GR changed. These data are consistent with competition of progesterone
with cortisol for binding at MR, resulting in fewer activated MR and more unactivated
MR available for ligand binding in the cytosolic assay. These studies therefore support
the hypothesis that increased progesterone during pregnancy reduces the MR-mediated
effects of cortisol. This action of progesterone may result in decreased cortisol feedback
effects in the hippocampus during pregnancy.


93
Jones,MT, E W Hillhouse, 1976, Structure-activity relationship and the mode of action of
corticosteroid feedback on the secretion of corticotrophin-releasing factor
(corticoliberin): J Steroid Biochem., v. 7, p. 1189-1202.
Jones,MT, E W Hillhouse, J L Burden, 1977, Structure-activity relationships of
corticosteroid feedback at the hypothalamic level: J.Endocrinol., v. 74, p. 415-424.
Kageyama,Y, E L Bravo, 1988, Hypertensive mechanisms associated with centrally
administered aldosterone in dogs: Hypertension, v. 11, p. 750-753.
Kalinyak,JE, R I Dorin, A R Hoffman, A J Perlman, 1987, Tissue-specific regulation of
glucocorticoid receptor mRNA by dexamethasone: Journal of Biological Chemistry, v.
262, p. 10441-10444.
Kathol,RG, R S Jaeckle, J F Lopez, W H Meller, 1989, Pathophysiology of HP A axis
abnormalities in patients with major depression: an update: Am.J Psychiatry, v. 146, p.
311-317.
Keller-Wood,M, 1996, Inhibition of stimulated and basal ACTH by cortisol during ovine
pregnancy: Am J Physiol, v. 271, p. R130-R136.
Keller-Wood,M, 1998, Evidence for reset of regulated cortisol in pregnancy: studies in
adrenalectomized ewes: Am J Physiol, v. 274, p. R145-R151.
Keller-Wood,M, T A Cudd, W Norman, S M Caldwell, C E Wood, 1998, Sheep model
for study of maternal adrenal gland function during pregnancy: Lab Anim Sci., v. 48, p.
507-512.
Keller-Wood,M, M F Dallman, 1984, Corticosteroid inhibition of ACTH secretion.:
Endocrine Reviews, v. 5, p. 1-22.
Keller-Wood,M, J Silbiger, C E Wood, 1988, Progesterone attenuates the inhibition of
adrenocorticotropin responses by cortisol in nonpregnant ewes: Endocrinology, v. 123, p.
647-651.
Keller-Wood,M, C E Wood, 1991a, Corticotropin-releasing factor in the ovine fetus and
pregnant ewe: role of the placenta.: American Journal of Physiology, v. 261, p. R995-
R1002.
Keller-Wood,M, C E Wood, 1991b, Does the ovine placenta secrete ACTH under
normoxic or hypoxic conditions?: American Journal of Physiology, v. 260, p. R389-
R395.


103
Vermes,I, G H Mulder, P G Smelik, 1977, A superfusion system technique for the study
of the sites of action of glucocorticoids in the rat hypothalamus-pituitary-adrenal system
in vitro. II. Hypothalamus-pituitary cell-adrenal cell superfusion: Endocrinology, v. 100,
p.1153-1159.
Viau,V, M J Meaney, 1991, Variations in the hypothalamic-pituitary-adrenal response to
stress during the estrous cycle in the rat.: Endocrinology, v. 129, p. 2503-2511.
Wallace,AD, J A Cidlowski, 2001, Proteasome-mediated glucocorticoid receptor
degradation restricts transcriptional signaling by glucocorticoids: J.Biol.Chem., v. 276, p.
42714-42721.
Wambach,G, J R Higgins, 1979, Antihypertensive effect of progesterone in rats with
mineralocorticoid- induced hypertension: Am.J.Physiol, v. 236, p. E366-E370.
Webster,JC, C M Jewell, J E Bodwell, A Munck, M Sar, J A Cidlowski, 1997, Mouse
glucocorticoid receptor phosphorylation status influences multiple functions of the
receptor protein: Journal of Biological Chemistry, v. 272, p. 9287-9293.
Wehling,M, 1997, Specific, nongenomic actions of steroid hormones: Annu.Rev.Physiol,
v. 59, p. 365-393.
Weigel,NL, 1996, Steroid hormone receptors and their regulation by phosphorylation:
Biochem.J., v. 319 ( Pt 3), p. 657-667.
Weller,KL, D A Smith, 1982, Afferent connections to the bed nucleus of the stria
terminalis: Brain Res., v. 232, p. 255-270.
Wessely,0, E M Deiner, H Beug, M von Lindem, 1997, The glucocorticoid receptor is a
key regulator of the decision between self-renewal and differentiation in erythroid
progenitors: EMBO J., v. 16, p. 267-280.
Wickert,L, J Selbig, M Watzka, B Stoffel-Wagner, J Schramm, F Bidlingmaier, M
Ludwig, 2000, Differential mRNA expression of the two mineralocorticoid receptor
splice variants within the human brain: structure analysis of their different DNA binding
domains: J.Neuroendocrinol., v. 12, p. 867-873.
Wissink,S, O Meijer, D Pearce, B B van Der, P T Der Saag, 2000, Regulation of the rat
serotonin-1A receptor gene by corticosteroids: Journal of Biological Chemistry, v. 275, p.
1321-1326.


65
as
a a
a3
s
DC
a2
ai
ao
O 10 20 M 4D 5D 0 10 211 30 50
Cycle- Number Cyde Number
Fetal MR mRNA in LUNG
Fig. 4-4: (top panel) Tapman fluorophore signal intensity (Rn) generated in response to
real-time PCR in fetal (left) and metemal (right) lung samples. MR mRNA was detected
in all samples of fetal lung (n=l 1) and in none of the samples of maternal lung (n=7). For
comparision, Rn in a reaction containing no mRNA is also plotted in the left panel,
(bottom panel) Differeces of cycle threshold of MR mRNA and 28s rRNA (ACt) for
ovine fetal lungs at two gestational ages (120-125, n=7 and 129-131 days, n=4),
demonstrating a similar abundance of MR mRNA in both groups.


2.4.3.1 Estrogen 25
2.4.3.2 Progesterone 26
2.4.4Significance of Elevated Cortisol in Pregnancy 27
2.5 Corticosteroids Effects on Serotonin Receptors 27
2.6 Animal Models 29
2.7 Significance 30
2.8 Objectives 31
3 GENERAL MATERIALS AND METHODS 36
3.1 Animal Care 36
3.2 General Surgical Procedure 36
3.2.1 Adrenalectomy and Ovariectomy 36
3.2.2 Vascular Catheterization 37
3.3 Chronic Steroid Implantation 37
3.4 Tissue Collection 37
3.5 Collecting Blood Samples and Measurement 38
3.5.1 Sampling and Storage 38
3.5.2 Hormones: Cortisol, Aldosterone and Progesterone 38
3.5.3 Free Cortisol and Progesterone 39
3.6 Receptor Binding Assays 39
3.6.1 General Methodology 39
3.6.1.1 Tissue preparation 39
3.6.1.2 Incubation 40
3.6.1.3 Separation of bound from free 42
3.6.2 Saturation Binding Analysis 42
3.6.3 Total Receptor Availability 43
3.7 Western Blot Analysis 44
3.7.1 Tissue Preparation 44
3.7.2 Electrophoresis and Transfer 44
3.7.3 MR Western Blotting Method 44
3.7.4 GR Western Blotting Method 45
3.7.5 (3-actin Western Blotting Method 46
3.8 RT-PCR 46
3.9 Statistic Analysis 46
4 RT-PCR 48
4.1 Semi-Quantitative RT-PCR 49
4.1.1 RNA Extraction and Sample Preparation 49
4.1.2 Primer Design 49
4.1.3 Semi-quantitative RT-PCR 50
4.1.4 PCR Product Purification and Sequencing 51
4.2 Real-Time RT-PCR 52
4.2.1 RNA Extraction and Sample Preparation 52
4.2.2 Primer and Probe Design 53
4.2.3 Real-time RT-PCR 54
v


100
Reul,JMHM, E R DeKloet, 1986, Anatomical resolution of two types of corticosterone
receptor sites in rat brain with in vitro autoradiography and conputerized image analysis:
J.Steroid Biochem., v. 24, p. 269-272.
ReulJMHM, F R van den Bosch, E R DeKloet, 1987, Relative occupation of type I and
type II corticosteroid receptors in rat brain following stress and dexamethasone treatment:
functional implications.: Journal of Endocrinology, v. 115, p. 459-467.
Risold,PY, L W Swanson, 1996, Structural evidence for functional domains in the rat
hippocampus: Science, v. 272, p. 1484-1486.
Roesch,DM, M Keller-Wood, 1999, Differential Effects of Pregnancy on
Mineralocorticoid and Glucocorticoid Receptor Availability and Immunoreactivity in
Cortisol Feedback Sites: Neuroendocrinology, v. 70, p. 55-62.
Rosenthal,HE, W R Slaunwhite, A A Sandberg, 1969, Transcortin: A
corticosteroidpbinding protein of plasma. X. Cortisol adn progesterone interplay and
unbound levels of these steroids in pregnancy: Journal of Clinical Endocrinology, v. 29,
p. 352-367.
Ruppert,S, M Boshart, F X Bosch, W Schmid, R E Fournier, G Schtz, 1990, Two
genetically defined trans-acting loci coordinately regulate overlapping sets of liver-
specific genes: Cell, v. 61, p. 895-904.
Rupprecht,R, J L Arriza, D Spengler, J M Reul, R M Evans, F Holsboer, K Damm,
1993a, Transactivation and synergistic properties of the mineralocorticoid receptor:
relationship to the glucocorticoid receptor: Molecular Endocrinology, v. 7, p. 597-603.
Rupprecht,R, J M Reul, B van Steensel, D Spengler, M Soder, B Beming, F Holsboer, K
Damm, 1993b, Pharmacological and functional characterization of human
mineralocorticoid and glucocorticoid receptor ligands: Eur J Pharmacol, v. 247, p. 145-
154.
Saoud,CJ, C E Wood, 1996, Developmental changes and molecular weight of
immunoreactive glucocorticoid receptor protein in the ovine fetal hypothalamus and
pituitary: Biochem.Biophys.Res.Commun., v. 229, p. 916-921.
Sapolsky,RM, 1996, Why stress is bad for your brain: Science, v. 273, p. 749-750.
Sapolsky,RM, L C Krey, B S McEwen, 1984, Glucocorticoid-sensitive hippocampal
neurons are involved in terminating the adrenocortical stress response:
Proc.Natl.Acad.Sci.U.S.A, v. 81, p. 6174-6177.


43
Saturation binding curves were generated for three ewes in each treatment group
(n=15 ewes total). In these experiments cytosol from each hippocampus was incubated
with increasing concentrations of 3H-cortisol from 0.05 nM to 35 nM. Four tubes were
assayed at each concentration. Two contained 50-fold RU 28362 (2.5 nM to 1.75 pM)
and two 500-fold dexamethasone (25 nM to 17.5 pM). The difference between the mean
binding in these two sets of tubes at each 3H-cortisol concentration was specific binding
at MR.
Saturation binding isotherms were calculated by non-linear regression analysis of the
binding data (Graphpad Prism, Graphpad Software, Inc, San Diego, CA). The binding
affinity (Kd) and maximal binding capacity (Bmax) were determined from this curve. The
equation of the curve was Y = BmaxX / Kd + X; where Bmax is the maximal binding and Kd
is the concentration of ligand required to reach half-maximal binding.
3.6.3 Total Receptor Availability
Total available receptors measurements are indicative of the degree of activation of
GR and MR. They reflect the number of receptors that had not been activated in vivo by
steroid, so are inversely proportional to the number of activated receptors. This is because
the assay conditions used prevent the recycling of MR or GR from the conformation
following receptor activation to the receptor conformation required for ligand binding.
Total available receptor were measured in all 25 of the ewes studied (n=5 per group)
using a single saturating concentration of 3H-cortisol (25 nM ) as previously described.
MR, GR, CBG and NSB were determined in triplicate tubes (12 tubes per hippocampus)
and the mean of the triplicates used for analysis. CBG binding was always less than 10


CHAPTER 1
INTRODUCTION
The adrenal steroid hormones are critical for maintenance of body homeostasis. The
concentrations of adrenocorticotropic hormone (ACTH) and cortisol, the major
glucocorticoid in human and sheep, are tightly regulated by a negative feedback loop axis
(Dallman et al., 1987b). However, during pregnancy, both maternal cortisol and ACTH
levels are increased in sheep, as well as in humans (Bell et ah, 1991; Carr et ah, 1981).
Previous studies in our laboratory in sheep showed that the set point for the feedback
regulation of basal plasma cortisol is increased during pregnancy (Keller-Wood, 1998).
This would allow the basal plasma concentration of cortisol to be maintained at a higher
level without suppression of ACTH, whereas further increases in cortisol concentration
would suppress plasma ACTH concentration, as it does in nonpregnant sheep. However,
the mechanism of the normal pregnancy-induced increase in set point for cortisol is
unknown.
Regulation of ACTH is thought to involve both corticosteroid receptor subtypes, the
mineralocorticoid receptor (MR) and the glucocorticoid receptor (GR). Whereas MR has
a high affinity for cortisol and is almost fully occupied at the basal concentration of
cortisol, GR has a lower affinity for cortisol, but higher capacity (de Kloet and Reul,
1987). We estimate that approximately 90% of MR, but only 30% of GR are occupied at
the basal steroid level in adrenal intact ewes. This difference in affinity and occupancy of
the two receptor subtypes has led to the hypothesis that MR are more involved in the
regulation of the basal concentration of cortisol, whereas GR participate in the feedback
1


11
1988). On the level of pituitary, DNA binding is required for repression of the POMC
gene (Reichardt et al., 1998). Obviously, binding of the GR to the negative GRE (nGRE)
in the promoter (Drouin et al., 1993) is a prerequisite for repression of basal POMC gene
transcription. DNA-binding-independent mechanisms are responsible for repression of
secretion (Reichardt et al., 2000)
2.1.6.2 Nongenomic action
While genomic steroid effects are characterized by their delayed onset of action since
time is needed for new protein production, and their sensitivity to blockers of
transcription and protein synthesis, the rapid action of steroids has been less widely
recognized, and characterized in detail. These nongenomic steroid effects are likely to be
transmitted via specific membrane receptors for steroids (Christ and Wehling,
1998;Picard, 1998;Wehling, 1997). Nongenomic steroid actions are mainly characterized
by short delay of onset (within 1-2 minutes). Investigators have used steroid coupled with
macromolecules, such as bovine serum albumin, which prevent the steroid from entering
the cell, to study this action. However, endocytosis resulting in the uptake of active
steroid into the cell might obscure the conclusion. We still do not completely understand
how or if nongenomic actions influence the HPA axis. One thing that should be kept in
mind is that the mechanism of corticosteroid receptor function might be more
complicated than what we have understood so far.
2.1.7 Specificity in Mineraloccorticoid verus Glucocorticoid Action
As described above, MR and GR share considerable structural and functional
homology, especially at their ligand binding domain and DNA binding domain. MR and
GR bind as dimers to common glucocorticoid-response elements (GRE), which comprise
or approximate the nucleotide sequence GCTACAnnnTGTTCT. No specific


24
placenta under basal conditions or during hypoxia induced by maternal inhalation of a
hypoxic gas mixture. Therefore, neither extra pituitary secretion of ACTH nor extra
hypothalamic secretion of CRT seem to adequately explain the change in ACTH or free
cortisol in pregnancy (Allolio et al., 1990;Keller-Wood and Wood, 1991a;Keller-Wood
and Wood, 1991b), or the change in relationship between cortisol and ACTH.
2.4.2.2 Feedback sensitivity
During pregnancy the feedback regulation of HPA axis has been attenuated. Evidence
also suggests the ability of dexamethasone to reduce free cortisol concentrations be
attenuated in the pregnant women (Nolten and Rueckert, 1981;Odagiri et al., 1988).
However, pregnancy does not reduce the absolute suppression of ACTH by a two-hour
infusion of cortisol in the sheep (Keller-Wood, 1996). Decreasing cortisol to levels less
than normal for pregnancy (but similar to those of nonpregnant subjects ) can
dramatically increase plasma ACTH. Increase in cortisol, to levels similar to those during
stress, decreases ACTH concentration in pregnant animals to the same extent as in
nonpregnant animals(Keller-Wood and Wood, 2001). These results suggested that during
pregnancy, the regulation of ACTH by cortisol at basal levels, but not the effects of
elevated or stimulus-induced increases in cortisol, is altered. The HPA axis feedback still
exists, but it has been set at a higher level. Since MR is the high affinity receptor that is
activated by basal concentration of cortisol, the inability of low concentrations of cortisol
to decrease ACTH suggests that the MR-mediated mechanism, rather than the GR-
mediated mechanism, may be altered during pregnancy.


4.2.3.1 Mixture 54
4.2.3.2 Primer, probe and starting RNA concentration 54
4.2.3.3 RT-PCR cycles 55
4.2.4 Expression of Data 55
4.3 Corticosteroid Receptor Regulation in Sheep after Acute Adrenalectomy 55
4.3.1 Introduction 55
4.3.2 Methods 56
4.3.3 Results 57
4.3.3.1 Semi-Quantitative analysis of mRNA for MR and GR 57
4.3.3.2 Sequence of PCR product of MR and GR 57
4.3.4 Discussion 58
4.4 MR Expression in Late-Gestation Ovine Fetal Lung 59
4.4.1 Introduction 59
4.4.2 Methods 60
4.4.3 Results 60
4.4.4 Discussion 60
5 ALTERATION OF MINERALOCORTICOID RECEPTOR FUNCTION BY
PREGNANCY AND PROGESTERONE 66
5.1 Introduction 66
5.2 Materials and Methods 67
5.3 Results 69
5.3.1 Cortisol, Progesterone and Aldosterone Level in Plasma 69
5.3.2 Total Available Receptor Binding at MR and GR in Hippocampus 69
5.3.3 Apparent Kd of MR with Cortisol in Hippocampus 70
5.3.4 MR and GR Protein Levels and mRNA Expression in Hippocampus 71
5.3.5 5-HT1A Receptor mRNA Level in Hippocampus 71
5.4 Discussion 72
6 SUMMARY AND CONCLUSIONS 84
LIST OF REFERENCES 86
BIOGRAPHICAL SKETCH 105
vi


69
Reverse primer: GTAAATAGTGTAGCCGTGGTCCTTGCT
Probe: CGGACCCGGACGCGTGCA
5.3 Results
5.3.1 Cortisol, Progesterone and Aldosterone Level in Plasma.
Plasma levels of cortisol, progesterone and aldosterone at the time of sacrifice were
shown in Table 5-1. In the cortisol-replaced adrenalectomized ewes, plasma cortisol
levels were similar (3-5 pg/ml) to those of the nonpregnant, adrenal-intact ewes. As
expected, plasma cortisol levels were higher in the pregnant adrenal intact group of ewes;
free cortisol levels also tended to be higher, however this difference was not significant.
Progesterone levels were low in nonpregnant, ovariectomized sheep, and both total and
free progesterone concentrations were increased in both groups of pregnant ewes.
Progesterone treatment increased plasma progesterone concentration to a level similar to
that in adrenal- intact pregnant ewes.
5.3.2 Total Available Receptor Binding at MR and GR in Hippocampus
The estimate of Bmax values for MR obtained by binding at a single saturating
concentration of 3H- cortisol was very similar to that obtained by saturation binding
experiments with multiple 3H- cortisol concentrations, confirming the validity of the
results (r=0.91, n=24). In the adrenal-intact ewes, there were significantly more MR sites
available in hippocampus from pregnant as compared to nonpregnant ewes (Figure 5-1,
lower right), despite the higher plasma cortisol concentrations in the pregnant ewes. In
the adrenalectomized ewes, there were also significantly more MR sites available in the
pregnant ewes as compared to the nonpregnant ewes (Figure 5-1, lower left). MR
availability in the nonpregnant adrenalectomized, progesterone-treated group was
intermediate between that in the pregnant and nonpregnant adrenalectomized groups, but


7
terminal amino acids containing the transactivation and DNA-binding domains. The only
difference is in their carboxy-terminal; as a result, GRa binds cortisol while GRP does
not (Oakley et al., 1996). GRas activity is inhibited by GRP (Oakley et ah, 1996). In rat
GR pre-mRNA lacks this splice site (Otto et ah, 1997).
2.1.4.2 Isoforms of MR
Expression of the human MR gene may result in the formation of at least four
transcripts, which are derived from two different promoters (Arriza et ah, 1987;Kwak et
ah, 1993;Zennaro et ah, 1995). The two main transcripts, MRa and MRP, are different in
5-untranslated exon 1 and so they have identical amino acids. In rat, a MRy transcript
derived from exon 1 is detectable in very low amounts. There is also another splice
variant in MR, which is between exon 3 and 4. It creates a 12bp difference in mRNA and
4 amino acids in protein (Bloem et ah, 1995). These four amino acids are in the two zinc
finger domains of the DNA-binding domain. A low abundance had been detected for this
splice variant in hippocampus in human and rat (Bloem et ah, 1995). Since the difference
is in the DNA binding domain, it is quite possible that this splice variant would have
aberrant functional properties.
In ovine, the MR has not been cloned, but a 942 base pair segment of the ovine GR
corresponding to residues 143-453 of the human GR (80% identity) has been cloned
(Yanget ah, 1992).
The availability of multiple isoforms of MR and GR indicates that the physiological
0
function of the steroid receptors is very complicated. Each receptor isoform would be
expected to have a different rank order of affinity for the endogenous ligands and each


21
stimulation of the hippocampal formation results in decreased HPA activity in both rat
and human (Jacobson and Sapolsky, 1991). The effect of hippocampal manipulation on
the HPA axis is state dependent, varying both during the day and with or without
stress, suggesting a modulatory role for corticosteroids (Canny et al., 1989;De Kloet et
al., 1991;Jacobson and Sapolsky, 1991). Hippocampal MRs, which have higher affinity
with corticosteroid compared to GR, are important in terms of control of inhibitory tone
over the HPA axis. This effect of corticosteroid via MRs is modulated by GRs that
become progressively occupied after stress, which also negatively feed back on the PVN
(Fig.2-3).
2.3.2 Hippocampus and Its Connection
It is generally accepted that hippocampal formation plays a key role in animals
reactivity to novelty and provides an essential contribution to learning and memory
(Gray, 1987).
Anatomically, the hippocampus has two major outputs: multisynaptic pathways to the
cerebral cortex and a massive descending projection directly to the lateral septum of the
basal ganglia. It has been shown that the descending output is organized in such a way
that different hippocampal regions map in an orderly way onto hypothalamic systems
mediating the expression of different classes of goal-oriented behavior (Risold and
Swanson, 1996). This mapping is characterized by a unidirectional hippocampo-lateral
septal projection and then by bidirectional lateral septo-hypothalamic projections, all
topographically organized. The bed nucleus of the stria terminalis (BST) may convey
excitation of the HPA axis. This limbic forebrain structure links regions such as the
amygdala and hippocampus with hypothalamic and brainstem regions controlling vital


64
4
Fig. 4-3 : cDNA polymerase chain reaction product for MR, GR and (3-actin mRNA.
Adjacent lanes demonstrate lack of product when P-actin primers are used after omission
of the reverse transcriptase (RT) reaction and after omission of mRNA.


20
2.3 Hippocampus and Its Connection
2.3.1 Role of Hippocampus in HPA Regulation
The importance of maintaining glucocorticoid secretion with tolerable limits requires
an efficient mechanism. This process appears to be accomplished by multiple pathways.
As described above, PVN is an important negative feedback site in HPA axis. However,
feedback at the PVN or pituitary can not account for all aspects of HPA inhibition. A lot
of evidence supports the existence of neuronal inhibitory pathways working in parallel
with steroid feedback. Furthermore, total or anterior deafferentations of the PVN increase
the expression of mRNA of CRF and AVP (Herman et al., 1990), indicating that the one
or more neuronal inhibitory pathways are also required for maintenance of basal HPA
tone.
Neuronal mediated inhibition of the HPA axis might emanate from several sources.
Perhaps the most intensely studied of these has been the hippocampus. The hippocampus
has been implicated in the neuronal regulation of the HPA axis activity by several
different research groups (Feldman and Conforti, 1980;Herman et al., 1989b;Jacobson
and Sapolsky, 1991;Magarinos et al., 1987;Sapolsky et al., 1984). Implication of the
hippocampus as a suprahypothalamic site mediating glucocorticoid feedback inhibition of
the HPA axis was suggested by the demonstration that the hippocampus exhibits the
highest brain levels of glucocorticoid binding and high-affinity receptors of
glucocorticoid (Herman, 1993;Jacobson and Sapolsky, 1991). Both lesion and electrical
stimulation studies suggest an overall inhibitory influence of the hippocampus on HPA
activity (Jacobson and Sapolsky, 1991). Dorsal hippocampectomy or transection of the
fomix elevates the basal HPA activity at the circadian trough in particular, and CRF
mRNA and VP mRNA expression in the moming.(Herman et al., 1989b). Conversely,


49
4.1Semi-Quantitative RT-PCR
4.1.1 RNA Extraction and Sample Preparation
Total RNA was extracted from 150-200mg of tissue with Trizol(GIBCO/BRL, Grand
Island, NY) following the manufacturers recommended method. Tissues were
homogenized in Trizol, then extracted with chloroform(0.2ml/ ml Trizol). The RNA was
precipitated from aqueous phase by the addition of isopropanol (0.5ml/ ml Trizol) and
pelleted by centrifugation at 12,000g for lOmin. After washing the pellets in 75%
ethanol, the RNA was dissolved in 200ul HPLC water. The integrity of RNA was
assessed by 1% non-denaturing agarose gel electrophoresis and visualization of the 18s
and 28s ribosomal RNA bands with ethidium bromide staining.
4.1.2 Primer Design
PCR primers for regular PCR for MR were designed using published human DNA
sequences (Arriza et al., 1987) with the aid of the Primer Design software and
synthesized by a commercial vendor (Gemini Biotechnology, Alachua, FL). Primers for
GR were similarly designed using published ovine RNA sequences (Yang et al., 1992).
The expression of the MR gene was determined by amplification of 277 bp region of
the MR cDNA sequence (4846-5122) (Arriza et al., 1987).
The sense upstream primer sequence:
5 -GGCACTGATGC AATGTATGG-3
The antisense downstream primer sequence:
5 -GTAATGTTGCCTGCATGGTG-3 .
The expression of GR was determined by amplification of a 275 bp region of the ovine
GR cDNA sequence (301-575) (Yang et al., 1992).
The sense upstream primer sequence:


23
loss in pregnant subjects. These results are consistent with a reset of regulated blood
volume to a higher level and reset of blood pressure to a lower level in the pregnant state.
The alterations in regulated blood pressure, volume, and baroreflex regulation in the
pregnant state likely represents a combination of effects of many hormones (Longo,
1983). The estrogen, progesterone and cortisols effects on the renin-angiotensin system,
nitric oxide, uteroplacental circulation may all contribute to these changes.
2.4.2 Changes in Regulation of Cortisol and ACTH During Pregnancy
2.4.2.1 Basal activity
During pregnancy, both plasma maternal ACTH and cortisol increased in sheep as
well as in human (Bell et al., 1991;Carr et al., 1981). The plasma cortisol level is almost
doubled compared with nonpregnant sheep. Both total and free cortisol concentrations are
also increased. Previous studies in Dr. Keller-Woods lab showed that in sheep the set
point for the feedback regulation of basal plasma cortisol is increased during pregnancy
(Keller-Wood, 1998). The mechanism of the normal pregnancy induced increase in set
point for cortisol remains unknown. Although elevated concentrations of plasma
corticosteroid binding globulin (CBG) may contribute to the elevation in plasma cortisol
in women, CBG concentration does not increase in the pregnant ewe and the
concentration of the free plasma cortisol is increased in both species during pregnancy
(Keller-Wood, 1996). Extrapituitary secretion of ACTH or corticotropin-releasing
hormone (CRF) has been proposed by a number of investigators as a stimulus to
adrenocortical secretion in pregnancy (Campbell et al., 1987;Rees et al., 1975), however,
in humans the CRF in plasma during pregnancy is bound to a protein (Orth and Mount,
1987;Suda et al., 1988)so that only a small proportion is biologically active. In sheep, Dr.
Keller-Wood lab found that there was no net secretion of ACTH or CRF from the


LIST OF REFERENCES
Abou-Samra,AB, B Loras, M Pugeat, J Toumiaire, J Bertrand, 1984, Demonstration of
an antigluccorticoid action of progesterone on the corticosterone inhibition of b-
endorphin release by rat anterior pituitary in primary culture: Endocrinology, v. 115, p.
1471-1475.
Albert,PR, Q Y Zhou, H H Van Tol, J R Bunzow, O Civelli, 1990, Cloning, functional
expression, and mRNA tissue distribution of the rat 5-hydroxytryptaminelA receptor
gene: J Biol.Chem., v. 265, p. 5825-5832.
Allolio,B, J Hoffmann, E A Linton, W Winkelmann, M Kusche, H M Schulte, 1990,
Diurnal salivary cortisol patterns during pregnancy and after delivery: relationship to
plasma corticotrophin-releasing-hormone: Clin.Endocrinol.(Oxf), v. 33, p. 279-289.
Aron,DC, A M Schnall, L R Sheeler, 1990, Cushing's syndrome and pregnancy.:
American Journal of Obstetrics and Gynecology, v. 162, p. 244-252.
Aronsson,M, K Fuxe, Y Dong, L F Agnati, S Okret, J A Gustafsson, 1988, Localization
of glucocorticoid receptor mRNA in the male rat brain by in situ hybridization:
Proc.Natl.Acad.Sci.U.S.A, v. 85, p. 9331-9335.
Arriza,JL, R B Simerly, L W Swanson, R M Evans, 1988, The neuronal
mineralocorticoid receptor as a mediator of glucocorticoid response: Neuron, v. 1, p. 887-
900.
Arriza,JL, C Weinberger, G Cerelli, T M Glaser, B L Handelin, D E Housman, R M
Evans, 1987, Cloning of human mineralocorticoid receptor complementary DNA:
structural and functional kinship with the glucocorticoid receptor.: Science, v. 237, p.
268-275.
Barker,PM, D V Walters, M Markiewicz, L B Strang, 1994, Development of the lung
liquid resorptive mechanism in fetal sheep:synergism of triiodothyronine and
hydrocortisone: Journal of Physiology, v. 433, p. 435-449.
Barnes,PJ, I Adcock, 1993, Anti-inflammatory actions of steroids: molecular
mechanisms: Trends Pharmacol.Sci., v. 14, p. 436-441.
86


CHAPTER 6
SUMMARY AND CONCLUSIONS
The studies presented in this dissertation were designed to explain how the set point
for the feedback regulation of cortisol and ACTH can be increased during pregnancy in
sheep as well as in humans. We hypothesize that the changes in pregnancy result from a
decrease in cortisol action at the MR, but no decrease in action at the GR. we hypothesize
that these changes, and therefore the elevation of cortisol, are related to the increase in
plasma progesterone during pregnancy. The specific hypotheses in this dissertation are:
1. Progesterone acts as an antagonist of cortisol at MR and/or reduces MR number in
the pregnant state to reduce the mineralocorticoid action of cortisol in brain.
2. Progesterone doesnt interfere with cortisol effect at GR, but as partial agonist
results in the combined effect of progesterone and cortisol at GR.
By the data shown above, we found that the apparent Kd of cortisol at MR in the
hippocampus is increased by an increase in progesterone concentration, produced either
by pregnancy or progesterone treatment. The increase in apparent Kd is also reflected in
an increase in MR availability in hippocampus in pregnant ewes and in nonpregnant ewes
with chronic progesterone treatment. These changes are not related to the level of
circulating cortisol, and there was no change in GR availability in hippocampus. The
change in MR availability was not due to the level of receptors in vivo since neither
mRNA nor protein level of MR and GR changed. These data are consistent with
competition of progesterone with cortisol for binding at MR, resulting in fewer activated
MR and more unactivated MR available for ligand binding in the cytosolic assay. 5-
84


45
Santa Cruz, CA) at a final concentration of 0.4 jug IgG/ml (1: 500) in blocking solution
was incubated with the blot for overnight at 4C. The blot was washed once for 10
minutes and twice for 5 minutes in PBST, then incubated with peroxidase linked
secondary antibody (SC 2350) at a dilution of 1:5000 in PBST:1% BSA for 1.5 hours at
room temperature. The blot was rinsed and then washed five times (once for 15 minutes
and four times for 5 minutes) in PBST. After washing, MR bands were visualized with an
enhanced chemiluminescence kit (NEN Renaissance, NEN Life Sciences, Boston, MA)
according to the manufacturers directions. Films (Kodak Biomax ML) were developed
and the bands quantified on densitometer and image analysis software (BioRad GS 710
linked to Quantity One software, Bio-Rad). Preliminary experiments defined the antibody
conditions used in these determinations and also showed that the amount of protein
loaded in each lane on these gels was approximately in the center of the dynamic range of
band detection. This ensured that any changes in the amount of MR (or GR, as described
below) protein in a sample compared to control could be readily detected. Preliminary
blocking experiments with cognate peptide decreased the intensity of the band,
suggesting that it was specific.
3.7.4 GR Western Blotting Method
GR protein bands were detected using similar methodology as that used for MR,
except the blot was blocked in 7.5% non-fat dried milk in PBST overnight at 4C. Anti-
GR antibody (PAI-511, Affinity BioReagents, Golden, CO) at 0.5 |ig/ml in blocking
solution was incubated with the blot overnight at 4C. Previous studies in these labs have
shown that this antibody recognizes a 97 kD protein in sheep hypothalamus and pituitary,
and is specific, as it was preabsorbed by immunizing peptide (Saoud and Wood, 1996).


12
mineralocrticoid-response element has been identified so far. However, MR and GR can
elicit markedly different physiological effects, even in cells expressing both receptors.
There are several mechanisms may be involved in delivering the specificity. First, it is
determined by the actions of 11 (3-HSD (see detail in section of 11 (3-HSD). Second,
different tissue may express different types of receptors, either MR or GR which deliver
the specificity by receptor availability. Beyond that, Pearce and Yamamoto also showed
that MR and GR mediate different effects at plfG, a 25-nucleotide composite response
element containing both a low-affinity GRE and an API binding site. The API binding
site binds heterodimers of c-Fos and c-Jun (or c-Jun homodimers). An activated (ligand-
bound) GR can block c-Jun-c-Fos-enhanced transcription from the composite response
element, but an activated MR can not (Pearce and Yamamoto, 1993). With the use of
chimeras of MR-GR, a segment of the N-terminal region of GR (amino acids 105-440)
was shown to be required for this repression. Thus, the distinct physiological effects
mediated by MR and GR may be determined by differential interactions of nonreceptor
factors with specific receptor domains at composite response elements. In tissues where
MR and GR are co-localized, such as lymphocytes, muscle and kidney cells and various
areas of the brain, especially the hippocampus, it has been shown that MR and GR can
form a heterodimer and might be more active than MR or GR homodimers (Trapp et al.,
1994). For homodimers of GRGR and MRMR, their transcription activities are different,
too. Usually, MR exerts a less pronounced sitmulation of transcription rate than the GR
and does not show synergistic activity on two copies of GRE as shown by GR (Rupprecht
et al., 1993a). This difference is thought to be due to the genetic structure difference at
the least conserved amino-terminal region of MR and GR.


94
Keller-Wood,M, C E Wood, 2001, Pregnancy alters cortisol feedback inhibition of
stimulated ACTH: studies in adrenalectomized ewes: Am.J.Physiol Regul.Integr.Comp
Physiol, v. 280, p. R1790-R1798.
Kim,EK, C E Wood, M Keller-Wood, 1995, Characterization of 11 beta-hydroxysteroid
dehydrogenase activity in fetal and adult ovine tissues: Reprod.Fertil.Dev., v. 7, p. 377-
383.
Kitay,JI, 1975, Effects of various hormones on the pituitary-adrenal axis:
Adv.Exp.Med.Biol., v. 54, p. 155-167.
Kretz,0, H M Reichardt, G Schtz, R Bock, 1999, Corticotropin-releasing hormone
expression is the major target for glucocorticoid feedback-control at the hypothalamic
level: Brain Res., v. 818, p. 488-491.
Kwak,SP, P D Patel, R C Thompson, H Akil, S J Watson, 1993, 5'-Heterogeneity of the
mineralocorticoid receptor messenger ribonucleic acid: differential expression and
regulation of splice variants within the rat hippocampus: Endocrinology, v. 133, p. 2344-
2350.
Laemmli,UK, 1970, Cleavage of structural proteins during the assembly of the head of
bacteriophage T4.: Nature, v. 227, p. 681-685.
Lakshmi,V, R R Sakai, B S McEwen, C Monder, 1991, Regional distribution of 11(3-
Hydroxysteroid dehydrogenase in rat brain.: Endocrinology, v. 128, p. 1741-1748.
landau,RL, K Lugibihl, 1958, inhibition of the sodium-retaining influence of aldosterone
by progesterone: J Clin Endocrinol Metab, v. 18, p. 1237.
Landfield,PW, J C Eldridge, 1991, The glucocorticoid hypothesis of brain aging and
neurodegeneration: recent modifications: Acta Endocrinol (Copenh), v. 125 Suppl 1, p.
54-64.
Lindner,HR, 1964, Comparative aspects of cortisol transport: lack of firm binding to
plasma proteins in domestic ruminants: J Endocrinol, v. 28, p. 301-320.
Lombes,M, N Farman, M E Oblin, E E Baulieu, J P Bonvalet, B F Erlanger, J M Gasc,
1990, Immunohistochemical localization of renal mineralocorticoid receptor by using an
anti-idiotypic antibody that is an internal image of: Proc.Natl.Acad.Sci.U.S.A, v. 87, p.
1086-1088.



PAGE 1

352*(67(521( $1' &257,&267(52,' ,17(5$&7,21 '85,1* 35(*1$1&< ,1 (:(6 %\ <, +8$ $ ',66(57$7,21 35(6(17(' 72 7+( *5$'8$7( 6&+22/ 2) 7+( 81,9(56,7< 2) )/25,'$ ,1 3$57,$/ )8/),//0(17 2) 7+( 5(48,5(0(176 )25 7+( '(*5(( 2) '2&725 2) 3+,/2623+< 81,9(56,7< 2) )/25,'$

PAGE 2

$ GHGLFDWLRQ WR P\ SDUHQWV IRU WKHLU ORYH DQG EHOLHYLQJ LQ PH

PAGE 3

$&.12:/('*0(176 )LUVW RI DOO ZRXOG OLNH WR WKDQN P\ PHQWRUV 'U &KDUOHV :RRG DQG 'U 0DXUHHQ .HOOHU:RRG IRU WKHLU LPPHDVXUDEOH JXLGDQFH VXSSRUW DQG GHGLFDWLRQ WR P\ GRFWRUDO WUDLQLQJ 7KH\ DUH UROH PRGHOV ERWK LQ DFDGHPLF OLIH DQG LQ UHDO OLIH IRU PH 7KHLU HQWKXVLDVWLF DWWLWXGH WR VFLHQFH DQG WKHLU NHHQ LQVLJKW DOZD\V LQVSLUHG PH ZKHQ IHOW LQ WKH GDUNQHVV RI P\ UHVHDUFK DP DOVR YHU\ WKDQNIXO WR P\ FRPPLWWHH PHPEHUV 'U &ROLQ 6XPQHUV 'U 3DXO 2K DQG 'U 5RVDOLD 6LPPHQ 7KH\ JDYH PH D ORW RI LQWHOOHFWXDO DGYLFH IRU P\ SURMHFW DQG WKH\ ZHUH DOZD\V WKHUH WR KHOS ZKHQ KDG DQ\ TXHVWLRQV WKDQN 'U (ODLQH 6XPQHUV IRU KHU KHOS DQG SDWLHQFH 6KH WDXJKW PH WKH WHFKQLTXHV VWHS E\ VWHS ZKHQ ILUVW FDPH WR WKH ODE DQG JDYH PH GDLO\EDVLV WURXEOH VKRRWLQJ IRU WKH H[SHULPHQWV 0\ DSSUHFLDWLRQ DOVR JRHV WR DOO WKH PHPEHUV LQ WKH ODE IRU WKHLU HQFRXUDJHPHQW VXSSRUW DQG IULHQGVKLS ZKLFK PDGH PH FRQILGHQW DQG IHOW OLNH ZDV SDUW RI D ELJ IDPLO\ WKDQN P\ VLVWHU IURP WKH ERWWRP RI P\ KHDUW IRU KHU VXSSRUW DQG WDNLQJ FDUH RI RXU SDUHQWV GXULQJ WKH KDUG WLPHV ZKLFK PDGH WKLV GLVVHUWDWLRQ SRVVLEOH )LQDOO\ P\ GHHS DSSUHFLDWLRQ JRHV WR P\ KXVEDQG IRU KLV VXSSRUW XQGHUVWDQGLQJ DQG ORYH LQ HYHU\ VLQJOH DVSHFW ZKLFK KHOSHG PH DFKLHYH WKLV KHLJKW LLL

PAGE 4

7$%/( 2) &217(176 SDJH $&.12:/('*0(176 LLL $%675$&7 YLL &+$37(5 ,1752'8&7,21 /,7(5$785( 5(9,(: &RUWLFRVWHURLG DQG &RUWLFRVWHURLG 5HFHSWRU *HQHUDO ,QWURGXFWLRQ 3KDUPDFRORJLFDO &KDUDFWHUL]DWLRQ /RFDOL]DWLRQ ,VRIRUPV ,VRIRUPV RI *5 ,VRIRUPV RI 05 *HQHWLF &KDUDFWHUL]DWLRQ RI 05 DQG *5 0HFKDQLVPV RI $FWLRQ *HQRPLF DFWLRQV 1RQJHQRPLF DFWLRQ 6SHFLILFLW\ LQ 0LQHUDORFFRUWLFRLG YHUDV *OXFRFRUWLFRLG $FWLRQ 05*5 0HGLDWHG 3K\VLRORJLFDO )XQFWLRQ RI *OXFRFRUWLFRLGV 5HJXODWLRQ RI 5HFHSWRUV +\GUR[\VWHURLG 'HK\GURJHQDVH S+6'f &RUWLFRVWHURLG DQG +3$ $[LV ,QWURGXFWLRQ )DVW )HHGEDFN ,QWHUPHGLDWH DQG 6ORZ )HHGEDFN +LSSRFDPSXV DQG ,WV &RQQHFWLRQ 5ROH RI +LSSRFDPSXV LQ +3$ 5HJXODWLRQ +LSSRFDPSXV DQG ,WV &RQQHFWLRQ 3K\VLRORJLFDO $GDSWDWLRQ 'XULQJ 3UHJQDQF\ &KDQJHV LQ &DUGLRYDVFXODU )XQFWLRQ LQ 3UHJQDQF\ &KDQJHV LQ 5HJXODWLRQ RI &RUWLVRO DQG $&7+ 'XULQJ 3UHJQDQF\ %DVDO DFWLYLW\ )HHGEDFN VHQVLWLYLW\ 5ROH RI 2YDULDQ3ODFHQWDO 6WHURLG ,9

PAGE 5

(VWURJHQ 3URJHVWHURQH 6LJQLILFDQFH RI (OHYDWHG &RUWLVRO LQ 3UHJQDQF\ &RUWLFRVWHURLGV (IIHFWV RQ 6HURWRQLQ 5HFHSWRUV $QLPDO 0RGHOV 6LJQLILFDQFH 2EMHFWLYHV *(1(5$/ 0$7(5,$/6 $1' 0(7+2'6 $QLPDO &DUH *HQHUDO 6XUJLFDO 3URFHGXUH $GUHQDOHFWRP\ DQG 2YDULHFWRP\ 9DVFXODU &DWKHWHUL]DWLRQ &KURQLF 6WHURLG ,PSODQWDWLRQ 7LVVXH &ROOHFWLRQ &ROOHFWLQJ %ORRG 6DPSOHV DQG 0HDVXUHPHQW 6DPSOLQJ DQG 6WRUDJH +RUPRQHV &RUWLVRO $OGRVWHURQH DQG 3URJHVWHURQH )UHH &RUWLVRO DQG 3URJHVWHURQH 5HFHSWRU %LQGLQJ $VVD\V *HQHUDO 0HWKRGRORJ\ 7LVVXH SUHSDUDWLRQ ,QFXEDWLRQ 6HSDUDWLRQ RI ERXQG IURP IUHH 6DWXUDWLRQ %LQGLQJ $QDO\VLV 7RWDO 5HFHSWRU $YDLODELOLW\ :HVWHUQ %ORW $QDO\VLV 7LVVXH 3UHSDUDWLRQ (OHFWURSKRUHVLV DQG 7UDQVIHU 05 :HVWHUQ %ORWWLQJ 0HWKRG *5 :HVWHUQ %ORWWLQJ 0HWKRG DFWLQ :HVWHUQ %ORWWLQJ 0HWKRG 573&5 6WDWLVWLF $QDO\VLV 573&5 6HPL4XDQWLWDWLYH 573&5 51$ ([WUDFWLRQ DQG 6DPSOH 3UHSDUDWLRQ 3ULPHU 'HVLJQ 6HPLTXDQWLWDWLYH 573&5 3&5 3URGXFW 3XULILFDWLRQ DQG 6HTXHQFLQJ 5HDO7LPH 573&5 51$ ([WUDFWLRQ DQG 6DPSOH 3UHSDUDWLRQ 3ULPHU DQG 3UREH 'HVLJQ 5HDOWLPH 573&5 Y

PAGE 6

0L[WXUH 3ULPHU SUREH DQG VWDUWLQJ 51$ FRQFHQWUDWLRQ 573&5 F\FOHV ([SUHVVLRQ RI 'DWD &RUWLFRVWHURLG 5HFHSWRU 5HJXODWLRQ LQ 6KHHS DIWHU $FXWH $GUHQDOHFWRP\ ,QWURGXFWLRQ 0HWKRGV 5HVXOWV 6HPL4XDQWLWDWLYH DQDO\VLV RI P51$ IRU 05 DQG *5 6HTXHQFH RI 3&5 SURGXFW RI 05 DQG *5 'LVFXVVLRQ 05 ([SUHVVLRQ LQ /DWH*HVWDWLRQ 2YLQH )HWDO /XQJ ,QWURGXFWLRQ 0HWKRGV 5HVXOWV 'LVFXVVLRQ $/7(5$7,21 2) 0,1(5$/2&257,&2,' 5(&(3725 )81&7,21 %< 35(*1$1&< $1' 352*(67(521( ,QWURGXFWLRQ 0DWHULDOV DQG 0HWKRGV 5HVXOWV &RUWLVRO 3URJHVWHURQH DQG $OGRVWHURQH /HYHO LQ 3ODVPD 7RWDO $YDLODEOH 5HFHSWRU %LQGLQJ DW 05 DQG *5 LQ +LSSRFDPSXV $SSDUHQW .G RI 05 ZLWK &RUWLVRO LQ +LSSRFDPSXV 05 DQG *5 3URWHLQ /HYHOV DQG P51$ ([SUHVVLRQ LQ +LSSRFDPSXV +7$ 5HFHSWRU P51$ /HYHO LQ +LSSRFDPSXV 'LVFXVVLRQ 6800$5< $1' &21&/86,216 /,67 2) 5()(5(1&(6 %,2*5$3+,&$/ 6.(7&+ YL

PAGE 7

$EVWUDFW RI 'LVVHUWDWLRQ 3UHVHQWHG WR WKH *UDGXDWH 6FKRRO RI WKH 8QLYHUVLW\ RI )ORULGD LQ 3DUWLDO )XOILOOPHQW RI WKH 5HTXLUHPHQWV IRU WKH 'HJUHH RI 'RFWRU RI 3KLORVRSK\ 352*(67(521( $1' &257,&267(52,'6 ,17(5$&7,21 '85,1* 35(*1$1&< ,1 (:(6 %\
PAGE 8

