Citation
Characterization of an inducible enhancer element and the signaling pathways involved in manganese superoxide dismutase gene regulation

Material Information

Title:
Characterization of an inducible enhancer element and the signaling pathways involved in manganese superoxide dismutase gene regulation
Creator:
Rogers, Richard James, 1957-
Publication Date:
Language:
English
Physical Description:
viii, 153 leaves : ill. ; 29 cm.

Subjects

Subjects / Keywords:
DNA ( jstor )
Endothelial cells ( jstor )
Enhancer elements ( jstor )
Enzymes ( jstor )
Messenger RNA ( jstor )
Polymerase chain reaction ( jstor )
Rats ( jstor )
RNA ( jstor )
Superoxides ( jstor )
Transfection ( jstor )
Department of Biochemistry and Molecular Biology thesis Ph.D ( mesh )
Dissertations, Academic -- College of Medicine -- Department of Biochemistry and Molecular Biology -- UF ( mesh )
Enhancer Elements (Genetics) ( mesh )
Enzyme Induction ( mesh )
Gene Expression Regulation ( mesh )
Interleukin-1 -- metabolism ( mesh )
Lipopolysaccharides -- metabolism ( mesh )
Reactive Oxygen Species ( mesh )
Research ( mesh )
Superoxide Dismutase ( mesh )
Tumor Necrosis Factor -- metabolism ( mesh )
Genre:
bibliography ( marcgt )
non-fiction ( marcgt )

Notes

Thesis:
Thesis (Ph.D.)--University of Florida, 2000.
Bibliography:
Bibliography: leaves 130-152.
General Note:
Typescript.
General Note:
Vita.
Statement of Responsibility:
by Richard James Rogers.

Record Information

Source Institution:
University of Florida
Holding Location:
University of Florida
Rights Management:
Copyright [name of dissertation author]. Permission granted to the University of Florida to digitize, archive and distribute this item for non-profit research and educational purposes. Any reuse of this item in excess of fair use or other copyright exemptions requires permission of the copyright holder.
Resource Identifier:
025684153 ( ALEPH )
48668445 ( OCLC )

Downloads

This item has the following downloads:


Full Text










CHARACTERIZATION OF AN INDUCIBLE ENHANCER ELEMENT AND THE
SIGNALING PATHWAYS INVOLVED IN MANGANESE SUPEROXIDE
DISMUTASE GENE REGULATION













By

RICHARD JAMES ROGERS


A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY

UNIVERSITY OF FLORIDA


2000

























To my parents who understood the significance of education.


Live as if you were to die tomorrow. Learn as if you were to live forever.

Ghandi














ACKNOWLEDGMENTS


I would like to thank Dr. Harry S. Nick, chairman of my graduate advisory

committee, for his support, trust, friendship, guidance, and encouragement throughout my

graduate studies. I am also grateful to the other committee members--Drs. Brian Cain,

Sarah Chesrown, Robert Ferl, and Michael Kilberg--for their assistance. I would like to

thank all members, professors and staff, from the Department of Biochemistry and

Molecular Biology from the University of Florida College of Medicine. I am deeply

indebted to the members of my laboratory, both past (Maureen, Jan-Ling, Michael, Yemi,

and Jane) and present (Yang, Chris, Nikki, and Ann), for their help along this journey. I

also wish to extend a special, heartfelt thanks to Joan Monnier, my second mom, for her

support, technical help and spiritual guidance, during the most emotionally trying time in

my personal life. I can never fully repay my debt to her. Finally, I would like to express

my gratitude, respect and love to Ming Ming Chow for helping me in countless ways to

become a better person, but especially for showing me how to feel joy again.














TABLE OF CONTENTS
page


ACKN OW LEDGM EN TS ................................................................................................. iii

ABSTRACT ................................................................................................................. vii

CHAPTERS

1 INTRODUCTION ......................................................................................................... 1

Oxygen and Free Radicals ............................................................................................. 1
Superoxide Dism utases ............................................................................................. 3
Inflam m ation ............................................................................................................ 5
Lipopolysaccharide ................................................................................................. 6
Tum or N ecrosis Factor ............................................................................................ 7
Interleukin-1 .............................................................................................................. 9
M olecular Biology of M nSOD ..................................................................................... 11
Enhancers ................................................................................................................ 14

2 M ATERIA LS AND M ETHOD S ........................................................................... 18

M aterials ...................................................................................................................... 18
M ethods ........................................................................................................................ 20
Tissue Culture ................................................................................................. 20
Polym erase Chain Reaction (PCR) .................................................................. 21
TA Cloning of PCR Products ........................................................................... 22
Reporter Vector Cloning ................................................................................... 23
Plasm id Purification ........................................................................................ 24
Transient Transfection of M amm alian Cells .................................................. 26
RNA Isolation ................................................................................................. 27
N orthern Analysis ............................................................................................ 28
Genom ic DNA Isolation ................................................................................... 29
Electrophoretic M obility Shift A ssay (EM SA) ................................................. 30
In Vivo DM S Treatm ent ................................................................................... 31
Ligation-M ediated PCR (LM PCR) .................................................................. 33
Site-Directed Mutagenesis and Substitutions by PCR ...................................... 37
Radiolabeled Probe Synthesis ......................................................................... 40
Hybridization of N orthern and Southern Blots ................................................ 41











3 CYTOKINE-INDUCIBLE ENHANCER WITH PROMOTER ACTIVITY IN
BOTH THE RAT AND HUMAN SUPEROXIDE DISMUTASE GENES .......... 42

Introduction ............................................................................................................ 42
R esults .......................................................................................................................... 44
An Inducible Cis-Acting Element Exists within MnSOD ................................. 44
The MnSOD Inducible Enhancer Element is Located within Intron 2 ............. 48
The Enhancer Is Likely Composed of A Complex Set of Interacting
Elem ents ....................................................................................................... 54
The Inducible Enhancer Elements within Rat and Human MnSOD Can Act
with A Heterologous Promoter .................................................................... 60
Evaluation of Promoter-Enhancer Interactions ................................................. 63
The Rat and Human Enhancer Elements Contain Inducible Promoter
A ctivity ...................................................................................................... 69
D iscussion .............................................................................................................. 70

4 IN VIVO FOOTPRINTING AND MUTAGENESIS OF THE RAT
MANGANESE SUPEROXIDE DISMUTASE ENHANCER .............................. 75

Introduction ............................................................................................................ 75
R esults .......................................................................................................................... 77
Multiple Potential Protein Binding Sites Exist within the MnSOD
Enhancer ...................................................................................................... 77
Mutagenesis of Putative DNA Binding Sites Alters Inducible MnSOD
Expression .................................................................................................... 83

D iscussion .............................................................................................................. 89

5 REACTIVE OXYGEN SPECIES AND MITOCHONDRIA-TO-NUCLEUS
SIGN A LIN G ......................................................................................................... 91

Introduction ............................................................................................................ 91
R esults .......................................................................................................................... 93
Mitochondrial Electron Transport Inhibitors Modulate TNF-a-Induced
Expression of MnSOD in Pulmonary Epithelial Cells ................................. 93
Antimycin A Strongly Decreases TNF-ot-Inducible MnSOD Expression in
Pulmonary Endothelial Cells ...................................................................... 96
The Signaling Pathway of TNF-ox Is Different from the Pathways of LPS-
or IL-1-Stimulated Expression of MnSOD ..................................................... 100
Inhibition of Mitochondrial ATPase with Oligomycin also Represses
TNF-ct-Stimulated Expression of MnSOD ..................................................... 103
Reactive Oxygen Species Are Important for TNF-a-Stimulated
Expression of MnSOD .................................................................................... 108









TNF-a-Stimulated Expression of MnSOD in Endothelial Cells Is
Dependent on Cytoplasmic Phospholipase A2 (cPLA2) ................................. 108
TNF-a-Inducible Expression of MnSOD Is Not Dependent on Nuclear
Factor- KcB (NF-cB) ........................................................................................ 115

Discussion .................................................................................................................. 116

6 CONCLUSIONS AND FUTURE DIRECTIONS ..................................................... 121

Conclusions ................................................................................................................ 121
Future Directions ....................................................................................................... 127

REFERENCES ................................................................................................................ 130

BIOGRAPHICAL SKETCH ........................................................................................... 153



































vi















Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy



CHARACTERIZATION OF AN INDUCIBLE ENHANCER ELEMENT AND THE
SIGNALING PATHWAYS INVOLVED IN MANGANESE SUPEROXIDE
DISMUTASE GENE REGULATION


By

Richard James Rogers

December 2000


Chairman: Dr. Harry S. Nick
Major Department: Biochemistry and Molecular Biology

Manganese superoxide dismutase (MnSOD), an enzyme localized to the

mitochondria, converts superoxide (02") into oxygen (02) and hydrogen peroxide

(H202). The superoxide dismutases (SODs) are the first line of cellular defense against

the damaging effects of superoxide anion radicals. Manganese superoxide dismutase is

the most highly regulated of the three SODs. Multiple studies have shown that increased

cellular levels of MnSOD are cytoprotective during cellular oxidative stress or

inflammatory challenges. The major goals of this dissertation were to identify within the

MnSOD gene the regions of DNA that are responsible for inducible expression and to

understand some of the intracellular signaling pathways that control this induction. To do

so, I utilized the polymerase chain reaction method to create deletions of a large region









within the MnSOD gene as a means of creating reporter vectors, which could be

evaluated by transient transfection studies in a rat lung epithelial cell line. The results of

these experiments defined a small region (260 bp) within intron 2 as an enhancer, which

regulates the inducible expression seen in the endogenous MnSOD gene. In addition, by

utilizing a variety of specific pharmacologic inhibitors, I was able to show the differences

between signaling pathways (lipopolysaccharide, tumor necrosis factor, interleukin-1)

responsible for the inducible expression of MnSOD. Interestingly, reactive oxygen

species, which are byproducts of the mitochondrial electron transport chain, appear to be

important regulators of the tumor necrosis factor pathway, but not that of

lipopolysaccharide or interleukin-1. Finally, by using the method of in vivo footprinting,

I was able to identify putative protein-DNA binding sites within the enhancer region.

Using this data, I created a number of reporter vectors with mutations within the enhancer

region. By transiently transfecting these reporter vectors into rat lung epithelial cells, I

may have identified at least one important putative protein-DNA binding site in the

enhancer region. It is likely that the MnSOD enhancer contains multiple protein-DNA

binding sites which work to create a protein complex necessary for the inducible

expression seen in the endogenous MnSOD gene. This work will add to the

understanding of how the inducible MnSOD gene is regulated.













CHAPTER 1
INTRODUCTION



Oxygen and Free Radicals

The element oxygen (chemical symbol 0) exists in air as a diatomic molecule, 02,

which strictly should be called dioxygen. Over 99% of the 02 in the atmosphere is the

isotope oxygen- 16 but there are traces of oxygen- 17 (about 0.04%) and oxygen- 18 (about

0.2%). Except for certain anaerobic and aero-tolerant unicellular organisms, all animals,

plants, and bacteria require 02 for efficient production of energy by the use of 02-

dependent electron-transport chains, such as those in the mitochondria of eukaryotic

cells. This need for 02 obscures the fact that 02 is a toxic mutagenic gas; aerobes survive

because they have antioxidant defenses to protect against it.

Perhaps the earliest suggestion made to explain 02 toxicity was that 02 inhibits

cellular enzymes (Balentine, 1982; Haugaard, 1968). Indeed, direct inhibition by 02 is

thought to account for the loss of nitrogenase activity in 02-exposed C. pasterianum

(Gallon, 1981). Another good example of the direct effect of 02 comes from green

plants. During photosynthesis, illuminated green plants fix CO2 into sugars by a complex

metabolic pathway know as the Calvin cycle. The first enzyme in this pathway, ribulose

bisphosphate carboxylase, catalyses the reaction of CO2 with a five-carbon sugar

(ribulose 1,5-bisphosphate) to produce two molecules of phoshoglyceric acid. Oxygen is

an alternative substrate for this enzyme, competitive with C02, and so at elevated 02

concentrations there is less CO2 fixation and hence less plant growth (Halliwell, 1984).









In general, however, the rates of direct inactivation of enzymes by 02 in aerobic

cells are too slow and too limited in extent to account for the rate at which toxic effects

develop; most enzymes are totally unaffected by 02. In 1954, Rebecca Gershman and

Daniel L. Gilbert drew a parallel between the effects of 02 and those of ionizing radiation

and proposed that most of the damaging effects of 02 could be attributed to the formation

of free oxygen radicals (Gilbert, 1981).

The growth inhibition observed after exposing E. coli to high-pressure 02 can be

relieved by adding valine to the culture medium. Valine synthesis is impaired because of

a rapid inhibition of the enzyme dihydoxyacid dehydratase, which catalyzes a reaction in

the metabolic pathway leading to valine. This is probably not a direct inhibition by 02,

but rather by oxygen radicals such as superoxide (Flint et al., 1993). Other enzymes

inactivated by superoxide radical (02"') in E. coli exposed to high pressure 02 include the

Krebs cycle enzymes aconitase and fumarase. E. coli contains three fumarases: fumarase

A and B are inactivated by 02" whereas fumarase C is not. Levels of fumarase C

increase when E. coli is exposed to oxidizing conditions, perhaps as a replacement for the

superoxide-sensitive fumarases A and B. Aconitase may also be an important target of

damage by 02" in mammalian tissues exposed to excess 02 (Hausladen and Fridovich,

1994; Morton et al., 1998). The onset of 02-induced convulsions in animals is correlated

with a decrease in the cerebral content of the neurotransmitter GABA (y-aminobutyric

acid), perhaps because of an inhibition of the enzyme glutamate decarboxylase

(glutamine -+ GABA + C02) by 02 (Hori, 1982); it has not, however, been shown that









the enzyme inhibition in vivo is due to 02 itself rather than to the effects of an increased

production of oxygen radicals (Haugaard, 1968).

The term "free radical" has several definitions, however, the simplest one

describes a free radical as any species capable of independent existence and contains one

or more unpaired electrons (Halliwell and Gutteridge, 1999). The presence of one or

more unpaired electrons usually causes free radicals to be attracted slightly to a magnetic

field (i.e., to be paramagnetic), and sometimes makes them highly reactive, although the

chemical reactivity of radicals varies over a wide spectrum. Radicals can be formed

when a covalent bond is broken if one electron from each of the pair shared remains with

each atom, a process known as hemolytic fission (von Sonntag, 1987).

A:B -- A'+Be

For example, hemolytic fission of one of the O-H covalent bonds in the H20 molecule

will yield a hydrogen radical (H') and a hydroxyl radical (*OH). The opposite of

hemolytic fission is heterolytic fission, in which one atom receives both electrons when a

covalent bond breaks, i.e.

A:B -- A'+B+

Where A receives both electrons. A is now negatively charged and this gives A a

negative charge and B is left with a positive charge. Heterolytic fission of water gives

the hydrogen ion H+ and the hydoxide ion OH-.

Superoxide Dismutases

The superoxide dismutases (SODs) catalyze the dismutation of superoxide anion

radical (02*-) into hydrogen peroxide and oxygen as follows:


2H + 2 02*" -+ H202 + 02









SODs, isolated from a wide range of organisms, fall into three types depending on

the metals found in their active centers: copper/zinc, manganese, and iron. Cu/ZnSOD is

found mainly in the cytosol of eukaryotes (Slot et al., 1986) and in chloroplasts; MnSOD,

in prokaryotes and in the mitochondria of eukaryotes; and FeSOD, in prokaryotes and in

a few families of plants. In addition, an extracellular SOD similar to the Cu/ZnSOD had

also been found in the extracellular fluid of eukaryotic cells (Marklund, 1984;

Hjalmarsson et al., 1987). Amino acid sequence data had shown that these three types of

SODs fall into two distinct families (Bannister et al., 1987). The FeSOD and MnSOD

show a high degree of amino acid sequence and structural homology, while the second

family, which includes the Cu/ZnSOD, is completely unrelated.

Two major forms of SOD have been purified from rat liver (Assayama and Burr,

1985). The Cu/ZnSOD consists of two identical subunits with a total molecular weight

of 32 kilodaltons (kD). Each subunit contains a single Cu and Zn atom, noncovalently

linked. The copper ion appears to function in the enzymatic reaction, whereas the zinc

ion is noncatalytic and serves to stabilize the enzyme. The complete amino acid

sequence of Cu/ZnSOD has been determined from various species with a high level of

conservation (Bannister et al., 1987).

The rat MnSOD is a tetrameric enzyme containing four identical 21 kD subunits

with a total molecular weight of approximately 80 kD whereas most bacterial MnSODs

are dimeric enzymes of approximately 40 kD. The amino acid sequences of the MnSOD

enzyme from various species, including rat, mouse, and human, as well as from bacteria,

have been compared and are very similar (Bannister et al., 1987). These enzymes contain

Mn at the active site and the mammalian forms have been localized primarily in the









mitochondria, particularly in the matrix between the cristae (Slot et al., 1986).

Mitochondrial DNA and membranes are particularly prone to oxidation because

mitochondria themselves are a major source of free radicals. When mitochondria are

severely damaged, aerobically growing cells are starved for energy. The localization of

the MnSOD exclusively within the mitochondria suggests an important role for this

antioxidant enzyme in this organelle.

Both rat Cu/ZnSOD and MnSOD cDNAs have been isolated and characterized by

our laboratory and others (Ho and Crapo, 1987). The rat MnSOD cDNA encodes a

protein of 222 amino acids, which includes a putative mitochondrial targeting sequence

of 24 amino acids. The Cu/ZnSOD is sensitive to cyanide, whereas MnSOD is resistant

to this reagent (Weisinger and Fridovich, 1973; Fridovich, 1974). This difference in the

cyanide sensitivity makes it possible to distinguish the enzymatic activities of these two

SODs.

In general, the synthesis of Cu/ZnSOD is constitutive whereas MnSOD is

inducible. Induction of MnSOD in eukaryotes has been observed following treatment

with paraquat (Krall et al., 1988), X-irradiation (Oberley et al., 1987), and hyperoxia

(Freeman et al., 1986), suggesting that MnSOD induction is important for protection

against oxidative stress. Since inflammatory responses often result in generation of a

variety of free radicals, which can directly or indirectly lead to tissue injury, it is of

interest to further characterize the role of SOD in such inflammatory responses.

Inflammation

Microbial invasion, immunological reactions, and inflammatory processes induce

a complex set of responses in the host, collectively referred to as the acute phase response









(Kushner et al., 1989). This response is characterized by fever, metabolic changes,

increased peripheral white blood cell count, and an increased synthesis of acute phase

proteins including C-reactive protein, ceruloplasmin, serum amyloid A protein, and

various complement proteins.

In addition, the immune system produces a variety of inflammatory mediators

including cytokines, arachidonic acid metabolites, and oxygen free radicals to protect the

host when threatened by inflammatory agents, microbial invasion, or injury. In some

cases this complex defense network successfully restores normal homeostasis, but at

other times the overproduction of inflammatory mediators may actually prove deleterious

to the host (Welbourn and Young, 1992). For example, septic shock associated with

infection is generally caused by wide-spread and uncontrolled activation of the

mononuclear phagocyte cell population and the release of massive quantities of

inflammatory mediators (Molloy et al., 1993). The clinical characteristics of this

condition include fever, hypotension, hypoglycemia, disseminated intravascular

coagulation and increased vascular permeability. The acute phase response,

characterized by the release of pro-inflammatory mediators and the activation of immune

cells, can be produced upon exposure to bacterial cell wall materials, most notably,

lipopolysaccharide.

Lipopolysaccharide

One of the major toxic components contributing to the inflammatory response

during microbial invasions is lipopolysaccharide (LPS). LPS, a constituent of the cell

wall of gram-negative bacteria, consists of a polysaccharide portion and a covalently

linked lipid moiety termed lipid A (Rietschel and Brade, 1992). Wide derangements









including acute inflammatory responses, altered energy metabolism, and multiple tissue

injury are observed after LPS administration (Ghosh et al, 1993). The toxic properties of

LPS account for its other name, bacterial endotoxin.

Several lipopolysaccharide binding proteins (LBP), which specifically interact

with LPS, have been reported (Tobias et al., 1988). For example, Schumann et al. (1990)

have characterized a LBP which is a 60 kD plasma glycoprotein synthesized in

hepatocytes. After the LBP interacts with LPS, this LPS-LBP complex then binds to the

cell surface protein CD 14 and presumably elicits the cellular and tissue responses to LPS

(Wright et al., 1990). In addition, a membrane-localized 80 kD LPS-specific binding

protein has been identified in B lymphocytes, T lymphocytes, and macrophages (Lei and

Morrison, 1988). However, the roles of these different LBPs and the interaction between

them are still not clear.

Tumor Necrosis Factor

Tumor necrosis factor (TNF), also called cachectin, is synthesized principally by

monocytes and macrophages in response to macrophage activators such as endotoxin.

Human TNF has a molecular weight of 17 kD, which is synthesized as a propeptide of

233 amino acids with a precursor sequence of 76 amino acids (Pennica et al., 1984;

Aggarwal et al., 1985). The amino acid sequences of both the pro- and mature peptides

are highly conserved between mouse and human, with about 80% homology (Beutler et

al., 1985; Cseh and Beutler, 1989). A wide spectrum of possible physiological actions

for TNF, including its use in the management of certain tumors, its role in an

inflammatory reaction, and its involvement in the immune response, have been

documented (Beutler and Cerami, 1989).









TNF and lymphotoxin (a tumoricidal protein produced by lymphocytes),

sometimes referred to as TNF-t and TNF-P respectively, are structurally and

functionally related (Goeddel et al., 1986). They share about 28% homology and have

been shown to interact with the same receptors and exhibit a number of shared biological

activities. The genes for TNF and lymphotoxin are closely linked and separated by about

I kb in humans (Nedwin et al., 1985). Lymphotoxin lies 5' to TNF, and both genes

reside within the major histocompatibility complex locus on chomosome 6, indicating

that these two genes may have evolved from a gene duplication event.

Most cell types including liver, kidney, muscle, and adipose tissue have been

shown to possess specific high affinity receptors for TNF. Two distinct TNF receptors of

55-69 kD (p55) and 70-80 kD (p75) have been identified in the mouse (Goodwin et al.,

1991) and human systems which demonstrate ligand specificity for both TNF-a and

TNF-3 (Hohmann et al., 1990). The p75 receptor possesses greater affinity for TNF than

the p55 receptor (Tartaglia and Goeddel, 1992). The genes for the p55 and p75 receptors

map to chromosomes 12 and 1 in humans, and to chomosome 6 and 4 in the mouse,

respectively (Goodwin et al., 1991).

Based on their amino acid sequence, the two receptors are only 29% identical to

each other, and both share four cysteine-rich repeats in their extracellular domains that

are characteristic of the nerve growth factor (NGF) receptor family. For both proteins,

aggregation of receptors mediated by binding of dimeric or trimeric TNF is believed to

initiate the signaling process. However, several lines of evidence suggest that subsequent

steps of the signal transduction process may diverge. Studies have been conducted using

antibodies specific for either the p55 or p75 receptor. Heller et al. (1992) reported that









the cytotoxicity of TNF was mediated through the p75 receptor. Tartaglia et al. (1993)

provided evidence indicating that the cytotoxicity of TNF is signaled by the p55 receptor.

The controversy between these two hypotheses needs further investigation, but also

demonstrates the complexity of the TNF function.

Soluble forms of the TNF receptors are released from the cell surface by

proteolytic cleavage (Lantz et al., 1990; Gullberg et al., 1992). These soluble receptors

act as TNF binding proteins, which subsequently inhibit TNF interactions with surface

receptors. In addition, the release of soluble receptors results in the down-regulation of

cell surface receptors. Therefore, shedding of surface receptors enables target cells to

decrease their responsiveness to TNF. Binding of TNF to its receptor is followed by

rapid internalization and degradation via a lysosomal pathway (Tsujimoto et al., 1985;

Niitsu et al., 1985)

Interleukin-1

Interleukin- 1 (IL-1), initially recognized as a factor producing high fever and a

shock-like state (Okusawa et al., 1988; Fischer et al., 1991), is primarily synthesized by

macrophages and monocytes, but may also be produced by epithelial cells, endothelial

cells, keratinocytes, and glial cells. IL- 1 is an inflammatory cytokine, more closely

related to tumor necrosis factor (TNF) than any other cytokine, although the structure and

receptors for IL-I and TNF are clearly distinct. IL-I is biologically active in the low

picomolar or even femtomolar range. There is little evidence that cytokines, such as IL-

1, play any role in normal homeostasis such as hormonal regulation, metabolism or in

physiological regulation. In the absence of injury or damage, however, it is unclear

whether IL-I is needed.









During inflammation, injury, immunological challenge or infection, IL-I is

produced and because of its multiple biological properties, this cytokine appears to affect

the pathogenesis of disease. Specific physiological activities of IL-I include lymphocyte

stimulation, induction of acute phase proteins, helper activity for immunoglobulin

production by B lymphocytes, induction of interferon P-2, and radioprotection (Neta et

al., 1986; Fibbe et al., 1989). Most studies on IL-1 are derived from experiments in

which bacterial products such as lipopolysaccharide (LPS), endotoxins from Gram-

negative bacteria or exotoxins from Gram-positive organisms are used to stimulate

macrophages (Ikejima et al., 1988).

Two distinct genes, located on chromosome 2, code for the IL-I a and IL- I 3

precursor polypeptides both having molecular masses of 31 kD (Auron et al., 1984;

Lomedico et al., 1984; Clark et al., 1986; Dinarello, 1992). However, unlike most

proteins, both IL-l c and 3 lack a leader sequence of amino acids, which would enable

the precursor protein to be inserted into the Golgi and cleaved to a smaller, mature size to

be transported out of the cell. The mature protein of both IL-la and 3 is approximately

17 kD after enzymatic cleavage. IL-l a and IL- 13 have very different amino acid

sequences, sharing only 26% similarity; however, structurally the two isoforms of IL-I

are related at the three dimensional level, having been crystallized (Preistle et al., 1988,

1989). These two proteins have been found in human, mouse, rat, pig, and rabbit and

exhibit significant interspecies homology at the amino acid level (62% homology

between human and mouse IL-la, Auron et al., 1985). The third member of the IL-I

gene family is IL- 1 receptor antagonist (IL-IRa). The three members of the IL-I family









recognize and bind to the same cell surface receptors. IL-I a and IL-i 13 binding to the IL-

1 receptors transmits a signal whereas IL-1 Ra does not.

IL-1 is rapidly synthesized by mononuclear cells, which are stimulated by

microbial products or inflammatory agents. Because of the lack of a leader peptide, most

IL-I x remains in the cytosol of cells. There is some evidence that the precursor IL- I a is

transported to the cell surface where it has been identified as membrane IL-I (Brody and

Durum, 1989). In human monocytes, between 40-60% of IL-I P is transported out of the

cell but in contrast to IL-I a, IL- 113 enters the circulation. Various mechanisms for

transport include exocytosis from vesicles, active transport via multiple-drug-resistance

carrier proteins, or following cell death. Unlike the IL-i Ia precursor, the IL- 113 precursor

requires cleavage for optimal biological activity. Several common enzymes will cut the

IL- 113 precursor into smaller and more active forms. However, one particular protease

appears highly specific for cleaving the IL-I P precursor from 31 to 17.5 kD, its most

active form (Cerretti et al., 1992; Thornberry et al., 1992). This enzyme is known as the

IL-I P converting enzyme (ICE) and is a member of the cysteine protease family. ICE

does not cleave the IL-Ia precursor. Other enzymes have been found which cleave the

IL-Ia precursor, but these other enzymes seem less specific than ICE.

Molecular Biology of MnSOD

Our laboratory has previously characterized the rat MnSOD cDNA (Dougall,

1990). The rat MnSOD genomic locus was first sequenced by Ho et al. (1991). The

promoter region of MnSOD contains neither a "CAAT box" nor a "TATA box." Our

laboratory has also identified and characterized the rat MnSOD gene, which contains five

exons. Exon one encodes the 5' untranslated leader sequence, the mitochondrial signal









sequence, and the N-terminus of the rat MnSOD protein. Exon 2, 3, 4, and 5 encode the

mature MnSOD protein. Exon 5 contains the stop codon, TGA, and the 3' untranslated

region (Dougall, 1990). Primer extension analysis was used to locate the transcription

initiation site at between 70 and 74 nucleotides 5' to the start of translation (Hurt et al,

1992). There are five species of MnSOD mRNA identified by Northern analysis. Our

laboratory has demonstrated that these five species of MnSOD mRNA are the result of

differential polyadenylation (Hurt et al., 1992).

The regulation of MnSOD biosynthesis in E. coli is under rigorous control. The

induction of this enzyme is in response to the cellular environmental redox state. E. coli

grown in iron-poor medium or in the presence of iron-chelating agents results in an

induction of the bacterial MnSOD gene. On the other hand, cells grown in iron-enriched

medium produces an inhibition of MnSOD expression. All of these observations led

Fridovich to suggest that E. coli MnSOD is controlled by an iron-containing repressor

(Fridovich, 1986). More recently, the transcriptional regulators, Fnr, Fur, and Arc, were

identified (Hassan and Sun, 1992; Privalle and Fridovich, 1993) and found to negatively

regulate the expression of MnSOD in E. coli. Unlike bacteria, MnSOD synthesis in

eukaryotic cells is upregulated dramatically by proinflammatory mediators including

lipopolysaccharide (LPS), tumor necrosis factor alpha (TNF-a), interleukins-1 and -6

(IL-1, IL-6), and interferon gamma (IFN-,) (Wong and Goeddel, 1988; Shaffer et al.,

1990; Del-Vecchio and Shaffer, 1991; Dougall and Nick, 1991; Borg et al., 1992; Eddy et

al., 1992, Gibbs et al., 1992; Valentine and Nick, 1992; Visner et al., 1992; Whitsett et

al., 1992; Eastgate et al., 1993; Melendez and Baglioni, 1993; Bigdeli et al., 1994;









Jacoby et al., 1994; Akashi et al., 1995; Gwinner et al., 1995; Jones et al., 1995; Lontz et

al., 1995; Stephanz et al., 1996). In L2 cells, a rat pulmonary epithelial-like cell line,

MnSOD mRNA levels show an 18-23 fold induction after stimulation with LPS (Visner

et al., 1990). Cells treated with TNF-ox or IL-I showed similar results.

To evaluate the importance of on-going protein synthesis and de novo

transcription, studies with cycloheximide, an inhibitor of protein synthesis, showed no

effect on LPS-, TNF-a-, or IL-l-dependent induction of MnSOD mRNA level. On the

other hand, L2 cells co-treated with stimulant (LPS, TNF-cc, or IL-1) and actinomycin, an

inhibitor of mRNA transcription, inhibited the stimulus-dependent induction of MnSOD

mRNA expression (Visner et al., 1990). Furthermore, nuclear-run on data showed a 9

fold induction in MnSOD mRNA level (Hsu, 1993). The above evidence suggests that

the regulation of MnSOD gene expression is, at least partly, transcriptionally dependent.

The difference between nuclear run-on analysis and in vivo data on mRNA level

following LPS treatment may be caused by the stability of the mRNA or the loss of some

transcription factors during the preparation of nuclei for nuclear run-on experiments.

Examinations of other cell types treated with LPS, TNF-a, or IL-I also showed similar

results at the mRNA level, including rat pulmonary artery endothelial cells (Visner et al.,

1992), porcine pulmonary artery endothelial cells (Visner et al., 1991), and intestinal

epithelial cells (Valentine and Nick, 1992). Interestingly, though Cu/ZnSOD contributes

the major part of the total cellular SOD activity, its mRNA level is not regulated by any

known stimulant to any large degree.








Enhancers

The control of transcription in prokaryotes is largely governed by sequences in the

vicinity of the transcriptional start site. Most prokaryotic promoters consist of short

sequence motifs approximately 10 to 35 base pairs upstream of the transcriptional start

site; these motifs make direct contact with RNA polymerase and thus serve to position

the start site (Rosenberg and Court, 1979). The initial characterization of eukaryotic

promoters revealed a similar arrangement of sequence elements. Many eukaryotic

promoters possess the conserved sequence motif TATAAA (the TATA box) in the -20 to

-30 region, and some promoters contain an additional upstream conserved element GG(T

or C)CAATCT (the CAAT box). However, unlike the corresponding prokaryotic

element, deletion of the TATA box does not necessarily abolish expression, as shown by

early studies on the histones H2A gene (Grosschedl and Birnstiel, 1980a). In addition,

these studies revealed that DNA sequences lying several hundred base pairs (bp)

upstream of the transcriptional start site can positively influence transcription, even when

positioned in an inverted orientation (Grosschedl and Birnstiel, 1980b).

Similar work with the simian virus 40 (SV40) early region indicated that the

TATA box was not required for early gene expression (Benoist and Chambon, 1980) and

that its deletion resulted in heterogeneous transcriptional start sites (Benoist and

Chambon, 1981). In addition, deletion of sequences about 150 bp upstream of the

transcriptional start site had an adverse effect on early gene expression. Deletion of one

of the two 72 bp repeat elements upstream of the early gene did not greatly reduce early

gene expression or virus viability, but the additional removal of a portion of the second

repeat reduced expression dramatically (Gruss et al., 1981; Benoist and Chambon, 1981).









Thus, it was found that DNA sequences lying a considerable distance upstream of

transcriptional start sites play a significant role in transcriptional regulation.

Further characterization of these sequences revealed a surprising result. When a

366 bp DNA segment of the SV40 promoter region was linked to a P-globin gene,

transcription of the gene was enhanced up to 200-fold (Banerji et al., 1981). This

enhancement of transcription occurred only when the SV40 sequences were present in

cis, did not depend upon DNA replication, and could occur when the sequences were

placed in both orientations either 1400 bp 5' or 3300 bp 3' of the gene. Enhancement

was observed as long as one copy of the 72 bp repeats was present. Similar results were

obtained when the SV40 promoter region was placed adjacent to the chicken conablumin

or adenovirus major late promoters, or within the T antigen gene intron sequences

(Moreau et al., 1981; Fromm and Berg, 1983). Thus, sequences within and flanking the

SV40 72 bp repeats are important for enhancing the expression of cis-linked promoters in

an orientation and distance independent fashion, although in some cases distance effects

were observed (Moreau et al., 1981). Studies with polyoma virus also revealed the

existence of a DNA segment essential for viral viability and capable of enhancing

expression of cis-linked genes (Tyndall et al., 1981; de Villiers and Schaffner, 1981).

Shortly thereafter, retroviruses were found to possess similar DNA elements in their long

terminal repeat (LTR) regions (Levinson et al., 1982; Gorman et al., 1982).

The properties of these viral transcriptional control elements now constitute the

definition of an enhancer element. These properties include the ability to (a) increase

transcription of cis-linked promoters, (b) operate in an orientation independent manner,









(c) exert an effect over large distances independent of position, and (d) enhance the

expression of heterologous promoters.

Since the first identified enhancer was observed in viral genomes it was

conceivable that these transcriptional control elements might be unique to viruses and

represent a means that enables them to compete for the host cell transcriptional

machinery. However, the discovery and characterization of mammalian cellular enhancer

elements within the immunoglobulin (Ig) genes eliminated this possibility (Banerji et al.,

1983; Gillies et al., 1983; Neuberger 1983; Mercola et al., 1983). Banerji et al. (1983)

showed that a several hundred bp DNA segment derived from the Ig heavy chain locus

could enhance expression of a linked 3-globin promoter in an orientation and position-

independent manner. This effect occurred only when the Ig sequences were present in cis

and did not depend upon DNA replication. Furthermore, enhancement occurred in three

different lymphoid cell lines, but not in mouse 3T6, mink lung, or human HeLa cells.

Gillies et al. (1983) concurrently demonstrated that the same DNA segment increased

expression of the Igy2b gene in an orientation and position independent manner, and

functioned in lymphoid cells but not in L cells. Thus, the enhancing sequences operated

in a tissue-specific manner. Similar results were obtained with the Ig K gene, which

indicated that a tissue-specific transcriptional enhancer element is located within the

intron separating the joining (JK) and constant (CK) regions (Queen and Baltimore, 1983;

Stafford and Queen, 1983; Queen and Stafford, 1984; Picard and Shaffner, 1984). The

identification of enhancers in cellular genes indicated that enhancers are not

transcriptional control elements peculiar to viral genomes.









Previous work from our laboratory demonstrated that the regulatory element

responsible for the dramatic inductions in MnSOD mRNA was not contained within the

5' flanking region of the gene (Chesrown, 1994). Further work suggested that another

region of DNA within the gene might be responsible for the transcriptional regulation by

inflammatory mediators (Chesrown, 1994). The main objective of the research presented

in this dissertation was to investigate the molecular mechanisms responsible for the

dramatic inductions of MnSOD expression in response to inflammatory stimuli. The

ultimate goal of this study was to characterize the cis-element(s) within the gene

responsible for the inducibility of MnSOD. These results will provide information for

future identification of the trans-acting factors, and other steps and components involved

in the inflammatory pathway of MnSOD.















CHAPTER 2
MATERIALS AND METHODS

Materials


Ham's F12K Medium (Cat# N-3520), bovine serum albumin (Cat# A-751 1), and

dithiothreitol (Cat# D-0632), bacterial lipopolysaccharide (LPS) E.coli serotype 055:B5

(Cat#L 2880), amobarbital (Amytal) (Cat#A 4430), 2-heptyl-4-hydroxyquinoline N-

oxide (HQNO) (Cat#H 3875), oligomycin (Cat#O 4876), and myxothiazol (Cat#M 5779)

were purchased from Sigma Chemical Company, St. Louis, MO. Oligonucleotides,

deprotected, desalted, and dephosphorylated, Medium 199 with Earle's salts (Cat#3 1100-

035), fetal bovine serum (Cat# 16000-044), antibiotic-antimycotic solution (ABAM)

(Cat#15240-062), restriction enzymes, Taq DNA Polymerase (Cat# 18038-018), T4 DNA

Ligase (Cat# 15224), DH5a E. coli competent cells (Cat# 18265017), and Random

Primers DNA Labeling System (Cat# 18187-013) were purchased from Gibco BRL,

Gaitherburg, MD. Recombinant human TNF-a was a gift from Genentech. IL-103 was a

gift from the National Cancer Institute. Antimycin A (Cat#1782), N-acetyl cysteine

(Cat# 106425), SB 203580 (559389), and PD 98059 (Cat#513000) were purchased from

Calbiochem, San Diego, CA. The I kappa kinase inhibitor, Bay 11-7082, was purchased

from BioMol, Plymouth Meeting, PA. (Sigma Corp, St. Louis, MO.). VentR DNA

Polymerase (Cat# 254S), restriction enzymes, T4 Polynucleotide Kinase (Cat#201 S), and

calf intestinal alkaline phosphatase (CIP) (Cat#290S) were purchased from New England









Biolabs, Inc., Beverly, MA. Long Ranger Gel Solution (Cat# 50611), and Seakem HGT

agarose (Cat# 50040) were purchased from FMC BioProducts, Rockland, ME.

Proteinase K (Cat# 161519) and E. coli tRNA (Cat# 109541) were purchased from

Boehringer-Mannheim, Indianapolis, IN. TA Cloning kit (Cat# K2000) was purchased

from Invitrogen Corporation, Carlsbad, CA. pCRScript Cloning kit (Cat# 211188-5) was

purchased from Stratagene, La Jolla, CA. Zetabind positively charged nylon transfer

membrane (Cat# NM511-01-045SP) was purchased from Cuno, Meriden, CT. Dimethyl

sulfate (Cat#18,630-9) amd sodium cacodylate (Cat#23,385-4) were purchased from

Aldrich, Milwaukee, WI. Piperidine (Cat# P 125-100) was purchased from Fisher

Scientific, Pittsburg, PA. QlAquick Nucleotide Removal kit (Cat#28304), QlAquick Gel

Extraction kit (Cat#12162), QIAprep Spin Miniprep kit (Cat#27106), Qiagen Plasmid

Midi kit (Cat#12144), Qiagen Plasmid Maxi kit (Cat# 12162) were obtained from

Qiagen, Valencia, CA. Hyperfilm MP (Cat# RNP 1677K, Cat#RNP30H), Ultrapure

dNTP Set (Cat# 27-2035-01), and adenosine 5'-triphosphate (Cat#27-1006-01) were

purchased from Amersham-Pharmacia, Piscataway, NJ. [a-32p]dATP (3,000 Ci

(11 TBq)/mmol) (Cat# BLU013H) and ['-32p]ATP (3,000 Ci (11 1TBq)/mmol)

(Cat#BLU002A) were purchased from New England Nuclear (NEN) Life Sciences

Products, Boston, MA. Cell lines rat pulmonary epithelial-like L2 (Cat# ATCC CCL

149) was purchased from American Type Culture Collection, Manassas, VA. pOGH and

pTKGH were obtained as a kit (Cat# 40-2205) from Nichols Institute Diagnostics, San

Juan Capistrano, CA. All other chemicals not mentioned were obtained through either

Sigma Chemical Co. or Fisher Scientific.











Methods

Tissue Culture

The cell lines used in the studies described in this thesis were: L2 rat pulmonary

epithelial-like cells (ATCC CCL 149), rat pulmonary artery endothelial cells, VA cells,

isolated from segments of pulmonary artery by mechanical methods (Visner et al., 1992),

and, mouse fibroblast antimycin-resistant mutant cells, LA9 cells (generously provided

by Dr. Neil Howell, Howell et al., 1983). All cells were cultured as adherent monolayers.

The L2 rat pulmonary epithelial-like cell line (ATCC CCL 149) was grown as a

monolayer in 150 mm tissue culture plates containing Ham's modified F12K medium

(GIBCO) supplemented with 10% fetal bovine serum, 10 gg/ml penicillin G, 0.1 mg/ml

streptomycin, and 0.25 gg/ml amphotericin B at 370C in humidified air with 5% CO2. If

cells were used for in vivo footprinting experiments, then at approximately 90%

confluence, cells were treated with 0.5 gig/ml Escherischia coli (E. coli) LPS (E.coli

serotype 055:B5, Sigma), 10 ng/ml TNF-a (kindly provided by the Genentech Corp.), or

2 ng/ml IL- 1I0 (kindly provided by the National Cancer Institute) for 2 or 4 hours to

induce MnSOD gene expression. Untreated cells were used as controls. VA cells, a rat

pulmonary artery endothelial cell line, were grown in Medium 199 with Earle's salts

(Sigma Corp., St. Louis, MO.) with sodium bicarbonate to pH 7.4, 10% fetal bovine

serum, 10 mM L-glutamine and antibiotic-antimycotic solution at 370 C in room air, 5%

CO2. LA9 cells, a mouse fibroblast antimycin-resistant mutant cell line (Howell et al.,

1983), were grown in Ham's F12K media with 10% fetal bovine serum, 10 mM L-

glutamine, and antibiotic-antimycotic solution at 37' C in room air, 5% CO2.









Experiments with VA cells and LA9 cells were all performed with confluent 100 mm

tissue culture plates.

Polymerase Chain Reaction (PCR)

The PCR reaction contained: DNA template (10-20 ng), 20 mM Tris-HCl pH 8.0,

50 mM KCI, 1.5 mM MgCl2, 0.2 mM of each dNTP, 100 pmol of each oligonucleotide

primer (oligonucleotide primers for PCR were obtained deprotected, desalted, and

dephosphorylated) in a total volume of 99.5 pl covered with 60 p1 of mineral oil. This

mixture was heated for 5 minutes to allow denaturation of the template and 0.5 p1 (2.5 U)

of Taq DNA Polymerase were added after 3 minutes of this time. The PCR was run in a

Perkin Elmer 480 thermocycler (Perkin Elmer Corporation, Norwalk, CT) for 25 cycles,

1 minute and 30 seconds at 94'C for denaturation, 30 seconds at 55-65C for annealing,

and 1 minute at 72C for extension. After 25 cycles, samples were incubated at 72'C for

10 minutes to allow complete extension and addition of an extra deoxyadenosine

nucleotide in each fragment by Taq DNA polymerase and refrigerated at 4C. Mineral

oil was extracted by the addition of 120 p1 of chloroform:isoamyl alcohol (IAA),

vortexing, and centrifugation for 5 minutes at 13,000 x g at room temperature. The

aqueous phase was transferred to a new tube and 10 p1 of the PCR reaction plus 1/6

volume of bromophenol blue/xylene cyanol/Ficoll mixture was loaded on a 1-2% Seakem

HGT agarose gel containing ethidium bromide (0.1 mg/ml), 40 mM Tris-acetate, 20 mM

acetic acid, 1 mM EDTA and run with TAE buffer for 40-60 minutes at 80-100 volts.

The DNA templates for the PCR used to produce the MnSOD genomic fragments

in the enhancer deletion analyses were plasmids containing restriction-digested fragments

from the original genomic clones (Dougall, 1990).









TA Cloning of PCR Products

Taq DNA polymerase has a nontemplate-dependent activity, which adds a single

deoxyadenosine (A) to the 3' ends of PCR products. The linearized vector, pCR2. 1,

supplied in the TA Cloning kit (Invitrogen, Carlsbad, CA), has a single 3'

deoxythymidine (T) residue. This allows PCR inserts to ligate efficiently with those

vectors. To ligate the PCR product in the TA cloning vector, 1 g1 of fresh PCR reaction

was incubated with 2 gl of the pCR2.1 vector (50 ng in 10 mM Tris-HC1, 1 mM EDTA,

pH 7.5), 1 gl of lOX T4 DNA ligase buffer (60 mM Tris-HC1, pH 7.5, 60 mM MgC2, 50

mM NaCl, 1 mg/ml bovine serum albumin, 70 mM P-mercaptoethanol, 1 mM ATP, 20

mM dithithreitol, 10 mM spermidine), 5 gl of sterile ddH20, and 1 g1 of T4 DNA ligase

(4 U) for 16 hours at 160C.

Two g1 of the ligation reaction were used to transform 50 ml of E. coli competent

cells, INVaF' strain, in the presence of 2 ml of 0.5 M P-mercaptoethanol, for 30 minutes,

on ice. The transformation reaction was then heat shocked for 45 seconds at 42C and

450 gl of SOC medium (2% tryptone, 0.5% yeast extract, 10 mM NaCl, 2.5 mM KC1, 10

mM MgCl2, 20 mM glucose, pH 7.0) were added. This mixture was incubated at 37C

for one hour in a rotary shaker at 225 rpm. After this time, 100 pl of the bacteria solution

were plated using a glass spreader on YT (1.6% bacto-tryptone, 1% yeast extract, 0.5%

NaCl, pH 7.0) agar plate (1.5% Bacto-agar added), supplemented with 50 gg/ml of

ampicillin and covered with 20 pl of 5-Bromo-4-Chloro-3-indolyl-3-D-galactoside (X-

gal) (40 mg/ml), and incubated at 37C overnight. X-gal is a substrate for 3-

galactosidase, and when this gene is present in the vector, P-galactosidase metabolizes X-

gal, a blue product is formed and the colony becomes blue. If an insert is present in the









plasmid, the P-galactosidase gene is disrupted, X-gal is not metabolized, and the colony

remains white.

Reporter Vector Cloning

A 4.5 kb EcoR I/Eag I fragment of 5' non-coding sequence was isolated from the

17 kb MnSOD genomic clone (Figure 3-1) and the 5' overhang ends filled in using the

large fragment of E. coli DNA polymerase I (Klenow fragment). The resulting blunt-end

Eco/Eag fragment was cloned into the Hinc II polylinker site in a promoterless, pUC 12-

based human growth hormone expression vector, pOGH, (Selden et al., 1986), creating a

9.3 kb plasmid referred to as Eco/E GH (Figure 3-10). The unique restriction enzyme

site, HindII, was utilized to delete a 2.0 Kb portion of the MnSOD Eco/E sequence,

creating the vector, Hind/E (Kuo et al., 1999, Figure 3-10). To test for non-specific

effects of the inflammatory mediators on hGH expression, we used an hGH expression

vector that contained the herpes simplex thymidine kinase minimal promoter, pTKGH

(Selden et al., 1986).

To identify possible regulatory elements in the remainder of MnSOD that might

interact with the 5' promoter, we cloned an internal 6.1 kb Hind III fragment (+1180 to

+7312) from the rat genomic clone into the HindlII site of the Hind/E GH vector, creating

a 13.45 kb vector (Figure 3-1). The same Hind III fragment was cloned into Hind/E GH

in the opposite orientation. To begin to localize observed enhancer effects, we removed

the Hind III/Hpa I fragment (+1180 to +5046) and the Hpa I/Hind III fragment (+5046 to

+7312) from the Hind III fragment in both orientations creating enhancer deletions of 3.8

Kb or 2.3 Kb in the Hind/E GH construct (Figure 3-3). To clarify the position of the

enhancer within the 3.8 kb fragment, serial 3' and 5' deletions of the area were performed









by creating PCR products (Figure 3-3) which were subsequently cloned into the Hind/E

GH vector at the HindIllI site or NdeI site. Oligonucleotides flanking the regions of

interest were designed containing either HindllI or NdeI sites for convenient ligation into

the restriction sites. To test whether the enhancer activity was specific to the MnSOD

promoter, we used the plasmid, TKGH, which contains a heterologous, TATA-

containing, non-GC-rich promoter. The 6.1 kb Hind III MnSOD genomic fragment

(+1180 to +7312) was cloned into the HindII site (Figure 3-9) in the TKGH polylinker in

both orientations. To evaluate the interaction of the promoter with the enhancer

fragment, the 919 bp (Figure 3-3) fragment of MnSOD containing the entire enhancer

region was ligated into the NdeI site of the promoter deletion constructs (Figure 3-10).

Comparison of the rat enhancer sequence with the analogous region in human

MnSOD revealed a high degree of homology in intron 2. PCR amplification of a 466 bp

fragment (+2410 to +2875, human manganese SOD, accession S77127) from human

genomic DNA with primers, 5' CGTTAGTGGTTTGCACAAGGAAGATAATCG 3'

and 5' GGCTCTGATTCCACAAGTAAAGGACTG 3', to create a fragment, which was

inserted into NdeI site of the TKGH vector in both orientations.

Plasmid Purification

For small scale plasmid isolation the QIAprep Spin miniprep from Qiagen was

used. A single bacterial colony from YT agar plates with ampicillin was used to

inoculate 5 ml of YT media (1.6% bacto-tryptone, 1% yeast extract, 0.5% NaCl, pH 7.0)

supplemented with 50 ig/ml of ampicillin and grown overnight at 37C in a rotary water

bath shaker. Plasmids were extracted using the QlAprep Spin Miniprep kit following the

manufacturer's protocol. Bacteria from 1.5 ml of YT culture were collected by









centrifugation at 13,000 x g for 5 minutes, resuspended in 250 111 of resuspension buffer

(50 mM Tris-HC1, pH 8.0, 10 mM EDTA, 100 gg/ml RNase), lysed with 250 g1 of lysis

buffer (200 mM NaOH, 1% SDS), neutralized and adjusted to high-salt binding

conditions with 350 gl of neutralization buffer (3 M potassium acetate, pH 5.5), and

centrifuged for 10 minutes at 13,000 x g, at 40C. The supernatant was applied to a

QlAprep silica-gel membrane column. A vacuum manifold was used for the following

steps. First, the supernatant was drawn through the column using the vacuum manifold.

The column was washed once with 500 gl wash buffer (10 mM Tris-HCl, 80 % ethanol)

containing chaotrophic salts and once with 750 ptl wash buffer (10 mM Tris-HC1, 80 %

ethanol). The column was then centrifuged at 13,000 x g for 2 minutes at room

temperature. The plasmid DNA was eluted from the column with addition of 100 gl of

TE buffer (50 mM Tris-HC1, pH 8.0, 10 mM EDTA), and centrifugation at 13,000 x g for

one minute at room temperature into a clean, DNase-free eppendorf tube.

For large, scale plasmid isolation a QIAGEN plasmid maxi kit was used. One ml

of a single colony overnight liquid culture (5 ml YT/ampicillin) was inoculated in 50 ml

(high copy plasmid) of YT media supplemented with 50 gg/ml of ampicillin, and grown

overnight at 370C in a rotary water bath shaker. Bacteria were collected by centrifugation

(4,000 x g, 15 minutes, 4C), pellets were resuspended in 10 ml of resuspension buffer

(50 mM Tris-HC1, pH 8.0, 10 mM EDTA, 100 gg/ml RNase), lysed with 10 ml of lysis

buffer (200 mM NaOH, 1% SDS) and incubated for 5 minutes at room temperature,

neutralized by addition of chilled (4C) neutralization buffer (3 M potassium acetate, pH

5.5), incubated on ice for 20 minutes, and centrifuged at 16,000 x g for 30 minutes at

4C. The supernatant was removed from the centrifugation tube with a sterile transfer









pipette and allowed to flow through by gravity on a QIAGEN-tip 500 column, that had

been previously equilibrated with 10 ml of equilibration buffer (750 mM NaCl, 50 mM

MOPS, pH 7.0, 15% isopropanol, 0.15% Triton X-100). The flow-through was discarded

and the column was washed twice with 30 ml of wash buffer (1 M NaCl, 50 mM 3-(N-

morholino)propane sulfonic acid (MOPS), pH 7.0, 15% isopropanol) by gravity flow.

Plasmid DNA was eluted from the column with 15 ml of elution buffer (1.25 M NaCl, 50

mM Tris-HCl, pH 8.5, 15% isopropanol). The DNA present in the eluate was

precipitated with 0.7 volumes (10.5 ml) of isopropanol, and collected by centrifugation

(16,000 x g, 30 minutes, 40C). The pellet was washed once with 5 ml of 70% ethanol and

centrifugation was repeated (16,000 x g, 30 minutes, 4C). The final pellet was

resuspended in 300-500 p1 of TE buffer.

Plasmid DNA concentration was estimated by measuring the absorbance at 260

mn in a Beckman DU-64 Spectrophotometer (Beckman Instruments, Inc., Fullerton, CA),

of water dilutions (1:50) from each sample. An absorbance of I at 260 m corresponds

to 50 mg of double-stranded DNA. The ratio between the readings taken at 260 nm and

280 nm (A260/A280) provided an estimate of DNA purity (1.5-2.0). Typical yield

depended on the size of the plasmid, but ranged from 20-50 pg of plasmid DNA for

QlAprep Spin minipreps and 400-800 pg for maxi-size preparations.

Transient Transfection of Mammalian Cells

L2 cells, a rat pulmonary epithelial-like cell line (ATCC CCL 149), were grown

in Ham's modified F12K medium (GIBCO) with 10% fetal bovine serum (Flow

Laboratories), ABAM (penicillin G 100 U/ml, streptomycin 0.1 mg/ml, amphotericin B

0.25 mg/ml (Sigma) and 4 mM glutamine at 37C in room air, 5% CO2. To control for









transfection efficiency, transfections were carried out using a batch transfection method.

Cells were grown as monolayers on 150 mm tissue culture plates until 70-90% confluent.

The cells were transfected with 10 mg of each expression vector using the DEAE-dextran

method (Kriegler et al., 1990). After 24 h, cells from each 150 mm, batch transfected

plate were trypsinized, pooled, and plated onto four separate 100 mm tissue culture

plates. Inflammatory mediators were added to the medium of each plate 24 h later with

final concentrations of 0.5 jig/ml Escherichia coli lipopolysaccharide (LPS, E. coli

serotype 055:B5, Sigma), 10 ng/ml TNF-cL, or 2 ng/ml IL-I P. Twenty-four hours later,

total RNA was isolated from the cell monolayers for northern analysis.

RNA Isolation

Total cellular RNA was isolated according to the procedure described by

Chomczynski and Sacchi (1987) with modifications (Visner et al, 1990). Briefly, the

monolayer cells (L2 cells or VA cells), cultured as noted above, were washed once with

room temperature PBS, and then 3 ml/100 mm tissue culture plate of guanidinium

thiocyanate solution (4 M guanidinium thiocyanate, 25 mM sodium citrate pH 7.0, 0.5%

sarcosyl, and 0.1 M 2-mercaptoethanol) were added. The homogenate was collected in a

15 ml conical polypropylene tube and extracted with 0.1 volume of 2 M sodium acetate

pH 4.0, and an equal volume of water-saturated phenol. This suspension was mixed

together and cooled on ice for at least 15 minutes. Before centrifugation at 3,000 x g for

20 minutes at 4C, 0.22 volumes of chloroform/isoamyl alcohol (IAA) (49:1) were added

and the mixture was shaken vigorously for 20 seconds. After centrifugation, the aqueous

phase was transferred to a fresh centrifugation tube and mixed with an equal volume of

isopropanol. This solution was placed at -20C for at least 1 hour and then centrifuged at









10, 000 x g for 25 minutes at 40C. The RNA pellet was resuspended in 500 PI of

guanidinium thiocyanate solution and transferred to a 1.5 ml microfuge tube. An equal

volume of isopropanol was added and the mixture was incubated for at least an hour at -

200C. RNA was collected by centrifugation at 10, 000 x g for 10 minutes at 4C, and 400

p of DEPC-treated water was added to the pellet and incubated at 500C for 15 minutes.

The RNA was precipitated with 0.1 volume of DEPC-treated 3 M sodium acetate pH 5.2,

and 2.2 volumes of 100% ethanol, followed by incubation at -20C for at least an hour.

The RNA was collected again by centrifugation, resuspended in 300 PI of DEPC-treated

water and ethanol precipitated one more time. The final pellet was dried in a Savant

speed-vacuum centrifuge to remove any trace amounts of ethanol, and then resuspended

in DEPC-treated water.

RNA concentration was estimated by measuring the absorbance at 260 nm in a

Beckman DU-64 Spectrophotometer (Beckman Instruments, Inc., Fullerton, CA), of two

water dilutions (1:20) from each sample. An absorbance of 1 at 260 nm corresponds to

40 pg of RNA. The ratio between the readings taken at 260 nm and 280 nm (A260/A28o)

provided an indication of RNA purity (1.5-2.0). Typical RNA yield for L2 cells or VA

cells was 80-150 pg per 70-100% confluent 100 mm tissue culture plate.

Northern Analysis

RNA was size-fractionated for 16 hours at 40 volts on a 1% Seakem HGT agarose

gel containing 6.6% formaldehyde, 40 mM MOPS pH 7.0, 10 mM sodium acetate pH

7.4, and 1 mM EDTA pH 8.0 with constant buffer recirculation. For each lane of the gel,

twenty pg of total RNA were dried and resuspended in 30 ml of 12.5 M formamide, 6.6%

formaldehyde, 6 mM sodium acetate pH 7.4, 0.5 mM EDTA pH 8.0,20 mM 3-(N-









morholino)propane sulfonic acid (MOPS) pH 7.0. This RNA was dissolved and heated

by incubations for 10 minutes at 50'C, then for 10 minutes at 650C. A 5 P1 aliquot of

loading dye (0.4% xylene cyanol FF, 0.4% bromophenol blue, 1 mM EDTA pH 8.0, 50%

glycerol, 0.3 pg/ptl ethidium bromide) was added prior to loading the gel. To confirm

that equal amounts of RNA had been loaded into each lane, after electrophoresis, each gel

was photographed under UV light and the level of ribosomal RNA assessed by the

ethidium bromide staining. Ethidium bromide was present in the loading dye and RNA

could be visualized promptly under UV light after electrophoresis. The gel was then

treated for 30 minutes with 50 mM NaOH, 30 minutes with 100 mM Tris-HCl pH 7.0,

and twice for 25 minutes with 50 mM TBE (10 mM Tris-HCl, pH 8.0, 1 mM EDTA, pH

8.0). The RNA was electo-transferred to a positively-charged nylon membrane in 40 mM

TBE for 75 minutes and then covalently cross-linked to the membrane with UV light

(Church and Gilbert, 1984).

Genomic DNA Isolation

For genomic DNA isolation, L2 cells were grown in 15 cm tissue culture plates

until 70-90% confluent, washed once with PBS and lysed with 3 ml lysis solution (50

mM Tris-HC1, pH 8.5, 25 mM EDTA, pH 8.0, 50 mM NaC1, 0.5% SDS, 300 Pg/ml

Proteinase K). The lysate was incubated overnight on a rocking platform at room

temperature. After this incubation, the lysate was then extracted once with equal volume

of Tris-equilibrated phenol for at least 1 hour at room temperature on a rocking platform.

The phases were separated by centrifugation at 3,000 x g for 20 minutes at room

temperature. The upper aqueous phase was transferred with a sterile large-bore, transfer

pipette to a new tube. Then the lysate was extracted once with an equal volume of








phenol/chloroform:isoamyl alcohol (IAA) (50/49:1) and once with chloroform:IAA, with

incubations of at least one hour at room temperature on a rocking platform, and

centrifugations at 3,000 x g for 20 minutes at room temperature to separate the phases.

After separation of the phases in the cholorform:IAA extraction, 2.5 ml of RNase A (750

U/ml) was added to the lysate, for digestion of contaminant RNA, and the mixture was

incubated overnight at room temperture on a rocking platform. The lysate was extracted

again, once with phenol/chloroform:IAA, and once with chloroform:IAA, as above.

DNA was precipitated from the aqueous phase by addition of 120 pl 5M NaC1 to final

concentration of 0.2 M and 2.5 volumes (7.5 ml) of ice-cold 100% ethanol. The cotton-

like DNA was collected with a sealed bent glass Pasteur pipette, washed by rinsing the

DNA with 2 ml of chilled (4C) 80% ethanol and resuspended in 300 pl of TE buffer (10

mM Tris-HCl, pH 8.0, 1 mM EDTA, pH 8.0).

Electrophoretic Mobility Shift Assay (EMSA)

EMSA were performed as previously described (Fried and Crothers, 1981) with 8

mg nuclear extract prepared from control and LPS, TNF-a, or IL-I P-treated L2 cells by

high salt extraction (Andrews and Faller, 1991). Binding reactions were carried out at

room temperature in 10 mM HEPES (N-[2-Hydroxyethyl]piperazine-N'-[2-

ethanesulfonic acid])-KOH, pH 7.9, 100 mM KC1, 1mM dithiothreitol, 0.5 mM MgCl2,

0.1 mM EDTA and 8.5% glycerol to yield a final volume of 20 Pl. EMSA probes were

made from cloned PCR products of the defined enhancer region between 4130 and 4491

and end-labeled by filling the recessed 3' termini of EcoRI digested fragments with 32p_

dATP using the large fragment of E. coli DNA polymerase I (Klenow fragment).

Fragments used in EMSAs were 143 bp (+4348 to +4491), 143 bp (+4231 to +4374), 100









bp (+4231 to +4331), 95 bp (+4331 to +4426), and 103 bp (+4426 to +4529). Numbers

shown in parentheses refer to sequence in the rat MnSOD gene (accession X56600).

In Vivo DMS Treatment

L2 cells were cultured as described above in 150 mm tissue culture plates. The

medium was removed by aspiration and the cells washed once with room temperature

phosphate buffered saline (PBS, 10 mM sodium phosphate, pH 7.4 and 150 mM NaCl).

The PBS buffer was removed and replaced with room temperature PBS containing

0.25%-0.5% demethyl sulfate (DMS, Aldrich) for 1-2 min. The PBS containing DMS

was rapidly removed (30-60 seconds), and the cell monolayer washed twice with 40C

PBS to quench the DMS reaction. The cells were lysed in 5 ml of lysis solution (50 mM

Tris pH 8.5, 25 mM EDTA pH 8.0, 50 mM NaCl, 0.5% SDS, 300 Ag/ml Proteinase K)

followed by incubation overnight at room temperature on a rocking platform. Genomic

DNA was then purified by phenol/chloroform extractions. Each sample was extracted

once with an equal volume of Tris-equilibrated phenol, followed by two extractions with

a 24:24:1 (v/v/v) mixture of Tris-equilibrated phenol/chloroform/isoamyl alcohol, and

finally by one extraction with a 24:1 (v/v) mixture of chloroform/isoamyl alcohol. Each

extraction was performed for at least an hour on a rocking platform prior to collection of

aqueous phase. The aqueous phase was collected each time by centrifugation at 14, 000 x

g for 10 minutes at room temperature and ethanol precipitated. Samples were then

treated with 100 pg/ml RNase A, organic extracted as above, ethanol precipitated and

suspended in TE (10 mM Tris pH 8.0 and 1 mM EDTA). The DNA samples were

digested with BamH I restriction endonuclease enzyme, and strand cleavage at modified

guanine residues was achieved by treatment with 1 M piperidine (Fisher Scientific) at









90C for 30 minutes. Naked genomic DNA was isolated and purified from cells without

any DMS treatment and digested with restriction endonuclease enzyme, BamHI (New

England Biolabs).

As a control, genomic DNA was extracted in the same way from cells incubated

in Ham's F12K medium for 2 or 4 hours, but not treated with DMS. One hundred Pg of

this "naked" DNA was restriction digested with BamHI. After digestion, DNA was

extracted once with pheno/chloroform:IAA, once with chloroform:IAA, and ethanol

precipitated with 2.5 volumes of 100% ethanol and 2.5 M ammonium acetate incubating

at -70*C for 30 minutes. DNA was collected by centrifugation at 16,000 x g for 30

minutes at 4C, and washed twice with 80% ethanol and centrifugation at 16,000 x g for

30 minutes at 40C. After lyophilizing, the pellet DNA was resuspended in 10 pl of sterile

water. The in vitro DMS treatment of the naked DNA recovered from digestion of

BamHI was done as described by Maxam and Gilbert (1980) with some modification.

Naked DNA (100 jg) in 10 pl of water was added to 190 p1 of DMS buffer (50 mM

sodium cacodylate, 0.1 M EDTA, pH 8.0), treated for 30 seconds with 0.5 P1 (0.25%) of

DMS, and immediately precipitated with addition of 7.5 M ammonium acetate to the

final concentration of 2.5 M, 14 jig of E. coli tRNA, and 2.5 volumes of 100% ice-cold

ethanol. After incubation in a dry ice/ethanol bath for at least 5 minutes, DNA was

collected by centrifugation at 13,000 x g for 30 minutes at 4C, resuspended in 250 p1 of

common reagent (2.5 M ammonium acetate, 0.1 mM EDTA, pH 8.0), and precipitated

again by addition of 14 pg of tRNA and 750 pl of ice-cold 100% ethanol. After

incubation for 5 minutes in the dry ice/ethanol bath, DNA was collected by centrifugation

at 13,000 x g, for 30 minutes at 40C and washed twice with 80% ethanol with









centrifugation as above. After lyophilization, the final DNA pellet was resuspended in 90

pl of sterile water.

Once the DMS-modified DNA (both in vivo- and in vitro-treated samples) were

precipitated and redissolved in water (approximately 70 mg in 90 ml of sterile water) as

described, the DNA was mixed with 10 ml of piperidine (10 M) and incubated at 900C

for 30 minutes to cleave the DNA at the modified guanine residues (Maxam and Gilbert,

1980). DNA was then ethanol precipitated, collected by centrifugation at 13,000 x g at

40C for 30 minutes, washed twice with 80% ethanol, lyophilized, and then resuspended

and lyophilized three more times in 500 p1 of sterile water. After the last lyophilization,

DNA was resuspended in 20 pil of TE buffer.

Ligation-Mediated PCR (LMPCR)

LMPCR was begun by annealing 3 pmol of primer I to 3 pig of DMS-modified

and piperidine cleaved DNA for each sample in 1 X Vent polymerase buffer (10 mM

KCI, 10 mM (NH4)2SO4, 20 mM Tris-HC1 (pH 8.8), 2 mM MgSO4, 0.1% Triton X-100),

in a total volume of 15 ml, with denaturation at 95C for 10 minutes followed by primer

annealing at 45C for 30 minutes. Primer 1 is the primer for the known site of the

cleaved DNA and is a synthetic single stranded oligonucleotide. The first strand primers

utilized for bottom strand, 5'-GGATAACTTTGGGGAGTTGGTTC-3' and 5'-

GAATAATGTTAGCCGTGTCTCTGGG-3', as well as for the top strand, 5'-

CCAACCTTTGGGTTCTCCAC-3'. The first strand synthesis was performed in 1 X

Vent polymerase buffer with 4 mM MgSO4, 0.25 mM of each dNTP, and 2 U of Vent

DNA polymerase. The samples were incubated for 1 minute each at 53'C, 550C, 570C,









60 C, 62 C, 64 C, 68 C, followed by incubations for 3 minutes each at 72C (Hornstra

and Yang, 1993). Separate primer 1 for top and bottom DNA sequence were designed.

