Citation
Characterization of the pathogenesis of amelanosis in the Smyth line chicken : a model of the human autoimmune disease vitiligo

Material Information

Title:
Characterization of the pathogenesis of amelanosis in the Smyth line chicken : a model of the human autoimmune disease vitiligo
Creator:
Leung, Edmund Chuan-son
Publication Date:
Language:
English

Subjects

Subjects / Keywords:
Antigens ( jstor )
Autoantigens ( jstor )
Autoimmune diseases ( jstor )
Cells ( jstor )
Chickens ( jstor )
Diseases ( jstor )
Feathers ( jstor )
Lymphocytes ( jstor )
Melanocytes ( jstor )
Vitiligo ( jstor )

Record Information

Holding Location:
University of Florida
Rights Management:
Copyright [name of dissertation author]. Permission granted to the University of Florida to digitize, archive and distribute this item for non-profit research and educational purposes. Any reuse of this item in excess of fair use or other copyright exemptions requires permission of the copyright holder.
Resource Identifier:
29059708 ( ALEPH )
50989127 ( OCLC )

Downloads

This item has the following downloads:


Full Text










CHARACTERIZATION OF THE PATHOGENESIS OF AMELANOSIS IN THE SMYTH LINE CHICKEN: A MODEL OF THE HUMAN AUTOIMMUNE DISEASE VITILIGO












By

EDMUND C. LEUNG















A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 1998































Copyright 1998

by

EDMUND C. LEUNG


































In loving rememberance of my grandmother Gertrude Chur Ho iii














ACKNOWLEDGMENTS




There are many people I want to acknowledge in making this project possible. First of all, I am appreciative of my mentor Dr. Wayne McCormack for the opportunity to join his lab and for the distinction of being his first graduate student. I thank him for passing on his knowledge and experience.

I thank my committee members Drs. Mark Atkinson, Maureen Goodenow, Ward Wakeland, and Thomas Rowe for all their suggestions, support, and encouragement. I thank Dr. Goodenow for her gift of the LTR probe in my endogenous virus study.

For all the work on the live chickens, I want to thank Drs. J. Robert Smyth, Jr., and Gisela Erf for assistance in establishing colonies of Smyth and Brown line chickens. Without their insight I would not have been able to develop this project. Drs. Jack Gaskins, Gary Butcher, Victor Apanius, Ben Mather, and Richard Miles were all instrumental in my trials and errors in learning how to perform phlebotomies on chickens and to perform injections. I am thankful for the many, many hours provided by almost a dozen University of Florida undergraduate students who were willing to come faithfully to our poultry facilities even in rainy weather. They learned how to tame these chickens enough to move them one at a time from a pen. Without them I could not have performed the cell and serum injections, the serum collection, and plucked feathers every two weeks.





iv








So I thank Sharon Richertson, Brad Copley, Jaime Sanchez, Nilesh Patel, Randy Scarboro, and Shally Wang. May they regard the experience as useful to their careers.

I thank Bruce Glick for his suggesting that I use cyclophosphamide rather than irradiation to immunosuppress the chickens. I wish I had followed this advice. I thank Robert E. Boissy for his suggestions as well.

I thank Karen Achey for all her efforts in sequencing. I thank Pat Glendon for her assistance in analyzing proteins. Rose Pratt did so much to provide cryosections of regenerating feathers. I am grateful to Paul Kubilis for his advice on statistical analyses.

And I thank the members of the McCormack lab, Cheryl Spence, Luke Utley, Javier Sanchez-Garcia, Alex Aller, Christy Myrick, David Gill, Kim Taylor, Neha Sahni, and Claudia Lazo de la Vega, and many of the volunteer students already mentioned for their friendship and technical support.

I thank my family and my friends who have made their own sacrifices to help me see this project come to fruition. I especially also want to thank Dr. Jin Xiong She for believing in my potential and offering a postdoctorate position to me.



















v














TABLE OF CONTENTS


ACKNOWLEDGMENTS ............................................ iv

LIST OF TABLES .................................................. ix

LIST OF FIGURES ................................................. x

A BSTRA CT ....................................................... xii

CHAPTERS

1. INTRODUCTION .............................................1

Autoimmunity .............................................. 1
Tolerance M echanisms .................................... 3
Loss of Immunological Tolerance ........................... 7
Mechanisms of Autoimmunity .............................. 7
Regulation of Autoimmune Responses....................... 13
Autoimmune Diseases Cause by Antibodies ................... 14
Autoimmune Diseases Caused by T cells ...................... 16
Vitiligo in Hum ans ........................................... 16
M elanocyte Biology ...................................... 17
Vitiligo Pathology ........................................ 18
The Association of Vitiligo with Other Autoimmune Diseases and the
Genetics of Vitiligo Susceptibility in Humans ............... 20
The C57BL/6J-vit/vit Mouse Model for Vitiligo .................... 21
The Smyth Line (SL) Chicken Animal Model for Vitiligo ............ 22
M elanocyte Biology ...................................... 26
Amelanosis Pathology in the Smyth Chicken ................... 30
Genetics of Vitiligo Susceptibility in SL Chickens .............. 33
Chicken Immunology ......................................... 33
Chicken Immunoglobulin Genes and B Cell Development ........ 33 Chicken T Cell Receptor Genes and T Cell Development ......... 35 T Cell Repertoire Analysis ................................. 40
Other Chicken Models of Autoimmunity ......................... 42
Limitations in the Use of the Chicken Animal Model ................ 43
Rationale for This Study ...................................... 45



vi








2. ADOPTIVE TRANSFER OF AMELANOSIS IN THE SMYTH LINE
CH ICKEN .................................................... 48

Introduction ................................................ 48
M aterials and M ethods ........................................ 55
A nim als ............................................... 55
Sex Determination by PCR ................................ 56
Immunosuppression of the Host Animals ..................... 57
Preparation of the SL Donor Cells and Cell Injections ........... 57
Smyth Line Serum Collection and Preparation .................. 57
Cell Lines and Source ..................................... 58
Im m unoblotting ......................................... 58
H istology ............................................... 59
R esults .................................................... 59
Observations of the UF Colony of Smyth Line Chickens ......... 59 Adoptive Cell Transfer Experiments ......................... 64
Serum Transfer Experiment ................................. 72
W estern Blot Analysis .................................... 76
D iscussion ................................................. 79

3. T CELL RECEPTOR y REPERTOIRE ANALYSIS OF THE EXPANDED
PERIPHERAL BLOOD y 8 T CELL POPULATION DURING AVIAN
V ITILIG O .................................................... 85

Introduction ................................................ 85
M aterials and M ethods ........................................ 89
A nim als ................................................ 89
RT-PCR and Clorung ..................................... 90
DNA Sequence Comparisons ............................... 91
R esults .................................................... 91
Phenotype of Birds Used for Repertoire Analysis ............... 91
TCR Vy 8 Repertoire Analysis .............................. 92
CDR3 Length and Amino Acid Composition .................. 100
Jy U sage .............................................. 100
D iscussion ................................................. 100

4. ENDOGENOUS VIRAL LOCI IN THE SMYTH LINE CHICKEN: A
MODEL FOR THE AUTOIMMUNE DISEASE VITILIGO ............ 106

Introduction ................................................ 106
M aterials and M ethods ........................................ 112
Southern Blot Analysis ................................... 112
Statistical Analyses ...................................... 113
R esults .................................................... 113
Phenotypic Analysis of SL Sample Population .................. 113


vii








Southern Blot Analysis of BL and SL ev Loci ...................114
Comparison of BL and SL ev Genotypes .......................122
Comparison of SL Progressor and SL Nonprogressor ev
Genotypes ........................................... 124
Discussion ................................................ 126

5. SUMMARYAND FUTURE DIRECTIONS.......................... 132

LIST OF REFERENCES .......................................... 139

BIOGRAPHICAL SKETCH........................................ 159









































viii














LIST OF TABLES


Table pg

2-1. Amelanosis incidence in the UF Smyth line colony .....................60

2-2. Adoptive transfer of amelanosis with single transfers of SL lymphocytes ..... 66 2-3. Progression of amelanosis in 5 BL5 hosts after adoptive transfers of SL
lymphocytes................................................. 67

2-4. Adoptive transfer of amelanosis with multiple transfers of SL lymphocytes .. 71 2-5. Bio Rad protein assay of gamma globulin pools and selected
serum samples................................................ 74

2-6. Adoptive transfer of SL gamma globulins into 6 week old BL 10 hosts ........75 3-1. Amelanosis stage of Smyth Line chickens at ages 2-25 weeks .............. 91

4-1. Smyth line (SL) chicken phenotypes ............................... 115

4-2. Frequencies of ev loci detected in BL, and SL chickens..................118

4-3. Frequencies of ev loci detected in SL progressing (p) and nonprogressing
(np) chickens................................................ 125

















ix
















LIST OF FIGURES


Figure DA99

1-1. A female Smyth line chicken displaying amelanosis of stage 4 .............23

1-2. A group of Smyth line chickens at various stages of amelanosis ............23

1-3. A typical pair of parental Brown line chickens ......................... 24

1-4. Model of developing feather showing the arrangement of barb ridges ........ 27 1-5. A cross section of a feather shaft and barb ............................ 28

1-6. A single barb ridge............................................ 29

1-7. Chick thymocyte development.................................... 36

1-8. Models depicting the V, D, J, and C gene segments of the T cell receptors ... 39 2-1. Frequencies of Smyth line females ................................. 61

2-2. Frequencies of Smyth Line males ................................. 62

2-3. Frequencies of Smyth line females and males......................... 63

2-4. BL5-1 11, a Brown line adoptive transfer host displaying stage 3 amelanosis .69 2-5. BL5-l 15, a Brown line adoptive transfer host displaying stage 2 amelanosis ..69 2-6. Adoptive cell transfer hosts show antimelanocyte antibody profile typical
of SL chickens................................................ 77

3-1. Partial nucleotide sequences of rearranged TCR Vy 1 genes ...............94

3-2. Partial nucleotide sequences of rearranged TCR Vy 2 genes ...............96

3-3. Partial nucleotide sequences of rearranged TCR Vy 3 genes ...............98


x










3-4. Predicted amino acid sequences of rearranged TCR Vy genes ............101

4-1. Southern blot analysis of ev loci detected as BamHJ restriction fragments .... 116 4-2. Southern blot analysis of ev loci detected as EcoRI restriction fragments ... 117 4-3. BL1 and SL chickens have similar total numbers of ev loci ................121

4-4. SL chickens have more ev-SL loci than BL1 chickens ...................123










































xi








Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy

CHARACTERIZATION OF THE PATHOGENESIS OF AMELANOSIS IN THE SMYTH LINE CHICKEN: A MODEL OF THE HUMAN AUTOIMMUNE DISEASE VITILIGO



By

EDMUND C. LEUNG

May 1998

Chairman: Wayne T. McCormack, Ph.D.
Major Department: Immunology, Pathology and Laboratory Medicine

Autoimmune diseases result when components of normally innocuous body tissues have unexpectedly undergone changes that make them appear foreign to the immune system. The immune system recognizes aberrantly expressed self proteins as nonself and recruits an immune attack on self.

In the human autoimmune disease vitiligo, the pigment producing cells of the skin, the melanocytes, are destroyed and patients manifest irregular expanding depigmented patches of skin. An animal model for vitiligo, the Smyth line chicken, displays a spontaneous loss of feather and ocular melanocytes and the feathers progressively become whiter. Fifty percent of the birds also become blind.

By adoptive transfer of splenocytes, I demonstrated that amelanosis can be transferred and mediated by lymphocytes. This is the first direct demonstration that lymphocytes mediate the disease. Prior research by bursectomy has shown antibody mediation. A role for y5 T cells was previously suggested by their expansion in number


xii








of peripheral blood lymphocytes with age in SL chickens. Sequence analysis of the T cell receptor y8 repertoire of the peripheral blood lymphocytes indicated a polyclonal expansion, rather than monoclonal or oligoclonal, a result that might be expected if they played a direct role in antigen-driven pathogenesis. The expansion of y8 T cells may be secondary to spillover from the site of inflammation at the regenerating feather pulp. A future experiment to examine the T cells found in the developing feather may demonstrate recurrence of an oligoclonal subset of T cells. This could lead to the development of therapy aimed at inhibiting clonal T cell activation.

Southern blot analysis indicates that depigmentation does not appear to show an association with the presence of integrated endogenous viruses. The genetic heterogeneity present in SL chickens and revealed by the ev genotyping shows the feasibility of genetic linkage mapping to find vitiligo susceptibility loci.

There are many diseases that have autoimmune responses to what are normally innocuous everyday proteins produced in the body. Studying autoimmune vitiligo adds one more piece to the autoimmune disease puzzle. One to two out of every 100 persons suffer from vitiligo. If a common factor can be found then preventive therapies would enhance the lives of many people.














xiii














CHAPTER 1
INTRODUCTION


Autoimmun~ty


The normal function of the adaptive immune response to a foreign antigen is the clearance of the foreign antigen (Ag) from the body. This is mainly achieved through the B lymphocyte compartment, which develops in the marrow in mammals or the bursa in avian species, and through the T lymphocyte or thymocyte compartment that matures in the thymus. The body has learned to distinguish between self-antigens and foreign antigens during T lymphocyte ontogeny. Essentially self-tolerance is established before mature T cells leave the thymus to enter the peripheral circulation for normal surveillance. Tolerance can be induced to some foreign antigens and self-antigens in the periphery by several means. Antigen presenting cells (APCs) which include B cells and various mononuclear cells (monocytes in blood, macrophages in tissues, Langerhans cells in the skin, Kupffer cells in liver, dendritic cells in lymph nodes) process and present antigen peptides in the groove of the major histocompatibility complex (MHC) molecules.

The Ag-MHC complex engages with the T cell receptor heterodimer on the surface of a naive T cell migrating through the cortical regions in lymphoid tissue. Costimulation is provided by B7 on the APC engaging CD28 on the T cell. The activated T cell then remains in the lymphoid tissue, proliferates and differentiates into armed


I





2


effector T cells. T helper 1 (Thl) cells will instruct phagocytes to clear involved tissue cells containing intracellular parasites; Th2 cells will activate the corresponding B cell in the germinal centers to multiply, undergo somatic hypermutations (affinity maturation), differentiate to become plasma cells and secrete antibodies to complex the extracellular antigen or to opsonize foreign particles for recognition by phagocytes. T helper cells will also activate cytotoxic (CTL) T lymphocytes to destroy infected cells. The goal is complete and efficient clearance of the antigen from the body. Memory B and T cells are generated in preparation for a second exposure to the antigen with B cells undergoing somatic mutation adding diversity and better specificity. This is a general description of an ideally functioning immune system (reviewed in Janeway and Travers, 1997; Abbas et al., 1991).

Inappropriate responses by T cells have been suggested to initiate autoimmunity as a result of a sustained immune response against self-antigen. Inappropriate T cell help can activate a harmful antibody response against self-antigens and activate polymorphonuclear cells (PMNs) to cause tissue damage. T helper cells will recruit cytotoxic T cells. Autoimmune antibodies can bind to the target surface antigen and cause complement-mediated cytolysis of the self tissues. Autoimmune antibodies can also initiate antibody dependent cell-mediated cytotoxicity (ADCC), recruiting natural killer cells to perform cytolytic killing of the autoantigen-expressing target cell.

Autoimmune responses can be described as a loss of self-tolerance. If there is a sustained immune response that develops against the self-antigens, it becomes chronic if the initial immune effector mechanisms can not eliminate the antigen completely. The fact that the body is constantly producing and is therefore providing a constant source of





3


the very antigen that the immune response is against makes it nearly impossible for the vicious cycle to end. The immune response intended to protect the body from foreign intruders has in the case of an autoimmune disease launched a chronic inflammatory injury against its own tissues and may in some cases prove to be lethal. Tolerance Mechanisms

Autoimimunity occurs as a result of a breakdown of tolerance mechanisms. Tolerance is achieved when T cells recognize antigen in the absence of co-stimulation but remain inactivated having received only one of the two required activation signals. Tolerance is established in peripheral tissues and maintained mainly by developing central tolerance of the developing thymocytes to self-antigens prior to exposure to the outside environment, and then by peripheral tolerance mechanisms. Bone marrowderived precursor T cells undergo the process of thymocyte education by first positive selection for cells that respond to self MHC expressed on cortical epithelial cells found in the thymus. Only those that bind the self MHC molecules with some affinity but not excessively continue to the thymic medulla for negative selection. Those that do not bind or bind to self MHC too well are deleted. In negative selection, the thymic medulla presents self-antigen on self MHC molecules as expressed on bone-marrow derived dendritic cells and macrophages. Only those thymocytes that bind with some affinity but not too excessively are allowed to leave the thymus as competent mature T cells; the rest are deleted by inducing apoptosis. So potentially self-reactive T cell clones are deleted before joining the peripheral T cell repertoire. This establishes central tolerance. This has been demonstrated in mice expressing the Mls (minor lymphocyte stimulating) gene





4


product, which can interact with a high proportion of T cells expressing particular VP3 gene segments (V08.1 subfamily; VP6). Those T cells that recognize both M/sa and the appropriate H-2 allele were eliminated during T cell development in the thymus. Ai/s is considered a superantigen (Kappler et al., 1988; MacDonald et al., 1988). Developing thymocytes that bind viral or bacterial superantigens integrated into human and mouse genomes of some strains have likewise experienced intrathymic deletion rather than anergy or peripheral suppression to provide tolerance.

Central tolerance is incomplete because not all self-antigens will be expressed in the thymus during T cell development. Therefore peripheral self-tolerance must be established. In the periphery, the mature T cell is activated by recognizing the peptide:MHC complex on a professional antigen presenting cell (APC) that must also provide costimulation of the T cell's CD28 receptor by B7 molecules on the APC. In the absence of co-stimulation, specific antigen recognition leads to anergy or deletion of the mature T cell. Those antigens expressed uniquely by peripheral organs will not normally induce clonal deletion unless transported to the thymus in sufficient amounts or brought to lymphoid tissue. This is especially the case for organ-specific intracellular selfantigens located in sequestered sites (Barker and Billingham, 1972) or self-antigens expressed below a minimal concentration level (Schild et al., 1990; Ferber et al., 1994). These are immunologically ignored because of the absence of co-stimulator activity on tissue cells. The autoreactive T cells specific for these self-antigens are usually not eliminated nor anergized unless the self-antigens become presented by professional APCs in lymphoid tissue that would break the ignorance (Aichele et al., 1996).





5


In the B lymphocyte repertoire, elimination of potentially self-reactive B cells occurs when immature B cells bind to multivalent membrane bound self-antigens during B cell ontogeny within the bone marrow. They are deleted by apoptosis by activation of the Fas receptor. This is unlike mature B cells, which become activated by multivalent polyclonal foreign antigens and CD4 T cell help. Self-reactive immature B cells may be rescued in the bone marrow by gene rearrangement events editing and deleting the sequence encoding for an autoreactive receptor to that of a different specificity that is tolerant (Comall et al., 1995). B cells in the preimmune repertoire may be excluded in the competition for follicular niches in lymphoid organs if the self-reactive B cell binds soluble or low avidity autoantigens. They are not selected to proliferate and die out in the T cell zone. Such excluded B cells can be rescued if they enlist T cell help.

There are mechanisms that help mature B cells become tolerant to self-antigens in the periphery. B cells that recognize a self-antigen as they would a foreign antigen would enter the T cell zone of lymphoid tissue. However, there would not be appropriate antigen-specific armed CD4' T cells to activate the B cells. Such T cells would not have been presented the appropriate antigen from an APC and would be absent from lymphoid tissues; thus, they would not be available to provide secondary stimulation to the B cell. Those B cells with self-antigen would end up undergoing apoptosis, although death can be delayed by expression of bcl-2. A second mechanism is seen in naive B cells just entering the periphery. Chronic exposure to the specific soluble autoantigen, such as soluble lysozyme, will cause them to downregulate surface IgM expression and the signaling pathways of activation in order to survive. These become anergic because they fail to generate CD28-dependent T-cell help. Normally, T cells would induce Fas-





6


mediated apoptotic deletion of the anergized B cell when they present autoantigen. However, in mice in which the B cells carry the Fas mutation lpr, the B cells are not eliminated, nor can T cells deficient in the Fas-ligand, gld, trigger the apoptosis of the B cells. These mice have autoimmune accumulations of lymphoid cells (Cornall et al., 1995).

B cell tolerance can be induced depending on antigen dose. High doses of antigen may overwhelm the surface immunoglobulins of B cells and induce specific unresponsiveness. This helps maintain tolerance to abundant self-proteins like plasma proteins. Very low doses of antigen in which the density of peptide:MHC complex on APCs may be too low to be recognized (that is, below the recognition threshold) by the T cells that do encounter them. Depending on the MHC genotype of an individual, some rare proteins contain peptides that may be presented at levels that are sufficient for T cell recognition but will not induce activation or tolerance. Such T cells are immunologically ignorant. They would then not be able to stimulate a B cell. T cell tolerance can be demonstrated in bone marrow chimeric animals during fetal development studies (Abbas et al., 1991). If allogeneic bone marrow is donated before the host achieves immune competence, then the developing T cell precursors would undergo central tolerance to antigens of both host and donor origin, thus tolerating self-peptides presented by both MHC genotypes.

In summary, central tolerance is established by clonal selection, strength and quality of antigen receptor signaling of the B cells, avidity of immature T cell receptors for the MHC-peptide complex, and apoptosis of deleted cells. Peripheral tolerance depends upon the need for co-stimulation by appropriate APC.





7


Loss of Immununological Tolerance

When the immune system is unable to remain unresponsive to self-molecules tolerance is broken and autoimmunity may result. There are organ-specific diseases and systemic autoimmune diseases. Two hypotheses suggest that autoimmunity arises due to defects in the establishment of central or peripheral tolerance, or a conventional immune response occurs against self-antigens that, under normal circumstances, did not need to establish tolerance and the tolerance became broken. As suggested by Lehmann et al., (1993) a circumvention by the display of previously cryptic host determinants to which the host never had the need to develop tolerance causes autoimmune recognition. Mechanisms of Autoimmunity

Autoimmunity may develop against self-antigen for a number of possible reasons. As mentioned above there may be incomplete deletions of self-reactive clones due to immunologic ignorance. This ignorance (clonal escape) may be due to the differences in genetic susceptibility based on the differences in ability of different alleles of MHC molecules to bind and present autoantigens to autoreactive T cells. Thus, in healthy individuals, there are probably autoantibodies that have been characterized as consisting of unmutated germline sequences with low avidity for autoantigens, and there are antiself T cells (Schwartz, 1993).

The genetics of autoimmune diseases has been demonstrated in many ways. The HLA haplotype has often shown associations for susceptibility. For example in diabetes, people who express the MHC class II alleles HLA-DR3 or DR4, which are tightly linked to the HLA-DQ genes (the relevant disease susceptibility genes), have a noticeably higher





8


frequency of disease (Todd, 1995; Vyse and Todd, 1996). In HLA-DQP 1, the normal Asp-57 is substituted by an uncharged amino acid residue destabilizing the DQ molecule. Other genetic factors influence susceptibility. Identical twins have a higher frequency of having the same autoimmune disease than MHC-identical fraternal twins. The hormonal status of an individual affects disease susceptibility. Many autoimmune diseases show a strong sex bias. Diabetes in the NOD mouse is more severe and occurs at a quicker onset in the female (Wicker et al., 1986). Peak incidence of autoimmune diseases that are more common in females occurs during the child-bearing period.

If antigens are expressed selectively in a specific tissue rather than ubiquitously throughout the body, such antigens would be less likely to have induced clonal deletion of autoreactive T cells in the thymus during T cell ontogeny. Antigens of peripheral tissues especially sequestered behind anatomical barriers would not come in contact with the developing T cell repertoire. Tissue cells do not express co-stimulatory molecules. However, tissue damage may occur as a result of sustained direct attack of the cells expressing the self-antigen, from immune-complex formation, or from local inflammation. These antigens then become newly available as neoantigens in the periphery and subject to immune scrutiny by T cells that had escaped deletion. An example is seen in systemic lupus erythematosus (SLE). A broad range of autoantibodies is produced against intracellular nucleoprotein components: nucleosomes, DNA, histones, and ribosomes. Immune complexes continuously can deposit on the renal glumeruli, joints, and small arteries, and subsequently recruit macrophages to try to eliminate these immune complexes in a never ending battle (Kotzin, 1996; Schwartz, 1993).





9


Autommunity may be the circumvention of self-tolerance by the induction of responses to cryptic determinants to which the host was never made tolerant (reviewed by Lehmann et al., 1993; Sercarz and Datta, 1994). The responses are by members of the self-reactive repertoire that had evaded negative selection. Changes occur causing determinant spreading and the availability of neoantigens to induce activation of autoreactive T cells out of naive T cells. Additional self-determinants previously hidden from recognition now prime other previously nave T cells with additional specificities. Intracellular as well as extracellular proteins can be presented on class II and class I MHC (Moreno et al., 1991; Nuchern et al., 1990), leading to a wide range of newly available self-antigens. Intermolecular spreading (antigenic spread from one determinant/epitope to many in the same protein) and intermolecular spreading (antigenic spread from one protein to another) recruits more self-antigens newly available for the immune system to respond to. Endogenously produced antigens have been presented by APCs as newly recognized autoantigens on activated thyroid epithelia, hepatocytes and pancreatic cells (Dayan et al., 1991; Barnaba et al., 1989; de Berardinis et al., 1988).

In NOD mice, autoimmunity seems to start against glutamate decarboxylase (GAD) and then by determinant spreading more antigens, such as insulin, have become target antigens (Tisch and McDevitt, 1996). GAD is produced by the pancreatic islet 03 cells. Recent evidence is the finding of an 18 amino acid peptide showing a high sequence homology between human GAD and the Coxsackie virus P2-C protein (Kaufman et al., 1992). This is an example of molecular mimicry as a result of a misdirected immune attack.






10

In response to an environmental change, cytokines, such as TNF-a and IFN-y (Pestka and Langer, 1987), may cause shifts in the peptides synthesized, and oxygen radicals have induced the heat shock protein (HSP) response. HSP have facilitated peptide binding onto the MHC (De Nagel and Pierce, 1992), and caused differences in self-peptides produced during stress. In the EAE model of T cell-mediated autoimmunity, Lehmann and colleagues (1992), showed that a single determinant of myelin basic protein (MBP), the peptide Ac 1-11, was the immunodominant determinant in the primary response to MBP. Other determinants were cryptic, although available. Later in the chronically diseased mice the formerly cryptic host peptide determinants became the immunodominant primers of the second immunization. This has demonstrated diversification of the T cell repertoire due to determinant spreading.

Prior infections causing tissue damage and the inability to clear immune complexes have been suggested in the induction of autoimmune disease. There are several mechanisms that have been postulated to explain how viral involvement leads to autoimmunity (Aichele et al., 1996; Nakagawa and Harrison, 1996; Barnaba, 1996). Viruses are involved in the generation of new epitopes (neoantigens) causing a loss of tolerance (breaking of immune ignorance). Goverman and associates (1993) developed a transgenic mouse to mimic the spontaneous induction and pathology of multiple sclerosis, which expressed a TCR specific for myelin basic protein. Spontaneous EAE could not develop in a sterile environment, but it could develop easily if the mice were given pertussis virus alone or even simply housed in a nonsterile facility (Goverman et al., 1993). Anti-viral immune responses may shift and recognize shared molecular





11


components in self-antigens which may have altered expression in infected tissue. Thus antibodies trigger cross-reactive autoimmune reactions to shared determinants of the self-antigens (molecular mimicry) (Douvas and Sobelman, 1991). In rheumatoid arthritis, the HLA-DR 1 alleles, which contain the QKRAA amino acid sequence in the CDR3 region, have been associated with the autoimmune condition. QKRAA sequences as expressed by Epstein-Barr virus have been found in RA patients with enhanced humoral and cellular responses (La-Cava et al., 1997).

Viruses have developed means to circumvent the host. As mentioned before, viruses may act as superantigens such as the M/s locus for T cells with certain VO3 genes, or they may provide generalized immunosuppression, such as during HIV infection. The respiratory syncytial virus induces interferon to inhibit a proliferative response by human PBMCs (Preston et al., 1995). A T cell polyclonal activation by a bacterial superantigen could likewise overcome tolerance, as in rheumatoid arthritis or in EAE in which T cell clones expressing certain VP genes all become activated. The bacterial superantigen staphylococcal enterotoxin B (SEB) activates VI38 T cells that engage the amino-terminal epitope of myelin basic protein. SEB induces relapse of the paralysis in mice that are in clinical remission and triggers paralysis in mice with subclinical disease after initial immunization with the Ac 1-11 epitope or after transfer of encephalitogenic T cell lines (Brocke et al., 1993). Thus incomplete deletions of self-reactive clones or aberrant stimulation or regulation of normally anergic clones later become newly elicited selfreactive clones.





12


Viruses can produce proteins that can regulate or counteract the antiviral responses of the host (Gooding, 1992; Marrack and Kappler, 1994). Epstein-Barr virus stimulates the conversion of uncommitted T helper cells into Th2 helper cells by the product of the BCRF1 gene which has structural and functional homology to IL-10. This allows EBV to prevent the induction of Thl-activated inflammatory responses initiated by such cytokines as IL-I, tumor necrosis factor, and interferon-y. The herpes simplex virus induces the infected cell to express HSV-Fc receptor, a heterodimer of glycoproteins E and I, which binds to the Fc region of the host's nonimmune IgG. This binding prevents complement-mediated lysis of infected cells by blocking access to the cell surface of antiviral antibody or effector cells (Bell et al., 1990). Cowpox virus codes for a soluble glycoprotein that has amino acid homology to that of the IL-i receptor. This product probably competes with cell-bound IL-I receptors for secreted IL-1, interfering with the activation of IL-I cytokine-mediated inflammatory responses.

In persistent infections, such as in autoimmune hepatitis, the infected tissue is destroyed during long-term chronic inflammatory responses to the replicating virus itself, or is destroyed by the cytotoxic T cell response to the viral antigens presented on the target tissue. This destruction inadvertently and continuously releases large quantities of the organ's self-antigens (especially those never exposed extracellularly) which become presented by professional APCs in lymphoid tissue (Koziel et al., 1992; Cerny et al., 1994). Wounds may also disrupt tolerance by causing the release of self-antigens normally protected.





13

Endogenous viruses can also deregulate the expression of normal gene products. By their integration into the chromosome of the host, they cause interruptions in the normal functions of the genes and their protein products. Endogenous viruses can inactivate genes by premature termination of protein synthesis due to the addition nucleotides encoding a stop codon. Integration of endogenous viruses can create mutations that enhance transcription, and may therefore cause chronic protein expression. More about endogenous viruses will be discussed in Chapter 4. Regulation of Autoimmune Responses

Immune regulation can either encourage the initiation of autoimmunity or act to maintain the tolerance. Cyclosporin is a potent suppressor of graft versus host disease (GVHD) and autoimmune diseases, including the suppression of amelanosis in the Smyth line chicken (Pardue et al., 1987). However, cyclosporin has also been shown to induce autoimmunity (Sorokin et al., 1986).

Adhesion molecules and cytokines can affect autoimmune processes. In the EAE model for multiple sclerosis, transforming growth factor (TGF)-o provided protection when the injection occurred for the period of 5-9 days after immunization with MBP; there was no protection if TGF-P was administered before (days 1-5) or after (days 911). TGF-0 is immunosuppressive to the Thl-produced interferon (IFN)-y in response to the presence of MBP (Santanbrogio et al., 1993). This Thl-mediated autoimmune disease was examined by Racke and colleagues (1995) for the role of co-stimulatory molecules. They demonstrated that in vitro activation of MBP-specific lymph node cells was inhibited by the combination of B7-1 and B7-2 activation. However in actively





14


induced disease, administration of anti-B7-1 reduced disease; anti-B7-2 exacerbated disease. In murine diabetes, intercellular adhesion molecule 1 (ICAM-1) is involved in recruiting lymphocytes to the pancreatic islet cells. Cytokines interferon-y and tumor necrosis factor-ao secreted by the islet cells could induce the ICAM-1 expression on pancreatic 03 cells, and immunointervention by anti-ICAM-1 and anti-LFA-1 mAbs would significantly prevent the development of diabetes (Yagi et al., 1995). Whereas the administration of cytokines promotes IDDM, the administration of mAbs against Thlproduced cytokines blocks the development of the disease (Song et al., 1996; Mossman and Coffman, 1989; Maclaren and Atkinson, 1997).

Oral tolerance has been a method of antigen-specific immunotherapy for autoimmune disease (reviewed by Hafler and Weiner, 1995; Muir et al., 1993). The use of low doses of orally administered autoantigens is suggested to utilize the secretion of downregulatory cytokines such as TGF-p and the Th2 responses of IL-4 and IL-10 to cause active suppression. High dose therapy induces anergy, the unresponsiveness of Thl function in a systemic presentation of autoantigen. Intermittent injections of the autoantigen insulin, or the B chain of insulin in incomplete Freund's adjuvant, induces an active suppressive response that induces a protective insulitis in the NOD mouse model of diabetes (Muir et al., 1995).

Autoimmune Diseases Cause by Antibodies

Autoantibodies may bind to autoantigens on the cell surfaces or extracellular matrix and initiate tissue damage similar to type II hypersensitivity. By interaction of the bound antibody with Fc receptor-bearing macrophages, there is increased clearance of






15

red blood cells in autoimmune hemolytic anemia. These IgG- or IgA-coated cells may fix complement to lyse these RBCs. The binding of autoantibodies to cells in tissues allows for the fixation of sub-lytic doses of the membrane attack complex of complement proteins to stimulate an inflammatory response recruiting inflammatory polymorphonuclear cells and natural killer mediated antibody-dependent cell cytotoxicity to cause tissue damage. An example of this is seen in Hashimoto's thyroiditis. Autoantibodies binding to a cell surface receptor can cause excessive activity by the receptor or inhibit its stimulation by its natural ligand. Patients become hyperthyroid in Grave's disease because antibodies to thyroid stimulating hormone prevent normal feedback to the production of thyroid hormone. Antibody response to soluble antigens produces immune complexes that are normally cleared by red blood cells, which have complement receptors, and phagocytes, which have complement and Fc receptors. Failure to clear immune complexes leads to persistent presence and deposition, especially after tissue injury continues to generate more of the antigen as in serum sickness, and chronic infections such as bacterial endocarditis, and systemic lupus erythematosus. In SLE, antibodies are formed against ubiquitously found intracellular nucleoproteins of all nucleated cells, such as DNA, RNA, and histones. Immune complexes are formed that deposit on the walls of small to medium blood vessels, especially in the renal glomeruli. These complexes attract complement and PMNs, causing more tissue damage and starting the cycle again. SLE is considered therefore a systemic rather than an organ-specific autoimmune disease.

Mothers pass on their IgG antibodies to the fetus through the placenta. Babies born to mothers with IgG-mediated autoimmune diseases may often show the symptoms





16


similar to that of the mothers temporarily, until the baby starts manufacturing its own antibodies. This describes one form of passive adoptive transfer of autoimmunity. Autoimmune Diseases Caused by T Cells

Autoimmune T cells may also be directly involved in tissue destruction or in causing inflammation by activating macrophages, as well as being necessary to maintain autoantibody responses. They require the autoantigen presented on MHC with costimulatory ability from a professional APC and at sufficient quantities to interact in lymphoid tissue in order to initiate an autoimmune response. In insulin-dependent diabetes mellitus, the insulin-producing 3 cells of the pancreatic islets are selectively destroyed by CD8' T cells, which have received inappropriate activation from CD4' T cells that were activated by APCs. The specificity of the autoantigen as the target of destruction can be seen in pancreas transplants when, even though the graft is from an identical twin donor, the recipient's T cells destroy the graft.

Vitiligo in Humans


Vitiligo is an acquired melanin pigmentary disorder of the epidermis and hair follicles, manifested by expanding, irregular, depigmented lesions of the skin. Vitiligo can appear at any stage of life (LePoole et al., 1993) but half of those affected develop vitiligo before the age of 20. Vitiligo is a common disease, affecting 1-2% of the population in all racial groups worldwide. It is otherwise asymptomatic and most patients remain physically in good health. However it does predispose affected persons to sunburn skin damage and an 180-fold increased risk of melanoma (Dunston and Halder, 1990). The often severe cosmetic disfigurement has psychological effects and





17


current treatment modalities for vitiligo, such as phototherapy with psoralens and high intensity UV-A irradiation (PUVA), are difficult, expensive, and usually disappointing (Grimes, 1993).

Melanocyte Biology

Melanocytes, which are located in the epidermis of the skin, produce the pigment melanin, and release the melanin to keratinocytes. The biosynthesis of melanins occurs in melanocytes, and the enzyme tyrosinase catalyzes several of the initial steps of melanogenesis, which occurs within the melanosome organelle of the melanocyte (Orlow et al., 1993; Prota, 1988; Bennett, 1993). This includes the hydroxylation of tyrosine to dopa; the oxidation of dopa to dopaquinone and intermolecular circularization and oxidation of dopaquinone to dopachrome. Divergent paths then take place. In the presence of metals, dopachrome eventually becomes 5,6 dihydroxyindole, which ultimately undergoes oxidative polymerization to create eumelanin. In the presence of cysteine, the sulfur-containing phaeomelanins and trichochromes are polymerized. The black eumelanins are insoluble in all solvents and the phaeomelanins, the browns and reds, are alkali-soluble.

Two of the enzymes involved in melanin biosynthesis are characterized in studies using mutations in the mouse at the albino locus, which encodes tyrosinase, and the brown locus, which encodes tyrosinase related protein-1 (TRP-1). Trp-1 has a 43% identity to tyrosinase at the protein level. Due to two amino acid substitutions, the homozygous b/b mouse produces brown melanin which at physiologic pH, is soluble instead of the black melanin produced in the wild type which is insoluble. During





18

melanin synthesis, TRP-1 appears present only in unmelanized stage I and stage II melanosomes, and tyrosinase is primarily found in late stage III and IV melanosomes. Both are found in the Golgi and trans-Golgi and then enter a LAMP-1-positive (a marker for organelles of the endosomal-lysosomal lineage) organelle that is consistent with a late endosome (Orlow et al., 1993). The mature melanosomes travel along the melanocyte dendritic processes from which they are transferred to the keratinocyte for depositing. Vitiligo Pathology

There are several theories to explain the etiology of vitiligo, including self destruction of the melanocyte, the neurogenic, the immune, and the genetic (Ortonne and Bose, 1993; Ortonne et al., 1983). Vitiligo is characterized by inherent melanocyte defects, loss of melanocytes accompanied by T cell infiltration in the affected tissue (Le Poole et al., 1993b; Hann et al., 1992; Badri et al., 1993; Erf et al., 1995b), disturbances in peripheral blood lymphocyte subpopulations (Mozzanica et al., 1990; Abdel-Nasser et al., 1992; Erf et al., 1995a), and the presence of serum autoantibodies directed against melanocyte antigens (Harning et al., 1991; Austin et al., 1992; Searle et al., 1993). Park et al. (1996) suggest that the antibodies are directed primarily against a 65 kDa antigen. Both antibody-dependent cellular cytotoxicity (ADCC) and complement-mediated damage have been induced to cultured human melanocytes by anti-melanocyte antibodies from the sera of vitiligo patients (Norris et al., 1988). This suggests a possible role for autoantibodies in vitiligo. Two groups have demonstrated that the antibodies in the serum of vitiligo patients is against tyrosinase (MW of 70 kDa) an enzyme involved in the biosynthesis of melanin by the melanocytes (Fishman et al., 1997; Song et al., 1994).





19

Enzymes have been known to be autoantigens in various autoimmune diseases; GAD is a major autoantigen in the NOD mouse model of diabetes (Maclaren and Atkinson, 1997).

The melanocytes have been shown in vivo and in vitro to have intrinsic aberrant morphology, increased tyrosinase activity and increased acid phosphatase activity (Boissy et al., 1983, 1986), suggesting that an underlying melanocyte defect may predispose these cells to abnormal antigen presentation, which may be important for pathogenesis (Boissy et al., 1991). Abnormal presentation may be possible, considering the abnormal expression of class II HLA molecules by perilesional melanocytes in about 2/3 of the patients studied, as well as a six-fold increase in expression of ICAM-1 (Al-Badri et al., 1993; Ahn et al., 1994). The endoplasmic reticulum found in the melanocytes is irregularly dilated and circular rather than narrow and elongated, floccular material can be found within the cisterna (Boissy, 1991; Hafler, 1995; Im et al., 1994), and membrane bound compartments of melanosomes that contain autophagocytic activity possibly bound for lysosomal destruction have also been observed (Im et al., 1994). Yet it has not been proven that these melanocyte defects actually are toxic.

The presence of an inflammatory rim of cellular infiltrates detected in inflammatory vitiligo skin coincided with the loss of melanocytes, and infiltrating T cells in the epidermis were frequently juxtaposed to the remaining melanocytes. This rim of cellular infiltrates was in the perilesional skin in the basal layer of the epidermis and with the destruction mainly by CD8' T cells. These melanocyte abnormalities are present prior to the presence of mononuclear infiltration (Boissy et al., 1983, 1986). Keratinocytes may contribute to the HLA-DR class II presentation of melanocyte antigens following phagocytosis of melanosomes within the destroyed melanocytes (Le Poole et al., 1996).






20

Immunohistochemical studies have shown the actual loss of melanocytes (LePoole et al., 1993). Melanocyte loss is accompanied by epidermal and dermal lymphocyte infiltrations in the active lesions (Hann et al., 1993; Badri et al., 1993) with increases in both CD4' and CD8' T cells (Hann et al., 1993). Cellular infiltrates have IL2 and IFN-y expressed, indicating a possible Thl recruitment (Abdel-Nasar et al., 1994). The Association of Vitiligo with Other Autoimmune Diseases and the Genetics of
Vitiligo Susceptibility in Humans

Vitiligo is inherited as a polygenic trait and probably involves mutations in at least 3 or 4 autosomal recessive genes (Lacour and Ortonne, 1995; Bhatia et al., 1992). The risk of developing vitiligo appears to be strongly dependent on one's kinship to the proband and not dependent on gender. The relative risks, whether parent, sibling or offspring of probands, show considerable variation, pointing to a lack of involvement of a single gene with complete penetrance (Majumder et al., 1993). However, the high frequency of familial aggregation of the disease in association with other autoimmune/endocrine diseases, and the presence of organ-specific autoantibodies in the first and second degree relatives of the patients gives support to a genetic predisposition in vitiligo (Mandry et al., 1996).

Recent data suggest that human endogenous viruses may be involved in the pathogenesis of a variety of human autoimmune diseases, such as diabetes, systemic lupus erythematosus, rheumatoid arthritis, psoriasis, and inflammatory neurologic diseases (Yoon, 1990; Umrnovitz and Murphy, 1996). Vitiligo may indeed be triggered by a viral infection in select patients (Grimes et al., 1996). Affected vitiligo patients can also express the hypothyroidism found in Hashimoto's thyroiditis, Grave's disease, and





21

alopecia universalis (loss of hair). Thus vitiligo's association with other autoimmune diseases (Elder et al., 1981; Shong and Kim, 1991; Schallreuter et al., 1994a; Nath, 1994) has categorized it within the Autoimmune Polyglandular Syndrome I diseases.

There is evidence suggesting a neuronal involvement in the disease in order to explain the segmental and symmetric distribution of depigmentation found in some patients or why there is a lack of depigmentation below the level of spinal cord injury in a patient with transverse myelitis and vitiligo. In a study of dermal nerves in vitiligo patients, Al'Abadie and colleagues (1995) concluded that cycles of initial events of vitiligo may cause axonal damage with later nerve regeneration. They suggested that the destructive mechanism of melanocytes may be triggered by the neurotransmitters released by nerve endings which are of close proximity to the melanocytes. Studies of neuropeptide and neuronal marker immunoreactivity in skin biopsies such as neuropeptide Y (NPY), support the theory that there is neuronal involvement in vitiligo and that NPY may have a role in the pathogenesis of vitiligo (Al'Abadie et al., 1994).

The C57BL/6J-vit/vit Mouse Model for Vitiligo


Researchers normally gravitate to the mouse in order to identify an animal model that depicts the disease condition in the human. Such exists in the C57BL/6J-vit/vit mouse model for vitiligo, which progressively loses much of its epidermal and follicular pigment cells during successive shedding of fur. Eyes are also affected (Lemrner 1986; Lamoreux et al., 1992). This has been mapped to a recessive allele of the microphthalmia gene locus (mivi') (Halaban et al., 1993; Lamoroux et al., 1993). The mi gene has been identified as a member of a basic-helix-loop-helix zipper transcription factor family





22

(Hodgkinson et al., 1993) able to bind transcriptional control elements in melanocytespecific genes. This mivit allele has a single G-to-A transition, causing an Asp222Asn substitution in the first helix domain (Steingrimsson et al., 1994). The mi"it gene product of the mouse and the Mitf equivalent in the human regulate the expression of melanocytespecific genes including TRP-l and TRP-2 (Bertolotto et al., 1996; Yasumoto et al., 1997). However, this strain of mice does not exhibit an autoimmune component comparable to what is seen in the human, and the affected tissues fail to show a lymphocyte infiltration (Lemer et al., 1986; Boissy et al., 1987). The premature death and cytological aberrations found in this strain is considered to be the consequence of an innate cellular defect; it has been concluded that the depigmentation is the result of a genetic defect that is not initiated by a systemic or local condition (Im et al., 1994) and so it is not a suitable model for human vitiligo studies.

The Smvth Line (SL) Chicken Animal Model for Vitiligo


The Smyth line chicken represents a good animal model for the study of human vitiligo (reviewed by Smyth et al., 1981; Smyth, 1989). SL chickens are characterized by a spontaneous loss of feather and ocular melanocytes beginning around 6-8 weeks posthatch (Figure 1-1 and 1-2); thus, feathers progressively become whiter rather than maintain the original brown feather color of the parental Brown line strain (Figure 1-3).

The progenitor of the Smyth line was a spontaneous amelanotic female hatched in 1971 from the Massachusetts Brown line, and since then, a current frequency of approximately 1-2% of the Brown line spontaneously becomes amelanotic. From






23

























Figure 1-1. A female Smyth line chicken displaying amelanosis of stage 4 Figure 1-2. A group of Smyth line chickens at various stages of amelanosis.






24


































Figure 1-3. A typical pair of parental Brown line chickens.





25




outcrosses to various other chicken lines and backcrosses of the original mutant back to the Brown line, the delayed amelanosis (DAM) line, later renamed the Smyth line, was developed by selection for onset of amelanosis and severity (Smyth et al., 1981). Since the fifth generation, the Smyth line has closely resembled the parental line and three novel MHC B alleles are segregating in both lines (Erfet al., 1995a).

Pigment and melanocyte loss in SL chickens can range from partial to complete amelanosis, and about 50% of depigmented birds are blind due to melanocyte destruction in the choroid and retinal pigmented epithelium (Smyth, 1989). The magnitude of amelanosis in any Smyth line bird depends on the time frame of each feather's development when melanin synthesis and pigment deposition are destroyed. Up to 90% of a hatch will exhibit the amelanotic phenotype as reported by Smyth (Smyth, 1989) although as described in chapter 2, only about 60% are amelanotic in the University of Florida colony.

SL chickens also have an increased incidence of thyroiditis/hypothyroidism resembling human Hashimoto's thyroiditis, and a defeathering defect analogous to human alopecia (Smyth, 1989). Thus it is characterized by the same features as human vitiligo, including an association with other autoimmune diseases (Elder et al., 1981; Schallreuter et al., 1994; Shong et al., 1991). SL melanocytes have been shown in vivo and in vitro to have intrinsic aberrant morphology, increased tyrosinase activity, and increased acid phosphatase activity (Boissy et al., 1983, 1986), suggesting that, as in human vitiligo (Boissy et al., 1991), an inherent melanocyte defect may be important for pathogenesis.





26




Melanocyte Biology

As in the human, the melanin pigment is a product of melanosomes, the melanocyte cytoplasmic organelles that produce the pigment granules. The ocular melanocytes, as well as the choroid and anterior surface of the iris of the eye, originate from pleuripotent cells in the embryonic neural crest (Smyth et al., 1981; Smyth, 1989). The retinal pigmented epithelium and the iris are derived from the optic cup. The undifferentiated melanoblasts congregate as dermal reservoirs initially populating outside near the base of the growing feather pulp follicle (Figure 1-4). Melanoblasts migrate through the feather pulp toward the periphery of the pulp and align near the basement membrane interface of the barbed ridges and the pulp (Figure 1-5). Dendritic extensions extend from the melanocytes to the barbule cells, where melanin granules are deposited in a situation similar to the keratinocyte in the human skin. After the barbule cells receive pigment, the melanocytes retract and degenerate (Smyth, 1989; Figure 1-6).

In chickens, tyrosinase was the only known catalyst of melanogenesis (Smyth, 1989). However, more recently, tyrosinase related protein, TRP-1, but not tyrosinase, has been detected by serum autoantibodies of Smyth line chickens (Austin et al., 1995). There are five tyrosinase isozymes each with a molecular weight of approximately 66 kDa, and an additional nine other proteins that have been isolated from cultured chicken melanocytes and are assumed to be involved in melanogenesis. Dopa (dihydroxyphenylalanine) is one of the intermediate products produced by tyrosinase and can be used in tyrosinase detection (White, 1983).















Ear/ne



Order of fioration of khqher parts


Lain!t







lsohronous segments




Rachidial ridge



Main barb ridges: Joined to rachidial ridge Not yet joined to rachidial ridge Hyporachidial ridge
Sieof original Epidermal collar ventral locus
Rantogcnic zone Z on of most active cell proliferation Nlas pat ofteaherSites of daughter IISm! id '* ventral loci


M ainatrf athe Vastrol sIde

Figure 1-4. Model of a developing feather showing the arrangement of barb ridges as basilar and intermediate cells rearrange themselves into barbs. The barbs are laid out in a spiral course, extruded by the addition of cells upward away from the epidermal collar (base). They grow axially (along the shaft of) and tangentially (perpendicularly): the sum of these vectors is a spiral. The barbs are carried upward by the lengthening pulp and pushed obliquely outward. The feather (vane) will arise from the oldest or tip of the feather as the vane spreads out radially. The sheath and pulp have been removed in this depiction. Adapted from Avian Anatomy-Integument. Lucas and Stettenheim, 1972. Public domain for public use from the Agricultural Res. Service, USDA.













Mmt-Epidermis of follicle Feather sheath
'~ Rachis
Barb:
Distal barbules
Proximal barbulcs Ramogenic column

Mclanocytes
SPulp



0.1 mm.


Figure 1-5. A cross section of a feather shaft and barbs perpendicular to the previous figure. The barbs radiate obliquely from the rachis (shaft) the melanocytes at the junction of the pulp and base of the feather follicle. Melanocytes have migrated from the dermis outside of the feather follicle into the pulp and congregate at the periphery of the pulp in the region of the barb cells and begin to penetrate the epidermis. They migrate in to the epidermis through the basement membrane and line up in the barbs. The melanocytes then extend dendrite processes distally outwards depositing melanin in the barbule cells. Note the outer zone of pigmented barbule cells and the inner not pigmented zone. Melanocytes are continually supplied at the base of the feather follicle; they provide pigment granules to the section of the feather as it develops and then degenerate. Adapted from Avian Anatomy-Integument. Lucas and Stettenheim, 1972. Public domain for public use from the Agricultural Res. Service, USDA.


























Feather sheath~ e

Cells of proximal
barbules (lightly
Axil place Cells of distal barbul: pigmented)

Cells of proximal Fully pigmented -Melanin granules
Cells ofpoia in cytoplasm

barbules (lightly fReceiving pigment Axial plate
pigmented) *
Not yet pigmented

Barb septum
Barb septumof m lano
-'Pro~cess of mela tl~ctt

Ramogenic column Ramogenic column:
(obscured by Medulla
melanocyres) &Bdv of mclanoc, y te Corte
Nucleus of epidermal cell
Basilar layer (outside melanoc yr) Pulp epithlium
of epidermis

0.05 mm.


A B








Figure 1-6. (A) A single feather barb ridge. The melanocytes extend dendritic processes distally (perpendicularly) outwards depositing melanin in the barbule cells. Note the outer zone of pigmented barbule cells and the inner not pigmented zone. Melanocytes are continually supplied at the base of the feather follicle; they provide pigment granules to the section of the feather as it develops and then degenerate. (B) In this single barb the melanocytes have degraded and disappeared after they have completed their function. Adapted from Avian Anatomy-Integument. Lucas and Stettenheim, 1972. Public domain for public use from the Agricultural Res. Service, USDA.






30




Amelanosis Pathology in the Smyth Chicken

As in human vitiligo patients, the Smyth line chicken melanocyte is the target of autoimmune destruction, but instead of the skin and hair follicles, the feathers, the choroid, and retinal pigmented epithelium are affected. Both autoantibodies and cellmediated immunity may be involved in the pathogenesis of vitiligo in the Smyth line animal model. Melanocyte-specific autoAb have been detected 1-4 weeks prior to depigmentation in SL chickens, as observed in humans, and the autoAb have been shown to recognize at least three melanocyte proteins between 65 and 80 KDa, which are localized to the melanocyte cytoplasm and plasma membrane (Austin et al., 1992). Because the enzyme tyrosinase is involved in the biosynthesis of melanin, and because enzymes are known to be autoantigens in other autoimmune conditions, tyrosinase has been suggested as a possible autoantigen for vitiligo. It was recently shown that Trp-1, the most immunogenic of the tyrosinase-related proteins, is a major autoantigen recognized by serum autoAb in SL chickens (Austin et al., 1995).

The Smyth Line chicken demonstrates a functional immune system capable of providing an autoimmune response in the initiation and progression of melanocyte destruction. If the immune system is experimentally voided or suppressed then it might be expected that the amelanotic condition may be eliminated or reduced. When the B lymphocytes are essentially eliminated by neonatal bursectomy the effect is a decrease in the incidence and severity of amelanosis (Lamont and Smyth, 1981). Cyclosporin A treatment and corticosteroid-induced immunosuppression result in a decreased incidence





31

and severity of amelanosis in the Smyth Line chicken as long as the treatment continues. However, when the therapy is stopped the amelanosis will be as severe as littermate nontreatment controls (Boyle et al., 1987; Pardue et al., 1987).

It appears that the MHC locus influences the disease progression. Three MHC alleles have been found segregating within Smyth line chickens and sublines have been established (B101, B102 and B103). Of the three, B101 exhibits the earliest age of onset and the most severe phenotypes (Erf et al., 1995a).

Evidence for T cell involvement in amelanosis in the Smyth chicken is less extensive. Studies have demonstrated that cyclosporin A, a potent inhibitor of IL-1 and IL-2 release that normally stimulate PBMLs and NK cells, can measurably reduce the incidence and severity of amelanosis in SL chickens (Pardue, 1987). There is also histological evidence of an intense T cell involvement in amelanosis of the SL chicken (Erf et al., 1995b). Lymphocytic infiltration is consistently seen associated at sites of melanocyte destruction (Smyth, 1989) which have recently been shown to be primarily T cells (Erf et al., 1995b) as detected by polyclonal and monoclonal antibodies against functionally important surface T cell molecules (Cooper et al., 1991; Chen et al., 1988; Chen et al., 1989; Char et al., 1990; Lahti et al., 1988).

T cells infiltrate growing feather pulp as much as 6 weeks prior to visible signs of vitiligo. Significantly greater numbers (9-14 fold) of T cells of all three subpopulations, y 8 (detected by TCR1), Vo3l' xpl1 (detected by TCR2), and VI32'oP2 (detected by TCR3) are found present in cross sections of the feather pulp in SL as compared to BL prior to and throughout amelanosis. Of note are the proportions of TCR2' cells being





32


significantly higher, and of TCRl' cells being significantly lower, as compared to Light Brown Leghorn control birds (LBL, a related line with similar plumage but no incidence of vitiligo) (Erf et al., 1995b).

Initially, both the SL and control BL have a CD4 /CD8 ratio close to 1. Prior to and early in the amelanosis, CD4' T cells are found histologically in a central, perivascular region within the confines of the feather pulp. As the disease progresses, the ratio decreases to below 0.4 (indicating mainly CD8 cytolytic cells) but then rebounds to about 0.8 late in the disease (indicating an increase in CD4 cells, probably to recruit B cells). Mainly CD8 cells remain after the melanocytes have been destroyed (CD4+/CD8+ ratio of 0.3). The shift in the CD4/CD8 ratio from below 0.4 back to 0.8 in late disease suggests the activation of T helper 2 (Th2) cells involved in a humoral response to melanocyte autoantigens released during their destruction. In the later stages of amelanosis CD4 cells become scattered throughout the pulp and surrounded melanocytes. CD8' T cells are observed throughout the pulp and are most abundant near the epithelial barb ridges and associated with melanocytes (Erf et al., 1995b). This indicates that the CD8' T cells have penetrated beyond the pulp to get to the melanincontaining barb ridges.

A working hypothesis for the pathogenesis of amelanosis found in the Smyth line chicken is that there are inherent defects in the Smyth line melanocyte that cause the cells to self-destruct. These cells may self destruct or possess a quality that predisposes them to abnormal antigen expression. Abnormal presentation by the melanocytes themselves may target them for CTL-mediated destruction. This releases the internal components of





33


the cell as neo antigens that the immune system responds to by the production of autoantibodies.

Genetics of vitiligo susceptibility in SL chickens

Three SL sublines have been described, and each one is homozygous for a different MHC haplotype (B'01, B102, and B103) based on serological typing (Erf et al., 1995a). While all three sublines are similar in incidence of vitiligo, the B101 SL subline has the earliest age of onset, with more severe expression of vitiligo, and a greater incidence of blindness due to retinal dystrophy as compared to the B102 and B103 sublines. Interestingly, the three SL sublines also exhibit differences in the distribution of T cell subpopulations in peripheral blood as compared to the controls, LBL and Brown line (BL, the parental line from which SL was derived, with a 2% incidence of vitiligo). B101 SL chickens at 40 weeks of age contained significantly fewer CD4' and TCR2 c43 T cells and significantly more TCR1 y8 T cells in peripheral blood lymphocytes (PBL) of 40 week-old SL chickens (Erf et al., 1995a). This increase in PBL y8 T cells is detectable as early as 13-18 weeks of age (Erf and Smyth, 1996). Similar differences were found in the B102 subline, but not in B103 subline.

Chicken Immunology

Chicken Immunoglobulin genes and B cell development

Antibodies or immunoglobulins (Igs) are the antigen specific receptors produced exclusively by the B lymphocytes. They bind soluble antigens (proteins, nucleic acids, polysaccharides, lipids, and small chemicals) by recognizing conformational determinants of the antigens in their native three-dimensional form as well as determinants unmasked






34 I


by denaturation or proteolysis. During the different phases of their maturation as an adult cell, the B cell provides both cognitive and effector functions for the humoral immune response. With their membrane Ig receptors, B cells recognize and respond to specific antigens. Through their MHC class 11 they present processed Ag to T cells. Following antigenic stimulation they become effector cells by releasing serum Ig as plasma cells.

All progenitor B cells develop from pleuripotent stem cells that migrate from the embryonic thoracic aorta to the yolk sac, where the Ig heavy chain undergoes D-J rearrangement, and then colonize the spleen, yolk sac, and bone marrow. In these organs the cells rearrange the VH and then the VL genes, resulting in surface 1gM expression. Between embryonic days 8 and 14 about 20,000 to 30,000 of these B cells start to accumulate in the bursa (Reynaud et al., 1987).

Mammalian B cells rely on large numbers of germline Ig gene segments and the combinatorial diversity of Ig gene rearrangement to generate a diverse Ab repertoire, which occurs continuously throughout life, in the bone marrow. In contrast, chicken Ig genes undergo rearrangement of single functional VH and VL gene segments within a short time period during embryogenesis. Then diversity is generated in the rearranged variable regions by somatic gene conversion using a pool of pseudogenes as sequence donors (Reynaud et al., 1987; McCormack et al., 1993).

Gene conversion provides a progressive substitution of the sequence within the functional VL or VH gene with sequence blocks donated or copied from the nonfunctional pseudogenes. Progressive overlapping replacement events efficiently corrects out of frame joints and expands the diversity (McCormack et al., 1993). After 6 months the





35


bursa involutes, and no new B cell development occurs. The B cell population is maintained by the proliferation of a post bursal population. Chicken T cell receptor genes and T cell development

T cells recognize antigens that are linear processed fragments of foreign proteins, but only when presented to the T cell receptors (TCR) in physical association with a self MHC molecule expressed on the surfaces of syngeneic antigen presenting cells or on target cells. TCR are heterodimer plasma membrane proteins and the surfaces that bind the peptide-MHC complex are expressed as unique determinants, which differ in one clone from another, providing different antigen-MHC specificities. The particular TCR will recognize peptides associated with either class I MHC or class II molecules, which are also recognized by the CD8 or CD4 coreceptor molecules, respectively.

Both TCR ct3 (50kDa) and y8 (40kDa) receptor molecules are disulfide-linked heterodimer glycoproteins noncovalently associated with a CD3 complex as in mammals (Sowder et al., 1998; Chen et al., 1989; Char et al., 1990). They are identified by antiTCR antibodies: y8 (TCR1) (Sowder et al., 1988), acl1 (TCR2) (Cihak et al., 1988; Chen et al., 1988), and aP32 (TCR3) (Chen et al., 1989; Char et al., 1990).

Chicken precursor T cells originate from pleuripotent stem cells in the embryonic thoracic aorta that then colonize the spleen, yolk sac, and bone marrow. Thymocyte progenitors enter the thymus in three waves into the thymic epithelium, which produces P2 microglobulin as a chemoattractant (Dunon et al., 1990). Each wave of progenitors will give rise to all three different forms of T cells, always in the order of yS, Vol1p3, and V32ct 1 (Figure 1-7).









Chicken thymocyte development
y I /' ,

\ - -lstwave
-I2nd wave
- 3rd wave
I
I ,, I\
I I I I I I I I 1 1 T I I I I I I I I I I I I I I I I

1 5 9 13 17 H 4 8 12 16 20 24 28 32 36 40

Age in Days
At


thymocyte precursor influx
Figure 1-7. Chick thymocyte development. The arrows depict the three waves (timepoints) of entry of thymocyte stem cell precursor entry into the embryonic thymus with wave A starting at E 6.5, B at E12, and C at E18 (E=embryonic). Then the production of subsequent thymocytes leave the thymus as waves 1, 2, and 3. Each wave of production will produce T cells bearing first TCRI receptors, then TCR2, and lastly, TCR3. The first wave is
depicted here. Adapted from Cooper et al. (1991)





37




Chicken y8 T cells (TCRl) appear first in thymocyte development, as TCR y8 /CD3 cells. They enter the thymus at embryonic day 6 (E6), avoid thymic education and selection, migrate quickly through the thymus without clonal expansion, reach peak levels by El5, and exit after day El5 (Cooper et al., 1991; Dunon and Imhof, 1996). y8 T cells do not express CD4 or CD8 and are not self MHC-restricted, as they do not undergo intrathymic selection (Raulet, 1989; Chen et al., 1996). In the periphery, the y8 T cells reach 20-50% in the adult with a very high predominance in the intestinal epithelium and either absence or minor presence in chicken Peyer's patches and cecal tonsils (Bucy et al., 1988). They are resistant to death by receptor cross linking and apoptosis (George and Cooper, 1990) and are not subject to arrest by cyclosporin A (Bucy et al., 1990). V31+c43 cells, in contrast, are susceptible to receptor modulation and apoptotic death (Smith et al., 1989). TCR1 cells are relatively dispersed and rarely form lymphoid nodules or aggregates even in the spleen or intestine. About two-thirds will express CD8 in the spleen and intestine (Chen et al., 1988; Bucy et al., 1988) but rarely in the circulation. y8 T cells lack GVH potential and their proliferative response is relatively low (Sowder et al., 1988).

The second wave of chicken T cells enters the thymus by E12-13 and this wave contributes predominantly to the VI+ ct3 T cell subset. These do express initially CD4 and CD8, undergo thymic maturation and clonal selection, and are found mostly in the splenic periareriolar sheath and intestinal lamina propria with a CD4/CD8 ratio of 2/1. The last wave of thymocytes does not enter the thymus until El8 and contributes






38


predominantly to the VI32' c4 T cell subset, which makes up a very small percentage of the total T cell repertoire, develop like TCR2 cells, and are found in the spleen, but are rare in the intestine. They have a 4/1 ratio of CD4/CD8. Thus the three populations are produced sequentially in agreement with their ontogeny (Coltey et al., 1989).

As in mammals, the chicken TCR genes in the chicken are structurally organized quite similarly to that of Ig chains and are evolutionarily conserved at the protein level to mammalian TCR. Key features of chicken TCR gene organization are shown in Figure 1-8. The a and y chain variable regions are encoded by variable (V), joining (J), and constant (C) gene segments and join to form a sequence of V-J-C; the P3 and 8 chains are encoded by V, D, J, and C gene segments, with the D, or diversity, segments between V and J in order to form a sequence of V-D-J-C. The 8 chain locus is contained within the a chain locus. V, D, and J gene segments are flanked by typical recombination signal sequences (RSS) at the 3' end of V and D and the 5' end of D and J gene segments. As in the V region of the Ig molecule, there are three complementarity determining regions (CDR) and four framework regions (FR) in the V of the TCR molecule. These are involved in forming a stable three dimensional surface for binding antigen peptides presented in the major groove of the MHC molecule of an APC cell. The CDR3 is the most variable of the three CDR due to the high level of junctional diversity generated during TCR gene rearrangement.

The chicken TCR-y locus has three Vy families, three Jy segments, and one Cy segment. Eight to ten members (with high homology) are found in each Vy family. The three Jy segments are more closely related to each other than to any in mammalian









V[3i V32 DP Jp CP VP2

2V3 subgroups 1 D3 4 J3 1C13 VaV6 D8 J6 C8 Jot Cot


VaV8 1C6 many Ju 1 Cax

Vy IJy Cy


3 Vy subgroups 3 Jy 1 Cy

Figure 1-8. Models depicting the V, D, J, and C gene segments that comprise the genomic organization of the T cell receptors in the chicken. There are only 2 VP subgroups of genes, one D3, 4 J3, and one C3 that can combine from the 3 chain. The 8 locus is located within the a chain. There are 25 Ja but only a few get used. Compare this to only 2 J8. There are 3 Vy' subgroups which can join any of the 3 J'y. (Cooper et al., 1991; Chen et al., 1988; Chen et al., 1989; Char et al., 1990; Lahti et al., 1988; Sowder et al., 1988).






40


species (Six et al., 1996), but most of the substitutions are in the silent second and third position in the amino acid code. TCRP locus includes two VP families, one Do, four JP3, and one CO3 gene segment. There are approximately 6 members of the Vol family and three to five of Vf32 gene segments. Within each VP3 family there is little difference, however, the two families bear little similarity.

So it appears that combinatorial rearrangement alone provides a somewhat limited means of generating diversity in chicken T cell receptors. No sequence modifications occur in the germline gene segments from recombination alone. In a sequence analysis of TCRf3, Cooper and colleagues realized that diversity was generated almost exclusively in the junctions, creating nontemplated N regions. Every clone was found to have a distinct sequence at these N junctions between V-D and D-J in the CDR3 (Cooper et al., 199 1).

This is quite in contrast to humans and mice where there are about 50 functional V gene segments in 20-30 subfamilies of VO, plus two separate clusters each consisting of a single DP gene segment, a JPI region (with 6-7 members each), and a single Cf3 gene segment. In humans there are eight V'y gene segments with five Jy segments arranged in two clusters and one Cy' to yield 40 V-J pairings. In mice seven Vy and four Jy genes are arranged in four V-J-Cy clusters (Arden et al., 1995a, 1995b; Janeway and Travers, 1997; Rowen et al., 1996).

T cell repertoire analysis

Despite the fact that T cell repertoires may be as large as 10"' specificities, it appears that most of the T cell responses studied in animal autoimmune diseases have demonstrated restricted repertoires of responsive clones, that of oligoclonal T cell





41

repertoires (Gold, 1994). A more refined observation is that "most pathological infiltrates are either oligoclonal in nature or display oligoclonal expansions over a polyclonal background" (Pannetier et al., 1995). This is despite the fact that there may be a difference in length in the CDR3 found in any VP3-JP3 recombination junction of as many as 6-8 amino acids. For example, in experimental allergic encephalitis, T cells responding to the major epitope of amino acids 1-11 of myelin basic protein express V P 8.2 associated with either Va2 or Va4 (Acha-Orbea et al., 1988; Urban et al., 1988). In rheumatoid arthritis, Palliard et al. (1991) and Howell et al. (1991) suggested that a superantigen activated the preferred T cells expressing V33, VP 14, and V1317. Of these activated families, only T cells with specificity for synovial joint-associated antigens would then initiate autoimmune inflammatory response. These examples illustrate the limited subgroup of actual T cells clones (variants) being recruited, even though a vast number are available in the total repertoire.

If that is so, then perhaps direct targeting and functional deletion of T cells that express specific V gene products can control the autoimmunity and still maintain an otherwise intact immune system. That would be like the elimination of certain T cells that respond to the minor lymphocyte stimulating antigen (Mls) for maleness in the mouse (Scott et al., 1995). Moreover, during the course of an autoimmune disease, evidence indicates that the expressed repertoire evolves, as more antigenic determinants, previously cryptic, become available and the immune response spreads to respond to them. What may happen in the EAE system, is that the original Ac 1-11 -specific T cells may upregulate self-antigen exposure in the CNS (a usually privileged site), activating a






42


newer set of T cells to what were until then nonsequestered cryptic MBP determinants (Lehmann et al., 1993). The reverse situation may occur in which the autoimmune response is diverse initially but honed via additional waves of recruitment, which may cause a consolidation and selection to produce a more oligoclonal T cell repertoire. So the conflicting reports between restricted or diverse repertoires may just represent different stages in the development of disease.


Other chicken models of autoimimunity


There are two other chicken animal models for autoimmune diseases in humans. The Obese Strain (OS) chicken line is characterized by iodine-induced autoimmune thyroiditis, and is recognized as a model for the organ-specific disease Hashimoto's thyroiditis. Reducing thyroidal iodine by antithyroid drugs can prevent the thyroiditis. However, therapy must be administered at the embryonic stage (Bagchi et al., 1995); otherwise, the thyroiditis becomes severe by 5 weeks of age. Autoreactive B and T cells can be seen in the thyroid by 2 weeks post hatch (Wick et al., 1970). Furthermore, adoptive transfer of splenocytes from affected OS chickens to the Cornell strain (CS), a related strain that develops a mild late onset disease, causes the development of thyroiditis when the hosts were supplemented with iodine (Brown et al., 1991). It has been recently demonstrated that the T cells expressing VolI genes are the main T cells infiltrating the OS strain thyroids (Cihak et al., 1995).

The University of California at Davis (UCD) lines 200 and 206 chickens develop a hereditary scleroderma-like connective tissue disease. It develops early in life, as early as 7 days post hatch, presenting initially as swelling, erythema, and necrosis of the comb,






43


digits, and skin (Haynes and Gershwin, 1983). Survivors develop a severe lymphocytic infiltrate of the comb, skin, digits, and viscera. They develop an excessive buildup of collagen, resulting in fibrosis of the dermis and as vascular occlusions of internal organs such as the esophagus, small intestine, lungs, kidneys, heart, and testes. T helper and T cytotoxic cells are present with a CD4:CD8 ratio of 1.44:1 by week four (van der Water et al., 1989). The infiltrates also contained distinct groups of B cells as the disease progressed. These infiltrates secrete IgM, fibroblast-activating cytokines (Duncan et al., 1995), antinuclear antibodies (including antibodies to ssDNA), and anticytoplasmic antibodies that recognize an avian-specific set of antigenic determinants (Haynes and Gershwin, 1983). As in humans, fibroblast activation is suggested to contribute to fibrosis (Duncan et al., 1992). A defect in the T cells' response to a panel of T cell mitogens such as concanavalin A or pokeweed mitogen indicates abnormalities in T cell stimulation as seen in decreased calcium influx and proliferation (Wilson et al., 1992).


Limitations in the use of the chicken animal model


No animal can represent perfectly what is found in a human. Small mammals have become the more popular study models and often they can depict the human phenomenon reasonably well. In the case of vitiligo, the chicken presents a closer animal model due to the shared features suggesting an autoimmune component to the disease. However, the chicken is not well regarded as a relevant animal model for medical research, certainly not as extensively as the laboratory mouse. With a much more limited pool of investigators and experience, there is not an extensive network of shared technical protocols that have been developed or people aware of the chicken system to






44


begin trouble shooting this untapped resource. It takes time and a collective effort to try new ideas in the chicken just as it was for pioneers with the small mammals. Beyond not knowing if a protocol may work for a specific strain is whether the protocol already established in the mammal can be adapted to the chicken at all.

It takes 5-6 months for chickens to become sexually mature so creating congenic chickens with 12 or so crosses would require several years. Slow reproduction is a problem with animals larger than mice. Larger animals are more costly to feed, house, and have enough space for. Because the chicken is not used extensively, researchers do not attempt new technology with them and the biotechnology industry does not find the need to develop useful tools. Transgenic chicken embryos are created with the assistance of infections by variants of the Rous Sarcoma Virus. Hybridomas have been developed only in the last few years.

The genome of the chicken is just beginning to get serious attention and now only in the past 2 years has linkage mapping of the genome with readily available microsatellite markers is being started. Unlike the mouse, chickens have not been characterized genetically into well-defined lines guaranteeing the purity of a line. There is no equivalent for chicken of a library such as that of Jackson Laboratories that allows a scientist to buy a mouse, C57BL/6, or the NZW for its specific genetic features. The library of described avian cell differentiation antigens and known avian cytokines and lymphokines is also less extensive than that of the mouse and human. This limits the extent of some types of avian research, such as the cytokine profile expressed by cells in response to inflammation of the thyroid in the Obese Strain chicken.






45


A conclusion that can be made about using the chicken to study diseases in the human is that it will probably not be as readily appreciated as the laboratory mouse. It is more expensive in terms of reproduction time and cost to maintain. One really needs to be both a poultry and medical scientist. The typical medical scientist is not aware of the extensive network, knowledge, and experience that is necessary to study live chickens.

On the other hand, the chicken is the best studied vertebrate for embryogenesis and development. The egg provides a most convenient source of embryos; the shell can simply be opened to expose the living animal. It was through studying the chicken, that the concept separating the B cells as bursa-derived (bone-marrow-derived for mammals) from the T cells, as thymus derived, was clarified. Several monoclonal antibodies including those that distinguish several subsets of T cells and B cells are available and marketed for cell separations and immunohistochemnistry. At this moment, the Smyth line chicken does represent the closest model providing the best opportunity to unveil some of the unknown pathology of human vitiligo.


Rationale for this study


Vitiligo is considered an autoimmune disease. Vitiligo is not considered life threatening such as the physiological destruction of the insulin-producing cells in diabetes; nevertheless, for the 1-2% of the population with vitiligo there is a significant increased risk of skin cancer. The patient's well being and self esteem are compromised and these may cause distress because there is little the patient can do to hide the condition. The current means to treat vitiligo is to have the patient undergo PUVA





46

therapy to attempt to stimulate new melanization However the treatments are harsh, prolonged and the success rate is poor.

Often the presence of one autoimmune condition can be found to occur along with other preexisting autoimmune conditions and this is true for vitiligo. For example, vitiligo has been associated with Autoimmune Polyglandular Syndrome type 1 and vitiligo patients have increased risk for other autoimmune diseases.

Animal models have proven to be very useful in studying the pathogenesis of autoimmune diseases. In the study of diabetes mellitus, the target of autoimmune destruction is the 13 islet cells of the pancreas. The NOD mouse has been a very useful animal model to study the human disease. The insulitis has an infiltration mainly of CD8' T cells but also of CD4 + T cells to a lesser degree. The disease has been proven by many labs to be adoptively transferred using T lymphocytes. Immunotherapy targeted at the T cell has been used inhibit the progression of the disease. Autoantibodies against the islet cells are characteristic of diabetes. They proceed and are detectable before the onset of the disease. GAD has been identified as a major autoantigen; both forms of which have homology with a peptide from Coxsackie virus. Islet cell antigen (ICA) has more recently been identified as a autoantigen in diabetes. Yet, the role of the autoantibodies in causing the destruction is not clear.

The Smyth line chicken is the best available animal model for the study of human vitiligo. The melanocytes of the regenerating feather compare to the melanocytes of human epidermis and hair follicles. The depigmentation develops in patches that are irregular and expand as the process proceeds. The disease is otherwise asymptomatic in





47

both species, except in nearly 50% of the affected that become blind as well. There are similar inherent defects within the chicken melanocyte. An intense lymphocytic infiltrate with increased numbers of CD8 and CD4 T cells is associated in the chicken. Autoantibodies are detectable before the onset of amelanosis. A putative autoantigen, tyrosinase-related protein, has been detected and is related tyrosinase which is an enzyme involved in melanogenesis (Austin and Boissy, 1995).

Thus in this study of vitiligo, experiments were designed to ask some of the same questions as in other animal models of autoimmunity. Adoptive transfers of lymphocytes from affected SL chickens into non-affected BL chickens tested the hypothesis that autoimmune lymphocytes can induce the destruction of the feather melanocytes and cause the depigmentation. Likewise, the hypothesis that sera containing autoantibodies might induce disease if transferred to an unaffected host was also tested.

Since T cells have been shown in diabetes to cause the disease, the question of which subsets of T cells might be the key members involved would help define the pathology. In the peripheral blood of Smyth line chickens, the y8 T cells increase in proportion during the course of the amelanosis and with age. Therefore, a repertoire analysis of the y8 T cells in the peripheral blood was examined.

Since animal models allow one to manipulate the genotype of the animals to determine genetic causes of diseases, preliminary genetic studies of the SL chickens were performed. If certain patterns of inheritance are found that would correlate with the presence, absence, onset, or severity of the disease then this would help in the understanding and predictability of the disease. Endogenous viruses are genes that






48


encode components of retroviruses that have become integrated in the genomes of all species of vertebrate animals. They are stable and inherited in Mendelian fashion. The random integrations provide unique genetic markers that can be used to follow inheritance and examine for correlations with phenotype.

It is a goal of using animal models to provide a means to gain understanding of a human disease. This study of the amelanosis in the Smyth line chicken is being pursued to understand vitiligo in humans.














CHAPTER 2
ADOPTIVE TRANSFER OF AMELANOSIS IN THE SMYTH LINE CHICKEN Introduction


This aim is designed to determine the role and clarifyr the contribution of humoral and cellular immunity in the pathogenesis of amnelanosis in the Smyth line chicken.

In order to study and characterize the immune response, it is often an advantage to study the intact organism. To make the study manageable, experimental animals have been manipulated by various means to help study immune functions. The laboratory mouse for example, has been inbred so that the immune responses based on the MHC haplotype have been characterized and documented to minimize 'masking' of the effect of a locus or genetic region; a large collection of MHC-specific strains is available through Jackson Laboratories. This allows researchers to choose mouse strains to conduct investigations and make variants such as the NOD mouse. The variants have been developed through altering the genome either by inserting new genes to create transgenic animals, or by targeted disruption of genes by gene knockout through means of homologous recombination.

Adoptive transfer of cells or antibodies is a classical experimental approach to demonstrate immune function. The transfer of serum (the fluid phase of blood containing specific antibodies against an immunizing antigen) from an immunized individual (donor) into a naive individual (host or recipient) can confer immunity if antibodies



49





50

mediate that condition. This is passive immunization, dependent upon the antibodies generated originally by the donor by active immunization or infection. Adoptive transfer of lymphoid cells from the immune donor can provide cell-mediated immunity in a host. Transfer of cells must be done between donors and recipients genetically matched at the major histocompatibility complex (MHC) loci so that the donor cells are not rejected by the recipient and do not attack the recipient's tissues (graft versus host disease). Incompatibility may also occur despite the donor and host being identical at the MHC locus, due to differences in the minor histocompatibility antigens (Scott et al., 1995), such as the male specific H-Y antigen.

Immunosuppression of the host animal is often utilized to facilitate adoptive transfer studies because syngeneic matches in the MHC are rare in outbred populations. This pretreatment also provides a void in the immune function in the recipient host providing space for the restoration of immune function by the adoptively transferred cells (Toivanen et al., 1975). This allows the effect of the transferred donor cells to be studied in the absence of host lymphoid cells. One method of immunosuppression is by the use of ionizing radiation from X-rays or y-rays to kill off rapidly dividing lymphoid cells at doses that spare the other tissues of the body. Other means of cell depletion include neonatal thymectomy, cyclophosphamide (which acts primarily by eliminating B cells and suppressor T cells) (Toivanen et al., 1975; Harada and Makino, 1984), splenectomy, and antilymphocyte antibodies generated in another species of animals.

Adoptive transfer studies have been performed to study the functions of chicken lymphocyte subsets. Toivanen et al. (1975) compared the transplantation of lymphoid





51

cells (bursa, spleen, or bone marrow) into 4.5 week old immunodeficient chicks. Using donated bursal cells of 3 day old, 4.5 week old, or 10 week old donors, and pretreatment with cyclophosphamide (Cy), even large numbers of donated bursal cells would not bring about a long term restoration of antibody formation. Pretreatment by X-irradiation (750 rads) on the day before transplantation with 10 week old donated cells from spleen (as well as marrow, thymus, or bursa) allowed higher survival rates and body weight gains suggesting that restoration of T cell functions, but not B cell functions, was achieved. Toivanen and colleagues concluded from these studies that T cell function is more crucial to survival than is humoral immunity. A dose of 750 rads for 4.5 week old chickens was shown to be effective in allowing reconstitution of the T cell compartment, but only short term reconstitution of B cells.

Lehtonen and co-workers (1990) determined that Cy treatment destroys proliferating B cells in the bursa, and allows donor B cell reconstitution in 4 day old hosts for at least 10 weeks if 4 day old donor bursa cells were used. Irradiated with 750 rads, 4 day old hosts could again be reconstituted with T cells but not with B cells. The B cell compartment was not restored. Based mainly on these reports, our experiments utilized irradiation treatment for the adoptive cell transfer of lymphocytes from amelanotic SL chickens into BL hosts, in order to determine whether the autoimmune disease could be transferred by lymphocytes.

The transfer of autoimmune disease to host animals has been previously demonstrated by the adoptive transfer of lymphocytes in other animal models of autoimmunity. Experimental allergic encephalomyelitis (EAE) is a disease produced by injecting animals with homogenized spinal cord, myelin basic protein (MBP), and it





52

resembles the demyelinating disease similar to multiple sclerosis. It has been transferred using MBP-reactive T cells from the spleen or lymph node cells from a MBP-immunized donor to naive syngeneic hosts in mice and rats (Panitch and McFarlin, 1977; van der Veen et al., 1989). In EAE, it appears that CD4' T cells expressing a restricted, limited TCR repertoire are responsible. In humans, however, the TCR repertoire may be more diverse, with greater heterogeneity of MBP-specific T cells associated with a greater severity of disease (Richert et al., 1995; Utz and McFarland, 1994; Utz et al., 1994). Systemic lupus erythematosus was transferred to SCID mice when human PBMC were injected into SCID mice, and the SCID serum was shown to carry the human autoantibodies for up to 22 weeks (Ashany et al., 1992).

In the non-obese diabetic (NOD) mouse, a model for human insulin-dependent diabetes mellitus, several laboratories have demonstrated the transfer of insulitis and diabetes into irradiated hosts. Normally, signs of initial insulitis begin to appear by the sixth week. By 30 weeks of age, spontaneous diabetes develops in about 95% of the mice with a mononuclear cellular infiltrate within the pancreatic islets (Wicker et al., 1986). Wicker and coworkers induced diabetes within 3 weeks in greater than 95% of the hosts when the hosts were older than six weeks of age and by using unfractionated splenocytes from overtly diabetic NOD donor mice older than 16 weeks old (Wicker et al., 1986). They refined these studies further by achieving successful adoptive transfers using splenic T cells using the CD4' or CD8' T cell subsets (Miller et al., 1987). Meanwhile, Hanafusa and colleagues (1988) induced insulitis in T cell-depleted NOD mice reconstituted with the same two T cell subsets. Subpopulations of spleen and lymph node cells transferred diabetes to syngeneic neonates and demonstrated an age





53

and cell dose-dependent susceptibility range (Bendelac et al., 1987). LaFace and Peck (1989) transferred diabetes in non-susceptible C57BL/6 or B1O.BR/cd mice, and Serreze and co-workers (1988) did the same in NOD SCID hosts. T cells have been generally recognized as being mediators of autimmunity against the pancreatic 3 cells in diabetes.

Autoantibodies can also be transferred from autoantigen-immunized donors to induce the autoimmune disease in hosts. Autoantibodies to the thyroid stimulating hormone receptor from mothers with Grave's disease frequently produce thyroid activation when serum is transferred into the fetus. Because IgG can cross the placenta, infants of affected mothers can be bom with hyperthyroidism (Gossage and Munro, 1985; Becks and Burrows, 1991). Thyroiditis enduring for up to 40 days has been induced by the transfer of antiserum to susceptible strains of mice (Tomazic and Rose, 1975). Likewise in the Obese Strain chicken, the chicken model for thyroiditis, repeated injections of high titer antiserum for 4 weeks induced thyroiditis (Jaroszewski et al., 1988). In EAE, serum transfer in a rabbit model induced severe autoimmune thyroiditis (Inoue et al., 1993). Autoimmune cataract formation has been created experimentally in eyes of mice by means of serum and monoclonal antibody transfers from donors which had received injections of emulsified beta-crystallins (Singh et al., 1995).

A current hypothesis of the pathogenesis in the Smyth Line chicken suggests that there are inherent defects in the melanocytes, predisposing SL melanocytes to abnormal antigen presentation (Smyth, 1989; Austin and Boissy, 1995; Sreekumar et al., 1996). Cells and antibodies in the SL chicken become sensitized to melanocyte antigens. Presumably auto-reactive T cells associated with the melanocytes can be seen infiltrating






54

the feather barb ridges in tissue sections stained with monoclonal antibodies specific for T cell markers (Erf et al., 1995b). Austin and colleagues reported the detection of melanocyte-specific antigens between 65 and 80 kDa in the Smyth line chicken (Austin et al., 1992). More recently, Austin and Boissy (1995) reported that these same autoantibodies are recognizing the chicken homologue of mammalian tyrosinase-related protein- I (TRP- 1).

Consideration must be given to the fact that during a long term condition as in autoimmunity changes will occur in the autoimmune repertoire during the course of a disease. Autoimmunity may represent not only the breakdown of self-tolerance, but the display of new cryptic self-determinants to which the host was not originally tolerant (Lehmann et al.; 1992 and 1993; Sercarz and Datta, 1994). The changes in the antigenic determinants that are involved in this amelanosis may therefore be reflected in a changing autoinimune T cell and B cell repertoire. The design of adoptive transfer experiments, might, therefore, take into account these possible shifts in antigenicity, and utilize donor cells from donors of different ages.

The parental Massachusetts Brown Line chickens (BL) from which the Smyth line was derived also exhibit the amelanosis of the feather and eyes but at an incidence of only 1 to 2 percent (Erf et al., 1995a) as compared to the 90% incidence reported for SL (Smyth, 1989; Smyth et al., 1981). One potential explanation for this low incidence of amelanosis might be that the melanocytes of some BL chickens display the same defects in antigen presentation as hypothesized for the SL. The adoptive transfer of autoreactive lymphocytes from amelanotic SL chickens may result in the same autoimmune pathogenesis. Alternatively, the melanocyte defect may not be required, and the simple





55

presence of anti-melanocyte autoreactive lymphocytes, or autoantibodies, may be sufficient to cause amelanosis in BL chickens receiving SL lymphocytes or serum autoantibodies by adoptive transfer. The variables tested included the host age, donor age, use of irradiation, and number of injections of donor lymphocytes. We also performed one experiment involving the transfer of SL serum autoantibody into BL hosts. In this study, we report the first transfer of autoimmune amelanosis with splenic cells from Smyth Line chickens in Brown Line chickens.

Materials and Methods


Animals

Fertile SL eggs from the B101 major histocompatibility complex (MHC)-defined subline, which has the earliest age of onset and the most severe phenotype of the three SL MHC-defined sublines (Erf et al., 1995a), and from the B101 MHC-matched BL were generously provided by Dr. J. Robert Smyth, Jr. (University of Massachusetts, Amherst). Chickens were hatched and housed at the University of Florida Poultry Unit, and were individually identified with leg band or wing tag numbers. The degree of pigment loss (amelanosis) by SL chickens was classified according to Erf et al. (1995b): (1) normal, no apparent amelanosis; (2) mixed amelanosis, with both normal and <20% amelanotic feather tissue; (3) mixed amelanosis, with normal and 20-60% amelanotic feather tissue;

(4) mixed amelanosis, with normal and >60% amelanotic feather tissue; and (5) complete amelanosis, all developing feathering tissue is amelanotic. SL chickens with stage 1 or no amelanosis are also referred to as nonprogressors, and SL chickens with any apparent





56


amelanosis (stages 2-5) are referred to as progressors. It should be noted that the phenotypes reported represent the maximum amelanosis stage reached and were stable.

The SL donors were hatched and raised before hatching the BL hosts so that there were visible amelanotic donors by the time they were 8-12 weeks old in time to donate their cells to 3 week old BL hosts.

Sex Determination by PCR

The sex of the donors and the recipients was determined when the hosts were 3 weeks old because the hosts at this age do not have definitive secondary sexual features for reliable identification. SL females display the earlier onset and more severe phenotype than SL males and would appear to have the best potential of passing autoreactive T cells. The ideal transfer would be from a SL female to a BL1 female. Attempts were made in some experiments to avoid female to male cell transfers in case of possible incompatibility at the minor H loci. In birds, the females are the heterogametic sex, bearing the W and Z chromosomes whereas males are ZZ. The gender was determined by PCR using primers, Chi I and Chi 111, derived from the sequence of the chicken W chromosome-specific Xho repeat fragment described by Kodama et al. (1987) and kindly provided by Dr. Siwo R. de Kloet (Florida State University, Tallahassee). The DNA template for the PCR was obtained from a drop of blood obtained by pricking the brachial wing vein and absorption onto Isocode Stix, PCR template preparation dipsticks (Schleicher and Schuell Inc., Keene, NH). Genomic DNA was eluted and PCR amplified as directed by the manufacturer. A 3 16 bp product was resolved on a 1% agarose gel.





57

Immunosuppression of the Host Animals

Some host BL chicks were immunosuppressed by sublethal irradiation one day before the cell transfers. y irradiation was performed using a '37Cs source at the U.F. Health Center Animal Resources Facility. Dosages used were either 750 rads (Toivanen et al., 1975, as used on 4 day old chicks) to 850 rads (Dr. Bruce Glick, personal communication) or none at all.

Preparation of the SL Donor Cells and Cell Injections

The donor SL cells were obtained from SL chickens undergoing active amelanosis at the time of sacrifice (8 to 20 weeks of age). The spleens were removed, made into cell suspensions in PBS on ice by teasing the organ and by dounce homogenization, and the lymphocytes were separated from the red blood cells by density centrifugation over Ficoll-Hypaque (Pharmacia). The splenic lymphocytes were resuspended in PBS at a density of 5x107 to lx109 cells per ml, and a maximum of 1-2 ml of cell suspension was then injected intravenously into the right jugular vein with the balance into the wing brachial vein. The recipient animals were then monitored in normal housing conditions (not pathogen-free) for at least 20 weeks of age to allow the development of the amelanotic phenotype during the typical time frame as would be found in a SL chicken. Smyth Line Serum Collection and Preparation

Serum was collected from Smyth Line chickens that displayed obvious amelanosis (at least level 3) at the time of collection. A range of 20 to 60 ml of blood per bird was collected into heparinized Vacutainer tubes from the jugular and/or brachial vein of the wing. Blood was centrifuged at 1500 rpm to collect the serum, which was





58

then stored at -800C. The sera was then pooled and the gamma globulin fraction was obtained by two sequential precipitations with 33% and then 28% saturated ammonium sulfate. The precipitates were dissolved in a minimum volume of cold phosphate buffered saline (PBS), dialyzed 2-3 days against 40C PBS after each precipitation, and then filter-sterilized using a .45p micropore filter (Nalgene). Aliquots of the gamma globulin fractions were then introduced by injection in the jugular vein (1-2 ml) with an additional volume (2-3) introduced intraperitoneally beneath the breastplate. Cell Lines

Chicken melanocyte cultures were obtained from chicken embryonic neural crest tissue by the method of Boissy and Hallaban (1985) in the laboratory of Gisela Erf and obtained as a gift. Cultures were grown in Ham's F10 media (Sigma) supplemented with 10% FBS, 5% Nuserum (Collaborative Biomedical Products), 200 mM Lglutamine/penicillin-streptomycin (Sigma), 0.5 mg/ml cholera toxin (Sigma), and ImM phorbol myristic acid.

Immunoblotting

Semiconfluent melanocytes were harvested from flasks, rinsed twice in PBS and solubilized in 10 mmol/L Tris buffer (pH 8), with 1 mmol/1 phenylmethysulfonyl fluoride, 5% 2-mercaptoethanol, .02 mM/1 of each antipain, aprotinin, chymostatin, leupeptin, and pepstatin A, with 1% sodium dodecyl sulfate (SDS) for 5 minutes at 951000 C, and sheared with 21 GA needle. The lysates were separated on SDSpolyacrylamide gel electrophoresis (SDS-PAGE) reducing gels and electroblotted onto Immobilon-P polyvinylidene fluoride (PVDF) membrane. A Bio-Rad low range






59

molecular weight marker lane was used (Bio-Rad Laboratories, California). The blotted proteins were blocked in 5% Carnation non-fat dry milk with 20 mM Tris pH 7.5, 137 mM NaCl, and 0.1% Tween 20 (TBS-T). The blots were cut in individual strips and each strip was individually incubated with different sources, primary antibody (either direct serum cleared as described above or the gamma globulin fraction) for 2 hours at room temperature in TBS-T with 5% milk, washed 5 times for 2 minutes, and 2 times for 5 minutes and then incubated in goat anti-chicken horse radish peroxidase-conjugated secondary antibody (Southern Biotechnologies, 1:1500) for 2 hours. The proteins were detected by ECL chemiluminescence (Amersham). The blots were analyzed by densitometry and Hoefer Image Master software. Histology

Regenerating feathers of SL and control BL birds were generated by gentle plucking of growing feathers and collecting of the young feathers bimonthly. The feathers were brought to the University of Florida Diagnostic Research Laboratory for cryosectioning. Mouse monoclonal antibodies to chicken TCR1, TCR2, TCR3, CD4, CD8, CT3 were a gift of Dr. Chen-lo Chen and described by Cooper et. al., 1991). Methyl green was used as the counterstain.

Results


Observations of the UF Colony of Smyth Line Chickens

Observations have been compiled from raising twelve populations of the Smyth line chicken. In the colony raised at the University of Florida, the amelanosis incidence has been approximately 60%. Observations compiled from four of the populations of Smyth





60


line chicken is summarized in Table 2-1. Female Smyth chickens (Table 2-1 and Figure 2-1) usually demonstrate a quicker onset and more severe manifestations of the phenotype of depigmentation at a higher frequency than in males, a phenomenon that has been seen in other autoimmune disease animals such as the female NOD mouse.

During the first 6-9 weeks, 42% of the females (16 of 38) became amelanotic, with 12 at the more severe levels (stages 3-5). As the birds aged, the females continued to have a higher proportion that are affected and have the more severe phenotype. By the 17th week, 66% of the females were amelanotic and of these, 20 displayed the more




Table 2-1. Amelanosis incidence in the UF Smyth line colony Population # number early onset delayed number % total
available (6-12 wks) onset amelanotic amelanotic amelanotic (17 wks)
SL2 6F 5/6 1/6 6/6 100% 60%
liM 3/11 1/11 4/11 36% 10/17


SL3 14F 9/14 1/14 10/14 71% 77%
8M 7/8 0 7/8 87.50% 17/22


SLI I 9F 4/9 3/9 7/9 77% 68%
16M 8/16 1/16 9/16 56% 17/25


SL12 17F 5/17 2/17 7/17 41% 36%
liM 2/11 1/11 3/11 27% 10/28


total F 72% 60%
total M 52%








Smyth line females


Amelanosis stage El E2 03 4 0-15

2420
.16
12


4
0
9 w 11 w 13 w 15 w 17 w
Age
Figure 2-1. Frequencies of Smyth Line Females







Smyth line males


Amelanosisstage 1 W2 3 4 ]5


24 20 16

12

8

4

0
9w 11w 13 w 15w 17 w

Figure 2-2. Frequencies of Smyth Line Age males






Smyth line (females + males)


Amelanosis stage 1 1 1 2 1 3 E 4 0 5

48 40
S32
S24

16
8 0
9 w 11 w 13 w 15w 17 w
Age
Figure 2-3. Frequencies of Smyth line females and males





64

severe phenotypes. Only 14% of the males (4 of 28) showed any depigmentation by the 9" week and all at the lowest level (Table 2-1 and Figure 2-2). Males can become just as severe; they usually take longer to develop. By the 17" week, 42% displayed the more severe phenotypes, but only one showed the severest at level 5, as compared to 9 females. The information combining the frequencies from both sexes is compiled in Figure 2-3. In one generation, there was actually some reversion of the phenotype in three of the females, otherwise the phenotype once the maximum was achieved remains stable. Of these three revertants two were completely amelanotic and one was 75% amelanotic. After their initial depigmentation had peaked, a period of repigmentation began, which started as patches in a different pattern than they were first depigmenting. The repigmentation was not complete.

There seems to be two waves of developing amelanosis based on observations of several populations as shown in Table 2-1 and Figure 2-3. The early onset wave (majority of the SL) begins at the 6' through the 9 week post hatch. They peaked at development of amelanosis by the 12th to 14th week, achieving the severe phenotypes, stages 4 and 5, often earlier than 12 weeks. The second wave, fully pigmented up to this point, started developing amelanosis at 17th to 20-21' week and none became totally amelanotic from the second wave. This was seen at week 17 for a male from the SL2 population and for two females from the SL 12 population. Adoptive Cell Transfer Experiments

Five cell transfer experiments were conducted. Variables considered included: (1) host age; (2) donor age; (3) stage of amelanosis exhibited by the donor (including how





65


rapid and severe the amelanosis developed); (4) whether hosts were irradiated; and (5) the number of injections of cells.

The first cell transfer experiment was performed on 18-19 day-old BL chicks (mean weight of 126 g). In order to allow for the possibility that changes might occur in the autoimmune T cell repertoire during the course of disease, two age groups of SL donors were used. The plan included five test groups with a one time donation of transferred cells per host, as shown in Table 2-2 (Groups IlA-lIE).

Total body irradiation of 750 rads was issued per host BL bird on the day before the adoptive transfer. The splenic lymphocyte suspensions were prepared with a range of cells between 5xl1O' cells/mi and 4x1 08 cells/mI, which is within the range used in mouse and rat transfer experiments. Hosts and controls were kept in normal housing conditions. Of the 25 BL host chickens, 12 survived. Of these 12 BL hosts that received SL donor cells, 5 (44%) displayed a partial amelanotic phenotype. This has been summarized in Table 2-3, which shows the progression of amelanosis of these 5 hosts after receiving the transfer of SL lymphocytes.

Two females, from either groups 1 A, 1ID, or 1 B, each developed a highly severe stage of amelanosis within 3 months of age. Unfortunately, these two died and were removed from the poultry unit by the animal caretaker before photographs and tissue samples could be taken. Unfortunate too, was the fact that the birds had outgrown their leg tags. Other BL hosts only hinted of a possible amelanotic phenotype. BL5-105, a female also from either groups 1 A, 1 D, or 1 E, gradually developed amelanosis to stage 3 in severity. Unfortunately, this healthy bird died suddenly before photographs were considered. It too was removed from the poultry unit before samples could be taken.















Table 2-2. Adoptive transfer of amelanosis with single transfers of SL splenic lymphocytes.

Hosts Donors
Test Irradiated Amelanosis # Cells / # Amelanotic/
Group No. Age Sex (rads) Sex Age Stage Host # Survived
lA 3 18d F 750 F 8w 2 5x107
IB 3 18d M 750 M 16w 3 lx108
1C 3 18d M 750 M 16w 5 3x10' 5/12
ID 1 18d F 750 F 16w 4 4x108
1E 2 18d M,F 750 F 16w 4 2x108
2A 4 12 d n.d. 850 M 20w 2 7x108 1/4
2B 3 12 d n.d. 850 M 32w (BL) lx108 0/3
2C 12 12 d n.d. 850 0 0/12
3A 1 6w F M 16 w 3 1x109 0/1
3B 2 6 w F F 10 lOw 4 2x108 0/2
3C 2 6w F M,F 10w 4 2x108 0/2

n.d.=not determined





67











Table 2-3. Progression of amelanosis in 5 BL5 hosts after adoptive transfers of SL splenic lymphocytes.


Age of host in months
Animal sex 3m 4m 5m 6m 7m 8m 9m
BL5 F 4 (a)
BL5 F 4 (a)
BL5-105 F 1 2 3 (b)
BL5-111 M 1 2 2 3 3 3 3(c)
BL5-115 M 1 2 2 2 2 2 2(c)

(a) Died at 12 weeks old and removed from poultry unit before samples could be taken.
(b) Died within the fifth month of age and removed before photographs and samples
could be taken.
(c) Died after the ninth month of age.

There are five levels to describe the degree of amelanosis as developed by Erf et al. (1995b) and adapted by this lab:
(1) normal, no apparent amelanosis; (2) mixed amelanosis, with both normal and <20% amelanotic feather tissue; (3) mixed amelanosis, with normal and 20-60% amelanotic feather tissue; (4) mixed amelanosis, with normal and >60% amelanotic feather tissue; and (5) complete amelanosis, all developing feathering tissue is amelanotic. SL chickens with stage 1 or no amelanosis are also referred to as nonprogressors, and SL chickens with any apparent amelanosis (stages 2-5) are referred to as progressors.





68




Two males, BL5-l 11 and BL5-l 15, also developed an amelanotic phenotype resembling that of the Smyth line and were followed more closely. Around the sixth month of BL5- 11 I's life, regenerating feathers began to display melanocyte destruction in the pulps that had been all along reflected in the banded black and white feather vanes. Now the pulps in regenerating feathers were creamy gray instead of homogenous black. By the eighth month, the pulps in the regenerating feathers in BL5 -111 were mostly gray, some were banded black and white, and only one to two percent were still completely black. B15-1 15, even in its eighth month, still displayed a low level of amelanosis with mostly black pulps in the regenerating feathers. Nevertheless, the feather vanes were banded with the oldest parts, the tips, being black and the youngest parts, closest to the pulp, being white or depigmented. The development of amelanosis was very gradual and not convincing until changes in the pulps could be witnessed. Photographs of the extent of amelanosis developed at the age of 7 months are shown in Figure 2-4 and 2-5.

In the second cell transfer experiment, three groups of 12 day-old BL7 generation hosts (sex not predetermined) were used as the recipients of a single transfer of cells comparing hosts receiving lymphocytes from a SL donor to hosts receiving lymphocytes from a BL control donor (Table 2-2).

Hosts were irradiated with 850 rad total irradiation each on the day before the adoptive transfer and given a single reconstitution of SL splenic lymphocytes or BL lymphocytes. An extra 12 BL7 which were prepared by irradiation were not used and never reconstituted with cells. These 12 survived until sacrificed after 20 plus weeks of age.






69























Figure 2-4. BL5-111, a Brown Line adoptive transfer host displaying stage 3 amelanosis Figure 2-5. BL5-115, a Brown Line adoptive transfer host displaying stage 2 amelanosis





70




Only three BL7 hosts showed any manifestations of amelanosis above, BL7-222, (male), showed amelanosis of stage 2. Out of 4 host BL chickens, reconstituted with SL donor cells, only one (25%) demonstrated amelanosis. None of the control hosts reconstituted with BL donor cells developed any signs of amelanosis.

In the third adoptive cell transfer experiment, older 6 week-old non-irradiated, normal hosts were given one injection of SL donor splenocytes, as shown in Table 2-2 (Groups 3A-3C). Donor cells came from two different age groups. The change to 6 week-old chickens and no irradiation provided the opportunity of the donated SL splenic lymphocytes to be present during the time period in which amelanosis usually starts in the early onset SL chickens. None of the 10 host BL chickens developed any signs of amelanosis by the age of 20 weeks.