FDSDFLW\ K\SRWKHVL]H WKDW GXULQJ SUHJQDQF\ ZLWK KLJK OHYHO RI SURJHVWHURQH 05 IXQFWLRQ GHFUHDVHV DQG *5 IXQFWLRQ NHHSV QRUPDO K\SRWKHVL]H SURJHVWHURQH DFWV DV DQ DQWDJRQLVW RI FRUWLVRO DW 05 DQGRU UHGXFHV 05 QXPEHU LQ WKH SUHJQDQW VWDWH DQG LW DFWV ZLWK FRUWLVRO DW *5 DV D SDUWLDO DJRQLVW ZKLFK UHVXOWV LQ WKH FRPELQHG HIIHFWV RI SURJHVWHURQH DQG FRUWLVRO 7R WHVW WKHVH K\SRWKHVHV ZH VWXGLHG SUHJQDQW RU SURJHVWHURQH WUHDWHG QRQSUHJQDQW HZHV ZLWK VKDP DGUHQDOHFWRP\ RU DGUHQDOHFWRP\ 5HFHSWRU ELQGLQJ VWXGLHV VKRZHG WKDW WKHUH ZDV D VLJQLILFDQW UHODWLRQVKLS EHWZHHQ WKH SODVPD SURJHVWHURQH FRQFHQWUDWLRQ DQG WKH DYDLODELOLW\ RI 05 DQG EHWZHHQ WKH SODVPD SURJHVWHURQH FRQFHQWUDWLRQ DQG WKH DSSDUHQW .G RI 05 IRU FRUWLVRO 7KHUH ZDV D VLJQLILFDQW LQFUHDVH LQ 05 DYDLODELOLW\ DQG .G IRU FRUWLVRO LQ KLSSRFDPSDO F\WRVRO LQ SUHJQDQW HZHV DV FRPSDUHG WR QRQSUHJQDQW HZHV ZKHWKHU WKH\ ZHUH VKDP DGUHQDOHFWRPL]HG RU DGUHQDOHFWRPL]HG 7KH DSSDUHQW .G ZDV DOVR LQFUHDVHG LQ WKH SURJHVWHURQHWUHDWHG QRQSUHJQDQW DGUHQDOHFWRPL]HG HZHV UHODWLYH WR WKH QRQSUHJQDQW DGUHQDOHFWRPL]HG HZHV ZLWKRXW SURJHVWHURQH WUHDWPHQW 7KHUH ZHUH QR GLIIHUHQFHV LQ KLSSRFDPSDO *5 ELQGLQJ ,Q DGGLWLRQ XVLQJ :HVWHUQ EORW DQG UHDOWLPH 573&5 ZH PHDVXUHG WKH SURWHLQ DQG P51$ H[SUHVVLRQ LQ KLSSRFDPSXV IRU 05 DV ZHOO DV *5 1R VLJQLILFDQW GLIIHUHQFH KDG EHHQ GHWHFWHG 7KHVH VWXGLHV VXSSRUW WKH K\SRWKHVLV WKDW LQFUHDVHG SURJHVWHURQH GXULQJ SUHJQDQF\ UHGXFHV 05PHGLDWHG HIIHFWV RI FRUWLVRO UHVXOWLQJ LQ GHFUHDVHG IHHGEDFN HIIHFWV LQ WKH KLSSRFDPSXV DW WKH EDVDO OHYHO RI FRUWLVRO ,Q DGGLWLRQ *5PHGLDWHG HIIHFWV RI FRUWLVRO KDYHQfW EHHQ FKDQJHG E\ SURJHVWHURQH VR WKDW D IHHGEDFN HIIHFWV DW WKH VWLPXODWHG OHYHO RI FRUWLVRO GXULQJ SUHJQDQF\ DUH WKH VDPH DV LQ QRQSUHJQDQW VWDWH YLLL

PAGE 9

&+$37(5 ,1752'8&7,21 7KH DGUHQDO VWHURLG KRUPRQHV DUH FULWLFDO IRU PDLQWHQDQFH RI ERG\ KRPHRVWDVLV 7KH FRQFHQWUDWLRQV RI DGUHQRFRUWLFRWURSLF KRUPRQH $&7+f DQG FRUWLVRO WKH PDMRU JOXFRFRUWLFRLG LQ KXPDQ DQG VKHHS DUH WLJKWO\ UHJXODWHG E\ D QHJDWLYH IHHGEDFN ORRS D[LV 'DOOPDQ HW DO Ef +RZHYHU GXULQJ SUHJQDQF\ ERWK PDWHUQDO FRUWLVRO DQG $&7+ OHYHOV DUH LQFUHDVHG LQ VKHHS DV ZHOO DV LQ KXPDQV %HOO HW DK &DUU HW DK f 3UHYLRXV VWXGLHV LQ RXU ODERUDWRU\ LQ VKHHS VKRZHG WKDW WKH VHW SRLQW IRU WKH IHHGEDFN UHJXODWLRQ RI EDVDO SODVPD FRUWLVRO LV LQFUHDVHG GXULQJ SUHJQDQF\ .HOOHU:RRG f 7KLV ZRXOG DOORZ WKH EDVDO SODVPD FRQFHQWUDWLRQ RI FRUWLVRO WR EH PDLQWDLQHG DW D KLJKHU OHYHO ZLWKRXW VXSSUHVVLRQ RI $&7+ ZKHUHDV IXUWKHU LQFUHDVHV LQ FRUWLVRO FRQFHQWUDWLRQ ZRXOG VXSSUHVV SODVPD $&7+ FRQFHQWUDWLRQ DV LW GRHV LQ QRQSUHJQDQW VKHHS +RZHYHU WKH PHFKDQLVP RI WKH QRUPDO SUHJQDQF\LQGXFHG LQFUHDVH LQ VHW SRLQW IRU FRUWLVRO LV XQNQRZQ 5HJXODWLRQ RI $&7+ LV WKRXJKW WR LQYROYH ERWK FRUWLFRVWHURLG UHFHSWRU VXEW\SHV WKH PLQHUDORFRUWLFRLG UHFHSWRU 05f DQG WKH JOXFRFRUWLFRLG UHFHSWRU *5f :KHUHDV 05 KDV D KLJK DIILQLW\ IRU FRUWLVRO DQG LV DOPRVW IXOO\ RFFXSLHG DW WKH EDVDO FRQFHQWUDWLRQ RI FRUWLVRO *5 KDV D ORZHU DIILQLW\ IRU FRUWLVRO EXW KLJKHU FDSDFLW\ GH .ORHW DQG 5HXO f :H HVWLPDWH WKDW DSSUR[LPDWHO\ b RI 05 EXW RQO\ b RI *5 DUH RFFXSLHG DW WKH EDVDO VWHURLG OHYHO LQ DGUHQDO LQWDFW HZHV 7KLV GLIIHUHQFH LQ DIILQLW\ DQG RFFXSDQF\ RI WKH WZR UHFHSWRU VXEW\SHV KDV OHG WR WKH K\SRWKHVLV WKDW 05 DUH PRUH LQYROYHG LQ WKH UHJXODWLRQ RI WKH EDVDO FRQFHQWUDWLRQ RI FRUWLVRO ZKHUHDV *5 SDUWLFLSDWH LQ WKH IHHGEDFN

PAGE 10

UHJXODWLRQ ZKHQ WKH FRUWLVRO FRQFHQWUDWLRQ LQFUHDVHV %UDGEXU\ HW DO 5HXO HW DO f 7KH ORFDOL]DWLRQ RI 05 DQG *5 LV DOVR FRQVLVWHQW ZLWK 05 HIIHFWV PHGLDWLQJ WRQLF EDVDO FRQWURO RI WKH D[LV DQG *5 PHGLDWLQJ FRQWURO RI VWLPXODWHG UHVSRQVHV *5 LV GLVWULEXWHG LQ DOO WKH EUDLQ UHJLRQV EXW 05 KDV KLJKHVW DEXQGDQFH LQ WKH KLSSRFDPSXV +HUPDQ HW DK D5HXO DQG 'H.ORHW f VXJJHVWLQJ WKDW ZKHUHDV JOXFRFRUWLFRLG IHHGEDFN LV H[HUWHG DW PXOWLSOH VLWHV LQFOXGLQJ K\SRWKDODPXV DQG SLWXLWDU\f 05 PHGLDWHG IHHGEDFN HIIHFWV RFFXU SULPDULO\ LQ WKH KLSSRFDPSXV ZKLFK UHJXODWHV EDVDO $&7+ WKURXJK LQKLELWRU\ FRQQHFWLRQV WR WKH SDUDYHQWULFXODU QXFOHXV 391f +HUPDQ DQG &XOOLQDQ f ,W KDV EHHQ VKRZQ WKDW SURJHVWHURQH FDQ DQWDJRQL]H 05PHGLDWHG HIIHFWV LQ YLYR :DPEDFK DQG +LJJLQV 6SHQFH HW DK f DQG LQ YLWUR -RQHV HW DK 5XSSUHFKW HW DK f 3URJHVWHURQH KDV YHU\ KLJK DIILQLW\ IRU WKH KXPDQ 05 EXW SURJHVWHURQH H[HUWV YHU\ ORZ WUDQVFULSWLRQDO DFWLYLW\ DIWHU ELQGLQJ 05 5XSSUHFKW HW DK Ef 3URJHVWHURQH DOVR ELQGV WR KXPDQ *5 ZLWK DQ DIILQLW\ VLPLODU WR WKDW RI FRUWLVRO DQG H[HUWV PRGHUDWH DFWLYLW\ DIWHU ELQGLQJ VXJJHVWLQJ WKDW SURJHVWHURQH FDQ DFW DV SDUWLDO DJRQLVW DW KXPDQ *5 3URJHVWHURQH KDV DQ DSSUR[LPDWHO\ HTXDO DIILQLW\ FRPSDUHG WR FRUWLVRO DW WKH RYLQH 05 DQG ORZHU DIILQLW\ IRU RYLQH *5 6WXGLHV LQ UDWV KDYH VXJJHVWHG WKDW SURJHVWHURQH WUHDWPHQW LQ YLYR DOWHUV FRUWLFRVWHURQH ELQGLQJ DW 05 &DUH\ HW DK f :H WKHUHIRUH K\SRWKHVL]HG WKDW GXULQJ SUHJQDQF\ RU GXULQJ FKURQLF SURJHVWHURQH WUHDWPHQW SURJHVWHURQH ZLOO DFW DV DQ DQWDJRQLVW WR FRUWLVRO ELQGLQJ DW 05 UHGXFLQJ 05 DYDLODELOLW\ DQG LQFUHDVLQJ WKH DSSDUHQW .G RI 05 IRU FRUWLVRO LQ KLSSRFDPSDO F\WRVRO

PAGE 11

&+$37(5 /,7(5$785( 5(9,(: &RUWLFRVWHURLGV DUH KRUPRQHV VHFUHWHG IURP FRUWH[ RI DGUHQDO JODQG 7KH\ KDYH WUHPHQGRXV HIIHFWV RQ GLIIHUHQW V\VWHPV &RUWLFRVWHURLG KRUPRQH DFWLRQ LQYROYHV ELQGLQJ WR WZR LQWUDFHOOXODU UHFHSWRUV %RWK RI WKHVH WZR UHFHSWRUV FDQ ELQG ZLWK FRUWLFRVWHURLGV +RZHYHU WKH\ VKRZ D ORW RI GLIIHUHQFHV LQ WKHLU SKDUPDFRORJLFDO DQG SK\VLRORJLFDO FKDUDFWHULVWLFV 7KLV GLVVHUWDWLRQ LV EDVHG RQ WKH K\SRWKHVLV WKDW HOHYDWHG RYDULDQ VWHURLGV HVSHFLDOO\ WKH SURJHVWHURQH FRQWULEXWH WR WKH DGDSWDWLRQ RI SUHJQDQF\ E\ GHFUHDVLQJ IHHGEDFN HIIHFWV DW WKH EDVDO OHYHO RI FRUWLVRO ZLWKRXW LQWHUIHULQJ ZLWK WKH IHHGEDFN HIIHFWV ZKHQ WKH OHYHO RI FRUWLVRO DUH LQFUHDVHG DIWHU VWUHVV RU VWLPXODWLRQ 7KLV FKDSWHU UHYLHZV WKH FXUUHQW NQRZOHGJH DERXW FRUWLFRVWHURLGV WKHLU UHFHSWRUV DQG WKHLU UHJXODWLRQ SK\VLRORJLFDO DGDSWDWLRQ GXULQJ SUHJQDQF\ RYDULDQ VWHURLGVf HIIHFWV RQ FRUWLFRVWHURLG UHFHSWRU DQG SRWHQWLDO PHFKDQLVPV IRU VHW SRLQW DGDSWDWLRQ E\ SURJHVWHURQH &RUWLFRVWHURLG DQG &RUWLFRVWHURLG 5HFHSWRU *HQHUDO ,QWURGXFWLRQ &RUWLFRVWHURLGV DUH V\QWKHVL]HG LQ WKH DGUHQDO JODQG DQG SDUWLFLSDWH LQ WKH UHJXODWLRQ RI SK\VLRORJLFDO SURFHVVHV LQ D YDULHW\ RI RUJDQ V\VWHPV 0LOOHU f 7KH\ H[HUW D ZLGH UDQJH RI IXQFWLRQV WKURXJKRXW WKH ERG\ WR NHHS WKH KRPHRVWDVLV RI WKH ERG\ DQG UHVSRQG WR VWUHVV RU VWLPXOXV IURP LQWHUQDO RU H[WHUQDO HQYLURQPHQW 7KHUH DUH WZR W\SHV RI FRUWLFRVWHURLG UHFHSWRUV WKURXJK ZKLFK FRUWLFRVWHURLGV PRGXODWH WKHLU WDUJHW WLVVXHV 7KH WZR UHFHSWRUV FRORFDOL]H LQ PDQ\ WLVVXHV 0F(ZHQ HW DO f 7KHVH UHFHSWRUV QRW RQO\ PHGLDWH WKH SK\VLRORJLFDO HIIHFWV RI FRUWLFRVWHURLGV EXW DOVR SDUWLFLSDWH LQ WKH

PAGE 12

IHHGEDFN ORRS WKDW UHJXODWHV SODVPD OHYHOV RI FRUWLVRO %UDGEXU\ HW DO 5HXO DQG 'H.ORHW f 3KDUPDFRORJLFDO &KDUDFWHUL]DWLRQ &RUWLFRVWHURLG UHFHSWRU W\SH DOVR FDOOHG WKH PLQHUDORFRUWLFRLG UHFHSWRU 05f KDYH KLJK DIILQLW\ ZLWK FRUWLFRVWHURLGV DQG ORZ FDSDFLW\ GH .ORHW DQG 5HXO f ,Q GLIIHUHQW VSHFLHV LWV DIILQLW\ ZLWK WKHVH KRUPRQHV VKRZV YDULDWLRQ 7KH DIILQLW\fV UDQN RUGHU IRU WKH PDMRU FLUFXODWLQJ FRUWLFRVWHURLGV FRUWLFRVWHURQH FRUWLVRO DQG DOGRVWHURQH f LV DV IROORZV ,Q WKH UDW DQG WKH PRXVH ZKLFK XVHV FRUWLFRVWHURQH DV WKH SULQFLSDO FRUWLFRVWHURLG 05 GLVSOD\V D KLJK DIILQLW\ IRU DOGRVWHURQH DQG FRUWLFRVWHURQH a Q0f DQG D ORZHU DIILQLW\ IRU FRUWLVRO 5HXO DQG 'H.ORHW f ,Q WKH GRJ ZKLFK OLNH KXPDQV DQG VKHHS XVHV FRUWLVRO DV WKH SULQFLSDO FRUWLFRVWHURLG WKH 05 DOVR KDV D YHU\ KLJK DIILQLW\ IRU FRUWLFRVWHURQH aQ0f DQG D ORZHU DIILQLW\ aQ0f IRU FRUWLVRO DQG DOGRVWHURQH 5HXO HW DO f ,Q KXPDQ 05 ELQGV WKRVH VWHURLGV ZLWK VLPLODU RUGHU KLJK DIILQLW\ IRU FRUWLFRVWHURQH Q0f ORZHU DIILQLW\ IRU FRUWLVROQ0f DQG DOGRVWHURQH Q0f 5XSSUHFKW HW DO Ef ,Q 'U .HOOHU:RRGfV ODE ZH FKDUDFWHUL]HG WKH ELQGLQJ DIILQLW\ LQ VKHHS 2YLQH 05 KDV VLPLODU KLJK DIILQLW\ IRU DOGRVWHURQH Q0f DQG FRUWLVRO Q0f %HFDXVH RI LWV KLJK DIILQLW\ ZLWK FRUWLFRVWHURLGV 05 LV DOPRVW IXOO\ RFFXSLHG DW WKH EDVDO FRQFHQWUDWLRQ RI FRUWLVRO ,W LV WKRXJKW WR PHGLDWH WRQLF DFWLRQV RI FRUWLFRVWHURLG &RUWLFRVWHURLG UHFHSWRU W\SH ,, DOVR FDOOHG WKH JOXFRFRUWLFRLG UHFHSWRU *5f KDV ORZHU DIILQLW\ ZLWK JOXFRFRUWLFRLG FRPSDUHG ZLWK 05 DQG KLJKHU FDSDFLW\ 7KH SDUDOOHO H[SHULPHQWV VKRZHG WKDW LQ WKH UDW WKH *5 KDV D UHODWLYHO\ KLJK DIILQLW\ EXW ORZHU WKDQ WKH 05f IRU FRUWLFRVWHURQH aQ0f DQG HYHQ ORZHU DIILQLW\ IRU FRUWLVRO DQG DOGRVWHURQH aQ0f 5HXO DQG 'H.ORHW f ,Q WKH GRJ WKH *5 KDV DQ HTXDO EXW ORZHU DIILQLW\

PAGE 13

WKDQ WKH 05 IRU FRUWLFRVWHURQH DQG FRUWLVRO aQ0f DQG WZRIROG ORZHU DIILQLW\ IRU DOGRVWHRPH aQ0f 5HXO HW DO f ,Q KXPDQ WKH *5 KDV D ORZHU DIILQLW\ IRU FRUWLVRO Q0f WKDQ 05 DQG PXFK ORZHU DIILQLW\ IRU FRUWLFRVWHURQH Q0f DQG DOGRVWHURQH Q0f 5XSSUHFKW HW DO Ef ,Q VKHHS WKH *5fV DIILQLW\ IRU FRUWLVRO LV DOVR ORZHU WKDQ 05 Q0f DQG LWV DIILQLW\ IRU DOGRVWHURQH LV HYHQ ORZHU Q0f 7KHUHIRUH *5 LV PXFK OHVV RFFXSLHG DW EDVDO OHYHO RI FRUWLVRO EXW RFFXSDWLRQ LQFUHDVHV ZLWK WKH LQFUHDVH RI FRUWLVRO FRQFHQWUDWLRQ DIWHU LQWHUQDO RU H[WHUQDO VWLPXODWLRQ 6R *5 VKRZV LWV HIIHFWV PRUH ZKHQ WKH FRUWLVRO OHYHO LV UHODWLYHO\ KLJK ,Q RXU ODE ZH PHDVXUHG DQG HVWLPDWHG WKDW DSSUR[LPDWHO\ b RI 05 DQG b RI *5 DUH RFFXSLHG DW WKH EDVDO VWHURLG OHYHO LQ DGUHQDO LQWDFW HZHV 7KLV GLIIHUHQFH LQ DIILQLW\ DQG RFFXSDQF\ RI WKH WZR UHFHSWRU VXEW\SHV KDV OHG WR WKH K\SRWKHVLV WKDW 05 LV PRUH LQYROYHG LQ WKH UHJXODWLRQ RI WKH EDVDO OHYHO RI FRUWLVRO DW WKH IHHGEDFN VLWHV ZKLOH *5 SDUWLFLSDWHV LQ WKH IHHGEDFN UHJXODWLRQ ZKHQ FRUWLVRO OHYHO LQFUHDVHV %UDGEXU\ HW DO 5HXO HW DO f /RFDOL]DWLRQ %\ LQ VLWX K\EULGL]DWLRQ DQG LPPXQRKLVWRFKHPLVWU\ GLIIHUHQW ODEV ORFDOL]HG WKH 05 DQG *5 LQ FHQWUDO QHUYRXV V\VWHP DQG SHULSKHUDO WLVVXHV *5 LV ZLGHO\ H[SUHVVHG LQ PRVW FHOO W\SHV ZKHUHDV 05 H[SUHVVLRQ LV UHVWULFWHG WR HSLWKHOLDO FHOOV LQ NLGQH\ FRORQ DQG WKH VDOLYDU\ JODQGV DQG QRQHSLWKHOLDO FHOOV LQ EUDLQ DQG KHDUW 5HLFKDUGW DQG 6FKW] f ,Q WKH SHULSKHU\ DFFHVV RI FRUWLVRO DQG FRUWLFRVWHURQH WR 05 LV SUHYHQWHG E\ D SUHn UHFHSWRU PHFKDQLVP VHH VHFWLRQ RQ +6'f DQG DV D FRQVHTXHQFH FRUWLVROFRUWLFRVWHURQH ELQGLQJ WR 05 PDLQO\ SOD\V D UROH LQ WKH EUDLQ ,Q WKH EUDLQ *5 LV ZLGHO\ GLVWULEXWHG LQ D ODUJH QXPEHU RI &16 QXFOHL ZLWK KLJKHU FRQFHQWUDWLRQV LQ UHJLRQV LQYROYHG LQ WKH VWUHVV UHVSRQVH VXFK DV WKH SDUDYHQWULFXODU QXFOHXV 391f RI WKH

PAGE 14

K\SRWKDODPXV DQWHULRU SLWXLWDU\ DQG LQ WKH KLSSRFPDSXV +HUPDQ HW DO D5HXO DQG 'H.ORHW 9DQ (HNHOHQ HW DK f 7KH GLVWULEXWLRQ RI 05 LV VRPHZKDW PRUH OLPLWHG ZLWK WKH KLJKHVW DEXQGDQFH LQ S\UDPLGDO QHXURQV RI WKH KLSSRFDPSXV +HUPDQ HW DK D5HXO DQG 'H.ORHW f VXJJHVWLQJ WKDW ZKHUHDV *5PHGLDWHG IHHGEDFN LV H[HUWHG DW PXOWLSOH VLWHV LQFOXGLQJ SLWXLWDU\ DQG K\SRWKDODPXV HVSHFLDOO\ 391f 05 PHGLDWHG IHHGEDFN HIIHFWV RFFXU SULPDULO\ LQ WKH KLSSRFDPSXV 7KH ORFDOL]DWLRQ RI 05 DQG *5 LV FRQVLVWHQW ZLWK 05 HIIHFWV PHGLDWLQJ WRQLF EDVDO FRQWURO RI WKH D[LV DQG *5 PHGLDWLQJ FRQWURO RI VWLPXODWHG UHVSRQVHV %RWK 05 DQG *5 P51$ H[KLELW KLJKHVW OHYHOV RI H[SUHVVLRQ LQ WKH OLPELF V\VWHP PRVW QRWDEO\ LQ WKH KLSSRFDPSDO IRUPDWLRQ +RZHYHU ZLWKLQ KLSSRFDPSDO IRUPDWLRQ *5 DQG 05 VKRZ ZLGH GLIIHUHQFHV LQ UHODWLYH OHYHO RI DEXQGDQFH *5 P51$ KDV KLJKHVW OHYHOV LQ &$ LQWHUPHGLDWH OHYHOV LQ GHQWDWH J\UXV '*f DQG ORZ OHYHOV LQ &$ ZKHUHDV 05 VLJQDO LV KHDYLHVW LQ &$ &$ LV DSSUR[LPDWHO\ HTXDO LQ LQWHQVLW\ LQ &$ DQG '* $URQVVRQ HW DK $UUL]D HW DK +HUPDQ HW DK D6RXVD HW DK 9DQ (HNHOHQ HWDK
PAGE 15

WHUPLQDO DPLQR DFLGV FRQWDLQLQJ WKH WUDQVDFWLYDWLRQ DQG '1$ELQGLQJ GRPDLQV 7KH RQO\ GLIIHUHQFH LV LQ WKHLU FDUER[\WHUPLQDO DV D UHVXOW *5D ELQGV FRUWLVRO ZKLOH *53 GRHV QRW 2DNOH\ HW DO f *5DfV DFWLYLW\ LV LQKLELWHG E\ *53 2DNOH\ HW DK f ,Q UDW *5 SUHP51$ ODFNV WKLV VSOLFH VLWH 2WWR HW DK f ,VRIRUPV RI 05 ([SUHVVLRQ RI WKH KXPDQ 05 JHQH PD\ UHVXOW LQ WKH IRUPDWLRQ RI DW OHDVW IRXU WUDQVFULSWV ZKLFK DUH GHULYHG IURP WZR GLIIHUHQW SURPRWHUV $UUL]D HW DK .ZDN HW DK =HQQDUR HW DK f 7KH WZR PDLQ WUDQVFULSWV 05D DQG 053 DUH GLIIHUHQW LQ fXQWUDQVODWHG H[RQ DQG VR WKH\ KDYH LGHQWLFDO DPLQR DFLGV ,Q UDW D 05\ WUDQVFULSW GHULYHG IURP H[RQ LV GHWHFWDEOH LQ YHU\ ORZ DPRXQWV 7KHUH LV DOVR DQRWKHU VSOLFH YDULDQW LQ 05 ZKLFK LV EHWZHHQ H[RQ DQG ,W FUHDWHV D ES GLIIHUHQFH LQ P51$ DQG DPLQR DFLGV LQ SURWHLQ %ORHP HW DK f 7KHVH IRXU DPLQR DFLGV DUH LQ WKH WZR ]LQF ILQJHU GRPDLQV RI WKH '1$ELQGLQJ GRPDLQ $ ORZ DEXQGDQFH KDG EHHQ GHWHFWHG IRU WKLV VSOLFH YDULDQW LQ KLSSRFDPSXV LQ KXPDQ DQG UDW %ORHP HW DK f 6LQFH WKH GLIIHUHQFH LV LQ WKH '1$ ELQGLQJ GRPDLQ LW LV TXLWH SRVVLEOH WKDW WKLV VSOLFH YDULDQW ZRXOG KDYH DEHUUDQW IXQFWLRQDO SURSHUWLHV ,Q RYLQH WKH 05 KDV QRW EHHQ FORQHG EXW D EDVH SDLU VHJPHQW RI WKH RYLQH *5 FRUUHVSRQGLQJ WR UHVLGXHV RI WKH KXPDQ *5 b LGHQWLW\f KDV EHHQ FORQHG
PAGE 16

OLJDQG UHFHSWRU FRPSOH[ ZRXOG EH H[SHFWHG WR ELQG YDULRXV JHQHWLF UHVSRQVH HOHPHQWV ZLWK YDU\LQJ DIILQLW\ DQG HIILFDF\ *HQHWLF &KDUDFWHUL]DWLRQ RI 05 DQG *5 7KH DPLQR DFLG VHTXHQFHV RI WKH WZR SURWHLQV DUH KLJKO\ KRPRORJRXV DQG WKHLU VWUXFWXUDO DQG IXQFWLRQDO GRPDLQV DUH VLPLODU $UUL]D HW DO f %RWK UHFHSWRUV DUH FRQVLGHUHG WR EH GLYLGHG LQWR IXQFWLRQDO GRPDLQV GHVLJQDWHG GRPDLQV $ WKURXJK ) 7KH '1$ELQGLQJ GRPDLQ LV PDSSHG WR WKH ZHOO FRQVHUYHG PLGGOH UHJLRQ & GRPDLQf RI WKH UHFHSWRU 7KH OHVV FRQVHUYHG FDUER[\WHUPLQDO () GRPDLQ LV WKH OLJDQG ELQGLQJ GRPDLQ 7KH DPLQR WHUPLQXV LV $% GRPDLQ 7KH DPLQR WHUPLQDO UHJLRQ FRQWDLQV DQ DXWRQRPRXV DFWLYDWLRQ IXQFWLRQ $) ,W ZDV WKRXJKW WR EH D NH\ HOHPHQW LQ WUDQVDFWLYDWLRQ WRJHWKHU ZLWK $) ZKLFK LV ORFDWHG DW FDUER[\WHUPLQDO GRPDLQV 7KH DPLQR WHUPLQXV YDULHV LQ VL]H DQG EDUHV QR VWUXFWXUDO KRPRORJ\ DPRQJ WKH 05 DQG *5 ,Q KXPDQ WKH 1WHUPLQDO UHJLRQ RI 05 DQG *5 KDV RQO\ b KRPRORJ\ 7KLV GLIIHUHQFH VHHPV WR EH D FULWLFDO GHWHUPLQDQW IRU WKH GLIIHUHQW HIILFLHQF\ LQ VWLPXODWLQJ JHQH H[SUHVVLRQ E\ 05 DQG *5$UUL]D HW DO $UUL]D HW DO +ROOHQEHUJ HW DO 5XSSUHFKW HW DO Ef ,Q WKH *5 WKLV UHJLRQ FRQWDLQV D VWURQJHU WUDQVDFWLYDWLRQ IXQFWLRQ WKDQ 05 DQG LV QHFHVVDU\ IRU HIILFLHQW VWLPXODWLRQ RI JHQH WUDQVFULSWLRQ 'DQLHOVHQ HW DO *LJXHUH HW DO +ROOHQEHUJ DQG (YDQV f ,W KDV EHHQ VKRZQ WKDW 05 H[HUWV D OHVV SURQRXQFHG VWLPXODWLRQ RI WUDQVFULSWLRQ UDWH WKDQ WKH *5 DQG GRHV QRW VKRZ V\QHUJLVWLF DFWLYLW\ RQ SURPRWHUV FRQWDLQLQJ WZR FRSLHV RI D SDOOLQGURPLF ELQGLQJ VLWH 5XSSUHFKW HW DO Df +RZHYHU WKH FDUER[\WHUPLQDO OLJDQG ELQGLQJ GRPDLQ b LGHQWLW\ LQ KXPDQf DQG WKH F\VWHLQH ULFK ]LQF ILQJHU '1$ ELQGLQJ GRPDLQ b LGHQWLW\ LQ KXPDQf DUH KLJKO\ KRPRORJRXV $UUL]D HW DO f )LJ f 7KHVH VWUXFWXUDO VLPLODULWLHV DOORZ WKH WZR UHFHSWRUV WR KDYH VLPLODU VWHURLG ELQGLQJ DQG DFWLYDWLRQ SURILOHV 5XSSUHFKW HW DO

PAGE 17

DQG WR ELQG FORVHO\ UHODWHG '1$ WDUJHW VHTXHQFHV $UUL]D HW DO f ,Q DGGLWLRQ WKH OLJDQGELQGLQJ GRPDLQ FRQWDLQV VHTXHQFHV UHVSRQVLEOH IRU KHDWVKRFN SURWHLQ LQWHUDFWLRQV QXFOHDU WUDQVORFDWLRQ GLPHUL]DWLRQ DQG WUDQVFULSWLRQ DFWLYDWLRQ IXQFWLRQ $)f +ROOHQEHUJ DQG (YDQV f 0HFKDQLVPV RI $FWLRQ *HQRPLF DFWLRQV '1$ ELQGLQJ GHSHQGHQW PHFKDQLVP &RUWLFRVWHURLG UHFHSWRUV DUH QXFOHDU UHFHSWRUV ZKLFK DUH OLJDQG LQGXFLEOH WUDQVFULSWLRQ IDFWRUV WKDW VSHFLILFDOO\ UHJXODWH WKH H[SUHVVLRQ RI WDUJHW JHQHV 7KH\ UHVLGH LQ F\WRVRO DVVRFLDWHG ZLWK KHDW VKRFN SURWHLQV KVSfWZR PROHFXOHV RI KVS RQH KVS RQH KVS DQG DQ LPPXQRSKLOLQf +XWFKLVRQ HW DO 1DWKDQ DQG /LQGTXLVW 6PLWK DQG 7RIW f *OXFRFRUWLFRLGV FDQ FURVV SODVPD PHPEUDQHV IUHHO\ $IWHU ELQGLQJ ZLWK WKH OLJDQG WKH UHFHSWRUV ZLOO GLVVRFLDWH IURP KHDW VKRFN SURWHLQV DQG IRUP GLPHUV HLWKHU KRPRGLPHU RI 0505 *5*5 RU KHWHURGLPHU RI 05*5f 7KH OLJDQGUHFHSWRU FRPSOH[ ZLOO WKHQ WUDQVORFDWH LQWR WKH QXFOHXV ZKHUH LW ELQGV WR SDOOLQGURPLF FRQVHQVXV HOHPHQWV RQ SURPRWHU VHTXHQFHV RI WDUJHW JHQHV WR KDYH HIIHFWV RQ WKH JHQH WUDQVFULSWLRQ $URQVVRQ HW DO (ULNVVRQ DQG :UDQJH f 'HSHQGLQJ RQ HLWKHU WKH QDWXUH RI WKH '1$ FRQVHQVXV VHTXHQFH RU LQWHUDFWLRQV ZLWK RWKHU WUDQVFULSWLRQ IDFWRUV WKH VWHURLG UHFHSWRU FRPSOH[ FDQ DFW DV HLWKHU SRVLWLYH RU QHJDWLYH UHJXODWRUV RI JHQH H[SUHVVLRQ 'URXLQ HW DO 3HDUFH DQG
PAGE 18

DQG IXQFWLRQDOO\ UHODWHG WUDQVFULSWLRQDO FRDFWLYDWRUV 5HFHSWRUV DOVR LQWHUDFW ZLWK WKH WUDQVFULSWLRQDO FRLQWHJUDWRUV S DQG &%3 ZKLFK DUH SURSRVHG WR LQWHJUDWH GLYHUVH DIIHUHQW VLJQDOV DW KRUPRQHUHJXODWHG SURPRWHUV 0F.HQQD HW DO f '1$ ELQGLQJ LQGHSHQGHQW PHFKDQLVP $SDUW IURP '1$ ELQGLQJGHSHQGHQW PHFKDQLVPV RI *5 DQG 05fV IXQFWLRQ '1$ ELQGLQJLQGHSHQGHQW PHFKDQLVPV DUH DOVR XVHG E\ ERWK *5 DQG 05 7KH VWXGLHV RI WDUJHWHG GLVUXSWLRQ RI WKH *5 '1$ ELQGLQJ GRPDLQ VXJJHVWHG WKDW WUDQFULSWLRQDO UHJXODWLRQ E\ *5 LV DFKLHYHG YLD '1$ELQGLQJ GHSHQGHQW DV ZHOO DV LQGHSHQGHQW PHFKDQLPV -RQDW HW DO 6FKXOH HW DO
PAGE 19

f 2Q WKH OHYHO RI SLWXLWDU\ '1$ ELQGLQJ LV UHTXLUHG IRU UHSUHVVLRQ RI WKH 320& JHQH 5HLFKDUGW HW DO f 2EYLRXVO\ ELQGLQJ RI WKH *5 WR WKH QHJDWLYH *5( Q*5(f LQ WKH SURPRWHU 'URXLQ HW DO f LV D SUHUHTXLVLWH IRU UHSUHVVLRQ RI EDVDO 320& JHQH WUDQVFULSWLRQ '1$ELQGLQJLQGHSHQGHQW PHFKDQLVPV DUH UHVSRQVLEOH IRU UHSUHVVLRQ RI VHFUHWLRQ 5HLFKDUGW HW DO f 1RQJHQRPLF DFWLRQ :KLOH JHQRPLF VWHURLG HIIHFWV DUH FKDUDFWHUL]HG E\ WKHLU GHOD\HG RQVHW RI DFWLRQ VLQFH WLPH LV QHHGHG IRU QHZ SURWHLQ SURGXFWLRQ DQG WKHLU VHQVLWLYLW\ WR EORFNHUV RI WUDQVFULSWLRQ DQG SURWHLQ V\QWKHVLV WKH UDSLG DFWLRQ RI VWHURLGV KDV EHHQ OHVV ZLGHO\ UHFRJQL]HG DQG FKDUDFWHUL]HG LQ GHWDLO 7KHVH QRQJHQRPLF VWHURLG HIIHFWV DUH OLNHO\ WR EH WUDQVPLWWHG YLD VSHFLILF PHPEUDQH UHFHSWRUV IRU VWHURLGV &KULVW DQG :HKOLQJ 3LFDUG :HKOLQJ f 1RQJHQRPLF VWHURLG DFWLRQV DUH PDLQO\ FKDUDFWHUL]HG E\ VKRUW GHOD\ RI RQVHW ZLWKLQ PLQXWHVf ,QYHVWLJDWRUV KDYH XVHG VWHURLG FRXSOHG ZLWK PDFURPROHFXOHV VXFK DV ERYLQH VHUXP DOEXPLQ ZKLFK SUHYHQW WKH VWHURLG IURP HQWHULQJ WKH FHOO WR VWXG\ WKLV DFWLRQ +RZHYHU HQGRF\WRVLV UHVXOWLQJ LQ WKH XSWDNH RI DFWLYH VWHURLG LQWR WKH FHOO PLJKW REVFXUH WKH FRQFOXVLRQ :H VWLOO GR QRW FRPSOHWHO\ XQGHUVWDQG KRZ RU LI QRQJHQRPLF DFWLRQV LQIOXHQFH WKH +3$ D[LV 2QH WKLQJ WKDW VKRXOG EH NHSW LQ PLQG LV WKDW WKH PHFKDQLVP RI FRUWLFRVWHURLG UHFHSWRU IXQFWLRQ PLJKW EH PRUH FRPSOLFDWHG WKDQ ZKDW ZH KDYH XQGHUVWRRG VR IDU 6SHFLILFLW\ LQ 0LQHUDORFFRUWLFRLG YHUXV *OXFRFRUWLFRLG $FWLRQ $V GHVFULEHG DERYH 05 DQG *5 VKDUH FRQVLGHUDEOH VWUXFWXUDO DQG IXQFWLRQDO KRPRORJ\ HVSHFLDOO\ DW WKHLU OLJDQG ELQGLQJ GRPDLQ DQG '1$ ELQGLQJ GRPDLQ 05 DQG *5 ELQG DV GLPHUV WR FRPPRQ JOXFRFRUWLFRLGUHVSRQVH HOHPHQWV *5(f ZKLFK FRPSULVH RU DSSUR[LPDWH WKH QXFOHRWLGH VHTXHQFH *&7$&$QQQ7*77&7 1R VSHFLILF

PAGE 20

PLQHUDORFUWLFRLGUHVSRQVH HOHPHQW KDV EHHQ LGHQWLILHG VR IDU +RZHYHU 05 DQG *5 FDQ HOLFLW PDUNHGO\ GLIIHUHQW SK\VLRORJLFDO HIIHFWV HYHQ LQ FHOOV H[SUHVVLQJ ERWK UHFHSWRUV 7KHUH DUH VHYHUDO PHFKDQLVPV PD\ EH LQYROYHG LQ GHOLYHULQJ WKH VSHFLILFLW\ )LUVW LW LV GHWHUPLQHG E\ WKH DFWLRQV RI +6' VHH GHWDLO LQ VHFWLRQ RI +6'f 6HFRQG GLIIHUHQW WLVVXH PD\ H[SUHVV GLIIHUHQW W\SHV RI UHFHSWRUV HLWKHU 05 RU *5 ZKLFK GHOLYHU WKH VSHFLILFLW\ E\ UHFHSWRU DYDLODELOLW\ %H\RQG WKDW 3HDUFH DQG
PAGE 21

6RPH HYLGHQFH VXJJHVWV LQWULQVLF UHFHSWRU SURSHUWLHV DOVR FRQWULEXWH WR WKH DELOLW\ RI WKLV GLIIHUHQWLDWLRQ $OWKRXJK WKH 05 ELQGV FRUWLFRVWHURQH DQG FRUWLVRO ZLWK D KLJK DIILQLW\ WKH DOGRVWHURQH05 FRPSOH[ LV PRUH SRWHQW WKDQ WKH FRUWLVROFRUWLFRVWHURQH05 FRPSOH[ VLQFH WKH KDOI PD[LPDO HIIHFWLYH GRVH LV DSSUR[LPDWHO\ IROG ORZHU /RPEHV HW DO 5XSSUHFKW HW DO Ef $OGRVWHURQH GLVVRFLDWHV PRUH VORZO\ IURP 05 WKDQ GRHV FRUWLVRO LQGLFDWLQJ WKDW WKH VWDELOLW\ RI WKH DOGRVWHRPH05 FRPSOH[ LV KLJKHU WKDQ WKDW RI WKH FRUWLVRO05 FRPSOH[ +HOODO/HY\ HW DO +HOODO/HY\ HW DO /RPEHV HW DO f DQG WKLV VORZ RIIUDWH RI DOGRVWHURQH IURP 05 LV UHVSRQVLEOH IRU LWV KLJK HIILFLHQF\ LQ VWLPXODWLQJ 05 WUDQVFULSWLRQDO DFWLYLW\ 05*5 0HGLDWHG 3K\VLRORJLFDO )XQFWLRQ RI *OXFRFRUWLFRLGV *OXFRFUWLFRLGV DUH RI PDMRU LPSRUWDQFH IRU PDLQWDLQLQJ FHOOXODU DQG KXPRUDO KRPHRVWDVLV 7KH\ H[HUW WKHVH IXQFWLRQV E\ 05 DQG *5 ,Q WKH SHULSKHU\ RQH RI WKH ZHOOHVWDEOLVKHG IXQFWLRQV DVVLJQHG WR JOXFRFRUWLFRLGV LV WKH FRQWURO RI FDUERK\GUDWH DQG OLSLG PHWDEROLVP )RU H[DPSOH WKH JOXFRFRUWLFRLGV LQGXFH JOXFRVH V\QWKHVLV E\ DFWLYDWLRQ RI JOXFRQHRJHQHVLV DQG LPSRUWDQW JHQHV LQYROYHG LQ WKLV SURFHVV VXFK DV JOXFRVHSKRVSKDWDVH SKRVSKRHQROS\UXYDWH FDUER[\NLQDVH3(3&.f DQG W\URVLQH DPLQRWUDQVIHUDVH 7$7f KDYH EHHQ VKRZQ WR EH GLUHFW WDUJHWV RI JOXFRFRUWLFRLGV 5XSSHUW HW DO f ,Q WKH OXQJ JOXFRFRUWLFRLGV DUH DEOH WR SURPRWH PDWXUDWLRQ GXULQJ GHYHORSPHQW DQG LQ WKH DGUHQDO JODQG WKH\ DUH LQYROYHG LQ WKH ELRV\QWKHVLV RI FDWHFKRODPLQHV )XUWKHUPRUH JOXFRFRUWLFRLGV SDUWLFLSDWH LQ WKH VXSSUHVVLRQ RI LQIODPPDWRU\ UHDFWLRQV ZKLFK LV DFKLHYHG E\ UHSUHVVLQJ P51$ H[SUHVVLRQ RI F\WRNLQHV DQG UHJXODWLRQ RI O\PSKRF\WH PLJUDWLRQ %DUQHV DQG $GFRFN f $GGLWLRQDOO\ JOXFRFRUWLFRLGV DUH DEOH WR LQGXFH DSRSWRVLV RI WK\PRF\WHV

PAGE 22

&KDSPDQ HW DO f DQG LQ WKH HU\WKURLG FRPSDUWPHQW WKH\ DUH LQYROYHG LQ ORQJWHUP SUROLIHUDWLRQ RI HU\WKUREODVWV :HVVHO\ HW DO f ,Q WKH FHQWUDO QHUYRXV V\VWHP JOXFRFRUWLFRLGV DUH LQYROYHG LQ WKH QHJDWLYH IHHGEDFN UHJXODWLRQ RI WKH +3$D[LV EXW WKH\ DOVR KDYH WUHPHQGRXV HIIHFWV RQ EHKDYLRU OHDUQLQJ DQG PHPRU\ 0F(ZHQ DQG 6DSROVN\ 0F*DXJK HW DO 6DSROVN\ f %RWK UHFHSWRU VSHFLHV DUH SUHVHQW GXULQJ GHYHORSPHQW LPSO\LQJ DELOLW\ IRU WKHVH WUDQVFULSWLRQ IDFWRUV WR LQWHUDFW ZLWK QHXURQDO GLIIHUHQWLDWLRQ JURZWK DQG YLDELOLW\ &RJQLWLYH SURFHVV HOHFWURSK\VLRORJLFDO SURSHUWLHV RI KLSSRFDPSDO QHXURQV DQG DQ[LHW\ FOHDUO\ LQYROYH JOXFRFRUWLFRLG DFWLRQ DQG ERWK WKH *5 DQG WKH 05 PD\ FRQWULEXWH WR WKHVH HIIHFWV +LSSSRFDPSXV LV D NH\ VLWH IRU WKHVH IXQFWLRQV %UDLQ 05 DQG *5 DOVR DSSHDU WR UHJXODWH QHXUDO FRQWURO RI EORRG SUHVVXUH *RPH]6DQFKH] DQG *RPH]6DQFKH] .DJH\DPD DQG %UDYR 3H\VQHU HW DO f 6RPH HYLGHQFH VXJJHVWV WKDW EUDLQ 05 PRGXODWH V\PSDWKHWLF RXWIORZ DQG LW LV SRVVLEO\ PHGLDWHG E\ WKH EUDLQ UHQLQDQJLRWHQVLQ V\VWHP 7DNDKDVKL HW DO 9DQ GHQ %HUJ HW DO E9DQ GHQ %HUJ HW DO Df &XUUHQWO\ DYDLODEOH GDWD VXJJHVW DFWLYDWLRQ RI FHQWUDO 05 LQFUHDVHV V\PSDWKHWLF RXWIORZ DQG FHQWUDO *5 GHFUHDVHV RU GRHV QRW FRQWURO V\PSDWKHWLF RXWIORZ WR WKH YDVFXODU V\VWHP *RPH] 6DQFKH] HW DO YDQ GHQ %HUJ HW DO f )RU WKH HIIHFWV RQ +3$D[LV LW ZDV SURSRVHG WKDW 05 PHGLDWHV WKH WRQLF LQKLELWRU\ FRQWURO RI WKH KLSSRFDPSXV LQ +3$ DFWLYLW\ ZKHUHDV *5 PHGLDWHV WKH QHJDWLYH IHHGEDFN RI HOHYDWHG JOXFRFRUWLFRLG OHYHOV WR UHVWUDLQ +3$ GULYH GH .ORHW DQG 5HXO fVHH GHWDLO LQ VHFWLRQ KLSSRFDPSXV DQG LWV FRQQHFWLRQf 5HJXODWLRQ RI 5HFHSWRUV &RUWLFRVWHURLG UHFHSWRUV OHYHOV DUH UHJXODWHG DW PXOWLSOH OHYHOV LQFOXGLQJ P51$ DQG SURWHLQ 2DNOH\ DQG &LGORZVNL 6FKPLGW DQG 0H\HU f $W WKH SURWHLQ OHYHO