Following the first strand synthesis, a common linker was ligated to the double-

stranded DMS-piperidine cleaved fragment. The linker sequences used were the same as

published by Mueller and Wold (1989). The double-stranded linker is composed of two

synthesized, dephosphorylated complementary oligonucleotides, a 25-mer

oligonucleotide (5'-GCGGTGACCCGGGACATCTGAATT-3') annealed to an 1 1-mer

oligonucleotide (5'-GAATTCAGATC-3'). The double stranded linker (20 pmol/ml) was

prepared from these oligonucleotides by mixing 2 nmol each in 250 mM Tris-HC1, pH

7.7 (total volume of 100 ml), and heating to 950C for 10 minutes followed by gradual

cooling down to 40C for 3 hours, in a thermocycler (Perkin Elmer 480, Applied

Biosciences PE, Norwalk, CT) and incubation at 4C overnight. After the primer

extension step with primer 1, 20 jt1 of 40C solution containing 50 mM dithiothreitol, 18

mM MgC12, 0.125 tg/ d nonacetylated BSA (Sigma Cat#A-751 1), and 110 mM Tris-

HC1, pH 7.5 (Garrity and Wold, 1992) were added, followed by addition of 25 ml of a

40C ligation solution containing 20 mM dithithreitol, 10 mM MgC12, 0.05 ptg/pl

nonacetylated BSA, 3 mM ATP, 4 pmol of annealed common linker, and 4 U of T4 DNA

ligase (Garrity and Wold, 1992). Ligation was performed at 160C overnight. The T4

DNA ligase and the Vent polymerase were removed by one extraction with an equal

volume of phenol/chloroform:IAA and one extraction with an equal volume of

chloroform:IAA. DNA was precipitated by the addition of 7.5 M ammonium acetate to a

final concentration of 2.5 M, 14 jig of tRNA, and 2.5 volumes of 100% ethanol and

incubation at -700C for 30 minutes. After precipitation, the DNA was collected by









centrifugation (13,000 x g, 30 minutes, 4C), washed once with 80 % ethanol, and again

DNA collected after centrifugation (13,000 x g, 30 minutes, 40C), lyophilized, and

resuspended in 20 ml of sterile water.

After ligation of the linker, the nested set of linear genomic DNA fragments from

the region of interest were amplified by PCR using a second gene-specific

oligonucleotide primer, termed primer 2 (5'-GGGGAGTTGGTTCTCTCCTTTCACTG-

3' and 5'-GCCGTGTCTCTGGGTTAGCTGTATTGC-3', respectively for bottom

strands and 5'-CCAACCTTTGGGTTCTCCAC-3' for the top strand, as well as the

complementary primer to the 25-mer linker-primer (5'-

CGCCACTGGGCCCTCTAGACTTAAG-3'). PCR conditions were the same for both

DNA strands and sets of primers, as described by Homstra and Yang (1993) with some

modifications. Freshly prepared Taq DNA polymerase mix (79.4 jLl) containing 1 x Taq

DNA polymerase buffer (1 x 20 mM Tris-HC1, pH 8.4, 50 mM KC1, 1.75 mM MgC12,

0.25 mM each dNTP, 15 pmol primer 2, and 10 pmol 25-mer complementary linker

primer were added to the common linker-ligated DNA samples. Samples were initially

heated to 95C for 5 minutes and 0.6 gl (3 U) of Taq DNA polymerase was added after

the first two minutes of this period. The annealing temperatures (53-65C) were

determined experimentally to establish the conditions that yielded the best results.

Samples were denatured at 95C for 1 minute, annealed at 58C for 2 minutes, and

extended at 76C for 3 minutes. Samples were denatured, annealed and extended in this

manner for 25 cycles. In addition, with each cycle of PCR amplification, the extension

time was increased by 5 seconds. After 25 cycles, samples were kept at 76C and 5 ml of

a fresh PCR incubation solution containing 2.5 mM each dNTP, 1.75 mM MgC12, 1 X









Taq DNA polymerase buffer, and I U of Taq DNA polymerase was added. Samples

were then incubated at 760C for 30 minutes to ensure full extension of each template

strand and addition of a single deoxyadenosine nucleotide to the end of every fragment.

After this incubation, samples were placed on ice, and 1 ml of 0.5 M EDTA was added to

stop the reaction. The DNA was precipitated by addition of 7.5 M ammonium acetate to

a final concentration of 2.5 M, 14 plg of tRNA, and 2.5 volumes of 100% ethanol, and

incubation at -700C for 30 minutes. DNA was collected by centrifugation (13,000 x g,

4C, 30 minutes), washed twice with 80% ethanol and collected again by centrifugation

(13,000 x g, 40C, 30 minutes), lyophilized, and resuspended in 20 P.t of water.

Following LMPCR amplification of the genomic DNA fragments from the region

of interest, the "footprint" is visualized by genomic sequencing (Church and Gilbert,

1984). For this protocol, a 2 ptl aliquot of each LMPCR sample is dried in a vacuum

concentrator and redissolved in 2 pll of formamide-dye solution (98% formamide, 0.025%

xylene cyanol, 0.025% bromophenol blue, and 0.5X TBE (44.5 mM Tris-base, 44.5 mM

boric acid, 1 mM Na2EDTA 2H20). Samples were then loaded onto a 8.3 M urea, 5%

Long Ranger polyacrylamide, TBE (89 mM Tris-base, 89 mM boric acid, 2 mM EDTA)

DNA sequencing gel (60 centimeters long), and size-fractionated, with TBE (89 mM

Tris-base, 89 mM boric acid, 2 mM EDTA) as tank buffer, at 120 W for 4-5 hours. The

PCR fragments were then electro-transferred as described in Hornstra and Yang (1993),

in an electro-transfer apparatus (Harvard Biolabs, Sommerville, MA), using 40 mM TBE

(40 mM Tris-base, 33.8 mM boric acid, 0.4 mM EDTA, pH 8.3) as transfer buffer, for 45

minutes, at 110 V, 2 A, to a Zetabind positively charged nylon membrane (Cuno,

Meriden, CT), with UV crosslinking (Church and Gilbert, 1984). The resulting









membrane containing the electro-transferred DNA was then hybridized with a 32P-radio-

labeled oligonucleotide positioned internal to primer 2, called primer 3. The

oligonucleotide was 32P-radio-labeled as described above for oligonucleotide probes and

separated from the free radiolabeled-nucleotide using the QlAquick Nucleotide Removal

kit from Qiagen as follows. The T4 polynucleotide kinase labeling reaction was added to

10 volumes of Qiagen PN buffer in the kit and passed through a QlAquick column.

Bound DNA was washed twice with a buffer containing 80% ethanol and eluted with 100

gl of TE buffer. The resulting autoradiograph of this preliminary gel was used as a

loading control to obtain data for more adequate loading of the final gel in which the

amount of each sample loaded was adjusted to obtain equal signal intensity in all lanes,

and the final gel was run, in the same way, but with only two samples of each treatment.

Site-Directed Mutagenesis and Substitutions by PCR

The technique of mutagenesis by overlap extension or site-directed mutagenesis

using PCR has been previously described (Ho et al., 1989). The method employs PCR as

a means of creating altered DNA fragments from cloned DNA in a vector with essentially

100% efficiency and in very few steps. Two inside primers (Primer 2 and Primer 3) are

designed for each mutation. For base mutation, the inside primers are mismatched to the

target sequence at the mutated base. Two PCR reactions (Figure 2-1), performed as

described, were run to generate the two overlapping products, one reaction using primer 3

(P3) and the 3' primer (P4) used to amplify the original wild-type 360 bp construct, and

the other reaction using primer 2 (P2) and the 5' primer (P 1) used to amplify the original

wild-type 360 bp construct. The PCR amplicons were agarose gel-purified using the









QlAquick Gel Extraction kit to remove the original PCR primers which might interfere

with the subsequent reaction. Because the mutagenesis primers are complementary to


First PCR Rea
- '4


-1 3'.LA4 .~ 59
P5'
53- 3, P2 59


tions

P3 4 5
5' 39 3'


59 3 5 *

Second PCR Reaction

dirt nleng 1 3 5'


5' *3* 3'
3' ** 5

5' AI I
59 P1 3' 3'P45
39 T** 3'


Figure 2-1. Schematic representation of PCR-based mutagenesis.


First Cycle
Extension



24 Cycles









each other, the two overlapping fragments can be fused in a subsequent extension

reaction. The overlapping gel-purified products (approx. 20 ng) were used as DNA

templates for a second PCR reaction and the PCR reaction conditions were the same as

described previously, using the 5' (P 1) and 3' (P4) primers used to amplify the original

wild-type 360 bp MnSOD enhancer fragment, which contains NdeI sites at both ends. In

the first round of denaturation/annealing/extension of the second PCR reaction, the two

PCR reaction products used as templates, which are the two overlapping parts of the final

amplicon, were denatured and annealed to each other, forming the two possible

heteroduplex products, with recessed 3' ends, that were subsequently extended by Vent

DNA polymerase to produce a product that was the sum of the two overlapping products

and containing the mutation. This product became the template for the second PCR

reaction and it was amplified by 25 cycles of denaturation/annealing/extension, resulting

in multiple copies of the full-length product containing the mutation.

The PCR product was cloned with the use of the PCR Script Cloning System

(Stratagene), and positive colonies were identified by the presence of a 360 bp restriction

fragment when the vector was digested with NdeI. The digested fragment was agarose

gel purified using QIAquick Gel Extraction kit, and the isolated DNA fragment was

cloned into the Ndel site of a linearized CIP-treated hGH vector containing the minimal

MnSOD promoter (Kuo, unpublished data). The directionality of the mutagenized

enhancer fragment was checked by PCR using primers specific to the enhancer fragment

and a primer specific to the vector. Directionality and mutations were also checked by

direct DNA sequencing. The final reporter gene plasmids containing these site-directed









mutant PCR fragments were grown in 50 ml DN5ot E. coli, isolated with a Qiagen

Plasmid Maxi kit and then used for transient transfections in L2 cells, as described above.

Radiolabeled Probe Synthesis

For radiolabel hybridization of UV-crosslinked RNA on positively-charged, nylon

membranes, the cDNA (MnSOD, hGH, or Cathepsin B) was radio-labeled using a

random primer DNA labeling system (Gibco BRL, Gaithersburg, MD) as follows. 100-

500 ng of DNA in 17 pl of ddH20 were boiled for 5 minutes and 15 pl of the random

primers-buffer solution (0.67 M HEPES, 0.17 M Tris-HC1, 17 mM MgCI2, 33 mM 2-

mercaptoethanol, 1.33 mg/ml BSA, 18 OD260 units/ml oligodeoxyribonucleotide primers

(hexamers), pH 6.8) were added together with 2 pl of each dCTP, dTTP, and dGTP (0.5

mM in Tris-HCl (pH 7.5)), 2 Al Klenow fragment (6 U), and 10 pl of [a -32p]dATP (100

iCi). The labeling process was allowed to proceed for 3-4 hours at room temperature.

The un-incorporated nucleotides were removed by passing the labeling reaction over a

Sephadex G-50 column using TE buffer with 100 mM NaCI as elution buffer. The probe

was incubated for five minutes in boiling water before being added to the membrane and

hybridization solution.

When the radiolabeled-probe was an oligonucleotide (for hybridization for in vivo

footprinting analyses), the labeling was done by phosphorylation with bacteriophage T4

polynucleotide kinase as described in Sambrook et al (1989), with some modifications.

Briefly, 30 pmol of oligonucleotide were incubated with 120 PCi of [Y-32p]ATP, 70 mM

Tris-HCl pH 7.6, 5 mM DTT, 10 mM MgCI2, and 20 units of T4 polynucleotide kinase,

in a total volume of 20 gal, for 30 minutes at 370C. The 32-radiolabeled oligonucleotide

was separated from the free radiolabeled-nucleotide, by precipitation with addition of 5









M NaC1 to the final concentration of 0.2 M, 25 pLg of tRNA, and 2.5 volumes of 100%

ethanol, followed by incubation at -70'C for 20 minutes. The precipitated probe was

collected by centrifugation at 13,000 x g for 30 minutes at room temperature,

resuspended in 200 p1 of TE buffer and added to the membrane hybridization solution

after incubating in boiling water for 5 minutes.

Hybridization of Northern and Southern Blots

Membranes were pre-hybridized with 20 ml of hybridization solution (0.5 M

sodium phosphate, pH 7.2, 7% SDS, 1 mM EDTA, pH 8.0, 1% BSA) for at least 20

minutes and then the probe was added after boiling for 5 minutes. After an overnight

incubation at 61C, the blots were washed 4 times for 10 minutes with each wash

temperature at 65C in a high-stringency buffer (0.04 M sodium phosphate, pH 7.2, 1

mM EDTA, pH 8.0, 1% SDS), blotted dry on Whatman filter paper #1 and exposed to

film. When the probe was an oligonucleotide, the incubation overnight was at 400C, the

washing temperature was 45C, and the high-stringency wash buffer had the Na+

concentration adjusted to 350 mM with 5M NaCl. After washing, the membrane was

subjected to autoradiography by exposure to Hyperfilm MP (Amersham-Pharmacia,

Piscataway, NJ).

The exposed film was scanned using a Hewlett-Packard ScanJet 4cIT into Adobe

Photoshop (Adobe Systems Incorporated, San Jose, CA) computer software for creation

of the figures displayed in this dissertation made in Microsoft Office Powerpoint

(Microsoft Corporaton, Redmond, WA).














CHAPTER 3
CYTOKINE-INDUCIBLE ENHANCER WITH PROMOTER ACTIVITY IN BOTH
THE RAT AND HUMAN MANGANESE SUPEROXIDE DISMUTASE GENES

Introduction

The superoxide dismutases (SODs) are the first line of cellular defense against the

damaging effects of superoxide anion radicals (Halliwell and Gutteridge, 1990).

Manganese superoxide dismutase (MnSOD) is the most highly regulated of the three

SODs (Visner et al., 1991; Dougall and Nick, 1991), being localized to mitochondria

(Suzuki et al., 1993; Del Maestro and McDonald, 1989) and conferring potent

cytoprotection (Shull et al., 1991; Wong and Goeddel, 1988; Wong et al., 1989; Visner et

al., 1990; Eastgate et al., 1993; Akashi et al, 1995; Manganaro et al., 1995; Baker et al.,

1998). Multiple studies have shown that increased cellular levels of MnSOD are

cytoprotective during cellular oxidative stress (Shull et al., 1991) or inflammatory

challenges, such as TNF-oa-mediated apoptosis (Wong and Goeddel, 1988; Wong et al.,

1989), IL-I cytotoxicity (Visner et al., 1990), ionizing radiation (Eastgate et al., 1993;

Akashi et al., 1995), and neurotoxicity (Manganaro et al., 1995; Baker et al., 1998). The

role of MnSOD as a potent cytoprotective enzyme is most strikingly illustrated in three

transgenic model studies. The first transgenic model involves targeted overexpression of

MnSOD in the pulmonary epithelium of mice resulting in a decreased level of

inflammation as a consequence of a hyperoxic exposure (Wispe et al., 1992). In the

second study, the physiological importance of this gene is best exemplified through gene

ablation where MnSOD knockout mice manifest severe dilated cardiac myopathy and die









within ten days of birth (Li et al., 1995). The third study shows that treatment of the

MnSOD knockout mouse with the superoxide dismutase mimetic, manganese 5,10,15,20-

tetakis (4-benzoic acid) porphyrin, rescues these mice from the systemic toxicity, but

allows development of a severe neurodegenerative disorder by three weeks of age (Melov

et al., 1998).

Previous investigations from this and other laboratories have established that

levels of steady state MnSOD mRNA and protein increase following exposure to

bacterial lipopolysaccharide (LPS), tumor necrosis factor (TNF) and interleukin- 1 (IL-1)

(Wong and Goeddel, 1988; Visner et al., 1990; Visner et al., 1991; Melov et al., 1998).

Stimulus-dependent increases in mRNA levels are inhibited by actinomycin D (Visner et

al., 1992), suggesting increased transcription of the gene, which has been confirmed by

subsequent nuclear run-on studies (Hsu, 1993). Results from DNase I hypersensitive

studies analyzing the chromatin structure of MnSOD have identified multiple regions of

increased nuclease accessibility located throughout the gene as well as a stimulus-

dependent alteration in chromatin structure in the 5' flanking region (Kuo et al., 1999).

Furthermore, dimethyl sulfate in vivo footprinting studies have identified the binding sites

for ten basal protein factors which interact with the promoter as well as stimulus-

dependent alterations in guanine residue reactivity near the hypersensitive site found only

in stimulus treated cells (Kuo et al., 1999). To complement the preceding studies on

chromatin structure and in vivo footprinting, functional studies of the promoter were

performed by analyzing deletions of the 5' flanking region. The promoter deletion data

suggest that basal promoter activity requires only a very small portion of the 5' flanking

region. Together these data suggest that multiple protein-DNA interactions occur during









transcription under basal conditions and that treatment with inflammatory mediators,

causes an alteration in chromatin structure in the promoter region of the gene.

Not all cis-acting regulatory elements are located in 5' flanking regions. In fact,

regulatory sequences have been identified within introns or in distant 3' flanking

sequences of the human and mouse immunoglobulin kappa gene (Queen and Baltimore,

1983; Judd and Max, 1992), platelet-derived growth factor gene (Takimoto and

Kuramoto, 1993), alcohol dehydrogenase-l-S (Callis et al., 1987) and collagen genes

(Simkevich et al., 1992). To identify regions of MnSOD that regulate basal and

stimulated expression, our present study utilized deletion analysis of rat MnSOD (Hurt et

al., 1992) coupled with transient transfection studies in a rat lung epithelial cell line.

Measuring mRNA expression levels of the human growth hormone reporter gene, we

have localized a complex enhancer element within intron 2 of the rat and a homologous

region in intron 2 of the human MnSOD. Most interestingly, this regulatory element

possesses the ability to promote cytokine-inducible transcription independent of a

promoter sequence.

Results

An Inducible Cis-Acting Enhancer Element Exists within MnSOD

Previous results of steady-state MnSOD mRNA levels in rat pulmonary epithelial

and endothelial cells demonstrated dramatic induction with inflammatory mediators

(Visner et al., 1991). In addition, nuclear run-on experiments showed that stimulus-

dependent MnSOD expression is at least in part a consequence of de novo transcription

(Hsu, 1993). MnSOD promoter deletion analysis demonstrated levels of stimulus-

dependent MnSOD expression that were far lower than that seen with the endogenous









steady-state mRNA. The vector constructs used in the analysis contained only 5'

flanking sequence, incorporating only one of the seven DNase I hypersensitive sites

within MnSOD (Kuo et al., 1999). To determine whether the remaining DNase I

hypersensitive sites within MnSOD contained regulatory function, we created hGH

expression vectors that combine both the MnSOD promoter (a 2.5 Kb HindIII to EagI

fragment) and a 6.1 kb HindIII fragment, containing the remaining DNase I

hypersensitive sites (Figure 3-1). Expression of hGH in cells transfected with these

vectors was compared in the same experiments to expression of hGH in cells transfected

with the vector construct, HindIE GH, containing only the 5' promoter fragment.

Of note, the data displayed in Fig. 3-2 and all subsequent figures use northern

analysis to directly assess transcription rates from the transfected reporter constructs.

This is distinct from studies which assay reporter protein levels or enzymatic activity that

must take into consideration potential effects of stimuli on translation and post-

translational events.

As shown in Fig. 3-2A, LPS treatment caused a dramatic enhancement of steady-

state mRNA expression as a result of adding the internal MnSOD genomic fragment, in a

manner independent of fragment orientation. The same result was obtained when

transfected cells were stimulated with TNF- or IL- I P (data not shown). Furthermore,

cleavage of the 6.1 kb HindIII fragment by making use of the unique HpaI site

demonstrated that the cis-acting element responsible for the inducible activity was

localized to the 5' 3.8 kb portion of the original HindIII fragment (Figure 3-2B). Again,

orientation did not influence the inducible activity in response to inflammatory












MnSOD Genomic Clone
19.5 Kb


EcoR I

Exons
DNase HS Sites


Hind III Eag I
[2.5 Kb Hi,
Fragment

12
1


6.1 Kb
nd III Hpa I Hind III


3 4 5
2 3 4 56 7


2.5 Kb MnSOD Promoter
Fragment (Hind-E).
Nde I Hind III
I I


human growth hormone gene


d %
Enhancer Fragments


p GH


Figure 3-1. Schematic representations and restriction maps of the MnSOD genomic clone
and the expression vectors constructed to assess potential enhancer activity. The
restriction enzyme sites are indicated above the sequence (e.g., HindII). The expression
vectors contain the 6.1 kb HindIII fragment from positions +1107 to +7238 of MnSOD,
with DNase-I hypersensitive sites 2-7 (*; Kuo et al., 1999) in either the 5'-to-3' or the 3'-
to-5' orientation. In addition, each expression vector contains the MnSOD 5' promoter
sequence from the HindlI site to the EagI site (Hind-E). The HindlI fragment, from
positions +1107 to +7238 of MnSOD, has been cut at position +4938 by HpaI digestion
creating the 3.8 kb and 2.3 kb fragments. The HindIllI (+1107) to HpaI (+4938) fragment
contains hypersensitive sites 2, 3, and 4 (*; Kuo et al., 1999). The HpaI (+4938) to
HindlII (+7238) fragment contains hypersensitive sites 5, 6, and 7. These two fragments
were tested in in transient transfections as was the 6.1 kb HindII fragment. The
restriction sites (HindIII and NdeI) into which the enhancer deletions were ligated are
denoted on the hGH vector, which also contains the MnSOD promoter (Hind-E).
Reproduced with permission from Rogers et al. (2000), Biochem. J., 347, 233-242.
Biochemical Society.


EcoR I
I


m

















Hind/E Hind/E Promoter and
Promoter 6.1 Kb Fragment
Alone
Orientation forward reverse
LPS + + +
hGH a

Cathepsin B


Hind/E Promoter plus


3.8 Kb Fragment 2.3 Kb Fragment
Orientation forward reverse forward reverse
LPS + -+ + +
hGH
Cathepsin B


MnSOD


MnSOD


Figure 3-2. hGH mRNA levels after transfection in rat lung epithelial cells with vectors
containing the internal HindIII fragment of MnSOD coupled to the promoter versus
MnSOD promoter alone. Northern analysis was done using radiolabeled probes
synthesized from hGH, MnSOD and cathepsin B cDNAs as described in the Methods
section. hGH mRNA expression in rat lung epithelial cells transfected with vectors
containing either the 3.8 kb or the 2.3 kb fragments which are deletions of the internal
HindIII fragment of MnSOD. Reproduced with permission from Rogers et al. (2000),
Biochem. J., 347, 233-242. Biochemical Society.










mediators, thus indicating that the element could partially satisfy the definition of an

enhancer.

The MnSOD Inducible Enhancer Element Is Located within Intron 2

To further localize the inducible cis-acting element within the 3.8 kb region, a set

of serial deletion fragments spanning this region were amplified by PCR using

complementary oligonucleotides and inserted into the MnSOD promoter vector, Hind-E

GH. Deletions of the fragment from the 5' end and from the 3' end (Fig. 3-3) were

generated in this manner. The inducible enhancer activity was evaluated by transient

transfections into L2 cells using northern analysis. Based on the 3' deletions of the 3.8

kb HindIII-HpaI fragment, the enhancer activity was localized to a region of

approximately 450 bp in the 5' end of this 3.8 Kb fragment (Fig. 3-4). This position

coincides extremely well with DNase hypersensitive site 2 (Kuo et al., 1999) located near

the intron 2-exon 3 boundary.

In an effort to localize the enhancer more precisely, 5' deletions were also

constructed as shown in Figure 3-5. Multiple 3' and 5' deletions containing the enhancer

fragment demonstrate inducible activity comparable to the steady-state mRNA levels of

the endogenous gene. Interestingly, the 338 and 227 bp deletions show reduced enhancer

activity relative to the 455 bp fragment as shown in figure 3-5B, thus further delineating

the enhancer activity regulated by LPS, TNF-a, and IL-I P to within a 200 to 300 bp

region near the 3' end of intron 2.












6.1 Kb


1.; 3.8 Kb
Restriction 3 K
Sites HindIII


900 hpI
Exon 3
116bp
0
2
Hi


Intron 3
2475 bp


3 4
dndlII/HpaI fragment


HpaI
Intron 4
1 552 bp1

Exon 4 Exon
179 bp 1451
5 6


2.3 Kb -1
HindIII

1765 bp d


919 bp


1 2.9 Kb


1.8Kb


I 765 bp

--- 542 bp

I- 455 bp


I--464 bp ..... H 338 bp

..H 227bp


Figure 3-3. Deletions of the 3.8 kb enhancer fragment. Seriel deletions from both the 5'
and 3' ends of the 3.8 kb fragment were created by PCR amplification and ligated into
either the HindII site or the NdeI site of the Hind/E GH vector (see Figure 3-1).
Reproduced with permission from Rogers et al. (2000), Biochem. J., 347, 233-242.
@ Biochemical Society.


HS Sites







CD
MT
0A






























Figure 3-4. Northern analysis of transient transfections of the 3' PCR deletions of the
3.8 kb enhancer fragment localized the inducible activity to the 464 bp/1.0 kb fragment.
Reproduced with permission from Rogers et al. (2000), Biochem. J., 347, 233-242.
Biochemical Society.










Hind/E Hind/E Promoter plus 3' Deletion Fragments
Promoter
Alone 464bp 1.0Kb 1.8Kb 2.9Kb 3.8Kb
Orientation fwd rev fwd rev fwd rev fwd rev fwd
LPS + + + + + + + + + +
hGH all $4 .... '4



MnSOD


Cathepsin B


Hind/E
Promoter


HindJE Promoter plus 3' Deletion Fragments


Alone 262bp 464bp 1.0Kb 464bp- 1.0Kb
Orientation fwd rev fwd rev fwd rev fwd rev
LPS + + + + + + + + -+


hGH


Cathepsin B



MnSOD


... W ,:: 1 1 r 1






























Figure 3-5. Northern analysis of transient transfections of the 5' PCR deletions of the 3.8
kb enhancer fragment localized the inducible activity to an area between the 455 bp and
the 227 bp fragments in the 3' end of the 1.0 kb PCR fragment. Reproduced with
permission from Rogers et al. (2000), Biochem. J., 347, 233-242. Biochemical
Society.













Hind/E Hin
Promoter
Alone 919 bp
orientation fwd rev
LPS + + +
hGH 'W 2V


I/E Promoter plus 5' Fragments


765 bp
fwd rev


542 bp
fwd rev


455 bp
fwd rev


Cathepsin B


A


Hind/E
Promoter


Hind/E Promoter plus 5' Fragments


Orientation


Alone 455 bp 338 bp 227 bp

forward forward reverse forward reverse


LPS + + -+-

hGH I'.060


Cathepsin B


+ + +









The Enhancer Is Likely Composed of A Complex Set of Interacting Elements

To further localize the enhancer within the 3' end of intron 2, additional deletion

constructs were created (Fig. 3-6). PCR amplification was used to generate a 260 bp

fragment spanning the region between the two 5' deletions shown in Figure 3-3 (455 bp

and 227 bp) as well as two 143 bp fragments which overlap each other within the 260 bp

fragment (Fig. 3-6). The ability of these fragments to cause inducible expression was

evaluated by transient transfection and northern analysis. The 260 bp fragment

reproduced the enhancer activity seen with the larger, 919 bp fragment (Fig. 3-7). In

addition, response to all the inflammatory mediators (LPS, TNF-a, and IL- 13) was

maintained. Interestingly, the two overlapping 143 bp fragments show reproducibly

diminished enhancer activity as compared to the 260 bp fragment (Fig. 3-7). These

results are consistent with the previous deletion analyses in Figure 3-5, which showed

partial enhancer activity in the 338 bp fragment compared to the 455 bp fragment and

loss of activity with the 227 bp fragment. Together the results summarized in Figures 3-5

and 3-7, demonstrate that the 260 bp fragment delineates the minimum functional

boundaries of the enhancer along with the complexity and interactive nature of this

important regulatory sequence, as displayed by the retention of enhancer activity in the

143 bp fragments relative to the promoter alone.

To further assess the complexity of the enhancer element, electrophoretic

mobility shift assays (EMSA) were performed with nuclear extracts from control and

treated (LPS, TNF-a, IL- 1 ) cells. Figure 3D illustrates the different protein binding

patterns between treated and control nuclear extracts as well as the different patterns of

protein binding between the two functional DNA fragments of the enhancer element.












Exon 3 Exon 4
I Intron 21 IIIntron 3



260bp

14 bp I [ Enhancer Fragments
00 Used in Transfections

143 bp
IA Ao
Enhancer Fragments 100 bp
Used in EMSA 00 & I
95 bp
AA
1103 bp
[A oAol








Figure 3-6. Schematic of the enhancer region in intron 2. A 260 bp PCR fragment of the
enhancer region totally contained within intron 2 and two overlapping 143 bp PCR
fragments encompassing the 260 bp region were created and ligated into the NdeI site of
the Hind/E GH vector (see Fig. 3-1) for transient transfection in rat epithelial cells and
northern analysis. In addition to the 143 bp fragments, three other fragments (100, 95
and 103 bp) were created by PCR amplification for EMSA. Putative constitutive and
inducible protein-binding sites are illustrated by open circles and filled triangles,
respectively. Reproduced with permission from Rogers et al. (2000), Biochem. J., 347,
233-242. Biochemical Society.































Figure 3-7. A. Northern analysis of transient transfections of the 919 bp (see Fig. 3-6) or
the 260 bp fragment (both orientations) in the Hind/E GH vectors in control, LPS, TNF-
a, and IL-1-stimulated rat pulmonary epithelial cells. B. Northern analysis of transient
transfections of the 260 bp fragment and 143 bp fragments in the Hind/E GH vectors in
control and LPS-stimulated rat pulmonary epithelial cells. Reproduced with permission
from Rogers et al. (2000), Biochem. J., 347, 233-242. Biochemical Society.














Hind/E Promoter
plus Enhancer Fragment


Orientation

Stimulus

hGH


Cathepsin B


919 bp 260 bp 260 bp
Forward Forward Reverse


HindIE Hind/E Promoter
Promoter plus Enhancer Fragment
Alone 260 bp 143 bp 143 bp

Orientation fwd rev fwd rev fwd rev
LPS + + + + + + +


hGH:


Cathepsin B


Hind/E
Promoter
Alone


--,&. I -II.&I-AkIM,































Figure 3-8. EMSA of the two 143 bp, as well as, the 100, 95 and 103 bp fragments using
nuclear extracts from untreated cells and cells treated with LPS, TNF-ox, and IL-I P.
Open circles refer to putative constitutive protein binding and filled triangles refer to
putative inducible protein binding. Reproduced with permission from Rogers et al.
(2000), Biochem. J., 347, 233-242. Biochemical Society.









DNA
Fragment


Stimulus


5' 143bp
0


3' 143 bp
>
ci


tii


DNA
Fragment

Stimulus


100 bp 95 bp 103 bp


~0




ii 0
4 0









Constitutive protein binding is observed in the 3' 143 bp fragment, but several

inducible binding proteins can be appreciated in both fragments. In an attempt to further

localize the protein binding sites, smaller fragments of the involved region were

generated by PCR and evaluated by EMSA (Fig. 3-8). Once again, constitutive protein

binding was observed in two of the fragments (100 bp and 103 bp). However, as with the

143 bp fragment, inducible protein binding was also observed in two of the smaller

fragments (100 bp and 95 bp), most notably in the 95 bp fragment with a dramatic

difference in binding between control and stimulated nuclear extracts. Further

localization of protein binding was attempted with 50 bp and 30 bp fragments from this

region, however, I was unable to obtain protein-DNA interactions, which displayed any

stimulus-specific pattern (Rogers, data not shown). Unlike the results with the larger

fragments (Fig. 3-8 A and B), EMSA with the smaller fragments (50 bp and 30 bp)

showed only constitutive binding patterns. I believe that multiple protein-protein

interactions are likely a prerequisite for the stimulus-specific DNA binding pattern, thus

explaining the loss of stimulus-specific protein-DNA interaction in the smaller deletions

of this complex regulatory element.

The Inducible Enhancer Elements within Rat and Human MnSOD Can Act with a

Heterologous Promoter

To determine whether the MnSOD enhancer could function with a heterologous

promoter, the enhancer fragment was cloned in both orientations into the TKGH

expression vector. The herpes virus thymidine kinase (TK) promoter in this vector is a

200 bp minimal, TATA-containing promoter, quite dissimilar to the GC-rich, TATA- and

CAAT-less MnSOD promoter. Results of transient transfections and northern analysis



























Figure 3-9. A. Interaction of the 6.1 kb MnSOD fragment with the heterologous herpes-
simplex TK promoter in the pTKGH expression vector. Expression vectors, pTKGH
alone and pTKGH containing the 6.1 kb enhancer (both orientations), were constructed
and a comparison of hGH mRNA levels in transiently transfected rat lung epithelial cells
treated with LPS, TNF-a, or IL-1 I3 was made. Northern analysis was done using
radiolabeled probes from hGH, MnSOD and cathepsin B cDNAs. B. Comparison of the
rat and human enhancer regions in the pTKGH vector. A 553 bp region encompassing
the rat enhancer as well as the analogous region of the human MnSOD (466 bp fragment)
were amplified by PCR and cloned into the HindII site of the pTKGH vector. Northern
analysis of transient transfections in rat pulmonary epithelial cells shown here and
described in the Methods section. Reproduced with permission from Rogers et al.
(2000), Biochem. J., 347, 233-242. Biochemical Society.







62






Thymidine Kinase Promoter

Hifpd I'll L


h


-- pIKtKl-i
man growth hormone gene


6.1 Kb Rat MnSOD Hind III Fragment


TK Promoter and 6.1 Kb Enhancer
TK Promoter (plus orientation)
Alone forward reverse
LPSTNFL1 LPSTNFLI LPSTNFIL1


A


Thymidine Kinase Promoter

Hipd ll K


hu


* plKGiH
man growth hormone gene


553 bp Rat Enhancer Fragment or
466 bp Human Enhancer Fragment

TK Promoter plus

553 bp 466 bp
Rat Enhancer Human Enhancer
Stimulus LPS TNF IL-I LPS TNF IL-I

hGH 00


Cathepsin B T~T~


hGH

Cathepsin B



MnSOD


Cathepsin B


v-v Tm wa~ Tw T ... ..Tvw-


I I


m w F TT









(Fig. 3-9) demonstrated that the enhancer element could cooperate with the minimal TK

promoter and dramatically increase the transcriptional activity of the hGH reporter gene

in response to LPS, TNF-a, and IL-13. The element functioned equally well in both

orientations and interestingly was able to orchestrate reporter induction to as much as 45

fold above baseline. The ability of this element to enhance transcriptional activity of

both the endogenous and a heterologous promoter in an orientation-independent and

position-independent manner further qualifies it as an enhancer element.

Given the potency of this enhancer element, we compared the sequence of intron

2 in the rat gene with the corresponding region in the human MnSOD locus and found a

high level of homology. In order to evaluate the functional significance of this region, a

553 bp fragment of the rat enhancer and an analogous 466 bp region of intron 2 of human

MnSOD were inserted into Nde I site of the TKGH vector. The ability of the fragments

to cause inducible enhancer activity was assessed by transient transfections and northern

analysis. Both the rat and the human fragments caused essentially identical inducible

expression in response to LPS, TNF-a and IL-13 (Fig. 3-9), indicating that this region of

human intron 2 likely acts as an enhancer in the endogenous gene and that the enhancer

activity itself is well conserved between species. We have also demonstrated that the rat

and human enhancer can function equally as well in human cell lines (data not shown).

Evaluation of Promoter-Enhancer Interactions

We have demonstrated by in vivo footprinting that the MnSOD promoter contains

10 potential basal protein-binding sites (Kuo et al., 1999). These sites are illustrated in

Figure 3-10 relative to the restriction sites that were employed for the promoter deletion

analysis. To define the areas within the promoter required for interaction with the













9= protein binding site by in vivo footprinting


Hind III
Hind/EI
-2500


Enhanced G's by
in vivo footprinting
GG Sfi I Sac II Nae I Eag I
1 000016000 OSooo I


-285


1
-134


I I
-46 +32


tExon i


Sfi/El 00000 000
Sac2/E1 -OOO

Nae/E -


Nde I
I


919 bp Rat Enhancer
Fragment


Deletions of MnSOD Promoter



human growth hormone gene


Figure 3-10. MnSOD promoter deletions summarizing the protein binding sites found by
in vitro footprinting (Kuo et al., 1999). The 919 bp fragment encompassing the entire
enhancer was ligated into the NdeI site of the hGH vector with the respective MnSOD
promoter deletions. Reproduced with permission from Rogers et al. (2000), Biochem. J.,
347, 233-242. Biochemical Society.


pOGH





























Figure 3-11. A. Northern analysis following transient transfections of promoter deletion
constructucts (Hind/E and Sfi/E containing the 919 bp enhancer fragment) into rat
pulmonary epithelial cells. B. Northern analysis following transient transfections of
promoter deletion constructs (Hind/E, Sac/E, and NaeE containing the 919 bp enhancer
fragment) into rat pulmonary epithelial cells. Reproduced with permission from Rogers
et al. (2000), Biochem. J., 347, 233-242. Biochemical Society.












Promoter
Fragment
Enhancer Orientation
LPS

hGH


919 bp Enhancer Fragment
plus Promoter Deletion

Hind/E Sfi/E Hind/E Sfi/E
forward reverse forward reverse
+ -+ -+ +-+ +


Cathepsin B


Hind/E
Promoter
Alone

LPS +


hGH


Cathepsin B


919 bp Enhancer
plus Promoter Deletion


Hind/E Sac/E Nae/E
- + .. + +





























Figure 3-12. A. Schematic of the promoter-less human growth hormone vector (pGH)
and the position of the human 466 bp enhancer fragment. Northern analysis of the 466
bp human enhancer in p4GH and pTKGH constructs transiently transfected into control
and treated (LPS, TNF-a, and IL-13) rat pulmonary epithelial cells. B. Schematic of the
promoter-less hGH vector (p GH) and the position of the 260, 553, or 746 bp enhancer
fragments. Northern analysis of the rat enhancer fragments (260, 553, and 746 bp) in
p4GH constructs transiently transfected into control and treated (LPS, TNF-ct, and IL- 13)
rat pulmonary epithelial cells. Reproduced with permission from Rogers et al. (2000),
Biochem. J., 347, 233-242. Biochemical Society.











466 bp Human Prohancer


Hind III A
r-_ pGH
human growth hormone gene


466 bp Human MnSOD 466 bp Human MnSOD
Prohancer Fragment Prohancer Fragment
in pbGH in pTKGH
Stimulus LPS TNF IL-1 LPS TNF IL-1


hGH


Cathepsin B


746, 553, or 260 bp Rat Prohancer



Hind III B
U- pGH
human growth hormone gene


Rat Prohancer Fragments in p)&GH
Prohafcer 746 bp 553 bp 260 bp
Fragment

Orientation 5'# 3' 3'* 5' 5'* 3' 3'* 5' 3'* 5'
Stimulus LPS TNF IL-1 LPS TNF IL-I LPS TNF IL-I LPS TNF IL-I LPS TNF IL-I

hGH


0-+U -1









enhancer element, the previous promoter deletion constructs (Kuo et al., 1999) were

coupled with a 919 bp enhancer fragment (Fig. 3-10). Transient transfection and

northern analysis were used to evaluate inducible activity for these vector constructs. Of

interest, the first five binding sites could be deleted without any detectable decrease in

inducible activity (Fig. 3-1 IA). It was not until the remaining five basal binding sites

were eliminated that the level of induction decreased (Fig. 3-11B) with almost complete

loss of basal activity. Interestingly, LPS-inducible transcription could still occur when all

promoter protein-binding sites were deleted, but only when the vector construct contained

the enhancer fragment (Fig. 3-11B). However, in the absence of the enhancer element,

deletion of the same promoter region, (construct Nae/E, 18), eliminated any transcription,

thus, indicating that the enhancer element contained DNA sequence potentially capable

of independently promoting transcription in a stimulus-regulated manner.

The Rat and Human Enhancer Elements Contain Inducible Promoter Activity

With the results of the previous experiment (Figure 3-11), we postulated that the

enhancer element might exhibit stimulus-dependent promoter activity in the absence of a

true promoter. Since the Nae/E GH construct did contain 77 bp from the 5' flanking

region of the MnSOD promoter, the rat and the human enhancer elements were inserted

into the promoter-less hGH vector (IGH) (Figure 3-12A). Figure 3-12A shows the

results of the 466 bp human MnSOD enhancer fragment in the presence and absence of

the TK promoter. Inducible transcription was observed with LPS, TNF-a and IL- 1 P, but

at lower levels than when the fragment was inserted into the pTKGH vector.

Interestingly, two transcripts, one the correct size and one approximately 200 to 300 bp

larger, were seen when the enhancer fragment acted as its own promoter. When the 553









bp and 746 bp rat enhancer fragments were tested in the promoter-less hGH vector

(pOGH), similar results to the human fragment were obtained, in that, two different-sized

transcripts were observed (Figure 3-12A and B). Of note, however, when either the 553

bp or the 746 bp enhancer fragment was inserted into p0GH in the 3' to 5' orientation,

the correct-sized transcript predominated. This result would indicate that the enhancer

can indeed act as a promoter, but its orientation and position relative to the start of

transcription are important. To determine if the preceding hypothesis was correct, p0GH

vector constructs containing the 260 bp enhancer fragment were created. As can be seen

in Figure 6B, when the 260 bp enhancer fragment acting as a promoter was inserted into

the p0GH vector in the 3' to 5' orientation, a single stimulus-responsive transcript

resulted.

Discussion

As a cellular antioxidant, mitochondrial MnSOD has been consistently shown to

be an effective cytoprotective enzyme. MnSOD expression is highly regulated in

response to a variety of pro-inflammatory mediators in many cell types. In rat lung

epithelial cells, the inflammatory mediators, LPS, TNF-a and IL-13, each cause MnSOD

steady-state mRNA levels to increase 10 to 20 fold, which has been shown in nuclear

run-on studies (Hsu, 1993) to be partly due to increased transcription of the gene. A

survey of the entire MnSOD locus for sites of possible protein-DNA interaction using

DNase I hypersensitive site analysis revealed increased nuclease accessibility at sites in

the 5' proximal promoter region and 6 other sites located within the gene (Kuo et al.,

1999). The present experiments further expand our understanding of the molecular









mechanisms regulating basal and induced expression of MnSOD by identifying an

enhancer region within the rat and human MnSOD.

The 5' flanking sequence of MnSOD is characterized by a GC-rich island, lacking

a TATA- and CAAT-box for initiation of transcription. In vivo footprinting studies have

defined protein binding sites for 10 basal transciption factors within 500 bp of the

transcriptional start site (Kuo et al., 1999). Promoter deletion analysis identified essential

cis-acting sequences located within 157 bp of the transcriptional start site (Kuo et al.,

1999). This region of the promoter includes 5 of the basal protein binding sites and is

capable of supporting basal and stimulated (LPS, TNF-a and IL- 13) expression.

However, protein and mRNA levels of the hGH reporter were only induced 2 to 3 fold in

transient transfection studies using vectors containing from 4.5 to 0.16 kb of the MnSOD

promoter region alone (Kuo et al., 1999). Examination of the MnSOD promoter for

known transcription factor consensus sequences by computer analysis revealed an NF-KB

sequence at -353 as well as Spl and gut-enriched Kriippel-like factor (GKLF) (Shields

and Yang, 1998; Zhang et al., 1998) sites corresponding to binding sites I-V. As

previously shown, the NF-KB site is not occupied based on in vivo footprinting data and

is not important for enhancer function (Fig. 3-11 A). On the other hand guanine contacts

from in vitro footprinting with purified Sp I and GKLF strongly implicates these proteins

with the in vivo contacts observed at sites I-V. However, previous data (Kuo et al., 1999)

and Figure 3-11 A seem to indicate that based on transient transfection studies the

potential Sp 1 and GKLF sites (I-V) are not essential for basal or enhancer-dependent

gene expression (using LPS, TNF-a, and IL- 113 as stimulants). These data may be

reconciled by appreciating that constitutive Sp I and/or GKLF binding to sites I-V might









be necessary for other stimuli known to induce INF-y (Harris et al., 1991; Valentine and

Nick, 1992), phorbol ester (Fujii and Taniguchi, 1991) or inhibit (glucocorticoids

(Dougall and Nick, 1991)) MnSOD expression. Alternatively, it should be noted that the

functional data was obtained by transient transfection of plasmid reporter gene DNA into

mammalian cells. Consequently, it is very possible that the plasmid DNA does not form

proper chromatin structures following transfection. Appropriate chromatin structure is

likely crucial for the correct alignment of DNA sequence important for the

promoter/enhancer interactions. Therefore, we must consider this as a possible

explanation for the data shown in Figure 3-1 lB. The data in Figure 3-1 lB does,

however, strongly implicate the functional importance of binding sites VI-X to both basal

and enhancer/stimulus-specific expression. The pNae/Eag GH vector was not sufficient

to drive either basal or stimulated expression (Kuo et al., 1999), suggesting that a

minimal promoter sequence for transcriptional initiation was no longer present.

The observed induction of the reporter gene from the 5' MnSOD promoter was

much lower than endogenous MnSOD expression following treatment with inflammatory

mediators (Kuo et al., 1999). These data and the presence of DNase I hypersensitive sites

within the gene suggested that regulatory elements might exist outside the 5' flanking

sequence. Results from transfections with vectors combining both the 5' promoter region

and the internal 6.1 kb fragment (containing the remainder of the DNase I hypersensitive

sites) confirmed that genomic sequences 3' to the transcriptional start site contain

enhancer activity. Most importantly, this region contains adequate enhancer activity to

mimic endogenous, stimulus-dependent transcription levels. Deletion analysis of this

region localized this activity to a 260 bp area within intron 2, which contains DNase I








hypersensitive site 2. When this 260 bp region is divided into two 143 bp fragments, we

found that each of these fragments independently retained inducible activity, albeit at a

lower level. Moreover, based on EMSA these same 143 bp fragments were able to bind

both constitutive nuclear factors as well as a number of factors specific to extracts from

induced cells. However, attempts to further delineate the enhancer by EMSA using DNA

fragments less than 50 bp (Rogers, unpublished data) led to the elimination of stimulus-

specific in vitro binding, further demonstrating the complexity of this enhancer and

implying that protein-protein interactions may be critical to the formation of specific

protein-DNA complexes between the promoter and enhancer. Therefore, we believe that

this enhancer is composed of a set of complex, interacting elements involved in the

inducible expression of MnSOD. Contrary to the published characterization of the

murine gene (Jones et al., 1995 and 1997), our data would indicate that separate elements

within this enhancer region retain an ability to induce MnSOD transcriptional activity, but

that small (25-30 bp) individual elements cannot act independently to confer the same

inducible levels seen in the endogenous gene.

Our results demonstrate that this enhancer element requires a portion of the

MnSOD promoter to achieve levels of induction analogous to steady-state northern

analysis. Using portions of the promoter coupled with the enhancer, we demonstrated the

requirement for sequences from -154 to the start of transcription, which include protein-

binding sites VI-X defined by in vivo footprinting (Kuo et al., 1999). Given the

functional connection between the enhancer and the MnSOD promoter, we postulate that

the enhancer may interact with the promoter through a mechanism involving DNA

bending (Ptashne, 1986). As support for this hypothesis, we have performed co-









transfection experiments with the promoter and enhancer on separate plasmids and found

under these conditions that inducible transcription could not be achieved (Rogers, data

not shown). This substantiates the argument that the MnSOD promoter and enhancer

must reside within a contiguous region of DNA. Therefore regulatory elements most

likely physically interact through DNA bending (Ptaslne, 1986) and possibly involving

an alteration in chromatin structure in the promoter as defined by Kuo et al., 1999.

Of particular interest is the existence of a homologous functional enhancer

element in human MnSOD (Fig. 3-10), which responds to the same inflammatory

mediators as the rat enhancer in both rat and human cells (data not shown). In addition,

another unique characteristic of the rat and human enhancer element is its ability to drive

transcription independent of a classical promoter (Figures 3-12A and B). As an

independent promoter/regulatory element, this sequence has the capacity to promote

stimulus-dependent transcription with negligible basal levels. Previous work in our

laboratory explored the possibility of an alternative promoter or differential mRNA

splicing as a cause for the multiple transcripts in the rat. Using primer extension and 32p_

labeled cDNA and genomic fragments as hybridization probes, it was determined that

alternative polyadenylation was the likely cause for the multiple transcripts seen in the rat

MnSOD (Hurt et al., 1992). Understanding the regulation of this enhancer region will be

important since it seems to be exquisitely responsive to acute cytokine mediators and, if

similar motifs are found in other genes, may exist as a regulatory unit that serves as a

general inflammatory response element. Current efforts are underway to further

characterize the enhancer by DMS in vivo footprinting and mutagenesis for functional

transfection studies.















CHAPTER 4
IN VIVO FOOTPRINTING AND MUTAGENESIS OF THE RAT MANGANESE
SUPEROXIDE DISMUTASE ENHANCER

Introduction

Gene activation in response to extracellular signals, infection by pathogens, or

environmental stresses requires highly integrated signal transduction pathways that direct

the transcriptional machinery to the appropriate set of genes. A crucial issue in

understanding inducible gene regulation is how a relatively small number of different

transcription factors is used to achieve the high level of specificity required to control

complex patterns of gene expression (Maniatis et al., 1987; McKnight and Yamamoto,

1992). The answer probably lies in the correct combination of transcription factors

aligning on the regulatory region to cause gene activation. Most genes are regulated by

multiple transcriptional activator proteins, each of which plays a role in controlling the

transcription of a variety of genes with different expression patterns. The expression of a

given gene depends, however, on the simultaneous interaction of a specific combination

of regulatory proteins with the control DNA elements. Indeed, most transcription

enhancers contain distinct sets of transcription factor-binding sites, and variations in the

arrangement of binding sites provide the potential to create unique nucleoprotein

complexes. Cooperative interactions between the proteins in these complexes can lead to

a high level of specificity in gene activation and to a high level of transcriptional synergy.









Perhaps one of the best examples of combinatorial interactions among distinct

regulatory elements is provided by the interferon-P (IFNP) gene (Maniatis et al., 1992;

Tijan and Maniatis, 1994). The IFN3 gene is activated in response to virus infection, and

the transcription factors required for activating the IFNP gene have been identified.

Detailed studies of this promoter revealed a highly compact and remarkably complex

organization of regulatory sequences containing four positive regulatory domains. None

of these domains function on their own, but two or more copies of any one of them can

act as a virus-inducible enhancer. However, the synthetic enhancers display varying

levels of basal activity, are less inducible than a natural enhancer, and can respond to

inducers other than virus infection. Thus, the specificity and activity of the natural intact

enhancer are distinct from those of the independent enhancer elements. The activation of

at least some natural enhancers appears to result from the precise arrangement of

transcription factors on DNA, resulting in the formation of a highly specific three-

dimensional nucleo-protein complex (stereospecific enhancer complex; Grosschedl,

1995).

Transcriptional activator proteins have been shown to synergize with each other

in vitro using synthetic enhancers containing multiple activator binding sites (McKnight

and Yamamoto, 1992; Tijian and Maniatis, 1994). In some cases, the observed

transcriptional synergy could be explained, at least in part, by cooperative binding of the

activators to their sites. However, in other cases, the transcriptional synergy could be

observed at concentrations of activator in which the binding sites are fully occupied

(Carey et al., 1990; Lin et al., 1990). The most straightforward explanation for this

synergy is that activators recruit the general transcription apparatus to nearby promoters,









and the transcriptional synergy is a consequence of multiple interactions between the

activators and components of the transcription apparatus (Ptashne and Gann, 1997). This

recruitment could involve the stepwise association of general transcription factors with

the promoter (Orphanides et al., 1996; Roeder, 1996), interactions between activators and

specific TATA box binding protein (TBP) associated factors (or TAFs) in the TFIID

complex (Sauer et al., 1995), or interactions between activators and components of the

RNA polymerase 1I holoenzyme (Koleske and Young, 1995). The best example of a

functional enhancer where the assembly of a protein-DNA complex is required for the

inducible transcription seen at the endogenous levels is the IFNP gene enhancer (Kim and

Maniatis, 1997).

In this study, I have used DMS in vivo footprinting to identify potential protein-

DNA interactions in the MnSOD enhancer element previously delineated by deletion

analysis and transient transfections. In addition, after identification of putative binding

sites, mutagenesis of the potential binding sites was used to verify whether the DNA

elements were crucial for the inducible MnSOD enhancer in a functional transient

transfection assay system.



Results

Multiple Potential Protein Binding Sites Exist within the MnSOD Enhancer

Using the technique of dimethyl sulfate (DMS) in vivo footprinting as the

molecular probe coupled with ligation-mediated polymerase chain reaction (LMPCR), it

is possible to identify cis-acting DNA elements at single nucleotide resolution and thus

display the in vivo protein-DNA contacts. As a small hydrophobic molecule, the









chemical DMS can enter intact cells and react predominantly by methylating the N-7

atom of guanine and, to a lesser extent, the N-3 atom of adenine in duplexed DNA.

Amino acid side chains of trans-acting factors, which contact guanine residues, can

protect these bases from methylation by DMS. Alternatively, amino acid side chains can

create a hydrophobic pocket around specific guanine residues, which increases the DMS

solubility and results in enhanced reactivity. Ultimately, protein side chains produce a

footprint composed of protections and/or enhancements which appear as diminished or

more intense bands as compared to the corresponding band in the naked DNA guanine

ladder on the final sequencing gel autoradiograph (Nick and Gilbert, 1985).

Previous work from this laboratory has established the timing of experimental

conditions when cell cultures are treated with inflammatory stimuli prior to DMS (Kuo,

1998). Kinetics of transcription factor binding is stable and comparable between control

and stimulus-treated samples. Those experiments demonstrated that protein-DNA

contacts were detectable as early as 0.5 hr and as late as 8 hr after addition of stimulus.

For the experiments in this thesis, time points of 2 and 4 hrs were chosen for DMS

treatment after addition of stimulus (LPS, TNF-a, IL-1 0).

Illustrated in Figure 4-1 is an autoradiograph of DMS in vivo footprinting and

LMPCR results of both control and treated samples. Several guanine and adenine

residues exhibited altered DMS reactivity, which appeared as diminished or enhanced

hybidization signals relative to in vitro DMS-treated DNA lanes. The existence of

several potential protein binding sites are postulated to account for patterns uncovered by

in vivo footprinting. Figure 4-2 summarizes the putative protein-DNA contacts




























Figure 4-1. Autoradiograph of DMS in vivo footprinting of enhancer region of MnSOD.
Lanes are as follows: G, naked DNA from L2 cells treated with DMS; C, control L2 cells
treated in vivo with DMS; T, TNF-a-treated L2 cells for 2 hours prior to in vivo
treatment with DMS; I, IL- 1 -treated L2 cells for 2 hours prior to in vivo treatment with
DMS. Open triangles refer to inducible protected sites; and closed triangles refer to
inducible enhanced sites. Site numbers 1-4 refer to regions where putative protein-
binding may occur on the enhancer element. Sequence refers to bottom strand.














Site 2

I>.~ to. 0*00


I
I
I
/
I I
~'00QQOm.is3O0
pm. ~

Site 1


Site 4


Site 3





























Figure 4-2. Sequence comparison of rat, human and mouse MnSOD enhancer regions of
intron 2. Open triangles refer to inducible protected sites; and closed triangles refer to
inducible enhanced sites. Site numbers 1-4 refer to regions where putative protein-
binding may occur on the enhancer element of the rat MnSOD gene. C/EBP-2 refers to
putative transcription factor binding site in the mouse MnSOD enhancer by consensus
sequence analysis and DMS in vivo footprinting. Arrows with numbers refer to
boundaries of smallest regions of the rat MnSOD enhancer tested in transient transfection
assays.















#4231
RAT 4190 CCCCGTAGATCACCTCTTCACACCATAAAATCGTATCAACACATTCACCGGGTTGGTTCTC
I ii1l1llilil1i II 1 itii11 1 1HI M1i I I I I
HUM 2577 CTCCGTAGATCACCTTTTTACGTCATAAAGTCGGACTAACACAAACTTCATTTACTAATTTTCTC
i i l l i i l I I l l l l i i I l l i l I I i I
MUS 2119 CCCCGTAGATCACCTCTTCATATCATAAAGTTGTATTAACACATTCACCGGTTAGGTTCTCTC

Site2 Site3
UAA" A AA A AA A
RAT 4251 TTCCTTTAATGGTGTAAGACCTTTAAAATGAACGTTATTCGTTTAGTGTATTAGCACTTATGCCCTTCTCTGAG
i IIIIIiIlllili i ilI 1 i 1 I I i i 1I1
HUM 2657 CTCCTTCAATGGTGTAAGACCTTCTAAATGAACTCTGTCTGCTTGGAACTTAATGCCCTTTTCCG C ..............
i IIIiiiIIlliiI 111lli1i iI 111II I I Ii i
MUS 2283 CCTTTATAATGGTGTAAGACCTTTAAAATGAACGTTATTCGTTTAGTGTGTTTAGAATTTATGCCCTTCTCTGAC
f 4374 Site4

44348 A A"A A
RAT 4325 ACTAAATCCTTTACTGTCTAAACCCTTCCGACACCATTATCACTCATCCCCTTTTCGCGTCAACCCTTTAGC
H lli I M 11 l1ii11 1 i1 i Iii I IIIIIIII 1111 00
HUM 2711 ACTAAATCCTTTATTGTTTAAACCCTTTGTACATTACCCCTCTCTGACCCCTTATGGGGTCAACACTTTCAT

MUS 2259 CCTAAAACCTTTAACGTCTAGACCCTCCTAACACCATTATCCTTCGTCCCCTTATCGGGTCAACCCTTTCGT
C/EBP-2

RAT 4397 AAAGGAGATTCCACTGTAGACTGTTGAAAGGAGAATTACAACATTTTTGTACCA
H ill Hilil IIIIIIIIII I I I
HUM 2783 GAAGGACATTCCGTTGTAGACTGTGGTCCTTGGAAAGAGAAGTCATAAAATTTT
ill1 l 11i lil ll l 1 I 1 I
MUS 2343 AAAGGAAATTCCACTGTAGACCGTAGATCTTTTGAAAGAAGAATTACAACAGGT


#441
RAT 4451 CTAAAGTTGGGAAGGCACCTCTGTCTCGACATAAACAAATCACTTACGAC
I I
HUM 2837 TGTTGAATTAAAGTCAGGAAATGAACACCTTAGTCTCGGAATGAATACAT
I I
MUS 2397 CTGTAGAACTAACATTAGGAAGACACCTCGGTCTCC-AAACGAAATTCCAC








being numbered sites 1 through site 4 over a region of approximately 150 to 200 bp.

Mutagenesis of Putative DNA Binding Sites Alters Inducible MnSOD Expression

Knowing the results of the DMS in vivo footprinting, mutagenesis of the

enhanced or protected nucleotides within the MnSOD enhancer region was performed

using PCR amplification. Mutations achieved were verified by sequencing. Figure 4-2

shows a comparison between the rat, human and murine sequences in intron 2 of each

gene. The sites that were shown to be enhanced or protected in the rat intron 2 enhancer

region are depicted as well as the in vivo footprinting sites found in the murine intron 2

enhancer region (Jones et al., 1997). The mutations within each of the 4 sites that were

created in the hGH reporter vectors used in the mutagenesis studies are shown in figure

4-3. Figures 4-4 and 4-5 demonstrate the results of northern analysis of transient

transfections of L2 cells with the wild type (WT), control, and mutated binding sites 1-4.

The results in both Figures 4-4 and 4-5 would suggest that the mutations made in site 2

seem to affect the level of inducible transcription to extent much greater than the other

site mutations. As way of control, the mutations made in the consensus sequence of

C/EBP, referred to as C/EBP-2, does not seem to change the level of inducible

expression. Also mutagenesis of the individual sites in Site 4 (4a and 4b) did not

influence the level of inducible transcription until the two site mutations were combined

into one vector construct.














Site 2


MUT CACATTCACC

WT CACATTCACC


TTGTTTTTTC
II II
GGGTTGGTTC


TCTTCCTTTA

TCTTCCTTTA


Site 3


MUT TTAACTTTAT TCTTTTATTT
I I I II
WT TGAACGTTAT TCGTTTAGTG


MUT AATCCTTTAC TGTCTAAACC

WT AATCCTTTAC TGTCTAAACC

Site 4B
MUT TCTTTTCAAC CCTTTCTCAA
Iii II
WT TCGGGTCAAC CCTTTAGCAA


TATTATCACT
I
TATTAGCACT


ATTTTTTAAG AAATTTAAAA
III il
ATGGTGTAAG ACCTTTAAAA


TATGCCCTTC TCTGAGACTA

TATGCCCTTC TCTGAGACTA


C/EBP-2
CTTCCGAAAA AATTATCACT


II
CTTCCGACAC


I
CATTATCACT


Site 4a
CATCAAATTT
III
CATCCCCTTT


AGGAGATTCC ACTGTAGACT GTTGAAAGGA

AGGAGATTCC ACTGTAGACT GTTGAAAGGA


Figure 4-3. The sequence of the rat MnSOD intronic enhancer region displaying the
putative protein-DNA binding sites and the mutations made in each site for construction
of hGH reporter vectors and transient transfection into L2 pulmonary epithelial cells.
Rectangles mark the mutated base pairs with the sequence for the wild type (WT)
MnSOD enhancer on the bottom and the mutated sequence on top.


Site 1



























Figure 4-4. Northern analysis of transient transfections of wild-type (WT) and mutated
binding site enhancer elements in hGH vector. WT refers to the unchanged rat 360 bp
enhancer fragment, control refers to the mutated CiEBP-2 site in the 360 bp fragment,
Site 2 refers to the Site 2 mutation in the 360 bp fragment, Site 4a and 4b refer to the site
4a and 4b mutations in the 360 bp enhancer fragment. The upper panel shows cells that
were stimulated with TNF-a for 8 hours prior to isolation of RNA and the lower panel
shows cells that were stimulated with IL- 10 for 8 hours prior to RNA isolation. In all
vectors in both panels the enhancer fragment was in a 5'-3' orientation. hGH refers to
the reporter gene product in each vector. Cathepsin B was used as a RNA loading
control.










Site Mutations


WT 4N_' Co_ _____
TNF-a -+ + +

hGH

Cathepsin B





Site Mutations


WT_________
IL-13 -+ -+ + -

hGH

Cathepsin B .... .. ..

























Figure 4-5. Northern analysis of transient transfections of wild-type (WT) and mutated
binding site enhancer elements in hGH vector. WT refers to the unchanged rat 360 bp
enhancer fragment, Site 2 refers to the Site 2 mutation in the 360 bp fragment, Site 4
refers to the combination of mutations in sites 4a and 4b in the 360 bp enhancer
fragment. The upper panel shows cells that were stimulated with lipopolysacharride
(LPS) for 8 hours prior to isolation of RNA. The middle panel shows cells that were
stimulated with TNF-ax for 8 hours prior to isolation of RNA. The lower panel shows
cells that were stimulated with IL-1 I3 for 8 hours prior to RNA isolation. hGH refers to
the reporter gene product in each vector.










5'-3' Orientation
WT Site 2 Site 4
LPS -+ -+ +
hGH WU


5'-3' Orientation
WT Site 2 Site 4
TNF-a + -+ -+
hGH do', f


5'-3' Orientation
WT Site 2 Site 4
IL-105--t + + +


3'-5' Orientation
WT Site 2 Site 4


3'-5' Orientation
WT Site 2 Site 4


3'-5' Orientation
WT Site 2 Site 4


hGH











Discussion

A number of eukaryotic genes with complex enhancer elements exist in the

literature, such as P-interferon (Kim and Maniatis, 1997, Merika et al., 1998), T-cell

receptor a (Giese et al., 1995; Mayall et al., 1997), interleukin-4 (Henkel and Brown,

1994; Ranganath et al., 1998), and urokinase (De Cesare et al., 1995; De Cesare et al.,

1997). Within the cell, multiple factors not only participate in the initiation of

transcription but also share an active role in the regulation of gene expression. In

addition, from the data available on eukaryotic transcription, it is clear that the

mechanisms by which transcription is regulated are tremendously complex.

The data shown here in this chapter would agree with findings of other

investigators regarding the complex transcription factor binding patterns in inducible

enhancer elements. Perhaps the most studied eukaryotic enhancer element, the 3-

interferon enhancer, demonstrates the combinatorial complexity of inducible enhancers.

In vitro, it requires the binding of five different DNA binding proteins in order to

simulate the in vivo levels of inducible gene expression. The MnSOD enhancer element

likely requires a similar complex combination of DNA binding proteins to simulate the in

vivo levels of inducible expression. The in vivo footprinting data would suggest that

multiple proteins bind within the enhancer element (Figure 4-1). From the enhancer

mutagenesis experiments, I would propose that interaction of the enhancer element with

multiple DNA binding proteins is necessary to achieve the inducible expression seen in

vivo. Mutations created within the enhancer at site 2 appear to disrupt the inducible

levels of transcription as compared to the wild-type (WT) vector (Figures 4-4 and 4-5).









A protein binding at the putative site 2 may be found in further experiments to be a

crucial member of the protein DNA enhancer complex. Also, when mutations were made

individually at sites 4a and 4b, no significant reduction in inducible gene expression was

seen (Figure 4-4). When the mutated sites were combined in a single vector, a reduction

in the amount of inducible expression was observed, not unlike that seen in the deletion

experiments of chapter 3 (Figures 3-5B and 3-7B). So there may be another putative

protein that is integral to the inducible activity of the enhancer. This additional data lends

further support for the hypothesis that this is a complex enhancer with interacting

elements.

Many more experiments will need to be done with this regulatory element. More

in vivo footprinting data, will be necessary to get a clear picture of the proteins binding to

both strands of the enhancer element. Perhaps a different technique of footprinting, such

as DNase I footprinting, may delineate the protein boundaries better than DMS

footprinting since the GC ratio of this region of the MnSOD gene is only about 40%

compared to the promoter which is over 70% GC-rich. Further combinations of

mutagenesis combined with transient transfections may answer the questions regarding

the cooperativity of the proteins binding in this regulatory region. Perhaps, rather than

mutagenesis, simply altering the phasing by inserting DNA (6 bp) in key regions between

putative binding sites may be enough to disrupt the protein complex formation. Finally,

cloning the factors binding to the important putative binding sites within the enhancer

will be necessary to allow evaluation of the inducible transcriptional regulation in an in

vitro system.















