RNA-protein interactions of a mitochondrial group I intron in Saccharomyces cerevisiae

Material Information

RNA-protein interactions of a mitochondrial group I intron in Saccharomyces cerevisiae
Tirupati, Hymavathi K
Publication Date:
Physical Description:
viii, 149 leaves : ill. ; 29 cm.


Subjects / Keywords:
Amino acids ( jstor )
Biochemistry ( jstor )
Crosslinking ( jstor )
Exons ( jstor )
Gels ( jstor )
Introns ( jstor )
Proteins ( jstor )
RNA ( jstor )
Splicing ( jstor )
Transfer RNA ( jstor )
Binding Sites ( mesh )
Cytochrome b Group ( mesh )
Department of Molecular Genetics and Microbiology thesis Ph.D ( mesh )
Dissertations, Academic -- College of Medicine -- Department of Molecular Genetics and Microbiology -- UF ( mesh )
Introns ( mesh )
Mutagenesis, Site-Directed ( mesh )
RNA, Fungal ( mesh )
Research ( mesh )
Ribonucleoproteins ( mesh )
Saccharomyces cerevisiae ( mesh )
bibliography ( marcgt )
non-fiction ( marcgt )


Thesis (Ph.D.)--University of Florida, 1998.
Bibliography: leaves 130-148.
General Note:
General Note:
Statement of Responsibility:
by Hymavathi K. Tirupati.

Record Information

Source Institution:
University of Florida
Holding Location:
University of Florida
Rights Management:
Copyright [name of dissertation author]. Permission granted to the University of Florida to digitize, archive and distribute this item for non-profit research and educational purposes. Any reuse of this item in excess of fair use or other copyright exemptions requires permission of the copyright holder.
Resource Identifier:
029444254 ( ALEPH )
51003784 ( OCLC )


This item has the following downloads:

Full Text

GROUP I INTRON IN Saccharomyces cerevisiae





I thank Dr. Alfred S. Lewin, my mentor and supervisor, for his constant support in both academic and personal matters. He gave me immense freedom in the conduct of experiments and stood by me during difficult times. I knew I could always count on him. I would also like to thank all the past and present colleagues in the lab, who have made life in the lab enjoyable and friendly.

I would like to thank the members of my advisory committee, Drs. Bert

Flanegan, Henry Baker, and Phil Laipis, for the various constructive suggestions they have made during the course of the investigation and for taking the time to review various documents, including this one. I also appreciate the input from all the other faculty and students in the department, which has helped in my personal growth. I also thank the other personnel in the Department, especially Joyce Conners and Brad Moore, for their efficient help.

My special thanks go to Chandu, my husband, who has stood by me during all times and made this all possible.


ACKNOWLEDGMENTS .....................1

LIST OF TABLES. .. .....................v


ABSTRACT .. ........ ..............vii


1 INTRODUCTION. ...................

General Introduction .. .. ..................
Group I Introns. .. ..................4
Protein Facilitated Splicing ... ..............1
Two-component System of Cbp2 and Intron 5 RNA ... .. ....16 Major Objective of Dissertation .. ..............19

2 MATERIALS AND METHODS. .. ............21

Over-expression and Purification of Cbp2 .. .........21
In vitro Transcription. .. ... .............23
UV-crosslinking and Generation of Peptides. .........23
Site-directed Mutagenesis .. ...............27
In vitro Splicing Assay. ... .............29
Partial Proteolysis of Cbp2. .. ..............30
Equilibrium Binding Analysis. .. .............30

PROTEIN .. .... .................32

Introduction. .. ...................32
Results. .. .....................35
Discussion .. .. ...................46



Introduction. .. ...................55
Results. .. .....................58
Discussion. .. ....................100


LIST OF REFERENCES. ............... ...130

BIOGRAPHICAL SKETCH. .. ...............149



2-1 Oligonucleotides used for mutagenesis of Cbp2 . 28

4-1 Description of Cbp2 mutants . 59

4-2 Rate measurements for wild-type and mutant Cbp2 76 4-3 Dissociation constants of Cbp2 mutants . 81



1-1 Proposed secondary structure of yeast apocytochrome b intron 5 RNA. 6 3-1 Optimization of UV-dosage for crosslinking ... .......... .37

3-2 Chemical cleavage of Cbp2-intron 5 RNA complexes ... ...... 40

3-3 Confirmation of the crosslink site in the N-terminus of Cbp2. .. 44 3-4 Summary of UV-crosslinking results .... ............ .47

4-1 Western analysis of Cbp2 mutants .... ............. ..61

4-2 Functional analysis of deletion (aal7-aa28) and triple aromatic
mutants ......... ....................... .64

4-3 Partial proteolytic profiles of deletion (aal 7-aa28) and triple aromatic
mutants ......... ....................... .66

4-4 Time course of splicing for wild-type and mutant Cbp2 ......... 69

4-5 Splicing rates of wild-type and mutant Cbp2 ... .......... .72

4-6 Double filter-binding assay of wild-type and mutant Cbp2 ....... 77 4-7 UV-crosslinking of wild-type and mutant Cbp2 to intron 5 RNA 83 4-8 Effect of mutant proteins on wild-type Cbp2-mediated splicing 86 4-9 Effect of increasing concentrations of wild-type Cbp2 on proteinmediated splicing ....... ................... ..90

4-10 Effect of tRNA addition on wild-type Cbp2-mediated splicing 93 4-11 Effect of mutant proteins on wild-type Cbp2-mediated splicing at
low total protein to RNA ratios ..... .............. .97


Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy

GROUP I INTRON IN Saccharomyces cerevisiae


Hymavathi K. Tirupati

December, 1998

Chairperson: Alfred S. Lewin
Major Department: Molecular Genetics and Microbiology

Group I introns and associated proteins represent simple but valuable systems for understanding more complex RNP systems such as the spliceosomes or ribosomes, which employ multiple RNA-protein interactions. The terminal intron of yeast cytochrome b pre-mRNA (a group I intron) requires the nuclear protein Cbp2 for splicing in vivo. However, in vitro, this intron can be made to either selfsplice or undergo protein-facilitated splicing by altering the Mg2+ concentration. Since catalysis is intrinsic to RNA, the protein is believed to promote RNA folding at secondary and tertiary structure levels, leading to the formation of a catalytically competent intron. Therefore, this two-component system provides a model for understanding the role of proteins in promoting RNA folding.


The present study was aimed at identifying critical RNA binding sites on Cbp2 and gaining insights into Cbp2-intron 5 RNA interactions. 32p-labeled intron 5 RNA was UV-crosslinked to Cbp2, and the crosslink sites identified by chemical cleavage and label transfer. These experiments demonstrated that the termini of Cbp2 contain important RNA binding sites. A 12-amino acid region (aa17-28) in the N-terminal contact site (rich in basic and aromatic residues) was targeted for mutagenesis, and mutant proteins characterized for RNA binding and stimulation of splicing. Mutations in this region resulted in no, partial, and complete loss of function, demonstrating the importance of this N-terminal region for stimulation of RNA splicing. These studies also led to the finding that Cbp2 stimulates splicing only in a narrow range of concentrations, with higher concentrations being inhibitory. Addition of a non-specific competitor tRNA attenuated this inhibition, demonstrating the non-specific RNA binding ability of Cbp2.

The current study has identified an important RNA binding region (aal7-28aa) in the N-terminus of Cbp2. A tyrosine at position 21 is indispensable while three charged residues at positions 20, 22 and 24 are important for Cbp2 function. An offshoot of the current study is the identification of an RNA chaperone function for Cbp2. Cbp2 appears to engage in both non-specific and specific interactions with intron 5 RNA. At inhibitory concentrations of the protein, however, nonspecific interactions may predominate and preclude the formation of specific contacts that promote catalysis. This newly characterized chaperone function of Cbp2 may be important for promoting correct intron 5 RNA folding in vivo.



General Introduction

Ribozymes, or catalytic RNA molecules, have been shown to catalyze reactions at phosphorus centers with RNA or DNA as the substrate (Cech, 1987; Herschlag and Cech, 1990; Robertson and Joyce, 1990; Forster and Altman, 1990). These reactions include transesterification or hydrolysis of phosphate diesters or phosphate monoesters. For instance, ribozymes have been shown to catalyze the polymerization of RNA monomer strands (Been and Cech, 1988), replication of RNA strands (Green and Szostak, 1992), and hydrolysis at internal processing sites (Decatur et al., 1995; Einvik et al., 1997; Jabri et al., 1997). RNA catalysts can also act on substrates other than nucleic acids. In vitro selected RNA molecules have been shown to interact with amino acids such as arginine, phenylalanine, tryptophan and valine (Majerfeld and Yarus, 1994; Yarus, 1991; Zinnen and Yarus, 1995). Arginine-binding RNA motifs (Tan et al., 1993) and aromatic side chains (Valegard et al., 1994) have been found to be important for protein-RNA interactions. Although aliphatic-RNA interactions have been frequently neglected, their avidity and specificity seem sufficient for a biological role. Also, the guanosine binding site of group I introns has been shown to bind arginine,



suggesting that the proto-ribosome might be related to group I introns (Yarus, 1991).

RNA catalysis is not limited to ribozymes alone. It is also involved in two

important steps of gene expression: mRNA processing and protein synthesis. In mRNA splicing, small nuclear RNAs recognize the reaction sites (Guthrie, 1991; Steitz, 1992) and may participate directly in the chemical steps (Madhani and Guthrie, 1992; McPheeters and Abelson, 1992), while the associated proteins may facilitate proper folding of these RNA molecules. It is also possible that, in addition to participating in mRNA splicing, RNAs can catalyze a variety of posttranscriptional RNA modifications. For instance, a calcium-metalloribozyme has been shown to efficiently catalyze a self-capping reaction with free GDP, yielding the same 5'-capped structure as that formed by protein guanylyltransferase (Huang and Yams, 1997a). This ribozyme was subsequently shown to possess selfdecapping and pyrophosphatase activities (Huang and Yarus, 1997b), adding to the growing repertoire of the catalytic capabilities of RNA.

The catalytic activities of RNA may also include facilitation of protein synthesis. Following extensive digestion of proteins from the prokaryotic ribosome, the large rRNA was shown to support the peptidyl transferase reaction, suggesting that RNA may be the catalytic component while ribosomal proteins may serve a scaffold function (Noller et al., 1992). Recently, in vitro selected RNA molecules with a peptidyl transferase-like motif have been shown to bind a


puromycin analog (a high-affinity ligand of ribosomal peptidyl transferase), in the absence of protein (Welch et al., 1997). Together, these results strengthen the hypothesis that peptidyl transfer originated in an RNA world.

The catalytic role of RNA in translation of mRNAs appears to be versatile. A ribozyme derived from the group I intron of Tetrahymena thermophila was shown to catalyze the hydrolysis of an aminoacyl ester bond (which involves a carbon center), suggesting that the first aminoacyl tRNA synthetase could have been an RNA molecule (Piccirilli et al., 1992). Furthermore, an RNA molecule identified by in vitro selection has been shown to rapidly aminoacylate its 2'(3') terminus when provided with phenylalanyl-adenosine monophosphate (Illangasekare et al., 1995; 1997). Thus, RNA can accelerate the same aminoacyl group transfer catalyzed by protein aminoacyl-tRNA synthetases.

The ongoing discovery of the versatile properties of catalytic RNA has lent

more credence to the theories of a prehistoric "RNA world". This pre-biotic world might have been populated by life forms that stored genetic information in RNA and employed RNA catalysts prior to the advent of ribosomal protein synthesis (Visser, 1984; Benner et al., 1989). It has also been proposed that the functions of these ancient catalytic RNAs may have been modulated by low molecular weight effectors related to antibiotics (Davies, 1990, Davies et al., 1992). Antibiotics have been shown to inhibit translation by the prokaryotic ribosome (Moazed and Noller, 1987; Powers and Noller, 1994; Yamada et al., 1978), either inhibit selfsplicing (von Ahsen et al., 1991; Davies et al., 1992; von Ahsen and Noller, 1993)


or promote oligomerization (Wank and Schroeder, 1996) of group I introns, and inhibit the self-cleavage reaction of the human hepatitis delta virus ribozyme (Rogers et al., 1996). Parallels between the inhibition of group I intron splicing and the protection of bacterial rRNAs by antibiotics also raises the possibility that group I intron splicing and tRNA selection by ribosomes involve similar RNA structural motifs.

Group I Introns

Group I introns are abundant in mitochondrial RNA of fungi and plants (Palmer and Logsdon, 1991). Coding regions for group I introns are also found in the nuclear genomes of other lower eukaryotes (rRNA genes of Tetrahymena), chloroplast DNAs, bacteriophages, and in several tRNA genes of eubacteria (Cech, 1988; Michel and Westhof, 1990; Palmer and Logsdon, 1991; Reinhold-Hurek and Shub, 1992). Some of these group I introns can self-splice. The ability to selfsplice is related to the highly conserved secondary and tertiary structures of these introns (Burke, 1988; Cech, 1988; Michel and Westhof, 1990). Although group I introns have relatively little sequence similarity, all share a series of short conserved elements designated P, Q, R and S. The secondary structure common to group I introns was first proposed by Michel et al. (1982) and Davies et al. (1982) based on comparative sequence analysis. This eventually led to the development of a three dimensional model of the catalytic core by Michel and Westhof (1990). The basic features of this model have been confirmed by mutational analysis, photochemical crosslinking and chemical modification studies employing several


affinity cleavage reagents (Pyle et al., 1992; Wang and Cech, 1992). On the basis of these studies, Cech et al. (1994) proposed a revised two-dimensional secondary structure for group I introns that represents more accurately the domain organization and orientation of helices within the intron, the coaxial stacking of certain helices, and the proximity of key nucleotides in three-dimensional space. Based on these revisions, the secondary structure of the fifth intron of the COB gene of Saccharomyces cerevisiae (used in the current study) is shown in Figure 11. The folded structure of group I introns consists of two co-axially stacked helices, P5-P4-P6 and P7-P3-P8, that form a cleft to enclose a third helical domain, P1P2, which contains the 5' splice site. The 5' and 3' splice sites are stabilized by P 1 and P 10 interactions respectively. P 1 is formed by base pairing between the 5' exon and the internal guide sequence (IGS), whereas P 10 is formed by base pairing between the 3' exon and the IGS (not shown in Figure 1-1). P9, a 2 base pair helix near P7 also contributes to the formation of 3' splice site.

The rRNA intron of Tetrahynena thermophila (considered to be the prototype group I intron) has been demonstrated to undergo autocatalytic splicing by a two step trans-esterification mechanism (Cech, 1990). The same mechanism has been documented for a number of other group I introns (Garriga and Lambowitz, 1984; Garriga and Lambowitz, 1986). The first step comprises a nucleophilic attack by guanosine at the 5' splice site, resulting in a free 3' OH group on the upstream exon and guanosine addition to the intron. In the second step, the free 3' OH group on the exon attacks the phosphodiester bond at the 3' splice site, leading to

Figure 1-1. Proposed secondary structure of yeast apocytochrome b intron 5 RNA. The coaxially stacked helices, P4-P6 and P3-P7, along with the joining regions J3/4, J4/6, J6/7, and J8/7, constitute the catalytic core while P1-P2 forms the substrate domain. The peripheral element P7. I-P7.1 a is a signature element of subgroup IA introns. Lower and upper case letters represent the exons and the intron respectively. Short horizontal and vertical lines represent hydrogen bonds. Dotted lines represent long-range interactions. Sequences for LI and L8 are not shown.

a u a c u u a u u a-31

Li A a 710
200 nt u a A AA U
A g U U AA

5- U A-U A-U
a A A c U-A U-A
u A A c pg1jCC U-A p9

AUAAA c A A 220 a U-A A-U
A U c A G u U-A U-A
AU-A A u A U g A-U U-A
A-U u U A u +1 U-A GACG-C
A-U uU A U A-C G 738 G A
P5 U-A a 1 UA U U A
A-U g 1 u- U U G:
CGu a-U A A U-A
AUA a 1u-A A A C 444
GUA-AUC a ca c c agcauc-C A C C-G

U-A 305 A-U G
P4 P2 U-A A ii 1 1 1 1 I-A G L7.1la
350 C-GC A .............................. ............... ............. U u 7l
AUA-U A C P. 71
40U-G A
P6 C-C AA-...... .........;.................. ;......................
U-A U-A G-C P3
P6a U-A A-UCCAA-U C-CAU-A U-A .....U-A
37UAC- P2a U-A U-A
L6a C A U-C 660 A-U
UCU-A 250 C-C A-U
P6b A-U C-G A-U

U-A L u UUU-A 500

P6c U-A





excision of the intron and ligation of the exons. An exogenous guanosine nucleotide is used as the nucleophile in the first step while a universally conserved 3'-terminal guanosine residue of the intron is employed in the second step (Cech, 1990). These steps are chemically the reverse of each other, with the bound exogenous guanosine nucleophile in the first step equivalent to the 3'-terminal guanosine leaving group in the second step. This led to the proposal that a single guanosine-binding site was used in both steps (Inoue et al., 1986). Subsequent studies indicated that the rate constant of the chemical step is the same with exogenous guanosine bound to L-21Scal ribozyme (a model system for first step of splicing) and with the intramolecular guanosine residue of the L-21 G414 ribozyme (a model system for second step of splicing) (Mei and Herschlag, 1996). These results support the previously proposed single guanosine-binding site model, and further suggest that the orientation of the bound guanosine and the overall active site structure is the same in both steps of the splicing reaction.

Oligonucleotide substrate binding to the Tetrahymena ribozyme was found to be stronger than predicted for a simple duplex interaction with the IGS, suggesting that tertiary interactions in addition to base pairing stabilized the bound substrate (Herschlag and Cech, 1990; Pyle et al., 1990). These tertiary interactions were shown to involve specific 2'-OH groups on the substrate and IGS, as well as the GU wobble pair at the 5' cleavage site (Pyle and Cech, 1991; Pyle et al., 1994; Strobel and Cech, 1993, Strobel and Cech, 1995). These and other kinetic studies led to a 2-step model for substrate binding, wherein the substrate forms a duplex


(P1) with the IGS to give an 'open complex', followed by docking of the P1 duplex into tertiary interactions to give a closed complex (Herschlag, 1992). Thus, P 1 docking represents a tertiary-folding event in which a single duplex adopts its tertiary structure in the context of an otherwise fully folded ribozyme. P 1 docking was characterized further by isolating the open complex as a thermodynamically stable species using a site-specific modification and high Na+ ion concentrations (Narlikar and Herschlag, 1996). These authors proposed that P1 docking is entropically driven, and is possibly accompanied by a release of bound water molecules.

It is interesting to note that group I introns do not contain specific functional groups that are typically employed in the catalysis of protein-enzymes. Instead, they depend on divalent cations for chemistry and certain other functions such as structural stabilization of folded RNA and substrate binding. For instance, the Tetrahymena group I intron requires Mg2+ or Mn2+ ions for catalysis (Grosshans and Cech, 1989), while cations like Ca2+ can only promote RNA folding and substrate binding (Pyle et al., 1990). A two metal-ion mechanism has been proposed for group I introns and other catalytic RNAs (Steitz and Steitz, 1993). In this mechanism, one metal ion activates the 3'-OH of the guanosine factor which initiates the first step of group I intron splicing. The second one coordinates and stabilizes the oxyanion leaving group, that is, the 3'-OH of uridine created at the end of 5' exon which initiates the second step of group I intron splicing. These metal ions act as Lewis acids and stabilize the expected pentacovalent transition


states. In case of group I introns, the mirror symmetry Of two Mg2 ions in the catalytic center reflects the identical chemistry of the two transesterification reactions that effect splicing. The role of RNA in catalysis is to position the two metal ions and properly orient the substrates. Evidence for the involvement of two Mg 2+ions in the chemical step of group I intron splicing was provided by McConnell et al. (1997). Testudy alosoe htasingle Mg 2+ion increases the rate of RNA substrate binding while one or more Mg 2+ions reduce the rate of dissociation of substrate. Evidence for stabilization of the leaving group by a second Mg2 ion was subsequently provided by Weinstein et al. (1997). Studies on the crystal structure of the P4-P6 domain of Tetrahymena documented the first detailed view of metal-binding motifs in a structurally complex RNA (Cate et al., 1996). Three unique metal binding sites have been found in the major groove, two of which are occupied by fully hydrated magnesium ions in the native RNA (Cate and Doudna, 1996). It is interesting to note that the tandem GU wobble base pairs, which comprise two of these three metal binding sites, are also abundant and conserved in the ribosomal RNAs. These sites, upon metal binding, might facilitate higher order folding of ribosomal RNAs or their association with ribosomal proteins.

Group I introns have been classified into four major subgroups, IA through ID, based on distinctive structural and sequence features (Michel and Westhof, 1990). For example, group IA introns contain two extra base pairings, P7. 1 /P7. 1la or P7. 1/P7.2, between P3 and P7 while several other group IB and IC introns


including the Tetrahymena rRNA intron possess an extended RNA structure, P5abc, that is essential for catalysis (Joyce et al., 1989). Recent crystallographic studies revealed that P5abc stabilizes P4-P6, the major domain of the catalytic core, via two key interactions (Cate et al., 1996). The first one includes an adenosine-rich bulge which docks in the minor groove of the P4 helix while the second interaction takes place between a GAAA tetraloop and the minor groove of its conserved 11-nucleotide receptor. In addition to base-specific hydrogen bonding and base stacking, pairs of interdigitated riboses (ribose zippers) further stabilize these long-range interactions in the P4-P6 domain. Other group I introns lacking P5abc possess additional RNA structures such as a long, peripheral extension of the P9 stem, denoted P9.1 (Wallweber et al., 1997) or protein factors (Mohr et al., 1994) that bind and stabilize the intron active structure. For example, the mitochondrial large ribosomal intron of N. crassa that lacks this extended domain absolutely requires a protein factor Cyt- 18 for its activity, both in vitro and in vivo. The protein binds at the junction of P4-P6 stacked helices and facilitates correct geometry in this region (Saldanha et al., 1996). Cyt-18 could also replace the P5abc domain of Tetrahymena (Mohr et al., 1994). Thus an RNA-binding protein can provide substantial binding energy to stabilize the catalytic structure of the intron, obviating the requirement for an additional but important RNA element.

Protein Facilitated Splicing

Several mitochondrial transcripts in yeast employ protein factors to facilitate splicing of group I and group II introns, although some of them can self splice in


vitro. Protein-facilitated splicing has also been documented in other fungi such as Neurospora (Akins and Lambowitz, 1987; Saldanha et al., 1993) and Aspergillus (Ho et al., 1997). Some of these protein factors, termed maturases, are encoded within the intervening sequences (Carignani et al., 1983; Lamb et al., 1983; Lazowska et al., 1989). The reading frames encoding these maturases are in frame with the upstream exons. A proteolytic cleavage downstream of the 5' splice site generates the active form of maturase, presumably enabling a feedback mechanism of regulation. All yeast maturases (encoded by group I introns such as cob-I2 and 13, and group II introns like cox]-I and -I2) primarily function in splicing the intron that encodes them. However, the cob-I4 maturase enables splicing of both cob-I4 and another closely related group I intron, cox1-I4 (Burke, 1988; Lambowitz and Perlman, 1990).

The maturases encoded by group I introns are structurally related to sitespecific endonucleases that confer mobility (Bell-Pedersen et al., 1990; Perlman and Butow, 1989). It is well established that group I introns can transpose sitespecifically to intron-less alleles of the same gene after cleavage of the target DNA by an intron-encoded DNA endonuclease (Belfort and Perlman, 1995; Byrk and Mueller, 1996). This conservative process, known as intron homing (Dujon, 1989), is highly specific because of the large recognition sites (15-35 bp) of homing endonucleases (Byrk and Mueller, 1996). Group I introns are thought to have become mobile following the acquisition of open reading frames (ORFs) that encode specific DNA endonucleases (Dujon, 1989; Lambowitz and Bellfort,


1993). Evidence for this came from the demonstration of autonomous mobility of an ORF, independent of the entire intronic sequence, in the mitochondria of Podospora anserina (Sellem and Belcour, 1997). The mitochondrial nadl-i4 intron of Podospora contains one (monorfic) or two (biorfic) ORFs, according to the origin of the strain (Cummings et al., 1988; Sellem et al., 1996). The nadl-i4orfl, recently acquired by the Podospora nadl-i4 intron (Sellem et al., 1996), appears to remain as a mobile entity, as it could be efficiently transferred from a biorfic intron to its monoorfic counterpart, independent of the core intron sequence (Sellem and Belcour, 1997).

Reverse splicing coupled with reverse transcription and recombination may serve as an alternative mechanism for intron mobility (Cech, 1985; Sharp, 1985; Woodson and Cech, 1989). A related mechanism has been documented in the homing of group II introns of yeast mitochondria (e.g., a12 intron of coxl) (Zimmerly et al., 1995; Yang et al., 1996) and Lactobacillus lactis (e.g., LtrB intron) (Matsuura et al., 1997). The insertion of these introns has been shown to occur by reverse transcription of unspliced precursor RNA at a break in doublestrand DNA caused by an endonuclease activity. This DNA endonuclease activity is associated with RNP particles containing the excised intron RNA that cleaves the sense strand of the recipient DNA by reverse splicing and the intron-encoded reverse transcriptase protein that cleaves the anti-sense strand.

Integration of an intron into foreign RNA (instead of DNA) by reverse splicing, followed by reverse transcription and recombination, could also lead to its


transposition. Reverse splicing into RNA has been demonstrated in vitro for group I introns such as Tetrahymena rRNA intron (Woodson and Cech, 1989) and the 23S rRNA intron from Chlamydomonas reinhardtii chloroplast (Thompson and Herrin, 1994). Recently, RNA-dependent integration of the Tetrahymena group I intron into the 23S rRNA has been demonstrated in E. coli (Roman and Woodson, 1998). The process of reverse splicing into RNA, unlike homing of group I and group II introns, does not require intron-encoded proteins. However, stable transposition into the genome would presumably require reverse transcriptase activity in the host (Belfort and Perlman, 1995). This activity could be provided by "indigenous" group II introns (Kennell et al., 1993) or retroelements present in many cell types (Eickbush, 1994). Importantly, reverse splicing appears to be significantly less sequence-specific than homing endonucleases and could therefore expand the repertoire of intron-containing sites (Cech, 1985; Roman and Woodson, 1998).

In addition to maturases, several nuclear-encoded proteins essential for splicing of mitochondrial introns have been identified in yeast and Neurospora by screening cytochrome-deficient strains and by isolating nuclear suppressors of splicing mutants (Burke, 1988; Lambowitz and Perlman, 1990). In Neurospora, the products of three nuclear genes, cyt-18, cyt-19 and cyt-4 have been implicated in splicing the mitochondrial large rRNA intron and several other mitochondrial group I introns. In contrast, most of the yeast proteins facilitate splicing of a single intron. For instance, the product of MRS 1 in yeast appears to be specific to the


group I intron, cob-bl3 (Kreike et al., 1987, Kreike et al., 1986), although an intron-encoded maturase is also required for excision of this intron (Holl et al., 1985). Proteins facilitating the splicing of group I introns may exhibit additional biological functions as documented in the case of certain aminoacyl-tRNA synthetases. The yeast NAM2 gene, for example, encodes mitochondrial leucyltRNA synthetase which also facilitates the splicing of group I introns, cob-I4 and cox-I4 (Labouesse et al., 1987; Herbert et al., 1988). Similarly, the Cyt-18 protein of Neurospora which is responsible for the splicing of several group I introns also happens to be the mitochondrial tyrosyl tRNA synthetase (Akins and Lambowitz, 1987). These synthetases and other pre-existing RNA-binding proteins may have evolved to recognize sequences or structures in group I introns that resemble their normal cellular targets (Lambowitz and Perlman, 1990; Caprara et al., 1996).

Nuclear-encoded proteins also appear to be important for group II intron

splicing. Two genetically identified proteins that are likely to function directly in group II intron splicing are MRS2 and MSS 116 (Wiesenberger et al., 1992; Seraphin et al., 1989). MRS2 functions in splicing of all four yeast group II introns (coxl-I1, -12, -I5y and cob-Il 1), and is relatively specific for these introns, while MSS 116 is involved in splicing group II introns (cox]-I1 and cob-I1) and also some group I introns. However, both MRS2 and MSS 116 appear to have some additional function besides splicing, as gene disruptions result in a respiratory-deficient phenotype in yeast strains whose mtDNA contains no introns (Wiesenberger et al., 1992; Seraphin et al., 1989)


Two-Component System of Cbp2 and Intron 5 RNA

The yeast cytochrome b gene contains five introns, of which the terminal intron is a group IA intron (bI5). In some yeast strains, the gene has only two introns, with the terminal intron designated b12. The processing of this group I intron in vivo was demonstrated to be dependent on a protein factor designated Cbp2 (McGraw and Tzagoloff, 1983). The nuclear gene encoding Cbp2 was identified by complementation of cytochrome b mutants (defective in the excision of the terminal intron) with a yeast genomic library. This analysis identified an 1890 nucleotide-long ORF encoding a basic protein of 74 kDa. Deletion analysis revealed that the entire ORF was essential for complementation of the cbp2 mutants. Later, a mitochondrial revertant was shown to contain a precise deletion of the terminal intron of cytochrome b gene, demonstrating that neither Cbp2 nor the intron itself is required for growth on non-fermentable carbon sources (Hill et al., 1984). In addition to these findings, Cbp2 has been shown to be important in the splicing of the 0o intron of large ribosomal RNA (Shaw and Lewin, 1997).

The terminal intron (intron 5) of cytochrome b can self-splice in vitro at high concentrations of Mg2+ (Gampel and Tzagoloff, 1987; Partono and Lewin, 1988), whereas Cbp2 is essential to enable splicing at physiological concentrations of Mg2+ (Gampel et al., 1989). Although this group IA intron possesses the conserved secondary and tertiary structures found in all group I introns, it varies in important ways from the prototype, the Tetrahymena rRNA intron. The fifth intron of cytochrome b is about 738 nucleotides long, making structural probing


harder compared to the rRNA intron of Tetrahymena (-400 nucleotides long). The internal guide sequence (IGS) that establishes the substrate specificity starts 220 nucleotides downstream from the 5' splice junction, rather than the usual 14-20 nucleotides described for other group I introns. The intron is AU-rich, requiring higher levels of Mg2+ for stabilization of the active structure unlike the GC-rich Tetrahymena group I intron. It also possesses additional RNA structures like the P7.1 stem loop that are not found in Tetrahymena. Hence, intron 5 RNA, with its structural differences from the Tetrahymena rRNA intron, offers an opportunity to gain further insights into the mechanism of splicing of group IA introns.

The fifth intron of COB pre-mRNA is also devoid of the peripheral RNA

element, P5abc, that is important for the catalysis of Tetrahymena rRNA intron. It is therefore conceivable that Cbp2 compensates for this RNA structure and stabilizes its RNA partner by contributing substantial binding energy in a manner similar to the Cyt- 18 protein of Neurospora. UV-crosslinking, chemical and enzymatic modification studies indicate that Cbp2 contacts intron 5 RNA at multiple sites in the catalytic core (P4) and peripheral RNA elements such as exon 5, IGS, L2, L6 and stimulates the formation of the catalytically active structure (Shaw and Lewin, 1995; Weeks and Cech, 1995). Based on these and kinetic studies, Weeks and Cech (1996) proposed that Cbp2 serves as a tertiary structure capture protein. However, Cbp2 also induces the formation of RNA secondary structure, in addition to the stabilization of tertiary structure (Shaw and Lewin, 1995; Shaw et al., 1996). In addition, chemical modification studies (Shaw and


Lewin, manuscript in preparation) show that Cbp2 binds to intron 5 RNA even in the absence of Mg 2+and nucleates the formation of the catalytic core by stabilizing the P4/P6 domain. Thus, Cbp2 appears to be involved in a dynamic process of stabilizing RNA structure both at the secondary and tertiary structure levels, stimulating the formation of the catalytically active RNA structure.

Weeks and Cech (1995a; 1995b) provided a kinetic framework for both Cbp2mediated and self-splicing reactions of intron 5 RNA. At low Mg 2+ levels (5 mM), the self-splicing reaction is estimated to be 3 orders of magnitude slower than the protein-facilitated reaction. At near saturating concentrations of Mg 2+(40 mM), the protein-independent reaction is still 8-fold slower, indicating that high levels of the cation cannot completely compensate for Cbp2 function. The self-splicing reaction is always slower than the protein- facilitated reaction, since it has to proceed through two additional transitions compared to the latter. The first step involves a transition from secondary structure to an intermediate state that is efficiently promoted by Mg2+ However, self-splicing must still overcome a second barrier which is the transition from the intermediate to an active enzyme state that finally gives rise to products. The kinetics of Cbp2-mediated splicing, on the other hand, include two significant steps, namely, guanosine binding to the Cbp2-active intron 5 RNA complex followed by efficient conversion of this ternary complex to products. Studies on phosphorothioate substitution at the 5' splice site and pH profiles indicate that at physiological pH the self-splicing reaction is limited by chemistry while the Cbp2-facilitated reaction is limited by a


conformational step (Weeks and Cech, 1995a). These studies indicate that Cbp2 binding compensates for at least two structural defects while increasing the rate of chemistry.

Main Objective of Dissertation

The availability of a two-component in vitro system to study autocatalytic and protein- facilitated splicing offers the advantage of studying RNA catalysis in isolation or in combination with the RNA-binding protein simply by varying the Mg concentration. Insights obtained from the analyses of this one protein-one RNA system will aid in understanding more complex systems like the spliceosomes involved in nuclear pre-mRNA splicing or ribosomes involved in protein synthesis, all of which employ multiple protein and RNA components.

Studies so far have focused on mapping the Cbp2 contact sites on intron 5 RNA and the kinetics of splicing in the presence and absence of the protein. Little is known about the structure of Cbp2 protein or its interaction with intron 5 RNA from the protein point of view. In order to understand the role of Cbp2 in stimulation of splicing, it is important to determine the functional groups on the protein that intimately contact RNA and facilitate catalysis. Once the contact sites are identified, the actual mechanism of interaction between Cbp2 and intron 5 RNA can be investigated further. Therefore, one of the main aims of the current project was to identify potential intron 5 RNA binding regions of Cbp2 using the technique of UV-crosslinking and label transfer. Following the identification of major contact sites, site-directed mutagenesis was employed to confirm the


importance of various amino acid residues in these sites for interaction with intron

5 RNA and enable facilitation of splicing.

UTV-crosslinking identified two major RNA contact sites in the termini of Cbp2 with the N-terminal site comprising the first 37 amino acid residues. The deletion of a potential RNA binding motif (aal 7-SSSRYRYKFNM-aa28) in the Nterminal contact site abolished splicing activity, showing that this region was likely to be critical for Cbp2 function. Single and cluster mutagenesis of various residues in this region yielded a variety of mutants with no, partial, or complete loss of Cbp2 function. The characterization of these mutants and the significance of various amino acid residues in question are discussed in Chapter 4.

An offshoot of the current study was the identification of an RNA chaperone function for Cbp2. The studies reported in Chapter 4 show that Cbp2 has a nonspecific or generalized RNA binding capability besides its specific RNA binding component. Drawing parallels with studies on other RNA chaperones (Chapter 5), this study adds a new perspective on how the non-specific RNA binding activity of Cbp2 might play a critical role in the facilitation of intron 5 RNA splicing in vivo.


Over-Expression and Purification of CBP2

In vitro studies of CBP2-bI5 RNA interactions were done with CBP2 protein purified to near homogeneity after over-expression in E. coli. Two versions of the protein, 6x histidine-tagged and native, were employed for different studies. Expression Clones

His-tagged Cbp2. Plasmid pET15b-CBP2 was constructed by cloning the

NdeI-ClaI fragment carrying the CBP2 cDNA from pET3a-CBP2, downstream of the 6x histidine tag in the T7 expression vector, pET15b (Novagen). The histidine tag adds an additional 20 amino acid residues at the N-terminus of Cbp2 protein. The plasmid was transformed into JM IO09(DE3) strain of E. coli for overexpression. This strain carries the T7 RNA polymerase gene driven by lac-uv5 promoter on a lambda lysogen and enables the induction of Cbp2 in the presence of IPTG.

Native Cbp2. This form of Cbp2 protein was over-expressed from pET3aCBP2 plasmid in BL2 I1(DE3), another E.coli strain carrying the T7 RNA polymerase gene. This plasmid was constructed by introducing an NdeI site at the start codon of CBP2 gene by PCR-mutagenesis and cloning the NdeI-SnaBI 21


fragment between the NdeI-BamHI sites of pET3a expression vector (Studier et al., 1990). The Cbp2 protein expressed from this construct is 20 amino acid residues shorter than the his-tagged version. Induction of Cbp2

An overnight culture of bacteria carrying the Cbp2 expression plasmid was

used to inoculate a large volume of LB/ampicillin medium at 1:100 dilution. The cultures were grown at 370C until they reached an A550 of 0.35 and the expression of Cbp2 was induced with 0.4-1 mM IPTG for 1-3 hours. Cells were pelleted after addition of 17 ig/ml PMSF, washed with 20 mM Tris, pH 7.5, 50 mM NaCI, snap frozen in a dry ice/ethanol bath and stored at -700 C until purification. Purification of Cbp2

His-tagged Cbp2. The protein was purified on Ni-NTA Superflow (Qiagen) column, adapting the protocol of Weeks and Cech (1995). This purification system is based on the high affinity of histidine residues for nickel ions immobilized on nitrilotriacetate resin. The contaminant proteins can be efficiently removed at low levels of imidazole (a competitor), while the his-tagged protein can be specifically eluted at slightly higher concentrations of imidazole.