In the fourth cell transfer experiment, a serial adoptive cell transfer protocol was adopted. Each set of BL hosts, which were not irradiated, received several cell injections from a series of amelanotic SL donors over a course of several weeks. The transfers began at 6 weeks of age (just before the time when amelanosis begins to appear in the SL) and continued through the time period (8-16 weeks) during which amelanosis usually develops in the SL (Table 2-4, Group 4). It was hoped that weekly repeated injections of splenic cells from SL donors into the same set of BL hosts would mimic the constant presence of melanocyte-sensitized T cells in the SL chicken.

In experiment 4, 5 female BL7 hosts initially received SL donor cells representing three different experimental test groups, Groups 4A-4C. However, it was necessary to simplify the source of donor cells in the subsequent transfer of SL lymphocytes to one















Table 2-4. Adoptive transfer of amelanosis with multiple transfers of SL splenic lymphocytes.


Hosts Donors
Test Amelanosis # Cells/ #Amelantic/
Group No. Sex Age Sex Age Stage Host #Survived
4A 2 F,M 6w M 16w 3 lxl09
4B 1 M 6 w F 10 lw 4 2x10'
4C 2 F,M 6w M,F 10w 4 2x10'
7w F,F 11 w 4 3x108 0/5
8w M,F 12 w 5,4 2.7x108
9 w M,F,F 11 w 4,3,4 not counted 10 w M,M,F 11 w 4,4,3 1.5X109
5A 7 F 6w M 17 w 4 5.6x108
7 w M,F 17 w 3,4 7x109 0/7
5B 3 F 6 w M 16 w BL 5.5x109
7 w F,M,F 8 w BL 9x108 0/3





72

source of donors each week. This was dictated by the availability of a large enough pool of SL donors with the desired stage of amelanosis and the work necessary to prepare the splenocytes from several SL donors. Thus if SL males provided the desired amelanotic features, their spleens were used to augment the SL donor cell source. The hosts in Group 4 were retained until 20 weeks of age; however, no amelanosis was apparent.

The fifth adoptive cell transfer experiment also utilized 6 week-old nonirradiated normal BL hosts with the same protocol as in the fourth experiment. Seven BL9 female hosts were given injections of SL donor splenic lymphocytes on week 6 and then on week 7 (Group 5A). A control group of 3 BL9 females received injections on both weeks of BL splenic lymphocytes (Table 2-4, Group 5B). These hosts were maintained for 18 weeks, and no amelanosis was observed.

Serum Transfer Experiment

We performed one experiment to determine whether the transfer of SL serum autoantibodies to melanocyte antigens could result in the transfer of the disease into BL chickens as evidenced by an amelanotic phenotype. Repetitive administrations of serum have been utilized in previous studies of passive transfer of autoimmunity. For example, in the autoimmune murine model for thyroiditis, serum transfers were performed on day 0, 2, and 4. This was sufficient to induce thyroid lesions by passive transfer of immune serum in 10-12 week old animals (Tomazic and Rose, 1975). The regiment of weekly 1ml injections has been performed for 4 weeks by intravenous and subcutaneous means in the OS chicken model of thyroiditis (Jaroszewski et al., 1978). Serum was collected from SL chickens that expressed amelanotic phenotypes of various different stages (stages 2-5)





73


to account for the possible changes that occur in the antibody repertoire as amelanosis progresses. We collected and pooled serum from four different sources:

Pool 1 = 10- 11 weeks old (SLi11)

Pool 2 = 3-7 months old (SL6, SL7, SLl10)

Pool 3 = 11I months old (SL3) Pool 4 =17 months old (SL2)

Eight normal BLI10 hosts received SL gamma globulin injections over a 4-week period. Three BLlO hosts received PBS as a control group.

A Bio-Rad protein assay was used to determined the total gamma globulin fraction administered per injection by assaying aliquots saved from each preparation used for injection. Results of this assay, (Table 2-5) indicate that the hosts received a total of 99 to 121 mg of total serum gamma globulins, which corresponds to the original serum volumes of 82 to 116 ml per host.

The experimental approach for this experiment combined elements of the aforementioned mouse (Tomazic and Rose, 1975) and OS chicken (Jaroszewski et al., 1978) studies. It included 3 administrations during the first week and then additional inoculations weekly for four additional weeks. Each autoantibody (gamma globulin) transfer consisted of the injection of a total of 5 ml per host: 2 or 3 ml into the jugular vein and 2-3 ml injected intraperitoneally (Table 2-6). Hosts and controls were kept in normal housing conditions.

These gamma globulin transfer hosts were maintained and monitored biweekly for visual changes in phenotype and regenerating feathers were collected biweekly. No













Table 2-5 BioRad Protein Assay of Gamma Globulin Pools and Selected Serum Samples

Standard (ug/mi) OD 595 0D595 OD ave. Bovine Gamma Globulin standard
0 0.336 0.324 0.33 ddH2O as reference
27 0.498 0.46 0.479 correlation 0.0995
57 0.632 0.649 0.6405 slope 0.0046
80 0.757 0.747 0.752 y-intercept 0.3552
107 0.825 0.864 0.8445
134 0.93 0.957 0.9435 ___________________________Dilution Stock
Sample Dilution OD 595 OD 595 OD ave ug sample ug/mI mg/S ml Conc. Factor Equiv. Vol.
pool 1(sm. vial) 1/20 0.595 0.61 0.6025 53.96 1079.2 5.39 2.77 13.85
pool 1(Ig. vial) 1/50 0.534 0.57 0.552 42.86 2143 10.72 2.77 13.85
SU3 pool 50m1 con 1/50 0.567 0.593 0.58 48.95 2447.5 12.24 2.2 11
(SL3) pool 2 3/7/97 1/50 0.769 0.798 0.7835 93.27 4663.5 23.32 2.2 11
(SL3) pool 2 2/21/97 1/50 0.744 0.686 0.715 78.3 3915 19.58 2.2 11
(SL3) pool 2 2/26/97 1/50 0.497 0.563 0.53 38.1 1905 9.53 2.2 11
SL2 pool 3/13/97 1/50 0.822 0.899 0.8605 109.9 5495 27.48 5.61 28.05
SL2 pool 3/13/97 1/50 0.803 0.859 0.83 1 106.6 5330 26.65 5.61 28.05
SL2 pool 3 1/50 0.939 0.972 0.9555 130.6 6530 32.65 5.61 28.05
SL I1I pool 1/100 0.711 0.729 0.72 79.4 7940 11.91 (a) 4.3 6.45
BL5-l11 4/18/97 1/50 1.035 1.043 1.039 148.9 7445 37.23
BL5-1l115/16/97 1/50 1.073 1.167 1.12 166.5 8325 41.63
BL5-l 15 4/18/97 1/50 0.963 1.026 0.9945 139.2 6960 34.8
BL5-115 5/16/97 1/50 1.214 1.101 1.1575 174.7 8735 43.68
SL12 1611 1/50 0.946 1.059 1.0025 140.9 7045 35.23
SL12 1619 1150 0.924 1.008 0.966 133 6650 33.25
BL3 205 1150 0.999 1.065 1.032 147.5 7375 36.88
BU3 203 1/50 1.181 1.179 1.18 179.6 8980 44.91

(a): mg/1.5m1






75




















Table 2-6. Adoptive transfer of SL gamma globulin into 6 week-old BL 10 hosts

Day of Serum
Injection Age Pool Ml Equiv.(ml) mg IgG
1 6 w 2 5 ml 14 10.7
3 6 w 2 5 ml 14 10.7
6 6 w 2 5 ml 14 10.7
15 7 w 3 5 ml 11 18.4
23 8 w 1 1.5 ml 6 11.9
30 9 w 3 5ml. 11 18.4
4 5ml. 28 28.9
37 low 3 5 ml 11 18.4
____4 5 ml 28 28.9





76


induced amelanosis was apparent by the age of 18 weeks at which time it was decided to terminate the experiment, 8 weeks after the last injection of gamma globulins. Western Blot Analysis

Western blot analysis was performed to confirm the presence of antimelanocyte autoantibodies in the serum pools used for the gamma globulin adoptive transfer experiments. Serum from the two adoptive cell transfer BL hosts that became melanotic, BL5-1 11 and BL5-115, were also examined to learn more about the extent of their phenotype.

As shown in Figure 2-6, serum pools 1, 3, and 4 (lanes 1, 2, and 3 respectively) did contain autoantibodies specific to melanocyte proteins in the size range of 65-8OkDa, reported as characteristic of the Smyth line chickens by Austin et al. (1992). Lanes 4, 5, 6, and 7 are serum samples from BL adoptive cell transfer hosts, BL5-111 and BL5-115, from two timepoints each at about a month apart. All four samples had the same autoantibody profiles specific for the same melanocyte proteins as seen typical in the other SL sera (lanes 1, 2, and 3). This suggests that, in addition to the partially amelanotic phenotype observed in these hosts, antimelanocyte autoantibody production may have been induced by the adoptive transfer of SL splenic lymphocytes. Control sera included an amelanotic SL positive control that recognized the same 65-80 kDa protein bands, and a BL serum negative control (lane 8), which did not contain autoantibodies that would recognize the same melanocyte proteins.

According to Austin and colleagues, the SL antimelanocyte antibodies recognize melanocyte proteins between 65 kDa and 80 kDa in size. Using Image Maker software,














1 2 3 4 5 6 7 8



106
80
50


33
28





Figure 2-6. Adoptive cell transfer hosts detect the same melanocyte autoantigens between 65kDa to 80kDa as do the SL donor serum (lanes 4-7). These may be anti-Trp-1 autoantigens (Austin et al., 1992; Austin and Boissy, 1996). Gamma globulin sources (lanes 1-3) did provide serum antimelanocyte antibodies of the correct specificity and size range typical of SL chickens. Arrow refers to the detection of an approximately 79kDa melanocyte protein found only with serum antibodies from SL chickens and the adoptive SL cell transfer hosts (lanes 1-7) but not with BL chicken serum (lane 8). Bio Rad Low Range prestained markers were used.





78


the principal bands observed between the 49.5 and 80 kDa molecular weight markers have a size of 65 to 80 kDa proteins (Figure 2-6). The 64-65 kDa protein band is seen across all lanes (see the lower of 2 bands next to 80 kDa marker) including in the BL (lane 8).

A 79 kDa protein band was recognized by all the SL samples (lanes 1-7) but not by 131 samples, which corresponds to a protein reported by Austin and colleagues as Sbspecific (1992 and 1995). This figure is representative of the results of three blots using 3 different BL animals. None of the three BL control sera tested had antibodies that recognized the 79 kDa band. Austin and Boissy (1995) demonstrate that the melanocytespecific proteins of the 65-80 kDa range are Trp-l specific. This 79 kDa protein may therefore be Trp- 1.

Regenerating feathers were plucked biweekly and collected of BL5-1 11 and BL5115 starting from the fifth month. Cryosections were prepared and iminunostained for CD3 expression using mouse monoclonal antibody as referenced in Chapter 1 (Erf et al. 1995b; Cooper et al., 1991). As compared to feathers from a BL control chicken, the barb ridges of feathers from BL5-1 11 contained a gradually decreasing amount of melanin in the barb ridges (data not shown). The last sample taken early in its last month, was completely without melanin. This suggests that in the BL5-1 11 host, antimelanocyte lymphocytes had penetrated beyond the confines of the pulp and invaded the barb ridges to destroy and remove the melanocytes and their products. BL5-1 15 samples did not show these changes and resembled the fully pigmented barb ridges of the BL control. The tissue samples were poorly preserved due to improper freezing and so can not be published. These findings, in addition to the obvious change in phenotype and the serum





79


antibody profile, suggest several samples of evidence of the changes induced by the adoptive transfer of SL lymphocytes in this BL5-I I11 host.


Discussion


Adoptive transfer experiments often can provide a means to study the autoimmune response in vivo in the intact organism. We used this experimental approach to determine whether melanocyte-sensitized lymphocytes and/or autoantibodies have the capacity to transfer amelanosis in a non-Smyth line chicken.

In hindsight, this portion of my project presented numerous technical challenges for a chicken animal model, including a relative lack of published protocols for adoptive transfer, radiation doses, etc. Most literature reported protocols in which mice were suppressed soon after sexual maturity (8-10 weeks). However, chickens are not sexually mature until the fifth or sixth month and that is unsuitable for the study of amelanosis in the SL. Most literature reported using approximately 5xl1 0 donated cells whether the cells were bone marrow cells, spleen, or lymph node cells. Our experiments involved the transfer of up to I x 10' cells.

I had consulted several authorities on the chicken animal model, but never found a standard protocol for the immunosuppression of hosts of cell transfer that answered such questions as to its necessity, by which means, and how much per age or weight or other measurable parameter. Most published mouse and rat experiments did use irradiation (Wicker et al., 1986; Hanafusa et al., 1988; Panitch and McFarlin, 1977; van der Veen et al., 1989; Toivanen et al., 1975). Miller et al. (1988) subjected 4 to 8 week-old NOD mouse recipients with up to 950 rad of irradiation. However, within 2 hours the hosts





80

were reconstituted with splenocytes. In our experiments, the irradiation occurred the day before. Irradiation was probably necessary based on the fact that the animals in our experiments that did display induced amelanosis had been irradiated. Like et al. (1985), working on the adoptive transfer of diabetes in the biobreeding rat, concluded that an "...an intact immune system protects against adoptive transfer and diabetes ...", and so they suggested the requirement for immunosuppression. An alternative to irradiation that could have been used is cyclophosphamide (Cy) which has been used to immunosuppress the hosts in the mouse and rat (Hanafusa et al., 1988) and in the chicken (Toivanen et al., 1990; Lehtonen et al., 1975; Glick by personal communication and Glick, 1977; Olah and Glick, 1978; Glick, 1971). Transferring unfractionated splenic lymphoid cells produced higher incidence of insulitis than T cell subsets in the mouse (Hanafusa et al., 1988).

A logical next step in our experiments would be to transfer T cell subsets. As demonstrated in various studies of the subsets of T cells mediating diabetes in the NOD mouse, some researchers report the both the CD4' and CD8' T cell subsets were necessary to transfer diabetes into recipients (Miller et al., 1988; Bendelac et al., 1987). Mitsunobu et al. (1992) concluded that CD4' T cells cause the insulitis and that the CD8' T cells act as mature killer cells against the 1 cells with the aid of CD4+ T cells. This ability to distinguish separate roles for different subsets of cells as demonstrated in the mouse should be possible in the SL chicken model for amelanosis.

Mouse monoclonal antibody reagents specific for T cells expressing y8 (TCR1), ao3VI1 (TCR2) and c43VP32 (TCR3) (Chen et al., 1988; Chen et al., 1989; Char et al., 1990) are available. The chicken homologues to CD3, CD4, CD8, CD1, CD2, CD5,





81


CD45, MHC class I, MHC class II, and IL-2 receptor are also recognized by mouse monoclonal antibodies (Cooper et al., 1991). Negative selection by means of complement lysis of the non-desired T cell subsets, or positive selection using mouse anti-TCR mAb and goat anti-mouse conjugated to magnetic beads are established methods. Another possibility would require the isolation of clonal populations from regenerating feathers using Con-A and IL-2 stimulated T cell subsets (Koevary et al., 1983; Panitch and McFarlin, 1977). This would most closely resemble the T cells at the site of melanocyte destruction (Erf et al., 1995b). There is the issue of the unknown feasibility of adopting this technique to the chicken in vivo.

Nevertheless, the fact that 5 out of 12 BL5 hosts (44%) and 1 out of 4 BL7 hosts (25%) survived long enough to manifest amelanosis by adoptive cell transfer indicates that the amelanosis found in the SL chickens may be cell-mediated. A total of 40 BL hosts of SL splenic lymphocytes were followed from all five experiments and of these 6 hosts (15%) became amelanotic. This is not by chance considering BL chickens normally demonstrate only 1-2% comparatively. These results suggest that the autoreactive lymphocytes are capable of recognizing BL, as well as SL, melanocytes, and that the SL melanocyte defect may not be required for pathogenesis.

The T cell-mediated melanocyte destruction in vitiligo would resemble the T cellmediated destruction of pancreatic f3 cells in diabetes, demyelinization in myelin basic protein-induced EAE, and destruction of follicular epithelial cells in autoimmune thyroiditis. T cell involvement has also been suggested in two other autoimmune chicken conditions, hereditary scleroderma in the UCD-200 and UCD-206 lines (Haynes and





82


Gershwin, 1983; van der Water et al., 1989) and thyroiditis found in the Obese strain

(OS) chicken (Brown et al., 1991; Wick et al., 1970). The observation that adoptive transfer of SL lymphocytes may cause amelanosis in BL hosts is significant, in part because previous authors on the amelanosis of the SL chicken have over-emphasized the role of autoantibody, based on studies of bursectomy and corticosteroid inhibition of amelanosis (Lamont and Smyth, 1981; Boyle et al., 1987).

It is also interesting to note that the western blot analysis demonstrated that the BL adoptive cell hosts had the same antimelanocyte serum antibody profile as the typical SL serum. This result suggests that either: (1) melanocyte-reactive SL B cells were transferred; or (2) melanocyte-reactive SL T helper cells induced BL B cells to produce anti-melanocyte autoantibodies.

One must consider the possibility that the BL hosts that became amelanotic as a result of the cell transfers may actually have been susceptible to amelanosis given the 1 to 2% incidence of amelanosis in the BL. The introduction of autoreactive SL lymphocytes may have "tipped the scale" in favor of disease in these individuals. This is the conclusion that adoptive transfer of splenocytes in the NOD mice accomplished in the work by Wicker et al. (1986).

The repetitive administrations to the BL hosts with the transfer of SL-sensitized T cells or autoantibodies during the time period during which amelanosis has normally occurred in the SL donors appeared to be a logical approach to inducing amelanosis and should be done in combination with immunosuppression. Future studies should include these two conditions. Recall that in the first experiment the BL5 hosts were immune suppressed and were given one transfer of cells, resulting in five BL5 recipients that





83


displayed the amelanotic phenotype to some degree. The serial transfer experiments (3 and 4) with older (6-week-old) not-immune-compromised hosts were given up to 5 repeated transfers of donated SL cells. Still they had not displayed a hint of amelanosis in a situation we anticipated would have an earlier onset. Future experiments should involve both immunosuppression by irradiation and serial transfers.

Previous attempts to induce an autoimmune disease by injection of antisera in normal chickens have been unsuccessful (Jaroszewski et al., 1978). Anti-thyroglobulin antisera from OS chicken suffering from thyroiditis were transferred to the normal Cornell strain but failed to induce thyroiditis, despite the fact that they share the same B alleles at the MHC locus. Immunocompromising these Cornell recipients did not help, even though neonatal thymectomy did potentiate the severity of thyroiditis in OS chickens (Wick et al., 1970), as immunosuppression seemed to have done for our cell transfer experiments.

Timing of the transfers may have an influence on the success. Wicker et al. (1986) noticed that they were unable to transfer diabetes using splenocytes if the NOD irradiated mice were less than or equal to 6 weeks old, but were much more effective with transfers to hosts that were slightly older than 6 weeks of age. For the Smyth line chicken, perhaps the transfers needed to be initiated earlier for both our cell and humoral administrations. Perhaps in vitro stimulation of the splenocytes with lectins or melanocyte fragments in the donor may help (Takenaka et al., 1986; McCarron and McFarlin, 1988). Cell transfers have been successful from bone marrow and mature splenocytes or lymph node cells. Our utilization of repeated transfers of cells or gamma globulin, and the concentration of the immunoglobulins used should have addressed the





84


problem of maintaining high enough concentrations of effector cells or antibodies over long enough periods of time, a problem encountered by others in serum transfer experiments (Inoue et al., 1993).

In summary, the experiments involving the adoptive transfer of SL splenocytes into the BL hosts suggests that amelanosis can be transferred and may be a cell-mediated autoimmune process. The role of the associated autoimmune antibodies may not be as clear. Whether autoantibodies can cause or trigger the destruction of the melanocytes in BL hosts was not apparent. In diabetes, autoimmune antibodies against islet cells is a distinguishing feature of the disease, precedes the onset of the disease, are specific to the 65kDa autoantigen GAD, and can be used as predictive markers of patients susceptible to the disease. This likewise may be a similar situation with the autoantibodies in the SL chicken. The role of the autoantibodies in diabetes as a primary inducer of diabetes has not yet been proven.
















CHAPTER 3
T CELL RECEPTOR y REPERTOIRE ANALYSIS OF THE EXPANDED
PERIPHERAL BLOOD y8 T CELL POPULATION DURING AVIAN VITILIGO Introduction


Many autoimmune diseases are T cell-dependent, which, in part, can be determined by the study of TCR genes. T cell receptors can generate up to 1016 total receptor specificities by combinatorial and junctional diversity (Janeway and Travers, 1997), although much of this diversity is lost during thymic education during the induction of central tolerance. During an immune response, T cells respond in a clonal fashion due to TCR recognition of antigenic peptides. Similarly, during an autoimmune response, a fraction of T cells may be clonally expanded in response to self-antigen. The T cell response may be described as (1) polyclonal, in which many T cell clones are recruited in the response, (2) oligoclonal, in which a small number of T cell clones expand, or (3) monoclonal, in which one specific clone responds. Experimentally, this can be studied by TCR repertoire analysis of a T cell population. The identification of recurrent TCR sequences (with the same or similar CDR3) in large T cell populations provides evidence for antigen-driven expansion.

T cells present in acute graft-versus-host-disease of target organs (skin, liver, and intestine) in HLA-matched allogeneic bone marrow transplants express predominantly


85





86


the et[ TCR (Dietrich et al., 1994). The TCR Va and VP usage in both skin and blood appeared unrestricted, but with overexpression, unique to each patient, of a few Va and VP gene segments in the skin as compared to blood. To avoid the possibility that a nonspecific inflammatory response would mask detection of a clonal T cell expansion, Dietrich and colleagues concentrated on one patient. Evidence for the repeated usage of at least five specific TCR Va 1l and VIP16 transcripts, with CDR3 of unique length and sequence, indicated an oligoclonal expansion in the skin, with specific V genes overexpressed as compared to the blood, which also showed some of the same recurrent TCR transcripts but to a lesser degree.

Even when genetically identical mice are raised in the same environment, murine intestinal intraepithelial lymphocytes (IEL) display unique oligoclonal repertoires. As compared to lymph node, VP3 expression of c43 TCR IELs is oligoclonal, as indicated by prominent and distinct subsets of clonal populations of IELs detected as peaks in their CDR3 length analysis (Regnault et al., 1994). This contrasted with the polyclonal repertoire of respective T cells in the lymph nodes.

Likewise, human IELs of five patients were compared (Blumberg et al., 1993). The dominant VP of the IELs in patient 1 was VP3 and every VP33 isolated was identical. The dominant VP in patient 2 showed one VP13, two VP35 clones, and an oligoclonal expansion of V034 and V06. Patient 3 displayed either monoclonal or oligoclonal dominant V3 gene expression. This was in contrast to a totally polyclonal TCR repertoire in the PBL sampling, where no sequence was repeated. Therefore, one or a small number of dominant clones appear to comprise the majority of IEL. The conclusions are that





87


most LELs are clonally expanded, express a small number of different VP genes, and may recognize a limited number of antigens. Blumberg and colleagues suggest that this small T cell repertoire would suffice if the target antigens were conserved, such as bacterial heat shock proteins, or a small number of endogenous antigens expressed by JELs in response to injury. Similar to the report of Dietrich et al. (1994) on human T cell repertoires, the IEL clonal expansion is unique to each individual; there were no shared clonal sequences.

Kourilsky and co-workers applied their high resolution PCR-based method of determining and following the TCR repertoire in heterogeneous cell populations of tumor-infiltrating lymphocytes (TILs) in human melanomas. Results confirmed clonal expansions in a rather complex polyclonal background. Detection of clonal T cell expansions before, during, and after treatment is facilitated using this method of PCRdetection of junctional diversity in terms of CDR3 length and sequence clonality (Puisieux et al., 1994).

In the Smyth line chicken, the melanocytes, which are located in developing feathers and the choroid layer of the eye, appear to be the target of both T and B cellmediated autoimmune responses (Smyth, 1989). Cryosections of the regenerating feathers display an intense T cell infiltration including both c4p and 'y8 T cell lineages (Erf et al., 1 995b). In addition, y8 T cells are found in increased proportions in the peripheral blood of 40 week-old SL chickens (44.1%) as compared to MIIC-matched parental BL chickens (33.2%) (Erf et al., 1996) This observation is especially intriguing given the fact the chickens have a significantly greater proportion of y8 T cells within the PBL




Full Text
52
resembles the demyelinating disease similar to multiple sclerosis. It has been transferred
using MBP-reactive T cells from the spleen or lymph node cells from a MBP-immunized
donor to naive syngeneic hosts in mice and rats (Panitch and McFarlin, 1977; van der
Veen et al., 1989). In EAE, it appears that CD4+ T cells expressing a restricted, limited
TCR repertoire are responsible. In humans, however, the TCR repertoire may be more
diverse, with greater heterogeneity of MBP-specific T cells associated with a greater
severity of disease (Richert et al., 1995; Utz and McFarland, 1994; Utz et al., 1994).
Systemic lupus erythematosus was transferred to SCID mice when human PBMC were
injected into SCID mice, and the SCID serum was shown to carry the human
autoantibodies for up to 22 weeks (Ashany et al., 1992).
In the non-obese diabetic (NOD) mouse, a model for human insulin-dependent
diabetes mellitus, several laboratories have demonstrated the transfer of insulitis and
diabetes into irradiated hosts. Normally, signs of initial insulitis begin to appear by the
sixth week. By 30 weeks of age, spontaneous diabetes develops in about 95% of the
mice with a mononuclear cellular infiltrate within the pancreatic islets (Wicker et al.,
1986). Wicker and coworkers induced diabetes within 3 weeks in greater than 95% of
the hosts when the hosts were older than six weeks of age and by using unfractionated
splenocytes from overtly diabetic NOD donor mice older than 16 weeks old (Wicker et
al., 1986). They refined these studies further by achieving successful adoptive transfers
using splenic T cells using the CD4+ or CD8+ T cell subsets (Miller et al., 1987).
Meanwhile, Hanafusa and colleagues (1988) induced insulitis in T cell-depleted NOD
mice reconstituted with the same two T cell subsets. Subpopulations of spleen and
lymph node cells transferred diabetes to syngeneic neonates and demonstrated an age


136
chicken for thyroiditis and the UDC-200 and UCD-206 chickens for systemic
scleroderma.
An improvement in possibly detecting vitiligo susceptibility genes is to use a
genome-wide linkage analysis, mapping backcross progeny between the SL and BL
chickens. Using primer pairs for microsatellite genetic markers from the U.S. Poultry
Gene Mapping Project, I would like to identify candidate genetic intervals that are
associated with vitiligo. This would assist in the identification of vitiligo-associated
candidate regions. The candidate genes may be identified from these candidate regions by
physical mapping. Yac constructs would be created and linked into contigs. Within each
Yac construct, a more dense use of microsatellite markers would be used to further
narrow and fine map the intervals within a candidate region. A candidate gene could be
identified in a genomic library and then be confirmed by in situ hybridization to
chromosome spreads using the sequence of a cloned restriction fragment from the
candidate locus.
Once a gene is cloned, then the more interesting questions can be examined. I will
need to translate its protein sequence and look for its identity by a search for homology
to known proteins in GenBank or similar database. If the protein is well characterized,
such as IL-4, then functional assays of IL-4 and the pathogenesis of vitiligo could be
examined. Mutational analysis by introducing a transgene containing a reporter gene
such as the lac gene or a gentimycin resistance gene could be introduced in the chick
embryo to create a knockout and see if vitiligo is recreated in a BL. The effects of over-
or under-expression of the protein can be assessed.


75
Table 2-6. Adoptive transfer of SL gamma globulin into 6 week-old BL10 hosts
Day of
Injection
Age
Pool
ml
Serum
Equiv.(ml)
mg IgG
1
6 w
2
5 ml
14
10.7
3
6 w
2
5 ml
14
10.7
6
6 w
2
5 ml
14
10.7
15
7 w
3
5 ml
11
18.4
23
8 w
1
1.5 ml
6
11.9
30
9 w
3
5 ml
11
18.4
4
5 ml
28
28.9
37
10 w
3
5 ml
11
18.4
4
5 ml
28
28.9


CHAPTER 3
T CELL RECEPTOR y REPERTOIRE ANALYSIS OF THE EXPANDED
PERIPHERAL BLOOD y5 T CELL POPULATION DURING AVIAN VITILIGO
Introduction
Many autoimmune diseases are T cell-dependent, which, in part, can be
determined by the study of TCR genes. T cell receptors can generate up to 1016 total
receptor specificities by combinatorial and junctional diversity (Janeway and Travers,
1997), although much of this diversity is lost during thymic education during the
induction of central tolerance. During an immune response, T cells respond in a clonal
fashion due to TCR recognition of antigenic peptides. Similarly, during an autoimmune
response, a fraction of T cells may be clonally expanded in response to self-antigen. The
T cell response may be described as (1) polyclonal, in which many T cell clones are
recruited in the response, (2) oligoclonal, in which a small number of T cell clones
expand, or (3) monoclonal, in which one specific clone responds. Experimentally, this
can be studied by TCR repertoire analysis of a T cell population. The identification of
recurrent TCR sequences (with the same or similar CDR3) in large T cell populations
provides evidence for antigen-driven expansion.
T cells present in acute graft-versus-host-disease of target organs (skin, liver, and
intestine) in HLA-matched allogeneic bone marrow transplants express predominantly
85


12
Viruses can produce proteins that can regulate or counteract the antiviral
responses of the host (Gooding, 1992; Marrack and Kappler, 1994). Epstein-Barr virus
stimulates the conversion of uncommitted T helper cells into Th2 helper cells by the
product of the BCRF1 gene which has structural and functional homology to IL-10. This
allows EBV to prevent the induction of Thl-activated inflammatory responses initiated
by such cytokines as IL-1, tumor necrosis factor, and interferon-y. The herpes simplex
virus induces the infected cell to express HSV-Fc receptor, a heterodimer of
glycoproteins E and I, which binds to the Fc region of the hosts nonimmune IgG. This
binding prevents complement-mediated lysis of infected cells by blocking access to the
cell surface of antiviral antibody or effector cells (Bell et al., 1990). Cowpox virus codes
for a soluble glycoprotein that has amino acid homology to that of the IL-1 receptor.
This product probably competes with cell-bound IL-1 receptors for secreted IL-1,
interfering with the activation of IL-1 cytokine-mediated inflammatory responses.
In persistent infections, such as in autoimmune hepatitis, the infected tissue is
destroyed during long-term chronic inflammatory responses to the replicating virus itself,
or is destroyed by the cytotoxic T cell response to the viral antigens presented on the
target tissue. This destruction inadvertently and continuously releases large quantities of
the organs self-antigens (especially those never exposed extracellularly) which become
presented by professional APCs in lymphoid tissue (Koziel et al., 1992; Cemy et al.,
1994). Wounds may also disrupt tolerance by causing the release of self-antigens
normally protected.


72
source of donors each week. This was dictated by the availability of a large enough pool
of SL donors with the desired stage of amelanosis and the work necessary to prepare the
splenocytes from several SL donors. Thus if SL males provided the desired amelanotic
features, their spleens were used to augment the SL donor cell source. The hosts in
Group 4 were retained until 20 weeks of age; however, no amelanosis was apparent.
The fifth adoptive cell transfer experiment also utilized 6 week-old nonirradiated
normal BL hosts with the same protocol as in the fourth experiment. Seven BL9 female
hosts were given injections of SL donor splenic lymphocytes on week 6 and then on week
7 (Group 5A). A control group of 3 BL9 females received injections on both weeks of
BL splenic lymphocytes (Table 2-4, Group 5B). These hosts were maintained for 18
weeks, and no amelanosis was observed.
Serum Transfer Experiment
We performed one experiment to determine whether the transfer of SL serum
autoantibodies to melanocyte antigens could result in the transfer of the disease into BL
chickens as evidenced by an amelanotic phenotype. Repetitive administrations of serum
have been utilized in previous studies of passive transfer of autoimmunity. For example,
in the autoimmune murine model for thyroiditis, serum transfers were performed on day
0, 2, and 4. This was sufficient to induce thyroid lesions by passive transfer of immune
serum in 10-12 week old animals (Tomazic and Rose, 1975). The regiment of weekly 1-
ml injections has been performed for 4 weeks by intravenous and subcutaneous means in
the OS chicken model of thyroiditis (Jaroszewski et al., 1978). Serum was collected from
SL chickens that expressed amelanotic phenotypes of various different stages (stages 2-5)


112
such as interleukin-1. Thyroid diseases, type I diabetes, and rheumatoid arthritis, all
diseases with autoimmune components, occur with increased frequency in patients with
vitiligo (Grimes, 1996).
In this study we sought to determine whether unique ev loci are correlated with
vitiligo in the SL chicken model by performing Southern blot analysis on genomic DNA
from BL and SL chickens. We identified novel ev loci not previously described for
White Leghorn or other chicken lines, which are segregating in BL and SL chicken lines
in a large number of different combinations or ev genotypes. Although four ev loci,
designated ev-SLl through ev-SL4, were observed to be present in significantly higher
proportions in SL than in BL chickens, none of the ev-SL loci was found to be
exclusively associated with the vitiligo phenotype when ev genotypes for affected and
nonaffected SL chickens were compared. However, the genetic polymorphisms detected
between BL and SL chickens by these studies suggest that this animal model may be
useful for further genetic analysis of vitiligo susceptibility.
Materials and Methods
Southern blot analysis
Genomic DNA samples were prepared from red blood cells of the BL and SL
chickens using standard protocols we have previously described (McCormack et al.,
1989). Genomic digests were prepared using the restriction endonucleases BamHl and
EcoKl (New England Biolabs) according to the manufacturers guidelines, and restriction
fragments were separated on 0.8% agarose gels. Southern blots were prepared using
Hybond N+ membranes (Amersham), hybridized at 65 C according to Church and Gilbert


81
CD45, MHC class I, MHC class II, and IL-2 receptor are also recognized by mouse
monoclonal antibodies (Cooper et al., 1991). Negative selection by means of complement
lysis of the non-desired T cell subsets, or positive selection using mouse anti-TCR mAb
and goat anti-mouse conjugated to magnetic beads are established methods. Another
possibility would require the isolation of clonal populations from regenerating feathers
using Con-A and IL-2 stimulated T cell subsets (Koevary et al., 1983; Panitch and
McFarlin, 1977). This would most closely resemble the T cells at the site of melanocyte
destruction (Erf et al., 1995b). There is the issue of the unknown feasibility of adopting
this technique to the chicken in vivo.
Nevertheless, the fact that 5 out of 12 BL5 hosts (44%) and 1 out of 4 BL7 hosts
(25%) survived long enough to manifest amelanosis by adoptive cell transfer indicates
that the amelanosis found in the SL chickens may be cell-mediated. A total of 40 BL
hosts of SL splenic lymphocytes were followed from all five experiments and of these 6
hosts (15%) became amelanotic. This is not by chance considering BL chickens normally
demonstrate only 1-2% comparatively. These results suggest that the autoreactive
lymphocytes are capable of recognizing BL, as well as SL, melanocytes, and that the SL
melanocyte defect may not be required for pathogenesis.
The T cell-mediated melanocyte destruction in vitiligo would resemble the T cell-
mediated destruction of pancreatic P cells in diabetes, demyelinization in myelin basic
protein-induced EAE, and destruction of follicular epithelial cells in autoimmune
thyroiditis. T cell involvement has also been suggested in two other autoimmune chicken
conditions, hereditary scleroderma in the UCD-200 and UCD-206 lines (Haynes and


157
Von-Herrath, M, and Holz, A. 1997. Pathological changes in the islet milieu preceed
infiltration of islets and destruction of beta-cells by autoreactive lymphocytes in a
transgenic model of virus-induced IDDM. J. Autoimmun. 10(3): 231-8.
Vyse, T.J., and Todd, J.A. 1996. Genetic analysis of autoimmune disease. Cell 85(3):
311-8.
Weber, W.T. 1972. Proliferative and functional capacity of bursal lymphocytes after
transfer to agammaglobulinemic chicks. Cellular Immunol. 4:51-65.
White, R., Hu, F., and Roman, N.A. 1983. False dopa reaction in studies of mammalian
tyrosinase: some characteristics and precautions. Stain Technology 58(1): 13-9.
Wick, G., Kite, J.H. Jr., and Witebsky, E. 1970. Spontaneous Thyroiditis. Euro. J.
Immunol. 104(2): 344-52.
Wicker, L.S., Miller, B.J., and Mullen, Y. 1986. Transfer of autoimmune diabetes
mellitus with splenocytes from nonobese diabetic (NOD) mice. Diabetes 35(8):
855-60.
Wilson, T.J., and Van de Water, J., Mohr, F.C., Boyd, R.L., Ansari, A., Wick, G., and
Gershwin, M.E. 1992. Avian scleroderma: evidence for qualitative and
quantitative T cell defects. J. Autoimmunity 5(3): 261-76.
Williams, R.C. Jr., and Malone, C.C. 1992. Studies of antibody to herpes simplex virus
Fc gamma-binding protein IgE in patients with rheumatoid arthritis, juvenile
rheumatoid arthritis and normal controls. Scand. J. Immunol. 36(6): 801-10.
Wu, J., Zhou, T., He, J., and Mountz, J.D. 1993. autoimmune disease in mice due to
integration of an endogenous retrovirus in an apoptosis gene. J. Exp. Med. 178:
461-8.
Wucherpfennig, K.W., Newcombe, J., Li, H., Keddy, C., Cuzner, M.L., Hafler, D.A.
1992. y T-cell receptor repertoire in acute multiple sclerosis lesions. Proc. Natl.
Acad. Sci USA 89(10): 4588-92.
Yagi, N., Yokono, K., Amano, K., Nagata, M., Tsukamoto, K., Hasegawa, Y., Yoneda,
R., Okamoto, N., Moriyama, H., Miki, M., Tominaga, Y., Miyazaki, J., Yagita, H.,
Okumura, K., Mizoguchi, A., Kiki, A., Ide, C., Maeda, S., and Kasuga, M. 1995.
Expression of intercellular adhesion molecule 1 on pancreatic B cells accelerates B
cell destruction of cytotoxic T cells in murine autoimmune diabetes. Diabetes
44(7): 744-52.


88
compartment than humans and mice, e.g., 20-50% in chicken and 3-5% in human and
mouse (Buey et al., 1988). One possible explanation for the expansion of PBL y5 T cells
is that melanocyte autoantigens caused an antigen-driven clonal expansion in the target
tissues. The peripheral blood with its higher proportion of y5 T cells, may reflect this
clonal expansion of y8 T cells infiltrating the feathers in the SL chicken, either as a spill
over effect from the target tissues. This was observed in the representation of certain
Vail and Vpi6 TCR transcripts in the blood reflecting the spillover of T cells
infiltrating the skin during human GVHD (Dietrich et al., 1994).
y8 T cells represent only 0.5-10% of the normal mammalian peripheral blood T
cell population, and they are believed to be involved in immunity to infectious disease
(Haas et al., 1993; Modlin et al., 1993; Mombaerts et al., 1993). A role for y8 T cells in
the pathogenesis of autoimmune disease has been suggested due to their reactivity to
stress proteins (Kaufman, 1990) and by the accumulation of y8 T cells in affected organs
and peripheral blood. For example, in systemic sclerosis, y8 T cells expressing the TCR
V81+gene segment are expanded in both PBL and the lungs, and have restricted
junctional diversity in terms of CDR3 length and sequence (Yurovsky et al., 1994 and
1995). This was indicated by a significantly higher proportion of repeated sequences in
the patients than in controls suggesting that V81+y8 T cells may be Ag-driven in systemic
sclerosis patients. The percentage of y8 T cells is expanded in PBL of patients with
inflammatory bowel disease, showing some skewing of V8 gene expression (Bucht et al.,
1995). Similarly, the frequency of y8 T cells is higher in PBL and cerebrospinal fluid of
multiple sclerosis patients, as compared to other neurologic disease patients and normal


15
red blood cells in autoimmune hemolytic anemia. These IgG- or IgA-coated cells may
fix complement to lyse these RBCs. The binding of autoantibodies to cells in tissues
allows for the fixation of sub-lytic doses of the membrane attack complex of complement
proteins to stimulate an inflammatory response recruiting inflammatory
polymorphonuclear cells and natural killer mediated antibody-dependent cell cytotoxicity
to cause tissue damage. An example of this is seen in Hashimotos thyroiditis.
Autoantibodies binding to a cell surface receptor can cause excessive activity by the
receptor or inhibit its stimulation by its natural ligand. Patients become hyperthyroid in
Graves disease because antibodies to thyroid stimulating hormone prevent normal
feedback to the production of thyroid hormone. Antibody response to soluble antigens
produces immune complexes that are normally cleared by red blood cells, which have
complement receptors, and phagocytes, which have complement and Fc receptors.
Failure to clear immune complexes leads to persistent presence and deposition, especially
after tissue injury continues to generate more of the antigen as in serum sickness, and
chronic infections such as bacterial endocarditis, and systemic lupus erythematosus. In
SLE, antibodies are formed against ubiquitously found intracellular nucleoproteins of all
nucleated cells, such as DNA, RNA, and histones. Immune complexes are formed that
deposit on the walls of small to medium blood vessels, especially in the renal glomeruli.
These complexes attract complement and PMNs, causing more tissue damage and starting
the cycle again. SLE is considered therefore a systemic rather than an organ-specific
autoimmune disease.
Mothers pass on their IgG antibodies to the fetus through the placenta. Babies
bom to mothers with IgG-mediated autoimmune diseases may often show the symptoms



PAGE 1

&+$5$&7(5,=$7,21 2) 7+( 3$7+2*(1(6,6 2) $0(/$126,6 ,1 7+( 60<7+ /,1( &+,&.(1 $ 02'(/ 2) 7+( +80$1 $872,0081( ',6($6( 9,7,/,*2 %\ ('081' & /(81* $ ',66(57$7,21 35(6(17(' 72 7+( *5$'8$7( 6&+22/ 2) 7+( 81,9(56,7< 2) )/25,'$ ,1 3$57,$/ )8/),//0(17 2) 7+( 5(48,5(0(176 )25 7+( '(*5(( 2) '2&725 2) 3+,/2623+< 81,9(56,7< 2) )/25,'$

PAGE 2

&RS\ULJKW E\ ('081' & /(81*

PAGE 3

,Q ORYLQJ UHPHPEHUDQFH RI P\ JUDQGPRWKHU *HUWUXGH &KXU +R P

PAGE 4

$&.12:/('*0(176 7KHUH DUH PDQ\ SHRSOH ZDQW WR DFNQRZOHGJH LQ PDNLQJ WKLV SURMHFW SRVVLEOH )LUVW RI DOO DP DSSUHFLDWLYH RI P\ PHQWRU 'U :D\QH 0F&RUPDFN IRU WKH RSSRUWXQLW\ WR MRLQ KLV ODE DQG IRU WKH GLVWLQFWLRQ RI EHLQJ KLV ILUVW JUDGXDWH VWXGHQW WKDQN KLP IRU SDVVLQJ RQ KLV NQRZOHGJH DQG H[SHULHQFH WKDQN P\ FRPPLWWHH PHPEHUV 'UV 0DUN $WNLQVRQ 0DXUHHQ *RRGHQRZ :DUG :DNHODQG DQG 7KRPDV 5RZH IRU DOO WKHLU VXJJHVWLRQV VXSSRUW DQG HQFRXUDJHPHQW WKDQN 'U *RRGHQRZ IRU KHU JLIW RI WKH /75 SUREH LQ P\ HQGRJHQRXV YLUXV VWXG\ )RU DOO WKH ZRUN RQ WKH OLYH FKLFNHQV ZDQW WR WKDQN 'UV 5REHUW 6P\WK -U DQG *LVHOD (UI IRU DVVLVWDQFH LQ HVWDEOLVKLQJ FRORQLHV RI 6P\WK DQG %URZQ OLQH FKLFNHQV :LWKRXW WKHLU LQVLJKW ZRXOG QRW KDYH EHHQ DEOH WR GHYHORS WKLV SURMHFW 'UV -DFN *DVNLQV *DU\ %XWFKHU 9LFWRU $SDQLXV %HQ 0DWKHU DQG 5LFKDUG 0LOHV ZHUH DOO LQVWUXPHQWDO LQ P\ WULDOV DQG HUURUV LQ OHDUQLQJ KRZ WR SHUIRUP SKOHERWRPLHV RQ FKLFNHQV DQG WR SHUIRUP LQMHFWLRQV DP WKDQNIXO IRU WKH PDQ\ PDQ\ KRXUV SURYLGHG E\ DOPRVW D GR]HQ 8QLYHUVLW\ RI )ORULGD XQGHUJUDGXDWH VWXGHQWV ZKR ZHUH ZLOOLQJ WR FRPH IDLWKIXOO\ WR RXU SRXOWU\ IDFLOLWLHV HYHQ LQ UDLQ\ ZHDWKHU 7KH\ OHDUQHG KRZ WR WDPH WKHVH FKLFNHQV HQRXJK WR PRYH WKHP RQH DW D WLPH IURP D SHQ :LWKRXW WKHP FRXOG QRW KDYH SHUIRUPHG WKH FHOO DQG VHUXP LQMHFWLRQV WKH VHUXP FROOHFWLRQ DQG SOXFNHG IHDWKHUV HYHU\ WZR ZHHNV ,9

PAGE 5

6R WKDQN 6KDURQ 5LFKHUWVRQ %UDG &RSOH\ -DLPH 6DQFKH] 1LOHVK 3DWHO 5DQG\ 6FDUERUR DQG 6KDOO\ :DQJ 0D\ WKH\ UHJDUG WKH H[SHULHQFH DV XVHIXO WR WKHLU FDUHHUV WKDQN %UXFH *OLFN IRU KLV VXJJHVWLQJ WKDW XVH F\FORSKRVSKDPLGH UDWKHU WKDQ LUUDGLDWLRQ WR LPPXQRVXSSUHVV WKH FKLFNHQV ZLVK KDG IROORZHG WKLV DGYLFH WKDQN 5REHUW ( %RLVV\ IRU KLV VXJJHVWLRQV DV ZHOO WKDQN .DUHQ $FKH\ IRU DOO KHU HIIRUWV LQ VHTXHQFLQJ WKDQN 3DW *OHQGRQ IRU KHU DVVLVWDQFH LQ DQDO\]LQJ SURWHLQV 5RVH 3UDWW GLG VR PXFK WR SURYLGH FU\RVHFWLRQV RI UHJHQHUDWLQJ IHDWKHUV DP JUDWHIXO WR 3DXO .XELOLV IRU KLV DGYLFH RQ VWDWLVWLFDO DQDO\VHV $QG WKDQN WKH PHPEHUV RI WKH 0F&RUPDFN ODE &KHU\O 6SHQFH /XNH 8WOH\ -DYLHU 6DQFKH]*DUFLD $OH[ $OOHU &KULVW\ 0\ULFN 'DYLG *LOO .LP 7D\ORU 1HKD 6DKQL DQG &ODXGLD /D]R GH OD 9HJD DQG PDQ\ RI WKH YROXQWHHU VWXGHQWV DOUHDG\ PHQWLRQHG IRU WKHLU IULHQGVKLS DQG WHFKQLFDO VXSSRUW WKDQN P\ IDPLO\ DQG P\ IULHQGV ZKR KDYH PDGH WKHLU RZQ VDFULILFHV WR KHOS PH VHH WKLV SURMHFW FRPH WR IUXLWLRQ HVSHFLDOO\ DOVR ZDQW WR WKDQN 'U -LQ ;LRQJ 6KH IRU EHOLHYLQJ LQ P\ SRWHQWLDO DQG RIIHULQJ D SRVWGRFWRUDWH SRVLWLRQ WR PH Y

PAGE 6

7$%/( 2) &217(176 SDJH $&.12:/('*0(176 LY /,67 2) 7$%/(6 L[ /,67 2) ),*85(6 [ $%675$&7 [LL &+$37(56 ,1752'8&7,21 $XWRLPPXQLW\ 7ROHUDQFH 0HFKDQLVPV /RVV RI ,PPXQRORJLFDO 7ROHUDQFH 0HFKDQLVPV RI $XWRLPPXQLW\ 5HJXODWLRQ RI $XWRLPPXQH 5HVSRQVHV $XWRLPPXQH 'LVHDVHV &DXVH E\ $QWLERGLHV $XWRLPPXQH 'LVHDVHV &DXVHG E\ 7 FHOOV 9LWLOLJR LQ +XPDQV 0HODQRF\WH %LRORJ\ 9LWLOLJR 3DWKRORJ\ 7KH $VVRFLDWLRQ RI 9LWLOLJR ZLWK 2WKHU $XWRLPPXQH 'LVHDVHV DQG WKH *HQHWLFV RI 9LWLOLJR 6XVFHSWLELOLW\ LQ +XPDQV 7KH &%/-YLYM< 0RXVH 0RGHO IRU 9LWLOLJR 7KH 6P\WK /LQH 6/f &KLFNHQ $QLPDO 0RGHO IRU 9LWLOLJR 0HODQRF\WH %LRORJ\ $PHODQRVLV 3DWKRORJ\ LQ WKH 6P\WK &KLFNHQ *HQHWLFV RI 9LWLOLJR 6XVFHSWLELOLW\ LQ 6/ &KLFNHQV &KLFNHQ ,PPXQRORJ\ &KLFNHQ ,PPXQRJOREXOLQ *HQHV DQG % &HOO 'HYHORSPHQW &KLFNHQ 7 &HOO 5HFHSWRU *HQHV DQG 7 &HOO 'HYHORSPHQW 7 &HOO 5HSHUWRLUH $QDO\VLV 2WKHU &KLFNHQ 0RGHOV RI $XWRLPPXQLW\ /LPLWDWLRQV LQ WKH 8VH RI WKH &KLFNHQ $QLPDO 0RGHO 5DWLRQDOH IRU 7KLV 6WXG\ YL

PAGE 7

$'237,9( 75$16)(5 2) $0(/$126,6 ,1 7+( 60<7+ /,1( &+,&.(1 ,QWURGXFWLRQ 0DWHULDOV DQG 0HWKRGV $QLPDOV 6H[ 'HWHUPLQDWLRQ E\ 3&5 ,PPXQRVXSSUHVVLRQ RI WKH +RVW $QLPDOV 3UHSDUDWLRQ RI WKH 6/ 'RQRU &HOOV DQG &HOO ,QMHFWLRQV 6P\WK /LQH 6HUXP &ROOHFWLRQ DQG 3UHSDUDWLRQ &HOO /LQHV DQG 6RXUFH ,PPXQREORWWLQJ +LVWRORJ\ 5HVXOWV 2EVHUYDWLRQV RI WKH 8) &RORQ\ RI 6P\WK /LQH &KLFNHQV $GRSWLYH &HOO 7UDQVIHU ([SHULPHQWV 6HUXP 7UDQVIHU ([SHULPHQW :HVWHUQ %ORW $QDO\VLV 'LVFXVVLRQ 7 &(// 5(&(3725 \ 5(3(572,5( $1$/<6,6 2) 7+( (;3$1'(' 3(5,3+(5$/ %/22' \6 7 &(// 3238/$7,21 '85,1* $9,$1 9,7,/,*2 ,QWURGXFWLRQ 0DWHULDOV DQG 0HWKRGV $QLPDOV 573&5 DQG &ORQLQJ '1$ 6HTXHQFH &RPSDULVRQV 5HVXOWV 3KHQRW\SH RI %LUGV 8VHG IRU 5HSHUWRLUH $QDO\VLV 7&59\ 5HSHUWRLUH $QDO\VLV &'5 /HQJWK DQG $PLQR $FLG &RPSRVLWLRQ -\ 8VDJH 'LVFXVVLRQ (1'2*(1286 9,5$/ /2&, ,1 7+( 60<7+ /,1( &+,&.(1 $ 02'(/ )25 7+( $872,0081( ',6($6( 9,7,/,*2 ,QWURGXFWLRQ 0DWHULDOV DQG 0HWKRGV 6RXWKHUQ %ORW $QDO\VLV 6WDWLVWLFDO $QDO\VHV 5HVXOWV 3KHQRW\SLF $QDO\VLV RI 6/ 6DPSOH 3RSXODWLRQ YLL

PAGE 8

6RXWKHUQ %ORW $QDO\VLV RI %/ DQG 6/ HY /RFL &RPSDULVRQ RI %/ DQG 6/ HY *HQRW\SHV &RPSDULVRQ RI 6/ 3URJUHVVRU DQG 6/ 1RQSURJUHVVRU HY *HQRW\SHV 'LVFXVVLRQ 6800$5<$1' )8785( ',5(&7,216 /,67 2) 5()(5(1&(6 %,2*5$3+,&$/ 6.(7&+ YP

PAGE 9

/,67 2) 7$%/(6 7DEOH SDJH $PHODQRVLV LQFLGHQFH LQ WKH 8) 6P\WK OLQH FRORQ\ $GRSWLYH WUDQVIHU RI DPHODQRVLV ZLWK VLQJOH WUDQVIHUV RI 6/ O\PSKRF\WHV 3URJUHVVLRQ RI DPHODQRVLV LQ %/ KRVWV DIWHU DGRSWLYH WUDQVIHUV RI 6/ O\PSKRF\WHV $GRSWLYH WUDQVIHU RI DPHODQRVLV ZLWK PXOWLSOH WUDQVIHUV RI 6/ O\PSKRF\WHV %LR 5DG SURWHLQ DVVD\ RI JDPPD JOREXOLQ SRROV DQG VHOHFWHG VHUXP VDPSOHV $GRSWLYH WUDQVIHU RI 6/ JDPPD JOREXOLQV LQWR ZHHN ROG %/ KRVWV $PHODQRVLV VWDJH RI 6P\WK /LQH FKLFNHQV DW DJHV ZHHNV 6P\WK OLQH 6/f FKLFNHQ SKHQRW\SHV )UHTXHQFLHV RI HY ORFL GHWHFWHG LQ %/ DQG 6/ FKLFNHQV )UHTXHQFLHV RI HY ORFL GHWHFWHG LQ 6/ SURJUHVVLQJ Sf DQG QRQSURJUHVVLQJ QSf FKLFNHQV ,;

PAGE 10

/,67 2) ),*85(6 )LJXUH SDJH $ IHPDOH 6P\WK OLQH FKLFNHQ GLVSOD\LQJ DPHODQRVLV RI VWDJH $ JURXS RI 6P\WK OLQH FKLFNHQV DW YDULRXV VWDJHV RI DPHODQRVLV $ W\SLFDO SDLU RI SDUHQWDO %URZQ OLQH FKLFNHQV 0RGHO RI GHYHORSLQJ IHDWKHU VKRZLQJ WKH DUUDQJHPHQW RI EDUE ULGJHV $ FURVV VHFWLRQ RI D IHDWKHU VKDIW DQG EDUE $ VLQJOH EDUE ULGJH &KLFN WK\PRF\WH GHYHORSPHQW 0RGHOV GHSLFWLQJ WKH 9 DQG & JHQH VHJPHQWV RI WKH 7 FHOO UHFHSWRUV )UHTXHQFLHV RI 6P\WK OLQH IHPDOHV )UHTXHQFLHV RI 6P\WK /LQH PDOHV )UHTXHQFLHV RI 6P\WK OLQH IHPDOHV DQG PDOHV %/ D %URZQ OLQH DGRSWLYH WUDQVIHU KRVW GLVSOD\LQJ VWDJH DPHODQRVLV %/ D %URZQ OLQH DGRSWLYH WUDQVIHU KRVW GLVSOD\LQJ VWDJH DPHODQRVLV $GRSWLYH FHOO WUDQVIHU KRVWV VKRZ DQWLPHODQRF\WH DQWLERG\ SURILOH W\SLFDO RI 6/ FKLFNHQV 3DUWLDO QXFOHRWLGH VHTXHQFHV RI UHDUUDQJHG 7&5 9\ JHQHV 3DUWLDO QXFOHRWLGH VHTXHQFHV RI UHDUUDQJHG 7&5 9\ JHQHV 3DUWLDO QXFOHRWLGH VHTXHQFHV RI UHDUUDQJHG 7&5 9\ JHQHV [

PAGE 11

3UHGLFWHG DPLQR DFLG VHTXHQFHV RI UHDUUDQJHG 7&5 9\ JHQHV 6RXWKHUQ EORW DQDO\VLV RI HY ORFL GHWHFWHG DV %DP+O UHVWULFWLRQ IUDJPHQWV 6RXWKHUQ EORW DQDO\VLV RI HY ORFL GHWHFWHG DV (FR5O UHVWULFWLRQ IUDJPHQWV %/ DQG 6/ FKLFNHQV KDYH VLPLODU WRWDO QXPEHUV RI HY ORFL 6/ FKLFNHQV KDYH PRUH HY6/ ORFL WKDQ %/ FKLFNHQV [L

PAGE 12

$EVWUDFW RI 'LVVHUWDWLRQ 3UHVHQWHG WR WKH *UDGXDWH 6FKRRO RI WKH 8QLYHUVLW\ RI )ORULGD LQ 3DUWLDO )XOILOOPHQW RI WKH 5HTXLUHPHQWV IRU WKH 'HJUHH RI 'RFWRU RI 3KLORVRSK\ &+$5$&7(5,=$7,21 2) 7+( 3$7+2*(1(6,6 2) $0(/$126,6 ,1 7+( 60<7+ /,1( &+,&.(1 $ 02'(/ 2) 7+( +80$1 $872,0081( ',6($6( 9,7,/,*2 %\ ('081' & /(81* 0D\ &KDLUPDQ :D\QH 7 0F&RUPDFN 3K' 0DMRU 'HSDUWPHQW ,PPXQRORJ\ 3DWKRORJ\ DQG /DERUDWRU\ 0HGLFLQH $XWRLPPXQH GLVHDVHV UHVXOW ZKHQ FRPSRQHQWV RI QRUPDOO\ LQQRFXRXV ERG\ WLVVXHV KDYH XQH[SHFWHGO\ XQGHUJRQH FKDQJHV WKDW PDNH WKHP DSSHDU IRUHLJQ WR WKH LPPXQH V\VWHP 7KH LPPXQH V\VWHP UHFRJQL]HV DEHUUDQWO\ H[SUHVVHG VHOI SURWHLQV DV QRQVHOI DQG UHFUXLWV DQ LPPXQH DWWDFN RQ VHOI ,Q WKH KXPDQ DXWRLPPXQH GLVHDVH YLWLOLJR WKH SLJPHQW SURGXFLQJ FHOOV RI WKH VNLQ WKH PHODQRF\WHV DUH GHVWUR\HG DQG SDWLHQWV PDQLIHVW LUUHJXODU H[SDQGLQJ GHSLJPHQWHG SDWFKHV RI VNLQ $Q DQLPDO PRGHO IRU YLWLOLJR WKH 6P\WK OLQH FKLFNHQ GLVSOD\V D VSRQWDQHRXV ORVV RI IHDWKHU DQG RFXODU PHODQRF\WHV DQG WKH IHDWKHUV SURJUHVVLYHO\ EHFRPH ZKLWHU )LIW\ SHUFHQW RI WKH ELUGV DOVR EHFRPH EOLQG %\ DGRSWLYH WUDQVIHU RI VSOHQRF\WHV GHPRQVWUDWHG WKDW DPHODQRVLV FDQ EH WUDQVIHUUHG DQG PHGLDWHG E\ O\PSKRF\WHV 7KLV LV WKH ILUVW GLUHFW GHPRQVWUDWLRQ WKDW O\PSKRF\WHV PHGLDWH WKH GLVHDVH 3ULRU UHVHDUFK E\ EXUVHFWRP\ KDV VKRZQ DQWLERG\ PHGLDWLRQ $ UROH IRU \ 7 FHOOV ZDV SUHYLRXVO\ VXJJHVWHG E\ WKHLU H[SDQVLRQ LQ QXPEHU ;OO

PAGE 13

RI SHULSKHUDO EORRG O\PSKRF\WHV ZLWK DJH LQ 6/ FKLFNHQV 6HTXHQFH DQDO\VLV RI WKH 7 FHOO UHFHSWRU \ UHSHUWRLUH RI WKH SHULSKHUDO EORRG O\PSKRF\WHV LQGLFDWHG D SRO\FORQDO H[SDQVLRQ UDWKHU WKDQ PRQRFORQDO RU ROLJRFORQDO D UHVXOW WKDW PLJKW EH H[SHFWHG LI WKH\ SOD\HG D GLUHFW UROH LQ DQWLJHQGULYHQ SDWKRJHQHVLV 7KH H[SDQVLRQ RI \ 7 FHOOV PD\ EH VHFRQGDU\ WR VSLOORYHU IURP WKH VLWH RI LQIODPPDWLRQ DW WKH UHJHQHUDWLQJ IHDWKHU SXOS $ IXWXUH H[SHULPHQW WR H[DPLQH WKH 7 FHOOV IRXQG LQ WKH GHYHORSLQJ IHDWKHU PD\ GHPRQVWUDWH UHFXUUHQFH RI DQ ROLJRFORQDO VXEVHW RI 7 FHOOV 7KLV FRXOG OHDG WR WKH GHYHORSPHQW RI WKHUDS\ DLPHG DW LQKLELWLQJ FORQDO 7 FHOO DFWLYDWLRQ 6RXWKHUQ EORW DQDO\VLV LQGLFDWHV WKDW GHSLJPHQWDWLRQ GRHV QRW DSSHDU WR VKRZ DQ DVVRFLDWLRQ ZLWK WKH SUHVHQFH RI LQWHJUDWHG HQGRJHQRXV YLUXVHV 7KH JHQHWLF KHWHURJHQHLW\ SUHVHQW LQ 6/ FKLFNHQV DQG UHYHDOHG E\ WKH HY JHQRW\SLQJ VKRZV WKH IHDVLELOLW\ RI JHQHWLF OLQNDJH PDSSLQJ WR ILQG YLWLOLJR VXVFHSWLELOLW\ ORFL 7KHUH DUH PDQ\ GLVHDVHV WKDW KDYH DXWRLPPXQH UHVSRQVHV WR ZKDW DUH QRUPDOO\ LQQRFXRXV HYHU\GD\ SURWHLQV SURGXFHG LQ WKH ERG\ 6WXG\LQJ DXWRLPPXQH YLWLOLJR DGGV RQH PRUH SLHFH WR WKH DXWRLPPXQH GLVHDVH SX]]OH 2QH WR WZR RXW RI HYHU\ SHUVRQV VXIIHU IURP YLWLOLJR ,I D FRPPRQ IDFWRU FDQ EH IRXQG WKHQ SUHYHQWLYH WKHUDSLHV ZRXOG HQKDQFH WKH OLYHV RI PDQ\ SHRSOH [LLL

PAGE 14

&+$37(5 ,1752'8&7,21 $XWRLPPXQLW\ 7KH QRUPDO IXQFWLRQ RI WKH DGDSWLYH LPPXQH UHVSRQVH WR D IRUHLJQ DQWLJHQ LV WKH FOHDUDQFH RI WKH IRUHLJQ DQWLJHQ $Jf IURP WKH ERG\ 7KLV LV PDLQO\ DFKLHYHG WKURXJK WKH % O\PSKRF\WH FRPSDUWPHQW ZKLFK GHYHORSV LQ WKH PDUURZ LQ PDPPDOV RU WKH EXUVD LQ DYLDQ VSHFLHV DQG WKURXJK WKH 7 O\PSKRF\WH RU WK\PRF\WH FRPSDUWPHQW WKDW PDWXUHV LQ WKH WK\PXV 7KH ERG\ KDV OHDUQHG WR GLVWLQJXLVK EHWZHHQ VHOIDQWLJHQV DQG IRUHLJQ DQWLJHQV GXULQJ 7 O\PSKRF\WH RQWRJHQ\ (VVHQWLDOO\ VHOIWROHUDQFH LV HVWDEOLVKHG EHIRUH PDWXUH 7 FHOOV OHDYH WKH WK\PXV WR HQWHU WKH SHULSKHUDO FLUFXODWLRQ IRU QRUPDO VXUYHLOODQFH 7ROHUDQFH FDQ EH LQGXFHG WR VRPH IRUHLJQ DQWLJHQV DQG VHOIDQWLJHQV LQ WKH SHULSKHU\ E\ VHYHUDO PHDQV $QWLJHQ SUHVHQWLQJ FHOOV $3&Vf ZKLFK LQFOXGH % FHOOV DQG YDULRXV PRQRQXFOHDU FHOOV PRQRF\WHV LQ EORRG PDFURSKDJHV LQ WLVVXHV /DQJHUKDQV FHOOV LQ WKH VNLQ .XSIIHU FHOOV LQ OLYHU GHQGULWLF FHOOV LQ O\PSK QRGHVf SURFHVV DQG SUHVHQW DQWLJHQ SHSWLGHV LQ WKH JURRYH RI WKH PDMRU KLVWRFRPSDWLELOLW\ FRPSOH[ 0+&f PROHFXOHV 7KH $J0+& FRPSOH[ HQJDJHV ZLWK WKH 7 FHOO UHFHSWRU KHWHURGLPHU RQ WKH VXUIDFH RI D QDLYH 7 FHOO PLJUDWLQJ WKURXJK WKH FRUWLFDO UHJLRQV LQ O\PSKRLG WLVVXH &Rn VWLPXODWLRQ LV SURYLGHG E\ % RQ WKH $3& HQJDJLQJ &' RQ WKH 7 FHOO 7KH DFWLYDWHG 7 FHOO WKHQ UHPDLQV LQ WKH O\PSKRLG WLVVXH SUROLIHUDWHV DQG GLIIHUHQWLDWHV LQWR DUPHG

PAGE 15

HIIHFWRU 7 FHOOV 7 KHOSHU 7KOf FHOOV ZLOO LQVWUXFW SKDJRF\WHV WR FOHDU LQYROYHG WLVVXH FHOOV FRQWDLQLQJ LQWUDFHOOXODU SDUDVLWHV 7K FHOOV ZLOO DFWLYDWH WKH FRUUHVSRQGLQJ % FHOO LQ WKH JHUPLQDO FHQWHUV WR PXOWLSO\ XQGHUJR VRPDWLF K\SHUPXWDWLRQV DIILQLW\ PDWXUDWLRQf GLIIHUHQWLDWH WR EHFRPH SODVPD FHOOV DQG VHFUHWH DQWLERGLHV WR FRPSOH[ WKH H[WUDFHOOXODU DQWLJHQ RU WR RSVRQL]H IRUHLJQ SDUWLFOHV IRU UHFRJQLWLRQ E\ SKDJRF\WHV 7 KHOSHU FHOOV ZLOO DOVR DFWLYDWH F\WRWR[LF &7/f 7 O\PSKRF\WHV WR GHVWUR\ LQIHFWHG FHOOV 7KH JRDO LV FRPSOHWH DQG HIILFLHQW FOHDUDQFH RI WKH DQWLJHQ IURP WKH ERG\ 0HPRU\ % DQG 7 FHOOV DUH JHQHUDWHG LQ SUHSDUDWLRQ IRU D VHFRQG H[SRVXUH WR WKH DQWLJHQ ZLWK % FHOOV XQGHUJRLQJ VRPDWLF PXWDWLRQ DGGLQJ GLYHUVLW\ DQG EHWWHU VSHFLILFLW\ 7KLV LV D JHQHUDO GHVFULSWLRQ RI DQ LGHDOO\ IXQFWLRQLQJ LPPXQH V\VWHP UHYLHZHG LQ -DQHZD\ DQG 7UDYHUV $EEDV HW DOf f ,QDSSURSULDWH UHVSRQVHV E\ 7 FHOOV KDYH EHHQ VXJJHVWHG WR LQLWLDWH DXWRLPPXQLW\ DV D UHVXOW RI D VXVWDLQHG LPPXQH UHVSRQVH DJDLQVW VHOIDQWLJHQ ,QDSSURSULDWH 7 FHOO KHOS FDQ DFWLYDWH D KDUPIXO DQWLERG\ UHVSRQVH DJDLQVW VHOIDQWLJHQV DQG DFWLYDWH SRO\PRUSKRQXFOHDU FHOOV 301Vf WR FDXVH WLVVXH GDPDJH 7 KHOSHU FHOOV ZLOO UHFUXLW F\WRWR[LF 7 FHOOV $XWRLPPXQH DQWLERGLHV FDQ ELQG WR WKH WDUJHW VXUIDFH DQWLJHQ DQG FDXVH FRPSOHPHQWPHGLDWHG F\WRO\VLV RI WKH VHOI WLVVXHV $XWRLPPXQH DQWLERGLHV FDQ DOVR LQLWLDWH DQWLERG\ GHSHQGHQW FHOOPHGLDWHG F\WRWR[LFLW\ $'&&f UHFUXLWLQJ QDWXUDO NLOOHU FHOOV WR SHUIRUP F\WRO\WLF NLOOLQJ RI WKH DXWRDQWLJHQH[SUHVVLQJ WDUJHW FHOO $XWRLPPXQH UHVSRQVHV FDQ EH GHVFULEHG DV D ORVV RI VHOIWROHUDQFH ,I WKHUH LV D VXVWDLQHG LPPXQH UHVSRQVH WKDW GHYHORSV DJDLQVW WKH VHOIDQWLJHQV LW EHFRPHV FKURQLF LI WKH LQLWLDO LPPXQH HIIHFWRU PHFKDQLVPV FDQ QRW HOLPLQDWH WKH DQWLJHQ FRPSOHWHO\ 7KH IDFW WKDW WKH ERG\ LV FRQVWDQWO\ SURGXFLQJ DQG LV WKHUHIRUH SURYLGLQJ D FRQVWDQW VRXUFH RI

PAGE 16

WKH YHU\ DQWLJHQ WKDW WKH LPPXQH UHVSRQVH LV DJDLQVW PDNHV LW QHDUO\ LPSRVVLEOH IRU WKH YLFLRXV F\FOH WR HQG 7KH LPPXQH UHVSRQVH LQWHQGHG WR SURWHFW WKH ERG\ IURP IRUHLJQ LQWUXGHUV KDV LQ WKH FDVH RI DQ DXWRLPPXQH GLVHDVH ODXQFKHG D FKURQLF LQIODPPDWRU\ LQMXU\ DJDLQVW LWV RZQ WLVVXHV DQG PD\ LQ VRPH FDVHV SURYH WR EH OHWKDO 7ROHUDQFH 0HFKDQLVPV $XWRLPPXQLW\ RFFXUV DV D UHVXOW RI D EUHDNGRZQ RI WROHUDQFH PHFKDQLVPV 7ROHUDQFH LV DFKLHYHG ZKHQ 7 FHOOV UHFRJQL]H DQWLJHQ LQ WKH DEVHQFH RI FRVWLPXODWLRQ EXW UHPDLQ LQDFWLYDWHG KDYLQJ UHFHLYHG RQO\ RQH RI WKH WZR UHTXLUHG DFWLYDWLRQ VLJQDOV 7ROHUDQFH LV HVWDEOLVKHG LQ SHULSKHUDO WLVVXHV DQG PDLQWDLQHG PDLQO\ E\ GHYHORSLQJ FHQWUDO WROHUDQFH RI WKH GHYHORSLQJ WK\PRF\WHV WR VHOIDQWLJHQV SULRU WR H[SRVXUH WR WKH RXWVLGH HQYLURQPHQW DQG WKHQ E\ SHULSKHUDO WROHUDQFH PHFKDQLVPV %RQH PDUURZ GHULYHG SUHFXUVRU 7 FHOOV XQGHUJR WKH SURFHVV RI WK\PRF\WH HGXFDWLRQ E\ ILUVW SRVLWLYH VHOHFWLRQ IRU FHOOV WKDW UHVSRQG WR VHOI 0+& H[SUHVVHG RQ FRUWLFDO HSLWKHOLDO FHOOV IRXQG LQ WKH WK\PXV 2QO\ WKRVH WKDW ELQG WKH VHOI 0+& PROHFXOHV ZLWK VRPH DIILQLW\ EXW QRW H[FHVVLYHO\ FRQWLQXH WR WKH WK\PLF PHGXOOD IRU QHJDWLYH VHOHFWLRQ 7KRVH WKDW GR QRW ELQG RU ELQG WR VHOI 0+& WRR ZHOO DUH GHOHWHG ,Q QHJDWLYH VHOHFWLRQ WKH WK\PLF PHGXOOD SUHVHQWV VHOIDQWLJHQ RQ VHOI 0+& PROHFXOHV DV H[SUHVVHG RQ ERQHPDUURZ GHULYHG GHQGULWLF FHOOV DQG PDFURSKDJHV 2QO\ WKRVH WK\PRF\WHV WKDW ELQG ZLWK VRPH DIILQLW\ EXW QRW WRR H[FHVVLYHO\ DUH DOORZHG WR OHDYH WKH WK\PXV DV FRPSHWHQW PDWXUH 7 FHOOV WKH UHVW DUH GHOHWHG E\ LQGXFLQJ DSRSWRVLV 6R SRWHQWLDOO\ VHOIUHDFWLYH 7 FHOO FORQHV DUH GHOHWHG EHIRUH MRLQLQJ WKH SHULSKHUDO 7 FHOO UHSHUWRLUH 7KLV HVWDEOLVKHV FHQWUDO WROHUDQFH 7KLV KDV EHHQ GHPRQVWUDWHG LQ PLFH H[SUHVVLQJ WKH 0LVD PLQRU O\PSKRF\WH VWLPXODWLQJf JHQH

PAGE 17

SURGXFW ZKLFK FDQ LQWHUDFW ZLWK D KLJK SURSRUWLRQ RI 7 FHOOV H[SUHVVLQJ SDUWLFXODU 9 JHQH VHJPHQWV 93 VXEIDPLO\ 9Sf 7KRVH 7 FHOOV WKDW UHFRJQL]H ERWK 0OVD DQG WKH DSSURSULDWH + DOOHOH ZHUH HOLPLQDWHG GXULQJ 7 FHOO GHYHORSPHQW LQ WKH WK\PXV 0LV LV FRQVLGHUHG D VXSHUDQWLJHQ .DSSOHU HW DO 0DF'RQDOG HW DO f 'HYHORSLQJ WK\PRF\WHV WKDW ELQG YLUDO RU EDFWHULDO VXSHUDQWLJHQV LQWHJUDWHG LQWR KXPDQ DQG PRXVH JHQRPHV RI VRPH VWUDLQV KDYH OLNHZLVH H[SHULHQFHG LQWUDWK\PLF GHOHWLRQ UDWKHU WKDQ DQHUJ\ RU SHULSKHUDO VXSSUHVVLRQ WR SURYLGH WROHUDQFH &HQWUDO WROHUDQFH LV LQFRPSOHWH EHFDXVH QRW DOO VHOIDQWLJHQV ZLOO EH H[SUHVVHG LQ WKH WK\PXV GXULQJ 7 FHOO GHYHORSPHQW 7KHUHIRUH SHULSKHUDO VHOIWROHUDQFH PXVW EH HVWDEOLVKHG ,Q WKH SHULSKHU\ WKH PDWXUH 7 FHOO LV DFWLYDWHG E\ UHFRJQL]LQJ WKH SHSWLGH0+& FRPSOH[ RQ D SURIHVVLRQDO DQWLJHQ SUHVHQWLQJ FHOO $3&f WKDW PXVW DOVR SURYLGH FRVWLPXODWLRQ RI WKH 7 FHOOfV &' UHFHSWRU E\ % PROHFXOHV RQ WKH $3& ,Q WKH DEVHQFH RI FRVWLPXODWLRQ VSHFLILF DQWLJHQ UHFRJQLWLRQ OHDGV WR DQHUJ\ RU GHOHWLRQ RI WKH PDWXUH 7 FHOO 7KRVH DQWLJHQV H[SUHVVHG XQLTXHO\ E\ SHULSKHUDO RUJDQV ZLOO QRW QRUPDOO\ LQGXFH FORQDO GHOHWLRQ XQOHVV WUDQVSRUWHG WR WKH WK\PXV LQ VXIILFLHQW DPRXQWV RU EURXJKW WR O\PSKRLG WLVVXH 7KLV LV HVSHFLDOO\ WKH FDVH IRU RUJDQVSHFLILF LQWUDFHOOXODU VHOIn DQWLJHQV ORFDWHG LQ VHTXHVWHUHG VLWHV %DUNHU DQG %LOOLQJKDP f RU VHOIDQWLJHQV H[SUHVVHG EHORZ D PLQLPDO FRQFHQWUDWLRQ OHYHO 6FKLOG HW DO )HUEHU HW DO f 7KHVH DUH LPPXQRORJLFDOO\ LJQRUHG EHFDXVH RI WKH DEVHQFH RI FRVWLPXODWRU DFWLYLW\ RQ WLVVXH FHOOV 7KH DXWRUHDFWLYH 7 FHOOV VSHFLILF IRU WKHVH VHOIDQWLJHQV DUH XVXDOO\ QRW HOLPLQDWHG QRU DQHUJL]HG XQOHVV WKH VHOIDQWLJHQV EHFRPH SUHVHQWHG E\ SURIHVVLRQDO $3&V LQ O\PSKRLG WLVVXH WKDW ZRXOG EUHDN WKH LJQRUDQFH $LFKHOH HW DO f

PAGE 18

,Q WKH % O\PSKRF\WH UHSHUWRLUH HOLPLQDWLRQ RI SRWHQWLDOO\ VHOIUHDFWLYH % FHOOV RFFXUV ZKHQ LPPDWXUH % FHOOV ELQG WR PXOWLYDOHQW PHPEUDQH ERXQG VHOIDQWLJHQV GXULQJ % FHOO RQWRJHQ\ ZLWKLQ WKH ERQH PDUURZ 7KH\ DUH GHOHWHG E\ DSRSWRVLV E\ DFWLYDWLRQ RI WKH )DV UHFHSWRU 7KLV LV XQOLNH PDWXUH % FHOOV ZKLFK EHFRPH DFWLYDWHG E\ PXOWLYDOHQW SRO\FORQDO IRUHLJQ DQWLJHQV DQG &' 7 FHOO KHOS 6HOIUHDFWLYH LPPDWXUH % FHOOV PD\ EH UHVFXHG LQ WKH ERQH PDUURZ E\ JHQH UHDUUDQJHPHQW HYHQWV HGLWLQJ DQG GHOHWLQJ WKH VHTXHQFH HQFRGLQJ IRU DQ DXWRUHDFWLYH UHFHSWRU WR WKDW RI D GLIIHUHQW VSHFLILFLW\ WKDW LV WROHUDQW &RPDOO HW DO f % FHOOV LQ WKH SUHLPPXQH UHSHUWRLUH PD\ EH H[FOXGHG LQ WKH FRPSHWLWLRQ IRU IROOLFXODU QLFKHV LQ O\PSKRLG RUJDQV LI WKH VHOIUHDFWLYH % FHOO ELQGV VROXEOH RU ORZ DYLGLW\ DXWRDQWLJHQV 7KH\ DUH QRW VHOHFWHG WR SUROLIHUDWH DQG GLH RXW LQ WKH 7 FHOO ]RQH 6XFK H[FOXGHG % FHOOV FDQ EH UHVFXHG LI WKH\ HQOLVW 7 FHOO KHOS 7KHUH DUH PHFKDQLVPV WKDW KHOS PDWXUH % FHOOV EHFRPH WROHUDQW WR VHOIDQWLJHQV LQ WKH SHULSKHU\ % FHOOV WKDW UHFRJQL]H D VHOIDQWLJHQ DV WKH\ ZRXOG D IRUHLJQ DQWLJHQ ZRXOG HQWHU WKH 7 FHOO ]RQH RI O\PSKRLG WLVVXH +RZHYHU WKHUH ZRXOG QRW EH DSSURSULDWH DQWLJHQVSHFLILF DUPHG &' 7 FHOOV WR DFWLYDWH WKH % FHOOV 6XFK 7 FHOOV ZRXOG QRW KDYH EHHQ SUHVHQWHG WKH DSSURSULDWH DQWLJHQ IURP DQ $3& DQG ZRXOG EH DEVHQW IURP O\PSKRLG WLVVXHV WKXV WKH\ ZRXOG QRW EH DYDLODEOH WR SURYLGH VHFRQGDU\ VWLPXODWLRQ WR WKH % FHOO 7KRVH % FHOOV ZLWK VHOIDQWLJHQ ZRXOG HQG XS XQGHUJRLQJ DSRSWRVLV DOWKRXJK GHDWK FDQ EH GHOD\HG E\ H[SUHVVLRQ RI EFO $ VHFRQG PHFKDQLVP LV VHHQ LQ QDLYH % FHOOV MXVW HQWHULQJ WKH SHULSKHU\ &KURQLF H[SRVXUH WR WKH VSHFLILF VROXEOH DXWRDQWLJHQ VXFK DV VROXEOH O\VR]\PH ZLOO FDXVH WKHP WR GRZQUHJXODWH VXUIDFH ,J0 H[SUHVVLRQ DQG WKH VLJQDOLQJ SDWKZD\V RI DFWLYDWLRQ LQ RUGHU WR VXUYLYH 7KHVH EHFRPH DQHUJLF EHFDXVH WKH\ IDLO WR JHQHUDWH &'GHSHQGHQW 7FHOO KHOS 1RUPDOO\ 7 FHOOV ZRXOG LQGXFH )DV

PAGE 19

PHGLDWHG DSRSWRWLF GHOHWLRQ RI WKH DQHUJL]HG % FHOO ZKHQ WKH\ SUHVHQW DXWRDQWLJHQ +RZHYHU LQ PLFH LQ ZKLFK WKH % FHOOV FDUU\ WKH )DV PXWDWLRQ ,SU WKH % FHOOV DUH QRW HOLPLQDWHG QRU FDQ 7 FHOOV GHILFLHQW LQ WKH )DVOLJDQG JOG WULJJHU WKH DSRSWRVLV RI WKH % FHOOV 7KHVH PLFH KDYH DXWRLPPXQH DFFXPXODWLRQV RI O\PSKRLG FHOOV &RUQDOO HW DO f % FHOO WROHUDQFH FDQ EH LQGXFHG GHSHQGLQJ RQ DQWLJHQ GRVH +LJK GRVHV RI DQWLJHQ PD\ RYHUZKHOP WKH VXUIDFH LPPXQRJOREXOLQV RI % FHOOV DQG LQGXFH VSHFLILF XQUHVSRQVLYHQHVV 7KLV KHOSV PDLQWDLQ WROHUDQFH WR DEXQGDQW VHOISURWHLQV OLNH SODVPD SURWHLQV 9HU\ ORZ GRVHV RI DQWLJHQ LQ ZKLFK WKH GHQVLW\ RI SHSWLGH0+& FRPSOH[ RQ $3&V PD\ EH WRR ORZ WR EH UHFRJQL]HG WKDW LV EHORZ WKH UHFRJQLWLRQ WKUHVKROGf E\ WKH 7 FHOOV WKDW GR HQFRXQWHU WKHP 'HSHQGLQJ RQ WKH 0+& JHQRW\SH RI DQ LQGLYLGXDO VRPH UDUH SURWHLQV FRQWDLQ SHSWLGHV WKDW PD\ EH SUHVHQWHG DW OHYHOV WKDW DUH VXIILFLHQW IRU 7 FHOO UHFRJQLWLRQ EXW ZLOO QRW LQGXFH DFWLYDWLRQ RU WROHUDQFH 6XFK 7 FHOOV DUH LPPXQRORJLFDOO\ LJQRUDQW 7KH\ ZRXOG WKHQ QRW EH DEOH WR VWLPXODWH D % FHOO 7 FHOO WROHUDQFH FDQ EH GHPRQVWUDWHG LQ ERQH PDUURZ FKLPHULF DQLPDOV GXULQJ IHWDO GHYHORSPHQW VWXGLHV $EEDV HW DO f ,I DOORJHQHLF ERQH PDUURZ LV GRQDWHG EHIRUH WKH KRVW DFKLHYHV LPPXQH FRPSHWHQFH WKHQ WKH GHYHORSLQJ 7 FHOO SUHFXUVRUV ZRXOG XQGHUJR FHQWUDO WROHUDQFH WR DQWLJHQV RI ERWK KRVW DQG GRQRU RULJLQ WKXV WROHUDWLQJ VHOISHSWLGHV SUHVHQWHG E\ ERWK 0+& JHQRW\SHV ,Q VXPPDU\ FHQWUDO WROHUDQFH LV HVWDEOLVKHG E\ FORQDO VHOHFWLRQ VWUHQJWK DQG TXDOLW\ RI DQWLJHQ UHFHSWRU VLJQDOLQJ RI WKH % FHOOV DYLGLW\ RI LPPDWXUH 7 FHOO UHFHSWRUV IRU WKH 0+&SHSWLGH FRPSOH[ DQG DSRSWRVLV RI GHOHWHG FHOOV 3HULSKHUDO WROHUDQFH GHSHQGV XSRQ WKH QHHG IRU FRVWLPXODWLRQ E\ DSSURSULDWH $3&

PAGE 20

/RVV RI ,PPXQXQRORJLFDO 7ROHUDQFH :KHQ WKH LPPXQH V\VWHP LV XQDEOH WR UHPDLQ XQUHVSRQVLYH WR VHOIPROHFXOHV WROHUDQFH LV EURNHQ DQG DXWRLPPXQLW\ PD\ UHVXOW 7KHUH DUH RUJDQVSHFLILF GLVHDVHV DQG V\VWHPLF DXWRLPPXQH GLVHDVHV 7ZR K\SRWKHVHV VXJJHVW WKDW DXWRLPPXQLW\ DULVHV GXH WR GHIHFWV LQ WKH HVWDEOLVKPHQW RI FHQWUDO RU SHULSKHUDO WROHUDQFH RU D FRQYHQWLRQDO LPPXQH UHVSRQVH RFFXUV DJDLQVW VHOIDQWLJHQV WKDW XQGHU QRUPDO FLUFXPVWDQFHV GLG QRW QHHG WR HVWDEOLVK WROHUDQFH DQG WKH WROHUDQFH EHFDPH EURNHQ $V VXJJHVWHG E\ /HKPDQQ HW DO f D FLUFXPYHQWLRQ E\ WKH GLVSOD\ RI SUHYLRXVO\ FU\SWLF KRVW GHWHUPLQDQWV WR ZKLFK WKH KRVW QHYHU KDG WKH QHHG WR GHYHORS WROHUDQFH FDXVHV DXWRLPPXQH UHFRJQLWLRQ 0HFKDQLVPV RI $XWRLPPXQLW\ $XWRLPPXQLW\ PD\ GHYHORS DJDLQVW VHOIDQWLJHQ IRU D QXPEHU RI SRVVLEOH UHDVRQV $V PHQWLRQHG DERYH WKHUH PD\ EH LQFRPSOHWH GHOHWLRQV RI VHOIUHDFWLYH FORQHV GXH WR LPPXQRORJLF LJQRUDQFH 7KLV LJQRUDQFH FORQDO HVFDSHf PD\ EH GXH WR WKH GLIIHUHQFHV LQ JHQHWLF VXVFHSWLELOLW\ EDVHG RQ WKH GLIIHUHQFHV LQ DELOLW\ RI GLIIHUHQW DOOHOHV RI 0+& PROHFXOHV WR ELQG DQG SUHVHQW DXWRDQWLJHQV WR DXWRUHDFWLYH 7 FHOOV 7KXV LQ KHDOWK\ LQGLYLGXDOV WKHUH DUH SUREDEO\ DXWRDQWLERGLHV WKDW KDYH EHHQ FKDUDFWHUL]HG DV FRQVLVWLQJ RI XQPXWDWHG JHUPOLQH VHTXHQFHV ZLWK ORZ DYLGLW\ IRU DXWRDQWLJHQV DQG WKHUH DUH DQWLVHOI 7 FHOOV 6FKZDUW] f 7KH JHQHWLFV RI DXWRLPPXQH GLVHDVHV KDV EHHQ GHPRQVWUDWHG LQ PDQ\ ZD\V 7KH +/$ KDSORW\SH KDV RIWHQ VKRZQ DVVRFLDWLRQV IRU VXVFHSWLELOLW\ )RU H[DPSOH LQ GLDEHWHV SHRSOH ZKR H[SUHVV WKH 0+& FODVV ,, DOOHOHV +/$'5 RU '5 ZKLFK DUH WLJKWO\ OLQNHG WR WKH +/$'4 JHQHV WKH UHOHYDQW GLVHDVH VXVFHSWLELOLW\ JHQHVf KDYH D QRWLFHDEO\ KLJKHU

PAGE 21

IUHTXHQF\ RI GLVHDVH 7RGG 9\VH DQG 7RGG f ,Q +/$'4WKH QRUPDO $VS LV VXEVWLWXWHG E\ DQ XQFKDUJHG DPLQR DFLG UHVLGXH GHVWDELOL]LQJ WKH '4 PROHFXOH 2WKHU JHQHWLF IDFWRUV LQIOXHQFH VXVFHSWLELOLW\ ,GHQWLFDO WZLQV KDYH D KLJKHU IUHTXHQF\ RI KDYLQJ WKH VDPH DXWRLPPXQH GLVHDVH WKDQ 0+&LGHQWLFDO IUDWHUQDO WZLQV 7KH KRUPRQDO VWDWXV RI DQ LQGLYLGXDO DIIHFWV GLVHDVH VXVFHSWLELOLW\ 0DQ\ DXWRLPPXQH GLVHDVHV VKRZ D VWURQJ VH[ ELDV 'LDEHWHV LQ WKH 12' PRXVH LV PRUH VHYHUH DQG RFFXUV DW D TXLFNHU RQVHW LQ WKH IHPDOH :LFNHU HW DO f 3HDN LQFLGHQFH RI DXWRLPPXQH GLVHDVHV WKDW DUH PRUH FRPPRQ LQ IHPDOHV RFFXUV GXULQJ WKH FKLOGEHDULQJ SHULRG ,I DQWLJHQV DUH H[SUHVVHG VHOHFWLYHO\ LQ D VSHFLILF WLVVXH UDWKHU WKDQ XELTXLWRXVO\ WKURXJKRXW WKH ERG\ VXFK DQWLJHQV ZRXOG EH OHVV OLNHO\ WR KDYH LQGXFHG FORQDO GHOHWLRQ RI DXWRUHDFWLYH 7 FHOOV LQ WKH WK\PXV GXULQJ 7 FHOO RQWRJHQ\ $QWLJHQV RI SHULSKHUDO WLVVXHV HVSHFLDOO\ VHTXHVWHUHG EHKLQG DQDWRPLFDO EDUULHUV ZRXOG QRW FRPH LQ FRQWDFW ZLWK WKH GHYHORSLQJ 7 FHOO UHSHUWRLUH 7LVVXH FHOOV GR QRW H[SUHVV FRVWLPXODWRU\ PROHFXOHV +RZHYHU WLVVXH GDPDJH PD\ RFFXU DV D UHVXOW RI VXVWDLQHG GLUHFW DWWDFN RI WKH FHOOV H[SUHVVLQJ WKH VHOIDQWLJHQ IURP LPPXQHFRPSOH[ IRUPDWLRQ RU IURP ORFDO LQIODPPDWLRQ 7KHVH DQWLJHQV WKHQ EHFRPH QHZO\ DYDLODEOH DV QHRDQWLJHQV LQ WKH SHULSKHU\ DQG VXEMHFW WR LPPXQH VFUXWLQ\ E\ 7 FHOOV WKDW KDG HVFDSHG GHOHWLRQ $Q H[DPSOH LV VHHQ LQ V\VWHPLF OXSXV HU\WKHPDWRVXV 6/(f $ EURDG UDQJH RI DXWRDQWLERGLHV LV SURGXFHG DJDLQVW LQWUDFHOOXODU QXFOHRSURWHLQ FRPSRQHQWV QXFOHRVRPHV '1$ KLVWRQHV DQG ULERVRPHV ,PPXQH FRPSOH[HV FRQWLQXRXVO\ FDQ GHSRVLW RQ WKH UHQDO JOXPHUXOL MRLQWV DQG VPDOO DUWHULHV DQG VXEVHTXHQWO\ UHFUXLW PDFURSKDJHV WR WU\ WR HOLPLQDWH WKHVH LPPXQH FRPSOH[HV LQ D QHYHU HQGLQJ EDWWOH .RW]LQ 6FKZDUW] f

PAGE 22

$XWRPPXQLW\ PD\ EH WKH FLUFXPYHQWLRQ RI VHOIWROHUDQFH E\ WKH LQGXFWLRQ RI UHVSRQVHV WR FU\SWLF GHWHUPLQDQWV WR ZKLFK WKH KRVW ZDV QHYHU PDGH WROHUDQW UHYLHZHG E\ /HKPDQQ HW DO 6HUFDU] DQG 'DWWD f 7KH UHVSRQVHV DUH E\ PHPEHUV RI WKH VHOIUHDFWLYH UHSHUWRLUH WKDW KDG HYDGHG QHJDWLYH VHOHFWLRQ &KDQJHV RFFXU FDXVLQJ GHWHUPLQDQW VSUHDGLQJ DQG WKH DYDLODELOLW\ RI QHRDQWLJHQV WR LQGXFH DFWLYDWLRQ RI DXWRUHDFWLYH 7 FHOOV RXW RI QDLYH 7 FHOOV $GGLWLRQDO VHOIGHWHUPLQDQWV SUHYLRXVO\ KLGGHQ IURP UHFRJQLWLRQ QRZ SULPH RWKHU SUHYLRXVO\ QDLYH 7 FHOOV ZLWK DGGLWLRQDO VSHFLILFLWLHV ,QWUDFHOOXODU DV ZHOO DV H[WUDFHOOXODU SURWHLQV FDQ EH SUHVHQWHG RQ FODVV ,, DQG FODVV 0+& 0RUHQR HW DK 1XFKHUQ HW DK f OHDGLQJ WR D ZLGH UDQJH RI QHZO\ DYDLODEOH VHOIDQWLJHQV ,QWHUPROHFXODU VSUHDGLQJ DQWLJHQLF VSUHDG IURP RQH GHWHUPLQDQWHSLWRSH WR PDQ\ LQ WKH VDPH SURWHLQf DQG LQWHUPROHFXODU VSUHDGLQJ DQWLJHQLF VSUHDG IURP RQH SURWHLQ WR DQRWKHUf UHFUXLWV PRUH VHOIDQWLJHQV QHZO\ DYDLODEOH IRU WKH LPPXQH V\VWHP WR UHVSRQG WR (QGRJHQRXVO\ SURGXFHG DQWLJHQV KDYH EHHQ SUHVHQWHG E\ $3&V DV QHZO\ UHFRJQL]HG DXWRDQWLJHQV RQ DFWLYDWHG WK\URLG HSLWKHOLD KHSDWRF\WHV DQG SDQFUHDWLF FHOOV 'D\DQ HW DK %DPDED HW DK GH %HUDUGLQLV HW DK f ,Q 12' PLFH DXWRLPPXQLW\ VHHPV WR VWDUW DJDLQVW JOXWDPDWH GHFDUER[\ODVH *$'f DQG WKHQ E\ GHWHUPLQDQW VSUHDGLQJ PRUH DQWLJHQV VXFK DV LQVXOLQ KDYH EHFRPH WDUJHW DQWLJHQV 7LVFK DQG 0F'HYLWW f *$' LV SURGXFHG E\ WKH SDQFUHDWLF LVOHW FHOOV 5HFHQW HYLGHQFH LV WKH ILQGLQJ RI DQ DPLQR DFLG SHSWLGH VKRZLQJ D KLJK VHTXHQFH KRPRORJ\ EHWZHHQ KXPDQ *$' DQG WKH &R[VDFNLH YLUXV 3& SURWHLQ .DXIPDQ HW DK f 7KLV LV DQ H[DPSOH RI PROHFXODU PLPLFU\ DV D UHVXOW RI D PLVGLUHFWHG LPPXQH DWWDFN

PAGE 23

,Q UHVSRQVH WR DQ HQYLURQPHQWDO FKDQJH F\WRNLQHV VXFK DV 71)D DQG ,)1\ 3HVWND DQG /DQJHU f PD\ FDXVH VKLIWV LQ WKH SHSWLGHV V\QWKHVL]HG DQG R[\JHQ UDGLFDOV KDYH LQGXFHG WKH KHDW VKRFN SURWHLQ +63f UHVSRQVH +63 KDYH IDFLOLWDWHG SHSWLGH ELQGLQJ RQWR WKH 0+& 'H 1DJHO DQG 3LHUFH f DQG FDXVHG GLIIHUHQFHV LQ VHOISHSWLGHV SURGXFHG GXULQJ VWUHVV ,Q WKH ($( PRGHO RI 7 FHOOPHGLDWHG DXWRLPPXQLW\ /HKPDQQ DQG FROOHDJXHV f VKRZHG WKDW D VLQJOH GHWHUPLQDQW RI P\HOLQ EDVLF SURWHLQ 0%3f WKH SHSWLGH $FO ZDV WKH LPPXQRGRPLQDQW GHWHUPLQDQW LQ WKH SULPDU\ UHVSRQVH WR 0%3 2WKHU GHWHUPLQDQWV ZHUH FU\SWLF DOWKRXJK DYDLODEOH /DWHU LQ WKH FKURQLFDOO\ GLVHDVHG PLFH WKH IRUPHUO\ FU\SWLF KRVW SHSWLGH GHWHUPLQDQWV EHFDPH WKH LPPXQRGRPLQDQW SULPHUV RI WKH VHFRQG LPPXQL]DWLRQ 7KLV KDV GHPRQVWUDWHG GLYHUVLILFDWLRQ RI WKH 7 FHOO UHSHUWRLUH GXH WR GHWHUPLQDQW VSUHDGLQJ 3ULRU LQIHFWLRQV FDXVLQJ WLVVXH GDPDJH DQG WKH LQDELOLW\ WR FOHDU LPPXQH FRPSOH[HV KDYH EHHQ VXJJHVWHG LQ WKH LQGXFWLRQ RI DXWRLPPXQH GLVHDVH 7KHUH DUH VHYHUDO PHFKDQLVPV WKDW KDYH EHHQ SRVWXODWHG WR H[SODLQ KRZ YLUDO LQYROYHPHQW OHDGV WR DXWRLPPXQLW\ $LFKHOH HW DO 1DNDJDZD DQG +DUULVRQ %DPDED f 9LUXVHV DUH LQYROYHG LQ WKH JHQHUDWLRQ RI QHZ HSLWRSHV QHRDQWLJHQVf FDXVLQJ D ORVV RI WROHUDQFH EUHDNLQJ RI LPPXQH LJQRUDQFHf *RYHUPDQ DQG DVVRFLDWHV f GHYHORSHG D WUDQVJHQLF PRXVH WR PLPLF WKH VSRQWDQHRXV LQGXFWLRQ DQG SDWKRORJ\ RI PXOWLSOH VFOHURVLV ZKLFK H[SUHVVHG D 7&5 VSHFLILF IRU P\HOLQ EDVLF SURWHLQ 6SRQWDQHRXV ($( FRXOG QRW GHYHORS LQ D VWHULOH HQYLURQPHQW EXW LW FRXOG GHYHORS HDVLO\ LI WKH PLFH ZHUH JLYHQ SHUWXVVLV YLUXV DORQH RU HYHQ VLPSO\ KRXVHG LQ D QRQVWHULOH IDFLOLW\ *RYHUPDQ HW DO f $QWLYLUDO LPPXQH UHVSRQVHV PD\ VKLIW DQG UHFRJQL]H VKDUHG PROHFXODU

PAGE 24

FRPSRQHQWV LQ VHOIDQWLJHQV ZKLFK PD\ KDYH DOWHUHG H[SUHVVLRQ LQ LQIHFWHG WLVVXH 7KXV DQWLERGLHV WULJJHU FURVVUHDFWLYH DXWRLPPXQH UHDFWLRQV WR VKDUHG GHWHUPLQDQWV RI WKH VHOIDQWLJHQV PROHFXODU PLPLFU\f 'RXYDV DQG 6REHOPDQ f ,Q UKHXPDWRLG DUWKULWLV WKH +/$'5 SL DOOHOHV ZKLFK FRQWDLQ WKH 4.5$$ DPLQR DFLG VHTXHQFH LQ WKH &'5 UHJLRQ KDYH EHHQ DVVRFLDWHG ZLWK WKH DXWRLPPXQH FRQGLWLRQ 4.5$$ VHTXHQFHV DV H[SUHVVHG E\ (SVWHLQ%DUU YLUXV KDYH EHHQ IRXQG LQ 5$ SDWLHQWV ZLWK HQKDQFHG KXPRUDO DQG FHOOXODU UHVSRQVHV /D&DYD HW DO f 9LUXVHV KDYH GHYHORSHG PHDQV WR FLUFXPYHQW WKH KRVW $V PHQWLRQHG EHIRUH YLUXVHV PD\ DFW DV VXSHUDQWLJHQV VXFK DV WKH 0LV ORFXV IRU 7 FHOOV ZLWK FHUWDLQ 9S JHQHV RU WKH\ PD\ SURYLGH JHQHUDOL]HG LPPXQRVXSSUHVVLRQ VXFK DV GXULQJ +,9 LQIHFWLRQ 7KH UHVSLUDWRU\ V\QF\WLDO YLUXV LQGXFHV LQWHUIHURQ WR LQKLELW D SUROLIHUDWLYH UHVSRQVH E\ KXPDQ 3%0&V 3UHVWRQ HW DO f $ 7 FHOO SRO\FORQDO DFWLYDWLRQ E\ D EDFWHULDO VXSHUDQWLJHQ FRXOG OLNHZLVH RYHUFRPH WROHUDQFH DV LQ UKHXPDWRLG DUWKULWLV RU LQ ($( LQ ZKLFK 7 FHOO FORQHV H[SUHVVLQJ FHUWDLQ 93 JHQHV DOO EHFRPH DFWLYDWHG 7KH EDFWHULDO VXSHUDQWLJHQ VWDSK\ORFRFFDO HQWHURWR[LQ % 6(%f DFWLYDWHV 9S7 FHOOV WKDW HQJDJH WKH DPLQRWHUPLQDO HSLWRSH RI P\HOLQ EDVLF SURWHLQ 6(% LQGXFHV UHODSVH RI WKH SDUDO\VLV LQ PLFH WKDW DUH LQ FOLQLFDO UHPLVVLRQ DQG WULJJHUV SDUDO\VLV LQ PLFH ZLWK VXEFOLQLFDO GLVHDVH DIWHU LQLWLDO LPPXQL]DWLRQ ZLWK WKH $FO HSLWRSH RU DIWHU WUDQVIHU RI HQFHSKDOLWRJHQLF 7 FHOO OLQHV %URFNH HW DO f 7KXV LQFRPSOHWH GHOHWLRQV RI VHOIUHDFWLYH FORQHV RU DEHUUDQW VWLPXODWLRQ RU UHJXODWLRQ RI QRUPDOO\ DQHUJLF FORQHV ODWHU EHFRPH QHZO\ HOLFLWHG VHOIn UHDFWLYH FORQHV