CHAPTER 5
REACTIVE OXYGEN SPECIES AND MITOCHONDRIA-TO-NUCLEUS
SIGNALING

Introduction

Manganese superoxide dismutase (MnSOD), a vital anti-oxidant enzyme

localized to the mitochondrial matrix, catalyzes the dismutation of superoxide anions

(02) to hydrogen peroxide (H202). In aerobic cells, the mitochondrial electron transport

chain is probably the most abundant source of 02". At atmospheric oxygen

concentrations, it is estimated that between 1 to 3% of the 02 reduced in the

mitochondrial electron transport chain during ATP production may form 02".(Chance et

al., 1979; Beyer, 1990; Nohl et al., 1996). Although 02"and other reactive oxygen

species (ROS) are byproducts of normal respiration, imbalance or loss of cellular

homeostasis results in oxidative stress, causing damage to cellular components lipid

membranes, proteins, and nucleic acids (Freeman and Crapo, 1982; Fridovich, 1986).

MnSOD acts as the first line of cellular defense to detoxify these 02".(Fridovich, 1975).

Various inflammatory mediators (TNF-a, IL-1 3, IL-6 and LPS) in multiple tissues have

been demonstrated to elicit dramatic elevations of both the messenger RNA and protein

levels of MnSOD (Visner et al., 1990; Dougall and Nick, 1991; Visner et al., 1991;

Valentine and Nick, 1992; Visner et al., 1992; Eastgate et al., 1993). The increased

levels of MnSOD have been shown to be cytoprotective (Wong and Goeddel, 1988;

Wong et al., 1989; Warner et al., 1991; Wispe et al., 1992). However, the signaling








pathways responsible for MnSOD expression are numerous and are still far from being

fully elucidated.

Elaborate intercommunications take place between the nucleus and mitochondria

coordinating not only mitochondrial gene expression and genome maintenance, but also

nuclear gene expression (Poyton and McEwen, 1996). The classic view has been that

mitochondria simply function as organelles responding to changes in energy demand.

However, recent data would suggest a more complex picture where mitochondria also

function as active signaling organelles in a number of important intracellular pathways

(Surpin and Chory, 1997; Ichas and Mazat, 1998; Mignotte and Vayssiere, 1998; Chandel

and Schumacker, 1999). An example of such a complex signaling pathway would be the

role that mitochondria play in regulating cellular apoptosis initiated by TNF-L at

membrane receptors (Duriez et al., 2000).

It is well documented that TNF-a binding to membrane receptors triggers

complex signal transduction cascades (Feng et al., 1995; Warner et al., 1996; De

Keulenaer et al., 2000), some of which result in excess ROS production in the

mitochondria (Schulze-Osthoff, 1992; Schulze-Osthoff, 1993). The cytocidal-effect of

these ROS is either direct or necessary for downstream signaling events leading to cell

death. The crucial toxic role of ROS was demonstrated by the inhibition of

mitochondrial electron transport at specific sites, which differentially interferes with

TNF-ac-mediated cytotoxicity (Schulze-Osthoff, 1992) and by the correlation between

sensitivity to TNF-a. cytotoxicity and mitochondrial activity in the cell (Schulze-Osthoff,

1993). Pharmacological experiments revealed that the mitochondrial respiratory chain is

the major source of TNF-cx-induced ROS (Schulze-Osthoff, 1992; Schulze-Osthoff,




Full Text

PAGE 1

&+$5$&7(5,=$7,21 2) $1 ,1'8&,%/( (1+$1&(5 (/(0(17 $1' 7+( 6,*1$/,1* 3$7+:$<6 ,192/9(' ,1 0$1*$1(6( 683(52;,'( ',6087$6( *(1( 5(*8/$7,21 %\ 5,&+$5' -$0(6 52*(56 $ ',66(57$7,21 35(6(17(' 72 7+( *5$'8$7( 6&+22/ 2) 7+( 81,9(56,7< 2) )/25,'$ ,1 3$57,$/ )8/),//0(17 2) 7+( 5(48,5(0(176 )25 7+( '(*5(( 2) '2&725 2) 3+,/2623+< 81,9(56,7< 2) )/25,'$

PAGE 2

7R P\ SDUHQWV ZKR XQGHUVWRRG WKH VLJQLILFDQFH RI HGXFDWLRQ /LYH DV LI \RX ZHUH WR GLH WRPRUURZ /HDUQ DV LI \RX ZHUH WR OLYH IRUHYHU *KDQGL

PAGE 3

$&.12:/('*0(176 ZRXOG OLNH WR WKDQN 'U +DUU\ 6 1LFN FKDLUPDQ RI P\ JUDGXDWH DGYLVRU\ FRPPLWWHH IRU KLV VXSSRUW WUXVW IULHQGVKLS JXLGDQFH DQG HQFRXUDJHPHQW WKURXJKRXW P\ JUDGXDWH VWXGLHV DP DOVR JUDWHIXO WR WKH RWKHU FRPPLWWHH PHPEHUVf§'UV %ULDQ &DLQ 6DUDK &KHVURZQ 5REHUW )HUO DQG 0LFKDHO .LOEHUJIRU WKHLU DVVLVWDQFH ZRXOG OLNH WR WKDQN DOO PHPEHUV SURIHVVRUV DQG VWDII IURP WKH 'HSDUWPHQW RI %LRFKHPLVWU\ DQG 0ROHFXODU %LRORJ\ IURP WKH 8QLYHUVLW\ RI )ORULGD &ROOHJH RI 0HGLFLQH DP GHHSO\ LQGHEWHG WR WKH PHPEHUV RI P\ ODERUDWRU\ ERWK SDVW 0DXUHHQ -DQ/LQJ 0LFKDHO
PAGE 4

7$%/( 2) &217(176 SDJH $&.12:/('*0(176 LLL $%675$&7 YLL &+$37(56 ,1752'8&7,21 2[\JHQ DQG )UHH 5DGLFDOV 6XSHUR[LGH 'LVPXWDVHV ,QIODPPDWLRQ /LSRSRO\VDFFKDULGH 7XPRU 1HFURVLV )DFWRU ,QWHUOHXNLQ 0ROHFXODU %LRORJ\ RI 0Q62' (QKDQFHUV 0$7(5,$/6 $1' 0(7+2'6 0DWHULDOV 0HWKRGV 7LVVXH &XOWXUH 3RO\PHUDVH &KDLQ 5HDFWLRQ 3&5f 7$ &ORQLQJ RI 3&5 3URGXFWV 5HSRUWHU 9HFWRU &ORQLQJ 3ODVPLG 3XULILFDWLRQ 7UDQVLHQW 7UDQVIHFWLRQ RI 0DPPDOLDQ &HOOV 51$ ,VRODWLRQ 1RUWKHUQ $QDO\VLV *HQRPLF '1$ ,VRODWLRQ (OHFWURSKRUHWLF 0RELOLW\ 6KLIW $VVD\ (06$f ,Q 9LYR '06 7UHDWPHQW /LJDWLRQ0HGLDWHG 3&5 /03&5f 6LWH'LUHFWHG 0XWDJHQHVLV DQG 6XEVWLWXWLRQV E\ 3&5 5DGLRODEHOHG 3UREH 6\QWKHVLV +\EULGL]DWLRQ RI 1RUWKHUQ DQG 6RXWKHUQ %ORWV ,9

PAGE 5

&<72.,1(,1'8&,%/( (1+$1&(5 :,7+ 352027(5 $&7,9,7< ,1 %27+ 7+( 5$7 $1' +80$1 683(52;,'( ',6087$6( *(1(6 ,QWURGXFWLRQ 5HVXOWV $Q ,QGXFLEOH &Z$FWLQJ (OHPHQW ([LVWV ZLWKLQ 0Q62' 7KH 0Q62' ,QGXFLEOH (QKDQFHU (OHPHQW LV /RFDWHG ZLWKLQ ,QWURQ 7KH (QKDQFHU ,V /LNHO\ &RPSRVHG RI $ &RPSOH[ 6HW RI ,QWHUDFWLQJ (OHPHQWV 7KH ,QGXFLEOH (QKDQFHU (OHPHQWV ZLWKLQ 5DW DQG +XPDQ 0Q62' &DQ $FW ZLWK $ +HWHURORJRXV 3URPRWHU (YDOXDWLRQ RI 3URPRWHU(QKDQFHU ,QWHUDFWLRQV 7KH 5DW DQG +XPDQ (QKDQFHU (OHPHQWV &RQWDLQ ,QGXFLEOH 3URPRWHU $FWLYLW\ 'LVFXVVLRQ ,1 9,92 )22735,17,1* $1' 087$*(1(6,6 2) 7+( 5$7 0$1*$1(6( 683(52;,'( ',6087$6( (1+$1&(5 ,QWURGXFWLRQ 5HVXOWV 0XOWLSOH 3RWHQWLDO 3URWHLQ %LQGLQJ 6LWHV ([LVW ZLWKLQ WKH 0Q62' (QKDQFHU 0XWDJHQHVLV RI 3XWDWLYH '1$ %LQGLQJ 6LWHV $OWHUV ,QGXFLEOH 0Q62' ([SUHVVLRQ 'LVFXVVLRQ 5($&7,9( 2;<*(1 63(&,(6 $1' 0,72&+21'5,$7218&/(86 6,*1$/,1* ,QWURGXFWLRQ 5HVXOWV 0LWRFKRQGULDO (OHFWURQ 7UDQVSRUW ,QKLELWRUV 0RGXODWH 71)D,QGXFHG ([SUHVVLRQ RI 0Q62' LQ 3XOPRQDU\ (SLWKHOLDO &HOOV $QWLP\FLQ $ 6WURQJO\ 'HFUHDVHV 71)D,QGXFLEOH 0Q62' ([SUHVVLRQ LQ 3XOPRQDU\ (QGRWKHOLDO &HOOV 7KH 6LJQDOLQJ 3DWKZD\ RI 71)D ,V 'LIIHUHQW IURP WKH 3DWKZD\V RI /36 RU ,/6WLPXODWHG ([SUHVVLRQ RI 0Q62' ,QKLELWLRQ RI 0LWRFKRQGULDO $73DVH ZLWK 2OLJRP\FLQ DOVR 5HSUHVVHV 71)D6WLPXODWHG ([SUHVVLRQ RI 0Q62' 5HDFWLYH 2[\JHQ 6SHFLHV $UH ,PSRUWDQW IRU 71)D6WLPXODWHG ([SUHVVLRQ RI 0Q62' Y

PAGE 6

71)D6WLPXODWHG ([SUHVVLRQ RI 0Q62' LQ (QGRWKHOLDO &HOOV ,V 'HSHQGHQW RQ &\WRSODVPLF 3KRVSKROLSDVH $ &3/$f 71)D,QGXFLEOH ([SUHVVLRQ RI 0Q62' ,V 1RW 'HSHQGHQW RQ 1XFOHDU )DFWRU N% 1)N%f 'LVFXVVLRQ &21&/86,216 $1' )8785( ',5(&7,216 &RQFOXVLRQV )XWXUH 'LUHFWLRQV 5()(5(1&(6 %,2*5$3+,&$/ 6.(7&+ YL

PAGE 7

$EVWUDFW RI 'LVVHUWDWLRQ 3UHVHQWHG WR WKH *UDGXDWH 6FKRRO RI WKH 8QLYHUVLW\ RI )ORULGD LQ 3DUWLDO )XOILOOPHQW RI WKH 5HTXLUHPHQWV IRU WKH 'HJUHH RI 'RFWRU RI 3KLORVRSK\ &+$5$&7(5,=$7,21 2) $1 ,1'8&,%/( (1+$1&(5 (/(0(17 $1' 7+( 6,*1$/,1* 3$7+:$<6 ,192/9(' ,1 0$1*$1(6( 683(52;,'( ',6087$6( *(1( 5(*8/$7,21 %\ 5LFKDUG -DPHV 5RJHUV 'HFHPEHU &KDLUPDQ 'U +DUU\ 6 1LFN 0DMRU 'HSDUWPHQW %LRFKHPLVWU\ DQG 0ROHFXODU %LRORJ\ 0DQJDQHVH VXSHUR[LGH GLVPXWDVH 0Q62'f DQ HQ]\PH ORFDOL]HG WR WKH PLWRFKRQGULD FRQYHUWV VXSHUR[LGH 2rf LQWR R[\JHQ 2f DQG K\GURJHQ SHUR[LGH +2f 7KH VXSHUR[LGH GLVPXWDVHV 62'Vf DUH WKH ILUVW OLQH RI FHOOXODU GHIHQVH DJDLQVW WKH GDPDJLQJ HIIHFWV RI VXSHUR[LGH DQLRQ UDGLFDOV 0DQJDQHVH VXSHUR[LGH GLVPXWDVH LV WKH PRVW KLJKO\ UHJXODWHG RI WKH WKUHH 62'V 0XOWLSOH VWXGLHV KDYH VKRZQ WKDW LQFUHDVHG FHOOXODU OHYHOV RI 0Q62' DUH F\WRSURWHFWLYH GXULQJ FHOOXODU R[LGDWLYH VWUHVV RU LQIODPPDWRU\ FKDOOHQJHV 7KH PDMRU JRDOV RI WKLV GLVVHUWDWLRQ ZHUH WR LGHQWLI\ ZLWKLQ WKH 0Q62' JHQH WKH UHJLRQV RI '1$ WKDW DUH UHVSRQVLEOH IRU LQGXFLEOH H[SUHVVLRQ DQG WR XQGHUVWDQG VRPH RI WKH LQWUDFHOOXODU VLJQDOLQJ SDWKZD\V WKDW FRQWURO WKLV LQGXFWLRQ 7R GR VR XWLOL]HG WKH SRO\PHUDVH FKDLQ UHDFWLRQ PHWKRG WR FUHDWH GHOHWLRQV RI D ODUJH UHJLRQ 9OO

PAGE 8

ZLWKLQ WKH 0Q62' JHQH DV D PHDQV RI FUHDWLQJ UHSRUWHU YHFWRUV ZKLFK FRXOG EH HYDOXDWHG E\ WUDQVLHQW WUDQVIHFWLRQ VWXGLHV LQ D UDW OXQJ HSLWKHOLDO FHOO OLQH 7KH UHVXOWV RI WKHVH H[SHULPHQWV GHILQHG D VPDOO UHJLRQ ESf ZLWKLQ LQWURQ DV DQ HQKDQFHU ZKLFK UHJXODWHV WKH LQGXFLEOH H[SUHVVLRQ VHHQ LQ WKH HQGRJHQRXV 0Q62' JHQH ,Q DGGLWLRQ E\ XWLOL]LQJ D YDULHW\ RI VSHFLILF SKDUPDFRORJLF LQKLELWRUV ZDV DEOH WR VKRZ WKH GLIIHUHQFHV EHWZHHQ VLJQDOLQJ SDWKZD\V OLSRSRO\VDFFKDULGH WXPRU QHFURVLV IDFWRU LQWHUOHXNLQf UHVSRQVLEOH IRU WKH LQGXFLEOH H[SUHVVLRQ RI 0Q62' ,QWHUHVWLQJO\ UHDFWLYH R[\JHQ VSHFLHV ZKLFK DUH E\SURGXFWV RI WKH PLWRFKRQGULDO HOHFWURQ WUDQVSRUW FKDLQ DSSHDU WR EH LPSRUWDQW UHJXODWRUV RI WKH WXPRU QHFURVLV IDFWRU SDWKZD\ EXW QRW WKDW RI OLSRSRO\VDFFKDULGH RU LQWHUOHXNLQ )LQDOO\ E\ XVLQJ WKH PHWKRG RI LQ YLYR IRRWSULQWLQJ ZDV DEOH WR LGHQWLI\ SXWDWLYH SURWHLQ'1$ ELQGLQJ VLWHV ZLWKLQ WKH HQKDQFHU UHJLRQ 8VLQJ WKLV GDWD FUHDWHG D QXPEHU RI UHSRUWHU YHFWRUV ZLWK PXWDWLRQV ZLWKLQ WKH HQKDQFHU UHJLRQ %\ WUDQVLHQWO\ WUDQVIHFWLQJ WKHVH UHSRUWHU YHFWRUV LQWR UDW OXQJ HSLWKHOLDO FHOOV PD\ KDYH LGHQWLILHG DW OHDVW RQH LPSRUWDQW SXWDWLYH SURWHLQ'1$ ELQGLQJ VLWH LQ WKH HQKDQFHU UHJLRQ ,W LV OLNHO\ WKDW WKH 0Q62' HQKDQFHU FRQWDLQV PXOWLSOH SURWHLQ'1$ ELQGLQJ VLWHV ZKLFK ZRUN WR FUHDWH D SURWHLQ FRPSOH[ QHFHVVDU\ IRU WKH LQGXFLEOH H[SUHVVLRQ VHHQ LQ WKH HQGRJHQRXV 0Q62' JHQH 7KLV ZRUN ZLOO DGG WR WKH XQGHUVWDQGLQJ RI KRZ WKH LQGXFLEOH 0Q62' JHQH LV UHJXODWHG 9OOO

PAGE 9

&+$37(5 ,1752'8&7,21 2[\JHQ DQG )UHH 5DGLFDOV 7KH HOHPHQW R[\JHQ FKHPLFDO V\PERO 2f H[LVWV LQ DLU DV D GLDWRPLF PROHFXOH 2 ZKLFK VWULFWO\ VKRXOG EH FDOOHG GLR[\JHQ 2YHU b RI WKH 2 LQ WKH DWPRVSKHUH LV WKH LVRWRSH R[\JHQ EXW WKHUH DUH WUDFHV RI R[\JHQ DERXW bf DQG R[\JHQ DERXW bf ([FHSW IRU FHUWDLQ DQDHURELF DQG DHURWROHUDQW XQLFHOOXODU RUJDQLVPV DOO DQLPDOV SODQWV DQG EDFWHULD UHTXLUH 2 IRU HIILFLHQW SURGXFWLRQ RI HQHUJ\ E\ WKH XVH RI GHSHQGHQW HOHFWURQWUDQVSRUW FKDLQV VXFK DV WKRVH LQ WKH PLWRFKRQGULD RI HXNDU\RWLF FHOOV 7KLV QHHG IRU REVFXUHV WKH IDFW WKDW LV D WR[LF PXWDJHQLF JDV DHUREHV VXUYLYH EHFDXVH WKH\ KDYH DQWLR[LGDQW GHIHQVHV WR SURWHFW DJDLQVW LW 3HUKDSV WKH HDUOLHVW VXJJHVWLRQ PDGH WR H[SODLQ 2 WR[LFLW\ ZDV WKDW 2 LQKLELWV FHOOXODU HQ]\PHV %DOHQWLQH +DXJDDUG f ,QGHHG GLUHFW LQKLELWLRQ E\ 2 LV WKRXJKW WR DFFRXQW IRU WKH ORVV RI QLWURJHQDVH DFWLYLW\ LQ H[SRVHG & SDVWHULDQXP *DOORQ f $QRWKHU JRRG H[DPSOH RI WKH GLUHFW HIIHFW RI 2 FRPHV IURP JUHHQ SODQWV 'XULQJ SKRWRV\QWKHVLV LOOXPLQDWHG JUHHQ SODQWV IL[ &2 LQWR VXJDUV E\ D FRPSOH[ PHWDEROLF SDWKZD\ NQRZ DV WKH &DOYLQ F\FOH 7KH ILUVW HQ]\PH LQ WKLV SDWKZD\ ULEXORVH ELVSKRVSKDWH FDUER[\ODVH FDWDO\VHV WKH UHDFWLRQ RI &2 ZLWK D ILYHFDUERQ VXJDU ULEXORVH ELVSKRVSKDWHf WR SURGXFH WZR PROHFXOHV RI SKRVKRJO\FHULF DFLG 2[\JHQ LV DQ DOWHUQDWLYH VXEVWUDWH IRU WKLV HQ]\PH FRPSHWLWLYH ZLWK &2 DQG VR DW HOHYDWHG 2 FRQFHQWUDWLRQV WKHUH LV OHVV &2 IL[DWLRQ DQG KHQFH OHVV SODQW JURZWK +DOOLZHOO f

PAGE 10

,Q JHQHUDO KRZHYHU WKH UDWHV RI GLUHFW LQDFWLYDWLRQ RI HQ]\PHV E\ 2 LQ DHURELF FHOOV DUH WRR VORZ DQG WRR OLPLWHG LQ H[WHQW WR DFFRXQW IRU WKH UDWH DW ZKLFK WR[LF HIIHFWV GHYHORS PRVW HQ]\PHV DUH WRWDOO\ XQDIIHFWHG E\ 2 ,Q 5HEHFFD *HUVKPDQ DQG 'DQLHO / *LOEHUW GUHZ D SDUDOOHO EHWZHHQ WKH HIIHFWV RI 2 DQG WKRVH RI LRQL]LQJ UDGLDWLRQ DQG SURSRVHG WKDW PRVW RI WKH GDPDJLQJ HIIHFWV RI 2 FRXOG EH DWWULEXWHG WR WKH IRUPDWLRQ RI IUHH R[\JHQ UDGLFDOV *LOEHUW f 7KH JURZWK LQKLELWLRQ REVHUYHG DIWHU H[SRVLQJ ( FROL WR KLJKSUHVVXUH 2 FDQ EH UHOLHYHG E\ DGGLQJ YDOLQH WR WKH FXOWXUH PHGLXP 9DOLQH V\QWKHVLV LV LPSDLUHG EHFDXVH RI D UDSLG LQKLELWLRQ RI WKH HQ]\PH GLK\GR[\DFLG GHK\GUDWDVH ZKLFK FDWDO\]HV D UHDFWLRQ LQ WKH PHWDEROLF SDWKZD\ OHDGLQJ WR YDOLQH 7KLV LV SUREDEO\ QRW D GLUHFW LQKLELWLRQ E\ 2 EXW UDWKHU E\ R[\JHQ UDGLFDOV VXFK DV VXSHUR[LGH )OLQW HW DO f 2WKHU HQ]\PHV LQDFWLYDWHG E\ VXSHUR[LGH UDGLFDO 2rf LQ ( FROL H[SRVHG WR KLJK SUHVVXUH 2 LQFOXGH WKH .UHEV F\FOH HQ]\PHV DFRQLWDVH DQG IXPDUDVH ( FROL FRQWDLQV WKUHH IXPDUDVHV IXPDUDVH $ DQG % DUH LQDFWLYDWHG E\ 2r ZKHUHDV IXPDUDVH & LV QRW /HYHOV RI IXPDUDVH & LQFUHDVH ZKHQ ( FROL LV H[SRVHG WR R[LGL]LQJ FRQGLWLRQV SHUKDSV DV D UHSODFHPHQW IRU WKH VXSHUR[LGHVHQVLWLYH IXPDUDVHV $ DQG % $FRQLWDVH PD\ DOVR EH DQ LPSRUWDQW WDUJHW RI GDPDJH E\ 2r LQ PDPPDOLDQ WLVVXHV H[SRVHG WR H[FHVV 2 +DXVODGHQ DQG )ULGRYLFK 0RUWRQ HW DO f 7KH RQVHW RI LQGXFHG FRQYXOVLRQV LQ DQLPDOV LV FRUUHODWHG ZLWK D GHFUHDVH LQ WKH FHUHEUDO FRQWHQW RI WKH QHXURWUDQVPLWWHU *$%$ \DPLQREXW\ULF DFLGf SHUKDSV EHFDXVH RI DQ LQKLELWLRQ RI WKH HQ]\PH JOXWDPDWH GHFDUER[\ODVH JOXWDPLQH f§} *$%$ &2f E\ 2 +RUL f LW KDV QRW KRZHYHU EHHQ VKRZQ WKDW

PAGE 11

WKH HQ]\PH LQKLELWLRQ LQ YLYR LV GXH WR 2 LWVHOI UDWKHU WKDQ WR WKH HIIHFWV RI DQ LQFUHDVHG SURGXFWLRQ RI R[\JHQ UDGLFDOV +DXJDDUG f 7KH WHUP fIUHH UDGLFDOf KDV VHYHUDO GHILQLWLRQV KRZHYHU WKH VLPSOHVW RQH GHVFULEHV D IUHH UDGLFDO DV DQ\ VSHFLHV FDSDEOH RI LQGHSHQGHQW H[LVWHQFH DQG FRQWDLQV RQH RU PRUH XQSDLUHG HOHFWURQV +DOOLZHOO DQG *XWWHULGJH f 7KH SUHVHQFH RI RQH RU PRUH XQSDLUHG HOHFWURQV XVXDOO\ FDXVHV IUHH UDGLFDOV WR EH DWWUDFWHG VOLJKWO\ WR D PDJQHWLF ILHOG LH WR EH SDUDPDJQHWLFf DQG VRPHWLPHV PDNHV WKHP KLJKO\ UHDFWLYH DOWKRXJK WKH FKHPLFDO UHDFWLYLW\ RI UDGLFDOV YDULHV RYHU D ZLGH VSHFWUXP 5DGLFDOV FDQ EH IRUPHG ZKHQ D FRYDOHQW ERQG LV EURNHQ LI RQH HOHFWURQ IURP HDFK RI WKH SDLU VKDUHG UHPDLQV ZLWK HDFK DWRP D SURFHVV NQRZQ DV KHPRO\WLF ILVVLRQ YRQ 6RQQWDJ f $% $r %r )RU H[DPSOH KHPRO\WLF ILVVLRQ RI RQH RI WKH 2+ FRYDOHQW ERQGV LQ WKH +2 PROHFXOH ZLOO \LHOG D K\GURJHQ UDGLFDO +rf DQG D K\GUR[\O UDGLFDO r2+f 7KH RSSRVLWH RI KHPRO\WLF ILVVLRQ LV KHWHURO\WLF ILVVLRQ LQ ZKLFK RQH DWRP UHFHLYHV ERWK HOHFWURQV ZKHQ D FRYDOHQW ERQG EUHDNV LH $% $ % :KHUH $ UHFHLYHV ERWK HOHFWURQV $ LV QRZ QHJDWLYHO\ FKDUJHG DQG WKLV JLYHV $ D QHJDWLYH FKDUJH DQG % LV OHIW ZLWK D SRVLWLYH FKDUJH +HWHURO\WLF ILVVLRQ RI ZDWHU JLYHV WKH K\GURJHQ LRQ + DQG WKH K\GR[LGH LRQ 2+ 6XSHUR[LGH 'LVPXWDVHV 7KH VXSHUR[LGH GLVPXWDVHV 62'Vf FDWDO\]H WKH GLVPXWDWLRQ RI VXSHUR[LGH DQLRQ UDGLFDO 2rf LQWR K\GURJHQ SHUR[LGH DQG R[\JHQ DV IROORZV + rn +

PAGE 12

62'V LVRODWHG IURP D ZLGH UDQJH RI RUJDQLVPV IDOO LQWR WKUHH W\SHV GHSHQGLQJ RQ WKH PHWDOV IRXQG LQ WKHLU DFWLYH FHQWHUV FRSSHU]LQF PDQJDQHVH DQG LURQ &X=Q62' LV IRXQG PDLQO\ LQ WKH F\WRVRO RI HXNDU\RWHV 6ORW HW DO f DQG LQ FKORURSODVWV 0Q62' LQ SURNDU\RWHV DQG LQ WKH PLWRFKRQGULD RI HXNDU\RWHV DQG )H62' LQ SURNDU\RWHV DQG LQ D IHZ IDPLOLHV RI SODQWV ,Q DGGLWLRQ DQ H[WUDFHOOXODU 62' VLPLODU WR WKH &X=Q62' KDG DOVR EHHQ IRXQG LQ WKH H[WUDFHOOXODU IOXLG RI HXNDU\RWLF FHOOV 0DUNOXQG +MDOPDUVVRQ HW DO f $PLQR DFLG VHTXHQFH GDWD KDG VKRZQ WKDW WKHVH WKUHH W\SHV RI 62'V IDOO LQWR WZR GLVWLQFW IDPLOLHV %DQQLVWHU HW DO f 7KH )H62' DQG 0Q62' VKRZ D KLJK GHJUHH RI DPLQR DFLG VHTXHQFH DQG VWUXFWXUDO KRPRORJ\ ZKLOH WKH VHFRQG IDPLO\ ZKLFK LQFOXGHV WKH &X=Q62' LV FRPSOHWHO\ XQUHODWHG 7ZR PDMRU IRUPV RI 62' KDYH EHHQ SXULILHG IURP UDW OLYHU $VVD\DPD DQG %XUU f 7KH &X=Q62' FRQVLVWV RI WZR LGHQWLFDO VXEXQLWV ZLWK D WRWDO PROHFXODU ZHLJKW RI NLORGDOWRQV N'f (DFK VXEXQLW FRQWDLQV D VLQJOH &X DQG =Q DWRP QRQFRYDOHQWO\ OLQNHG 7KH FRSSHU LRQ DSSHDUV WR IXQFWLRQ LQ WKH HQ]\PDWLF UHDFWLRQ ZKHUHDV WKH ]LQF LRQ LV QRQFDWDO\WLF DQG VHUYHV WR VWDELOL]H WKH HQ]\PH 7KH FRPSOHWH DPLQR DFLG VHTXHQFH RI &X=Q62' KDV EHHQ GHWHUPLQHG IURP YDULRXV VSHFLHV ZLWK D KLJK OHYHO RI FRQVHUYDWLRQ %DQQLVWHU HW DO f 7KH UDW 0Q62' LV D WHWUDPHULF HQ]\PH FRQWDLQLQJ IRXU LGHQWLFDO N' VXEXQLWV ZLWK D WRWDO PROHFXODU ZHLJKW RI DSSUR[LPDWHO\ N' ZKHUHDV PRVW EDFWHULDO 0Q62'V DUH GLPHULF HQ]\PHV RI DSSUR[LPDWHO\ N' 7KH DPLQR DFLG VHTXHQFHV RI WKH 0Q62' HQ]\PH IURP YDULRXV VSHFLHV LQFOXGLQJ UDW PRXVH DQG KXPDQ DV ZHOO DV IURP EDFWHULD KDYH EHHQ FRPSDUHG DQG DUH YHU\ VLPLODU %DQQLVWHU HW DO f 7KHVH HQ]\PHV FRQWDLQ 0Q DW WKH DFWLYH VLWH DQG WKH PDPPDOLDQ IRUPV KDYH EHHQ ORFDOL]HG SULPDULO\ LQ WKH

PAGE 13

PLWRFKRQGULD SDUWLFXODUO\ LQ WKH PDWUL[ EHWZHHQ WKH FULVWDH 6ORW HW DO f 0LWRFKRQGULDO '1$ DQG PHPEUDQHV DUH SDUWLFXODUO\ SURQH WR R[LGDWLRQ EHFDXVH PLWRFKRQGULD WKHPVHOYHV DUH D PDMRU VRXUFH RI IUHH UDGLFDOV :KHQ PLWRFKRQGULD DUH VHYHUHO\ GDPDJHG DHURELFDOO\ JURZLQJ FHOOV DUH VWDUYHG IRU HQHUJ\ 7KH ORFDOL]DWLRQ RI WKH 0Q62' H[FOXVLYHO\ ZLWKLQ WKH PLWRFKRQGULD VXJJHVWV DQ LPSRUWDQW UROH IRU WKLV DQWLR[LGDQW HQ]\PH LQ WKLV RUJDQHOOH %RWK UDW &X=Q62' DQG 0Q62' F'1$V KDYH EHHQ LVRODWHG DQG FKDUDFWHUL]HG E\ RXU ODERUDWRU\ DQG RWKHUV +R DQG &UDSR f 7KH UDW 0Q62' F'1$ HQFRGHV D SURWHLQ RI DPLQR DFLGV ZKLFK LQFOXGHV D SXWDWLYH PLWRFKRQGULDO WDUJHWLQJ VHTXHQFH RI DPLQR DFLGV 7KH &X=Q62' LV VHQVLWLYH WR F\DQLGH ZKHUHDV 0Q62' LV UHVLVWDQW WR WKLV UHDJHQW :HLVLQJHU DQG )ULGRYLFK )ULGRYLFK f 7KLV GLIIHUHQFH LQ WKH F\DQLGH VHQVLWLYLW\ PDNHV LW SRVVLEOH WR GLVWLQJXLVK WKH HQ]\PDWLF DFWLYLWLHV RI WKHVH WZR 62'V ,Q JHQHUDO WKH V\QWKHVLV RI &X=Q62' LV FRQVWLWXWLYH ZKHUHDV 0Q62' LV LQGXFLEOH ,QGXFWLRQ RI 0Q62' LQ HXNDU\RWHV KDV EHHQ REVHUYHG IROORZLQJ WUHDWPHQW ZLWK SDUDTXDW .UDOO HW DO f ;LUUDGLDWLRQ 2EHUOH\ HW DO f DQG K\SHUR[LD )UHHPDQ HW DO f VXJJHVWLQJ WKDW 0Q62' LQGXFWLRQ LV LPSRUWDQW IRU SURWHFWLRQ DJDLQVW R[LGDWLYH VWUHVV 6LQFH LQIODPPDWRU\ UHVSRQVHV RIWHQ UHVXOW LQ JHQHUDWLRQ RI D YDULHW\ RI IUHH UDGLFDOV ZKLFK FDQ GLUHFWO\ RU LQGLUHFWO\ OHDG WR WLVVXH LQMXU\ LW LV RI LQWHUHVW WR IXUWKHU FKDUDFWHUL]H WKH UROH RI 62' LQ VXFK LQIODPPDWRU\ UHVSRQVHV ,QIODPPDWLRQ 0LFURELDO LQYDVLRQ LPPXQRORJLFDO UHDFWLRQV DQG LQIODPPDWRU\ SURFHVVHV LQGXFH D FRPSOH[ VHW RI UHVSRQVHV LQ WKH KRVW FROOHFWLYHO\ UHIHUUHG WR DV WKH DFXWH SKDVH UHVSRQVH

PAGE 14

.XVKQHU HW DO f 7KLV UHVSRQVH LV FKDUDFWHUL]HG E\ IHYHU PHWDEROLF FKDQJHV LQFUHDVHG SHULSKHUDO ZKLWH EORRG FHOO FRXQW DQG DQ LQFUHDVHG V\QWKHVLV RI DFXWH SKDVH SURWHLQV LQFOXGLQJ &UHDFWLYH SURWHLQ FHUXORSODVPLQ VHUXP DP\ORLG $ SURWHLQ DQG YDULRXV FRPSOHPHQW SURWHLQV ,Q DGGLWLRQ WKH LPPXQH V\VWHP SURGXFHV D YDULHW\ RI LQIODPPDWRU\ PHGLDWRUV LQFOXGLQJ F\WRNLQHV DUDFKLGRQLF DFLG PHWDEROLWHV DQG R[\JHQ IUHH UDGLFDOV WR SURWHFW WKH KRVW ZKHQ WKUHDWHQHG E\ LQIODPPDWRU\ DJHQWV PLFURELDO LQYDVLRQ RU LQMXU\ ,Q VRPH FDVHV WKLV FRPSOH[ GHIHQVH QHWZRUN VXFFHVVIXOO\ UHVWRUHV QRUPDO KRPHRVWDVLV EXW DW RWKHU WLPHV WKH RYHUSURGXFWLRQ RI LQIODPPDWRU\ PHGLDWRUV PD\ DFWXDOO\ SURYH GHOHWHULRXV WR WKH KRVW :HOERXP DQG
PAGE 15

LQFOXGLQJ DFXWH LQIODPPDWRU\ UHVSRQVHV DOWHUHG HQHUJ\ PHWDEROLVP DQG PXOWLSOH WLVVXH LQMXU\ DUH REVHUYHG DIWHU /36 DGPLQLVWUDWLRQ *KRVK HW DO f 7KH WR[LF SURSHUWLHV RI /36 DFFRXQW IRU LWV RWKHU QDPH EDFWHULDO HQGRWR[LQ 6HYHUDO OLSRSRO\VDFFKDULGH ELQGLQJ SURWHLQV /%3f ZKLFK VSHFLILFDOO\ LQWHUDFW ZLWK /36 KDYH EHHQ UHSRUWHG 7RELDV HW DO f )RU H[DPSOH 6FKXPDQQ HW DO f KDYH FKDUDFWHUL]HG D /%3 ZKLFK LV D N' SODVPD JO\FRSURWHLQ V\QWKHVL]HG LQ KHSDWRF\WHV $IWHU WKH /%3 LQWHUDFWV ZLWK /36 WKLV /36/%3 FRPSOH[ WKHQ ELQGV WR WKH FHOO VXUIDFH SURWHLQ &' DQG SUHVXPDEO\ HOLFLWV WKH FHOOXODU DQG WLVVXH UHVSRQVHV WR /36 :ULJKW HW DO f ,Q DGGLWLRQ D PHPEUDQHORFDOL]HG N' /36VSHFLIOF ELQGLQJ SURWHLQ KDV EHHQ LGHQWLILHG LQ % O\PSKRF\WHV 7 O\PSKRF\WHV DQG PDFURSKDJHV /HL DQG 0RUULVRQ f +RZHYHU WKH UROHV RI WKHVH GLIIHUHQW /%3V DQG WKH LQWHUDFWLRQ EHWZHHQ WKHP DUH VWLOO QRW FOHDU 7XPRU 1HFURVLV )DFWRU 7XPRU QHFURVLV IDFWRU 71)f DOVR FDOOHG FDFKHFWLQ LV V\QWKHVL]HG SULQFLSDOO\ E\ PRQRF\WHV DQG PDFURSKDJHV LQ UHVSRQVH WR PDFURSKDJH DFWLYDWRUV VXFK DV HQGRWR[LQ +XPDQ 71) KDV D PROHFXODU ZHLJKW RI N' ZKLFK LV V\QWKHVL]HG DV D SURSHSWLGH RI DPLQR DFLGV ZLWK D SUHFXUVRU VHTXHQFH RI DPLQR DFLGV 3HQQLFD HW DO $JJDUZDO HW DO f 7KH DPLQR DFLG VHTXHQFHV RI ERWK WKH SUR DQG PDWXUH SHSWLGHV DUH KLJKO\ FRQVHUYHG EHWZHHQ PRXVH DQG KXPDQ ZLWK DERXW b KRPRORJ\ %HXWOHU HW DO &VHK DQG %HXWOHU f $ ZLGH VSHFWUXP RI SRVVLEOH SK\VLRORJLFDO DFWLRQV IRU 71) LQFOXGLQJ LWV XVH LQ WKH PDQDJHPHQW RI FHUWDLQ WXPRUV LWV UROH LQ DQ LQIODPPDWRU\ UHDFWLRQ DQG LWV LQYROYHPHQW LQ WKH LPPXQH UHVSRQVH KDYH EHHQ GRFXPHQWHG %HXWOHU DQG &HUDPL f

PAGE 16

71) DQG O\PSKRWR[LQ D WXPRULFLGDO SURWHLQ SURGXFHG E\ O\PSKRF\WHVf VRPHWLPHV UHIHUUHG WR DV 71)D DQG 71) UHVSHFWLYHO\ DUH VWUXFWXUDOO\ DQG IXQFWLRQDOO\ UHODWHG *RHGGHO HW DO f 7KH\ VKDUH DERXW b KRPRORJ\ DQG KDYH EHHQ VKRZQ WR LQWHUDFW ZLWK WKH VDPH UHFHSWRUV DQG H[KLELW D QXPEHU RI VKDUHG ELRORJLFDO DFWLYLWLHV 7KH JHQHV IRU 71) DQG O\PSKRWR[LQ DUH FORVHO\ OLQNHG DQG VHSDUDWHG E\ DERXW NE LQ KXPDQV 1HGZLQ HW DO f /\PSKRWR[LQ OLHV f WR 71) DQG ERWK JHQHV UHVLGH ZLWKLQ WKH PDMRU KLVWRFRPSDWLELOLW\ FRPSOH[ ORFXV RQ FKRPRVRPH LQGLFDWLQJ WKDW WKHVH WZR JHQHV PD\ KDYH HYROYHG IURP D JHQH GXSOLFDWLRQ HYHQW 0RVW FHOO W\SHV LQFOXGLQJ OLYHU NLGQH\ PXVFOH DQG DGLSRVH WLVVXH KDYH EHHQ VKRZQ WR SRVVHVV VSHFLILF KLJK DIILQLW\ UHFHSWRUV IRU 71) 7ZR GLVWLQFW 71) UHFHSWRUV RI N' Sf DQG N' Sf KDYH EHHQ LGHQWLILHG LQ WKH PRXVH *RRGZLQ HW DO f DQG KXPDQ V\VWHPV ZKLFK GHPRQVWUDWH OLJDQG VSHFLILFLW\ IRU ERWK 71)D DQG 71)S +RKPDQQ HW DO f 7KH S UHFHSWRU SRVVHVVHV JUHDWHU DIILQLW\ IRU 71) WKDQ WKH S UHFHSWRU 7DUWDJOLD DQG *RHGGHO f 7KH JHQHV IRU WKH S DQG S UHFHSWRUV PDS WR FKURPRVRPHV DQG LQ KXPDQV DQG WR FKRPRVRPH DQG LQ WKH PRXVH UHVSHFWLYHO\ *RRGZLQ HW DO f %DVHG RQ WKHLU DPLQR DFLG VHTXHQFH WKH WZR UHFHSWRUV DUH RQO\ b LGHQWLFDO WR HDFK RWKHU DQG ERWK VKDUH IRXU F\VWHLQHULFK UHSHDWV LQ WKHLU H[WUDFHOOXODU GRPDLQV WKDW DUH FKDUDFWHULVWLF RI WKH QHUYH JURZWK IDFWRU 1*)f UHFHSWRU IDPLO\ )RU ERWK SURWHLQV DJJUHJDWLRQ RI UHFHSWRUV PHGLDWHG E\ ELQGLQJ RI GLPHULF RU WULPHULF 71) LV EHOLHYHG WR LQLWLDWH WKH VLJQDOLQJ SURFHVV +RZHYHU VHYHUDO OLQHV RI HYLGHQFH VXJJHVW WKDW VXEVHTXHQW VWHSV RI WKH VLJQDO WUDQVGXFWLRQ SURFHVV PD\ GLYHUJH 6WXGLHV KDYH EHHQ FRQGXFWHG XVLQJ DQWLERGLHV VSHFLILF IRU HLWKHU WKH S RU S UHFHSWRU +HOOHU HW DO f UHSRUWHG WKDW

PAGE 17

WKH F\WRWR[LFLW\ RI 71) ZDV PHGLDWHG WKURXJK WKH S UHFHSWRU 7DUWDJOLD HW DO f SURYLGHG HYLGHQFH LQGLFDWLQJ WKDW WKH F\WRWR[LFLW\ RI 71) LV VLJQDOHG E\ WKH S UHFHSWRU 7KH FRQWURYHUV\ EHWZHHQ WKHVH WZR K\SRWKHVHV QHHGV IXUWKHU LQYHVWLJDWLRQ EXW DOVR GHPRQVWUDWHV WKH FRPSOH[LW\ RI WKH 71) IXQFWLRQ 6ROXEOH IRUPV RI WKH 71) UHFHSWRUV DUH UHOHDVHG IURP WKH FHOO VXUIDFH E\ SURWHRO\WLF FOHDYDJH /DQW] HW DO *XOOEHUJ HW DO f 7KHVH VROXEOH UHFHSWRUV DFW DV 71) ELQGLQJ SURWHLQV ZKLFK VXEVHTXHQWO\ LQKLELW 71) LQWHUDFWLRQV ZLWK VXUIDFH UHFHSWRUV ,Q DGGLWLRQ WKH UHOHDVH RI VROXEOH UHFHSWRUV UHVXOWV LQ WKH GRZQUHJXODWLRQ RI FHOO VXUIDFH UHFHSWRUV 7KHUHIRUH VKHGGLQJ RI VXUIDFH UHFHSWRUV HQDEOHV WDUJHW FHOOV WR GHFUHDVH WKHLU UHVSRQVLYHQHVV WR 71) %LQGLQJ RI 71) WR LWV UHFHSWRU LV IROORZHG E\ UDSLG LQWHUQDOL]DWLRQ DQG GHJUDGDWLRQ YLD D O\VRVRPDO SDWKZD\ 7VXMLPRWR HW DO 1LLWVX HW DO f ,QWHUOHXNLQ ,QWHUOHXNLQ ,/f LQLWLDOO\ UHFRJQL]HG DV D IDFWRU SURGXFLQJ KLJK IHYHU DQG D VKRFNOLNH VWDWH 2NXVDZD HW DO )LVFKHU HW DO f LV SULPDULO\ V\QWKHVL]HG E\ PDFURSKDJHV DQG PRQRF\WHV EXW PD\ DOVR EH SURGXFHG E\ HSLWKHOLDO FHOOV HQGRWKHOLDO FHOOV NHUDWLQRF\WHV DQG JOLDO FHOOV ,/ LV DQ LQIODPPDWRU\ F\WRNLQH PRUH FORVHO\ UHODWHG WR WXPRU QHFURVLV IDFWRU 71)f WKDQ DQ\ RWKHU F\WRNLQH DOWKRXJK WKH VWUXFWXUH DQG UHFHSWRUV IRU ,/ DQG 71) DUH FOHDUO\ GLVWLQFW ,/ LV ELRORJLFDOO\ DFWLYH LQ WKH ORZ SLFRPRODU RU HYHQ IHPWRPRODU UDQJH 7KHUH LV OLWWOH HYLGHQFH WKDW F\WRNLQHV VXFK DV ,/ SOD\ DQ\ UROH LQ QRUPDO KRPHRVWDVLV VXFK DV KRUPRQDO UHJXODWLRQ PHWDEROLVP RU LQ SK\VLRORJLFDO UHJXODWLRQ ,Q WKH DEVHQFH RI LQMXU\ RU GDPDJH KRZHYHU LW LV XQFOHDU ZKHWKHU ,/ LV QHHGHG

PAGE 18

'XULQJ LQIODPPDWLRQ LQMXU\ LPPXQRORJLFDO FKDOOHQJH RU LQIHFWLRQ ,/ LV SURGXFHG DQG EHFDXVH RI LWV PXOWLSOH ELRORJLFDO SURSHUWLHV WKLV F\WRNLQH DSSHDUV WR DIIHFW WKH SDWKRJHQHVLV RI GLVHDVH 6SHFLILF SK\VLRORJLFDO DFWLYLWLHV RI ,/ LQFOXGH O\PSKRF\WH VWLPXODWLRQ LQGXFWLRQ RI DFXWH SKDVH SURWHLQV KHOSHU DFWLYLW\ IRU LPPXQRJOREXOLQ SURGXFWLRQ E\ % O\PSKRF\WHV LQGXFWLRQ RI LQWHUIHURQ DQG UDGLRSURWHFWLRQ 1HWD HW DO )LEEH HW DO f 0RVW VWXGLHV RQ ,/ DUH GHULYHG IURP H[SHULPHQWV LQ ZKLFK EDFWHULDO SURGXFWV VXFK DV OLSRSRO\VDFFKDULGH /36f HQGRWR[LQV IURP *UDPn QHJDWLYH EDFWHULD RU H[RWR[LQV IURP *UDPSRVLWLYH RUJDQLVPV DUH XVHG WR VWLPXODWH PDFURSKDJHV ,NHMLPD HW DO f 7ZR GLVWLQFW JHQHV ORFDWHG RQ FKURPRVRPH FRGH IRU WKH ,/OD DQG ,/LS SUHFXUVRU SRO\SHSWLGHV ERWK KDYLQJ PROHFXODU PDVVHV RI N' $XURQ HW DO /RPHGLFR HW DO &ODUN HW DO 'LQDUHOOR f +RZHYHU XQOLNH PRVW SURWHLQV ERWK ,/ D DQG ODFN D OHDGHU VHTXHQFH RI DPLQR DFLGV ZKLFK ZRXOG HQDEOH WKH SUHFXUVRU SURWHLQ WR EH LQVHUWHG LQWR WKH *ROJL DQG FOHDYHG WR D VPDOOHU PDWXUH VL]H WR EH WUDQVSRUWHG RXW RI WKH FHOO 7KH PDWXUH SURWHLQ RI ERWK ,/OD DQG 3 LV DSSUR[LPDWHO\ N' DIWHU HQ]\PDWLF FOHDYDJH ,/OD DQG ,/3 KDYH YHU\ GLIIHUHQW DPLQR DFLG VHTXHQFHV VKDULQJ RQO\ b VLPLODULW\ KRZHYHU VWUXFWXUDOO\ WKH WZR LVRIRUPV RI ,/ DUH UHODWHG DW WKH WKUHH GLPHQVLRQDO OHYHO KDYLQJ EHHQ FU\VWDOOL]HG 3UHLVWOH HW DO f 7KHVH WZR SURWHLQV KDYH EHHQ IRXQG LQ KXPDQ PRXVH UDW SLJ DQG UDEELW DQG H[KLELW VLJQLILFDQW LQWHUVSHFLHV KRPRORJ\ DW WKH DPLQR DFLG OHYHO b KRPRORJ\ EHWZHHQ KXPDQ DQG PRXVH ,/OD $XURQ HW DO f 7KH WKLUG PHPEHU RI WKH ,/ JHQH IDPLO\ LV ,/ UHFHSWRU DQWDJRQLVW ,/,5Df 7KH WKUHH PHPEHUV RI WKH ,/ IDPLO\

PAGE 19

UHFRJQL]H DQG ELQG WR WKH VDPH FHOO VXUIDFH UHFHSWRUV ,/OD DQG ,/LS ELQGLQJ WR WKH ,/ UHFHSWRUV WUDQVPLWV D VLJQDO ZKHUHDV ,/ 5D GRHV QRW ,/ LV UDSLGO\ V\QWKHVL]HG E\ PRQRQXFOHDU FHOOV ZKLFK DUH VWLPXODWHG E\ PLFURELDO SURGXFWV RU LQIODPPDWRU\ DJHQWV %HFDXVH RI WKH ODFN RI D OHDGHU SHSWLGH PRVW ,/ D UHPDLQV LQ WKH F\WRVRO RI FHOOV 7KHUH LV VRPH HYLGHQFH WKDW WKH SUHFXUVRU ,/ D LV WUDQVSRUWHG WR WKH FHOO VXUIDFH ZKHUH LW KDV EHHQ LGHQWLILHG DV PHPEUDQH ,/ %URG\ DQG 'XUXP f ,Q KXPDQ PRQRF\WHV EHWZHHQ b RI ,/ 3 LV WUDQVSRUWHG RXW RI WKH FHOO EXW LQ FRQWUDVW WR ,/OD ,/ S HQWHUV WKH FLUFXODWLRQ 9DULRXV PHFKDQLVPV IRU WUDQVSRUW LQFOXGH H[RF\WRVLV IURP YHVLFOHV DFWLYH WUDQVSRUW YLD PXOWLSOHGUXJUHVLVWDQFH FDUULHU SURWHLQV RU IROORZLQJ FHOO GHDWK 8QOLNH WKH ,/OD SUHFXUVRU WKH ,/3 SUHFXUVRU UHTXLUHV FOHDYDJH IRU RSWLPDO ELRORJLFDO DFWLYLW\ 6HYHUDO FRPPRQ HQ]\PHV ZLOO FXW WKH ,/ 3 SUHFXUVRU LQWR VPDOOHU DQG PRUH DFWLYH IRUPV +RZHYHU RQH SDUWLFXODU SURWHDVH DSSHDUV KLJKO\ VSHFLILF IRU FOHDYLQJ WKH ,/ 3 SUHFXUVRU IURP WR N' LWV PRVW DFWLYH IRUP &HUUHWWL HW DO 7KRPEHUU\ HW DO f 7KLV HQ]\PH LV NQRZQ DV WKH ,/ S FRQYHUWLQJ HQ]\PH ,&(f DQG LV D PHPEHU RI WKH F\VWHLQH SURWHDVH IDPLO\ ,&( GRHV QRW FOHDYH WKH ,/OD SUHFXUVRU 2WKHU HQ]\PHV KDYH EHHQ IRXQG ZKLFK FOHDYH WKH ,/OD SUHFXUVRU EXW WKHVH RWKHU HQ]\PHV VHHP OHVV VSHFLILF WKDQ ,&( 0ROHFXODU %LRORJ\ RI 0Q62' 2XU ODERUDWRU\ KDV SUHYLRXVO\ FKDUDFWHUL]HG WKH UDW 0Q62' F'1$ 'RXJDOO f 7KH UDW 0Q62' JHQRPLF ORFXV ZDV ILUVW VHTXHQFHG E\ +R HW DO f 7KH SURPRWHU UHJLRQ RI 0Q62' FRQWDLQV QHLWKHU D f&$$7 ER[f QRU D f7$7$ ER[f 2XU ODERUDWRU\ KDV DOVR LGHQWLILHG DQG FKDUDFWHUL]HG WKH UDW 0Q62' JHQH ZKLFK FRQWDLQV ILYH H[RQV ([RQ RQH HQFRGHV WKH f XQWUDQVODWHG OHDGHU VHTXHQFH WKH PLWRFKRQGULDO VLJQDO

PAGE 20

VHTXHQFH DQG WKH 1WHUPLQXV RI WKH UDW 0Q62' SURWHLQ ([RQ DQG HQFRGH WKH PDWXUH 0Q62' SURWHLQ ([RQ FRQWDLQV WKH VWRS FRGRQ 7*$ DQG WKH f XQWUDQVODWHG UHJLRQ 'RXJDOO f 3ULPHU H[WHQVLRQ DQDO\VLV ZDV XVHG WR ORFDWH WKH WUDQVFULSWLRQ LQLWLDWLRQ VLWH DW EHWZHHQ DQG QXFOHRWLGHV f WR WKH VWDUW RI WUDQVODWLRQ +XUW HW DO f 7KHUH DUH ILYH VSHFLHV RI 0Q62' P51$ LGHQWLILHG E\ 1RUWKHUQ DQDO\VLV 2XU ODERUDWRU\ KDV GHPRQVWUDWHG WKDW WKHVH ILYH VSHFLHV RI 0Q62' P51$ DUH WKH UHVXOW RI GLIIHUHQWLDO SRO\DGHQ\ODWLRQ +XUW HW DO f 7KH UHJXODWLRQ RI 0Q62' ELRV\QWKHVLV LQ ( FROL LV XQGHU ULJRURXV FRQWURO 7KH LQGXFWLRQ RI WKLV HQ]\PH LV LQ UHVSRQVH WR WKH FHOOXODU HQYLURQPHQWDO UHGR[ VWDWH ( FROL JURZQ LQ LURQSRRU PHGLXP RU LQ WKH SUHVHQFH RI LURQFKHODWLQJ DJHQWV UHVXOWV LQ DQ LQGXFWLRQ RI WKH EDFWHULDO 0Q62' JHQH 2Q WKH RWKHU KDQG FHOOV JURZQ LQ LURQHQULFKHG PHGLXP SURGXFHV DQ LQKLELWLRQ RI 0Q62' H[SUHVVLRQ $OO RI WKHVH REVHUYDWLRQV OHG )ULGRYLFK WR VXJJHVW WKDW ( FROL 0Q62' LV FRQWUROOHG E\ DQ LURQFRQWDLQLQJ UHSUHVVRU )ULGRYLFK f 0RUH UHFHQWO\ WKH WUDQVFULSWLRQDO UHJXODWRUV )QU )XU DQG $UF ZHUH LGHQWLILHG +DVVDQ DQG 6XQ 3ULYDOOH DQG )ULGRYLFK f DQG IRXQG WR QHJDWLYHO\ UHJXODWH WKH H[SUHVVLRQ RI 0Q62' LQ ( FROL 8QOLNH EDFWHULD 0Q62' V\QWKHVLV LQ HXNDU\RWLF FHOOV LV XSUHJXODWHG GUDPDWLFDOO\ E\ SURLQIODPPDWRU\ PHGLDWRUV LQFOXGLQJ OLSRSRO\VDFFKDULGH /36f WXPRU QHFURVLV IDFWRU DOSKD 71)Df LQWHUOHXNLQV DQG (/ ,/f DQG LQWHUIHURQ JDPPD ,)1\f :RQJ DQG *RHGGHO 6KDIIHU HW DO 'HO9HFFKLR DQG 6KDIIHU 'RXJDOO DQG 1LFN %RUJ HW DO (GG\ HW DO *LEEV HW DO 9DOHQWLQH DQG 1LFN 9LVQHU HW DO :KLWVHWW HW DO (DVWJDWH HW DO 0HOHQGH] DQG %DJOLRQL %LJGHOL HW DO

PAGE 21

-DFRE\ HW DO $NDVKL HW DO *ZLQQHU HW DO -RQHV HW DO /RQW] HW DO 6WHSKDQ] HW DO f ,Q / FHOOV D UDW SXOPRQDU\ HSLWKHOLDOOLNH FHOO OLQH 0Q62' P51$ OHYHOV VKRZ DQ IROG LQGXFWLRQ DIWHU VWLPXODWLRQ ZLWK /36 9LVQHU HW DO f &HOOV WUHDWHG ZLWK 71)D RU ,/ VKRZHG VLPLODU UHVXOWV 7R HYDOXDWH WKH LPSRUWDQFH RI RQJRLQJ SURWHLQ V\QWKHVLV DQG GH QRYR WUDQVFULSWLRQ VWXGLHV ZLWK F\FORKH[LPLGH DQ LQKLELWRU RI SURWHLQ V\QWKHVLV VKRZHG QR HIIHFW RQ /36 71)D RU ,/GHSHQGHQW LQGXFWLRQ RI 0Q62' P51$ OHYHO 2Q WKH RWKHU KDQG / FHOOV FRWUHDWHG ZLWK VWLPXODQW /36 71)D RU ,/f DQG DFWLQRP\FLQ DQ LQKLELWRU RI P51$ WUDQVFULSWLRQ LQKLELWHG WKH VWLPXOXVGHSHQGHQW LQGXFWLRQ RI 0Q62' P51$ H[SUHVVLRQ 9LVQHU HW DO f )XUWKHUPRUH QXFOHDUUXQ RQ GDWD VKRZHG D IROG LQGXFWLRQ LQ 0Q62' P51$ OHYHO +VX f 7KH DERYH HYLGHQFH VXJJHVWV WKDW WKH UHJXODWLRQ RI 0Q62' JHQH H[SUHVVLRQ LV DW OHDVW SDUWO\ WUDQVFULSWLRQDOO\ GHSHQGHQW 7KH GLIIHUHQFH EHWZHHQ QXFOHDU UXQRQ DQDO\VLV DQG LQ YLYR GDWD RQ P51$ OHYHO IROORZLQJ /36 WUHDWPHQW PD\ EH FDXVHG E\ WKH VWDELOLW\ RI WKH P51$ RU WKH ORVV RI VRPH WUDQVFULSWLRQ IDFWRUV GXULQJ WKH SUHSDUDWLRQ RI QXFOHL IRU QXFOHDU UXQRQ H[SHULPHQWV ([DPLQDWLRQV RI RWKHU FHOO W\SHV WUHDWHG ZLWK /36 71)D RU ,/ DOVR VKRZHG VLPLODU UHVXOWV DW WKH P51$ OHYHO LQFOXGLQJ UDW SXOPRQDU\ DUWHU\ HQGRWKHOLDO FHOOV 9LVQHU HW DO f SRUFLQH SXOPRQDU\ DUWHU\ HQGRWKHOLDO FHOOV 9LVQHU HW DO f DQG LQWHVWLQDO HSLWKHOLDO FHOOV 9DOHQWLQH DQG 1LFN f ,QWHUHVWLQJO\ WKRXJK &X=Q62' FRQWULEXWHV WKH PDMRU SDUW RI WKH WRWDO FHOOXODU 62' DFWLYLW\ LWV P51$ OHYHO LV QRW UHJXODWHG E\ DQ\ NQRZQ VWLPXODQW WR DQ\ ODUJH GHJUHH

PAGE 22

(QKDQFHUV 7KH FRQWURO RI WUDQVFULSWLRQ LQ SURNDU\RWHV LV ODUJHO\ JRYHUQHG E\ VHTXHQFHV LQ WKH YLFLQLW\ RI WKH WUDQVFULSWLRQDO VWDUW VLWH 0RVW SURNDU\RWLF SURPRWHUV FRQVLVW RI VKRUW VHTXHQFH PRWLIV DSSUR[LPDWHO\ WR EDVH SDLUV XSVWUHDP RI WKH WUDQVFULSWLRQDO VWDUW VLWH WKHVH PRWLIV PDNH GLUHFW FRQWDFW ZLWK 51$ SRO\PHUDVH DQG WKXV VHUYH WR SRVLWLRQ WKH VWDUW VLWH 5RVHQEHUJ DQG &RXUW f 7KH LQLWLDO FKDUDFWHUL]DWLRQ RI HXNDU\RWLF SURPRWHUV UHYHDOHG D VLPLODU DUUDQJHPHQW RI VHTXHQFH HOHPHQWV 0DQ\ HXNDU\RWLF SURPRWHUV SRVVHVV WKH FRQVHUYHG VHTXHQFH PRWLI 7$7$$$ WKH 7$7$ ER[f LQ WKH WR UHJLRQ DQG VRPH SURPRWHUV FRQWDLQ DQ DGGLWLRQDO XSVWUHDP FRQVHUYHG HOHPHQW **7 RU 4&$$7&7 WKH &$$7 ER[f +RZHYHU XQOLNH WKH FRUUHVSRQGLQJ SURNDU\RWLF HOHPHQW GHOHWLRQ RI WKH 7$7$ ER[ GRHV QRW QHFHVVDULO\ DEROLVK H[SUHVVLRQ DV VKRZQ E\ HDUO\ VWXGLHV RQ WKH KLVWRQHV +$ JHQH *URVVFKHGO DQG %LPVWLHO Df ,Q DGGLWLRQ WKHVH VWXGLHV UHYHDOHG WKDW '1$ VHTXHQFHV O\LQJ VHYHUDO KXQGUHG EDVH SDLUV ESf XSVWUHDP RI WKH WUDQVFULSWLRQDO VWDUW VLWH FDQ SRVLWLYHO\ LQIOXHQFH WUDQVFULSWLRQ HYHQ ZKHQ SRVLWLRQHG LQ DQ LQYHUWHG RULHQWDWLRQ *URVVFKHGO DQG %LPVWLHO Ef 6LPLODU ZRUN ZLWK WKH VLPLDQ YLUXV 69f HDUO\ UHJLRQ LQGLFDWHG WKDW WKH 7$7$ ER[ ZDV QRW UHTXLUHG IRU HDUO\ JHQH H[SUHVVLRQ %HQRLVW DQG &KDPEQ f DQG WKDW LWV GHOHWLRQ UHVXOWHG LQ KHWHURJHQHRXV WUDQVFULSWLRQDO VWDUW VLWHV %HQRLVW DQG &KDPEQ f ,Q DGGLWLRQ GHOHWLRQ RI VHTXHQFHV DERXW ES XSVWUHDP RI WKH WUDQVFULSWLRQDO VWDUW VLWH KDG DQ DGYHUVH HIIHFW RQ HDUO\ JHQH H[SUHVVLRQ 'HOHWLRQ RI RQH RI WKH WZR ES UHSHDW HOHPHQWV XSVWUHDP RI WKH HDUO\ JHQH GLG QRW JUHDWO\ UHGXFH HDUO\ JHQH H[SUHVVLRQ RU YLUXV YLDELOLW\ EXW WKH DGGLWLRQDO UHPRYDO RI D SRUWLRQ RI WKH VHFRQG UHSHDW UHGXFHG H[SUHVVLRQ GUDPDWLFDOO\ *UXVV HW DO %HQRLVW DQG &KDPEQ f

PAGE 23

7KXV LW ZDV IRXQG WKDW '1$ VHTXHQFHV O\LQJ D FRQVLGHUDEOH GLVWDQFH XSVWUHDP RI WUDQVFULSWLRQDO VWDUW VLWHV SOD\ D VLJQLILFDQW UROH LQ WUDQVFULSWLRQDO UHJXODWLRQ )XUWKHU FKDUDFWHUL]DWLRQ RI WKHVH VHTXHQFHV UHYHDOHG D VXUSULVLQJ UHVXOW :KHQ D ES '1$ VHJPHQW RI WKH 69 SURPRWHU UHJLRQ ZDV OLQNHG WR D 3JORELQ JHQH WUDQVFULSWLRQ RI WKH JHQH ZDV HQKDQFHG XS WR IROG %DQHUML HW DO f 7KLV HQKDQFHPHQW RI WUDQVFULSWLRQ RFFXUUHG RQO\ ZKHQ WKH 69 VHTXHQFHV ZHUH SUHVHQW LQ FLV GLG QRW GHSHQG XSRQ '1$ UHSOLFDWLRQ DQG FRXOG RFFXU ZKHQ WKH VHTXHQFHV ZHUH SODFHG LQ ERWK RULHQWDWLRQV HLWKHU ES f RU ES f RI WKH JHQH (QKDQFHPHQW ZDV REVHUYHG DV ORQJ DV RQH FRS\ RI WKH ES UHSHDWV ZDV SUHVHQW 6LPLODU UHVXOWV ZHUH REWDLQHG ZKHQ WKH 69 SURPRWHU UHJLRQ ZDV SODFHG DGMDFHQW WR WKH FKLFNHQ FRQDEOXPLQ RU DGHQRYLUXV PDMRU ODWH SURPRWHUV RU ZLWKLQ WKH 7 DQWLJHQ JHQH LQWURQ VHTXHQFHV 0RUHDX HW DO )URPP DQG %HUJ f 7KXV VHTXHQFHV ZLWKLQ DQG IODQNLQJ WKH 69 ES UHSHDWV DUH LPSRUWDQW IRU HQKDQFLQJ WKH H[SUHVVLRQ RI F$OLQNHG SURPRWHUV LQ DQ RULHQWDWLRQ DQG GLVWDQFH LQGHSHQGHQW IDVKLRQ DOWKRXJK LQ VRPH FDVHV GLVWDQFH HIIHFWV ZHUH REVHUYHG 0RUHDX HW DO f 6WXGLHV ZLWK SRO\RPD YLUXV DOVR UHYHDOHG WKH H[LVWHQFH RI D '1$ VHJPHQW HVVHQWLDO IRU YLUDO YLDELOLW\ DQG FDSDEOH RI HQKDQFLQJ H[SUHVVLRQ RI F$OLQNHG JHQHV 7\QGDOO HW DO GH 9LOOLHUV DQG 6FKDIIQHU f 6KRUWO\ WKHUHDIWHU UHWURYLUXVHV ZHUH IRXQG WR SRVVHVV VLPLODU '1$ HOHPHQWV LQ WKHLU ORQJ WHUPLQDO UHSHDW /75f UHJLRQV /HYLQVRQ HW DO *RUPDQ HW DO f 7KH SURSHUWLHV RI WKHVH YLUDO WUDQVFULSWLRQDO FRQWURO HOHPHQWV QRZ FRQVWLWXWH WKH GHILQLWLRQ RI DQ HQKDQFHU HOHPHQW 7KHVH SURSHUWLHV LQFOXGH WKH DELOLW\ WR Df LQFUHDVH WUDQVFULSWLRQ RI F$OLQNHG SURPRWHUV Ef RSHUDWH LQ DQ RULHQWDWLRQ LQGHSHQGHQW PDQQHU

