Citation
Changes in extracellular matrix gene and protein expression in developing mouse submandibular glands

Material Information

Title:
Changes in extracellular matrix gene and protein expression in developing mouse submandibular glands
Creator:
Macauley, Shawn P., 1964-
Publication Date:
Language:
English
Physical Description:
x, 123 leaves : ill. ; 29 cm.

Subjects

Subjects / Keywords:
Basement membrane ( jstor )
Cells ( jstor )
Collagens ( jstor )
Extracellular matrix ( jstor )
Messenger RNA ( jstor )
Molecules ( jstor )
Morphogenesis ( jstor )
Rats ( jstor )
RNA ( jstor )
Salivary glands ( jstor )
Amino Acid Sequence ( mesh )
Base Sequence ( mesh )
Department of Oral Biology thesis Ph.D ( mesh )
Dissertations, Academic -- College of Dentistry -- Department of Oral Biology -- UF ( mesh )
Extracellular Matrix Proteins -- genetics ( mesh )
Extracellular Matrix Proteins -- physiology ( mesh )
Gene Expression ( mesh )
Gene Expression Regulation, Developmental ( mesh )
Mice, Inbred BALB C ( mesh )
Molecular Sequence Data ( mesh )
Research ( mesh )
Submandibular Gland -- chemistry ( mesh )
Submandibular Gland -- embryology ( mesh )
Genre:
bibliography ( marcgt )
non-fiction ( marcgt )

Notes

Thesis:
Thesis (Ph.D.)--University of Florida, 1996.
Bibliography:
Bibliography: leaves 104-120.
General Note:
Typescript.
General Note:
Vita.
Statement of Responsibility:
by Shawn Patrick Macauley.

Record Information

Source Institution:
University of Florida
Holding Location:
University of Florida
Rights Management:
Copyright [name of dissertation author]. Permission granted to the University of Florida to digitize, archive and distribute this item for non-profit research and educational purposes. Any reuse of this item in excess of fair use or other copyright exemptions requires permission of the copyright holder.
Resource Identifier:
028143974 ( ALEPH )
49817511 ( OCLC )

Downloads

This item has the following downloads:


Full Text












CHANGES IN EXTRACELLULAR MATRIX GENE
AND PROTEIN EXPRESSION IN
DEVELOPING MOUSE SUBMANDIBULAR GLANDS












BY

SHAWN P. MACAULEY












A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 1996



















to my wife Beth

for her limitless sacrifices and love















... the very order, changes, and
movements in the universe, the very
beauty of form in all that is visible,
proclaim, however silently, both that
the world was created and also that its Creator could be none other than God
whose greatness and beauty are both
ineffable and invisible.



St. Augustine, The City of God















ACKNOWLEDGMENTS



I offer my sincere gratitude to Drs. Michael Humphreys-Beher and Gregory Schultz, who have helped mold and shape my understanding of science through their complete support, patience, and guidance during these graduate studies. My sincere thanks are extended to Drs. Linda Brinkley, N. Ingvar Magnusson and William Buhi, members of my committee, for their helpful suggestions over the past two years. A very special thank you goes to Dr. Richard Boyce, Department of Biochemistry and Molecular Biology, who helped smooth the bumps along the way and helped keep everything in perspective. Also instrumental in my finishing this degree program is Dr. Arnold S. Bleiweis, Chairman of Oral Biology, who along with the department faculty, allowed me the opportunity to join the department.

I would also like to thank Dr. Gregg Oxford, Dr. Kamrnum Purushotham, Mr. Micah Kerr, Ms. Elizabeth Bowen, Mr. Chris Robinson, Mr. Jason Brayer, Ms. Kim-Hoa Nyugen, Ms. Randi Broverman, Dr. Hideo Yamamoto, Dr. Zeng Tao, Dr. Pao-Li Wang, Dr. Yanfei Hu, and Dr. Rongfa Bu, all past and present members of the laboratory, for making science equally fun and entertaining. Along with the lab personnel, special thanks go to fellow graduate students Ms. Heather Allison, Ms. Lori Wojciechowski, Dr. Adriana Da Silviera,




iii









Ms. Lina Bueno, and Mr. James Kohler who have helped make the graduate student experience very enjoyable.

Special thanks go to members of the Institute for Wound Research--Dr. Nasser Chegini, for assistance in immunohistochemistry and in situ hybridization, Dr. Roy Tamuzzer, for assistance in synthesizing pMATRIX, and especially to Mrs. Landis Young who has assisted me in unmeasurable ways. All of these contributions were invaluable to the project.

Finally, I wish to thank above all, my Lord and Savior Jesus Christ, my parents, Karen and Curtis Winters, my in-laws, Barbara and John Martin, my cherished wife Beth, and my daughters Erin and Emily, for their unconditional love and enduring strength.



























iv















TABLE OF CONTENTS





ACKNOW LEDGMENTS ...................................................................................... iii

LIST OF FIGURES .................................................................................................. vii

ABSTRACT .............................................................................................................. ix

CHAPTERS

INTRODUCTION ............................................................................ 1
The Extracellular M atrix ............................................................... 1
Salivary Gland Development ........................................................ 16
Salivary Gland M orphogenesis ..................................................... 18
Role of Epithelial-Mesenchymal Interactions in Salivary Gland M orphogenesis .......................................... 18
Contribution of the Extracellular Matrix to Salivary Gland M orphogenesis .......................................... 23
Contribution of Glycosaminoglycans to Salivary Gland M orphogenesis ........................................... 30
Salivary Gland Cytodifferentiation ............................................. 33
Role of Epithelial-Mesenchymal Interactions in Salivary Gland Cytodifferentiation ..................................... 34
Contribution of the Extracellular Matrix in Salivary Gland Cytodifferentiation ..................................... 35
Contribution of Glycosaminoglycans in Salivary Gland Cytodifferentiation .............................................. 36
Statement of the Problem ................................................................. 38
Gene Quantitation ............................................................................. 39
RT-PCR ............................................................................... 40
Competitive RT-PCR .......................................................... 43




V














2 MATERIALS AND METHODS ................................................. 46
Synthetic Supertemplate pMATRIX Construction ...................... 46
Selection of Oligonucleotide Sequences .......................... 46
Synthesis of Multiprimer Template ............................................. 49
Engineering and Insertion of a Poly(A) Tail ................................ 56
Isolation of Poly(A) RNA .......................................................... 58
Isolation of Total Cellular RNA ................................................... 59
Quantitative RT-PCR ................................................................ 60
Separation of products and photographing of gels ........... 63
Scanning image and final analysis ................................... 63
Statistical analysis ....................................................................... 63
Immunohistochemistry ................................................................. 64

3 R E SU LTS ....................................................................................... 67
Synthesis of pMATRIX .............................................................. 67
Quantitation of ECM Gene Expression Using pMATRIX ........... 70
ECM Protein Localization by Immunohistochemistry
in developing mouse submandibular glands .................... 76

4 DISCUSSION ................................................................................. 81

5 OTHER STUDIES ......................................................................... 95

APPENDICES
A: List of Oligonucleotides Synthesized for pMATRIX ............................ 101
B: Restriction Map of pMATRIX Multiprimer Insert ................................ 102

REFERENCES .......................................................................................................... 104

BIOGRAPHICAL SKETCH .................................................................................... 121









vi















LIST OF FIGURES

igurE

1-1 Structure of fibrillar collagens ..................................................... 3

1-2 Structure of collagen type IV ....................................................... 6

1-3 Structure of fibronectin ................................................................ 8

1-4 Structure of lam inin ..................................................................... 10

1-5 Structure of elastin ...................................................................... 12

1-6 Crosslinking reaction catalyzed by lysyl oxidase ....................... 13

1-7 Structure of glycosaminoglycans ............................................... 15

1-8 In vitro development of a fetal mouse submandibular gland ...... 20

1-9 Photograph of a freshly dissected day 13 fetal mouse
subm andibular gland ........................................................ 21

1-10 Effects of collagenase and collagenase inhibitors
on submandibular gland development ............................. 26

1-11 Schematic diagram of the RT-PCR method ................................. 42

2-1 Alignment of oligonucleotides to create multiprimer insert ........ 48

2-2 Scheme for the construction of pMATRIX ................................. 51

2-3 Nucleotide sequence of 501bp multiprimer insert ...................... 53






vii










2-4 Cloning of a poly(A) tail to the multiprimer insert ...................... 57

2-5 General scheme for quantitative RT-PCR experiments ............... 62

2-6 Immunohistochemistry protocol ................................................... 66

3-1 Representative composite data for Q-RT-PCR ............................ 69

3-2 Ethidium bromide stained agarose gels showing
Q-RT-PCR data for laminin B2 and
fibronectin at day 18 .......................................................... 71

3-3 Graphical analysis of data ............................................................ 72

3-4 Copies of mRNA per cell for each ECM gene
measured over the development of mouse
subm andibular glands ........................................................ 74

3-5 Protein localization for ECM molecules ...................................... 78

4-1 Schematic representation of the expression of ECM proteins
in developing mouse submandibular glands .................... 87

4-2 List of other potential supertemplates .......................................... 94




















viii















Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy CHANGES IN EXTRACELLULAR MATRIX GENE AND PROTEIN EXPRESSION IN DEVELOPING MOUSE SUBMANDIBULAR GLANDS By

Shawn P. Macauley

May 1996

Chair: Michael G. Humphreys-Beher, Ph.D. Major Department: Oral Biology

Submandibular gland fetal development involves the orchestrated expression of extracellular matrix molecules (ECM) which direct the morphogenesis, differentiation, and budding of the epithelium. Early morphogenesis of mouse submandibular glands begins on late day 11 of development when the epithelium begins to bud from the surrounding mandibular mesenchyme. Submandibular glands have two bursts of development, one in utero and a second postnatally occurring in the suckling/weanling transition. From the small amounts of total RNA collected from fetal BALB/c submandibular glands, gene expression was measured using quantitative competitive RT-PCR. To investigate the changes in ECM gene expression during fetal development, a multiprimer plasmid (pMATRIX) was constructed which contains the primer


ix









sequences for collagens a2(I), a I (III), a 1 (IV), fibronectin, laminins B 1 and B2, elastin, and lysyl oxidase. The primer sequences were identical for human, rat, and mouse. cRNA was synthesized from the supertemplate and added in varying known amounts to a series of reverse transcription reactions each containing 1.0 jig of total submandibular gland RNA. By comparing the PCR amplification products of both the cellular mRNA and the synthetic template, it was possible to measure the direct expression of each gene. The number of collagen a2(I), collagen a I (III), and lysyl oxidase mRNA molecules per cell peaked on day 16 of development. The expression of elastin mRNA was detectable only on day 16. Fibronectin and laminin B2 were more constitutive in their expression but again had their highest copy number per cell on day 16. A second burst of ECM gene expression occurred in the neonate, with the lowest ECM gene expression seen in the mature adult gland. In addition, immunohistochemistry was performed to localize the protein for each of the ECM molecules examined. With the construction of the pMATRIX supertemplate and the advent of competitive RT-PCR technology it has been possible to measure small changes in ECM gene expression during salivary gland development. This plasmid can be utilized to examine the ECM gene expression of any human, mouse, or rat tissue previously thought to be too small or limited for traditional techniques.














CHAPTER ONE
INTRODUCTION

The Extracellular Matrix

Tissues are not made exclusively of cells but instead derive a substantial part of their volume from the extracellular space which is filled with an intricate network of macromolecules constituting the extracellular matrix (Alberts et al., 1994). Two main classes of extracellular macromolecules make up the matrix: 1) fibrous proteins of two functional types, mainly structural (collagens and elastin) and mainly adhesive (fibronectin and laminin), and 2) glycosaminoglycans (hyaluronic acid, chondroitin sulfate, heparan sulfate and keratan sulfate) which form a highly hydrated gel-like ground substance in which the fibrous proteins are embedded. The macromolecules that constitute the extracellular matrix are mainly produced locally by fibroblasts in the matrix. The assembly, disassembly, and reassembly of extracellular matrices are dynamic processes that occur most rapidly during morphogenesis, growth, and repair (Birk and Linsenmayer, 1994). The extracellular matrix can be divided into at least two distinct components, the interstitial matrices and the basement membranes. Whereas the interstitial stroma possesses thick and long striated collagen cables separated by microfilaments and hydrated glycosaminoglycans, basement membranes are arranged into fine and delicate networks. Basement membranes form thin coats around mesenchymal cells or sheets underneath epithelial and endothelial cell layers called the



1























































0 4j








cis


u









.;Z 03





Cd ti






























S-S






4


basal lamina (Yurchenco, 1994).

Basement membranes play several roles: they supply mechanical support for cell layers, form flexible barriers between tissue compartments that helps regulate the exchange of macromolecules, serve as interactive surfaces providing adhesion, regulate cell shape, and communicate information for the regeneration and differentiation of cells (Yurchenco, 1994). Discussed briefly below are several major extracellular matrix molecules that are critical for development.

Collagens types I and III. Type I collagen is the most abundant collagen

accounting for 90% of all the collagens. Collagens in general account for 25% of the total protein in mammals. Collagens are extremely rich in proline and glycine, both of which are important in the formation of the triple-stranded helices. The general amino acid sequence of collagens is a repeat of (Gly-X-Y),, where X and Y can be any amino acid although one is commonly proline. The high glycine content allows collagen to tightly pack in the triple-helix while prolines stabilize the left-hand helical structure. Fibrillar collagens are secreted into the extracellular matrix by fibroblasts where they form rigid, triple-stranded helical structures made up of three alpha chains. These triplehelical collagen molecules assemble into fibrils which can further aggregate into collagen fibers (Figure 1-1).

Collgen IV. The major molecular constituent of basement membranes is

collagen IV along with laminin, entactin and proteoglycans. As is shown in Figure 1-2, each monomer is composed of two o1 chains and one ot2 chain. Unlike the fibrillar collagens the regular Gly-X-Y repeating amino acid sequence of type IV collagen is





































Figure 1-2. Structure of type IV collagen. Type IV collagen assembles into a
multilayered network, which forms the core of all basement membranes.






6




( monomers

rapid "head-to-head" association
via C-terminal globular domains



dimers

Lateral association via triple helical
domains to form a sheetlike meshwor








I




sheetlike polygonal meshwork



slow covalent associations via N-terminal
tails form a stacked network of sheets multilayered network I' I I 1 l _-I multilayered network






7


interrupted in a number of regions and each triple-helical chain is longer and more flexible (Hofmann et al., 1984). Rather than assembling into fibrils, type IV collagen usually forms a sheetlike meshwork by forming head to head dimers that is found exclusively in the basal laminae. Type IV collagen dimers appear to assemble initially into a network through noncovalent interactions and quickly becomes crosslinked through disulfides and lysyl oxidase-derived covalent bonds.

Fibronectin. Fibronectin-containing extracellular matrices play critical roles in such diverse processes as embryogenesis, wound healing, and malignant transformation (Peters and Mosher, 1994). Unlike most other commonly studied extracellular matrix proteins, fibronectin does not readily self-assemble and is thought to involve interactions among fibronectin, cell-surface receptors, and other matrix proteins (Peters and Mosher, 1994). Fibronectin is a 500,000 Da multifunctional glycoprotein which can be found as a soluble protein in blood, cerebrospinal fluid, and amniotic fluid or as an insoluble molecule incorporated into the connective tissue stroma, basement membrane, bone, cartilage, and plasma (Hynes, 1985). Fibronectin, shown in Figure 1-3, is made from two similar 250,000 Da subunits which are held together by two disulfide bonds at their carboxy termini (Kar et al., 1993). Numerous isoforms of fibronectin are made as a result of alternate splicing of the fibronectin precursor mRNA and can exist as a homodimer of two identical subunits or as a heterodimer of two similar but unidentical subunits (Petersen et al., 1989). The subunits are flexible and can be found fully extended to form a V-shaped molecule (Emch et al., 1992) or folded into a compact globular molecule (Erickson and Carrell, 1983). Fibronectin can bind to most collagens as well as a number







8







NH2

collagen binding


NH2
cell binding



heparin binding














Figure 1-3. Structure of fibronectin. A fibronectin dimer is made
of two similar polypeptide chains and are joined by two
disulfide bonds near the carboxy terminus. Each chain is
folded into a series of globular domains connected by flexible
polypeptide segments. Individual domains responsible for
binding collagen, heparin, and the cell are shown.






9


of other ECM components including heparin/heparan sulfate, bone, and fibrin and promotes the attachment of fibroblasts to the matrix in connective tissue (Engvall and Rouslahti, 1977; Engvall et al., 1978, 1982; Jilek and H6rnmann 1979; Woodley et al., 1983; Saunders and Bernfield, 1988; Yamada et al., 1992) and has been shown to colocalize with collagens type I, II, III, laminin, and heparan sulfate proteoglycans in culture (Furcht et al., 1980; Hayman et al., 1981; Hayman et al., 1982; Hedman et al., 1982; Ledger et al., 1980; Little and Chen, 1982; McDonald et al., 1982; Singer et al., 1987; Vaheri et al., 1978). Fibronectin has been implicated in cell migration and morphology, cytoskeletal organization, and control of cell growth and differentiation. Fibronectin is found in various fetal tissues, including connective tissues and basement membrane (Thiery et al., 1989). They are mostly absent from adult tissues but are reexpressed during wound healing and in tumor stroma (Carnemolla et al., 1989; Colvin, 1989; Matsuura and Hakomori, 1985; Vartio et al., 1987).

Laminin. Laminin is the most common non-collagenous protein in the basement membrane and has several in vivo functions which include promoting attachment of epithelial cells to the basement membrane, aiding in cell migration during development, and regulating cell growth and differentiation (Drago et al., 1991; Panayotou et al., 1989; Reh et al., 1987; Sweeney et al., 1990). As is shown in Figure 1-4, laminin is an 800 kDa multidomain glycoprotein composed of three genetically distinct polypeptide chains (A, B 1, and B2 chains) connected to each other in an asymmetrical four-armed structure by disulfide bonds (Beck et al., 1990; Timpl, 1989). The laminin amino acid sequence shares homologous repeats with EGF (Sasaki and Yamada, 1987). Laminin is







10






globular domains c




BI chainA chain



B2lchain /



B2 chain coile coil a domain















Figure 1-4. Structure of laminin. The muiltidomain glycoprotein
is composed of three polypeptides (A, B 1, and B2) arranged
in an assymetric cross-like structure by disulfide bonds. Each of the polypeptide's chains is more than 1500 amino acids in
length.






11


synthesized by various types of cells including epithelial and endothelial cells, muscle cells, and fibroblasts (Campbell and Terranova, 1988; Paulsson, 1992). Laminin is among the earliest detectable ECM proteins during development appearing at the two-cell embryo stage (Cooper and MacQueen, 1983; Dziadek and Timpl, 1985; Leivo et al., 1980). Messenger RNA expression studies have shown that various laminin chains are temporarily expressed during development and exhibit cell- and tissue-specific patterns of expression (Ekblom et al., 1990; Klein et al., 1990). Laminin binds to type IV collagen, heparan sulfate proteoglycan and heparin (Paulsson, 1992). Laminin interacts with the members of the integrin class of transmembrane receptors (Paulsson, 1992) which are known to mediate the signal to the cytoskeleton influencing cellular behavior, e.g., proliferation and differentiation. It has also been suggested that laminin plays a part in integrating signaling systems with other regulatory molecules such as growth factors (Nathan and Sporn, 1991).

E1asin. Elastic fibers are among the most complex structures of the extracellular matrix requiring at least four different proteins that not only direct polymerization of the elastin monomer but also determine the final architecture of the fiber (Mecham and Davis, 1994). Elastin is the predominant protein of mature elastic fibers and endows the fiber with the characteristic property of elastic recoil. As is shown in Figure 1-5, elastin is secreted from the cell as a soluble precursor protein of 60,000-70,000 molecular weight. Like collagen, a critical step in the maturation of elastin in the covalent crosslinking by lysyl oxidase.

Lysyl oxidase. The deposition of collagen fibrils into specific spatial patterns represents a central problem in morphogenesis. Elucidating the mechanisms regulating







12




















relax stretch





crosslinks








single elastin molecules Figure 1-5. Structure of elastin. Elastin moleculaes are held together by
covalent bonds to generate an extensive cross-linked network. Some
of the covalent bonds are generated by lysyl oxidase.








13





NH2
I Cu++
CH2 + 02 + H20 CHO + NH3 + H202
I I
CH2 (CH2)3
I I
-HN CH CO- -HN CH COpeptidyl lysine a-aminoadipic-8-semialdehyde
"allysine"












Figure 1-6. Crosslinking reaction catalyzed by lysyl oxidase. Crosslink
formation is initiated by the oxidative deamination of the e-amino
groups of specific lysyl and hydroxylysyl residues. This forms
reactive allysyl and hydroxyallysyl intermediates, which undergo
a series of spontaneous nonenzymatic condensation reactions to
form novel covalent crosslinks in both collagens and elastin.






14


collagen fibril assembly, deposition, and growth is necessary to understand the maintenance of structure and tissue function during development. Lysyl oxidase (LO) initiates the enzymatic crosslinking of both collagen and elastin in the extracellular matrix (Kagan, 1986). LO is a copper- and pyrolloquinoline quinone (PQQ)-dependent enzyme which catalyzes the oxidative deamination of e-amino groups in some lysyl and hydroxylysyl residues of collagen and in lysyl residues of elastin (Figure 1-6) (Siegel, 1979). LO is specific for lysyl residues in collagen and elastin and does not readily deaminate free lysine (Siegel et al., 1970). The deamination of lysyl residues results in the formation of reactive aldehydes (allysine or hydroxyallysine if the substrate residues are lysine or hydroxylysine, respectively) that non-enzymatically and spontaneously condense with lysyl or hydroxylysine residues in adjacent collagen and elastin molecules to form intra- and inter-chain divalent crosslinks. Soluble pro-collagen and pro-elastin secreted into the extracellular matrix is rendered insoluble through the cross-linking activity of LO. The crosslinkages of collagen and elastin contribute significantly to the elastic properties and tensile strength of lung, vascular, and connective tissues. The ratio of collagen to lysyl oxidase and different patterns of temporal expression are thought to be important in influencing the character of the matrix (Birk and Linsenmayer, 1994).

Glycosaminoglycans. Glycosaminoglycans (GAGS) are long, unbranched

polysaccharide chains composed of repeating disaccharide units with one unit always being either N-acetylglucosamine or N-acetylgalactosamine covalently linked to a core protein (Figure 1-7). GAGS are highly negatively charged attracting cations which make them highly hydrophilic, thus occupying very large volumes compared to their mass. The







15


hyaluronic acid link protein

keratan sulfate Schondroitin sulfate Score protein






















Proteoglycan aggregate







Figure 1-7. Structure of glycosaminoglycans. Schematic drawing of a proteoglycan
aggregate consists of approximately 100 proteoglycan monomers noncovalently
bound to a single hyaluronic chain. The proteoglycans are attached to the
hyaluronic acid chain by link proteins.






16


amount of GAGS in connective tissue is usually less than 10% by weight of the fibrous proteins, but because they form porous hydrated gels, GAG chains fill most of the extracellular space thus providing mechanical support to tissues while still allowing the rapid diffusion of water-soluble molecules and the migration of cells.



Salivar Gland Development



Salivary glands provide a model system to study many biological phenomena including structure and regulation of living systems. Fetal salivary glands have been utilized for years as a model for mammalian development (Nakanishi et al., 1986). The major salivary glands, iLe., the parotid, submandibular, and sublingual glands, are large paired organs that lie outside the oral cavity proper, and which communicate with the oral mucosa through major ducts. Salivary glands are an ideal system to study development because they are anatomically distinct and as they develop, begin to synthesize and secrete unique salivary-specific proteins. In the mouse, the earliest evidence of submandibular gland morphogenesis begins on late day 11I of development with a focal clustering of the primitive oral epithelium which pushes into the surrounding mesenchyme. Simultaneously, the adjacent mesenchymal cells become more numerous and condense. The epithelium proliferates and begins to bud from the surrounding mandibular mesenchyme on day 12. This occurs when clefts form in the distal end of the terminal bulb which deepen until two or more clefts have developed from the original. This forms a club-shaped structure surrounded by a basement membrane and a thin layer






17


of oriented mesenchyme. The ducts and alveolar components of the glands are epithelial outgrowths while the stroma and blood vessels are of mesenchymal origin. On day 13 the glands begin to resemble the familiar stalk and branch morphology and can be removed by microdissection. The minor salivary glands begin development as proliferations of oral epithelium in a fashion similar to the major salivary glands.

The most extensive early studies on the embryonic development of salivary glands were carried out in the pig (Chievitz, 1885; Flint, 1903; Kallius, 1910; Moral, 1913a; Moral, 1913b), in the mouse (Moral, 1916; Moral, 1919) and more recently and more precisely in the rat (Cutler and Chaudhry, 1973a; Cutler and Chaudhry, 1973b; Cutler and Chaudhry, 1974; Cutler and Chaudhry, 1975; Redman and Sreebny, 1970a; Redman and Sreebny, 1970b). The literature on salivary gland development has been difficult to compare since Redman and Sreebny (Redman and Sreebny, 1970a) refer to the day after matings as "day zero" whereas Cutler and Chaudhry (Cutler and Chaudhry, 1973a) define the day after mating as "the first day" so that apparent discrepancies between the two studies arise (Young and Lennep, 1978). In describing developmental timing of mouse salivary glands in this discussion the designation made by Cutler and Chaudhry will be used such that the day after the mating is designated as day 1.

There are four key events in the development of salivary glands: 1)

morphogenesis, the initiation of the characteristic clefts and branching architecture of the glands leading to lumenization of the primitive glandular epithelium, 2) cytodifferentiation, the differentiation of the rudimentary salivary gland into several cell types which begins after the initial phases of morphogenesis and includes the appearance






18


and accumulation of secretory granules and other organelles associated with the synthesis, storage, and secretion of specialized salivary-specific protein within the branching structure, 3) development of the stimulus/secretion coupling system by the parasympathetic and sympathetic branches of the autonomic nervous system and the acquisition by the glandular epithelia of receptors to the neurotransmitters of these nerves which together transduce external stimuli into a secretory response by the secretory cells, and 4) the anatomical coupling of the sympathetic nerves to begin the secretion of salivary fluids and proteins (Redman, 1987). In this report the effects of the extracellular matrix on the first two events, morphogenesis and cytodifferentiation, will be discussed.



Salivary Gland Morphogenesis



Role of Epithelial-Mesenchymal Interactions in Salivary Gland Morphogenesis

Classical studies of experimental embryology demonstrated that vertebrate organ development depends on sequential and reciprocal interactions between tissue layers (Grobstein, 1953c; Sax6n et al., 1976; Speman and Mangold, 1924). These inductive interactions (or secondary inductions) occur between epithelial and mesenchymal tissues and they lead to differences between cells and to the organization of cells into tissues and organs (Vainio et al., 1993).

There is limited information available concerning the molecules involved in the induction and regulation of the initial events in salivary gland development (Cutler, 1993). Figure 1-8 shows the early in vitro development of mouse submandibular glands. The important role of the mesenchymal capsule in the regulation of the development of






19


the epithelial part of the submandibular gland was first noted by Borghese (Borghese, 1950) when he observed that branching morphogenesis and growth of the submandibular gland rudiment in vitro was inhibited if the surrounding mesenchymal capsule (Figure 19) was removed. This observation was confirmed and expanded by Grobstein (1953a, 1953b, 1953c) who showed that the potential for branching morphogenesis resided predominantly in the end-buds while the stalk of duct had only limited capacity for branching. In addition, in now classical in vitro, transfilter experiments, Grobstein (1953c) demonstrated that the induction of branching morphogenesis appeared to be dependent upon a diffusible macromolecule which was produced by the capsular mesenchyme. Experiments in which the mesenchymal and epithelial elements of salivary gland rudiments were separated by gentle enzymatic digestion, then grown in vitro in various combinations from a different gland, established that, in general, salivary glands are highly selective with regard to the sources of mesenchyme that will support their growth and differentiation (Ball, 1974; Lawson, 1974). Bernfield and coworkers (1984) examined the reciprocal interactions between the mouse embryo submandibular epithelium and mesenchyme and found that the interactions modify the composition and metabolism of the basement membrane. They demonstrated that the mesenchyme remodels the basement membrane (BM) by depositing a collagen type I-rich matrix on the basal lamina and by producing a hyaluronidase which degrades hyaluronate and chondroitin sulfate. Similarly BM remodeling may be a general process for regulating cell behavior during other aspects of development. To clarify whether the elongation and branching morphogenesis of salivary glands is directed by the epithelium of the







20
















El -s



















u 0 1 00










en CN 4-4 (u P6


















































Figure 1-9. Photograph of a freshly dissected day 13 fetal mouse submandibular gland.
The submandibular gland epithelium is embedded by the darker appearing
mesenchymal capsule.






22


mesenchyme, Nogawa and Mizuno (1981) demonstrated by recombinational experiments that the elongating and branching morphogenesis of quail salivary glands is controlled by the mesenchyme.

It has been clearly demonstrated that the mesenchymal capsule surrounding the

epithelial portion of the salivary gland directly controls the development of the branching pattern seen in the developing glands (Lawson, 1970, 1972, 1974; Grobstein, 1953a, 1953b, 1953c; Bernfield et al., 1972; Cohn et al., 1977). The mesenchyme appears to exercise this control through the selective production and destruction of specific extracellular matrix molecules [Bernfield et al., 1984; Thompson and Spooner, 1982, 1983; Spooner et al., 1985; Grobstein, 1953a, 1953b, 1953c). These extracellular matrix molecules are deposited in and near the basal lamina which serves as the interface between the epithelial cells and their investing mesenchymal capsule.

Borghese (1950) and Grobstein (1953b) showed that mechanical or enzymatic removal of the surrounding submandibular mesenchyme reduced or eliminated the subsequent epithelial branching in culture. However, recombination of the separated mesenchyme and epithelium brought about further proper morphogenesis. This epithelial-mesenchymal interaction is thought to be achieved through the action of extracellular matrix components including basal lamina located between the epithelium and mesenchyme. These components include collagen, proteoglycan, fibronectin, and laminin (Trelstad, 1984). However one of the difficulties in elucidating the precise physiological function of these molecules is that most, if not all, of them exist as a sturdy multi-molecular complex in a solid state. Although the importance of epithelial-






23


mesenchymal interactions for the development of most organs is well established, the actual mechanisms involved in mediation of inductive signals are only starting to be elucidated.



Contribution of the Extracellular Matrix in Salivary Gland Morphogenesis

The mouse embryonic submandibular gland is an interesting and useful model, for several reasons, for analyzing the mechanisms of epithelial branching. The rudiment can be cultured on a Millipore filter or agar and the change in epithelial shape is easily followed in the living state with light microscopy. Secondly the epithelium and mesenchyme are readily separated from each other by brief treatment with collagenase or other proteases, a property that makes various recombinational experiments possible. Thirdly, because of the absence of the mesothelial layer outside the mesenchyme, proteinaceous factors added in culture medium (e.g., extracellular matrix moleculedegrading enzymes) quickly diffuse into the tissues (Nakanishi and Ishii, 1989).

The ECM can be functionally divided into the basement membrane, a continuous layer underlying all epithelia, and interstitial matrix which forms the noncellular part of the mesenchymal stroma. Each compartment has a distinct set of extracellular matrix macromolecules. For example, basement membranes contain collagen type IV, heparan sulfate proteoglycan, and laminin; while interstitial matrix generally contains mixtures of collagen types I and III, chondroitin sulfate proteoglycan and fibronectin.

The role of the extracellular matrix in the embryological development of the

mouse salivary glands has been initially explored. As early as 1965 it was thought that






24


collagen inhibited or retarded cellular growth -- serving either as an anchor or as a stabilization point around which nonstabilized cells would proliferate, giving rise to new branches (Grobstein and Cohen, 1965).

Collagen appeared to serve as a stabilizing component which inhibited cell growth in specific areas of the growing rudiment while other areas were devoid of collagen and thus able to grow. The stabilized areas could therefore serve as branch points from which morphogenetically active cells gave rise to new branches. These works of Grobstein and Cohen suggested that collagen could reduce cell growth at the branch point and serve as an anchor point from which cells not inhibited by collagen could undergo mitosis and develop into new branches. It was also postulated that some type of localized collagenolytic activity might be involved at the points of growth to free some cells from the stabilizing effect of collagen.

Collagen is present in the mesenchyme and on the epithelial surface, especially on the cleft and stalk regions, and is an important molecule in the branching morphogenesis of the salivary gland (Spooner and Faubion, 1980). To show that collagen was important in epithelial branching, Spooner and Faubion (1980) used L-azetidine 2-carboxylic acid and a,a'-dipyridyl, inhibitors for collagen synthesis and secretion, to introduce collagenolytic activity in the salivary gland. Previous work using bacterial collagenase preparations (Grobstein and Cohen, 1965; Wessels and Cohen, 1968) were possibly obscured due to the probable contamination of mucopolysaccharidases (Bernfield and Banerjee, 1982). Nakanishi and coworkers (1986) also showed that collagen was an important extracellular matrix protein in the regulation of cleft formation in the salivary






25


epithelium through the use of a collagenase. In that study collagenase from Clostridium histolyticum was shown to inhibit cleft formation while a collagenase inhibitor isolated from the culture medium of bovine dental pulp (Kishi and Hayakawa, 1984), now thought to be a tissue inhibitor of metalloproteinases (TIMP), stimulated multiple cleft formations by specifically rearranging type III collagen to allow cleft formation (Figure 1-10). The results supported the notion that collagenase inhibitor affected the collagenase acting on the interstitial collagens and changed the fibrous architecture at the epithelialmesenchymal interface (Nakanishi et al., 1986) and demonstrated the role of collagen as a source of constraint probably necessary for cleft formation (Nogawa, 1983). Further experiments have indicated that clefting of the terminal buds begins with the contraction of microfilaments in the peripheral cells, but that deposition of collagen and glycosaminoglycans (GAGS) in the mesenchyme at the points of the clefts is required for the subsequent division of the bud (Grobstein and Cohen, 1965).

Indications are that both types I and III collagen synthesis and deposition are

required for salivary gland branching morphogenesis (Spooner and Faubion, 1980). But some questions about the absolute requirement for type I collagen in salivary gland morphogenesis remain (Kratochwil et al., 1986). By using submandibular glands of collagen I-deficient Mov- 13 mutant mouse embryos, Kratochwil et al. demonstrated normal morphogenesis at the 13-day stage. However, based on the work of Spooner and Faubion (1980), and more recent data from Fukuda and associates (1988), it appears that branching morphogenesis is affected by both types I and III collagen.







26



































Figure 1-10. Effects of collagenase and collagenase inhibitors on submandibular
gland development. Schemiatic summary of epithelial morphogenesis of a
mid-day 12 mouse submandibular gland under various conditions. A)
cultured in normal media; B) plus 5 pg/ml Clostridial collagenase; and C)
plus 5 pg/ml bovine pulp collagenase inhibitor (TIMP). Adapted from
Nakanishi and Ishii, 1989.






27


The convergence of the observations suggesting the importance of other collagens and glycosaminoglycans in the regulation and stabilization of salivary gland morphogenesis came from data indicating that types I and III collagen appear to protect the basal lamina from breakdown by hyaluronidase and other enzymes by binding with heparan sulfate proteoglycan. This binding stabilizes the basal lamina and reduces the breakdown of the heparin-rich proteoglycan (Bernfield et al., 1984; Spooner and Faubion, 1980) which is the dominant proteoglycan of the maturing salivary epithelial basal lamina (Cutler et al., 1987). Deposition of type III collagen at the cleft or branch point areas seem to play a key role in regulating both assembly of basal lamina components and stabilizing these points so that branching may proceed.

The distribution of ECM macromolecules during development has been examined in various systems including whole mouse embryos (Leivo et al., 1980), mouse salivary glands (Bernfield et al., 1972; Banerjee et al., 1977; Spooner, et al., 1985, 1986, 1989) and rat submandibular glands (Kadoya and Yamashina, 1989). These initial studies, using fixed or frozen sections, provided valuable information concerning the spatial and temporal distribution of ECM macromolecules during embryogenesis. Hardman and Spooner used confocal microscopy to localize BM-1 proteoglycan, fibronectin, laminin, and collagen types I, IV, and V in developing mouse submandibular and sublingual glands in 3-D (Hardman and Spooner, 1992). Each of the ECM components measured was shown to have a distinct distribution and that the distribution of some of the molecules changed with culture time. Laminin was mainly restricted to the basement membrane. BM-1 proteoglycan was concentrated in the basement membrane and also






28


formed a fine network throughout the mesenchyme. Type IV collagen was mainly located in the basement membrane of the epithelium, but it was also present throughout the mesenchyme. Type V collagen was distributed throughout the mesenchyme at 24 hours, but at 48 hours was principally located in the basement membrane. Type I collagen was distributed throughout the mesenchyme at all culture times and accumulated in the clefts and particularly at the epithelial-mesenchymal interface as time in culture increases. Fibronectin was observed throughout the mesenchyme at all times.

One of the most interesting questions in animal developmental biology is how an epithelium changes its shape. Nakanishi and Ishii have proposed a model using mouse submandibular glands to describe how several organs including the salivary glands, pancreas, lung, kidney, and mammary glands produce elaborate epithelial structures with maximal surface area (Nakanishi and Ishii, 1989). The results from Nakanishi and Ishii (1989) suggest that collagen may modulate branching morphogenesis of submandibular epithelium in such a way that the number of clefts formed depends on the amount of some type of collagen present in the tissue. Bundles of collagen fibrils were visualized at the narrow clefts between two adjacent epithelial lobules, consistent with the observations of Bernfield and Wessells (1970). These studies raised the question of which specific collagen molecule is important for the morphogenetic change. Earlier work had shown that the most abundant interstitial collagen in submandibular glands is collagen I.

Further work by Nakanishi et al. (1988) using antibodies specific to various types of collagen demonstrated strong collagen III reactivity in the very early clefts of late day 12 and early day 13 mouse submandibular glands. Staining for collagen I showed a






29


rather uniform distribution both at the epithelial-mesenchymal interface and throughout the mesenchyme. Collagen IV was uniform in the basal lamina. These results demonstrated that collagen III, which is known to be relatively rich in embryonic tissues, may play an important role in submandibular gland morphogenesis. With this information, Nakanishi proposed a working model on how the mesenchymal cells secrete collagen which exerts mechanical force to the epithelium giving strain to the surface of the epithelial lobule and initiating cleft formation.

The role of cell proliferation, cell shape change and extracellular matrices in

branching morphogenesis has been investigated in the branching morphogenesis of the fetal mouse submandibular gland. However all the studies were based on organ culture experiments whereby the epithelium and mesenchyme interacted as easily as in situ. Takahashi and Nogawa (1991) introduced a more analytical experimental system by examining epithelial branching on Matrigel, a commercially available gel composed of ECM components derived from cultured cells. In those studies the submandibular epithelium showed fair growth and branching morphogenesis when clotted with Matrigel and separated from the mesenchyme by a porous filter demonstrating that the Matrigele provided a good extracellular environment for epithelial growth. In addition the epithelium clotted with Matrigel with mesenchyme on the opposite side of the filter shows far better growth than the one without mesenchyme indicating that mesenchymal factors stimulate epithelial growth.

The temporal and spatial expression of laminin, collagen types IV and I and 0.6/31 integrin receptor (the major laminin receptor of the integrin family) has been






30


examined in the postnatally developing rat parotid gland (Lazowski et al., 1994). Laminin B 1 and B2 isoforms and collagens a (IV) and a 1(I) steady-state mRNA levels were highest at ages 0, 7, and 14 days after birth and declined to the adult (90 days) level at 21 days and older. Laminin A chain transcripts were not detected at any age. Collagen a 1 (IV) and laminin were localized in the basal membrane of the developing acinar and ductal cells, while collagen a 1(I) was localized in the stroma surrounding the cells. The amounts of these ECM components were high at the early stages of development and lower at later times. The pattern of expression for the a6/1 I integrin genes during development was similar to those of laminin and collagen a 1 (IV) and a 1 (I). These data suggested that laminin B 1 and B2 and collagen a I (IV) and a 1 (I) are consistently coexpressed with the a6/01 integrin receptor complex in the developing acinar and ductal cells during parotid postnatal development in the rat.

Through studies such as these the importance of the extracellular matrix in the

development of salivary glands has been demonstrated, but because of the limited tissues available, no attempt has yet been made at quantifying the ECM gene expression in developing salivary glands.



Contribution of Glycosaminoglycans in Salivary Gland Morphogenesis

The potential importance of glycosaminoglycans in the regulation of salivary gland morphogenesis was first suggested by Kallman and Grobstein (1966). It was suggested that, in addition to collagen, the epithelial basal lamina might be important in the regulation of salivary gland morphogenesis. The basal lamina of the embryonic






31


submandibular gland is an extracellular product of the epithelium (Banerjee et al., 1977), which is rich in proteoglycan and hyaluronic acid (Cohn et al., 1977) and additionally has been reported to contain type IV collagen, laminin, fibronectin, and chondroitin sulfate and heparan sulfate proteoglycans (Bernfield et al., 1984). That the branching morphogenesis of the epithelial component of developing salivary glands is maintained by its basal lamina has been demonstrated (Banerjee et al., 1977; Bernfield and Banerjee, 1982; Bernfield et al., 1972; Cohn et al., 1977). A number of studies have demonstrated that it is the proteoglycan associated with the basal lamina that play a major role in the regulation and maintenance of the characteristic branching pattern of salivary glands (Bernfield et al., 1984; Cutler, 1989; Spooner etal., 1986).

During early morphogenesis of the mouse and rat submandibular gland xyloselinked proteoglycan is the predominant proteoglycan synthesized by the growing salivary epithelium (Banerjee et al., 1977; Cohn et al., 1977; Cutler et al., 1991a). The direct proof that basement membrane xylose-linked proteoglycans were of critical importance in the control of salivary gland branching morphogenesis came from studies by Spooner and coworkers (Thompson and Spooner, 1982, 1983; Spooner et al., 1985). In these studies they used p-nitrophenyl-p-D-xylopyranoside (P-D-xyloside), an inhibitor of proteoglycan assembly, in in vitro experiments to provide direct evidence that blockage of proteoglycan assembly inhibited submandibular gland morphogenesis. Both chondroitin sulfate and heparan sulfate proteoglycan have the same (ser-xyl-gal-gal-) linkage region between the appropriate GAG molecules and their respective core proteins, rendering the






32


synthesis of both proteoglycan types sensitive to exogenous 3-D-xylosides (Thompson and Spooner, 1983).

Data which showed the significant role of the basal lamina and its components was developed by Bernfield and his colleagues (Banerjee et al., 1977; Bernfield and Banerjee, 1972; Cohn et al., 1977). Glycosaminoglycans (proteoglycans) and type I collagen were shown, by histochemical, electron microscopic, and biochemical studies, to be concentrated in the clefts or branch points while these molecules appeared to be absent or sparsely distributed at the growing ends of the branches (Banerjee et al., 1977; Bernfield et al., 1972; Bernfield and Banerjee, 1972; Cohn et al., 1977).

Autoradiographic studies suggested that there were regional differences in

glycosaminoglycan turnover and that there was an increased degradation of the basement membrane which occurred at the growing end of the branches. This degradative activity seemed to be mediated by the investing connective tissue since there was an activation of a neutral hyaluronidase with specificity for hyaluronic acid and chondroitin sulfate proteoglycan in the tissue at the time branching morphogenesis was initiated. (Bernfield and Banerjee, 1982; Bernfield et al., 1984). Coincident with the activation of this hyaluronidase, the pattern of glycosaminoglycans produced by the salivary epithelium changed. The glycosaminoglycans synthesized by the early rudiments were rich in hyaluronic acid and chondroitin sulfate. However, as morphogenesis progressed and became more complex the glycosaminoglycans produced showed an increased amount of heparin sulfate and a reduced content of hyaluronic acid and chondroitin sulfate (Banerjee et al., 1977; Cohn et al., 1977; Cutler et al., 1991b). In the mature gland, heparan sulfate






33


is the predominant glycosaminoglycan synthesized with only small amounts of hyaluronic acid and virtually no chondroitin sulfate produced (Cutler et al., 1987).

Collectively these data, along with definition of distinct patterns of proteoglycan deposition that correlates with events of lung development (Smith et al., 1990), strongly suggest a role for glycosaminoglycans, specifically chondroitin sulfate proteoglycan, in the morphogenetic branching of salivary glands. However, neither the localization of individual proteoglycans nor definition of their roles in the morphogenic changes is yet defined (Vogel, 1994).



Salivary Gland Cytodifferentiation



Information regarding the molecular factors involved in the regulation of

secretory cell differentiation in the salivary glands is not as advanced as that for salivary gland morphogenesis. The basic morphogenetic branching pattern is established prior to the initial events in secretory cell development (Cutler, 1980). As the branching pattern of the rudiment is being established, cells producing low levels of secretory proteins can be identified within the rudiment. However, these cells do not demonstrate any structural signs of differentiation such as secretory granules at this time (Cutler, 1973; Cutler and Chaudhry, 1974; Yamashina and Barka, 1973). By the time secretory granules, the first fine structural sign of secretory cell differentiation, can be seen in developing secretory cells, branching morphogenesis is very advanced (Yamashina and Barka, 1972, 1973,






34


1974; Redman and Sreebny, 1970b, 1971; Redman and Ball, 1978; Cutler and Chaudhry, 1973a, 1973b, 1974).