PAGE 23

VWHURLG UHFHSWRUV XQGHUJR KRUPRQH GHSHQGHQW K\SHUSKRVSKRU\ODWLRQ 2UWL HW DO :HLJHO f 5HFHQW VWXGLHV VKRZHG WKDW SKRVSKRU\ODWLRQ VWDWXV SOD\V DQ LPSRUWDQW UROH LQ UHFHSWRUfV VWDELOLW\ DQG WXUQRYHU :HEVWHU HW DK f ,W LV D PDMRU VLJQDO LQ XELTXLWLQDWLRQ DQG SURWHRVRPH PHGLDWHG GHJUDGDWLRQ DQG WKXV UHJXODWHV WKH QXPEHU RI UHFHSWRUV LQ F\WRVRO DQG WKHLU DELOLW\ WR WUDQVDFWLYDWH :DOODFH DQG &LGORZVNL f 3KRVSKRU\ODWLRQ LV WKRXJKW WR EH WKH VLJQDO WR DOORZ VXEVWUDWH UHFRJQLWLRQ E\ HQ]\PHV LQ WKH XELTXLWLQDWLRQ SDWKZD\ 3RO\XELTXLWLQDWLRQ RI D SURWHLQ LV UHFRJQL]HG E\ WKH PXOWLVXEXQLW SURWHLQ FRPSOH[ NQRZQ DV WKH SURWHDVRPH ZKLFK GHJUDGHV WKH SURWHLQ LQWR VPDOO SHSWLGHV DQG DPLQR DFLGV 7KLV LV DW OHDVW SDUW RI WKH UHDVRQV IRU OLJDQG GHSHQGHQW GRZQUHJXODWLRQ RI WKH UHFHSWRUV 6WXGLHV H[DPLQLQJ WKH KDOIOLIH RI WKH *5 SURWHLQ VHSDUDWH IURP DQ\ OLJDQG DIIHFWV RQ 51$ KDYH VKRZQ WKDW OLJDQG RFFXSDWLRQ RI WKH UHFHSWRU VLJQLILFDQWO\ GHFUHDVHV *5 SURWHLQ KDOIOLIH IURP HLJKWHHQ KRXUV WR QLQH KRXUV 'RQJ HW DO +RHFN HW DO f 3KRVSKRGHILFLHQW PXWDQW RI PRXVH *5 GRHV QRW XQGHUJR OLJDQG GHSHQGHQW GRZQUHJXODWLRQ :HEVWHU HW DO f $W P51$ OHYHO PDQ\ VWXGLHV VKRZHG WKDW JOXFRFRUWLFRLG WUHDWPHQW VLJQLILFDQWO\ GHFUHDVHG P51$ OHYHO RI *5 DQG 05 LQ PDQ\ GLIIHUHQW WLVVXHV %XPVWHLQ HW DO 'RQJ HW DO 2NUHW HW DO f $OVR DGUHQDOHFWRP\LQGXFHG VWHURLG GHSOHWLRQ HOLFLWV UHOLDEOH LQFUHDVHV LQ WKH *5 P51$ IURP b DV PHDVXUHG LQ GLIIHUHQW ODEV E\ D YDULHW\ RI PHWKRGV LQFOXGLQJ 1RUWKHUQ 51$VH SURWHFWLRQ DQG LQ VLWX K\EULGL]DWLRQ DQDO\VHV +HUPDQ HW DO D+HUPDQ .DOLQ\DN HW DO 3DWHO HW DO 3HLIIHU HW DO 5HXO HW DO 6KHSSDUG HW DO f $GUHQDOHFWRP\ HIIHFWV RQ 05 P51$ H[SUHVVLRQ DUH VPDOOHU IDOOLQJ LQ WKH b UDQJH +HUPDQ HW DO D+HUPDQ 3DWHO HW DO 5HXO HW DO f

PAGE 24

3+\GUR[\VWHURLG 'HK\GURJHQDVH 3+6'f 7KHUH LV DQ HQ]\PH FDOOHG 3+\GUR[\VWHURLG GHK\GURJHQDVH 3+6'f ,W SOD\V DQ LPSRUWDQW UROH LQ FRQWUROOLQJ WKH ORFDO WLVVXH FRQFHQWUDWLRQ RI FRUWLVRO 7ZR GLVWLQFW LVRIRUPV RI 3+6' KDYH EHHQ LGHQWLILHG 3+6' W\SH DQG W\SH 0LFKDHO HW DO 7HWVXND HW DO f 3+6' W\SH SULPDULO\ FDWDO\]HV WKH UHDFWLRQ LQ RQH GLUHFWLRQ UHVXOWLQJ LQ WKH FRQYHUVLRQ RI SK\VLRORJLFDO JOXFRFRUWLFRLGV FRUWLVRO LQ KXPDQ DQG VKHHS FRUWLFRVWHURQH LQ UDWVf WR LQDFWLYH NHWR SURGXFWV FRUWLVRQH GHK\GURFRUWLFRVWHURQHf 6HFNO f 3+6' W\SH LV ELGLUHFWLRQDO 0RQGHU DQG :KLWH f DQG KDV D UHODWLYHO\ ORZ DIILQLW\ LQ WKH X0 UDQJHf IRU FRUWLVRO DQG FRUWLFRVWHURQH ,W DSSHDUV WR SURFHHG LQ WKH GLUHFWLRQ IDYRULQJ FRQYHUVLRQ RI FRUWLVRQH WR FRUWLVRO RU GHK\GURFRUWLFRVWHURQH WR FRUWLFRVWHURQH DW SK\VLRORJLFDO JOXFRFRUWLFRLG FRQFHQWUDWLRQ 0HUFHU HW DO 0LFKDHO HW DO 0RQGHU DQG /DNVKPL 6HFNO f $V D UHVXOW 3+6' W\SH DSSHDUV WR LQDFWLYDWH JOXFRFRUWLFRLGV RQO\ ZKHQ FLUFXODWLQJ FRQFHQWUDWLRQV DUH KLJK 6HFNO f 7KLV LVRIRUP H[LVWV LQ WKH OLYHU RI PRVW VSHFLHV DQG WKH EUDLQ RI VSHFLHV LQFOXGLQJ WKH VKHHS DQG KXPDQ 6HFNO f 7KH UHODWLYH H[SUHVVLRQ RI WKH WZR W\SHV RI 3+6' LQ VSHFLILF RUJDQV PRGLILHV FRUWLVRO H[SRVXUH E\ LQWHUFRQYHUVLRQ EHWZHHQ DFWLYH DQG LQDFWLYH JOXFRFRUWLFRLGV &RUWLVRQH RU GHK\GURFRUWLFRVWHURQH GR QRW ELQG WR RU DFWLYDWH UHFHSWRUV DQG WKXV FRQWUROV FRUWLFRVWHURLGV DFFHVV WR UHFHSWRUV LQ D WLVVXH VSHFLILF PDQQHU 3+6' W\SH FRORFDOL]HV ZLWK 05 SURWHFWV 05 IURP FRUWLVRO DQG OHWV 05 FRPELQH ZLWK DOGRVWHURQH LQ WKH NLGQH\ RI PRVW VSHFLHV )XQGHU f VR WKDW LQ WKH NLGQH\ PRVW RI 05V DUH RFFXSLHG E\ DOGRVWHURQH LQVWHDG RI FRUWLVRO 'HILFLHQF\ RI 3+6' W\SH LQ KXPDQV OHDGV WR WKH V\QGURPH RI DSSDUHQW PLQHUDORFRUWLFRLG H[FHVV 6$0(f LQ ZKLFK FRUWLVRO

PAGE 25

LOOLFLWO\ RFFXSLHV 05 FDXVLQJ VRGLXP UHWHQVLRQ K\SRNDOHPLD DQG K\SHUWHQVLRQ ,Q UDWV WKLV HQ]\PH LV DOVR SUHVHQW LQ WKH EUDLQ /DNVKPL HW DO f EXW LQ HZHV WKHUH LV QR GHWHFWDEOH +6' W\SH DFWLYLW\ LQ EUDLQ ,Q WKH RYLQH EUDLQ LW LV WKRXJKW WKDW FRQYHUVLRQ LV LQ WKH RSSRVLWH GLUHFWLRQ IURP FRUWLVRQH WR FRUWLVRO .LP HW DO f DQG LW LV FDWDO\]HG E\ +6' W\SH 7KLV UHVXOWV LQ WKH SRVVLELOLW\ WKDW 05 LV QRW SURWHFWHG LQ WKH EUDLQ DQG FRUWLVRO FDQ KDYH DQ DFWLRQ YLD 05 LQ WKH EUDLQV RI VKHHS &RUWLFRVWHURLG DQG +3$ $[LV ,QWURGXFWLRQ *OXFRFRUWLFRLG VHFUHWLRQ RI WKH DGUHQDO FRUWH[ LV VWLPXODWHG E\ SLWXLWDU\ UHOHDVH RI $&7+ ZKLFK LV RQH RI WKH HQG SURGXFWV JHQHUDWHG IURP WKH ODUJH SUHFXUVRU PROHFXOH SURRSLRPHODQRFRUWLQ 320&f $&7+ LQ WXUQ LV XQGHU WKH FRQWURO RI D QXPEHU RI K\SRWKDODPLF UHOHDVLQJ DQG LQKLELWLQJ IDFWRUV RI ZKLFK &5) DQG YDVRSUHVVLQ 93f DUH WKH EHVW NQRZQ %RWK SHSWLGHV DUH FRORFDOL]HG LQ SDUYRFHOOXODU QHXURQV RI WKH SDUDYHQWULFXODU QXFOHXV 391f ZKLFK SURMHFW WR WKH PHGLDQ HPLQHQFH DQG UHOHDVH WKH SHSWLGHV LQ WKH SRUWDO YHVVHO V\VWHP 3ORWVN\ HW DO f 7KH SDUYRFHOOXODU 391 QHXURQV UHFHLYH LQIRUPDWLRQ IURP QXPHURXV EUDLQ UHJLRQV VXFK DV QXFOHL RI OLPELF V\VWHP EUDLQ VWHP QXFOHL DQG WKH VXSUDFKLDVPDWLF QXFOXHV +\SRWKDODPLF 391 DSSHDUV WR EH WKH FUXFLDO IRFXV IRU FHQWUDO UHJXODWLRQ RI WKH +3$ D[LV /HYHOV RI FRUWLFRVWHURLGV DUH WLJKWO\ UHJXODWHG E\ WKH FORVHG IHHGEDFN ORRS RI +3$ D[LV )LJ f ,W LV UHJXODWHG DW D VHW SRLQW E\ FRUWLVRO QHJDWLYH IHHGEDFN RQ $&7+ DQG &5) 'DOOPDQ HW DO Df 6PDOO SK\VLRORJLFDO LQFUHDVHV LQ SODVPD FRUWLVRO VXSSUHVV $&7+ LQ D ORJDULWKPLF PDQQHU .HOOHU:RRG DQG 'DOOPDQ f 7KH SLWXLWDU\ FRUWLFRWURSKV DQG WKH SDUYRFHOOXODU 391 DUH ZHOOHVWDEOLVKHG WDUJHWV IRU WKH VXSSUHVVLYH DFWLRQ RI KLJK

PAGE 26

DPRXQWV RI HQGRJHQRXV FRUWLFRVWHURQH RU FRUWLVRO DQG H[RJHQRXV V\QWKHWLF JOXFRFRUWLFRLGV RQ VWUHVVLQGXFHG +3$ DFWLYLW\'DOOPDQ HW DO D.HOOHU:RRG DQG 'DOOPDQ f *5 DUH DEXQGDQW LQ WKHVH FHOOV DQG WKRXJKW WR EH LQYROYHG LQ WKLV IHHGEDFN UHJXODWLRQ DIWHU VWUHVV RU VWLPXODWLRQ $V GHVFULEHG DERYH LQ VHFWLRQ RI UHFHSWRU ORFDOL]DWLRQ 05 GRHVQfW VKRZ D KLJK H[SUHVVLRQ LQ WKHVH DUHDV ,W KDV KLJKHVW DEXQGDQFH LQ KLSSRFDPSXV +LSSRFDPSXV LV DOVR DQ LPSRUWDQW VLWH LQ FRUWLVRO IHHGEDFN UHJXODWLRQ VLQFH WKH 391 QHXURQV RI K\SRWKDODPXV UHFHLYH LQSXW IURP KLSSRFDPSDO QHXURQV +LSSRFDPSDO 05V DUH LPSRUWDQW LQ WHUPV RI H[HUWLQJ LQKLELWRU\ WRQH RYHU WKH +3$ D[LV VHH GHWDLO LQ VHFWLRQ KLSSRFDPSXV DQG LWV FRQQHFWLRQf 7KHUH DSSHDU WR EH WKUHH PDMRU WLPH IUDPHV RI FRUWLFRVWHURLG DFWLRQ IDVW VHFRQGV WR PLQXWHVf LQWHUPHGLDWH KRXUVf DQG VORZ KRXUV WR GD\Vf 7KHVH WLPH IUDPHV SUREDEO\ DUH WKH FRQVHTXHQFH RI WKUHH VHSDUDWH PHFKDQLVPV RI FRUWLFRVWHURLG DFWLRQ DW IHHGEDFN VHQVLWLYH VLWHV 05 DQG *5 PHGLDWH LQWHUPHGLDWH DQG VORZ IHHGEDFN LQKLELWLRQ RI WKH D[LV LQ WKH KLSSRFDPSXV -DFREVRQ DQG 6DSROVN\ f K\SRWKDODPXV SLWXLWDU\ DQG SHUKDSV HYHQ WKH DGUHQDO LWVHOI .HOOHU:RRG DQG 'DOOPDQ f 7KH UHFHSWRUV LQYROYHG LQ IDVW IHHGEDFN LQKLELWLRQ DUH XQNQRZQ )DVW )HHGEDFN 7KH WLPH RI RFFXUUHQFH RI IDVW IHHGEDFN LV QRW FRPSDWLEOH ZLWK D QXFOHDU VLWH RI FRUWLFRVWHURLG DFWLRQ DQG SURWHLQ V\QWKHVLV LV QRW UHTXLUHG 'DOOPDQ DQG
PAGE 27

UHOHDVH DQG QRW KRUPRQH V\QWKHVLV DQG WKDW SURWHLQ V\QWKHVLV LV QRW LQYROYHG 6RPH VWXGLHV VXJJHVW WKDW IDVW IHHGEDFN DFWV WR VWDELOL]H WKH FHOO PHPEUDQH DQG WKDW IDVW IHHGEDFN LQYROYHV &Df IOX[HV ,QWHUPHGLDWH DQG 6ORZ )HHGEDFN ,QWHUPHGLDWH DQG VORZ IHHGEDFN LQKLELWLRQ UHTXLUHV JHQRPLF HYHQWV DQG SURWHLQ V\QWKHVLV .HOOHU:RRG DQG 'DOOPDQ f :KLOH LQWHUPHGLDWH IHHGEDFN LQKLELWV WKH UHOHDVH RI $&7+ DQG WKH V\QWKHVLV DQG UHOHDVH RI &5) VORZ IHHGEDFN LQKLELWV ERWK WKH V\QWKHVLV DQG UHOHDVH RI &5) DQG $&7+ .HOOHU:RRG DQG 'DOOPDQ f ,QWHUPHGLDWH DQG IDVWf IHHGEDFN ZRXOG EH H[SHFWHG WR RFFXU XQGHU SK\VLRORJLFDO FRQGLWLRQV ZKHQ LQFUHDVHV LQ SODVPD FRUWLFRVWHURLGV DUH SURGXFHG LQ UHVSRQVH WR PRGHUDWH RU SXQFWXDWH VWUHVV :KLOH VORZ IHHGEDFN ZRXOG RQO\ RFFXU XQGHU SDWKRORJLFDO FRQGLWLRQV RU XQGHU SKDUPDFRORJLFDO WUHDWPHQW RI FRUWLFRVWHURLGV ZKHQ LQFUHDVHG FRUWLFRVWHURLG FDQ EH NHSW IRU DW OHDVW VHYHUDO GD\V 8QGHU QRUPDO FRQGLWLRQV WKHUHIRUH GHFUHDVH LQ 320& P51$ V\QWKHVLV RU SLWXLWDU\ $&7+ FRQWHQW ZRXOG QRW EH H[SHFWHG WR RFFXU IROORZLQJ PRGHUDWH VWUHVV.HOOHU:RRG DQG 'DOOPDQ f 7KHVH WKUHH IHHGEDFNV KDYH WKHLU VSHFLILF UROHV LQ UHJXODWLRQ RI WKH +3$ D[LV UHVSHFWLYHO\ )DVW UDWH VHQVLWLYH IHHGEDFN FRQWUROV WKH UDWH DQG PDJQLWXGH RI $&7+ LQ UHVSRQVH WR D VWUHVV RU VWLPXODWLRQ 'HOD\HG RU LQWHUPHGLDWH IHHGEDFN PD\ OLPLW WKH UHVSRQVH RI WKH V\VWHP WR UHSHDWHG VWLPXOXV ZLWKLQ D UHODWLYHO\ VKRUW SHULRG RI WLPH KRXUVf ZKLOH VORZ IHHGEDFN OLPLW WKH UHVSRQVH WR UHSHDWHG VWLPXOXV GXULQJ SURORQJHG SHULRG RI WLPH GD\Vf.HOOHU:RRG DQG 'DOOPDQ f

PAGE 28

+LSSRFDPSXV DQG ,WV &RQQHFWLRQ 5ROH RI +LSSRFDPSXV LQ +3$ 5HJXODWLRQ 7KH LPSRUWDQFH RI PDLQWDLQLQJ JOXFRFRUWLFRLG VHFUHWLRQ ZLWK WROHUDEOH OLPLWV UHTXLUHV DQ HIILFLHQW PHFKDQLVP 7KLV SURFHVV DSSHDUV WR EH DFFRPSOLVKHG E\ PXOWLSOH SDWKZD\V $V GHVFULEHG DERYH 391 LV DQ LPSRUWDQW QHJDWLYH IHHGEDFN VLWH LQ +3$ D[LV +RZHYHU IHHGEDFN DW WKH 391 RU SLWXLWDU\ FDQ QRW DFFRXQW IRU DOO DVSHFWV RI +3$ LQKLELWLRQ $ ORW RI HYLGHQFH VXSSRUWV WKH H[LVWHQFH RI QHXURQDO LQKLELWRU\ SDWKZD\V ZRUNLQJ LQ SDUDOOHO ZLWK VWHURLG IHHGEDFN )XUWKHUPRUH WRWDO RU DQWHULRU GHDIIHUHQWDWLRQV RI WKH 391 LQFUHDVH WKH H[SUHVVLRQ RI P51$ RI &5) DQG $93 +HUPDQ HW DO f LQGLFDWLQJ WKDW WKH RQH RU PRUH QHXURQDO LQKLELWRU\ SDWKZD\V DUH DOVR UHTXLUHG IRU PDLQWHQDQFH RI EDVDO +3$ WRQH 1HXURQDO PHGLDWHG LQKLELWLRQ RI WKH +3$ D[LV PLJKW HPDQDWH IURP VHYHUDO VRXUFHV 3HUKDSV WKH PRVW LQWHQVHO\ VWXGLHG RI WKHVH KDV EHHQ WKH KLSSRFDPSXV 7KH KLSSRFDPSXV KDV EHHQ LPSOLFDWHG LQ WKH QHXURQDO UHJXODWLRQ RI WKH +3$ D[LV DFWLYLW\ E\ VHYHUDO GLIIHUHQW UHVHDUFK JURXSV )HOGPDQ DQG &RQIRUWL +HUPDQ HW DO E-DFREVRQ DQG 6DSROVN\ 0DJDULQRV HW DO 6DSROVN\ HW DO f ,PSOLFDWLRQ RI WKH KLSSRFDPSXV DV D VXSUDK\SRWKDODPLF VLWH PHGLDWLQJ JOXFRFRUWLFRLG IHHGEDFN LQKLELWLRQ RI WKH +3$ D[LV ZDV VXJJHVWHG E\ WKH GHPRQVWUDWLRQ WKDW WKH KLSSRFDPSXV H[KLELWV WKH KLJKHVW EUDLQ OHYHOV RI JOXFRFRUWLFRLG ELQGLQJ DQG KLJKDIILQLW\ UHFHSWRUV RI JOXFRFRUWLFRLG +HUPDQ -DFREVRQ DQG 6DSROVN\ f %RWK OHVLRQ DQG HOHFWULFDO VWLPXODWLRQ VWXGLHV VXJJHVW DQ RYHUDOO LQKLELWRU\ LQIOXHQFH RI WKH KLSSRFDPSXV RQ +3$ DFWLYLW\ -DFREVRQ DQG 6DSROVN\ f 'RUVDO KLSSRFDPSHFWRP\ RU WUDQVHFWLRQ RI WKH IRPL[ HOHYDWHV WKH EDVDO +3$ DFWLYLW\ DW WKH FLUFDGLDQ WURXJK LQ SDUWLFXODU DQG &5) P51$ DQG 93 P51$ H[SUHVVLRQ LQ WKH PRPLQJ+HUPDQ HW DO Ef &RQYHUVHO\

PAGE 29

VWLPXODWLRQ RI WKH KLSSRFDPSDO IRUPDWLRQ UHVXOWV LQ GHFUHDVHG +3$ DFWLYLW\ LQ ERWK UDW DQG KXPDQ -DFREVRQ DQG 6DSROVN\ f 7KH HIIHFW RI KLSSRFDPSDO PDQLSXODWLRQ RQ WKH +3$ D[LV LV fVWDWH GHSHQGHQWf YDU\LQJ ERWK GXULQJ WKH GD\ DQG ZLWK RU ZLWKRXW VWUHVV VXJJHVWLQJ D PRGXODWRU\ UROH IRU FRUWLFRVWHURLGV &DQQ\ HW DO 'H .ORHW HW DO -DFREVRQ DQG 6DSROVN\ f +LSSRFDPSDO 05V ZKLFK KDYH KLJKHU DIILQLW\ ZLWK FRUWLFRVWHURLG FRPSDUHG WR *5 DUH LPSRUWDQW LQ WHUPV RI FRQWURO RI LQKLELWRU\ WRQH RYHU WKH +3$ D[LV 7KLV HIIHFW RI FRUWLFRVWHURLG YLD 05V LV PRGXODWHG E\ *5V WKDW EHFRPH SURJUHVVLYHO\ RFFXSLHG DIWHU VWUHVV ZKLFK DOVR QHJDWLYHO\ IHHG EDFN RQ WKH 391 )LJf +LSSRFDPSXV DQG ,WV &RQQHFWLRQ ,W LV JHQHUDOO\ DFFHSWHG WKDW KLSSRFDPSDO IRUPDWLRQ SOD\V D NH\ UROH LQ DQLPDOVf UHDFWLYLW\ WR QRYHOW\ DQG SURYLGHV DQ HVVHQWLDO FRQWULEXWLRQ WR OHDUQLQJ DQG PHPRU\ *UD\ f $QDWRPLFDOO\ WKH KLSSRFDPSXV KDV WZR PDMRU RXWSXWV PXOWLV\QDSWLF SDWKZD\V WR WKH FHUHEUDO FRUWH[ DQG D PDVVLYH GHVFHQGLQJ SURMHFWLRQ GLUHFWO\ WR WKH ODWHUDO VHSWXP RI WKH EDVDO JDQJOLD ,W KDV EHHQ VKRZQ WKDW WKH GHVFHQGLQJ RXWSXW LV RUJDQL]HG LQ VXFK D ZD\ WKDW GLIIHUHQW KLSSRFDPSDO UHJLRQV PDS LQ DQ RUGHUO\ ZD\ RQWR K\SRWKDODPLF V\VWHPV PHGLDWLQJ WKH H[SUHVVLRQ RI GLIIHUHQW FODVVHV RI JRDORULHQWHG EHKDYLRU 5LVROG DQG 6ZDQVRQ f 7KLV PDSSLQJ LV FKDUDFWHUL]HG E\ D XQLGLUHFWLRQDO KLSSRFDPSRODWHUDO VHSWDO SURMHFWLRQ DQG WKHQ E\ ELGLUHFWLRQDO ODWHUDO VHSWRK\SRWKDODPLF SURMHFWLRQV DOO WRSRJUDSKLFDOO\ RUJDQL]HG 7KH EHG QXFOHXV RI WKH VWULD WHUPLQDOLV %67f PD\ FRQYH\ H[FLWDWLRQ RI WKH +3$ D[LV 7KLV OLPELF IRUHEUDLQ VWUXFWXUH OLQNV UHJLRQV VXFK DV WKH DP\JGDOD DQG KLSSRFDPSXV ZLWK K\SRWKDODPLF DQG EUDLQVWHP UHJLRQV FRQWUROOLQJ YLWDO

PAGE 30

KRPHRVWDWLF IXQFWLRQV VXFK DV WKH 391 &XOOLQDQ HW DO 0RJD HW DO :HOOHU DQG 6PLWK f ,Q VXPPDU\ KLSSRFDPSXV SOD\V DQ LPSRUWDQW UROH LQ UHJXODWLRQ RI +3 $ D[LV 8QGHU EDVDO FRQGLWLRQV 05V PHGLDWH WRQLF LQKLELWRU\ HIIHFWV RI LQ +3$ DFWLYLW\ ZKHUHDV XQGHU FRQGLWLRQ RI HOHYDWHG FRUWLVRO OHYHO WKH *5 PHGLDWHV WKH QHJDWLYH IHHGEDFN WR UHVWUDLQ +3$ GULYH GH .ORHW DQG 5HXO f +LSSRFDPSXV KDV LWV LQSXW WR 391 RI K\SRWKDODPXV YLD *$%$ FRQWDLQLQJ QHXURQV ,W KDV LWV LQKLELWRU\ HIIHFWV E\ VWLPXODWLQJ *$% $QHUJLF QHXURQV 3K\VLRORJLFDO $GDSWDWLRQ 'XULQJ 3UHJQDQF\ 3UHJQDQF\ LQYROYHV SURIRXQG FKDQJHV LQ WKH KRUPRQHV DQG WLVVXHV RI WKH UHSURGXFWLYH D[LV DQG WUDFW +RZHYHU SUHJQDQF\ DOVR LQGXFHV FKDQJHV LQ FDUGLRYDVFXODU IXQFWLRQ DQG LQ KRUPRQHV LQYROYHG LQ UHJXODWLQJ SUHVVXUH YROXPH DQG EORRG IORZ LQFOXGLQJ WKH UHQLQ DQJLRWHQVLQ V\VWHP YDVRSUHVVLQ DQG WKH +3$ D[LV &KDQJHV LQ &DUGLRYDVFXODU )XQFWLRQ LQ 3UHJQDQF\ 'XULQJ SUHJQDQF\ EORRG YROXPH LV LQFUHDVHG E\ b DQG FDUGLDF RXWSXW LV LQFUHDVHG SURSRUWLRQDWHO\ 0HDQ DUWHULDO SUHVVXUH LV GHFUHDVHG UHIOHFWLQJ GHFUHDVHG SHULSKHUDO UHVLVWDQFH &KULVWLDQVRQ 0HWFDOIH DQG 3DUHU f 7KLV LV DFFRPSDQLHG E\ D GHFUHDVH LQ YDVFXODU UHVSRQVHV WR SUHVVRU DJHQWV /RQJR f 7KHUH LV HYLGHQFH LQ D QXPEHU RI VSHFLHV WKDW EDURUHIOH[ FRQWURO RI EORRG SUHVVXUH LV DOWHUHG LQ WKH SUHJQDQW VWDWH %URRNV DQG .HLO &UDQGDOO DQG +HHVFK +HHVFK DQG 5RJHUV +XPSKUH\V DQG -RHOV ,VPD\ HW DO f WKH EDURUHFHSWRUV UHJXODWH SUHVVXUH DERXW WKH ORZHU VHWSRLQW ZLWK UHGXFHG VHQVLWLYLW\ +RUPRQH UHVSRQVHV WR K\SRWHQVLRQ DQG WR KHPRUUKDJH DUH DOWHUHG E\ SUHJQDQF\ %URRNV DQG .HLO f WKHUH LV D GHFUHDVHG UHVSRQVH WR K\SRWHQVLRQ EXW WKH UHVSRQVH WR YROXPH ORVV RFFXUV ZLWK D VPDOOHU SHUFHQW

PAGE 31

ORVV LQ SUHJQDQW VXEMHFWV 7KHVH UHVXOWV DUH FRQVLVWHQW ZLWK D UHVHW RI UHJXODWHG EORRG YROXPH WR D KLJKHU OHYHO DQG UHVHW RI EORRG SUHVVXUH WR D ORZHU OHYHO LQ WKH SUHJQDQW VWDWH 7KH DOWHUDWLRQV LQ UHJXODWHG EORRG SUHVVXUH YROXPH DQG EDURUHIOH[ UHJXODWLRQ LQ WKH SUHJQDQW VWDWH OLNHO\ UHSUHVHQWV D FRPELQDWLRQ RI HIIHFWV RI PDQ\ KRUPRQHV /RQJR f 7KH HVWURJHQ SURJHVWHURQH DQG FRUWLVROfV HIIHFWV RQ WKH UHQLQDQJLRWHQVLQ V\VWHP QLWULF R[LGH XWHURSODFHQWDO FLUFXODWLRQ PD\ DOO FRQWULEXWH WR WKHVH FKDQJHV &KDQJHV LQ 5HJXODWLRQ RI &RUWLVRO DQG $&7+ 'XULQJ 3UHJQDQF\ %DVDO DFWLYLW\ 'XULQJ SUHJQDQF\ ERWK SODVPD PDWHUQDO $&7+ DQG FRUWLVRO LQFUHDVHG LQ VKHHS DV ZHOO DV LQ KXPDQ %HOO HW DO &DUU HW DO f 7KH SODVPD FRUWLVRO OHYHO LV DOPRVW GRXEOHG FRPSDUHG ZLWK QRQSUHJQDQW VKHHS %RWK WRWDO DQG IUHH FRUWLVRO FRQFHQWUDWLRQV DUH DOVR LQFUHDVHG 3UHYLRXV VWXGLHV LQ 'U .HOOHU:RRGfV ODE VKRZHG WKDW LQ VKHHS WKH VHW SRLQW IRU WKH IHHGEDFN UHJXODWLRQ RI EDVDO SODVPD FRUWLVRO LV LQFUHDVHG GXULQJ SUHJQDQF\ .HOOHU:RRG f 7KH PHFKDQLVP RI WKH QRUPDO SUHJQDQF\ LQGXFHG LQFUHDVH LQ VHW SRLQW IRU FRUWLVRO UHPDLQV XQNQRZQ $OWKRXJK HOHYDWHG FRQFHQWUDWLRQV RI SODVPD FRUWLFRVWHURLG ELQGLQJ JOREXOLQ &%*f PD\ FRQWULEXWH WR WKH HOHYDWLRQ LQ SODVPD FRUWLVRO LQ ZRPHQ &%* FRQFHQWUDWLRQ GRHV QRW LQFUHDVH LQ WKH SUHJQDQW HZH DQG WKH FRQFHQWUDWLRQ RI WKH IUHH SODVPD FRUWLVRO LV LQFUHDVHG LQ ERWK VSHFLHV GXULQJ SUHJQDQF\ .HOOHU:RRG f ([WUDSLWXLWDU\ VHFUHWLRQ RI $&7+ RU FRUWLFRWURSLQUHOHDVLQJ KRUPRQH &5)f KDV EHHQ SURSRVHG E\ D QXPEHU RI LQYHVWLJDWRUV DV D VWLPXOXV WR DGUHQRFRUWLFDO VHFUHWLRQ LQ SUHJQDQF\ &DPSEHOO HW DO 5HHV HW DO f KRZHYHU LQ KXPDQV WKH &5) LQ SODVPD GXULQJ SUHJQDQF\ LV ERXQG WR D SURWHLQ 2UWK DQG 0RXQW 6XGD HW DO fVR WKDW RQO\ D VPDOO SURSRUWLRQ LV ELRORJLFDOO\ DFWLYH ,Q VKHHS 'U .HOOHU:RRGf ODE IRXQG WKDW WKHUH ZDV QR QHW VHFUHWLRQ RI $&7+ RU &5) IURP WKH

PAGE 32

SODFHQWD XQGHU EDVDO FRQGLWLRQV RU GXULQJ K\SR[LD LQGXFHG E\ PDWHUQDO LQKDODWLRQ RI D K\SR[LF JDV PL[WXUH 7KHUHIRUH QHLWKHU H[WUD SLWXLWDU\ VHFUHWLRQ RI $&7+ QRU H[WUD K\SRWKDODPLF VHFUHWLRQ RI &57 VHHP WR DGHTXDWHO\ H[SODLQ WKH FKDQJH LQ $&7+ RU IUHH FRUWLVRO LQ SUHJQDQF\ $OOROLR HW DO .HOOHU:RRG DQG :RRG D.HOOHU:RRG DQG :RRG Ef RU WKH FKDQJH LQ UHODWLRQVKLS EHWZHHQ FRUWLVRO DQG $&7+ )HHGEDFN VHQVLWLYLW\ 'XULQJ SUHJQDQF\ WKH IHHGEDFN UHJXODWLRQ RI +3$ D[LV KDV EHHQ DWWHQXDWHG (YLGHQFH DOVR VXJJHVWV WKH DELOLW\ RI GH[DPHWKDVRQH WR UHGXFH IUHH FRUWLVRO FRQFHQWUDWLRQV EH DWWHQXDWHG LQ WKH SUHJQDQW ZRPHQ 1ROWHQ DQG 5XHFNHUW 2GDJLUL HW DO f +RZHYHU SUHJQDQF\ GRHV QRW UHGXFH WKH DEVROXWH VXSSUHVVLRQ RI $&7+ E\ D WZRKRXU LQIXVLRQ RI FRUWLVRO LQ WKH VKHHS .HOOHU:RRG f 'HFUHDVLQJ FRUWLVRO WR OHYHOV OHVV WKDQ QRUPDO IRU SUHJQDQF\ EXW VLPLODU WR WKRVH RI QRQSUHJQDQW VXEMHFWV f FDQ GUDPDWLFDOO\ LQFUHDVH SODVPD $&7+ ,QFUHDVH LQ FRUWLVRO WR OHYHOV VLPLODU WR WKRVH GXULQJ VWUHVV GHFUHDVHV $&7+ FRQFHQWUDWLRQ LQ SUHJQDQW DQLPDOV WR WKH VDPH H[WHQW DV LQ QRQSUHJQDQW DQLPDOV.HOOHU:RRG DQG :RRG f 7KHVH UHVXOWV VXJJHVWHG WKDW GXULQJ SUHJQDQF\ WKH UHJXODWLRQ RI $&7+ E\ FRUWLVRO DW EDVDO OHYHOV EXW QRW WKH HIIHFWV RI HOHYDWHG RU VWLPXOXVLQGXFHG LQFUHDVHV LQ FRUWLVRO LV DOWHUHG 7KH +3$ D[LV IHHGEDFN VWLOO H[LVWV EXW LW KDV EHHQ VHW DW D KLJKHU OHYHO 6LQFH 05 LV WKH KLJK DIILQLW\ UHFHSWRU WKDW LV DFWLYDWHG E\ EDVDO FRQFHQWUDWLRQ RI FRUWLVRO WKH LQDELOLW\ RI ORZ FRQFHQWUDWLRQV RI FRUWLVRO WR GHFUHDVH $&7+ VXJJHVWV WKDW WKH 05PHGLDWHG PHFKDQLVP UDWKHU WKDQ WKH *5 PHGLDWHG PHFKDQLVP PD\ EH DOWHUHG GXULQJ SUHJQDQF\

PAGE 33

5ROH RI 2YDULDQ3ODFHQWDO 6WHURLG (VWURJHQ (VWURJHQV DSSHDU WR FDXVH JHQHUDOL]HG LQFUHDVHV LQ EDVDO $&7+ DQG $&7+ UHVSRQVHV WR VWLPXOL )RU H[DPSOHV IHPDOH UDWV WHQG WR KDYH KLJKHU FLUFXODWLQJ OHYHOV RI ERWK $&7+ DQG FRUWLFRVWHURQH WKDQ PDOH UDWV DQG LQ F\FOLQJ IHPDOH UDWV WKH +3$ D[LV LV VLJQLILFDQWO\ PRUH UHVSRQVLYH GXULQJ SURHVWUXV ZKHQ HVWUDGLRO OHYHOV DUH KLJKHVWf WKDQ GXULQJ HVWURXV RU GLHVWURXV 9LDX DQG 0HDQH\ f (VWURJHQV LQFUHDVH DFWLYLW\ RI WKH D[LV E\ LQFUHDVLQJ K\SRWKDODPLF &5) H[SUHVVLRQ +LURVKLJH DQG :DGD2NDGD f DGUHQDO UHVSRQVLYHQHVV WR $&7+ .LWD\ f DQG DWWHQXDWLQJ WKH JOXFRFRUWLFRLG IHHGEDFN VLJQDO %XUJHVV DQG +DQGD 5HGHL HW DO f $OWKRXJK HVWURJHQV KDYH EHHQ VKRZQ WR GHFUHDVH FRUWLFRVWHURQH ELQGLQJ FDSDFLW\ DW 05 LQ WKH KLSSRFDPSXV DQG HVWURJHQ WUHDWPHQW FDQ FDXVH D GHFUHDVH LQ WKH P51$ IRU 05 LQ WKH &$ UHJLRQ RI WKH KLSSRFDPSXV &DUH\ HW DO f WKH SURJHVWHURQH DSSHDUHG WR DWWHQXDWH WKH HIIHFWV RI HVWURJHQ RQ ERWK 05 ELQGLQJ FDSDFLW\ DQG P51$ &DUH\ HW DO f VXJJHVWLQJ WKDW LQ WKH SUHJQDQW VWDWH WKHVH HIIHFWV RI HVWURJHQ PD\ QRW EH H[SUHVVHG ,Q VXPPDU\ WKH DFWLYDWLQJ HIIHFWV RI HVWURJHQV PD\ SOD\ D UROH LQ WKH DGDSWDWLRQ RI WKH D[LV WR SUHJQDQF\ EXW VLQFH DEVROXWH IHHGEDFN VHQVLWLYLW\ LV QRW UHGXFHG GXULQJ RYLQH SUHJQDQF\ WKH HIIHFWV RI HVWURJHQV RQ IHHGEDFN GR QRW DSSHDU WR EH SK\VLRORJLFDOO\ UHOHYDQW WR SUHJQDQF\ )XUWKHU $&7+ DQG FRUWLVRO OHYHOV LQ SUHJQDQF\ DOVR GR QRW DSSHDU WR WHPSRUDOO\ IROORZ WKH SDWWHUQ RI LQFUHDVH LQ HVWURJHQV SDUWLFXODUO\ LQ VKHHS LQ ZKRP DQ LQFUHDVH LQ FRUWLVRO RFFXUV EHIRUH GD\V EXW WKH LQFUHDVH LQ HVWURJHQV SULPDULO\ HVWURQHf LV VPDOO ZLWKLQ WKH ODVW ZHHNV RI SUHJQDQF\

PAGE 34

3URJHVWHURQH 3URJHVWHURQHfV HIIHFWV RQ +3$ D[LV LV WKH WKHPH RI WKLV ZKROH GLVVHUWDWLRQ (YLGHQFH VXJJHVWV WKDW SURJHVWHURQH FRXOG DQWDJRQL]H IHHGEDFN UHJXODWLRQ RI WKH +3$ D[LV DQG KDV EHHQ WKRXJKW WR DFW DV DQ DQWLFRUWLFRVWHURLG 3URJHVWHURQH DGPLQLVWUDWLRQ UHGXFHV WKH K\SHUWHQVLYH HIIHFW RI DOGRVWHURQH /DQGDX DQG /XJLELKO f ,Q UHODWLYHO\ KLJK GRVHV SURJHVWHURQH DOVR DSSHDUV WR DQWDJRQL]H FRUWLFRLG LQKLELWLRQ RI &5) DQG $&7+ VHFUHWLRQ $ERX6DPUD HW DO 'XQFDQ DQG 'XQFDQ -RQHV DQG +LOOKRXVH f ,Q WKH DEVHQFH RI FRUWLVRO SURJHVWHURQH DSSHDUV WR KDYH SDUWLDO DJRQLVW DFWLYLW\ WR LQKLELW &5) DQG $&7+ %XFNLQJKDP 9DOH HW DO f ,Q 'U .HOOHU:RRGfV ODE GDWD KDYH VKRZQ WKDW DFXWH WUHDWPHQW ZLWK SURJHVWHURQH UHGXFHG WKH LQKLELWLRQ RI $&7+ SURGXFHG E\ LQIXVLRQ RI FRUWLVRO .HOOHU:RRG HW DO f 7KLV HIIHFW ZDV IRXQG ZLWK DQ LQIXVLRQ RI SURJHVWHURQH WKDW LQFUHDVHG SODVPD SURJHVWHURQH WR FRQFHQWUDWLRQV ZLWKLQ WKH SK\VLRORJLFDO UDQJH ,W KDV EHHQ VKRZQ WKDW SURJHVWHURQH FDQ DQWDJRQL]H 05PHGLDWHG HIIHFWV LQ YLYR 6SHQFH HW DO :DPEDFK DQG +LJJLQV f DQG LQ YLWUR -RQHV HW DO 5XSSUHFKW HW DO Ef 3URJHVWHURQH KDV YHU\ KLJK DIILQLW\ IRU WKH KXPDQ 05 EXW SURJHVWHURQH H[HUWV YHU\ ORZ WUDQVFULSWLRQDO DFWLYLW\ DIWHU ELQGLQJ 05 5XSSUHFKW HW DO Ef 3URJHVWHURQH DOVR ELQGV WR KXPDQ *5 ZLWK DQ DIILQLW\ VLPLODU WR WKDW RI FRUWLVRO DQG H[HUWV PRGHUDWH DFWLYLW\ DIWHU ELQGLQJ VXJJHVWLQJ WKDW SURJHVWHURQH FDQ DFW DV SDUWLDO DJRQLVW DW KXPDQ *5 3URJHVWHURQH KDV DQ DSSUR[LPDWHO\ HTXDO DIILQLW\ FRPSDUHG WR FRUWLVRO DW WKH RYLQH 05 DQG ORZHU DIILQLW\ IRU RYLQH *5 6WXGLHV LQ UDWV KDYH VXJJHVWHG WKDW SURJHVWHURQH WUHDWPHQW LQ YLYR DOWHUV FRUWLFRVWHURQH ELQGLQJ DW 05 &DUH\ HW DO f :H WKHUHIRUH K\SRWKHVL]HG WKDW GXULQJ SUHJQDQF\ RU GXULQJ FKURQLF SURJHVWHURQH WUHDWPHQW SURJHVWHURQH ZLOO DFW DV DQ DQWDJRQLVW WR FRUWLVRO ELQGLQJ DW 05

PAGE 35

UHGXFLQJ 05 DYDLODELOLW\ DQG LQFUHDVLQJ WKH DSSDUHQW .G RI 05 IRU FRUWLVRO 7KH ILUVW UHJLRQ ZH VWXGLHG LV KLSSRFDPSXV LQ WKLV GLVVHUWDWLRQ $V GHVFULEHG DERYH KLSSRFDPSXV LV RQH RI WKH PRVW LPSRUWDQW VLWHV ZKLFK UHJXODWHV WKH WRQLF DFWLYLW\ RI +3 $ D[LV +\SRWKDODPXV SLWXLWDU\ EUDLQVWHP DQG NLGQH\ DUH DOVR LPSRUWDQW DQG ZLOO EH VWXGLHG LQ WKH IXWXUH 6LJQLILFDQFH RI (OHYDWHG &RUWLVRO LQ 3UHJQDQF\ 7KH HOHYDWHG FRUWLVRO LV QHFHVVDU\ DQG FULWLFDO IRU QRUPDO SUHJQDQF\ ,Q H[SHULPHQWV LQ SUHJQDQW HZHV LQ 'U .HOOHU:RRGfV ODE ZH KDYH IRXQG WKDW WKHUH ZDV DQ LQFUHDVHG LQFLGHQFH RI IHWDO ORVV DQG DERUWLRQ ZKHQ HZHV ZHUH DGUHQDOHFWRPL]HG DQG UHSODFHG ZLWK FRUWLVRO WR OHYHOV OHVV WKDQ QRUPDO IRU SUHJQDQW HZHV LH QRUPDO IRU QRQSUHJQDQW HZHVf :H DUH FXUUHQWO\ VWXG\LQJ WKH UROH RI UHGXFHG PDWHUQDO FRUWLVRO RQ IHWDO YROXPH KRPHRVWDVLV DQG JURZWK ,Q KXPDQ FDVHV RI K\SHU RU K\SRFRUWLFLVP LQ SUHJQDQW ZRPHQ DUH UHODWLYHO\ UDUH EHFDXVH WKHVH FRQGLWLRQV DUH DOVR DVVRFLDWHG ZLWK LQIHUWLOLW\ +RZHYHU LW KDV EHHQ REVHUYHG WKDW ZRPDQ ZLWK XQWUHDWHG K\SHU RU K\SRFRUWLFLVP GXULQJ SUHJQDQF\ DSSHDUV WR KDYH LQFUHDVHG LQFLGHQFH RI IHWDO GHDWK RU DERUWLRQQ $URQ HW DO 2n6KDXJKQHVV\ DQG +DFNHWW 2VOHU 3LFNDUG HW DO f :KHQ $GGLVRQfV GLVHDVH SUHVHQWV GXULQJ SUHJQDQF\ WKHUH DSSHDUV WR EH D GHFUHDVH LQ ELUWK ZHLJKW UHODWLYH WR JHVWDWLRQDO DJH 2n6KDXJKQHVV\ DQG +DFNHWW 2VOHU f DQG DQ LQFUHDVHG ULVN RI PDWHUQDO GHDWK SDUWLFXODUO\ LQ ODWH JHVWDWLRQ GXULQJ ODERU RU LQ WKH LPPHGLDWH SHULSDUWXP SHULRG 'UXFNHU HW DO 6HDZDUG HW DO f &RUWLFRVWHURLGV (IIHFWV RQ 6HURWRQLQ 5HFHSWRUV 6HURWRQLQ K\GUR[\WU\SWDPLQH +7f QHXURWUDQVPLWWHU V\VWHP DQG WKH +3$ D[LV KDYH D UHFLSURFDO UHJXODWRU\ IXQFWLRQ LQ WKH IHHGEDFN PDQDJHPHQW RI DQ RUJDQLVPfV

PAGE 36

UHVSRQVH WR VWUHVV 6HURWRQHUJLF FHOO ERGLHV DUH ORFDWHG LQ WKH UDSKH DQG SURMHFW WR PDQ\ EUDLQ DUHDV LQFOXGLQJ WKH KLSSRFDPSXV K\SRWKDODPXV DQG FRUWH[ +7 UHFHSWRUV DUH SURWHLQ FRXSOHG UHFHSWRUV 6HYHQ GLVWLQFW IDPLOLHV RI +7 UHFHSWRUV +7+7f KDYH EHHQ LGHQWLILHG VR IDU 6XESRSXODWLRQV KDYH EHHQ GHVFULEHG IRU VHYHUDO RI WKHVH $W OHDVW VXESRSXODWLRQV KDYH EHHQ FORQHG 7KH +7 $ UHFHSWRU LV D VRPDWRGHQGULWLF DXWRUHFHSWRU LQ UDSKH QHXURQV WKDW PHGLDWHV D UHGXFWLRQ LQ ILULQJ UDWH 7KH +7 $ UHFHSWRU LV DOVR IRXQG SRVWV\QDSWLFDOO\ LQ EUDLQ QXFOHL UHFHLYLQJ +7 D[RQ SURMHFWLRQV ,W LV VWURQJO\ H[SUHVVHG LQ WKH KLSSRFDPSXV VHSWXP DQG RWKHU OLPELF DUHDV $OEHUW HW DO 3RPSHLDQR HW DO f DQG IXQFWLRQV DV D NH\ UHJXODWRU RI WKH OLPELF V\VWHP ,W KDV EHHQ VKRZQ WKDW +7 $ UHFHSWRU LV VXSSUHVVHG E\ FRUWLFRVWHURLGV1HXPDLHU HW DO 1LVKL DQG $]PLWLD :LVVLQN HW DO f (OHFWURSK\VLRORJLFDO VWXGLHV KDYH GHPRQVWUDWHG VXSSUHVVLRQ RI +7 LQGXFHG K\SHUSRODULDWLRQ ZLWK &$ S\UDPLGDO FHOOV DIWHU EULHI DSSOLFDWLRQ RI VWHURLGV ZKLFK DFW DW 05 DQG *5 -RHOV DQG GH .ORHW f )XUWKHUPRUH FRUWLFRVWHURLGV UHPRYDO E\ ELODWHUDO DGUHQDOHFWRP\ $';f UHVXOWV LQ DQ LQFUHDVH LQ EUDLQ KLSSRFDPSDO +7 $ UHFHSWRU P51$ H[SUHVVLRQ &KDOPHUV HW DO &KDOPHUV DQG :DWVRQ 0HLMHU DQG GH .ORHW f 8VLQJ 05 DQG *5 VHOHFWLYH OLJDQGV LQ UDWf DQG JHQH NQRFNRXW DSSURDFKHV LQ PRXVHf 0HLMHU HW DO 0HLMHU DQG GH .ORHW 1LVKL DQG $]PLWLD f 05 SULPDULO\f DQG *5 KDYH EHHQ LPSOLFDWHG LQ QHJDWLYH UHJXODWLRQ RI +7$ JHQH H[SUHVVLRQ EXW WKH SUHFLVH PHFKDQLVP UHPDLQV XQFOHDU '\VUHJXODWLRQ RI WKH VHURWRQHUJLF V\VWHP DQG DEQRUPDOLWLHV RI WKH +3$ D[LV IXQFWLRQ KDYH EHHQ LPSOLFDWHG WR EH LQYROYHG LQ QHXURSV\FKLDWULF GLVRUGHUV VXFK DV PDMRU GHSUHVVLRQ DQ[LHW\ DQG UHODWHG GLVRUGHUV )RU H[DPSOH JHQH