PAGE 24

Ff H[HUW DQ HIIHFW RYHU ODUJH GLVWDQFHV LQGHSHQGHQW RI SRVLWLRQ DQG Gf HQKDQFH WKH H[SUHVVLRQ RI KHWHURORJRXV SURPRWHUV 6LQFH WKH ILUVW LGHQWLILHG HQKDQFHU ZDV REVHUYHG LQ YLUDO JHQRPHV LW ZDV FRQFHLYDEOH WKDW WKHVH WUDQVFULSWLRQDO FRQWURO HOHPHQWV PLJKW EH XQLTXH WR YLUXVHV DQG UHSUHVHQW D PHDQV WKDW HQDEOHV WKHP WR FRPSHWH IRU WKH KRVW FHOO WUDQVFULSWLRQDO PDFKLQHU\ +RZHYHU WKH GLVFRYHU\ DQG FKDUDFWHUL]DWLRQ RI PDPPDOLDQ FHOOXODU HQKDQFHU HOHPHQWV ZLWKLQ WKH LPPXQRJOREXOLQ ,Jf JHQHV HOLPLQDWHG WKLV SRVVLELOLW\ %DQHUML HW DO *LOOLHV HW DO 1HXEHUJHU 0HUFOD HW DO f %DQHUML HW DO f VKRZHG WKDW D VHYHUDO KXQGUHG ES '1$ VHJPHQW GHULYHG IURP WKH ,J KHDY\ FKDLQ ORFXV FRXOG HQKDQFH H[SUHVVLRQ RI D OLQNHG 3JORELQ SURPRWHU LQ DQ RULHQWDWLRQ DQG SRVLWLRQ LQGHSHQGHQW PDQQHU 7KLV HIIHFW RFFXUUHG RQO\ ZKHQ WKH ,J VHTXHQFHV ZHUH SUHVHQW LQ FLV DQG GLG QRW GHSHQG XSRQ '1$ UHSOLFDWLRQ )XUWKHUPRUH HQKDQFHPHQW RFFXUUHG LQ WKUHH GLIIHUHQW O\PSKRLG FHOO OLQHV EXW QRW LQ PRXVH 7 PLQN OXQJ RU KXPDQ +H/D FHOOV *LOOLHV HW DO f FRQFXUUHQWO\ GHPRQVWUDWHG WKDW WKH VDPH '1$ VHJPHQW LQFUHDVHG H[SUHVVLRQ RI WKH ,J\E JHQH LQ DQ RULHQWDWLRQ DQG SRVLWLRQ LQGHSHQGHQW PDQQHU DQG IXQFWLRQHG LQ O\PSKRLG FHOOV EXW QRW LQ / FHOOV 7KXV WKH HQKDQFLQJ VHTXHQFHV RSHUDWHG LQ D WLVVXHVSHFLILF PDQQHU 6LPLODU UHVXOWV ZHUH REWDLQHG ZLWK WKH ,J N JHQH ZKLFK LQGLFDWHG WKDW D WLVVXHVSHFLILF WUDQVFULSWLRQDO HQKDQFHU HOHPHQW LV ORFDWHG ZLWKLQ WKH LQWURQ VHSDUDWLQJ WKH MRLQLQJ -Nf DQG FRQVWDQW &Nf UHJLRQV 4XHHQ DQG %DOWLPRUH 6WDIIRUG DQG 4XHHQ 4XHHQ DQG 6WDIIRUG 3LFDUG DQG 6KDIIQHU f 7KH LGHQWLILFDWLRQ RI HQKDQFHUV LQ FHOOXODU JHQHV LQGLFDWHG WKDW HQKDQFHUV DUH QRW WUDQVFULSWLRQDO FRQWURO HOHPHQWV SHFXOLDU WR YLUDO JHQRPHV

PAGE 25

3UHYLRXV ZRUN IURP RXU ODERUDWRU\ GHPRQVWUDWHG WKDW WKH UHJXODWRU\ HOHPHQW UHVSRQVLEOH IRU WKH GUDPDWLF LQGXFWLRQV LQ 0Q62' P51$ ZDV QRW FRQWDLQHG ZLWKLQ WKH f IODQNLQJ UHJLRQ RI WKH JHQH &KHVURZQ f )XUWKHU ZRUN VXJJHVWHG WKDW DQRWKHU UHJLRQ RI '1$ ZLWKLQ WKH JHQH PLJKW EH UHVSRQVLEOH IRU WKH WUDQVFULSWLRQDO UHJXODWLRQ E\ LQIODPPDWRU\ PHGLDWRUV &KHVURZQ f 7KH PDLQ REMHFWLYH RI WKH UHVHDUFK SUHVHQWHG LQ WKLV GLVVHUWDWLRQ ZDV WR LQYHVWLJDWH WKH PROHFXODU PHFKDQLVPV UHVSRQVLEOH IRU WKH GUDPDWLF LQGXFWLRQV RI 0Q62' H[SUHVVLRQ LQ UHVSRQVH WR LQIODPPDWRU\ VWLPXOL 7KH XOWLPDWH JRDO RI WKLV VWXG\ ZDV WR FKDUDFWHUL]H WKH GVHOHPHQWVf ZLWKLQ WKH JHQH UHVSRQVLEOH IRU WKH LQGXFLELOLW\ RI 0Q62' 7KHVH UHVXOWV ZLOO SURYLGH LQIRUPDWLRQ IRU IXWXUH LGHQWLILFDWLRQ RI WKH WUDZDFWLQJ IDFWRUV DQG RWKHU VWHSV DQG FRPSRQHQWV LQYROYHG LQ WKH LQIODPPDWRU\ SDWKZD\ RI 0Q62'

PAGE 26

&+$37(5 0$7(5,$/6 $1' 0(7+2'6 0DWHULDOV +DPfV ). 0HGLXP &DW 1f ERYLQH VHUXP DOEXPLQ &DW $f DQG GLWKLRWKUHLWRO &DW 'f EDFWHULDO OLSRSRO\VDFFKDULGH /36f (FROL VHURW\SH % &DW/ f DPREDUELWDO $P\WDOf &DW$ f KHSW\OK\GUR[\TXLQROLQH 1 R[LGH +412f &DW+ f ROLJRP\FLQ &DW f DQG P\[RWKLD]RO &DW0 f ZHUH SXUFKDVHG IURP 6LJPD &KHPLFDO &RPSDQ\ 6W /RXLV 02 2OLJRQXFOHRWLGHV GHSURWHFWHG GHVDOWHG DQG GHSKRVSKRU\ODWHG 0HGLXP ZLWK (DUOHfV VDOWV &DW f IHWDO ERYLQH VHUXP &DW f DQWLELRWLFDQWLP\FRWLF VROXWLRQ $%$0f &DW f UHVWULFWLRQ HQ]\PHV 7DT '1$ 3RO\PHUDVH &DW f 7 '1$ /LJDVH &DW f '+D ( FROL FRPSHWHQW FHOOV &DW f DQG 5DQGRP 3ULPHUV '1$ /DEHOLQJ 6\VWHP &DW f ZHUH SXUFKDVHG IURP *LEFR %5/ *DLWKHUEXUJ 0' 5HFRPELQDQW KXPDQ 71)D ZDV D JLIW IURP *HQHQWHFK ,/LS ZDV D JLIW IURP WKH 1DWLRQDO &DQFHU ,QVWLWXWH $QWLP\FLQ $ &DW f 1DFHW\O F\VWHLQH &DW f 6% f DQG 3' &DWf ZHUH SXUFKDVHG IURP &DOELRFKHP 6DQ 'LHJR &$ 7KH NDSSD NLQDVH LQKLELWRU %D\ ZDV SXUFKDVHG IURP %LR0RO 3O\PRXWK 0HHWLQJ 3$ 6LJPD &RUS 6W /RXLV 02f 9HQW5 '1$ 3RO\PHUDVH &DW 6f UHVWULFWLRQ HQ]\PHV 7 3RO\QXFOHRWLGH .LQDVH &DW6f DQG FDOI LQWHVWLQDO DONDOLQH SKRVSKDWDVH &,3f &DW6f ZHUH SXUFKDVHG IURP 1HZ (QJODQG

PAGE 27

%LRODEV ,QF %HYHUO\ 0$ /RQJ 5DQJHU *HO 6ROXWLRQ &DW f DQG 6HDNHP +*7 DJDURVH &DW f ZHUH SXUFKDVHG IURP )0& %LR3URGXFWV 5RFNODQG 0( 3URWHLQDVH &DW f DQG ( FROL W51$ &DW f ZHUH SXUFKDVHG IURP %RHKULQJHU0DQQKHLP ,QGLDQDSROLV ,1 7$ &ORQLQJ NLW &DW .f ZDV SXUFKDVHG IURP ,QYLWURJHQ &RUSRUDWLRQ &DUOVEDG &$ S&56FULSW &ORQLQJ NLW &DW f ZDV SXUFKDVHG IURP 6WUDWDJHQH /D -ROOD &$ =HWDELQG SRVLWLYHO\ FKDUJHG Q\ORQ WUDQVIHU PHPEUDQH &DW 1063f ZDV SXUFKDVHG IURP &XQR 0HULGHQ &7 'LPHWK\O VXOIDWH &DW f DPG VRGLXP FDFRG\ODWH &DWf ZHUH SXUFKDVHG IURP $OGULFK 0LOZDXNHH :, 3LSHULGLQH &DW 3,f ZDV SXUFKDVHG IURP )LVKHU 6FLHQWLILF 3LWWVEXUJ 3$ 4,$TXLFN 1XFOHRWLGH 5HPRYDO NLW &DWf 4,$TXLFN *HO ([WUDFWLRQ NLW &DWf 4,$SUHS 6SLQ 0LQLSUHS NLW &DWf 4LDJHQ 3ODVPLG 0LGL NLW &DW f 4LDJHQ 3ODVPLG 0D[L NLW &DW f ZHUH REWDLQHG IURP 4LDJHQ 9DOHQFLD &$ +\SHUILOP 03 &DW 513 &DW513+f 8OWUDSXUH G173 6HW &DW f DQG DGHQRVLQH fWULSKRVSKDWH &DWf ZHUH SXUFKDVHG IURP $PHUVKDP3KDUPDFLD 3LVFDWDZD\ 1>D 3-G$73 &L O7%TfPPROf &DW %/8+f DQG >\3@$73 &L O7%TfPPROf &DW%/8$f ZHUH SXUFKDVHG IURP 1HZ (QJODQG 1XFOHDU 1(1f /LIH 6FLHQFHV 3URGXFWV %RVWRQ 0$ &HOO OLQHV UDW SXOPRQDU\ HSLWKHOLDOOLNH / &DW $7&& &&/ f ZDV SXUFKDVHG IURP $PHULFDQ 7\SH &XOWXUH &ROOHFWLRQ 0DQDVVDV 9$ Sff*+ DQG S7.*+ ZHUH REWDLQHG DV D NLW &DW f IURP 1LFKROV ,QVWLWXWH 'LDJQRVWLFV 6DQ -XDQ &DSLVWUDQR &$ $OO RWKHU FKHPLFDOV QRW PHQWLRQHG ZHUH REWDLQHG WKURXJK HLWKHU 6LJPD &KHPLFDO &R RU )LVKHU 6FLHQWLILF

PAGE 28

0HWKRGV 7LVVXH &XOWXUH 7KH FHOO OLQHV XVHG LQ WKH VWXGLHV GHVFULEHG LQ WKLV WKHVLV ZHUH / UDW SXOPRQDU\ HSLWKHOLDOOLNH FHOOV $7&& &&/ f UDW SXOPRQDU\ DUWHU\ HQGRWKHOLDO FHOOV 9$ FHOOV LVRODWHG IURP VHJPHQWV RI SXOPRQDU\ DUWHU\ E\ PHFKDQLFDO PHWKRGV 9LVQHU HW DO f DQG PRXVH ILEUREODVW DQWLP\FLQUHVLVWDQW PXWDQW FHOOV /$ FHOOV JHQHURXVO\ SURYLGHG E\ 'U 1HLO +RZHOO +RZHOO HW DO f $OO FHOOV ZHUH FXOWXUHG DV DGKHUHQW PRQROD\HUV 7KH / UDW SXOPRQDU\ HSLWKHOLDOOLNH FHOO OLQH $7&& &&/ f ZDV JURZQ DV D PRQROD\HU LQ PP WLVVXH FXOWXUH SODWHV FRQWDLQLQJ +DPfV PRGLILHG ). PHGLXP *,%&2f VXSSOHPHQWHG ZLWK b IHWDO ERYLQH VHUXP SJPO SHQLFLOOLQ PJPO VWUHSWRP\FLQ DQG SJPO DPSKRWHULFLQ % DW r& LQ KXPLGLILHG DLU ZLWK b &2 ,I FHOOV ZHUH XVHG IRU LQ YLYR IRRWSULQWLQJ H[SHULPHQWV WKHQ DW DSSUR[LPDWHO\ b FRQIOXHQFH FHOOV ZHUH WUHDWHG ZLWK SJPO (VFKHULVFKLD FROL ( FROLf /36 (FROL VHURW\SH % 6LJPDf QJPO 71)D NLQGO\ SURYLGHG E\ WKH *HQHQWHFK &RUSf RU QJPO ,/LS NLQGO\ SURYLGHG E\ WKH 1DWLRQDO &DQFHU ,QVWLWXWHf IRU RU KRXUV WR LQGXFH 0Q62' JHQH H[SUHVVLRQ 8QWUHDWHG FHOOV ZHUH XVHG DV FRQWUROV 9$ FHOOV D UDW SXOPRQDU\ DUWHU\ HQGRWKHOLDO FHOO OLQH ZHUH JURZQ LQ 0HGLXP ZLWK (DUOHfV VDOWV 6LJPD &RUS 6W /RXLV 02f ZLWK VRGLXP ELFDUERQDWH WR S+ b IHWDO ERYLQH VHUXP P0 /JOXWDPLQH DQG DQWLELRWLFDQWLP\FRWLF VROXWLRQ DW r & LQ URRP DLU b &2 /$ FHOOV D PRXVH ILEUREODVW DQWLP\FLQUHVLVWDQW PXWDQW FHOO OLQH +RZHOO HW DO f ZHUH JURZQ LQ +DPfV ). PHGLD ZLWK b IHWDO ERYLQH VHUXP P0 / JOXWDPLQH DQG DQWLELRWLFDQWLP\FRWLF VROXWLRQ DW r & LQ URRP DLU b &2

PAGE 29

([SHULPHQWV ZLWK 9$ FHOOV DQG /$ FHOOV ZHUH DOO SHUIRUPHG ZLWK FRQIOXHQW PP WLVVXH FXOWXUH SODWHV 3RO\PHUDVH &KDLQ 5HDFWLRQ 3&5f 7KH 3&5 UHDFWLRQ FRQWDLQHG '1$ WHPSODWH QJf P0 7ULV+&O S+ P0 .& P0 0J&O P0 RI HDFK G173 SPRO RI HDFK ROLJRQXFOHRWLGH SULPHU ROLJRQXFOHRWLGH SULPHUV IRU 3&5 ZHUH REWDLQHG GHSURWHFWHG GHVDOWHG DQG GHSKRVSKRU\ODWHGf LQ D WRWDO YROXPH RI SL FRYHUHG ZLWK SL RI PLQHUDO RLO 7KLV PL[WXUH ZDV KHDWHG IRU PLQXWHV WR DOORZ GHQDWXUDWLRQ RI WKH WHPSODWH DQG SL 8f RI 7DT '1$ 3RO\PHUDVH ZHUH DGGHG DIWHU PLQXWHV RI WKLV WLPH 7KH 3&5 ZDV UXQ LQ D 3HUNLQ (OPHU WKHUPRF\FOHU 3HUNLQ (OPHU &RUSRUDWLRQ 1RUZDON &7f IRU F\FOHV PLQXWH DQG VHFRQGV DW r& IRU GHQDWXUDWLRQ VHFRQGV DW r& IRU DQQHDOLQJ DQG PLQXWH DW r& IRU H[WHQVLRQ $IWHU F\FOHV VDPSOHV ZHUH LQFXEDWHG DW r& IRU PLQXWHV WR DOORZ FRPSOHWH H[WHQVLRQ DQG DGGLWLRQ RI DQ H[WUD GHR[\DGHQRVLQH QXFOHRWLGH LQ HDFK IUDJPHQW E\ 7DT '1$ SRO\PHUDVH DQG UHIULJHUDWHG DW r& 0LQHUDO RLO ZDV H[WUDFWHG E\ WKH DGGLWLRQ RI SL RI FKORURIRUUPLVRDP\O DOFRKRO ,$$f YRUWH[LQJ DQG FHQWULIXJDWLRQ IRU PLQXWHV DW [ J DW URRP WHPSHUDWXUH 7KH DTXHRXV SKDVH ZDV WUDQVIHUUHG WR D QHZ WXEH DQG SL RI WKH 3&5 UHDFWLRQ SOXV YROXPH RI EURPRSKHQRO EOXH[\OHQH F\DQRO)LFROO PL[WXUH ZDV ORDGHG RQ D b 6HDNHP +*7 DJDURVH JHO FRQWDLQLQJ HWKLGLXP EURPLGH PJPOf P0 7ULVDFHWDWH P0 DFHWLF DFLG P0 ('7$ DQG UXQ ZLWK 7$( EXIIHU IRU PLQXWHV DW YROWV 7KH '1$ WHPSODWHV IRU WKH 3&5 XVHG WR SURGXFH WKH 0Q62' JHQRPLF IUDJPHQWV LQ WKH HQKDQFHU GHOHWLRQ DQDO\VHV ZHUH SODVPLGV FRQWDLQLQJ UHVWULFWLRQGLJHVWHG IUDJPHQWV IURP WKH RULJLQDO JHQRPLF FORQHV 'RXJDOO f

PAGE 30

7$ &ORQLQJ RI 3&5 3URGXFWV 7DT '1$ SRO\PHUDVH KDV D QRQWHPSODWHGHSHQGHQW DFWLYLW\ ZKLFK DGGV D VLQJOH GHR[\DGHQRVLQH $f WR WKH f HQGV RI 3&5 SURGXFWV 7KH OLQHDUL]HG YHFWRU S&5 VXSSOLHG LQ WKH 7$ &ORQLQJ NLW ,QYLWURJHQ &DUOVEDG &$f KDV D VLQJOH f GHR[\WK\PLGLQH 7f UHVLGXH 7KLV DOORZV 3&5 LQVHUWV WR OLJDWH HIILFLHQWO\ ZLWK WKRVH YHFWRUV 7R OLJDWH WKH 3&5 SURGXFW LQ WKH 7$ FORQLQJ YHFWRU SL RI IUHVK 3&5 UHDFWLRQ ZDV LQFXEDWHG ZLWK SL RI WKH S&5 YHFWRU QJ LQ P0 7ULV+&O P0 ('7$ S+ f SL RI ; 7 '1$ OLJDVH EXIIHU P0 7ULV+&O S+ P0 0J&O P0 1D&O PJPO ERYLQH VHUXP DOEXPLQ P0 3PHUFDSWRHWKDQRO P0 $73 P0 GLWKLWKUHLWRO P0 VSHUPLGLQHf SL RI VWHULOH GG+ DQG SL RI 7 '1$ OLJDVH 8f IRU KRXUV DW r& 7ZR SL RI WKH OLJDWLRQ UHDFWLRQ ZHUH XVHG WR WUDQVIRUP PO RI ( FROL FRPSHWHQW FHOOV ,19D)f VWUDLQ LQ WKH SUHVHQFH RI PO RI 0 3PHUFDSWRHWKDQRO IRU PLQXWHV RQ LFH 7KH WUDQVIRUPDWLRQ UHDFWLRQ ZDV WKHQ KHDW VKRFNHG IRU VHFRQGV DW r& DQG SL RI 62& PHGLXP b WU\SWRQH b \HDVW H[WUDFW P0 1D&O P0 .& P0 0J&O P0 JOXFRVH S+ f ZHUH DGGHG 7KLV PL[WXUH ZDV LQFXEDWHG DW r& IRU RQH KRXU LQ D URWDU\ VKDNHU DW USP $IWHU WKLV WLPH SL RI WKH EDFWHULD VROXWLRQ ZHUH SODWHG XVLQJ D JODVV VSUHDGHU RQ <7 b EDFWRWU\SWRQH b \HDVW H[WUDFW b 1D&O S+ f DJDU SODWH b %DFWRDJDU DGGHGf VXSSOHPHQWHG ZLWK SJPO RI DPSLFLOOLQ DQG FRYHUHG ZLWK SL RI %URPR&KORURLQGRO\O3'JDODFWRVLGH ; JDOf PJPOf DQG LQFXEDWHG DW r& RYHUQLJKW ;JDO LV D VXEVWUDWH IRU 3 JDODFWRVLGDVH DQG ZKHQ WKLV JHQH LV SUHVHQW LQ WKH YHFWRU 3JDODFWRVLGDVH PHWDEROL]HV ; JDO D EOXH SURGXFW LV IRUPHG DQG WKH FRORQ\ EHFRPHV EOXH ,I DQ LQVHUW LV SUHVHQW LQ WKH

PAGE 31

SODVPLG WKH 3JDODFWRVLGDVH JHQH LV GLVUXSWHG ;JDO LV QRW PHWDEROL]HG DQG WKH FRORQ\ UHPDLQV ZKLWH 5HSRUWHU 9HFWRU &ORQLQJ $ NE (FR5 ,(DJ IUDJPHQW RI n QRQFRGLQJ VHTXHQFH ZDV LVRODWHG IURP WKH NE 0Q62' JHQRPLF FORQH )LJXUH f DQG WKH n RYHUKDQJ HQGV ILOOHG LQ XVLQJ WKH ODUJH IUDJPHQW RI ( FROL '1$ SRO\PHUDVH .OHQRZ IUDJPHQWf 7KH UHVXOWLQJ EOXQWHQG (FR(DJ IUDJPHQW ZDV FORQHG LQWR WKH +LH ,, SRO\OLQNHU VLWH LQ D SURPRWHUOHVV S8& EDVHG KXPDQ JURZWK KRUPRQH H[SUHVVLRQ YHFWRU S*+ 6HOGHQ HW DO f FUHDWLQJ D NE SODVPLG UHIHUUHG WR DV (FR( *+ )LJXUH f 7KH XQLTXH UHVWULFWLRQ HQ]\PH VLWH +LQGOOO ZDV XWLOL]HG WR GHOHWH D .E SRUWLRQ RI WKH 0Q62' (FR( VHTXHQFH FUHDWLQJ WKH YHFWRU +LQG( .XR HW DO )LJXUH f 7R WHVW IRU QRQVSHFLILF HIIHFWV RI WKH LQIODPPDWRU\ PHGLDWRUV RQ K*+ H[SUHVVLRQ ZH XVHG DQ K*+ H[SUHVVLRQ YHFWRU WKDW FRQWDLQHG WKH KHUSHV VLPSOH[ WK\PLGLQH NLQDVH PLQLPDO SURPRWHU S7.*+ 6HOGHQ HW DO f 7R LGHQWLI\ SRVVLEOH UHJXODWRU\ HOHPHQWV LQ WKH UHPDLQGHU RI 0Q62' WKDW PLJKW LQWHUDFW ZLWK WKH n SURPRWHU ZH FORQHG DQ LQWHUQDO NE +LQG ,,, IUDJPHQW WR f IURP WKH UDW JHQRPLF FORQH LQWR WKH +LQGO8 VLWH RI WKH +LQG( *+ YHFWRU FUHDWLQJ D NE YHFWRU )LJXUH f 7KH VDPH +LQG ,,, IUDJPHQW ZDV FORQHG LQWR +LQG( *+ LQ WKH RSSRVLWH RULHQWDWLRQ 7R EHJLQ WR ORFDOL]H REVHUYHG HQKDQFHU HIIHFWV ZH UHPRYHG WKH +LQG ,,,+SD IUDJPHQW WR f DQG WKH +SD ,+LQG ,,, IUDJPHQW WR f IURP WKH +LQG ,,, IUDJPHQW LQ ERWK RULHQWDWLRQV FUHDWLQJ HQKDQFHU GHOHWLRQV RI .E RU .E LQ WKH +LQG( *+ FRQVWUXFW )LJXUH f 7R FODULI\ WKH SRVLWLRQ RI WKH HQKDQFHU ZLWKLQ WKH NE IUDJPHQW VHULDO f DQG f GHOHWLRQV RI WKH DUHD ZHUH SHUIRUPHG

PAGE 32

E\ FUHDWLQJ 3&5 SURGXFWV )LJXUH f ZKLFK ZHUH VXEVHTXHQWO\ FORQHG LQWR WKH +LQG( *+ YHFWRU DW WKH +LQGOOO VLWH RU 1GHO VLWH 2OLJRQXFOHRWLGHV IODQNLQJ WKH UHJLRQV RI LQWHUHVW ZHUH GHVLJQHG FRQWDLQLQJ HLWKHU +LQGL,, RU 1GHO VLWHV IRU FRQYHQLHQW OLJDWLRQ LQWR WKH UHVWULFWLRQ VLWHV 7R WHVW ZKHWKHU WKH HQKDQFHU DFWLYLW\ ZDV VSHFLILF WR WKH 0Q62' SURPRWHU ZH XVHG WKH SODVPLG 7.*+ ZKLFK FRQWDLQV D KHWHURORJRXV 7$7$ FRQWDLQLQJ QRQ*&ULFK SURPRWHU 7KH NE +LQG ,,, 0Q62' JHQRPLF IUDJPHQW WR f ZDV FORQHG LQWR WKH +LQGOOO VLWH )LJXUH f LQ WKH 7.*+ SRO\OLQNHU LQ ERWK RULHQWDWLRQV 7R HYDOXDWH WKH LQWHUDFWLRQ RI WKH SURPRWHU ZLWK WKH HQKDQFHU IUDJPHQW WKH ES )LJXUH f IUDJPHQW RI 0Q62' FRQWDLQLQJ WKH HQWLUH HQKDQFHU UHJLRQ ZDV OLJDWHG LQWR WKH 1GHO VLWH RI WKH SURPRWHU GHOHWLRQ FRQVWUXFWV )LJXUH f &RPSDULVRQ RI WKH UDW HQKDQFHU VHTXHQFH ZLWK WKH DQDORJRXV UHJLRQ LQ KXPDQ 0Q62' UHYHDOHG D KLJK GHJUHH RI KRPRORJ\ LQ LQWURQ 3&5 DPSOLILFDWLRQ RI D ES IUDJPHQW WR KXPDQ PDQJDQHVH 62' DFFHVVLRQ 6f IURP KXPDQ JHQRPLF '1$ ZLWK SULPHUV f &*77$*7**777*&$&$$**$$*$7$$7&* f DQG f **&7&7*$77&&$&$$*7$$$**$&7* f WR FUHDWH D IUDJPHQW ZKLFK ZDV LQVHUWHG LQWR 1GHO VLWH RI WKH 7.*+ YHFWRU LQ ERWK RULHQWDWLRQV 3ODVPLG 3XULILFDWLRQ )RU VPDOO VFDOH SODVPLG LVRODWLRQ WKH 4,$SUHS 6SLQ PLQLSUHS IURP 4LDJHQ ZDV XVHG $ VLQJOH EDFWHULDO FRORQ\ IURP <7 DJDU SODWHV ZLWK DPSLFLOOLQ ZDV XVHG WR LQRFXODWH PO RI <7 PHGLD b EDFWRWU\SWRQH b \HDVW H[WUDFW b 1D&O S+ f VXSSOHPHQWHG ZLWK SJPO RI DPSLFLOOLQ DQG JURZQ RYHUQLJKW DW r& LQ D URWDU\ ZDWHU EDWK VKDNHU 3ODVPLGV ZHUH H[WUDFWHG XVLQJ WKH 4,$SUHS 6SLQ 0LQLSUHS NLW IROORZLQJ WKH PDQXIDFWXUHUfV SURWRFRO %DFWHULD IURP PO RI <7 FXOWXUH ZHUH FROOHFWHG E\

PAGE 33

FHQWULIXJDWLRQ DW [ J IRU PLQXWHV UHVXVSHQGHG LQ SL RI UHVXVSHQVLRQ EXIIHU P0 7ULV+&O S+ P0 ('7$ SJPO 51DVHf O\VHG ZLWK SL RI O\VLV EXIIHU P0 1D2+ b 6'6f QHXWUDOL]HG DQG DGMXVWHG WR KLJKVDOW ELQGLQJ FRQGLWLRQV ZLWK SL RI QHXWUDOL]DWLRQ EXIIHU 0 SRWDVVLXP DFHWDWH S+ f DQG FHQWULIXJHG IRU PLQXWHV DW [ J DW r& 7KH VXSHUQDWDQW ZDV DSSOLHG WR D 4,$SUHS VLOLFDJHO PHPEUDQH FROXPQ $ YDFXXP PDQLIROG ZDV XVHG IRU WKH IROORZLQJ VWHSV )LUVW WKH VXSHUQDWDQW ZDV GUDZQ WKURXJK WKH FROXPQ XVLQJ WKH YDFXXP PDQLIROG 7KH FROXPQ ZDV ZDVKHG RQFH ZLWK SL ZDVK EXIIHU P0 7ULV+&O b HWKDQROf FRQWDLQLQJ FKDRWURSKLF VDOWV DQG RQFH ZLWK SL ZDVK EXIIHU P0 7ULV+&O b HWKDQROf 7KH FROXPQ ZDV WKHQ FHQWULIXJHG DW [ J IRU PLQXWHV DW URRP WHPSHUDWXUH 7KH SODVPLG '1$ ZDV HOXWHG IURP WKH FROXPQ ZLWK DGGLWLRQ RI SL RI 7( EXIIHU P0 7ULV+&O S+ P0 ('7$f DQG FHQWULIXJDWLRQ DW [ J IRU RQH PLQXWH DW URRP WHPSHUDWXUH LQWR D FOHDQ '1DVHIUHH HSSHQGRUI WXEH )RU ODUJH VFDOH SODVPLG LVRODWLRQ D 4,$*(1 SODVPLG PD[L NLW ZDV XVHG 2QH PO RI D VLQJOH FRORQ\ RYHUQLJKW OLTXLG FXOWXUH PO <7DPSLFLOOLQf ZDV LQRFXODWHG LQ PO KLJK FRS\ SODVPLGf RI <7 PHGLD VXSSOHPHQWHG ZLWK SJPO RI DPSLFLOOLQ DQG JURZQ RYHUQLJKW DW r& LQ D URWDU\ ZDWHU EDWK VKDNHU %DFWHULD ZHUH FROOHFWHG E\ FHQWULIXJDWLRQ [ J PLQXWHV r&f SHOOHWV ZHUH UHVXVSHQGHG LQ PO RI UHVXVSHQVLRQ EXIIHU P0 7ULV+&O S+ P0 ('7$ SJPO 51DVHf O\VHG ZLWK PO RI O\VLV EXIIHU P0 1D2+ b 6'6f DQG LQFXEDWHG IRU PLQXWHV DW URRP WHPSHUDWXUH QHXWUDOL]HG E\ DGGLWLRQ RI FKLOOHG r&f QHXWUDOL]DWLRQ EXIIHU 0 SRWDVVLXP DFHWDWH S+ f LQFXEDWHG RQ LFH IRU PLQXWHV DQG FHQWULIXJHG DW [ J IRU PLQXWHV DW r& 7KH VXSHUQDWDQW ZDV UHPRYHG IURP WKH FHQWULIXJDWLRQ WXEH ZLWK D VWHULOH WUDQVIHU

PAGE 34

SLSHWWH DQG DOORZHG WR IORZ WKURXJK E\ JUDYLW\ RQ D 4,$*(1WLS FROXPQ WKDW KDG EHHQ SUHYLRXVO\ HTXLOLEUDWHG ZLWK PO RI HTXLOLEUDWLRQ EXIIHU P0 1D&O P0 0236 S+ b LVRSURSDQRO b 7ULWRQ ;f 7KH IORZWKURXJK ZDV GLVFDUGHG DQG WKH FROXPQ ZDV ZDVKHG WZLFH ZLWK PO RI ZDVK EXIIHU 0 1D&O P0 1 PRUKROLQRfSURSDQH VXOIRQLF DFLG 0236f S+ b LVRSURSDQROf E\ JUDYLW\ IORZ 3ODVPLG '1$ ZDV HOXWHG IURP WKH FROXPQ ZLWK PO RI HOXWLRQ EXIIHU 0 1D&O P0 7ULV+&O S+ b LVRSURSDQROf 7KH '1$ SUHVHQW LQ WKH HOXDWH ZDV SUHFLSLWDWHG ZLWK YROXPHV POf RI LVRSURSDQRO DQG FROOHFWHG E\ FHQWULIXJDWLRQ [ J PLQXWHV r&f 7KH SHOOHW ZDV ZDVKHG RQFH ZLWK PO RI b HWKDQRO DQG FHQWULIXJDWLRQ ZDV UHSHDWHG [ J PLQXWHV r&f 7KH ILQDO SHOOHW ZDV UHVXVSHQGHG LQ SL RI 7( EXIIHU 3ODVPLG '1$ FRQFHQWUDWLRQ ZDV HVWLPDWHG E\ PHDVXULQJ WKH DEVRUEDQFH DW QP LQ D %HFNPDQ '8 6SHFWURSKRWRPHWHU %HFNPDQ ,QVWUXPHQWV ,QF )XOOHUWRQ &$f RI ZDWHU GLOXWLRQV f IURP HDFK VDPSOH $Q DEVRUEDQFH RI DW QP FRUUHVSRQGV WR PJ RI GRXEOHVWUDQGHG '1$ 7KH UDWLR EHWZHHQ WKH UHDGLQJV WDNHQ DW QP DQG QP $$f SURYLGHG DQ HVWLPDWH RI '1$ SXULW\ f 7\SLFDO \LHOG GHSHQGHG RQ WKH VL]H RI WKH SODVPLG EXW UDQJHG IURP SJ RI SODVPLG '1$ IRU 4,$SUHS 6SLQ PLQLSUHSV DQG SJ IRU PD[LVL]H SUHSDUDWLRQV 7UDQVLHQW 7UDQVIHFWLRQ RI 0DPPDOLDQ &HOOV / FHOOV D UDW SXOPRQDU\ HSLWKHOLDOOLNH FHOO OLQH $7&& &&/ f ZHUH JURZQ LQ +DPfV PRGLILHG ). PHGLXP *,%&2f ZLWK b IHWDO ERYLQH VHUXP )ORZ /DERUDWRULHVf $%$0 SHQLFLOOLQ 8PO VWUHSWRP\FLQ PJPO DPSKRWHULFLQ % PJPO 6LJPDf DQG P0 JOXWDPLQH DW r& LQ URRP DLU b &2 7R FRQWURO IRU

PAGE 35

WUDQVIHFWLRQ HIILFLHQF\ WUDQVIHFWLRQV ZHUH FDUULHG RXW XVLQJ D EDWFK WUDQVIHFWLRQ PHWKRG &HOOV ZHUH JURZQ DV PRQROD\HUV RQ PP WLVVXH FXOWXUH SODWHV XQWLO b FRQIOXHQW 7KH FHOOV ZHUH WUDQVIHFWHG ZLWK PJ RI HDFK H[SUHVVLRQ YHFWRU XVLQJ WKH '($(GH[WUDQ PHWKRG .ULHJOHU HW DO f $IWHU K FHOOV IURP HDFK PP EDWFK WUDQVIHFWHG SODWH ZHUH WU\SVLQL]HG SRROHG DQG SODWHG RQWR IRXU VHSDUDWH PP WLVVXH FXOWXUH SODWHV ,QIODPPDWRU\ PHGLDWRUV ZHUH DGGHG WR WKH PHGLXP RI HDFK SODWH K ODWHU ZLWK ILQDO FRQFHQWUDWLRQV RI SJPO (VFKHULFKLD FROL OLSRSRO\VDFFKDULGH /36 ( FROL VHURW\SH % 6LJPDf QJPO 71)D RU QJPO ,/OS 7ZHQW\IRXU KRXUV ODWHU WRWDO 51$ ZDV LVRODWHG IURP WKH FHOO PRQROD\HUV IRU QRUWKHUQ DQDO\VLV 51$ ,VRODWLRQ 7RWDO FHOOXODU 51$ ZDV LVRODWHG DFFRUGLQJ WR WKH SURFHGXUH GHVFULEHG E\ &KRPF]\QVNL DQG 6DFFKL f ZLWK PRGLILFDWLRQV 9LVQHU HW DO f %ULHIO\ WKH PRQROD\HU FHOOV / FHOOV RU 9$ FHOOVf FXOWXUHG DV QRWHG DERYH ZHUH ZDVKHG RQFH ZLWK URRP WHPSHUDWXUH 3%6 DQG WKHQ PO PP WLVVXH FXOWXUH SODWH RI JXDQLGLQLXP WKLRF\DQDWH VROXWLRQ 0 JXDQLGLQLXP WKLRF\DQDWH P0 VRGLXP FLWUDWH S+ b VDUFRV\O DQG 0 PHUFDSWRHWKDQROf ZHUH DGGHG 7KH KRPRJHQDWH ZDV FROOHFWHG LQ D PO FRQLFDO SRO\SURS\OHQH WXEH DQG H[WUDFWHG ZLWK YROXPH RI 0 VRGLXP DFHWDWH S+ DQG DQ HTXDO YROXPH RI ZDWHUVDWXUDWHG SKHQRO 7KLV VXVSHQVLRQ ZDV PL[HG WRJHWKHU DQG FRROHG RQ LFH IRU DW OHDVW PLQXWHV %HIRUH FHQWULIXJDWLRQ DW [ J IRU PLQXWHV DW r& YROXPHV RI FKORURIRUPLVRDP\O DOFRKRO ,$$f f ZHUH DGGHG DQG WKH PL[WXUH ZDV VKDNHQ YLJRURXVO\ IRU VHFRQGV $IWHU FHQWULIXJDWLRQ WKH DTXHRXV SKDVH ZDV WUDQVIHUUHG WR D IUHVK FHQWULIXJDWLRQ WXEH DQG PL[HG ZLWK DQ HTXDO YROXPH RI LVRSURSDQRO 7KLV VROXWLRQ ZDV SODFHG DW r& IRU DW OHDVW KRXU DQG WKHQ FHQWULIXJHG DW

PAGE 36

[ J IRU PLQXWHV DW r& 7KH 51$ SHOOHW ZDV UHVXVSHQGHG LQ SL RI JXDQLGLQLXP WKLRF\DQDWH VROXWLRQ DQG WUDQVIHUUHG WR D PO PLFURIXJH WXEH $Q HTXDO YROXPH RI LVRSURSDQRO ZDV DGGHG DQG WKH PL[WXUH ZDV LQFXEDWHG IRU DW OHDVW DQ KRXU DW r& 51$ ZDV FROOHFWHG E\ FHQWULIXJDWLRQ DW [ J IRU PLQXWHV DW r& DQG SL RI '(3&WUHDWHG ZDWHU ZDV DGGHG WR WKH SHOOHW DQG LQFXEDWHG DW r& IRU PLQXWHV 7KH 51$ ZDV SUHFLSLWDWHG ZLWK YROXPH RI '(3&WUHDWHG 0 VRGLXP DFHWDWH S+ DQG YROXPHV RI b HWKDQRO IROORZHG E\ LQFXEDWLRQ DW r& IRU DW OHDVW DQ KRXU 7KH 51$ ZDV FROOHFWHG DJDLQ E\ FHQWULIXJDWLRQ UHVXVSHQGHG LQ SL RI '(3&WUHDWHG ZDWHU DQG HWKDQRO SUHFLSLWDWHG RQH PRUH WLPH 7KH ILQDO SHOOHW ZDV GULHG LQ D 6DYDQW VSHHGYDFXXP FHQWULIXJH WR UHPRYH DQ\ WUDFH DPRXQWV RI HWKDQRO DQG WKHQ UHVXVSHQGHG LQ '(3&WUHDWHG ZDWHU 51$ FRQFHQWUDWLRQ ZDV HVWLPDWHG E\ PHDVXULQJ WKH DEVRUEDQFH DW QP LQ D %HFNPDQ '8 6SHFWURSKRWRPHWHU %HFNPDQ ,QVWUXPHQWV ,QF )XOOHUWRQ &$f RI WZR ZDWHU GLOXWLRQV f IURP HDFK VDPSOH $Q DEVRUEDQFH RI DW QP FRUUHVSRQGV WR SJ RI 51$ 7KH UDWLR EHWZHHQ WKH UHDGLQJV WDNHQ DW QP DQG QP $$f SURYLGHG DQ LQGLFDWLRQ RI 51$ SXULW\ f 7\SLFDO 51$ \LHOG IRU / FHOOV RU 9$ FHOOV ZDV SJ SHU b FRQIOXHQW PP WLVVXH FXOWXUH SODWH 1RUWKHUQ $QDO\VLV 51$ ZDV VL]HIUDFWLRQDWHG IRU KRXUV DW YROWV RQ D b 6HDNHP +*7 DJDURVH JHO FRQWDLQLQJ b IRUPDOGHK\GH P0 0236 S+ P0 VRGLXP DFHWDWH S+ DQG P0 ('7$ S+ ZLWK FRQVWDQW EXIIHU UHFLUFXODWLRQ )RU HDFK ODQH RI WKH JHO WZHQW\ SJ RI WRWDO 51$ ZHUH GULHG DQG UHVXVSHQGHG LQ PO RI 0 IRUPDPLGH b IRUPDOGHK\GH P0 VRGLXP DFHWDWH S+ P0 ('7$ S+ P0 1

PAGE 37

PRUKROLQRfSURSDQH VXOIRQLF DFLG 0236f S+ 7KLV 51$ ZDV GLVVROYHG DQG KHDWHG E\ LQFXEDWLRQV IRU PLQXWHV DW r& WKHQ IRU PLQXWHV DW r& $ SL DOLTXRW RI ORDGLQJ G\H b [\OHQH F\DQRO )) b EURPRSKHQRO EOXH P0 ('7$ S+ b JO\FHURO SJSO HWKLGLXP EURPLGHf ZDV DGGHG SULRU WR ORDGLQJ WKH JHO 7R FRQILUP WKDW HTXDO DPRXQWV RI 51$ KDG EHHQ ORDGHG LQWR HDFK ODQH DIWHU HOHFWURSKRUHVLV HDFK JHO ZDV SKRWRJUDSKHG XQGHU 89 OLJKW DQG WKH OHYHO RI ULERVRPDO 51$ DVVHVVHG E\ WKH HWKLGLXP EURPLGH VWDLQLQJ (WKLGLXP EURPLGH ZDV SUHVHQW LQ WKH ORDGLQJ G\H DQG 51$ FRXOG EH YLVXDOL]HG SURPSWO\ XQGHU 89 OLJKW DIWHU HOHFWURSKRUHVLV 7KH JHO ZDV WKHQ WUHDWHG IRU PLQXWHV ZLWK P0 1D2+ PLQXWHV ZLWK P0 7ULV+&O S+ DQG WZLFH IRU PLQXWHV ZLWK P0 7%( P0 7ULV+&O S+ P0 ('7$ S+ f 7KH 51$ ZDV HOHFWRWUDQVIHUUHG WR D SRVLWLYHO\FKDUJHG Q\ORQ PHPEUDQH LQ P0 7%( IRU PLQXWHV DQG WKHQ FRYDOHQWO\ FURVVOLQNHG WR WKH PHPEUDQH ZLWK 89 OLJKW &KXUFK DQG *LOEHUW f *HQRPLF '1$ ,VRODWLRQ )RU JHQRPLF '1$ LVRODWLRQ / FHOOV ZHUH JURZQ LQ FP WLVVXH FXOWXUH SODWHV XQWLO b FRQIOXHQW ZDVKHG RQFH ZLWK 3%6 DQG O\VHG ZLWK PO O\VLV VROXWLRQ P0 7ULV+&O S+ P0 ('7$ S+ P0 1D&O b 6'6 SJPO 3URWHLQDVH .f 7KH O\VDWH ZDV LQFXEDWHG RYHUQLJKW RQ D URFNLQJ SODWIRUP DW URRP WHPSHUDWXUH $IWHU WKLV LQFXEDWLRQ WKH O\VDWH ZDV WKHQ H[WUDFWHG RQFH ZLWK HTXDO YROXPH RI 7ULVHTXLOLEUDWHG SKHQRO IRU DW OHDVW KRXU DW URRP WHPSHUDWXUH RQ D URFNLQJ SODWIRUP 7KH SKDVHV ZHUH VHSDUDWHG E\ FHQWULIXJDWLRQ DW [ J IRU PLQXWHV DW URRP WHPSHUDWXUH 7KH XSSHU DTXHRXV SKDVH ZDV WUDQVIHUUHG ZLWK D VWHULOH ODUJHERUH WUDQVIHU SLSHWWH WR D QHZ WXEH 7KHQ WKH O\VDWH ZDV H[WUDFWHG RQFH ZLWK DQ HTXDO YROXPH RI

PAGE 38

SKHQROFKORURIRUPLVRDP\O DOFRKRO ,$$f f DQG RQFH ZLWK FKORURIRUP,$$ ZLWK LQFXEDWLRQV RI DW OHDVW RQH KRXU DW URRP WHPSHUDWXUH RQ D URFNLQJ SODWIRUP DQG FHQWULIXJDWLRQV DW [ J IRU PLQXWHV DW URRP WHPSHUDWXUH WR VHSDUDWH WKH SKDVHV $IWHU VHSDUDWLRQ RI WKH SKDVHV LQ WKH FKRORUIRUP,$$ H[WUDFWLRQ PO RI 51DVH $ 8POf ZDV DGGHG WR WKH O\VDWH IRU GLJHVWLRQ RI FRQWDPLQDQW 51$ DQG WKH PL[WXUH ZDV LQFXEDWHG RYHUQLJKW DW URRP WHPSHUWXUH RQ D URFNLQJ SODWIRUP 7KH O\VDWH ZDV H[WUDFWHG DJDLQ RQFH ZLWK SKHQROFKORURIRUP,$$ DQG RQFH ZLWK FKORURIRUP,$$ DV DERYH '1$ ZDV SUHFLSLWDWHG IURP WKH DTXHRXV SKDVH E\ DGGLWLRQ RI SL 0 1D&O WR ILQDO FRQFHQWUDWLRQ RI 0 DQG YROXPHV POf RI LFHFROG b HWKDQRO 7KH FRWWRQn OLNH '1$ ZDV FROOHFWHG ZLWK D VHDOHG EHQW JODVV 3DVWHXU SLSHWWH ZDVKHG E\ ULQVLQJ WKH '1$ ZLWK PO RI FKLOOHG r&f b HWKDQRO DQG UHVXVSHQGHG LQ SL RI 7( EXIIHU P0 7ULV+&O S+ P0 ('7$ S+ f (OHFWURSKRUHWLF 0RELOLW\ 6KLIW $VVD\ (06$f (06$ ZHUH SHUIRUPHG DV SUHYLRXVO\ GHVFULEHG )ULHG DQG &URWKHUV f ZLWK PJ QXFOHDU H[WUDFW SUHSDUHG IURP FRQWURO DQG /36 71)D RU ,/LSWUHDWHG / FHOOV E\ KLJK VDOW H[WUDFWLRQ $QGUHZV DQG )DOOHU f %LQGLQJ UHDFWLRQV ZHUH FDUULHG RXW DW URRP WHPSHUDWXUH LQ P0 +(3(6 1>+\GUR[\HWK\O@SLSHUD]LQH1f> HWKDQHVXOIRQLF DFLG@f.2+ S+ P0 .& ,P0 GLWKLRWKUHLWRO P0 0J&K P0 ('7$ DQG b JO\FHURO WR \LHOG D ILQDO YROXPH RI SL (06$ SUREHV ZHUH PDGH IURP FORQHG 3&5 SURGXFWV RI WKH GHILQHG HQKDQFHU UHJLRQ EHWZHHQ DQG DQG HQGODEHOHG E\ ILOOLQJ WKH UHFHVVHG f WHUPLQL RI (FR5, GLJHVWHG IUDJPHQWV ZLWK 3 G$73 XVLQJ WKH ODUJH IUDJPHQW RI ( FROL '1$ SRO\PHUDVH .OHQRZ IUDJPHQWf )UDJPHQWV XVHG LQ (06$V ZHUH ES WR f ES WR f

PAGE 39

ES WR f ES WR f DQG ES WR f 1XPEHUV VKRZQ LQ SDUHQWKHVHV UHIHU WR VHTXHQFH LQ WKH UDW 0Q62' JHQH DFFHVVLRQ ;f ,Q 9LYR '06 7UHDWPHQW / FHOOV ZHUH FXOWXUHG DV GHVFULEHG DERYH LQ PP WLVVXH FXOWXUH SODWHV 7KH PHGLXP ZDV UHPRYHG E\ DVSLUDWLRQ DQG WKH FHOOV ZDVKHG RQFH ZLWK URRP WHPSHUDWXUH SKRVSKDWH EXIIHUHG VDOLQH 3%6 P0 VRGLXP SKRVSKDWH S+ DQG P0 1D&Of 7KH 3%6 EXIIHU ZDV UHPRYHG DQG UHSODFHG ZLWK URRP WHPSHUDWXUH 3%6 FRQWDLQLQJ bb GHPHWK\O VXOIDWH '06 $OGULFKf IRU PLQ 7KH 3%6 FRQWDLQLQJ '06 ZDV UDSLGO\ UHPRYHG VHFRQGVf DQG WKH FHOO PRQROD\HU ZDVKHG WZLFH ZLWK r& 3%6 WR TXHQFK WKH '06 UHDFWLRQ 7KH FHOOV ZHUH O\VHG LQ PO RI O\VLV VROXWLRQ P0 7ULV S+ P0 ('7$ S+ P0 1D&O b 6'6 SJPO 3URWHLQDVH .f IROORZHG E\ LQFXEDWLRQ RYHUQLJKW DW URRP WHPSHUDWXUH RQ D URFNLQJ SODWIRUP *HQRPLF '1$ ZDV WKHQ SXULILHG E\ SKHQROFKORURIRUP H[WUDFWLRQV (DFK VDPSOH ZDV H[WUDFWHG RQFH ZLWK DQ HTXDO YROXPH RI 7ULVHTXLOLEUDWHG SKHQRO IROORZHG E\ WZR H[WUDFWLRQV ZLWK D YYYf PL[WXUH RI 7ULVHTXLOLEUDWHG SKHQROFKORURIRUPLVRDP\O DOFRKRO DQG ILQDOO\ E\ RQH H[WUDFWLRQ ZLWK D YYf PL[WXUH RI FKORURIRUPLVRDP\O DOFRKRO (DFK H[WUDFWLRQ ZDV SHUIRUPHG IRU DW OHDVW DQ KRXU RQ D URFNLQJ SODWIRUP SULRU WR FROOHFWLRQ RI DTXHRXV SKDVH 7KH DTXHRXV SKDVH ZDV FROOHFWHG HDFK WLPH E\ FHQWULIXJDWLRQ DW [ J IRU PLQXWHV DW URRP WHPSHUDWXUH DQG HWKDQRO SUHFLSLWDWHG 6DPSOHV ZHUH WKHQ WUHDWHG ZLWK SJPO 51DVH $ RUJDQLF H[WUDFWHG DV DERYH HWKDQRO SUHFLSLWDWHG DQG VXVSHQGHG LQ 7( P0 7ULV S+ DQG P0 ('7$f 7KH '1$ VDPSOHV ZHUH GLJHVWHG ZLWK %DP+ UHVWULFWLRQ HQGRQXFOHDVH HQ]\PH DQG VWUDQG FOHDYDJH DW PRGLILHG JXDQLQH UHVLGXHV ZDV DFKLHYHG E\ WUHDWPHQW ZLWK 0 SLSHULGLQH )LVKHU 6FLHQWLILFf DW

PAGE 40

r& IRU PLQXWHV 1DNHG JHQRPLF '1$ ZDV LVRODWHG DQG SXULILHG IURP FHOOV ZLWKRXW DQ\ '06 WUHDWPHQW DQG GLJHVWHG ZLWK UHVWULFWLRQ HQGRQXFOHDVH HQ]\PH %DP+O 1HZ (QJODQG %LRODEVf $V D FRQWURO JHQRPLF '1$ ZDV H[WUDFWHG LQ WKH VDPH ZD\ IURP FHOOV LQFXEDWHG LQ +DPfV ). PHGLXP IRU RU KRXUV EXW QRW WUHDWHG ZLWK '06 2QH KXQGUHG SJ RI WKLV fQDNHGf '1$ ZDV UHVWULFWLRQ GLJHVWHG ZLWK %DP+O $IWHU GLJHVWLRQ '1$ ZDV H[WUDFWHG RQFH ZLWK SKHQRFKORURIRUP,$$ RQFH ZLWK FKORURIRUP,$$ DQG HWKDQRO SUHFLSLWDWHG ZLWK YROXPHV RI b HWKDQRO DQG 0 DPPRQLXP DFHWDWH LQFXEDWLQJ DW r& IRU PLQXWHV '1$ ZDV FROOHFWHG E\ FHQWULIXJDWLRQ DW [ J IRU PLQXWHV DW r& DQG ZDVKHG WZLFH ZLWK b HWKDQRO DQG FHQWULIXJDWLRQ DW [ J IRU PLQXWHV DW r& $IWHU O\RSKLOL]LQJ WKH SHOOHW '1$ ZDV UHVXVSHQGHG LQ SL RI VWHULOH ZDWHU 7KH LQ YLWUR '06 WUHDWPHQW RI WKH QDNHG '1$ UHFRYHUHG IURP GLJHVWLRQ RI %DP+O ZDV GRQH DV GHVFULEHG E\ 0D[DP DQG *LOEHUW f ZLWK VRPH PRGLILFDWLRQ 1DNHG '1$ SJf LQ SL RI ZDWHU ZDV DGGHG WR SL RI '06 EXIIHU P0 VRGLXP FDFRG\ODWH 0 ('7$ S+ f WUHDWHG IRU VHFRQGV ZLWK SL bf RI '06 DQG LPPHGLDWHO\ SUHFLSLWDWHG ZLWK DGGLWLRQ RI 0 DPPRQLXP DFHWDWH WR WKH ILQDO FRQFHQWUDWLRQ RI 0 SJ RI ( FROL W51$ DQG YROXPHV RI b LFHFROG HWKDQRO $IWHU LQFXEDWLRQ LQ D GU\ LFHHWKDQRO EDWK IRU DW OHDVW PLQXWHV '1$ ZDV FROOHFWHG E\ FHQWULIXJDWLRQ DW [ J IRU PLQXWHV DW r& UHVXVSHQGHG LQ SL RI FRPPRQ UHDJHQW 0 DPPRQLXP DFHWDWH P0 ('7$ S+ f DQG SUHFLSLWDWHG DJDLQ E\ DGGLWLRQ RI SJ RI W51$ DQG SL RI LFHFROG b HWKDQRO $IWHU LQFXEDWLRQ IRU PLQXWHV LQ WKH GU\ LFHHWKDQRO EDWK '1$ ZDV FROOHFWHG E\ FHQWULIXJDWLRQ DW [ J IRU PLQXWHV DW r& DQG ZDVKHG WZLFH ZLWK b HWKDQRO ZLWK

PAGE 41

FHQWULIXJDWLRQ DV DERYH $IWHU O\RSKLOL]DWLRQ WKH ILQDO '1$ SHOOHW ZDV UHVXVSHQGHG LQ SL RI VWHULOH ZDWHU 2QFH WKH '06PRGLILHG '1$ ERWK LQ YLYR DQG LQ YLWURWUHDWHG VDPSOHVf ZHUH SUHFLSLWDWHG DQG UHGLVVROYHG LQ ZDWHU DSSUR[LPDWHO\ PJ LQ PO RI VWHULOH ZDWHUf DV GHVFULEHG WKH '1$ ZDV PL[HG ZLWK PO RI SLSHULGLQH 0f DQG LQFXEDWHG DW r& IRU PLQXWHV WR FOHDYH WKH '1$ DW WKH PRGLILHG JXDQLQH UHVLGXHV 0D[DP DQG *LOEHUW f '1$ ZDV WKHQ HWKDQRO SUHFLSLWDWHG FROOHFWHG E\ FHQWULIXJDWLRQ DW [ J DW r& IRU PLQXWHV ZDVKHG WZLFH ZLWK b HWKDQRO O\RSKLOL]HG DQG WKHQ UHVXVSHQGHG DQG O\RSKLOL]HG WKUHH PRUH WLPHV LQ SL RI VWHULOH ZDWHU $IWHU WKH ODVW O\RSKLOL]DWLRQ '1$ ZDV UHVXVSHQGHG LQ SL RI 7( EXIIHU /LJDWLRQ0HGLDWHG 3&5 /03&5f /03&5 ZDV EHJXQ E\ DQQHDOLQJ SPRO RI SULPHU WR SJ RI '06PRGLILHG DQG SLSHULGLQH FOHDYHG '1$ IRU HDFK VDPSOH LQ ; 9HQW SRO\PHUDVH EXIIHU P0 .& P0 1+f6 P0 7ULV+&O S+ f P0 0J6 b 7ULWRQ ;f LQ D WRWDO YROXPH RI PO ZLWK GHQDWXUDWLRQ DW r& IRU PLQXWHV IROORZHG E\ SULPHU DQQHDOLQJ DW r& IRU PLQXWHV 3ULPHU LV WKH SULPHU IRU WKH NQRZQ VLWH RI WKH FOHDYHG '1$ DQG LV D V\QWKHWLF VLQJOH VWUDQGHG ROLJRQXFOHRWLGH 7KH ILUVW VWUDQG SULPHUV XWLOL]HG IRU ERWWRP VWUDQG f**$7$$&777****$*77**77&f DQG f *$$7$$7*77$*&&*7*7&7&7***f DV ZHOO DV IRU WKH WRS VWUDQG f &&$$&&777***77&7&&$&f 7KH ILUVW VWUDQG V\QWKHVLV ZDV SHUIRUPHG LQ ; 9HQW SRO\PHUDVH EXIIHU ZLWK P0 0J6 P0 RI HDFK G173 DQG 8 RI 9HQW '1$ SRO\PHUDVH 7KH VDPSOHV ZHUH LQFXEDWHG IRU PLQXWH HDFK DW r& r& r&

PAGE 42

r& r& r& r& IROORZHG E\ LQFXEDWLRQV IRU PLQXWHV HDFK DW r& +RPVWUD DQG
PAGE 43

FHQWULIXJDWLRQ [ J PLQXWHV r&f ZDVKHG RQFH ZLWK b HWKDQRO DQG DJDLQ '1$ FROOHFWHG DIWHU FHQWULIXJDWLRQ [ J PLQXWHV r&f O\RSKLOL]HG DQG UHVXVSHQGHG LQ PO RI VWHULOH ZDWHU $IWHU OLJDWLRQ RI WKH OLQNHU WKH QHVWHG VHW RI OLQHDU JHQRPLF '1$ IUDJPHQWV IURP WKH UHJLRQ RI LQWHUHVW ZHUH DPSOLILHG E\ 3&5 XVLQJ D VHFRQG JHQHVSHFLILF ROLJRQXFOHRWLGH SULPHU WHUPHG SULPHU f****$*77**77&7&7&&777&$&7* f DQG f *&&*7*7&7&7***77$*&7*7$77*& f UHVSHFWLYHO\ IRU ERWWRP VWUDQGV DQG f&&$$&&777***77&7&&$&f IRU WKH WRS VWUDQG DV ZHOO DV WKH FRPSOHPHQWDU\ SULPHU WR WKH PHU OLQNHUSULPHU f &*&&$&7***&&&7&7$*$&77$$*ff 3&5 FRQGLWLRQV ZHUH WKH VDPH IRU ERWK '1$ VWUDQGV DQG VHWV RI SULPHUV DV GHVFULEHG E\ +RPVWUD DQG
PAGE 44

7DT '1$ SRO\PHUDVH EXIIHU DQG 8 RI 7DT '1$ SRO\PHUDVH ZDV DGGHG 6DPSOHV ZHUH WKHQ LQFXEDWHG DW r& IRU PLQXWHV WR HQVXUH IXOO H[WHQVLRQ RI HDFK WHPSODWH VWUDQG DQG DGGLWLRQ RI D VLQJOH GHR[\DGHQRVLQH QXFOHRWLGH WR WKH HQG RI HYHU\ IUDJPHQW $IWHU WKLV LQFXEDWLRQ VDPSOHV ZHUH SODFHG RQ LFH DQG PO RI 0 ('7$ ZDV DGGHG WR VWRS WKH UHDFWLRQ 7KH '1$ ZDV SUHFLSLWDWHG E\ DGGLWLRQ RI 0 DPPRQLXP DFHWDWH WR D ILQDO FRQFHQWUDWLRQ RI 0 SJ RI W51$ DQG YROXPHV RI b HWKDQRO DQG LQFXEDWLRQ DW r& IRU PLQXWHV '1$ ZDV FROOHFWHG E\ FHQWULIXJDWLRQ [ J r& PLQXWHVf ZDVKHG WZLFH ZLWK b HWKDQRO DQG FROOHFWHG DJDLQ E\ FHQWULIXJDWLRQ [ J r& PLQXWHVf O\RSKLOL]HG DQG UHVXVSHQGHG LQ SL RI ZDWHU )ROORZLQJ /03&5 DPSOLILFDWLRQ RI WKH JHQRPLF '1$ IUDJPHQWV IURP WKH UHJLRQ RI LQWHUHVW WKH fIRRWSULQWf LV YLVXDOL]HG E\ JHQRPLF VHTXHQFLQJ &KXUFK DQG *LOEHUW f )RU WKLV SURWRFRO D SL DOLTXRW RI HDFK /03&5 VDPSOH LV GULHG LQ D YDFXXP FRQFHQWUDWRU DQG UHGLVVROYHG LQ SL RI IRUPDPLGHG\H VROXWLRQ b IRUPDPLGH b [\OHQH F\DQRO b EURPRSKHQRO EOXH DQG ; 7%( P0 7ULVEDVH P0 ERULF DFLG P0 1D('7$ )/2f 6DPSOHV ZHUH WKHQ ORDGHG RQWR D 0 XUHD b /RQJ 5DQJHU SRO\DFU\ODPLGH 7%( P0 7ULVEDVH P0 ERULF DFLG P0 ('7$f '1$ VHTXHQFLQJ JHO FHQWLPHWHUV ORQJf DQG VL]HIUDFWLRQDWHG ZLWK 7%( P0 7ULVEDVH P0 ERULF DFLG P0 ('7$f DV WDQN EXIIHU DW : IRU KRXUV 7KH 3&5 IUDJPHQWV ZHUH WKHQ HOHFWURWUDQVIHUUHG DV GHVFULEHG LQ +RPVWUD DQG
PAGE 45

PHPEUDQH FRQWDLQLQJ WKH HOHFWURWUDQVIHUUHG '1$ ZDV WKHQ K\EULGL]HG ZLWK D 3UDGLR ODEHOHG ROLJRQXFOHRWLGH SRVLWLRQHG LQWHUQDO WR SULPHU FDOOHG SULPHU 7KH ROLJRQXFOHRWLGH ZDV 3UDGLRODEHOHG DV GHVFULEHG DERYH IRU ROLJRQXFOHRWLGH SUREHV DQG VHSDUDWHG IURP WKH IUHH UDGLRODEHOHGQXFOHRWLGH XVLQJ WKH 4,$TXLFN 1XFOHRWLGH 5HPRYDO NLW IURP 4LDJHQ DV IROORZV 7KH 7 SRO\QXFOHRWLGH NLQDVH ODEHOLQJ UHDFWLRQ ZDV DGGHG WR YROXPHV RI 4LDJHQ 31 EXIIHU LQ WKH NLW DQG SDVVHG WKURXJK D 4,$TXLFN FROXPQ %RXQG '1$ ZDV ZDVKHG WZLFH ZLWK D EXIIHU FRQWDLQLQJ b HWKDQRO DQG HOXWHG ZLWK SL RI 7( EXIIHU 7KH UHVXOWLQJ DXWRUDGLRJUDSK RI WKLV SUHOLPLQDU\ JHO ZDV XVHG DV D ORDGLQJ FRQWURO WR REWDLQ GDWD IRU PRUH DGHTXDWH ORDGLQJ RI WKH ILQDO JHO LQ ZKLFK WKH DPRXQW RI HDFK VDPSOH ORDGHG ZDV DGMXVWHG WR REWDLQ HTXDO VLJQDO LQWHQVLW\ LQ DOO ODQHV DQG WKH ILQDO JHO ZDV UXQ LQ WKH VDPH ZD\ EXW ZLWK RQO\ WZR VDPSOHV RI HDFK WUHDWPHQW 6LWH'LUHFWHG 0XWDJHQHVLV DQG 6XEVWLWXWLRQV E\ 3&5 7KH WHFKQLTXH RI PXWDJHQHVLV E\ RYHUODS H[WHQVLRQ RU VLWHGLUHFWHG PXWDJHQHVLV XVLQJ 3&5 KDV EHHQ SUHYLRXVO\ GHVFULEHG +R HW DO f 7KH PHWKRG HPSOR\V 3&5 DV D PHDQV RI FUHDWLQJ DOWHUHG '1$ IUDJPHQWV IURP FORQHG '1$ LQ D YHFWRU ZLWK HVVHQWLDOO\ b HIILFLHQF\ DQG LQ YHU\ IHZ VWHSV 7ZR LQVLGH SULPHUV 3ULPHU DQG 3ULPHU f DUH GHVLJQHG IRU HDFK PXWDWLRQ )RU EDVH PXWDWLRQ WKH LQVLGH SULPHUV DUH PLVPDWFKHG WR WKH WDUJHW VHTXHQFH DW WKH PXWDWHG EDVH 7ZR 3&5 UHDFWLRQV )LJXUH f SHUIRUPHG DV GHVFULEHG ZHUH UXQ WR JHQHUDWH WKH WZR RYHUODSSLQJ SURGXFWV RQH UHDFWLRQ XVLQJ SULPHU 3f DQG WKH f SULPHU 3f XVHG WR DPSOLI\ WKH RULJLQDO ZLOGW\SH ES FRQVWUXFW DQG WKH RWKHU UHDFWLRQ XVLQJ SULPHU 3f DQG WKH f SULPHU 3,f XVHG WR DPSOLI\ WKH RULJLQDO ZLOGW\SH ES FRQVWUXFW 7KH 3&5 DPSOLFRQV ZHUH DJDURVH JHOSXULILHG XVLQJ WKH

PAGE 46

4,$TXLFN *HO ([WUDFWLRQ NLW WR UHPRYH WKH RULJLQDO 3&5 SULPHUV ZKLFK PLJKW LQWHUIHUH ZLWK WKH VXEVHTXHQW UHDFWLRQ %HFDXVH WKH PXWDJHQHVLV SULPHUV DUH FRPSOHPHQWDU\ WR )LUVW 3&5 5HDFWLRQV f§ f ff§ 3, 3 f f 3 ,7f S$ f f )LUVW &\FOH ([WHQVLRQ &\FOHV 9 f n f 7777 77 UPr f 3, f 3 f f f f )LJXUH 6FKHPDWLF UHSUHVHQWDWLRQ RI 3&5EDVHG PXWDJHQHVLV

