Activated transcription of the glycolytic enzyme genes of Saccharomyces cerevisiae

Material Information

Activated transcription of the glycolytic enzyme genes of Saccharomyces cerevisiae the chromatin structures of TP11 and mechanisms of RAP1P mediated activation
Smerage, Jeffrey Beaumont, 1967-
Publication Date:
Physical Description:
x, 131 leaves : ill. ; 29 cm.


Subjects / Keywords:
Cells ( jstor )
Chromatin ( jstor )
DNA ( jstor )
Enzymes ( jstor )
Genes ( jstor )
Histones ( jstor )
Nucleosomes ( jstor )
RNA ( jstor )
Transcriptional activation ( jstor )
Yeasts ( jstor )
Chromatin -- ultrastructure ( mesh )
Department of Molecular Genetics and Microbiology thesis Ph.D ( mesh )
Dissertations, Academic -- College of Medicine -- Department of Molecular Genetics and Microbiology -- UF ( mesh )
Gene Expression Regulation ( mesh )
Promoter Regions (Genetics) ( mesh )
Research ( mesh )
Saccharomyces cerevisiae -- genetics ( mesh )
Saccharomyces cerevisiae -- physiology ( mesh )
Trans-Activation (Genetics) ( mesh )
Transcription Factors ( mesh )
City of Gainesville ( local )
bibliography ( marcgt )
non-fiction ( marcgt )


Thesis (Ph.D.)--University of Florida, 2000.
Bibliography: leaves 108-129.
General Note:
General Note:
Statement of Responsibility:
by Jeffery Beaumont Smerage.

Record Information

Source Institution:
University of Florida
Holding Location:
University of Florida
Rights Management:
Copyright [name of dissertation author]. Permission granted to the University of Florida to digitize, archive and distribute this item for non-profit research and educational purposes. Any reuse of this item in excess of fair use or other copyright exemptions requires permission of the copyright holder.
Resource Identifier:
026074586 ( ALEPH )
52305664 ( OCLC )


This item has the following downloads:

Full Text








The support of a great many people made the completion of this document and its

associated work possible. I would first like to acknowledge and thank my wife, Lucia,

and my son, Alec, for their love, patience, and support through the completion of my

graduate studies. Without their sacrifice and support, this document might never have

been completed. I would also like to recognize my parents, Glen and Barbara Smerage.

Their love and encouragement have not only helped me through graduate school, but

they are also largely responsible for the development of my curiosity and love of


I would also like to thank and recognize the lab of Dr. Henry Baker, which has

also been an essential component of my graduate experience. The encouragement and

direction provided by Dr. Baker has been an invaluable resource in my growth and

education. Many current and past members of Dr. Baker's lab have also had a significant

impact on the successful completion of this project. These include Dr. Lucia Eisner

Smerage, Ms. Cecilia Lopez, Dr. Carolyn Drazinic. and Dr. Michael Huie.

My graduate committee has also been instrumental in my graduate experience.

The members include Dr. Henry Baker (Chairman), Dr. Daniel Driscoll, Dr. Alfred

Lewin, Dr. Harry Nick, and Dr. Thomas Yang. The time that they have dedicated to

my education and personal development is greatly appreciated. I have enjoyed the

multitude of discussions, committee meetings, as well as data and document reviews,

which they so generously provided. Their advice and insight into the development of an

academic career will be invaluable as I continue to further my own career and personal

research direction. Dr. Donna Duckworth also deserves special recognition for her

participation in the defense of my dissertation and for her advice and friendship over

these years.



ACKNOW LDGM EN TS ................................................................................................. ii

LIST OF FIGURES .................................................................................................. vi

KEY TO SYM BOLS AND ABBREVIATIONS ........................................................... vii

ABSTRACT .................................................................................................................. ix

INTRODUCTION .......................................................................................................... I

The Basal Transcription Apparatus .......................................................................... 3
Enhancer Structure and Function ............................................................................ 9
Chromatin and Nucleosomes as Regulators of Transcription ................................. 12
Transcription and Saccharomyces cerevisiae ........................................................ 26
Summ ary ................................................................................................................... 44

M ATERIALS AND M ETHODS ............................................................................... 46

Strains ....................................................................................................................... 46
M edia and Growth Conditions .............................................................................. 46
Chrom atin M apping by Nuclease Sensitivity ........................................................ 46
In vivo Footprinting .............................................................................................. 52
DNA Band-Shift Analysis ..................................................................................... 57

RESULTS ..................................................................................................................... 67

Characterization of the Chromatin Structure at TPIJ in Saccharomyces cerevisiae ... 67
Raplp Binding is Required for Binding of Gcrlp at TPIJ in vivo ......................... 81
Raplp Facilitates the Binding of Gcrlp in vitro .................................................... 85

DISCUSSION ............................................................................................................... 96

Gcrlp Binding Depends on the Presence of Rap Ip ............................................... 96
The N-terminus and C-terminus of Rap lp Both Facilitate the Gcrlp Binding
Specificity ............................................................................................................. 98
Raplp Mediated Gcrlp Binding Is Distance Dependent .......................................... 100
TPI1 Is Located W ithin a Permissive Nucleosome Environment .............................. 101
TPI1 Chromatin Structure Is Not Affected By Mutations in GCRI, GCR2, or
Gal ................................................................................................................. 104
Chromatin Structure At Surrounding Open Reading Frames .................................... 105
M odel of Glycolytic Enzyme UAS Function ........................................................... 105

REFERENCES ........................................................................................................... 108

BIOGRAPHICAL SKETCH ....................................................................................... 130


Figure Page

1.1 The glycolytic pathway ................................................................... 28

1.2 Glycolytic UAS elements ............................................................... 32

1.3 Glycolytic UAS elements ............................................................... 34

2.1 Design of RapIp truncation mutants ............................................... 59

2.2 RapIp truncation vectors ................................................................. 60

2.3 Phosphorimager quantification ......................................................... 66

3.1 MNase sensitivity pattern upstream from BsiHKAI ........................ 70

3.2 MNase sensitivity pattern upstream from KpnI ................................ 72

3.3 DNaseI sensitivity pattern upstream from KpnI ............................... 74

3.4 MNase sensitivity pattern downstream from KpnI .......................... 76

3.5 DNasel sensitivity pattern downstream from KpnI ........................... 78

3.6 In vivo footprint analysis at the UASTP ........................................... 83

3.7 Bandshift of Raplp and Gcrlp using native spacing ....................... 89

3.8 Bandshift of RapIp and Gcrlp at +5 basepairs separation ............... 91

3.9 Summary of bandshift data for native and +5 spacing ..................... 94

4.1 Summary of the TPI1 chromatin and promoter structures ................... 103


A adenine
A600 Spectrophotometric absorbance at 600nm
BMV Brome Mosaic Virus
BSA bovine serum albumin
CaC12 calcium chloride
ChiP chromatin immunoprecipitation
CTD carboxy-terminal domain
D dextrose/glucose
DMS dimethylsulfate
DNA deoxyribonucleic acid
DTT dithiothreitol
E. coli Escherichia coli
EDTA ethylenedinitrilotetraacetic acid
EtBr ethidium bromide
G guanine
GCR1 gene encoding the yeast Glycolysis Regulation protein
Gcrlp Glycolysis Regulation protein
GCR2 gene encoding the yeast Glycolysis Regulation protein number two
Gly/Lac glycerol lactate
GTF general transcription factor
GuHCI guanidine hydrochloride
HCl hydrochloric acid
HDA high-density oligonucleotide array
HEPES 4-(2-hydroxyethyl)- 1 -piperazineethanesulfonic acid
IPTG isopropylthiogalactoside
kb kilobase
KCI potassium chloride
KPO4 potassium phosphate
lacZ E. coli gene encoding B-galactosidase
LB Luria broth
LBamp Luria broth with ampicillin
LTR long terminal repeat
M63 minimal media 63 (media)
MBP maltose-binding protein
Mda megadalton
mg milligram
mg/ml milligram per milliliter
MgC12 magnesium chloride
ml milliliter


Pol II
S. cerevisiae

mouse mammary tumor virus
micrococcal nuclease
3-[N-Morpholino]propanesulfonic acid
micrograms per milliliter
sodium acetate
sodium chloride
sodium hydroxide
sodium phosphate
Nonidet P-40
o-nitrophenyl galactoside
open reading frame
phosphate buffered saline
polymerase chain reaction
RNA polymerase II
polydeoxyinosinic-deoxycytidylic acid
gene encoding the yeast Repressor/Activator protein
Repressor/Activator protein
gene encoding the yeast Ribosomal Enhancer Binding protein
Ribosomal Enhancer Binding protein
temperature-sensitive allele of RAP 1
serial analysis of gene expression
Saccharomyces cerevisiae
sodiumdodecylsulfate polyacrylamide gel electrophoresis
TATA binding protein associated factor
Tris, borate, EDTA buffer
TATA binding protein
trichloroacetic acid
Tris, EDTA buffer
gene encoding triosphosphate isomerase
tris(hydroxymethyl)aminomethane hydrochloride
upstream activating sequence
gene encoding ornithine transcarbamylase
yeast peptone (media)
yeast peptone dextrose/glucose (media)
yeast peptone glycerol lactate (media)

Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy



Jeffrey Beaumont Smerage

December 2000

Chairman: Hemy V. Baker, Ph.D.
Department: Molecular Genetics and Microbiology

Regulation of transcription is a major pathway by which cells maintain a stable

intracellular environment and react to the extracellular environment. This study

addresses mechanisms by which a limited number of transcription factors can regulate

large and complex transcription systems. The glycolytic enzyme genes of

Saccharomyces cerevisiae were used as a model for the study of high-level activated

transcription. High-level expression of these genes is the result of combinatorial

interactions within a conserved set of transcription factors which bind at the Upstream

Activating Sequences (UASs) of each gene. These include the transcription factors

Abflp, Reblp, Raplp, and Gcrlp. In vivo treatment with micrococcal nuclease and

DNase I were used to demonstrate a region of nuclease hypersensitivity over the

promoter element of TPIJ and a series of statistically positioned nucleosomes running

upstream from the hypersensitive region. Nuclease hypersensitive regions are

characteristic of genes which are poised for activated transcription, and statistically

positioned nucleosomes are associated with "boundary" elements which can function to

prevent the formation of repressing nucleosomes over a UAS element. In vivo footprint

analysis of the TPI1 locus was used to demonstrate that binding of Gcrlp at its two sites

in the UAS requires concomitant binding of Raplp at its adjacent binding site. This is a

critical function of Raplp because in the absence of bound Gcrlp transcription is reduced

by 99%. Finally, DNA electromobility gel-shift analysis was used to define domains

within RapIp which are important for the facilitation of Gcrlp binding. The strongest

facilitation was seen in Rapl p species which retain both the deoxyribonucleic acid

(DNA)-binding domain and the asymmetric bending domain, although the asymmetric

bending domain was not absolutely required. Facilitation was observed when either the

amino-terminus or the carboxy-terminus was eliminated but not when both were

eliminated, leaving just the core DNA-binding domain. In summary, this work

demonstrates that the promoter of the TPI1 gene is located within a permissive chromatin

structure, the transcriptional activator Gcr 1 p is directed to its binding site by Rap lp. and

several domains within RapIp appear to be important for the facilitation of Gcr I p



Molecular biology has become an integral part of modern life. It has changed the

foods we eat. It has revolutionized the way many vaccines and medicines are made. It is

now an important factor in the diagnosis and risk stratification of many illnesses. As a

result, the biotechnology industry has become a major sector of our economy. Many of

these applications have been made possible by our knowledge of gene structure and

transcriptional regulation.

Since the realization that DNA is the repository of genetic information (Avery et

al. 1944; Hershey and Chase 1952), an enormous amount of work has been done

investigating how that information is mobilized. Appropriate and coordinated expression

of genes is important for many reasons, and there are many examples of how either lack

of gene expression or inappropriately activated transcription can result in failure of

cellular processes. Some of the most-studied mammalian mutations lead to inappropriate

expression of oncogenes or lack of expression of tumor suppressor genes resulting in

neoplastic disease. In microbiology, mutagenic analysis has been used to great advantage

in clarifying many details of transcriptional regulation and other cellular functions.

A basic question in the field of transcriptional regulation has asked how a cell can

regulate the complex patterns of gene expression with the specificity required for

successful function, growth, and reproduction. It appears that part of this specificity is

provided by DNA sequences that act as regulatory elements. These sequences function

primarily as protein binding sites, and they can be generally divided into two groups.

First, there is a proximal promoter that serves as a binding area for the transcription

apparatus often referred to as the basal transcription complex (Hernandez 1993; Malik

and Roeder 2000). Second, there are more distal regulatory elements that act as binding

sites for transactivating regulatory proteins (Tjian and Maniatis 1994; Malik and Roeder

2000). In general, these distal elements contain binding sites for multiple proteins. This

study utilizes the glycolytic enzyme genes as a model for the study of these regulatory

elements and their DNA-binding proteins. The evidence presented here demonstrates

that the binding of the transcriptional activator Gcrlp requires the simultaneous binding

of a second DNA-binding protein, Rap lp. It also investigates the domains within Rap I p

that may be required for this interaction. They represent an example of how specific and

appropriate gene expression appears to depend on the combinatorial interaction between

multiple transcriptional activators. An analysis of the chromatin structure surrounding

the glycolytic enzyme gene TPI1 is also presented. Chromatin in this region is found to

have areas of nuclease hypersensitivity and nucleosome phasing, both of which are

consistent with a transcriptionally active gene. These data provide a framework upon

which further investigation can be made into the formation and maintenance of active

chromatin structures. It is through complex interactions such as those seen at TPIJ and

the other glycolytic enzyme genes that a relatively small number of transcriptional

activators can regulate the activity of a large number of individual genes. This also

provides a mechanism by which cells can coordinate the expression of groups of genes in

response to environmental stimuli, intercellular signals, metabolic needs, cell cycle

functions, and cell type functions.

The Basal Transcription Apparatus

The basal transcription apparatus has traditionally been defined as a large multi-

protein complex that consists of the RNA Polymerase II (Pol II), the TATA Binding

Protein (TBP) as a component of TFIID, and additional General Transcription Factors

(GTFs) (Conaway and Conaway 1993; Orphanides et al. 1996). As noted above, this

complex acts at proximal DNA structures including the TATA box and the transcription

initiation site (Avery et al. 1944; Struhl 1989). In addition, a protein complex termed

mediator has been isolated in association with Pol II (Kim et al. 1994; Koleske and

Young 1994). The basal complex is capable of directing transcription of in vitro systems,

and this in vitro activity has been defined as basal transcription. The basal transcription

apparatus, as the target of the activating factors, remains an important component in the

understanding of the in vivo activation of transcription.

RNA Polymerase II and the General Transcription Factors

The heart of the basal apparatus is Pol II. This is one of three eukaryotic RNA

polymerase complexes, and it is responsible for the transcription of most protein-

encoding genes (Sawadogo 1990). Our knowledge of the eukaryotic Pol II has gone

through significant conceptual evolution in the past thirty years. This enzyme was first

isolated as a chromatographic fraction capable of in vitro template-dependent RNA

synthesis (Roeder and Rutter 1969). It has since been isolated from many species

including human (Freund and McGuire 1986), yeast (Sentenac 1985), fruitfly (Greenleaf

and Bautz 1975), mouse (Schwartz and Roeder 1975), frog (Engelke et al. 1983) as well

as others (reviewed in Young 1991). The "core" enzyme is a multi-protein complex that

consists of 10-+2 subunits depending on the species (Sawadogo 1990; Young 1991 ).

They are highly conserved across species (Roeder 1976; Allison et al. 1985; Sentenac

1985; Young 1991). However, this "core" polymerase is unable to direct selective

transcription in vitro (Roeder 1976; Weil et al. 1979).

Selective transcription initiation was achieved by the addition of chromatographic

fractions from crude cellular extracts (Matsui et al. 1980). The components of these

fractions became known as the General Transcription Factors (GTFs) (Sawadogo 1990;

Conaway and Conaway 1993; Orphanides et al. 1996). They have been isolated and

purified from many types of cells including budding yeast, HeLa cells, rat liver cells, and

fruitfly cells (Zawel and Reinberg 1993). The GTFs are represented by six fractions

named TFIIA, TFIIB, TFIID, TFIIE, TFIIF, and TFIIH. As a group, they represent a

collection of approximately 30 proteins (Orphanides et al. 1996). Extensive genetic and

biochemical investigation has defined proposed functions for many of the GTFs. These

include recognition and binding to the TATA box, recruitment of the Pol II enzyme,

melting of the promoter DNA, and initiation of Pol II transcription (Orphanides et al.

1996). However, their true functions within the Pol II "holoenzyme" are still

incompletely understood.

The TFIID subunit has been extensively studied and shown to be the only GTF

with strong DNA-binding activity and the GTF required for sequence specific positioning

of the transcription apparatus (Hahn et al. 1989). TFIID is a multi-protein complex, and

the sequence specificity is provided by a subunit called the TATA-binding Protein (TBP).

The remaining TFIID subunits are referred to as TBP-associated factors (TAFs).

Isolation of TBP was made possible by its high degree of cross-species conservation. It

was initially isolated as a yeast protein that could substitute for TFIID in an in vitro

mammalian transcription system (Buratowski et al. 1988; Cavallini et al. 1988). TBP has

been called the universal transcription factor by many authors (Hernandez 1993; Struhl

1995; Orphanides et al. 1996). It is the most conserved eukaryotic transcription factor,

and it is required for the transcription by all three of the eukaryotic RNA polymerases

(Pol 1, II, and III) (Hernandez 1993; Orphanides et al. 1996). The C-terminal domain

displays over 80% sequence identity across numerous species (Hernandez 1993). TBP

has also been shown to bind with high affinity and specificity to its consensus site

(TATAa/tAa/t) (Hahn et al. 1989). TBP is capable of directing selective but not activated

transcription in vitro (Hernandez 1993). The function of the non-conserved N-terminus

is not yet known.

The structure of TBP and the mechanism by which it binds to DNA may play an

important regulatory role in the ability of the transcription apparatus to bind to the

promoter. The crystal structure of TBP has been solved for both the protein alone as well

as bound to the TATA DNA element (Nikolov et al. 1992; Chasman et al. 1993; Kim et

al. 1993a; Kim et al. 1993b). TBP is an intramolecular dimer with near twofold

symmetry. It binds in the minor groove of the DNA double helix and displays a preferred

orientation. It also induces a dramatic 900 bend in the DNA with resulting unwinding

and superhelical twist at the end of the TATA sequence. This bend induced by TBP has

been proposed to function both to prevent nucleosome formation and to brine distant

regulation elements together through a looping mechanism (Orphanides et al. 1996).

In addition to the TBP, TFIID contains the TAFs, which may contribute further to

the development of an active promoter conformation. TBP creates a footprint over the

TATA box, and the complete TFIID extends this footprint beyond the site of transcription

initiation (Nakajima et al. 1988; Purnell et al. 1994; Sypes and Gilmour 1994). TFIID

may also play an important role in local chromatin structure. Several of the TAFs have

sequence and structural homology to histones (Orphanides et al. 1996)). More

specifically, yeast TAF61, TAF17, and TAF60 have homology to histones H2B, H3, and

H4 respectively. In Drosophila, a crystal structure of the H3- and H4-like TAFs has

revealed a complex similar to the histone (H3-H4)2 heterotetramer (Xie et al. 1996). In

vitro, prebound TFIID can prevent the formation of nucleosomes (Meisterernst et al.

1990). Conversely, it has also been shown that preexisting nucleosomes can prevent

TFIID binding in vitro (Han and Grunstein 1988). As noted above, the TBP causes the

DNA to bend away from the minor groove, resulting in a widened minor groove.

Nucleosomes on the other hand cause the DNA to bend in the opposite direction resulting

in compression of the minor groove (Van Holde 1989). The exact mechanism by which

TFIID affects chromatin is not yet clear. It is possible that TFIID initiates actual

nucleosome disruption, but it is also possible that TFIID simply maintains a structure that

was opened by other mechanisms. In either case, it is unlikely that both TFIID and

nucleosomes can be bound to the promoter simultaneously because of their incompatible

bending effects on the DNA strand.

The TAF components of TFIID have been of significant research interest because

initial in vitro studies demonstrated that they were required for activator-dependent

transcription initiation (Hernandez 1993). There are also many transcription activators

that have been shown to have protein-protein interactions with TBP as well as the TAFs

(Burley and Roeder 1996). However, initial attempts to demonstrate this dependence in

vivo were unsuccessful. Several authors showed that when individual TAFs are mutated

there are no global effects on transcription (Moqtaderi et al. 1996; Walker et al. 1996).

More recent data has shown that selected TAFs are generally although not universally

required for transcriptional activation. In particular, the histone-like TAFs appear to be

important for transcriptional activation (Michel et al. 1998; Moqtaderi et al. 1998;

Natarajan et al. 1998; Lee et al. 2000).

TAF17 is an example of a histone-like TAF that appears to be generally but not

universally required for transcriptional activation. Moqtaderi et al used a copper-

inducible, "double shutoff' construct to produce conditional alleles in TAF 17 (histone H3

homolog), TAF40, and TAF67 (Moqtaderi et al. 1998). This conditional system was

designed such that the addition of copper repressed the expression of each experimental

TAF gene and activated the expression of the ubiquitin degradation pathway. The

experimental TAF gene contained an N-terminal recognition signal that resulted in rapid

ubiquitin-directed depletion of the TAF. Depletion of TAF 17 resulted in the loss of

mRNA species from a broad array of genes, indicating a loss of general transcriptional

activity. This was not universal, however, as even eight hours after the addition of

copper they were still able to induce wild-type Aceip-dependent expression of cupl, and

induce wild-type heat shock-dependent expression of hsp104 and ssa4. The non-histone-

like TAFs, TAF40 and TAF67, were required only for transcriptional activation from

non-consensus TATA box elements. In a prior study, it was also found that two other

non-histone-like TAFs, TAF 145 and TAF 19, were required for transcriptional activation

only if the promoter contained a non-consensus TATA box (Moqtaderi et al. 1996).

The use of high-density oligonucleotide arrays (HDAs) has shown similar results.

Lee, et al (2000) used temperature sensitive alleles of several TAFs to evaluate their

effects on genome-wide expression. They studied seven TAFs, and each individual TAF

was required for transcriptional activation of 2-67% of yeast genes. TAF 17 demonstrated

the widest effects, being required for the expression of 67% of yeast genes. Recent data

has shown that there is a group of TAFs that are contained in a non-TFIID complex

known as SAGA (Grant et al. 1998). Five of the seven TAFs studied by Lee, et al (2000)

are found in both complexes. They evaluated the effects on genome-wide expression by

the depletion of TFIID specific TAFs, SAGA specific proteins, and TAFs that are shared

between the two complexes. They found that the greatest effects on transcription were

seen with the TAFs shared by both complexes. In total, the five shared TAFs were

required for the expression of 70% of the yeast genome. This resulted in the hypothesis

that TFIID and SAGA may perform overlapping functions. Loss of TFIID or SAGA in

isolation only affects transcription from subsets of yeast genes, but loss of both effects

the expression of most yeast genes.

Mediator and the Pol I Holoenzme

Signal transduction from activator elements to the polymerase complex now

appears to be communicated through the mediator complex. The combination of the

mediator and the traditional basal apparatus are now called holoenzyme. The term

mediator was first used to describe a cellular extract fraction required for activated

transcription in vitro using a reaction composed of otherwise purified components

(Flanagan et al. 1991). The mediator has been isolated and characterized by both genetic

(Nonet and Young 1989; Thompson et al. 1993) and biochemical means (Kim et al. 1994;

Koleske and Young 1994). Most of its components have now been identified. It is

composed of approximately 20 proteins, including Gall l p, Sug I p, four Srb proteins

(Kim et al. 1994), Sin4p, Rgrl p (Li et al. 1995), Rox3p (Gustafsson et al. 1997), and

seven Med proteins (Myers et al. 1998). Mediator was discovered in yeast; however

there is evidence that a similar structure is present in mammals (Jiang et al. 1998; Sun et

al. 1998; Gu et al. 1999)

Mediator appears to play a significant role in transcriptional activation. It

stimulates basal transcription 10-fold when added to in vitro transcription reactions

composed of purified components. An additional 30-fold response is seen when activator

proteins are included in the reaction (Kim et al. 1994). This represents a 300-fold

increase in transcriptional activation when compared to the basal apparatus in the absence

of the mediator complex.

Mediator appears to effect its action through the C-terminal domain (CTD) of Pol

II. The CTD is a highly conserved structure that contains tandem repeats of the

consensus amino acid sequence Tyr-Ser-Pro-Thr-Ser-Pro-Ser (Corden 1990). Like many

other components of the transcriptional apparatus, the Pol II CTD is highly conserved

across species, but it does vary in length from species to species. The murine CTD

contains 52 repeats, whereas the yeast CTD contains 26-27 repeats (Allison et al. 1985;

Corden et al. 1985; Nonet et al. 1987). The transition from the polymerase pre-initiation

complex to the actively transcribing polymerase complex correlates with the

phosphorylation state of the CTD (Dahmus 1996). Interestingly, mediator stimulates

activator-dependent phosphorylation of the CTD 40-fold in vitro (Kim et al. 1994).

Enhancer Structure and Function

The activation of the holoenzyme is achieved by the presence of more distal

elements known as enhancers. Enhancers have been defined as DNA elements that

activate transcription when placed at variable distances up- or down-stream from the

proximal promoter element, and their activity is independent of orientation (Struhl 1989;

Tjian and Maniatis 1994). They were also found to be responsive to cell-type specific

signals. It is now known that these enhancer elements represent binding sites for

transcriptional activator proteins (McKnight and Tjian 1986; Guarente 1987).

The first use of the term enhancer was in relation to the SV-40 early region

promoter (Banerji et al. 1981; Benoist and Chambon 1981; Fromm and Berg 1982).

Initial experiments in which segments of the promoter region were deleted identified two

72-base pair repeats that were essential for gene expression in vivo (Benoist and

Chambon 1981). This enhancing activity was further investigated using a construct in

which a variety of SV40 promoter region mutants were placed in front of a rabbit

hemoglobin 01 reporter gene (Banerji et al. 1981). They found that the presence of the

SV40 sequence resulted in a 200-fold increase in expression of the reporter RNA product.

They also found that the SV40 sequence was capable of enhancing transcription when

placed in either orientation and when placed in a variety of positions relative to the site of

transcription initiation. This included placement as far upstream as 1400 base pairs and

as far downstream as 3300 base pairs. Since the discovery of the SV40 enhancing

activity, similar cis-acting enhancer sequences have been found in association with

essentially all genes and in all organisms studied (Guarente 1988). In yeast, these

enhancer elements have been named Upstream Activating Sequences (UASs). A

hallmark property of enhancing elements is that they contain binding sites for a wide

variety of transcription activator proteins (McKnight and Tjian 1986; Guarente 1987).

One of the interesting properties of transcriptional activators is that they have a

modular structure. There are many examples of proteins that contain distinct DNA-

binding domains and activation domains that have been identified by mutation analysis.

For example, the yeast activator Gal4p contains a DNA-binding domain located in the

amino terminus and an activation domain located in the carboxy end of the protein (Brent

and Ptashne 1985). For the activator Gcn4p, the locations are different. The DNA-

binding domain is at the carboxy terminus, and the activation domain is in the middle of

the protein (Hope and Struhl 1986; Hope et al. 1988). In fact, the DNA-binding and the

activation functions can be physically separated. This has been demonstrated by the

creation of hybrid proteins in which the DNA-binding domain of one activator has been

combined with the activation domain of another protein. When the activation domains of

either Gal4p or Gcn4p have been fused with the LexA DNA-binding domain they are

capable of activating transcription from a reporter gene in which a LexA operator has

been placed upstream (Brent and Ptashne 1985; Hope and Struhl 1986). LexA is a DNA-

binding protein that normally represses transcription in the prokaryote E. coli (Brent and

Ptashne 1985).

The function of these transcriptional activators is dependent on the ability of the

DNA-binding domain to bring the activation domain to the enhancing element of the

promoter. If the activator protein is mutated such that the DNA-binding domain is

absent, then the activation domain can no longer activate transcription. This has been

demonstrated well in the "two-hybrid system" (Fields and Song 1989; Chien et al. 1991),

which has been put to dramatic use in identifying protein-protein interactions. In this

experimental system the DNA-binding domain and the activation domain of the Gal4

activator protein are physically separated. The DNA binding domain of Gal4 (amino

acids 1-147) is fused to an unrelated protein. Likewise, the activation domain of Gal4

(amino acids 768-881) is fused to a second unrelated protein. If these two fused proteins

demonstrate protein-protein binding, then this binding tethers the activation domain to the

DNA-binding domain that is bound to the promoter of the reporter gene. If the two

proteins do not interact then this tethering action does not occur, the activation domain is

not brought to the promoter, and transcriptional activation does not occur.

Several families of activator domains have been identified. In mammalian

systems these include acidic domains, proline-rich domains, and glutamine-rich domains

(Struhl 1995). In yeast, only acidic activation domains have been identified (Struhl

1995). Glutamine-rich and proline-rich elements do not appear to function in yeast

(Kunzler et al. 1994; Ponticelli et al. 1995). However, not all yeast activators contain

acidic domains so it is assumed that there are other yet undiscovered motifs in yeast

(Struhl 1995). The mechanisms by which activation domains function are not clearly

known, but there is evidence for several possibilities. These include recruitment of the

Pol II complex, induction of confonnational changes in the Pol II complex, alterations in

chromatin structure, and effects on transcription elongation (Keaveney and Struhl 1998).

However, these do not represent mutually exclusive mechanisms.

Chromatin and Nucleosomes as Regulators of Transcription

In vivo essentially the entire DNA is contained within chromatin. This packaging

system imparts many structural constraints and alterations to the DNA strand as well as to

the individual promoter elements. The nucleosomes and chromatin were initially thought

to be static structures, and they were thought to repress transcription simply by the steric

hindrance of binding by transcriptional activators and RNA polymerase (Thoma et al.

1979). More recently, however, chromatin and nucleosome structure have been found to

be much more dynamic, and they may even play a role in promoter specific

transcriptional regulation (Kingston et al. 1996; Workman and Kingston 1998; Wolffe

and Guschin 2000).

The Nucleosome Core

Chromatin has multiple levels of organization, but at the heart of this structure lies

the nucleosome. This protein complex is an octomer composed of four histones, H2A,

H2B, H3. and H4. Assembly of the nucleosome core involves the formation of H3-H4

heterodimers that then combine to form a tetramer through dimerization of the H3

subunits (Eickbush and Moudrianakis 1978). This (H3-H4)2 tetramer is bound on both

sides by H2A-H2B heterodimers to form the final nucleosome octomer (Arents et al.

1991). The octomer is then wrapped by DNA to form the nucleosome (Hayes et al. 1990;

Hayes et al. 1991).

The histones are another example of proteins that are highly conserved across

species (Wells and McBride 1989, Wells and Brown 1991). The most conserved histones

are H3 and H4 (Wells and McBride 1989; Wells and Brown 1991). The human H3 and

H4 histones are virtually identical (either identical or one amino acid difference) to the

corresponding histone proteins from cow, mouse, frog, trout, and sea urchin. When

mammals are compared to more distantly related metazoa such as wheat, pea, and maize,

the H4 histones only differ at two amino acids. The 13 and 114 histones of S. cerevisiae

vary from human by only 15 and 8 amino acids, respectively. The H3 and H4 histone

lengths are also virtually identical in all species. Histone H4 is always 102 amino acids

in length, and with only one exception, histone H3 is always 135 amino acids. The

histones also have structural conservation, and they have two major structural domains, a

globular core that contains a tertiary structure known as a "histone fold" and an

unstructured N-terminal tail (Arents et al. 1991). The unstructured tail contains multiple

lysine residues that serve as sites of acetylation.

The histones H2A and H2B show more sequence variability, but they continue to

share the tertiary structure of the histone fold and the unstructured tail regions (Wells and

McBride 1989; Wells and Brown 1991). There is some evidence that the H2A-H2B

heterodimers are destabilized when active chromatin structures are created. This has led

to the hypothesis that the variations in H2A and H2B may represent regulatory

differences between different organisms.

Higher Order Chromatin Structure

One of the first views of chromatin revealed a 10-nm filament that has been

described as "beads on a string" (Thoma et al. 1979; De Murcia and Koller 1981). This

structure is characterized by individual nucleosomes separated by lengths of "linker"

DNA. This was consistent with nuclease digestion data in which showed partially

digested chromatin formed a ladder of DNA fragments whose lengths were multiples of a

basic size unit (Lohr et al. 1977a; Noll and Kornberg 1977). More extensive nuclease

digestion demonstrated a 166 bp unit termed a chromatosome (Simpson 1978). The

chromatosome contained DNA supported by both the core histone octomer and one

histone HI. With further digestion, a 145 bp unit was produced that represented the

removal of the linker DNA, leaving only the core DNA (Simpson 1978). The beads-on-

a-string structure is not thought to represent the predominant form of chromatin because

it was seen predominantly in preparations using non-physiologic cation concentrations

(Schwarz and Hansen 1994).

In higher eukaryotes the majority of chromatin is believed to exist in vivo as a

higher order structure, which is 30-nm in diameter (Davies et al. 1974; Paranjape et al.

1994; Wolffe 1998). This 30-nm fiber, as well as even higher order structures, is

virtually devoid of transcriptional activity. As a result, it is believed to be involved with

the epigenetic control of transcription. It is unclear whether a similar 30-nm structure

exists in budding yeast. Several studies utilizing electron microscopy have shown that

yeast chromatin can form a 30-nm filament in vitro (Rattner et al. 1982; Lowary and

Widom 1989). However, yeast do not have cytogenetically detectable heterochromatin

(Rattner and Hamkalo 1981; Bazett-Jones dt al. 1988: Guacci et al. 1993; Elgin 1995).

Early experiments indicated that HI linker histones were required for formation

of the 30-nm fiber (Thoma et al. 1979; Widom 1989). More recent results show that the

30-nm fiber can be formed in the absence of histone H I if appropriate cation

concentrations are present (Schwarz and Hansen 1994). It is now felt that the H I histone

serves to stabilize the 30-nm fiber via a charge neutralization mechanism, in which the

highly basic tail domains neutralize the charge on the polyanionic backbone of the DNA

strand (Clark and Kimuura 1990; Carruthers et al. 1998; Wolffe 1998).

Histone HI is highly variable across species (Wells and McBride 1989; Wells and

Brown 1991). In fact, it is controversial whether S cerevisiae even possesses an HI

histone. For a long time, it has been believed that S. cerevisiae does not contain a H I

histone. Many attempts to immunoprecipitate an H 1 protein using antibodies against H I

proteins from higher eukaryotes were unsuccessful (Escher and Schaffner 1997).

Additionally, the length of the yeast linker regions is very short, given that the DNA in

the chromatosome is approximately 160 base pairs (Lohr et al. 1977a; Lohr et al. 1977b).

This has been felt to be incompatible with the presence of a linker protein. Recently,

however, the gene HHOJ was identified using data from the S. cerevisiae genome

project. This sequence encodes a protein with a globular domain that has 36% identity to

human HI histone (Landsman 1996). The significance of this protein is currently

uncertain since neither deletion nor over-expression of HHO1 appears to affect activation

or repression of transcription (Escher and Schaffner 1997; Patterton et al. 1998).

Nuclease Hypersensitivity and Statistical Positioning of Nucleosomes

An early observation was that regions of nuclease hypersensitivity were

associated with loci of transcriptional activity, and conceptually they have been thought

of as "open windows" that provide transcription factors access to regulatory DNA

sequences (Wu et al. 1979a; Wu et al. 1979b; Gross 1988). Nuclease hypersensitivity

was first noted in work with the SV40 virus (Scott and Wigmore 1978; Varshavsky et al.

1978). In these studies, DNase I was used to demonstrate that the SV40 chromatin

contained a region of hypersensitivity located near the origin of viral replication. Since

this early discovery, nuclease hypersensitivity sites have been found to be ubiquitous in

eukaryotes, and they are associated with functional elements within the DNA sequence

including centromeres, silencers, recombination sequences, origins of replication,

enhanceriUAS elements, promoter elements, transcriptional terminators, locus control

regions, and A-elements (Gross 1988).

The chromatin structure at glycolytic genes is not well studied. Work at TDH3

has demonstrated a hypersensitive area over the promoter (Gross 1988). Additionally, it

was demonstrated that mutant strains in which the transcriptional activator Gcr 1 p is

deleted are associated with the deposition of two positioned nucleosomes over the

proximal promoter element (Gross 1988).

The PHO5 promoter provides another example of an inducible hypersensitive site

(Schmid et al. 1992). PHO5 encodes an acid phosphatase, and its transcription is induced

by phosphate starvation. The PHO5 promoter has two Pho4p-binding sites as well as a

Pho2p-binding site. When the PHO5 gene is inactive, the UAS region is incorporated

into at least six positioned nucleosomes. The first Pho4p-binding site is positioned

between two nucleosomes in a very small area of DNase I hypersensitivity (Almer and

Horz 1986). The second Pho4p-binding site, along with the Pho2-binding site are

positioned within a nucleosome and are notaccessible for binding (Venter et al. 1994).

Upon phosphate starvation, Pho4p binds to the binding site between nucleosomes

followed by the loss of four positioned nucleosomes as evidenced by the appearance of a

new area of nuclease hypersensitivity (Almer and Horz 1986; Almer et al. 1986). This

area of hypersensitivity included the binding sites for Pho4p and Pho2p. This

nucleosome disruption occurs in the absence of DNA replication (Schmid et al. 1992). It

is during this hypersensitive state that Pho4p and Pho2p are able to bind to their sites,

which were previously incorporated into a nucleosome (Venter et al. 1994).

A second phenomenon observed at transcriptional promoters is nucleosome

positioning. Nucleosomes can be positioned by a variety of mechanisms including DNA-

binding proteins, DNA sequence, and DNA bending (Simpson 1978; Thoma 1992).

Positioned nucleosomes then result in a phenomenon known as statistical positioning

(Fedor et al. 1988), which occurs because the positioned nucleosome acts as a boundary

element. This boundary forces adjacent nucleosomes to assume a specific rotational and

translational positions. Translational position is the location of the histone octomer along

the linear DNA strand. Translational positioning was seen in the PHO5 promoter, as

discussed above, where nucleosomes were positioned along the length of the DNA

resulting in Pho4p access to the first binding site. Rotational position relates to the

orientation of the DNA on the histone octomer. The DNA helix is a three dimensional

structure, and any surface such as the major or minor grooves can be either facing toward

the histone core or it can be facing out away from the core. Thus, if a protein binds a

particular surface of the DNA, this binding site can either be obscured or accessible based

on the rotational positioning.

Nucleosome positioning can have both positive and negative effects on

transcription. When promoter sites are obscured by the placement of a nucleosome, this

can prevent binding and as a result inhibit transcriptional activation. The positioning of

nucleosomes over the Pho4p- and Pho2p-binding sites at the PH05 locus described

above exemplify how transcription factor binding can be inhibited by the presence of a

nucleosome. As noted above, this association was also seen at the TDH3 gene at which

the gcrl deletion mutation was associated with the deposition of positioned nucleosomes

over the proximal promoter (Gross 1988). In the gcrl deletion mutant, transcription from

this promoter is severely reduced (Gross 1988). Alternatively, the mouse mammary

tumor virus (MMTV) provides an example where the presence and exact positioning of a

nucleosome is required for the activation of transcription. The long terminal repeat

(LTR) of the MMTV promoter contains binding sites for multiple protein factors,

including the glucocorticoid receptor, OTF, and NFL. In the absence of glucocorticoid

hormone, the promoter is covered by six positioned nucleosomes (Zaret and Yamamoto

1984; Richard-Foy and Hager 1987; Pina et al. 1990). When the glucocorticoid receptor

binds to its site, both the rotational and translational position of the second or "B"

nucleosome changes. The rotational position allows the NF 1 binding site to become

accessible on the surface of the nucleosome (Lee and Archer 1994; Truss et al. 1995).

The translational positioning also places all the activator binding sites on the curved

surface of the nucleosome. Simultaneous binding of all the transcription factors does not

occur on naked DNA (Bruggemeier et al. 1990). 'Thus, their positioning on a curved

surface is believed to relieve steric constraints and allow concurrent binding of all factors

(Truss et al. 1995).

Promoter-Specific Chromatin Alteration

It was once thought that alterations in local chromatin structure might require

DNA replication to remove pre-existing nucleosomes (Svaren and Chalkley 1990). In

this scenario, transcriptional activator proteins would bind promoters after DNA

replication and prevent the reformation of nucleosomes. This would then allow other

transcription factors and the Pol II apparatus to bind. However, work in yeast has shown

that DNA replication is not required in order for nucleosome clearance/alteration to occur

(Schmid et al. 1992), and there are now many examples of promoter-specific chromatin

modulation. Two families of chromatin modulating complexes have been identified.

One is characterized by ATP-dependent nucleosome alterations, and the other is

characterized by the ability to acetylate nucleosomes.

ATP-dependent nucleosome alteration

There are several ATP-dependent chromatin-modifying complexes. The

prototype is the 2 MDa multiprotein Swi/Snf complex (Cairns et al. 1994). The Swi/Snf

proteins were initially identified in Saccharomyces cerevisiae through mutations that

produced defects in mating type switching (SWI) and sucrose fermentation (SNF)

(Sudarsanam and Winston 2000). The first link to chromatin structure came when

suppressors of Swi and Snf mutations were found to be located within chromatin

components including mutations in the histones H2A, H2B, H3, and H4 (Kruger and

Herskowitz 1991; Hirschhorn et al. 1992; Winston and Carlson 1992). They were then

found to alter nucleosomes in an ATP-dependant manner (Cote et al. 1994). There are

several other members of the Swi/Snf family of ATP-dependent chromatin remodeling

factors and they are found in a number of organisms. An additional yeast complex is

named RSC (Cairns et al. 1996). The related human complexes include hSWI/SNF

(Kwon et al. 1994), NURD (Xue et al. 1998), and RSF (Jaskelioff et al. 2000).

Drosophila complexes include ACF, CHRAC, NURF, and brm (Kingston and Narlikar


The mechanisms by which Swi/Snf and the other ATP-dependent complex alter

nucleosome structure and transcriptional activation are not well understood. Swi/Snf has

been shown to have a variety of effects on nucleosomes. It has been implicated in

nucleosome movement. This includes "cis-displacement," which is sliding without loss

of DNA binding (Whitehouse et al. 1999). Swi/Snf has also been shown to cause "trans-

displacement" of nucleosomes, which is the actual loss of DNA binding of nucleosomes

as evidenced by the ability to catalyze the transfer of nucleosomes from one DNA strand

to another (Lorch et al. 1999). The degree of cis- versus trans-displacement appears to

be dependent on the relative concentrations of Snf/Swi and nucleosomes. Trans-

displacement requires much higher concentrations of the Swi!Snf complex (Whitehouse

et al. 1999). The binding of Swi/Snf to either naked DNA or chromatin is ATP-

independent (Quinn et al. 1996), and this binding has been show to form loops within the

DNA or chromatin strands (Bazett-Jones et al. 1999). The Swi/Snf alterations in

nucleosome structure have been found to be stable after removal of Swi/Snf (Lorch et al.

1998). Interestingly, Swi/Snf is capable of catalyzing both the forward and reverse

reactions of nucleosome alteration (Lorch et al. 1998; Schnitzler et al. 1998).

There may be more than one mechanism by which the Swi/Snf complex is

brought to the promoter regions. Swi/Snf complexes have been co-immunoprecipitated

with both the yeast and human PollI holoenzymes (Wilson et al. 1996; Cho et al. 1998;

Neish et al. 1998). This finding generated an early hypothesis, which postulated that

Swi/Snf was brought to some promoters by the Poll holoenzyme itself. However, the

intracellular concentration of the Swi/Snf complex is one-tenth the concentration of

holoenzyme (Cairns et al. 1994; Cote et al. 1994), and PollI has not been co-

immunoprecipitated with Swi/Snf (Cairns et al. 1994; Cote et al. 1994; Cairns et al. 1996)

Alternatively, Swi/Snf might be brought to promoters via interactions with

transcriptional activators. In vitro studies performed in yeast demonstrated that Swi/Snf

interacts with Gcn4, Hap4, Ga1-AH, VP-16, and glucocorticoid receptor (Yoshinaga et al.

1992; Natarajan et al. 1999; Neely et al. 1999; Yudkovsky et al. 1999) The strength of

the Swi/Snf to Gcn4 interaction also correlated with the degree of Gcn4 transcriptional

activation (Natarajan et al. 1999). Chromatin immunoprecipitation (CHiP) demonstrated

in vivo that the presence of Swi/Snf at the HO promoter was dependent on the presence of

the transcriptional activator Swi5 (Cosma et al. 1999). The human Swi/Snf (hSwi/Snf)

has been shown to associated with the glucocorticoid receptor in vivo, and this interaction

was required for hormone dependent changes in the chromatin structure at the

glucocorticoid receptor binding site (Fryer and Archer 1998). The transcription factor

EKLF has been shown to recruit hSwi/Snf to the --globin gene (Lee et al. 1999).