PAGE 37

NQRFNRXW RI WKH +7$ UHFHSWRU JHQH UHVXOWV LQ PLFH ZLWK LQFUHDVH DQ[LHW\UHODWHG EHKDYLRUV +HLVOHU HW DO 3DUNV HW DK 5DPER] HW DK f ,Q WKLV SURMHFW ZH XVH +7$ UHFHSWRU DV DQ LQGLFDWRU IRU 05 RU *5 PHGLDWHG HIIHFWV LQ KLSSRFDPSXV 6LQFH ZH SURSRVHG WKDW SURJHVWHURQH DFWV DV DQ DQWDJRQLVW RI FRUWLVRO DW 05 WR UHGXFH WKH DFWLRQ RI FRUWLVRO LQ EUDLQ ZH H[SHFWHG WR VHH WKDW WKH VXSSUHVVLRQ HIIHFWV RI FRUWLVRO DW +7$ UHFHSWRU ZRXOG EH UHGXFHG $QLPDO 0RGHOV 6KHHS DUH ZLGHO\ XVHG LQ HQGRFULQH SK\VLRORJLFDO VWXGLHV LQ SDUWLFXODU LQ WKH VWXG\ RI UHSURGXFWLYH DQG DGUHQDO JODQG FRQWURO PHFKDQLVPV 6KHHS DOVR RIIHU D JRRG PRGHO IRU PDWHUQDO SK\VLRORJ\ GXULQJ SUHJQDQF\ ,Q VKHHS DV LQ KXPDQV WKH PDWHUQDO DGUHQDO FRUWH[ LV PRUH DFWLYH LQ VHFUHWLRQ RI FRUWLVRO GXULQJ SUHJQDQF\ WKDQ GXULQJ WKH QRQSUHJQDQW VWDWH 'XULQJ RYLQH DQG KXPDQ SUHJQDQF\ PDWHUQDO SODVPD FRUWLVRO FRQFHQWUDWLRQ DSSUR[LPDWHO\ GRXEOHV %HOO HW DK 1ROWHQ DQG 5XHFNHUW f 2Q WKH RWKHU KDQG WKH IHWDO DGUHQDO FRUWH[ LV LQDFWLYH DV D VRXUFH RI FRUWLFRVWHURLGV XQWLO ODWH JHVWDWLRQ ,W KDV EHHQ FDOFXODWHG LQ RYLQH DQG SULPDWH PRGHOV WKDW WUDQVIHU RI FRUWLVRO IURP WKH PRWKHU WR WKH IHWXV WKHUHIRUH DFFRXQWV IRU PRVW WR bf SODVPD FRUWLVRO PHDVXUHG LQ WKH IHWXV EHIRUH WKH WLPH RI IHWDO DGUHQDO JODQG PDWXUDWLRQ DSSUR[LPDWHO\ RI JHVWDWLRQ +HQQHVV\ HW DK 3HSH DQG $OEUHFKW f DSSUR[LPDWHO\ GD\ LQ VKHHSf ,Q IDFW IHWDO DGUHQDOHFWRP\ EHIRUH WKDW WLPH GRHV QRW DSSUHFLDEO\ UHGXFH FRUWLVRO FRQFHQWUDWLRQ LQ WKH IHWDO FLUFXODWLRQ 5D\ HW DK f 6WXG\ RI WKH UROH RI KLJK PDWHUQDO FRUWLVRO FRQFHQWUDWLRQ DV D PHGLDWRU RI PDWHUQDO DQG IHWDO FDUGLRYDVFXODU DQG IOXLG KRPHRVWDVLV LV WKHUHIRUH RI LQWHUHVW $OVR WKHUH DUH VHYHUDO DVSHFWV RI WKH +3$ LQ VKHHS DUH VLPLODU WR KXPDQ SK\VLRORJ\ IRU H[DPSOH VHFUHWLRQ RI FRUWLVRO DV WKH PDMRU fJOXFRFRUWLFRLGf KRUPRQH E\ WKH DGUHQDO DQG WKH LQDELOLW\ WR VXUYLYH DIWHU DGUHQDOHFWRP\

PAGE 38

ZLWKRXW FRUWLFRVWHURLG UHSODFHPHQW )XUWKHU WKH DYHUDJH JHVWDWLRQ SHULRG IRU VKHHS LV DERXW GD\V ZKLFK LV PXFK ORQJHU WKDQ UDWV RU PLFH DQG ORQJ HQRXJK WR DOORZ FKURQLF DGDSWDWLRQ RI SUHJQDQF\ WR RFFXU 6LJQLILFDQFH ,QDGHTXDWH FRQWURO RI JOXFRFRUWLFRLG UHVSRQVHV PD\ OHDG WR D VHYHUH WKUHDW WR WKH KHDOWK DQG ZHOOEHLQJ RI WKH RUJDQLVP +\SHUVHFUHWLRQ RI JOXFRFRUWLFRLGV FDQ SURPRWH WKH GHYHORSPHQW RI SK\VLRORJLF DQG SV\FKRORJLFDO G\VIXQFWLRQ )RU H[DPSOH LQDSSURSULDWH UHJXODWLRQ RI VWUHVV KDV EHHQ LPSOLFDWHG LQ WKH SDWKRJHQHVLV RI V\VWHPLF GLVHDVH VXFK DV FROLWLV DVWKPD K\SHUWHQVLRQf0F(ZHQ DQG 6WHOODU f DIIHFWLYH GLVRUGHUV VXFK DV GHSUHVVLRQ SRVWWUDXPDWLF VWUHVV GLVRUGHUf&KDPH\ HW DO .DWKRO HW DO fDQG QHXURGHJHQHUDWLYH GLVHDVH VXFK DV $O]KHLPHUfV GLVHDVHf/DQGILHOG DQG (OGULGJH f $OVR WKH LQFUHDVH RI OHYHOV RI FRUWLVRO DQG $&7+ LV YHU\ LPSRUWDQW IRU QRUPDO PDWHUQDO DQG IHWDO KRPHRVWDVLV +\SHU RU K\SRFRUWLFLVP GXULQJ SUHJQDQF\ PD\ UHVXOW LQ DQ LQFUHDVHG LQFLGHQFH RI IHWDO GHDWK RU DERUWLRQ $URQ HW DO 2n6KDXJKQHVV\ DQG +DFNHWW 3LFNDUG HW DO f 5LVN RI PDWHUQDO GHDWK DOVR LQFUHDVHV VLJQLILFDQWO\ DFFRUGLQJ WR FOLQLF FDVH UHSRUWV DQG DQLPDO H[SHULPHQWV 'UXFNHU HW DO 6HDZDUG HW DO f 7KH DGUHQRFRUWLFDO V\VWHP LV YHU\ FULWLFDO IRU WKH PDLQWHQDQFH RI FDUGLRYDVFXODU KRPHRVWDVLV /RULDX[ 0DQWHUR DQG %RVFDUR f ,QFUHDVHV RU GHFUHDVHV LQ DGUHQRFRUWLFDO DFWLYLW\ PD\ OHDG DQLPDOV RU KXPDQ EHLQJV WR VXIIHU IURP GLVWXUEDQFH RI WKH FDUGLRYDVFXODU V\VWHP ,Q WKH FOLQLF WKHVH GLVWXUEDQFHV DUH VKRZQ LQ &XVKLQJfV DQG $GGLVRQnV GLVHDVHV ,Q &XVKLQJfV GLVHDVH ZKLFK LV D K\SHUFRUWLVROLVP VWDWH SDWLHQWV KDYH V\PSWRPV RI K\SHUWHQVLRQ DQG WKH EORRG YROXPH LQFUHDVHV ZKLFK OHDGV WR HGHPD ,Q $GGLVRQnV GLVHDVH SDWLHQWV KDYH V\PSWRPV RI K\SRWHQVLRQ FDXVHG E\ GHFUHDVHG JOXFRFRUWLFRLG HIIHFWV RQ YDVFXODU UHDFWLYLW\ ZKLFK FDQ EH UHYHUVHG E\ FRUWLVRO

PAGE 39

UHSODFHPHQW DQG D GHFUHDVHG FDUGLDF RXWSXW FDXVHG E\ GHFUHDVHG EORRG YROXPH 8QGHUVWDQGLQJ WKH DFWLRQ RI SURJHVWHURQH DQG FRUWLVRO LV FULWLFDO IRU XQGHUVWDQGLQJ PDQ\ FRPPRQ V\PSWRPV GXULQJ SUHJQDQF\ VXFK DV HGHPD IOXLG UHWHQWLRQf DQG UHGXFHG JOXFRVH WROHUDQFH ZKLFK DUH WKH VLJQV RI K\SHUFRUWLFLVP ZLWK JOXFRFRUWLFRLG DFWLRQ EXW DEVHQW VLJQV ZLWK PLQHUDORFRUWLFRLG DFWLRQ :KLOH DQRWKHU LQWHUHVWLQJ EXW QRW YHU\ FRPPRQ SDWKRSK\VLRORJLFDO V\PSWRP GXULQJ SUHJQDQF\ LQ VRPH ZRPHQ LV LQFUHDVHG EORRG SUHVVXUH 6HYHUH LQFUHDVHV LQ EORRG SUHVVXUH PD\ OHDG WR HFODPSVLD ZKLFK PD\ EH YHU\ GDQJHURXV IRU PDWHUQDO DQG IHWDO OLIH ,Q VRPH VHYHUH VLWXDWLRQV SUHJQDQF\ ZLOO KDYH WR EH VWRSSHG $IWHU GHOLYHU\ WKH LQFUHDVHG EORRG SUHVVXUH PD\ GHFUHDVH WR QRUPDO OHYHO VSRQWDQHRXVO\ 7KH PHFKDQLVP RI HFODPSVLD UHPDLQV XQNQRZQ XQWLO QRZ EXW FKDQJHV LQ +3$ D[LV ZLWK LQWHUDFWLRQ RI SODFHQWDO VWHURLG PD\ SOD\ D UROH RQ LW ,W LV LPSRUWDQW WKDW ZH XQGHUVWDQG WKH LQWHUDFWLRQ EHWZHHQ SURJHVWHURQH DQG FRUWLVRO GXULQJ SUHJQDQF\ LQ RUGHU WR XQGHUVWDQG WKH FKDQJH LQ UHJXODWLRQ RI $&7+ DQG WKH UROH RI HOHYDWHG FRUWLFRVWHURLGV LQ WKH FUHDWLRQ RI D QHZ KRPHRVWDVLV GXULQJ SUHJQDQF\ 2EMHFWLYHV ,Q VXPPDU\ RI WKLV OLWHUDWXUH UHYLHZ FRQFHQWUDWLRQV RI FRUWLVRO DOGRVWHURQH DQG $&7+ LQFUHDVH GXULQJ SUHJQDQF\ 6SHFLILFDOO\ WKH LQFUHDVHV LQ FRUWLVRO DQG DOGRVWHURQH VHFUHWLRQ GXULQJ SUHJQDQF\ DUH LPSRUWDQW IRU WKH QRUPDO SUHJQDQF\ DGDSWDWLRQ ,PSRUWDQWO\ FRUWLVRO H[SDQGV WKH EORRG YROXPH GXULQJ SUHJQDQF\ EHFDXVH RI ERWK JOXFRFRUWLFRLG DQG PLQHUDORFRUWLFRLG HIIHFWV DW WKH NLGQH\ DQG LQ WKH YDVFXODWXUH %RWK FRUWLVRO DQG DOGRVWHURQH DOVR DFW LQ VSHFLILF K\SRWKDODPLF DQG EUDLQVWHP QXFOHL WR DIIHFW ERWK FDUGLRYDVFXODU DQG HQGRFULQH IXQFWLRQ 7KH SK\VLRORJLFDO FKDQJHV LQ FDUGLRYDVFXODU IXQFWLRQ DUH FULWLFDO IRU SURYLGLQJ WKH PDWHUQDO HQYLURQPHQW QHFHVVDU\ IRU SURSHU IHWDO GHYHORSPHQW &RUWLVRO LV QRUPDOO\ XQGHU QHJDWLYH IHHGEDFN FRQWURO 7KLV QHJDWLYH

PAGE 40

IHHGEDFN PHFKDQLVP LV DOWHUHG LQ SUHJQDQF\ DOORZLQJ FKURQLF LQFUHDVHV LQ FRUWLVRO VHFUHWLRQ UDWH KDYH K\SRWKHVL]HG WKDW WKH SODFHQWDO VWHURLG SURJHVWHURQH DFWV WR FDXVH WKH FKDQJHV LQ UHJXODWLRQ RI WKH K\SRWKDODPXVSLWXLWDU\DGUHQDO D[LV ZKLFK UHVXOW LQ WKH LQFUHDVHG SODVPD FRUWLVRO OHYHOV DQG FRQWULEXWHV WR WKH FKDQJHV LQ FDUGLRYDVFXODU KRPHRVWDVLV LQ SUHJQDQF\ &RUWLVRO DQG DOGRVWHURQH H[HUW JOXFRFRUWLFRLG DQG PLQHUDORFRUWLFRLG HIIHFWV YLD DFWLRQ DW 05 DQG *5 &RUWLVRO DQG RWKHU VWHURLGV VXFK DV SURJHVWHURQH ELQG WR ERWK *5 DQG 05 7KHUH LV LQ YLWUR HYLGHQFH WKDW SURJHVWHURQH DFWV DV PLQHUDORFRUWLFRLG UHFHSWRU DQWDJRQLVW DQG K\SRWKHVL]H WKDW WKLV UHVXOWV LQ GHFUHDVHG 05 PHGLDWHG DFWLRQ DOWKRXJK WKH SODVPD FRQFHQWUDWLRQ RI FRUWLVRO DQG DOGRVWHURQH LQFUHDVHV ,W DOORZV WKH HIIHFW RI GHFUHDVHG EORRG SUHVVXUH LQ WKH SUHVHQFH RI LQFUHDVHG DOGRVWHURQH DQG FRUWLVRO DQG FDXVHV D UHGXFHG QHJDWLYH IHHGEDFN RQ EDVDO $&7+ ZKLFK LQ WXUQ DOORZV FKURQLF LQFUHDVHV LQ SODVPD FRUWLVRO FRQFHQWUDWLRQf ZLOO LQYHVWLJDWH WKH DFWLRQ RI WKHVH VWHURLGV XVLQJ D PROHFXODU ELRORJ\ DSSURDFK WR WKH VWXG\ RI WKH VWHURLG UHFHSWRUV 6SHFLILFDOO\ ZLOO WHVW WKH IROORZLQJ K\SRWKHVHV 3URJHVWHURQH DFWV DV DQ DQWDJRQLVW RI FRUWLVRO DW 05 DQGRU UHGXFHV 05 QXPEHU LQ WKH SUHJQDQW VWDWH WR UHGXFH WKH DFWLRQ RI FRUWLVRO LQ EUDLQ 3URJHVWHURQH GRHVQfW LQWHUIHUH ZLWK FRUWLVRO HIIHFW DW *5 EXW DV DQ DJRQLVW UHVXOWV LQ WKH FRPELQHG HIIHFW RI SURJHVWHURQH DQG FRUWLVRO DW *5

PAGE 41

K05 $% & ( )LJ 6FKHPDWLF UHSUHVHQWDWLRQ RI WKH VWUXFWXUHV RI WKH KXPDQ 05 K05f DQG *5 K*5f ZLWK WKH SHUFHQWDJH RI DPLQR DFLG LGHQWLW\ DSSHDULQJ EHWZHHQ HDFK RI WKH GRPDLQV $(f WKH ILJXUH KDV EHHQ DGDSWHG IURP $UUL]D HW DO

PAGE 42

)LJ &RQWURO RI JOXFRFRUWLFRLG VHFUHWLRQ E\ +3$ D[LV 7KH ILJXUH KDV EHHQ DGDSWHG IURP 5HLFKDUGW HW DO

PAGE 43

+\SRWKDODPXV )LJ +LSSRFDPSDO UHJXODWLRQV RI +3$ D[LV

PAGE 44

&+$37(5 *(1(5$/ 0$7(5,$/6 $1' 0(7+2'6 $QLPDO &DUH 7KH HZHV ZHUH KRXVHG DQG VWXGLHG LQ WKH +HDOWK 6FLHQFH &HQWHU $QLPDO 5HVRXUFHV 'HSDUWPHQW 7KH\ ZHUH PDLQWDLQHG LQ D FRQWUROOHG HQYLURQPHQW KRXU OLJKWGDUN F\FOH DQG D FRQVWDQW r&r& WHPSHUDWXUHf *HQHUDO 6XUJLFDO 3URFHGXUH 7KH HZHV XVHG LQ WKH H[SHULPHQWV ZHUH VXUJLFDOO\ SUHSDUHG DFFRUGLQJ WR WKH IROORZLQJ SURWRFROV %HIRUH VXUJHU\ IRRG ZDV ZLWKKHOG IURP WKH HZH IRU KRXUV %HIRUH DQG GXULQJ VXUJHU\ WKH HZH LV DQHVWKHWL]HG ZLWK KDORWKDQH bf LQ R[\JHQ $OO VXUJHU\ ZHUH SHUIRUPHG LQ WKH VXUJHU\ VXLWH RI WKH +HDOWK &HQWHU $QLPDO 5HVRXUFHV 'HSDUWPHQW $OO HZHV ZHUH WUHDWHG ZLWK DPSLFLOOLQ PJ LPf IRU GD\V SRVW RSHUDWLYHO\ DQG RQ HDFK H[SHULPHQWDO GD\ $OO DQLPDOV ZHUH DOORZHG DW OHDVW GD\V WR UHFRYHU IURP VXUJHU\ EHIRUH VWXG\ $GUHQDOHFWRP\ DQG 2YDULHFWRP\ $GUHQDOHFWRP\ RYDULHFWRP\ RU VKDP DGUHQDOHFWRP\ ZHUH SHUIRUPHG DFFRUGLQJ WR SUHYLRXVO\ SXEOLVKHG SURWRFROV %HOO HW DO .HOOHU:RRG HW DO 3HFLQV 7KRPSVRQ DQG .HOOHU:RRG f %ULHIO\ DGUHQDO JODQGV RU RYDULHV ZHUH LVRODWHG WKURXJK D PLGOLQH DEGRPLQDO LQFLVLRQ WKH YDVFXODU VXSSO\ ZDV OLJDWHG DQG DGUHQDO JODQGV RU RYDULHV ZHUH UHPRYHG

PAGE 45

9DVFXODU &DWKHWHUL]DWLRQ $OO HZHV KDG SRO\YLQ\OFKORULGH FDWKHWHUV 2' ,'f LPSODQWHG LQWR WKH IHPRUDO DUWHU\ DQG YHLQ DW WKH IHPRUDO WULDQJOH IRU VWHURLG GHOLYHU\ DQG EORRG VDPSOLQJ 7KLV PHWKRG KDV EHHQ SUHYLRXVO\ GHVFULEHG LQ GHWDLO %HOO HW DO f %ULHIO\ DQ LQFLVLRQ ZDV PDGH LQ WKH IHPRUDO WULDQJOH DQG WKH DUWHU\ DQG YHLQ ZHUH H[SRVHG (DFK YHVVHO ZDV OLJDWHG GLVWDOO\ DQG D PP FDWKHWHU ZDV DGYDQFHG DSSUR[LPDWHO\ LQFKHV LQWR WKH GHVFHQGLQJ DRUWD RU LQIHULRU YHQD FDYD (DFK FDWKHWHU ZDV VHFXUH ZLWK VXUJLFDO WLHV ILOOHG ZLWK KHSDULQL]HG VDOLQH SOXJJHG ZLWK D VWHULOH QDLO DQG URXWHG VXEFXWDQHRXVO\ ZLWK D WURFDU WR H[LW WKH IODQN :KHQ QRW LQ XVH WKH H[WHULRUL]HG FDWKHWHUV ZHUH VWRUHG LQ D SDSHU SRFNHW DQG SURWHFWHG E\ D VSDQGDJH ZUDS &KURQLF 6WHURLG ,PSODQWDWLRQ ,Q DGUHQDOHFWRPL]HG HZHV FRUWLVRO ZDV UHSODFHG WR WKH QRUPDO QRQSUHJQDQW OHYHO QJPOf E\ LPSODQWLQJ SHOOHWV RI FRUWLVRO KHPLVXFFLQDWH HVWLPDWHG UHOHDVH RI PJNJG ,QRYDWLYH 5HVHDUFK 6DUDVRWD )/f $OGRVWHURQH ZDV UHSODFHG E\ LQIXVLRQ RI DSSUR[LPDWHO\ _LJNJG (ZHV ZHUH WUHDWHG ZLWK SURJHVWHURQH E\ SODFHPHQW RI VXEFXWDQHRXV LPSODQWV IRU GD\V SULRU WR DGUHQDOHFWRP\ (ZHV ZHUH WUHDWHG ZLWK PJG IRU GD\V IROORZHG E\ WUHDWPHQW ZLWK PJG IRU WKH QH[W GD\V DQG PJG IURP WKH WLPH RI DGUHQDOHFWRP\ WKURXJK WKH WLPH RI VDFULILFH 7LVVXH &ROOHFWLRQ 7KH HZHV ZHUH NLOOHG ZLWK DQ LQWUDYHQRXV RYHUGRVH RI SHQWREDUELWDO XQGHU EDVDO FRQGLWLRQV DW OHDVW GD\V DIWHU WKH ODVW H[SHULPHQWf $V UDSLGO\ DV SRVVLEOH WKHLU FDURWLG DUWHULHV ZHUH FDQQXODWHG MXJXODU YHLQV ZHUH FXW DQG WKHLU EUDLQV ZHUH SHUIXVHG ZLWK DSSUR[LPDWHO\ / LFHFROG LVRWRQLF VDOLQH FRQWDLQLQJ b YYf GLPHWK\O VXOIR[LGH

PAGE 46

'062 6LJPD 6W /RXLV 02f 7KLV VHUYHG WR SURWHFW WKH UHFHSWRUV GXULQJ IUHH]LQJ DQG WR UHPRYH DQ\ EORRGERUQH FRUWLFRVWHURLGELQGLQJ JOREXOLQ &%*f 0DF/XVN\ HW DO f 7KH EUDLQV ZHUH TXLFNO\ UHPRYHG DQG VSHFLILF EUDLQ DUHDV ZHUH GLVVHFFWHG DQG IUR]HQ LQ OLTXLG QLWURJHQ 7KHQ WKH\ ZHUH VWRUHG DW r& XQWLO DVVD\ $OO VWXGLHV ZHUH DSSURYHG E\ WKH ,QVWLWXWLRQDO $QLPDO &DUH DQG 8VH &RPPLWWHH RI WKH 8QLYHUVLW\ RI )ORULGD DQG ZHUH LQ FRPSOLDQFH ZLWK 1,+ JXLGHOLQHV IRU WKH XVH RI DQLPDOV LQ UHVHDUFK &ROOHFWLQJ %ORRG 6DPSOHV DQG 0HDVXUHPHQW 6DPSOLQJ DQG 6WRUDJH $W WKH WLPH RI VDFULILFH LPPHGLDWHO\ SULRU WR WKH LQMHFWLRQ RI SHQWREDUELWDOf D EORRG VDPSOH ZDV WDNHQ IRU PHDVXUHPHQWV RI SODVPD FRUWLVRO DOGRVWHURQH DQG SURJHVWHURQH %ORRG VDPSOHV ZHUH FROOHFWHG LQ WXEHV FRQWDLQLQJ VRGLXP ('7$ 0 IRU DQDO\VLV RI KRUPRQHVf 7KH ZKROH EORRG VDPSOHV ZHUH SODFHG RQ LFH XQWLO WKH HQG RI WKH H[SHULPHQW 6DPSOHV ZHUH WKHQ FHQWULIXJHG DQG SODVPD DOLTXRWV ZHUH VWRUHG DW r& XQWLO DQDO\VLV +RUPRQHV &RUWLVRO $OGRVWHURQH DQG 3URJHVWHURQH 3ODVPD FRUWLVRO ZDV PHDVXUHG E\ UDGLRLPPXQRDVVD\ ZLWK DQ DQWLERG\ UDLVHG LQ RXU ODERUDWRU\ :RRG HW DO f 7KH ORZHU OLPLW RI GHWHFWLRQ LQ WKH DVVD\ LV QJPO XVLQJ DQ PO DOLTXRW RI SODVPD 3ODVPD SURJHVWHURQH DQG DOGRVWHURQH ZHUH PHDVXUHG E\ UDGLRLPPXQRDVVD\ XVLQJ NLWV REWDLQHG IURP 'LDJQRVWLF 3URGXFWV &RUS /RV $QJHOHV &$f 7KH ORZHU OLPLW RI GHWHFWLRQ RI WKH SURJHVWHURQH DVVD\ LV SJPO XVLQJ D PO DOLTXRW RI SODVPD 7KH DQWLERG\ XVHG GRHV QRW ELQG WKH DGUHQDO VWHURLGV 7KH ORZHU OLPLW RI GHWHFWLRQ RI WKH DOGRVWHURQH DVVD\ LV SJPO XVLQJ XO SODVPD

PAGE 47

)UHH &RUWLVRO DQG 3URJHVWHURQH )UHH FRUWLVRO DQG SURJHVWHURQH ZHUH HVWLPDWHG XVLQJ D PRGLILFDWLRQ RI WKH HTXLOLEULXP GLDO\VLV PHWKRG RI +DPPRQG +DPPRQG HW DO f $OLTXRWV RI SODVPD ZHUH LQFXEDWHG DW r& ZLWK +FRUWLVRO RU +SURJHVWHURQH DQG O&JOXFRVH IRU RQH KRXU DQG ERXQG DQG IUHH VWHURLG ZHUH VHSDUDWHG E\ FHQWULIXJDWLRQ DW J IRU PLQXWHV DW r& XVLQJ 0: H[FOXVLRQ ILOWHUV &HQWULIUHH 0LOOLSRUH &RUS %HGIRUG 0$f DOWKRXJK WKH VHSDUDWLRQ PHWKRG ZDV PRGLILHG WKH UHTXLUHPHQW IRU HTXLOLEULXP ZDV PDLQWDLQHG E\ DGMXVWLQJ VHSDUDWLRQ FRQGLWLRQV VR WKDW RQO\ D VPDOO TXDQWLW\ RI WKH WRWDO YROXPH ZDV ILOWHUHG DSSUR[LPDWHO\ SL RXW RI SLf 7KH UHODWLYH UDWLR RI +,& LQ ILOWUDWH ORZHU FKDPEHUf DV FRPSDUHG WR WKH QRQILOWHUHG VDPSOH XSSHU FKDPEHU RI ILOWUDWLRQ GHYLFHf LV DQ HVWLPDWH RI WKH SHUFHQW IUHH VWHURLG LQ WKH VDPSOH 5HFHSWRU %LQGLQJ $VVD\V 5HFHSWRU ELQGLQJ DVVD\V ZHUH SHUIRUPHG ZLWK +FRUWLVRO XVLQJ D PRGLILFDWLRQ RI WKH PHWKRG XVHG E\ 5HXO HW DO IRU GHWHUPLQDWLRQ RI ELQGLQJ LQ EUDLQ 5HXO DQG 'H.ORHW f *HQHUDO 0HWKRGRORJ\ 7LVVXH SUHSDUDWLRQ &\WRVRO ZDV SUHSDUHG IURP KLSSRFDPSXV DFFRUGLQJ WR SUHYLRXVO\ SXEOLVKHG SURWRFROV 5RHVFK DQG .HOOHU:RRG f%ULHIO\ KLSSRFDPSXV ZDV KRPRJHQL]HG XVLQJ D PRWRU GULYHQ 7HIORQ SHVWOH DQG JODVV WXEH :KHDWRQ 6FLHQFH 3URGXFWVf LQ D UHGXFLQJ KRPRJHQL]DWLRQ EXIIHU 5+%f ZKLFK FRQWDLQHG P0 7ULV+&/ S+ P0 VRGLXP PRO\EGDWH P0 HWK\OHQHGLDPLQHWHWUDDFHWLF DFLG b YYf JO\FHURO P0 GLWKLRWKUHLWRO DQG P0 PHUFDSWRHWKDQRO 7KH FRPSRQHQWV RI WKLV EXIIHU KDYH EHHQ

PAGE 48

VKRZQ WR VWDELO]H FRUWLFRVWHURLG UHFHSWRU +XEEDUG DQG .DOLPL f 7KH KRPRJHQDWH ZDV FHQWULIXJHG DW [ J IRU PLQXWHV DW r& WR REWDLQ D F\WRVROLF IUDFWLRQ VXSHUQDWDQWf $OLTXRWV RI F\WRVRO ZHUH VWRUHG DW r& XQWLO DVVD\HG 3URWHLQ FRQWHQW RI WKH F\WRVRO ZDV PHDVXUHG ZLWK D %UDGIRUG DVVD\ NLW %LRUDG +HUFXOHV &$f XVLQJ ERYLQH VHUXP DOEXPLQ DV WKH VWDQGDUG 7KH ELQGLQJ H[SHULPHQWV ZHUH FDUULHG RXW HVVHQWLDOO\ DV SUHYLRXVO\ GHVFULEHG 5HXO HW DO f DV PRGLILHG LQ RXU ODERUDWRU\ 5RHVFK DQG .HOOHU:RRG f ,QFXEDWLRQ &RUWLVRO LV WKH PDMRU DGUHQDO VWHURLG RI VKHHS DQG KXPDQVf DQG ELQGV WR 05 *5 DQG &%* *5 UHFHSWRU ELQGLQJ ZDV PHDVXUHG DV WKH GLIIHUHQFH EHWZHHQ ELQGLQJ LQ WKH DEVHQFH DQG SUHVHQFH RI S0 58 D VSHFLILF *5 DJRQLVW 5RXVVHO8FODI 5RPDLQYLOOH )UDQFHf 05 ZDV PHDVXUHG DV WKH GLIIHUHQFH EHWZHHQ ELQGLQJ LQ WKH SUHVHQFH RI S0 58 DQG S0 GH[DPHWKDVRQH ZKLFK ELQGV WR ERWK 05 DQG *5 EXW QRW &%* 7KH 05 DQG *5 DUH FDOFXODWHG LQ WKLV LQGLUHFW ZD\ EHFDXVH RI WKH ODFN RI D KLJK DIILQLW\ 05VSHFLILF OLJDQGV &%* ELQGLQJ ZDV GHILQHG DV WKH GLIIHUHQFH EHWZHHQ ELQGLQJ LQ WKH SUHVHQFH RI S0 GH[DPHWKDVRQH DQG S0 FRUWLVRO ,Q WKLV FDVH WKH FRUWLVRO LV LQ H[FHVV VR WKH RQO\ UHPDLQLQJ ELQGLQJ VKRXOG EH QRQVSHFLILF 7KH WDEOH EHORZ VKRZHG WKH GHWDLOHG ELQGLQJ VWDWXV LQ HDFK WXEH DQG KRZ WR FDOFXODWH WKH ELQGLQJ GDWD IRU 05 *5 DQG &%* 7KLV FDOFXODWLRQ PHWKRG ZDV RULJLQDOO\ JHQHUDWHG E\ 5HXO DQG 'H .ORHW 5HXO DQG 'H.ORHW f

PAGE 49

([SHFWHG ELQGLQJ E\ +FRUWLVRO 7XEH FRQWHQWV *5 05 &%* 16% +FRUWLVRO ; ; ; ; +FRUWLVRO [ 58 ; ; ; -+FRUWLVRO [ GH[DPHWKDVRQH ; ; +FRUWLVRO [ FRUWLVRO ; 1RWH 16% QRQ VSHFLILF ELQGLQJ ; LQ WKH FHOO VWDQGV IRU WKH ELQGLQJ E\ +FRUWLVRO DW WKH VSHFLILF VLWH &DOFXODWLRQ (TXDWLRQV 6SHFLILF *5 ELQGLQJ WRWDO ELQGLQJ RI +FRUWLVRO fELQGLQJ LQ WKH SUHVHQFH RI H[FHVV 58 6SHFLILF 05 ELQGLQJ ELQGLQJ LQ WKH SUHVHQFH RI H[FHVV 58 ELQGLQJ LQ WKH SUHVHQFH RI H[FHVV RI GH[DPHWKDVRQH 6SHFLILF &%* ELQGLQJ ELQGLQJ LQ WKH SUHVHQFH RI H[FHVV GH[DPHWKDVRQH ELQGLQJ LQ WKH SUHVHQFH RI H[FHVV FRUWLVRO 6WHURLG OLJDQGV ZHUH PDGH IUHVK IURP VWRFN HWKDQRO VROXWLRQV GULHG LQ JODVV WXEHV LQ -RXDQ HYDSRUDWLQJ FHQWULIXJH -RXDQ ,QF :LQFKHVWHU 9$f DQG WKHQ UHVXVSHQGHG LQ ELQGLQJ EXIIHU 5+%f 7KH VROYHQW RI WKH +FRUWLVRO $PHUVKDP $UOLQJWRQ +HLJKWV ,/f ZDV HYDSRUDWHG XQGHU D JHQWOH DLU VWUHDP DQG GLOXWHG LQ ELQGLQJ EXIIHU EHIRUH DGGLWLRQ WR WKH WXEHV $OO FRPSRQHQWV RI WKH ELQGLQJ UHDFWLRQ ZHUH PL[HG LQ WKH JODVV WXEHV ZLWK

PAGE 50

DGGLWLRQ RI SJ F\WRVRO EHLQJ WKH ODVW VWHS )LQDO YROXPH ZDV XO LQ HDFK WXEH %LQGLQJ ZDV DOORZHG WR SURFHHG IRU RYHUQLJKW DW r& 6HSDUDWLRQ RI ERXQG IURP IUHH 5HFHSWRUERXQG DQG IUHH OLJDQG ZHUH VHSDUDWHG RQ /+ 6HSKDGH[ FROXPQV DW r& DV SUHYLRXVO\ GHVFULEHG 5RHVFK DQG .HOOHU:RRG f &KURPDWRJUDSK\ FROXPQV ZHUH SUHSDUHG E\ SOXJJLQJ PO 3<5(;r1 VHURORJLFDO SLSHWWHV &RPLQJ ,QFf ZLWK PP GLDPHWHU ERURVLOLFDWH EHDGV .LPEOH *ODVV &RPSDQ\f 7KH FROXPQV ZHUH ILOOHG WR D KHLJKW RI FP ZLWK 6HSKDGH[ /+ 3KDUPDFLD %LRWHFK 8SSVDOD 6ZHGHQf UHFRQVWLWXWHG LQ 5+% )RU VHSDUDWLRQ RI ERXQG IURP IUHH XO RI WKH LQFXEDWH ZDV ORDGHG WR WKH WRS RI WKH FROXPQ EHG ZDVKHG LQWR WKH FROXPQ EHG ZLWK XO EXIIHU 5HFHSWRUERXQG UDGLRDFWLYLW\ HOXWHG LQ PO RI ELQGLQJ EXIIHU ZDV FRXQWHG LQ D OLTXLG VFLQWLOODWLRQ FRXQWHU %HFNPDQ /6 %HFNPDQ ,QF )XOOHUWRQ &$f ZLWK PO R VFLQWLOODQW 6FLQWLVDIH )LVKHUf &RXQWV ZHUH H[SUHVVHG DV IHPWRPROHV RI +FRUWLVRO VSHFLILFDOO\ ERXQG SHU PLOOLJUDP SURWHLQ $IWHU HDFK XVH WKH FROXPQV ZHUH ZDVKHG ZLWK YROXPHV RI PHWKDQRO DQG YROXPHV RI 5+% 'XULQJ WKH EXIIHU 5+% UHHTXLOLEUDWLRQ SRUWLRQ RI WKH ZDVK WKH EHDG EHG ZDV DJLWDWHG DQG DOORZHG WR UHVHWWOH &ROXPQV ZHUH PDLQWDLQHG DW r& 6DWXUDWLRQ %LQGLQJ $QDO\VLV 7KHVH H[SHULPHQWV ZHUH SHUIRUPHG WR GHWHUPLQH WKH ELQGLQJ DIILQLW\ .Gf RI 05 LQ WKH KLSSRFDPSXV RI VKHHS GXULQJ SUHJQDQF\ DQG ZLWK YDULRXV OHYHOV RI SURJHVWHURQH %PD[ YDOXHV ZHUH DOVR GHWHUPLQHG WR FRQILUP WKH %PD[ YDOXH RU WRWDO DYDLODEOH ELQGLQJ GHWHUPLQHG XVLQJ D VLQJOH VDWXUDWLRQ GRVH RI FRUWLVRO VHH EHORZf

PAGE 51

6DWXUDWLRQ ELQGLQJ FXUYHV ZHUH JHQHUDWHG IRU WKUHH HZHV LQ HDFK WUHDWPHQW JURXS Q HZHV WRWDOf ,Q WKHVH H[SHULPHQWV F\WRVRO IURP HDFK KLSSRFDPSXV ZDV LQFXEDWHG ZLWK LQFUHDVLQJ FRQFHQWUDWLRQV RI +FRUWLVRO IURP Q0 WR Q0 )RXU WXEHV ZHUH DVVD\HG DW HDFK FRQFHQWUDWLRQ 7ZR FRQWDLQHG IROG 58 Q0 WR S0f DQG WZR IROG GH[DPHWKDVRQH Q0 WR S0f 7KH GLIIHUHQFH EHWZHHQ WKH PHDQ ELQGLQJ LQ WKHVH WZR VHWV RI WXEHV DW HDFK +FRUWLVRO FRQFHQWUDWLRQ ZDV VSHFLILF ELQGLQJ DW 05 6DWXUDWLRQ ELQGLQJ LVRWKHUPV ZHUH FDOFXODWHG E\ QRQOLQHDU UHJUHVVLRQ DQDO\VLV RI WKH ELQGLQJ GDWD *UDSKSDG 3ULVP *UDSKSDG 6RIWZDUH ,QF 6DQ 'LHJR &$f 7KH ELQGLQJ DIILQLW\ .Gf DQG PD[LPDO ELQGLQJ FDSDFLW\ %PD[f ZHUH GHWHUPLQHG IURP WKLV FXUYH 7KH HTXDWLRQ RI WKH FXUYH ZDV < %PD[; .G ; ZKHUH %PD[ LV WKH PD[LPDO ELQGLQJ DQG .G LV WKH FRQFHQWUDWLRQ RI OLJDQG UHTXLUHG WR UHDFK KDOIPD[LPDO ELQGLQJ 7RWDO 5HFHSWRU $YDLODELOLW\ 7RWDO DYDLODEOH UHFHSWRUV PHDVXUHPHQWV DUH LQGLFDWLYH RI WKH GHJUHH RI DFWLYDWLRQ RI *5 DQG 05 7KH\ UHIOHFW WKH QXPEHU RI UHFHSWRUV WKDW KDG QRW EHHQ DFWLYDWHG LQ YLYR E\ VWHURLG VR DUH LQYHUVHO\ SURSRUWLRQDO WR WKH QXPEHU RI DFWLYDWHG UHFHSWRUV 7KLV LV EHFDXVH WKH DVVD\ FRQGLWLRQV XVHG SUHYHQW WKH UHF\FOLQJ RI 05 RU *5 IURP WKH FRQIRUPDWLRQ IROORZLQJ UHFHSWRU DFWLYDWLRQ WR WKH UHFHSWRU FRQIRUPDWLRQ UHTXLUHG IRU OLJDQG ELQGLQJ 7RWDO DYDLODEOH UHFHSWRU ZHUH PHDVXUHG LQ DOO RI WKH HZHV VWXGLHG Q SHU JURXSf XVLQJ D VLQJOH VDWXUDWLQJ FRQFHQWUDWLRQ RI +FRUWLVRO Q0 f DV SUHYLRXVO\ GHVFULEHG 05 *5 &%* DQG 16% ZHUH GHWHUPLQHG LQ WULSOLFDWH WXEHV WXEHV SHU KLSSRFDPSXVf DQG WKH PHDQ RI WKH WULSOLFDWHV XVHG IRU DQDO\VLV &%* ELQGLQJ ZDV DOZD\V OHVV WKDQ

PAGE 52

IPROPJ SURWHLQ DQG ZDV QRW VLJQLILFDQWO\ DOWHUHG E\ DQ\ RI WKH WUHDWPHQWV KHQFH LW LV QRW UHSRUWHG KHUH :HVWHUQ %ORW $QDO\VLV $Q DOLTXRW RI WKH F\WRVROLF SUHSDUDWLRQV IURP KLSSRFDPSXV RI LQGLYLGXDO HZHV ZDV DQDO\]HG E\ :HVWHUQ EORW IRU WKH WRWDO DPRXQW RI *5 DQG 05 SURWHLQV SUHVHQW LQ WKH SUHSDUDWLRQ 7KLV DOORZHG GLIIHUHQWLDWLRQ RI FKDQJHV LQ WKH OHYHO RI +FRUWLVRO ELQGLQJ GXH WR LQFUHDVHV LQ UHFHSWRU SURWHLQ IURP LQFUHDVHV LQ WKH OHYHO RI DYDLODEOH UHFHSWRU 7LVVXH 3UHSDUDWLRQ 7LVVXHV ZHUH SUHSDUHG LQ WKH VDPH ZD\ DV LQ UHFHSWRU ELQGLQJ DVVD\ 3ULRU WR JHO HOHFWURSKRUHVLV VDPSOHV ZHUH GLOXWHG LQ /DHPPOL /DHPPOL f UHGXFLQJ ORDGLQJ EXIIHU 0 7ULV+&/ b JO\FHURO YYf b 6'6 ZYf 0 PHUFDSWRHWKDQRO DQG b EURPRSKHQRO EOXHf DQG KHDWHG LQ ERLOLQJ ZDWHU IRU PLQXWHV (OHFWURSKRUHVLV DQG 7UDQVIHU SJ IRU 05f RU SJ IRU *5f RI F\WRVRO SURWHLQ SUHSDUHG IURP KLSSRFDPSXV ZDV VHSDUDWHG E\ VL]H RQ b 7ULV+&O JHOV %LRUDG +HUFXOHV &$f E\ 6'63$*( DW 9 $IWHU HOHFWURSKRUHVLV WKH SURWHLQV ZHUH WUDQVIHUUHG WR SP QLWURFHOOXORVH PHPEUDQHV %LRUDG +HUFXOHV &$f IRU KRXU DW 9 7KH PHPEUDQH ZDV ZDVKHG RQFH ZLWK SKRVSKDWH EXIIHUHG VDOLQH FRQWDLQLQJ b 7ZHHQ 3%67f DQG OHIW WR GU\ RYHUQLJKW 7KH PHPEUDQH ZDV ZHWWHG ZLWK 3%67 RQ WKH GD\ RI VWDLQLQJ 05 :HVWHUQ %ORWWLQJ 0HWKRG )RU GHWHFWLRQ RI 05 WKH EORW ZDV EORFNHG LQ b QRQIDW GULHG PLON LQ 3%67 FRQWDLQLQJ b ERYLQH VHUXP DOEXPLQ 6LJPD 6LJPD 6W /RXLV 02f IRU KRXUV DW URRP WHPSHUDWXUH 3ULPDU\ DQWLERG\ 1 6& 6DQWD &UX] %LRWHFKQRORJLHV ,QF

PAGE 53

6DQWD &UX] &$f DW D ILQDO FRQFHQWUDWLRQ RI MXJ ,J*PO f LQ EORFNLQJ VROXWLRQ ZDV LQFXEDWHG ZLWK WKH EORW IRU RYHUQLJKW DW r& 7KH EORW ZDV ZDVKHG RQFH IRU PLQXWHV DQG WZLFH IRU PLQXWHV LQ 3%67 WKHQ LQFXEDWHG ZLWK SHUR[LGDVH OLQNHG VHFRQGDU\ DQWLERG\ 6& f DW D GLOXWLRQ RI LQ 3%67b %6$ IRU KRXUV DW URRP WHPSHUDWXUH 7KH EORW ZDV ULQVHG DQG WKHQ ZDVKHG ILYH WLPHV RQFH IRU PLQXWHV DQG IRXU WLPHV IRU PLQXWHVf LQ 3%67 $IWHU ZDVKLQJ 05 EDQGV ZHUH YLVXDOL]HG ZLWK DQ HQKDQFHG FKHPLOXPLQHVFHQFH NLW 1(1 5HQDLVVDQFHp 1(1 /LIH 6FLHQFHV %RVWRQ 0$f DFFRUGLQJ WR WKH PDQXIDFWXUHUfV GLUHFWLRQV )LOPV .RGDN %LRPD[ 0/f ZHUH GHYHORSHG DQG WKH EDQGV TXDQWLILHG RQ GHQVLWRPHWHU DQG LPDJH DQDO\VLV VRIWZDUH %LR5DG *6 OLQNHG WR 4XDQWLW\ 2QH VRIWZDUH %LR5DGf 3UHOLPLQDU\ H[SHULPHQWV GHILQHG WKH DQWLERG\ FRQGLWLRQV XVHG LQ WKHVH GHWHUPLQDWLRQV DQG DOVR VKRZHG WKDW WKH DPRXQW RI SURWHLQ ORDGHG LQ HDFK ODQH RQ WKHVH JHOV ZDV DSSUR[LPDWHO\ LQ WKH FHQWHU RI WKH G\QDPLF UDQJH RI EDQG GHWHFWLRQ 7KLV HQVXUHG WKDW DQ\ FKDQJHV LQ WKH DPRXQW RI 05 RU *5 DV GHVFULEHG EHORZf SURWHLQ LQ D VDPSOH FRPSDUHG WR FRQWURO FRXOG EH UHDGLO\ GHWHFWHG 3UHOLPLQDU\ EORFNLQJ H[SHULPHQWV ZLWK FRJQDWH SHSWLGH GHFUHDVHG WKH LQWHQVLW\ RI WKH EDQG VXJJHVWLQJ WKDW LW ZDV VSHFLILF *5 :HVWHUQ %ORWWLQJ 0HWKRG *5 SURWHLQ EDQGV ZHUH GHWHFWHG XVLQJ VLPLODU PHWKRGRORJ\ DV WKDW XVHG IRU 05 H[FHSW WKH EORW ZDV EORFNHG LQ b QRQIDW GULHG PLON LQ 3%67 RYHUQLJKW DW r& $QWL *5 DQWLERG\ 3$, $IILQLW\ %LR5HDJHQWV *ROGHQ &2f DW _LJPO LQ EORFNLQJ VROXWLRQ ZDV LQFXEDWHG ZLWK WKH EORW RYHUQLJKW DW r& 3UHYLRXV VWXGLHV LQ WKHVH ODEV KDYH VKRZQ WKDW WKLV DQWLERG\ UHFRJQL]HV D N' SURWHLQ LQ VKHHS K\SRWKDODPXV DQG SLWXLWDU\ DQG LV VSHFLILF DV LW ZDV SUHDEVRUEHG E\ LPPXQL]LQJ SHSWLGH 6DRXG DQG :RRG f