PAGE 47

HDFK RWKHU WKH WZR RYHUODSSLQJ IUDJPHQWV FDQ EH IXVHG LQ D VXEVHTXHQW H[WHQVLRQ UHDFWLRQ 7KH RYHUODSSLQJ JHOSXULILHG SURGXFWV DSSUR[ QJf ZHUH XVHG DV '1$ WHPSODWHV IRU D VHFRQG 3&5 UHDFWLRQ DQG WKH 3&5 UHDFWLRQ FRQGLWLRQV ZHUH WKH VDPH DV GHVFULEHG SUHYLRXVO\ XVLQJ WKH f 3,f DQG f 3f SULPHUV XVHG WR DPSOLI\ WKH RULJLQDO ZLOGW\SH ES 0Q62' HQKDQFHU IUDJPHQW ZKLFK FRQWDLQV 1GHO VLWHV DW ERWK HQGV ,Q WKH ILUVW URXQG RI GHQDWXUDWLRQDQQHDOLQJH[WHQVLRQ RI WKH VHFRQG 3&5 UHDFWLRQ WKH WZR 3&5 UHDFWLRQ SURGXFWV XVHG DV WHPSODWHV ZKLFK DUH WKH WZR RYHUODSSLQJ SDUWV RI WKH ILQDO DPSOLFRQ ZHUH GHQDWXUHG DQG DQQHDOHG WR HDFK RWKHU IRUPLQJ WKH WZR SRVVLEOH KHWHURGXSOH[ SURGXFWV ZLWK UHFHVVHG f HQGV WKDW ZHUH VXEVHTXHQWO\ H[WHQGHG E\ 9HQW '1$ SRO\PHUDVH WR SURGXFH D SURGXFW WKDW ZDV WKH VXP RI WKH WZR RYHUODSSLQJ SURGXFWV DQG FRQWDLQLQJ WKH PXWDWLRQ 7KLV SURGXFW EHFDPH WKH WHPSODWH IRU WKH VHFRQG 3&5 UHDFWLRQ DQG LW ZDV DPSOLILHG E\ F\FOHV RI GHQDWXUDWLRQDQQHDOLQJH[WHQVLRQ UHVXOWLQJ LQ PXOWLSOH FRSLHV RI WKH IXOOOHQJWK SURGXFW FRQWDLQLQJ WKH PXWDWLRQ 7KH 3&5 SURGXFW ZDV FORQHG ZLWK WKH XVH RI WKH 3&5 6FULSW &ORQLQJ 6\VWHP 6WUDWDJHQHf DQG SRVLWLYH FRORQLHV ZHUH LGHQWLILHG E\ WKH SUHVHQFH RI D ES UHVWULFWLRQ IUDJPHQW ZKHQ WKH YHFWRU ZDV GLJHVWHG ZLWK 1GHO 7KH GLJHVWHG IUDJPHQW ZDV DJDURVH JHO SXULILHG XVLQJ 4,$TXLFN *HO ([WUDFWLRQ NLW DQG WKH LVRODWHG '1$ IUDJPHQW ZDV FORQHG LQWR WKH 1GHO VLWH RI D OLQHDUL]HG &,3WUHDWHG K*+ YHFWRU FRQWDLQLQJ WKH PLQLPDO 0Q62' SURPRWHU .XR XQSXEOLVKHG GDWDf 7KH GLUHFWLRQDOLW\ RI WKH PXWDJHQL]HG HQKDQFHU IUDJPHQW ZDV FKHFNHG E\ 3&5 XVLQJ SULPHUV VSHFLILF WR WKH HQKDQFHU IUDJPHQW DQG D SULPHU VSHFLILF WR WKH YHFWRU 'LUHFWLRQDOLW\ DQG PXWDWLRQV ZHUH DOVR FKHFNHG E\ GLUHFW '1$ VHTXHQFLQJ 7KH ILQDO UHSRUWHU JHQH SODVPLGV FRQWDLQLQJ WKHVH VLWHGLUHFWHG

PAGE 48

PXWDQW 3&5 IUDJPHQWV ZHUH JURZQ LQ PO '1D ( FROL LVRODWHG ZLWK D 4LDJHQ 3ODVPLG 0D[L NLW DQG WKHQ XVHG IRU WUDQVLHQW WUDQVIHFWLRQV LQ / FHOOV DV GHVFULEHG DERYH 5DGLRODEHOHG 3UREH 6\QWKHVLV )RU UDGLRODEHO K\EULGL]DWLRQ RI 89FURVVOLQNHG 51$ RQ SRVLWLYHO\FKDUJHG Q\ORQ PHPEUDQHV WKH F'1$ 0Q62' K*+ RU &DWKHSVLQ %f ZDV UDGLRODEHOHG XVLQJ D UDQGRP SULPHU '1$ ODEHOLQJ V\VWHP *LEFR %5/ *DLWKHUVEXUJ 0'f DV IROORZV QJ RI '1$ LQ SL RI GG+ ZHUH ERLOHG IRU PLQXWHV DQG SL RI WKH UDQGRP SULPHUVEXIIHU VROXWLRQ 0 +(3(6 0 7ULV+&O P0 0J&O P0 PHUFDSWRHWKDQRO PJPO %6$ 2'R XQLWVPO ROLJRGHR[\ULERQXFOHRWLGH SULPHUV KH[DPHUVf S+ f ZHUH DGGHG WRJHWKHU ZLWK SL RI HDFK G&73 G773 DQG G*73 P0 LQ 7ULV+&O S+ ff SL .OHQRZ IUDJPHQW 8f DQG SL RI >D3@G$73 S&Lf 7KH ODEHOLQJ SURFHVV ZDV DOORZHG WR SURFHHG IRU KRXUV DW URRP WHPSHUDWXUH 7KH XQLQFRUSRUDWHG QXFOHRWLGHV ZHUH UHPRYHG E\ SDVVLQJ WKH ODEHOLQJ UHDFWLRQ RYHU D 6HSKDGH[ FROXPQ XVLQJ 7( EXIIHU ZLWK P0 1D&O DV HOXWLRQ EXIIHU 7KH SUREH ZDV LQFXEDWHG IRU ILYH PLQXWHV LQ ERLOLQJ ZDWHU EHIRUH EHLQJ DGGHG WR WKH PHPEUDQH DQG K\EULGL]DWLRQ VROXWLRQ :KHQ WKH UDGLRODEHOHGSUREH ZDV DQ ROLJRQXFOHRWLGH IRU K\EULGL]DWLRQ IRU LQ YLYR IRRWSULQWLQJ DQDO\VHVf WKH ODEHOLQJ ZDV GRQH E\ SKRVSKRU\ODWLRQ ZLWK EDFWHULRSKDJH 7 SRO\QXFOHRWLGH NLQDVH DV GHVFULEHG LQ 6DPEURRN HW DO f ZLWK VRPH PRGLILFDWLRQV %ULHIO\ SPRO RI ROLJRQXFOHRWLGH ZHUH LQFXEDWHG ZLWK S&L RI >\3@$73 P0 7ULV+&O S+ P0 '77 P0 0J&O DQG XQLWV RI 7 SRO\QXFOHRWLGH NLQDVH LQ D WRWDO YROXPH RI SL IRU PLQXWHV DW r& 7KH 3UDGLRODEHOHG ROLJRQXFOHRWLGH ZDV VHSDUDWHG IURP WKH IUHH UDGLRODEHOHGQXFOHRWLGH E\ SUHFLSLWDWLRQ ZLWK DGGLWLRQ RI

PAGE 49

0 1D&O WR WKH ILQDO FRQFHQWUDWLRQ RI 0 SJ RI W51$ DQG YROXPHV RI b HWKDQRO IROORZHG E\ LQFXEDWLRQ DW r& IRU PLQXWHV 7KH SUHFLSLWDWHG SUREH ZDV FROOHFWHG E\ FHQWULIXJDWLRQ DW [ J IRU PLQXWHV DW URRP WHPSHUDWXUH UHVXVSHQGHG LQ SL RI 7( EXIIHU DQG DGGHG WR WKH PHPEUDQH K\EULGL]DWLRQ VROXWLRQ DIWHU LQFXEDWLQJ LQ ERLOLQJ ZDWHU IRU PLQXWHV +\EULGL]DWLRQ RI 1RUWKHUQ DQG 6RXWKHUQ %ORWV 0HPEUDQHV ZHUH SUHK\EULGL]HG ZLWK PO RI K\EULGL]DWLRQ VROXWLRQ 0 VRGLXP SKRVSKDWH S+ b 6'6 P0 ('7$ S+ b %6$f IRU DW OHDVW PLQXWHV DQG WKHQ WKH SUREH ZDV DGGHG DIWHU ERLOLQJ IRU PLQXWHV $IWHU DQ RYHUQLJKW LQFXEDWLRQ DW r& WKH EORWV ZHUH ZDVKHG WLPHV IRU PLQXWHV ZLWK HDFK ZDVK WHPSHUDWXUH DW r& LQ D KLJKVWULQJHQF\ EXIIHU 0 VRGLXP SKRVSKDWH S+ P0 ('7$ S+ b 6'6f EORWWHG GU\ RQ :KDWPDQ ILOWHU SDSHU DQG H[SRVHG WR ILOP :KHQ WKH SUREH ZDV DQ ROLJRQXFOHRWLGH WKH LQFXEDWLRQ RYHUQLJKW ZDV DW r& WKH ZDVKLQJ WHPSHUDWXUH ZDV r& DQG WKH KLJKVWULQJHQF\ ZDVK EXIIHU KDG WKH 1D FRQFHQWUDWLRQ DGMXVWHG WR P0 ZLWK 0 1D&O $IWHU ZDVKLQJ WKH PHPEUDQH ZDV VXEMHFWHG WR DXWRUDGLRJUDSK\ E\ H[SRVXUH WR +\SHUILOP 03 $PHUVKDP3KDUPDFLD 3LVFDWDZD\ 1-f 7KH H[SRVHG ILOP ZDV VFDQQHG XVLQJ D +HZOHWW3DFNDUG 6FDQ-HW F7 LQWR $GREH 3KRWRVKRS $GREH 6\VWHPV ,QFRUSRUDWHG 6DQ -RVH &$f FRPSXWHU VRIWZDUH IRU FUHDWLRQ RI WKH ILJXUHV GLVSOD\HG LQ WKLV GLVVHUWDWLRQ PDGH LQ 0LFURVRIW 2IILFH 3RZHUSRLQW 0LFURVRIW &RUSRUDWRQ 5HGPRQG :$f

PAGE 50

&+$37(5 &<72.,1(,1'8&,%/( (1+$1&(5 :,7+ 352027(5 $&7,9,7< ,1 %27+ 7+( 5$7 $1' +80$1 0$1*$1(6( 683(52;,'( ',6087$6( *(1(6 ,QWURGXFWLRQ 7KH VXSHUR[LGH GLVPXWDVHV 62'Vf DUH WKH ILUVW OLQH RI FHOOXODU GHIHQVH DJDLQVW WKH GDPDJLQJ HIIHFWV RI VXSHUR[LGH DQLRQ UDGLFDOV +DOOLZHOO DQG *XWWHULGJH f 0DQJDQHVH VXSHUR[LGH GLVPXWDVH 0Q62'f LV WKH PRVW KLJKO\ UHJXODWHG RI WKH WKUHH 62'V 9LVQHU HW DO 'RXJDOO DQG 1LFN f EHLQJ ORFDOL]HG WR PLWRFKRQGULD 6X]XNL HW DO 'HO 0DHVWUR DQG 0F'RQDOG f DQG FRQIHUULQJ SRWHQW F\WRSURWHFWLRQ 6KXOO HW DO :RQJ DQG *RHGGHO :RQJ HW DO 9LVQHU HW DO (DVWJDWH HW DO $NDVKL HW DO 0DQJDQDUR HW DO %DNHU HW DO f 0XOWLSOH VWXGLHV KDYH VKRZQ WKDW LQFUHDVHG FHOOXODU OHYHOV RI 0Q62' DUH F\WRSURWHFWLYH GXULQJ FHOOXODU R[LGDWLYH VWUHVV 6KXOO HW DO f RU LQIODPPDWRU\ FKDOOHQJHV VXFK DV 71)DPHGLDWHG DSRSWRVLV :RQJ DQG *RHGGHO :RQJ HW DO f ,/ F\WRWR[LFLW\ 9LVQHU HW DO f LRQL]LQJ UDGLDWLRQ (DVWJDWH HW DO $NDVKL HW DO f DQG QHXURWR[LFLW\ 0DQJDQDUR HW DO %DNHU HW DO f 7KH UROH RI 0Q62' DV D SRWHQW F\WRSURWHFWLYH HQ]\PH LV PRVW VWULNLQJO\ LOOXVWUDWHG LQ WKUHH WUDQVJHQLF PRGHO VWXGLHV 7KH ILUVW WUDQVJHQLF PRGHO LQYROYHV WDUJHWHG RYHUH[SUHVVLRQ RI 0Q62' LQ WKH SXOPRQDU\ HSLWKHOLXP RI PLFH UHVXOWLQJ LQ D GHFUHDVHG OHYHO RI LQIODPPDWLRQ DV D FRQVHTXHQFH RI D K\SHUR[LF H[SRVXUH :LVSH HW DO f ,Q WKH VHFRQG VWXG\ WKH SK\VLRORJLFDO LPSRUWDQFH RI WKLV JHQH LV EHVW H[HPSOLILHG WKURXJK JHQH DEODWLRQ ZKHUH 0Q62' NQRFNRXW PLFH PDQLIHVW VHYHUH GLODWHG FDUGLDF P\RSDWK\ DQG GLH

PAGE 51

ZLWKLQ WHQ GD\V RI ELUWK /L HW DO f 7KH WKLUG VWXG\ VKRZV WKDW WUHDWPHQW RI WKH 0Q62' NQRFNRXW PRXVH ZLWK WKH VXSHUR[LGH GLVPXWDVH PLPHWLF PDQJDQHVH WHWDNLV EHQ]RLF DFLGf SRUSK\ULQ UHVFXHV WKHVH PLFH IURP WKH V\VWHPLF WR[LFLW\ EXW DOORZV GHYHORSPHQW RI D VHYHUH QHXURGHJHQHUDWLYH GLVRUGHU E\ WKUHH ZHHNV RI DJH 0HORY HW DO f 3UHYLRXV LQYHVWLJDWLRQV IURP WKLV DQG RWKHU ODERUDWRULHV KDYH HVWDEOLVKHG WKDW OHYHOV RI VWHDG\ VWDWH 0Q62' P51$ DQG SURWHLQ LQFUHDVH IROORZLQJ H[SRVXUH WR EDFWHULDO OLSRSRO\VDFFKDULGH /36f WXPRU QHFURVLV IDFWRU 71)f DQG LQWHUOHXNLQ ,/f :RQJ DQG *RHGGHO 9LVQHU HW DO 9LVQHU HW DO 0HORY HW DO f 6WLPXOXVGHSHQGHQW LQFUHDVHV LQ P51$ OHYHOV DUH LQKLELWHG E\ DFWLQRP\FLQ 9LVQHU HW DO f VXJJHVWLQJ LQFUHDVHG WUDQVFULSWLRQ RI WKH JHQH ZKLFK KDV EHHQ FRQILUPHG E\ VXEVHTXHQW QXFOHDU UXQRQ VWXGLHV +VX f 5HVXOWV IURP '1DVH K\SHUVHQVLWLYH VWXGLHV DQDO\]LQJ WKH FKURPDWLQ VWUXFWXUH RI 0Q62' KDYH LGHQWLILHG PXOWLSOH UHJLRQV RI LQFUHDVHG QXFOHDVH DFFHVVLELOLW\ ORFDWHG WKURXJKRXW WKH JHQH DV ZHOO DV D VWLPXOXV GHSHQGHQW DOWHUDWLRQ LQ FKURPDWLQ VWUXFWXUH LQ WKH n IODQNLQJ UHJLRQ .XR HW DO f )XUWKHUPRUH GLPHWK\O VXOIDWH LQ YLYR IRRWSULQWLQJ VWXGLHV KDYH LGHQWLILHG WKH ELQGLQJ VLWHV IRU WHQ EDVDO SURWHLQ IDFWRUV ZKLFK LQWHUDFW ZLWK WKH SURPRWHU DV ZHOO DV VWLPXOXV GHSHQGHQW DOWHUDWLRQV LQ JXDQLQH UHVLGXH UHDFWLYLW\ QHDU WKH K\SHUVHQVLWLYH VLWH IRXQG RQO\ LQ VWLPXOXV WUHDWHG FHOOV .XR HW DO f 7R FRPSOHPHQW WKH SUHFHGLQJ VWXGLHV RQ FKURPDWLQ VWUXFWXUH DQG LQ YLYR IRRWSULQWLQJ IXQFWLRQDO VWXGLHV RI WKH SURPRWHU ZHUH SHUIRUPHG E\ DQDO\]LQJ GHOHWLRQV RI WKH f IODQNLQJ UHJLRQ 7KH SURPRWHU GHOHWLRQ GDWD VXJJHVW WKDW EDVDO SURPRWHU DFWLYLW\ UHTXLUHV RQO\ D YHU\ VPDOO SRUWLRQ RI WKH f IODQNLQJ UHJLRQ 7RJHWKHU WKHVH GDWD VXJJHVW WKDW PXOWLSOH SURWHLQ'1$ LQWHUDFWLRQV RFFXU GXULQJ

PAGE 52

WUDQVFULSWLRQ XQGHU EDVDO FRQGLWLRQV DQG WKDW WUHDWPHQW ZLWK LQIODPPDWRU\ PHGLDWRUV FDXVHV DQ DOWHUDWLRQ LQ FKURPDWLQ VWUXFWXUH LQ WKH SURPRWHU UHJLRQ RI WKH JHQH 1RW DOO FDFWLQJ UHJXODWRU\ HOHPHQWV DUH ORFDWHG LQ n IODQNLQJ UHJLRQV ,Q IDFW UHJXODWRU\ VHTXHQFHV KDYH EHHQ LGHQWLILHG ZLWKLQ LQWURQV RU LQ GLVWDQW n IODQNLQJ VHTXHQFHV RI WKH KXPDQ DQG PRXVH LPPXQRJOREXOLQ NDSSD JHQH 4XHHQ DQG %DOWLPRUH -XGG DQG 0D[ f SODWHOHWGHULYHG JURZWK IDFWRU JHQH 7DNLPRWR DQG .XUDPRWR f DOFRKRO GHK\GURJHQDVH6 &DOOLV HW DO f DQG FROODJHQ JHQHV 6LPNHYLFK HW DO f 7R LGHQWLI\ UHJLRQV RI 0Q62' WKDW UHJXODWH EDVDO DQG VWLPXODWHG H[SUHVVLRQ RXU SUHVHQW VWXG\ XWLOL]HG GHOHWLRQ DQDO\VLV RI UDW 0Q62' +XUW HW DO f FRXSOHG ZLWK WUDQVLHQW WUDQVIHFWLRQ VWXGLHV LQ D UDW OXQJ HSLWKHOLDO FHOO OLQH 0HDVXULQJ P51$ H[SUHVVLRQ OHYHOV RI WKH KXPDQ JURZWK KRUPRQH UHSRUWHU JHQH ZH KDYH ORFDOL]HG D FRPSOH[ HQKDQFHU HOHPHQW ZLWKLQ LQWURQ RI WKH UDW DQG D KRPRORJRXV UHJLRQ LQ LQWURQ RI WKH KXPDQ 0Q62' 0RVW LQWHUHVWLQJO\ WKLV UHJXODWRU\ HOHPHQW SRVVHVVHV WKH DELOLW\ WR SURPRWH F\WRNLQHLQGXFLEOH WUDQVFULSWLRQ LQGHSHQGHQW RI D SURPRWHU VHTXHQFH 5HVXOWV $Q ,QGXFLEOH &V$FWLQJ (QKDQFHU (OHPHQW ([LVWV ZLWKLQ 0Q62' 3UHYLRXV UHVXOWV RI VWHDG\VWDWH 0Q62' P51$ OHYHOV LQ UDW SXOPRQDU\ HSLWKHOLDO DQG HQGRWKHOLDO FHOOV GHPRQVWUDWHG GUDPDWLF LQGXFWLRQ ZLWK LQIODPPDWRU\ PHGLDWRUV 9LVQHU HW DO f ,Q DGGLWLRQ QXFOHDU UXQRQ H[SHULPHQWV VKRZHG WKDW VWLPXOXV GHSHQGHQW 0Q62' H[SUHVVLRQ LV DW OHDVW LQ SDUW D FRQVHTXHQFH RI GH QRYR WUDQVFULSWLRQ +VX f 0Q62' SURPRWHU GHOHWLRQ DQDO\VLV GHPRQVWUDWHG OHYHOV RI VWLPXOXV GHSHQGHQW 0Q62' H[SUHVVLRQ WKDW ZHUH IDU ORZHU WKDQ WKDW VHHQ ZLWK WKH HQGRJHQRXV

PAGE 53

VWHDG\VWDWH P51$ 7KH YHFWRU FRQVWUXFWV XVHG LQ WKH DQDO\VLV FRQWDLQHG RQO\ n IODQNLQJ VHTXHQFH LQFRUSRUDWLQJ RQO\ RQH RI WKH VHYHQ '1DVH K\SHUVHQVLWLYH VLWHV ZLWKLQ 0Q62' .XR HW DO f 7R GHWHUPLQH ZKHWKHU WKH UHPDLQLQJ '1DVH K\SHUVHQVLWLYH VLWHV ZLWKLQ 0Q62' FRQWDLQHG UHJXODWRU\ IXQFWLRQ ZH FUHDWHG K*+ H[SUHVVLRQ YHFWRUV WKDW FRPELQH ERWK WKH 0Q62' SURPRWHU D .E +LQGOOO WR (DJO IUDJPHQWf DQG D NE +LQGOOO IUDJPHQW FRQWDLQLQJ WKH UHPDLQLQJ '1DVH K\SHUVHQVLWLYH VLWHV )LJXUH f ([SUHVVLRQ RI K*+ LQ FHOOV WUDQVIHFWHG ZLWK WKHVH YHFWRUV ZDV FRPSDUHG LQ WKH VDPH H[SHULPHQWV WR H[SUHVVLRQ RI K*+ LQ FHOOV WUDQVIHFWHG ZLWK WKH YHFWRU FRQVWUXFW +LQG( *+ FRQWDLQLQJ RQO\ WKH n SURPRWHU IUDJPHQW 2I QRWH WKH GDWD GLVSOD\HG LQ )LJ DQG DOO VXEVHTXHQW ILJXUHV XVH QRUWKHUQ DQDO\VLV WR GLUHFWO\ DVVHVV WUDQVFULSWLRQ UDWHV IURP WKH WUDQVIHFWHG UHSRUWHU FRQVWUXFWV 7KLV LV GLVWLQFW IURP VWXGLHV ZKLFK DVVD\ UHSRUWHU SURWHLQ OHYHOV RU HQ]\PDWLF DFWLYLW\ WKDW PXVW WDNH LQWR FRQVLGHUDWLRQ SRWHQWLDO HIIHFWV RI VWLPXOL RQ WUDQVODWLRQ DQG SRVW WUDQVODWLRQDO HYHQWV $V VKRZQ LQ )LJ $ /36 WUHDWPHQW FDXVHG D GUDPDWLF HQKDQFHPHQW RI VWHDG\ VWDWH P51$ H[SUHVVLRQ DV D UHVXOW RI DGGLQJ WKH LQWHUQDO 0Q62' JHQRPLF IUDJPHQW LQ D PDQQHU LQGHSHQGHQW RI IUDJPHQW RULHQWDWLRQ 7KH VDPH UHVXOW ZDV REWDLQHG ZKHQ WUDQVIHFWHG FHOOV ZHUH VWLPXODWHG ZLWK 71)D RU ,/LS GDWD QRW VKRZQf )XUWKHUPRUH FOHDYDJH RI WKH NE +LQGOOO IUDJPHQW E\ PDNLQJ XVH RI WKH XQLTXH +SDO VLWH GHPRQVWUDWHG WKDW WKH GVDFWLQJ HOHPHQW UHVSRQVLEOH IRU WKH LQGXFLEOH DFWLYLW\ ZDV ORFDOL]HG WR WKH f NE SRUWLRQ RI WKH RULJLQDO +LQGOOO IUDJPHQW )LJXUH %f $JDLQ RULHQWDWLRQ GLG QRW LQIOXHQFH WKH LQGXFLEOH DFWLYLW\ LQ UHVSRQVH WR LQIODPPDWRU\

PAGE 54

0Q62' *HQRPLF &ORQH .E (FR5 ([RQV '1DVH +6 6LWHV +LQG ,,, (D6 .E ^ A)UDJPHQW L rrrr .E +LQG ,,, +SD +LQG ,,, ML_ r r rrrrrr (FR5 .E 0Q62' 3URPRWHU )UDJPHQW +LQG(f 1GH 7 +LQG ,77 (QKDQFHU )UDJPHQWV S_f*+ )LJXUH 6FKHPDWLF UHSUHVHQWDWLRQV DQG UHVWULFWLRQ PDSV RI WKH 0Q62' JHQRPLF FORQH DQG WKH H[SUHVVLRQ YHFWRUV FRQVWUXFWHG WR DVVHVV SRWHQWLDO HQKDQFHU DFWLYLW\ 7KH UHVWULFWLRQ HQ]\PH VLWHV DUH LQGLFDWHG DERYH WKH VHTXHQFH HJ +LQGL,,f 7KH H[SUHVVLRQ YHFWRUV FRQWDLQ WKH NE +LQGOOO IUDJPHQW IURP SRVLWLRQV WR RI 0Q62' ZLWK '1DVH, K\SHUVHQVLWLYH VLWHV r .XR HW DO f LQ HLWKHU WKH fWRf RU WKH f WRf RULHQWDWLRQ ,Q DGGLWLRQ HDFK H[SUHVVLRQ YHFWRU FRQWDLQV WKH 0Q62' f SURPRWHU VHTXHQFH IURP WKH +LQGOOO VLWH WR WKH (DJO VLWH +LQG(f 7KH +LQGOOO IUDJPHQW IURP SRVLWLRQV WR RI 0Q62' KDV EHHQ FXW DW SRVLWLRQ E\ +SDO GLJHVWLRQ FUHDWLQJ WKH NE DQG NE IUDJPHQWV 7KH +LQGOOO f WR +SDO f IUDJPHQW FRQWDLQV K\SHUVHQVLWLYH VLWHV DQG r .XR HW DO f 7KH +SDO f WR +LQGOOO f IUDJPHQW FRQWDLQV K\SHUVHQVLWLYH VLWHV DQG 7KHVH WZR IUDJPHQWV ZHUH WHVWHG LQ LQ WUDQVLHQW WUDQVIHFWLRQV DV ZDV WKH NE +LQGOOO IUDJPHQW 7KH UHVWULFWLRQ VLWHV +LQGOOO DQG 1GHOf LQWR ZKLFK WKH HQKDQFHU GHOHWLRQV ZHUH OLJDWHG DUH GHQRWHG RQ WKH K*+ YHFWRU ZKLFK DOVR FRQWDLQV WKH 0Q62' SURPRWHU +LQG(f 5HSURGXFHG ZLWK SHUPLVVLRQ IURP 5RJHUV HW DO f %LRFKHP k %LRFKHPLFDO 6RFLHW\

PAGE 55

+LQG( +LQG( 3URPRWHU DQG 3URPRWHU .E )UDJPHQW 2ULHQWDWLRQ $ORQH IRUZDUG UHYHUVH /36 f K*+ r &DWKHSVLQ % 0Q62' + ,, ,, +LQG( 3URPRWHU SOXV .E )UDJPHQW .E )UDJPHQW 2ULHQWDWLRQ /36 K*+ &DWKHSVLQ % 0Q62' IRUZDUG UHYHUVH IRUZDUG UHYHUVH + 0 0 D $ % )LJXUH K*+ P51$ OHYHOV DIWHU WUDQVIHFWLRQ LQ UDW OXQJ HSLWKHOLDO FHOOV ZLWK YHFWRUV FRQWDLQLQJ WKH LQWHUQDO +LQGOOO IUDJPHQW RI 0Q62' FRXSOHG WR WKH SURPRWHU YHUVXV 0Q62' SURPRWHU DORQH 1RUWKHUQ DQDO\VLV ZDV GRQH XVLQJ UDGLRODEHOHG SUREHV V\QWKHVL]HG IURP K*+ 0Q62' DQG FDWKHSVLQ % F'1$V DV GHVFULEHG LQ WKH 0HWKRGV VHFWLRQ K*+ P51$ H[SUHVVLRQ LQ UDW OXQJ HSLWKHOLDO FHOOV WUDQVIHFWHG ZLWK YHFWRUV FRQWDLQLQJ HLWKHU WKH NE RU WKH NE IUDJPHQWV ZKLFK DUH GHOHWLRQV RI WKH LQWHUQDO +LQGOOO IUDJPHQW RI 0Q62' 5HSURGXFHG ZLWK SHUPLVVLRQ IURP 5RJHUV HW DO f %LRFKHP k %LRFKHPLFDO 6RFLHW\

PAGE 56

PHGLDWRUV WKXV LQGLFDWLQJ WKDW WKH HOHPHQW FRXOG SDUWLDOO\ VDWLVI\ WKH GHILQLWLRQ RI DQ HQKDQFHU 7KH 0Q62' ,QGXFLEOH (QKDQFHU (OHPHQW ,V /RFDWHG ZLWKLQ ,QWURQ 7R IXUWKHU ORFDOL]H WKH LQGXFLEOH FLVDFWLQJ HOHPHQW ZLWKLQ WKH NE UHJLRQ D VHW RI VHULDO GHOHWLRQ IUDJPHQWV VSDQQLQJ WKLV UHJLRQ ZHUH DPSOLILHG E\ 3&5 XVLQJ FRPSOHPHQWDU\ ROLJRQXFOHRWLGHV DQG LQVHUWHG LQWR WKH 0Q62' SURPRWHU YHFWRU +LQG( *+ 'HOHWLRQV RI WKH IUDJPHQW IURP WKH f HQG DQG IURP WKH f HQG )LJ f ZHUH JHQHUDWHG LQ WKLV PDQQHU 7KH LQGXFLEOH HQKDQFHU DFWLYLW\ ZDV HYDOXDWHG E\ WUDQVLHQW WUDQVIHFWLRQV LQWR / FHOOV XVLQJ QRUWKHUQ DQDO\VLV %DVHG RQ WKH f GHOHWLRQV RI WKH NE +LQGOOO+SDO IUDJPHQW WKH HQKDQFHU DFWLYLW\ ZDV ORFDOL]HG WR D UHJLRQ RI DSSUR[LPDWHO\ ES LQ WKH f HQG RI WKLV .E IUDJPHQW )LJ f 7KLV SRVLWLRQ FRLQFLGHV H[WUHPHO\ ZHOO ZLWK '1DVH K\SHUVHQVLWLYH VLWH .XR HW DO f ORFDWHG QHDU WKH LQWURQ H[RQ ERXQGDU\ ,Q DQ HIIRUW WR ORFDOL]H WKH HQKDQFHU PRUH SUHFLVHO\ f GHOHWLRQV ZHUH DOVR FRQVWUXFWHG DV VKRZQ LQ )LJXUH 0XOWLSOH f DQG f GHOHWLRQV FRQWDLQLQJ WKH HQKDQFHU IUDJPHQW GHPRQVWUDWH LQGXFLEOH DFWLYLW\ FRPSDUDEOH WR WKH VWHDG\VWDWH P51$ OHYHOV RI WKH HQGRJHQRXV JHQH ,QWHUHVWLQJO\ WKH DQG ES GHOHWLRQV VKRZ UHGXFHG HQKDQFHU DFWLYLW\ UHODWLYH WR WKH ES IUDJPHQW DV VKRZQ LQ ILJXUH % WKXV IXUWKHU GHOLQHDWLQJ WKH HQKDQFHU DFWLYLW\ UHJXODWHG E\ /36 71)D DQG ,/LS WR ZLWKLQ D WR ES UHJLRQ QHDU WKH f HQG RI LQWURQ

PAGE 57

.E 5HVWULFWLRQ 6LWHV +LQGOOO .E .E +SDO +LQGL ,, ESO ES Q ESO ES +6 6LWHV ([RQ ES f f f X ([RQ ES ([RQ ES f ff fff +LQGO8-+SDO IUDJPHQW X! R R R U Rn S Fm .E .E + ES + ES .E ? ES ES + ES + ES a+ ES A )LJXUH 'HOHWLRQV RI WKH NE HQKDQFHU IUDJPHQW 6HULHO GHOHWLRQV IURP ERWK WKH f DQG f HQGV RI WKH NE IUDJPHQW ZHUH FUHDWHG E\ 3&5 DPSOLILFDWLRQ DQG OLJDWHG LQWR HLWKHU WKH +LQGL,, VLWH RU WKH 1GHO VLWH RI WKH +LQG( *+ YHFWRU VHH )LJXUH f 5HSURGXFHG ZLWK SHUPLVVLRQ IURP 5RJHUV HW DO f %LRFKHP k %LRFKHPLFDO 6RFLHW\ f 3&5 'HOHWLRQV

PAGE 58

)LJXUH 1RUWKHUQ DQDO\VLV RI WUDQVLHQW WUDQVIHFWLRQV RI WKH f 3&5 GHOHWLRQV RI WKH NE HQKDQFHU IUDJPHQW ORFDOL]HG WKH LQGXFLEOH DFWLYLW\ WR WKH ES NE IUDJPHQW 5HSURGXFHG ZLWK SHUPLVVLRQ IURP 5RJHUV HW DO f %LRFKHP -f k %LRFKHPLFDO 6RFLHW\

PAGE 59

+LQG( +LQG( 3URPRWHU SOXV f 'HOHWLRQ )UDJPHQWV $ORQH ES .E .E .E .E 2ULHQWDWLRQ IZG UHY IZG UHY IZG UHY IZG UHY IZG /36 K*+ L L L F I P 0Q62' &DWKHSVLQ % ‘ ‘ +LQG( +LQG( 3URPRWHU SOXV f 'HOHWLRQ )UDJPHQWV $ORQH ES ES .E ES.E 2ULHQWDWLRQ IZG UHY IZG UHY IZG UHY IZG UHY /36 L L L L L L L K*+ f ,, &DWKHSVLQ % 0Q62' PLLLP %

PAGE 60

)LJXUH 1RUWKHUQ DQDO\VLV RI WUDQVLHQW WUDQVIHFWLRQV RI WKH f 3&5 GHOHWLRQV RI WKH NE HQKDQFHU IUDJPHQW ORFDOL]HG WKH LQGXFLEOH DFWLYLW\ WR DQ DUHD EHWZHHQ WKH ES DQG WKH ES IUDJPHQWV LQ WKH f HQG RI WKH NE 3&5 IUDJPHQW 5HSURGXFHG ZLWK SHUPLVVLRQ IURP 5RJHUV HW DO f %LRFKHP -f k %LRFKHPLFDO 6RFLHW\

PAGE 61

+LQG( 3URPRWHU $ORQH RULHQWDWLRQ /36 +LQG( 3URPRWHU SOXV f )UDJPHQWV ES ES ES ES IZG UHY IZG UHY IZG UHY IZG UHY &DWKHSVLQ % +LQG( 3URPRWHU +LQG( 3URPRWHU SOXV f )UDJPHQWV $ORQH ES ES ES IRUZDUG IRUZDUG UHYHUVH IRUZDUG UHYHUVH 2ULHQWDWLRQ /36 K*+ r r &DWKHSVLQ % %

PAGE 62

7KH (QKDQFHU ,V /LNHO\ &RPSRVHG RI $ &RPSOH[ 6HW RI ,QWHUDFWLQJ (OHPHQWV 7R IXUWKHU ORFDOL]H WKH HQKDQFHU ZLWKLQ WKH f HQG RI LQWURQ DGGLWLRQDO GHOHWLRQ FRQVWUXFWV ZHUH FUHDWHG )LJ f 3&5 DPSOLILFDWLRQ ZDV XVHG WR JHQHUDWH D ES IUDJPHQW VSDQQLQJ WKH UHJLRQ EHWZHHQ WKH WZR f GHOHWLRQV VKRZQ LQ )LJXUH ES DQG ESf DV ZHOO DV WZR ES IUDJPHQWV ZKLFK RYHUODS HDFK RWKHU ZLWKLQ WKH ES IUDJPHQW )LJ f 7KH DELOLW\ RI WKHVH IUDJPHQWV WR FDXVH LQGXFLEOH H[SUHVVLRQ ZDV HYDOXDWHG E\ WUDQVLHQW WUDQVIHFWLRQ DQG QRUWKHUQ DQDO\VLV 7KH ES IUDJPHQW UHSURGXFHG WKH HQKDQFHU DFWLYLW\ VHHQ ZLWK WKH ODUJHU ES IUDJPHQW )LJ f ,Q DGGLWLRQ UHVSRQVH WR DOO WKH LQIODPPDWRU\ PHGLDWRUV /36 71)D DQG ,/f ZDV PDLQWDLQHG ,QWHUHVWLQJO\ WKH WZR RYHUODSSLQJ ES IUDJPHQWV VKRZ UHSURGXFLEO\ GLPLQLVKHG HQKDQFHU DFWLYLW\ DV FRPSDUHG WR WKH ES IUDJPHQW )LJ f 7KHVH UHVXOWV DUH FRQVLVWHQW ZLWK WKH SUHYLRXV GHOHWLRQ DQDO\VHV LQ )LJXUH ZKLFK VKRZHG SDUWLDO HQKDQFHU DFWLYLW\ LQ WKH ES IUDJPHQW FRPSDUHG WR WKH ES IUDJPHQW DQG ORVV RI DFWLYLW\ ZLWK WKH ES IUDJPHQW 7RJHWKHU WKH UHVXOWV VXPPDUL]HG LQ )LJXUHV DQG GHPRQVWUDWH WKDW WKH ES IUDJPHQW GHOLQHDWHV WKH PLQLPXP IXQFWLRQDO ERXQGDULHV RI WKH HQKDQFHU DORQJ ZLWK WKH FRPSOH[LW\ DQG LQWHUDFWLYH QDWXUH RI WKLV LPSRUWDQW UHJXODWRU\ VHTXHQFH DV GLVSOD\HG E\ WKH UHWHQWLRQ RI HQKDQFHU DFWLYLW\ LQ WKH ES IUDJPHQWV UHODWLYH WR WKH SURPRWHU DORQH 7R IXUWKHU DVVHVV WKH FRPSOH[LW\ RI WKH HQKDQFHU HOHPHQW HOHFWURSKRUHWLF PRELOLW\ VKLIW DVVD\V (06$f ZHUH SHUIRUPHG ZLWK QXFOHDU H[WUDFWV IURP FRQWURO DQG WUHDWHG /36 71)D ,/f FHOOV )LJXUH LOOXVWUDWHV WKH GLIIHUHQW SURWHLQ ELQGLQJ SDWWHUQV EHWZHHQ WUHDWHG DQG FRQWURO QXFOHDU H[WUDFWV DV ZHOO DV WKH GLIIHUHQW SDWWHUQV RI SURWHLQ ELQGLQJ EHWZHHQ WKH WZR IXQFWLRQDO '1$ IUDJPHQWV RI WKH HQKDQFHU HOHPHQW

PAGE 63

([RQ ([RQ ,QWURQ ‘ ,QWURQ N L ES nnM A (QKDQFHU )UDJPHQWV 8VHG LQ (06$ W ES 22 $$ $ ES $G (QKDQFHU )UDJPHQWV 8VHG LQ 7UDQVIHFWLRQV ES fRR$$ ES A$7$ L ES $ 2 ƒ2 )LJXUH 6FKHPDWLF RI WKH HQKDQFHU UHJLRQ LQ LQWURQ $ ES 3&5 IUDJPHQW RI WKH HQKDQFHU UHJLRQ WRWDOO\ FRQWDLQHG ZLWKLQ LQWURQ DQG WZR RYHUODSSLQJ ES 3&5 IUDJPHQWV HQFRPSDVVLQJ WKH ES UHJLRQ ZHUH FUHDWHG DQG OLJDWHG LQWR WKH 1GHO VLWH RI WKH +LQG( *+ YHFWRU VHH )LJ f IRU WUDQVLHQW WUDQVIHFWLRQ LQ UDW HSLWKHOLDO FHOOV DQG QRUWKHUQ DQDO\VLV ,Q DGGLWLRQ WR WKH ES IUDJPHQWV WKUHH RWKHU IUDJPHQWV DQG ESf ZHUH FUHDWHG E\ 3&5 DPSOLILFDWLRQ IRU (06$ 3XWDWLYH FRQVWLWXWLYH DQG LQGXFLEOH SURWHLQELQGLQJ VLWHV DUH LOOXVWUDWHG E\ RSHQ FLUFOHV DQG ILOOHG WULDQJOHV UHVSHFWLYHO\ 5HSURGXFHG ZLWK SHUPLVVLRQ IURP 5RJHUV HW DO f %LRFKHP -f k %LRFKHPLFDO 6RFLHW\

PAGE 64

)LJXUH $ 1RUWKHUQ DQDO\VLV RI WUDQVLHQW WUDQVIHFWLRQV RI WKH ES VHH )LJ f RU WKH ES IUDJPHQW ERWK RULHQWDWLRQVf LQ WKH +LQG( *+ YHFWRUV LQ FRQWURO /36 71) D DQG ,/OSVWLPXODWHG UDW SXOPRQDU\ HSLWKHOLDO FHOOV % 1RUWKHUQ DQDO\VLV RI WUDQVLHQW WUDQVIHFWLRQV RI WKH ES IUDJPHQW DQG ES IUDJPHQWV LQ WKH +LQG( *+ YHFWRUV LQ FRQWURO DQG /36VWLPXODWHG UDW SXOPRQDU\ HSLWKHOLDO FHOOV 5HSURGXFHG ZLWK SHUPLVVLRQ IURP 5RJHUV HW DO f %LRFKHP k %LRFKHPLFDO 6RFLHW\

PAGE 65

+LQG( 3URPRWHU +LQG( 3URPRWHU $ORQH SOXV (QKDQFHU )UDJPHQW 2ULHQWDWLRQ ES )RUZDUG ES ES )RUZDUG 5HYHUVH 6WLPXOXV Y A 6\ A 9 7 A K*+ ,0 rrrrrr fr PPP +0+ &DWKHSVLQ % rrrrrrr Z Z $ +LQG( 3URPRWHU $ORQH 2ULHQWDWLRQ /36 +LQG( 3URPRWHU SOXV (QKDQFHU )UDJPHQW ES E3 ES IZG UHY IZG UHY IZG UHY K*+ &DWKHSVLQ % %

PAGE 66

)LJXUH (06$ RI WKH WZR ES DV ZHOO DV WKH DQG ES IUDJPHQWV XVLQJ QXFOHDU H[WUDFWV IURP XQWUHDWHG FHOOV DQG FHOOV WUHDWHG ZLWK /36 71)D DQG ,/LS 2SHQ FLUFOHV UHIHU WR SXWDWLYH FRQVWLWXWLYH SURWHLQ ELQGLQJ DQG ILOOHG WULDQJOHV UHIHU WR SXWDWLYH LQGXFLEOH SURWHLQ ELQGLQJ 5HSURGXFHG ZLWK SHUPLVVLRQ IURP 5RJHUV HW DO f %LRFKHP -f k %LRFKHPLFDO 6RFLHW\

PAGE 67

'1$ )UDJPHQW 6WLPXOXV '1$ )UDJPHQW 6WLPXOXV f ES f ES U Rr ES ES ES $ Rr R $YY R: X ‘ L !+ O ,1 W r f L R ,88/ZXXPX8 r % 7 7

PAGE 68

&RQVWLWXWLYH SURWHLQ ELQGLQJ LV REVHUYHG LQ WKH f ES IUDJPHQW EXW VHYHUDO LQGXFLEOH ELQGLQJ SURWHLQV FDQ EH DSSUHFLDWHG LQ ERWK IUDJPHQWV ,Q DQ DWWHPSW WR IXUWKHU ORFDOL]H WKH SURWHLQ ELQGLQJ VLWHV VPDOOHU IUDJPHQWV RI WKH LQYROYHG UHJLRQ ZHUH JHQHUDWHG E\ 3&5 DQG HYDOXDWHG E\ (06$ )LJ f 2QFH DJDLQ FRQVWLWXWLYH SURWHLQ ELQGLQJ ZDV REVHUYHG LQ WZR RI WKH IUDJPHQWV ES DQG ESf +RZHYHU DV ZLWK WKH ES IUDJPHQW LQGXFLEOH SURWHLQ ELQGLQJ ZDV DOVR REVHUYHG LQ WZR RI WKH VPDOOHU IUDJPHQWV ES DQG ESf PRVW QRWDEO\ LQ WKH ES IUDJPHQW ZLWK D GUDPDWLF GLIIHUHQFH LQ ELQGLQJ EHWZHHQ FRQWURO DQG VWLPXODWHG QXFOHDU H[WUDFWV )XUWKHU ORFDOL]DWLRQ RI SURWHLQ ELQGLQJ ZDV DWWHPSWHG ZLWK ES DQG ES IUDJPHQWV IURP WKLV UHJLRQ KRZHYHU ZDV XQDEOH WR REWDLQ SURWHLQ'1$ LQWHUDFWLRQV ZKLFK GLVSOD\HG DQ\ VWLPXOXVVSHFLILF SDWWHUQ 5RJHUV GDWD QRW VKRZQf 8QOLNH WKH UHVXOWV ZLWK WKH ODUJHU IUDJPHQWV )LJ $ DQG %f (06$ ZLWK WKH VPDOOHU IUDJPHQWV ES DQG ESf VKRZHG RQO\ FRQVWLWXWLYH ELQGLQJ SDWWHUQV EHOLHYH WKDW PXOWLSOH SURWHLQSURWHLQ LQWHUDFWLRQV DUH OLNHO\ D SUHUHTXLVLWH IRU WKH VWLPXOXVVSHFLILF '1$ ELQGLQJ SDWWHUQ WKXV H[SODLQLQJ WKH ORVV RI VWLPXOXVVSHFLILF SURWHLQ'1$ LQWHUDFWLRQ LQ WKH VPDOOHU GHOHWLRQV RI WKLV FRPSOH[ UHJXODWRU\ HOHPHQW 7KH ,QGXFLEOH (QKDQFHU (OHPHQWV ZLWKLQ 5DW DQG +XPDQ 0Q62' &DQ $FW ZLWK D +HWHURORJRXV 3URPRWHU 7R GHWHUPLQH ZKHWKHU WKH 0Q62' HQKDQFHU FRXOG IXQFWLRQ ZLWK D KHWHURORJRXV SURPRWHU WKH HQKDQFHU IUDJPHQW ZDV FORQHG LQ ERWK RULHQWDWLRQV LQWR WKH 7.*+ H[SUHVVLRQ YHFWRU 7KH KHUSHV YLUXV WK\PLGLQH NLQDVH 7.f SURPRWHU LQ WKLV YHFWRU LV D ES PLQLPDO 7$7$FRQWDLQLQJ SURPRWHU TXLWH GLVVLPLODU WR WKH *&ULFK 7$7$ DQG &$$7OHVV 0Q62' SURPRWHU 5HVXOWV RI WUDQVLHQW WUDQVIHFWLRQV DQG QRUWKHUQ DQDO\VLV

PAGE 69

)LJXUH $ ,QWHUDFWLRQ RI WKH NE 0Q62' IUDJPHQW ZLWK WKH KHWHURORJRXV KHUSHV VLPSOH[ 7. SURPRWHU LQ WKH S7.*+ H[SUHVVLRQ YHFWRU ([SUHVVLRQ YHFWRUV S7.*+ DORQH DQG S7.*+ FRQWDLQLQJ WKH NE HQKDQFHU ERWK RULHQWDWLRQVf ZHUH FRQVWUXFWHG DQG D FRPSDULVRQ RI K*+ P51$ OHYHOV LQ WUDQVLHQWO\ WUDQVIHFWHG UDW OXQJ HSLWKHOLDO FHOOV WUHDWHG ZLWK /36 71)D RU ,/LS ZDV PDGH 1RUWKHUQ DQDO\VLV ZDV GRQH XVLQJ UDGLRODEHOHG SUREHV IURP K*+ 0Q62' DQG FDWKHSVLQ % F'1$V % &RPSDULVRQ RI WKH UDW DQG KXPDQ HQKDQFHU UHJLRQV LQ WKH S7.*+ YHFWRU $ ES UHJLRQ HQFRPSDVVLQJ WKH UDW HQKDQFHU DV ZHOO DV WKH DQDORJRXV UHJLRQ RI WKH KXPDQ 0Q62' ES IUDJPHQWf ZHUH DPSOLILHG E\ 3&5 DQG FORQHG LQWR WKH +LQGOOO VLWH RI WKH S7.*+ YHFWRU 1RUWKHUQ DQDO\VLV RI WUDQVLHQW WUDQVIHFWLRQV LQ UDW SXOPRQDU\ HSLWKHOLDO FHOOV VKRZQ KHUH DQG GHVFULEHG LQ WKH 0HWKRGV VHFWLRQ 5HSURGXFHG ZLWK SHUPLVVLRQ IURP 5RJHUV HW DO f %LRFKHP -f k %LRFKHPLFDO 6RFLHW\

PAGE 70

7K\PLGLQH .LQDVH 3URPRWHU S7.*+ H .E 5DW 0Q62' +LQG ,,, )UDJPHQW 7. 3URPRWHU DQG .E (QKDQFHU 7. 3URPRWHU SOXV RULHQWDWLRQf $ORQH IRUZDUG UHYHUVH /3671),/O /3671),/O /3671),/O K*+ fff PPUQ &DWKHSVLQ % 0Q62' 00 0%6 ,%% 7K\PLGLQH .LQDVH 3URPRWHU ES +XPDQ (QKDQFHU )UDJPHQW 7. 3URPRWHU SOXV ES ES 5DW (QKDQFHU +XPDQ (QKDQFHU 6WLPXOXV /36 71) ,/ /36 71) ,/ &DWKHSVLQ % %

PAGE 71

)LJ f GHPRQVWUDWHG WKDW WKH HQKDQFHU HOHPHQW FRXOG FRRSHUDWH ZLWK WKH PLQLPDO 7. SURPRWHU DQG GUDPDWLFDOO\ LQFUHDVH WKH WUDQVFULSWLRQDO DFWLYLW\ RI WKH K*+ UHSRUWHU JHQH LQ UHVSRQVH WR /36 71)D DQG ,/ 7KH HOHPHQW IXQFWLRQHG HTXDOO\ ZHOO LQ ERWK RULHQWDWLRQV DQG LQWHUHVWLQJO\ ZDV DEOH WR RUFKHVWUDWH UHSRUWHU LQGXFWLRQ WR DV PXFK DV IROG DERYH EDVHOLQH 7KH DELOLW\ RI WKLV HOHPHQW WR HQKDQFH WUDQVFULSWLRQDO DFWLYLW\ RI ERWK WKH HQGRJHQRXV DQG D KHWHURORJRXV SURPRWHU LQ DQ RULHQWDWLRQLQGHSHQGHQW DQG SRVLWLRQLQGHSHQGHQW PDQQHU IXUWKHU TXDOLILHV LW DV DQ HQKDQFHU HOHPHQW *LYHQ WKH SRWHQF\ RI WKLV HQKDQFHU HOHPHQW ZH FRPSDUHG WKH VHTXHQFH RI LQWURQ LQ WKH UDW JHQH ZLWK WKH FRUUHVSRQGLQJ UHJLRQ LQ WKH KXPDQ 0Q62' ORFXV DQG IRXQG D KLJK OHYHO RI KRPRORJ\ ,Q RUGHU WR HYDOXDWH WKH IXQFWLRQDO VLJQLILFDQFH RI WKLV UHJLRQ D ES IUDJPHQW RI WKH UDW HQKDQFHU DQG DQ DQDORJRXV ES UHJLRQ RI LQWURQ RI KXPDQ 0Q62' ZHUH LQVHUWHG LQWR 1GH VLWH RI WKH 7.*+ YHFWRU 7KH DELOLW\ RI WKH IUDJPHQWV WR FDXVH LQGXFLEOH HQKDQFHU DFWLYLW\ ZDV DVVHVVHG E\ WUDQVLHQW WUDQVIHFWLRQV DQG QRUWKHUQ DQDO\VLV %RWK WKH UDW DQG WKH KXPDQ IUDJPHQWV FDXVHG HVVHQWLDOO\ LGHQWLFDO LQGXFLEOH H[SUHVVLRQ LQ UHVSRQVH WR /36 71)D DQG ,/LS )LJ f LQGLFDWLQJ WKDW WKLV UHJLRQ RI KXPDQ LQWURQ OLNHO\ DFWV DV DQ HQKDQFHU LQ WKH HQGRJHQRXV JHQH DQG WKDW WKH HQKDQFHU DFWLYLW\ LWVHOI LV ZHOO FRQVHUYHG EHWZHHQ VSHFLHV :H KDYH DOVR GHPRQVWUDWHG WKDW WKH UDW DQG KXPDQ HQKDQFHU FDQ IXQFWLRQ HTXDOO\ DV ZHOO LQ KXPDQ FHOO OLQHV GDWD QRW VKRZQf (YDOXDWLRQ RI 3URPRWHU(QKDQFHU ,QWHUDFWLRQV :H KDYH GHPRQVWUDWHG E\ LQ YLYR IRRWSULQWLQJ WKDW WKH 0Q62' SURPRWHU FRQWDLQV SRWHQWLDO EDVDO SURWHLQELQGLQJ VLWHV .XR HW DO f 7KHVH VLWHV DUH LOOXVWUDWHG LQ )LJXUH UHODWLYH WR WKH UHVWULFWLRQ VLWHV WKDW ZHUH HPSOR\HG IRU WKH SURPRWHU GHOHWLRQ DQDO\VLV 7R GHILQH WKH DUHDV ZLWKLQ WKH SURPRWHU UHTXLUHG IRU LQWHUDFWLRQ ZLWK WKH

PAGE 72

k SURWHLQ ELQGLQJ VLWH E\ LQ YLYR IRRWSULQWLQJ +LQG ,,, +LQG( (QKDQFHG *fV E\ LQ YLYR IRRWSULQWLQJ ** X f$< 6DF ,, 1DH (DJ 22222O 22224O Ur VDH0 ([RQ 6DF( 1DH( 1GH 'HOHWLRQV RI 0Q62' 3URPRWHU KXPDQ JURZWK KRUPRQH JHQH SL6*+ ES 5DW (QKDQFHU )UDJPHQW )LJXUH 0Q62' SURPRWHU GHOHWLRQV VXPPDUL]LQJ WKH SURWHLQ ELQGLQJ VLWHV IRXQG E\ LQ YLWUR IRRWSULQWLQJ .XR HW DO f 7KH ES IUDJPHQW HQFRPSDVVLQJ WKH HQWLUH HQKDQFHU ZDV OLJDWHG LQWR WKH 1GHO VLWH RI WKH K*+ YHFWRU ZLWK WKH UHVSHFWLYH 0Q62' SURPRWHU GHOHWLRQV 5HSURGXFHG ZLWK SHUPLVVLRQ IURP 5RJHUV HW DO f %LRFKHP k %LRFKHPLFDO 6RFLHW\

PAGE 73

)LJXUH $ 1RUWKHUQ DQDO\VLV IROORZLQJ WUDQVLHQW WUDQVIHFWLRQV RI SURPRWHU GHOHWLRQ FRQVWUXFWXFWV +LQG( DQG 6IL( FRQWDLQLQJ WKH ES HQKDQFHU IUDJPHQWf LQWR UDW SXOPRQDU\ HSLWKHOLDO FHOOV % 1RUWKHUQ DQDO\VLV IROORZLQJ WUDQVLHQW WUDQVIHFWLRQV RI SURPRWHU GHOHWLRQ FRQVWUXFWV +LQG( 6DF( DQG 1DH( FRQWDLQLQJ WKH ES HQKDQFHU IUDJPHQWf LQWR UDW SXOPRQDU\ HSLWKHOLDO FHOOV 5HSURGXFHG ZLWK SHUPLVVLRQ IURP 5RJHUV HW DO f %LRFKHP k %LRFKHPLFDO 6RFLHW\

PAGE 74

ES (QKDQFHU )UDJPHQW SOXV 3URPRWHU 'HOHWLRQ 3URPRWHU )UDJPHQW +LQG( 6IL( +LQG( 6IL( (QKDQFHU 2ULHQWDWLRQ IRUZDUG UHYHUVH IRUZDUG UHYHUVH /36 K*+ W 00 + 0 P mL +LQG( 3URPRWHU $ORQH ES (QKDQFHU SOXV 3URPRWHU 'HOHWLRQ +LQG( 6DF( 1DH( /36 K*+ &DWKHSVLQ % %

PAGE 75

)LJXUH $ 6FKHPDWLF RI WKH SURPRWHUOHVV KXPDQ JURZWK KRUPRQH YHFWRU S_f*+f DQG WKH SRVLWLRQ RI WKH KXPDQ ES HQKDQFHU IUDJPHQW 1RUWKHUQ DQDO\VLV RI WKH ES KXPDQ HQKDQFHU LQ SMf*), DQG S7.*+ FRQVWUXFWV WUDQVLHQWO\ WUDQVIHFWHG LQWR FRQWURO DQG WUHDWHG /36 71)D DQG ,/_f UDW SXOPRQDU\ HSLWKHOLDO FHOOV % 6FKHPDWLF RI WKH SURPRWHUOHVV K*+ YHFWRU S_f*+f DQG WKH SRVLWLRQ RI WKH RU ES HQKDQFHU IUDJPHQWV 1RUWKHUQ DQDO\VLV RI WKH UDW HQKDQFHU IUDJPHQWV DQG ESf LQ Sf*+ FRQVWUXFWV WUDQVLHQWO\ WUDQVIHFWHG LQWR FRQWURO DQG WUHDWHG /36 71)D DQG ,/LSf UDW SXOPRQDU\ HSLWKHOLDO FHOOV 5HSURGXFHG ZLWK SHUPLVVLRQ IURP 5RJHUV HW DO f %LRFKHP / k %LRFKHPLFDO 6RFLHW\

PAGE 76

ES +XPDQ 3URKDQFHU KXPDQ JURZWK KRUPRQH JHQH ES +XPDQ 0Q62' ES +XPDQ 0Q62' 3URKDQFHU )UDJPHQW 3URKDQFHU )UDJPHQW LQ St*+ LQ S7.*+ 6WLPXOXV /36 71) ,/ /36 71) ,/ WR K*+ +P__ &DWKHSVLQ % RU ES 5DW 3URKDQFHU KXPDQ JURZWK KRUPRQH JHQH 3URKDQFHU )UDJPHQW 5DW 3URKDQFHU )UDJPHQWV LQ SA6*+ ES ES ES 2ULHQWDWLRQ fA f fA f fA f fA f fA f 6WLPXOXV /36 71) ,/ /36 71) ,/ /36 71) ,/ /36 71) ,/ /36 71) ,/

PAGE 77

HQKDQFHU HOHPHQW WKH SUHYLRXV SURPRWHU GHOHWLRQ FRQVWUXFWV .XR HW DO f ZHUH FRXSOHG ZLWK D ES HQKDQFHU IUDJPHQW )LJ f 7UDQVLHQW WUDQVIHFWLRQ DQG QRUWKHUQ DQDO\VLV ZHUH XVHG WR HYDOXDWH LQGXFLEOH DFWLYLW\ IRU WKHVH YHFWRU FRQVWUXFWV 2I LQWHUHVW WKH ILUVW ILYH ELQGLQJ VLWHV FRXOG EH GHOHWHG ZLWKRXW DQ\ GHWHFWDEOH GHFUHDVH LQ LQGXFLEOH DFWLYLW\ )LJ $f ,W ZDV QRW XQWLO WKH UHPDLQLQJ ILYH EDVDO ELQGLQJ VLWHV ZHUH HOLPLQDWHG WKDW WKH OHYHO RI LQGXFWLRQ GHFUHDVHG )LJ ,%f ZLWK DOPRVW FRPSOHWH ORVV RI EDVDO DFWLYLW\ ,QWHUHVWLQJO\ /36LQGXFLEOH WUDQVFULSWLRQ FRXOG VWLOO RFFXU ZKHQ DOO SURPRWHU SURWHLQELQGLQJ VLWHV ZHUH GHOHWHG EXW RQO\ ZKHQ WKH YHFWRU FRQVWUXFW FRQWDLQHG WKH HQKDQFHU IUDJPHQW )LJ ,%f +RZHYHU LQ WKH DEVHQFH RI WKH HQKDQFHU HOHPHQW GHOHWLRQ RI WKH VDPH SURPRWHU UHJLRQ FRQVWUXFW 1DH( f HOLPLQDWHG DQ\ WUDQVFULSWLRQ WKXV LQGLFDWLQJ WKDW WKH HQKDQFHU HOHPHQW FRQWDLQHG '1$ VHTXHQFH SRWHQWLDOO\ FDSDEOH RI LQGHSHQGHQWO\ SURPRWLQJ WUDQVFULSWLRQ LQ D VWLPXOXVUHJXODWHG PDQQHU 7KH 5DW DQG +XPDQ (QKDQFHU (OHPHQWV &RQWDLQ ,QGXFLEOH 3URPRWHU $FWLYLW\ :LWK WKH UHVXOWV RI WKH SUHYLRXV H[SHULPHQW )LJXUH f ZH SRVWXODWHG WKDW WKH HQKDQFHU HOHPHQW PLJKW H[KLELW VWLPXOXVGHSHQGHQW SURPRWHU DFWLYLW\ LQ WKH DEVHQFH RI D WUXH SURPRWHU 6LQFH WKH 1DH( *+ FRQVWUXFW GLG FRQWDLQ ES IURP WKH f IODQNLQJ UHJLRQ RI WKH 0Q62' SURPRWHU WKH UDW DQG WKH KXPDQ HQKDQFHU HOHPHQWV ZHUH LQVHUWHG LQWR WKH SURPRWHUOHVV K*+ YHFWRU S_f*+f )LJXUH $f )LJXUH $ VKRZV WKH UHVXOWV RI WKH ES KXPDQ 0Q62' HQKDQFHU IUDJPHQW LQ WKH SUHVHQFH DQG DEVHQFH RI WKH 7. SURPRWHU ,QGXFLEOH WUDQVFULSWLRQ ZDV REVHUYHG ZLWK /36 71)D DQG ,/LS EXW DW ORZHU OHYHOV WKDQ ZKHQ WKH IUDJPHQW ZDV LQVHUWHG LQWR WKH S7.*+ YHFWRU ,QWHUHVWLQJO\ WZR WUDQVFULSWV RQH WKH FRUUHFW VL]H DQG RQH DSSUR[LPDWHO\ WR ES ODUJHU ZHUH VHHQ ZKHQ WKH HQKDQFHU IUDJPHQW DFWHG DV LWV RZQ SURPRWHU :KHQ WKH

PAGE 78

ES DQG ES UDW HQKDQFHU IUDJPHQWV ZHUH WHVWHG LQ WKH SURPRWHUOHVV K*+ YHFWRU S_!*+f VLPLODU UHVXOWV WR WKH KXPDQ IUDJPHQW ZHUH REWDLQHG LQ WKDW WZR GLIIHUHQWVL]HG WUDQVFULSWV ZHUH REVHUYHG )LJXUH $ DQG %f 2I QRWH KRZHYHU ZKHQ HLWKHU WKH ES RU WKH ES HQKDQFHU IUDJPHQW ZDV LQVHUWHG LQWR S_f*+ LQ WKH f WR f RULHQWDWLRQ WKH FRUUHFWVL]HG WUDQVFULSW SUHGRPLQDWHG 7KLV UHVXOW ZRXOG LQGLFDWH WKDW WKH HQKDQFHU FDQ LQGHHG DFW DV D SURPRWHU EXW LWV RULHQWDWLRQ DQG SRVLWLRQ UHODWLYH WR WKH VWDUW RI WUDQVFULSWLRQ DUH LPSRUWDQW 7R GHWHUPLQH LI WKH SUHFHGLQJ K\SRWKHVLV ZDV FRUUHFW SMf*+ YHFWRU FRQVWUXFWV FRQWDLQLQJ WKH ES HQKDQFHU IUDJPHQW ZHUH FUHDWHG $V FDQ EH VHHQ LQ )LJXUH % ZKHQ WKH ES HQKDQFHU IUDJPHQW DFWLQJ DV D SURPRWHU ZDV LQVHUWHG LQWR WKH S_f*+ YHFWRU LQ WKH f WR f RULHQWDWLRQ D VLQJOH VWLPXOXVUHVSRQVLYH WUDQVFULSW UHVXOWHG 'LVFXVVLRQ $V D FHOOXODU DQWLR[LGDQW PLWRFKRQGULDO 0Q62' KDV EHHQ FRQVLVWHQWO\ VKRZQ WR EH DQ HIIHFWLYH F\WRSURWHFWLYH HQ]\PH 0Q62' H[SUHVVLRQ LV KLJKO\ UHJXODWHG LQ UHVSRQVH WR D YDULHW\ RI SURLQIODPPDWRU\ PHGLDWRUV LQ PDQ\ FHOO W\SHV ,Q UDW OXQJ HSLWKHOLDO FHOOV WKH LQIODPPDWRU\ PHGLDWRUV /36 71)D DQG ,/LS HDFK FDXVH 0Q62' VWHDG\VWDWH P51$ OHYHOV WR LQFUHDVH WR IROG ZKLFK KDV EHHQ VKRZQ LQ QXFOHDU UXQRQ VWXGLHV +VX f WR EH SDUWO\ GXH WR LQFUHDVHG WUDQVFULSWLRQ RI WKH JHQH $ VXUYH\ RI WKH HQWLUH 0Q62' ORFXV IRU VLWHV RI SRVVLEOH SURWHLQ'1$ LQWHUDFWLRQ XVLQJ '1DVH K\SHUVHQVLWLYH VLWH DQDO\VLV UHYHDOHG LQFUHDVHG QXFOHDVH DFFHVVLELOLW\ DW VLWHV LQ WKH n SUR[LPDO SURPRWHU UHJLRQ DQG RWKHU VLWHV ORFDWHG ZLWKLQ WKH JHQH .XR HW DO f 7KH SUHVHQW H[SHULPHQWV IXUWKHU H[SDQG RXU XQGHUVWDQGLQJ RI WKH PROHFXODU

PAGE 79

PHFKDQLVPV UHJXODWLQJ EDVDO DQG LQGXFHG H[SUHVVLRQ RI 0Q62' E\ LGHQWLI\LQJ DQ HQKDQFHU UHJLRQ ZLWKLQ WKH UDW DQG KXPDQ 0Q62' 7KH n IODQNLQJ VHTXHQFH RI 0Q62' LV FKDUDFWHUL]HG E\ D *&ULFK LVODQG ODFNLQJ D 7$7$ DQG &$$7ER[ IRU LQLWLDWLRQ RI WUDQVFULSWLRQ ,Q YLYR IRRWSULQWLQJ VWXGLHV KDYH GHILQHG SURWHLQ ELQGLQJ VLWHV IRU EDVDO WUDQVFLSWLRQ IDFWRUV ZLWKLQ ES RI WKH WUDQVFULSWLRQDO VWDUW VLWH .XR HW DO f 3URPRWHU GHOHWLRQ DQDO\VLV LGHQWLILHG HVVHQWLDO FVDFWLQJ VHTXHQFHV ORFDWHG ZLWKLQ ES RI WKH WUDQVFULSWLRQDO VWDUW VLWH .XR HW DO f 7KLV UHJLRQ RI WKH SURPRWHU LQFOXGHV RI WKH EDVDO SURWHLQ ELQGLQJ VLWHV DQG LV FDSDEOH RI VXSSRUWLQJ EDVDO DQG VWLPXODWHG /36 71)D DQG ,/LSf H[SUHVVLRQ +RZHYHU SURWHLQ DQG P51$ OHYHOV RI WKH K*+ UHSRUWHU ZHUH RQO\ LQGXFHG WR IROG LQ WUDQVLHQW WUDQVIHFWLRQ VWXGLHV XVLQJ YHFWRUV FRQWDLQLQJ IURP WR NE RI WKH 0Q62' SURPRWHU UHJLRQ DORQH .XR HW DO f ([DPLQDWLRQ RI WKH 0Q62' SURPRWHU IRU NQRZQ WUDQVFULSWLRQ IDFWRU FRQVHQVXV VHTXHQFHV E\ FRPSXWHU DQDO\VLV UHYHDOHG DQ 1)N% VHTXHQFH DW DV ZHOO DV 6SO DQG JXWHQULFKHG .ULLSSHOOLNH IDFWRU *./)f 6KLHOGV DQG
PAGE 80