Role of Epithelial-Mesenchymal Interactions in Salivary Gland Cytodifferentiation

Direct epithelial-mesenchymal contact between the salivary epithelium and the surrounding capsular mesenchyme (Cutler and Chaudhry, 1973a, 1973b; Cutler, 1977) appears to have an important role in initiating the sequence of events (amplification of secretory protein synthesis and the subsequent structural changes at the cellular level) that lead to secretory cell cytodifferentiation within the salivary glands (Cutler, 1980). These contacts are seen only after the primary branching pattern has been established and only involve interaction between the epithelial cells in the end-buds of the initial 4 to 12 branches of the early rudiment and the surrounding mesenchyme (Cutler, 1977; Cutler and Chaudhry, 1973b). Contacts of this type are not seen before or after this stage of development of the gland. If these direct epithelial-mesenchymal interactions are prevented by separating the developing epithelium from its investing mesenchyme differentiation of secretory cells does not occur. However, if the epithelial-mesenchymal contacts have taken place, many of the cells go on to develop into secretory cells (Cutler, 1980).

The continued presence of the mesenchyme does not seem to be required for secretory cell development to occur once the inductive signals for secretory cell differentiation have been generated. This observation points out a significant difference between morphogenesis of the rudiment and secretory cell development, since the






35


continued presence of the mesenchymal capsule is required in order for morphogenesis to occur. In addition the attainment of apical-basal polarity of the secretory cells seems to require factors produced by the mesenchyme. Secretory cells differentiating in the absence of the capsular mesenchyme produce secretory material and package the material into secretory granules. However, the cells do not demonstrate the apical-basal polarity typical of salivary gland exocrine cells. Further, the clustering of cells into acinar units is not required for the differentiation of secretory cells. These observations suggest that the development of the typical glandular morphogenetic branching pattern and the differentiation of secretory cells within developing salivary lands are partially coupled but independently regulated processes (Cutler, 1980). The mesenchyme seems to regulate both the gross, glandular morphology and the fine, cytological form (columnar shape, apical-basal polarity) of the individual cells within the gland.



Contribution of the Extracellular Matrix in Salivary Gland Cytodifferentiation

It was noted that there was a fibrillar material between the opposing membranes of the direct epithelial-mesenchymal contacts involved in secretory cell differentiation (Cutler, 1977; Cutler and Chaudhry, 1973b). The fibrillar material was structurally similar to the lamina densa of the basal lamina and suggested the possibility for a role for extracellular matrix molecules in the regulation of secretory cell differentiation.

Recent studies (Cutler, 1990) have examined the effects of culturing developing 16-day embryonic rat submandibular gland rudiments in the presence or absence of polyclonal or monoclonal antibodies directed against extracellular matrix components.






36


These studies have provided some interesting insights into the regulation of glandular morphogenesis and secretory cell differentiation It appears that type IV collagen and laminin have roles in the regulation of salivary gland morphogenesis in addition to the roles already established for types I and III collagen and chondroitin sulfate proteoglycan. To date, with regard to the control of the differentiation of salivary gland secretory cells, type IV collagen is the only extracellular matrix molecule which was shown to play a role in this process. When embryonic submandibular gland rudiments are cultured in the presence of anti-type IV collagen antibody virtually all of the rudiments were prevented from undergoing further branching morphogenesis and secretory cell differentiation was not observed in any of these rudiments.

The processes of morphogenesis and cytodifferentiation are partially linked,

independently regulated processes. The full expression of both processes is modulated or controlled by epithelial-mesenchymal interactions involving both direct contacts and indirect molecular interactions. It appears that, at least in part, molecular constituents of the extracellular matrix may mediate the regulatory effects of both direct and indirect interactions. Data indicate that epithelial-mesenchymal interactions and various extracellular matrix molecules are intimately involved in the induction, control, and maintenance of salivary gland morphogenesis and cytodifferentiation.



Contribution of Glycosaminoglycans in Salivary Gland Cytodifferentiation

Previous studies (Bottaro and Cutler, 1984; Cutler, 1980; Cutler et al., 1985)

suggested that the process of differentiation of salivary gland secretory cells is controlled






37


independently from the process of glandular morphogenesis. To test this, Cutler et al., examined the role of xylose-linked proteoglycans, molecules known to play a significant role in the regulation of salivary gland morphogenesis, in the control of secretory cell differentiation in developing salivary glands (Cutler et al., 1991b). In these studies 16day rat embryonic submandibular gland rudiments were cultured in the presence or absence of P-D-xyloside under conditions known to permit secretory cell differentiation. Morphogenesis was inhibited in greater than 90% of the rudiments cultured in the presence of xyloside analogous to the findings of Spooner and coworkers (Spooner et al., 1985). However, secretory cell differentiation was seen in more than 70% of the rudiments in which branching morphogenesis had been inhibited. Analysis of the effect of P-D-xyloside on glycosaminoglycan/proteoglycan synthesis by rat salivary gland rudiments indicated that xyloside specifically inhibited chondroitin sulfate synthesis but had little effect on heparan sulfate proteoglycan production. This observation is consistent with those of Spooner and coworkers (Spooner et al., 1986) and earlier reports by Thompson and Spooner (1982, 1983) which indicated that chondroitin sulfate proteoglycan plays a major role in the regulation of salivary gland morphogenesis.

Proteoglycans play a very central role in the regulation of the morphogenesis of salivary glands. Chondroitin sulfate proteoglycan clearly appears to be the major proteoglycan in this regard. Interestingly, chondroitin sulfate proteoglycan does not appear to be involved in the regulation of secretory cell differentiation within the developing rudiment. The epithelial cells also secrete GAGS and other ECMs such as fibronectin and laminin, which strongly influence the course of cytodifferentiation in the






38


gland (Bemfield et al., 1984). This observation supports earlier work (Cutler, 1980) that indicated that morphogenesis and cytodifferentiation of salivary glands are separately regulated processes.



Statement of the Problem



The preceding discussion of salivary gland morphogenesis and cytodifferentiation shows the great historical interest in salivary gland development and describes compelling evidence that the extracellular matrix is critical to the development of salivary glands. While the literature supports the important role of the extracellular matrix in salivary gland development there is complete lack of ECM gene quantitation accompanying this data. Until recently the ability to measure gene expression from small developing tissues was not possible, but with the advent of polymerase chain reaction (PCR) technology, it is now possible to begin to understand the changes that occur in gene expression in developing tissues. The research project in this dissertation reports on the development of a multiprimer supertemplate to measure gene expression of ECM genes. The technology is so powerful that it permits quantitative gene expression from small developing mouse submandibular gland rudiments. The following section will describe the history of PCR technology that has led to competition-based quantitative RT-PCR, one of the techniques used in this report.






39


Gene Quantitation



The disadvantage of working with fetal samples, particularly early embryos or dissected fetal organs, is that it is often difficult to obtain sufficient tissue for many molecular analyses. Sensitive methods commonly used for the detection and analysis of RNA molecules include in situ hybridization, Northern gels, dot or slot blots, S I nuclease studies, and RNase A protection studies (Kawasaki, 1990). The most sensitive of these methods is in situ hybridization, in which 10 to 100 molecules can be detected in a single cell. However, in situ hybridization is technically very difficult and does not lend itself to the processing of large number of samples. With other techniques the level of detection is approximately 0.1 to 1.0 pg of the target sequence which for an average-sized mRNA translates to 105 to 106 target sequence molecules. The high sensitivity of RT-PCR overcomes this limitation. The first published description of the use of PCR to amplify mRNA from cDNA was in 1987 (Veres et al., 1987), when it was used to study point mutations in the mouse ornithine transcarbamylase gene.

The use of RT-PCR quickly turned toward quantitation of gene expression. Initially many groups attempted to coamplify a gene of interest in comparison to the amplification of a housekeeping gene, i.e., 13-actin, glyceraldehyde-3-phosphate dehydrogenase, keratins, etc. These coamplifications were done in either separate tubes or in a single tube, but when RNA is limited, it is desirable to amplify both the test and reference mRNAs in a single tube as long as the two products are of different sizes. Braga and Gendler (1994) found however, that the yield of muc- 1, an epithelial






40


differentiation marker in mouse embryos, and P-actin can vary if they are amplified together in a single tube. The ratios of Muc- 1 to 1-actin also differed when amplified individually or together even with the use of gene-specific primers in the RT reaction. This led to the conclusion that a more sophisticated system was needed to simultaneously amplify more than one cDNA in one single reaction.



RT-PCR

Detection of low abundance mRNAs by reverse transcription-polymerase chain reaction (RT-PCR; Figure 1-11) has become a standard technique to study gene expression in tissues and cells in culture. The ability to determine relative or absolute copy number of specific mRNAs has been difficult however due to inadequate internal standards to control for sample-to-sample variation (Tarnuzzer et al., 1996a). The use of a synthetic RNA standard with identical sequences to the PCR primers allows reproducible quantitation between samples and assays. By designing multisequence templates, specific mRNAs can be quantified using a single template. Addition of multiple templates to a single RT reaction allows the quantitation of large number of targets from as little as 1 jig of total RNA. Quantitative RT-PCR therefore provides a very powerful technique to study gene expression in tissues which are limited due to size or availability

One of the applications of PCR is the quantitative analysis of specific nucleotide sequences. The main advantage of this method, as compared with other methods based on probe hybridization, is its extreme sensitivity and specificity. However, because of the































Figure 1-11. Schematic diagram of the RT-PCR method. Briefly, either total or poly(A)
RNA is isolated whole tissue or cells. The RNA is then reverse-transcribed to
make cDNA using either oligo (dT), random hexamer, or gene-specific primers.
The cDNA is amplified by PCR. The products are separated on an agarose gel,
stained with ethidium bromide, and photographed.







42




Cells or tissue








RNA isolation



poly (A)+RNA




reverse transcription



TTTTTTTTTT cDNA
TTTTTTTTTT



polymerase chain reaction



1 2 3 4



Ethidium bromide electrophoresis validation of PCR products






43




many amplification steps, PCR by itself is not an accurate quantitative assay. Small differences in amplification efficiency can result in dramatic differences in product yield. A number of controls have been introduced to compensate for the problems intrinsic to quantitation using PCR. The use of PCR for gene quantitation has been attempted a number of times in the literature, but because of the intrinsic problems in PCR amplification, sufficient controls have not been included to overcome serious concerns with the methodology.



Competitive RT-PCR

The name "competitive PCR" refers to PCR that is allowed to proceed into the saturation phase in which a competition occurs between target and standard templates for available substrates. However, because the sum of the masses of both products cannot exceed some maximum value, the amount of product formed from one template will decrease with the increasing quantity of the other template. A related quantitative application of PCR coamplification is the determination of relative mRNA levels of members of gene families. The term "ratio PCR" has been suggested for this method. Instead of housekeeping genes, many investigators have used exogenously added standards. The conditions for reliable quantification are much less stringent if the standard and target sequences possess identical primer binding sites. The use of an exogenously added standard that contains the same sequences for primer binding as the target was first described by Wang et aL (1989). This technique was also explored by Becker-Andre, who named the method PATTY: PECR-aided transcript titration assay (1993), and by Gilliland et aL, who introduced the term "competitive PCR" (Gilliland et al., 1990). This






44


latter term was adopted in most of the literature. Because only one primer pair is needed in this approach, it can be assumed that the amplification efficiency is identical for both sequences if the region in between the primer-binding sites also is very similar. Therefore, the PCR can be extended into the latent phase where a decrease of the efficiency occurs, if this decrease occurs with an identical time course for both sequences. The ability to extend the PCR into the nonexponential phase is very useful in practice because it avoids many additional controls and allows accurate quantification of the PCR products (Raeymaekers, 1995).

In competitive PCR, the products of target and standard sequences are discriminated

either by a difference in length or by a specific restriction site in the region between the primer templates. In practice, a series of PCR tubes containing the same but unknown amount of target sequence is spiked with a dilution series of defined quantities of the standard. If the rate of amplification is the same for both sequences, their ratios will remain constant during the amplification and the amount of the unknown template can be quantitated from the ratio of the two products. In the practical application of the method, it was recommended that a curve be constructed relating the logarithm of the ratio of PCR products (standard/target) to the logarithm of the initial copy number of standard template added. The amount of initial target template can be read easily from the point on the curve where the amounts of target or RNA and standard or template are equal (Siebert, 1993; Siebert and Larrick, 1992).

Although competitive PCR has been used in several examples for reliable quantification, many incorrect results have also been published, as is apparent from the shape of the log-log calibration curves. Theory predicts that this calibration curve should be linear and have a slope of 1. An invalid standard curve must be caused by a difference in the amplification factor






45


between the template and the standard, or by differences in the PCR tubes of the dilution series (Raeymaekers, 1994).

For the analysis of submandibular gland ECM gene expression, a "thematic" multiprimer supertemplate, pMATRIX, has been constructed and used to measure the gene expression for 7 ECM genes by competition-based quantitative RT-PCR. It represents the first report of quantitative gene expression in developing submandibular glands. To correlate with this data, immunohistochemistry was performed on developing mouse submandibular glands to localize the ECM proteins.














CHAPTER 2
MATERIALS AND METHODS


Synthetic Supertemplate pMATRIX Construction

To investigate the changes in extracellular matrix gene expression during fetal submandibular gland development, a multiprimer plasmid (pMATRIX) was constructed which contains primer sequences for collagens o2(I), a 1 (III), and a I (IV), elastin, fibronectin, laminins B 1 and B2, and lysyl oxidase. The multiprimer sequence with an added poly(A) tail was inserted into pCRII downstream from an Sp6 RNA polymerase promoter.

Selection of oligonucleotide sequences. The nucleotide sequences for the human, mouse and rat ECM genes were retrieved from Genbank The primer sequences selected were 100% identical for all three species (Table 2-1) and were selected to amplify polymerase chain reaction (PCR) products between 500-800 base pairs. In addition, oligonucleotide primers, also 100% identical between human, mouse, and rat, were synthesized to correspond to internal sequences approximately 50 bp downstream from either the 5' or 3' primers. Appendix A lists the code names for each of the ECM oligonucleotide primers. The oligonucleotide primers were also designed to span introns where possible to control for the amplification of contaminating genomic DNA.







46







47





00 t 00 eq m 't
r- CA eq le ON
CL c kn tn t- t- t- W)

A










u u u u F. u u u
U U U u U
U U U U
u 1-- 0 <
u 0 u
0 u u
< u F- 0 0 U
F" -1 1-,
u u < u u
u u U lu




cn

u u u u < U U
u u
U U0 Od
0 u

96 1- u
cd u
E- 8 u
0 u
U U
u d u u
F" u < <
u u u
U U U 0





F. U 0
F- U

U U
< u u
u 0 U
u u <
0 0 u
0 u u
u 0 u

u u
u
u 0 u u
w 0 < u
4-4 u U U U
u u u <
u u



eq
cq ts






48





FN-3' CCTCCCAGAGAAGTGGTCCT LAMB2-3' CCMCTTCAATGACCGGCCG LO-3' CCGACCCCTACTACATCCAGG COL3AI-3' GGAGAACCTGGTGCAAATGGG ELAST-3' GAGCTGCAGCTGGGCTTGGTGC COLlA2-3' GGTGCCAGAGGACTTGT7GGT COLAAI-3' CCCTGGCCTTCCTGGACAGCA GTAK-3' CCTGAAGGAGACGGGCTrCCA LAM[Bl-3' AGTGGAAGGAATGGTFCACGG LAMB2-3'
CCTCCCAGAGAAGTGGTC Cn7CTTCAATGACCGGC-CGAEL-CCrA-CTA
FN-3' LO-3'

COL3AI-3'
CATCCAGGAGAACCTGGTGCAAATGG-GAGCTGCAGCTGGGCTTGGTG
ELAST-3'


COLIA2-3' GTAK-3'
-CCAGAGGACTTGTTGGTCCCIQQ=CET(Y-ACA-GCACCrGAAGGAG
COL4AI-3'


ACGGGCTTCCAGTGGAAGGAATGGT'FCACGG
LAM[Bl-3'



Figure 2-1. Alignment of oligonucleotides to create the 501 bp multiprimer insert.
The most economical arrangement was made as shown above for the 3' primers.






49


Synthesis of multiprimer template. The multisequence insert was synthesized by PCR using overlapping 80-mer oligonucleotide primers (Tamuzzer et al., 1996a) containing contiguous ECM gene sequences. Before the 80-mers were synthesized, however, the selected 5' and 3' oligonucleotide primers were tested for specificity using standard RTPCR using a tissue which is known to express the ECM genes. Total RNA from mouse liver and placenta were used to test these primers. Amplification of a single band of the correct size (confirmed by restriction endonuclease digestion) indicated a good primer pair had been selected and synthesized. Amplification of multiple bands [as is the case for collagen a I (III)] was considered acceptable if a temperature was found which reduced the other bands. Primers which produced a non-specific product(s) with a molecular weight similar to the correct product were excluded for use in the plasmid. Each of the 5' oligonucleotide primer sequences was aligned and examined for common overlapping ends. The same was done for the 3' oligonucleotides. The arrangement that was the most economical, i.e., had the most overlaps in the 5' and 3' primers, was the sequence used to determine the order of the genes arranged on the plasmid. An example of how this was achieved in shown in Figure 2-1. For pMATRIX, the most economical arrangement of the oligonucleotide primers was 501 bp. A restriction map of the insert is shown in Appendix B. From this sequence eight overlapping 80-mers were then selected and synthesized by the University of Florida DNA Synthesis Laboratory.

The construction of pMATRIX is diagramatically represented in Figure 2-2. To synthesize the multisequence insert, 5OOng of each 80-mer oligonucleotide was added in a 100pl standard PCR run with 200 jiM each dNTP, 2.5U Taq polymerase in a buffer



































Figure 2-2. Scheme for construction of pMATRIX. The 8 overlapping synthetic
oligonucleotides were ligated and filled with Taq polymerase in a multi-step
process as described. The compete template sequence was unidirectionally cloned into plasmid pCRII to allow cRNA synthesis by Sp6 RNA polymerase (Tarnuzzer
et al., 1996). GTAK = GTA kinase (p58), a unrelated gene included on this
plasmid.








51

1 2 3 4



5 6 7 8


7 cycles PCR

9




10

20 cycles PCR











Upstream amplification Internal detection Downstream amplification poly A
oligo sequences oligo sequences oligo sequences tail







Sp6 promoter P lac



pMATRIX IacZ a
4451 bp
pCRII F1 origin
Ampicillin



Kanamycin






52

containing 50 mM KC1, 10mM Tris, pH 8.0 and 1.5 mM MgCl2. This reaction was amplified for 1 cycle at 94oC for 7 min for denaturing, 550C for 2 min for annealing, and 72oC for 3 min for extension, followed by 7 cycles of 940C for 1.5 min, 55oC for 2 min, and 72oC for 3 min, and finally incubated at 4oC indefinitely. To add the flanking oligonucleotides, a second polymerase chain reaction was performed consisting of 2il of the product from the above polymerase chain reaction as well as the 5' and 3' oligonucleotide primers (primers 9 and 10 in Figure 2-2). The entire multisequence insert was then amplified by PCR for 25 cycles at 940C for 1.5 min, 550C for 2 min, and 720C for 3 min. The resulting 501 bp reaction product was separated on a 2% low melting point (LMP) agarose gel and the band excised for cloning into pCRII. Figure 2-3 is the sequence of the 501bp multisequence insert. pCRII is a commercially available plasmid from Invitrogen (San Diego, California) and is contained in the TA Cloning kit (K200001). pCRII contains both an Sp6 and a T7 RNA polymerase promoter which flanks a polylinker site designed to easily accept PCR generated products by nature of a 5' adenine overhang.

Lgation. The low melting point agarose gel slice containing the multisequence

insert was heated to 65oC for 10 minutes and then kept at 370C for the subsequent ligation reaction (Sambrook et al., 1989). The ligation reaction consisted of 1 g1 of the PCR product (approx. 10ng), 6 p1l of sterile water, 25 ng of pCRII (freshly resuspended in 8.8 p.1 of Tris/EDTA buffer), 1 pl of T4 ligase (Invitrogen), and 1 p.1 of 10X ligation buffer (60mM Tris pH 7.5, 60mM MgCl2, 50mM NaC1, 1 mg/ml BSA, 70mM PME, ImM ATP, 20mM DTT, 10mM spermidine). The reaction was incubated at 120C overnight.







53



1 CCGGGTTCTGAGTACACAGTCGGGCAGCCTTCCTGACCGACTGGGAGAAC
GGCCCAAGACTCATGTGTCAGCCCATCGGAAGGACTGGCTGACCCTCTTG 51 AACGGGCAGGTGTGGCTCCTGGTGAGCGAGGACGTGCAGGCTTAGTGCCT TTGCCCGTCCACACCGAGGACCACTCGCTCCTGCACGTCCGAATCACGGA 101 GGTGGCCCTGGACCAATGGGCTTAGGACAAGCAGGCTTTCCTGGATGCCA
CCACCGGGACCTGGTTACCCGAATCCTGTTCGTCCGAAAGGACCTACGGT 151 GGGGAGGTGAAGACCCTGCGCAGAAGGCAGCTGCTAGCCAGCCCCTGATT
CCCCTCCACTTCTGGGACGCGTCTTCCGTCGACGATCGGTCGGGGACTAA 201 GGTAACTGCCACTGACACTGGTTCCAAGCTGCCTGGATCCCCTGGTGGCT
CCATTGACGGTGACTGTGACCAAGGTTCGACGGACCTAGGGGACCACCGA 251 GCCAAAGCCCAGCCGTGGTGAAGTGGGTCAGGGGATCAGAGGTGCATGTT
CGGTTTCGGGTCGGCACCACTTCACCCAGTCCCCTAGTCTCCACGTACAA 301 CCCCACGTGGGCTCCAAACCGCCTTACCTCCCAGAGAAGTGGTCCCTTTC
GGGGTGCACCCGAGGTTTGGCGGAATGGAGGGTCTCTTCACCAGGGAAAG 351 TTCAATGACCGGCCGACCCCTACTACATCCAGGAGAACCTGGTGCAAATG
AAGTTACTGGCCGGCTGGGGATGATGTAGGTCCTCTTGGACCACGTTTAC 401 GGAGCTGCAGCTGGGCTTGGTGCCAGAGGACTTGTTGGTCCCTGGCCTTC
CCTCGACGTCGACCCGAACCACGGTCTCCTGAACAACCAGGGACCGGAAG 451 CTGGACAGCACCTGAAGGAGACGGGCTTCCAGTGGAAGGAATGGTTCACG
GACCTGTCGTGGACTTCCTCTGCCCGAACCTCACCTTCCTTACCAAGTGC 501 G
C





Figure 2-3. Nucleotide sequence of the 501 bp multiprimer insert.






54


Transfection. Fresh Luria broth plates with 50pg/ml ampicillin were prepared as per (Sambrook et al., 1989) for the transfection. Competent cells (INVaF') were incubated at 40C for 30 minutes with 2 tl of beta-mercaptoethanol (PME) and 1 l. of the ligation mixture. The cells were immediately heat-shocked at 420C for 30 see and then further incubated at 4oC for 2 min. To this vial 450~pl of warmed SOC medium was added and incubated at 370C with shaking at 225 rpm. While the cells were shaking, 25 gl of 5bromo-4-chloro-3-indolyl-p3-D-galactopyranoside (X-gal, 40mg/mi) was spread on the Luria broth/ampicillin plates. Either 25 or 100l OO of the transfection reaction mixture was spread on the LB/ampicillin plates, inverted and incubated overnight.

The pCRII has a number of added advantages including classical blue/white selection due to the inclusion of the lacZac complementation fragment as well as ampicillin and kanamycin resistance. All colonies of the transfected bacteria which grow on the plates have been conferred ampicillin resistant through the uptake of the pCRII plasmid. Bacterial colonies which contain pCRII with no insert will be blue while colonies containing pCRII with the insert will be white. The white colonies (and some blue colonies to use as negative controls) were selected for alkali lysis mini-preps.

Determination of positive clones. To determine which of the clones were positive for the 501 bp insert, the colonies were selected as described above, grown up in 5 ml of ampicillin containing LB broth. A mini-plasmid DNA prep (Sambrook et al., 1989) and restriction endonuclease digestions (Sambrook et al., 1989) were performed to identify those clones which contained the multisequence insert. NheI (New England Biolabs, Boston, MA) cuts the 501 bp multisequence insert once at position 183 and does not cut






55

pCRII. By performing a double digest with HindlIl, which cuts pCRII in the multiple cloning site at 277 but not the multisequence insert, it was possible to test for both the presence and orientation of the multisequence insert in pCRII. If the insert was not present, digestion with NheI/HindII would yield the linearized plasmid of 4400 bp. If the insert is present and is in the 5' to 3' orientation, digestion with NheIIHindIII would yield a restriction digest product of 243 bp. If the insert is present and is in the 3' to 5' orientation, digestion with Nhel/HindII would yield a product of 378bp. Digestion with EcoRl, which does not cut the insert or the plasmid but does release the insert, can be used to confirm the presence of the insert. Two clones were identified which contained the multisequence insert and were in the 5' to 3' insert and therefore would use the Sp6 RNA polymerase promoter. In addition, PCR amplification with different pairs of oligonucleotide primers included on the plasmid confirmed that the multisequence insert was intact (the 5' fibronectin, MH61 and the 3' laminin B2, MH74 as well as with all nine pairs of 5' and 3' oligonucleotide primers).

Cesium chloride gradient. Preparation of a large maxi-prep from the positive clones (Sambrook et al., 1989) was performed. Briefly, this involved separating the plasmid and cellular DNA on a cesium chloride (CsCI) ethidium bromide (EtBr) gradient. Centrifugation of the CsCl EtBr gradient was done at 45,000 rpm for 24.5 hrs at 4C using a Beckman VTi50 rotor and L55 ultracentrifuge. The plasmid band was removed from the gradient and collected in 15ml tubes. EtBr was removed through five successive isoamyl alcohol washes until both phases are clear (Sambrook et al., 1989). Finally the residual CsCl was removed from the plasmid DNA by diluting with 3 volumes of sterile






56

water and 2 volumes of 100% ethyl alcohol (EtOH) and centrifuging 10,000 x g for 15 min at 4oC. The resulting pellet was the dissolved in 0.5 ml TE (pH 8.0), recentrifuged at 10,000 x g as above, washed in 70% EtOH, and finally resuspended in 0.5 ml TE. The concentration of the plasmid was determined by measuring the optical density (OD) at 260nm using a Pharmacia GeneQuant (Pharmacia, Uppsala, Sweden).



Engineering and Insertion of a Poly(A) Tail

The orientation of the insert was determined by restriction endonuclease

digestion. Two oligonucleotides were designed to add the poly(A) tail at the XhoI/XbaI sites distal to the Sp6 promoter on pCRII (Tarnuzzer et al., 1996a). The oligonucleotide primers retain the XhoI and XbaI sites as well as add an HindIII site which allowed for confirmation of insertion by restriction digestion. The two oligonucleotides and the arrangement of the 501 bp insert in relationship to pCRII is shown in Figure 2-4.

Two micrograms of the plasmid were linearized overnight at 370C with XboI and XbaI. The products were separated on a 1.5% LMP agarose gel and the linearized plasmid was excised from the gel and allowed to ligate overnight with the poly(A) tail oligonucleotides. The plasmid was transformed using the TA cloning kit (Invitrogen) as previously described. The transformants were plated on LB/ampicillin plates, however, there is no blue/white color selection here since lac is already interrupted by the multisequence insert. To test for the successful insertion of the poly(A) tail, mini-preps were done and the DNA cut with HindlII. Large scale plasmid isolation was done for the positive clones. The plasmid DNA was purified using the Wizard Maxipreps@ DNA









57












0-4 0-4








tu
0

n

0










rQ












cn























to


0



to



to






58

Purification System (Promega, Madison, WI, A7270) and resuspended in 2 ml TE. Concentration of the plasmid was determined by absorbance at 260nm.

The poly(A)-tail containing plasmid was prepared for the Sp6 transcription reaction (Ausubel, 1987) by digesting the plasmid with XbaI and proteinase K. The linearized plasmid was extracted twice with phenol/ chloroform and then precipitated overnight with 2.5 volumes of EtOH at -200C. The plasmid was centrifuged for 15 min at 14,000 rpm, the pellet washed in 70% (v/v) DEPC/EtOH and resuspended in 30gl DEPCtreated water. The RNA template was synthesized using an RNA transcription reaction containing 5pl of 5x buffer (40mM Tris-HCI pH 7.9, 6mM MgCl2, 2mM spermidine, 10mM dithiothreitol, and 10mM NaCl, Promega), l g treated plasmid, 0.5mM ribonucleotides (rNTPs, I pil each at 10mM), 20U RNasin, 10U Sp6 (Promega, P 1085) and 12pl DEPC-treated water. The 25pl reaction was incubated for 1.75 hr and stored at

-200C.



Isolation of Poly(A). RNA

Poly(A) RNA was isolated with a Micro-Fast Track mRNA Isolation kit

(Invitrogen, K1520-02), a modification of a protocol established by Haqqi et al. (1992). Briefly, the Sp6 transcription reaction was diluted up to 1 ml with DEPC-treated water and NaCl was added to 300mM. An oligo-(dT) cellulose pellet was incubated with the RNA and allowed to absorb for 20 minutes at 250 rpm at 370C. The oligo-dT cellulose slurry with absorbed poly(A)+ RNA was pelleted, resuspended in binding buffer, and loaded onto a spin column. The poly(A) RNA was eluted, ethanol precipitated,






59

resuspended in 10pIl DEPC-treated water and quantified by absorbance at 260nm using a GeneQuant spectrophotometer (Pharmacia). Sample calculation:

0.24 pg/ml (OD 260nm) x (gmole/214,500 pg) = 1.1189xl0-6 pmoles/ml or = 1.1189x 10-9 pmoles/gl

where 214,500 = 650 bases x 330 MW

1.1189xl0"9 pmoles/gl x 6.023x 1017 molecules/ tmole = 6.73902 x 1V copies/l. Tenfold serial dilutions of the transcription reaction (102 to 10-9) were made in DEPCtreated water. Quantitative RT-PCR reactions with different dilutions of template should then give a series of reactions which decrease in intensity with decreasing template copy number.


Isolation of Total Cellular RNA

The method of Chirgwin (Chirgwin et al., 1979) was used for isolating total

cellular RNA. Procedures involving experimental animal were performed under protocol number #4206 approved by the Animal Care and Use Committee of the University of Florida. Briefly, timed-pregnant BALB/c mice (days 13 18) were sacrificed by cervical dislocation and fetal submandibular glands were excised and lysed in 2 ml of 4M guanidinium isothiocyanate, 25mM sodium citrate (pH 7.0), 0.5% sarkosyl, and 0.1M 3mercaptoethanol, shearing the samples through a 22 gauge needle, and loading the mixture on top of a 2 ml cushion of 5.7M cesium chloride (CsC1), 0.1M ethylenediaminetetraacetic acid (EDTA) in 10mM Tris-HC1. The CsCl gradient was






60

centrifuged at 35,000 rpm in a Beckman SW 50.1 rotor for 18 hours at 200C. RNA was recovered and stored indefinitely as an ethanol precipitate at -800C.



Quantitative RT-PCR

The protocol for quantitative RT-PCR (Tarnuzzer et al., 1996a) is shown in

Figure 2-5. After the submandibular gland RNA was isolated, cDNA was synthesized in a series of standard 50pl reverse transcription (RT) reactions each containing 1.0ag of total RNA and known dilutions of pMATRIX cRNA (3.7x105 3.7x109 copies), 2.5 lM oligo(dT)16, 1.5mM MgCl2, 200 lM dNTP, 50 U/ml human placental ribonuclease inhibitor (Promega), 10mM Tris-HCI (pH 8.3), 50 mM KCI, and 200 U/Lg RNA Moloney murine leukemia virus reverse transcriptase (MMLV-RT; Gibco-BRL). The reaction was incubated at 250C for 10 min, 420C for 60 min, and 94oC for 5 min.

DNA amplification for each ECM gene was done in standard 50PIl polymerase chain reactions which contained 5l of the RT reaction, 200 pM dNTP, 50 pmoles of each 3' and 5' PCR primer (Table 1), 1.5 mM MgCl2, 10 mM Tris-HCl (pH 8.3), 50mM KC1, and 0.5pl/reaction Taq polymerase (P-E Express, Norwalk, CT; N801-0060). Amplification reactions were carried out in a Biometra thermocycler with 40 sequential cycles at 940C for 1.5 min, 580C for 2 min, and 720C for 3 min, followed by 10 min at 720C for final extension. The 580C temperature was previously determined to be optimal for each of the primer pairs.




















tu 0





m














ON






>









cu
















cu Q





cn (Qu







62














00 < CoC












E~~D








00



asa
Q H




CC 0.0
C: E






63



Separation of Products and Photographing of Gels

PCR products were separated on 1.5% agarose gels containing 25 ng/ml ethidium bromide at IOOV for -2 hours until the template and cellular RNA amplicons were clearly discernible. The gels were photographed for 0.5 seconds using a Polaroid MP-4 Land camera using Type 57 film.

Scanning Image and Final Analysis

Photographs were scanned and digitized on a Hewlett-Packard Ilcx digital scanner and stored as TIFF files on a Macintosh computer. Band intensities were determined using NIH-Image (vl.54). These intensity values were then normalized for their molecular weight. The log of the ratio of band intensities within each lane was plotted against the log of the copy number of template added per reaction. Molecules of target messages were determined where the ratio of template and target band intensities was equal to 1. Use of NIH Image is outlined in Appendix C. Statistical Analysis

All data was statistically analyzed by both Kruskall-Wallis one-sided ANOVA and Newman-Keuls Multiple Comparison Test using Number Cruncher Statistical System version 6.0 (NCSS; Hintze, 1995). For the K-W One-Way ANOVA, the null hypothesis was that all means were equal while the alternate hypothesis was that at least two of the means were different. Data was considered statistically significant at alpha =

0.05.






64



Immunohistochemistr.

Immunohistochemical detection of each ECM protein was performed as

previously described (Chegini et al., 1993). A schematic diagram of the technique is shown in Figure 2-6. The goat anti-human/bovine collagens I, III, and IV polyclonal antibodies used at 1:20 were graciously supplied by Southern Biotechnology Associated (Birmingham, AL). The rabbit anti-mouse laminin B 1/B2 used at 1:2000 was purchased from Upstate Biotechnolgy (Lake Placid, NY). The rabbit anti-mouse fibronectin used at 1:100 was purchased from Chemicon International (Temecula, CA). The rabbit antibovine lysyl oxidase used at 1:500 was generously supplied by Dr. Philip Trackman (Department of Periodontology and Oral Biology, Boston University). The slides were washed with phosphate-buffered saline and incubated for 1 hour at room temperature with either goat anti-rabbit or horse anti-goat biotinylated second antibody conjugate (Vector Laboratories, Burlingame, CA. The stained sections were photographed with an Olympus BH-2 microscope using Normarski interference contrast optics.





































Figure 2-6. Schematic diagram of the immunohistochemical protocol. (adapted from Ausubel, 1987).






66


O tissue specimen

fix overnight in 4% paraformaldehyde dehydrate in ethanol series and xylene embed in paraffin

I~ctme
6 I L cut tissue into 6tm thick sections
dry slides and store indefinitely

I

rehydrate section
inactivate endogenous peroxidase with 3% H202 block non-specific binding with normal serum



S X incubate 3 hrs with primary antibody


wash slide with PBS


O / I incubate I hr with biotinylated secondary antibody

wash slide with PBS

incubate with streptavidin horseradish peroxidase conjugate Z Z IZ add diaminobenzidine and develop for 5-10 min

Stop reaction in water
dehydrate section in a graded alcohol seried and xylene cover sections with cover slip photograph














CHAPTER THREE
RESULTS

Synthesis of pMATRIX



A multiprimer template, pMATRIX, containing oligonucleotide sequences for collagens a2(I), a 1(III), a 1 (IV), fibronectin, laminins B 1 and B2, elastin, and lysyl oxidase has been synthesized according to the procedures described in the Materials and Methods. Using pMATRIX and competition-based quantitative RT-PCR it is possible to quantify the abundance of mRNA corresponding to any of the extracellular matrix genes in human, mouse, or rat tissues.

While constructing pMATRIX, to ensure that the multiprimer insert was complete and intact, all 3' and 5' primers were used to amplify products of the expected size. cRNA of the poly(A)-containing multiprimer insert was transcribed using Sp6 RNA polymerase. Final yields were 3.72 x 10" copies RNA template/pl. Ten-fold serial dilutions were made in DEPC-treated water and standard RT-PCR reactions were performed using 5' and 3' oligonucleotide primers for fibronectin (MH61 and MH62). Products from these reactions, when separated on a 1.5% agarose gel, yielded decreasing amplified product corresponding to the decreased template copy number (data not shown). This simple approach demonstrated that PCR using decreasing template copy number resulted in a decrease in amplification products.



67
































Figure 3-1. Representative composite data for Q-RT-PCR. Actual raw PCR data are
shown for collagen a2(I), fibronectin, and laminin B2 for fetal (days 13-18),
neonatal (days 1, 7, 14, 21, and 28), and adult submandibular glands. The product
sizes are the same as listed in Table 2-1. Reactions in lanes 1-5 contain
decreasing copies of pMATRIX template.








69














Collagen 1.c2 Fibronectin Laminin B2


Fetal 13 I



Fetal 14 Fetal 15 Fetal 16 Fetal 17 Fetal 18 Neonatal 1 Neonatal 7 Neonatal 14 Neonatal 21 Neonatal 28






70


The amount of total RNA recovered from fetal submandibular glands ranged from

1.2 lag RNA/gland to 4.4 pag RNA/gland for days 13 and 18, respectively. The major limitation of these experiments was the availability of fetal mouse salivary gland RNA. Yields of total RNA for neonatal (postnatal days 1, 7, 14, 21, and 28) and adult submandibular glands ranged from 50-300 jig/total RNA/gland and were not limited.



Quantitation of ECM Gene Expression Using pMATRIX

A composite of raw data for Q-RT-PCR from collagen a2(I), fibronectin, and

laminin B2 from fetal day 13 to adult is shown in Figure 3-1. Quantitation is achieved by measuring the area of each PCR generated band, dividing the area by the molecular weight of each band, and plotting the log of the ratio of band intensities over the log of the copies of template. The resulting line should be linear with a slope of 1. A sample calculation for Figures 3-2 and 3-3 is detailed below. The intensities of the Q-RT-PCR products were measured for both the supertemplate and the cellular RNA in Figure 3-2. Lane 3 of the top panel of Figure 3-2 (Laminin B2) has a 677 bp band (RNA) with an area of 567 and a 344 bp band (supertemplate) with an area of 1582. Lane 4 has a 677 bp band with an area of 815 and a 344 bp band with an area of 245. Lane 5 has a 677 bp band with an area of 1506 and a 344 bp band with an area of 91. The band intensities were normalized by dividing the area by the MW such that 567/677 = 0.84, 1582/344 = 4.60, 815/677 = 1.20, 245/344 = 0.71, 1506/677 =2.22 and 91/344 = 0.26. The ratio of band intensities was then calculated (4.60/0.84 = 5.48, 0.71/1.20 = 0.59, and 0.26/2.22








71





04






cq a






















442









tm
4.4
0 UD to






.00 ;To
C 4










rA
4.0








72






10
13 fibronectin day 18

0 laminin B2 day 18

on
0


0 ).........................1.... ......................................



I
0II I
0










Template copy number (copies per cell)





Figure 3-3. Graphed representation of the data from Figure 3-2 with the
log of the ratio of the normalized band intensities plotted against
the log of template copy number 13 fibronectin day 18;
Slaminin B2 day 18.





































































4.






74










jjnpV C4
I- 8Z IMMOON
0
0 0 0
u u u
[Z linguoDN 171 llntUWN LIMVUOQN




I IMPUOON 81 IRIOA P

A Ll lInOd E91 tm;)d 91 19104




171 JRIQJ C 1 IMOA W)


[1a;) jod salmolow VNSLU saidoz)






75


0.12) and finally plotted as the log of these calculated ratios against the log of the starting copy number of the template added to each RT reaction. This should result in a line with a slope of 1. The number of RNA copies was determined from where the line crosses 1. With 26 pg of total RNA per mammalian cell (Bradhorst and McConkey, 1974), the value can then be expressed as copies of RNA per cell.

Using this method of quantitation, the ECM gene expression in developing mouse submandibular glands was measured. This analysis met all requirements previously stated in that the part of the calibration curve used for quantification should be linear and have a slope equal to 1. In practice, a correct standard curve can be considered a strong argument for equal rates of amplification (Raeymaekers, 1994; Raeymaekers, 1995; Siebert, 1993; Siebert and Larrick, 1992).

As shown in Figure 3-4, the number of collagen a2(I), collagen a I (III), and lysyl oxidase mRNA molecules per cell peaked on day 16 of development. For collagen a2(I), the number of copies of mRNA per cell at days 14, 15, 16, and 17 are significantly higher than other days and days 15 and 16 are significant over days 14 and 17 (p < 0.05). Collagen a 1(111) mRNA expression was significantly higher at days 14 and 16 (p < 0.05). Collagen ccl(IV) mRNA expression was below detectable limits except at day 13. The expression of elastin mRNA was only detectable on day 16 of development. Fibronectin and laminin B2 were more constitutively expressed but again had their highest copy number per cell at day 16. The levels of fibronectin mRNA was significant at day 16 above day 18, day 18 above days 15 and 17, and days 15 and 17 significantly higher than all other days (p < 0.05). Laminin mRNA was significantly higher at days 15






76


and 16 over days 14 and 17 with days 14 and 17 significantly higher than other days (p <

0.05). Lysyl oxidase mRNA was significantly higher at day 16 (p < 0.05). The null hypotheses that the means are equal can be rejected at p < 0.0000001 for collagens a2(I), a 1 (III), laminin B2, and lysyl oxidase and p < 0.0000003 for fibronectin. Although not statistically significant, a second smaller burst of ECM gene expression occurred for collagen a2(I), collagen a 1 (III), fibronectin, and laminin B2 at postnatal day 7, with the lowest overall ECM gene expression seen in the mature adult gland.



ECM Protein Localization by Immunohistochemistry in Developing Mouse Submandibular Glands
Immunhistochemistry was performed to localize each of these extracellular matrix proteins in fetal and adult submandibular glands (collagen type I, Figure 3-5A; collagen type III, Figure 3-5B; collagen type IV, Figure 3-5C; fibronectin, Figure 3-5D; laminin, Figure 3-5E; lysyl oxidase, Figure 3-5F. On day 16 of development the fetal tissue has immunoreactive collagen I, collagen III, and fibronectin present throughout the connective tissue between the epithelial lobules. Greater staining was seen in the outer mesenchymal capsule. There is little or no staining for these three proteins within the epithelial lobules. Immunoreactive lysyl oxidase and collagen IV were primarily in the mesenchymal capsule and basement membranes with some lighter staining present throughout the mesenchyme but like collagens I and III and fibronectin, were void in the epithelium. Immunoreactive laminin was present throughout both the mesenchyme, basement membranes, and the epithelium of the developing fetal submandibular glands.


























Figure 3-5. Protein localization for ECM molecules.
a) Each ECM protein was localized in both day 16 developing glands and adult
mouse submandibular by immunohistochemistry. Arrows indicate areas
of more intense staining. Asterisks denote epithelial lobules.
b) Controls for immunohistochemistry. The upper panel is a day 16 gland without
primary antibody while the middle panel is an adult gland without primary
antibody. The bottom panel is H&E staining of a day 16 developing mouse
submandibular gland.






78





Collagen a2(I) Collagen al(III) Collagen ul(IV)










Fetal day 16 Fetal day 16 Fetal day 16

Adult Adult Adult











Fibronectin Laminin Lysyl Oxidase










Fetal day 16 Fetal day 16 Fetal day 16

Adult Adult Adult







79









Controls Day 16 -primary antibody Adult -primary antibody Day 16 H&E Figure 3-5--continued.






80


Controls tissues which were treated with pre-immune sera were completely void of immunoreactive staining.

In the adult, immunoreactive collagen I and lysyl oxidase were present most strongly around the striated duct cells as well as the basal lamina surrounding the acini. There was no staining in the connective tissue septa. Collagen III also exhibited similar but stronger immunoreactive staining in the striated duct cells and in the basal lamina surrounding the acini than collagen I and lysyl oxidase. Immunoreactive fibronectin was most strongly associated with the striated ducts but was also present throughout the acini. Collagen IV was found most concentrated in the basal lamina of the acini and of the striated ducts. Laminin was most present in the striated ducts and basal lamina of the acini.















CHAPTER 4
DISCUSSION


Development of fetal submandibular glands involves the orchestrated expression of extracellular matrix molecules which direct the morphogenesis and cytodifferentiation of the epithelium. These events are highly regulated and coordinated both temporally and spatially (Cutler, 1989). Differentiation of salivary glands begins during fetal development when specific cells of the oral epithelium are induced to undergo organized, coordinated growth and to produce salivary-specific secretory proteins. Following this primary induction, the salivary gland rudiment initiates morphogenesis to develop its unique branching pattern. Once the primary branching patterns has been established, specific cells within the rudiment are induced to amplify the production of these salivaryspecific secretory proteins. These primordial acinar cells modify their shape and their organelle composition to develop an architecture which is optimally suited to the synthesis and secretion of these exocrine products.

The full expression of morphogenesis and cytodifferentiation appears to be modulated or controlled by components of the extracellular matrix. The role of the collagens in submandibular gland development have been described but much less is known about the role of other extracellular matrix molecules. The use of competitionbased quantitative RT-PCR to measure ECM gene expression provides valuable





81






82

information concerning the levels of extracellular matrix genes during the development of mouse submandibular glands.