The bacterial pellet was resuspended in 10 ml of column buffer (50 mM

HEPES, pH 7.6, 700 mM NaCl, 1mM imidazole, 17.5 ug/ml PMSF) and lysed by two passages through a French pressure cell at 18000 p.s.i. The lysate was cleared by centrifugation at 35000 rpm for 30 minutes in a Beckman Ti 42.1 rotor. The


supernatant was loaded on a 2 ml Ni-NTA Superflow column pre-equilibrated with 10 volumes of column buffer. The column was washed with 10 volumes of column buffer (lmM imidazole) followed by 7.5 volumes of wash buffer (20 mM imidazole). Cbp2 protein was then eluted with 7.5 volumes each of column buffers containing 80 mM and 200 mM imidazole. The fractions containing Cbp2 (detected by SDS-polyacrylamide gel electrophoresis) were pooled and dialyzed twice against 1 liter each of 10 mM Tris, pH 7.5, ImM EDTA, 20% glycerol and once with a liter of 10 mM Tris, pH 7.5, 1 mM EDTA, 50% glycerol and stored at 700 C after rapid freezing in a dry ice/ethanol bath.

Native Cbp2. This version of Cbp2 protein was isolated according to the 4step purification protocol described by Shaw and Lewin (1995).

In Vitro Transcription

pSPI5 plasmid DNA purified by CsCl gradients (Maniatis et al., 1989) was

linearized with SmaI and used for in vitro transcription with T7 RNA polymerase (Partono and Lewin, 1988). The transcripts contain the entire intron 5 RNA sequence and the flanking exon sequences. The transcripts were internally labeled using Ca-32P UTP and/or a-32P ATP (ICN).

UV-Crosslinking and Generation of Peptides UV-Crosslinking

Cbp2-RNA complexes were generated according to the UV-crosslinking
technique of Zamore and Green 1989. 32-labeled intron 5 RNA transcripts were
technique of Zamore and Green, 1989). P-labeled intron 5 RNA transcripts were


incubated at room temperature or 370 C for 30 minutes with a molar excess of histagged Cbp2 (7 fold over RNA) or native Cbp2 (21 fold) in a low salt buffer (50 mM Tris, pH 7.5, 10 mM MgCl2, 50 mM NH4CI) containing excess tRNA (nonspecific competitor). Each sample was split into several aliquots, 10 p1 each, in a 96-well microtiter plate (Falcon) placed on ice (in a petridish) and exposed to 600 mJ of UV radiation in a UV-Stratalinker (Stratagene). The aliquots of each sample were pooled into a 1.5 ml Eppendorf tube and treated with 0.32 ug/ml of RNAse A and 100 units of RNAse TI (Boehringer Mannheim) at 370 C for 2 hours to remove uncrosslinked RNA. The samples were resolved by electrophoresis on a 10% SDS-polyacrylamide gel (Laemmli, 1970) and the band corresponding to Cbp2 excised after Coommassie blue staining. The Cbp2 thus purified includes both the crosslinked and un-crosslinked forms of the protein. Generation of Peptides

The purified gel fragments were incubated with chemical cleavage reagents such as hydroxylamine (NH20H) and 2-nitro-5-thiocyanobenzoate (NTCB) and the resulting peptides were resolved on high percentage tris-tricine gels.

Cleavage. The gel pieces were washed four times with distilled water over a period of 20 minutes, placed into appropriate cleavage buffer and thoroughly macerated with a Kontes Eppendorf pestle. The slurry so obtained was completely covered with the cleavage buffer and incubated overnight at appropriate temperature.


Chemical cleavage of proteins with hydroxylamine generates relatively large

peptides due to the infrequency of Asn-Gly bonds. The asparaginyl side chain has a tendency to form a cyclic imide that is susceptible to nucleophilic attack by hydroxylamine (Bornstein, 1977). The cyclization is more favored in the context of a smaller amino acid like glycine resulting in increased susceptibility of AsnGly bonds. Hydroxylamine (NH2OH) cleavage of Cbp2 was performed by overnight incubation of Cbp2 containing gel pieces in 2.4 M guanidine-HC1, 2M hydroxylamine buffer, pH 9, at room temperature, as described above. LiOH was used to neutralize the guanidine-HCI and hydroxylamine-HCl due to increased solubility of LiCl compared to NaCI. The process of gel purification contributes to partial denaturation of the protein while the presence of guanidine-HC1, a strong solvent, enhances the exposure of the Asn-Gly bonds to the nucleophile. Chain cleavage occurs in the presence of alkaline hydroxylamine liberating a new aminoterminal amino acid.

Cleavage with 2-nitro-5-thiocyanobenzoate (NTCB) is a two-step process.

First, the thiol groups on cysteine residues of denatured proteins are modified to SCN groups by NTCB (Jacobson et al., 1973; Degani and Patchornik, 1974), followed by cleavage at the amino group of the modified cysteine by exposure to alkaline pH conditions. Gel purified Cbp2 protein was incubated in 2.4 M guanidine-HC1, 5 mM DTT, 1 mM EDTA, 0.2 M tris acetate, pH 8, buffer at 370 C for 2 hours in order to denature the protein and reduce the disulfide bonds to SH groups. A 10 fold excess of NTCB (50 mM) over the total thiol was added to the


gel slurry, and the incubation was continued for half hour at the same temperature to effect modification of the SH groups to SCN groups. The slurry was filtered through a 0.22 LM low protein-binding, cellulose acetate spin column (CorningCostar), and washed once with distilled water. The slurry was later transferred to a

1.5 ml Eppendorf tube and incubated overnight in 2.4 M guanidine-HCl, pH 9, cleavage buffer at 370 C.

Extraction of peptides. After cleavage, the slurry was filtered through a

Costar column, washed once with distilled water and incubated overnight at 370C in the extraction buffer (0.1% SDS, 50 mM Tris pH 8.8, 0.1 mM EDTA and 0.2 M ammonium bicarbonate). On the third day, the gel slurry was heated at 850 C for 5 minutes and rapidly filtered through a Costar column to recover soluble peptides. The slurry was further incubated with 0.5% SDS, 10 mM Tris, pH 8, for 20 minutes at room temperature and filtered to extract the residual peptides in the gel.

Acetone precipitation and electrophoresis. The filtrates containing the

peptides were pooled, dried in a Speed-Vac (Savant), resuspended in water and precipitated overnight at -20o C with 9 volumes of acidified acetone. Peptides were pelleted at 12000 rpm in a microcentrifuge (Eppendorf) for 20 min and resuspended in 15 1l of SDS gel-loading buffer. The samples were dried in a Speed-Vac to remove the residual acetone, brought to a final volume of 40 g1 with water, resolved on 15% (for hydroxylamine ) or 16.5% (for NTCB) tris-tricine gels (Schagger and von Jagow, 1987), along with 14C-labeled low molecular weight peptide markers (Amersham Corporation), and autoradiographed.


Site-Directed Mutagenesis

The N-terminal RNA contact site on Cbp2 (identified by the UV-crosslinking strategy) was subjected to site-directed mutagenesis to identify key residues for Cbp2 function. Mutations were designed to either delete the region of interest (aal7 SSSRYRYKF aa25) or make point mutations that do not severely perturb the conformation of the protein. The Xbal-BamH1 fragment encoding the first 97 codons of CBP2 from pET15b-CBP2 was sub-cloned into the M13mpl 19 vector and used as the template for oligonucleotide-directed mutagenesis. Mutagenesis Scheme

Single stranded DNA isolated from the phage clone mentioned above was used as a template for mutagenesis. The oligonucleotides used for mutagenesis are shown in Table 2-1. The double primer method of Zoller and Smith (1984) was employed to introduce mutations into the CBP2 segment cloned into M13mpl9 vector. Briefly, 10 pmoles each of the kinased mutagenic oligonucleotide and the universal M13 primer were annealed to 0.5 pmoles of single-stranded DNA template by incubation at 650 C for 30 minutes, 370 C for 20 minutes and room temperature for 5 minutes. The annealed complexes were extended and ligated overnight at 150 C using 4 units of Klenow DNA polymerase (Promega) and 2.5 units of T4 DNA ligase (BRL) to form a gapped heteroduplex. The reaction was diluted 200-fold, transformed into competent TG 1 cells (Amersham) and overlaid


Table 2-1. Oligonucleotides used for mutagenesis of CBP2

Name Length Sequence (5' to 3') Description
AL 260 19 TAGCAAGCCCAATAGGAAC Universal primer (position
1822-1804 in antisense
strand of M13mp 19)
AL 261 17 TAAACGCTTGCTTACAG Sequencing primer to
verify mutations (position
790-774 in antisense
strand of CBP2)
AL 263 33 CACCTGATGTGTGATATTGCCC Deletion of aa 17-28 of
AL 290 30 GTTGAACTTATACCTTAAACG Changes Y to L at aa 21
AL 291 30 CTCCATGTTGAACTTTAACCTG Changes Y to L at aa 23
AL 292* 36 GAACTTATACCTGTAACGACC Deletion of SSS at aa
AL 293 31 GATATTCTCCATGTTCAACTTA Changes F to L at aa 25

* AL292 also changes the codon usage for glycine at position 16 from GGC to GGU


with molten agar to allow formation of plaques. Mutants were identified by plaque lift hybridization with y-32P-labeled mutagenic oligonucleotide as the probe. The resulting mutants were plaque purified once and the single-stranded DNA sequenced. Double-stranded DNA was prepared by mini-prep protocols (Maniatis et al., 1989) from the mutant TG1 clones. The CBP2 segment carrying the mutation of interest was then recloned into pETI 5b-CBP2 expression vector, and sequenced using Sequenase 2.0 kits (Amershami).

In Vitro Splicing Assay

ihe act:i ity of various mutant Cbp2 proteins was determined by an in vitro spl.iciig assay (Partono and Lewin, 1988). 32P-labeled intron 5 RNA transcripts were incubated with wild-type or mutant Cbp2 proteins in 5 mM MgCl2, 50 mM Nt1CI, 50 mM tris-HC1, pH 7.5, buffer, in the presence of 5 mM DTT and 2 units of RNAsin RNase inhibitor (Promega), at 370 C for 10 minutes. Splicing was initiated with 0.2 mM GTP (Pharmacia) and the reactions allowed to continue for varying lengths of time. Reactions were terminated by the addition of equal volumes of 90% formamide, 25 mM EDTA or ethanol precipitated and resuspended in the formamide buffer. Reaction products were resolved on 4% polyacrylamide-8M urea gels and autoradiographed. Splicing Competition Assays

These assays were done essentially as described above but in the presence of a constant amount of the wild-type protein and increasing concentrations of mutant


Cbp2 proteins. The deletion mutant lacking amino acids 17-28 and the triple aromatic mutant with Y21, Y23 and F25 residues converted to leucine were employed to compete with the wild-type protein in splicing assays. As a control, the concentration of wild-type Cbp2 was increased to the same level of total Cbp2 protein (wild-type + mutant) used in the above reactions but in the absence of mutant proteins. Spliced products were resolved on denaturing gels and quantitated using Phosphorlmager (Molecular Dynamics).

Partial Proteolysis of Cbp2

The conformation of mutant Cbp2 proteins was determined by comparing the partial proteolytic profiles of wild-type and mutant Cbp2. Partial proteolysis was done by incubating 0.5-1 ug of the wild-type (native or heat-denatured) or the mutant Cbp2 protein with trypsin, at protease:Cbp2 ratios of 1:50 and 1:100 (w/w), for 1 hour at room temperature and the peptides resolved on 12% SDS-PAGE gels. The peptide profiles were detected by Western blotting performed according to Towbin et al. (1979), with a Cbp2-specific polyclonal antibody (a generous gift of Dr. Alexander Tzagaloff).

Equilibrium Binding Analysis

The affinity of wild-type and mutant Cbp2 proteins for b15 RNA was

determined by the double-filter binding assay (Wong and Lohman, 1993) with the exception that a charged nylon membrane (Hybond N+ from Amersham) was used in place of DEAE. This method involves filtration of protein-RNA mixtures through a sandwich of two membranes, a nitrocellulose filter on top and a nylon


membrane at the bottom, in a 96-well dot-blot apparatus. The protein-RNA complexes are retained on the nitrocellulose while the free RNA is trapped by the nylon membrane. The fraction [RNA bound] can be calculated as follows:

[RNA]bound = [RNA]total (CNc (Y CNY) / (CNC + CNY)

where, CNC and CNY correspond to the Phosphorlmager counts retained on the nitrocellulose and nylon filters respectively. The parameter refers to the RNA retained nonspecifically on nitrocellulose and is empirically derived from RNA bound in the absence of the protein (G = CNC / CNY at [protein] = 0).

Protein-RNA complexes were generated by incubating a low concentration (16 pM) of 32p-labeled intron 5 RNA with increasing concentrations (0-4000 pM) of wild-type or mutant Cbp2 in 5 mM MgCI2, 5 mM DTT, 50 mM NH4CI, 50 mM tris-HC1, pH 7.5, buffer at 370C for 30 minutes. The reactions exhibit equilibrium binding by 30 minutes. Duplicate reactions were filtered through a pre-soaked BA 85 nitrocellulose membrane (Schleicher and Schuell) overlaid on a pre-wetted Hybond N+ nylon membrane, in a 96-well dot-blot apparatus (Bio-Rad). The filters were washed four times with low salt buffer and the radioactivity retained on both the membranes was quantitated using a Phosphorlmager (Molecular Dynamics). The fraction [RNA bound] was calculated and Kd of the mutants determined by the Cbp2 concentration needed for half maximal RNA binding.



Induction of crosslinks by ultraviolet light in nucleic acid-protein complexes has been a valuable tool for probing structural aspects of protein-DNA/RNA interactions. Ultraviolet (UV) photolysis provides a useful approach to determine the contact points between nucleic acid and protein, as it produces zero-length crosslinks in contrast to chemical crosslinking agents. The latter interpose spacers of varying lengths at the interface and hence are less appropriate to probe intimate contacts at the interface of protein-nucleic acid complexes. A free radical mechanism has been proposed to explain the process of UV-crosslinking of amino acids to nucleic acid bases (Shetlar, 1980). Photoexcitation of a nucleic acid base followed by abstraction of a hydrogen atom from a favorably positioned amino acid residue generates a purinyl or pyrimidinyl radical which recombines with the corresponding radical on the proximate amino acid residue. Such a zero-length recombination event requires an amino acid to be present in extremely close proximity to an excited base. Studies on the bacteriophage fd gene 5 protein, a single-stranded DNA-binding protein suggest that the amino acid and the base 32


must also be present in a relatively specific topological arrangement to achieve photochemical crosslinking (Williams and Konigsberg, 1991). For instance, the amino acids Tyr-26 and Phe-73 of the bacteriophage fd gene 5 protein could not be crosslinked in a gene 5-ssDNA complex (Paradiso et al., 1979; Paradiso and Konigsberg, 1982), although 'H nuclear magnetic resonance data suggest that these two residues form part of the DNA-binding domain of the protein (King and Coleman, 1988. The extent of photocrosslinking also depends on the intrinsic structure of the nucleic acid or protein. Among the nucleotides, thymine and uridine appear to be the most photoreactive, yielding greatest extent of crosslinking to proteins. On the other hand, in principle, any of the 20 amino acids found in proteins can be crosslinked to nucleic acids by UV-irradiation (Williams and Kongsberg, 1991).

Photochemical crosslinking has been adapted to detect protein bound to specific sites on double-stranded DNA using 32P-labeled, site-specific probes (Safer et al., 1988). This method permits transfer of 32P from specific phosphodiester bonds to amino acid residues at the interface upon photocrosslinking (Williams and Konigsberg, 1991). We have employed a similar method to detect intron 5 RNA binding sites on Cbp2 protein. We synthesized intron 5 RNA transcripts (internally labeled with a-32P UTP), UV-crosslinked it to purified Cbp2 under conditions that favor specific complex formation, and detected the crosslinked Cbp2-RNA complexes on SDS-polyacrylamide gels by autoradiography as the protein became indirectly labeled upon photocrosslinking.


Various biochemical methods have been employed by several groups to identify the crosslinked peptides and amino acid residues at the interface of protein-nucleic acid complexes. The most common approach has been to digest the crosslinked complex with trypsin, rapidly isolate the peptides using anion-exchange HPLC, detect the peptides by their absorbance at 220 nm or 254 nm, and identify the crosslinked fragments by Cerenkov counting of the resultant fractions (Merrill et al., 1984; Merrill et al., 1988 and Shamoo et al., 1988). In case of proteins with known primary structure, the crosslinked amino acid residues have been identified by amino acid analysis following acid hydrolysis. For example, the crosslink site in the bacteriophage fd gene 5 protein was identified as cysteine-33 by this method (Paradiso et al, 1979). However, this may not represent a general approach as it depends on the ability of acid hydrolysis to regenerate the free amino acid from the crosslinked adduct. In most instances, the crosslinked amino acid was identified by amino acid sequencing, based on the following principle. A gas or liquid phase sequencer cannot extract the phenylthiazolinone derivative of the crosslinked amino acid from the polybrene-coated support disk and therefore leaves a hole in the sequence at the crosslinked position. Thus, the site of crosslinking is determined by the absence of an identifiable phenylthiohydantion derivative in the peptide sequence. Using this approach, the contact sites in E. coli SSB (Merrill et al., 1984) and Al hnRNP (Merrill et al., 1988) proteins crosslinked to 32P-labeled

(dT)8 oligonucleotides were identified. In the case ofE. coli SSB, the site of crosslinking was further confirmed by solid-phase sequencing which employed a


sufficiently polar solvent such as trifluoroacetic acid to extract the 32P-labeled phenylthiohydantion derivative of the crosslinked amino acid.

In addition to the above biochemical methods, gel electrophoresis is a simple but powerful analytical technique to resolve complex mixtures of peptides and identify the indirectly labeled, crosslinked peptides by autoradiography. In the studies reported in this chapter, we have analyzed the UV-crosslinked, Cbp2-32P labeled intron 5 RNA complexes by digesting the protein-RNA complexes with non-enzymatic cleavage agents and resolving the resultant peptides by one dimensional tris-tricine gel electrophoresis. We have mapped the major crosslink sites of intron 5 RNA to the N- and C-termini of Cbp2.


Optimization of UV-Crosslinking Conditions

One of the technical hurdles in biochemical characterization of crosslinked complexes is isolation of sufficient amounts of the protein-RNA complexes, relatively free from other species. As the yield of the product depends on the extent of crosslinking, reaction conditions must be optimized to maximize the crosslinking efficiency. To that end, the dosage of UV-radiation employed for crosslinking Cbp2 protein to intron 5 RNA was titrated, holding other conditions constant. 32P-labeled intron 5 transcripts were incubated with native Cbp2 under low salt conditions (5 mM MgCl2, 50 mM NH4C1) without GTP. Cbp2 binds to intron 5 RNA under these conditions and induces formation of the catalytic RNA conformation (Shaw and Lewin, 1995). The Cbp2-RNA complexes generated

were UV-crosslinked in the presence of excess tRNA (added as a non specific competitor) by the technique of Zamore and Green (1989), as described in Materials and Methods. The samples were irradiated at an increasing UV-dosage ranging from 100 to 950 mJ. As a control, intron 5 RNA was irradiated with a noncognate protein, BSA, at the highest UV-dosage (950 mJ) employed in the experiment. All samples were extensively treated with RNAse A and RNAse TI to remove uncrosslinked RNA, and the protein-RNA complexes were resolved on SDS-polyacrylamide gels. The gel was autoradiographed (Figure 3-1) and also quantitated using Phosphorlmager. No crosslinked complex was observed in the presence of BSA (lane 1) even at a high dosage of UV-radiation, demonstrating the specificity of Cbp2-intron 5 RNA interaction. The extent of crosslinking of intron 5 RNA to Cbp2 increased by about 2-fold at a UV-dosage of 600 mJ (lane 7) compared to that at 100mJ (lane 2) and almost remained the same at higher doses (lanes 8 and 9). Thus a UV-dosage of 600 mJ was chosen as the lowest UV-dosage which yielded optimal complex formation. Identification of Cbp2 Peptides that Contact Intron 5 RNA

The UV-crosslinking technique standardized above was successfully employed to identify the RNA contact sites on Cbp2 protein. 32P-labeled intron 5 RNA transcripts were crosslinked to his-tagged Cbp2 under low salt conditions at a UVdosage of 600 mJ as described above. The Cbp2-RNA complexes generated were purified on SDS-polyacrylamide gels. The gel fragments were then soaked in different chemical cleavage reagents like hydroxylamine (NH2OH) and 2-nitro-5-

Figure 3-1. Optimization of UV-dosage for crosslinking. 32P -labeled intron 5 RNA was incubated with Cbp2 or BSA under low salt conditions as described in Materials and Methods. Samples were irradiated with UV-doses ranging from 100 to 950 mJ, extensively RNAase-treated, resolved on 10% SDS-polyacrylamide gels, and crosslinked complexes detected by autoradiography. UV-irradiation was done at 950 mJ for BSA (lane 1), and for Cbp2 at 100 mJ (lane 2), 200 mJ (lane 3), 300 mJ (lane 4), 400 mJ (lane 5), 500 mJ (lane 6), 600 mJ (lane 7), 800 mJ (lane 8), and 950 mJ (lane 9).


UV-dosage (mJ) Ln
BSA +--------------Cbp2 -+ + + + + + + +

12 34 56 78 9


thiocyanobenzoate (NTCB) to generate peptides. The peptides were separated on high percentage tris-tricine gels (Schagger and Von Jagow, 1987), and the crosslinked peptides that retained the label were identified by autoradiography (Figure 3-2).

NH20H cleaves proteins at asparaginyl-glycyl peptide bonds (Bornstein and Balian, 1977) and would yield three large peptides (15.1, 24, 37.1 kDa) in a complete digest of Cbp2. Cleavage of the crosslinked Cbp2-RNA complex (Figure 3-2, panel A) showed that the 24 kDa amino terminal and the 15.2 kDa carboxy terminal fragments of Cbp2 strongly crosslinked with intron 5 RNA, whereas the large central 37.1 kDa fragment displayed only a very weak signal. The fact that only two of the three peptides were strongly labeled suggests that the terminal fragments of Cbp2 might comprise important RNA binding domains. The weak signal retained by the central 37.1 kDa peptide suggests that other minor contact sites may be distributed throughout the length of protein. These sites of interaction may also contribute to the stabilization of the active intron structure, although the termini may be absolutely essential for the activity.

NTCB is specific to amino groups of cysteines (Jacobson et al., 1973; Degani and Patchornik, 1974). NTCB Cleavage of Cbp2 would produce 9 peptides ranging from 0.17 to 29.5 kDa if the reaction proceeded to completion. However, for several reasons, only a partial digestion of the protein could be achieved. Incomplete cleavage results from p-elimination and/or incomplete modification due to the reversible nature of the cyanylation reaction (Degani and Patchornik,

Figure 3-2. Chemical cleavage of Cbp2-intron 5 RNA complexes. His-tagged Cbp2 was crosslinked to 32P-labeled intron 5 RNA under low salt conditions in the absence of GTP, extensively RNAse treated, gel purified on 10% SDSpolyacrylamide gels, and digested in-gel with hydroxylamine (panel A) and NTCB (panel B). Following cleavage, peptides were extracted as described in Materials and Methods, separated on 15% (hydroxylamine) or 16.5% (NTCB) tris-tricine gels, dried and autoradiographed. Molecular weights of strongly crosslinked peptides are indicated by arrows, with asterisks representing partial cleavage products. Panel C. 0.2 mM GTP was added to the crosslinking reaction mixture and incubated at 370C for 30 minutes. The reaction products were ethanol precipitated, resolved on 4% polyacrylamide-8M urea gels and autoradiographed. Lane 1 shows intron 5 RNA alone incubated in the reaction mixture. Lanes 2 and 3 show the spliced products of intron 5 RNA incubated with native and his-tagged Cbp2 repectively. The input RNA and the spliced products are schematically represented on the left.


A. B.

-4-19.3 kDa* 24 kDa-P 15 kDa-- -4-7 kDa

C.1 2 3


1974). While complete denaturation of the protein is essential to obtain cleavage at the internal sites, Cbp2, a relatively large protein (73.4 kDa), appears to be somewhat refractile even to the strong denaturation conditions employed in these cleavage reactions. Cleavage of crosslinked Cbp2-RNA complexes with NTCB (Figure 3-2, panel B) generated several peptides that retained the label. Among the various indirectly labeled peptides, the 7.0 kDa N-terminal peptide and its corresponding partials (indicated by asterisks) of sizes 8.7 and 19.3 kDa could be readily identified. This further supports the finding that the N-terminus comprises an important RNA binding domain. However, the 5.6 kDa C-terminal fragment generated by NTCB (identified by silver staining, data not shown) did not retain the label, suggesting that the extreme C-terminal region may not be important for Cbp2-RNA interactions. The putative C-terminal contact site identified by NI20H cleavage may therefore be located upstream of this 5.6 kDa C-terminal fragment.

In order to demonstrate that the conditions employed for UV-crosslinking

promote the formation of active Cbp2-intron 5 RNA complexes, the reaction mixes were incubated with 0.2 mM GTP at 370 C for 30 minutes and the products were resolved on denaturing gels and autoradiographed. The results are shown in Figure 3-2, panel C. Reaction mixes containing either his-tagged (lane 3) or native Cbp2 (lane 2) protein clearly demonstrated splicing, while the RNA alone (lane 1) could not splice under similar low salt conditions.


The 6x histidine tag adds an additional 20 amino acid residues (about 2 kDa) to the N-terminus of the his-tagged Cbp2 protein. Therefore, the indirectly labeled N-terminal peptide and the partials obtained with his-tagged Cbp2 would migrate slower in the gels than their non-tagged counterparts. This difference in electrophoretic mobility was used as an analytical tool to confirm the assignment of the crosslink site to the N-terminal fragment (Figure 3-3, panels A and B). The NH20H and NTCB digestion patterns of the crosslinked complexes using either his-tagged or native Cbp2 were compared on the same gel. The results for NH2OH cleavage reactions run on 15% tris-tricine gels are shown in Figure 3-3, panel A. The N-terminal peptide of the his-tagged protein (lane 2) obtained by NH2OH cleavage migrated at 24 kDa level while the non-tagged peptide (lane 1) migrated faster (at 21.6 kDa level). The C-terminal peptides derived from both versions exhibited similar mobilities, since the his-tag is present only at the N-terminus. The corresponding NTCB digests of both versions of crosslinked Cbp2 are shown in Figure 3-3, panel B. The N-terminal peptide (7kDa) and the corresponding 8.7 and 19.3kDa partials (shown by asterisks) of his-tagged Cbp2 (lane 2) were shifted up in the 16.5 % tris-tricine gels compared to those generated from the native Cbp2 (lane 1). No other peptides shifted in the gel relative to the non-tagged version. These experiments showing differential mobility clearly demonstrate that the N-terminal crosslink site corresponds to the extreme N-terminal fragment. The minimal N-terminal peptide that crosslinked with intron 5 RNA was the 4.6 kDa peptide of the native Cbp2 that corresponds to the first 37 residues of the protein.

Figure 3-3. Confirmation of the crosslink site in the N-terminus of Cbp2.
Native and his-tagged Cbp2 proteins were crosslinked to 32P-labeled intron 5 RNA and digested with hydroxylamine (panel A) and NTCB (panel B) as described in the legend to Figure 3-2. Lanes 1 and 2 represent the cleavage patterns of native and his-tagged Cbp2, respectively. Molecular weights of strongly crosslinked peptides are indicated by arrows, with asterisks representing partial cleavage products. Note the slower migration of N-terminal derived fragments in the histagged Cbp2 lanes.


A. z

21.6 kDa--O- -4-24 kDa
15 kDa--*2

B. z

16.9 kDa--O- 1 1 -4-19.3 kDa*

It -4-8.7 kDa*
*6.3 kDa--po- -4-7.0 kDa
4.6 kDa---lo1 2


Further analysis of the identified contact sites (Chapter 4) was restricted to the identified N-terminal fragment. However, certain conclusions can be drawn about the C-terminal fragment from the experiments described above. The 15 kDa Cterminal peptide generated by NH2OH cleavage showed strong crosslinking with intron 5 RNA (Figure 3-2, panel A). But the 5.6 kDa C-terminal fragment generated by NTCB (Figure 3-2, panel B) did not retain the label in crosslinking experiments. These results suggest that the 29.5 kDa penultimate C-terminal peptide of Cbp2 (aa 502-aa582) generated by NTCB has a potential RNA binding site.

The summary of findings from the UV-crosslinking experiments are shown in Figure 3-4. The map shows the two strong RNA binding regions (hashed boxes) that have been identified by these experiments, with one site being in the first 37 amino acids of the N-terminus and the other in a distally located C-terminal region (aa 502-aa 582). The digestion sites of NH2OH and NTCB on Cbp2 are also indicated in Figure 3-4. Further analysis of the importance of amino acid residues in the N-terminal fragment was carried out using site-directed mutagenesis (Chapter 4).


UV-crosslinking is a powerful tool to identify RNA contact sites on a protein, especially when the primary structure and homology searches do not afford any clues about critical functional elements of the protein. Cbp2, required for the

Figure 3-4. Summary of UV-crosslinking results. The peptide map represents the cleavage sites of NTCB (top arrows) and hyroxylamine (bottom arrows) on the 630-aa long Cbp2 protein. From the UV-crosslinking and chemical cleavage results shown in Figures 3-2 and 3-3, the intron 5 RNA crosslink sites on Cbp2 were mapped to the first 37 amino acids at the N-terminus and aa502-aa582 in the C-terminus (hashed boxes).

co 11 tC o0
CO LnC14 o coNTCB

Ir 00

__ __ __ I1l 630

79NH20H 501



splicing of intron 5 RNA, fits into this profile of proteins. Nothing is known so far about the RNA contact sites on the protein while extensive studies are available on the RNA component of the system. In the studies reported here, UV-crosslinking was employed to determine the contact points of intron 5 RNA on Cbp2 in an attempt to investigate the functional interactions between this group I intron and its protein co-factor. The photocrosslinking studies were performed under conditions that favored the formation of stable protein-RNA complexes. The Mg levels (10 mM) employed in these experiments were sufficient to promote 90-95% RNA binding to Cbp2 in equilibrium filter binding assays (data not shown), but splicing of RNA would not occur under these conditions due to the absence of guanosine (nucleophile). However, control experiments show that addition of GTP to the reaction facilitates splicing, demonstrating that the crosslinking conditions enable the formation of productive Cbp2-RNA complexes (Figure 3-2, panel C).

Prior to determining the sites of crosslinking, it is essential to establish the specificity of crosslinking between the RNA and the protein in question. In control experiments, intron 5 RNA failed to crosslink to the non-cognate protein BSA (Figure 3-1), showing that photocrosslinking (zero-length crosslinking) can occur only between functionally interacting species. Also, Cbp2 proteins carrying mutations in the N-terminal domain showed reduced or no crosslinking with intron

5 RNA compared to the wild-type protein (discussed in Chapter 4). Furthermore, Cbp2 does not facilitate splicing of intron 4 of COB pre-mRNA (Lewin, unpublished observation), a group I intron that also requires a protein co-factor in

vivo (Lamb et al., 1983; Banroques et al., 1986). Cbp2 protein is specific to intron 5 RNA in its splicing-enhancing function. This corroborates the authenticity of the crosslinking results, as UV-light crosslinks an amino acid to its neighboring nucleic acid base only when present in a specific orientation (Williams and Konigsberg, 1991). The results of various experiments described above strongly suggest that the crosslinking conditions employed permit the structural probing of specific, functional interactions between Cbp2 and intron5 RNA.

Precise identification of the residues that participate in photocrosslinking can be accomplished by amino acid analysis or amino acid sequencing, as described earlier. These conventional biochemical techniques, however, require crosslinking efficiencies of 20% or more. Unfortunately, low crosslinking efficiencies (less than 10%) were obtained under our conditions. Therefore, the RNA employed for some of the crosslinking experiments was double labeled with c 32P-UTP and a32PATP to increase the specific activity of RNA and enable detection of crosslinked peptides. There are several possibilities for the low yields of crosslinked product obtained in our system. Cbp2 and intron 5 RNA may have inherently poor tendencies to crosslink in spite of appreciable complex formation. On the other hand, exposure to UV-light could be causing significant photoinactivation of Cbp2. Photodamage of protein was reported to be a problem by other groups (Gott et al., 1991; Tanner et al., 1988). Finally, though UV-crosslinking indicates sites of protein-RNA contact, most of the affinity between protein and RNA may be attributable to contact sites that are not crosslinked under the conditions employed.


The low level of crosslinked product obtained in our system proved to be a potential problem for further biochemical characterization of crosslinked complexes. One of the ways to overcome this problem would be to enhance the photosensitivity of RNA using modified residues like 5-bromouridine or 5iodouracil and using a monochromatic laser instead of a broad spectrum ultraviolet light. For instance, the amino acid residue Tyr 85 of R17 bacteriophage coat protein was shown to be crosslinked with singly BrU-substituted hairpin RNA 1 (Gott et al., 1991) using a monochromatic XeCI excimer laser (308 nm) that yielded crosslinking levels exceeding 50%. Substitution of 5-iodouracil for uracil in the binding site for bacteriophage R 17 coat protein improved crosslinking levels to 80% in less than 5 minutes of irradiation (Willis et al., 1993). However, incorporation of 5-BrU into intron 5 RNA significantly reduced its autocatalytic activity, indicating that the structure of the ribozyme was perturbed (data not shown). Also, our attempts to crosslink Cbp2 protein with 5-BrU-RNA using a broad spectrum UV-source (Stratalinker) did not significantly enhance the extent of crosslinking. Since we did not have ready access to a monochromatic laser, we opted to employ alternative analytical methods which accommodate low crosslinking efficiencies.

A popular approach to analyze crosslinked complexes obtained at low yields is to employ extremely sensitive analytical techniques like Matrix-assisted, laser desorption/ionization-time of flight (MALDI-TOF) mass spectrometry (Karas and


Hillenkamp, 1988; Beavis and Chait, 1990 and Hillenkamp et al., 1991) and ladder sequencing (Chait et al., 1993), which typically require 10-15% crosslinking efficiency. Elaborate attempts were made to identify the crosslinked peptides/amino acid residues using this approach in collaboration with the Protein Core facility of the Interdisciplinary Center for Biotechnology Research (ICBR), University of Florida. Unfortunately, all attempts failed due to various technical problems including difficulty in removal of SDS, Coommassie Blue and other gelderived contaminants from the peptides. Consequently, the indirectly labeled Cbp2 peptides (crosslinked with intron 5 RNA) were identified by size separation on tris-tricine gels followed by Phosphorlmager analysis (Figures 3-2 and 3-3). Non-enzymatic cleavage agents were used instead of proteases to avoid interference from protease-derived peptides resulting from self-cleavage. Of several chemical cleavage reagents, hydroxylamine was chosen for the initial analysis of crosslinked complexes as it generates only a few large peptides in Cbp2 that can be readily identified on high percentage tris-tricine gels. NTCB was selected as a secondary reagent to further narrow down the contact points on Cbp2.

Chemical cleavage of the protein-RNA complexes with NH2OH and NTCB

showed that the termini of Cbp2 comprise important RNA binding domains, while several stretches in the central core of the protein may contribute to the overall stabilization of protein-RNA interactions (Figures 3-4). Experiments with histagged and native versions of Cbp2 (Figure 3-3) unambiguously demonstrate that the first 37 amino acids in the N-terminus of Cbp2 constitute a strong RNA contact

site. A second site may be located in the C-terminus between residues 502 and 582 of the protein. A similar architecture of RNA binding domains has been demonstrated with the mitochondrial tyrosyl-tRNA synthetase protein (Cyt- 18) of Neurospora which is essential for splicing several mitochondrial group I introns in addition to aminoacylation of tRNATyr (Akins and Lambowitz, 1987). The regions required for splicing are distributed throughout the Cyt-18 protein, as it binds the precursor RNA and facilitates formation of the catalytic RNA structure. These regions overlap with the stretches required for synthetase activity but are not identical to them. However, the principal RNA binding regions include a small, idiosyncratic N-terminal domain significantly absent in bacterial tyrosyl-tRNA synthetases (Cherniack et al., 1990) and a C-terminal tRNA-binding domain required for both splicing and synthetase activities (Kittle et al., 1991).

A comparison of Cyt 18 binding sites in N. crassa mt LSU and ND1 introns with that in N. crassa mt tRNATyr has revealed a remarkable three-dimensional overlap between the tRNA and the catalytic core of group I introns, suggesting an evolutionary relationship between group I introns and tRNA and perhaps the evolution of RNA splicing factors from cellular RNA-binding proteins (Caprara et al., 1996). Adaptation of a synthetase to facilitate group I intron splicing appears to be a relatively recent evolutionary improvement as it has been reported in only one other closely related fungus, Podospora anserina (Cherniack et al., 1990; Lambowitz and Perlman, 1990 and Kamper et al., 1992).


Cbp2 protein does not possess any sequence homology with Cyt 18 of N. crassa or Ytsl protein of P. anserina. However, the latter two share three blocks of amino acids required for splicing, of which one corresponds to the idiosyncratic Nterminal domain of Cyt- 18, while the other two are located in the putative Cterminal tRNA binding domain. Although Cbp2 is not a bifunctional protein, the structural similarities between the catalytic core of group I introns and tRNA may point to a common mechanism of recognition of a conserved tRNA-like structural motif in its cognate intron, intron 5 RNA.