PAGE 54

DFWLQ :HVWHUQ %ORWWLQJ 0HWKRG $ DFWLQ DQWLERG\ ZDV XVHG WR UHSUREH WKH PHPEUDQH DIWHU 05 DQG *5 EDQGV ZHUH GHWHFWHG WR DVVXUH WKDW HTXDO DPRXQWV RI SURWHLQ ZDV ORDGHG LQ HDFK ODQH DQG HTXDOO\ WUDQVIHUUHG WR WKH PHPEUDQH $IWHU TXDQWLILFDWLRQ RI WKH 05 RU *5 EDQGV WKH PHPEUDQH ZDV VWULSSHG DW r& IRU PLQXWHV ZLWK b 6'6 P0 7ULV+&/ 3+ DQG O22P0 "PHUFDSWRHWKRQRO 7KHQ LW ZDV ZDVKHG ZLWK 3%67 WLPHV IRU PLQXWHV HDFK 7KH PHPEUDQH ZDV EORFNHG LQ b QRQIDW GULHG PLON LQ 3%67 b %6$ DW URRP WHPSHUDWXUH IRU KRXUV $QWL 7DFWLQ DQWLERG\ $ 6LJPD 6W/RXLV 0LVVRXULf DW LQ 3%67 b%6$ ZDV LQFXEDWHG ZLWK WKH EORW IRU KRXU DW URRP WHPSHUDWXUH 7KH EORW ZDV WKHQ LQFXEDWHG ZLWK SHUR[LGDVH OLQNHG VHFRQGDU\ DQWLERG\ $f DW D GLOXWLRQ RI LQ 3%67 b %6$ IRU KRXUV DW URRP WHPSHUDWXUH $IWHU ZDVKLQJ DFWLQ EDQGV ZHUH GHWHFWHG XVLQJ VLPLODU PHWKRGRORJ\ DV WKDW XVHG IRU 05 DQG *5 573&5 6HH &KDSWHU IRU GHWDLOV 6WDWLVWLF $QDO\VLV 7KH YDOXHV RI KRUPRQH FRQFHQWUDWLRQ %PD[ RI 05*5 DQG .G RI 05 ZHUH DQDO\]HG E\ DQDO\VLV RI YDULDQFH $129$f ,QGLYLGXDO PHDQV ZHUH FRPSDUHG E\ 1HZPDQ.HXOV PXOWLSOH FRPSDULVRQ WHVW )RU :HVWHUQ EORWWLQJ VDPSOHV IURP WKH WZR DGUHQDOLQWDFW JURXSV ZHUH ORDGHG LQ RQH JHO DQG WKH VDPSOHV IURP DGUHQDOHFWRPL]HG JURXSV ZHUH UXQ LQ DQRWKHU JHO 7KH UHVXOWV RI GHQVLWRPHWULF DQDO\VLV RI WKH EORWV IRU 05 DQG *5 ZHUH DQDO\]HG E\ XQSDLUHG W WHVW IRU WZR JURXSV RI DGUHQDO LQWDFW HZHV DQG E\ $129$ IRU WKH WKUHH JURXSV RI DGUHQDOHFWRPL]G HZHV 7KH $&W FDOFXODWHG IURP UHDOn WLPH 573&5 ZDV DQDO\]HG E\ $129$ WKH IROG FKDQJH LV QRW D OLQHDU YDULDEOH VR WKDW

PAGE 55

GDWD LV QRW QRUPDOO\ GLVWULEXWHG DQG FDQQRW EH DQDO\]HG E\ $129$ 7KH QXOO K\SRWKHVLV ZDV UHMHFWHG ZKHQ 3

PAGE 56

&+$37(5 573&5 573&5 LV DQ LPSRUWDQW WRRO IRU GHWHFWLQJ RU TXDQWLWDWLQJ WKH P51$ LQ WLVVXHV RU FHOOV ,W KDV EHHQ ZLGHO\ XVHG LQ QXPHURXV DUHDV $ QXPEHU RI ZLGHO\ XVHG SURFHGXUHV H[LVW IRU GHWHFWLQJ DQG GHWHUPLQLQJ WKH DEXQGDQFH RI D SDUWLFXODU P51$ LQ D WRWDO RU SRO\ $f 51$ VDPSOH )RXU PHWKRGV DUH PRVW IUHTXHQWO\ XVHG WKH\ DUH QXFOHDVH SURWHFWLRQ DVVD\ QRUWKHUQ EORW LQ VLWX K\EULGL]DWLRQ DQG 573&5 (DFK RI WKHP KDV LQKHUHQW DGYDQWDJHV DQG OLPLWDWLRQV ,Q JHQHUDO 1RUWKHUQ DQDO\VLV LV WKH RQO\ PHWKRG WKDW SURYLGHV LQIRUPDWLRQ DERXW WUDQVFULSW VL]H ZKHUHDV QXFOHDVH SURWHFWLRQ DVVD\V DUH WKH HDVLHVW ZD\ WR VLPXOWDQHRXVO\ H[DPLQH PXOWLSOH PHVVDJHV ,Q VLWX K\EULGL]DWLRQ LV XVHG WR ORFDOL]H H[SUHVVLRQ RI D SDUWLFXODU JHQH ZLWKLQ D WLVVXH RU FHOO W\SH DQG 573&5 LV WKH PRVW VHQVLWLYH PHWKRG IRU GHWHFWLQJ DQG TXDQWLWDWLQJ JHQH H[SUHVVLRQ ,Q P\ SURMHFW FKRVH 573&5 EHFDXVH RI IROORZLQJ WZR UHDVRQV )LUVW DV GHVFULEHG DERYH 573&5 LV WKH PRVW VHQVLWLYH PHWKRG IRU GHWHFWLQJ DQG TXDQWLWDWLQJ JHQH H[SUHVVLRQ 0\ JRDO LQ WKLV UHVHDUFK SURMHFW LV TXDQWLWDWLQJ 05 DQG *5 P51$ LQ FHUWDLQ EUDLQ DUHD 6HFRQG LW LV D ZHOOGHYHORSHG WHFKQLTXH LQ 'U .HOOHU:RRGfV ODE %RWK VHPLTXDQWLWDWLYH 573&5 DQG UHDOWLPH 3&5 DUH XVHG LQ WKLV SURMHFW %\ VHPLTXDQWLWDWLYH 3&5 ZH DOVR JRW WKH SDUW RI WKH VHTXHQFH IRU RYLQH 05 ZKLFK LV QHFHVVDU\ LQ SULPHU DQG SUREH GHVLJQ IRU UHDOWLPH 3&5 7KLV FKDSWHU GHVFULEHG WKH PHWKRGRORJ\ LQ GHWDLO IRU ERWK VHPLTXDQWLWDWLYH 57 3&5 DQG UHDOWLPH 573&5 DQG VRPH GDWD REWDLQHG LQ WKH SURFHVV RI GHYHORSLQJ WKH PHWKRG

PAGE 57

6HPL4XDQWLWDWLYH 573&5 51$ ([WUDFWLRQ DQG 6DPSOH 3UHSDUDWLRQ 7RWDO 51$ ZDV H[WUDFWHG IURP PJ RI WLVVXH ZLWK 7UL]RO*,%&2%5/ *UDQG ,VODQG 1
PAGE 58

f**$$*&7&*$$7*$**$&7* f 7KH DQWLVHQVH GRZQVWUHDP SULPHU VHTXHQFH f7*7&&&&& $*$**7$&7& $& f 573&5 IRU 05 DQG *5 SURGXFHG SURGXFWV ZKRVH VL]HV ZHUH FRQVLVWHQW ZLWK WKH SUHGLFWHG SURGXFWV UHVSHFWLYHO\ $V D SRVLWLYH FRQWURO IRU HDFK 51$ SUHSDUDWLRQ DQ RYLQH DFWLQ VHTXHQFH ZDV DOVR DPSOLILHG VLPXWDQHRXVO\ LQ DGMDFHQW WXEH 7KH VHQVH XSVWUHDP SULPHU RI RYLQH DFWLQ F'1$ VHTXHQFH f*$*$$*$7*$&&&$*$7&$7*7 f 7KH DQWLVHQVH GRZQVWUHDP SULPHU VHTXHQFH f7&&$7*&&&$**$$**$$* f 6HPLTXDQWLWDWLYH 573&5 7RWDO 51$ MLJf ZDV WUHDWHG ZLWK 8 '1DVH 3URPHJDf DW D WHPSHUDWXUH RI r& IRU PLQ 7KH '1DVH UHDFWLRQ ZDV VWRSSHG E\ LQFXEDWLRQ DW r& IRU PLQ EHIRUH FRROLQJ WR r& 7KH 51$ ZDV WKHQ UHYHUVH WUDQVFULEHG LQ EXIIHU FRQWDLQLQJ 8 RI 0X/9 UHYHUVH WUDQVFULSWDVH ,P0 HDFK G173 8 51DVH LQKLELWRU DQG SPRO RI ROLJRG7f SULPHU LQ D WRWDO YROXPH RI MX DFFRUGLQJ WR WKH PDQXIDFWXUHUfV SURWRFRO 3HUNLQ(OPHU *HQH $PS 3&5 &RUH .LW 3HUNLQ(OPHU &R )RVWHU &LW\ &$ f 3UHOLPLQDU\ H[SHULPHQWV GHWHUPLQHG WKH 3&5 FRQGLWLRQV QHFHVVDU\ IRU DPSOLILFDWLRQ RI SURGXFW WR EH LQ WKH OLQHDU UDQJH %ULHIO\ WKH PL[WXUH ZDV LQFXEDWHG IRU PLQXWHV DW r& WKHQ IRU PLQXWHV DW r& 7KH 57 UHDFWLRQ ZDV VWRSSHG E\ LQFXEDWLRQ DW r& IRU PLQXWHV 7KH F'1$ VDPSOH SLf ZDV XVHG IRU DPSOLILFDWLRQ E\ VSHFLILF SULPHU IRU 05 DQG *5 3&5 UHDFWLRQV ZHUH FDUULHG RXW LQ ,; 3&5 EXIIHU FRQWDLQLQJ P0

PAGE 59

0J& P0 HDFK G173 S0 SULPHUV DQG 8 RI7DT '1$ SRO\PHUDVH 7KH F\FOLQJ SURJUDP ZDV r& IRU VHFRQGV IRU GHQDWXUDWLRQ r& IRU PLQXWH IRU DQQHDOLQJ DQG r& IRU PLQXWH IRU HORQJDWLRQ IRU F\FOHV $IWHU WKH HQG RI VW F\FOH ZH DOORZHG DQ DGGLWLRQDO PLQXWHV IRU H[WHQVLRQ 7KH 3&5 EDQGV ZHUH VHSDUDWHG E\ HOHFWURSKRUHVLV RQ b DJDURVH JHOV FRQWDLQLQJ HWKLGLXP EURPLGH DQG YLVXDOL]HG XQGHU 89 WUDQVLOOXPLQDWLRQ 7KH GHQVLW\ RI 3&5 EDQGV ZHUH GHWHUPLQHG XVLQJ D GHQVLWRPHWHU DQG LPDJH DQDO\VLV VRIWZDUH %LR5DG +HUFXOHV &$f 3&5 3URGXFW 3XULILFDWLRQ DQG 6HTXHQFLQJ 7R JHW WKH SULPHU DQG SUREH IRU UHDOWLPH 3&5 WKH VSHFLILF RYLQH VHTXHQFH RI 05 DQG *5 KDG WR EH REWDLQHG 2YLQH *5 VHTXHQFH ZDV DYDLODEOH LQ SXEOLVKHG SDSHU
PAGE 60

7KH SXULILHG '1$ ZDV VHQW WR ,QWHUGLVFLSOLQDU\ &HQWHU IRU %LRWHFKQRORJ\ 5HVHDUFK ,&%5f DW WKH 8QLYHUVLW\ RI )ORULGD IRU VHTXHQFLQJ 7KH VHTXHQFHV REWDLQHG ZHUH FRPSDUHG WR WKH SUHYLRXVO\ SXEOLVKHG RYLQH *5 VHTXHQFH DQG WKH KXPDQ 05 VHTXHQFH RYLQH 05 VHTXHQFH KDV QRW EHHQ FRPSOHWHO\ FORQHG DQG VHTXHQFHGf XVLQJ %/$67 7KH UHVXOWV RI WKH %/$67 VHDUFK VKRZHG WKH 3&5 SURGXFW IRU *5 ZDV b KRPRORJRXV WR WKH SXEOLVKHG RYLQH JOXFRFRUWLFRLG UHFHSWRU VHTXHQFH
PAGE 61

3ULPHU DQG 3UREH 'HVLJQ 3&5 SULPHUV DQG 7DTPDQ SUREH VSHFLILF IRU WKH RYLQH PLQHUDORFRUWLFRLG UHFHSWRU ZDV GHVLJQHG XVLQJ 3ULPHU ([SUHVV VRIWZDUH $SSOLHG %LRV\VWHPVf DFFRUGLQJ WR WKH VHTXHQFH ZKLFK ZDV REWDLQHG IURP UHJXODU 573&5 LQ RXU ODE )RUZDUG SULPHU $777 & $&7 $*7 $&&7*77 *$77 $7 &$7 & 5HYHUVH 3ULPHU ***$$$&77$$7$7*$77*&$&7$$$7$$$ 7DT0DQ 3UREH &7777&& $ $* $77 $ $777**&&7&7 $77& $$$*& $ 7KH SUREHV DQG SULPHUV XVHG WR GHWHFW 05 P51$ ZLOO UHFRJQL]H DOO VXEW\SHV RI 05 IRXQG LQ UDW KLSSRFDPSXV .ZDN HW DO f ZKLFK YDU\ LQ WKH f XQWUDQVODWHG UHJLRQ DQG ZLOO DOVR UHFRJQL]H WKH 05 P51$ VSOLFH YDULDQW IRXQG LQ KXPDQ EUDLQ ZKLFK KDV DGGLWLRQDO EDVH SDLUV EHWZHHQ H[RQV DQG LQ WKH '1$ ELQGLQJ GRPDLQ :LFNHUW HW DO f 3&5 SULPHUV DQG 7DTPDQ SUREH VSHFLILF IRU WKH RYLQH JOXFRFRUWLFRLG UHFHSWRU ZDV GHVLJQHG XVLQJ WKH VDPH VRIWZDUH DFFRUGLQJ WR WKH VHTXHQFH ZKLFK KDV EHHQ FORQHG DQG SXEOLVKHG DW *HQHEDQN
PAGE 62

5HDOWLPH 573&5 0L[WXUH 7KH UHDFWLRQ ZDV SHUIRUPHG LQ DQ $%, 3ULVP VHTXHQFH GHWHFWRU $SSOLHG %LRV\VWHPVf XVLQJ D 7DTPDQ 2QH6WHS 573&5 0DVWHU 0L[ 5HDJHQWV NLW $SSOLHG %LRV\VWHPVf DQG IROORZLQJ WKH SURWRFRO ODLG RXW WKHUHLQ H[FHSW WKDW WKH UHDFWLRQ YROXPH ZDV XO XO 51$ ZDV PL[HG ZLWK XO ; PDVWHU PL[ XO ; PXOWL6FULEH UHYHUVH WUDQVFULSWDVH51DVH LQKLELWRU PL[ IRUZDUG SULPHU UHYHUVH SULPHU DQG 7DTPDQ SUREH ZLWK DGGLWLRQ RI ZDWHU LQ D WRWDO YROXPH RI XO 3ULPHU SUREH DQG VWDUWLQJ 51$ FRQFHQWUDWLRQ ,QLWLDO H[SHULPHQWV GHILQHG SULPHU SUREH DQG VWDUWLQJ 51$ FRQFHQWUDWLRQ IRU WKH P51$ EHLQJ PHDVXUHG )RU HDFK JHQH ZH RSWLPL]HG WKH SULPHU FRQFHQWUDWLRQ IURP Q0 DQG SUREH FRQFHQWUDWLRQ IURP Q0 :H VHOHFW WKH SULPHU DQG SUREH FRQFHQWUDWLRQ ZKLFK JDYH WKH ORZHVW &W DQG KLJKHVW $5Q $IWHU WKHVH RSWLPL]DWLRQV ZH SHUIRUPHG YDOLGDWLRQ H[SHULPHQW E\ XVLQJ LQFUHDVLQJ DPRXQW RI 51$ LQSXW IRU LQWHUHVWHG JHQH DQG U51$ WR YHULI\ WKDW WKH\ KDG WKH VDPH DPSOLILFDWLQ HIILFLHQF\ 7KH ILQDO FRQFHQWUDWLRQV RI SULPHU DQG SUREH IRU 05 ZHUH Q0 IRUZDUG SULPHU Q0 UHYHUVH SULPHU DQG Q0 SUREH 7KH ILQDO FRQFHQWUDWLRQV RI SULPHU DQG SUREH IRU *5 ZHUH Q0 HDFK RI IRUZDUG DQG UHYHUVH SULPHU Q0 SUREH 7KH ILQDO FRQFHQWUDWLRQV RI SULPHU DQG SUREH IRU V U51$ ZKLFK ZDV XVHG DV LQWHUQDO FRQWURO IRU QRUPROL]DWLRQ RI WKH VDPSOHVf YDULDWLRQ ZHUH Q0 HDFK RI IRUZDUG SULPHU DQG UHYHUVH SULPHU Q0 SUREH O22QJ 51$ ZDV DGGHG IRU 05 O2QJ 51$ ZDV DGGHG IRU *5 DQG QJ 51$ ZDV DGGHG IRU U51$ LQ HDFK UHDFWLRQ

PAGE 63

573&5 F\FOHV 5HYHUVH WUDQVFULSWLRQ ZDV FDUULHG RXW DW r& IRU PLQ 7KHUPDO F\FO\LQJ IRU 3&5 ZDV LQLWLDWHG ZLWK LQFXEDWLRQ DW r& IRU PLQ IRU DFWLYDWLRQ RI $PSOL7DT *ROG '1$ SRO\PHUDVH $IWHU WKLV LQLWLDO VWHS F\FOHV RI 3&5 ZHUH SHUIRUPHG (DFK F\FOH FRQVLVWHG RI KHDWLQJ DW r& IRU V IRU PHOWLQJ DQG r& IRU OPLQ IRU DQQHDOLQJ DQG H[WHQVLRQ ([SUHVVLRQ RI 'DWD (DFK VDPSOH ZDV DQDO\]HG LQ WULSOLFDWH IRU 05 *5 DQG U51$ 7KH GDWD ZDV DQDO\]HG E\ FDOFXODWLQJ WKH WKUHVKROG QXPEHU RI F\FOHV &Wf DQG GHWHUPLQLQJ $&W EHWZHHQ WKH PHDQ &W IRU HDFK JHQH DQG WKH PHDQ &W IRU U51$ IURP WKH VDPH VDPSOH GLIIHUHQFHV DPRQJ JURXSV ZHUH DQDO\]HG E\ $129$ XVLQJ WKH $&W GDWD 7KH IROG FKDQJH LQ P51$ UHODWLYH WR FRQWURO FDQ WKHQ EH FDOFXODWHG DV n$$&W ZKHUH $$&W $&W LQ HDFK DQLPDO LQ WKH H[SHULPHQWDO JURXS PHDQ $&W LQ WKH FRQWURO JURXS QRQSUHJQDQW DGUHQDO LQWDFW HZHVf &RUWLFRVWHURLG 5HFHSWRU 5HJXODWLRQ LQ 6KHHS DIWHU $FXWH $GUHQDOHFWRP\ ,QWURGXFWLRQ ,Q WKHVH H[SHULPHQWV ZH PHDVXUHG WKH OHYHOV RI P51$ IRU WKH 05 DQG *5 LQ KLSSRFDPSXV DQG NLGQH\ WR WHVW ZKHWKHU UHFHSWRU JHQH H[SUHVVLRQ LV LQFUHDVHG XQGHU FRQGLWLRQV RI DFXWH ZLWKGUDZDO RI DGUHQDO VWHURLGV LQ DGXOW IHPDOH HZHV 7KH UHDVRQV IRU VWXG\LQJ WKH HIIHFWV RI DGUHQDOHFWRP\ LQ WKH VKHHS DUH DV IROORZV )LUVW ZH ZDQWHG WR H[DPLQH WKH UHFHSWRU UHJXODWLRQ LQ WKH DFXWH DQG FRPSOHWH DEVHQFH RI VWHURLG LQ VKHHS 7KHUH DUH VLPLODU VWXGLHV LQ WKLV DUHD EXW QR VWXG\ KDV EHHQ GRQH LQ VSHFLHV RI VKHHS 6HFRQG LW LV SDUW RI WKH VWXG\ RI FKDUDFWHUL]DWLRQ RI RYLQH FRUWLFRVWHURLG UHFHSWRUV ,Q WKLV

PAGE 64

VWXG\ UHFHSWRUELQGLQJ DVVD\ ZDV XVHG WR HVWLPDWH RI WKH WRWDO QXPEHU RI UHFHSWRUV ZKHQ FRUWLVRO OHYHO ZDV FORVH WR ]HUR 7KLV LV D SDUDPHWHU GLIILFXOW WR GLUHFWO\ GHWHUPLQH IRU VWHURLG UHFHSWRUV EHFDXVH RI WKH LQDELOLW\ RI DFWLYDWHG UHFHSWRUV WR UHELQG VWHURLG XQGHU WKH FRQGLWLRQV XVHG LQ ELQGLQJ DVVD\V &KRX DQG /XWWJH *DOLJQLDQD HW DO f 7KLV SURYLGHV ERWK D PD[LPXP ELQGLQJ FDSDFLW\ IRU FRPSDULVRQ ZLWK RWKHU PRUH SK\VLRORJLF VWDWHV DQG DOORZV DQ HVWLPDWLRQ RI WKH SHUFHQW RFFXSDQF\ RI WKH 05 DQG *5 DW SK\VLRORJLF FRQFHQWUDWLRQV RI VWHURLG .QRZLQJ ZKHWKHU WKHUH LV D UHJXODWLRQ RI UHFHSWRU LQ FRQGLWLRQ RI DFXWH ZLWKGUDZDO RI VWHURLG RU FRPSOHWH DEVHQFH RI VWHURLG LV D XVHIXO LQIRUPDWLRQ ZKHQ LQWHUSUWDWH WKH GDWD IURP UHFHSWRUELQGLQJ DVVD\ 0HWKRGV 7HQ DGXOW IHPDOH VKHHS RI PL[HG EUHHG ZHUH UDQGRPO\ DVVLJQHG WR WZR JURXSV 7KH ILUVW JURXS ZDV RYDULHFWRPL]HG DQG VKDPDGUHQDOHFWRPL]HG fDGUHQDOLQWDFWf $',f 7KH VHFRQG JURXS ZDV RYDULHFWRPL]HG DQG DGUHQDOHFWRPL]HG fDGUHQDOHFWRPL]HGf $';f DFFRUGLQJ WR SUHYLRXVO\ SXEOLVKHG SURWRFROV .HOOHU:RRG HW DO f 7KH DGUHQDOHFWRPL]HG HZHV ZHUH PDLQWDLQHG RQ UHSODFHPHQW LQIXVLRQV RI FRUWLVRO DQG DOGRVWHURQH IRU RQH ZHHN DIWHU VXUJHU\ WR DOORZ WKHP WR UHFRYHU IURP WKH VXUJLFDO VWUHVV 7KH UHSODFHPHQW VWHURLG LQIXVLRQV PJNJG FRUWLVRO DQG SJNJG DOGRVWHURQHf ZHUH WKHQ ZLWKGUDZQ IURP WKH DGUHQDOHFWRPL]HG HZHV DQG WKHLU EORRG SUHVVXUH DQG EORRG SRWDVVLXP OHYHOV ZHUH PHDVXUHG DV SUHYLRXVO\ GHVFULEHG 2UEDFK HW DO f 2QFH WKH HZHV VKRZHG VLJQV RI K\SRDGUHQRFRUWLFLVP GHILQHG DV PHDQ DUWHULDO EORRG SUHVVXUH EHORZ PP +J DQG RU VHUXP SRWDVVLXP DERYH P(TG/ WKH HZHV ZHUH NLOOHG ZLWK DQ RYHUGRVH RI SHQWREDUELWRO 6KDPDGUHQDOHFWRPL]HG HZHV ZHUH NLOOHG DW WKH VDPH WLPH DIWHU VXUJHU\ DV WKH DGUHQDOHFWRPL]HG DQLPDOV 7KHLU EUDLQV ZHUH SHUIXVHG ZLWK LFHFROG

PAGE 65

LVRWRQLF VDOLQH FRQWDLQLQJ b YYf '062 6LJPD 6W/RXLV 02f 7KLV VHUYHG WR SURWHFW WKH UHFHSWRUV GXULQJ GXULQJ IUHH]LQJ DQG WR UHPRYH DQ\ EORRG ERUQH FRUWLFRVWHURLGELQGLQJ JOREXOLQ &%*f 0DF/XVN\ HW DO f 7KH EUDLQV ZHUH GLVVHFWHG DQG IUR]HQ LQ D GU\ LFHDFHWRQH EDWK DQG WKHQ VWRUHG DW r& XQWLO DVVD\ 5HVXOWV 6HPL4XDQWLWDWLYH DQDO\VLV RI P51$ IRU 05 DQG *5 05 DQG *5 LQ KLSSRFDPSXV DQG NLGQH\ ZHUH FRPSDUHG EHWZHHQ WKH $'; JURXS DQG FRQWURO JURXSV XVLQJ VHPLTXDQWLWDWLYH 573&5 6HTXHQFH DQDO\VLV RI WKH SURGXFWV VKRZHG WKDW WKH *5 SURGXFW ZDV b KRPRORJRXV WR WKH SXEOLVKHG RYLQH *5 VHTXHQFH 7KH 05 SURGXFW ZDV b LGHQWLFDO WR WKH KXPDQ 05 VHTXHQFH +HQFH ZH EHOLHYH WKDW WKH 3&5 SURGXFWV ZHUH GHULYHG IURP WKH 51$ IRU *5 DQG 05 7KHUH ZDV QR VLJQLILFDQW GLIIHUHQFH EHWZHHQ VWHDG\VWDWH P51$ OHYHOV LQ WKH KLSSRFDPSXV RI FRQWURO RU DGUHQDOHFWRPL]HG HZHV IRU HLWKHU 05 RU *5 )LJXUH UHODWLYH RSWLFDO GHQVLWLHV 05 s LQ $'; YHUVXV s LQ $', *5 s LQ $'; YHUVXV s LQ $', Q LQ HDFK JURXSf 7KHUH ZDV DOVR QR VLJQLILFDQW GLIIHUHQFH LQ VWHDG\VWDWH OHYHOV RI P51$ IRU HLWKHU UHFHSWRU LQ WKH NLGQH\V RI WKHVH DQLPDOV *5 s LQ $'; DQG s LQ $', 05 s LQ $'; DQG s LQ $', Q LQ HDFK JURXS )LJXUH f 6HTXHQFH RI 3&5 SURGXFW RI 05 DQG *5 6LQFH QR RYLQH 05 KDV EHHQ FORQHG ZH VHQW WKH SURGXFWV RI WKH 3&5 UHDFWLRQV WR ,&%5 '1$ VHTXHQFLQJ FRUH ODEV LQ WKH 8QLYHUVLW\ RI )ORULGD $W WKH VDPH WLPH ZH FDQ DOVR FKHFN LI WKH SURGXFW LV WKH SURGXFW ZH H[SHFWHG 7KH *5 VHTXHQFH REWDLQHG ZDV

PAGE 66

$$*&&7&77& 7777$&&**$ &*&7$$*&&7 $$$$77$$$* $7 $ $7 ** $* $ 777*$7&77$ &&$$*7&&7$ $&$*7*7*&& $&7*&&&&$$ *7*$$$$&$* $$$$$*$$*$ 7777$7&*$$ &7&7*&$&&& &7****7$$7 7$$*&$**$* $$$&7***&& &$*777$77* 7&$**&&$*& 777&&7**** &&$$&$7$$7 7**&$$7$$$ $7*7&7*&&$ 777&7*77&$ 7**7*7*$*7 $&&7&7**** *$&$$ 7KH 05 VHTXHQFH REWDLQHG ZDV $*$$$$***7 7*$7&&&$*& *&7*&&$7&7 &&&**&&77* ***&7&&&&$ *&7&7$*&77 77$**7777* *$$$$*$$7$ &*$777&$&7 *$*7$&&7*7 7*$77$7&$7 &$&7777&&$ $*$77$$777 **&&7&7$77 &$$$*&$*77 7$777$*7*& $$7&$7$77$ $*777&&&&$ $$* $7 $7 $7 $ 7$7$7$7*77 7*7*$777** **&$$*$*$$ $$$*&&$7$& $77*&$7&$* 7*& 7KH VHTXHQFHV REWDLQHG ZHUH FRPSDUHG WR WKH SUHYLRXVO\ SXEOLVKHG RYLQH *5 VHTXHQFH DQG WKH KXPDQ 05 VHTXHQFH RYLQH 05 KDV QRW EHHQ FRPSOHWHO\ FORQHG DQG VHTXHQFHGf XVLQJ %/$67 7KH UHVXOWV RI WKH %/$67 VHDUFK VKRZHG WKH 3&5 SURGXFW IRU *5 ZDV b KRPRORJRXV WR WKH SXEOLVKHG RYLQH JOXFRFRUWLFRLG UHFHSWRU VHTXHQFH
PAGE 67

ZHHNV E\ VXSSO\LQJ VDOW ZDWHU WR GULQN +RZHYHU LQFUHDVHG VRGLXP LQWDNH LV QRW D VXIILFLHQW WUHDWPHQW IRU DGUHQDOHFWRPL]HG VKHHS RU KXPDQ 6HFRQGO\ LW LV SRVVLEOH WKDW RXU PHWKRG RI H[DPLQLQJ D ODUJH SRUWLRQ RI WKH KLSSRFDPSXV PDVNHG DQ\ UHJLRQDO FKDQJHV ZLWKLQ WKH KLSSRFDPSXV 6RPH UHJLRQV PD\ KDYH XQGHUJRQH XSUHJXODWLRQ RI WKH UHFHSWRUV GXH WR ODFN RI VWHURLG ZKLOH RWKHU UHJLRQV RI WKH KLSSRFDPSXV ZKHUH VWHURLG LV UHTXLUHG WR NHHS WKH FHOOV YLDEOH PD\ KDYH XQGHUJRQH DSRSWRVLV ,W KDV EHHQ SURSRVHG WKDW 05 PHGLDWH FHOO VXUYLYDO LQ WKH KLSSRFDPSXV DQG DGUHQDOHFWRP\ UHVXOWV LQ ORVV RI FHOOV LQ GHQWDWH J\UXV 5HDJDQ DQG 0F(ZHQ :RROOH\ HW DO f ,Q WKLV VLWXDWLRQ WKH DYHUDJH UHFHSWRU QXPEHU RU PHVVDJH RU SURWHLQ ZRXOG DSSHDU WR EH XQFKDQJHG E\ VWHURLG ZKHUHDV LQ IDFW UHJXODWLRQ PD\ KDYH RFFXUUHG LQ VXEUHJLRQV 05 ([SUHVVLRQ LQ /DWH*HVWDWLRQ 2YLQH )HWDO /XQJ ,QWURGXFWLRQ 7KH UROH RI WKH JOXFRFRUWLFRLG VXFK DV FRUWLVRO DQG EHWDPHWKDVRQH LQ DFFHOHUDWLQJ WKH PDWXUDWLRQ RI WKH OXQJ DQG LQ SURGXFWLRQ RI VXUIDFWDQW LV ZHOO NQRZQ )URK DQG %DOODUG f ,W KDV EHHQ ZLGHO\ XVHG LQ FOLQLFV *5 KDV EHHQ IRXQG LQ IHWDO OXQJV ODWH LQ JHVWDWLRQ DQG DUH ORFDOL]HG LQ DOYHRODU W\SH ,, FHOOV ZKLFK SURGXFH VXUIDFWDQW DV ZHOO DV ILEUREODVWV DQG HSLWKHOLDO FHOOV +RZHYHU VWXGLHV VKRZHG WKDW FRUWLFRVWHURLGV PD\ DOVR SDUWLFLSDWH LQ UHDEVRUSWLRQ RI OXQJ OLTXLG DW ELUWK LQ IHWDO VKHHS DQG JXLQHD SLJV%DUNHU HW DO +DUGLQJ f $OGRVWHURQH RU FRUWLVRO DORQH ERWK VLJQLILFDQWO\ GHFUHDVH WKH UDWH RI OXQJ OLTXLG SURGXFWLRQ 7KLV HIIHFWV RI DOGRVWHURQH DQG FRUWLVRO VXJJHVWV WKDW 05 ZKLFK KDV KLJK DIILQLW\ ZLWK DOGRVWHURQH DQG FRUWLVRO PD\ PHGLDWH WKLV HIIHFW ,Q WKLV VWXG\ ZH H[DP 05 JHQH H[SUHVVLRQ LQ WKH IHWDO OXQJ E\ XVLQJ ERWK VHPLTXDQWLWDWLYH 573&5 DQG UHDOWLPH 573&5 7KLV LV WKH SDUW RI WKH ZKROH VWXG\ ZKLFK DOVR LQFOXGH H[DPLQJ WKH UHODWLYH ORFDWLRQ RI WKH 1D. $73DVH LVRIRUP LQ OXQJ ,Q

PAGE 68

IHWDO OXQJ VRGLXP UHDEVRUSWLRQ LV WKRXJKW WR EH GHSHQGHQW XSRQ 1D. $73DVH DFWLYLW\ DFWLQJ LQ FRQFHUW ZLWK OXPLQDO 1D LQIOX[ +DUGLQJ f 0HWKRGV /XQJV ZHUH FROOHFWHG IURP IHWDO VKHHS GD\Vf JHVWDWLRQf DW VDFULILFH 3XOPRQDU\ WLVVXH IRU DQDO\VLV RI P51$ ZDV LPPHGLDWHO\ VQDSIUR]HQ LQ 51$VHIUHH WXEHV LQ D GU\ LFHDFHWRQH EDWK DQG VWRUHG DW r& XQWLO DQDO\VLV 5HVXOWV :H XVHG ERWK VHPLTXDQWLWDWLYH 573&5 DQG UHDOWLPH 3&5 WHFKQRORJ\ WR LGHQWLI\ 05 P51$ LQ OXQJV FROOHFWHG IURP D ODUJH JURXS RI DQLPDOV GD\fV JHVWDWLRQf 05 P51$ ZDV GHWHFWHG LQ VDPSOHV RI IRXU IHWDO OXQJV XVLQJ VHPLTXDQWLWDWLYH 573&5 )LJ f %\ UHDOWLPH 573&5 05 P51$ ZDV DOVR LGHQWLILHG LQ WKH OXQJV RI HOHYHQ IHWDO VKHHS )LJ WRS OHIW SDQHOf ,Q WKH IHWDO OXQJV WKH JHQHUDWLRQ RI F'1$ ZDV VLJQLILFDQWO\ JUHDWHU WKDQ WKH JHQHUDWLRQ RI SURGXFW LQ UHDFWLRQ LQ ZKLFK WKHUH ZDV QR DGGHG P51$ )LJ fQR 51$ FRQWUROff 05 P51$ ZDV XQGHWHFWDEOH LQ WKH OXQJV RI VHYHQ SUHJQDQW HZHV )LJ WRS ULJKW SDQHOf 3URGXFW JHQHUDWLRQ LQ VDPSOHV IURP PDWHUQDO OXQJV ZDV QRW GLIIHUHQW WKDQ WKDW RI WKH QHJDWLYH FRQWURO 7KHUH ZDV QR LQIOXHQFH RI IHWDO JHVWDWLRQDO DJH RQ WKH DEXQGDQFH RI 05 P51$ LQ WKH IHWDO OXQJV QRUPDOL]HG WR WKH DEXQGDQFH RI 6 U51$ )LJ ERWWRP SDQHOf 'LVFXVVLRQ 7KH GDWD IURP VHPLTXDQWLWDWLYH 573&5 LV FRQVLVWHQW ZLWK WKH GDWD IURP UHDOWLPH 573&5 7KLV LPSOLHV WKDW WKH PHWKRG RI UHDOWLPH 3&5 ZRUNV ZHOO DQG GDWD LV YDOLG VLQFH WKLV LV WKH ILUVW GDWD REWDLQHG IURP UHDOWLPH 3&5 LQ RXU ODERUDWRU\ :H DOVR PHDVXUHG P51$ RI 05 LQ PDQ\ GLIIHUHQW WLVVXHV LQFOXGLQJ PDQ\ GLIIHUHQW EUDLQ UHJLRQV 0RVW RI WKHP KDYH GHWHFWDEOH P51$ RI 05 7KLV LPSOLHV WKDW P51$ RI 05 LV

PAGE 69

XQGHWHFWDEOH LQ PDWHUQDO OXQJ LV QRW D SUREOHP FDXVHG E\ WLVVXH VSHFLILF GHWHFWLRQ IURP SULPHU RU SUREH

PAGE 70

(WKLGLXP EURPLGHVWDLQHG 3&5 SURGXFWV IRU 05 *5 DQG 3DFWLQ IURP $', RU $'; VKHHS KLSSRFDPSXV 67' $ % & $ % & $ % & $ % 05 DQG *5 VSHFLILF 3&5 SURGXFWV LQ KLSSRFDPSXV RI $', DQG $'; HZHV >==,$', ‘ $'; )LJ 7RWDO 51$ LVRODWHG IURP KLSSRFDPSXV RI DGUHQDOLQWDFW RU DGUHQDOHFWRPL]HG HZHV ZDV VXEMHFWHG WR 573&5 ZLWK SULPHUV VSHFLILF IRU 05*5 RU 3DFWLQ 7RS SDQHO JHO VKRZLQJ 573&5 SURGXFWV IURP DGUHQDOLQWDFW $',f DQG DGUHQDOHFWRPL]HG $';f HZHV 2GG QXPEHUHG ODQHV DUH $', HYHQ QXPEHUV $'; $ *5 % 05 & 3DFWLQ 7KH DUURZ LQGLFDWHG WKH ES PDUNHU LQ D ES ODGGHU 3URPHJDf 7KH 3&5 SURGXFW IRU 05 ZDV ES IRU *5 ZDV ES DQG IRU 3DFWLQ ZDV ES %RWWRP SDQHO 0HDQ GDWD IRU $', YV $'; DQLPDOV Q SHU JURXS QRUPDOL]HG WR 3DFWLQ 7KH GDWD VKRZQ LQ WKH WRS SDQHO ZHUH QRUPDOL]HG WR 3DFWLQ LQ HDFK LQGLYLGXDO HZH WKH PHDQ QRUPDOL]HG GDWD LV VKRZQ LQ WKLV SDQHO 7KHUH ZHUH QR VLJQLILFDQW GLIIHUHQFHV EHWZHHQ $', DQG $'; HZHV E\ W WHVWf

PAGE 71

2' 3&5 SURGXFW2' 3DFWLQ DUELWUDU\ XQLWVf (WKLGLXP EURPLGHVWDLQHG 3&5 SURGXFWV IRU 05 *5 DQG 3DFWLQ IURP $', RU $'; VKHHS NLGQH\ 67' $% & $%&$%& $ %&$%& $%&$%&$%&$%&$% $', Q f $'; Q f 05 DQG *5 VSHFLILF 3&5 SURGXFWV LQ NLGQH\ RI $', DQG $'; HZHV ’ $', ‘‘$'; )LJ 7RWDO 51$ LVRODWHG IURP NLGQH\ RI DGUHQDOLQWDFW RU DGUHQDOHFWRPL]HG HZHV ZDV VXEMHFWHG WR 573&5 ZLWK SULPHUV VSHFLILF IRU 05*5 RU 3DFWLQ 7RS SDQHO JHO VKRZLQJ 573&5 SURGXFWV IURP DGUHQDO LQWDFW $',f DQG DGUHQDOHFWRPL]HG $';f HZHV 7KH DUURZV EHQHDWK WKH VFDQ LQGLFDWH $', DQG $'; HZHV $ *5 % 05 & 3DFWLQ 7KH DUURZ LQGLFDWHG WKH ES PDUNHU LQ D ES ODGGHU 3URPHJDf 7KH 3&5 SURGXFW IRU 05 ZDV ES IRU *5 ZDV ES DQG IRU 3DFWLQ ZDV ES %RWWRP SDQHO 0HDQ GDWD IRU $', YV $'; DQLPDOV Q SHU JURXS QRUPDOL]HG WR 3DFWLQ 7KH GDWD VKRZQ LQ WKH WRS SDQHO ZHUH QRUPDOL]HG WR 3DFWLQ LQ HDFK LQGLYLGXDO HZH WKH PHDQ QRUPDOL]HG GDWD LV VKRZQ LQ WKLV SDQHO 7KHUH ZHUH QR VLJQLILFDQW GLIIHUHQFHV EHWZHHQ $', DQG $'; HZHV E\ W WHVWf 26 X!

PAGE 72

)LJ F'1$ SRO\PHUDVH FKDLQ UHDFWLRQ SURGXFW IRU 05 *5 DQG DFWLQ P51$ $GMDFHQW ODQHV GHPRQVWUDWH ODFN RI SURGXFW ZKHQ 3DFWLQ SULPHUV DUH XVHG DIWHU RPLVVLRQ RI WKH UHYHUVH WUDQVFULSWDVH 57f UHDFWLRQ DQG DIWHU RPLVVLRQ RI P51$

PAGE 73

DV D D D V '& D DL DR 2 0 ' m &\FOH 1XPEHU &\GH 1XPEHU )HWDO 05 P51$ LQ /81* )LJ WRS SDQHOf 7DSPDQ IOXRURSKRUH VLJQDO LQWHQVLW\ 5Qf JHQHUDWHG LQ UHVSRQVH WR UHDOWLPH 3&5 LQ IHWDO OHIWf DQG PHWHPDO ULJKWf OXQJ VDPSOHV 05 P51$ ZDV GHWHFWHG LQ DOO VDPSOHV RI IHWDO OXQJ Q O f DQG LQ QRQH RI WKH VDPSOHV RI PDWHUQDO OXQJ Q f )RU FRPSDULVLRQ 5Q LQ D UHDFWLRQ FRQWDLQLQJ QR P51$ LV DOVR SORWWHG LQ WKH OHIW SDQHO ERWWRP SDQHOf 'LIIHUHFHV RI F\FOH WKUHVKROG RI 05 P51$ DQG V U51$ $&Wf IRU RYLQH IHWDO OXQJV DW WZR JHVWDWLRQDO DJHV Q DQG GD\V Q f GHPRQVWUDWLQJ D VLPLODU DEXQGDQFH RI 05 P51$ LQ ERWK JURXSV

PAGE 74

&+$37(5 $/7(5$7,21 2) 0,1(5$/2&257,&2,' 5(&(3725 )81&7,21 %< 35(*1$1&< $1' 352*(67(521( ,QWURGXFWLRQ $V GHVFULEHG LQ WKH /LWHUDWXUH 5HYLHZ VWXGLHV LQ RXU ODERUDWRU\ LQ VKHHS KDYH VKRZQ WKDW WKH VHW SRLQW IRU WKH IHHGEDFN UHJXODWLRQ RI EDVDO SODVPD FRUWLVRO FRQFHQWUDWLRQ LV LQFUHDVHG GXULQJ SUHJQDQF\.HOOHU:RRG f 7KLV ZRXOG DOORZ WKH EDVDO SODVPD FRQFHQWUDWLRQ RI FRUWLVRO WR EH PDLQWDLQHG DW D KLJKHU OHYHO ZLWKRXW VXSSUHVVLRQ RI $&7+ ZKHUHDV IXUWKHU LQFUHDVHV LQ FRUWLVRO FRQFHQWUDWLRQ ZRXOG VXSSUHVV SODVPD $&7+ FRQFHQWUDWLRQ DV LW GRHV LQ QRQSUHJQDQW VKHHS +RZHYHU WKH PHFKDQLVP RI WKH QRUPDO SUHJQDQF\LQGXFHG LQFUHDVH LQ VHW SRLQW IRU FRUWLVRO LV VWLOO XQNQRZQ $OVR DV SUHYLRXVO\ GHVFULEHG LQ /LWHUDWXUH 5HYLHZ LW KDV EHHQ VKRZQ WKDW SURJHVWHURQH FDQ DQWDJRQL]H 05PHGLDWHG HIIHFWV LQ YLYR 6SHQFH HW DO :DPEDFK DQG +LJJLQV f DQG LQ YLWUR -RQHV HW DO 5XSSUHFKW HW DO Ef 3URJHVWHURQH KDV YHU\ KLJK DIILQLW\ IRU WKH KXPDQ 05 EXW LW H[HUWV YHU\ ORZ WUDQVFULSWLRQDO DFWLYLW\ DIWHU ELQGLQJ 05 5XSSUHFKW HW DO Ef ,Q VKHHS SURJHVWHURQH KDV DQ DSSUR[LPDWHO\ HTXDO DIILQLW\ FRPSDUHG WR FRUWLVRO DW WKH 05 DQG ORZHU DIILQLW\ IRU RYLQH *5 XQSXEOLVKHG GDWDf :H WKHUHIRUH K\SRWKHVL]HG WKDW HOHYDWHG SURJHVWHURQH DFWV DV DQ DQWDJRQLVW WR FRUWLVRO ELQGLQJ DW 05 UHGXFLQJ 05 DYDLODELOLW\ DQG LQFUHDVLQJ WKH DSSDUHQW .G RI 05 IRU FRUWLVRO LQ KLSSRFDPSDO F\WRVRO 7KLV UHVXOWV LQ WKH XSUHJXODWLRQ RI VHWSRLQW IRU UHJXODWLRQ RI FRUWLVRO GXULQJ SUHJQDQF\ VLQFH 05PHGLDWHG HIIHFWV KDYH EHHQ GHFUHDVHG

PAGE 75

7R WHVW RXU K\SRWKHVLV ZH XVHG VDWXUDWLRQ ELQGLQJ DVVD\ WR GHWHUPLQH WKH .G RI 05 IRU FRUWLVRO LQ KLSSRFDPSXV DQG PHDVXUHG UHFHSWRU DYDLODELOLW\ IRU 05 DQG *5 P51$ DQG SURWHLQ OHYHO ZHUH DOVR PHDVXUHG IRU 05 DQG *5 )LQDOO\ +7$ UHFHSWRU ZHUH XVHG DV DQ LQGLFDWRU IRU 05*5 PHGLDWHG DFWLRQ LQ KLSSRFDPSXV ([SUHVVLRQ RI +7$ UHFHSWRU KDV EHHQ VKRZQ WR EH VXSSUHVVHG E\ FRUWLVRO LQ KLSSRFDPSXV ,I SURJHVWHURQH LQGHHG DQWDJRQL]HV 05 PHGLDWHG HIIHFWV RI FRUWLVRO WKLV VXSSUHVVLRQ ZRXOG EH DWWHQXDWHG 5HDOWLPH 3&5 ZDV XVHG WR PHDXVUH WKH P51$ RI +7$ UHFHSWRU LQ KLSSRFDPSXV 0DWHULDOV DQG 0HWKRGV ,Q RUGHU WR FRPSDUH WKH HIIHFWV RI SUHJQDQF\ DQG SURJHVWHURQH RQ PLQHUDORFRUWLFRLG UHFHSWRU PHGLDWHG IXQFWLRQ WZHQW\ILYH DGXOW IHPDOH VKHHS LQFOXGLQJ WHQ SUHJQDQW DQG ILIWHHQ QRQSUHJQDQW ZHUH VWXGLHG LQ ILYH H[SHULPHQWDO JURXSV *URXS f ZHUH QRQSUHJQDQW VKDPDGUHQDOHFWRPL]HG DQG RYDULHFWRPL]HG HZHV *URXS f ZHUH SUHJQDQW VKDP DGUHQDOHFWRPL]HG HZHV *URXS f ZHUH QRQSUHJQDQW DGUHQDOHFWRPL]HG DQG RYDULHFWRPL]HG HZHV *URXS f ZHUH SUHJQDQW DGUHQDOHFWRPL]HG HZHV *URXS f ZHUH QRQSUHJQDQW DGUHQDOHFWRPL]HG HZHV FKURQLFDOO\ WUHDWHG ZLWK SURJHVWHURQH 'DWD IURP RQH DGUHQDOHFWRPL]HG SUHJQDQW HZH ZDV H[FOXGHG IURP DQDO\VLV EHFDXVH ERWK 05 DQG *5 ELQGLQJ DQG SURWHLQ OHYHOV ZHUH DOO PDUNHGO\ ORZHU WKDQ DOO RWKHU DQLPDOV bf VXJJHVWLQJ GHJUDGDWLRQ RI WKH UHFHSWRUV LQ WKH F\WRVRO SUHSDUDWLRQ 7KH DGUHQDOHFWRP\ DQG RYDULHFWRP\ ZHUH SHUIRUPHG DFFRUGLQJ WR SUHYLRXVO\ SXEOLVKHG SURWRFROV.HOOHU:RRG HW DO f DV GHVFULEHG LQ 0HWKRGV3HFLQV7KRPSVRQ DQG .HOOHU:RRG f 6WHURLG LPSODQWDWLRQ ZDV SHUIRUPHG WR NHHS WKH FRUWLVRO DQG DOGRVWHURQH DW D ORZ FRQVLVWHQW OHYHO QJPO SJPO UHVSHFWLYHO\f (ZHV LQ