A recent report measured the temporal levels of some ECM genes in the

developing parotid gland of neonatal rats (Lazowski et al., 1994). In that report standard Northern blot techniques were used which required 30 Ig of total RNA and only relative levels of gene expression could be reported. It is an immense task to collect large quantities of total RNA from developing salivary glands. In comparison, by using competition-based quantitative RT-PCR to obtain quantitative information on each ECM mRNA levels, only 0.1 pg of total RNA per message was needed making it 100-300-fold more sensitive than traditionally used techniques. In addition the technique does not require radioactively-labeled probes and has the added convenience and speed of PCR. Competition-based RT-PCR permits an accurate calculation of the number of mRNA molecules in a sample and also allows for quantitative comparisons between different experiments.

The increases in ECM gene expression observed at both fetal day 16 and neonatal day 7 (Figure 3-4) occur immediately before two important functional changes in submandibular gland development. Beginning on fetal day 18, following the initial morphogenetic stage of salivary gland development, cytodifferentiation, or the initiation of specialized salivary-specific protein synthesis (i.e., amylase and parotid-specific protein) within the branching structure, begins (Poulsen et al., 1986). In addition the expression of muc-1 mucin, which correlates with epithelial differentiation during morphogenesis, is first seen at day 15 in developing mouse submandibular glands (Braga






83

et al., 1992). The dramatic increases in ECM gene expression at day 16 appear to represent the most dramatic changes in morphogenesis and the initiation of cytodifferentiation. Likewise the small peak in ECM gene expression observed at neonatal day 7 occurs just prior to the development of the stimulus/secretion coupling system that occurs at the suckling/weanling transition.

Recently, it was shown that glucocorticoids regulate morphogenesis in several branching organs including salivary glands. Jaskoll et al. (1994) studied the glucocorticoid receptor signal transduction pathway during mouse submandibular gland development and observed an increase in the number of branches in embryos after maternal injections of glucocorticoids. In addition the administration of glucocorticoids in utero enhanced the expression of acinar-cell-specific mucin protein. Another component of this study was the detection of transforming growth factor beta (TGF-p) 1,

2 and 3 mRNA transcripts in embryonic submandibular glands. Northern analysis suggested that the glucocorticoid signal transduction pathway modulates the rate of morphogenesis by regulating TGF-P 2 and 3 mRNA expression. This is an important observation since TGFI3s are known to induce gene expression of extracellular matrix molecules including collagens, fibronectin, elastin, lysyl oxidase and TIMPS, as well as downregulate ECM-degrading enzymes (Macauley et al., 1996c; Massigue, 1991). Glucocorticoids could then indirectly affect the branching morphogenesis by regulating the levels of TGF-3s, which in turn upregulate the expression and deposition of molecules making up the extracellular matrix.






84


Redman (1987) who noted that the high levels of laminin and collagen types a I (IV) and (x 1 (I) expression at the early stages of neonatal parotid gland development may have indicated that the immature acinar and ductal cells and the mesenchyme produce these ECM components at a faster rate than of their mature counterparts in development. This observation has been validated by the quantitation of ECM gene expression in which fetal and neonatal submandibular gland gene expression was much higher than the adult. The changes in laminin and collagen expression suggests the involvement of these components in the profound changes in acinar and ductal cell morphogenesis, proliferation, and differentiation which take place during parotid gland postnatal development (Redman, 1987). The sharp decrease of laminin, collagens type I (IV) and a 1 (I) seen at day 21 coincided with the onset of acinar and ductal cell cytodifferentiation. At this and later ages the basal surface of the cells have nearly contacted each other and the extracellular space has been diminished (Redman, 1987). Therefore one consequence of the decline of laminin and collagens I and IV may be the decrease of ECM due to displacement as the acini and the ductal cells attain proximity at the later stages of development (Lazowski et al., 1994).

Although most basement membranes possess two scaffolding molecules, collagen type IV and laminin, several developing tissues produce basement membranes that initially lack type IV collagen but possess laminin (Cooper and MacQueen, 1983; Leivo et al., 1980). This condition is observed both in the embryo and in capillary growth during tissue repair. Whereas the type IV collagen polymer becomes rapidly cross-linked on formation and is essentially irreversible, the laminin polymer can remain in a






85

reversible state. Laminin, therefore, may be better suited as a matrix scaffolding in basement membranes that are undergoing rapid remodeling. It may be that laminin is the principle polymer of the developing mouse submandibular gland and explains why collagen a 1 (IV) levels were below detection even at day 16 when most ECM gene expression was optimal.

An increase in laminin expression might be expected in rapidly developing

submandibular glands since the migration of fibroblasts has been shown to involve the interaction of the carbohydrate moieties of laminin with cell surface 131,4 galactosyltransferase (GalTase) (Begovac et al., 1994). 131,4 GalTase is expressed in spatially-restricted, cell type-specific domains where it functions as a receptor for extracellular oligosaccharide ligands during migration and has been shown to be present on the leading and trailing edges of migrating cells. In addition it has been shown to bind to specific N-linked oligosaccharides within laminin. Increased expression of laminin as would be expected during highly proliferative stages of development such as the morphogenesis and cytodifferentiation of submandibular glands. Recently it was confirmed that cell-surface GalTase has the highest expression at day 16 fetal mouse submandibular gland development (Oxford et al., 1995).

The immunohistochemical localization of the ECM proteins in mouse

submandibular glands was consistent with earlier reports by Hardman and Spooner (1992), Spooner (1986), and Lazowski (1994). The distribution of the extracellular matrix proteins in both developing and mature salivary glands is shown in Figure 4-1.















































Figure 4-1. Schematic representation of the expression of ECM proteins in developing
mouse submandibular glands. Hatched areas represent the location of
immunoreactive protein.
a) collagen I, collagen III, and collagen IV
b) fibronectin, laminin, and lysyl oxidase








87




Day 16 Adult

mesenchymal capsule
acinar lumen epithelial lobules c acinar units

intercalated duct








Collagen I









Collagen III









Collagen IV








88






Day 16 Adult





Fibronectin ,, *, '"VLaminin S











Lysyl oxidase Figure 4-1 --continued






89


Figure 4-2 reports on the localization of the ECM mRNAs. The work reported here was done to coincide and correlate with the data collected from the quantitative RT-PCR measurements of ECM gene expression. There was a difference noted however. In Hardman and Spooner (1992), laminin was found exclusively restricted to the basement membrane. Figure 3-E however shows laminin, while primarily in the mesenchyme and basement membrane, also present at day 16 in the epithelium. In addition collagen IV was found, like Hardman and Spooner, to be present in basement membrane and the mesenchyme. The existence of basement membrane constituents such as collagen IV and laminin in the interstitial matrixes of developing tissues and embryos is not uncommon but is usually transient (Fitch and Linsenmayer, 1994). The first report of collagen IV not being found exclusively in the basement membrane in sheetlike arrangements was by Chen and Little who demonstrated that collagen IV was synthesized as "short wisplike" fibers by mouse embryonic lung mesenchymal cells and are not found within the basement membrane (Chen and Little, 1985, 1987). Kadoya and Yamashina demonstrated that the epithelium can transiently synthesize basement membrane specific molecules (laminin and collagen IV) before the formation of simple epithelial structures in the morphogenesis of mouse submandibular glands (1989). The transient presence of these molecules, which can be produced by either the epithelia or mesenchyme or both, seems to facilitate interactions between epithelial derived cells and the interstitial matrix during processes that involve tissue rearrangements, movement of individual cells, or anchorage of cells to the matrix.






90

Like the work of Nakanishi and Ishii (1989) and Nakanishi and colleagues (1986, 1988) collagen III appeared to be discontinuous along the epithelial-mesenchymal interface but it did not appear to be more prevalent at the clefts. The same polyclonal antibody (Southern Biotechnology Associates, Inc.) was used for this localization, however Nakanishi concentrated on earlier epithelial formation at days 12 and 13. With this information, Nakanishi proposed a working model on how the mesenchymal cells secrete collagen which exerts mechanical force to the epithelium giving strain to the surface of the epithelial lobule and initiating cleft formation. The temporal increases in collagen a I (III) do suggest that collagen III plays a major role in morphogenesis.

The literature reports that the extracellular matrix and in particular types I, III, and IV collagen, laminin, and chondroitin sulfate proteoglycan play roles in the control of glandular morphogenesis. With the exception of type IV collagen, and possibly laminin however, these molecules do not appear to be involved in the regulation of cytodifferentiation of salivary gland secretory cells. However, of the extracellular matrix molecules tested to date, only type IV collagen appears to play a significant role in the regulation of salivary gland secretory cell differentiation.

The expression of a number of extracellular matrix genes and their message localization in various developing tissues has been reported. (Andujar et al., 1991; Lukinmaa et al., 1993; McDonald and Tuan, 1989; Sarthy, 1993). In embryonic lung morphogenesis, laminin B 1 and B2 was expressed evenly throughout the mesenchymal compartment and was higher in the epithelial buds (Thomas and Dziadek, 1994). Collagen aI(IV) was found throughout the epithelial layer and the mesenchyme. In that




Full Text

PAGE 1

&+$1*(6 ,1 (;75$&(//8/$5 0$75,; *(1( $1' 3527(,1 (;35(66,21 ,1 '(9(/23,1* 0286( 68%0$1',%8/$5 */$1'6 %< 6+$:1 3 0$&$8/(< $ ',66(57$7,21 35(6(17(' 72 7+( *5$'8$7( 6&+22/ 2) 7+( 81,9(56,7< 2) )/25,'$ ,1 3$57,$/ )8/),//0(17 2) 7+( 5(48,5(0(176 )25 7+( '(*5(( 2) '2&725 2) 3+,/2623+< 81,9(56,7< 2) )/25,'$

PAGE 2

WR P\ ZLIH %HWK IRU KHU OLPLWOHVV VDFULILFHV DQG ORYH WKH YHU\ RUGHU FKDQJHV DQG PRYHPHQWV LQ WKH XQLYHUVH WKH YHU\ EHDXW\ RI IRUP LQ DOO WKDW LV YLVLEOH SURFODLP KRZHYHU VLOHQWO\ ERWK WKDW WKH ZRUOG ZDV FUHDWHG DQG DOVR WKDW LWV &UHDWRU FRXOG EH QRQH RWKHU WKDQ *RG ZKRVH JUHDWQHVV DQG EHDXW\ DUH ERWK LQHIIDEOH DQG LQYLVLEOH 6W $XJXVWLQH 7KH &LW\ RI *RG

PAGE 3

$&.12:/('*0(176 RIIHU P\ VLQFHUH JUDWLWXGH WR 'UV 0LFKDHO +XPSKUH\V%HKHU DQG *UHJRU\ 6FKXOW] ZKR KDYH KHOSHG PROG DQG VKDSH P\ XQGHUVWDQGLQJ RI VFLHQFH WKURXJK WKHLU FRPSOHWH VXSSRUW SDWLHQFH DQG JXLGDQFH GXULQJ WKHVH JUDGXDWH VWXGLHV 0\ VLQFHUH WKDQNV DUH H[WHQGHG WR 'UV /LQGD %ULQNOH\ 1 ,QJYDU 0DJQXVVRQ DQG :LOOLDP %XKL PHPEHUV RI P\ FRPPLWWHH IRU WKHLU KHOSIXO VXJJHVWLRQV RYHU WKH SDVW WZR \HDUV $ YHU\ VSHFLDO WKDQN \RX JRHV WR 'U 5LFKDUG %R\FH 'HSDUWPHQW RI %LRFKHPLVWU\ DQG 0ROHFXODU %LRORJ\ ZKR KHOSHG VPRRWK WKH EXPSV DORQJ WKH ZD\ DQG KHOSHG NHHS HYHU\WKLQJ LQ SHUVSHFWLYH $OVR LQVWUXPHQWDO LQ P\ ILQLVKLQJ WKLV GHJUHH SURJUDP LV 'U $UQROG 6 %OHLZHLV &KDLUPDQ RI 2UDO %LRORJ\ ZKR DORQJ ZLWK WKH GHSDUWPHQW IDFXOW\ DOORZHG PH WKH RSSRUWXQLW\ WR MRLQ WKH GHSDUWPHQW ZRXOG DOVR OLNH WR WKDQN 'U *UHJJ 2[IRUG 'U .DPXP 3XUXVKRWKDP 0U 0LFDK .HUU 0V (OL]DEHWK %RZHQ 0U &KULV 5RELQVRQ 0U -DVRQ %UD\HU 0V .LP+RD 1\XJHQ 0V 5DQGL %URYHUPDQ 'U +LGHR
PAGE 4

0V /LQD %XHQR DQG 0U -DPHV .RKOHU ZKR KDYH KHOSHG PDNH WKH JUDGXDWH VWXGHQW H[SHULHQFH YHU\ HQMR\DEOH 6SHFLDO WKDQNV JR WR PHPEHUV RI WKH ,QVWLWXWH IRU :RXQG 5HVHDUFKa'U 1DVVHU &KHJLQL IRU DVVLVWDQFH LQ LPPXQRKLVWRFKHPLVWU\ DQG LQ VLWX K\EULGL]DWLRQ 'U 5R\ 7DPX]]HU IRU DVVLVWDQFH LQ V\QWKHVL]LQJ S0$75,; DQG HVSHFLDOO\ WR 0UV /DQGLV
PAGE 5

7$%/( 2) &217(176 SDJH $&.12:/('*0(176 LLL /,67 2) ),*85(6 YLL $%675$&7 L[ &+$37(56 ,1752'8&7,21 7KH ([WUDFHOOXODU 0DWUL[ 6DOLYDU\ *ODQG 'HYHORSPHQW 6DOLYDU\ *ODQG 0RUSKRJHQHVLV 5ROH RI (SLWKHOLDO0HVHQFK\PDO ,QWHUDFWLRQV LQ 6DOLYDU\ *ODQG 0RUSKRJHQHVLV &RQWULEXWLRQ RI WKH ([WUDFHOOXODU 0DWUL[ WR 6DOLYDU\ *ODQG 0RUSKRJHQHVLV &RQWULEXWLRQ RI *O\FRVDPLQRJO\FDQV WR 6DOLYDU\ *ODQG 0RUSKRJHQHVLV 6DOLYDU\ *ODQG &\WRGLIIHUHQWLDWLRQ 5ROH RI (SLWKHOLDO0HVHQFK\PDO ,QWHUDFWLRQV LQ 6DOLYDU\ *ODQG &\WRGLIIHUHQWLDWLRQ &RQWULEXWLRQ RI WKH ([WUDFHOOXODU 0DWUL[ LQ 6DOLYDU\ *ODQG &\WRGLIIHUHQWLDWLRQ &RQWULEXWLRQ RI *O\FRVDPLQRJO\FDQV LQ 6DOLYDU\ *ODQG &\WRGLIIHUHQWLDWLRQ 6WDWHPHQW RI WKH 3UREOHP *HQH 4XDQWLWDWLRQ 573&5 &RPSHWLWLYH 573&5

PAGE 6

0$7(5,$/6 $1' 0(7+2'6 6\QWKHWLF 6XSHUWHPSODWH S0$75,; &RQVWUXFWLRQ 6HOHFWLRQ RI 2OLJRQXFOHRWLGH 6HTXHQFHV 6\QWKHVLV RI 0XOWLSULPHU 7HPSODWH (QJLQHHULQJ DQG ,QVHUWLRQ RI D 3RO\$f 7DLO ,VRODWLRQ RI 3RO\$f 51$ ,VRODWLRQ RI 7RWDO &HOOXODU 51$ 4XDQWLWDWLYH 573&5 6HSDUDWLRQ RI SURGXFWV DQG SKRWRJUDSKLQJ RI JHOV 6FDQQLQJ LPDJH DQG ILQDO DQDO\VLV 6WDWLVWLFDO DQDO\VLV ,PPXQRKLVWRFKHPLVWU\ 5(68/76 6\QWKHVLV RI S0$75,; 4XDQWLWDWLRQ RI (&0 *HQH ([SUHVVLRQ 8VLQJ S0$75,; (&0 3URWHLQ /RFDOL]DWLRQ E\ ,PPXQRKLVWRFKHPLVWU\ LQ GHYHORSLQJ PRXVH VXEPDQGLEXODU JODQGV ',6&866,21 27+(5 678',(6 $33(1',&(6 $ /LVW RI 2OLJRQXFOHRWLGHV 6\QWKHVL]HG IRU S0$75,; % 5HVWULFWLRQ 0DS RI S0$75,; 0XOWLSULPHU ,QVHUW 5()(5(1&(6 %,2*5$3+,&$/ 6.(7&+ 9,

PAGE 7

/,67 2) ),*85(6 )LJXUH 3DJH 6WUXFWXUH RI ILEULOODU FROODJHQV 6WUXFWXUH RI FROODJHQ W\SH ,9 6WUXFWXUH RI ILEURQHFWLQ 6WUXFWXUH RI ODPLQLQ 6WUXFWXUH RI HODVWLQ &URVVOLQNLQJ UHDFWLRQ FDWDO\]HG E\ O\V\O R[LGDVH 6WUXFWXUH RI JO\FRVDPLQRJO\FDQV ,Q YLWUR GHYHORSPHQW RI D IHWDO PRXVH VXEPDQGLEXODU JODQG 3KRWRJUDSK RI D IUHVKO\ GLVVHFWHG GD\ IHWDO PRXVH VXEPDQGLEXODU JODQG (IIHFWV RI FROODJHQDVH DQG FROODJHQDVH LQKLELWRUV RQ VXEPDQGLEXODU JODQG GHYHORSPHQW 6FKHPDWLF GLDJUDP RI WKH 573&5 PHWKRG $OLJQPHQW RI ROLJRQXFOHRWLGHV WR FUHDWH PXOWLSULPHU LQVHUW 6FKHPH IRU WKH FRQVWUXFWLRQ RI S0$75,; 1XFOHRWLGH VHTXHQFH RI ES PXOWLSULPHU LQVHUW YLL

PAGE 8

&ORQLQJ RI D SRO\$f WDLO WR WKH PXOWLSULPHU LQVHUW *HQHUDO VFKHPH IRU TXDQWLWDWLYH 573&5 H[SHULPHQWV ,PPXQRKLVWRFKHPLVWU\ SURWRFRO 5HSUHVHQWDWLYH FRPSRVLWH GDWD IRU 4573&5 (WKLGLXP EURPLGH VWDLQHG DJDURVH JHOV VKRZLQJ 4573&5 GDWD IRU ODPLQLQ % DQG ILEURQHFWLQ DW GD\ *UDSKLFDO DQDO\VLV RI GDWD &RSLHV RI P51$ SHU FHOO IRU HDFK (&0 JHQH PHDVXUHG RYHU WKH GHYHORSPHQW RI PRXVH VXEPDQGLEXODU JODQGV 3URWHLQ ORFDOL]DWLRQ IRU (&0 PROHFXOHV 6FKHPDWLF UHSUHVHQWDWLRQ RI WKH H[SUHVVLRQ RI (&0 SURWHLQV LQ GHYHORSLQJ PRXVH VXEPDQGLEXODU JODQGV /LVW RI RWKHU SRWHQWLDO VXSHUWHPSODWHV YLLL

PAGE 9

$EVWUDFW RI 'LVVHUWDWLRQ 3UHVHQWHG WR WKH *UDGXDWH 6FKRRO RI WKH 8QLYHUVLW\ RI )ORULGD LQ 3DUWLDO )XOILOOPHQW RI WKH 5HTXLUHPHQWV IRU WKH 'HJUHH RI 'RFWRU RI 3KLORVRSK\ &+$1*(6 ,1 (;75$&(//8/$5 0$75,; *(1( $1' 3527(,1 (;35(66,21 ,1 '(9(/23,1* 0286( 68%0$1',%8/$5 */$1'6 %\ 6KDZQ 3 0DFDXOH\ 0D\ &KDLU 0LFKDHO +XPSKUH\V%HKHU 3K' 0DMRU 'HSDUWPHQW 2UDO %LRORJ\ 6XEPDQGLEXODU JODQG IHWDO GHYHORSPHQW LQYROYHV WKH RUFKHVWUDWHG H[SUHVVLRQ RI H[WUDFHOOXODU PDWUL[ PROHFXOHV (&0f ZKLFK GLUHFW WKH PRUSKRJHQHVLV GLIIHUHQWLDWLRQ DQG EXGGLQJ RI WKH HSLWKHOLXP (DUO\ PRUSKRJHQHVLV RI PRXVH VXEPDQGLEXODU JODQGV EHJLQV RQ ODWH GD\ RI GHYHORSPHQW ZKHQ WKH HSLWKHOLXP EHJLQV WR EXG IURP WKH VXUURXQGLQJ PDQGLEXODU PHVHQFK\PH 6XEPDQGLEXODU JODQGV KDYH WZR EXUVWV RI GHYHORSPHQW RQH LQ WHUR DQG D VHFRQG SRVWQDWDOO\ RFFXUULQJ LQ WKH VXFNOLQJZHDQOLQJ WUDQVLWLRQ )URP WKH VPDOO DPRXQWV RI WRWDO 51$ FROOHFWHG IURP IHWDO %$/%F VXEPDQGLEXODU JODQGV JHQH H[SUHVVLRQ ZDV PHDVXUHG XVLQJ TXDQWLWDWLYH FRPSHWLWLYH 573&5 7R LQYHVWLJDWH WKH FKDQJHV LQ (&0 JHQH H[SUHVVLRQ GXULQJ IHWDO GHYHORSPHQW D PXOWLSULPHU SODVPLG S0$75,;f ZDV FRQVWUXFWHG ZKLFK FRQWDLQV WKH SULPHU ,;

PAGE 10

VHTXHQFHV IRU FROODJHQV D,f DO,,,f DO,9f ILEURQHFWLQ ODPLQLQV % DQG % HODVWLQ DQG O\V\O R[LGDVH 7KH SULPHU VHTXHQFHV ZHUH LGHQWLFDO IRU KXPDQ UDW DQG PRXVH F51$ ZDV V\QWKHVL]HG IURP WKH VXSHUWHPSODWH DQG DGGHG LQ YDU\LQJ NQRZQ DPRXQWV WR D VHULHV RI UHYHUVH WUDQVFULSWLRQ UHDFWLRQV HDFK FRQWDLQLQJ SJ RI WRWDO VXEPDQGLEXODU JODQG 51$ %\ FRPSDULQJ WKH 3&5 DPSOLILFDWLRQ SURGXFWV RI ERWK WKH FHOOXODU P51$ DQG WKH V\QWKHWLF WHPSODWH LW ZDV SRVVLEOH WR PHDVXUH WKH GLUHFW H[SUHVVLRQ RI HDFK JHQH 7KH QXPEHU RI FROODJHQ D,f FROODJHQ DO,,,f DQG O\V\O R[LGDVH P51$ PROHFXOHV SHU FHOO SHDNHG RQ GD\ RI GHYHORSPHQW 7KH H[SUHVVLRQ RI HODVWLQ P51$ ZDV GHWHFWDEOH RQO\ RQ GD\ )LEURQHFWLQ DQG ODPLQLQ % ZHUH PRUH FRQVWLWXWLYH LQ WKHLU H[SUHVVLRQ EXW DJDLQ KDG WKHLU KLJKHVW FRS\ QXPEHU SHU FHOO RQ GD\ $ VHFRQG EXUVW RI (&0 JHQH H[SUHVVLRQ RFFXUUHG LQ WKH QHRQDWH ZLWK WKH ORZHVW (&0 JHQH H[SUHVVLRQ VHHQ LQ WKH PDWXUH DGXOW JODQG ,Q DGGLWLRQ LPPXQRKLVWRFKHPLVWU\ ZDV SHUIRUPHG WR ORFDOL]H WKH SURWHLQ IRU HDFK RI WKH (&0 PROHFXOHV H[DPLQHG :LWK WKH FRQVWUXFWLRQ RI WKH S0$75,; VXSHUWHPSODWH DQG WKH DGYHQW RI FRPSHWLWLYH 573&5 WHFKQRORJ\ LW KDV EHHQ SRVVLEOH WR PHDVXUH VPDOO FKDQJHV LQ (&0 JHQH H[SUHVVLRQ GXULQJ VDOLYDU\ JODQG GHYHORSPHQW 7KLV SODVPLG FDQ EH XWLOL]HG WR H[DPLQH WKH (&0 JHQH H[SUHVVLRQ RI DQ\ KXPDQ PRXVH RU UDW WLVVXH SUHYLRXVO\ WKRXJKW WR EH WRR VPDOO RU OLPLWHG IRU WUDGLWLRQDO WHFKQLTXHV

PAGE 11

&+$37(5 21( ,1752'8&7,21 7KH ([WUDFHOOXODU 0DWUL[ 7LVVXHV DUH QRW PDGH H[FOXVLYHO\ RI FHOOV EXW LQVWHDG GHULYH D VXEVWDQWLDO SDUW RI WKHLU YROXPH IURP WKH H[WUDFHOOXODU VSDFH ZKLFK LV ILOOHG ZLWK DQ LQWULFDWH QHWZRUN RI PDFURPROHFXOHV FRQVWLWXWLQJ WKH H[WUDFHOOXODU PDWUL[ $OEHUWV HW DO f 7ZR PDLQ FODVVHV RI H[WUDFHOOXODU PDFURPROHFXOHV PDNH XS WKH PDWUL[ f ILEURXV SURWHLQV RI WZR IXQFWLRQDO W\SHV PDLQO\ VWUXFWXUDO FROODJHQV DQG HODVWLQf DQG PDLQO\ DGKHVLYH ILEURQHFWLQ DQG ODPLQLQf DQG f JO\FRVDPLQRJO\FDQV K\DOXURQLF DFLG FKRQGURLWLQ VXOIDWH KHSDUDQ VXOIDWH DQG NHUDWDQ VXOIDWHf ZKLFK IRUP D KLJKO\ K\GUDWHG JHOOLNH JURXQG VXEVWDQFH LQ ZKLFK WKH ILEURXV SURWHLQV DUH HPEHGGHG 7KH PDFURPROHFXOHV WKDW FRQVWLWXWH WKH H[WUDFHOOXODU PDWUL[ DUH PDLQO\ SURGXFHG ORFDOO\ E\ ILEUREODVWV LQ WKH PDWUL[ 7KH DVVHPEO\ GLVDVVHPEO\ DQG UHDVVHPEO\ RI H[WUDFHOOXODU PDWULFHV DUH G\QDPLF SURFHVVHV WKDW RFFXU PRVW UDSLGO\ GXULQJ PRUSKRJHQHVLV JURZWK DQG UHSDLU %LUN DQG /LQVHQPD\HU f 7KH H[WUDFHOOXODU PDWUL[ FDQ EH GLYLGHG LQWR DW OHDVW WZR GLVWLQFW FRPSRQHQWV WKH LQWHUVWLWLDO PDWULFHV DQG WKH EDVHPHQW PHPEUDQHV :KHUHDV WKH LQWHUVWLWLDO VWURPD SRVVHVVHV WKLFN DQG ORQJ VWULDWHG FROODJHQ FDEOHV VHSDUDWHG E\ PLFURILODPHQWV DQG K\GUDWHG JO\FRVDPLQRJO\FDQV EDVHPHQW PHPEUDQHV DUH DUUDQJHG LQWR ILQH DQG GHOLFDWH QHWZRUNV %DVHPHQW PHPEUDQHV IRUP WKLQ FRDWV DURXQG PHVHQFK\PDO FHOOV RU VKHHWV XQGHUQHDWK HSLWKHOLDO DQG HQGRWKHOLDO FHOO OD\HUV FDOOHG WKH

PAGE 12

)LJXUH 6WUXFWXUH RI ILEULOODU FROODJHQV &ROODJHQ PROHFXOHV DUH LQLWLDOO\ V\QWKHVL]HG LQ WKH IRUP RI SURD FKDLQV ZKLFK FRQWDLQ H[WUD SURSHSWLGHV RQ ERWK WKH FDUER[\ DQG DPLQR WHUPLQL 7KH ILQDO FROODJHQ PROHFXOH FRQWDLQV RQO\ WKH SRUWLRQ RI WKH SURFROODJHQ PROHFXOH LQ WKH XSSHU EUDFNHW

PAGE 13

1WHUPLQDO SHSWLGHV SURFROODJHQ &WHUPLQDO SHSWLGHV GLVXOILGH OLQNHGf WURSRFROODJHQ FURVVOLQNV FROODJHQ ILEHU VV

PAGE 14

EDVDO ODPLQD
PAGE 15

)LJXUH 6WUXFWXUH RI W\SH ,9 FROODJHQ 7\SH ,9 FROODJHQ DVVHPEOHV LQWR D PXOWLOD\HUHG QHWZRUN ZKLFK IRUPV WKH FRUH RI DOO EDVHPHQW PHPEUDQHV

PAGE 16

PRQRPHUV UDSLG KHDGWRKHDG DVVRFLDWLRQ YLD &WHUPLQDO JOREXODU GRPDLQV O GLPHUV ODWHUDO DVVRFLDWLRQ YLD WULSOH KHOLFDO GRPDLQV WR IRUP D VKHHWOLNH PHVKZRU VKHHWOLNH SRO\JRQDO PHVKZRUN VORZ FRYDOHQW DVVRFLDWLRQV YLD 1WHUPLQDO WDLOV IRUP D VWDFNHG QHWZRUN RI VKHHWV LU ? U PXOWLOD\HUHG QHWZRUN U

PAGE 17

LQWHUUXSWHG LQ D QXPEHU RI UHJLRQV DQG HDFK WULSOHKHOLFDO FKDLQ LV ORQJHU DQG PRUH IOH[LEOH +RIPDQQ HW DO f 5DWKHU WKDQ DVVHPEOLQJ LQWR ILEULOV W\SH ,9 FROODJHQ XVXDOO\ IRUPV D VKHHWOLNH PHVKZRUN E\ IRUPLQJ KHDG WR KHDG GLPHUV WKDW LV IRXQG H[FOXVLYHO\ LQ WKH EDVDO ODPLQDH 7\SH ,9 FROODJHQ GLPHUV DSSHDU WR DVVHPEOH LQLWLDOO\ LQWR D QHWZRUN WKURXJK QRQFRYDOHQW LQWHUDFWLRQV DQG TXLFNO\ EHFRPHV FURVVOLQNHG WKURXJK GLVXOILGHV DQG O\V\O R[LGDVHGHULYHG FRYDOHQW ERQGV )LEURQHFWLQ )LEURQHFWLQFRQWDLQLQJ H[WUDFHOOXODU PDWULFHV SOD\ FULWLFDO UROHV LQ VXFK GLYHUVH SURFHVVHV DV HPEU\RJHQHVLV ZRXQG KHDOLQJ DQG PDOLJQDQW WUDQVIRUPDWLRQ 3HWHUV DQG 0RVKHU f 8QOLNH PRVW RWKHU FRPPRQO\ VWXGLHG H[WUDFHOOXODU PDWUL[ SURWHLQV ILEURQHFWLQ GRHV QRW UHDGLO\ VHOIDVVHPEOH DQG LV WKRXJKW WR LQYROYH LQWHUDFWLRQV DPRQJ ILEURQHFWLQ FHOOVXUIDFH UHFHSWRUV DQG RWKHU PDWUL[ SURWHLQV 3HWHUV DQG 0RVKHU f )LEURQHFWLQ LV D 'D PXOWLIXQFWLRQDO JO\FRSURWHLQ ZKLFK FDQ EH IRXQG DV D VROXEOH SURWHLQ LQ EORRG FHUHEURVSLQDO IOXLG DQG DPQLRWLF IOXLG RU DV DQ LQVROXEOH PROHFXOH LQFRUSRUDWHG LQWR WKH FRQQHFWLYH WLVVXH VWURPD EDVHPHQW PHPEUDQH ERQH FDUWLODJH DQG SODVPD +\QHV f )LEURQHFWLQ VKRZQ LQ )LJXUH LV PDGH IURP WZR VLPLODU 'D VXEXQLWV ZKLFK DUH KHOG WRJHWKHU E\ WZR GLVXOILGH ERQGV DW WKHLU FDUER[\ WHUPLQL .DU HW DO f 1XPHURXV LVRIRUPV RI ILEURQHFWLQ DUH PDGH DV D UHVXOW RI DOWHUQDWH VSOLFLQJ RI WKH ILEURQHFWLQ SUHFXUVRU P51$ DQG FDQ H[LVW DV D KRPRGLPHU RI WZR LGHQWLFDO VXEXQLWV RU DV D KHWHURGLPHU RI WZR VLPLODU EXW XQLGHQWLFDO VXEXQLWV 3HWHUVHQ HW DO f 7KH VXEXQLWV DUH IOH[LEOH DQG FDQ EH IRXQG IXOO\ H[WHQGHG WR IRUP D 9VKDSHG PROHFXOH (PFK HW DO f RU IROGHG LQWR D FRPSDFW JOREXODU PROHFXOH (ULFNVRQ DQG &DUUHOO f )LEURQHFWLQ FDQ ELQG WR PRVW FROODJHQV DV ZHOO DV D QXPEHU

PAGE 18

1+ 1+ )LJXUH 6WUXFWXUH RI ILEURQHFWLQ $ ILEURQHFWLQ GLPHU LV PDGH RI WZR VLPLODU SRO\SHSWLGH FKDLQV DQG DUH MRLQHG E\ WZR GLVXOILGH ERQGV QHDU WKH FDUER[\ WHUPLQXV (DFK FKDLQ LV IROGHG LQWR D VHULHV RI JOREXODU GRPDLQV FRQQHFWHG E\ IOH[LEOH SRO\SHSWLGH VHJPHQWV ,QGLYLGXDO GRPDLQV UHVSRQVLEOH IRU ELQGLQJ FROODJHQ KHSDULQ DQG WKH FHOO DUH VKRZQ

PAGE 19

RI RWKHU (&0 FRPSRQHQWV LQFOXGLQJ KHSDULQKHSDUDQ VXOIDWH ERQH DQG ILEULQ DQG SURPRWHV WKH DWWDFKPHQW RI ILEUREODVWV WR WKH PDWUL[ LQ FRQQHFWLYH WLVVXH (QJYDOO DQG 5RXVODKWL (QJYDOO HW DO -LOHN DQG +RPPDQQ :RRGOH\ HW DO 6DXQGHUV DQG %HPILHOG
PAGE 20

)LJXUH 6WUXFWXUH RI ODPLQLQ 7KH PXLOWLGRPDLQ JO\FRSURWHLQ LV FRPSRVHG RI WKUHH SRO\SHSWLGHV $ % DQG %f DUUDQJHG LQ DQ DVV\PHWULF FURVVOLNH VWUXFWXUH E\ GLVXOILGH ERQGV (DFK RI WKH SRO\SHSWLGHfV FKDLQV LV PRUH WKDQ DPLQR DFLGV LQ OHQJWK

PAGE 21

V\QWKHVL]HG E\ YDULRXV W\SHV RI FHOOV LQFOXGLQJ HSLWKHOLDO DQG HQGRWKHOLDO FHOOV PXVFOH FHOOV DQG ILEUREODVWV &DPSEHOO DQG 7HUUDQRYD 3DXOVVRQ f /DPLQLQ LV DPRQJ WKH HDUOLHVW GHWHFWDEOH (&0 SURWHLQV GXULQJ GHYHORSPHQW DSSHDULQJ DW WKH WZRFHOO HPEU\R VWDJH &RRSHU DQG 0DF4XHHQ ']LDGHN DQG 7LPSO /HLYR HW DO f 0HVVHQJHU 51$ H[SUHVVLRQ VWXGLHV KDYH VKRZQ WKDW YDULRXV ODPLQLQ FKDLQV DUH WHPSRUDULO\ H[SUHVVHG GXULQJ GHYHORSPHQW DQG H[KLELW FHOO DQG WLVVXHVSHFLILF SDWWHUQV RI H[SUHVVLRQ (NEORP HW DO .OHLQ HW DO f /DPLQLQ ELQGV WR W\SH ,9 FROODJHQ KHSDUDQ VXOIDWH SURWHRJO\FDQ DQG KHSDULQ 3DXOVVRQ f /DPLQLQ LQWHUDFWV ZLWK WKH PHPEHUV RI WKH LQWHJULQ FODVV RI WUDQVPHPEUDQH UHFHSWRUV 3DXOVVRQ f ZKLFK DUH NQRZQ WR PHGLDWH WKH VLJQDO WR WKH F\WRVNHOHWRQ LQIOXHQFLQJ FHOOXODU EHKDYLRU HJ SUROLIHUDWLRQ DQG GLIIHUHQWLDWLRQ ,W KDV DOVR EHHQ VXJJHVWHG WKDW ODPLQLQ SOD\V D SDUW LQ LQWHJUDWLQJ VLJQDOLQJ V\VWHPV ZLWK RWKHU UHJXODWRU\ PROHFXOHV VXFK DV JURZWK IDFWRUV 1DWKDQ DQG 6SRP f (ODVWLQ (ODVWLF ILEHUV DUH DPRQJ WKH PRVW FRPSOH[ VWUXFWXUHV RI WKH H[WUDFHOOXODU PDWUL[ UHTXLULQJ DW OHDVW IRXU GLIIHUHQW SURWHLQV WKDW QRW RQO\ GLUHFW SRO\PHUL]DWLRQ RI WKH HODVWLQ PRQRPHU EXW DOVR GHWHUPLQH WKH ILQDO DUFKLWHFWXUH RI WKH ILEHU 0HFKDP DQG 'DYLV f (ODVWLQ LV WKH SUHGRPLQDQW SURWHLQ RI PDWXUH HODVWLF ILEHUV DQG HQGRZV WKH ILEHU ZLWK WKH FKDUDFWHULVWLF SURSHUW\ RI HODVWLF UHFRLO $V LV VKRZQ LQ )LJXUH HODVWLQ LV VHFUHWHG IURP WKH FHOO DV D VROXEOH SUHFXUVRU SURWHLQ RI PROHFXODU ZHLJKW /LNH FROODJHQ D FULWLFDO VWHS LQ WKH PDWXUDWLRQ RI HODVWLQ LQ WKH FRYDOHQW FURVVOLQNLQJ E\ O\V\O R[LGDVH /\VYO R[LGDVH 7KH GHSRVLWLRQ RI FROODJHQ ILEULOV LQWR VSHFLILF VSDWLDO SDWWHUQV UHSUHVHQWV D FHQWUDO SUREOHP LQ PRUSKRJHQHVLV (OXFLGDWLQJ WKH PHFKDQLVPV UHJXODWLQJ

PAGE 22

L UHOD[ VWUHWFK FURVVOLQNV )LJXUH 6WUXFWXUH RI HODVWLQ (ODVWLQ PROHFXODHV DUH KHOG WRJHWKHU E\ FRYDOHQW ERQGV WR JHQHUDWH DQ H[WHQVLYH FURVVOLQNHG QHWZRUN 6RPH RI WKH FRYDOHQW ERQGV DUH JHQHUDWHG E\ O\V\O R[LGDVH

PAGE 23

1+ &+ + &+ +1 &+ &2 &X &+2 1+ +2 &+f +1 &+ &2 SHSWLG\O O\VLQH DDPLQRDGLSLFVHPLDOGHK\GH DOO\VLQH )LJXUH &URVVOLQNLQJ UHDFWLRQ FDWDO\]HG E\ O\V\O R[LGDVH &URVVOLQN IRUPDWLRQ LV LQLWLDWHG E\ WKH R[LGDWLYH GHDPLQDWLRQ RI WKH HDPLQR JURXSV RI VSHFLILF O\V\O DQG K\GUR[\O\V\O UHVLGXHV 7KLV IRUPV UHDFWLYH DOO\V\O DQG K\GUR[\DOO\V\O LQWHUPHGLDWHV ZKLFK XQGHUJR D VHULHV RI VSRQWDQHRXV QRQHQ]\PDWLF FRQGHQVDWLRQ UHDFWLRQV WR IRUP QRYHO FRYDOHQW FURVVOLQNV LQ ERWK FROODJHQV DQG HODVWLQ

PAGE 24

FROODJHQ ILEULO DVVHPEO\ GHSRVLWLRQ DQG JURZWK LV QHFHVVDU\ WR XQGHUVWDQG WKH PDLQWHQDQFH RI VWUXFWXUH DQG WLVVXH IXQFWLRQ GXULQJ GHYHORSPHQW /\V\O R[LGDVH /2f LQLWLDWHV WKH HQ]\PDWLF FURVVOLQNLQJ RI ERWK FROODJHQ DQG HODVWLQ LQ WKH H[WUDFHOOXODU PDWUL[ .DJDQ f /2 LV D FRSSHU DQG S\UROORTXLQROLQH TXLQRQH 344fGHSHQGHQW HQ]\PH ZKLFK FDWDO\]HV WKH R[LGDWLYH GHDPLQDWLRQ RI VDPLQR JURXSV LQ VRPH O\V\O DQG K\GUR[\O\V\O UHVLGXHV RI FROODJHQ DQG LQ O\V\O UHVLGXHV RI HODVWLQ )LJXUH f 6LHJHO f /2 LV VSHFLILF IRU O\V\O UHVLGXHV LQ FROODJHQ DQG HODVWLQ DQG GRHV QRW UHDGLO\ GHDPLQDWH IUHH O\VLQH 6LHJHO HW DL f 7KH GHDPLQDWLRQ RI O\V\O UHVLGXHV UHVXOWV LQ WKH IRUPDWLRQ RI UHDFWLYH DOGHK\GHV DOO\VLQH RU K\GUR[\DOO\VLQH LI WKH VXEVWUDWH UHVLGXHV DUH O\VLQH RU K\GUR[\O\VLQH UHVSHFWLYHO\f WKDW QRQHQ]\PDWLFDOO\ DQG VSRQWDQHRXVO\ FRQGHQVH ZLWK O\V\O RU K\GUR[\O\VLQH UHVLGXHV LQ DGMDFHQW FROODJHQ DQG HODVWLQ PROHFXOHV WR IRUP LQWUD DQG LQWHUFKDLQ GLYDOHQW FURVVOLQNV 6ROXEOH SURFROODJHQ DQG SURHODVWLQ VHFUHWHG LQWR WKH H[WUDFHOOXODU PDWUL[ LV UHQGHUHG LQVROXEOH WKURXJK WKH FURVVOLQNLQJ DFWLYLW\ RI /2 7KH FURVVOLQNDJHV RI FROODJHQ DQG HODVWLQ FRQWULEXWH VLJQLILFDQWO\ WR WKH HODVWLF SURSHUWLHV DQG WHQVLOH VWUHQJWK RI OXQJ YDVFXODU DQG FRQQHFWLYH WLVVXHV 7KH UDWLR RI FROODJHQ WR O\V\O R[LGDVH DQG GLIIHUHQW SDWWHUQV RI WHPSRUDO H[SUHVVLRQ DUH WKRXJKW WR EH LPSRUWDQW LQ LQIOXHQFLQJ WKH FKDUDFWHU RI WKH PDWUL[ %LUN DQG /LQVHQPD\HU f *OYFRVDPLQRJO\FDQV *O\FRVDPLQRJO\FDQV *$*6f DUH ORQJ XQEUDQFKHG SRO\VDFFKDULGH FKDLQV FRPSRVHG RI UHSHDWLQJ GLVDFFKDULGH XQLWV ZLWK RQH XQLW DOZD\V EHLQJ HLWKHU $DFHW\OJOXFRVDPLQH RU $DFHW\OJDODFWRVDPLQH FRYDOHQWO\ OLQNHG WR D FRUH SURWHLQ )LJXUH f *$*6 DUH KLJKO\ QHJDWLYHO\ FKDUJHG DWWUDFWLQJ FDWLRQV ZKLFK PDNH WKHP KLJKO\ K\GURSKLOLF WKXV RFFXS\LQJ YHU\ ODUJH YROXPHV FRPSDUHG WR WKHLU PDVV 7KH

PAGE 25

L,_LL,_nL nnL nnLnnn nO n9OnO K\DOXURQLF DFLG OLQN SURWHLQ NHUDWDQ VXOIDWH FKRQGURLWLQ VXOIDWH FRUH SURWHLQ LL L -/O-/ UUU L nLn LnOL nL ‘nL LnL_LnL_LnL_LLL ,7 3URWHRJO\FDQ DJJUHJDWH )LJXUH 6WUXFWXUH RI JO\FRVDPLQRJO\FDQV 6FKHPDWLF GUDZLQJ RI D SURWHRJO\FDQ DJJUHJDWH FRQVLVWV RI DSSUR[LPDWHO\ SURWHRJO\FDQ PRQRPHUV QRQFRYDOHQWO\ ERXQG WR D VLQJOH K\DOXURQLF FKDLQ 7KH SURWHRJO\FDQV DUH DWWDFKHG WR WKH K\DOXURQLF DFLG FKDLQ E\ OLQN SURWHLQV