PAGE 25

9LUXVHV FDQ SURGXFH SURWHLQV WKDW FDQ UHJXODWH RU FRXQWHUDFW WKH DQWLYLUDO UHVSRQVHV RI WKH KRVW *RRGLQJ 0DUUDFN DQG .DSSOHU f (SVWHLQ%DUU YLUXV VWLPXODWHV WKH FRQYHUVLRQ RI XQFRPPLWWHG 7 KHOSHU FHOOV LQWR 7K KHOSHU FHOOV E\ WKH SURGXFW RI WKH %&5) JHQH ZKLFK KDV VWUXFWXUDO DQG IXQFWLRQDO KRPRORJ\ WR ,/ 7KLV DOORZV (%9 WR SUHYHQW WKH LQGXFWLRQ RI 7KODFWLYDWHG LQIODPPDWRU\ UHVSRQVHV LQLWLDWHG E\ VXFK F\WRNLQHV DV ,/ WXPRU QHFURVLV IDFWRU DQG LQWHUIHURQ\ 7KH KHUSHV VLPSOH[ YLUXV LQGXFHV WKH LQIHFWHG FHOO WR H[SUHVV +69)F UHFHSWRU D KHWHURGLPHU RI JO\FRSURWHLQV ( DQG ZKLFK ELQGV WR WKH )F UHJLRQ RI WKH KRVWfV QRQLPPXQH ,J* 7KLV ELQGLQJ SUHYHQWV FRPSOHPHQWPHGLDWHG O\VLV RI LQIHFWHG FHOOV E\ EORFNLQJ DFFHVV WR WKH FHOO VXUIDFH RI DQWLYLUDO DQWLERG\ RU HIIHFWRU FHOOV %HOO HW DO f &RZSR[ YLUXV FRGHV IRU D VROXEOH JO\FRSURWHLQ WKDW KDV DPLQR DFLG KRPRORJ\ WR WKDW RI WKH ,/ UHFHSWRU 7KLV SURGXFW SUREDEO\ FRPSHWHV ZLWK FHOOERXQG ,/ UHFHSWRUV IRU VHFUHWHG ,/ LQWHUIHULQJ ZLWK WKH DFWLYDWLRQ RI ,/ F\WRNLQHPHGLDWHG LQIODPPDWRU\ UHVSRQVHV ,Q SHUVLVWHQW LQIHFWLRQV VXFK DV LQ DXWRLPPXQH KHSDWLWLV WKH LQIHFWHG WLVVXH LV GHVWUR\HG GXULQJ ORQJWHUP FKURQLF LQIODPPDWRU\ UHVSRQVHV WR WKH UHSOLFDWLQJ YLUXV LWVHOI RU LV GHVWUR\HG E\ WKH F\WRWR[LF 7 FHOO UHVSRQVH WR WKH YLUDO DQWLJHQV SUHVHQWHG RQ WKH WDUJHW WLVVXH 7KLV GHVWUXFWLRQ LQDGYHUWHQWO\ DQG FRQWLQXRXVO\ UHOHDVHV ODUJH TXDQWLWLHV RI WKH RUJDQfV VHOIDQWLJHQV HVSHFLDOO\ WKRVH QHYHU H[SRVHG H[WUDFHOOXODUO\f ZKLFK EHFRPH SUHVHQWHG E\ SURIHVVLRQDO $3&V LQ O\PSKRLG WLVVXH .R]LHO HW DO &HP\ HW DO f :RXQGV PD\ DOVR GLVUXSW WROHUDQFH E\ FDXVLQJ WKH UHOHDVH RI VHOIDQWLJHQV QRUPDOO\ SURWHFWHG

PAGE 26

(QGRJHQRXV YLUXVHV FDQ DOVR GHUHJXODWH WKH H[SUHVVLRQ RI QRUPDO JHQH SURGXFWV %\ WKHLU LQWHJUDWLRQ LQWR WKH FKURPRVRPH RI WKH KRVW WKH\ FDXVH LQWHUUXSWLRQV LQ WKH QRUPDO IXQFWLRQV RI WKH JHQHV DQG WKHLU SURWHLQ SURGXFWV (QGRJHQRXV YLUXVHV FDQ LQDFWLYDWH JHQHV E\ SUHPDWXUH WHUPLQDWLRQ RI SURWHLQ V\QWKHVLV GXH WR WKH DGGLWLRQ QXFOHRWLGHV HQFRGLQJ D VWRS FRGRQ ,QWHJUDWLRQ RI HQGRJHQRXV YLUXVHV FDQ FUHDWH PXWDWLRQV WKDW HQKDQFH WUDQVFULSWLRQ DQG PD\ WKHUHIRUH FDXVH FKURQLF SURWHLQ H[SUHVVLRQ 0RUH DERXW HQGRJHQRXV YLUXVHV ZLOO EH GLVFXVVHG LQ &KDSWHU 5HJXODWLRQ RI $XWRLPPXQH 5HVSRQVHV ,PPXQH UHJXODWLRQ FDQ HLWKHU HQFRXUDJH WKH LQLWLDWLRQ RI DXWRLPPXQLW\ RU DFW WR PDLQWDLQ WKH WROHUDQFH &\FORVSRULQ LV D SRWHQW VXSSUHVVRU RI JUDIW YHUVXV KRVW GLVHDVH *9+'f DQG DXWRLPPXQH GLVHDVHV LQFOXGLQJ WKH VXSSUHVVLRQ RI DPHODQRVLV LQ WKH 6P\WK OLQH FKLFNHQ 3DUGXH HW DO f +RZHYHU F\FORVSRULQ KDV DOVR EHHQ VKRZQ WR LQGXFH DXWRLPPXQLW\ 6RURNLQ HW DK f $GKHVLRQ PROHFXOHV DQG F\WRNLQHV FDQ DIIHFW DXWRLPPXQH SURFHVVHV ,Q WKH ($( PRGHO IRU PXOWLSOH VFOHURVLV WUDQVIRUPLQJ JURZWK IDFWRU 7*)f3 SURYLGHG SURWHFWLRQ ZKHQ WKH LQMHFWLRQ RFFXUUHG IRU WKH SHULRG RI GD\V DIWHU LPPXQL]DWLRQ ZLWK 0%3 WKHUH ZDV QR SURWHFWLRQ LI 7*)3 ZDV DGPLQLVWHUHG EHIRUH GD\V f RU DIWHU GD\V f 7*)3 LV LPPXQRVXSSUHVVLYH WR WKH 7KOSURGXFHG LQWHUIHURQ ,)1f\ LQ UHVSRQVH WR WKH SUHVHQFH RI 0%3 6DQWDQEURJLR HW DK f 7KLV 7KOPHGLDWHG DXWRLPPXQH GLVHDVH ZDV H[DPLQHG E\ 5DFNH DQG FROOHDJXHV f IRU WKH UROH RI FRVWLPXODWRU\ PROHFXOHV 7KH\ GHPRQVWUDWHG WKDW LQ YLWUR DFWLYDWLRQ RI 0%3VSHFLILF O\PSK QRGH FHOOV ZDV LQKLELWHG E\ WKH FRPELQDWLRQ RI % DQG % DFWLYDWLRQ +RZHYHU LQ DFWLYHO\

PAGE 27

LQGXFHG GLVHDVH DGPLQLVWUDWLRQ RI DQWL%O UHGXFHG GLVHDVH DQWL% H[DFHUEDWHG GLVHDVH ,Q PXULQH GLDEHWHV LQWHUFHOOXODU DGKHVLRQ PROHFXOH ,&$0f LV LQYROYHG LQ UHFUXLWLQJ O\PSKRF\WHV WR WKH SDQFUHDWLF LVOHW FHOOV &\WRNLQHV LQWHUIHURQ\ DQG WXPRU QHFURVLV IDFWRUD VHFUHWHG E\ WKH LVOHW FHOOV FRXOG LQGXFH WKH ,&$0 H[SUHVVLRQ RQ SDQFUHDWLF FHOOV DQG LPPXQRLQWHUYHQWLRQ E\ DQWL,&$0 DQG DQWL/)$ P$EV ZRXOG VLJQLILFDQWO\ SUHYHQW WKH GHYHORSPHQW RI GLDEHWHV
PAGE 28

UHG EORRG FHOOV LQ DXWRLPPXQH KHPRO\WLF DQHPLD 7KHVH ,J* RU ,J$FRDWHG FHOOV PD\ IL[ FRPSOHPHQW WR O\VH WKHVH 5%&V 7KH ELQGLQJ RI DXWRDQWLERGLHV WR FHOOV LQ WLVVXHV DOORZV IRU WKH IL[DWLRQ RI VXEO\WLF GRVHV RI WKH PHPEUDQH DWWDFN FRPSOH[ RI FRPSOHPHQW SURWHLQV WR VWLPXODWH DQ LQIODPPDWRU\ UHVSRQVH UHFUXLWLQJ LQIODPPDWRU\ SRO\PRUSKRQXFOHDU FHOOV DQG QDWXUDO NLOOHU PHGLDWHG DQWLERG\GHSHQGHQW FHOO F\WRWR[LFLW\ WR FDXVH WLVVXH GDPDJH $Q H[DPSOH RI WKLV LV VHHQ LQ +DVKLPRWRfV WK\URLGLWLV $XWRDQWLERGLHV ELQGLQJ WR D FHOO VXUIDFH UHFHSWRU FDQ FDXVH H[FHVVLYH DFWLYLW\ E\ WKH UHFHSWRU RU LQKLELW LWV VWLPXODWLRQ E\ LWV QDWXUDO OLJDQG 3DWLHQWV EHFRPH K\SHUWK\URLG LQ *UDYHfV GLVHDVH EHFDXVH DQWLERGLHV WR WK\URLG VWLPXODWLQJ KRUPRQH SUHYHQW QRUPDO IHHGEDFN WR WKH SURGXFWLRQ RI WK\URLG KRUPRQH $QWLERG\ UHVSRQVH WR VROXEOH DQWLJHQV SURGXFHV LPPXQH FRPSOH[HV WKDW DUH QRUPDOO\ FOHDUHG E\ UHG EORRG FHOOV ZKLFK KDYH FRPSOHPHQW UHFHSWRUV DQG SKDJRF\WHV ZKLFK KDYH FRPSOHPHQW DQG )F UHFHSWRUV )DLOXUH WR FOHDU LPPXQH FRPSOH[HV OHDGV WR SHUVLVWHQW SUHVHQFH DQG GHSRVLWLRQ HVSHFLDOO\ DIWHU WLVVXH LQMXU\ FRQWLQXHV WR JHQHUDWH PRUH RI WKH DQWLJHQ DV LQ VHUXP VLFNQHVV DQG FKURQLF LQIHFWLRQV VXFK DV EDFWHULDO HQGRFDUGLWLV DQG V\VWHPLF OXSXV HU\WKHPDWRVXV ,Q 6/( DQWLERGLHV DUH IRUPHG DJDLQVW XELTXLWRXVO\ IRXQG LQWUDFHOOXODU QXFOHRSURWHLQV RI DOO QXFOHDWHG FHOOV VXFK DV '1$ 51$ DQG KLVWRQHV ,PPXQH FRPSOH[HV DUH IRUPHG WKDW GHSRVLW RQ WKH ZDOOV RI VPDOO WR PHGLXP EORRG YHVVHOV HVSHFLDOO\ LQ WKH UHQDO JORPHUXOL 7KHVH FRPSOH[HV DWWUDFW FRPSOHPHQW DQG 301V FDXVLQJ PRUH WLVVXH GDPDJH DQG VWDUWLQJ WKH F\FOH DJDLQ 6/( LV FRQVLGHUHG WKHUHIRUH D V\VWHPLF UDWKHU WKDQ DQ RUJDQVSHFLILF DXWRLPPXQH GLVHDVH 0RWKHUV SDVV RQ WKHLU ,J* DQWLERGLHV WR WKH IHWXV WKURXJK WKH SODFHQWD %DELHV ERP WR PRWKHUV ZLWK ,J*PHGLDWHG DXWRLPPXQH GLVHDVHV PD\ RIWHQ VKRZ WKH V\PSWRPV

PAGE 29

VLPLODU WR WKDW RI WKH PRWKHUV WHPSRUDULO\ XQWLO WKH EDE\ VWDUWV PDQXIDFWXULQJ LWV RZQ DQWLERGLHV 7KLV GHVFULEHV RQH IRUP RI SDVVLYH DGRSWLYH WUDQVIHU RI DXWRLPPXQLW\ $XWRLPPXQH 'LVHDVHV &DXVHG E\ 7 &HOOV $XWRLPPXQH 7 FHOOV PD\ DOVR EH GLUHFWO\ LQYROYHG LQ WLVVXH GHVWUXFWLRQ RU LQ FDXVLQJ LQIODPPDWLRQ E\ DFWLYDWLQJ PDFURSKDJHV DV ZHOO DV EHLQJ QHFHVVDU\ WR PDLQWDLQ DXWRDQWLERG\ UHVSRQVHV 7KH\ UHTXLUH WKH DXWRDQWLJHQ SUHVHQWHG RQ 0+& ZLWK FRn VWLPXODWRU\ DELOLW\ IURP D SURIHVVLRQDO $3& DQG DW VXIILFLHQW TXDQWLWLHV WR LQWHUDFW LQ O\PSKRLG WLVVXH LQ RUGHU WR LQLWLDWH DQ DXWRLPPXQH UHVSRQVH ,Q LQVXOLQGHSHQGHQW GLDEHWHV PHOOLWXV WKH LQVXOLQSURGXFLQJ S FHOOV RI WKH SDQFUHDWLF LVOHWV DUH VHOHFWLYHO\ GHVWUR\HG E\ &' 7 FHOOV ZKLFK KDYH UHFHLYHG LQDSSURSULDWH DFWLYDWLRQ IURP &' 7 FHOOV WKDW ZHUH DFWLYDWHG E\ $3&V 7KH VSHFLILFLW\ RI WKH DXWRDQWLJHQ DV WKH WDUJHW RI GHVWUXFWLRQ FDQ EH VHHQ LQ SDQFUHDV WUDQVSODQWV ZKHQ HYHQ WKRXJK WKH JUDIW LV IURP DQ LGHQWLFDO WZLQ GRQRU WKH UHFLSLHQWfV 7 FHOOV GHVWUR\ WKH JUDIW 9LWLOLJR LQ +XPDQV 9LWLOLJR LV DQ DFTXLUHG PHODQLQ SLJPHQWDU\ GLVRUGHU RI WKH HSLGHUPLV DQG KDLU IROOLFOHV PDQLIHVWHG E\ H[SDQGLQJ LUUHJXODU GHSLJPHQWHG OHVLRQV RI WKH VNLQ 9LWLOLJR FDQ DSSHDU DW DQ\ VWDJH RI OLIH /H3RROH HW DO f EXW KDOI RI WKRVH DIIHFWHG GHYHORS YLWLOLJR EHIRUH WKH DJH RI 9LWLOLJR LV D FRPPRQ GLVHDVH DIIHFWLQJ b RI WKH SRSXODWLRQ LQ DOO UDFLDO JURXSV ZRUOGZLGH ,W LV RWKHUZLVH DV\PSWRPDWLF DQG PRVW SDWLHQWV UHPDLQ SK\VLFDOO\ LQ JRRG KHDOWK +RZHYHU LW GRHV SUHGLVSRVH DIIHFWHG SHUVRQV WR VXQEXUQ VNLQ GDPDJH DQG DQ IROG LQFUHDVHG ULVN RI PHODQRPD 'XQVWRQ DQG +DLGHU f 7KH RIWHQ VHYHUH FRVPHWLF GLVILJXUHPHQW KDV SV\FKRORJLFDO HIIHFWV DQG

PAGE 30

FXUUHQW WUHDWPHQW PRGDOLWLHV IRU YLWLOLJR VXFK DV SKRWRWKHUDS\ ZLWK SVRUDOHQV DQG KLJK LQWHQVLW\ 89$ LUUDGLDWLRQ 389$f DUH GLIILFXOW H[SHQVLYH DQG XVXDOO\ GLVDSSRLQWLQJ *ULPHV f 0HODQRF\WH %LRORJ\ 0HODQRF\WHV ZKLFK DUH ORFDWHG LQ WKH HSLGHUPLV RI WKH VNLQ SURGXFH WKH SLJPHQW PHODQLQ DQG UHOHDVH WKH PHODQLQ WR NHUDWLQRF\WHV 7KH ELRV\QWKHVLV RI PHODQLQV RFFXUV LQ PHODQRF\WHV DQG WKH HQ]\PH W\URVLQDVH FDWDO\]HV VHYHUDO RI WKH LQLWLDO VWHSV RI PHODQRJHQHVLV ZKLFK RFFXUV ZLWKLQ WKH PHODQRVRPH RUJDQHOOH RI WKH PHODQRF\WH 2UORZ HW DO 3URWD %HQQHWW f 7KLV LQFOXGHV WKH K\GUR[\ODWLRQ RI W\URVLQH WR GRSD WKH R[LGDWLRQ RI GRSD WR GRSDTXLQRQH DQG LQWHUPROHFXODU FLUFXODUL]DWLRQ DQG R[LGDWLRQ RI GRSDTXLQRQH WR GRSDFKURPH 'LYHUJHQW SDWKV WKHQ WDNH SODFH ,Q WKH SUHVHQFH RI PHWDOV GRSDFKURPH HYHQWXDOO\ EHFRPHV GLK\GUR[\LQGROH ZKLFK XOWLPDWHO\ XQGHUJRHV R[LGDWLYH SRO\PHUL]DWLRQ WR FUHDWH HXPHODQLQ ,Q WKH SUHVHQFH RI F\VWHLQH WKH VXOIXUFRQWDLQLQJ SKDHRPHODQLQV DQG WULFKRFKURPHV DUH SRO\PHUL]HG 7KH EODFN HXPHODQLQV DUH LQVROXEOH LQ DOO VROYHQWV DQG WKH SKDHRPHODQLQV WKH EURZQV DQG UHGV DUH DONDOLVROXEOH 7ZR RI WKH HQ]\PHV LQYROYHG LQ PHODQLQ ELRV\QWKHVLV DUH FKDUDFWHUL]HG LQ VWXGLHV XVLQJ PXWDWLRQV LQ WKH PRXVH DW WKH DOELQR ORFXV ZKLFK HQFRGHV W\URVLQDVH DQG WKH EURZQ ORFXV ZKLFK HQFRGHV W\URVLQDVH UHODWHG SURWHLQ 753f 7US KDV D b LGHQWLW\ WR W\URVLQDVH DW WKH SURWHLQ OHYHO 'XH WR WZR DPLQR DFLG VXEVWLWXWLRQV WKH KRPR]\JRXV EE PRXVH SURGXFHV EURZQ PHODQLQ ZKLFK DW SK\VLRORJLF S+ LV VROXEOH LQVWHDG RI WKH EODFN PHODQLQ SURGXFHG LQ WKH ZLOG W\SH ZKLFK LV LQVROXEOH 'XULQJ

PAGE 31

PHODQLQ V\QWKHVLV 753 DSSHDUV SUHVHQW RQO\ LQ XQPHODQL]HG VWDJH DQG VWDJH ,, PHODQRVRPHV DQG W\URVLQDVH LV SULPDULO\ IRXQG LQ ODWH VWDJH ,,, DQG ,9 PHODQRVRPHV %RWK DUH IRXQG LQ WKH *ROJL DQG WUDQV*ROJL DQG WKHQ HQWHU D /$03 SRVLWLYH D PDUNHU IRU RUJDQHOOHV RI WKH HQGRVRPDOO\VRVRPDO OLQHDJHf RUJDQHOOH WKDW LV FRQVLVWHQW ZLWK D ODWH HQGRVPH 2UORZ HW DO f 7KH PDWXUH PHODQRVRPHV WUDYHO DORQJ WKH PHODQRF\WH GHQGULWLF SURFHVVHV IURP ZKLFK WKH\ DUH WUDQVIHUUHG WR WKH NHUDWLQRF\WH IRU GHSRVLWLQJ 9LWLOLJR 3DWKRORJ\ 7KHUH DUH VHYHUDO WKHRULHV WR H[SODLQ WKH HWLRORJ\ RI YLWLOLJR LQFOXGLQJ VHOI GHVWUXFWLRQ RI WKH PHODQRF\WH WKH QHXURJHQLF WKH LPPXQH DQG WKH JHQHWLF 2UWRQQH DQG %RVH 2UWRQQH HW DO f 9LWLOLJR LV FKDUDFWHUL]HG E\ LQKHUHQW PHODQRF\WH GHIHFWV ORVV RI PHODQRF\WHV DFFRPSDQLHG E\ 7 FHOO LQILOWUDWLRQ LQ WKH DIIHFWHG WLVVXH /H 3RROH HW DO E +DUP HW DO %DGUL HW DO (UI HW DO Ef GLVWXUEDQFHV LQ SHULSKHUDO EORRG O\PSKRF\WH VXESRSXODWLRQV 0R]]DQLFD HW DO $EGHO1DVVHU HW DO (UI HW DO Df DQG WKH SUHVHQFH RI VHUXP DXWRDQWLERGLHV GLUHFWHG DJDLQVW PHODQRF\WH DQWLJHQV +DPLQJ HW DO $XVWLQ HW DO 6HDUOH HW DO f 3DUN HW DO f VXJJHVW WKDW WKH DQWLERGLHV DUH GLUHFWHG SULPDULO\ DJDLQVW D N'D DQWLJHQ %RWK DQWLERG\GHSHQGHQW FHOOXODU F\WRWR[LFLW\ $'&&f DQG FRPSOHPHQWPHGLDWHG GDPDJH KDYH EHHQ LQGXFHG WR FXOWXUHG KXPDQ PHODQRF\WHV E\ DQWLPHODQRF\WH DQWLERGLHV IURP WKH VHUD RI YLWLOLJR SDWLHQWV 1RUULV HW DO f 7KLV VXJJHVWV D SRVVLEOH UROH IRU DXWRDQWLERGLHV LQ YLWLOLJR 7ZR JURXSV KDYH GHPRQVWUDWHG WKDW WKH DQWLERGLHV LQ WKH VHUXP RI YLWLOLJR SDWLHQWV LV DJDLQVW W\URVLQDVH 0: RI N'Df DQ HQ]\PH LQYROYHG LQ WKH ELRV\QWKHVLV RI PHODQLQ E\ WKH PHODQRF\WHV )LVKPDQ HW DO 6RQJ HW DO f

PAGE 32

(Q]\PHV KDYH EHHQ NQRZQ WR EH DXWRDQWLJHQV LQ YDULRXV DXWRLPPXQH GLVHDVHV *$' LV D PDMRU DXWRDQWLJHQ LQ WKH 12' PRXVH PRGHO RI GLDEHWHV 0DFODUHQ DQG $WNLQVRQ f 7KH PHODQRF\WHV KDYH EHHQ VKRZQ LQ YLYR DQG LQ YLWUR WR KDYH LQWULQVLF DEHUUDQW PRUSKRORJ\ LQFUHDVHG W\URVLQDVH DFWLYLW\ DQG LQFUHDVHG DFLG SKRVSKDWDVH DFWLYLW\ %RLVV\ HW DO f VXJJHVWLQJ WKDW DQ XQGHUO\LQJ PHODQRF\WH GHIHFW PD\ SUHGLVSRVH WKHVH FHOOV WR DEQRUPDO DQWLJHQ SUHVHQWDWLRQ ZKLFK PD\ EH LPSRUWDQW IRU SDWKRJHQHVLV %RLVV\ HW DO f $EQRUPDO SUHVHQWDWLRQ PD\ EH SRVVLEOH FRQVLGHULQJ WKH DEQRUPDO H[SUHVVLRQ RI FODVV ,, +/$ PROHFXOHV E\ SHULOHVLRQDO PHODQRF\WHV LQ DERXW RI WKH SDWLHQWV VWXGLHG DV ZHOO DV D VL[IROG LQFUHDVH LQ H[SUHVVLRQ RI ,&$0 $O%DGUL HW DO $KQ HW DO f 7KH HQGRSODVPLF UHWLFXOXP IRXQG LQ WKH PHODQRF\WHV LV LUUHJXODUO\ GLODWHG DQG FLUFXODU UDWKHU WKDQ QDUURZ DQG HORQJDWHG IORFFXODU PDWHULDO FDQ EH IRXQG ZLWKLQ WKH FLVWHUQD %RLVV\ +DIOHU ,P HW DO f DQG PHPEUDQH ERXQG FRPSDUWPHQWV RI PHODQRVRPHV WKDW FRQWDLQ DXWRSKDJRF\WLF DFWLYLW\ SRVVLEO\ ERXQG IRU O\VRVRPDO GHVWUXFWLRQ KDYH DOVR EHHQ REVHUYHG ,P HW DO f
PAGE 33

,PPXQRKLVWRFKHPLFDO VWXGLHV KDYH VKRZQ WKH DFWXDO ORVV RI PHODQRF\WHV /H3RROH HW DO f 0HODQRF\WH ORVV LV DFFRPSDQLHG E\ HSLGHUPDO DQG GHUPDO O\PSKRF\WH LQILOWUDWLRQV LQ WKH DFWLYH OHVLRQV +DUP HW DO %DGUL HW DO f ZLWK LQFUHDVHV LQ ERWK &' DQG &' 7 FHOOV +DQQ HW DO f &HOOXODU LQILOWUDWHV KDYH ,/ DQG ,)1\ H[SUHVVHG LQGLFDWLQJ D SRVVLEOH 7KO UHFUXLWPHQW $EGHO1DVDU HW DO f 7KH $VVRFLDWLRQ RI 9LWLOLJR ZLWK 2WKHU $XWRLPPXQH 'LVHDVHV DQG WKH *HQHWLFV RI 9LWLOLJR 6XVFHSWLELOLW\ LQ +XPDQV 9LWLOLJR LV LQKHULWHG DV D SRO\JHQLF WUDLW DQG SUREDEO\ LQYROYHV PXWDWLRQV LQ DW OHDVW RU DXWRVRPDO UHFHVVLYH JHQHV /DFRXU DQG 2UWRQQH %KDWLD HW DO f 7KH ULVN RI GHYHORSLQJ YLWLOLJR DSSHDUV WR EH VWURQJO\ GHSHQGHQW RQ RQHfV NLQVKLS WR WKH SUREDQG DQG QRW GHSHQGHQW RQ JHQGHU 7KH UHODWLYH ULVNV ZKHWKHU SDUHQW VLEOLQJ RU RIIVSULQJ RI SUREDQGV VKRZ FRQVLGHUDEOH YDULDWLRQ SRLQWLQJ WR D ODFN RI LQYROYHPHQW RI D VLQJOH JHQH ZLWK FRPSOHWH SHQHWUDQFH 0DMXPGHU HW DO f +RZHYHU WKH KLJK IUHTXHQF\ RI IDPLOLDO DJJUHJDWLRQ RI WKH GLVHDVH LQ DVVRFLDWLRQ ZLWK RWKHU DXWRLPPXQHHQGRFULQH GLVHDVHV DQG WKH SUHVHQFH RI RUJDQVSHFLILF DXWRDQWLERGLHV LQ WKH ILUVW DQG VHFRQG GHJUHH UHODWLYHV RI WKH SDWLHQWV JLYHV VXSSRUW WR D JHQHWLF SUHGLVSRVLWLRQ LQ YLWLOLJR 0DQGU\ HW DO f 5HFHQW GDWD VXJJHVW WKDW KXPDQ HQGRJHQRXV YLUXVHV PD\ EH LQYROYHG LQ WKH SDWKRJHQHVLV RI D YDULHW\ RI KXPDQ DXWRLPPXQH GLVHDVHV VXFK DV GLDEHWHV V\VWHPLF OXSXV HU\WKHPDWRVXV UKHXPDWRLG DUWKULWLV SVRULDVLV DQG LQIODPPDWRU\ QHXURORJLF GLVHDVHV
PAGE 34

DORSHFLD XQLYHUVDOLV ORVV RI KDLUf 7KXV YLWLOLJRfV DVVRFLDWLRQ ZLWK RWKHU DXWRLPPXQH GLVHDVHV (OGHU HW DO 6KRQJ DQG .LP 6FKDOOUHXWHU HW DK D 1DWK f KDV FDWHJRUL]HG LW ZLWKLQ WKH $XWRLPPXQH 3RO\JODQGXODU 6\QGURPH GLVHDVHV 7KHUH LV HYLGHQFH VXJJHVWLQJ D QHXURQDO LQYROYHPHQW LQ WKH GLVHDVH LQ RUGHU WR H[SODLQ WKH VHJPHQWDO DQG V\PPHWULF GLVWULEXWLRQ RI GHSLJPHQWDWLRQ IRXQG LQ VRPH SDWLHQWV RU ZK\ WKHUH LV D ODFN RI GHSLJPHQWDWLRQ EHORZ WKH OHYHO RI VSLQDO FRUG LQMXU\ LQ D SDWLHQW ZLWK WUDQVYHUVH P\HOLWLV DQG YLWLOLJR ,Q D VWXG\ RI GHUPDO QHUYHV LQ YLWLOLJR SDWLHQWV $Of$EDGLH DQG FROOHDJXHV f FRQFOXGHG WKDW F\FOHV RI LQLWLDO HYHQWV RI YLWLOLJR PD\ FDXVH D[RQDO GDPDJH ZLWK ODWHU QHUYH UHJHQHUDWLRQ 7KH\ VXJJHVWHG WKDW WKH GHVWUXFWLYH PHFKDQLVP RI PHODQRF\WHV PD\ EH WULJJHUHG E\ WKH QHXURWUDQVPLWWHUV UHOHDVHG E\ QHUYH HQGLQJV ZKLFK DUH RI FORVH SUR[LPLW\ WR WKH PHODQRF\WHV 6WXGLHV RI QHXURSHSWLGH DQG QHXURQDO PDUNHU LPPXQRUHDFWLYLW\ LQ VNLQ ELRSVLHV VXFK DV QHXURSHSWLGH < 13
PAGE 35

+RGJNLQVRQ HW DO f DEOH WR ELQG WUDQVFULSWLRQDO FRQWURO HOHPHQWV LQ PHODQRF\WH VSHFLILF JHQHV 7KLV PL DOOHOH KDV D VLQJOH *WR$ WUDQVLWLRQ FDXVLQJ DQ $VS$VQ VXEVWLWXWLRQ LQ WKH ILUVW KHOL[ GRPDLQ 6WHLQJULPVVRQ HW DO f 7KH PLr JHQH SURGXFW RI WKH PRXVH DQG WKH 0LWI HTXLYDOHQW LQ WKH KXPDQ UHJXODWH WKH H[SUHVVLRQ RI PHODQRF\WH VSHFLILF JHQHV LQFOXGLQJ 753 DQG 753 %HUWRORWWR HW DO
PAGE 36

)LJXUH $ IHPDOH 6P\WK OLQH FKLFNHQ GLVSOD\LQJ DPHODQRVLV RI VWDJH )LJXUH $ JURXS RI 6P\WK OLQH FKLFNHQV DW YDULRXV VWDJHV RI DPHODQRVLV

PAGE 37

)LJXUH $ W\SLFDO SDLU RI SDUHQWDO %URZQ OLQH FKLFNHQV

PAGE 38

RXWFURVVHV WR YDULRXV RWKHU FKLFNHQ OLQHV DQG EDFNFURVVHV RI WKH RULJLQDO PXWDQW EDFN WR WKH %URZQ OLQH WKH GHOD\HG DPHODQRVLV '$0f OLQH ODWHU UHQDPHG WKH 6P\WK OLQH ZDV GHYHORSHG E\ VHOHFWLRQ IRU RQVHW RI DPHODQRVLV DQG VHYHULW\ 6P\WK HW DO f 6LQFH WKH ILIWK JHQHUDWLRQ WKH 6P\WK OLQH KDV FORVHO\ UHVHPEOHG WKH SDUHQWDO OLQH DQG WKUHH QRYHO 0+& % DOOHOHV DUH VHJUHJDWLQJ LQ ERWK OLQHV (UI HW DO Df 3LJPHQW DQG PHODQRF\WH ORVV LQ 6/ FKLFNHQV FDQ UDQJH IURP SDUWLDO WR FRPSOHWH DPHODQRVLV DQG DERXW b RI GHSLJPHQWHG ELUGV DUH EOLQG GXH WR PHODQRF\WH GHVWUXFWLRQ LQ WKH FKRURLG DQG UHWLQDO SLJPHQWHG HSLWKHOLXP 6P\WK f 7KH PDJQLWXGH RI DPHODQRVLV LQ DQ\ 6P\WK OLQH ELUG GHSHQGV RQ WKH WLPH IUDPH RI HDFK IHDWKHUfV GHYHORSPHQW ZKHQ PHODQLQ V\QWKHVLV DQG SLJPHQW GHSRVLWLRQ DUH GHVWUR\HG 8S WR b RI D KDWFK ZLOO H[KLELW WKH DPHODQRWLF SKHQRW\SH DV UHSRUWHG E\ 6P\WK 6P\WK f DOWKRXJK DV GHVFULEHG LQ FKDSWHU RQO\ DERXW b DUH DPHODQRWLF LQ WKH 8QLYHUVLW\ RI )ORULGD FRORQ\ 6/ FKLFNHQV DOVR KDYH DQ LQFUHDVHG LQFLGHQFH RI WK\URLGLWLVK\SRWK\URLGLVP UHVHPEOLQJ KXPDQ +DVKLPRWRfV WK\URLGLWLV DQG D GHIHDWKHULQJ GHIHFW DQDORJRXV WR KXPDQ DORSHFLD 6P\WK f 7KXV LW LV FKDUDFWHUL]HG E\ WKH VDPH IHDWXUHV DV KXPDQ YLWLOLJR LQFOXGLQJ DQ DVVRFLDWLRQ ZLWK RWKHU DXWRLPPXQH GLVHDVHV (OGHU HW DO 6FKDOOUHXWHU HW DO 6KRQJ HW DO f 6/ PHODQRF\WHV KDYH EHHQ VKRZQ LQ YLYR DQG LQ YLWUR WR KDYH LQWULQVLF DEHUUDQW PRUSKRORJ\ LQFUHDVHG W\URVLQDVH DFWLYLW\ DQG LQFUHDVHG DFLG SKRVSKDWDVH DFWLYLW\ %RLVV\ HW DO f VXJJHVWLQJ WKDW DV LQ KXPDQ YLWLOLJR %RLVV\ HW DO f DQ LQKHUHQW PHODQRF\WH GHIHFW PD\ EH LPSRUWDQW IRU SDWKRJHQHVLV

PAGE 39

0HODQRF\WH %LRORJ\ $V LQ WKH KXPDQ WKH PHODQLQ SLJPHQW LV D SURGXFW RI PHODQRVRPHV WKH PHODQRF\WH F\WRSODVPLF RUJDQHOOHV WKDW SURGXFH WKH SLJPHQW JUDQXOHV 7KH RFXODU PHODQRF\WHV DV ZHOO DV WKH FKRURLG DQG DQWHULRU VXUIDFH RI WKH LULV RI WKH H\H RULJLQDWH IURP SOHXULSRWHQW FHOOV LQ WKH HPEU\RQLF QHXUDO FUHVW 6P\WK HW DO 6P\WK f 7KH UHWLQDO SLJPHQWHG HSLWKHOLXP DQG WKH LULV DUH GHULYHG IURP WKH RSWLF FXS 7KH XQGLIIHUHQWLDWHG PHODQREODVWV FRQJUHJDWH DV GHUPDO UHVHUYRLUV LQLWLDOO\ SRSXODWLQJ RXWVLGH QHDU WKH EDVH RI WKH JURZLQJ IHDWKHU SXOS IROOLFOH )LJXUH f 0HODQREODVWV PLJUDWH WKURXJK WKH IHDWKHU SXOS WRZDUG WKH SHULSKHU\ RI WKH SXOS DQG DOLJQ QHDU WKH EDVHPHQW PHPEUDQH LQWHUIDFH RI WKH EDUEHG ULGJHV DQG WKH SXOS )LJXUH f 'HQGULWLF H[WHQVLRQV H[WHQG IURP WKH PHODQRF\WHV WR WKH EDUEXOH FHOOV ZKHUH PHODQLQ JUDQXOHV DUH GHSRVLWHG LQ D VLWXDWLRQ VLPLODU WR WKH NHUDWLQRF\WH LQ WKH KXPDQ VNLQ $IWHU WKH EDUEXOH FHOOV UHFHLYH SLJPHQW WKH PHODQRF\WHV UHWUDFW DQG GHJHQHUDWH 6P\WK )LJXUH f ,Q FKLFNHQV W\URVLQDVH ZDV WKH RQO\ NQRZQ FDWDO\VW RI PHODQRJHQHVLV 6P\WK f +RZHYHU PRUH UHFHQWO\ W\URVLQDVH UHODWHG SURWHLQ 753 EXW QRW W\URVLQDVH KDV EHHQ GHWHFWHG E\ VHUXP DXWRDQWLERGLHV RI 6P\WK OLQH FKLFNHQV $XVWLQ HW DO f 7KHUH DUH ILYH W\URVLQDVH LVR]\PHV HDFK ZLWK D PROHFXODU ZHLJKW RI DSSUR[LPDWHO\ N'D DQG DQ DGGLWLRQDO QLQH RWKHU SURWHLQV WKDW KDYH EHHQ LVRODWHG IURP FXOWXUHG FKLFNHQ PHODQRF\WHV DQG DUH DVVXPHG WR EH LQYROYHG LQ PHODQRJHQHVLV 'RSD GLK\GUR[\SKHQ\ODODQLQHf LV RQH RI WKH LQWHUPHGLDWH SURGXFWV SURGXFHG E\ W\URVLQDVH DQG FDQ EH XVHG LQ W\URVLQDVH GHWHFWLRQ :KLWH f

PAGE 40

(DUOLHVW 2UGHU RI IRUPDWLRQ RI IHDWKHU SDUWV ,VRFKURQRXV VHJPHQWV 5DFKLGLDO ULGJH 0DLQ EDUE ULGJHV -RLQHG WR UDFKLGLDO ULGJH 1RW \HW MRLQHG WR UDFKLGLDO ULGJH (SLGHUPDO FROODU 5DPRJHQLF ]RQH =RQH RI PRVW DFWLYH FHOO SUROLIHUDWLRQ +\SRUDFKLGLDO ULGJH f 6LWH RI RULJLQDO YHQWUDO ORFXV 6LWHV RI GDXJKWHU YHQWUDO ORFL )LJXUH 0RGHO RI D GHYHORSLQJ IHDWKHU VKRZLQJ WKH DUUDQJHPHQW RI EDUE ULGJHV DV EDVLODU DQG LQWHUPHGLDWH FHOOV UHDUUDQJH WKHPVHOYHV LQWR EDUEV 7KH EDUEV DUH ODLG RXW LQ D VSLUDO FRXUVH H[WUXGHG E\ WKH DGGLWLRQ RI FHOOV XSZDUG DZD\ IURP WKH HSLGHUPDO FROODU EDVHf 7KH\ JURZ D[LDOO\ DORQJ WKH VKDIW RIf DQG WDQJHQWLDOO\ SHUSHQGLFXODUO\f WKH VXP RI WKHVH YHFWRUV LV D VSLUDO 7KH EDUEV DUH FDUULHG XSZDUG E\ WKH OHQJWKHQLQJ SXOS DQG SXVKHG REOLTXHO\ RXWZDUG 7KH IHDWKHU YDQHf ZLOO DULVH IURP WKH ROGHVW RU WLS RI WKH IHDWKHU DV WKH YDQH VSUHDGV RXW UDGLDOO\ 7KH VKHDWK DQG SXOS KDYH EHHQ UHPRYHG LQ WKLV GHSLFWLRQ $GDSWHG IURP $YLDQ $QDWRP\,QWHJXPHQW /XFDV DQG 6WHWWHQKHLP 3XEOLF GRPDLQ IRU SXEOLF XVH IURP WKH $JULFXOWXUDO 5HV 6HUYLFH 86'$ UR M

PAGE 41

(SLGHUPLV RI IROOLFOH )HDWKHU VKHDWK 0HODQRF\WHV 3XOS 5DFKLV %DUE f§ 'LVWDO EDUEXOHV f§ 3UR[LPDO EDUEXOHV 5DPRJHQLF FROXPQ L PP 1)LJXUH $ FURVV VHFWLRQ RI D IHDWKHU VKDIW DQG EDUEV SHUSHQGLFXODU WR WKH SUHYLRXV ILJXUH 7KH EDUEV UDGLDWH REOLTXHO\ IURP WKH UDFKLV VKDIWf WKH PHODQRF\WHV DW WKH MXQFWLRQ RI WKH SXOS DQG EDVH RI WKH IHDWKHU IROOLFOH 0HODQRF\WHV KDYH PLJUDWHG IURP WKH GHUPLV RXWVLGH RI WKH IHDWKHU IROOLFOH LQWR WKH SXOS DQG FRQJUHJDWH DW WKH SHULSKHU\ RI WKH SXOS LQ WKH UHJLRQ RI WKH EDUE FHOOV DQG EHJLQ WR SHQHWUDWH WKH HSLGHUPLV 7KH\ PLJUDWH LQ WR WKH HSLGHUPLV WKURXJK WKH EDVHPHQW PHPEUDQH DQG OLQH XS LQ WKH EDUEV 7KH PHODQRF\WHV WKHQ H[WHQG GHQGULWH SURFHVVHV GLVWDOO\ RXWZDUGV GHSRVLWLQJ PHODQLQ LQ WKH EDUEXOH FHOOV 1RWH WKH RXWHU ]RQH RI SLJPHQWHG EDUEXOH FHOOV DQG WKH LQQHU QRW SLJPHQWHG ]RQH 0HODQRF\WHV DUH FRQWLQXDOO\ VXSSOLHG DW WKH EDVH RI WKH IHDWKHU IROOLFOH WKH\ SURYLGH SLJPHQW JUDQXOHV WR WKH VHFWLRQ RI WKH IHDWKHU DV LW GHYHORSV DQG WKHQ GHJHQHUDWH $GDSWHG IURP $YLDQ $QDWRP\,QWHJXPHQW /XFDV DQG 6WHWWHQKHLP 3XEOLF GRPDLQ IRU SXEOLF XVH IURP WKH $JULFXOWXUDO 5HV 6HUYLFH 86'$

PAGE 42

)HDWKHU VKHDWK $[LDO SODWH &HOOV RI SUR[LPDO EDUEXOFV OLJKWO\ SLJPHQWHGf %DUE VHSWXP 5DPRJHQLF FROXPQ REVFXUHG E\ PHODQRF\WHVf %DVLODU OD\HU RI HSLGHUPLV &HOOV RI GLVWDO EDUEXOFV )XOO\ SLJPHQWHG ‘\ 5HFHLYLQJ SLJPHQW 1RW \HW SLJPHQWHG 3URFHVV RI PHODQRF\WH %RGV RI PHODQRF\WH 1XFOHXV RI HSLGHUPDO FHOO RXWVLGH PHODQRF\WHf &HOOV RI SUR[LPDO EDUEXOHV OLJKWO\ SLJPHQWHGf 0HODQLQ JUDQXOHV LQ F\WRSODVP $[LDO SODWH %DUE VHSWXP 5DPRJHQLF FROXPQ 0HGXOOD 3XOS HSLWKHOLXP V2 $ % )LJXUH $f $ VLQJOH IHDWKHU EDUE ULGJH 7KH PHODQRF\WHV H[WHQG GHQGULWLF SURFHVVHV GLVWDOO\ SHUSHQGLFXODUO\f RXWZDUGV GHSRVLWLQJ PHODQLQ LQ WKH EDUEXOH FHOOV 1RWH WKH RXWHU ]RQH RI SLJPHQWHG EDUEXOH FHOOV DQG WKH LQQHU QRW SLJPHQWHG ]RQH 0HODQRF\WHV DUH FRQWLQXDOO\ VXSSOLHG DW WKH EDVH RI WKH IHDWKHU IROOLFOH WKH\ SURYLGH SLJPHQW JUDQXOHV WR WKH VHFWLRQ RI WKH IHDWKHU DV LW GHYHORSV DQG WKHQ GHJHQHUDWH %f ,Q WKLV VLQJOH EDUE WKH PHODQRF\WHV KDYH GHJUDGHG DQG GLVDSSHDUHG DIWHU WKH\ KDYH FRPSOHWHG WKHLU IXQFWLRQ $GDSWHG IURP $YLDQ $QDWRP\,QWHJXPHQW /XFDV DQG 6WHWWHQKHLP 3XEOLF GRPDLQ IRU SXEOLF XVH IURP WKH $JULFXOWXUDO 5HV 6HUYLFH 86'$

PAGE 43

$PHODQRVLV 3DWKRORJ\ LQ WKH 6P\WK &KLFNHQ $V LQ KXPDQ YLWLOLJR SDWLHQWV WKH 6P\WK OLQH FKLFNHQ PHODQRF\WH LV WKH WDUJHW RI DXWRLPPXQH GHVWUXFWLRQ EXW LQVWHDG RI WKH VNLQ DQG KDLU IROOLFOHV WKH IHDWKHUV WKH FKRURLG DQG UHWLQDO SLJPHQWHG HSLWKHOLXP DUH DIIHFWHG %RWK DXWRDQWLERGLHV DQG FHOO PHGLDWHG LPPXQLW\ PD\ EH LQYROYHG LQ WKH SDWKRJHQHVLV RI YLWLOLJR LQ WKH 6P\WK OLQH DQLPDO PRGHO 0HODQRF\WHVSHFLILF DXWR$E KDYH EHHQ GHWHFWHG ZHHNV SULRU WR GHSLJPHQWDWLRQ LQ 6/ FKLFNHQV DV REVHUYHG LQ KXPDQV DQG WKH DXWR$E KDYH EHHQ VKRZQ WR UHFRJQL]H DW OHDVW WKUHH PHODQRF\WH SURWHLQV EHWZHHQ DQG .'D ZKLFK DUH ORFDOL]HG WR WKH PHODQRF\WH F\WRSODVP DQG SODVPD PHPEUDQH $XVWLQ HW DO f %HFDXVH WKH HQ]\PH W\URVLQDVH LV LQYROYHG LQ WKH ELRV\QWKHVLV RI PHODQLQ DQG EHFDXVH HQ]\PHV DUH NQRZQ WR EH DXWRDQWLJHQV LQ RWKHU DXWRLPPXQH FRQGLWLRQV W\URVLQDVH KDV EHHQ VXJJHVWHG DV D SRVVLEOH DXWRDQWLJHQ IRU YLWLOLJR ,W ZDV UHFHQWO\ VKRZQ WKDW 7US WKH PRVW LPPXQRJHQLF RI WKH W\URVLQDVHUHODWHG SURWHLQV LV D PDMRU DXWRDQWLJHQ UHFRJQL]HG E\ VHUXP DXWR$E LQ 6/ FKLFNHQV $XVWLQ HW DO f 7KH 6P\WK /LQH FKLFNHQ GHPRQVWUDWHV D IXQFWLRQDO LPPXQH V\VWHP FDSDEOH RI SURYLGLQJ DQ DXWRLPPXQH UHVSRQVH LQ WKH LQLWLDWLRQ DQG SURJUHVVLRQ RI PHODQRF\WH GHVWUXFWLRQ ,I WKH LPPXQH V\VWHP LV H[SHULPHQWDOO\ YRLGHG RU VXSSUHVVHG WKHQ LW PLJKW EH H[SHFWHG WKDW WKH DPHODQRWLF FRQGLWLRQ PD\ EH HOLPLQDWHG RU UHGXFHG :KHQ WKH % O\PSKRF\WHV DUH HVVHQWLDOO\ HOLPLQDWHG E\ QHRQDWDO EXUVHFWRP\ WKH HIIHFW LV D GHFUHDVH LQ WKH LQFLGHQFH DQG VHYHULW\ RI DPHODQRVLV /DPRQW DQG 6P\WK f &\FORVSRULQ $ WUHDWPHQW DQG FRUWLFRVWHURLGLQGXFHG LPPXQRVXSSUHVVLRQ UHVXOW LQ D GHFUHDVHG LQFLGHQFH

PAGE 44

DQG VHYHULW\ RI DPHODQRVLV LQ WKH 6P\WK /LQH FKLFNHQ DV ORQJ DV WKH WUHDWPHQW FRQWLQXHV +RZHYHU ZKHQ WKH WKHUDS\ LV VWRSSHG WKH DPHODQRVLV ZLOO EH DV VHYHUH DV OLWWHUPDWH QRQn WUHDWPHQW FRQWUROV %R\OH HW DO 3DUGXH HW DK f ,W DSSHDUV WKDW WKH 0+& ORFXV LQIOXHQFHV WKH GLVHDVH SURJUHVVLRQ 7KUHH 0+& DOOHOHV KDYH EHHQ IRXQG VHJUHJDWLQJ ZLWKLQ 6P\WK OLQH FKLFNHQV DQG VXEOLQHV KDYH EHHQ HVWDEOLVKHG %AA %A DQM RI WKH WKUHH H[KLELWV WKH HDUOLHVW DJH RI RQVHW DQG WKH PRVW VHYHUH SKHQRW\SHV (UI HW DK Df (YLGHQFH IRU 7 FHOO LQYROYHPHQW LQ DPHODQRVLV LQ WKH 6P\WK FKLFNHQ LV OHVV H[WHQVLYH 6WXGLHV KDYH GHPRQVWUDWHG WKDW F\FORVSRULQ $ D SRWHQW LQKLELWRU RI ,/ DQG ,/ UHOHDVH WKDW QRUPDOO\ VWLPXODWH 3%0/V DQG 1. FHOOV FDQ PHDVXUDEO\ UHGXFH WKH LQFLGHQFH DQG VHYHULW\ RI DPHODQRVLV LQ 6/ FKLFNHQV 3DUGXH f 7KHUH LV DOVR KLVWRORJLFDO HYLGHQFH RI DQ LQWHQVH 7 FHOO LQYROYHPHQW LQ DPHODQRVLV RI WKH 6/ FKLFNHQ (UI HW DK Ef /\PSKRF\WLF LQILOWUDWLRQ LV FRQVLVWHQWO\ VHHQ DVVRFLDWHG DW VLWHV RI PHODQRF\WH GHVWUXFWLRQ 6P\WK f ZKLFK KDYH UHFHQWO\ EHHQ VKRZQ WR EH SULPDULO\ 7 FHOOV (UI HW DK Ef DV GHWHFWHG E\ SRO\FORQDO DQG PRQRFORQDO DQWLERGLHV DJDLQVW IXQFWLRQDOO\ LPSRUWDQW VXUIDFH 7 FHOO PROHFXOHV &RRSHU HW DK &KHQ HW DK &KHQ HW DK &KDU HW DK /DKWL HW DK f 7 FHOOV LQILOWUDWH JURZLQJ IHDWKHU SXOS DV PXFK DV ZHHNV SULRU WR YLVLEOH VLJQV RI YLWLOLJR 6LJQLILFDQWO\ JUHDWHU QXPEHUV IROGf RI 7 FHOOV RI DOO WKUHH VXESRSXODWLRQV \ GHWHFWHG E\ 7&5f 9SL DSL GHWHFWHG E\ 7&5f DQG 9SDS GHWHFWHG E\ 7&5f DUH IRXQG SUHVHQW LQ FURVV VHFWLRQV RI WKH IHDWKHU SXOS LQ 6/ DV FRPSDUHG WR %/ SULRU WR DQG WKURXJKRXW DPHODQRVLV 2I QRWH DUH WKH SURSRUWLRQV RI 7&5 FHOOV EHLQJ

PAGE 45

VLJQLILFDQWO\ KLJKHU DQG RI 7&5 FHOOV EHLQJ VLJQLILFDQWO\ ORZHU DV FRPSDUHG WR /LJKW %URZQ /HJKRUQ FRQWURO ELUGV /%/ D UHODWHG OLQH ZLWK VLPLODU SOXPDJH EXW QR LQFLGHQFH RI YLWLOLJRf (UI HW DO Ef ,QLWLDOO\ ERWK WKH 6/ DQG FRQWURO %/ KDYH D &'&' UDWLR FORVH WR 3ULRU WR DQG HDUO\ LQ WKH DPHODQRVLV &' 7 FHOOV DUH IRXQG KLVWRORJLFDOO\ LQ D FHQWUDO SHULYDVFXODU UHJLRQ ZLWKLQ WKH FRQILQHV RI WKH IHDWKHU SXOS $V WKH GLVHDVH SURJUHVVHV WKH UDWLR GHFUHDVHV WR EHORZ LQGLFDWLQJ PDLQO\ &' F\WRO\WLF FHOOVf EXW WKHQ UHERXQGV WR DERXW ODWH LQ WKH GLVHDVH LQGLFDWLQJ DQ LQFUHDVH LQ &' FHOOV SUREDEO\ WR UHFUXLW % FHOOVf 0DLQO\ &' FHOOV UHPDLQ DIWHU WKH PHODQRF\WHV KDYH EHHQ GHVWUR\HG &'&' UDWLR RI f 7KH VKLIW LQ WKH &'&' UDWLR IURP EHORZ EDFN WR LQ ODWH GLVHDVH VXJJHVWV WKH DFWLYDWLRQ RI 7 KHOSHU 7Kf FHOOV LQYROYHG LQ D KXPRUDO UHVSRQVH WR PHODQRF\WH DXWRDQWLJHQV UHOHDVHG GXULQJ WKHLU GHVWUXFWLRQ ,Q WKH ODWHU VWDJHV RI DPHODQRVLV &' FHOOV EHFRPH VFDWWHUHG WKURXJKRXW WKH SXOS DQG VXUURXQGHG PHODQRF\WHV &' 7 FHOOV DUH REVHUYHG WKURXJKRXW WKH SXOS DQG DUH PRVW DEXQGDQW QHDU WKH HSLWKHOLDO EDUE ULGJHV DQG DVVRFLDWHG ZLWK PHODQRF\WHV (UI HW DO Ef 7KLV LQGLFDWHV WKDW WKH &' 7 FHOOV KDYH SHQHWUDWHG EH\RQG WKH SXOS WR JHW WR WKH PHODQLQ FRQWDLQLQJ EDUE ULGJHV $ ZRUNLQJ K\SRWKHVLV IRU WKH SDWKRJHQHVLV RI DPHODQRVLV IRXQG LQ WKH 6P\WK OLQH FKLFNHQ LV WKDW WKHUH DUH LQKHUHQW GHIHFWV LQ WKH 6P\WK OLQH PHODQRF\WH WKDW FDXVH WKH FHOOV WR VHOIGHVWUXFW 7KHVH FHOOV PD\ VHOI GHVWUXFW RU SRVVHVV D TXDOLW\ WKDW SUHGLVSRVHV WKHP WR DEQRUPDO DQWLJHQ H[SUHVVLRQ $EQRUPDO SUHVHQWDWLRQ E\ WKH PHODQRF\WHV WKHPVHOYHV PD\ WDUJHW WKHP IRU &7/PHGLDWHG GHVWUXFWLRQ 7KLV UHOHDVHV WKH LQWHUQDO FRPSRQHQWV RI

PAGE 46

WKH FHOO DV QHR DQWLJHQV WKDW WKH LPPXQH V\VWHP UHVSRQGV WR E\ WKH SURGXFWLRQ RI DXWRDQWLERGLHV *HQHWLFV RI YLWLOLJR VXVFHSWLELOLW\ LQ 6/ FKLFNHQV 7KUHH 6/ VXEOLQHV KDYH EHHQ GHVFULEHG DQG HDFK RQH LV KRPR]\JRXV IRU D GLIIHUHQW 0+& KDSORW\SH %AO DQG %AAf EDVHG RQ VHURORJLFDO W\SLQJ (UI HW DO Df :KLOH DOO WKUHH VXEOLQHV DUH VLPLODU LQ LQFLGHQFH RI YLWLOLJR WKH 6/ VXEOLQH KDV WKH HDUOLHVW DJH RI RQVHW ZLWK PRUH VHYHUH H[SUHVVLRQ RI YLWLOLJR DQG D JUHDWHU LQFLGHQFH RI EOLQGQHVV GXH WR UHWLQDO G\VWURSK\ DV FRPSDUHG WR WKH A DQG %AA VXEOLQHV ,QWHUHVWLQJO\ WKH WKUHH 6/ VXEOLQHV DOVR H[KLELW GLIIHUHQFHV LQ WKH GLVWULEXWLRQ RI 7 FHOO VXESRSXODWLRQV LQ SHULSKHUDO EORRG DV FRPSDUHG WR WKH FRQWUROV /%/ DQG %URZQ OLQH %/ WKH SDUHQWDO OLQH IURP ZKLFK 6/ ZDV GHULYHG ZLWK D b LQFLGHQFH RI YLWLOLJRf %AO 6/ FKLFNHQV DW ZHHNV RI DJH FRQWDLQHG VLJQLILFDQWO\ IHZHU &' DQG 7&5 DS 7 FHOOV DQG VLJQLILFDQWO\ PRUH 7&5 \ 7 FHOOV LQ SHULSKHUDO EORRG O\PSKRF\WHV 3%/f RI ZHHNROG 6/ FKLFNHQV (UI HW DO Df 7KLV LQFUHDVH LQ 3%/ \ 7 FHOOV LV GHWHFWDEOH DV HDUO\ DV ZHHNV RI DJH (UI DQG 6P\WK f 6LPLODU GLIIHUHQFHV ZHUH IRXQG LQ WKH %A VXEOLQH EXW QRW LQ %AA VXEOLQH &KLFNHQ ,PPXQRORJ\ &KLFNHQ ,PPXQRJOREXOLQ JHQHV DQG % FHOO GHYHORSPHQW $QWLERGLHV RU LPPXQRJOREXOLQV ,JVf DUH WKH DQWLJHQ VSHFLILF UHFHSWRUV SURGXFHG H[FOXVLYHO\ E\ WKH % O\PSKRF\WHV 7KH\ ELQG VROXEOH DQWLJHQV SURWHLQV QXFOHLF DFLGV SRO\VDFFKDULGHV OLSLGV DQG VPDOO FKHPLFDOVf E\ UHFRJQL]LQJ FRQIRUPDWLRQDO GHWHUPLQDQWV RI WKH DQWLJHQV LQ WKHLU QDWLYH WKUHHGLPHQVLRQDO IRUP DV ZHOO DV GHWHUPLQDQWV XQPDVNHG

PAGE 47

E\ GHQDWXUDWLRQ RU SURWHRO\VLV 'XULQJ WKH GLIIHUHQW SKDVHV RI WKHLU PDWXUDWLRQ DV DQ DGXOW FHOO WKH % FHOO SURYLGHV ERWK FRJQLWLYH DQG HIIHFWRU IXQFWLRQV IRU WKH KXPRUDO LPPXQH UHVSRQVH :LWK WKHLU PHPEUDQH ,J UHFHSWRUV % FHOOV UHFRJQL]H DQG UHVSRQG WR VSHFLILF DQWLJHQV 7KURXJK WKHLU 0+& FODVV ,, WKH\ SUHVHQW SURFHVVHG $J WR 7 FHOOV )ROORZLQJ DQWLJHQLF VWLPXODWLRQ WKH\ EHFRPH HIIHFWRU FHOOV E\ UHOHDVLQJ VHUXP ,J DV SODVPD FHOOV $OO SURJHQLWRU % FHOOV GHYHORS IURP SOHXULSRWHQW VWHP FHOOV WKDW PLJUDWH IURP WKH HPEU\RQLF WKRUDFLF DRUWD WR WKH \RON VDF ZKHUH WKH ,J KHDY\ FKDLQ XQGHUJRHV 'UHDUUDQJHPHQW DQG WKHQ FRORQL]H WKH VSOHHQ \RON VDF DQG ERQH PDUURZ ,Q WKHVH RUJDQV WKH FHOOV UHDUUDQJH WKH 9+ DQG WKHQ WKH 9/ JHQHV UHVXOWLQJ LQ VXUIDFH ,J0 H[SUHVVLRQ %HWZHHQ HPEU\RQLF GD\V DQG DERXW WR RI WKHVH % FHOOV VWDUW WR DFFXPXODWH LQ WKH EXUVD 5H\QDXG HW DO f 0DPPDOLDQ % FHOOV UHO\ RQ ODUJH QXPEHUV RI JHUPOLQH ,J JHQH VHJPHQWV DQG WKH FRPELQDWRULDO GLYHUVLW\ RI ,J JHQH UHDUUDQJHPHQW WR JHQHUDWH D GLYHUVH $E UHSHUWRLUH ZKLFK RFFXUV FRQWLQXRXVO\ WKURXJKRXW OLIH LQ WKH ERQH PDUURZ ,Q FRQWUDVW FKLFNHQ ,J JHQHV XQGHUJR UHDUUDQJHPHQW RI VLQJOH IXQFWLRQDO 9+ DQG 9/ JHQH VHJPHQWV ZLWKLQ D VKRUW WLPH SHULRG GXULQJ HPEU\RJHQHVLV 7KHQ GLYHUVLW\ LV JHQHUDWHG LQ WKH UHDUUDQJHG YDULDEOH UHJLRQV E\ VRPDWLF JHQH FRQYHUVLRQ XVLQJ D SRRO RI SVHXGRJHQHV DV VHTXHQFH GRQRUV 5H\QDXG HW DO 0F&RUPDFN HW DO f *HQH FRQYHUVLRQ SURYLGHV D SURJUHVVLYH VXEVWLWXWLRQ RI WKH VHTXHQFH ZLWKLQ WKH IXQFWLRQDO 9/ RU 9+ JHQH ZLWK VHTXHQFH EORFNV GRQDWHG RU FRSLHG IURP WKH QRQIXQFWLRQDO SVHXGRJHQHV 3URJUHVVLYH RYHUODSSLQJ UHSODFHPHQW HYHQWV HIILFLHQWO\ FRUUHFWV RXW RI IUDPH MRLQWV DQG H[SDQGV WKH GLYHUVLW\ 0F&RUPDFN HW DO f $IWHU PRQWKV WKH

PAGE 48

EXUVD LQYROXWHV DQG QR QHZ % FHOO GHYHORSPHQW RFFXUV 7KH % FHOO SRSXODWLRQ LV PDLQWDLQHG E\ WKH SUROLIHUDWLRQ RI D SRVW EXUVDO SRSXODWLRQ &KLFNHQ 7 FHOO UHFHSWRU JHQHV DQG 7 FHOO GHYHORSPHQW 7 FHOOV UHFRJQL]H DQWLJHQV WKDW DUH OLQHDU SURFHVVHG IUDJPHQWV RI IRUHLJQ SURWHLQV EXW RQO\ ZKHQ SUHVHQWHG WR WKH 7 FHOO UHFHSWRUV 7&5f LQ SK\VLFDO DVVRFLDWLRQ ZLWK D VHOI 0+& PROHFXOH H[SUHVVHG RQ WKH VXUIDFHV RI V\QJHQHLF DQWLJHQ SUHVHQWLQJ FHOOV RU RQ WDUJHW FHOOV 7&5 DUH KHWHURGLPHU SODVPD PHPEUDQH SURWHLQV DQG WKH VXUIDFHV WKDW ELQG WKH SHSWLGH0+& FRPSOH[ DUH H[SUHVVHG DV XQLTXH GHWHUPLQDQWV ZKLFK GLIIHU LQ RQH FORQH IURP DQRWKHU SURYLGLQJ GLIIHUHQW DQWLJHQ0+& VSHFLILFLWLHV 7KH SDUWLFXODU 7&5 ZLOO UHFRJQL]H SHSWLGHV DVVRFLDWHG ZLWK HLWKHU FODVV 0+& RU FODVV ,, PROHFXOHV ZKLFK DUH DOVR UHFRJQL]HG E\ WKH &' RU &' FRUHFHSWRU PROHFXOHV UHVSHFWLYHO\ %RWK 7&5 D3 N'Df DQG \ N'Df UHFHSWRU PROHFXOHV DUH GLVXOILGHOLQNHG KHWHURGLPHU JO\FRSURWHLQV QRQFRYDOHQWO\ DVVRFLDWHG ZLWK D &' FRPSOH[ DV LQ PDPPDOV 6RZGHU HW DO &KHQ HW DO &KDU HW DK f 7KH\ DUH LGHQWLILHG E\ DQWL 7&5 DQWLERGLHV \ 7&5f 6RZGHU HW DK f DSL 7&5f &LKDN HW DK &KHQ HW DK f DQG DS 7&5f &KHQ HW DK &KDU HW DK f &KLFNHQ SUHFXUVRU 7 FHOOV RULJLQDWH IURP SOHXULSRWHQW VWHP FHOOV LQ WKH HPEU\RQLF WKRUDFLF DRUWD WKDW WKHQ FRORQL]H WKH VSOHHQ \RON VDF DQG ERQH PDUURZ 7K\PRF\WH SURJHQLWRUV HQWHU WKH WK\PXV LQ WKUHH ZDYHV LQWR WKH WK\PLF HSLWKHOLXP ZKLFK SURGXFHV 3 PLFURJOREXOLQ DV D FKHPRDWWUDFWDQW 'XQRQ HW DK f (DFK ZDYH RI SURJHQLWRUV ZLOO JLYH ULVH WR DOO WKUHH GLIIHUHQW IRUPV RI 7 FHOOV DOZD\V LQ WKH RUGHU RI \ 9S7D3 DQG 9SDS )LJXUH f

PAGE 49

&KLFNHQ WK\PRF\WH GHYHORSPHQW $ % & WW W WK\PRF\WH SUHFXUVRU LQIOX[ VW ZDYH QG ZDYH f§ UG ZDYH )LJXUH &KLFN WK\PRF\WH GHYHORSPHQW 7KH DUURZV GHSLFW WKH WKUHH ZDYHV WLPHSRLQWVf RI HQWU\ RI WK\PRF\WH VWHP FHOO SUHFXUVRU HQWU\ LQWR WKH HPEU\RQLF WK\PXV ZLWK ZDYH $ VWDUWLQJ DW ( % DW ( DQG & DW (O ( HPEU\RQLFf 7KHQ WKH SURGXFWLRQ RI VXEVHTXHQW WK\PRF\WHV OHDYH WKH WK\PXV DV ZDYHV DQG (DFK ZDYH RI SURGXFWLRQ ZLOO SURGXFH 7 FHOOV EHDULQJ ILUVW 7&5 UHFHSWRUV WKHQ 7&5 DQG ODVWO\ 7&5 7KH ILUVW ZDYH LV GHSLFWHG KHUH $GDSWHG IURP &RRSHU HW DO f DV

PAGE 50

&KLFNHQ \ 7 FHOOV 7&5f DSSHDU ILUVW LQ WK\PRF\WH GHYHORSPHQW DV 7&5 \ &' FHOOV 7KH\ HQWHU WKH WK\PXV DW HPEU\RQLF GD\ (f DYRLG WK\PLF HGXFDWLRQ DQG VHOHFWLRQ PLJUDWH TXLFNO\ WKURXJK WKH WK\PXV ZLWKRXW FORQDO H[SDQVLRQ UHDFK SHDN OHYHOV E\ ( DQG H[LW DIWHU GD\ ( &RRSHU HW DO 'XQRQ DQG ,PKRI f \ 7 FHOOV GR QRW H[SUHVV &' RU &' DQG DUH QRW VHOI 0+&UHVWULFWHG DV WKH\ GR QRW XQGHUJR LQWUDWK\PLF VHOHFWLRQ 5DXOHW &KHQ HW DO f ,Q WKH SHULSKHU\ WKH \ 7 FHOOV UHDFK b LQ WKH DGXOW ZLWK D YHU\ KLJK SUHGRPLQDQFH LQ WKH LQWHVWLQDO HSLWKHOLXP DQG HLWKHU DEVHQFH RU PLQRU SUHVHQFH LQ FKLFNHQ 3H\HUfV SDWFKHV DQG FHFDO WRQVLOV %XH\ HW DO f 7KH\ DUH UHVLVWDQW WR GHDWK E\ UHFHSWRU FURVV OLQNLQJ DQG DSRSWRVLV *HRUJH DQG &RRSHU f DQG DUH QRW VXEMHFW WR DUUHVW E\ F\FORVSRULQ $ %XH\ HW DO f 9SLD FHOOV LQ FRQWUDVW DUH VXVFHSWLEOH WR UHFHSWRU PRGXODWLRQ DQG DSRSWRWLF GHDWK 6PLWK HW DO f 7&5 FHOOV DUH UHODWLYHO\ GLVSHUVHG DQG UDUHO\ IRUP O\PSKRLG QRGXOHV RU DJJUHJDWHV HYHQ LQ WKH VSOHHQ RU LQWHVWLQH $ERXW WZRWKLUGV ZLOO H[SUHVV &' LQ WKH VSOHHQ DQG LQWHVWLQH &KHQ HW DO %XH\ HW DO f EXW UDUHO\ LQ WKH FLUFXODWLRQ \ 7 FHOOV ODFN *9+ SRWHQWLDO DQG WKHLU SUROLIHUDWLYH UHVSRQVH LV UHODWLYHO\ ORZ 6RZGHU HW DO f 7KH VHFRQG ZDYH RI FKLFNHQ 7 FHOOV HQWHUV WKH WK\PXV E\ (O DQG WKLV ZDYH FRQWULEXWHV SUHGRPLQDQWO\ WR WKH 9SL D3 7 FHOO VXEVHW 7KHVH GR H[SUHVV LQLWLDOO\ &' DQG &' XQGHUJR WK\PLF PDWXUDWLRQ DQG FORQDO VHOHFWLRQ DQG DUH IRXQG PRVWO\ LQ WKH VSOHQLF SHULDUHULRODU VKHDWK DQG LQWHVWLQDO ODPLQD SURSULD ZLWK D &'&' UDWLR RI 7KH ODVW ZDYH RI WK\PRF\WHV GRHV QRW HQWHU WKH WK\PXV XQWLO (O DQG FRQWULEXWHV

PAGE 51

SUHGRPLQDQWO\ WR WKH 9S D3 7 FHOO VXEVHW ZKLFK PDNHV XS D YHU\ VPDOO SHUFHQWDJH RI WKH WRWDO 7 FHOO UHSHUWRLUH GHYHORS OLNH 7&5 FHOOV DQG DUH IRXQG LQ WKH VSOHHQ EXW DUH UDUH LQ WKH LQWHVWLQH 7KH\ KDYH D UDWLR RI &'&' 7KXV WKH WKUHH SRSXODWLRQV DUH SURGXFHG VHTXHQWLDOO\ LQ DJUHHPHQW ZLWK WKHLU RQWRJHQ\ &ROWH\ HW DO f $V LQ PDPPDOV WKH FKLFNHQ 7&5 JHQHV LQ WKH FKLFNHQ DUH VWUXFWXUDOO\ RUJDQL]HG TXLWH VLPLODUO\ WR WKDW RI ,J FKDLQV DQG DUH HYROXWLRQDULO\ FRQVHUYHG DW WKH SURWHLQ OHYHO WR PDPPDOLDQ 7&5 .H\ IHDWXUHV RI FKLFNHQ 7&5 JHQH RUJDQL]DWLRQ DUH VKRZQ LQ )LJXUH 7KH D DQG \ FKDLQ YDULDEOH UHJLRQV DUH HQFRGHG E\ YDULDEOH 9f MRLQLQJ -f DQG FRQVWDQW &f JHQH VHJPHQWV DQG MRLQ WR IRUP D VHTXHQFH RI 9-& WKH 3 DQG FKDLQV DUH HQFRGHG E\ 9 DQG & JHQH VHJPHQWV ZLWK WKH RU GLYHUVLW\ VHJPHQWV EHWZHHQ 9 DQG LQ RUGHU WR IRUP D VHTXHQFH RI 9'-& 7KH FKDLQ ORFXV LV FRQWDLQHG ZLWKLQ WKH D FKDLQ ORFXV 9 DQG JHQH VHJPHQWV DUH IODQNHG E\ W\SLFDO UHFRPELQDWLRQ VLJQDO VHTXHQFHV 566f DW WKH f HQG RI 9 DQG DQG WKH f HQG RI DQG JHQH VHJPHQWV $V LQ WKH 9 UHJLRQ RI WKH ,J PROHFXOH WKHUH DUH WKUHH FRPSOHPHQWDULW\ GHWHUPLQLQJ UHJLRQV &'5f DQG IRXU IUDPHZRUN UHJLRQV )5f LQ WKH 9 RI WKH 7&5 PROHFXOH 7KHVH DUH LQYROYHG LQ IRUPLQJ D VWDEOH WKUHH GLPHQVLRQDO VXUIDFH IRU ELQGLQJ DQWLJHQ SHSWLGHV SUHVHQWHG LQ WKH PDMRU JURRYH RI WKH 0+& PROHFXOH RI DQ $3& FHOO 7KH &'5 LV WKH PRVW YDULDEOH RI WKH WKUHH &'5 GXH WR WKH KLJK OHYHO RI MXQFWLRQDO GLYHUVLW\ JHQHUDWHG GXULQJ 7&5 JHQH UHDUUDQJHPHQW 7KH FKLFNHQ 7&5\ ORFXV KDV WKUHH 9\ IDPLOLHV WKUHH -\ VHJPHQWV DQG RQH &\ VHJPHQW (LJKW WR WHQ PHPEHUV ZLWK KLJK KRPRORJ\f DUH IRXQG LQ HDFK 9\ IDPLO\ 7KH WKUHH -\ VHJPHQWV DUH PRUH FORVHO\ UHODWHG WR HDFK RWKHU WKDQ WR DQ\ LQ PDPPDOLDQ

PAGE 52

9 'S &S 9S 9S VXEJURXSV 'S -S O&S 9D9 & -D &D f§+f§'f§f§‘ ++++++++++}f§ 9D9 & PDQ\ -D &D -\ &\ 9\ VXEJURXSV -\ &\ )LJXUH 0RGHOV GHSLFWLQJ WKH 9 DQG & JHQH VHJPHQWV WKDW FRPSULVH WKH JHQRPLF RUJDQL]DWLRQ RI WKH 7 FHOO UHFHSWRUV LQ WKH FKLFNHQ 7KHUH DUH RQO\ 9S VXEJURXSV RI JHQHV RQH 'S MS DQG RQH &3 WKDW FDQ FRPELQH IURP WKH 3 FKDLQ 7KH ORFXV LV ORFDWHG ZLWKLQ WKH D FKDLQ 7KHUH DUH -D EXW RQO\ D IHZ JHW XVHG &RPSDUH WKLV WR RQO\ 7KHUH DUH 9\ VXEJURXSV ZKLFK FDQ MRLQ DQ\ RI WKH -\ &RRSHU HW DO &KHQ HW DO &KHQ HW DO &KDU HW DO /DKWL HW DO 6RZGHU HW DO f

PAGE 53

VSHFLHV 6L[ HW DO f EXW PRVW RI WKH VXEVWLWXWLRQV DUH LQ WKH VLOHQW VHFRQG DQG WKLUG SRVLWLRQ LQ WKH DPLQR DFLG FRGH 7&5 ORFXV LQFOXGHV WZR 9S IDPLOLHV RQH 'S IRXU MS DQG RQH &S JHQH VHJPHQW 7KHUH DUH DSSUR[LPDWHO\ PHPEHUV RI WKH 9SL IDPLO\ DQG WKUHH WR ILYH RI 9S JHQH VHJPHQWV :LWKLQ HDFK 9S IDPLO\ WKHUH LV OLWWOH GLIIHUHQFH KRZHYHU WKH WZR IDPLOLHV EHDU OLWWOH VLPLODULW\ 6R LW DSSHDUV WKDW FRPELQDWRULDO UHDUUDQJHPHQW DORQH SURYLGHV D VRPHZKDW OLPLWHG PHDQV RI JHQHUDWLQJ GLYHUVLW\ LQ FKLFNHQ 7 FHOO UHFHSWRUV 1R VHTXHQFH PRGLILFDWLRQV RFFXU LQ WKH JHUPOLQH JHQH VHJPHQWV IURP UHFRPELQDWLRQ DORQH ,Q D VHTXHQFH DQDO\VLV RI 7&5S &RRSHU DQG FROOHDJXHV UHDOL]HG WKDW GLYHUVLW\ ZDV JHQHUDWHG DOPRVW H[FOXVLYHO\ LQ WKH MXQFWLRQV FUHDWLQJ QRQWHPSODWHG 1 UHJLRQV (YHU\ FORQH ZDV IRXQG WR KDYH D GLVWLQFW VHTXHQFH DW WKHVH 1 MXQFWLRQV EHWZHHQ 9' DQG 'LQ WKH &'5 &RRSHU HW DO f 7KLV LV TXLWH LQ FRQWUDVW WR KXPDQV DQG PLFH ZKHUH WKHUH DUH DERXW IXQFWLRQDO 9 JHQH VHJPHQWV LQ VXEIDPLOLHV RI 9S SOXV WZR VHSDUDWH FOXVWHUV HDFK FRQVLVWLQJ RI D VLQJOH 'S JHQH VHJPHQW D MS UHJLRQ ZLWK PHPEHUV HDFKf DQG D VLQJOH &S JHQH VHJPHQW ,Q KXPDQV WKHUH DUH HLJKW 9\ JHQH VHJPHQWV ZLWK ILYH -\ VHJPHQWV DUUDQJHG LQ WZR FOXVWHUV DQG RQH &\ WR \LHOG 9SDLULQJV ,Q PLFH VHYHQ 9\ DQG IRXU -\ JHQHV DUH DUUDQJHG LQ IRXU 9-&\ FOXVWHUV $UGHQ HW DO D E -DQHZD\ DQG 7UDYHUV 5RZHQ HW DO f 7 FHOO UHSHUWRLUH DQDO\VLV 'HVSLWH WKH IDFW WKDW 7 FHOO UHSHUWRLUHV PD\ EH DV ODUJH DV VSHFLILFLWLHV LW DSSHDUV WKDW PRVW RI WKH 7 FHOO UHVSRQVHV VWXGLHG LQ DQLPDO DXWRLPPXQH GLVHDVHV KDYH GHPRQVWUDWHG UHVWULFWHG UHSHUWRLUHV RI UHVSRQVLYH FORQHV WKDW RI ROLJRFORQDO 7 FHOO

PAGE 54

UHSHUWRLUHV *ROG f $ PRUH UHILQHG REVHUYDWLRQ LV WKDW fPRVW SDWKRORJLFDO LQILOWUDWHV DUH HLWKHU ROLJRFORQDO LQ QDWXUH RU GLVSOD\ ROLJRFORQDO H[SDQVLRQV RYHU D SRO\FORQDO EDFNJURXQGf 3DQQHWLHU HW DO f 7KLV LV GHVSLWH WKH IDFW WKDW WKHUH PD\ EH D GLIIHUHQFH LQ OHQJWK LQ WKH &'5 IRXQG LQ DQ\ 9SMS UHFRPELQDWLRQ MXQFWLRQ RI DV PDQ\ DV DPLQR DFLGV )RU H[DPSOH LQ H[SHULPHQWDO DOOHUJLF HQFHSKDOLWLV 7 FHOOV UHVSRQGLQJ WR WKH PDMRU HSLWRSH RI DPLQR DFLGV RI P\HOLQ EDVLF SURWHLQ H[SUHVV 9S DVVRFLDWHG ZLWK HLWKHU 9D RU 9D $FKD2UEHD HW DO 8UEDQ HW DO f ,Q UKHXPDWRLG DUWKULWLV 3DOOLDUG HW DO f DQG +RZHOO HW DO f VXJJHVWHG WKDW D VXSHUDQWLJHQ DFWLYDWHG WKH SUHIHUUHG 7 FHOOV H[SUHVVLQJ 9S 9SL DQG 9SL 2I WKHVH DFWLYDWHG IDPLOLHV RQO\ 7 FHOOV ZLWK VSHFLILFLW\ IRU V\QRYLDO MRLQWDVVRFLDWHG DQWLJHQV ZRXOG WKHQ LQLWLDWH DXWRLPPXQH LQIODPPDWRU\ UHVSRQVH 7KHVH H[DPSOHV LOOXVWUDWH WKH OLPLWHG VXEJURXS RI DFWXDO 7 FHOOV FORQHV YDULDQWVf EHLQJ UHFUXLWHG HYHQ WKRXJK D YDVW QXPEHU DUH DYDLODEOH LQ WKH WRWDO UHSHUWRLUH ,I WKDW LV VR WKHQ SHUKDSV GLUHFW WDUJHWLQJ DQG IXQFWLRQDO GHOHWLRQ RI 7 FHOOV WKDW H[SUHVV VSHFLILF 9 JHQH SURGXFWV FDQ FRQWURO WKH DXWRLPPXQLW\ DQG VWLOO PDLQWDLQ DQ RWKHUZLVH LQWDFW LPPXQH V\VWHP 7KDW ZRXOG EH OLNH WKH HOLPLQDWLRQ RI FHUWDLQ 7 FHOOV WKDW UHVSRQG WR WKH PLQRU O\PSKRF\WH VWLPXODWLQJ DQWLJHQ 0LVf IRU PDOHQHVV LQ WKH PRXVH 6FRWW HW DO f 0RUHRYHU GXULQJ WKH FRXUVH RI DQ DXWRLPPXQH GLVHDVH HYLGHQFH LQGLFDWHV WKDW WKH H[SUHVVHG UHSHUWRLUH HYROYHV DV PRUH DQWLJHQLF GHWHUPLQDQWV SUHYLRXVO\ FU\SWLF EHFRPH DYDLODEOH DQG WKH LPPXQH UHVSRQVH VSUHDGV WR UHVSRQG WR WKHP :KDW PD\ KDSSHQ LQ WKH ($( V\VWHP LV WKDW WKH RULJLQDO $F VSHFLILF 7 FHOOV PD\ XSUHJXODWH VHOIDQWLJHQ H[SRVXUH LQ WKH &16 D XVXDOO\ SULYLOHJHG VLWHf DFWLYDWLQJ D

PAGE 55

QHZHU VHW RI 7 FHOOV WR ZKDW ZHUH XQWLO WKHQ QRQVHTXHVWHUHG FU\SWLF 0%3 GHWHUPLQDQWV /HKPDQQ HW DO f 7KH UHYHUVH VLWXDWLRQ PD\ RFFXU LQ ZKLFK WKH DXWRLPPXQH UHVSRQVH LV GLYHUVH LQLWLDOO\ EXW KRQHG YLD DGGLWLRQDO ZDYHV RI UHFUXLWPHQW ZKLFK PD\ FDXVH D FRQVROLGDWLRQ DQG VHOHFWLRQ WR SURGXFH D PRUH ROLJRFORQDO 7 FHOO UHSHUWRLUH 6R WKH FRQIOLFWLQJ UHSRUWV EHWZHHQ UHVWULFWHG RU GLYHUVH UHSHUWRLUHV PD\ MXVW UHSUHVHQW GLIIHUHQW VWDJHV LQ WKH GHYHORSPHQW RI GLVHDVH 2WKHU FKLFNHQ PRGHOV RI DXWRLPPXQLW\ 7KHUH DUH WZR RWKHU FKLFNHQ DQLPDO PRGHOV IRU DXWRLPPXQH GLVHDVHV LQ KXPDQV 7KH 2EHVH 6WUDLQ 26f FKLFNHQ OLQH LV FKDUDFWHUL]HG E\ LRGLQHLQGXFHG DXWRLPPXQH WK\URLGLWLV DQG LV UHFRJQL]HG DV D PRGHO IRU WKH RUJDQVSHFLILF GLVHDVH +DVKLPRWRfV WK\URLGLWLV 5HGXFLQJ WK\URLGDO LRGLQH E\ DQWLWK\URLG GUXJV FDQ SUHYHQW WKH WK\URLGLWLV +RZHYHU WKHUDS\ PXVW EH DGPLQLVWHUHG DW WKH HPEU\RQLF VWDJH %DJFKL HW DO f RWKHUZLVH WKH WK\URLGLWLV EHFRPHV VHYHUH E\ ZHHNV RI DJH $XWRUHDFWLYH % DQG 7 FHOOV FDQ EH VHHQ LQ WKH WK\URLG E\ ZHHNV SRVW KDWFK :LFN HW DO f )XUWKHUPRUH DGRSWLYH WUDQVIHU RI VSOHQRF\WHV IURP DIIHFWHG 26 FKLFNHQV WR WKH &RUQHOO VWUDLQ &6f D UHODWHG VWUDLQ WKDW GHYHORSV D PLOG ODWH RQVHW GLVHDVH FDXVHV WKH GHYHORSPHQW RI WK\URLGLWLV ZKHQ WKH KRVWV ZHUH VXSSOHPHQWHG ZLWK LRGLQH %URZQ HW DO f ,W KDV EHHQ UHFHQWO\ GHPRQVWUDWHG WKDW WKH 7 FHOOV H[SUHVVLQJ 9SL JHQHV DUH WKH PDLQ 7 FHOOV LQILOWUDWLQJ WKH 26 VWUDLQ WK\URLGV &LKDN HW DO f 7KH 8QLYHUVLW\ RI &DOLIRUQLD DW 'DYLV 8&'f OLQHV DQG FKLFNHQV GHYHORS D KHUHGLWDU\ VFOHURGHUPDOLNH FRQQHFWLYH WLVVXH GLVHDVH ,W GHYHORSV HDUO\ LQ OLIH DV HDUO\ DV GD\V SRVW KDWFK SUHVHQWLQJ LQLWLDOO\ DV VZHOOLQJ HU\WKHPD DQG QHFURVLV RI WKH FRPE

PAGE 56

GLJLWV DQG VNLQ +D\QHV DQG *HUVKZLQ f 6XUYLYRUV GHYHORS D VHYHUH O\PSKRF\WLF LQILOWUDWH RI WKH FRPE VNLQ GLJLWV DQG YLVFHUD 7KH\ GHYHORS DQ H[FHVVLYH EXLOGXS RI FROODJHQ UHVXOWLQJ LQ ILEURVLV RI WKH GHUPLV DQG DV YDVFXODU RFFOXVLRQV RI LQWHUQDO RUJDQV VXFK DV WKH HVRSKDJXV VPDOO LQWHVWLQH OXQJV NLGQH\V KHDUW DQG WHVWHV 7 KHOSHU DQG 7 F\WRWR[LF FHOOV DUH SUHVHQW ZLWK D &'&' UDWLR RI E\ ZHHN IRXU YDQ GHU :DWHU HW DO f 7KH LQILOWUDWHV DOVR FRQWDLQHG GLVWLQFW JURXSV RI % FHOOV DV WKH GLVHDVH SURJUHVVHG 7KHVH LQILOWUDWHV VHFUHWH ,J0 ILEUREODVWDFWLYDWLQJ F\WRNLQHV 'XQFDQ HW DO f DQWLQXFOHDU DQWLERGLHV LQFOXGLQJ DQWLERGLHV WR VV'1$f DQG DQWLF\WRSODVPLF DQWLERGLHV WKDW UHFRJQL]H DQ DYLDQVSHFLILF VHW RI DQWLJHQLF GHWHUPLQDQWV +D\QHV DQG *HUVKZLQ f $V LQ KXPDQV ILEUREODVW DFWLYDWLRQ LV VXJJHVWHG WR FRQWULEXWH WR ILEURVLV 'XQFDQ HW DO f $ GHIHFW LQ WKH 7 FHOOVn UHVSRQVH WR D SDQHO RI 7 FHOO PLWRJHQV VXFK DV FRQFDQDYDOLQ $ RU SRNHZHHG PLWRJHQ LQGLFDWHV DEQRUPDOLWLHV LQ 7 FHOO VWLPXODWLRQ DV VHHQ LQ GHFUHDVHG FDOFLXP LQIOX[ DQG SUROLIHUDWLRQ :LOVRQ HW DO f /LPLWDWLRQV LQ WKH XVH RI WKH FKLFNHQ DQLPDO PRGHO 1R DQLPDO FDQ UHSUHVHQW SHUIHFWO\ ZKDW LV IRXQG LQ D KXPDQ 6PDOO PDPPDOV KDYH EHFRPH WKH PRUH SRSXODU VWXG\ PRGHOV DQG RIWHQ WKH\ FDQ GHSLFW WKH KXPDQ SKHQRPHQRQ UHDVRQDEO\ ZHOO ,Q WKH FDVH RI YLWLOLJR WKH FKLFNHQ SUHVHQWV D FORVHU DQLPDO PRGHO GXH WR WKH VKDUHG IHDWXUHV VXJJHVWLQJ DQ DXWRLPPXQH FRPSRQHQW WR WKH GLVHDVH +RZHYHU WKH FKLFNHQ LV QRW ZHOO UHJDUGHG DV D UHOHYDQW DQLPDO PRGHO IRU PHGLFDO UHVHDUFK FHUWDLQO\ QRW DV H[WHQVLYHO\ DV WKH ODERUDWRU\ PRXVH :LWK D PXFK PRUH OLPLWHG SRRO RI LQYHVWLJDWRUV DQG H[SHULHQFH WKHUH LV QRW DQ H[WHQVLYH QHWZRUN RI VKDUHG WHFKQLFDO SURWRFROV WKDW KDYH EHHQ GHYHORSHG RU SHRSOH DZDUH RI WKH FKLFNHQ V\VWHP WR

PAGE 57

EHJLQ WURXEOH VKRRWLQJ WKLV XQWDSSHG UHVRXUFH ,W WDNHV WLPH DQG D FROOHFWLYH HIIRUW WR WU\ QHZ LGHDV LQ WKH FKLFNHQ MXVW DV LW ZDV IRU SLRQHHUV ZLWK WKH VPDOO PDPPDOV %H\RQG QRW NQRZLQJ LI D SURWRFRO PD\ ZRUN IRU D VSHFLILF VWUDLQ LV ZKHWKHU WKH SURWRFRO DOUHDG\ HVWDEOLVKHG LQ WKH PDPPDO FDQ EH DGDSWHG WR WKH FKLFNHQ DW DOO ,W WDNHV PRQWKV IRU FKLFNHQV WR EHFRPH VH[XDOO\ PDWXUH VR FUHDWLQJ FRQJHQLH FKLFNHQV ZLWK RU VR FURVVHV ZRXOG UHTXLUH VHYHUDO \HDUV 6ORZ UHSURGXFWLRQ LV D SUREOHP ZLWK DQLPDOV ODUJHU WKDQ PLFH /DUJHU DQLPDOV DUH PRUH FRVWO\ WR IHHG KRXVH DQG KDYH HQRXJK VSDFH IRU %HFDXVH WKH FKLFNHQ LV QRW XVHG H[WHQVLYHO\ UHVHDUFKHUV GR QRW DWWHPSW QHZ WHFKQRORJ\ ZLWK WKHP DQG WKH ELRWHFKQRORJ\ LQGXVWU\ GRHV QRW ILQG WKH QHHG WR GHYHORS XVHIXO WRROV 7UDQVJHQLF FKLFNHQ HPEU\RV DUH FUHDWHG ZLWK WKH DVVLVWDQFH RI LQIHFWLRQV E\ YDULDQWV RI WKH 5RXV 6DUFRPD 9LUXV +\EULGRPDV KDYH EHHQ GHYHORSHG RQO\ LQ WKH ODVW IHZ \HDUV 7KH JHQRPH RI WKH FKLFNHQ LV MXVW EHJLQQLQJ WR JHW VHULRXV DWWHQWLRQ DQG QRZ RQO\ LQ WKH SDVW \HDUV KDV OLQNDJH PDSSLQJ RI WKH JHQRPH ZLWK UHDGLO\ DYDLODEOH PLFURVDWHOOLWH PDUNHUV LV EHLQJ VWDUWHG 8QOLNH WKH PRXVH FKLFNHQV KDYH QRW EHHQ FKDUDFWHUL]HG JHQHWLFDOO\ LQWR ZHOOGHILQHG OLQHV JXDUDQWHHLQJ WKH SXULW\ RI D OLQH 7KHUH LV QR HTXLYDOHQW IRU FKLFNHQ RI D OLEUDU\ VXFK DV WKDW RI -DFNVRQ /DERUDWRULHV WKDW DOORZV D VFLHQWLVW WR EX\ D PRXVH &%/ RU WKH 1=: IRU LWV VSHFLILF JHQHWLF IHDWXUHV 7KH OLEUDU\ RI GHVFULEHG DYLDQ FHOO GLIIHUHQWLDWLRQ DQWLJHQV DQG NQRZQ DYLDQ F\WRNLQHV DQG O\PSKRNLQHV LV DOVR OHVV H[WHQVLYH WKDQ WKDW RI WKH PRXVH DQG KXPDQ 7KLV OLPLWV WKH H[WHQW RI VRPH W\SHV RI DYLDQ UHVHDUFK VXFK DV WKH F\WRNLQH SURILOH H[SUHVVHG E\ FHOOV LQ UHVSRQVH WR LQIODPPDWLRQ RI WKH WK\URLG LQ WKH 2EHVH 6WUDLQ FKLFNHQ

PAGE 58

$ FRQFOXVLRQ WKDW FDQ EH PDGH DERXW XVLQJ WKH FKLFNHQ WR VWXG\ GLVHDVHV LQ WKH KXPDQ LV WKDW LW ZLOO SUREDEO\ QRW EH DV UHDGLO\ DSSUHFLDWHG DV WKH ODERUDWRU\ PRXVH ,W LV PRUH H[SHQVLYH LQ WHUPV RI UHSURGXFWLRQ WLPH DQG FRVW WR PDLQWDLQ 2QH UHDOO\ QHHGV WR EH ERWK D SRXOWU\ DQG PHGLFDO VFLHQWLVW 7KH W\SLFDO PHGLFDO VFLHQWLVW LV QRW DZDUH RI WKH H[WHQVLYH QHWZRUN NQRZOHGJH DQG H[SHULHQFH WKDW LV QHFHVVDU\ WR VWXG\ OLYH FKLFNHQV 2Q WKH RWKHU KDQG WKH FKLFNHQ LV WKH EHVW VWXGLHG YHUWHEUDWH IRU HPEU\RJHQHVLV DQG GHYHORSPHQW 7KH HJJ SURYLGHV D PRVW FRQYHQLHQW VRXUFH RI HPEU\RV WKH VKHOO FDQ VLPSO\ EH RSHQHG WR H[SRVH WKH OLYLQJ DQLPDO ,W ZDV WKURXJK VWXG\LQJ WKH FKLFNHQ WKDW WKH FRQFHSW VHSDUDWLQJ WKH % FHOOV DV EXUVDGHULYHG ERQHPDUURZGHULYHG IRU PDPPDOVf IURP WKH 7 FHOOV DV WK\PXV GHULYHG ZDV FODULILHG 6HYHUDO PRQRFORQDO DQWLERGLHV LQFOXGLQJ WKRVH WKDW GLVWLQJXLVK VHYHUDO VXEVHWV RI 7 FHOOV DQG % FHOOV DUH DYDLODEOH DQG PDUNHWHG IRU FHOO VHSDUDWLRQV DQG LPPXQRKLVWRFKHPLVWU\ $W WKLV PRPHQW WKH 6P\WK OLQH FKLFNHQ GRHV UHSUHVHQW WKH FORVHVW PRGHO SURYLGLQJ WKH EHVW RSSRUWXQLW\ WR XQYHLO VRPH RI WKH XQNQRZQ SDWKRORJ\ RI KXPDQ YLWLOLJR 5DWLRQDOH IRU WKLV VWXG\ 9LWLOLJR LV FRQVLGHUHG DQ DXWRLPPXQH GLVHDVH 9LWLOLJR LV QRW FRQVLGHUHG OLIH WKUHDWHQLQJ VXFK DV WKH SK\VLRORJLFDO GHVWUXFWLRQ RI WKH LQVXOLQSURGXFLQJ FHOOV LQ GLDEHWHV QHYHUWKHOHVV IRU WKH b RI WKH SRSXODWLRQ ZLWK YLWLOLJR WKHUH LV D VLJQLILFDQW LQFUHDVHG ULVN RI VNLQ FDQFHU 7KH SDWLHQWfV ZHOO EHLQJ DQG VHOI HVWHHP DUH FRPSURPLVHG DQG WKHVH PD\ FDXVH GLVWUHVV EHFDXVH WKHUH LV OLWWOH WKH SDWLHQW FDQ GR WR KLGH WKH FRQGLWLRQ 7KH FXUUHQW PHDQV WR WUHDW YLWLOLJR LV WR KDYH WKH SDWLHQW XQGHUJR 389$

PAGE 59

WKHUDS\ WR DWWHPSW WR VWLPXODWH QHZ PHODQL]DWLRQ +RZHYHU WKH WUHDWPHQWV DUH KDUVK SURORQJHG DQG WKH VXFFHVV UDWH LV SRRU 2IWHQ WKH SUHVHQFH RI RQH DXWRLPPXQH FRQGLWLRQ FDQ EH IRXQG WR RFFXU DORQJ ZLWK RWKHU SUHH[LVWLQJ DXWRLPPXQH FRQGLWLRQV DQG WKLV LV WUXH IRU YLWLOLJR )RU H[DPSOH YLWLOLJR KDV EHHQ DVVRFLDWHG ZLWK $XWRLPPXQH 3RO\JODQGXODU 6\QGURPH W\SH DQG YLWLOLJR SDWLHQWV KDYH LQFUHDVHG ULVN IRU RWKHU DXWRLPPXQH GLVHDVHV $QLPDO PRGHOV KDYH SURYHQ WR EH YHU\ XVHIXO LQ VWXG\LQJ WKH SDWKRJHQHVLV RI DXWRLPPXQH GLVHDVHV ,Q WKH VWXG\ RI GLDEHWHV PHOOLWXV WKH WDUJHW RI DXWRLPPXQH GHVWUXFWLRQ LV WKH 3 LVOHW FHOOV RI WKH SDQFUHDV 7KH 12' PRXVH KDV EHHQ D YHU\ XVHIXO DQLPDO PRGHO WR VWXG\ WKH KXPDQ GLVHDVH 7KH LQVXOLWLV KDV DQ LQILOWUDWLRQ PDLQO\ RI &' 7 FHOOV EXW DOVR RI &' 7 FHOOV WR D OHVVHU GHJUHH 7KH GLVHDVH KDV EHHQ SURYHQ E\ PDQ\ ODEV WR EH DGRSWLYHO\ WUDQVIHUUHG XVLQJ 7 O\PSKRF\WHV ,PPXQRWKHUDS\ WDUJHWHG DW WKH 7 FHOO KDV EHHQ XVHG LQKLELW WKH SURJUHVVLRQ RI WKH GLVHDVH $XWRDQWLERGLHV DJDLQVW WKH LVOHW FHOOV DUH FKDUDFWHULVWLF RI GLDEHWHV 7KH\ SURFHHG DQG DUH GHWHFWDEOH EHIRUH WKH RQVHW RI WKH GLVHDVH *$' KDV EHHQ LGHQWLILHG DV D PDMRU DXWRDQWLJHQ ERWK IRUPV RI ZKLFK KDYH KRPRORJ\ ZLWK D SHSWLGH IURP &R[VDFNLH YLUXV ,VOHW FHOO DQWLJHQ ,&$f KDV PRUH UHFHQWO\ EHHQ LGHQWLILHG DV D DXWRDQWLJHQ LQ GLDEHWHV
PAGE 60

ERWK VSHFLHV H[FHSW LQ QHDUO\ b RI WKH DIIHFWHG WKDW EHFRPH EOLQG DV ZHOO 7KHUH DUH VLPLODU LQKHUHQW GHIHFWV ZLWKLQ WKH FKLFNHQ PHODQRF\WH $Q LQWHQVH O\PSKRF\WLF LQILOWUDWH ZLWK LQFUHDVHG QXPEHUV RI &' DQG &' 7 FHOOV LV DVVRFLDWHG LQ WKH FKLFNHQ $XWRDQWLERGLHV DUH GHWHFWDEOH EHIRUH WKH RQVHW RI DPHODQRVLV $ SXWDWLYH DXWRDQWLJHQ W\URVLQDVHUHODWHG SURWHLQ KDV EHHQ GHWHFWHG DQG LV UHODWHG W\URVLQDVH ZKLFK LV DQ HQ]\PH LQYROYHG LQ PHODQRJHQHVLV $XVWLQ DQG %RLVV\ f 7KXV LQ WKLV VWXG\ RI YLWLOLJR H[SHULPHQWV ZHUH GHVLJQHG WR DVN VRPH RI WKH VDPH TXHVWLRQV DV LQ RWKHU DQLPDO PRGHOV RI DXWRLPPXQLW\ $GRSWLYH WUDQVIHUV RI O\PSKRF\WHV IURP DIIHFWHG 6/ FKLFNHQV LQWR QRQDIIHFWHG %/ FKLFNHQV WHVWHG WKH K\SRWKHVLV WKDW DXWRLPPXQH O\PSKRF\WHV FDQ LQGXFH WKH GHVWUXFWLRQ RI WKH IHDWKHU PHODQRF\WHV DQG FDXVH WKH GHSLJPHQWDWLRQ /LNHZLVH WKH K\SRWKHVLV WKDW VHUD FRQWDLQLQJ DXWRDQWLERGLHV PLJKW LQGXFH GLVHDVH LI WUDQVIHUUHG WR DQ XQDIIHFWHG KRVW ZDV DOVR WHVWHG 6LQFH 7 FHOOV KDYH EHHQ VKRZQ LQ GLDEHWHV WR FDXVH WKH GLVHDVH WKH TXHVWLRQ RI ZKLFK VXEVHWV RI 7 FHOOV PLJKW EH WKH NH\ PHPEHUV LQYROYHG ZRXOG KHOS GHILQH WKH SDWKRORJ\ ,Q WKH SHULSKHUDO EORRG RI 6P\WK OLQH FKLFNHQV WKH \ 7 FHOOV LQFUHDVH LQ SURSRUWLRQ GXULQJ WKH FRXUVH RI WKH DPHODQRVLV DQG ZLWK DJH 7KHUHIRUH D UHSHUWRLUH DQDO\VLV RI WKH \ 7 FHOOV LQ WKH SHULSKHUDO EORRG ZDV H[DPLQHG 6LQFH DQLPDO PRGHOV DOORZ RQH WR PDQLSXODWH WKH JHQRW\SH RI WKH DQLPDOV WR GHWHUPLQH JHQHWLF FDXVHV RI GLVHDVHV SUHOLPLQDU\ JHQHWLF VWXGLHV RI WKH 6/ FKLFNHQV ZHUH SHUIRUPHG ,I FHUWDLQ SDWWHUQV RI LQKHULWDQFH DUH IRXQG WKDW ZRXOG FRUUHODWH ZLWK WKH SUHVHQFH DEVHQFH RQVHW RU VHYHULW\ RI WKH GLVHDVH WKHQ WKLV ZRXOG KHOS LQ WKH XQGHUVWDQGLQJ DQG SUHGLFWDELOLW\ RI WKH GLVHDVH (QGRJHQRXV YLUXVHV DUH JHQHV WKDW

PAGE 61

HQFRGH FRPSRQHQWV RI UHWURYLUXVHV WKDW KDYH EHFRPH LQWHJUDWHG LQ WKH JHQRPHV RI DOO VSHFLHV RI YHUWHEUDWH DQLPDOV 7KH\ DUH VWDEOH DQG LQKHULWHG LQ 0HQGHOLDQ IDVKLRQ 7KH UDQGRP LQWHJUDWLRQV SURYLGH XQLTXH JHQHWLF PDUNHUV WKDW FDQ EH XVHG WR IROORZ LQKHULWDQFH DQG H[DPLQH IRU FRUUHODWLRQV ZLWK SKHQRW\SH ,W LV D JRDO RI XVLQJ DQLPDO PRGHOV WR SURYLGH D PHDQV WR JDLQ XQGHUVWDQGLQJ RI D KXPDQ GLVHDVH 7KLV VWXG\ RI WKH DPHODQRVLV LQ WKH 6P\WK OLQH FKLFNHQ LV EHLQJ SXUVXHG WR XQGHUVWDQG YLWLOLJR LQ KXPDQV

PAGE 62

&+$37(5 $'237,9( 75$16)(5 2) $0(/$126,6 ,1 7+( 60<7+ /,1( &+,&.(1 ,QWURGXFWLRQ 7KLV DLP LV GHVLJQHG WR GHWHUPLQH WKH UROH DQG FODULI\ WKH FRQWULEXWLRQ RI KXPRUDO DQG FHOOXODU LPPXQLW\ LQ WKH SDWKRJHQHVLV RI DPHODQRVLV LQ WKH 6P\WK OLQH FKLFNHQ ,Q RUGHU WR VWXG\ DQG FKDUDFWHUL]H WKH LPPXQH UHVSRQVH LW LV RIWHQ DQ DGYDQWDJH WR VWXG\ WKH LQWDFW RUJDQLVP 7R PDNH WKH VWXG\ PDQDJHDEOH H[SHULPHQWDO DQLPDOV KDYH EHHQ PDQLSXODWHG E\ YDULRXV PHDQV WR KHOS VWXG\ LPPXQH IXQFWLRQV 7KH ODERUDWRU\ PRXVH IRU H[DPSOH KDV EHHQ LQEUHG VR WKDW WKH LPPXQH UHVSRQVHV EDVHG RQ WKH 0+& KDSORW\SH KDYH EHHQ FKDUDFWHUL]HG DQG GRFXPHQWHG WR PLQLPL]H fPDVNLQJf RI WKH HIIHFW RI D ORFXV RU JHQHWLF UHJLRQ D ODUJH FROOHFWLRQ RI 0+&VSHFLILF VWUDLQV LV DYDLODEOH WKURXJK -DFNVRQ /DERUDWRULHV 7KLV DOORZV UHVHDUFKHUV WR FKRRVH PRXVH VWUDLQV WR FRQGXFW LQYHVWLJDWLRQV DQG PDNH YDULDQWV VXFK DV WKH 12' PRXVH 7KH YDULDQWV KDYH EHHQ GHYHORSHG WKURXJK DOWHULQJ WKH JHQRPH HLWKHU E\ LQVHUWLQJ QHZ JHQHV WR FUHDWH WUDQVJHQLF DQLPDOV RU E\ WDUJHWHG GLVUXSWLRQ RI JHQHV E\ JHQH NQRFNRXW WKURXJK PHDQV RI KRPRORJRXV UHFRPELQDWLRQ $GRSWLYH WUDQVIHU RI FHOOV RU DQWLERGLHV LV D FODVVLFDO H[SHULPHQWDO DSSURDFK WR GHPRQVWUDWH LPPXQH IXQFWLRQ 7KH WUDQVIHU RI VHUXP WKH IOXLG SKDVH RI EORRG FRQWDLQLQJ VSHFLILF DQWLERGLHV DJDLQVW DQ LPPXQL]LQJ DQWLJHQf IURP DQ LPPXQL]HG LQGLYLGXDO GRQRUf LQWR D QDLYH LQGLYLGXDO KRVW RU UHFLSLHQWf FDQ FRQIHU LPPXQLW\ LI DQWLERGLHV