Swi/Snf is required for the normal expression of only 6% of yeast genes by

genome wide expression analysis using HDAs (Holstege et al. 1998). Even more

intriguing, loss of Swi/Snf function was associated with decreased expression of 2%

genes and increased expression of 4% of genes (Holstege et al. 1998). Thus, its appears

to function both in transcriptional activation and repression. There is some evidence that

the strength of a promoter may dictate whether the promoter is Swi/Snf dependent.

Swi/Snf was required in vivo to facilitate the binding of Gal4p to weak binding sites

(Bums and Peterson 1997). However, when the binding site was altered to make it a high

affinity site or to place it in a nucleosome-free position, Gap4p binding became Swi/Snf

independent. The HDA data also indicate that Swi/Snf is not significantly involved with

the expression of yeast glycolytic enzyme genes (Holstege et al. 1998). This is consistent

with older data that showed that mutations in swil, swi2/snf2, and swi3 do not affect

TDH3 expression (Yoshinaga et al. 1992), and mutations in swi2/snf2, snf5, and snf6 do

not affect TPIl expression (Hirschhorn et al. 1992).

Histone acetylation

Histone acetylation has been implicated in the regulation of transcription for a

number of years. In the 1960's, while investigators were beginning to look at the role of

nucleosomes in transcriptional repression, it was noted that acetylated histones caused

less repression than non-acetylated histones (Allfrey et al. 1964). Several organisms have

also been noted to contain chromatin structures that correlate acetylation with

transcriptional activity. Tetrahymena contains two nuclei, a macronucleus that is

transcriptionally active and a micronucleus that is transcriptionally inactive (Lin et al.

1989). The macronucleus has been shown to contain acetylated histones, and the

micronucleus has decreased levels of acetylation (Gorovsky et al. 1973; Lin et al. 1989).

In Drosophila the male has a single hyperactive X chromosome that demonstrates

hyperacetylation of histone H4 compared to the female X chromosomes and all

autosomes (Turner et al. 1992). In mammalian females one of the two X chromosomes is

inactivated, and the inactivated X chromosome is "virtually devoid" of H4 acetylation

(Jeppesen and Turner 1993). Other investigators have used organomercurial-agarose gels

to isolate transcriptionally active chromatin(Walker et al. 1990). Chromatin isolated via

this chromatography technique was shown to have elevated levels of histone acetylation.

Antibodies directed against acetylated histones have also been used to purify acetylated

chromatin that was then shown to be enriched for active genes (Hebbes et al. 1988;

Hebbes et al. 1994).

The manipulation of nucleosome acetylation both in vivo and in vitro has

continued to link transcriptional activity with the degree of acetylation. Sodium butyrate

has been used to create hyperacetylated nucleosomes by inhibiting cellular deacetylases.

Treatment of cells with sodium butyrate has been associated with increased DNase I

sensitivity and increased expression from transfected DNA templates (Gorman et al.

1983). Nucleosomes reconstituted in vitro from hyperacetylated histones have

demonstrated increased binding of transcriptional activators (Lee et al. 1993; Vettese-

Dadey et al. 1996). Proteolytic removal of the N-terminal histone tails also results in

increased transcription factor binding that is similar to the result seen with acetylated

histones (Vettese-Dadey et al. 1994; Vettese-Dadey et al. 1996). Acetylation has also

been shown to disrupt higher-order chromatin folding, with an associated enhancement of

transcriptional activity (Tse et al. 1998). Acetylation decreases the number of times the

DNA strand is wrapped around each nucleosome core (Bauer et al. 1994) and results in

DNA that is less constrained by the nucleosome as demonstrated by greater flexibility

(Krajewski and Becker 1998). All of these findings have led to a model where histone

acetylation functions by destabilizing the interaction between the N-terminal tails and

DNA (Wolffe and Guschin 2000). Acetylation reduces the ionic charge on the histone

tails, and as a result acetylation would weaken the histone-DNA interaction proposed by

the charge neutralization hypothesis discussed above.

The connection between histone acetylation and promoter specific transcriptional

activation came with the identification of the Tetrahymena histone acetylase p55, which

was subsequently found to be homologous to the yeast transcriptional activator Gcn5p

(Brownell et al. 1996). GCN5 was initially identified through two independent mutation

screens. One was looking for mutations that effected the function of Gcn4p, which is a

transcriptional activator required for the expression of genes activated during amino acid

starvation (Georgakopoulos and Thireos 1992). It was also identified under a different

name, ADA4, during a screen looking for suppressors of Gal4-VP 16 toxicity (Marcus et

al. 1994).

Gcn5p was found to be associated with two protein complexes, the 0.8 MDa Ada

complex and the 1.8 MDa SAGA (_pt-Ada-Gcn5-acetyltransferase) complex (Grant et al.

1997). In the original isolate, the SAGA complex contained Gcn5, four Ada proteins,

four Spt proteins, and additional unidentified proteins (Grant et al. 1997). SAGA is also

now known to contain at least five TAFs (Grant et al. 1998). There are additional

acetylase complexes found in yeast including NuA3 (nucleosomal acetyltransferase of

H3) and NuA4 (nucleosomal acetyltransferase of H4),(Eberharter et al. 1998; Allard et al.

1999). Even TFIID has been found to contain a histone acetylase, TAF 145 (Mizzen et al.

1996). Gcn5p and SAGA also appear to have cross species conservation. The human

acetylase PCAF, which has homology to Gcn5p (Yang et al. 1996), is also found within a

multi-protein complex, which like SAGA also contains histone-like TAFs (Ogryzko et al.

1998). These are all examples of transcriptional activators that are associated with

acetylase activity. The opposite also occurs. There are several examples of

transcriptional repressors that are associated with deacetylase activity (Taunton et al.

1996; Pazin and Kadonaga 1997; Wolffe 1997).

Nucleosome acetylation appears to be a phenomenon generally associated with

transcriptional activation. However it is unclear whether complexes such as SAGA play

general roles in transcription regulation. When Gcn5p or other SAGA-specific proteins

are inactivated, the expression of at most 12% of genes are significantly affected, as

assessed by genome wide expression analysis using HDAs (Lee et al. 2000). As an

individual gene, the deletion of Gcn5p affected expression of only 4% of yeast genes.

However, it appears that SAGA has overlapping function with TFIID (Lee et al. 2000).

When the TAFs that are shared between the two complexes were mutated, they

individually affected the expression of 10-67% of yeast genes. As a group they were

required for expression of 70% of yeast genes. This effect is not specific to the

acetylation function because when the two acetylases TAF145 and Gcn5p are both

depleted at the same time, expression is only affected in 25% of the genes. Of note,

neither TFIID, SAGA, nor the combination appeared to significantly affect transcription

of glycolytic enzyme genes.

Transcription and Saccharomyces cerevisiae

The yeast S. cerevisiae provides an excellent model for the study of eukaryotic

transcriptional activation. It provides a eukaryotic environment within an organism,

which like the prokaryote Escherichia coli (E. coli), is generally easy to grow, and has a

rapid growth rate. It is genetically very malleable (Guthrie and Fink 1991), allowing

genetic manipulations not currently possible in mammalian cells. The S. cerevisiae

genome has also been sequenced (Cherry et al. 1997; Cherry et al. 1998). It has also been

shown to have many common features when compared to the mammalian eukaryotic cell.

In addition to overall cellular organization, these include similarities between RNA

polymerases, enhancer/UAS elements, protein structural domains, chromatin structure,

and many transcription factors. Many of these are been described above.

Within the context of S. cerevisiae, the glycolytic enzyme genes provide an

interesting system with which to study activated transcription because they are highly

expressed and because their transcription control mechanisms appear to be both

multifactorial and coordinated. The glycolytic pathway (Figure 1.1) is a dominant system

within this organism. S. cerevisiae, also known as Baker's yeast or Brewer's yeast, has

been selected over centuries to efficiently convert sugars into ethanol. It has been found

to possess very high levels of glycolytic enzyme activity. In fact, it is estimated that

these enzymes make up 30-60% of the cell's soluble protein (Hess et al. 1969; Fraenkel

1982), and the mRNA transcripts constitute a major fraction of total cellular mRNA

(Holland and Holland 1978). More recent analysis using both SAGE (serial analysis of

gene expression) (Velculescu et al. 1997) and HDAs (Holstege et al. 1998) have

Figure 1.1. The glycolytic pathway

Glucose is transformed to several end products in yeast, including lactate and ethanol.
The enzymes required for each step of the pathway and the genes, which encode each
of these enzymes, are indicated next to each set of arrows.

Glycolytic Pathway


Glucose 6-phosphate
Phosphoglucose isomerase
Fructose 6-phosphate
Fructose 1,6,-bisphosphate

Dihydroxyacetone phosphate I
isomerase (TPII

Glyceraldehyde 3-phosphate
4 Glyceraldehyde 3-phosphate
r) Dehydrogenase
Phosphoglycerate kinase



(ENOI, EN02)

Pyruvate Kinase
Lactate m Pyruvate
Lactate dehydrogenase t Pyruvate decarboxylase

Alcohol dehydrogenase

confirmed the high level of glycolytic gene expression. The SAGE analysis

demonstrated that each glycolytic enzyme was represented by 69-425 mRNA transcripts

per cell. The HDA analysis demonstrated each glycolytic enzyme to be represented by

50-123 mRNA transcripts per cell. The vast majority of yeast genes (approximately

80%) are only represented by 0 1-2 mRNA transcripts per cell (Holstege et al. 1998).

Expression of the glycolytic enzyme genes is primarily constitutive. Possible

exceptions may include PGK, EV02, PYK, PDC1, and ADH1 that show some induction

in response to glucose. However, much of the glucose induction may be the result of

changes in enzymatic activity rather than transcriptional activity. Enzymatic activity was

studied in the hybrid yeast Saccharomycesfragili X Saccharomyces dobzhanskii, and

this work showed a glucose-modulated induction of 3- to 7-fold for most glycolytic

enzymes and 50- and 70-fold inductions for pyruvate decarboxylase and glyceraldehyde-

3-phosphate dehydrogenase, respectively (Maitra and Lobo 1971). However, when the

mRNA levels were assayed in S. cerevisiae it was found that most glycolytic transcripts

were induced less than two-fold. The transcripts for PFK2, PGM, ENO, and PYK

showed the greatest effect with 2.2-, 2.3-, 3.1-, and 3.9-fold inductions, respectively

(Moore et al. 1991).

The first evidence that transcriptional activation at the glycolytic enzyme genes is

regulated by a common mechanism came with the discovery of the Glycolysis Regulation

gene (GCR1). Mutations in the regulatory gene GCR] are associated with a significant

loss of both mRNA-encoding glycolytic enzymes and measurable enzyme activity

(Clifton and Fraenkel 1981; Holland et al. 1987; Scott et al. 1990). GCRJ has been

shown to encode a DNA-binding protein that has binding sites in the Upstream

Activating Sequences (UASs) of the glycolytic enzyme genes, and it has been shown to

be required for activated transcription from glycolytic enzyme genes (Baker 1991; Huie

et al. 1992). Gcrlp primarily effects the expression of glycolytic genes and Ty

transposon elements (Ciriacy et al. 1991; Turkel et al. 1997; Dudley et al. 1999; Lopez

and Baker 2000). Additional proteins, which are known to bind at these UAS elements,

include RebIp, Abflp, and Rap Ip. All three of these additional proteins are known to

effect expression of a wide variety of genes and as a result a wide variety of cellular

processes. Figure 1.2 summarizes the structures of the glycolytic UAS elements. The

similarity of the UAS regions for glycolytic enzyme genes suggests that their

transcriptional activation occurs through a similar mechanism and that this mechanism

provides the basis for the coordinated transcription of this family of genes.

TPIJ Transcriptional Activation

In this study, the gene TPI1 was used as a model for activated transcription of a

glycolytic enzyme gene. TPII encodes the triosphosphate isomerase enzyme, which is

required for the conversion of dihydroxyacetone phosphate into glyceraldehyde-3-

phosphate. It is a single-copy gene, and it has a promoter structure that includes both a

TATA element and a UAS (Baker 1986; Scott et al. 1990). Within this UAS there are

known protein-binding sites for RebIp, Rap Ip, and Gcrlp (Figure 1.3). Each of these

sites appears to play an essential role in full expression of the TPIJ gene. Utilizing

UASTPII elements in which either the RebIp-, the RapIp-, one Gcrlp-, or both GcrIp-

binding sites are deleted, transcription fell to 18%, 9%, 28-38%, and 1% of wild-type

respectively (Scott and Baker 1993).

Figure 1.2 Glycolytic UAS elements

The glycolytic enzyme genes of Saccharomyces cerevisiae have a highly conserved
set of transcriptional activators that bind at their UAS elements. These include
Raplp, Gcrlp, Reblp, and Abflp. References for the binding sites listed here
include: PGI (Tekamp-Olson et al. 1988), PFK2 (Heinisch et al. 1991; Huie et al.
1992), FBA1 (Schwelberger et al. 1989), TPI1 (Baker 1991 ;Chambers et al. 1989;
Huie et al. 1992; Scott et al. 1990; Scott and Baker 1993), TDH3 (Bitter et al. 1991;
Kuroda et al. 1994; Huie et al. 1992), PGK1 (Chambers et al. 1989; Chambers et al.
1994; Ogden et al. 1986; Huie et al. 1992), GPM1 (Rodicio et al. 1993), ENO1
(Brindle et al. 1990; Buchman et al. 1988; Chambers et al. 1989), ENO2 (Brindle et
al. 1990; Willett et al. 1993), ADHI (Buchman et al. 1988; Chambers et al. 1989;
Tornow and Santangelo 1990), PDC 1 (Butler et al. 1990; Chambers et al. 1989).


PYKI ....


PFK2 r




GPM] pp

ENO] psi

EN02 mOO



100bp *=Raplp 0 Gcrlp cJ=Reblp =Abflp
= structural gene

Figure 1.3 The TPIJ gene and surrounding region

A. The organization of the TPI1 promoter includes the UAS binding sites between bases -396 to -371 and a TATA box at position
-170. B. The structural gene is 747 basepairs in length. Several restriction enzyme sites used in this study are indicated including
AvalI/TthIllI, Kpnl, BsiHKAI. The UAS and TATA elements are located as notated. C. The sequence surrounding TPIJ contains
several open reading frames and genes as identified by the yeast genome sequencing project. The locations of DBF4, YDR051C, and
YDRO49W are indicated.

Rebip Gcrlp Rapip Gcrlp TATA




II I %.
-859 +1 '-'+747



Reblp Gcrlp Raplp



A model for UASTPI, function has been proposed that predicts a sequential

binding process in which the binding of one protein allows the binding of subsequent

proteins (Scott and Baker 1993; Drazinic et al. 1996; Huie and Baker 1996). In this

model, Reblp or Abflp bind first, possibly altering the chromatin structure over the UAS

region. RapIp then binds its site, which is within this nucleosome-free region. The

presence of Rap I p then creates conditions that are appropriate for full binding by Gcrl p

at the Gcrlp-binding sites adjacent to the Raplp-binding site. Finally, Gcrlp binds and

stimulates transcriptional activation either directly or through adapter proteins such as

Gcr2p (Uemura and Jigami 1995) or Gall Ip (Stanway et al. 1994). Thus, there would be

a sequential addition of proteins at the UASTpiI, each necessary to prepare the promoter

for the addition of the subsequent proteins.

This model, if correct, has significant implications for the coordinated control of

transcriptional activation. As will be discussed below, Reblp, Abflp, and Raplp act at

many different genes and appear to perform the role of preparing the regulatory elements

of multiple genes that may need to be coordinately expressed or repressed. Also, Gcr 1 p

acts primarily at glycolytic genes and may be the factor that creates specificity for the

activation of this distinct group of functionally related genes. This provides a nested set

of controls that become progressively more specific. Since the glycolytic genes appear to

be constitutively expressed, it may be that this specific grouping of proteins has evolved

in S. cerevisiae to maintain constitutive expression.

Proteins That Bind at the Upstream Activating Sequences of Glycolytic
Enzyme Genes


Reblp is a highly abundant protein, which is essential for cell viability (Morrow

et al. 1993). Reblp affects transcription at many genes, and as a result it appears to be

important for many cellular functions. This multi-functional nature is further emphasized

by the fact that it affects transcription by both RNA Polymerases I and II. At rRNA

genes, which are transcribed by RNA Polymerase I, Reb 1 p is required for both activation

and termination of transcription (Morrow et al. 1989; Kulkens et al. 1992; Lang and

Reeder 1993). Reblp DNA-binding sites have also been shown at loci transcribed by

RNA Polymerase II including the glycolytic enzyme genes (Figure 1.2), autonomously

replicating sequences (Sweder et al. 1988), and GAL1-GALIO (Chasman et al. 1990).

Such a wide variety of activities suggest that RebIp may provide a very general function

such as preparing promoters for activation by other factors.

The proposal that Reb Ip functions to prepare promoters for transcription

originates from evidence that Reblp cannot activate transcription on its own. Instead it

has been found to potentiate activation by other proteins (Chasman et al. 1990). The

strength of this potentiation was also shown to be distance dependent. Reb I p was once

thought to affect chromatin structure at the GAL1-GALIO locus (Fedor et al. 1988:

Chasman et al. 1990). However, recent data demonstrates that this is not true (Reagan

and Majors 1998)


RebIp does not have binding sites in all glycolytic enzyme gene promoters, and in

these cases it appears that the protein Abfl p may supply the Reb 1 p function (Figure 1.2).

Abflp is another highly abundant protein that has been shown to act at multiple

promoters and is required for cell viability (Buchman et al. 1988a; Rhode et al. 1989).

The Abflp binding-site alone, like the Reblp binding-site, is only capable of weak UAS

activity, but when combined with a T-rich region from the DEDI promoter it becomes a

strong activator of transcription (Buchman and Komberg 1990). This similarity of

function has been further implicated by experiments that show Reblp binding-sites can

functionally replace Abflp binding-sites, and Abflp binding-sites can functionally

replace Reblp binding-sites (Remacle and Holmberg 1992). Thus, both proteins may use

the same common mechanism to fulfill their role in transcriptional activation.

Raplp is also a highly abundant protein that is essential for cell viability (Shore

and Nasmyth 1987; Buchman et al. 1988a; Buchman et al. 1988b). Like Reblp, Raplp is

important in a wide variety of cellular activities including transcriptional activation and

repression (Shore and Nasmyth 1987; Buchman et al. 1988a), maintenance of telomere

length (Chasman et al. 1990), and meiotic recombination (White et al. 1993). Rap Ip has

been shown to be required for transcriptional activation at many genes including the

glycolytic enzyme genes (Figure 1.2), ribosomal genes (Huet et al. 1985), and an ATP-

ase gene (Rao et al. 1993).

Current evidence indicates that Rap I p does not function as the direct or final

activator protein, and instead it likely works through additional activating factors. Rap I p

binding sites act only as very weak activators, but when a Raplp site is adjacent to a CT-

box, activation increases over 10 fold (Buchman et al. 1988a; Bitter et al. 1991). CT-

boxes contain the sequence C(A/T)TCC and are known to be the binding site for Gcr 1 p

(Baker 1991). In vivo footprinting of HBY4, a gcrl deletion strain in which glycolytic

enzyme activities and mRNA levels are greatly reduced (Scott and Baker 1993),

demonstrated that while the Rap Ip-binding site remained occupied, the adjacent CT

boxes were unoccupied. This provided further evidence that Rap I p does not activate

transcription alone, and implied that RapIp is necessary to allow transcription, but that an

additional factor(s) is required for activated transcription. The Rap I p-binding site is

required for wild-type activation of transcription at the TPI] promoter, and there are

Gcrlp sites located adjacent to a RapIp site (Huie et al. 1992; Scott and Baker 1993). In

fact, as seen in Figure 1.2, this close proximity between Raplp- and Gcrlp- binding sites

is a hallmark of glycolytic enzyme UAS elements. Thus, Gcr1p presents itself as the

probable Rap I p-associated activation factor. The same results have been seen at the

pyruvate decarboxylase structural gene (PDC1), where Raplp is required for expression

but is not sufficient for wild-type expression (Butler et al. 1990).

At this time the mechanism for an interaction between RapIp and Gcrl p is

unknown, but there are two leading possibilities: protein-protein interactions and changes

in the DNA conformation at the GcrIp binding-site. Both of these mechanisms could

theoretically create an environment at the Gcrlp binding-site that allows for greater

binding specificity. There is evidence for both of these possibilities. First, using epitope-

tagged proteins, Raplp and Gcrlp have been co-immunoprecipitated, indicating that they

are capable of forming protein-protein contacts in vitro (Tornow et al. 1993). Second, it

has been inferred from circular permutation assays that Rap 1 p creates a sharp bend in

DNA when it binds DNA (Vignais and Sentenac 1989). The crystal structure and

scanning tunneling microscopy of the Rap I p binding domain (aa 361-596) has shown a

200 to 290 bend in DNA containing its binding sequence (Muller et al. 1994; Konig et al.

1996). Scanning tunneling microscopy using full-length Rap Ip demonstrated a mean

DNA bend of 52' (Muller et al. 1994). This bend may change the conformation of

adjacent DNA sequences, including the Gcrlp-binding sites. These two mechanisms are

both consistent with the current model in which Rap I p directs Gcr I p-mediated

activation, and they are not mutually exclusive. However, it is possible that Rap I p also

forms one subunit of an activation surface that also contains Gcr Ip.

Gcrl p

The characteristics of Gcr 1 p are distinctly different from Reb I p, Abfl p, and

Raplp. It is expressed at low levels and is not essential for cell viability (Baker 1986).

Its binding sites have been found primarily at glycolytic enzyme gene and Ty element

promoters (Ciriacy et al. 1991; Turkel et al. 1997; Dudley et al. 1999; Lopez and Baker

2000). HDA experiments comparing the transcriptomes from a wild-type strain and a

gcrl deletion mutant strain demonstrated that 53 open reading frames (ORFs) were gcrl

dependent (Lopez and Baker 2000). Approximately 75% of these 53 ORFs represented

either glycolytic enzyme genes or Ty elements, and there were an additional 14 unrelated

ORFs. The functional importance of Gcrlp at glycolytic enzyme genes was illustrated by

deleting the single copy of GCRJ. Strains that have the gcr] deletion mutation are viable

but grow very slowly and form very small colonies These strains also have a dramatic

loss of glycolytic enzyme activity to below 10% of wild-type for each of the glycolytic

enzymes (Clifton et al. 1978; Clifton and Fraenkel 1981; Baker 1986). This loss of

enzyme activity is believed to be the result of decreased transcriptional activation because

there is a parallel loss of mRNA levels (Clifton and Fraenkel 1981; Scott et al. 1990). In

addition, when individual Gcrlp sites are mutated in specific promoters including TPIJ,

EN02, TDH3, and PGK expression from that promoter is reduced (Chambers et al. 1989;

Bitter et al. 1991; Scott and Baker 1993; Willett et al. 1993). This implicates Gcrlp as an

important regulator of transcription at the glycolytic enzyme genes.

Gcrlp appears to be capable of transcriptional activation when used in isolation.

When fused with the lexA binding domain, Gcrlp was able to activate transcription 116-

fold over the lexA binding domain alone (Scott and Baker 1993). These lexA

experiments utilized a lexA operator that does not contain sites for Reb I p or Rap I p.

Thus, the Gcrlp activity was isolated from the other UASTpII binding factors. Further

evidence for Gcrlp's role as an activator comes from its association with a region of

nuclease hypersensitivity. In a wild-type strain, the promoter of TDH3 is associated with

a large region that is hypersensitive to DNase I, and this hypersensitivity extends from -

560 to -40 relative to the transcription start codon (Pavlovic and Horz 1988). This region

includes a UAS element and a Gcrlp binding site (Bitter et al. 1991) as well as the TATA

box. In a gcr! deletion mutant the size of the hypersensitive region shrinks. The area

from -560 to -370 remains hypersensitive, but the region from -370 to -50 becomes

protected from nuclease digestion (Pavlovic and Horz 1988). They suggested that this

protected region was the result of two nucleosomes that formed over this region, which

includes the TATA box, in the absence of Gcrlp. Whether these positioned nucleosomes

prevent transcription or are just associated with a lack of transcription activity is yet to be

determined, but it has been suggested that the presence of nucleosomes over a TATA box

inhibits binding of the transcription apparatus (Komberg and Lorch 1992).

The DNA-binding characteristics of Gcrl p are also consistent with the sequential

binding model. Gcrlp has a high binding affinity for DNA but a relatively low

specificity for its specific DNA-binding site (Huie and Baker 1996). It has an apparent

dissociation constant (Kd) of 2.9 X 10O for the Gcr I p-binding sequence found at position

-375 of the TPIJ locus. Additionally, there was only a 33-fold difference between the

specific and non-specific binding affinities in competition experiments. For comparison,

the specific and non-specific binding of Rap I p differ by almost six orders of magnitude

(Huie and Baker 1996). Thus, it is hypothesized that Gcrlp requires factors in addition to

DNA sequence to direct binding specificity.

The spatial context of the Gcrl p-binding site relative to the Rapl p-binding site is

important for Gcrlp binding and transcriptional activation (Drazinic et al. 1996). Using a

TPII::lacZ reporter gene, it was shown that if the Rap I p- and Gcrl p-binding sites are

separated by five base pairs, transcriptional activation was virtually eliminated. If the

sites are separated by ten base pairs then transcriptional activation is 50% of that seen

with wild-type spacing. As the sites are further separated at 5 base-pair intervals, there is

a continual decrease in transcriptional activation. The degree of decreased activity is

greater for separations that are a multiple of five and less for those that are a multiple of

ten. At a +30 base-pair interval, activation is approximately 5% of wild-type, which is

still higher than the level of activation seen at the +5 base-pair interval. In vivo

footprinting was also used to investigate the protein binding at these promoters (Drazinic

et al. 1996). In the wild-type construct there was normal protection over the Rap lp- and

Gcrlp-binding sites. In the +5 base-pair construct there was protection at the Rap Ip-

binding site but no protection at the Gcrlp-binding site. In the +15, +20, +25, and +30

constructs there was incomplete and decreasing protection over the Gcr I p-binding site.

Thus, the facilitation of Gcrlp binding is dependent on both the distance from the Rap I p-

binding site and on its rotational positioning relative to Rap Ip.

The close spatial relationship between the RapIp and Gcrlp binding-sites

implicates RapIp as the factor that provides the additional specificity for Gcrlp binding.

There are two possible mechanisms of interaction. First, RapI p could alter the DNA

conformation at the Gcrlp site, and second there may be physical contact between RapI p

and Gcrlp. As noted above, Raplp does cause changes in DNA conformation by

bending the DNA at its binding-site. In addition, there is evidence that Gcrlp itself

causes a small bend when it binds to the DNA (Huie and Baker 1996). This Gcrlp-

induced bending could be significant because it has been shown that proteins that bend

DNA bind to bent DNA with a higher affinity than to unbent DNA (Kahn and Crothers

1992). The second possibility, protein-protein contacts, has been implicated by the co-

immunoprecipitation experiments discussed above (Tomow et al. 1993). The two

mechanisms, DNA conformational changes and protein-protein contacts, are not mutually

exclusive and may both be present.

Non-DNA-binding Proteins That Affect Expression of Glycolytic Enzyme Genes

Although Gcrlp is capable of activating transcription, it is not known whether

Gcrlp interacts with the transcription apparatus directly or whether it operates through

adapter proteins. The genes GCR2 and GAL] encode non-DNA-binding proteins that

are required for wild-type expression of many glycolytic genes (Nishizawa et al. 1990;

Uemura and Fraenkel 1990). As a result these proteins present themselves as possible

adapter molecules. At the present time, the mechanism of their activity is unknown.

Strains that contain deletions of these genes are viable and thus can be used to investigate

their role in transcription.


GCR2 was identified in a screen for mutations that affect expression from the

ENO] promoter (Uemura and Fraenkel 1990). Deletion of GCR2 results in a profound

decrease in glycolytic enzyme activity that is similar to the defects found in gcr] mutant

strains (Uemura and Fraenkel 1990). The mechanism for the glycolytic enzyme defects

appears to be due to defects in transcriptional activation as evidenced by significant

reduction in mRNA levels seen in Northern analysis (Uemura and Fraenkel 1990).

However, the gcr2 mutants do not have as severe a growth defect as gcr] mutants when

grown on glucose containing media at 30C (Uemura and Fraenkel 1990).

Current evidence indicates that Gcr2p acts as a non-DNA-binding adapter protein,

possibly through interactions with Gcr lp. Evidence for an interaction between Gcr l p

and Gcr2p comes from genetic studies (Uemura and Jigami 1992, 1995) utilizing the

"two-hybrid" method of Fields and Song (1989). In addition a Rap I p-Gcr2p fusion

protein partially complements the defects of the gcr] mutation (Uemura and Jigami

1992). Currently there is no evidence that Gcr2p binds DNA. In vivo footprinting in

wild-type, gcri, and gcr2 mutant strains did not provide evidence for a Gcr2p-binding

site within the UASTPIJ element (Scott and Baker 1993; Huie and Baker 1996).

Gall p

Gall lp appears to be a general transcription factor that has been implicated in the

positive and negative regulation of several loci. It is a positive regulator of the GAL

system, MRal, MA Tal, and MA Ta2, and it is a negative regulator of Ty element (Fassler

and Winston 1989). There is also evidence that it interacts with zinc-finger proteins

including Abflp (Stanway 1991; Sakurai et al. 1993). It has also been isolated in

association with the basal RNA polymerase II transcription apparatus (Kim et al. 1994).

It has been suggested that Gal lIp acts as an adapter protein at the UAS elements

of glycolytic enzymes. The primary evidence comes from the PYK1 and PGKJ loci. In a

gall] mutant transcriptional activation from a UASpYKI construct is reduced seven fold

when compared to wild-type (Nishizawa et al. 1990). In addition, mRNA levels for the

PGKJ transcript are reduced two fold in a gall mutant (Stanway et al. 1994).


The process of eukaryotic transcriptional activation is a complex process that

requires interactions between a large number of proteins and protein complexes including

histones, chromatin modifying complexes, transcriptional activators, transcriptional

repressors, mediators, as well as the polymerase complex. The UAS elements of the

glycolytic enzyme genes provide a model of eukaryotic transcriptional activation. More

specifically, they represent an example of a transcription system in which the UAS

elements direct appropriate transcriptional expression from a group of functionally

related genes. This study presents the chromatin structure surrounding the TPIJ gene.

This structure includes an area of distinct nuclease hypersensitivity over the regulatory

promoter elements. It also demonstrates that the transcription factor Gcrl p requires the

simultaneous binding of a second DNA-binding protein, Raplp. This combinatorial

interaction would provide increased specificity to transcriptional activation. Experiments

are presented that investigate which domains within Raplp are required for this


The current evidence supports a stepwise preparation of the promoter region,

which then allows the final activator to bind and direct transcriptional activation. The

UAS elements in yeast glycolytic enzyme genes are structurally similar to the UAS

elements in other yeast genes. They are also similar to the enhancers of higher

eukaryotes. Thus, it is likely that these mechanisms will be present at other non-

glycolytic yeast genes as well as at genes in higher eukaryotes. With greater knowledge

of the UAS/enhancer function it may become possible to modulate the activity of specific

genes or gene families for research, industrial, and medical benefit.



The genotypes for all strains of S. cerevisiae and E. coli used in this study are

described in Table 2.1.

Media and Growth Conditions

Yeast cultures were grown in yeast-peptone (YP) medium (Rose et al. 1990)

supplemented with 2% glucose (YPD) or 2% lactate and 2% glycerol (YP-Gly/Lac).

Unless otherwise noted, liquid yeast cultures were grown at 30'C with shaking. In

experiments involving temperature-sensitive strains, yeast cultures were grown at the

permissive temperature of 24'C.

Unless otherwise noted, E. coli cultures were grown in Luria Broth (LB) medium

(Miller 1972) and, as appropriate, supplemented with ampicillin (LBamp). E. coli

cultures used for growth of phage Ml 3 were grown in Minimal Media 63 (M63)

supplemented with one microgram per milliliter (jig/ml) thiamine hydrochloride, and

25jig/ml amino acids as required (Miller 1972). All E. coli cultures were grown at 37C

with shaking.

Chromatin Mapping by Nuclease Sensitivity

The nuclease sensitivity experiments were based on a method published by Kent

et al. (1993). Nuclease sensitivity patterns have been used most commonly to map the

positions of nucleosomes. Unfortunately, nucleases such as DNase I and micrococcal

nuclease are unable to enter intact cells because they are too large to diffuse through the

Table 2.1. Strains



E. coli




S. cerevisiae









supE, sbcB 15, hasdR4, rpsL, thi, A(lac-proAB) F' [traD36,
proAB+, lacq, lacZAm 15]

hsdR, mcrB, araD139, A(araABC-leu)7679 AlacX74, galU,
galK, rpsL, thi

080dlacZAM 15, A[lacZYA-argF] U 169, deoR, recA 1, hsdR 17,
supE44, thi-1, hyrA96, relA1

MATa, leu2-3, 112, his3A, trp1 -289, ura3-52

MATa, gcrlA::HIS3, leu2-3,112, his3A, trpl-289, ura3-52

MATa, gcr2A::URA3 leu2-3,112 ura3-52

MATa, leu2-3,112, ura3-52

MATt, ade2-1 his3-11,13 trpl-1 ura3-1

MATa, ade2-1 his3-11,13 trpl-1 ura3-1 rapl-2ts

MATa, ade2-1 trpl-1 canl-100 leu2-3,112 his3-11,15 ura3052

MATa, ade2-1 trpl-1 canl-100 leu2-3,112 his3-11,15 gall 1-

cell wall and membrane. This had previously limited their use to the treatment of in vitro

systems and to the treatment of isolated nuclei. The method of Kent et al. (1993) utilized

unlysed yeast cells. To perform the nuclease digestion in vivo it was necessary to

spheroplast and permeabilize the cells. Yeast possesses a cell wall composed primarily of

3(1-3)glucan, (1-6)glucan, and mannoprotein (Guthrie and Fink 1991; Johnston 1994).

This cell wall can be enzymatically disrupted with zymolase, which hydrolyses the poly

3(1-3-glucose) of the cell wall glucan (Guthrie and Fink 1991; Johnston 1994). The lipid

bilayer of the cell membrane was then permeabilized but not disrupted using the non-

ionic detergent NP-40. Permeabilization allowed for rapid sample processing and for less

manipulation of the cell and nucleus than occurred with older methods that utilized

isolated nuclei.

Permeabilization and Nuclease Treatment of Cells

The various strains S. cerevisiae were grown at 30'C with shaking to an

exponential growth phase and harvested at an A600 of 1.0 by centrifugation. Cells were

then washed three times with ddH20. The wet weight of the pellets was measured. The

cells were then resuspended in one ml/g of High DTT Solution (50 mM Tris-

hydrochloric acid (HC1) pH 7.5, 8 mM MgCl2, I M sorbitol, 30 mM dithiothreitol (DTT))

and incubated at room temperature for 5 minutes and then pelleted by centrifugation.

The DTT functions to reduce disulfide bridges in the mannoprotein layer allowing

increased access to the underlying 13(1-3)glucan layer by yeast lytic enzyme (Guthrie and

Fink 1991; Johnston 1994). The cells were then resuspended in three volumes of Low

DTT Solution with yeast lytic enzyme (50 mM Tris-HC1 pH 7.5, 8 mM MgCI2, 1 M

sorbitol, 5 mM DTT, and 200 u/pl yeast lytic enzyme) and incubated at 37C for 30 to 45

minutes. The adequacy of spheroplast formation was determined by observing rapid lysis

when 1 p was mixed with 5 ml ddH20. The spheroplasts were then pelleted by

centrifugation and washed twice in 1 M sorbitol. The spheroplasts were then

resuspended in one volume of Nuclease Treatment Buffer (I M sorbitol, 50 mM NaCI, 10

mM Tris-HCl pH 7.5, 5.3 mM MgC12, 1 mM calcium chloride (CaCI2, 0.3 mM

spermidine, and 1 mM i-mercaptoethanol). The spheroplasts were then aliquoted into

100 jtl volumes that were treated with either MNase or DNase I as described below.

Dilutions of MNase and DNase I were made in Nuclease Treatment Buffer

containing 0.05% Nonidet P-40 (NP-40) (v/v). The MNase concentrations used were 0,

0.006, 0.02, 0.06, and 0.2 units/pl, and the DNase I concentrations used were 0, 0.005,

0.01, 0.02, and 0.04 units/pl. Note that the concentrations of nuclease and NP-40 in each

reaction were actually half of the values described above because in a subsequent step the

nuclease samples were diluted 50% when they were added to the spheroplast samples.

After the nuclease dilutions were prepared, both the spheroplast aliquots and the nuclease

aliquots were pre-heated in a 37'C heat block for 2 minutes. Then the nuclease dilutions

were then added to the spheroplast tubes, gently mixed, and incubated at 37C for 10


The nuclease reactions were stopped by adding 11 tl of 0.5 M EDTA, 11 tl 20%

SDS, and 2.5 pl Proteinase K (20 mg/ml) sequentially. It was not possible to premix the

stop solutions due to precipitation of the SDS. The samples were then incubated at 370C

for 30 minutes followed by centrifugation to pellet the cellular debris. The supematants

were extracted once with phenol and then once again with phenol:chloroform (50:50).

They were then ethanol precipitated.

Several experiments were performed to determine the appropriate concentrations

of NP-40 and nuclease. The degree of nuclease digestion is directly proportional to the

concentrations of both the NP-40 and the nucleases, and the actual concentrations were

made empirically. For a given concentration of NP-40 a series of nuclease dilutions were

tested for their average fragment size when viewed on ethidiumbromide (EtBr)-stained

agarose gel.

Electrophoresis and Southern Transfer

The DNA samples were loaded onto a 1.5% agarose Tris-borate-EDTA (TBE) gel

25 cm in length. The gel was then run at 160 V until the bromophenol blue had migrated

a distance of 21 centimeters. The gel was stained with EtBr and photographed.

The DNA was then transferred to Hybond-N+ nylon membrane by the method of

Southern (Elder et al. 1983; Elder and Southern 1983). The gels were soaked in 0.25 M

HC1 for 30 minutes. They were then soaked in 0.5 M NaOH, 1.0 M NaC1 for 30 minutes.

The transfer buffer used in the Southern apparatus was 0.025 M NaPO4 (pH 6.5). After

transferring overnight for 12-14 hours the nylon membrane was removed and irradiated

in a UV-Stratalinker-1800 (Stratagene) for a total of 1200 X 102 joulese.

Probes, Probe Synthesis, and Hybridization Conditions

The probes used for indirect end-labeling were created by primer extension on

M13 templates. The M13 strains jbsTPImpl 8.2-21 and jbsTPImpl8.2-24 both contain a

4.4 kilobase (kb) HindII fragment from pHB51 (Scott et al. 1990), which contains the

TPII structural gene with surrounding sequence. Strain jbsTPImpl 8.2-21 contains the

non-coding strand, and strain jbsTPlmpl 8.2-24 contains the coding strand. Probes

produced with jbsTPImpl 8.2-21 and HB149 allow visualization of the region upstream

from the BsiHKAI restriction site that is located at nucleotide + 189 relative to the

translation start site of TPIJ. Probes produced with jbsTPImpl 8.2-21 and HB 152 allow

visualization of the region upstream from the KpnI restriction site that is located at

nucleotide +514 relative to the translation start site of TPI1. Probes produced with

j bsTPImp 18.2-24 and HB 149 allows visualization of the regions downstream from the

KpnI restriction site that is located at nucleotide +512 relative to the translation start site

of TPIJ (Figure 1.3).

Primer extension utilizing Klenow fragment was carried out using 2.5 I-tg of

template and 5 pmol of HB54 in a reaction buffer of 20 mM DTT, 10 mM MgC12, 50 mM

Tris-HCl (pH 8.0), 200 mM NaCl, 0.24 mM dNTPs (minus dATP), and 100 [iCi a 32P

dATP. The reaction was incubated at 37C for 45 minutes. The products were then

denatured at 100C and separated on a small preparative sequencing gel. The location of

the single-stranded, radioactive product was localized by brief autoradiography. The

appropriate area of the gel was excised from the gel and manually crushed. The crushed

gel fragment was suspended in 6 ml of hybridization solution (1% BSA, 1 mM EDTA,

[0.5 M Na]HPO4, 7% SDS).

Hybridization was carried out in a rolling drum hybridization chamber. The

membrane was pre-hybridized in hybridization solution at 60'C for 60 minutes. The

solution used for pre-hybridization was poured off, and the 6 ml volume of probe was

added. The membrane and probe were then incubated at 60'C for at least 12 hours. The

hybridized membrane was washed 3-4 times in wash solution (1 mM EDTA, [40 mM

Na]HPO4, 1% SDS) at 60-C.


The Southern blots were exposed to Kodak AR film both with and without a

Lightning Plus (Dupont) intensifying screen.

In vivo Footprinting

In vivo footprinting utilizes one of the four chemical sequencing reactions

originally described by Church and Gilbert (Maxam and Gilbert 1977; Church and

Gilbert 1984). Dimethylsulfate (DMS) methylates DNA at the N7 position of guanine

(G) residues and the N3 position of adenine (A) residues. Because DMS can penetrate

the cellular and nuclear membranes, it was possible to perform this methylation in vivo.

When a protein binds a DNA sequence that contains G residues this methylation will

often be inhibited. Thus, analysis of the methylation patterns produced by DMS

treatment often allows the detection of protein binding at specific DNA sequences. The

procedure described here has been published previously (Huie et al. 1992; Lopez et al.

1993). Additionally, there are several other published descriptions of in vivo footprinting

protocols (Becker and Schutz 1988; Becker et al. 1993; Homstra and Yang 1993).

In vivo Dimethylsulfate Treatment and Preparation of Saccharomvces
cerevisiae DNA

The strains YDS485 and YDS487 were grown at 24C in 500 ml of yeast peptone

dextrose (YPD) with shaking to an optical density (A600) of about one. The cultures were

then concentrated 1 00-fold into 5 ml of clarified YPD. The concentrated cells were

incubated in the clarified growth media under three conditions: 24C, 24C with 10

gg/ml cycloheximide, and 37C for 30 minutes. DMS was then added at a concentration

of either 50mM for the 24C samples or 10mM for the 37C samples. The lower

concentration of DMS used at 37C was used to compensate for the increased

methylation activity of DMS at the higher temperature. Incubation times with DMS are

indicated in the text. The methylation reactions were quenched by the addition of 40ml

ice-cold phosphate buffered saline (PBS) (137 mM sodium chloride (NaCI), 2.7 mM

potassium chloride (KCl), 4.3 mM sodium phosphate (NaPO4), 1.4 mM potassium

phosphate (KPO4), pH 7.4). The cells were then pelleted by centrifugation. The cells

were washed three times with 35 ml ice-cold PBS to dilute out the DMS. The washes

were accomplished by resuspending the cells in ice-cold PBS, pelleting the cells by

centrifugation, and decanting the supernatant in a fume hood.

The genomic DNA was extracted from the DMS-treated cells with a Qiagen-tip

500 following the manufacturer's recommended protocol, as described below. The

washed cell pellet was resuspended in 12 ml Qiagen buffer Y1 (1 M sorbitol, 100 mM

ethylenedinitrilotetraacetic acid (EDTA), 14mM jP-mercaptoethanol) containing 0.4

milligrams per milliliter (mg/ml) yeast lytic enzyme and incubated at 37'C for 60

minutes. Spheroplast formation was confirmed by checking for osmotic lysis in ddH20.

The spheroplasts were then pelleted by centrifugation at 4 krpm for 5 minutes. The

spheroplasts were then resuspended in 12 ml Qiagen buffer G2 (800 mM guanidine

hydrochloride (GuHC1), 30 mM EDTA pH 8, 5% Tween-20, 0.5% Triton X-100) plus

250 microliters (Rt) 10 mg/ml RNase A and 20tl 20 mg/ml Proteinase K. This was

incubated at 370C for 2 hours. The lysate was then poured over a Qiagen-tip 500 that had

previously been equilibrated with Qiagen buffer QBT (750 mM sodium chloride (NaCI),

50mM 3-[N-Morpholino]propane sulfonic acid (MOPS), 15% ethanol, 0.15% Triton X-

100, pH 7.0). The column was then washed twice with 30 ml Qiagen buffer QC (1.0 M

NaC1, 50mM MOPS, 15% ethanol, pH 7.0). The genomic DNA was then eluted with 15

ml of Qiagen buffer QF (1.25 M NaCI, 50mM Tris-HCL, 15% ethanol, pH 8.5).

During the isolation and subsequent processing of the DMS treated DNA, care

was taken that it not be exposed to temperatures in excess of 37C. At temperatures

higher than 37C non-specific cleavage occurs at both the methylated G and methylated

A as a result of uncontrolled apurination (Becker and Schutz 1988). Preferential cleavage

occurs at the G residues during treatment with piperidine as will be described below.