PAGE 26

DPRXQW RI *$*6 LQ FRQQHFWLYH WLVVXH LV XVXDOO\ OHVV WKDQ b E\ ZHLJKW RI WKH ILEURXV SURWHLQV EXW EHFDXVH WKH\ IRUP SRURXV K\GUDWHG JHOV *$* FKDLQV ILOO PRVW RI WKH H[WUDFHOOXODU VSDFH WKXV SURYLGLQJ PHFKDQLFDO VXSSRUW WR WLVVXHV ZKLOH VWLOO DOORZLQJ WKH UDSLG GLIIXVLRQ RI ZDWHUVROXEOH PROHFXOHV DQG WKH PLJUDWLRQ RI FHOOV 6DOLYDU\ *ODQG 'HYHORSPHQW 6DOLYDU\ JODQGV SURYLGH D PRGHO V\VWHP WR VWXG\ PDQ\ ELRORJLFDO SKHQRPHQD LQFOXGLQJ VWUXFWXUH DQG UHJXODWLRQ RI OLYLQJ V\VWHPV )HWDO VDOLYDU\ JODQGV KDYH EHHQ XWLOL]HG IRU \HDUV DV D PRGHO IRU PDPPDOLDQ GHYHORSPHQW 1DNDQLVKL HW DO f 7KH PDMRU VDOLYDU\ JODQGV LH WKH SDURWLG VXEPDQGLEXODU DQG VXEOLQJXDO JODQGV DUH ODUJH SDLUHG RUJDQV WKDW OLH RXWVLGH WKH RUDO FDYLW\ SURSHU DQG ZKLFK FRPPXQLFDWH ZLWK WKH RUDO PXFRVD WKURXJK PDMRU GXFWV 6DOLYDU\ JODQGV DUH DQ LGHDO V\VWHP WR VWXG\ GHYHORSPHQW EHFDXVH WKH\ DUH DQDWRPLFDOO\ GLVWLQFW DQG DV WKH\ GHYHORS EHJLQ WR V\QWKHVL]H DQG VHFUHWH XQLTXH VDOLYDU\VSHFLILF SURWHLQV ,Q WKH PRXVH WKH HDUOLHVW HYLGHQFH RI VXEPDQGLEXODU JODQG PRUSKRJHQHVLV EHJLQV RQ ODWH GD\ RI GHYHORSPHQW ZLWK D IRFDO FOXVWHULQJ RI WKH SULPLWLYH RUDO HSLWKHOLXP ZKLFK SXVKHV LQWR WKH VXUURXQGLQJ PHVHQFK\PH 6LPXOWDQHRXVO\ WKH DGMDFHQW PHVHQFK\PDO FHOOV EHFRPH PRUH QXPHURXV DQG FRQGHQVH 7KH HSLWKHOLXP SUROLIHUDWHV DQG EHJLQV WR EXG IURP WKH VXUURXQGLQJ PDQGLEXODU PHVHQFK\PH RQ GD\ 7KLV RFFXUV ZKHQ FOHIWV IRUP LQ WKH GLVWDO HQG RI WKH WHUPLQDO EXOE ZKLFK GHHSHQ XQWLO WZR RU PRUH FOHIWV KDYH GHYHORSHG IURP WKH RULJLQDO 7KLV IRUPV D FOXEVKDSHG VWUXFWXUH VXUURXQGHG E\ D EDVHPHQW PHPEUDQH DQG D WKLQ OD\HU

PAGE 27

RI RULHQWHG PHVHQFK\PH 7KH GXFWV DQG DOYHRODU FRPSRQHQWV RI WKH JODQGV DUH HSLWKHOLDO RXWJURZWKV ZKLOH WKH VWURPD DQG EORRG YHVVHOV DUH RI PHVHQFK\PDO RULJLQ 2Q GD\ WKH JODQGV EHJLQ WR UHVHPEOH WKH IDPLOLDU VWDON DQG EUDQFK PRUSKRORJ\ DQG FDQ EH UHPRYHG E\ PLFURGLVVHFWLRQ 7KH PLQRU VDOLYDU\ JODQGV EHJLQ GHYHORSPHQW DV SUROLIHUDWLRQV RI RUDO HSLWKHOLXP LQ D IDVKLRQ VLPLODU WR WKH PDMRU VDOLYDU\ JODQGV 7KH PRVW H[WHQVLYH HDUO\ VWXGLHV RQ WKH HPEU\RQLF GHYHORSPHQW RI VDOLYDU\ JODQGV ZHUH FDUULHG RXW LQ WKH SLJ &KLHYLW] )OLQW .DOOLXV 0RUDO D 0RUDO Ef LQ WKH PRXVH 0RUDO 0RUDO f DQG PRUH UHFHQWO\ DQG PRUH SUHFLVHO\ LQ WKH UDW &XWOHU DQG &KDXGKU\ D &XWOHU DQG &KDXGKU\ E &XWOHU DQG &KDXGKU\ &XWOHU DQG &KDXGKU\ 5HGPDQ DQG 6UHHEQ\ D 5HGPDQ DQG 6UHHEQ\ Ef 7KH OLWHUDWXUH RQ VDOLYDU\ JODQG GHYHORSPHQW KDV EHHQ GLIILFXOW WR FRPSDUH VLQFH 5HGPDQ DQG 6UHHEQ\ 5HGPDQ DQG 6UHHEQ\ Df UHIHU WR WKH GD\ DIWHU PDWLQJV DV fGD\ ]HURf ZKHUHDV &XWOHU DQG &KDXGKU\ &XWOHU DQG &KDXGKU\ Df GHILQH WKH GD\ DIWHU PDWLQJ DV fWKH ILUVW GD\f VR WKDW DSSDUHQW GLVFUHSDQFLHV EHWZHHQ WKH WZR VWXGLHV DULVH
PAGE 28

DQG DFFXPXODWLRQ RI VHFUHWRU\ JUDQXOHV DQG RWKHU RUJDQHOOHV DVVRFLDWHG ZLWK WKH V\QWKHVLV VWRUDJH DQG VHFUHWLRQ RI VSHFLDOL]HG VDOLYDU\VSHFLILF SURWHLQ ZLWKLQ WKH EUDQFKLQJ VWUXFWXUH f GHYHORSPHQW RI WKH VWLPXOXVVHFUHWLRQ FRXSOLQJ V\VWHP E\ WKH SDUDV\PSDWKHWLF DQG V\PSDWKHWLF EUDQFKHV RI WKH DXWRQRPLF QHUYRXV V\VWHP DQG WKH DFTXLVLWLRQ E\ WKH JODQGXODU HSLWKHOLD RI UHFHSWRUV WR WKH QHXURWUDQVPLWWHUV RI WKHVH QHUYHV ZKLFK WRJHWKHU WUDQVGXFH H[WHUQDO VWLPXOL LQWR D VHFUHWRU\ UHVSRQVH E\ WKH VHFUHWRU\ FHOOV DQG f WKH DQDWRPLFDO FRXSOLQJ RI WKH V\PSDWKHWLF QHUYHV WR EHJLQ WKH VHFUHWLRQ RI VDOLYDU\ IOXLGV DQG SURWHLQV 5HGPDQ f ,Q WKLV UHSRUW WKH HIIHFWV RI WKH H[WUDFHOOXODU PDWUL[ RQ WKH ILUVW WZR HYHQWV PRUSKRJHQHVLV DQG F\WRGLIIHUHQWLDWLRQ ZLOO EH GLVFXVVHG 6DOLYDU\ *ODQG0RUSKRJHQHVLV 5ROH RI (SLWKHOLDO0HVHQFK\PDO ,QWHUDFWLRQV LQ 6DOLYDU\ *ODQG 0RUSKRJHQHVLV &ODVVLFDO VWXGLHV RI H[SHULPHQWDO HPEU\RORJ\ GHPRQVWUDWHG WKDW YHUWHEUDWH RUJDQ GHYHORSPHQW GHSHQGV RQ VHTXHQWLDO DQG UHFLSURFDO LQWHUDFWLRQV EHWZHHQ WLVVXH OD\HUV *UREVWHLQ F 6D[Q HW DL 6SHPDQ DQG 0DQJROG f 7KHVH LQGXFWLYH LQWHUDFWLRQV RU VHFRQGDU\ LQGXFWLRQVf RFFXU EHWZHHQ HSLWKHOLDO DQG PHVHQFK\PDO WLVVXHV DQG WKH\ OHDG WR GLIIHUHQFHV EHWZHHQ FHOOV DQG WR WKH RUJDQL]DWLRQ RI FHOOV LQWR WLVVXHV DQG RUJDQV 9DLQLR HW DO f 7KHUH LV OLPLWHG LQIRUPDWLRQ DYDLODEOH FRQFHUQLQJ WKH PROHFXOHV LQYROYHG LQ WKH LQGXFWLRQ DQG UHJXODWLRQ RI WKH LQLWLDO HYHQWV LQ VDOLYDU\ JODQG GHYHORSPHQW &XWOHU f )LJXUH VKRZV WKH HDUO\ LQ YLWUR GHYHORSPHQW RI PRXVH VXEPDQGLEXODU JODQGV 7KH LPSRUWDQW UROH RI WKH PHVHQFK\PDO FDSVXOH LQ WKH UHJXODWLRQ RI WKH GHYHORSPHQW RI

PAGE 29

WKH HSLWKHOLDO SDUW RI WKH VXEPDQGLEXODU JODQG ZDV ILUVW QRWHG E\ %RUJKHVH %RUJKHVH f ZKHQ KH REVHUYHG WKDW EUDQFKLQJ PRUSKRJHQHVLV DQG JURZWK RI WKH VXEPDQGLEXODU JODQG UXGLPHQW LQ YLWUR ZDV LQKLELWHG LI WKH VXUURXQGLQJ PHVHQFK\PDO FDSVXOH )LJXUH f ZDV UHPRYHG 7KLV REVHUYDWLRQ ZDV FRQILUPHG DQG H[SDQGHG E\ *UREVWHLQ D E Ff ZKR VKRZHG WKDW WKH SRWHQWLDO IRU EUDQFKLQJ PRUSKRJHQHVLV UHVLGHG SUHGRPLQDQWO\ LQ WKH HQGEXGV ZKLOH WKH VWDON RI GXFW KDG RQO\ OLPLWHG FDSDFLW\ IRU EUDQFKLQJ ,Q DGGLWLRQ LQ QRZ FODVVLFDO LQ YLWUR WUDQVILOWHU H[SHULPHQWV *UREVWHLQ Ff GHPRQVWUDWHG WKDW WKH LQGXFWLRQ RI EUDQFKLQJ PRUSKRJHQHVLV DSSHDUHG WR EH GHSHQGHQW XSRQ D GLIIXVLEOH PDFURPROHFXOH ZKLFK ZDV SURGXFHG E\ WKH FDSVXODU PHVHQFK\PH ([SHULPHQWV LQ ZKLFK WKH PHVHQFK\PDO DQG HSLWKHOLDO HOHPHQWV RI VDOLYDU\ JODQG UXGLPHQWV ZHUH VHSDUDWHG E\ JHQWOH HQ]\PDWLF GLJHVWLRQ WKHQ JURZQ LQ YLWUR LQ YDULRXV FRPELQDWLRQV IURP D GLIIHUHQW JODQG HVWDEOLVKHG WKDW LQ JHQHUDO VDOLYDU\ JODQGV DUH KLJKO\ VHOHFWLYH ZLWK UHJDUG WR WKH VRXUFHV RI PHVHQFK\PH WKDW ZLOO VXSSRUW WKHLU JURZWK DQG GLIIHUHQWLDWLRQ %DOO /DZVRQ f %HPILHOG DQG FRZRUNHUV f H[DPLQHG WKH UHFLSURFDO LQWHUDFWLRQV EHWZHHQ WKH PRXVH HPEU\R VXEPDQGLEXODU HSLWKHOLXP DQG PHVHQFK\PH DQG IRXQG WKDW WKH LQWHUDFWLRQV PRGLI\ WKH FRPSRVLWLRQ DQG PHWDEROLVP RI WKH EDVHPHQW PHPEUDQH 7KH\ GHPRQVWUDWHG WKDW WKH PHVHQFK\PH UHPRGHOV WKH EDVHPHQW PHPEUDQH %0f E\ GHSRVLWLQJ D FROODJHQ W\SH ,ULFK PDWUL[ RQ WKH EDVDO ODPLQD DQG E\ SURGXFLQJ D K\DOXURQLGDVH ZKLFK GHJUDGHV K\DOXURQDWH DQG FKRQGURLWLQ VXOIDWH 6LPLODUO\ %0 UHPRGHOLQJ PD\ EH D JHQHUDO SURFHVV IRU UHJXODWLQJ FHOO EHKDYLRU GXULQJ RWKHU DVSHFWV RI GHYHORSPHQW 7R FODULI\ ZKHWKHU WKH HORQJDWLRQ DQG EUDQFKLQJ PRUSKRJHQHVLV RI VDOLYDU\ JODQGV LV GLUHFWHG E\ WKH HSLWKHOLXP RI WKH

PAGE 30

UR R )LJXUH ,Q YLWUR GHYHORSPHQW RI D IHWDO PRXVH VXEPDQGLEXODU JODQG $ GHYHORSLQJ VDOLYDU\ JODQG ZDV UHPRYHG DW GD\ IURP D %$/%F IHWXV 7KH JODQG ZDV FXOWXUHG LQ '0(0 ZLWK b )&6 7KH HDFK SDQHO UHSUHVHQWV WKH VDPH JODQG DW XSSHU OHIWf XSSHU PLGGOHf XSSHU ULJKWf ORZHU OHIWf ORZHU PLGGOHf DQG ORZHU ULJKWf KRXUV

PAGE 31

)LJXUH 3KRWRJUDSK RI D IUHVKO\ GLVVHFWHG GD\ IHWDO PRXVH VXEPDQGLEXODU JODQG 7KH VXEPDQGLEXODU JODQG HSLWKHOLXP LV HPEHGGHG E\ WKH GDUNHU DSSHDULQJ PHVHQFK\PDO FDSVXOH

PAGE 32

PHVHQFK\PH 1RJDZD DQG 0L]XQR f GHPRQVWUDWHG E\ UHFRPELQDWLRQDO H[SHULPHQWV WKDW WKH HORQJDWLQJ DQG EUDQFKLQJ PRUSKRJHQHVLV RI TXDLO VDOLYDU\ JODQGV LV FRQWUROOHG E\ WKH PHVHQFK\PH ,W KDV EHHQ FOHDUO\ GHPRQVWUDWHG WKDW WKH PHVHQFK\PDO FDSVXOH VXUURXQGLQJ WKH HSLWKHOLDO SRUWLRQ RI WKH VDOLYDU\ JODQG GLUHFWO\ FRQWUROV WKH GHYHORSPHQW RI WKH EUDQFKLQJ SDWWHUQ VHHQ LQ WKH GHYHORSLQJ JODQGV /DZVRQ *UREVWHLQ D E F %HPILHOG HW DO &RKQ HW DO f 7KH PHVHQFK\PH DSSHDUV WR H[HUFLVH WKLV FRQWURO WKURXJK WKH VHOHFWLYH SURGXFWLRQ DQG GHVWUXFWLRQ RI VSHFLILF H[WUDFHOOXODU PDWUL[ PROHFXOHV >%HPILHOG HW DO 7KRPSVRQ DQG 6SRRQHU 6SRRQHU HW DO *UREVWHLQ D E Ff 7KHVH H[WUDFHOOXODU PDWUL[ PROHFXOHV DUH GHSRVLWHG LQ DQG QHDU WKH EDVDO ODPLQD ZKLFK VHUYHV DV WKH LQWHUIDFH EHWZHHQ WKH HSLWKHOLDO FHOOV DQG WKHLU LQYHVWLQJ PHVHQFK\PDO FDSVXOH %RUJKHVH f DQG *UREVWHLQ Ef VKRZHG WKDW PHFKDQLFDO RU HQ]\PDWLF UHPRYDO RI WKH VXUURXQGLQJ VXEPDQGLEXODU PHVHQFK\PH UHGXFHG RU HOLPLQDWHG WKH VXEVHTXHQW HSLWKHOLDO EUDQFKLQJ LQ FXOWXUH +RZHYHU UHFRPELQDWLRQ RI WKH VHSDUDWHG PHVHQFK\PH DQG HSLWKHOLXP EURXJKW DERXW IXUWKHU SURSHU PRUSKRJHQHVLV 7KLV HSLWKHOLDOPHVHQFK\PDO LQWHUDFWLRQ LV WKRXJKW WR EH DFKLHYHG WKURXJK WKH DFWLRQ RI H[WUDFHOOXODU PDWUL[ FRPSRQHQWV LQFOXGLQJ EDVDO ODPLQD ORFDWHG EHWZHHQ WKH HSLWKHOLXP DQG PHVHQFK\PH 7KHVH FRPSRQHQWV LQFOXGH FROODJHQ SURWHRJO\FDQ ILEURQHFWLQ DQG ODPLQLQ 7UHOVWDG f +RZHYHU RQH RI WKH GLIILFXOWLHV LQ HOXFLGDWLQJ WKH SUHFLVH SK\VLRORJLFDO IXQFWLRQ RI WKHVH PROHFXOHV LV WKDW PRVW LI QRW DOO RI WKHP H[LVW DV D VWXUG\ PXOWLPROHFXODU FRPSOH[ LQ D VROLG VWDWH $OWKRXJK WKH LPSRUWDQFH RI HSLWKHOLDO

PAGE 33

PHVHQFK\PDO LQWHUDFWLRQV IRU WKH GHYHORSPHQW RI PRVW RUJDQV LV ZHOO HVWDEOLVKHG WKH DFWXDO PHFKDQLVPV LQYROYHG LQ PHGLDWLRQ RI LQGXFWLYH VLJQDOV DUH RQO\ VWDUWLQJ WR EH HOXFLGDWHG &RQWULEXWLRQ RI WKH ([WUDFHOOXODU 0DWUL[ LQ 6DOLYDU\ *ODQG 0RUSKRJHQHVLV 7KH PRXVH HPEU\RQLF VXEPDQGLEXODU JODQG LV DQ LQWHUHVWLQJ DQG XVHIXO PRGHO IRU VHYHUDO UHDVRQV IRU DQDO\]LQJ WKH PHFKDQLVPV RI HSLWKHOLDO EUDQFKLQJ 7KH UXGLPHQW FDQ EH FXOWXUHG RQ D 0LOOLSRUH ILOWHU RU DJDU DQG WKH FKDQJH LQ HSLWKHOLDO VKDSH LV HDVLO\ IROORZHG LQ WKH OLYLQJ VWDWH ZLWK OLJKW PLFURVFRS\ 6HFRQGO\ WKH HSLWKHOLXP DQG PHVHQFK\PH DUH UHDGLO\ VHSDUDWHG IURP HDFK RWKHU E\ EULHI WUHDWPHQW ZLWK FROODJHQDVH RU RWKHU SURWHDVHV D SURSHUW\ WKDW PDNHV YDULRXV UHFRPELQDWLRQDO H[SHULPHQWV SRVVLEOH 7KLUGO\ EHFDXVH RI WKH DEVHQFH RI WKH PHVRWKHOLDO OD\HU RXWVLGH WKH PHVHQFK\PH SURWHLQDFHRXV IDFWRUV DGGHG LQ FXOWXUH PHGLXP HJH[WUDFHOOXODU PDWUL[ PROHFXOHn GHJUDGLQJ HQ]\PHVf TXLFNO\ GLIIXVH LQWR WKH WLVVXHV 1DNDQLVKL DQG ,VKLL f 7KH (&0 FDQ EH IXQFWLRQDOO\ GLYLGHG LQWR WKH EDVHPHQW PHPEUDQH D FRQWLQXRXV OD\HU XQGHUO\LQJ DOO HSLWKHOLD DQG LQWHUVWLWLDO PDWUL[ ZKLFK IRUPV WKH QRQFHOOXODU SDUW RI WKH PHVHQFK\PDO VWURPD (DFK FRPSDUWPHQW KDV D GLVWLQFW VHW RI H[WUDFHOOXODU PDWUL[ PDFURPROHFXOHV )RU H[DPSOH EDVHPHQW PHPEUDQHV FRQWDLQ FROODJHQ W\SH ,9 KHSDUDQ VXOIDWH SURWHRJO\FDQ DQG ODPLQLQ ZKLOH LQWHUVWLWLDO PDWUL[ JHQHUDOO\ FRQWDLQV PL[WXUHV RI FROODJHQ W\SHV DQG ,,, FKRQGURLWLQ VXOIDWH SURWHRJO\FDQ DQG ILEURQHFWLQ 7KH UROH RI WKH H[WUDFHOOXODU PDWUL[ LQ WKH HPEU\RORJLFDO GHYHORSPHQW RI WKH PRXVH VDOLYDU\ JODQGV KDV EHHQ LQLWLDOO\ H[SORUHG $V HDUO\ DV LW ZDV WKRXJKW WKDW

PAGE 34

FROODJHQ LQKLELWHG RU UHWDUGHG FHOOXODU JURZWK f§ VHUYLQJ HLWKHU DV DQ DQFKRU RU DV D VWDELOL]DWLRQ SRLQW DURXQG ZKLFK QRQVWDELOL]HG FHOOV ZRXOG SUROLIHUDWH JLYLQJ ULVH WR QHZ EUDQFKHV *UREVWHLQ DQG &RKHQ f &ROODJHQ DSSHDUHG WR VHUYH DV D VWDELOL]LQJ FRPSRQHQW ZKLFK LQKLELWHG FHOO JURZWK LQ VSHFLILF DUHDV RI WKH JURZLQJ UXGLPHQW ZKLOH RWKHU DUHDV ZHUH GHYRLG RI FROODJHQ DQG WKXV DEOH WR JURZ 7KH VWDELOL]HG DUHDV FRXOG WKHUHIRUH VHUYH DV EUDQFK SRLQWV IURP ZKLFK PRUSKRJHQHWLFDOO\ DFWLYH FHOOV JDYH ULVH WR QHZ EUDQFKHV 7KHVH ZRUNV RI *UREVWHLQ DQG &RKHQ VXJJHVWHG WKDW FROODJHQ FRXOG UHGXFH FHOO JURZWK DW WKH EUDQFK SRLQW DQG VHUYH DV DQ DQFKRU SRLQW IURP ZKLFK FHOOV QRW LQKLELWHG E\ FROODJHQ FRXOG XQGHUJR PLWRVLV DQG GHYHORS LQWR QHZ EUDQFKHV ,W ZDV DOVR SRVWXODWHG WKDW VRPH W\SH RI ORFDOL]HG FROODJHQRO\WLF DFWLYLW\ PLJKW EH LQYROYHG DW WKH SRLQWV RI JURZWK WR IUHH VRPH FHOOV IURP WKH VWDELOL]LQJ HIIHFW RI FROODJHQ &ROODJHQ LV SUHVHQW LQ WKH PHVHQFK\PH DQG RQ WKH HSLWKHOLDO VXUIDFH HVSHFLDOO\ RQ WKH FOHIW DQG VWDON UHJLRQV DQG LV DQ LPSRUWDQW PROHFXOH LQ WKH EUDQFKLQJ PRUSKRJHQHVLV RI WKH VDOLYDU\ JODQG 6SRRQHU DQG )DXELRQ f 7R VKRZ WKDW FROODJHQ ZDV LPSRUWDQW LQ HSLWKHOLDO EUDQFKLQJ 6SRRQHU DQG )DXELRQ f XVHG /D]HWLGLQH FDUER[\OLF DFLG DQG DDfGLS\ULG\O LQKLELWRUV IRU FROODJHQ V\QWKHVLV DQG VHFUHWLRQ WR LQWURGXFH FROODJHQRO\WLF DFWLYLW\ LQ WKH VDOLYDU\ JODQG 3UHYLRXV ZRUN XVLQJ EDFWHULDO FROODJHQDVH SUHSDUDWLRQV *UREVWHLQ DQG &RKHQ :HVVHOV DQG &RKHQ f ZHUH SRVVLEO\ REVFXUHG GXH WR WKH SUREDEOH FRQWDPLQDWLRQ RI PXFRSRO\VDFFKDULGDVHV %HPILHOG DQG %DQHUMHH f 1DNDQLVKL DQG FRZRUNHUV f DOVR VKRZHG WKDW FROODJHQ ZDV DQ LPSRUWDQW H[WUDFHOOXODU PDWUL[ SURWHLQ LQ WKH UHJXODWLRQ RI FOHIW IRUPDWLRQ LQ WKH VDOLYDU\

PAGE 35

HSLWKHOLXP WKURXJK WKH XVH RI D FROODJHQDVH ,Q WKDW VWXG\ FROODJHQDVH IURP &ORVWULGLXP KLVWRO\WLFXP ZDV VKRZQ WR LQKLELW FOHIW IRUPDWLRQ ZKLOH D FROODJHQDVH LQKLELWRU LVRODWHG IURP WKH FXOWXUH PHGLXP RI ERYLQH GHQWDO SXOS .LVKL DQG +D\DNDZD f QRZ WKRXJKW WR EH D WLVVXH LQKLELWRU RI PHWDOORSURWHLQDVHV 7,03f VWLPXODWHG PXOWLSOH FOHIW IRUPDWLRQV E\ VSHFLILFDOO\ UHDUUDQJLQJ W\SH ,,, FROODJHQ WR DOORZ FOHIW IRUPDWLRQ )LJXUH f 7KH UHVXOWV VXSSRUWHG WKH QRWLRQ WKDW FROODJHQDVH LQKLELWRU DIIHFWHG WKH FROODJHQDVH DFWLQJ RQ WKH LQWHUVWLWLDO FROODJHQV DQG FKDQJHG WKH ILEURXV DUFKLWHFWXUH DW WKH HSLWKHOLDO PHVHQFK\PDO LQWHUIDFH 1DNDQLVKL HW DO f DQG GHPRQVWUDWHG WKH UROH RI FROODJHQ DV D VRXUFH RI FRQVWUDLQW SUREDEO\ QHFHVVDU\ IRU FOHIW IRUPDWLRQ 1RJDZD f )XUWKHU H[SHULPHQWV KDYH LQGLFDWHG WKDW FOHIWLQJ RI WKH WHUPLQDO EXGV EHJLQV ZLWK WKH FRQWUDFWLRQ RI PLFURILODPHQWV LQ WKH SHULSKHUDO FHOOV EXW WKDW GHSRVLWLRQ RI FROODJHQ DQG JO\FRVDPLQRJO\FDQV *$*6f LQ WKH PHVHQFK\PH DW WKH SRLQWV RI WKH FOHIWV LV UHTXLUHG IRU WKH VXEVHTXHQW GLYLVLRQ RI WKH EXG *UREVWHLQ DQG &RKHQ f ,QGLFDWLRQV DUH WKDW ERWK W\SHV DQG ,,, FROODJHQ V\QWKHVLV DQG GHSRVLWLRQ DUH UHTXLUHG IRU VDOLYDU\ JODQG EUDQFKLQJ PRUSKRJHQHVLV 6SRRQHU DQG )DXELRQ f %XW VRPH TXHVWLRQV DERXW WKH DEVROXWH UHTXLUHPHQW IRU W\SH FROODJHQ LQ VDOLYDU\ JODQG PRUSKRJHQHVLV UHPDLQ .UDWRFKZLO HW DO f %\ XVLQJ VXEPDQGLEXODU JODQGV RI FROODJHQ ,GHILFLHQW 0RY PXWDQW PRXVH HPEU\RV .UDWRFKZLO HW DO GHPRQVWUDWHG QRUPDO PRUSKRJHQHVLV DW WKH GD\ VWDJH +RZHYHU EDVHG RQ WKH ZRUN RI 6SRRQHU DQG )DXELRQ f DQG PRUH UHFHQW GDWD IURP )XNXGD DQG DVVRFLDWHV f LW DSSHDUV WKDW EUDQFKLQJ PRUSKRJHQHVLV LV DIIHFWHG E\ ERWK W\SHV DQG ,,, FROODJHQ

PAGE 36

)LJXUH (IIHFWV RI FROODJHQDVH DQG FROODJHQDVH LQKLELWRUV RQ VXEPDQGLEXODU JODQG GHYHORSPHQW 6FKHPLDWLF VXPPDU\ RI HSLWKHOLDO PRUSKRJHQHVLV RI D PLGGD\ PRXVH VXEPDQGLEXODU JODQG XQGHU YDULRXV FRQGLWLRQV $f FXOWXUHG LQ QRUPDO PHGLD %f SOXV SJPO &ORVWULGLDO FROODJHQDVH DQG &f SOXV SJPO ERYLQH SXOS FROODJHQDVH LQKLELWRU 7,03f $GDSWHG IURP 1DNDQLVKL DQG ,VKLL

PAGE 37

7KH FRQYHUJHQFH RI WKH REVHUYDWLRQV VXJJHVWLQJ WKH LPSRUWDQFH RI RWKHU FROODJHQV DQG JO\FRVDPLQRJO\FDQV LQ WKH UHJXODWLRQ DQG VWDELOL]DWLRQ RI VDOLYDU\ JODQG PRUSKRJHQHVLV FDPH IURP GDWD LQGLFDWLQJ WKDW W\SHV DQG ,,, FROODJHQ DSSHDU WR SURWHFW WKH EDVDO ODPLQD IURP EUHDNGRZQ E\ K\DOXURQLGDVH DQG RWKHU HQ]\PHV E\ ELQGLQJ ZLWK KHSDUDQ VXOIDWH SURWHRJO\FDQ 7KLV ELQGLQJ VWDELOL]HV WKH EDVDO ODPLQD DQG UHGXFHV WKH EUHDNGRZQ RI WKH KHSDULQULFK SURWHRJO\FDQ %HPILHOG HW DO 6SRRQHU DQG )DXELRQ f ZKLFK LV WKH GRPLQDQW SURWHRJO\FDQ RI WKH PDWXULQJ VDOLYDU\ HSLWKHOLDO EDVDO ODPLQD &XWOHU HW DO f 'HSRVLWLRQ RI W\SH ,,, FROODJHQ DW WKH FOHIW RU EUDQFK SRLQW DUHDV VHHP WR SOD\ D NH\ UROH LQ UHJXODWLQJ ERWK DVVHPEO\ RI EDVDO ODPLQD FRPSRQHQWV DQG VWDELOL]LQJ WKHVH SRLQWV VR WKDW EUDQFKLQJ PD\ SURFHHG 7KH GLVWULEXWLRQ RI (&0 PDFURPROHFXOHV GXULQJ GHYHORSPHQW KDV EHHQ H[DPLQHG LQ YDULRXV V\VWHPV LQFOXGLQJ ZKROH PRXVH HPEU\RV /HLYR HW DO f PRXVH VDOLYDU\ JODQGV %HPILHOG HW DO %DQHUMHH HW DO 6SRRQHU HW DO f DQG UDW VXEPDQGLEXODU JODQGV .DGR\D DQG
PAGE 38

IRUPHG D ILQH QHWZRUN WKURXJKRXW WKH PHVHQFK\PH 7\SH ,9 FROODJHQ ZDV PDLQO\ ORFDWHG LQ WKH EDVHPHQW PHPEUDQH RI WKH HSLWKHOLXP EXW LW ZDV DOVR SUHVHQW WKURXJKRXW WKH PHVHQFK\PH 7\SH 9 FROODJHQ ZDV GLVWULEXWHG WKURXJKRXW WKH PHVHQFK\PH DW KRXUV EXW DW KRXUV ZDV SULQFLSDOO\ ORFDWHG LQ WKH EDVHPHQW PHPEUDQH 7\SH FROODJHQ ZDV GLVWULEXWHG WKURXJKRXW WKH PHVHQFK\PH DW DOO FXOWXUH WLPHV DQG DFFXPXODWHG LQ WKH FOHIWV DQG SDUWLFXODUO\ DW WKH HSLWKHOLDOPHVHQFK\PDO LQWHUIDFH DV WLPH LQ FXOWXUH LQFUHDVHV )LEURQHFWLQ ZDV REVHUYHG WKURXJKRXW WKH PHVHQFK\PH DW DOO WLPHV 2QH RI WKH PRVW LQWHUHVWLQJ TXHVWLRQV LQ DQLPDO GHYHORSPHQWDO ELRORJ\ LV KRZ DQ HSLWKHOLXP FKDQJHV LWV VKDSH 1DNDQLVKL DQG ,VKLL KDYH SURSRVHG D PRGHO XVLQJ PRXVH VXEPDQGLEXODU JODQGV WR GHVFULEH KRZ VHYHUDO RUJDQV LQFOXGLQJ WKH VDOLYDU\ JODQGV SDQFUHDV OXQJ NLGQH\ DQG PDPPDU\ JODQGV SURGXFH HODERUDWH HSLWKHOLDO VWUXFWXUHV ZLWK PD[LPDO VXUIDFH DUHD 1DNDQLVKL DQG ,VKLL f 7KH UHVXOWV IURP 1DNDQLVKL DQG ,VKLL f VXJJHVW WKDW FROODJHQ PD\ PRGXODWH EUDQFKLQJ PRUSKRJHQHVLV RI VXEPDQGLEXODU HSLWKHOLXP LQ VXFK D ZD\ WKDW WKH QXPEHU RI FOHIWV IRUPHG GHSHQGV RQ WKH DPRXQW RI VRPH W\SH RI FROODJHQ SUHVHQW LQ WKH WLVVXH %XQGOHV RI FROODJHQ ILEULOV ZHUH YLVXDOL]HG DW WKH QDUURZ FOHIWV EHWZHHQ WZR DGMDFHQW HSLWKHOLDO OREXOHV FRQVLVWHQW ZLWK WKH REVHUYDWLRQV RI %HPILHOG DQG :HVVHOOV f 7KHVH VWXGLHV UDLVHG WKH TXHVWLRQ RI ZKLFK VSHFLILF FROODJHQ PROHFXOH LV LPSRUWDQW IRU WKH PRUSKRJHQHWLF FKDQJH (DUOLHU ZRUN KDG VKRZQ WKDW WKH PRVW DEXQGDQW LQWHUVWLWLDO FROODJHQ LQ VXEPDQGLEXODU JODQGV LV FROODJHQ )XUWKHU ZRUN E\ 1DNDQLVKL HW DO f XVLQJ DQWLERGLHV VSHFLILF WR YDULRXV W\SHV RI FROODJHQ GHPRQVWUDWHG VWURQJ FROODJHQ ,,, UHDFWLYLW\ LQ WKH YHU\ HDUO\ FOHIWV RI ODWH GD\ DQG HDUO\ GD\ PRXVH VXEPDQGLEXODU JODQGV 6WDLQLQJ IRU FROODJHQ VKRZHG D

PAGE 39

UDWKHU XQLIRUP GLVWULEXWLRQ ERWK DW WKH HSLWKHOLDOPHVHQFK\PDO LQWHUIDFH DQG WKURXJKRXW WKH PHVHQFK\PH &ROODJHQ ,9 ZDV XQLIRUP LQ WKH EDVDO ODPLQD 7KHVH UHVXOWV GHPRQVWUDWHG WKDW FROODJHQ ,,, ZKLFK LV NQRZQ WR EH UHODWLYHO\ ULFK LQ HPEU\RQLF WLVVXHV PD\ SOD\ DQ LPSRUWDQW UROH LQ VXEPDQGLEXODU JODQG PRUSKRJHQHVLV :LWK WKLV LQIRUPDWLRQ 1DNDQLVKL SURSRVHG D ZRUNLQJ PRGHO RQ KRZ WKH PHVHQFK\PDO FHOOV VHFUHWH FROODJHQ ZKLFK H[HUWV PHFKDQLFDO IRUFH WR WKH HSLWKHOLXP JLYLQJ VWUDLQ WR WKH VXUIDFH RI WKH HSLWKHOLDO OREXOH DQG LQLWLDWLQJ FOHIW IRUPDWLRQ 7KH UROH RI FHOO SUROLIHUDWLRQ FHOO VKDSH FKDQJH DQG H[WUDFHOOXODU PDWULFHV LQ EUDQFKLQJ PRUSKRJHQHVLV KDV EHHQ LQYHVWLJDWHG LQ WKH EUDQFKLQJ PRUSKRJHQHVLV RI WKH IHWDO PRXVH VXEPDQGLEXODU JODQG +RZHYHU DOO WKH VWXGLHV ZHUH EDVHG RQ RUJDQ FXOWXUH H[SHULPHQWV ZKHUHE\ WKH HSLWKHOLXP DQG PHVHQFK\PH LQWHUDFWHG DV HDVLO\ DV LQ VLWX 7DNDKDVKL DQG 1RJDZD f LQWURGXFHG D PRUH DQDO\WLFDO H[SHULPHQWDO V\VWHP E\ H[DPLQLQJ HSLWKHOLDO EUDQFKLQJ RQ 0DWULJHOp D FRPPHUFLDOO\ DYDLODEOH JHO FRPSRVHG RI (&0 FRPSRQHQWV GHULYHG IURP FXOWXUHG FHOOV ,Q WKRVH VWXGLHV WKH VXEPDQGLEXODU HSLWKHOLXP VKRZHG IDLU JURZWK DQG EUDQFKLQJ PRUSKRJHQHVLV ZKHQ FORWWHG ZLWK 0DWULJHOp DQG VHSDUDWHG IURP WKH PHVHQFK\PH E\ D SRURXV ILOWHU GHPRQVWUDWLQJ WKDW WKH 0DWULJHOp SURYLGHG D JRRG H[WUDFHOOXODU HQYLURQPHQW IRU HSLWKHOLDO JURZWK ,Q DGGLWLRQ WKH HSLWKHOLXP FORWWHG ZLWK 0DWULJHOp ZLWK PHVHQFK\PH RQ WKH RSSRVLWH VLGH RI WKH ILOWHU VKRZV IDU EHWWHU JURZWK WKDQ WKH RQH ZLWKRXW PHVHQFK\PH LQGLFDWLQJ WKDW PHVHQFK\PDO IDFWRUV VWLPXODWH HSLWKHOLDO JURZWK 7KH WHPSRUDO DQG VSDWLDO H[SUHVVLRQ RI ODPLQLQ FROODJHQ W\SHV ,9 DQG DQG DSL LQWHJULQ UHFHSWRU WKH PDMRU ODPLQLQ UHFHSWRU RI WKH LQWHJULQ IDPLO\f KDV EHHQ

PAGE 40

H[DPLQHG LQ WKH SRVWQDWDOO\ GHYHORSLQJ UDW SDURWLG JODQG /D]RZVNL HW DO f /DPLQLQ % DQG % LVR IRUPV DQG FROODJHQV DO,9f DQG D f VWHDG\VWDWH P51$ OHYHOV ZHUH KLJKHVW DW DJHV DQG GD\V DIWHU ELUWK DQG GHFOLQHG WR WKH DGXOW GD\Vf OHYHO DW GD\V DQG ROGHU /DPLQLQ $ FKDLQ WUDQVFULSWV ZHUH QRW GHWHFWHG DW DQ\ DJH &ROODJHQ DO,9f DQG ODPLQLQ ZHUH ORFDOL]HG LQ WKH EDVDO PHPEUDQH RI WKH GHYHORSLQJ DFLQDU DQG GXFWDO FHOOV ZKLOH FROODJHQ D f ZDV ORFDOL]HG LQ WKH VWURPD VXUURXQGLQJ WKH FHOOV 7KH DPRXQWV RI WKHVH (&0 FRPSRQHQWV ZHUH KLJK DW WKH HDUO\ VWDJHV RI GHYHORSPHQW DQG ORZHU DW ODWHU WLPHV 7KH SDWWHUQ RI H[SUHVVLRQ IRU WKH DS LQWHJULQ JHQHV GXULQJ GHYHORSPHQW ZDV VLPLODU WR WKRVH RI ODPLQLQ DQG FROODJHQ DO,9f DQG D f 7KHVH GDWD VXJJHVWHG WKDW ODPLQLQ % DQG % DQG FROODJHQ DO,9f DQG D f DUH FRQVLVWHQWO\ FRH[SUHVVHG ZLWK WKH DSL LQWHJULQ UHFHSWRU FRPSOH[ LQ WKH GHYHORSLQJ DFLQDU DQG GXFWDO FHOOV GXULQJ SDURWLG SRVWQDWDO GHYHORSPHQW LQ WKH UDW 7KURXJK VWXGLHV VXFK DV WKHVH WKH LPSRUWDQFH RI WKH H[WUDFHOOXODU PDWUL[ LQ WKH GHYHORSPHQW RI VDOLYDU\ JODQGV KDV EHHQ GHPRQVWUDWHG EXW EHFDXVH RI WKH OLPLWHG WLVVXHV DYDLODEOH QR DWWHPSW KDV \HW EHHQ PDGH DW TXDQWLI\LQJ WKH (&0 JHQH H[SUHVVLRQ LQ GHYHORSLQJ VDOLYDU\ JODQGV &RQWULEXWLRQ RI *OYFRVDPLQRJO\FDQV LQ 6DOLYDU\ *ODQG 0RUSKRJHQHVLV 7KH SRWHQWLDO LPSRUWDQFH RI JO\FRVDPLQRJO\FDQV LQ WKH UHJXODWLRQ RI VDOLYDU\ JODQG PRUSKRJHQHVLV ZDV ILUVW VXJJHVWHG E\ .DOOPDQ DQG *UREVWHLQ f ,W ZDV VXJJHVWHG WKDW LQ DGGLWLRQ WR FROODJHQ WKH HSLWKHOLDO EDVDO ODPLQD PLJKW EH LPSRUWDQW LQ WKH UHJXODWLRQ RI VDOLYDU\ JODQG PRUSKRJHQHVLV 7KH EDVDO ODPLQD RI WKH HPEU\RQLF

PAGE 41

VXEPDQGLEXODU JODQG LV DQ H[WUDFHOOXODU SURGXFW RI WKH HSLWKHOLXP %DQHUMHH HW DO f ZKLFK LV ULFK LQ SURWHRJO\FDQ DQG K\DOXURQLF DFLG &RKQ HW DO f DQG DGGLWLRQDOO\ KDV EHHQ UHSRUWHG WR FRQWDLQ W\SH ,9 FROODJHQ ODPLQLQ ILEURQHFWLQ DQG FKRQGURLWLQ VXOIDWH DQG KHSDUDQ VXOIDWH SURWHRJO\FDQV %HPILHOG HW DO f 7KDW WKH EUDQFKLQJ PRUSKRJHQHVLV RI WKH HSLWKHOLDO FRPSRQHQW RI GHYHORSLQJ VDOLYDU\ JODQGV LV PDLQWDLQHG E\ LWV EDVDO ODPLQD KDV EHHQ GHPRQVWUDWHG %DQHUMHH HW DO %HPILHOG DQG %DQHUMHH %HPILHOG HW DO &RKQ HW DO f $ QXPEHU RI VWXGLHV KDYH GHPRQVWUDWHG WKDW LW LV WKH SURWHRJO\FDQ DVVRFLDWHG ZLWK WKH EDVDO ODPLQD WKDW SOD\ D PDMRU UROH LQ WKH UHJXODWLRQ DQG PDLQWHQDQFH RI WKH FKDUDFWHULVWLF EUDQFKLQJ SDWWHUQ RI VDOLYDU\ JODQGV %HPILHOG HWDO &XWOHU 6SRRQHU HW DO f 'XULQJ HDUO\ PRUSKRJHQHVLV RI WKH PRXVH DQG UDW VXEPDQGLEXODU JODQG [\ORVH OLQNHG SURWHRJO\FDQ LV WKH SUHGRPLQDQW SURWHRJO\FDQ V\QWKHVL]HG E\ WKH JURZLQJ VDOLYDU\ HSLWKHOLXP %DQHUMHH HW DO &RKQ HW DO &XWOHU HW DO Df 7KH GLUHFW SURRI WKDW EDVHPHQW PHPEUDQH [\ORVHOLQNHG SURWHRJO\FDQV ZHUH RI FULWLFDO LPSRUWDQFH LQ WKH FRQWURO RI VDOLYDU\ JODQG EUDQFKLQJ PRUSKRJHQHVLV FDPH IURP VWXGLHV E\ 6SRRQHU DQG FRZRUNHUV 7KRPSVRQ DQG 6SRRQHU 6SRRQHU HW DO f ,Q WKHVH VWXGLHV WKH\ XVHG !QLWURSKHQ\OS'[\ORS\UDQRVLGH 3'[\ORVLGHf DQ LQKLELWRU RI SURWHRJO\FDQ DVVHPEO\ LQ LQ YLWUR H[SHULPHQWV WR SURYLGH GLUHFW HYLGHQFH WKDW EORFNDJH RI SURWHRJO\FDQ DVVHPEO\ LQKLELWHG VXEPDQGLEXODU JODQG PRUSKRJHQHVLV %RWK FKRQGURLWLQ VXOIDWH DQG KHSDUDQ VXOIDWH SURWHRJO\FDQ KDYH WKH VDPH VHU[\OJDOJDOf OLQNDJH UHJLRQ EHWZHHQ WKH DSSURSULDWH *$* PROHFXOHV DQG WKHLU UHVSHFWLYH FRUH SURWHLQV UHQGHULQJ WKH