PAGE 63

PHGLDWH WKDW FRQGLWLRQ 7KLV LV SDVVLYH LPPXQL]DWLRQ GHSHQGHQW XSRQ WKH DQWLERGLHV JHQHUDWHG RULJLQDOO\ E\ WKH GRQRU E\ DFWLYH LPPXQL]DWLRQ RU LQIHFWLRQ $GRSWLYH WUDQVIHU RI O\PSKRLG FHOOV IURP WKH LPPXQH GRQRU FDQ SURYLGH FHOOPHGLDWHG LPPXQLW\ LQ D KRVW 7UDQVIHU RI FHOOV PXVW EH GRQH EHWZHHQ GRQRUV DQG UHFLSLHQWV JHQHWLFDOO\ PDWFKHG DW WKH PDMRU KLVWRFRPSDWLELOLW\ FRPSOH[ 0+&f ORFL VR WKDW WKH GRQRU FHOOV DUH QRW UHMHFWHG E\ WKH UHFLSLHQW DQG GR QRW DWWDFN WKH UHFLSLHQWfV WLVVXHV JUDIW YHUVXV KRVW GLVHDVHf ,QFRPSDWLELOLW\ PD\ DOVR RFFXU GHVSLWH WKH GRQRU DQG KRVW EHLQJ LGHQWLFDO DW WKH 0+& ORFXV GXH WR GLIIHUHQFHV LQ WKH PLQRU KLVWRFRPSDWLELOLW\ DQWLJHQV 6FRWW HW DO f VXFK DV WKH PDOH VSHFLILF +< DQWLJHQ ,PPXQRVXSSUHVVLRQ RI WKH KRVW DQLPDO LV RIWHQ XWLOL]HG WR IDFLOLWDWH DGRSWLYH WUDQVIHU VWXGLHV EHFDXVH V\QJHQHLF PDWFKHV LQ WKH 0+& DUH UDUH LQ RXWEUHG SRSXODWLRQV 7KLV SUHWUHDWPHQW DOVR SURYLGHV D YRLG LQ WKH LPPXQH IXQFWLRQ LQ WKH UHFLSLHQW KRVW SURYLGLQJ VSDFH IRU WKH UHVWRUDWLRQ RI LPPXQH IXQFWLRQ E\ WKH DGRSWLYHO\ WUDQVIHUUHG FHOOV 7RLYDQHQ HW DO f 7KLV DOORZV WKH HIIHFW RI WKH WUDQVIHUUHG GRQRU FHOOV WR EH VWXGLHG LQ WKH DEVHQFH RI KRVW O\PSKRLG FHOOV 2QH PHWKRG RI LPPXQRVXSSUHVVLRQ LV E\ WKH XVH RI LRQL]LQJ UDGLDWLRQ IURP ;UD\V RU \UD\V WR NLOO RII UDSLGO\ GLYLGLQJ O\PSKRLG FHOOV DW GRVHV WKDW VSDUH WKH RWKHU WLVVXHV RI WKH ERG\ 2WKHU PHDQV RI FHOO GHSOHWLRQ LQFOXGH QHRQDWDO WK\PHFWRP\ F\FORSKRVSKDPLGH ZKLFK DFWV SULPDULO\ E\ HOLPLQDWLQJ % FHOOV DQG VXSSUHVVRU 7 FHOOVf 7RLYDQHQ HW DO +DUDGD DQG 0DNLQR f VSOHQHFWRP\ DQG DQWLO\PSKRF\WH DQWLERGLHV JHQHUDWHG LQ DQRWKHU VSHFLHV RI DQLPDOV $GRSWLYH WUDQVIHU VWXGLHV KDYH EHHQ SHUIRUPHG WR VWXG\ WKH IXQFWLRQV RI FKLFNHQ O\PSKRF\WH VXEVHWV 7RLYDQHQ HW DO f FRPSDUHG WKH WUDQVSODQWDWLRQ RI O\PSKRLG

PAGE 64

FHOOV EXUVD VSOHHQ RU ERQH PDUURZf LQWR ZHHN ROG LPPXQRGHILFLHQW FKLFNV 8VLQJ GRQDWHG EXUVDO FHOOV RI GD\ ROG ZHHN ROG RU ZHHN ROG GRQRUV DQG SUHWUHDWPHQW ZLWK F\FORSKRVSKDPLGH &\f HYHQ ODUJH QXPEHUV RI GRQDWHG EXUVDO FHOOV ZRXOG QRW EULQJ DERXW D ORQJ WHUP UHVWRUDWLRQ RI DQWLERG\ IRUPDWLRQ 3UHWUHDWPHQW E\ ;LUUDGLDWLRQ UDGVf RQ WKH GD\ EHIRUH WUDQVSODQWDWLRQ ZLWK ZHHN ROG GRQDWHG FHOOV IURP VSOHHQ DV ZHOO DV PDUURZ WK\PXV RU EXUVDf DOORZHG KLJKHU VXUYLYDO UDWHV DQG ERG\ ZHLJKW JDLQV VXJJHVWLQJ WKDW UHVWRUDWLRQ RI 7 FHOO IXQFWLRQV EXW QRW % FHOO IXQFWLRQV ZDV DFKLHYHG 7RLYDQHQ DQG FROOHDJXHV FRQFOXGHG IURP WKHVH VWXGLHV WKDW 7 FHOO IXQFWLRQ LV PRUH FUXFLDO WR VXUYLYDO WKDQ LV KXPRUDO LPPXQLW\ $ GRVH RI UDGV IRU ZHHN ROG FKLFNHQV ZDV VKRZQ WR EH HIIHFWLYH LQ DOORZLQJ UHFRQVWLWXWLRQ RI WKH 7 FHOO FRPSDUWPHQW EXW RQO\ VKRUW WHUP UHFRQVWLWXWLRQ RI % FHOOV /HKWRQHQ DQG FRZRUNHUV f GHWHUPLQHG WKDW &\ WUHDWPHQW GHVWUR\V SUROLIHUDWLQJ % FHOOV LQ WKH EXUVD DQG DOORZV GRQRU % FHOO UHFRQVWLWXWLRQ LQ GD\ ROG KRVWV IRU DW OHDVW ZHHNV LI GD\ ROG GRQRU EXUVD FHOOV ZHUH XVHG ,UUDGLDWHG ZLWK UDGV GD\ ROG KRVWV FRXOG DJDLQ EH UHFRQVWLWXWHG ZLWK 7 FHOOV EXW QRW ZLWK % FHOOV 7KH % FHOO FRPSDUWPHQW ZDV QRW UHVWRUHG %DVHG PDLQO\ RQ WKHVH UHSRUWV RXU H[SHULPHQWV XWLOL]HG LUUDGLDWLRQ WUHDWPHQW IRU WKH DGRSWLYH FHOO WUDQVIHU RI O\PSKRF\WHV IURP DPHODQRWLF 6/ FKLFNHQV LQWR %/ KRVWV LQ RUGHU WR GHWHUPLQH ZKHWKHU WKH DXWRLPPXQH GLVHDVH FRXOG EH WUDQVIHUUHG E\ O\PSKRF\WHV 7KH WUDQVIHU RI DXWRLPPXQH GLVHDVH WR KRVW DQLPDOV KDV EHHQ SUHYLRXVO\ GHPRQVWUDWHG E\ WKH DGRSWLYH WUDQVIHU RI O\PSKRF\WHV LQ RWKHU DQLPDO PRGHOV RI DXWRLPPXQLW\ ([SHULPHQWDO DOOHUJLF HQFHSKDORP\HOLWLV ($(f LV D GLVHDVH SURGXFHG E\ LQMHFWLQJ DQLPDOV ZLWK KRPRJHQL]HG VSLQDO FRUG P\HOLQ EDVLF SURWHLQ 0%3f DQG LW

PAGE 65

UHVHPEOHV WKH GHP\HOLQDWLQJ GLVHDVH VLPLODU WR PXOWLSOH VFOHURVLV ,W KDV EHHQ WUDQVIHUUHG XVLQJ 0%3UHDFWLYH 7 FHOOV IURP WKH VSOHHQ RU O\PSK QRGH FHOOV IURP D 0%3LPPXQL]HG GRQRU WR QDLYH V\QJHQHLF KRVWV LQ PLFH DQG UDWV 3DQLWFK DQG 0F)DUOLQ YDQ GHU 9HHQ HW DO f ,Q ($( LW DSSHDUV WKDW &' 7 FHOOV H[SUHVVLQJ D UHVWULFWHG OLPLWHG 7&5 UHSHUWRLUH DUH UHVSRQVLEOH ,Q KXPDQV KRZHYHU WKH 7&5 UHSHUWRLUH PD\ EH PRUH GLYHUVH ZLWK JUHDWHU KHWHURJHQHLW\ RI 0%3VSHFLILF 7 FHOOV DVVRFLDWHG ZLWK D JUHDWHU VHYHULW\ RI GLVHDVH 5LFKHUW HW DO 8W] DQG 0F)DUODQG 8W] HW DO f 6\VWHPLF OXSXV HU\WKHPDWRVXV ZDV WUDQVIHUUHG WR 6&,' PLFH ZKHQ KXPDQ 3%0& ZHUH LQMHFWHG LQWR 6&,' PLFH DQG WKH 6&,' VHUXP ZDV VKRZQ WR FDUU\ WKH KXPDQ DXWRDQWLERGLHV IRU XS WR ZHHNV $VKDQ\ HW DO f ,Q WKH QRQREHVH GLDEHWLF 12'f PRXVH D PRGHO IRU KXPDQ LQVXOLQGHSHQGHQW GLDEHWHV PHOOLWXV VHYHUDO ODERUDWRULHV KDYH GHPRQVWUDWHG WKH WUDQVIHU RI LQVXOLWLV DQG GLDEHWHV LQWR LUUDGLDWHG KRVWV 1RUPDOO\ VLJQV RI LQLWLDO LQVXOLWLV EHJLQ WR DSSHDU E\ WKH VL[WK ZHHN %\ ZHHNV RI DJH VSRQWDQHRXV GLDEHWHV GHYHORSV LQ DERXW b RI WKH PLFH ZLWK D PRQRQXFOHDU FHOOXODU LQILOWUDWH ZLWKLQ WKH SDQFUHDWLF LVOHWV :LFNHU HW DO f :LFNHU DQG FRZRUNHUV LQGXFHG GLDEHWHV ZLWKLQ ZHHNV LQ JUHDWHU WKDQ b RI WKH KRVWV ZKHQ WKH KRVWV ZHUH ROGHU WKDQ VL[ ZHHNV RI DJH DQG E\ XVLQJ XQIUDFWLRQDWHG VSOHQRF\WHV IURP RYHUWO\ GLDEHWLF 12' GRQRU PLFH ROGHU WKDQ ZHHNV ROG :LFNHU HW DO f 7KH\ UHILQHG WKHVH VWXGLHV IXUWKHU E\ DFKLHYLQJ VXFFHVVIXO DGRSWLYH WUDQVIHUV XVLQJ VSOHQLF 7 FHOOV XVLQJ WKH &' RU &' 7 FHOO VXEVHWV 0LOOHU HW DO f 0HDQZKLOH +DQDIXVD DQG FROOHDJXHV f LQGXFHG LQVXOLWLV LQ 7 FHOOGHSOHWHG 12' PLFH UHFRQVWLWXWHG ZLWK WKH VDPH WZR 7 FHOO VXEVHWV 6XESRSXODWLRQV RI VSOHHQ DQG O\PSK QRGH FHOOV WUDQVIHUUHG GLDEHWHV WR V\QJHQHLF QHRQDWHV DQG GHPRQVWUDWHG DQ DJH

PAGE 66

DQG FHOO GRVHGHSHQGHQW VXVFHSWLELOLW\ UDQJH %HQGHODF HW DO f /D)DFH DQG 3HFN f WUDQVIHUUHG GLDEHWHV LQ QRQVXVFHSWLEOH &%/ RU %%5FG PLFH DQG 6HUUH]H DQG FRZRUNHUV f GLG WKH VDPH LQ 12' 6&,' KRVWV 7 FHOOV KDYH EHHQ JHQHUDOO\ UHFRJQL]HG DV EHLQJ PHGLDWRUV RI DXWLPPXQLW\ DJDLQVW WKH SDQFUHDWLF FHOOV LQ GLDEHWHV $XWRDQWLERGLHV FDQ DOVR EH WUDQVIHUUHG IURP DXWRDQWLJHQLPPXQL]HG GRQRUV WR LQGXFH WKH DXWRLPPXQH GLVHDVH LQ KRVWV $XWRDQWLERGLHV WR WKH WK\URLG VWLPXODWLQJ KRUPRQH UHFHSWRU IURP PRWKHUV ZLWK *UDYHfV GLVHDVH IUHTXHQWO\ SURGXFH WK\URLG DFWLYDWLRQ ZKHQ VHUXP LV WUDQVIHUUHG LQWR WKH IHWXV %HFDXVH ,J* FDQ FURVV WKH SODFHQWD LQIDQWV RI DIIHFWHG PRWKHUV FDQ EH ERP ZLWK K\SHUWK\URLGLVP *RVVDJH DQG 0XQUR %HFNV DQG %XUURZV f 7K\URLGLWLV HQGXULQJ IRU XS WR GD\V KDV EHHQ LQGXFHG E\ WKH WUDQVIHU RI DQWLVHUXP WR VXVFHSWLEOH VWUDLQV RI PLFH 7RPD]LF DQG 5RVH f /LNHZLVH LQ WKH 2EHVH 6WUDLQ FKLFNHQ WKH FKLFNHQ PRGHO IRU WK\URLGLWLV UHSHDWHG LQMHFWLRQV RI KLJK WLWHU DQWLVHUXP IRU ZHHNV LQGXFHG WK\URLGLWLV -DURV]HZVNL HW DO f ,Q ($( VHUXP WUDQVIHU LQ D UDEELW PRGHO LQGXFHG VHYHUH DXWRLPPXQH WK\URLGLWLV ,QRXH HW DO f $XWRLPPXQH FDWDUDFW IRUPDWLRQ KDV EHHQ FUHDWHG H[SHULPHQWDOO\ LQ H\HV RI PLFH E\ PHDQV RI VHUXP DQG PRQRFORQDO DQWLERG\ WUDQVIHUV IURP GRQRUV ZKLFK KDG UHFHLYHG LQMHFWLRQV RI HPXOVLILHG EHWDFU\VWDOOLQV 6LQJK HW DO f $ FXUUHQW K\SRWKHVLV RI WKH SDWKRJHQHVLV LQ WKH 6P\WK /LQH FKLFNHQ VXJJHVWV WKDW WKHUH DUH LQKHUHQW GHIHFWV LQ WKH PHODQRF\WHV SUHGLVSRVLQJ 6/ PHODQRF\WHV WR DEQRUPDO DQWLJHQ SUHVHQWDWLRQ 6P\WK $XVWLQ DQG %RLVV\ 6UHHNXPDU HW DO f &HOOV DQG DQWLERGLHV LQ WKH 6/ FKLFNHQ EHFRPH VHQVLWL]HG WR PHODQRF\WH DQWLJHQV 3UHVXPDEO\ DXWRUHDFWLYH 7 FHOOV DVVRFLDWHG ZLWK WKH PHODQRF\WHV FDQ EH VHHQ LQILOWUDWLQJ

PAGE 67

WKH IHDWKHU EDUE ULGJHV LQ WLVVXH VHFWLRQV VWDLQHG ZLWK PRQRFORQDO DQWLERGLHV VSHFLILF IRU 7 FHOO PDUNHUV (UI HW DO Ef $XVWLQ DQG FROOHDJXHV UHSRUWHG WKH GHWHFWLRQ RI PHODQRF\WHVSHFLILF DQWLJHQV EHWZHHQ DQG N'D LQ WKH 6P\WK OLQH FKLFNHQ $XVWLQ HW DO f 0RUH UHFHQWO\ $XVWLQ DQG %RLVV\ f UHSRUWHG WKDW WKHVH VDPH DXWRDQWLERGLHV DUH UHFRJQL]LQJ WKH FKLFNHQ KRPRORJXH RI PDPPDOLDQ W\URVLQDVHUHODWHG SURWHLQ 753f &RQVLGHUDWLRQ PXVW EH JLYHQ WR WKH IDFW WKDW GXULQJ D ORQJ WHUP FRQGLWLRQ DV LQ DXWRLPPXQLW\ FKDQJHV ZLOO RFFXU LQ WKH DXWRLPPXQH UHSHUWRLUH GXULQJ WKH FRXUVH RI D GLVHDVH $XWRLPPXQLW\ PD\ UHSUHVHQW QRW RQO\ WKH EUHDNGRZQ RI VHOIWROHUDQFH EXW WKH GLVSOD\ RI QHZ FU\SWLF VHOIGHWHUPLQDQWV WR ZKLFK WKH KRVW ZDV QRW RULJLQDOO\ WROHUDQW /HKPDQQ HW DO DQG 6HUFDU] DQG 'DWWD f 7KH FKDQJHV LQ WKH DQWLJHQLF GHWHUPLQDQWV WKDW DUH LQYROYHG LQ WKLV DPHODQRVLV PD\ WKHUHIRUH EH UHIOHFWHG LQ D FKDQJLQJ DXWRLPPXQH 7 FHOO DQG % FHOO UHSHUWRLUH 7KH GHVLJQ RI DGRSWLYH WUDQVIHU H[SHULPHQWV PLJKW WKHUHIRUH WDNH LQWR DFFRXQW WKHVH SRVVLEOH VKLIWV LQ DQWLJHQLFLW\ DQG XWLOL]H GRQRU FHOOV IURP GRQRUV RI GLIIHUHQW DJHV 7KH SDUHQWDO 0DVVDFKXVHWWV %URZQ /LQH FKLFNHQV %/f IURP ZKLFK WKH 6P\WK OLQH ZDV GHULYHG DOVR H[KLELW WKH DPHODQRVLV RI WKH IHDWKHU DQG H\HV EXW DW DQ LQFLGHQFH RI RQO\ WR SHUFHQW (UI HW DO Df DV FRPSDUHG WR WKH b LQFLGHQFH UHSRUWHG IRU 6/ 6P\WK 6P\WK HW DO f 2QH SRWHQWLDO H[SODQDWLRQ IRU WKLV ORZ LQFLGHQFH RI DPHODQRVLV PLJKW EH WKDW WKH PHODQRF\WHV RI VRPH %/ FKLFNHQV GLVSOD\ WKH VDPH GHIHFWV LQ DQWLJHQ SUHVHQWDWLRQ DV K\SRWKHVL]HG IRU WKH 6/ 7KH DGRSWLYH WUDQVIHU RI DXWRUHDFWLYH O\PSKRF\WHV IURP DPHODQRWLF 6/ FKLFNHQV PD\ UHVXOW LQ WKH VDPH DXWRLPPXQH SDWKRJHQHVLV $OWHUQDWLYHO\ WKH PHODQRF\WH GHIHFW PD\ QRW EH UHTXLUHG DQG WKH VLPSOH

PAGE 68

SUHVHQFH RI DQWLPHODQRF\WH DXWRUHDFWLYH O\PSKRF\WHV RU DXWRDQWLERGLHV PD\ EH VXIILFLHQW WR FDXVH DPHODQRVLV LQ %/ FKLFNHQV UHFHLYLQJ 6/ O\PSKRF\WHV RU VHUXP DXWRDQWLERGLHV E\ DGRSWLYH WUDQVIHU 7KH YDULDEOHV WHVWHG LQFOXGHG WKH KRVW DJH GRQRU DJH XVH RI LUUDGLDWLRQ DQG QXPEHU RI LQMHFWLRQV RI GRQRU O\PSKRF\WHV :H DOVR SHUIRUPHG RQH H[SHULPHQW LQYROYLQJ WKH WUDQVIHU RI 6/ VHUXP DXWRDQWLERG\ LQWR %/ KRVWV ,Q WKLV VWXG\ ZH UHSRUW WKH ILUVW WUDQVIHU RI DXWRLPPXQH DPHODQRVLV ZLWK VSOHQLF FHOOV IURP 6P\WK /LQH FKLFNHQV LQ %URZQ /LQH FKLFNHQV 0DWHULDOV DQG 0HWKRGV $QLPDOV )HUWLOH 6/ HJJV IURP WKH PDMRU KLVWRFRPSDWLELOLW\ FRPSOH[ 0+&fGHILQHG VXEOLQH ZKLFK KDV WKH HDUOLHVW DJH RI RQVHW DQG WKH PRVW VHYHUH SKHQRW\SH RI WKH WKUHH 6/ 0+&GHIPHG VXEOLQHV (UI HW DO Df DQG IURP WKH %A2O 0+&PDWFKHG %/ ZHUH JHQHURXVO\ SURYLGHG E\ 'U 5REHUW 6P\WK -U 8QLYHUVLW\ RI 0DVVDFKXVHWWV $PKHUVWf &KLFNHQV ZHUH KDWFKHG DQG KRXVHG DW WKH 8QLYHUVLW\ RI )ORULGD 3RXOWU\ 8QLW DQG ZHUH LQGLYLGXDOO\ LGHQWLILHG ZLWK OHJ EDQG RU ZLQJ WDJ QXPEHUV 7KH GHJUHH RI SLJPHQW ORVV DPHODQRVLVf E\ 6/ FKLFNHQV ZDV FODVVLILHG DFFRUGLQJ WR (UI HW DO Ef f QRUPDO QR DSSDUHQW DPHODQRVLV f PL[HG DPHODQRVLV ZLWK ERWK QRUPDO DQG b DPHODQRWLF IHDWKHU WLVVXH f PL[HG DPHODQRVLV ZLWK QRUPDO DQG b DPHODQRWLF IHDWKHU WLVVXH f PL[HG DPHODQRVLV ZLWK QRUPDO DQG !b DPHODQRWLF IHDWKHU WLVVXH DQG f FRPSOHWH DPHODQRVLV DOO GHYHORSLQJ IHDWKHULQJ WLVVXH LV DPHODQRWLF 6/ FKLFNHQV ZLWK VWDJH RU QR DPHODQRVLV DUH DOVR UHIHUUHG WR DV QRQSURJUHVVRUV DQG 6/ FKLFNHQV ZLWK DQ\ DSSDUHQW

PAGE 69

DPHODQRVLV VWDJHV f DUH UHIHUUHG WR DV SURJUHVVRUV ,W VKRXOG EH QRWHG WKDW WKH SKHQRW\SHV UHSRUWHG UHSUHVHQW WKH PD[LPXP DPHODQRVLV VWDJH UHDFKHG DQG ZHUH VWDEOH 7KH 6/ GRQRUV ZHUH KDWFKHG DQG UDLVHG EHIRUH KDWFKLQJ WKH %/ KRVWV VR WKDW WKHUH ZHUH YLVLEOH DPHODQRWLF GRQRUV E\ WKH WLPH WKH\ ZHUH ZHHNV ROG LQ WLPH WR GRQDWH WKHLU FHOOV WR ZHHN ROG %/ KRVWV 6H[ 'HWHUPLQDWLRQ E\ 3&5 7KH VH[ RI WKH GRQRUV DQG WKH UHFLSLHQWV ZDV GHWHUPLQHG ZKHQ WKH KRVWV ZHUH ZHHNV ROG EHFDXVH WKH KRVWV DW WKLV DJH GR QRW KDYH GHILQLWLYH VHFRQGDU\ VH[XDO IHDWXUHV IRU UHOLDEOH LGHQWLILFDWLRQ 6/ IHPDOHV GLVSOD\ WKH HDUOLHU RQVHW DQG PRUH VHYHUH SKHQRW\SH WKDQ 6/ PDOHV DQG ZRXOG DSSHDU WR KDYH WKH EHVW SRWHQWLDO RI SDVVLQJ DXWRUHDFWLYH 7 FHOOV 7KH LGHDO WUDQVIHU ZRXOG EH IURP D 6/ IHPDOH WR D %/ IHPDOH $WWHPSWV ZHUH PDGH LQ VRPH H[SHULPHQWV WR DYRLG IHPDOH WR PDOH FHOO WUDQVIHUV LQ FDVH RI SRVVLEOH LQFRPSDWLELOLW\ DW WKH PLQRU + ORFL ,Q ELUGV WKH IHPDOHV DUH WKH KHWHURJDPHWLF VH[ EHDULQJ WKH : DQG = FKURPRVRPHV ZKHUHDV PDOHV DUH == 7KH JHQGHU ZDV GHWHUPLQHG E\ 3&5 XVLQJ SULPHUV &KL DQG &KL ,,, GHULYHG IURP WKH VHTXHQFH RI WKH FKLFNHQ : FKURPRVRPHVSHFLILF ;KR UHSHDW IUDJPHQW GHVFULEHG E\ .RGDPD HW DO f DQG NLQGO\ SURYLGHG E\ 'U 6LZR 5 GH .ORHW )ORULGD 6WDWH 8QLYHUVLW\ 7DOODKDVVHHf 7KH '1$ WHPSODWH IRU WKH 3&5 ZDV REWDLQHG IURP D GURS RI EORRG REWDLQHG E\ SULFNLQJ WKH EUDFKLDO ZLQJ YHLQ DQG DEVRUSWLRQ RQWR ,VRFRGH 6WL[ 3&5 WHPSODWH SUHSDUDWLRQ GLSVWLFNV 6FKOHLFKHU DQG 6FKXHOO ,QF .HHQH 1+f *HQRPLF '1$ ZDV HOXWHG DQG 3&5 DPSOLILHG DV GLUHFWHG E\ WKH PDQXIDFWXUHU $ ES SURGXFW ZDV UHVROYHG RQ D b DJDURVH JHO

PAGE 70

,PPXQRVXSSUHVVLRQ RI WKH +RVW $QLPDOV 6RPH KRVW %/ FKLFNV ZHUH LPPXQRVXSSUHVVHG E\ VXEOHWKDO LUUDGLDWLRQ RQH GD\ EHIRUH WKH FHOO WUDQVIHUV \ LUUDGLDWLRQ ZDV SHUIRUPHG XVLQJ D O&V VRXUFH DW WKH 8) +HDOWK &HQWHU $QLPDO 5HVRXUFHV )DFLOLW\ 'RVDJHV XVHG ZHUH HLWKHU UDGV 7RLYDQHQ HW DO DV XVHG RQ GD\ ROG FKLFNVf WR UDGV 'U %UXFH *OLFN SHUVRQDO FRPPXQLFDWLRQf RU QRQH DW DOO 3UHSDUDWLRQ RI WKH 6/ 'RQRU &HOOV DQG &HOO ,QMHFWLRQV 7KH GRQRU 6/ FHOOV ZHUH REWDLQHG IURP 6/ FKLFNHQV XQGHUJRLQJ DFWLYH DPHODQRVLV DW WKH WLPH RI VDFULILFH WR ZHHNV RI DJHf 7KH VSOHHQV ZHUH UHPRYHG PDGH LQWR FHOO VXVSHQVLRQV LQ 3%6 RQ LFH E\ WHDVLQJ WKH RUJDQ DQG E\ GRXQFH KRPRJHQL]DWLRQ DQG WKH O\PSKRF\WHV ZHUH VHSDUDWHG IURP WKH UHG EORRG FHOOV E\ GHQVLW\ FHQWULIXJDWLRQ RYHU )LFROO+\SDTXH 3KDUPDFLDf 7KH VSOHQLF O\PSKRF\WHV ZHUH UHVXVSHQGHG LQ 3%6 DW D GHQVLW\ RI [O WR O[O FHOOV SHU PO DQG D PD[LPXP RI PO RI FHOO VXVSHQVLRQ ZDV WKHQ LQMHFWHG LQWUDYHQRXVO\ LQWR WKH ULJKW MXJXODU YHLQ ZLWK WKH EDODQFH LQWR WKH ZLQJ EUDFKLDO YHLQ 7KH UHFLSLHQW DQLPDOV ZHUH WKHQ PRQLWRUHG LQ QRUPDO KRXVLQJ FRQGLWLRQV QRW SDWKRJHQIUHHf IRU DW OHDVW ZHHNV RI DJH WR DOORZ WKH GHYHORSPHQW RI WKH DPHODQRWLF SKHQRW\SH GXULQJ WKH W\SLFDO WLPH IUDPH DV ZRXOG EH IRXQG LQ D 6/ FKLFNHQ 6P\WK /LQH 6HUXP &ROOHFWLRQ DQG 3UHSDUDWLRQ 6HUXP ZDV FROOHFWHG IURP 6P\WK /LQH FKLFNHQV WKDW GLVSOD\HG REYLRXV DPHODQRVLV DW OHDVW OHYHO f DW WKH WLPH RI FROOHFWLRQ $ UDQJH RI WR PO RI EORRG SHU ELUG ZDV FROOHFWHG LQWR KHSDULQL]HG 9DFXWDLQHU WXEHV IURP WKH MXJXODU DQGRU EUDFKLDO YHLQ RI WKH ZLQJ %ORRG ZDV FHQWULIXJHG DW USP WR FROOHFW WKH VHUXP ZKLFK ZDV

PAGE 71

WKHQ VWRUHG DW r& 7KH VHUD ZDV WKHQ SRROHG DQG WKH JDPPD JOREXOLQ IUDFWLRQ ZDV REWDLQHG E\ WZR VHTXHQWLDO SUHFLSLWDWLRQV ZLWK b DQG WKHQ b VDWXUDWHG DPPRQLXP VXOIDWH 7KH SUHFLSLWDWHV ZHUH GLVVROYHG LQ D PLQLPXP YROXPH RI FROG SKRVSKDWH EXIIHUHG VDOLQH 3%6f GLDO\]HG GD\V DJDLQVW r& 3%6 DIWHU HDFK SUHFLSLWDWLRQ DQG WKHQ ILOWHUVWHULOL]HG XVLQJ D S PLFURSRUH ILOWHU 1DOJHQHf $OLTXRWV RI WKH JDPPD JOREXOLQ IUDFWLRQV ZHUH WKHQ LQWURGXFHG E\ LQMHFWLRQ LQ WKH MXJXODU YHLQ POf ZLWK DQ DGGLWLRQDO YROXPH f LQWURGXFHG LQWUDSHULWRQHDOO\ EHQHDWK WKH EUHDVWSODWH &HOO /LQHV &KLFNHQ PHODQRF\WH FXOWXUHV ZHUH REWDLQHG IURP FKLFNHQ HPEU\RQLF QHXUDO FUHVW WLVVXH E\ WKH PHWKRG RI %RLVV\ DQG +DOODEDQ f LQ WKH ODERUDWRU\ RI *LVHOD (UI DQG REWDLQHG DV D JLIW &XOWXUHV ZHUH JURZQ LQ +DPfV ) PHGLD 6LJPDf VXSSOHPHQWHG ZLWK b )%6 b 1XVHUXP &ROODERUDWLYH %LRPHGLFDO 3URGXFWVf P0 / JOXWDPLQHSHQLFLOOLQVWUHSWRP\FLQ 6LJPDf PJPO FKROHUD WR[LQ 6LJPDf DQG ,P0 SKRUERO P\ULVWLF DFLG ,PPXQREORWWLQJ 6HPLFRQIOXHQW PHODQRF\WHV ZHUH KDUYHVWHG IURP IODVNV ULQVHG WZLFH LQ 3%6 DQG VROXELOL]HG LQ PPRO/ 7ULV EXIIHU S+ f ZLWK PPRO SKHQ\OPHWK\VXOIRQ\O IOXRULGH b PHUFDSWRHWKDQRO P0 RI HDFK DQWLSDLQ DSURWLQLQ FK\PRVWDWLQ OHXSHSWLQ DQG SHSVWDWLQ $ ZLWK b VRGLXP GRGHF\O VXOIDWH 6'6f IRU PLQXWHV DW r & DQG VKHDUHG ZLWK *$ QHHGOH 7KH O\VDWHV ZHUH VHSDUDWHG RQ 6'6 SRO\DFU\ODPLGH JHO HOHFWURSKRUHVLV 6'63$*(f UHGXFLQJ JHOV DQG HOHFWUREORWWHG RQWR ,PPRELORQ3 SRO\YLQ\OLGHQH IOXRULGH 39')f PHPEUDQH $ %LR5DG ORZ UDQJH

PAGE 72

PROHFXODU ZHLJKW PDUNHU ODQH ZDV XVHG %LR5DG /DERUDWRULHV &DOLIRUQLDf 7KH EORWWHG SURWHLQV ZHUH EORFNHG LQ b &DUQDWLRQ QRQIDW GU\ PLON ZLWK P0 7ULV S+ P0 1D&O DQG b 7ZHHQ 7%67f 7KH EORWV ZHUH FXW LQ LQGLYLGXDO VWULSV DQG HDFK VWULS ZDV LQGLYLGXDOO\ LQFXEDWHG ZLWK GLIIHUHQW VRXUFHV SULPDU\ DQWLERG\ HLWKHU GLUHFW VHUXP FOHDUHG DV GHVFULEHG DERYH RU WKH JDPPD JOREXOLQ IUDFWLRQf IRU KRXUV DW URRP WHPSHUDWXUH LQ 7%67 ZLWK b PLON ZDVKHG WLPHV IRU PLQXWHV DQG WLPHV IRU PLQXWHV DQG WKHQ LQFXEDWHG LQ JRDW DQWLFKLFNHQ KRUVH UDGLVK SHUR[LGDVHFRQMXJDWHG VHFRQGDU\ DQWLERG\ 6RXWKHUQ %LRWHFKQRORJLHV f IRU KRXUV 7KH SURWHLQV ZHUH GHWHFWHG E\ (&/ FKHPLOXPLQHVFHQFH $PHUVKDPf 7KH EORWV ZHUH DQDO\]HG E\ GHQVLWRPHWU\ DQG +RHIHU ,PDJH 0DVWHU VRIWZDUH +LVWRORJ\ 5HJHQHUDWLQJ IHDWKHUV RI 6/ DQG FRQWURO %/ ELUGV ZHUH JHQHUDWHG E\ JHQWOH SOXFNLQJ RI JURZLQJ IHDWKHUV DQG FROOHFWLQJ RI WKH \RXQJ IHDWKHUV ELPRQWKO\ 7KH IHDWKHUV ZHUH EURXJKW WR WKH 8QLYHUVLW\ RI )ORULGD 'LDJQRVWLF 5HVHDUFK /DERUDWRU\ IRU FU\RVHFWLRQLQJ 0RXVH PRQRFORQDO DQWLERGLHV WR FKLFNHQ 7&5 7&5 7&5 &' &' &7 ZHUH D JLIW RI 'U &KHQOR &KHQ DQG GHVFULEHG E\ &RRSHU HW DO f 0HWK\O JUHHQ ZDV XVHG DV WKH FRXQWHUVWDLQ 5HVXOWV 2EVHUYDWLRQV RI WKH 8) &RORQ\ RI 6P\WK /LQH &KLFNHQV 2EVHUYDWLRQV KDYH EHHQ FRPSLOHG IURP UDLVLQJ WZHOYH SRSXODWLRQV RI WKH 6P\WK OLQH FKLFNHQ ,Q WKH FRORQ\ UDLVHG DW WKH 8QLYHUVLW\ RI )ORULGD WKH DPHODQRVLV LQFLGHQFH KDV EHHQ DSSUR[LPDWHO\ b 2EVHUYDWLRQV FRPSLOHG IURP IRXU RI WKH SRSXODWLRQV RI 6P\WK

PAGE 73

OLQH FKLFNHQ LV VXPPDUL]HG LQ 7DEOH )HPDOH 6P\WK FKLFNHQV 7DEOH DQG )LJXUH f XVXDOO\ GHPRQVWUDWH D TXLFNHU RQVHW DQG PRUH VHYHUH PDQLIHVWDWLRQV RI WKH SKHQRW\SH RI GHSLJPHQWDWLRQ DW D KLJKHU IUHTXHQF\ WKDQ LQ PDOHV D SKHQRPHQRQ WKDW KDV EHHQ VHHQ LQ RWKHU DXWRLPPXQH GLVHDVH DQLPDOV VXFK DV WKH IHPDOH 12' PRXVH 'XULQJ WKH ILUVW ZHHNV b RI WKH IHPDOHV RI f EHFDPH DPHODQRWLF ZLWK DW WKH PRUH VHYHUH OHYHOV VWDJHV f $V WKH ELUGV DJHG WKH IHPDOHV FRQWLQXHG WR KDYH D KLJKHU SURSRUWLRQ WKDW DUH DIIHFWHG DQG KDYH WKH PRUH VHYHUH SKHQRW\SH %\ WKH WK ZHHN b RI WKH IHPDOHV ZHUH DPHODQRWLF DQG RI WKHVH GLVSOD\HG WKH PRUH 7DEOH $PHODQRVLV LQFLGHQFH LQ WKH 8) 6P\WK OLQH FRORQ\ 3RSXODWLRQ QXPEHU DYDLODEOH HDUO\ RQVHW ZNVf GHOD\HG RQVHW ZNVf QXPEHU DPHODQRWLF b DPHODQRWLF WRWDO DPHODQRWLF 6/ ) b b 0 b 6/ ) b b 0 b 6/ ) b b 0 b 6/ ) b b 0 b WRWDO ) b b WRWDO 0 b

PAGE 74

1XPEHU 6P\WK OLQH IHPDOHV $PHODQRVLV VWDJH ‘ ‘'''

PAGE 75

1XPEHU 6P\WK OLQH PDOHV $PHODQRVLV VWDJH ‘ EGG' Z Z Z Z 2V .! )LJXUH )UHTXHQFLHV RI 6P\WK /LQH PDOHV Z $JH

PAGE 76

1XPEHU 6P\WK OLQH IHPDOHV PDOHVf $PHODQRVLV VWDJH ‘%''' )LJXUH )UHTXHQFLHV RI 6P\WK OLQH IHPDOHV DQG PDOHV

PAGE 77

VHYHUH SKHQRW\SHV 2QO\ b RI WKH PDOHV RI f VKRZHG DQ\ GHSLJPHQWDWLRQ E\ WKH WK ZHHN DQG DOO DW WKH ORZHVW OHYHO 7DEOH DQG )LJXUH f 0DOHV FDQ EHFRPH MXVW DV VHYHUH WKH\ XVXDOO\ WDNH ORQJHU WR GHYHORS %\ WKH WK ZHHN b GLVSOD\HG WKH PRUH VHYHUH SKHQRW\SHV EXW RQO\ RQH VKRZHG WKH VHYHUHVW DW OHYHO DV FRPSDUHG WR IHPDOHV 7KH LQIRUPDWLRQ FRPELQLQJ WKH IUHTXHQFLHV IURP ERWK VH[HV LV FRPSLOHG LQ )LJXUH ,Q RQH JHQHUDWLRQ WKHUH ZDV DFWXDOO\ VRPH UHYHUVLRQ RI WKH SKHQRW\SH LQ WKUHH RI WKH IHPDOHV RWKHUZLVH WKH SKHQRW\SH RQFH WKH PD[LPXP ZDV DFKLHYHG UHPDLQV VWDEOH 2I WKHVH WKUHH UHYHUWDQWV WZR ZHUH FRPSOHWHO\ DPHODQRWLF DQG RQH ZDV b DPHODQRWLF $IWHU WKHLU LQLWLDO GHSLJPHQWDWLRQ KDG SHDNHG D SHULRG RI UHSLJPHQWDWLRQ EHJDQ ZKLFK VWDUWHG DV SDWFKHV LQ D GLIIHUHQW SDWWHUQ WKDQ WKH\ ZHUH ILUVW GHSLJPHQWLQJ 7KH UHSLJPHQWDWLRQ ZDV QRW FRPSOHWH 7KHUH VHHPV WR EH WZR ZDYHV RI GHYHORSLQJ DPHODQRVLV EDVHG RQ REVHUYDWLRQV RI VHYHUDO SRSXODWLRQV DV VKRZQ LQ 7DEOH DQG )LJXUH 7KH HDUO\ RQVHW ZDYH PDMRULW\ RI WKH 6/f EHJLQV DW WKH WK WKURXJK WKH WK ZHHN SRVW KDWFK 7KH\ SHDNHG DW GHYHORSPHQW RI DPHODQRVLV E\ WKH WK WR WK ZHHN DFKLHYLQJ WKH VHYHUH SKHQRW\SHV VWDJHV DQG RIWHQ HDUOLHU WKDQ ZHHNV 7KH VHFRQG ZDYH IXOO\ SLJPHQWHG XS WR WKLV SRLQW VWDUWHG GHYHORSLQJ DPHODQRVLV DW WK WR ,Vn ZHHN DQG QRQH EHFDPH WRWDOO\ DPHODQRWLF IURP WKH VHFRQG ZDYH 7KLV ZDV VHHQ DW ZHHN IRU D PDOH IURP WKH 6/ SRSXODWLRQ DQG IRU WZR IHPDOHV IURP WKH 6/ SRSXODWLRQ $GRSWLYH &HOO 7UDQVIHU ([SHULPHQWV )LYH FHOO WUDQVIHU H[SHULPHQWV ZHUH FRQGXFWHG 9DULDEOHV FRQVLGHUHG LQFOXGHG f KRVW DJH f GRQRU DJH f VWDJH RI DPHODQRVLV H[KLELWHG E\ WKH GRQRU LQFOXGLQJ KRZ

PAGE 78

UDSLG DQG VHYHUH WKH DPHODQRVLV GHYHORSHGf f ZKHWKHU KRVWV ZHUH LUUDGLDWHG DQG f WKH QXPEHU RI LQMHFWLRQV RI FHOOV 7KH ILUVW FHOO WUDQVIHU H[SHULPHQW ZDV SHUIRUPHG RQ GD\ROG %/ FKLFNV PHDQ ZHLJKW RI Jf ,Q RUGHU WR DOORZ IRU WKH SRVVLELOLW\ WKDW FKDQJHV PLJKW RFFXU LQ WKH DXWRLPPXQH 7 FHOO UHSHUWRLUH GXULQJ WKH FRXUVH RI GLVHDVH WZR DJH JURXSV RI 6/ GRQRUV ZHUH XVHG 7KH SODQ LQFOXGHG ILYH WHVW JURXSV ZLWK D RQH WLPH GRQDWLRQ RI WUDQVIHUUHG FHOOV SHU KRVW DV VKRZQ LQ 7DEOH *URXSV $(f 7RWDO ERG\ LUUDGLDWLRQ RI UDGV ZDV LVVXHG SHU KRVW %/ ELUG RQ WKH GD\ EHIRUH WKH DGRSWLYH WUDQVIHU 7KH VSOHQLF O\PSKRF\WH VXVSHQVLRQV ZHUH SUHSDUHG ZLWK D UDQJH RI FHOOV EHWZHHQ [O FHOOVPO DQG [O FHOOVPO ZKLFK LV ZLWKLQ WKH UDQJH XVHG LQ PRXVH DQG UDW WUDQVIHU H[SHULPHQWV +RVWV DQG FRQWUROV ZHUH NHSW LQ QRUPDO KRXVLQJ FRQGLWLRQV 2I WKH %/ KRVW FKLFNHQV VXUYLYHG 2I WKHVH %/ KRVWV WKDW UHFHLYHG 6/ GRQRU FHOOV bf GLVSOD\HG D SDUWLDO DPHODQRWLF SKHQRW\SH 7KLV KDV EHHQ VXPPDUL]HG LQ 7DEOH ZKLFK VKRZV WKH SURJUHVVLRQ RI DPHODQRVLV RI WKHVH KRVWV DIWHU UHFHLYLQJ WKH WUDQVIHU RI 6/ O\PSKRF\WHV 7ZR IHPDOHV IURP HLWKHU JURXSV $ ,' RU ,( HDFK GHYHORSHG D KLJKO\ VHYHUH VWDJH RI DPHODQRVLV ZLWKLQ PRQWKV RI DJH 8QIRUWXQDWHO\ WKHVH WZR GLHG DQG ZHUH UHPRYHG IURP WKH SRXOWU\ XQLW E\ WKH DQLPDO FDUHWDNHU EHIRUH SKRWRJUDSKV DQG WLVVXH VDPSOHV FRXOG EH WDNHQ 8QIRUWXQDWH WRR ZDV WKH IDFW WKDW WKH ELUGV KDG RXWJURZQ WKHLU OHJ WDJV 2WKHU %/ KRVWV RQO\ KLQWHG RI D SRVVLEOH DPHODQRWLF SKHQRW\SH %/ D IHPDOH DOVR IURP HLWKHU JURXSV $ ,' RU ,( JUDGXDOO\ GHYHORSHG DPHODQRVLV WR VWDJH LQ VHYHULW\ 8QIRUWXQDWHO\ WKLV KHDOWK\ ELUG GLHG VXGGHQO\ EHIRUH SKRWRJUDSKV ZHUH FRQVLGHUHG ,W WRR ZDV UHPRYHG IURP WKH SRXOWU\ XQLW EHIRUH VDPSOHV FRXOG EH WDNHQ

PAGE 79

7DEOH $GRSWLYH WUDQVIHU RI DPHODQRVLV ZLWK VLQJOH WUDQVIHUV RI 6/ VSOHQLF O\PSKRF\WHV 7HVW *URXS +RVWV 'RQRUV $PHODQRWLF 6XUYLYHG 1R $JH 6H[ ,UUDGLDWHG UDGVf 6H[ $JH $PHODQRVLV 6WDJH &HOOV +RVW $ G ) ) Z [O ,% G 0 0 Z R ; & G 0 0 Z [O ,' G ) ) Z [O ,( G 0) ) Z [O $ G QG 0 Z [O % G QG 0 Z %/f O[O2 & G QG $ Z ) 0 Z O[O2 % Z ) ) Z [O & Z ) 0) Z [O QG QRW GHWHUPLQHG

PAGE 80

7DEOH 3URJUHVVLRQ RI DPHODQRVLV LQ %/ KRVWV DIWHU DGRSWLYH WUDQVIHUV RI 6/ VSOHQLF O\PSKRF\WHV $JH RI KRVW LQ PRQWKV $QLPDO VH[ P P P P P P P %/ ) Df %/ ) Df %/ ) Ef %/ 0 Ff %/ 0 Ff Df 'LHG DW ZHHNV ROG DQG UHPRYHG IURP SRXOWU\ XQLW EHIRUH VDPSOHV FRXOG EH WDNHQ Ef 'LHG ZLWKLQ WKH ILIWK PRQWK RI DJH DQG UHPRYHG EHIRUH SKRWRJUDSKV DQG VDPSOHV FRXOG EH WDNHQ Ff 'LHG DIWHU WKH QLQWK PRQWK RI DJH 7KHUH DUH ILYH OHYHOV WR GHVFULEH WKH GHJUHH RI DPHODQRVLV DV GHYHORSHG E\ (UI HW DO Ef DQG DGDSWHG E\ WKLV ODE f QRUPDO QR DSSDUHQW DPHODQRVLV f PL[HG DPHODQRVLV ZLWK ERWK QRUPDO DQG b DPHODQRWLF IHDWKHU WLVVXH f PL[HG DPHODQRVLV ZLWK QRUPDO DQG b DPHODQRWLF IHDWKHU WLVVXH f PL[HG DPHODQRVLV ZLWK QRUPDO DQG !b DPHODQRWLF IHDWKHU WLVVXH DQG f FRPSOHWH DPHODQRVLV DOO GHYHORSLQJ IHDWKHULQJ WLVVXH LV DPHODQRWLF 6/ FKLFNHQV ZLWK VWDJH RU QR DPHODQRVLV DUH DOVR UHIHUUHG WR DV QRQSURJUHVVRUV DQG 6/ FKLFNHQV ZLWK DQ\ DSSDUHQW DPHODQRVLV VWDJHV f DUH UHIHUUHG WR DV SURJUHVVRUV

PAGE 81

7ZR PDOHV %/ DQG %/ DOVR GHYHORSHG DQ DPHODQRWLF SKHQRW\SH UHVHPEOLQJ WKDW RI WKH 6P\WK OLQH DQG ZHUH IROORZHG PRUH FORVHO\ $URXQG WKH VL[WK PRQWK RI %/fV OLIH UHJHQHUDWLQJ IHDWKHUV EHJDQ WR GLVSOD\ PHODQRF\WH GHVWUXFWLRQ LQ WKH SXOSV WKDW KDG EHHQ DOO DORQJ UHIOHFWHG LQ WKH EDQGHG EODFN DQG ZKLWH IHDWKHU YDQHV 1RZ WKH SXOSV LQ UHJHQHUDWLQJ IHDWKHUV ZHUH FUHDP\ JUD\ LQVWHDG RI KRPRJHQRXV EODFN %\ WKH HLJKWK PRQWK WKH SXOSV LQ WKH UHJHQHUDWLQJ IHDWKHUV LQ %/ ZHUH PRVWO\ JUD\ VRPH ZHUH EDQGHG EODFN DQG ZKLWH DQG RQO\ RQH WR WZR SHUFHQW ZHUH VWLOO FRPSOHWHO\ EODFN % HYHQ LQ LWV HLJKWK PRQWK VWLOO GLVSOD\HG D ORZ OHYHO RI DPHODQRVLV ZLWK PRVWO\ EODFN SXOSV LQ WKH UHJHQHUDWLQJ IHDWKHUV 1HYHUWKHOHVV WKH IHDWKHU YDQHV ZHUH EDQGHG ZLWK WKH ROGHVW SDUWV WKH WLSV EHLQJ EODFN DQG WKH \RXQJHVW SDUWV FORVHVW WR WKH SXOS EHLQJ ZKLWH RU GHSLJPHQWHG 7KH GHYHORSPHQW RI DPHODQRVLV ZDV YHU\ JUDGXDO DQG QRW FRQYLQFLQJ XQWLO FKDQJHV LQ WKH SXOSV FRXOG EH ZLWQHVVHG 3KRWRJUDSKV RI WKH H[WHQW RI DPHODQRVLV GHYHORSHG DW WKH DJH RI PRQWKV DUH VKRZQ LQ )LJXUH DQG ,Q WKH VHFRQG FHOO WUDQVIHU H[SHULPHQW WKUHH JURXSV RI GD\ROG %/ JHQHUDWLRQ KRVWV VH[ QRW SUHGHWHUPLQHGf ZHUH XVHG DV WKH UHFLSLHQWV RI D VLQJOH WUDQVIHU RI FHOOV FRPSDULQJ KRVWV UHFHLYLQJ O\PSKRF\WHV IURP D 6/ GRQRU WR KRVWV UHFHLYLQJ O\PSKRF\WHV IURP D %/ FRQWURO GRQRU 7DEOH f +RVWV ZHUH LUUDGLDWHG ZLWK UDG WRWDO LUUDGLDWLRQ HDFK RQ WKH GD\ EHIRUH WKH DGRSWLYH WUDQVIHU DQG JLYHQ D VLQJOH UHFRQVWLWXWLRQ RI 6/ VSOHQLF O\PSKRF\WHV RU %/ O\PSKRF\WHV $Q H[WUD %/ ZKLFK ZHUH SUHSDUHG E\ LUUDGLDWLRQ ZHUH QRW XVHG DQG QHYHU UHFRQVWLWXWHG ZLWK FHOOV 7KHVH VXUYLYHG XQWLO VDFULILFHG DIWHU SOXV ZHHNV RI DJH

PAGE 82

)LJXUH %/ D %URZQ /LQH DGRSWLYH WUDQVIHU KRVW GLVSOD\LQJ VWDJH DPHODQRVLV

PAGE 83

2QO\ WKUHH %/ KRVWV VKRZHG DQ\ PDQLIHVWDWLRQV RI DPHODQRVLV DERYH %/ PDOHf VKRZHG DPHODQRVLV RI VWDJH 2XW RI KRVW %/ FKLFNHQV UHFRQVWLWXWHG ZLWK 6/ GRQRU FHOOV RQO\ RQH bf GHPRQVWUDWHG DPHODQRVLV 1RQH RI WKH FRQWURO KRVWV UHFRQVWLWXWHG ZLWK %/ GRQRU FHOOV GHYHORSHG DQ\ VLJQV RI DPHODQRVLV ,Q WKH WKLUG DGRSWLYH FHOO WUDQVIHU H[SHULPHQW ROGHU ZHHNROG QRQLUUDGLDWHG QRUPDO KRVWV ZHUH JLYHQ RQH LQMHFWLRQ RI 6/ GRQRU VSOHQRF\WHV DV VKRZQ LQ 7DEOH *URXSV $&f 'RQRU FHOOV FDPH IURP WZR GLIIHUHQW DJH JURXSV 7KH FKDQJH WR ZHHNROG FKLFNHQV DQG QR LUUDGLDWLRQ SURYLGHG WKH RSSRUWXQLW\ RI WKH GRQDWHG 6/ VSOHQLF O\PSKRF\WHV WR EH SUHVHQW GXULQJ WKH WLPH SHULRG LQ ZKLFK DPHODQRVLV XVXDOO\ VWDUWV LQ WKH HDUO\ RQVHW 6/ FKLFNHQV 1RQH RI WKH KRVW %/ FKLFNHQV GHYHORSHG DQ\ VLJQV RI DPHODQRVLV E\ WKH DJH RI ZHHNV ,Q WKH IRXUWK FHOO WUDQVIHU H[SHULPHQW D VHULDO DGRSWLYH FHOO WUDQVIHU SURWRFRO ZDV DGRSWHG (DFK VHW RI %/ KRVWV ZKLFK ZHUH QRW LUUDGLDWHG UHFHLYHG VHYHUDO FHOO LQMHFWLRQV IURP D VHULHV RI DPHODQRWLF 6/ GRQRUV RYHU D FRXUVH RI VHYHUDO ZHHNV 7KH WUDQVIHUV EHJDQ DW ZHHNV RI DJH MXVW EHIRUH WKH WLPH ZKHQ DPHODQRVLV EHJLQV WR DSSHDU LQ WKH 6/f DQG FRQWLQXHG WKURXJK WKH WLPH SHULRG ZHHNVf GXULQJ ZKLFK DPHODQRVLV XVXDOO\ GHYHORSV LQ WKH 6/ 7DEOH *URXS f ,W ZDV KRSHG WKDW ZHHNO\ UHSHDWHG LQMHFWLRQV RI VSOHQLF FHOOV IURP 6/ GRQRUV LQWR WKH VDPH VHW RI %/ KRVWV ZRXOG PLPLF WKH FRQVWDQW SUHVHQFH RI PHODQRF\WHVHQVLWL]HG 7 FHOOV LQ WKH 6/ FKLFNHQ ,Q H[SHULPHQW IHPDOH %/ KRVWV LQLWLDOO\ UHFHLYHG 6/ GRQRU FHOOV UHSUHVHQWLQJ WKUHH GLIIHUHQW H[SHULPHQWDO WHVW JURXSV *URXSV $& +RZHYHU LW ZDV QHFHVVDU\ WR VLPSOLI\ WKH VRXUFH RI GRQRU FHOOV LQ WKH VXEVHTXHQW WUDQVIHU RI 6/ O\PSKRF\WHV WR RQH

PAGE 84

7DEOH $GRSWLYH WUDQVIHU RI DPHODQRVLV ZLWK PXOWLSOH WUDQVIHUV RI 6/ VSOHQLF O\PSKRF\WHV 7HVW *URXS +RVWV 'RQRUV $PHODQWLF 6XUYLYHG 1R 6H[ $JH 6H[ $JH $PHODQRVLV 6WDJH &HOOV +RVW $ )0 Z 0 Z O[O2 % 0 Z ) Z [O & )0 Z 0) Z [O Z )) Z [O Z 0) Z [O Z 0)) Z QRW FRXQWHG Z 00) Z ; $ ) Z 0 Z [ Z 0) Z [O % ) Z 0 Z %/ [O Z )0) Z %/ [O

PAGE 85

VRXUFH RI GRQRUV HDFK ZHHN 7KLV ZDV GLFWDWHG E\ WKH DYDLODELOLW\ RI D ODUJH HQRXJK SRRO RI 6/ GRQRUV ZLWK WKH GHVLUHG VWDJH RI DPHODQRVLV DQG WKH ZRUN QHFHVVDU\ WR SUHSDUH WKH VSOHQRF\WHV IURP VHYHUDO 6/ GRQRUV 7KXV LI 6/ PDOHV SURYLGHG WKH GHVLUHG DPHODQRWLF IHDWXUHV WKHLU VSOHHQV ZHUH XVHG WR DXJPHQW WKH 6/ GRQRU FHOO VRXUFH 7KH KRVWV LQ *URXS ZHUH UHWDLQHG XQWLO ZHHNV RI DJH KRZHYHU QR DPHODQRVLV ZDV DSSDUHQW 7KH ILIWK DGRSWLYH FHOO WUDQVIHU H[SHULPHQW DOVR XWLOL]HG ZHHNROG QRQLUUDGLDWHG QRUPDO %/ KRVWV ZLWK WKH VDPH SURWRFRO DV LQ WKH IRXUWK H[SHULPHQW 6HYHQ %/ IHPDOH KRVWV ZHUH JLYHQ LQMHFWLRQV RI 6/ GRQRU VSOHQLF O\PSKRF\WHV RQ ZHHN DQG WKHQ RQ ZHHN *URXS $f $ FRQWURO JURXS RI %/ IHPDOHV UHFHLYHG LQMHFWLRQV RQ ERWK ZHHNV RI %/ VSOHQLF O\PSKRF\WHV 7DEOH *URXS %f 7KHVH KRVWV ZHUH PDLQWDLQHG IRU ZHHNV DQG QR DPHODQRVLV ZDV REVHUYHG 6HUXP 7UDQVIHU ([SHULPHQW :H SHUIRUPHG RQH H[SHULPHQW WR GHWHUPLQH ZKHWKHU WKH WUDQVIHU RI 6/ VHUXP DXWRDQWLERGLHV WR PHODQRF\WH DQWLJHQV FRXOG UHVXOW LQ WKH WUDQVIHU RI WKH GLVHDVH LQWR %/ FKLFNHQV DV HYLGHQFHG E\ DQ DPHODQRWLF SKHQRW\SH 5HSHWLWLYH DGPLQLVWUDWLRQV RI VHUXP KDYH EHHQ XWLOL]HG LQ SUHYLRXV VWXGLHV RI SDVVLYH WUDQVIHU RI DXWRLPPXQLW\ )RU H[DPSOH LQ WKH DXWRLPPXQH PXULQH PRGHO IRU WK\URLGLWLV VHUXP WUDQVIHUV ZHUH SHUIRUPHG RQ GD\ DQG 7KLV ZDV VXIILFLHQW WR LQGXFH WK\URLG OHVLRQV E\ SDVVLYH WUDQVIHU RI LPPXQH VHUXP LQ ZHHN ROG DQLPDOV 7RPD]LF DQG 5RVH f 7KH UHJLPHQW RI ZHHNO\ PO LQMHFWLRQV KDV EHHQ SHUIRUPHG IRU ZHHNV E\ LQWUDYHQRXV DQG VXEFXWDQHRXV PHDQV LQ WKH 26 FKLFNHQ PRGHO RI WK\URLGLWLV -DURV]HZVNL HW DO f 6HUXP ZDV FROOHFWHG IURP 6/ FKLFNHQV WKDW H[SUHVVHG DPHODQRWLF SKHQRW\SHV RI YDULRXV GLIIHUHQW VWDJHV VWDJHV f

PAGE 86

WR DFFRXQW IRU WKH SRVVLEOH FKDQJHV WKDW RFFXU LQ WKH DQWLERG\ UHSHUWRLUH DV DPHODQRVLV SURJUHVVHV :H FROOHFWHG DQG SRROHG VHUXP IURP IRXU GLIIHUHQW VRXUFHV 3RRO ZHHNV ROG 6/f 3RRO PRQWKV ROG 6/ 6/ 6/f 3RRO PRQWKV ROG 6/f 3RRO PRQWKV ROG 6/f (LJKW QRUPDO %/ KRVWV UHFHLYHG 6/ JDPPD JOREXOLQ LQMHFWLRQV RYHU D ZHHN SHULRG 7KUHH %/ KRVWV UHFHLYHG 3%6 DV D FRQWURO JURXS $ %LR5DG SURWHLQ DVVD\ ZDV XVHG WR GHWHUPLQHG WKH WRWDO JDPPD JOREXOLQ IUDFWLRQ DGPLQLVWHUHG SHU LQMHFWLRQ E\ DVVD\LQJ DOLTXRWV VDYHG IURP HDFK SUHSDUDWLRQ XVHG IRU LQMHFWLRQ 5HVXOWV RI WKLV DVVD\ 7DEOH f LQGLFDWH WKDW WKH KRVWV UHFHLYHG D WRWDO RI WR PJ RI WRWDO VHUXP JDPPD JOREXOLQV ZKLFK FRUUHVSRQGV WR WKH RULJLQDO VHUXP YROXPHV RI WR PO SHU KRVW 7KH H[SHULPHQWDO DSSURDFK IRU WKLV H[SHULPHQW FRPELQHG HOHPHQWV RI WKH DIRUHPHQWLRQHG PRXVH 7RPD]LF DQG 5RVH f DQG 26 FKLFNHQ -DURV]HZVNL HW DO f VWXGLHV ,W LQFOXGHG DGPLQLVWUDWLRQV GXULQJ WKH ILUVW ZHHN DQG WKHQ DGGLWLRQDO LQRFXODWLRQV ZHHNO\ IRU IRXU DGGLWLRQDO ZHHNV (DFK DXWRDQWLERG\ JDPPD JOREXOLQf WUDQVIHU FRQVLVWHG RI WKH LQMHFWLRQ RI D WRWDO RI PO SHU KRVW RU PO LQWR WKH MXJXODU YHLQ DQG PO LQMHFWHG LQWUDSHULWRQHDOO\ 7DEOH f +RVWV DQG FRQWUROV ZHUH NHSW LQ QRUPDO KRXVLQJ FRQGLWLRQV 7KHVH JDPPD JOREXOLQ WUDQVIHU KRVWV ZHUH PDLQWDLQHG DQG PRQLWRUHG ELZHHNO\ IRU YLVXDO FKDQJHV LQ SKHQRW\SH DQG UHJHQHUDWLQJ IHDWKHUV ZHUH FROOHFWHG ELZHHNO\ 1R

PAGE 87

7DEOH %LR5DG 3URWHLQ $VVD\ RI *DPPD *OREXOLQ 3RROV DQG 6HOHFWHG 6HUXP 6DPSOHV 6WDQGDUG XJPOf 2' 2' 2' DYH %RYLQH *DPPD *OREXOLQ VWDQGDUG GG+ DV UHIHUHQFH FRUUHODWLRQ VORSH \LQWHUFHSW 6DPSOH 'LOXWLRQ 2' 2' 2' DYH 'LOXWLRQ XJ VDPSOH 6WRFN XJPO PJ PO &RQH )DFWRU (TXLY 9RO SRRO OVP YLDOf SRRO OOJ YLDOf 6/ SRRO PO FRQ 6/f SRRO 6/f SRRO 6/f SRRO 6/ SRRO 6/ SRRO 6/ SRRO 6/ SRRO Df %/ %/ %/ %/ 6/ 6/ %/ %/ Df PJPO

PAGE 88

7DEOH $GRSWLYH WUDQVIHU RI 6/ JDPPD JOREXOLQ LQWR ZHHNROG %/ KRVWV 'D\ RI ,QMHFWLRQ $JH 3RRO PO 6HUXP (TXLYPOf PJ ,J* Z PO Z PO Z PO Z PO Z PO Z PO PO Z PO PO

PAGE 89

LQGXFHG DPHODQRVLV ZDV DSSDUHQW E\ WKH DJH RI ZHHNV DW ZKLFK WLPH LW ZDV GHFLGHG WR WHUPLQDWH WKH H[SHULPHQW ZHHNV DIWHU WKH ODVW LQMHFWLRQ RI JDPPD JOREXOLQV :HVWHUQ %ORW $QDO\VLV :HVWHUQ EORW DQDO\VLV ZDV SHUIRUPHG WR FRQILUP WKH SUHVHQFH RI DQWLPHODQRF\WH DXWRDQWLERGLHV LQ WKH VHUXP SRROV XVHG IRU WKH JDPPD JOREXOLQ DGRSWLYH WUDQVIHU H[SHULPHQWV 6HUXP IURP WKH WZR DGRSWLYH FHOO WUDQVIHU %/ KRVWV WKDW EHFDPH PHODQRWLF %/ DQG %/ ZHUH DOVR H[DPLQHG WR OHDUQ PRUH DERXW WKH H[WHQW RI WKHLU SKHQRW\SH $V VKRZQ LQ )LJXUH VHUXP SRROV DQG ODQHV DQG UHVSHFWLYHO\f GLG FRQWDLQ DXWRDQWLERGLHV VSHFLILF WR PHODQRF\WH SURWHLQV LQ WKH VL]H UDQJH RI N'D UHSRUWHG DV FKDUDFWHULVWLF RI WKH 6P\WK OLQH FKLFNHQV E\ $XVWLQ HW DO f /DQHV DQG DUH VHUXP VDPSOHV IURP %/ DGRSWLYH FHOO WUDQVIHU KRVWV %/ DQG %/ IURP WZR WLPHSRLQWV HDFK DW DERXW D PRQWK DSDUW $OO IRXU VDPSOHV KDG WKH VDPH DXWRDQWLERG\ SURILOHV VSHFLILF IRU WKH VDPH PHODQRF\WH SURWHLQV DV VHHQ W\SLFDO LQ WKH RWKHU 6/ VHUD ODQHV DQG f 7KLV VXJJHVWV WKDW LQ DGGLWLRQ WR WKH SDUWLDOO\ DPHODQRWLF SKHQRW\SH REVHUYHG LQ WKHVH KRVWV DQWLPHODQRF\WH DXWRDQWLERG\ SURGXFWLRQ PD\ KDYH EHHQ LQGXFHG E\ WKH DGRSWLYH WUDQVIHU RI 6/ VSOHQLF O\PSKRF\WHV &RQWURO VHUD LQFOXGHG DQ DPHODQRWLF 6/ SRVLWLYH FRQWURO WKDW UHFRJQL]HG WKH VDPH N'D SURWHLQ EDQGV DQG D %/ VHUXP QHJDWLYH FRQWURO ODQH f ZKLFK GLG QRW FRQWDLQ DXWRDQWLERGLHV WKDW ZRXOG UHFRJQL]H WKH VDPH PHODQRF\WH SURWHLQV $FFRUGLQJ WR $XVWLQ DQG FROOHDJXHV WKH 6/ DQWLPHODQRF\WH DQWLERGLHV UHFRJQL]H PHODQRF\WH SURWHLQV EHWZHHQ N'D DQG N'D LQ VL]H 8VLQJ ,PDJH 0DNHU VRIWZDUH

PAGE 90

)LJXUH $GRSWLYH FHOO WUDQVIHU KRVWV GHWHFW WKH VDPH PHODQRF\WH DXWRDQWLJHQV EHWZHHQ N'D WR N'D DV GR WKH 6/ GRQRU VHUXP ODQHV f 7KHVH PD\ EH DQWL7US DXWRDQWLJHQV $XVWLQ HW DO $XVWLQ DQG %RLVV\ f *DPPD JOREXOLQ VRXUFHV ODQHV f GLG SURYLGH VHUXP DQWLPHODQRF\WH DQWLERGLHV RI WKH FRUUHFW VSHFLILFLW\ DQG VL]H UDQJH W\SLFDO RI 6/ FKLFNHQV $UURZ UHIHUV WR WKH GHWHFWLRQ RI DQ DSSUR[LPDWHO\ N'D PHODQRF\WH SURWHLQ IRXQG RQO\ ZLWK VHUXP DQWLERGLHV IURP 6/ FKLFNHQV DQG WKH DGRSWLYH 6/ FHOO WUDQVIHU KRVWV ODQHV f EXW QRW ZLWK %/ FKLFNHQ VHUXP ODQH f %LR 5DG /RZ 5DQJH SUHVWDLQHG PDUNHUV ZHUH XVHG

PAGE 91

WKH SULQFLSDO EDQGV REVHUYHG EHWZHHQ WKH DQG N'D PROHFXODU ZHLJKW PDUNHUV KDYH D VL]H RI WR N'D SURWHLQV )LJXUH f 7KH N'D SURWHLQ EDQG LV VHHQ DFURVV DOO ODQHV VHH WKH ORZHU RI EDQGV QH[W WR N'D PDUNHUf LQFOXGLQJ LQ WKH %/ ODQH f $ N'D SURWHLQ EDQG ZDV UHFRJQL]HG E\ DOO WKH 6/ VDPSOHV ODQHV f EXW QRW E\ %/ VDPSOHV ZKLFK FRUUHVSRQGV WR D SURWHLQ UHSRUWHG E\ $XVWLQ DQG FROOHDJXHV DV 6/ VSHFLILF DQG f 7KLV ILJXUH LV UHSUHVHQWDWLYH RI WKH UHVXOWV RI WKUHH EORWV XVLQJ GLIIHUHQW %/ DQLPDOV 1RQH RI WKH WKUHH %/ FRQWURO VHUD WHVWHG KDG DQWLERGLHV WKDW UHFRJQL]HG WKH N'D EDQG $XVWLQ DQG %RLVV\ f GHPRQVWUDWH WKDW WKH PHODQRF\WH VSHFLILF SURWHLQV RI WKH N'D UDQJH DUH 7US VSHFLILF 7KLV N'D SURWHLQ PD\ WKHUHIRUH EH 7US 5HJHQHUDWLQJ IHDWKHUV ZHUH SOXFNHG ELZHHNO\ DQG FROOHFWHG RI %/ DQG %/ VWDUWLQJ IURP WKH ILIWK PRQWK &U\RVHFWLRQV ZHUH SUHSDUHG DQG LPPXQRVWDLQHG IRU &' H[SUHVVLRQ XVLQJ PRXVH PRQRFORQDO DQWLERG\ DV UHIHUHQFHG LQ &KDSWHU (UI HW DO E &RRSHU HW DO f $V FRPSDUHG WR IHDWKHUV IURP D %/ FRQWURO FKLFNHQ WKH EDUE ULGJHV RI IHDWKHUV IURP %/ FRQWDLQHG D JUDGXDOO\ GHFUHDVLQJ DPRXQW RI PHODQLQ LQ WKH EDUE ULGJHV GDWD QRW VKRZQf 7KH ODVW VDPSOH WDNHQ HDUO\ LQ LWV ODVW PRQWK ZDV FRPSOHWHO\ ZLWKRXW PHODQLQ 7KLV VXJJHVWV WKDW LQ WKH %/ KRVW DQWLPHODQRF\WH O\PSKRF\WHV KDG SHQHWUDWHG EH\RQG WKH FRQILQHV RI WKH SXOS DQG LQYDGHG WKH EDUE ULGJHV WR GHVWUR\ DQG UHPRYH WKH PHODQRF\WHV DQG WKHLU SURGXFWV %/ VDPSOHV GLG QRW VKRZ WKHVH FKDQJHV DQG UHVHPEOHG WKH IXOO\ SLJPHQWHG EDUE ULGJHV RI WKH %/ FRQWURO 7KH WLVVXH VDPSOHV ZHUH SRRUO\ SUHVHUYHG GXH WR LPSURSHU IUHH]LQJ DQG VR FDQ QRW EH SXEOLVKHG 7KHVH ILQGLQJV LQ DGGLWLRQ WR WKH REYLRXV FKDQJH LQ SKHQRW\SH DQG WKH VHUXP

PAGE 92

DQWLERG\ SURILOH VXJJHVW VHYHUDO VDPSOHV RI HYLGHQFH RI WKH FKDQJHV LQGXFHG E\ WKH DGRSWLYH WUDQVIHU RI 6/ O\PSKRF\WHV LQ WKLV %/ KRVW 'LVFXVVLRQ $GRSWLYH WUDQVIHU H[SHULPHQWV RIWHQ FDQ SURYLGH D PHDQV WR VWXG\ WKH DXWRLPPXQH UHVSRQVH LQ YLYR LQ WKH LQWDFW RUJDQLVP :H XVHG WKLV H[SHULPHQWDO DSSURDFK WR GHWHUPLQH ZKHWKHU PHODQRF\WHVHQVLWL]HG O\PSKRF\WHV DQGRU DXWRDQWLERGLHV KDYH WKH FDSDFLW\ WR WUDQVIHU DPHODQRVLV LQ D QRQ6P\WK OLQH FKLFNHQ ,Q KLQGVLJKW WKLV SRUWLRQ RI P\ SURMHFW SUHVHQWHG QXPHURXV WHFKQLFDO FKDOOHQJHV IRU D FKLFNHQ DQLPDO PRGHO LQFOXGLQJ D UHODWLYH ODFN RI SXEOLVKHG SURWRFROV IRU DGRSWLYH WUDQVIHU UDGLDWLRQ GRVHV HWF 0RVW OLWHUDWXUH UHSRUWHG SURWRFROV LQ ZKLFK PLFH ZHUH VXSSUHVVHG VRRQ DIWHU VH[XDO PDWXULW\ ZHHNVf +RZHYHU FKLFNHQV DUH QRW VH[XDOO\ PDWXUH XQWLO WKH ILIWK RU VL[WK PRQWK DQG WKDW LV XQVXLWDEOH IRU WKH VWXG\ RI DPHODQRVLV LQ WKH 6/ 0RVW OLWHUDWXUH UHSRUWHG XVLQJ DSSUR[LPDWHO\ [ GRQDWHG FHOOV ZKHWKHU WKH FHOOV ZHUH ERQH PDUURZ FHOOV VSOHHQ RU O\PSK QRGH FHOOV 2XU H[SHULPHQWV LQYROYHG WKH WUDQVIHU RI XS WR O[O2 FHOOV KDG FRQVXOWHG VHYHUDO DXWKRULWLHV RQ WKH FKLFNHQ DQLPDO PRGHO EXW QHYHU IRXQG D VWDQGDUG SURWRFRO IRU WKH LPPXQRVXSSUHVVLRQ RI KRVWV RI FHOO WUDQVIHU WKDW DQVZHUHG VXFK TXHVWLRQV DV WR LWV QHFHVVLW\ E\ ZKLFK PHDQV DQG KRZ PXFK SHU DJH RU ZHLJKW RU RWKHU PHDVXUDEOH SDUDPHWHU 0RVW SXEOLVKHG PRXVH DQG UDW H[SHULPHQWV GLG XVH LUUDGLDWLRQ :LFNHU HW DO +DQDIXVD HW DO 3DQLWFK DQG 0F)DUOLQ YDQ GHU 9HHQ HW DO 7RLYDQHQ HW DO f 0LOOHU HW DO f VXEMHFWHG WR ZHHNROG 12' PRXVH UHFLSLHQWV ZLWK XS WR UDG RI LUUDGLDWLRQ +RZHYHU ZLWKLQ KRXUV WKH KRVWV

PAGE 93

ZHUH UHFRQVWLWXWHG ZLWK VSOHQRF\WHV ,Q RXU H[SHULPHQWV WKH LUUDGLDWLRQ RFFXUUHG WKH GD\ EHIRUH ,UUDGLDWLRQ ZDV SUREDEO\ QHFHVVDU\ EDVHG RQ WKH IDFW WKDW WKH DQLPDOV LQ RXU H[SHULPHQWV WKDW GLG GLVSOD\ LQGXFHG DPHODQRVLV KDG EHHQ LUUDGLDWHG /LNH HW DO f ZRUNLQJ RQ WKH DGRSWLYH WUDQVIHU RI GLDEHWHV LQ WKH ELREUHHGLQJ UDW FRQFOXGHG WKDW DQ fDQ LQWDFW LPPXQH V\VWHP SURWHFWV DJDLQVW DGRSWLYH WUDQVIHU DQG GLDEHWHV f DQG VR WKH\ VXJJHVWHG WKH UHTXLUHPHQW IRU LPPXQRVXSSUHVVLRQ $Q DOWHUQDWLYH WR LUUDGLDWLRQ WKDW FRXOG KDYH EHHQ XVHG LV F\FORSKRVSKDPLGH &\f ZKLFK KDV EHHQ XVHG WR LPPXQRVXSSUHVV WKH KRVWV LQ WKH PRXVH DQG UDW +DQDIXVD HW DO f DQG LQ WKH FKLFNHQ 7RLYDQHQ HW DO /HKWRQHQ HW DO *OLFN E\ SHUVRQDO FRPPXQLFDWLRQ DQG *OLFN 2ODK DQG *OLFN *OLFN f 7UDQVIHUULQJ XQIUDFWLRQDWHG VSOHQLF O\PSKRLG FHOOV SURGXFHG KLJKHU LQFLGHQFH RI LQVXOLWLV WKDQ 7 FHOO VXEVHWV LQ WKH PRXVH +DQDIXVD HW DO f $ ORJLFDO QH[W VWHS LQ RXU H[SHULPHQWV ZRXOG EH WR WUDQVIHU 7 FHOO VXEVHWV $V GHPRQVWUDWHG LQ YDULRXV VWXGLHV RI WKH VXEVHWV RI 7 FHOOV PHGLDWLQJ GLDEHWHV LQ WKH 12' PRXVH VRPH UHVHDUFKHUV UHSRUW WKH ERWK WKH &' DQG &' 7 FHOO VXEVHWV ZHUH QHFHVVDU\ WR WUDQVIHU GLDEHWHV LQWR UHFLSLHQWV 0LOOHU HW DO %HQGHODF HW DO f 0LWVXQREX HW DO f FRQFOXGHG WKDW &' 7 FHOOV FDXVH WKH LQVXOLWLV DQG WKDW WKH &' 7 FHOOV DFW DV PDWXUH NLOOHU FHOOV DJDLQVW WKH S FHOOV ZLWK WKH DLG RI &' 7 FHOOV 7KLV DELOLW\ WR GLVWLQJXLVK VHSDUDWH UROHV IRU GLIIHUHQW VXEVHWV RI FHOOV DV GHPRQVWUDWHG LQ WKH PRXVH VKRXOG EH SRVVLEOH LQ WKH 6/ FKLFNHQ PRGHO IRU DPHODQRVLV 0RXVH PRQRFORQDO DQWLERG\ UHDJHQWV VSHFLILF IRU 7 FHOOV H[SUHVVLQJ \ 7&5f DSYSL 7&5f DQG DSYS 7&5f &KHQ HW DO &KHQ HW DO &KDU HW DO f DUH DYDLODEOH 7KH FKLFNHQ KRPRORJXHV WR &' &' &' &' &' &'

PAGE 94

&' 0+& FODVV 0+& FODVV ,, DQG ,/ UHFHSWRU DUH DOVR UHFRJQL]HG E\ PRXVH PRQRFORQDO DQWLERGLHV &RRSHU HW DO f 1HJDWLYH VHOHFWLRQ E\ PHDQV RI FRPSOHPHQW O\VLV RI WKH QRQGHVLUHG 7 FHOO VXEVHWV RU SRVLWLYH VHOHFWLRQ XVLQJ PRXVH DQWL7&5 P$E DQG JRDW DQWLPRXVH FRQMXJDWHG WR PDJQHWLF EHDGV DUH HVWDEOLVKHG PHWKRGV $QRWKHU SRVVLELOLW\ ZRXOG UHTXLUH WKH LVRODWLRQ RI FORQDO SRSXODWLRQV IURP UHJHQHUDWLQJ IHDWKHUV XVLQJ &RQ$ DQG ,/ VWLPXODWHG 7 FHOO VXEVHWV .RHYDU\ HW DO 3DQLWFK DQG 0F)DUOLQ f 7KLV ZRXOG PRVW FORVHO\ UHVHPEOH WKH 7 FHOOV DW WKH VLWH RI PHODQRF\WH GHVWUXFWLRQ (UI HW DO Ef 7KHUH LV WKH LVVXH RI WKH XQNQRZQ IHDVLELOLW\ RI DGRSWLQJ WKLV WHFKQLTXH WR WKH FKLFNHQ LQ YLYR 1HYHUWKHOHVV WKH IDFW WKDW RXW RI %/ KRVWV bf DQG RXW RI %/ KRVWV bf VXUYLYHG ORQJ HQRXJK WR PDQLIHVW DPHODQRVLV E\ DGRSWLYH FHOO WUDQVIHU LQGLFDWHV WKDW WKH DPHODQRVLV IRXQG LQ WKH 6/ FKLFNHQV PD\ EH FHOOPHGLDWHG $ WRWDO RI %/ KRVWV RI 6/ VSOHQLF O\PSKRF\WHV ZHUH IROORZHG IURP DOO ILYH H[SHULPHQWV DQG RI WKHVH KRVWV bf EHFDPH DPHODQRWLF 7KLV LV QRW E\ FKDQFH FRQVLGHULQJ %/ FKLFNHQV QRUPDOO\ GHPRQVWUDWH RQO\ b FRPSDUDWLYHO\ 7KHVH UHVXOWV VXJJHVW WKDW WKH DXWRUHDFWLYH O\PSKRF\WHV DUH FDSDEOH RI UHFRJQL]LQJ %/ DV ZHOO DV 6/ PHODQRF\WHV DQG WKDW WKH 6/ PHODQRF\WH GHIHFW PD\ QRW EH UHTXLUHG IRU SDWKRJHQHVLV 7KH 7 FHOOPHGLDWHG PHODQRF\WH GHVWUXFWLRQ LQ YLWLOLJR ZRXOG UHVHPEOH WKH 7 FHOO PHGLDWHG GHVWUXFWLRQ RI SDQFUHDWLF 3 FHOOV LQ GLDEHWHV GHP\HOLQL]DWLRQ LQ P\HOLQ EDVLF SURWHLQLQGXFHG ($( DQG GHVWUXFWLRQ RI IROOLFXODU HSLWKHOLDO FHOOV LQ DXWRLPPXQH WK\URLGLWLV 7 FHOO LQYROYHPHQW KDV DOVR EHHQ VXJJHVWHG LQ WZR RWKHU DXWRLPPXQH FKLFNHQ FRQGLWLRQV KHUHGLWDU\ VFOHURGHUPD LQ WKH 8&' DQG 8&' OLQHV +D\QHV DQG

PAGE 95

*HUVKZLQ YDQ GHU :DWHU HW DO f DQG WK\URLGLWLV IRXQG LQ WKH 2EHVH VWUDLQ 26f FKLFNHQ %URZQ HW DO :LFN HW DO f 7KH REVHUYDWLRQ WKDW DGRSWLYH WUDQVIHU RI 6/ O\PSKRF\WHV PD\ FDXVH DPHODQRVLV LQ %/ KRVWV LV VLJQLILFDQW LQ SDUW EHFDXVH SUHYLRXV DXWKRUV RQ WKH DPHODQRVLV RI WKH 6/ FKLFNHQ KDYH RYHUHPSKDVL]HG WKH UROH RI DXWRDQWLERG\ EDVHG RQ VWXGLHV RI EXUVHFWRP\ DQG FRUWLFRVWHURLG LQKLELWLRQ RI DPHODQRVLV /DPRQW DQG 6P\WK %R\OH HW DO f ,W LV DOVR LQWHUHVWLQJ WR QRWH WKDW WKH ZHVWHUQ EORW DQDO\VLV GHPRQVWUDWHG WKDW WKH %/ DGRSWLYH FHOO KRVWV KDG WKH VDPH DQWLPHODQRF\WH VHUXP DQWLERG\ SURILOH DV WKH W\SLFDO 6/ VHUXP 7KLV UHVXOW VXJJHVWV WKDW HLWKHU f PHODQRF\WHUHDFWLYH 6/ % FHOOV ZHUH WUDQVIHUUHG RU f PHODQRF\WHUHDFWLYH 6/ 7 KHOSHU FHOOV LQGXFHG %/ % FHOOV WR SURGXFH DQWLPHODQRF\WH DXWRDQWLERGLHV 2QH PXVW FRQVLGHU WKH SRVVLELOLW\ WKDW WKH %/ KRVWV WKDW EHFDPH DPHODQRWLF DV D UHVXOW RI WKH FHOO WUDQVIHUV PD\ DFWXDOO\ KDYH EHHQ VXVFHSWLEOH WR DPHODQRVLV JLYHQ WKH WR b LQFLGHQFH RI DPHODQRVLV LQ WKH %/ 7KH LQWURGXFWLRQ RI DXWRUHDFWLYH 6/ O\PSKRF\WHV PD\ KDYH fWLSSHG WKH VFDOHf LQ IDYRU RI GLVHDVH LQ WKHVH LQGLYLGXDOV 7KLV LV WKH FRQFOXVLRQ WKDW DGRSWLYH WUDQVIHU RI VSOHQRF\WHV LQ WKH 12' PLFH DFFRPSOLVKHG LQ WKH ZRUN E\ :LFNHU HW DO f 7KH UHSHWLWLYH DGPLQLVWUDWLRQV WR WKH %/ KRVWV ZLWK WKH WUDQVIHU RI 6/VHQVLWL]HG 7 FHOOV RU DXWRDQWLERGLHV GXULQJ WKH WLPH SHULRG GXULQJ ZKLFK DPHODQRVLV KDV QRUPDOO\ RFFXUUHG LQ WKH 6/ GRQRUV DSSHDUHG WR EH D ORJLFDO DSSURDFK WR LQGXFLQJ DPHODQRVLV DQG VKRXOG EH GRQH LQ FRPELQDWLRQ ZLWK LPPXQRVXSSUHVVLRQ )XWXUH VWXGLHV VKRXOG LQFOXGH WKHVH WZR FRQGLWLRQV 5HFDOO WKDW LQ WKH ILUVW H[SHULPHQW WKH %/ KRVWV ZHUH LPPXQH VXSSUHVVHG DQG ZHUH JLYHQ RQH WUDQVIHU RI FHOOV UHVXOWLQJ LQ ILYH %/ UHFLSLHQWV WKDW

PAGE 96

GLVSOD\HG WKH DPHODQRWLF SKHQRW\SH WR VRPH GHJUHH 7KH VHULDO WUDQVIHU H[SHULPHQWV DQG f ZLWK ROGHU ZHHNROGf QRWLPPXQHFRPSURPLVHG KRVWV ZHUH JLYHQ XS WR UHSHDWHG WUDQVIHUV RI GRQDWHG 6/ FHOOV 6WLOO WKH\ KDG QRW GLVSOD\HG D KLQW RI DPHODQRVLV LQ D VLWXDWLRQ ZH DQWLFLSDWHG ZRXOG KDYH DQ HDUOLHU RQVHW )XWXUH H[SHULPHQWV VKRXOG LQYROYH ERWK LPPXQRVXSSUHVVLRQ E\ LUUDGLDWLRQ DQG VHULDO WUDQVIHUV 3UHYLRXV DWWHPSWV WR LQGXFH DQ DXWRLPPXQH GLVHDVH E\ LQMHFWLRQ RI DQWLVHUD LQ QRUPDO FKLFNHQV KDYH EHHQ XQVXFFHVVIXO -DURV]HZVNL HW DO f $QWLWK\URJOREXOLQ DQWLVHUD IURP 26 FKLFNHQ VXIIHULQJ IURP WK\URLGLWLV ZHUH WUDQVIHUUHG WR WKH QRUPDO &RUQHOO VWUDLQ EXW IDLOHG WR LQGXFH WK\URLGLWLV GHVSLWH WKH IDFW WKDW WKH\ VKDUH WKH VDPH % DOOHOHV DW WKH 0+& ORFXV ,PPXQRFRPSURPLVLQJ WKHVH &RUQHOO UHFLSLHQWV GLG QRW KHOS HYHQ WKRXJK QHRQDWDO WK\PHFWRP\ GLG SRWHQWLDWH WKH VHYHULW\ RI WK\URLGLWLV LQ 26 FKLFNHQV :LFN HW DO f DV LPPXQRVXSSUHVVLRQ VHHPHG WR KDYH GRQH IRU RXU FHOO WUDQVIHU H[SHULPHQWV 7LPLQJ RI WKH WUDQVIHUV PD\ KDYH DQ LQIOXHQFH RQ WKH VXFFHVV :LFNHU HW DO f QRWLFHG WKDW WKH\ ZHUH XQDEOH WR WUDQVIHU GLDEHWHV XVLQJ VSOHQRF\WHV LI WKH 12' LUUDGLDWHG PLFH ZHUH OHVV WKDQ RU HTXDO WR ZHHNV ROG EXW ZHUH PXFK PRUH HIIHFWLYH ZLWK WUDQVIHUV WR KRVWV WKDW ZHUH VOLJKWO\ ROGHU WKDQ ZHHNV RI DJH )RU WKH 6P\WK OLQH FKLFNHQ SHUKDSV WKH WUDQVIHUV QHHGHG WR EH LQLWLDWHG HDUOLHU IRU ERWK RXU FHOO DQG KXPRUDO DGPLQLVWUDWLRQV 3HUKDSV LQ YLWUR VWLPXODWLRQ RI WKH VSOHQRF\WHV ZLWK OHFWLQV RU PHODQRF\WH IUDJPHQWV LQ WKH GRQRU PD\ KHOS 7DNHQDND HW DO 0F&DUURQ DQG 0F)DUOLQ f &HOO WUDQVIHUV KDYH EHHQ VXFFHVVIXO IURP ERQH PDUURZ DQG PDWXUH VSOHQRF\WHV RU O\PSK QRGH FHOOV 2XU XWLOL]DWLRQ RI UHSHDWHG WUDQVIHUV RI FHOOV RU JDPPD JOREXOLQ DQG WKH FRQFHQWUDWLRQ RI WKH LPPXQRJOREXOLQV XVHG VKRXOG KDYH DGGUHVVHG WKH

PAGE 97

SUREOHP RI PDLQWDLQLQJ KLJK HQRXJK FRQFHQWUDWLRQV RI HIIHFWRU FHOOV RU DQWLERGLHV RYHU ORQJ HQRXJK SHULRGV RI WLPH D SUREOHP HQFRXQWHUHG E\ RWKHUV LQ VHUXP WUDQVIHU H[SHULPHQWV ,QRXH HW DO f ,Q VXPPDU\ WKH H[SHULPHQWV LQYROYLQJ WKH DGRSWLYH WUDQVIHU RI 6/ VSOHQRF\WHV LQWR WKH %/ KRVWV VXJJHVWV WKDW DPHODQRVLV FDQ EH WUDQVIHUUHG DQG PD\ EH D FHOOPHGLDWHG DXWRLPPXQH SURFHVV 7KH UROH RI WKH DVVRFLDWHG DXWRLPPXQH DQWLERGLHV PD\ QRW EH DV FOHDU :KHWKHU DXWRDQWLERGLHV FDQ FDXVH RU WULJJHU WKH GHVWUXFWLRQ RI WKH PHODQRF\WHV LQ %/ KRVWV ZDV QRW DSSDUHQW ,Q GLDEHWHV DXWRLPPXQH DQWLERGLHV DJDLQVW LVOHW FHOOV LV D GLVWLQJXLVKLQJ IHDWXUH RI WKH GLVHDVH SUHFHGHV WKH RQVHW RI WKH GLVHDVH DUH VSHFLILF WR WKH N'D DXWRDQWLJHQ *$' DQG FDQ EH XVHG DV SUHGLFWLYH PDUNHUV RI SDWLHQWV VXVFHSWLEOH WR WKH GLVHDVH 7KLV OLNHZLVH PD\ EH D VLPLODU VLWXDWLRQ ZLWK WKH DXWRDQWLERGLHV LQ WKH 6/ FKLFNHQ 7KH UROH RI WKH DXWRDQWLERGLHV LQ GLDEHWHV DV D SULPDU\ LQGXFHU RI GLDEHWHV KDV QRW \HW EHHQ SURYHQ

PAGE 98

&+$37(5 7 &(// 5(&(3725 \ 5(3(572,5( $1$/<6,6 2) 7+( (;3$1'(' 3(5,3+(5$/ %/22' \ 7 &(// 3238/$7,21 '85,1* $9,$1 9,7,/,*2 ,QWURGXFWLRQ 0DQ\ DXWRLPPXQH GLVHDVHV DUH 7 FHOOGHSHQGHQW ZKLFK LQ SDUW FDQ EH GHWHUPLQHG E\ WKH VWXG\ RI 7&5 JHQHV 7 FHOO UHFHSWRUV FDQ JHQHUDWH XS WR WRWDO UHFHSWRU VSHFLILFLWLHV E\ FRPELQDWRULDO DQG MXQFWLRQDO GLYHUVLW\ -DQHZD\ DQG 7UDYHUV f DOWKRXJK PXFK RI WKLV GLYHUVLW\ LV ORVW GXULQJ WK\PLF HGXFDWLRQ GXULQJ WKH LQGXFWLRQ RI FHQWUDO WROHUDQFH 'XULQJ DQ LPPXQH UHVSRQVH 7 FHOOV UHVSRQG LQ D FORQDO IDVKLRQ GXH WR 7&5 UHFRJQLWLRQ RI DQWLJHQLF SHSWLGHV 6LPLODUO\ GXULQJ DQ DXWRLPPXQH UHVSRQVH D IUDFWLRQ RI 7 FHOOV PD\ EH FORQDOO\ H[SDQGHG LQ UHVSRQVH WR VHOIDQWLJHQ 7KH 7 FHOO UHVSRQVH PD\ EH GHVFULEHG DV f SRO\FORQDO LQ ZKLFK PDQ\ 7 FHOO FORQHV DUH UHFUXLWHG LQ WKH UHVSRQVH f ROLJRFORQDO LQ ZKLFK D VPDOO QXPEHU RI 7 FHOO FORQHV H[SDQG RU f PRQRFORQDO LQ ZKLFK RQH VSHFLILF FORQH UHVSRQGV ([SHULPHQWDOO\ WKLV FDQ EH VWXGLHG E\ 7&5 UHSHUWRLUH DQDO\VLV RI D 7 FHOO SRSXODWLRQ 7KH LGHQWLILFDWLRQ RI UHFXUUHQW 7&5 VHTXHQFHV ZLWK WKH VDPH RU VLPLODU &'5f LQ ODUJH 7 FHOO SRSXODWLRQV SURYLGHV HYLGHQFH IRU DQWLJHQGULYHQ H[SDQVLRQ 7 FHOOV SUHVHQW LQ DFXWH JUDIWYHUVXVKRVWGLVHDVH RI WDUJHW RUJDQV VNLQ OLYHU DQG LQWHVWLQHf LQ +/$PDWFKHG DOORJHQHLF ERQH PDUURZ WUDQVSODQWV H[SUHVV SUHGRPLQDQWO\

PAGE 99

WKH D3 7&5 'LHWULFK HW DO f 7KH 7&5 9D DQG 9S XVDJH LQ ERWK VNLQ DQG EORRG DSSHDUHG XQUHVWULFWHG EXW ZLWK RYHUH[SUHVVLRQ XQLTXH WR HDFK SDWLHQW RI D IHZ 9D DQG 9S JHQH VHJPHQWV LQ WKH VNLQ DV FRPSDUHG WR EORRG 7R DYRLG WKH SRVVLELOLW\ WKDW D QRQVSHFLILF LQIODPPDWRU\ UHVSRQVH ZRXOG PDVN GHWHFWLRQ RI D FORQDO 7 FHOO H[SDQVLRQ 'LHWULFK DQG FROOHDJXHV FRQFHQWUDWHG RQ RQH SDWLHQW (YLGHQFH IRU WKH UHSHDWHG XVDJH RI DW OHDVW ILYH VSHFLILF 7&5 9DO DQG 9SL WUDQVFULSWV ZLWK &'5 RI XQLTXH OHQJWK DQG VHTXHQFH LQGLFDWHG DQ ROLJRFORQDO H[SDQVLRQ LQ WKH VNLQ ZLWK VSHFLILF 9 JHQHV RYHUH[SUHVVHG DV FRPSDUHG WR WKH EORRG ZKLFK DOVR VKRZHG VRPH RI WKH VDPH UHFXUUHQW 7&5 WUDQVFULSWV EXW WR D OHVVHU GHJUHH (YHQ ZKHQ JHQHWLFDOO\ LGHQWLFDO PLFH DUH UDLVHG LQ WKH VDPH HQYLURQPHQW PXULQH LQWHVWLQDO LQWUDHSLWKHOLDO O\PSKRF\WHV ,(/f GLVSOD\ XQLTXH ROLJRFORQDO UHSHUWRLUHV $V FRPSDUHG WR O\PSK QRGH 9S H[SUHVVLRQ RI D3 7&5 ,(/V LV ROLJRFORQDO DV LQGLFDWHG E\ SURPLQHQW DQG GLVWLQFW VXEVHWV RI FORQDO SRSXODWLRQV RI ,(/V GHWHFWHG DV SHDNV LQ WKHLU &'5 OHQJWK DQDO\VLV 5HJQDXOW HW DK f 7KLV FRQWUDVWHG ZLWK WKH SRO\FORQDO UHSHUWRLUH RI UHVSHFWLYH 7 FHOOV LQ WKH O\PSK QRGHV /LNHZLVH KXPDQ ,(/V RI ILYH SDWLHQWV ZHUH FRPSDUHG %OXPEHUJ HW DK f 7KH GRPLQDQW 9S RI WKH ,(/V LQ SDWLHQW ZDV 9S DQG HYHU\ 9S LVRODWHG ZDV LGHQWLFDO 7KH GRPLQDQW 9S LQ SDWLHQW VKRZHG RQH 9SL WZR 93 FORQHV DQG DQ ROLJRFORQDO H[SDQVLRQ RI 9S DQG 9S 3DWLHQW GLVSOD\HG HLWKHU PRQRFORQDO RU ROLJRFORQDO GRPLQDQW 9S JHQH H[SUHVVLRQ 7KLV ZDV LQ FRQWUDVW WR D WRWDOO\ SRO\FORQDO 7&5 UHSHUWRLUH LQ WKH 3%/ VDPSOLQJ ZKHUH QR VHTXHQFH ZDV UHSHDWHG 7KHUHIRUH RQH RU D VPDOO QXPEHU RI GRPLQDQW FORQHV DSSHDU WR FRPSULVH WKH PDMRULW\ RI ,(/ 7KH FRQFOXVLRQV DUH WKDW

PAGE 100

PRVW ,(/V DUH FORQDOO\ H[SDQGHG H[SUHVV D VPDOO QXPEHU RI GLIIHUHQW 9S JHQHV DQG PD\ UHFRJQL]H D OLPLWHG QXPEHU RI DQWLJHQV %OXPEHUJ DQG FROOHDJXHV VXJJHVW WKDW WKLV VPDOO 7 FHOO UHSHUWRLUH ZRXOG VXIILFH LI WKH WDUJHW DQWLJHQV ZHUH FRQVHUYHG VXFK DV EDFWHULDO KHDW VKRFN SURWHLQV RU D VPDOO QXPEHU RI HQGRJHQRXV DQWLJHQV H[SUHVVHG E\ ,(/V LQ UHVSRQVH WR LQMXU\ 6LPLODU WR WKH UHSRUW RI 'LHWULFK HW DO f RQ KXPDQ 7 FHOO UHSHUWRLUHV WKH ,(/ FORQDO H[SDQVLRQ LV XQLTXH WR HDFK LQGLYLGXDO WKHUH ZHUH QR VKDUHG FORQDO VHTXHQFHV .RXULOVN\ DQG FRZRUNHUV DSSOLHG WKHLU KLJK UHVROXWLRQ 3&5EDVHG PHWKRG RI GHWHUPLQLQJ DQG IROORZLQJ WKH 7&5 UHSHUWRLUH LQ KHWHURJHQHRXV FHOO SRSXODWLRQV RI WXPRULQILOWUDWLQJ O\PSKRF\WHV 7,/Vf LQ KXPDQ PHODQRPDV 5HVXOWV FRQILUPHG FORQDO H[SDQVLRQV LQ D UDWKHU FRPSOH[ SRO\FORQDO EDFNJURXQG 'HWHFWLRQ RI FORQDO 7 FHOO H[SDQVLRQV EHIRUH GXULQJ DQG DIWHU WUHDWPHQW LV IDFLOLWDWHG XVLQJ WKLV PHWKRG RI 3&5 GHWHFWLRQ RI MXQFWLRQDO GLYHUVLW\ LQ WHUPV RI &'5 OHQJWK DQG VHTXHQFH FORQDOLW\ 3XLVLHX[ HW DO f ,Q WKH 6P\WK OLQH FKLFNHQ WKH PHODQRF\WHV ZKLFK DUH ORFDWHG LQ GHYHORSLQJ IHDWKHUV DQG WKH FKRURLG OD\HU RI WKH H\H DSSHDU WR EH WKH WDUJHW RI ERWK 7 DQG % FHOO PHGLDWHG DXWRLPPXQH UHVSRQVHV 6P\WK f &U\RVHFWLRQV RI WKH UHJHQHUDWLQJ IHDWKHUV GLVSOD\ DQ LQWHQVH 7 FHOO LQILOWUDWLRQ LQFOXGLQJ ERWK DS DQG \ 7 FHOO OLQHDJHV (UI HW DO Ef ,Q DGGLWLRQ \ 7 FHOOV DUH IRXQG LQ LQFUHDVHG SURSRUWLRQV LQ WKH SHULSKHUDO EORRG RI ZHHNROG 6/ FKLFNHQV bf DV FRPSDUHG WR 0+&PDWFKHG SDUHQWDO %/ FKLFNHQV bf (UI HW DO f 7KLV REVHUYDWLRQ LV HVSHFLDOO\ LQWULJXLQJ JLYHQ WKH IDFW WKH FKLFNHQV KDYH D VLJQLILFDQWO\ JUHDWHU SURSRUWLRQ RI \ 7 FHOOV ZLWKLQ WKH 3%/

PAGE 101

FRPSDUWPHQW WKDQ KXPDQV DQG PLFH HJ b LQ FKLFNHQ DQG b LQ KXPDQ DQG PRXVH %XH\ HW DO f 2QH SRVVLEOH H[SODQDWLRQ IRU WKH H[SDQVLRQ RI 3%/ \ 7 FHOOV LV WKDW PHODQRF\WH DXWRDQWLJHQV FDXVHG DQ DQWLJHQGULYHQ FORQDO H[SDQVLRQ LQ WKH WDUJHW WLVVXHV 7KH SHULSKHUDO EORRG ZLWK LWV KLJKHU SURSRUWLRQ RI \ 7 FHOOV PD\ UHIOHFW WKLV FORQDO H[SDQVLRQ RI \ 7 FHOOV LQILOWUDWLQJ WKH IHDWKHUV LQ WKH 6/ FKLFNHQ HLWKHU DV D fVSLOOn RYHUf HIIHFW IURP WKH WDUJHW WLVVXHV 7KLV ZDV REVHUYHG LQ WKH UHSUHVHQWDWLRQ RI FHUWDLQ 9DLO DQG 9SL 7&5 WUDQVFULSWV LQ WKH EORRG UHIOHFWLQJ WKH fVSLOORYHUf RI 7 FHOOV LQILOWUDWLQJ WKH VNLQ GXULQJ KXPDQ *9+' 'LHWULFK HW DO f \ 7 FHOOV UHSUHVHQW RQO\ b RI WKH QRUPDO PDPPDOLDQ SHULSKHUDO EORRG 7 FHOO SRSXODWLRQ DQG WKH\ DUH EHOLHYHG WR EH LQYROYHG LQ LPPXQLW\ WR LQIHFWLRXV GLVHDVH +DDV HW DO 0RGOLQ HW DO 0RPEDHUWV HW DO f $ UROH IRU \ 7 FHOOV LQ WKH SDWKRJHQHVLV RI DXWRLPPXQH GLVHDVH KDV EHHQ VXJJHVWHG GXH WR WKHLU UHDFWLYLW\ WR VWUHVV SURWHLQV .DXIPDQ f DQG E\ WKH DFFXPXODWLRQ RI \ 7 FHOOV LQ DIIHFWHG RUJDQV DQG SHULSKHUDO EORRG )RU H[DPSOH LQ V\VWHPLF VFOHURVLV \ 7 FHOOV H[SUHVVLQJ WKH 7&5 9JHQH VHJPHQW DUH H[SDQGHG LQ ERWK 3%/ DQG WKH OXQJV DQG KDYH UHVWULFWHG MXQFWLRQDO GLYHUVLW\ LQ WHUPV RI &'5 OHQJWK DQG VHTXHQFH
PAGE 102