In vitro DMS Treatment of Plasmid DNA

In order to identify areas that were protected from methylation, the DNA that was

methylated in vivo needed to be compared to similar DNA that had been methylated in

the absence of bound proteins. This was accomplished by treating the plasmid pHB51

(Scott et al. 1990) with DMS in vitro. The plasmid pHB51 has bases -3079 to +826 of

the TPIJ locus cloned into the HindIlI site of pUC 18.

Twenty micrograms ofpHB51 were precipitated with ethanol and resuspended in

200ptl of DMS buffer (50mM Na-cacodylate, I mM EDTA pH 8.0). DMS was added to

a concentration of 50mM (1 p ) and incubated at room-temperature for 60 seconds. The

reaction was then stopped by precipitation with of 50 ptl DMS stop solution (1.5 M

sodium acetate (NaAc), I M P-mercaptoethanol) and 750 ptl cold absolute ethanol. The

methylated DNA was pelleted by centrifugation, and the excess DMS was removed by

washing the pellet with 70% ethanol.

Restriction Diaest and Cleavage of Methylated Guanine Residues

Both the genomic DNA samples and the plasmid samples were digested with

Avail, which cleaves at a unique restriction site located 859 base-pairs upstream from the

TPIJ structural gene (Figure 1.3). The Avail-digested DNA was then cleaved at the

methylated G residues by incubating in 2001 1 M piperidine at 100'C for 30 minutes.

Under these conditions the cleavage occurs more rapidly at methylated G residues and

relatively slowly at methylated A residues (Maxam and Gilbert 1977; Becker and Schutz

1988). The piperidine reaction was stopped by precipitation with ethanol. The DNA was

pelleted by centrifugation, and the excess piperidine was removed during washes with

70% ethanol and vacuum drying of the pellet.


The fragments resulting from restriction digestion and piperidine cleavage were

separated on a sequencing gel (7% acrylamide, 0.23% bisacrylamide, 8 M urea, 0.5 X

TBE. The plasmid-derived G ladder was loaded at 4 nanograms (ng) per lane, and the

genomic samples were loaded at either 2 tg or 5 pg per lane as indicated. The gel was

pre-run at 50 V/cm for 30-60 minutes. The samples were denatured at 95'C for 3

minutes in formamide sequencing dye and then loaded onto the gel. After loading the

samples, the gel was run at 50 V!cm until the xylene cyanol had migrated 30 cm.

Transfer of DNA to Nylon Membrane

After electrophoresis was complete, the glass plates were separated, and a piece of

Hybond-N+ (Amersham) was placed on top of the gel. The membrane was used dry and

not pre-wetted. The gel, which adhered to the nylon membrane, was easily lifted off the

glass plate. It was placed membrane down onto two pieces of dry 3MM paper

(Whatman), covered with plastic wrap, and placed on the wire mesh of a Savant gel dryer

(Model SGC4050; Savant Instruments). It was then blotted under vacuum without heat

for 45-60 minutes. The gel sandwich was then placed plastic wrap side down on a 312

nm transilluminator (Fischer Scientific) and irradiated with ultraviolet (UV) light on high

for 10 minutes. The gel was removed from the membrane using ddH20.

Probes, Probe Synthesis, and Hybridization Conditions

The probe used for indirect end-labeling was created by primer extension on an

M13 template. Probes for the AvalI restriction site located at -487 with respect to the

translational start site of TPI1 were prepared from the M13 clone mesTPImpl 8B (Scott

1992), which contains the 5' non-coding region of the TPI1 locus. The primer used,

HB54, is complementary to the sequence at the AvaIl restriction site such that upon

annealing, its 5' end is located at the AvalI site (Huie et al. 1992). Primer extension

utilizing Klenow fragment was carried out using 2.5 lag template and 5 pmol of HB54.

The reaction buffer was composed of 20 mM DTT, 10 mM magnesium chloride (MgC12),

50 mM Tris-HCI (pH 8.0), 200 mM NaCl, 0.24 mM dNTPs (minus dATP), and 100 jiCi

&2p dATP.

The probe was then purified by electrophoresis on a 6% polyacrylamide, 8.3 M

urea, 0.5X TBE gel. The location of the single-stranded, radioactive product was

localized by brief autoradiography. The appropriate area of the gel was excised from the

gel and manually crushed. The crushed gel was suspended in 6 ml of hybridization

solution (1% bovine serum albumin [BSA], 1 mM EDTA, [0.5 M Na]HPO4, 7%

sodiumdodecylsulfate [SDS]).

Hybridization was carried out in a rolling drum hybridization incubator (Robbins

Scientific, Model 310). The membrane was pre-hybridized in hybridization solution at

60'C for 60 minutes. The solution used for pre-hybridization was poured off, and the 6

ml volume of probe was added. The membrane and probe were then incubated at 60'C

for at least 12 hours. The hybridized membrane was washed 3-4 times in wash solution

(1 mM EDTA, [40 mM Na]HPO4, 1% SDS) at 60'C.


The hybridized membranes were exposed to Kodak AR film with one Dupont

Lightning Plus intensifying screen.

DNA Band-Shift Analysis

DNA band-shift analysis, also known as electrophoretic mobility gel-shift

analysis, is an in vitro method used for the study of protein-DNA interaction. The

procedures used in these studies were based on those by Fried and Crothers (1981) and

Garner and Revzin (1981).

Expression Vectors for RAp] and RAPJ-Truncations

Full-length Raplp and several carboxy-terminal and amino-terminal truncations

of RapIp were produced by in vitro transcription and translation from plasmid expression

vectors utilizing the SP6 RNA polymerase promoter. The plasmid pSP56RT7 contains

the entire RAP] coding region and its construction has been described previously

(Chambers et al. 1989). The plasmids pSPRAP361-596 and pSPRAP361-827, contain

truncated forms of RAP! (Figures 2.1 and 2.2). The RAPI truncations were produced by

polymerase chain reaction (PCR). The PCR primers were designed to introduce start and

stop codons at the proper ends of the coding sequences and to introduce restrictions sites

for cloning into the pSP19 multiple-cloning site (McCracken 1985). The 5' end of the

primers was also designed for optimal restriction activity since digestion with restriction

enzymes at the ends of DNA strands is often very inefficient. The cloning enzymes were

chosen by both their presence in the pSP19 polylinker as well as their ability to cut at the

Figure 2.1 Design of RapIp truncation mutants

The RapIp mutations were created with custom oligonucleotides used as primers for
PCR amplification. A. The RAP] structural gene is displayed. It encodes a protein
that has several functional domains including a DNA-binding domain, an asymmetric
bending domain, an activation domain, and a silencing domain. The sites of
complementary annealing for the oligonucleotide primers are indicated. B. The
primers used for amplification contain either an EcoRI or a KpnI site as indicated.
Translation start and stop codons were designed into the sequence as indicated. The
genetic code triplets are bracketed above the sequence, and the associated amino acid
and native position within the wild-type Raplp are indicated. C. The products
produced by PCR amplification were cloned into the polylinker of the expression
vector PS 19. The SP6 promoter and the relative position of the polylinker are

HB 166

1 4.--


=_ Asymmetric DNA-bending domain, aa44-274
= -DNA-binding domain, aa361-596
-Activation domain, aa630-695
= Silencing domain, aa665-827


Coding-strand primer

Start A
EcoRI Codon 361
HB165 5'aaaacg gaattc atg gct

362 363 364
tct ttt aca

365 366
gat gag g 3'

Noncoding-strand primers

HB163 5'cggataacaatttcacacagg 3'

Stop A
Kpnl Codon 596
HB166 5'aaaaaa tgcag tca ggc


595 594
ggc aga

593 592 591
gtt ata att gc 3'



| .....................


pSP56RT7 StuI
1 827 XbaI
1-183 1-127

promoter BglI
361 827 XbaI
SP6 1"2

promoter BglI

361 596


m = Asymmetric DNA-bending domain, aa44-274
= DNA-binding domain, aa361-596
= Activation domain, aa630-695
= Silencing domain, aa665-827

Figure 2.2 RapIp truncation vectors

The Raplp and Raplp truncations were produced by in vitro transcription followed by in
vitro translation. The transcription reaction utilized the SP6 polymerase. There were
three vectors. The plasmid pSP56RT7 contains the entire RAPI coding sequence. An
mRNA encoding full-length Raplp, aal-827, was produced by cleavage with Xbal
followed by run-off transcription. Similarly, mRNAs encoding aal-583, aal-596 were
produced run-off transcription after cleavage with Stul and BglII, respectively. Plasmid
pSPTPI361-827 was created using primers HB 165 and HB 163 as described in Figure 2.1.
An mRNA encoding aa361-827 was produced by cleavage with XbaI followed by run-of
transcription. Plasmid pSPTPI361-596 was created using primers HB165 and HB166 as
described in Figure 2.1. An mRNA encoding aa361-596 was produced by cleavage with
KpnI followed by run-off transcription.

ends of DNA strands as described by New England Biolabs (1996). Additional bases

were included to move the restriction sites away from the very ends of the PCR products.

The PCR template was pSP56RT7, the same plasmid used to express full-length Rap Ip.

The 5' cloning junctions were all confirmed by sequencing with HB 167, and the 3'

cloning junctions were confirmed by sequencing with HB163.

In vitro Transcription and Translation of Rap I p Constructs

Ten micrograms of each DNA template were linearized by incubation with

appropriate restriction enzyme. For pSP56RT7, cleavage with XbaI, Stul, BglI, BstBI, or

BglII resulted in transcripts encoding amino acids 1-827 (full-length), 1-583, 1-596, 1-

677, or 1-701, respectively. The plasmid pSPRAP361-596 when linearized with PstI

resulted in a transcript encoding amino acids 361-596. The plasmid pSPRAP361-827

when linearized with XbaI resulted in transcripts encoding amino acids 361-827,


The templates were then transcribed with SP6 RNA polymerase. The reaction

conditions were 40mM Tris-HCl (pH 7.5), 6 mM MgC12, 2 mM spermidine, 10mM NaCl,

10mM DTT, 0.1 mg/mI BSA, 1 mM ATP, 1 mM CTP, 1 mM UTP, 0.1 mM GTP, 0.5

mM m7G(5")ppp(5')G, 50 units Rnasin, and 2.7 units SP6 RNA polymerase. After

incubating at 370C for 60 minutes, the samples were treated with DNase I for 15 minutes

at 370C, followed by extraction with phenol/chloroform and precipitation with ethanol.

The samples were resuspended in 20gl of ddH20 and incubated at 650C for 15 minutes.

The transcription products were stored at -700C.

The transcription products described above were translated in a Nuclease Treated

Rabbit Reticulocyte Lysate (Promega) with [35S]methionine to radiolabel the resulting

proteins. Two microliters of the in vitro transcribed RNA was combined with 18pil rabbit

reticulocyte lysate, 1 pl Rnasin, 1 pl 1 mM amino acid mixture minus methionine, 2itl

[35S]methionine 10 mCi/ml (Amersham), and 4jpl ddH20. The positive control

translation reaction used 1 p1 of Brome Mosaic virus (BMV) RNA (Promega).

Transcription, Translation, and Purification of Gcrl p(63 1-785)

The Gcrlp binding domain was produced as a malE::Gcrl fusion protein. As

previously described (Enea et al. 1975; Scott and Baker 1993), the E. coli strain TB1 was

transformed with pMAL::GCR1(631-785). This plasmid contains sequence encoding a

malE::GCR1 (631-785) fusion protein that is cloned downstream from a Ptac promoter. A

500 ml culture was grown at 37C to an A600 of 0.5. Then IPTG was added to a final

concentration of 2 mM to induce expression of the malE::GCR1(631-785) fusion gene.

The cultures were grown for an additional 2 hours at 37C and then harvested by

centrifugation. The cells were then resuspended in 3 ml TEN lysis buffer (50 mM Tris

[pH 8.0}, 1 mM EDTA, 50 mM NaCl) per gram of cells. The bacteria were lysed using a

French pressure cell at 20,000 lb/in2 (Clifton et al. 1978). The cellular debris was

pelleted by centrifugation at 17,000 x g for 20 minutes at 4'C. The supernatant was

retained as the crude protein extract.

The MBP-Gcrlp(631-785) was purified by affinity chromatography utilizing an

amylose column. A 2.5 x 10 cm column was packed with 7 cm3 of amylose resin. The

column was washed with three volumes (25 ml) of column buffer (10 mM phosphate, 0.5

MM NaCI, 1 mM azide, 1 mM DTT, 1 mM EGTA) containing 0.25% Tween 20. The

crude protein extract was diluted 1:5 with column buffer containing 0.25% Tween 20.

The diluted lysate was then passed through the column, after which the column was

washed with three volumes of column buffer containing 0.25% Tween 20. The column

was then washed with three volumes of column buffer without Tween 20. The MBP-

Gcrl (631-785) fusion protein was then eluted from the column using 10 nM maltose in 3

ml aliquots. Aliquots of each fraction was visualized via SDS-PAGE with Coomassie

blue staining. The fractions that contained the fusion protein were pooled and

concentrated by ultrafiltration in a Centriprep-30 concentrator (Amicon).

Protein SDS-PAGE and TCA Precipitation of Translation Products

The amount and quality of protein produced in the in vitro translation reactions

was analyzed by both sodiumdodecylsulfate polyacrylamide gel electrophoresis (SDS-

PAGE) and trichloroacetic acid (TCA) precipitation. SDS-PAGE utilized a 3%

acrylanide stacking gel and a 10% acrylamide separating gel. One microliter of each

translation reaction was diluted to 5 g1 in loading buffer, denatured at 100C for five

minutes and then loaded onto the gel that was then run at 20 mA until the bromophenol

blue reached the bottom of the gel. The gel was then vacuum-dried onto 3MM paper

(Whatman) and visualized via autoradiography.

For TCA precipitation, 1 jtl of each translation product was mixed with 50I1 0.1

mM sodium hydroxide (NaOH) and incubated at 37'C for 15 minutes. One milliliter of

cold 10% TCA was added to each sample and then incubated on ice for 60 minutes. Each

sample was then applied to a fiberglass filter that was then washed twice with cold 10%

TCA. The filters were then counted in Scintiverse (Fischer) using a scintillation counter

(Beckman, model LS5801).

Probe Synthesis

The probes were derived from the plasmids YIpCD12 and YIpCD 13 (Drazinic et

al. 1996). The plasmid YIpCD12 contains both a Raplp- and Gcrlp-binding site with the

native PYK1 spacing. The plasmid YIpCD 13 is identical except for the addition of 5

base-pairs between the two binding sites. These probes were used to investigate the

binding interactions between the Gcrlp and the various Raplp species. The plasmids

pCD12 and pCD13 were cleaved with Xhol and Hnel to produce 71 base-pair fragments

that were end labeled with Klenow fragment. The probes were then purified by gel


Binding Reaction

The binding reactions were done in binding buffer (4 mM Tris [pH 7.5], 12 mM

4-(2-hydroxyethyl)-1-piperazine ethanesulfonic acid (HEPES) [pH 7.5], 60 mM Kcl, 5

mM MgCl2, 0.6 mM EDTA, 60pmm DTT, 0.1 mg/mI polydeoxyinosinic-deoxycytidylic

acid (poly(dI-dC)), 0.3 mg/mI BSA, and 50% glycerol). The poly(dI-dC) functions as a

non-specific competitor to inhibit non-specific binding by Gcrlp or the Rap I p constructs.

The DNA probes were diluted to 1 kcpm/Ll in binding buffer. The proteins were diluted,

using binding buffer, such that each sample produced approximately the same amount of

binding activity. Combinations of the probes and proteins, as described in the Results,

were incubated in total volumes of 20til of binding buffer for 10 minutes at room

temperature before loading onto the polyacrylamide gel.


The reaction mixtures were fractionated by molecular weight using

electrophoresis through a non-denaturing 5% T (82:1) polyacrylamide gels using a 0.5X

TBE running buffer, utilizing the Vertical Gel Electrophoresis System (Bethesda

Research Laboratories, Model V16). Before loading, the gels were pre-run at 100V (6.67

V/cm) for 2 hours. After loading the voltage was increased to 150V (10 V/cm). To

monitor the extent of electrophoresis, loading dye (0.25% bromophenol blue, 0.25%

xylene cyanol, and 25% ficoll-400) was added to an empty lane. Band-shifts using the 72

base-pair probes derived from pCD12 or pCD13 were run until the bromophenol blue had

migrated 14 cm through the 15 cm gel. The gels were then vacuum dried onto 3MM

paper (Whatman).

Autoradiography and Phosphorimager Analysis

Dried band-shift gels were exposed to using two Dupont Lightning Plus

intensifying screens. The screen separating the gel and the film served the additional

purpose of blocking most of the 35S signal from the labeled protein.

Phosphorimages were produced using a Phosphorlmager (Molecular Dynamics).

Using the peak finder function it was possible to calculate relative volumes of radioactive

emission for each visible band. Control titrations were also included with each exposure

to demonstrate that the screen maintains a linear absorption over the range of counts

present in the gel (see Figure 2.3).

a a- ii

Sensitivity Noise Min. Area Max. Area Auto Nols Baseline Kernel
64 0.005 0 0 No Automatic 12
Peak # Area Height Percent Vaiance m]ex(mm Separatn
1 26318.24 1946.834 53.259 2.74E+05 19.12 W
2 12233.92 728.794 24.757 4.82E+04 38.8 W
3 5951.062 440.456 12.043 1.63E+04 59.3 W
4 2713.516 192.548 5.491 3.77E+03 78.95 W
5 1237.54 82.024 2.504 &45E+02 98.77 W
8 590.323 39.924 1.196 198E+02 118.77 W
7 232.827 15.475 0.471 3.34E+01 139.3 W
8 83.973 6.212 0.17 4.31E+00 158.95 W
9 36.748 2.997 0.074 .68E-01 178.95 W
10 17.315 1.88 0.035 1.IOE-01 199.5 W

Figure 2.3 Phosphorlmager quantification

The band shift gels were exposed to an Phosphorlmager (Molecular Dynamics) screen.
The image was then decoded and the density of signal was calculated from a line

centered over the signal and with width encompassing the signal. A. This is an example
of a titration of which was used as a control exposure for linearity of the phosphorescent
screen. Each dot represents a progression of 50:50 dilutions. The solid line was place
manually, and dotted lines represent the width of the line in which data were calculated.
B. The signal density for each of the dots is represented graphically. The calculated area
under each curve is displayed in the table. A similar method was used for calculating the
signal density for the bands in the bandshift gels.


Characterization of the Chromatin Structure at TPIJ in Saccharomyces cerevisiae

Chromatin structure has been shown to be an important factor in the

transcriptional activity of many eukaryotic genes. The importance of chromatin structure

should not be different for the glycolytic enzyme genes. As noted in the Introduction, a

hypersensitive site has been demonstrated for TDH3, and this structure changed in the

context of a gcrl mutant. The following experiments were performed in order to

elucidate the wild-type chromatin structure at TPIJ and to see if the gcrl mutation had a

similar effect on the TPI1 chromatin structure as seen previously at the TDH3 locus.

TPIJ was selected to serve as a model in which the promoter/UAS regions were defined

in great detail. In addition, two other mutations that have been shown to effect glycolytic

enzyme gene expression, gcr2 and gall1, were evaluated for alterations in chromatin


Nuclease Sensitivity Patterns at TPJJ in Purified DNA

Since both micrococcal nuclease and DNase I show varying degrees of sequence

specificity, it is necessary to know the cleavage patterns in the absence of nucleosomes or

other bound proteins. Otherwise interpretation of the in vivo pattern can be difficult.

Samples of purified genomic DNA were treated with escalating concentrations of

micrococcal nuclease or DNase I. They were then cleaved at the unique sites BsiHKAI

or KpnI for indirect end-labeling and separated by electrophoresis in a 1.5% agarose gel.

BsiHKAI cleaves within the TPI1 coding sequence at position +185 relative to the

translation start site, and KpnI cleaves within the TPIJ coding sequence at position +511

relative to the translation start site. The DNA that had been fractionated by

electrophoresis was then transferred to a nylon membrane, and indirectly end-labeled

with a radioactive DNA probe. Nuclease treatment of purified "naked" genomic DNA

from the wild-type strain S150-2B produced cleavage patterns at the TPIJ locus that were

consistent with the cleavage characteristics of micrococcal nuclease and DNase I. The

pattern produced by micrococcal nuclease digestion of purified DNA is labeled "wild-

type" in Figure 3.1, lanes 1-3 and Figures 3.2, 3.3, lanes 1-4. The pattern produced by

DNase I digestion of purified DNA is labeled "wild-type" in Figures 3.3 and 3.5, lanes 1-

4. Micrococcal nuclease produced a distinctive pattern that results from this enzyme's

higher affinity for dAodT-rich duplex DNA sequences (Gross 1988). DNase I produced a

more uniform smear, which results from its lower sequence specificity (Gross 1988).

The same nuclease digestion patterns were seen when purified DNA from the strains

HBY4, DFY64 1, and R884-1 C were treated with micrococcal nuclease and DNase I.

These strains contain gcrl, gcr2, and gall1 mutations, respectively. This sensitivity

pattern was used for comparison when evaluating the in vivo treated samples.

Statistically Positioned Nucleosomes are Present Both Upstream and Downstream
from the TPIJ Structural Gene

The wild-type strain S150-2B was treated in vivo with DNase I and micrococcal

nuclease after spheroplasting and simultaneously with permeabilization with dilute NP-

40. They were treated with escalating concentrations of each nuclease. They were then

lysed and their DNA purified. The DNA samples were cleaved at the unique restriction

sites BsiHKAI or KpnI. The DNA fragments were separated by electrophoresis in a

1.5% agarose gel, transferred to a nylon membrane, and indirectly end-labeled using a

Figure 3.1. MNase sensitivity pattern upstream from BsiHKAI

Micrococcal digestion looking upstream from BsiHKAI restriction site. Spheroplasts
permeabilized with NP-40 were treated with increasing concentrations of micrococcal
nuclease. The strains used were S150-2B, HBY4, DFY-41, and R884-IC. They
represent wild-type (lanes 4-7) and the gcrl (lanes 8-11), gcr2 (lanes 12-15), and
gall1 (lanes 16-19) mutants respectively. Purified DNA from the wild-type strain
S 150-2B was used to display the digestion pattern that results from the sequence
specificity of micrococcal nuclease. Lanes 1-3 contain purified genomic DNA that
was treated with increasing concentrations of micrococcal nuclease. Lane 20 contains
a lambda HindIll size marker. The samples, which were treated in situ, are displayed
in groups of four lanes for each strain treated. From left to right each group of four
lanes represents treatment with 0.012, 0.04, 0.12, and 0.4 units of micrococcal
nuclease respectively.

The nuclease sensitivity pattern is interpreted to the immediate right of the
autoradiograph. The ovals are located at regions of nuclease protection and they
represent statistically positioned nucleosomes. The vertical striped box represents an
area of nuclease sensitivity characterized by a digestion pattern identical to that of
purified DNA.

Genetic landmarks are illustrated to the right of the nuclease sensitivity illustration.
The open reading frames for DBF4, YDR051C and TPIJ are represented by black
arrows. The UASTpuJ, TATA, and transcription start site (Tx start) are indicated by a
black box and two black lines respectively.

nuclease treated chromatin
a wild-type gcrlA gcr2A galll-313

[ -- ]Ir -- -- I ------ I
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 1819 20






Tx start


Figure 3.2. MNase sensitivity pattern upstream from KpnI

Micrococcal nuclease digestion looking upstream from KpnI restriction site.
Spheroplasts permeabilized with NP-40 were treated with increasing concentrations
of micrococcal nuclease. The strains used were S 150-2B, HBY4, DFY64 1, and
R884-1C. They represent wild-type (lanes 5-8) and the gcrl (lanes 9-12), gcr2 (lanes
13-16), and gall1 (lanes 17-20) mutants respectively.

Purified DNA from the wild-type strain S 150-2B was used to display the digestion
pattern resulting from the sequence specificity of micrococcal nuclease. Lanes 1-4
contain genomic DNA that was treated with increasing concentrations of micrococcal
nuclease. Lane 21 contains a lambda-HindlII size marker.

The samples, which were treated in situ, are displayed in groups of four lanes for each
strain treated. From left to right each group of four lanes represents treatment with
0.012, 0.04, 0.12, and 0.4 units of micrococcal nuclease respectively.

The nuclease sensitivity pattern is illustrated to the immediate right of the
autoradiograph. The ovals are located at regions of nuclease protection, and they
represent statistically positioned nucleosomes. The vertical striped box represents an
area of nuclease sensitivity characterized by a digestion pattern identical to that of
purified DNA. The vertical empty box represents continued nuclease sensitivity, but
the degree of sensitivity in this area differs in the samples treated with DNasel
(Figure 3.3).

Genetic landmarks are illustrated to the right of the nuclease sensitivity illustration.
The open reading frames for DBF4, YDR051C and TPIJ are represented by black
arrows. The UASrp11, TATA, and transcription start site (Tx start) are indicated by a
black box and two black lines respectively.

nuclease treated chromatin
0 wild-type gcrlA gcr2A galll-313 .

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 1819 20 21





0- TsATA

h -Tx stat


Figure 3.3. DNaseI sensitivity pattern upstream from KpnI

DNaseI digestion looking upstream from KpnI restriction site. Spheroplasts
permeabilized with NP-40 were treated with increasing concentrations of DNaseI.
The strains used were S150-2B, HBY4, DFY641, and R884-1C. They represent
wild-type (lanes 5-8) and the gcrl (lanes 9-12), gcr2 (lanes 13-16), and gall] (lanes
17-20) mutants respectively.

Purified DNA from the wild-type strain S 150-2B was used to display the digestion
pattern that results from the sequence specificity of micrococcal nuclease. Lanes 1-4
contain genomic DNA that was treated with increasing concentrations of DNase.
Lane 21 contains a lambda HindIII size marker.

The samples that were treated in situ are displayed in groups of four lanes for each
strain treated. From left to right each group of four lanes represents treatment with
0.01, 0.02, 0.04, 0.08 units of DnaseI respectively.

The nuclease sensitivity pattern is illustrated to the immediate right of the
autoradiograph. The ovals represent statistically positioned nucleosomes. The
vertical striped box represents an area of nuclease sensitivity, which is characterized
by a digestion pattern identical to that of purified DNA. The vertical empty box
represents continued nuclease sensitivity, but the degree of sensitivity in this area is
less than that seen in the are represented by the striped box.

Genetic landmarks are illustrated to the right of the nuclease sensitivity illustration.
The open reading frames for DBF4, YDR051C and TPIJ are represented by black
arrows. The UASTPIj, TATA, and transcription start site (Tx start) are indicated by a
black box and two black lines respectively.

-< nuclease treated chromatin
wild-type gcrlA gcr2A gall 1-313 -
I 1 -- I I
1 2 3456 78 9101112131415161718192021




Tx start


Figure 3.4. MNase sensitivity pattern downstream from KpnI

Micrococcal nuclease digestion looking downstream from KpnI restriction site.
Spheroplasts permeabilized with NP-40 were treated with increasing concentrations
of micrococcal nuclease. The strains used were SI 50-2B, HBY4, DFY64 1, and
R884-1C. They represent wild-type (lanes 5-8) and the gcrl (lanes 9-12), gcr2 (lanes
13-16), and gall 1 (lanes 17-20) mutants respectively.

Purified DNA from the wild-type strain S150-2B was used to display the digestion
pattern, which results from the sequence specificity of micrococcal nuclease. Lanes
1-4 contain genomic DNA that was treated with increasing concentrations of
micrococcal nuclease respectively. Lane 21 contains a lambda-HindlIl size marker.

The samples that were treated in situ are displayed in groups of four lanes for each
strain treated. From left to right each group of four lanes represents treatment with
0.012, 0.04, 0.12, and 0.4 units of micrococcal nuclease respectively.

The nuclease sensitivity pattern is illustrated to the immediate right of the
autoradiograph. The ovals represent statistically positioned nucleosomes. The
vertical striped boxes represent areas of nuclease sensitivity which were characterized
by a digestion pattern identical to that of purified DNA.

Genetic landmarks are illustrated to the right of the nuclease sensitivity illustration.
The open reading frames for YDRO49 Wand TPI1 are represented by black arrows.
The asterisk represents the location of a putative poly(A) signal sequence.

nuclease treated chromatin
Z wild-type gcrlA gcr2A gall1-313
1 2 3 4 5 6 7 8 9 10 11 12 1314 15 16 17 18 19 20 21

i! fo



Figure 3.5. DnaseI sensitivity pattern downstream from KpnI

DNaseI digestion looking downstream from KpnI restriction site. Spheroplasts
permeabilized with NP-40 were treated with increasing concentrations of DNaseI.
The strains used were S150-2B, HBY4, DFY641, and R884-1C. They represent
wild-type (lanes 5-8) and the gcrl (lanes 9-12), gcr2 (lanes 13-16), and gall 1 (lanes
17-20) mutants respectively.

Purified DNA from the wild-type strain S 150-2B was used to display the digestion
pattern, which results from the sequence specificity of DNaseI. Lanes 1-4 contain
genomic DNA that was treated with increasing concentrations of DNasel. Lane 21
contains a lambda-HindIII size marker.

The samples, which were treated in situ, are displayed in groups of four lanes for each
strain treated. From left to right each group of four lanes represents treatment with
0.01, 0.02, 0.04, 0.08 units of DNaseI respectively.

The nuclease sensitivity pattern is illustrated to the immediate right of the
autoradiograph. The ovals represent statistically positioned nucleosomes. The
vertical striped boxes represent areas of nuclease sensitivity which were characterized
by a digestion pattern identical to that of purified DNA.

Genetic landmarks are illustrated to the right of the nuclease sensitivity illustration.
The open reading frames for YDRO49W and TPIJ are represented by black arrows.
The asterisk represents the location of a putative poly(A) signal sequence.

nuclease treated chromatin
wild-type gcrlA gcr2A gall 1-313
.... 1 .. m _
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 1819 20 21


: I


radioactive DNA probe. Both enzymes produced distinct ladders of nuclease protections

with intervening areas of nuclease sensitivity. The micrococcal nuclease pattern of S 150-

2B is seen in Figure 3.1, lanes 4-7 and Figure 3.2, lanes 5-8, and the DNase I pattern is

seen in Figure 3.3, lanes 5-8.

Extending upstream from the 5' end of the UASTpu element there is a ladder of

alternating areas of nuclease sensitivity and protection. There are seven protected areas.

After the seventh area of protection the micrococcal nuclease pattern changes subtly, and

then it continues for what appears to be an additional four areas of nuclease protection.

In the DNase I samples, the area, which had the pattern change, demonstrated a small

region of nuclease hypersensitivity (Figure 3.3). This transition is spatially related to the

5' end of the open-reading frame YDR05 1 C and the 3' end of the DBF4 gene (Chapman

and Johnston 1989; Cherry et al. 1998). It is noted that the ladder of nuclease protections

lies over the coding sequence for open-reading frame YDR05 1 C. The average repeat

length for the seven areas of protection is 170 base-pairs. This is slightly longer than the

known repeat length of 160 base-pairs for S. cerevisiae (Bernardi et al. 1991; Thoma


There is an area of hypersensitivity that extends from the 5' end of the UASTp/1

element to the transcription start site. This is best seen in the DNase I samples (Figure

3.3, lanes 5-8), but it is also seen in the micrococcal nuclease samples (Figure 3.2, lanes

5-8). This area of hypersensitivity is consistent with a nucleosome-free region.

There is also some nuclease protection located over the TP11 structural gene.

Both micrococcal nuclease and DNase I sensitivity patterns over the coding sequence are

identical to that seen in the "naked" DNA samples, but the intensity of these bands is less

in the in vivo treated samples. This implies a modest, although incomplete nuclease

protection. However, the intensity of the bands are less than that seen over the upstream

promoter region. This protection over the structural gene is also more evident in the

DNase I samples (Figure 3.3).

Extending downstream from the TPIJ gene, a second ladder of nuclease

protections is identified by micrococcal nuclease digestion (Figure 3.4, lanes 5-8). It is

also seen faintly in the DNase I digested samples (Figure 3.5, lanes 5-8). This ladder of

nuclease protections with intervening nuclease sensitivity extends for at least nine areas

of protection. After the ninth area of protection, the pattern becomes less clear due to the

sequence specificity of micrococcal nuclease, but the nuclease sensitivity pattern may

continue for another four more cycles before the next KpnI cleavage site prevents further

evaluation. This is consistent with at least nine and possibly 13 positioned nucleosomes

extending away from TPIJ in the 3' direction. These have an average size of 160 base-

pairs. This downstream ladder of nuclease protections overlie an ORF designated

YDR049W (Cherry et al. 1998).

Nuclease Sensitivity Patterns Are Not Affected By Mutations In gcrl. gcr2, or gall I

The strains containing the mutations gcrlA, gcr2A, and gallI-313 were treated in

vivo with micrococcal nuclease and DNase I in a manner identical to that described above

for the wild-type strain S1 50-2B. As described in the introduction, all three of these

mutations have been shown to affect the level of transcription of glycolytic enzyme

genes. There does not appear to be any significant difference in the nuclease sensitivity

patterns seen either upstream or downstream from the TPIJ structural gene (Figures 3. 1,

3.2, 3.3, 3.4, 3.5).

Raplp Binding is Required for Binding of Gcrlp at TPI] in vivo

An in vivo dimethylsulfate (DMS) methylation protection assay was used

investigate the hypothesis that RapIp is required for Gcrl p binding at the UAS TpI. This

assay is commonly referred to as in vivo footprinting. In vivo analysis of the

hypothesized Rap lp/Gcrlp interaction at the TPIJ locus required a conditional mutation

in RapIp because both RapIp and triosphosphate isomerase are essential proteins. For

this study the RAP1 allele rap1-2' was used. It is one of a collection of temperature

sensitive (ts) alleles of RAP] that were isolated and characterized by Kurtz and Shore

(1991). They demonstrated that upon a shift to the non-permissive temperature of 37C,

the rap]-2's protein no longer binds the RapIp DNA-binding site. The isogenic strains

used in this study were YDS485, containing wild-type RAP], and YDS487, containing

the rap1-2's allele.

DMS Footprinting at the Permissive Temperature Demonstrated Protection at All
Known Binding Sites

Previous DMS footprinting of TP11 had been done at 30'C (Huie et al. 1992;

Lopez et al. 1993). Thus, it was necessary to demonstrate that culture growth and DMS

treatment at 24C, the permissive temperature for YDS487, do not affect protein binding.

Cultures of YDS485 and YDS487 were grown at 24C to log-phase at an A600=1,

harvested and treated with DMS at 24C. Purified DNA samples from these treated cell

were digested at the unique site Avail and then treated with piperidine at 95'C for 30

minutes to cleave DNA at the guanine residues methylated by DMS. The DNA

fragments were then separated on a sequencing gel and transferred to nylon membrane.

Indirect end-labeling demonstrated protection over the known binding sites for Reb I p,

Raplp, and Gcrlp (Figure 3.6, lanes 3 and 6).

Figure 3.6 In-vivo footprint analysis at the UASTPIJ

In-vivo footprint analysis at TPIJ in wild-type and rap]-2ts mutant strains. In vivo
guanine methylation protection assays of the UASTPI1 were performed in the wild
type strain S 150-2B and the rapl-2ts mutant strain YDS485 at permissive and non-
permissive temperatures and while inhibiting protein synthesis with cycloheximide.

Lanes 1,2,8, and 13 contain samples prepared by DMS methylation of purified DNA.
These reference lanes display all the guanine residues in the sequence. Lane 3
contains YDS485 DNA that was treated in vivo with DMS for 5 minutes at 24C
after a 30 minute incubation at 24'C. Lanes 4 and 5 contain YDS485 DNA that was
treated in-vivo with DMS for 5 minutes at 37C after a 30 and 60 minute incubations
respectively at 37'C. Lanes 6 and 7 contain YDS485 DNA that was treated in vivo
with DMS for 2 minutes at 24'C and 37C after 30 minute incubations at 24'C and
37C respectively. Lanes 9 and 10 contain S150-2B DNA which was treated in vivo
with DMS for 5 minutes at 37C after a 30 minute incubation at 37C. Lanes 11 and
12 contain YDS485 DNA that was treated in vivo with DMS for 5 minutes at 24'C
after a 30 minute exposure to 10 pig/ml cycloheximide.

The sequencing reactions and in-vivo footprints were resolved by electrophoresis on
denaturing polyacrylamide gels, transferred to Hybond-N+, and visualized after
indirect end-labeling by autoradiography. The positions of Reb Ip binding sites
(stippled ovals), Gcrlp-binding sites (open ovals), and Raplp-binding sites (closed
ovals) are indicated.

1 2 3 4 5 6 7 8 9 10 11 12 13


Gcrlp 8 S

Gcrlp 8
R ap lp~ti .....................

Grelp 0 !iiiil~

G G Rap U UU G U U G

Rap l-2t= RAP]

DMS Footprinting at The Non-permissive Temperature Demonstrated Loss of Protection
at Both the Raplp- and Gcrlp-binding Sites

DMS treatment was performed at the non-permissive temperature to investigate

what effects the loss of Raplp binding would have on the binding of Gcrlp. Cultures of

YDS485 and YDS487 were again grown at 24C to an A600=l. Aliquots of these cultures

were then incubated at 37C, the non-permissive temperature, for 30 minutes and then

treated with DMS at the same temperature. The DNA was then isolated and processed as

described above. Indirect end-labeling demonstrated a loss of protection over both the

Raplp- and Gcrlp-binding sites in the YDS487 sample treated at 37'C (Figure 3.6, lanes

4, 5, and 7). This loss of protection indicated that RapIp and Gcrlp are not bound to

their sites. Notably, deprotection at these sites did not occur when the isogenic wild-type

strain YDS485 was treated under the same 37*C conditions (Figure 3.6, lanes 9 and 10).

This indicates that the deprotection was specific to the rap1-2 mutation and not the

strain background. Previous experiments have shown that RapIp remains bound in the

absence of Gcrl p (Huie et al. 1992). Thus, the in vivo binding of Gcrl p was dependent

on the binding of Raplp at an adjacent site within the UASTpIJ, but the binding of Raplp

is not dependent on Gcrlp.

Inhibition of Protein Synthesis Does Not Affect DMS Protection at the GcrI -
Binding Site

Cycloheximide was used to demonstrate that the loss of Gcr I p-binding was not

due to changes in protein synthesis. The transfer of a YDS487 culture to 37C is an

irreversible and terminal event. If the culture is returned to 241C, it does not resume

growth. Thus, one possible explanation for the loss of Gcrlp binding was that cell death

associated with the shift to the non-permissive temperature resulted in the cessation of

protein synthesis. It was possible that if protein synthesis ceased, the intracellular

concentration of Gcrlp might drop, and Gcrlp dissociation would occur by a shift in

mass action equilibrium rather than a loss of Rap 1 p facilitation. To test this, the wild-

type YDS485 strain was grown at 24'C until a density of A600=l had been reached. The

cells were then treated with cycloheximide for 30 minutes at a concentration (101ag/ml)

adequate to arrest growth. Cycloheximide inhibits protein synthesis by preventing

polypeptide elongation (Ferguson et al. 1967). The standard DMS footprinting protocol

was then performed. Indirect end-labeling of the resulting blot demonstrated that the

binding sites for RebIp, Rap ip, and Gcrlp remained protected (Figure 3.6, lanes 11 and

12). This protection indicates that inhibition of protein synthesis did not affect the

binding equilibrium of these proteins.

The timeline of these experiments suggests that these changes are a direct result

of Rap Ip dissociation rather than secondary to other cellular events such as DNA

replication and the process of cell division. In the experiments presented here the

deprotection was evident after 30 minutes of incubation at the non-permissive

temperature. The shortest incubation time performed was 20 minutes, which also

demonstrated Raplp-dependent protection over the Gcrlp-binding site (not shown). This

interval is much shorter than the two hour doubling time for the wild-type strain grown at

30'C or four hours for the mutant strain when grown at 240C.

Raplp Facilitates the Binding of Gcrlp in vitro

Having shown that RapIp was required in vivo for the binding of Gcrl p, in vitro

electrophoresis mobility gel-retardation analysis was used to characterize this binding

dependence further. The mobility retardation assay, also known as a band-shift, was

utilized to compare Gcrlp binding with and without RapIp present in the binding

reaction. In these experiments a DNA probe was pre-incubated with the proteins of

interest to allow binding. The mixture was then separated by electrophoresis through a

non-denaturing polyacrylamide gel. Electrophoresis separates the bound from the

unbound probe because the protein-bound probe has a higher molecular weight and

migrates more slowly through the gel matrix. If one binding protein is present in the

binding reaction there would be two bands produced: 1) free probe and 2) protein bound

probe. If two binding proteins were present in the binding reaction there would be four

bands produced: 1) free probe, 2) probe + protein-i, 3) probe + protein-2, and 4) a ternary

complex of probe bound by both proteins.

The ability of one protein to facilitate the binding of another can be tested by

comparing the amount of probe shifted by each protein alone to the amount of probe in

the ternary complex, which is produced when both proteins are present in the same

reaction. If the two proteins bind independently and no facilitation occurs then they

should produce a ternary complex whose radioactive signal equals the multiplication

product of the radioactive signals produced when each protein is incubated alone.

Conversely, if facilitation does occur then the radioactive signal of the ternary complex

would be greater than this multiplication product.

The end-labeled DNA probes used in these experiments were modeled after the

sequence of the UAS element of PYK1 (Drazinic et al. 1996). One probe was derived

from pCD12, which includes the binding sites for Raplp, and Gcrlp as found at the UAS

element of PYK1. A second probe was derived from pCD 13 in which the same Rap Ip-

and Gcrlp-binding sites were separated by five base-pairs. Separation of the two sites by

five base-pairs has been shown qualitatively to decrease the binding of Gcr 1 p both in vivo

and in vitro footprinting (Drazinic et al. 1996).

The Gcrlp used in these experiments is a fusion between the Maltose-Binding

Protein (MBP) and the DNA-binding domain of Gcrlp (MBP::GCR1631.785). It was not

possible to utilize full-length Gcrlp because of its instability. This instability has been

seen when MBP-Gcrlp.785 has been synthesized either in E. coli or in rabbit reticulocyte

lysate systems (Huie and Baker 1996), and as a result it has not been possible to purify

full-length Grc I p for use in vitro experiments.

The RapIp species used in these experiments included full-length RapIp as well

as amino- and carboxy-terminal truncations. As displayed in Figure 3.7, the amino-

terminal truncation deletes the asymmetric DNA-bending domain (Muller et al. 1994),

and the carboxy-terminal truncation deletes the transcriptional activation domain (Sussel

and Shore 1991), and the transcription silencing domain (Sussel and Shore 1991). If both

ends are deleted only the minimal DNA-binding domain remains (Henry et al. 1990).

The Gcrlp and RapIp proteins produced discrete, single band-shifts when used

alone, and they produced discrete, single ternary complexes when used in combination.

The DNA probe alone produced a single band (Figure 3.7, panel b, lane 1). The

individual addition of each of the proteins Gcrlp, Rap1 P361-596, Rap1P36i-827, Rapl p 1-596,

and Raplp1.827 produced a single shifted band (Figures 3.7 and 3.8, panel b, lanes 2, 4, 5,

7, 9, and 11, respectively) in addition to the free probe. When Gcrlp was combined with

each individual Rap Ip species an additional band representing the ternary complex was

seen in each case (Figure 3.7, panel b, lanes 6, 8, 10, and 12).

Figure 3.7 Bandshift of Raplp and Gcrlp using native spacing.

A. The drawing is represents the RapIp protein and highlights its functional
domains. This panel also displays the four RapIp species used in the bandshift
analysis. B. This is an autoradiograph of the in vitro bandshift gel in which Gcrlp
was incubated with and without the four RapIp species. Lanes I and 2 show
unbound probe and probe bound by Gcrlp respectively. Lane 3 contains probe and
BMV proteins translated in vitro using rabbit reticulocyte lysate. Lane 4 is the same
as lane 3 with the addition of Gcrlp. Lanes 5 12 all contain probe and Gcrlp with
the addition of the indicated RapIp species in lanes 6, 8, 10, 12. The bands
representing probe bound by Gcrlp are indicated by the empty arrow to the right of
the autoradiograph, and the bands representing the various Rap I p species are
indicated by filled arrows to the right of the autoradiograph. The ternary complexes
are indicated by black dots on the autoradiograph. C. This is a table that displays the
phosphorimage data collected using a Molecular Dynamics Phosphorlmager. The
data in this table is in phosphorimager units.