EH QHFHVVDU\ IRU RWKHU VWLPXOL NQRZQ WR LQGXFH ,1)\ +DUULV HW DO 9DOHQWLQH DQG 1LFN f SKRUERO HVWHU )XMLL DQG 7DQLJXFKL f RU LQKLELW JOXFRFRUWLFRLGV 'RXJDOO DQG 1LFN ff 0Q62' H[SUHVVLRQ $OWHUQDWLYHO\ LW VKRXOG EH QRWHG WKDW WKH IXQFWLRQDO GDWD ZDV REWDLQHG E\ WUDQVLHQW WUDQVIHFWLRQ RI SODVPLG UHSRUWHU JHQH '1$ LQWR PDPPDOLDQ FHOOV &RQVHTXHQWO\ LW LV YHU\ SRVVLEOH WKDW WKH SODVPLG '1$ GRHV QRW IRUP SURSHU FKURPDWLQ VWUXFWXUHV IROORZLQJ WUDQVIHFWLRQ $SSURSULDWH FKURPDWLQ VWUXFWXUH LV OLNHO\ FUXFLDO IRU WKH FRUUHFW DOLJQPHQW RI '1$ VHTXHQFH LPSRUWDQW IRU WKH SURPRWHUHQKDQFHU LQWHUDFWLRQV 7KHUHIRUH ZH PXVW FRQVLGHU WKLV DV D SRVVLEOH H[SODQDWLRQ IRU WKH GDWD VKRZQ LQ )LJXUH ,% 7KH GDWD LQ )LJXUH ,% GRHV KRZHYHU VWURQJO\ LPSOLFDWH WKH IXQFWLRQDO LPSRUWDQFH RI ELQGLQJ VLWHV 9,; WR ERWK EDVDO DQG HQKDQFHUVWLPXOXVVSHFLILF H[SUHVVLRQ 7KH S1DH(DJ *+ YHFWRU ZDV QRW VXIILFLHQW WR GULYH HLWKHU EDVDO RU VWLPXODWHG H[SUHVVLRQ .XR HW DO f VXJJHVWLQJ WKDW D PLQLPDO SURPRWHU VHTXHQFH IRU WUDQVFULSWLRQDO LQLWLDWLRQ ZDV QR ORQJHU SUHVHQW 7KH REVHUYHG LQGXFWLRQ RI WKH UHSRUWHU JHQH IURP WKH n 0Q62' SURPRWHU ZDV PXFK ORZHU WKDQ HQGRJHQRXV 0Q62' H[SUHVVLRQ IROORZLQJ WUHDWPHQW ZLWK LQIODPPDWRU\ PHGLDWRUV .XR HW DO f 7KHVH GDWD DQG WKH SUHVHQFH RI '1DVH K\SHUVHQVLWLYH VLWHV ZLWKLQ WKH JHQH VXJJHVWHG WKDW UHJXODWRU\ HOHPHQWV PLJKW H[LVW RXWVLGH WKH n IODQNLQJ VHTXHQFH 5HVXOWV IURP WUDQVIHFWLRQV ZLWK YHFWRUV FRPELQLQJ ERWK WKH f SURPRWHU UHJLRQ DQG WKH LQWHUQDO NE IUDJPHQW FRQWDLQLQJ WKH UHPDLQGHU RI WKH '1DVH K\SHUVHQVLWLYH VLWHVf FRQILUPHG WKDW JHQRPLF VHTXHQFHV n WR WKH WUDQVFULSWLRQDO VWDUW VLWH FRQWDLQ HQKDQFHU DFWLYLW\ 0RVW LPSRUWDQWO\ WKLV UHJLRQ FRQWDLQV DGHTXDWH HQKDQFHU DFWLYLW\ WR PLPLF HQGRJHQRXV VWLPXOXVGHSHQGHQW WUDQVFULSWLRQ OHYHOV 'HOHWLRQ DQDO\VLV RI WKLV UHJLRQ ORFDOL]HG WKLV DFWLYLW\ WR D ES DUHD ZLWKLQ LQWURQ ZKLFK FRQWDLQV '1DVH ,

PAGE 81

K\SHUVHQVLWLYH VLWH :KHQ WKLV ES UHJLRQ LV GLYLGHG LQWR WZR ES IUDJPHQWV ZH IRXQG WKDW HDFK RI WKHVH IUDJPHQWV LQGHSHQGHQWO\ UHWDLQHG LQGXFLEOH DFWLYLW\ DOEHLW DW D ORZHU OHYHO 0RUHRYHU EDVHG RQ (06$ WKHVH VDPH ES IUDJPHQWV ZHUH DEOH WR ELQG ERWK FRQVWLWXWLYH QXFOHDU IDFWRUV DV ZHOO DV D QXPEHU RI IDFWRUV VSHFLILF WR H[WUDFWV IURP LQGXFHG FHOOV +RZHYHU DWWHPSWV WR IXUWKHU GHOLQHDWH WKH HQKDQFHU E\ (06$ XVLQJ '1$ IUDJPHQWV OHVV WKDQ ES 5RJHUV XQSXEOLVKHG GDWDf OHG WR WKH HOLPLQDWLRQ RI VWLPXOXV VSHFLILF LQ YLWUR ELQGLQJ IXUWKHU GHPRQVWUDWLQJ WKH FRPSOH[LW\ RI WKLV HQKDQFHU DQG LPSO\LQJ WKDW SURWHLQSURWHLQ LQWHUDFWLRQV PD\ EH FULWLFDO WR WKH IRUPDWLRQ RI VSHFLILF SURWHLQ'1$ FRPSOH[HV EHWZHHQ WKH SURPRWHU DQG HQKDQFHU 7KHUHIRUH ZH EHOLHYH WKDW WKLV HQKDQFHU LV FRPSRVHG RI D VHW RI FRPSOH[ LQWHUDFWLQJ HOHPHQWV LQYROYHG LQ WKH LQGXFLEOH H[SUHVVLRQ RI 0Q62' &RQWUDU\ WR WKH SXEOLVKHG FKDUDFWHUL]DWLRQ RI WKH PXULQH JHQH -RQHV HW DO DQG f RXU GDWD ZRXOG LQGLFDWH WKDW VHSDUDWH HOHPHQWV ZLWKLQ WKLV HQKDQFHU UHJLRQ UHWDLQ DQ DELOLW\ WR LQGXFH 0Q62' WUDQVFULSWLRQDO DFWLYLW\ EXW WKDW VPDOO ESf LQGLYLGXDO HOHPHQWV FDQQRW DFW LQGHSHQGHQWO\ WR FRQIHU WKH VDPH LQGXFLEOH OHYHOV VHHQ LQ WKH HQGRJHQRXV JHQH 2XU UHVXOWV GHPRQVWUDWH WKDW WKLV HQKDQFHU HOHPHQW UHTXLUHV D SRUWLRQ RI WKH 0Q62' SURPRWHU WR DFKLHYH OHYHOV RI LQGXFWLRQ DQDORJRXV WR VWHDG\VWDWH QRUWKHUQ DQDO\VLV 8VLQJ SRUWLRQV RI WKH SURPRWHU FRXSOHG ZLWK WKH HQKDQFHU ZH GHPRQVWUDWHG WKH UHTXLUHPHQW IRU VHTXHQFHV IURP WR WKH VWDUW RI WUDQVFULSWLRQ ZKLFK LQFOXGH SURWHLQn ELQGLQJ VLWHV 9,; GHILQHG E\ LQ YLYR IRRWSULQWLQJ .XR HW DO f *LYHQ WKH IXQFWLRQDO FRQQHFWLRQ EHWZHHQ WKH HQKDQFHU DQG WKH 0Q62' SURPRWHU ZH SRVWXODWH WKDW WKH HQKDQFHU PD\ LQWHUDFW ZLWK WKH SURPRWHU WKURXJK D PHFKDQLVP LQYROYLQJ '1$ EHQGLQJ 3WDVKQH f $V VXSSRUW IRU WKLV K\SRWKHVLV ZH KDYH SHUIRUPHG FR

PAGE 82

WUDQVIHFWLRQ H[SHULPHQWV ZLWK WKH SURPRWHU DQG HQKDQFHU RQ VHSDUDWH SODVPLGV DQG IRXQG XQGHU WKHVH FRQGLWLRQV WKDW LQGXFLEOH WUDQVFULSWLRQ FRXOG QRW EH DFKLHYHG 5RJHUV GDWD QRW VKRZQf 7KLV VXEVWDQWLDWHV WKH DUJXPHQW WKDW WKH 0Q62' SURPRWHU DQG HQKDQFHU PXVW UHVLGH ZLWKLQ D FRQWLJXRXV UHJLRQ RI '1$ 7KHUHIRUH UHJXODWRU\ HOHPHQWV PRVW OLNHO\ SK\VLFDOO\ LQWHUDFW WKURXJK '1$ EHQGLQJ 3WDVKQH f DQG SRVVLEO\ LQYROYLQJ DQ DOWHUDWLRQ LQ FKURPDWLQ VWUXFWXUH LQ WKH SURPRWHU DV GHILQHG E\ .XR HW DO 2I SDUWLFXODU LQWHUHVW LV WKH H[LVWHQFH RI D KRPRORJRXV IXQFWLRQDO HQKDQFHU HOHPHQW LQ KXPDQ 0Q62' )LJ f ZKLFK UHVSRQGV WR WKH VDPH LQIODPPDWRU\ PHGLDWRUV DV WKH UDW HQKDQFHU LQ ERWK UDW DQG KXPDQ FHOOV GDWD QRW VKRZQf ,Q DGGLWLRQ DQRWKHU XQLTXH FKDUDFWHULVWLF RI WKH UDW DQG KXPDQ HQKDQFHU HOHPHQW LV LWV DELOLW\ WR GULYH WUDQVFULSWLRQ LQGHSHQGHQW RI D FODVVLFDO SURPRWHU )LJXUHV $ DQG %f $V DQ LQGHSHQGHQW SURPRWHUUHJXODWRU\ HOHPHQW WKLV VHTXHQFH KDV WKH FDSDFLW\ WR SURPRWH VWLPXOXVGHSHQGHQW WUDQVFULSWLRQ ZLWK QHJOLJLEOH EDVDO OHYHOV 3UHYLRXV ZRUN LQ RXU ODERUDWRU\ H[SORUHG WKH SRVVLELOLW\ RI DQ DOWHUQDWLYH SURPRWHU RU GLIIHUHQWLDO P51$ VSOLFLQJ DV D FDXVH IRU WKH PXOWLSOH WUDQVFULSWV LQ WKH UDW 8VLQJ SULPHU H[WHQVLRQ DQG 3 ODEHOHG F'1$ DQG JHQRPLF IUDJPHQWV DV K\EULGL]DWLRQ SUREHV LW ZDV GHWHUPLQHG WKDW DOWHUQDWLYH SRO\DGHQ\ODWLRQ ZDV WKH OLNHO\ FDXVH IRU WKH PXOWLSOH WUDQVFULSWV VHHQ LQ WKH UDW 0Q62' +XUW HW DO f 8QGHUVWDQGLQJ WKH UHJXODWLRQ RI WKLV HQKDQFHU UHJLRQ ZLOO EH LPSRUWDQW VLQFH LW VHHPV WR EH H[TXLVLWHO\ UHVSRQVLYH WR DFXWH F\WRNLQH PHGLDWRUV DQG LI VLPLODU PRWLIV DUH IRXQG LQ RWKHU JHQHV PD\ H[LVW DV D UHJXODWRU\ XQLW WKDW VHUYHV DV D JHQHUDO LQIODPPDWRU\ UHVSRQVH HOHPHQW &XUUHQW HIIRUWV DUH XQGHUZD\ WR IXUWKHU FKDUDFWHUL]H WKH HQKDQFHU E\ '06 LQ YLYR IRRWSULQWLQJ DQG PXWDJHQHVLV IRU IXQFWLRQDO WUDQVIHFWLRQ VWXGLHV

PAGE 83

&+$37(5 ,1 9,92 )22735,17,1* $1' 087$*(1(6,6 2) 7+( 5$7 0$1*$1(6( 683(52;,'( ',6087$6( (1+$1&(5 ,QWURGXFWLRQ *HQH DFWLYDWLRQ LQ UHVSRQVH WR H[WUDFHOOXODU VLJQDOV LQIHFWLRQ E\ SDWKRJHQV RU HQYLURQPHQWDO VWUHVVHV UHTXLUHV KLJKO\ LQWHJUDWHG VLJQDO WUDQVGXFWLRQ SDWKZD\V WKDW GLUHFW WKH WUDQVFULSWLRQDO PDFKLQHU\ WR WKH DSSURSULDWH VHW RI JHQHV $ FUXFLDO LVVXH LQ XQGHUVWDQGLQJ LQGXFLEOH JHQH UHJXODWLRQ LV KRZ D UHODWLYHO\ VPDOO QXPEHU RI GLIIHUHQW WUDQVFULSWLRQ IDFWRUV LV XVHG WR DFKLHYH WKH KLJK OHYHO RI VSHFLILFLW\ UHTXLUHG WR FRQWURO FRPSOH[ SDWWHUQV RI JHQH H[SUHVVLRQ 0DQLDWLV HW DO 0F.QLJKW DQG
PAGE 84

3HUKDSV RQH RI WKH EHVW H[DPSOHV RI FRPELQDWRULDO LQWHUDFWLRQV DPRQJ GLVWLQFW UHJXODWRU\ HOHPHQWV LV SURYLGHG E\ WKH LQWHUIHURQ3 ,)13f JHQH 0DQLDWLV HW DO 7LMDQ DQG 0DQLDWLV f 7KH ,)1S JHQH LV DFWLYDWHG LQ UHVSRQVH WR YLUXV LQIHFWLRQ DQG WKH WUDQVFULSWLRQ IDFWRUV UHTXLUHG IRU DFWLYDWLQJ WKH ,)13 JHQH KDYH EHHQ LGHQWLILHG 'HWDLOHG VWXGLHV RI WKLV SURPRWHU UHYHDOHG D KLJKO\ FRPSDFW DQG UHPDUNDEO\ FRPSOH[ RUJDQL]DWLRQ RI UHJXODWRU\ VHTXHQFHV FRQWDLQLQJ IRXU SRVLWLYH UHJXODWRU\ GRPDLQV 1RQH RI WKHVH GRPDLQV IXQFWLRQ RQ WKHLU RZQ EXW WZR RU PRUH FRSLHV RI DQ\ RQH RI WKHP FDQ DFW DV D YLUXVLQGXFLEOH HQKDQFHU +RZHYHU WKH V\QWKHWLF HQKDQFHUV GLVSOD\ YDU\LQJ OHYHOV RI EDVDO DFWLYLW\ DUH OHVV LQGXFLEOH WKDQ D QDWXUDO HQKDQFHU DQG FDQ UHVSRQG WR LQGXFHUV RWKHU WKDQ YLUXV LQIHFWLRQ 7KXV WKH VSHFLILFLW\ DQG DFWLYLW\ RI WKH QDWXUDO LQWDFW HQKDQFHU DUH GLVWLQFW IURP WKRVH RI WKH LQGHSHQGHQW HQKDQFHU HOHPHQWV 7KH DFWLYDWLRQ RI DW OHDVW VRPH QDWXUDO HQKDQFHUV DSSHDUV WR UHVXOW IURP WKH SUHFLVH DUUDQJHPHQW RI WUDQVFULSWLRQ IDFWRUV RQ '1$ UHVXOWLQJ LQ WKH IRUPDWLRQ RI D KLJKO\ VSHFLILF WKUHH GLPHQVLRQDO QXFOHRSURWHLQ FRPSOH[ VWHUHRVSHFLILF HQKDQFHU FRPSOH[ *URVVFKHGO f 7UDQVFULSWLRQDO DFWLYDWRU SURWHLQV KDYH EHHQ VKRZQ WR V\QHUJL]H ZLWK HDFK RWKHU LQ YLWUR XVLQJ V\QWKHWLF HQKDQFHUV FRQWDLQLQJ PXOWLSOH DFWLYDWRU ELQGLQJ VLWHV 0F.QLJKW DQG
PAGE 85

DQG WKH WUDQVFULSWLRQDO V\QHUJ\ LV D FRQVHTXHQFH RI PXOWLSOH LQWHUDFWLRQV EHWZHHQ WKH DFWLYDWRUV DQG FRPSRQHQWV RI WKH WUDQVFULSWLRQ DSSDUDWXV 3WDVKQH DQG *DQQ f 7KLV UHFUXLWPHQW FRXOG LQYROYH WKH VWHSZLVH DVVRFLDWLRQ RI JHQHUDO WUDQVFULSWLRQ IDFWRUV ZLWK WKH SURPRWHU 2USKDQLGHV HW DO 5RHGHU f LQWHUDFWLRQV EHWZHHQ DFWLYDWRUV DQG VSHFLILF 7$7$ ER[ ELQGLQJ SURWHLQ 7%3f DVVRFLDWHG IDFWRUV RU 7$)Vf LQ WKH 7),,' FRPSOH[ 6DXHU HW DO f RU LQWHUDFWLRQV EHWZHHQ DFWLYDWRUV DQG FRPSRQHQWV RI WKH 51$ SRO\PHUDVH ,, KRORHQ]\PH .ROHVNH DQG
PAGE 86

FKHPLFDO '06 FDQ HQWHU LQWDFW FHOOV DQG UHDFW SUHGRPLQDQWO\ E\ PHWK\ODWLQJ WKH 1 DWRP RI JXDQLQH DQG WR D OHVVHU H[WHQW WKH 1 DWRP RI DGHQLQH LQ GXSOH[HG '1$ $PLQR DFLG VLGH FKDLQV RI WUDQVDFWLQJ IDFWRUV ZKLFK FRQWDFW JXDQLQH UHVLGXHV FDQ SURWHFW WKHVH EDVHV IURP PHWK\ODWLRQ E\ '06 $OWHUQDWLYHO\ DPLQR DFLG VLGH FKDLQV FDQ FUHDWH D K\GURSKRELF SRFNHW DURXQG VSHFLILF JXDQLQH UHVLGXHV ZKLFK LQFUHDVHV WKH '06 VROXELOLW\ DQG UHVXOWV LQ HQKDQFHG UHDFWLYLW\ 8OWLPDWHO\ SURWHLQ VLGH FKDLQV SURGXFH D IRRWSULQW FRPSRVHG RI SURWHFWLRQV DQGRU HQKDQFHPHQWV ZKLFK DSSHDU DV GLPLQLVKHG RU PRUH LQWHQVH EDQGV DV FRPSDUHG WR WKH FRUUHVSRQGLQJ EDQG LQ WKH QDNHG '1$ JXDQLQH ODGGHU RQ WKH ILQDO VHTXHQFLQJ JHO DXWRUDGLRJUDSK 1LFN DQG *LOEHUW f 3UHYLRXV ZRUN IURP WKLV ODERUDWRU\ KDV HVWDEOLVKHG WKH WLPLQJ RI H[SHULPHQWDO FRQGLWLRQV ZKHQ FHOO FXOWXUHV DUH WUHDWHG ZLWK LQIODPPDWRU\ VWLPXOL SULRU WR '06 .XR f .LQHWLFV RI WUDQVFULSWLRQ IDFWRU ELQGLQJ LV VWDEOH DQG FRPSDUDEOH EHWZHHQ FRQWURO DQG VWLPXOXVWUHDWHG VDPSOHV 7KRVH H[SHULPHQWV GHPRQVWUDWHG WKDW SURWHLQ'1$ FRQWDFWV ZHUH GHWHFWDEOH DV HDUO\ DV KU DQG DV ODWH DV KU DIWHU DGGLWLRQ RI VWLPXOXV )RU WKH H[SHULPHQWV LQ WKLV WKHVLV WLPH SRLQWV RI DQG KUV ZHUH FKRVHQ IRU '06 WUHDWPHQW DIWHU DGGLWLRQ RI VWLPXOXV /36 71)D ,/LSf ,OOXVWUDWHG LQ )LJXUH LV DQ DXWRUDGLRJUDSK RI '06 LQ YLYR IRRWSULQWLQJ DQG /03&5 UHVXOWV RI ERWK FRQWURO DQG WUHDWHG VDPSOHV 6HYHUDO JXDQLQH DQG DGHQLQH UHVLGXHV H[KLELWHG DOWHUHG '06 UHDFWLYLW\ ZKLFK DSSHDUHG DV GLPLQLVKHG RU HQKDQFHG K\ELGL]DWLRQ VLJQDOV UHODWLYH WR LQ YLWUR '06WUHDWHG '1$ ODQHV 7KH H[LVWHQFH RI VHYHUDO SRWHQWLDO SURWHLQ ELQGLQJ VLWHV DUH SRVWXODWHG WR DFFRXQW IRU SDWWHUQV XQFRYHUHG E\ LQ YLYR IRRWSULQWLQJ )LJXUH VXPPDUL]HV WKH SXWDWLYH SURWHLQ'1$ FRQWDFWV

PAGE 87

)LJXUH $XWRUDGLRJUDSK RI '06 LQ YLYR IRRWSULQWLQJ RI HQKDQFHU UHJLRQ RI 0Q62' /DQHV DUH DV IROORZV QDNHG '1$ IURP / FHOOV WUHDWHG ZLWK '06 & FRQWURO / FHOOV WUHDWHG LQ YLYR ZLWK '06 7 71)DWUHDWHG / FHOOV IRU KRXUV SULRU WR LQ YLYR WUHDWPHQW ZLWK '06 ,/ 3WUHDWHG / FHOOV IRU KRXUV SULRU WR LQ YLYR WUHDWPHQW ZLWK '06 2SHQ WULDQJOHV UHIHU WR LQGXFLEOH SURWHFWHG VLWHV DQG FORVHG WULDQJOHV UHIHU WR LQGXFLEOH HQKDQFHG VLWHV 6LWH QXPEHUV UHIHU WR UHJLRQV ZKHUH SXWDWLYH SURWHLQn ELQGLQJ PD\ RFFXU RQ WKH HQKDQFHU HOHPHQW 6HTXHQFH UHIHUV WR ERWWRP VWUDQG

PAGE 88

6LWH 6LWH ? $ $ LW $ WL **&&77, D6W F F F On 6&II f§ f f mrf m rr £ $V W ; $ 7 $J $J 7 £ $ £D e Em_ P A P P P P%Wi r}t__ + $ $ n 7 *$ 7 $ J$ $ 7 7 7 & 7 7 $ 7 7 *$ & $ 7 $ Y $ V $ V DD L 7 7 *D L F n$$ DL f 0 &=

PAGE 89

)LJXUH 6HTXHQFH FRPSDULVRQ RI UDW KXPDQ DQG PRXVH 0Q62' HQKDQFHU UHJLRQV RI LQWURQ 2SHQ WULDQJOHV UHIHU WR LQGXFLEOH SURWHFWHG VLWHV DQG FORVHG WULDQJOHV UHIHU WR LQGXFLEOH HQKDQFHG VLWHV 6LWH QXPEHUV UHIHU WR UHJLRQV ZKHUH SXWDWLYH SURWHLQn ELQGLQJ PD\ RFFXU RQ WKH HQKDQFHU HOHPHQW RI WKH UDW 0Q62' JHQH &(%3 UHIHUV WR SXWDWLYH WUDQVFULSWLRQ IDFWRU ELQGLQJ VLWH LQ WKH PRXVH 0Q62' HQKDQFHU E\ FRQVHQVXV VHTXHQFH DQDO\VLV DQG '06 LQ YLYR IRRWSULQWLQJ $UURZV ZLWK QXPEHUV UHIHU WR ERXQGDULHV RI VPDOOHVW UHJLRQV RI WKH UDW 0Q62' HQKDQFHU WHVWHG LQ WUDQVLHQW WUDQVIHFWLRQ DVVD\V

PAGE 90

5$7 +80 086 5$7 +80 086 5$7 +80 086 6LWH nƒ $$ &&&&*7$*$7&$&&7&77&$&$&&$7$$$$7&*7$7&$$&$&$77&$&&***77**77&7& L LL L PLOL PL L PLQL LOO L &7&&*7$*$7&$&&77777$&*7&$7$$$*7&**$&7$$&$&$$$&77&$777$&7$$7777&7& , , , , , , , ,, , , , , , , , O , O ,,, &&&&*7$*$7&$&&7&77&$7$7&$7$$$*77*7$77$$&$&$77&$&&**77$**77&7&7& 6LWH 6LWH 8$ $ 8 $$ $ $$$ 77&&777$$7**7*7$$*$&&777$$$$7*$$&*77$77&*777$*7*7$77$*&$&77$7*&&&77&7&7*$* OOOOOOOOOOOOOOOO OOOOOOOO ,, ,, , , ,, &7&&77&$$7**7*7$$*$&&77&7$$$7*$$&7&7*7&7*&77**$$&77$$7*&&&7777&&****& OOOOOOOOOOOOOOOO OOOOOOOO ,, ,, , ,, , &&777$7$$7**7*7$$*$&&777$$$$7*$$&*77$77&*777$*7*7*777$*$$777$7*&&&77&7&7*$& 6LWH n $$$ $ $&7$$$7&&777$&7*7&7$$$&&&77&&*$&$&&$77$7&$&7&$7&&&&7777&***7&$$&&&777$*& PX PP Q LPLLPL P L PP LL LQL $&7$$$7&&777$77*777$$$&&&777*7$&$77$&&&&7&7&7*$&&&&77$7****7&$$&$&777&$7 KLP PP LL Q KLP LQ L OOOOOOOO OOOOOOOO PL &&7$$$$&&777$$&*7&7$*$&&&7&&7$$&$&&$77$7&&77&*7&&&&77$7&***7&$$&&&777&*7 &(%3 5$7 $$$**$*$77&&$&7*7$*$&7*77*$$$**$*$$77$&$$&$77777*7$&&$ 0LOO ,11 , , ,,, , , , +80 *$$**$&$77&&*77*7$*$&7*7**7&&77**$$$*$*$$*7&$7$$$$7777 0LOO 0LOO ,, ,, ,, ,, ,, 086 $$$**$$$77&&$&7*7$*$&&*7$*$7&7777*$$$*$$*$$77$&$$&$**7 5$7 &7$$$*77***$$**&$&&7&7*7&7&*$&$7$$$&$$$7&$&77$&*$& , +80 7*77*$$77$$$*7&$**$$$7*$$&$&&77$*7&7&**$$7*$$7$&$7 , &7*7$*$$&7$$&$77$**$$*$&$&&7&**7&7&*$$$&*$$$77&&$& WR 086

PAGE 91

EHLQJ QXPEHUHG VLWHV WKURXJK VLWH RYHU D UHJLRQ RI DSSUR[LPDWHO\ WR ES 0XWDJHQHVLV RI 3XWDWLYH '1$ %LQGLQJ 6LWHV $OWHUV ,QGXFLEOH 0Q62' ([SUHVVLRQ .QRZLQJ WKH UHVXOWV RI WKH '06 LQ YLYR IRRWSULQWLQJ PXWDJHQHVLV RI WKH HQKDQFHG RU SURWHFWHG QXFOHRWLGHV ZLWKLQ WKH 0Q62' HQKDQFHU UHJLRQ ZDV SHUIRUPHG XVLQJ 3&5 DPSOLILFDWLRQ 0XWDWLRQV DFKLHYHG ZHUH YHULILHG E\ VHTXHQFLQJ )LJXUH VKRZV D FRPSDULVRQ EHWZHHQ WKH UDW KXPDQ DQG PXULQH VHTXHQFHV LQ LQWURQ RI HDFK JHQH 7KH VLWHV WKDW ZHUH VKRZQ WR EH HQKDQFHG RU SURWHFWHG LQ WKH UDW LQWURQ HQKDQFHU UHJLRQ DUH GHSLFWHG DV ZHOO DV WKH LQ YLYR IRRWSULQWLQJ VLWHV IRXQG LQ WKH PXULQH LQWURQ HQKDQFHU UHJLRQ -RQHV HW DO f 7KH PXWDWLRQV ZLWKLQ HDFK RI WKH VLWHV WKDW ZHUH FUHDWHG LQ WKH K*+ UHSRUWHU YHFWRUV XVHG LQ WKH PXWDJHQHVLV VWXGLHV DUH VKRZQ LQ ILJXUH )LJXUHV DQG GHPRQVWUDWH WKH UHVXOWV RI QRUWKHUQ DQDO\VLV RI WUDQVLHQW WUDQVIHFWLRQV RI / FHOOV ZLWK WKH ZLOG W\SH :7f FRQWURO DQG PXWDWHG ELQGLQJ VLWHV 7KH UHVXOWV LQ ERWK )LJXUHV DQG ZRXOG VXJJHVW WKDW WKH PXWDWLRQV PDGH LQ VLWH VHHP WR DIIHFW WKH OHYHO RI LQGXFLEOH WUDQVFULSWLRQ WR H[WHQW PXFK JUHDWHU WKDQ WKH RWKHU VLWH PXWDWLRQV $V ZD\ RI FRQWURO WKH PXWDWLRQV PDGH LQ WKH FRQVHQVXV VHTXHQFH RI &(%3 UHIHUUHG WR DV &(%3 GRHV QRW VHHP WR FKDQJH WKH OHYHO RI LQGXFLEOH H[SUHVVLRQ $OVR PXWDJHQHVLV RI WKH LQGLYLGXDO VLWHV LQ 6LWH D DQG Ef GLG QRW LQIOXHQFH WKH OHYHO RI LQGXFLEOH WUDQVFULSWLRQ XQWLO WKH WZR VLWH PXWDWLRQV ZHUH FRPELQHG LQWR RQH YHFWRU FRQVWUXFW

PAGE 92

6LWH 6LWH 087 &$&$77&$&& 77*777777& 7&77&&777$ $777777$$* $$$777$$$$ '2 :7 &$&$77&$&& ***77**77& 7&77&&777$ $7**7*7$$* $&&777$$$$ 6LWH 087 77$$&777$7 7&7777$777 7$77$7&$&7 7$7*&&&77& 7&7*$*$&7$ TG D D D R :7 7*$$&*77$7 7&*777$*7* 7$77$*&$&7 7$7*&&&77& 7&7*$*$&7$ &(%3 6LWH D 087 $$7&&777$& 7*7&7$$$&& &77&&*$$$$ $$77$7&$&7 &$7&$$$777 ' ''2 :7 $$7&&777$& 7*7&7$$$&& &77&&*$&$& &$77$7&$&7 &$7&&&&777 6LWH % 087 7&7777&$$& &&777&7&$$ $**$*$77&& $&7*7$*$&7 *77*$$$**$ :7 7&***7&$$& &&777$*&$$ $**$*$77&& $&7*7$*$&7 *77*$$$**$ )LJXUH 7KH VHTXHQFH RI WKH UDW 0Q62' LQWURQLF HQKDQFHU UHJLRQ GLVSOD\LQJ WKH SXWDWLYH SURWHLQ'1$ ELQGLQJ VLWHV DQG WKH PXWDWLRQV PDGH LQ HDFK VLWH IRU FRQVWUXFWLRQ RI K*+ UHSRUWHU YHFWRUV DQG WUDQVLHQW WUDQVIHFWLRQ LQWR / SXOPRQDU\ HSLWKHOLDO FHOOV 5HFWDQJOHV PDUN WKH PXWDWHG EDVH SDLUV ZLWK WKH VHTXHQFH IRU WKH ZLOG W\SH :7f 0Q62' HQKDQFHU RQ WKH ERWWRP DQG WKH PXWDWHG VHTXHQFH RQ WRS

PAGE 93

)LJXUH 1RUWKHUQ DQDO\VLV RI WUDQVLHQW WUDQVIHFWLRQV RI ZLOGW\SH :7f DQG PXWDWHG ELQGLQJ VLWH HQKDQFHU HOHPHQWV LQ K*+ YHFWRU :7 UHIHUV WR WKH XQFKDQJHG UDW ES HQKDQFHU IUDJPHQW FRQWURO UHIHUV WR WKH PXWDWHG &(%3 VLWH LQ WKH ES IUDJPHQW 6LWH UHIHUV WR WKH 6LWH PXWDWLRQ LQ WKH ES IUDJPHQW 6LWH D DQG E UHIHU WR WKH VLWH D DQG E PXWDWLRQV LQ WKH ES HQKDQFHU IUDJPHQW 7KH XSSHU SDQHO VKRZV FHOOV WKDW ZHUH VWLPXODWHG ZLWK 71)D IRU KRXUV SULRU WR LVRODWLRQ RI 51$ DQG WKH ORZHU SDQHO VKRZV FHOOV WKDW ZHUH VWLPXODWHG ZLWK ,/ IRU KRXUV SULRU WR 51$ LVRODWLRQ ,Q DOO YHFWRUV LQ ERWK SDQHOV WKH HQKDQFHU IUDJPHQW ZDV LQ D ff RULHQWDWLRQ K*+ UHIHUV WR WKH UHSRUWHU JHQH SURGXFW LQ HDFK YHFWRU &DWKHSVLQ % ZDV XVHG DV D 51$ ORDGLQJ FRQWURO

PAGE 94

6LWH 0XWDWLRQV :7 71)D [6r &r[ t &DWKHSVLQ % 6LWH 0XWDWLRQV :7 &! t t t ,/OS K*+ P0 &DWKHSVLQ %

PAGE 95

)LJXUH 1RUWKHUQ DQDO\VLV RI WUDQVLHQW WUDQVIHFWLRQV RI ZLOGW\SH :7f DQG PXWDWHG ELQGLQJ VLWH HQKDQFHU HOHPHQWV LQ K*+ YHFWRU :7 UHIHUV WR WKH XQFKDQJHG UDW ES HQKDQFHU IUDJPHQW 6LWH UHIHUV WR WKH 6LWH PXWDWLRQ LQ WKH ES IUDJPHQW 6LWH UHIHUV WR WKH FRPELQDWLRQ RI PXWDWLRQV LQ VLWHV D DQG E LQ WKH ES HQKDQFHU IUDJPHQW 7KH XSSHU SDQHO VKRZV FHOOV WKDW ZHUH VWLPXODWHG ZLWK OLSRSRO\VDFKDUULGH /36f IRU KRXUV SULRU WR LVRODWLRQ RI 51$ 7KH PLGGOH SDQHO VKRZV FHOOV WKDW ZHUH VWLPXODWHG ZLWK 71)D IRU KRXUV SULRU WR LVRODWLRQ RI 51$ 7KH ORZHU SDQHO VKRZV FHOOV WKDW ZHUH VWLPXODWHG ZLWK ,/LS IRU KRXUV SULRU WR 51$ LVRODWLRQ K*+ UHIHUV WR WKH UHSRUWHU JHQH SURGXFW LQ HDFK YHFWRU

PAGE 96

ff 2ULHQWDWLRQ ff 2ULHQWDWLRQ :7 6LWH 6LWH :7 6LWH 6LWH /36 L L L L  L L K*+ ff 2ULHQWDWLRQ ff 2ULHQWDWLRQ :7 6LWH 6LWH :7 6LWH 6LWH 71)D L L L K*+ rrrrr ff 2ULHQWDWLRQ ff 2ULHQWDWLRQ :7 6LWH 6LWH :7 6LWH 6LWH ,/OS L ‘ L L L L K*+ 0IW 0Wn+r 0P m08 0PP 0P mf

PAGE 97

'LVFXVVLRQ $ QXPEHU RI HXNDU\RWLF JHQHV ZLWK FRPSOH[ HQKDQFHU HOHPHQWV H[LVW LQ WKH OLWHUDWXUH VXFK DV LQWHUIHURQ .LP DQG 0DQLDWLV 0HULND HW DO f 7FHOO UHFHSWRU D *LHVH HW DO 0D\DOO HW DO f LQWHUOHXNLQ +HQNHO DQG %URZQ 5DQJDQDWK HW DO f DQG XURNLQDVH 'H &HVDUH HW DO 'H &HVDUH HW DO f :LWKLQ WKH FHOO PXOWLSOH IDFWRUV QRW RQO\ SDUWLFLSDWH LQ WKH LQLWLDWLRQ RI WUDQVFULSWLRQ EXW DOVR VKDUH DQ DFWLYH UROH LQ WKH UHJXODWLRQ RI JHQH H[SUHVVLRQ ,Q DGGLWLRQ IURP WKH GDWD DYDLODEOH RQ HXNDU\RWLF WUDQVFULSWLRQ LW LV FOHDU WKDW WKH PHFKDQLVPV E\ ZKLFK WUDQVFULSWLRQ LV UHJXODWHG DUH WUHPHQGRXVO\ FRPSOH[ 7KH GDWD VKRZQ KHUH LQ WKLV FKDSWHU ZRXOG DJUHH ZLWK ILQGLQJV RI RWKHU LQYHVWLJDWRUV UHJDUGLQJ WKH FRPSOH[ WUDQVFULSWLRQ IDFWRU ELQGLQJ SDWWHUQV LQ LQGXFLEOH HQKDQFHU HOHPHQWV 3HUKDSV WKH PRVW VWXGLHG HXNDU\RWLF HQKDQFHU HOHPHQW WKH LQWHUIHURQ HQKDQFHU GHPRQVWUDWHV WKH FRPELQDWRULDO FRPSOH[LW\ RI LQGXFLEOH HQKDQFHUV ,Q YLWUR LW UHTXLUHV WKH ELQGLQJ RI ILYH GLIIHUHQW '1$ ELQGLQJ SURWHLQV LQ RUGHU WR VLPXODWH WKH LQ YLYR OHYHOV RI LQGXFLEOH JHQH H[SUHVVLRQ 7KH 0Q62' HQKDQFHU HOHPHQW OLNHO\ UHTXLUHV D VLPLODU FRPSOH[ FRPELQDWLRQ RI '1$ ELQGLQJ SURWHLQV WR VLPXODWH WKH LQ YLYR OHYHOV RI LQGXFLEOH H[SUHVVLRQ 7KH LQ YLYR IRRWSULQWLQJ GDWD ZRXOG VXJJHVW WKDW PXOWLSOH SURWHLQV ELQG ZLWKLQ WKH HQKDQFHU HOHPHQW )LJXUH f )URP WKH HQKDQFHU PXWDJHQHVLV H[SHULPHQWV ZRXOG SURSRVH WKDW LQWHUDFWLRQ RI WKH HQKDQFHU HOHPHQW ZLWK PXOWLSOH '1$ ELQGLQJ SURWHLQV LV QHFHVVDU\ WR DFKLHYH WKH LQGXFLEOH H[SUHVVLRQ VHHQ LQ YLYR 0XWDWLRQV FUHDWHG ZLWKLQ WKH HQKDQFHU DW VLWH DSSHDU WR GLVUXSW WKH LQGXFLEOH OHYHOV RI WUDQVFULSWLRQ DV FRPSDUHG WR WKH ZLOGW\SH :7f YHFWRU )LJXUHV DQG f

PAGE 98

$ SURWHLQ ELQGLQJ DW WKH SXWDWLYH VLWH PD\ EH IRXQG LQ IXUWKHU H[SHULPHQWV WR EH D FUXFLDO PHPEHU RI WKH SURWHLQ '1$ HQKDQFHU FRPSOH[ $OVR ZKHQ PXWDWLRQV ZHUH PDGH LQGLYLGXDOO\ DW VLWHV D DQG E QR VLJQLILFDQW UHGXFWLRQ LQ LQGXFLEOH JHQH H[SUHVVLRQ ZDV VHHQ )LJXUH f :KHQ WKH PXWDWHG VLWHV ZHUH FRPELQHG LQ D VLQJOH YHFWRU D UHGXFWLRQ LQ WKH DPRXQW RI LQGXFLEOH H[SUHVVLRQ ZDV REVHUYHG QRW XQOLNH WKDW VHHQ LQ WKH GHOHWLRQ H[SHULPHQWV RI FKDSWHU )LJXUHV % DQG %f 6R WKHUH PD\ EH DQRWKHU SXWDWLYH SURWHLQ WKDW LV LQWHJUDO WR WKH LQGXFLEOH DFWLYLW\ RI WKH HQKDQFHU 7KLV DGGLWLRQDO GDWD OHQGV IXUWKHU VXSSRUW IRU WKH K\SRWKHVLV WKDW WKLV LV D FRPSOH[ HQKDQFHU ZLWK LQWHUDFWLQJ HOHPHQWV 0DQ\ PRUH H[SHULPHQWV ZLOO QHHG WR EH GRQH ZLWK WKLV UHJXODWRU\ HOHPHQW 0RUH LQ YLYR IRRWSULQWLQJ GDWD ZLOO EH QHFHVVDU\ WR JHW D FOHDU SLFWXUH RI WKH SURWHLQV ELQGLQJ WR ERWK VWUDQGV RI WKH HQKDQFHU HOHPHQW 3HUKDSV D GLIIHUHQW WHFKQLTXH RI IRRWSULQWLQJ VXFK DV '1DVH IRRWSULQWLQJ PD\ GHOLQHDWH WKH SURWHLQ ERXQGDULHV EHWWHU WKDQ '06 IRRWSULQWLQJ VLQFH WKH *& UDWLR RI WKLV UHJLRQ RI WKH 0Q62' JHQH LV RQO\ DERXW b FRPSDUHG WR WKH SURPRWHU ZKLFK LV RYHU b *&ULFK )XUWKHU FRPELQDWLRQV RI PXWDJHQHVLV FRPELQHG ZLWK WUDQVLHQW WUDQVIHFWLRQV PD\ DQVZHU WKH TXHVWLRQV UHJDUGLQJ WKH FRRSHUDWLYLW\ RI WKH SURWHLQV ELQGLQJ LQ WKLV UHJXODWRU\ UHJLRQ 3HUKDSV UDWKHU WKDQ PXWDJHQHVLV VLPSO\ DOWHULQJ WKH SKDVLQJ E\ LQVHUWLQJ '1$ ESf LQ NH\ UHJLRQV EHWZHHQ SXWDWLYH ELQGLQJ VLWHV PD\ EH HQRXJK WR GLVUXSW WKH SURWHLQ FRPSOH[ IRUPDWLRQ )LQDOO\ FORQLQJ WKH IDFWRUV ELQGLQJ WR WKH LPSRUWDQW SXWDWLYH ELQGLQJ VLWHV ZLWKLQ WKH HQKDQFHU ZLOO EH QHFHVVDU\ WR DOORZ HYDOXDWLRQ RI WKH LQGXFLEOH WUDQVFULSWLRQDO UHJXODWLRQ LQ DQ LQ YLWUR V\VWHP

PAGE 99

&+$37(5 5($&7,9( 2;<*(1 63(&,(6 $1' 0,72&+21'5,$7218&/(86 6,*1$/,1* ,QWURGXFWLRQ 0DQJDQHVH VXSHUR[LGH GLVPXWDVH 0Q62'f D YLWDO DQWLR[LGDQW HQ]\PH ORFDOL]HG WR WKH PLWRFKRQGULDO PDWUL[ FDWDO\]HV WKH GLVPXWDWLRQ RI VXSHUR[LGH DQLRQV 2nf WR K\GURJHQ SHUR[LGH +2f ,Q DHURELF FHOOV WKH PLWRFKRQGULDO HOHFWURQ WUDQVSRUW FKDLQ LV SUREDEO\ WKH PRVW DEXQGDQW VRXUFH RI f $W DWPRVSKHULF R[\JHQ FRQFHQWUDWLRQV LW LV HVWLPDWHG WKDW EHWZHHQ WR b RI WKH 2 UHGXFHG LQ WKH PLWRFKRQGULDO HOHFWURQ WUDQVSRUW FKDLQ GXULQJ $73 SURGXFWLRQ PD\ IRUP Af&KDQFH HW DO %H\HU 1RKO HW DO f $OWKRXJK &AnDQG RWKHU UHDFWLYH R[\JHQ VSHFLHV 526f DUH E\SURGXFWV RI QRUPDO UHVSLUDWLRQ LPEDODQFH RU ORVV RI FHOOXODU KRPHRVWDVLV UHVXOWV LQ R[LGDWLYH VWUHVV FDXVLQJ GDPDJH WR FHOOXODU FRPSRQHQWV OLSLG PHPEUDQHV SURWHLQV DQG QXFOHLF DFLGV )UHHPDQ DQG &UDSR )ULGRYLFK f 0Q62' DFWV DV WKH ILUVW OLQH RI FHOOXODU GHIHQVH WR GHWR[LI\ WKHVH n)ULGRYLFK f 9DULRXV LQIODPPDWRU\ PHGLDWRUV 71)D ,/ 3 ,/ DQG /36f LQ PXOWLSOH WLVVXHV KDYH EHHQ GHPRQVWUDWHG WR HOLFLW GUDPDWLF HOHYDWLRQV RI ERWK WKH PHVVHQJHU 51$ DQG SURWHLQ OHYHOV RI 0Q62' 9LVQHU HW DO 'RXJDOO DQG 1LFN 9LVQHU HW DO 9DOHQWLQH DQG 1LFN 9LVQHU HW DO (DVWJDWH HW DO f 7KH LQFUHDVHG OHYHOV RI 0Q62' KDYH EHHQ VKRZQ WR EH F\WRSURWHFWLYH :RQJ DQG *RHGGHO :RQJ HW DO :DUQHU HW DO :LVSH HW DO f +RZHYHU WKH VLJQDOLQJ

PAGE 100

SDWKZD\V UHVSRQVLEOH IRU 0Q62' H[SUHVVLRQ DUH QXPHURXV DQG DUH VWLOO IDU IURP EHLQJ IXOO\ HOXFLGDWHG (ODERUDWH LQWHUFRPPXQLFDWLRQV WDNH SODFH EHWZHHQ WKH QXFOHXV DQG PLWRFKRQGULD FRRUGLQDWLQJ QRW RQO\ PLWRFKRQGULDO JHQH H[SUHVVLRQ DQG JHQRPH PDLQWHQDQFH EXW DOVR QXFOHDU JHQH H[SUHVVLRQ 3R\WRQ DQG 0F(ZHQ f 7KH FODVVLF YLHZ KDV EHHQ WKDW PLWRFKRQGULD VLPSO\ IXQFWLRQ DV RUJDQHOOHV UHVSRQGLQJ WR FKDQJHV LQ HQHUJ\ GHPDQG +RZHYHU UHFHQW GDWD ZRXOG VXJJHVW D PRUH FRPSOH[ SLFWXUH ZKHUH PLWRFKRQGULD DOVR IXQFWLRQ DV DFWLYH VLJQDOLQJ RUJDQHOOHV LQ D QXPEHU RI LPSRUWDQW LQWUDFHOOXODU SDWKZD\V 6XUSLQ DQG &KRU\ ,FKDV DQG 0D]DW 0LJQRWWH DQG 9D\VVLHUH &KDQGHO DQG 6FKXPDFNHU f $Q H[DPSOH RI VXFK D FRPSOH[ VLJQDOLQJ SDWKZD\ ZRXOG EH WKH UROH WKDW PLWRFKRQGULD SOD\ LQ UHJXODWLQJ FHOOXODU DSRSWRVLV LQLWLDWHG E\ 71)D DW PHPEUDQH UHFHSWRUV 'XULH] HW DO f ,W LV ZHOO GRFXPHQWHG WKDW 71)D ELQGLQJ WR PHPEUDQH UHFHSWRUV WULJJHUV FRPSOH[ VLJQDO WUDQVGXFWLRQ FDVFDGHV )HQJ HW DO :DUQHU HW DO 'H .HXOHQDHU HW DO f VRPH RI ZKLFK UHVXOW LQ H[FHVV 526 SURGXFWLRQ LQ WKH PLWRFKRQGULD 6FKXO]H2VWKRII 6FKXO]H2VWKRII f 7KH F\WRFLGDOHIIHFW RI WKHVH 526 LV HLWKHU GLUHFW RU QHFHVVDU\ IRU GRZQVWUHDP VLJQDOLQJ HYHQWV OHDGLQJ WR FHOO GHDWK 7KH FUXFLDO WR[LF UROH RI 526 ZDV GHPRQVWUDWHG E\ WKH LQKLELWLRQ RI PLWRFKRQGULDO HOHFWURQ WUDQVSRUW DW VSHFLILF VLWHV ZKLFK GLIIHUHQWLDOO\ LQWHUIHUHV ZLWK 71)DPHGLDWHG F\WRWR[LFLW\ 6FKXO]H2VWKRII f DQG E\ WKH FRUUHODWLRQ EHWZHHQ VHQVLWLYLW\ WR 71)D F\WRWR[LFLW\ DQG PLWRFKRQGULDO DFWLYLW\ LQ WKH FHOO 6FKXO]H2VWKRII f 3KDUPDFRORJLFDO H[SHULPHQWV UHYHDOHG WKDW WKH PLWRFKRQGULDO UHVSLUDWRU\ FKDLQ LV WKH PDMRU VRXUFH RI 71)DLQGXFHG 526 6FKXO]H2VWKRII 6FKXO]H2VWKRII

PAGE 101

*RRVVHQV HW DO f $QWLR[LGDQWV LQKLELW YDULRXV DFWLRQV RI 71)D WUDQVFULSWLRQ IDFWRU DFWLYDWLRQ JHQH H[SUHVVLRQ DQG F\WRWR[LFLW\f DQG H[RJHQRXVO\ DGGHG 526 PLPLF LWV ELRORJLFDO DFWLRQ .LQQXOD HW DO $UDL HW DO *RWWOLHE HW DO f 2XU GDWD ZRXOG DJUHH ZLWK WKH OLWHUDWXUH UHJDUGLQJ 526 DQG 71)D 6LQFH WKH VXSHUR[LGH UDGLFDO D FHQWUDO 526 LV WKH VXEVWUDWH IRU 0Q62' LW ZRXOG OHDG WR UHDVRQ WKDW WKH OHYHO RI LQWUDFHOOXODU 526 PLJKW UHJXODWH 0Q62' WUDQVFULSWLRQ ,Q WKLV GLVVHUWDWLRQ VKRZ WKDW LQKLELWLRQ RI PLWRFKRQGULDO HOHFWURQ WUDQVSRUW UHVXOWV LQ WKH ORVV RI 71)DVWLPXODWHG 0Q62' H[SUHVVLRQ PRVW OLNHO\ GXH WR WKH ORVV RI PLWRFKRQGULDWRQXFOHXV VLJQDOLQJ ZLWK 526 DFWLQJ DV WKH VHFRQGPHVVHQJHU LQ WKH VLJQDO WUDQVGXFWLRQ SDWKZD\ ,Q DGGLWLRQ GHPRQVWUDWH WKDW DOWKRXJK LQIODPPDWRU\ PHGLDWRUV 71)D ,/OS DQG /36f PD\ HOLFLW VLPLODU LQGXFLEOH P51$ OHYHOV RI 0Q62' WKH VLJQDOLQJ SDWKZD\V OHDGLQJ WR WKLV H[SUHVVLRQ DUH YHU\ GLIIHUHQW 5HVXOWV 0LWRFKRQGULDO (OHFWURQ 7UDQVSRUW ,QKLELWRUV 0RGXODWH 71)D,QGXFHG ([SUHVVLRQ RI 0Q62' LQ 3XOPRQDU\ (SLWKHOLDO &HOOV 3UHYLRXV DQDO\VLV RI WKH HIIHFWV RI PLWRFKRQGULDO HOHFWURQ WUDQVSRUW FKDLQ LQKLELWRUV VKRZHG WKDW GHSHQGLQJ RQ WKH LQKLELWRUfV VLWH RI DFWLRQ WKH F\WRWR[LFLW\ RI 71)D ZDV HLWKHU LQFUHDVHG RU GHFUHDVHG 6FKXO]H2VWKRII f $ VFKHPDWLF RI WKH PLWRFKRQGULDO UHVSLUDWRU\ FKDLQ LV VKRZQ LQ )LJ $ %DVHG RQ HDUOLHU H[SHULPHQWV GHPRQVWUDWLQJ VWLPXODWHG H[SUHVVLRQ RI 0Q62' P51$ IROORZLQJ WUHDWPHQW RI D UDW SXOPRQDU\ HSLWKHOLDOOLNH FHOO OLQH / FHOOVf ZLWK LQIODPPDWRU\ PHGLDWRUV 9LVQHU HW DO 9LVQHU HW DO f LQLWLDWHG VWXGLHV WR HYDOXDWH WKH HIIHFW RI 71)D RQ 0Q62' H[SUHVVLRQ LQ FHOOV DOVR WUHDWHG ZLWK PLWRFKRQGULDO UHVSLUDWRU\ FKDLQ LQKLELWRUV

PAGE 102

)LJXUH $ 6LPSOLILHG VFKHPH RI WKH UHVSLUDWRU\ FKDLQ VKRZLQJ VLWHV RI VXEVWUDWH HQWU\ LQKLELWRU DFWLRQ DQG SRWHQWLDO VLWHV RI VXSHUR[LGH DQLRQ IRUPDWLRQ &\W F\WRFKURPH 84 XELTXLQRQH )H6 LURQ VXOIXU FHQWHU +412 KHSW\O K\GUR[\TXLQROLQH 1R[LGH % 1RUWKHUQ DQDO\VLV RI 51$ IURP SXOPRQDU\ HSLWKHOLDO FHOOV H[SRVHG WR 71)D DQGRU PLWRFKRQGULDO LQKLELWRUV ,QKLELWLRQ RI 71)DVWLPXODWHG LQGXFWLRQ RI 0Q62' E\ DPREDUELWDO DQG P0f DQG DQWLP\FLQ $ DQG P0f LQ UDW SXOPRQDU\ HSLWKHOLDO FHOOV / FHOOVf HLWKHU XQWUHDWHG RU WUHDWHG ZLWK PLWRFKRQGULDO LQKLELWRUV DORQH RU LQ FRPELQDWLRQ ZLWK 71)D QJPOf RU ZLWK 71)D DORQH &RQWURO ODQHV DQG FRQWDLQ DQG b HWKDQRO ZKLFK ZHUH XVHG DV WKH VROYHQW IRU DOO LQKLELWRUV QRW VROXEOH LQ ZDWHU

PAGE 103

&203/(; &R 1$'+ $PREDUELWDO ? &203/(; ,,, 84!F\W EAF\W F & F\W F Hn &203/(; ‘ R &203/(; ,9 a H
PAGE 104

)LJ ,% LOOXVWUDWHV WKH HIIHFWV RI WUHDWPHQW RI / FHOOV ZLWK DQWLP\FLQ $ RU DPREDUELWDO DQGRU 71)D 7KH FRQWURO VDPSOHV H[KLELW D ORZ FRQVWLWXWLYH OHYHO RI H[SUHVVLRQ RI 0Q62' P51$ $GGLWLRQ RI DQWLP\FLQ $ RU DPREDUELWDO DW LQFUHDVLQJ FRQFHQWUDWLRQV 6FKXO]H2VWKRII f GLG QRW DIIHFW WKLV FRQVWLWXWLYH 0Q62' P51$ H[SUHVVLRQ 0D[LPDO LQGXFWLRQ RI 0Q62' P51$ OHYHOV ZLWK 71)D RFFXUV DIWHU KRXUV DQG WKXV WKLV WLPH SRLQW ZDV VHOHFWHG IRU LVRODWLRQ RI 51$ IRU QRUWKHUQ DQDO\VLV &RWUHDWPHQW ZLWK 71)D DQG DQWLP\FLQ $ VLPXOWDQHRXVO\ FDXVHG D PDUNHG GHFUHDVH LQ 0Q62' P51$ H[SUHVVLRQ DW ERWK FRQFHQWUDWLRQV RI DQWLP\FLQ $ 6FKXO]H2VWKRII f $PREDUELWDO ZKLFK EORFNV HOHFWURQ WUDQVIHU WKURXJK FRPSOH[ )LJ $f KDG PLQLPDO HIIHFW RQ 71)DLQGXFHG H[SUHVVLRQ RI 0Q62' P51$ FRPSDUHG WR DQWLP\FLQ $ 0LFURVFRSLF H[DPLQDWLRQ DW KRXUV VKRZHG QR DSSDUHQW GLIIHUHQFH LQ WKH FHOOXODU YLDELOLW\ EHWZHHQ FRQWURO DQG WUHDWHG FHOOV $QWLP\FLQ $ 6WURQJO\ 'HFUHDVHV 71)D,QGXFLEOH 0Q62' ([SUHVVLRQ LQ 3XOPRQDU\ (QGRWKHOLDO &HOOV :LWK WKH UHVXOWV VKRZQ LQ )LJ ,% ZH SURFHHGHG WR HYDOXDWH WKH FHOOXODU VSHFLILFLW\ RI WKH PLWRFKRQGULDO LQKLELWRU DQWLP\FLQ $ VWXG\LQJ LWV HIIHFWV RQ DQRWKHU FHOO W\SH WKH UDW SXOPRQDU\ DUWHU\ HQGRWKHOLDO FHOO OLQH 9$ FHOOV 9LVQHU HW DO f 2EVHUYLQJ WKDW WKH WZR FRQFHQWUDWLRQV RI DQWLP\FLQ $ XVHG LQ WKH SXOPRQDU\ HSLWKHOLDO FHOO H[SHULPHQWV )LJ ,%f JDYH VLPLODU UHVXOWV LQ WKH LQKLELWLRQ RI 71)DVWLPXODWHG 0Q62' P51$ OHYHOV DQG EDVHG RQ WKDW IDFW WKDW PXFK ORZHU FRQFHQWUDWLRQV RI DQWLP\FLQ $ DUH HIIHFWLYH DW LQKLELWLQJ PLWRFKRQGULDO HOHFWURQ WUDQVSRUW ZH WHVWHG

PAGE 105

)LJXUH $ 1RUWKHUQ DQDO\VLV RI 51$ IURP SXOPRQDU\ DUWHU\ HQGRWKHOLDO FHOOV H[SRVHG WR 71)D DQGRU DQWLP\FLQ $ ,QKLELWLRQ RI 71)DVWLPXODWHG LQGXFWLRQ RI 0Q62' E\ DQWLP\FLQ $ LQ UDW SXOPRQDU\ HQGRWKHOLDO FHOOV 9$ FHOOVf HLWKHU XQWUHDWHG RU WUHDWHG ZLWK LQFUHDVLQJ FRQFHQWUDWLRQV RI DQWLP\FLQ $ DORQH RU LQ FRPELQDWLRQ ZLWK 71) D QJPOf RU ZLWK 71)D DORQH % 1RUWKHUQ DQDO\VLV RI 51$ IURP SXOPRQDU\ DUWHU\ HQGRWKHOLDO FHOOV H[SRVHG WR 71)D DQG P\[RWKLD]ROH ,QKLELWLRQ RI 71)DVWLPXODWHG LQGXFWLRQ RI 0Q62' LQ UDW SXOPRQDU\ HQGRWKHOLDO FHOOV 9$ FHOOVf HLWKHU XQWUHDWHG RU WUHDWHG ZLWK LQFUHDVLQJ FRQFHQWUDWLRQV RI P\[RWKLD]ROH DORQH RU LQ FRPELQDWLRQ ZLWK 71)D QJPOf RU 71)D DORQH

PAGE 106

$QWLP\FLQ S0f 71)D 0Q62' &DWKHSVLQ % f f r} $ 71)D 0\[RWKLR]ROH MLJPOf 0Q62' 8 P }X WRVW X DX L &DWKHSVLQ % ArrrrrrtWrtArLWRrPrrAr6rt f f %

PAGE 107

FRQFHQWUDWLRQV IURP WR S0 WR ILQG WKH RSWLPXP LQKLELWRU\ FRQFHQWUDWLRQ LQ WKH 9$ FHOOV )LJ $ LOOXVWUDWHV WKH HIIHFWV RI LQFUHDVLQJ FRQFHQWUDWLRQV RI DQWLP\FLQ $ RQ 0Q62' P51$ OHYHOV 7KH PD[LPDO LQKLELWLRQ ZDV DFKLHYHG DW D FRQFHQWUDWLRQ RI S0 8VLQJ WKLV FRQFHQWUDWLRQ RI DQWLP\FLQ $ WHVWHG WKH HIIHFW RQ 71)DVWLPXODWHG H[SUHVVLRQ RYHU KRXUV 7KH PD[LPDO LQKLELWLRQ DSSHDUV WR RFFXU EHWZHHQ WR KRXUV ZKHQ ERWK 71)D DQG DQWLP\FLQ $ DUH DGGHG VLPXOWDQHRXVO\ GDWD QRW VKRZQf )XUWKHUPRUH WKH VHTXHQFH RI DGGLWLRQ RI 71)D RU DQWLP\FLQ $ WR WKH FHOOV ZDV LPSRUWDQW IRU WKH 71)DVWLPXODWHG H[SUHVVLRQ RI 0Q62' P51$ ,I 71)D ZDV DGGHG DV OLWWOH DV PLQXWHV SULRU WR DQWLP\FLQ $ WKH GLPLQXWLRQ RI WKH LQGXFLEOH H[SUHVVLRQ ZDV GUDPDWLFDOO\ UHGXFHG GDWD QRW VKRZQf 2WKHU LQYHVWLJDWRUV KDYH IRXQG WKDW SUHWUHDWPHQW RI / FHOOV ZLWK PLWRFKRQGULDO LQKLELWRUV UHVXOWHG LQ D VLJQLILFDQW GHFUHDVH LQ ELQGLQJ RI 71) WR FHOO VXUIDFH UHFHSWRUV 6DQFKH]$OFD]DU HW DO f 7KXV DOO WKH FHOO WUHDWPHQWV LQ WKHVH H[SHULPHQWV ZHUH GRQH VLPXOWDQHRXVO\ 7UHDWPHQW RI ERWK SXOPRQDU\ HSLWKHOLDO DQG HQGRWKHOLDO FHOOV ZLWK WKH FRPSOH[ ,,, LQKLELWRU DQWLP\FLQ $ VKRZHG GUDPDWLF LQKLELWLRQ RI 71)DLQGXFWLRQ RI 0Q62' P51$ :LWK WKLV LQ PLQG GHFLGHG WR WHVW ZKHWKHU DQRWKHU FRPSOH[ ,,, LQKLELWRU ZRXOG JLYH VLPLODU UHVXOWV 7KH LQKLELWRUV DQWLP\FLQ $ DQG P\[RWKLD]RO ERWK EORFN HOHFWURQ WUDQVSRUW DW WKH F\WRFKURPH ELF VHJPHQW RI WKH PLWRFKRQGULDO UHVSLUDWRU\ FKDLQ EXW DW GLIIHUHQW ELQGLQJ VLWHV 7KLHUEDFK DQG 5HLFKHQEDFK ,ZDWD HW DO f )LJ % VKRZV WKH HIIHFWV RI LQFUHDVLQJ FRQFHQWUDWLRQV RI P\[RWKLD]RO RQ 71)DVWLPXODWHG H[SUHVVLRQ RI 0Q62' P51$ 7KH H[WHQW RI LQKLELWLRQ E\ P\[RWKLD]RO LV YHU\ VLPLODU WR WKH SDWWHUQ REVHUYHG IRU DQWLP\FLQ $ ZKLFK PLJKW EH H[SHFWHG FRQVLGHULQJ WKH SUR[LPLW\ RI WKH ELQGLQJ RI DQWLP\FLQ DQG P\[RWKLD]ROH LQ WKH F\WRFKURPH EMF FU\VWDO VWUXFWXUH

PAGE 108

,ZDWD HW DO f ,QWHUHVWLQJO\ WKH LQKLELWLRQ RI JHQH H[SUHVVLRQ E\ WKHVH HOHFWURQ WUDQVSRUW LQKLELWRUV LV H[TXLVLWHO\ VSHFLILF VLQFH KHSW\OK\GUR[\TXLQROLQH 1R[LGH +412f ZKLFK DOVR LQKLELWV FRPSOH[ ,,, EXW DW D GLIIHUHQW VLWH GRHV QRW DOWHU 71) LQGXFWLRQ RI 0Q62' GDWD QRW VKRZQf 7KHVH UHVXOWV ZRXOG VXJJHVW WKDW LQKLELWLRQ RI PLWRFKRQGULDO HOHFWURQ WUDQVSRUW DW FRPSOH[ ,,, DOWHUV SURGXFWLRQ RI 526 WKDW FDQ DFW LQ UHWURJUDGH FRPPXQLFDWLRQ ZLWK WKH QXFOHXV 7KH 6LJQDOLQJ 3DWKZD\ IRU 71)D ,V 'LIIHUHQW IURP WKH 3DWKZD\V IRU /36 RU ,/ 6WLPXODWHG ([SUHVVLRQ RI 0Q62' 3UHYLRXVO\ LW KDV EHHQ VKRZQ WKDW ERWK OLSRSRO\VDFFDULGH /36f DQG LQWHUOHXNLQ ,/f DOVR LQGXFH H[SUHVVLRQ RI 0Q62' LQ ERWK SXOPRQDU\ HSLWKHOLDO DQG HQGRWKHOLDO FHOOV 9LVQHU HW DO 9LVQHU HW DO f 0D[LPDO LQGXFWLRQ RFFXUV DW WR KRXUV VLPLODU WR 71)D 7R HYDOXDWH ZKHWKHU VLJQDOLQJ SDWKZD\V IRU DOO WKUHH LQIODPPDWRU\ PHGLDWRUV ZHUH VLPLODU ZKHQ PLWRFKRQGULDO UHVSLUDWLRQ LV LQKLELWHG ZLWK DQWLP\FLQ $ H[DPLQHG WKH HIIHFW WKDW LQFUHDVLQJ FRQFHQWUDWLRQV RI DQWLP\FLQ $ KDG RQ WKH /36 DQG ,/VWLPXODWHG H[SUHVVLRQ RI 0Q62' LQ 9$ FHOOV )LJ $f 2QO\ DW WKH KLJKHVW FRQFHQWUDWLRQ RI DQWLP\FLQ $ GLG WKH OHYHO RI VWLPXODWHG H[SUHVVLRQ RI 0Q62' YDU\ HYHQ VOLJKWO\ IURP /36 RU ,/ DORQH 7KLV ZRXOG VXJJHVW WKDW WKH LQWUDFHOOXODU VLJQDOLQJ SDWKZD\ RI 71)D LV GLIIHUHQW IURP WKDW RI /36 RU ,/ 71)DVWLPXODWHG H[SUHVVLRQ RI 0Q62' LV XQDIIHFWHG E\ DQWLP\FLQ $ LQ D UHVLVWDQW ILEUREODVW FHOO OLQH 7R GHPRQVWUDWH WKDW WKH HIIHFWV RI DQWLP\FLQ $ DUH GLUHFWO\ DVVRFLDWHG ZLWK PLWRFKRQGULDO LQKLELWLRQ DQG QRW GXH WR RWKHU SRVVLEOH VLGH HIIHFWV REWDLQHG DQ DQWLP\FLQUHVLVWDQW PRXVH ILEUREODVW PXWDQW FHOO OLQH /$ +RZHOO HW DO f ,Q WKLV PXWDQW WKH UDWH RI UHVSLUDWLRQ LV QRUPDO EXW HOHFWURQ WUDQVSRUW WKURXJK WKH

PAGE 109

)LJXUH $ 1RUWKHUQ DQDO\VLV RI 51$ IURP SXOPRQDU\ DUWHU\ HQGRWKHOLDO FHOOV H[SRVHG WR OLSRSRO\VDFFDULGH /36f RU LQWHUOHXNLQ DQGRU DQWLP\FLQ $ ,QKLELWLRQ RI /36 DQG ,/VWLPXODWHG LQGXFWLRQ RI 0Q62' LQ UDW SXOPRQDU\ HQGRWKHOLDO FHOOV 9$ FHOOVf HLWKHU XQWUHDWHG RU WUHDWHG ZLWK LQFUHDVLQJ FRQFHQWUDWLRQV RI DQWLP\FLQ $ DORQH RU LQ FRPELQDWLRQ ZLWK /36 PJPOf RU ,/LS QJPOf RU ZLWK /36 RU ,/ DORQH % 1RUWKHUQ DQDO\VLV RI 51$ IURP DQWLPF\LQUHVLVWDQW PXULQH ILEUREODVW FHOOV H[SRVHG WR 71)D DQGRU DQWLP\FLQ $ ,QKLELWLRQ RI 71)DVWLPXODWHG LQGXFWLRQ RI 0Q62' LQ D PXULQH ILEUREODVW DQWLP\FLQUHVLVWDQW FHOO OLQH /$ f HLWKHU XQWUHDWHG RU WUHDWHG ZLWK LQFUHDVLQJ FRQFHQWUDWLRQV RI DQWLP\FLQ $ DORQH RU LQ FRPELQDWLRQ ZLWK 71)D QJPOf RU 71)D DORQH