UV-crosslinking studies (Chapter 3) show that the N- and C-termini of Cbp2 intimately contact intron 5 RNA. Now the challenge is to identify which amino acids in these regions are important for Cbp2 function. Unlike most other RNAbinding proteins, Cbp2 does not contain any well-characterized RNA binding motifs like the RGG box, RNP or KH motif (Burd and Dreyfuss, 1994). However, Cbp2 is rich in basic and hydrophobic amino acids, which is also a characteristic of double stranded RNA-binding proteins (St Johnston et al., 1992; Gatignol et al., 1993). The only protein with which Cbp2 displays any homology is its counterpart in S. douglasii (Li et al., 1996). However, the extremely high identity (87%) between the two homologs does not lend itself to the identification of potential RNA binding domains by sequence alignments. Therefore, the only viable alternative is to identify the important residues by biochemical or genetic methods. The low crosslinking efficiencies obtained in our system ruled out the use of biochemical methods such as anion-exchange HPLC or mass spectrometry to identify the critical residues. Therefore, site-directed mutagenesis was used to identify critical residues for Cbp2 function.


Site-directed mutagenesis is a powerful tool to study the structure-function relationship of single or combinations of amino acid residues in proteins. It has been classically used in probing various RNA-protein interactions. One of the many applications of this technique has been to dissect the individual functions of various amino acids in dual-function proteins. For instance, the MS2 (R17) bacteriophage coat protein which binds and encapsidates viral RNA also acts as a translational repressor of viral replicase by binding to an RNA hairpin in the RNA genome. LeCuyer et al., 1995, LeCuyer et al., 1996) successfully studied the RNA binding properties of MS2 coat protein independent of capsid assembly by isolating a Val75Glu; Ala8 1Gly double-mutant coat protein which had wild-typelike affinity and specificity for RNA, but was defective in capsid assembly.

Site-directed mutagenesis has also been employed to study the evolutionary

relationships of RNA-binding proteins in various species. For example, the second intron (bi2) of cyt b gene has two homologs in related Saccharomyces species that differ in their mobility. The S. capensis intron product is bifunctional, with both a DNA endonuclease and an RNA maturase function (Lazowska et al., 1992; Szczepanek and Lazowska, 1996), whereas the homologous S. cerevisiae intron product has only an RNA maturase function and is not mobile (Meunier et al., 1990; Lazowska et al., 1992). These two intron-encoded proteins differ by only four amino acid substitutions. Mutational analysis showed that replacement of two non-adjacent amino acids (Thr212Ala; Thr239His) in the S. cerevisiae maturase was necessary and sufficient for the acquisition of an endonuclease activity


promoting intron mobility (Szczepanek and Lazowska, 1996). Thus, the S. capensis protein could be considered more primitive in terms of mitochondrial group I intron-encoded protein evolution as the two activities have not yet diverged. The S. cerevisiae protein, on the other hand, lost the original function (intron mobility) and maintained the acquired one (RNA maturase function) during evolution.

Site-directed mutagenesis has been instrumental in delineating novel RNA binding motifs of proteins with little or no sequence homology to known RNA binding consensus sequences. The viral coat proteins of the plant viruses alfalfa mosaic virus (AMV) and tobacco streak virus (TSV) share little primary amino acid sequence identity (van Vloten-Doting, 1975; Reusken et al., 1995), but are functionally interchangeable in RNA binding (Zuidema and Jaspars, 1984) and initiation of infection (Gonsalves and Garnsey, 1975). The lysine-rich N-terminal RNA binding domain of the AMV coat protein lacks previously identified RNA binding motifs. Mutational analysis of this N-terminal region identified a single arginine whose specific side chain and position were crucial for RNA binding (Ansel McKinney et al., 1996). Consequently, protein sequence alignments between AMV, TSV, and other related viruses centered on this key arginine residue revealed a new RNA binding consensus sequence. This also explained in part why heterologous viral RNA-coat protein mixtures were infectious.

In the case of Cbp2, we employed site-directed mutagenesis to identify the

important residues (by either partial or complete loss of Cbp2 function) in the N-


terminus that crosslinked to intron 5 RNA. The C-terminal region that strongly crosslinked to RNA was not pursued further, as attempts to narrow down this region by double digestion of crosslinked complexes with NH2OH followed by cyanogen bromide were not feasible within the resolution of our gel system.

In order to identify targets for site-directed mutagenesis of Cbp2, the putative N-terminal RNA contact site on Cbp2 (spanning 37 residues) was scanned closely to allow the prediction of residues that might be important in RNA-protein interactions. This sequence, aal7 SSSRYRYKFNME aa28, has the following interesting features:

a. Charged residues alternate with aromatic residues. b. Polar residues flank the region of alternating charged and aromatic residues. While the charges could promote ionic interactions between protein and RNA, the aromatic residues could engage in stacking interactions. The stretch of serines could participate in hydrogen bonding interactions. These various possibilities led us to target this N-terminal region (aal7-aa28) for site-directed mutagenesis. The details of the analyses of all these mutants and a discussion of their implications are described in the following sections.


All mutant his-tagged Cbp2 proteins (Table 4-1) were purified by one-step

metal affinity chromatography as described in Materials and Methods. The serine deletion mutant and the Y23L mutant could not be successfully purified. The


Table 4-1. Description of Cbp2 mutants

Name of Mutant Mutant Description

Deletion mutant Deletion of aal7-aa28

Triple aromatic mutant Changes Y21, Y23, and F25 to L Triple charged mutant Changes R20, R22, and K24 to L

Y21IL mutant Changes Y21 to L

Y23L mutant Changes Y23 to L

F25L mutant -Changes F25 to L

Serine, deletion mutant Deletion Of S17, S18, and S19


former eluted in the wash fractions with other E. coli proteins, while the latter copurified with a nuclease activity and could not be assayed. The serine deletion appears to have altered the global conformation of Cbp2 (perhaps the topology of the histidine tag), resulting in poor binding to the nickel column. Independent attempts to purify the Y23L mutant with fresh reagents and columns still yielded preparations with high nuclease activity, raising the possibility that this mutation has conferred a nuclease function to Cbp2. This problem was not encountered in parallel preparations of any of the other mutants. Although these mutants appear to possess interesting properties, they were not characterized further.

The mutant Cbp2 proteins purified from E.coli were first analyzed by Western blotting with a Cbp2-specific polyclonal antibody to check for production of the full-length protein. Mutant proteins were separated on a 10% SDS-polyacrylamide gel and electroblotted to a nitrocellulose membrane at 15 volts, overnight. The membrane was first probed with Cbp2-specific primary antibody followed by secondary goat anti-rabbit antibody as described by Towbin et al. (1979). The Cbp2 bands were detected by chemiluminescence using ECL detection system (Amersham) (Figure 4-1, panel A and panel B). All mutant proteins (in both panels) except the deletion mutant (lacking aal 7-aa28) exhibited electrophoretic mobilities similar to that of wild-type Cbp2. The deletion mutant (aa 17-aa28) was shorter by about 1.3 kDa, as expected. These data confirm the synthesis of full length mutant Cbp2 proteins in E. coli. To test the effects of these mutations on splicing function, in vitro splicing assays were carried out. 32P-labeled intron 5


c! C-q

0 Cd > 0




-0 C;3 cd


0 C'i

4 u


tA C'j


ICZA lizlk

qszd Cl)




(sz-zl) U014alaa C4 aldiijL V-4


RNA transcripts were incubated with increasing concentrations of wild-type or mutant Cbp2 proteins under low salt splicing conditions. The reaction products were separated on 4% polyacrylamide-8M urea gels and autoradiographed (Figure 4-2). Increasing concentrations of deletion mutant (aal 7-aa28) (lanes 4 and 5) and triple aromatic mutant (lanes 6 and 7) failed to stimulate splicing of intron 5 RNA, while wild-type Cbp2 spliced normally at both concentrations tested (lanes 2 and 3). These results strongly suggest that the N-terminal residues (aal7-aa28) may comprise an important RNA binding domain essential for Cbp2 function. However, it is important to demonstrate that the loss of activity observed was not due to structural destabilization caused by these mutations.

Partial proteolysis is a useful technique to analyze the conformational states of proteins (Chang and Doi, 1993; Hay and Nicholson, 1993; Petersen et al., 1995; Ikeda et al., 1996; Liu et al., 1996). In this assay, deletion and triple aromatic mutant proteins (in native states) were incubated separately with trypsin under conditions that favored partial proteolysis as described in Materials and Methods. A control digest with native or heat-denatured wild-type Cbp2 was also done. The peptides were resolved on 12% SDS-PAGE gels and detected by Western blotting with a Cbp2-specific polyclonal antibody (Figure 4-3). The tryptic peptide profiles of native deletion (lanes 3 and 4, panel A) and triple aromatic (lanes 3 and 4, panel B) mutants closely resembled the pattern obtained with native wild-type Cbp2 (lanes 5 and 6 of both panels). In contrast, heat-treated wild-type samples (lanes 1 and 2 of both panels) exhibited a different pattern, showing aggregation of

Figure 4-2. Functional analysis of deletion (aa17-aa28) and triple aromatic mutants. 32p-labeled intron 5 RNA was incubated with increasing concentrations of wild-type and mutant Cbp2 under low salt splicing conditions at 370C for 1 hour, ethanol precipitated, resolved on a 4% polyacrylamide-8M urea gel, and autoradiographed. The precursor RNA and the products of splicing are schematically represented on the left side of the gel, with the ratio of protein to RNA shown on top of the lanes. Lane 1, precursor RNA alone; lanes 2 and 3, incubation with wild-type Cbp2; lanes 4 and 5, incubation with deletion (aal7aa28); lanes 6 and 7, incubation with triple aromatic mutant (Y21, Y23, F25 to L).




Protein: RNA 6

2 3 4 5 6 7

cis 4.) 4 0


0 '74


cd -r

tv rcis
0 0 J. .- 0 V) co cp

C-) u cq

u Cq u

u 00 u

o3 4-o a) q3

-cl u V)



Qf) cn




ZdqD 4m 09:1
1001:1 LO
:)i Pwon aldlijL
L001:1 Cf)
ZdcD Im F os:l
pajnjLuaP-4LaH 001:1



zdqD IMF os:i
001:1 Ln

U014ala(l 001:1 co

ZdcD ImF osi: I pajnlPuaP-ILaH
001:1 0-


denatured protein at the top of the gel. In addition, partial products corresponding to those obtained with native proteins were markedly absent in these digests. This is probably due to complete degradation of denatured protein molecules that were not present in aggregates. Thus, these results demonstrate that the mutations in Cbp2 did not alter the global conformation of these proteins.

Preliminary splicing experiments with triple charged mutant (R20, R22, K24 changed to leucine) and two point mutants, namely Y2 1 L (tyrosine to leucine change at position 2 1) and F25L (phenylalanine to leucine at position 25), showed varying degrees of activity. These mutants were characterized further by a series of time-course experiments that measured their initial rates of splicing (Figures 4-4 and 4-5). 32P-labeled transcripts were pre-incubated with each mutant protein at 37 0C for 10 minutes under low salt conditions and splicing was initiated by the addition of 0.2 mM GTP. The reactions were terminated at different times, resolved on denaturing polyacrylamide gels (Figure 4-4A & B) and autoradiographed. The F25L mutant (Figure 4-4A, right panel) stimulated splicing at levels comparable to wild-type Cbp2 (Figure 4-4A, left panel), while the triple charged and Y21IL mutants (Figure 4-413 left and right panels, respectively) showed drastic reduction in the extent of splicing. It is interesting to note that in the case of triple charged and Y2 I L mutants (compare Figures 4-4 A and 4-4B), the products of the first step of splicing (5' exon and the intron-3' exon) were barely detectable compared to the products of the second step (ligated exons and free intron), suggesting that the first step of splicing is rate limiting for these two

Figure 4-4. Time course of splicing for wild-type and mutant Cbp2. Radiolabeled intron 5 RNA was incubated with wild-type or mutant Cbp2 proteins under low salt splicing conditions. Reactions were terminated at indicated times, resolved on 4% polyacrylamide-8M urea gels, and autoradiographed. A schematic representation of the precursor RNA and spliced products are given on the left side of the figures. A. Shows the splicing time course for the wild-type Cbp2 (left panel) and F25L mutant (right panel). B. Shows the splicing time course for the triple charged mutant (left panel) and the Y21L mutant (right panel). A marker lane with wild-type Cbp2 was run on the right of each panel to indicate the location of spliced products.


Wt Cbp2 F25L

Time (min) 0 1 2 4 6 8 10 12 24 60 0 1 2 4 6 8 10 12 24 60
.. -..... .. .. -.... .. ......

.. .. ... .. .... .0


Triple charged mutant Y21L mutant
Time (min) 0 1 2 4 6 8 10 12 24 60 0 1 2 4 6 8 10 12 24 60

Fgr t -A continued

Figure 4-4..continued

Figure 4-5. Splicing rates of wild-type and mutant Cbp2. The gels shown in Figure 4-4 were quantitated using Phosphorlmager and the RNA fraction spliced calculated as the ratio of the sum of ligated exons and free 5' exon to the exon sequences present in the precursor RNA. The plots show RNA fraction spliced (+/-S.D) vs. time in min. A. Filled circles, Wt Cbp2; open circles, F25L mutant; filled squares, Triple charged (LYLYLF) mutant; open squares, Y2 1 L mutant. B. The plots for the last two mutants shown in A are plotted on an expanded scale to show initial rates of splicing. Filled circles, Triple charged (LYLYLF) mutant; open circles, Y2 1 L mutant.



--- Wt Cbp2
--0-- F25L
1.0 ---- Y21 L



o 0.6
- I

0.4 l<


0 5 10 15 20 25

Time (min)



0.08 -o- Y21L

.' 0.06 C-)

o 0.04


: 0.02

0 5 10 15 20 25

Time (min)

Figure 4-5...continued


mutants. A quantitative representation of splicing for the wild-type and mutant proteins is shown in Figure 4-5A. A re-plot of the data corresponding to triple charged and Y2 IL mutants is shown on an expanded scale in Figure 4-5B3. Initial rates of splicing were calculated from the above plots for all mutants (Table 4-2). Figure 4-5A shows that the triple charged (filled squares) and the Y2 1 L (open squares) mutants exhibited extremely low activity compared to F25L mutant (open circles) or wild-type Cbp2 (filled circles). However, it is obvious from Figure 45B that both triple charged and Y2 1 L mutants accumulated spliced products with time. Initial rate measurements (Table 4-2) indicated that the rate of splicing of the F25L mutant, though appreciable, was slightly lower than that of the wild-type protein. In the case of the Y2 I L and triple charged mutants, the initial rate of splicing was lowered by -45-fold and -4O-fold, respectively, in comparison to wild-type Cbp2. Thus, tyrosine at position 21 is critical for activity while a phenylalanine at position 25 is dispensable. The charged residues at positions 20, 22 and 24 are also important for Cbp2 function.

To determine if lower splicing activity of the Cbp2 mutants corresponded to a reduction in overall affinity for intron 5 RNA, equilibrium binding assays were performed. 32P-labeled intron 5 RNA (16 pM) was incubated with increasing concentrations of wild-type or mutant Cbp2 (0-4000 pM) at 370C for 30 minutes and equal aliquots were filtered in duplicate through a double-filter consisting of nitrocellulose on top and charged nylon at the bottom, as described in Materials and Methods. Representative filter binding data are shown in Figure 4-6A. The


Table 4-2. Rate measurements for wild type and mutant Cbp2

Cbp2 protein RNA fraction spliced Initial rate of splicing at 60 minutes (fraction min'l)

Wild-type 0.94 0.22 0.189

F25L 0.68 0.09 0.162

LYLYLF 0.11 0.01 0.474 x 10-2

Y21L 0.05 0.0005 0.417 x 10-2

Figure 4-6. Double filter-binding assay of wild-type and mutant Cbp2. A. Radiolabeled RNA was incubated with increasing concentrations of wild-type and mutant proteins under low salt splicing conditions (without GTP) at 370C for 30 min. Equal aliquots of each reaction were filtered in duplicate through a sandwich consisting of nitrocellulose on top and charged nylon at the bottom, as described in Materials and Methods. RNA-binding patterns for the triple charged and F25L mutants and wild-type Cbp2 on nitrocellulose (left panel) and nylon (right panel) are shown. B. The dot blots shown in A. were quantitated using Phosphorlmager and the fraction RNA bound calculated as described in Materials and Methods. The fraction of RINA bound is plotted as a function of Cbp2 concentration. Open squares, Y2 1 L; filled squares, triple charged mutant; open circles, deletion (aalI7-aa28); filled circles, triple aromatic mutant; open triangles, F25L; filled triangles, wildtype Cbp2.

Nitrocellulose Nylon N+

[Cbp2] --o

Triple 0 0
charged 0 *#*#*0







0 0.6-c 0.4,

--e-Triple charged
0.2 0 Deletion (aal7-28)
*-- Triple aromatic A-- Wild type & F25L
0.0 I I
0 1000 2000 3000 4000

Cbp2 (pM) Figure 4-6...continued


nitrocellulose membrane, which contains protein-RNA complexes (left panel) showed an increase in the bound RNA fraction with increasing Cbp2 concentrations, while the nylon membrane which contains free RNA (right panel) showed a corresponding decrease in the free RNA retained. Each filter binding experiment (in duplicate) was repeated at least two times and the RNA binding data (Figure 4-6B) used to calculate dissociation constants (kd) (Table 4-3).

The F25L mutant (open triangles), which showed wild-type-like splicing

activity, demonstrated RNA binding levels comparable to that of wild-type (filled triangles). The kd values of wild-type protein and F25L mutant were very similar (147 pM and 143 pM respectively). The triple charged (filled squares) and the Y21L mutants (open squares), which displayed partial splicing activity, showed reduced binding. These two mutants showed '-2.5-fold and '-5-fold increase in kd values, respectively, relative to wild-type Cbp2. The deletion mutant (open circles) showed slightly tighter binding (kd of 77 pM) than wild-type, whereas the triple aromatic mutant (filled circles) showed slightly lower binding levels (kd Of 184 pM) compared to wild-type Cbp2. Although the kd1 values are variable, the overall RNA binding profiles of mutants are similar to that of wild-type Cbp2 (hyperbolic). The similarity in binding isotherms for most of the mutant proteins confirms our conclusion that the amino acid changes have not significantly destabilized the higher order structure of protein. These results also suggest that the overall RNA binding pattern does not necessarily reflect the ability to stimulate splicing of intron 5 RNA.


Table 4-3. Dissociation constants of Cbp2 mutants

Cbp2 protein kd (pM)

Deletion (aal7-aa28) 77

Wild type Cbp2 147

F25L mutant 143

Triple aromatic mutant 184
(Y21, Y23, and F25 to L) Triple charged mutant 367
(R20, R22, and K24 to L) Y21L mutant 710


Since the putative contact sites in Cbp2 were initially identified by UVcrosslinking, the mutants were tested for their ability to crosslink to intron 5 RNA. 32P labeled RNA transcripts were UV-crosslinked to wild type or mutant Cbp2 protein, RNAase treated and resolved on 10% SDS-polyacrylamide gels. The crosslinked complexes were detected by autoradiography (Figure 4-7) and quantitated using PhosphorImager. RNA crosslinked in the absence of protein (lane 5) was almost completely degraded, without any detectable complexes. However, RNA crosslinked to wild type Cbp2 (lane 4) showed a prominent crosslinked species corresponding to the molecular weight of Cbp2. Crosslinking to triple charged (lane 3) and F25L (lane 1) mutant proteins was reduced by -50% and -53%, respectively, compared to wild type. The Y21L mutant (lane 2) showed extremely poor crosslinking to intron 5 RNA. The background bands seen below the level of Cbp2 (lanes 1 to 4) could be photodamaged Cbp2-RNA complexes or RNA-RNA crosslinks that were resistant to RNAase. Thus, mutations at positions R22, R24, K26, Y21 and F25 lowered the crosslinking efficiency of Cbp2. It is important to note that mutations targeting the above residues also affected splicing, with the exception of the F25L mutation. Thus, some of the residues in this region (aal7-aa28) that are important for Cbp2 function also appear to be involved in crosslinking Cbp2 to intron 5 RNA.

As partial proteolytic profiles (Figure 4-3) and filter binding curves (Figure 46B) of deletion (aal7-aa28) and triple aromatic mutants were similar to that of

Figure 4-7. UV-crosslinking of wild-type and mutant Cbp2 to intron 5 RNA. Wild-type or mutant Cbp2 was incubated with radiolabeled intron 5 RNA under low salt conditions in the presence of 20 ug/ml tRNA. The samples were then UVcrosslinked at 600 mJ, extensively RNAase treated, resolved on 10% SDS-PAGE gels, and autoradiographed as described in Materials and Methods. Lane 1, F25L mutant; lane 2, Y21L mutant; lane 3, triple charged (LYLYLF) mutant; lane 4, wild-type Cbp2; lane 5, radiolabeled RNA alone. The molecular weight position of Cbp2 is indicated by the arrow.


cu O-j
cq C4 74 kDa-01 2 3 4 5


wild-type, they were tested for their ability to compete with wild-type Cbp2 in splicing assays. Splicing reactions were set up at wvild-type Cbp2 to intron 5 RNA ratio of 7:1 in the presence of increasing concentrations of mutant proteins. Reaction products were resolved on denaturing gels and autoradiographed (Figure 4-8A). Wild-type Cbp2 alone (lane 1) spliced normally while the deletion (lane 2) or triple aromatic (lane 7) mutant alone was completely defective in splicing activity, as reported before. Addition of increasing concentrations of deletion (lanes 3 to 6) or triple aromatic (lanes 8 to 11) mutant protein to wild-type Cbp2mediated reactions showed a progressive inhibition of splicing (compare lane 1 with lanes 3 to 6 and 8 to 11). These results are quantitatively represented in Figure 4-8B3. The graphs show percentage splicing as a function of mutant:wildtype ratios, with the extent of splicing obtained in the presence of wild-type Cbp2 alone set to 100%. Results of the addition of deletion and triple aromatic mutants are shown in the left and right panels, respectively. Addition of a 3-fold excess of deletion mutant lowered splicing levels to 40% of control levels. A similar inhibition of splicing was observed with triple aromatic mutant, although at a higher ratio (9: 1) of mutant to wild-type Cbp2. Thus, Cbp2 mutants inhibited the protein-mediated splicing of intron 5 RNA when present in excess over the wildtype protein.

It is important to note that at the highest level of splicing inhibition (Figure 4813), total protein (mutant + wilId-type) to RNA ratio was 7 1: 1 for the deletion mutant and 140:1 for the triple aromatic mutant. It is, therefore, possible that the

Figure 4-8. Effect of mutant proteins on wild-type Cbp2-mediated splicing. Splicing reactions were performed at 7:1 wild-type Cbp2:RNA in the presence of increasing concentrations of deletion (aal 7-aa28) or triple aromatic mutant proteins. Reactions were resolved on 4% polyacrylamide-8M urea gels and autoradiographed. A. Lane 1, wild-type Cbp2 alone; lane 2, deletion mutant (aal7-aa28) alone; lanes 3-6, constant amount of wild-type + increasing concentrations of deletion mutant proteins; lane 7, triple aromatic mutant alone; lanes 8-11, constant amount of wild-type + increasing concentrations of triple aromatic mutant proteins. The ratio of mutant to wild-type Cbp2 in each reaction is indicated above the lanes. The precursor RNA and spliced products are schematically represented on the left of the gel. B. The splicing gels in A were quantitated using PhosphorImager and the % splicing (determined from ligated exons) plotted as a function of mutant:wildtype Cbp2, setting the extent of splicing with wild-type Cbp2 alone to 100%. The left and right panels show data corresponding to deletion (aal 7-aa28) and triple aromatic mutants, respectively.

Deletion Triple aromatic
(aal7-aa28) (RLRLKL)

Mutant: Wt Cbp2 ', 7 71 71' c: 00 67 6 6$

C) CD M cr, 00

12 3 4 56 78 910 1


Deletion (aal7-28) Triple aromatic mutant
120 120

100 100.

0 80
60 6040o 40

20 20

0. 0
0:1 0.6:1 3:1 6:1 9:1 0:1 1.8:1 9:1 18:1 27:1
Mutant: Wt-Cbp2 Mutant : Wt-Cbp2

Figure 4-8...continued


inhibition observed in this experiment was a function of total protein concentration (mutant + wild-type Cbp2), rather than being a property of mutants. To test this possibility, splicing was performed with increasing concentrations of wild-type Cbp2 alone (Figures 4-9A and 4-9B3). Maximum splicing activity was obtained at a protein:RNA ratio of 7:1 (lane 4 in Figure 4-9A; expressed as 100% activity in Figure 4-9B3). However, splicing was severely inhibited at 28:1 (lane 6), and almost completely inhibited at higher ratios (lanes 7 and 8) of wild-type Cbp2:RNA. The splicing levels dropped to 21% (for 28:1) and -1% (for 56:1 and 112: 1) of the activity obtained at 7:1 ratio (Figure 4-9B3). Thus, wild-type Cbp2 appears to stimulate splicing only in a narrow range of protein:RNA ratios, with higher levels being inhibitory. In order to determine whether aggregation was the cause for the observed inhibition of activity, these experiments were repeated over a wide range of concentrations of wild-type Cbp2. Identical inhibition was observed whether the protein was titrated at lower (3.6-5 8 nM) or higher (up to 116 nM) ranges, suggesting that aggregation of protein was not a problem in these experiments (data not shown).

It is possible that the observed inhibition of splicing at higher concentrations of wild-type protein could be due to non-specific interactions of Cbp2 (a highly basic protein) with its RNA counterpart. This possibility was tested using the nonspecific competitor, tRNA, in partially inhibited splicing reactions. A titration of Cbp2 concentration in the absence of tRNA is shown in Figures 4- 1 OA (lanes 1 to 6) and 4-l1OB (left panel). The maximal splicing observed at 14:1 ratio (lane 3,

Figure 4-9. Effect of increasing concentrations of wild-type Cbp2 on proteinmediated splicing. Radiolabeled intron 5 RNA was pre-incubated with increasing concentrations of wild-type Cbp2 for 10 min at 370C. Splicing was initiated by the addition of 0.2 mM GTP and incubation continued at 37'C for 30 min. Spliced products were resolved on 4% polyactylamide-8M urea gels and autoradiographed. A. Lane 1, intron 5 RNA alone; lane 2, splicing at protein:RNA of 1:1; lane 3, 3.5:1; lane 4, 7:1; lane 5, 14:1; lane 6, 28:1; lane 7, 56:1; and lane 8, 112:1. B. PhosphorImager quantitation of the gel shown in A was used to plot the % splicing (ratio of the sum of ligated exons and 5' exon to unspliced precursor) as a function of wild type-Cbp2 to RNA ratios, setting the extent of splicing obtained at 7:1 to 100%.



Cbp2: RNA 5 t 4 N

1 2 3 4 5 6 7 8



100 80


40 20

1:1 3.5:1 7:1 14:1 28:1 56:1 112:1


Figure 4-9... continued

Full Text
GROUP IINTRON IN Saccharomyces cerevisiae

I thank Dr. Alfred S. Lewin, my mentor and supervisor, for his constant support
in both academic and personal matters. He gave me immense freedom in the
conduct of experiments and stood by me during difficult times. I knew I could
always count on him. I would also like to thank all the past and present colleagues
in the lab, who have made life in the lab enjoyable and friendly.
I would like to thank the members of my advisor}' committee, Drs. Bert
Flanegan, Henry Baker, and Phil Laipis, for the various constructive suggestions
they have made during the course of the investigation and for taking the time to
review various documents, including this one. I also appreciate the input from all
the other faculty and students in the department, which has helped in my personal
growth. I also thank the other personnel in the Department, especially Joyce
Conners and Brad Moore, for their efficient help.
My special thanks go to Chandu, my husband, who has stood by me during all
times and made this all possible.

General Introduction 1
Group I Introns 4
Protein Facilitated Splicing 11
Two-component System of Cbp2 and Intron 5 RNA 16
Major Objective of Dissertation 19
Over-expression and Purification of Cbp2 21
In vitro Transcription 23
UV-crosslinking and Generation of Peptides 23
Site-directed Mutagenesis 27
In vitro Splicing Assay 29
Partial Proteolysis of Cbp2 30
Equilibrium Binding Analysis 30
Introduction 32
Results 35
Discussion 46

Introduction 55
Results 58
Discussion 100

2-1 Oligonucleotides used for mutagenesis of Cbp2 28
4-1 Description of Cbp2 mutants 59
4-2 Rate measurements for wild-type and mutant Cbp2 76
4-3 Dissociation constants of Cbp2 mutants 81

1-1 Proposed secondary structure of yeast apocytochrome b intron 5 RNA. 6
3-1 Optimization of UV-dosage for crosslinking 37
3-2 Chemical cleavage of Cbp2-intron 5 RNA complexes 40
3-3 Confirmation of the crosslink site in the N-terminus of Cbp2 .... 44
3-4 Summary of UV-crosslinking results 47
4-1 Western analysis of Cbp2 mutants 61
4-2 Functional analysis of deletion (aal7-aa28) and triple aromatic
mutants 64
4-3 Partial proteolytic profiles of deletion (aal7-aa28) and triple aromatic
mutants 66
4-4 Time course of splicing for wild-type and mutant Cbp2 69
4-5 Splicing rates of wild-type and mutant Cbp2 72
4-6 Double filter-binding assay of wild-type and mutant Cbp2 77
4-7 UV-crosslinking of wild-type and mutant Cbp2 to intron 5 RNA . . 83
4-8 Effect of mutant proteins on wild-type Cbp2-mediated splicing ... 86
4-9 Effect of increasing concentrations of wild-type Cbp2 on protein-
mediated splicing 90
4-10 Effect of tRNA addition on wild-type Cbp2-mediated splicing ... 93
4-11 Effect of mutant proteins on wild-type Cbp2-mediated splicing at
low total protein to RNA ratios 97

Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy
GROUP IINTRON IN Saccharomyces cerevisiae
Hymavathi K. Tirupati
December, 1998
Chairperson: Alfred S. Lewin
Major Department: Molecular Genetics and Microbiology
Group I introns and associated proteins represent simple but valuable systems
for understanding more complex RNP systems such as the spliceosomes or
ribosomes, which employ multiple RNA-protein interactions. The terminal intron
of yeast cytochrome b pre-mRNA (a group I intron) requires the nuclear protein
Cbp2 for splicing in vivo. However, in vitro, this intron can be made to either self-
splice or undergo protein-facilitated splicing by altering the Mg concentration.
Since catalysis is intrinsic to RNA, the protein is believed to promote RNA folding
at secondary and tertiary structure levels, leading to the formation of a catalytically
competent intron. Therefore, this two-component system provides a model for
understanding the role of proteins in promoting RNA folding.

The present study was aimed at identifying critical RNA binding sites on Cbp2
and gaining insights into Cbp2-intron 5 RNA interactions. P-labeled intron 5
RNA was UV-crosslinked to Cbp2, and the crosslink sites identified by chemical
cleavage and label transfer. These experiments demonstrated that the termini of
Cbp2 contain important RNA binding sites. A 12-amino acid region (aal7-28) in
the N-terminal contact site (rich in basic and aromatic residues) was targeted for
mutagenesis, and mutant proteins characterized for RNA binding and stimulation
of splicing . Mutations in this region resulted in no, partial, and complete loss of
function, demonstrating the importance of this N-terminal region for stimulation of
RNA splicing. These studies also led to the finding that Cbp2 stimulates splicing
only in a narrow range of concentrations, with higher concentrations being
inhibitory. Addition of a non-specific competitor tRNA attenuated this inhibition,
demonstrating the non-specific RNA binding ability of Cbp2.
The current study has identified an important RNA binding region (aal7-28aa)
in the N-terminus of Cbp2. A tyrosine at position 21 is indispensable while three
charged residues at positions 20, 22 and 24 are important for Cbp2 function. An
offshoot of the current study is the identification of an RNA chaperone function
for Cbp2. Cbp2 appears to engage in both non-specific and specific interactions
with intron 5 RNA. At inhibitory concentrations of the protein, however, non¬
specific interactions may predominate and preclude the formation of specific
contacts that promote catalysis. This newly characterized chaperone function of
Cbp2 may be important for promoting correct intron 5 RNA folding in vivo.