44 274 361 596630 695

665 827
11111 =Asymetric DNA-bending domain, aa44-274
.' -DNA-binding domain, aa361-596
Activation domain, aa630-695
Silencing domain, aa665-827

Rap Ip(1-596)

Rap I p(I-827)

Rap lp(361-827)

Gcrip RapIp RapIp RapIp
(631-785) BMV (361-596) (361-827) (1-5%)
+ r+ -I- + +


- Raplp (1-827)
- Raplp (1-596)

- Raplp (361-827)
~ Gcrlp (631-785)

Raplp (361-596)

- Free probe

Rapip Rapip Gcrlp Ternary Free Total counts Ternary -Gcrip free Gcrlp RapIp Free Rapip Expected Act./Exp Avg.
construct peak peak peak probe in lane % alone probe % alone probe % Gcrlp
361-596 1464 1878 661 6520 10522 6.3% 2546 9786 26.0% 2042 8552 19.3% 5.0i 1.3 1.5
1739,__1664_ 852 6074_ 8591' 9.9'4 2262 9713 23.3% 2992 862 25.7% 60% 17
527 585 266 2133 3511 7.6, 769 3294 23.4% 756 2870 20.9% 4.9% 1.6
361-827 2533 979. 1985 4145- 9643, 20.6% 2546 9786 26.0%i 3820 7019-352%4 9.2% 2. 2.4
2140 12W60_ 1729) 4530 7518 23.0% 2262 9713 23.3% 344 689 33.3% 7,8% 3.0
522 481 318 2023 33441 95% 769 3294 23,% 711 2617 21.4%1 50%' 1.9
1I-596 1-387: 1889 1910 6 7 12 119 16.1%/ 2546 9786126.0%, 2417T 9541~ 20 2%' 5.3%' 3. 3.3
1162 1578 1890 6273i 9741 19.4% 2262 9713 23.3% 2916 9004 24.5% 57% 3.4
369 535' 5 27 2087 3519, 150% 769 3294 23.4%x 684 2852: 193%:: 4.58 3.3
1 827 1633 1482 1668 5702' 10484 15.9% 2546 9786 26.0% 2620 7619 25.6%/, 6 7/, 2.f4_3.2
1213 1462 1164 6324 8950 13.0 2262 9713 23.3 1W 2 919f 15,.2 3.% 37
363 497 324 2120. 2941 110%1 769 3294 234% 456 2873 13.7%' 32 3.4

'41, -AkA.AA.A

Figure 3.8. Bandshift of RapIp and Gcrlp +5 basepairs separation

A. The drawing is represents the RapIp protein and highlights its functional domains.
This panel also displays the four Raplp species used in the bandshift analysis. B.
This is an autoradiograph of the in vitro bandshift gel in which Gcrlp was incubated
with and without the four RapIp species. Lanes 1 and 2 show unbound probe and
probe bound by Gcrlp, respectively. Lane 3 contains probe and BMV proteins
translated in vitro using rabbit reticulocyte lysate. Lane 4 is the same as lane 3 with
the addition of Gcrlp. Lanes 5-12 all contain probe and Gcrlp with the addition of
the indicated RapIp species in lanes 6, 8, 10, 12. The bands representing probe
bound by Gcrlp are indicated by the empty arrow to the right of the autoradiograph,
and the bands representing the various Raplp species are indicated by filled arrows to
the right of the autoradiograph. The ternary complexes are indicated by black dots on
the autoradiograph. C. This is a table that displays the phosphorimage data collected
using a Molecular Dynamics Phosphorlmager. The data in this table are in
phosphorimager units.

Full Text
xml version 1.0 encoding UTF-8
REPORT xmlns http:www.fcla.edudlsmddaitss xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.fcla.edudlsmddaitssdaitssReport.xsd
INGEST IEID E6I0QM8ZO_RM9N5Q INGEST_TIME 2014-07-24T00:12:51Z PACKAGE AA00022160_00001




ACKNOWLEDGMENTS The support of a great many people made the completion of this document and its associated work possible. I would first like to acknowledge and thank my wife Lucia, and my son Alec for their love patience, and support through the completion of my graduate studies. Without their sacrifice and support this document might ne ve r have been completed. I would also like to recognize my parents Glen and Barbara Smerage. Their love and encouragement have not only helped me through graduate school but they are also largely responsible for the development of my curiosity and love of learning. I would also like to thank and recognize the lab of Dr. Henry Baker which has also been an essential component of my graduate experience. The encouragement and direction provided by Dr. Baker has been an invaluable resource in my growth and education. Many current and past members of Dr. Baker s lab have also had a significant impact on the successful completion of this project. These include Dr. Lucia Eisner Smerage Ms Cecilia Lopez Dr. Carolyn Drazinic and Dr. Michael Huie. My graduate committee has also been instrumental in my graduate experience The members include Dr. Henry Baker (Chairman), Dr. Daniel Driscoll Dr. Alfred Lewin Dr. Harry Nick and Dr. Thomas Yang. The time that they have dedicated to my education and personal development is greatly appreciated I have enjoyed the multitude of discussions committee meetings as well as data and document re iews which they so generously pro vi ded Their advice and insight into the developm e nt of an 11


academic career will be invaluable as I continue to further my own career and personal research direction. Dr. Donna Duckworth also deserves special recognition for her participation in the defense of my dissertation and for her advice and friendship over these years. lll


TABLE OF CONTENTS ACKNOWLDGMENTS LIST OF FIGURES ........................................................................................................ vi KEY TO SYMBOLS AND ABBREVIATIONS .. ..... ............ ... ..... ............. .................. vii ABSTRACT .................................................................................................................. ix INTRODUCTION .... ... ...... ... ..... ...... ................. .. .. ........ ..................... .. ...... ... ..... .......... 1 The Basal Transcription Apparatus .............................................................................. 3 Enhancer Structure and Function ... ........... .............. .... ............ .. ........................ ......... 9 Chromatin and Nucleosomes as Regulators of Transcription ........ ...... ...... ............... 12 Transcription and Saccharom yces cerevisiae ......... .... ... .. .......... ........ ....... ...... ........... 26 Summary ......... ........... ........ .......... ... ................................................................. .... .... 44 MATERIALS AND METHODS ................................................................................... 46 Strains ....................................................................................................................... 46 Media and Growth Conditions ............... ................................... ................................ 46 Chromatin Mapping by uclea e Sensitivity .............................................. .............. 46 In vivo Footprinting ................................................................................................... 52 DNA Band-Shift Analysis .............. ..... ... ......... ............ ....... .................. ... .......... ...... 57 RESULTS ..... ... .... ... ....... ........ ......... ......... .......... ... ....... . ........... ...... .. ............ ...... ...... 67 Characterization of the Chromatin Structure at TPII in Saccharom yces cerevisiae .. 67 Raplp Binding is Required for Binding of Gcrlp at TPII in vivo ........ .... .................. 81 Rap l p Facilitate s the Binding of Ger 1 p in vitro ..... ...... ........ .... ....................... .......... 85 iv


DISCUSSION ..... ..... .. .. .. ... .. ...... ....... ......... ................ ........................... ........ . ...... ... ... 96 Gerl p Binding Depends on the Presence of Rap l p .............. . .. ........... ....... . ..... ..... ... 96 The N-terminus and C-terminus of Raplp Both Facilitate the Gcrlp Bindin g Specificity ................ .. .......... ....... ......... .............. ..... ..... ......... ... ......... . ........... .. .. 98 Rap 1 p Mediated Ger 1 p Binding Is Distance Dependent ............ .... .. .. .......... .. .......... 100 TPII Is Located Within a Permissive Nucleosome Environment.. ...... ...... ................ 101 TPIJ Chromatin Structure Is Not Affected By Mutations in GCRI GCR2 or Gall 1 .... .. .. .. ..... .... .... ........... .. ............. .. ... .................... .. .. ...... ...... ............. ..... .. 104 Chromatin Structure At Sunmmding Open Reading Frames ........ .. ......... ...... ...... .. ... I 05 Model of Glycolytic Enzyme UAS Function .... ............... . ... .. .. ................ ........ ..... 105 REFERENCES .... ... ... .. ................ ... .. . .. .. ......... .. ......... .. .. .. ... ... ... . ...... ..... ........ ..... 108 BIOGRAPI-IICAL SKETCH ..... ...... ... .. .... ............ .. .. ........ .............. .. ... .......... ... .... .. .. 1 3 0 V


LIST OF FIGURES Figure Page 1.1 The glycolytic pathway ................................. ..... ................ .... .... ......... 28 1.2 Glycolytic UAS elements ............................................................ ......... 32 1.3 Glycolytic UAS elements ..................... ............................................... 34 2.1 Design of Raplp truncation mutants ....................................... .. ........... 59 2.2 Raplp truncation vectors ..................................................................... 60 2.3 Phosphorimager quantification ....................................... ........ .............. 66 3.1 MNase sensitivity pattern upstream from BsiHKAI ..... ... ..................... 70 3.2 MNase sensitivity pattern upstream from Kpnl .................................... 72 3.3 DNaseI sensitivity pattern upstream from Kpnl ... ................................. 74 3.4 MNase sensitivity pattern downstream from Kpnl ............................... 76 3.5 DNaseI sensitivity pattern downstream from Kpnl ................... ... ....... .. 78 3.6 In vivo footprint analysis at the 3.7 Bandshift of Raplp and Gcrlp using native spacing .................. ..... ..... 89 3.8 Bandshift ofRaplp and Gcrlp at +5 basepairs separation . ....... .......... 91 3.9 Summary ofbandshift data for native and +5 spacing .......................... 94 4.1 Summary of the TPil chromatin and promoter structures ............... ... 103 vi


A A600 BMV BSA CaC12 ChiP CTD D DMS DNA DTT E.coli EDTA EtBr G GCRI Gcrlp GCR2 Gly/Lac GTF GuHCl HCl HDA HEPES IPTG kb KCl KP04 lacZ LB LBamp LTR M63 MBP Mda mg mg/ml MgCl2 ml KEY TO SYMBOLS AND ABBREVIATIONS adenine Spectrophotometric absorbance at 600nm Brome Mosaic Virus bovine serum albumin calcium chloride chromatin irnrnunoprecipitation carboxy-terrninal domain dextrose/glucose dimethy lsulfate deoxyribonucleic acid dithiothreitol Escherichia coli ethy lenedinitrilotetraacetic acid ethidium bromide guanine gene encoding the yeast Glycolysis Regulation protein Glycolysis Regulation protein gene encoding the yeast Glycolysis Regulation protein number two glycerol lactate general transcription factor guanidine hydrochloride hydrochloric acid high-density oligonucleotide array 4-(2-hydroxyethy 1)-1-piperazineethanesulfonic acid isopropylthiogalactoside kilobase potassium chloride potassium phosphate E. coli gene encoding 13-galactosidase Luria broth Luria broth with ampicillin long terminal repeat minimal media 63 (media) maltose-binding protein megadalton milligram milligram per milliliter magnesium chloride milliliter vii


MMTV MNase MOPS g g/ml l NaAc NaCl ng NaOH NaPO4 NP-40 ONPG ORF PBS PCR Pol II poly( dl-dC) RAPl Raplp REBl Reblp raplts SAGE S. cerevisiae SDS SOS-PAGE TAF TBE TBP TCA TE TPil Tris-HCl UAS URA3 UV X-gal yp YPD YP-Gly/Lac mouse mammary tumor virus micrococcal nuclease 3-[N-Morpholino ]propanesulfonic acid microgram micrograms per milliliter micro liter sodium acetate sodium chloride nanogram sodium hydroxide sodium phosphate Nonidet P-40 o-nitrophenyl galactoside open reading frame phosphate buffered saline polymerase chain reaction RNA polymerase II polydeoxyinosinic-deoxycytidy lie acid gene encoding the yeast Repressor/ Activator protein Repressor/ Activator protein gene encoding the yeast Ribosomal Enhancer Binding protein Ribosomal Enhancer Binding protein temperature-sensitive allele of RAP 1 serial analysis of gene expression Saccharomyces cerevisiae sodiumdodecy !sulfate sodiumdodecylsulfate polyacrylarnide gel electrophoresis TAT A binding protein associated factor Tris borate, EDT A buffer TAT A binding protein trichloroacetic acid Tris EDT A buffer gene encoding triosphosphate isomerase tris(hydroxymethy 1 )amino methane hydrochloride upstream activating sequence gene encoding omithine transcarbamylase ultraviolet 5-bromo-4-chloro-3-indo ly 1-B-D-galactose yeast peptone (media) yeast peptone dextrose/glucose (media) yeast peptone glycerol lactate (media) Vlll


Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy ACTIVATED TRANSCRIPTION OF THE GLYCOL YTIC E ZYME GENES OF SACCHAROMYCES CEREVISIAE: THE CHROMATIN STRUCTURE OF TPII AND MECHANISMS OF RAPlP MEDIATED ACTIVATIO By Jeffrey Beaumont Smerage December 2000 Chairman: Henry V. Baker Ph.D. Department: Molecular Genetics and Microbiology Regulation of transcription is a major pathway by which cells maintain a stable intracellular environment and react to the extracellular environment. This study addresses mechanisms by which a limited number of transcription factors can regulate large and complex transcription systems. The glycolytic enzyme genes of Saccharomyces cerevisiae were used as a model for the study of high-level activated transcription. High-level expression of these genes is the result of combinatorial interactions within a conserved set of transcription factors which bind at the Upstream Activating Sequences (UASs) of each gene. These include the transcription factors Abflp, Reblp Raplp, and Gcrlp. In vivo treatment with micrococcal nuclease and DNase I were used to demonstrate a region of nuclease hypersensitivity over the promoter element of TPII and a series of statistically positioned nucleosomes running upstream from the hypersensitive region. Nuclease hypersensitive regions are lX


characteristic of genes which are poised for activated transcription, and statistically positioned nucleosomes are associated with "boundary" elements which can function to prevent the formation of repressing nucleosomes over a UAS element. In vivo footprint analysis of the TP I1 locus was used to demonstrate that binding of Gerl p at its two sites in the UAS requires concomitant binding ofRaplp at its adjacent binding site. This is a critical function of Rap 1 p because in the absence of bound Ger 1 p transcription is reduced by 99%. Finally, DNA electromobility gel-shift analysis was used to define domains within Rap 1 p which are important for the facilitation of Ger 1 p binding. The strongest facilitation was seen in Raplp species which retain both the deoxyribonucleic acid (DNA)-binding domain and the asymmetric bending domain, although the asymmetric bending domain was not absolutely required. Facilitation was observed when either the amino-terminus or the carboxy-terminus was eliminated but not when both were eliminated, leaving just the core DNA-binding domain. In summary, this work demonstrates that the promoter of the TPIJ gene is located within a permissive chromatin structure, the transcriptional activator Gerl p is directed to its binding site by Rap 1 p and several domains within Rap 1 p appear to be important for the facilitation of Ger 1 p binding. X


INTRODUCTION Molecular biology has become an integral part of modern life It has chan ged th e foods we eat. It has revolutionized the way many vaccines and medicines ar e mad e. lt i s now an important factor in the diagnosis and risk stratification of man y illne sses. As a result, the biotechnology industry has become a major sector of our econom y Ma n y of these applications have been made possible by our knowledge of gene structure a nd transcriptional regulation. Since the realization that D T A is the repository of genetic infonnation (Ave r e t al. 1944 ; Hershey and Chase 1952) an enormous amount o f work ha s b e n d o n e investigating how that information is mobilized. Appropriate and coordinat e d ex pr ess i o n of genes is important for many reasons, and there are many e x amples o f how e ither l ac k of gene expression or inappropriately activated transcription can result in failur e of cellular processes. Some of the most-studied mammalian mutations lead to i n a pp ro p ria t e expression of oncogenes or lack of expression of tumor suppressor ge ne s r es ultin g in neoplastic disease. In microbiolog y, mutagenic anal y sis has been used to g r ea t a d vantage in clarifying many details of transcriptional regulation and other cellular function s. A basic question in the field of transcriptional regulation has asked how a c e ll ca n regulate the complex patterns of gene expression with the specificity required for successful function growth and reproduction It appear s that part o f t hi s s p ec ifi ci t y i provided by DNA sequences that act as regulator y el e ment s These se qu e nc es f uncti on


2 primarily as protein binding sites, and they can be generally divided into two groups. First, there is a proximal promoter that serves as a binding area for the transcription apparatus often referred to as the basal transcription complex (Hernandez 1993 ; Malik and Roeder 2000). Second, there are more distal regulatory elements that act as binding sites for transactivating regulatory proteins (Tjian and Maniatis 1994; Malik and Roeder 2000). In general, these distal elements contain binding sites for multiple proteins. This study utilizes the glycolytic enzyme genes as a model for the study of these regulatory elements and their DNA-binding proteins. The evidence presented here demonstrates that the binding of the transcriptional activator Gcrlp requires the simultaneous binding of a second DNA-binding protein, Raplp. It also investigates the domains within R ap 1 p that may be required for this interaction. They represent an example of how specific and appropriate gene expression appears to depend on the combinatorial interaction between multiple transcriptional activators. An analysis of the chromatin structure sw-rounding the glycolytic enzyme gene TP I1 is also presented. Chromatin in this region is found to have areas of nuclease hypersensitivity and nucleosome phasing both of which a~e consistent with a transcriptionally active gene. These data provide a fran1ework upon which further investigation can be made into the formation and maintenance of active chromatin structures. It is through complex interactions such as those seen at TP 11 and the other glycolytic enzyme genes that a relatively small number of transcriptional activators can regulate the activity of a large number of individual genes. This also provides a mechanism by which cells can coordinate the expression of groups of genes in response to environmental stimuli, intercellular signals, metabolic needs cell cycle functions, and cell type functions.


3 The Basal Transcription Apparatus The basal transcription apparatus has traditionally been defined as a large multi protein complex that consists of the RNA Polymerase II (Pol II) the TAT Binding Protein (TBP) as a component of TFIID, and additional General Transcription Factor (GTFs) (Conaway and Conaway 1993; Orphanides et al. 1996). s noted above, this complex acts at proximal DNA structures including the TAT A box and the transcription initiation site (A very et al. 1944; Struhl 1989). In addition a protein complex termed mediator has been isolated in association with Pol II (Kim et al. 1994; Koleske and Young 1994). The basal complex is capable of directing transcription of in vitro systems, and this in vitro activity has been defined as basal transcription. The basal transcription apparatus, as the targ tor the activating factors remain an important component in the understanding of the in vivo a tivation of transcription. RNA Polymerase II and the General Transcription Factors The heart of the basal apparatus is Pol II. This is one of three eukar otic polymerase complexes and it is responsible for the transcription of most protein encoding genes (Sawadogo 1990). Our knowledge of the eukaryotic Pol II has gone through significant conceptual evolution in the past thirty year This enz me was first isolated as a chromatographic fraction capable of in vitro template-dependent RNA synthesis (Roeder and Rutter 1969). It has since been isolated from many species including human (Freund and McGuire 1986) east ( entenac 1985) fruitfly (Greenleaf and Bautz 1975), mouse (Schwartz and Roeder 1975) frog (Engelke et al. 1983 ) as well as others (reviewed in Young 1991). The core enzyme is a multi-protein complex that consists of I 0 subunits depending on the species (Sawadogo 1990 ; Young 1991 ). They are highly conserved across species (Roeder 1976; Alli on et al. 1985 Sentenac


1985; Young 1991). However this "core" polymerase is unable to direct selective transcription in vitro (Roeder 1976 ; Weil et al. 1979) 4 Selective transcription initiation was achieved by the addition of chromatographic fractions from crude cellular extracts (Matsui et al. 1980) The components of these fractions became known as the General Transcription Factors (GTFs) ( awadogo 1990 Conaway and Conaway 1993 Orphanides et al. 1996). They ha e been isolated and purified from many types of cells including budding yeast HeLa cells rat liver cells and fruitfly cells (Zawel and Reinberg 1993). The GTFs are represented by s ix fractions named TFIIA TFIIB TFIID TFIIE TFIIF and TFIIH As a group, th represent a collection of approximately 30 proteins (Orphanides et al. 1996) Extensive genetic and biochemical investigation has defined proposed functions for many of the GTFs. These include recognition and binding to the TAT A box, recruitment of the Pol II enzyme melting of the promoter DNA and initiation of Pol II transcription ( Orphanid es et al. 1996) However their true functions within the Pol II holoenzyme are still incompletely understood. The TFIID subunit has been extensively studied and shown to be the only GTF with strong DNA-binding activity and the GTF required for sequence specific positioning of the transcription apparatus (Hahn et al. 1989). TFIID is a multi-protein complex and the sequence specificity is provided by a subunit called the TAT A-binding Protein (T BP ). The remaining TFIID subunits are referred to as TSP-associated factors (TAFs). Isolation of TBP was made possible by its high degree of cross-species conservation. It was initially isolated as a yeast protein that could substitute for TFIID in an in vitro mammalian transcription system (Buratowski et al. 1988 ; Cavallini et al. 1988 ). T BP has


5 been called the universal transcription factor by many authors (Hernandez 1993 ; Struhl 1995; Orphanides et al. 1996). It is the most conserved euk:aryotic transcription factor and it is required for the transcription by all three of the euk:aryotic RNA polymerases (Pol I, II, and III) (Hernandez 1993; Orphanides et al. 1996). The C-terminal domain displays over 80% sequence identity across numerous species (Hernandez 1993). TBP has also been shown to bind with high affinity and specificity to its consensus site (TATAa/tAa/t) (Hahn et al. 1989). TBP is capable e,f directing selective but not activated transcription in vitro (Hernandez 1993). The function of the non-conserved -terminus is not yet known. The structure of TBP and the mechanism by which it binds to D A may pla y an important regulatory role in the ability of the transcription apparatus to bind to the promoter. The crystal structme of TBP has been solved for both the prote in alone as we ll as bound to the TA TA DNA element (Nikolov et al. 1992; Chasman et al. 1993 Kim et al. 1993a; Kim et al. 1993b). TBP is an intramolecular dimer with near twofo ld symmetry It binds in the minor groove of the DNA double helix and displays a pre ferred orientation. It also induces a dramatic 90 bend in the DNA with resulting unwindin g and superhelical twist at the end of the TAT A sequence This bend induced b y TB P has been proposed to function both to p r event nucleosome formation and to bring distant r egulation elements together through a looping mechanism (Orphanides et al. 1996). In addition to the TBP, TFIID contains the TAFs which may contribute further to the development of an active promoter conformation. TBP creates a footprint over the TATA box, and the complete TFIID extends this footprint beyond the site of transcription initiation (Nakajima et al. 1988 ; Purnell et al. 1994 ; Sypes and Gilmour 1994 ). TFIID


6 may also play an important role in local chromatin structure. Several of the TAFs have sequence and structural homology to histones (Orphanides et al. 1996)). More specifically, yeast TAF61, TAFl 7, and TAF60 have homology to histones H2B H3 and H4 respectively In Drosophila, a crystal structure of the H3and H4-like TAFs has revealed a complex similar to the histone (H3-H4)2 heterotetramer (Xie et al. 1996) In vitro, pre bound TFIID can prevent the formation of nucleosomes (Meisterernst et al. 1990). Conversely, it has also been shown that preexisting nucleosomes can prevent TFIID binding in vitro (Han and Grunstein 1988) As noted above, the TBP causes the DNA to bend away from the minor groove resulting in a widened minor groove. Nucleosomes on the other hand cause the DNA to bend in the opposite direction resultin g in compression of the minor groove (Van Holde 1989) The exact mechanism by which TFIID affects chromatin is not yet clear. It is possible that TFIID initiates actual nucleosome disruption, but it is also possible that TFIID simply maintains a structure that was opened by other mechanisms. In either case it is unlikely that both TFIID and nucleosomes can be bound to the promoter simultaneously because of their incompatible bending effects on the DNA strand The T AF components of TFIID have been of significant research interest bec a u se initial in vitro studies demonstrated that they were required for activator-dependent transcription initia ti on (Hernandez 1993). There are also many transcription activators that have been shown to have protein-protein interactions with TBP as well as the TAFs (Burley and Roeder 1996). However, initial attempts to demonstrate this dependence in vivo were unsuccessful. Several authors showed that when individual T AFs are mut a ted there are no global effects on transcription (Moqtaderi et al. 1996 ; Walker et al. 199 6).


More recent data has shown that selected TAFs are generally although not universally required for transcriptional activation. In particular the histone-like TAFs appear to be important for transcriptional activation (Michel et al. 1998 ; Moqtaderi et al. 1998 ; Natarajan et al. 1998 ; Lee et al. 2000). 7 T AF 17 is an example of a histone-lik TAF that app ars to be generally but not universally required for t anscriptionr.l activation. Moqtaderi et al used a copper inducible "double shutoff cunstruct to produce conditional alleles in TAFl 7 ( histone H3 homolog) TAF40 and TAF67 (Moqtaderi et al. 1998) This conditional system was designed such that the addition of copper repressP-d th e expres ion of each experimental T AF gene and activated the expression of th ubiquitin degradation pathway The experimental TAF gene contained an N-terminai recognition signal that resulted in rapid ubiquitin-directed depletion of the T AF. Depletion of T AF 17 resulted in the los s of mRNA species from a broad arra J of genes indicating a loss of general transcriptional activity. This wa s not universal, however as even eight homs after the addition of copper they were still able to induce wild-type Acelp-dependent expres ion of cupl a nd induce wild-type heat shock-dependent expres ion of hspl 04 and ssa-1 The non-hi sto n e like T AFs, TAF 40 and T AF67 were required only for transcriptional activation from non-consensus TATA box elements. In a pr or study it was also found that two oth er non-histone-like TAFs TAF145 and TAF19 were required for transcriptional ac ti at ion only if the promoter contained a non-consensus TAT A box (Moqtader i et al. 1996 ). The use of high-density oligonucleotide arrays (HD As) has shown similar re su lt s. Lee et al (2000) used temperature sensitive alleles of several T AFs to evaluate their effects on genome-wide expression. They studied seven T AFs and each individual T AF


8 was required for transcriptional activation of 2-67% of yeast genes. T AF 17 demonstrated the widest effects, being required for the expression of 67% of yeast genes. Recent data has shown that there is a group ofTAFs that are contained in a non-TFIID complex known as SAGA (Grant et al. 1998). Five of the seven TAFs studied by Lee et al (2000 ) are found in both complexes. They evaluated the effects on genome-wide expression by the depletion ofTFIID specific TAFs SAGA specific proteins and TAFs that are shared between the two complexes. They found that the greatest effects on transcription were seen with the T AFs shared by both complexes. In t ta! the five shared T AFs ere required for the expression of 70% of the yeast genome. This resulted in the hypothesis that TFIID and SAGA may perform overlapping functions. Loss of TFIID or AGA in isolation only affects hanscription from subsets of yeast genes but loss of both effects the expression of most yeast genes. Mediator and the Pol U Holoenzyme Signal transduction from activator elements to the polymerase complex now appears to be communicated through the mediator complex. The combination of the mediator and the traditional basal apparatus are now called holoenzyme. The term mediator wa~ first used to describe a cellular extra t fraction required for acti ated transcription in vitro using a reaction composed of otherwise pmified components (Flanagan et al. 1991). The mediator has been isolated and characterized b both genetic (Nonet and Young 1989; Thompson et al. 1993) and biochemical means (Kim et al. 1994 ; Koleske and Young 1994). Most of its components have now been identified It is composed of approximately 20 proteins, including Gall Ip, Suglp four Srb proteins (Kim et al. 1994) Sin4p, Rgr1 p (Li et al. 1995), Rox3p (Gustafsson et al. 1997) and


seven Med proteins (Myers et al. 1998). Mediator was discovered in yeast; however there is evidence that a similar structure is present in mammals (Jiang et al. 1998 Sun et al. 1998; Gu et al. 1999) 9 Mediator appears to play a significant role in transcriptional activation. It stimulates basal transcription 10-fold when added to in vitro transcription reactions composed of purified components. An additional 30-fold response i seen when activator proteins are included in the reaction (Kim et al. 1994). This represents a 300-fold increase in transcriptional activation when compared to the basal apparatus in the absence of the mediator complex. Mediator appears to effect its action through the C-terminal domain (CTD) of Pol II. The CTD is a highly conserved structure that contains tandem repeats of the consensus amino acid equence Tyr-St:r-Pro-Thr-Ser-Pro-Ser ( orden 1990) L ike man other components of the transcriptional apparatus the Pol II CTD is highly cons rved across species, but it does vary in length from species to spe ies. The murine CTD contains 52 repeats whereas the yeast CTD contains 26-27 repeats (Allison et al. 1985 Corden et al. 1985; Nonet et al. 1987). The transition from the polymerase pre-initiation complex to the actively transcribing polymerase complex correlates with the phosphorylation state of the CTD (Dahmus 1996). f nterestingl mediator stimulates activator-dependent phosphorylation of the CTD 40-fold in vitro (Kim et al. 1994 ). Enhancer Structure and Function The activation of the holoenzyme is achieved by the presence of more distal elements known as nhancer Enhancers have been d fined as D A elements that activate transcription when placed at variable distances 1por down-stream from the proximal promoter element and their activity is independent of orientation (Struhl 1989 ;


Tjian and Maniatis 1994). They were also found to be responsive to cell-type s pecific signals It is now known that these enhancer elements represent binding sites fo r transcriptional activator proteins (McKnight and Tjian 1986; Guarente 1987 ) 10 The first use of the term enhancer was in relation to the SV-40 earl y re g ion promoter (Banerji et al. 1981; Benoist and Chambon 1981; Fromm and Berg 1982 ) Initial experiments in which segments of the promoter region were deleted identifi e d t wo 72-base pair repeats that were essential for gene expression in vivo ( Benoist and Chambon 1981 ). This enhancing activity was further investigated using a construc t in which a variety of SY 40 promoter region mutants were placed in front of a rabbit hemoglobin Pl reporter gene (Banerji et al. 1981) They found that the presence of t he SV 40 sequence resulted in a 200-fold increase in expression of the report e r RN A p ro duct They also found that the SV40 sequence was capable of enhancing transcription wh e n placed in either orientation and when placed in a variety of positions relati v e to the s ite of transcription initiation This included placement as far upstream as 1400 base pair s a nd as far downstream as 3300 base pairs Since the discovery of the SV40 e nhancin g activity similar ci s -acting enhancer sequences have been found in association w ith essentially all genes and in all organisms studied ( Guarente 1988 ). In ye a s t th es e enhancer elements have been named Upstream Acti v ating S e quenc es (UASs) A hallmark property of enhancing elements is that they contain binding sites for a w id e variety of transcription activator proteins (McKnight and Tjian 1986 Guarent e 1987 ). One of the interesting properties of transcriptional activator s is that the y h ave a modular structure There are many examples of prot e ins that contain di s tinct D NA binding domains and activation domains that have been identified b y mut a tion a n a l ys i s


1 1 For example the yeast activator Gal4p contains a DNA-binding domain located in th e amino terminus and an activation domain located in the carboxy end of the pro t ein ( Brent and Ptashne 1985) For the activator Gcn4p the locations are different. Th e DNA binding domain is at the carboxy terminus and the activation domain is in the middl e o f the protein (Hope and Struhl 1986 ; Hope et al. 1988 ). In fact the DNA-bindin g a n d t h e activation functions can be physically separated This has been demonstrated b y th e creation of hybrid proteins in which the DNA-binding domain of one acti va tor has b e en combined with the activation domain of another protein When the activation dom a ins o f either Gal4p or Gcn4p ha v e been fused with the LexA DNA-bindin g doma i n the y are capable of activating transcription from a reporter gene in which a Le xA opera t or h as been placed upstream ( Brent and Ptashne 1985 ; Hope and Struhl 1986 ). L e xA i s a DNA binding protein that normall y represses transcription in the prokaryote E. co l i ( Br e n t a nd Ptashne 1985). The function of these transcriptional activators is dependent on th e abil ity of t h e DNA-binding domain to brin g the activation do m ain to the enhancin g el e ment o f th e promoter. If the activator protein is mutated such that the DNA-bindin g dom a in i s absent then the acti v ation domain can no longer activate transcription. T hi s h as b een demonstrated well in the two-hybrid system (Fields and Song 1989 ; Chien e t al. 1 99 1 ) which has been put to dramatic use in identi fy ing protein-protein interactions. In th is experimental system the DNA-binding domain and the acti v ation domain o f th e G a l 4 activator protein are physically separated. The DNA binding domain of Gal4 (a min o acids 1-14 7) is fused to an unrelated protein. L ikewise the acti v ation domain o f G al4 ( amino acids 7 68-881) is fused to a second unrelated protein. If these two fus e d pro te in s


12 demonstrate protein-protein binding, then this binding tethers the activation domain to the DNA-binding domain that is bound to the promoter of the reporter gene. If the two proteins do not interact then this tethering action does not occur the activation dom a in is not brought to the promoter and transcriptional activation does not occur. Several families of activator domains have been identified. In mammalian systems these include acidic domains proline-rich domains and glutamine-rich dom a ins (Struhl 1995). In yeast, only acidic activation domains have been identified ( Struhl 1995). Glutamine-rich and proline-rich elements do not appear to function in ye a s t (Kunzler et al. 1994 ; Ponticelli et al. 1995). However not all yeast activator s contain acidic domains so it is assumed that there are other yet undiscovered moti fs in ye a st (Struhl 1995). The mechanisms b y which activation domains function are not clearl y known, but there is evidence for several possibilities. These include recruitment of the Pol II complex induction of confonnational changes in the Pol II complex alteration s in chromatin structure and effects on transcription elongation (Keaveney and Strub! 1 99 8 ). However these do not repre s ent mutuall y exclusive mechanisms. Chromatin and Nucleosomes as Regulators of Transcription In vivo essentially the entire DNA is contained within chromatin. Thi s pack ag in g system imparts many structural constraints and alterations to the DNA strand as w ell a s t o the individual promote r elements The nucleosomes and chromatin were initiall y th o u g ht to be static structures and they wer e thought to repress transcription simpl y b y th e s t e ri c hindrance of binding by transcripti o nal activators and RNA pol y merase ( Thom a et al. 1979) More recentl y, howe v er chromatin and nucleosome structure ha v e been found to be much more dynamic and the y may even play a role in promoter specific


transcriptional regulation (Kingston et al. 1996; Workman and Kingston 1998 ; Wolffe and Guschin 2000). The Nucleosome Core 13 Chromatin has multiple levels of organization, but at the heart of this structure lies the nucleosome. This protein complex is an octomer composed of four hi stones H2A H2B, H3 and H4. Assembly of the nucleosorne core involves the formation ofH3-H4 heterodimers that then combine to form a tetramer through dimerization of the H3 subunits (Eickbush and Moudrianakis 1978). This (H3-H4)2 tetramer is bound on both sides by H2A-H2B heterodimers to form the final nucleosome octomer (Arents et al. 1991 ). The octomer is then wrnpped by DNA to fom the nucleosome (Hayes et al. 1990 ; Hayes et al. 1991). The hi stones are another example of proteins that are highly conserved acros s species (Wells and McBride 1989; Well and Brown 1991 ) The most conserved hi s tones are H3 and H4 (Wells and McBride 1989; Wells and Brown 1991). The human H3 and H4 histones are virtually identical ( either identical or one amino acid difference) to the corresponding histone proteins from cow, mouse, frog, trout, and sea urchin. When mammals are compared to more distantly related metazoa such as wheat pea a nd m a ize the H4 histones only differ at two amino acids. The H3 and H4 histones of S. ce r e v is ia e vary from human by only 15 and 8 amino acids, respectively. The H3 and H4 histone lengths are also virtually identical in all species. Histone H4 is always l 02 amino acids in length, and with only one exception, histone H3 is always 135 amino acids. The histones also have structural conservation, and they have two major structural domains a globular core that contains a tertiary structure known as a "histone fold and an


14 unstructured N-terminal tail (Arents et al. 1991). The unstructured tail contains multiple lysine residues that serve as sites of acetylation. The histones H2A and H2B show more sequence variability, but they continue to share the tertiary structure of the histone fold and the unstructured tail regions (Wells and McBride 1989; Wells and Brown 1991). There is some evidence that the H2A-H2B heterodimers are destabilized when active chromatin structures are created. This has led to the hypothesis that the variations in H2A and H2B may represent regulatory differences between different organisms. Higher Order Chromatin Structure One of the first views of chromatin revealed a 10-nrn filament that has been described as "beads on a string" (Thoma et al. 1979; De Mmcia and Ko Iler 1981 ). This structure is characterized by individual nucleosomes separated by lengths of "linker DNA. This was consistent with nuclease digestion data in which showed partially digested chromatin formed a ladder of DNA fragments whose lengths were multiples of a basic size unit (Lohr et al. 1977a; Noll and Kornberg 1977). More extensive nuclease digestion demonstrated a 166 bp unit termed a chromatosome (Simpson 1978). The chromatosome contained D A supported by both the core histone octomer and one histone Hl. With further digestion, a 145 bp unit was produced that represented the removal of the linker DNA, leaving only the core DNA (Simpson 1978). The beads-on a-string structure is not thought to represent the predominant form of chromatin because it was seen predominantly in preparations using non-physiologic cation concentrations (Schwarz and Hansen 1994).


15 In higher eukaryotes the majority of chromatin is believed to exist in vivo as a higher order structure, which is 30-nm in diameter (Davies et al. 1974; Paranjape et al. 1994; Wolffe 1998). This 30 -nm fiber, as well as even higher order structures is virtually devoid of transcriptional activity. As a result, it is believed to be involved with the epigenetic control of transcription. It is unclear whether a similar 30-nm structure exists in budding yeast. Several studies utilizing electron microscopy have shown that yeast chromatin can form a 30-nm filament in vitro (Rattner et al. 1982; Lowary and Widom 1989). However, yeast do not have cytogenetically detectable heterochromatin (Rattner and Hamkalo 1981; Bazett-Jones et al. 1988; Guacci et al. 1993 ; Elgin 1995). Early experiments indicated that Hl linker histones were required for formation of the 30-n..'TI fiber (Thoma et al. 1979; Widom l 989) More recent results show that the 30-nm fiber can be formed in the absence of histone HI if appropriate cation concentrations are present (Schwarz and Hansen 1994). It is now felt that the H 1 hi stone serves to stabilize the 30-nm fiber via a charge neutralization mechanism in which the highly basic tail domains neutralize the charge on the polyanionic backbone of the DNA strand (Clark and l(jmuura 1990; Carruthers et al. 1998 ; Wolffe 1998). Histone Hl is highly variable across species (Weils and McBride 1989; Well s and Brown 1991). In fact it is controversial whether S cerevisiae even possesses an HI histone. For a long time, it has been believed that S. cerevisiae does not contain a Hl hi stone. Many attempts to immunoprecipitate an H 1 protein usin g antibodies against H 1 proteins from higher eukaryotes were unsuccessful (Escher and Schaffner 1997). Additionally, the length of the yeast linker regions is very short given that the DNA in the chromatosome is approximately 160 base pairs (Lohr et al. 1977a; Lohr et al. 1977b )


16 This has been felt to be incompatible with the presence of a linker protein. Recently however, the gene HHOJ was identified using data from the S. cerevisiae genome project. This sequence encodes a protein with a globular domain that has 36% identity to human Hl histone (Landsman 1996). The significance of this protein is cun-ently uncertain since neither deletion nor over-expression of HHOJ appears to affect activation or repression of transcription (Escher and Schaffner 1997; Patterton et al. 1998 ) Nuclease Hypersensitivity and Statistical Positioning ofNucleosomes An early observation was that regions of nuclease hypersensitivity were associated with loci of transcriptional activity, and conceptually they have been thought of as "open windows" that provide transcription factors access to regulatory D A sequences (Wu et al. 1979a; Wu et al. 1979b; Gross 1988). Nuclease hypersensitivity was first noted in work with the SV40 virus (Scott and Wigmore 1978 Varshavsky et al. 1978). In these studies, DNase I was used to demonstrate that the SY 40 chromatin contained a region of hypersensitivity located near the origin of iral replication. Since this early discovery, nucleasr hypersensitivity sites have been found to be ubiquitou s in eukaryotes, and they are associated with functional elements within the D A sequence including centromeres, silencers, recombination sequences origins of rep! ication enhancer/UAS elements, promoter elements transcriptional terminators, locus control regions, and A-elements (Gross 1988). The chromatin structure at glycolytic genes is not well studied. Work at TDH3 has demonstrated a hypersensitive area over the promoter (Gross 1988). Additionall it was demonstrated that mutant strains in which the transcriptional activator Gerl p is


deleted are associated with the deposition of two positioned nucleosomes over the proximal promoter element (Gross 1988). 17 The PH05 promoter provides another example of an inducible h y pers e nsiti ve sit e (Schmid et al 1992). PH05 encodes an acid phosphatase, and its transcription is induced by phosphate starvation. The PH05 promoter has two Pho4p-binding sites a s w ell as a Pho2p-binding site When the PH05 gene is inactive the UAS region is incorporat e d into at least six positioned nucleosomes. The first Pho4p-binding site is positioned between two nucleosomes in a very small at'ea of DNase I hypersensitivity (A lmer a nd Horz 1986). The second Pho4p binding site along with the Pho2-bindin g s it e a r e positioned within a nucleosorne and are not accessible for binding ( enter et a l. 199 4) Upon phosphate starvat i on Pho4p binds to the bindin g site between nucleosornes followed by the loss of four positioned nucleosomes as e videnced b y the appearanc e o f a new area of nuclease hyp~rsensitivi t y (Almer and Horz 1986 ; Almer et a l. 1986 ) This area of hypersensitivit y included the binding site s for Pho4p and Pho 2 p Thi s nucleosome disruption occw-s in th e absence of DNA replication (Schmid et al. 19 92) It is during this hypersensitive state that Pho4p and Pho2p are able to b i nd to th e ir site s, which were previously incorporated into a nucleosome (V e nt e r et al. 1994) A second phenomenon obser v ed at transc r iptional promoters is nucleosom e positioning Nucleosomes can be positioned by a variety of mechanisms includin g D A. binding proteins, DNA sequence and DNA bending (Simpson 1978 Thoma 1992 ) Positioned nucleosomes then result in a phenomenon known as statistical positionin g (Fedor et al. 1988) which occurs because the positioned nucleosome acts as a bound a r y element. This boundary forces adjacent nucleosome to assume a specific rotational a nd


18 translational positions. Translational position is the location of the histone octomer along the linear DNA strand. Translational positioning was seen in the PH05 promoter as discussed above where nucleosomes were positioned along the length of the D A resulting in Pho4p access to the first binding site. Rotational position relates to the orientation of the DNA on the histone octomer The DNA helix is a three dimensional structure, and any surface such as the major or minor grooves can be either facing toward the histone core or it can be facing out away from the core. Thus if a protein binds a particular surface of the DNA, this binding site can either be obscured or accessible based on the rotational positioning. Nucleosome positioning can have both positive and negative effects on transcription. When promoter sites are obscured by the placement of a nucleo ome this can prevent binding and as a result inhibit transcriptional activation. The positionin g of nucleosomes over the Pho4pand Pho2p-binding sites at the PH05 locus described above exemplify how transcription factor binding can be inhibited by the presence o f a nucleosome. As noted above thi association was also seen at the TDH3 gene at which the gcr I deletion mutation as associated with the deposition of positioned nucleosom s over the proximal promoter (Gross 1988). In the gcrl deletion mutant transcription from this promoter i severely reduced (Gross 1988) Alternatively the mouse mammar y tumor virus (MMTV) provides an example where the presence and exact positionin g of a nucleosome is required for the activation of transcription The long terminal repeat (L TR) of the MMTV promoter contains binding sites for multiple protein factors including the glucocorticoid receptor OTF, and NFl. In the absence of glucocorticoid hormone, the promoter is covered by six position e d nucleo~omes ( Zaret and Yamam o to