PAGE 76

JURXS ZHUH DOVR WUHDWHG ZLWK SURJHVWHURQH WR LQFUHDVH LWV OHYHO WR WKDW RI WKH QRUPDO SUHJQDQW VKHHS QJPOf $IWHU FROOHFWLQJ WKH KLSSRFDPSDO WLVVXH WKH SODVPD KRUPRQH OHYHOV ZHUH PHDVXUHG 5HFHSWRU ELQGLQJ DVVD\ :HVWHUQ EORW DQG UHDOWLPH 573&5 ZHUH DOO GRQH DFFRUGLQJ WR WKH SURWRFRO GHVFULEHG LQ 0HWKRGV DQG 573&5 FKDSWHUV )RU WKLV SURMHFW ZH GLG VDWXUDWLRQ ELQGLQJ DVVD\ IROORZHG E\ QRQOLQHDU UHJUHVVLRQ DQDO\VLV IRU 05 IRU WKUHH DQLPDOV LQ HDFK JURXS :LWK LQFUHDVHG FRQFHQWUDWLRQ RI + FRUWLVRO IURP WR Q0 WKH VDWXUDWLRQ ELQGLQJ FXUYHV ZHUH JHQHUDWHG DQG WKH ELQGLQJ DIILQLW\ .Gf RI 05 LQ WKH KLSSRFDPSXV DQG %PD[ RI 05 ZHUH GHWHUPLQHG )RU DOO DQLPDOV ZH DOVR PHDVXUHG WRWDO UHFHSWRU DYDLODELOLW\ IRU 05 DQG *5 XVLQJ D VLQJOH VDWXUDWLQJ FRQFHQWUDWLRQ RI +FRUWLVRO Q0f DV SUHYLRXVO\ GHVFULEHG )RU UHDOWLPH 3&5 IRU +7$ UHFHSWRU WKH PHWKRGRORJ\ ZDV H[DFWO\ WKH VDPH DV PHDVXUHPHQW IRU 05 DQG *5 $ SDLU RI SULPHU ZDV ILUVW GHVLJQHG DFFRUGLQJ WR KXPDQ +7$ UHFHSWRU VHTXHQFH f LQ *HQHEDQN IRU UHJXODU 573&5 )RUZDUG 3ULPHU $&& &&$ 7&* $&7 $&* 7*$ $& 5HYHUVH 3ULPHU &$* &** *$7 *7$ *$$ $*& 7& $IWHU VHTXHQFLQJ WKH 3&5 SURGXFW ZH JRW D SLHFH RI ES VHTXHQFH 7KH VHTXHQFH ZDV FRPSDUHG ZLWK +7$ UHFHSWRU RI KXPDQ DQG RWKHU VSHFLHV E\ %/$67 ,W ZDV b KRPRORJRXV WR WKH KXPDQ +7$ UHFHSWRU 7KLV FRQILUPHG WKH 3&5 SURGXFW ZDV IURP +7$ UHFHSWRU P51$ 7KHQ SULPHU DQG SUREH IRU UHDOWLPH 3&5 ZHUH GHVLJQHG DFFRUGLQJ WR WKLV ES VHTXHQFH )RUZDUG SULPHU *&*&$&&&&**$$*$

PAGE 77

5HYHUVH SULPHU *7$$$7$*7*7$*&&*7**7&&77*&7 3UREH &**$&&&**$&*&*7*&$ 5HVXOWV &RUWLVRO 3URJHVWHURQH DQG $OGRVWHURQH /HYHO LQ 3ODVPD 3ODVPD OHYHOV RI FRUWLVRO SURJHVWHURQH DQG DOGRVWHURQH DW WKH WLPH RI VDFULILFH ZHUH VKRZQ LQ 7DEOH ,Q WKH FRUWLVROUHSODFHG DGUHQDOHFWRPL]HG HZHV SODVPD FRUWLVRO OHYHOV ZHUH VLPLODU SJPOf WR WKRVH RI WKH QRQSUHJQDQW DGUHQDOLQWDFW HZHV $V H[SHFWHG SODVPD FRUWLVRO OHYHOV ZHUH KLJKHU LQ WKH SUHJQDQW DGUHQDO LQWDFW JURXS RI HZHV IUHH FRUWLVRO OHYHOV DOVR WHQGHG WR EH KLJKHU KRZHYHU WKLV GLIIHUHQFH ZDV QRW VLJQLILFDQW 3URJHVWHURQH OHYHOV ZHUH ORZ LQ QRQSUHJQDQW RYDULHFWRPL]HG VKHHS DQG ERWK WRWDO DQG IUHH SURJHVWHURQH FRQFHQWUDWLRQV ZHUH LQFUHDVHG LQ ERWK JURXSV RI SUHJQDQW HZHV 3URJHVWHURQH WUHDWPHQW LQFUHDVHG SODVPD SURJHVWHURQH FRQFHQWUDWLRQ WR D OHYHO VLPLODU WR WKDW LQ DGUHQDO LQWDFW SUHJQDQW HZHV 7RWDO $YDLODEOH 5HFHSWRU %LQGLQJ DW 05 DQG *5 LQ +LSSRFDPSXV 7KH HVWLPDWH RI %PD[ YDOXHV IRU 05 REWDLQHG E\ ELQGLQJ DW D VLQJOH VDWXUDWLQJ FRQFHQWUDWLRQ RI + FRUWLVRO ZDV YHU\ VLPLODU WR WKDW REWDLQHG E\ VDWXUDWLRQ ELQGLQJ H[SHULPHQWV ZLWK PXOWLSOH + FRUWLVRO FRQFHQWUDWLRQV FRQILUPLQJ WKH YDOLGLW\ RI WKH UHVXOWV U Q f ,Q WKH DGUHQDOLQWDFW HZHV WKHUH ZHUH VLJQLILFDQWO\ PRUH 05 VLWHV DYDLODEOH LQ KLSSRFDPSXV IURP SUHJQDQW DV FRPSDUHG WR QRQSUHJQDQW HZHV )LJXUH ORZHU ULJKWf GHVSLWH WKH KLJKHU SODVPD FRUWLVRO FRQFHQWUDWLRQV LQ WKH SUHJQDQW HZHV ,Q WKH DGUHQDOHFWRPL]HG HZHV WKHUH ZHUH DOVR VLJQLILFDQWO\ PRUH 05 VLWHV DYDLODEOH LQ WKH SUHJQDQW HZHV DV FRPSDUHG WR WKH QRQSUHJQDQW HZHV )LJXUH ORZHU OHIWf 05 DYDLODELOLW\ LQ WKH QRQSUHJQDQW DGUHQDOHFWRPL]HG SURJHVWHURQHWUHDWHG JURXS ZDV LQWHUPHGLDWH EHWZHHQ WKDW LQ WKH SUHJQDQW DQG QRQSUHJQDQW DGUHQDOHFWRPL]HG JURXSV EXW

PAGE 78

WKHVH GLIIHUHQFHV ZHUH QRW VWDWLVWLFDOO\ VLJQLILFDQW 7KHUH ZDV KRZHYHU D VWDWLVWLFDOO\ VLJQLILFDQW UHODWLRQVKLS EHWZHHQ WRWDO SODVPD SURJHVWHURQH FRQFHQWUDWLRQ DQG 05 DYDLODELOLW\ U S Q f DQG IUHH SODVPD SURJHVWHURQH FRQFHQWUDWLRQ DQG 05 DYDLODELOLW\ U 3 Q f 7KHUH ZHUH QR GLIIHUHQFHV LQ %PD[ IRU *5 EHWZHHQ SUHJQDQW DQG QRQSUHJQDQW s YV s IPROPJ SURWHLQ UHVSHFWLYHO\f DGUHQDOLQWDFW HZHV RU DPRQJ QRQSUHJQDQW SUHJQDQW DQG QRQSUHJQDQWSURJHVWHURQHWUHDWHG HZHV s s s IPROPJ SURWHLQ UHVSHFWLYHO\f $SSDUHQW .G RI 05 ZLWK &RUWLVRO LQ +LSSRFDPSXV 7R GHWHUPLQH LI SURJHVWHURQH ZDV DFWLQJ DV DQ DQWDJRQLVW LQ YLYR ZH PHDVXUHG WKH DSSDUHQW .G IRU + FRUWLVRO LQ KLSSRFDPSDO F\WRVROV XVLQJ D VDWXUDWLRQ ELQGLQJ DVVD\ IROORZHG E\ QRQOLQHDU UHJUHVVLRQ DQDO\VLV )LJXUH f 3UHJQDQF\ RU SURJHVWHURQH WUHDWPHQW LQFUHDVHG WKH DSSDUHQW .G RI 05 LQ WKH DGUHQDOHFWRPL]HG HZHV )LJXUH XSSHU OHIWf 7KHUH ZDV DOVR D VLJQLILFDQW GLIIHUHQFH LQ WKH DSSDUHQW .G RI 05 EHWZHHQ QRQSUHJQDQW DQG SUHJQDQW DGUHQDOLQWDFW HZHV )LJXUH XSSHU ULJKWf 7KHUH ZDV QR VLJQLILFDQW GLIIHUHQFH EHWZHHQ WKH DSSDUHQW .G RI 05 LQ KLSSRFDPSXV RI DGUHQDOHFWRPL]HG HZHV ZKR ZHUH SUHJQDQW YHUVXV SURJHVWHURQH WUHDWHG 2YHUDOO WKHUH ZDV D VWURQJ SRVLWLYH OLQHDU UHODWLRQVKLS EHWZHHQ SURJHVWHURQH OHYHO DQG WKH DSSDUHQW .G RI 05 XVLQJ GDWD IURP DOO JURXSV LQGLFDWLQJ UHGXFHG DIILQLW\ RI FRUWLVRO DW 05 ZLWK LQFUHDVLQJ WRWDO SODVPD SURJHVWHURQH FRQFHQWUDWLRQV U S Q f RU IUHH SODVPD SURJHVWHURQH FRQFHQWUDWLRQV U S Q f 7KHUH ZDV QRW D VLJQLILFDQW UHODWLRQVKLS EHWZHHQ HLWKHU WRWDO RU IUHH SODVPD FRUWLVRO FRQFHQWUDWLRQ DQG WKH DSSDUHQW .G S DQG S UHVSHFWLYHO\f

PAGE 79

05 DQG *5 3URWHLQ /HYHOV DQG P51$ ([SUHVVLRQ LQ +LSSRFDPSXV 6LQFH ZH GHWHFWHG GLIIHUHQFHV LQ UHFHSWRU DYDLODELOLW\ DPRQJ WKH GLIIHUHQW JURXSV RI VKHHS ZH H[DPLQHG LI WKHVH FKDQJHV ZHUH SDUWO\ GXH WR FKDQJHV LQ WKH WRWDO DPRXQW RI UHFHSWRU SURWHLQ RU 05 DQG *5 JHQH H[SUHVVLRQ :H XVHG :HVWHUQ EORW DQDO\VLV WR PHDVXUH WKH SURWHLQ OHYHO RI 05 DQG *5 LQ F\WRVRO RI KLSSRFDPSXV IRU HDFK DQLPDO 7KHUH ZDV QR VLJQLILFDQW GLIIHUHQFH EHWZHHQ WKH QRQSUHJQDQW LQWDFW JURXS DQG SUHJQDQW LQWDFW JURXS )LJXUH DQG 7DEOH f 7KHUH ZDV DOVR QR VLJQLILFDQW GLIIHUHQFH DPRQJ WKH WKUHH JURXSV RI DGUHQDOHFWRPL]HG HZHV 7DEOH f :H DOVR H[DPLQHG WKH P51$ H[SUHVVLRQ IRU 05 RU *5 XVLQJ WKH UHDOWLPH 573&5 PHWKRG 7DEOH f 7KHUH ZDV QR VLJQLILFDQW GLIIHUHQFH DPRQJ WKH JURXSV LQ VWHDG\ VWDWH OHYHOV RI 05 RU *5 P51$ LQ KLSSRFDPSXV +7$ 5HFHSWRU P51$ /HYHO LQ +LSSRFDPSXV 7KH F'1$ SURGXFW RI WKH 573&5 H[SHULPHQWV ZDV VHTXHQFHG DQG WKH VHTXHQFH REWDLQHG ZDV FRPSDUHG WR WKH KXPDQ +7$ UHFHSWRU VHTXHQFHV XVLQJ %/$67 WKH VHTXHQFH REWDLQHG ZDV &&&&**&*&* &&*&7*&*&7 &$7&7&*&7& $&&7**&7&$ 77**&77&&7 &$7&7&&$7& &&*&&&$7*& 7***&7**&* &$&&&&**$$ *$&&*&7&** $&&&**$&*& *7*&$&7$7& $*&$$**$&& $&**&7$&$& 7$777$&7&& $&&77&**$* &777&7$&$7 &&&*&7* :H XVHG UHDOWLPH 3&5 WR PHDVXUH WR P51$ OHYHO RI +7$ OHYHO LQ KLSSRFDPSXV 7KHUH ZDV QR VLJQLILFDQW GLIIHUHQFH DPRQJ WKH JURXSV LQ VWHDG\ VWDWH OHYHOV RI +7$ UHFHSWRU P51$ LQ KLSSRFDPSXV )LJf

PAGE 80

'LVFXVVLRQ $Q LQFUHDVHG FRQFHQWUDWLRQ RI SODVPD SURJHVWHURQH LQGXFHG HLWKHU E\ SUHJQDQF\ RU SURJHVWHURQH DGPLQLVWUDWLRQ LQFUHDVHG WKH QXPEHU RI DYDLODEOH 05 LQ VKHHS KLSSRFDPSXV DQG GHFUHDVHG WKH DIILQLW\ RI WKRVH VLWHV IRU FRUWLVRO 7KHVH UHVXOWV VXSSRUW DQG H[WHQG RXU SUHYLRXV REVHUYDWLRQV WKDW 05 DYDLODELOLW\ LQ WKH KLSSRFDPSXV LV LQFUHDVHG GXULQJ RYLQH SUHJQDQF\ 5RHVFK DQG .HOOHU:RRG f 7KLV LQFUHDVH LQ DYDLODELOLW\ LV QRW SUHGLFWHG IURP FRQVLGHUDWLRQ RI SODVPD FRUWLVRO DQG DOGRVWHURQH FRQFHQWUDWLRQV JLYHQ WKDW FLUFXODWLQJ IUHH FRQFHQWUDWLRQV RI ERWK DUH LQFUHDVHG LQ WKH SUHJQDQW VWDWH 7KLV VXJJHVWHG WKDW DQRWKHU OLJDQG DQWDJRQL]HG FRUWLVRO ELQGLQJ WR 05 LQ KLSSRFDPSXV GXULQJ SUHJQDQF\ ,Q SUHVHQW VWXG\ ZH XVHG SURJHVWHURQHWUHDWHG HZHV WR PLPLF WKH SUHJQDQW VWDWH WR WHVW WKH K\SRWKHVLV WKDW LW LV WKH SURJHVWHURQH GXULQJ SUHJQDQF\ WKDW FDXVHG WKLV FKDQJH 7R DYRLG WKH SRVVLEOH FRQIRXQGLQJ HIIHFWV RI GLIIHUHQFHV LQ SODVPD FRUWLFRVWHURLGV WKH DQLPDOV ZHUH DGUHQDOHFWRPL]HG DQG WUHDWHG ZLWK D ORZ GRVH RI FRUWLVRO DQG DOGRVWHURQH 6LQFH DFWLYDWHG VWHURLG UHFHSWRUV ZLOO QRW UHELQG OLJDQG XQGHU WKH FRQGLWLRQV XVHG LQ RXU DVVD\ WKH PHDVXUH RI UHFHSWRU DYDLODELOLW\ LQ RXU VWXG\ SUHVXPDEO\ UHIOHFWV DQ LQYHUVH FKDQJH LQ UHFHSWRU DFWLYDWLRQ 7KLV ZRXOG VXJJHVW WKDW SURJHVWHURQH UHGXFH 05 RFFXSDQF\ DQG DFWLYDWLRQ LQ KLSSRFDPSXV LQ YLYR 7KH DIILQLW\ RI 05 IRU SURJHVWHURQH LV VLPLODU WR WKDW RI FRUWLVRO DQG FRUWLFRVWHURQH 5XSSUHFKW HW DO Ef LQ WKH SUHVHQW VWXGLHV WKH HVWLPDWHG FRQFHQWUDWLRQ RI IUHH SURJHVWHURQH GXULQJ SUHJQDQF\ LV VHYHUDO IROG KLJKHU WKDQ WKDW RI FRUWLVRO RU DOGRVWHURQH ,W ZRXOG WKHUHIRUH EH H[SHFWHG WKDW SURJHVWHURQH ZRXOG FRPSHWLWLYHO\ LQKLELW FRUWLVRO ELQGLQJ WR 05 ,I SURJHVWHURQH DFWV DV DQ DQWDJRQLVW DW 05 WKHQ WKH DSSDUHQW .G IRU WKH UHFHSWRU IRU FRUWLVRO VKRXOG EH LQFUHDVHG ,Q WKLV VWXG\ ZH IRXQG D VLJQLILFDQW SRVLWLYH OLQHDU UHODWLRQVKLS EHWZHHQ WKH

PAGE 81

SODVPD FRQFHQWUDWLRQ RI SURJHVWHURQH DQG ERWK WKH DSSDUHQW .G RI FRUWLVRO DW 05 DQG 05 DYDLODELOLW\ 7KH DQDO\VLV RI WKH DSSDUHQW .G DW 05 VKRZHG D VLPLODU SDWWHUQ DV 05 DYDLODELOLW\ LH WKHUH ZDV D JUHDWHU FRQFHQWUDWLRQ RI FRUWLVRO UHTXLUHG WR DFKLHYH b ELQGLQJ LQ SUHJQDQW LQWDFW HZHV FRPSDUHG WR QRQSUHJQDQW LQWDFW HZHV DQG LQ SUHJQDQW DGUHQDOHFWRPL]HG HZHV DV FRPSDUHG WR QRQSUHJQDQW DGUHQDOHFWRPL]HG DQG RYDULHFWRPL]HG HZHV 7KH DSSDUHQW .G IRU 05 DQG 05 DYDLODELOLW\ LQ QRQSUHJQDQW DGUHQDOHFWRPL]HG HZHV WUHDWHG ZLWK SURJHVWHURQH ZDV LQWHUPHGLDWH KRZHYHU WKH SURJHVWHURQH FRQFHQWUDWLRQ ZDV DOVR LQWHUPHGLDWH $Q HIIHFW RI SURJHVWHURQH KDV DOVR EHHQ VKRZQ LQ UDWV DIWHU DFXWH SURJHVWHURQH WUHDWPHQW &DUH\ HW DO f 7KH DSSDUHQW .G RI FRUWLFRVWHURQH IRU 05 ZDV LQFUHDVHG LQ KLSSRFDPSDO F\WRVRO REWDLQHG IURP UDWV K DIWHU LQMHFWLRQ ZLWK SURJHVWHURQH &DVWUHQ HW DO f 6WXGLHV LQ FHOOV WUDQVIHFWHG ZLWK 05 RU *5 DQG WUHDWHG ZLWK YDULRXV VWHURLGV VKRZHG WKDW SURJHVWHURQH LV D SRWHQW DQWDJRQLVW DW WKH KXPDQ 05 5XSSUHFKW HW DO Ef ELQGLQJ ZLWK KLJK DIILQLW\ EXW UHVXOWLQJ LQ OLWWOH WUDQVFULSWLRQDO DFWLYLW\ 0RGHOLQJ RI WKH KXPDQ 05 KDV DOVR VXJJHVWHG WKDW SURJHVWHURQH QRUPDOO\ FDQ ELQG LQ WKH OLJDQG ELQGLQJ SRFNHW RI WKH KXPDQ 05 EXW ZLOO QRW DOORZ WKH FRQIRUPDWLRQDO FKDQJH QHFHVVDU\ IRU WUDQVDFWLYDWLRQ *HOOHU HW DO f D PXWDWLRQ LQ RQH UHVLGXH ZLWKLQ WKH ELQGLQJ SRFNHW FDQ UHVXOW LQ FRQVWLWXWLYH WUDQVFULSWLRQDO DFWLYLW\ DQG HQKDQFHG WUDQVFULSWLRQDO DFWLYLW\ DIWHU SURJHVWHURQH ELQGLQJ :RPHQ ZLWK WKLV PXWDWLRQ DUH K\SHUWHQVLYH GXULQJ SUHJQDQF\ *HOOHU HW DO f 7KHVH VWXGLHV KDYH VXJJHVWHG WKDW SURJHVWHURQH LQKLELWLRQ RI 05PHGLDWHG DFWLRQV FDQ RFFXU YLD DQWDJRQLVP RI WKH UHFHSWRU +RZHYHU LW LV SRVVLEOH WKDW SURJHVWHURQH DOVR LQKLELWV 05 DFWLYLW\ WKURXJK DQRWKHU PHFKDQLVP ,Q RWKHU VWXGLHV LQ FXOWXUHG FHOOV SURJHVWHURQH LQKLELWHG WKH

PAGE 82

WUDQVFULSWLRQDO DFWLYLW\ RI 05 WKURXJK D SURJHVWHURQH UHFHSWRU 35$f PHGLDWHG HIIHFW 0F'RQQHOO HW DO f ,Q VKHHS WKH FKDQJH LQ 05 DYDLODELOLW\ LQ WKH KLSSRFDPSXV GXULQJ SUHJQDQF\ RU E\ SURJHVWHURQH WUHDWPHQW FDQQRW EH DFFRXQWHG IRU E\ WKH LQFUHDVH LQ FRUWLVRO ELQGLQJ WR ELQGLQJ JOREXOLQ VLQFH FRUWLFRVWHURLG ELQGLQJ JOREXOLQ &%*f OHYHOV GR QRW LQFUHDVH GXULQJ SUHJQDQF\ RU ZLWK VWHURLG WUHDWPHQWV /LQGQHU 5RVHQWKDO HW DO f &RQVLVWHQW ZLWK WKLV WKHUH ZDV QR VLJQLILFDQW GLIIHUHQFH LQ WKH SHUFHQWDJH RI IUHH FRUWLVRO LQ SODVPD ZLWK SUHJQDQF\ LQ WKLV VWXG\ QRU ZHUH WKH FKDQJHV LQ 05 DYDLODELOLW\ RU DSSDUHQW DIILQLW\ UHODWHG WR FRQFHQWUDWLRQV RI IUHH FRUWLVRO 7KH FKDQJH LV DOVR QRW DFFRXQWHG IRU E\ DQ LQFUHDVH LQ PHWDEROLVP RI FRUWLVRO WR FRUWLVRQH E\ K\GUR[\VWHURLG GHK\GURJHQDVH :H KDYH PHDVXUHG K\GUR[\VWHURLG GHK\GURJHQDVH DFWLYLW\ LQ VHYHUDO EUDLQ UHJLRQV DQG IRXQG WKDW LWV DFWLYLW\ ZDV EHORZ RU DW WKH OLPLW RI GHWHFWLRQ LQ KLSSRFDPSXV LQ QRQSUHJQDQW RU SUHJQDQW HZHV .LP HW DO f 6LQFH DYDLODELOLW\ RI 05 FRXOG DOVR EH LQFUHDVHG E\ DQ HIIHFW RI SURJHVWHURQH RQ WKH V\QWKHVLV RU H[SUHVVLRQ RI 05 ZH DOVR PHDVXUHG 05 P51$ DQG SURWHLQ OHYHOV IRU 05 LQ KLSSRFDPSXV IROORZLQJ SURJHVWHURQH WUHDWPHQW DQG GXULQJ SUHJQDQF\ 'HVSLWH WKH FKDQJH LQ DYDLODELOLW\ WKH SURWHLQ DQG P51$ OHYHOV ZHUH QRW VLJQLILFDQWO\ GLIIHUHQW GXULQJ SUHJQDQF\ RU ZLWK SURJHVWHURQH WUHDWPHQW 7KLV VXJJHVWV WKDW WKH FKDQJH LQ DYDLODELOLW\ LV UHODWHG WR SUHVHQFH RI D FRPSHWLWLYH DQWDJRQLVW ZKLFK ZRXOG LQFUHDVH DSSDUHQW .G GHFUHDVH 05 DFWLYDWLRQ DQG LQFUHDVH UHFHSWRU DYDLODELOLW\ UDWKHU WKDQ WR D FKDQJH LQ 05 H[SUHVVLRQ +RZHYHU LW LV SRVVLEOH WKDW WKHUH DUH HLWKHU UHJLRQDO RU VSOLFH YDULDQW VHOHFWLYH FKDQJHV LQ 05 DQG *5 ZKLFK ZRXOG QRW EH GHWHFWHG ZLWK WKH PHWKRGV XVHG

PAGE 83

$OWKRXJK ZH GLG QRW ILQG D FKDQJH LQ 05 H[SUHVVLRQ RU SURWHLQ ZLWK SUHJQDQF\ RU SURJHVWHURQH WUHDWPHQW RWKHU VWXGLHV XVLQJ DGUHQDOHFWRPL]HG DQLPDOV ZLWKRXW VWHURLG UHSODFHPHQW RU XVLQJ FHOO FXOWXUH V\VWHPV KDYH IRXQG FKDQJHV LQ 05 P51$ OHYHOV ZLWK JRQDGDO VWHURLG DGPLQLVWUDWLRQ ,Q FXOWXUHV RI KLSSRFDPSDO QHXURQV RU QHXUREODVWRPD FHOOV SURJHVWHURQH LQFUHDVHV 05 H[SUHVVLRQ &DVWUHQ HW DO f 3URJHVWHURQH DOVR LQFUHDVHG 05 P51$ LQ KLSSRFDPSXV RI DGUHQDOHFWRPL]HG RYDULHFWRPL]HG UDWV DIWHU GD\V RI DGPLQLVWUDWLRQ LI WKH\ ZHUH SUHWUHDWHG ZLWK HVWURJHQ VXJJHVWLQJ WKDW WKLV HIIHFW LV PHGLDWHG E\ SURJHVWHURQH UHFHSWRUV &DVWUHQ HW DO f +RZHYHU RWKHU VWXGLHV ZLWK GD\V RI DGPLQLVWUDWLRQ KDYH VKRZQ WKDW RYDULHFWRP\ GRHV QRW FKDQJH 05 P51$ RU WKH LQFUHDVH LQ 05 H[SUHVVLRQ DIWHU DGUHQDOHFWRP\ SURJHVWHURQH DGPLQVWUDWLRQ LQ WKH DGUHQDOHFWRPL]HG RYDULHFWRPL]HG UDW DOVR GLG QRW FKDQJH WKH VXSSUHVVLRQ RI 05 E\ KLJK GRVH FRUWLFRVWHURQH 3DWFKHY DQG $OPHLGD f +RZHYHU SURJHVWHURQH EORFNHG WKH LQKLELWRU\ HIIHFW RI HVWUDGLRO RQ 05 P51$ DQG QR HIIHFW RI SURJHVWHURQH RFFXUUHG LI WKH UDWV ZHUH WUHDWHG ZLWK KLJK GRVHV RI FRUWLFRVWHURQH DIWHU DGUHQDOHFWRP\ ,Q WKHVH VWXGLHV SURJHVWHURQH DWWHQXDWHG ERWK WKH LQFUHDVH LQ *5 P51$ DIWHU DGUHQDOHFWRP\ DQG WKH VXSSUHVVLRQ RI WKLV LQFUHDVH E\ KLJK GRVH FRUWLFRVWHURQH WKLV HIIHFW LV FRQVLVWHQW ZLWK SURJHVWHURQH DFWLRQ DV D ZHDN DJRQLVW DW *5 LQ WKLV FDVH PRGXODWLQJ WKH *5 DXWRUHJXODWLRQ $Q LQWHUDFWLYH HIIHFW RI SURJHVWHURQH ZLWK HVWUDGLRO ZDV DOVR REVHUYHG ZLWK DFXWH VWHURLG DGPLQLVWUDWLRQ RYHU KRXUV LQ DGUHQDOHFWRPL]HG RYDULHFWRPL]HG UDWV :KHUHDV DFXWH HVWURJHQ WUHDWPHQW GHFUHDVHG 05 DYDLODELOLW\ LQ KLSSRFDPSXV DQG OHYHOV RI 05 P51$ LQ WKH &$ UHJLRQ RI WKH KLSSRFDPSXV SURJHVWHURQH ZLWK HVWUDGLRO LQFUHDVHG ERWK 05 ELQGLQJ FDSDFLW\ DQG P51$ &DUH\ HW DO f 7DNHQ WRJHWKHU ZLWK WKH UHVXOWV RI RXU VWXG\ WKHVH VWXGLHV VXJJHVW WKDW SURJHVWHURQH PD\ PRGXODWH WKH

PAGE 84

UHVSRQVH WR FKURQLF GUDPDWLF LQFUHDVHV RU GHFUHDVHV LQ FRUWLFRVWHURLGV EXW LQ WKH SUHJQDQW VWDWH LQ WKH SUHVHQFH RI ERWK FRUWLFRVWHURLGV DQG HVWURJHQ WKH RYHUDOO HIIHFWV RI SURJHVWHURQH RQ VWHDG\VWDWH OHYHOV RI 05 P51$ DQG *5 P51$ DUH PLQLPDO :H GLG QRW GHWHFW DQ\ VLJQLILFDQW FKDQJH RI +7$ UHFHSWRU P51$ OHYHO LQ KLSSRFDPSXV DPRQJ ILYH JURXSV ZKLOH ZH H[SHFWHG WKDW VXSSUHVVLRQ RI +7$ UHFHSWRU E\ FRUWLVRO ZRXOG EH DWWHQXDWHG E\ SURJHVWHURQH LI SURJHVWHURQH DQWDJRQL]H FRUWLVRO HIIHFWV LQ YLYR LQ VKHHS ,Q WKUHH $'; JURXSV WKH OHYHOV RI SODVPD FRUWLVRO DUH DOO DW WKH VLPLODU UDQJH ,I SURJHVWHURQH DQWDJRQL]H 05 PHGLDWHG FRUWLVRO DFWLYLW\ WKH HZHV ZLWK KLJKHU SURJHVWHURQH OHYHO JURXS DQG f ZRXOG KDYH D KLJKHU +7$ UHFHSWRU P51$ 7KHUH DUH VHYHUDO SRVVLEOH UHDVRQV WR H[SODLQ WKLV GLVFUHSDQF\ )LUVW LQ RXU H[SHULPHQW FRUWLVRO OHYHOV ZHUH DW WKH UDQJH RI QRUPDO QRQSUHJQDQW OHYHO QJPOf ,W LV SRVVLEOH WKDW WKLV OHYHO LV WRR ORZ WR KDYH WKH HIIHFWV RQ +7$ UHFHSWRU JHQH H[SUHVVLRQ 1HXPDLHU DQG KLV FROOHDJXHV GHWHFWHG UHJXODWLRQ RI +7$ UHFHSWRU P51$ LQ UDW LQ KLSSRFDPSXV E\ FRUWLFRVWHURLGV DW WKH OHYHO RI QJPO 1HXPDLHU HW DO f ,I QR UHJXODWLRQ RFFXUUHG DW WKH ORZ QRUPDO OHYHO RI FRUWLVRO SURJHVWHURQH ZRXOG QRW KDYH HIIHFWV RQ +7$ UHFHSWRU P51$ 6HFHRQG QR SUHYLRXV VWXGLHV KDYH EHHQ GRQH RQ VKHHS 6XSSUHVVLRQ RI +7$ UHFHSWRU E\ FRUWLFRVWHURLG ZHUH UHSRUWHG LQ UDWV RU FXOWXUHG KLSSRFDPSDO FHOOV 7KHUH PLJKW EH VSHFLHV GLIIHUHQW RQ JHQH UHJXODWLRQ 7KLUG SURJHVWHURQH PLJKW KDYH LWV RZQ HIIHFWV RQ +7$ UHFHSWRU E\ SURJHVWHURQH UHFHSWRU %RWK FRUWLVRO DQG SURJHVWHURQH HIIHFWV PD\ ZRUN RQ JHQH UHJXODWLRQ RI +7$ UHFHSWRU DQG QHW HIIHFWV PLJKW EH ]HUR )XUWKHU VWXGLHV QHHG WR EH GRQH WR UHDOO\ H[SODLQ WKH HIIHFWV RI FRUWLVRO DQG SURJHVWHURQH DFWLRQ RQ WKLV +7$ UHFHSWRU JHQH UHJXODWLRQ

PAGE 85

,Q VXPPDU\ ZH KDYH IRXQG WKDW WKH DSSDUHQW .G RI FRUWLVRO DW 05 LQ WKH KLSSRFDPSXV LV LQFUHDVHG E\ DQ LQFUHDVH LQ SURJHVWHURQH FRQFHQWUDWLRQ SURGXFHG HLWKHU E\ SUHJQDQF\ RU SURJHVWHURQH WUHDWPHQW 7KH LQFUHDVH LQ DSSDUHQW .G LV DOVR UHIOHFWHG LQ DQ LQFUHDVH LQ 05 DYDLODELOLW\ LQ KLSSRFDPSXV LQ SUHJQDQW HZHV DQG LQ QRQSUHJQDQW HZHV ZLWK FKURQLF SURJHVWHURQH WUHDWPHQW 7KHVH FKDQJHV DUH QRW UHODWHG WR WKH OHYHO RI FLUFXODWLQJ FRUWLVRO DQG WKHUH ZDV QR FKDQJH LQ *5 DYDLODELOLW\ LQ KLSSRFDPSXV 7KH FKDQJH LQ 05 DYDLODELOLW\ ZDV QRW GXH WR WKH OHYHO RI UHFHSWRUV LQ YLYR VLQFH QHLWKHU P51$ QRU SURWHLQ OHYHO RI 05 DQG *5 FKDQJHG 7KHVH GDWD DUH FRQVLVWHQW ZLWK FRPSHWLWLRQ RI SURJHVWHURQH ZLWK FRUWLVRO IRU ELQGLQJ DW 05 UHVXOWLQJ LQ IHZHU DFWLYDWHG 05 DQG PRUH XQDFWLYDWHG 05 DYDLODEOH IRU OLJDQG ELQGLQJ LQ WKH F\WRVROLF DVVD\ 7KHVH VWXGLHV WKHUHIRUH VXSSRUW WKH K\SRWKHVLV WKDW LQFUHDVHG SURJHVWHURQH GXULQJ SUHJQDQF\ UHGXFHV WKH 05PHGLDWHG HIIHFWV RI FRUWLVRO 7KLV DFWLRQ RI SURJHVWHURQH PD\ UHVXOW LQ GHFUHDVHG FRUWLVRO IHHGEDFN HIIHFWV LQ WKH KLSSRFDPSXV GXULQJ SUHJQDQF\

PAGE 86

7DEOH 3ODVPD KRUPRQH OHYHOV LQ ILYH JURXSV 7RWDO 3ODVPD &RUWLVRO QJPOf )UHH 3ODVPD &RUWLVRO Q0 7RWDO 3ODVPD 3URJHVWHURQH QJPOf )UHH 3ODVPD 3URJHVWHURQH Q0f $OGRVWHURQH SJPOf $GUHQDO,QWDFW VKDPf 1RQSUHJQDQW RYDULHFWRPL]HG s s s s s 3UHJQDQW sr s sr sr s $GUHQDOHFWRPL]HG 1RQSUHJQDQW RYDULHFWRPL]HG s s s s s 3UHJQDQW s s sr s r s 1RQSUHJQDQW SURJHVWHURQH s s s r sr s 'DWD H[SUHVVHG DV PHDQ s 6(0 r LQGLFDWHV GLIIHUHQW WKDQ QRQSUHJQDQW

PAGE 87

7DEOH 05 DQG *5 3URWHLQ DQG P51$ LQ KLSSRFDPSXV 5HFHSWRU 3URWHLQ 2'rPPfr 5HFHSWRU P51$ IROG FKDQJHfrr 05 *5 05 *5 $GUHQDO,QWDFW VKDPf 1RQSUHJQDQW s s f f 3UHJQDQW s s f f $GUHQDOHFWRPL]HG 1RQSUHJQDQW s s f f 3UHJQDQW s s f f 1RQSUHJQDQW 3 s s f 'DWD H[SUHVVHG DV PHDQ s 6(0 r 'DWD H[SUHVVHG DV PHDQ s 6(0 RI DGMXVWHG YROXPH2'rPPf DERYH EDFNJURXQG s 6(0 rr 'DWD IRU UHFHSWRU P51$ DUH H[SUHVVHG DV IROG FKDQJH UHODWLYH WR QRQSUHJQDQW DGUHQDO LQWDFW WKH UDQJH LV LQGLFDWHG LQ SDUHQWKHVHV

PAGE 88

F nR 2 f§ 4B 2f ( 7R R R ( [ &' ( & && $'; $'; $';3 1RQ3UHJ 3UHJ ,QWDFW ,QWDFW )LJ 05 ELQGLQJ SDUDPHWHUV LQ RYLQH KLSSRFDPSXV ZLWK SUHJQDQF\ RU SURJHVWHURQH WUHDWPHQW .G DQG %PD[ RI 05 IRU FRUWLVRO LQ SUHJQDQW DQG QRQSUHJQDQW DGUHQDOLQWDFW HZHV ULJKW XSSHU DQG ORZHU SDQHOVf DQG LQ SUHJQDQW QRQSUHJQDQW DQG QRQSUHJQDQW SURJHVWHURQHWUHDWHG DGUHQDOHFWRPL]HG $';f HZHV OHIW XSSHU DQG ORZHU SDQHOVf 'DWD DUH VKRZQ DV PHDQ s 6(0 r LQGLFDWHV VLJQLILFDQWO\ GLIIHUHQW IURP QRQSUHJQDQW DQLPDOV LQ VDPH FRUWLFRVWHURLG WUHDWPHQW JURXS LH DGUHQDOLQWDFW RU $';f

PAGE 89

2 %RXQG r_ ‘R L + FRUWLVRO FRQFHQWUDWLRQ Q0f LI %RXQG )LJ 05 ELQGLQJ FXUYHV LQ UHSUHVHQWDWLYH QRQSUHJQDQW WRSf SUHJQDQW PLGGOHf DQG QRQSUHJQDQW SURJHVWHURQHWUHDWHG ERWWRPf DGUHQDOHFWRPL]HG HZH $W HDFK XSSHUULJKW FRPHU LW LV WKH 6FDWFKDUG SORW FRQYHUWHG IURP QRQOLQHDU UHJUHVVLRQ GDWD

PAGE 90

,17$&7 05 N'D $'; *5 N'D frf§ 13f§ frf§3f§ 22 )LJXUH :HVWHUQ EORW LPDJHV IRU 05 WRSf DQG *5 ERWWRPf LQ KLSSRFDPSDO F\WRVRO /DQHV LQ WKH 05 LPPXQREORW DUH LGHQWLILHG DV VDPSOHV IURP QRQSUHJQDQW DGUHQDOLQWDFW HZHV VDPSOHV IURP SUHJQDQW DGUHQDOLQWDFW HZHV VDPSOHV IURP QRQSUHJQDQW DGUHQDOHFWRPL]HG HZHV VDPSOHV IURP SUHJQDQW DGUHQDOHFWRPL]HG HZHV VDPSOHV IURP QRQSUHJQDQW SURJHVWHURQHWUHDWHG DGUHQDOHFWRPL]HG HZHV /DQHV LQ WKH *5 LPPXQREORW DUH LGQHWLILHG DV 13 QRQSUHJQDQW 3 SUHJQDQW 133 QRQSUHJQDQW SURJHVWHURQHWUHDWHG 6DPSOHV IURP DGUHQDOLQWDFW HZHV DUH VKRZQ LQ SDQHOV RQ WKH OHIW WKRVH IURP DGUHQDOFHWRPL]HG HZHV RQ WKH ULJKW

PAGE 91

13 $G[ 3 $G[ 13$G[3 )LJ +7$ UHFHSWRU P51$ OHYHO PHDVXUHG E\ UHDOWLPH 573&5 LQ KLSSRFDPSXV 7RS SDQHO FRPSDULVRQ RI P51$ LQ WZR DGUHQDO LQWDFW JURXSV 7KHUH ZDV QR VLJQLILFDQW GLIIHUHQFH E\ XQSDLUHG W WHVW %RWWRP SDQHO FRPSDULVRQ RI P51$ LQ WKUHH $'; JURXSV 7KHUH ZDV QR VLJQLILFDQW GLIIHUHQFH E\ RQH ZD\ $129$ 'DWD ZDV VKRZHG E\ GHOWD &W ZKLFK LV WKH GLIIHUHQFH EHWZHHQ &W RI +7$ UHFHSWRU DQG &W RI U51$ IURP WKH VDPH VDPSOH

PAGE 92

&+$37(5 6800$5< $1' &21&/86,216 7KH VWXGLHV SUHVHQWHG LQ WKLV GLVVHUWDWLRQ ZHUH GHVLJQHG WR H[SODLQ KRZ WKH VHW SRLQW IRU WKH IHHGEDFN UHJXODWLRQ RI FRUWLVRO DQG $&7+ FDQ EH LQFUHDVHG GXULQJ SUHJQDQF\ LQ VKHHS DV ZHOO DV LQ KXPDQV :H K\SRWKHVL]H WKDW WKH FKDQJHV LQ SUHJQDQF\ UHVXOW IURP D GHFUHDVH LQ FRUWLVRO DFWLRQ DW WKH 05 EXW QR GHFUHDVH LQ DFWLRQ DW WKH *5 ZH K\SRWKHVL]H WKDW WKHVH FKDQJHV DQG WKHUHIRUH WKH HOHYDWLRQ RI FRUWLVRO DUH UHODWHG WR WKH LQFUHDVH LQ SODVPD SURJHVWHURQH GXULQJ SUHJQDQF\ 7KH VSHFLILF K\SRWKHVHV LQ WKLV GLVVHUWDWLRQ DUH 3URJHVWHURQH DFWV DV DQ DQWDJRQLVW RI FRUWLVRO DW 05 DQGRU UHGXFHV 05 QXPEHU LQ WKH SUHJQDQW VWDWH WR UHGXFH WKH PLQHUDORFRUWLFRLG DFWLRQ RI FRUWLVRO LQ EUDLQ 3URJHVWHURQH GRHVQfW LQWHUIHUH ZLWK FRUWLVRO HIIHFW DW *5 EXW DV SDUWLDO DJRQLVW UHVXOWV LQ WKH FRPELQHG HIIHFW RI SURJHVWHURQH DQG FRUWLVRO DW *5 %\ WKH GDWD VKRZQ DERYH ZH IRXQG WKDW WKH DSSDUHQW .G RI FRUWLVRO DW 05 LQ WKH KLSSRFDPSXV LV LQFUHDVHG E\ DQ LQFUHDVH LQ SURJHVWHURQH FRQFHQWUDWLRQ SURGXFHG HLWKHU E\ SUHJQDQF\ RU SURJHVWHURQH WUHDWPHQW 7KH LQFUHDVH LQ DSSDUHQW .G LV DOVR UHIOHFWHG LQ DQ LQFUHDVH LQ 05 DYDLODELOLW\ LQ KLSSRFDPSXV LQ SUHJQDQW HZHV DQG LQ QRQSUHJQDQW HZHV ZLWK FKURQLF SURJHVWHURQH WUHDWPHQW 7KHVH FKDQJHV DUH QRW UHODWHG WR WKH OHYHO RI FLUFXODWLQJ FRUWLVRO DQG WKHUH ZDV QR FKDQJH LQ *5 DYDLODELOLW\ LQ KLSSRFDPSXV 7KH FKDQJH LQ 05 DYDLODELOLW\ ZDV QRW GXH WR WKH OHYHO RI UHFHSWRUV LQ YLYR VLQFH QHLWKHU P51$ QRU SURWHLQ OHYHO RI 05 DQG *5 FKDQJHG 7KHVH GDWD DUH FRQVLVWHQW ZLWK FRPSHWLWLRQ RI SURJHVWHURQH ZLWK FRUWLVRO IRU ELQGLQJ DW 05 UHVXOWLQJ LQ IHZHU DFWLYDWHG 05 DQG PRUH XQDFWLYDWHG 05 DYDLODEOH IRU OLJDQG ELQGLQJ LQ WKH F\WRVROLF DVVD\

PAGE 93

+7$ UHFHSWRU GDWD GLGQfW VKRZ DQ LQFUHDVH LQ P51$ H[SUHVVLRQ LQ HZHV ZLWK KLJK SURJHVWHURQH OHYHO 7KHUH DUH VHYHUDO SRVVLEOH H[SODQDWLRQV IRU WKLV QHJDWLYH UHVXOW DV VWDWHG LQ &KDSWHU 7KHVH VWXGLHV WKHUHIRUH VXSSRUW WKH K\SRWKHVLV WKDW LQFUHDVHG SURJHVWHURQH GXULQJ SUHJQDQF\ UHGXFHV WKH 05PHGLDWHG HIIHFWV RI FRUWLVRO DQG SURJHVWHURQH GRHVQfW LQWHUIHUH WKH *5PHGLDWHG HIIHFWV RI FRUWLVRO 7KLV DFWLRQ RI SURJHVWHURQH PD\ UHVXOW LQ GHFUHDVHG FRUWLVRO IHHGEDFN HIIHFWV DW WKH EDVDO OHYHO LQ WKH KLSSRFDPSXV GXULQJ SUHJQDQF\

PAGE 94

/,67 2) 5()(5(1&(6 $ERX6DPUD$% % /RUDV 0 3XJHDW 7RXPLDLUH %HUWUDQG 'HPRQVWUDWLRQ RI DQ DQWLJOXFFRUWLFRLG DFWLRQ RI SURJHVWHURQH RQ WKH FRUWLFRVWHURQH LQKLELWLRQ RI E HQGRUSKLQ UHOHDVH E\ UDW DQWHULRU SLWXLWDU\ LQ SULPDU\ FXOWXUH (QGRFULQRORJ\ Y S $OEHUW35 4 < =KRX + + 9DQ 7RO 5 %XQ]RZ 2 &LYHOOL &ORQLQJ IXQFWLRQDO H[SUHVVLRQ DQG P51$ WLVVXH GLVWULEXWLRQ RI WKH UDW K\GUR[\WU\SWDPLQHO$ UHFHSWRU JHQH %LRO&KHP Y S $OOROLR% +RIIPDQQ ( $ /LQWRQ : :LQNHOPDQQ 0 .XVFKH + 0 6FKXOWH 'LXUQDO VDOLYDU\ FRUWLVRO SDWWHUQV GXULQJ SUHJQDQF\ DQG DIWHU GHOLYHU\ UHODWLRQVKLS WR SODVPD FRUWLFRWURSKLQUHOHDVLQJKRUPRQH &OLQ(QGRFULQRO2[If Y S $URQ'& $ 0 6FKQDOO / 5 6KHHOHU &XVKLQJnV V\QGURPH DQG SUHJQDQF\ $PHULFDQ -RXUQDO RI 2EVWHWULFV DQG *\QHFRORJ\ Y S $URQVVRQ0 )X[H < 'RQJ / ) $JQDWL 6 2NUHW $ *XVWDIVVRQ /RFDOL]DWLRQ RI JOXFRFRUWLFRLG UHFHSWRU P51$ LQ WKH PDOH UDW EUDLQ E\ LQ VLWX K\EULGL]DWLRQ 3URF1DWO$FDG6FL86$ Y S $UUL]D-/ 5 % 6LPHUO\ / : 6ZDQVRQ 5 0 (YDQV 7KH QHXURQDO PLQHUDORFRUWLFRLG UHFHSWRU DV D PHGLDWRU RI JOXFRFRUWLFRLG UHVSRQVH 1HXURQ Y S $UUL]D-/ & :HLQEHUJHU &HUHOOL 7 0 *ODVHU % / +DQGHOLQ ( +RXVPDQ 5 0 (YDQV &ORQLQJ RI KXPDQ PLQHUDORFRUWLFRLG UHFHSWRU FRPSOHPHQWDU\ '1$ VWUXFWXUDO DQG IXQFWLRQDO NLQVKLS ZLWK WKH JOXFRFRUWLFRLG UHFHSWRU 6FLHQFH Y S %DUNHU30 9 :DOWHUV 0 0DUNLHZLF] / % 6WUDQJ 'HYHORSPHQW RI WKH OXQJ OLTXLG UHVRUSWLYH PHFKDQLVP LQ IHWDO VKHHSV\QHUJLVP RI WULLRGRWK\URQLQH DQG K\GURFRUWLVRQH -RXUQDO RI 3K\VLRORJ\ Y S %DUQHV3, $GFRFN $QWLLQIODPPDWRU\ DFWLRQV RI VWHURLGV PROHFXODU PHFKDQLVPV 7UHQGV 3KDUPDFRO6FL Y S