General Introduction
Ribozymes, or catalytic RNA molecules, have been shown to catalyze reactions
at phosphorus centers with RNA or DNA as the substrate (Cech, 1987; Herschlag
and Cech, 1990; Robertson and Joyce, 1990; Forster and Altman, 1990). These
reactions include transesterification or hydrolysis of phosphate diesters or
phosphate monoesters. For instance, ribozymes have been shown to catalyze the
polymerization of RNA monomer strands (Been and Cech, 1988), replication of
RNA strands (Green and Szostak, 1992), and hydrolysis at internal processing sites
(Decatur et al., 1995; Einvik et al., 1997; Jabri et al., 1997). RNA catalysts can
also act on substrates other than nucleic acids. In vitro selected RNA molecules
have been shown to interact with amino acids such as arginine, phenylalanine,
tryptophan and valine (Majerfeld and Yarns, 1994; Yarns, 1991; Zinnen and
Yarns, 1995). Arginine-binding RNA motifs (Tan et al., 1993) and aromatic side
chains (Valegard et al., 1994) have been found to be important for protein-RNA
interactions. Although aliphatic-RNA interactions have been frequently neglected,
their avidity and specificity seem sufficient for a biological role. Also, the
guanosine binding site of group I introns has been shown to bind arginine,

suggesting that the proto-ribosome might be related to group I introns (Yarns,
RNA catalysis is not limited to ribozymes alone. It is also involved in two
important steps of gene expression: mRNA processing and protein synthesis. In
mRNA splicing, small nuclear RNAs recognize the reaction sites (Guthrie, 1991;
Steitz, 1992) and may participate directly in the chemical steps (Madhani and
Guthrie, 1992; McPheeters and Abelson, 1992), while the associated proteins may
facilitate proper folding of these RNA molecules. It is also possible that, in
addition to participating in mRNA splicing, RNAs can catalyze a variety of post-
transcriptional RNA modifications. For instance, a calcium-metalloribozyme has
been shown to efficiently catalyze a self-capping reaction with free GDP, yielding
the same 5’-capped structure as that formed by protein guanylyltransferase (Huang
and Yarns, 1997a). This ribozyme was subsequently shown to possess self¬
decapping and pyrophosphatase activities (Huang and Yarns, 1997b), adding to the
growing repertoire of the catalytic capabilities of RNA.
The catalytic activities of RNA may also include facilitation of protein
synthesis. Following extensive digestion of proteins from the prokaryotic
ribosome, the large rRNA was shown to support the peptidyl transferase reaction,
suggesting that RNA may be the catalytic component while ribosomal proteins
may serve a scaffold function (Noller et al., 1992). Recently, in vitro selected
RNA molecules with a peptidyl transferase-like motif have been shown to bind a

puromycin analog (a high-affinity ligand of ribosomal peptidyl transferase), in the
absence of protein (Welch et al., 1997). Together, these results strengthen the
hypothesis that peptidyl transfer originated in an RNA world.
The catalytic role of RNA in translation of mRNAs appears to be versatile. A
ribozyme derived from the group I intron of Tetrahymena thermophila was shown
to catalyze the hydrolysis of an aminoacyl ester bond (which involves a carbon
center), suggesting that the first aminoacyl tRNA synthetase could have been an
RNA molecule (Piccirilli et al., 1992). Furthermore, an RNA molecule identified
by in vitro selection has been shown to rapidly aminoacylate its 2’(3’) terminus
when provided with phenylalanyl-adenosine monophosphate (Illangasekare et al.,
1995; 1997). Thus, RNA can accelerate the same aminoacyl group transfer
catalyzed by protein aminoacyl-tRNA synthetases.
The ongoing discovery of the versatile properties of catalytic RNA has lent
more credence to the theories of a prehistoric “RNA world”. This pre-biotic world
might have been populated by life forms that stored genetic information in RNA
and employed RNA catalysts prior to the advent of ribosomal protein synthesis
(Visser, 1984; Benner et al., 1989). It has also been proposed that the functions of
these ancient catalytic RNAs may have been modulated by low molecular weight
effectors related to antibiotics (Davies, 1990, Davies et al., 1992). Antibiotics
have been shown to inhibit translation by the prokaryotic ribosome (Moazed and
Noller, 1987; Powers and Noller, 1994; Yamada et al., 1978), either inhibit self¬
splicing (von Ahsen et al., 1991; Davies et al., 1992; von Ahsen and Noller, 1993)

or promote oligomerization (Wank and Schroeder, 1996) of group I introns, and
inhibit the self-cleavage reaction of the human hepatitis delta virus ribozyme
(Rogers et al., 1996). Parallels between the inhibition of group I intron splicing
and the protection of bacterial rRNAs by antibiotics also raises the possibility that
group I intron splicing and tRNA selection by ribosomes involve similar RNA
structural motifs.
Group I Introns
Group I introns are abundant in mitochondrial RNA of fungi and plants (Palmer
and Logsdon, 1991). Coding regions for group I introns are also found in the
nuclear genomes of other lower eukaryotes (rRNA genes of Tetrahymena),
chloroplast DNAs, bacteriophages, and in several tRNA genes of eubacteria (Cech,
1988; Michel and Westhof, 1990; Palmer and Logsdon, 1991; Reinhold-Hurek and
Shub, 1992). Some of these group I introns can self-splice. The ability to self¬
splice is related to the highly conserved secondary and tertiary structures of these
introns (Burke, 1988; Cech, 1988; Michel and Westhof, 1990). Although group I
introns have relatively little sequence similarity, all share a series of short
conserved elements designated P, Q, R and S. The secondary structure common to
group I introns was first proposed by Michel et al. (1982) and Davies et al. (1982)
based on comparative sequence analysis. This eventually led to the development
of a three dimensional model of the catalytic core by Michel and Westhof (1990).
The basic features of this model have been confirmed by mutational analysis,
photochemical crosslinking and chemical modification studies employing several

affinity cleavage reagents (Pyle et al., 1992; Wang and Cech, 1992). On the basis
of these studies, Cech et al. (1994) proposed a revised two-dimensional secondary
structure for group I introns that represents more accurately the domain
organization and orientation of helices within the intron, the coaxial stacking of
certain helices, and the proximity of key nucleotides in three-dimensional space.
Based on these revisions, the secondary structure of the fifth intron of the COB
gene of Saccharomyces cerevisiae (used in the current study) is shown in Figure 1-
1. The folded structure of group I introns consists of two co-axially stacked
helices, P5-P4-P6 and P7-P3-P8, that form a cleft to enclose a third helical domain,
P1P2, which contains the 5’ splice site. The 5’ and 3’ splice sites are stabilized by
PI and P10 interactions respectively. PI is formed by base pairing between the 5’
exon and the internal guide sequence (IGS), whereas P10 is formed by base pairing
between the 3’ exon and the IGS (not shown in Figure 1-1). P9, a 2 base pair helix
near P7 also contributes to the formation of 3’ splice site.
The rRNA intron of Tetrahymena thermophila (considered to be the prototype
group I intron) has been demonstrated to undergo autocatalytic splicing by a two
step trans-esterification mechanism (Cech, 1990). The same mechanism has been
documented for a number of other group I introns (Garriga and Lambowitz, 1984;
Garriga and Lambowitz, 1986). The first step comprises a nucleophilic attack by
guanosine at the 5’ splice site, resulting in a free 3’ OH group on the upstream
exon and guanosine addition to the intron. In the second step, the free 3’ OH
group on the exon attacks the phosphodiester bond at the 3’ splice site, leading to

Figure 1-1. Proposed secondary structure of yeast apocytochrome b intron 5
RNA. The coaxially stacked helices, P4-P6 and P3-P7, along with the joining
regions J3/4, J4/6, J6/7, and J8/7, constitute the catalytic core while P1-P2 forms
the substrate domain. The peripheral element P7.1-P7.1a is a signature element of
subgroup IA introns. Lower and upper case letters represent the exons and the
intron respectively. Short horizontal and vertical lines represent hydrogen bonds.
Dotted lines represent long-range interactions. Sequences for LI and L8 are not

a c a c c
u a c u u a
u u
u u
P9.1 C-G
a 220
+ 1 U-AGAG-C
g c a
1 U-A
- 1 u-G
P1 u-A
u c-G
i U
C~ A
A j
A-U ,
AUn' '^UAa
U a
U A Ga
I I l i I III G
ccuuucc aug auA
P7.1 u P7.1a

excision of the intron and ligation of the exons. An exogenous guanosine
nucleotide is used as the nucleophile in the first step while a universally conserved
3’-terminal guanosine residue of the intron is employed in the second step (Cech,
1990). These steps are chemically the reverse of each other, with the bound
exogenous guanosine nucleophile in the first step equivalent to the 3’-terminal
guanosine leaving group in the second step. This led to the proposal that a single
guanosine-binding site was used in both steps (Inoue et al., 1986). Subsequent
studies indicated that the rate constant of the chemical step is the same with
exogenous guanosine bound to L-21ScaI ribozyme (a model system for first step of
splicing) and with the intramolecular guanosine residue of the L-21G414 ribozyme
(a model system for second step of splicing) (Mei and Herschlag, 1996). These
results support the previously proposed single guanosine-binding site model, and
further suggest that the orientation of the bound guanosine and the overall active
site structure is the same in both steps of the splicing reaction.
Oligonucleotide substrate binding to the Tetrahymena ribozyme was found to
be stronger than predicted for a simple duplex interaction with the IGS, suggesting
that tertiary interactions in addition to base pairing stabilized the bound substrate
(Herschlag and Cech, 1990; Pyle et al., 1990). These tertiary interactions were
shown to involve specific 2’-OH groups on the substrate and IGS, as well as the
GU wobble pair at the 5’ cleavage site (Pyle and Cech, 1991; Pyle et al., 1994;
Strobel and Cech, 1993, Strobel and Cech, 1995). These and other kinetic studies
led to a 2-step model for substrate binding, wherein the substrate forms a duplex

(PI) with the IGS to give an ‘open complex’, followed by docking of the PI
duplex into tertiary interactions to give a closed complex (Herschlag, 1992). Thus,
PI docking represents a tertiary-folding event in which a single duplex adopts its
tertiary structure in the context of an otherwise fully folded ribozyme. PI docking
was characterized further by isolating the open complex as a thermodynamically
stable species using a site-specific modification and high Na+ ion concentrations
(Narlikar and Herschlag, 1996). These authors proposed that PI docking is
entropically driven, and is possibly accompanied by a release of bound water
It is interesting to note that group I introns do not contain specific functional
groups that are typically employed in the catalysis of protein-enzymes. Instead,
they depend on divalent cations for chemistry and certain other functions such as
structural stabilization of folded RNA and substrate binding. For instance, the
Tetrahymena group I intron requires Mg or Mn ions for catalysis (Grosshans
and Cech, 1989), while cations like Ca2+ can only promote RNA folding and
substrate binding (Pyle et al., 1990). A two metal-ion mechanism has been
proposed for group I introns and other catalytic RNAs (Steitz and Steitz, 1993). In
this mechanism, one metal ion activates the 3’-OH of the guanosine factor which
initiates the first step of group I intron splicing. The second one coordinates and
stabilizes the oxyanion leaving group, that is, the 3’-OH of uridine created at the
end of 5’ exon which initiates the second step of group I intron splicing. These
metal ions act as Lewis acids and stabilize the expected pentacovalent transition

states. In case of group I introns, the mirror symmetry of two Mg ions in the
catalytic center reflects the identical chemistry of the two transesterification
reactions that effect splicing. The role of RNA in catalysis is to position the two
metal ions and properly orient the substrates. Evidence for the involvement of two
Mg ions in the chemical step of group I intron splicing was provided by
McConnell et al. (1997). The study also showed that a single Mg ion increases
the rate of RNA substrate binding while one or more Mg ions reduce the rate of
dissociation of substrate. Evidence for stabilization of the leaving group by a
second Mg ion was subsequently provided by Weinstein et al. (1997). Studies on
the crystal structure of the P4-P6 domain of Tetrahymena documented the first
detailed view of metal-binding motifs in a structurally complex RNA (Cate et al.,
1996). Three unique metal binding sites have been found in the major groove, two
of which are occupied by fully hydrated magnesium ions in the native RNA (Cate
and Doudna, 1996). It is interesting to note that the tandem GU wobble base pairs,
which comprise two of these three metal binding sites, are also abundant and
conserved in the ribosomal RNAs. These sites, upon metal binding, might
facilitate higher order folding of ribosomal RNAs or their association with
ribosomal proteins.
Group I introns have been classified into four major subgroups, IA through ID,
based on distinctive structural and sequence features (Michel and Westhof, 1990).
For example, group IA introns contain two extra base pairings, P7.1/P7.1a or
P7.1/P7.2, between P3 and P7 while several other group IB and IC introns

including the Tetrahymena rRNA intron possess an extended RNA structure,
P5abc, that is essential for catalysis (Joyce et al., 1989). Recent crystallographic
studies revealed that P5abc stabilizes P4-P6, the major domain of the catalytic
core, via two key interactions (Cate et al., 1996). The first one includes an
adenosine-rich bulge which docks in the minor groove of the P4 helix while the
second interaction takes place between a GAAA tetraloop and the minor groove of
its conserved 11-nucleotide receptor. In addition to base-specific hydrogen
bonding and base stacking, pairs of interdigitated riboses (ribose zippers) further
stabilize these long-range interactions in the P4-P6 domain. Other group I introns
lacking P5abc possess additional RNA structures such as a long, peripheral
extension of the P9 stem, denoted P9.1 (Wallweber et al., 1997) or protein factors
(Mohr et al., 1994) that bind and stabilize the intron active structure. For example,
the mitochondrial large ribosomal intron of N. crassa that lacks this extended
domain absolutely requires a protein factor Cyt-18 for its activity, both in vitro and
in vivo. The protein binds at the junction of P4-P6 stacked helices and facilitates
correct geometry in this region (Saldanha et al., 1996). Cyt-18 could also replace
the P5abc domain of Tetrahymena (Mohr et al., 1994). Thus an RNA-binding
protein can provide substantial binding energy to stabilize the catalytic structure of
the intron, obviating the requirement for an additional but important RNA element.
Protein Facilitated Splicing
Several mitochondrial transcripts in yeast employ protein factors to facilitate
splicing of group I and group II introns, although some of them can self splice in

vitro. Protein-facilitated splicing has also been documented in other fungi such as
Neurospora (Akins and Lambowitz, 1987; Saldanha et al., 1993) and Aspergillus
(Ho et al., 1997). Some of these protein factors, termed maturases, are encoded
within the intervening sequences (Carignani et al., 1983; Lamb et al., 1983;
Lazowska et al., 1989). The reading frames encoding these maturases are in frame
with the upstream exons. A proteolytic cleavage downstream of the 5’ splice site
generates the active form of maturase, presumably enabling a feedback mechanism
of regulation. All yeast maturases (encoded by group I introns such as cob-12 and -
13, and group II introns like coxl-\\ and -12) primarily function in splicing the
intron that encodes them. However, the cob-\4 maturase enables splicing of both
cob-14 and another closely related group I intron, coxl-14 (Burke, 1988;
Lambowitz and Perlman, 1990).
The maturases encoded by group I introns are structurally related to site-
specific endonucleases that confer mobility (Bell-Pedersen et al., 1990; Perlman
and Butow, 1989). It is well established that group I introns can transpose site-
specifically to intron-less alleles of the same gene after cleavage of the target DNA
by an intron-encoded DNA endonuclease (Belfort and Perlman, 1995; Byrk and
Mueller, 1996). This conservative process, known as intron homing (Dujon,
1989), is highly specific because of the large recognition sites (15-35 bp) of
homing endonucleases (Byrk and Mueller, 1996). Group I introns are thought to
have become mobile following the acquisition of open reading frames (ORFs) that
encode specific DNA endonucleases (Dujon, 1989; Lambowitz and Bellfort,

1993). Evidence for this came from the demonstration of autonomous mobility of
an ORF, independent of the entire intronic sequence, in the mitochondria of
Podospora anserina (Sellem and Belcour, 1997). The mitochondrial nadl-i4
intron of Podospora contains one (monorfic) or two (biorfic) ORFs, according to
the origin of the strain (Cummings et al., 1988; Sellem et al., 1996). The nadl-i4-
orfl, recently acquired by the Podospora nadl-i4 intron (Sellem et al., 1996),
appears to remain as a mobile entity, as it could be efficiently transferred from a
biorfic intron to its monoorfic counterpart, independent of the core intron sequence
(Sellem and Belcour, 1997).
Reverse splicing coupled with reverse transcription and recombination may
serve as an alternative mechanism for intron mobility (Cech, 1985; Sharp, 1985;
Woodson and Cech, 1989). A related mechanism has been documented in the
homing of group II introns of yeast mitochondria (e.g., aI2 intron of coxl)
(Zimmerly et al., 1995; Yang et al., 1996) and Lactobacillus lactis (e.g., LtrB
intron) (Matsuura et al., 1997). The insertion of these introns has been shown to
occur by reverse transcription of unspliced precursor RNA at a break in double¬
strand DNA caused by an endonuclease activity. This DNA endonuclease activity
is associated with RNP particles containing the excised intron RNA that cleaves
the sense strand of the recipient DNA by reverse splicing and the intron-encoded
reverse transcriptase protein that cleaves the anti-sense strand.
Integration of an intron into foreign RNA (instead of DNA) by reverse splicing,
followed by reverse transcription and recombination, could also lead to its

transposition. Reverse splicing into RNA has been demonstrated in vitro for group
I introns such as Tetrahymena rRNA intron (Woodson and Cech, 1989) and the
23 S rRNA intron from Chlamydomonas reinhardtii chloroplast (Thompson and
Herrin, 1994). Recently, RNA-dependent integration of the Tetrahymena group I
intron into the 23 S rRNA has been demonstrated in E. coli (Roman and Woodson,
1998). The process of reverse splicing into RNA, unlike homing of group I and
group II introns, does not require intron-encoded proteins. However, stable
transposition into the genome would presumably require reverse transcriptase
activity in the host (Belfort and Perlman, 1995). This activity could be provided
by “indigenous” group II introns (Kennell et al., 1993) or retroelements present in
many cell types (Eickbush, 1994). Importantly, reverse splicing appears to be
significantly less sequence-specific than homing endonucleases and could
therefore expand the repertoire of intron-containing sites (Cech, 1985; Roman and
Woodson, 1998).
In addition to maturases, several nuclear-encoded proteins essential for splicing
of mitochondrial introns have been identified in yeast and Neurospora by
screening cytochrome-deficient strains and by isolating nuclear suppressors of
splicing mutants (Burke, 1988; Lambowitz and Perlman, 1990). In Neurospora,
the products of three nuclear genes, cyt-18, cyt-19 and cyt-4 have been implicated
in splicing the mitochondrial large rRNA intron and several other mitochondrial
group I introns. In contrast, most of the yeast proteins facilitate splicing of a single
intron. For instance, the product of MRS 1 in yeast appears to be specific to the

group I intron, cob-bYi (Kreike et al., 1987, Kreike et al., 1986), although an
intron-encoded maturase is also required for excision of this intron (Holl et al.,
1985). Proteins facilitating the splicing of group I introns may exhibit additional
biological functions as documented in the case of certain aminoacyl-tRNA
synthetases. The yeast NAM2 gene, for example, encodes mitochondrial leucyl-
tRNA synthetase which also facilitates the splicing of group I introns, cob-14 and
cox-14 (Labouesse et al., 1987; Herbert et al., 1988). Similarly, the Cyt-18 protein
of Neurospora which is responsible for the splicing of several group I introns also
happens to be the mitochondrial tyrosyl tRNA synthetase (Akins and Lambowitz,
1987). These synthetases and other pre-existing RNA-binding proteins may have
evolved to recognize sequences or structures in group I introns that resemble their
normal cellular targets (Lambowitz and Perlman, 1990; Caprara et al., 1996).
Nuclear-encoded proteins also appear to be important for group II intron
splicing. Two genetically identified proteins that are likely to function directly in
group II intron splicing are MRS2 and MSS 116 (Wiesenberger et al., 1992;
Seraphin et al., 1989). MRS2 functions in splicing of all four yeast group II
introns [coxl-II, -12, -I5y and cob-II), and is relatively specific for these introns,
while MSS 116 is involved in splicing group II introns (cox/-Il and cob-II) and
also some group I introns. However, both MRS2 and MSS116 appear to have
some additional function besides splicing, as gene disruptions result in a
respiratory-deficient phenotype in yeast strains whose mtDNA contains no introns
(Wiesenberger et al., 1992; Seraphin et al., 1989)

Two-Component System of Cbp2 and Intron 5 RNA
The yeast cytochrome b gene contains five introns, of which the terminal intron
is a group IA intron (bI5). In some yeast strains, the gene has only two introns,
with the terminal intron designated bI2. The processing of this group I intron in
vivo was demonstrated to be dependent on a protein factor designated Cbp2
(McGraw and Tzagoloff, 1983). The nuclear gene encoding Cbp2 was identified
by complementation of cytochrome b mutants (defective in the excision of the
terminal intron) with a yeast genomic library. This analysis identified an 1890
nucleotide-long ORF encoding a basic protein of 74 kDa. Deletion analysis
revealed that the entire ORF was essential for complementation of the cbp2
mutants. Later, a mitochondrial revertant was shown to contain a precise deletion
of the terminal intron of cytochrome b gene, demonstrating that neither Cbp2 nor
the intron itself is required for growth on non-fermentable carbon sources (Hill et
al., 1984). In addition to these findings, Cbp2 has been shown to be important in
the splicing of the co intron of large ribosomal RNA (Shaw and Lewin, 1997).
The terminal intron (intron 5) of cytochrome b can self-splice in vitro at high
concentrations of Mg (Gampel and Tzagoloff, 1987; Partono and Lewin, 1988),
whereas Cbp2 is essential to enable splicing at physiological concentrations of
Mg2+ (Gampel et al., 1989). Although this group IA intron possesses the
conserved secondary and tertiary structures found in all group I introns, it varies in
important ways from the prototype, the Tetrahymena rRNA intron. The fifth
intron of cytochrome b is about 738 nucleotides long, making structural probing

harder compared to the rRNA intron of Tetrahymena (-400 nucleotides long). The
internal guide sequence (IGS) that establishes the substrate specificity starts 220
nucleotides downstream from the 5’ splice junction, rather than the usual 14-20
nucleotides described for other group I introns. The intron is AU-rich, requiring
higher levels of Mg for stabilization of the active structure unlike the GC-nch
Tetrahymena group I intron. It also possesses additional RNA structures like the
P7.1 stem loop that are not found in Tetrahymena. Hence, intron 5 RNA, with its
structural differences from the Tetrahymena rRNA intron, offers an opportunity to
gain further insights into the mechanism of splicing of group IA introns.
The fifth intron of COB pre-mRNA is also devoid of the peripheral RNA
element, P5abc, that is important for the catalysis of Tetrahymena rRNA intron. It
is therefore conceivable that Cbp2 compensates for this RNA structure and
stabilizes its RNA partner by contributing substantial binding energy in a manner
similar to the Cyt-18 protein of Neurospora. UV-crosslinking, chemical and
enzymatic modification studies indicate that Cbp2 contacts intron 5 RNA at
multiple sites in the catalytic core (P4) and peripheral RNA elements such as exon
5, IGS, L2, L6 and stimulates the formation of the catalytically active structure
(Shaw and Lewin, 1995; Weeks and Cech, 1995). Based on these and kinetic
studies, Weeks and Cech (1996) proposed that Cbp2 serves as a tertiary structure
capture protein. However, Cbp2 also induces the formation of RNA secondary
structure, in addition to the stabilization of tertiary structure (Shaw and Lewin,
1995; Shaw et al., 1996). In addition, chemical modification studies (Shaw and

Lewin, manuscript in preparation) show that Cbp2 binds to intron 5 RNA even in
the absence of Mg and nucleates the formation of the catalytic core by stabilizing
the P4/P6 domain. Thus, Cbp2 appears to be involved in a dynamic process of
stabilizing RNA structure both at the secondary and tertiary structure levels,
stimulating the formation of the catalytically active RNA structure.
Weeks and Cech (1995a; 1995b) provided a kinetic framework for both Cbp2-
mediated and self-splicing reactions of intron 5 RNA. At low Mg2+ levels (5 mM),
the self-splicing reaction is estimated to be 3 orders of magnitude slower than the
protein-facilitated reaction. At near saturating concentrations of Mg (40 mM),
the protein-independent reaction is still 8-fold slower, indicating that high levels of
the cation cannot completely compensate for Cbp2 function. The self-splicing
reaction is always slower than the protein-facilitated reaction, since it has to
proceed through two additional transitions compared to the latter. The first step
involves a transition from secondary structure to an intermediate state that is
efficiently promoted by Mg . However, self-splicing must still overcome a
second barrier which is the transition from the intermediate to an active enzyme
state that finally gives rise to products. The kinetics of Cbp2-mediated splicing, on
the other hand, include two significant steps, namely, guanosine binding to the
Cbp2-active intron 5 RNA complex followed by efficient conversion of this
ternary complex to products. Studies on phosphorothioate substitution at the 5’
splice site and pH profiles indicate that at physiological pH the self-splicing
reaction is limited by chemistry while the Cbp2-facilitated reaction is limited by a

conformational step (Weeks and Cech, 1995a). These studies indicate that Cbp2
binding compensates for at least two structural defects while increasing the rate of
Main Objective of Dissertation
The availability of a two-component in vitro system to study autocatalytic and
protein-facilitated splicing offers the advantage of studying RNA catalysis in
isolation or in combination with the RNA-binding protein simply by varying the
Mg concentration. Insights obtained from the analyses of this one protein-one
RNA system will aid in understanding more complex systems like the
spliceosomes involved in nuclear pre-mRNA splicing or ribosomes involved in
protein synthesis, all of which employ multiple protein and RNA components.
Studies so far have focused on mapping the Cbp2 contact sites on intron 5 RNA
and the kinetics of splicing in the presence and absence of the protein. Little is
known about the structure of Cbp2 protein or its interaction with intron 5 RNA
from the protein point of view. In order to understand the role of Cbp2 in
stimulation of splicing, it is important to determine the functional groups on the
protein that intimately contact RNA and facilitate catalysis. Once the contact sites
are identified, the actual mechanism of interaction between Cbp2 and intron 5
RNA can be investigated further. Therefore, one of the main aims of the current
project was to identify potential intron 5 RNA binding regions of Cbp2 using the
technique of UV-crosslinking and label transfer. Following the identification of
major contact sites, site-directed mutagenesis was employed to confirm the

importance of various amino acid residues in these sites for interaction with intron
5 RNA and enable facilitation of splicing.
UV-crosslinking identified two major RNA contact sites in the termini of Cbp2
with the N-terminal site comprising the first 37 amino acid residues. The deletion
of a potential RNA binding motif (aal7-SSSRYRYKFNME-aa28) in the N-
terminal contact site abolished splicing activity, showing that this region was likely
to be critical for Cbp2 function. Single and cluster mutagenesis of various
residues in this region yielded a variety of mutants with no, partial, or complete
loss of Cbp2 function. The characterization of these mutants and the significance
of various amino acid residues in question are discussed in Chapter 4.
An offshoot of the current study was the identification of an RNA chaperone
function for Cbp2. The studies reported in Chapter 4 show that Cbp2 has a non¬
specific or generalized RNA binding capability besides its specific RNA binding
component. Drawing parallels with studies on other RNA chaperones (Chapter 5),
this study adds a new perspective on how the non-specific RNA binding activity of
Cbp2 might play a critical role in the facilitation of intron 5 RNA splicing in vivo.

Over-Expression and Purification of CBP2
In vitro studies of CBP2-bI5 RNA interactions were done with CBP2 protein
purified to near homogeneity after over-expression in E. coli. Two versions of the
protein, 6x histidine-tagged and native, were employed for different studies.
Expression Clones
His-tagged Cbp2. Plasmid pET15b-CBP2 was constructed by cloning the
Ndel-Clal fragment carrying the CBP2 cDNA from pET3a-CBP2, downstream of
the 6x histidine tag in the T7 expression vector, pET15b (Novagen). The histidine
tag adds an additional 20 amino acid residues at the N-terminus of Cbp2 protein.
The plasmid was transformed into JM109(DE3) strain of E. coli for over¬
expression. This strain carries the T7 RNA polymerase gene driven by lac-uv5
promoter on a lambda lysogen and enables the induction of Cbp2 in the presence
Native Cbp2. This form of Cbp2 protein was over-expressed from pET3a-
CBP2 plasmid in BL21(DE3), another E.coli strain carrying the T7 RNA
polymerase gene. This plasmid was constructed by introducing an Ndel site at the
start codon of CBP2 gene by PCR-mutagenesis and cloning the Ndel-SnaBI

fragment between the Ndel-BamHI sites of pET3a expression vector (Studier et
al., 1990). The Cbp2 protein expressed from this construct is 20 amino acid
residues shorter than the his-tagged version.
Induction of Cbp2
An overnight culture of bacteria carrying the Cbp2 expression plasmid was
used to inoculate a large volume of LB/ampicillin medium at 1:100 dilution. The
cultures were grown at 37° C until they reached an A550 of 0.35 and the expression
of Cbp2 was induced with 0.4-1 mM IPTG for 1-3 hours. Cells were pelleted after
addition of 17 pg/ml PMSF, washed with 20 mM Tris, pH 7.5, 50 mM NaCl, snap
frozen in a dry ice/ethanol bath and stored at -70° C until purification.
Purification of Cbp2
His-tagged Cbp2. The protein was purified on Ni-NTA Superflow (Qiagen)
column, adapting the protocol of Weeks and Cech (1995). This purification
system is based on the high affinity of histidine residues for nickel ions
immobilized on nitrilotriacetate resin. The contaminant proteins can be efficiently
removed at low levels of imidazole (a competitor), while the his-tagged protein
can be specifically eluted at slightly higher concentrations of imidazole.
The bacterial pellet was resuspended in 10 ml of column buffer (50 mM
HEPES, pH 7.6, 700 mM NaCl, ImM imidazole, 17.5 ug/ml PMSF) and lysed by
two passages through a French pressure cell at 18000 p.s.i. The lysate was cleared
by centrifugation at 35000 rpm for 30 minutes in a Beckman Ti 42.1 rotor. The

supernatant was loaded on a 2 ml Ni-NTA Superflow column pre-equilibrated with
10 volumes of column buffer. The column was washed with 10 volumes of
column buffer (ImM imidazole) followed by 7.5 volumes of wash buffer (20 mM
imidazole). Cbp2 protein was then eluted with 7.5 volumes each of column
buffers containing 80 mM and 200 mM imidazole. The fractions containing Cbp2
(detected by SDS-polyacrylamide gel electrophoresis) were pooled and dialyzed
twice against 1 liter each of 10 mM Tris, pH 7.5, ImM EDTA, 20% glycerol and
once with a liter of 10 mM Tris, pH 7.5, ImM EDTA, 50% glycerol and stored at -
70° C after rapid freezing in a dry ice/ethanol bath.
Native Cbp2. This version of Cbp2 protein was isolated according to the 4-
step purification protocol described by Shaw and Lewin (1995).
In Vitro Transcription
pSPI5 plasmid DNA purified by CsCl gradients (Maniatis et ai, 1989) was
linearized with Smal and used for in vitro transcription with T7 RNA polymerase
(Partono and Lewin, 1988). The transcripts contain the entire intron 5 RNA
sequence and the flanking exon sequences. The transcripts were internally labeled
using a-32P UTP and/or a-32P ATP (ICN).
UV-Crosslinking and Generation of Peptides
Cbp2-RNA complexes were generated according to the UV-crosslinking
technique ofZamore and Green, 19 89). 32P-labeled intron 5 RNA transcripts were

incubated at room temperature or 37° C for 30 minutes with a molar excess of his-
tagged Cbp2 (7 fold over RNA) or native Cbp2 (21 fold) in a low salt buffer (50
mM Tris, pH 7.5, 10 mM MgCh, 50 mM NH4CI) containing excess tRNA (non¬
specific competitor). Each sample was split into several aliquots, 10 p.1 each, in a
96-well microtiter plate (Falcon) placed on ice (in a petridish) and exposed to 600
mJ of UV radiation in a UV-Stratalinker (Stratagene). The aliquots of each sample
were pooled into a 1.5 ml Eppendorf tube and treated with 0.32 ug/ml of RNAse A
and 100 units of RNAse T1 (Boehringer Mannheim) at 37° C for 2 hours to remove
uncrosslinked RNA. The samples were resolved by electrophoresis on a 10%
SDS-polyacrylamide gel (Laemmli, 1970) and the band corresponding to Cbp2
excised after Coommassie blue staining. The Cbp2 thus purified includes both the
crosslinked and un-crosslinked forms of the protein.
Generation of Peptides
The purified gel fragments were incubated with chemical cleavage reagents
such as hydroxylamine (NH2OH) and 2-nitro-5-thiocyanobenzoate (NTCB) and
the resulting peptides were resolved on high percentage tris-tricine gels.
Cleavage. The gel pieces were washed four times with distilled water over a
period of 20 minutes, placed into appropriate cleavage buffer and thoroughly
macerated with a Kontes Eppendorf pestle. The slurry so obtained was completely
covered with the cleavage buffer and incubated overnight at appropriate

Chemical cleavage of proteins with hydroxylamine generates relatively large
peptides due to the infrequency of Asn-Gly bonds. The asparaginyl side chain has
a tendency to form a cyclic imide that is susceptible to nucleophilic attack by
hydroxylamine (Bomstein, 1977). The cyclization is more favored in the context
of a smaller amino acid like glycine resulting in increased susceptibility of Asn-
Gly bonds. Hydroxylamine (NH2OH) cleavage of Cbp2 was performed by
overnight incubation of Cbp2 containing gel pieces in 2.4 M guanidine-HCl, 2M
hydroxylamine buffer, pH 9, at room temperature, as described above. LiOH was
used to neutralize the guanidine-HCl and hydroxylamine-HCl due to increased
solubility of LiCl compared to NaCl. The process of gel purification contributes to
partial denaturation of the protein while the presence of guanidine-HCl, a strong
solvent, enhances the exposure of the Asn-Gly bonds to the nucleophile. Chain
cleavage occurs in the presence of alkaline hydroxylamine liberating a new amino-
terminal amino acid.
Cleavage with 2-nitro-5-thiocyanobenzoate (NTCB) is a two-step process.
First, the thiol groups on cysteine residues of denatured proteins are modified to
SCN groups by NTCB (Jacobson et al., 1973; Degani and Patchomik, 1974),
followed by cleavage at the amino group of the modified cysteine by exposure to
alkaline pH conditions. Gel purified Cbp2 protein was incubated in 2.4 M
guanidine-HCl, 5 mM DTT, 1 mM EDTA, 0.2 M tris acetate, pH 8, buffer at 37° C
for 2 hours in order to denature the protein and reduce the disulfide bonds to SH
groups. A 10 fold excess of NTCB (50 mM) over the total thiol was added to the

gel slurry, and the incubation was continued for half hour at the same temperature
to effect modification of the SH groups to SCN groups. The slurry was filtered
through a 0.22 pM low protein-binding, cellulose acetate spin column (Coming-
Costar), and washed once with distilled water. The slurry was later transferred to a
1.5 ml Eppendorf tube and incubated overnight in 2.4 M guanidine-HCl, pH 9,
cleavage buffer at 37° C .
Extraction of peptides. After cleavage, the slurry was filtered through a
Costar column, washed once with distilled water and incubated overnight at 37° C
in the extraction buffer (0.1% SDS, 50 mM Tris pH 8.8, 0.1 mM EDTA and 0.2 M
ammonium bicarbonate). On the third day, the gel slurry was heated at 85° C for 5
minutes and rapidly filtered through a Costar column to recover soluble peptides.
The slurry was further incubated with 0.5% SDS, 10 mM Tris, pH 8, for 20
minutes at room temperature and filtered to extract the residual peptides in the gel.
Acetone precipitation and electrophoresis. The filtrates containing the
peptides were pooled, dried in a Speed-Vac (Savant), resuspended in water and
precipitated overnight at -20° C with 9 volumes of acidified acetone. Peptides
were pelleted at 12000 rpm in a microcentrifuge (Eppendorf) for 20 min and
resuspended in 15 pi of SDS gel-loading buffer. The samples were dried in a
Speed-Vac to remove the residual acetone, brought to a final volume of 40 pi with
water, resolved on 15% (for hydroxylamine ) or 16.5% (for NTCB) tris-tricine gels
(Schagger and von Jagow, 1987), along with 14C-labeled low molecular weight
peptide markers (Amersham Corporation), and autoradiographed.

Site-Directed Mutagenesis
The N-terminal RNA contact site on Cbp2 (identified by the UV-crosslinking
strategy) was subjected to site-directed mutagenesis to identify key residues for
Cbp2 function. Mutations were designed to either delete the region of interest
(aal7 SSSRYRYKF aa25) or make point mutations that do not severely perturb
the conformation of the protein. The Xbal-BamHl fragment encoding the first 97
codons of CBP2 from pET15b-CBP2 was sub-cloned into the M13mpl9 vector
and used as the template for oligonucleotide-directed mutagenesis.
Mutagenesis Scheme
Single stranded DNA isolated from the phage clone mentioned above was used
as a template for mutagenesis. The oligonucleotides used for mutagenesis are
shown in Table 2-1. The double primer method of Zoller and Smith (1984) was
employed to introduce mutations into the CBP2 segment cloned into M13mpl9
vector. Briefly, 10 pmoles each of the kinased mutagenic oligonucleotide and the
universal Ml 3 primer were annealed to 0.5 pmoles of single-stranded DNA
template by incubation at 65° C for 30 minutes, 37° C for 20 minutes and room
temperature for 5 minutes. The annealed complexes were extended and ligated
overnight at 15° C using 4 units of Klenow DNA polymerase (Promega) and 2.5
units of T4 DNA ligase (BRL) to form a gapped heteroduplex. The reaction was
diluted 200-fold, transformed into competent TGI cells (Amersham) and overlaid

Table 2-1. Oligonucleotides used for mutagenesis of CBP2
Sequence (5’ to 3’)
AL 260
Universal primer (position
1822-1804 in antisense
strand of M13 mp 19)
AL 261
Sequencing primer to
verify mutations (position
790-774 in antisense
strand of CBP2)
AL 262
Changes RYRYKF to
LYLYLF at aa 20,22,24
AL 263
Deletion of aa 17-28 of
AL 264
Changes RYRYKF to
RLRLKL at aa 21,23,25
AL 290
Changes Y to L at aa 21
AL 291
Changes Y to L at aa 23
AL 292*
Deletion of SSS at aa
AL 293
Changes F to L at aa 25
* AL292 also changes the codon usage for glycine at position 16 from GGC to

with molten agar to allow formation of plaques. Mutants were identified by plaque
lift hybridization with y- P-labeled mutagenic oligonucleotide as the probe. The
resulting mutants were plaque purified once and the single-stranded DNA
sequenced. Double-stranded DNA was prepared by mini-prep protocols (Maniatis
e1 ai, 1989) from the mutant TGI clones. The CBP2 segment carrying the
mutation of interest was then recloned into pET15b-CBP2 expression vector, and
sequenced using Sequenase 2.0 kits (Amersham).
In Vitro Splicing Assay
The activity of various mutant Cbp2 proteins was determined by an in vitro
splicing assay (Partono and Lewin, 1988). 32P-labeled intron 5 RNA transcripts
were incubated with wild-type or mutant Cbp2 proteins in 5 mM MgCh, 50 mM
NTLjCl. 50 mM tris-HCl, pH 7.5, buffer, in the presence of 5 mM DTT and 2 units
of RNAsin RNase inhibitor (Promega), at 37° C for 10 minutes. Splicing was
initiated with 0.2 mM GTP (Pharmacia) and the reactions allowed to continue for
varying lengths of time. Reactions were terminated by the addition of equal
volumes of 90% formamide, 25 mM EDTA or ethanol precipitated and
resuspended in the formamide buffer. Reaction products were resolved on 4%
polyacryiamide-8M urea gels and autoradiographed.
Splicing Competition Assays
These assays were done essentially as described above but in the presence of a
constant amount of the wild-type protein and increasing concentrations of mutant

Cbp2 proteins. The deletion mutant lacking amino acids 17-28 and the triple
aromatic mutant with Y21, Y23 and F25 residues converted to leucine were
employed to compete with the wild-type protein in splicing assays. As a control,
the concentration of wild-type Cbp2 was increased to the same level of total Cbp2
protein (wild-type + mutant) used in the above reactions but in the absence of
mutant proteins. Spliced products were resolved on denaturing gels and
quantitated using Phosphorlmager (Molecular Dynamics).
Partial Proteolysis of Cbp2
The conformation of mutant Cbp2 proteins was determined by comparing the
partial proteolytic profiles of wild-type and mutant Cbp2. Partial proteolysis was
done by incubating 0.5-1 ug of the wild-type (native or heat-denatured) or the
mutant Cbp2 protein with trypsin, at protease:Cbp2 ratios of 1:50 and 1:100 (w/w),
for 1 hour at room temperature and the peptides resolved on 12% SDS-PAGE gels.
The peptide profiles were detected by Western blotting performed according to
Towbin et al. (1979), with a Cbp2-specific polyclonal antibody (a generous gift of
Dr. Alexander Tzagaloff).
Equilibrium Binding Analysis
The affinity of wild-type and mutant Cbp2 proteins for bI5 RNA was
determined by the double-filter binding assay (Wong and Lohman, 1993) with the
exception that a charged nylon membrane (Hybond N+ from Amersham) was used
in place of DEAE. This method involves filtration of protein-RNA mixtures
through a sandwich of two membranes, a nitrocellulose filter on top and a nylon

membrane at the bottom, in a 96-well dot-blot apparatus. The protein-RNA
complexes are retained on the nitrocellulose while the free RNA is trapped by the
nylon membrane. The fraction [RNA bound] can be calculated as follows:
[RNA]bound = [RNA]totai (Cnc - a Cny) / (Cnc + Cny)
where, Cnc and Cny correspond to the Phosphorlmager counts retained on the
nitrocellulose and nylon filters respectively. The parameter a_refers to the RNA
retained nonspecifically on nitrocellulose and is empirically derived from RNA
bound in the absence of the protein (a = Cnc / Cny at [protein] = 0).
Protein-RNA complexes were generated by incubating a low concentration (16
pM) of P-labeled intron 5 RNA with increasing concentrations (0-4000 pM) of
wild-type or mutant Cbp2 in 5 mM MgCh, 5 mM DTT, 50 mM NH4CI, 50 mM
tris-HCl, pH 7.5, buffer at 37° C for 30 minutes. The reactions exhibit equilibrium
binding by 30 minutes. Duplicate reactions were filtered through a pre-soaked BA
85 nitrocellulose membrane (Schleicher and Schuell) overlaid on a pre-wetted
Hybond N+ nylon membrane, in a 96-well dot-blot apparatus (Bio-Rad). The
filters were washed four times with low salt buffer and the radioactivity retained
on both the membranes was quantitated using a Phosphorlmager (Molecular
Dynamics). The fraction [RNA bound] was calculated and Ka of the mutants
determined by the Cbp2 concentration needed for half maximal RNA binding.