19 1984; Richard-Foy and Hager 1987 ; Pina et al. 1990). When the glucocorticoid receptor binds to its site both the rotational and translational position of the second or B" nucleosome changes. The rotational position allows the NF 1 binding site to become accessible on the surface of the nucleosome (Lee and Archer 1994; Truss et al. 1995). The translational positioning also places all the activator binding sites on the curved surface of the nucieosome Simultaneous binding of all the transcription factors does not occur on naked DNA (Bruggemeier et al. 1990) Thus, their positioning on a curved surface is believed to relieve steric constraints and allow concurrent binding of all factors (Truss et al. 1995). Promoter-Specific Chromatin Alteration It was once tho 1ght that alterations in local chromatin structure might require DNA replication to remove pre-.xisting nucleosomcs (Svaren and Chalkley 1990). In this scenario, transcriptional activator proteins would bind promoters after DNA replication and prevent the reformation of nucleosomes. This would then allow other transcription factors and the Pol II apparatus to bind. However, work in yeast has shown that DNA replication is not required in order for nucleosome clearance / alteration to occur (Schmid et al. 1992) and there are now many examples of promoter-specific chromatin modulation. Two families of chromatin modulating complexes have been identified. One is characterized by ATP-depend nt nucleosome alterations and the other is characterized by the ability to acetylate nucleosomes. ATP dependent nucleosome alteration There are everal ATP-dependent chromatin modifying complexes. The prototype is the 2 MDa multiprotein Swi/Snf complex (Cairns et al. 1994). The Swi / nf


proteins were initially identified in Saccharomyces cerevisiae through mutations that produced defects in mating type switching (SWI) and sucrose fermentation (SNF) (Sudarsanam and Winston 2000). The first link to chromatin structure came when suppressors of Swi and Snf mutations were found to be located within chromatin components including mutations in the histcnes H2A, H2B H3 and H4 (Kruger and Herskowitz 1991 ; Hirschhorn et al. 1992; Winston and Carlson 1992). They were then found to alter nucleosomes in an ATP-dependant manner (Cote et al. 1994). There are several other members of the Swi/Snf family of A IP-dependent chromatin remodeling factors and they are found in a number of organisms. An additional yeast complex is named RSC (Cairns et al. 1996). The related human complexes include h WI/S F (Kwon et al. 1994), NURD (Xue et al. 1998), and RSF (Jaskelioff et al. 2000). Drosophila complexes include ACF CHRAC NURF, and brm (Kingston and Narlikar 1999). 20 The mechanisms by which Swi/Snf and the other ATP-dependent complex alter nucleosome structure and transcriptional activation are not well understood. Swi / Snf has been shown to have a variety of effects on nucleosomes. It has been implicated in nucleosome movement. This includes "cis -displacement, which is sliding without loss of DNA binding (Whitehouse et al. 1999). Swi/Snfhas also been shown to cause trans displacement" of nucleosomes which is the actual loss of DNA binding of nucleosome s as evidenced by the ability to catalyze the transfer of nucleosomes from one DNA strand to another (Lorch et al. 1999). The degree of cisversus trans-displacement appears to be dependent on the relative concentrations of Snf / Swi and nucleosomes. Trans displacement requires much higher concentrations of the Swi / Snf complex (Whitehouse


21 et al. 1999). The binding of Swi/Snf io either naked DNA or chromatin is ATP independent (Quinn et al. 1996), and this binding has been show to form loops within the DNA or chromatin strands (Bazett-Jones et al. 1999) The Swi/Snf alterations in nucleosome structure have been found to be stable after removal of Swi / Snf (Lorch e t al. 1998). Interestingly Swi/Snf is capable of catalyzing both the forward and reverse reactions of nucleosome alteration (Lorch et al. 1998; Schnitzler et al. 1998). There may be more than one mechanism by which the Swi / Snf complex is brought to the promoter regions. Swi/Snf complexes have been co-immunoprecipitated with both the yeast and hwnan PolII holoehzymes (Wilson et al. 1996 ; Cho et al. 1998 ; Neish et al. 1998). This finding generated an early hypothesis which postulated that Swi/Snf was brought to some promoters by the PolII holoenzyme itself. Howe v er the intracellular concentration of the Swi / Snf complex is one 1:enth the concentration of holoenzyme (Cairns e t al. 1994; Cote et al. 1994) and Po!II has not been co immunoprecipitated with Swi/Snf (Cairns et al. 1994 ; Cote et al. 1994; Cairns et al. 1996) Alternatively Swi/Snf might be brought to promoters via interactions with transcriptional activators. In vitro studies performed in yeast demonstrated that Swi / Snf interacts with Gcn4 Hap4 Gal-AH VP 16 and glucocorticoid receptor ( Yoshinaga et al. 1992; Natarajan et al. 1999 ; Neely et al. 1999 ; Yudkovsky et al. 1999) The strength of the Swi/Snf to Gcn4 interaction also correlated with the degree of Gcn4 transcriptional activation (Natarajan et al. 1999). Chromatin immunoprecipitation (CHiP) demonst ra ted in vivo that the presence of Swi / Snf at the HO promoter was dependent on the presence of the transcriptional activator Swi5 (Cosma et al. 1999 ) The human Swi / Snf (hSwi / Snf) has been shown to associated with the glucocorticoid receptor in vivo, and this interaction


was required for hormone dependent changes in the chromatin structure at the glucocorticoid receptor binding site (Fryer and Archer 1998). The transcription factor EKLF has been shown to recruit hSwi/Snf to the ~-globin gene (Lee et al. 1999 ) 22 Swi/Snf is required for the normal expression of only 6% of yeast genes b y genome wide expression analysis using HDAs (Holstege et al. 1998). Even more intriguing, loss of Swi/Snf function was associated with decreased expression o f 2 % genes and increased expression of 4% of genes (Holstege et al. 1998). Thus its app e ar s to function both in transcriptionai activation and repression. There is some e v id e nc e t h a t the strength of a promoter may dictate whether the promoter is Swi/Snf dependent. Swi/Snf was required in vivo to facilitate the binding of Gal4p to weak bindin g site s (Burns and Peterson 1997). However, when the binding site was altered to make it a hi g h affinity site or to place it in a nucleosome-free position Gap4p binding becam e S w i / Sn f independent. The HDA data also indicate that Swi / Snf is not significantly in v olved w ith the expression of yeast glycolytic enzyme genes (Holstege et al. 1998) This i s con s i s t e nt with older data that showed that mutations in swi 1 swi2 / snf2 and swi3 do not affect TDH3 expression (Yoshinaga et al. 1992) and mutations in swi2 / snf2 snf5 and sn f6 do not affect TP II expression (Hirschhorn et al. 1992) Histone acetylation Histone acetylation has been implicated in the regulation of transcription for a number of years. In the 1960 s while investigators were beginning to look at the rol e o f nucleosomes in transcriptional repression, it was noted that ac e tylated histone s caus e d less repression than non-acetylated histones (Allfrey et aJ. 1964 ). Several or g anism s ha ve also been noted to contain chromatin structures that corr e late acetylation with


23 transcriptional activity. Tetrahymena contains two nuclei, a macronucleus that is transcriptionally active and a micronucleus that is transcriptionally inactive (Lin et al. 1989). The macronucleus has been shown to contain acetylated histones, and the micronucleus has decreased levels of acetylation (Gorovsky et al. 1973; Lin et al. 1989). In Drosophila the male has a single hyperactive X chromosome that demonstrates hyperacetylation of histone H4 compared to the female X chromosomes and all autosomes (Turner et al. 1992). In mammalian femaies one of the two X chromosomes is inactivated, and the inactivated X chromosome is "virtually devoid" of H4 acetylation (Jeppesen and Turner 1993) Other investigators have used organomercurial-agarose gels to isolate transcriptionally active chromatin (Walker et al. 1990) Chromatin isolated via this chromatography techmque was shown to have elevated levels of hi stone acetylation. Antibodies directed against acecylated histones have also been used to purify acetylated chromatin that was then shown to be enriched for cti ve genes (Hebbes et al. 1988 ; Hebbes et al. 1994). The manipulation of nucleosome acetylation both in vivo and in vitro has continued to link transcriptional activity with the degree of acetylation Sodium butyrate has been used to create hyperacetylated nucleosomes b y inhibiting cellular deacetylases Treatment of cells with sodium butyrate has been associated with increased D ase I sensitivity and increased expression from transfected DNA templates (Gorman et al. 1983). Nucleosomes rP.constituted in vitro from hyperacetylated histones have demonstrated increased binding of transcriptional activators (Lee et al. 1993 ; Vettese Dadey et al. 1996). Proteolytic removal of the N-terminal histone tails also results in increased transcription factor binding that is similar to the result seen with acetylated


24 histones (Vettese-Dadey et al. 1994; Vettese-Dadey et al. 1996). Acetylation has also been shown to disrupt higher-order chromatin folding, with an associated enhancement of transcriptional activity (Tse et al. 1998). Acetylation decreases the number of times the DNA strand is wrapped around each nucleosome core (Bauer et al. 1994) and results in DNA that is less constrained by the nucleosome as demonstrated by greater flexibilit y (Krajewski and Becker 1998). All of these findings have led to a model where hi stone acetylation functions by destabilizing the interaction between the -terminal tails and DNA (Wolffe and Guschin 2000). Acetylation reduces the ionic charge on the histone tails, and as a result acetylation would weaken the histone-DNA interaction proposed by the charge neutralization hypothesis discussed above. The connection between histone acetylation and promoter specific transcriptional activation came with the identification of the Tetrahymena histone acetylase p55 which was subsequently found to be homologous to the yeast transcriptional activator Gcn5p (Brownell et al. 1996). GCN5 was initially identified through two independent mutation screens. One was looking for mutations that effected the function of Gcn4p which is a transcriptional activator required for the expression of genes activated during amino acid starvation (Georgakopoulos and Thireos 1992). It was also identified under a differ en t name, ADA4, during a screen looking for suppressors of Gal4-VP16 toxicity (Marcus et al. 1994). Gcn5p was found to be associated with two protein complexes the 0.8 MDa Ada complex and the 1.8 MDa SAGA (!cetyltransferase) complex (Grant et al. 1997). In the original isolate, the SAGA complex contained Gcn5, four Ada proteins four Spt proteins and additional uni

25 now known to contain at least five TAFs (Grant et al. 1998) There are additional acetylase complexes found in yeast including NuA3 (oucleosomal acetyltransferase of H3) and NuA4 (nucleosomal acetyltransferase ofH4) (Eberharter et al. 1998 ; Allard et al. 1999) Even TFIID has been found to contain a histone acetylase, TAF145 (Mizzen et al. 1996). Gcn5p and SAGA also appear to have cross species conservation. The hum a n acetylase PCAF, which has homology to Gctt5p ( Yang et al. 1996) is also found within a multi-protein complex which like SAGA also contains histone-like TAFs ( Ogryzko et al. 1998). These are all examples of transcriptional activators that are associated with acetylase activity. The opposite also occurs. There are several examples of transcriptional repressors that are associated 'with deacetylase activity (Taunton et al. 1996; Pazin and Kadonaga 1 997; Wolffe 1997 ). Nucleosome acetylation appears to be a phenomenon generally associated with transcriptional activation. However it is unclear whether complexes such as SAGA play general roles in transcription regulation. When Gcn5p or other AG -specific prot ei n s are inactivated, the expression of at most 12% of genes are significantly affected as assessed by genome wide expression analysis using HDAs (Lee et al. 2000). As an individual gene, the deletion of G e n Sp affected expression of only 4% of yeast ge ne s. However it appears that SAGA has overlapping function, ith TFIID (Lee et al. 2000). When the TAFs that are shared between the t wo complexes were mutated the y individually affected the expression of 10-67% of yeast genes. As a group the y were required for expression of 70% of yeast genes. This effect i s not specific to the acetylation function because when the two acetylases TAF145 and Gcn5p are both depleted at the same time, expression is only affected in 25% of the genes. Of note


26 neither TFIID, SAGA, nor the combination appeared to significantly affect tran cription of glycolytic enzyme genes. Transcription and Saccharomyces cerevisiae The yeast S. cerevisiae provides an excellent model for the study of eukaryotic transcriptional activation. It provides a eukaryotic environment within an organism which like the prokaryote Escherichia coli (E. coli) is generally easy to grow and has a rapid growth rate. It is genetically very malleable (Guthrie and Fink 1991) allowing genetic manipulations not currently possible in mammalian cells. The cerevisia e genome has also been sequenced (Cherry et al. 1997 Cherry et al. 1998) It has also been shown to have many common features when compared to the mammalian eukaryotic cell. In addition to overall cellular organization, these include similarities between RNA polymerases, enhancer/UA elements protein structural domains, chromatin structure, and many transcription factors. Many of these are been described above. Within the context of S. cerevisiae, the glycolytic enzyme genes provide an interesting system with which to study activated tran cription because they are highl y expressed and because their transcription control mechanisms appear to be both multifactorial and coordinated. The glycolytic pathway (Figure 1.1) is a dominant system within this organism. S. cerevisiae, also known as Baker s yeast or Brewer s yeast has been selected over centuries to efficiently convert sugars into ethanol. It has been found to possess very high levels of glycolytic enzyme activity. In fact it is estimated that these enzymes make up 30-60% of the cell's soluble protein (Hess et al. 1969 ; Fraenkel 1982) and the mRNA transcripts constitute a major fraction of total cellular mRNA (Holland and Holland 1978). More recent analysis using both SAGE (serial analysis of gene expression) 01 elculescu et al. 1997) and HD As (Holstege et al. 1998) have


Figure 1.1. The glycolytic pathway Glucose is transformed to several end products in yeast including lactate and ethanol. The enzymes required for each step of the pathway and the genes which encode each of these enzymes are indicated next to each set of arrows.


Glycolytic Pathway G luco se I Hexokinase (HXKJ, HXK2) Glucose 6 phosphate I Phosphoglucose isomerase ( PG[) Fructose 6-phosphate I Phosphofructokinase ( PFKJ, PFK2) Fructose 1,6,-bisphosphate I A ldol ase (F BAJ ) Dihydroxyacetone phosphate .:;;;;==== Glyceraldehyde 3-phosphate Triosephosphate I Glyceraldehyde 3-phospbate isomerase ( TPIJ ) Dehydrogenase ( TDHJ, TDH2 TDH3) 1 ,3bisphosphoglycerate I Pho s pho g l ycerate kinase ( PGKJ ) 3-phosphoglycerate I Phosphoglyceromuta e ( GPMI) 2 phosphoglycerate I Eno l a e ( E OJ E 02 ) Phosphoenolpyruvate I P yruvate Kinase ( PYKJ ) Lactate --- P y ru va t e Lactate deh y dro ge n ase I Pyruvate de ca rbo xy l ase ( LDHI ) ( PDCI) Acetaldehyde I Alcoho l dehydrogenase (A DHI, ADH2) Et h a nol 28


29 confirmed the high level of glycolytic gene expression. The SAGE analysis demonstrated that each glycolytic enzyme was represented by 69-425 mRNA transcripts per cell. The HDA analysis demonstrated each glycolytic enzyme to be represented by 50-123 mRNA transcripts per cell. The vast majority of yeast genes (approximately 80%) are only represented by 0 1-2 mRNA transcripts per cell (Holstege et al. 1998 ) Expression of the glycolytic enzyme genes is primarily constitutive. Possible exceptions may include ?GK, EN02 PYK, PDC l, and ADHJ that show some induction in response to glucose. However much of the glucose induction may be the result of changes in enzymatic activity rather than transcriptional activity. Enzymatic activity was studied in the hybrid yeast Saccharomyces fragilis X Saccharomyces dob z han s kii and this work showed a glucose-modulated induction of 3to 7-fold for most glycolytic enzymes and 50and 70-fold inductions for pyruvate decarboxylase and glyceraldehyde3-phosphate dehydrogenase, respectively (Maitra and Lobo 1971). However when the mRNA levels were assayed in S. cerevisiae it was found that most glycolytic transcripts were induced less than two-fold. The transcripts for PFK2, PGM ENO, and PYK showed the greatest effect with 2.2-, 2.3-, 3.1-, and 3 9-fold induction, respectively (Moore et al. 1991 ). The fust evidence that transcriptional activation at the glycolytic enzyme genes is regulated by a common mechanism came with the discovery of the Glycolysis Regulation gene (GCRJ). Mutations in the regulatory gene GCRJ are associated with a significant loss of both mRNA-encoding glycolytic enzymes and measurable enzyme activity (Clifton and Fraenkel 1981; Holland et al. 1987 ; Scott et al. 1990). GCRJ has been shown to encode a DNA-hinding protein that has binding sites in the Upstream


30 Activating Sequences (UASs) of the glycolytic enzyme genes, and it has been shown to be required for activated transcription from glycolytic enzyme genes (Baker 1991 Huie et al. 1992). Ger 1 p primarily effects the expression of glycol tic genes and T transposon elements (Ciriacy et al. 1991; Turkel et al. 1997; Dudley et al. 1999; Lopez and Baker 2000). Additional proteins, which are known to bind at these UAS elements include Reblp, Abflp, and Raplp. All three of these additional proteins are known to effect expression of a wide variety of genes and as a result a wide variety of cellular processes. Figure 1.2 summarizes the structures of the glycolytic UA elements. The similarity of the UAS regions for glycolytic enzyme genes suggests that their transcriptional activation occurs through a similar mechanism and that this mechanism provides the basis for the coordinated transcription of this family of genes. TP II Transcriptional Activation In this study, the gene TPJJ was used as a model for activated transcription of a glycolytic enzyme gene. TP 11 encodes the triosphosphate isomerase enzyme which is r equired for the conversion of dihydroxyacetone phosphate into glyceraldehyde-3phosphate. It is a single -copy gene, and it has a promoter structure that includes both a TATA element and a UAS (Ba.1

Figure 1.2 Glycolytic UAS elements The glycolytic enzyme genes of Saccharomyces cerevisiae have a highl y conserved set of transcriptional activators that bind at their UAS elements These include Raplp Gcrlp, Reblp and Abflp. References for the binding sites listed here include: PGI (Tekamp-Olson et al. 1988) PFK2 (Heinisch et al. 1991 ; Huie et al. 1992) FBAl (Schwelberger et al. 1989) TPII (Baker 1991 ; Chambers et al. 1989 ; Huie et al. 1992 ; Scott et al. 1990; Scott and Baker 1993) TDH3 (Bitter et al. 1991 ; Kuroda et al. 1994 ; Huie et al. 1992) PGKl (Chambers et al. 1989 ; Chamber s e t al. 1994; Ogden et al. 1986; Huie et al. 1992) GPMl (Rodicio et al. 1993 ), ENO 1 (Brindle et al. 1990 ; Buchman et al. 1988 ; Chambers et al. 1989) ENO2 ( Brindle et al. 1990 ; Willett et al. 1993) ADHl (Buchman et al. 1988; Chambers et al. 1989 ; Tornow and Santangelo 1990) PDCl (Butler et al. 1990; Chambers et al. 1989 ).


32 TPII GQIQ ,.... PYKJ IQt,jQ ,.... PG/ fl)Q ,.... PFK2 0 Q ,.... FBAJ 13 Q ,.... TDH3 G IQQ ,.... PGKJ t,j &)Q ) GPMJ I Q ENOJ QI:] G EN02 IDQQ ADHJ QI PDCJ ICO l00bp I = Raplp 0 = Gcrlp G = Reblp 0 = Abflp ,....... = structural gene


Figure 1.3 The TP 11 gene and surrounding region A. The organization of the TPil promoter includes the UAS binding sites between bases 396 to 371 and a TATA box at position 170. B. The structural gene is 747 basepairs in length Several restriction enzyme sites used in this study are indicated including AvaII/TthIIIl Kpnl BsiHKAI. The UAS and TATA elements are located as notated C. The sequence surrounding TPil contains several open reading frames and genes as identified by the yeast genome sequencing project. The locations of DBF4 YDR05JC and YDR049W are indicated


A. Reblp Gcrlp Raplp -396 B. -859 C. DBF4 Gcrlp -37 l c::::J UAS I TATA YDR05 u C: > Cl) TATA -170 + l ,)1 + 747 TPI ~ YDR049W


35 A model for UASrm function has been proposed that predicts a sequential binding process in which the binding of one protein allows the binding of subsequent proteins (Scott and Baker 1993 ; Drazinic et al. 1996 ; Huie and Baker 1996). ln this model Reblp or Abflp bind first possibly altering the chromatin structure o er the UA region. Rap 1 p then binds its site which is within this nucleosome-free region. The presence of Rap 1 p then creates conditions that are appropriate for full binding by Ger 1 p at the Gcrlp-binding sites adjacent to the Raplp-binding site. Finally Gcrlp binds an d stimulates transcriptional activation either directly or through adapter proteins uch as Gcr2p (Uemura and Jigami 1995) or Gall 1 p (Stanway et al. 1994). Thus ther e would be a sequential addition of proteins at the UASrp 11 each necessary to prepare the promoter for the addition of the subsequent proteins. This model if correct, has significant implications for the coordinated control of transcriptional activation. As will be discussed below Reb 1 p Abfl p and Rap 1 p act at many different genes and appear to perform the role of preparing the regulatory elements of multiple genes that may need to be coordinately expressed or repressed. Also Ger 1 p acts primarily at glycolytic genes and may be the factor that creates specificity for the activation of this distinct group of functionally related genes. This provides a nested set of controls that become progressively more specific. Since the glycolytic genes appear to be constitutively expressed it may be that this specific grouping of proteins has evol ed in S. cerevisiae to maintain constitutive expression.


Proteins That Bind at the Upstream Acti v ating Sequence s of Glycolytic Enzyme Genes Reblp 36 Reblp is a highly abundant protein which is es s ential for cell viabilit y ( Mor ro w et al. 1993). Reblp affects transcription at many genes and as a result it appears to b e important for many cellular functions. This multi-functional nature is further emph as i ze d by the fact that it affects transcription by both RNA Polymerases I and II. At rRNA genes which are transcribed by RNA Polymerase I Reblp is required for both acti va tion and termination of transcription (Morrow et al. 1989 ; Kulkens et al 1992 ; La n g and Reeder 1993) Reblp DNA-binding sites have also been shown at loci transcribed b y RNA Polymerase II including the glycolytic enzyme genes (Figure 1 2 ) autonomou s l y replicating sequences (Sweder et al. 1988) and G A LI-G A LI O (Chasman et a l. 1990 ). uch a wide variety of activities suggest that Reb 1 p ma y pro ide a v ery g ener a l fun ct i o n such as preparing promoters for activation by other factors. The proposal that Reb 1 p functions to prepare promoter s for tran s cripti o n originates from evidence that Reb 1 p cannot activate transcription on its own. Inst e a d it has been found to potentiate activation by other proteins (Chasman et al. 1990 ). Th e strength of this potentiation was also shown to be distance dependent. Reb Ip w a s on ce thought to affec t chromatin structure a t the G A LI-G A LI O locu s (F edor et al. 1 9 88: Chasman et al. 1990). However recent data demonstrates that thi s is not tru e ( R eagan and Majors 1998) Reblp does not have binding sites in all glycolytic enzyme gene promoter s a nd in these cases it appears that the protein Abfl p ma y suppl y the R e b 1 p function (F i g ur e 1.2).


37 Abfl pis another highly abunrla. 11 .t protein that has been shown to act at multipl e promoters and is required for cell viability (Buchman et al. 1988a Rhode et al. 1 989). The AbfJ p binding-site alone like the Reb 1 p binding-site, is only capable of weak activity, but when combined with a T-rich region from the DEDI promoter it becomes a strong activator of transcription (Buchman and Kornberg 1990). This similarity of function has been further implicated by experiments that show Reblp binding-sites can functionally replace Abflp binding-sites, and Abflp binding-sites can functionally replace Reb 1 p binding-sites (Remade and Holmberg 1992) Thus, both proteins ma y u e the same common mechanism to fulfill their role in transcriptional activation. Raplp Rap 1 p is also a highly abundant protein that is essential for cell viabi I ity ( h ore and Nasmyth 1987; Buchman et al. 1988a; Buchman et al. 1988b) Like Reblp Raplp is important in a wide variety of cellular activities including transcriptional activation and repression (Shore and Nasmyth 1987 ; Buchman et al. 1988a) maintenance of telomere length (Chasman et al. 1990) and meiotic recombination (White et al. 1993 ). Rap 1 p has been shown to be required for transcriptional activation at many genes includin g the glycolytic enzyme g nes /figure 1.2) ribosomal genes (Huet et al. 1985) and an TP ase gene (Rao et al. 1993). Current evidence indicates that Raplp does not function as the direct or final activator protein, and instead it likely works through additional activating factors. R ap l p binding sites act only as very weak activators but when a Raplp site is adjacent to a CT box activation increases over 10 fold (Buchman et al. 1988a Bitter et al. 1991 ). CT boxes contain the sequence C(NT)TCC and are known to be the binding site for Gcrlp


38 (Baker 1991). In vivo footprinting ofHBY4, agcrl deletion strain in which glycolytic enzyme activities and mRNA levels are greatly reduced (Scott and Baker 1993 ), demonstrated that while the Rapl p-binding site remained occupied the adjacent CT boxes were unoccupied. This provided further evidence that Rap 1 p does not activate transcription alone, and implied that Raplp is necessary to allow transcription but that an additional factor(s) is required for activated transcription. The Raplp-binding site is required for wild-type activation of transcription at the TP II promoter and there are Gcrlp sites located adjacent to a Raplp site (Huie et al. 1992 Scott and Baker 1993 ) In fact, as seen in Figure 1.2, this close proximity between Rap 1 pand Ger 1 pbinding sites is a hallmark of glycolytic enzyme UAS elements. Thus Gerl p presents itself as the probable Rap 1 p-associated activation factor. The same results have been een at the pyruvate decarboxylase structural gene (PDCI) where Raplp is required for expression but is not sufficient for wild-type expression (Butler et al. 1990). At this time the mechanism for an interaction between Rap 1 p and Ger 1 p is unknown, but there are two leading possibilities: protein-protein interactions and change in the DNA conformation at the Ger 1 p binding-site Both of these mechanisms could theoretically create an environment at the Gcrlp binding-site that allows for greater binding specificity. There is e idence for both of these possibilities. First. using epitope tagged proteins, Rap 1 p and Gerl p have been co-immunoprecipitated indicating that they are capable of forming protein-protein contacts in vitro (Tornow et al. 1993). Second it has been inferred from circular permutation assays that Rap 1 p creates a sharp bend in D A when it binds D A (Vignais and Sentenac 1989). The crystal structure and scanning tunneling microscopy of the Raplp binding domain (aa 361-596) has shown a


39 20 to 29 bend in DNA containing its binding sequence (Muller et al. 1994 ; Konig et al. 1996). Scanning tunneling microscopy using full-length Rap 1 p demonstrated a mean DNA bend of 52 (Muller et al. 1994). This bend may change the conformation of adjacent DNA sequences, including the Gerl p-binding sites. These two mechanisms are both consistent with the current model in which Rap 1 p directs Ger 1 p-mediated activation and the., are not mutually exclusi e. However, it is possible that Rap Ip al o forms one subunit of an activation surface that also contains Gerl p. Gcrlp The characteristics of Ger 1 p are distinctly different from Reb 1 p Abfl p and Rap 1 p. It is expressed at low levels and is not essential for cell viability (Baker 1986). Its binding sites have been found primarily at glycolytic enzyme gene and Ty element promoters (Ciriacy et al. 1991 ; Turkel et al. 1997; Dudle y et al. 1999 Lopez and Baker 2000). HDA experiments comparing the transcript mes from a wild-t pe strain and a gcrl deletion mutant strain demonstrated that 53 open reading frames (ORFs) were gcrl dependent (Lopez and Baker 2000). Approximately 75% of these 53 ORFs represented either glycolytic enzyme genes or Ty elements and there were an additional 14 unrelated ORFs. The functional importance of Gerl pat glycolytic enzyme genes was illustrated b deleting the single copy of GCRJ Strains that have the gcr 1 deletion mutation are viable but grow very slowly and form very small colonies These strains also ha e a dramatic loss of glycolytic enzyme activity to below 10% of wild-type for ach of the glycolytic enzymes (Clifton et al. 1978 Clifton and Fraenkel 1981 Baker 1986 ). This lo s of enzyme activity is believed to be the result of decreased transcriptional activation becau e there is a parallel loss of mRNA levels (Clifton and Fraenkel 1981; cott et al. 1990 ). In addition, when individual Gerl p sites are mutated in specific promoters including TP fl


40 EN02, TDH3, and PGK expression from that promoter is reduced (Chambers et al. 1989; Bitter et al. 1991; Scott and Baker 1993; Willett et al. 1993). This implicates Ger 1 p as an important regulator of transcription at the glycolytic enzyme genes. Gcrlp appears to be capable of transcriptional activation when used in isolation. When fused with the lexA binding domain, Ger 1 p was able to activate transcription 116fold over the lexA binding domain alone (Scott and Baker 1993). These lexA experiments utilized a lexA operator that does not contain sites for Reb 1 p or Rap 1 p. Thus, the Gerl p activity was isolated from the other UASrP!I binding factors. Further evidence for Gerl p's role as an activator comes from its association with a region of nuclease hypersensitivity. In a wild-type strain, the promoter of TDH3 is associated with a large region that is hypersensitive tu DNase I, and this hypersensitivity extends from 560 to -40 relative to the transcription start codon (Pavlovic and Horz 1988). This region includes a UAS element and a Gerl p binding site (Bitter et al. 1991) as well as the TAT A box. In a gcr 1 deletion mutant the size of the hypersensitive region shrinks. The area from -560 to -370 remains hypersensitive, but the region from -370 to -50 becomes protected from nuclease digestion (Pavlovic and Horz 1988). They suggested that this protected region was the result of two nucleosomes that formed over this region which includes the TAT A box, in the absence of Ger 1 p. Whether these positioned nucleosomes prevent transcription or are just associated with a lack of transcription activity is yet to be determined, but it has been suggested that the presence of nucleosomes over a TAT A box inhibits binding of the transcription apparatus (Kornberg and Lorch 1992). The DNA-binding characteristics of Gcrlp are als consistent with the sequential binding model. Gcrlp has a high binding affinity for DNA but a relatively low


41 specificity for its specific DNA-binding site (Huie and Baker 1996). It has an apparent dissociation constant (Ki) of 2.9 X 10 10 for the Ger 1 p-binding sequence found at position -375 of the TPIJ locus. Additionally there was only a 33-fold difference between the specific and non-specific binding affinities in competiti n experiments. For comparison the specific and non-specific binding of Rap 1 p differ by almost ix ord rs of magnitud (Huie and Baker 1996) Thus it is hypothesized that Gerl p requires factors in addition to DNA sequence to direct binding specificity. The spatial context of the Gcrlp-binding site relati e to the Raplp-bindin g site is important for Gerl p binding and transcri ption al activation (Drazinic et al. 1996). Using a TPJJ::lacZ reporter gene, it was shown that if the Raplpand Gcrlp-binding ites are separated by five base pairs transcriptional activation was virtually eliminated. If the sites are separated by ten base pairs then transcriptional acti ation is 50% of that seen with wild-type spacing. As the site are further separated at 5 base-pair interval there is a continual decrease in transcriptional activation. The degree of decreased activity is greater for separations that are a multiple of five and less for those that are a multiple of ten. At a+ 30 base-pair interval activation is approximately 5% of wild-type which is still higher than the level of activation seen at the +5 base-pair interval. / n vivo footprinting was also used to investigate the protein binding at these promoters (Drazinic et al. 1996). In the wild-type construct there was normal protection over the Rap 1 pand Gcrlp-binding sites. In the +5 base-pair construct there was protection at the Raplp binding site but no protection at the Gerl p-binding site. In the + 15 + 20 + 25 and + 3 0 constructs there was incomplete and decreasing protection o er the Gerl p-binding site.


42 Thus, the facilitation of Ger 1 p binding is dependent on both the distance from the Rap 1 binding site and on its rotational positioning relative to Rap 1 p. The close spatial relationship between the Rap 1 p and Gerl p binding-sites implicates Raplp as the factor that provides the additional specificity for Gcrlp binding. There are two possible mechanisms of interaction. First Raplp could alter the D A conformation at the Ger 1 p site and second there may be physica l contact between Rap 1 p and Gerl p. As noted above Rap 1 p does cause changes in DNA conformation by bending the DNA at its binding-site. In addition there is evidence that Gerl p itself causes a small bend when it binds to the DNA (Huie and Baker 1996). This Ger 1 induced bending could be significant because it has been shown that proteins that b e nd DNA bind to bent DNA with a higher affinity than to unbent DNA (Kahn and Croth e r s 1992). The second possibility protein-protein contacts has been implicated b y the co immunoprecipitation experiments discussed above (Tornow et al. 1993 ). The t w o mechanisms DNA conformational changes and protein-protein contacts are not mu t uall y exclusive and may both be present. Non-DNA-binding Proteins That Affect Expression of Glycolytic E nzyme Gen es Although Gerl p is capable of activatin g transcription it is not known wheth e r Gcrlp interacts with the transcription apparatus directl y or whether it operates throu g h adapter protein.s. The genes GCR 2 and GALI 1 encode non DNA-bindin g protein s th a t are required for wild-type expression of many glycolytic genes (Nishizawa et a l. 19 90; Uemura and Fraenkel 1990 ) As a result thes e protein s present them s el ves a s po ss ib le adapter molecules At the presen t tin1e the mechanism of their acti v ity i s unkn ow n. Strains that contain deletions of these genes are viable and thus can be used to i nv es t i g at e t heir role in transc r iption


43 Gcr2p GCR2 was identified in a screen for mutations that affect expression from the ENO I promoter (Uemura and Fraenkel 1990). Deletion of GCR2 results in a profound decrease in glycolytic enzyme activity that is similar to the defects found in gcr I mut a nt strains (Uemura and Fraenkel 1990). The mechan i sm for the glycolytic enzyme de fec ts appears to be due to defects in transcriptional activation as evidenced by significant reduction in mRNA levels seen in Northern analysis (Uemura and Fraenkel 1990 ). However, the gcr2 mutants do not have as severe a growth defect as gcr I mutant s when grown on glucose containing media at 30 C (Uemura and Fraenkel 1990 ). Current evidence indicates that Gcr2p acts as a non-DNA-binding adapter protein possibly through interactions with Ger 1 p. Evidence for an interaction between Ger 1 p and Gcr2p comes from genetic stud ies (Uemura and Jigami 1992, 1995 ) utilizin g the "two-hybrid" method of Fields and Song (1989 ). In addition a Raplp-Gcr2p fusion protein partially complements the defects of the gcrl mutation (Uemura and Ji ga mi 1992). Currently there is no evidence that Gcr2p binds D A. In vivo footprinting in wild-type gcr I and gcr2 mutant strains did not provide evidence for a Gcr2p-binding site within the UAS rPll element (Scott and Baker 1993 ; Huie and Baker 1996 ). Galllp Gal 11 p appears to be a general transcription factor that has been implicated in the positive and negative regulation of several loci It is a positive regulator of the GAL system MRal, MATal, and MATa2, and it is a negati ve regulator of Ty element (Fassle r and Winston 1989 ). There is also evidence that it interacts with zinc finger proteins


44 including Abfl p (Stanway 1991; Sakurai et al. 1993). It has also been isolated in association with the basal RNA polymerase II transcription apparatus (Kim et al. 1994). It has been suggested that Gal 11 p acts as an adapter protein at the UAS elements of glycolytic enzymes. The primary evidence comes from the PYKJ and PGKJ loci. In a gall] mutant transcriptional activation from a UASPYKI construct is reduced seven fold when compared to wild-type (Nishizawa et al. 1990). In addition, mRNA levels for the PGKJ transcript are reduced two fold in a gall] mutant (Stanway et al. 1994). Summary The process of eukaryotic transcriptional activation is a complex process that requires interactions between a large number of proteins and protein complexes including histones, chromatin modifying complexes, transcriptional activators, transcriptional repressors, mediators as well as the polymerase complex. The U AS elements of the glycolytic enzyme genes provide a model of eukaryotic transcriptional activation. More specifically, they represent an example of a transcription system in which the UAS elements direct appropriate transcriptional expression from a group of functionally related genes. This study presents the chromatin structure surrounding the TPJJ gene. This structure includes an area of distinct nuclease hypersensitivity over the regulatory promoter elements. It also demonstrates that the transcription factor Gerl p requires the simultaneous binding of a second DNA-binding protein Rap 1 p. This combinatorial interaction would provide increased specificity to transcriptional activation. Experiments are presented that investigate which domains within Rap Ip are required for this interaction.


45 The current evidence supports a stepwise preparation of the promoter region which then allows the final activator to bind and direct transcriptional activation. The UAS elements in yeast glycolytic enzyme genes are structurally similar to the UAS elements in other yeast genes. They are also similar to the enhancers of higher eukaryotes. Thus, it is likely that these mechanisms will be present at other non glycolytic yeast genes as well as at genes in higher eukaryotes. With greater knowledge of the DAS/enhancer function it may become possible to modulate the activity of specific genes or gene families for research, industrial, and medical benefit.


MA TERJALS AND METHODS Strains The genotypes for all strains of S. cer ev isia e and E. c oli used in thi s s tud y are described in Table 2 1. Media and Growth Conditions Yeast cultures were grown in yeast-peptone (YP) medium (Rose et al. 1990 ) supplemented with 2% glucose (YPD) or 2% lactate and 2 % glycerol (YP-Gl y / Lac ). Unless otherwise noted liquid y east cultures were grown at 30 C w ith s hakin g. In experiments involving temperature-sensitive strains y east cultures were g ro w n a t th e permissive temperature of 24 C Unless otherwise noted E. coli cultures were grown in Luria Broth ( LB ) me d ium (Miller 1972) and as appropriate, supplemented with ampicillin (LBamp ) E. c ol i cultures used for growth of phage M 13 were grown in Minimal Media 6 3 ( M 63) supplemented with one microgram per milliliter g/ ml) thian1ine h y drochlorid e a n d 25 / ml amino acids as required ( Miller 1972) All E. c oli culture s w ere g ro w n at 3 7 C with shaking Chromatin Mapping by Nuclease Sensitivity The nuclease sensitivity experiments were based on a method publish e d b y K e nt et al. (1993). Nuclease sensitivity patterns have been u s ed most commonl y to m a p t he positions of nucleosomes. Unfortunately nucleases s uch a s D ase I and mic roc o ccal nuclease are unable to enter intact cells becau s e they ar e too large to diffu s e throu g h t h e 46


Table 2.1 Strains Strain Genotype E. coli KK2186 MC1061 DH5alpha S. cerevisiae S150-2B HBY4 DFY641 DFY642 YDS485 YDS487 W303-1A R884-1C supE sbcB15 hasdR4 rpsL thi Li(lac-proAB) F [traD36 proAB+ ,aclq, lacZLiml.5] hsdR mcrB araD139 Li(araABC-leu)7679 LilacX74 ga l U, galK rpsL thi 80dlacZLiM15 Li[lacZYA-argF] U169 deoR recAl h s dRl 7 supE44 thi-1 hyrA96 relAl MATa, leu2-3 112 his3Li trpl2 89 ura3-52 MATa gcr1Li::HIS3 leu2-3 11 2, his3Li trpl-289 ur a3 52 MATa, gcr2ti :: URA3 leu2-3 l 12 ura3-52 MATa leu2-3 112, ura3-52 MATa ade2 1 his3-11 13 trpl-1 ura3-l MA Ta ade2-1 his3-11 13 trp 1-1 ura3-1 rap 12 15 MATa, ade2-1 trpl-1 canl-100 leu2-3 112 hi s 3-11 1 5 u ra30 5 2 MA Ta ade2l trp 1-1 canl-100 leu2-3 112 his3l l 15 g al 11313 47


48 cell wall and membrane. This had previously limited their use to the treatment of in vitro systems and to the treatment of isolated nuclei. The method of Kent et al. ( 1993) utilized unlysed yeast cells. To perform the nuclease digestion in vivo it was necessary to spheroplast and permeabilize the cells. Yeast possesses a cell wall composed primarily of ~(1 -> 3)glucan, ~(1 -> 6)glucan and mannoprotein (Guthrie and Fink 1991; Johnston 1994). This cell wall can be enzymatically disrupted with zymolase, which hydrol yses the poly ~(1 -> 3-glucose) of the cell wall glucan (Guthrie and Fink 1991 Johnston 1994). The lipid bilayer of the cell membrane was then permeabilized but not disrupted using the non ionic detergent NP-40. Permeabilization allowed for rapid sample processing and for less manipulation of the cell and nucleus than occurred with older methods that utilized isolated nuclei. Permeabilization and Nuclease Treatment of Cells The various strains S. cerevisiae were grown at 30C with shaking to an exponential growth phase and harvested at an A 600 of 1.0 b y centrifugation. Cells were then washed three times with ddH2O. The wet weight of the pellets was measured The cells were then resuspended in one ml/g of High DTT Solution (50 mM Tris hydrochloric acid (HCl) pH 7.5 8 mM MgCh 1 M sorbitol, 30 mM dithiothr e itol (DTT)) and incubated at room temperature for 5 minutes and then pelleted by centrifugation. The DTT functions to reduce disulfide bridges in the mannoprotein la yer allowing increased access to the underlying ~(l -> 3)glucan la ye r b y yeas t lytic enzyme (Guthrie and Fink 1991 ; Johnston 1994). The cells were then resuspended in three volumes of Low DTT Solution with yeast l y tic enzyme (50 mM Tris-HCI pH 7.5 8 mM MgCh, 1 M


4 9 sorbitol 5 mM DTT, and 200 u/l yeast lytic enzyme) and incubated at 37 C for 30 to 45 minutes. The adequacy of spheroplast formation was determined by observing rapid l y si s when 1 l was mixed with 5 ml ddH 2 0. The spheroplasts were then pelleted b y centrifugation and washed twice in 1 M sorbitol. The s pheroplasts wer e then resuspended in one voh;me of Nuclease Tre a tm e nt Buffe r (i M sorbitol 50 mM a C l 1 0 mM Tris-HCl pH 7 5 5.3 mM MgCb, 1 mM calcium chloride (CaC h 0 .3 mM spermidine and 1 mM P-mercaptoethanol) The spheroplasts were then aliquoted into 100 l volumes that were treated with either MNase or D ase I as described b e lo w Dilutions of MNase and DNase I were made in uclease Tre a tmen t Bu ffe r containing 0.05% Nonidet P-40 (NP-40) (v / v). The MNase concentration s u se d were 0 0.006 0.02 0 06 and 0.2 units / and the DNase I concentrations used w e r e 0 0.0 05 0.01, 0.02 and 0.04 units / l. Note that the concentrations of nucleas e a nd P-40 in ea ch reaction were actually half of the v alues described abo v e because in a s ubsequ e nt s t ep th e nuclease samples were diluted 50% when the y were added to the spheropl a st sa mpl es After the nuclease dilutions w ere prepared both the spheroplast aliquot s and th e nu cle a se aliquots were pre-heated in a 37 C heat block for 2 minutes Then the nuclea se dilu tio n s were then added to th e spheroplast tubes gently mixed and incubated at 3 7 C fo r 1 0 minutes. The nuclease reactions were stopped by adding 11 l of 0 5 M E DT A 11 ~LI 2 0 % SDS and 2.5 l Proteinase K (20 mg / ml) sequentiall y It was not po s sibl e to p re m ix th e stop solutions due to precipitation of the SDS. The samples were th e n incub a t e d a t 3 7 C for 30 minutes followed by centrifugation to pellet the cellular debri s Th e s up e rn a t a nt s


were extracted once with phenol and then once again with pheno l :chloroform (50:50 ). They were then ethanol precipitated. 50 Several experiments were performed to determine the appropriate concentrations of NP-40 and nuclease. The degree of nuclease digestion is directly proportional to the concentrations of both the NP-40 and the nucleases, and the actual concentrations were made empirically. For a given concentration ofNP-40 a series of nuclease dilutions were tested for their average fragment size when viewed on ethidiumbrornide (EtBr)-stained agarose gel. Electrophoresis and Southern Transfer The DNA samples were loaded onto a 1.5% agarose Tris-borate-EDTA (TBE) gel 25 cm in length. The gel was then run at 160 V until the bromophenol blue had migrated a distance of 21 centimeters. The gel was stained with EtBr and photographed The DNA was then transferred to Hybond-N+ nylon membrane by the method of Southern (Elder et al. 1983; Elder and Southern 1983). The gels were soaked in 0.25 M HCl for 30 minutes. They were then soaked in 0.5 M NaOH 1.0 M aCl for 30 minutes The transfer buffer used in the Southern apparatus was 0.025 M NaPO 4 (pH 6.5). After transferring overnight for 12-14 hours the nylon membrane was removed and irradiated in a UV -Stratalinker-1800 (Stratagene) for a total of 1200 X 10 2 joules Probes, Probe Synthesis, and Hybridization Conditions The probes used for indirect end-labeling were created by primer extension on M13 templates. The M13 strainsjbsTPimp18.2-21 andjbsTPimp18.2-24 both contain a 4.4 kilo base (kb) HindIII fragment from pHB51 (Scott et al. 1990), which contains the TPIJ structural gene with surrotmding sequence. StrainjbsTPimp18.2-21 contains the non-coding strand and strainjbsTPimp18.2-24 contains the coding strand. Probes


51 produced with jbsTPlmp 18.2-21 and HB 149 allow visualization of the region upstre a m from the BsiHKAI restriction site that is located at nucleotide + 189 relative to the translation start site of TPII. Probes produced with jbsTPTmpl 8.2-21 and HB 15 2 allow visualization of the region upstream from the Kpnl restriction site that is located at nucleotide +514 relative to the translation start site of TP 11. Probes produced with jbsTPlmp18.2-24 and HB149 allows visualization of the regions downstream from the Kpnl restriction site that is located at nucleotide +512 relative to the translation start s ite of TPil (Figure 1.3). Primer extension utilizing Kienow fragment was carried out using 2.5 g of template and 5 pmol of HB54 in a reaction buffer of 20 mM DTT 10 mM MgCh 50 mM Tris-HCl (pH 8.0) 200 mM NaCl 0.24 mM dNTPs (minus dA TP) and 100 Ci a 3 2 P dATP. The reaction was incubated at 37C for 45 minutes. The products were then denatured at 100C and separated on a small preparative sequencing gel. The locati on of the single-stranded, radioactive product was localized by brief autoradiograph y. The appropriate area of the gel was excised from the gel and manually crushed. The crushed gel fragment was suspended in 6 ml of hybridization solution (1 % BSA 1 mM EDTA, [0 5 M Na ]HPO 4 7% SDS). Hybridization was carried out in a rolling drum hybridization chamber. The membrane was pre-hybridized in hybridization solution at 60 C for 60 minutes. The solution used for pre-hybridization was poured off and the 6 ml volume of probe was added. The membrane and probe were then incubated at 60C for at least 12 hours The hybridized membrane was washed 3-4 times in wash solution (1 mM EDT A, [ 40 mM Na]HPO4, 1 % SDS) at 60C.