LQGLYLGXDOV ZLWK SUHIHUHQWLDO 9\ DQG 9 JHQH H[SUHVVLRQ EXW KHWHURJHQHRXV FORQDO RULJLQV 6WLQLVVHQ HW DO f 6\VWHPLF OXSXV HU\WKHPDWRVXV SDWLHQWV DUH UHSRUWHG WR H[SUHVV D GLYHUVH 3%/ 9\ UHSHUWRLUH EXW DQ ROLJRFORQDO 9\ UHSHUWRLUH UHVWULFWHG LQ WHUPV RI 9\ JHQH XVDJH DQG MXQFWLRQDO GLYHUVLW\ 2OLYH HW DK f )LQDOO\ LQFUHDVHG OHYHOV RI SHULSKHUDO EORRG \E 7 FHOOV KDYH EHHQ FRUUHODWHG ZLWK LQFUHDVHG ULVN IRU LQVXOLQGHSHQGHQW GLDEHWHV /DQJ HW DK f 7DNHQ WRJHWKHU WKHVH UHSRUWV VXJJHVW D SRVVLEOH UROH IRU \ 7 FHOOV LQ WKH GHYHORSPHQW RI DXWRLPPXQH GLVHDVHV RU DVVRFLDWHG LQIODPPDWRU\ SURFHVVHV :H WHVWHG WKH K\SRWKHVLV WKDW WKH H[SDQGHG 3%/ \ 7 FHOO UHSHUWRLUH LV LQYROYHG LQ WKH SDWKRJHQHVLV RI YLWLOLJR LQ WKH FKLFNHQ DQLPDO PRGHO E\ FKDUDFWHUL]LQJ WKH H[SUHVVHG 7&5\ UHSHUWRLUH E\ QXFOHRWLGH VHTXHQFH DQDO\VLV RI 9\ JHQHV H[SUHVVHG LQ 3%/ RI 0+&PDWFKHG 6/ FKLFNHQV ZLWK DFWLYH YLWLOLJR DQG FRQWURO %/ FKLFNHQV 7KH FKLFNHQ 7&5\ ORFXV FRQVLVWV RI WKUHH IDPLOLHV RI 9\ JHQHV -\ JHQHV DQG D VLQJOH &\ JHQH VHJPHQW 6L[ HW DK f WKXV DOORZLQJ 7&5 9\ UHSHUWRLUH DQDO\VLV LQ WKH FKLFNHQ DQLPDO PRGHO 0DWHULDOV DQG 0HWKRGV $QLPDOV %UHHGLQJ FRORQLHV ZHUH HVWDEOLVKHG IRU WKH %AO VXEOLQH RI WKH 6/ DQG %/ IURP IHUWLOH HJJV JHQHURXVO\ SURYLGHG E\ 5REHUW 6P\WK -U 8QLYHUVLW\ RI 0DVVDFKXVHWWV DW $PKHUVWf &KLFNHQV ZHUH UDLVHG DW WKH 8QLYHUVLW\ RI )ORULGD 3RXOWU\ 6FLHQFH 8QLW 7KH 6/ DQG %/ FKLFNHQV XVHG LQ WKLV VWXG\ ZHUH 0+&PDWFKHG DQG DOO RI WKH %AO VXEOLQH ZKLFK LV FKDUDFWHUL]HG E\ WKH PRUH VHYHUH IRUP RI YLWLOLJR LQ WKLV DQLPDO PRGHO 7KH GHJUHH RI SLJPHQW ORVV DPHODQRVLVf ZDV FODVVLILHG DFFRUGLQJ WR WKH IROORZLQJ VFDOH DIWHU

PAGE 103

(UI HW DO Ef f QRUPDO QR DSSDUHQW DPHODQRVLV f PL[HG DPHODQRVLV ZLWK ERWK QRUPDO DQG b DPHODQRWLF IHDWKHU WLVVXH f PL[HG DPHODQRVLV ZLWK QRUPDO DQG b DPHODQRWLF IHDWKHU WLVVXH f PL[HG DPHODQRVLV ZLWK QRUPDO DQG !b DPHODQRWLF IHDWKHU WLVVXH DQG f FRPSOHWH DPHODQRVLV DOO GHYHORSLQJ IHDWKHULQJ WLVVXH LV DPHODQRWLF 573&5 DQG FORQLQJ 3HULSKHUDO EORRG O\PSKRF\WHV ZHUH LVRODWHG IURP KHSDULQL]HG EORRG VDPSOHV FROOHFWHG IURP WKH EUDFKLDO YHLQ E\ )LFROO+\SDTXH GHQVLW\ FHQWULIXJDWLRQ 7RWDO 51$ ZDV SUHSDUHG XVLQJ 51HDV\ FROXPQV 4LDJHQ &RUSf DQG HOXWHG LQ 51DVHIUHH GLVWLOOHG ZDWHU 7RWDO F'1$ ZDV V\QWKHVL]HG XVLQJ UDQGRP SULPHUV DQG 6XSHUVFULSW,, UHYHUVH WUDQVFULSWDVH DFFRUGLQJ WR WKH VXSSOLHU *LEFR%5/f 5HDUUDQJHG FKLFNHQ 9\ JHQHV ZHUH DPSOLILHG E\ UHYHUVH WUDQVFULSWDVH SRO\PHUDVH FKDLQ UHDFWLRQ 573&5f DV SUHYLRXVO\ GHVFULEHG 6L[ HW DO f XVLQJ WKH IROORZLQJ 9\ IDPLO\VSHFLILF IRUZDUG SULPHUV DQG D &\ UHYHUVH SULPHU 9\O *&7&7$*$&7*$$*&&7**77*&$7&&n 9\ n*&7&7$*$&&&$7$&$*$*&&&7*7$7&&n 9\ n*&7&7$*$*&$*$&$$&$7*&7*&7*n &\ n&&7**$7&&777&$7$$77&7&7**7*&7*? 3&5 UHDFWLRQV ZHUH SHUIRUPHG LQ SL ZLWK XQLWV 7DT SRO\PHUDVH DQG EXIIHU SURYLGHG ZLWK WKH HQ]\PH %RHKULQJHU 0DQQKHLP %LRFKHPLFDOVf F'1$ WHPSODWH P0 G173V DQG SPROHV RI HDFK SULPHU IRU F\FOHV RI VHF DW r& VHF DW r& DQG VHF DW r& 573&5 SURGXFWV ZHUH FORQHG LQWR WKH YHFWRU S%OXHVFULSW,,

PAGE 104

6WUDWDJHQHf XVLQJ UHVWULFWLRQ VLWHV EXLOW LQWR WKH 3&5 SULPHUV RU FORQHG LQWR S1R7$7 XVLQJ D 3ULPH 3&5 &ORQHU FORQLQJ NLW 3ULPH 3ULPH ,QFf E\ EOXQWHQG OLJDWLRQ &ORQHV ZHUH VHOHFWHG E\ EOXHZKLWH VHOHFWLRQ DQG E\ VL]H DQDO\VLV RI DPSOLILHG LQVHUWV E\ DJDURVH JHO HOHFWURSKRUHVLV ,QGLYLGXDO FORQHV ZHUH VHTXHQFHG XVLQJ GLGHR[\QXFOHRWLGH F\FOHVHTXHQFLQJ NLWV $SSOLHG %LRV\VWHPV ,QFRUSf DQG 7 DQG 7 SULPHUV 1RQLQFRUSRUDWHG G\H WHUPLQDWRUV ZHUH UHPRYHG RQ &HQWUL6HS VSLQ FROXPQV 3ULQFHWRQ 6HSDUDWLRQV $GHOSKLD 1-f DQG UHDFWLRQV ZHUH DQDO\]HG RQ DQ $SSOLHG %LRV\VWHPV 0RGHO $ '1$ VHTXHQFHU &KURPDWRJUDPV ZHUH DQDO\]HG XVLQJ $SSOLHG %LRV\VWHPV VRIWZDUH '1$ VHTXHQFH FRPSDULVRQV )RU VHTXHQFH FRPSDULVRQV RQO\ VHTXHQFHV ZLWK RSHQ UHDGLQJ IUDPHV ZHUH LQFOXGHG LQ WKH DOLJQPHQWV :H KDYH UHFHQWO\ GHVFULEHG UHIHUHQFH VHTXHQFHV IRU WKH 9\O 9\ DQG 9\ IDPLOLHV DV ZHOO DV LQGLYLGXDO 9\ IDPLO\ PHPEHUV 6L[ HW DO f 7KH $/,*1 3OXV SURJUDP YHUVLRQ 6FLHQWLILF t (GXFDWLRQDO 6RIWZDUHf ZDV XVHG IRU LQLWLDO VHTXHQFH DOLJQPHQWV 5HVXOWV 3KHQRW\SH RI ELUGV XVHG IRU UHSHUWRLUH DQDO\VLV 7KH SKHQRW\SHV RI WKH 6/ FKLFNHQV VHOHFWHG IRU WKLV VWXG\ DUH VKRZQ LQ 7DEOH 7DEOH $PHODQRVLV 6WDJH RI 6P\WK /LQH &KLFNHQV DW $JHV :HHNV $QLPDO Z Z O2Z Z Z Z 6, 6 6 6

PAGE 105

7ZR ELUGV 6, DQG 6f ZHUH FKDUDFWHUL]HG E\ HDUO\ RQVHW RI DPHODQRVLV SULRU WR ZHHNV RI DJH DQG WKUHH RI IRXU 6/ ELUGV ZHUH FRPSOHWHO\ DPHODQRWLF DW WKH WLPH RI 3%/ FROOHFWLRQ DW ZHHNV RI DJH $V FRQWUROV 3%/ ZHUH XVHG IURP WZR DJHPDWFKHG %/ FKLFNHQV ZKLFK KDG QRUPDO SOXPDJH 7&5 9\ UHSHUWRLUH DQDO\VLV 5HDUUDQJHG 9\O 9\ DQG 9\ JHQHV ZHUH DPSOLILHG E\ 573&5 IURP 3%/ P51$ FORQHG LQWR D SODVPLG YHFWRU DQG LQGLYLGXDO FORQHV ZHUH VHTXHQFHG $ WRWDO RI UHDUUDQJHG 9\ JHQHV ZHUH VHTXHQFHG IURP WKH 3%/ RI %/ DQG 6/ FKLFNHQV 7KLUWHHQ VHTXHQFHV ZHUH HOLPLQDWHG GXH WR WKH SUHVHQFH RI VWRS FRGRQV RU IUDPHVKLIWV LQ &'5 7KH SUHVHQFH RI WKHVH FORQHV ZDV QRW XQH[SHFWHG EHFDXVH WKH 3%/ ZHUH QRW SUHHQULFKHG IRU \ 7 FHOOV DQG QRQSURGXFWLYH 7&5\ JHQH UHDUUDQJHPHQWV ZRXOG EH H[SHFWHG LQ WKH WRWDO 3%/ SRSXODWLRQ IURP DS DV ZHOO DV \ 7 FHOOV 7KH ILUVW LQGLFDWLRQ RI WKH KHWHURJHQHRXV FORQDOLW\ RI WKH FORQHG 9\ JHQHV IURP ERWK %/ DQG 6/ ZDV LQGLFDWHG E\ WKH IDFW WKDW RQO\ VHTXHQFHV ZHUH UHSHDW VHTXHQFHV LH LGHQWLFDO WR RWKHU FORQHV GHULYHG IURP WKH VDPH DQLPDO 3DUWLDO QXFOHRWLGH VHTXHQFHV IRU WKH 9\ IUDPHZRUN UHJLRQ )5f FRPSOHPHQWDULW\ GHWHUPLQLQJ UHJLRQ &'5f LH WKH 9\-\ MXQFWLRQf DQG )5 HQFRGHG E\ WKH -\ JHQH VHJPHQWf DUH VKRZQ LQ )LJXUHV DQG IRU 9\O 9\ DQG 9\ IDPLOLHV UHVSHFWLYHO\ %/ DQG 6/ 9\ VHTXHQFHV DUH DOLJQHG ZLWK UHIHUHQFH VHTXHQFHV ZH KDYH UHFHQWO\ GHVFULEHG IRU 9\ JHQH IDPLOLHV LQ :KLWH /HJKRUQ :/f FKLFNHQV 6L[ HW DO f ,GHQWLFDO VHTXHQFHV ZHUH REWDLQHG IURP GLIIHUHQW DQLPDOV LQ RQO\ WZR FDVHV 7ZR LGHQWLFDO 9\ VHTXHQFHV ZHUH REWDLQHG IURP WZR GLIIHUHQW %/

PAGE 106

$VS 7\U7\U&\V 9\O 7$7$&$7&77&&$$$$7****$$7$$$$7&7*&$&7&7&7&$*77&$$*$&$7$**7*$7*$7*$7$$$**7$&&7$&7$&7*7 9\O% 9\O% 9\O% 9\O% 77* $7 *7$ 7* 9\O% 77* $7 *7$ 7* 9\O% 77* $7 *7$ 7* 9\O% 77* $7 *7$ 7* 9\O% 9\O6 9\O6 9\O6 9\O6 9\O6O 9\O6O 9\O6O 9\O6 9\O6O 9\O6O 77* $7 *7$ 7* & & F F F F F * & F 77* $7 *7$ 7* 9\O6 77* $7 *7$ 7*

PAGE 107

1 UHJLRQ 3KH*O\ *O\ -\ 9\O *&&7$&7***$*7& $&*$7 &&**$7$77$&7$&$$$*7777&**&7&7**7$&$$$*&7&$77*7$7&$*$& 9\O% 9<% 9\O% 9\O% 9\O% *&77&7$ &$B55$7 7$& $$ $ 7 & &$ *7&*7$ 7$7$7*&$**$7 7$& $$ $ 7 & &$ &&** $7***7** $ $ 7 $$* $ 7 $7 7 $7***7** $ $ 7 $$* $ 7 $7 7 7 $7$7&**77* *$7 & 9\O% 9\O% 9\O% 9\O6 9\O6 7$& 7$$*$&&7* *$7 $ &*7$7$&2I 7** $ $ 7 $$* $ 7 $7 7 **7**$*$**&$7 $**$7 7$& $$ $ 7 & &$ 9\O6 9\O6 9\O6OO 9\O6O 9\O6O 9\O6 9\O6O 9\O6O 9\O6 $7&$ $ 77** *$**7$ 7& *$7 &***&&& *$7 7&*& *7&$$& ***7** $$ 7 $$* $ 7 $7 7 77 &777**** )LJXUH 3DUWLDO QXFOHRWLGH VHTXHQFHV RI UHDUUDQJHG 7&59\O JHQHV IURP %URZQ OLQH DQG 6P\WK OLQH FKLFNHQV VKRZLQJ WKH )5 1 UHJLRQ DQG -\ VHTXHQFHV &ORQH GHVLJQDWLRQV LQFOXGH DQ DQLPDO QXPEHU VKRZQ LQ 7DEOH IRU 6/f DQG DQ LQGLYLGXDO FORQH QXPEHU 6HTXHQFHV UHFRYHUHG PRUH WKDQ RQFH DUH LQGLFDWHG E\ WKH QXPEHU RI UHSHDWV LQ SDUHQWKHVHV DIWHU WKH FORQH QXPEHU 6HTXHQFHV DUH DOLJQHG ZLWK UHIHUHQFH 9\ JHQHV 6L[ HW DO f (YROXWLRQDULO\ FRQVHUYHG DPLQR DFLGV LQ 9\ DQG -\ DUH LQGLFDWHG DERYH WKH QXFOHRWLGH VHTXHQFH 'RWV V\PEROL]H LGHQWLW\ WR WKH UHIHUHQFH VHTXHQFH 1RQJHUPOLQH HQFRGHG QXFOHRWLGHV DUH ODEHOHG DV WKH 1 UHJLRQ 3RVVLEOH 3 QXFOHRWLGHV DUH XQGHUOLQHG

PAGE 108

$VS 7\U7\U&\V 9\ $**$77&$$$&7$777&7$&$&$*$*$&777*&$&7&77$&$$7$$*$$$7*7$$77&&**$7*$7*$7*&7$&77$&7$&7*7 9\% 9\% 9\% & 9\% f & 9\% & & 9\ % $* & 9\ % $* & 9\% $* & 9\%O $* & 9\%O & $* & 9\%O *& 7*7$ *** $* 7 & 9\ % *& 7*7$ *** $* 7 & 9\6O f & 9\6 & & 9\6 & & 9\6, & & 9\6, & 9\ 6 $* & 9\ 6 $* & 9\ 6, $* & 9\6 $* & 7 9\6 $* & 7 9\6O $* & 7 9\6 $* & 7 9\ 6, $* 7 & 9\ 6, $* 7 & 9\6 & **$* 7 &

PAGE 109

9\ *&&7$&7***$&&&7 9\% 9\% 9\% A 9\% f 9\% 9<% 9<% 9<% 9<% 9<% 9<% 9<% 9<6 f 9<6 A 9<6 9<6 9<6 9<6 A 9<6 9<6 9<6 A 9<6 A 9<6 9<6 9<6 9<6, 9<6 1 UHJLRQ 3KH*O\ *O\7KU -\ $*7&&*$** 7$77$&7$&$$$*7777&**&7&7**7$&$$$*&7&$77*7$7&$*$& &7&*$*$ **$ $*77&&77&&&7$$***7$&7 $J7*&* $J7*&* 7&*7&& *7** $$ 7 $$* $ 7 $ 7 7 *7&&7*77&* *&7&$$$$ $ $** &$$* $*7*&$**$7 7$& $$$7 &&$ $7&7&7$7& *&$ **$7 7$& $$$7 &&$ *7$& *&$ **$7 7$& $$$7 &&$ $*7*&$**$7 7$& $$ $ 7 & &$ $*7*&* $&* 7&**& $ &$7* *$7&&**$ $ *$ 7 $77$**$ & 7&*7***77* *$7&&**$ *7$ 7*&$ **$7 7$& $$$7 &&$ $7*7&* *&$ **$7 7$& $$$7 &&$ $7$$&7&&$&*** 77$& $$$7 &&$ &7&*&*7&*7&77$ 7$7$*7*&$ **$7 7$& $$$7 &&$ 7$ **$ 7&* **$7 7$& $$$7 &&$ &*$ 7$7$*7*&$ **$7 7$& $$$7 &&$ $7&**&**7***7&* 7* $ $ 7 $$* $ 7 $ 7 7 92 21 )LJXUH 3DUWLDO QXFOHRWLGH VHTXHQFHV RI UHDUUDQJHG 7&59\ JHQHV IURP %URZQ OLQH DQG 6P\WK OLQH FKLFNHQV VKRZLQJ WKH )5 1 UHJLRQ DQG -\ VHTXHQFHV &ORQH GHVLJQDWLRQV LQFOXGH DQ DQLPDO QXPEHU VKRZQ LQ 7DEOH IRU 6/f DQG DQ LQGLYLGXDO FORQH QXPEHU 6HTXHQFHV UHFRYHUHG PRUH WKDQ RQFH DUH LQGLFDWHG E\ WKH QXPEHU RI UHSHDWV LQ SDUHQWKHVHV DIWHU WKH FORQH QXPEHU 6HTXHQFHV DUH DOLJQHG ZLWK UHIHUHQFH 9\ JHQHV 6L[ HW DO f (YROXWLRQDULO\ FRQVHUYHG DPLQR DFLGV LQ 9\ DQG -\ DUH LQGLFDWHG DERYH WKH QXFOHRWLGH VHTXHQFH 'RWV V\PEROL]H LGHQWLW\ WR WKH UHIHUHQFH VHTXHQFH 1RQJHUPOLQH HQFRGHG QXFOHRWLGHV DUH ODEHOHG DV WKH 1 UHJLRQ 3RVVLEOH 3 QXFOHRWLGHV DUH XQGHUOLQHG

PAGE 110

$VS 7\U7\U&\V 9\ $$*777&$$*7*&$*$*$$$7&&77&&$$&7&7*77&7*$&$$7$$$*$$$7&$$&7&**$***$7$&&**7$&77$&7$77*7 9\%f 9\% 9\% 9\% 9\ % 7 $ 9\ % 7 $ 9\% 7 $ 9\ % 7$ 9\ % 7$ 9\% 7 & 7 $ 7 & 9\ % $ 7&& &$ 7 & 9\6 9\6, 9\6 & 9\6 7 $ 9\6 7$ & 9\6 7 & 7 $ 7 & 9\6 7 & & $ & 9\6 7 $&$ 7 9\6 7 $&$ 7 9\6 7 $&$ 7 9\ 6 * $ 7 $&$ 7

PAGE 111

9\ 9\%f 9\% 9\% 9\% 9\% 9\% 9\% 9\%O 9\%O 9\%O 9\% 9\6 9\6, 9\6 9\6 9\6 9\6 9\6 9\6 9\6 9\6 9\6 *&$7$&7**7$7$$*& 77 77 77 77 * * $$* 1 UHJLRQ &$&*$&**77 $&$ $7&&** **$*7*&$7L 77$&& &*$ $$ &$ $$**& $$**& $$ &7&$ $$**&$7 $7$&**** *$$*7* *$$&$$**&77&&&*$ &&** $$* $$** $$**& $$ 3KH*O\ *O\ $7$77$&7$&$$$*7777&**&7&7**7$&$$$*&7&$77*7$7&$*$& -\ *$7& 7$& $$ $ 7 & &$ *7*&$**$7 7$& $$ $ 7 & &$ ** *7** *$$7 $$* $ 7 $7 7 7**7&&*$ &* &$**$7 7$& $$ $ 7 & &$ $ &7$7$*7*&$**$7 7$& 377$$ I$$ $ 7 & &$ 7&&&&&7&77 $7***7**$$ 7 $$* $ 7 $ 7 7 &$ *7***$$ 7 $$* $ 7 $ 7 7 *&&& 7&&&77**$$ *&$**$7 7$& $$ $ 7 & &$ *$$& &$**$77$& $$ $ 7 & &$ *&$$*&&7$7$7& $$ $ 7 & &$ *&$$*&&&*$ *&$$ *$*$$ 7 $$* $ 7 $ 7 7 &&77$$*&*$ *7***$$ 7 $$* $ 7 $ 7 7 RR )LJXUH 3DUWLDO QXFOHRWLGH VHTXHQFHV RI UHDUUDQJHG 7&59\ JHQHV IURP %URZQ OLQH DQG 6P\WK OLQH FKLFNHQV VKRZLQJ WKH )5 1 UHJLRQ DQG -\ VHTXHQFHV &ORQH GHVLJQDWLRQV LQFOXGH DQ DQLPDO QXPEHU VKRZQ LQ 7DEOH IRU 6/f DQG DQ LQGLYLGXDO FORQH QXPEHU 6HTXHQFHV UHFRYHUHG PRUH WKDQ RQFH DUH LQGLFDWHG E\ WKH QXPEHU RI UHSHDWV LQ SDUHQWKHVHV DIWHU WKH FORQH QXPEHU 6HTXHQFHV DUH DOLJQHG ZLWK UHIHUHQFH 9\ JHQHV 6L[ HW DO f (YROXWLRQDULO\ FRQVHUYHG DPLQR DFLGV LQ 9\ DQG -\ DUH LQGLFDWHG DERYH WKH QXFOHRWLGH VHTXHQFH 'RWV V\PEROL]H LGHQWLW\ WR WKH UHIHUHQFH VHTXHQFH 1RQJHUPOLQH HQFRGHG QXFOHRWLGHV DUH ODEHOHG DV WKH 1 UHJLRQ 3RVVLEOH 3 QXFOHRWLGHV DUH XQGHUOLQHG

PAGE 112

DQLPDOV FORQHV 9\% DQG 9\%f DQG LGHQWLFDO 9\ VHTXHQFHV ZHUH REWDLQHG IURP D %/ DQG 6/ DQLPDO FORQHV 9\% DQG 9\6f 9\O $OO HLJKW RI WKH UHDUUDQJHG 9\O JHQHV IURP %/ DQG WKUHH RI HOHYHQ 9, JHQHV IURP 6/ ZHUH LGHQWLILHG DV NQRZQ 9, IDPLO\ PHPEHUV EDVHG RQ WKHLU SUHGLFWHG )5 DPLQR DFLG VHTXHQFH 7KH UHPDLQLQJ HLJKW RI HOHYHQ 9\O JHQHV IURP 6/ PD\ UHSUHVHQW D QRYHO 9\O IDPLO\ PHPEHU ZKLFK VKDUHV WZR DPLQR DFLG VXEVWLWXWLRQV *O\$UJ DQG /\V*OXf ZLWK WKUHH RWKHU 9\O JHQHV &RQVLGHULQJ WKH UHODWLYHO\ ORZ QXPEHU RI DPLQR DFLG VXEVWLWXWLRQV FRPSDUHG WR :/ 9\O JHQHV DQG WKH DEVHQFH RI IXUWKHU JHQRPLF PDSSLQJ DQG VHTXHQFH GDWD IRU WKH FKLFNHQ 7&5\ ORFXV WKHVH QRYHO 6/ 9\O JHQHV PD\ DOVR UHSUHVHQW DOOHOLF GLIIHUHQFHV EHWZHHQ NQRZQ 9\O IDPLO\ PHPEHUV VHJUHJDWLQJ LQ WKH :/ DQG 6/ VWUDLQV 9\ 7HQ RI WZHOYH %/ 9\ JHQHV DQG HLJKW RI ILIWHHQ 6/ 9\ JHQHV FRXOG EH LGHQWLILHG DV NQRZQ 9\D VXEIDPLO\ PHPEHUV 7KH UHPDLQLQJ WZR RI WZHOYH %/ 9\ VHTXHQFHV UHSUHVHQW D QRYHO 9\ VXEIDPLO\ ZKLFK ZH GHVLJQDWH 9\G DQG WKH UHPDLQLQJ VHYHQ RI ILIWHHQ 6/ VHTXHQFHV UHSUHVHQW WKUHH GLIIHUHQW QRYHO 9\D JHQHV ZKLFK PD\ UHSUHVHQW QHZ 9\D VXEIDPLO\ PHPEHUV RU DOOHOLF SRO\PRUSKLVPV EHWZHHQ :/ DQG 6/ 9\ 7HQ RI HOHYHQ %/ DQG HLJKW RI HOHYHQ 6/ 9\ JHQHV FRXOG EH LGHQWLILHG DV NQRZQ 9\ IDPLO\ PHPEHUV 7KH UHPDLQLQJ RQH RI HOHYHQ %/ DQG WKUHH RI HOHYHQ 6/ VHTXHQFHV UHSUHVHQW WZR GLIIHUHQW QRYHO 9\ JHQHV ZKLFK PD\ UHSUHVHQW QHZ 9\ IDPLO\ PHPEHUV RU DOOHOLF SRO\PRUSKLVPV EHWZHHQ :/ DQG 6/ 7KHUH DUH IRXU 6/ 9\ VHTXHQFHV UHSUHVHQWLQJ D 9\ PHPEHU QRW VHHQ LQ %/ VHTXHQFHV VXJJHVWLQJ D SRVVLEOH VKLIW LQ 9\ XVDJH LQ 6/ DV FRPSDUHG WR %/

PAGE 113

&'5 OHQJWK DQG DPLQR DFLG FRPSRVLWLRQ 7KH DPLQR DFLG VHTXHQFHV HQFRGHG E\ WKH %/ DQG 6/ 9\ JHQHV DUH VKRZQ LQ )LJXUH IRU WKH UHJLRQ EHWZHHQ WKH FRQVHUYHG &\V DQG 3KHO UHVLGXHV LQ 9\ DQG -\ UHVSHFWLYHO\ 6HTXHQFHV ZHUH FRPSDUHG IRU RYHUDOO &'5 OHQJWK PHDVXUHG DV WKH QXPEHU RI DPLQR DFLGV EHWZHHQ WKHVH WZR DQFKRU SRVLWLRQV WKH QXPEHU RI QRQJHUPOLQH HQFRGHG DPLQR DFLGV LQ WKH 1 UHJLRQ DQG IRU WKH DPLQR DFLG FRQWHQW RI &'5 DQG 1 UHJLRQV 1R GLIIHUHQFHV ZHUH IRXQG EHWZHHQ %/ DQG 6/ IRU WKH &'5 RU 1 UHJLRQ OHQJWK RI DOO 9\ VHTXHQFHV FRPELQHG RU IRU LQGLYLGXDO 9\ IDPLOLHV :KHQ WKH 6/ 9\ DPLQR DFLG VHTXHQFHV LQ WKH &'5 ZHUH FRPSDUHG WR %/ WKHUH ZHUH IHZHU QRQSRODU DQG PRUH FKDUJHG DPLQR DFLGV LQ 9\O VHTXHQFHV DQG PRUH QRQSRODU DQG IHZHU SRODU DPLQR DFLGV LQ 9\ VHTXHQFHV +RZHYHU QRQH RI WKH GLIIHUHQFHV LQ DPLQR DFLG FRQWHQW IUHTXHQF\ RI QRQSRODU SRODU DQG FKDUJHG DPLQR DFLGV EHWZHHQ %/ DQG 6/ 9\ VHTXHQFHV ZHUH VWDWLVWLFDOO\ VLJQLILFDQW DV GHWHUPLQHG E\ b DQDO\VLV GDWD QRW VKRZQf -\ XVDJH 2YHUDOO WKH XVDJH RI WKH WKUHH -\ JHQH VHJPHQWV LQ WKH %/ DQG 6/ VHTXHQFHV ZDV b YV b XVDJH RI -\O b YV b RI -\ DQG b YV b RI -\ $OWKRXJK WKHUH DSSHDUHG WR EH PRUH 9\O-\O DQG 9\-\ DQG IHZHU 9\O-\ DQG 9\-\O FRPELQDWLRQV LQ 6/ FKLFNHQV DV FRPSDUHG WR %/ FKLFNHQV WKH GLIIHUHQFHV LQ -\ XVDJH RYHUDOO DQG ZLWKLQ HDFK 9\ IDPLO\ DUH QRW VWDWLVWLFDOO\ VLJQLILFDQW E\ \M DQDO\VLV GDWD QRW VKRZQf 'LVFXVVLRQ 7KH IXQFWLRQ RI \ 7 FHOOV LQ JHQHUDO LV OHVV ZHOO XQGHUVWRRG WKDQ WKDW RI DS 7 FHOOV DQG WKH\ DUH FKDUDFWHUL]HG E\ IXQFWLRQDO GLIIHUHQFHV VXFK DV DQWLJHQ UHFRJQLWLRQ

PAGE 114

Y\ 1 UHJLRQ -\ 9
PAGE 115

DQG UHSHUWRLUH VHOHFWLRQ DQG XVXDOO\ H[SUHVV DQ DFWLYDWHG SKHQRW\SH +DDV HW DO 6FLDPPDV HW DO f 7KH SUHVHQFH RI \ 7 FHOOV LQ WKH SRSXODWLRQV RI O\PSKRF\WHV LQILOWUDWLQJ WLVVXHV DIIHFWHG LQ YDULRXV DXWRLPPXQH GLVHDVHV VXJJHVWHG D SRVVLEOH UROH IRU WKLV 7 FHOO VXEVHW LQ WKH SDWKRJHQHVLV RI DXWRLPPXQLW\ ZKLFK KDV EHHQ IXUWKHU VXSSRUWHG E\ HYLGHQFH RI FORQDO H[SDQVLRQ RI WKH LQILOWUDWLQJ \ 7 FHOOV LQ DQ DQWLJHQGULYHQ IDVKLRQ E\ ILQGLQJV RI UHODWHG RU LGHQWLFDO 7&5 MXQFWLRQ VHTXHQFHV
PAGE 116

ZLWK WKH QRQVHJPHQWDO IRUP RI YLWLOLJR KDYH EHHQ VWXGLHG IRU FKDQJHV LQ WKHLU SHULSKHUDO EORRG O\PSKRF\WH VXEVHWV E\ )$&6 DQDO\VLV XVLQJ D SDQHO RI P$EV UHFRJQL]LQJ 7 FHOO VXUIDFH PDUNHUV $EGHO1DVVHU HW DO f 1R VLJQLILFDQW GLIIHUHQFHV ZHUH REVHUYHG LQ 7 FHOOV SRVLWLYH IRU DS 7&5 \ 7&5 &' &' &' &'52 &'OOE &'OOF &' &' &' RU &' 7KH RQO\ FKDQJHV WKDW ZHUH GHWHFWHG LQFOXGHG D GHFUHDVH LQ WKH &'5$ VXEVHW DQG DQ LQFUHDVH LQ +/$'5 FHOOV VXJJHVWLQJ DQ LQFUHDVH LQ DFWLYDWHG SHULSKHUDO 7 FHOOV :KHWKHU WKLV REVHUYDWLRQ LV XQLTXH WR WKLV VXEVHW RI KXPDQ YLWLOLJR SDWLHQWV RU UHSUHVHQWV D GLIIHUHQFH LQ WKH SDWKRJHQHVLV RU SURJUHVVLRQ RI YLWLOLJR LQ WKH 6/ FKLFNHQ DQLPDO PRGHO LV XQNQRZQ ,Q WKLV UHSRUW ZH DGGUHVVHG WKH LVVXH RI FORQDOLW\ RI WKH SHULSKHUDO EORRG \ 7 FHOOV LQ WKH DYLDQ PRGHO RI YLWLOLJR DQG IRXQG QR HYLGHQFH IRU FORQDO H[SDQVLRQ RI \ 7 FHOOV EHORQJLQJ WR DQ\ RI WKH WKUHH VXEJURXSV RI \ 7 FHOOV WKDW FDQ EH LGHQWLILHG EDVHG RQ 9\ IDPLO\ JHQH H[SUHVVLRQ 7KLV FRQFOXVLRQ LV EDVHG RQ DQDO\VLV RI &'5 OHQJWK &'5 DPLQR DFLG FRQWHQW DQG 9\-\ JHQH FRPELQDWLRQV H[SUHVVHG LQ 6/ SHULSKHUDO EORRG DV FRPSDUHG WR WKH FRQWURO SDUHQWDO %/ FKLFNHQ ,W VKRXOG EH QRWHG WKDW WKH QXPEHU RI \ 7 FHOOV LQ WKH DIIHFWHG WLVVXH LH JURZLQJ IHDWKHUV GRHV LQFUHDVH WHQIROG LQ 6/ FKLFNHQV KRZHYHU GXH WR WKH HYHQ JUHDWHU H[SDQVLRQ RI D3 7 FHOOV WKH SURSRUWLRQ RI \ 7 FHOOV LQ WKH LQILOWUDWLQJ 7 FHOO SRSXODWLRQ DFWXDOO\ LV ORZHU WKDQ LQ WKH IHDWKHU SXOS RI QRUPDO DQLPDOV (UI HW DO Ef ,W LV XQNQRZQ ZKHWKHU WKH LQILOWUDWLQJ \ 7 FHOOV DUH FORQDOO\ H[SDQGHG )XWXUH VWXGLHV PLJKW LQFOXGH WKH XVH RI VSHFWUDW\SLQJ RI &'5 OHQJWKV WR GHWHUPLQH ZKLFK 9S DQG 9\ VXEIDPLOLHV VKRZ UHFXUUHQW XVDJH EDVHG RQ WKH VL]H RI WKH

PAGE 117

&'5 SHDNV 'LHWULFK HW DO f 7KLV H[SHULPHQWDO DSSURDFK PLJKW DOVR LQGLFDWH ZKHWKHU WKHUH LV FORQDOLW\ ZLWKLQ WKH FRPSOH[ SRO\FORQDO UHSHUWRLUH 6LQJOH VWUDQG FRQIRUPDWLRQDO SRO\PRUSKLVP 66&3f DQDO\VLV RI DPSOLILHG 3&5 SURGXFWV RQ D QRQGHQDWXULQJ SRO\DFU\ODPLGH JHO ZRXOG DOVR DIIRUG H[WUD FKDUDFWHUL]DWLRQ RI WKH SUHGRPLQDQFH RI FHUWDLQ FORQHV 'LIIXVH EDQGV DQG VPHDULQJ ZRXOG EH LQGLFDWLYH RI SRO\FORQDOLW\ PRQRFORQDOLW\ RU ROLJRFORQDOLW\ ZRXOG EH FRQILUPHG E\ RQH RU VHYHUDO SURPLQHQW EDQGV FRUUHODWLQJ WR EXON VHTXHQFLQJ 7KH GHYHORSLQJ IHDWKHU LV WKH WLVVXH RI FKRLFH WR H[DPLQH WKH DPHODQRWLF SURFHVV DW WKH VLWH RI 7 FHOO LQILOWUDWLRQ :H DQWLFLSDWH WKDW H[SUHVVLRQ RI D PRUH UHVWULFWHG 7 FHOO UHSHUWRLUH PLJKW EH IRXQG LQ WKH UHJHQHUDWLQJ IHDWKHU FRPSDUHG ZLWK WKH UHSHUWRLUH IRXQG LQ WKH 7 FHOOV RI WKH SHULSKHUDO EORRG O\PSKRF\WHV RI WKH 6/ FKLFNHQ 7KLV KDV EHHQ UHSRUWHG IRU WKH 7 FHOO XVDJH LQ RWKHU DXWRLPPXQH GLVHDVHV DV ZHOO DV WUDQVSODQW UHMHFWLRQ DQG WXPRU LQILOWUDWLRQV )RU H[DPSOH DQ ROLJRFORQDO 7&5 UHSHUWRLUH FRQVLVWLQJ SULPDULO\ RI 9S DQG 9D RU 9D KDV EHHQ UHSRUWHG IRU WKH PRXVH $FKD HW DO 8UEDQ HW DO f DQG UDWV %XPV HW DK f PRGHOV RI ($( &RPSDULVRQ RI WKH 7&5 WUDQVFULSWV RI 7 FHOOV IRXQG LQ SDWLHQW EURQFKLRODU ODYDJH WR WKH VDPH SDWLHQWfV 3%/ UHYHDOHG ROLJRFORQDO SUHIHUHQFHV IRU 9 9D DQG 9S JHQH IDPLOLHV ZKLFK SHUVLVWHG RYHU WLPH DQG IURP PXOWLSOH WLVVXHV
PAGE 118

FRQVHTXHQFH RI WKH GLVHDVH SURFHVV UDWKHU WKDQ D FDXVDO IDFWRU DQG PD\ EH D VHFRQGDU\ UHVXOW RI WKH LQIODPPDWRU\ UHVSRQVH DW WKH VLWHV RI PHODQRF\WH GHVWUXFWLRQ

PAGE 119

&+$37(5 (1'2*(1286 9,5$/ /2&, ,1 7+( 60<7+ /,1( &+,&.(1 $ 02'(/ )25 7+( $872,0081( ',6($6( 9,7,/,*2 ,QWURGXFWLRQ 9LUXVHV KDYH EHHQ LPSOLFDWHG LQ WKH SDWKRJHQHVLV RI PDQ\ DXWRLPPXQH GLVHDVHV ,QIHFWLRQV E\ KXPDQ F\WRPHJDORYLUXV +&09f KDYH VKRZQ D VSHFLILF DQG KLJKO\ VLJQLILFDQW DVVRFLDWLRQ ZLWK V\VWHPLF OXSXV HU\WKHPDWRVXV ZKLFK KDV DOVR EHHQ DVVRFLDWHG ZLWK UHWURYLUXVHV DQG (SVWHLQ %DUU 9LUXV LQIHFWLRQV 5LGHU HW DO f $IWHU DQ HQFHSKDORP\HOLWLV LQIHFWLRQ WKDW KDV EHHQ HQKDQFHG E\ D FU\ROHVLRQ LQ /HZLV UDWV FHUYLFDO O\PSK QRGHV DSSHDU WR EH D VRXUFH RI DXWRLPPXQH O\PSKRF\WHV LQYROYHG LQ FHUHEUDO ($( 5HGXFWLRQ LQ VHYHULW\ RI ($( E\ O\PSKDGHQHFWRP\ VXJJHVWHG WKDW WKH O\PSK QRGHV SULPH 7 FHOOV WR WDUJHW WKH LQIHFWHG EUDLQ 3KLOOLSV HW DO f 7KHUH DUH VHYHUDO PXULQH PRGHOV RI YLUXVLQGXFHG GLDEHWHV LQFOXGLQJ O\PSKRF\WLF FKRULRPHQLQJLWLV /&09f &R[VDFNLH YLUXV KHUSHV YLUXV DQG HQFHSKDORP\RFDUGLWLV YLUXV ZKLFK LV UHODWHG WR WKH PRXVH PDPPDU\ WXPRU YLUXV 0079f DQG HQFRGHV D 0+& FODVV ,OGHSHQGHQW VXSHUDQWLJHQ YLD LWV 1WHUPLQDO PRLHW\ LQ LWV HQY JHQH &RQUDG HW DO 5DPVLQJK HW DO f 6HYHUDO PHFKDQLVPV KDYH EHHQ SRVWXODWHG WR H[SODLQ KRZ YLUDO LQYROYHPHQW OHDGV WR DXWRLPPXQLW\ $LFKHOH HW DO 1DNDJDZD DQG +DUULVRQ %DPDED f

PAGE 120

9LUXVHV DUH LQYROYHG LQ WKH JHQHUDWLRQ RI QHZ HSLWRSHV QHRDQWLJHQVf FDXVLQJ D ORVV RI WROHUDQFH EUHDNLQJ RI LPPXQH LJQRUDQFHf ,PPXQH UHVSRQVHV WR YLUDO DQWLJHQLF GHWHUPLQDQWV PD\ WULJJHU FURVVUHDFWLYH DXWRLPPXQH UHDFWLRQV WR VKDUHG GHWHUPLQDQWV RI WKH VHOIDQWLJHQV WKDW KDYH EHHQ UHOHDVHG GXH WR WLVVXH GHVWUXFWLRQ GXULQJ D KRVW DQWLYLUDO LPPXQH UHVSRQVH PROHFXODU PLPLFU\f 'RXYDV DQG 6REHOPDQ f 9LUXVHV PD\ DFW DV VXSHUDQWLJHQV WKDW DFWLYDWH 7 FHOOV H[SUHVVLQJ VSHFLILF 9S IDPLO\ JHQHV IRU H[DPSOH WKH 0LV ORFXV LQ PLFH RU WKH\ PD\ SURYLGH LPPXQRVXSSUHVVLRQ VXFK DV LQ +,9 5HVSLUDWRU\ V\QF\WLDO YLUXV LQGXFHV KRVW LQWHUIHURQ SURGXFWLRQ WR LQKLELW D SUROLIHUDWLYH UHVSRQVH E\ KXPDQ 3%0&V WR WKH LQIHFWLRQ 3UHVWRQ HW DO f ,Q SHUVLVWHQW LQIHFWLRQV LQ ZKLFK WKH ERG\ FDQ QRW FRPSOHWHO\ UHPRYH WKH YLUXV VXFK DV LQ DXWRLPPXQH KHSDWLWLV WKH LQIHFWHG WLVVXH LV GHVWUR\HG GXULQJ ORQJWHUP FKURQLF LQIODPPDWRU\ UHVSRQVHV WR WKH UHSOLFDWLQJ YLUXV 7KXV WKH GHVWUXFWLRQ LV UHDOO\ GXH WR WKH SHUVLVWHQW F\WRWR[LF 7 FHOO UHVSRQVH RQ WKH WDUJHW WLVVXH 7KLV GHVWUXFWLRQ LQDGYHUWHQWO\ DQG FRQWLQXRXVO\ UHOHDVHV ODUJH TXDQWLWLHV RI WKH RUJDQfV VHOIDQWLJHQV HVSHFLDOO\ QHYHU H[SRVHG LQWUDFHOOXODU DQWLJHQVf ZKLFK EHFRPH SUHVHQWHG E\ SURIHVVLRQDO $3&V LQ O\PSKRLG WLVVXH .R]LHO HW DO &HUQ\ HW DO f 6XEVHTXHQWO\ VHOIUHDFWLYH % FHOOV DQG 7 FHOOV EHFRPH DFWLYDWHG WR VHFUHWH DXWRDQWLERGLHV DQG PDLQWDLQ WKH DXWRLPPXQH UHVSRQVH 'XULQJ LQIHFWLRQ VRPH YLUDO SURWHLQ SURGXFWV FDQ PRGXODWH RU FRXQWHUDFW KRVW DQWLYLUDO LPPXQH GHIHQVHV UHYLHZHG E\ *RRGLQJ 0DUUDFN DQG .DSSOHU f &\WRNLQHV VXFK DV LQWHUOHXNLQ ,/f DQG WXPRU QHFURVLV IDFWRU 71)f KDYH RIWHQ EHHQ WKH WDUJHWV IRU VXFK YLUDO LPPXQH PRGXODWLRQ 6KRSH ILEURPD YLUXV D SR[ YLUXV SURGXFHV

PAGE 121

D SURWHLQ WKDW ELQGV WR 71) SUHYHQWLQJ WKH UHFRJQLWLRQ RI 71) E\ LWV UHFHSWRUV DQG WKXV SUHYHQWLQJ WKH DFWLYDWLRQ RI LQIODPPDWRU\ UHVSRQVHV WR UHPRYH WKLV YLUXV &RZSR[ YLUXV HQFRGHV D VROXEOH JO\FRSURWHLQ WKDW KDV DPLQR DFLG KRPRORJ\ WR WKDW RI WKH ,/ UHFHSWRU 7KLV SURGXFW SUREDEO\ FRPSHWHV ZLWK FHOOERXQG ,/ UHFHSWRUV IRU VHFUHWHG ,/ LQWHUIHULQJ ZLWK WKH DFWLYDWLRQ RI ,/ F\WRNLQHPHGLDWHG LQIODPPDWRU\ UHVSRQVHV 7KH SURGXFW RI WKH %&5) JHQH RI WKH (SVWHLQ%DUU YLUXV VWLPXODWHV WKH FRQYHUVLRQ RI 7 FHOOV LQWR 7K KHOSHU FHOOV E\ LWV VWUXFWXUDO DQG IXQFWLRQDO DQDORJ\ WR ,/ (%9 WKHUHIRUH DYRLGV LQGXFWLRQ RI LQIODPPDWRU\ UHVSRQVHV FRQWUROOHG E\ 7KO FHOO DFWLYLW\ 9LUXVHV SURGXFH SURWHLQV WKDW PD\ VXEYHUW WKH KRVW LQ RWKHU ZD\V DV ZHOO +XPDQ DGHQRYLUXVHV SURGXFH YLUXVDVVRFLDWHG 9$f 51$V 7KHVH WUDQVFULSWV FDQ UHJXODWH LQWHUIHURQ DFWLYDWLRQ RI 3, NLQDVH E\ SUHYHQWLQJ WKH SKRVSKRU\ODWLRQ RI H,) HXFDU\RWLF SURWHLQ V\QWKHVLV LQLWLDWLRQ IDFWRUf ZKLFK ZRXOG SUHYHQW WKH V\QWKHVLV RI YLUDO SURWHLQV 0DWWKHZV DQG 6KHQN f 9$ 51$V WKHUHIRUH IDFLOLWDWH FRQWLQXHG JURZWK RI WKH YLUXV LQ WKH KRVW FHOOV ,J* DQWLERG\GHSHQGHQW FRPSOHPHQWPHGLDWHG GHVWUXFWLRQ RI YLUXV FRQWDLQLQJ FHOOV LV DYRLGHG E\ KHUSHV YLUXVHV 7KH KHUSHV VLPSOH[ YLUXV LQGXFHV WKH LQIHFWHG FHOO WR H[SUHVV +69)F UHFHSWRU D KHWHURGLPHU RI JO\FRSURWHLQV ( DQG WKDW ELQGV WR WKH )F UHJLRQ RI WKH KRVWfV QRQVSHFLILF QRQLPPXQH ,J* 7KLV ELQGLQJ SUHYHQWV FRPSOHPHQWPHGLDWHG O\VLV RI LQIHFWHG FHOOV E\ EORFNLQJ DFFHVV WR WKH FHOO VXUIDFH RI DQWLYLUDO DQWLERG\ RU HIIHFWRU FHOOV %HOO HW DO f $QWLERGLHV WR KHUSHV VLPSOH[ YLUXV DQG &09 )FELQGLQJ SURWHLQV KDYH EHHQ GHWHFWHG LQ SDWLHQWV ZLWK UKHXPDWRLG DUWKULWLV 7VXFKL\D HW DO :LOOLDPV HW DO f ,Q UKHXPDWRLG DUWKULWLV WKH +/$'5SL DOOHOHV FRQWDLQ WKH 4.5$$ DPLQR DFLG VHTXHQFH LQ WKH SHSWLGHELQGLQJ UHJLRQ WKDW KDV

PAGE 122

EHHQ DVVRFLDWHG ZLWK WKH DXWRLPPXQH FRQGLWLRQ (QKDQFHG KXPRUDO DQG FHOOXODU UHVSRQVHV WR 4.5$$ VHTXHQFHV H[SUHVVHG E\ (SVWHLQ%DUU YLUXV KDYH EHHQ IRXQG LQ 5$ SDWLHQWV /D&DYD HW DO f (QGRJHQRXV UHWURYLUXVHV ^HYf DUH JHUPOLQH HOHPHQWV WKDW HQFRGH FRPSRQHQWV RI D UHWURYLUXV DUH SUHVHQW LQ DOO FHOOV DQG DUH LQKHULWHG LQ D 0HQGHOLDQ IDVKLRQ UHYLHZHG LQ 5RYLJDWWL DQG $VWULQ f (QGRJHQRXV UHWURYLUXVHV DUH SDVVHG IURP SDUHQW WR RIIVSULQJ DV VWDEOH SURYLUDO HOHPHQWV LQWHJUDWHG LQWR WKH JHUPOLQH %\ UHYHUVH WUDQVFULSWLRQ IURP D YLUDOHQFRGHG 51$GHSHQGHQW '1$ SRO\PHUDVH WKH '1$ FRSLHV RI WKHVH 51$EDVHG YLUXVHV KDYH EHFRPH LQWHJUDWHG LQWR WKH JHQRPH RI WKH KRVW IODQNHG E\ D f DQG D f ORQJ WHUPLQDO UHSHDW /75f 7KUHH JHQHV YLWDO IRU YLUDO UHSOLFDWLRQ DUH LQFOXGHG JDJ D SUHFXUVRU SRO\SURWHLQ SRO D SUHFXUVRU IRU SURWHDVH UHYHUVH WUDQVFULSWDVH DQG HQGRQXFOHDVH DQG HQY WKH JO\FRSURWHLQ IRU WKH YLUDO HQYHORSH 7KH /75 FRQWDLQV PXOWLSOH FLVDFWLQJ HOHPHQWV LQYROYHG LQ JHQH H[SUHVVLRQ DQG DFWV DV D SURPRWHU 0DQ\ HY ORFL DUH QRW WUDQVFULSWLRQDOO\ DFWLYH WKH\ KDYH WUXQFDWHG RSHQ UHDGLQJ IUDPHV EHFDXVH RI WHUPLQDWLRQ FRGRQV GHOHWLRQV RU IUDPHVKLIW PXWDWLRQV +RZHYHU VRPH HY ORFL DUH H[SUHVVHG DQG PD\ DFWXDOO\ SURGXFH YLUDO SDUWLFOHV 7KHLU VWUXFWXUDO DQG VHTXHQFH VLPLODULW\ WR LQIHFWLRXV H[RJHQRXV UHWURYLUXVHV ZKLFK KDYH EHHQ DVVRFLDWHG ZLWK LPPXQH G\VIXQFWLRQ DQG WLVVXHVSHFLILF H[SUHVVLRQ PDNH WKHP FDQGLGDWHV IRU SDWKRJHQLF UROHV LQ DXWRLPPXQLW\ ([RJHQRXV RQFRJHQLF UHWURYLUXVHV DOVR LQWHJUDWH LQWR WKH KRVW JHQRPH DQG LQ WKH SURFHVV FDXVH LQVHUWLRQDO PXWDJHQHVLV ,Q DGGLWLRQ WKH\ DUH QRW SDVVHG IURP SDUHQW WR RIIVSULQJ DQG FRQWDLQ WUDQVIRUPLQJ JHQHV VXFK DV YP\F YVUF YHUE DQG YP\E ZKLFK DUH QRW SUHVHQW LQ WKH OHXNRVLV YLUXVHV RU HQGRJHQRXV YLUXVHV

PAGE 123

5HWURYLUDO LQWHJUDWLRQV PD\ FDXVH LPPXQH G\VUHJXODWLRQ RI KRVW FHOOXODU JHQH H[SUHVVLRQ $V WUDQVLHQW WUDQVSRVDEOH HOHPHQWV WKH\ FDQ DFWLYDWH RU LQDFWLYDWH WKH KRVW JHQH E\ FDXVLQJ JHQH UHDUUDQJHPHQWV 5HWURYLUXVHV FDQ XQGHUJR JHQH GXSOLFDWLRQ RI WKH YLUDO DQG IODQNLQJ FHOOXODU VHTXHQFHVf FDSWXUH KRVW JHQHV DQG PRYH KRVW JHQHWLF LQIRUPDWLRQ E\ PHDQV RI LQWUDFHOOXODU UHSOLFDWLRQ DQG LQWHJUDWLRQ DV D SURYLUXV +XJKHV HW DO 7HUHED 5RYLJDWWL DQG $VWULQ f 7KH LQWHJUDWLRQ RI DYLDQ OHXNRVLV YLUXV LQWR WKH KRVWfV SURWRRQFRJHQH FP\F LV DQ H[DPSOH RI LQVHUWLRQDO DFWLYDWLRQ LQ WKLV FDVH DV D SURPRWHU LQVHUWLRQ 7KLV EULQJV WZR FRGLQJ H[RQV RI FP\F XQGHU WKH WUDQVFULSWLRQDO FRQWURO RI WKH f /75 DQG FDXVHV KLJKHU OHYHOV RI FP\F H[SUHVVLRQ DQG WKH G\VUHJXODWLRQ RI FP\F RIWHQ OHDGV WR % FHOO O\PSKRPDV &RIILQ f 2WKHU LQVHUWLRQDO PXWDWLRQV LQFOXGH f HQKDQFHU LQVHUWLRQV LQ ZKLFK WKH SURYLUXV LV LQVHUWHG XSVWUHDP RI WKH QDWXUDO RU FU\SWLF SURPRWHU f OHDGHU LQVHUWLRQV ZKLFK DOORZ UHDGWKURXJK RI VHYHUDO WUDQVFULSWV LQLWLDWHG IURP WKH SURYLUXV f/75 f WHUPLQDWRU LQVHUWLRQV ZKLFK LQVWDOO D SRO\$ VLJQDO WUXQFDWLQJ WKH WUDQVFULSW DQG FDXVLQJ D EXLOG XS RI WUDQVFULSW FRQFHQWUDWLRQ LQVWHDG RI DOORZLQJ QRUPDO WXUQRYHU DQG f LQVHUWLRQDO LQDFWLYDWLRQ LI WKH LQVHUWLRQ LV LQ WKH FRGLQJ UHJLRQ DQG GLVUXSWV IXQFWLRQ RI WKH JHQH $V D UHVXOW RI WKHVH LQVHUWLRQV WKH UHWURYLUXV JHQRPHV RIWHQ XQGHUJR KLJK UDWHV RI LQWUDJHQRPLF UHDUUDQJHPHQWV VXFK DV GHOHWLRQV SRLQW PXWDWLRQV GXSOLFDWLRQV DQG LQYHUVLRQV QHDU WKH f /75 LQ RUGHU WR UHOLHYH D EORFN WR WUDQVFULSWLRQDO H[SUHVVLRQ IURP WKH f /75 5HWURYLUDO SURYLUXVHV FDQ DOVR DFW DV WUDQVDFWLYDWRUV WR WKH KRVW JHQRPH (QGRJHQRXV YLUXVHV DUH XELTXLWRXV LQ YHUWHEUDWH VSHFLHV LQFOXGLQJ KXPDQV DQG KDYH EHHQ H[WHQVLYHO\ VWXGLHG LQ :KLWH /HJKRUQ OLQHV RI WKH GRPHVWLF FKLFNHQ *DOOXV JDOOXV ZKHUH DW OHDVW HQGRJHQRXV YLUDO HYf ORFL KDYH EHHQ FKDUDFWHUL]HG E\ 6RXWKHUQ

PAGE 124

,OO EORW DQDO\VLV RI MXQFWLRQ IUDJPHQWV LQKHULWDQFH SDWWHUQV DQG VWUXFWXUDO DQDO\VLV E\ UHVWULFWLRQ PDSSLQJ DQGRU '1$ VHTXHQFLQJ +XPSKULHV HW DO 5RQIRUW HW DO f &KLFNHQ HY ORFL DUH VWUXFWXUDOO\ UHODWHG WR WKH DYLDQ OHXNRVLV DQG 5RXV VDUFRPD YLUXV JURXS $/9 DQG 569f 7KH\ PD\ H[SUHVV JV JURXS VSHFLILFf RU FKI FKLFNHQ IDFWRUf DQWLJHQV ZKLFK FRUUHVSRQG WR WKH YLUDO JDJ DQG HQY JHQH SURGXFWV UHVSHFWLYHO\ RU PD\ SURGXFH LQWDFW YLUXV 5RYLJDWWL HW DK 6PLWK f $SSDUHQWO\ WKHVH HQGRJHQRXV SURYLUXVHV DUH QRW HVVHQWLDO HYQHJDWLYH FKLFNHQV ZHUH IRXQG WR EH QRUPDO DQG IHUWLOH $VWULQ HW DK f 5HFHQW GDWD VXJJHVWV WKDW KXPDQ HQGRJHQRXV YLUXVHV PD\ EH LQYROYHG LQ WKH SDWKRJHQHVLV RI D YDULHW\ RI KXPDQ DXWRLPPXQH GLVHDVHV VXFK DV GLDEHWHV V\VWHPLF OXSXV HU\WKHPDWRVXV UKHXPDWRLG DUWKULWLV SVRULDVLV DQG LQIODPPDWRU\ QHXURORJLF GLVHDVHV 8URQRYLW] DQG 0XUSK\ f 8QLTXH HY ORFL KDYH DOVR EHHQ UHSRUWHG LQ WZR FKLFNHQ PRGHOV IRU DXWRLPPXQH GLVHDVHV =LHPHFNL DQG FRZRUNHUV =LHPLHFNL HW DK f GHVFULEHG D QHZ ORFXV GHVLJQDWHG HY LQ WKH 2EHVH VWUDLQ 26f ZKLFK LV FKDUDFWHUL]HG E\ DXWRLPPXQH WK\URLGLWLV D PRGHO IRU WKH KXPDQ RUJDQVSHFLILF GLVHDVH +DVKLPRWRfV WK\URLGLWLV &RVHJUHJDWLRQ ZDV REVHUYHG RI HY ZLWK DQ 26VSHFLILF GHIHFW LQ LPPXQRHQGRFULQH FRPPXQLFDWLRQ D GHILFLHQW FRUWLFRVWHURQH UHVSRQVH DIWHU LQWUDYHQRXV LQMHFWLRQ RI O\PSKRNLQHVf EXW QRW ZLWK 7 FHOO K\SHUSUROLIHUDWLRQ RU WK\URLGLWLV 6JRQF HW DK f UHSRUWHG DQ DVVRFLDWLRQ RI \HW DQRWKHU QRYHO ORFXV GHVLJQDWHG HY LQ WKH 8&' DQG 8&' FKLFNHQ OLQHV ZKLFK DUH FKDUDFWHUL]HG E\ KHUHGLWDU\ V\VWHPLF VFOHURGHUPDOLNH FRQQHFWLYH WLVVXH GLVHDVH $OWKRXJK HY PD\ QRW SOD\ D FDXVDO UROH LQ V\VWHPLF VFOHURGHUPD LW LV VXJJHVWHG WR FRQWULEXWH WR GLVHDVH VXVFHSWLELOLW\ WKDW LV E\ SURORQJLQJ WKH UHVSRQVH RI JOXFRFRUWLFRLG LQFUHDVLQJ IDFWRUV

PAGE 125

VXFK DV LQWHUOHXNLQ 7K\URLG GLVHDVHV W\SH GLDEHWHV DQG UKHXPDWRLG DUWKULWLV DOO GLVHDVHV ZLWK DXWRLPPXQH FRPSRQHQWV RFFXU ZLWK LQFUHDVHG IUHTXHQF\ LQ SDWLHQWV ZLWK YLWLOLJR *ULPHV f ,Q WKLV VWXG\ ZH VRXJKW WR GHWHUPLQH ZKHWKHU XQLTXH HY ORFL DUH FRUUHODWHG ZLWK YLWLOLJR LQ WKH 6/ FKLFNHQ PRGHO E\ SHUIRUPLQJ 6RXWKHUQ EORW DQDO\VLV RQ JHQRPLF '1$ IURP %/ DQG 6/ FKLFNHQV :H LGHQWLILHG QRYHO HY ORFL QRW SUHYLRXVO\ GHVFULEHG IRU :KLWH /HJKRUQ RU RWKHU FKLFNHQ OLQHV ZKLFK DUH VHJUHJDWLQJ LQ %/ DQG 6/ FKLFNHQ OLQHV LQ D ODUJH QXPEHU RI GLIIHUHQW FRPELQDWLRQV RU HY JHQRW\SHV $OWKRXJK IRXU HY ORFL GHVLJQDWHG HY6/O WKURXJK HY6/ ZHUH REVHUYHG WR EH SUHVHQW LQ VLJQLILFDQWO\ KLJKHU SURSRUWLRQV LQ 6/ WKDQ LQ %/ FKLFNHQV QRQH RI WKH HY6/ ORFL ZDV IRXQG WR EH H[FOXVLYHO\ DVVRFLDWHG ZLWK WKH YLWLOLJR SKHQRW\SH ZKHQ HY JHQRW\SHV IRU DIIHFWHG DQG QRQDIIHFWHG 6/ FKLFNHQV ZHUH FRPSDUHG +RZHYHU WKH JHQHWLF SRO\PRUSKLVPV GHWHFWHG EHWZHHQ %/ DQG 6/ FKLFNHQV E\ WKHVH VWXGLHV VXJJHVW WKDW WKLV DQLPDO PRGHO PD\ EH XVHIXO IRU IXUWKHU JHQHWLF DQDO\VLV RI YLWLOLJR VXVFHSWLELOLW\ 0DWHULDOV DQG 0HWKRGV 6RXWKHUQ EORW DQDO\VLV *HQRPLF '1$ VDPSOHV ZHUH SUHSDUHG IURP UHG EORRG FHOOV RI WKH %/ DQG 6/ FKLFNHQV XVLQJ VWDQGDUG SURWRFROV ZH KDYH SUHYLRXVO\ GHVFULEHG 0F&RUPDFN HW DO f *HQRPLF GLJHVWV ZHUH SUHSDUHG XVLQJ WKH UHVWULFWLRQ HQGRQXFOHDVHV %DP+O DQG (FR.O 1HZ (QJODQG %LRODEVf DFFRUGLQJ WR WKH PDQXIDFWXUHUfV JXLGHOLQHV DQG UHVWULFWLRQ IUDJPHQWV ZHUH VHSDUDWHG RQ b DJDURVH JHOV 6RXWKHUQ EORWV ZHUH SUHSDUHG XVLQJ +\ERQG 1 PHPEUDQHV $PHUVKDPf K\EULGL]HG DW r& DFFRUGLQJ WR &KXUFK DQG *LOEHUW

PAGE 126

f DQG ZDVKHG ZLWK [ 66& b 6'6 DW URRP WHPSHUDWXUH IROORZHG E\ [ 66& b 6'6 DW r& 7KH K\EULGL]DWLRQ SUREH FRQVLVWHG RI D 3ODEHOHG ES 6DFO (FR5O UHVWULFWLRQ IUDJPHQW IURP WKH SODVPLG S8/ WKH JHQHURXV JLIW RI 'U 0DXUHHQ *RRGHQRZf UHSUHVHQWLQJ WKH 8 UHJLRQ RI WKH DYLDQ OHXNRVLV YLUXV /75 *RRGHQRZ DQG +D\ZRRG f 7KLV SUREH K\EULGL]HV ZLWK ERWK WKH n DQG n /75 RI DYLDQ OHXNRVLV YLUXV DQG HQGRJHQRXV YLUXVHV HY ORFLf 5HVWULFWLRQ IUDJPHQWV ZHUH VFRUHG DV SUHVHQW RU DEVHQW 5HVWULFWLRQ IUDJPHQW VL]HV ZHUH FDOFXODWHG EDVHG FRPSDULVRQ WR +LQGO8 UHVWULFWLRQ IUDJPHQWV RI ODPEGD SKDJH '1$ $ VLQJOH FRS\ SUREH IRU WKH 7 FHOO UHFHSWRU & JHQH VHJPHQW 7MRHONHU HW DO f ZDV XVHG DV D FRQWURO WR GHWHFW SDUWLDO GLJHVWLRQ 6WDWLVWLFDO DQDO\VHV 7KH IUHTXHQFLHV RI LQGLYLGXDO HY ORFL LGHQWLILHG DV %DP+O DQG eFR5, UHVWULFWLRQ IUDJPHQWV RU SDLUV RI IUDJPHQWV ZHUH FRPSDUHG XVLQJ VWDQGDUG VWDWLVWLFDO WHVWV LQFOXGLQJ ; DQDO\VLV DQG )LVKHUfV H[DFW WHVW WR GHWHUPLQH ZKHWKHU WKH GLIIHUHQFHV REVHUYHG EHWZHHQ WKH %/ DQG 6/ RU EHWZHHQ 6/ SURJUHVVRUV DQG QRQSURJUHVVRUV ZHUH VWDWLVWLFDOO\ VLJQLILFDQW 5HVXOWV 3KHQRW\SLF DQDO\VLV RI 6/ VDPSOH SRSXODWLRQ 7KLUW\ILYH 6/ DQG %/ FKLFNHQV ZHUH XVHG IRU WKH 6RXWKHUQ EORW DQDO\VLV RI HY ORFL 7ZHQW\IRXU RI WKH 6/ FKLFNHQV GLVSOD\HG D PD[LPXP DPHODQRVLV VWDJH RI DFFRUGLQJ WR WKH DPHODQRVLV VFDOH RI (UI HW DO Ef DQG ZHUH FODVVLILHG DV SURJUHVVRUV LQ WKH DQDO\VHV GHVFULEHG EHORZ (OHYHQ 6/ FKLFNHQV VKRZHG QR VLJQ RI DPHODQRVLV

PAGE 127

VWDJH f GXULQJ WKHLU OLIHWLPH DQG ZHUH FODVVLILHG DV QRQSURJUHVVRUV 7KH DPHODQRVLV VWDJHV DUH LQGLFDWHG LQ 7DEOH 6RXWKHUQ EORW DQDO\VLV RI %/ DQG 6/ HY ORFL 7ZR UHVWULFWLRQ HQGRQXFOHDVHV ZHUH VHOHFWHG IRU 6RXWKHUQ EORW DQDO\VLV RI %/ DQG 6/ HY ORFL EDVHG RQ SXEOLVKHG ZRUN GHVFULELQJ HY ORFL RI RWKHU FKLFNHQ OLQHV %DP+, ZDV VHOHFWHG EDVHG RQ LWV XVH WR LGHQWLI\ FKDUDFWHULVWLF MXQFWLRQ IUDJPHQWV IRU WKH HY ORFL LQ :KLWH /HJKRUQ FKLFNHQV +XPSKULHV HW DO 5RYLJDWWL DQG $VWULQ f DQG (FR5, ZDV VHOHFWHG EDVHG RQ LWV XVH WR FKDUDFWHUL]H WKH HY ORFL RI %URZQ /HJKRUQ FKLFNHQV 5RQIRUW HW DO f &RPSRVLWHV RI UHSUHVHQWDWLYH DXWRUDGLRJUDSKV REWDLQHG IURP 6RXWKHUQ EORWV RI %DP +, DQG (FR5, GLJHVWV RI %/ DQG 6/ JHQRPLF '1$ K\EULGL]HG ZLWK WKH UHWURYLUDO /75 SUREH DUH VKRZQ LQ )LJXUHV DQG UHVSHFWLYHO\ $IWHU K\EULGL]DWLRQ ZLWK WKH /75 SUREH DOO EORWV ZHUH VWULSSHG DQG UHK\EULGL]HG ZLWK D VLQJOH FRS\ &S JHQH SUREH ZKLFK UHYHDOHG WKDW WKH UHVWULFWLRQ GLJHVWV ZHUH FRPSOHWH GDWD QRW VKRZQf 7KH IUHTXHQFLHV IRU WKH SUHVHQFH DQG DEVHQFH RI HY ORFL LGHQWLILHG DV XQLTXH %DP+, DQG (FR5, UHVWULFWLRQ IUDJPHQW RU SDLUV RI IUDJPHQWV DV GLVFXVVHG EHORZ DUH VXPPDUL]HG LQ 7DEOH $V GLVFXVVHG EHORZ IRXU HY ORFL RI LQWHUHVW DUH JLYHQ WKH GHVLJQDWLRQ HY6/ :LWKLQ WKH VDPSOH SRSXODWLRQ RI %/ FKLFNHQV RI ELUGV H[KLELWHG GLIIHUHQW UHVWULFWLRQ GLJHVW SDWWHUQV XVLQJ %DP +, DQG RI ELUGV H[KLELWHG GLIIHUHQW (FR5, SDWWHUQV $ NE %DP +, UHVWULFWLRQ IUDJPHQW UHSUHVHQW WKH RQO\ HY ORFXV VKDUHG E\ DOO %/ FKLFNHQV 7KH RWKHU PRVW FRPPRQ HY ORFL LQ %/ FKLFNHQV DUH UHSUHVHQWHG E\ WKH

PAGE 128

7DEOH 6P\WK OLQH 6/f FKLFNHQ SKHQRW\SHV $QLPDO DPHODQRVLV VWDJHr $QLPDO DPHODQRVLV VWDJHr 6/ 6/ 6/ 6/ 6/ 6/ 6/ 6/ 6/ 6/ 6/ 6/ 6/ 6/ 6/ 6/ 6/ 6/ 6/ 6/ 6/ 6/ 6/ 6/ 6/ 6/ 6/ 6/ 6/ 6/ 6/ 6/ 6/ 6/ 6/ r7KH PD[LPXP DPHODQRVLV VWDJH ZDV FODVVLILHG DFFRUGLQJ WR (UI HW DO Df QR DPHODQRVLV QRQSURJUHVVRUVf b DPHODQRVLV b DPHODQRVLV !b DPHODQRVLV FRPSOHWH DPHODQRVLV

PAGE 129

$PHODQRVLV VWDJH ),* O 6RXWKHUQ EORW DQDO\VLV RI HY ORFL GHWHFWHG DV %DP+? UHVWULFWLRQ IUDJPHQWV %DP+? UHVWULFWLRQ GLJHVWV RI %/ DQG 6/ JHQRPLF '1$ VDPSOHV ZHUH K\EULGL]HG ZLWK DQ /75 SUREH ?+LQ£??? '1$ VL]H PDUNHUV ODQH f0ff LQFOXGH DQG NE WRS WR ERWWRPf 6L]HV RI EDQGV RI LQWHUHVW DUH LQGLFDWHG RQ WKH OHIW DQG HY6/ ORFL DUH ODEHOHG RQ WKH ULJKW VLGH /DQHV DUH ODEHOHG ZLWK LQGLYLGXDO DQLPDO QXPEHUV DW WKH WRS DQG WKH DPHODQRVLV VWDJH (UI HW DO Df DW WKH ERWWRP 6RXWKHUQ EORWV VKRZQ DUH UHSUHVHQWDWLYH RI WKUHH H[SHULPHQWV HY6/I ‘HY6/ HY6/ HY6/

PAGE 130

%URZQ /LQH W L P P P A33A3,33A-3,PP IWr 0 OL P rf Wi f r fL_ f ‹Orr} % IW 7! &' U2O2W1ALQ62O216 2 7 7 2WW22222LWW 22 222222222222 $PHODQRVLV VWDJH HY6/ HY6/ HY68 HY6/ ),* 6RXWKHUQ EORW DQDO\VLV RI HY ORFL GHWHFWHG DV eFR5, UHVWULFWLRQ IUDJPHQWV (FR5O UHVWULFWLRQ GLJHVWV RI %URZQ OLQH DQG 6P\WK OLQH JHQRPLF '1$ VDPSOHV ZHUH K\EULGL]HG DV GHVFULEHG LQ )LJXUH 6RXWKHUQ EORWV VKRZQ DUH UHSUHVHQWDWLYH RI WKUHH H[SHULPHQWV

PAGE 131

7$%/( )UHTXHQFLHV RI HY ORFL GHWHFWHG LQ %/ DQG 6/ FKLFNHQV %DP +, %/ %/ 6/ 6/ (FR 5O %/ %/ 6/ 6/ EDQG NEf SUHVHQW DEVHQW SUHVHQW DEVHQW %/ YV 6/ HY ORFL EDQG NEf SUHVHQW DEVHQW SUHVHQW DEVHQW %/ YV 6/ HY ORFL t S HY6/ t S2 HY6/ S t QV S t QV S HY6/ t S QV S S HY6/ QV QV S QV S HY6/ QV S S2 HY6/ QV S 7KH WDEOH VKRZV WKH QXPEHU RI FKLFNHQV LQ ZKLFK HDFK %DP +, DQG (FR 5O EDQG RU SDLU RI EDQGV LV SUHVHQW DQG DEVHQW )LJV t f QV QRW VLJQLILFDQW S )LVKHUV H[DFW WHVW SUREDELOLW\ YDOXH

PAGE 132

NE %DP8O UHVWULFWLRQ IUDJPHQW f WKH t NE (FR5O IUDJPHQW SDLU f DQG (FR5O UHVWULFWLRQ IUDJPHQWV RI NE f NE f DQG NE f :LWKLQ WKH 6/ FKLFNHQ SRSXODWLRQ VDPSOH RI FKLFNHQV H[KLELWHG GLIIHUHQW UHVWULFWLRQ GLJHVW SDWWHUQV XVLQJ %DP8O DQG RI ELUGV H[KLELWHG GLIIHUHQW (FR5O SDWWHUQV 7ZR HY ORFL DSSHDU WR EH VKDUHG E\ DOO 6/ FKLFNHQV 7KH ILUVW RI WKHVH LV UHSUHVHQWHG E\ WKH VDPH NE %DP8O UHVWULFWLRQ IUDJPHQW SUHVHQW LQ RI %/ FKLFNHQV 7KH VHFRQG HY ORFXV SUHVHQW LQ DOO 6/ FKLFNHQV LV UHSUHVHQWHG E\ WKH NE %DP8O UHVWULFWLRQ IUDJPHQW DQG E\ WKH t NE (FR5O IUDJPHQW SDLU GHVLJQDWHG HY 6/ VHH EHORZf 7KH RWKHU PRVW FRPPRQ HY ORFXV LQ 6/ FKLFNHQV LV UHSUHVHQWHG E\ DQ NE (FR5O UHVWULFWLRQ IUDJPHQW SUHVHQW LQ RI ELUGV GHVLJQDWHG HY6/ VHH EHORZf )LYH SDLUV RI UHVWULFWLRQ IUDJPHQWV DUH SUHVHQW LQ WKH VDPH JURXSV RI FKLFNHQV IRU D SDUWLFXODU UHVWULFWLRQ GLJHVW *LYHQ WKH ODUJH QXPEHU RI GLIIHUHQW JHQRW\SHV VHJUHJDWLQJ LQ WKH %/ DQG 6/ SRSXODWLRQV DQG WKH IDFW WKDW WKH SUREH GHWHFWV ERWK YLUDO /75V WKHVH UHVWULFWLRQ IUDJPHQW SDLUV DUH OLNHO\ WR UHSUHVHQW WKH n DQG n MXQFWLRQV RI LQGLYLGXDO HY ORFL 7KHVH UHVWULFWLRQ IUDJPHQW SDLUV LQFOXGH WKH t %DP8O IUDJPHQW SDLUV HY 6/ 7DEOH f DQG WKH t NE HY6/f t NE t NE DQG t NE (FR5O IUDJPHQW SDLUV 7DEOH f 7KHUH ZHUH RQO\ WZR H[FHSWLRQV WR WKLV SDLULQJ RI IUDJPHQWV LQ WKDW RQH %/ ELUG %/f KDG D NE (FR5O EDQG LQ WKH DEVHQFH RI D NE (FR5O EDQG DQG RQH 6/ ELUG 6/f KDG D NE (FR5O EDQG LQ WKH DEVHQFH RI D NE (FR5O EDQG

PAGE 133

,Q WKUHH LQVWDQFHV WKHUH LV D SHUIHFW FRUUHODWLRQ EHWZHHQ WKH SUHVHQFH RI VSHFLILF %DP8O DQG eFR5, IUDJPHQWV RU IUDJPHQW SDLUV LQ WKH VDPH JURXSV RI FKLFNHQV VXJJHVWLQJ WKDW WKH\ UHSUHVHQW WKH VDPH HY ORFXV 7DEOH f 7KHVH LQFOXGH WKH t NE %DP8O SDLU DQG NE (FR5O EDQG UHSUHVHQWLQJ WKH HY6/O ORFXV WKH NE %DP8O EDQG DQG t NE (FR5O SDLU UHSUHVHQWLQJ WKH HY6/ ORFXV DQG WKH NE %DP8O EDQG DQG t NE eFR5, SDLU 7KH QXPEHU RI HY ORFL SHU ELUG IRU %/ DQG 6/ FKLFNHQV LV VKRZQ LQ )LJXUH (Y ORFL ZHUH GHILQHG DV XQLTXH UHVWULFWLRQ IUDJPHQW EDQGV RU EDQG SDLUV DV GHVFULEHG DERYH IRU HDFK UHVWULFWLRQ HQ]\PH GLJHVW +XJKHV HW DO f 7KH UDQJH IRU WKH QXPEHU RI HY ORFL SHU ELUG ZDV IRU %/ DQG 6/ FKLFNHQV DV GHWHFWHG E\ 6RXWKHUQ EORWV RI %DP8O GLJHVWV DQG DV GHWHFWHG E\ 6RXWKHUQ EORWV RI (FR5O GLJHVWV 7KH DYHUDJH QXPEHU RI HY ORFL SHU ELUG GLG QRW GLIIHU VLJQLILFDQWO\ EHWZHHQ WKH %/ DQG 6/ JURXSV ZLWK DYHUDJH QXPEHUV RI s IRU %/ Q f DQG s IRU 6/ Q f FKLFNHQV EDVHG RQ WKH %DP8O 6RXWKHUQ EORWV DQG s IRU %/ Q f DQG s IRU 6/ Q f FKLFNHQV EDVHG RQ WKH eFR5, 6RXWKHUQ EORWV 7KH %/ DQG 6/ %DP8O UHVWULFWLRQ IUDJPHQWV GR QRW FRPLJUDWH ZLWK WKH :KLWH /HJKRUQ ORFL HYO RU HY GDWD QRW VKRZQf 7KH NE %DP8O IUDJPHQW SUHVHQW LQ QHDUO\ DOO %/ DQG 6/ FKLFNHQV FRPLJUDWHV ZLWK HYO GDWD QRW VKRZQf EXW LWV LGHQWLW\ WR HYO LV UXOHG RXW E\ WKH DEVHQFH RI (FR5$ IUDJPHQWV RI WKH DSSURSULDWH VL]H +XJKHV HW DO f $OWKRXJK VWDQGDUG PDUNHUV IRU DOO NQRZQ HY ORFL KDYH QRW EHHQ FRPSDUHG WR WKH HY6/ ORFL E\ 6RXWKHUQ EORW DQDO\VLV FRPSDULVRQ RI WKH UHVWULFWLRQ IUDJPHQW VL]HV VXPPDUL]HG LQ 7DEOH ZLWK SXEOLVKHG GDWD IRU HY ORFL DOUHDG\ UHSRUWHG IRU :KLWH /HJKRUQV +XPSKULHV HW DO 5RYLJDWWL DQG $VWULQ f %URZQ /HJKRUQV 5RQIRUW HW DO

PAGE 134

$ % ‘ %/ ’ 6/ 7RWDO QXPEHU RI HY ORFL SUHVHQW ),* %/ DQG 6/ FKLFNHQV KDYH VLPLODU WRWDO QXPEHUV RI HY ORFL 7KH QXPEHUV RI HY ORFL GHWHFWHG LQ LQGLYLGXDO %/ DQG 6/ FKLFNHQV E\ $f %DP+O DQG %f eFR5, UHVWULFWLRQ GLJHVWV DUH SORWWHG DJDLQVW WKH QXPEHU RI ELUGV ZLWK HDFK QXPEHU RI ORFL )LOOHG EDUV %/ RSHQ EDUV 6/

PAGE 135

f DQG EURLOHUV %RLOOLRX HW DO f VXJJHVWV WKDW %/ DQG 6/ FKLFNHQV DUH FKDUDFWHUL]HG E\ XQLTXH HY ORFL ,Q SDUWLFXODU QRQH RI WKH UHVWULFWLRQ IUDJPHQWV UHSUHVHQWLQJ HY6/ ORFL RI LQWHUHVW LH HY6/O WKURXJK HY6/ FRUUHVSRQG LQ VL]H ZLWK WKRVH RI SUHYLRXVO\ LGHQWLILHG HY ORFL 7DNHQ WRJHWKHU WKHVH GDWD VXJJHVW WKDW D ODUJH QXPEHU RI SUHYLRXVO\ XQGHVFULEHG HY ORFL DUH VHJUHJDWLQJ LQ %/ DQG 6/ FKLFNHQ &RPSDULVRQ RI %/ DQG 6/ HY JHQRW\SHV 6WDWLVWLFDO DQDO\VHV RI WKH IUHTXHQFLHV IRU WKH SUHVHQFH DQG DEVHQFH RI HY ORFL LQ %/ DQG 6/ FKLFNHQV DUH VKRZQ LQ 7DEOH IRU WKH %DP+O DQG &FR5, UHVWULFWLRQ GLJHVWV )RXU HY ORFL ZKLFK ZH KDYH GHVLJQDWHG DV HY6/O WKURXJK HY6/ ZHUH REVHUYHG WR EH SUHVHQW LQ VLJQLILFDQWO\ KLJKHU SURSRUWLRQV LQ 6/ WKDQ LQ %/ FKLFNHQV S E\ )LVKHUV H[DFW WHVWf 7KH HY6/O DQG HY6/ ORFL DUH LGHQWLILHG RQ ERWK WKH %DP+O DQG WKH (FR5O 6RXWKHUQ EORWV ZKHUHDV HY6/ DQG HY6/ DUH LGHQWLILHG RQ %DP+O RU (FR5O EORWV UHVSHFWLYHO\ )LJXUHV DQG 7DEOH f 7KH QXPEHU RI HY6/ ORFL GHWHFWHG SHU ELUG DQG WKH HY6/ ORFXV FRPELQDWLRQV REVHUYHG DUH VKRZQ LQ )LJXUH 0RVW 6/ FKLFNHQV f KDYH RU PRUH HY6/ ORFL ZKHUHDV PRVW %/ FKLFNHQV f KDYH RQH RU QRQH $V DOUHDG\ QRWHG DERYH HY6/ LV SUHVHQW LQ b f RI WKH 6/ FKLFNHQV WHVWHG EXW LV SUHVHQW LQ RQO\ b f RI WKH %/ FKLFNHQV 7KH HY6/O ORFXV LV DEVHQW IURP WKH %/ VDPSOH SRSXODWLRQ EXW SUHVHQW LQ b f RI WKH 6/ FKLFNHQV WHVWHG 7KH HY6/ DQG HY6/ ORFL ZHUH SUHVHQW LQ b f DQG b f RI 6/ FKLFNHQV UHVSHFWLYHO\ DQG LQ RQO\ b f DQG b f RI %/ FKLFNHQV UHVSHFWLYHO\ $V VKRZQ LQ )LJXUH WKH RQO\ HY6/ FRPELQDWLRQV REVHUYHG LQ HLWKHU WKH %/ RU 6/ ZHUH HY6/ HY6/ HY6/ DQG DOO IRXU HY6/ ORFL

PAGE 136

$ ‘R 1XPEHU RI HY6/ SUHVHQW % HY6/ FRPELQDWLRQV SUHVHQW ‘ %/ ’ 6/ WR 8f ),* 6/ FKLFNHQV KDYH PRUH HY6/ ORFL WKDQ %/ FKLFNHQV $f 7KH QXPEHUV RI HY6/ ORFL GHWHFWHG LQ LQGLYLGXDO %/ DQG 6/ FKLFNHQV DUH SORWWHG DJDLQVW WKH SHUFHQW RI ELUGV ZLWK HDFK QXPEHU RI ORFL %f 7KH HY6/ JHQRW\SHV SUHVHQW DUH SORWWHG DJDLQVW WKH SHUFHQW RI ELUGV ZLWK HDFK JHQRW\SH )LOOHG EDUV %/ RSHQ EDUV 6/

PAGE 137

2WKHU VLJQLILFDQW GLIIHUHQFHV EHWZHHQ %/ DQG 6/ FKLFNHQV ZHUH REVHUYHG WKDW FRUUHODWHG ZLWK WKH UHODWLYH DEVHQFH RI VRPH HY ORFL LQ 6/ FKLFNHQV $V PDQ\ DV VHYHQ HY ORFL ZKLFK ZH KDYH QRW DVVLJQHG DQ\ GHVLJQDWLRQV SHQGLQJ IXUWKHU FKDUDFWHUL]DWLRQ ZHUH REVHUYHG WR EH SUHVHQW LQ VLJQLILFDQWO\ KLJKHU SURSRUWLRQV LQ %/ WKDQ LQ 6/ FKLFNHQV S E\ )LVKHUV H[DFW WHVWf 7KH HY ORFL WKDW DUH SUHVHQW LQ VLJQLILFDQWO\ KLJKHU SURSRUWLRQV RI %/ WKDQ 6/ FKLFNHQV LQFOXGH WKH DQG NE %DP+O IUDJPHQWV DQG WKH t NE (FR5O IUDJPHQW SDLU DQG WKH DQG NE eFR5, IUDJPHQWV 7DEOH f 7KHVH GDWD VXJJHVW WKDW HY ORFL PD\ EH XVHIXO DV JHQHWLF PDUNHUV WR GLVWLQJXLVK EHWZHHQ %/ DQG 6/ FKLFNHQV DQGRU RWKHU FKLFNHQ OLQHV &RPSDULVRQ RI 6/ SURJUHVVRU DQG 6/ QRQSURJUHVVRU HY JHQRW\SHV 7KH HY JHQRW\SHV ZHUH FRPSDUHG IRU 6/ VXESRSXODWLRQV GHILQHG RQ WKH EDVLV RI WKHLU PD[LPXP VWDJH RI DPHODQRVLV LQ RUGHU WR GHWHUPLQH ZKHWKHU WKHUH ZDV DQ\ FRUUHODWLRQ EHWZHHQ WKH SUHVHQFH RI VSHFLILF HY ORFL ZLWK WKH YLWLOLJR SKHQRW\SH 1R VLJQLILFDQW GLIIHUHQFHV LQ WKH IUHTXHQF\ RI LQGLYLGXDO HY ORFXV SUHVHQFH FRXOG EH DVVRFLDWHG ZLWK WKH 6/ SURJUHVVRU VWDJHV f SKHQRW\SH DV FRPSDUHG WR WKH 6/ QRQSURJUHVVRU VWDJH f SKHQRW\SH 7DEOH f 7KH QXPEHU RI HY6/ ORFL GHWHFWHG SHU ELUG DQG WKH HY6/ ORFXV FRPELQDWLRQV SUHVHQW ZHUH VLPLODU LQ 6/ SURJUHVVRUV DQG QRQSURJUHVVRUV 7KHVH GDWD VXJJHVW WKDW LQ FRQWUDVW WR WZR RWKHU FKLFNHQ PRGHOV RI DXWRLPPXQLW\ 6JRQF HW DO =LHPLHFNL HW DO f WKHUH LV QR XQLTXH HY ORFXV DVVRFLDWHG ZLWK YLWLOLJR LQ WKH 6/ FKLFNHQ

PAGE 138

7DEOH )UHTXHQFLHV RI HY ORFL GHWHFWHG LQ 6/ SURJUHVVLQJ Sf DQG QRQSURJUHVVLQJ QSf FKLFNHQV %DP +, KDQG IOF.O 6/S SUHVHQW 6/S DKVHQW 6/QS SUHVHQW 6/QS DEVHQW 6/ S YV QS 39 ORFL (FR 5, KDQG INKO 6/S SUHVHQW 6/S DKVHQW 6/QS SUHVHQW 6/QS DKVHQW 6/ S YV QS HY ORFL t QV HY6/O t QV HY6/ QV t QV QV t QV QV HY6/ t QV QV QV QV HY6/ QV QV QV QV QV HY6/ QV QV QV HY6/O QV QV 7KH WDEOH VKRZV WKH QXPEHU RI FKLFNHQV LQ ZKLFK HDFK %DP +, DQG (FR 5, EDQG RU SDLU RI EDQGV LV SUHVHQW DQG DEVHQW )LJV t f QV QRW VLJQLILFDQW S )LVKHUV H[DFW WHVW SUREDELOLW\ YDOXH

PAGE 139

'LVFXVVLRQ 7KH LQKHULWDQFH RI YLWLOLJR LQ WKH 6P\WK OLQH DQLPDO PRGHO LV SRO\JHQLF LQ QDWXUH DQG VKRZV ORZ SHQHWUDQFH LQ RXWFURVV PDWLQJV 6P\WK HW DK f 7KH LQFLGHQFH DQG VHYHULW\ RI WKH DPHODQRVLV DQG RWKHU DVVRFLDWHG DXWRLPPXQH GHIHFWV K\SRWK\URLGLVP DQG DORSHFLDOLNH IHDWKHULQJ GHIHFWf LQ WKH 6/ FKLFNHQ DUH LQIOXHQFHG E\ D YDULHW\ RI IDFWRUV ERWK JHQHWLF DQG HQYLURQPHQWDO $OWKRXJK WKH PDMRU KLVWRFRPSDWLELOLW\ FRPSOH[ 0+&f LV DQ LPSRUWDQW JHQHWLF IDFWRU DV HYLGHQFHG E\ GLIIHUHQFHV LQ GLVHDVH VHYHULW\ DQG DJH RI RQVHW DVVRFLDWHG ZLWK GLIIHUHQW 0+& DOOHOHV LQ 6/ VXEOLQHV (UI HW DK Df WKH %/ DQG 6/ FKLFNHQV XVHG LQ WKLV VWXG\ ZHUH 0+&PDWFKHG WKXV UXOLQJ RXW 0+& LQIOXHQFH 2WKHU JHQHWLF IDFWRUV DSSHDU WR LQFOXGH LQKHUHQW PHODQRF\WH GHIHFWV PHODQLQ SLJPHQWDWLRQ JHQHV PHODQRF\WHVWLPXODWLQJ KRUPRQH DQG VH[ KRUPRQHV UHYLHZHG LQ 6P\WK f 7KH YDU\LQJ LQFLGHQFH RI DPHODQRVLV LQ GLIIHUHQW 6/ EUHHGLQJ FRORQLHV IURP b VXJJHVWV WKDW VRPH HQYLURQPHQWDO IDFWRUV PD\ EH DVVRFLDWHG ZLWK KRXVLQJ FRQGLWLRQV 0F&RUPDFN DQG 6P\WK XQSXEOLVKHGf +XPDQ YLWLOLJR DOVR DSSHDUV WR EH SRO\JHQLF DQG LV VXJJHVWHG WR UHVXOW IURP UHFHVVLYH DOOHOHV DW VHYHUDO XQOLQNHG DXWRVRPDO ORFL EDVHG RQ H[WHQVLYH IDPLOLDO DJJUHJDWLRQ RI YLWLOLJR %KDWLD HW DK 0DMXPGHU HW DK f DQG WKH REVHUYDWLRQ WKDW b RI SUREDQGV DUH UHSRUWHG WR KDYH DW OHDVW RQH ILUVWGHJUHH UHODWLYH DIIHFWHG E\ YLWLOLJR 1DWK HW DK f ,W KDV EHHQ VSHFXODWHG WKDW VLPXOWDQHRXV DOWHUDWLRQV LQ VHYHUDO JHQHV DUH UHTXLUHG WR FDXVH GLVHDVH RU LQFUHDVH VXVFHSWLELOLW\ HJ PXWDWLRQV LQ JHQHV FRQWUROOLQJ PHODQRF\WH JURZWK DQG VXUYLYDO DQGRU WKH LPPXQH UHVSRQVH /DFRXU DQG

PAGE 140

2UWRQQH f &DQGLGDWH JHQHV IRU YLWLOLJR VXVFHSWLELOLW\ PLJKW EH VXJJHVWHG E\ GHIHFWV LQ HQ]\PHV LQYROYHG LQ PHODQRJHQHVLV DQG FDWHFKRODPLQH PHWDEROLVP WKDW KDYH EHHQ DVVRFLDWHG ZLWK YLWLOLJR +DODEDQ DQG 0RHOOPDQQ $XVWLQ DQG %RLVV\ 6DO]HU DQG 6FKDOOUHXWHU 6FKDOOUHXWHU HW DO f $OWKRXJK WKHUH DUH VRPH UHSRUWV WKDW VSHFLILF +/$ FODVV RU ,, DOOHOHV DUH DVVRFLDWHG ZLWK YLWLOLJR LQ VRPH KXPDQ SRSXODWLRQV 'XQVWRQ DQG +DGOHU 9HQQHFNHU HW DO $QGR HW DO DO )RX]DQ HW DO f RWKHU LQYHVWLJDWRUV UHSRUW QR VXFK DVVRFLDWLRQ 6FKDOOUHXWHU HW DO +XDQJ HW DO f ,Q WKLV VWXG\ ZH KDYH WDNHQ DGYDQWDJH RI WKH JHQHWLFV RI HQGRJHQRXV YLUXVHV LQ FKLFNHQV WR H[SORUH WKH SRVVLELOLW\ WKDW HQGRJHQRXV YLUXVHV PD\ SOD\ D UROH LQ JHQHWLF VXVFHSWLELOLW\ WR YLWLOLJR LQ WKH DYLDQ PRGHO 1HDUO\ DOO FKLFNHQV KDYH HY ORFL ZKLFK PD\ EH VLOHQW RU H[SUHVVHG DV YLUDO SURWHLQV RU LQIHFWLRXV YLUXV DQG HY JHQH H[SUHVVLRQ FDQ LQIOXHQFH WKH FRXUVH RI LQIHFWLRQ E\ H[RJHQRXV DYLDQ OHXNRVLV YLUXV 5RYLJDWWL DQG $VWULQ f 7KHUH DUH UHSRUWHG DVVRFLDWLRQV EHWZHHQ YDULRXV VSHFLILF HY ORFL DQG FRPPHUFLDOO\ LPSRUWDQW SURGXFWLRQ WUDLWV LQ FKLFNHQV *RYRUD HW DO ,UDTL HW DO f KRZHYHU LW ZDV WKH WZR UHSRUWV RI DVVRFLDWLRQ RI QRYHO HY ORFL ZLWK WZR RWKHU DXWRLPPXQH GLVHDVHV WKDW SURPSWHG XV WR H[DPLQH HY ORFL LQ 6/ FKLFNHQV LQFOXGLQJ WKH 26 FKLFNHQ ZLWK VSRQWDQHRXV KHUHGLWDU\ WK\URLGLWLV =LHPLHFNL HW DO f DQG WKH 8&' DQG OLQHV ZLWK KHUHGLWDU\ V\VWHPLF VFOHURGHUPDOLNH FRQQHFWLYH WLVVXH GLVHDVH 6JRQF HW DO f 7KHUH DUH VHYHUDO SRVVLEOH UROHV RI HY ORFL LQ VXVFHSWLELOLW\ WR DXWRLPPXQH GLVHDVHV 2QH SRVVLELOLW\ LV WKDW RQH RU PRUH HY ORFL GLVUXSWV D JHQH H[SUHVVHG LQ WKH WDUJHW WLVVXH FRQWULEXWLQJ WR DQ LQFUHDVHG VXVFHSWLELOLW\ WR DXWRLPPXQH UHFRJQLWLRQ RU LQ

PAGE 141

O\PSKRF\WHV UHVXOWLQJ LQ D SRVVLEOH EUHDNGRZQ RI QRUPDO VHOIWROHUDQFH $Q H[DPSOH RI VXFK DQ LQVHUWLRQDO PXWDJHQHVLV HYHQW LQ DQ DXWRLPPXQH GLVHDVH ZDV UHSRUWHG E\ :X DQG FROOHDJXHV f ZKR REVHUYHG WKDW LQWHJUDWLRQ RI DQ HQGRJHQRXV UHWURYLUXV KDV RFFXUUHG LQ WKH )DV DSRSWRVLVUHJXODWLQJ JHQH RI 05/OSUOSU PLFH $OWHUQDWLYHO\ HY ORFL PD\ UHSUHVHQW JHQHWLF PDUNHUV IRU OLQNHG VXVFHSWLELOLW\ JHQHV $ WKLUG SRVVLELOLW\ LV WKDW RQH RU PRUH HY ORFL SURGXFHV LQIHFWLRXV YLUDO SDUWLFOHV UHVXOWLQJ LQ D VRPDWLF UHLQIHFWLRQ RI FHOOV LQYROYHG LQ WKH DXWRLPPXQH SURFHVV DV VXJJHVWHG DERYH :KHWKHU KXPDQ HQGRJHQRXV YLUXVHV DUH LQYROYHG LQ YLWLOLJR UHPDLQV WR EH GHWHUPLQHG DOWKRXJK WKHLU SRVVLEOH LQYROYHPHQW LQ KXPDQ QHRSODVWLF DQG DXWRLPPXQH GLVHDVH KDV EHHQ VXJJHVWHG +RKHQDGO HW DO 8PRYLW] DQG 0XUSK\ f :H LGHQWLILHG IRXU HY ORFL WKDW DUH SUHVHQW DW VWDWLVWLFDOO\ VLJQLILFDQWO\ KLJKHU IUHTXHQFLHV LQ 6/ WKDQ %/ FKLFNHQV DQG DQ DGGLWLRQDO VHYHQ HY ORFL FKDUDFWHULVWLF RI %/ FKLFNHQV 7KH SUHGRPLQDQFH RI WKH HY6/ ORFL PD\ KDYH RULJLQDWHG GXULQJ WKH RULJLQDO VHOHFWLRQ RI 6/ FKLFNHQV DQGRU PD\ KDYH EHHQ LQWURGXFHG GXULQJ GHULYDWLRQ RI WKH 6/ IURP RXWFURVVHV ZLWK RWKHU FKLFNHQ OLQHV 6P\WK HW DO f :KHQ WKH HY JHQRW\SHV IRU 6/ SURJUHVVRUV DQG QRQSURJUHVVRUV ZHUH FRPSDUHG WKHUH ZDV QR VLJQLILFDQW DVVRFLDWLRQ RI HY ORFL ZLWK WKH DXWRLPPXQH SKHQRW\SH WKXV LQ FRQWUDVW WR WKH 26 DQG 8&' DYLDQ PRGHOV RI RWKHU KXPDQ DXWRLPPXQH GLVHDVHV ZH ILQG QR HYLGHQFH IRU D UROH RI HY ORFL LQ WKH SDWKRJHQHVLV RI YLWLOLJR LQ WKH 6/ FKLFNHQ DQLPDO PRGHO 3RVVLEOH UROHV IRU HQGRJHQRXV YLUXVHV LQ WKH SDWKRJHQHVLV RI DYLDQ DPHODQRVLV PLJKW EH GHWHFWDEOH ZLWK DGGLWLRQDO H[SHULPHQWV '1$ PHWK\ODWLRQ KDV EHHQ VXJJHVWHG DV EHLQJ SDUWLDOO\ UHVSRQVLEOH IRU WKH ORZ H[SUHVVLRQ RI VRPH DYLDQ HQGRJHQRXV YLUXVHV $Q LQKLELWRU RI '1$ PHWK\ODWLRQ D]DF\WLGLQH FDQ LQGXFH WKH H[SUHVVLRQ RI YLUDO

PAGE 142

SDUWLFOHV LQ HY FRQWDLQLQJ FKLFNHQ HPEU\R FHOOV 5RYLJDWWL DQG $VWULQ f D]DF\WLGLQH WUHDWPHQW DFWLYDWHV VLOHQW JHQHV DQG SURPRWHV FHOOXODU GLIIHUHQWLDWLRQ D]DF\WLGLQH KDV EHHQ VKRZQ WR LQFUHDVH WKH LQFLGHQFH RI DXWRLPPXQH WK\URLGLWLV LQ WKH VXVFHSWLEOH SDUHQWDO OLQH &RUQHOO & VWUDLQf RI WKH 2EHVH VWUDLQ FKLFNHQ 6FKDXHQVWHLQ HW DO f &KURQLF ORZ GRVH DGPLQLVWUDWLRQ RI D]DF\WLGLQH LQGXFHG DPHODQRVLV LQ WKH JHQHWLFDOO\ VXVFHSWLEOH %URZQ /LQH FKLFNHQV EXW QRW WKH PRUH GLVWDQWO\ UHODWHG /%/ FKLFNHQV 6UHHNXPDU HW DK f +RZHYHU WKH HIIHFWV RI D]DF\WLGLQH WUHDWPHQW RQ HY JHQH H[SUHVVLRQ LQ %/ DQG 6/ FKLFNHQV KDYH QRW EHHQ UHSRUWHG ,I H[SHULPHQWDO HYLGHQFH LV IRXQG WR LPSOLFDWH D SDUWLFXODU HY ORFXV LQ WKH SDWKRJHQHVLV RI YLWLOLJR LW FRXOG EH LGHQWLILHG LQ D JHQRPLF OLEUDU\ XVLQJ DSSURSULDWH SUREHV DQG UHVWULFWLRQ PDSSLQJ FORQHG DQG WKHQ VHTXHQFHG LQ RUGHU WR GHWHUPLQH KRPRORJ\ ZLWK WKDW RI NQRZQ UHWURYLUXVHV ,Q VLWX K\EULGL]DWLRQ RI WKH VSHFLILF HY VHTXHQFH FDQ EH XVHG DV D SUREH WR PHWDSKDVH FKURPRVRPHV WR ORFDOL]H WKH HY ORFL 6L[ HY ORFL LQ FKLFNHQV KDYH EH PDSSHG WR FKURPRVRPH DORQH 7HUHED HW DK 7HUHED DQG $VWULQ f ,Q DGGLWLRQ WKH SKHQRW\SH RI WKH HY ORFXV ZRXOG EH FKDUDFWHUL]HG IRU WKH SUHVHQFH RI WKH JV DQWLJHQ LQGLUHFW LPPXQRIORXUHVFHQFHf RI WKH FKI IXVLRQ ZLWK WKH 4 FHOO OLQHf GHWHFWLRQ RI WKH YLUXV ZKLFK VXEJURXSf RU YLUDO SURWHLQV IURP WKH FXOWXUH VXSHUQDWDQW DQG WKH VXVFHSWLELOLW\ WR RWKHU VXEJURXSV RI WKH $/9569 JURXS +XPSKULHV HW DK Df (QGRJHQRXV UHWURYLUXVHV DUH LQ VXEJURXS ( DQG DUH QRQRQFRJHQLF XQOLNH WKH $/9V RI WKH H[RJHQRXV YLUXVHV IRXQG LQ VXEJURXSV $ % & DQG ([SUHVVLRQ RI VXEJURXS ( YLUDO SURWHLQV KHOSV PDNH WKH FHOOV UHIUDFWRU\ WR LQIHFWLRQ E\ RWKHU YLUXVHV RI WKH VDPH VXEJURXS &HOOV FRQWDLQLQJ HY HY DQGRU HY