PAGE 110

$QWLP\FLQ S0f f ,/ /36 0Q62' &DWKHSVLQ % XXLWL L XXXP $ 71)D $QWLP\FLQ S0f f 0Q62' &DWKHSVLQ % mmmmL Y!: A %

PAGE 111

VXFFLQDWHF\WRFKURPH F R[LGRUHGXFWDVH VHJPHQW RI WKH PLWRFKRQGULDO UHVSLUDWRU\ FKDLQ ZKLFK LQFOXGHV F\WRFKURPH E VKRZV UHVLVWDQFH WR LQKLELWLRQ E\ DQWLP\FLQ $ )LJ % LOOXVWUDWHV WKH HIIHFW RI 71)D RQ WKH H[SUHVVLRQ RI 0Q62' LQ WKH PXWDQW /$ FHOOV VKRXOG SRLQW RXW WKDW SUHYLRXVO\ LW KDV EHHQ GHPRQVWUDWHG WKDW WKH ILYH VHSDUDWH 0Q62' P51$ WUDQVFULSWV LQ WKH UDW UHVXOW IURP DOWHUQDWLYH SRO\DGHQ\ODWLRQ +XUW HW DO f KRZHYHU WKHUH DUH RQO\ WZR PXULQH 0Q62' WUDQVFULSWV DW .E DQG .E $W FRQFHQWUDWLRQV RI DQWLP\FLQ $ YDU\LQJ IURP WR S0 71)D FRQWLQXHG WR LQGXFH 0Q62' P51$ OHYHOV GHPRQVWUDWLQJ WKH VSHFLILFLW\ RI WKH DQWLP\FLQ DFWLRQ LQ 9$ FHOOV ,QKLELWLRQ RI 0LWRFKRQGULDO $73DVH ZLWK 2OLJRP\FLQ DOVR 5HSUHVVHV 71)D 6WLPXODWHG ([SUHVVLRQ RI 0Q62' 2OLJRP\FLQ ZKLFK LQKLELWV )L)R $73DVH FDXVHV XQFRXSOLQJ RI PLWRFKRQGULDO UHVSLUDWRU\ HOHFWURQ WUDQVSRUW DQG $73DVH DFWLYLW\ 3UHYLRXV ZRUN E\ RWKHU LQYHVWLJDWRUV KDV GHPRQVWUDWHG WKDW FHOOV WUHDWHG ZLWK 71)D UHVXOWV LQ DQ LQFUHDVH LQ ROLJRP\FLQ VHQVLWLYH PLWRFKRQGULDO UHVSLUDWLRQ 6DQFKH]$OFD]DU HW DO f ZLWK WKH UHVXOWDQW LQFUHDVH LQ 526 +RZHYHU FHOOV WUHDWHG ZLWK ERWK 71)D DQG ROLJRP\FLQ UHVXOWHG LQ GHFUHDVHG OHYHOV RI FHOOXODU $73 DV ZHOO DV EORFNDGH RI WKH LQFUHDVH LQ 526 JHQHUDWLRQ 6DQFKH]$OFD]DU HW DO f 7R HYDOXDWH ZKHWKHU ROLJRP\FLQ WUHDWPHQW RI 9$ FHOOV ZRXOG LQKLELW 71)DLQGXFWLRQ RI 0Q62' WUHDWHG 9$ FHOOV ZLWK LQFUHDVLQJ FRQFHQWUDWLRQV RI ROLJRP\FLQ LQ WKH SUHVHQFH DQG DEVHQFH RI 71)D 7KH UHVXOWV VKRZQ LQ )LJ ZRXOG LQGLFDWH WKDW ROLJRP\FLQ LQKLELWV 71)DLQGXFLEOH 0Q62' H[SUHVVLRQ DQG WKDW WKLV LQKLELWLRQ LV OLNHO\ GXH WR WKH GHFUHDVHG PLWRFKRQGULDO $73 DQGRU 526 OHYHOV

PAGE 112

)LJXUH 1RUWKHUQ DQDO\VLV RI 51$ IURP SXOPRQDU\ DUWHU\ HQGRWKHOLDO FHOOV H[SRVHG WR 71)D DQG ROLJRP\FLQ ,QKLELWLRQ RI 71)DVWLPXODWHG LQGXFWLRQ RI 0Q62' LQ UDW SXOPRQDU\ HQGRWKHOLDO FHOOV 9$ FHOOVf HLWKHU XQWUHDWHG RU WUHDWHG ZLWK LQFUHDVLQJ FRQFHQWUDWLRQV RI ROLJRP\FLQ DORQH RU LQ FRPELQDWLRQ ZLWK 71)D QJPOf RU 71)D DORQH

PAGE 114

)LJXUH 1RUWKHUQ DQDO\VLV RI 51$ IURP SXOPRQDU\ DUWHU\ HQGRWKHOLDO FHOOV H[SRVHG WR 71)D DQGRU 1DFHW\O F\VWHLQH 1$&f ,QKLELWLRQ RI 71)DVWLPXODWHG LQGXFWLRQ RI 0Q62' LQ SXOPRQDU\ DUWHU\ HQGRWKHOLDO FHOOV 9$ FHOOVf HLWKHU XQWUHDWHG RU WUHDWHG ZLWK YDULRXV LQFUHDVLQJ FRQFHQWUDWLRQV RI 1$& DORQH RU LQ FRPELQDWLRQ ZLWK 71)D QJPOf RU 71)D DORQH

PAGE 115

71)D 1$& S0f 0Q62' PXXX &DWKHSVLQ % P rr

PAGE 116

5HDFWLYH 2[\JHQ 6SHFLHV $UH ,PSRUWDQW IRU 71)D6WLPXODWHG ([SUHVVLRQ RI 0Q62' 6LQFH OHYHOV RI 526 KDYH SUHYLRXVO\ EHHQ VKRZQ WR EH GHFUHDVHG LQ FHOOV WUHDWHG ZLWK DQWLP\FLQ $ %RYHULV DQG &KDQFH 7DQ HW DO f PDGH XVH RI WKH DQWLR[LGDQW 1DFHW\O F\VWHLQH 1$&f WR HYDOXDWH ZKHWKHU 526 VFDYHQJLQJ FDQ PRGXODWH 71)DLQGXFLEOH H[SUHVVLRQ RI 0Q62' 1$& FDXVHG D GRVHGHSHQGHQW GHFUHDVH LQ WKH 71)DVWLPXODWHG H[SUHVVLRQ RI 0Q62' WR EDVHOLQH OHYHOV ZLWK QR GHWHFWDEOH HIIHFW RQ FHOO YLDELOLW\ )LJ f 2I QRWH WKH FRQFHQWUDWLRQV RI 1$& FDSDEOH RI GHFUHDVLQJ 0Q62' H[SUHVVLRQ DUH IDU EHORZ WKH PLOOLPRODU OHYHOV XVHG LQ PXFK RI WKH OLWHUDWXUH GHPRQVWUDWLQJ WKH SRWHQWLDO LPSRUWDQFH RI 526 LQ 71)DPHGLDWHG VLJQDO WUDQVGXFWLRQ DQG WKH VHQVLWLYLW\ RI 526 LQ UHWURJUDGH PLWRFKRQGULDWRQXFOHXV FRPPXQLFDWLRQ 71)D6WLPXODWHG ([SUHVVLRQ RI 0Q62' LQ (QGRWKHOLDO &HOOV ,V 'HSHQGHQW RQ &\WRSODVPLF 3KRVSKROLSDVH $ &3/$f 6HYHUDO VWXGLHV KDYH GHPRQVWUDWHG WKH FRQQHFWLRQ EHWZHHQ DUDFKLGRQLF DFLG DQG PLWRFKRQGULDO 526 SURGXFWLRQ %RQG\ DQG 0DUZDK /L DQG &DWKFDUW &RFHR HW DO :RR HW DO f 7R H[SORUH ZKHWKHU LQKLELWLRQ RI &3/$ DQG WKXV PLWRFKRQGULDO 526 DIIHFW 0Q62' H[SUHVVLRQ ZH XWLOL]HG WKH SRWHQW DQG VHOHFWLYH &3/$ LQKLELWRU DUDFKLGRQ\O WULIOXRURPHWK\O NHWRQH $$&2&)f /L DQG &DWKFDUW f 7KLV LQKLELWRU FDXVHG D GRVHGHSHQGHQW UHSUHVVLRQ RI 0Q62' H[SUHVVLRQ LQ 71)DVWLPXODWHG HQGRWKHOLDO FHOOV )LJ $f ZKHUHDV $$&2&) KDG QR HIIHFW RQ ,/LSVWLPXODWHG FHOOV )LJ %f

PAGE 117

)LJXUH $ 1RUWKHUQ DQDO\VLV RI 51$ IURP SXOPRQDU\ DUWHU\ HQGRWKHOLDO FHOOV H[SRVHG WR 71)D DQGRU F3/$ LQKLELWRU $$&2&)f ,QKLELWLRQ RI 71)DVWLPXODWHG LQGXFWLRQ RI 0Q62' LQ SXOPRQDU\ DUWHU\ HQGRWKHOLDO FHOOV 9$ FHOOVf HLWKHU XQWUHDWHG RU WUHDWHG ZLWK LQFUHDVLQJ FRQFHQWUDWLRQV RI $$&2&) DORQH RU LQ FRPELQDWLRQ ZLWK 71)D QJPOf RU 71)D DORQH % 1RUWKHUQ DQDO\VLV RI 51$ IURP SXOPRQDU\ DUWHU\ HQGRWKHOLDO FHOOV H[SRVHG WR ,/ DQG F3/$ LQKLELWRU $$&2&)f ,QKLELWLRQ RI ,/ VWLPXODWHG LQGXFWLRQ RI 0Q62' LQ SXOPRQDU\ DUWHU\ HQGRWKHOLDO FHOOV HLWKHU XQWUHDWHG RU WUHDWHG ZLWK LQFUHDVLQJ FRQFHQWUDWLRQV RI $$&2&) DORQH RU LQ FRPELQDWLRQ ZLWK ,/ QJPOf RU ,/ DORQH

PAGE 118

71)D KL 00f F3/$,QKLELWRU 0Q62' &DWKHSVLQ % H&9 6 Y n9 ,M r  ‘ } Pr WVL ,0 rrrm}r L ,/OS F3/$ ,QKLELWRU S0f 0Q62' %

PAGE 119

)LJXUH $ 1RUWKHUQ DQDO\VLV RI 51$ IURP SXOPRQDU\ DUWHU\ HQGRWKHOLDO FHOOV H[SRVHG WR 71)D DQGRU NDSSD NLQDVH ,N.f LQKLELWRU %D\ f ,QKLELWLRQ RI 71)DVWLPXODWHG LQGXFWLRQ RI 0Q62' LQ SXOPRQDU\ DUWHU\ HQGRWKHOLDO FHOOV 9$ FHOOVf HLWKHU XQWUHDWHG RU WUHDWHG ZLWK LQFUHDVLQJ FRQFHQWUDWLRQV RI ,N. LQKLELWRU DORQH RU LQ FRPELQDWLRQ ZLWK 71)D QJPOf RU 71)D DORQH % 1RUWKHUQ DQDO\VLV RI 51$ IURP SXOPRQDU\ DUWHU\ HQGRWKHOLDO FHOOV H[SRVHG WR ,/ DQGRU NDSSD NLQDVH ,N.f LQKLELWRU %D\ f ,QKLELWLRQ RI ,/ VWLPXODWHG LQGXFWLRQ RI 0Q62' LQ SXOPRQDU\ DUWHU\ HQGRWKHOLDO FHOOV 9$ FHOOVf HLWKHU XQWUHDWHG RU WUHDWHG ZLWK LQFUHDVLQJ FRQFHQWUDWLRQV RI ,N. LQKLELWRU DORQH RU LQ FRPELQDWLRQ ZLWK ,/LS QJPOf RU ,/LS DORQH

PAGE 120

71)D ,N. ,QKLELWRU S0f 0Q62' f§ ZZZ m00 &DWKHSVLQ % $ ,/LS ,N. ,QKLELWRU S0f f 0Q62' &DWKHSVLQ % %

PAGE 121

)LJXUH 1RUWKHUQ DQDO\VLV RI 51$ IURP SXOPRQDU\ DUWHU\ HQGRWKHOLDO FHOOV H[SRVHG WR 71)D DQGRU 0$3 NLQDVH LQKLELWRU 3'f /HYHOV RI 71)DVWLPXODWHG LQGXFWLRQ RI 0Q62' LQ SXOPRQDU\ DUWHU\ HQGRWKHOLDO FHOOV 9$ FHOOVf HLWKHU XQWUHDWHG RU WUHDWHG ZLWK LQFUHDVLQJ FRQFHQWUDWLRQV RI WKH 0$3 NLQDVH LQKLELWRU 3'f DORQH RU LQ FRPELQDWLRQ ZLWK 71)D RU 71)D DORQH $OVR ZKHQ WKH 0$3 NLQDVH LQKLELWRU 6% ZDV XVHG LQ VLPLODU H[SHULPHQWV QR DOWHUDWLRQ LQ 71)DLQGXFLEOH SDWWHUQ RI 0Q62' ZDV REVHUYHG DOPRVW LGHQWLFDO WR WKH DERYH H[SHULPHQW ZLWK 3'

PAGE 122

71)D 3' _L0f 0Q62' ‘ f§ r ‘ :00 PW &DWKHSVLQ %

PAGE 123

71)D,QGXFLEOH ([SUHVVLRQ RI 0Q62' ,V 1RW 'HSHQGHQW RQ 1XFOHDU )DFWRU N% 1)N%f 2WKHU LQYHVWLJDWRUV KDYH VKRZQ WKDW 526 DFWLYDWLRQ E\ GLYHUVH FRQGLWLRQV LV LPSRUWDQW IRU JHQH DFWLYDWLRQ E\ 1)N% &RFHR HW DO f 7R LQYHVWLJDWH ZKHWKHU 1)N% LV LPSRUWDQW LQ 71)DVLJQDOLQJ RI 0Q62' XWLOL]HG WKH NDSSD NLQDVH ,N.f LQKLELWRU %$< 3LHUFH HW DO f $W LQFUHDVLQJ FRQFHQWUDWLRQV RI WKH ,N. LQKLELWRU 0Q62' H[SUHVVLRQ LQ ,/ AVWLPXODWHG HQGRWKHOLDO FHOOV FRXOG EH UHGXFHG WR EDVHOLQH )LJ %f ZLWK QR HIIHFW RQ 71)DVWLPXODWHG FHOOV )LJ $f 7KHVH GDWD VXJJHVW WKDW 1)N% LV DFWLYDWHG LQ WKH ,/ VLJQDOLQJ SDWKZD\ EXW QRW LQ WKH 71)D VLJQDOLQJ SDWKZD\ RI 0Q62' 2WKHU NLQDVH VLJQDOLQJ SDWKZD\V ZHUH DOVR LQYHVWLJDWHG E\ XVLQJ VSHFLILF LQKLELWRUV 7KH PLWRJHQDFWLYDWHG SURWHLQ 0$3f NLQDVHV DUH D JURXS RI SURWHLQ VHULQHWKUHRQLQH NLQDVHV WKDW DUH DFWLYDWHG LQ UHVSRQVH WR D YDULHW\ RI H[WUDFHOOXODU VWLPXOL DQG PHGLDWH VLJQDO WUDQVGXFWLRQ IURP WKH FHOO VXUIDFH WR WKH QXFOHXV 7ZR RI WKH 0$3 NLQDVH SDWKZD\V WKDW KDYH EHHQ LPSOLFDWHG LQ 71)D DQG ,/ VLJQDO WUDQVGXFWLRQ DUH -816$3. DQG S 7KH -1.6$3. F-XQ NLQDVHVWUHVV DFWLYDWHG SURWHLQ NLQDVHf FDVFDGH LV DFWLYDWHG IROORZLQJ H[SRVXUH WR 89 UDGLDWLRQ KHDW VKRFN RU LQIODPPDWRU\ F\WRNLQHV 7KH S NLQDVH UHDFWLYDWLQJ NLQDVHf LV WKH QHZHVW PHPEHU RI WKH 0$3 NLQDVH IDPLO\ ,W LV DFWLYDWHG LQ UHVSRQVH WR LQIODPPDWRU\ F\WRNLQHV HQGRWR[LQV DQG RVPRWLF VWUHVV 6HOHFWLYH LQKLELWRUV RI WKH 0.. 3' f .XOW] HW DO f DQG S 6% f .UDPHU HW DO f ZHUH XWLOL]HG DW YDULRXV FRQFHQWUDWLRQV WR WUHDW HQGRWKHOLDO FHOOV ZLWK RU ZLWKRXW 71)D 1R GLIIHUHQFHV ZHUH VHHQ EHWZHHQ LQGXFLEOH H[SUHVVLRQ RI 0Q62' ZLWK HLWKHU RI WKH LQKLELWRUV UHSUHVHQWDWLYH H[DPSOH )LJ f VXJJHVWLQJ WKDW

PAGE 124

71)D VLJQDO WUDQVGXFWLRQ IRU 0Q62' OLNHO\ GRHV QRW RFFXU WKURXJK WKHVH 0$3 NLQDVH SDWKZD\V 'LVFXVVLRQ 0DQJDQHVH VXSHUR[LGH GLVPXWDVH SOD\V DQ LPSRUWDQW UROH LQ WKH FHOOXODU GHIHQVH DJDLQVW VXSHUR[LGH SURGXFHG E\ WKH PLWRFKRQGULDO HOHFWURQ WUDQVSRUW FKDLQ GXULQJ QRUPDO FHOOXODU PHWDEROLVP :RQJ DQG *RHGGHO :RQJ HW DO :DUQHU HW DK :LVSH HW DK f 5HGXFWLRQ RU GHILFLHQF\ RI 0Q62' KDV EHHQ VKRZQ WR SURPRWH F\WRWR[LFLW\ XQGHU FRQGLWLRQV RI R[LGDQW VWUHVV /L HW DK 0HORY HW DK f $ QXPEHU RI ODERUDWRULHV LQFOXGLQJ RXU RZQ KDYH EHJXQ WR XQGHUVWDQG WKH ZRUNLQJV RI WKH SURPRWHU DQG WKH LQWURQLF HQKDQFHU LQ FDXVLQJ WKH GUDPDWLF LQGXFLEOH H[SUHVVLRQ RI 0Q62' -RQHV HW DK .XR HW DK 5RJHUV HW DK f +RZHYHU WKH PROHFXODU LQWUDFHOOXODU VLJQDOLQJ SDWKZD\V DQG WKH QDWXUH RI WKH LQGXFWLRQ RI 0Q62' E\ YDULRXV LQIODPPDWRU\ PHGLDWRUV DUH VWLOO EHLQJ XQUDYHOHG 5HWURJUDGH FRPPXQLFDWLRQ IURP WKH PLWRFKRQGULD WR WKH QXFOHXV OLNHO\ FRQVLVWV RI PHWDEROLF VLJQDOV DQG WUDQVGXFWLRQ SDWKZD\V WKDW IXQFWLRQ DFURVV WKH LQQHU PLWRFKRQGULDO PHPEUDQH 6LQFH 526 DUH YHU\ VKRUWOLYHG PROHFXOHV FORVHO\ UHJXODWHG E\ D FRRUGLQDWHG HQ]\PH V\VWHP WKH\ FRXOG EH SRWHQWLDO VLJQDO WUDQVGXFHUV RI SXWDWLYH PLWRFKRQGULDWR QXFOHXV VLJQDOLQJ SDWKZD\V 3URGXFWLRQ RI 526 LQ WKH PLWRFKRQGULD LV UHODWHG WR FKDQJHV LQ HOHFWURQ IOX[ WKURXJK WKH UHVSLUDWRU\ FKDLQ EURXJKW DERXW E\ YDULRXV SK\VLRORJLFDO FRQGLWLRQV VXFK DV KHDW VKRFN /DPERZLW] HW DO f YDULDWLRQV LQ R[\JHQ WHQVLRQ .UDPHU HW DO f DQG H[SRVXUH WR QLWULF R[LGH +HQU\ DQG *XLVVDQL f 526 KDYH EHHQ IRXQG WR DFW DV VHFRQG PHVVHQJHUV LQ FHOOXODU IXQFWLRQV VXFK DV FHOO JURZWK DQG GLIIHUHQWLDWLRQ +DQVEHUJ HW DO 5HPDGH HW DO f 0LWRFKRQGULDO UHVSLUDWLRQ

PAGE 125

KDV EHHQ OLQNHG WR WKH H[SUHVVLRQ RI WKH PDPPDOLDQ JHQH */87 (EHUW HW DO f ([SUHVVLRQ RI WKH */87 JHQH RQH RI WKH LVRIRUPV RI WKH JOXFRVH WUDQVSRUWHU LV HQKDQFHG E\ K\SR[LD DQG E\ H[SRVLQJ FHOOV WR LQKLELWRUV RI PLWRFKRQGULDO UHVSLUDWLRQ (EHUW HW DO f WKHUHIRUH SRVWXODWHG WKDW LQKLELWLRQ RI PLWRFKRQGULDO UHVSLUDWLRQ PLJKW DOVR UHJXODWH 0Q62' H[SUHVVLRQ SRVVLEO\ WKURXJK D PHFKDQLVP LQYROYLQJ LQWUDFHOOXODU OHYHOV RI 526 2XU GDWD VKRZ WKDW PLWRFKRQGULDO UHVSLUDWRU\ FKDLQ LQKLELWRUV DQWLP\FLQ $ )LJ ,% $f DQG P\[RWKLD]ROH )LJ %f DV ZHOO DV WKH )L)R$73DVH LQKLELWRU ROLJRP\FLQ )LJf FDQ UHSUHVV 71)DLQGXFLEOH H[SUHVVLRQ RI QXFOHDUHQFRGHG 0Q62' KDYH DOVR DGGUHVVHG WKH VSHFLILFLW\ RI WKH DQWLP\FLQ HIIHFWV ZLWK VWXGLHV LQ DQWLP\FLQ $UHVLVWDQW /$ PXWDQW FHOOV VWLPXODWHG ZLWK 71)D )LJ %f IXUWKHU LPSOLFDWLQJ 526 526 E\SURGXFWV DQGRU OLSLG SHUR[LGHV DV OLNHO\ FDQGLGDWHV IRU VLJQDO WUDQVGXFWLRQ IURP WKH PLWRFKRQGULD WR WKH QXFOHXV ,Q DGGLWLRQ RWKHU LQYHVWLJDWRUV KDYH VKRZQ WKDW VXEPLFURPRODU FRQFHQWUDWLRQV RI DUDFKLGRQLF DFLG FDXVH D VXEVWDQWLDO LQFUHDVH LQ 526 SURGXFWLRQ LQ PLWRFKRQGULD &RFHR HW DO :RR HW DO f 7KH GDWD LQ )LJ ZRXOG VXJJHVW WKDW GHFUHDVHG OHYHOV RI DUDFKLGRQLF DFLG RFFXUULQJ DV D UHVXOW RI VHOHFWLYH EORFNDGH RI &3/$ HQ]\PH LV VXIILFLHQW WR LQKLELW WKH 71)DLQGXFLEOH H[SUHVVLRQ RI 0Q62' 7KXV R[LGDWLYH HYHQWV JHQHUDWHG LQ WKH PLWRFKRQGULRQ QRW VLPSO\ LQKLELWLRQ RI HQHUJ\FRXSOHG SURFHVVHV DUH FUXFLDO LQ 71)DLQGXFHG 0Q62' JHQH H[SUHVVLRQ 526 RU RWKHU PLWRFKRQGULDO LQWHUPHGLDWHV PD\ FRQWURO ERWK WKH F\WRWR[LF DQG JHQHUHJXODWRU\ HIIHFWV RI 71)D WKXV SURYLGLQJ D EDVLV IRU D PLWRFKRQGULDWRQXFOHXV VLJQDOLQJ SDWKZD\ ZKLFK UHTXLUHV ELGLUHFWLRQDO FRPPXQLFDWLRQ EHWZHHQ WKH QXFOHXV DQG

PAGE 126

WKH PLWRFKRQGULD :KLOH WKH F\WRWR[LF DFWLYLW\ RI 71)D VHHPV WR EH UDWKHU UHVWULFWHG WR WXPRU FHOOV QHDUO\ HYHU\ FHOO W\SH UHVSRQGV WR 71)D E\ WKH DFWLYDWLRQ RI D ZLGH UDQJH RI GLIIHUHQW JHQHV /HH HW DO f 7UDQVFULSWLRQDO UHJXODWLRQ RI JHQHV LQYROYHV LQWHUDFWLRQ RI FULDFWLQJ HOHPHQWV RI '1$ ZLWK WKHLU FRJQDWH '1$ELQGLQJ SURWHLQV 71)D LQGXFHV DFWLYDWLRQ RI QXFOHDU IDFWRUV WKDW DFW DV fWKLUGf PHVVHQJHU PROHFXOHV VSHFLILFDOO\ ELQGLQJ WR FZDFWLQJ VHTXHQFHV 3HUKDSV WKH EHVW XQGHUVWRRG H[DPSOH RI WKH VHFRQG PHVVHQJHU IXQFWLRQ RI 526 LV WKH DFWLYDWLRQ RI WKH PDPPDOLDQ WUDQVFULSWLRQ IDFWRU 1)N% %DHXHUOH DQG %DOWLPRUH f :KHQ DFWLYDWHG 1)N% LQGXFHV WKH H[SUHVVLRQ RI YDULRXV JHQHV LQYROYHG LQ LQIODPPDWRU\ UHVSRQVHV LPPXQH FHOO UHJXODWLRQ DQG GLIIHUHQWLDWLRQ %DHXHUOH DQG +HQNHO f $ GLYHUVH VHW RI FRQGLWLRQV FDQ FDXVH 1)N% DFWLYDWLRQ ZLWK WKH FRPPRQ IDFWRU EHLQJ WKH JHQHUDWLRQ RI 526 ZLWKLQ WKH DIIHFWHG FHOOV %DHXHUOH DQG %DOWLPRUH %DHXHUOH DQG +HQNHO f 526 DUH LQYROYHG LQ WKH 71)D VLJQDOLQJ RI 0Q62' H[SUHVVLRQ )LJ f KRZHYHU P\ H[SHULPHQWV ZLWK WKH ,N NLQDVH LQKLELWRU )LJ f ZRXOG LQGLFDWH WKDW DOWKRXJK 1)N% PD\ EH LQYROYHG LQ ,/LS VLJQDOLQJ LW LV QRW LQYROYHG LQ 71)DLQGXFLEOH H[SUHVVLRQ RI 0Q62' ,Q DGGLWLRQ P\ GDWD ZRXOG DOVR VXJJHVW WKDW WKH 0$3 NLQDVH SDWKZD\V LQYROYLQJ -1.6$3. DQG S SUREDEO\ GR QRW UHJXODWH H[SUHVVLRQ RI 0Q62' )LJ f 7KXV P\ GDWD ZRXOG VXJJHVW WKDW PXOWLSOH VLJQDOLQJ SDWKZD\V UHVXOW LQ VWLPXODWHG H[SUHVVLRQ RI 0Q62' &OHDUO\ LQKLELWLRQ RI PLWRFKRQGULDO HOHFWURQ WUDQVSRUW DOWHUV LQGXFLEOH H[SUHVVLRQ RI 0Q62' E\ 71)D EXW QRW ,/ RU /36 7KXV LW ZRXOG DSSHDU WKDW WKH 71)D VLJQDOLQJ SDWKZD\ UHTXLUHV UHWURJUDGH FRPPXQLFDWLRQ IURP WKH PLWRFKRQGULD WR WKH QXFOHXV SUREDEO\ LQYROYLQJ 526 +RZHYHU GXH WR WKH KLJK UHDFWLYLW\ RI 526 DQG WKHLU SURGXFWLRQ ZLWKLQ WKH PLWRFKRQGULDO PHPEUDQH LW LV PXFK

PAGE 127

PRUH OLNHO\ WKDW WKH F\WRSODVPLF VLJQDOLQJ PROHFXOH RI WKH 71)D VLJQDOLQJ SDWKZD\ PD\ EH D SURWHLQ DFWHG XSRQ E\ D OLSLG SHUR[LGH RU RWKHU 526 RU HYHQ WKH OLSLG SHUR[LGH LWVHOI 2XU GDWD ZLWK WKH F3/$ LQKLELWRU ZRXOG VHHP WR EROVWHU WKLV DUJXPHQW LQ WKH 71)D SDWKZD\ 2WKHU LQYHVWLJDWRUV KDYH VKRZQ WKDW 71)DLQGXFHG 526 SURGXFWLRQ UHTXLUHV F3/$ DQG OLSR[\JHQDVH DFWLYLW\ EXW QRW F\FORR[\JHQDVH DFWLYLW\ LQ WKH 5DF VLJQDO WUDQVGXFWLRQ FDVFDGH :RR HW DO f 7KLV ZRXOG VXJJHVW WKDW 526 JHQHUDWLRQ LV GHSHQGHQW RQ V\QWKHVLV RI DUDFKLGRQLF DFLG DQG LWV VXEVHTXHQW PHWDEROLVP WR OHXNRWULHQHV ,Q IDFW H[RJHQHRXVO\ DSSOLHG OHXNRWULHQGH % FRXOG LQFUHDVH PLWRFKRQGULDO 526 :RR HW DO f $ PRGHO RI P\ SURSRVHG 0Q62' VLJQDOLQJ SDWKZD\V LV VKRZQ LQ )LJ GHWDLOLQJ WKH GLIIHUHQFHV EHWZHHQ WKH 71)D DQG ,/ SDWKZD\V ,W PD\ EH WKDW D \HW XQLGHQWLILHG VLJQDO SDWKZD\ SURWHLQ LV DFWLYDWHG E\ 526 RU D OLSLG SHUR[LGH PRLHW\ FDXVLQJ ELQGLQJ ZLWKLQ WKH HQKDQFHU RI 0Q62' WR SURGXFH WKH GUDPDWLF LQGXFWLRQV VHHQ ZLWK 71)D )LJ f

PAGE 128

)LJXUH 0RGHO RI 71)D DQG ,/ VLJQDO WUDQVGXFWLRQ SDWKZD\V LQYROYHG LQ LQGXFLEOH 0Q62' H[SUHVVLRQ 0LWRFKRQGULDO LQKLELWRUV DQWLP\FLQ $ P\[RWKLD]ROHf DQG )L)R$73DVH LQKLELWRU ROLJRP\FLQf DUH VKRZQ WR QHJDWLYHO\ DIIHFW PLWRFKRQGULDO SURGXFWLRQ RI 526 ZKLFK DUH LQYROYHG LQ WKH 71)D VLJQDOLQJ SDWKZD\ EXW QRW WKH ,/ SDWKZD\ 7KH &3/$ LQKLELWRU $$&2&)f GLPLQLVKHV SURGXFWLRQ RI DUDFKLGRQLF DFLG $$f ZKLFK LQFUHDVHV PLWRFKRQGULDO SURGXFWLRQ RI 526 WR SURGXFH SRWHQWLDOO\ OLSLG SHUR[LGH VSHFLHV ,QKLELWRU\ N NLQDVH ,N.f LQKLELWRU %D\ f LQKLELWV SKRVSKRU\ODWLRQ RI WKH ,N VXEXQLW WKXV SUHYHQWLQJ VHSDUDWLRQ RI WKH ,N VXEXQLW IURP QXFOHDU IDFWRU NDSSD % 1)N%f DQG EORFNLQJ LW IURP WUDQVORFDWLQJ LQWR WKH QXFOHXV

PAGE 129

&+$37(5 &21&/86,216 $1' )8785( ',5(&7,216 &RQFOXVLRQV 8QGHUVWDQGLQJ WUDQVFULSWLRQDO UHJXODWLRQ EHJDQ ZLWK WKH SLRQHHULQJ ZRUN RI -DFRE DQG 0RQRG -DFRE DQG 0RQRG f DQG SURJUHVVHV WR WKLV GD\ DW D GL]]\LQJ UDWH 7KH LQWHUDFWLRQ RI SURWHLQ WUDQVFULSWLRQ IDFWRUV ZLWK '1$ SOD\V D FULWLFDO UROH LQ WKLV UHJXODWLRQ 7KHVH SURWHLQ'1$ LQWHUDFWLRQV YDU\ LQ UHVSRQVH WR ERWK LQWHUQDO DQG H[WHUQDO FHOOXODU HQYLURQPHQWDO FRQGLWLRQV DQG VWLPXOL ,W LV WKH PXOWLWXGH RI SRVVLEOH FRPELQDWLRQV RI SURWHLQ'1$ LQWHUDFWLRQV ZKLFK JLYH WKH FHOO VXFK D YDULHW\ RI FRQWURO PHFKDQLVP 3HUKDSV WKH PRVW WKRURXJKO\ XQGHUVWRRG H[DPSOH RI SURWHLQ'1$ LQWHUDFWLRQ LQYROYHG LQ WUDQVFULSWLRQDO UHJXODWLRQ LV WKH ODF UHSUHVVRURSHUDWRU FRPSOH[ ,VRODWLRQ RI WKH ODF UHSUHVVRU 0XOOHU+LOO f SHUPLWWHG WKH NLQHWLF VWXGLHV ZKLFK ZHUH HVVHQWLDO WR XQGHUVWDQGLQJ KRZ SURWHLQELQGLQJ FRQWULEXWHV WR WKH UHJXODWRU\ PHFKDQLVP )XUWKHU UHILQHPHQW RI WKH UHJXODWRU\ PHFKDQLVP ZDV DFKLHYHG E\ DQ H[DPLQDWLRQ LQ YLYR RI WKH ODF UHSUHVVRU'1$ LQWHUDFWLRQV 1LFN DQG *LOEHUW f 7KHVH DQG KXQGUHGV RI RWKHU SLHFHV RI GDWD FXOPLQDWHG LQ XQGHUVWDQGLQJ WKH UHJXODWRU\ PHFKDQLVP RI WKH ODF RSHURQ 0XOOHU+LOO f $OPRVW \HDUV HODSVHG EHIRUH D IXOO XQGHUVWDQGLQJ RI WKH ODF RSHURQ FRXOG EH DWWDLQHG $ IXOO FRPSUHKHQVLRQ RI WKH PHFKDQLVPV UHJXODWLQJ WUDQVFULSWLRQ LQ HXNDU\RWHV LV XQOLNHO\ WR WDNH OHVV WLPH 0XOWLSOH H[DPSOHV RI HXNDU\RWLF JHQHV ZLWK FRPSOH[ HQKDQFHUV H[LVW LQ WKH OLWHUDWXUH SLQWHUIHURQ .LP DQG 0DQLDWLV 0HULND HW DO f 7FHOO UHFHSWRU D

PAGE 130

*LHVH HW DO 0D\DOO HW DO f LQWHUOHXNLQ +HQNHO DQG %URZQ 5DQJDQDWK HW DO f DQG XURNLQDVH 'H &HVDUH HW DO 'H &HVDUH HW DO f WR QDPH D IHZ )URP WKHVH DQG RWKHU VWXGLHV WZR IDFWV KDYH EHFRPH LQFUHDVLQJO\ FOHDU )LUVW ZLWKLQ WKH FHOO WKH PXOWLSOH IDFWRUV WKDW SDUWLFLSDWH LQ WKH WUDQVFULSWLRQ SURFHVV DOVR SOD\ DQ DFWLYH UROH LQ WKH UHJXODWLRQ RI JHQH H[SUHVVLRQ 6HFRQG IURP WKH GDWD DYDLODEOH RQ HXNDU\RWLF WUDQVFULSWLRQ LW LV DOVR FOHDU WKDW WKH PHFKDQLVPV E\ ZKLFK WUDQVFULSWLRQ LV UHJXODWHG DUH WUHPHQGRXVO\ FRPSOH[ (XNDU\RWLF WUDQVFULSWLRQDO FRQWURO HQWDLOV WKH SUHFLVH VHTXHQWLDO LQWHUDFWLRQ RI D YDULHW\ RI ODUJH HQ]\PDWLF FRPSOH[HV WKDW DUH UHFUXLWHG E\ VHTXHQFHVSHFLILF SURPRWHUHQKDQFHUELQGLQJ SURWHLQV &RQWURO RI WUDQVFULSWLRQDO UHJXODWLRQ LV H[HUWHG DW PXOWLSOH OHYHOV RI WKH SURFHVV ZKLFK LQFOXGHV FKURPDWLQ UHFRJQLWLRQ DQG UHPRGHOLQJ FRYDOHQW PRGLILFDWLRQ RI KLVWRQHV UHFUXLWPHQW RI FRDFWLYDWRUV DQG EDVDO WUDQVFULSWLRQ FRPSRQHQWV DQG WKH DVVHPEO\ RI DQ HORQJDWLRQFRPSHWHQW WUDQVFULSWLRQ FRPSOH[ WKDW LV FDSDEOH RI HIILFLHQW SURFHVVLQJ WKURXJK QXFOHRVRPDO DUUD\V 3HUKDSV WKH HDUOLHVW VWHS LQ JHQH DFWLYDWLRQ LQYROYHV WKH PRELOL]DWLRQ RI HQHUJ\ GHSHQGHQW FKURPDWLQ UHPRGHOLQJ FRPSOH[HV $ QXPEHU RI GLIIHUHQW FRPSOH[HV FDSDEOH RI DVVHPEOLQJ DQG GLVUXSWLQJ QXFOHRVRPH DUUD\V KDYH EHHQ LGHQWLILHG IURP \HDVW 'URVRSKLOD DQG PDPPDOLDQ FHOOV *HQHUDOO\ WKHVH FRPSOH[HV DUH FODVVLILHG DFFRUGLQJ WR WKH LGHQWLW\ RI WKH FDWDO\WLF $73DVH DQG RWKHU VKDUHG VXEXQLWV ([DPSOHV RI VXFK UHPRGHOLQJ FRPSOH[HV LQ 'URVRSKLOD ZRXOG EH WKH $&) $73XWLOL]LQJ FKURPDWLQ DVVHPEO\ DQG UHPRGHOLQJ IDFWRUf 185) QXFOHRVRPH UHPRGHOLQJ IDFWRUf DQG &+5$& FKURPDWLQ DFFHVVLELOLW\ FRPSOH[f FRPSOH[HV ZKLFK XVH WKH $73DVH VXEXQLWV RI WKH ,6:, QXFOHRVRPH $73DVHf IDPLO\ DV GR WKH WZR PDPPDOLDQ UHPRGHOLQJ FRPSOH[HV

PAGE 131

UHPRGHOLQJ DQG VSDFLQJ IDFWRU 56)f DQG KXPDQ $73XWLOL]LQJ FKURPDWLQ DVVHPEO\ DQG UHPRGHOLQJ IDFWRU:LOOLDPV V\QGURPH FKURPDWLQ UHPRGHOLQJ IDFWRU K$&)$9&5)f :RUNPDQ DQG .LQJVWRQ f 2WKHU VWXGLHV ZRXOG VXJJHVW WKDW LQ DGGLWLRQ WR WKH $73DVH DFWLYLW\ KLVWRQH GHDFHW\OWUDQVIHUDVH FRPSOH[HV S DQG 7,)f DOVR DUH UHTXLUHG .RED\DVKL HW DO 7UHXWHU HW DO f 7KH LQWHUDFWLRQ DSSHDUV WR EH VHTXHQWLDO ZLWK WKH ,6:, UHPRGHOLQJ FRPSOH[ IXQFWLRQLQJ EHIRUH WKH DFHW\OWUDQVIHUDVHV WR IDFLOLWDWH WLJKW ELQGLQJ RI WKH QXFOHDU UHFHSWRU KHWHURGLPHU WR FKURPDWLQ ,Q WKH \HDVW JHQH 3+ WUDQVFULSWLRQDO DFWLYDWLRQ UHTXLUHV FKURPDWLQ UHPRGHOLQJ DQG DFHW\OWUDQVIHUDVH FRPSOH[HV WR RFFXU VXEVHTXHQW WR ELQGLQJ RI IDFWRUV WR WKH 8SVWUHDP $FWLYDWLQJ 6HTXHQFH 8$6fHQKDQFHU *UHJRU\ HW DO f +LVWRQHV ZKHWKHU K\SR RU K\SHUDFHW\ODWHG FRQWDFW '1$ VLPLODUO\ KRZHYHU WKH DFHW\ODWHG SDUWLFOH LV PRUH DV\PPHWULF DQG WKH KLVWRQH WDLOV DGRSW D KLJKHU GHJUHH RI D KHOLFDO VWUXFWXUH :RUNPDQ DQG .LQJVWRQ f ,Q WKH DEVHQFH RI KLVWRQH +, WKH VWUXFWXUDO FKDQJHV UHVXOW LQ D OHVV GHQVHO\ SDFNHG ILEHU +LVWRQHV + DQG +% LQ FRUH SDUWLFOHV FDQ DOVR EH PRGLILHG WKURXJK WUDQVJOXWDPLQDWLRQ %DOOHVWDU HW DO f ZKLFK SURYLGHV D VHQVLWLYH SUREH IRU QXFOHRVRPH VWUXFWXUH DQG SRVVLEO\ DQ DGGLWLRQDO UHJXODWRU\ PRGLILFDWLRQ LQ YLYR 7KH GHFUHDVH LQ FKURPDWLQ FRPSDFWLRQ ZLWK KLVWRQH DFHW\ODWLRQ LV YHU\ UHOHYDQW WR WKH HIIHFWV RI DFHW\OWUDQVIHUDVHV RQ WUDQVFULSWLRQDO DFWLYLW\ $ QXPEHU RI WUDQVFULSWLRQDO FRDFWLYDWRUV KDYH EHHQ LGHQWLILHG YLWDPLQ UHFHSWRU LQWHUDFWLQJ SURWHLQ '5,3f DFWLYDWRUUHFUXLWHG FRIDFWRU $5&f QHJDWLYH UHJXODWRU RI DFWLYDWHG WUDQVFULSWLRQ 1$7f WK\URLG KRUPRQH UHFHSWRUDVVRFLDWHG SURWHLQ 75$3f 7KH 75$3 FRPSOH[ ZDV LGHQWLILHG ELRFKHPLFDOO\ )RQGHOO HW DO f DV D FRDFWLYDWRU RI WKH WK\URLG KRUPRQH UHFHSWRU DQG KDV EHHQ IRXQG WR EH UHTXLUHG IRU PDQ\ RWKHU

PAGE 132

SURPRWHUHQKDQFHUELQGLQJ IDFWRUV 0DOLN HW DO f 7KHVH FRPSOH[HV ELQG ZLWK KLJK DIILQLW\ WR VHYHUDO GLIIHUHQW W\SHV RI WUDQVFULSWLRQ DFWLYDWLRQ GRPDLQV DQG PD\ EH D GLUHFW FRQQHFWLRQ EHWZHHQ SURPRWHUHQKDQFHUELQGLQJ IDFWRUV DQG 51$ SRO\PHUDVH ,, &RDFWLYDWRUV PD\ DOVR DFW LQ DQ DUFKLWHFWXUDO PDQQHU WR SURPRWH DVVHPEO\ RI HQKDQFHU FRPSOH[HV RU WR UHJXODWH ELQGLQJ RI VSHFLILF SURPRWHUHQKDQFHU IDFWRUV WR FKURPDWLQ 2QH VXFK FRDFWLYDWRU +LJK 0RELOLW\ *URXS SURWHLQ +0* ,f LV GLVWLQJXLVKHG E\ LWV DELOLW\ WR ELQG VSHFLILFDOO\ LQ WKH QDUURZ PLQRU JURRYH RI $7ULFK '1$ &KXUFKLOO DQG 7UDYHUV f +0* GRHV QRW IXQFWLRQ DV D WUDQVFULSWLRQDO DFWLYDWRU RQ LWV RZQ EXW UDWKHU LQIOXHQFHV WKH DFWLYLWLHV RI RWKHU UHJXODWRU\ IDFWRUV 7KDQRV HW DO f +0* FDQ LQWHUDFW GLUHFWO\ ZLWK WUDQVFULSWLRQDO DFWLYDWRUV RI VHYHUDO IDPLOLHV LQFOXGLQJ 5HO 7KDQRV DQG 0DQLDWLV f E=LS 'X HW DO f (WV -RKQ HW DO f DQG 328 /HJHU HW DO f +0* DOWHUV WKH FRQIRUPDWLRQ RI WKH '1$ )DOYR HW DO f DQG IDFLOLWDWHV WKH DVVHPEO\ RI D KLJKHURUGHU QXFOHRSURWHLQ FRPSOH[ LQ WKH ,)1 HQKDQFHU
PAGE 133

VSHFLHV DQG WKH QDWXUH RI WKH FRUH SURPRWHU HJ FRQWDLQLQJ D 7$7$ ER[ RU '3(f ZLOO GHWHUPLQH WKH UHVSRQVLYHQHVV WR GLIIHUHQW SURPRWHUVHQKDQFHUV $QRWKHU LQWHUHVWLQJ FRQVLGHUDWLRQ LV WKDW WKH FRPSRQHQWV RI WKH 7),,' FRPSOH[ PD\ DOVR UHJXODWH WUDQVFULSWLRQ WKRXJK PRGLILFDWLRQ RI FKURPDWLQ RU RWKHU SURWHLQV 7KH 7$),, VXEXQLW RI 7),,' LV QRW RQO\ ERWK DQ DFHW\OWUDQVIHUDVH DQG D SURWHLQ NLQDVH EXW FDQ DOVR FDWDO\]H WKH $73GHSHQGHQW XELTXLWLQDWLRQ RI KLVWRQH +, LQ YLWUR 2f%ULHQ DQG 7LMDQ f 7KHUHIRUH 7$),, DSSHDUV WR FRQWDLQ ERWK XELTXLWLQDFWLYDWLQJ DQG XELTXLWLQFRQMXJDWLQJ DFWLYLWLHV $ SRLQW PXWDWLRQ LQ 'URVRSKLOD 7$),, DEROLVKHG LWV XELTXLWLQDWLRQ DFLWLYLW\ LQ YLWUR DQG ZDV IRXQG WR UHGXFH H[SUHVVLRQ RI VHYHUDO JHQHV LQ YLYR 3KDP DQG 6DXHU f 7KH SUHFHGLQJ VWXGLHV XQGHUVFRUH WKH IDFW WKDW UHJXODWRU\ FRPSOH[HV PD\ FRQWDLQ PXOWLSOH HQ]\PDWLF DFWLYLWLHV DQG WKXV VXJJHVW D UROH IRU 7$),, DQG 7),,' LQ WKH UHJXODWLRQ RI JHQH H[SUHVVLRQ 6LJQDOV LQ WKH IRUP RI LQWHUDFWLRQV IURP WKH HQKDQFHU WR WKH FRUH SURPRWHU DOVR DIIHFW WKH WUDQVLWLRQ IURP LQLWLDWLRQ WR HORQJDWLRQ DQG HQKDQFHUSURPRWHUVSHFLILF IDFWRUV PD\ VWLPXODWH HLWKHU RU ERWK RI WKHVH SURFHVVHV 2QH H[DPSOH ZRXOG EH WKH +,9 7DW SURWHLQ ZKLFK DVVRFLDWHV ZLWK 37()E&'. DQG VWURQJO\ HQKDQFHV FDUER[\WHUPLQDO GRPDLQ &7'f SKRVSKRU\ODWLRQ DW WKH 6HU SRVLWLRQ RI 51$ SRO\PHUDVH ,, 2NDPRWR HW DO 3DUDGD DQG 5RHGHU f 2QFH LQLWLDWLRQ LV HVWDEOLVKHG KRZHYHU QXFOHRVRPDO VWUXFWXUHV SUHVHQW D EDUULHU WR HORQJDWLRQ WKURXJK JHQHV 7KH FKURPDWLQ VSHFLILF HORQJDWLRQ IDFWRU )$&7 IDFLOLWDWHV FKURPDWLQ WUDQVFULSWLRQf FRQWDLQV WZR VXEXQLWV 6SWO DQG 6653 7KH 6SW VXEXQLW LQWHUDFWV GLUHFWO\ ZLWK WKH KLVWRQH GHDFHW\ODVH +$7f SURWHLQ 1X$ ZKHUHDV 6653 ELQGV WR WKH 6:,61)UHODWHG SURWHLQ &+' $Q LPSRUWDQW IXQFWLRQ RI )$&7 LV LWV DELOLW\ WR IDFLOLWDWH UHPRYDO RI +$+%

PAGE 134

IURP FKURPDWLQ DQG )$&7 LV XQDEOH WR HQKDQFH WUDQVFULSWLRQ HORQJDWLRQ IURP FKURPDWLQ ZKHQ +$+% GLVVRFLDWLRQ LV SUHYHQWHG E\ KLVWRQH FURVVOLQNLQJ 2USKDQLGHV HW DO f :LWKLQ HXNDU\RWLF FKURPRVRPHV RSHQ DFFHVVLEOH FKURPDWLQ W\SLFDOO\ VLJQLILHV DFWLYH JHQHV ZKLFK DUH LQWHUVSHUVHG ZLWK UHJLRQV RI PRUH GHQVHO\ FRPSDFWHG FKURPDWLQ KHWHURFKURPDWLQf ZKLFK RIWHQ KDUERUV LQDFWLYH JHQHV :LWKLQ ODUJH UHJLRQV RI WKH JHQRPH ERXQGDU\LQVXODWRU HOHPHQWV VHSDUDWH LQGHSHQGHQW UHJLRQV RI JHQHWLF DFWLYLW\ ,Q 'URVRSKLOD D XQLTXH UHJXODWRU\ HOHPHQW KDV EHHQ GHILQHG WKH SURPRWHU WDUJHWLQJ VHTXHQFH 376f ZKLFK DFWLQJ LQ D GRPLQDQW IDVKLRQ DOORZV DQ HQKDQFHU WR RYHUFRPH WKH DELOLW\ RI DQ LQVXODWRU WR EORFN HQKDQFHUSURPRWHU LQWHUDFWLRQ =KRX DQG /HYLQH f $OVR LQ 'URVRSKLOD DQ LQWULJXLQJ PRGHO IRU ORQJUDQJH HQKDQFHUSURPRWHU LQWHUDFWLRQV LV SURSRVHG LQYROYLQJ FKURPDWLQ FRQGHQVDWLRQ ZKHUHE\ SURPRWHUHQKDQFHU FRPPXQLFDWLRQ LV VWUXFWXUDOO\ IDFLOLWDWHG 5ROOLQV HW DO f 7KLV VHHPV WR EH PHGLDWHG E\ D QRYHO FODVV RI SURWHLQV 1LSSHG % D KRPRORJXH RI FKURPRVRPDO DGKHULQV ZKLFK KDYH EURDG IXQFWLRQV RI VLVWHU FKURPDWLG FRKHVLRQ FKURPRVRPH FRQGHQVDWLRQ DQG '1$ UHSDLU 7KLV ODVW PHFKDQLVP RI SURPRWHUHQKDQFHU UHJXODWLRQ LV UHPLQLVFHQW RI WKH FRQFHSW RI WUDQVYHFWLRQ ILUVW VXJJHVWHG E\ ( % /HZLV /HZLV f ,Q WKLV UHVHDUFK KDYH GHPRQVWUDWHG WKDW D VPDOO UHJLRQ RI VHTXHQFH ZLWKLQ LQWURQ RI 0Q62' LV UHVSRQVLEOH IRU SDUW RI WKH LQGXFWLRQ VHHQ ZKHQ FHOOV DUH VWLPXODWHG E\ LQIODPPDWRU\ PHGLDWRUV 2WKHU PHFKDQLVPV FKURPDWLQ UHPRGHOLQJ FRDFWLYDWRUV SRVWWUDQVODWLRQDO PRGLILFDWLRQVf ZKLFK PD\ FRQWULEXWH WR WKH WUDQVFULSWLRQDO UHJXODWLRQ ZLOO EH IRXQG WKURXJK IXUWKHU VWXG\ DQG H[SHULPHQWDWLRQ ,Q DGGLWLRQ KDYH VKRZQ WKDW WKH VLJQDOLQJ SDWKZD\V IURP WKH FHOO VXUIDFH WR WKH 0Q62' JHQH DUH GLIIHUHQW DQG

PAGE 135

GHSHQGHQW RQ WKH LQIODPPDWRU\ VWLPXOXV 7KH UHVXOW LQFUHDVHG 0Q62' H[SUHVVLRQ PD\ EH VLPLODU IRU HDFK RI WKH LQIODPPDWRU\ VWLPXOL EXW WKH SDWKZD\V WR WKH HQG DUH YHU\ GLIIHUHQW 7KLV VKRXOG FRPH DV QR VXUSULVH (DFK VWLPXOXV DV ZHOO DV WKH OHYHO RI VWLPXODWLRQ OLNHO\ FDXVHV FKDQJHV ERWK LQGXFWLRQ DQG VXSSUHVVLRQf LQ D YDULHW\ RI JHQHV ,W LV WKH FRPELQDWLRQ RI H[SUHVVLRQ SURGXFWV ZKLFK JLYHV ULVH WR WKH ILQDO FHOOXODU UHVSRQVH )XWXUH 'LUHFWLRQV 7KH REVHUYDWLRQ WKDW WKH 0Q62' JHQH KDV D FRPSOH[ HQKDQFHU HOHPHQW ZKLFK LV UHVSRQVLYH WR PXOWLSOH LQIODPPDWRU\ VWLPXOL LV FRQVLVWHQW ZLWK WKH REVHUYDWLRQV RI HQKDQFHUV LQ RWKHU LQGXFLEOH JHQHV .LP DQG 0DQLDWLV *LHVH HW DO +HQNHO DQG %URZQ 'H &HVDUH HW DK f $V RSSRVHG WR VRPH RI WKHVH RWKHU LQGXFLEOH HQKDQFHUV WKH WUDQVFULSWLRQ IDFWRUV WKDW ELQG WR WKH 0Q62' HQKDQFHU KDYH \HW WR EH LGHQWLILHG ,W ZLOO EH QHFHVVDU\ WR VWDUW ZLWK WKHVH SURWHLQV DV WKH\ DUH WKH ILUVW OD\HU RI WKH SURWHLQHQKDQFHU FRPSOH[ ZKLFK PXVW IRUP WR FDXVH WKH LQGXFLEOH H[SUHVVLRQ VHHQ E\ QRUWKHUQ DQDO\VLV 7R IXOO\ FKDUDFWHUL]H WKH UHJXODWRU\ SURWHLQV WKDW ELQG WR WKH 0Q62' HQKDQFHU HOHPHQW LW ZLOO EH QHFHVVDU\ WR XWLOL]H D YDULHW\ RI WHFKQLTXHV $V SUHYLRXVO\ VKRZQ WKH HQKDQFHU HOHPHQW FDQ EH VKRZQ WR FDXVH DQ LQGXFLEOH VKLIW SDWWHUQ RQ HOHFWURPRELOLW\ JHO VKLIW DVVD\ (06$f )XUWKHU REVHUYDWLRQV FDQ EH PDGH E\ XVLQJ WKH PXWDWHG UHJLRQV IRU WKHVH VDPH VKLIWV XQGHU WKH VDPH FRQGLWLRQV DV WKH ZLOGW\SH HQKDQFHU WR DVFHUWDLQ LI WKH VKLIWV DUH DOWHUHG E\ WKH PXWDWLRQV 'DWD IURP VXFK H[SHULPHQWV PLJKW OHQG IXUWKHU VXSSRUW IRU D ODUJH LQGXFLEOH SURWHLQ'1$ FRPSOH[ 6RPH HYLGHQFH RI IXQFWLRQDO DOWHUDWLRQV KDV EHHQ VKRZQ E\ WUDQVLHQW WUDQVIHFWLRQV DQG QRUWKHUQ DQDO\VLV &KDSWHU f

PAGE 136

,I D WUDQVFULSWLRQ IDFWRU FDQ EH LGHQWLILHG RU VSHFXODWHG RQ E\ FRQVHQVXVVHTXHQFH WKHQ IXUWKHU LQIRUPDWLRQ FRXOG EH REWDLQHG E\ VXSHUVKLIW (06$ ZLWK WKH WUDQVFULSWLRQ IDFWRU DQWLERG\ LI DYDLODEOH 6LQFH ZH KDYH QRW LGHQWLILHG DQ\ WUDQVFULSWLRQ IDFWRUV LW ZLOO EH QHFHVVDU\ WR FKRRVH D WHFKQLTXH ZKLFK FRXOG SURYLGH WKHVH IDFWRUV ZLWK D KLJKGHJUHH RI UHOLDELOLW\ 2QH VXFK FRPPHUFLDOO\ DYDLODEOH WHFKQLTXH ZRXOG EH WKH \HDVW RQHK\EULG V\VWHP XVLQJ WKH HQKDQFHU VHTXHQFH ELQGLQJ VLWHVf DV EDLW WR REWDLQ WKH SULPDU\ FORQHVf RI WKH WUDQVn DFWLQJ IDFWRUV 2WKHU WHFKQLTXHV ZKLFK FRXOG EH XVHG WR REWDLQ SURWHLQV ELQGLQJ WR WKH HQKDQFHU UHJLRQV ZRXOG LQFOXGH f WKH FUHDWLRQ RI D ELRWLQ\ODWHG HQKDQFHU UHJLRQ XVLQJ ELRWLQ\ODWHG ROLJRQXFOHRWLGHV DV SULPHUV IRU 3&5 DQG XVLQJ WKHVH '1$ IUDJPHQWV LQ FRPELQDWLRQ ZLWK VWUHSWDYLGLQFRDWHG PDJQHWLF EHDGV WR LVRODWH QXFOHDU SURWHLQV ZKLFK ZRXOG ELQG WR WKH HQKDQFHU HOHPHQW 7KHVH QXFOHDU IUDFWLRQV FRXOG EH ODEHOHG ZLWK 6 PHWKLRQLQH WR DOORZ LGHQWLILFDWLRQ RQ SRO\DFU\ODPLGH JHO HOHFWURSKRUHVLV f WKH LGHQWLILFDWLRQ RI SURWHLQV ZKLFK LQWHUDFW ZLWK WKH WUDQVFULSWLRQ IDFWRUV ERXQG WR WKH HQKDQFHU UHJLRQ FRXOG EH LVRODWHG XVLQJ WKH WHFKQLTXH RI LQ YLYR IRUPDOGHK\GH FURVV OLQNLQJ ,QWDFW FHOOV DUH WUHDWHG ZLWK GLOXWH VROXWLRQV RI IRUPDOGHK\GH ZKLFK SURGXFHV SURWHLQSURWHLQ SURWHLQ51$ DQG SURWHLQ'1$ FURVVOLQNV ZLWKLQ PLQXWHV 7KLV ZRXOG EH IROORZHG E\ WKH O\VLV RI FHOOV DQG WKH LVRODWLRQ RI YLUWXDOO\ LQWDFW FKURPDWLQ 7KH FKURPDWLQ ZRXOG EH PHFKDQLFDOO\ VKHDUHG WR SURGXFH RSWLPDO FKURPDWLQ '1$ RI DURXQG ES $Q LPSRUWDQW SRLQW RI WKLV WHFKQLTXH LV WKDW DW OHDVW RQH SURWHLQ ELQGLQJ WR WKH DUHD RI LQWHUHVW PXVW EH NQRZQ IRU WKH QH[W VWHS 7KH VKHDUHGVROXEOH FKURPDWLQ LV LPPXQRSUHFLSLWDWHG ZLWK WKH DQWLERG\ RI WKH NQRZQ ELQGLQJ SURWHLQ WR REWDLQ D SXUH LPPXQRFRPSOH[ RI DOO WKH SURWHLQV ELQGLQJ WR WKH UHJLRQ RI LQWHUHVW 7KH IRUPDOGHK\GH

PAGE 137

FURVVOLQNV DUH UHYHUVHG DQG WKH '1$ SXULILHG 7KH SXULILHG '1$ FDQ EH XVHG LQ RQH RI WZR ZD\V f TXDQWLWDWLYH 3&5 DQDO\VLV RI JHQRPLF IUDJPHQWV XVLQJ VSHFLILF SDLUV RI SULPHUV RU f WKH LPPXQRSUHFLSLWDWHG '1$ FDQ EH XVHG DV SUREH WR VFDQ VSHFLILF JHQRPLF UHJLRQV E\ 6RXWKHUQ DQDO\VLV ,Q DGGLWLRQ IXUWKHU ZRUN LV QHHGHG WR FKDUDFWHUL]H LQ PRUH GHWDLO WKH WUDQVPHPEUDQH UHFHSWRUPHGLDWHG LQWUDFHOOXODU VLJQDOLQJ SDWKZD\V ZKLFK DOO VHHP WR FXOPLQDWH ZLWK LQFUHDVHG H[SUHVVLRQ RI 0Q62' .QRZLQJ WKH GLYHUVLW\ RI VLJQDOLQJ SDWKZD\V LQVLGH WKH FHOO DQG WKH QXPHURXV SURWHLQV LQYROYHG LQ WKH GLIIHUHQW SDWKZD\V LW ZLOO EH D FKDOOHQJLQJ WDVN WR GLVVHFW RXW WKH LQGLYLGXDO HOHPHQWV WR JDLQ D NHHQHU XQGHUVWDQGLQJ RI WKH NH\ UHJXODWRU\ HOHPHQWV 3RVVLEOH DYHQXHV RI H[SHULPHQWDWLRQ ZRXOG LQFOXGH REWDLQLQJ SODVPLGV FRQWDLQLQJ WKH ZLOGW\SH DV ZHOO DV PXWDWHG IRUPV RI WKH YDULRXV LQWUDFHOOXODU VLJQDOLQJ SURWHLQV WKDW KDYH WKXV IDU EHHQ LGHQWLILHG 1)N% PHPEHUV RI WKH 75$) IDPLO\ RI SURWHLQV PHPEHUV RI WKH OHXNRWULHQH HQ]\PH FDVFDGH WR QDPH D IHZf DOO ZLWK WKH LQWHQW RI SHUIRUPLQJ LQ YLYR RYHUH[SUHVVLRQ DQG GRPLQDQWn QHJDWLYH VWXGLHV DV DQRWKHU PHDQV WR HOXFLGDWH ZKLFK SDUWV RI WKH SDWKZD\V DUH LPSRUWDQW IRU WKH LQGLYLGXDO WUDQVPHPEUDQHUHFHSWRUPHGLDWHG VLJQDOV $QRWKHU SRVVLEOH VHULHV RI H[SHULPHQWV PLJKW LQYROYH REWDLQLQJ HLWKHU FHOOV RU WKH DQLPDOV WKHPVHOYHV RI WKH fNQRFNn RXWVf RI WKH LQGLYLGXDO SURWHLQV RI WKH VLJQDOLQJ SDWKZD\V $V PRUH WUDQVJHQLF fNQRFNn RXWf PLFH DUH FUHDWHG D VHULHV RI DQLPDOV ZLWK VSHFLILF GHOHWLRQV RI VLJQDO SDWKZD\ SURWHLQV PD\ DOORZ YHU\ SUHFLVH LQ YLYR H[SHULPHQWDWLRQ RI VLJQDO WUDQVGXFWLRQ SDWKZD\V

PAGE 138

5()(5(1&(6 $JJDUZDO % % .RKU : +DVV 3 ( 0RIIDW % 6SHQFHU 6 $ +HQ]HO : %ULQJPDQ 7 6 1HGZLQ ( *RHGGHO 9 DQG +DUNLQV 5 1 f +XPDQ 7XPRU 1HFURVLV )DFWRU 3URGXFWLRQ 3XULILFDWLRQ DQG &KDUDFWHUL]DWLRQ %LRO &KHP $NDVKL 0 +DFKL\D 0 3DTXHWWH 5 / 2VDZD < 6KLPL]X 6 DQG 6X]XNL f ,UUDGLDWLRQ ,QFUHDVHV 0DQJDQHVH 6XSHUR[LGH 'LVPXWDVH P51$ /HYHOV LQ +XPDQ )LEUREODVWV %LRO &KHP $QGUHZV 1 & DQG )DOOHU 9 f $ 5DSLG 0LFURSUHSDUDWLRQ 7HFKQLTXH IRU ([WUDFWLRQ RI '1$%LQGLQJ 3URWHLQV IURP /LPLWLQJ 1XPEHUV RI 0DPPDOLDQ &HOOV 1XFOHLF $FLGV 5HV $UDL 7 .HOO\ 6 $ %UHQJPDQ 0 / 7DNDQR 0 6PLWK ( + *ROGVFKPLGW &OHUPRQ 3 DQG %XONOH\ % f $PELHQW EXW 1RW ,QFUHPHQWDO 2[LGDQW *HQHUDWLRQ (IIHFWV ,QWHUFHOOXODU $GKHVLRQ 0ROHFXOH ,QGXFWLRQ E\ 7XPRU 1HFURVLV )DFWRU DOSKD LQ (QGRWKHOLXP %LRFKHP $VVD\DPD DQG %XUU 0 f 5DW 6XSHUR[LGH 'LVPXWDVHV %LRO &KHP $XURQ 3 ( :HEE $ & 5RVHQZDVVHU / 0XFFL 6 ) 5LFK $ :ROII 6 0 DQG 'LQDUHOOR & $ f 1XFOHRWLGH 6HTXHQFH RI +XPDQ 0RQRF\WH ,QWHUOHXNLQ 3UHFXUVRU F'1$ 3URF 1DWO $FDG 6FL 86$ $XURQ 3 ( 5RVHQZDVVHU / 0DWVXVKLPD &RSHODQG 7 'LQDUHOOR & $ 2SSHQKHLP DQG :HEE $ & f +XPDQ DQG 0XULQH ,QWHUOHXNLQ 3RVVHVV 6HTXHQFH DQG 6WUXFWXUDO 6LPLODULWLHV 0RO &HOO ,PPXQRO %DHXHUOH 3 $ DQG %DOWLPRUH f NDSSD % $ 6SHFLILF ,QKLELWRU RI WKH 1) NDSSD % 7UDQVFULSWLRQ )DFWRU 6FLHQFH %DHXHUOH 3 $ DQG +HQNHO 7 f )XQFWLRQ DQG $FWLYDWLRQ RI 1)NDSSD % LQ WKH ,PPXQH 6\VWHP $QQ 5HY ,PPXQRO

PAGE 139

%DNHU 0DUFXV & % +XIIPDQ .UXN + 0DOIUR\ % DQG 'RFWURZ 6 5 f 6\QWKHWLF &RPELQHG 6XSHUR[LGH 'LVPXWDVH&DWDODVH 0LPHWLFV $UH 3URWHFWLYH DV $ 'LVSOD\HG 7UHDWPHQW LQ D 5DW 6WURNH 0RGHO $ .H\ 5ROH IRU 5HDFWLYH 2[\JHQ 6SHFLHV LQ ,VFKHPLF %UDLQ ,QMXU\ 3KDUPDFRO ([S 7KHU %DOHQWLQH f 3DWKRORJ\ RI 2[\JHQ 7R[LFLW\ $FDGHPLF 3UHVV 1HZ
PAGE 140