52 Autoradiography The Southern blots were exposed to Kodak AR film both with and without a Lightning Plus (Dupont) intensifying screen. In vivo Footprinting In vivo footprinting utilizes one of the four chemical sequencing reactions originally described by Church and Gilbert (Maxam and Gilbert 1977; Church and Gilbert 1984). Dimethylsulfate (DMS) methylates DNA at the N7 position of guanine (G) residues and the N3 position of adenine (A) residues. Because DMS can penetrate the cellular and nuclear membranes, it was possible to perform this methylation in v i vo. When a protein binds a DNA sequence that contains G residues this methylation will often be inhibited. Thus analysis of the methylation patterns produced by DMS treatment often allows the detection of protein binding at specific D A sequences The procedure described here has been published previously (Huie et al. 1992; Lopez et a l. 1993). Additionally there are several other published descriptions of in v ivo footprinting protocols (Becker and Schutz 1988; Becker et al. 1993; Hamstra and Yang 1993). In vivo Dimethylsulfate Treatment and Preparation of Saccharomvces cerevisiae DNA The strains YDS485 and YDS487 were grown at 24 C in 500 ml of yeast peptone dextrose (YPD) with shaking to an optical density (A 6oo ) of about one. The cultures were then concentrated 100-fold into 5 ml of clarified YPD. The concentrated cells were incubated in the clarified growth media under three conditions: 24 C 24 C with 1 0 g/ml cycloheximide, and 37 C for 30 minutes DMS was then added at a concentration of either 50mM for the 24 C samples or I 0m.M for the 3 7 C samples. The lower concentration ofDMS used at 37C was used to compensate for the increased


53 methylation activity of DMS at the higher temperature. Incubation times with DMS are indicated in the text. The methylation reactions were quenched by the addition of 40ml ice-cold phosphate buffered saline (PBS) (137 mM sodium chloride (NaCl), 2.7 mM potassium chloride (KCl), 4.3 mNI sodium phosphate (NaPO4 ), 1.4 mM potassium phosphate (KPO 4 ), pH 7.4). The cells were then peUeted by centrifugation. The cells were washed three times with 35 ml ice-cold PBS to dilute out the DMS. The washes were accomplished by resuspending the cells in ice-cold PBS, pelleting the cells b y centrifugation, and decanting the supernatant in a fume hood. The genomic DNA was extracted from the DMS-treated cells with a Qiagen-tip 500 following the manufacturer's recommended protocol as described below The washed cell pellet was resuspended in 12 ml Qiagen buffer Yl (1 M sorbitol 100 mM ethylenedinitrilotetraacetic acid (EDTA), 14mM ~-mer c aptoethanol) containing 0.4 milligrams per milliliter (mg/ml) yeast lytic enzyme and incubated at 37C for 60 minutes. Spheroplast formation was confirmed by checking for osmotic lysis in ddH 2 0 The spheroplasts were then pelleted by centrifugation at 4 krpm for 5 minutes. The spheroplasts were then resuspended in 12 ml Qiagen buffer G2 (800 mM guanidine hydrochloride (GuHCl) 30 mM EDTA pH 8 5% Tween-20, 0.5 % Triton X-100) plu s 250 microliters (l) 10 mg/ml RNase A and 20 mg / ml Proteinase K This was incubated at 37C for 2 hours. The lysate was then poured over a Qiagen-tip 500 th at had previously been equilibrated with Qiagen buffer QBT (750 mM sodium chloride ( aC I ), 50mM 3-[N-Morpholino]propane sulfonic acid (MOPS), 15% ethanol 0 15 % Triton X100 pH 7 0). The column was then washed twice with 30 ml Qiagen buffer Q C ( 1. 0 M


54 NaCl, 50mM MOPS, 15% ethanol, pH 7.0). The genomic DNA was then eluted with 15 ml of Qiagen buffer QF (1.25 M NaCl, 50mM Tris-HCL, 15% ethanol, pH 8.5 ). During the isolation and subsequent processing of the DMS treated D A, care was taken that it not be exposed to temperatures in excess of 3 7 C. At temperatures higher than 37C non-specific cleavage occurs at both the methylated G and meth y l ated A as a result of uncontrolled apurination ( Becker and chutz 1988) Preferential c l eavag occurs at the G residues during treatment with piperidine as will be described below In vitro DMS Treatment of Plasmid DNA In order to identify areas that were pro ected from methylation the D A that was methylated in vivo needed to be compared to similar DNA that had been meth y lated in the absence of bound proteins. This was accomplished by treating the plasmid pHB 51 (Scott et al. 1990) with DM in vitro. The plasmid pHB5 l has bases -3079 to + 8 26 of the TPII locus cloned into the HindIII site ofpUC18 Twenty micrograms of pHB51 were precipitated with ethanol and resuspend e d in 200 ofDMS buffer (50mM a-cacodylate I mM EDTA pH 8.0). DM was added to a concentration of 50mM (1 l) and incubated at room-temperature for 60 second The reaction was then stopped by precipitation with of 50 l DMS stop solution (1.5 M sodium acetate (NaAc 1 M B-mercaptoethanol ) and 750 l cold absolute ethanol. The methylated D Awa pelleted by centrifugation and the excess DMS was remo ved b washing the pellet with 70% ethanol. Restriction Digest and Cleavage of Methylated Guanine Residues Both the genomic D A samples and the plasmid samples were digested w ith A vaII, which cleaves at a unique restriction site located 859 base-pairs up tream from th e


55 TPIJ structural gene (Figure 1.3). The AvaII-digested DNA was then cleaved at the methylated G residues by incubating in 200 1 M piperidine at 100 C for 30 minutes. Under these conditions the cleavage occurs mor J rapidl at methylated G residues and relatively slowly at methylated A residues (Maxam and Gilbert 1977 Becker and chutz 1988). The piperidine reaction was s t opped by precipilation with ethanol. The D A was pelleted by centrifugation, and the excess piperidine was remo ed during washes with 70% ethanol and vacuum drying of the pellet. Electrophoresis The fragments resulting from restriction digestion and piperidine cleavage were separated on a sequencing gel (7% a~rylamide, 0.23% bisacrylamide 8 M urea 0.5 X TBE. The plasmid-derived G ladder was loaded at 4 nanograms (ng) per lane and the genomic samples we r e loaded at either 2 g or 5 g per lane as indicated. The gel was pre-run at 50 V /cm for 30-60 minutes The samples were denatured at 95 C for 3 minutes in formamide sequencing dye and then loaded onto the gel. After loading the samples, the gel was run at 50 V / cm until the ylene cyanol had migrated 30 cm. Transfer ofD A to ylon Membrane After electrophoresis as complete, the glass plates were separated and a piece of Hy bond+ (Amersham) was placed on top of the gel. The membrane was used dry and not pre wetted. The gel, which adhered to the nylon membrane was easily lifted off the glass plate It was placed membrane down onto two pieces of dry 3MM paper (Whatman) covered with plastic wrap, and placed on the wire mesh of a avant gel dryer (Model SGC4050 ; Savant Instruments). It was then blotted under vacuum without h ea t for 45-60 minutes. The gel sandwich was then placed plastic wrap side down on a 312


56 run transilluminator (Fischer Scientific) and irradiated with ultraviolet (UV) light on high for 10 minutes. The gel was removed from the membrane using ddH2O. Probes, Probe Synthesis, and Hybridization Conditions The probe used for indirect end-labeling was created by primer extension on an M13 template. Probes for the Avall restriction site located at -487 with respect to the translational start site of TP II were prepared from the Ml 3 clone mesTPimp 18B (Scott 1992), which contains the 5' non-coding region of the TP II locus. The primer used HB54, is complementary to the sequence at the A vaII restriction site such that upon annealing, its 5' end is located at the Aval! site (Huie et al. 1992). Primer extension utilizing Kienow fragment was carried out using 2.5 g template and 5 pmol of HB54 The reaction buffer was composed of20 mM DTT 10 mM magnesium chloride (MgCh) 50 mM Tris-HCl (pH 8.0), 200 mM NaCl, 0.24 mM dNTPs (minus dATP) and 100 Ci a.32P dATP. The probe was then purified by electrophoresis on a 6% polyacrylan1ide 8.3 M urea, 0.5X TBE gel. The location of the single-stranded, radioactive product was localized by brief autoradiography. The appropriate area of the gel was excised from the gel and manually crushed. The crushed gel was suspended in 6 ml of hybridization solution (1 % bovine serum albumin [BSA], 1 mM EDTA, [0.5 M a]HPO 4 7 % sodiumdodecylsulfate [SDS]) Hybridization was carried out in a rolling drum hybridization incubator ( Robbins Scientific, Model 310). The membrane was pre-hybridized in hybridization solution at 60C for 60 minutes. The solution used for pre-hybridization was poured off and th e 6 ml volume of probe was added. The membrane and probe were then incubat d at 60 C


57 for at least 12 hours. The hybridized membrane was washed 3-4 times in wash solution (1 mM EDTA, [40 mM Na]HPO4, 1 % SDS) at 60C. Auto radiography The hybridized membranes were exposed to Kodak AR film with one Dupont Lightning Plus intensifying screen. DNA Band-Shift Analysis DNA band-shift analysis, also knowrt as electrophoretic mobility gel-shift analysis, is an in vitro method used for the study of protein-DNA interaction. The procedures used in these studies were based on those by Fried and Crothers (1981) and Garner and Revzin (1981). Expression Vectors for RAP I and RAP I -Truncations Full-length Raplp and several carboxy-terminal and amino-terminal truncations of Rap 1 p were produced by in vitro transcription and translation from plasmid expression vectors utilizing the SP6 R.t"'\J"A polymerase promoter. The plasmid pSP56RT7 contains the entire RAP I coding region and its construction has been described previously (Chambers et al. 1989). The plasmids pSPRAP361-596 and pSPRAP361-827 contain truncated forms of RAP I (Figures 2.1 and 2.2). The RAP I truncations were produced by polymerase chain reaction (PCR). The PCR primers were designed to introduce start and stop codons at the proper ends of the coding sequences and to introduce restrictions s ites for cloning into the pSP 19 multiple-cloning site (McCracken 1985). The 5 end of the primers was also designed for optimal restriction activity since digestion with restriction enzymes at the ends of DNA strands is often very inefficient. The cloning enzymes were chosen by both their presence in the pSP19 polylinker as well as their ability to cut at the


Figure 2 1 Design of Rap Ip truncation mutants The Raplp mutations were created with custom oligonucleotides used as primers for PCR amplification. A. The RAP 1 structural gene is displayed. It encodes a protein that has several functional domains including a DNA-binding domain an asymmetric bending domain, an activation domain and a silencing domain. The sites of complementary annealing for the oligonucleotide primers are indicated. B. The primers used for amplification contain either an EcoRI or a KpnI site as indicated Translation start and stop codons were designed into the sequence as indicated The genetic code triplets are bracketed above the sequence, and the associated amino acid and native position within the wild-type Rap 1 p are indicated. C. The products produced by PCR amplification were cloned into the poly linker of the expression vector PS 19. The SP6 promoter and the relative position of the poly linker are indicated.


A B. HB166 +I m1111muu111111111111111111 1nuu 1 1 r --::-::::-:.-::-:.-::-:.-::-:.-::-:.-::-::::-:.-::-:.-::-: 1 .. Y :.:1 ., ,, .. ., ., ., .... I --+ HB165 = Asymmetric DNA-bending domain, aa44-274 l .:-:;:.1 = DNA-binding domain aa361-596 = Activation domain aa630-695 = Silencin g domain aa665-827 Coding-strand primer Start A S F T D E EcoRl Codon 361 362 363 364 365 366 HB165 5'aaaacg gaattc atg gci tct ttf aca gat gag g 3' Noncoding-strand primers HB 163 5 'cggataacaatttcacacagg 3' Stop A A S N Y N Kpnl Codon 596 595 594 593 592 591 HB 166 5 'aaaaaa ctgcag tca ggc ggc aga gtt ata atf gc 3' C. Polylinker pSP19 HB163 +59


pSP56RT7 1 11111111111111mmmnnmmnu 11 SP6 StuJ 827 1 .: :-:: :-:.: :-:.:.-._-.:_-._-.:_-._-_. _-._/ }.;3 h c )?:) ,,,, ,, promoter B g lI 1-596 pSPTPI361-827 361 827 XbaI -------1t -.:--.:-.:--.:-._--.:-.:--.:.:--._.:---.:-. .. l .... 2 1 __ SP6 promoter pSPTPI361-596 B gll 1-596 Kpnl 36 1 596 ------ii .-._ ..... ........................... 1-1 --SP6 promoter = Asymmetric DNA-bending domain, aa44-274 r .. : : j = DNA-binding domain, aa36 l-5 96 = Activation domain, aa630-695 = Silencing domain aa665-827 Figure 2.2 Rap 1 p truncation vectors 60 The Raplp and Raplp truncations were produced by in vitro transcription followed by in vitro translation. The transcription reaction utilized the SP6 polymerase. There were three vectors. The plasmid pSP56RT7 contains the entire RAPl coding sequence. An mRNA encoding full-length Raplp aal-827 was produced by cleavage with XbaI followed by run-off transcription Similarly mRNAs encoding aal-583, aal-596 were produced run-off transcription after cleavage with StuI and BglII respectivel y Plasmid pSPTPI361-827 was created using primers HB 165 and HB 163 as described in Figure 2 .1. An mRNA encoding aa361-827 was produced by cleavage with XbaI followed by run-of transcription. Plasmid pSPTPI361-596 was created using primers HB 165 and HB 166 as described in Figure 2 1 An mRNA encoding aa361-596 was produced b y cleavage with KpnI followed by run-off transcription


61 ends of DNA strands as described by New England Biolabs ( 1996 ) Addition a l base s were included to move the restriction sites away from the very ends of the PCR products The PCR template was pSP56RT7 the same plasmid used to express full-len g th Raplp. The 5 cloning junctions were all confirmed by sequencing with HB167 and the 3' cloning junctions were confirmed by sequencing with HB 163 In vitro Transcription and Translation of Rap 1 p Constructs Ten micrograms of each DNA template were linearized by incubation with appropriate restriction enzyme. For pSP56RT7 cleavage with Xbal Stul B g ll BstBI or Bglll resulted in transcripts encoding amino acids 1-827 (full-length) 1-583 1-596 1677 or 1-701 respectively. The plasmid pSPRAP361-596 when linearized with Pst l resulted in a transcript encoding amino acids 361-596. The plasmid pSPRAP 3 6 l-8 2 7 when linearized with Xbal resulted in transcripts encoding amino acids 361-8 2 7 respectively. The templates were then transcribed with SP6 RNA polymerase Th e reacti o n conditions were 40mM Tris-HCl (pH 7.5) 6 mM MgCh 2 mM spermidine 1 0mM aCl lOmM DTT 0.1 mg/ml BSA 1 mM ATP 1 mM CTP 1 mM UTP 0.1 mM G T P 0 5 mM m 7 G(5 )ppp ( 5 )G 50 units Rnasin and 2.7 units SP6 RNA pol y meras e Afte r incubating at 37 C for 60 minutes the samples were treated with DNase I for 15 mi n ute s at 37 C followed by extraction with phenol / chloroform and precipitation with ethanol. The samples were resuspended in 20 of ddH 2 0 and incubated at 65 C for 15 minutes. The transcription products were stored at 70 C. The transcription products described above were translated in a Nucle as e Tr e ated Rabbit Reticulocyte Lysate (Promega) with [3 5 S]methionine to radiolabel the r es ulti ng proteins. Two micro liters of the in vitro transcribed RNA was combined with 18 rabbit


reticulocyte lysate 1 l Rnasin 1 l 1 mM amino acid mixture minus methionine 2 [3 5 S]methionine 10 mCi/ml (Amersham) and 4 ddH2O. The positive control translation reaction used ll of Brome Mosaic virus (BMV) RNA (Promega). Transcription, Translation, and Purification of Gerl p(631-785) 62 The Gcrlp binding domain was produced as a malE: :Gc rl fusion protein. As previously described (Enea et al. 1975; Scott and Baker 1993) the E. coli strain TB 1 was transformed withpMAL: : GCRJ(631-785). This plasmid contains sequence encoding a ma1E::GCR1(631-785) fusion protein that is cloned downstream from a P1 ac promoter. A 500 ml culture was grown at 37C to an A 600 of 0.5. Then IPTG was added to a final concentration of2 mM to induce expression of the malE::GCRJ(631-785) fusion gene. The cultures were grown for an additional 2 hours at 3 7C and then harvested by centrifugation. The cells were then resuspended in 3 ml TEN lysis buffer (50 mM Tris [pH 8.0} 1 mM EDTA, 50 mM NaCl) per gram of cells. The bacteria were lysed using a French pressure cell at 20,000 lb/in 2 (Clifton et al. 1978). The cellular debris was pelleted by centrifugation at 17,000 x g for 20 minutes at 4C. The supernatant was retained as the crude protein extract. The MBP-Gcrlp(631-785) was purified by affinity chromatography utilizin g an amylose column. A 2.5 x 10 cm column was packed with 7 cm 3 of amylose resin The column was washed with three volumes (25 ml) of column buffer (10 mM phosphate 0.5 MM NaCl 1 mM azide, 1 mM DTT 1 mM EGTA) containing 0.25% Tween 20. The crude protein extract was diluted 1 :5 with column buffer containing 0.25% Tween 20. The diluted lysate was then passed through the column after which the column was washed with three volumes of column buffer containing 0.25% Tween 20. The column was then washed with three volumes of column buffer without Tween 20. The MBP


63 Gcr1(631-785) fusion protein was then eluted from the column using 10 nM maltose in 3 ml aliquots. Aliquots of each fraction was visualized via SDS-PAGE with Coomassie blue staining. The fractions that contained the fusion protein were pooled and concentrated by ultrafiltration in a Centriprep-30 concentrator (Amicon). Protein SDS-PAGE and TCA Precipitation of Translation Products The amount and quality of protein produced in the in vitro translation reactions was analyzed by both sodiumdodecylsulfate polyacrylamide gel electrophoresis (SDS P AGE) and trichloroacetic acid (TCA) precipitation. SDS-PAGE utilized a 3% acrylamide stacking gel and a 10% acrylamide separating gel. One rnicroliter of each translation reaction was diluted to 5 in loading buffer denatured at 100 C for five minutes and then loaded onto the gel that was then run at 20 mA until the bromophenol blue reached the bottom of the gel. The gel was then vacuum-dried onto 3MM paper (Whatman) and visualized via autoradiography. For TCA precipitation, 1 l of each translation product was mixed with 50 0.1 rnM sodium hydroxide (NaOH) and incubated at 37C for 15 minutes One milliliter of cold I 0% TCA was added to each sample and then incubated on ice for 60 minutes. Each sample was then applied to a fiberglass filter that was then washed twice with cold 10 % TCA. The filters were then counted in Scintiverse (Fischer) using a scintillation counter (Beckman, model LS5801). Probe Synthesis The probes were derived from the plasmids YipCD12 and YipCD13 (Drazinic et al. 1996). The plasmid YipCD12 contains both a Raplpand Gcrlp-binding site with the native PYKJ spacing. The plasmid YlpCD13 is identical except for the addition of 5 base-pairs between the two binding sites. These probes were used to investigate the


64 binding interactions between the Ger 1 p and the various Rap 1 p species. The plasmids pCD12 and pCD13 were cleaved with Xhol and Hnel to produce 71 base-pair fragments that were end labeled with Kienow fragment. The probes were then purified by gel electrophoresis. Binding Reaction The binding reactions were done in binding buffer ( 4 mM Tris [pH 7 .5], 12 mM 4-(2-hydroxyethyl)-1-piperazine ethanesulfonic acid (HEPES) [pH 7.5] 60 mM Kcl 5 mM MgCh 0.6 mM EDTA, 60mm DTT, 0.1 mg / ml polydeoxyinosinic-deoxycytidylic acid (poly(dI-dC)), 0.3 mg/ml BSA and 50% glycerol) The poly(dl-dC) functions as a non-specific competitor to inhibit non-specific binding by Ger 1 p or the Rap 1 p constructs. The DNA probes were diluted to 1 kcpm/l in binding buffer. The proteins were diluted using binding buffer, such that each sample produced approximately the same amount of binding activity. Combinations of the probes and proteins, as described in the Results were incubated in total volumes of 20 of binding buffer for 10 minutes at room temperature before loading onto the polyacrylamide gel. Electrophoresis The reaction mixtures were fractionated by molecular weight using electrophoresis through a non-denaturing 5% T (82: 1) polyacrylarnide gels using a 0 5X TBE running buffer, utilizing the Vertical Gel Electrophoresis System (Bethesda Research Laboratories, Model V16). Before loading the gels were pre-run at 100V ( 6.67 V /cm) for 2 hours. After loading the voltage was increased to 150V (10 V / cm ) To monitor the extent of electrophoresis loading dye (0 .25 % bromophenol blue 0 25 % xylene cyanol and 25% ficoll-400) was added to an empty lane. Band-shifts using the 72 base-pair probes derived from pCD12 or pCD13 were run until the bromophenol blue had


migrated 14 cm through the 15 cm gel. The gels were then vacuum dried onto 3MM paper (Whatman). Autoradiography and Phosphorimager Analysis Dried band-shift gels were exposed to using two Dupont Lightning Plus intensifying screens. The screen separating the gel and the film served the additional purpose of blocking most of the 35 S signal from the labeled protein. 65 Phosphorimages were produced using a Phosphorlmager (Molecular Dynamics). Using the peak finder function it was possible to calculate relative volumes of radioactive emission for each visible band. Control titrations were also included with each exposure to demonstrate that the screen maintains a linear absorption over the range of counts present in the gel (see Figure 2.3).


A. B. Counts(Z) 2100-4 0 50 LINE1 Sensltivi Noise Min Area Max. Area Auto No i s Baseline Kernel 64 0 005 0 0 No Automatic 12 Peak# Area Hei ht Percent Variance A x mm Se aration 1 26318 24 1946 834 53 259 2 74E+05 19 12 W 2 12233 92 728 794 24 757 4 82E+04 38 6 W 3 5951 062 440.456 12.043 1 63E+04 59 3 W 4 2713 516 192 548 5.491 3 77E+03 78 95 W 5 1237 54 82 024 2.504 8.45E+02 98 77 W 6 590 323 39 924 1 195 1 96E+02 118. 77 W 7 232 827 15 475 0.471 3 34E+01 139 3 W 8 83.973 6 212 0 17 4 31E+OO 158 95 W 9 36.746 2 997 0 074 6 68E-01 178 95 W 10 17 315 1.688 0.035 1 10E-01 199 65 W 8 10 100 150 200 Figure 2.3 Phosphorlmager quantification 66 mm The band shift gels were exposed to an Phosphorlmager (Molecular Dynamic s) scr ee n. The image was then decoded and the density of signal was calculated from a line centered over the signal and with width encompassing the signal. A. Thi s i s an exam pl e of a titration of which was used as a control exposure for linearity o f the phosphor esce nt screen. Each dot represents a progression of 50:50 dilutions. The solid line w a s pl ac e manually and dotted lines represent the width of the line in which data were calcul at ed B. The signal density for each of the dots is represented graphicall y The calculat e d area under each curve is displayed in the table. A similar method was u s ed for calcul at in g th e signal density for the bands in the bandshift gels


RESULTS Characterization of the Chromatin Structure at TPJI in Saccharomyces cerevisia e Chromatin structure has been shown to be an important factor in the transcriptional activity of many eukaryotic genes. The importance of chromatin structure should not be different for the glycolytic enzyme genes. As noted in the Introduction a hypersensitive site has been demonstrated for TDH3 and this structure changed in the context of a gcr 1 mutant. The following experiments were performed in order to elucidate the wild-type chromatin structure at TP 11 and to see if the gcr 1 mutation had a similar effect on the TPIJ chromatin structure as seen previously at the TDH3 locus TPJI was selected to serve as a model in which the promoter/UAS regions were defined in great detail. In addition, two other mutations that have been shown to effect glycolytic enzyme gene expression, gcr2 and gall 1 were evaluated for alterations in chromatin structure. Nuclease Sensitivity Patterns at TPIJ in Purified DNA Since both micrococcal nuclease and DNase I show varying degrees of sequence specificity, it is necessary to know the cleavage patterns in the absence of nucleosomes or other bound proteins. Otherwise interpretation of the in vivo pattern can be difficult. Samples of purified genomic DNA were treated with escalating concentrations of micrococcal nuclease or DNase I. They were then cleaved at the unique sites BsiHKAI or KpnI for indirect end-labeling and separated by electrophoresis in a 1.5% agarose gel. BsiHKAI cleaves within the TP JI coding sequence at position + 185 relative to the 67


68 translation start site and Kpnl cleaves within the TP II coding sequence at position + 511 relative to the translation start site. The DNA that had been fractionated b y electrophoresis was then transferred to a nylon membrane and indirectly end-labeled with a radioactive DNA probe. Nuclease treatment of purified naked genomic D A from the wild-type strain S 150-2B produced cleavage patterns at the TP II locus that were consistent with the cleavage characteristics of micrococcal nuclease and DNase I. The pattern produced by rnicrococcal nuclease digestion of purified DNA is labeled wild type" in Figure 3.1 lanes 1-3 and Figures 3.2 3 3 lanes 1-4 The pattern produced b y DNase I digestion of purified DNA is labeled 'wild-type in Figures 3 .3 and 3 5 lan es 14. Micrococcal nuclease produced a distinctive pattern that results from this enzym e s higher affinity for dAdT-rich duplex DNA sequences (Gross 1988) D ase I produced a more uniform smear which results from its lower sequence specificity (Gross 1988 ). The same nuclease digestion patterns were seen when purified DNA from the strains HBY4, DFY641, and R884-1C were treated with micrococcal nuclease and DNase I. These strains contain gcr I gcr2 and gall I mutations respectively. This sen s iti i ty pattern was used for comparison when evaluating the in vivo treated samples Statistically Positioned Nucleosomes are Present Both Upstream and Downstream from the TP II Structural Gene The wild-type strain S150-2B was treated in vivo with DNase I and rnicrococcal nuclease after spheroplasting and simultaneously with permeabilization with dilute P40. They were treated with escalating concentrations of each nuclease The y w ere t hen lysed and their DNA purified. The DNA samples were cleaved at the unique restriction sites BsiHKAI or Kpnl. The DNA fragments were separated by electrophoresis in a 1.5% agarose gel transferred to a nylon membrane and indirectly end-labeled usin g a


Figure 3.1. MNase sensitivity pattern upstream from BsiHKAI Micrococcal digestion looking upstream from BsiHKAI restriction site. Spheroplasts permeabilized with NP-40 were treated with increasing concentrations of micrococcal nuclease. The strains used were S150-2B HBY4 DFY-41 and R884-1C. They represent wild-type (lanes 47) and the gcr 1 (lanes 8-11 ) gcr 2 (lanes 12-15 ) and galll (lanes 16-19) mutants respectively. Purified DNA from the wild-type strain S150-2B was used to display the digestion pattern that results from the sequence specificity of micrococcal nuclease. Lanes 1-3 contain purified genomic DNA that was treated with increasing concentrations of micrococcal nuclease Lane 2 0 cont a in s a lambda HindIII size marker. The samples which were treated in situ are displa y ed in groups of four lanes for each strain treated. From left to right each group o f four lanes represents treatment with 0.012 0 04 0.12 and 0.4 units of micrococcal nuclease respectively. The nuclease sensitivity pattern is interpreted to the immediate right of the autoradiograph The ovals are located at regions of nuclease protection and the y represent statistically positioned nucleosomes. The vertical striped box represents an area of nuclease sensitivity characterized by a digestion pattern identical to that o f purified DNA. Genetic landmarks are illustrated to the right of the nuclease sensiti v ity illustration The open reading frames for DBF4 YDR05JC and TPIJ are represented by black arrows The VAS rp11, TATA and transcription start site (Tx start ) are indic a ted b y a black box and two black lines respectively.


1 2 nuclease treated chromatin wild-type gcrlti. gcr2ti. i::: "Cl .s ::c: 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 70 YDR051C I UAS -TATA Tx start TPll


Figure 3.2. MNase sensitivity pattern upstream from Kpnl Micrococcal nuclease digestion looking upstream from Kpnl restriction site. Spheroplasts permeabilized with NP-40 were treated with increasing concentrations of micrococcal nuclease. The strains used were S150-2B, HBY4 DFY641 and R884-l C. They represent wild type (lanes 5-8) and the gcr 1 (lanes 9-12), gcr 2 (lanes 13-16), and gall 1 (lanes 17-20) mutants respectively. Purified DNA from the wild-type strain S150-2B was used to display the digestion pattern resulting from the sequence specificity of micrococcal nuclease. Lanes 1-4 contain genomic DNA that was treated with increasing concentrations of micrococcal nuclease. Lane 21 contains a lambda-Hindlll size marker. The samples, which were treated in situ, are displayed in groups of four lanes for each strain treated. From left to right each group of four lanes represents treatment with 0.012, 0.04, 0.12 and 0.4 units of micrococcal nuclease respectively. The nuclease sensitivity pattern is illustrated to the immediate right of the autoradiograph. The ovals are located at regions of nuclease protection and they represent statistically positioned nucleosomes. The vertical striped box represents an area of nuclease sensitivity characterized by a digestion pattern identical to that of purified DNA. The vertical empty box represents continued nuclease sensitivity but the degree of sensitivity in this area differs in the samples treated with DNasel (Figure 3.3). Genetic landmarks are illustrated to the right of the nuclease sensitivity illustration. The open reading frames for DBF4, YDR05JC and TPJJ are represented by black arrows. The UASrp11, TATA, and transcription start site (Tx start) are indicated by a black box and two black lines respectively.


72 nuclease treated chromatin wild-type gcr/6. gcr26. ga/11-313 .I:) ] 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 1819 20 21 YDR05JC I UAS TATA Tx start TPJJ


Figure 3.3. DNasel sensitivity pattern upstream from Kpnl DNasel digestion looking upstream from Kpnl restriction site. Spheroplasts permeabilized with NP-40 were treated with increasing concentrations of DNasel. The strains used were S150-2B, HBY4, DFY641, and R884-1C. They represent wild-type (lanes 5-8) and the gcr 1 (lanes 9-12), gcr 2 (lanes 13-16) and gall I (lanes 17-20) mutants respectively. Purified DNA from the wild-type strain S150-2B was used to display the digestion pattern that results from the sequence specificity of micrococcal nuclease. Lanes 1-4 contain genomic DNA that was treated with increasing concentrations ofDNase. Lane 21 contains a lambda HindIII size marker. The samples that were treated in situ are displayed in groups of four lanes for each strain treated. From left to right each group of four lanes represents treatment with 0.01 0.02, 0.04 0.08 units ofDnasel respectively. The nuclease sensitivity pattern is illustrated to the immediate right of the autoradiograph. The ovals represent statistically positioned nucleosomes The vertical striped box represents an area of nuclease sensitivity which is characterized by a digestion pattern identical to that of purified DNA. The vertical empty box represents continued nuclease sensitivity, but the degree of sensitivity in this area is less than that seen in the are represented by the striped box. Genetic landmarks are illustrated to the right of the nuclease sensitivity illustration The open reading frames for DBF4 YDR051C and TPJJ are represented by black arrows. The UASrPII TATA, and transcription start site (Tx start) are indicated by a black box and two black lines respectively.


74 nuclease treated chromatin wild-type gcrlCi gcr21l ga/11-313 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 l DBF4 YDR05/C I UAS TATA Tx start TPII


Figure 3.4. MNase sensitivity pattern downstream from Kpnl Micrococcal nuclease digestion looking downstream from Kpnl restriction site. Spheroplasts permeabilized with NP-40 were treated with increasing concentrations ofmicrococcal nuclease. The strains used were S150-2B HBY4 DFY641 and R884l C. They represent wild-type (lanes 5-8) and the gcr I (lanes 9-12) gcr 2 (lanes 13-16) and gall I (lanes 17-20) mutants respectively. Purified DNA from the wild-type strain S150-2B was used to display the digestion pattern which results from the sequence specificity of micrococcal nuclease. Lanes 1-4 contain genomic DNA that was treated with increasing concentrations of micrococcal nuclease respectively. Lane 21 contains a lambda-HindIII size marker. The samples that were treated in situ are displayed in groups of four lanes for each strain treated. From left to right each group of four lanes represents treatment with 0.012 0.04 0.12 and 0.4 units of micrococcal nuclease respectively The nuclease sensitivity pattern is illustrated to the immediate right of the autoradiograph. The ovals represent statistically positioned nucleosomes. The vertical striped boxes represent areas of nuclease sensitivity which were characterized by a digestion pattern identical to that of purified DNA. Genetic landmarks are illustrated to the right of the nuclease sensitivity illustration. The open reading frames for YDR049Wand TPII are represented by black arrows The asterisk represents the location of a putative poly(A) signal sequence.


nuclease treated chromatin ga/11-313 ] :::::===~~;::::-===~~ ;:::::::~~;:=~-====-~~ ;:::=:=~ ] 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 wild-type gcrl!l. gcr2!l. 76 YDR049W TPIJ


Figure 3.5. Dnasel sensitivity pattern downstream from Kpnl DNaseI digestion looking downstream from Kpnl restriction site. Spheroplasts permeabilized with NP-40 were treated with increasing concentrations of D asel. The strains used were S150-2B, HBY4, DFY641 and R884-1C. They represent wild-type (lanes 5-8) and the gcrl (lanes 9-12), gcr2 (lanes 13-16) and gall I (lanes 17-20) mutants respectively. Purified DNA from the wild-type strain S 150-2B was used to display the digestion pattern which results from the sequence specificity of DN asel. Lanes 1-4 contain genomic DNA that was treated with increasing concentrations of D asel. Lane 21 contains a lambda-HindIII size marker. The samples which were treated in situ are displayed in groups of four lanes for each strain treated. From left to right each group of four lanes represents treatment with 0.01 0.02 0.04 0.08 units of DNasel respectively. The nuclease sensitivity pattern is illustrated to the immediate right of the autoradiograph The ovals represent statistically positioned nucleosomes. Th e vertical striped boxes represent areas of nuclease sensitivity which were characteri z ed by a digestion pattern identical to that of purified DNA. Genetic landmarks are illustrated to the right of the nuclease sensitivity illustration The open reading frames for YDR049W and TPJJ are represented by black arrows. The asterisk represents the location of a putative poly(A) signal sequence.


78 nuclease treated chromatin wild-type gcrl/1 gcr2A gall 1-313 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 YDR049W -* TPJJ


79 radioactive DNA probe. Both enzymes produced distinct ladders of nuclease protections with intervening areas of nuclease sensitivity. The micrococcal nuclease pattern of S 1502B is seen in Figure 3.1 lanes 4-7 and Figure 3.2 lanes 5-8 and the DNase I pattern is seen in Figure 3.3, lanes 5-8. Extending upstream from the 5' end of the UASrp11 element there is a ladder of alternating areas of nuclease sensitivity and protection. There are seven protected areas. After the seventh area of protection the micrococcal nuclease pattern changes subtly and then it continues for what appears to be an additional four areas of nuclease protection. In the DNase I samples the area, which had the pattern change demonstrated a small region of nuclease hypersensitivity (Figure 3.3). This transition is spatially related to the 5' end of the open-reading frame YDR051C and the 3 end of the DBF4 gene (Chapman and Johnston 1989 ; Cherry et al. 1998). It is noted that the ladder of nuclease protections lies over the coding sequence for open-reading frame YDR051 C. The average repeat length for the seven areas of protection is 170 base-pairs. This is slightly longer than the known repeat length of 160 base-pairs for S. cerevisiae (Bernardi et al. 1991 ; Thoma 1992). There is an area of hypersensitivity that extends from the 5 end of the UAS rPI/ element to the transcription start site. This is best seen in the DNase I samples (Figu r e 3.3, lanes 5-8) but it is also seen in the micrococcal nuclease samples (Figure 3.2 lanes 5-8). This area of hypersensitivity is consistent with a nucleosome-free region. There is also some nuclease protection located over the TP II structural gene. Both micrococcal nuclease and DNase I sensitivity patterns over the coding sequenc e are identical to that seen in the naked DNA samples but the intensity of these bands is less


80 in the in vivo treated samples. This implies a modest, although incomplete nuclease protection. However, the intensity of the bands are less than that seen over the upstream promoter region. This protection over the structural gene is also more evident in the DNase I samples (Figure 3.3). Extending downstream from the TP 11 gene, a second ladder of nuclease protections is identified by micrococcal nuclease digestion (Figure 3.4 lanes 5-8). It is also seen faintly in the DNase I digested samples (Figure 3.5 lanes 5-8). This ladder of nuclease protections with intervening nuclease sensitivity extends for at least nine areas of protection. After the ninth area of protection the pattern becomes less clear due to the sequence specificity of micrococcal nuclease, but the nuclease sensitivity pattern may continue for another four more cycles before the next KpnI cleavage site prevents further evaluation. This is consistent with at least nine and possibly 13 positioned nucleosomes extending away from TP 11 in the 3' direction. These have an average size of 160 base pairs. This downstream ladder of nuclease protections overlie an ORF designated YDR049W (Cherry et al. 1998). Nuclease Sensitivity Patterns Are Not Affected By Mutations In gcr 1. gcr2, or gall I The strains containing the mutations gcr 111 gcr 2 L1 and gall 1-313 were treated in vivo with micrococcal nuclease and DNase I in a manner identical to that described above for the wild-type strain S150-2B. As described in the introduction all three of these mutations have been shown to affect the level of transcription of glycolytic enzyme genes. There does not appear to be any significant difference in the nuclease sensitivity patterns seen either upstream or downstream from the TP11 structural gene (Figures 3.1, 3.2 3.3 3.4 3.5)


81 Raplp Binding is Required for Binding of Gcrlp at TPJJ in vivo An in vivo dimethylsulfate (DMS) meth y lation protection assay was used investigate the hypothesis that Raplp is required for Gcrlp binding at the UAS rp11. Thi s assay is commonly referred to as in vivo footprinting. In vivo analysis of the hypothesized Rap 1 p / Gcr 1 p interaction at the TP I1 locus required a conditional mutation in Rap 1 p because both Rap 1 p and trios phosphate isomerase are essential proteins. For this study the RAP J allele rap I-i s was used It is one of a collection of temperature sensitive (ts) alleles of RAP 1 that were isolated and characterized by Kurtz and Shor e (1991) They demonstrated that upon a shift to the non-permissive temperature of 37 C the rapl-i s protein no longer binds the Raplp DNA-binding site. The isogenic strains used in this study were YDS485 containing wild-type RAP 1 and YDS487 containing the rapl-2 1 5 allele. DMS Footprinting at the Permissive Temperature Demonstrated Protection at All Known Binding Sites Previous DMS footprinting of TPJJ had been done at 30 C (Huie et al. 1992 ; Lopez et al. 1993). Thus, it was necessary to demonstrate that culture growth and DMS treatment at 24C the permissive temperature for YDS487 do not affect protein binding. Cultures of YDS485 and YDS487 were grown at 24 C to log-phase at an oo= l harvested and treated with DMS at 24C. Purified DNA samples from these treated cell were digested at the unique site Avall and then treated with piperidine at 95 C for 3 0 minutes to cleave DNA at the guanine residues methylated by DMS. The D A fragments were then separated on a sequencing gel and transferred to nylon membrane. Indirect end-labeling demonstrated protection over the known binding sites for Reb 1 p Raplp and Gcrlp (Figure 3.6 lanes 3 and 6).


Figure 3.6 In-vivo footprint analysis at the UASTPII In-vivo footprint analysis at TPIJ in wild-type and rapl-2ts mutant strains In vivo guanine methylation protection assays of the UASTPJJ were performed in the wild type strain S150-2B and the rapl-2ts mutant strain YDS485 at permissive and non permissive temperatures and while inhibiting protein synthesis with cycloheximide. Lanes 1,2,8, and 13 contain samples prepared by DMS methylation of purified DNA. These reference lanes display all the guanine residues in the sequence. Lane 3 contains YDS485 DNA that was treated in vivo with DMS for 5 minutes at 24 C after a 30 minute incubation at 24C. Lanes 4 and 5 contain YDS485 DNA that was treated in-vivo with DMS for 5 minutes at 37C after a 30 and 60 minute incubations respectively at 37C. Lanes 6 and 7 contain YDS485 DNA that was treated in vivo with DMS for 2 minutes at 24C and 37C after 30 minute incubations at 24 C and 37C respectively. Lanes 9 and 10 contain S150-2B DNA which was treated in v ivo with DMS for 5 minutes at 37C after a 30 minute incubation at 37 C. Lanes 11 and 12 contain YDS485 DNA that was treated in vivo with DMS for 5 minutes at 24 C after a 30 minute exposure to 10 g/ml cycloheximide. The sequencing reactions and in-vivo footprints were resolved by electrophoresis on denaturing polyacrylamide gels, transferred to Hybond-N+ and visualized after indirect end-labeling by autoradiography. The positions of Reblp binding sites (stippled ovals) Gcrlp-binding sites (open ovals) and Raplp-binding sites (closed ovals) are indicated


83 1 2 3 4 5 6 7 8 9 10 11 12 13 8 Gcrlp 8 I I Raplp I I Gcrlp 8 9 Reblp g GGU UUUUG U U .9 .9G r-r-~rrru u NMMNM MM;>.,;>., u u Rapl-2 1 s RAPJ


84 DMS Footprinting at The Non-permissive Temperature Demonstrated Loss of Protection at Both the Raplpand Gcrlp-binding Sites DMS treatment was performed at the non-permissive temperature to investigate what effects the loss of Rap 1 p binding would have on the binding of Gerl p. Cultures of YDS485 and YDS487 were again grown at 24 C to an A 600 = 1. Aliquots of these cultures were then incubated at 37C the non-permissive temperature for 30 minutes and then treated with DMS at the same temperature. The DNA was then isolated and processed as described above. Indirect end-labeling demonstrated a loss of protection over both the Raplpand Gcrlp-binding sites in the YDS487 sample treated at 37C (Figure 3.6, lanes 4 5, and 7). This loss of protection indicated that Raplp and Gcrlp are not bound to their sites. Notably deprotection at these sites did not occur when the isogenic wild-type strain YDS485 was treated under the same 3 7 C conditions (Figure 3 .6 lanes 9 and 10). This indicates that the deprotection was specific to the rap I-i s mutation and not the strain background. Previous experiments have shown that Rap 1 p remains bound in the absence of Ger 1 p (Huie et al. 1992). Thus the in vivo binding of Ger 1 p was dependent on the binding ofRaplp at an adjacent site within the UASrPI/, but the binding of Raplp is not dependent on Ger 1 p. Inhibition of Protein Synthesis Does Not Affect DMS Protection at the Ger 1Binding Site Cycloheximide was used to demonstrate that the loss of Gcrlp-binding was not due to changes in protein synthesis. The transfer of a YDS487 culture to 37C is an irreversible and terminal event. If the culture is returned to 24C, it does not resume growth. Thus, one possible explanation for the loss of Ger 1 p binding was that cell death associated with the shift to the non-permissive temperature resulted in the cessation of


85 protein synthesis. It was possible that if protein synthesis ceased the intracellular concentration of Ger 1 p might drop, and Ger 1 p dissociation would occur by a shift in mass action equilibrium rather than a loss of Rap 1 p facilitation. To test this the wild type YDS485 strain was grown at 24C until a density of A 60 o=l had been reached. The cells were then treated with cycloheximide for 30 minutes at a concentration (1 0g / ml) adequate to arrest growth. Cycloheximide inhibits protein synthesis by preventing polypeptide elongation (Ferguson et al. 1967). The standard DMS footprinting protocol was then performed. Indirect end-labeling of the resulting blot demonstrated that the binding sites for Reblp Raplp, and Gcrlp remained protected (Figure 3 6 lanes 11 and 12). This protection indicates that inhibition of protein synthesis did not affect the binding equilibrium of these proteins. The timeline of these experiments suggests that these changes are a direct result ofRaplp dissociation rather than secondary to other cellular events such as DNA replication and the process of cell division. In the experiments presented here the deprotection was evident after 30 minutes of incubation at the non-permissive temperature. The shortest incubation time performed was 20 minutes which also demonstrated Raplp-dependent protection over the Gcrlp-binding site (not shown). This interval is much shorter than the two hour doubling time for the wild-type strain grown at 30C or four hours for the mutant strain when grown at 24C. Raplp Facilitates the Binding of Gcrlp in vitro Having shown that Rap 1 p was required in vivo for the binding of Ger 1 p in v itro electrophoresis mobility gel-retardation analysis was used to characterize this bindin g dependence further. The mobility retardation assay, also known as a band-shift was


86 utilized to compare Ger 1 p binding with and without Rap 1 p present in the binding reaction. In these experiments a DNA probe was pre-incubated with the proteins of interest to allow binding. The mixture was then separated by electrophoresis through a non-denaturing polyacrylamide gel. Electrophoresis separates the bound from the unbound probe because the protein-bound probe has a higher molecular weight and migrates more slowly through the gel matrix If one binding protein is present in the binding reaction there would be two bands produced: 1) free probe and 2) protein bound probe. If two binding proteins were present in the binding reaction there would be four bands produced: 1) free probe 2) probe+ protein-I 3) probe+ protein-2 and 4) a ternary complex of probe bound by both proteins. The ability of one protein to facilitate the binding of another can be tested by comparing the amount of probe shifted by each protein alone to the amount of probe in the ternary complex which is produced when both proteins are present in the same reaction. If the two proteins bind independently and no facilitation occurs then they should produce a ternary complex whose radioactive signal equals the multiplication product of the radioactive signals produced when each protein is incubated alone. Conversely if facilitation does occur then the radioactive signal of the ternary complex would be greater than this multiplication product. The end-labeled DNA probes used in these experiments were modeled after the sequence of the UAS element of PYKJ (Drazinic et al. 1996). One probe was derived from pCD12, which includes the binding sites for Rap Ip and Gcrlp as found at the UAS element of PYKJ. A second probe was derived from pCD 13 in which the same Rap 1 and Gerl p-binding sites were separated by five base-pairs. Separation of the two sites by


87 five base-pairs has been shown qualitatively to decrease the binding of Ger 1 p both i n v i vo and in vitro footprinting (Drazinic et al. 1996). The Gcrlp used in these experiments is a fusion between the Maltose-Bindin g Protein (MBP) and the DNA-binding domain of Gcrlp (MBP :: GCR h31-785)It w a s not possible to utilize full-length Ger 1 p because of its instability. This instability h as be e n seen when MBP-Gcrlp 1 78 5 has been synthesized either in E. c oli or in rabbit r et icul ocy t e lysate systems (Huie and Baker 1996) and as a result it has not been possible to puri fy full-length Grclp for use in vitro experiments The Raplp species used in these experiments included full-length Raplp a s we ll as aminoand carboxy-terminal truncations. As displa y ed in Figure 3.7 th e amin o terminal truncation deletes the asymmetric DNA-bending domain (Muller et al. 199 4) and the carbox y -terminal truncation deletes the transcriptional activation domain ( Su s sel and Shore 1991 ) and the transcription silencing domain (Sussel and Shore 1991 ). If both ends are deleted only the minimal DNA-binding domain remains (Henry et al. 19 9 0 ). The Gcrlp and Raplp proteins produced discrete single band-shift s w h e n u se d alone and they produced discrete single ternary complexes when used in combin a ti o n. The DNA probe alone produced a single band (Figure 3 7 panel b lane 1 ) Th e individual addition of each of the proteins Gcrlp Raplp 36 I596, Raplp 36 1s21, R a plp 1 .s96, and Raplp1 s 21 produced a single shifted band ( Figures 3.7 and 3 8 panel b l anes 2 4, 5, 7 9 and 11 respectively) in addition to the free probe. When Gcrlp was combin e d w ith each individual Rap 1 p species an additional band representing the ternar y compl ex was seen in each case ( Figure 3 7 panel b lanes 6 8 10 and 12)


Figure 3.7 Bandshift of Raplp and Gcrlp using native spacing. A. The drawing is represents the Rap 1 p protein and highlights its functional domains. This panel also displays the four Rap 1 p species used in the bandshift analysis. B. This is an autoradiograph of the in vitro bandshift gel in which Ger 1 p was incubated with and without the four Rap 1 p species. Lanes 1 and 2 show unbound probe and probe bound by Gcrlp respectively. Lane 3 contains probe and BMV proteins translated in vitro using rabbit reticulocyte lysate. Lane 4 is the same as lane 3 with the addition of Gerl p. Lanes 5 12 all contain probe and Gerl p with the addition of the indicated Raplp species in lanes 6 8 10 12. The bands representing probe bound by Gcrlp are indicated by the empty arrow to the ri g ht o f the autoradiograph and the bands representing the various Rap 1 p species are indicated by filled arrows to the right of the autoradiograph. The ternary comple x es are indicated by black dots on the autoradiograph. C. This is a table that displays the phosphorimage data collected using a Molecular Dynamics Phosphorlmager. T h e data in this table is in phosphorimager units.