PAGE 143

KDYH D UHGXFHG VXVFHSWLELOLW\ WR LQIHFWLRQ WR H[RJHQRXV VXEJURXS ( YLUXV 5RYLJDWWL DQG $VWULQ 5RELQVRQ HW DO f 7KH KHWHURJHQHLW\ RI WKH HQGRJHQRXV YLUDO ORFL GHWHFWHG LQ WKLV VWXG\ IRU WKH 6/ DQG %/ FKLFNHQV LV LQWHUHVWLQJ FRQVLGHULQJ WKH IDFW WKDW WKH 6/ ZDV GHULYHG IURP WKH %/ 7KLV PD\ EH GXH WR WKH RXWFURVVLQJV XVHG WR HVWDEOLVK WKH 6/ 6P\WK HW DO f LH WKH RXWFURVVLQJ WR %DUUHG 3O\PRXWK 5RFN /LJKW %URZQ /HJKRUQV DQG D UDQGRPEUHHGLQJ PHDW VWRFN PD\ KDYH LQWURGXFHG DGGLWLRQDO HY ORFL $Q DOWHUQDWLYH DSSURDFK WR JHQHWLF PDSSLQJ RI YLWLOLJR VXVFHSWLELOLW\ LV JHQRPHn ZLGH JHQHWLF OLQNDJH DQDO\VLV 6HWV RI SULPHU SDLUV IRU PLFURVDWHOOLWH JHQHWLF PDUNHUV DUH QRZ DYDLODEOH IURP WKH 86 3RXOWU\ *HQH 0DSSLQJ 3URMHFW 0DSSLQJ EDFNFURVV SURJHQ\ ZLWK WKHVH PDUNHUV ZLOO DVVLVW LQ WKH LGHQWLILFDWLRQ RI FDQGLGDWH UHJLRQV DVVRFLDWHG ZLWK YLWLOLJR &DQGLGDWH JHQHV PD\ XOWLPDWHO\ EH LGHQWLILHG ZLWKLQ WKHVH JHQRPLF LQWHUYDOV ZKLFK FDQ WKHQ EH DQDO\]HG IRU JHQH H[SUHVVLRQ LGHQWLW\ RI WKH SURWHLQ PXWDWLRQDO DQDO\VLV DQG IXQFWLRQDO DVVD\V WR GHWHUPLQH WKH FDXVH RI DPHODQRVLV 2QH DSSURDFK WR H[DPLQH JHQH H[SUHVVLRQ ZRXOG PDNH XVH RI D]DF\WLGLQH WUHDWHG %/ FKLFNHQV 1RUWKHUQ EORW DQDO\VLV FRXOG EH XVHG WR FRPSDUH JHQH H[SUHVVLRQ LQ 6/ %/ D]DF\WLGLQHWUHDWHG %/ DQG /%/ FKLFNHQV 2QH PLJKW SUHGLFW GLIIHUHQFHV LQ H[SUHVVLRQ RI FDQGLGDWH JHQHV ZKHQ FRPSDULQJ WKH D]DF\WLGLQHWUHDWHG %/ DQG 6/ WR XQWUHDWHG %/ DQG /%/ FKLFNHQV ,QWHUHVWLQJO\ RI WKH DSSUR[LPDWHO\ %/ FKLFNHQV ZH KDYH UDLVHG ZH KDYH UHFHQWO\ LGHQWLILHG RQH %/ FKLFNHQ H[SUHVVLQJ DPHODQRVLV VWDJH f 7KH HY JHQRW\SH RI WKLV DPHODQRWLF %/ FKLFNHQ UHVHPEOHG D 6/ JHQRW\SH LH DOO IRXU HY6/ ORFL ZHUH SUHVHQW DQG VHYHUDO HY ORFL FKDUDFWHULVWLF RI %/ FKLFNHQV ZHUH DEVHQW GDWD QRW VKRZQf

PAGE 144

VXJJHVWLQJ WKDW WKH JHQRPH RI WKLV LQGLYLGXDO %/ FKLFNHQ LV PRUH VLPLODU WR 6/ FKLFNHQV WKDQ WR RWKHU %/ FKLFNHQV 7KLV REVHUYDWLRQ LV FRQVLVWHQW ZLWK WKH K\SRWKHVLV WKDW WKH b LQFLGHQFH RI DPHODQRVLV REVHUYHG LQ %/ FKLFNHQV 6P\WK HW DO f LV GXH WR WKH FKDQFH FRPELQDWLRQV RI PXOWLSOH UHFHVVLYH YLWLOLJR VXVFHSWLELOLW\ JHQHV VHJUHJDWLQJ LQ WKH %URZQ OLQH DQG WKDW WKHVH JHQHV ZHUH VHOHFWHG IRU GXULQJ WKH GHULYDWLRQ RI WKH 6P\WK OLQH ,Q FRQFOXVLRQ DOWKRXJK ZH ILQG QR HYLGHQFH RI OLQNDJH RI HY ORFL ZLWK WKH YLWLOLJR SKHQRW\SH LQ 6/ FKLFNHQV RXU UHVXOWV VXJJHVW WKDW %/ DQG 6/ FKLFNHQV EHDU FRQVLGHUDEOH JHQHWLF SRO\PRUSKLVPV DQG ZLOO WKHUHIRUH SURYLGH D XVHIXO PRGHO IRU IXUWKHU JHQHWLF GLVVHFWLRQ RI YLWLOLJR VXVFHSWLELOLW\

PAGE 145

&+$37(5 6800$5< $1' )8785( ',5(&7,216 $V DXWRLPPXQH GLVHDVHV DUH H[SORUHG PDQ\ KDYH ZLWQHVVHG WKDW ILQGLQJ D VLPSOH DQVZHU LV GRXEWIXO 7KH SURFHVV RI DPHODQRVLV IRXQG LQ WKH 6P\WK OLQH FKLFNHQ LV DQRWKHU H[DPSOH RI D FRPSOH[ VLWXDWLRQ 7KHUH LV REYLRXV HYLGHQFH WKDW LW LV D SRO\JHQLF SKHQRPHQRQ 7KUHH VXEOLQHV RI WKH 6P\WK OLQH FKLFNHQ H[LVW DV WKH %A2O %A DQG WKH %A 7KH %A VXEOLQH KDV WKH TXLFNHVW RQVHW DQG JUHDWHVW VHYHULW\ EXW DOO WKUHH KDG D KLJK LQFLGHQFH RI DPHODQRVLV EHWZHHQ b DQG b
PAGE 146

0DVVDFKXVHWWV b RI WKH 6/ GHYHORSHG DPHODQRVLV ,Q FRPSDULVRQ WKH 8) 6/ FRORQ\ LV FKDUDFWHUL]HG E\ D b LQFLGHQFH RI DPHODQRVLV ZKLOH WKH FRORQ\ RI 'U (UI 8QLYHUVLW\ RI $UNDQVDVf ZKLFK LV UDLVHG XQGHU VSHFLILF SDWKRJHQIUHH FRQGLWLRQV KDV DQ HYHQ ORZHU LQFLGHQFH RI DPHODQRVLV SHUVRQDO FRPPXQLFDWLRQf 7KH %URZQ OLQH FKLFNHQV RI WKH VDPH 0+& KDSORW\SH A KDYH D VXVFHSWLELOLW\ RI b 2QH %/ %/ GLG VSRQWDQHRXVO\ EHFRPH DPHODQRWLF DW WKH VDPH HDUO\ RQVHW DQG VHYHULW\ RI FRQGLWLRQ DV WKH W\SLFDO 6/ ZHfYH VWXGLHG 7KH %/ KRVWV LQ WKH DGRSWLYH WUDQVIHU H[SHULPHQWV WKDW GHPRQVWUDWHG DPHODQRVLV PLJKW LQGHHG KDYH KDG WKH JHQHWLF FRPELQDWLRQ WR EH PRUH VXVFHSWLEOH WR GHYHORS DPHODQRVLV RQ WKHLU RZQ DV GHPRQVWUDWHG LQ WKH %/ 3HUKDSV WKH WUDQVIHUUHG FHOOV KHOSHG WR SRWHQWLDWH DQG TXLFNHQ ZKDW ZDV DOUHDG\ WKHUH 7KLV ZRXOG UHIOHFW WKH ZRUN RI :LFNHUfV ODE 7KH\ IHOW WKDW WKH WUDQVIHU RI VSOHQRF\WHV IURP DIIHFWHG 12' PLFH LQWR \RXQJ 12' IHPDOHV \LHOGHG WKH TXLFNHU RQVHW DQG VHYHULW\ WR DOUHDG\ VXVFHSWLEOH JHQHWLFV ZLWKLQ WKH KRVWV :LFNHU HW DO f 7KH IDFW WKDW WKH VSOHQRF\WHV ZHUH DEOH WR WUDQVIHU VXVFHSWLELOLW\ WR WKH %/ KRVWV LV DQ LQGLFDWLRQ WKDW 7 FHOOV PHGLDWH VRPH DVSHFW RI DPHODQRVLV $V FLWHG EHIRUH WKH ZRUNV RI $XVWLQ HW DO f %RLVV\ HW DO f DQG /DPRQW HW DO f KDYH SURYHQ D UROH RI DXWRDQWLERGLHV E\ EXUVHFWRP\ ZKLFK EDVLFDOO\ HOLPLQDWHV WKH % FHOO SRSXODWLRQ LQ FKLFNHQV 7KH DQWLPHODQRF\WH DXWRDQWLERGLHV GHWHFWHG PHODQRF\WH SURWHLQV RI N'D PROHFXODU ZHLJKWV DQG WKH ODWHVW HYLGHQFH VKRZV WKDW WKHVH UHSUHVHQW ELQGLQJ WR WKH SRVVLEOH DXWRDQWLJHQ 7US 7KH GUXJ F\FORVSRULQ DQ LQKLELWRU RI DOO 7 FHOOV KDV EHHQ VKRZQ WR VXSSUHVV DPHODQRVLV LQ WKH 6/ FKLFNHQ 3DUGXH f 7KH H[SHULPHQWV GHVFULEHG KHUHLQ SURYLGH WKH ILUVW LQ YLYR HYLGHQFH WKDW 7 FHOOV FDQ DW OHDVW

PAGE 147

WUDQVIHU D SRWHQWLDWLRQ RI WKH DPHODQRWLF GLVHDVH VXVFHSWLELOLW\ IRXQG LQ WKH 6P\WK FKLFNHQ ,W ZRXOG WKXV EH ZRUWK H[SDQGLQJ WKHVH 7 FHOO WUDQVIHU H[SHULPHQWV $V VWDWHG HDUOLHU IHZHU UHVWULFWLRQV WR WKH H[SHULPHQW QHHG WR EH LQ SODFH WR EHWWHU DVVXUH LWV VXFFHVV ZRXOG VXJJHVW DQ H[SHULPHQW SDWWHUQHG XVLQJ D VHULHV RI UHSHDWHG GRQDWLRQV RI DIIHFWHG 6/ VSOHQRF\WHV XVLQJ F\FORSKRVSKDPLGH WR SURYLGH WKH LPPXQRVXSSUHVVLRQ &\FORSKRVSKDPLGH GRHV QRW DIIHFW 7 FHOOV DQG XQWUHDWHG FKLFNV DUH UHSRUWHG WR KDYH D EHWWHU VXUYLYDO UDWH 7RLYDQHQ HW DO /HKWRQHQ HW DO f $ GRVH GHSHQGHQFH FXUYH VKRXOG EH JHQHUDWHG WR RSWLPL]H WKH TXDOLW\ RI LPPXQRVXSSUHVVLRQ GHVSLWH WKH VDFULILFH RI DQ LQLWLDO VHW RI ELUGV $ PRUH SDWKRJHQOLPLWHG HQYLURQPHQW LQ ZKLFK WR UDLVH WKH LPPXQRFRPSURPLVHG KRVWV GXULQJ WKH LQLWLDO UHFRYHU\ IURP LPPXQRVXSSUHVVLRQ LV VXJJHVWHG 7KH XVH RI D]DF\WLGLQH PD\ KHOS WR SRWHQWLDWH WKH PDQLIHVWDWLRQ RI WKH DPHODQRWLF SKHQRW\SH RI WKH KRVWV DV VHHQ LQ WKH ZRUN E\ 6UHHNXPDU DQG FROOHDJXHV f EXW LW PLJKW GLVJXLVH WKH FHOO WUDQVIHU 0LWRJHQVWLPXODWLRQ VXFK DV E\ &RQ$ RI WKH GRQRU VSOHQRF\WHV PD\ DOVR KHOS WR SRWHQWLDWH WKH REVHUYDWLRQ RI DPHODQRVLV LQ WKH WUDQVIHU KRVWV ,I UHSHDWDEOH UHVXOWV FRQWLQXH WKHQ 7 FHOO VXEVHWV PD\ IXUWKHU KHOS GHILQH WKH LQYROYHG DXWRLPPXQH 7 FHOOV 6HSDUDWLRQ RI FKLFNHQ 7 FHOO VXEVHWV LV PDGH SRVVLEOH ZLWK DYDLODEOH UHDJHQWV WKDW LQFOXGH \ 7 FHOOV DS 7 FHOOV H[SUHVVLQJ 9SL JHQHV DQG DS 7 FHOOV H[SUHVVLQJ 9S JHQHV ZKLFK DUH LGHQWLILHG E\ WKH PRXVH PRQRFORQDO DQWLERGLHV 7&5 7&5 DQG 7&5 UHVSHFWLYHO\

PAGE 148

$ 7&5 UHSHUWRLUH DQDO\VLV RI WKH UHJHQHUDWLQJ IHDWKHU PD\ FKDUDFWHUL]H WKH H[SDQVLRQ WKDW DSSHDUV WR EH LQGLFDWHG LQ WKH LQWHQVH O\PSKRF\WLF LQILOWUDWLRQ RI WKH SXOS DV UHSRUWHG LQ WKH ZRUN RI (UI HW DO D Ef &RXQWV RI FHOOV LQ FU\RVHFWLRQV VWDLQHG ZLWK PRXVH DQWL7&5 DQWLERGLHV KDYH LQGLFDWHG KLJK SUHVHQFH IRU ERWK &' DQG &' 7 FHOOV H[SUHVVLQJ SUHGRPLQDQWO\ D3 7&5 EHDULQJ 9SL LH 7&5f 6R WKH UHSHUWRLUH DQDO\VLV VKRXOG VWLOO EH LQLWLDOO\ H[DPLQLQJ 9SL ,I DQ ROLJRFORQDO H[SDQVLRQ RI FHUWDLQ UHFXUULQJ VXEVHWVf RI 7 FHOOV LV GHWHFWHG IURP WKH IHDWKHU DQDO\VLV WKHQ LW PLJKW EH SRVVLEOH WR LVRODWH D VXEVHW RI 7 FHOOV IURP UHJHQHUDWLQJ IHDWKHUV ZKLFK FRXOG EH FXOWXUHG VWLPXODWHG ZLWK &RQ$ DQG WKHQ WUDQVIHUUHG LQWR ZHHN %/ KRVWV 7KLV SRSXODWLRQ PLJKW EH PRUH UHIOHFWLYH RI WKH DXWRDQWLJHQDFWLYDWHG FHOOV WKDQ VSOHQLF FHOOV 0RUH LPSRUWDQWO\ WKLV ZRXOG OHDG WR SRVVLEOH LPPXQRWKHUDS\ 0RQRFORQDO DQWLERGLHV GLUHFWHG DJDLQVW WKH VSHFLILF 9S FKDLQ IRU H[DPSOHf PLJKW EH XVHG WR LQDFWLYDWH WKDW DXWRUHDFWLYH VXEVHW RI 7 FHOOV ZKLOH OHDYLQJ WKH UHVW RI WKH 7 FHOO UHSHUWRLUH LQWDFW 7KLV 9S VHOHFWLYH WKHUDS\ KDV EHHQ SHUIRUPHG H[SHULPHQWDOO\ LQ WKH WUHDWPHQW RI FKURQLF UHODSVLQJ ($( LQ 6-/PLFH E\ :KLWKDP DQG FROOHDJXHV f 7KLV ZRXOG EULGJH WKH ZRUN EHWZHHQ WKH 7&5 UHSHUWRLUH DQDO\VLV DQG WKH DGRSWLYH WUDQVIHU VWXGLHV %\ GHWHFWLQJ HQGRJHQRXV YLUXV LQWHJUDWLRQV DV LQKHULWDEOH VWDEOH HOHPHQWV LQ WKH JHQRPHV RI WKH 6P\WK OLQH FKLFNHQ IRXU QRYHO ORFL HY6/f KDYH EHHQ LGHQWLILHG WKDW PD\ EH XVHG DV JHQHWLF PDUNHUV IRU YLWLOLJR VXVFHSWLELOLW\ LQ WKLV FKLFNHQ $OWKRXJK WKHVH ORFL ZHUH QRW XQLTXH WR RQO\ WKH 6/ ELUGV GLVSOD\LQJ WKH DPHODQRWLF SKHQRW\SH LW PD\ VWLOO EH SRVVLEOH WR ILQG ORFL WKDW DUH FRUUHODWHG ZLWK WKH GLVHDVH $VVRFLDWLRQV RI QRYHO HYORFL KDYH EHHQ IRXQG LQ WKH WZR RWKHU PDMRU FKLFNHQ PRGHOV IRU DXWRLPPXQLW\ WKH 26

PAGE 149

FKLFNHQ IRU WK\URLGLWLV DQG WKH 8'& DQG 8&' FKLFNHQV IRU V\VWHPLF VFOHURGHUPD $Q LPSURYHPHQW LQ SRVVLEO\ GHWHFWLQJ YLWLOLJR VXVFHSWLELOLW\ JHQHV LV WR XVH D JHQRPHZLGH OLQNDJH DQDO\VLV PDSSLQJ EDFNFURVV SURJHQ\ EHWZHHQ WKH 6/ DQG %/ FKLFNHQV 8VLQJ SULPHU SDLUV IRU PLFURVDWHOOLWH JHQHWLF PDUNHUV IURP WKH 86 3RXOWU\ *HQH 0DSSLQJ 3URMHFW ZRXOG OLNH WR LGHQWLI\ FDQGLGDWH JHQHWLF LQWHUYDOV WKDW DUH DVVRFLDWHG ZLWK YLWLOLJR 7KLV ZRXOG DVVLVW LQ WKH LGHQWLILFDWLRQ RI YLWLOLJRDVVRFLDWHG FDQGLGDWH UHJLRQV 7KH FDQGLGDWH JHQHV PD\ EH LGHQWLILHG IURP WKHVH FDQGLGDWH UHJLRQV E\ SK\VLFDO PDSSLQJ
PAGE 150

:KDW KDV VWLOO QRW EHHQ DGGUHVVHG LV WKH LQKHUHQWO\ GHIHFWLYH PHODQRF\WH LWVHOI 6WLOO DYDLODEOH DUH RULJLQDO SODQV WR SHUIRUP DQWLERG\ GHSHQGHQW FHOO F\WRWR[LFLW\ DVVD\V 7KHVH ZRXOG FRQVLVW RI LQFXEDWLQJ FXOWXUHG 6/ RU %/ PHODQRF\WHV DOO RI WKH KDSORW\SHf IURP FXOWXUHV ZLWK HLWKHU DIIHFWHG RU QRQDIIHFWHG 6/ VHUD RU %/ VHUD DQG HLWKHU :KLWH /HJKRUQ FRPSOHPHQW RU :KLWH /HJKRUQ VSOHHQ FHOOV DV HIIHFWRUV RI F\WRWR[LFLW\ 7KLV ZLOO H[DPLQH WKH VXUIDFH H[SUHVVLRQ RI WKH 6/ PHODQRF\WH DQG GHWHFW DEHUUDQW H[SUHVVLRQ RI PHODQRF\WH DXWRDQWLJHQV DV FRPSDUHG WR WKDW H[SUHVVHG E\ %/ 6XFK DXWRDQWLJHQV PLJKW EH WKRVH LQYROYHG LQ PHODQLQ SURGXFWLRQ LQFOXGLQJ 753 ,I WKH VHUD RI WKH 6/ FDQ DFWLYDWH WKH GHVWUXFWLRQ RI ERWK %/ DQG 6/ PHODQRF\WHV RU LI WKH VHUD RI WKH %/ FDQ QRW DFWLYDWH WKH GHVWUXFWLRQ RI HLWKHU RI WKH PHODQRF\WHV WKHQ WKH PHODQRF\WH LV QRW GLIIHUHQW EHWZHHQ WKH WZR VWUDLQV DW OHDVW DW WKH OHYHO RI VXUIDFH H[SUHVVLRQ RI NH\ DXWRDQWLJHQV ([SHULPHQWV GHWHFWLQJ GLIIHUHQFHV LQ 51$ DQG SURWHLQ H[SUHVVLRQ EHWZHHQ 6/ DQG %/ PHODQRF\WHV DQG 7 O\PSKRF\WHV DUH DQRWKHU GLUHFWLRQ 7KLV ZRXOG UHTXLUH WKDW D OLEUDU\ RI SULPHUV IRU FKLFNHQ F\WRNLQHV EH UHDGLO\ DYDLODEOH XQOHVV RQH LV ZLOOLQJ WR RSWLPL]H WKH FRQGLWLRQV IRU XVLQJ PDPPDOLDQ SULPHUV &XOWXUHV ZRXOG LQFOXGH 7 FHOOV PHODQRF\WHV DQG $3&V 3&5 DPSOLILFDWLRQ IURP P51$ LVRODWHG IURP WKH FXOWXUHV ZRXOG DOORZ WKH GHWHFWLRQ RI WKH W\SHV RI F\WRNLQHV UHOHDVHG E\ WKH 7 FHOOV 7KH LGHQWLILFDWLRQ RI ,/ UHFHSWRUV PD\ EH GHWHFWHG DV ZHOO $ F'1$ OLEUDU\ RI WKH P51$ SURGXFHG E\ FXOWXUHG PHODQRF\WHV FRXOG EH HVWDEOLVKHG )URP WKH VXUYH\ FRQGXFWHG LGHQWLW\ RI FDQGLGDWH YLWLOLJR VXVFHSWLEOH ORFL FDQ EH GHWHUPLQHG 7KH F'1$ ZRXOG EH FORQHG LQWR YHFWRUV DQG WKH '1$ RI FDQGLGDWH YLWLOLJR VXVFHSWLEOH ORFL VHTXHQFHG 7KH VHTXHQFH FRXOG EH WUDQVODWHG LQWR DQ DPLQR DFLG

PAGE 151

VHTXHQFH DQG FRPSDUHG ZLWK VHTXHQFHV VXEPLWWHG LQ *HQ%DQN RU VLPLODU GDWDEDVH 7KLV PD\ FKDUDFWHUL]H DQG UHYHDO WKH SRVVLEOH DEHUUDQW QDWXUH RI WKH 6/ PHODQRF\WH 7KH QDWXUH RI WKH SURWHLQV H[SUHVVHG PD\ UHYHDO SRVVLEOH HSLWRSH GLIIHUHQFHV EHWZHHQ WKH 6/ DQG %/ PHODQRF\WHV ,W PD\ FRQILUP RU FRUURERUDWH ZLWK WKH ZRUN RI %RLVV\ DQG FROOHDJXHV LQ WKH LGHQWLILFDWLRQ RI DXWRDQWLJHQV $XVWLQ HW DO $XVWLQ DQG %RLVV\ f ,W PD\ OHDG WR RUDO LPPXQRWKHUDS\ H[SHULPHQWV XVLQJ SHSWLGH DGPLQLVWUDWLRQV VLPLODU WR WKH DGPLQLVWUDWLRQV RI 0%3 LQWR ($( PLFH DQG *$' LQWR 12' PLFH WR LQGXFH WROHUDQFH 7KXV WKLV ZDV P\ VWXG\ RI DPHODQRVLV LQ WKH 6P\WK OLQH FKLFNHQ DV DQ DQLPDO PRGHO IRU WKH DXWRLPPXQH GLVHDVH RI KXPDQ YLWLOLJR 9LWLOLJR LV MXVW RQH SLHFH LQ WKH DXWRLPPXQH SX]]OH $V RQH RI PDQ\ DXWRLPPXQH GLVHDVHV LW LV P\ KRSH DV ZHOO DV RWKHUV WKDW D FRPPRQ IDFWRU RU WKHPH RI IDFWRUV FDQ EH IRXQG DQG WKDW ZRXOG LQ VRPH ZD\ KDYH KHOSHG LPSURYH WKH OLYHV RI PDQ\

PAGE 152

/,67 2) 5()(5(1&(6 $EEDV $. /LFKWPDQ $+ DQG 3REHU -6 &HOOXODU DQG 0ROHFXODU ,PPXQRORJ\ :% 6DXQGHUV &RPSDQ\ $EGHO1DVHU 0% /XGZLJ :' *ROOQLFN + DQG 2UIDQRV &( 1RQVHJPHQWDO YLWLOLJR GHFUHDVH RI WKH &'5$ 7FHOO VXEVHW DQG HYLGHQFH IRU SHULSKHUDO 7 FHOO DFWLYDWLRQ ,QW 'HUPDWRO f $FKHD2UEHD + 0LWFKHOO '7LPPHUPDQQ / :UDLWK '& 7DXVFK *6 :DOGRU 0. =DPYLO 66 0F'HYLWW +2 DQG 6WHLQPDQ / /LPLWHG KHWHURJHQHLW\ RI 7 FHOO UHFHSWRUV IURP O\PSKRF\WHV PHGLDWLQJ DXWRLPPXQH HQFHSKDORP\HOLWLV DOORZV VSHFLILF LPPXQH LQWHUYHQWLRQ &HOO f $KQ 6. &KRL (+ /HH 6+ :RQ -+ +DUP 6. DQG 3DUN <. ,PPXQRKLVWRFKHPLFDO VWXGLHV IURP YLWLOLJRf§FRPSDULVRQ EHWZHHQ DFWLYH DQG LQDFWLYH OHVLRQV
PAGE 153

$QGR &KL +, 1DNDJDZD + DQG 2WVXND ) 'LIIHUHQFH LQ FOLQLFDO IHDWXUHV DQG +/$ DQWLJHQV EHWZHHQ IDPLOLDO DQG QRQIDPLOLDO YLWLOLJR RI QRQVHJPHQWDO W\SH %U 'HUPDWRO f $UGHQ % &ODUN 63 .DEHOLW] DQG 0DN 7: +XPDQ 7FHOO UHFHSWRU YDULDEOH JHQH VHJPHQW IDPLOLHV ,PPXQRJHQHWLFV f $UGHQ % &ODUN 63 .DEHOLW] DQG 0DN 7: 0RXVH 7FHOO UHFHSWRU YDULDEOH JHQH VHJPHQW IDPLOLHV ,PPXQRJHQHWLFV f $VKDQ\ +LQHV *KDUDYL $ 0RXUDGLDQ DQG (ONRQ .% $QDO\VLV RI DXWRDQWLERG\ SURGXFWLRQ LQ 6&,'V\VWHPLF OXSXV HU\WKHPDWRVXV 6/(f FKLPHUDV &OLQ ([S ,PPXQRO f $VWULQ 60 %XVV (* DQG +D\ZDUG :6 (QGRJHQRXV YLUDO JHQHV DUH QRQ HVVHQWLDO LQ WKH FKLFNHQ 1DWXUH $XVWLQ /0 DQG %RLVV\ 5( 0DPPDOLDQ W\URVLQDVHUHODWHG SURWHLQ LV UHFRJQL]HG E\ DXWRDQWLERGLHV IURP YLWLOLJLQRXV 6P\WK FKLFNHQV $Q DYLDQ PRGHO IRU KXPDQ YLWLOLJR $P 3DWKRO f $XVWLQ /0 %RLVV\ 5( -DFREVRQ %6 DQG 6P\WK -5 -U 7KH GHWHFWLRQ RI PHODQRF\WH DXWRDQWLERGLHV LQ WKH 6P\WK OLQH FKLFNHQ PRGHO IRU YLWLOLJR &OLQ ,PPXQRO ,PPXQRSDWKRO f %DGUL $0 7RGG 30 *DULRFK -*XGJHRQ -( 6WHZDUW '* DQG *RXGLH 5 % $Q LPPXQRKLVWRORJLFDO VWXG\ RI FXWDQHRXV O\PSKRF\WHV LQ YLWLOLJR 3DWKRO f %DJFKL 1 %URZQ 75 DQG 6XQGLFN 56 7K\URLG FHOO LQMXU\ LV DQ LQLWLDO HYHQW LQ WKH LQGXFWLRQ RI DXWRLPPXQH WK\URLGLWLV E\ LRGLQH LQ REHVH VWUDLQ FKLFNHQ (QGRFULQRORJ\ f %DUNHU &) DQG %LOOLQJKDP 5( ,PPXQRORJLFDOO\ SULYLOHJHG VLWHV $GY ,PPXQRO %DPDED 9 9LUXVHV KLGGHQ VHOIHSLWRSHV DQG DXWRLPPXQLW\ ,PPXQRO 5HY %DPDED 9 )UDQFR $ DQG %DOVDQR ) $XWRLPPXQH FKURQLF OLYHU GLVHDVH DV D PRGHO RI KXPDQ DXWRLPPXQLW\ &OLQ ([S 5KHXPDWRO 6XSSO 6 %HFNV *3 DQG %XUURZ *1 7K\URLG GLVHDVH DQG SUHJQDQF\ 0HG &OLQ 1RUWK $P f

PAGE 154

%HOO 6 &UDQDJH 0 %RU\VLHZLF] / DQG 0LQVRQ 7 ,QGXFWLRQ RI ,PPXQRJOREXOLQ )F UHFHSWRUV E\ 5HFRPELQDQW 9DFFLQLD YLUXVHV ([SUHVVLQJ JO\FRSURWHLQV ( DQG RI +HUSHV 6LPSOH[ 9LUXV W\SH 9LURO f %HQQHWW '& *HQHWLFV GHYHORSPHQW DQG PDOLJQDQF\ RI PHODQRF\WHV ,QWHUQDWLRQDO 5HY RI &\WRORJ\ %KDWLD 36 0RKDQ / 3DQGH\ 21 6LQJK .. $URUD 6 DQG 0XNKLMD 5' *HQHWLF QDWXUH RI YLWLOLJR 'HUPDWRO 6FL f %RLVV\ 5( 3HUVLVWHQFH RI DEQRUPDO PHODQRF\WHV LQ LPPXQRVXSSUHVVHG FKLFNHQV RI WKH DXWRLPPXQH f'$0f OLQH &HOO 7LVVXH 5HV f %RLVV\ 5( DQG +DODEDQ 5 (VWDEOLVKPHQW RI SUROLIHUDWLYH SXUH FXOWXUHV RI SLJPHQWHG FKLFNHQ PHODQRF\WHV IURP QHXUDO WXEHV ,QYHVW 'HUPDWRO f %RLVV\ 5( /LX << 0HGUDQR (( DQG 1RUGOXQG -6WUXFWXUDO DEHUUDWLRQ RI WKH URXJK HQGRSODVPLF UHWLFXOXP DQG PHODQRVRPH FRPSDUWPHQWDOL]DWLRQ LQ ORQJWHUP FXOWXUHV RI PHODQRF\WHV IURP YLWLOLJR SDWLHQWV ,QYHVW 'HUPDWRO f %RLVV\ 5( 0RHOOPDQQ 7UDLQHU $7 6P\WK -5 -U DQG /HPHU $% 'HOD\HGDPHODQRWLF '$0 RU 6P\WKf FKLFNHQ PHODQRF\WH G\VIXQFWLRQ LQ YLYR DQG LQ YLWUR ,QYHVW 'HUPDWRO f %RLVV\ 5( 6P\WK -5 -U DQG )LWH .9 3URJUHVVLYH F\WRORJLFDO FKDQJHV GXULQJ WKH GHYHORSPHQW RI GHOD\HG IHDWKHU DPHODQRVLV DQG DVVRFLDWHG FKRURLG GHIHFWV LQ WKH '$0 FKLFNHQ OLQH $ YLWLOLJR PRGHO $P 3DWKRO f %RXOOLRX $ /H3HQQHF -3 +XEHUW 'RQDO 5 DQG 6PLOH\ 0 5HVWULFWLRQ IUDJPHQW OHQJWK SRO\PRUSKLVP DQDO\VLV RI HQGRJHQRXV DYLDQ OHXNRVLV YLUDO ORFL GHWHUPLQDWLRQ RI IUHTXHQFLHV LQ FRPPHUFLDO EURLOHU OLQHV 3RXOWU\ 6FLHQFH f %R\OH 0/ ,,, 3DUGXH 6/ DQG 6P\WK -5 -U (IIHFW RI FRUWLFRVWHURQH RQ WKH LQFLGHQFH RI DPHODQRVLV LQ 6P\WK GHOD\HG DPHODQRWLF OLQH FKLFNHQV 3RXOWU\ 6FLHQFH f %URFNH 6 *DXU $ 3LHUF\ & *DXWDP $ *LMEHOV )DWKPDQ &* DQG 6WHLQPDQ / ,QGXFWLRQ RI UHODSVLQJ SDUDO\VLVLQ H[SHULPHQWDO DXWRLPPXQH HQFHSKDORP\HOLWLV E\ EDFWHULDO VXSHUDQWLJHQ 1DWXUH

PAGE 155

%URZQ 75 6XQGLFN 56 'KDU $ 6KHWK DQG %DJFKL 1 8SWDNH DQG PHWDEROLVP RI LRGLQH LV FUXFLDO IRU WKH GHYHORSPHQW RI WK\URLGLWLV LQ REHVH VWUDLQ FKLFNHQV &OLQ ,QYHVW f %XH\ 53 &KHQ &/ &LKDN /RVFK 8 DQG &RRSHU 0' $YLDQ 7 FHOOV H[SUHVVLQJ \ UHFHSWRUV ORFDOL]H LQ WKH VSOHQLF VLQXVRLGV DQG WKH LQWHVWLQDO HSLWKHOLXP ,PPXQRO f %XH\ 53 /L ;X ; &KDU DQG &KHQ &+ (IIHFW RI F\FORVSRULQ $ RQ WKH RQWRJHQ\ RI GLIIHUHQW 7 FHOO VXEOLQHDJHV LQ FKLFNHQV ,PPXQRO f %XFKW $ 6RGHUVWURP (VLQ 6 *UQHZDOG +DJHOEHUJ 6 0DJQXVVRQ :LJ]HOO + *URQEHUJ $ DQG .LHVVOLQJ 5 $QDO\VLV RI \ 9 UHJLRQ XVDJH LQ QRUPDO DQG GLVHDVHG KXPDQ LQWHVWLQDO ELRSVLHV DQG SHULSKHUDO EORRG E\ SRO\PHUDVH FKDLQ UHDFWLRQ 3&5f DQG IORZ F\WRPHWU\ &OLQ ([S ,PPXQRO f %XPV )5 /L ;% 6KHQ 1 2IIQHU + &KRX <. 9DQGHQEDUN $$ DQG +HEHU .DW] ( %RWK UDW DQG PRXVH 7 FHOO UHFHSWRUV VSHFLILF IRU WKH HQFHSKDOLWRJHQLF GHWHUPLQDQW RI P\HOLQ EDVLF SURWHLQ XVH VLPLODU 9 DOSKD DQG 9 EHWD FKDLQ JHQHV HYHQ WKRXJK WKH PDMRU KLVWRFRPSDWLELOLW\ FRPSOH[ DQG HQFHSKDOLWRJHQLF GHWHUPLQDQWV EHLQJ UHFRJQL]HG DUH GLIIHUHQW ([S 0HG f &HP\ $ )HUUDUL & DQG &KLVDUL )9 7KH FODVV UHVWULFWHG F\WRWR[LF 7 O\PSKRF\WH UHVSRQVH WR SUHGHWHUPLQHG HSLWRSHV LQ WKH KHSDWLWLV % DQG & YLUXVHV &XUU 7RSLFV 0LFURELRO ,PPXQRO 6SULQJHU 1HZ
PAGE 156

&KHQ &+ 6RZGHU -7 /DKWL -0 &LKDN /RVFK 8 DQG &RRSHU 0' 7&5 $ WKLUG 7 FHOO UHFHSWRU LQ WKH FKLFNHQ 3URF 1DWO $FDG 6FL 86$ f &KRPF]\QVNL 3 6LQJOHVWHS PHWKRG RI 51$ LVRODWLRQ E\ DFLG JXDQLGLQLXP WKLRF\DQDWHSKHQROFKORURIRUP H[WUDFWLRQ $QDO %LRFKHP f &KXUFK *0 DQG *LOEHUW : *HQRPLF VHTXHQFLQJ 3URF 1DWO $FDG 6FL 86$ f &LKDN +RIIPDQQ)H]HU 5ROOHU $ .DVSHUV % 0HUNOH + +DOD :LFN DQG /RVFK 8 3UHIHUHQWLDO 7&5 9 EHWD JHQH XVDJH E\ DXWRUHDFWLYH 7 FHOOV LQ VSRQWDQHRXV DXWRLPPXQH WK\URLGLWLV RI WKH REHVH VWUDLQ RI FKLFNHQV $XWRLPPXQ f &RIILQ -0 5HWURYLULGDH DQG WKHLU UHSOLFDWLRQ )XQGDPHQWDO 9LURORJ\ QG HG &KDSWHU :LOOLDP ( 3DXO (Gf 5DYHQ 3UHVV 1HZ
PAGE 157

'LHWULFK 3< &DLJQDUG $ /LP $ &KXQJ 9 3LFR -/ 3DQQHWLHU & .RXULOVN\ 3 +HUFHQG 7 (YHQ DQG 7ULHEHO ) ,Q YLYR 7FHOO FORQDO DPSOLILFDWLRQ DW WLPH RI DFXWH JUDIWYHUVXVKRVW GLVHDVH %ORRG f 'RXYDV $ DQG 6REHOPDQ 6 0XOWLSOH RYHUODSSLQJ KRPRORJLHV EHWZHHQ WZR UKHXPDWRLG DQWLJHQV DQG LPPXQRVXSSUHVVLYH YLUXVHV 3URF 1DWO $FDG 6FL 86$ f 'XQFDQ 05 %HUPDQ % 9DQ GH :DWHU %R\G 5/ :LFN DQG *HUVKZLQ 0( 0RQRQXFOHDU FHOOV LVRODWHG IURP ILEURWLF VNLQ OHVLRQV LQ DYLDQ VFOHURGHUPD FRQVWLWXLWLYHO\ SURGXFH ILEUREODVWDFWLYDWLQJ F\WRNLQHV DQG ,PPXQRJOREXOLQ 0 ,QW $UFK $OOHUJ\ ,PPXQRO f 'XQFDQ 05 :LOVRQ 79DQ GH :DWHU %HUPDQ % %R\G 5 :LFN DQG *HUVKZLQ 0( &XOWXUHG ILEUREODVW LQ DYLDQ VFOHURGHUPD DQ DXWRLPPXQH ILEURWLF GLVHDVH GLVSOD\ DQ DFWLYDWHG SKHQRW\SH $XWRLPPXQLW\ f 'XQRQ DQG ,PKRI %$ 7 FHOO PLJUDWLRQ GXULQJ RQWRJHQ\ DQG 7 FHOO UHSHUWRLUH JHQHUDWLRQ ,Q ,PPXQRORJ\ DQG 'HYHORSPHQWDO %LRORJ\ RI WKH &KLFNHQ 2 9DLQLR DQG %$ ,PKRI (GVf &XUU 7RS 0LFUR ,PPXQRO 6SULQJHU 1HZ
PAGE 158

)XQN 3( DQG 7KRPSVRQ &% &XUUHQW FRQFHSWV LQ FKLFNHQ % FHOO GHYHORSPHQW ,Q ,PPXQRORJ\ DQG 'HYHORSPHQWDO %LRORJ\ RI WKH &KLFNHQ 2 9DLQLR DQG %$ ,PKRI (GVf &XUU 7RS 0LFUR ,PPXQRO 6SULQJHU 1HZ
PAGE 159

+DODEDQ 5 DQG 0RHOOPDQQ :KLWH PXWDQWV LQ PLFH VKHGGLQJ OLJKW RQ KXPDQV ,QYHVW 'HUPDWRO 6XSSO f 66 +DQDIXVD 7 6XJLKDUD 6 )XMLQR.XULKDUD + 0L\DJDZD -, 0L\D]DNL $
PAGE 160

+XPSKULHV (+ 'DQKRI 0/ DQG +OR]DQHN &KDUDFWHUL]DWLRQ RI HQGRJHQRXV YLUDO ORFL LQ ILYH OLQHV RI ZKLWH /HJKRUQ FKLFNHQV 9LURO f ,P 6 +DQQ 6. .LP +, .LP 16 DQG 3DUN <. %LRORJLF FKDUDFWHULVWLFV RI FXOWXUHG KXPDQ YLWLOLJR PHODQRF\WHV ,QWL 'HUPDWRO f ,QRXH 1LHVHQ 1 0LOJURP ) DQG $OELQL % 7UDQVIHU RI H[SHULPHQWDO DXWRLPPXQH WK\URLGLWLV E\ LQ VLWX SHUIXVLRQ RI WK\URLGV ZLWK LPPXQH VHUD &OLQ ,PPXQRO ,PPXQRSDWKRO f ,UDTL ) 'DUYDV $ =HLWOLQ %HFNPDQQ DQG 6ROOHU 0 1RQOLQHDU HIIHFWV RI FKLFNHQ HQGRJHQRXV YLUXVHV RQ ERG\ ZHLJKW PD\ EH UHVSRQVLEOH IRU PDLQWDLQLQJ WKHVH HOHPHQWV LQ D VWDEOH JHQHWLF SRO\PRUSKLVP 3RXOWU\ 6FL f -DQHZD\ &$ -U DQG 7UDYHUV 3 ,PPXQRELRORJ\ 7KH ,PPXQH 6\VWHP LQ +HDOWK DQG 'LVHDVH UG HG *DUODQG 1HZ
PAGE 161

.R]LHO 0'XGOH\ :RQJ -7 'LHQVWDJ +RXJKWRQ 0 5DOVWRQ 5 DQG :DONHU %' ,QWUDKHSDWLF F\WRWR[LF 7 O\PSKRF\WHV VSHFLILF IRU KHSDWLWLV & YLUXV LQ SHUVRQV ZLWK FKURQLF KHSDWLWLV ,PPXQRO f /D &DYD $ 1HOVRQ -/ 2OOLHU :( 0DF*UHJRU $ .H\VWRQH (& 7KRPH -& 6FDYXOOL -) %HUU\ && &DUVRQ '$ DQG $OEDQL 6 *HQHWLF ELDV LQ LPPXQH UHVSRQVHV WR D FDVVHWWH VKDUHG E\ GLIIHUHQW PLFURRUJDQLVPV LQ SDWLHQWV ZLWK UKHXPDWRLG DUWKULWLV &OLQ ,QYHVW f /DFRXU -3 DQG 2UWRQQH -3 *HQHWLFV RI YLWLOLJR $QQ 'HUPDWRO 9HQHUHDO /D)DFH '0 DQG 3HFN $% 5HFLSURFDO DOORJHQHLF ERQH PDUURZ WUDQVSODQWDWLRQ EHWZHHQ 12' PLFH DQG GLDEHWHVQRQVXFHSWLEOH PLFH DVVRFLDWHG ZLWK WUDQVIHU DQG SUHYHQWLRQ RI DXWRLPPXQH GLDEHWHV 'LDEHWHV f /DKWL -0 &KHQ &+ 7MRHONHU /: 3LFNHO -0 6FKDW .$ &DOQHN %: 7KRPSVRQ &% DQG &RRSHU 0' 7ZR GLVWLQFW DS 7 FHOO OLQHDJHV FDQ EH GLVWLQJXLVKHG E\ WKH GLIIHUHQWLDO XVDJH RI 7FHOO UHFHSWRU 9S JHQH VHJPHQWV 3URF 1DWO $FDG 6FL 86$ f /DPRQW 6DQG 6P\WK -5 -U (IIHFW RI EXUVHFWRP\ RQ GHYHORSPHQW RI D VSRQWDQHRXV SRVWQDWDO DPHODQRVLV &OLQ ,PPXQRO DQG ,PPXQRSDWKRO /DPRQW 6DQG 6P\WK -5 6HYHULW\ RI IHDWKHU DPHODQRVLV DQG YLVXDO GHIHFWV ZDV DVVRFLDWHG ZLWK LQFUHDVHG DQWLERG\ OHYHOV ,PPXQRORJLFDO &RPPXQLFDWLRQV f /DQJ )3 6FKDW] '$ 3ROORFN %+ 5LOH\ :0DFODUHQ 1. 'XPRQW'ULVFROO 0 DQG %DUUHWW ',QFUHDVHG 7 O\PSKRF\WHV EHDULQJ \ 7 FHOO UHFHSWRU LQ VXEMHFWV DW KLJK ULVN IRU LQVXOLQ GHSHQGHQW GLDEHWHV $XWRLPPXQLW\ f /HKPDQQ 39 )RUVWKXEHU 7 0LOOHU $ DQG 6HUFDU] (( 6SUHDGLQJ RI 7FHOO DXWRLPPXQLW\ WR FU\SWLF GHWHUPLQDQWV RI DQ DXWRDQWLJHQ 1DWXUH f /HKPDQQ 39 6HUFDU] (( )RUVWKXEHU 7 'D\DQ (0 DQG *DPPRQ 'HWHUPLQDQW VSUHDGLQJ DQG WKH G\QDPLFV RI WKH DXWRLPPXQH 7 FHOO UHSHUWRLUH ,PPXQRORJ\ 7RGD\ f /HKWRQHQ / 9DLQR 2 DQG 7RLYDQHQ 3 'LIIHUHQFH LQ % FHOOLQGXFHG WUDQVSODQWDWLRQ WROHUDQFH WR PDMRU KLVWRFRPSDWLELOLW\ FRPSOH[ DQWLJHQV LQ LUUDGLDWHG DQG F\FORSKRVSKDPLGHWUHDWHG FKLFNHQV 7UDQVSODQWDWLRQ 3URFHHGLQJV f

PAGE 162

/H 3RROH ,& YDQ GHQ :LMQJDDUG 50 :HVWHUKRI : DQG 'DV 3. 3UHVHQFH RI 7 FHOOV DQG PDFURSKDJHV LQ LQIODPPDWRU\ YLWLOLJR VNLQ SDUDOOHOV PHODQRF\WH GLVDSSHDUDQFH $P 3DWKRO f /H 3RROH ,& YDQ GHQ :LMQJDDUG 50 :HVWHUKRI : 'XWULH[ 53 DQG 'DV 3. 3UHVHQFH RU DEVHQFH RI PHODQRF\WHV LQ YLWLOLJR OHVLRQV DQ ,PPXQRKLVWRFKHPLFDO LQYHVWLJDWLRQ ,QYHVW 'HUPDWRO f /HPHU $% 6KLRKDUD 7 %RLVV\ 5( -DFREVRQ .$ /DPRUHX[ 0/ DQG 0RHOOPDQQ *( $ PRXVH PRGHO IRU YLWLOLJR ,QYHVW 'HUPDWRO f /LNH $$ :HULQJHU (+ROGDVK $ 0F)LOO 3 $WNLQVRQ DQG 5RVVLQL $$ $GRSWLYH WUDQVIHU RI DXWRLPPXQH GLDEHWHV PHOOLWXV LQ ELREUHHGLQJ:RUFHVWHU %%:f LQEUHG DQG K\EULG UDWV ,PPXQRO f /XFDV $0 DQG 6WHWWHQKHLP 35 $YLDQ $QDWRP\ ,QWHJXPHQW 3DUW DQG ,, $JULFXOWXUH +DQGERRN 86'$ LQ &RRSHUDWLRQ ZLWK 0LFKLJDQ $JULFXOWXUDO ([SHULPHQW 6WDWLRQ 0LFKLJDQ 6WDWH 8QLYHUVLW\ (DVW /DQVLQJ 0DF'RQDOG +5 6FKQHLGHU 5 /HHV 5. +RZH 5& $FKD2UEHD + )HVWHQVWHLQ + =LQNHPDJHO 50 DQG +HQJDUWQHU + 7FHOO UHFHSWRU 9S XVH SUHGLFWV UHDFWLYLW\ DQG WROHUDQFH WR 0OVDHQFRGHG DQWLJHQV 1DWXUH 0DFODUHQ 1. DQG $WNLQVRQ 0$ ,QVXOLQGHSHQGHQW GLDEHWHV PHOOLWXV WKH K\SRWKHVLV RI PROHFXODU PLPLFU\ EHWZHHQ LVOHW FHOO DQWLJHQV DQG PLFURRUJDQLVPV 0ROHFXODU 0HGLFLQH 7RGD\ f 0DMXPGHU 33 1RUGOXQG-DQG 1DWK 6. 3DWWHUQ RI IDPLOLDO DJJUHJDWLRQ RI YLWLOLJR $UFK 'HUPDWRO f 0DQGU\ 5& 2UWL] //XJR6RPROLQRV $ DQG 6DQFKH] -/ 2UJDQVSHFLILF DXWRDQWLERGLHV LQ YLWLOLJR SDWLHQWV DQG WKHLU UHODWLYHV ,QW 'HUPDWRO f 0DUUDFN 3 DQG .DSSOHU 6XEYHUVLRQ RI WKH ,PPXQH 6\VWHP E\ 3DWKRJHQV &HOO 0DWWKHZV 0% DQG 6KHQN 7 $GHQRYLUXV$VVRFLDWHG 51$ DQG 7UDQVODWLRQ &RQWURO 9LURO f 0F&RUPDFN :7 +XUOH\ ($ DQG 7KRPSVRQ &% *HUP OLQH PDLQWHQDQFH RI WKH SVHXGRJHQH GRQRU SRRO IRU VRPDWLF ,PPXQRJOREXOLQ JHQH FRQYHUVLRQ LQ FKLFNHQV 0RO &HOO %LRORJ\ f

PAGE 163

0F&RUPDFN :7 7MRHONHU /: 6WHOOD 3RVWHPD &( DQG 7KRPSVRQ &% &KLFNHQ 7FHOO UHFHSWRU FKDLQ GLYHUVLW\ DQ HYROXWLRQDULO\ FRQVHUYHG 'SHQFRGHG JO\FLQH WXUQ ZLWKLQ WKH K\SHUYDULDEOH &'5 GRPDLQ 3URF 1DWO $FDG 6FL 86$ f 0F&RUPDFN :7 7MRHONHU /: DQG 7KRPSVRQ &% $YLDQ % FHOO GHYHORSPHQW JHQHUDWLRQ RI DQ ,PPXQRJOREXOLQ UHSHUWRLUH E\ JHQH FRQYHUVLRQ $QQX 5HY ,PPXQRO 0LWVXQREX 0 DQG \i 7 FHOOV LQ LPPXQLW\ DJDLQVW LQWUDFHOOXODU EDFWHULDO SDWKRJHQ 1DWXUH 0RUHQR 9LJQDOL '$ 1DGLPL ) )XFKV 6 $GRULQL / DQG +DPPPHUOLQJ *) 3URFHVVLQJ RI DQ HQGRJHQRXV SURWHLQ FDQ JHQHUDWH 0+& FODVV ,, UHVWULFWHG 7 FHOO GHWHUPLQDQWV GLVWLQFW IURP WKRVH GHULYHG IURP H[RJHQRXV DQWLJHQ ,PPXQRO f 0RVPDQ 75 DQG &RIIPDQ 5/ 7KO DQG 7K FHOOV GLIIHUHQW SDWWHUQV RI O\PSKRNLQH VHFUHWLRQ OHDG WR GLIIHUHQW IXQFWLRQDO SURSHUWLHV $QQX 5HY ,PPXQRO 0XLU $ 3HFN $ &ODUH6DO]OHU 0 6RQJ <+ &RUQHOLXV /XFKHWWD 5 .ULVFKHU DQG 0DFODUHQ 1 ,QVXOLQ LPPXQL]DWLRQ RI QRQREHVH GLDEHWLF PLFH LQGXFHV D SURWHFWLYH LQVXOLWLV FKDUDFWHUL]HG E\ GLPLQLVKHG LQWUDLVOHW LQWHUIHURQ \ WUDQVFULSWLRQ &OLQ ,QYHVW f 0XLU $ 6FKDW] DQG 0DFODUHQ 1 $QWLJHQ VSHFLILF LPPXQRWKHUDS\ RUDO WROHUDQFH DQG VXEFXWDQHRXV LPPXQL]DWLRQ LQ WKH WUHDWPHQW RI LQVXOLQ GHSHQGHQW GLDEHWHV 'LDEHWHV 0HWDEROLVP 5HYLHZV f

PAGE 164

1DNDJDZD DQG +DUULVRQ /& 7KH SRWHQWLDO UROHV RI HQGRJHQRXV UHWURYLUXVHV LQ DXWRLPPXQLW\ ,PPXQRO 5HY 1DWK 6. 0DMXPGHU 33 DQG 1RUGOXQG -*HQHWLF HSLGHPLRORJ\ RI YLWLOLJR PXOWLORFXV UHFHVVLYLW\ FURVVYDOLGDWHG $P +XP *HQHW f 1RUULV '$ .LVVLQJHU 50 1DXJKWRQ *0 DQG %\VWU\Q -& (YLGHQFH IRU LPPXQRORJLF PHFKDQLVPV LQ KXPDQ YLWLOLJR SDWLHQWVf VHUD LQGXFH GDPDJH WR KXPDQ PHODQRF\WHV LQ YLWUR E\ FRPSOHPHQWPHGLDWHG GDPDJH DQG DQWLERG\ GHSHQGHQW FHOOXODU F\WRWR[LFLW\ ,QYHVW 'HUPDWRO f 1XFKWHP -* %LGGLVRQ :( DQG .ODXVQHU 5' &ODVV ,, 0+& PROHFXOHV FDQ XVH WKH HQGRJHQRXV SDWKZD\ RI DQWLJHQ SUHVHQWDWLRQ 1DWXUH 2OLYH & *DWHQE\ 3$ DQG 6HUMHDQWVRQ 6: 5HVWULFWHG MXQFWLRQDO GLYHUVLW\ RI 7 FHOO UHFHSWRU 3 JHQH UHDUUDQJHPHQWV H[SUHVVHG LQ V\VWHPLF OXSXV HU\WKHPDWRVXV 6/(f SDWLHQWV &OLQ ([S ,PPXQRO f 2UORZ 6%RLVV\ 5( 0RUDQ 'DQG 3LINR+LUVW 6 6XEFHOOXODU GLVWULEXWLRQ RI W\URVLQDVH DQG W\URVLQDVHUHODWHG SURWHLQ LPSOLFDWLRQV IRU PHODQRVRPDO ELRJHQHVLV ,QYHVW 'HUPDWRO f 2UWRQQH -3 DQG %RVH 6. 9LWLOLJR ZKHUH GR ZH VWDQG" 3LJPHQW &HOO 5HV f 2UWRQQH -3 0RVKHU '% DQG )LW]SDWULFN 7% 9LWLOLJR DQG RWKHU K\SHUPHODQRVHV RI KDLU DQG VNLQ ,Q 7RSLFV LQ 'HUPDWRORJ\ $ 3DUULVK DQG 7% )LW]SDWULFN (GVf 3OHQXP 0HGLFDO %RRN &RPSDQ\ 1HZ
PAGE 165

3KLOOLSV 01HHGKDP 0 DQG :HOOHU 52 5ROH RI FHUYLFDO O\PSK QRGHV LQ DXWRLPPXQH HQFHSKDORP\HOLWLV LQ WKH /HZLV 5DW 3DWKRO f 3URWD 3URJUHVV LQ WKH FKHPLVWU\ RI PHODQLQV DQG UHODWHG PHWDEROLWHV 0HGLFLQDO 5HVHDUFK 5HY f 3UHVWRQ )0 %HLHU 3/ DQG 3RSH -+ ,GHQWLILFDWLRQ RI WKH UHVSLUDWRU\ V\QF\WLDO YLUXVLQGXFHG LPPXQRVXSSUHVVLYH IDFWRU SURGXFHG E\ KXPDQ SHULSKHUDO EORRG PRQRQXFOHDU FHOOV LQ YLWUR DV LQWHUIHURQDOSKD ,QIHFW 'LV f 5DFNH 0. 6FRWW '( 4XLJOH\ / *UD\ *6 $EH 5 -XQH &+ DQG 3HUULQ 3'LVWLQFW UROHV IRU % &'f DQG % &'f LQ WKH LQLWLDWLRQ RI ([SHULPHQWDO $OOHUJLF (QFHSKDORP\HOLWLV &OLQ ,QYHVW f 5DPVLQJK 6, &KDSPDQ 1 DQG 7UDF\ 6 &R[DFNLHYLUXVHV DQG GLDEHWHV %LRHVVD\V f 5DXOHW '+ 7KH VWUXFWXUH IXQFWLRQ DQG PROHFXODU JHQHWLFV RI WKH \ 7 FHOO UHFHSWRU $QQ 5HY ,PPXQRO 5HJQDXOW $ &XPDQR $ 9DVVDOOL 3 *X\*UDQG DQG .RXULOVN\ 3 2OLJRFORQDO 5HSHUWRLUH RI WKH &'DD DQG WKH &'D3 7&5DS 0XULQH ,QWHVWLQDO ,QWUDHSLWKHOLDO 7 /\PSKRF\WHV (YLGHQFH IRU WKH 5DQGRP (PHUJHQFH RI 7 FHOOV ([S 0HG 5H\QDXG &$ $QTXH] 9 *ULPDO + DQG :HLOO -& $ K\SHUFRQYHUVLRQ PHFKDQLVP JHQHUDWHV WKH FKLFNHQ OLJKW FKDLQ SUHLPPXQH UHSHUWRLUH &HOO f 5H\QDXG &$ %HUWRFFL % 'DKDQ $ DQG :HLOO -& )RUPDWLRQ RI WKH FKLFNHQ % FHOO UHSHUWRLUH RQWRJHQHVLV UHJXODWLRQ RI ,J JHQH UHDUUDQJHPHQW DQG GLYHUVLILFDWLRQ E\ JHQH FRQYHUVLRQ $GY ,PPXQRO 5LGHU -5 2OOLHU :( /RFN 5%URRNHV 67 DQG 3DPSKLORQ '+ +XPDQ F\WRPHJDORYLUXV LQIHFWLRQ DQG V\VWHPLF OXSXV HU\WKHPDWRVXV &OLQ ([S 5KHXPDWRO f 5LFKHUW -5 5RELQVRQ (' &DPSKDXVHQ 0DUWLQ 5 9RVNXKO 55 )DHUEHU 00 0F)DUODQG +) DQG +XUOH\ &. 'LYHUVLW\ RI 7FHOO UHFHSWRU 9 DOSKD 9 EHWD DQG &'5 H[SUHVVLRQ E\ P\HOLQ EDVLF SURWHLQVSHFLILF KXPDQ 7FHOO FORQHV 1HXURORJ\ f

PAGE 166

5RELQVRQ +/ $VWULQ 60 6HQRLU $0 DQG 6DOD]DU )+ +RVW VXVFHSWLELOLW\ WR HQGRJHQRXV YLUXVHV GHIHFWLYH JO\FRSURWHLQ H[SUHVVLQJ SURYLUXVHV LQWHUIHUH ZLWK LQIHFWLRQV 9LURO 5RQIRUW & $IDQDVVLHII 0 &KHEORXQH < 'DPEULQH 1LJRQ 90 DQG 9HUGLHU ,GHQWLILFDWLRQ DQG 6WUXFWXUH DQDO\VLV RI (QGRJHQRXV 3URYLDO 6HTXHQFHV LQ D %URZQ /HJKRUQ &KLFNHQ 6WUDLQ 3RXOWU\ 6FL f 5RYLJDWWL 8* DQG $VWULQ 60 $YLDQ HQGRJHQRXV YLUDO JHQHV &XUU 7RS 0LFURELRO ,PPXQRO 5RZHQ / .RRS %) DQG +RRG / 7KH FRPSOHWH N% '1$ VHTXHQFH RI WKH KXPDQ 7 FHOO UHFHSWRU ORFXV 6FLHQFH 6DO]HU %$ DQG 6FKDOOUHXWHU .8 ,QYHVWLJDWLRQ RI WKH SHUVRQDOLW\ VWUXFWXUH LQ SDWLHQWV ZLWK YLWLOLJR DQG D SRVVLEOH DVVRFLDWLRQ ZLWK LPSDLUHG FDWHFKRODPLQH PHWDEROLVP 'HUPDWRORJ\ f 6DQFKH]*DUFLD )DQG 0F&RUPDFN :7 &KLFNHQ \ 7 FHOOV ,Q ,PPXQRORJ\ DQG 'HYHORSPHQWDO %LRORJ\ RI WKH &KLFNHQ 2 9DLQLR DQG %$ ,PKRI (GVf &XUU 7RS 0LFUR ,PPXQRO 6SULQJHU 1HZ
PAGE 167

6FKZDUW] 56 $XWRLPPXQLW\ DQG $XWRLPPXQH 'LVHDVHV LQ )XQGDPHQWDO ,PPXQRORJ\ UG HG :( 3DXO (Gf 5DYHQ 3UHVV /WG 1HZ
PAGE 168

6P\WK -5 -U 7KH 6P\WK FKLFNHQ D PRGHO IRU DXWRLPPXQH DPHODQRVLV &5& 5HY 3RXOW %LRO 6P\WK -5 -U %RLVV\ 5( DQG )LWH .9 7KH '$0 FKLFNHQ D PRGHO IRU VSRQWDQHRXV SRVWQDWDO FXWDQHRXV DQG RFXODU DPHODQRVLV +HUHG f 6RQJ < + &RQQRU ( =RURYLFK % /L < %DOGXFFL 3 DQG 0DFODUHQ 1 7KH UROH RI W\URVLQDVH LQ DXWRLPPXQH YLWLOLJR /DQFHW 6RQJ < + /L < DQG 0DFODUHQ 1. 7KH QDWXUH RI WKH DXWRDQWLJHQV WDUJHWHG LQ DXWRLPPXQH HQGRFULQH GLVHDVHV ,PPXQRO 7RGD\ f 6RURNLQ 5 .LPXUD + 6FKURGHU :LOVRQ '+ DQG :LOVRQ '% F\FORVSRULQLQGXFHG DXWRLPPXQLW\ FRQGLWLRQV IRU H[SUHVVLQJ GLVHDVH UHTXLUHPHQW IRU LQWDFW WK\PXV DQG SRWHQF\ HVWLPDWH RI DXWRLPPXQH O\PSKRF\WHV LQ GUXJ WUHDWHG UDWV ([S 0HG 6UHHNXPDU *3 (UI *) DQG 6P\WK -5 -U D]DF\WLGLQH WUHDWPHQW LQGXFHV DXWRLPPXQH YLWLOLJR LQ SDUHQWDO FRQWURO VWUDLQV RI WKH 6P\WK OLQH FKLFNHQ PRGHO IRU DXWRLPPXQH YLWLOLJR &OLQ ,PPXQRO ,PPXQRSDWKRO f 6WLQLVVHQ 3 9DQGHY\YHU & 0HGDHU 5 9DQGHJDHU / 1LHV / 7X\OV / +DIOHU '$ 5DXV DQG =KDQJ ,QFUHDVHG IUHTXHQF\ RI \ 7 FHOOV LQ FHUHEURVSLQDO IOXLG DQG SHULSKHUDO EORRG RI SDWLHQWV ZLWK PXOWLSOH VFOHURVLV UHDFWLYLW\ F\WRWR[LFLW\ DQG 7 FHOO UHFHSWRU 9 JHQH UHDUUDQJHPHQWV ,PPXQRO f 6XQGLFN 56 %DJFKL 1 DQG %URZQ 75 7KH UROH RI LRGLQH WK\URLG DXWRLPPXQLW\ IURP FKLFNHQV WR KXPDQV D UHYLHZ $XWRLPPXQLW\ f 7HUHED $ f 7HUPLQDO GHOHWLRQV DUH D FRPPRQ IHDWXUH RI HQGRJHQRXV UHWURYLUXV ORFL ORFDWHG RQ FKURPRVRPH RI ZKLWH /HJKRUQ FKLFNHQV 9LURO 7LVFK 5 DQG 0F'HYLWW + ,QVXOLQGHSHQGHQW GLDEHWHV PHOOLWXV &HOO f 7MRHONHU /: &DUOVRQ /0 /HH /DKWL 0F&RUPDFN :7 /HLGHQ -0 &KHQ &+ &RRSHU 0' DQG 7KRPSVRQ &% (YROXWLRQDU\ FRQVHUYDWLRQ RI DQWLJHQ UHFRJQLWLRQ WKH FKLFNHQ 7FHOO UHFHSWRU S FKDLQ 3URF 1DWO $FDG 6FL 86$ f 7RLYDQHQ 3 7RLYDQHQ $ 5XRWVDODLQHQ 3 DQG $QWWL3RLND 7UDQVSODQWDWLRQ RI O\PSKRLG FHOOV LQWR LPPXQRGHIOFLHQW FKLFNHQV GLVVRFLDWLRQ LQ WKH UHFRQVWLWXWLRQ RI % DQG 7 FHOO UHDFWLRQV &OLQ ,PPXQRO DQG ,PPXQRSDWKRO f

PAGE 169

7RPD]LF 9 DQG 5RVH 15 $XWRLPPXQH PXULQH WK\URLGLWLV 9,, LQGXFWLRQ RI WKH WK\URLG OHVLRQV E\ SDVVLYH WUDQVIHU RI LPPXQH VHUXP &OLQ ,PPXQRO DQG ,PPXQRSDWKRO f 7RGG -$ *HQHWLF DQDO\VLV RI W\SH GLDEHWHV XVLQJ ZKROH JHQRPH DSSURDFKHV 3URF 1DWO $FDG 6FL 86$ f 7VXFKL\D 1 0XUD\DPD 7
PAGE 170

9RQ+HUUDWK 0 DQG +RO] $ 3DWKRORJLFDO FKDQJHV LQ WKH LVOHW PLOLHX SUHFHHG LQILOWUDWLRQ RI LVOHWV DQG GHVWUXFWLRQ RI EHWDFHOOV E\ DXWRUHDFWLYH O\PSKRF\WHV LQ D WUDQVJHQLF PRGHO RI YLUXVLQGXFHG ,''0 $XWRLPPXQ f 9\VH 7DQG 7RGG -$ *HQHWLF DQDO\VLV RI DXWRLPPXQH GLVHDVH &HOO f :HEHU :7 3UROLIHUDWLYH DQG IXQFWLRQDO FDSDFLW\ RI EXUVDO O\PSKRF\WHV DIWHU WUDQVIHU WR DJDPPDJOREXOLQHPLF FKLFNV &HOOXODU ,PPXQRO :KLWH 5 +X ) DQG 5RPDQ 1$ )DOVH GRSD UHDFWLRQ LQ VWXGLHV RI PDPPDOLDQ W\URVLQDVH VRPH FKDUDFWHULVWLFV DQG SUHFDXWLRQV 6WDLQ 7HFKQRORJ\ f :LFN .LWH -+ -U DQG :LWHEVN\ ( 6SRQWDQHRXV 7K\URLGLWLV (XUR ,PPXQRO f :LFNHU /6 0LOOHU %DQG 0XOOHQ < 7UDQVIHU RI DXWRLPPXQH GLDEHWHV PHOOLWXV ZLWK VSOHQRF\WHV IURP QRQREHVH GLDEHWLF 12'f PLFH 'LDEHWHV f :LOVRQ 7DQG 9DQ GH :DWHU 0RKU )& %R\G 5/ $QVDUL $ :LFN DQG *HUVKZLQ 0( $YLDQ VFOHURGHUPD HYLGHQFH IRU TXDOLWDWLYH DQG TXDQWLWDWLYH 7 FHOO GHIHFWV $XWRLPPXQLW\ f :LOOLDPV 5& -U DQG 0DORQH && 6WXGLHV RI DQWLERG\ WR KHUSHV VLPSOH[ YLUXV )F JDPPDELQGLQJ SURWHLQ ,J( LQ SDWLHQWV ZLWK UKHXPDWRLG DUWKULWLV MXYHQLOH UKHXPDWRLG DUWKULWLV DQG QRUPDO FRQWUROV 6FDQG ,PPXQRO f :X =KRX 7 +H DQG 0RXQW] -' DXWRLPPXQH GLVHDVH LQ PLFH GXH WR LQWHJUDWLRQ RI DQ HQGRJHQRXV UHWURYLUXV LQ DQ DSRSWRVLV JHQH ([S 0HG :XFKHUSIHQQLJ .: 1HZFRPEH /L + .HGG\ & &X]QHU 0/ +DIOHU '$ \ 7FHOO UHFHSWRU UHSHUWRLUH LQ DFXWH PXOWLSOH VFOHURVLV OHVLRQV 3URF 1DWO $FDG 6FL 86$ f
PAGE 171


PAGE 172

%,2*5$3+,&$/ 6.(7&+ (GPXQG &KXDQVRQ /HXQJ ZDV ERUQ LQ (DVW 2UDQJH 1HZ -HUVH\ WKH ROGHVW FKLOG RI *HRUJH DQG
PAGE 173

, FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ :D\QH 7 0F&RUPDFN 3K' &KDLUPDQ $VVRFLDWH 3URIHVVRU RI 3DWKRORJ\ ,PPXQRORJ\ DQG /DERUDWRU\ 0HGLFLQH FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ 0DUN $ $WNLQVRQ73K' $VVRFLDWH 3URIHVVRU RI 3DWKRORJ\ ,PPXQRORJ\ DQG /DERUDWRU\ 0HGLFLQH FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ 0DXUHHQ 0 *WRFOHQRZ 3IL' $VVRFLDWH 3URIHVVRU RI 3DWKRORJ\ ,PPXQRORJ\ DQG /DERUDWRU\ 0HGLFLQH FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ $VVRFLDWH 3URIHVVRU RI 3KDUPDFRORJ\ DQG 7KHUDSHXWLFV

PAGE 174

, FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ (GZDUG :DNHODQG 3K' 3URIHVVRU RI 3DWKRORJ\ ,PPXQRORJ\ DQG /DERUDWRU\ 0HGLFLQH 7KLV GLVVHUWDWLRQ ZDV VXEPLWWHG WR WKH *UDGXDWH )DFXOW\ RI WKH &ROOHJH RI 0HGLFLQH DQG WR WKH *UDGXDWH 6FKRRO DQG ZDV DFFHSWHG DV SDUWLDO IXOILOOPHQW RI WKH UHTXLUHPHQWV IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ 0D\ 0c $ ;e 'HDQ &ROOHJH RI 0HGLFLQH n 'HDQ *UDGXDWH 6FKRRO

PAGE 175

81,9(56,7< 2) )/25,'$


11
components in self-antigens which may have altered expression in infected tissue. Thus
antibodies trigger cross-reactive autoimmune reactions to shared determinants of the
self-antigens (molecular mimicry) (Douvas and Sobelman, 1991). In rheumatoid arthritis,
the HLA-DR pi alleles, which contain the QKRAA amino acid sequence in the CDR3
region, have been associated with the autoimmune condition. QKRAA sequences as
expressed by Epstein-Barr virus have been found in RA patients with enhanced humoral
and cellular responses (La-Cava et al., 1997).
Viruses have developed means to circumvent the host. As mentioned before,
viruses may act as superantigens such as the Mis locus for T cells with certain Vp genes,
or they may provide generalized immunosuppression, such as during HIV infection. The
respiratory syncytial virus induces interferon to inhibit a proliferative response by human
PBMCs (Preston et al., 1995). A T cell polyclonal activation by a bacterial superantigen
could likewise overcome tolerance, as in rheumatoid arthritis or in EAE in which T cell
clones expressing certain VP genes all become activated. The bacterial superantigen
staphylococcal enterotoxin B (SEB) activates Vp8+T cells that engage the amino-terminal
epitope of myelin basic protein. SEB induces relapse of the paralysis in mice that are in
clinical remission and triggers paralysis in mice with subclinical disease after initial
immunization with the Acl-11 epitope or after transfer of encephalitogenic T cell lines
(Brocke et al., 1993). Thus incomplete deletions of self-reactive clones or aberrant
stimulation or regulation of normally anergic clones later become newly elicited self
reactive clones.


99
animals (clones Vy2-B2.6 and Vy2-B1.2), and identical Vy3 sequences were obtained
from a BL and SL animal (clones Vy3-B2.3 and Vy3-S2.8).
Vyl. All eight of the rearranged Vyl genes from BL and three of eleven VI genes
from SL were identified as known VI family members based on their predicted FR3
amino acid sequence. The remaining eight of eleven Vyl genes from SL may represent a
novel Vyl family member, which shares two amino acid substitutions (Gly85Arg and
Lys89Glu) with three other Vyl genes. Considering the relatively low number of amino
acid substitutions compared to WL Vyl genes and the absence of further genomic
mapping and sequence data for the chicken TCR-y locus, these novel SL Vyl genes may
also represent allelic differences between known Vyl family members segregating in the
WL and SL strains.
Vy2. Ten of twelve BL Vy2 genes and eight of fifteen SL Vy2 genes could be
identified as known Vy2a subfamily members. The remaining two of twelve BL Vy2
sequences represent a novel Vy2 subfamily, which we designate Vy2d, and the remaining
seven of fifteen SL sequences represent three different novel Vy2a genes, which may
represent new Vy2a subfamily members or allelic polymorphisms between WL and SL.
Vy3. Ten of eleven BL and eight of eleven SL Vy3 genes could be identified as
known Vy3 family members. The remaining one of eleven BL and three of eleven SL
sequences represent two different novel Vy3 genes, which may represent new Vy3 family
members or allelic polymorphisms between WL and SL. There are four SL Vy3
sequences representing a Vy3 member not seen in BL sequences, suggesting a possible
shift in Vy3 usage in SL as compared to BL.


142
Brown, T.R., Sundick, R.S., Dhar, A., Sheth, D., and Bagchi, N. 1991. Uptake and
metabolism of iodine is crucial for the development of thyroiditis in obese strain
chickens. J. Clin. Invest. 88(1): 106-11.
Buey, R.P., Chen, C.L., Cihak, J., Losch, U., and Cooper, M.D. 1988. Avian T cells
expressing y8 receptors localize in the splenic sinusoids and the intestinal
epithelium. J. Immunol. 141(7): 2200-5.
Buey, R.P., Li, J., Xu, X., Char, D., and Chen, C.H. 1990. Effect of cyclosporin A on the
ontogeny of different T cell sublineages in chickens. J. Immunol. 144(9): 3257-
65.
Bucht, A., Soderstrom, K., Esin, S., Grnewald, J., Hagelberg, S., Magnusson, I.,
Wigzell, H., Gronberg, A., and Kiessling, R. 1995. Analysis of y8 V region usage
in normal and diseased human intestinal biopsies and peripheral blood by
polymerase chain reaction (PCR) and flow cytometry. Clin. Exp. Immunol.
99(1): 57-64.
Bums, F.R., Li, X.B., Shen, N., Offner, H., Chou, Y.K., Vandenbark, A.A., and Heber-
Katz, E. 1989. Both rat and mouse T cell receptors specific for the
encephalitogenic determinant of myelin basic protein use similar V alpha and V
beta chain genes even though the major histocompatibility complex and
encephalitogenic determinants being recognized are different. J. Exp. Med.
169(1): 27-39.
Cemy, A., Ferrari, C., and Chisari, F.V. 1994. The class 1-restricted cytotoxic T
lymphocyte response to predetermined epitopes in the hepatitis B and C viruses.
Curr. Topics Microbiol. Immunol. Springer, New York, 189: 169-86.
Char, D., Sanchez, P., Chen, C.H., Buey, R. P., and Cooper, M.D. 1990. A third
sublineage of avian T cells can be identified with a T cell receptor-3-specific
antibody. J. Immunol. 145(11): 3547-55.
Chen, C. H., Cihak, J., Losch, U., and Cooper, M.D. 1988. Differential expression of
two T cell receptors, TCR1 and TCR2, on chicken lymphocytes. Eur. J. Immunol.
18(4): 539-43.
Chen, C.H., Six, A., Kubota, T, Tsuji, S., Kong, F.K., Gobel, T.W.F., and Cooper, M.D.
1996. T cell receptors and T cell development. In: Immunology and Developmental
Biology of the Chicken, O. Vainio and B.A. Imhof (Eds.). Curr. Top. Micro.
Immunol. Springer, New York. 212:37-53.


Number
Smyth line males
Amelanosis stage 1 b2d3d4D5
24
20
16
12
8
4
0
9 w 11 w
15 w 17 w
Os
K>
Figure 2-2. Frequencies of Smyth Line
males
13 w
Age


Copyright 1998
by
EDMUND C. LEUNG


91
(Stratagene) using restriction sites built into the PCR primers, or cloned into pNoTAT7
using a Prime PCR Cloner cloning kit (5 Prime 3 Prime, Inc.) by blunt-end ligation.
Clones were selected by blue/white selection and by size analysis of amplified inserts by
agarose gel electrophoresis. Individual clones were sequenced using dideoxynucleotide
cycle-sequencing kits (Applied Biosystems, Incorp.) and T7 and T3 primers.
Nonincorporated dye terminators were removed on Centri-Sep spin columns
(Princeton Separations, Adelphia, NJ), and reactions were analyzed on an Applied
Biosystems Model 373A DNA sequencer. Chromatograms were analyzed using Applied
Biosystems software.
DNA sequence comparisons
For sequence comparisons, only sequences with open reading frames were
included in the alignments. We have recently described reference sequences for the Vyl,
Vy2 and Vy3 families, as well as individual Vy family members (Six et al., 1996). The
ALIGN Plus program (version 2.0, Scientific & Educational Software) was used for
initial sequence alignments.
Results
Phenotype of birds used for repertoire analysis
The phenotypes of the SL chickens selected for this study are shown in Table 3-1.
Table 3-1. Amelanosis Stage of Smyth Line Chickens at Ages 2-25 Weeks
Animal #
2w
5w
lOw
15w
20w
25w
SI
1
3
4
5
5
5
S2
1
1
3
4
4
4
S3
1
3
4
5
5
5
S4
1
1
4
4
5
5


127
Ortonne, 1995). Candidate genes for vitiligo susceptibility might be suggested by defects
in enzymes involved in melanogenesis and catecholamine metabolism that have been
associated with vitiligo (Halaban and Moellmann, 1993; Austin and Boissy, 1995; Salzer
and Schallreuter, 1995; Schallreuter et al., 1994). Although there are some reports that
specific HLA class I or II alleles are associated with vitiligo in some human populations
(Dunston and Hadler, 1990; Vennecker et al., 1992; Ando et al., 1993; al Fouzan et al.,
1995), other investigators report no such association (Schallreuter et al., 1993; Huang et
al., 1996).
In this study we have taken advantage of the genetics of endogenous viruses in
chickens to explore the possibility that endogenous viruses may play a role in genetic
susceptibility to vitiligo in the avian model. Nearly all chickens have ev loci, which may
be silent or expressed as viral proteins or infectious virus, and ev gene expression can
influence the course of infection by exogenous avian leukosis virus (Rovigatti and Astrin,
1983). There are reported associations between various specific ev loci and commercially
important production traits in chickens (Govora et al., 1991; Iraqi et al., 1994), however,
it was the two reports of association of novel ev loci with two other autoimmune diseases
that prompted us to examine ev loci in SL chickens, including the OS chicken with
spontaneous hereditary thyroiditis (Ziemiecki et al., 1988) and the UCD-200 and 206
lines with hereditary systemic scleroderma-like connective tissue disease (Sgonc et al.,
1995).
There are several possible roles of ev loci in susceptibility to autoimmune
diseases. One possibility is that one or more ev loci disrupts a gene expressed in the
target tissue, contributing to an increased susceptibility to autoimmune recognition, or in


86
the aP TCR (Dietrich et al., 1994). The TCR Va and Vp usage in both skin and blood
appeared unrestricted, but with overexpression, unique to each patient, of a few Va and
Vp gene segments in the skin as compared to blood. To avoid the possibility that a
nonspecific inflammatory response would mask detection of a clonal T cell expansion,
Dietrich and colleagues concentrated on one patient. Evidence for the repeated usage of
at least five specific TCR Val 1 and Vpi6 transcripts, with CDR3 of unique length and
sequence, indicated an oligoclonal expansion in the skin, with specific V genes
overexpressed as compared to the blood, which also showed some of the same recurrent
TCR transcripts but to a lesser degree.
Even when genetically identical mice are raised in the same environment, murine
intestinal intraepithelial lymphocytes (IEL) display unique oligoclonal repertoires. As
compared to lymph node, Vp expression of aP TCR+ IELs is oligoclonal, as indicated by
prominent and distinct subsets of clonal populations of IELs detected as peaks in their
CDR3 length analysis (Regnault et ah, 1994). This contrasted with the polyclonal
repertoire of respective T cells in the lymph nodes.
Likewise, human IELs of five patients were compared (Blumberg et ah, 1993).
The dominant Vp of the IELs in patient 1 was Vp3 and every Vp3 isolated was identical.
The dominant Vp in patient 2 showed one Vpi3, two VP5 clones, and an oligoclonal
expansion of Vp4 and Vp6. Patient 3 displayed either monoclonal or oligoclonal
dominant Vp gene expression. This was in contrast to a totally polyclonal TCR repertoire
in the PBL sampling, where no sequence was repeated. Therefore, one or a small number
of dominant clones appear to comprise the majority of IEL. The conclusions are that


19
Enzymes have been known to be autoantigens in various autoimmune diseases; GAD is a
major autoantigen in the NOD mouse model of diabetes (Maclaren and Atkinson, 1997).
The melanocytes have been shown in vivo and in vitro to have intrinsic aberrant
morphology, increased tyrosinase activity and increased acid phosphatase activity (Boissy
et al., 1983, 1986), suggesting that an underlying melanocyte defect may predispose these
cells to abnormal antigen presentation, which may be important for pathogenesis (Boissy
et al., 1991). Abnormal presentation may be possible, considering the abnormal
expression of class II HLA molecules by perilesional melanocytes in about 2/3 of the
patients studied, as well as a six-fold increase in expression of ICAM-1 (Al-Badri et al.,
1993; Ahn et al., 1994). The endoplasmic reticulum found in the melanocytes is
irregularly dilated and circular rather than narrow and elongated, floccular material can be
found within the cisterna (Boissy, 1991; Hafler, 1995; Im et al., 1994), and membrane
bound compartments of melanosomes that contain autophagocytic activity possibly
bound for lysosomal destruction have also been observed (Im et al., 1994). Yet it has not
been proven that these melanocyte defects actually are toxic.
The presence of an inflammatory rim of cellular infiltrates detected in
inflammatory vitiligo skin coincided with the loss of melanocytes, and infiltrating T cells
in the epidermis were frequently juxtaposed to the remaining melanocytes. This rim of
cellular infiltrates was in the perilesional skin in the basal layer of the epidermis and with
the destruction mainly by CD8+ T cells. These melanocyte abnormalities are present prior
to the presence of mononuclear infiltration (Boissy et al., 1983, 1986). Keratinocytes
may contribute to the HLA-DR class II presentation of melanocyte antigens following
phagocytosis of melanosomes within the destroyed melanocytes (Le Poole et al., 1996).


156
Tomazic, V., and Rose, N.R. 1975. Autoimmune murine thyroiditis VII: induction of
the thyroid lesions by passive transfer of immune serum. Clin. Immunol, and
Immunopathol. 4(4): 511-8.
Todd, J.A. 1995. Genetic analysis of type 1 diabetes using whole genome approaches.
Proc. Natl. Acad. Sci. USA 92(19): 8560-5.
Tsuchiya, N., Murayama, T., Yoshinoya, S., Matsuta, K., Shiota, M, Furukawa, T., and
Ito, K. 1993. Antibodies to human cytomegalovirus 65-kilodalton Fc binding
protein in rheumatoid arthritis: idiotypic mimicry hypothesis of rheumatoid factor
production. Autoimmunity 15(1): 39-48.
Urban, J.L., Kumar, V., Kono, D.H., Gomez, C., Horvath, S.J., Clayton, J., Audo, D.G.,
Sercarz, E.E., and Hood, L. 1988. Restricted use of T cell receptor V genes in
murine autoimmune encephalomyelitis raises possibilities for antibody therapy.
Cell 54:577-91.
Umovitz, H.B., and Murphy, W.H. 1996. Human endogenous retroviruses: nature,
occurrence, and clinical implications in human disease. Clin. Microbiol. Rev.
9(1): 72-99.
Utz, U., Brooks, J.A., McFarland, H.F., Martin, R., and Biddison, W.E. 1994.
Heterogeneity of T-cell receptor alpha-chain complementarity-determining region 3
in myelin basic protein-specific T cells increases with severity of multiple sclerosis.
Proc. Natl. Acad. Sci. USA 91(12): 5567-71.
Utz, U., and McFarland, H.F. 1994. The role of T cells in multiple sclerosis:
implications for therapies targeting the T cell receptor. J-Neuropathol-Exp-Neurol.
53(4): 351-8.
Van der Veen, R.C., Trotter, J.L., Clark, H.B., and Kapp, J.A. 1989. The adoptive
transfer of chronic relapsing experimental allergic encephalomyelitis with lymph
node cells sensitized to myelin proteolipid protein. J-Neuroimmunol. 21(2-3): 183-
91.
Van der Water, J., Haapanen, L., Boyd, R., Abplanalp, H., and Gershwin, M.E. 1989.
Identification of T cells in early dermal infiltrates in avian scleroderma. Arthritis
and Rheumatism 32(8): 1031-40.
Venneker, G.T., Westerhof, W., de Vries, I.J., Drayer, N.M., Wolthers, B.G., de Waal,
L.P., Bos, J.D., and Asghar, S.S. 1992. Molecular heterogeneity of the fourth
component of complement (C4) and its genes in vitiligo. J. Invest. Dermatol. 99:
853-8.


Table 2-5
BioRad Protein Assay of Gamma Globulin Pools and Selected Serum Samples
Standard (ug/ml)
OD 595
OD595
OD ave.
Bovine Gamma Globulin standard
ddH20 as reference
correlation 0.0995
slope 0.0046
y-intercept 0.3552
0
27
57
80
107
134
0.336
0.498
0.632
0.757
0.825
0.93
0.324
0.46
0.649
0.747
0.864
0.957
0.33
0.479
0.6405
0.752
0.8445
0.9435
Sample
Dilution
OD 595
OD 595
OD ave
Dilution
ug sample
Stock
ug/ml
mg/5 ml
Cone. Factor
Equiv. Vol.
pool l(sm. vial)
1/20
0.595
0.61
0.6025
53.96
1079.2
5.39
2.77
13.85
pool l(lg. vial)
1/50
0.534
0.57
0.552
42.86
2143
10.72
2.77
13.85
SL3 pool 50ml con
1/50
0.567
0.593
0.58
48.95
2447.5
12.24
2.2
11
(SL3) pool 2 3/7/97
1/50
0.769
0.798
0.7835
93.27
4663.5
23.32
2.2
11
(SL3) pool 2 2/21/97
1/50
0.744
0.686
0.715
78.3
3915
19.58
2.2
11
(SL3) pool 2 2/26/97
1/50
0.497
0.563
0.53
38.1
1905
9.53
2.2
11
SL2 pool 3/13/97
1/50
0.822
0.899
0.8605
109.9
5495
27.48
5.61
28.05
SL2 pool 3/13/97
1/50
0.803
0.859
0.831
106.6
5330
26.65
5.61
28.05
SL2 pool 3
1/50
0.939
0.972
0.9555
130.6
6530
32.65
5.61
28.05
SL 11 pool
1/100
0.711
0.729
0.72
79.4
7940
11.91 (a)
4.3
6.45
BL5-111 4/18/97
1/50
1.035
1.043
1.039
148.9
7445
37.23
BL5-111 5/16/97
1/50
1.073
1.167
1.12
166.5
8325
41.63
BL5-115 4/18/97
1/50
0.963
1.026
0.9945
139.2
6960
34.8
BL5-115 5/16/97
1/50
1.214
1.101
1.1575
174.7
8735
43.68
SL12 1611
1/50
0.946
1.059
1.0025
140.9
7045
35.23
SL12 1619
1/50
0.924
1.008
0.966
133
6650
33.25
BL3 205
1/50
0.999
1.065
1.032
147.5
7375
36.88
BL3 203
1/50
1.181
1.179
1.18
179.6
8980
44.9
(a): mg/1.5ml


146
Halaban, R., and Moellmann, G. 1993. White mutants in mice shedding light on
humans. J. Invest. Dermatol. 100(Suppl. 2): 176S-185S.
Hanafusa, T., Sugihara, S., Fujino-Kurihara, H., Miyagawa, J.-I., Miyazaki, A.,
Yoshioka, T., Yamada, K., Nakajima, H., Asakawa, H., and Kono, N. 1988.
Induction of insulitis by adoptive transfer with L3T4+Lyt2-T lymphocytes in T
lymphocyte depleted NOD mice. Diabetes 37(2): 204-8.
Hann, S.K., Park, Y.K., Lee, K.G., Choi, E.H., and Im, S. 1992. Epidermal changes in
active vitiligo. J. Dermatol. 19(4): 217-22.
Harada, M., and Makino, S. 1984. Promotion of spontaneous diabetes in non-obese
diabetes-prone mice by cyclophosphamide. Diabetologia 27(6): 604-6.
Haming, R., Cui, J., and Bystryn, J.C. 1991. Relation between the incidence and level of
pigment cell antibodies and disease activity in vitiligo. J. Invest. Dermatol. 97(6):
1078-80.
Haynes, D.C., and Gershwin, M.E. 1983. Diversity of autoantibodies in avian
scleroderma. An inherited fibrotic disease of white leghorn chickens. J. Clin.
Invest. 73(6): 1557-68.
Hodgkinson, C.A., Moore, K.J., Nakayama, A., Steingrimsson, E., Copeland, N.G.,
Jenkins, N.A., and Amheiter, H. 1993. Mutations at the mouse microphthalmia
locus are associated with defects in a gene encoding a novel basic-helix-loop-helix-
zipper protein. Cell 74(2): 395-404.
Hohenadl, C., Leib-Mosch, C., Hehlmann, R., and Erfle, V. 1996. Biological
significance of human endogenous retroviral sequences. J. Acquir. Immune Defic.
Syndr. Hum. Retrovirol. 13(Suppl. 1): S268-S273.
Huang, W., Connor, E., Rosa, T.D., Muir, A., Schatz, D., Silverstein, J., Crockett, S.,
She, J.X., and Maclaren, N.K. 1996. Although DR3-DQB 1*0201 may be
associated with multiple component diseases of the autoimmune polyglandular
syndromes, the human leukocyte antigen DR4-DQB 1*0302 haplotype is implicated
only in beta-cell autoimmunity. J. Clin. Endocrinol. Metab. 81(7): 2559-63.
Hughes, S.H., Bishop, J.M., and Varmus, H.E. 1981. Organization of the endogenous
proviruses in chickens: implications for origin and expression. Virology 108(1):
189-207.
Humphries, E.H., and Allen, R. 1984. Replication of endogenous Avian Retrovirus in
permissive and nonpermissive chicken embryo fibroblasts. J. Virol. 50(3): 748-58.


V(32 Dp J(3 Cp Vp2
2Vp subgroups 1 Dp 4 Jp lCp
Va/V5 D5 J5 C8 Ja Ca
HD0 HHHHHHHHHH
Va/V5 1C5 many Ja 1 Ca
Jy Cy
3 Vy subgroups 3 Jy 1 Cy
Figure 1-8. Models depicting the V, D, J, and C gene segments that comprise the genomic organization of the T cell receptors in the
chicken. There are only 2 Vp subgroups of genes, one Dp, 4 jp, and one CP that can combine from the P chain. The 8 locus is located
within the a chain. There are 25 Ja but only a few get used. Compare this to only 2 J8 There are 3 Vy subgroups which can join any
of the 3 Jy. (Cooper et al., 1991; Chen et al., 1988; Chen et al., 1989; Char et al., 1990; Lahti et al., 1988; Sowder et al., 1988).


18
melanin synthesis, TRP-1 appears present only in unmelanized stage I and stage II
melanosomes, and tyrosinase is primarily found in late stage III and IV melanosomes.
Both are found in the Golgi and trans-Golgi and then enter a LAMP-1 -positive (a marker
for organelles of the endosomal-lysosomal lineage) organelle that is consistent with a late
endosme (Orlow et al., 1993). The mature melanosomes travel along the melanocyte
dendritic processes from which they are transferred to the keratinocyte for depositing.
Vitiligo Pathology
There are several theories to explain the etiology of vitiligo, including self
destruction of the melanocyte, the neurogenic, the immune, and the genetic (Ortonne and
Bose, 1993; Ortonne et al., 1983). Vitiligo is characterized by inherent melanocyte
defects, loss of melanocytes accompanied by T cell infiltration in the affected tissue (Le
Poole et al., 1993b; Harm et al., 1992; Badri et al., 1993; Erf et al., 1995b), disturbances
in peripheral blood lymphocyte subpopulations (Mozzanica et al., 1990; Abdel-Nasser et
al., 1992; Erf et al., 1995a), and the presence of serum autoantibodies directed against
melanocyte antigens (Haming et al., 1991; Austin et al., 1992; Searle et al., 1993). Park
et al. (1996) suggest that the antibodies are directed primarily against a 65 kDa antigen.
Both antibody-dependent cellular cytotoxicity (ADCC) and complement-mediated
damage have been induced to cultured human melanocytes by anti-melanocyte antibodies
from the sera of vitiligo patients (Norris et al., 1988). This suggests a possible role for
autoantibodies in vitiligo. Two groups have demonstrated that the antibodies in the serum
of vitiligo patients is against tyrosinase (MW of 70 kDa) an enzyme involved in the
biosynthesis of melanin by the melanocytes (Fishman et al., 1997; Song et al., 1994).


120
In three instances there is a perfect correlation between the presence of specific
BamUl and £coRI fragments or fragment pairs in the same groups of chickens,
suggesting that they represent the same ev locus (Table 4-2). These include the 9.1 & 3.8
kb BamUl pair and 4.9 kb EcoRl band, representing the ev-SLl locus, the 8.2 kb BamUl
band and 11.2 & 1.3 kb EcoRl pair representing the ev-SL2 locus, and the 1.4 kb BamUl
band and 8.4 & 3.2 kb £coRI pair.
The number of ev loci per bird for BL and SL chickens is shown in Figure 4-3.
Ev loci were defined as unique restriction fragment bands or band pairs as described
above for each restriction enzyme digest (Hughes et al., 1981). The range for the number
of ev loci per bird was 2-7 for BL and SL chickens, as detected by Southern blots of
BamUl digests, and 1-9 as detected by Southern blots of EcoRl digests. The average
number of ev loci per bird did not differ significantly between the BL and SL groups,
with average numbers of 4.9 1.2 for BL (n=12) and 5.5 1.1 for SL (n=35) chickens
based on the BamUl Southern blots, and 6.2 1.4 for BL (n=13) and 5.3 1.4 for SL
(n=35) chickens based on the £coRI Southern blots.
The BL and SL BamUl restriction fragments do not co-migrate with the White
Leghorn loci evl or ev5 (data not shown). The 7.3 kb BamUl fragment present in nearly
all BL and SL chickens comigrates with evl (data not shown), but its identity to evl is
ruled out by the absence of EcoRA fragments of the appropriate size (Hughes et al., 1981).
Although standard markers for all known ev loci have not been compared to the ev-SL
loci by Southern blot analysis, comparison of the restriction fragment sizes summarized
in Table 4-2 with published data for ev loci already reported for White Leghorns
(Humphries et al., 1984; Rovigatti and Astrin, 1983), Brown Leghorns (Ronfort et al.,


73
to account for the possible changes that occur in the antibody repertoire as amelanosis
progresses. We collected and pooled serum from four different sources:
Pool 1 = 10-11 weeks old (SL11)
Pool 2 = 3-7 months old (SL6, SL7, SL10)
Pool 3 = 11 months old (SL3)
Pool 4 =17 months old (SL2)
Eight normal BL10 hosts received SL gamma globulin injections over a 4-week
period. Three BL10 hosts received PBS as a control group.
A Bio-Rad protein assay was used to determined the total gamma globulin
fraction administered per injection by assaying aliquots saved from each preparation used
for injection. Results of this assay, (Table 2-5) indicate that the hosts received a total of
99 to 121 mg of total serum gamma globulins, which corresponds to the original serum
volumes of 82 to 116 ml per host.
The experimental approach for this experiment combined elements of the
aforementioned mouse (Tomazic and Rose, 1975) and OS chicken (Jaroszewski et al.,
1978) studies. It included 3 administrations during the first week and then additional
inoculations weekly for four additional weeks. Each autoantibody (gamma globulin)
transfer consisted of the injection of a total of 5 ml per host: 2 or 3 ml into the jugular
vein and 2-3 ml injected intraperitoneally (Table 2-6). Hosts and controls were kept in
normal housing conditions.
These gamma globulin transfer hosts were maintained and monitored biweekly
for visual changes in phenotype and regenerating feathers were collected biweekly. No


108
a protein that binds to TNF preventing the recognition of TNF, by its receptors and thus
preventing the activation of inflammatory responses to remove this virus. Cowpox virus
encodes a soluble glycoprotein that has amino acid homology to that of the IL-1 receptor.
This product probably competes with cell-bound IL-1 receptors for secreted IL-1,
interfering with the activation of IL-1 cytokine-mediated inflammatory responses. The
product of the BCRF1 gene of the Epstein-Barr virus stimulates the conversion of T cells
into Th2 helper cells by its structural and functional analogy to IL-10. EBV therefore
avoids induction of inflammatory responses controlled by Thl cell activity.
Viruses produce proteins that may subvert the host in other ways as well. Human
adenoviruses produce virus-associated (VA) RNAs. These transcripts can regulate
interferon activation of PI kinase by preventing the phosphorylation of eIF-2 (eucaryotic
protein synthesis initiation factor), which would prevent the synthesis of viral proteins
(Matthews and Shenk, 1991). VA RNAs therefore facilitate continued growth of the
virus in the host cells. IgG antibody-dependent complement-mediated destruction of
virus- containing cells is avoided by herpes viruses. The herpes simplex virus induces the
infected cell to express HSV-Fc receptor, a heterodimer of glycoproteins E and I that
binds to the Fc region of the hosts nonspecific nonimmune IgG. This binding prevents
complement-mediated lysis of infected cells by blocking access to the cell surface of
antiviral antibody or effector cells (Bell et al., 1990). Antibodies to herpes simplex virus
and CMV Fc-binding proteins have been detected in patients with rheumatoid arthritis
(Tsuchiya et al., 1993; Williams et al., 1992). In rheumatoid arthritis, the HLA-DRpi
alleles contain the QKRAA amino acid sequence in the peptide-binding region that has


24
Figure 1-3. A typical pair of parental Brown line chickens.


80
were reconstituted with splenocytes. In our experiments, the irradiation occurred the day
before. Irradiation was probably necessary based on the fact that the animals in our
experiments that did display induced amelanosis had been irradiated. Like et al. (1985),
working on the adoptive transfer of diabetes in the biobreeding rat, concluded that an
...an intact immune system protects against adoptive transfer and diabetes ..., and so
they suggested the requirement for immunosuppression. An alternative to irradiation that
could have been used is cyclophosphamide (Cy) which has been used to immunosuppress
the hosts in the mouse and rat (Hanafusa et al., 1988) and in the chicken (Toivanen et al.,
1990; Lehtonen et al., 1975; Glick by personal communication and Glick, 1977; Olah and
Glick, 1978; Glick, 1971). Transferring unfractionated splenic lymphoid cells produced
higher incidence of insulitis than T cell subsets in the mouse (Hanafusa et al., 1988).
A logical next step in our experiments would be to transfer T cell subsets. As
demonstrated in various studies of the subsets of T cells mediating diabetes in the NOD
mouse, some researchers report the both the CD4+ and CD8+ T cell subsets were
necessary to transfer diabetes into recipients (Miller et al., 1988; Bendelac et al., 1987).
Mitsunobu et al. (1992) concluded that CD4+ T cells cause the insulitis and that the CD8+
T cells act as mature killer cells against the p cells with the aid of CD4+ T cells. This
ability to distinguish separate roles for different subsets of cells as demonstrated in the
mouse should be possible in the SL chicken model for amelanosis.
Mouse monoclonal antibody reagents specific for T cells expressing y8 (TCR1),
apvpi (TCR2) and apvp2 (TCR3) (Chen et al., 1988; Chen et al., 1989; Char et al.,
1990) are available. The chicken homologues to CD3, CD4, CD8, CD1, CD2, CD5,


26
Melanocyte Biology
As in the human, the melanin pigment is a product of melanosomes, the
melanocyte cytoplasmic organelles that produce the pigment granules. The ocular
melanocytes, as well as the choroid and anterior surface of the iris of the eye, originate
from pleuripotent cells in the embryonic neural crest (Smyth et al., 1981; Smyth, 1989).
The retinal pigmented epithelium and the iris are derived from the optic cup. The
undifferentiated melanoblasts congregate as dermal reservoirs initially populating outside
near the base of the growing feather pulp follicle (Figure 1-4). Melanoblasts migrate
through the feather pulp toward the periphery of the pulp and align near the basement
membrane interface of the barbed ridges and the pulp (Figure 1-5). Dendritic extensions
extend from the melanocytes to the barbule cells, where melanin granules are deposited in
a situation similar to the keratinocyte in the human skin. After the barbule cells receive
pigment, the melanocytes retract and degenerate (Smyth, 1989; Figure 1-6).
In chickens, tyrosinase was the only known catalyst of melanogenesis (Smyth,
1989). However, more recently, tyrosinase related protein, TRP-1, but not tyrosinase, has
been detected by serum autoantibodies of Smyth line chickens (Austin et al., 1995).
There are five tyrosinase isozymes each with a molecular weight of approximately 66
kDa, and an additional nine other proteins that have been isolated from cultured chicken
melanocytes and are assumed to be involved in melanogenesis. Dopa
(dihydroxyphenylalanine) is one of the intermediate products produced by tyrosinase and
can be used in tyrosinase detection (White, 1983).


N region
PheGly Gly
Jy
Vyl-186
GCCTACTGGGAGTC ACGAT
CCGGATATTACTACAAAGTTTTCGGCTCTGGTACAAAGCTCATTGTATCAGAC
1
Vyl-B2.17
VY1-B2.24
Vyl-B2.20
Vyl-B2.15
Vyl-B2.21
GCTTCTA
CA_RRAT
. TAC.
..A.A.
.A.
. T.
....G...
. .C.
.CA. .
3
GTCGTA
TATA.TGCA.GGAT
.TAC.
. .A.A.
.A.
.T.
. . G. .
. .C.
.CA. .
3
CCGG
ATGG.G.TG.G..
.A. A.
.T.
.AAG..
.A.
.T.
.A..T...
, .T.
2
ATGG.G.TG.G..
.A. A.
. T.
. AAG. .
.A.
. T.
.A..T...
, .T.
2
T ATATCGGTTG
GAT
...C....
1
Vyl-B2.18
Vyl-B2.2
Vyl-B2.22
Vyl-S2.1
Vyl-S2.3
1
TAC
1
TAAGACCTG
GAT
1
A CGTATACOf!
TG.G..
.A. A.
. T.
.AAG..
.A.
.T.
.A..T...
. .T.
2
.... GGTGGAGAGGCAT
A.GGAT...
.TAC.
. .A.A.
.A.
.T.
. . G. ,
. .C.
.CA. .
3
Vyl-S2.5
Vyl-S2.2
Vyl-Sl.l
Vyl-Sl.4
Vyl-Sl.6
Vyl-S6.3
Vyl-Sl.7
Vyl-Sl.2
Vyl-S2.11
ATCA
1
A.. TTGG
1
GAGGTA
1
TC
GAT
1
CGGGCCC
GAT
1
TCGC
1
GTCAAC
GG.G.TG.G..
.A.A.
.T.
.AAG..
.A.
. T.
.A..T..
. .T.
2
TT
1
CTTTGGGG
1
Figure 3-1. Partial nucleotide sequences of rearranged TCR-Vyl genes from Brown line and Smyth line chickens, showing the FR3, N region and Jy
sequences. Clone designations include an animal number (shown in Table 3-1 for SL) and an individual clone number. Sequences recovered more than
once are indicated by the number of repeats in parentheses after the clone number. Sequences are aligned with reference Vy genes (Six et al. 1996).
Evolutionarily conserved amino acids in Vy and Jy are indicated above the nucleotide sequence. Dots symbolize identity to the reference sequence.
Nongermline encoded nucleotides are labeled as the N region. Possible P nucleotides are underlined.