PAGE 95

%HOO0( & ( :RRG : 0 .HOOHU ,QIOXHQFH RI UHSURGXFWLYH VWDWH RQ SLWXLWDU\ DGUHQDO DFWLYLW\ LQ WKH HZH 'RPHVW$QLP(QGRFULQRO Y S %ORHP/& *XR + 3UDWW ,GHQWLILFDWLRQ RI D VSOLFH YDULDQW RI WKH UDW DQG KXPDQ PLQHUDORFRUWLFRLG UHFHSWRU JHQHV -6WHURLG %LRFKHP0RO%LRO Y S %UDGEXU\06 ) $NDQD 0 ) 'DOOPDQ 5ROHV RI W\SH DQG ,, FRUWLFRVWHURLG UHFHSWRUV LQ UHJXODWLRQ RI EDVDO DFWLYLW\ LQ WKH K\SRWKDODPRSLWXLWDU\DGUHQDO D[LV GXULQJ WKH GLXUQDO WURXJK DQG WKH SHDN HYLGHQFH IRU D QDQDGGLWLYH HIIHFW RI FRPELQHG UHFHSWRU RFFXSDWLRQ (QGRFULQRORJ\ Y S %URRNV9/ / & .HLO &KDQJHV LQ WKH EDURUHIOH[ GXULQJ SUHJQDQF\ LQ FRQVFLRXV GRJV KHDUW UDWH DQG KRUPRQDO UHVSRQVHV (QGRFULQRORJ\ Y S %XFNLQJKDP -& (IIHFWV RI DGUHQRFRUWLFDO DQG JRQDGDO VWHURLGV RQ WKH VHFUHWLRQ LQ YLWUR RI FRUWLFRWURSKLQ DQG LWV K\SRWKDODPLF UHOHDVLQJ IDFWRU (QGRFULQRO Y S %XFNLQJKDP -& 5 +RGJHV 7KH XVH RI FRUWLFRWURSKLQ SURGXFWLRQ E\ DGHQRK\SRSK\VLDO WLVVXH LQ YLWUR IRU WKH GHWHFWLRQ DQG HVWLPDWLRQ RI SRWHQWLDO FRUWLFRWURSKLQ UHOHDVLQJ IDFWRUV -(QGRFULQRO Y S %XUJHVV/+ 5 +DQGD &KURQLF HVWURJHQLQGXFHG DOWHUDWLRQV LQ DGUHQRFRUWLFRWURSLQ DQG FRUWLFRVWHURQH VHFUHWLRQ DQG JOXFRFRUWLFRLG UHFHSWRUPHGLDWHG IXQFWLRQ LQ IHPDOH UDWV (QGRFULQRORJ\ Y S %XPVWHLQ./ & 0 -HZHOO 0 6DU $ &LGORZVNL ,QWUDJHQLF VHTXHQFHV RI WKH KXPDQ JOXFRFRUWLFRLG UHFHSWRU FRPSOHPHQWDU\ '1$ PHGLDWH KRUPRQHLQGXFLEOH UHFHSWRU PHVVHQJHU 51$ GRZQUHJXODWLRQ WKURXJK PXOWLSOH PHFKDQLVPV 0ROHFXODU (QGRFULQRORJ\ Y S &DOGHQKRYHQ( 7 YDQ 'LMN $ 5DDLMPDNHUV : /DPPHUV / .RHQGHUPDQ 5 3 'H *URRW $FWLYDWLRQ RI WKH 67$7DFXWH SKDVH UHVSRQVH IDFWRU WUDQVFULSWLRQ IDFWRU E\ LQWHUOHXNLQ -%LRO&KHP Y S &DPSEHOO($ ( $ /LQWRQ & $ :ROIH 3 5 6FUDJJV 0 7 -RQHV 3 /RZU\ 3ODVPD FRUWLFRWURSLQUHOHDVLQJ KRUPRQH FRQFHQWUDWLRQV GXULQJ SUHJQDQF\ DQG SDUWXULWLRQ -RXUQDO RI &OLQLFDO (QGRFULQRORJ\ DQG 0HWDEROLVP Y S &DQQ\%: )XQGHU &ODUNH *OXFRFRUWLFRLGV UHJXODWH RYLQH K\SRSK\VLDO SRUWDO OHYHOV RI FRUWLFRWURSLQUHOHDVLQJ IDFWRU DQG DUJLQLQH YDVRSUHVVLQ LQ D VWUHVVVSHFLILF PDQQHU (QGRFULQRORJ\ Y S

PAGE 96

&DUH\03 & + 'HWHUG GH.RQLJ ) +HOPHUKRVW ( 5 'H.ORHW 7KH LQIOXHQFH RI RYDULDQ VWHURLGV RQ K\SRWKDODPLFSLWXLWDU\DGUHQDO UHJXODWLRQ LQ WKH IHPDOH UDW -(QGRFULQRO Y S &DUU%5 & 5 3DUNHU 0DGGHQ 3 & 0DF'RQDOG & 3RUWHU 0DWHUQDO DGUHQRFRUWLFRWURSLQ DQG FRUWLVRO UHODWLRQVKLSV WKURXJKRXW KXPDQ SUHJQDQF\ $PHULFDQ -RXUQDO RI 2EVWHWULFV DQG *\QHFRORJ\ Y S &DVWUHQ0 9 3DWFKHY 2 ) $OPHLGD ) +ROVERHU 7 7UDSS ( &DVWUHQ 5HJXODWLRQ RI UDW PLQHUDORFRUWLFRLG UHFHSWRU H[SUHVVLRQ LQ QHXURQV E\ SURJHVWHURQH (QGRFULQRORJ\ Y S &KDOPHUV'7 6 3 .ZDN $ 0DQVRXU + $NLO 6 :DWVRQ &RUWLFRVWHURLGV UHJXODWH EUDLQ KLSSRFDPSDO +7$ UHFHSWRU P51$ H[SUHVVLRQ 1HXURVFL Y S &KDOPHUV'7 6 :DWVRQ &RPSDUDWLYH DQDWRPLFDO GLVWULEXWLRQ RI +7$ UHFHSWRU P51$ DQG +7$ ELQGLQJ LQ UDW EUDLQf§D FRPELQHG LQ VLWX K\EULGLVDWLRQLQ YLWUR UHFHSWRU DXWRUDGLRJUDSKLF VWXG\ %UDLQ 5HV Y S &KDSPDQ06 $VNHZ 8 .XVFXRJOX 5 / 0LHVIHOG 7UDQVFULSWLRQDO FRQWURO RI VWHURLGUHJXODWHG DSRSWRVLV LQ PXULQH WK\PRPD FHOOV 0RO(QGRFULQRO Y S &KDPH\'6 $ < 'HXWFK + .U\VWDO 6 0 6RXWKZLFN 0 'DYLV 3V\FKRELRORJLF PHFKDQLVPV RI SRVWWUDXPDWLF VWUHVV GLVRUGHU $UFK*HQ3V\FKLDWU\ Y S &KRX<& : /XWWJH $FWLYDWHG W\SH ,, UHFHSWRUV LQ EUDLQ FDQQRW UHELQG JOXFRFRUWLFRLGV UHODWLRQVKLS WR SURJHVWHURQHnV DQWLJOXFRFRUWLFRLG DFWLRQV %UDLQ 5HVHDUFK Y S &KULVW0 0 :HKOLQJ &DUGLRYDVFXODU VWHURLG DFWLRQV VZLIW VZDOORZV RU VOXJJLVK VQDLOV" &DUGLRYDVF5HV Y S &KULVWLDQVRQ5( 6WXGLHV RQ EORRG SUHVVXUH GXULQJ SUHJQDQF\ ,QIOXHQFH RI SDULW\ DQG DJH $P-2EVWHW*\QHFRO Y S &UDQGDOO0( & 0 +HHVFK %DURUHIOH[ FRQWURO RI V\PSDWKHWLF RXWIORZ LQ SUHJQDQW UDWV HIIHFWV RI FDSWRSULO $P-3K\VLRO Y S 55 &XOOLQDQ:( 3 +HUPDQ 6 :DWVRQ 9HQWUDO VXELFXODU LQWHUDFWLRQ ZLWK WKH K\SRWKDODPLF SDUDYHQWULFXODU QXFOHXV HYLGHQFH IRU D UHOD\ LQ WKH EHG QXFOHXV RI WKH VWULD -&RPS 1HXURO Y S

PAGE 97

'DOOPDQ0) 6 ) $NDQD & 6 &DVFLR 1 'DUOLQJWRQ / -DFREVRQ 1 /HYLQ D 5HJXODWLRQ RI $&7+ VHFUHWLRQ 9DULDWLRQV RQ D WKHPH RI % 5HFHQW 3URJUHVV LQ +RUPRQH 5HVHDUFK Y S 'DOOPDQ0) 6 ) $NDQD / -DFREVRQ 1 /HYLQ & 6 &DVFLR 6KLQVDNR E &KDUDFWHUL]DWLRQ RI FRUWLFRVWHURQH IHHGEDFN UHJXODWLRQ RI $&7+ VHFUHWLRQ $QQ1< $FDG6FL Y S 'DOOPDQ0) ) (
PAGE 98

(QFLR-6 'HWHUD:DGOHLJK 7KH JHQRPLF VWUXFWXUH RI WKH KXPDQ JOXFRFRUWLFRLG UHFHSWRU -RXUQDO RI %LRORJLFDO &KHPLVWU\ Y S (ULNVVRQ3 2 :UDQJH 3URWHLQSURWHLQ FRQWDFWV LQ WKH JOXFRFRUWLFRLG UHFHSWRU KRPRGLPHU LQIOXHQFH LWV '1$ ELQGLQJ SURSHUWLHV -%LRO&KHP Y S )HOGPDQ6 1 &RQIRUWL 3DUWLFLSDWLRQ RI WKH GRUVDO KLSSRFDPSXV LQ WKH JOXFRFRUWLFRLG IHHGEDFN HIIHFW RQ DGUHQRFRUWLFDO DFWLYLW\ 1HXURHQGRFULQRORJ\ Y S )URK'. 3 / %DOODUG )HWDO /XQJ 0DWXUDWLRQ LQ *' 7KRUEXP DQG 5 +DUGLQJ HGVf 7H[WERRN RI )HWDO 3K\VLRORJ\ 2[IRUG 2[IRUG 8QLYHUVLW\ 3UHVV S )XQGHU-: 0LQHUDORFRUWLFRLG UHFHSWRUV DQG JOXFRFRUWLFRLG UHFHSWRUV &OLQ(QGRFULQRO2[If Y S *DOLJQLDQD0' 3 9LFHQW 3LZLHQ3LOLSXN %XUWRQ & 3 /DQWRV 0HFKDQLVP RI DFWLRQ RI WKH SRWHQW VRGLXPUHWDLQLQJ VWHURLG R[LGRSURJHVWHURQH 0RO3KDUPDFRO Y S *HOOHU'6 $ )DUKL 1 3LQNHUWRQ 0 )UDGOH\ 0 0RULW] $ 6SLW]HU 0HLQNH ) 7 7VDL 3 % 6LJOHU 5 3 /LIWRQ $FWLYDWLQJ PLQHUDORFRUWLFRLG UHFHSWRU PXWDWLRQ LQ K\SHUWHQVLRQ H[DFHUEDWHG E\ SUHJQDQF\ 6FLHQFH Y S *LJXHUH9 6 0 +ROOHQEHUJ 0 5RVHQIHOG 5 0 (YDQV )XQFWLRQDO GRPDLQV RI WKH KXPDQ JOXFRFRUWLFRLG UHFHSWRU &HOO Y S *RPH]6DQFKH](3 & ( *RPH]6DQFKH] &HQWUDO PLQHUDORFRUWLFRLG UHFHSWRU DQWDJRQLVP EORFNV K\SHUWHQVLRQ LQ 'DKO6-5 UDWV $PHULFDQ -RXUQDO RI 3K\VLRORJ\ Y S (( *RPH]6DQFKH](3 0 7 9HQNDWDUDPDQ 7KZDLWHV & )RUW ,&9 LQIXVLRQ RI FRUWLFRVWHURQH DQWDJRQL]HV ,&9DOGRVWHURQH K\SHUWHQVLRQ $PHULFDQ -RXUQDO RI 3K\VLRORJ\ Y S (( *UD\-$ 7KH 3V\FKRORJ\ RI )HDU DQG 6WUHVV 8QLYHUVLW\ 3UHVV &DPEULGH 0$ +DPPRQG*& $ 1LVNHU / $ -RQHV 3 6LLWHUL (VWLPDWLRQ RI WKH SHUFHQWDJH RI IUHH VWHURLG LQ XQGLOXWHG VHUXP E\ FHQWULIXJDO XOWUDILOWUDWLRQGLDO\VLV -RXUQDO RI %LRORJLFDO &KHPLVWU\ Y S +DUGLQJ5 'HYHORSPHQW RI WKH UHVSLUDWRU\ V\VWHP LQ *' 7KRUEXP DQG 5 +DUGLQJ HGVf 7H[WERRN RI )HWDO 3K\VLRORJ\ 2[IRUG 2[IRUG 8QLYHUVLW\ 3UHVV S

PAGE 99

+HHVFK&0 5 & 5RJHUV (IIHFWV RI SUHJQDQF\ DQG SURJHVWHURQH PHWDEROLWHV RQ UHJXODWLRQ RI V\PSDWKHWLF RXWIORZ &OLQLFDO DQG ([SHULPHQWDO 3KDUPDFRORJ\ DQG 3K\VLRORJ\ Y S +HLVOHU/. + 0 &KX 7 %UHQQDQ $ 'DQDR 3 %DMZD / + 3DUVRQV / + 7HFRWW (OHYDWHG DQ[LHW\ DQG DQWLGHSUHVVDQWOLNH UHVSRQVHV LQ VHURWRQLQ +7$ UHFHSWRU PXWDQW PLFH 3URF1DWO$FDG6FL86$ Y S +HOODO/HY\& % &RXHWWH )DJDUW $ 6RXTXH & *RPH]6DQFKH] 0 5DIHVWLQ2EOLQ 6SHFLILF K\GUR[\ODWLRQV GHWHUPLQH VHOHFWLYH FRUWLFRVWHURLG UHFRJQLWLRQ E\ KXPDQ JOXFRFRUWLFRLG DQG PLQHUDORFRUWLFRLG UHFHSWRUV )(%6 /HWW Y S +HOODO/HY\& )DJDUW $ 6RXTXH 0 ( 5DIHVWLQ2EOLQ 0HFKDQLVWLF DVSHFWV RI PLQHUDORFRUWLFRLG UHFHSWRU DFWLYDWLRQ .LGQH\ ,QW Y S +HQQHVV\'3 3 &RJKODQ +DUG\ % $ 6FRJJLQV ( 0 :LQWRXU 7KH RULJLQ RI FRUWLVRO LQ WKH EORRG RI IHWDO VKHHS -RXUQDO RI (QGRFULQRORJ\ Y S +HUPDQ-3 5HJXODWLRQ RI DGUHQRFRUWLFRVWHURLG UHFHSWRU P51$ H[SUHVVLRQ LQ WKH FHQWUDO QHUYRXV V\VWHP &HOO 0RO1HXURELRO Y S +HUPDQ -3 : ( &XOOLQDQ 1HXURFLUFXLWU\ RI VWUHVV FHQWUDO FRQWURO RI WKH K\SRWKDODPRSLWXLWDU\DGUHQRFRUWLFDO D[LV 7UHQGV LQ 1HXURVFLHQFHV Y S +HUPDQ-3 3 3DWHO + $NLO 6 :DWVRQ D /RFDOL]DWLRQ DQG UHJXODWLRQ RI JOXFRFRUWLFRLG DQG PLQHUDORFRUWLFRLG UHFHSWRU PHVVHQJHU 51$V LQ WKH KLSSRFDPSDO IRUPDWLRQ RI WKH UDW 0ROHFXODU (QGRFULQRORJ\ Y S +HUPDQ-3 0 6FKDIHU ( $
PAGE 100

+RHFN: 6 5XVFRQL % *URQHU 'RZQUHJXODWLRQ DQG SKRVSKRU\ODWLRQ RI JOXFRFRUWLFRLG UHFHSWRUV LQ FXOWXUHG FHOOV ,QYHVWLJDWLRQV ZLWK D PRQRVSHFLILF DQWLVHUXP DJDLQVW D EDFWHULDOO\ H[SUHVVHG UHFHSWRU IUDJPHQW -%LRO&KHP Y S +ROOHQEHUJ60 5 0 (YDQV 0XOWLSOH DQG FRRSHUDWLYH WUDQVDFWLYDWLRQ GRPDLQV RI WKH KXPDQ JOXFRFRUWLFRLG UHFHSWRU &HOO Y S +ROOHQEHUJ60 & :HLQEHUJHU ( 6 2QJ &HUHOOL $ 2UR 5 /HER ( % 7RPSVRQ 0 5RVHQIHOG 5 0 (YDQV 3ULPDU\ VWUXFWXUH DQG H[SUHVVLRQ RI D IXQFWLRQDO KXPDQ JOXFRFRUWLFRLG UHFHSWRU F'1$ 1DWXUH Y S +XEEDUG 0 .DOLPL 6\QHUJLVWLF HIIHFW RI PRO\EGDWH SOXV GLWKLRWKUHLWRO RQ VWDELOL]DWLRQ UHDFWLYDWLRQ DQG SDUWLDO SXULILFDWLRQ RI WKH NLGQH\ JOXFRFRUWLFRLG UHFHSWRU %LRO&KHP Y S +XPSKUH\V3: 1 -RHOV &KDQJHV LQ FDUGLDF RXWSXW DQG WRWDO SHULSKHUDO UHVLVWDQFH GXULQJ WKH FDURWLG VLQXV EDURUHFHSWRU UHIOH[ LQ WKH SUHJQDQW UDEELW -3K\VLRO Y S +XWFKLVRQ.$ 'LWWPDU : % 3UDWW $OO RI WKH IDFWRUV UHTXLUHG IRU DVVHPEO\ RI WKH JOXFRFRUWLFRLG UHFHSWRU LQWR D IXQFWLRQDO KHWHURFRPSOH[ ZLWK KHDW VKRFN SURWHLQ DUH SUHDVVRFLDWHG LQ D VHOIVXIILFLHQW SURWHLQ IROGLQJ VWUXFWXUH D IROGRVRPH -%LRO&KHP Y S ,PDL( 1 0LQHU $ 0LWFKHOO 5
PAGE 101

-RQHV07 ( : +LOOKRXVH 6WUXFWXUHDFWLYLW\ UHODWLRQVKLS DQG WKH PRGH RI DFWLRQ RI FRUWLFRVWHURLG IHHGEDFN RQ WKH VHFUHWLRQ RI FRUWLFRWURSKLQUHOHDVLQJ IDFWRU FRUWLFROLEHULQf 6WHURLG %LRFKHP Y S -RQHV07 ( : +LOOKRXVH / %XUGHQ 6WUXFWXUHDFWLYLW\ UHODWLRQVKLSV RI FRUWLFRVWHURLG IHHGEDFN DW WKH K\SRWKDODPLF OHYHO -(QGRFULQRO Y S .DJH\DPD< ( / %UDYR +\SHUWHQVLYH PHFKDQLVPV DVVRFLDWHG ZLWK FHQWUDOO\ DGPLQLVWHUHG DOGRVWHURQH LQ GRJV +\SHUWHQVLRQ Y S .DOLQ\DN-( 5 'RULQ $ 5 +RIIPDQ $ 3HUOPDQ 7LVVXHVSHFLILF UHJXODWLRQ RI JOXFRFRUWLFRLG UHFHSWRU P51$ E\ GH[DPHWKDVRQH -RXUQDO RI %LRORJLFDO &KHPLVWU\ Y S .DWKRO5* 5 6 -DHFNOH ) /RSH] : + 0HOOHU 3DWKRSK\VLRORJ\ RI +3 $ D[LV DEQRUPDOLWLHV LQ SDWLHQWV ZLWK PDMRU GHSUHVVLRQ DQ XSGDWH $P3V\FKLDWU\ Y S .HOOHU:RRG0 ,QKLELWLRQ RI VWLPXODWHG DQG EDVDO $&7+ E\ FRUWLVRO GXULQJ RYLQH SUHJQDQF\ $P 3K\VLRO Y S 55 .HOOHU:RRG0 (YLGHQFH IRU UHVHW RI UHJXODWHG FRUWLVRO LQ SUHJQDQF\ VWXGLHV LQ DGUHQDOHFWRPL]HG HZHV $P 3K\VLRO Y S 55 .HOOHU:RRG0 7 $ &XGG : 1RUPDQ 6 0 &DOGZHOO & ( :RRG 6KHHS PRGHO IRU VWXG\ RI PDWHUQDO DGUHQDO JODQG IXQFWLRQ GXULQJ SUHJQDQF\ /DE $QLP 6FL Y S .HOOHU:RRG0 0 ) 'DOOPDQ &RUWLFRVWHURLG LQKLELWLRQ RI $&7+ VHFUHWLRQ (QGRFULQH 5HYLHZV Y S .HOOHU:RRG0 6LOELJHU & ( :RRG 3URJHVWHURQH DWWHQXDWHV WKH LQKLELWLRQ RI DGUHQRFRUWLFRWURSLQ UHVSRQVHV E\ FRUWLVRO LQ QRQSUHJQDQW HZHV (QGRFULQRORJ\ Y S .HOOHU:RRG0 & ( :RRG D &RUWLFRWURSLQUHOHDVLQJ IDFWRU LQ WKH RYLQH IHWXV DQG SUHJQDQW HZH UROH RI WKH SODFHQWD $PHULFDQ -RXUQDO RI 3K\VLRORJ\ Y S 5 5 .HOOHU:RRG0 & ( :RRG E 'RHV WKH RYLQH SODFHQWD VHFUHWH $&7+ XQGHU QRUPR[LF RU K\SR[LF FRQGLWLRQV" $PHULFDQ -RXUQDO RI 3K\VLRORJ\ Y S 5 5

PAGE 102

.HOOHU:RRG0 & ( :RRG 3UHJQDQF\ DOWHUV FRUWLVRO IHHGEDFN LQKLELWLRQ RI VWLPXODWHG $&7+ VWXGLHV LQ DGUHQDOHFWRPL]HG HZHV $P-3K\VLRO 5HJXO,QWHJU&RPS 3K\VLRO Y S 55 .LP(. & ( :RRG 0 .HOOHU:RRG &KDUDFWHUL]DWLRQ RI EHWDK\GUR[\VWHURLG GHK\GURJHQDVH DFWLYLW\ LQ IHWDO DQG DGXOW RYLQH WLVVXHV 5HSURG)HUWLO'HY Y S .LWD\-, (IIHFWV RI YDULRXV KRUPRQHV RQ WKH SLWXLWDU\DGUHQDO D[LV $GY([S0HG%LRO Y S .UHW] + 0 5HLFKDUGW 6FKW] 5 %RFN &RUWLFRWURSLQUHOHDVLQJ KRUPRQH H[SUHVVLRQ LV WKH PDMRU WDUJHW IRU JOXFRFRUWLFRLG IHHGEDFNFRQWURO DW WKH K\SRWKDODPLF OHYHO %UDLQ 5HV Y S .ZDN63 3 3DWHO 5 & 7KRPSVRQ + $NLO 6 :DWVRQ n+HWHURJHQHLW\ RI WKH PLQHUDORFRUWLFRLG UHFHSWRU PHVVHQJHU ULERQXFOHLF DFLG GLIIHUHQWLDO H[SUHVVLRQ DQG UHJXODWLRQ RI VSOLFH YDULDQWV ZLWKLQ WKH UDW KLSSRFDPSXV (QGRFULQRORJ\ Y S /DHPPOL8. &OHDYDJH RI VWUXFWXUDO SURWHLQV GXULQJ WKH DVVHPEO\ RI WKH KHDG RI EDFWHULRSKDJH 7 1DWXUH Y S /DNVKPL9 5 5 6DNDL % 6 0F(ZHQ & 0RQGHU 5HJLRQDO GLVWULEXWLRQ RI +\GUR[\VWHURLG GHK\GURJHQDVH LQ UDW EUDLQ (QGRFULQRORJ\ Y S ODQGDX5/ /XJLELKO LQKLELWLRQ RI WKH VRGLXPUHWDLQLQJ LQIOXHQFH RI DOGRVWHURQH E\ SURJHVWHURQH &OLQ (QGRFULQRO 0HWDE Y S /DQGILHOG3: & (OGULGJH 7KH JOXFRFRUWLFRLG K\SRWKHVLV RI EUDLQ DJLQJ DQG QHXURGHJHQHUDWLRQ UHFHQW PRGLILFDWLRQV $FWD (QGRFULQRO &RSHQKf Y 6XSSO S /LQGQHU+5 &RPSDUDWLYH DVSHFWV RI FRUWLVRO WUDQVSRUW ODFN RI ILUP ELQGLQJ WR SODVPD SURWHLQV LQ GRPHVWLF UXPLQDQWV (QGRFULQRO Y S /RPEHV0 1 )DUPDQ 0 ( 2EOLQ ( ( %DXOLHX 3 %RQYDOHW % ) (UODQJHU 0 *DVF ,PPXQRKLVWRFKHPLFDO ORFDOL]DWLRQ RI UHQDO PLQHUDORFRUWLFRLG UHFHSWRU E\ XVLQJ DQ DQWLLGLRW\SLF DQWLERG\ WKDW LV DQ LQWHUQDO LPDJH RI 3URF1DWO$FDG6FL86$ Y S

PAGE 103

/RPEHV0 6 .HQRXFK $ 6RXTXH 1 )DUPDQ 0 ( 5DIHVWLQ2EOLQ 7KH PLQHUDORFRUWLFRLG UHFHSWRU GLVFULPLQDWHV DOGRVWHURQH IURP JOXFRFRUWLFRLGV LQGHSHQGHQWO\ RI WKH EHWDK\GUR[\VWHURLG (QGRFULQRORJ\ Y S /RQJR/' 0DWHUQDO EORRG YROXPH DQG FDUGLDF RXWSXW GXULQJ SUHJQDQF\ D K\SRWKHVLV RI HQGRFULQRORJLF FRQWURO $PHULFDQ -RXUQDO RI 3K\VLRORJ\ S 55 /RULDX['/ $GUHQRFRUWLFDO ,QVXIILFLHQF\ LQ ./ %HFNHU HGf 3ULQFLSOHV DQG 3UDFWLFH RI (QGRFULQRORJ\ DQG 0HWDEROLVP 3KLODGHOSKLD -% /LSSLQFRWW &R S 0DF/XVN\1( 5R\ 0 6KDQDEURXJK $ (LVHQIHOG 3UHVHUYDWLRQ RI VWHURLG UHFHSWRUV LQ IUR]HQ EUDLQ DQG SLWXLWDU\ WLVVXH XVH RI WKH FU\RSURWHFWLYH DJHQW GLPHWK\OVXOIR[LGH -1HXURVFL0HWKRGV Y S 0DJDULQRV$0 6RPR]D $ ) 'H 1LFROD *OXFRFRUWLFRLG QHJDWLYH IHHGEDFN DQG JOXFRFRUWLFRLG UHFHSWRUV DIWHU KLSSRFDPSHFWRP\ LQ UDWV +RUP0HWDE 5HV Y S 0DQWHUR) 0 %RVFDUR *OXFRFRUWLFRLGGHSHQGHQW K\SHUWHQVLRQ 6WHURLG %LRFKHP0RO%LRO Y S 0F'RQQHOO'3 0 0 6KDKED] ( 9HJHWR 0 ( *ROGPDQ 7KH KXPDQ SURJHVWHURQH UHFHSWRU $IRUP IXQFWLRQV DV D WUDQVFULSWLRQDO PRGXODWRU RI PLQHUDORFRUWLFRLG UHFHSWRU WUDQVFULSWLRQDO DFWLYLW\ -6WHURLG %LRFKHP0RO%LRO Y S 0F(ZHQ%6 ( 5 GH .ORHW : 5RVWHQH $GUHQDO VWHURLG UHFHSWRUV DQG DFWLRQV LQ WKH QHUYRXV V\VWHP 3K\VLRO 5HY Y S 0F(ZHQ%6 5 0 6DSROVN\ 6WUHVV DQG FRJQLWLYH IXQFWLRQ &XUU2SLQ1HXURELRO Y S 0F(ZHQ%6 ( 6WHOODU 6WUHVV DQG WKH LQGLYLGXDO 0HFKDQLVPV OHDGLQJ WR GLVHDVH $UFK,QWHP0HG Y S 0F*DXJK-/ / &DKLOO % 5RR]HQGDDO ,QYROYHPHQW RI WKH DP\JGDOD LQ PHPRU\ VWRUDJH LQWHUDFWLRQ ZLWK RWKHU EUDLQ V\VWHPV 3URF1DWO$FDG6FL86$ Y S 0F.HQQD1;X = 1DZD] 6 < 7VDL 0 7VDL % : 2n0DOOH\ 1XFOHDU UHFHSWRU FRDFWLYDWRUV PXOWLSOH HQ]\PHV PXOWLSOH FRPSOH[HV PXOWLSOH IXQFWLRQV -6WHURLG %LRFKHP0RO%LRO Y S

PAGE 104

0HLMHU2& 7 &ROH : 6FKPLG 6FKW] 0 -RHOV ( 5 GH .ORHW 5HJXODWLRQ RI KLSSRFDPSDO +7$ UHFHSWRU P51$ DQG ELQGLQJ LQ WUDQVJHQLF PLFH ZLWK D WDUJHWHG GLVUXSWLRQ RI WKH JOXFRFRUWLFRLG UHFHSWRU %UDLQ 5HV0RO%UDLQ 5HV Y S 0HLMHU2& ( 5 GH .ORHW &RUWLFRVWHURQH VXSSUHVVHV WKH H[SUHVVLRQ RI +7$ UHFHSWRU P51$ LQ UDW GHQWDWH J\UXV (XU-3KDUPDFRO Y S 0HLMHU2& ( 5 GH .ORHW $ UROH IRU WKH PLQHUDORFRUWLFRLG UHFHSWRU LQ D UDSLG DQG WUDQVLHQW VXSSUHVVLRQ RI KLSSRFDPSDO +7$ UHFHSWRU P51$ E\ FRUWLFRVWHURQH -1HXURHQGRFULQRO Y S 0HUFHU: 9 2EH\HVHNHUH 5 6PLWK = .UR]RZVNL &KDUDFWHUL]DWLRQ RI EHWD +6'% JHQH H[SUHVVLRQ DQG HQ]\PDWLF DFWLYLW\ 0RO&HOO (QGRFULQRO Y S 0HWFDOIH7 3DUHU &DUGLRYDVFXODU FKDQJHV GXULQJ SUHJQDQF\ LQ HZHV $P-3K\VLRO Y S 0LFKDHO$( 0 (YDJHODWRX 3 1RUJDWH 5 &ODUNH : $QWRQLZ % $ 6WHGPDQ $ %UHQQDQ 5 :HOVE\ %XMDOVND 3 0 6WHZDUW % $ &RRNH ,VRIRUPV RI OEHWD K\GUR[\VWHURLG GHK\GURJHQDVH LQ KXPDQ JUDQXORVDOXWHLQ FHOOV 0RO&HOO (QGRFULQRO Y S 0LOOHU:/ HQGRFULQRORJ\ DQG PHWDEROLVP 0F*UDZ+LOO1HZ -K\GUR[\VWHURLG GHK\GURJHQDVH 9LWDPLQV DQG +RUPRQHV Y S 0XUSK\(3 2 0 &RQQHHO\ 1HXURHQGRFULQH UHJXODWLRQ RI WKH K\SRWKDODPLF SLWXLWDU\ DGUHQDO D[LV E\ WKH QXUUOQXU VXEIDPLO\ RI QXFOHDU UHFHSWRUV 0RO(QGRFULQRO Y S 1DWKDQ') 6 /LQGTXLVW 0XWDWLRQDO DQDO\VLV RI +VS IXQFWLRQ LQWHUDFWLRQV ZLWK D VWHURLG UHFHSWRU DQG D SURWHLQ NLQDVH 0RO&HOO %LRO Y S

PAGE 105

1HXPDLHU-) 7 6H[WRQ 0 : +DPEOLQ 6 %HFN &RUWLFRVWHURLGV UHJXODWH +7$f EXW QRW +7O%f UHFHSWRU P51$ LQ UDW KLSSRFDPSXV %UDLQ 5HV0RO%UDLQ 5HV Y S 1LVKL0 ( & $]PLWLD +7$ UHFHSWRU H[SUHVVLRQ LV PRGXODWHG E\ FRUWLFRVWHURLG UHFHSWRU DJRQLVWV LQ SULPDU\ UDW KLSSRFDPSDO FXOWXUH %UDLQ 5HV Y S 1ROWHQ:( 3 $ 5XHFNHUW (OHYDWHG IUHH FRUWLVRO LQGH[ LQ SUHJQDQF\ SRVVLEOH UHJXODWRU\ PHFKDQLVPV $P 2EVWHW *\QHFRO Y S n6KDXJKQHVV\5: +DFNHWW 0DWHUQDO $GGLVRQnV GLVHDVH DQG IHWDO JURZWK UHWDUGDWLRQ $ FDVH UHSRUW 5HSURG 0HG Y S 2DNOH\5+ $ &LGORZVNL +RPRORJRXV GRZQ UHJXODWLRQ RI WKH JOXFRFRUWLFRLG UHFHSWRU WKH PROHFXODU PDFKLQHU\ &ULW 5HY(XNDU\RW*HQH ([SU Y S 2DNOH\5+ 0 6DU $ &LGORZVNL 7KH KXPDQ JOXFRFRUWLFRLG UHFHSWRU EHWD LVRIRUP ([SUHVVLRQ ELRFKHPLFDO SURSHUWLHV DQG SXWDWLYH IXQFWLRQ -RXUQDO RI %LRORJLFDO &KHPLVWU\ Y S 2GDJLUL( 1 ,VKLZDWDUL < $EH -LELNL 7 $GDFKL 5 'HPXUD + 'HPXUD 6KL]XPH +\SHUFRUWLVROLVP DQG WKH UHVLVWDQFH WR GH[DPHWKDVRQH VXSSUHVVLRQ GXULQJ JHVWDWLRQ (QGRFULQRO-SQ Y S 2NUHW6 / 3RHOOLQJHU < 'RQJ $ *XVWDIVVRQ 'RZQUHJXODWLRQ RI JOXFRFRUWLFRLG UHFHSWRU P51$ E\ JOXFRFRUWLFRLG KRUPRQHV DQG UHFRJQLWLRQ E\ WKH UHFHSWRU RI D VSHFLILF ELQGLQJ VHTXHQFH ZLWKLQ D UHFHSWRU F'1$ FORQH 3URF1DWO$FDG6FL86$ Y S 2UEDFK3 & ( :RRG 0 .HOOHU:RRG 1LWULF R[LGH UHGXFHV SUHVVRU UHVSRQVLYHQHVV GXULQJ RYLQH K\SRDGUHQRFRUWLFLVP &OLQLFDO DQG ([SHULPHQWDO 3KDUPDFRORJ\ DQG 3K\VLRORJ\ 5HI 7\SH ,Q 3UHVV 2UWK'1 & 0RXQW 6SHFLILF KLJKDIILQLW\ ELQGLQJ SURWHLQ IRU KXPDQ FRUWLFRWURSLQUHOHDVLQJ KRUPRQH LQ QRUPDO KXPDQ SODVPD %LRFKHPLFDO DQG %LRSK\VLFDO 5HVHDUFK &RPPXQLFDWLRQV Y S 2UWL( ( %RGZHOO $ 0XQFN 3KRVSKRU\ODWLRQ RI VWHURLG KRUPRQH UHFHSWRUV (QGRFU5HY Y S 2VLHU0 $GGLVRQnV GLVHDVH DQG SUHJQDQF\ $FWD (QGRFULQRO Y S

PAGE 106

2WWR& + 0 5HLFKDUGW 6FKW] $EVHQFH RI JOXFRFRUWLFRLG UHFHSWRUEHWD LQ PLFH -RXUQDO RI %LRORJLFDO &KHPLVWU\ Y S 3DUNV&/ 3 6 5RELQVRQ ( 6LELOOH 7 6KHQN 0 7RWK ,QFUHDVHG DQ[LHW\ RI PLFH ODFNLQJ WKH VHURWRQLQO$ UHFHSWRU 3URF1DWO$FDG6FL86$ Y S 3DWFKHY9. 2 ) $OPHLGD *RQDGDO VWHURLGV H[HUW IDFLOLWDWLQJ DQG EXIIHULQJ HIIHFWV RQ JOXFRFRUWLFRLGPHGLDWHG WUDQVFULSWLRQDO UHJXODWLRQ RI FRUWLFRWURSLQ UHOHDVLQJ KRUPRQH DQG FRUWLFRVWHURLG UHFHSWRU JHQHV LQ UDW EUDLQ -1HXURVFL Y S 3DWHO3' 6 3 .ZDN 3 +HUPDQ ( $
PAGE 107

3RPSHLDQR0 0 3DODFLRV 0HQJRG 'LVWULEXWLRQ DQG FHOOXODU ORFDOL]DWLRQ RI P51$ FRGLQJ IRU +7$ UHFHSWRU LQ WKH UDW EUDLQ FRUUHODWLRQ ZLWK UHFHSWRU ELQGLQJ 1HXURVFL Y S 5DPER]6 5 2RVWLQJ $ $PDUD + ) .XQJ 3 %OLHU 0 0HQGHOVRKQ 0DQQ %UXQQHU 5 +HQ 6HURWRQLQ UHFHSWRU $ NQRFNRXW DQ DQLPDO PRGHO RI DQ[LHW\ UHODWHG GLVRUGHU 3URF1DWO$FDG6FL86$ Y S 5D\1' & 6 7XUQHU 1 0 5DZDVKGHK & 5RVH 2YLQH IHWDO DGUHQDO JODQG DQG FDUGLRYDVFXODU IXQFWLRQ $PHULFDQ -RXUQDO RI 3K\VLRORJ\ Y S 55 5HDJDQ/3 % 6 0F(ZHQ &RQWURYHUVLHV VXUURXQGLQJ JOXFRFRUWLFRLGPHGLDWHG FHOO GHDWK LQ WKH KLSSRFDPSXV -&KHP1HXURDQDW Y S 5HGHL( / /L +DODV] 5 ) 0F*LYHP ) $LUG )DVW JOXFRFRUWLFRLG IHHGEDFN LQKLELWLRQ RI $&7+ VHFUHWLRQ LQ WKH RYDULHFWRPL]HG UDW HIIHFW RI FKURQLF HVWURJHQ DQG SURJHVWHURQH3* 1HXURHQGRFULQRORJ\ Y 5HHV/+ & : %XUNH 7 &KDUG 6 : (YDQV $ 7 /HWFKZRUWK 3RVVLEOH SODFHQWDO RULJLQ RI $&7+ LQ QRUPDO KXPDQ SUHJQDQF\ 1DWXUH Y S 5HLFKDUGW+0 + .DHVWQHU 7XFNHUPDQQ 2 .UHW] 2 :HVVHO\ 5 %RFN 3 *DVV : 6FKPLG 3 +HUUOLFK 3 $QJHO 6FKW] '1$ ELQGLQJ RI WKH JOXFRFRUWLFRLG UHFHSWRU LV QRW HVVHQWLDO IRU VXUYLYDO &HOO Y S 5HLFKDUGW+0 6FKW] *OXFRFRUWLFRLG VLJQDOOLQJf§PXOWLSOH YDULDWLRQV RI D FRPPRQ WKHPH 0RO&HOO (QGRFULQRO Y S 5HLFKDUGW+0 ) 7URQFKH 6 %HUJHU & .HOOHQGRQN 6FKW] 1HZ LQVLJKWV LQWR JOXFRFRUWLFRLG DQG PLQHUDORFRUWLFRLG VLJQDOLQJ OHVVRQV IURP JHQH WDUJHWLQJ $GY3KDUPDFRO Y S 5HXO-0 ( 5 GH .ORHW ) YDQ 6OXLMV $ 5LMQEHUN 5RWKXL]HQ %LQGLQJ FKDUDFWHULVWLFV RI PLQHUDORFRUWLFRLG DQG JOXFRFRUWLFRLG UHFHSWRUV LQ GRJ EUDLQ DQG SLWXLWDU\ (QGRFULQRORJ\ Y S 5HXO-0 3 7 3HDUFH : )XQGHU = 6 .UR]RZVNL 7\SH DQG W\SH ,, FRUWLFRVWHURLG UHFHSWRU JHQH H[SUHVVLRQ LQ WKH UDW HIIHFW RI DGUHQDOHFWRP\ DQG GH[DPHWKDVRQH DGPLQLVWUDWLRQ 0ROHFXODU (QGRFULQRORJ\ Y S 5HXO-0+ ( 5 'H.ORHW 7ZR UHFHSWRU V\VWHP IRU FRUWLFRVWHURQH LQ UDW EUDLQ PLFURGLVWULEXWLRQ DQG GLIIHUHQWLDO RFFXSDWLRQ (QGRFULQRORJ\ Y S

PAGE 108

5HXO-0+0 ( 5 'H.ORHW $QDWRPLFDO UHVROXWLRQ RI WZR W\SHV RI FRUWLFRVWHURQH UHFHSWRU VLWHV LQ UDW EUDLQ ZLWK LQ YLWUR DXWRUDGLRJUDSK\ DQG FRQSXWHUL]HG LPDJH DQDO\VLV -6WHURLG %LRFKHP Y S 5HXO-0+0 ) 5 YDQ GHQ %RVFK ( 5 'H.ORHW 5HODWLYH RFFXSDWLRQ RI W\SH DQG W\SH ,, FRUWLFRVWHURLG UHFHSWRUV LQ UDW EUDLQ IROORZLQJ VWUHVV DQG GH[DPHWKDVRQH WUHDWPHQW IXQFWLRQDO LPSOLFDWLRQV -RXUQDO RI (QGRFULQRORJ\ Y S 5LVROG3< / : 6ZDQVRQ 6WUXFWXUDO HYLGHQFH IRU IXQFWLRQDO GRPDLQV LQ WKH UDW KLSSRFDPSXV 6FLHQFH Y S 5RHVFK'0 0 .HOOHU:RRG 'LIIHUHQWLDO (IIHFWV RI 3UHJQDQF\ RQ 0LQHUDORFRUWLFRLG DQG *OXFRFRUWLFRLG 5HFHSWRU $YDLODELOLW\ DQG ,PPXQRUHDFWLYLW\ LQ &RUWLVRO )HHGEDFN 6LWHV 1HXURHQGRFULQRORJ\ Y S 5RVHQWKDO+( : 5 6ODXQZKLWH $ $ 6DQGEHUJ 7UDQVFRUWLQ $ FRUWLFRVWHURLGSELQGLQJ SURWHLQ RI SODVPD ; &RUWLVRO DGQ SURJHVWHURQH LQWHUSOD\ DQG XQERXQG OHYHOV RI WKHVH VWHURLGV LQ SUHJQDQF\ -RXUQDO RI &OLQLFDO (QGRFULQRORJ\ Y S 5XSSHUW6 0 %RVKDUW ) ; %RVFK : 6FKPLG 5 ( )RXUQLHU 6FKW] 7ZR JHQHWLFDOO\ GHILQHG WUDQVDFWLQJ ORFL FRRUGLQDWHO\ UHJXODWH RYHUODSSLQJ VHWV RI OLYHU VSHFLILF JHQHV &HOO Y S 5XSSUHFKW5 / $UUL]D 6SHQJOHU 0 5HXO 5 0 (YDQV ) +ROVERHU 'DPP D 7UDQVDFWLYDWLRQ DQG V\QHUJLVWLF SURSHUWLHV RI WKH PLQHUDORFRUWLFRLG UHFHSWRU UHODWLRQVKLS WR WKH JOXFRFRUWLFRLG UHFHSWRU 0ROHFXODU (QGRFULQRORJ\ Y S 5XSSUHFKW5 0 5HXO % YDQ 6WHHQVHO 6SHQJOHU 0 6RGHU % %HPLQJ ) +ROVERHU 'DPP E 3KDUPDFRORJLFDO DQG IXQFWLRQDO FKDUDFWHUL]DWLRQ RI KXPDQ PLQHUDORFRUWLFRLG DQG JOXFRFRUWLFRLG UHFHSWRU OLJDQGV (XU 3KDUPDFRO Y S 6DRXG&& ( :RRG 'HYHORSPHQWDO FKDQJHV DQG PROHFXODU ZHLJKW RI LPPXQRUHDFWLYH JOXFRFRUWLFRLG UHFHSWRU SURWHLQ LQ WKH RYLQH IHWDO K\SRWKDODPXV DQG SLWXLWDU\ %LRFKHP%LRSK\V5HV&RPPXQ Y S 6DSROVN\50 :K\ VWUHVV LV EDG IRU \RXU EUDLQ 6FLHQFH Y S 6DSROVN\50 / & .UH\ % 6 0F(ZHQ *OXFRFRUWLFRLGVHQVLWLYH KLSSRFDPSDO QHXURQV DUH LQYROYHG LQ WHUPLQDWLQJ WKH DGUHQRFRUWLFDO VWUHVV UHVSRQVH 3URF1DWO$FDG6FL86$ Y S

PAGE 109

6FKPLGW7$ 6 0H\HU $XWRUHJXODWLRQ RI FRUWLFRVWHURLG UHFHSWRUV +RZ ZKHQ ZKHUH DQG ZK\" 5HFHSWRU Y S 6FKXOH5 3 5DQJDUDMDQ 6 .OLHZHU / 5DQVRQH %RODGR 1
PAGE 110