A. R a plp 44 274 361 596 630 695 Dllll llll~IllllfflWIJI = =~ : ,--,-----. .-:.:~ :--:. --.. :.:--:.:.: :.-,:, /\--..:.:-::-:: ~ _.-:.:,.:.-: --.. .:.:--:.:. ~ :--:.:-. -~~ik ~ m -_ Z'.Z22 -_ ~_ z llllllrn = Asymetric DNA-bending domain, aa44-27 4 : .: = D A-binding domain, aa361-596 = Activation domain, aa630-695 t;:0~ = Silencing d o m ai n aa665-827 B. Gcrlp R ap lp R ap l p R a p l p (63 1785) BMV (36 1-5 96) (36 1-8 27) ( 1-596 ) + + -+ ~ -+ l + C. 665 827 Rap l p( 1-8 27) Raplp(l 596 ) Rap l p(36 l-596) R a plp ( 1-827 ) + Raplp(361-8 2 7) R a p l p(l-827) R a plp ( l-59 6) R a plp (36 1-827 ) = Gcrlp(631-785 ) R a plp (36 1-5 96) Freeprobe 89 Raplp R ap l p Gerl p Ternary Free Total co unts Ternary Gcr lp free Gcrlp Raplp Free Rap Ip Expected Act./Exp Avg construct oeak oeak oeak orobe in l ane % alone orobe % alone orobe % Gcrlo 361-596 I= 1 878 661 6520 1 1052 2 6.3 % 2546 9786 26.0 % 2042 8552 19 3 % 5 0 % 1.3 1.5 1739 1664 852 6074 1 8591 9 9 % 2262 9713 23.3 % 2992 8652 25 7 '1 6 0 % 1.7 527 585 266 2 133 35 11 7.6 % 769 3294 23.4 % 756 2870 20 9 '1 4 9 % 1.6 361-827 2533 979 19 85 4 14 5 9643 20.6 % 2546 9786 26.0 % 3820 7019 35.2 % 9 2% 2.2 2.4 2 140 1260 1729 4530 75 1 8 23 0 % 2262 97 1 3 23.3 % 3444 6896 33.3 % 7 8 % 3.0 522 481 3 1 8 2023 3344 9.5 % 769 3294 23.4 % 711 2617 21.4 % 5 0 % 1.9 1-5 96 1 387 1 889 19 1 0 6712 I 1 898 16 .1% 2546 9786 26.0 % 2417 9541 20.2 'll 5 3 % 3 1 3 3 11 62 1578 1890 6273 9741 1 9.4 % 2262 97 1 3 23.3 % 2916 9004 24.5 \ll 5.7 % 3.4 369 535 527 2087 3519 15 0 % 769 3294 23.4 % 684 2852 19 3 '1 4.5 % 3 3 1-827 1633 1482 1668 5702 10484 15 9 % 2546 9786 26.0 % 2620 7619 25.6 '1 6.7 % 2.4 3 2 1 213 1462 1164 6324 8950 13.0 % 2262 9713 23.3 % 1642 9191 15 2 'll 3.5 % 3 7 363 497 1 324 2120 294 1 11.0 % 769 3294 23.4 % 4 56 2873 1 3.7 % 3 2 % 3.4

PAGE 100

Figure 3.8. Bandshift ofRaplp and Gcrlp +5 basepairs separation A. The drawing is represents the Raplp protein and highlights its functional domains. This panel also displays the four Raplp species used in the bandshift analysis B This is an autoradiograph of the in vitro bandshift gel in which Ger 1 p was incubated with and without the four Rap 1 p species. Lanes 1 and 2 show unbound probe and probe bound by Gcrlp respectively. Lane 3 contains probe and BMV proteins translated in vitro using rabbit reticulocyte lysate. Lane 4 is the same as lane 3 with the addition of Ger 1 p. Lanes 5-12 all contain probe and Ger 1 p with the addition of the indicated Raplp species in lanes 6 8 10 12. The bands representing probe bound by Gcrlp are indicated by the empty arrow to the right of the autoradiograph and the bands representing the various Rap 1 p species are indicated by filled arrows to the right of the autoradiograph. The ternary complexes are indicated by black dots on the autoradiograph. C. This is a table that displays the phosphorimage data collected using a Molecular Dynamics Phosphorlmager. The data in this table are in phosphorimager units

PAGE 101

A. B. C. Raplp c onstruct 36 1-596 361-827 1-596 1 -82 7 Raplp Ulllllll = Asymetric DNA-bending domain, aa44-274 .: -._: = DNA-binding domain aa36J-596 ESSSJ = Activation domain, aa630-695 = Silencing domain aa665-827 Gcr l p R a plp Raplp 63 1785 BMV 361-596 36 1-8 27 + I + I + + R a plp Gcrlp Ternary Free Total co unts Supershift oeak nf'.ak ""-"k probe in l ane % 385 310 82 1414 1 806 4.5 % 582 279 39 1144 1461 2.7 % 348 327 3 0 15 1 8 1 875 1 6 % 326 288 no n ea k 1407 1695 NIA 665 827 R ap 1 p( 1-827) Raplp(l-596 ) Rap 1 p(361-596 ) Raplp (361-827) Rap Ip (1-827) Raplp ( l-5 96) Raplp(361-827 ) = Gcr lp (631 785) Rap Ip (361-596) Free probe 91 Gcr lp free Gc rlp Raplp Free R a plp Expected Act./Exp alone probe % alone probe % Gcrlp 438 2 167 20.2% 506 1833 21.6 % 4 4 % 1.0 4 3 8 2167 20.2% 533 1596 25 0 % 5 1 % 0 5 438 2167 20 .2% 393 1819 17 7 % 3.6% 0 4 4 38 2167 20 .2% 323 1927 14 4 % 2.9% NIA

PAGE 102

The Raplp DNA-binding Domain Is Necessary But Not Sufficient for the Facilitation of Ger 1 p in vitro 92 When the Raplpand Gcrlp-binding sites are in their native spacing (Figure 3.7), facilitation of Gcrlp binding is seen with the full-length Raplp the amino-terminal Raplp truncation and the carboxy-terminal Raplp truncation but not with the Raplp binding domain alone. The radioactivity of each band was measured in Phosphorlmager units and the results are tabulated in Figure 3.7 panel c. The values in the expected" column represent the multiplication product of the fraction of counts shifted for Ger 1 p (Figure 3. 7 panel b lane 4) and the fraction of counts shifted for each Rap 1 p species (Figure 3.7 panel b, lanes 5, 7 9, 11). A ratio of the "expected" ternary activity to the actual ternary activity was then calculated. This experiment was performed on three different occasions and the ratios for each of these experiments were averaged. The Raplp1.s21 and Raplp1.s96 species are both associated with ternary complex activity that was more than 3 fold higher than would be expected if no facilitation occurred. The Rap 1 P361-s21 species produces a ternary complex with activity 2.5 fold higher than expected for non-facilitation. The Raplp 36I-S96 shows an activity only 1.5 fold higher than was expected if no facilitation occurred. Raplp and Gcrlp Binding Are Affected by the Intrasite Spacing As with the previous experiment the radioactivity of each band was measured in Phosphorlmager units. The results are tabulated in Figure 3.8 panel c. Again, the va lues in the "expected" column represent the multiplication products of the fraction of counts shifted for Ger 1 p (Figure 3. 7, panel b, lane 4) and the fraction of counts shifted for each Raplp species (Figure 3.7 panel b, lanes 5 7 9 11). The Raplp 1 5 9 6 and Raplp 361 827 species are both associated with ternary complex activities that are about half of what

PAGE 103

93 would be expected if no facilitation or inhibition occurred. The Raplp 36 1596 shows an activity 1.1 fold higher than was predicted if no facilitation or inhibition occurred T he ImageQuant software was unable to distinguish the ternary complex for the Rapl P1 -s21 species. Visual inspection of the volume curve revealed that it was the ternary peak w as no greater than those seen in the Rap 1 PI-596 and Rap 1 P 3 6 I-827 species. Thus the estimated ratio would be 0.5 or less. It is noted that the Rap 1 p species that displayed facilitati o n of Ger 1 p binding in the native spacing also displayed inhibition of Ger 1 p binding in th e + 5 spacing (Figure 3.9). The Raplp361-596 does not display facilitation or inhibition (Fi g ure 3.9). Brome Mosaic Virus (BMV) proteins produced by in vitro translation in rabbit reticulocyte lysate were used as a control for possible effects on Gcrlp bindin g th a t m i g ht result from the presence of rabbit reticulocyte lysate. The BMV samples were produced in a manner identical to the various Rap 1 p species. When they are incubated with th e DNA probes alone no band-shift is seen (Figures 3.7 and 3 8 lane 3). When the y ar e incubated with the DNA probes in combination with Ger 1 p there are no additional b a nd shifts or apparent ternary complexes seen. Thus there is no evidence that th e constituents of the rabbit reticulocyte lysate bind the DNA probes. There is a s li g ht increase in the binding of Gcrlp. In the presence of the BMV proteins and rabbit reticulocyte lysate the fraction of probe bound by Gerl p increased on average b y 0. 04. This increases the actual/expected" ratios by 0.1 in all samples This produce s a negligible effect on the final calculations and analysis. For example the R a pl p 36 1 596 produced an actual to expected ratio of 1.5. When the effect of the BMV / rabbit reticulocyte lysate is included the ratio becomes 1.6. The BMV sample was added as 2

PAGE 104

A. Raplp 44 274 361 596630 695 11111111111111111111111111111111111111111111 665 827 B. llilIIIIJ = Asymmetric DNA bending domain aa44-274 r -. _:J = D A-binding domain aa361-596 g ,, SJ = Activation domain aa630-695 IZ?Z) = Silencing domain aa665 -82 7 4 :& ~-:: 3 2 i -0 B c.) V 2 0.. :< o:l B c.)
PAGE 105

95 l of a 1 :2 dilution so this effect is most relevant to the Rap 1 P 36 I596 lanes in which th e Raplp was added as 2 l of a 1:2 dilution. The Raplp3 6 1-s21, Raplpi596, and Raplp1 -s21 were added as 2 l of 1 :32 1: 16 and 1: 16 dilutions respectively resulting in a dilut i on of the rabbit reticulocyte lysate component. Thus the effect is even less in these sampl e s.

PAGE 106

DISCUSSION The activation of eukaryotic transcription is a process that requires more than just an RNA polymerase and a DNA template. It is a process that requires complex interactions between a large number of proteins including histones, chromatin modifying complexes, transcriptional activators transcriptional repressors, mediators as well as the polymerase complex. These interactions are defined and initiated by the D A sequence elements known as enhancers or upstream activator sequences (UASs) and they are found within the promoter regions for each gene. They are characterized as modular structures containing binding sites for defined sets of proteins. The UAS elements of the glycolytic enzyme genes contain binding sites for a conserved set of DNA-binding proteins, including Reblp, Abflp, Raplp, and Gcrlp. There are also several non-DNA binding proteins that have been shown to play an important role in the activation of glycolytic enzyme genes. These include Gcr2p and Gall Ip. It was the goal of this work to better understand the relationships between these proteins and what roles they play in initiating the cascade of interactions that finally results in transcriptional activation Gcrlp Binding Depends on the Presence of Raplp The modularity of UAS elements is a recurring theme, and as a result it has been believed to be an important component in their function. The presence of adjacent Raplpand Gcrlp-binding sites has been found to be a hallmark of their structure. Since this relationship is so highly conserved it has been presumed to be important in the 96

PAGE 107

97 activation of transcription at these genes. The only other major class of promoters regulated by Gcrlp are the Ty elements (Lopez and Baker 2000). The Gcrlp-binding sites at Ty elements do not have associated Rap Ip-binding sites but their expression is influenced by adjacent sequences (Turkel et al. 1997; Dudley et al. 1999 Lopez and Baker 2000). Thus it has been hypothesized that a second protein may be important for the binding of Gcrlp at Ty elements (Lopez and Baker 2000). The data presented here demonstrate that at least one function for Rap 1 p is to direct the binding of Gcrlp to its DNA-binding site This finding unifies several characteristics of each protein, and it provides a mechanism for promoter specificity at the glycolytic enzyme genes. Gerl p is known to be a transcriptional activator. It was surprising however, that Gerl p had a relatively low specificity for its binding site. This was surprising because Gerl p is a low abundance protein and yet its binding sites are always bound in vivo. Given its close binding proximity, Raplp presented itself as a candidate as a possible specificity factor for Ger 1 p. Using temperature sensitive mutants ofRaplp, it was possible to disrupt Raplp binding and to demonstrate that this loss of Rap 1 p binding was associated with a concomitant disruption in Gcrlp binding (Figure 3.6). This was accomplished at the TP I1 locus where the Rap 1 p-binding site is flanked by two Ger 1 p-binding sites. At the non-permissive temperature, all three binding sites became sensitive to DMS methylation indicating a loss of binding. Prior work has shown that mutations that disrupt Gerl p binding do not disruption Rap 1 p binding. Thus Ger 1 p is dependent on Rap 1 p for specific binding, but Rap 1 p is not dependent on Ger 1 p for specific binding Several important control experiments were included that demonstrate that these results were not

PAGE 108

a side effect of either the background yeast strain, the temperature change or the cessation of protein synthesis. 98 The finding that Gcrlp depends on Raplp for its binding specificity is consi s tent with previously known characteristics of these two proteins. As noted above Gerl p has relatively high DNA binding affinity but low binding specificity. Its dissociation constant (Ko) is 2.9 X 1010 however there is only a 33-fold difference between its specific and non-specific binding (Huie and Baker 1996). This differs from Rap 1 p which has both a very high binding affinity and specificity. Its dissociation con tant is 1.3 X 10 11 and the difference between specific and non-specific binding exceeds 5 orders of magnitude (Vignais et al. 1990). Additionally Ger 1 p is known to be an activator when tested in isolation, and Raplp is known to be only a weak activator when tested in isolation. Thus the close proximity of the Raplpand Gcrlp-bindin g sites provides a mechanism by which Gerl p, a transcriptional activator can bind D A in a promoter specific manner. This would explain both the constitutive nature of Ger 1 p binding as well as the constitutive nature of glycolytic enzyme gene expression. The N-terminus and C-terminus ofRaplp Both Facilitate the Gcrlp Binding Specificity The mechanism by which Raplp facilitates the Gcrlp binding specificity is unknown. Rap 1 p has been shown to contain several functional domains that are important for functions such as DNA binding asymmetric bending of the DNA strand transcriptional silencing, and transcriptional activation (Figure 3.9). The data presented here demonstrate that while the DNA-binding domain is necessary for the facilitation of Gcrlp binding in vitro it is not sufficient. The DNA-binding domain requires either the N-terminus or the C-terminus in order to facilitate Gcrlp binding in vitro This is

PAGE 109

particularly interesting because several possible mechanisms for their interaction mi g ht have predicted that one or the other of the termini would have been able to pro v id e facilitation of Ger 1 p binding but not both. 99 One possible mechanism for the Rap 1 p-dependent binding could be throu g h changes in DNA conformation at the Gcrlp-binding site In essence the bind i n g o f Raplp would change the tertiary structure of the Gcrlp DNA-bindin g sit e. Such a mechanism has been seen with relation to DNA bending. Several studies have s ho wn that proteins that bend DNA also bind with greater affinity to bent DNA ( Kahn and Crothers 1992 ) Both Rap 1 p and Ger 1 p are known to bend D A ( Huie and B ake r 1 9 96 ). Additionally Rap 1 p is known to create an asymmetric bend. It might have be e n predicted that either the DNA-binding domain of Raplp or the as y mmetric-bendin g domain of Rap 1 p w ould create conformational change s in the D A strand that ex t e nd t o the Gcrlp-binding site. While it is still possible that these may play a role in th e facilitation of Ger 1 p binding they do not appear to be the full explanation how e ver s ince the DNA-binding domain does not facilitate Gcrlp binding and the as y mmetric b e ndin g domain is not absolutely required Alternatively it could be argued that the D binding domain does in fact provide this facilitation but the DNA-binding dom a in i s not in its native conformation when produced without its Nor C-termini. It i s po ss ibl e t hat the presence of either termini produces a three dimensional structure at the D A -bindin g site that more accurately represents the native structure seen with the full-length prot e in. This would then result in a more functional protein A second hypothesis could be that the activation domain is important for G er 1 p binding. Since Raplp is a relatively weak activator in isolation it is possible th a t it s

PAGE 110

100 transcriptional activation function occurs through protein-protein interactions with additional activator proteins rather that with the polymerase complex directly. In this scenario it would be logical that the activation domain would be the site of this interaction. The possibility of such an interaction between Rap 1 p and Ger 1 p has been implicated by a report that Raplp and Gcrlp can be co-immunoprecipitated (Tornow et al. 1993). The co-immunoprecipitation data did not provide information about which domains ofRaplp and Gcrlp interact. However the band-shift data presented here indicate that the activation domain of Raplp is not absolutely required for facilitation of Ger 1 p binding. These mechanisms are not mutually exclusive and it is possible that both of them occur. This might explain how either domain can facilitate Gcrlp binding in v itro. It is interesting that the Rap 1 p C-terminal truncation mutant which contains the asymmetric bending domain, facilitates Gcrlp binding as strongly as full-length Raplp. The Raplp N-terminal truncation mutant facilitates Gcrlp binding to a lesser degree. Thus the asymmetric binding domain appears to have a stronger effect than the activation domain in vitro. It is unknown whether this difference is functionally significant. Also the i n vitro evidence presented here does not indicate whether either of these mechanisms are important in vivo. Raplp Mediated Gcrlp Binding Is Distance Dependent The spacing between the two binding sites appears to play an important role in their interaction. The band-shift data presented in Figure 3.8 show that separating the two binding sites inhibits binding facilitation. This correlates well with similar in vi v o data that show a decrease in methylation protection over the Gcrlp-binding site when the

PAGE 111

101 Rap 1 pand Gerl p-binding sites were separated by five basepairs (Drazinic et al. 1996). However, the prior in vivo data only indicated that there was decreased facilitation of Ger 1 p binding. The data presented here go one step farther and demonstrate that the separation of these two sites results in actual inhibition of Ger 1 p binding. The degree of Ger 1 p binding was decreased by about half when Rap 1 p was present in the in vitro binding reaction when compared to the same binding reaction in the absence of Rap l p. The distance dependent inhibition of Ger 1 p binding may provide further insight into the mechanism of the Rap 1 p-Gcr 1 p interaction. The two most likely mechanisms for this finding are either steric hindrance of binding or changes in DNA-binding site conformation. If the mechanism is steric hindrance this implies that Rap 1 p and Ger 1 p bind on opposite sides of the DNA strand. When the ites are separated by an additional half tum of the DNA helix these two proteins would then find themselves attempting to occupy overlapping spaces. It is also possible that the inhibition of binding results from changes in D A conformation at the Ger 1 p binding site. By separating the two sites by a half turn of the helix, the direction of bending induced by Raplp will be different and possibly exactly opposite that seen with the wild-type spacing. If the direction of strand bending differs it is likely that the widths of the major and minor grooves also differ. Thus, if the binding of Gcrlp depends on contacts within either of the two DNA grooves it is possible that these interactions are inhibited by alterations in major or minor groove conformation TPJJ Is Located Within a Permissive Nucleosome En ironment The glycolytic enzyme genes are expressed in a constitutive manner, and to achieve constitutive expression the UAS and promoter elements must pro ide a

PAGE 112

102 mechanism to maintain a permissive chromatin environment. TP I1 is known to be a highly expressed gene and its expression is essentially independent of the presence o r absence of glucose in the growth media Permissive chromatin has classicall y been represented by nuclease hypersensitivity and the data presented here demonstrate th a t th e TPJJ promoter contains such a region of nuclease hypersensitivity (Figure 4 1 ) Thi s region of hypersensitivity extends from the UAS element to the site of transcription initiation (Figures 3.1 3 2 3.3 4.1). The factors required for maintenance of this hypersensitive region are s till no t understood. Originally it was hypothesized that Reb 1 p was the responsible protein. This was inferred from experiments at the GALJ -GALJ O locus where maintenance o f a permissive chromatin structure was seen in the presence of an Reb 1 p-binding site bu t not when this binding site was absent (Fedor et al. 1988 ; Chasman et al. 1990 ). Ho w e ver more recent data have tested this hypothesis more directly and have shown that th e R e b 1 p is not required for the maintenance of a permissive chromatin structure at G A LJGAL J 0 (Reagan and Majors 1998) This does not mean that Reb 1 p does not play a rol e in th e formation of the TPJJ hypersensitivity region but it does cast doubt on this role. Testing the role of Reb 1 p and Rap 1 p at the TP 11 locus has been di f ficult bec a use all three gene products are essential for cell viability. This has limited e v aluation to reporter constructs located on plasmids or integrated at non-native locations. T his makes interpretation of chromatin structure at these locations problematic s ince unint e nded factors may create new nucleosome environments and dynamics. The data presente d here indicate that there may be boundary elements located both upand down-stream from the TP I1 structural gene. These boundary elements may provide a mechanism b y

PAGE 113

103 A. B. UAS TATA Figure 4 1 Summary of the TP11 chromatin and promoter structure A. The promoter of TP 11 is located within a distinct region of (grey rectangle). The TP 11 structural gene itself appears to be sensitive to nuclease digestion although less than over the promoter (hatches rectangle) This is in distinct contrast to the adjacent open reading frames YDR05 JC and YDR049W which both display a nuclease sensitivity pattern consistent with the presence of positioned nucleosomes. The mechanism by which the TP11 promoter is maintained within a nucleosome-free region is unknown but this study has shown that Ger 1 p Gcr2p and Gal 11 are not required for its maintenance (Holstege et al. 1998). Additionally it is known that the Swi/Snf and SAGA complexes do not play a significant role in the expression of the TP11. B. The UAS r m is known to be bound by Reblp Raplp and Gcrlp. Immediately upstream from this UAS the presence of positioned nucleosomes begin (hatched ovals). This study has demonstrated that Raplp is required for the binding of Gcrlp at its adjacent sites in vivo. There is evidence that Gcrlp is capable of forming protein-protein interactions with Gcr2p (Uemura and Jigami 1992 1995) and it is possible that Gcrlp recruits Gcr2p to the promoter. Gcr2p could then activate transcription throught either direct or indirect contact with the Pol II holoenzyme which includes Pol II the GTFs and mediator.

PAGE 114

104 which the TP 11 locus can be investigated at non-native sites. If these extended sequences are included in the experimental construct, it may be possible to show that they act as insulator elements. This may allow the maintenance of the native chromatin structure even when this DNA sequence is placed at a non-native site within the genome. TP11 Chromatin Structure Is Not Affected By Mutations in GCRJ, GCR2, or Gall I The nuclease sensitivity patterns at TP11 are not affected by mutations in GCRJ, GCR2, or Gall 1. This was somewhat unexpected. All three of these genes have been shown to affect transcription of glycolytic enzyme genes. In addition, deletion of GCRJ has been associated with changes in the chromatin structure at the TDH3 gene (Pavlovic and Horz 1988). Specifically, the deletion of GCRJ has been associated with the formation of two positioned nucleosomes over the proximal promoter including the TATA box at TDH3. The gcrl mutant did not eliminate the hypersensitive region completely. The hypersensitivity over the UAS region was maintained at TDH3. There was no reason to think that this would be different at TP 11 since both are highly expressed, constitutive genes and since they both have very similar DAS/promoter elements (Figure 1.2). The significance of this difference is uncertain at this time. These results do demonstrate that Ger 1 p, Gcr2p, and Gal 11 p are not required for the maintenance of the open chromatin structure at TP 11. The formation of two nucleosomes seen previously at the TDH3 promoter could be consistent with the loss of the PolII complex over the TAT A element. It is possible that the PolII complex remains bound at the TP11 promoter, preventing the deposition of nucleosomes. If this were the case, it might imply that the Ger 1 p, Gcr2p, and Gal 11 p are required for initiation of PolII transcription at TP 11 but not PolII binding.

PAGE 115

105 Chromatin Structure At Surrounding Open Reading Frames The statistically positioned nucleosomes surrounding TPJJ may also reflect the transcriptional activity of the surrounding open reading frames (ORFs). Both YDR05JC and YDR049W were identified as open reading frames through the Yeast Genome Project, but neither has a characterized transcription product. When cells are grown in media containing glucose or glycerol/lactate, these ORFs are protected from nuclease digestion, and they demonstrate a repeating ladder of nuclease sensitivity. This implies the presence of statistically positioned nucleosomes over these regions. The intensity of the DNase I sensitivity ladder is less intense over YDR049Wthan over YDR051C (Figures 3.3 and 3.5); thus, it is possible that a subpopulation of cells within the cultures have transcriptional activity at YDR049W. However, neither of these coding sequences appears to be highly transcribed under normal logarithmic growth conditions. If these loci are discovered to be actively transcribed under defined growth or cell cycle conditions, they could provide a significant model with which to study the transitions between active and inactive chromatin structures. Model of Glycolytic Enzyme UAS Function The glycolytic enzyme genes have a highly conserved DAS/promoter structure, and they are defined by binding sites for a conserved set of transcriptional activator proteins. The modular nature ofUAS and enhancer elements has long implied that each transcriptional activator plays a specific role in the assembly of the promoter and polymerase complexes. These proteins are likely to play important regulatory roles in several stages of transcriptional activation including formation of a permissive chromatin

PAGE 116

106 environment recruitment of the PolII holoenzyme, and initiation of transcription (Figme 4.1). The mechanisms required for the formation of a permissive chromatin environment at the glycolytic enzyme genes in general and TP Il in particular are still not well defmed. The data presented here indicate that Ger 1 p, Gcr2p and Gal 11 p are not required for this process. This leaves Reb 1 p and Rap 1 p as the likely candidates. There is data from other genes that would support either protein in this role. As noted above Rep 1 p had been the prime candidate until recently but data from GAL] -GAL] 0 have placed this possibility in question. The statistically positioned nucleosomes that extend upstream from the UASrPII may demonstrate the presence of a boundary element. It seems most likely that this boundary element would be a DNA-binding protein. The TPJJ upstream region has been extensively studied and it is unlikely although not impossible, that additional DNA binding proteins are present at the UASrp11. Thus it is unlikely that a protein other than Reb 1 p or Rap 1 p play this role at TP Il. Use of the additional boundary elements identified in this study may allow further evaluation of the roles of Reb 1 p and Rap 1 p in forming this chromatin environment. It is now clear that Raplp is required for Gcrlp binding specificity. The relationship between Raplp which is an abundant and highly specific DNA binding protein and Ger 1 p which is a strong activator with low sequence specificity provides a perfect mechanism by which a known transcriptional activator can be brought to a specific promoter. Gerl p is a protein of very low abundance within the cell. It has an inherently high affinity for random DNA sequence and it requires Rap 1 p for specific binding. Ger 1 p has a low intracellular concentration and if any Ger 1 p remain s free in

PAGE 117

the cell it is likely to bind non-specifically to DNA. Thus the statistical chance that Ger 1 p might bind to an unintended promoter and produce in appropriate transcription would be low. 107 The final steps in the activation appear to be the interaction of Gerl p with non DNA-binding proteins specifically Gcr2p. There is genetic evidence that Gerl p and Gcr2p are capable of protein-protein interactions, and Gcr2p mutants have similar defects in transcription from glycolytic enzyme genes (Uemura and Jigami 1992 1995 ). Gal 11 p has been found as a component of the PolII holoenzyme (Kim et al. 1994) and Gall lp mutants have defects in glycolytic gene expression (Nishizawa et al. 1990 ; Stanway et al. 1994). It is possible that the Gcrlp and Gcr2p interact with Gall lp although no additional evidence exists to support this possibility. This cascade of events culminates in the activation of transcription. Further investigation into the mechanisms by which each of these proteins function will lead to a better understanding of transcriptional activation. Given the highly conserved nature of the PolII complex and the conserved modular nature ofUAS and enhancer elements it is likely that the mechanisms elucidated at the glycolytic enzyme genes of S. cerevisiae will provide models that are applicable to transcriptional activation in higher eukaryotes including humans.

PAGE 118

REFERENCES Allard S. R. T. Utley J. Savard A. Clarke P. Grant C. J. Brandl L. Pillus J. L. Workman and J Cote (1999) Nu.A4 an essential transcription adapter / histon e H4 acetyltransferase complex containing Esalp and the ATM-related cofactor Tralp ." EMBO Journal 18 ( 18): 5108-19. Allfrey V G. R Faulkner and A. E. Mirsky ( 1964). Acetylation and methylation of histones and their possible role in the regulation of RNA s y nth es is .' Proceedings of the National Academy of Sciences USA 51: 786794 Allison L. A. M. Moyle M. Shales and C J. Ingles (1985) "Ex tensi ve homology among the largest subunits of eukaryotic and prokaryotic RNA pol y m erases." Cell 42: 599-610 Almer A and W. Horz (1986). Nuclease hypersensitive re g ions with adjac e nt positioned nucleosomes mark the gene boundaries of the PHO5/PHO3 locu s in yeast. EMBO Journal 5: 2681-2687. Almer A. H. Rudolph A. Hinnen and W Horz (1986) Remo v al of po s itioned nucleosomes from the yeast PHO5 promoter upon PHO5 induction releases addition a l upstream activating DNA elements. EMBO Journal 5(10): 2689-96 Arents G ., R. W. Burlingame B.-C. Wang W E. Love and E N. Moudrian a kis (1991). The nucleosomal core histone octamer at 3.lA resolution: a tripartit e prot e i n assembly and a left-handed superhelix. Proceedings of the ational Academ y of Sciences USA 88 : 10148-10152 Avery 0 T. C. M. Macleod and M. McCarty (1944). Studies on the chemical nature of the substance inducing transformation of pneumococcal types: Induction o f transformation by a desoxyribonucleic acid fraction isolated from pneumococcu s ty p e III. Journal of Experimental Medicine 79: 13 7-159. Baker H. V (1986). Glycolytic gene expression in S acc h a rom yces cerevi iae: nucleotide sequence of GCRJ null mutants and evidence for expre s sion .' Mol ec ula r a nd Cellular Biology 6: 3774-3784. Baker H. V (1991). GCRJ of Saccharom y c es ce r e vi s ia e encode s a D NA binding protein whose binding is abolished by mutation s in the CTT C C s equ e nc e m ot i f.' Proceedings of the ational Academy of Sciences USA 88: 944 3 -9447 108

PAGE 119

109 Banerji, J. S. Rusconi and W. Schaffner (1981). "Expression of a ~-globin gene is enhanced by remote SV40 DNA sequences." Cell 27: 299-308. Bauer, W.R., J. J. Hayes, J. H White and A. P. Wolffe (1994). "Nucleosome structural changes due to acetylation." Journal of Molecular Biology 236(3): 685-90 Bazett-Jones, D. P., J. Cote, C. C. Lande!, C. L. Peterson and J. L. Workman (1999). "The SWI/SNF complex creates loop domains in DNA and polynucleosome arrays and can disrupt DNA-histone contacts within these domains. Molecular and Cellular Biology 19(2): 1470-8. Bazett-Jones D. P., L. Locklear and J.B. Rattner (1988). 'Electron spectroscopic imaging of DNA." Journal of Ultrastructure and Molecular Structure Research 99: 48-58. Becker P. B. and G. Schutz (1988). Genomic footprinting. Genetic Engineering Principles and Methods, Vol. 10. Setlon J.: 1-19. Becker P. B. F. Weih and G. Schutz (1993) Footprinting ofD A-binding proteins in intact cells. Methods in Enzymology 218: 568-587. Benoist, C. and P. Chambon (1981) "In vivo sequence requirements of the SV40 early promoter region." Nature 2 9 0: 304-310. Bernardi, F. T. Koller and F. Thoma (1991). "The ade6 gene of the fission yeast Schizosaccharomyces pombe has the same chromatin structure in the chromosome and in plasmids." Yeast 7: 547-558. Bitter G. A. K. Chang and K. M. Egan (1991) A multi-component upstream activation sequence of the Saccharomyces cerevisiae glyceraldehyde-3-phosphate dehydrogenase gene promoter." Molecular and General Genetics 231 : 22-32. Brent R. and M. Ptashne (1985). A eukaryotic transcriptional acti va tor bearing the DNA specificity of a prokaryotic repressor. Cell 43: 729-736 Brownell, J.E., J. Zhou, T. Ranalli R. Kobayashi D. G. Edmondson S. Y. Roth and C. D. Allis (1996). Tetrahymena histone acetyltransferase A: A homolog to yeast Gcn5p linking histone acetylation to gene activation. Cell 8 4: 843-851. Bruggemeier, U., L. Rogge E. L. Winnacker and M. Beato (1990) "N uclear factor I acts as a transcription factor on the MMTV promoter but competes with steroid hormone receptors for DNA binding. EMBO Journal 9(7) : 2233-9. Buchman A. R. W. J. Kimmerly J. Rine and R. D. Kornberg (1988a). "Two DNA-binding factors recognize specific sequences at silencers upstream activating sequences autonomously replicating sequences and telomeres in Sa cc harom yces cerevisiae." Molecular and Cellular Biology 8: 210-225.

PAGE 120

110 Buchman, A. R. and R. D. Kornberg (1990). "A yeast ARS-binding protein activates transcription synergistically in combination with other weak activating factors. Molecular and Cellular Biology 10 : 887-897. Buchman A. R., N. F. Lue and R. D. Kornberg (1988b). "Connections between transcriptional activators, silencers, and telomeres as revealed by functional analysis of a yeast DNA-binding protein." Molecular and Cellular Biology 8 : 5086-5099. Buratowski S., S. Hahn P. A. Sharp and L. Guarente ( 1988). Function of a yeast TATA element-binding protein in a mammalian transcription system." Nature 334: 37 42. Burley, S. K. and R. G. Roeder (1996). "Biochemistry and structural biology of transcription factor 11D (TFIID)." Annual Review of Biochemistry 65: 769-799. Burns L. G. and C. L. Peterson (1997). "The yeast SWI-SNF complex facilitates binding of a transcriptional activator to nucleosomal sites in vivo." Molecular and Cellular Biology 17(8): 4811-9. Butler, G., I. W. Dawes and D. J. McConnell (1990). "TUF factor binds to the upstream region of the pyruvate decarboxylase structural gene (PDCJ) of Saccharom y ces cerevisiae." Molecular and General Genetics 223: 449-456. Cairns B. R. Y J. Kim, M. H. Sayre, B. C. Laurent and R. D. Kornberg (1994). "A multisubunit complex containing the SWI1/ADR6 SWI2 / SNF2 SWI3 SNF5 and SNF6 gene products isolated from yeast." Proceedings of the National Academy of Sciences USA 91(5): 1950-4. Cairns, B. R. Y. Lorch Y. Li M. Zhang L. Lacomis, H. Erdjument-Bromage P. Tempst, J. Du, B. Laurent and R. D. Kornberg (1996) "RSC, an essential abundant chromatin-remodeling complex." Cell 87 (7): 1249-60. Carruthers L. M. J. Bedner C. L. Woodcock and J.C. Hansen (1998) Linker histones stabilize the intrinsic salt-dependent folding of nucleosomal arrays : Mechanistic ramifications for higher-order chromatin folding. Biochemistry 37: 14776-14787. Cavallini, B. J. Huet, J. L. Plassat A. Sentenac, J.M. Egly and P Chambon (1988). "A yeast activity can substitute for the HeLa cell TATA box factor. Nature 334: 77-80. Chambers A., J. S. H. Tsang C. Stanway A. J. Kingsman and S M. Kingsman (1989) "Transcriptional control of the Saccharomyces cerevisiae PGK gene b y RAPl. Molecular and Cellular Biology 9: 5516-5524. Chapman J W. and L. H. Johnston (1989) The yeast gene DBF 4, essential for entry into S phase is cell cycle regulated." Experimental Cell Research 180: 419-428

PAGE 121

111 Chasman, D. I. K. M. Flaherty, P.A. Sharp and R. D. Kornberg (1993). "Crystal structure of yeast TAT A-binding protein and model for interaction with D A.' Proceedings of the National Academy of Sciences USA 90: 8174-8178. Chasrnan, D. I., N. F. Lue, A. R. Buchman, J. W. LaPointe, Y Lorch and R. D. Kornberg (1990). "A yeast protein that influences the chromatin structure ofUAS a and functions as a powerful auxiliary gene activator." Genes and Development 4: 503-514. Cherry, J.M., C. Ball K. Dolinski, S. Dwight M. Harris A. Kasarskis C. cafe, G. Sherlock, G. Binkley H. Jin, S. Weng and D. Botstein (1998). "Saccharomyces Genome Database." / August 25, 2000 Cherry, J.M., C. Ball S. Weng, G. Juvik, R. Schmidt C. Adler B. Dunn S. Dwight L. Riles, R. K. Mortimer and D. Botstein (1997). "Genetic and physical maps of Saccharomyces cerevisiae." Nature 387 (6632 Suppl): 67-73 Chien, C.-T P. L. Bartel R. Sternglanz and S. Fields (1991). The two-hybrid system: a method to identify and clone genes for proteins that interact with a protein of interest." Proceedings of the National Academy of Sciences USA 88: 9578-9582. Cho, H., G. Orphanides, X. Sun, X. J. Yang, V. Ogryzko, E. Lees, Y. Nakatani and D. Reinberg (1998). "A human RNA polymerase II complex containing factors that modify chromatin structure." Molecular and Cellular Biology 18(9): 5355-63. Church G. M. and W. Gilbert (1984). 'Genomic sequencing. Proceedings of the National Academy of Sciences USA 81: 1991-1995. Ciriacy M. K. Freidel and C. Lohning ( 1991 ). Characterization of trans-acting mutations affecting Ty and Ty-mediated transcription in Saccharomyces cerevisiae." Current Genetics 20 : 441-448. Clark, D. J. and T. Kimuura (1990). "Electrostatic mechanism of chromatin folding." Journal of Molecular Biology 211: 883-896 Clifton, D. and D. G. Fraenkel (1981). "The gcr (glycolysis regulation) mutation of Saccharomyces cerevisiae.'' Journal of Biological Chemistry 256 : 13074-13078. Clifton, D., S. B. Weinstock and D. G. Fraenkel (1978). Glycolysis mutants in Saccharomyces cerevisiae." Genetics 88: 1-11. Conaway R. C. and J. W. Conaway (1993). "General initiation factors for RNA polymerase II." Annual Review of Biochemistry 62 : 161-190. Corden, J. L. (1990) Tails of RNA polymerase II. Trends in Biochemical Science 15: 383-387.

PAGE 122

112 Corden, J. L. D. L : Cadena J. M. Ahearn and M. E. Dahmus (1985) A unique structure at the carboxyl terminus of the largest subunit of eukaryotic RNA pol y merase II." Proceedings of the National Academy of Sciences USA 82: 7934-7938. Cosma, M. P. T. Tanaka and K. Nasmyth (1999). "Ordered recruitment of transcription and chromatin remodeling factors to a cell cycleand developmentally regulated promoter." Cell 97(3): 299-311. Cote, J. J. Quinn, J. L. Workman and C. L. Peterson (1994) Stimulation o f GAL4 derivative binding to nucleosomal DNA by the yeast SWI/SNF comple x Science 265(5168): 53-60 Dahmus, M. E. (1996). "Reversible phosphorylation of the C-terminal domain of RNA polymerase II." Journal of Biological Chemistry 32: 19009-19012. Davies H. G. A. B. Murray and M. E. Walmsley (1974). Electron-microscope observations on the organization of the nucleus in chicken erythrocytes and a superunit thread hypothesis for chromosome structure." Journal of Cell Science 16: 261-299 De Murcia G. and T. Koller (1981 ). The electron microscopic appearance o f soluble rate liver chromatin mounted on different supports. Biologic Cell 40 : 165. Drazinic, C. M. J.B. Smerage M. C Lopez and H. V. Baker (1996) Acti v ation mechanism of the multifunctional transcription factor Repressor-Activator Protein 1 (Raplp). Molecular and Cellular Biology 16: 3187-3196 Dudley A. M. L. J. Gansheroff and F. Winston (1999). Specific components of the SAGA complex are required for Gcn4and Gerlmediated activation of the his 4 912delta promoter in Saccharomyces cerevisiae. Genetics 151( 4) : 136578 Eberharter A. S. John, P.A. Grant R. T Utley and J. L. Workman (1998 ) "Identification and analysis of yeast nucleosomal histone acetyltransferase complex es." Methods 15(4): 315-21. Eickbush T. H. and E. N. Moudrianakis (1978). The histone core comple x : An octamer assembled by two sets of protein-protein interactions. Biochemistry 17 : 49 5 54964. Elder, J. K. A. Amos E. M. Southern and G. A. Shippey (1983 ) Mea s urem e nt of DNA length by gel electrophoresis. Analytical Biochemistry 128: 223-226. Elder J. K. and E. M. Southern (1983). Measurement of DNA length b y g el electrophoresis II: Comparison of methods for relating mobility to fragment length. Analytical Biochemistry 128: 227-231.