Chicken thymocyte development
A B C
tt t
thymocyte precursor influx
- - 1st wave
2nd wave
3rd wave
Figure 1-7. Chick thymocyte development. The arrows depict the three waves (timepoints) of entry of thymocyte
stem cell precursor entry into the embryonic thymus with wave A starting at E 6.5, B at E12, and C at El8
(E=embryonic). Then the production of subsequent thymocytes leave the thymus as waves 1, 2, and 3. Each wave
of production will produce T cells bearing first TCR1 receptors, then TCR2, and lastly, TCR3. The first wave is
depicted here. Adapted from Cooper et al. (1991)
as


109
been associated with the autoimmune condition. Enhanced humoral and cellular
responses to QKRAA sequences expressed by Epstein-Barr virus have been found in RA
patients (La-Cava et al., 1997).
Endogenous retroviruses {ev) are germline elements that encode components of a
retrovirus, are present in all cells, and are inherited in a Mendelian fashion (reviewed in
Rovigatti and Astrin, 1983). Endogenous retroviruses are passed from parent to offspring
as stable proviral elements integrated into the germline. By reverse transcription from a
viral-encoded RNA-dependent DNA polymerase, the DNA copies of these RNA-based
viruses have become integrated into the genome of the host flanked by a 5 and a 3 long
terminal repeat (LTR). Three genes vital for viral replication are included: gag, a
precursor polyprotein; pol, a precursor for protease, reverse transcriptase, and
endonuclease; and env, the glycoprotein for the viral envelope. The LTR contains
multiple cis-acting elements involved in gene expression and acts as a promoter.
Many ev loci are not transcriptionally active; they have truncated open reading
frames because of termination codons, deletions or frameshift mutations. However, some
ev loci are expressed and may actually produce viral particles. Their structural and
sequence similarity to infectious exogenous retroviruses, which have been associated
with immune dysfunction and tissue-specific expression, make them candidates for
pathogenic roles in autoimmunity. Exogenous oncogenic retroviruses also integrate into
the host genome and, in the process, cause insertional mutagenesis. In addition, they are
not passed from parent to offspring and contain transforming genes such as v-myc, v-src,
v-erb, and v-myb, which are not present in the leukosis viruses or endogenous viruses.


114
(stage 1) during their lifetime, and were classified as nonprogressors. The amelanosis
stages are indicated in Table 4-1.
Southern blot analysis of BL and SL ev loci
Two restriction endonucleases were selected for Southern blot analysis of BL and
SL ev loci, based on published work describing ev loci of other chicken lines. BamHI
was selected based on its use to identify characteristic junction fragments for the ev loci
in White Leghorn chickens (Humphries et al., 1984; Rovigatti and Astrin, 1983), and
EcoRI was selected based on its use to characterize the ev loci of Brown Leghorn
chickens (Ronfort et al., 1991). Composites of representative autoradiographs obtained
from Southern blots of Bam HI and EcoRI digests of BL and SL genomic DNA
hybridized with the retroviral LTR probe are shown in Figures 4-1 and 4-2, respectively.
After hybridization with the LTR probe, all blots were stripped and rehybridized with a
single copy Cp gene probe, which revealed that the restriction digests were complete
(data not shown). The frequencies for the presence and absence of ev loci, identified as
unique BamHI and EcoRI restriction fragment or pairs of fragments as discussed below,
are summarized in Table 4-2. As discussed below, four ev loci of interest are given the
designation ev-SL.
Within the sample population of BL chickens, 11 of 12 birds exhibited different
restriction digest patterns using Bam HI, and 12 of 13 birds exhibited different EcoRI
patterns. A 12 kb Bam HI restriction fragment represent the only ev locus shared by all
BL chickens. The other most common ev loci in BL chickens are represented by the 7.3


151
Nakagawa, K. and Harrison, L.C. 1996. The potential roles of endogenous retroviruses
in autoimmunity. Immunol. Rev. 152:193-236.
Nath, S.K., Majumder, P.P., and Nordlund, J.J. 1994. Genetic epidemiology of vitiligo:
multilocus recessivity cross-validated. Am. J. Hum. Genet. 55(5): 981-90.
Norris, D.A., Kissinger, R.M., Naughton, G.M., and Bystryn, J.C. 1988. Evidence for
immunologic mechanisms in human vitiligo: patients sera induce damage to
human melanocytes in vitro by complement-mediated damage and antibody-
dependent cellular cytotoxicity. J. Invest. Dermatol. 90(6): 783-9.
Nuchtem, J.G., Biddison, W.E., and Klausner, R.D. 1990. Class II MHC molecules can
use the endogenous pathway of antigen presentation. Nature 343: 74-6.
Olive, C., Gatenby, P.A., and Serjeantson, S.W. 1994. Restricted junctional diversity of
T cell receptor P gene rearrangements expressed in systemic lupus erythematosus
(SLE) patients. Clin. Exp. Immunol. 97(3): 430-8.
Orlow, S.J., Boissy, R.E., Moran, D.J., and Pifko-Hirst, S. 1993. Subcellular distribution
of tyrosinase and tyrosinase-related protein-1: implications for melanosomal
biogenesis. J. Invest. Dermatol. 100(1): 55-64.
Ortonne, J.P., and Bose, S.K. 1993. Vitiligo: where do we stand? Pigment Cell Res.
6(2): 61-72.
Ortonne, J.P, Mosher, D.B., and Fitzpatrick, T.B. 1983. Vitiligo and other
hypermelanoses of hair and skin. In: Topics in Dermatology, J. A. Parrish and T.B.
Fitzpatrick (Eds.). Plenum Medical Book Company, New York.
Panitch, H.S., and McFarlin, D.E. 1977. Experimental allergic encephalomyelitis:
enhancement of cell-mediated transfer by concanavalin A. J. Immunol. 119(3):
1134-7.
Pannetier, C., Even, J., and Kourilsky, P. 1995. T cell repertoire diversity and clonal
expansions in normal and clinical samples. Immunology Today 16(4): 176-81.
Pardue, S.L., Fite, K.V., Bengston, L., Lamont, S.J., Boyle, M.L. Ill, and Smyth, J.R. Jr.
1987. Enhanced integumental and ocular amelanosis following the termination of
cyclosporin administration. J. Invest. Dermatol. 88: 758-61.
Pestka, S., Langer, J.A., Zoon, K.C., and Samuel, C.E. 1987. Interferons and their
actions. Annu. Rev. Biochem. 56: 727-77.


41
repertoires (Gold, 1994). A more refined observation is that most pathological infiltrates
are either oligoclonal in nature or display oligoclonal expansions over a polyclonal
background (Pannetier et al., 1995). This is despite the fact that there may be a
difference in length in the CDR3 found in any Vp-jp recombination junction of as many
as 6-8 amino acids. For example, in experimental allergic encephalitis, T cells
responding to the major epitope of amino acids 1-11 of myelin basic protein express Vp
8.2 associated with either Va2 or Va4 (Acha-Orbea et al., 1988; Urban et al., 1988). In
rheumatoid arthritis, Palliard et al. (1991) and Howell et al. (1991) suggested that a
superantigen activated the preferred T cells expressing Vp3, Vpi4, and Vpi7. Of these
activated families, only T cells with specificity for synovial joint-associated antigens
would then initiate autoimmune inflammatory response. These examples illustrate the
limited subgroup of actual T cells clones (variants) being recruited, even though a vast
number are available in the total repertoire.
If that is so, then perhaps direct targeting and functional deletion of T cells that
express specific V gene products can control the autoimmunity and still maintain an
otherwise intact immune system. That would be like the elimination of certain T cells
that respond to the minor lymphocyte stimulating antigen (Mis) for maleness in the
mouse (Scott et al., 1995). Moreover, during the course of an autoimmune disease,
evidence indicates that the expressed repertoire evolves, as more antigenic determinants,
previously cryptic, become available and the immune response spreads to respond to
them. What may happen in the EAE system, is that the original Ac 1-11-specific T cells
may upregulate self-antigen exposure in the CNS (a usually privileged site), activating a


155
Smyth, J.R. Jr. 1989. The Smyth chicken: a model for autoimmune amelanosis. CRC
Rev. Poult. Biol. 2: 1-19.
Smyth, J.R. Jr., Boissy, R.E., and Fite, K.V. 1981. The DAM chicken: a model for
spontaneous postnatal cutaneous and ocular amelanosis. J. Hered. 72(3): 150-6.
Song, Y. H., Connor, E., Zorovich, B., Li, Y., Balducci, P., and Maclaren, N. 1994. The
role of tyrosinase in autoimmune vitiligo. Lancet 344:1049-52.
Song, Y. H., Li, Y., and Maclaren, N.K. 1996. The nature of the autoantigens targeted in
autoimmune endocrine diseases. Immunol. Today 17(5): 232-8.
Sorokin, R., Kimura, H., Schroder, K., Wilson, D.H., and Wilson, D.B. 1986.
cyclosporin-induced autoimmunity: conditions for expressing disease, requirement
for intact thymus and potency estimate of autoimmune lymphocytes in drug treated
rats. J. Exp. Med. 164:1615-25.
Sreekumar, G.P., Erf, G.F., and Smyth, J.R. Jr. 1996. 5-azacytidine treatment induces
autoimmune vitiligo in parental control strains of the Smyth line chicken model for
autoimmune vitiligo. Clin. Immunol. Immunopathol. 81(2): 136-44.
Stinissen, P., Vandevyver, C., Medaer, R., Vandegaer, L., Nies, L., Tuyls, L., Hafler,
D.A., Raus, J., and Zhang, J. 1995. Increased frequency of y5 T cells in
cerebrospinal fluid and peripheral blood of patients with multiple sclerosis:
reactivity, cytotoxicity, and T cell receptor V gene rearrangements. J. Immunol.
154(9): 4883-94.
Sundick, R.S., Bagchi, N., and Brown, T.R. 1992. The role of iodine thyroid
autoimmunity: from chickens to humans: a review. Autoimmunity 13(1): 61-8.
Tereba, A. 1981. 5 Terminal deletions are a common feature of endogenous retrovirus
loci located on chromosome 1 of white Leghorn chickens. J. Virol. 40: 920-6.
Tisch, R., and McDevitt, H. 1996. Insulin-dependent diabetes mellitus. Cell 85(3):
291-7.
Tjoelker, L.W., Carlson, L.M., Lee, K., Lahti, J., McCormack, W.T., Leiden, J.M., Chen,
C.H., Cooper, M.D., and Thompson, C.B. 1990. Evolutionary conservation of
antigen recognition: the chicken T-cell receptor p chain. Proc. Natl. Acad. Sci.
USA 87(20): 7856-60.
Toivanen, P., Toivanen, A., Ruotsalainen, P., and Antti-Poika, I. 1975. Transplantation
of lymphoid cells into immunodeflcient chickens: dissociation in the reconstitution
of B and T cell reactions. Clin. Immunol, and Immunopathol. 3(3): 315-323.


Table 4-3. Frequencies of ev loci detected in SL progressing (p) and nonprogressing (np) chickens
Bam HI
hand flcKl
SLp
present
SLp
ahsent
SLnp
present
SLnp
absent
SL
p vs. np
PV loci
Eco RI
hand fkhl
SLp
present
SLp
ahsent
SLnp
present
SLnp
ahsent
SL
p vs. np
ev loci
9.1 & 3.8
18
6
9
2
n.s.
ev-SLl
11.2& 1.3
24
0
11
0
n.s.
ev-SL2
12
9
15
7
4
n.s.
4.2 & 2.8
5
19
1
10
n.s.
9.5
0
24
0
11
n.s.
8.4 & 3.2
21
3
8
3
n.s.
8.2
24
0
11
0
n.s.
ev-SL2
5.8 & 3.4
0
24
0
11
n.s.
7.3
24
0
11
0
n.s.
23.5
3
21
3
8
n.s.
4.1
17
7
9
2
n.s.
ev-SL3
21.7
4
20
0
11
n.s.
2.5
8
16
3
8
n.s.
12.5
7
17
1
10
n.s.
1.4
20
4
9
2
n.s.
8.1
23
1
9
2
n.s.
ev-SL4
1.3
8
16
5
6
n.s.
7.2
5
19
2
9
n.s.
4.9
19
5
8
3
n.s.
ev-SLl
4.7
8
16
4
7
n.s.
4 4
13
11
6
5
n.s.
The table shows the number of chickens in which each Bam HI and Eco RI band or pair of bands is present and absent (Figs. 4-1 & 4-2).
n.s., not significant; p = Fishers exact test probability value.


Figure 2-6. Adoptive cell transfer hosts detect the same melanocyte autoantigens between 65kDa to 80kDa as do the SL donor
serum (lanes 4-7). These may be anti-Trp-1 autoantigens (Austin et al., 1992; Austin and Boissy, 1996). Gamma globulin sources
(lanes 1-3) did provide serum antimelanocyte antibodies of the correct specificity and size range typical of SL chickens. Arrow
refers to the detection of an approximately 79kDa melanocyte protein found only with serum antibodies from SL chickens and the
adoptive SL cell transfer hosts (lanes 1-7) but not with BL chicken serum (lane 8). Bio Rad Low Range prestained markers were
used.


Table 4-1. Smyth line (SL) chicken phenotypes
Animal #
amelanosis
stage*
Animal #
amelanosis
stage*
SL 7
4
SL 79
4
SL 10
4
SL 1001
5
SL 16
5
SL 1002
3
SL 22
5
SL 1003
5
SL 23
5
SL 1004
1
SL 26
4
SL 1005
1
SL 28
1
SL 1006
5
SL 31
1
SL 1007
1
SL 34
1
SL 1008
5
SL 35
4
SL 1009
1
SL 44
1
SL 1010
1
SL 55
5
SL 1011
5
SL 61
4
SL 1012
1
SL 64
5
SL 1014
4
SL 65
5
SL 1015
4
SL 70
5
SL 1016
5
SL 72
SL 77
5
5
SL 1017
1
*The maximum amelanosis stage was classified
according to Erf et al (1995a):
1, no amelanosis (nonprogressors)
2, <20% amelanosis
3, 20-60% amelanosis
4, >60% amelanosis
5, complete amelanosis


82
Gershwin, 1983; van der Water et al., 1989) and thyroiditis found in the Obese strain
(OS) chicken (Brown et al., 1991; Wick et al., 1970). The observation that adoptive
transfer of SL lymphocytes may cause amelanosis in BL hosts is significant, in part
because previous authors on the amelanosis of the SL chicken have over-emphasized the
role of autoantibody, based on studies of bursectomy and corticosteroid inhibition of
amelanosis (Lamont and Smyth, 1981; Boyle et al., 1987).
It is also interesting to note that the western blot analysis demonstrated that the
BL adoptive cell hosts had the same antimelanocyte serum antibody profile as the typical
SL serum. This result suggests that either: (1) melanocyte-reactive SL B cells were
transferred; or (2) melanocyte-reactive SL T helper cells induced BL B cells to produce
anti-melanocyte autoantibodies.
One must consider the possibility that the BL hosts that became amelanotic as a
result of the cell transfers may actually have been susceptible to amelanosis given the 1 to
2% incidence of amelanosis in the BL. The introduction of autoreactive SL lymphocytes
may have tipped the scale in favor of disease in these individuals. This is the
conclusion that adoptive transfer of splenocytes in the NOD mice accomplished in the
work by Wicker et al. (1986).
The repetitive administrations to the BL hosts with the transfer of SL-sensitized T
cells or autoantibodies during the time period during which amelanosis has normally
occurred in the SL donors appeared to be a logical approach to inducing amelanosis and
should be done in combination with immunosuppression. Future studies should include
these two conditions. Recall that in the first experiment the BL5 hosts were immune
suppressed and were given one transfer of cells, resulting in five BL5 recipients that


13
Endogenous viruses can also deregulate the expression of normal gene products.
By their integration into the chromosome of the host, they cause interruptions in the
normal functions of the genes and their protein products. Endogenous viruses can
inactivate genes by premature termination of protein synthesis due to the addition
nucleotides encoding a stop codon. Integration of endogenous viruses can create
mutations that enhance transcription, and may therefore cause chronic protein expression.
More about endogenous viruses will be discussed in Chapter 4.
Regulation of Autoimmune Responses
Immune regulation can either encourage the initiation of autoimmunity or act to
maintain the tolerance. Cyclosporin is a potent suppressor of graft versus host disease
(GVHD) and autoimmune diseases, including the suppression of amelanosis in the Smyth
line chicken (Pardue et al., 1987). However, cyclosporin has also been shown to induce
autoimmunity (Sorokin et ah, 1986).
Adhesion molecules and cytokines can affect autoimmune processes. In the EAE
model for multiple sclerosis, transforming growth factor (TGF)-P provided protection
when the injection occurred for the period of 5-9 days after immunization with MBP;
there was no protection if TGF-P was administered before (days 1-5) or after (days 9-
11). TGF-P is immunosuppressive to the Thl-produced interferon (IFN)-y in response to
the presence of MBP (Santanbrogio et ah, 1993). This Thl-mediated autoimmune
disease was examined by Racke and colleagues (1995) for the role of co-stimulatory
molecules. They demonstrated that in vitro activation of MBP-specific lymph node cells
was inhibited by the combination of B7-1 and B7-2 activation. However in actively


44
begin trouble shooting this untapped resource. It takes time and a collective effort to try
new ideas in the chicken just as it was for pioneers with the small mammals. Beyond not
knowing if a protocol may work for a specific strain is whether the protocol already
established in the mammal can be adapted to the chicken at all.
It takes 5-6 months for chickens to become sexually mature so creating congenie
chickens with 12 or so crosses would require several years. Slow reproduction is a
problem with animals larger than mice. Larger animals are more costly to feed, house,
and have enough space for. Because the chicken is not used extensively, researchers do
not attempt new technology with them and the biotechnology industry does not find the
need to develop useful tools. Transgenic chicken embryos are created with the assistance
of infections by variants of the Rous Sarcoma Virus. Hybridomas have been developed
only in the last few years.
The genome of the chicken is just beginning to get serious attention and now only
in the past 2 years has linkage mapping of the genome with readily available
microsatellite markers is being started. Unlike the mouse, chickens have not been
characterized genetically into well-defined lines guaranteeing the purity of a line. There is
no equivalent for chicken of a library such as that of Jackson Laboratories that allows a
scientist to buy a mouse, C57BL/6, or the NZW for its specific genetic features. The
library of described avian cell differentiation antigens and known avian cytokines and
lymphokines is also less extensive than that of the mouse and human. This limits the
extent of some types of avian research, such as the cytokine profile expressed by cells in
response to inflammation of the thyroid in the Obese Strain chicken.


50
mediate that condition. This is passive immunization, dependent upon the antibodies
generated originally by the donor by active immunization or infection. Adoptive transfer
of lymphoid cells from the immune donor can provide cell-mediated immunity in a host.
Transfer of cells must be done between donors and recipients genetically matched at the
major histocompatibility complex (MHC) loci so that the donor cells are not rejected by
the recipient and do not attack the recipients tissues (graft versus host disease).
Incompatibility may also occur despite the donor and host being identical at the MHC
locus, due to differences in the minor histocompatibility antigens (Scott et al., 1995), such
as the male specific H-Y antigen.
Immunosuppression of the host animal is often utilized to facilitate adoptive
transfer studies because syngeneic matches in the MHC are rare in outbred populations.
This pretreatment also provides a void in the immune function in the recipient host
providing space for the restoration of immune function by the adoptively transferred cells
(Toivanen et al., 1975). This allows the effect of the transferred donor cells to be studied
in the absence of host lymphoid cells. One method of immunosuppression is by the use
of ionizing radiation from X-rays or y-rays to kill off rapidly dividing lymphoid cells at
doses that spare the other tissues of the body. Other means of cell depletion include
neonatal thymectomy, cyclophosphamide (which acts primarily by eliminating B cells
and suppressor T cells) (Toivanen et al., 1975; Harada and Makino, 1984), splenectomy,
and antilymphocyte antibodies generated in another species of animals.
Adoptive transfer studies have been performed to study the functions of chicken
lymphocyte subsets. Toivanen et al. (1975) compared the transplantation of lymphoid


33
the cell as neo antigens that the immune system responds to by the production of
autoantibodies.
Genetics of vitiligo susceptibility in SL chickens
Three SL sublines have been described, and each one is homozygous for a
different MHC haplotype (B^l, and B^^) based on serological typing (Erf et al.,
1995a). While all three sublines are similar in incidence of vitiligo, the SL subline
has the earliest age of onset, with more severe expression of vitiligo, and a greater
incidence of blindness due to retinal dystrophy as compared to the 5^- and B^^
sublines. Interestingly, the three SL sublines also exhibit differences in the distribution of
T cell subpopulations in peripheral blood as compared to the controls, LBL and Brown
line (BL, the parental line from which SL was derived, with a 2% incidence of vitiligo).
B^l SL chickens at 40 weeks of age contained significantly fewer CD4+ and TCR2+ ap
T cells and significantly more TCR1+ y8 T cells in peripheral blood lymphocytes (PBL)
of 40 week-old SL chickens (Erf et al., 1995a). This increase in PBL y5 T cells is
detectable as early as 13-18 weeks of age (Erf and Smyth, 1996). Similar differences
were found in the B^2 subline, but not in B^^ subline.
Chicken Immunology
Chicken Immunoglobulin genes and B cell development
Antibodies or immunoglobulins (Igs) are the antigen specific receptors produced
exclusively by the B lymphocytes. They bind soluble antigens (proteins, nucleic acids,
polysaccharides, lipids, and small chemicals) by recognizing conformational determinants
of the antigens in their native three-dimensional form as well as determinants unmasked


119
kb BamUl restriction fragment (11/12), the 5.8 & 3.4 kb EcoRl fragment pair (12/13),
and EcoRl restriction fragments of 12.5 kb (11/13), 7.2 kb (12/13), and 4.4 kb (12/13).
Within the SL chicken population sample, 27 of 35 chickens exhibited different
restriction digest patterns using BamUl, and 26 of 35 birds exhibited different EcoRl
patterns. Two ev loci appear to be shared by all SL chickens. The first of these is
represented by the same 7.3 kb BamUl restriction fragment present in 11 of 12 BL
chickens. The second ev locus present in all SL chickens is represented by the 8.2 kb
BamUl restriction fragment and by the 11.2 & 1.3 kb EcoRl fragment pair (designated ev-
SL2, see below). The other most common ev locus in SL chickens is represented by an
8.1 kb EcoRl restriction fragment present in 32 of 35 birds (designated ev-SL4, see
below).
Five pairs of restriction fragments are present in the same groups of chickens for a
particular restriction digest. Given the large number of different genotypes segregating in
the BL and SL populations and the fact that the probe detects both viral LTRs, these
restriction fragment pairs are likely to represent the 5' and 3' junctions of individual ev
loci. These restriction fragment pairs include the 9.1 & 3.8 BamUl fragment pairs (ev-
SL1, Table 4-2), and the 11.2 & 1.3 kb (ev-SL2), 4.2 & 2.8 kb, 8.4 & 3.2 kb, and 5.8 &
3.4 kb EcoRl fragment pairs (Table 4-2). There were only two exceptions to this pairing
of fragments, in that one BL bird (BL214) had a 3.2 kb EcoRl band in the absence of a
8.4 kb EcoRl band, and one SL bird (SL77) had a 3.4 kb .EcoRl band in the absence of a
5.8 kb EcoRl band.


147
Humphries, E.H., Danhof, M.L., and Hlozanek, I. 1984. Characterization of endogenous
viral loci in five lines of white Leghorn chickens. Virol. 135(1): 125-38.
Im, S., Hann, S.K., Kim, H.I., Kim, N.S., and Park Y.K. 1994. Biologic characteristics
of cultured human vitiligo melanocytes. Inti. J. Dermatol. 33(8): 556-62.
Inoue, K., Niesen, N., Milgrom, F., and Albini, B. 1993. Transfer of experimental
autoimmune thyroiditis by in situ perfusion of thyroids with immune sera. Clin.
Immunol. Immunopathol. 66(1): 11-7.
Iraqi, F., Darvas, A., Zeitlin, G., Beckmann, J., and Soller, M. 1994. Nonlinear effects of
chicken endogenous viruses on body weight may be responsible for maintaining
these elements in a stable genetic polymorphism. Poultry Sci. 73(11): 1625-32.
Janeway, C.A. Jr., and Travers, P. 1997. Immunobiology: The Immune System in
Health and Disease. 3rd ed. Garland, New York.
Jaroszewski, J., Sundick, R.S., and Rose, N.R. 1978. Effects of antiserum containing
Thyroglobulin antibody on the chicken thyroid gland. Clin. Immunol, and
Immunopathol. 10(1): 95-103.
Kappler, J.W., Staerz, U., White, J., and Marrack, P.C. 1988. Self-tolerance eliminates T
cells specific for MLs-modifed products of the major histocompatibility complex.
Nature 332: 35-40.
Kaufman, D.L., Erlander, M.G., Clare-Salzler, M., Atkinson, M.A., Maclaren, N.K., and
Tobin, A.J. 1992. Autoimmunity to a determinant common to glutamate
decarboxylase and Coxsachie virus in insulin-dependent diabetes. J. Clin. Invest.
89(1): 283-92.
Kaufmann, S.H. 1990. Heat shock proteins and the immune response. Immunol. Today
11: 129-136.
Kodama, H., Saitoh, H., Tone, M., Kuhara, S., Sakaki, Y., and Mizuno, S. 1987.
Nucleotide sequences and unusual electrophoretic behavior of the W-chromosome-
specific repeating DNA units of the domestic fowl, Gallus gallus domesticus.
Chromosoma 96(1): 18-25.
Koevary, S., Rossini, A.A., Stoller, W., and Chick, W. 1983. Passive transfer of diabetes
in the BB/W rat. Science 220: 727-8.
Kotzin B.L. 1996. Systemic lupus erythematosus. Cell 85(3): 3030-6.


Table 2-2. Adoptive transfer of amelanosis with single transfers of SL splenic lymphocytes.
Test
Group
Hosts
Donors
# Amelanotic/
# Survived
No.
Age
Sex
Irradiated
(rads)
Sex
Age
Amelanosis
Stage
# Cells /
Host
1A
3
18 d
F
750
F
8 w
2
5xl07
IB
3
18 d
M
750
M
16 w
3
00
o
X
1C
3
18 d
M
750
M
16 w
5
3xl08
5/12
ID
1
18 d
F
750
F
16 w
4
4xl08
IE
2
18 d
M,F
750
F
16 w
4
2xl08
2A
4
12 d
n.d.
850
M
20 w
2
7xl08
1/4
2B
3
12 d
n.d.
850
M
32 w
(BL)
lxlO8
0/3
2C
12
12 d
n.d.
850
-
-
-
0
0/12
3A
1
6 w
F
-
M
16 w
3
lxlO9
0/1
3B
2
6 w
F
-
F
10 w
4
2xl08
0/2
3C
2
6 w
F
-
M,F
10 w
4
2xl08
0/2
n.d.=not determined


92
Two birds (SI and S3) were characterized by early onset of amelanosis, prior to 5
weeks of age, and three of four SL birds were completely amelanotic at the time of PBL
collection at 25 weeks of age. As controls, PBL were used from two age-matched BL
chickens, which had normal plumage.
TCR Vy5 repertoire analysis
Rearranged Vyl, Vy2 and Vy3 genes were amplified by RT-PCR from PBL
mRNA, cloned into a plasmid vector, and individual clones were sequenced. A total of
86 rearranged Vy genes were sequenced from the PBL of BL and SL chickens. Thirteen
sequences were eliminated due to the presence of stop codons or frame-shifts in CDR3.
The presence of these clones was not unexpected, because the PBL were not pre-enriched
for y8 T cells, and nonproductive TCR-y gene rearrangements would be expected in the
total PBL population from ap as well as y5 T cells. The first indication of the
heterogeneous clonality of the cloned Vy genes from both BL and SL was indicated by
the fact that only 5 sequences were repeat sequences, i.e. identical to other clones derived
from the same animal.
Partial nucleotide sequences for the Vy framework region 3 (FR3),
complementarity determining region 3 (CDR3) (i.e. the Vy-Jy junction), and FR4
(encoded by the Jy gene segment), are shown in Figures 3-1, 3-2, and 3-3 for Vyl, Vy2,
and Vy3 families, respectively. BL and SL Vy sequences are aligned with reference
sequences we have recently described for Vy gene families in White Leghorn (WL)
chickens (Six et al., 1996). Identical sequences were obtained from different animals in
only two cases. Two identical Vy2 sequences were obtained from two different BL


131
suggesting that the genome of this individual BL chicken is more similar to SL chickens
than to other BL chickens. This observation is consistent with the hypothesis that the 1-
2% incidence of amelanosis observed in BL chickens (Smyth et al., 1981) is due to the
chance combinations of multiple recessive vitiligo susceptibility genes segregating in the
Brown line, and that these genes were selected for during the derivation of the Smyth
line. In conclusion, although we find no evidence of linkage of ev loci with the vitiligo
phenotype in SL chickens, our results suggest that BL and SL chickens bear considerable
genetic polymorphisms, and will therefore provide a useful model for further genetic
dissection of vitiligo susceptibility.


20
Immunohistochemical studies have shown the actual loss of melanocytes
(LePoole et al., 1993). Melanocyte loss is accompanied by epidermal and dermal
lymphocyte infiltrations in the active lesions (Harm et al., 1993; Badri et al., 1993) with
increases in both CD4+ and CD8+ T cells (Hann et al., 1993). Cellular infiltrates have IL2
and IFN-y expressed, indicating a possible Thl recruitment (Abdel-Nasar et al., 1994).
The Association of Vitiligo with Other Autoimmune Diseases and the Genetics of
Vitiligo Susceptibility in Humans
Vitiligo is inherited as a polygenic trait and probably involves mutations in at
least 3 or 4 autosomal recessive genes (Lacour and Ortonne, 1995; Bhatia et al., 1992).
The risk of developing vitiligo appears to be strongly dependent on ones kinship to the
proband and not dependent on gender. The relative risks, whether parent, sibling or
offspring of probands, show considerable variation, pointing to a lack of involvement of
a single gene with complete penetrance (Majumder et al., 1993). However, the high
frequency of familial aggregation of the disease in association with other
autoimmune/endocrine diseases, and the presence of organ-specific autoantibodies in the
first and second degree relatives of the patients gives support to a genetic predisposition
in vitiligo (Mandry et al., 1996).
Recent data suggest that human endogenous viruses may be involved in the
pathogenesis of a variety of human autoimmune diseases, such as diabetes, systemic
lupus erythematosus, rheumatoid arthritis, psoriasis, and inflammatory neurologic
diseases (Yoon, 1990; Urnovitz and Murphy, 1996). Vitiligo may indeed be triggered by
a viral infection in select patients (Grimes et al., 1996). Affected vitiligo patients can
also express the hypothyroidism found in Hashimotos thyroiditis, Graves disease, and


Asp TyrTyrCys
Vyl-186
TATACATCTTCCAAAATGGGGAATAAAATCTGCACTCTCTCAGTTCAAGACATAGGTGATGATGATAAAGGTACCTACTACTGT
Vyl-B2.17
Vyl-B2.24
Vyl-B2.20
Vyl-B2.15
...TTG..
..AT..
..GT.A...
...TG
Vyl-B2.21
...TTG..
. AT. .
. .GT.A. .
...TG
Vyl-B2.18
...TTG..
..AT..
..GT.A...
...TG
Vyl-B2.2
...TTG..
..AT..
. .GT.A. .
...TG
Vyl-B2.22
Vyl-S2.1
Vyl-S2.3
Vyl-S2.5
Vyl-S2.2
Vyl-Sl.1
Vyl-Sl.4
Vyl-Sl.6
Vyl-S6.3
Vyl-Sl.7
Vyl-Sl.2
...TTG..
..AT..
..GT.A...
. .TG
C
G
C
G
c
G
c
G
c
G
c
G
c
G
G. . .
. .C
c
G
...TTG..
..AT..
..GT.A...
...TG
Vyl-S2.11
...TTG..
..AT..
..GT.A...
...TG


35
bursa involutes, and no new B cell development occurs. The B cell population is
maintained by the proliferation of a post bursal population.
Chicken T cell receptor genes and T cell development
T cells recognize antigens that are linear processed fragments of foreign proteins,
but only when presented to the T cell receptors (TCR) in physical association with a self
MHC molecule expressed on the surfaces of syngeneic antigen presenting cells or on
target cells. TCR are heterodimer plasma membrane proteins and the surfaces that bind
the peptide-MHC complex are expressed as unique determinants, which differ in one
clone from another, providing different antigen-MHC specificities. The particular TCR
will recognize peptides associated with either class I MHC or class II molecules, which
are also recognized by the CD8 or CD4 coreceptor molecules, respectively.
Both TCR aP (50kDa) and y5 (40kDa) receptor molecules are disulfide-linked
heterodimer glycoproteins noncovalently associated with a CD3 complex as in mammals
(Sowder et al., 1998; Chen et al., 1989; Char et ah, 1990). They are identified by anti-
TCR antibodies: y5 (TCR1) (Sowder et ah, 1988), api (TCR2) (Cihak et ah, 1988; Chen
et ah, 1988), and a.p2 (TCR3) (Chen et ah, 1989; Char et ah, 1990).
Chicken precursor T cells originate from pleuripotent stem cells in the embryonic
thoracic aorta that then colonize the spleen, yolk sac, and bone marrow. Thymocyte
progenitors enter the thymus in three waves into the thymic epithelium, which produces
P2 microglobulin as a chemoattractant (Dunon et ah, 1990). Each wave of progenitors
will give rise to all three different forms of T cells, always in the order of y8, VpTaP,
and Vp2+ap (Figure 1-7).


101
3-4. Predicted amino acid sequences of rearranged TCR Vy genes
4-1. Southern blot analysis of ev loci detected as BamHl restriction fragments .... 116
4-2. Southern blot analysis of ev loci detected as EcoRl restriction fragments .... 117
4-3. BL and SL chickens have similar total numbers of ev loci 121
4-4. SL chickens have more ev-SL loci than BL chickens 123
xi


Vy2- 502 9 GCCTACTGGGACCCT
Vy2-B2.8
Vy2-B2.12
Vy2-B2.6 ^
Vy2-B1.2 (3)
Vy2-B1.7
VY2-B1.6
VY2-B1.5
VY2-B2.13
VY2-B1.4
VY2-B1.21
VY2-B1.9
VY2-B1.18
VY2-S1.1 (3)
VY2-S6.1 ^
VY2-S2.13
VY2-S1.3
VY2-S1.4
VY2-S2.1 ^
VY2-S2.9
VY2-S1.8
VY2-S2.10 ^
VY2-S6.4 ^
VY2-S1.9
VY2-S1.2
VY2-S1.6
VY2-SI.14
VY2-S6.7
N region PheGly GlyThr Jy
AGTCCGAGG TATTACTACAAAGTTTTCGGCTCTGGTACAAAGCTCATTGTATCAGAC 1
CTCGAGA GGA 1
AGTTCCTTCCCTAAGGGTACT 1
AgTGCG 1
AgTGCG 1
TCGTCC G.TG.G. .A.A. .T. .AAG. .A. .T. .A. .T T 2
GTCCTGTTCG 1
GCTCAAAA A 1
AGG 1
CAAG AGTGCA.GGAT .... TAC A.A..A..T G C..CA.. 3
ATCTCTATC GCA. GGAT .... TAC A.A..A..T G C..CA.. 3
GTAC GCA. GGAT.... TAC A.A..A..T G C..CA. 3
AGTGCA.GGAT. . .TAC A.A. .A. .T G C. .CA. 3
AGTGCG 1
ACG 1
TCGGC A 1
CATG GATCCGGA 1
A GA T 1
ATTAGGA C 1
TCGTGGGTTG GATCCGGA 1
GTA TGCA. GGAT.... TAC A.A..A..T G C..CA.. 3
ATGTCG GCA. GGAT .... TAC A.A..A..T G C..CA.. 3
ATAACTCCACGGG T....TAC A.A..A..T G C..CA.. 3
CTCGCGTCGTCTTA TATAGTGCA. GGAT.... TAC A.A..A..T G C..CA.. 3
TA GGA 1
TCG GGAT.... TAC A.A..A..T G C..CA.. 3
CGA TATAGTGCA. GGAT.... TAC A.A..A..T G C..CA.. 3
ATCGGCGGTGGGTCG G. TG. G. . A. A. T. AAG. . A. T . A. T T 2
VO
ON
Figure 3-2. Partial nucleotide sequences of rearranged TCR-Vy2 genes from Brown line and Smyth line chickens, showing the FR3, N region and Jy
sequences. Clone designations include an animal number (shown in Table 3-1 for SL) and an individual clone number. Sequences recovered more than
once are indicated by the number of repeats in parentheses after the clone number. Sequences are aligned with reference Vy genes Six et al 1996).
Evolutionarily conserved amino acids in Vy and Jy are indicated above the nucleotide sequence. Dots symbolize identity to the reference sequence.
Nongermline encoded nucleotides are labeled as the N region. Possible P nucleotides are underlined.


UNIVERSITY OF FLORIDA
3 1262 08555 3096


CHAPTER 5
SUMMARY AND FUTURE DIRECTIONS
As autoimmune diseases are explored many have witnessed that finding a simple
answer is doubtful. The process of amelanosis found in the Smyth line chicken is another
example of a complex situation. There is obvious evidence that it is a polygenic
phenomenon. Three sublines of the Smyth line chicken exist as the B^Ol, B^2 and the
B^ 03 The B^01 subline has the quickest onset and greatest severity but all three had a
high incidence of amelanosis between 80% and 90%. Yet even in the B^Olf there is
variability. Females usually display a quicker onset, pass through the stages more rapidly,
and achieve the higher stages of amelanosis than the males. However, not all females
will develop amelanosis. Some will never become amelanotic, while others do not even
begin depigmentation until the 17lh week of life and do not progress to the severe stages.
In the SL2 population, three females reverted and became partially repigmented after they
became sexually mature. Most of the male B^Ol never became amelanotic. Of the male
B^Ol chickens that did become amelanotic a few became just as severe as the females
with similar ages in terms of onset and progression. Some and only female SL chickens
were blind, as noticed by their unawareness when they were being picked up. There were
females that displayed alopecia, the feathering defect.
Thus the variability of amelanosis in the Smyth line B subline characterizes the
polygenic variability in the rate, penetrance and environment. Smyth reported that in
132


48
encode components of retroviruses that have become integrated in the genomes of all
species of vertebrate animals. They are stable and inherited in Mendelian fashion. The
random integrations provide unique genetic markers that can be used to follow
inheritance and examine for correlations with phenotype.
It is a goal of using animal models to provide a means to gain understanding of a
human disease. This study of the amelanosis in the Smyth line chicken is being pursued
to understand vitiligo in humans.


140
Ando, I., Chi, H.I., Nakagawa, H., and Otsuka, F. 1993. Difference in clinical features
and HLA antigens between familial and non-familial vitiligo of non-segmental type.
Br. J. Dermatol. 129(4): 408-10.
Arden, B., Clark, S.P., Kabelitz, D., and Mak, T.W. 1995. Human T-cell receptor
variable gene segment families. Immunogenetics 42 (6): 455-500.
Arden, B., Clark, S.P., Kabelitz, D., and Mak, T.W. 1995. Mouse T-cell receptor
variable gene segment families. Immunogenetics 42 (6): 501-30.
Ashany D., Hines J., Gharavi, A., Mouradian J., and Elkon, K.B. 1992. Analysis of
autoantibody production in SCID-systemic lupus erythematosus (SLE) chimeras.
Clin. Exp. Immunol. 88(1): 84-90.
Astrin, S.M., Buss, E.G., and Hayward, W.S. 1979. Endogenous viral genes are non
essential in the chicken. Nature 282: 3339-40.
Austin, L.M., and Boissy, R.E. 1995. Mammalian tyrosinase-related protein-1 is
recognized by autoantibodies from vitiliginous Smyth chickens. An avian model
for human vitiligo. Am. J. Pathol. 146(6): 1529-41.
Austin, L.M., Boissy, R.E., Jacobson, B.S., and Smyth, J.R. Jr. 1992. The detection of
melanocyte autoantibodies in the Smyth line chicken model for vitiligo. Clin.
Immunol. Immunopathol. 64(2): 112-20.
Badri, A.M., Todd, P.M., Garioch, J.J., Gudgeon, J.E., Stewart, D.G., and Goudie, R. B.
1993. An immunohistological study of cutaneous lymphocytes in vitiligo. J.
Pathol. 170(2): 149-55.
Bagchi, N., Brown, T.R., and Sundick, R.S. 1995. Thyroid cell injury is an initial event
in the induction of autoimmune thyroiditis by iodine in obese strain chicken.
Endocrinology 136(11): 5054-60.
Barker, C.F., and Billingham, R.E. 1972. Immunologically privileged sites. Adv.
Immunol. 25: 1-54.
Bamaba, V. 1996. Viruses, hidden self-epitopes and autoimmunity. Immunol. Rev.
152:47-66.
Bamaba, V., Franco, A., and Balsano, F. 1989. Autoimmune chronic liver disease as a
model of human autoimmunity. Clin. Exp. Rheumatol. 7, Suppl 3: S47-50.
Becks, G.P., and Burrow, G.N. 1991. Thyroid disease and pregnancy. Med. Clin. North.
Am. 75(1): 121-50.


68
Two males, BL5-111 and BL5-115, also developed an amelanotic phenotype
resembling that of the Smyth line and were followed more closely. Around the sixth
month of BL5-111s life, regenerating feathers began to display melanocyte destruction
in the pulps that had been all along reflected in the banded black and white feather vanes.
Now the pulps in regenerating feathers were creamy gray instead of homogenous black.
By the eighth month, the pulps in the regenerating feathers in BL5-111 were mostly gray,
some were banded black and white, and only one to two percent were still completely
black. B15-115, even in its eighth month, still displayed a low level of amelanosis with
mostly black pulps in the regenerating feathers. Nevertheless, the feather vanes were
banded with the oldest parts, the tips, being black and the youngest parts, closest to the
pulp, being white or depigmented. The development of amelanosis was very gradual and
not convincing until changes in the pulps could be witnessed. Photographs of the extent
of amelanosis developed at the age of 7 months are shown in Figure 2-4 and 2-5.
In the second cell transfer experiment, three groups of 12 day-old BL7 generation
hosts (sex not predetermined) were used as the recipients of a single transfer of cells
comparing hosts receiving lymphocytes from a SL donor to hosts receiving lymphocytes
from a BL control donor (Table 2-2).
Hosts were irradiated with 850 rad total irradiation each on the day before the
adoptive transfer and given a single reconstitution of SL splenic lymphocytes or BL
lymphocytes. An extra 12 BL7 which were prepared by irradiation were not used and
never reconstituted with cells. These 12 survived until sacrificed after 20 plus weeks of
age.


Earliest
Order of formation
of feather parts
Isochronous segments
Rachidial ridge
Main barb ridges:
Joined to rachidial ridge
Not yet joined
to rachidial ridge
Epidermal collar
Ramogenic zone
Zone of most active
cell proliferation
Hyporachidial ridge
Site of original
ventral locus
Sites of daughter
ventral loci
Figure 1-4. Model of a developing feather showing the arrangement of barb ridges as basilar and intermediate cells rearrange
themselves into barbs. The barbs are laid out in a spiral course, extruded by the addition of cells upward away from the
epidermal collar (base). They grow axially (along the shaft of) and tangentially (perpendicularly): the sum of these vectors
is a spiral. The barbs are carried upward by the lengthening pulp and pushed obliquely outward. The feather (vane) will
arise from the oldest or tip of the feather as the vane spreads out radially. The sheath and pulp have been removed in this depiction.
Adapted from Avian Anatomy-Integument. Lucas and Stettenheim, 1972. Public domain for public use from the Agricultural Res.
Service, USDA.
ro
-j


144
Dietrich, P.Y., Caignard, A., Lim, A., Chung, V., Pico, J.L., Pannetier, C., Kourilsky, P.,
Hercend, T., Even, J., and Triebel, F. 1994. In vivo T-cell clonal amplification at
time of acute graft-versus-host disease. Blood 84(8): 2815-20.
Douvas, A., and Sobelman, S. 1991. Multiple overlapping homologies between two
rheumatoid antigens and immunosuppressive viruses. Proc. Natl. Acad. Sci. USA
88(14): 6328-32.
Duncan, M.R., Berman, B., Van de Water, J., Boyd, R.L., Wick, G., and Gershwin, M.E.
1995. Mononuclear cells isolated from fibrotic skin lesions in avian scleroderma
constituitively produce fibroblast-activating cytokines and Immunoglobulin M.
Int. Arch. Allergy Immunol. 107(4): 519-26.
Duncan M.R., Wilson, T.J., Van de Water, J., Berman, B., Boyd, R., Wick, G., and
Gershwin, M.E. 1992. Cultured fibroblast in avian scleroderma, an autoimmune
fibrotic disease, display an activated phenotype. J. Autoimmunity 5(5): 603-15.
Dunon D., and Imhof, B.A., 1996. T cell migration during ontogeny and T cell repertoire
generation. In: Immunology and Developmental Biology of the Chicken. O. Vainio
and B.A. Imhof (Eds.). Curr. Top. Micro. Immunol. Springer, New York. 212: 79-
93.
Dunston, G.M., and Haider, R.M. 1990. Vitiligo is associated with HLA-DR4 in Black
patients. A preliminary report. Arch. Dermatol. 126(1): 56-60.
Elder, M., Maclaren, N., and Riley, W. 1981. Gonadal antibodies in patients with
hypogonadism and/or Addisons disease. J. Clin. Endo. Metab. 52(6): 1137-42.
Erf, G. F., Lakshmanan, N., Sreekumar, G.P., and Smyth, J.R. Jr. 1995a. Mitogen-
responsiveness and blood lymphocyte profiles in autoimmune, vitiliginous Smyth
Line chickens with different MHC haplotypes. In: Progress in Avian Immunology,
T. F. Davison (Ed.). Carax Publ., Abingdon, U.K.
Erf, G.F., Trejo-Skalli, A.V., and Smyth, J.R. Jr. 1995b. T cells in regenerating feathers
of Smyth Line chickens with vitiligo. Clin. Immunol. Immunopathol. 76(2): 120-6.
Erf, G.F., and Smyth, J.R. Jr. 1996. Alterations in blood leukocyte populations in Smyth
line chickens with autoimmune vitiligo. Poult. Sci. 75(3): 351-6.
Ferber, L, Schonrich, G., Schenkel, J., Mellor, A. L., Hammmerling, G.J., and Arnold, B.
1994. Levels of peripheral T cell tolerance induced by different doses of tolerogen.
Science 263: 674-6.
Fishman, P., Merimski, O., Baharav, E., and Shoenfeld, Y. 1997. Autoantibodies to
tyrosinase: the bridge between melanoma and vitiligo. Cancer 79(8): 1461-4.


152
Phillips, M.J., Needham, M, and Weller, R.O. 1997. Role of cervical lymph nodes in
autoimmune encephalomyelitis in the Lewis Rat. J. Pathol. 182(4): 457-64.
Prota, G. 1988. Progress in the chemistry of melanins and related metabolites.
Medicinal Research Rev. 8(4): 525-56.
Preston, F.M., Beier, P.L., and Pope, J.H. 1995. Identification of the respiratory syncytial
virus-induced immunosuppressive factor produced by human peripheral blood
mononuclear cells in vitro as interferon-alpha. J. Infect. Dis. 172(4): 919-26
Racke M.K., Scott, D.E., Quigley, L, Gray, G.S., Abe, R., June, C.H., and Perrin, P.J.
1995. Distinct roles for B7-1 (CD80) and B7-2 (CD-86) in the initiation of
Experimental Allergic Encephalomyelitis. J. Clin. Invest. 96(5): 2195-203.
Ramsingh, S.I., Chapman, N., and Tracy, S. 1997. Coxackieviruses and diabetes.
Bioessays 19(9): 793-800.
Raulet, D.H. 1989. The structure, function, and molecular genetics of the y/8 T cell
receptor. Ann. Rev. Immunol. 7:175-207.
Regnault, A., Cumano, A., Vassalli, P., Guy-Grand, D., and Kourilsky, P. 1994.
Oligoclonal Repertoire of the CD8aa and the CD8aP TCR-a/p Murine Intestinal
Intraepithelial T Lymphocytes: Evidence for the Random Emergence of T cells. J.
Exp. Med. 180:1345-58.
Reynaud, C.A., Anquez, V., Grimal, H., and Weill, J.C. 1987. A hyperconversion
mechanism generates the chicken light chain preimmune repertoire. Cell 48(3):
379-88.
Reynaud, C.A., Bertocci, B., Dahan, A., and Weill, J.C. 1994. Formation of the chicken
B cell repertoire: ontogenesis, regulation of Ig gene rearrangement, and
diversification by gene conversion. Adv. Immunol. 57: 353-78.
Rider J.R., Ollier, W.E., Lock, R.J., Brookes, S.T., and Pamphilon, D.H. 1997. Human
cytomegalovirus infection and systemic lupus erythematosus. Clin. Exp.
Rheumatol. 15(4): 405-9.
Richert, J.R., Robinson, E.D., Camphausen, K., Martin, R., Voskuhl, R.R., Faerber,
M.M., McFarland, H.F., and Hurley, C.K. 1995. Diversity of T-cell receptor V
alpha, V beta, and CDR3 expression by myelin basic protein-specific human T-cell
clones. Neurology 45(10): 1919-22.


158
Yoon, T.H., Paparella, M.M., Schachem, P.A., and Alleva, M. 1990. Histopathology of
sudden hearing loss. Laryngoscope 100(7): 707-15.
Yurovsky, V.V., Sutton, P.A., Schulze, D.H., Wigley, F.M., Wise, R.A., Howard, R.F.,
and White, B. 1994. Expansion of selected Vpi+ y8 T cells in systemic sclerosis
patients. J. Immunol. 153(2): 881-91.
Yurovsky V.V. 1995. The repertoire of T-cell receptors in systemic sclerosis. Crit. Rev.
Immunol. 15(2): 155-65.
Yurovsky, V.V. and White, B. 1995. T cell repertoire in systemic sclerosis. Int. Rev.
Immunol. 12(2-4): 97-105.
Zhang, J., Weiner, H.L., and Hafler, D.A. 1992. Autoreactive T cells in multiple
sclerosis. Int. Rev. Immunol. 9:183-201.
Ziemiecki, A., Kromer, G., Mueller, R.G., Hala, K., and Wick, G. 1988. Ev 22, a new
endogenous avian leukosis virus locus found in chickens with spontaneous
autoimmune thyroiditis. Arch. Virol. 100:267-71.


67
Table 2-3. Progression of amelanosis in 5 BL5 hosts after adoptive transfers of SL
splenic lymphocytes.
Age of host in months
Animal
sex
3m
4m
5m
6m
7m
8m
9m
BL5
F
4(a)
BL5
F
4(a)
BL5-105
F
1
2
3(b)
BL5-111
M
1
2
2
3
3
3
3(c)
BL5-115
M
1
2
2
2
2
2
2(c)
(a) Died at 12 weeks old and removed from poultry unit before samples could be taken.
(b) Died within the fifth month of age and removed before photographs and samples
could be taken.
(c) Died after the ninth month of age.
There are five levels to describe the degree of amelanosis as developed by Erf et
al. (1995b) and adapted by this lab:
(1) normal, no apparent amelanosis; (2) mixed amelanosis, with both normal and
<20% amelanotic feather tissue; (3) mixed amelanosis, with normal and 20-60%
amelanotic feather tissue; (4) mixed amelanosis, with normal and >60% amelanotic
feather tissue; and (5) complete amelanosis, all developing feathering tissue is
amelanotic. SL chickens with stage 1 or no amelanosis are also referred to as
nonprogressors, and SL chickens with any apparent amelanosis (stages 2-5) are referred
to as progressors.


A
B
BL
SL
Total number of ev loci present
FIG. 4-3. BL and SL chickens have similar total numbers of ev loci. The numbers of ev loci detected in individual
BL and SL chickens by (A) BamHl and (B) £coRI restriction digests are plotted against the number of birds with
each number of loci. Filled bars, BL; open bars, SL.


103
with the nonsegmental form of vitiligo have been studied for changes in their peripheral
blood lymphocyte subsets by FACS analysis using a panel of mAbs recognizing T cell
surface markers (Abdel-Nasser et al., 1992). No significant differences were observed in
T cells positive for ap TCR, y5 TCR, CD3, CD4, CD8, CD45RO, CDllb, CDllc,
CD 16, CD56, CD25, or CD54. The only changes that were detected included a decrease
in the CD45RA+ subset and an increase in HLA-DR+ cells, suggesting an increase in
activated peripheral T cells. Whether this observation is unique to this subset of human
vitiligo patients or represents a difference in the pathogenesis or progression of vitiligo in
the SL chicken animal model is unknown.
In this report we addressed the issue of clonality of the peripheral blood y8 T cells
in the avian model of vitiligo, and found no evidence for clonal expansion of y8 T cells
belonging to any of the three subgroups of y8 T cells that can be identified based on Vy
family gene expression. This conclusion is based on analysis of CDR3 length, CDR3
amino acid content and Vy-Jy gene combinations expressed in SL peripheral blood as
compared to the control parental BL chicken. It should be noted that the number of y8 T
cells in the affected tissue, i.e. growing feathers, does increase ten-fold in SL chickens,
however, due to the even greater expansion of aP T cells, the proportion of y8 T cells in
the infiltrating T cell population actually is lower than in the feather pulp of normal
animals (Erf et al., 1995b). It is unknown whether the infiltrating y8 T cells are clonally
expanded.
Future studies might include the use of spectratyping of CDR3 lengths to
determine which Vp and Vy subfamilies show recurrent usage based on the size of the


150
McCormack, W.T., Tjoelker, L.W., Stella, G., Postema, C.E., and Thompson, C.B. 1991.
Chicken T-cell receptor (3-chain diversity: an evolutionarily conserved Dp-encoded
glycine turn within the hypervariable CDR3 domain. Proc. Natl. Acad. Sci. USA
88(17): 7699-703.
McCormack, W.T., Tjoelker L.W., and Thompson C.B. 1991. Avian B cell
development: generation of an Immunoglobulin repertoire by gene conversion.
Annu. Rev. Immunol. 9: 219-41. Mitsunobu, M., Yagi, H., Kunimoto, K.,
Kawaguchi, J., Makino, S., and Harada, M. 1992. Transfer of Autoimmune
Diabetes from Diabetic NOD Mice to NOD Athymic Nude mice: The roles of T
Cell Subsets in the Pathogenesis. Cell. Immunol. 148: 189-97.
Mitsunobu, M., Yagi, H., Kunimoto, K., Kawaguchi, J., Makino, S., and Harada, M.
1992. Transfer of Autoimmune Diabetes from Diabetic NOD Mice to NOD
Athymic Nude mice: The roles of T Cell Subsets in the Pathogenesis. Cell.
Immunol. 148: 189-97.
Modlin, R., Pirmez, C., Hofman, F., Torigian, V., Uyemura, K., Rea, T., Bloom, B., and
Brenner, M. 1989. Lymphocytes bearing antigen-specific y5 T cell receptors
accumulate in human infectious disease lesions. Nature 339: 544-8.
Mombaerts, P., Amoldi, J., Russ, F., Tonegawa, S., and Kaufmann, S. 1993. Different
roles of a[3 and y§ T cells in immunity against intracellular bacterial pathogen.
Nature 365: 53-6.
Moreno, J., Vignali, D.A., Nadimi, F., Fuchs, S., Adorini, L. and Hammmerling, G.F.
Processing of an endogenous protein can generate MHC class II restricted T cell
determinants distinct from those derived from exogenous antigen. 1991. J.
Immunol. 147(10): 3306-13.
Mosman, T.R., and Coffman, R.L. 1989. Thl and Th2 cells: different patterns of
lymphokine secretion lead to different functional properties. Annu. Rev. Immunol.
7145-73.
Muir, A., Peck, A., Clare-Salzler, M., Song, Y.H., Cornelius, J., Luchetta, R., Krischer,
J., and Maclaren, N. 1995. Insulin immunization of nonobese diabetic mice
induces a protective insulitis characterized by diminished intraislet interferon -y
transcription. J. Clin. Invest. 95(2): 628-34.
Muir, A., Schatz, D., and Maclaren, N. 1993. Antigen specific immunotherapy : oral
tolerance and subcutaneous immunization in the treatment of insulin dependent
diabetes. Diabetes Metabolism Reviews. 9(4):279-87.


107
Viruses are involved in the generation of new epitopes (neoantigens) causing a loss of
tolerance (breaking of immune ignorance). Immune responses to viral antigenic
determinants may trigger cross-reactive autoimmune reactions to shared determinants of
the self-antigens that have been released due to tissue destruction during a host antiviral
immune response (molecular mimicry) (Douvas and Sobelman, 1991). Viruses may act
as superantigens that activate T cells expressing specific Vp family genes, for example
the Mis locus in mice, or they may provide immunosuppression, such as in HIV.
Respiratory syncytial virus induces host interferon production to inhibit a proliferative
response by human PBMCs to the infection (Preston et al., 1995).
In persistent infections in which the body can not completely remove the virus,
such as in autoimmune hepatitis, the infected tissue is destroyed during long-term chronic
inflammatory responses to the replicating virus. Thus, the destruction is really due to the
persistent cytotoxic T cell response on the target tissue. This destruction inadvertently
and continuously releases large quantities of the organs self-antigens (especially never
exposed intracellular antigens) which become presented by professional APCs in
lymphoid tissue (Koziel et al., 1992; Cerny et al., 1994). Subsequently, self-reactive B
cells and T cells become activated to secrete autoantibodies and maintain the autoimmune
response.
During infection, some viral protein products can modulate or counteract host
antiviral immune defenses (reviewed by Gooding, 1992; Marrack and Kappler, 1994).
Cytokines, such as interleukin-1 (IL-1) and tumor necrosis factor (TNF), have often been
the targets for such viral immune modulation. Shope fibroma virus, a pox virus, produces


LIST OF FIGURES
Figure page
1-1. A female Smyth line chicken displaying amelanosis of stage 4 23
1-2. A group of Smyth line chickens at various stages of amelanosis 23
1-3. A typical pair of parental Brown line chickens 24
1-4. Model of developing feather showing the arrangement of barb ridges 27
1-5. A cross section of a feather shaft and barb 28
1-6. A single barb ridge 29
1-7. Chick thymocyte development 36
1-8. Models depicting the V, D, J, and C gene segments of the T cell receptors .... 39
2-1. Frequencies of Smyth line females 61
2-2. Frequencies of Smyth Line males 62
2-3. Frequencies of Smyth line females and males 63
2-4. BL5-111, a Brown line adoptive transfer host displaying stage 3 amelanosis . 69
2-5. BL5-115, a Brown line adoptive transfer host displaying stage 2 amelanosis .. 69
2-6. Adoptive cell transfer hosts show antimelanocyte antibody profile typical
of SL chickens 77
3-1. Partial nucleotide sequences of rearranged TCR Vy 1 genes 94
3-2. Partial nucleotide sequences of rearranged TCR Vy 2 genes 96
3-3. Partial nucleotide sequences of rearranged TCR Vy 3 genes 98
x


87
most IELs are clonally expanded, express a small number of different Vp genes, and may
recognize a limited number of antigens. Blumberg and colleagues suggest that this small
T cell repertoire would suffice if the target antigens were conserved, such as bacterial
heat shock proteins, or a small number of endogenous antigens expressed by IELs in
response to injury. Similar to the report of Dietrich et al. (1994) on human T cell
repertoires, the IEL clonal expansion is unique to each individual; there were no shared
clonal sequences.
Kourilsky and co-workers applied their high resolution PCR-based method of
determining and following the TCR repertoire in heterogeneous cell populations of
tumor-infiltrating lymphocytes (TILs) in human melanomas. Results confirmed clonal
expansions in a rather complex polyclonal background. Detection of clonal T cell
expansions before, during, and after treatment is facilitated using this method of PCR-
detection of junctional diversity in terms of CDR3 length and sequence clonality
(Puisieux et al., 1994).
In the Smyth line chicken, the melanocytes, which are located in developing
feathers and the choroid layer of the eye, appear to be the target of both T and B cell-
mediated autoimmune responses (Smyth, 1989). Cryosections of the regenerating
feathers display an intense T cell infiltration including both ap and y5 T cell lineages (Erf
et al., 1995b). In addition, y8 T cells are found in increased proportions in the peripheral
blood of 40 week-old SL chickens (44.1%) as compared to MHC-matched parental BL
chickens (33.2%) (Erf et al., 1996) This observation is especially intriguing given the
fact the chickens have a significantly greater proportion of y5 T cells within the PBL


154
Schwartz, R.S. 1993. Autoimmunity and Autoimmune Diseases, in: Fundamental
Immunology, 3rd ed., W.E. Paul (Ed.). Raven Press, Ltd., New York.
Sciammas R., Tatsumi Y., Sperling, A.I., Arunan, K., and Bluestone, J.A. 1991. TCR y8
cells: mysterious cells of the immune system. Immunol. Rev. 13(4): 268-79.
Scott, D. M., Erhmann, I.E., Ellis, P.S., Bishop, C.E., Agulnik, A.I., Simpson, E., and
Mitchell, M.J. 1995. Identification of a mouse male-specific transplantation
antigen, H-Y. Nature 376:695-8.
Searle, E.A., Austin, L.M., Boissy, Y.L, Zhao, H., Nordlund, J.J., and Boissy, R.E. 1993.
Smyth chicken melanocyte autoantibodies: cross-species recognition, in vivo
binding, and plasma membrane reactivity of the antiserum. Pigment Cell Res. 6(3):
145-57.
Sercarz, E.E., and Datta, S.K. 1994. Mechanisms of autoimmunization: perspective from
the mid 90s. Curr. Opin. Immunol. 6(6): 875-81.
Serreze, D.V., Leiter, E.H., Worthen, S.M., and Shultz, D. 1988. NOD marrow stem
cells adoptively transfer diabetes to resistant (NOD x NON)Fl mice. Diabetes
37(2): 252-5.
Sgonc, R., Dietrich, H., Gershwin, M.E., Colombatti, A., and Wick, G. 1995. Genomic
analysis of collagen and endogenous virus loci in the UCD-200 and 206 lines of
chickens, animal models for scleroderma. J. Autoimmunity 8(5): 763-70.
Shimonkevitz, R., Colburn, C., Burnham, J.A., Murray, R.S., and Kotzin, B.L. 1993.
Clonal expansions of activated y8 T cells in recent-onset multiple sclerosis. Proc.
Natl. Acad. Sci. USA 90(3): 923-7.
Shong, Y.K., and Kim J.A. 1991. Vitiligo in autoimmune thyroid disease. Thyroidology
3(2): 389-91.
Singh, D.P., Guru, S.C., Kikuchi, T., Abe, T., and Shinohara, T. 1995. Autoantibodies
against beta-crystallins induce lens epithelial cell damage and cataract formation in
mice. J. Immunol. 155(2): 993-9.
Six, A., Rast, J.P., McCormack, W.T., Dunon, D., Courtois, D., Li, Y., Chen, C.H., and
Cooper, M.D. 1997. Characterization of avian T-cell receptor y genes. Proc. Natl.
Acad. Sci. USA 93(26): 15329-34.
Smith, E.J. 1986. Endogenous avian leukemia viruses. Avian Leukosis, G. F. de Boer
(Ed.). Martinus Nijhoff Publishing, Boston, MA., 101-120.


141
Bell, S., Cranage, M., Borysiewicz, L., and Minson, T. 1990. Induction of
Immunoglobulin G Fc receptors by Recombinant Vaccinia viruses Expressing
glycoproteins E and I of Herpes Simplex Virus type 1. J. Virol. 64 (5): 2181-86.
Bennett, D.C. 1993. Genetics, development, and malignancy of melanocytes.
International Rev. of Cytology 146: 191-260.
Bhatia, P.S., Mohan, L., Pandey, O.N., Singh, K.K., Arora, S. K., and Mukhija, R.D.
1992. Genetic nature of vitiligo. J. Dermatol. Sci. 4(3): 180-4.
Boissy R.E. 1984. Persistence of abnormal melanocytes in immunosuppressed chickens
of the autoimmune DAM line. Cell Tissue Res. 235(3): 663-8.
Boissy R.E., and Halaban, R. 1985. Establishment of proliferative, pure cultures of
pigmented chicken melanocytes from neural tubes. J. Invest. Dermatol. 84(2):
158-61.
Boissy, R.E., Liu, Y.Y., Medrano, E.E., and Nordlund, J.J. 1991. Structural aberration
of the rough endoplasmic reticulum and melanosome compartmentalization in
long-term cultures of melanocytes from vitiligo patients. J. Invest. Dermatol.
97(3): 395-404.
Boissy, R.E., Moellmann, G., Trainer, A.T., Smyth, J.R. Jr., and Lemer, A.B. 1986.
Delayed-amelanotic (DAM or Smyth) chicken: melanocyte dysfunction in vivo
and in vitro. J. Invest. Dermatol. 86(2): 149-56.
Boissy, R.E., Smyth, J.R. Jr., and Fite, K.V. 1983. Progressive cytological changes
during the development of delayed feather amelanosis and associated choroid
defects in the DAM chicken line. A vitiligo model. Am. J. Pathol. 111(2): 197-
212, 1983.
Boulliou, A., LePennec J.P., Hubert G., Donal R., and Smiley M. 1991. Restriction
fragment length polymorphism analysis of endogenous avian leukosis viral loci:
determination of frequencies in commercial broiler lines. Poultry Science 70(6):
1287-96.
Boyle, M.L., III, Pardue, S.L., and Smyth, J.R. Jr. 1987. Effect of corticosterone on the
incidence of amelanosis in Smyth delayed amelanotic line chickens. Poultry
Science 66(2): 363-7.
Brocke S., Gaur, A., Piercy, C., Gautam, A., Gijbels, K., Fathman, C.G., and Steinman,
L. 1993. Induction of relapsing paralysisin experimental autoimmune
encephalomyelitis by bacterial superantigen. Nature 365: 642-4.


40
species (Six et al., 1996), but most of the substitutions are in the silent second and third
position in the amino acid code. TCR(3 locus includes two Vp families, one Dp, four jp,
and one Cp gene segment. There are approximately 6 members of the Vpi family and
three to five of Vp2 gene segments. Within each Vp family there is little difference,
however, the two families bear little similarity.
So it appears that combinatorial rearrangement alone provides a somewhat limited
means of generating diversity in chicken T cell receptors. No sequence modifications
occur in the germline gene segments from recombination alone. In a sequence analysis of
TCRp, Cooper and colleagues realized that diversity was generated almost exclusively in
the junctions, creating nontemplated N regions. Every clone was found to have a distinct
sequence at these N junctions between V-D and D-J in the CDR3 (Cooper et al., 1991).
This is quite in contrast to humans and mice where there are about 50 functional
V gene segments in 20-30 subfamilies of Vp, plus two separate clusters each consisting
of a single Dp gene segment, a jp region (with 6-7 members each), and a single Cp gene
segment. In humans there are eight Vy gene segments with five Jy segments arranged in
two clusters and one Cy to yield 40 V-J pairings. In mice seven Vy and four Jy genes are
arranged in four V-J-Cy clusters (Arden et al., 1995a, 1995b; Janeway and Travers, 1997;
Rowen et al., 1996).
T cell repertoire analysis
Despite the fact that T cell repertoires may be as large as 1015 specificities, it
appears that most of the T cell responses studied in animal autoimmune diseases have
demonstrated restricted repertoires of responsive clones, that of oligoclonal T cell


22
(Hodgkinson et al., 1993) able to bind transcriptional control elements in melanocyte-
specific genes. This mi" allele has a single G-to-A transition, causing an Asp222Asn
substitution in the first helix domain (Steingrimsson et al., 1994). The mi1* gene product
of the mouse and the Mitf equivalent in the human regulate the expression of melanocyte-
specific genes including TRP-1 and TRP-2 (Bertolotto et al., 1996; Yasumoto et al.,
1997). However, this strain of mice does not exhibit an autoimmune component
comparable to what is seen in the human, and the affected tissues fail to show a
lymphocyte infiltration (Lemer et al., 1986; Boissy et al., 1987). The premature death and
cytological aberrations found in this strain is considered to be the consequence of an
innate cellular defect; it has been concluded that the depigmentation is the result of a
genetic defect that is not initiated by a systemic or local condition (Im et al., 1994) and so
it is not a suitable model for human vitiligo studies.
The Smyth Line (SL) Chicken Animal Model for Vitiligo
The Smyth line chicken represents a good animal model for the study of human
vitiligo (reviewed by Smyth et al., 1981; Smyth, 1989). SL chickens are characterized by
a spontaneous loss of feather and ocular melanocytes beginning around 6-8 weeks
posthatch (Figure 1-1 and 1-2); thus, feathers progressively become whiter rather than
maintain the original brown feather color of the parental Brown line strain (Figure 1-3).
The progenitor of the Smyth line was a spontaneous amelanotic female hatched in
1971 from the Massachusetts Brown line, and since then, a current frequency of
approximately 1-2% of the Brown line spontaneously becomes amelanotic. From


128
lymphocytes, resulting in a possible breakdown of normal self-tolerance. An example of
such an insertional mutagenesis event in an autoimmune disease was reported by Wu and
colleagues (1993), who observed that integration of an endogenous retrovirus has
occurred in the Fas apoptosis-regulating gene of MRL-lpr/lpr mice. Alternatively, ev loci
may represent genetic markers for linked susceptibility genes. A third possibility is that
one or more ev loci produces infectious viral particles, resulting in a somatic reinfection
of cells involved in the autoimmune process as suggested above. Whether human
endogenous viruses are involved in vitiligo remains to be determined, although their
possible involvement in human neoplastic and autoimmune disease has been suggested
(Hohenadl et al., 1996; Umovitz and Murphy, 1996).
We identified four ev loci that are present at statistically significantly higher
frequencies in SL than BL chickens, and an additional seven ev loci characteristic of BL
chickens. The predominance of the ev-SL loci may have originated during the original
selection of SL chickens and/or may have been introduced during derivation of the SL
from outcrosses with other chicken lines (Smyth et al., 1981). When the ev genotypes for
SL progressors and nonprogressors were compared, there was no significant association
of ev loci with the autoimmune phenotype, thus, in contrast to the OS and UCD-200
avian models of other human autoimmune diseases, we find no evidence for a role of ev
loci in the pathogenesis of vitiligo in the SL chicken animal model.
Possible roles for endogenous viruses in the pathogenesis of avian amelanosis
might be detectable with additional experiments. DNA methylation has been suggested
as being partially responsible for the low expression of some avian endogenous viruses.
An inhibitor of DNA methylation, 5-azacytidine can induce the expression of viral


78
the principal bands observed between the 49.5 and 80 kDa molecular weight markers
have a size of 65 to 80 kDa proteins (Figure 2-6). The 64-65 kDa protein band is seen
across all lanes (see the lower of 2 bands next to 80 kDa marker) including in the BL
(lane 8).
A 79 kDa protein band was recognized by all the SL samples (lanes 1-7) but not
by BL samples, which corresponds to a protein reported by Austin and colleagues as SL-
specific (1992 and 1995). This figure is representative of the results of three blots using 3
different BL animals. None of the three BL control sera tested had antibodies that
recognized the 79 kDa band. Austin and Boissy (1995) demonstrate that the melanocyte-
specific proteins of the 65-80 kDa range are Trp-1 specific. This 79 kDa protein may
therefore be Trp-1.
Regenerating feathers were plucked biweekly and collected of BL5-111 and BL5-
115 starting from the fifth month. Cryosections were prepared and immunostained for
CD3 expression using mouse monoclonal antibody as referenced in Chapter 1 (Erf et al.
1995b; Cooper et al., 1991). As compared to feathers from a BL control chicken, the
barb ridges of feathers from BL5-111 contained a gradually decreasing amount of
melanin in the barb ridges (data not shown). The last sample taken early in its last month,
was completely without melanin. This suggests that in the BL5-111 host, antimelanocyte
lymphocytes had penetrated beyond the confines of the pulp and invaded the barb ridges
to destroy and remove the melanocytes and their products. BL5-115 samples did not
show these changes and resembled the fully pigmented barb ridges of the BL control.
The tissue samples were poorly preserved due to improper freezing and so can not be
published. These findings, in addition to the obvious change in phenotype and the serum


23
Figure 1-1. A female Smyth line chicken displaying amelanosis of stage 4
Figure 1-2. A group of Smyth line chickens at various stages of amelanosis.


38
predominantly to the Vp2+ aP T cell subset, which makes up a very small percentage of
the total T cell repertoire, develop like TCR2 cells, and are found in the spleen, but are
rare in the intestine. They have a 4/1 ratio of CD4/CD8. Thus the three populations are
produced sequentially in agreement with their ontogeny (Coltey et al., 1989).
As in mammals, the chicken TCR genes in the chicken are structurally organized
quite similarly to that of Ig chains and are evolutionarily conserved at the protein level to
mammalian TCR. Key features of chicken TCR gene organization are shown in Figure
1-8. The a and y chain variable regions are encoded by variable (V), joining (J), and
constant (C) gene segments and join to form a sequence of V-J-C; the P and 8 chains are
encoded by V, D, J, and C gene segments, with the D, or diversity, segments between V
and J in order to form a sequence of V-D-J-C. The 8 chain locus is contained within the a
chain locus. V, D, and J gene segments are flanked by typical recombination signal
sequences (RSS) at the 3 end of V and D and the 5 end of D and J gene segments. As in
the V region of the Ig molecule, there are three complementarity determining regions
(CDR) and four framework regions (FR) in the V of the TCR molecule. These are
involved in forming a stable three dimensional surface for binding antigen peptides
presented in the major groove of the MHC molecule of an APC cell. The CDR3 is the
most variable of the three CDR due to the high level of junctional diversity generated
during TCR gene rearrangement.
The chicken TCR-y locus has three Vy families, three Jy segments, and one Cy
segment. Eight to ten members (with high homology) are found in each Vy family. The
three Jy segments are more closely related to each other than to any in mammalian


Epidermis of follicle
Feather sheath
Melanocytes
Pulp
Rachis
Barb:
Distal barbules
Proximal barbules
Ramogenic column
i 1
0.1 mm.
NJ
00
Figure 1-5. A cross section of a feather shaft and barbs perpendicular to the previous figure. The barbs radiate obliquely
from the rachis (shaft) the melanocytes at the junction of the pulp and base of the feather follicle. Melanocytes have migrated
from the dermis outside of the feather follicle into the pulp and congregate at the periphery of the pulp in the region of the barb
cells and begin to penetrate the epidermis. They migrate in to the epidermis through the basement membrane and line up in the
barbs. The melanocytes then extend dendrite processes distally outwards depositing melanin in the barbule cells. Note the
outer zone of pigmented barbule cells and the inner not pigmented zone. Melanocytes are continually supplied at the base of
the feather follicle; they provide pigment granules to the section of the feather as it develops and then degenerate.
Adapted from Avian Anatomy-Integument. Lucas and Stettenheim, 1972. Public domain for public use from the Agricultural
Res. Service, USDA.


145
Funk, P.E., and Thompson, C.B. Current concepts in chicken B cell development. 1996.
In: Immunology and Developmental Biology of the Chicken, O. Vainio and B.A.
Imhof (Eds.). Curr. Top. Micro. Immunol. Springer, New York. 212: 17-28.
Gavora, J.S., Kuhnlein, U., Crittenden, L.B., Spencer, J.L., and Sabour, M.P. 1991.
Endogenous viral genes: association with reduced egg production rate and egg size
in White Leghorns. Poultry Sci. 70(3): 618-23.
George J.F., and Cooper, M.D. 1990. y/5 T cells and a/p T cells differ in their
developmental patterns of receptor expression and modulation requirements. Eur. J.
Immunol. 20(10): 2177-81.
Gold, D.P. TCR V gene usage in autoimmunity. 1994. Curr. Opin. Immunol. 6(6): 907-
12.
Goodenow, M.M., and Hayward, W.S. 1987. 5' Long terminal repeats of myc-associated
proviruses appear structurally intact but are functionally impaired in tumors induced
by avian leukosis viruses. J. Virol. 61(8): 2489-98.
Gooding, L. R. 1992. Virus Proteins that Counteract Host Immune Defenses. Cell 71:5-
7.
Gossage, A.A., and Munro, D.S. 1985. The pathogenesis of Graves disease. Clin.
Endocrinol. Metab. 14(2): 299-330.
Goverman, J.A., Woods, L., Larson, L.P., Weiner, H., Hood, L., and Zaller, D.M. 1993.
Transgenic mice that express a myelin basic protein specific T cell receptor develop
spontaneous autoimmunity. Cell 72(4): 551-60.
Grimes, P.E. 1993. Vitiligo. An overview of therapeutic approaches. Dermatol. Clin.
11(2): 325-38.
Grimes, P.E. 1996. Diseases of hypopigmentation. In: Principles and practice of
Dermatology. 2nd ed., W.M. Sams and P.J. Lynch (Eds.). Churchill-Livingstone,
New York, 843-57.
Haas W., Pereira P., and Tonegawa S. 1993. Gamma/delta T cells. Annu. Rev.
Immunol. 11:637-85.
Hafler, D.A., and Weiner, H.L. 1995. Antigen specific immunosuppression: oral
tolerance for the treatment of autoimmune disease. Chem. Immunol. 60: 126-49.


Ill
blot analysis of junction fragments, inheritance patterns, and structural analysis by
restriction mapping and/or DNA sequencing (Humphries et al., 1984; Ronfort et al.,
1990). Chicken ev loci are structurally related to the avian leukosis and Rous sarcoma
virus group (ALV and RSV). They may express gs (group specific) or chf (chicken
factor) antigens, which correspond to the viral gag and env gene products, respectively, or
may produce intact virus (Rovigatti et ah, 1983; Smith, 1986). Apparently these
endogenous proviruses are not essential; ev-negative chickens were found to be normal
and fertile (Astrin et ah, 1979).
Recent data suggests that human endogenous viruses may be involved in the
pathogenesis of a variety of human autoimmune diseases, such as diabetes, systemic
lupus erythematosus, rheumatoid arthritis, psoriasis, and inflammatory neurologic
diseases (Uronovitz and Murphy, 1996). Unique ev loci have also been reported in two
chicken models for autoimmune diseases. Ziemecki and coworkers (Ziemiecki et ah,
1996) described a new locus, designated ev22, in the Obese strain (OS), which is
characterized by autoimmune thyroiditis, a model for the human organ-specific disease
Hashimotos thyroiditis. Cosegregation was observed of ev22 with an OS-specific defect
in immunoendocrine communication (a deficient corticosterone response after
intravenous injection of lymphokines), but not with T cell hyperproliferation or
thyroiditis. Sgonc et ah (1995) reported an association of yet another novel locus,
designated ev23, in the UCD-200 and UCD-206 chicken lines, which are characterized by
hereditary systemic scleroderma-like connective tissue disease. Although ev23 may not
play a causal role in systemic scleroderma, it is suggested to contribute to disease
susceptibility, that is, by prolonging the response of glucocorticoid increasing factors,


Number
Smyth line females
Amelanosis stage 1 2D3D4D5


7
Loss of Immununological Tolerance
When the immune system is unable to remain unresponsive to self-molecules
tolerance is broken and autoimmunity may result. There are organ-specific diseases and
systemic autoimmune diseases. Two hypotheses suggest that autoimmunity arises due to
defects in the establishment of central or peripheral tolerance, or a conventional immune
response occurs against self-antigens that, under normal circumstances, did not need to
establish tolerance and the tolerance became broken. As suggested by Lehmann et al.,
(1993) a circumvention by the display of previously cryptic host determinants to which
the host never had the need to develop tolerance causes autoimmune recognition.
Mechanisms of Autoimmunity
Autoimmunity may develop against self-antigen for a number of possible reasons.
As mentioned above there may be incomplete deletions of self-reactive clones due to
immunologic ignorance. This ignorance (clonal escape) may be due to the differences in
genetic susceptibility based on the differences in ability of different alleles of MHC
molecules to bind and present autoantigens to autoreactive T cells. Thus, in healthy
individuals, there are probably autoantibodies that have been characterized as consisting
of unmutated germline sequences with low avidity for autoantigens, and there are antiself
T cells (Schwartz, 1993).
The genetics of autoimmune diseases has been demonstrated in many ways. The
HLA haplotype has often shown associations for susceptibility. For example in diabetes,
people who express the MHC class II alleles HLA-DR3 or DR4, which are tightly linked
to the HLA-DQ genes (the relevant disease susceptibility genes), have a noticeably higher


14
induced disease, administration of anti-B7-l reduced disease; anti-B7-2 exacerbated
disease. In murine diabetes, intercellular adhesion molecule 1 (ICAM-1) is involved in
recruiting lymphocytes to the pancreatic islet cells. Cytokines interferon-y and tumor
necrosis factor-a secreted by the islet cells could induce the ICAM-1 expression on
pancreatic (3 cells, and immunointervention by anti-ICAM-1 and anti-LFA-1 mAbs would
significantly prevent the development of diabetes (Yagi et al., 1995). Whereas the
administration of cytokines promotes IDDM, the administration of mAbs against Thl-
produced cytokines blocks the development of the disease (Song et al., 1996; Mossman
and Coffman, 1989; Maclaren and Atkinson, 1997).
Oral tolerance has been a method of antigen-specific immunotherapy for
autoimmune disease (reviewed by Hafler and Weiner, 1995; Muir et al., 1993). The use
of low doses of orally administered autoantigens is suggested to utilize the secretion of
downregulatory cytokines such as TGF-P and the Th2 responses of IL-4 and IL-10 to
cause active suppression. High dose therapy induces anergy, the unresponsiveness of
Thl function in a systemic presentation of autoantigen. Intermittent injections of the
autoantigen insulin, or the B chain of insulin in incomplete Freunds adjuvant, induces an
active suppressive response that induces a protective insulitis in the NOD mouse model
of diabetes (Muir et al., 1995).
Autoimmune Diseases Cause by Antibodies
Autoantibodies may bind to autoantigens on the cell surfaces or extracellular
matrix and initiate tissue damage similar to type II hypersensitivity. By interaction of
the bound antibody with Fc receptor-bearing macrophages, there is increased clearance of


126
Discussion
The inheritance of vitiligo in the Smyth line animal model is polygenic in nature,
and shows low penetrance in out-cross matings (Smyth et ah, 1981). The incidence and
severity of the amelanosis and other associated autoimmune defects (hypothyroidism and
alopecia-like feathering defect) in the SL chicken are influenced by a variety of factors,
both genetic and environmental. Although the major histocompatibility complex (MHC)
is an important genetic factor, as evidenced by differences in disease severity and age of
onset associated with different MHC alleles in SL sublines (Erf et ah, 1995a), the BL and
SL chickens used in this study were MHC-matched, thus ruling out MHC influence.
Other genetic factors appear to include inherent melanocyte defects, melanin
pigmentation genes, melanocyte-stimulating hormone, and sex hormones (reviewed in
Smyth, 1989). The varying incidence of amelanosis in different SL breeding colonies
from 60-90% suggests that some environmental factors may be associated with housing
conditions (McCormack and Smyth, unpublished).
Human vitiligo also appears to be polygenic, and is suggested to result from
recessive alleles at several unlinked autosomal loci based on extensive familial
aggregation of vitiligo (Bhatia et ah, 1992; Majumder et ah, 1993), and the observation
that 20% of probands are reported to have at least one first-degree relative affected by
vitiligo (Nath et ah, 1994). It has been speculated that simultaneous alterations in several
genes are required to cause disease or increase susceptibility, e.g. mutations in genes
controlling melanocyte growth and survival and/or the immune response (Lacour and


10
In response to an environmental change, cytokines, such as TNF-a and IFN-y
(Pestka and Langer, 1987), may cause shifts in the peptides synthesized, and oxygen
radicals have induced the heat shock protein (HSP) response. HSP have facilitated
peptide binding onto the MHC (De Nagel and Pierce, 1992), and caused differences in
self-peptides produced during stress. In the EAE model of T cell-mediated
autoimmunity, Lehmann and colleagues (1992), showed that a single determinant of
myelin basic protein (MBP), the peptide Acl-11, was the immunodominant determinant
in the primary response to MBP. Other determinants were cryptic, although available.
Later in the chronically diseased mice the formerly cryptic host peptide determinants
became the immunodominant primers of the second immunization. This has
demonstrated diversification of the T cell repertoire due to determinant spreading.
Prior infections causing tissue damage and the inability to clear immune
complexes have been suggested in the induction of autoimmune disease. There are
several mechanisms that have been postulated to explain how viral involvement leads to
autoimmunity (Aichele et al., 1996; Nakagawa and Harrison, 1996; Bamaba, 1996).
Viruses are involved in the generation of new epitopes (neoantigens) causing a loss of
tolerance (breaking of immune ignorance). Goverman and associates (1993) developed a
transgenic mouse to mimic the spontaneous induction and pathology of multiple
sclerosis, which expressed a TCR specific for myelin basic protein. Spontaneous EAE
could not develop in a sterile environment, but it could develop easily if the mice were
given pertussis virus alone or even simply housed in a nonsterile facility (Goverman et
al., 1993). Anti-viral immune responses may shift and recognize shared molecular


of peripheral blood lymphocytes with age in SL chickens. Sequence analysis of the T cell
receptor y8 repertoire of the peripheral blood lymphocytes indicated a polyclonal
expansion, rather than monoclonal or oligoclonal, a result that might be expected if they
played a direct role in antigen-driven pathogenesis. The expansion of y8 T cells may be
secondary to spillover from the site of inflammation at the regenerating feather pulp. A
future experiment to examine the T cells found in the developing feather may
demonstrate recurrence of an oligoclonal subset of T cells. This could lead to the
development of therapy aimed at inhibiting clonal T cell activation.
Southern blot analysis indicates that depigmentation does not appear to show an
association with the presence of integrated endogenous viruses. The genetic heterogeneity
present in SL chickens and revealed by the ev genotyping shows the feasibility of genetic
linkage mapping to find vitiligo susceptibility loci.
There are many diseases that have autoimmune responses to what are normally
innocuous everyday proteins produced in the body. Studying autoimmune vitiligo adds
one more piece to the autoimmune disease puzzle. One to two out of every 100 persons
suffer from vitiligo. If a common factor can be found then preventive therapies would
enhance the lives of many people.
xiii


43
digits, and skin (Haynes and Gershwin, 1983). Survivors develop a severe lymphocytic
infiltrate of the comb, skin, digits, and viscera. They develop an excessive buildup of
collagen, resulting in fibrosis of the dermis and as vascular occlusions of internal organs
such as the esophagus, small intestine, lungs, kidneys, heart, and testes. T helper and T
cytotoxic cells are present with a CD4:CD8 ratio of 1.44:1 by week four (van der Water
et al., 1989). The infiltrates also contained distinct groups of B cells as the disease
progressed. These infiltrates secrete IgM, fibroblast-activating cytokines (Duncan et al.,
1995), antinuclear antibodies (including antibodies to ssDNA), and anticytoplasmic
antibodies that recognize an avian-specific set of antigenic determinants (Haynes and
Gershwin, 1983). As in humans, fibroblast activation is suggested to contribute to fibrosis
(Duncan et al., 1992). A defect in the T cells' response to a panel of T cell mitogens such
as concanavalin A or pokeweed mitogen indicates abnormalities in T cell stimulation as
seen in decreased calcium influx and proliferation (Wilson et al., 1992).
Limitations in the use of the chicken animal model
No animal can represent perfectly what is found in a human. Small mammals
have become the more popular study models and often they can depict the human
phenomenon reasonably well. In the case of vitiligo, the chicken presents a closer animal
model due to the shared features suggesting an autoimmune component to the disease.
However, the chicken is not well regarded as a relevant animal model for medical
research, certainly not as extensively as the laboratory mouse. With a much more
limited pool of investigators and experience, there is not an extensive network of shared
technical protocols that have been developed or people aware of the chicken system to


47
both species, except in nearly 50% of the affected that become blind as well. There are
similar inherent defects within the chicken melanocyte. An intense lymphocytic infiltrate
with increased numbers of CD8 and CD4 T cells is associated in the chicken.
Autoantibodies are detectable before the onset of amelanosis. A putative autoantigen,
tyrosinase-related protein, has been detected and is related tyrosinase which is an enzyme
involved in melanogenesis (Austin and Boissy, 1995).
Thus in this study of vitiligo, experiments were designed to ask some of the same
questions as in other animal models of autoimmunity. Adoptive transfers of lymphocytes
from affected SL chickens into non-affected BL chickens tested the hypothesis that
autoimmune lymphocytes can induce the destruction of the feather melanocytes and
cause the depigmentation. Likewise, the hypothesis that sera containing autoantibodies
might induce disease if transferred to an unaffected host was also tested.
Since T cells have been shown in diabetes to cause the disease, the question of
which subsets of T cells might be the key members involved would help define the
pathology. In the peripheral blood of Smyth line chickens, the y8 T cells increase in
proportion during the course of the amelanosis and with age. Therefore, a repertoire
analysis of the y8 T cells in the peripheral blood was examined.
Since animal models allow one to manipulate the genotype of the animals to
determine genetic causes of diseases, preliminary genetic studies of the SL chickens were
performed. If certain patterns of inheritance are found that would correlate with the
presence, absence, onset, or severity of the disease then this would help in the
understanding and predictability of the disease. Endogenous viruses are genes that


Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy
CHARACTERIZATION OF THE PATHOGENESIS OF AMELANOSIS IN THE
SMYTH LINE CHICKEN: A MODEL OF THE HUMAN AUTOIMMUNE DISEASE
VITILIGO
By
EDMUND C. LEUNG
May 1998
Chairman: Wayne T. McCormack, Ph.D.
Major Department: Immunology, Pathology and Laboratory Medicine
Autoimmune diseases result when components of normally innocuous body
tissues have unexpectedly undergone changes that make them appear foreign to the
immune system. The immune system recognizes aberrantly expressed self proteins as
nonself and recruits an immune attack on self.
In the human autoimmune disease vitiligo, the pigment producing cells of the
skin, the melanocytes, are destroyed and patients manifest irregular expanding
depigmented patches of skin. An animal model for vitiligo, the Smyth line chicken,
displays a spontaneous loss of feather and ocular melanocytes and the feathers
progressively become whiter. Fifty percent of the birds also become blind.
By adoptive transfer of splenocytes, I demonstrated that amelanosis can be
transferred and mediated by lymphocytes. This is the first direct demonstration that
lymphocytes mediate the disease. Prior research by bursectomy has shown antibody
mediation. A role for y8 T cells was previously suggested by their expansion in number
Xll


8.2;
7.3
4.1-
2.5"
Amelanosis 555445555544 45411 1155555 54431111111
stage:
FIG. 4-l. Southern blot analysis of ev loci detected as BamH\ restriction fragments. BamH\ restriction digests of BL and SL genomic DNA samples
were hybridized with an LTR probe. \-Hin\\\ DNA size markers (lane M) include 23.1, 9.4, 6.6, 4.4, 2.3, and 2.0 kb (top to bottom). Sizes of
bands of interest are indicated on the left, and ev-SL loci are labeled on the right side. Lanes are labeled with individual animal numbers at the top,
and the amelanosis stage (Erf et al., 1995a) at the bottom. Southern blots shown are representative of three experiments.
-ev-SLf
ev-SL2
-ev-SL3
-ev-SL1
1.4-
1.3-


122
1991) and broilers (Boilliou et al., 1991) suggests that BL and SL chickens are
characterized by unique ev loci. In particular, none of the restriction fragments
representing ev-SL loci of interest, i.e. ev-SLl through ev-SL4, correspond in size with
those of previously identified ev loci. Taken together, these data suggest that a large
number of previously undescribed ev loci are segregating in BL and SL chicken.
Comparison of BL and SL ev genotypes
Statistical analyses of the frequencies for the presence and absence of ev loci in
BL and SL chickens are shown in Table 4-2 for the BamHl and CcoRI restriction digests.
Four ev loci, which we have designated as ev-SLl through ev-SL4, were observed to be
present in significantly higher proportions in SL than in BL chickens (p<0.001 by Fishers
exact test). The ev-SLl and ev-SL2 loci are identified on both the BamHl and the EcoRl
Southern blots, whereas ev-SL3 and ev-SL4 are identified on BamHl or EcoRl blots,
respectively (Figures 4-1 and 4-2; Table 4-2). The number of ev-SL loci detected per bird
and the ev-SL locus combinations observed are shown in Figure 4-4. Most SL chickens
(32/35) have 3 or more ev-SL loci, whereas most BL chickens (10/12) have one or none.
As already noted above, ev-SL2 is present in 100% (35/35) of the SL chickens tested, but
is present in only 38% (5/13) of the BL chickens. The ev-SLl locus is absent from the
BL sample population, but present in 77% (27/35) of the SL chickens tested. The ev-SL3
and ev-SL4 loci were present in 74% (26/35) and 91% (32/35) of SL chickens,
respectively, and in only 17% (2/12) and 8% (1/13) of BL chickens, respectively. As
shown in Figure 4-4, the only ev-SL combinations observed in either the BL or SL were
ev-SL2+3,
ev-SL 1+2+4,
ev-SL2+3+4, and all four ev-SL loci.


133
Massachusetts, 90% of the SL developed amelanosis. In comparison, the UF SL colony
is characterized by a 60% incidence of amelanosis while the colony of Dr. G. Erf
(University of Arkansas), which is raised under specific pathogen-free conditions, has an
even lower incidence of amelanosis (personal communication). The Brown line chickens
of the same MHC haplotype, 5^, have a susceptibility of 1-2%. One BL, BL7-1130,
did spontaneously become amelanotic at the same early onset and severity of condition as
the typical SL weve studied. The BL hosts in the adoptive transfer experiments that
demonstrated amelanosis might indeed have had the genetic combination to be more
susceptible to develop amelanosis on their own, as demonstrated in the BL7-1130.
Perhaps the transferred cells helped to potentiate and quicken what was already there.
This would reflect the work of Wickers lab. They felt that the transfer of splenocytes
from affected NOD mice into young NOD females yielded the quicker onset and severity
to already susceptible genetics within the hosts (Wicker et al., 1986).
The fact that the splenocytes were able to transfer susceptibility to the BL hosts
is an indication that T cells mediate some aspect of amelanosis. As cited before, the
works of Austin et al. (1992, 1995), Boissy et al. (1985) and Lamont et al. (1981, 1982)
have proven a role of autoantibodies by bursectomy, which basically eliminates the B cell
population in chickens. The anti-melanocyte autoantibodies detected melanocyte proteins
of 65-80kDa molecular weights, and the latest evidence shows that these represent
binding to the possible autoantigen Trp-1. The drug cyclosporin, an inhibitor of all T
cells has been shown to suppress amelanosis in the SL chicken (Pardue, 1987). The
experiments described herein, provide the first in vivo evidence that T cells can at least


89
individuals, with preferential Vy and V5 gene expression, but heterogeneous clonal
origins (Stinissen et al., 1995). Systemic lupus erythematosus patients are reported to
express a diverse PBL Vy repertoire, but an oligoclonal Vy repertoire restricted in terms
of Vy gene usage and junctional diversity (Olive et ah, 1994). Finally, increased levels of
peripheral blood yb T cells have been correlated with increased risk for insulin-dependent
diabetes (Lang et ah, 1991). Taken together, these reports suggest a possible role for y5 T
cells in the development of autoimmune diseases or associated inflammatory processes.
We tested the hypothesis that the expanded PBL y5 T cell repertoire is involved in
the pathogenesis of vitiligo in the chicken animal model by characterizing the expressed
TCR-y repertoire by nucleotide sequence analysis of Vy genes expressed in PBL of
MHC-matched SL chickens with active vitiligo and control BL chickens. The chicken
TCR-y locus consists of three families of 8-10 Vy genes, 3 Jy genes, and a single Cy gene
segment (Six et ah, 1997), thus allowing TCR Vy repertoire analysis in the chicken
animal model.
Materials and Methods
Animals
Breeding colonies were established for the B^l subline of the SL and BL from
fertile eggs generously provided by J. Robert Smyth, Jr. (University of Massachusetts at
Amherst). Chickens were raised at the University of Florida Poultry Science Unit. The
SL and BL chickens used in this study were MHC-matched and all of the B^l subline,
which is characterized by the more severe form of vitiligo in this animal model. The
degree of pigment loss (amelanosis) was classified according to the following scale after


153
Robinson, H.L., Astrin, S.M., Senoir, A.M., and Salazar, F.H. 1981. Host susceptibility
to endogenous viruses: defective glycoprotein expressing proviruses interfere with
infections. J. Virol. 40:745-51.
Ronfort, C., Afanassieff, M, Chebloune, Y., Dambrine, G., Nigon, V.M., and Verdier, G.
1991. Identification and Structure analysis of Endogenous Provial Sequences in a
Brown Leghorn Chicken Strain. Poultry Sci. 70(10): 2161-75.
Rovigatti, U.G., and Astrin S.M. 1983. Avian endogenous viral genes. Curr. Top.
Microbiol. Immunol. 103: 1-21.
Rowen, L., Koop, B.F., and Hood, L. 1996. The complete 685-kB DNA sequence of the
human (3 T cell receptor locus. Science 272: 1755-62.
Salzer, B.A., and Schallreuter, K.U. 1995. Investigation of the personality structure in
patients with vitiligo and a possible association with impaired catecholamine
metabolism. Dermatology 190(2): 109-15.
Sanchez-Garcia, F.J. and McCormack, W.T. 1996. Chicken y8 T cells. In: Immunology
and Developmental Biology of the Chicken, O. Vainio and B.A. Imhof (Eds.).
Curr. Top. Micro. Immunol., Springer, New York. 212: 55-69.
Santambrogio L., Hochwald, G.M., Saxena, B., Leu, C.H., Martz, J.E., Carlinoo, J.A.,
Ruddle, N.H., Palladino, M.A., Gold, L.I., and Thorbecke, G.J. 1993. Studies on
the mechanism by which transforming grown factor-B (TGF-B) protects against
allergic encephalomyelitis. J. Immunol. 151(2): 1116-27.
Schallreuter, K.U., Lemke, R., Brandt, O., Schwartz, R., Westhofen, M., Montz, R., and
Berger, J. 1994. Vitiligo and other diseases: coexistence or true association?
Hamburg study on 321 patients. Dermatology 188(4): 269-75.
Schallreuter, K.U., Levenig, C., Kuhnl, P., Loliger, C., Hohl-Tehari, M., and Berger, J.
1993. Histocompatibility antigens in vitiligo: Hamberg study on 102 patients from
northern Germany. Dermatology 187(3): 186-92.
Schallreuter, K.U., Wood, J.M., Ziegler, I., Lemke, K.R., Pittelkow, M.R., Lindsey, N.J.,
and Gutlich, M. 1994. Defective tetrahydrobiopterin and catecholamine
biosynthesis in the depigmentation disorder vitiligo. Biochim. Biophys. Acta.
1226(2): 181-92.
Schild, H.J., Rotzschke, O., Kalbacher, H., and Rammensee, H.G. 1990. Limit of T cell
tolerance to self proteins by peptide presentation. Science 247: 1587-9.


8
frequency of disease (Todd, 1995; Vyse and Todd, 1996). In HLA-DQJ31, the normal
Asp-57 is substituted by an uncharged amino acid residue destabilizing the DQ molecule.
Other genetic factors influence susceptibility. Identical twins have a higher frequency of
having the same autoimmune disease than MHC-identical fraternal twins. The hormonal
status of an individual affects disease susceptibility. Many autoimmune diseases show a
strong sex bias. Diabetes in the NOD mouse is more severe and occurs at a quicker onset
in the female (Wicker et al., 1986). Peak incidence of autoimmune diseases that are
more common in females occurs during the child-bearing period.
If antigens are expressed selectively in a specific tissue rather than ubiquitously
throughout the body, such antigens would be less likely to have induced clonal deletion
of autoreactive T cells in the thymus during T cell ontogeny. Antigens of peripheral
tissues especially sequestered behind anatomical barriers would not come in contact with
the developing T cell repertoire. Tissue cells do not express co-stimulatory molecules.
However, tissue damage may occur as a result of sustained direct attack of the cells
expressing the self-antigen, from immune-complex formation, or from local
inflammation. These antigens then become newly available as neoantigens in the
periphery and subject to immune scrutiny by T cells that had escaped deletion. An
example is seen in systemic lupus erythematosus (SLE). A broad range of autoantibodies
is produced against intracellular nucleoprotein components: nucleosomes, DNA, histones,
and ribosomes. Immune complexes continuously can deposit on the renal glumeruli,
joints, and small arteries, and subsequently recruit macrophages to try to eliminate these
immune complexes in a never ending battle (Kotzin, 1996; Schwartz, 1993).