Induction of crosslinks by ultraviolet light in nucleic acid-protein complexes
has been a valuable tool for probing structural aspects of protein-DNA/RNA
interactions. Ultraviolet (UV) photolysis provides a useful approach to determine
the contact points between nucleic acid and protein, as it produces zero-length
crosslinks in contrast to chemical crosslinking agents. The latter interpose spacers
of varying lengths at the interface and hence are less appropriate to probe intimate
contacts at the interface of protein-nucleic acid complexes. A free radical
mechanism has been proposed to explain the process of UV-crosslinking of amino
acids to nucleic acid bases (Shetlar, 1980). Photoexcitation of a nucleic acid base
followed by abstraction of a hydrogen atom from a favorably positioned amino
acid residue generates a purinyl or pyrimidinyl radical which recombines with the
corresponding radical on the proximate amino acid residue. Such a zero-length
recombination event requires an amino acid to be present in extremely close
proximity to an excited base. Studies on the bacteriophage fd gene 5 protein, a
single-stranded DNA-binding protein suggest that the amino acid and the base

must also be present in a relatively specific topological arrangement to achieve
photochemical crosslinking (Williams and Konigsberg, 1991). For instance, the
amino acids Tyr-26 and Phe-73 of the bacteriophage fd gene 5 protein could not be
crosslinked in a gene 5-ssDNA complex (Paradiso et al., 1979; Paradiso and
Konigsberg, 1982), although *H nuclear magnetic resonance data suggest that
these two residues form part of the DNA-binding domain of the protein (King and
Coleman, 1988. The extent of photocrosslinking also depends on the intrinsic
structure of the nucleic acid or protein. Among the nucleotides, thymine and
uridine appear to be the most photoreactive, yielding greatest extent of
crosslinking to proteins. On the other hand, in principle, any of the 20 amino acids
found in proteins can be crosslinked to nucleic acids by UV-irradiation (Williams
and Kongsberg, 1991).
Photochemical crosslinking has been adapted to detect protein bound to specific
• 32
sites on double-stranded DNA using P-labeled, site-specific probes (Safer et al.,
1988). This method permits transfer of P from specific phosphodiester bonds to
amino acid residues at the interface upon photocrosslinking (Williams and
Konigsberg, 1991). We have employed a similar method to detect intron 5 RNA
binding sites on Cbp2 protein. We synthesized intron 5 RNA transcripts
(internally labeled with a- P UTP), UV-crosslinked it to purified Cbp2 under
conditions that favor specific complex formation, and detected the crosslinked
Cbp2-RNA complexes on SDS-polyacrylamide gels by autoradiography as the
protein became indirectly labeled upon photocrosslinking.

Various biochemical methods have been employed by several groups to identify
the crosslinked peptides and amino acid residues at the interface of protein-nucleic
acid complexes. The most common approach has been to digest the crosslinked
complex with trypsin, rapidly isolate the peptides using anion-exchange HPLC,
detect the peptides by their absorbance at 220 nm or 254 nm, and identify the
crosslinked fragments by Cerenkov counting of the resultant fractions (Merrill et
al., 1984; Merrill et al., 1988 and Shamoo et al., 1988). In case of proteins with
known primary structure, the crosslinked amino acid residues have been identified
by amino acid analysis following acid hydrolysis. For example, the crosslink site
in the bacteriophage fd gene 5 protein was identified as cysteine-33 by this method
(Paradiso et al, 1979). However, this may not represent a general approach as it
depends on the ability of acid hydrolysis to regenerate the free amino acid from the
crosslinked adduct. In most instances, the crosslinked amino acid was identified
by amino acid sequencing, based on the following principle. A gas or liquid phase
sequencer cannot extract the phenylthiazolinone derivative of the crosslinked
amino acid from the polybrene-coated support disk and therefore leaves a hole in
the sequence at the crosslinked position. Thus, the site of crosslinking is
determined by the absence of an identifiable phenylthiohydantion derivative in the
peptide sequence. Using this approach, the contact sites in E. coli SSB (Merrill et
al, 1984) and Al hnRNP (Merrill et al., 1988) proteins crosslinked to j2P-labeled
(dT)8 oligonucleotides were identified. In the case of E. coli SSB, the site of
crosslinking was further confirmed by solid-phase sequencing which employed a

sufficiently polar solvent such as trifluoroacetic acid to extract the P-labeled
phenylthiohydantion derivative of the crosslinked amino acid.
In addition to the above biochemical methods, gel electrophoresis is a simple
but powerful analytical technique to resolve complex mixtures of peptides and
identify the indirectly labeled, crosslinked peptides by autoradiography. In the
studies reported in this chapter, we have analyzed the UV-crosslinked, Cbp2- P
labeled intron 5 RNA complexes by digesting the protein-RNA complexes with
non-enzymatic cleavage agents and resolving the resultant peptides by one
dimensional tris-tricine gel electrophoresis. We have mapped the major crosslink
sites of intron 5 RNA to the N- and C-termini of Cbp2.
Optimization of UV-Crosslinking Conditions
One of the technical hurdles in biochemical characterization of crosslinked
complexes is isolation of sufficient amounts of the protein-RNA complexes,
relatively free from other species. As the yield of the product depends on the
extent of crosslinking, reaction conditions must be optimized to maximize the
crosslinking efficiency. To that end, the dosage of UV-radiation employed for
crosslinking Cbp2 protein to intron 5 RNA was titrated, holding other conditions
constant. P-labeled intron 5 transcripts were incubated with native Cbp2 under
low salt conditions (5 mM MgCb, 50 mM NH4C1) without GTP. Cbp2 binds to
intron 5 RNA under these conditions and induces formation of the catalytic RNA
conformation (Shaw and Lewin, 1995). The Cbp2-RNA complexes generated

were UV-crosslinked in the presence of excess tRNA (added as a non specific
competitor) by the technique of Zamore and Green (1989), as described in
Materials and Methods. The samples were irradiated at an increasing UV-dosage
ranging from 100 to 950 mJ. As a control, intron 5 RNA was irradiated with a
noncognate protein, BSA, at the highest UV-dosage (950 mJ) employed in the
experiment. All samples were extensively treated with RNAse A and RNAse T1
to remove uncrosslinked RNA, and the protein-RNA complexes were resolved on
SDS-polyacrylamide gels. The gel was autoradiographed (Figure 3-1) and also
quantitated using Phosphorlmager. No crosslinked complex was observed in the
presence of BSA (lane 1) even at a high dosage of UV-radiation, demonstrating
the specificity of Cbp2-intron 5 RNA interaction. The extent of crosslinking of
intron 5 RNA to Cbp2 increased by about 2-fold at a UV-dosage of 600 mJ (lane
7) compared to that at lOOmJ (lane 2) and almost remained the same at higher
doses (lanes 8 and 9). Thus a UV-dosage of 600 mJ was chosen as the lowest
UV-dosage which yielded optimal complex formation.
Identification of Cbp2 Peptides that Contact Intron 5 RNA
The UV-crosslinking technique standardized above was successfully employed
to identify the RNA contact sites on Cbp2 protein. 32P-labeled intron 5 RNA
transcripts were crosslinked to his-tagged Cbp2 under low salt conditions at a UV-
dosage of 600 mJ as described above. The Cbp2-RNA complexes generated were
purified on SDS-polyacrylamide gels. The gel fragments were then soaked in
different chemical cleavage reagents like hydroxylamine (NH2OH) and 2-nitro-5-

Figure 3-1. Optimization of UV-dosage for crosslinking. P -labeled intron 5
RNA was incubated with Cbp2 or BSA under low salt conditions as described in
Materials and Methods. Samples were irradiated with UV-doses ranging from 100
to 950 mJ, extensively RNAase-treated, resolved on 10% SDS-polyacrylamide
gels, and crosslinked complexes detected by autoradiography. UV-irradiation was
done at 950 mJ for BSA (lane 1), and for Cbp2 at 100 mJ (lane 2), 200 mJ (lane 3),
300 mJ (lane 4), 400 mJ (lane 5), 500 mJ (lane 6), 600 mJ (lane 7), 800 mJ (lane
8), and 950 mJ (lane 9).

. I

thiocyanobenzoate (NTCB) to generate peptides. The peptides were separated on
high percentage tris-tricine gels (Schagger and Von Jagow, 1987), and the
crosslinked peptides that retained the label were identified by autoradiography
(Figure 3-2).
NH2OH cleaves proteins at asparaginyl-glycyl peptide bonds (Bomstein and
Balian, 1977) and would yield three large peptides (15.1, 24, 37.1 kDa) in a
complete digest of Cbp2. Cleavage of the crosslinked Cbp2-RNA complex
(Figure 3-2, panel A) showed that the 24 kDa amino terminal and the 15.2 kDa
carboxy terminal fragments of Cbp2 strongly crosslinked with intron 5 RNA,
whereas the large central 37.1 kDa fragment displayed only a very weak signal.
The fact that only two of the three peptides were strongly labeled suggests that the
terminal fragments of Cbp2 might comprise important RNA binding domains. The
weak signal retained by the central 37.1 kDa peptide suggests that other minor
contact sites may be distributed throughout the length of protein. These sites of
interaction may also contribute to the stabilization of the active intron structure,
although the termini may be absolutely essential for the activity.
NTCB is specific to amino groups of cysteines (Jacobson et ai, 1973; Degani
and Patchomik, 1974). NTCB Cleavage of Cbp2 would produce 9 peptides
ranging from 0.17 to 29.5 kDa if the reaction proceeded to completion. Flowever,
for several reasons, only a partial digestion of the protein could be achieved.
Incomplete cleavage results from p-elimination and/or incomplete modification
due to the reversible nature of the cyanylation reaction (Degani and Patchomik,

Figure 3-2. Chemical cleavage of Cbp2-intron 5 RNA complexes. His-tagged
Cbp2 was crosslinked to 32P-labeled intron 5 RNA under low salt conditions in the
absence of GTP, extensively RNAse treated, gel purified on 10% SDS-
polyacrylamide gels, and digested in-gel with hydroxylamine (panel A) and NTCB
(panel B). Following cleavage, peptides were extracted as described in Materials
and Methods, separated on 15% (hydroxylamine) or 16.5% (NTCB) tris-tricine
gels, dried and autoradiographed. Molecular weights of strongly crosslinked
peptides are indicated by arrows, with asterisks representing partial cleavage
products. Panel C. 0.2 mM GTP was added to the crosslinking reaction mixture
and incubated at 37°C for 30 minutes. The reaction products were ethanol
precipitated, resolved on 4% polyacrylamide-8M urea gels and autoradiographed.
Lane 1 shows intron 5 RNA alone incubated in the reaction mixture. Lanes 2 and
3 show the spliced products of intron 5 RNA incubated with native and his-tagged
Cbp2 repectively. The input RNA and the spliced products are schematically
represented on the left.

24 kDa-
15 kDa-
21.9 kDa*
19.3 kDa*
8.7 kDa*
7 kDa

1974). While complete denaturation of the protein is essential to obtain cleavage
at the internal sites, Cbp2, a relatively large protein (73.4 kDa), appears to be
somewhat refractile even to the strong denaturation conditions employed in these
cleavage reactions. Cleavage of crosslinked Cbp2-RNA complexes with NTCB
(Figure 3-2, panel B) generated several peptides that retained the label. Among
the various indirectly labeled peptides, the 7.0 kDa N-terminal peptide and its
corresponding partials (indicated by asterisks) of sizes 8.7 and 19.3 kDa could be
readily identified. This further supports the finding that the N-terminus comprises
an important RNA binding domain. However, the 5.6 kDa C-terminal fragment
generated by NTCB (identified by silver staining, data not shown) did not retain
the label, suggesting that the extreme C-terminal region may not be important for
Cbp2-RNA interactions. The putative C-terminal contact site identified by
NH2OH cleavage may therefore be located upstream of this 5.6 kDa C-terminal
In order to demonstrate that the conditions employed for UV-crosslinking
promote the formation of active Cbp2-intron 5 RNA complexes, the reaction mixes
were incubated with 0.2 mM GTP at 37° C for 30 minutes and the products were
resolved on denaturing gels and autoradiographed. The results are shown in
Figure 3-2, panel C. Reaction mixes containing either his-tagged (lane 3) or native
Cbp2 (lane 2) protein clearly demonstrated splicing, while the RNA alone (lane 1)
could not splice under similar low salt conditions.

The 6x histidine tag adds an additional 20 amino acid residues (about 2 kDa) to
the N-terminus of the his-tagged Cbp2 protein. Therefore, the indirectly labeled
N-terminal peptide and the partíais obtained with his-tagged Cbp2 would migrate
slower in the gels than their non-tagged counterparts. This difference in
electrophoretic mobility was used as an analytical tool to confirm the assignment
of the crosslink site to the N-terminal fragment (Figure 3-3, panels A and B). The
NH2OH and NTCB digestion patterns of the crosslinked complexes using either
his-tagged or native Cbp2 were compared on the same gel. The results for NH2OH
cleavage reactions run on 15% tris-tricine gels are shown in Figure 3-3, panel A.
The N-terminal peptide of the his-tagged protein (lane 2) obtained by NH2OH
cleavage migrated at 24 kDa level while the non-tagged peptide (lane 1) migrated
faster (at 21.6 kDa level). The C-terminal peptides derived from both versions
exhibited similar mobilities, since the his-tag is present only at the N-terminus.
The corresponding NTCB digests of both versions of crosslinked Cbp2 are shown
in Figure 3-3, panel B. The N-terminal peptide (7kDa) and the corresponding 8.7
and 19.3kDa partíais (shown by asterisks) of his-tagged Cbp2 (lane 2) were shifted
up in the 16.5 % tris-tricine gels compared to those generated from the native
Cbp2 (lane 1). No other peptides shifted in the gel relative to the non-tagged
version. These experiments showing differential mobility clearly demonstrate that
the N-terminal crosslink site corresponds to the extreme N-terminal fragment. The
minimal N-terminal peptide that crosslinked with intron 5 RNA was the 4.6 kDa
peptide of the native Cbp2 that corresponds to the first 37 residues of the protein.

Figure 3-3. Confirmation of the crosslink site in the N-terminus of Cbp2.
Native and his-tagged Cbp2 proteins were crosslinked to j2P-labeled intron 5 RNA
and digested with hydroxy lamine (panel A) and NTCB (panel B) as described in
the legend to Figure 3-2. Lanes 1 and 2 represent the cleavage patterns of native
and his-tagged Cbp2, respectively. Molecular weights of strongly crosslinked
peptides are indicated by arrows, with asterisks representing partial cleavage
products. Note the slower migration of N-terminal derived fragments in the his-
tagged Cbp2 lanes.


21.6 kDa-
15 kDa-
-24 kDa
*16.9 kDa-
*6.3 kDa-
4.6 kDa-
19.3 kDa*
8.7 kDa*
7.0 kDa

Further analysis of the identified contact sites (Chapter 4) was restricted to the
identified N-terminal fragment. However, certain conclusions can be drawn about
the C-terminal fragment from the experiments described above. The 15 kDa C-
terminal peptide generated by NH2OH cleavage showed strong crosslinking with
intron 5 RNA (Figure 3-2, panel A). But the 5.6 kDa C-terminal fragment
generated by NTCB (Figure 3-2, panel B) did not retain the label in crosslinking
experiments. These results suggest that the 29.5 kDa penultimate C-terminal
peptide of Cbp2 (aa 502-aa582) generated by NTCB has a potential RNA binding
The summary of findings from the UV-crosslinking experiments are shown in
Figure 3-4. The map shows the two strong RNA binding regions (hashed boxes)
that have been identified by these experiments, with one site being in the first 37
amino acids of the N-terminus and the other in a distally located C-terminal region
(aa 502-aa 582). The digestion sites of NH2OH and NTCB on Cbp2 are also
indicated in Figure 3-4. Further analysis of the importance of amino acid residues
in the N-terminal fragment was carried out using site-directed mutagenesis
(Chapter 4).
UV-crosslinking is a powerful tool to identify RNA contact sites on a protein,
especially when the primary structure and homology searches do not afford any
clues about critical functional elements of the protein. Cbp2, required for the

Figure 3-4. Summary of UV-crossI¡nking results. The peptide map represents the cleavage sites of NTCB (top arrows)
and hyroxylamine (bottom arrows) on the 630-aa long Cbp2 protein. From the UV-crosslinking and chemical cleavage
results shown in Figures 3-2 and 3-3, the intron 5 RNA crosslink sites on Cbp2 were mapped to the first 37 amino acids at
the N-terminus and aa502-aa582 in the C-terminus (hashed boxes).


splicing of intron 5 RNA, fits into this profile of proteins. Nothing is known so far
about the RNA contact sites on the protein while extensive studies are available on
the RNA component of the system. In the studies reported here, UV-crosslinking
was employed to determine the contact points of intron 5 RNA on Cbp2 in an
attempt to investigate the functional interactions between this group I intron and its
protein co-factor. The photocrosslinking studies were performed under conditions
that favored the formation of stable protein-RNA complexes. The Mg" levels (10
mM) employed in these experiments were sufficient to promote 90-95% RNA
binding to Cbp2 in equilibrium filter binding assays (data not shown), but splicing
of RNA would not occur under these conditions due to the absence of guanosine
(nucleophile). However, control experiments show that addition of GTP to the
reaction facilitates splicing, demonstrating that the crosslinking conditions enable
the formation of productive Cbp2-RNA complexes (Figure 3-2, panel C).
Prior to determining the sites of crosslinking, it is essential to establish the
specificity of crosslinking between the RNA and the protein in question. In
control experiments, intron 5 RNA failed to crosslink to the non-cognate protein
BSA (Figure 3-1), showing that photocrosslinking (zero-length crosslinking) can
occur only between functionally interacting species. Also, Cbp2 proteins carrying
mutations in the N-terminal domain showed reduced or no crosslinking with intron
5 RNA compared to the wild-type protein (discussed in Chapter 4). Furthermore,
Cbp2 does not facilitate splicing of intron 4 of COB pre-mRNA (Lewin,
unpublished observation), a group I intron that also requires a protein co-factor in

vivo (Lamb et al, 1983; Banroques et al., 1986). Cbp2 protein is specific to intron
5 RNA in its splicing-enhancing function. This corroborates the authenticity of the
crosslinking results, as UV-light crosslinks an amino acid to its neighboring
nucleic acid base only when present in a specific orientation (Williams and
Konigsberg, 1991). The results of various experiments described above strongly
suggest that the crosslinking conditions employed permit the structural probing of
specific, functional interactions between Cbp2 and intron5 RNA.
Precise identification of the residues that participate in photocrosslinking can be
accomplished by amino acid analysis or amino acid sequencing, as described
earlier. These conventional biochemical techniques, however, require crosslinking
efficiencies of 20% or more. Unfortunately, low crosslinking efficiencies (less
than 10%) were obtained under our conditions. Therefore, the RNA employed for
some of the crosslinking experiments was double labeled with a P-UTP and a P-
ATP to increase the specific activity of RNA and enable detection of crosslinked
peptides. There are several possibilities for the low yields of crosslinked product
obtained in our system. Cbp2 and intron 5 RNA may have inherently poor
tendencies to crosslink in spite of appreciable complex formation. On the other
hand, exposure to UV-light could be causing significant photoinactivation of
Cbp2. Photodamage of protein was reported to be a problem by other groups (Gott
et al., 1991; Tanner et al., 1988). Finally, though UV-crosslinking indicates sites
of protein-RNA contact, most of the affinity between protein and RNA may be
attributable to contact sites that are not crosslinked under the conditions employed.

The low level of crosslinked product obtained in our system proved to be a
potential problem for further biochemical characterization of crosslinked
complexes. One of the ways to overcome this problem would be to enhance the
photosensitivity of RNA using modified residues like 5-bromouridine or 5-
iodouracil and using a monochromatic laser instead of a broad spectrum ultraviolet
light. For instance, the amino acid residue Tyr of R17 bacteriophage coat
protein was shown to be crosslinked with singly BrU-substituted hairpin RNA 1
(Gott et al., 1991) using a monochromatic XeCl excimer laser (308 nm) that
yielded crosslinking levels exceeding 50%. Substitution of 5-iodouracil for uracil
in the binding site for bacteriophage R17 coat protein improved crosslinking levels
to 80% in less than 5 minutes of irradiation (Willis et al., 1993). However,
incorporation of 5-BrU into intron 5 RNA significantly reduced its autocatalytic
activity, indicating that the structure of the ribozyme was perturbed (data not
shown). Also, our attempts to crosslink Cbp2 protein with 5-BrU-RNA using a
broad spectrum UV-source (Stratalinker) did not significantly enhance the extent
of crosslinking. Since we did not have ready access to a monochromatic laser, we
opted to employ alternative analytical methods which accommodate low
crosslinking efficiencies.
A popular approach to analyze crosslinked complexes obtained at low yields is
to employ extremely sensitive analytical techniques like Matrix-assisted, laser
desorption/ionization-time of flight (MALDI-TOF) mass spectrometry (Karas and

Hillenkamp, 1988; Beavis and Chait, 1990 and Hillenkamp et al., 1991) and ladder
sequencing (Chait et al., 1993), which typically require 10-15% crosslinking
efficiency. Elaborate attempts were made to identify the crosslinked
peptides/amino acid residues using this approach in collaboration with the Protein
Core facility of the Interdisciplinary Center for Biotechnology Research (ICBR),
University of Florida. Unfortunately, all attempts failed due to various technical
problems including difficulty in removal of SDS, Coommassie Blue and other gel-
derived contaminants from the peptides. Consequently, the indirectly labeled
Cbp2 peptides (crosslinked with intron 5 RNA) were identified by size separation
on tris-tricine gels followed by Phosphorlmager analysis (Figures 3-2 and 3-3).
Non-enzymatic cleavage agents were used instead of proteases to avoid
interference from protease-derived peptides resulting from self-cleavage. Of
several chemical cleavage reagents, hydroxylamine was chosen for the initial
analysis of crosslinked complexes as it generates only a few large peptides in Cbp2
that can be readily identified on high percentage tris-tricine gels. NTCB was
selected as a secondary reagent to further narrow down the contact points on Cbp2.
Chemical cleavage of the protein-RNA complexes with NH2OH and NTCB
showed that the termini of Cbp2 comprise important RNA binding domains, while
several stretches in the central core of the protein may contribute to the overall
stabilization of protein-RNA interactions (Figures 3-4). Experiments with his-
tagged and native versions of Cbp2 (Figure 3-3) unambiguously demonstrate that
the first 37 amino acids in the N-terminus of Cbp2 constitute a strong RNA contact

site. A second site may be located in the C-terminus between residues 502 and
582 of the protein. A similar architecture of RNA binding domains has been
demonstrated with the mitochondrial tyrosyl-tRNA synthetase protein (Cyt-18) of
Neurospora which is essential for splicing several mitochondrial group I introns in
addition to aminoacylation of tRNAT>r (Akins and Lambowitz, 1987). The regions
required for splicing are distributed throughout the Cyt-18 protein, as it binds the
precursor RNA and facilitates formation of the catalytic RNA structure. These
regions overlap with the stretches required for synthetase activity but are not
identical to them. However, the principal RNA binding regions include a small,
idiosyncratic N-terminal domain significantly absent in bacterial tyrosyl-tRNA
synthetases (Cherniack et al., 1990) and a C-terminal tRNA-binding domain
required for both splicing and synthetase activities (Kittle et al., 1991).
A comparison of Cyt 18 binding sites in N. crassa mt LSU and ND1 introns
with that in N. crassa mt tRNAT>r has revealed a remarkable three-dimensional
overlap between the tRNA and the catalytic core of group I introns, suggesting an
evolutionary relationship between group I introns and tRNA and perhaps the
evolution of RNA splicing factors from cellular RNA-binding proteins (Caprara et
al., 1996). Adaptation of a synthetase to facilitate group I intron splicing appears
to be a relatively recent evolutionary improvement as it has been reported in only
one other closely related fungus, Podospora anserina (Cherniack et al., 1990;
Lambowitz and Perlman, 1990 and Kamper et al., 1992).

Cbp2 protein does not possess any sequence homology with Cyt 18 of N. crassa
or Ytsl protein of P. anserina. However, the latter two share three blocks of
amino acids required for splicing, of which one corresponds to the idiosyncratic N-
terminal domain of Cyt-18, while the other two are located in the putative C-
terminal tRNA binding domain. Although Cbp2 is not a bifunctional protein, the
structural similarities between the catalytic core of group I introns and tRNA may
point to a common mechanism of recognition of a conserved tRNA-like structural
motif in its cognate intron, intron 5 RNA.

UV-crosslinking studies (Chapter 3) show that the N- and C-termini of Cbp2
intimately contact intron 5 RNA. Now the challenge is to identify which amino
acids in these regions are important for Cbp2 function. Unlike most other RNA-
binding proteins, Cbp2 does not contain any well-characterized RNA binding
motifs like the RGG box, RNP or KH motif (Burd and Dreyfuss, 1994). However,
Cbp2 is rich in basic and hydrophobic amino acids, which is also a characteristic of
double stranded RNA-binding proteins (St Johnston et al., 1992; Gatignol et al.,
1993). The only protein with which Cbp2 displays any homology is its counterpart
in S. douglasii (Li et al., 1996). However, the extremely high identity (87%)
between the two homologs does not lend itself to the identification of potential
RNA binding domains by sequence alignments. Therefore, the only viable
alternative is to identify the important residues by biochemical or genetic methods.
The low crosslinking efficiencies obtained in our system ruled out the use of
biochemical methods such as anion-exchange HPLC or mass spectrometry to
identify the critical residues. Therefore, site-directed mutagenesis was used to
identify critical residues for Cbp2 function.

Site-directed mutagenesis is a powerful tool to study the structure-function
relationship of single or combinations of amino acid residues in proteins. It has
been classically used in probing various RNA-protein interactions. One of the
many applications of this technique has been to dissect the individual functions of
various amino acids in dual-function proteins. For instance, the MS2 (R17)
bacteriophage coat protein which binds and encapsidates viral RNA also acts as a
translational repressor of viral replicase by binding to an RNA hairpin in the RNA
genome. LeCuyer et al., 1995, LeCuyer et al., 1996) successfully studied the RNA
binding properties of MS2 coat protein independent of capsid assembly by
isolating a Val75Glu; Ala81Gly double-mutant coat protein which had wild-type¬
like affinity and specificity for RNA, but was defective in capsid assembly.
Site-directed mutagenesis has also been employed to study the evolutionary
relationships of RNA-binding proteins in various species. For example, the second
intron (bi2) of cyt b gene has two homologs in related Saccharomyces species that
differ in their mobility. The S. capensis intron product is bifunctional, with both a
DNA endonuclease and an RNA maturase function (Lazowska et al., 1992;
Szczepanek and Lazowska, 1996), whereas the homologous S. cerevisiae intron
product has only an RNA maturase function and is not mobile (Meunier et al.,
1990; Lazowska et al., 1992). These two intron-encoded proteins differ by only
four amino acid substitutions. Mutational analysis showed that replacement of two
non-adjacent amino acids (Thr212Ala; Thr239His) in the S. cerevisiae maturase
was necessary and sufficient for the acquisition of an endonuclease activity

promoting intron mobility (Szczepanek and Lazowska, 1996). Thus, the S.
capensis protein could be considered more primitive in terms of mitochondrial
group I intron-encoded protein evolution as the two activities have not yet
diverged. The S. cerevisiae protein, on the other hand, lost the original function
(intron mobility) and maintained the acquired one (RNA maturase function) during
Site-directed mutagenesis has been instrumental in delineating novel RNA
binding motifs of proteins with little or no sequence homology to known RNA
binding consensus sequences. The viral coat proteins of the plant viruses alfalfa
mosaic virus (AMV) and tobacco streak virus (TSV) share little primary amino
acid sequence identity (van Vloten-Doting, 1975; Reusken et al., 1995), but are
functionally interchangeable in RNA binding (Zuidema and Jaspars, 1984) and
initiation of infection (Gonsalves and Gamsey, 1975). The lysine-rich N-terminal
RNA binding domain of the AMV coat protein lacks previously identified RNA
binding motifs. Mutational analysis of this N-terminal region identified a single
arginine whose specific side chain and position were crucial for RNA binding
(Ansel McKinney et al., 1996). Consequently, protein sequence alignments
between AMV, TSV, and other related viruses centered on this key arginine
residue revealed a new RNA binding consensus sequence. This also explained in
part why heterologous viral RNA-coat protein mixtures were infectious.
In the case of Cbp2, we employed site-directed mutagenesis to identify the
important residues (by either partial or complete loss of Cbp2 function) in the N-

terminus that crosslinked to intron 5 RNA. The C-terminal region that strongly
crosslinked to RNA was not pursued further, as attempts to narrow down this
region by double digestion of crosslinked complexes with NH2OH followed by
cyanogen bromide were not feasible within the resolution of our gel system.
In order to identify targets for site-directed mutagenesis of Cbp2, the putative
N-terminal RNA contact site on Cbp2 (spanning 37 residues) was scanned closely
to allow the prediction of residues that might be important in RNA-protein
interactions. This sequence, aal7 SSSRYRYKFNME aa28, has the following
interesting features:
a. Charged residues alternate with aromatic residues.
b. Polar residues flank the region of alternating charged and aromatic residues.
While the charges could promote ionic interactions between protein and RNA, the
aromatic residues could engage in stacking interactions. The stretch of serines
could participate in hydrogen bonding interactions. These various possibilities led
us to target this N-terminal region (aal7-aa28) for site-directed mutagenesis. The
details of the analyses of all these mutants and a discussion of their implications
are described in the following sections.
All mutant his-tagged Cbp2 proteins (Table 4-1) were purified by one-step
metal affinity chromatography as described in Materials and Methods. The serine
deletion mutant and the Y23L mutant could not be successfully purified. The

Table 4-1. Description of Cbp2 mutants
Name of Mutant
Mutant Description
Deletion mutant
Deletion of aal7-aa28
Triple aromatic mutant
Changes Y2i, Y23, and F25 to L
Triple charged mutant
Changes R20, R22, and K24 to L
Y21L mutant
Changes Y21 to L
Y23L mutant
Changes Y23 to L
F25L mutant
Changes F25 to L
Serine deletion mutant
Deletion of Si7, Si8, and S]9

former eluted in the wash fractions with other E.coli proteins, while the latter co¬
purified with a nuclease activity and could not be assayed. The serine deletion
appears to have altered the global conformation of Cbp2 (perhaps the topology of
the histidine tag), resulting in poor binding to the nickel column. Independent
attempts to purify the Y23L mutant with fresh reagents and columns still yielded
preparations with high nuclease activity, raising the possibility that this mutation
has conferred a nuclease function to Cbp2. This problem was not encountered in
parallel preparations of any of the other mutants. Although these mutants appear
to possess interesting properties, they were not characterized further.
The mutant Cbp2 proteins purified from E.coli were first analyzed by Western
blotting with a Cbp2-specific polyclonal antibody to check for production of the
full-length protein. Mutant proteins were separated on a 10% SDS-polyacrylamide
gel and electroblotted to a nitrocellulose membrane at 15 volts, overnight. The
membrane was first probed with Cbp2-specific primary antibody followed by
secondary goat anti-rabbit antibody as described by Towbin et al. (1979). The
Cbp2 bands were detected by chemiluminescence using ECL detection system
(Amersham) (Figure 4-1, panel A and panel B). All mutant proteins (in both
panels) except the deletion mutant (lacking aal7-aa28) exhibited electrophoretic
mobilities similar to that of wild-type Cbp2. The deletion mutant (aa 17-aa28) was
shorter by about 1.3 kDa, as expected. These data confirm the synthesis of full
length mutant Cbp2 proteins in E. coli. To test the effects of these mutations on
splicing function, in vitro splicing assays were carried out. P-labeled intron 5

Figure 4-1. Western analysis of Cbp2 mutants. Mutant and wild-type Cbp2 proteins were resolved on 10% SDS-
polyacrylamide gels, electroblotted to nitrocellulose membranes, probed with Cbp2-specific polyclonal antibody, and bands
detected using ECL chemilumiscence kit (Amersham). Panel A. Lane 1, triple aromatic mutant; lane 2, deletion (aal7-
aa28) mutant; lane 3, wild-type Cbp2. Panel B. Lane 1, wild-type Cbp2; lane 2, triple charged mutant; lane 3, F25L, lane 4,
Y21L; lane 5, Y23L.

Triple aromatic
Deletion (17-28)

RNA transcripts were incubated with increasing concentrations of wild-type or
mutant Cbp2 proteins under low salt splicing conditions. The reaction products
were separated on 4% polyacrylamide-8M urea gels and autoradiographed (Figure
4-2). Increasing concentrations of deletion mutant (aal7-aa28) (lanes 4 and 5) and
triple aromatic mutant (lanes 6 and 7) failed to stimulate splicing of intron 5 RNA,
while wild-type Cbp2 spliced normally at both concentrations tested (lanes 2 and
3). These results strongly suggest that the N-terminal residues (aal7-aa28) may
comprise an important RNA binding domain essential for Cbp2 function.
However, it is important to demonstrate that the loss of activity observed was not
due to structural destabilization caused by these mutations.
Partial proteolysis is a useful technique to analyze the conformational states of
proteins (Chang and Doi, 1993; Hay and Nicholson, 1993; Petersen et al., 1995;
Ikeda et al., 1996; Liu et al., 1996). In this assay, deletion and triple aromatic
mutant proteins (in native states) were incubated separately with trypsin under
conditions that favored partial proteolysis as described in Materials and Methods.
A control digest with native or heat-denatured wild-type Cbp2 was also done. The
peptides were resolved on 12% SDS-PAGE gels and detected by Western blotting
with a Cbp2-specific polyclonal antibody (Figure 4-3). The tryptic peptide profiles
of native deletion (lanes 3 and 4, panel A) and triple aromatic (lanes 3 and 4, panel
B) mutants closely resembled the pattern obtained with native wild-type Cbp2
(lanes 5 and 6 of both panels). In contrast, heat-treated wild-type samples (lanes 1
and 2 of both panels) exhibited a different pattern, showing aggregation of

Figure 4-2. Functional analysis of deletion (aal7-aa28) and triple aromatic
mutants. l2P-labeled intron 5 RNA was incubated with increasing concentrations
of wild-type and mutant Cbp2 under low salt splicing conditions at 37°C for 1
hour, ethanol precipitated, resolved on a 4% polyacrylamide-8M urea gel, and
autoradiographed. The precursor RNA and the products of splicing are
schematically represented on the left side of the gel, with the ratio of protein to
RNA shown on top of the lanes. Lane 1, precursor RNA alone; lanes 2 and 3,
incubation with wild-type Cbp2; lanes 4 and 5, incubation with deletion (aal7-
aa28); lanes 6 and 7, incubation with triple aromatic mutant (Y21, Y23, F25 to L).

Triple aromatic

Figure 4-3. Partial proteolytic profiles of deletion (aal7-28) and triple aromatic mutants. Native or heat denatured
wild-type and native mutant proteins were digested with trypsin under conditions allowing only partial digestion, resolved
on 12% SDS-polyacrylamide gels, and Western blotted with Cbp2-specific polyclonal antibody as described in Materials
and Methods. Panel A. Lanes 1 and 2, heat-denatured wild-type Cbp2; lanes 3 and 4, deletion mutant; lanes 5 and 6, native
wild-type. Panel B. Lanes 1 and 2, heat-denatured wild-type Cbp2; lanes 3 and 4, triple aromatic mutant; lanes 5 and 6,
native wild-type. The duplicate lanes for each protein in both panels refer to the ratio of trypsin to Cbp2 (w/w) as indicated
above the lanes.

1:50 _
wt Cbp2
1:50 _
Wt Cbp2
\ »
] 1
! l|
| |
j I
‘ il
) 1
1:50 _
1:50 _
wt Cbp2
Triple aromatic
Wt Cbp2

denatured protein at the top of the gel. In addition, partial products corresponding
to those obtained with native proteins were markedly absent in these digests. This
is probably due to complete degradation of denatured protein molecules that were
not present in aggregates. Thus, these results demonstrate that the mutations in
Cbp2 did not alter the global conformation of these proteins.
Preliminary splicing experiments with triple charged mutant (R20, R22, K24
changed to leucine) and two point mutants, namely Y21L (tyrosine to leucine
change at position 21) and F25L (phenylalanine to leucine at position 25), showed
varying degrees of activity. These mutants were characterized further by a series
of time-course experiments that measured their initial rates of splicing (Figures 4-4
and 4-5). P-labeled transcripts were pre-incubated with each mutant protein at
37°C for 10 minutes under low salt conditions and splicing was initiated by the
addition of 0.2 mM GTP. The reactions were terminated at different times,
resolved on denaturing polyacrylamide gels (Figure 4-4A & B) and
autoradiographed. The F25L mutant (Figure 4-4A, right panel) stimulated splicing
at levels comparable to wild-type Cbp2 (Figure 4-4A, left panel), while the triple
charged and Y21L mutants (Figure 4-4B, left and right panels, respectively)
showed drastic reduction in the extent of splicing. It is interesting to note that in
the case of triple charged and Y21L mutants (compare Figures 4-4 A and 4-4B),
the products of the first step of splicing (5’ exon and the intron-3’ exon) were
barely detectable compared to the products of the second step (ligated exons and
free intron), suggesting that the first step of splicing is rate limiting for these two

Figure 4-4. Time course of splicing for wild-type and mutant Cbp2. Radiolabeled intron 5 RNA was incubated with
wild-type or mutant Cbp2 proteins under low salt splicing conditions. Reactions were terminated at indicated times,
resolved on 4% polyacrylamide-8M urea gels, and autoradiographed. A schematic representation of the precursor RNA and
spliced products are given on the left side of the figures. A. Shows the splicing time course for the wild-type Cbp2 (left
panel) and F25L mutant (right panel). B. Shows the splicing time course for the triple charged mutant (left panel) and the
Y21L mutant (right panel). A marker lane with wild-type Cbp2 was run on the right of each panel to indicate the location of
spliced products.