PAGE 42

V\QWKHVLV RI ERWK SURWHRJO\FDQ W\SHV VHQVLWLYH WR H[RJHQRXV 3'[\ORVLGHV 7KRPSVRQ DQG 6SRRQHU f 'DWD ZKLFK VKRZHG WKH VLJQLILFDQW UROH RI WKH EDVDO ODPLQD DQG LWV FRPSRQHQWV ZDV GHYHORSHG E\ %HPILHOG DQG KLV FROOHDJXHV %DQHUMHH HW DO %HPILHOG DQG %DQHUMHH &RKQ HW DO f *O\FRVDPLQRJO\FDQV SURWHRJO\FDQVf DQG W\SH FROODJHQ ZHUH VKRZQ E\ KLVWRFKHPLFDO HOHFWURQ PLFURVFRSLF DQG ELRFKHPLFDO VWXGLHV WR EH FRQFHQWUDWHG LQ WKH FOHIWV RU EUDQFK SRLQWV ZKLOH WKHVH PROHFXOHV DSSHDUHG WR EH DEVHQW RU VSDUVHO\ GLVWULEXWHG DW WKH JURZLQJ HQGV RI WKH EUDQFKHV %DQHUMHH HW DO %HPILHOG HW DO %HPILHOG DQG %DQHUMHH &RKQ HW DO f $XWRUDGLRJUDSKLF VWXGLHV VXJJHVWHG WKDW WKHUH ZHUH UHJLRQDO GLIIHUHQFHV LQ JO\FRVDPLQRJO\FDQ WXUQRYHU DQG WKDW WKHUH ZDV DQ LQFUHDVHG GHJUDGDWLRQ RI WKH EDVHPHQW PHPEUDQH ZKLFK RFFXUUHG DW WKH JURZLQJ HQG RI WKH EUDQFKHV 7KLV GHJUDGDWLYH DFWLYLW\ VHHPHG WR EH PHGLDWHG E\ WKH LQYHVWLQJ FRQQHFWLYH WLVVXH VLQFH WKHUH ZDV DQ DFWLYDWLRQ RI D QHXWUDO K\DOXURQLGDVH ZLWK VSHFLILFLW\ IRU K\DOXURQLF DFLG DQG FKRQGURLWLQ VXOIDWH SURWHRJO\FDQ LQ WKH WLVVXH DW WKH WLPH EUDQFKLQJ PRUSKRJHQHVLV ZDV LQLWLDWHG %HPILHOG DQG %DQHUMHH %HPILHOG HW DO f &RLQFLGHQW ZLWK WKH DFWLYDWLRQ RI WKLV K\DOXURQLGDVH WKH SDWWHUQ RI JO\FRVDPLQRJO\FDQV SURGXFHG E\ WKH VDOLYDU\ HSLWKHOLXP FKDQJHG 7KH JO\FRVDPLQRJO\FDQV V\QWKHVL]HG E\ WKH HDUO\ UXGLPHQWV ZHUH ULFK LQ K\DOXURQLF DFLG DQG FKRQGURLWLQ VXOIDWH +RZHYHU DV PRUSKRJHQHVLV SURJUHVVHG DQG EHFDPH PRUH FRPSOH[ WKH JO\FRVDPLQRJO\FDQV SURGXFHG VKRZHG DQ LQFUHDVHG DPRXQW RI KHSDULQ VXOIDWH DQG D UHGXFHG FRQWHQW RI K\DOXURQLF DFLG DQG FKRQGURLWLQ VXOIDWH %DQHUMHH HW DO &RKQ HW DO &XWOHU HW DO Ef ,Q WKH PDWXUH JODQG KHSDUDQ VXOIDWH

PAGE 43

LV WKH SUHGRPLQDQW JO\FRVDPLQRJO\FDQ V\QWKHVL]HG ZLWK RQO\ VPDOO DPRXQWV RI K\DOXURQLF DFLG DQG YLUWXDOO\ QR FKRQGURLWLQ VXOIDWH SURGXFHG &XWOHU HW DL f &ROOHFWLYHO\ WKHVH GDWD DORQJ ZLWK GHILQLWLRQ RI GLVWLQFW SDWWHUQV RI SURWHRJO\FDQ GHSRVLWLRQ WKDW FRUUHODWHV ZLWK HYHQWV RI OXQJ GHYHORSPHQW 6PLWK HW DO f VWURQJO\ VXJJHVW D UROH IRU JO\FRVDPLQRJO\FDQV VSHFLILFDOO\ FKRQGURLWLQ VXOIDWH SURWHRJO\FDQ LQ WKH PRUSKRJHQHWLF EUDQFKLQJ RI VDOLYDU\ JODQGV +RZHYHU QHLWKHU WKH ORFDOL]DWLRQ RI LQGLYLGXDO SURWHRJO\FDQV QRU GHILQLWLRQ RI WKHLU UROHV LQ WKH PRUSKRJHQLF FKDQJHV LV \HW GHILQHG 9RJHO f 6DOLYDU\ *ODQG &YWRGLIIHUHQWLDWLRQ ,QIRUPDWLRQ UHJDUGLQJ WKH PROHFXODU IDFWRUV LQYROYHG LQ WKH UHJXODWLRQ RI VHFUHWRU\ FHOO GLIIHUHQWLDWLRQ LQ WKH VDOLYDU\ JODQGV LV QRW DV DGYDQFHG DV WKDW IRU VDOLYDU\ JODQG PRUSKRJHQHVLV 7KH EDVLF PRUSKRJHQHWLF EUDQFKLQJ SDWWHUQ LV HVWDEOLVKHG SULRU WR WKH LQLWLDO HYHQWV LQ VHFUHWRU\ FHOO GHYHORSPHQW &XWOHU f $V WKH EUDQFKLQJ SDWWHUQ RI WKH UXGLPHQW LV EHLQJ HVWDEOLVKHG FHOOV SURGXFLQJ ORZ OHYHOV RI VHFUHWRU\ SURWHLQV FDQ EH LGHQWLILHG ZLWKLQ WKH UXGLPHQW +RZHYHU WKHVH FHOOV GR QRW GHPRQVWUDWH DQ\ VWUXFWXUDO VLJQV RI GLIIHUHQWLDWLRQ VXFK DV VHFUHWRU\ JUDQXOHV DW WKLV WLPH &XWOHU &XWOHU DQG &KDXGKU\
PAGE 44

5HGPDQ DQG 6UHHEQ\ E 5HGPDQ DQG %DOO &XWOHU DQG &KDXGKU\ D E f 5ROH RI (SLWKHOLDO0HVHQFKYPDO ,QWHUDFWLRQV LQ 6DOLYDU\ *ODQG &YWRGLIIHUHQWLDWLRQ 'LUHFW HSLWKHOLDOPHVHQFK\PDO FRQWDFW EHWZHHQ WKH VDOLYDU\ HSLWKHOLXP DQG WKH VXUURXQGLQJ FDSVXODU PHVHQFK\PH &XWOHU DQG &KDXGKU\ D E &XWOHU f DSSHDUV WR KDYH DQ LPSRUWDQW UROH LQ LQLWLDWLQJ WKH VHTXHQFH RI HYHQWV DPSOLILFDWLRQ RI VHFUHWRU\ SURWHLQ V\QWKHVLV DQG WKH VXEVHTXHQW VWUXFWXUDO FKDQJHV DW WKH FHOOXODU OHYHOf WKDW OHDG WR VHFUHWRU\ FHOO F\WRGLIIHUHQWLDWLRQ ZLWKLQ WKH VDOLYDU\ JODQGV &XWOHU f 7KHVH FRQWDFWV DUH VHHQ RQO\ DIWHU WKH SULPDU\ EUDQFKLQJ SDWWHUQ KDV EHHQ HVWDEOLVKHG DQG RQO\ LQYROYH LQWHUDFWLRQ EHWZHHQ WKH HSLWKHOLDO FHOOV LQ WKH HQGEXGV RI WKH LQLWLDO WR EUDQFKHV RI WKH HDUO\ UXGLPHQW DQG WKH VXUURXQGLQJ PHVHQFK\PH &XWOHU &XWOHU DQG &KDXGKU\ Ef &RQWDFWV RI WKLV W\SH DUH QRW VHHQ EHIRUH RU DIWHU WKLV VWDJH RI GHYHORSPHQW RI WKH JODQG ,I WKHVH GLUHFW HSLWKHOLDOPHVHQFK\PDO LQWHUDFWLRQV DUH SUHYHQWHG E\ VHSDUDWLQJ WKH GHYHORSLQJ HSLWKHOLXP IURP LWV LQYHVWLQJ PHVHQFK\PH GLIIHUHQWLDWLRQ RI VHFUHWRU\ FHOOV GRHV QRW RFFXU +RZHYHU LI WKH HSLWKHOLDOPHVHQFK\PDO FRQWDFWV KDYH WDNHQ SODFH PDQ\ RI WKH FHOOV JR RQ WR GHYHORS LQWR VHFUHWRU\ FHOOV &XWOHU f 7KH FRQWLQXHG SUHVHQFH RI WKH PHVHQFK\PH GRHV QRW VHHP WR EH UHTXLUHG IRU VHFUHWRU\ FHOO GHYHORSPHQW WR RFFXU RQFH WKH LQGXFWLYH VLJQDOV IRU VHFUHWRU\ FHOO GLIIHUHQWLDWLRQ KDYH EHHQ JHQHUDWHG 7KLV REVHUYDWLRQ SRLQWV RXW D VLJQLILFDQW GLIIHUHQFH EHWZHHQ PRUSKRJHQHVLV RI WKH UXGLPHQW DQG VHFUHWRU\ FHOO GHYHORSPHQW VLQFH WKH

PAGE 45

FRQWLQXHG SUHVHQFH RI WKH PHVHQFK\PDO FDSVXOH LV UHTXLUHG LQ RUGHU IRU PRUSKRJHQHVLV WR RFFXU ,Q DGGLWLRQ WKH DWWDLQPHQW RI DSLFDOEDVDO SRODULW\ RI WKH VHFUHWRU\ FHOOV VHHPV WR UHTXLUH IDFWRUV SURGXFHG E\ WKH PHVHQFK\PH 6HFUHWRU\ FHOOV GLIIHUHQWLDWLQJ LQ WKH DEVHQFH RI WKH FDSVXODU PHVHQFK\PH SURGXFH VHFUHWRU\ PDWHULDO DQG SDFNDJH WKH PDWHULDO LQWR VHFUHWRU\ JUDQXOHV +RZHYHU WKH FHOOV GR QRW GHPRQVWUDWH WKH DSLFDOEDVDO SRODULW\ W\SLFDO RI VDOLYDU\ JODQG H[RFULQH FHOOV )XUWKHU WKH FOXVWHULQJ RI FHOOV LQWR DFLQDU XQLWV LV QRW UHTXLUHG IRU WKH GLIIHUHQWLDWLRQ RI VHFUHWRU\ FHOOV 7KHVH REVHUYDWLRQV VXJJHVW WKDW WKH GHYHORSPHQW RI WKH W\SLFDO JODQGXODU PRUSKRJHQHWLF EUDQFKLQJ SDWWHUQ DQG WKH GLIIHUHQWLDWLRQ RI VHFUHWRU\ FHOOV ZLWKLQ GHYHORSLQJ VDOLYDU\ ODQGV DUH SDUWLDOO\ FRXSOHG EXW LQGHSHQGHQWO\ UHJXODWHG SURFHVVHV &XWOHU f 7KH PHVHQFK\PH VHHPV WR UHJXODWH ERWK WKH JURVV JODQGXODU PRUSKRORJ\ DQG WKH ILQH F\WRORJLFDO IRUP FROXPQDU VKDSH DSLFDOEDVDO SRODULW\f RI WKH LQGLYLGXDO FHOOV ZLWKLQ WKH JODQG &RQWULEXWLRQ RI WKH ([WUDFHOOXODU 0DWUL[ LQ 6DOLYDU\ *ODQG &YWRGLIIHUJQWLDWLRQ ,W ZDV QRWHG WKDW WKHUH ZDV D ILEULOODU PDWHULDO EHWZHHQ WKH RSSRVLQJ PHPEUDQHV RI WKH GLUHFW HSLWKHOLDOPHVHQFK\PDO FRQWDFWV LQYROYHG LQ VHFUHWRU\ FHOO GLIIHUHQWLDWLRQ &XWOHU &XWOHU DQG &KDXGKU\ Ef 7KH ILEULOODU PDWHULDO ZDV VWUXFWXUDOO\ VLPLODU WR WKH ODPLQD GHQVD RI WKH EDVDO ODPLQD DQG VXJJHVWHG WKH SRVVLELOLW\ IRU D UROH IRU H[WUDFHOOXODU PDWUL[ PROHFXOHV LQ WKH UHJXODWLRQ RI VHFUHWRU\ FHOO GLIIHUHQWLDWLRQ 5HFHQW VWXGLHV &XWOHU f KDYH H[DPLQHG WKH HIIHFWV RI FXOWXULQJ GHYHORSLQJ GD\ HPEU\RQLF UDW VXEPDQGLEXODU JODQG UXGLPHQWV LQ WKH SUHVHQFH RU DEVHQFH RI SRO\FORQDO RU PRQRFORQDO DQWLERGLHV GLUHFWHG DJDLQVW H[WUDFHOOXODU PDWUL[ FRPSRQHQWV

PAGE 46

7KHVH VWXGLHV KDYH SURYLGHG VRPH LQWHUHVWLQJ LQVLJKWV LQWR WKH UHJXODWLRQ RI JODQGXODU PRUSKRJHQHVLV DQG VHFUHWRU\ FHOO GLIIHUHQWLDWLRQ ,W DSSHDUV WKDW W\SH ,9 FROODJHQ DQG ODPLQLQ KDYH UROHV LQ WKH UHJXODWLRQ RI VDOLYDU\ JODQG PRUSKRJHQHVLV LQ DGGLWLRQ WR WKH UROHV DOUHDG\ HVWDEOLVKHG IRU W\SHV DQG ,,, FROODJHQ DQG FKRQGURLWLQ VXOIDWH SURWHRJO\FDQ 7R GDWH ZLWK UHJDUG WR WKH FRQWURO RI WKH GLIIHUHQWLDWLRQ RI VDOLYDU\ JODQG VHFUHWRU\ FHOOV W\SH ,9 FROODJHQ LV WKH RQO\ H[WUDFHOOXODU PDWUL[ PROHFXOH ZKLFK ZDV VKRZQ WR SOD\ D UROH LQ WKLV SURFHVV :KHQ HPEU\RQLF VXEPDQGLEXODU JODQG UXGLPHQWV DUH FXOWXUHG LQ WKH SUHVHQFH RI DQWLW\SH ,9 FROODJHQ DQWLERG\ YLUWXDOO\ DOO RI WKH UXGLPHQWV ZHUH SUHYHQWHG IURP XQGHUJRLQJ IXUWKHU EUDQFKLQJ PRUSKRJHQHVLV DQG VHFUHWRU\ FHOO GLIIHUHQWLDWLRQ ZDV QRW REVHUYHG LQ DQ\ RI WKHVH UXGLPHQWV 7KH SURFHVVHV RI PRUSKRJHQHVLV DQG F\WRGLIIHUHQWLDWLRQ DUH SDUWLDOO\ OLQNHG LQGHSHQGHQWO\ UHJXODWHG SURFHVVHV 7KH IXOO H[SUHVVLRQ RI ERWK SURFHVVHV LV PRGXODWHG RU FRQWUROOHG E\ HSLWKHOLDOPHVHQFK\PDO LQWHUDFWLRQV LQYROYLQJ ERWK GLUHFW FRQWDFWV DQG LQGLUHFW PROHFXODU LQWHUDFWLRQV ,W DSSHDUV WKDW DW OHDVW LQ SDUW PROHFXODU FRQVWLWXHQWV RI WKH H[WUDFHOOXODU PDWUL[ PD\ PHGLDWH WKH UHJXODWRU\ HIIHFWV RI ERWK GLUHFW DQG LQGLUHFW LQWHUDFWLRQV 'DWD LQGLFDWH WKDW HSLWKHOLDOPHVHQFK\PDO LQWHUDFWLRQV DQG YDULRXV H[WUDFHOOXODU PDWUL[ PROHFXOHV DUH LQWLPDWHO\ LQYROYHG LQ WKH LQGXFWLRQ FRQWURO DQG PDLQWHQDQFH RI VDOLYDU\ JODQG PRUSKRJHQHVLV DQG F\WRGLIIHUHQWLDWLRQ &RQWULEXWLRQ RI *OYFRVDPLQRJOYFDQV LQ 6DOLYDU\ *ODQG &\WRGLIIHUHQWLDWLRQ 3UHYLRXV VWXGLHV %RWWDUR DQG &XWOHU &XWOHU &XWOHU HW DO f VXJJHVWHG WKDW WKH SURFHVV RI GLIIHUHQWLDWLRQ RI VDOLYDU\ JODQG VHFUHWRU\ FHOOV LV FRQWUROOHG

PAGE 47

LQGHSHQGHQWO\ IURP WKH SURFHVV RI JODQGXODU PRUSKRJHQHVLV 7R WHVW WKLV &XWOHU HW DO H[DPLQHG WKH UROH RI [\ORVHOLQNHG SURWHRJO\FDQV PROHFXOHV NQRZQ WR SOD\ D VLJQLILFDQW UROH LQ WKH UHJXODWLRQ RI VDOLYDU\ JODQG PRUSKRJHQHVLV LQ WKH FRQWURO RI VHFUHWRU\ FHOO GLIIHUHQWLDWLRQ LQ GHYHORSLQJ VDOLYDU\ JODQGV &XWOHU HW DO Ef ,Q WKHVH VWXGLHV GD\ UDW HPEU\RQLF VXEPDQGLEXODU JODQG UXGLPHQWV ZHUH FXOWXUHG LQ WKH SUHVHQFH RU DEVHQFH RI '[\ORVLGH XQGHU FRQGLWLRQV NQRZQ WR SHUPLW VHFUHWRU\ FHOO GLIIHUHQWLDWLRQ 0RUSKRJHQHVLV ZDV LQKLELWHG LQ JUHDWHU WKDQ b RI WKH UXGLPHQWV FXOWXUHG LQ WKH SUHVHQFH RI [\ORVLGH DQDORJRXV WR WKH ILQGLQJV RI 6SRRQHU DQG FRZRUNHUV 6SRRQHU HW DO f +RZHYHU VHFUHWRU\ FHOO GLIIHUHQWLDWLRQ ZDV VHHQ LQ PRUH WKDQ b RI WKH UXGLPHQWV LQ ZKLFK EUDQFKLQJ PRUSKRJHQHVLV KDG EHHQ LQKLELWHG $QDO\VLV RI WKH HIIHFW RI 3'[\ORVLGH RQ JO\FRVDPLQRJO\FDQSURWHRJO\FDQ V\QWKHVLV E\ UDW VDOLYDU\ JODQG UXGLPHQWV LQGLFDWHG WKDW [\ORVLGH VSHFLILFDOO\ LQKLELWHG FKRQGURLWLQ VXOIDWH V\QWKHVLV EXW KDG OLWWOH HIIHFW RQ KHSDUDQ VXOIDWH SURWHRJO\FDQ SURGXFWLRQ 7KLV REVHUYDWLRQ LV FRQVLVWHQW ZLWK WKRVH RI 6SRRQHU DQG FRZRUNHUV 6SRRQHU HW DO f DQG HDUOLHU UHSRUWV E\ 7KRPSVRQ DQG 6SRRQHU f ZKLFK LQGLFDWHG WKDW FKRQGURLWLQ VXOIDWH SURWHRJO\FDQ SOD\V D PDMRU UROH LQ WKH UHJXODWLRQ RI VDOLYDU\ JODQG PRUSKRJHQHVLV 3URWHRJO\FDQV SOD\ D YHU\ FHQWUDO UROH LQ WKH UHJXODWLRQ RI WKH PRUSKRJHQHVLV RI VDOLYDU\ JODQGV &KRQGURLWLQ VXOIDWH SURWHRJO\FDQ FOHDUO\ DSSHDUV WR EH WKH PDMRU SURWHRJO\FDQ LQ WKLV UHJDUG ,QWHUHVWLQJO\ FKRQGURLWLQ VXOIDWH SURWHRJO\FDQ GRHV QRW DSSHDU WR EH LQYROYHG LQ WKH UHJXODWLRQ RI VHFUHWRU\ FHOO GLIIHUHQWLDWLRQ ZLWKLQ WKH GHYHORSLQJ UXGLPHQW 7KH HSLWKHOLDO FHOOV DOVR VHFUHWH *$*6 DQG RWKHU (&0V VXFK DV ILEURQHFWLQ DQG ODPLQLQ ZKLFK VWURQJO\ LQIOXHQFH WKH FRXUVH RI F\WRGLIIHUHQWLDWLRQ LQ WKH

PAGE 48

JODQG %HPILHOG HW DO f 7KLV REVHUYDWLRQ VXSSRUWV HDUOLHU ZRUN &XWOHU f WKDW LQGLFDWHG WKDW PRUSKRJHQHVLV DQG F\WRGLIIHUHQWLDWLRQ RI VDOLYDU\ JODQGV DUH VHSDUDWHO\ UHJXODWHG SURFHVVHV 6WDWHPHQW RI WKH 3UREOHP 7KH SUHFHGLQJ GLVFXVVLRQ RI VDOLYDU\ JODQG PRUSKRJHQHVLV DQG F\WRGLIIHUHQWLDWLRQ VKRZV WKH JUHDW KLVWRULFDO LQWHUHVW LQ VDOLYDU\ JODQG GHYHORSPHQW DQG GHVFULEHV FRPSHOOLQJ HYLGHQFH WKDW WKH H[WUDFHOOXODU PDWUL[ LV FULWLFDO WR WKH GHYHORSPHQW RI VDOLYDU\ JODQGV :KLOH WKH OLWHUDWXUH VXSSRUWV WKH LPSRUWDQW UROH RI WKH H[WUDFHOOXODU PDWUL[ LQ VDOLYDU\ JODQG GHYHORSPHQW WKHUH LV FRPSOHWH ODFN RI (&0 JHQH TXDQWLWDWLRQ DFFRPSDQ\LQJ WKLV GDWD 8QWLO UHFHQWO\ WKH DELOLW\ WR PHDVXUH JHQH H[SUHVVLRQ IURP VPDOO GHYHORSLQJ WLVVXHV ZDV QRW SRVVLEOH EXW ZLWK WKH DGYHQW RI SRO\PHUDVH FKDLQ UHDFWLRQ 3&5f WHFKQRORJ\ LW LV QRZ SRVVLEOH WR EHJLQ WR XQGHUVWDQG WKH FKDQJHV WKDW RFFXU LQ JHQH H[SUHVVLRQ LQ GHYHORSLQJ WLVVXHV 7KH UHVHDUFK SURMHFW LQ WKLV GLVVHUWDWLRQ UHSRUWV RQ WKH GHYHORSPHQW RI D PXOWLSULPHU VXSHUWHPSODWH WR PHDVXUH JHQH H[SUHVVLRQ RI (&0 JHQHV 7KH WHFKQRORJ\ LV VR SRZHUIXO WKDW LW SHUPLWV TXDQWLWDWLYH JHQH H[SUHVVLRQ IURP VPDOO GHYHORSLQJ PRXVH VXEPDQGLEXODU JODQG UXGLPHQWV 7KH IROORZLQJ VHFWLRQ ZLOO GHVFULEH WKH KLVWRU\ RI 3&5 WHFKQRORJ\ WKDW KDV OHG WR FRPSHWLWLRQEDVHG TXDQWLWDWLYH 573&5 RQH RI WKH WHFKQLTXHV XVHG LQ WKLV UHSRUW

PAGE 49

*HQH 4XDQWLWDWLRQ 7KH GLVDGYDQWDJH RI ZRUNLQJ ZLWK IHWDO VDPSOHV SDUWLFXODUO\ HDUO\ HPEU\RV RU GLVVHFWHG IHWDO RUJDQV LV WKDW LW LV RIWHQ GLIILFXOW WR REWDLQ VXIILFLHQW WLVVXH IRU PDQ\ PROHFXODU DQDO\VHV 6HQVLWLYH PHWKRGV FRPPRQO\ XVHG IRU WKH GHWHFWLRQ DQG DQDO\VLV RI 51$ PROHFXOHV LQFOXGH LQ VLWX K\EULGL]DWLRQ 1RUWKHUQ JHOV GRW RU VORW EORWV 6 QXFOHDVH VWXGLHV DQG 51DVH $ SURWHFWLRQ VWXGLHV .DZDVDNL f 7KH PRVW VHQVLWLYH RI WKHVH PHWKRGV LV LQ VLWX K\EULGL]DWLRQ LQ ZKLFK WR PROHFXOHV FDQ EH GHWHFWHG LQ D VLQJOH FHOO +RZHYHU LQ VLWX K\EULGL]DWLRQ LV WHFKQLFDOO\ YHU\ GLIILFXOW DQG GRHV QRW OHQG LWVHOI WR WKH SURFHVVLQJ RI ODUJH QXPEHU RI VDPSOHV :LWK RWKHU WHFKQLTXHV WKH OHYHO RI GHWHFWLRQ LV DSSUR[LPDWHO\ WR SJ RI WKH WDUJHW VHTXHQFH ZKLFK IRU DQ DYHUDJHVL]HG P51$ WUDQVODWHV WR WR WDUJHW VHTXHQFH PROHFXOHV 7KH KLJK VHQVLWLYLW\ RI 573&5 RYHUFRPHV WKLV OLPLWDWLRQ 7KH ILUVW SXEOLVKHG GHVFULSWLRQ RI WKH XVH RI 3&5 WR DPSOLI\ P51$ IURP F'1$ ZDV LQ 9HUHV HW DO f ZKHQ LW ZDV XVHG WR VWXG\ SRLQW PXWDWLRQV LQ WKH PRXVH RUQLWKLQH WUDQVFDUEDP\ODVH JHQH 7KH XVH RI 573&5 TXLFNO\ WXUQHG WRZDUG TXDQWLWDWLRQ RI JHQH H[SUHVVLRQ ,QLWLDOO\ PDQ\ JURXSV DWWHPSWHG WR FRDPSOLI\ D JHQH RI LQWHUHVW LQ FRPSDULVRQ WR WKH DPSOLILFDWLRQ RI D KRXVHNHHSLQJ JHQH LH 3DFWLQ JO\FHUDOGHK\GHSKRVSKDWH GHK\GURJHQDVH NHUDWLQV HWF 7KHVH FRDPSOLILFDWLRQV ZHUH GRQH LQ HLWKHU VHSDUDWH WXEHV RU LQ D VLQJOH WXEH EXW ZKHQ 51$ LV OLPLWHG LW LV GHVLUDEOH WR DPSOLI\ ERWK WKH WHVW DQG UHIHUHQFH P51$V LQ D VLQJOH WXEH DV ORQJ DV WKH WZR SURGXFWV DUH RI GLIIHUHQW VL]HV %UDJD DQG *HQGOHU f IRXQG KRZHYHU WKDW WKH \LHOG RI PXF DQ HSLWKHOLDO

PAGE 50

GLIIHUHQWLDWLRQ PDUNHU LQ PRXVH HPEU\RV DQG 3DFWLQ FDQ YDU\ LI WKH\ DUH DPSOLILHG WRJHWKHU LQ D VLQJOH WXEH 7KH UDWLRV RI 0XF WR 3DFWLQ DOVR GLIIHUHG ZKHQ DPSOLILHG LQGLYLGXDOO\ RU WRJHWKHU HYHQ ZLWK WKH XVH RI JHQHVSHFLILF SULPHUV LQ WKH 57 UHDFWLRQ 7KLV OHG WR WKH FRQFOXVLRQ WKDW D PRUH VRSKLVWLFDWHG V\VWHP ZDV QHHGHG WR VLPXOWDQHRXVO\ DPSOLI\ PRUH WKDQ RQH F'1$ LQ RQH VLQJOH UHDFWLRQ 573&5 'HWHFWLRQ RI ORZ DEXQGDQFH P51$V E\ UHYHUVH WUDQVFULSWLRQSRO\PHUDVH FKDLQ UHDFWLRQ 573&5 )LJXUH f KDV EHFRPH D VWDQGDUG WHFKQLTXH WR VWXG\ JHQH H[SUHVVLRQ LQ WLVVXHV DQG FHOOV LQ FXOWXUH 7KH DELOLW\ WR GHWHUPLQH UHODWLYH RU DEVROXWH FRS\ QXPEHU RI VSHFLILF P51$V KDV EHHQ GLIILFXOW KRZHYHU GXH WR LQDGHTXDWH LQWHUQDO VWDQGDUGV WR FRQWURO IRU VDPSOHWRVDPSOH YDULDWLRQ 7DPX]]HU HW DO Df 7KH XVH RI D V\QWKHWLF 51$ VWDQGDUG ZLWK LGHQWLFDO VHTXHQFHV WR WKH 3&5 SULPHUV DOORZV UHSURGXFLEOH TXDQWLWDWLRQ EHWZHHQ VDPSOHV DQG DVVD\V %\ GHVLJQLQJ PXOWLVHTXHQFH WHPSODWHV VSHFLILF P51$V FDQ EH TXDQWLILHG XVLQJ D VLQJOH WHPSODWH $GGLWLRQ RI PXOWLSOH WHPSODWHV WR D VLQJOH 57 UHDFWLRQ DOORZV WKH TXDQWLWDWLRQ RI ODUJH QXPEHU RI WDUJHWV IURP DV OLWWOH DV SJ RI WRWDO 51$ 4XDQWLWDWLYH 573&5 WKHUHIRUH SURYLGHV D YHU\ SRZHUIXO WHFKQLTXH WR VWXG\ JHQH H[SUHVVLRQ LQ WLVVXHV ZKLFK DUH OLPLWHG GXH WR VL]H RU DYDLODELOLW\ 2QH RI WKH DSSOLFDWLRQV RI 3&5 LV WKH TXDQWLWDWLYH DQDO\VLV RI VSHFLILF QXFOHRWLGH VHTXHQFHV 7KH PDLQ DGYDQWDJH RI WKLV PHWKRG DV FRPSDUHG ZLWK RWKHU PHWKRGV EDVHG RQ SUREH K\EULGL]DWLRQ LV LWV H[WUHPH VHQVLWLYLW\ DQG VSHFLILFLW\ +RZHYHU EHFDXVH RI WKH

PAGE 51

)LJXUH 6FKHPDWLF GLDJUDP RI WKH 573&5 PHWKRG %ULHIO\ HLWKHU WRWDO RU SRO\$f 51$ LV LVRODWHG ZKROH WLVVXH RU FHOOV 7KH 51$ LV WKHQ UHYHUVHWUDQVFULEHG WR PDNH F'1$ XVLQJ HLWKHU ROLJR G7f UDQGRP KH[DPHU RU JHQHVSHFLILF SULPHUV 7KH F'1$ LV DPSOLILHG E\ 3&5 7KH SURGXFWV DUH VHSDUDWHG RQ DQ DJDURVH JHO VWDLQHG ZLWK HWKLGLXP EURPLGH DQG SKRWRJUDSKHG

PAGE 52

A 51$ LVRODWLRQ SRO\ $f 51$ A UHYHUVH WUDQVFULSWLRQ F'1$ A SRO\PHUDVH FKDLQ UHDFWLRQ 0 (WKLGLXP EURPLGH HOHFWURSKRUHVLV YDOLGDWLRQ RI 3&5 SURGXFWV

PAGE 53

PDQ\ DPSOLILFDWLRQ VWHSV 3&5 E\ LWVHOI LV QRW DQ DFFXUDWH TXDQWLWDWLYH DVVD\ 6PDOO GLIIHUHQFHV LQ DPSOLILFDWLRQ HIILFLHQF\ FDQ UHVXOW LQ GUDPDWLF GLIIHUHQFHV LQ SURGXFW \LHOG $ QXPEHU RI FRQWUROV KDYH EHHQ LQWURGXFHG WR FRPSHQVDWH IRU WKH SUREOHPV LQWULQVLF WR TXDQWLWDWLRQ XVLQJ 3&5 7KH XVH RI 3&5 IRU JHQH TXDQWLWDWLRQ KDV EHHQ DWWHPSWHG D QXPEHU RI WLPHV LQ WKH OLWHUDWXUH EXW EHFDXVH RI WKH LQWULQVLF SUREOHPV LQ 3&5 DPSOLILFDWLRQ VXIILFLHQW FRQWUROV KDYH QRW EHHQ LQFOXGHG WR RYHUFRPH VHULRXV FRQFHUQV ZLWK WKH PHWKRGRORJ\ &RPSHWLWLYH 573&5 7KH QDPH fFRPSHWLWLYH 3&5f UHIHUV WR 3&5 WKDW LV DOORZHG WR SURFHHG LQWR WKH VDWXUDWLRQ SKDVH LQ ZKLFK D FRPSHWLWLRQ RFFXUV EHWZHHQ WDUJHW DQG VWDQGDUG WHPSODWHV IRU DYDLODEOH VXEVWUDWHV +RZHYHU EHFDXVH WKH VXP RI WKH PDVVHV RI ERWK SURGXFWV FDQQRW H[FHHG VRPH PD[LPXP YDOXH WKH DPRXQW RI SURGXFW IRUPHG IURP RQH WHPSODWH ZLOO GHFUHDVH ZLWK WKH LQFUHDVLQJ TXDQWLW\ RI WKH RWKHU WHPSODWH $ UHODWHG TXDQWLWDWLYH DSSOLFDWLRQ RI 3&5 FRDPSOLILFDWLRQ LV WKH GHWHUPLQDWLRQ RI UHODWLYH P51$ OHYHOV RI PHPEHUV RI JHQH IDPLOLHV 7KH WHUP fUDWLR 3&5f KDV EHHQ VXJJHVWHG IRU WKLV PHWKRG ,QVWHDG RI KRXVHNHHSLQJ JHQHV PDQ\ LQYHVWLJDWRUV KDYH XVHG H[RJHQRXVO\ DGGHG VWDQGDUGV 7KH FRQGLWLRQV IRU UHOLDEOH TXDQWLILFDWLRQ DUH PXFK OHVV VWULQJHQW LI WKH VWDQGDUG DQG WDUJHW VHTXHQFHV SRVVHVV LGHQWLFDO SULPHU ELQGLQJ VLWHV 7KH XVH RI DQ H[RJHQRXVO\ DGGHG VWDQGDUG WKDW FRQWDLQV WKH VDPH VHTXHQFHV IRU SULPHU ELQGLQJ DV WKH WDUJHW ZDV ILUVW GHVFULEHG E\ :DQJ HW DO f 7KLV WHFKQLTXH ZDV DOVR H[SORUHG E\ %HFNHU$QGUH ZKR QDPHG WKH PHWKRG 3$77< 3&5DLGHG WUDQVFULSW WLWUDWLRQ DVVD\ f DQG E\ *LOOLODQG HW DO ZKR LQWURGXFHG WKH WHUP fFRPSHWLWLYH 3&5f *LOOLODQG HW DO f 7KLV

PAGE 54

ODWWHU WHUP ZDV DGRSWHG LQ PRVW RI WKH OLWHUDWXUH %HFDXVH RQO\ RQH SULPHU SDLU LV QHHGHG LQ WKLV DSSURDFK LW FDQ EH DVVXPHG WKDW WKH DPSOLILFDWLRQ HIILFLHQF\ LV LGHQWLFDO IRU ERWK VHTXHQFHV LI WKH UHJLRQ LQ EHWZHHQ WKH SULPHUELQGLQJ VLWHV DOVR LV YHU\ VLPLODU 7KHUHIRUH WKH 3&5 FDQ EH H[WHQGHG LQWR WKH ODWHQW SKDVH ZKHUH D GHFUHDVH RI WKH HIILFLHQF\ RFFXUV LI WKLV GHFUHDVH RFFXUV ZLWK DQ LGHQWLFDO WLPH FRXUVH IRU ERWK VHTXHQFHV 7KH DELOLW\ WR H[WHQG WKH 3&5 LQWR WKH QRQH[SRQHQWLDO SKDVH LV YHU\ XVHIXO LQ SUDFWLFH EHFDXVH LW DYRLGV PDQ\ DGGLWLRQDO FRQWUROV DQG DOORZV DFFXUDWH TXDQWLILFDWLRQ RI WKH 3&5 SURGXFWV 5DH\PDHNHUV f ,Q FRPSHWLWLYH 3&5 WKH SURGXFWV RI WDUJHW DQG VWDQGDUG VHTXHQFHV DUH GLVFULPLQDWHG HLWKHU E\ D GLIIHUHQFH LQ OHQJWK RU E\ D VSHFLILF UHVWULFWLRQ VLWH LQ WKH UHJLRQ EHWZHHQ WKH SULPHU WHPSODWHV ,Q SUDFWLFH D VHULHV RI 3&5 WXEHV FRQWDLQLQJ WKH VDPH EXW XQNQRZQ DPRXQW RI WDUJHW VHTXHQFH LV VSLNHG ZLWK D GLOXWLRQ VHULHV RI GHILQHG TXDQWLWLHV RI WKH VWDQGDUG ,I WKH UDWH RI DPSOLILFDWLRQ LV WKH VDPH IRU ERWK VHTXHQFHV WKHLU UDWLRV ZLOO UHPDLQ FRQVWDQW GXULQJ WKH DPSOLILFDWLRQ DQG WKH DPRXQW RI WKH XQNQRZQ WHPSODWH FDQ EH TXDQWLWDWHG IURP WKH UDWLR RI WKH WZR SURGXFWV ,Q WKH SUDFWLFDO DSSOLFDWLRQ RI WKH PHWKRG LW ZDV UHFRPPHQGHG WKDW D FXUYH EH FRQVWUXFWHG UHODWLQJ WKH ORJDULWKP RI WKH UDWLR RI 3&5 SURGXFWV VWDQGDUGWDUJHWf WR WKH ORJDULWKP RI WKH LQLWLDO FRS\ QXPEHU RI VWDQGDUG WHPSODWH DGGHG 7KH DPRXQW RI LQLWLDO WDUJHW WHPSODWH FDQ EH UHDG HDVLO\ IURP WKH SRLQW RQ WKH FXUYH ZKHUH WKH DPRXQWV RI WDUJHW RU 51$ DQG VWDQGDUG RU WHPSODWH DUH HTXDO 6LHEHUW 6LHEHUW DQG /DUULFN f $OWKRXJK FRPSHWLWLYH 3&5 KDV EHHQ XVHG LQ VHYHUDO H[DPSOHV IRU UHOLDEOH TXDQWLILFDWLRQ PDQ\ LQFRUUHFW UHVXOWV KDYH DOVR EHHQ SXEOLVKHG DV LV DSSDUHQW IURP WKH VKDSH RI WKH ORJORJ FDOLEUDWLRQ FXUYHV 7KHRU\ SUHGLFWV WKDW WKLV FDOLEUDWLRQ FXUYH VKRXOG EH OLQHDU DQG KDYH D VORSH RI $Q LQYDOLG VWDQGDUG FXUYH PXVW EH FDXVHG E\ D GLIIHUHQFH LQ WKH DPSOLILFDWLRQ IDFWRU

PAGE 55

EHWZHHQ WKH WHPSODWH DQG WKH VWDQGDUG RU E\ GLIIHUHQFHV LQ WKH 3&5 WXEHV RI WKH GLOXWLRQ VHULHV 5DH\PDHNHUV f )RU WKH DQDO\VLV RI VXEPDQGLEXODU JODQG (&0 JHQH H[SUHVVLRQ D fWKHPDWLFf PXOWLSULPHU VXSHUWHPSODWH S0$75,; KDV EHHQ FRQVWUXFWHG DQG XVHG WR PHDVXUH WKH JHQH H[SUHVVLRQ IRU (&0 JHQHV E\ FRPSHWLWLRQEDVHG TXDQWLWDWLYH 573&5 ,W UHSUHVHQWV WKH ILUVW UHSRUW RI TXDQWLWDWLYH JHQH H[SUHVVLRQ LQ GHYHORSLQJ VXEPDQGLEXODU JODQGV 7R FRUUHODWH ZLWK WKLV GDWD LPPXQRKLVWRFKHPLVWU\ ZDV SHUIRUPHG RQ GHYHORSLQJ PRXVH VXEPDQGLEXODU JODQGV WR ORFDOL]H WKH (&0 SURWHLQV

PAGE 56

&+$37(5 0$7(5,$/6 $1' 0(7+2'6 6\QWKHWLF 6XSHUWHPSODWH S0$75,; &RQVWUXFWLRQ 7R LQYHVWLJDWH WKH FKDQJHV LQ H[WUDFHOOXODU PDWUL[ JHQH H[SUHVVLRQ GXULQJ IHWDO VXEPDQGLEXODU JODQG GHYHORSPHQW D PXOWLSULPHU SODVPLG S0$75,;f ZDV FRQVWUXFWHG ZKLFK FRQWDLQV SULPHU VHTXHQFHV IRU FROODJHQV D,f DO ,,,f DQG DO,9f HODVWLQ ILEURQHFWLQ ODPLQLQV % DQG % DQG O\V\O R[LGDVH 7KH PXOWLSULPHU VHTXHQFH ZLWK DQ DGGHG SRO\$f WDLO ZDV LQVHUWHG LQWR S&5,, GRZQVWUHDP IURP DQ 6S 51$ SRO\PHUDVH SURPRWHU 6HOHFWLRQ RI ROLJRQXFOHRWLGH VHTXHQFHV 7KH QXFOHRWLGH VHTXHQFHV IRU WKH KXPDQ PRXVH DQG UDW (&0 JHQHV ZHUH UHWULHYHG IURP *HQEDQN 7KH SULPHU VHTXHQFHV VHOHFWHG ZHUH b LGHQWLFDO IRU DOO WKUHH VSHFLHV 7DEOH f DQG ZHUH VHOHFWHG WR DPSOLI\ SRO\PHUDVH FKDLQ UHDFWLRQ 3&5f SURGXFWV EHWZHHQ EDVH SDLUV ,Q DGGLWLRQ ROLJRQXFOHRWLGH SULPHUV DOVR b LGHQWLFDO EHWZHHQ KXPDQ PRXVH DQG UDW ZHUH V\QWKHVL]HG WR FRUUHVSRQG WR LQWHUQDO VHTXHQFHV DSSUR[LPDWHO\ ES GRZQVWUHDP IURP HLWKHU WKH n RU n SULPHUV $SSHQGL[ $ OLVWV WKH FRGH QDPHV IRU HDFK RI WKH (&0 ROLJRQXFOHRWLGH SULPHUV 7KH ROLJRQXFOHRWLGH SULPHUV ZHUH DOVR GHVLJQHG WR VSDQ LQWURQV ZKHUH SRVVLEOH WR FRQWURO IRU WKH DPSOLILFDWLRQ RI FRQWDPLQDWLQJ JHQRPLF '1$

PAGE 57

7DEOH /LVW RI (&0 JHQHV ZLWK WKHLU UHVSHFWLYH XSVWUHDP ff GRZQVWUHDP ff DQG LQWHUQDO ROLJRQXFOHRWLGHV ZLWK WKH H[SHFWHG VL]H RI WKH S0$75,; WHPSODWH DQG FHOOXODU P51$ DPSOLFRQV JHQH f 3ULPHUV f LQWHUQDO 6L]H ESf SODVPLG P51$ ILEURQHFWLQ &&***77&7*$*7$&$&$*7& ** $***7&7 &77&$&&$***$ *&&$*&&&&7*$77** ODPLQLQ % ***&$*&&77&&7*$&&*$&7 ** $$$* $$*77 $&7 **&&**& *&7&&$$$&&*&&77$ O\V\O R[LGDVH ***$*$$&$$&***&$**7*7 **&7 ****$7*$7*7$**7&& &$&7**77&&$$*&7* FROODJHQ DO,,,f **&7&&7**7*$*&*$**$&* &&7&77**$&&$&*777$&&& &&7**$7&&&&7**7* HODVWLQ 7 *&$**&77$*7*&&7**7** &7&*$&*7&*$&&&*$$&&$&* &&*$&**777&***7& FROODJHQ F[,f **&&&7**&$&&$$7***&77$ &&$&**7&7&&7*$$&$$&&$ **&$&&$&77&$&&&$ FROODJHQ DO,9f **$&$$*&$**&777&&7**$ ***$&&**$$**$&&7*7&*7 &&7**$7&&&&7**7* ODPLQLQ % &7*&*&$*$$**&$*&7*&7$ 7&$&&77&&77$&&$$*7*&& *&7&&$$$&&*&&77$

PAGE 58

)1f /$0% f /2f &2/$f (/$67f &2/$f &2/$f *7$.f /$0% f &&7&&&$*$*$$*7**7&&7 &&777&77&$$7*$&&**&&* &&*$&&&&7$&7$&$7&&$** **$*$$&&7**7*&$$$7*** *$*&7*&$*&7***&77**7*& **7*&&$*$**$&77*77**7 &&&7**&&77&&7**$&$*&$ &&7*$$**$*$&***&77&&$ $*7**$$**$$7**77&$&** /$0%f &&7&&&$*$*$$*7**7&&777&77&$$7*$&&**&&*$&&&&7$&7$ )1f /2f &2/$f &$7&&$* $*$$&&7**7*& $$$7*** $*&7*& $*&7***&77* 7 (/$67f &2/$f *7$.f &&$*$**$&77*77**7&&&7**&&77&&7**$&$*&$&&7*$$**$* &2/$f $&***&77&&$*7**$$**$$7**77&$&** /$0% f )LJXUH $OLJQPHQW RI ROLJRQXFOHRWLGHV WR FUHDWH WKH ES PXOWLSULPHU LQVHUW 7KH PRVW HFRQRPLFDO DUUDQJHPHQW ZDV PDGH DV VKRZQ DERYH IRU WKH f SULPHUV