CHAPTER 1
INTRODUCTION
Autoimmunity
The normal function of the adaptive immune response to a foreign antigen is the
clearance of the foreign antigen (Ag) from the body. This is mainly achieved through the
B lymphocyte compartment, which develops in the marrow in mammals or the bursa in
avian species, and through the T lymphocyte or thymocyte compartment that matures in
the thymus. The body has learned to distinguish between self-antigens and foreign
antigens during T lymphocyte ontogeny. Essentially self-tolerance is established before
mature T cells leave the thymus to enter the peripheral circulation for normal
surveillance. Tolerance can be induced to some foreign antigens and self-antigens in the
periphery by several means. Antigen presenting cells (APCs) which include B cells and
various mononuclear cells (monocytes in blood, macrophages in tissues, Langerhans cells
in the skin, Kupffer cells in liver, dendritic cells in lymph nodes) process and present
antigen peptides in the groove of the major histocompatibility complex (MHC)
molecules.
The Ag-MHC complex engages with the T cell receptor heterodimer on the
surface of a naive T cell migrating through the cortical regions in lymphoid tissue. Co
stimulation is provided by B7 on the APC engaging CD28 on the T cell. The activated T
cell then remains in the lymphoid tissue, proliferates and differentiates into armed
1


17
current treatment modalities for vitiligo, such as phototherapy with psoralens and high
intensity UV-A irradiation (PUVA), are difficult, expensive, and usually disappointing
(Grimes, 1993).
Melanocyte Biology
Melanocytes, which are located in the epidermis of the skin, produce the pigment
melanin, and release the melanin to keratinocytes. The biosynthesis of melanins occurs in
melanocytes, and the enzyme tyrosinase catalyzes several of the initial steps of
melanogenesis, which occurs within the melanosome organelle of the melanocyte (Orlow
et al., 1993; Prota, 1988; Bennett, 1993). This includes the hydroxylation of tyrosine to
dopa; the oxidation of dopa to dopaquinone and intermolecular circularization and
oxidation of dopaquinone to dopachrome. Divergent paths then take place. In the
presence of metals, dopachrome eventually becomes 5,6 dihydroxyindole, which
ultimately undergoes oxidative polymerization to create eumelanin. In the presence of
cysteine, the sulfur-containing phaeomelanins and trichochromes are polymerized. The
black eumelanins are insoluble in all solvents and the phaeomelanins, the browns and
reds, are alkali-soluble.
Two of the enzymes involved in melanin biosynthesis are characterized in studies
using mutations in the mouse at the albino locus, which encodes tyrosinase, and the
brown locus, which encodes tyrosinase related protein-1 (TRP-1). Trp-1 has a 43%
identity to tyrosinase at the protein level. Due to two amino acid substitutions, the
homozygous b/b mouse produces brown melanin which at physiologic pH, is soluble
instead of the black melanin produced in the wild type which is insoluble. During


100
CDR3 length and amino acid composition
The amino acid sequences encoded by the BL and SL Vy genes are shown in
Figure 3-4 for the region between the conserved Cys94 and Phel08 residues in Vy and Jy,
respectively. Sequences were compared for overall CDR3 length, measured as the
number of amino acids between these two anchor positions, the number of nongermline-
encoded amino acids in the N region, and for the amino acid content of CDR3 and N
regions. No differences were found between BL and SL for the CDR3 or N region length
of all Vy sequences combined or for individual Vy families. When the SL Vy amino acid
sequences in the CDR3 were compared to BL, there were fewer nonpolar and more
charged amino acids in Vyl sequences, and more nonpolar and fewer polar amino acids
in Vy3 sequences. However, none of the differences in amino acid content (frequency of
nonpolar, polar, and charged amino acids between BL and SL Vy sequences were
statistically significant as determined by %2 analysis (data not shown).
Jy usage
Overall the usage of the three Jy gene segments in the BL and SL sequences was
58% vs. 51% usage of Jyl, 13% vs. 19% of Jy2, and 30% vs. 29% of Jy3. Although there
appeared to be more Vyl-Jyl and Vy3-Jy2 and fewer Vyl-Jy3 and Vy3-Jyl combinations
in SL chickens as compared to BL chickens, the differences in Jy usage overall and
within each Vy family are not statistically significant by yj analysis (data not shown).
Discussion
The function of y8 T cells in general is less well understood than that of ap T
cells, and they are characterized by functional differences, such as antigen recognition


57
Immunosuppression of the Host Animals
Some host BL chicks were immunosuppressed by sublethal irradiation one day
before the cell transfers, y irradiation was performed using a l37Cs source at the U.F.
Health Center Animal Resources Facility. Dosages used were either 750 rads (Toivanen
et al., 1975, as used on 4 day old chicks) to 850 rads (Dr. Bruce Glick, personal
communication) or none at all.
Preparation of the SL Donor Cells and Cell Injections
The donor SL cells were obtained from SL chickens undergoing active amelanosis
at the time of sacrifice (8 to 20 weeks of age). The spleens were removed, made into cell
suspensions in PBS on ice by teasing the organ and by dounce homogenization, and the
lymphocytes were separated from the red blood cells by density centrifugation over
Ficoll-Hypaque (Pharmacia). The splenic lymphocytes were resuspended in PBS at a
density of 5xl07 to lxl 09 cells per ml, and a maximum of 1-2 ml of cell suspension was
then injected intravenously into the right jugular vein with the balance into the wing
brachial vein. The recipient animals were then monitored in normal housing conditions
(not pathogen-free) for at least 20 weeks of age to allow the development of the
amelanotic phenotype during the typical time frame as would be found in a SL chicken.
Smyth Line Serum Collection and Preparation
Serum was collected from Smyth Line chickens that displayed obvious
amelanosis (at least level 3) at the time of collection. A range of 20 to 60 ml of blood per
bird was collected into heparinized Vacutainer tubes from the jugular and/or brachial
vein of the wing. Blood was centrifuged at 1500 rpm to collect the serum, which was


CHAPTER 4
ENDOGENOUS VIRAL LOCI IN THE SMYTH LINE CHICKEN: A MODEL FOR
THE AUTOIMMUNE DISEASE VITILIGO
Introduction
Viruses have been implicated in the pathogenesis of many autoimmune diseases.
Infections by human cytomegalovirus (HCMV) have shown a specific and highly
significant association with systemic lupus erythematosus, which has also been associated
with retroviruses and Epstein Barr Virus infections (Rider et al., 1997). After an
encephalomyelitis infection that has been enhanced by a cryolesion in Lewis rats,
cervical lymph nodes appear to be a source of autoimmune lymphocytes involved in
cerebral EAE. Reduction in severity of EAE by lymphadenectomy suggested that the
lymph nodes prime T cells to target the infected brain (Phillips et al., 1997). There are
several murine models of virus-induced diabetes, including lymphocytic choriomeningitis
(LCMV), Coxsackie virus, herpes virus, and encephalomyocarditis virus, which is related
to the mouse mammary tumor virus (MMTV) and encodes a MHC class Il-dependent
superantigen via its N-terminal moiety in its env gene (Conrad et al., 1997; Ramsingh et
al., 1997).
Several mechanisms have been postulated to explain how viral involvement leads
to autoimmunity (Aichele et al., 1996; Nakagawa and Harrison, 1996; Bamaba, 1996).
106


46
therapy to attempt to stimulate new melanization However the treatments are harsh,
prolonged and the success rate is poor.
Often the presence of one autoimmune condition can be found to occur along with
other preexisting autoimmune conditions and this is true for vitiligo. For example, vitiligo
has been associated with Autoimmune Polyglandular Syndrome type 1 and vitiligo
patients have increased risk for other autoimmune diseases.
Animal models have proven to be very useful in studying the pathogenesis of
autoimmune diseases. In the study of diabetes mellitus, the target of autoimmune
destruction is the P islet cells of the pancreas. The NOD mouse has been a very useful
animal model to study the human disease. The insulitis has an infiltration mainly of CD8+
T cells but also of CD4+ T cells to a lesser degree. The disease has been proven by many
9
labs to be adoptively transferred using T lymphocytes. Immunotherapy targeted at the T
cell has been used inhibit the progression of the disease. Autoantibodies against the islet
cells are characteristic of diabetes. They proceed and are detectable before the onset of
the disease. GAD has been identified as a major autoantigen; both forms of which have
homology with a peptide from Coxsackie virus. Islet cell antigen (ICA) has more recently
been identified as a autoantigen in diabetes. Yet, the role of the autoantibodies in causing
the destruction is not clear.
The Smyth line chicken is the best available animal model for the study of human
vitiligo. The melanocytes of the regenerating feather compare to the melanocytes of
human epidermis and hair follicles. The depigmentation develops in patches that are
irregular and expand as the process proceeds. The disease is otherwise asymptomatic in


76
induced amelanosis was apparent by the age of 18 weeks at which time it was decided to
terminate the experiment, 8 weeks after the last injection of gamma globulins.
Western Blot Analysis
Western blot analysis was performed to confirm the presence of antimelanocyte
autoantibodies in the serum pools used for the gamma globulin adoptive transfer
experiments. Serum from the two adoptive cell transfer BL hosts that became melanotic,
BL5-111 and BL5-115, were also examined to learn more about the extent of their
phenotype.
As shown in Figure 2-6, serum pools 1, 3, and 4 (lanes 1, 2, and 3 respectively)
did contain autoantibodies specific to melanocyte proteins in the size range of 65-80kDa,
reported as characteristic of the Smyth line chickens by Austin et al. (1992). Lanes 4, 5,
6, and 7 are serum samples from BL adoptive cell transfer hosts, BL5-111 and BL5-115,
from two timepoints each at about a month apart. All four samples had the same
autoantibody profiles specific for the same melanocyte proteins as seen typical in the
other SL sera (lanes 1, 2, and 3). This suggests that, in addition to the partially amelanotic
phenotype observed in these hosts, antimelanocyte autoantibody production may have
been induced by the adoptive transfer of SL splenic lymphocytes. Control sera included
an amelanotic SL positive control that recognized the same 65-80 kDa protein bands, and
a BL serum negative control (lane 8), which did not contain autoantibodies that would
recognize the same melanocyte proteins.
According to Austin and colleagues, the SL antimelanocyte antibodies recognize
melanocyte proteins between 65 kDa and 80 kDa in size. Using Image Maker software,


53
and cell dose-dependent susceptibility range (Bendelac et al., 1987). LaFace and Peck
(1989) transferred diabetes in non-susceptible C57BL/6 or B10.BR/cd mice, and Serreze
and co-workers (1988) did the same in NOD SCID hosts. T cells have been generally
recognized as being mediators of autimmunity against the pancreatic (3 cells in diabetes.
Autoantibodies can also be transferred from autoantigen-immunized donors to
induce the autoimmune disease in hosts. Autoantibodies to the thyroid stimulating
hormone receptor from mothers with Graves disease frequently produce thyroid
activation when serum is transferred into the fetus. Because IgG can cross the placenta,
infants of affected mothers can be bom with hyperthyroidism (Gossage and Munro, 1985;
Becks and Burrows, 1991). Thyroiditis enduring for up to 40 days has been induced by
the transfer of antiserum to susceptible strains of mice (Tomazic and Rose, 1975).
Likewise in the Obese Strain chicken, the chicken model for thyroiditis, repeated
injections of high titer antiserum for 4 weeks induced thyroiditis (Jaroszewski et al.,
1988). In EAE, serum transfer in a rabbit model induced severe autoimmune thyroiditis
(Inoue et al., 1993). Autoimmune cataract formation has been created experimentally in
eyes of mice by means of serum and monoclonal antibody transfers from donors which
had received injections of emulsified beta-crystallins (Singh et al., 1995).
A current hypothesis of the pathogenesis in the Smyth Line chicken suggests that
there are inherent defects in the melanocytes, predisposing SL melanocytes to abnormal
antigen presentation (Smyth, 1989; Austin and Boissy, 1995; Sreekumar et al., 1996).
Cells and antibodies in the SL chicken become sensitized to melanocyte antigens.
Presumably auto-reactive T cells associated with the melanocytes can be seen infiltrating


65
rapid and severe the amelanosis developed); (4) whether hosts were irradiated; and (5) the
number of injections of cells.
The first cell transfer experiment was performed on 18-19 day-old BL chicks
(mean weight of 126 g). In order to allow for the possibility that changes might occur in
the autoimmune T cell repertoire during the course of disease, two age groups of SL
donors were used. The plan included five test groups with a one time donation of
transferred cells per host, as shown in Table 2-2 (Groups 1A-1E).
Total body irradiation of 750 rads was issued per host BL bird on the day before
the adoptive transfer. The splenic lymphocyte suspensions were prepared with a range of
cells between 5xl07 cells/ml and 4xl08 cells/ml, which is within the range used in
mouse and rat transfer experiments. Hosts and controls were kept in normal housing
conditions. Of the 25 BL host chickens, 12 survived. Of these 12 BL hosts that received
SL donor cells, 5 (44%) displayed a partial amelanotic phenotype. This has been
summarized in Table 2-3, which shows the progression of amelanosis of these 5 hosts
after receiving the transfer of SL lymphocytes.
Two females, from either groups 1A, ID, or IE, each developed a highly severe
stage of amelanosis within 3 months of age. Unfortunately, these two died and were
removed from the poultry unit by the animal caretaker before photographs and tissue
samples could be taken. Unfortunate too, was the fact that the birds had outgrown their
leg tags. Other BL hosts only hinted of a possible amelanotic phenotype. BL5-105, a
female also from either groups 1A, ID, or IE, gradually developed amelanosis to stage 3
in severity. Unfortunately, this healthy bird died suddenly before photographs were
considered. It too was removed from the poultry unit before samples could be taken.


16
similar to that of the mothers temporarily, until the baby starts manufacturing its own
antibodies. This describes one form of passive adoptive transfer of autoimmunity.
Autoimmune Diseases Caused by T Cells
Autoimmune T cells may also be directly involved in tissue destruction or in
causing inflammation by activating macrophages, as well as being necessary to maintain
autoantibody responses. They require the autoantigen presented on MHC with co
stimulatory ability from a professional APC and at sufficient quantities to interact in
lymphoid tissue in order to initiate an autoimmune response. In insulin-dependent
diabetes mellitus, the insulin-producing p cells of the pancreatic islets are selectively
destroyed by CD8+ T cells, which have received inappropriate activation from CD4+ T
cells that were activated by APCs. The specificity of the autoantigen as the target of
destruction can be seen in pancreas transplants when, even though the graft is from an
identical twin donor, the recipients T cells destroy the graft.
Vitiligo in Humans
Vitiligo is an acquired melanin pigmentary disorder of the epidermis and hair
follicles, manifested by expanding, irregular, depigmented lesions of the skin. Vitiligo
can appear at any stage of life (LePoole et al., 1993) but half of those affected develop
vitiligo before the age of 20. Vitiligo is a common disease, affecting 1-2% of the
population in all racial groups worldwide. It is otherwise asymptomatic and most
patients remain physically in good health. However it does predispose affected persons
to sunburn skin damage and an 180-fold increased risk of melanoma (Dunston and
Haider, 1990). The often severe cosmetic disfigurement has psychological effects and


79
antibody profile, suggest several samples of evidence of the changes induced by the
adoptive transfer of SL lymphocytes in this BL5-111 host.
Discussion
Adoptive transfer experiments often can provide a means to study the
autoimmune response in vivo in the intact organism. We used this experimental approach
to determine whether melanocyte-sensitized lymphocytes and/or autoantibodies have the
capacity to transfer amelanosis in a non-Smyth line chicken.
In hindsight, this portion of my project presented numerous technical challenges
for a chicken animal model, including a relative lack of published protocols for adoptive
transfer, radiation doses, etc. Most literature reported protocols in which mice were
suppressed soon after sexual maturity (8-10 weeks). However, chickens are not sexually
mature until the fifth or sixth month and that is unsuitable for the study of amelanosis in
the SL. Most literature reported using approximately 5x10 donated cells whether the
cells were bone marrow cells, spleen, or lymph node cells. Our experiments involved the
transfer of up to lxlO9 cells.
I had consulted several authorities on the chicken animal model, but never found a
standard protocol for the immunosuppression of hosts of cell transfer that answered such
questions as to its necessity, by which means, and how much per age or weight or other
measurable parameter. Most published mouse and rat experiments did use irradiation
(Wicker et al., 1986; Hanafusa et al., 1988; Panitch and McFarlin, 1977; van der Veen et
al., 1989; Toivanen et al., 1975). Miller et al. (1988) subjected 4 to 8 week-old NOD
mouse recipients with up to 950 rad of irradiation. However, within 2 hours the hosts


Southern Blot Analysis of BL and SL ev Loci 114
Comparison of BL and SL ev Genotypes 122
Comparison of SL Progressor and SL Nonprogressor ev
Genotypes 124
Discussion 126
5. SUMMARYAND FUTURE DIRECTIONS 132
LIST OF REFERENCES 139
BIOGRAPHICAL SKETCH 159
vm


134
transfer a potentiation of the amelanotic disease susceptibility found in the Smyth
chicken.
It would thus be worth expanding these T cell transfer experiments. As stated
earlier, fewer restrictions to the experiment need to be in place to better assure its success.
I would suggest an experiment patterned using a series of repeated donations of affected
SL splenocytes, using cyclophosphamide to provide the immunosuppression.
Cyclophosphamide does not affect T cells and untreated chicks are reported to have a
better survival rate (Toivanen et al., 1975; Lehtonen et al., 1990). A dose dependence
curve should be generated to optimize the quality of immunosuppression despite the
sacrifice of an initial set of birds. A more pathogen-limited environment in which to raise
the immunocompromised hosts during the initial recovery from immunosuppression is
suggested. The use of 5-azacytidine may help to potentiate the manifestation of the
amelanotic phenotype of the hosts as seen in the work by Sreekumar and colleagues
(1995); but it might disguise the cell transfer. Mitogen-stimulation such as by Con-A of
the donor splenocytes may also help to potentiate the observation of amelanosis in the
transfer hosts.
If repeatable results continue, then T cell subsets may further help define the
involved autoimmune T cells. Separation of chicken T cell subsets is made possible with
available reagents that include y5 T cells, ap T cells expressing Vpi genes, and ap T
cells expressing Vp2 genes, which are identified by the mouse monoclonal antibodies,
TCR1, TCR2, and TCR3, respectively.


137
What has still not been addressed is the inherently defective melanocyte itself.
Still available are original plans to perform antibody dependent cell cytotoxicity assays.
These would consist of incubating cultured SL or BL melanocytes (all of the
haplotype) from cultures with either affected or nonaffected SL sera or BL sera and either
White Leghorn complement or White Leghorn spleen cells as effectors of cytotoxicity.
This will examine the surface expression of the SL melanocyte and detect aberrant
expression of melanocyte autoantigens as compared to that expressed by BL. Such
autoantigens might be those involved in melanin production, including TRP-1. If the sera
of the SL can activate the destruction of both BL and SL melanocytes or if the sera of the
BL can not activate the destruction of either of the melanocytes, then the melanocyte is
not different between the two strains, at least at the level of surface expression of key
autoantigens.
Experiments detecting differences in RNA and protein expression between SL and
BL melanocytes and T lymphocytes are another direction. This would require that a
library of primers for chicken cytokines be readily available, unless one is willing to
optimize the conditions for using mammalian primers. Cultures would include T cells,
melanocytes and APCs. PCR amplification from mRNA isolated from the cultures would
allow the detection of the types of cytokines released by the T cells. The identification
of IL receptors may be detected as well.
A cDNA library of the mRNA produced by cultured melanocytes could be
established. From the survey conducted, identity of candidate vitiligo susceptible loci
can be determined. The cDNA would be cloned into vectors and the DNA of candidate
vitiligo susceptible loci sequenced. The sequence could be translated into an amino acid


113
(1984), and washed with 2x SSC, 0.1% SDS at room temperature, followed by 0.1 x SSC,
0.1% SDS at 65 C. The hybridization probe consisted of a 32P-labeled 315 bp Sacl-
EcoRl restriction fragment from the plasmid pU5L (the generous gift of Dr. Maureen
Goodenow), representing the U5 region of the avian leukosis virus LTR (Goodenow and
Haywood, 1987). This probe hybridizes with both the 5' and 3' LTR of avian leukosis
virus and endogenous viruses (ev loci). Restriction fragments were scored as present or
absent. Restriction fragment sizes were calculated based comparison to HindlU
restriction fragments of lambda phage DNA. A single copy probe for the T cell receptor
C(3 gene segment (Tjoelker et al., 1990) was used as a control to detect partial digestion.
Statistical analyses
The frequencies of individual ev loci, identified as BamHl and £coRI restriction
fragments or pairs of fragments, were compared using standard statistical tests, including
X2 analysis and Fishers exact test, to determine whether the differences observed between
the BL and SL, or between SL progressors and nonprogressors, were statistically
significant.
Results
Phenotypic analysis of SL sample population
Thirty-five SL and 13 BL chickens were used for the Southern blot analysis of ev
loci. Twenty-four of the 35 SL chickens displayed a maximum amelanosis stage of 3-5
according to the amelanosis scale of Erf et al. (1995b) and were classified as progressors
in the analyses described below. Eleven SL chickens showed no sign of amelanosis


60
line chicken is summarized in Table 2-1. Female Smyth chickens (Table 2-1 and Figure
2-1) usually demonstrate a quicker onset and more severe manifestations of the
phenotype of depigmentation at a higher frequency than in males, a phenomenon that has
been seen in other autoimmune disease animals such as the female NOD mouse.
During the first 6-9 weeks, 42% of the females (16 of 38) became amelanotic,
with 12 at the more severe levels (stages 3-5). As the birds aged, the females continued to
have a higher proportion that are affected and have the more severe phenotype. By the
17th week, 66% of the females were amelanotic and of these, 20 displayed the more
Table 2-1. Amelanosis incidence in the UF Smyth line colony
Population
# number
available
early onset
(6-12 wks)
delayed
onset
(17 wks)
number
amelanotic
%
amelanotic
total
amelanotic
SL2
6F
5/6
1/6
6/6
100%
60%
11M
3/11
1/11
4/11
36%
10/17
SL3
14F
9/14
1/14
10/14
71%
77%
8M
7/8
0
7/8
87.50%
17/22
SL11
9F
4/9
3/9
7/9
77%
68%
16M
8/16
1/16
9/16
56%
17/25
SL12
17F
5/17
2/17
7/17
41%
36%
11M
2/11
1/11
3/11
27%
10/28
total F
72%
60%
total M
52%


138
sequence and compared with sequences submitted in GenBank or similar database. This
may characterize and reveal the possible aberrant nature of the SL melanocyte.
The nature of the proteins expressed may reveal possible epitope differences
between the SL and BL melanocytes. It may confirm or corroborate with the work of
Boissy and colleagues in the identification of autoantigens (Austin et al., 1992; Austin
and Boissy, 1995). It may lead to oral immunotherapy experiments using peptide
administrations similar to the administrations of MBP into EAE mice and GAD into
NOD mice to induce tolerance.
Thus, this was my study of amelanosis in the Smyth line chicken as an animal
model for the autoimmune disease of human vitiligo. Vitiligo is just one piece in the
autoimmune puzzle. As one of many autoimmune diseases, it is my hope, as well as
others, that a common factor or theme of factors can be found and that I would in some
way have helped improve the lives of many.


25
outcrosses to various other chicken lines and backcrosses of the original mutant back to
the Brown line, the delayed amelanosis (DAM) line, later renamed the Smyth line, was
developed by selection for onset of amelanosis and severity (Smyth et al., 1981). Since
the fifth generation, the Smyth line has closely resembled the parental line and three
novel MHC B alleles are segregating in both lines (Erf et al., 1995a).
Pigment and melanocyte loss in SL chickens can range from partial to complete
amelanosis, and about 50% of depigmented birds are blind due to melanocyte destruction
in the choroid and retinal pigmented epithelium (Smyth, 1989). The magnitude of
amelanosis in any Smyth line bird depends on the time frame of each feathers
development when melanin synthesis and pigment deposition are destroyed. Up to 90%
of a hatch will exhibit the amelanotic phenotype as reported by Smyth (Smyth, 1989)
although as described in chapter 2, only about 60% are amelanotic in the University of
Florida colony.
SL chickens also have an increased incidence of thyroiditis/hypothyroidism
resembling human Hashimotos thyroiditis, and a defeathering defect analogous to human
alopecia (Smyth, 1989). Thus it is characterized by the same features as human vitiligo,
including an association with other autoimmune diseases (Elder et al., 1981; Schallreuter
et al., 1994; Shong et al., 1991). SL melanocytes have been shown in vivo and in vitro to
have intrinsic aberrant morphology, increased tyrosinase activity, and increased acid
phosphatase activity (Boissy et al., 1983, 1986), suggesting that, as in human vitiligo
(Boissy et al., 1991), an inherent melanocyte defect may be important for pathogenesis.


69
Figure 2-4. BL5-111, a Brown Line adoptive transfer host displaying stage 3 amelanosis


31
and severity of amelanosis in the Smyth Line chicken as long as the treatment continues.
However, when the therapy is stopped the amelanosis will be as severe as littermate non
treatment controls (Boyle et al., 1987; Pardue et ah, 1987).
It appears that the MHC locus influences the disease progression. Three MHC
alleles have been found segregating within Smyth line chickens and sublines have been
established (B^^, B^2 an(j of the three, exhibits the earliest age of onset
and the most severe phenotypes (Erf et ah, 1995a).
Evidence for T cell involvement in amelanosis in the Smyth chicken is less
extensive. Studies have demonstrated that cyclosporin A, a potent inhibitor of IL-1 and
IL-2 release that normally stimulate PBMLs and NK cells, can measurably reduce the
incidence and severity of amelanosis in SL chickens (Pardue, 1987). There is also
histological evidence of an intense T cell involvement in amelanosis of the SL chicken
(Erf et ah, 1995b). Lymphocytic infiltration is consistently seen associated at sites of
melanocyte destruction (Smyth, 1989) which have recently been shown to be primarily T
cells (Erf et ah, 1995b) as detected by polyclonal and monoclonal antibodies against
functionally important surface T cell molecules (Cooper et ah, 1991; Chen et ah, 1988;
Chen et ah, 1989; Char et ah, 1990; Lahti et ah, 1988).
T cells infiltrate growing feather pulp as much as 6 weeks prior to visible signs of
vitiligo. Significantly greater numbers (9-14 fold) of T cells of all three subpopulations, y
5 (detected by TCR1), Vpi+ api (detected by TCR2), and Vp2+ap2 (detected by TCR3)
are found present in cross sections of the feather pulp in SL as compared to BL prior to
and throughout amelanosis. Of note are the proportions of TCR2+ cells being


56
amelanosis (stages 2-5) are referred to as progressors. It should be noted that the
phenotypes reported represent the maximum amelanosis stage reached and were stable.
The SL donors were hatched and raised before hatching the BL hosts so that there
were visible amelanotic donors by the time they were 8-12 weeks old in time to donate
their cells to 3 week old BL hosts.
Sex Determination by PCR
The sex of the donors and the recipients was determined when the hosts were 3
weeks old because the hosts at this age do not have definitive secondary sexual features
for reliable identification. SL females display the earlier onset and more severe phenotype
than SL males and would appear to have the best potential of passing autoreactive T cells.
The ideal transfer would be from a SL female to a BL female. Attempts were made in
some experiments to avoid female to male cell transfers in case of possible
incompatibility at the minor H loci. In birds, the females are the heterogametic sex,
bearing the W and Z chromosomes whereas males are ZZ. The gender was determined
by PCR using primers, Chi I and Chi III, derived from the sequence of the chicken W
chromosome-specific Xho repeat fragment described by Kodama et al. (1987) and kindly
provided by Dr. Siwo R. de Kloet (Florida State University, Tallahassee). The DNA
template for the PCR was obtained from a drop of blood obtained by pricking the brachial
wing vein and absorption onto Isocode Stix, PCR template preparation dipsticks
(Schleicher and Schuell Inc., Keene, NH). Genomic DNA was eluted and PCR amplified
as directed by the manufacturer. A 316 bp product was resolved on a 1% agarose gel.


58
then stored at -80C. The sera was then pooled and the gamma globulin fraction was
obtained by two sequential precipitations with 33% and then 28% saturated ammonium
sulfate. The precipitates were dissolved in a minimum volume of cold phosphate
buffered saline (PBS), dialyzed 2-3 days against 4C PBS after each precipitation, and
then filter-sterilized using a .45p micropore filter (Nalgene). Aliquots of the gamma
globulin fractions were then introduced by injection in the jugular vein (1-2 ml) with an
additional volume (2-3) introduced intraperitoneally beneath the breastplate.
Cell Lines
Chicken melanocyte cultures were obtained from chicken embryonic neural crest
tissue by the method of Boissy and Hallaban (1985) in the laboratory of Gisela Erf and
obtained as a gift. Cultures were grown in Hams F10 media (Sigma) supplemented with
10% FBS, 5% Nuserum (Collaborative Biomedical Products), 200 mM L-
glutamine/penicillin-streptomycin (Sigma), 0.5 mg/ml cholera toxin (Sigma), and ImM
phorbol myristic acid.
Immunoblotting
Semiconfluent melanocytes were harvested from flasks, rinsed twice in PBS and
solubilized in 10 mmol/L Tris buffer (pH 8), with 1 mmol/1 phenylmethysulfonyl
fluoride, 5% 2-mercaptoethanol, .02 mM/1 of each antipain, aprotinin, chymostatin,
leupeptin, and pepstatin A, with 1% sodium dodecyl sulfate (SDS) for 5 minutes at 95-
100 C, and sheared with 21 GA needle. The lysates were separated on SDS-
polyacrylamide gel electrophoresis (SDS-PAGE) reducing gels and electroblotted onto
Immobilon-P polyvinylidene fluoride (PVDF) membrane. A Bio-Rad low range


32
significantly higher, and of TCR1+ cells being significantly lower, as compared to Light
Brown Leghorn control birds (LBL, a related line with similar plumage but no incidence
of vitiligo) (Erf et al., 1995b).
Initially, both the SL and control BL have a CD47CD8+ ratio close to 1. Prior to
and early in the amelanosis, CD4+ T cells are found histologically in a central,
perivascular region within the confines of the feather pulp. As the disease progresses, the
ratio decreases to below 0.4 (indicating mainly CD8+ cytolytic cells) but then rebounds
to about 0.8 late in the disease (indicating an increase in CD4+ cells, probably to recruit B
cells). Mainly CD8+ cells remain after the melanocytes have been destroyed (CD4+/CD8+
ratio of 0.3). The shift in the CD4/CD8 ratio from below 0.4 back to 0.8 in late disease
suggests the activation of T helper 2 (Th2) cells involved in a humoral response to
melanocyte autoantigens released during their destruction. In the later stages of
amelanosis CD4+ cells become scattered throughout the pulp and surrounded
melanocytes. CD8+ T cells are observed throughout the pulp and are most abundant near
the epithelial barb ridges and associated with melanocytes (Erf et al., 1995b). This
indicates that the CD8+ T cells have penetrated beyond the pulp to get to the melanin-
containing barb ridges.
A working hypothesis for the pathogenesis of amelanosis found in the Smyth line
chicken is that there are inherent defects in the Smyth line melanocyte that cause the cells
to self-destruct. These cells may self destruct or possess a quality that predisposes them
to abnormal antigen expression. Abnormal presentation by the melanocytes themselves
may target them for CTL-mediated destruction. This releases the internal components of


CHAPTER 2
ADOPTIVE TRANSFER OF AMELANOSIS IN THE SMYTH LINE CHICKEN
Introduction
This aim is designed to determine the role and clarify the contribution of humoral
and cellular immunity in the pathogenesis of amelanosis in the Smyth line chicken.
In order to study and characterize the immune response, it is often an advantage to
study the intact organism. To make the study manageable, experimental animals have
been manipulated by various means to help study immune functions. The laboratory
mouse for example, has been inbred so that the immune responses based on the MHC
haplotype have been characterized and documented to minimize masking of the effect
of a locus or genetic region; a large collection of MHC-specific strains is available
through Jackson Laboratories. This allows researchers to choose mouse strains to
conduct investigations and make variants such as the NOD mouse. The variants have
been developed through altering the genome either by inserting new genes to create
transgenic animals, or by targeted disruption of genes by gene knockout through means of
homologous recombination.
Adoptive transfer of cells or antibodies is a classical experimental approach to
demonstrate immune function. The transfer of serum (the fluid phase of blood containing
specific antibodies against an immunizing antigen) from an immunized individual
(donor) into a naive individual (host or recipient) can confer immunity if antibodies
49


42
newer set of T cells to what were until then nonsequestered cryptic MBP determinants
(Lehmann et al., 1993). The reverse situation may occur in which the autoimmune
response is diverse initially but honed via additional waves of recruitment, which may
cause a consolidation and selection to produce a more oligoclonal T cell repertoire. So
the conflicting reports between restricted or diverse repertoires may just represent
different stages in the development of disease.
Other chicken models of autoimmunity
There are two other chicken animal models for autoimmune diseases in humans.
The Obese Strain (OS) chicken line is characterized by iodine-induced autoimmune
thyroiditis, and is recognized as a model for the organ-specific disease Hashimotos
thyroiditis. Reducing thyroidal iodine by antithyroid drugs can prevent the thyroiditis.
However, therapy must be administered at the embryonic stage (Bagchi et al., 1995);
otherwise, the thyroiditis becomes severe by 5 weeks of age. Autoreactive B and T cells
can be seen in the thyroid by 2 weeks post hatch (Wick et al., 1970). Furthermore,
adoptive transfer of splenocytes from affected OS chickens to the Cornell strain (CS), a
related strain that develops a mild late onset disease, causes the development of
thyroiditis when the hosts were supplemented with iodine (Brown et al., 1991). It has
been recently demonstrated that the T cells expressing Vpi genes are the main T cells
infiltrating the OS strain thyroids (Cihak et al., 1995).
The University of California at Davis (UCD) lines 200 and 206 chickens develop
a hereditary scleroderma-like connective tissue disease. It develops early in life, as early
as 7 days post hatch, presenting initially as swelling, erythema, and necrosis of the comb,


Vy3-6439
Vy3-B2.6(2)
Vy3-B2.1
Vy3-B2.5
Vy3-B2.8
Vy3-B2.3
Vy3-B2.2
Vy3-B2.7
Vy3-Bl.14
Vy3-Bl.16
Vy3-Bl.13
Vy3-B2.4
Vy3-S6.2
Vy3-SI.13
Vy3-S6.3
Vy3-S2.8
Vy3-S2.10
Vy3-S6.1
Vy3-S3.3
Vy3-S3.5
Vy3-S3.6
Vy3-S6.4
Vy3-S2.12
GCATACTGGTATAAGC
T.T
T.T
T.T
T.T
G
G
G
G. .AAG
N region
CACGACGGTT
ACA ATCCGG
GGAGTGCATi
TTACC
CGA
AA CA
AAGGC
AAGGC
AA CTCA
AAGGCAT ATACGGGG
GAAGTG
GAACAAGGCTTCCCGA CCGG
AAG
AAGG
AAGGC
AA
PheGly Gly
ATATTACTACAAAGTTTTCGGCTCTGGTACAAAGCTCATTGTATCAGAC
Jy
1
3GATC
TAC....
..A.A.
.A.
.T.
....G..
. .C.
.CA.
3
GTGCA.GGAT..
. .TAC....
. .A.A.
.A.
.T.
....G..
. .C.
.CA.
3
GG
1
.G.TG.G.
.GA.A..T.
.AAG..
.A.
.T.
.A..T..
. .T.
2
TGGTCCGA
1
CG
1
CA.GGAT..
. .TAC....
..A.A.
.A.
.T.
. . G .
. .C.
.CA.
3
A CTATAGTGCA.GGAT.... TAC.
PTTAA fJ
..A.A.
.A.
.T.
.G. .
. .C.
.CA. .
3
1
TCCCCCTCTT
ATGG.G.TG.G...A.A.
.T.
.AAG..
.A.
.T.
.A.
.T. .
. .T.
2
CA
.G.TG.G..GA.A.
.T.
.AAG..
.A.
.T.
.A.
.T. .
. .T.
2
GCCC
G. .
1
TCCCTTGGAA
GCA.GGAT.... TAC.
. .A.A.
.A.
.T.
.G. .
. .C.
.CA. .
3
GAAC
CA.GGAT....TAC.
. .A.A.
.A.
.T.
.G. .
. .C.
.CA. .
3
GCAAGCCTATATC
. .A.A.
.A.
.T.
.G. .
. .C.
.CA. .
3
GCAAGCCCGA
1
GCAA
GAG...A.A.
.T.
.AAG..
.A.
.T.
.A.
.T. .
. .T.
2
CCTTAAGCGA
.G.TG.G..GA.A.
.T.
.AAG..
.A.
.T.
.A.
.T. .
. .T.
2
oo
Figure 3-3. Partial nucleotide sequences of rearranged TCR-Vy3 genes from Brown line and Smyth line chickens, showing the FR3, N region and Jy
sequences. Clone designations include an animal number (shown in Table 3-1 for SL) and an individual clone number. Sequences recovered more than
once are indicated by the number of repeats in parentheses after the clone number. Sequences are aligned with reference Vy genes (Six et al. 1996).
Evolutionarily conserved amino acids in Vy and Jy are indicated above the nucleotide sequence. Dots symbolize identity to the reference sequence.
Nongermline encoded nucleotides are labeled as the N region. Possible P nucleotides are underlined.


23.5-
11.2-
8.1-
7.2-
5.8-
4.9-
4.4-
3.4-
1.3-
Brown Line
t i
m m - m
^PP^PIPP^JPImm
ft*
M
li
m
*
t§
4* i|
l**
B 1
ft
(T> CD rOlOtN^inSOlONS
O T- T- Ot-t-OOOOOi-t-t-
OO OOOOOOOOOOOO
Amelanosis 5554455555444541 1 1 1 55555 544311111 11
stage:
-ev-SL2
-ev-SL4
-ev-SU
-ev-SL2
FIG. 4- 2. Southern blot analysis of ev loci detected as £coRI restriction fragments. EcoRl restriction digests of Brown line and
Smyth line genomic DNA samples were hybridized as described in Figure 4-1. Southern blots shown are representative of
three experiments.


LIST OF REFERENCES
Abbas, A.K., Lichtman, A.H., and Pober, J.S. 1991. Cellular and Molecular
Immunology. W.B. Saunders Company.
Abdel-Naser, M.B., Ludwig, W.D., Gollnick, H., and Orfanos, C.E. 1992. Nonsegmental
vitiligo: decrease of the CD45RA+ T-cell subset and evidence for peripheral T-
cell activation. Int. J. Dermatol. 31(5): 321-6.
Achea-Orbea, H., Mitchell, D.J., Timmermann, L., Wraith, D.C., Tausch, G.S., Waldor,
M.K., Zamvil, S.S., McDevitt, H.O., and Steinman, L. 1988. Limited
heterogeneity of T cell receptors from lymphocytes mediating autoimmune
encephalomyelitis allows specific immune intervention. Cell 54(2): 263-73.
Ahn S.K., Choi, E.H., Lee, S.H., Won, J.H., Harm, S.K., and Park, Y.K. 1994.
Immunohistochemical studies from vitiligocomparison between active and
inactive lesions. Yonsei Med. J. 35(4): 404-10.
Aichele, P, Bachman, M.F., Hengartner, H., and Zinkemagel, R.M. 1996.
Immunopathology or organ-specific autoimmunity as a consequence of virus
infection. Immunol. Rev. 152:21-45.
AlAbadie, M.S.K., Senior, H.J., Bleehen, S.S., and Gawkrodger, D.J. 1994.
Neuropeptide and neuronal marker studies in vitiligo. Br. J. Dermatol. 131(2):
160-5.
AlAbadie, M.S.K., Warren, M.A., Bleehen, S.S., and Gawkrodger, D.J. 1995.
Morphologic observations on the dermal nerves in vitiligo: an ultrastructural
study. Int. J. Dermatol. 34(12): 837-40.
al-Badri, A.M., Foulis, A.K., Todd, P.M., Garioch, H.J., Gudgeon, J.E., Stewart, .G.,
Gracie, J.A., and Goudie, R.B. 1993. Abnormal expression of MHC class II and
ICAM-1 by melanocytes in vitiligo. J. Pathol. 169 (2): 203-6.
al-Fouzan, A., al-Arbash, M., Fouad, F., Kaaba, S.A, Mousa, M.A., and al-Harbi, S.A.
1995. Study of HLA class I/IL and T lymphocyte subsets in Kuwaiti vitiligo
patients. Eur. J. Immunogenet. 22(2): 209-13.
139


129
particles in ev-1 containing chicken embryo cells (Rovigatti and Astrin, 1983). 5-
azacytidine treatment activates silent genes and promotes cellular differentiation. 5-
azacytidine has been shown to increase the incidence of autoimmune thyroiditis in the
susceptible parental line (Cornell C strain) of the Obese strain chicken (Schauenstein et
al., 1991). Chronic low dose administration of 5-azacytidine induced amelanosis in the
genetically susceptible Brown Line chickens, but not the more distantly related LBL
chickens (Sreekumar et ah, 1996). However, the effects of 5-azacytidine treatment on ev
gene expression in BL and SL chickens have not been reported.
If experimental evidence is found to implicate a particular ev locus in the
pathogenesis of vitiligo, it could be identified in a genomic library using appropriate
probes and restriction mapping, cloned and then sequenced in order to determine
homology with that of known retroviruses. In situ hybridization of the specific ev
sequence can be used as a probe to metaphase chromosomes to localize the ev loci. Six
ev loci in chickens have be mapped to chromosome 1 alone (Tereba et ah, 1979; Tereba
and Astrin, 1980). In addition, the phenotype of the ev locus would be characterized for
the presence of the gs antigen (indirect immunoflourescence), of the chf (fusion with the
16Q cell line), detection of the virus (which subgroup) or viral proteins from the culture
supernatant, and the susceptibility to other subgroups of the ALV-RSV group
(Humphries et ah, 1984a). Endogenous retroviruses are in subgroup E and are
nononcogenic, unlike the ALVs of the exogenous viruses found in subgroups A, B, C,
and D. Expression of subgroup E viral proteins helps make the cells refractory to
infection by other viruses of the same subgroup. Cells containing ev3, ev6, and/or ev9


45
A conclusion that can be made about using the chicken to study diseases in the
human is that it will probably not be as readily appreciated as the laboratory mouse. It is
more expensive in terms of reproduction time and cost to maintain. One really needs to
be both a poultry and medical scientist. The typical medical scientist is not aware of the
extensive network, knowledge, and experience that is necessary to study live chickens.
On the other hand, the chicken is the best studied vertebrate for embryogenesis
and development. The egg provides a most convenient source of embryos; the shell can
simply be opened to expose the living animal. It was through studying the chicken, that
the concept separating the B cells as bursa-derived (bone-marrow-derived for mammals)
from the T cells, as thymus derived, was clarified. Several monoclonal antibodies
including those that distinguish several subsets of T cells and B cells are available and
marketed for cell separations and immunohistochemistry. At this moment, the Smyth
line chicken does represent the closest model providing the best opportunity to unveil
some of the unknown pathology of human vitiligo.
Rationale for this study
Vitiligo is considered an autoimmune disease. Vitiligo is not considered life
threatening such as the physiological destruction of the insulin-producing cells in
diabetes; nevertheless, for the 1-2% of the population with vitiligo there is a significant
increased risk of skin cancer. The patients well being and self esteem are compromised
and these may cause distress because there is little the patient can do to hide the
condition. The current means to treat vitiligo is to have the patient undergo PUVA


101
vy
N region Jy
VYl-186
CAYWES
R
SGYYYKVF
VY1-B2.17
AST
WI.Y.
W1-B2.24
w
YSAWI .Y.
VY1-B2.20
PD
GDE.I.
VY1-B2.15
YGDE.I.
I SVG
VY1-B2.18
s
VY1-B2.2
LR
VY1-B2.22
LRPGS
VY1-S2.1
...R..
VYG
E.I.
VY1-S2.3
WWRGI
WI.Y.
W1-S2.5
IN
W1-S2.2
w
VYl-Sl.l
GGT
Vyl-Sl.4
DR
Vyl-Sl.6
RAR
VY1-S6.3
DR
Vyl-Sl.7
VN
GDE.I.
Vyl-Sl.2
V
Vy1-S2.11
SLG
Vy3
Vy N region Jy
Vy3-6439 CAYWYK PRRL YYYKVF
VY3-B2.6 KQ SG
Vy3-B2.1 RSAWI Y.
VY3-B2.5 NYR AWI.Y.
VY3-B2.8 .... R G
Vy3-B2.3 Q H DE.I.
VY3-B2.2 YQG WSE
VY3-B2.7 YQG R
VY3-B1.14 YQ LT WI.Y.
VY3-B1.16 YQG IYGD
VY3-B1.13 EV
VY3-B2.4 EQGFPT G
VY3-SG.2 Q D YSAWI.Y.
Vy3 -SI. 13 QG LR
VY3-S6.3 QG SPSY GDE.I.
VY3-S2.8 Q H DE.I.
VY3-S2.10 AR
VY3-SG.1 NPLE AWI.Y.
VY3-S3.3 EP WI.Y.
Vy3 S3.5 RQ AYI
Vy3 -S3.6 RQ AR
VY3-S6.4 RQ E.I.
VY3-S2.12 RQ ALSD DE.I.
Vy2
vy
N
region
Jy
Vy2-5 0 2 9
CAYWDP
SPR
YYYKVF
VY2-B2.8
SR
G
VY2-B2.12
SSFPKGT
VY2-B2.S
SA
VY2-B1.2
SA
VY2-B1.7
SS
DE.I.
VY2-B1.6
VLFD
Vy2-B1.5
AQK
Vy2-B2.13
R
VY2-B1.4
R
SAWI .Y.
VY2-B1.21
ISI
AWI.Y.
VY2-B1.9
Y
AWI.Y.
VY2-B1.18
SAWI .Y.
VY2-S1.1
SA
Vy2-S6.1
T
Vy2-S2.13
SA
VY2-S1.3
HG
SG
VY2-S1.4
R
Vy2-S2.1
IRN
Vy2-S2.9
SWVG
SG
VY2-S1.8
Y
AWI .Y.
Vy2-S2.10
MS
AWI.Y.
Vy2-S6.4
ITPRV
.Y.
Vy2-S1.9
SRWL
YSAWI .Y.
VY2-S1.2
L
G
VY2-S1.6
s
WI .Y.
Vy2-S1.14
R
YSAWI .Y.
Vy2-SS.7
IGGGS
DV.K.
Figure 3-4. Predicted amino acid sequences in one letter code of rearranged TCR-y genes from Brown line and Smyth
line chickens, from the conserved Cys94 and Phel08 residues in Vy and Jy, respectively. Dots indicate identity to the
top line of sequence.


Table 2-4. Adoptive transfer of amelanosis with multiple transfers of SL splenic lymphocytes.
Test
Group
Hosts
Donors
#Amelantic/
#Survived
No.
Sex
Age
Sex
Age
Amelanosis
Stage
# Cells/
Host
4A
2
F,M
6 w
M
16 w
3
lxlO9
4B
1
M
6 w
F
10 w
4
2xl08
4C
2
F,M
6 w
M,F
10 w
4
2xl08
7 w
F,F
11 w
4
3xl08
0/5
8 w
M,F
12 w
5,4
2.7xl08
9 w
M,F,F
11 w
4,3,4
not counted
10 w
M,M,F
11 w
4,4,3
1.5X109
5A
7
F
6 w
M
17 w
4
5.6x108
7 w
M,F
17 w
3,4
7xl09
0/7
5B
3
F
6 w
M
16 w
BL
5.5xl09
7 w
F,M,F
8 w
BL
9xl08
0/3


64
severe phenotypes. Only 14% of the males (4 of 28) showed any depigmentation by the
9th week and all at the lowest level (Table 2-1 and Figure 2-2). Males can become just as
severe; they usually take longer to develop. By the 17th week, 42% displayed the more
severe phenotypes, but only one showed the severest at level 5, as compared to 9 females.
The information combining the frequencies from both sexes is compiled in Figure 2-3. In
one generation, there was actually some reversion of the phenotype in three of the
females, otherwise the phenotype once the maximum was achieved remains stable. Of
these three revertants two were completely amelanotic and one was 75% amelanotic.
After their initial depigmentation had peaked, a period of repigmentation began, which
started as patches in a different pattern than they were first depigmenting. The
repigmentation was not complete.
There seems to be two waves of developing amelanosis based on observations of
several populations as shown in Table 2-1 and Figure 2-3. The early onset wave
(majority of the SL) begins at the 6th through the 9th week post hatch. They peaked at
development of amelanosis by the 12th to 14th week, achieving the severe phenotypes,
stages 4 and 5, often earlier than 12 weeks. The second wave, fully pigmented up to this
point, started developing amelanosis at 17th to 20-2Is' week and none became totally
amelanotic from the second wave. This was seen at week 17 for a male from the SL2
population and for two females from the SL12 population.
Adoptive Cell Transfer Experiments
Five cell transfer experiments were conducted. Variables considered included: (1)
host age; (2) donor age; (3) stage of amelanosis exhibited by the donor (including how


CHARACTERIZATION OF THE PATHOGENESIS OF AMELANOSIS IN THE
SMYTH LINE CHICKEN: A MODEL OF THE HUMAN AUTOIMMUNE DISEASE
VITILIGO
By
EDMUND C. LEUNG
A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY
UNIVERSITY OF FLORIDA
1998


148
Koziel, M.J., Dudley, D., Wong, J.T., Dienstag, J., Houghton, M, Ralston, R., and
Walker, B.D. 1992. Intrahepatic cytotoxic T lymphocytes specific for hepatitis C
virus in persons with chronic hepatitis. J. Immunol. 149(10): 3339-44.
La Cava, A., Nelson, J.L., Ollier, W.E., MacGregor, A., Keystone, E.C., Thome, J.C.,
Scavulli, J.F., Berry, C.C., Carson, D.A., and Albani, S. 1997. Genetic bias in
immune responses to a cassette shared by different microorganisms in patients with
rheumatoid arthritis. J. Clin. Invest. 100(3): 658-63.
Lacour, J.P., and Ortonne, J.P. 1995. Genetics of vitiligo. Ann. Dermatol. Venereal.
122: 167-171.
LaFace, D.M., and Peck, A.B. 1989. Reciprocal allogeneic bone marrow transplantation
between NOD mice and diabetes-nonsuceptible mice associated with transfer and
prevention of autoimmune diabetes. Diabetes. 38(7): 894-901.
Lahti, J.M., Chen, C.H., Tjoelker, L.W., Pickel, J.M., Schat, K.A., Calnek, B.W.,
Thompson, C.B., and Cooper, M.D. 1991. Two distinct ap T cell lineages can be
distinguished by the differential usage of T-cell receptor Vp gene segments. Proc.
Natl. Acad. Sci. USA 88(23): 10956-60.
Lamont, S.J. and Smyth J.R. Jr. 1981. Effect of bursectomy on development of a
spontaneous postnatal amelanosis. Clin. Immunol, and Immunopathol. 21: 407-11.
Lamont S.J., and Smyth J.R. 1982. Severity of feather amelanosis and visual defects was
associated with increased antibody levels. Immunological Communications 11(2):
121-7.
Lang, F.P., Schatz, D.A., Pollock, B.H., Riley, W.J., Maclaren, N.K., Dumont-Driscoll,
M., and Barrett, D.J. 1991. Increased T lymphocytes bearing y8 T cell receptor in
subjects at high risk for insulin dependent diabetes. J. Autoimmunity 4(6): 925-33.
Lehmann, P.V., Forsthuber, T., Miller, A., and Sercarz, E.E. 1992. Spreading of T-cell
autoimmunity to cryptic determinants of an autoantigen. Nature 358(6382): 155-7.
Lehmann, P.V., Sercarz, E.E., Forsthuber, T., Dayan, E.M., and Gammon, G. 1993.
Determinant spreading and the dynamics of the autoimmune T cell repertoire.
Immunology Today 14(5): 203-7.
Lehtonen, L., Vaino, O., and Toivanen, P. 1990. Difference in B cell-induced
transplantation tolerance to major histocompatibility complex antigens in irradiated
and cyclophosphamide-treated chickens. Transplantation Proceedings 22(1): 123-
4.


Asp TyrTyrCys
Vy3-6 4 3 9 AAGTTTCAAGTGCAGAGAAATCCTTCCAACTCTGTTCTGACAATAAAGAAATCAACTCGGAGGGATACCGGTACTTACTATTGT
Vy3-B2.6(2)
Vy3-B2.1
Vy3-B2.5
Vy3-B2.8
Vy3 -B2.3 T. .A
Vy3 -B2.2 T. .A
Vy3-B2.7 T. .A
Vy3 -B1.14 T...A
Vy3 -B1.16 T...A
Vy3-B1.13 T C T. .A T C...
Vy3 -B2.4 ...A T.C...C C..A T C...
Vy3-S6.2
Vy3-SI.13
Vy3-S6.3 C
Vy3-S2.8 T. . A
Vy3-S2.10 T...A C...
Vy3-S6.1 T C T. .A T C...
Vy3-S3.3 T C C. .A C. .
Vy3-S3.5 G T A....C..A T
Vy3-S3.6 G T A....C..A T
Vy3-S6.4 G T A....C..A T
Vy3 -S2.12 G G. .A T A....C..A T


149
Le Poole, I.C., van den Wijngaard, R.M., Westerhof, W., and Das, P.K. 1996. Presence
of T cells and macrophages in inflammatory vitiligo skin parallels melanocyte
disappearance. Am J. Pathol. 148(4): 1219-28.
Le Poole, I.C., van den Wijngaard, R.M., Westerhof, W., Dutriex, R.P., and Das, P.K.
1993. Presence or absence of melanocytes in vitiligo lesions: an
Immunohistochemical investigation. J. Invest. Dermatol. 100(6): 816-22.
Lemer, A.B., Shiohara, T., Boissy, R.E., Jacobson, K.A., Lamoreux, M.L., and
Moellmann, G.E. 1986. A mouse model for vitiligo. J. Invest. Dermatol. 87(3):
299-304.
Like, A.A., Weringer, E.J., Holdash, A., McFill, P., Atkinson, D., and Rossini, A.A.
1985. Adoptive transfer of autoimmune diabetes mellitus in biobreeding/Worcester
(BB/W) inbred and hybrid rats. J. Immunol. 134(3): 1583-7.
Lucas, A.M., and Stettenheim, P.R. 1972. Avian Anatomy: Integument. Part I and II.
Agriculture Handbook 362. USDA in Cooperation with Michigan Agricultural
Experiment Station, Michigan State University, East Lansing.
MacDonald, H.R., Schneider, R., Lees, R.K., Howe, R.C., Acha-Orbea, H., Festenstein,
H., Zinkemagel, R.M., and Hengartner, H. 1988. T-cell receptor Vp use predicts
reactivity and tolerance to Mlsa-encoded antigens. Nature 332: 40-5.
Maclaren, N.K., and Atkinson, M.A. 1997. Insulin-dependent diabetes mellitus: the
hypothesis of molecular mimicry between islet cell antigens and microorganisms.
Molecular Medicine Today 3(2): 76-83.
Majumder, P.P., Nordlund,J.J., and Nath, S.K. 1993. Pattern of familial aggregation of
vitiligo. Arch. Dermatol. 129(8): 994-8.
Mandry, R.C., Ortiz, L.J., Lugo-Somolinos, A., and Sanchez, J.L. 1996. Organ-specific
autoantibodies in vitiligo patients and their relatives. Int. J. Dermatol. 35(1): 18-
21.
Marrack, P., and Kappler, J. 1994.Subversion of the Immune System by Pathogens. Cell
76:323-32.
Matthews, M.B. and Shenk, T. 1991. Adenovirus-Associated RNA and Translation
Control. J. Virol. 65 (11): 5657-62.
McCormack, W.T., Hurley, E.A., and Thompson, C.B. 1993. Germ line maintenance of
the pseudogene donor pool for somatic Immunoglobulin gene conversion in
chickens. Mol. Cell Biology 13(2): 821-30.


4
product, which can interact with a high proportion of T cells expressing particular V(5
gene segments (VP8.1 subfamily; Vp6). Those T cells that recognize both Mlsa and the
appropriate H-2 allele were eliminated during T cell development in the thymus. Mis is
considered a superantigen (Kappler et al., 1988; MacDonald et al., 1988). Developing
thymocytes that bind viral or bacterial superantigens integrated into human and mouse
genomes of some strains have likewise experienced intrathymic deletion rather than
anergy or peripheral suppression to provide tolerance.
Central tolerance is incomplete because not all self-antigens will be expressed in
the thymus during T cell development. Therefore peripheral self-tolerance must be
established. In the periphery, the mature T cell is activated by recognizing the
peptide:MHC complex on a professional antigen presenting cell (APC) that must also
provide costimulation of the T cells CD28 receptor by B7 molecules on the APC. In the
absence of co-stimulation, specific antigen recognition leads to anergy or deletion of the
mature T cell. Those antigens expressed uniquely by peripheral organs will not normally
induce clonal deletion unless transported to the thymus in sufficient amounts or brought
to lymphoid tissue. This is especially the case for organ-specific intracellular self
antigens located in sequestered sites (Barker and Billingham, 1972) or self-antigens
expressed below a minimal concentration level (Schild et al., 1990; Ferber et al., 1994).
These are immunologically ignored because of the absence of co-stimulator activity on
tissue cells. The autoreactive T cells specific for these self-antigens are usually not
eliminated nor anergized unless the self-antigens become presented by professional APCs
in lymphoid tissue that would break the ignorance (Aichele et al., 1996).


I certify that I have read this study and that in my opinion it conforms to
acceptable standards of scholarly presentation and is fully adequate, in scope and quality,
as a dissertation for the degree of Doctor of Philosophy.
Wayne T. McCormack, Ph.D., Chairman
Associate Professor of Pathology,
Immunology and Laboratory Medicine
I certify that I have read this study and that in my opinion it conforms to
acceptable standards of scholarly presentation and is fully adequate, in scope and quality,
as a dissertation for the degree of Doctor of Philosophy.
Mark A. AtkinsonTPh.D.
Associate Professor of Pathology,
Immunology and Laboratory Medicine
I certify that I have read this study and that in my opinion it conforms to
acceptable standards of scholarly presentation and is fully adequate, in scope and quality,
as a dissertation for the degree of Doctor of Philosophy.
Maureen M. Gt/oclenow, Pfi.D.
Associate Professor of Pathology,
Immunology and Laboratory Medicine
I certify that I have read this study and that in my opinion it conforms to
acceptable standards of scholarly presentation and is fully adequate, in scope and quality,
as a dissertation for the degree of Doctor of Philosophy
Associate Professor of Pharmacology
and Therapeutics


110
Retroviral integrations may cause immune dysregulation of host cellular gene
expression. As transient transposable elements, they can activate or inactivate the host
gene by causing gene rearrangements. Retroviruses can undergo gene duplication (of the
viral and flanking cellular sequences), capture host genes and move host genetic
information by means of intracellular replication and integration as a provirus (Hughes et
al., 1981; Tereba, 1981; Rovigatti and Astrin, 1983). The integration of avian leukosis
virus into the hosts proto-oncogene, c-myc, is an example of insertional activation, in
this case as a promoter insertion. This brings two coding exons of c-myc under the
transcriptional control of the 3 LTR and causes higher levels of c-myc expression, and
the dysregulation of c-myc often leads to B cell lymphomas (Coffin, 1991). Other
insertional mutations include: (1) enhancer insertions in which the provirus is inserted
upstream of the natural or cryptic promoter; (2) leader insertions, which allow
readthrough of several transcripts initiated from the provirus 5LTR; (3) terminator
insertions, which install a poly-A signal truncating the transcript, and causing a build up
of transcript concentration instead of allowing normal turnover; and (4) insertional
inactivation, if the insertion is in the coding region and disrupts function of the gene. As
a result of these insertions, the retrovirus genomes often undergo high rates of
intragenomic rearrangements such as deletions, point mutations, duplications, and
inversions near the 5 LTR in order to relieve a block to transcriptional expression from
the 3 LTR Retroviral proviruses can also act as transactivators to the host genome.
Endogenous viruses are ubiquitous in vertebrate species, including humans, and
have been extensively studied in White Leghorn lines of the domestic chicken, Gallus
gallus, where at least 23 endogenous viral (ev) loci have been characterized by Southern


90
Erf et al. (1995b): (1) normal, no apparent amelanosis; (2) mixed amelanosis, with both
normal and <20% amelanotic feather tissue; (3) mixed amelanosis, with normal and 20-
60% amelanotic feather tissue; (4) mixed amelanosis, with normal and >60% amelanotic
feather tissue; and (5) complete amelanosis, all developing feathering tissue is
amelanotic.
RT-PCR and cloning
Peripheral blood lymphocytes were isolated from heparinized blood samples
collected from the brachial vein by Ficoll-Hypaque density centrifugation. Total RNA
was prepared using RNeasy columns (Qiagen Corp.), and eluted in RNase-free distilled
water. Total cDNA was synthesized using random primers and Superscript-II reverse
transcriptase according to the supplier (Gibco-BRL).
Rearranged chicken Vy genes were amplified by reverse transcriptase polymerase
chain reaction (RT-PCR) as previously described (Six et al., 1996) using the following
Vy family-specific forward primers and a Cy reverse primer:
Vyl 5-GCTCTAGACTGAAGCCTGGTTGCATCC-3'
Vy2 5'-GCTCTAGACCCATACAGAGCCCTGTATCC-3'
Vy3 5'-GCTCTAGAGCAGACAACATGCTGCTG-3'
Cy 5'-CCTGGATCCTTTCATAATTCTCTGGTGCTG-3\
PCR reactions were performed in 50 pi with 2.5 units Taq polymerase and buffer
provided with the enzyme (Boehringer Mannheim Biochemicals), cDNA template, 0.2
mM dNTPs, and 20 pmoles of each primer, for 28 cycles of 60 sec at 94C, 75 sec at
55C, and 90 sec at 72C. RT-PCR products were cloned into the vector pBluescript-II


104
CDR3 peaks (Dietrich et al., 1994). This experimental approach might also indicate
whether there is clonality within the complex polyclonal repertoire. Single strand
conformational polymorphism (SSCP) analysis of amplified PCR products on a
nondenaturing polyacrylamide gel would also afford extra characterization of the
predominance of certain clones. Diffuse bands and smearing would be indicative of
polyclonality; monoclonality or oligoclonality would be confirmed by one or several
prominent bands correlating to bulk sequencing.
The developing feather is the tissue of choice to examine the amelanotic process
at the site of T cell infiltration. We anticipate that expression of a more restricted T cell
repertoire might be found in the regenerating feather, compared with the repertoire found
in the T cells of the peripheral blood lymphocytes of the SL chicken. This has been
reported for the T cell usage in other autoimmune diseases as well as transplant rejection
and tumor infiltrations. For example, an oligoclonal TCR repertoire consisting primarily
of Vp8.2 and Va2 or Va4 has been reported for the mouse (Acha et al., 1988; Urban et
al., 1988) and rats (Bums et ah, 1989) models of EAE. Comparison of the TCR
transcripts of T cells found in patient bronchiolar lavage to the same patients PBL
revealed oligoclonal preferences for V81, Va and Vp gene families which persisted over
time and from multiple tissues (Yurovsky and White, 1995).
In conclusion, the expanded y5 T cell population of SL chickens appears to
represent a polyclonal expansion, with no apparent restriction in junctional diversity or
significant changes in CDR3 length or amino acid content, or shifts in Jy gene utilization.
These results suggest that the changes observed in PBL y5 T cells in SL chickens are a


70
Only three BL7 hosts showed any manifestations of amelanosis above, BL7-222,
(male), showed amelanosis of stage 2. Out of 4 host BL chickens, reconstituted with SL
donor cells, only one (25%) demonstrated amelanosis. None of the control hosts
reconstituted with BL donor cells developed any signs of amelanosis.
In the third adoptive cell transfer experiment, older 6 week-old non-irradiated,
normal hosts were given one injection of SL donor splenocytes, as shown in Table 2-2
(Groups 3A-3C). Donor cells came from two different age groups. The change to 6
week-old chickens and no irradiation provided the opportunity of the donated SL splenic
lymphocytes to be present during the time period in which amelanosis usually starts in
the early onset SL chickens. None of the 10 host BL chickens developed any signs of
amelanosis by the age of 20 weeks.
In the fourth cell transfer experiment, a serial adoptive cell transfer protocol was
adopted. Each set of BL hosts, which were not irradiated, received several cell injections
from a series of amelanotic SL donors over a course of several weeks. The transfers
began at 6 weeks of age (just before the time when amelanosis begins to appear in the
SL) and continued through the time period (8-16 weeks) during which amelanosis usually
develops in the SL (Table 2-4, Group 4). It was hoped that weekly repeated injections of
splenic cells from SL donors into the same set of BL hosts would mimic the constant
presence of melanocyte-sensitized T cells in the SL chicken.
In experiment 4, 5 female BL7 hosts initially received SL donor cells representing
three different experimental test groups, Groups 4A-4C. However, it was necessary to
simplify the source of donor cells in the subsequent transfer of SL lymphocytes to one


A
100
/ 80 -
o
0 12 3 4
Number of ev-SL present
B
00
80 -
0 2 23 124 234 1234
ev-SL combinations present
BL
SL
to
U)
FIG. 4-4. SL chickens have more ev-SL loci than BL chickens. (A) The numbers of ev-SL loci detected in individual
BL and SL chickens are plotted against the percent of birds with each number of loci. (B) The ev-SL genotypes
present are plotted against the percent of birds with each genotype. Filled bars, BL; open bars, SL.


In loving rememberance of my grandmother Gertrude Chur Ho
m


6
mediated apoptotic deletion of the anergized B cell when they present autoantigen.
However, in mice in which the B cells carry the Fas mutation Ipr, the B cells are not
eliminated, nor can T cells deficient in the Fas-ligand, gld, trigger the apoptosis of the B
cells. These mice have autoimmune accumulations of lymphoid cells (Cornall et al.,
1995).
B cell tolerance can be induced depending on antigen dose. High doses of antigen
may overwhelm the surface immunoglobulins of B cells and induce specific
unresponsiveness. This helps maintain tolerance to abundant self-proteins like plasma
proteins. Very low doses of antigen in which the density of peptide:MHC complex on
APCs may be too low to be recognized (that is, below the recognition threshold) by the T
cells that do encounter them. Depending on the MHC genotype of an individual, some
rare proteins contain peptides that may be presented at levels that are sufficient for T cell
recognition but will not induce activation or tolerance. Such T cells are immunologically
ignorant. They would then not be able to stimulate a B cell. T cell tolerance can be
demonstrated in bone marrow chimeric animals during fetal development studies (Abbas
et al., 1991). If allogeneic bone marrow is donated before the host achieves immune
competence, then the developing T cell precursors would undergo central tolerance to
antigens of both host and donor origin, thus tolerating self-peptides presented by both
MHC genotypes.
In summary, central tolerance is established by clonal selection, strength and
quality of antigen receptor signaling of the B cells, avidity of immature T cell receptors
for the MHC-peptide complex, and apoptosis of deleted cells. Peripheral tolerance
depends upon the need for co-stimulation by appropriate APC.


34
by denaturation or proteolysis. During the different phases of their maturation as an
adult cell, the B cell provides both cognitive and effector functions for the humoral
immune response. With their membrane Ig receptors, B cells recognize and respond to
specific antigens. Through their MHC class II they present processed Ag to T cells.
Following antigenic stimulation they become effector cells by releasing serum Ig as
plasma cells.
All progenitor B cells develop from pleuripotent stem cells that migrate from the
embryonic thoracic aorta to the yolk sac, where the Ig heavy chain undergoes D-J
rearrangement, and then colonize the spleen, yolk sac, and bone marrow. In these organs
the cells rearrange the VH and then the VL genes, resulting in surface IgM expression.
Between embryonic days 8 and 14 about 20,000 to 30,000 of these B cells start to
accumulate in the bursa (Reynaud et al., 1987).
Mammalian B cells rely on large numbers of germline Ig gene segments and the
combinatorial diversity of Ig gene rearrangement to generate a diverse Ab repertoire,
which occurs continuously throughout life, in the bone marrow. In contrast, chicken Ig
genes undergo rearrangement of single functional VH and VL gene segments within a short
time period during embryogenesis. Then diversity is generated in the rearranged variable
regions by somatic gene conversion using a pool of pseudogenes as sequence donors
(Reynaud et al., 1987; McCormack et al., 1993).
Gene conversion provides a progressive substitution of the sequence within the
functional VL or VH gene with sequence blocks donated or copied from the nonfunctional
pseudogenes. Progressive overlapping replacement events efficiently corrects out of
frame joints and expands the diversity (McCormack et al., 1993). After 6 months the


3
the very antigen that the immune response is against makes it nearly impossible for the
vicious cycle to end. The immune response intended to protect the body from foreign
intruders has in the case of an autoimmune disease launched a chronic inflammatory
injury against its own tissues and may in some cases prove to be lethal.
Tolerance Mechanisms
Autoimmunity occurs as a result of a breakdown of tolerance mechanisms.
Tolerance is achieved when T cells recognize antigen in the absence of co-stimulation but
remain inactivated having received only one of the two required activation signals.
Tolerance is established in peripheral tissues and maintained mainly by developing
central tolerance of the developing thymocytes to self-antigens prior to exposure to the
outside environment, and then by peripheral tolerance mechanisms. Bone marrow-
derived precursor T cells undergo the process of thymocyte education by first positive
selection for cells that respond to self MHC expressed on cortical epithelial cells found in
the thymus. Only those that bind the self MHC molecules with some affinity but not
excessively continue to the thymic medulla for negative selection. Those that do not bind
or bind to self MHC too well are deleted. In negative selection, the thymic medulla
presents self-antigen on self MHC molecules as expressed on bone-marrow derived
dendritic cells and macrophages. Only those thymocytes that bind with some affinity but
not too excessively are allowed to leave the thymus as competent mature T cells; the rest
are deleted by inducing apoptosis. So potentially self-reactive T cell clones are deleted
before joining the peripheral T cell repertoire. This establishes central tolerance. This has
been demonstrated in mice expressing the Misa (minor lymphocyte stimulating) gene


ACKNOWLEDGMENTS
There are many people I want to acknowledge in making this project possible.
First of all, I am appreciative of my mentor Dr. Wayne McCormack for the opportunity to
join his lab and for the distinction of being his first graduate student. I thank him for
passing on his knowledge and experience.
I thank my committee members Drs. Mark Atkinson, Maureen Goodenow, Ward
Wakeland, and Thomas Rowe for all their suggestions, support, and encouragement. I
thank Dr. Goodenow for her gift of the LTR probe in my endogenous virus study.
For all the work on the live chickens, I want to thank Drs. J. Robert Smyth, Jr.,
and Gisela Erf for assistance in establishing colonies of Smyth and Brown line chickens.
Without their insight I would not have been able to develop this project. Drs. Jack
Gaskins, Gary Butcher, Victor Apanius, Ben Mather, and Richard Miles were all
instrumental in my trials and errors in learning how to perform phlebotomies on chickens
and to perform injections. I am thankful for the many, many hours provided by almost a
dozen University of Florida undergraduate students who were willing to come faithfully
to our poultry facilities even in rainy weather. They learned how to tame these chickens
enough to move them one at a time from a pen. Without them I could not have performed
the cell and serum injections, the serum collection, and plucked feathers every two weeks.
IV


TABLE OF CONTENTS
page
ACKNOWLEDGMENTS iv
LIST OF TABLES ix
LIST OF FIGURES x
ABSTRACT xii
CHAPTERS
1. INTRODUCTION 1
Autoimmunity 1
Tolerance Mechanisms 3
Loss of Immunological Tolerance 7
Mechanisms of Autoimmunity 7
Regulation of Autoimmune Responses 13
Autoimmune Diseases Cause by Antibodies 14
Autoimmune Diseases Caused by T cells 16
Vitiligo in Humans 16
Melanocyte Biology 17
Vitiligo Pathology 18
The Association of Vitiligo with Other Autoimmune Diseases and the
Genetics of Vitiligo Susceptibility in Humans 20
The C57BL/6J-vi7/vjY Mouse Model for Vitiligo 21
The Smyth Line (SL) Chicken Animal Model for Vitiligo 22
Melanocyte Biology 26
Amelanosis Pathology in the Smyth Chicken 30
Genetics of Vitiligo Susceptibility in SL Chickens 33
Chicken Immunology 33
Chicken Immunoglobulin Genes and B Cell Development 33
Chicken T Cell Receptor Genes and T Cell Development 35
T Cell Repertoire Analysis 40
Other Chicken Models of Autoimmunity 42
Limitations in the Use of the Chicken Animal Model 43
Rationale for This Study 45
vi


59
molecular weight marker lane was used (Bio-Rad Laboratories, California). The blotted
proteins were blocked in 5% Carnation non-fat dry milk with 20 mM Tris pH 7.5, 137
mM NaCl, and 0.1% Tween 20 (TBS-T). The blots were cut in individual strips and each
strip was individually incubated with different sources, primary antibody (either direct
serum cleared as described above or the gamma globulin fraction) for 2 hours at room
temperature in TBS-T with 5% milk, washed 5 times for 2 minutes, and 2 times for 5
minutes and then incubated in goat anti-chicken horse radish peroxidase-conjugated
secondary antibody (Southern Biotechnologies, 1:1500) for 2 hours. The proteins were
detected by ECL chemiluminescence (Amersham). The blots were analyzed by
densitometry and Hoefer Image Master software.
Histology
Regenerating feathers of SL and control BL birds were generated by gentle
plucking of growing feathers and collecting of the young feathers bimonthly. The
feathers were brought to the University of Florida Diagnostic Research Laboratory for
cryosectioning. Mouse monoclonal antibodies to chicken TCR1, TCR2, TCR3, CD4,
CD8, CT3 were a gift of Dr. Chen-lo Chen and described by Cooper et. al., 1991).
Methyl green was used as the counterstain.
Results
Observations of the UF Colony of Smyth Line Chickens
Observations have been compiled from raising twelve populations of the Smyth line
chicken. In the colony raised at the University of Florida, the amelanosis incidence has
been approximately 60%. Observations compiled from four of the populations of Smyth


I certify that I have read this study and that in my opinion it conforms to
acceptable standards of scholarly presentation and is fully adequate, in scope and quality,
as a dissertation for the degree of Doctor of Philosophy.
Edward K. Wakeland, Ph.D.
Professor of Pathology, Immunology and
Laboratory Medicine
This dissertation was submitted to the Graduate Faculty of the College of
Medicine and to the Graduate School and was accepted as partial fulfillment of the
requirements for the degree of Doctor of Philosophy.
May, 1998
$M¡. A X£
Dean, College of Medicine '
Dean, Graduate School


130
have a reduced susceptibility to infection to exogenous subgroup E virus (Rovigatti and
Astrin, 1983; Robinson et al., 1981).
The heterogeneity of the endogenous viral loci detected in this study for the SL
and BL chickens is interesting considering the fact that the SL was derived from the BL.
This may be due to the outcrossings used to establish the SL (Smyth et al., 1981) i.e., the
outcrossing to Barred Plymouth Rock, Light Brown Leghorns, and a random-breeding
meat stock may have introduced additional ev loci.
An alternative approach to genetic mapping of vitiligo susceptibility is genome
wide genetic linkage analysis. Sets of primer pairs for microsatellite genetic markers are
now available from the U.S. Poultry Gene Mapping Project. Mapping backcross progeny
with these markers will assist in the identification of candidate regions associated with
vitiligo. Candidate genes may ultimately be identified within these genomic intervals,
which can then be analyzed for gene expression, identity of the protein, mutational
analysis and functional assays to determine the cause of amelanosis.
One approach to examine gene expression would make use of 5-azacytidine
treated BL chickens. Northern blot analysis could be used to compare gene expression in
SL, BL, 5-azacytidine-treated BL, and LBL chickens. One might predict differences in
expression of candidate genes when comparing the 5-azacytidine-treated BL and SL to
untreated BL and LBL chickens.
Interestingly, of the approximately 100 BL chickens we have raised, we have
recently identified one BL chicken expressing amelanosis (stage 4). The ev genotype of
this amelanotic BL chicken resembled a SL genotype, i.e. all four ev-SL loci were present
and several ev loci characteristic of BL chickens were absent (data not shown),


84
problem of maintaining high enough concentrations of effector cells or antibodies over
long enough periods of time, a problem encountered by others in serum transfer
experiments (Inoue et al., 1993).
In summary, the experiments involving the adoptive transfer of SL splenocytes
into the BL hosts suggests that amelanosis can be transferred and may be a cell-mediated
autoimmune process. The role of the associated autoimmune antibodies may not be as
clear. Whether autoantibodies can cause or trigger the destruction of the melanocytes in
BL hosts was not apparent. In diabetes, autoimmune antibodies against islet cells is a
distinguishing feature of the disease, precedes the onset of the disease, are specific to the
65kDa autoantigen GAD, and can be used as predictive markers of patients susceptible to
the disease. This likewise may be a similar situation with the autoantibodies in the SL
chicken. The role of the autoantibodies in diabetes as a primary inducer of diabetes has
not yet been proven.


Asp TyrTyrCys
Vy2 5 0 2 9 AGGATTCAAACTATTTCTACACAGAGACTTTGCACTCTTACAATAAGAAATGTAATTCCGGATGATGATGCTACTTACTACTGT
Vy2-B2.8
Vy2-B2.12
Vy2-B2.6 C
Vy2-B1.2 (3) C
Vy2-B1.7 C C
Vy2 -B1.6 AG C
Vy2 -B1.5 AG C
Vy2-B2.13 AG C
Vy2-Bl. 4 G AG C
Vy2-Bl. 21 .C G AG C
Vy2-Bl .9 . GC . TGTA. GGG. . G AG T C
Vy2 -B1.18 . GC . TGTA. GGG. . G AG T C
Vy2-Sl. 1 (3) C
Vy2-S6.1 C C
Vy2-S2.13 C C
Vy2-SI.3 C C
Vy2-SI.4 G C
Vy2 -S2.1 AG C
Vy2 -S2.9 AG C
Vy2 SI. 8 AG C
Vy2-S2.10 AG C T. . .
Vy2-S6.4 AG C T. . .
Vy2-Sl. 9 AG C T. . .
Vy2-S1.2 AG C T. . .
Vy2 SI. 6 G AG T C
Vy2 -SI. 14 G AG T C
Vy2-S6.7 .C G..G..AG T C


LIST OF TABLES
Table page
2-1. Amelanosis incidence in the UF Smyth line colony 60
2-2. Adoptive transfer of amelanosis with single transfers of SL lymphocytes 66
2-3. Progression of amelanosis in 5 BL5 hosts after adoptive transfers of SL
lymphocytes 67
2-4. Adoptive transfer of amelanosis with multiple transfers of SL lymphocytes ... 71
2-5. Bio Rad protein assay of gamma globulin pools and selected
serum samples 74
2-6. Adoptive transfer of SL gamma globulins into 6 week old BL10 hosts 75
3-1. Amelanosis stage of Smyth Line chickens at ages 2-25 weeks 91
4-1. Smyth line (SL) chicken phenotypes 115
4-2. Frequencies of ev loci detected in BL and SL chickens 118
4-3. Frequencies of ev loci detected in SL progressing (p) and nonprogressing
(np) chickens 125
IX


Feather sheath
Axial plate
Cells of proximal
barbulcs (lightly
pigmented)
Barb septum
Ramogenic column
(obscured by
melanocytes)
Basilar layer
of epidermis
Cells of distal barbulcs:
Fully pigmented
y Receiving pigment
Not yet pigmented
Process of melanocyte
Bods of melanocyte
Nucleus of epidermal cell
(outside melanocyte)
Cells of proximal
barbules (lightly
pigmented)
Melanin granules
in cytoplasm
Axial plate
Barb septum
Ramogenic column:
Medulla
Pulp epithelium
sO
A
B
Figure 1-6. (A) A single feather barb ridge. The melanocytes extend dendritic processes distally (perpendicularly)
outwards depositing melanin in the barbule cells. Note the outer zone of pigmented barbule cells and the inner not
pigmented zone. Melanocytes are continually supplied at the base of the feather follicle; they provide pigment
granules to the section of the feather as it develops and then degenerate. (B) In this single barb the melanocytes have
degraded and disappeared after they have completed their function. Adapted from Avian Anatomy-Integument.
Lucas and Stettenheim, 1972. Public domain for public use from the Agricultural Res. Service, USDA.


5
In the B lymphocyte repertoire, elimination of potentially self-reactive B cells
occurs when immature B cells bind to multivalent membrane bound self-antigens during
B cell ontogeny within the bone marrow. They are deleted by apoptosis by activation of
the Fas receptor. This is unlike mature B cells, which become activated by multivalent
polyclonal foreign antigens and CD4 T cell help. Self-reactive immature B cells may be
rescued in the bone marrow by gene rearrangement events editing and deleting the
sequence encoding for an autoreactive receptor to that of a different specificity that is
tolerant (Comall et al., 1995). B cells in the preimmune repertoire may be excluded in
the competition for follicular niches in lymphoid organs if the self-reactive B cell binds
soluble or low avidity autoantigens. They are not selected to proliferate and die out in the
T cell zone. Such excluded B cells can be rescued if they enlist T cell help.
There are mechanisms that help mature B cells become tolerant to self-antigens in
the periphery. B cells that recognize a self-antigen as they would a foreign antigen would
enter the T cell zone of lymphoid tissue. However, there would not be appropriate
antigen-specific armed CD4+ T cells to activate the B cells. Such T cells would not have
been presented the appropriate antigen from an APC and would be absent from lymphoid
tissues; thus, they would not be available to provide secondary stimulation to the B cell.
Those B cells with self-antigen would end up undergoing apoptosis, although death can
be delayed by expression of bcl-2. A second mechanism is seen in naive B cells just
entering the periphery. Chronic exposure to the specific soluble autoantigen, such as
soluble lysozyme, will cause them to downregulate surface IgM expression and the
signaling pathways of activation in order to survive. These become anergic because they
fail to generate CD28-dependent T-cell help. Normally, T cells would induce Fas-


30
Amelanosis Pathology in the Smyth Chicken
As in human vitiligo patients, the Smyth line chicken melanocyte is the target of
autoimmune destruction, but instead of the skin and hair follicles, the feathers, the
choroid, and retinal pigmented epithelium are affected. Both autoantibodies and cell-
mediated immunity may be involved in the pathogenesis of vitiligo in the Smyth line
animal model. Melanocyte-specific autoAb have been detected 1-4 weeks prior to
depigmentation in SL chickens, as observed in humans, and the autoAb have been shown
to recognize at least three melanocyte proteins between 65 and 80 KDa, which are
localized to the melanocyte cytoplasm and plasma membrane (Austin et al., 1992).
Because the enzyme tyrosinase is involved in the biosynthesis of melanin, and because
enzymes are known to be autoantigens in other autoimmune conditions, tyrosinase has
been suggested as a possible autoantigen for vitiligo. It was recently shown that Trp-1,
the most immunogenic of the tyrosinase-related proteins, is a major autoantigen
recognized by serum autoAb in SL chickens (Austin et al., 1995).
The Smyth Line chicken demonstrates a functional immune system capable of
providing an autoimmune response in the initiation and progression of melanocyte
destruction. If the immune system is experimentally voided or suppressed then it might
be expected that the amelanotic condition may be eliminated or reduced. When the B
lymphocytes are essentially eliminated by neonatal bursectomy the effect is a decrease in
the incidence and severity of amelanosis (Lamont and Smyth, 1981). Cyclosporin A
treatment and corticosteroid-induced immunosuppression result in a decreased incidence


143
Chen, C.H., Sowder, J.T., Lahti, J.M., Cihak, J., Losch, U., and Cooper, M.D. 1989.
TCR3: A third T cell receptor in the chicken. Proc. Natl. Acad. Sci. USA 86(7):
2351-55.
Chomczynski, P. 1987. Single-step method of RNA isolation by acid guanidinium
thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162(1): 56-9.
Church, G.M., and Gilbert, W. 1984. Genomic sequencing. Proc. Natl. Acad. Sci. USA
81(7): 1991-5.
Cihak, J., Hoffmann-Fezer, G., Roller, A., Kaspers, B., Merkle, H., Hala, K., Wick, G.,
and Losch, U. 1995. Preferential TCR V beta 1 gene usage by autoreactive T
cells in spontaneous autoimmune thyroiditis of the obese strain of chickens. J
Autoimmun. 8(4): 507-20.
Coffin, J.M. Retroviridae and their replication. 1991. Fundamental Virology. 2nd ed.,
Chapter 27. William E. Paul (Ed.) Raven Press, New York.
Conrad, B., Weissmahr, R.N., Boni, J., Arcari, R., Schupbach, J., and Mach, B. A human
endogenous retroviral superantigen as candidate autoimmune gene in type I
diabetes. 1997. Cell. 90(2): 303-13.
Cooper, MD, Chen, C.H., Buey, R.P., and Thompson, C.B. 1991. Avian T cell
ontogeny. Adv. Immunol. 50:87-117.
Cornall, R.J., Goodnow, C.C., and Cyster, J.G. 1995. The regulation of self-reactive B
cells. Curr. Opin. Immunol. 7(6): 804-11.
Dayan, C.M., Londei, M., Corcoran, A.E., Grubecker-Loebenstein, B., James, R.F.L.,
Rapoport, B., and Feldmann, M. 1991. Autoantigen recognition by thyroid
infiltrating T cells in Graves disease. Proc. Natl. Acad. Sci. USA 88(16): 7415-
9.
De Berardinis, P., Londei, M., James, R.F.L., Lake, S.P., Wise, P.H., and Feldmann, M.
1988. Do CD4-positive cytotoxic T cells damage islet beta cells in type 1
diabetes? Lancet 2: 823-4.
De Nagel, D.C., and Pierce, S.K. 1992. A case for chaperones in antigen processing.
Immunol. Today 13(3): 86-9.
Dietrich, P.V., Caignard, A., Diu, A., Genevee, C., Pico, J.L., Henry-Amar, M., Bosq, J.,
Angevin, E., Triebel, F., and Hercend, T. 1992. Analysis of T-cell receptor
variability in transplanted patients with acute graft-versus-host disease. Blood
80(9): 2419-24.


Number
Smyth line (females + males)
Amelanosis stage 1B2D3D4D5
Figure 2-3. Frequencies of Smyth line females and
males


BIOGRAPHICAL SKETCH
Edmund Chuan-son Leung was born in East Orange, New Jersey, the oldest child
of George and Ying Leung, a mechanical engineer and a private duty nurse, respectively.
Ed attended Hofstra University, Hempstead, New York, and graduated in 1982 with a
B.A. in biology, with a minor in biochemistry. He was employed at the Uniformed
Services University of the Health Professions, in Bethesda, Maryland, and at Georgetown
University, Washington, District of Columbia, and was encouraged to apply to graduate
school. He entered graduate school at the University of Florida, Department of Pathology
and Laboratory Medicine, in August 1991. After completion of his degree, he will
continue his academic career at the University of Florida in the laboratory of Dr. Jin
Xiong She.
159


135
A TCR repertoire analysis of the regenerating feather may characterize the
expansion that appears to be indicated in the intense lymphocytic infiltration of the pulp
as reported in the work of Erf et al. (1995a, 1995b). Counts of cells in cryosections
stained with mouse anti-TCR antibodies have indicated high presence for both CD4+ and
CD8+ T cells expressing predominantly aP TCR bearing Vpi (i.e. TCR2+). So the
repertoire analysis should still be initially examining Vpi. If an oligoclonal expansion of
certain recurring subset(s) of T cells is detected from the feather analysis, then it might be
possible to isolate a subset of T cells from regenerating feathers, which could be cultured,
stimulated with Con-A, and then transferred into 5-6 week BL hosts. This population
might be more reflective of the autoantigen-activated cells than splenic cells.
More importantly, this would lead to possible immunotherapy. Monoclonal
antibodies directed against the specific Vp chain (for example) might be used to
inactivate that autoreactive subset of T cells while leaving the rest of the T cell repertoire
intact. This Vp selective therapy has been performed experimentally in the treatment of
chronic relapsing EAE in SJL/J mice by Whitham and colleagues (1996). This would
bridge the work between the TCR repertoire analysis and the adoptive transfer studies.
By detecting endogenous virus integrations as inheritable stable elements in the
genomes of the Smyth line chicken, four novel loci (ev-SL) have been identified that may
be used as genetic markers for vitiligo susceptibility in this chicken. Although these loci
were not unique to only the SL birds displaying the amelanotic phenotype, it may still be
possible to find loci that are correlated with the disease. Associations of novel ev-loci
have been found in the two other major chicken models for autoimmunity, the OS


124
Other significant differences between BL and SL chickens were observed that
correlated with the relative absence of some ev loci in SL chickens. As many as seven ev
loci, which we have not assigned any designations pending further characterization, were
observed to be present in significantly higher proportions in BL than in SL chickens
(p<0.01 by Fishers exact test). The ev loci that are present in significantly higher
proportions of BL than SL chickens include the 12 and 9.5 kb BamHl fragments, and the
5.8 & 3.4 kb EcoRl fragment pair and the 23.5, 12.5, 7.2, and 4.4 kb £coRI fragments
(Table 4-2). These data suggest that ev loci may be useful as genetic markers to
distinguish between BL and SL chickens and/or other chicken lines.
Comparison of SL progressor and SL nonprogressor ev genotypes
The ev genotypes were compared for SL subpopulations defined on the basis of their
maximum stage of amelanosis, in order to determine whether there was any correlation
between the presence of specific ev loci with the vitiligo phenotype. No significant
differences in the frequency of individual ev locus presence could be associated with the
SL progressor (stages 2-5) phenotype, as compared to the SL nonprogressor (stage 1)
phenotype (Table 4-3). The number of ev-SL loci detected per bird and the ev-SL locus
combinations present were similar in SL progressors and nonprogressors. These data
suggest that, in contrast to two other chicken models of autoimmunity (Sgonc et al.,
1995; Ziemiecki et al., 1988), there is no unique ev locus associated with vitiligo in the
SL chicken.


37
Chicken y5 T cells (TCR1) appear first in thymocyte development, as TCR y8
/CD3 cells. They enter the thymus at embryonic day 6 (E6), avoid thymic education and
selection, migrate quickly through the thymus without clonal expansion, reach peak
levels by E15, and exit after day E15 (Cooper et al., 1991; Dunon and Imhof, 1996). y8 T
cells do not express CD4 or CD8 and are not self MHC-restricted, as they do not undergo
intrathymic selection (Raulet, 1989; Chen et al., 1996). In the periphery, the y8 T cells
reach 20-50% in the adult with a very high predominance in the intestinal epithelium and
either absence or minor presence in chicken Peyers patches and cecal tonsils (Buey et al.,
1988). They are resistant to death by receptor cross linking and apoptosis (George and
Cooper, 1990) and are not subject to arrest by cyclosporin A (Buey et al., 1990). Vpi+a(3
cells, in contrast, are susceptible to receptor modulation and apoptotic death (Smith et al.,
1989). TCR1 cells are relatively dispersed and rarely form lymphoid nodules or
aggregates even in the spleen or intestine. About two-thirds will express CD8 in the
spleen and intestine (Chen et al., 1988; Buey et al., 1988) but rarely in the circulation. y8
T cells lack GVH potential and their proliferative response is relatively low (Sowder et
al., 1988).
The second wave of chicken T cells enters the thymus by El2-13 and this wave
contributes predominantly to the Vpi+ aP T cell subset. These do express initially CD4
and CD8, undergo thymic maturation and clonal selection, and are found mostly in the
splenic periareriolar sheath and intestinal lamina propria with a CD4/CD8 ratio of 2/1.
The last wave of thymocytes does not enter the thymus until El8 and contributes


51
cells (bursa, spleen, or bone marrow) into 4.5 week old immunodeficient chicks. Using
donated bursal cells of 3 day old, 4.5 week old, or 10 week old donors, and pretreatment
with cyclophosphamide (Cy), even large numbers of donated bursal cells would not bring
about a long term restoration of antibody formation. Pretreatment by X-irradiation (750
rads) on the day before transplantation with 10 week old donated cells from spleen (as
well as marrow, thymus, or bursa) allowed higher survival rates and body weight gains
suggesting that restoration of T cell functions, but not B cell functions, was achieved.
Toivanen and colleagues concluded from these studies that T cell function is more crucial
to survival than is humoral immunity. A dose of 750 rads for 4.5 week old chickens was
shown to be effective in allowing reconstitution of the T cell compartment, but only short
term reconstitution of B cells.
Lehtonen and co-workers (1990) determined that Cy treatment destroys
proliferating B cells in the bursa, and allows donor B cell reconstitution in 4 day old hosts
for at least 10 weeks if 4 day old donor bursa cells were used. Irradiated with 750 rads, 4
day old hosts could again be reconstituted with T cells but not with B cells. The B cell
compartment was not restored. Based mainly on these reports, our experiments utilized
irradiation treatment for the adoptive cell transfer of lymphocytes from amelanotic SL
chickens into BL hosts, in order to determine whether the autoimmune disease could be
transferred by lymphocytes.
The transfer of autoimmune disease to host animals has been previously
demonstrated by the adoptive transfer of lymphocytes in other animal models of
autoimmunity. Experimental allergic encephalomyelitis (EAE) is a disease produced by
injecting animals with homogenized spinal cord, myelin basic protein (MBP), and it


83
displayed the amelanotic phenotype to some degree. The serial transfer experiments (3
and 4) with older (6-week-old) not-immune-compromised hosts were given up to 5
repeated transfers of donated SL cells. Still they had not displayed a hint of amelanosis
in a situation we anticipated would have an earlier onset. Future experiments should
involve both immunosuppression by irradiation and serial transfers.
Previous attempts to induce an autoimmune disease by injection of antisera in
normal chickens have been unsuccessful (Jaroszewski et al., 1978). Anti-thyroglobulin
antisera from OS chicken suffering from thyroiditis were transferred to the normal
Cornell strain but failed to induce thyroiditis, despite the fact that they share the same B
alleles at the MHC locus. Immunocompromising these Cornell recipients did not help,
even though neonatal thymectomy did potentiate the severity of thyroiditis in OS
chickens (Wick et al., 1970), as immunosuppression seemed to have done for our cell
transfer experiments.
Timing of the transfers may have an influence on the success. Wicker et al.
(1986) noticed that they were unable to transfer diabetes using splenocytes if the NOD
irradiated mice were less than or equal to 6 weeks old, but were much more effective with
transfers to hosts that were slightly older than 6 weeks of age. For the Smyth line
chicken, perhaps the transfers needed to be initiated earlier for both our cell and humoral
administrations. Perhaps in vitro stimulation of the splenocytes with lectins or
melanocyte fragments in the donor may help (Takenaka et al., 1986; McCarron and
McFarlin, 1988). Cell transfers have been successful from bone marrow and mature
splenocytes or lymph node cells. Our utilization of repeated transfers of cells or gamma
globulin, and the concentration of the immunoglobulins used should have addressed the


So I thank Sharon Richertson, Brad Copley, Jaime Sanchez, Nilesh Patel, Randy
Scarboro, and Shally Wang. May they regard the experience as useful to their careers.
I thank Bruce Glick for his suggesting that I use cyclophosphamide rather than
irradiation to immunosuppress the chickens. I wish I had followed this advice. I thank
Robert E. Boissy for his suggestions as well.
I thank Karen Achey for all her efforts in sequencing. I thank Pat Glendon for her
assistance in analyzing proteins. Rose Pratt did so much to provide cryosections of
regenerating feathers. I am grateful to Paul Kubilis for his advice on statistical analyses.
And I thank the members of the McCormack lab, Cheryl Spence, Luke Utley,
Javier Sanchez-Garcia, Alex Aller, Christy Myrick, David Gill, Kim Taylor, Neha Sahni,
and Claudia Lazo de la Vega, and many of the volunteer students already mentioned for
their friendship and technical support.
I thank my family and my friends who have made their own sacrifices to help me
see this project come to fruition. I especially also want to thank Dr. Jin Xiong She for
believing in my potential and offering a postdoctorate position to me.
v


105
consequence of the disease process rather than a causal factor, and may be a secondary
result of the inflammatory response at the sites of melanocyte destruction.


9
Autommunity may be the circumvention of self-tolerance by the induction of
responses to cryptic determinants to which the host was never made tolerant (reviewed by
Lehmann et al., 1993; Sercarz and Datta, 1994). The responses are by members of the
self-reactive repertoire that had evaded negative selection. Changes occur causing
determinant spreading and the availability of neoantigens to induce activation of
autoreactive T cells out of naive T cells. Additional self-determinants previously hidden
from recognition now prime other previously naive T cells with additional specificities.
Intracellular as well as extracellular proteins can be presented on class II and class I MHC
(Moreno et ah, 1991; Nuchern et ah, 1990), leading to a wide range of newly available
self-antigens. Intermolecular spreading (antigenic spread from one determinant/epitope to
many in the same protein) and intermolecular spreading (antigenic spread from one
protein to another) recruits more self-antigens newly available for the immune system to
respond to. Endogenously produced antigens have been presented by APCs as newly
recognized autoantigens on activated thyroid epithelia, hepatocytes and pancreatic cells
(Dayan et ah, 1991; Bamaba et ah, 1989; de Berardinis et ah, 1988).
In NOD mice, autoimmunity seems to start against glutamate decarboxylase
(GAD) and then by determinant spreading more antigens, such as insulin, have become
target antigens (Tisch and McDevitt, 1996). GAD is produced by the pancreatic islet (3
cells. Recent evidence is the finding of an 18 amino acid peptide showing a high
sequence homology between human GAD and the Coxsackie virus P2-C protein
(Kaufman et ah, 1992). This is an example of molecular mimicry as a result of a
misdirected immune attack.


102
and repertoire selection, and usually express an activated phenotype (Haas et al., 1993;
Sciammas et al., 1991). The presence of y5 T cells in the populations of lymphocytes
infiltrating tissues affected in various autoimmune diseases suggested a possible role for
this T cell subset in the pathogenesis of autoimmunity, which has been further supported
by evidence of clonal expansion of the infiltrating y8 T cells in an antigen-driven fashion
by findings of related or identical TCR junction sequences (Yurovsky et al., 1994;
Yurovsky, 1995; Wucherpfennig et al., 1992; Olive et al., 1992; Shimonkevitz et al.,
1993). However, the appearance of y5 T cells after a(3 T cells in some autoimmune
diseases, such as multiple sclerosis, suggests that they may be recruited secondarily to
contribute to the inflammatory response (Zhang et al., 1992). The peripheral blood y5 T
cell pool is also expanded in autoimmune diseases, often in a clonal fashion, such as
systemic sclerosis (Yurovsky et al., 1994; Yurovsky, 1995), inflammatory bowel disease
Bucht et al., 1995), multiple sclerosis (Stinissen et al., 1995), systemic lupus
erythematosus (Olive et al., 1994), and insulin-dependent diabetes (Lang et al., 1991). It
is unclear whether the expanded peripheral blood y5 T cells are activated in the periphery
and then migrate into the affected tissue, or represent spill-over from the inflammatory
response in the affected tissue into the periphery. Increased numbers of peripheral blood
y8 T cells might also arise from nonspecific polyclonal expansion due to the
inflammatory process.
In the avian model of vitiligo, expansion of the peripheral blood y8 T cell
population is detectable at 13-18 weeks of age, several weeks after onset of disease at 6-8
weeks, suggesting that their appearance is a secondary event. Human vitiligo patients


54
the feather barb ridges in tissue sections stained with monoclonal antibodies specific for
T cell markers (Erf et al., 1995b). Austin and colleagues reported the detection of
melanocyte-specific antigens between 65 and 80 kDa in the Smyth line chicken (Austin et
al., 1992). More recently, Austin and Boissy (1995) reported that these same
autoantibodies are recognizing the chicken homologue of mammalian tyrosinase-related
protein-1 (TRP-1).
Consideration must be given to the fact that during a long term condition as in
autoimmunity changes will occur in the autoimmune repertoire during the course of a
disease. Autoimmunity may represent not only the breakdown of self-tolerance, but the
display of new cryptic self-determinants to which the host was not originally tolerant
(Lehmann et al.; 1992 and 1993; Sercarz and Datta, 1994). The changes in the antigenic
determinants that are involved in this amelanosis may therefore be reflected in a changing
autoimmune T cell and B cell repertoire. The design of adoptive transfer experiments,
might, therefore, take into account these possible shifts in antigenicity, and utilize donor
cells from donors of different ages.
The parental Massachusetts Brown Line chickens (BL) from which the Smyth line
was derived also exhibit the amelanosis of the feather and eyes but at an incidence of only
1 to 2 percent (Erf et al., 1995a) as compared to the 90% incidence reported for SL
(Smyth, 1989; Smyth et al., 1981). One potential explanation for this low incidence of
amelanosis might be that the melanocytes of some BL chickens display the same defects
in antigen presentation as hypothesized for the SL. The adoptive transfer of autoreactive
lymphocytes from amelanotic SL chickens may result in the same autoimmune
pathogenesis. Alternatively, the melanocyte defect may not be required, and the simple


55
presence of anti-melanocyte autoreactive lymphocytes, or autoantibodies, may be
sufficient to cause amelanosis in BL chickens receiving SL lymphocytes or serum
autoantibodies by adoptive transfer. The variables tested included the host age, donor
age, use of irradiation, and number of injections of donor lymphocytes. We also
performed one experiment involving the transfer of SL serum autoantibody into BL hosts.
In this study, we report the first transfer of autoimmune amelanosis with splenic cells
from Smyth Line chickens in Brown Line chickens.
Materials and Methods
Animals
Fertile SL eggs from the major histocompatibility complex (MHC)-defined
subline, which has the earliest age of onset and the most severe phenotype of the three SL
MHC-defmed sublines (Erf et al., 1995a), and from the B^Ol MHC-matched BL were
generously provided by Dr. J. Robert Smyth, Jr. (University of Massachusetts, Amherst).
Chickens were hatched and housed at the University of Florida Poultry Unit, and were
individually identified with leg band or wing tag numbers. The degree of pigment loss
(amelanosis) by SL chickens was classified according to Erf et al. (1995b): (1) normal,
no apparent amelanosis; (2) mixed amelanosis, with both normal and <20% amelanotic
feather tissue; (3) mixed amelanosis, with normal and 20-60% amelanotic feather tissue;
(4) mixed amelanosis, with normal and >60% amelanotic feather tissue; and (5) complete
amelanosis, all developing feathering tissue is amelanotic. SL chickens with stage 1 or
no amelanosis are also referred to as nonprogressors, and SL chickens with any apparent


21
alopecia universalis (loss of hair). Thus vitiligos association with other autoimmune
diseases (Elder et al., 1981; Shong and Kim, 1991; Schallreuter et ah, 1994a; Nath,
1994) has categorized it within the Autoimmune Polyglandular Syndrome I diseases.
There is evidence suggesting a neuronal involvement in the disease in order to
explain the segmental and symmetric distribution of depigmentation found in some
patients or why there is a lack of depigmentation below the level of spinal cord injury in a
patient with transverse myelitis and vitiligo. In a study of dermal nerves in vitiligo
patients, AlAbadie and colleagues (1995) concluded that cycles of initial events of
vitiligo may cause axonal damage with later nerve regeneration. They suggested that the
destructive mechanism of melanocytes may be triggered by the neurotransmitters released
by nerve endings which are of close proximity to the melanocytes. Studies of
neuropeptide and neuronal marker immunoreactivity in skin biopsies such as
neuropeptide Y (NPY), support the theory that there is neuronal involvement in vitiligo
and that NPY may have a role in the pathogenesis of vitiligo (AlAbadie et al., 1994).
The C57BL/6J-v/f/v/f Mouse Model for Vitiligo
Researchers normally gravitate to the mouse in order to identify an animal model
that depicts the disease condition in the human. Such exists in the C57BL/6J-v///v/t
mouse model for vitiligo, which progressively loses much of its epidermal and follicular
pigment cells during successive shedding of fur. Eyes are also affected (Lerner 1986;
Lamoreux et al., 1992). This has been mapped to a recessive allele of the microphthalmia
gene locus (/m'v,t) (Halaban et al., 1993; Lamoroux et al., 1993). The mi gene has been
identified as a member of a basic-helix-loop-helix zipper transcription factor family


2
effector T cells. T helper 1 (Thl) cells will instruct phagocytes to clear involved tissue
cells containing intracellular parasites; Th2 cells will activate the corresponding B cell in
the germinal centers to multiply, undergo somatic hypermutations (affinity maturation),
differentiate to become plasma cells and secrete antibodies to complex the extracellular
antigen or to opsonize foreign particles for recognition by phagocytes. T helper cells will
also activate cytotoxic (CTL) T lymphocytes to destroy infected cells. The goal is
complete and efficient clearance of the antigen from the body. Memory B and T cells are
generated in preparation for a second exposure to the antigen with B cells undergoing
somatic mutation adding diversity and better specificity. This is a general description of
an ideally functioning immune system (reviewed in Janeway and Travers, 1997; Abbas et
al 1991).
Inappropriate responses by T cells have been suggested to initiate autoimmunity
as a result of a sustained immune response against self-antigen. Inappropriate T cell help
can activate a harmful antibody response against self-antigens and activate
polymorphonuclear cells (PMNs) to cause tissue damage. T helper cells will recruit
cytotoxic T cells. Autoimmune antibodies can bind to the target surface antigen and
cause complement-mediated cytolysis of the self tissues. Autoimmune antibodies can also
initiate antibody dependent cell-mediated cytotoxicity (ADCC), recruiting natural killer
cells to perform cytolytic killing of the autoantigen-expressing target cell.
Autoimmune responses can be described as a loss of self-tolerance. If there is a
sustained immune response that develops against the self-antigens, it becomes chronic if
the initial immune effector mechanisms can not eliminate the antigen completely. The
fact that the body is constantly producing and is therefore providing a constant source of


TABLE 4-2. Frequencies of ev loci detected in BL and SL chickens
Bam HI
BL
BL
SL
SL
Eco Rl
BL
BL
SL
SL
band (kb)
present
absent
present
absent
BL vs. SL
ev loci
band (kb)
present
absent
present
absent
BL vs. SL
ev loci
9.1 & 3.8
0
12
27
8
p<0.0001
ev-SL1
11.2 & 1.3
6
7
35
0
pO.0001
ev-SL2
12
12
0
16
19
p<0.001
4.2 & 2.8
0
13
6
29
n.s.
9.5
9
3
0
35
p<0.0001
8.4 & 3.2
8
5
29
6
n.s.
8.2
5
7
35
0
p<0.0001
ev-SL2
5.8 & 3.4
12
1
0
35
p<0.0001
7.3
11
1
35
0
n.s.
23.5
8
5
6
29
p<0.01
4.1
2
10
26
9
p<0.001
ev-SL3
21.7
0
13
4
31
n.s.
2.5
5
7
11
24
n.s.
12.5
11
2
8
27
p<0.0002
1.4
7
5
29
6
n.s.
8.1
1
12
32
3
p<0.0001
ev-SL4
1.3
8
4
13
22
n.s.
7.2
12
1
7
28
p<0.0001
4.9
0
13
27
8
pO.0001
ev-SL1
4.7
9
4
12
23
n.s.
4.4
12
1
19
16
p<0.01
The table shows the number of chickens in which each Bam HI and Eco Rl band or pair of bands is present and absent (Figs. 4-1 & 4-2).
n.s., not significant; p = Fishers exact test probability value.


2. ADOPTIVE TRANSFER OF AMELANOSIS IN THE SMYTH LINE
CHICKEN 48
Introduction 48
Materials and Methods 55
Animals 55
Sex Determination by PCR 56
Immunosuppression of the Host Animals 57
Preparation of the SL Donor Cells and Cell Injections 57
Smyth Line Serum Collection and Preparation 57
Cell Lines and Source 58
Immunoblotting 58
Histology 59
Results 59
Observations of the UF Colony of Smyth Line Chickens 59
Adoptive Cell Transfer Experiments 64
Serum Transfer Experiment 72
Western Blot Analysis 76
Discussion 79
3. T CELL RECEPTOR y REPERTOIRE ANALYSIS OF THE EXPANDED
PERIPHERAL BLOOD yS T CELL POPULATION DURING AVIAN
VITILIGO 85
Introduction 85
Materials and Methods 89
Animals 89
RT-PCR and Cloning 90
DNA Sequence Comparisons 91
Results 91
Phenotype of Birds Used for Repertoire Analysis 91
TCRVy Repertoire Analysis 92
CDR3 Length and Amino Acid Composition 100
Jy Usage 100
Discussion 100
4. ENDOGENOUS VIRAL LOCI IN THE SMYTH LINE CHICKEN: A
MODEL FOR THE AUTOIMMUNE DISEASE VITILIGO 106
Introduction 106
Materials and Methods 112
Southern Blot Analysis 112
Statistical Analyses 113
Results 113
Phenotypic Analysis of SL Sample Population 113
vii