Wt Cbp2 F25L
Time (min) 0 1 2 4 6 8 10 12 24 60 0 1 2 4 6 8 10 12 24 60

Triple charged mutant
O 1 2 4 6 8 10 12 24 60 í
Y21L mutant
0 1 2 4 6 8 10 12 24 60
Figure 4-4 continued

Figure 4-5. Splicing rates of wild-type and mutant Cbp2. The gels shown in
Figure 4-4 were quantitated using Phosphorlmager and the RNA fraction spliced
calculated as the ratio of the sum of ligated exons and free 5’ exon to the exon
sequences present in the precursor RNA. The plots show RNA fraction spliced
(+/-S.D) vs. time in min. A. Filled circles, Wt Cbp2; open circles, F25L mutant;
filled squares, Triple charged (LYLYLF) mutant; open squares, Y21L mutant. B.
The plots for the last two mutants shown in A are plotted on an expanded scale to
show initial rates of splicing. Filled circles, Triple charged (LYLYLF) mutant;
open circles, Y21L mutant.

RNA fraction spliced
Time (min)

RNA fraction spliced
Figure 4-5...continued

mutants. A quantitative representation of splicing for the wild-type and mutant
proteins is shown in Figure 4-5A. A re-plot of the data corresponding to triple
charged and Y21L mutants is shown on an expanded scale in Figure 4-5B. Initial
rates of splicing were calculated from the above plots for all mutants (Table 4-2).
Figure 4-5A shows that the triple charged (filled squares) and the Y21L (open
squares) mutants exhibited extremely low activity compared to F25L mutant (open
circles) or wild-type Cbp2 (filled circles). However, it is obvious from Figure 4-
5B that both triple charged and Y21L mutants accumulated spliced products with
time. Initial rate measurements (Table 4-2) indicated that the rate of splicing of
the F25L mutant, though appreciable, was slightly lower than that of the wild-type
protein. In the case of the Y21L and triple charged mutants, the initial rate of
splicing was lowered by ~45-fold and ~40-fold, respectively, in comparison to
wild-type Cbp2. Thus, tyrosine at position 21 is critical for activity while a
phenylalanine at position 25 is dispensable. The charged residues at positions 20,
22 and 24 are also important for Cbp2 function.
To determine if lower splicing activity of the Cbp2 mutants corresponded to a
reduction in overall affinity for intron 5 RNA, equilibrium binding assays were
performed. 32P-labeled intron 5 RNA (16 pM) was incubated with increasing
concentrations of wild-type or mutant Cbp2 (0-4000 pM) at 37°C for 30 minutes
and equal aliquots were filtered in duplicate through a double-filter consisting of
nitrocellulose on top and charged nylon at the bottom, as described in Materials
and Methods. Representative filter binding data are shown in Figure 4-6A. The

Table 4-2. Rate measurements for wild type and mutant Cbp2
Cbp2 protein
RNA fraction spliced
at 60 minutes
Initial rate of splicing
(fraction min"1)
0.94 + 0.22
0.68 ±0.09
0.11 ±0.01
0.474 x 10"2
0.05 ±0.0005
0.417 x 10'2

Figure 4-6. Double filter-binding assay of wild-type and mutant Cbp2. A. Radiolabeled RNA was incubated with
increasing concentrations of wild-type and mutant proteins under low salt splicing conditions (without GTP) at 37°C for 30
min. Equal aliquots of each reaction were filtered in duplicate through a sandwich consisting of nitrocellulose on top and
charged nylon at the bottom, as described in Materials and Methods. RNA-binding patterns for the triple charged and F25L
mutants and wild-type Cbp2 on nitrocellulose (left panel) and nylon (right panel) are shown. B. The dot blots shown in A.
were quantitated using Phosphorlmager and the fraction RNA bound calculated as described in Materials and Methods. The
fraction of RNA bound is plotted as a function of Cbp2 concentration. Open squares, Y21L; filled squares, triple charged
mutant; open circles, deletion (aal7-aa28); filled circles, triple aromatic mutant; open triangles, F25L; filled triangles, wild-
type Cbp2.

Nylon N+

Cbp2 (pM)
Figure 4-6...continued

nitrocellulose membrane, which contains protein-RNA complexes (left panel)
showed an increase in the bound RNA fraction with increasing Cbp2
concentrations, while the nylon membrane which contains free RNA (right panel)
showed a corresponding decrease in the free RNA retained. Each filter binding
experiment (in duplicate) was repeated at least two times and the RNA binding
data (Figure 4-6B) used to calculate dissociation constants (kd) (Table 4-3).
The F25L mutant (open triangles), which showed wild-type-like splicing
activity, demonstrated RNA binding levels comparable to that of wild-type (filled
triangles). The kd values of wild-type protein and F25L mutant were very similar
(147 pM and 143 pM respectively). The triple charged (filled squares) and the
Y21L mutants (open squares), which displayed partial splicing activity, showed
reduced binding. These two mutants showed ~2.5-fold and ~5-fold increase in kd
values, respectively, relative to wild-type Cbp2. The deletion mutant (open
circles) showed slightly tighter binding (kd of 77 pM) than wild-type, whereas the
triple aromatic mutant (filled circles) showed slightly lower binding levels (kd of
184 pM) compared to wild-type Cbp2. Although the kd values are variable, the
overall RNA binding profiles of mutants are similar to that of wild-type Cbp2
(hyperbolic). The similarity in binding isotherms for most of the mutant proteins
confirms our conclusion that the amino acid changes have not significantly
destabilized the higher order structure of protein. These results also suggest that
the overall RNA binding pattern does not necessarily reflect the ability to stimulate
splicing of intron 5 RNA.

Table 4-3. Dissociation constants of Cbp2 mutants
Cbp2 protein
kd (PM)
Deletion (aal7-aa28)
Wild type Cbp2
F25L mutant
Triple aromatic mutant
(Y2i, Y23, and F25 to L)
Triple charged mutant
(R-2o> R22? and K24 to L)
Y21L mutant

Since the putative contact sites in Cbp2 were initially identified by UV-
crosslinking, the mutants were tested for their ability to crosslink to intron 5 RNA.
P labeled RNA transcripts were UV-crosslinked to wild type or mutant Cbp2
protein, RNAase treated and resolved on 10% SDS-polyacrylamide gels. The
crosslinked complexes were detected by autoradiography (Figure 4-7) and
quantitated using Phosphorlmager. RNA crosslinked in the absence of protein
(lane 5) was almost completely degraded, without any detectable complexes.
However, RNA crosslinked to wild type Cbp2 (lane 4) showed a prominent
crosslinked species corresponding to the molecular weight of Cbp2. Crosslinking
to triple charged (lane 3) and F25L (lane 1) mutant proteins was reduced by -50%
and -53%, respectively, compared to wild type. The Y21L mutant (lane 2)
showed extremely poor crosslinking to intron 5 RNA. The background bands seen
below the level of Cbp2 (lanes 1 to 4) could be photodamaged Cbp2-RNA
complexes or RNA-RNA crosslinks that were resistant to RNAase. Thus,
mutations at positions R22, R24, K26, Y21 and F25 lowered the crosslinking
efficiency of Cbp2. It is important to note that mutations targeting the above
residues also affected splicing, with the exception of the F25L mutation. Thus,
some of the residues in this region (aal7-aa28) that are important for Cbp2
function also appear to be involved in crosslinking Cbp2 to intron 5 RNA.
As partial proteolytic profiles (Figure 4-3) and filter binding curves (Figure 4-
6B) of deletion (aal7-aa28) and triple aromatic mutants were similar to that of

Figure 4-7. UV-crosslinking of wild-type and mutant Cbp2 to intron 5 RNA.
Wild-type or mutant Cbp2 was incubated with radiolabeled intron 5 RNA under
low salt conditions in the presence of 20 ug/ml tRNA. The samples were then UV-
crosslinked at 600 mJ, extensively RNAase treated, resolved on 10% SDS-PAGE
gels, and autoradiographed as described in Materials and Methods. Lane 1, F25L
mutant; lane 2, Y21L mutant; lane 3, triple charged (LYLYLF) mutant; lane 4,
wild-type Cbp2; lane 5, radiolabeled RNA alone. The molecular weight position
of Cbp2 is indicated by the arrow.

RNA alone

wild-type, they were tested for their ability to compete with wild-type Cbp2 in
splicing assays. Splicing reactions were set up at wild-type Cbp2 to intron 5 RNA
ratio of 7:1 in the presence of increasing concentrations of mutant proteins.
Reaction products were resolved on denaturing gels and autoradiographed (Figure
4-8A). Wild-type Cbp2 alone (lane 1) spliced normally while the deletion (lane 2)
or triple aromatic (lane 7) mutant alone was completely defective in splicing
activity, as reported before. Addition of increasing concentrations of deletion
(lanes 3 to 6) or triple aromatic (lanes 8 to 11) mutant protein to wild-type Cbp2-
mediated reactions showed a progressive inhibition of splicing (compare lane 1
with lanes 3 to 6 and 8 to 11). These results are quantitatively represented in
Figure 4-8B. The graphs show percentage splicing as a function of mutant:wild-
type ratios, with the extent of splicing obtained in the presence of wild-type Cbp2
alone set to 100%. Results of the addition of deletion and triple aromatic mutants
are shown in the left and right panels, respectively. Addition of a 3-fold excess of
deletion mutant lowered splicing levels to 40% of control levels. A similar
inhibition of splicing was observed with triple aromatic mutant, although at a
higher ratio (9:1) of mutant to wild-type Cbp2. Thus, Cbp2 mutants inhibited the
protein-mediated splicing of intron 5 RNA when present in excess over the wild-
type protein.
It is important to note that at the highest level of splicing inhibition (Figure 4-
8B), total protein (mutant + wild-type) to RNA ratio was 71:1 for the deletion
mutant and 140:1 for the triple aromatic mutant. It is, therefore, possible that the

Figure 4-8. Effect of mutant proteins on wild-type Cbp2-mediated splicing. Splicing reactions were performed at 7:1
wild-type Cbp2:RNA in the presence of increasing concentrations of deletion (aal7-aa28) or triple aromatic mutant proteins.
Reactions were resolved on 4% polyacrylamide-8M urea gels and autoradiographed. A. Lane 1, wild-type Cbp2 alone; lane
2, deletion mutant (aal7-aa28) alone; lanes 3-6, constant amount of wild-type + increasing concentrations of deletion mutant
proteins; lane 7, triple aromatic mutant alone; lanes 8-11, constant amount of wild-type + increasing concentrations of triple
aromatic mutant proteins. The ratio of mutant to wild-type Cbp2 in each reaction is indicated above the lanes. The
precursor RNA and spliced products are schematically represented on the left of the gel. B. The splicing gels in A were
quantitated using Phosphorlmager and the % splicing (determined from ligated exons) plotted as a function of mutant:wild-
type Cbp2, setting the extent of splicing with wild-type Cbp2 alone to 100%. The left and right panels show data
corresponding to deletion (aa!7-aa28) and triple aromatic mutants, respectively.

Mutant : Wt Cbp2 ¿
VO rH 17H
o [=1
1 2 3 4 5
Triple aromatic

Deletion (aal7-28)
Triple aromatic mutant
• -j
;J :> •• •;
â–  '
■■ ■ .•;•; •:
- r â– â– 
: • •. • *. • *. • *. ■ *.
-r • *.*• •.*•
.*;• .*;• .*;• .* • .*
/.â–  V ^.
V;. .* • .•
.• •
. •„*. •.*. •.*. •.*. ••
• *.*• *.*• ••
, •*.* .*.* •• • ••
-r ••
.*;• •*.* •*.* •*.* •• • ••
• *.*•' ••
.*;• .* • .•
;• .•;• .•;• ■:
;■ .■;• \
■/. •• •• •. •.
;• •;
• *. • *. • • *. • •
•/. •, •
;• •,
•’ ■
;• .•;• .•;• •,
•V- •/. •
;• ■
■/. •. •
;• ■
•. ■
;â–  r,
•. •.
••• •. •
:■ •
• *. • *. • *. • *. • •
;• r,
•/.•/.•. ■
;â–  r,
V.â– . â– .
■v. •. •
••• '.*• •. •
■V- •. •
•• •
*• *.*• *.*• -.*• *.*• .*•
' •' •
*• *.*• *.*•
1 •*.* ■*.* •*.* • *
*• *.*• *.*• .*
*. •/. .*
*/y/y/yf:/: :/y/y/y/yy
â– â– â– â–  .â– 
V. V íjVvávv'.v'.- J- VVvVWvV. Tj
Mutant: Wt-Cbp2
Mutant: Wt-Cbp2
Figure 4-8...continued

inhibition observed in this experiment was a function of total protein concentration
(mutant + wild-type Cbp2), rather than being a property of mutants. To test this
possibility, splicing was performed with increasing concentrations of wild-type
Cbp2 alone (Figures 4-9A and 4-9B). Maximum splicing activity was obtained at
a protein:RNA ratio of 7:1 (lane 4 in Figure 4-9A; expressed as 100% activity in
Figure 4-9B). However, splicing was severely inhibited at 28:1 (lane 6), and
almost completely inhibited at higher ratios (lanes 7 and 8) of wild-type
Cbp2:RNA. The splicing levels dropped to 21% (for 28:1) and ~1% (for 56:1 and
112:1) of the activity obtained at 7:1 ratio (Figure 4-9B). Thus, wild-type Cbp2
appears to stimulate splicing only in a narrow range of protein:RNA ratios, with
higher levels being inhibitory. In order to determine whether aggregation was the
cause for the observed inhibition of activity, these experiments were repeated over
a wide range of concentrations of wild-type Cbp2. Identical inhibition was
observed whether the protein was titrated at lower (3.6-58 nM) or higher (up to
116 nM) ranges, suggesting that aggregation of protein was not a problem in these
experiments (data not shown).
It is possible that the observed inhibition of splicing at higher concentrations of
wild-type protein could be due to non-specific interactions of Cbp2 (a highly basic
protein) with its RNA counterpart. This possibility was tested using the non¬
specific competitor, tRNA, in partially inhibited splicing reactions. A titration of
Cbp2 concentration in the absence of tRNA is shown in Figures 4-10A (lanes 1 to
6) and 4-10B (left panel). The maximal splicing observed at 14:1 ratio (lane 3,

Figure 4-9. Effect of increasing concentrations of wild-type Cbp2 on protein-
mediated splicing. Radiolabeled intron 5 RNA was pre-incubated with increasing
concentrations of wild-type Cbp2 for 10 min at 37°C. Splicing was initiated by the
addition of 0.2 mM GTP and incubation continued at 37°C for 30 min. Spliced
products were resolved on 4% polyactylamide-8M urea gels and autoradiographed.
A. Lane 1, intron 5 RNA alone; lane 2, splicing at protein:RNA of 1:1; lane 3,
3.5:1; lane 4, 7:1; lane 5, 14:1; lane 6, 28:1; lane 7, 56:1; and lane 8, 112:1. B.
Phosphorlmager quantitation of the gel shown in A was used to plot the % splicing
(ratio of the sum of ligated exons and 5’ exon to unspliced precursor) as a function
of wild type-Cbp2 to RNA ratios, setting the extent of splicing obtained at 7:1 to

i1. E
Cbp2 : RNA
11 l
• « !
« 1
l< 1
• 112:1

Figure 4-9.. .continued

Figure 4-10. Effect of tRNA addition on wild-type Cbp2-mediated splicing. A. Radiolabeled intron 5 RNA was pre¬
incubated with wild-type Cbp2 at increasing protein to RNA ratios (as indicated) for 10 min at 37°C in the absence of tRNA
(lanes 1-6) or at a protein: RNA ratio of 29:1 in the presence of increasing concentrations of tRNA (lanes 7-13). Splicing
was initiated with 0.2 mM GTP and incubation was continued at 37°C for 30 min, after which samples were resolved on 4%
polyacrylamide-8M urea gels and autoradiographed. Lane 1, RNA alone; lane 2, splicing at protein to RNA ratio of 7:1;
lane 3, 14:1; lane 4, 29:1; lane 5, 58:1; lane 6, 116:1. Lanes 7-13, splicing at 29:1 protein:RNA ratio in the absence of tRNA
(lane 7) or in the presence of tRNA at 0.1 mg/ml (lane 8), 0.12 mg/ml (lane 9), 0.14 mg/ml (lane 10), 0.16 mg/ml (lane 11),
0.18 mg/ml (lane 12), 0.2 mg/ml (lane 13). B. Quantitation of the gel shown above was used to calculate % splicing (ratio
of sum of ligated exons and 5’ exon to unspliced precursor), setting the extent of splicing at 14:1 to 100%. The % splicing
is plotted as a function of wild type-Cbp2:RNA (left panel) and tRNA concentration titrated at proteimRNA ratio of 29:1
(right panel).

Cbp2: RNA
(no tRNA)
1 2 3 4 5 6
tRNA (mg/ml) at
Cbp2 : RNA of 29 :1
7 8 9 10 11 12 13

0 0.1 0.12 0.14 0.16 0.18 0.2
tRNA (mg/ml)
Figure 4-10...continued

Figure 4-10A) of Cbp2 to RNA was set to 100% (Figure 4-1 OB). Similar to the
results reported above (Figures 4-9A and 4-9B), a protein:RNA ratio of 29:1
lowered splicing to -40% of that at 14:1, with almost complete inhibition at higher
ratios (Figure 4-1 OB, left panel). Addition of increasing concentrations of tRNA
to splicing reactions containing protein:RNA ratio of 29:1 (partially inhibited
reactions) restored splicing activity to the levels obtained at 14:1 ratio (Figure 4-
10A, lanes 7-13; right panel in Figure 4-1 OB). It is interesting to note that the
addition of just 10 ug/ml tRNA resulted in a marked rescue of splicing activity.
These results suggest that tRNA overcomes the inhibition of splicing by reducing
non-specific interactions of Cbp2, allowing the formation of splicing-competent
protein-RNA complexes.
In light of the above results, the inhibition of wild-type Cbp2-mediated splicing
by deletion and triple aromatic mutants was re-examined under conditions that
minimize non-specific protein-RNA interactions. Keeping the wild-type
Cbp2:RNA ratio at 1:1, the concentrations of deletion and triple aromatic mutant
proteins were increased such that the total protein (wild-type + mutant Cbp2) to
RNA ratios did not exceed 7:1 (Figures 4-11A). Figure 4-1 IB shows the splicing
activity under these conditions as a function of mutant to wild-type Cbp2 ratios.
Neither mutant inhibited wild-type Cbp2-mediated splicing at the mutant:wild-type
Cbp2 ratios tested (Figure 4-1 IB). These results clearly show that the inhibition of
splicing by higher concentrations of Cbp2 (wild-type or mutant) was a function of
total protein to RNA ratios and not a characteristic of the mutants per se.

Figure 4-11. Effect of mutant proteins on wild-type Cbp2-mediated splicing
at low total protein to RNA ratios. A. Radiolabeled intron 5 RNA was pre¬
incubated for 10 min at 37°C with a constant amount of wild-type Cbp2 and
increasing concentrations of deletion (aal7-aa28) or triple aromatic mutants, such
that total protein to RNA ratios did not exceed 7 to 1. Splicing was initiated with
0.2 mM GTP, products resolved on 4% polyacrylamid-8M urea gels, and
autoradiographed. A RNA alone (lanes 1 and 9); splicing in the presence of wild-
type Cbp2 alone (lanes 2 and 10); splicing in the presence of a constant amount of
wild-type Cbp2 + increasing concentrations of deletion (aal7-aa28) mutant (lanes
3-8) or triple aromatic mutant (lanes 11-16). The ratio of mutant to wild-type
Cbp2 in each reaction is indicated above the lanes. The precursor RNA and
spliced products are schematically represented on the left of the gel. B.
Quantitation of the gel shown in A was used to plot the splicing ratio (sum of
ligated exons and 5’ exon to unspliced precursor) as a function of mutant: wild-type
Cbp2 ratio.

Deletion (aa!7-aa28)
Triple aromatic (RLRLKL)
Mutant : Wt
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16

Splicing Ratio
Figure 4-11...continued

UV-crosslinking studies (Chapter 3) showed a 37-amino acid N-terminal region
to be in close proximity with intron 5 RNA under facilitated splicing conditions.
These findings provided specific targets for mutagenesis, obviating the need for
general surface scanning methods like alanine scanning (Cunningham and Wells,
1989). A 12-amino acid stretch (aal7-SSSRYRYKFNME-aa28) in this 37 amino
acid region was predicted to be critical for RNA-protein interactions, based on the
biochemical properties of the residues. Therefore, this 12-amino acid region was
targeted for individual or cluster mutagenesis to alter the surface properties of this
region and study their effects on protein function. Deletion (aal7-aa28) and triple
aromatic (Y21, Y23, and F25 to L) mutants were completely defective in splicing
under low salt conditions, even at high protein concentrations (Figure 4-2). These
data confirm the prediction that aal7-aa28 is a critical region essential for Cbp2
function. However, it is important to show that these changes did not alter the
conformation and stability of mutant proteins. Unfortunately, Cbp2 has no known
function other than facilitating the processing of intron 5 (McGraw and Tzagoloff,
1983) and the co intron (Shaw and Lewin, 1997), unlike bi-functional RNA-
binding proteins like the mitochondrial tyrosyl tRNA synthetase (Cytl8) of
Neurospora crassa. Cytl8, in addition to its synthetase function, facilitates the
splicing of several mitochondrial group I introns (Akins and Lambowitz, 1987).
This bi-functionality of Cytl8 was exploited to demonstrate the native
conformation of splicing-defective mutants by assays for synthetase function

(Chemiack et al., 1990). Since our system does not afford this luxury, the
conformational integrity of the Cbp2 mutants was addressed using partial
proteolysis and equilibrium RNA binding assays.
Partial proteolysis is a simple and powerful tool to analyze the conformational
states and domain structure of proteins. It is based on the principle that protease-
susceptible sites often occur between independently folded domains. The potential
cleavage sites within these domains are protected from proteases in the native state
and exposed to various degrees in the denatured or partly unfolded states (Cleghon
andKlessig, 1992; Parker et al., 1998). Partial proteolysis has been successfully
used to study conformational changes in proteins induced by DNA binding (Chang
and Doi, 1993; Hay and Nicholson, 1993; Petersen et al., 1995; Ikeda et al., 1996)
or binding to a specific ligand (Vaisanen et al., 1997; Modarress et al., 1997; Chu
et al., 1997). This approach was also used to compare the conformation of wild-
type and mutant proteins in mutagenesis experiments to detect structural
perturbations, if any, caused by the mutations. For instance, Liu et al. (1996)
compared the folding patterns of several rhodopsin point mutants by partial tryptic
digests and CD spectroscopy. They found that changes in protein conformation
between wild-type and mutant proteins indicated by partial proteolysis were in
good agreement with the results of CD spectroscopy. Therefore, we utilized
partial proteolysis to probe the conformational states of wild-type and mutant Cbp2
proteins. The partial proteolytic profiles obtained with mutant Cbp2 proteins were
similar to that of the native but not the heat-denatured Cbp2 (Figure 4-3). These

results suggest that the deletion and triple aromatic mutants possess a
conformation similar to that of wild-type protein and yet lack some of the key
amino acid residues essential for Cbp2 function.
The formation of a functional Cbp2-intron 5 RNA complex requires proper
folding of RNA and an intact native conformation of protein. Filter-binding assays
with deletion and triple aromatic mutants exhibited hyperbolic RNA binding
patterns similar to that of wild-type Cbp2 (Figure 4-6B). Although the mutants
varied in their affinity for RNA (kd measurements in Table 4-3), their identical
binding profiles suggest that these proteins have a wild-type-like conformation that
allows interaction with cognate RNA (intron 5 RNA). However, as discussed
above, these two mutants did not promote splicing of intron 5 RNA under low salt
conditions. Together, these data suggest that the RNA binding property of Cbp2
(as detected by the filter binding assay) can be separated from its splicing-
enhancement function (as evidenced by the absence of spliced products under low
salt conditions). They also suggest that the RNA binding ability may not be
sufficient by itself to promote splicing at physiological concentrations of Mg
(employed in these experiments). The protein-RNA complex may have to attain a
particular active conformation (through specific contacts) before splicing can be
initiated. The salient features of the residues in aal7-aa28 region may enable this
In order to pinpoint the essentiality of individual residues in the aal7-aa28
region, a series of point mutations were made and characterized in vitro. Analysis

of these mutant proteins again emphasized the importance of the aromatic and
charged residues in this region. The triple charged mutant (R20, R22, K24 to L)
yielded a protein with partial activity in splicing assays (Figures 4-4 and 4-5), in
contrast to the triple aromatic mutant (Y21, Y23, and F25 to L), which was
completely defective in splicing (Figure 4-2). Therefore, the charged residues at
positions 20, 22 and 24 are important for Cbp2 function, though not as critical as
the aromatic residues at positions 21, 23, and 25.
Single mutations changing each aromatic residue to leucine gave contrasting
results. The Y21L mutant gave very low partial activity (with initial rates of
splicing lowered by 45-fold compared to wild-type, Table 4-2) while the F25L
mutant behaved almost like wild-type Cbp2 in the splicing time course
experiments (Figures 4-4 and 4-5). In addition, the Y21L and triple charged
mutations appear to have affected the first step of splicing, since the splicing
intermediates (5’ exon and intron-3’ exon) are markedly diminished compared to
the spliced products (ligated exons and free intron) (Figure 4-4B).
It is important to note that a single substitution in the case of the Y21L mutant
lowered the rate of splicing comparable to the triple charged mutant (40-fold
reduction, Table 4-2), emphasizing the indispensability of this tyrosine residue at
position 21 for splicing enhancement function. The importance of the Y21 residue
is also highlighted by the fact that the tyrosine to leucine change at this position
alone made a significant impact on the kd. A 5-fold increase in kd is quite
significant for a single amino acid change in this elongated protein of 630 amino

acids. The partial activity of Y21L could be due to the presence of the other
important residues in the aal7-aa28 region, partial compensation by the C-terminal
RNA binding domain, or both.
Cbp2 is reminiscent of proteins containing the double stranded RNA binding
motif (DSRM or dsRBM). DSRM is a conserved 65-68 amino acid region with
basic and hydrophobic residues scattered throughout the motif (St. Johnston et al.,
1992;Green and Mathews, 1992 and McCormack et al., 1992). A recent search
has identified about 44 dsRBM sequences from 27 functionally diverse proteins
(Kharrat et al., 1995). Mutational analysis indicates that nearly all of the
conserved residues are important for double-stranded RNA binding (Gatignol et
al., 1993, Gatignol et al., 1991). The DSRM motifs occur in single or multiple
copies in a protein and specifically bind double-stranded RNA in a sequence-
independent manner (Hunter et al., 1975). Studies on the human dsRNA-
dependent protein kinase, PKR, indicate that the specificity for dsRNA is largely
due to non-electrostatic interactions with a network of 2’-OH groups on both
strands of RNA (Bevilacqua and Cech, 1996). At physiological salt
concentrations, 90% of the free energy of binding is non-electrostatic owing to a
single ionic contact between K60, a conserved amino acid of DSRM, and the
phosphate backbone. Hydroxyl-radical footprinting experiments with PKR
indicate that the dsRBD interacts directly with the minor groove of dsRNA.
Minor-groove recognition has also been reported in the binding of tRNAAla by its
aminoacyl-tRNA synthetase protein (Musier-Forsyth and Schimmel, 1992). Cbp2

has hydrophobic and basic residues scattered throughout the length of the protein.
Hence, it is likely that different regions of this protein may participate in
sequence-independent recognition of the conserved intron structure, in addition to
engaging in specific interactions with the bases. Experiments with the triple
charged mutant of Cbp2 indicate that the charged residues are important but not
absolutely essential for activity, suggesting that these residues may not form
specific ion pairs with the phosphates of RNA. It is possible that Cbp2 might be
involved in a variety of non-specific interactions with the sugar-phosphate
backbone of intron 5 RNA. These might include non-electrostatic interactions
with 2’-OH groups of sugar residues or functional groups of bases.
Another motif that shares a few similarities with Cbp2 is the arginine-rich motif
(ARM) found in several viral, bacteriophage and ribosomal RNA-binding proteins.
There is very little identity between ARM sequences of different RNA-binding
proteins other than the preponderance of arginine residues (Lazinski et al., 1989).
For instance, the ARM regions of two HIV RNA-binding proteins, Tat and Rev are
dissimilar. Peptides containing the Rev ARM specifically bind RRE (Rev
responsive element) as an alpha helix (Tan et al., 1993) while Tat ARM peptides
are largely unstructured, but adopt a stable conformation upon binding the TAR
sequence (Calnan et al., 1991). Amino acids outside the conserved ARM regions
are important for in vitro RNA binding by Rev and Tat (Tan et al., 1993), as well
as for wild-type activity of other ARM proteins (Lazinski et al., 1989). Thus, the
overall structure of the ARM protein is important for RNA binding. Two general

roles have been attributed to the arginine residues of ARM proteins. The positive
charge of arginine may increase non-specific affinity for RNA, thereby facilitating
the search for high-affinity binding sites. A second role could be in the formation
of specific hydrogen bonds with the phosphoribose backbone and bases of RNA.
As two of the three basic residues in the putative N-terminal RNA binding region
(aal7-aa28) of Cbp2 are arginine residues, one or both of the above mentioned
roles may be important for Cbp2-RNA interactions. However, the partial splicing
activity of the triple charged mutant suggests that the net positive charge on Cbp2
may serve to bring the RNA molecule closer (by non-specific interactions),
allowing the search for specific, high affinity sites associated with other functional
groups on the protein. In addition, regions outside independent RNA-binding
domains may also contribute to total RNA binding (analogous to the ARM
proteins), as basic residues are scattered throughout the length of Cbp2.
The tyrosine residue at position 21 in Cbp2 appears to be indispensable for
activity, pointing to several possible roles in the stabilization of protein-RNA
interactions. The polar nature of the residue would allow polar interactions with
the phosphate backbone/bases of RNA, while the aromatic property would allow
stacking interactions with the bases. However, polar interactions may play a key
role in this context as additional polar amino acids such as serine (3 residues) and
asparagine flank this residue. The aromatic property, if essential, may be limited
to position 21, as phenylalanine (another aromatic residue) at position 25 is
dispensable for activity. The importance of having a polar/nonpolar, aromatic

residue at position 21 could be addressed by substitution with phenylalanine
(Y21F). A reduction in activity would suggest the existence of a polar interaction,
while no effect would argue for a stacking role of the Y21 residue. If this mutant
(Y21F) has the former phenotype, substitution of F21 with a polar residue like
serine or threonine should restore activity, proving the importance of a polar
residue at position 21. The importance of both polar and stacking interactions in
protein-RNA complexes has been documented in several systems. For instance,
crystal structure of the RNA bacteriophage MS2 coat protein complexed with its
RNA substrate (19-nucleotide stem-loop structure containing the initiation codon
of the replicase gene) shows that about 7 phosphates are involved in 11
interactions with the protein (Valegard et al., 1994). Of these, six are polar
interactions involving asparagine, serine or tyrosine, while a conserved tyrosine at
position 85 of MS2 protein (A subunit) is involved in stacking interactions with
the bases of RNA.
An offshoot of the mutational analyses has been an insight into the types of
interactions between Cbp2 and intron 5 RNA. Splicing experiments with
increasing concentrations of wild-type Cbp2 indicated that higher ratios of protein
to RNA were inhibitory (Figure 4-9). A similar inhibition was observed with the
deletion and triple aromatic mutants at total protein (wild-type + mutant) to RNA
ratios of 29:1 or above (Figure 4-8). Also, when the ratio of total Cbp2 (wild-type
+ mutant) to RNA was kept at or below 7:1, there was no inhibition of wild-type-
mediated splicing (Figure 4-11) by these mutant proteins. These results indicate

that the observed inhibition was not a property of the mutant proteins, but a
function of the ratio of total Cbp2 to RNA. It is important to note that the protein
to RNA ratios (below 30:1) that stimulated splicing corresponded to the linear
range of RNA binding profiles measured by filter binding assays (Figure 4-6B).
Thus, Cbp2 concentrations corresponding to submaximal RNA binding appear to
be important for specific, productive interactions between RNA and protein.
RNA-binding proteins, such as Cyt-18 of Neurospora crassa, have been
observed to engage in non-specific interactions with RNA in vitro (Saldanha et ai,
1996). These non-specific interactions were reduced by the addition of an RNA
mimetic like heparin. In order to test if the inhibitory effects of higher Cbp2
concentrations could also be overcome by a non-specific competitor, splicing
experiments were performed with wild-type protein at an inhibitory ratio of 29:1,
but in the presence of excess tRNA. Splicing activity was almost completely
rescued with the addition of tRNA (Figures 4-10A and 4-1 OB), demonstrating that
counteracting the non-specific interactions could alleviate the inhibition of
There are at least two instances in the literature where similar phenomena were
observed. Nucleocapsid protein (NC) of HIV-1, a non-specific RNA-binding
protein, enhances the activity of a hammerhead ribozyme (HH16) in vitro only in a
narrow range of protein concentrations (Herschlag et al., 1994). The observed rate
constant for single turnover reactions showed an increase followed by a decrease
with increasing NC protein concentration. Protein concentrations higher than that

required for stimulating multiple turnover decreased the rate of reaction. Though
the trends observed were reproducible, the exact concentration of NC protein
required for stimulation and inhibition varied with the experiment. Addition of
intermediate concentrations of the non-specific competitor, ssDNA, to reactions
containing an inhibitory NC concentration stimulated multiple turnover. Further
experiments demonstrated that NC protein, at higher concentrations, shuts down
RNA function by binding to the ribozyme-substrate complex and blocking the
cleavage step. Thus, high concentrations of NC protein appear to bind more
strongly to the denatured or inactive rather than the active conformation of the
hammerhead catalytic core.
The hnRNP proteins such as hnRNPA 1, C1, and U have been shown to
promote annealing between complementary single strands of RNA in vitro (Kumar
and Wilson, 1990; Portman and Dreyfuss, 1994). Interestingly, the RNA
annealing activity is reduced or abolished at high proteimRNA ratios (Munroe and
Dong, 1992; Portman and Dreyfuss, 1994). Portman and Dreyfuss (1994)
proposed that excess protein may inhibit annealing by stabilizing the single
strands, sterically blocking RNA base-pairing and/or squelching sites required for
protein-protein interactions involved in RNA annealing.
Analogous to the above systems, it is possible that Cbp2, at high protein to
RNA ratios, shuts down splicing by binding to alternate sites on intron 5 RNA and
stabilizing an inactive conformation. However, in the range of protein
concentrations that stimulate splicing (proteimRNA ratios of 14:1 or below), this

non-specific RNA binding may be necessary to promote the formation of the active
intron structure and facilitate splicing. Thus, Cbp2 appears to engage in both non¬
specific and specific interactions with intron 5 RNA. UV-crosslinking monitors
the interaction between closely apposed functional groups in RNP complexes, with
the extent of crosslinking representing the extent of specific interactions. Filter
binding analysis, on the other hand, determines the general RNA binding profiles
of proteins, emphasizing the non-specific interactions.
Certain mutations in the N-terminal crosslink site of Cbp2 (first 37 residues)
not only affected splicing but also lowered the extent of crosslinking to intron 5
RNA. For instance, triple charged and Y21L mutant Cbp2 proteins with partial
splicing activity showed low levels of crosslinking (Figure 4-7). Thus, the
crosslink sites on Cbp2 appear to reflect productive interactions in the RNP
complex that lead to correct folding and splicing of intron 5 RNA. Shaw and
Lewin (1995) have identified the nucleotides of intron 5 RNA that crosslink to
Cbp2 at protein:RNA ratios that promote splicing. These include specific
pyrimidine residues in the catalytic core (P4-P6, P3-P7) and in the peripheral
domains (P2) of the secondary structure. Mutagenesis of some of these crosslink
sites in intron 5 RNA also affected protein-mediated splicing (Shaw and Lewin,
unpublished observations), suggesting again that crosslink sites represent specific
contact sites important for catalysis.
At protein:RNA ratios that promote splicing, non-specific interactions may
precede the formation of specific contacts between Cbp2 and intron 5 RNA that

lead to catalysis. At high protein concentrations, however, non-specific
interactions may predominate and preclude the formation of specific contacts that
are essential for promoting the catalytic conformation of RNA. It can be
speculated that the charged residues on Cbp2 may, in part, be important for these
initial, non-specific encounters, while aromatic residues (such as Y21) may be
involved in making specific contacts with intron 5 RNA.
In summary, UV-crosslinking and site-directed mutagenesis has identified a 12
amino acid (aal7-SSSRYRYKFNME-aa28) region in the N-terminus of Cbp2 to
be very critical for Cbp2 function. It is interesting to note that the first 44 N-
terminal amino acid residues of Cbp2 in S. cerevisiae and S. douglasii are identical
(Li et al., 1996) and are typical of mitochondrial matrix targeting sequences, being
rich in hydroxylated and basic residues with a few acidic residues (von Heijne,
1986). However, the presequence of Cbp2 is not cleaved after import into S.
cerevisiae mitochondria (Lewin, unpublished observations). It is tempting to
speculate that the indispensability of the N-terminal residues for Cbp2 function
could have been the evolutionary' rationale for retainment of the mitochondrial
presequence after import. We have not determined, however, if the mitochondrial
targeting sequence of Cbp2 lies in this region.