PAGE 59

6\QWKHVLV RI PXOWLSULPHU WHPSODWH 7KH PXOWLVHTXHQFH LQVHUW ZDV V\QWKHVL]HG E\ 3&5 XVLQJ RYHUODSSLQJ PHU ROLJRQXFOHRWLGH SULPHUV 7DPX]]HU HW DO Df FRQWDLQLQJ FRQWLJXRXV (&0 JHQH VHTXHQFHV %HIRUH WKH PHUV ZHUH V\QWKHVL]HG KRZHYHU WKH VHOHFWHG n DQG n ROLJRQXFOHRWLGH SULPHUV ZHUH WHVWHG IRU VSHFLILFLW\ XVLQJ VWDQGDUG 57 3&5 XVLQJ D WLVVXH ZKLFK LV NQRZQ WR H[SUHVV WKH (&0 JHQHV 7RWDO 51$ IURP PRXVH OLYHU DQG SODFHQWD ZHUH XVHG WR WHVW WKHVH SULPHUV $PSOLILFDWLRQ RI D VLQJOH EDQG RI WKH FRUUHFW VL]H FRQILUPHG E\ UHVWULFWLRQ HQGRQXFOHDVH GLJHVWLRQf LQGLFDWHG D JRRG SULPHU SDLU KDG EHHQ VHOHFWHG DQG V\QWKHVL]HG $PSOLILFDWLRQ RI PXOWLSOH EDQGV >DV LV WKH FDVH IRU FROODJHQ DO ,,,f@ ZDV FRQVLGHUHG DFFHSWDEOH LI D WHPSHUDWXUH ZDV IRXQG ZKLFK UHGXFHG WKH RWKHU EDQGV 3ULPHUV ZKLFK SURGXFHG D QRQVSHFLILF SURGXFWVf ZLWK D PROHFXODU ZHLJKW VLPLODU WR WKH FRUUHFW SURGXFW ZHUH H[FOXGHG IRU XVH LQ WKH SODVPLG (DFK RI WKH f ROLJRQXFOHRWLGH SULPHU VHTXHQFHV ZDV DOLJQHG DQG H[DPLQHG IRU FRPPRQ RYHUODSSLQJ HQGV 7KH VDPH ZDV GRQH IRU WKH f ROLJRQXFOHRWLGHV 7KH DUUDQJHPHQW WKDW ZDV WKH PRVW HFRQRPLFDO LH KDG WKH PRVW RYHUODSV LQ WKH f DQG f SULPHUV ZDV WKH VHTXHQFH XVHG WR GHWHUPLQH WKH RUGHU RI WKH JHQHV DUUDQJHG RQ WKH SODVPLG $Q H[DPSOH RI KRZ WKLV ZDV DFKLHYHG LQ VKRZQ LQ )LJXUH )RU S0$75,; WKH PRVW HFRQRPLFDO DUUDQJHPHQW RI WKH ROLJRQXFOHRWLGH SULPHUV ZDV ES $ UHVWULFWLRQ PDS RI WKH LQVHUW LV VKRZQ LQ $SSHQGL[ % )URP WKLV VHTXHQFH HLJKW RYHUODSSLQJ PHUV ZHUH WKHQ VHOHFWHG DQG V\QWKHVL]HG E\ WKH 8QLYHUVLW\ RI )ORULGD '1$ 6\QWKHVLV /DERUDWRU\ 7KH FRQVWUXFWLRQ RI S0$75,; LV GLDJUDPDWLFDOO\ UHSUHVHQWHG LQ )LJXUH 7R V\QWKHVL]H WKH PXOWLVHTXHQFH LQVHUW QJ RI HDFK PHU ROLJRQXFOHRWLGH ZDV DGGHG LQ D O22SO VWDQGDUG 3&5 UXQ ZLWK S0 HDFK G173 8 7DT SRO\PHUDVH LQ D EXIIHU

PAGE 60

)LJXUH 6FKHPH IRU FRQVWUXFWLRQ RI S0$75,; 7KH RYHUODSSLQJ V\QWKHWLF ROLJRQXFOHRWLGHV ZHUH OLJDWHG DQG ILOOHG ZLWK 7DT SRO\PHUDVH LQ D PXOWLVWHS SURFHVV DV GHVFULEHG 7KH FRPSHWH WHPSODWH VHTXHQFH ZDV XQLGLUHFWLRQDOO\ FORQHG LQWR SODVPLG S&5,, WR DOORZ F51$ V\QWKHVLV E\ 6S 51$ SRO\PHUDVH 7DPX]]HU HW DO f *7$. *7$ NLQDVH Sf D XQUHODWHG JHQH LQFOXGHG RQ WKLV SODVPLG

PAGE 61

F\FOHV 3&5 7 ! D 2 f ++ ,f§W ++ ++ FR W+ 2Lf§L Lf§ E D D &4 n5 F F F R 3 EIO BJ ER EH fD -2 MD V !! R R nR FG X Z X X f§L D X F\FOHV 3&5 7 ++ ++ ++ F 1 m f§ 1 n % 7M D D m F n5 F F V D r 2f EQ & EQ OLIH -2 &2 &2 &2 !! R R K X Z X % IIO & F D D , R F% 2 + 8SVWUHDP DPSOLILFDWLRQ ,QWHUQDO GHWHFWLRQ 'RZQVWUHDP DPSOLILFDWLRQ SRO\ $

PAGE 62

FRQWDLQLQJ P0 .& O2P0 7ULV S+ DQG P0 0J&O 7KLV UHDFWLRQ ZDV DPSOLILHG IRU F\FOH DW r& IRU PLQ IRU GHQDWXULQJ r& IRU PLQ IRU DQQHDOLQJ DQG r& IRU PLQ IRU H[WHQVLRQ IROORZHG E\ F\FOHV RI r& IRU PLQ r& IRU PLQ DQG r& IRU PLQ DQG ILQDOO\ LQFXEDWHG DW r& LQGHILQLWHO\ 7R DGG WKH IODQNLQJ ROLJRQXFOHRWLGHV D VHFRQG SRO\PHUDVH FKDLQ UHDFWLRQ ZDV SHUIRUPHG FRQVLVWLQJ RI SO RI WKH SURGXFW IURP WKH DERYH SRO\PHUDVH FKDLQ UHDFWLRQ DV ZHOO DV WKH n DQG n ROLJRQXFOHRWLGH SULPHUV SULPHUV DQG LQ )LJXUH f 7KH HQWLUH PXOWLVHTXHQFH LQVHUW ZDV WKHQ DPSOLILHG E\ 3&5 IRU F\FOHV DW r& IRU PLQ r& IRU PLQ DQG r& IRU PLQ 7KH UHVXOWLQJ ES UHDFWLRQ SURGXFW ZDV VHSDUDWHG RQ D b ORZ PHOWLQJ SRLQW /03f DJDURVH JHO DQG WKH EDQG H[FLVHG IRU FORQLQJ LQWR S&5,, )LJXUH LV WKH VHTXHQFH RI WKH ES PXOWLVHTXHQFH LQVHUW S&5,, LV D FRPPHUFLDOO\ DYDLODEOH SODVPLG IURP ,QYLWURJHQ 6DQ 'LHJR &DOLIRUQLDf DQG LV FRQWDLQHG LQ WKH 7$ &ORQLQJ NLW f S&5,, FRQWDLQV ERWK DQ 6S DQG D 7 51$ SRO\PHUDVH SURPRWHU ZKLFK IODQNV D SRO\OLQNHU VLWH GHVLJQHG WR HDVLO\ DFFHSW 3&5 JHQHUDWHG SURGXFWV E\ QDWXUH RI D f DGHQLQH RYHUKDQJ /LJDWLRQ 7KH ORZ PHOWLQJ SRLQW DJDURVH JHO VOLFH FRQWDLQLQJ WKH PXOWLVHTXHQFH LQVHUW ZDV KHDWHG WR r& IRU PLQXWHV DQG WKHQ NHSW DW r& IRU WKH VXEVHTXHQW OLJDWLRQ UHDFWLRQ 6DPEURRN HW DK f 7KH OLJDWLRQ UHDFWLRQ FRQVLVWHG RI SL RI WKH 3&5 SURGXFW DSSUR[ O2QJf SL RI VWHULOH ZDWHU QJ RI S&5,, IUHVKO\ UHVXVSHQGHG LQ SL RI 7ULV('7$ EXIIHUf SL RI 7 OLJDVH ,QYLWURJHQf DQG SL RI ; OLJDWLRQ EXIIHU P0 7ULV S+ P0 0J&O P0 1D&O PJPO %6$ P0 S0( ,P0 $73 P0 '77 O2P0 VSHUPLGLQHf 7KH UHDFWLRQ ZDV LQFXEDWHG DW r& RYHUQLJKW

PAGE 63

&&***77&7*$*7$&$&$*7&***&$*&&77&&7*$&&*$&7***$*$$& **&&&$$*$&7&$7*7*7&$*&&&$7&**$$**$&7**&7*$&&&7&77* $$&***&$**7*7**&7&&7**7*$*&*$**$&*7*&$**&77$*7*&&7 77*&&&*7&&$&$&&*$**$&&$&7&*&7&&7*&$&*7&&*$$7&$&**$ **7**&&&7**$&&$$7***&77$**$&$$*&$**&777&&7**$7*&&$ &&$&&***$&&7**77$&&&*$$7&&7*77&*7&&*$$$**$&&7$&**7 ****$**7*$$*$&&&7*&*&$*$$**&$*&7*&7$*&&$*&&&&7*$77 &&&&7&&$&77&7***$&*&*7&77&&*7&*$&*$7&**7&****$&7$$ **7$$&7*&&$&7*$&$&7**77&&$$*&7*&&7**$7&&&&7**7**&7 &&$77*$&**7*$&7*7*$&&$$**77&*$&**$&&7$****$&&$&&*$ *&&$$$*&&&$*&&*7**7*$$*7***7&$****$7&$*$**7*&$7*77 &**777&***7&**&$&&$&77&$&&&$*7&&&&7$*7&7&&$&*7$&$$ &&&&$&*7***&7&&$$$&&*&&77$&&7&&&$*$*$$*7**7&&&777& ****7*&$&&&*$**777**&**$$7**$***7&7&77&$&&$***$$$* 77&$$7*$&&**&&*$&&&&7$&7$&$7&&$**$*$$&&7**7*&$$$7* $$*77$&7**&&**&7****$7*$7*7$**7&&7&77**$&&$&*777$& **$*&7*&$*&7***&77**7*&&$*$**$&77*77**7&&&7**&&77& &&7&*$&*7&*$&&&*$$&&$&**7&7&&7*$$&$$&&$***$&&**$$* &7**$&$*&$&&7*$$**$*$&***&77&&$*7**$$**$$7**77&$&* *$&&7*7&*7**$&77&&7&7*&&&*$$&&7&$&&77&&77$&&$$*7*& & )LJXUH 1XFOHRWLGH VHTXHQFH RI WKH ES PXOWLSULPHU LQVHUW

PAGE 64

7UDQVIHFWLRQ )UHVK /XULD EURWK SODWHV ZLWK SJPO DPSLFLOOLQ ZHUH SUHSDUHG DV SHU 6DPEURRN HW DO f IRU WKH WUDQVIHFWLRQ &RPSHWHQW FHOOV ,19D)ff ZHUH LQFXEDWHG DW r& IRU PLQXWHV ZLWK SL RI EHWDPHUFDSWRHWKDQRO 0(f DQG SL RI WKH OLJDWLRQ PL[WXUH 7KH FHOOV ZHUH LPPHGLDWHO\ KHDWVKRFNHG DW r& IRU VHF DQG WKHQ IXUWKHU LQFXEDWHG DW r& IRU PLQ 7R WKLV YLDO SO RI ZDUPHG 62& PHGLXP ZDV DGGHG DQG LQFXEDWHG DW r& ZLWK VKDNLQJ DW USP :KLOH WKH FHOOV ZHUH VKDNLQJ SL RI EURPRFKORURLQGRO\O3'JDODFWRS\UDQRVLGH ;JDO PJPOf ZDV VSUHDG RQ WKH /XULD EURWKDPSLFLOOLQ SODWHV (LWKHU RU 22SO RI WKH WUDQVIHFWLRQ UHDFWLRQ PL[WXUH ZDV VSUHDG RQ WKH /%DPSLFLOOLQ SODWHV LQYHUWHG DQG LQFXEDWHG RYHUQLJKW 7KH S&5,, KDV D QXPEHU RI DGGHG DGYDQWDJHV LQFOXGLQJ FODVVLFDO EOXHZKLWH VHOHFWLRQ GXH WR WKH LQFOXVLRQ RI WKH ODF=D FRPSOHPHQWDWLRQ IUDJPHQW DV ZHOO DV DPSLFLOOLQ DQG NDQDP\FLQ UHVLVWDQFH $OO FRORQLHV RI WKH WUDQVIHFWHG EDFWHULD ZKLFK JURZ RQ WKH SODWHV KDYH EHHQ FRQIHUUHG DPSLFLOOLQ UHVLVWDQW WKURXJK WKH XSWDNH RI WKH S&5,, SODVPLG %DFWHULDO FRORQLHV ZKLFK FRQWDLQ S&5,, ZLWK QR LQVHUW ZLOO EH EOXH ZKLOH FRORQLHV FRQWDLQLQJ S&5,, ZLWK WKH LQVHUW ZLOO EH ZKLWH 7KH ZKLWH FRORQLHV DQG VRPH EOXH FRORQLHV WR XVH DV QHJDWLYH FRQWUROVf ZHUH VHOHFWHG IRU DONDOL O\VLV PLQLSUHSV 'HWHUPLQDWLRQ RI SRVLWLYH FORQHV 7R GHWHUPLQH ZKLFK RI WKH FORQHV ZHUH SRVLWLYH IRU WKH ES LQVHUW WKH FRORQLHV ZHUH VHOHFWHG DV GHVFULEHG DERYH JURZQ XS LQ PO RI DPSLFLOOLQ FRQWDLQLQJ /% EURWK $ PLQLSODVPLG '1$ SUHS 6DPEURRN HW DO f DQG UHVWULFWLRQ HQGRQXFOHDVH GLJHVWLRQV 6DPEURRN HW DO f ZHUH SHUIRUPHG WR LGHQWLI\ WKRVH FORQHV ZKLFK FRQWDLQHG WKH PXOWLVHTXHQFH LQVHUW 1KHO 1HZ (QJODQG %LRODEV %RVWRQ 0$f FXWV WKH ES PXOWLVHTXHQFH LQVHUW RQFH DW SRVLWLRQ DQG GRHV QRW FXW

PAGE 65

S&5,, %\ SHUIRUPLQJ D GRXEOH GLJHVW ZLWK +LQGOOO ZKLFK FXWV S&5,, LQ WKH PXOWLSOH FORQLQJ VLWH DW EXW QRW WKH PXOWLVHTXHQFH LQVHUW LW ZDV SRVVLEOH WR WHVW IRU ERWK WKH SUHVHQFH DQG RULHQWDWLRQ RI WKH PXOWLVHTXHQFH LQVHUW LQ S&5,, ,I WKH LQVHUW ZDV QRW SUHVHQW GLJHVWLRQ ZLWK 1KHO+LQG8O ZRXOG \LHOG WKH OLQHDUL]HG SODVPLG RI ES ,I WKH LQVHUW LV SUHVHQW DQG LV LQ WKH f WR f RULHQWDWLRQ GLJHVWLRQ ZLWK 1KHO+LQG8O ZRXOG \LHOG D UHVWULFWLRQ GLJHVW SURGXFW RI ES ,I WKH LQVHUW LV SUHVHQW DQG LV LQ WKH f WR f RULHQWDWLRQ GLJHVWLRQ ZLWK 1KHO+LQG8O ZRXOG \LHOG D SURGXFW RI ES 'LJHVWLRQ ZLWK eFR5O ZKLFK GRHV QRW FXW WKH LQVHUW RU WKH SODVPLG EXW GRHV UHOHDVH WKH LQVHUW FDQ EH XVHG WR FRQILUP WKH SUHVHQFH RI WKH LQVHUW 7ZR FORQHV ZHUH LGHQWLILHG ZKLFK FRQWDLQHG WKH PXOWLVHTXHQFH LQVHUW DQG ZHUH LQ WKH f WR f LQVHUW DQG WKHUHIRUH ZRXOG XVH WKH 6S 51$ SRO\PHUDVH SURPRWHU ,Q DGGLWLRQ 3&5 DPSOLILFDWLRQ ZLWK GLIIHUHQW SDLUV RI ROLJRQXFOHRWLGH SULPHUV LQFOXGHG RQ WKH SODVPLG FRQILUPHG WKDW WKH PXOWLVHTXHQFH LQVHUW ZDV LQWDFW WKH f ILEURQHFWLQ 0+ DQG WKH f ODPLQLQ % 0+ DV ZHOO DV ZLWK DOO QLQH SDLUV RI f DQG f ROLJRQXFOHRWLGH SULPHUVf &HVLXP FKORULGH JUDGLHQW 3UHSDUDWLRQ RI D ODUJH PD[LSUHS IURP WKH SRVLWLYH FORQHV 6DPEURRN HW DO f ZDV SHUIRUPHG %ULHIO\ WKLV LQYROYHG VHSDUDWLQJ WKH SODVPLG DQG FHOOXODU '1$ RQ D FHVLXP FKORULGH &V&Of HWKLGLXP EURPLGH (W%Uf JUDGLHQW &HQWULIXJDWLRQ RI WKH &V&O (W%U JUDGLHQW ZDV GRQH DW USP IRU KUV DW r& XVLQJ D %HFNPDQ 97 URWRU DQG / XOWUDFHQWULIXJH 7KH SODVPLG EDQG ZDV UHPRYHG IURP WKH JUDGLHQW DQG FROOHFWHG LQ PO WXEHV (W%U ZDV UHPRYHG WKURXJK ILYH VXFFHVVLYH LVRDP\O DOFRKRO ZDVKHV XQWLO ERWK SKDVHV DUH FOHDU 6DPEURRN HW DO f )LQDOO\ WKH UHVLGXDO &V&O ZDV UHPRYHG IURP WKH SODVPLG '1$ E\ GLOXWLQJ ZLWK YROXPHV RI VWHULOH

PAGE 66

ZDWHU DQG YROXPHV RI b HWK\O DOFRKRO (W2+f DQG FHQWULIXJLQJ [ J IRU PLQ DW r& 7KH UHVXOWLQJ SHOOHW ZDV WKH GLVVROYHG LQ PO 7( S+ f UHFHQWULIXJHG DW [ J DV DERYH ZDVKHG LQ b (W2+ DQG ILQDOO\ UHVXVSHQGHG LQ PO 7( 7KH FRQFHQWUDWLRQ RI WKH SODVPLG ZDV GHWHUPLQHG E\ PHDVXULQJ WKH RSWLFDO GHQVLW\ 2'f DW QP XVLQJ D 3KDUPDFLD *HQH4XDQWp 3KDUPDFLD 8SSVDOD 6ZHGHQf (QJLQHHULQJ DQG ,QVHUWLRQ RI D 3RO\$f 7DLO 7KH RULHQWDWLRQ RI WKH LQVHUW ZDV GHWHUPLQHG E\ UHVWULFWLRQ HQGRQXFOHDVH GLJHVWLRQ 7ZR ROLJRQXFOHRWLGHV ZHUH GHVLJQHG WR DGG WKH SRO\$f WDLO DW WKH ;KRO;EDO VLWHV GLVWDO WR WKH 6S SURPRWHU RQ S&5,, 7DPX]]HU HW DO Df 7KH ROLJRQXFOHRWLGH SULPHUV UHWDLQ WKH ;KRO DQG ;EDO VLWHV DV ZHOO DV DGG DQ +LQGOOO VLWH ZKLFK DOORZHG IRU FRQILUPDWLRQ RI LQVHUWLRQ E\ UHVWULFWLRQ GLJHVWLRQ 7KH WZR ROLJRQXFOHRWLGHV DQG WKH DUUDQJHPHQW RI WKH ES LQVHUW LQ UHODWLRQVKLS WR S&5,, LV VKRZQ LQ )LJXUH 7ZR PLFURJUDPV RI WKH SODVPLG ZHUH OLQHDUL]HG RYHUQLJKW DW r& ZLWK ;ERO DQG ;EDO 7KH SURGXFWV ZHUH VHSDUDWHG RQ D b /03 DJDURVH JHO DQG WKH OLQHDUL]HG SODVPLG ZDV H[FLVHG IURP WKH JHO DQG DOORZHG WR OLJDWH RYHUQLJKW ZLWK WKH SRO\$f WDLO ROLJRQXFOHRWLGHV 7KH SODVPLG ZDV WUDQVIRUPHG XVLQJ WKH 7$ FORQLQJ NLW ,QYLWURJHQf DV SUHYLRXVO\ GHVFULEHG 7KH WUDQVIRUPDQWV ZHUH SODWHG RQ /%DPSLFLOOLQ SODWHV KRZHYHU WKHUH LV QR EOXHZKLWH FRORU VHOHFWLRQ KHUH VLQFH ODF LV DOUHDG\ LQWHUUXSWHG E\ WKH PXOWLVHTXHQFH LQVHUW 7R WHVW IRU WKH VXFFHVVIXO LQVHUWLRQ RI WKH SRO\$f WDLO PLQLSUHSV ZHUH GRQH DQG WKH '1$ FXW ZLWK mGLOO /DUJH VFDOH SODVPLG LVRODWLRQ ZDV GRQH IRU WKH SRVLWLYH FORQHV 7KH SODVPLG '1$ ZDV SXULILHG XVLQJ WKH :L]DUG 0D[LSUHSVp '1$

PAGE 67

+LQGO8 6S 3URPRWHU )LJXUH &ORQLQJ RI D SRO\$f WDLO WR WKH PXOWLSULPHU LQVHUW 2OLJRQXFOHRWLGH SULPHUV ZHUH GHVLJQHG DQG OLJDWHG LQWR WKH ;KRO;EDO VLWH RI S&5,, GRZQVWUHDP RI WKH PXOWLSULPHU LQVHUW 'LJHVWLRQ ZLWK +LQGO8 FRQILUPHG WKH OLJDWLRQ RI WKH SRO\$f WDLO

PAGE 68

3XULILFDWLRQ 6\VWHP 3URPHJD 0DGLVRQ :, $f DQG UHVXVSHQGHG LQ PO 7( &RQFHQWUDWLRQ RI WKH SODVPLG ZDV GHWHUPLQHG E\ DEVRUEDQFH DW QP 7KH SRO\$fWDLO FRQWDLQLQJ SODVPLG ZDV SUHSDUHG IRU WKH 6S WUDQVFULSWLRQ UHDFWLRQ $XVXEHO f E\ GLJHVWLQJ WKH SODVPLG ZLWK ;ED? DQG SURWHLQDVH 7KH OLQHDUL]HG SODVPLG ZDV H[WUDFWHG WZLFH ZLWK SKHQRO FKORURIRUP DQG WKHQ SUHFLSLWDWHG RYHUQLJKW ZLWK YROXPHV RI (W2+ DW r& 7KH SODVPLG ZDV FHQWULIXJHG IRU PLQ DW USP WKH SHOOHW ZDVKHG LQ b YYf '(3&(W2+ DQG UHVXVSHQGHG LQ SO '(3& WUHDWHG ZDWHU 7KH 51$ WHPSODWH ZDV V\QWKHVL]HG XVLQJ DQ 51$ WUDQVFULSWLRQ UHDFWLRQ FRQWDLQLQJ SO RI [ EXIIHU P0 7ULV+&O S+ P0 0J&O P0 VSHUPLGLQH O2P0 GLWKLRWKUHLWRO DQG O2P0 1D&O 3URPHJDf OSJ WUHDWHG SODVPLG P0 ULERQXFOHRWLGHV U173V SL HDFK DW O2P0f 8 51DVLQ 8 6S 3URPHJD 3,f DQG SO '(3&WUHDWHG ZDWHU 7KH SO UHDFWLRQ ZDV LQFXEDWHG IRU KU DQG VWRUHG DW r& ,VRODWLRQ RI 3ROYW$W 51$ 3RO\$f 51$ ZDV LVRODWHG ZLWK D 0LFUR)DVW 7UDFN P51$ ,VRODWLRQ NLW ,QYLWURJHQ .f D PRGLILFDWLRQ RI D SURWRFRO HVWDEOLVKHG E\ +DTTL HW DO f %ULHIO\ WKH 6S WUDQVFULSWLRQ UHDFWLRQ ZDV GLOXWHG XS WR PO ZLWK '(3&WUHDWHG ZDWHU DQG 1D&O ZDV DGGHG WR P0 $Q ROLJRG7f FHOOXORVH SHOOHW ZDV LQFXEDWHG ZLWK WKH 51$ DQG DOORZHG WR DEVRUE IRU PLQXWHV DW USP DW r& 7KH ROLJRG7 FHOOXORVH VOXUU\ ZLWK DEVRUEHG SRO\$f 51$ ZDV SHOOHWHG UHVXVSHQGHG LQ ELQGLQJ EXIIHU DQG ORDGHG RQWR D VSLQ FROXPQ 7KH SRO\$f 51$ ZDV HOXWHG HWKDQRO SUHFLSLWDWHG

PAGE 69

UHVXVSHQGHG LQ SO '(3&WUHDWHG ZDWHU DQG TXDQWLILHG E\ DEVRUEDQFH DW QP XVLQJ D *HQH4XDQW VSHFWURSKRWRPHWHU 3KDUPDFLDf 6DPSOH FDOFXODWLRQ SJPO 2' QPf [ SPROH SJf [ 2n SPROHVPO RU [ 2n SPROHVSO ZKHUH EDVHV [ 0: [ SPROHVSO [ [OPROHFXOHVSPROH [ V FRSLHVSO 7HQIROG VHULDO GLOXWLRQV RI WKH WUDQVFULSWLRQ UHDFWLRQ f WR ff ZHUH PDGH LQ '(3& WUHDWHG ZDWHU 4XDQWLWDWLYH 573&5 UHDFWLRQV ZLWK GLIIHUHQW GLOXWLRQV RI WHPSODWH VKRXOG WKHQ JLYH D VHULHV RI UHDFWLRQV ZKLFK GHFUHDVH LQ LQWHQVLW\ ZLWK GHFUHDVLQJ WHPSODWH FRS\ QXPEHU ,VRODWLRQ RI 7RWDO &HOOXODU 51$ 7KH PHWKRG RI &KLUJZLQ &KLUJZLQ HW DO f ZDV XVHG IRU LVRODWLQJ WRWDO FHOOXODU 51$ 3URFHGXUHV LQYROYLQJ H[SHULPHQWDO DQLPDO ZHUH SHUIRUPHG XQGHU SURWRFRO QXPEHU DSSURYHG E\ WKH $QLPDO &DUH DQG 8VH &RPPLWWHH RI WKH 8QLYHUVLW\ RI )ORULGD %ULHIO\ WLPHGSUHJQDQW %$/%F PLFH GD\V f ZHUH VDFULILFHG E\ FHUYLFDO GLVORFDWLRQ DQG IHWDO VXEPDQGLEXODU JODQGV ZHUH H[FLVHG DQG O\VHG LQ PO RI 0 JXDQLGLQLXP LVRWKLRF\DQDWH P0 VRGLXP FLWUDWH S+ f b VDUNRV\O DQG 0 PHUFDSWRHWKDQRO VKHDULQJ WKH VDPSOHV WKURXJK D JDXJH QHHGOH DQG ORDGLQJ WKH PL[WXUH RQ WRS RI D PO FXVKLRQ RI 0 FHVLXP FKORULGH &V&Of 0 HWK\OHQHGLDPLQHWHWUDDFHWLF DFLG ('7$f LQ O2P0 7ULV+&O 7KH &V&O JUDGLHQW ZDV

PAGE 70

FHQWULIXJHG DW USP LQ D %HFNPDQ 6: URWRU IRU KRXUV DW r& 51$ ZDV UHFRYHUHG DQG VWRUHG LQGHILQLWHO\ DV DQ HWKDQRO SUHFLSLWDWH DW r& 4XDQWLWDWLYH 573&5 7KH SURWRFRO IRU TXDQWLWDWLYH 573&5 7DPX]]HU HW DO Df LV VKRZQ LQ )LJXUH $IWHU WKH VXEPDQGLEXODU JODQG 51$ ZDV LVRODWHG F'1$ ZDV V\QWKHVL]HG LQ D VHULHV RI VWDQGDUG SO UHYHUVH WUDQVFULSWLRQ 57f UHDFWLRQV HDFK FRQWDLQLQJ 2SJ RI WRWDO 51$ DQG NQRZQ GLOXWLRQV RI S0$75,; F51$ [A [A FRSLHVf S0 ROLJRG7fL P0 0J&O S0 G173 8PO KXPDQ SODFHQWDO ULERQXFOHDVH LQKLELWRU 3URPHJDf O2P0 7ULV+&O S+ f P0 .& DQG 8SJ 51$ 0RORQH\ PXULQH OHXNHPLD YLUXV UHYHUVH WUDQVFULSWDVH 00/957 *LEFR%5/f 7KH UHDFWLRQ ZDV LQFXEDWHG DW r& IRU PLQ r& IRU PLQ DQG r& IRU PLQ '1$ DPSOLILFDWLRQ IRU HDFK (&0 JHQH ZDV GRQH LQ VWDQGDUG SO SRO\PHUDVH FKDLQ UHDFWLRQV ZKLFK FRQWDLQHG SO RI WKH 57 UHDFWLRQ S0 G173 SPROHV RI HDFK n DQG n 3&5 SULPHU 7DEOH f P0 0J&O P0 7ULV+&O S+ f P0 .& DQG SOUHDFWLRQ 7DT SRO\PHUDVH 3( ([SUHVV 1RUZDON &7 1f $PSOLILFDWLRQ UHDFWLRQV ZHUH FDUULHG RXW LQ D %LRPHWUD WKHUPRF\FOHU ZLWK VHTXHQWLDO F\FOHV DW r& IRU PLQ r& IRU PLQ DQG r& IRU PLQ IROORZHG E\ PLQ DW r& IRU ILQDO H[WHQVLRQ 7KH r& WHPSHUDWXUH ZDV SUHYLRXVO\ GHWHUPLQHG WR EH RSWLPDO IRU HDFK RI WKH SULPHU SDLUV

PAGE 71

)LJXUH *HQHUDO VFKHPH IRU TXDQWLWDWLYH 573&5 7DPX]]HU HW DO f 7HPSODWH VHTXHQFH FRPSHWHV DJDLQVW FHOO GHULYHG P51$ IRU ROLJRQXFOHRWLGH SULPHU ELQGLQJ $V YLVXDOL]HG E\ HWKLGLXP EURPLGH VWDLQLQJ RI DJDURVH JHOV WKH SUHFLVH VWDUWLQJ FRSLHV RI P51$ FDQ EH GHWHUPLQHG

PAGE 72

IHWDO QHRQDWDO VXEPDQGLEXODU JODQG *,7&&V&, XOWUDFHQWULIXJDWLRQ 51$ LVRODWLRQ 3&5 DPSOLILFDWLRQ a WHPSODWH VDPSOH 51$ $OLTXRW $GG NQRZQ FRSLHV RI S0$75,; 51$ WR HDFK WXEH F'1$ V\QWKHVLV 2nr UR $QDO\]H GHQVLWRPHWULFDOO\ E\ HWKLGLXP EURPLGH VWDLQLQJ LQWHQVLW\ RQ IODWEHG VFDQQHU

PAGE 73

6HSDUDWLRQ RI 3URGXFWV DQG 3KRWRJUDSKLQJ RI *HOV 3&5 SURGXFWV ZHUH VHSDUDWHG RQ b DJDURVH JHOV FRQWDLQLQJ QJPO HWKLGLXP EURPLGH DW 9 IRU a KRXUV XQWLO WKH WHPSODWH DQG FHOOXODU 51$ DPSOLFRQV ZHUH FOHDUO\ GLVFHUQLEOH 7KH JHOV ZHUH SKRWRJUDSKHG IRU VHFRQGV XVLQJ D 3RODURLG 03 /DQG FDPHUD XVLQJ 7\SH ILOP 6FDQQLQJ ,PDJH DQG )LQDO $QDO\VLV 3KRWRJUDSKV ZHUH VFDQQHG DQG GLJLWL]HG RQ D +HZOHWW3DFNDUG ,OH[ GLJLWDO VFDQQHU DQG VWRUHG DV 7,)) ILOHV RQ D 0DFLQWRVK FRPSXWHU %DQG LQWHQVLWLHV ZHUH GHWHUPLQHG XVLQJ 1,+,PDJH YOf 7KHVH LQWHQVLW\ YDOXHV ZHUH WKHQ QRUPDOL]HG IRU WKHLU PROHFXODU ZHLJKW 7KH ORJ RI WKH UDWLR RI EDQG LQWHQVLWLHV ZLWKLQ HDFK ODQH ZDV SORWWHG DJDLQVW WKH ORJ RI WKH FRS\ QXPEHU RI WHPSODWH DGGHG SHU UHDFWLRQ 0ROHFXOHV RI WDUJHW PHVVDJHV ZHUH GHWHUPLQHG ZKHUH WKH UDWLR RI WHPSODWH DQG WDUJHW EDQG LQWHQVLWLHV ZDV HTXDO WR 8VH RI1,+ ,PDJH LV RXWOLQHG LQ $SSHQGL[ & 6WDWLVWLFDO $QDO\VLV $OO GDWD ZDV VWDWLVWLFDOO\ DQDO\]HG E\ ERWK .UXVNDOO:DOOLV RQHVLGHG $129$ DQG 1HZPDQ.HXOV 0XOWLSOH &RPSDULVRQ 7HVW XVLQJ 1XPEHU &UXQFKHU 6WDWLVWLFDO 6\VWHP YHUVLRQ 1&66 +LQW]H f )RU WKH .: 2QH:D\ $129$ WKH QXOO K\SRWKHVLV ZDV WKDW DOO PHDQV ZHUH HTXDO ZKLOH WKH DOWHUQDWH K\SRWKHVLV ZDV WKDW DW OHDVW WZR RI WKH PHDQV ZHUH GLIIHUHQW 'DWD ZDV FRQVLGHUHG VWDWLVWLFDOO\ VLJQLILFDQW DW DOSKD

PAGE 74

,PPXQRKLVWRFKHPLVWUY ,PPXQRKLVWRFKHPLFDO GHWHFWLRQ RI HDFK (&0 SURWHLQ ZDV SHUIRUPHG DV SUHYLRXVO\ GHVFULEHG &KHJLQL HW DL f $ VFKHPDWLF GLDJUDP RI WKH WHFKQLTXH LV VKRZQ LQ )LJXUH 7KH JRDW DQWLKXPDQERYLQH FROODJHQV ,,, DQG ,9 SRO\FORQDO DQWLERGLHV XVHG DW ZHUH JUDFLRXVO\ VXSSOLHG E\ 6RXWKHUQ %LRWHFKQRORJ\ $VVRFLDWHG %LUPLQJKDP $/f 7KH UDEELW DQWLPRXVH ODPLQLQ %% XVHG DW ZDV SXUFKDVHG IURP 8SVWDWH %LRWHFKQROJ\ /DNH 3ODFLG 1
PAGE 75

)LJXUH 6FKHPDWLF GLDJUDP RI WKH LPPXQRKLVWRFKHPLFDO SURWRFRO DGDSWHG IURP $XVXEHO f

PAGE 76

2 L L L WLVVXH VSHFLPHQ IL[ RYHUQLJKW LQ b SDUDIRUPDOGHK\GH GHK\GUDWH LQ HWKDQRO VHULHV DQG [\OHQH HPEHG LQ SDUDIILQ FXW WLVVXH LQWR SP WKLFN VHFWLRQV GU\ VOLGHV DQG VWRUH LQGHILQLWHO\ UHK\GUDWH VHFWLRQ LQDFWLYDWH HQGRJHQRXV SHUR[LGDVH ZLWK b +2 EORFN QRQVSHFLILF ELQGLQJ ZLWK QRUPDO VHUXP LQFXEDWH KUV ZLWK SULPDU\ DQWLERG\ L a4 L ZDVK VOLGH ZLWK 3%6 LQFXEDWH KU ZLWK ELRWLQ\ODWHG VHFRQGDU\ DQWLERG\ ZDVK VOLGH ZLWK 3%6 LQFXEDWH ZLWK VWUHSWDYLGLQ KRUVHUDGLVK SHUR[LGDVH FRQMXJDWH DGG GLDPLQREHQ]LGLQH DQG GHYHORS IRU PLQ L VWRS UHDFWLRQ LQ ZDWHU Q]= GHK\GUDWH VHFWLRQ LQ D JUDGHG DOFRKRO VHULHG DQG [\OHQH FRYHU VHFWLRQV ZLWK FRYHU VOLS SKRWRJUDSK

PAGE 77

&+$37(5 7+5(( 5(68/76 6\QWKHVLV RI S0$75,; $ PXOWLSULPHU WHPSODWH S0$75,; FRQWDLQLQJ ROLJRQXFOHRWLGH VHTXHQFHV IRU FROODJHQV D,f DO,,,f DO,9f ILEURQHFWLQ ODPLQLQV % DQG % HODVWLQ DQG O\V\O R[LGDVH KDV EHHQ V\QWKHVL]HG DFFRUGLQJ WR WKH SURFHGXUHV GHVFULEHG LQ WKH 0DWHULDOV DQG 0HWKRGV 8VLQJ S0$75,; DQG FRPSHWLWLRQEDVHG TXDQWLWDWLYH 573&5 LW LV SRVVLEOH WR TXDQWLI\ WKH DEXQGDQFH RI P51$ FRUUHVSRQGLQJ WR DQ\ RI WKH H[WUDFHOOXODU PDWUL[ JHQHV LQ KXPDQ PRXVH RU UDW WLVVXHV :KLOH FRQVWUXFWLQJ S0$75,; WR HQVXUH WKDW WKH PXOWLSULPHU LQVHUW ZDV FRPSOHWH DQG LQWDFW DOO f DQG f SULPHUV ZHUH XVHG WR DPSOLI\ SURGXFWV RI WKH H[SHFWHG VL]H F51$ RI WKH SRO\$fFRQWDLQLQJ PXOWLSULPHU LQVHUW ZDV WUDQVFULEHG XVLQJ 6S 51$ SRO\PHUDVH )LQDO \LHOGV ZHUH [ FRSLHV 51$ WHPSODWHSO 7HQIROG VHULDO GLOXWLRQV ZHUH PDGH LQ '(3&WUHDWHG ZDWHU DQG VWDQGDUG 573&5 UHDFWLRQV ZHUH SHUIRUPHG XVLQJ f DQG f ROLJRQXFOHRWLGH SULPHUV IRU ILEURQHFWLQ 0+ DQG 0+f 3URGXFWV IURP WKHVH UHDFWLRQV ZKHQ VHSDUDWHG RQ D b DJDURVH JHO \LHOGHG GHFUHDVLQJ DPSOLILHG SURGXFW FRUUHVSRQGLQJ WR WKH GHFUHDVHG WHPSODWH FRS\ QXPEHU GDWD QRW VKRZQf 7KLV VLPSOH DSSURDFK GHPRQVWUDWHG WKDW 3&5 XVLQJ GHFUHDVLQJ WHPSODWH FRS\ QXPEHU UHVXOWHG LQ D GHFUHDVH LQ DPSOLILFDWLRQ SURGXFWV

PAGE 78

)LJXUH 5HSUHVHQWDWLYH FRPSRVLWH GDWD IRU 4573&5 $FWXDO UDZ 3&5 GDWD DUH VKRZQ IRU FROODJHQ D,f ILEURQHFWLQ DQG ODPLQLQ % IRU IHWDO GD\V f QHRQDWDO GD\V DQG f DQG DGXOW VXEPDQGLEXODU JODQGV 7KH SURGXFW VL]HV DUH WKH VDPH DV OLVWHG LQ 7DEOH 5HDFWLRQV LQ ODQHV FRQWDLQ GHFUHDVLQJ FRSLHV RI S0$75,; WHPSODWH

PAGE 79

)HWDO )HWDO )HWDO )HWDO )HWDO )HWDO 1HRQDWDO 1HRQDWDO 1HRQDWDO 1HRQDWDO 1HRQDWDO $GXOW &ROODJHQ D >A V /6% 46 &=%

PAGE 80

7KH DPRXQW RI WRWDO 51$ UHFRYHUHG IURP IHWDO VXEPDQGLEXODU JODQGV UDQJHG IURP MDJ 51$JODQG WR SJ 51$JODQG IRU GD\V DQG UHVSHFWLYHO\ 7KH PDMRU OLPLWDWLRQ RI WKHVH H[SHULPHQWV ZDV WKH DYDLODELOLW\ RI IHWDO PRXVH VDOLYDU\ JODQG 51$
PAGE 81

0 /DPLQLQ % VDPSOH 51$ WHPSODWH 51$ )LEURQHFWLQ VDPSOH 51$ WHPSODWH 51$ Kr )LJXUH (WKLGLXP EURPLGH VWDLQHG DJDURVH JHO VKRZLQJ GDWD IURP ILEURQHFWLQ DQG ODPLQLQ % 4573&5 7KH ODQHV f UHSUHVHQW GHFUHDVLQJ DPRXQWV RI S0$75,; F51$ [ WR [ FRSLHV UHVSHFWLYHO\f DGGHG WR SJ RI WRWDO 51$ 0 PDUNV WKH '1$ PDUNHU ODQH S*(0f

PAGE 82

5DWLR RI QRUPDOL]HG EDQG LQWHQVLWLHV 7HPSODWH FRS\ QXPEHU FRSLHV SHU FHOOf )LJXUH *UDSKHG UHSUHVHQWDWLRQ RI WKH GDWD IURP )LJXUH ZLWK WKH ORJ RI WKH UDWLR RI WKH QRUPDOL]HG EDQG LQWHQVLWLHV SORWWHG DJDLQVW WKH ORJ RI WHPSODWH FRS\ QXPEHU Â’ ILEURQHFWLQ GD\ 2 ODPLQLQ % GD\

PAGE 83

)LJXUH &RSLHV RI P51$ SHU FHOO IRU HDFK (&0 JHQH PHDVXUHG RYHU WKH GHYHORSPHQW RI PRXVH VXEPDQGLEXODU JODQGV

PAGE 84

7LPH 'D\f FRSLHV P51$ PROHFXOHV SHU FHOO R /$ /$ nOO $GXOW

PAGE 85

f DQG ILQDOO\ SORWWHG DV WKH ORJ RI WKHVH FDOFXODWHG UDWLRV DJDLQVW WKH ORJ RI WKH VWDUWLQJ FRS\ QXPEHU RI WKH WHPSODWH DGGHG WR HDFK 57 UHDFWLRQ 7KLV VKRXOG UHVXOW LQ D OLQH ZLWK D VORSH RI 7KH QXPEHU RI 51$ FRSLHV ZDV GHWHUPLQHG IURP ZKHUH WKH OLQH FURVVHV :LWK SJ RI WRWDO 51$ SHU PDPPDOLDQ FHOO %UDGKRUVW DQG 0F&RQNH\ f WKH YDOXH FDQ WKHQ EH H[SUHVVHG DV FRSLHV RI 51$ SHU FHOO 8VLQJ WKLV PHWKRG RI TXDQWLWDWLRQ WKH (&0 JHQH H[SUHVVLRQ LQ GHYHORSLQJ PRXVH VXEPDQGLEXODU JODQGV ZDV PHDVXUHG 7KLV DQDO\VLV PHW DOO UHTXLUHPHQWV SUHYLRXVO\ VWDWHG LQ WKDW WKH SDUW RI WKH FDOLEUDWLRQ FXUYH XVHG IRU TXDQWLILFDWLRQ VKRXOG EH OLQHDU DQG KDYH D VORSH HTXDO WR ,Q SUDFWLFH D FRUUHFW VWDQGDUG FXUYH FDQ EH FRQVLGHUHG D VWURQJ DUJXPHQW IRU HTXDO UDWHV RI DPSOLILFDWLRQ 5DH\PDHNHUV 5DH\PDHNHUV 6LHEHUW 6LHEHUW DQG /DUULFN f $V VKRZQ LQ )LJXUH WKH QXPEHU RI FROODJHQ D,f FROODJHQ DO ,,,f DQG O\V\O R[LGDVH P51$ PROHFXOHV SHU FHOO SHDNHG RQ GD\ RI GHYHORSPHQW )RU FROODJHQ D,f WKH QXPEHU RI FRSLHV RI P51$ SHU FHOO DW GD\V DQG DUH VLJQLILFDQWO\ KLJKHU WKDQ RWKHU GD\V DQG GD\V DQG DUH VLJQLILFDQW RYHU GD\V DQG S f &ROODJHQ DO,,,f P51$ H[SUHVVLRQ ZDV VLJQLILFDQWO\ KLJKHU DW GD\V DQG S f &ROODJHQ DO,9f P51$ H[SUHVVLRQ ZDV EHORZ GHWHFWDEOH OLPLWV H[FHSW DW GD\ 7KH H[SUHVVLRQ RI HODVWLQ P51$ ZDV RQO\ GHWHFWDEOH RQ GD\ RI GHYHORSPHQW )LEURQHFWLQ DQG ODPLQLQ % ZHUH PRUH FRQVWLWXWLYHO\ H[SUHVVHG EXW DJDLQ KDG WKHLU KLJKHVW FRS\ QXPEHU SHU FHOO DW GD\ 7KH OHYHOV RI ILEURQHFWLQ P51$ ZDV VLJQLILFDQW DW GD\ DERYH GD\ GD\ DERYH GD\V DQG DQG GD\V DQG VLJQLILFDQWO\ KLJKHU WKDQ DOO RWKHU GD\V S f /DPLQLQ P51$ ZDV VLJQLILFDQWO\ KLJKHU DW GD\V