PAGE 123

113 Elgin S. C.R. (1995). Chromatin Structure and Gene Expression. New York. Oxford University Press. Enea U., C. F. Vovis and N. D. Zinder (1975) Genetic studies with heteroduplex DNA of bacteriophage fl. Asymmetric segregation base correction and implications for the mechanism of genetic recombination. Journal of Molecular Biology 96 : 495-509. Engelke, D.R., B. S. Shastry and R. G. Roeder (1983) 'Multiple forms of DNA dependent RNA polymerase inXenopus laevis." Journal of Biological Chemistry 258: 1921-1931. Escher D. and W. Schaffner (1997). "Gene activation at a distance and telomeric silencing are not affected by yeast histone Hl. Molecular and General Genetics 256 : 456-461. Fassler, J. S. and F. Winston (1989). "The Saccharomyces cerevisiae SPTJ 3/GALJ 1 gene has both positive and negative regulatory roles in transcription ." Molecular and Cellular Biology 9(1 2): 5602-5609. Fedor, M. J. N. F. Lue and R. D. Kornberg (1988) Statistical positioning o f nucleosomes by specific protein-binding to an upstream activating sequence in yeast. Journal of Molecular Biology 204: 109-127. Ferguson, J. J., M. Boll and H. Holzer (1967). Yeast malate dehydrogenase: enzyme inactivation in catabolite repression." European Journal of Biochemistry 1: 2125. Fields, S. and 0.-K. Song (1989). "A novel genetic system to detect protein protein interactions." Nature 340: 245-246. Flanagan, P. M. R. J. Kelleher III, M. H. Sayre H. Tschochner and R. D Kornberg (1991). A mediator required for activation of RNA polymerase II transcription in-vitro." Nature 350: 436-438. Fraenkel, D. G. (1982). Carbohydrate metabolism. The Molecular Biology of the Yeast Saccharomyces: Metabolism and Gene Expression. Strathern J. E.W. Jones and J. R. Borach. Cold Spring Harbor New York Cold Spring Harbor Laboratory: 1-37. Freund E. and P. M. McGuire (1986). "Characterization of RNA polymerase type II from human term placenta." Journal of Cellular Physiology 127: 432-38 Fried M. and D. M. Crothers (1981). Equilibria and kinetics of lac repressor operator interactions by polyacrylarnide gel electrophoresis. Nucleic Acids Research 9 : 6505-6525.

PAGE 124

114 Fromm, M. and P. Berg (1982). "Deletion mapping of DNA regions required for SV40 early region promoter function in vivo." Journal of Molecular and Applied Genetics 1: 457-481. Fryer, C. J. and T. K. Archer (1998). "Chromatin remodeling by the glucocorticoid receptor requires the BRG 1 complex." Nature 393(6680): 88-91 Garner, M. M. and A. Revzin (1981). "A gel electrophoresis method for quantifying the binding of proteins to specific DNA regions: applications to components of Escherichia coli lactose operon regulatory system." Nucleic Acids Research 9: 30373060. Georgakopoulos, T. and G. Thireos (1992). "Two distinct yeast transcriptional activators require the function of the GCN5 protein to promote normal levels of transcription." EMBO Journal 11(11): 4145-52. Gorman, C. M., B. H. Howard and R. Reeves (1983). "Expression of recombinant plasmids in mammalian cells is enhanced by sodium butyrate." Nucleic Acids Research 11(21 ): 7631-48. Gorovsky M.A. G. L. Pleger J.B. Keevert and C. A Johmann (1973) Studies on histone fraction F2Al in macroand micronuclei of Tetrahymena pyriformis. Journal of Cell Biology 57(3): 773-81. Grant, P.A. L. Duggan, J. Cote, S. M. Roberts, J.E. Brownell R. Candau R. Ohba, T. Owen-Hughes, C. D. Allis, F. Winston S. L. Berger and J. L. Workman (1997). "Yeast Gcn5 functions in two multisubunit complexes to acetylate nucleosomal histones : characterization of an Ada complex and the SAGA (Spt/Ada) complex." Genes and Development 11(13): 1640-50. Grant, P.A., D. Schieltz, M. G. Pray-Grant D. J. Steger, J.C. Reese J. R Yates 3rd and J. L. Workman (1998). "A subset ofTAF(Il)s are integral components of the SAGA complex required for nucleosome acetylation and transcriptional stimulation [see comments]." Cell 94(1): 45-53. Greenleaf A. L. and E. K. F. Bautz (1975). RNA polymerase B from Drosophila melanogaster larvae. Purification and partial characterization." European Journal of Biochemistry 60(1): 169-179 Gross D.S. (1988). "Nuclease hypersensitive sites in chromatin. Annual Review of Biochemistry 57: 159-197. Gu, W. S. Malik, M. Ito C. X. Yuan J. D. Fondell, X. Zhang E. Martinez J. Qin and R. G. Roeder (1999). "A novel human SRB/MED-containing cofactor complex SMCC, involved in transcription regulation." Molecular Cell 3: 97-108.

PAGE 125

115 Guacci, V., A. Tamamoto, A. Strunnikov, J. Kingsbury, E. Hogan P. Meluh and D. Koshland (1993). "Structure and function of chromosomes in mitosis of budding yeast." Cold Spring Harbor Symposia on Quantitative Biology 58 : 677-686. Guarente, L. (1987). "Regulatory proteins in yeast." Annual Review of Genetics 21: 425-452. Guarente, L. (1988). "UASs and enhancers: Common mechanism of transcriptional activation in yeast and mammals." Cell 52: 303-305. Gustafsson, C. M., L. C. Myers Y. Li M. J. Redd, M. Lui H Erdjument Bromage P. Tempst and R. D. Kornberg (1997). "Identification of Rox3 as a component of mediator and RNA polymerase II holoenzyme." Journal of Biological Chemistry 272: 48-50. Guthrie, C. and G. R. Fink, Eds. (1991). Guide to Yeast Genetics and Molecular Biology. Methods in Enzymology. Hahn, S. S. Buratowski, P.A. Sharp and L. Guarente (1989). Yeast TATA binding protein TFIID binds to TAT A elements with both consensus and nonconsensus DNA sequences." Proceedings of the National Academy of Sciences USA 86: 57185722. Han, M. and M. Grunstein (1988). "Nucleosome loss activates yeast downstream promoters in vivo." Cell 55: 1137-1145. Hayes, J. J. D. J. Clark and A. P. Wolffe (1991) Histone contributions to the structure of DNA in the nucleosome." Proceedings of the National Academy of Sciences USA 88: 6829-6833. Hayes J. J. T. D. Tullius and A. P. Wolffe (1990). "The structure of DNA in a nucleosome." Proceedings of the National Academy of Sciences USA 87: 7405-7406. Hebbes, T. R. A. L. Clayton A. W. Thome and C. Crane-Robinson (1994). "Core histone hyperacetylation co-maps with generalized DNase I sensitivity in the chicken beta-globin chromosomal domain." EMBO Journal 13(8): 1823-30. Hebbes T. R., A. W. Thome and C. Crane-Robinson (1988). A direct link between core histone acetylation and transcriptionally active chromatin." EMBO Journal 7 (5): 1395-402. Henry, Y. A. L., A. Chambers, J. S. H. Tsang, A. J. Kingsman and S. M. Kingsman (1990). Characterization of the DNA binding domain of the yeast RAPl protein." Nucleic Acids Research 18: 2617-2623.

PAGE 126

116 Hernandez N. (1993). "TBP a universal eukaryotic transcription factor. Genes and Development 7: 1291-1308. Hershey A. D. and M. Chase (1952) Independent functions of viral protein and nucleic acid in growth of bacteriophage. Journal of General Physiology 36 : 39-56. Hess B. A. Boiteux and J. Kruger (1969). Cooperation of gl y col y tic enz y m e s. Advances in Enzyme Regulation 7: 149-169 Hirschhorn J. N. S A. Brown C. D. Clark and F. Winston (1992 ) 'Ev idenc e that SNF2/SWI2 and SNF5 activate transcription in yeast by altering chromatin structure ." Genes and Development 6: 2288-2298 Holland, M J. and J.P. Holland (1978). Isolation and identification o f y eas t messenger ribonucleic acids coding for enolase glyceraldehyde-3-phosphate dehydrogenase and phosphoglycerate kinase. Biochemistry 17: 4900-4907 Holland M J. T. Y okoi J. P. Holland K. Myambo and M. A Inni s (19 87 ). The GCRJ gene encodes a positive transcriptional regulator of the enolase and glyceraldehyde-3-phosphate dehydrogenase gene families in Sac c harom yces cerev i siae Molecular and Cellular Biology 7: 813-820. Holstege F C P. E.G. Jennings J. J. Wyrick T I. Lee C. J. Hengartner M R Green T. R. Golub E. S. Lander and R. A Young (1998). "Dissecting the re g ulator y circuitry of a eukaryotic genome. Cell 95: 717 728. Hope I. A. S Mahadevan and K Struhl (1988). Structural and functional characterization of the short acidic transcriptional activation region of yeast G C N4 protein. Nature 333: 635-640 Hope I. A and K Strohl (1986). Functional dissection of a eukar y oti c transcriptional activator protein GCN4 of yeast. Cell 46 : 885-894. Hornstra I. K. and T. P. Yang (1993) In v i v o footprinting and ge nom i c sequencing by ligation-mediated PCR. Analvtical Biochemistry 213: 179-19 3 Huet J. P Cottrelle M. Cool M. Vignais D. Thiele C. Marek J. Buhl e r A. Sentenac and P. Fromageot (1985) A general upstream binding factor for g en es o f the yeast translational apparatus. EMBO Journal 4 : 35 3 9-3547. Huie M.A and H. V. Baker (1996). DNA-binding propertie s o f the yeast transcriptional activator Gcrlp. Yeast 12: 307-3117.

PAGE 127

117 Huie, M.A., E.W. Scott, C. M. Drazinic M. C. Lopez, I. K. Hornstra T. P. Yang and H. V. Baker (1992). "Characterization of the DNA-binding activity of GCRl: in vivo evidence for two GCRl-binding sites in the upstream activating sequence of TP I of Saccharomyces cerevisiae." Molecular and Cellular Biology 12: 2690-2700. Jaskelioff, M., I. M. Gavin, C. L. Peterson and C. Logie (2000). "SWI-SNF mediated nucleosome remodeling: Role of histone octamer mobility in the persistence of the remodeled state." Molecular and Cellular Biology 20(9 ): 3058-3068. Jeppesen, P. and B. M. Turner (1993). "The inactive X chromosome in female mammals is distinguished by a lack of histone H4 acetylation, a cytogenetic marker for gene expression." Cell 74: 281-289. Jiang, Y. W., P. Veschambre, H. Erdjument-Bromage, P Tempst J. W. Conaway R. C. Conaway and R. D. Kornberg (1998). "Mammalian mediator of transcriptional regulation and its possible role as an end-point of signal transduction pathways. Proceedings of the National Academy of Sciences USA 95 : 8538-8543. Johnston J. R., Ed. (1994). Molecular Genetics of Yeast: A Practical Approach. Oxford; New York, IRL Press at Oxford University Press. Kahn, J. D. and D. M. Crothers (1992). "Protein-induced bending and DNA cyclization." Proceedings of the National Academy of Sciences USA 89 : 6343-6347 Keaveney, M. and K. Strohl (1998). "Activator-mediated recruitment of the RNA polymerase II machinery is the predominant mechanism for transcriptional activation in yeast." Molecular Cell 1: 917-924. Kent, N. A., L. E. Bird and J. Mellor (1993). "Chromatin analysis in yeast using NP-40 permeabilised sphaeroplasts." Nucleic Acids Research 21: 4653-4654. Kim, J. L., D. B. Nikolov and S. K. Burley (1993a). "Co-crystal structure ofTBP recognizing the minor groove of a TATA element." Nature 365: 520-527 Kim, Y. J. H. Geiger, S. Hahn and P. B. Sigler (1993b). "Crystal structure ofa yeast TBP/TATA-box complex." Nature 365: 512-520. Kim, Y.-J., S. Bjorklund, Y. Li, M. H. Sayre and R. D. Kornberg (1994). A multi protein mediator of transcriptional activation and its interaction with the C-terminal repeat domain of RNA Polymerase II." Cell 77: 599-608. Kingston, R. E. C. A. Bunker and A. N. Imbalzano (1996). "Repression and activation by multi protein complexes that alter chromatin structure." Genes and Development 10: 905-920.

PAGE 128

118 Kingston, R. E. and G. J. Narlikar (1999). "ATP-dependent remodeling and acetylation as regulators of chromatin fluidity." Genes and Development 13(18): 233952. Koleske, A. J. and R. A. Young (1994). "An RNA polymerase II holoenzyme responsive to activators." Nature 368: 466-469 Konig, P., R. Giraldo, L. Chapman and D. Rhodes (1996). "The crystal structure of the DNA-binding domain of yeast RAPl in complex with telomeric DNA. Cell 85: 125-136. Kornberg R. D. and Y. Lorch (1992). "Chromatin structure and transcription. Annual Review of Cell Biology 8: 563-587. Krajewski W. A. and P. B. Becker (1998). "Reconstitution ofhyperacetylated DNase I-sensitive chromatin characterized by high conformational flexibility of nucleosomal DNA." Proceedings of the National Academy of Sciences USA 95(4): 15405. Kruger, W. and I. Herskowitz (1991). "A negative regulator of HO transcription SINl (SPT2), is a nonspecific DNA-binding protein related to HMG l ." Molecular and Cellular Biology 11: 4135-4146. Kulkens T. C. van der Sande, A. F. Dekker H. van Heerikhuizen and R. J. Planta (1992). "A system to study transcription by yeast RNA polymerase I within the chromosomal context: functional analysis of the ribosomal DNA enhancer and the RBPl/REBl binding sites." EMBO Journal 11: 4665-4674. Kunzler M., G. H. Braus, 0. Georgiev K. Seipel and W. Schaffner (1994). "Functional differences between mammalian transcription activation domains at the y east GALI promoter." EMBO Journal 13: 641-645. Kurtz, S. and D. Shore (1991). "RAPl protein activates and silences transcription of mating-type genes in yeast." Genes and Development 5: 616-628. Kwon H. A. N. Imbalzano, P.A. Khavari R E. Kingston and M. R. Green (1994). ''Nucleosome disruption and enhancement of activator binding by a human SWl/SNF complex [see comments]." Nature 370(6489): 477-81. Landsman D. (1996). "Histone Hl in Saccharom yc es cerevisiae: a double mystery solved?" Trends in Biological Science 21: 287-288. Lang, W. H. and R. H. Reeder (1993). The REB 1 site is and essential component of a terminator for RNA polymerase I in Saccharomyces cerevisiae. Molecular and Cellular Biology 13: 649-658.

PAGE 129

119 Lee C.-H. M. R. Murphy J.-S. Lee and J H. Chung (1999). Targetin g a SWI/SNF-related chromatin remodeling complex to the ~-globin promoter in er y thr o id cells." Proceedings of the National Academy of Sciences USA 96(22): 12311-1 2 31 5 Lee D. Y. J. J. Haynes, D. Pruss and A. P. Wolffe (1993) A positive role fo r histone acetylation in transcription factor access to nucleosomal DNA. Cell 72 : 73-84 Lee H. L. and T. K. Archer (1994). "Nucleosome-mediated disruption o f transcription factor-chromatin initiation complexes at the mouse mammary tumor virus long terminal repeat in vivo ." Molecular and Cellular Biology 14(1): 32-41. Lee T. I. H. C. Causton F. C P. Holstege W.-C Shen N. Hanett E .G Jennings F. Winston M. R. Green and R. A. Young (2000). Redundant roles for th e TFIID and SAGA complexes in global transcription. Nature 405(6787) : 701-704 Li, Y. S. Bjorklund Y. W. Jiang, Y J. Kim W. S. Lane D. J. Stillman and R D Kornberg (1995) Yeast global transcriptional regulators Sin4 and Rgrl are compon e nts of mediator complex-RNA polymerase II holoenzyme. Proceedings of the Nat i onal Academy of Sciences USA 92: 10864-10868 Lin R. J. W. Leone R. G. Cook and C D. Allis (1989). Antibodies spec i fi c to acetylated histones document the existence of depositionand transcription-related histone acetylation in Tetrahymena. Journal of Cell Biology 108(5 ) : 1577-88 Lohr D. J Corden K. Tatchell R. T. Kovacic and K. E. Van Holde ( 1 9 77a ). "Comparative subunit structure of HeLa, yeast and chicken erythrocytes. Pro ce edi n gs of the National Academy of Sciences USA 74(1): 79-83. Lohr, D ., R. T Kovacic and K. E. Van Holde (1977b). Quantitati v e an a l ys i s o f the digestion of yeast chromatin by staphylococcal nuclease. Biochemistry 16 ( 3 ) : 4 6 3471. Lopez M. C and H. V Baker (2000) Understanding the growth pheno ty p e o f the yeast gcrl mutant in terms of global genomic expression patterns. Journal of Bacteriology 182(17): 4970-8. Lopez M. C. J.B Smerage and H. V. Baker (1993). A simplified v acuum blotting method for genomic sequencing and in vivo footprinting ." Biotechniqu e s 15 : 362-363. Lorch Y. B R. Cairns M. Zhang and R. D Kornberg (1998). Activat e d R SC nucleosome complex and persistently altered form of the micleosome ." Cell 94 ( 1 ) : 29 -34 Lorch Y. M. Zhang and R. D. Kornberg (1999). Histone octamer t ransfe r b y a chromatin-remodeling complex. Cell 96(3): 389-92.

PAGE 130

120 Lowary, P. T. and J. Widom (1989). "Higher-order structure of Saccharom y c es cerevisiae chromatin Proceedings of the National Academy of Sciences USA 86: 8 2 668270 Maitra P. K. and Z. Lobo (1971). "A kinetic study of glycolytic enzyme s y nthesis in yeast." Journal of Biological Chemistry 246: 475-488. Malik S. and R. G. Roeder (2000). Transcriptional regulation through Medi a tor like coactivators in yeast and metazoan cells." Trends in Biochemical Science 25 ( 6 ) : 277283. Marcus G A. N. Silverman S. L. Berger J. Horiuchi and L. Guarente (199 4) Functional similarity and physical association between GCN5 and ADA2 : putati v e transcriptional adaptors." EMBO Journal 13(20): 4807-15. Matsui, J. J. Segall A Weil and R. G Roeder (1980) Multiple factors requ i red for accurate initiation of transcription by purified RNA polymerase II. Journal of Biological Chemistry 255 : 11992-11996. Maxam, A. M. and W. Gilbert (1977). Sequencing end-labeled DNA w ith b as specific chemical cleavages. Methods in Enzymology 65: 499-560. McCracken S. (1985). Preparation of RNA transcripts using SP6 RNA polymerase. Focus 7: 5-8. McKnight S. and R. Tjian (1986) "Transcriptional selectivity of v iral g enes in mammalian cells. Cell 46: 795-805. Meisterernst M. M Horikoshi and R. G. Roeder (1990). Recombinan t y ea st TFIID a gen~ral transcription factor mediates activation by the gene-specific fa ctor U S F in a chromatin assembly assay Proceedings of the National Academy of Sciences U SA 87: 9153-9157. Michel B. P. Komarnitsky and S. Buratowski (1998). Histone-like T AFs a re essential for transcription in vivo. Molecular Cell 2(5): 663-73. Miller J H (1972). Experime nt s in Molecular Genetics. Cold Spring Harbor NY Cold Spring Harbor Laboratory. Mizzen C. A. X. J. Yang T. Kokubo J.E Brownell A. J. Bannister T. O we Hughes J. Workman L. Wang S L Berger T. Kouzarides Y. Nakatani and C. D. A lli s (1996) "The TAF(II)250 subunit ofTFIID has histone acetyltransferase activi ty C e ll 87(7): 1261-70

PAGE 131

1 2 1 Moore P A. F. A. Sagliocco R. M C. Wood and A. J.P. Brown (1991 ) Ye a s t glycolytic mRNAs are differentially regulated. Molecular and Cellular Biolog y 11: 5330-5337. Moqtaderi Z. Y. Bai D. Poon P.A. Weil and K. Struhl (1996). TBPa s s oc i ated factors are not generally required for transcriptional activation in yeast. Nature 383 : 188-191. Moqtaderi Z. M Keaveney and K. Struhl (1998). The histone H 3 -lik e T AF i s broadly required for transcription in ye a st. Molecular Cell 2(5): 675-82. Morrow B E. S. P. Johnson and J. R Warner (1989). Proteins that b i nd t o t he yeast rDNA enhancer. Journal of Biological Chemistry 264: 9061-9068. Morrow B. E. Q Ju and J. R. Warner (1993) A bipartite DNA-bindin g do ma in in yeast Reblp. Molecular and Cellular Biology 13: 1173-1182. Muller T. E. Gilson R. Schmidt R. Giraldo J. Sogo H. Gross and S. M. G as ser (1994). Imaging the asymmetrical DNA bend induced by Repressor Acti v ator Prot ei n 1 with scanning tunneling microscop y." Journal of Structural Biology 113: 1-1 2 Myers L. C., C. M. Gustafsson D. A. Bushnell M Lui H. E rdjum e nt-Bro mage P Tempst and R. D. Kornberg (1998 ) The Med proteins of yeast and their functi o n through the RNA polymerase II carboxy-terminal domain. Genes and De v elopmen t 12 : 45-54. Nakajima N. M. Horikoshi and R. G. Roeder (1988). Factors in v ol ve d in specific transcription by mammalian RNA pol y merase II: purification gen e t i c specificity and TATA box-promoter interactions ofTFIID ." Molecular and C e llul a r Biology 8(10): 4028-40 Natarajan K. B M. Jackson E Rhee and A.G. Hinnebusch ( 1998 ) yTAFII 61 has a general role i n RNA polymerase II transcription and is required b y Gcn 4p to rec ruit the SAGA coacti v ator complex. Molecular Cell 2(5 ) : 683-92. Natarajan K. B. M. Jackson H Zhou F Winston and A.G. Hinnebu s ch ( 1 9 99 ). Transcriptional activation by Gcn4p involves independent interactions with th e SWI/SNF complex and the SRB/mediator. Molecular Cell 4(4): 657-64 Neely K. E A.H. Hassan A. E. Wallberg D. J. Steger B. R. C airn s P .H. Wright and J. L. Workman (1999) Activation domain-mediated ta rge tin g of th e SWI/SNF comple x to promoters stimulates transcription from nucleo s ome a rr ays Molecular Cell 4: 649-655

PAGE 132

Neish, A. S., S. F. Anderson, B P. Schlegel W. Wei and J. D Parvin (1998) "Factors associated with the mammalian RNA polymerase II holoenzyme. Nucleic Acids Research 2 6(3): 847-53. New England Biolabs 96/97 Catalog (1996). Beverly MA 01915 USA New England Biolabs. Nikolov, D. B. S.-H. Hu, J. Lin A. Gasch, A. Hoffmann M. Horikoshi N -H Chua, R. G. Roeder and S. K. Burley (1992). "Crystal structure ofTFIID TATA-bo x binding protein." Nature 3 60 : 40-46. Nishizawa M. Y. Suzuki, Y. Nogi, K. Matsumoto and T. Fukasawa (1990 ) 122 "Yeast Gal 11 protein mediates the transcriptional activation signal of two different transacting factors Gal4 and general regulatory factor l/repressor / activator site binding protein 1/translation upstream factor." Proceedings of the National Academy o f Sciences USA 8 7: 5373-5377. Noll M and R. D. Kornberg (1977). Action of micrococcal nuclease on chromatin and the location ofhistone Hl Journal of Molecular Biology 109: 393-404 Nonet M. L. D. Sweetser and R. A. Young (1987). Functional redundancy a nd structural polymorphism in the large subunit of RNA polymerase II. Cell 50: 909-915 Nonet, M. L. and R. A. Young (1989). "Intragenic and extragenic suppressor s of mutations in the heptapeptide repeat domain of Saccharomyces cerevisia e RNA polymerase II." Genetics 1 23: 715-724. Ogryzko V. V. T. Kotani X. Zhang R. L. Schlitz T. Howard X. J. Yan g, B. H. Howard, J. Qin and Y. Nakatani (1998). "Histone-like TAFs within the PCAF histon e acetylase complex [see comments]." Cell 94(1): 35-44. Orphanides G. T. Lagrange and D. Reinberg (1996). The general transcript i on factors of RNA polymerase ." Genes and Development 10: 2657-2683 Paranjape S M. R. T. Kamakaka and J. T. Kadonaga (1994) Role of chromatin structure in the regulation of transcription by RNA polymerase II. Annual Re v iew o f Biochemistry 63: 265-297. Patterton H G. C. C. Landel D. Landsman C. L. Peterson and R. T. Simps o n (1998). "The biochemical and phenotypic characterization of Hho 1 p the putati v e linker histone Hl of Saccharomyces cerevisiae. Journal of Biological Chemistry 273: 72687276. Pavlovic B. and W. Horz (1988). "The chromatin structure at the promoter o f a glyceraldehyde phosphate dehydrogenase gene from Saccharom y c es ce r ev i s ia e refle c t s its functional state ." Molecular and Cellular Biology 8: 5513-5520

PAGE 133

Pazin, M. J. and J. T. Kadonaga (1997). "What's up and down with histone deacetylation and transcription?" Cell 89: 325-328. Pina B., U. Bruggemeier and M. Beato (1990). "N ucleosome positioning modulates accessibility of regulatory proteins to the mouse mammary tumor virus promoter." Cell 60 : 719-731. Ponticelli, A. S., T. S. Pardee and K. Struhl (1995). "The glutamine-rich activation domains of human Spi do not stimulate transcription in Saccharomyces cerevisiae." Molecular and Cellular Biology 15 : 983-988. Purnell, B. A., P.A. Emanuel and D.S. Gilmour (1994). "TFIID sequence recognition of the initiator and sequences farther downstream in Drosophila class II genes." Genes and Development 8(7): 830-42. Quinn, J., A. M. Fyrberg, R. W. Ganster, M. C. Schmidt and C. L. Peterson (1996). DNA-binding properties of the yeast SWI/SNF complex." Nature 379(6568 ) : 844-7. Rao, R., D. Drummond-Barbosa and C. W. Slayman (1993). "transcriptional regulation by glucose of the yeast PMA 1 gene encoding the plasma membrane H( + ATPase." Yeast 9: 1075-1084. 123 Rattner, J.B. and B. A. Hamkalo (1981). Visualization of chromosomes and chromatin. Electron Microscopy in Biology. Griffith J. D. New York John Wiley and Sons. 1: 31-65. Rattner, J B., C. Saunders, J. R. Davie and B. A. Hamkalo (1982). "Ultrastructural organization of yeast chromatin." Journal of Cell Biology 92: 217-222. Reagan M. S. and J. E. Majors (1998). "The chromatin structure of the GALI promoter forms independently of Reblp in Saccharomyces cerevisiae Molecular and General Genetics 259: 142-149. Remade, J.E. and S. Holmberg (1992). "A REBl-binding site is required for GCN4-Independent ILVJ basal level transcription and can be functionally replaced b y an ABFl-binding site." Molecular and Cellular Biology 12: 5516-5526. Rhode, P.R. K. S. Sweder K. F. Oegema and J. L. Campbell (1989). The gene encoding ARS-binding factor I is essential for the viability of yeast. Genes and Development 3: 1926-1939. Richard-Foy, H. and G. L. Hager (1987). "Sequence -specific positioning of nucleosomes over the steroid-inducible MMTV promoter." EMBO Journal 6(8): 2321-8.

PAGE 134

Roeder R. G. (1976). Eukaryotic nuclear RNA polymerases. In RNA polymerase. Cold Spring Harbor NY Cold Spring Harbor Laborato ry 124 Roeder R. G. and W. J. Rutter (1969) Multiple forms of DNA-dependent RN A polymerase in eukaryotic organisms ." Nature 224: 234-237. Rose M. D ., F Winston and P. Hieter ( 1990). Methods in Yeast Genetics. Co ld Spring Harbor NY Cold Spring Harbor Laboratory. Sakurai H ., Y. Kiraoka and T. Fukasawa (1993 ). Yeast GALl 1 protein i s a distinctive type transcription factor enhances basal transcription in v itro. Proc e edin gs of the National Academy of Sciences USA 90: 8382-8386 Sawadogo M. (1990) RNA polymerase B (II) and general transcription fac to rs. Annual Review of Biochemistry 59: 711-754. Schmid A. K. Pascher and W Horz (1992) Nucleosome Disruption a t th e Yeast PHO5 Promoter upon PHO5 Induction Occurs in the Absence of DNA Replication. Cell 71: 853-864. Schnitzler G ., S. Sif and R. E. Kingston (1998). Human SWI / SNF intercon v ert s a nucleosome between its base state and a stable remodeled state. Cell 94 ( 1 ): 172 7 Schwartz L. B and R. G. Roeder (1975). Purification and subunit structure o f deoxyribonucleic acid-dependent ribonucleic acid polymerase II from the mou se plasmacytoma MOPC 315. Journal of Biological Chemistry 250(9 ): 3221322 8 Schwarz P M. and J C. Hansen (1994). Formation and stabili ty o f hi g her or d e r chromatin structures. Journal of Biological Chemistry 269: 16284-16298 Scott E W ( 1992). Expression of the TPI gene of Saccharom y c es ce r evis i ae i s controlled by a single complex upstream activating sequence containin g bindin g sit es for three trans-acting factors: REBl RAPl and GCRl. Gainesville FL U ni ve rsi ty of Florida. Scott E W. H. E. Allison and H. V Baker ( 1990) Characteri z ation of T P I g ene expression in isogeneic wild-type and gcr I -deletion mutant strains of Sacc h aromyces cerevisiae. Nucleic Acids Research 18: 7099-7107 Scott E. W and H. V Baker (1993) Concerted action of th e tran s crip tio n al activators REBI RAPl and GCRJ in the high-level expression of the g l y col y tic gene TPI." Molecular and Cellular Biology 13: 543-550. Scott W. A. and D. J.. Wigmore (1978). Sites in simian v irus 40 chromatin which are preferentially cleaved by endonucleases. Cell 15 : 1511-1518.

PAGE 135

Sentenac, A. (1985). "Eukaryotic RNA polymerases. Critical Reviews in Biochemistry and Molecular Biology 18: 31-91. 125 Shore D. and K. Nasmyth (1987). "Purification and cloning of a DNA bindin g protein from yeast that binds to both silencer and activator elements ." Cell 51: 721-7 32. Simpson, R. T. (1978). "Structure of the chromatosome, a chromatin particle containing 160 base pairs of DNA and all the histones." Biochemistry 17: 5524-5531. Stanway C. A (1991). "The transactivator GAL4: Co-activators adaptors and chromatin." BioEssays 13(5): 241-242. Stanway, C. A. J.M. Gibbs S. E. Kearsey M. C. Lopez and H. V. Baker (1994). "The yeast co-activator GAL 11 positively influences transcription of the phosphoglycerate kinase gene but only when RAPl is bound to its upstream activation sequence." Molecular and General Genetics 243: 207-214. Struhl K. (1989). "Molecular mechanisms of transcriptional regulation in yeas t. Annual Review of Biochemistry 58 : 1051-1077. Struhl, K (1995). "Yeast Transcriptional regulatory mechanisms. Annual Review of Genetics 29: 651-674. Sudarsanam P. and F. Winston (2000). "The Swi/Snf family. Trends in Genetics 16(8): 345-350 Sun, X. Y Zhang H. Cho, P. Rickert, E. Lees W. Lane and D. Reinberg (1998). "NAT, a human complex containing Srb polypeptides that functions as a negative regulator of activated transcription ." Molecular Cell 2: 213 222. Sussel L. and D. Shore (1991). "Separation of transcriptional activation and silencing functions of the RAP I-encoded repressor/activator protein 1 : isolation of viable mutants affecting both silencing and telomere length. Proceedings of the National Academy of Sciences USA 88: 7749-7753. Svaren, J. and R. Chalkley (1990). "The structure and assembly of active chromatin ." Trends in Genetics 6( 2): 52-6. Sweder K. S. P. R. Rhode and J. L. Campbell (1988) Purification and characterization of proteins that bind to yeastARSs." Journal of Biological Chemistry 263: 17270-17277 Sypes, M. A. and D. S. Gilmour (1994). "Protein/DNA crosslinking of a TFIID complex reveals novel interactions downstream of the transcription start." Nucleic Acids Research 22 (5): 807-14.

PAGE 136

126 Taunton J. C. A. Hassig and S. L. Schreiber (1996). A mammalian histone deacetylase related to the yeast transcriptional regulator Rpd3p. Science 272: 408-4 1 1. Thoma F. (1992). Nucleosome positioning. Biochimica et Biophysica Act a 1130: 1-19. Thoma F. T. Koller and A. Klug (1979). Involvement ofhistone HI in th e organization of the nucleosome and of the salt-dependent superstructures o f chromat i n. Journal of Cell Biology 83: 403-427 Thompson C. M. A. J. Koleske D. M. Chao and R A. Youn g (1993 ) A multisubunit complex associated with the RNA polymerase II CTD and TATA-bind in g protein in yeast." Cell 73: 1361-1375. Tjian R. and T. Maniatis (1994). Transcriptional activation: A comp l e x pu zz le with few easy pieces ." Cell 77: 5-8. Tornow J. X. Zeng W. Gao and G. M. Santangelo ( 1993 ). GCRl a transcriptional activator in Saccharomyces cerevisiae complexes with RAPl a nd ca n function without its DNA binding domain. EMBO Journal 12: 2431-2437. Truss M. J. Bartsch, A. Schelbert R. J. G. Hache and M Beato ( 1995 ) "Hormone induces binding of receptors and transcription factors to a r earran ge d nucleosome on the MMTV promoter in vivo ." EMBO Journal 14: 1737-1751. Tse C. T Sera A P. Wolffe and J.C. Hansen (1998). Disruption o f hi g h er order folding by core histone acetylation dramatically enhances transcription o f nucleosomal arrays by RNA polymerase III. Molecular and Cellular Biolog y 18 : 46 2 94638. Turkel S. X. B. Liao and P. J. Farabaugh (1997). GCRl-dependent transcriptional activation of yeast retrotransposon T y 2917. Yeast 13(10 ) : 9 1 7-3 0. Turner B. M. A. J. Birley and J. Lavender (1992). Histone H4 iso fo r ms acetylated at specific lysine residues define individual chromosomes and chrom a tin domains in Drosophila polytene nuclei. Cell 69(2) : 375-84. Uemura H and D. G Fraenkel (1990) gcr 2, a new mutation affectin g g l y c o l y tic gene expression in Saccharomyces cerevisia e. Molecular and Cellular Biology 10 : 6389-6396 Uemura H. and Y. Jigami (1992). Role of GCR2 in transcriptional acti v atio n of yeast glycolytic genes. Molecular and Cellular Biology 12: 3834-384 2

PAGE 137

127 Uemura, H. and Y. Jigami (1995). "Mutations in GCRJ a transcriptional acti v ator of Saccharomyces cerevisiae glycolytic genes function as suppressors of g c r 2 mutations." Genetics 13 9 : 511-521. Van Holde K E (1989). Chromatin. New York Springer-Verlag. Varshavsky A. J. 0. H. Sundin and M. J. Bohn (1978). SV40 viral minichromosome: preferential exposure of the origin of replication as probed b y restriction endonucleases. Nucieic Acids Research 5(10): 3469-3479 Velculescu V. E. L. Zhang, W. Zhou J. Vogelstein M.A Basrai D. E Ba ss ett Jr. P Hieter B. Vogelstein and K. W. Kinzler (1997). Characterization of th e y eas t transcriptome. Cell 88 (2): 243-51. Venter U. J. Svaren J. Schmitz A. Schmid and W. Horz (1994). A nucleo s ome precludes binding of the transcription factor Pho4 in vivo to a critical target site in th e PHO5 promoter ." EMBO Journal 13(20): 4848-55. Vettese-Dadey M. P.A. Grant T. R. Hebbes C Crane-Robinson C. D All is and J. L. Workman (1996). Acetylation of histone H4 pla y s a primary role in e nhan c in g transcription factor binding to nucleosomal DNA in vitro. EMBO Journal 15: 2 5082518. Vettese-Dadey M ., P. Walter H. Chen L.-J. Juan and J. L. Workman (1 994 ). Role of the histone amino termini in facilitated binding of a transcription factor Gal4AH, to nucleosome cores." Molecular and Cellular Biology 14(2): 970-981. Vignais M and A. Sentenac (1989). Asymmetric DNA bending induc e d b y the yeast multifunctional factor TUF. Journal of Biological Chemistry 264: 846 3 -8466 Vignais M. L. J. Huet J.-M. Buhler and A. Sentenac ( 1990 ). Contact s be twe en the factor TUF and RPG sequences ." Journal of Biological Chemistry 265 : 14669-1 46 74. Walker J. T. A. Chen R. Sterner M. Berger F Winston and V G. All fr e y (1990). Affinity chromatography of mammalian and yeast nucleosomes Two mode s of binding of transcriptionally active mammalian nucleosomes to organomercuri a l-a g ar os e columns and contrasting behavior of the active nucleosomes of y east. Journal o f Biological Chemistry 26 5 (10): 5736-46 Walker S. S. J. C. Reese L. M. Apone and M. Green (1996 ). Transcription activation in cells lacking TAF-IIs. Nature 3 8 3: 185-188. Weil, P.A. D.S. Luse J. Segall and R. G. Roeder (1979) Selective and accurate initiation of transcription at the Ad2 major late promoter in a soluble sys tem dependent on purified RNA polymerase II and DNA. Cell 18: 469-484

PAGE 138

Wells, D. and D. Brown (1991). "Histone and histone gene compilation and alignment update." Nucleic Acids Research 19( supplement): 2173-2188. 128 Wells, D. and C. McBride (1989). "A comprehensive compilation and alignment of histones and histone genes." Nucleic Acids Research 17(supplement): r31l-r347 White, M. M. Dominska and T. Petes (1993). "Transcription factors are required for the meiotic recombination hotspot at the H/S4 locus in Saccharomyces cerevisiae." Proceedings of the National Academy of Sciences USA 90: 6621-6625. Whitehouse, I., A. Flaus, B. R. Cairns, M. F. White, J. L. Workman and T. Owen Hughes (1999). "Nucleosome mobilization catalyzed by the yeast SWI/SNF complex." Nature 400(6746): 784-7. Widom, J. (1989). "Toward a unified model of chromatin folding. Annual Review of Biophysics and Biophysical Chemistry 18: 365-395. Willett C E., C. M. Glefman and M. J. Holland (1993). "A complex regulatory element from the yeast gene EN02 modulates GCRJ-dependent transcriptional activation." Molecular and Cellular Biology 13: 2623-2633. Wilson, C. J., D. M. Chao A. N. lmbalzano G. R. Schnitzler R. E. Kingston and R. A. Young (1996). "RNA polymerase II holoenzyme contains SWI/SNF regulators involved in chromatin remodeling." Cell 84(2 ): 235-44. Winston, F. and M. Carlson (1992). Yeast SNF/SWI transcriptional activators and the SPT/SIN chromatin connection." Trends in Genetics 8(11 ): 387-91. Wolffe, A. (1998). Chromatin structure and function. San Diega CA Academic Press. Wolffe A P. (1997). "Sinful repression." Nature 387: 16-17. Wolffe, A. P. and D. Guschin (2000). "Review: Chromatin structural features and targets that regulate transcription." Journal of Structural Biology 129: 102-122 Workman, J. L. and R. E. Kingston (1998). "A lteration of nucleosome structure as a mechanism of transcriptional regulation." Annual Review of Biochemistry 67: 545-579. Wu, C., P. M. Binham, K. J. Livak, R. Holmgren and S. C.R. Elgin (1979a). The chromatin structure of specific genes: evidence for higher order domains of defined DNA sequence." Cell 16: 797-806 Wu C., Y.-C. Wong and S. C.R. Elgin (1979b). "T he chromatin structure of specific genes: Disruption of chromatin structure during gene activity." Cell 16: 807814.

PAGE 139

129 Xie X. T. Kokubo S L. Cohen, U. A. Mirza A Hoffmann B. T Chait R. G. Roeder Y. Nakatani and S. K. Burley (1996) Structural similarity between T A F s and the heterotetrameric core of the histone octamer [see comments]. Nature 380 ( 6572 ): 316 22. Xue, Y. J. Wong G T. Moreno M K. Young J. Cote and W. Wang (1998 ). NURD a novel complex with both ATP-dependent chromatin-remodeling and hist o ne deacetylase activities." Molecular Cell 2(6): 851-61. Yang X. J. V. V. Ogryzko J. Nishikawa B. H Howard and Y. Nakatani ( 1 9 96 ). A p300/CBP-associated factor that competes with the adenoviral oncoprotein E l A. Nature 382(6589) : 319-24. Yoshinaga S. K. C. L. Peterson I. Herskowitz and T. Yamamoto ( 199 2) R o les of SWI 1 SWI2 and SWI3 proteins for transcriptional enhancement b y steroid receptors. Science 258: 1598-1604. Young, R. A. (1991). "RNA polymerase II. Annual Review of Biochemistr y 60: 689 715 Yudkovsky N. C. Logie S. Hahn and C L. Peterson ( 1999 ). Re c ruitment of the SWI/SNF chromatin remodeling complex by transcriptional activators. Gene s a nd Development 13(18) : 2369-74. Zaret K. S. and K. R. Yamamoto (1984). Reversible and persistent chan g es in chromatin structure accompany activation of a glucocorticoid-dependent enhancer element. Cell 3 8 (1): 29-38. Zawel L. and D. Reinberg (1993). Initiation of transcription b y RN A polymerase II: A multi-step process." Progress in Nucleic Acid Research and Molecular Biology 44: 67-108.

PAGE 140

BIOGRAPHICAL SKETCH Jeffrey Beaumont Smerage was born in Palo Alto, California, on May 22 1967 to Glen and Barbara Smerage. He spent the first eight years of his life in Logan, Utah, where his father served on the faculty of Utah State University. His family then moved to Gainesville, Florida, where his father became a faculty member in the Department of Agricultural Engineering at the University of Florida. Through his high school years he was active in many endeavors including violin performance, Boy Scouts, soccer and swimming. Additionally he had a great love of the outdoors, and he spent many hours gardening and participating in outdoor activities such as hiking, camping and canoeing. After graduating from Gainesville High School in 1985, he attended Florida State University (FSU). While a student at FSU, he served as the student member of the State of Florida Board of Regents. He graduated cum laude in 1990 with degrees in both biochemistry and violin performance. His graduate education included the M.D./Ph.D. program at the University of Florida. His M.D. degree was conferred in May, 1998. His medical training has continued at the University of Virginia where he currently holds the position of Resident oflnternal Medicine. His future plans include fellowship training in hematology / oncology. He will begin fellowship training at the University of Michigan in July 2001. He is married to Lucia Eisner Smerage. They met at the University of Florida during their graduate training. Lucia also holds a doctoral degree in molecular genetics 130

PAGE 141

and microbiology from the University of Florida. They are the proud parents o f Alexander Francis Smerage who was born on August 8 1997. 131

PAGE 142

I certify that I have read this study and that in my opinion it conforms to acceptable stadards of scholarly presentation and is fully adequate in scope and quality as a dissertation for the degree of Doctor of Philosophy Henry V. Baker Chair Associate Professor of Molecular Genetics and Microbiology I certify that I have read this study and that in my opinion it conforms to acceptable stadards of scholarly presentation and is fully adequate in scope and quality as a dissertation for the degree of Doctor of Philosophy. Wlil Professor of Genetics I certify that I have read this study and that in my opinion it conforms to acceptable stadards of scholarly presentation and is fully adequate in scope and quality as a dissertation for the degree of Doctor of Philosophy. -~ Harry S. Nie Professor of 10chemistry and Molecular Biology I certify that I have read this study and that in my opinion it conforms to acceptable stadards of scholarly presentation and is fully adequate in scope and quality as a dissertation for the degree of Doctor of Philosophy. Thomas P. Yang Professor of Biochemistry Biology

PAGE 143

I certify that I have read this study and that in my opinion it conforms to acceptable stadards of scholarly presentation and is adequate in scope and quality as a dissertation for the degree of Doctor of Phil s hy. Daniel J. Driscoll Associate Professor of Genetics This dissertation was submitted to the Graduate Faculty of the College of Medicine and to the Graduate School and was accepted as partial fulfillment of the requirements for the degree of Doctor of Philosophy December 2000 Dean College of Medicine Dean Graduate School

PAGE 144

II I II lllllllllli~m~1 1 ~llllilil l lllllilil lilllllll 11111 3 1262 08555 2684