Biological processes such as RNA splicing, RNA processing, and translation
require the interplay between RNA and proteins. There is substantial evidence that
the essential active site structures for these ribonucleoprotein (RNP) enzymes are
provided by the folded RNA itself (Guerrier Takada et al., 1983; Madhani and
Guthrie, 1992; Myers et al., 1996; Noller et al., 1992). The protein component of
these RNPs may facilitate RNA catalysis by stabilizing the active RNA structure
(Saldanha et al., 1996; Shaw and Lewin, 1995; Weeks and Cech, 1996), increasing
affinity for substrate (Kurz et al., 1998), or regulating activity of the RNP complex
(Mogridge et al., 1998). Although many group I introns have been shown to self-
splice in vitro, most, if not all, require protein factors for efficient splicing in vivo.
Self-splicing in vitro requires unusually high Mg2+ concentrations for optimal
activity (Hicke et al., 1989; Jaeger et al., 1991; Partono and Lewin, 1988, Partono
and Lewin, 1991), and involves complex reaction kinetics that often result in lower
reaction rates (Bass and Cech, 1984; van der Horst and Tabak, 1985; Pan et al.,
1997). The self splicing rate of the prototypic Tetrahymena ribozyme, for
example, is 20 times lower at physiological Mg concentrations in vitro compared
to that in vivo (Brehm and Cech, 1983), suggesting the requirement of protein co¬
factors for efficient splicing in the cell.

The Cbp2-intron 5 RNP complex of Saccharomyces cerevisiae represents a
simple but valuable one protein-one RNA system to gain insights into RNA-
protein interactions. The RNA component (intron 5) is the terminal intron of the
mitochondrial cytochrome b (COB) pre-mRNA, while the protein component
(Cbp2) is nucleus-encoded and is essential for the splicing of intron 5 in vivo (Hill
et al., 1985; McGraw and Tzagoloff, 1983), or at physiological magnesium
concentrations in vitro (Gampel et al., 1989; Lewin et al., 1995; Weeks and Cech,
The current study represents the first attempt at mapping intron 5 RNA binding
sites on Cbp2. The UV-crosslinking strategy of Zamore and Green (1989) was
employed to map the amino acid residues on Cbp2 that intimately contact intron 5
RNA. Briefly, protein-RNA complexes generated under low salt splicing
conditions were immobilized with UV light and the crosslink sites on Cbp2 were
identified by indirect label transfer to peptides generated by two cleavage reagents,
hydroxylamine (NH2OH) and 2-nitro-5-thiocyanobenzoate (NTCB).
Hydroxylamine was the ideal reagent to obtain an initial handle on Cbp2 sites
contacting intron 5 RNA, since it is specific to the relatively infrequent
asparaginyl-glycyl peptide bond (Bornstein and Balian, 1977) and yields fewer
peptide fragments. Strong crosslink sites mapped to a 24 kDa N-terminal peptide
(aal-179aa) and a 15 kDa C-terminal fragment (aa502-63Oaa), showing that the
termini of Cbp2 comprise important RNA binding domains. However, the 37 kDa
central fragment (aal 80-50 laa) displayed very weak crosslinking. The central

region may be comprised of weaker binding sites that may be important for the
overall stabilization of the RNP complex. The importance of such weak RNA
binding domains in protein-RNA interactions is exemplified by the glutaminyl-
tRNA synthetase of Saccharomyces cerevisiae. This protein carries a novel and
dispensable N-terminal domain in addition to its active RNA binding site, which is
closely homologous to its Eschericia coli counterpart. Although the bacterial
synthetase is not capable of charging yeast tRNAelu, addition of the appended
domain of the yeast protein confers specificity to yeast tRNAglu (Whelihan and
Schimmel, 1997). This suggests that the appended domain may engage in an
additional RNA interaction that compensates for poor complex-formation by the
native bacterial enzyme. In eukaryotes, such appended domains are common in
these proteins and may serve to overcome conditions that would otherwise weaken
or disrupt the formation of a critical RNA-protein complex (Whelihan and
Schimmel, 1997).
In order to refine the mapping of the crosslink sites identified in the terminal
fragments, 2-nitro-5-thiocyanobenzoate (NTCB), specific to cysteines (Jacobson et
al, 1973; Degani and Patchornik, 1974), was employed as cleavage with this
reagent generates several peptides within the termini of Cbp2. The availability of
his-tagged and native versions of Cbp2 was exploited to unambiguously map the
N-terminal contact site to the first 37 amino acid residues of Cbp2 by NTCB
cleavage (Figure 3-3). The C-terminal contact site was tentatively mapped to a
region spanning aa502-582aa, as the extreme C-terminal fragment failed to

crosslink intron 5 RNA. Attempts to pinpoint the RNA contact sites in this 80
amino acid-region were not successful as the peptides generated by a combination
of NH2OH and cyanogen bromide were too small to be resolved by the tris-tricine
gel system. The use of HPLC or mass spectrometry to resolve these smaller
crosslinked peptides will alleviate this problem and lead to the identification of the
specific C-terminal residues that crosslink to intron 5 RNA. Thus, the results of
the study have led to the identification of key amino acid residues in the N-
terminus that are critical for Cbp2 function. Fine structure mapping of these RNA
contact sites using other cleavage reagents will eventually lead to a better
understanding of the mechanisms underlying Cbp2-intron 5 RNA interactions.
It is interesting to note that the two strong RNA contact sites identified by UV-
crosslinking (current study) are distally located at the N- and C-termini of Cbp2. It
is possible that these terminal regions contact important elements of the intron that
are widely separated in the secondary structure and stabilize the active intron
structure. This, in fact, seems to be the case. Chemical modification and UV-
crosslinking studies of the Cbp2-intron 5 RNA complex show that Cbp2 makes
intimate contacts in multiple regions of the RNA such as PI, L2, P4, and P6a of
intron 5 RNA (Shaw and Lewin, 1995). In addition, Cbp2 appears to bind across
P8, sandwiching PI-P2 between P8 and the rest of the core (Weeks and Cech,
1995). Thus, Cbp2 protein appears to bind one face of intron 5 RNA with an
estimated distance of 90Á between the protected regions. This distance, in theory,
can be readily spanned by the 630aa-long Cbp2 protein (Weeks and Cech, 1995b).

The importance of N-terminal residues (aal-37aa identified by UV-
crosslinking) for Cbp2 function was further investigated by site-directed
mutagenesis. A potential RNA binding region (aal7-SSSRYRYKFNME-aa28),
identified by physical scanning of the first 37 residues of Cbp2, was targeted for
single and cluster mutagenesis. Deletion of this 12 amino acid region (aal7-aa28)
in the N-terminus produced a mutant protein that failed to exhibit any detectable
splicing activity but retained a near native conformation (as confirmed by partial
tryptic profiles). This demonstrated that the 12-amino acid region (aal7-
SSSRYRYKFNME-aa28) in the N-terminus was indispensable for Cbp2 function.
The 12 amino acid-long RNA contact site identified by deletion analysis was
probed further to evaluate the importance of individual amino acid residues for
Cbp2-RNA interactions. This RNA binding region contains three aromatic
residues that alternate with three charged residues. It was hypothesized that
removing the aromatic residues would have more drastic effects on Cbp2 function
compared to charged residues, as the former often engage in contacts that are more
intimate with RNA by stacking with the bases. A triple aromatic mutant (Y21, Y23,
and F25 to leucine) and a triple charged mutant (R20, R22 and K24 to leucine) were
constructed to test this hypothesis. Leucine was chosen to substitute these residues
because of similar chain lengths. This would allow surface properties to be altered
with minimal perturbation of the topology of mutant proteins. As expected, the
triple aromatic mutant completely abrogated Cbp2 function, while the triple
charged mutant displayed partial activity with an initial rate of splicing ~40-fold

lower than that of wild-type protein. Since the triple aromatic mutant was
completely defective in splicing, the aromatic residues Y21, Y23, and F25 were
independently substituted with leucine to evaluate the contribution of each residue
for Cbp2 function. The single mutation changing Y21 to leucine lowered the
splicing rate by ~45-fold compared to wild-type Cbp2 (similar to the triple charged
mutant). However, the mutation converting F25 to leucine did not affect splicing.
The Y23L mutant could not be characterized due to repeated co-purification with
nuclease activity. Thus, among the three aromatic residues, a tyrosine at position
21 was found to be essential for Cbp2 function while a phenylalanine at position
23 may be dispensable.
In the time-course experiments with triple charged and Y21L mutants, a marked
reduction in splicing intermediates (5’ exon and intron-3’ exon) was observed,
suggesting that these mutations reduce the rate of the first step of splicing. Thus,
guanosine binding or an important conformational step prior to the nucleophilic
attack of guanosine at the 5’ intron-exon boundary could be rate limiting for these
mutants. Of these two possibilities, inefficient docking of PI in the catalytic core
(conformational step) may be responsible for slowing the first step of splicing, as
Cbp2 has been shown to promote this tertiary interaction in intron 5 RNA by
dimethyl sulfate modification studies (Weeks and Cech, 1995). Similar studies of
intron 5 RNA in the presence of either of these mutants can verify this hypothesis.
If proven true, residues R20, R22, K24, and Y21 would be implicated in PI docking,
an important tertiary interaction that precedes RNA splicing.

The panel of mutants described above was also characterized for RNA binding
by equilibrium filter binding assays (Wong and Lohman, 1993). The general RNA
binding profiles of all mutant proteins were more or less comparable to that of
wild-type Cbp2, indicating little or no perturbation of the native conformation of
these proteins. However, the dissociation constants of mutant proteins were found
to be variable. For example, the Y21L mutant, with partial splicing activity,
showed reduced RNA binding (5-fold increase in kd), while the splicing defective
deletion mutant showed tighter binding (~2-fold decrease in kd). Thus, there
appears to be no correlation between the general RNA binding activity of mutants
and their ability to support splicing. Therefore, general RNA binding ability (a
common feature of both the wild-type and mutant proteins) may not be sufficient
to stimulate splicing, while specific interactions between the active groups on
Cbp2 and intron 5 RNA, which may be important for stimulation of catalysis, may
not have a large impact on general binding.
The generalized RNA binding activity exhibited by both mutant and wild-type
proteins was characterized further by performing splicing assays at a wide range of
protein to RNA ratios. Interestingly, wild-type Cbp2 was found to facilitate intron
5 RNA splicing only in a narrow range of proteimRNA molar ratios (below 30:1).
Splicing was stimulated when the proteimRNA ratio was increased from 1:1
through 7:1 or 14:1, while ratios of 28:1 caused a 5-fold inhibition of splicing,
with higher ratios being completely inhibitory. Addition of a non-specific

competitor such as tRNA to a partially inhibited reaction (at 29:1 ratios)
completely alleviated this inhibition, suggesting that non-specific interations may
predominate at higher protein concentrations, preventing the formation of a
productive RNP complex.
RNA has two fundamental folding problems: a tendency to become kinetically
trapped in alternative conformations, and a difficulty in specifying a single tertiary
structure that is thermodynamically favored over competing structures (Herschlag,
1995). Non-specific RNA-binding proteins solve the kinetic problem by acting as
RNA chaperones that either prevent misfolding or resolve misfolded RNA in vivo
(Munroe and Dong, 1992). On the other hand, specific RNA-binding proteins
overcome the thermodynamic folding problem by stabilizing a specific tertiary
structure (Weeks and Cech, 1996). Such proteins can also have RNA chaperone¬
like activities (non-specific binding) that help prevent misfolding of their cognate
RNAs (Herschlag, 1995).
An investigation of Mg -dependent folding of the Tetrahymena ribozyme,
revealed that this large RNA partitions into a population that rapidly reaches the
native state and a slow-folding population that is trapped in metastable, misfolded
structures. Transition from this misfolded to the native state involves partial
unfolding. Thus, folding of large RNA molecules appears to involve multiple
parallel pathways, with non-native intermediates dominating the folding kinetics
(Pan et ah, 1997). Hydroxyl radical footprinting of Tetrahymena ribozyme using a
synchrotron x-ray beam enabled the study of RNA folding at millisecond intervals

(Sclavi et ai, 1998). The study revealed that P4-P6, the most stable domain of the
tertiary structure, folds within 3 seconds, while complete folding of the catalytic
center takes minutes, suggesting that P3-P9 (another major domain of the catalytic
core) remains disordered until late in the folding process.
An alternate kinetic barrier to Mg -dependent folding of Tetrahymena
ribozyme was concurrently proposed by Treiber et al. (1998). In vitro selection
was employed to identify mutant ribozymes with accelerated folding of the P3-P7
domain. Mutations that increased the rate of P3-P7 formation were found to
destabilize the P4-P6 domain, suggesting that the latter may serve as a native
kinetic trap in Tetrahymena ribozyme folding. The authors proposed that kinetic
traps stabilized by native interactions, in addition to misfolded non-native
structures, can present a substantial barrier to RNA folding.
Analogous to the Tetrahymena ribozyme, the self-splicing of intron 5 RNA is
not efficient. The rate of self-splicing is estimated to be 1000-fold slower than that
of Cbp2-facilitated reaction at physiological pH and Mg2+ concentrations (Weeks
and Cech, 1995a). At saturating Mg concentrations (40 mM), self-splicing is 8-
fold slower than the protein-facilitated reaction, suggesting that high Mg
concentrations cannot completely compensate for Cbp2 function. It was proposed
that transition from an intermediate to the active enzyme state could pose a
potential barrier for self-splicing. Subsequently, chemical modification studies by
Weeks and Cech (1995b) indicated that the slow rate of self-splicing was due to
the formation of a partially folded structural intermediate in which the catalytic

core was formed but the 5’ domain (PI) was not docked. Based on these and other
studies, it was proposed that Cbp2 facilitates splicing by assembling pre-formed
RNA secondary structure elements into a specific three-dimensional array
(formation of catalytic core and PI docking) (Weeks and Cech, 1995a; 1995b), and
serves primarily to capture otherwise transient RNA tertiary structures (Weeks and
Cech, 1996). However, Shaw and Lewin (1995), based on chemical and
enzymatic modification studies, reported that Cbp2 facilitates the formation of
secondary structures in addition to stimulating tertiary interactions. They also
found that Cbp2 can nucleate the formation of the catalytic core in the absence of
Mg by promoting duplex formation within P4/P6 and P1/P2, with Mg addition
leading to rapid catalytic activation of this folding intermediate (Shaw and Lewin,
manuscript in preparation). Thus, there are mechanistic gaps in our current
understanding of the various roles attributed to Cbp2, making the global picture
perplexing. The results of the current study provide interesting perspectives to
accommodate the observed pleiotropic effects of Cbp2 on the processing of intron
5 RNA, as discussed below.
The E.coli S12 ribosomal protein facilitates proper folding of group I introns
from bacteriophage T4 by nonspecific binding, suggesting a second mechanism for
stimulation of group I intron splicing in vivo (Coetzee et al., 1994; Herschlag,
1995). The S12 protein does not preferentially bind to group I introns over exons
or other RNAs, indicating that splicing is facilitated by a nonspecific mode of
action rather than by specific stabilization of the catalytic core. The protein can

also facilitate an unrelated reaction such as catalysis of a hammerhead ribozyme
(HH16) (Coetzee et al., 1994), similar to the two widely studied RNA chaperones,
the nucleocapsid protein (NC) of HIV-1 and the hnRNP Al protein. S12 can also
promote the splicing of kinetically trapped, inactive precursor RNA, suggesting an
ability to resolve misfolded RNA structures analogous to RNA chaperones.
Finally, S12 protein stimulates group I intron self-splicing even after removal by
proteolysis prior to the initiation of splicing, further confirming that the protein is
solely required for folding, similar to a protein chaperone that functions solely
during a folding step and is not present in the final active species.
The ability of S12 ribosomal protein to act as an RNA chaperone in the folding
of group I introns in vitro raises the interesting possibility that a chaperone-like
activity in specific RNA-binding proteins could also solve the kinetic problems of
RNA folding. Based on this idea, Herschlag (1995) proposed that specific RNA-
binding proteins could overcome the kinetic problems of RNA folding by
following a “preassociation” binding mechanism. According to this, the protein
initially engages in nonspecific and/ or a subset of specific interactions to bind the
unfolded RNA and prevent misfolding. Subsequently, the RNA structure
undergoes conformational rearrangements within the complex via multiple
dissociations and associations until the correct conformation is attained and
trapped by specific interactions with the protein. The high levels of nonspecific
binding exhibited by some specific RNA-binding proteins like the Cyt-18 protein

of Neurospora (Saldanha et al., 1996) or the Cbp2 protein (this study) could reflect
this chaperone activity.
Equilibrium binding studies show that Cbp2 fails to discriminate between
cognate (intron 5) and non-cognate (nrdB intron) RNAs at low Mg
concentrations (5 mM), suggesting that the protein may either possess a strong
generalized RNA binding ability or may recognize, in part, features conserved
among group I introns (Weeks and Cech, 1995a). Equilibrium filter binding
analysis of wild-type and splicing-defective Cbp2 mutants revealed more or less
comparable RNA binding profiles, demonstrating that Cbp2 possesses substantial
non-specific or generalized RNA binding ability, and that mutations disrupting the
splicing-enhancement function do not affect this property (Figure 4-6). This non-
specific RNA binding displayed by Cbp2 at physiological Mg concentrations
suggests that the protein may engage in a chaperone-like activity in vivo.
Cbp2 stimulates intron 5 RNA splicing only in a narrow range of protein:RNA
ratios, with severe inhibition of splicing activity at higher concentrations of
protein. Addition of a non-specific competitor like tRNA alleviates this inhibition
(Figure 4-10). Inhibition of RNA function at higher protein concentrations has
been reported for RNA chaperones such as hnRNP Al, Cl, U (Munroe and Dong,
1992; Portman and Dreyfuss, 1994) and the nucleocapsid (NC) protein of EflV-1
(Herschlag et al., 1994). In the case of hnRNP Al, inhibition of RNA annealing
activity by excess protein was speculated to arise from the stabilization of single
strands (Portman and Dreyfuss, 1994). For the NC protein, the inhibition of

hammerhead (HH16) catalysis was shown to result from protein binding to the
ribozyme-substrate complex, blocking the cleavage step. Also, the inhibition
observed with excess NC protein could be alleviated by the addition of ssDNA, a
non-specific competitor (Herschlag et al., 1994). Thus, high concentrations of
these proteins appear to bind more strongly to a denatured or inactive
conformation rather than the active conformation of RNA, shutting down RNA
function. Similarly, Cbp2 might stabilize misfolded rather than native
conformations of intron 5 RNA at high protein:RNA ratios, inhibiting splicing.
Modification studies at high protein:RNA ratios would verify this hypothesis, as
the protection patterns of misfolded RNA would be different from the correctly
folded conformation obtained at low protein:RNA ratios that are optimal for
splicing (Shaw and Lewin, 1995).
RNA chaperones, as mentioned earlier, aid in the process of RNA folding by
preventing misfolding or by resolving misfolded species. For example, UP1, the
N-terminal fragment of hnRNP Al, was shown to renature 5S RNA and several
tRNAs that were kinetically trapped in alternate conformations (Karpel et al.,
1974, 1982). Similarly, NC protein of HIV-1 was shown to resolve a kinetically
trapped, misfolded hammerhead ribozyme complex (Bertrand and Rossi, 1994;
Herschlag et al., 1994; Muller et al., 1994; Tsuchihashi et al., 1993). The Cbp2
protein also appears to resolve RNA structures that are kinetically trapped in
misfolded conformations. Weeks and Cech (1995b) reported the formation of a
promiscuous, inactive RNA structure (monitored by a UV-crosslink between the

core and 3’exon) at low Mg that was destabilized in the presence of Cbp2 and/or
higher concentrations of Mg . Also, Shaw and Lewin (manuscript in preparation)
observed that pre-incubation of intron 5 RNA with Cbp2 followed by addition of
Mg2+ (5mM) and GTP resulted in immediate onset of splicing. On the other hand,
pre-incubation with Mg followed by addition of Cbp2 and GTP caused a lag in
splicing. This lag may result from formation of misfolded RNA structures at low
Mg2+ that may have to be resolved by Cbp2 before splicing can occur. In addition,
Cbp2, when present during transcription of intron 5 RNA, can mitigate the effects
of certain RNA mutations that cannot be rescued by addition of protein after
transcription (Lewin et al., 1995; Shaw et al., 1996). Thus, during co-
transcriptional splicing, Cbp2 appears to bind to nascent transcripts and help bias
the RNA to fold correctly.
The recent finding that the P4-P6 domain acts as a native kinetic trap for the
Mg -dependent folding of the Tetrahymena ribozyme, slowing the folding of the
P3-P7 domain (Trieber et al., 1998), raises the interesting possibility that
stabilization of P4-P6 domain serves as a means to ensure correct RNA folding.
RNA-binding proteins that stabilize P4-P6 domain may serve a similar purpose.
The Cytl8 protein of Neurospora crassa, which promotes the splicing of several
mitochondrial group I introns, has been shown to bind and stabilize the P4-P6
domain of its cognate RNA (Saldanha et al., 1996). Similarly, the Cbp2 protein of
S. cerevisiae has been to shown to make intimate contacts in the P4-P6 domain of
intron 5 RNA (Shaw and Lewin, 1995), and stabilize this domain even in the

absence of Mg (Shaw and Lewin, manuscript in preparation). Though the Cyt-
18 and Cbp2 proteins are specific RNA-binding proteins that promote splicing of
only cognate RNAs, they exhibit substantial non-specific RNA binding activity
(Saldanha et al., 1996; current study), a property of RNA chaperones. RNA
chaperones are known to aid in correct RNA folding by preventing or slowing the
formation of certain misfolded intramolecular structures (Herschlag, 1995). It is
therefore interesting to speculate that RNA-binding proteins such as Cbp2 (and
perhaps Cyt-18), which stabilize the formation of the P4-P6 domain, may also slow
the folding of the rest of the molecule as a means to facilitate correct RNA folding,
preventing the formation of misfolded structures.
After Cbp2 facilitates the formation of the catalytic structure of intron 5 RNA
(in the presence of Mg ), the protein can be removed by proteinase K digestion
prior to the initiation of splicing without significant reduction in catalytic activity
(Shaw and Lewin, manuscript in preparation). This suggests that Cbp2 is solely
required for folding, similar to the S12 ribosomal protein of E. coli, an RNA
chaperone. RNA chaperones may stay bound to correctly folded RNA after
exerting their chaperone activity due to the strength of non-specific RNA-protein
interactions, serving additional specific roles (Herschlag et al., 1994). For
example, the nucleocapsid (NC) protein of HIV-1, an RNA chaperone, enhances
catalysis of the hammerhead ribozyme (HH16) by not only increasing the rate of
annealing of the ribozyme-substrate complex, but also by stimulating the rate of
dissociation of the products (Herschlag et al., 1994). In the case of Cbp2, there is

evidence that the protein may remain bound to the splicing intermediates during
catalysis. Organic extraction of proteinase K treated splicing reactions (described
above) resulted in selective removal of the unspliced precursor and splicing
intermediates (5’ exon and intron-3’ exon) from the aqueous phase, while the
spliced products (ligated exons and free intron) remained in the aqueous phase
(Shaw and Lewin, manuscript in preparation). Mei and Herschlag (1996)
proposed that the release of ligated exons in vivo for the Tetrahymena group I
intron reaction could be accomplished by changes in RNA structure brought about
by either features intrinsic to the intron or cellular components such as RNA
chaperones. Association of Cbp2 protein with the splicing intermediates during
catalysis suggests that this protein could have an additional role in the dissociation
of spliced products besides facilitating correct RNA folding.
Thus, Cbp2 appears to have multiple roles in the facilitation of intron 5 RNA
catalysis. The non-specific RNA binding or chaperone activity of Cbp2 may solve
various kinetic problems of RNA folding, ensuring correct folding of intron 5
RNA. The specific RNA binding activity of the protein can overcome the
thermodynamic problem of RNA folding by stabilizing the catalytic conformation
of RNA. In addition, Cbp2 may have a specific role in dissociation of the spliced
products. Various steps in the protein-facilitated splicing of intron 5 RNA can be
visualized as follows: Cbp2 may bind to the unfolded or nascent RNA and promote
correct RNA folding by employing weak, non-specific and/or a subset of specific
interactions. Charged residues in the protein (such as R20, R22, and K24) may

contribute to this non-specific RNA binding component. The correctly folded
RNA may then access high affinity sites (such as the tyrosine residue at position
21) on the Cbp2 protein through specific interactions, leading to stabilization of
the catalytic structure and RNA splicing.
From an evolutionary viewpoint, RNA chaperones might have evolved to
rescue RNA molecules from kinetic traps and help them explore structural
alternatives. These non-specific RNA-binding proteins subsequently might have
acquired binding preferences (via cooperation between RNA and proteins) and
evolved into specific RNA-binding proteins. For example, hnRNP A1 protein,
which has RNA chaperone activity (Herschlag et al., 1994; Portman and Drey fuss,
1994; Bertrand and Rossi, 1994), appears to have acquired a specific role in splice
site selection (Caceres et ah, 1994). The NC protein of HIV-1 has chaperone
activity and appears to bind specifically to viral RNA during packaging
(Tsuchihashi et al., 1994).
Proteins involved in group I intron splicing might have evolved from pre¬
existing RNA-binding proteins (Akins and Lambowitz, 1987; Lambowitz and
Perlman, 1990), as complex catalytic RNAs also appear to have originated from
pre-existing structured RNAs (e.g., tRNAs or rRNAs). The tyrosyl tRNA
synthetase (Cyt-18) of N. crassa, which also facilitates the splicing of several
group I introns, might have acquired this property relatively later in evolution by
recognizing a conserved tRNA-like structure in group I introns (Caprara et al,
1996). Since intron 5 RNA is also a group I intron, it is likely that Cbp2

recognizes a similar tRNA-like structural motif in its cognate RNA. It is tempting
to speculate that the generalized RNA binding activity common to these two
proteins (Cyt-18 and Cbp2) may contribute to recognition of this conserved
structural feature of group I introns, while the specific RNA binding ability may
limit splicing enhancement to their cognate RNA partners. It is also interesting to
note that these proteins retained their ancestral chaperone-like activity even after
evolving into specific RNA-binding proteins, perhaps to their added advantage in
solving various kinetic problems of RNA folding.

Akins, R. A., and A. M. Lambowitz. 1987. A protein required for splicing group I
introns in Neurospora mitochondria is mitochondrial tyrosyl-tRNA synthetase or a
derivative thereof. Cell 50:331-345.
Ansel McKinney, P., S. W. Scott, M. Swanson, X. Ge, and L. Gehrke. 1996. A
plant viral coat protein RNA binding consensus sequence contains a crucial
arginine [published erratum appears in EMBO J 1996 Dec 16; 15(24):7188-9].
EMBOJ 15:5077-5084.
Banroques, J., A. Delahodde, and C. Jacq. 1986. A mitochondrial RNA maturase
gene transferred to the yeast nucleus can control mitochondrial mRNA splicing.
Cell 46:837-844.
Bass, B. L., and T. R. Cech. 1984. Specific interaction between the self-splicing
RNA of Tetrahymena and its guanosine substrate: implications for biological
catalysis by RNA. Nature 308:820-826.
Beavis, R. C., and B. T. Chait. 1990. Rapid, sensitive analysis of protein mixtures
by mass spectrometry. Proc Natl Acad Sci USA 87:6873-6877.
Been, M. D., and T. R. Cech. 1988. RNA as an RNA polymerase: net elongation
of an RNA primer catalyzed by the Tetrahymena ribozyme. Science 239:1412-
Belfort, M., and P. S. Perlman. 1995. Mechanisms of intron mobility. J Biol
Chem 270:30237-30240.
Bell Pedersen, D., S. Quirk, J. Clyman, and M. Belfort. 1990. Intron mobility in
phage T4 is dependent upon a distinctive class of endonucleases and independent
of DNA sequences encoding the intron core: mechanistic and evolutionary
implications. Nucleic Acids Res 18:3763-3770.
Benner, S. A., A. D. Ellington, and A. Tauer. 1989. Modem metabolism as a
palimpsest of the RNA world. Proc Natl Acad Sci U S A 86:7054-7058.

Bevilacqua, P. C., and T. R. Cech. 1996. Minor-groove recognition of double-
stranded RNA by the double-stranded RNA-binding domain from the RNA-
activated protein kinase PKR. Biochemistry 35:9983-9994.
Bomstein, P. 1977. Cleavage at asn-gly bonds with hydroxylamine. Methods
Enzymol 78:132-145.
Brehm, S. L., and T. R. Cech. 1983. Fate of an intervening sequence ribonucleic
acid: excision and cyclization of the Tetrahymena ribosomal ribonucleic acid
intervening sequence in vivo. Biochemistry 22:2390-2397.
Burd, C. G., and G. Dreyfuss. 1994. Conserved structures and diversity of
functions of RNA-binding proteins. Science 265:615-621.
Burke, J. M. 1988. Molecular genetics of group I introns: RNA structures and
protein factors required for splicing—a review. Gene 73:273-294.
Byrk, M., and J. E. Mueller. 1996. In: Ribosomal RNA and Group I introns (R.
Green, and R. Schroeder. ed.), Landes, R. J. (Austin, TX), pp. 221-241.
Calnan, B. J., S. Biancalana, D. Hudson, and A. D. Frankel. 1991. Analysis of
arginine-rich peptides from the HIV Tat protein reveals unusual features of RNA-
protein recognition. Genes Dev 5:201-210.
Caprara, M. G., V. Lehnert, A. M. Lambowitz, and E. Westhof. 1996. A tyrosyl-
tRNA synthetase recognizes a conserved tRNA-like structural motif in the group I
intron catalytic core. Cell 87:1 135-1145.
Carignani, G., O. Groudinsky, D. Frezza, E. Schiavon, E. Bergantino, and P. P.
Slonimski. 1983. An mRNA maturase is encoded by the first intron of the
mitochondrial gene for the subunit I of cytochrome oxidase in S. cerevisiae. Cell
Cate, J. H., and J. A. Doudna. 1996. Metal-binding sites in the major groove of a
large ribozyme domain. Structure 4:1221-1229.
Cate, J. H., A. R. Gooding, E. Podell, K. Zhou, B. L. Golden, A. A. Szewczak, C.
E. Kundrot, T. R. Cech, and J. A. Doudna. 1996. RNA tertiary structure
mediation by adenosine platforms. Science 273:1696-1699.

Cech, T. R. 1987. The chemistry of self-splicing RNA and RNA enzymes.
Science 236:1532-1539.
Cech, T. R. 1988. Conserved sequences and structures of group I introns:
building an active site for RNA catalysis—a review. Gene 73:259-271.
Cech, T. R. 1990. Self-splicing of group I introns. Annu Rev Biochem 59:543-
Cech, T. R. 1985. Self-splicing RNA: implications for evolution. IntRevCytol
Cech, T. R., S. H. Damberger, and R. R. Gutell. 1994. Representation of the
secondary and tertiary structure of group I introns. Nat Struct Biol 1:273-280.
Chait, B. T., R. Wang, R. C. Beavis, and S. B. Kent. 1993. Protein ladder
sequencing. Science 262:89-92.
Chang, B. Y., and R. H. Doi. 1993. Conformational properties of Bacillus subtilis
RNA polymerase sigma A factor during transcription initiation. Biochem J
Chemiack, A. D., G. Garriga, J. D. Kittle, Jr., R. A. Akins, and A. M. Lambowitz.
1990. Function of Neurospora mitochondrial tyrosyl-tRNA synthetase in RNA
splicing requires an idiosyncratic domain not found in other synthetases. Cell
Chu, D. M., J. D. Corbin, K. A. Grimes, and S. H. Francis. 1997. Activation by
cyclic GMP binding causes an apparent conformational change in cGMP-
dependent protein kinase. J Biol Chem 272:31922-31928.
Cleghon, V., and D. F. Klessig. 1992. Characterization of the nucleic acid
binding region of adenovirus DNA-binding protein by partial proteolysis and
photochemical cross-linking. J Biol Chem 267:17872-17881.
Coetzee, T., D. Herschlag, and M. Belfort. 1994. Escherichia coli proteins,
including ribosomal protein SI 2, facilitate in vitro splicing of phage T4 introns by
acting as RNA chaperones. Genes Dev 8:1575-1588.

Cummings, D. J., J. M. Domenico, and F. Michel. 1988. DNA sequence and
organization of the mitochondrial ND1 gene from Podospora anserina: analysis of
alternate splice sites. Curr Genet 14:253-264.
Cunningham, B. C., and J. A. Wells. 1989. High-resolution epitope mapping of
hGH-receptor interactions by alanine-scanning mutagenesis. Science 244:1081-
Davies, J. 1990. What are antibiotics? Archaic functions for modem activities.
Mol Microbiol 4:1227-1232.
Davies, J., U. von Ahsen, H. Wank, and R. Schroeder. 1992. Evolution of
secondary metabolite production: potential roles for antibiotics as prebiotic
effectors of catalytic RNA reactions. Ciba Found Symp 171:24-32.
Davies, R. W., R. B. Waring, J. A. Ray, T. A. Brown, and C. Scazzocchio. 1982.
Making ends meet: a model for RNA splicing in fungal mitochondria. Nature
Decatur, W. A., C. Einvik, S. Johansen, and V. M. Vogt. 1995. Two group I
ribozymes with different functions in a nuclear rDNA intron. EMBO J 14:4558-
Degani, Y., and A. Patchornik. 1974. Cyanylation of sulfhydryl groups by 2-
nitro-5-thiocyanobenzoic acid. High-yield modification and cleavage of peptides
at cysteine residues. Biochemistry 13:1-11.
Dujon, B. 1989. Group I introns as mobile genetic elements: facts and
mechanistic speculations—a review. Gene 82:91-114.
Eickbush, T. H. 1994. In: Evolutionary biology of viruses (S. S. Morse, ed.),
Raven (New York), pp. 121-157.
Einvik, C., W. A. Decatur, T. M. Embley, V. M. Vogt, and S. Johansen. 1997.
Naegleria nucleolar introns contain two group I ribozymes with different functions
in RNA splicing and processing. RNA 3:710-720.
Forster, A. C., and S. Altman. 1990. External guide sequences for an RNA
enzyme. Science 249:783-786.

Gampel, A., M. Nishikimi, and A. Tzagoloff. 1989. CBP2 protein promotes in
vitro excision of a yeast mitochondrial group I intron. Mol Cell Biol 9:5424-
Gampel, A., and A. Tzagoloff. 1987. In vitro splicing of the terminal intervening
sequence of Saccharomyces cerevisiae cytochrome b pre-mRNA. Mol Cell Biol
Garriga, G., and A. M. Lambowitz. 1986. Protein-dependent splicing of a group I
intron in ribonucleoprotein particles and soluble fractions. Cell 46:669-680.
Garriga, G., and A. M. Lambowitz. 1984. RNA splicing in neurospora
mitochondria: self-splicing of a mitochondrial intron in vitro. Cell 39:631-641.
Gatignol, A., C. Buckler, and K. T. Jeang. 1993. Relatedness of an RNA-binding
motif in human immunodeficiency virus type 1 TAR RNA-binding protein TRBP
to human Pl/dsI kinase and Drosophila staufen. Mol Cell Biol 13:2193-2202.
Gatignol, A., A. Buckler White, B. Berkhout, and K. T. Jeang. 1991.
Characterization of a human TAR RNA-binding protein that activates the HIV-1
LTR. Science 251:1597-1600.
Gonsalves, D., and S. M. Gamsey. 1975. Infectivity of heterologous RNA-protein
mixtures from alfalfa mosaic, citrus leaf rugose, citrus variegation, and tobacco
streak viruses. Virology 67:319-326.
Gott, J. M., M. C. Willis, T. H. Koch, and O. C. Uhlenbeck. 1991. A specific,
UV-induced RNA-protein cross-link using 5-bromouridine-substituted RNA.
Biochemistry 30:6290-6295.
Green, R., and J. W. Szostak. 1992. Selection of a ribozyme that functions as a
superior template in a self-copying reaction. Science 258:1910-1915.
Green, S. R., and M. B. Mathews. 1992. Two RNA-binding motifs in the double-
stranded RNA-activated protein kinase, DAI. Genes Dev 6:2478-2490.
Grosshans, C. A., and T. R. Cech. 1989. Metal ion requirements for sequence-
specific endoribonuclease activity of the Tetrahymena ribozyme. Biochemistry

Guthrie, C. 1991. Messenger RNA splicing in yeast: clues to why the
spliceosome is a ribonucleoprotein. Science 253:157-163.
Hay, R. T., and J. Nicholson. 1993. DNA binding alters the protease
susceptibility of the p50 subunit of NF-kappa B. Nucleic Acids Res 21:4592-
Herbert, C. J., M. Labouesse, G. Dujardin, and P. P. Slonimski. 1988. The NAM2
proteins from S. cerevisiae and S. douglasii are mitochondrial leucyl-tRNA
synthetases, and are involved in mRNA splicing. EMBO J 7:473-483.
Herschlag, D. 1992. Evidence for processivity and two-step binding of the RNA
substrate from studies of J1/2 mutants of the Tetrahymena ribozyme.
Biochemistry 31:1386-1399.
Herschlag, D. 1995. RNA chaperones and the RNA folding problem. J Biol
Chem 270:20871-20874.
Herschlag, D., and T. R. Cech. 1990. Catalysis of RNA cleavage by the
Tetrahymena thermophila ribozyme. 1. Kinetic description of the reaction of an
RNA substrate complementary to the active site. Biochemistry 29:10159-10171.
Herschlag, D., and T. R. Cech. 1990. DNA cleavage catalysed by the ribozyme
from Tetrahymena [published erratum appears in Nature 1990 Apr
19;344(6268):792], Nature 344:405-409.
Herschlag, D., M. Khosla, Z. Tsuchihashi, and R. L. Karpel. 1994. An RNA
chaperone activity of non-specific RNA-binding proteins in hammerhead ribozyme
catalysis [published erratum appears in EMBO J 1994 Aug 15; 13(16):3926].
EMBO J 13:2913-2924.
Hicke, B. J., E. L. Christian, and M. Yarns. 1989. Stereoselective arginine
binding is a phylogenetically conserved property of group I self-splicing RNAs.
EMBO J 8:3843-3851.
Hill, J., P. McGraw, and A. Tzagoloff. 1985. A mutation in yeast mitochondrial
DNA results in a precise excision of the terminal intron of the cytochrome b gene.
J Biol Chem 260:3235-3238.