PAGE 86

DQG RYHU GD\V DQG ZLWK GD\V DQG VLJQLILFDQWO\ KLJKHU WKDQ RWKHU GD\V S f /\V\O R[LGDVH P51$ ZDV VLJQLILFDQWO\ KLJKHU DW GD\ S f 7KH QXOO K\SRWKHVHV WKDW WKH PHDQV DUH HTXDO FDQ EH UHMHFWHG DW S IRU FROODJHQV D,f DO ,,,f ODPLQLQ % DQG O\V\O R[LGDVH DQG S IRU ILEURQHFWLQ $OWKRXJK QRW VWDWLVWLFDOO\ VLJQLILFDQW D VHFRQG VPDOOHU EXUVW RI (&0 JHQH H[SUHVVLRQ RFFXUUHG IRU FROODJHQ D,f FROODJHQ DO,,,f ILEURQHFWLQ DQG ODPLQLQ % DW SRVWQDWDO GD\ ZLWK WKH ORZHVW RYHUDOO (&0 JHQH H[SUHVVLRQ VHHQ LQ WKH PDWXUH DGXOW JODQG (&0 3URWHLQ /RFDOL]DWLRQ E\ ,PPXQRKLVWRFKHPLVWU\ LQ 'HYHORSLQJ 0RXVH 6XEPDQGLEXODU *ODQGV ,PPXQKLVWRFKHPLVWU\ ZDV SHUIRUPHG WR ORFDOL]H HDFK RI WKHVH H[WUDFHOOXODU PDWUL[ SURWHLQV LQ IHWDO DQG DGXOW VXEPDQGLEXODU JODQGV FROODJHQ W\SH )LJXUH $ FROODJHQ W\SH ,,, )LJXUH % FROODJHQ W\SH ,9 )LJXUH & ILEURQHFWLQ )LJXUH ODPLQLQ )LJXUH ( O\V\O R[LGDVH )LJXUH ) 2Q GD\ RI GHYHORSPHQW WKH IHWDO WLVVXH KDV LPPXQRUHDFWLYH FROODJHQ FROODJHQ ,,, DQG ILEURQHFWLQ SUHVHQW WKURXJKRXW WKH FRQQHFWLYH WLVVXH EHWZHHQ WKH HSLWKHOLDO OREXOHV *UHDWHU VWDLQLQJ ZDV VHHQ LQ WKH RXWHU PHVHQFK\PDO FDSVXOH 7KHUH LV OLWWOH RU QR VWDLQLQJ IRU WKHVH WKUHH SURWHLQV ZLWKLQ WKH HSLWKHOLDO OREXOHV ,PPXQRUHDFWLYH O\V\O R[LGDVH DQG FROODJHQ ,9 ZHUH SULPDULO\ LQ WKH PHVHQFK\PDO FDSVXOH DQG EDVHPHQW PHPEUDQHV ZLWK VRPH OLJKWHU VWDLQLQJ SUHVHQW WKURXJKRXW WKH PHVHQFK\PH EXW OLNH FROODJHQV DQG ,,, DQG ILEURQHFWLQ ZHUH YRLG LQ WKH HSLWKHOLXP ,PPXQRUHDFWLYH ODPLQLQ ZDV SUHVHQW WKURXJKRXW ERWK WKH PHVHQFK\PH EDVHPHQW PHPEUDQHV DQG WKH HSLWKHOLXP RI WKH GHYHORSLQJ IHWDO VXEPDQGLEXODU JODQGV

PAGE 87

)LJXUH 3URWHLQ ORFDOL]DWLRQ IRU (&0 PROHFXOHV Df (DFK (&0 SURWHLQ ZDV ORFDOL]HG LQ ERWK GD\ GHYHORSLQJ JODQGV DQG DGXOW PRXVH VXEPDQGLEXODU E\ LPPXQRKLVWRFKHPLVWU\ $UURZV LQGLFDWH DUHDV RI PRUH LQWHQVH VWDLQLQJ $VWHULVNV GHQRWH HSLWKHOLDO OREXOHV Ef &RQWUROV IRU LPPXQRKLVWRFKHPLVWU\ 7KH XSSHU SDQHO LV D GD\ JODQG ZLWKRXW SULPDU\ DQWLERG\ ZKLOH WKH PLGGOH SDQHO LV DQ DGXOW JODQG ZLWKRXW SULPDU\ DQWLERG\ 7KH ERWWRP SDQHO LV +t( VWDLQLQJ RI D GD\ GHYHORSLQJ PRXVH VXEPDQGLEXODU JODQG 3

PAGE 88

&ROODJHQ D,f } )HWDO GD\ &ROODJHQ DO,,,f &ROODJHQ DO,9f U A )HWDO GD\ )LEURQHFWLQ /DPLQLQ /\V\O 2[LGDVH )HWDO GD\ U D )HWDO GD\ $GXOW $GXOW $GXOW

PAGE 89

&RQWUROV 'D\ SULPDU\ DQWLERG\ $GXOW SULPDU\ DQWLERG\ 'D\ +t( )LJXUH f§FRQWLQXHG

PAGE 90

&RQWUROV WLVVXHV ZKLFK ZHUH WUHDWHG ZLWK SUHLPPXQH VHUD ZHUH FRPSOHWHO\ YRLG RI LPPXQRUHDFWLYH VWDLQLQJ ,Q WKH DGXOW LPPXQRUHDFWLYH FROODJHQ DQG O\V\O R[LGDVH ZHUH SUHVHQW PRVW VWURQJO\ DURXQG WKH VWULDWHG GXFW FHOOV DV ZHOO DV WKH EDVDO ODPLQD VXUURXQGLQJ WKH DFLQL 7KHUH ZDV QR VWDLQLQJ LQ WKH FRQQHFWLYH WLVVXH VHSWD &ROODJHQ ,,, DOVR H[KLELWHG VLPLODU EXW VWURQJHU LPPXQRUHDFWLYH VWDLQLQJ LQ WKH VWULDWHG GXFW FHOOV DQG LQ WKH EDVDO ODPLQD VXUURXQGLQJ WKH DFLQL WKDQ FROODJHQ DQG O\V\O R[LGDVH ,PPXQRUHDFWLYH ILEURQHFWLQ ZDV PRVW VWURQJO\ DVVRFLDWHG ZLWK WKH VWULDWHG GXFWV EXW ZDV DOVR SUHVHQW WKURXJKRXW WKH DFLQL &ROODJHQ ,9 ZDV IRXQG PRVW FRQFHQWUDWHG LQ WKH EDVDO ODPLQD RI WKH DFLQL DQG RI WKH VWULDWHG GXFWV /DPLQLQ ZDV PRVW SUHVHQW LQ WKH VWULDWHG GXFWV DQG EDVDO ODPLQD RI WKH DFLQL

PAGE 91

&+$37(5 ',6&866,21 'HYHORSPHQW RI IHWDO VXEPDQGLEXODU JODQGV LQYROYHV WKH RUFKHVWUDWHG H[SUHVVLRQ RI H[WUDFHOOXODU PDWUL[ PROHFXOHV ZKLFK GLUHFW WKH PRUSKRJHQHVLV DQG F\WRGLIIHUHQWLDWLRQ RI WKH HSLWKHOLXP 7KHVH HYHQWV DUH KLJKO\ UHJXODWHG DQG FRRUGLQDWHG ERWK WHPSRUDOO\ DQG VSDWLDOO\ &XWOHU f 'LIIHUHQWLDWLRQ RI VDOLYDU\ JODQGV EHJLQV GXULQJ IHWDO GHYHORSPHQW ZKHQ VSHFLILF FHOOV RI WKH RUDO HSLWKHOLXP DUH LQGXFHG WR XQGHUJR RUJDQL]HG FRRUGLQDWHG JURZWK DQG WR SURGXFH VDOLYDU\VSHFLILF VHFUHWRU\ SURWHLQV )ROORZLQJ WKLV SULPDU\ LQGXFWLRQ WKH VDOLYDU\ JODQG UXGLPHQW LQLWLDWHV PRUSKRJHQHVLV WR GHYHORS LWV XQLTXH EUDQFKLQJ SDWWHUQ 2QFH WKH SULPDU\ EUDQFKLQJ SDWWHUQV KDV EHHQ HVWDEOLVKHG VSHFLILF FHOOV ZLWKLQ WKH UXGLPHQW DUH LQGXFHG WR DPSOLI\ WKH SURGXFWLRQ RI WKHVH VDOLYDU\ VSHFLILF VHFUHWRU\ SURWHLQV 7KHVH SULPRUGLDO DFLQDU FHOOV PRGLI\ WKHLU VKDSH DQG WKHLU RUJDQHOOH FRPSRVLWLRQ WR GHYHORS DQ DUFKLWHFWXUH ZKLFK LV RSWLPDOO\ VXLWHG WR WKH V\QWKHVLV DQG VHFUHWLRQ RI WKHVH H[RFULQH SURGXFWV 7KH IXOO H[SUHVVLRQ RI PRUSKRJHQHVLV DQG F\WRGLIIHUHQWLDWLRQ DSSHDUV WR EH PRGXODWHG RU FRQWUROOHG E\ FRPSRQHQWV RI WKH H[WUDFHOOXODU PDWUL[ 7KH UROH RI WKH FROODJHQV LQ VXEPDQGLEXODU JODQG GHYHORSPHQW KDYH EHHQ GHVFULEHG EXW PXFK OHVV LV NQRZQ DERXW WKH UROH RI RWKHU H[WUDFHOOXODU PDWUL[ PROHFXOHV 7KH XVH RI FRPSHWLWLRQ EDVHG TXDQWLWDWLYH 573&5 WR PHDVXUH (&0 JHQH H[SUHVVLRQ SURYLGHV YDOXDEOH

PAGE 92

LQIRUPDWLRQ FRQFHUQLQJ WKH OHYHOV RI H[WUDFHOOXODU PDWUL[ JHQHV GXULQJ WKH GHYHORSPHQW RI PRXVH VXEPDQGLEXODU JODQGV $ UHFHQW UHSRUW PHDVXUHG WKH WHPSRUDO OHYHOV RI VRPH (&0 JHQHV LQ WKH GHYHORSLQJ SDURWLG JODQG RI QHRQDWDO UDWV /D]RZVNL HW DO f ,Q WKDW UHSRUW VWDQGDUG 1RUWKHUQ EORW WHFKQLTXHV ZHUH XVHG ZKLFK UHTXLUHG SJ RI WRWDO 51$ DQG RQO\ UHODWLYH OHYHOV RI JHQH H[SUHVVLRQ FRXOG EH UHSRUWHG ,W LV DQ LPPHQVH WDVN WR FROOHFW ODUJH TXDQWLWLHV RI WRWDO 51$ IURP GHYHORSLQJ VDOLYDU\ JODQGV ,Q FRPSDULVRQ E\ XVLQJ FRPSHWLWLRQEDVHG TXDQWLWDWLYH 573&5 WR REWDLQ TXDQWLWDWLYH LQIRUPDWLRQ RQ HDFK (&0 P51$ OHYHOV RQO\ SJ RI WRWDO 51$ SHU PHVVDJH ZDV QHHGHG PDNLQJ LW IROG PRUH VHQVLWLYH WKDQ WUDGLWLRQDOO\ XVHG WHFKQLTXHV ,Q DGGLWLRQ WKH WHFKQLTXH GRHV QRW UHTXLUH UDGLRDFWLYHO\ODEHOHG SUREHV DQG KDV WKH DGGHG FRQYHQLHQFH DQG VSHHG RI 3&5 &RPSHWLWLRQEDVHG 573&5 SHUPLWV DQ DFFXUDWH FDOFXODWLRQ RI WKH QXPEHU RI P51$ PROHFXOHV LQ D VDPSOH DQG DOVR DOORZV IRU TXDQWLWDWLYH FRPSDULVRQV EHWZHHQ GLIIHUHQW H[SHULPHQWV 7KH LQFUHDVHV LQ (&0 JHQH H[SUHVVLRQ REVHUYHG DW ERWK IHWDO GD\ DQG QHRQDWDO GD\ )LJXUH f RFFXU LPPHGLDWHO\ EHIRUH WZR LPSRUWDQW IXQFWLRQDO FKDQJHV LQ VXEPDQGLEXODU JODQG GHYHORSPHQW %HJLQQLQJ RQ IHWDO GD\ IROORZLQJ WKH LQLWLDO PRUSKRJHQHWLF VWDJH RI VDOLYDU\ JODQG GHYHORSPHQW F\WRGLIIHUHQWLDWLRQ RU WKH LQLWLDWLRQ RI VSHFLDOL]HG VDOLYDU\VSHFLILF SURWHLQ V\QWKHVLV LH DP\ODVH DQG SDURWLGVSHFLILF SURWHLQf ZLWKLQ WKH EUDQFKLQJ VWUXFWXUH EHJLQV 3RXOVHQ HW DO f ,Q DGGLWLRQ WKH H[SUHVVLRQ RI PXF PXFLQ ZKLFK FRUUHODWHV ZLWK HSLWKHOLDO GLIIHUHQWLDWLRQ GXULQJ PRUSKRJHQHVLV LV ILUVW VHHQ DW GD\ LQ GHYHORSLQJ PRXVH VXEPDQGLEXODU JODQGV %UDJD

PAGE 93

HW DO f 7KH GUDPDWLF LQFUHDVHV LQ (&0 JHQH H[SUHVVLRQ DW GD\ DSSHDU WR UHSUHVHQW WKH PRVW GUDPDWLF FKDQJHV LQ PRUSKRJHQHVLV DQG WKH LQLWLDWLRQ RI F\WRGLIIHUHQWLDWLRQ /LNHZLVH WKH VPDOO SHDN LQ (&0 JHQH H[SUHVVLRQ REVHUYHG DW QHRQDWDO GD\ RFFXUV MXVW SULRU WR WKH GHYHORSPHQW RI WKH VWLPXOXVVHFUHWLRQ FRXSOLQJ V\VWHP WKDW RFFXUV DW WKH VXFNOLQJZHDQOLQJ WUDQVLWLRQ 5HFHQWO\ LW ZDV VKRZQ WKDW JOXFRFRUWLFRLGV UHJXODWH PRUSKRJHQHVLV LQ VHYHUDO EUDQFKLQJ RUJDQV LQFOXGLQJ VDOLYDU\ JODQGV -DVNROO HW DO f VWXGLHG WKH JOXFRFRUWLFRLG UHFHSWRU VLJQDO WUDQVGXFWLRQ SDWKZD\ GXULQJ PRXVH VXEPDQGLEXODU JODQG GHYHORSPHQW DQG REVHUYHG DQ LQFUHDVH LQ WKH QXPEHU RI EUDQFKHV LQ HPEU\RV DIWHU PDWHUQDO LQMHFWLRQV RI JOXFRFRUWLFRLGV ,Q DGGLWLRQ WKH DGPLQLVWUDWLRQ RI JOXFRFRUWLFRLGV LQ WHUR HQKDQFHG WKH H[SUHVVLRQ RI DFLQDUFHOOVSHFLILF PXFLQ SURWHLQ $QRWKHU FRPSRQHQW RI WKLV VWXG\ ZDV WKH GHWHFWLRQ RI WUDQVIRUPLQJ JURZWK IDFWRU EHWD 7*)3f DQG P51$ WUDQVFULSWV LQ HPEU\RQLF VXEPDQGLEXODU JODQGV 1RUWKHUQ DQDO\VLV VXJJHVWHG WKDW WKH JOXFRFRUWLFRLG VLJQDO WUDQVGXFWLRQ SDWKZD\ PRGXODWHV WKH UDWH RI PRUSKRJHQHVLV E\ UHJXODWLQJ 7*)3 DQG P51$ H[SUHVVLRQ 7KLV LV DQ LPSRUWDQW REVHUYDWLRQ VLQFH 7*)SV DUH NQRZQ WR LQGXFH JHQH H[SUHVVLRQ RI H[WUDFHOOXODU PDWUL[ PROHFXOHV LQFOXGLQJ FROODJHQV ILEURQHFWLQ HODVWLQ O\V\O R[LGDVH DQG 7,036 DV ZHOO DV GRZQUHJXODWH (&0GHJUDGLQJ HQ]\PHV 0DFDXOH\ HW DO F 0DVV£JXH f *OXFRFRUWLFRLGV FRXOG WKHQ LQGLUHFWO\ DIIHFW WKH EUDQFKLQJ PRUSKRJHQHVLV E\ UHJXODWLQJ WKH OHYHOV RI 7*)3V ZKLFK LQ WXUQ XSUHJXODWH WKH H[SUHVVLRQ DQG GHSRVLWLRQ RI PROHFXOHV PDNLQJ XS WKH H[WUDFHOOXODU PDWUL[

PAGE 94

5HGPDQ f ZKR QRWHG WKDW WKH KLJK OHYHOV RI ODPLQLQ DQG FROODJHQ W\SHV DO,9f DQG D f H[SUHVVLRQ DW WKH HDUO\ VWDJHV RI QHRQDWDO SDURWLG JODQG GHYHORSPHQW PD\ KDYH LQGLFDWHG WKDW WKH LPPDWXUH DFLQDU DQG GXFWDO FHOOV DQG WKH PHVHQFK\PH SURGXFH WKHVH (&0 FRPSRQHQWV DW D IDVWHU UDWH WKDQ RI WKHLU PDWXUH FRXQWHUSDUWV LQ GHYHORSPHQW 7KLV REVHUYDWLRQ KDV EHHQ YDOLGDWHG E\ WKH TXDQWLWDWLRQ RI (&0 JHQH H[SUHVVLRQ LQ ZKLFK IHWDO DQG QHRQDWDO VXEPDQGLEXODU JODQG JHQH H[SUHVVLRQ ZDV PXFK KLJKHU WKDQ WKH DGXOW 7KH FKDQJHV LQ ODPLQLQ DQG FROODJHQ H[SUHVVLRQ VXJJHVWV WKH LQYROYHPHQW RI WKHVH FRPSRQHQWV LQ WKH SURIRXQG FKDQJHV LQ DFLQDU DQG GXFWDO FHOO PRUSKRJHQHVLV SUROLIHUDWLRQ DQG GLIIHUHQWLDWLRQ ZKLFK WDNH SODFH GXULQJ SDURWLG JODQG SRVWQDWDO GHYHORSPHQW 5HGPDQ f 7KH VKDUS GHFUHDVH RI ODPLQLQ FROODJHQV W\SH DO,9f DQG D f VHHQ DW GD\ FRLQFLGHG ZLWK WKH RQVHW RI DFLQDU DQG GXFWDO FHOO F\WRGLIIHUHQWLDWLRQ $W WKLV DQG ODWHU DJHV WKH EDVDO VXUIDFH RI WKH FHOOV KDYH QHDUO\ FRQWDFWHG HDFK RWKHU DQG WKH H[WUDFHOOXODU VSDFH KDV EHHQ GLPLQLVKHG 5HGPDQ f 7KHUHIRUH RQH FRQVHTXHQFH RI WKH GHFOLQH RI ODPLQLQ DQG FROODJHQV DQG ,9 PD\ EH WKH GHFUHDVH RI (&0 GXH WR GLVSODFHPHQW DV WKH DFLQL DQG WKH GXFWDO FHOOV DWWDLQ SUR[LPLW\ DW WKH ODWHU VWDJHV RI GHYHORSPHQW /D]RZVNL HW DO f $OWKRXJK PRVW EDVHPHQW PHPEUDQHV SRVVHVV WZR VFDIIROGLQJ PROHFXOHV FROODJHQ W\SH ,9 DQG ODPLQLQ VHYHUDO GHYHORSLQJ WLVVXHV SURGXFH EDVHPHQW PHPEUDQHV WKDW LQLWLDOO\ ODFN W\SH ,9 FROODJHQ EXW SRVVHVV ODPLQLQ &RRSHU DQG 0DF4XHHQ /HLYR HW DO f 7KLV FRQGLWLRQ LV REVHUYHG ERWK LQ WKH HPEU\R DQG LQ FDSLOODU\ JURZWK GXULQJ WLVVXH UHSDLU :KHUHDV WKH W\SH ,9 FROODJHQ SRO\PHU EHFRPHV UDSLGO\ FURVVOLQNHG RQ IRUPDWLRQ DQG LV HVVHQWLDOO\ LUUHYHUVLEOH WKH ODPLQLQ SRO\PHU FDQ UHPDLQ LQ D

PAGE 95

UHYHUVLEOH VWDWH /DPLQLQ WKHUHIRUH PD\ EH EHWWHU VXLWHG DV D PDWUL[ VFDIIROGLQJ LQ EDVHPHQW PHPEUDQHV WKDW DUH XQGHUJRLQJ UDSLG UHPRGHOLQJ ,W PD\ EH WKDW ODPLQLQ LV WKH SULQFLSOH SRO\PHU RI WKH GHYHORSLQJ PRXVH VXEPDQGLEXODU JODQG DQG H[SODLQV ZK\ FROODJHQ DO,9f OHYHOV ZHUH EHORZ GHWHFWLRQ HYHQ DW GD\ ZKHQ PRVW (&0 JHQH H[SUHVVLRQ ZDV RSWLPDO $Q LQFUHDVH LQ ODPLQLQ H[SUHVVLRQ PLJKW EH H[SHFWHG LQ UDSLGO\ GHYHORSLQJ VXEPDQGLEXODU JODQGV VLQFH WKH PLJUDWLRQ RI ILEUREODVWV KDV EHHQ VKRZQ WR LQYROYH WKH LQWHUDFWLRQ RI WKH FDUERK\GUDWH PRLHWLHV RI ODPLQLQ ZLWK FHOO VXUIDFH SL JDODFWRV\OWUDQVIHUDVH *DO7DVHf %HJRYDF HW DO f SL *DO7DVH LV H[SUHVVHG LQ VSDWLDOO\UHVWULFWHG FHOO W\SHVSHFLILF GRPDLQV ZKHUH LW IXQFWLRQV DV D UHFHSWRU IRU H[WUDFHOOXODU ROLJRVDFFKDULGH OLJDQGV GXULQJ PLJUDWLRQ DQG KDV EHHQ VKRZQ WR EH SUHVHQW RQ WKH OHDGLQJ DQG WUDLOLQJ HGJHV RI PLJUDWLQJ FHOOV ,Q DGGLWLRQ LW KDV EHHQ VKRZQ WR ELQG WR VSHFLILF 1OLQNHG ROLJRVDFFKDULGHV ZLWKLQ ODPLQLQ ,QFUHDVHG H[SUHVVLRQ RI ODPLQLQ DV ZRXOG EH H[SHFWHG GXULQJ KLJKO\ SUROLIHUDWLYH VWDJHV RI GHYHORSPHQW VXFK DV WKH PRUSKRJHQHVLV DQG F\WRGLIIHUHQWLDWLRQ RI VXEPDQGLEXODU JODQGV 5HFHQWO\ LW ZDV FRQILUPHG WKDW FHOOVXUIDFH *DO7DVH KDV WKH KLJKHVW H[SUHVVLRQ DW GD\ IHWDO PRXVH VXEPDQGLEXODU JODQG GHYHORSPHQW 2[IRUG HW DO f 7KH LPPXQRKLVWRFKHPLFDO ORFDOL]DWLRQ RI WKH (&0 SURWHLQV LQ PRXVH VXEPDQGLEXODU JODQGV ZDV FRQVLVWHQW ZLWK HDUOLHU UHSRUWV E\ +DUGPDQ DQG 6SRRQHU f 6SRRQHU f DQG /D]RZVNL f 7KH GLVWULEXWLRQ RI WKH H[WUDFHOOXODU PDWUL[ SURWHLQV LQ ERWK GHYHORSLQJ DQG PDWXUH VDOLYDU\ JODQGV LV VKRZQ LQ )LJXUH

PAGE 96

)LJXUH 6FKHPDWLF UHSUHVHQWDWLRQ RI WKH H[SUHVVLRQ RI (&0 SURWHLQV LQ GHYHORSLQJ PRXVH VXEPDQGLEXODU JODQGV +DWFKHG DUHDV UHSUHVHQW WKH ORFDWLRQ RI LPPXQRUHDFWLYH SURWHLQ Df FROODJHQ FROODJHQ ,,, DQG FROODJHQ ,9 Ef ILEURQHFWLQ ODPLQLQ DQG O\V\O R[LGDVH

PAGE 97

'D\ $GXOW &ROODJHQ &ROODJHQ ,,,

PAGE 98

'D\ $GXOW )LEURQHFWLQ )LJXUH f§ FRQWLQXHG

PAGE 99

)LJXUH UHSRUWV RQ WKH ORFDOL]DWLRQ RI WKH (&0 P51$V 7KH ZRUN UHSRUWHG KHUH ZDV GRQH WR FRLQFLGH DQG FRUUHODWH ZLWK WKH GDWD FROOHFWHG IURP WKH TXDQWLWDWLYH 573&5 PHDVXUHPHQWV RI (&0 JHQH H[SUHVVLRQ 7KHUH ZDV D GLIIHUHQFH QRWHG KRZHYHU ,Q +DUGPDQ DQG 6SRRQHU f ODPLQLQ ZDV IRXQG H[FOXVLYHO\ UHVWULFWHG WR WKH EDVHPHQW PHPEUDQH )LJXUH ( KRZHYHU VKRZV ODPLQLQ ZKLOH SULPDULO\ LQ WKH PHVHQFK\PH DQG EDVHPHQW PHPEUDQH DOVR SUHVHQW DW GD\ LQ WKH HSLWKHOLXP ,Q DGGLWLRQ FROODJHQ ,9 ZDV IRXQG OLNH +DUGPDQ DQG 6SRRQHU WR EH SUHVHQW LQ EDVHPHQW PHPEUDQH DQG WKH PHVHQFK\PH 7KH H[LVWHQFH RI EDVHPHQW PHPEUDQH FRQVWLWXHQWV VXFK DV FROODJHQ ,9 DQG ODPLQLQ LQ WKH LQWHUVWLWLDO PDWUL[HV RI GHYHORSLQJ WLVVXHV DQG HPEU\RV LV QRW XQFRPPRQ EXW LV XVXDOO\ WUDQVLHQW )LWFK DQG /LQVHQPD\HU f 7KH ILUVW UHSRUW RI FROODJHQ ,9 QRW EHLQJ IRXQG H[FOXVLYHO\ LQ WKH EDVHPHQW PHPEUDQH LQ VKHHWOLNH DUUDQJHPHQWV ZDV E\ &KHQ DQG /LWWOH ZKR GHPRQVWUDWHG WKDW FROODJHQ ,9 ZDV V\QWKHVL]HG DV fVKRUW ZLVSOLNHf ILEHUV E\ PRXVH HPEU\RQLF OXQJ PHVHQFK\PDO FHOOV DQG DUH QRW IRXQG ZLWKLQ WKH EDVHPHQW PHPEUDQH &KHQ DQG /LWWOH f .DGR\D DQG
PAGE 100

/LNH WKH ZRUN RI 1DNDQLVKL DQG ,VKLL f DQG 1DNDQLVKL DQG FROOHDJXHV f FROODJHQ ,,, DSSHDUHG WR EH GLVFRQWLQXRXV DORQJ WKH HSLWKHOLDOPHVHQFK\PDO LQWHUIDFH EXW LW GLG QRW DSSHDU WR EH PRUH SUHYDOHQW DW WKH FOHIWV 7KH VDPH SRO\FORQDO DQWLERG\ 6RXWKHUQ %LRWHFKQRORJ\ $VVRFLDWHV ,QFf ZDV XVHG IRU WKLV ORFDOL]DWLRQ KRZHYHU 1DNDQLVKL FRQFHQWUDWHG RQ HDUOLHU HSLWKHOLDO IRUPDWLRQ DW GD\V DQG :LWK WKLV LQIRUPDWLRQ 1DNDQLVKL SURSRVHG D ZRUNLQJ PRGHO RQ KRZ WKH PHVHQFK\PDO FHOOV VHFUHWH FROODJHQ ZKLFK H[HUWV PHFKDQLFDO IRUFH WR WKH HSLWKHOLXP JLYLQJ VWUDLQ WR WKH VXUIDFH RI WKH HSLWKHOLDO OREXOH DQG LQLWLDWLQJ FOHIW IRUPDWLRQ 7KH WHPSRUDO LQFUHDVHV LQ FROODJHQ D ,,,f GR VXJJHVW WKDW FROODJHQ ,,, SOD\V D PDMRU UROH LQ PRUSKRJHQHVLV 7KH OLWHUDWXUH UHSRUWV WKDW WKH H[WUDFHOOXODU PDWUL[ DQG LQ SDUWLFXODU W\SHV ,,, DQG ,9 FROODJHQ ODPLQLQ DQG FKRQGURLWLQ VXOIDWH SURWHRJO\FDQ SOD\ UROHV LQ WKH FRQWURO RI JODQGXODU PRUSKRJHQHVLV :LWK WKH H[FHSWLRQ RI W\SH ,9 FROODJHQ DQG SRVVLEO\ ODPLQLQ KRZHYHU WKHVH PROHFXOHV GR QRW DSSHDU WR EH LQYROYHG LQ WKH UHJXODWLRQ RI F\WRGLIIHUHQWLDWLRQ RI VDOLYDU\ JODQG VHFUHWRU\ FHOOV +RZHYHU RI WKH H[WUDFHOOXODU PDWUL[ PROHFXOHV WHVWHG WR GDWH RQO\ W\SH ,9 FROODJHQ DSSHDUV WR SOD\ D VLJQLILFDQW UROH LQ WKH UHJXODWLRQ RI VDOLYDU\ JODQG VHFUHWRU\ FHOO GLIIHUHQWLDWLRQ 7KH H[SUHVVLRQ RI D QXPEHU RI H[WUDFHOOXODU PDWUL[ JHQHV DQG WKHLU PHVVDJH ORFDOL]DWLRQ LQ YDULRXV GHYHORSLQJ WLVVXHV KDV EHHQ UHSRUWHG $QGXMDU HW DO /XNLQPDD HW DO 0F'RQDOG DQG 7XDQ 6DUWK\ f ,Q HPEU\RQLF OXQJ PRUSKRJHQHVLV ODPLQLQ % DQG % ZDV H[SUHVVHG HYHQO\ WKURXJKRXW WKH PHVHQFK\PDO FRPSDUWPHQW DQG ZDV KLJKHU LQ WKH HSLWKHOLDO EXGV 7KRPDV DQG ']LDGHN f &ROODJHQ DO,9f ZDV IRXQG WKURXJKRXW WKH HSLWKHOLDO OD\HU DQG WKH PHVHQFK\PH ,Q WKDW

PAGE 101

UHSRUW OLNH WKH UHVXOWV UHSRUWHG LQ )LJXUH & WKHUH LV D FRQFHQWUDWLRQ RI VWDLQLQJ RQ WKH EDVHPHQW PHPEUDQHV 7KH H[SUHVVLRQ RI ILEURQHFWLQ KDV EHHQ H[DPLQHG LQ UDW IHWDO KHDUW ZKHUH DJDLQ VWDLQLQJ ZDV HYLGHQW LQ FHOOV EXW DOVR DSSHDUHG WR EH ORFDOL]HG WR D WKLQ OD\HU DORQJ WKH EDVHPHQW PHPEUDQHV 6DPXHO HW DO f /DXULH HW DO f H[DPLQHG WKH H[SUHVVLRQ RI ODPLQLQ UHFHSWRU ODPLQLQ DQG FROODJHQ W\SH ,9 LQ GHYHORSLQJ NLGQH\ ,Q WKDW UHSRUW LW ZDV IRXQG WKDW WKH H[SUHVVLRQ RI ODPLQLQ UHFHSWRU P51$ SUHFHGHG WKDW RI ODPLQLQ DQG FROODJHQ W\SH ,9 P51$V $JDLQ VSHFLILF VWDLQLQJ DSSHDUHG WR IROORZ WKH EDVHPHQW PHPEUDQHV ([SUHVVLRQ RI ODPLQLQ ZDV H[DPLQHG LQ KXPDQ IHWDO OXQJ GHYHORSPHQW E\ /DOOHPDQG HW DO f ZKR VKRZHG WKDW ODPLQLQ LV H[SUHVVHG E\ ERWK HSLWKHOLDO DQG PHVHQFK\PDO FHOOV (DFK RI WKHVH UHSRUWV LV LPSRUWDQW LQ XQGHUVWDQGLQJ WKH H[SHFWHG GLVWULEXWLRQ RI (&0 P51$V LQ GHYHORSLQJ WLVVXHV :LWK WKH FRQVWUXFWLRQ RI WKH S0$75,; VXSHUWHPSODWH DQG WKH DGYHQW RI FRPSHWLWLYH 4573&5 WHFKQRORJ\ LW KDV EHHQ SRVVLEOH WR PHDVXUH VPDOO FKDQJHV LQ (&0 JHQH H[SUHVVLRQ GXULQJ WKH GHYHORSPHQW RI IHWDO PRXVH VXEPDQGLEXODU JODQGV +RZHYHU WKH DELOLW\ WR VWXG\ JHQH H[SUHVVLRQ IURP VDOLYDU\ JODQG WLVVXHV LV QRW FRQILQHG WR GHYHORSPHQW :LWK WKH FRRUGLQDWHG H[SUHVVLRQ RI WKH H[WUDFHOOXODU PDWUL[ GHPRQVWUDWHG XVLQJ S0$75,; RWKHU fWKHPDWLFf SODVPLGV )LJXUH f 7DPX]]HU HW DO Df FRQWDLQLQJ WKH VHTXHQFHV IRU JURZWK IDFWRUV PDWUL[ PHWDOORSURWHLQDVHV F\WRNLQHV FHOO F\FOH SURWHLQV DQG VDOLYDU\VSHFLILF SURWHLQV KDYH EHHQ GLVFXVVHG 7KHUH DUH D QXPEHU RI RWKHU DSSOLFDWLRQV RI WKHVH SODVPLGV LQ GHQWDO VFLHQFHV LQFOXGLQJ VWXG\LQJ SHULRGRQWDO GLVHDVH WXPRU ELRORJ\ WRRWK PRUSKRJHQHVLV RUDO SDWKRORJLHV DQG FUDQLRIDFLDO GHYHORSPHQW 0HDVXULQJ JHQH H[SUHVVLRQ IURP WKHVH PLQXVFXOH WLVVXHV XVLQJ

PAGE 102

VXSHUWHPSODWH SODVPLGV DQG 4573&5 FRXOG OHDG WR D IXQGDPHQWDO XQGHUVWDQGLQJ RI IDFWRUV WKDW FRQWULEXWH WR ERWK QRUPDO GHYHORSPHQW DQG WKH LQLWLDWLRQ DQG SURJUHVVLRQ RI GLVHDVH

PAGE 103

)LJXUH 3RWHQWLDO OLVW RI RWKHU WKHPDWLF VXSHUWHPSODWHV

PAGE 104

(SLGHUPDO *URZWK )DFWRU )DPLO\ 7UDQVIRUPLQJ *URZWK )DFWRU %HWD (SLGHUPDO JURZWK IDFWRU 7UDQVIRUPLQJ JURZWK IDFWRU D 7UDQVIRUPLQJ JURZWK IDFWRU UHFHSWRU 7UDQVIRUPLQJ JURZWK IDFWRU SL 7UDQVIRUPLQJ JURZWK IDFWRU S 7UDQVIRUPLQJ JURZWK IDFWRU 3 7UDQVIRUPLQJ JURZWK IDFWRU SLOUHFHSWRU 3ODWHOHW 'HULYHG *URZWK )DFWRU )DPLO\ )LEUREODVW *URZWK )DFWRUV 3ODWHOHW GHULYHG JURZWK IDFWRU $ 3ODWHOHW GHULYHG JURZWK IDFWRU % 3ODWHOHW GHULYHG JURZWK IDFWRU UHFHSWRU D 3ODWHOHW GHULYHG JURZWK IDFWRU UHFHSWRU S DFLGLF )LEUREODVW JURZWK IDFWRU EDVLF )LEUREODVW JURZWK IDFWRU )LEUREODVW JURZWK IDFWRU UHFHSWRU 0DWUL[ 0HWDOORSURWHLQDVHV 7LVVXHLQKLELWRUV RI 003V 7\SH FROODJHQDVH 003f N' JHODWLQDVH 003f 6WURPHO\VLQ 003f 3803 003f N' FROODJHQDVH 003f QHXWURSKLO HODVWDVH 7LVVXHLQKLELWRU RI 003V 703f 7LVVXHLQKLELWRU RI 003V ,, 7,03f &HOOF\FOH SURWHLQV &\WRNLQHV ,QWHUOHXNLQ OD ,QWHUOHXNLQ OE ,QWHUOHXNLQ ,QWHUOHXNLQ ,QWHUOHXNLQ 7XPRU QHFURVLV IDFWRU D 7XPRU QHFURVLV IDFWRU UHFHSWRU Sf 7XPRU QHFURVLV IDFWRU UHFHSWRU ,, Sf ,QWHUOHXNLQ UHFHSWRU DQWDJRQLVW ,QWHUOHXNLQ UHFHSWRU Sf 6DOLYDU\ JODQG VSHFLILF SURWHLQV +LVWDWLQ 3DURWLGVSHFLILF SURWHLQ 363f $P\ODVH &\VWDWLQ 6 3UROLQHULFK SURWHLQV 3*DODFWRV\OWUDQVIHUDVH /\VR]\PH /DFWRIHUULQ 0XFLQ .DOOLNULHQ ([WUDFHOOXODU 0DWUL[ &ROODJHQ D,f &ROODJHQ DO,,,f &ROODJHQ DO,9f )LEURQHFWLQ /DPLQLQ % /DPLQLQ % (ODVWLQ /\V\O R[LGDVH 2QFRJHQHV FHUE$ FHUE% F+UDV FVUF FPRV FUDI FP\F F IRV FMXQ 6LJQDOWUDQVGXFWLRQ IDFWRUV F$03 3URWHLQ NLQDVH $ 3URWHLQ NLQDVH & 0$3 NLQDVH 0$3. NLQDVH 3URWHLQ OLSDVH &\ 5DI *$3 ,QVXOLQOLNH *URZWK )DFWRU )DPLO\ ,QVXOLQOLNH JURZWK IDFWRU ,QVXOLQOLNH JURZWK IDFWRU UHFHSWRU ,QVXOLQOLNH JURZWK IDFWRU ,, ,QVXOLQOLNH JURZWK IDFWRU ,, UHFHSWRU ,QVXOLQOLNH JURZWK IDFWRU ELQGLQJ SURWHLQ ,QVXOLQOLNH JURZWK IDFWRU ELQGLQJ SURWHLQ ,QVXOLQOLNH JURZWK IDFWRU ELQGLQJ SURWHLQ ,QVXOLQOLNH JURZWK IDFWRU ELQGLQJ SURWHLQ ,QVXOLQOLNH JURZWK IDFWRU ELQGLQJ SURWHLQ ,QVXOLQ ,QVXOLQ UHFHSWRU ‘!

PAGE 105

&+$37(5 ),9( 27+(5 678',(6 ,Q DGGLWLRQ WR WKH UHVHDUFK GHWDLOHG LQ WKH SUHFHGLQJ IRXU FKDSWHUV QXPHURXV RWKHU FROODERUDWLYH UHVHDUFK HIIRUWV KDYH UHVXOWHG LQ SXEOLVKHG PDQXVFULSWV 7KH DEVWUDFWV IRU HDFK RI WKHVH PDQXVFULSWV LV LQFOXGHG KHUH $V D 0DUFK RI 'LPHV 3UHGRFWRUDO )HOORZ LQ WKH 'HSDUWPHQW RI %LRFKHPLVWU\ DQG 0ROHFXODU %LRORJ\ WKH LQLWLDO UHVHDUFK FHQWHUHG RQ WKH FORQLQJ DQG FKDUDFWHUL]DWLRQ RI WKH KXPDQ O\V\O R[LGDVH JHQH /DWHU DV D 1(, WUDLQHH LQ WKH ODERUDWRU\ RI 'U *UHJRU\ 6FKXOW] WKH UHVHDUFK HIIRUWV VKLIWHG WRZDUG XQGHUVWDQGLQJ WKH UHJXODWLRQ RI O\V\O R[LGDVH E\ JURZWK IDFWRUV LQ ZRXQG KHDOLQJ ,Q DGGLWLRQ H[FLWLQJ ZRUN ZDV GRQH RQ FKDUDFWHUL]LQJ JURZWK IDFWRUV LQ RFXODU DQG VNLQ ZRXQG KHDOLQJ DV ZHOO DV LQ XQGHUVWDQGLQJ WKH PLFURHQYLURQPHQW RI FKURQLF ZRXQGV DQG KRZ PDWUL[ PHWDOORSURWHLQDVHV PD\ SOD\ D UROH LQ WKH FKURQLFLW\ RI WKHVH ZRXQGV )LQDOO\ DV D 1,'5 7UDLQHH LQ WKH 'HSDUWPHQW RI 2UDO %LRORJ\ WKH ZRUN VKLIWHG WRZDUG WKH GLVVHUWDWLRQ SURMHFW DV ZHOO DV LGHQWLI\LQJ JURZWK IDFWRUV V\QWKHVL]HG E\ WKH VDOLYDU\ JODQGV DQG SUHVHQW LQ VDOLYD ,W LV GLIILFXOW WR ILQG D XQLI\LQJ WKHPH IRU DOO RI WKHVH UHVHDUFK HIIRUWV EXW FRPPRQ WR PRVW RI WKH UHFHQW PDQXVFULSWV LV WKH LGHQWLILFDWLRQ DQG PROHFXODU FKDUDFWHUL]DWLRQ RI SHSWLGH JURZWK IDFWRUV SUHVHQW LQ ZRXQGV WHDUV DQG VDOLYD ZKLFK PD\ SOD\ DQ LPSRUWDQW UROH LQ WKH QRUPDO ZRXQG KHDOLQJ RI VNLQ WKH H\H DQG WKH RUDO FDYLW\ UHVSHFWLYHO\

PAGE 106

0\ LQLWLDO UHVHDUFK SURMHFW LQYROYHG WKH FORQLQJ DQG FKDUDFWHUL]DWLRQ RI WKH KXPDQ O\V\O R[LGDVH JHQH 6YLQDULFK HW DO f 7KLV ZRUN ZDV GRQH H[FOXVLYHO\ LQ WKH ODERUDWRU\ RI 7KRPDV 3
PAGE 107

HIIHFW RI 7*)SL RQ FROODJHQ D,f HODVWLQ DQG O\V\O R[LGDVH JHQH H[SUHVVLRQ LQ WKH FKURQLF VWDWH RI ODU\QJHDO VWHQRVLV :KLOH LQ WKH 6FKXOW] ODERUDWRU\ D QXPEHU RI FROODERUDWLYH HIIRUWV ZHUH LQLWLDWHG WKDW UHVXOWHG LQ SXEOLVKHG PDQXVFULSWV 7KH ILUVW SURMHFW ZDV LQ FROODERUDWLRQ ZLWK 'U 0LFKDHO +XPSKUH\V%HKHU LQ WKH 'HSDUWPHQW RI 2UDO %LRORJ\ 7KLV SURMHFW VRXJKW WR LGHQWLI\ JURZWK IDFWRUV SURGXFHG DQG VHFUHWHG E\ WKH VDOLYDU\ JODQGV DQG SUHVHQW LQ WKH VDOLYD +XPSKUH\V%HKHU HW DO f 7KH SUHVHQFH RI HSLGHUPDO JURZWK IDFWRU (*)f KDV EHHQ NQRZQ VLQFH LW ZDV LVRODWHG IURP PRXVH VDOLYDU\ JODQGV LQ :KLOH WKH H[DFW UHDVRQ ZK\ WKH GXFWDO FHOOV RI WKH VDOLYDU\ JODQGV SURGXFH VR PXFK LV QRW FRPSOHWHO\ XQGHUVWRRG EXW LW LV SURSRVHG WKDW (*) SURWHFWV WKH RUDO DQG JXW PXFRVD IURP WKH FRQVWDQW GDPDJH VHHQ ZLWK PDVWLFDWLRQ 7KH SUHVHQFH RI RWKHU JURZWK IDFWRUV LQ WKH (*) IDPLO\ KDG QRW SUHYLRXVO\ EHHQ UHSRUWHG ,Q WKLV UHSRUW WKH OHYHOV RI 7*)D ZHUH GHWHUPLQHG DQG FRPSDUHG ZLWK SDWLHQWV H[KLELWLQJ RUDO SDWKRORJLHV QDPHO\ [HURVWRPLD DQG 3DGJHWfV GLVHDVH ,W KDV ORQJ EHHQ NQRZQ WKDW VDOLYDU\ FRQVWLWXHQWV FDUU\ RXW D QXPEHU RI ELRORJLFDO IXQFWLRQV ZKLFK DUH NH\ WR PDLQWDLQLQJ RUDO KHDOWK 7KH SURWHLQV VHFUHWHG E\ VDOLYD DLG LQ OXEULFDWLRQ RI WKH KDUG DQG VRIW WLVVXHV GLJHVWLRQ UHPLQHUDOL]DWLRQ DV ZHOO DV SURYLGH DQWLPLFURELDO DFWLYLW\ 0RUHRYHU VDOLYD FRQWDLQV IDFWRUV WKDW PDLQWDLQ PXFRVDO LQWHJULW\ 7KH SUHVHQFH RI (*) LQ VDOLYD KDV EHHQ SURSRVHG WR EH DQ LPSRUWDQW IDFWRU LQ PDLQWDLQLQJ WKH LQWHJULW\ RI RUDO DQG JXW PXFRVD (*) DQG QHUYH JURZWK IDFWRU 1*)f KDYH EHHQ UHFRJQL]HG FRPSRQHQWV RI VDOLYD &RKHQ /HYL0RQWDOFLQL DQG &RKHQ f EXW

PAGE 108

UHFHQWO\ D QXPEHU RI PDQXVFULSWV KDYH UHSRUWHG WKH SUHVHQFH RI D FRQVLGHUDEOH QXPEHU RI RWKHU ELRORJLFDOO\ DFWLYH SHSWLGHV LQ VDOLYD 7KHVH LQFOXGH 7*)D +XPSKUH\V%HKHU HW DO D
PAGE 109