7DNDKDVKL+ 7DNHGD + $VKL]DZD $ ,QRXH 6
PAGE 111

9HUPHV, + 0XOGHU 3 6PHOLN $ VXSHUIXVLRQ V\VWHP WHFKQLTXH IRU WKH VWXG\ RI WKH VLWHV RI DFWLRQ RI JOXFRFRUWLFRLGV LQ WKH UDW K\SRWKDODPXVSLWXLWDU\DGUHQDO V\VWHP LQ YLWUR ,, +\SRWKDODPXVSLWXLWDU\ FHOODGUHQDO FHOO VXSHUIXVLRQ (QGRFULQRORJ\ Y S 9LDX9 0 0HDQH\ 9DULDWLRQV LQ WKH K\SRWKDODPLFSLWXLWDU\DGUHQDO UHVSRQVH WR VWUHVV GXULQJ WKH HVWURXV F\FOH LQ WKH UDW (QGRFULQRORJ\ Y S :DOODFH$' $ &LGORZVNL 3URWHDVRPHPHGLDWHG JOXFRFRUWLFRLG UHFHSWRU GHJUDGDWLRQ UHVWULFWV WUDQVFULSWLRQDO VLJQDOLQJ E\ JOXFRFRUWLFRLGV -%LRO&KHP Y S :DPEDFK* 5 +LJJLQV $QWLK\SHUWHQVLYH HIIHFW RI SURJHVWHURQH LQ UDWV ZLWK PLQHUDORFRUWLFRLG LQGXFHG K\SHUWHQVLRQ $P-3K\VLRO Y S (( :HEVWHU-& & 0 -HZHOO ( %RGZHOO $ 0XQFN 0 6DU $ &LGORZVNL 0RXVH JOXFRFRUWLFRLG UHFHSWRU SKRVSKRU\ODWLRQ VWDWXV LQIOXHQFHV PXOWLSOH IXQFWLRQV RI WKH UHFHSWRU SURWHLQ -RXUQDO RI %LRORJLFDO &KHPLVWU\ Y S :HKOLQJ0 6SHFLILF QRQJHQRPLF DFWLRQV RI VWHURLG KRUPRQHV $QQX5HY3K\VLRO Y S :HLJHO1/ 6WHURLG KRUPRQH UHFHSWRUV DQG WKHLU UHJXODWLRQ E\ SKRVSKRU\ODWLRQ %LRFKHPY 3W f S :HOOHU./ $ 6PLWK $IIHUHQW FRQQHFWLRQV WR WKH EHG QXFOHXV RI WKH VWULD WHUPLQDOLV %UDLQ 5HV Y S :HVVHO\ ( 0 'HLQHU + %HXJ 0 YRQ /LQGHP 7KH JOXFRFRUWLFRLG UHFHSWRU LV D NH\ UHJXODWRU RI WKH GHFLVLRQ EHWZHHQ VHOIUHQHZDO DQG GLIIHUHQWLDWLRQ LQ HU\WKURLG SURJHQLWRUV (0%2 Y S :LFNHUW/ 6HOELJ 0 :DW]ND % 6WRIIHO:DJQHU 6FKUDPP ) %LGOLQJPDLHU 0 /XGZLJ 'LIIHUHQWLDO P51$ H[SUHVVLRQ RI WKH WZR PLQHUDORFRUWLFRLG UHFHSWRU VSOLFH YDULDQWV ZLWKLQ WKH KXPDQ EUDLQ VWUXFWXUH DQDO\VLV RI WKHLU GLIIHUHQW '1$ ELQGLQJ GRPDLQV -1HXURHQGRFULQRO Y S :LVVLQN6 2 0HLMHU 3HDUFH % % YDQ 'HU 3 7 'HU 6DDJ 5HJXODWLRQ RI WKH UDW VHURWRQLQ$ UHFHSWRU JHQH E\ FRUWLFRVWHURLGV -RXUQDO RI %LRORJLFDO &KHPLVWU\ Y S

PAGE 112

:RRG&( 7 $ &XGG & .DQH (QJHONH )HWDO $&7+ DQG EORRG SUHVVXUH UHVSRQVHV WR WKURPER[DQH PLPHWLF 8 $PHULFDQ -RXUQDO RI 3K\VLRORJ\ Y S 55 :RROOH\&6 ( *RXOG 5 5 6DNDL 5 / 6SHQFHU % 6 0F(ZHQ (IIHFWV RI DOGRVWHURQH RU 58 WUHDWPHQW RQ DGUHQDOHFWRP\LQGXFHG FHOO GHDWK LQ WKH GHQWDWH J\UXV RI WKH DGXOW UDW %UDLQ 5HV Y S
PAGE 113

%,2*5$3+,&$/ 6.(7&+
PAGE 114

, FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ Q &KDUOHV ( :RRG &KDLU 3URIHVVRU RI 3K\VLRORJ\ DQG )XQFWLRQDO *HQRPLFV FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ \I I-t$ n"U]UF7 0DXUHHQ .HOOHU:RRG &RFKDLU 3URIHVVRU RI 3KDUPDFRG\QDPLFV FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ &ROLQ 6XPQHUV 3URIHVVRU RI 3K\VLRORJ\ DQG )XQFWLRQDO *HQRPLFV FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ 3DXO 2K $VVLVWDQW 3URIHVVRU RI 3K\VLRORJ\ DQG )XQFWLRQDO *HQRPLFV FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ 5RVDOLD 6LPPHQ 3URIHVVRU RI $QLPDO 6FLHQFHV

PAGE 115

7KLV GLVVHUWDWLRQ ZDV VXEPLWWHG WR WKH *UDGXDWH )DFXOW\ RI WKH &ROOHJH RI 0HGLFLQH DQG WR WKH *UDGXDWH 6FKRRO DQG ZDV DFFHSWHG DV SDUWLDO IXOILOOPHQW RI WKH UHTXLUHPHQWV IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ 'HFHPEHU OXQD NOKDP/A 'HDQ &ROOHJH RI 0HGLFLQH


55
4.2.3.3 RT-PCR cycles
Reverse transcription was carried out at 48C for 30 min. Thermal cyclying for PCR
was initiated with incubation at 95C for 10 min for activation of AmpliTaq Gold DNA
polymerase. After this initial step, 40 cycles of PCR were performed. Each cycle
consisted of heating at 95C for 15s for melting and 60C for lmin for annealing and
extension.
4.2.4 Expression of Data
Each sample was analyzed in triplicate for MR GR and rRNA. The data was
analyzed by calculating the threshold number of cycles (Ct), and determining ACt
between the mean Ct for each gene and the mean Ct for rRNA from the same sample;
differences among groups were analyzed by ANOVA using the ACt data. The fold
change in mRNA relative to control can then be calculated as 2'AACt, where AACt=ACt in
each animal in the experimental group mean ACt in the control group( nonpregnant
adrenal intact ewes).
4.3 Corticosteroid Receptor Regulation in Sheep after Acute Adrenalectomy
4.3.1 Introduction
In these experiments, we measured the levels of mRNA for the MR and GR in
hippocampus and kidney to test whether receptor gene expression is increased under
conditions of acute withdrawal of adrenal steroids in adult female ewes. The reasons for
studying the effects of adrenalectomy in the sheep are as follows. First, we wanted to
examine the receptor regulation in the acute and complete absence of steroid in sheep.
There are similar studies in this area but no study has been done in species of sheep.
Second, it is part of the study of characterization of ovine corticosteroid receptors. In this


CHAPTER 2
LITERATURE REVIEW
Corticosteroids are hormones secreted from cortex of adrenal gland. They have
tremendous effects on different systems. Corticosteroid hormone action involves binding
to two intracellular receptors. Both of these two receptors can bind with corticosteroids.
However, they show a lot of differences in their pharmacological and physiological
characteristics. This dissertation is based on the hypothesis that elevated ovarian steroids,
especially the progesterone, contribute to the adaptation of pregnancy by decreasing
feedback effects at the basal level of cortisol without interfering with the feedback effects
when the level of cortisol are increased after stress or stimulation. This chapter reviews
the current knowledge about corticosteroids, their receptors and their regulation,
physiological adaptation during pregnancy, ovarian steroids effects on corticosteroid
receptor and potential mechanisms for set point adaptation by progesterone.
2.1 Corticosteroid and Corticosteroid Receptor
2.1.1 General Introduction
Corticosteroids are synthesized in the adrenal gland and participate in the regulation of
physiological processes in a variety of organ systems (Miller, 1995). They exert a wide
range of functions throughout the body to keep the homeostasis of the body and respond
to stress or stimulus from internal or external environment. There are two types of
corticosteroid receptors, through which corticosteroids modulate their target tissues. The
two receptors co-localize in many tissues (McEwen et al., 1986). These receptors not
only mediate the physiological effects of corticosteroids, but also participate in the
3


98
Otto,C, H M Reichardt, G Schtz, 1997, Absence of glucocorticoid receptor-beta in mice:
Journal of Biological Chemistry, v. 272, p. 26665-26668.
Parks,CL, P S Robinson, E Sibille, T Shenk, M Toth, 1998, Increased anxiety of mice
lacking the serotoninlA receptor: Proc.Natl.Acad.Sci.U.S.A, v. 95, p. 10734-10739.
Patchev,VK, O F Almeida, 1996, Gonadal steroids exert facilitating and "buffering"
effects on glucocorticoid-mediated transcriptional regulation of corticotropin- releasing
hormone and corticosteroid receptor genes in rat brain: J.Neurosci., v. 16, p. 7077-7084.
Patel,PD, S P Kwak, J P Herman, E A Young, H Akil, S J Watson, 1992, Functional
heterogeneity of type I and type II corticosteroid receptor expression in rat hippocampus.,
in KE Sheppard, JH Boublik, and JW Funder (eds), Stress and Reproduction: New York,
Raven Press, p. 1-17.
Pearce,D, K R Yamamoto, 1993, Mineralocorticoid and glucocorticoid receptor activities
distinguished by nonreceptor factors at a composite response element: Science, v. 259, p.
1161-1165.
Pecins-Thompson,M, M Keller-Wood, 1994, Prolonged absence of ovarian hormones in
the ewe reduces the adrenocorticotropin response to hypotension, but not to
hypoglycemia or corticotropin-releasing factors: Endocrinology, v. 134, p. 678-684.
Peiffer,A, B Lapointe, N Barden, 1991, Hormonal regulation of type II glucocorticoid
receptor messenger ribonucleic acid in rat brain: Endocrinology, v. 129, p. 2166-2174.
Pepe,GJ, E D Albrecht, 1984, Transuteroplacental metabolism of cortisol and cortisone
during mid and late gestation in the baboon.: Endocrinology, v. 115, p. 1946.
Peysner,K, C A Henry, R L Malvin, 1990, Central infusion of aldosterone increases
blood pressure by mechanisms independent of Na retention: Clin Exp.Hypertens.A, v. 12,
p. 399-414.
Picard,D, 1998, Molecular endocrinology. Steroids tickle cells inside and out: Nature, v.
392, p. 437-438.
Pickard,J, A L Jochen, C N Sadur, F D Hofeldt, 1990, Cushing's syndrome in pregnancy:
Obstet Gynecol Surv, v. 45, p. 87-93.
Plotsky,PM, A Kjaer, S W Sutton, P E Sawchenko, W Vale, 1991, Central activin
administration modulates corticotropin-releasing hormone and adrenocorticotropin
secretion.: Endocrinology, v. 128, p. 2520-2525.


53
4.2.2 Primer and Probe Design
PCR primers and Taqman probe specific for the ovine mineralocorticoid receptor was
designed using Primer Express software (Applied Biosystems) according to the sequence
which was obtained from regular RT-PCR in our lab.
Forward primer: ATTT C ACT G AGT ACCTGTT GATT AT CAT C
Reverse Primer: GGGAAACTTAATATGATTGCACTAAATAAA
TaqMan Probe: CTTTTCC A AG ATT A ATTTGGCCTCT ATTC AAAGC A
The probes and primers used to detect MR mRNA will recognize all 3 subtypes of MR
found in rat hippocampus (Kwak et al., 1993), which vary in the 5 untranslated region,
and will also recognize the MR+4 mRNA splice variant found in human brain which has
12 additional base pairs between exons 3 and 4 in the DNA binding domain (Wickert et
al., 2000).
PCR primers and Taqman probe specific for the ovine glucocorticoid receptor was
designed using the same software according to the sequence which has been cloned and
published at Genebank(Yang et al., 1992).
Forward primer: ACTGCCCCAAGTGAAAACAGA
Reverse Primer: GCCCAGTTTCTCCTGCTTAATTAC
TaqMan Probe: AAAGAAGATTTTATCGAACTCTGCACCCCTGG
The GR primer and probe will recognize both splice variants of human GR, which
occur in sequences encoding for the carboxy terminus of the peptide (Oakley et al., 1996)
The 18s rRNA primer and probe were from TaqMan ribosomal RNA control reagents
(Applied Biosystems).


14
(Chapman et al., 1996), and in the erythroid compartment they are involved in long-term
proliferation of erythroblasts (Wessely et al., 1997).
In the central nervous system, glucocorticoids are involved in the negative feedback
regulation of the HPA-axis, but they also have tremendous effects on behavior, learning,
and memory (McEwen and Sapolsky, 1995;McGaugh et al., 1996;Sapolsky, 1996). Both
receptor species are present during development, implying ability for these transcription
factors to interact with neuronal differentiation, growth, and viability. Cognitive process,
electrophysiological properties of hippocampal neurons, and anxiety clearly involve
glucocorticoid action, and both the GR and the MR may contribute to these effects.
Hipppocampus is a key site for these functions. Brain MR and GR also appear to regulate
neural control of blood pressure (Gomez-Sanchez and Gomez-Sanchez, 1992;Kageyama
and Bravo, 1988;Peysner et al., 1990). Some evidence suggests that brain MR modulate
sympathetic outflow and it is possibly mediated by the brain renin-angiotensin system
(Takahashi et al., 1983;Van den Berg et al., 1994b;Van den Berg et al., 1994a). Currently
available data suggest activation of central MR increases sympathetic outflow and central
GR decreases or does not control sympathetic outflow to the vascular system (Gomez-
Sanchez et al., 1990;van den Berg et al., 1990). For the effects on HPA-axis, it was
proposed that MR mediates the tonic inhibitory control of the hippocampus in HPA
activity, whereas GR mediates the negative feedback of elevated glucocorticoid levels to
restrain HPA drive (de Kloet and Reul, 1987)(see detail in section 2.3 hippocampus and
its connection).
2.1.9 Regulation of Receptors
Corticosteroid receptors levels are regulated at multiple levels including mRNA and
protein (Oakley and Cidlowski, 1993; Schmidt and Meyer, 1994) At the protein level,


31
replacement, and a decreased cardiac output caused by decreased blood volume.
Understanding the action of progesterone and cortisol is critical for understanding many
common symptoms during pregnancy, such as edema (fluid retention) and reduced
glucose tolerance which are the signs of hypercorticism with glucocorticoid action, but
absent signs with mineralocorticoid action. While another interesting but not very
common pathophysiological symptom during pregnancy in some women is increased
blood pressure. Severe increases in blood pressure may lead to eclampsia which may be
very dangerous for maternal and fetal life. In some severe situations, pregnancy will have
to be stopped. After delivery, the increased blood pressure may decrease to normal level
spontaneously. The mechanism of eclampsia remains unknown until now, but changes in
HPA axis with interaction of placental steroid may play a role on it. It is important that
we understand the interaction between progesterone and cortisol during pregnancy in
order to understand the change in regulation of ACTH and the role of elevated
corticosteroids in the creation of a new homeostasis during pregnancy.
2.8 Objectives
In summary of this literature review, concentrations of cortisol, aldosterone, and
ACTH increase during pregnancy. Specifically, the increases in cortisol and aldosterone
secretion during pregnancy are important for the normal pregnancy adaptation.
Importantly, cortisol expands the blood volume during pregnancy because of both
glucocorticoid and mineralocorticoid effects at the kidney and in the vasculature. Both
cortisol and aldosterone also act in specific hypothalamic and brainstem nuclei to affect
both cardiovascular and endocrine function. The physiological changes in cardiovascular
function are critical for providing the maternal environment necessary for proper fetal
development. Cortisol is normally under negative feedback control. This negative


40
shown to stabilze corticosteroid receptor (Hubbard and Kalimi, 1982). The homogenate
was centrifuged at 35,000x g for 75 minutes at 4C to obtain a cytosolic fraction
(supernatant). Aliquots of cytosol were stored at -80C until assayed. Protein content of
the cytosol was measured with a Bradford assay kit (Biorad, Hercules, CA) using bovine
serum albumin as the standard. The binding experiments were carried out essentially as
previously described (Reul et al., 1990), as modified in our laboratory (Roesch and
Keller-Wood, 1999)
3.6.1.2 Incubation
Cortisol is the major adrenal steroid of sheep (and humans) and binds to MR, GR and
CBG. GR receptor binding was measured as the difference between binding in the
absence and presence of 1.25 pM RU 28362, a specific GR agonist (Roussel-Uclaf,
Romainville, France). MR was measured as the difference between binding in the
presence of 1.25 pM RU 28362 and 12.5 pM dexamethasone, which binds to both MR
and GR, but not CBG. The MR and GR are calculated in this indirect way because of
the lack of a high affinity, MR-specific ligands. CBG binding was defined as the
difference between binding in the presence of 12.5 pM dexamethasone and 12.5 pM
cortisol. In this case the cortisol is in excess so the only remaining binding should be
nonspecific. The table below showed the detailed binding status in each tube and how to
calculate the binding data for MR, GR and CBG. This calculation method was originally
generated by Reul and De Kloet (Reul and DeKloet, 1985).


CHAPTER 4
RT-PCR
RT-PCR is an important tool for detecting or quantitating the mRNA in tissues or
cells. It has been widely used in numerous areas. A number of widely used procedures
exist for detecting and determining the abundance of a particular mRNA in a total or poly
(A) RNA sample. Four methods are most frequently used, they are nuclease protection
assay, northern blot, in situ hybridization and RT-PCR. Each of them has inherent
advantages and limitations. In general, Northern analysis is the only method that provides
information about transcript size, whereas nuclease protection assays are the easiest way
to simultaneously examine multiple messages. In situ hybridization is used to localize
expression of a particular gene within a tissue or cell type, and RT-PCR is the most
sensitive method for detecting and quantitating gene expression. In my project, I chose
RT-PCR because of following two reasons. First, as described above, RT-PCR is the
most sensitive method for detecting and quantitating gene expression. My goal in this
research project is quantitating MR and GR mRNA in certain brain area. Second, it is a
well-developed technique in Dr. Keller-Woods lab. Both semi-quantitative RT-PCR and
real-time PCR are used in this project. By semi-quantitative PCR, we also got the part of
the sequence for ovine MR, which is necessary in primer and probe design for real-time
PCR. This chapter described the methodology in detail for both semi-quantitative RT-
PCR and real-time RT-PCR and some data obtained in the process of developing the
method.
48


73
plasma concentration of progesterone and both the apparent Kd of cortisol at MR and MR
availability. The analysis of the apparent Kd at MR showed a similar pattern as MR
availability, i.e. there was a greater concentration of cortisol required to achieve 50%
binding in pregnant intact ewes compared to nonpregnant intact ewes, and in pregnant
adrenalectomized ewes as compared to nonpregnant adrenalectomized and
ovariectomized ewes. The apparent Kd for MR and MR availability in nonpregnant
adrenalectomized ewes treated with progesterone was intermediate, however the
progesterone concentration was also intermediate.
An effect of progesterone has also been shown in rats after acute progesterone
treatment (Carey et al., 1995). The apparent Kd of corticosterone for MR was increased
in hippocampal cytosol obtained from rats 4h after injection with progesterone (Castren
et al., 1995). Studies in cells transfected with MR or GR and treated with various
steroids showed that progesterone is a potent antagonist at the human MR (Rupprecht et
al., 1993b), binding with high affinity, but resulting in little transcriptional activity.
Modeling of the human MR has also suggested that progesterone normally can bind in
the ligand binding pocket of the human MR, but will not allow the conformational
change necessary for transactivation (Geller et al., 2000); a mutation in one residue
within the binding pocket can result in constitutive transcriptional activity, and enhanced
transcriptional activity after progesterone binding. Women with this mutation are
hypertensive during pregnancy (Geller et al., 2000). These studies have suggested that
progesterone inhibition of MR-mediated actions can occur via antagonism of the
receptor. However, it is possible that progesterone also inhibits MR activity through
another mechanism. In other studies in cultured cells, progesterone inhibited the


capacity. I hypothesize that during pregnancy, with high level of progesterone, MR
function decreases and GR function keeps normal. I hypothesize progesterone acts as an
antagonist of cortisol at MR and/or reduces MR number in the pregnant state and it acts
with cortisol at GR as a partial agonist which results in the combined effects of
progesterone and cortisol. To test these hypotheses, we studied pregnant or progesterone-
treated nonpregnant ewes with sham adrenalectomy or adrenalectomy. Receptor binding
studies showed that there was a significant relationship between the plasma progesterone
concentration and the availability of MR, and between the plasma progesterone
concentration and the apparent Kd of MR for cortisol. There was a significant increase in
MR availability and Kd for cortisol in hippocampal cytosol in pregnant ewes as
compared to nonpregnant ewes whether they were sham- adrenalectomized or
adrenalectomized. The apparent Kd was also increased in the progesterone-treated,
nonpregnant adrenalectomized ewes relative to the nonpregnant adrenalectomized ewes
without progesterone treatment. There were no differences in hippocampal GR binding.
In addition, using Western blot and real-time RT-PCR, we measured the protein and
mRNA expression in hippocampus for MR as well as GR. No significant difference had
been detected.
These studies support the hypothesis that increased progesterone during pregnancy
reduces MR-mediated effects of cortisol, resulting in decreased feedback effects in the
hippocampus at the basal level of cortisol. In addition, GR-mediated effects of cortisol
havent been changed by progesterone so that a feedback effects at the stimulated level of
cortisol during pregnancy are the same as in nonpregnant state.
viii


97
Neumaier,JF, T J Sexton, M W Hamblin, S G Beck, 2000, Corticosteroids regulate 5-
HT(1A) but not 5-HT(lB) receptor mRNA in rat hippocampus: Brain Res.Mol.Brain
Res., v. 82, p. 65-73.
Nishi,M, E C Azmitia, 1996, 5-HT1A receptor expression is modulated by corticosteroid
receptor agonists in primary rat hippocampal culture: Brain Res., v. 722, p. 190-194.
Nolten,WE, P A Rueckert, 1981, Elevated free cortisol index in pregnancy: possible
regulatory mechanisms: Am J Obstet Gynecol, v. 139, p. 492-498.
0'Shaughnessy,RW, K J Hackett, 1984, Maternal Addison's disease and fetal growth
retardation. A case report: J Reprod Med, v. 29, p. 752-756.
Oakley,RH, J A Cidlowski, 1993, Homologous down regulation of the glucocorticoid
receptor: the molecular machinery: Crit Rev.Eukaryot.Gene Expr., v. 3, p. 63-88.
Oakley,RH, M Sar, J A Cidlowski, 1996, The human glucocorticoid receptor beta
isoform. Expression, biochemical properties, and putative function: Journal of Biological
Chemistry, v. 271, p. 9550-9559.
Odagiri,E, N Ishiwatari, Y Abe, K Jibiki, T Adachi, R Demura, H Demura, K Shizume,
1988, Hypercortisolism and the resistance to dexamethasone suppression during
gestation: Endocrinol.Jpn., v. 35, p. 685-690.
Okret,S, L Poellinger, Y Dong, J A Gustafsson, 1986, Down-regulation of glucocorticoid
receptor mRNA by glucocorticoid hormones and recognition by the receptor of a specific
binding sequence within a receptor cDNA clone: Proc.Natl.Acad.Sci.U.S.A, v. 83, p.
5899-5903.
Orbach,P, C E Wood, M Keller-Wood. Nitric oxide reduces pressor responsiveness
during ovine hypoadrenocorticism. Clinical and Experimental Pharmacology and
Physiology. 2001.
Ref Type: In Press
Orth,DN, C D Mount, 1987, Specific high-affinity binding protein for human
corticotropin-releasing hormone in normal human plasma: Biochemical and Biophysical
Research Communications, v. 143, p. 411-417.
Orti,E, J E Bodwell, A Munck, 1992, Phosphorylation of steroid hormone receptors:
Endocr.Rev., v. 13, p. 105-128.
Osier,M, 1962, Addison's disease and pregnancy: Acta Endocrinol, v. 41, p. 67-78.


CHAPTER 3
GENERAL MATERIALS AND METHODS
3.1 Animal Care
The ewes were housed and studied in the Health Science Center Animal Resources
Department. They were maintained in a controlled environment (12-hour light/dark cycle
and a constant 19C-21C temperature).
3.2 General Surgical Procedure
The ewes used in the experiments were surgically prepared according to the following
protocols. Before surgery, food was withheld from the ewe for 24 hours. Before and
during surgery, the ewe is anesthetized with halothane (0.5 2.0%) in oxygen. All
surgery were performed in the surgery suite of the Health Center Animal Resources
Department. All ewes were treated with ampicillin (750 mg im) for 5 days post-
operatively and on each experimental day. All animals were allowed at least 5 days to
recover from surgery before study.
3.2.1 Adrenalectomy and Ovariectomy
Adrenalectomy, ovariectomy or sham adrenalectomy were performed according to
previously published protocols (Bell et al., 1991;Keller-Wood et al., 1998;Pecins-
Thompson and Keller-Wood, 1994). Briefly, adrenal glands or ovaries were isolated
through a midline abdominal incision, the vascular supply was ligated, and adrenal glands
or ovaries were removed.
36


92
Hoeck,W, S Rusconi, B Groner, 1989, Down-regulation and phosphorylation of
glucocorticoid receptors in cultured cells. Investigations with a monospecific antiserum
against a bacterially expressed receptor fragment: J.Biol.Chem., v. 264, p. 14396-14402.
Hollenberg,SM, R M Evans, 1988, Multiple and cooperative trans-activation domains of
the human glucocorticoid receptor: Cell, v. 55, p. 899-906.
Hollenberg,SM, C Weinberger, E S Ong, G Cerelli, A Oro, R Lebo, E B Tompson, M G
Rosenfeld, R M Evans, 1985, Primary structure and expression of a functional human
glucocorticoid receptor cDNA.: Nature, v. 318, p. 635-641.
Hubbard, J, M Kalimi, 1982, Synergistic effect of molybdate plus dithiothreitol on
stabilization, reactivation, and partial purification of the kidney glucocorticoid receptor: J
Biol.Chem., v. 257, p. 14263-14270.
Humphreys,PW, N Joels, 1977, Changes in cardiac output and total peripheral resistance
during the carotid sinus baroreceptor reflex in the pregnant rabbit: J.Physiol, v. 272, p.
45-55.
Hutchison,KA, K D Dittmar, W B Pratt, 1994, All of the factors required for assembly of
the glucocorticoid receptor into a functional heterocomplex with heat shock protein 90
are preassociated in a self-sufficient protein folding structure, a "foldosome":
J.Biol.Chem., v. 269, p. 27894-27899.
Imai,E, J N Miner, J A Mitchell, K R Yamamoto, D K Granner, 1993, Glucocorticoid
receptor-cAMP response element-binding protein interaction and the response of the
phosphoenolpyruvate carboxykinase gene to glucocorticoids: J.Biol.Chem., v. 268, p.
5353-5356.
Ismay,MJA, E R Lumbers, A D Stevens, 1979, The action of angiotensin II on the
baroreflex response of the conscious ewe and the conscious fetus: Journal of Physiology,
v. 288, p. 467-479.
Jacobson,L, R Sapolsky, 1991, The role of the hippocampus in feedback regulation of the
hypothalamic-pituitary-adrenocortical axis: Endocr.Rev., v. 12, p. 118-134.
Joels,M, E R de Kloet, 1994, Mineralocorticoid and glucocorticoid receptors in the brain.
Implications for ion permeability and transmitter systems: Prog.Neurobiol., v. 43, p. 1-36.
Jonat,C, H J Rahmsdorf, K K Park, A C Cato, S Gebel, H Ponta, P Herrlich, 1990,
Antitumor promotion and antiinflammation: down-modulation of AP-1 (Fos/Jun) activity
by glucocorticoid hormone: Cell, v. 62, p. 1189-1204.


61
undetectable in maternal lung is not a problem caused by tissue specific detection from
primer or probe.


25
2.4.3 Role of Ovarian/Placental Steroid
2.4.3.1 Estrogen
Estrogens appear to cause generalized increases in basal ACTH and ACTH responses
to stimuli. For examples, female rats tend to have higher circulating levels of both ACTH
and corticosterone than male rats and in cycling female rats, the HPA axis is significantly
more responsive during proestrus (when estradiol levels are highest) than during estrous
or diestrous (Viau and Meaney, 1991). Estrogens increase activity of the axis by
increasing hypothalamic CRF expression (Hiroshige and Wada-Okada, 1973), adrenal
responsiveness to ACTH (Kitay, 1975), and attenuating the glucocorticoid feedback
signal (Burgess and Handa, 1992;Redei et al., 1994). Although estrogens have been
shown to decrease corticosterone binding capacity at MR in the hippocampus and
estrogen treatment can cause a decrease in the mRNA for MR in the CA2 region of the
hippocampus (Carey et al., 1995), the progesterone appeared to attenuate the effects of
estrogen on both MR binding capacity and mRNA (Carey et al., 1995), suggesting that in
the pregnant state these effects of estrogen may not be expressed. In summary, the
activating effects of estrogens may play a role in the adaptation of the axis to pregnancy,
but since absolute feedback sensitivity is not reduced during ovine pregnancy, the effects
of estrogens on feedback do not appear to be physiologically relevant to pregnancy.
Further, ACTH and cortisol levels in pregnancy also do not appear to temporally follow
the pattern of increase in estrogens, particularly in sheep in whom an increase in cortisol
occurs before 90 days, but the increase in estrogens (primarily estrone) is small within the
last 1 -2 weeks of pregnancy.


xml version 1.0 encoding UTF-8
REPORT xmlns http:www.fcla.edudlsmddaitss xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.fcla.edudlsmddaitssdaitssReport.xsd
INGEST IEID EAJ0N9NLE_3Z0OS6 INGEST_TIME 2014-11-05T22:47:09Z PACKAGE AA00024438_00001
AGREEMENT_INFO ACCOUNT UF PROJECT UFDC
FILES


68
group 5 were also treated with progesterone to increase its level to that of the normal
pregnant sheep (10ng/ml).
After collecting the hippocampal tissue, the plasma hormone levels were measured.
Receptor binding assay, Western blot and real-time RT-PCR were all done according to
the protocol described in Methods and RT-PCR chapters.
For this project, we did saturation binding assay followed by nonlinear regression
analysis for MR for three animals in each group. With increased concentration of 3H-
cortisol from 0.05 to 35 nM, the saturation binding curves were generated and the binding
affinity (Kd) of MR in the hippocampus and Bmax of MR were determined. For all
animals, we also measured total receptor availability for MR and GR using a single
saturating concentration of 3H-cortisol (25 nM) as previously described.
For real-time PCR for 5-HT1A receptor, the methodology was exactly the same as
measurement for MR and GR. A pair of primer was first designed according to human 5-
HT1A receptor sequence (448-624) in Genebank for regular RT-PCR.
Forward Primer: ACC CCA TCG ACT ACG TGA AC
Reverse Primer: CAG CGG GAT GTA GAA AGC TC
After sequencing the PCR product, we got a piece of 177bp sequence. The sequence was
compared with 5-HT1A receptor of human and other species by BLAST. It was 93%
homologous to the human 5-HT1A receptor. This confirmed the PCR product was from
5-HT1A receptor mRNA.
Then primer and probe for real-time PCR were designed according to this 177bp
sequence.
Forward primer: GCGCACCCCGGAAGA


85
HT1A receptor data didnt show an increase in mRNA expression in ewes with high
progesterone level. There are several possible explanations for this negative result as I
stated in Chapter 5.
These studies therefore support the hypothesis that increased progesterone during
pregnancy reduces the MR-mediated effects of cortisol and progesterone doesnt interfere
the GR-mediated effects of cortisol. This action of progesterone may result in decreased
cortisol feedback effects at the basal level in the hippocampus during pregnancy.


15
steroid receptors undergo hormone dependent hyperphosphorylation (Orti et al.,
1992;Weigel, 1996). Recent studies showed that phosphorylation status plays an
important role in receptors stability and turnover (Webster et ah, 1997). It is a major
signal in ubiquitination and proteosome mediated degradation and thus regulates the
number of receptors in cytosol and their ability to transactivate (Wallace and Cidlowski,
2001). Phosphorylation is thought to be the signal to allow substrate recognition by
enzymes in the ubiquitination pathway. Poly-ubiquitination of a protein is recognized by
the multi-subunit protein complex known as the proteasome, which degrades the protein
into small peptides and amino acids. This is at least part of the reasons for ligand
dependent down-regulation of the receptors. Studies examining the half-life of the GR
protein, separate from any ligand affects on RNA, have shown that ligand occupation of
the receptor significantly decreases GR protein half-life from eighteen hours to nine
hours (Dong et al., 1988;Hoeck et al., 1989). Phospho-deficient mutant of mouse GR
does not undergo ligand dependent down-regulation (Webster et al., 1997)
At mRNA level, many studies showed that glucocorticoid treatment significantly
decreased mRNA level of GR and MR in many different tissues (Bumstein et al.,
1994;Dong et al., 1988;Okret et al., 1986). Also, adrenalectomy-induced steroid depletion
elicits reliable increases in the GR mRNA from 40-100%, as measured in different labs
by a variety of methods, including Northern, RNAse protection, and in situ hybridization
analyses (Herman et al., 1989a;Herman, 1993;Kalinyak et al., 1987;Patel et al.,
1992;Peiffer et al., 1991;Reul et al., 1989;Sheppard et al., 1990). Adrenalectomy effects
on MR mRNA expression are smaller, falling in the 25-50% range (Herman et al.,
1989a;Herman, 1993;Patel et al., 1992;Reul et al., 1989)


42
addition of 200-250 p,g cytosol being the last step. Final volume was 200 ul in each tube.
Binding was allowed to proceed for overnight at 4C.
3.6.1.3 Separation of bound from free
Receptor-bound and free ligand were separated on LH-20 Sephadex columns at 4C as
previously described (Roesch and Keller-Wood, 1999). Chromatography columns were
prepared by plugging 5ml PYREX serological pipettes (Coming, Inc.) with 3 mm
diameter borosilicate beads (Kimble Glass Company). The columns were filled to a
height of 8 cm with Sephadex LH-20 (Pharmacia Biotech, Uppsala, Sweden)
reconstituted in RHB. For separation of bound from free, 200 ul of the incubate was
loaded to the top of the column bed, washed into the column bed with 100 ul buffer.
Receptor-bound radioactivity eluted in 1 ml of binding buffer was counted in a liquid
scintillation counter (Beckman LS 3801, Beckman Inc., Fullerton, CA) with 4.5 ml
o
scintillant (Scintisafe 30 Fisher). Counts were expressed as femtomoles of H-cortisol
specifically bound per milligram protein. After each use, the columns were washed with
15 volumes of methanol and 15 volumes of RHB. During the buffer RHB re-equilibration
portion of the wash, the bead bed was agitated and allowed to resettle. Columns were
maintained at 4C.
3.6.2 Saturation Binding Analysis
These experiments were performed to determine the binding affinity (Kd) of MR in
the hippocampus of sheep during pregnancy and with various levels of progesterone.
Bmax values were also determined to confirm the Bmax value, or total available binding,
determined using a single, saturation dose of cortisol (see below).


4
feedback loop that regulates plasma levels of cortisol (Bradbury et al., 1994;Reul and
DeKloet, 1985).
2.1.2 Pharmacological Characterization
Corticosteroid receptor type I, also called the mineralocorticoid receptor (MR), have
high affinity with corticosteroids and low capacity (de Kloet and Reul, 1987). In different
species, its affinity with these hormones shows variation. The affinitys rank order for the
major circulating corticosteroids (corticosterone, cortisol, and aldosterone ) is as follows.
In the rat and the mouse, which uses corticosterone as the principal corticosteroid, MR
displays a high affinity for aldosterone and corticosterone (~0.5 nM) and a lower affinity
for cortisol (Reul and DeKloet, 1985). In the dog, which like humans and sheep uses
cortisol as the principal corticosteroid, the MR also has a very high affinity for
corticosterone (~0.05nM) and a lower affinity (~0.2nM) for cortisol and aldosterone
(Reul et al., 1990). In human, MR binds those steroids with similar order: high affinity
for corticosterone (<0.01 nM), lower affinity for cortisol(0.13nM) and aldosterone
(0.09nM) (Rupprecht et al., 1993b). In Dr. Keller-Woods lab, we characterized the
binding affinity in sheep. Ovine MR has similar high affinity for aldosterone (0.17 nM)
and cortisol (0.19nM). Because of its high affinity with corticosteroids, MR is almost
fully occupied at the basal concentration of cortisol. It is thought to mediate tonic actions
of corticosteroid.
Corticosteroid receptor type II, also called the glucocorticoid receptor (GR), has lower
affinity with glucocorticoid compared with MR and higher capacity. The parallel
experiments showed that in the rat, the GR has a relatively high affinity (but lower than
the MR) for corticosterone (~5nM) and even lower affinity for cortisol and aldosterone
(~20nM) (Reul and DeKloet, 1985). In the dog, the GR has an equal but lower affinity


19
release and not hormone synthesis, and that protein synthesis is not involved. Some
studies suggest that fast feedback acts to stabilize the cell membrane and that fast
feedback involves Ca"11" fluxes.
2.2.3 Intermediate and Slow Feedback
Intermediate and slow feedback inhibition requires genomic events and protein
synthesis (Keller-Wood and Dallman, 1984). While intermediate feedback inhibits the
release of ACTH and the synthesis and release of CRF, slow feedback inhibits both the
synthesis and release of CRF and ACTH (Keller-Wood and Dallman, 1984).
Intermediate (and fast) feedback would be expected to occur under physiological
conditions when increases in plasma corticosteroids are produced in response to moderate
or punctuate stress. While slow feedback would only occur under pathological conditions
or under pharmacological treatment of corticosteroids when increased corticosteroid can
be kept for at least several days. Under normal conditions, therefore, decrease in POMC
mRNA synthesis or pituitary ACTH content would not be expected to occur following
moderate stress.(Keller-Wood and Dallman, 1984).
These three feedbacks have their specific roles in regulation of the HPA axis
respectively. Fast, rate sensitive feedback controls the rate and magnitude of ACTH in
response to a stress or stimulation. Delayed or intermediate feedback may limit the
response of the system to repeated stimulus within a relatively short period of time
(hours), while slow feedback limit the response to repeated stimulus during prolonged
period of time (days).(Keller-Wood and Dallman, 1984)


I certify that I have read this study and that in my opinion it conforms to
acceptable standards of scholarly presentation and is fully adequate, in scope and quality,
as a dissertation for the degree of Doctor of Philosophy. /J -n
Charles E. Wood, Chair
Professor of Physiology and Functional
Genomics
I certify that 1 have read this study and that in my opinion it conforms to
acceptable standards of scholarly presentation and is fully adequate, in scope and quality,
as a dissertation for the degree of Doctor of Philosophy.
yf fJ&A '/?rzrcT
Maureen Keller-Wood, Cochair
Professor of Pharmacodynamics
I certify that 1 have read this study and that in my opinion it conforms to
acceptable standards of scholarly presentation and is fully adequate, in scope and quality,
as a dissertation for the degree of Doctor of Philosophy.
Colin Sumners
Professor of Physiology and Functional
Genomics
I certify that I have read this study and that in my opinion it conforms to
acceptable standards of scholarly presentation and is fully adequate, in scope and quality,
as a dissertation for the degree of Doctor of Philosophy.
Paul Oh
Assistant Professor of Physiology and
Functional Genomics
1 certify that 1 have read this study and that in my opinion it conforms to
acceptable standards of scholarly presentation and is fully adequate, in scope and quality,
as a dissertation for the degree of Doctor of Philosophy.
Rosalia Simmen
Professor of Animal Sciences


89
Dallman,MF, S F Akana, C S Cascio, D N Darlington, L Jacobson, N Levin, 1987a,
Regulation of ACTH secretion: Variations on a theme of B.: Recent Progress in Hormone
Research, v. 43, p. 113-173.
Dallman,MF, S F Akana, L Jacobson, N Levin, C S Cascio, J Shinsako, 1987b,
Characterization of corticosterone feedback regulation of ACTH secretion.: Ann-N-Y-
Acad-Sci., v. 512, p. 402-414.
Dallman,MF, F E Yates, 1969, Dynamic asymmetries in the corticosteroid feedback path
and distribution-metabolism-binding elements of the adrenocortical system.PG:
Ann.N.Y.Acad.Sci., v. 156.
Danielsen,M, J P Northrop, J Jonklaas, G M Ringold, 1987, Domains of the
glucocorticoid receptor involved in specific and nonspecific deoxyribonucleic acid
binding, hormone activation, and transcriptional enhancement: Mol.Endocrinol, v. 1, p.
816-822.
de Kloet,ER, J M Reul, 1987, Feedback action and tonic influence of corticosteroids on
brain function: a concept arising from the heterogeneity of brain receptor systems:
Psychoneuroendocrinology, v. 12, p. 83-105.
De Kloet,ER, W Sutanto, N Rots, A van Haarst, B D van den, M Oitzl, A van Eekelen, D
Voorhuis, 1991, Plasticity and function of brain corticosteroid receptors during aging:
Acta Endocrinol.(Copenh), v. 125 Suppl 1, p. 65-72.
Dong,Y, L Poellinger, J A Gustafsson, S Okret, 1988, Regulation of glucocorticoid
receptor expression: evidence for transcriptional and posttranslational mechanisms:
Molecular Endocrinology, v. 2, p. 1256-1264.
Drouin,J, Y L Sun, M Chamberland, Y Gauthier, A De Lean, M Nemer, T J Schmidt,
1993, Novel glucocorticoid receptor complex with DNA element of the hormone-
repressed POMC gene: EMBO J, v. 12, p. 145-156.
Drouin,J, Y L Sun, M Nemer, 1989, Glucocorticoid repression of pro-opiomelanocortin
gene transcription: J.Steroid Biochem., v. 34, p. 63-69.
Drucker,D, S Shumak, A Angel, 1984, Schmidt's syndrome presenting with intrauterine
growth retardation and postpartum addisonian crisis: Am J Obstet Gynecol, v. 149, p.
229-230.
Duncan,MR, G R Duncan, 1979, An in vivo study of the action of antiglucocorticoids on
thymus weight ratio, antibody titre and the adrenal-pituitary-hypothalamus axis.PG -: J
Steroid Biochem., v. 10.


96
Meijer,OC, T J Cole, W Schmid, G Schtz, M Joels, E R de Kloet, 1997, Regulation of
hippocampal 5-HT1A receptor mRNA and binding in transgenic mice with a targeted
disruption of the glucocorticoid receptor: Brain Res.Mol.Brain Res., v. 46, p. 290-296.
Meijer,OC, E R de Kloet, 1994, Corticosterone suppresses the expression of 5-HT1A
receptor mRNA in rat dentate gyrus: Eur.J.Pharmacol., v. 266, p. 255-261.
Meijer,OC, E R de Kloet, 1995, A role for the mineralocorticoid receptor in a rapid and
transient suppression of hippocampal 5-HT1A receptor mRNA by corticosterone:
J.Neuroendocrinol., v. 7, p. 653-657.
Mercer,W, V Obeyesekere, R Smith, Z Krozowski, 1993, Characterization of 11 beta-
HSD1B gene expression and enzymatic activity: Mol.Cell Endocrinol., v. 92, p. 247-251.
Metcalfe,J, J T Parer, 1966, Cardiovascular changes during pregnancy in ewes:
Am.J.Physiol, v. 210, p. 821-825.
Michael,AE, M Evagelatou, D P Norgate, R J Clarke, J W Antoniw, B A Stedman, A
Brennan, R Welsby, I Bujalska, P M Stewart, B A Cooke, 1997, Isoforms of 1 lbeta-
hydroxysteroid dehydrogenase in human granulosa-lutein cells: Mol.Cell Endocrinol., v.
132, p.43-52.
Miller,WL, 1995, endocrinology and metabolism, McGraw-Hill,New York, p. 555-711.
Moga,MM, C B Saper, T S Gray, 1989, Bed nucleus of the stria terminalis:
cytoarchitecture, immunohistochemistry, and projection to the parabrachial nucleus in the
rat: J.Comp Neurol., v. 283, p. 315-332.
Monder,C, V Lakshmi, 1989, Evidence for kinetically distinct forms of corticosteroid 11
beta-dehydrogenase in rat liver microsomes: J.Steroid Biochem., v. 32, p. 77-83.
Monder,C, P C White, 1993, 11 [J-hydroxysteroid dehydrogenase.: Vitamins and
Hormones, v. 47, p. 187-271.
Murphy,EP, O M Conneely, 1997, Neuroendocrine regulation of the hypothalamic
pituitary adrenal axis by the nurrl/nur77 subfamily of nuclear receptors: Mol.Endocrinol,
v. 11, p. 39-47.
Nathan,DF, S Lindquist, 1995, Mutational analysis of Hsp90 function: interactions with a
steroid receptor and a protein kinase: Mol.Cell Biol., v. 15, p. 3917-3925.


Table 5-1 Plasma hormone levels in five groups
Total Plasma
Cortisol
(ng/ml)
Free Plasma
Cortisol
nM
Total Plasma
Progesterone
(ng/ml)
Free Plasma
Progesterone
(nM)
Aldosterone
(pg/ml)
Adrenal-Intact (sham)
Nonpregnant
ovariectomized
5.4 1.7
2.1 0.8
2.2 2.0
6.1 5.6
35 14
Pregnant
11.7 3.0*
3.4 0.9
14 2*
33 6*
26 5
Adrenalectomized
Nonpregnant
ovariectomized
4.2 0.7
1.4 0.3
0.14 0.04
0.3 0.1
21 4
Pregnant
4.3 0.8
1.2 0.2
32 8*
69 22*
48 12
Nonpregnant + progesterone
3.6 0.5
1.9 0.3
12 4*
28 9*
59 12
Data expressed as mean SEM
* indicates different than nonpregnant


34
Fig. 2-2: Control of glucocorticoid secretion by HPA axis. The figure has been
adapted from Reichardt et al., 2000.


102
Takahashi,H, K Takeda, H Ashizawa, A Inoue, S Yoneda, M Yoshimura, H Ijichi, 1983,
Centrally induced cardiovascular and sympathetic responses to hydrocortisone in rats:
Am.J Physiol, v. 245, p. H1013-H1018.
Tetsuka,M, F J Thomas, M J Thomas, R A Anderson, J I Mason, S G Hillier, 1997,
Differential expression of messenger ribonucleic acids encoding 1 lbeta-hydroxysteroid
dehydrogenase types 1 and 2 in human granulosa cells: J.Clin.Endocrinol.Metab, v. 82, p.
2006-2009.
Trapp,T, R Rupprecht, M Castren, J M Reul, F Holsboer, 1994, Heterodimerization
between mineralocorticoid and glucocorticoid receptor: a new principle of glucocorticoid
action in the CNS: Neuron, v. 13, p. 1457-1462.
Tsai,MJ, S Y Tsai, L Klein-Hitpass, M Bagchi, J F Elliston, J Carlstedt-Duke, J K
Gustafsson, B W O'Malley, 1988, Cooperative interactions of steroid hormone receptors
with their cognate response elements: Cold Spring Harb.Symp.Quant.Biol., v. 53 Pt 2, p.
829-833.
Vale,W, C River, 1977, Substances modulating the secretion of ACTH by cultured
anterior pituitary cells: Fed.Proc., v. 36, p. 2094-2099.
Vale,W, C Rivier, L Yang, S Minick, R Guillemin, 1978, Effects of purified
hypothalamic corticotropin-releasing factor and other substances on the secretion of
adrenocorticotropin and beta-endorphin-like immunoactivities in vitro: Endocrinology, v.
103, p. 1910-1915.
Van den Berg,DT, W de Jong, E R de Kloet, 1994a, Mineralocorticoid antagonist inhibits
stress-induced blood pressure response after repeated daily warming: Am.J Physiol, v.
267, p. E921-E926.
Van den Berg,DT, E R de Kloet, W de Jong, 1994b, Central effects of mineralocorticoid
antagonist RU-28318 on blood pressure of DOCA-salt hypertensive rats: Am.J Physiol,
v. 267, p. E927-E933.
van den Berg,DT, E R de Kloet, H H van Dijken, W de Jong, 1990, Differential central
effects of mineralocorticoid and glucocorticoid agonists and antagonists on blood
pressure: Endocrinology, v. 126, p. 118-124.
Van EekelenJA, W Jiang, E R de Kloet, M C Bohn, 1988, Distribution of the
mineralocorticoid and the glucocorticoid receptor mRNAs in the rat hippocampus:
J.Neurosci.Res., v. 21, p. 88-94.