Hillenkamp, F., M. Karas, R. C. Beavis, and B. T. Chait. 1991. Matrix-assisted
laser desorption/ionization mass spectrometry of biopolymers. Anal Chem
Ho, Y., S. J. Kim, and R. B. Waring. 1997. A protein encoded by a group I intron
in Aspergillus nidulans directly assists RNA splicing and is a DNA endonuclease.
Proc Natl Acad Sci U S A 94:8994-8999.
Holl, J., C. Schmidt, and R. J. Schweiyen. 1985. In: Achievements and
perspectives of mitochondrial research, Vol.II, Biogenesis (E. Quagliariello, E. C.
Slater, F. Palmieri, C. Saccone, and A. M. Kroon, ed.), Elsevier (Amsterdam), pp.
Huang, F., and M. Yarns. 1997a. 5'-RNA self-capping from guanosine
diphosphate. Biochemistry 36:6557-6563.
Huang, F., and M. Yarns. 1997b. A calcium-metalloribozyme with autodecapping
and pyrophosphatase activities. Biochemistry 36:14107-14119.
Hunter, T., T. Hunt, R. J. Jackson, and H. D. Robertson. 1975. The characteristics
of inhibition of protein synthesis by double-stranded ribonucleic acid in
reticulocyte lysates. J Biol Chem 250:409-417.
Ikeda, M., E. C. Wilcox, and W. W. Chin. 1996. Different DNA elements can
modulate the conformation of thyroid hormone receptor heterodimer and its
transcriptional activity. J Biol Chem 271:23096-23104.
Illangasekare, M., O. Kovalchuke, and M. Yarns. 1997. Essential structures of a
self-aminoacylating RNA. J Mol Biol 274:519-529.
Illangasekare, M., G. Sanchez, T. Nickles, and M. Yarns. 1995. Aminoacyl-RNA
synthesis catalyzed by an RNA. Science 267:643-647.
Inoue, T., F. X. Sullivan, and T. R. Cech. 1986. New reactions of the ribosomal
RNA precursor of Tetrahymena and the mechanism of self-splicing. J Mol Biol
Jabri, E., S. Aigner, and T. R. Cech. 1997. Kinetic and secondary structure
analysis of Naegleria andersoni GIR1, a group I ribozyme whose putative
biological function is site-specific hydrolysis. Biochemistry 36:16345-16354.

Jacobson, G. R., M. H. Schaffer, G. R. Stark, and T. C. Vanaman. 1973. Specific
chemical cleavage in high yield at the amino peptide bonds of cysteine and cystine
residues. J Biol Chem 248:6583-6591.
Jaeger, L., E. Westhof, and F. Michel. 1991. Function of PI 1, a tertiary base
pairing in self-splicing introns of subgroup IA. J Mol Biol 221:1153-1164.
Joyce, G. F., G. van der Horst, and T. Inoue. 1989. Catalytic activity is retained in
the Tetrahymena group I intron despite removal of the large extension of element
P5. Nucleic Acids Res 17:7879-7889.
Kamper, U., U. Kuck, A. D. Chemiack, and A. M. Lambowitz. 1992. The
mitochondrial tyrosyl-tRNA synthetase of Podospora anserina is a bifunctional
enzyme active in protein synthesis and RNA splicing. Mol Cell Biol 12:499-511.
Karas, M., and F. Hillenkamp. 1988. Laser desorption ionization of proteins with
molecular masses exceeding 10,000 daltons. Anal Chem 60:2299-2301.
Kennell, J. C., J. V. Moran, P. S. Perlman, R. A. Butow, and A. M. Lambowitz.
1993. Reverse transcriptase activity associated with maturase-encoding group II
introns in yeast mitochondria. Cell 73:133-146.
Kharrat, A., M. J. Macias, T. J. Gibson, M. Nilges, and A. Pastore. 1995.
Structure of the dsRNA binding domain of E. coli RNase III. EMBO J 14:3572-
King, G. C., and J. E. Coleman. 1988. The Ff gene 5 protein-d(pA)40-60
complex: 1H NMR supports a localized base-binding model. Biochemistry
Kittle, J. D., Jr., G. Mohr, J. A. Gianelos, H. Wang, and A. M. Lambowitz. 1991.
The Neurospora mitochondrial tyrosyl-tRNA synthetase is sufficient for group I
intron splicing in vitro and uses the carboxy-terminal tRNA-binding domain along
with other regions. Genes Dev 5:1009-1021.
Kreike, J., M. Schulze, F. Ahne, and B. F. Lang. 1987. A yeast nuclear gene,
MRS1, involved in mitochondrial RNA splicing: nucleotide sequence and
mutational analysis of two overlapping open reading frames on opposite strands.
EMBO J 6:2123-2129.

Kreike, J., M. Schulze, T. Pillar, A. Korte, and G. Rodel. 1986. Cloning of a
nuclear gene MRS1 involved in the excision of a single group I intron (bI3) from
the mitochondrial COB transcript in S. cerevisiae. Curr Genet 11:185-191.
Kumar, A., and S. H. Wilson. 1990. Studies of the strand-annealing activity of
mammalian hnRNP protein Al. Biochemistry 29:10717-10722.
Kurz, J. C., S. Niranjanakumari, and C. A. Fierke. 1998. Protein component of
Bacillus subtilis RNase P specifically enhances the affinity for precursor-
tRNAAsp. Biochemistry 37:2393-400.
Labouesse, M, C. J. Herbert, G. Dujardin, and P. P. Slonimski. 1987. Three
suppressor mutations which cure a mitochondrial RNA maturase deficiency occur
at the same codon in the open reading frame of the nuclear NAM2 gene. EMBO J
Laemmli, U. K. 1970. Cleavage of structural proteins during the assembly of the
head of bacteriophage T4. Nature 227:680-685.
Lamb, M. R., P. Q. Anziano, K. R. Glaus, D. K. Hanson, H. J. Klapper, P. S.
Perlman, and H. R. Mahler. 1983. Functional domains in introns. RNA
processing intermediates in cis- and trans-acting mutants in the penultimate intron
of the mitochondrial gene for cytochrome b. J Biol Chem 258:1991-1999.
Lambowitz, A. M., and P. S. Perlman. 1990. Involvement of aminoacyl-tRNA
synthetases and other proteins in group I and group II intron splicing. Trends
Biochem Sci 15:440-444.
Lazinski, D., E. Grzadzielska, and A. Das. 1989. Sequence-specific recognition
of RNA hairpins by bacteriophage antiterminators requires a conserved arginine-
rich motif. Cell 59:207-218.
Lazowska, J., M. Claisse, A. Gargouri, Z. Kotylak, A. Spyridakis, and P. P.
Slonimski. 1989. Protein encoded by the third intron of cytochrome b gene in
Saccharomyces cerevisiae is an mRNA maturase. Analysis of mitochondrial
mutants, RNA transcripts proteins and evolutionary relationships. J Mol Biol
Lazowska, J., T. Szczepanek, C. Macadre, and M. Dokova. 1992. Two
homologous mitochondrial introns from closely related Saccharomyces species

differ by only a few amino acid replacements in their Open Reading Frames: one is
mobile, the other is not. CR Acad Sci III 315:37-41.
LeCuyer, K. A., L. S. Behlen, and O. C. Uhlenbeck. 1996. Mutagenesis of a
stacking contact in the MS2 coat protein-RNA complex. EMBO J 15:6847-6853.
LeCuyer, K. A., L. S. Behlen, and O. C. Uhlenbeck. 1995. Mutants of the
bacteriophage MS2 coat protein that alter its cooperative binding to RNA.
Biochemistry 34:10600-10606.
Li, G. Y., G. L. Tian, P. P. Slonimski, and C. J. Herbert. 1996. The CBP2 gene
from Saccharomyces douglasii is a functional homologue of the Saccharomyces
cerevisiae gene and is essential for respiratory growth in the presence of a wild-
type (intron-containing) mitochondrial genome. Mol Gen Genet 250:316-322.
Liu, X., P. Garriga, and H. G. Khorana. 1996. Structure and function in
rhodopsin: correct folding and misfolding in two point mutations in the intradiscal
domain of rhodopsin identified in retinitis pigmentosa. Proc. Natl. Acad. Sci.
Madhani, H. D., and C. Guthrie. 1992. A novel base-pairing interaction between
U2 and U6 snRNAs suggests a mechanism for the catalytic activation of the
spliceosome. Cell 71:803-817.
Majerfeld, L, and M. Yarns. 1994. An RNA pocket for an aliphatic hydrophobe
[see comments]. Nat Struct Biol 1:287-292.
Matsuura, M., R. Saldanha, H. Ma, H. Wank, J. Yang, G. Mohr, S. Cavanagh, G.
M. Dunny, M. Belfort, and A. M. Lambowitz. 1997. A bacterial group II intron
encoding reverse transcriptase, maturase, and DNA endonuclease activities:
biochemical demonstration of maturase activity and insertion of new genetic
information within the intron. Genes Dev 11:2910-2924.
McConnell, T. S., D. Herschlag, and T. R. Cech. 1997. Effects of divalent metal
ions on individual steps of the Tetrahymena ribozyme reaction. Biochemistry
McCormack, S. J., D. C. Thomis, and C. E. Samuel. 1992. Mechanism of
interferon action: identification of a RNA binding domain within the N-terminal
region of the human RNA-dependent Pl/eIF-2 alpha protein kinase. Virology

McGraw, P., and A. Tzagoloff. 1983. Assembly of the mitochondrial membrane
system. Characterization of a yeast nuclear gene involved in the processing of the
cytochrome b pre-mRNA. J Biol Chem 258:9459-9468.
McPheeters, D. S., and J. Abelson. 1992. Mutational analysis of the yeast U2
snRNA suggests a structural similarity to the catalytic core of group I introns. Cell
Mei, R., and D. Herschlag. 1996. Mechanistic investigations of a ribozyme
derived from the Tetrahymena group I intron: Insights into catalysis and the second
step of self-splicing. Biochemistry 35:5796-5809.
Merrill, B. M., K. L. Stone, F. Cobianchi, S. H. Wilson, and K. R. Williams. 1988.
Phenylalanines that are conserved among several RNA-binding proteins form part
of a nucleic acid-binding pocket in the A1 heterogeneous nuclear
ribonucleoprotein. J Biol Chem 263:3307-3313.
Merrill, B. M., K. R. Williams, J. W. Chase, and W. H. Konigsberg. 1984.
Photochemical cross-linking of the Escherichia coli single-stranded DNA-binding
protein to oligodeoxynucleotides. Identification of phenylalanine 60 as the site of
cross-linking. J Biol Chem 259:10850-10856.
Meunier, B., T. G.-L., C. Macadre, P. P. Slonimski, and J. Lazowska. 1990.
Group II introns transpose in yeast mitochondria. In: Structure, function and
biogenesis of energy transfer systems (E. Quagliariello, S. Papa, F. Palmieri, and
C. Saccone. ed.), Elsevier Science Publishers (Amsterdam), pp. 169-174.
Michel, F., A. Jacquier, and B. Dujon. 1982. Comparison of fungal mitochondrial
introns reveals extensive homologies in RNA secondary structure. Biochimie
Michel, F., and E. Westhof. 1990. Modelling of the three-dimensional
architecture of group I catalytic introns based on comparative sequence analysis. J
Mol Biol 216:585-610.
Moazed, D., and H. F. Noller. 1987. Chloramphenicol, erythromycin, carbomycin
and vemamycin B protect overlapping sites in the peptidyl transferase region of
23S ribosomal RNA. Biochimie 69:879-884.

Modarress, K. J., J. Opoku, M. Xu, N. J. Sarlis, and S. S. Simons, Jr. 1997.
Steroid-induced conformational changes at ends of the hormone-binding domain in
the rat glucocorticoid receptor are independent of agonist versus antagonist
activity. J Biol Chem 272:23986-23994.
Mogridge, J., T. F. Mah, and J. Greenblatt. 1998. Involvement of boxA
nucleotides in the formation of a stable ribonucleoprotein complex containing the
bacteriophage lambda N protein. J Biol Chem 273:4143-4148.
Mohr, G., M. G. Caprara, Q. Guo, and A. M. Lambowitz. 1994. A tyrosyl-tRNA
synthetase can function similarly to an RNA structure in the Tetrahymena
ribozyme [see comments]. Nature 370:147-150.
Munroe, S. H., and X. Dong. 1992. Heterogeneous nuclear ribonucleoprotein A1
catalyzes RNA-RNA annealing. Proc. Natl. Acad. Sci. 89:895-899.
Myers, C. A., G. J. Wallvveber, R. Rennard, Y. Kernel, M. G. Caprara, G. Mohr,
and A. M. Lambowitz. 1996. A tyrosyl-tRNA synthetase suppresses structural
defects in the two major helical domains of the group I intron catalytic core. J Mol
Biol 262:87-104.
Narlikar, G. J., and D. Herschlag. 1996. Isolation of a local tertiary folding
transition in the context of a globally folded RNA. Nat Struct Biol 3:701-710.
Noller, H. F., V. Hoffarth, and L. Zimniak. 1992. Unusual resistance of peptidyl
transferase to protein extraction procedures [see comments]. Science 256:1416-
Palmer, J. D., and J. M. Logsdon, Jr. 1991. The recent origins of introns. Curr
Opin Genet Dev 1:470-477.
Pan, J., D. Thirumalai, and S. A. Woodson. 1997. Folding of RNA involves
parallel pathways. J Mol Biol 273:7-13.
Paradiso, P. R., and W. Konigsberg. 1982. Photochemical cross-linking of the
gene 5 protein.fd DNA complex from fd-infected cells. J Biol Chem 257:1462-

Paradiso, P. R., Y. Nakashima, and W. Konigsberg. 1979. Photochemical cross-
linking of protein . nucleic acid complexes. The attachment of the fd gene 5
protein to fd DNA. J Biol Chem 254:4739-4744.
Parker, E. J., C. H. Botting, A. Webster, and R. T. Hay. 1998. Adenovirus DNA
polymerase: domain organisation and interaction with preterminal protein. Nucleic
Acids Res 26:1240-1247.
Partono, S., and A. S. Lewin. 1988. Autocatalytic activities of intron 5 of the cob
gene of yeast mitochondria. Mol Cell Biol 8:2562-2571.
Partono, S., and A. S. Lewin. 1991. The rate and specificity of a group I ribozyme
are inversely affected by choice of monovalent salt. Nucleic Acids Res 19:605-
Perlman, P. S., and R. A. Butow. 1989. Mobile introns and intron-encoded
proteins. Science 246:1106-1109.
Petersen, J. M., J. J. Skalicky, L. W. Donaldson, L. P. McIntosh, T. Alber, and B.
J. Graves. 1995. Modulation of transcription factor Ets-1 DNA binding: DNA-
induced unfolding of an alpha helix. Science 269:1866-1869.
Piccirilli, J. A., T. S. McConnell, A. J. Zaug, H. F. Noller, and T. R. Cech. 1992.
Aminoacyl esterase activity of the Tetrahymena ribozyme [see comments].
Science 256:1420-1424. '
Portman, D. S., and G. Dreyfuss. 1994. RNA annealing activities in HeLa nuclei.
EMBOJ 13:213-221.
Powers, T., and H. F. Noller. 1994. Selective perturbation of G530 of 16 S rRNA
by translational miscoding agents and a streptomycin-dependence mutation in
protein S12. J Mol Biol 235:156-172.
Pyle, A. M., and T. R. Cech. 1991. Ribozyme recognition of RNA by tertiary
interactions with specific ribose 2'-OH groups. Nature 350:628-631.
Pyle, A. M., J. A. McSwiggen, and T. R. Cech. 1990. Direct measurement of
oligonucleotide substrate binding to wild-type and mutant ribozymes from
Tetrahymena. Proc Natl Acad Sci U S A 87:8187-8191.

Pyle, A. M., S. Moran, S. A. Strobel, T. Chapman, D. H. Turner, and T. R. Cech.
1994. Replacement of the conserved G.U with a G-C pair at the cleavage site of
the Tetrahymena ribozyme decreases binding, reactivity, and fidelity.
Biochemistry 33:13856-13863.
Pyle, A. M., F. L. Murphy, and T. R. Cech. 1992. RNA substrate binding site in
the catalytic core of the Tetrahymena ribozyme. Nature 358:123-128.
Reinhold Hurek, B., and D. A. Shub. 1992. Self-splicing introns in tRNA genes
of widely divergent bacteria. Nature 357:173-176.
Reusken, C. B., L. Neeleman, and J. F. Bol. 1995. Ability of tobacco streak virus
coat protein to substitute for late functions of alfalfa mosaic virus coat protein. J
Virol 69:4552-4555.
Robertson, D. L., and G. F. Joyce. 1990. Selection in vitro of an RNA enzyme
that specifically cleaves single-stranded DNA. Nature 344:467-468.
Rogers, J., A. H. Chang, U. von Ahsen, R. Schroeder, and J. Davies. 1996.
Inhibition of the self-cleavage reaction of the human hepatitis delta virus ribozyme
by antibiotics. J Mol Biol 259:916-925.
Roman, J., and S. A. Woodson. 1998. Integration of the Tetrahymena group I
intron into bacterial rRNA by reverse splicing in vivo. Proc Natl Acad Sci U S A
Safer, B., R. B. Cohen, S. Garfmkel, and J. A. Thompson. 1988. DNA affinity
labeling of adenovirus type 2 upstream promoter sequence-binding factors
identifies two distinct proteins. Mol Cell Biol 8:105-113.
Saldanha, R., A. Ellington, and A. M. Lambowitz. 1996. Analysis of the CYT-18
protein binding site at the junction of stacked helices in a group I intron RNA by
quantitative binding assays and in vitro selection. J Mol Biol 261:23-42.
Saldanha, R., G. Mohr, M. Belfort, and A. M. Lambowitz. 1993. Group I and
group II introns. FASEB J. 7:15-24.
Schagger, H., and G. von Jagow. 1987. Tricine-sodium dodecyl sulfate-
polyacrylamide gel electrophoresis for the separation of proteins in the range from
ItolOOkDa. Anal Biochem 166:368-379.

Sclavi, B., M. Sullivan, M. R. Chance, M. Brenovvitz, and S. A. Woodson. 1998.
RNA folding at millisecond intervals by synchrotron hydroxyl radical footprinting.
Science 279:1940-1943.
Sellem, C. H., and L. Belcour. 1997. Intron open reading frames as mobile
elements and evolution of a group I intron. Mol Biol Evol 14:518-526.
Sellem, C. H., Y. d'Aubenton Carafa, M. Rossignol, and L. Belcour. 1996.
Mitochondrial intronic open reading frames in Podospora: mobility and
consecutive exonic sequence variations. Genetics 143:777-788.
Seraphin, B., M. Simon, A. Boulet, and G. Faye. 1989. Mitochondrial splicing
requires a protein from a novel helicase family. Nature 337:84-87.
Shamoo, Y., K. R. Williams, and W. H. Konigsberg. 1988. Photochemical
crosslinking of bacteriophage T4 single-stranded DNA-binding protein (gp32) to
oligo-p(dT)8: identification of phenylalanine-183 as the site of crosslinking.
Proteins 4:1-6.
Sharp, P. A. 1985. On the origin of RNA splicing and introns. Cell 42:397-400.
Shaw, L. C., and A. S. Lewin. 1997. The Cbp2 protein stimulates the splicing of
the omega intron of yeast mitochondria. Nucleic Acids Res 25:1597-1604.
Shaw, L. C., and A. S. Lewin. 1995. Protein-induced folding of a group I intron
in cytochrome b pre-mRNA. J Biol Chem 270:21552-21562.
Shaw, L. C., J. Thomas, Jr., and A. S. Lewin. 1996. The Cbp2 protein suppresses
splice site mutations in a group I intron. Nucleic Acids Res 24:3415-3423.
Shetlar, M. D. 1980. Cross-linking of proteins to nucleic acids by ultraviolet
light. In: Photochemical and Photobiological reviews (K. C. Smith, ed.), Plenum
Press (New York), pp. 105-197.
St Johnston, D., N. H. Brown, J. G. Gall, and M. Jantsch. 1992. A conserved
double-stranded RNA-binding domain. Proc Natl Acad Sci U S A 89:10979-
Steitz, J. A. 1992. Splicing takes a holliday [see comments]. Science 257:888-

Steitz, T. A., and J. A. Steitz. 1993. A general two-metal-ion mechanism for
catalytic RNA. Proc Natl Acad Sci USA 90:6498-6502.
Strobel, S. A., and T. R. Cech. 1995. Minor groove recognition of the conserved
G.U pair at the Tetrahymena ribozyme reaction site. Science 267:675-679.
Strobel, S. A., and T. R. Cech. 1993. Tertiary interactions with the internal guide
sequence mediate docking of the PI helix into the catalytic core of the
Tetrahymena ribozyme. Biochemistry 32:13593-13604.
Studier, F. W., A. H. Rosenberg, J. J. Dunn, and J. W. Dubendorff. 1990. Use of
T7 RNA polymerase to direct expression of cloned genes. Methods Enzymol
Szczepanek, T., and J. Lazowska. 1996. Replacement of two non-adjacent amino
acids in the S.cerevisiae bi2 intron-encoded RNA maturase is sufficient to gain a
homing-endonuclease activity. EMBO J 15:3758-3767.
Tan, R., L. Chen, J. A. Buettner, D. Hudson, and A. D. Frankel. 1993. RNA
recognition by an isolated alpha helix. Cell 73:1031-1040.
Tanner, N. K., M. M. Hanna, and J. Abelson. 1988. Binding interactions between
yeast tRNA ligase and a precursor transfer ribonucleic acid containing two
photoreactive uridine analogues. Biochemistry 27:8852-8861.
Thompson, A. J., and D. L. Herrin. 1994. A chloroplast group I intron undergoes
the first step of reverse splicing into host cytoplasmic 5.8 S rRNA. Implications for
intron-mediated RNA recombination, intron transposition and 5.8 S rRNA
structure. J Mol Biol 236:455-468.
Towbin, H., T. Staehelin, and J. Gordon. 1979. Electrophoretic transfer of
proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some
applications. Proc Natl Acad Sci U S A 76:4350-4354.
Treiber, D. K., M. S. Rook, P. P. Zarrinkar, and J. R. Williamson. 1998. Kinetic
intermediates trapped by native interactions in RNA folding. Science 279:1943-

Vaisanen, S., K. Juntunen, A. Itkonen, P. Vihko, and P. H. Maenpaa. 1997.
Conformational studies of human vitamin-D receptor by antipeptide antibodies,
partial proteolytic digestion and ligand binding. Eur J Biochem 248:156-162.
Valegard, K., J. B. Murray, P. G. Stockley, N. J. Stonehouse, and L. Liljas. 1994.
Crystal structure of an RNA bacteriophage coat protein-operator complex. Nature
van der Horst, G., and H. F. Tabak. 1985. Self-splicing of yeast mitochondrial
ribosomal and messenger RNA precursors. Cell 40:759-766.
van Vloten-Doting, L. 1975. Coat protein is required for infectivity of tobacco
streak virus: biological equivalence of the coat proteins of tobacco streak and
alfalfa mosaic viruses. Virology 65:215-225.
Visser, C. M. 1984. Evolution of biocatalysis 2. Nicotinamide and/or flavin-
containing RNA molecules as possible pre-genetic-code replicating oxido-
reductases. OrigLife 14:301-305.
von Ahsen, U., J. Davies, and R. Schroeder. 1991. Antibiotic inhibition of group I
ribozyme function [see comments]. Nature 353:368-370.
von Ahsen, U., and H. F. Noller. 1993. Footprinting the sites of interaction of
antibiotics with catalytic group I intron RNA [see comments]. Science 260:1500-
von Heijne, G. 1986. Mitochondrial targeting sequences may form amphiphilic
helices. EMBO J 5:1335-1342.
Wallweber, G. J., S. Mohr, R. Rennard, M. G. Caprara, and A. M. Lambowitz.
1997. Characterization of Neurospora mitochondrial group I introns reveals
different CYT-18 dependent and independent splicing strategies and an alternative
3'splice site for an intron ORF. RNA 3:114-131.
Wang, J. F., and T. R. Cech. 1992. Tertiary structure around the guanosine¬
binding site of the Tetrahymena ribozyme. Science 256:526-529.
Wank, H., and R. Schroeder. 1996. Antibiotic-induced oligomerisaation of group
I intron RNA. J. Mol. Biol. 258:53-61.

Weeks, K. M., and T. R. Cech. 1996. Assembly of a ribonucleoprotein catalyst by
tertiary structure capture. Science 271:345-348.
Weeks, K. M., and T. R. Cech. 1995a. Efficient protein-facilitated splicing of the
yeast mitochondrial bI5 intron. Biochemistry 34:7728-7738.
Weeks, K. M, and T. R. Cech. 1995b. Protein facilitation of group I intron
splicing by assembly of the catalytic core and the 5' splice site domain. Cell
Weinstein, L. B., B. C. N. M. Jones, R. Cosstick, and T. R. Cech. 1997. A second
catalytic metal ion in a group I ribozyme. Nature 388:805-808.
Welch, M., I. Majerfeld, and M. Yarns. 1997. 23S rRNA similarity from selection
for peptidyl transferase mimicry. Biochemistry 36:6614-6623.
Whelihan, E. F., and P. Schimmel. 1997. Rescuing an essential enzyme RNA
complex with a non-essential appended domain. EMBO J 16:2968-2974.
Wiesenberger, G., M. Waldherr, and R. J. Schweyen. 1992. The nuclear gene
MRS2 is essential for the excision of group II introns from yeast mitochondrial
transcripts in vivo. J Biol Chem 267:6963-6969.
Williams, K. R., and W. H. Konigsberg. 1991. Identification of amino acid
residues at interface of protein-nucleic acid complexes by photochemical cross-
linking. Methods Enzymol 208:516-539.
Willis, M. C., B. J. Hicke, O. C. Uhlenbeck, T. R. Cech, and T. H. Koch. 1993.
Photocrosslinking of 5-iodouracil-substituted RNA and DNA to proteins. Science
Wong, I., and T. M. Lohman. 1993. A double-filter method for nitrocellulose-
filter binding: application to protein-nucleic acid interactions. Proc Natl Acad Sci
USA 90:5428-5432.
Woodson, S. A., and T. R. Cech. 1989. Reverse self-splicing of the tetrahymena
group I intron: implication for the directionality of splicing and for intron
transposition. Cell 57:335-345.

Yamada, T., Y. Mizugichi, K. H. Nierhaus, and H. G. Wittmann. 1978.
Resistance to viomycin conferred by RNA of either ribosomal subunit. Nature
Yang, J., S. Zimmerly, P. S. Perlman, and A. M. Lambowitz. 1996. Efficient
integration of an intron RNA into double-stranded DNA by reverse splicing [see
comments]. Nature 381:332-335.
Yarns, M. 1991. An RNA-amino acid complex and the origin of the genetic code.
New Biol 3:183-189.
Zamore, P. D., and M. R. Green. 1989. Identification, purification, and
biochemical characterization of U2 small nuclear ribonucleoprotein auxiliary
factor. Proc Natl Acad Sci U S A 86:9243-9247.
Zimmerly, S., H. Guo, R. Eskes, J. Yang, P. S. Perlman, and A. M. Lambowitz.
1995. A group II intron RNA is a catalytic component of a DNA endonuclease
involved in intron mobility. Cell 83:529-538.
Zinnen, S., and M. Yarns. 1995. An RNA pocket for the planar aromatic side
chains of phenylalanine and tryptophane. Nucleic Acids Symp Ser 33:148-151.
Zoller, M. J., and M. Smith. 1984. Oligonucleotide-directed mutagenesis: a
simple method using two oligonucleotide primers and a single-stranded DNA
template. DNA 3:479-488.
Zuidema, D., and E. M. J. Jaspars. 1984. Comparative investigations on the coat
protein binding sites of the genomic RNAs of alfalfa mosaic virus and tobacco
streak virus. Virology 135:43-52.

Hymavathi K. Tirupati obtained her undergraduate degree in agriculture in
1987 from the Andhra Pradesh Agricultural University, India, followed by a
master’s degree in genetics and plant breeding in 1989 from the Indian
Agricultural Research Institute, India. After two years of graduate studies in
molecular genetics, she entered the graduate program in molecular genetics and
microbiology at the University of Florida in 1992. She joined the laboratory of Dr.
Alfred S. Lewin for her graduate research in 1993.

I certify that I have read this study and that in my opinion it conforms to
acceptable standards of scholarly presentation and is fully adequate, in scope and
quality, as a dissertation for the degree of Doctor of Philosophy
Alfred S/Lewin, Chair
Professor of Molecular Genetics
and Microbiology
I certify that I have read this study and that in my opinion it conforms to
acceptable standards of scholarly presentation and is fully adequate, in scope and
quality, as a dissertation for the degree of Doctor of Philosophy
imes B. Flanegan
Professor of Molecular
and Microbiology
I certify that I have read this study and that in my opinion it conforms to
acceptable standards of scholarly presentation and is fully adequate, in scope and
quality, as a dissertation for the degree of Doctor of Philosophy
Henry V. Baker
Associate Professor of Molecular
Genetics and Microbiology

I certify that I have read this study and that in my opinion it conforms to
acceptable standards of scholarly presentation and is fully adequate, in scope and
quality, as a dissertation for the degree of Doctor of Philosophy.
Professor of Biochemistry
and Molecular Biology
This dissertation was submitted to the Graduate Faculty of the College of
Medicine and to the Graduate School and was accepted as partial fulfillment of the
requirements for the degree of Doctor of Philosophy.
December, 1998
Dean, College of Medicine
Dean, Graduate School

3 1262 08555 3013

xml version 1.0 encoding UTF-8
REPORT xmlns http:www.fcla.edudlsmddaitss xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.fcla.edudlsmddaitssdaitssReport.xsd
INGEST IEID E8M8014TB_HM62FR INGEST_TIME 2014-07-28T22:34:46Z PACKAGE AA00022301_00001


51$3527(,1 ,17(5$&7,216 2) $ 0,72&+21'5,$/ *5283 ,,17521 ,1 6DFFKDURP\FHV FHUHYLVLDH %\ +<0$9$7+, 7,583$7, $ ',66(57$7,21 35(6(17(' 72 7+( *5$'8$7( 6&+22/ 2) 7+( 81,9(56,7< 2) )/25,'$ ,1 3$57,$/ )8/),//0(17 2) 7+( 5(48,5(0(176 )25 7+( '(*5(( 2) '2&725 2) 3+,/2623+< 81,9(56,7< 2) )/25,'$






087$7,21$/ $1$/<6,6 2) 7+( 17(50,186 2) &%3 ,QWURGXFWLRQ 5HVXOWV 'LVFXVVLRQ 6800$5< $1' 3(563(&7,9(6 /,67 2) 5()(5(1&(6 %,2*5$3+,&$/ 6.(7&+ ,9



















3 $8 $$ $ 8 DXDD $8 $8 8$ $8 &* $ &DDFADDD$ / D D X F F X X X D J X D D F D F F D X D F X X D X X J $ X $ D QW 8 D DDDX $ J X X $$ $ $ $ $8 $8 $ $ F 8$ 8$ $ $ F 3 &* 8$ $ D D 8$ $8 $ X 8$ 8$ $ 8 J $8 8$ 8 $ X 8$*$*& 3 X J F D 8 $ *& 8$ X* D8 3 X$ X F* 8$ 8$ 3 *& L 8 &* &$ $8 *8 fX 3 &* $$ 3 &* $ 8 $8 8$ 8$ $8 $8 8 $ 8 $8 $8 $ / 3D /D 3E 3F $r *X$r 8$ 8$ $8 8$ $8 8$ $&* & $ 8&8$ $8 8$ $8 8$ 8$ $8 8$ $8 $8fr 88$ $8 $8 8$ $8 $ 8$ D / 3D /D $8 8* $ M LW87$ LP7 &* 8$ 8$ $8 $8 *& 8$ 8$ 8* &* &* *8 &* 8 8 8 FF $XQn AXD 8 D $ 8 8 $ $ $ 8$$8D$8 8 $ *D 8$*$$$* $ & 8 $ , O L ,,, FFXXXFF DXJ DX$ $ $ 3 X 3D /D



























































F D R Z }! I &ES %6$ e f§N 1! 2A &2Q RR Y2 _O /rRR






$ 1+ 2+ N'D N'D % 17&% N'Dr N'Dr N'Dr N'D








$ 7 /! F r} L F R = 7 8 DM rr L LQ N'D N'D N'D % r N'D r N'D N'D 7 f E2 ER m} } & R & = ; N'Dr N'Dr N'D






A RR 0 91 : 47/)0 9 6/554* 6 6 6 5 <5 <.)10 (1,7+4 9)35&























2 r 7ULSOH DURPDWLF 5/5/./f .f 'HOHWLRQ f Z :W .f : HQ FG /









1L 8! A &21 +HDWGHQDWXUHG B ZW &ES 'HOHWLRQ B DDODDf f :W &ES + : 6n 4 FU 7 1RG ? KN ? ? +HDWGHQDWXUHG 1f ? } B ZW &ES & L_ 7ULSOH DURPDWLF L B 5/5/./f 0 L L 2, M IO Lc L :W &ES 2V 9 I 




$ :W &ES )/ 7LPH PLQf
























$ 2f 2 e 'HOHWLRQ DDDDf 92 U_+ R UL YM •“ 0XWDQW :W &ES R 7ULSOH DURPDWLF 5/5/./f


% 'HOHWLRQ DDOf 7ULSOH DURPDWLF PXWDQW I rf rf rf f f f f rrf rf rrf ff rf rf rf f ‘ f / f frr frr rf fr f fr f f ff f rrf rrf rrf ff rr rf ff f ff f ‘ rr f f f U ff frr frr frr ff f f rn‘ rrf rrfn ff rf r f f \U$$UU f f f ‘ ‘f ‘ ff ? ‘f f rf f f r f r f f r f f f f f bf f f9f ‘ f ff ‘ fY f f f f ‘ ‘ ffff f ‘ ‘ f ‘ ‘ U f f f f f r f ? f r f r f f ‘ f ‘ f f ‘ ‘ f f ‘9 ‘ LL 9L f ‘ f f ff ‘ rf rrf rrf rf rf rrf rrf frr frr frr fnr f f rf rrf f rr‘ ff9f 9fr9fr ? 7 fff fn9fr9fr A A ‘ ‘‘f$LO ‘‘‘ 9 rrf fr fr rrf frrfrrfr fr f frrfrrfrrfnr f r f r f r f f f f f f f f f f f f r ‘ !9 f f rf rf f RR 0XWDQW :W&ES 0XWDQW :W&ES )LJXUH FRQWLQXHG






' , , RR ( &ES 51$ O 0 1 f WL m A f

PAGE 100


PAGE 101


PAGE 102

$ &ES 51$ QR W51$f 1 LQ Â’ W51$ PJPOf DW &ES 51$ RI e

PAGE 103


PAGE 104


PAGE 105


PAGE 106


PAGE 107


PAGE 108


PAGE 109


PAGE 110


PAGE 111

PAGE 112

PAGE 113


PAGE 114


PAGE 115


PAGE 116


PAGE 117


PAGE 118

PAGE 119

PAGE 120


PAGE 121


PAGE 122


PAGE 123


PAGE 124


PAGE 125

PAGE 126

PAGE 127


PAGE 128


PAGE 129


PAGE 130


PAGE 131


PAGE 132


PAGE 133


PAGE 134


PAGE 135


PAGE 136


PAGE 137


PAGE 138


PAGE 139


PAGE 140


PAGE 141

PAGE 142


PAGE 143

PAGE 144

PAGE 145


PAGE 146


PAGE 147

PAGE 148


PAGE 149


PAGE 150


PAGE 151


PAGE 152


PAGE 153


PAGE 154


PAGE 155

PAGE 156

PAGE 157


PAGE 158


PAGE 159


PAGE 160

81,9(56,7< 2) )/25,'$