(*) 7*)Df DV ZHOO DV WKH (*) DQG W\SH ,, 7*)3 UHFHSWRU SUHVHQW LQ WKH H\H 7KH SRVLWLYH HIIHFWV RI 7*)3 LQ FRUQHDO ZRXQG KHDOLQJ WKHQ DUH WKRXJKW WR RFFXU LQ SDUW WKURXJK WKHVH FKDQJHV LQ WHQVLOH VWUHQJWK DQG JURZWK IDFWRU DQG UHFHSWRU P51$ OHYHOV ,Q OLJKW RI DOO WKH ZRUN GRQH LQ WKH 6FKXOW] ODERUDWRU\ RQ WKH UROH RI JURZWK IDFWRUV LQ RFXODU ZRXQG KHDOLQJ D PDQXVFULSW ZDV FRPSOHWHG ZKLFK LQFOXGHG DOO WKH NQRZQ GDWD OLQNLQJ QXPHURXV JURZWK IDFWRUV WR UROHV LQ RFXODU ZRXQG KHDOLQJ 6FKXOW] HW DO f $QRWKHU DVSHFW RI UHVHDUFK KDV EHHQ GHDOLQJ ZLWK XQGHUVWDQGLQJ WKH PLFURHQYLURQPHQW RI FKURQLF ZRXQGV 1RUPDO ZRXQG KHDOLQJ LV FKDUDFWHUL]HG E\ D FDVFDGH RI KLJKO\ UHJXODWHG UDWH OLPLWLQJ VWHSV 7KHUH DUH D QXPEHU RI SRVVLEOH UHJXODWRU\ VWHSV LQ WKH ILQH EDODQFH EHWZHHQ V\QWKHWLF DQG GHJUDGDWLYH SDWKZD\V LQ QRUPDO KHDOLQJ WKDW LI DOWHUHG FRXOG UHVXOW LQ FKURQLF ZRXQG IRUPDWLRQ &KURQLF ZRXQGV DUH FOLQLFDOO\ GHVFULEHG DV RSHQ ZRXQGV ZKLFK GR QRW KHDO E\ FRQYHQWLRQDO PHWKRGV )DFWRUV ZKLFK DUH NQRZQ WR FRQWULEXWH WR WKH SDWKRJHQHVLV RI FKURQLF ZRXQGV LQFOXGH R[\JHQ WHQVLRQ LQ WKH ZRXQG DQG OHYHOV RI FDOFLXP $QRWKHU IDFWRU WKDW LV QRZ XQGHUVWRRG WR FRQWULEXWH WR FKURQLF ZRXQGV LV WKH OHYHO RI SURWHDVHV PDLQO\ WKH PDWUL[ PHWDOORSURWHLQDVHV 003Vf $ QRUPDO SDUW RI ZRXQG KHDOLQJ LV WKH GHJUDGDWLRQ DQG WXUQRYHU RI WKH H[WUDFHOOXODU PDWUL[ DQG WKH V\QWKHVLV RI WKH QHZ PDWUL[ LQ WKH IRUP RI D VFDU ,Q FKURQLF ZRXQGV LW ZDV IRXQG WKDW WKH OHYHOV RI 003V DUH YHU\ KLJK UHVXOWLQJ LQ WKH GHJUDGDWLRQ RI QRW RQO\ WKH (&0 EXW RWKHU IDFWRUV LPSRUWDQW LQ WKH ZRXQG KHDOLQJ SURFHVV LH JURZWK IDFWRUV 2QH DSSURDFK WR EULQJ EDFN D QRUPDO EDODQFH RI V\QWKHVLV DQG GHJUDGDWLRQ LV WR LQKLELW WKH 003V XVLQJ V\QWKHWLF 003 LQKLELWRUV *HODUGLQ LV D

PAGE 110

GLSHSWLGH ZKLFK ILOOV WKH VXEVWUDWH ELQGLQJ VLWH DQG LQDFWLYDWHV 003V ,Q WKLV VWXG\ QXPHURXV ZRXQG IOXLGV FROOHFWHG IURP SDWLHQWV ZLWK RSHQ FKURQLFDOO\ QRQKHDOLQJ ZRXQGV ZDV FRPSDUHG WR ZRXQG IOXLG IURP QRUPDOO\ KHDOLQJ PDVWHFWRP\ LQFLVLRQV 7KH GDWD KDV EHHQ FRPSLOHG DQG LV SDUW RI D VHULHV RI PDQXVFULSWV ZKLFK ZLOO H[SORUH WKH GLIIHUHQFHV IRXQG LQ WKH PLFURHQYLURQPHQW RI FKURQLF ZRXQGV ZKLFK PD\ OHDG WR WKHLU QRQKHDOLQJ VWDWH 0DFDXOH\ HW DO VXEPLWWHG 7DPX]]HU HW DO VXEPLWWHGf )LQDOO\ WKH WHFKQLTXH RI FRPSHWLWLRQEDVHG TXDQWLWDWLYH 573&5 DQG WKH V\QWKHVLV RI WKH PXOWLVHTXHQFH SODVPLGV XWLOL]HG IRU WKLV WHFKQLTXH DUH GHVFULEHG LQ D PDQXVFULSW 7KLV UHSRUW GHWDLOV WKH VL[ SODVPLGV ZKLFK DUH KDYH V\QWKHVL]HG WR GDWH 7DPX]]HU HW DO f 7RJHWKHU PDQ\ RI WKHVH PDQXVFULSWV KDYH GHPRQVWUDWHG WKH LPSRUWDQFH RI JURZWK IDFWRUV LQ WKH QRUPDO SURFHVVHV DQG KHDOLQJ RI WKH VNLQ WKH H\H DQG WKH RUDO FDYLW\

PAGE 111

$33(1',; $ /,67 2) 2/,*218&/(27,'(6 6<17+(6,=(' )25 S0$75,; JHQH HQG VL]H ESf ILEURQHFWLQ f f LQW HODVWLQ f f LQW FROODJHQ D,f f f LQW FROODJHQ DO,,,f f f LQW FROODJHQ DO,9f f f LQW *7$. f f LQW ODPLQLQ % f f LQW ODPLQLQ % f f LQW O\V\O R[LGDVH f f LQW SDV SODV SODV SODV SODV SODV SODV SODV SRO\$fWDLO f f FRGHV 0+ 0+ 0+ 0+ 0+ 0+ 0+ 0+ 0+ 0+ 0+ 0+ 0+ 0+ 0+ 0+ 0+ 0+ 0+ 0+ 0+ 0+ 0+ 0+ 0+ 0+ 0+ 0+ 0+ 0+ 0+ 0+ 0+ 0+ 0+ 0+ 0+ 0+ 0+ 0+ 0+ 0+ 0+ 0+ 0+ 0+ 0+ 0+ 0+ 0+ 0+ 0+ 0+ 0+ 0+ 0+ 0+ 0+ 0+ 0+ 0+ 0+ 0+ 0+ 0+

PAGE 112

$33(1',; % 5(675,&7,21 0$3 2) S0$75,; 08/7,35,0(5 ,16(57 7 ) D V Q & % T 0QF 5 X 9 % % 6 VFU G P L E 6 S SL) H D + 9 U 0 ,,, , , , &&***77&7*$*7$&$&$*7&***&$*&&77&&7*$&&*$&7***$*$$&$$&***&$** + K **&&&$$*$&7&$7*7*7&$*&&&$7&**$$**$&7**&7*$&&&7&77*77*&&&*7&& ( ( 6 (+ 6 % &QF 6 0 & & F 6 D %&FD$%D6 3 & 0 YOR F0 D+ 9 9' R F X%VYRHYVXF X 9 Z LD5 UQ HS L LG 5 U VDL5,DSU L R -,, ), ,K 5 -H ) J--,,,*) ,9, ,, ,, ,, , ,,,,,,,,,, , 7*7**&7&&7**7*$*&*$**$&*7*&$**&77$*7*&&7**7**&&&7**$&&$$7*** + $&$&&*$**$&&$&7&*&7&&7*&$&*7&&*$$7&$&**$&&$&&***$&&7**77$&&& 7 W ( K ( ) 6& F 6 &%6 0 Q IY R F 0RVF ) % %+)+E 0 X $ G DL 5 U Q5DU R E ESVKR Z H 1, ) ,-) N V YKSDO R + X ,, , ,,,, , LQQ , &77$**$&$$*&$**&777&&7**$7*&&$****$**7*$$*$&&&7*&*&$*$$**&$* K + *$$7&&7*77&*7&&*$$$**$&&7$&**7&&&&7&&$&77&7***$&*&*7&77&&*7& ) 1 0 () &Q V3 & & $ D 1 & FQ6 % % 1% YX1SY5Y % 9 ,; % H % % $Y$RXF D9V'OV LK%XPL E L ZF V E VD OLO5U PEWSDD -+HOOD9 1P 9 UO X-Z,+) +Y
PAGE 113

(6 ) 6 1 FD 6 %HQ & &% D & RX$F HYX 0 9 96%' + 0 X $ 9 D1 5U HL Z L LDVV 3 Q 3 L ,V ,$Z) I -+ R -MOD K $ Q Z 5 ,S ,,,, ,,, , ,,,, , , , ,, &&7**7**&7*&&$$$*&&&$*&&*7**7*$$*7***7&$****$7&$*$**7*&$7*77 **$&&$&&*$&**777&***7&**&$&&$&77&$&&&$*7&&&&7$*7&7&&$&*7$&$$ % V 3 6 & 0% &1% % $0 1D I* DV%3 YOD $ 0V YE)OX UG( HDVP LDQ F QW DRLD OLD ,DOO -,, L ,; ,,Q, 2OH ,,,, ,9,, ,, ,,,9, ,,, &&&&$&*7***&7&&$$$&&*&&77$&&7&&&$*$*$$*7**7&&&777&77&$$7*$&& ****7*&$&&&*$**777**&**$$7**$***7&7&77&$&&$***$$$*$$*77$&7** + ; ( ( ) ) 1 *& D P F 6 F 6 & &Q&Q &V3 & GY)H00D R F R F % 9 $YXYX3$YSY6Y6 0%% LLROFVO 5 U 5 U E L OLLVOL%XILI QDE ,-NOUS, ) ) 9 5 X-+5+WX-,,F-H OQY ,,,,,,, , , , ,,,,,,,,,,,,, ,,, **&&*$&&&&7$&7$&$7&&$**$*$$&&7**7*&$$$7***$*&7*&$*&7***&77** &&**&7****$7*$7*7$**7&&7&77**$&&$&*777$&&&7&*$&*7&*$&&&*$$&& 6 ( + ( 1 $D %F16 & D F 6 % $%( & YX)VROF Y+H R F V OVV 9 % D U DLD5DU LDO 5 U S ZPS L V G ,Q-,,) -HO ) 1$ U 9 ,,,,,9, ,,, , ,,, L 7*&&$*$**$&77*77**7&&&7**&&77&&7**$&$*&$&&7*$$**$*$&***&77&& &&**&7****$7*$7*7$**7&&7&77**$&&$&*777$&&&7&*$&*7&*$&&&*$$&& ( & 2 % 6 , $*7**$$**$$7**77&$&** 7&$&&77&&77$&&$$*7*&&

PAGE 114

5()(5(1&(6 $OEHUWV % %UD\ /HZLV 5DII 0 5REHUWV DQG :DWVRQ f f0ROHFXODU %LRORJ\ RI WKH &HOOf *DUODQG 3XEOLVKLQJ ,QF 1HZ
PAGE 115

%HPILHOG 0 %DQHUMHH 6 DQG &RKQ 5 + f 'HSHQGHQFH RI VDOLYDU\ HSLWKHOLDO PRUSKRORJ\ DQG EUDQFKLQJ PRUSKRJHQHVLV XSRQ DFLG PXFRSRO\VDFFKDULGHSURWHLQ SURWHRJO\FDQf DW WKH HSLWKHOLDO VXUIDFH -RXUQDO RI &HOO %LRORJ\ %HPILHOG 0 %DQHUMHH 6 .RGD DQG 5DSUDJHU $ & f 5HPRGHOOLQJ RI WKH EDVHPHQW PHPEUDQH PRUSKRJHQHVLV DQG PDWXUDWLRQ ,Q f%DVHPHQW 0HPEUDQHV DQG &HOO 0RYHPHQWf 5 3RUWHU DQG :KHODQ (GVf SS 3LWWPDQ 3UHVV %DWK %HPILHOG 0 5 DQG %DQHLMHH 6 f $FLG PXFRSRO\VDFFKDULGH JO\FRVDPLQRJO\FDQf DW WKH HSLWKHOLDOPHVHQFK\PDO LQWHUIDFH RI PRXVH HPEU\R VDOLYDU\ JODQGV -RXUQDO RI &HOO %LRORJ\ %HPILHOG 0 5 DQG :HVVHOOV 1 f ,QWUD DQG H[WUDFHOOXODU FRQWURO RI HSLWKHOLDO PRUSKRJHQHVLV 'HYHORSPHQWDO %LRORJ\ 6XSSOf %LUN ( DQG /LQVHQPD\HU 7 ) f &ROODJHQ ILEULO DVVHPEO\ GHSRVLWLRQ DQG RUJDQL]DWLRQ LQWR WLVVXHVSHFLILF PDWULFHV ,Q f([WUDFHOOXODU 0DWUL[ $VVHPEO\ DQG 6WUXFWXUHf 3
PAGE 116

&DPSEHOO DQG 7HUUDQRYD 9 f /DPLQLQ PROHFXODU RUJDQL]DWLRQ DQG ELRORJLFDO IXQFWLRQ -RXUQDO RI 2UDO 3DWKRORJ\ &DPHPROOD % %DO]D ( 6LUL $ =DUGL / 1LFRWUD 0 %LJRWWL $ DQG 1DWDOL 3 f $ WXPRUDVVRFLDWHG ILEURQHFWLQ LVRIRUP JHQHUDWHG E\ DOWHUQDWLYH VSOLFLQJ RI PHVVHQJHU 51$ SUHFXUVRUV -RXUQDO RI &HOO %LRORJ\ &KHJLQL 1 5RVVL 0 6FKXOW] 'XQQ : DQG 0DVWHUVRQ % f &HOOXODU GLVWULEXWLRQ RI HSLGHUPDO JURZWK IDFWRU WUDQVIRUPLQJ JURZWK IDFWRUD DQG HSLGHUPDO JURZWK IDFWRU UHFHSWRU LQ IDVFLD DQG SHULWRQHXP GXULQJ KHDOLQJ LQ WKH UDW DQ DXWRUDGLRJUDSKLF DQG LPPXQRKLVWRFKHPLFDO VWXG\ :RXQG 5HSDLU DQG 5HJHQHUDWLRQ &KHQ -0 DQG /LWWOH & f &HOOV WKDW HPHUJH IURP HPEU\RQLF H[SODQWV SURGXFH ILEHUV RI W\SH ,9 FROODJHQ -RXUQDO RI &HOO %LRORJ\ &KHQ -0 DQG /LWWOH & f &HOOXODU HYHQWV DVVRFLDWHG ZLWK OXQJ EUDQFKLQJ PRUSKRJHQHVLV LQFOXGLQJ WKH GHSRVLWLRQ RI FROODJHQ W\SH ,9 'HYHORSPHQWDO %LRORJ\ &KHQ 5 DQG )XJJOH 6 f ,Q VLWX F'1$ SRO\PHUDVH FKDLQ UHDFWLRQ $ QRYHO WHFKQLTXH IRU GHWHFWLQJ P51$ H[SUHVVLRQ $PHULFDQ -RXUQDO RI 3DWKRORJ\ &KLHYLW] + f %HLWUDJH ]XU HQWZLFNHOXQJVJHVFKLFKWH GHU VSHLFKHOGULLVHQ $UFKLY IXU $QDWRPLH XQG (QWZLFNOXQJVJHVFKLFKWH &KLUJZLQ 3U]\E\OD $ 0DF'RQDOG 5 DQG 5XWWHU : f ,VRODWLRQ RI ELRORJLFDOO\ DFWLYH ULERQXFOHLF DFLG IURP VRXUFHV ULFK LQ ULERQXFOHDVHV %LRFKHPLVWU\ &RKHQ 6 f ,VRODWLRQ RI D PRXVH VXEPD[LOODU\ JODQG SURWHLQ DFFHOHUDWLQJ LQFLVRU HUXSWLRQ DQG H\HOLG RSHQLQJ LQ WKH QHZERUQ DQLPDO -RXUQDO RI %LRORJLFDO &KHPLVWU\ &RKQ 5 + %DQHUMHH 6 DQG %HPILHOG 0 f %DVDO ODPLQD RI HPEU\RQLF VDOLYDU\ HSLWKHOLD 1DWXUH RI JO\FRVDPLQRJO\FDQ DQG RUJDQL]DWLRQ RI H[WUDFHOOXODU PDWHULDOV -RXUQDO RI &HOO %LRORJ\ &ORYHQ 5 f )LEURQHFWLQ LQ ZRXQG KHDOLQJ ,Q f)LEURQHFWLQf 0RVKHU (Gf SS $FDGHPLF 3UHVV 1HZ
PAGE 117

&XWOHU / f 7KH UROH RI H[WUDFHOOXODU PDWUL[ LQ WKH PRUSKRJHQHVLV DQG GLIIHUHQWLDWLRQ RI VDOLYDU\ JODQGV $GYDQFHV LQ 'HQWDO 5HVHDUFK &XWOHU / 6 f f0RUSKRJHQHVLV DQG )XQFWLRQDO 'LIIHUHQWLDWLRQ RI WKH 5DW 6XEPDQGLEXODU *ODQG LQ 9LYR DQG LQ 9LWUR 8OWUDVWUXFWXUDO DQG %LRFKHPLFDO 6WXGLHVf 6WDWH 8QLYHUVLW\ RI 1HZ
PAGE 118

&XWOHU / 6 &KULVWLDQ & 3 DQG 5HQGHOO 5 Df 6XOIDWHG JO\FRVDPLQRJO\FDQ V\QWKHVLV E\ GHYHORSLQJ UDW VXEPDQGLEXODU JODQG VHFUHWRU\ XQLWV $UFKLYHV RI 2UDO %LRORJ\ &XWOHU / 6 &KULVWLDQ & 3 DQG 5R]HQVNL Ef ;\ORVHOLQNHG SURWHRJO\FDQ V\QWKHVLV GRHV QRW KDYH D SULPDU\ UROH LQ WKH FRQWURO RI VHFUHWRU\ FHOO GLIIHUHQWLDWLRQ LQ VDOLYDU\ JODQGV 'HYHORSPHQWDO %LRORJ\ &XWOHU / 6 6FKQH\HU & DQG &KULVWLDQ & 3 f 7KH LQIOXHQFH RI WKH V\PSDWKHWLF QHUYRXV V\VWHP RQ WKH GHYHORSPHQW RI -DGUHQHUJLF UHFHSWRUV LQ WKH UDW VXEPDQGLEXODU JODQG $UFKLYHV RI 2UDO %LRORJ\ 'UDJR 1XUFRPEH 9 DQG %DUWOHWW 3 f /DPLQLQ WKURXJK LWV ORQJ DUP ( IUDJPHQW SURPRWHV WKH SUROLIHUDWLRQ DQG GLIIHUHQWLDWLRQ RI PXULQH QHXURHSLWKHOLDO FHOOV ([SHULPHQWDO &HOO 5HVHDUFK ']LDGHN 0 DQG 7LPSO 5 f ([SUHVVLRQ RI QLGRJHQ DQG ODPLQLQ LQ EDVHPHQW PHPEUDQHV GXULQJ PRXVH HPEU\RJHQHVLV DQG LQ WHUDWRFDUFLQRPD FHOOV 'HYHORSPHQWDO %LRORJ\ (NEORP 0 .OHLQ 0XJUDXHU )HFMNHU / 'HXW]PDQQ 5 7LPSO 5 DQG (NEORP 3 f 7UDQVLHQW DQG ORFDOO\ UHVWULFWHG H[SUHVVLRQ RI ODPLQLQ $ FKDLQ P51$ E\ GHYHORSLQJ HSLWKHOLDO FHOOV GXULQJ NLGQH\ RUJDQRJHQHVLV &HOO (PFK 5 =HQKDXVHP ) -RELQ 0 7DERUHOOL 0 DQG 'HVFRXWV 3 f 0RUSKRORJLFDO GLIIHUHQFH EHWZHHQ ILEURQHFWLQ VSUD\HG RQ PLFD DQG RQ 300$ 8OWUDPLFURVFRS\ (QJYDOO ( %HOO 0 &DUOVVRQ 5 0LOOHU ( DQG 5XRVODKWL ( f 1RQKHOLFDO IOEURQHFWLQ ELQGLQJ EDVHPHQWPHPEUDQH FROODJHQ IURP HQGRGHUPDO FHOO FXOWXUH &HOO (QJYDOO ( DQG 5RXVODKWL ( f %LQGLQJ RI VROXEOH IRUP RI ILEUREODVW VXUIDFH SURWHLQ ILEURQHFWLQ WR FROODJHQ ,QWHUQDWLRQDO -RXUQDO RI &DQFHU (QJYDOO ( 5RXVODKWL ( DQG 0LOOHU ( f $IILQLW\ RI ILEURQHFWLQ WR FROODJHQV RI GLIIHUHQW JHQHWLF W\SHV DQG WR ILEULQRJHQ -RXUQDO RI ([SHULPHQWDO 0HGLFLQH (ULFNVRQ + DQG &DUUHOO 1 f )LEURQHFWLQ LQ H[WHQGHG DQG FRPSDFW FRQIRUPDWLRQV (OHFWURQ PLFURVFRS\ DQG VHGLPHQWDWLRQ DQDO\VLV -RXUQDO RI %LRORJLFDO &KHPLVWU\ )HNHWH = .RUHF 5 )HNHWHRYD ( 0XUW\ 9/ 3LRWURZVNL 6ORPLDQ\ $ DQG 6ORPLDQ\ %/ f 6DOLYDU\ DQG SODVPD LQVXOLQ OHYHOV LQ PDQ %LRFKHPLFDO 0ROHFXODU %LRORJ\ ,QWHUQDWLRQDO

PAGE 119

)LWFK DQG /LQVHQPD\HU 7 f ,QWHUVWLWLDO EDVHPHQW PHPEUDQH FRPSRQHQWV LQ GHYHORSPHQW ,Q f([WUDFHOOXODU 0DWUL[ $VVHPEO\ DQG 6WUXFWXUHf 3
PAGE 120

+D\PDQ ( (QJYDOO ( DQG 5XRVODKWL ( f &RQFRPLWDQW ORVV RI FHOO VXUIDFH ILEURQHFWLQ DQG ODPLQLQ IURP WUDQVIRUPHG UDW NLGQH\ FHOOV -RXUQDO RI &HOO %LRORJ\ +D\PDQ ( 2OGEHUJ $ 0DUWLQ DQG 5XRVODKWL ( f &RGLVWULEXWLRQ RI KHSDUDQ VXOIDWH SURWHRJO\FDQ ODPLQLQ DQG ILEURQHFWLQ LQ WKH H[WUDFHOOXODU PDWUL[ RI QRUPDO UDW NLGQH\ FHOOV DQG WKHLU FRRUGLQDWH DEVHQFH LQ WUDQVIRUPHG FHOOV -RXUQDO RI &HOO %LRORJ\ +HGPDQ -RKDQVVRQ 6 9DUWLR 7 .MHOOQ / 9DKHUL $ DQG +RRN 0 f 6WUXFWXUH RI WKH SHULFHOOXODU PDWUL[ DVVRFLDWLRQ RI KHSDUDQ DQG FKRQGURLWLQ VXOIDWHV ZLWK ILEURQHFWLQ SURFROODJHQ ILEHUV &HOO +LQW]H -/ f 1&66 6WDWLVWLFDO 6\VWHP IRU :LQGRZV .D\VYLOOH 8WDK +LUDPDWVX < .DJDPL + .RVDNL 6KLJHWRPL 7 8HGD 0 .RED\DVKL 6 DQG DO H f 7KH ORFDOL]DWLRQ RI EDVLF ILEUREODVW JURZWK IDFWRU )*)f LQ UDW VXEPDQGLEXODU JODQGV 1DJR\D -RXUQDO RI 0HGLFDO 6FLHQFHV +RIPDQQ + 9RVV 7 .KQ + DQG (QJHO f /RFDOL]DWLRQ RI IOH[LEOH VLWHV LQ WKUHDGOLNH PROHFXOHV IURP HOHFWURQ PLFURJUDSKV FRPSDULVRQ RI LQWHUVWLWLDO EDVHPHQW PHPEUDQH DQG LQWLPD FROODJHQV -RXUQDO RI 0ROHFXODU %LRORJ\ +X < 1DNDJDZD < 3XUXVKRWKDP DQG +XPSKUH\V%HKHU 0 f )XQFWLRQDO FKDQJHV LQ VDOLYDU\ JODQGV RI DXWRLPPXQH GLVHDVHSURQH 12' PLFH $PHULFDQ -RXUQDO RI 3K\VLRORJ\ (( +XPSKUH\V%HKHU 0 0DFDXOH\ 6 &KHJLQL 1 YDQ 6HWWHQ 3XUXVKRWKDP 6WHZDUW & :KHHOHU 7 DQG 6FKXOW] Df &KDUDFWHUL]DWLRQ RI WKH V\QWKHVLV DQG VHFUHWLRQ RI WUDQVIRUPLQJ JURZWK IDFWRU D IURP VDOLYDU\ JODQGV DQG VDOLYD (QGRFULQRORJ\ +XPSKUH\V%HKHU 0 0DFDXOH\ 6 &KHJLQL 1 YDQ 6HWWHQ 3XUXVKRWKDP 6WHZDUW & :KHHOHU 7 DQG 6FKXOW] Ef &KDUDFWHUL]DWLRQ RI WKH V\QWKHVLV DQG VHFUHWLRQ RI WUDQVIRUPLQJ JURZWK IDFWRUD IURP VDOLYDU\ JODQGV DQG VDOLYD (QGRFULQRORJ\ +\QHV 5 f 0ROHFXODU ELRORJ\ RI ILEURQHFWLQ $QQXDO 5HYLHZ RI &HOO %LRORJ\ -DVNROO 7 &KR\ + $ DQG 0HOQLFN 0 f *OXFRFRUWLFRLGV 7*)3 DQG HPEU\RQLF PRXVH VDOLYDU\ JODQG PRUSKRJHQHVLV -RXUQDO RI &UDQLRIDFLDO 'HYHORSPHQWDO %LRORJ\ -LOHN ) DQG +UPDQQ + f )LEURQHFWLQ FROGLQVROXEOH JOREXOLQf 9, ,QIOXHQFH RI KHSDULQ DQG K\DOXURQLF DFLG RQ WKH ELQGLQJ RI QDWLYH FROODJHQ +RSSH6H\OHUnV =HLWVFKULIW IXU 3K\VLRORJLVFKH &KHPLH

PAGE 121

,OO .DGR\D < DQG
PAGE 122

.XUDFKL + DQG 2ND 7 f &KDQJHV LQ HSLGHUPDO JURZWK IDFWRU FRQFHQWUDWLRQ RI VXEPDQGLEXODU JODQG SODVPD DQG XULQH RI QRUPDO DQG VLRDORDGHQHFWRPL]HG IHPDOH PLFH GXULQJ YDULRXV UHSURGXFWLYH VWDJHV -RXUQDO RI (QGRFULQRORJ\ /DOOHPDQG $ 5XRFFR 6 DQG *DLOODUG f 6\QWKHVLV DQG H[SUHVVLRQ RI ODPLQLQ GXULQJ KXPDQ IRHWDO OXQJ GHYHORSPHQW 7KH $QDWRPLFDO 5HFRUG /DXULH +RULNRVKL 6 .LOOHQ 3 6HJXL5HDO % DQG
PAGE 123

/XNLQPDD 3/ 9DDKWRNDUL $ 9DLQLR 6 6DQGEHUJ 0 :DOWLPR DQG 7KHVOHII f 7UDQVLHQW H[SUHVVLRQ RI W\SH ,,, FROODJHQ E\ RGRQWREODVWV GHYHORSPHQWDO FKDQJHV LQ WKH GLVWULEXWLRQ RI SURD,,,f DQG SURD,f FROODJHQ P51$V LQ GHQWDO WLVVXHV 0DWUL[ 0DFDXOH\ 6 %HQQHWW 1 DQG 6FKXOW] Df 7KH 0ROHFXODU 3DWKRJHQHVLV RI &KURQLF :RXQGV 3DUW 0DWUL[ 0HWDOORSURWHLQDVHV ,Q SUHSDUDWLRQ 0DFDXOH\ 6 6FKXOW] %UXFNQHU % .UDZHW] 6 DQG
PAGE 124

0RUDO + Ef EHU GLH HUVWHQ HQWZLFNHOXQJVVWDGLHQ GHU JO£QGXOD VXEPD[LOODULV =HLWVFKULIW IXU $QDWRPLH XQG(QWZLFNOXQJVJHVFKLFKWH 0RUDO + f =XU NHQQWQLV YRQ GHU VSHLFKHOGUVHQHQWZLFNOXQJ GHU PDXV JO£QGXOD VXEPD[LOODULV =HLWVFKULIW IXU $QDWRPLH XQG (QWZLFNOXQJVJHVFKLFKWH 0RUDO + f =XU NHQQWQLV YRQ GHU VSLHFKHOGUVHQHQZLFNHOXQJ GHU PDXV ,, JO£QGXOD SDURWLV =HLWVFKULIW IXU $QDWRPLH XQG (QWZLFNOXQJVJHVFKLFKWH 0XUDNDPL 7DQLJXFKL + DQG %DED 6 f 3UHVHQFH RI LQVXOLQOLNH LPPXQRUHDFWLYLW\ DQG LWV ELRV\QWKHVLV LQ UDW DQG KXPDQ SDURWLG JODQG 'LDEHWORJLD 1DNDQLVKL < DQG ,VKLL 7 f (SLWKHOLDO VKDSH FKDQJH LQ PRXVH HPEU\RQLF VXEPDQGLEXODU JODQG PRGXODWLRQ E\ H[WUDFHOOXODU PDWUL[ FRPSRQHQWV %LR(VVD\V 1DNDQLVKL < 6XJLXUD ) .LVKL -, DQG +D\DNDZD 7 f &ROODJHQDVH LQKLELWRU VWLPXODWHV FOHIW IRUPDWLRQ GXULQJ HDUO\ PRUSKRJHQHVLV RI PRXVH VDOLYDU\ JODQG 'HYHORSPHQWDO %LRORJ\ 1DWKDQ & DQG 6SRP 0 f &\WRNLQHV LQ FRQWH[W -RXUQDO RI &HOO %LRORJ\ 1RJDZD + f 'HWHUPLQDWLRQ RI WKH FXUYDWXUH RI HSLWKHOLDO FHOO PDVV E\ PHVHQFK\PH LQ EUDQFKLQJ PRUSKRJHQHVLV RI PRXVH VDOLYDU\ JODQG -RXUQDO RI (PEU\RORJLFDO ([SHULPHQWDWLRQ DQG 0RUSKRORJ\ 1RJDZD + DQG 0L]XQR 7 f 0HVHQFK\PDO FRQWURO RYHU HORQJDWLRQ DQG EUDQFKLQJ PRUSKRJHQHVLV LQ VDOLYDU\ JODQG GHYHORSPHQW -RXUQDO RI (PEU\RORJLFDO ([SHULPHQWDWLRQ DQG 0RUSKRORJ\ 2OVHQ 3 3RXOVHQ 6 .LUNHJDDUG 3 DQG 1H[R ( f 5ROH RI VXEPDQGLEXODU VDOLYD DQG HSLGHUPDO JURZWK IDFWRU LQ JDVWULF F\WRSURWHFWLRQ *DVWURHQWHURORJ\ 2[IRUG 7DPX]]HU 5 %DOFK 6FKXOW] YDQ 6HWWHQ 0DFDXOH\ 6 0DF.D\ 6
PAGE 125

3DXOVVRQ 0 f %DVHPHQW PHPEUDQH SURWHLQV VWUXFWXUH DVVHPEO\ DQG FHOOXODU LQWHUDFWLRQV &ULWLFDO 5HYLHZV LQ %LRFKHPLVWU\ DQG 0ROHFXODU %LRORJ\ 3HWHUV 3 DQG 0RVKHU f )RUPDWLRQ RI ILEURQHFWLQ H[WUDFHOOXODU PDWUL[ ,Q f([WUDFHOOXODU 0DWUL[ $VVHPEO\ DQG 6WUXFWXUHf 3
PAGE 126

5HK 7 1DJ\ 7 DQG *UHWWRQ + f 5HWLQDO SLJPHQWHG HSLWKHOLDO FHOOV LQGXFHG WR WUDQVGLIIHUHQWLDWH WR QHXURQV E\ ODPLQLQ 1DWXUH 5REHUWVRQ DQG 6LPD $ f 'LDEHWLF QHXURSDWK\ LQ PXWDQW PLFH >&%/.6 GEGEf@ $ PRUSKRPHWULF VWXG\ 'LDEHWHV 5\DQ 0DQWOH 7 0F4XDLG 6 DQG &RVWLJDQ f 6DOLYDU\ LQVXOLQOLNH JURZWK IDFWRU RULJLQDWHV IURP ORFDO V\QWKHVLV -RXUQDO RI (QGRFULQRORJ\ 6DPEURRN )ULWVFK ( DQG 0DQLDWLV 7 f f0ROHFXODU &ORQLQJ $ /DERUDWRU\ 0DQXDOf &ROG 6SULQJ +DUERU /DERUDWRU\ &ROG 6SULQJ +DUERU 1< 6DPXHO )DUKDGLDQ ) 6DEUL $ 0DURWWH ) 5REHUW 9 DQG 5DSSDSRUW / f ([SUHVVLRQ RI ILEURQHFWLQ GXULQJ UDW IHWDO DQG SRVWQDWDO GHYHORSPHQW DQ LQ VLWX K\EULGLVDWLRQ DQG LPPXQRKLVWRFKHPLFDO VWXG\ &DUGLRYDVFXODU 5HVHDUFK 6DUWK\ 9 f &ROODJHQ ,9 P51$ H[SUHVVLRQ GXULQJ GHYHORSPHQW RI WKH PRXVH UHWLQD DQ LQ VLWX K\EULGL]DWLRQ VWXG\ ,QYHVWLJDWLYH 2SKWKDOPRORJ\ DQG 9LVXDO 6FLHQFHV 6DVDNL 0 DQG
PAGE 127

6LHEHUW 3 DQG /DUULFN : f &RPSHWLWLYH 3&5 1DWXUH 6LHJHO 5 f /\V\O R[LGDVH ,QWHUQDWLRQDO 5HYLHZ RI &RQQHFWLYH 7LVVXH 5HVHDUFK 6LHJHO 5 3LQHOO 6 DQG 0DUWLQ f &URVVOLQNLQJ RI FROODJHQ DQG HODVWLQ SURSHUWLHV RI O\V\O R[LGDVH %LRFKHPLVWU\ 6LQJHU 6FRWW 6 .DZND DQG +DVVHOO f ([WUDFHOOXODU PDWUL[ ILEHUV FRQWDLQLQJ ILEURQHFWLQ DQG EDVHPHQW PHPEUDQH KHSDUDQ VXOIDWH SURWHRJO\FDQ FRDOLJQ ZLWK IRFDO FRQWDFWV DQG PLFURILODPHQW EXQGOHV LQ VWDWLRQDU\ ILEUREODVWV ([SHULPHQWDO &HOO 5HVHDUFK 6PLWK & :HEVWHU ( 1DWKDQVRQ 0 6HDUOV 5 DQG +LOIHU 6 f $OWHUHG SDWWHUQV RI SURWHRJO\FDQ GHSRVLWLRQ GXULQJ PDWXUDWLRQ RI WKH IHWDO PRXVH OXQJ &HOO 'LIIHUHQWLDWLRQ DQG 'HYHORSPHQW 6PLWK 3 DQG 3DWHO f ,PPXQRFKHPLFDO VWXGLHV RI WKH LQVXOLQOLNH PDWHULDO LQ WKH SDURWLG JODQG RI UDWV 'LDEHWHV 6SHPDQ + DQG 0DQJROG + f EHU LQGXNWLRQHQ YRQ HPEU\RQDODQODJHQ GXUFK LQSODQWDWLRQ DUWIUHPGHU RUJDQLVDWRUHQ $UFKLY IXU (QWZLFNOXQJVPHFKDQLN GHU 2UJDQLVPHQ 6SRRQHU % 7KRPSVRQ3OHWVKHU + 6WRNHV % DQG %DVVHWW f ([WUDFHOOXODU PDWUL[ LQYROYHPHQW LQ HSLWKHOLDO EUDQFKLQJ PRUSKRJHQHVLV ,Q f7KH &HOO 6XUIDFH LQ 'HYHORSPHQW DQG &DQFHUf 0 6WHLQEHUJ (Gf 9RO SS 3OHQXP 3UHVV 1HZ
PAGE 128

6ZHHQH\ 7 2JOH 5 DQG /LWWOH & f /DPLQLQ SRWHQWLDWHV GLIIHUHQWLDWLRQ RI 3&&XYD HPEU\RQDO FDUFLQRPD FHOOV LQWR QHXURQV -RXUQDO RI &HOO 6FLHQFH 7DNDKDVKL < DQG 1RJDZD + f %UDQFKLQJ PRUSKRJHQHVLV RI PRXVH VDOLYDU\ HSLWKHOLXP LQ EDVHPHQW PHPEUDQHOLNH VXEVWUDWXP VHSDUDWHG IURP PHVHQFK\PH E\ WKH PHPEUDQH ILOWHU 'HYHORSPHQW 7DPX]]HU 5 0DFDXOH\ 6 )DUPHULH : &DEHOODUR 6 *KDVVHPLIDU 0 $QGHUVRQ 5RELQVRQ & *UDQW 0 +XPSKUH\V%HKHU 0 )UDQ]HQ / 3HFN $ DQG 6FKXOW] Df &RPSHWLWLYH 51$ WHPSODWHV IRU GHWHFWLRQ DQG TXDQWLWDWLRQ RI JURZWK IDFWRUV F\WRNLQHV H[WUDFHOOXODU PDWUL[ FRPSRQHQWV DQG PDWUL[ PHWDOORSURWHLQDVHV E\ 573&5 %LR7HFKQLTXHV 7DPX]]HU 5 0DFDXOH\ 6 0DVW % 6WDFH\ 0 7UHQJURYH 1 0ROGDZHU / %XUVOHP ) DQG 6FKXOW] Ef (SLGHUPDO JURZWK IDFWRU LQ ZRXQG KHDOLQJ D PRGHO IRU WKH PROHFXODU SDWKRJHQHVLV RI FKURQLF ZRXQGV ,Q f*URZWK )DFWRUV DQG :RXQG +HDOLQJ %DVLF 6FLHQFH DQG 3RWHQWLDO &OLQLFDO $SSOLFDWLRQVf 7 =LHJOHU 3LHUFH DQG +HUQGRQ (GVf 9RO LQ SUHVV 6HURQR 6\PSRVLXP ,QF 1RUZDOO 0$ 7KLHU\ -3 'XEDQG -/ 'XIRXU 6 6DYDJQHU 3 DQG ,PKRI % f 5ROHV RI ILEURQHFWLQ LQ HPEU\RJHQHVLV ,Q f)LEURQHFWLQf 0RVKHU (Gf SS $FDGHPLF 3UHVV 1HZ
PAGE 129

9DLQLR 6 .DUDYDQRYD -RZHWW $ DQG 7KHVOHII f ,GHQWLILFDWLRQ RI %03 DV D VLJQDO PHGLDWLQJ VHFRQGDU\ LQGXFWLRQ EHWZHHQ HSLWKHOLDO DQG PHVHQFK\PDO WLVVXHV GXULQJ HDUO\ WRRWK GHYHORSPHQW &HOO 9DOOHMR 0HDG 3 *D\QRU 'HYHOLQ DQG 5REELQV & f &KDUDFWHUL]DWLRQ RI LPPXQRUHDFWLYH LQVXOLQ LQ KXPDQ VDOLYD (YLGHQFH DJDLQVW SURGXFWLRQ LQ VLWX 'LDEHWRORJLD YDQ 6HWWHQ 0DFDXOH\ 6 +XPSKUH\V%HKHU 0 &KHJLQL 1 DQG 6FKXOW] f 'HWHFWLRQ RI 7*)D P51$ DQG SURWHLQ LQ UDW ODFULPDO JODQGV DQG FKDUDFWHUL]DWLRQ RI 7*)D LQ KXPDQ WHDUV ,QYHVWLJDWLYH 2SKWKDOPRORJ\ DQG 9LVXDO 6FLHQFHV YDQ 6HWWHQ 6FKXOW] DQG 0DFDXOH\ 6 f *URZWK IDFWRUV LQ KXPDQ WHDUV IOXLG DQG LQ ODFULPDO JODQGV ,Q f7KH /DFULPDO *ODQG 7HDU )LOP DQG 'U\ (\H 6\QGURPHV %DVLF 6FLHQFH DQG &OLQLFDO 5HOHYDQFHf 6XOOLYDQ (Gf 9RO SS 9DUWLR 7 /DLWLQHQ / 1£UY£QHQ 2 &XWORO 0 7KRPHOO /( =DUGL / DQG 9LUWDQHQ f 'LIIHUHQWLDO H[SUHVVLRQ RI WKH (' VHTXHQFHFRQWDLQLQJ IRUP RI FHOOXODU ILEURQHFWLQ LQ HPEU\RQLF DQG DGXOW KXPDQ WLVVXHV -RXUQDO RI &HOO 6FLHQFH 9HUHV *LEEV 5 6FKHUHU 6 DQG &DVNH\ & f 7KH PROHFXODU EDVLV RI WKH VSDUVH IXU PRXVH PXWDWLRQ 6FLHQFH 9RJHO f *O\FRVDPLQRJO\FDQV DQG SURWHRJO\FDQV ,Q f([WUDFHOOXODU 0DWUL[ $VVHPEO\ DQG 6WUXFWXUHf 3
PAGE 130


PAGE 131

%,2*5$3+,&$/ 6.(7&+ 6KDZQ 3DWULFN 0DFDXOH\ ZDV ERP RQ $XJXVW LQ 0DORQH 1HZ
PAGE 132

,Q -DQXDU\ 6KDZQ HQWHUHG WKH 3K' SURJUDP LQ WKH 8QLYHUVLW\ RI )ORULGD &ROOHJH RI 0HGLFLQH DQG ZDV DZDUGHG D SUHVWLJLRXV 0DUFK RI 'LPHV 3UHGRFWRUDO )HOORZVKLS IURP ZKLOH ZRUNLQJ LQ WKH ODERUDWRULHV RI 'U 7KRPDV 3
PAGE 133

VLQJLQJ WHQRU ZLWK WKH *DLQHVYLOOH &LYLF &KRUXV DQG SOD\LQJ VD[RSKRQH LQ WKH :RUVKLS (QVHPEOH DW &UHHNVLGH &RPPXQLW\ &KXUFK DQG ZLWK 6DOVD %\WH D ORFDO /DWLQ EDQG )ROORZLQJ JUDGXDWLRQ 6KDZQ KDV DFFHSWHG D IDFXOW\ SRVLWLRQ LQ WKH 'HSDUWPHQW RI *HQHWLFV DQG &HOO %LRORJ\ DW :DVKLQJWRQ 6WDWH 8QLYHUVLW\ ZKHUH KH ZLOO HVWDEOLVK KLV RZQ UHVHDUFK SURJUDP DW WKH +HDOWK 5HVHDUFK DQG (GXFDWLRQ &HQWHU DV ZHOO DV FRRUGLQDWH QHZ JUDGXDWH SURJUDPV LQ JHQHWLF FRXQVHOLQJ DQG PLFURELRORJ\ WR EHJLQ LQ WKH RU VFKRRO \HDUV +LV ZLIH %HWK LV FRPSOHWLQJ KHU 3K' LQ &RPPXQLFDWLRQ 3URFHVVHV DQG 'LVRUGHUV ZLWK D PLQRU LQ QHXURSV\FKRORJ\ DQG ZLOO EH DQ $VVLVWDQW 3URIHVVRU RI 6SHHFK DQG +HDULQJ 6FLHQFHV DW :DVKLQJWRQ 6WDWH 8QLYHUVLW\

PAGE 134

, FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ 0LFKDHO +XPSKUH\V%HKHU &KDL $VVRFLDWH 3URIHVVRU RI 2UDO %LRORJ\ FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ *UHJRU\ 6 6FKXOW] 3URIHVVRU RI %LRFKHPLVWU\ DQG 0ROHFXODU %LRORJ\ FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ /LQGD / %ULQGOH\ 3URIHVVRU RI 2UDO %LRORJ\

PAGE 135

, FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ ,QJYD 1 PJYDU 0DJQXVVRQn 3URIHVVRU RI 2UDO %LRORJ\ FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ 4nONWX :LOOLDP & %XKL $VVRFLDWH 3URIHVVRU RI %LRFKHPLVWU\ DQG 0ROHFXODU %LRORJ\ 7KLV GLVVHUWDWLRQ ZDV VXEPLWWHG WR WKH *UDGXDWH )DFXOW\ RI WKH &ROOHJH RI 0HGLFLQH DQG WR WKH *UDGXDWH 6FKRRO DQG ZDV DFFHSWHG DV SDUWLDO IXOILOOPHQW RI WKH UHTXLUHPHQWV RI WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ 'HDQ *UDGXDWH 6FKRRO


xml version 1.0 encoding UTF-8
REPORT xmlns http:www.fcla.edudlsmddaitss xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.fcla.edudlsmddaitssdaitssReport.xsd
INGEST IEID E60G44URI_Z8PSS0 INGEST_TIME 2014-08-07T19:12:06Z PACKAGE AA00022654_00001
AGREEMENT_INFO ACCOUNT UF PROJECT UFDC
FILES