%RQG\ 6 & DQG 0DUZDK 6 f 6WLPXODWLRQ RI 6\QDSWRVRPDO )UHH 5DGLFDO 3URGXFWLRQ E\ )DWW\ $FLGV 5HODWLRQ WR (VWHULILFDWLRQ DQG WR 'HJUHH RI 8QVDWXUDWLRQ )(%6 /HWW %RUJ / $ &DJOLHUR ( 6DQGOHU 6 :HOVK 1 DQG (L]LULN / f ,QWHUOHXNLQ EHWD ,QFUHDVHV WKH $FWLYLW\ RI 6XSHUR[LGH 'LVPXWDVH LQ 5DW 3DQFUHDWLF ,VOHWV (QGRFULQRO %RYHULV $ DQG &KDQFH % f 7KH 0LWRFKRQGULDO *HQHUDWLRQ RI +\GURJHQ 3HUR[LGH *HQHUDO 3URSHUWLHV DQG (IIHFW RI +\SHUEDULF 2[\JHQ %LRFKHP %URG\ 7 DQG 'XUXP 6 f 0HPEUDQH ,/ ,/ DOSKD 3UHFXUVRU %LQGV WR WKH 3ODVPD 0HPEUDQH 9LD D /HFWLQ/LNH ,QWHUDFWLRQ ,PPXQRO %XUNH 7 : .DGRQDJD -7 f 'URVRSKLOD 7),,' %LQGV WR D &RQVHUYHG 'RZQVWUHDP %DVDO 3URPRWHU (OHPHQW WKDW LV 3UHVHQW LQ 0DQ\ 7$7$%R[ 'HILFLHQW 3URPRWHUV *HQHV 'HY %XUNH 7 : .DGRQDJD -7 f 7KH 'RZQVWUHDP &RUH 3URPRWHU (OHPHQW '3( ,V &RQVHUYHG IURP 'URVRSKLOD WR +XPDQV DQG ,V 5HFRJQL]HG E\ 7$),, RI 'URVRSKLOD *HQHV 'HY &DOOLV )URPP 0 DQG :DOERW 9 f ,QWURQV ,QFUHDVH *HQH ([SUHVVLRQ LQ &XOWXUHG 0DL]H &HOOV *HQHV 'HY &DUH\ 0 /LQ < 6 *UHHQ 0 5 DQG 3WDVKQH 0 f $ 0HFKDQLVP IRU 6\QHUJLVWLF $FWLYDWLRQ RI D 0DPPDOLDQ *HQH E\ *$/ 'HULYDWLYHV 1DWXUH &HUUHWWL 3 .R]ORVN\ & 0RVOH\ % 1HOVRQ 1 9DQ 1HVV *UHHQVWUHHW 7 $ 0DUFK & .URQKHLP 6 5 'UXFN 7 &DQQD]DUUR / $ f 0ROHFXODU &ORQLQJ RI WKH ,QWHUOHXNLQ %HWD &RQYHUWLQJ (Q]\PH 6FLHQFH &KDQFH % 6LHV + DQG %RYHULV $ f +\GURSHUR[LGH 0HWDEROLVP LQ 0DPPDOLDQ 2UJDQLVPV 3K\VLRO 5HY &KDQGHO 1 6 DQG 6FKXPDFNHU 3 7 f &HOOV 'HSOHWHG RI 0LWRFKRQGULDO '1$ UKR f
PAGE 141

&KRPF]\QVNL 3 DQG 6DFFKL 1 f 6LQJOHVWHS 0HWKRG RI 51$ ,VRODWLRQ E\ $FLG *XDQLGLQLXP 7KLR &\DQDWH3KHQRO&KORURIRUP ([WUDFWLRQ $QDO %LRFKHP &KXUFK 0 DQG *LOEHUW : f *HQRPLF 6HTXHQFLQJ 3URF 1DWO $FDG 6FL 86$ &KXUFKLOO 0 ( $ DQG 7UDYHUV $ $ f 3URWHLQ 0RWLIV WKDW 5HFRJQL]H 6WUXFWXUDO )HDWXUHV RI '1$ 7UHQGV %LRFKHP 6FL &ODUN % &ROOLQV / *DQG\ 0 6 :HEE $ & DQG $XURQ 3 ( f *HQRPLF 6HTXHQFH IRU +XPDQ 3URLQWHUOHXNLQ EHWD 3RVVLEOH HYROXWLRQ IURP D 5HYHUVH 7UDQVFULEHG 3URLQWHUOHXNLQ DOSKD *HQH 1XFO $FLGV 5HV &RFHR 7 'L 3DROD 0 3DSD 6 DQG /RUXVVR 0 f $UDFKLGRQLF $FLG ,QWHUDFWLRQ ZLWK WKH 0LWRFKRQGULDO (OHFWURQ 7UDQVSRUW &KDLQ 3URPRWHV 5HDFWLYH 2[\JHQ 6SHFLHV *HQHUDWLRQ )UHH 5DG %LRO 0HG &VHK DQG %HXWOHU % f $OWHUQDWLYH &OHDYDJH RI WKH &DFKHFWLQ7XPRU 1HFURVLV )DFWRU 3URSHSWLGH 5HVXOWV LQ $ /DUJHU ,QDFWLYH )RUP RI 6HFUHWHG 3URWHLQ %LRO &KHP 'H &HVDUH 9DOORQH &DUDFFLROR $ 6DVVRQH&RUVH 3 1HUORY & 9HUGH 3 f +HWHURGLPHUL]DWLRQ RI F-XQ ZLWK $7) DQG F)RV ,V 5HTXLUHG IRU 3RVLWLYH DQG 1HJDWLYH 5HJXODWLRQ RI WKH +XPDQ 8URNLQDVH (QKDQFHU 2QFRJHQH 'H &HVDUH 3DOD]]ROR 0 %HUWKHOVHQ DQG %ODVL ) f &KDUDFWHUL]DWLRQ RI 8() $ '1$%LQGLQJ 3URWHLQ 5HTXLUHG IRU 7UDQVFULSWLRQDO 6\QHUJLVP EHWZHHQ 7ZR $3 6LWHV LQ WKH +XPDQ 8URNLQDVH (QKDQFHU %LRO &KHP 'HO 0DHVWUR 5 DQG 0F'RQDOG : f 6XEFHOOXODU /RFDOL]DWLRQ RI 6XSHUR[LGH 'LVPXWDVHV *OXWDWKLRQH 3HUR[LGDVH DQG &DWDODVH LQ 'HYHORSLQJ 5DW &HUHEUDO &RUWH[ 0HFK $JLQJ 'HY 'HO9HFFKLR 3 DQG 6KDIIHU % f 5HJXODWLRQ RI $QWLR[LGDQW (Q]\PH ([SUHVVLRQ LQ /36WUHDWHG %RYLQH 5HWLQDO 3LJPHQW (SLWKHOLDO DQG &RUQHDO (QGRWKHOLDO &HOOV &XUU (YH 5HV

PAGE 142

'H .HXOHQDHU : 8VKLR)XNDL 0
PAGE 143

)HQJ / ;LD < *DUFLD ( +ZDQJ DQG :LOVRQ & % f ,QYROYHPHQW RI 5HDFWLYH 2[\JHQ ,QWHUPHGLDWHV LQ &\FORR[\JHQDVH ([SUHVVLRQ ,QGXFHG E\ ,QWHUOHXNLQ 7XPRU 1HFURVLV )DFWRU $OSKD DQG /LSRSRO\VDFFKDULGH &OLQ ,QYHVW )LEEH : ( 6FKDDIVPD 0 5 )DONHQEXUJ + ) DQG :LOOHP]H 5 f 7KH %LRORJLFDO $FWLYLWLHV RI ,QWHUOHXNLQ %OXW )LVFKHU ( 0DUDR 0 $ %DUEHU $ ( +XGVRQ $ /HH 5RFN &6 +DZHV $6 7KRPSVRQ 5 & +D\HV 7 $QGHUVRQ 7 f &RPSDULVRQ %HWZHHQ (IIHFWV RI ,QWHUOHXNLQ $OSKD $GPLQLVWUDWLRQ DQG 6XEOHWKDO (QGRWR[HPLD LQ 3ULPDWHV $P 3K\VLRO /5 )OLQW + 7XPLQHOOR ) (PSWDJH 0 + f 7KH ,QDFWLYDWLRQ RI )H6 &OXVWHU &RQWDLQLQJ +\GURO\DVHV E\ 2r %LRO &KHP )RQGHOO -' *H + 5RHGHU 5* f /LJDQG ,QGXFWLRQ RI 7UDQVFULSWLRQDOO\ $FWLYH 7K\URLG +RUPRQH 5HFHSWRU &RDFWLYDWRU &RPSOH[ 3URF 1DWO $FDG 6FL 86$ )UHHPDQ % $ DQG &UDSR f )UHH 5DGLFDOV DQG 7LVVXH ,QMXU\ /DE ,QYHVW )UHHPDQ % $ 0DVRQ 5 :LOOLDP 0 & DQG &UDSR f $QWLR[LGDQW (Q]\PH $FWLYLW\ LQ $OYHRODU 7\SH ,, &HOOV DIWHU ([SRVXUH RI 5DWV WR +\SHUR[LD ([S /XQJ 5HV )ULGRYLFK f 6XSHUR[LGH 'LVPXWDVHV $GY (Q]\PRO )ULGRYLFK f 6XSHUR[LGH 'LVPXWDVHV $QQ 5HY %LRFKHP )ULGRYLFK f 7KH %LRORJ\ RI 2[\JHQ 5DGLFDOV 6FLHQFH )ULGRYLFK f 6XSHUR[LGH 'LVPXWDVHV $GY (Q]\PRO )ULGRYLFK f %LRORJLFDO (IIHFWV RI WKH 6XSHUR[LGH 5DGLFDO $UFK %LRFKHP %LRSKYV )ULGRYLFK f 6XSHUR[LGH 'LVPXWDVHV $Q $GDSWDWLRQ WR D 3DUDPDJQHWLF *DV / %LRO &KHP )ULHG 0 DQG &URWKHUV 0 f (TXLOLEULD DQG .LQHWLFV RI ODF 5HSUHVVRU2SHUDWRU ,QWHUDFWLRQV E\ 3RO\DFU\ODPLGH *HO (OHFWURSKRUHVLV 1XFO $FLGV 5HV

PAGE 144

)URPP 0 DQG %HUJ 3 f 6LPLDQ 9LUXV (DUO\ DQG /DWH 5HJLRQ 3URPRWHU )XQFWLRQV $UH (QKDQFHG E\ WKH %DVH 3DLU 5HSHDW ,QVHUWHG DW 'LVWDQW /RFDWLRQV DQG ,QYHUWHG 2ULHQWDWLRQV 0RO &HOO %LRO )XMLL DQG 7DQLJXFKL 1 f 3KRUERO (VWHU ,QGXFHV 0DQJDQHVH6XSHUR[LGH 'LVPXWDVH LQ 7XPRU 1HFURVLV )DFWRU5HVLVWDQW &HOOV %LRO &KHP *DOORQ 5 f 7KH 2[\JHQVHQVLWLYLW\ RI 1LWURJHQDVH $ 3UREOHP IRU %LRFKHPLVWV DQG 0LFURRJDQLVPV 7UHQGV %LRFKHP 6FL *DUULW\ 3 $ DQG :ROG % f (IIHFWV RI 'LIIHUHQW '1$ 3RO\PHUDVHV LQ /LJDWLRQ 0HGLDWHG 3&5 (QKDQFHG *HQRPLF 6HTXHQFLQJ DQG ,Q 9LYR )RRWSULQWLQJ 3URF 1DWO $FDG 6FL 86$ *KRVK 6 /DWLPHU 5 *DU\ % 0 +DUZRRG 5 DQG 2GXUR $ f (QGRWR[LQLQGXFHG 2UJDQ ,QMXU\ &ULW &DUH 0HG VO *LEEV / 6 'HO9HFFKLR 3 DQG 6KDIIHU % f 0Q DQG &X=Q 62' ([SUHVVLRQ LQ &HOOV IURP /366HQVLWLYH DQG /365HVLVWDQW 0LFH )UHH 5DG %LRO 0HG *LHVH .LQJVOH\ & .LUVKQHU 5 *URVVFKHGO 5 f $VVHPEO\ DQG )XQFWLRQ RI D 7&5 DOSKD (QKDQFHU &RPSOH[ LV 'HSHQGHQW RQ /(),QGXFHG '1$ %HQGLQJ DQG 0XOWLSOH 3URWHLQ3URWHLQ ,QWHUDFWLRQV *HQHV 'HY *LOEHUW / HGf f 2[\JHQ DQG /LYLQJ 3URFHVVHV $Q ,QWHU'LVFLSOLQDU\ $SSURDFK 6SULQJHU 1HZ
PAGE 145

*RRVVHQV 9 *URRWHQ DQG )LHUV : f 7KH 2[LGDWLYH 0HWDEROLVP RI *OXWDPLQH $ 0RGXODWRU RI 5HDFWLYH 2[\JHQ ,QWHUPHGLDWH0HGLDWHG &\WRWR[LFLW\ RI 7XPRU 1HFURVLV )DFWRU LQ / )LEURVDUFRPD &HOOV / %LRO &KHP *RWWOLHE ( 9DQHU +HLGHQ 0 DQG 7KRPSVRQ & % f %FO[/f 3UHYHQWV WKH ,QLWLDO 'HFUHDVH LQ 0LWRFKRQGULDO 0HPEUDQH 3RWHQWLDO DQG 6XEVHTXHQW 5HDFWLYH 2[\JHQ 6SHFLHV 3URGXFWLRQ GXULQJ 7XPRU 1HFURVLV )DFWRU DOSKD LQGXFHG $SRSWRVLV 0RO &HOO %LRO *RUPDQ & 0 0HUOLQR 7 :LOOLQJKDP 0 & 3DVWDQ DQG +RZDUG % + f 7KH 5RXV 6DUFRPD 9LUXV /RQJ 7HUPLQDO 5HSHDW ,V D 6WURQJ 3URPRWHU ZKHQ ,QWURGXFHG LQWR D 9DULHW\ RI (XNDU\RWLF &HOOV E\ '1$0HGLDWHG 7UDQVIHFWLRQ 3URF 1DWO $FDG 6FL 86$ *UHJRU\ 3 6FKPLG $ =DYDUL 0 0XQVWHUNRWWHU 0 DQG +RU] : f &KURPDWLQ 5HPRGHOOLQJ DW WKH 3+ 3URPRWHU 5HTXLUHV 6:,61) DQG 6$*$ DW D 6WHS 6XEVHTXHQW WR $FWLYDWRU %LQGLQJ (0%2 *URVVFKHGO 5 DQG %LPVWLHO 0 / Df ,GHQWLILFDWLRQ RI 5HJXODWRU\ 6HTXHQFHV LQ WKH 3UHOXGH 6HTXHQFH RI DQ +$ +LVWRQH *HQH E\ WKH 6WXG\ RI 6SHFLILF 'HOHWLRQ 0XWDQWV ,Q 9LYR 3URF 1DWO $FDG 6FL 86$ *URVVFKHGO 5 DQG %LPVWLH 0 / Ef 6SDFHU '1$ 6HTXHQFHV 8SVWUHDP RI WKH 7$7$$7$ 6HTXHQFH DUH (VVHQWLDO IRU 3URPRWLRQ RI +$ +LVWRQH *HQH 7UDQVFULSWLRQ ,Q 9LYR 3URF 1DWO $FDG 6FL 86$ *URVVFKHGO 5 f +LJKHU2UGHU 1XFOHRSURWHLQ &RPSOH[HV LQ 7UDQVFULSWLRQ$QDORJLHV ZLWK 6LWH6SHFLILF 5HFRPELQDWLRQ &XUU 2SLQ &HOO %LRO *UXVV 3 'KDU 5 .KRXU\ f 6LPLDQ 9LUXV 7DQGHP 5HSHDWHG 6HTXHQFHV DV DQ (OHPHQW RI WKH (DUO\ 3RPRWHU 3URF 1DWO $FDG 6FL 86$ *XOOEHUJ 8 /DQW] 0 /LQGYDOO / 2OVVRQ DQG +LPPOHU $ f ,QYROYHPHQW RI DQ $VQ9DO &OHDYDJH 6LWH LQ WKH 3URGXFWLRQ RI D 6ROXEOH )RUP RI D +XPDQ 7XPRU 1HFURVLV )DFWRU 71)f 5HFHSWRU 6LWH'LUHFWHG 0XWDJHQHVLV RI D 3XWDWLYH &OHDYDJH 6LWH LQ WKH S 71) 5HFHSWRU &KDLQ (XU &HOO %LRO *ZLQQHU : 7LVKHU & & DQG 1LFN + 6 f 5HJXODWLRQ RI 0DQJDQHVH 6XSHUR[LGH 'LVPXWDVH LQ *ORPHUXODU (SLWKHOLDO &HOOV 0HFKDQLVPV RI ,QWHUOHXNLQ ,QGXFWLRQ .LGQH\ ,QW +DOOLZHOO % f &KORURSODVW 0HWDEROLVP 2[IRUG 8QLYHUVLW\ 3UHVV 2[IRUG

PAGE 146

+DOOLZHOO % DQG *XWWHULGJH 0 f 5ROH RI )UHH 5DGLFDOV DQG &DWDO\WLF 0HWDO ,RQV LQ +XPDQ 'LVHDVH $Q 2YHUYLHZ 0HWKRGV (Q]YPRO +DOOLZHOO % DQG *XWWHULGJH 0 & f )UHH 5DGLFDOV LQ %LRORJ\ DQG 0HGLFLQH 2[IRUG 6FLHQFH 3XEOLFDWLRQV 2[IRUG +DQVEHUJ : GH *URRW + DQG 6LHV + f 5HDFWLYH 2[\JHQ 6SHFLHV $VVRFLDWHG ZLWK &HOO 'LIIHUHQWLDWLRQ LQ 1HXURVSRUD FUDVVD )UHH 5DG %LRO 0HG +DUULV & $ 'HUELQ 6 +XQWH 0F'RQRXJK % .UDXVV 0 5 &KHQ 7 6PLWK 0 DQG (SVWHLQ / % f 0DQJDQHVH 6XSHUR[LGH 'LVPXWDVH LV ,QGXFHG E\ ,)1JDPPD LQ 0XOWLSOH &HOO 7\SHV 6\QHUJLVWLF ,QGXFWLRQ E\ ,)1JDPPD DQG 7XPRU 1HFURVLV )DFWRU RU ,/ ,PPXQRO +DVVDQ + 0 DQG 6XQ + & f 5HJXODWRU\ 5ROHV RI )QU )XU DQG $UF LQ ([SUHVVLRQ RI 0DQJDQHVH&RQWDLQLQJ 6XSHUR[LGH 'LVPXWDVH LQ (VFKHULFKLD FROL 3URF 1DWO $FDG 6FL 86$ +DXJDDUG 1 f &HOOXODU 0HFKDQLVPV RI 2[\JHQ 7R[LFLW\ 3K\VLRO 5HY +DXVODGHQ $ DQG )ULGRYLFK f 6XSHUR[LGH DQG 3HUR[\QLWULWH ,QDFWLYDWH $FRQLWDVHV EXW 1LWULF 2[LGH 'RHV 1RW %LRO &KHP +HOOHU 5 $ 6RQJ )DQ 1 DQG &KDQJ f 7KH S 7XPRU 1HFURVLV )DFWRU 5HFHSWRU 0HGLDWHV &\WRWR[LFLW\ &HOO +HQNHO DQG %URZQ 0 $ f 38O DQG *$7$&RPSRQHQWV RI D 0DVW &HOO 6SHFLILF ,QWHUOHXNLQ ,QWURQLF (QKDQFHU 3URF 1DWO $FDG 6FL 86$ +HQU\ < DQG *XLVVDQL $ f ,QWHUDFWLRQV RI 1LWULF 2[LGH ZLWK +HPRSURWHLQV 5ROHV RI 1LWULF 2[LGH LQ 0LWRFKRQGULD &HOO 0RO /LIH 6FL +MDOPDUVVRQ 0DUNOXQG 6 (QJVWURP $ DQG (GOXQG 7 f ,VRODWLRQ DQG 6HTXHQFH RI &RPSOHPHQWDU\ '1$ (QFRGLQJ +XPDQ ([WUDFHOOXODU 6XSHUR[LGH 'LVPXWDVH 3URF 1DWO $FDG 6FL 86$ +R 6 1 +XQW + +RUWRQ 5 0 3XOOHQ DQG 3HDVH / 5 f 6LWH GLUHFWHG 0XWDJHQHVLV E\ 2YHUODS ([WHQVLRQ 8VLQJ WKH 3RO\PHUDVH &KDLQ 5HDFWLRQ *HQH +R < 6 DQG &UDSR f 1XFOHRWLGH 6HTXHQFH RI F'1$V &RGLQJ IRU 5DW 0DQJDQHVH&RQWDLQLQJ 6XSHUR[LGH 'LVPXWDVH 1XFO $FLGV 5HV

PAGE 147

+R < 6 DQG &UDSR f ,VRODWLRQ DQG &KDUDFWHUL]DWLRQ RI &RPSOHPHQWDU\ '1$V (QFRGLQJ +XPDQ 0DQJDQHVH&RQWDLQLQJ 6XSHUR[LGH 'LVPXWDVH )(%6 /HWW +R < 6 +RZDUG $ DQG &UDSR f 0ROHFXODU 6WUXFWXUH RI D )XQFWLRQDO 5DW *HQH IRU 0DQJDQHVH&RQWDLQLQJ 6XSHUR[LGH 'LVPXWDVH $P 5HVSLU &HOO 0RO %LRO +RKPDQQ + 3 5HP\ 5 3RVFKO % DQG /RRQ $ 3 0 f 7XPRU 1HFURVLV )DFWRUVD DQG S %LQG WR WKH 6DPH 7ZR 7\SHV RI 7XPRU 1HFURVLV )DFWRU 5HFHSWRUV DQG 0D[LPDOO\ $FWLYDWH WKH 7UDQVFULSWLRQ )DFWRU 1)N% DW /RZ 5HFHSWRU 2FFXSDQF\ DQG ZLWKLQ 0LQXWHV DIWHU 5HFHSWRU %LQGLQJ %LRO &KHP +RUL 6 f 6WXG\ RQ +\SHUEDULF 2[\JHQ,QGXFHG &RQYXOVLRQ ZLWK 3DUWLFXODU 5HIHUHQFH WR *DPPD$PLQREXW\ULF $FLG LQ 6\QDSWRVRPHV %LRFKHP 7RN\Rf +RPVWUD DQG
PAGE 148

,ZDWD 6 /HH : 2NDGD /HH ,ZDWD 0 5DVPXVVHQ % /LQN 7 $ 5DPDVZDP\ 6 DQG -DS % f &RPSOHWH 6WUXFWXUH RI WKH 6XEXQLW %RYLQH 0LWRFKRQGULDO &\WRFKURPH EFO &RPSOH[ 6FLHQFH -DFRE ) DQG 0RQRG f *HQHWLF 5HJXODWRU\ 0HFKDQLVPV LQ WKH 6\QWKHVLV RI 3URWHLQV 0RO %LRO -DFRE\ % DQG &KRL $ 0 f ,QIOXHQ]D 9LUXV ,QGXFHV ([SUHVVLRQ RI $QWLR[LGDQW *HQHV LQ +XPDQ (SLWKHOLDO &HOOV )UHH 5DG %LRO 0HG -RKQ 6 5HHYHV 5 /LQ &KLOG 5 /HLGHQ 7KRPSVRQ & % DQG /HRQDUG : f 5HJXODWLRQ RI &HOO7\SH6SHFLILF ,QWHUOHXNLQ 5HFHSWRU D&KDLQ *HQH ([SUHVVLRQ 3RWHQWLDO 5ROH RI 3K\VLFDO ,QWHUDFWLRQV EHWZHHQ (OI +0* ,
PAGE 149

.RED\DVKL < .LWDPRWR 7 0DVXKLUR < :DWDQDEH 0 .DVH 7 0HW]JHU
PAGE 150

.XWDFK $ DQG .DGRQDJD -7 f 7KH 'RZQVWUHDP 3URPRWHU (OHPHQW '3( $SSHDUV 7R %H DV :LGHO\ 8VHG DV WKH 7$7$ %R[ LQ 'URVRSKLOD &RUH 3URPRWHUV 0RO &HOO %LRO /DPERZLW] $ 0 .RER\DVKL 6 3DLQWHU $ DQG 0HGRII f 3RVVLEOH 5HODWLRQVKLS RI 0RUSKRJHQHVLV LQ 3DWKRJHQLF )XQJXV +LVWRSODVPD FDSVXODWXP WR +HDW 6KRFN 5HVSRQVH 1DWXUH /DQW] 0 *XOOEHUJ 8 1LOVVRQ ( DQG 2OVVRQ f &KDUDFWHUL]DWLRQ ,Q 9LWUR RI D +XPDQ 7XPRU 1HFURVLV )DFWRU%LQGLQJ 3URWHLQ $ 6ROXEOH )RUP RI D 7XPRU 1HFURVLV )DFWRU 5HFHSWRU &OLQ ,QYHVW /HH 7 + /HH : =LII ( % DQG 9LOFHN f ,VRODWLRQ DQG &KDUDFWHUL]DWLRQ RI (LJKW 7XPRU 1HFURVLV )DFWRU,QGXFHG *HQH 6HTXHQFHV IURP +XPDQ )LEUREODVWV 0RO &HOO %LRO /HL 0 DQG 0RUULVRQ & f 6SHFLILF (QGRWR[LF /LSRSRO\VDFFKDULGH%LQGLQJ 3URWHLQV RQ 0XULQH 6SOHQRF\WHV ,PPXQRO /HUJHU + 6RFN ( 5HQQHU *UXPPW ) DQG :HJQHU 0 f )XQFWLRQDO ,QWHUDFWLRQ EHWZHHQ WKH 328 'RPDLQ 3URWHLQ 7VW2FW DQG WKH +LJK 0RELOLW\*URXS 3URWHLQ +0* ,
PAGE 151

/RPHGLFR 3 7 *XEOHU 8 +HOOPDQQ & 3 'XNRYLFK 0 *LUL 3DQ < & &ROOLHU 6HPLRQRY 5 &KXD $ 2 DQG 0L]HO 6 % f &ORQLQJ DQG ([SUHVVLRQ RI 0XULQH ,QWHUOHXNLQ F'1$ LQ (VFKHULFKLD FROL 1DWXUH /RQW] : 6LUVMR $ /LX : /LQGEHUJ 0 5ROOPDQ 2 DQG 7RUPD + f ,QFUHDVH P51$ ([SUHVVLRQ RI 0DQJDQHVH 6XSHUR[LGH 'LVPXWDVH LQ 3VRULDVLV 6NLQ /HVLRQV DQG LQ &XOWXUHG +XPDQ .HUDWLQRF\WHV ([SRVHG WR ,/ EHWD DQG 71)DOSKD )UHH 5DG %LRO 0HG 0DQJDQDUR ) &KRSUD 9 6 0\GODUVNL 0 % %HPDWFKH] DQG 6FKLSSHU + 0 f 5HGR[ 3HUWXUEDWLRQV LQ &\VWHDPLQH6WUHVVHG $VWURJOLD ,PSOLFDWLRQV IRU ,QFOXVLRQ )RUPDWLRQ DQG *OLRVLV LQ WKH $JLQJ %UDLQ )UHH 5DGLFDOV %LRO 0HG 0DQLDWLV 7 *RRGEXP 6 DQG )LVFKHU $ f 5HJXODWLRQ RI ,QGXFLEOH DQG 7LVVXH6SHFLILF *HQH ([SUHVVLRQ 6FLHQFH 0DQLDWLV 7 :KLWWPRUH / $ 'X : )DQ & 0 .HOOHU $ 3DORPEHOOD 9 7KDQRV f 3RVLWLYH DQG 1HJDWLYH &RQWURO RI +XPDQ ,QWHUIHURQE *HQH ([SUHVVLRQ ,Q 7UDQVFULSWLRQDO 5HJXODWLRQ 6 / 0F.QLJKW DQG 5
PAGE 152

0HOHQGH] $ DQG %DJOLRQL & f 'LIIHUHQWLDO ,QGXFWLRQ DQG 'HFD\ RI 0DQJDQHVH 6XSHUR[LGH 'LVPXWDVH P51$V 0ROO &HOO %LRO 0HORY 6 6FKQHLGHU $ 'D\ % +LQHUIHOG &RVNXQ 3 0LUUD 6 6 &UDSR DQG :DOODFH & f $ 1RYHO 1HXURORJLFDO 3KHQRW\SH LQ 0LFH /DFNLQJ 0LWRFKRQGULDO 0DQJDQHVH 6XSHUR[LGH 'LVPXWDVH 1DW *HQHW 0HUFOD 0 :DQJ ;) 2OVHQ DQG &DDPH f 7UDQVFULSWLRQDO (QKDQFHU (OHPHQWV LQ WKH 0RXVH ,PPXQRJOREXOLQ +HDY\ &KDLQ /RFXV 6FLHQFH 0HULND 0 :LOOLDPV $ &KHQ &ROOLQV 7 DQG 7KDQRV f 5HFUXLWPHQW RI &%3S E\ WKH ,)1 EHWD (QKDQFHRVRPH ,V 5HTXLUHG IRU 6\QHUJLVWLF $FWLYDWLRQ RI 7UDQVFULSWLRQ 0RO &HOO 0LJQRWWH % DQG 9D\VVLHUH / f 0LWRFKRQGULD DQG $SRSWRVLV (XU %LRFKHP 0ROOR\ 5 0DQQLFN $ DQG 5RGULFN 0 / f &\WRNLQHV 6HSVLV DQG ,PPXQRPRGXODWLRQ %U 6XUH 0RUHDX 3 +HQ 5 :DV\O\N % (YHUUHWW 5 *DXE 0 HW DO f 7KH 69 ES 5HSHDW +DV D 6WULNLQJ (IIHFW RQ *HQH ([SUHVVLRQ %RWK LQ 69 DQG 2WKHU &KLPHULF 5HFRPELQDQWV 1XFOHLF $FLGV 5HV 0RUWRQ 5 / ,NOH DQG :KLWH & : f /RVV RI /XQJ 0LWRFKRQGULDO $FRQLWDVH $FWLYLW\ 'XH WR +\SHUR[LD LQ %URQFKRSXOPRQDU\ '\VSODVLD LQ 3ULPDWHV $P 3KYVLRO / 0XHOOHU 3 5 DQG :ROG % f ,Q 9LYR )RRWSULQWLQJ RI D 0XVFOH 6SHFLILF (QKDQFHU E\ /LJDWLRQ0HGLDWHG 3&5 6FLHQFH 0XOOHU+LOO % f 7KH ODF 2SHURQ $ 6KRUW +LVWRU\ RI D *HQHWLF 3DUDGLJP :DOWHU GH *UX\WHU %HUOLQ *HUPDQ\ 1HGZLQ ( 1D\ORU 6 / 6DNDJXFKL $ < 6PLWK -DUUHWW1HGZLQ 3HQQLFD *RHGGHO 9 DQG *UD\ 3 : f +XPDQ /\PSKRWR[LQ DQG 7XPRU 1HFURVLV )DFWRU *HQHV 6WUXFWXUH +RPRORJ\ DQG &KURPRVRPDO /RFDOL]DWLRQ 1XFOHLF $FLGV 5HV 1HWD 5 'RXFKHV 6 DQG 2SSHQKHLP f ,QWHUOHXNLQ LV D 5DGLRSURWHFWRU ,PPXQRO 1HXEHUJHU 0 6 f ([SUHVVLRQ DQG 5HJXODWLRQ RI ,PPXQRJOREXOLQ +HDY\ &KDLQ *HQH 7UDQVIHFWHG LQWR /\PSKRLG &HOOV (0%2

PAGE 153

1LFN + DQG *LOEHUW : f 'HWHFWLRQ RI ,Q 9LYR 3URWHLQ'1$ ,QWHUDFWLRQV ZLWKLQ WKH ODF 2SHURQ RI (VFKHULFKLD FROL 1DWXUH 1LLWVX < :DWDQDEH 1 6RQ + 1HGD +
PAGE 154

3UPLFD 1HZLQ ( +D\IOLFN 6 6HHEXUJ 3 + 'HU\QFN 5 3DOODGLQR 0 $ .RKU : $JJDUZDO % % DQG *RHGGHO 9 f +XPDQ 7XPRXU 1HFURVLV )DFWRU 3UHFXUVRU 6WUXFWXUH ([SUHVVLRQ DQG +RPRORJ\ WR /\PSKRWR[LQ 1DWXUH 3KDP $' DQG 6DXHU ) f 8ELTXLWLQ$FWLYDWLQJ&RQMXJDWLQJ $FWLYLW\ RI 7$),,f $ 0HGLDWRU RI $FWLYDWLRQ RI *HQH ([SUHVVLRQ LQ 'URVRSKLOD 6FLHQFH 3LFDUG DQG 6FKDIIQHU : f $ /\PSKRFWH6SHFLILF (QKDQFHU LQ WKH 0RXVH ,PPXQRJOREXOLQ N *HQH 1DWXUH 3LHUFH : 6FKRHQOHEHU -HVPRN %HVW 0RRUH 6 $ &ROOLQV 7 DQG *HUULWVHQ 0 ( f 1RYHO ,QKLELWRUV RI &\WRNLQH,QGXFHG ,NDSSD % DOSKD 3KRVSKRU\ODWLRQ DQG (QGRWKHOLDO &HOO $GKHVLRQ 0ROHFXOH ([SUHVVLRQ 6KRZ $QWL,QIODPPDWRU\ (IIHFWV ,Q 9LYR %LRO &KHP 3R\WRQ 5 2 DQG 0F(ZHQ ( f &URVVWDON EHWZHHQ 1XFOHDU DQG 0LWRFKRQGULDO *HQRPHV $QQ 5HY %LRFKHP 3ULHVWOH 3 6FKDU + 3 DQG *UXWWHU 0 f &U\VWDO 6WUXFWXUH RI WKH &\WRNLQH ,QWHUOHXNLQ EHWD (0%2 3ULHVWOH 3 6FKDU + 3 DQG *UXWWHU 0 f &U\VWDOORJUDSKLF 5HILQHPHQW RI ,QWHUOHXNLQ EHWD DW $ 5HVROXWLRQ 3URF 1DWO $FDG 6FL 86$ 3ULYDOOH & 7 DQG )ULGRYLFK f ,URQ 6SHFLILFLW\ RI WKH )XU'HSHQGHQW 5HJXODWLRQ RI WKH %LRV\QWKHVLV RI WKH 0DQJDQHVH&RQWDLQLQJ 6XSHUR[LGH 'LVPXWDVH LQ (VFKHULFKLD &ROL %LRO &KHP 3WDVKQH 0 f *HQH 5HJXODWLRQ E\ 3URWHLQV $FWLQJ 1HDUE\ DQG DW D 'LVWDQFH 1DWXUH 3WDVKQH 0 DQG *DQQ $ f 7UDQVFULSWLRQDO $FWLYDWLRQ E\ 5HFUXLWPHQW 1DWXUH 3XJK % ) DQG 7LMLDQ 5 f 7UDQVFULSWLRQ IURP D 7$7$OHVV 3URPRWHU 5HTXLUHV D 0XOWLVXEXQLW 7),,' &RPSOH[ *HQHV t 'HY 4XHHQ & DQG %DOWLPRUH f ,PPXQRJOREXOLQ *HQH 7UDQVFULSWLRQ ,V $FWLYDWHG E\ 'RZQVWUHDP 6HTXHQFH (OHPHQWV &HOO 4XHHQ & DQG 6WDIIRUG f )LQH 0DSSLQJ RI DQ ,PPXQRJOREXOLQ *HQH $FWLYDWRU 0RO &HOO %LRO

PAGE 155

5DQJDQDWK 6 2X\DQJ : %KDWWDUFKDU\D 6KD : & *UXSH $ 3HOW] DQG 0XUSK\ 0 f *$7$'HSHQGHQW (QKDQFHU $FWLYLW\ LQ ,/ *HQH 5HJXODWLRQ ,PPXQRO 5HPDGH 5DHV 0 7RXVVDLQW 2 5HQDUG 3 DQG 5DR f /RZ /HYHOV RI 5HDFWLYH 2[\JHQ 6SHFLHV DV 0RGXODWRUV RI &HOO )XQFWLRQ 0XWDW 5HV 5LHWVFKHO ( + DQG %UDGH + $XJ f %DFWHULDO (QGRWR[LQ 6FLHQWLILF $PHULFDQ 5RHGHU 5 f 7KH 5ROH RI *HQHUDO ,QLWLDWLRQ )DFWRUV LQ 7UDQVFULSWLRQ E\ 51$ 3RO\PHUDVH ,, 7UHQGV %LRFKHP 6FL 5RJHUV 5 &KHVURZQ 6 ( .XR 6 0RQQLHU 0 DQG 1LFN + 6 f &\WRNLQH,QGXFLEOH (QKDQFHU ZLWK 3URPRWHU $FWLYLW\ LQ %RWK WKH 5DW DQG +XPDQ 0DQJDQHVH6XSHUR[LGH 'LVPXWDVH *HQHV %LRFKHP 5ROOLQV 5$ 0RUFLOOR 3 DQG 'RUVHWW f 1LSSHG% $ 'URVRSKLOD +RPRORJXH RI &KURPRVRPDO $GKHULQV 3DUWLFLSDWHV LQ $FWLYDWLRQ E\ 5HPRWH (QKDQFHUV LQ WKH &XW DQG 8OWUDELWKRUD[ *HQHV *HQHWLFV 5RVHQEHUJ 0 DQG &RXUW f 5HJXODWRU\ 6HTXHQFHV ,QYROYHG LQ WKH 3URPRWLRQ DQG 7HUPLQDWLRQ RI 51$ 7UDQVFULSWLRQ $QQ 5HY *HQHW 6DPEURRN )ULWVFK ( ) DQG 0DQLDWLV 7 f 0ROHFXODU &ORQLQJ $ /DERUDWRU\ 0DQXDO VHFRQG HGLWLRQ &ROG 6SULQJ +DUERU /DERUDWRU\ 3UHVV &ROG 6SULQJ +DUERU 1< 6DQFKH]$OFD]DU $ +HUQDQGH] GHO OD 7RUUH 0 3 *DUFLD / 6DQWLDJR ( 0XQR]
PAGE 156

6FKPLGW 1 7UDHQFNQHU ( % 0HLHU % DQG %DHXHUOH 3 $ f ,QGXFWLRQ RI 2[LGDWLYH 6WUHVV E\ 2NDGDLF $FLG ,V 5HTXLUHG IRU $FWLYDWLRQ RI 7UDQVFULSWLRQ )DFWRU 1)NDSSD % %LRO &KHP 6FKUHFN 5 5LHEHU 3 DQG %DHXHUOH 3 $ f (0%2 6FKXO]H2VWKRII %DNNHU $ & 9DQKDHVHEURHFN % %H\DHUW 5 -DFRE : $ DQG )LHUV : f &\WRWR[LF $FWLYLW\ RI 7XPRU 1HFURVLV )DFWRU LV 0HGLDWHG E\ (DUO\ 'DPDJH RI 0LWRFKRQGULDO )XQFWLRQV (YLGHQFH IRU WKH ,QYROYHPHQW RI 0LWRFKRQGULDO 5DGLFDO *HQHUDWLRQ %LRO &KHP 6FKXO]H2VWKRII %H\DHUW 5 9DQGHYRRUGH 9 +DHJHPDQ DQG )LHUV : f 'HSOHWLRQ RI WKH 0LWRFKRQGULDO (OHFWURQ 7UDQVSRUW $EURJDWHV WKH &\WRWR[LF DQG *HQH,QGXFWLYH (IIHFWV RI 71) (0%2 6FKXPDQQ 5 5 /HRQJ 6 5 *ODJJV : *UD\ 3 : :ULJKW 6 0DWKLVRQ & 7RELDV 3 6 DQG 8OHYLWFK 5 f 6WUXFWXUH DQG )XQFWLRQ RI /LSRSRO\VDFFKDULGH %LQGLQJ 3URWHLQ 6FLHQFH 6HOGHQ 5 ) +RZLH % 5RZH 0 ( *RRGPDQ + 0 DQG 0RRUH ' f +XPDQ *URZWK +RUPRQH DV D 5HSRUWHU *HQH LQ 5HJXODWLRQ 6WXGLHV (PSOR\LQJ 7UDQVLHQW *HQH ([SUHVVLRQ 0RO &HOO %LRO 6KDIIHU % 7UHDQRU & 3 DQG 'HO9HFFKLR 3 f ([SUHVVLRQ RI %RYLQH DQG 0RXVH (QGRWKHOLDO &HOO $QWLR[LGDQW (Q]\PHV )ROORZLQJ 51)DOSKD ([SRVXUH )UHH 5DG %LRO 0HG 6KLHOGV -0 DQG
PAGE 157

6WDIIRUG DQG 4XHHQ & f &HOO7\SH 6SHFLILF ([SUHVVLRQ RI D 7UDQVIHFWHG ,PPXQRJOREXOLQ *HQH 1DWXUH 6WHSKDQ] % *ZLQQHU : &DQQRQ 7LVKHU & & DQG 1LFN + 6 f +HDW $JJUHJDWHG ,J* DQG ,QWHUOHXNLQ EHWD 6WLPXODWH 0DQJDQHVH 6XSHUR[LGH 'LVPXWDVH LQ 0HVDQJLDO &HOOV ([S 1HSKURO 6XUSLQ 0 DQG &KRU\ f 7KH &RRUGLQDWLRQ RI 1XFOHDU DQG 2UJDQHOODU *HQRPH ([SUHVVLRQ LQ (XNDU\RWLF &HOOV (VVD\V %LRFKHP 6X]XNL 7DWVXPL + 6DWRK 6 6HQGD 7 1DNDWD 7 )XMLL DQG 7DQLJXFKL 1 f 0DQJDQHVH6XSHUR[LGH 'LVPXWDVH LQ (QGRWKHOLDO &HOOV /RFDOL]DWLRQ DQG 0HFKDQLVP RI ,QGXFWLRQ $P 3K\VLRO + 7DNLPRWR < DQG .XUDPRWR $ f 3UHVHQFH RI D 5HJXODWRU\ (OHPHQW ZLWKLQ WKH )LUVW ,QWURQ RI WKH +XPDQ 3ODWHOHW'HULYHG *URZWK )DFWRU$ &KDLQ *HQH -SQ &DQFHU 5HV 7DQ 6 6DJDUD < /LX < 0DKHU 3 DQG 6FKXEHUW f 7KH 5HJXODWLRQ RI 5HDFWLYH 2[\JHQ 6SHFLHV 3URGXFWLRQ 'XULQJ 3URJUDPPHG &HOO 'HDWK / &HOO %LRO 7DUWDJOLD / $ DQG *RHGGHO 9 f 7ZR 71) 5HFHSWRUV ,PPXQRO 7RGD\ 7DUWDJOLD / $ 5RWKH 0 +X <) DQG *RHGGHO 9 f 7XPRU 1HFURVLV )DFWRUfV &\WRWR[LF $FWLYLW\ LV 6LJQDOHG E\ WKH S 71) 5HFHSWRU &HOO 7KDQRV DQG 0DQLDWLV 7 f 7KH +LJK 0RELOLW\ *URXS 3URWHLQ +0* ,
PAGE 158

7LMDQ 5 DQG 0DQLDWLV 7 f 7UDQVFULSWLRQDO $FWLYDWLRQ $ &RPSOH[ 3X]]OH ZLWK )HZ (DV\ 3LHFHV &HOO 7RELDV 3 6 0DWKLVRQ & DQG 8OHYLWFK 5 f $ )DPLO\ RI /LSRSRO\VDFFKDULGH %LQGLQJ 3URWHLQV ,QYROYHG LQ 5HVSRQVHV WR *UDPn QHJDWLYH 6HSVLV %LRO &KHP 7UHXWHU ( -RKDQVVRQ / 7KRPVHQ 6 :DPPDUN $ /HHUV 3HOWR+XLNNR 0 6MREHUJ 0 :ULJKW $ 3 6S\URX DQG *XVWDIVVRQ $ f &RPSHWLWLRQ EHWZHHQ 7K\URLG +RUPRQH 5HFHSWRU$VVRFLDWHG 3URWHLQ 75$3f DQG 7UDQVFULSWLRQDO ,QWHUPHGLDU\ )DFWRU 7,)f IRU %LQGLQJ WR 1XFOHDU 5HFHSWRUV ,PSOLFDWLRQV IRU WKH 5HFUXLWPHQW RI 75$3 DQG SL &RDFWLYDWRU &RPSOH[HV %LRO &KHP 7VXMLPRWR 0
PAGE 159

YRQ 6RQQWDJ & f 7KH &KHPLFDO %DVLV RI 5DGLDWLRQ %LRORJ\ 7D\ORU t )UDQFLV /RQGRQ :DUQHU % % %XQKDQV 0 6 &ODUN & DQG :LVSH 5 f 7XPRU 1HFURVLV )DFWRUDOSKD ,QFUHDVHV 0Q62' ([SUHVVLRQ 3URWHFWLRQ DJDLQVW 2[LGDQW ,QMXU\ $P 3K\VLRO / :DUQHU % % 6WXDUW / *HEE 6 DQG :LVSH 5 f 5HGR[ 5HJXODWLRQ RI 0DQJDQHVH 6XSHUR[LGH 'LVPXWDVH $P 3K\VLRO / :HLVLQJHU 5 $ DQG )ULGRYLFK f 6XSHUR[LGH 'LVPXWDVH 2UJDQHOOH 6SHFLILFLW\ %LRO &KHP :HOERXP & 5 % DQG
PAGE 160


PAGE 161

%,2*5$3+,&$/ 6.(7&+ 5LFKDUG -DPHV 5RJHUV ZDV ERP RQ 6HSWHPEHU WR 5LFKDUG 5RZH 5RJHUV DQG (OHDQRU )UDQFHV 5RJHUV LQ /RZHOO 0DVVDFKXVHWWV +H DWWHQGHG &HQWUDO &DWKROLF +LJK 6FKRRO LQ /DZUHQFH 0DVVDFKXVHWWV JUDGXDWLQJ LQ 0D\ +H FRQWLQXHG KLV HGXFDWLRQ E\ DWWHQGLQJ %RVWRQ &ROOHJH LQ &KHVWQXW +LOO 0DVVDFKXVHWWV JUDGXDWLQJ VXPPD FXP ODXGH ZLWK D %DFKHORU RI 6FLHQFH GHJUHH LQ FKHPLVWU\ $IWHU FROOHJH KH ZDV DFFHSWHG WR WKH 8QLYHUVLW\ RI 0DVVDFKXVHWWV 0HGLFDO 6FKRRO IURP ZKLFK KH UHFHLYHG KLV 'RFWRU RI 0HGLFLQH GHJUHH LQ -XQH 'XULQJ WKH IROORZLQJ WKUHH \HDUV KH WUDLQHG LQ WKH PHGLFDO VSHFLDOW\ RI LQWHUQDO PHGLFLQH DW WKH %ULJKDP t :RPHQfV +RVSLWDO LQ %RVWRQ 0DVVDFKXVHWWV DQG WKH %HUNVKLUH 0HGLFDO &HQWHU LQ 3LWWVILHOG 0DVVDFKXVHWWV )URP WR KH VHUYHG DV 'LUHFWRU RI (PHUJHQF\ 6HUYLFHV DW +DUULQJWRQ 0HPRULDO +RVSLWDO LQ 6RXWKEULGJH 0DVVDFKXVHWWV DV ZHOO DV DQ ,QVWUXFWRU LQ WKH 'HSDUWPHQW RI (PHUJHQF\ 0HGLFLQH DW WKH 8QLYHUVLW\ RI 0DVVDFKXVHWWV 0HGLFDO &HQWHU LQ :RUFHVWHU 0DVVDFKXVHWWV )URP WR KH WUDLQHG LQ WKH PHGLFDO VSHFLDOW\ RI DQHVWKHVLRORJ\ LQ WKH 'HSDUWPHQW RI $QHVWKHVLRORJ\ DW WKH 8QLYHUVLW\ RI )ORULGD &ROOHJH RI 0HGLFLQH LQ *DLQHVYLOOH )ORULGD ZKHUH KH FXUUHQWO\ KROGV WKH WLWOH RI ,QVWUXFWRU DQG LV LQYROYHG WKH FOLQLFDO FDUH RI SDWLHQWV DQG WKH VXSHUYLVLRQ DQG WHDFKLQJ RI UHVLGHQW SK\VLFLDQV DQG PHGLFDO VWXGHQWV +H HQWHUHG WKH GRFWRUDO SURJUDP LQ ELRFKHPLVWU\ DQG PROHFXODU ELRORJ\ DW WKH 8QLYHUVLW\ RI )ORULGD LQ WKH IDOO RI 8SRQ FRPSOHWLRQ RI WKH 'RFWRU RI 3KLORVRSK\ GHJUHH KH ZLOO FRQWLQXH DV DQ $VVLVWDQW 3URIHVVRU LQ WKH 'HSDUWPHQW RI $QHVWKHVLRORJ\ DW WKH 8QLYHUVLW\ RI )ORULGD &ROOHJH RI 0HGLFLQH LQ *DLQHVYLOOH )ORULGD

PAGE 162

, FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ +DUU\ 6 3URIHVVRU &KDLU 1HXURVFLHQFH FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ OFQtHO 6 .LOEHUJ 3URIHVVRU RI %LRFKHPLVWU\ DQOV 0ROHFXODU %LRORJ\ FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\A" %ULDQ &DLQ 3URIHVVRU RI %LRFKHPLVWU\ DQG 0ROHFXODU %LRORJ\ FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ 6DUDK ( &KHVURZQ $VVRFLDWH 3URIHVVRU RI %LRFKHPLVWU\ DQG 0ROHFXODU %LRORJ\ FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG-V-XOO\ DGHTXDWH LLUSFRSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWRU RI 3KL )HUO 3URIHVVRU RI LFXOWXUDO 6FLHQFH

PAGE 163

7KLV GLVVHUWDWLRQ ZDV VXEPLWWHG WR WKH *UDGXDWH )DFXOW\ RI WKH &ROOHJH RI 0HGLFLQH DQG WR WKH *UDGXDWH 6FKRRO DQG ZDV DFFHSWHG DV SDUWLDO IXOILOOPHQW RI WKH UHTXLUHPHQWV IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ 'HFHPEHU 'HDQ &ROOHJH RI 0HGLFLQH 'HDQ *UDGXDWH 6FKRRO


CHARACTERIZATION OF AN INDUCIBLE ENHANCER ELEMENT AND THE
SIGNALING PATHWAYS INVOLVED IN MANGANESE SUPEROXIDE
DISMUTASE GENE REGULATION
By
RICHARD JAMES ROGERS
A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY
UNIVERSITY OF FLORIDA
2000

To my parents who understood the significance of education.
Live as if you were to die tomorrow. Learn as if you were to live forever.
- Ghandi

ACKNOWLEDGMENTS
I would like to thank Dr. Harry S. Nick, chairman of my graduate advisory
committee, for his support, trust, friendship, guidance, and encouragement throughout my
graduate studies. I am also grateful to the other committee members—Drs. Brian Cain,
Sarah Chesrown, Robert Ferl, and Michael Kilberg—for their assistance. I would like to
thank all members, professors and staff, from the Department of Biochemistry and
Molecular Biology from the University of Florida College of Medicine. I am deeply
indebted to the members of my laboratory, both past (Maureen, Jan-Ling, Michael, Yemi,
and Jane) and present (Yang, Chris, Nikki, and Ann), for their help along this journey. I
also wish to extend a special, heartfelt thanks to Joan Monnier, my second mom, for her
support, technical help and spiritual guidance, during the most emotionally trying time in
my personal life. I can never fully repay my debt to her. Finally, I would like to express
my gratitude, respect and love to Ming Ming Chow for helping me in countless ways to
become a better person, but especially for showing me how to feel joy again.

TABLE OF CONTENTS
page
ACKNOWLEDGMENTS iii
ABSTRACT vii
CHAPTERS
1 INTRODUCTION 1
Oxygen and Free Radicals 1
Superoxide Dismutases 3
Inflammation 5
Lipopolysaccharide 6
Tumor Necrosis Factor 7
Interleukin-1 9
Molecular Biology of MnSOD 11
Enhancers 14
2 MATERIALS AND METHODS 18
Materials 18
Methods 20
Tissue Culture 20
Polymerase Chain Reaction (PCR) 21
TA Cloning of PCR Products 22
Reporter Vector Cloning 23
Plasmid Purification 24
Transient Transfection of Mammalian Cells 26
RNA Isolation 27
Northern Analysis 28
Genomic DNA Isolation 29
Electrophoretic Mobility Shift Assay (EMSA) 30
In Vivo DMS Treatment 31
Ligation-Mediated PCR (LMPCR) 33
Site-Directed Mutagenesis and Substitutions by PCR 37
Radiolabeled Probe Synthesis 40
Hybridization of Northern and Southern Blots 41
IV

3 CYTOKINE-INDUCIBLE ENHANCER WITH PROMOTER ACTIVITY IN
BOTH THE RAT AND HUMAN SUPEROXIDE DISMUTASE GENES 42
Introduction 42
Results 44
An Inducible Cw-Acting Element Exists within MnSOD 44
The MnSOD Inducible Enhancer Element is Located within Intron 2 48
The Enhancer Is Likely Composed of A Complex Set of Interacting
Elements 54
The Inducible Enhancer Elements within Rat and Human MnSOD Can Act
with A Heterologous Promoter 60
Evaluation of Promoter-Enhancer Interactions 63
The Rat and Human Enhancer Elements Contain Inducible Promoter
Activity 69
Discussion 70
4 IN VIVO FOOTPRINTING AND MUTAGENESIS OF THE RAT
MANGANESE SUPEROXIDE DISMUTASE ENHANCER 75
Introduction 75
Results 77
Multiple Potential Protein Binding Sites Exist within the MnSOD
Enhancer 77
Mutagenesis of Putative DNA Binding Sites Alters Inducible MnSOD
Expression 83
Discussion 89
5 REACTIVE OXYGEN SPECIES AND MITOCHONDRIA-TO-NUCLEUS
SIGNALING 91
Introduction 91
Results 93
Mitochondrial Electron Transport Inhibitors Modulate TNF-a-Induced
Expression of MnSOD in Pulmonary Epithelial Cells 93
Antimycin A Strongly Decreases TNF-a-Inducible MnSOD Expression in
Pulmonary Endothelial Cells 96
The Signaling Pathway of TNF-a Is Different from the Pathways of LPS-
or IL-1-Stimulated Expression of MnSOD 100
Inhibition of Mitochondrial ATPase with Oligomycin also Represses
TNF-a-Stimulated Expression of MnSOD 103
Reactive Oxygen Species Are Important for TNF-a-Stimulated
Expression of MnSOD 108
v

TNF-a-Stimulated Expression of MnSOD in Endothelial Cells Is
Dependent on Cytoplasmic Phospholipase A2 (CPLA2) 108
TNF-a-Inducible Expression of MnSOD Is Not Dependent on Nuclear
Factor- kB (NF-kB) 115
Discussion 116
6 CONCLUSIONS AND FUTURE DIRECTIONS 121
Conclusions 121
Future Directions 127
REFERENCES 130
BIOGRAPHICAL SKETCH 153
vi

Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy
CHARACTERIZATION OF AN INDUCIBLE ENHANCER ELEMENT AND THE
SIGNALING PATHWAYS INVOLVED IN MANGANESE SUPEROXIDE
DISMUTASE GENE REGULATION
By
Richard James Rogers
December 2000
Chairman: Dr. Harry S. Nick
Major Department: Biochemistry and Molecular Biology
Manganese superoxide dismutase (MnSOD), an enzyme localized to the
mitochondria, converts superoxide (O2*) into oxygen (O2) and hydrogen peroxide
(H2O2). The superoxide dismutases (SODs) are the first line of cellular defense against
the damaging effects of superoxide anion radicals. Manganese superoxide dismutase is
the most highly regulated of the three SODs. Multiple studies have shown that increased
cellular levels of MnSOD are cytoprotective during cellular oxidative stress or
inflammatory challenges. The major goals of this dissertation were to identify within the
MnSOD gene the regions of DNA that are responsible for inducible expression and to
understand some of the intracellular signaling pathways that control this induction. To do
so, I utilized the polymerase chain reaction method to create deletions of a large region
Vll

within the MnSOD gene as a means of creating reporter vectors, which could be
evaluated by transient transfection studies in a rat lung epithelial cell line. The results of
these experiments defined a small region (260 bp) within intron 2 as an enhancer, which
regulates the inducible expression seen in the endogenous MnSOD gene. In addition, by
utilizing a variety of specific pharmacologic inhibitors, I was able to show the differences
between signaling pathways (lipopolysaccharide, tumor necrosis factor, interleukin-1)
responsible for the inducible expression of MnSOD. Interestingly, reactive oxygen
species, which are byproducts of the mitochondrial electron transport chain, appear to be
important regulators of the tumor necrosis factor pathway, but not that of
lipopolysaccharide or interleukin-1. Finally, by using the method of in vivo footprinting,
I was able to identify putative protein-DNA binding sites within the enhancer region.
Using this data, I created a number of reporter vectors with mutations within the enhancer
region. By transiently transfecting these reporter vectors into rat lung epithelial cells, I
may have identified at least one important putative protein-DNA binding site in the
enhancer region. It is likely that the MnSOD enhancer contains multiple protein-DNA
binding sites which work to create a protein complex necessary for the inducible
expression seen in the endogenous MnSOD gene. This work will add to the
understanding of how the inducible MnSOD gene is regulated.
Vlll

CHAPTER 1
INTRODUCTION
Oxygen and Free Radicals
The element oxygen (chemical symbol O) exists in air as a diatomic molecule, O2,
which strictly should be called dioxygen. Over 99% of the O2 in the atmosphere is the
isotope oxygen-16 but there are traces of oxygen-17 (about 0.04%) and oxygen-18 (about
0.2%). Except for certain anaerobic and aero-tolerant unicellular organisms, all animals,
plants, and bacteria require O2 for efficient production of energy by the use of 02-
dependent electron-transport chains, such as those in the mitochondria of eukaryotic
cells. This need for 02 obscures the fact that 02 is a toxic mutagenic gas; aerobes survive
because they have antioxidant defenses to protect against it.
Perhaps the earliest suggestion made to explain O2 toxicity was that O2 inhibits
cellular enzymes (Balentine, 1982; Haugaard, 1968). Indeed, direct inhibition by O2 is
thought to account for the loss of nitrogenase activity in 02-exposed C. pasterianum
(Gallon, 1981). Another good example of the direct effect of O2 comes from green
plants. During photosynthesis, illuminated green plants fix CO2 into sugars by a complex
metabolic pathway know as the Calvin cycle. The first enzyme in this pathway, ribulose
bisphosphate carboxylase, catalyses the reaction of CO2 with a five-carbon sugar
(ribulose 1,5-bisphosphate) to produce two molecules of phoshoglyceric acid. Oxygen is
an alternative substrate for this enzyme, competitive with CO2, and so at elevated O2
concentrations there is less CO2 fixation and hence less plant growth (Halliwell, 1984).
1

2
In general, however, the rates of direct inactivation of enzymes by O2 in aerobic
cells are too slow and too limited in extent to account for the rate at which toxic effects
develop; most enzymes are totally unaffected by O2. In 1954, Rebecca Gershman and
Daniel L. Gilbert drew a parallel between the effects of O2 and those of ionizing radiation
and proposed that most of the damaging effects of O2 could be attributed to the formation
of free oxygen radicals (Gilbert, 1981).
The growth inhibition observed after exposing E. coli to high-pressure O2 can be
relieved by adding valine to the culture medium. Valine synthesis is impaired because of
a rapid inhibition of the enzyme dihydoxyacid dehydratase, which catalyzes a reaction in
the metabolic pathway leading to valine. This is probably not a direct inhibition by O2,
but rather by oxygen radicals such as superoxide (Flint et al., 1993). Other enzymes
inactivated by superoxide radical (O2*) in E. coli exposed to high pressure O2 include the
Krebs cycle enzymes aconitase and fumarase. E. coli contains three fumarases: fumarase
A and B are inactivated by O2* whereas fumarase C is not. Levels of fumarase C
increase when E. coli is exposed to oxidizing conditions, perhaps as a replacement for the
superoxide-sensitive fumarases A and B. Aconitase may also be an important target of
damage by O2* in mammalian tissues exposed to excess O2 (Hausladen and Fridovich,
1994; Morton et al., 1998). The onset of 02-induced convulsions in animals is correlated
with a decrease in the cerebral content of the neurotransmitter GABA (y-aminobutyric
acid), perhaps because of an inhibition of the enzyme glutamate decarboxylase
(glutamine —> GABA + CO2) by O2 (Hori, 1982); it has not, however, been shown that

3
the enzyme inhibition in vivo is due to O2 itself rather than to the effects of an increased
production of oxygen radicals (Haugaard, 1968).
The term “free radical” has several definitions, however, the simplest one
describes a free radical as any species capable of independent existence and contains one
or more unpaired electrons (Halliwell and Gutteridge, 1999). The presence of one or
more unpaired electrons usually causes free radicals to be attracted slightly to a magnetic
field (i.e., to be paramagnetic), and sometimes makes them highly reactive, although the
chemical reactivity of radicals varies over a wide spectrum. Radicals can be formed
when a covalent bond is broken if one electron from each of the pair shared remains with
each atom, a process known as hemolytic fission (von Sonntag, 1987).
A:B -> A* + B*
For example, hemolytic fission of one of the O-H covalent bonds in the H2O molecule
will yield a hydrogen radical (H*) and a hydroxyl radical (*OH). The opposite of
hemolytic fission is heterolytic fission, in which one atom receives both electrons when a
covalent bond breaks, i.e.
A:B -> A +B+
Where A receives both electrons. A is now negatively charged and this gives A a
negative charge and B is left with a positive charge. Heterolytic fission of water gives
the hydrogen ion H+ and the hydoxide ion OH-.
Superoxide Dismutases
The superoxide dismutases (SODs) catalyze the dismutation of superoxide anion
radical (O2*) into hydrogen peroxide and oxygen as follows:
2H+ + 2 02*' H202 + 02

4
SODs, isolated from a wide range of organisms, fall into three types depending on
the metals found in their active centers: copper/zinc, manganese, and iron. Cu/ZnSOD is
found mainly in the cytosol of eukaryotes (Slot et al., 1986) and in chloroplasts; MnSOD,
in prokaryotes and in the mitochondria of eukaryotes; and FeSOD, in prokaryotes and in
a few families of plants. In addition, an extracellular SOD similar to the Cu/ZnSOD had
also been found in the extracellular fluid of eukaryotic cells (Marklund, 1984;
Hjalmarsson et al., 1987). Amino acid sequence data had shown that these three types of
SODs fall into two distinct families (Bannister et al., 1987). The FeSOD and MnSOD
show a high degree of amino acid sequence and structural homology, while the second
family, which includes the Cu/ZnSOD, is completely unrelated.
Two major forms of SOD have been purified from rat liver (Assayama and Burr,
1985). The Cu/ZnSOD consists of two identical subunits with a total molecular weight
of 32 kilodaltons (kD). Each subunit contains a single Cu and Zn atom, noncovalently
linked. The copper ion appears to function in the enzymatic reaction, whereas the zinc
ion is noncatalytic and serves to stabilize the enzyme. The complete amino acid
sequence of Cu/ZnSOD has been determined from various species with a high level of
conservation (Bannister et al., 1987).
The rat MnSOD is a tetrameric enzyme containing four identical 21 kD subunits
with a total molecular weight of approximately 80 kD whereas most bacterial MnSODs
are dimeric enzymes of approximately 40 kD. The amino acid sequences of the MnSOD
enzyme from various species, including rat, mouse, and human, as well as from bacteria,
have been compared and are very similar (Bannister et al., 1987). These enzymes contain
Mn at the active site and the mammalian forms have been localized primarily in the

5
mitochondria, particularly in the matrix between the cristae (Slot et al., 1986).
Mitochondrial DNA and membranes are particularly prone to oxidation because
mitochondria themselves are a major source of free radicals. When mitochondria are
severely damaged, aerobically growing cells are starved for energy. The localization of
the MnSOD exclusively within the mitochondria suggests an important role for this
antioxidant enzyme in this organelle.
Both rat Cu/ZnSOD and MnSOD cDNAs have been isolated and characterized by
our laboratory and others (Ho and Crapo, 1987). The rat MnSOD cDNA encodes a
protein of 222 amino acids, which includes a putative mitochondrial targeting sequence
of 24 amino acids. The Cu/ZnSOD is sensitive to cyanide, whereas MnSOD is resistant
to this reagent (Weisinger and Fridovich, 1973; Fridovich, 1974). This difference in the
cyanide sensitivity makes it possible to distinguish the enzymatic activities of these two
SODs.
In general, the synthesis of Cu/ZnSOD is constitutive whereas MnSOD is
inducible. Induction of MnSOD in eukaryotes has been observed following treatment
with paraquat (Krall et al., 1988), X-irradiation (Oberley et al., 1987), and hyperoxia
(Freeman et al., 1986), suggesting that MnSOD induction is important for protection
against oxidative stress. Since inflammatory responses often result in generation of a
variety of free radicals, which can directly or indirectly lead to tissue injury, it is of
interest to further characterize the role of SOD in such inflammatory responses.
Inflammation
Microbial invasion, immunological reactions, and inflammatory processes induce
a complex set of responses in the host, collectively referred to as the acute phase response

6
(Kushner et al., 1989). This response is characterized by fever, metabolic changes,
increased peripheral white blood cell count, and an increased synthesis of acute phase
proteins including C-reactive protein, ceruloplasmin, serum amyloid A protein, and
various complement proteins.
In addition, the immune system produces a variety of inflammatory mediators
including cytokines, arachidonic acid metabolites, and oxygen free radicals to protect the
host when threatened by inflammatory agents, microbial invasion, or injury. In some
cases this complex defense network successfully restores normal homeostasis, but at
other times the overproduction of inflammatory mediators may actually prove deleterious
to the host (Welboum and Young, 1992). For example, septic shock associated with
infection is generally caused by wide-spread and uncontrolled activation of the
mononuclear phagocyte cell population and the release of massive quantities of
inflammatory mediators (Molloy et al., 1993). The clinical characteristics of this
condition include fever, hypotension, hypoglycemia, disseminated intravascular
coagulation and increased vascular permeability. The acute phase response,
characterized by the release of pro-inflammatory mediators and the activation of immune
cells, can be produced upon exposure to bacterial cell wall materials, most notably,
lipopolysaccharide.
Lipopolysaccharide
One of the major toxic components contributing to the inflammatory response
during microbial invasions is lipopolysaccharide (LPS). LPS, a constituent of the cell
wall of gram-negative bacteria, consists of a polysaccharide portion and a covalently
linked lipid moiety termed lipid A (Rietschel and Brade, 1992). Wide derangements

7
including acute inflammatory responses, altered energy metabolism, and multiple tissue
injury are observed after LPS administration (Ghosh et al, 1993). The toxic properties of
LPS account for its other name, bacterial endotoxin.
Several lipopolysaccharide binding proteins (LBP), which specifically interact
with LPS, have been reported (Tobias et al., 1988). For example, Schumann et al. (1990)
have characterized a LBP which is a 60 kD plasma glycoprotein synthesized in
hepatocytes. After the LBP interacts with LPS, this LPS-LBP complex then binds to the
cell surface protein CD 14 and presumably elicits the cellular and tissue responses to LPS
(Wright et al., 1990). In addition, a membrane-localized 80 kD LPS-speciflc binding
protein has been identified in B lymphocytes, T lymphocytes, and macrophages (Lei and
Morrison, 1988). However, the roles of these different LBPs and the interaction between
them are still not clear.
Tumor Necrosis Factor
Tumor necrosis factor (TNF), also called cachectin, is synthesized principally by
monocytes and macrophages in response to macrophage activators such as endotoxin.
Human TNF has a molecular weight of 17 kD, which is synthesized as a propeptide of
233 amino acids with a precursor sequence of 76 amino acids (Pennica et al., 1984;
Aggarwal et al., 1985). The amino acid sequences of both the pro- and mature peptides
are highly conserved between mouse and human, with about 80% homology (Beutler et
al., 1985; Cseh and Beutler, 1989). A wide spectrum of possible physiological actions
for TNF, including its use in the management of certain tumors, its role in an
inflammatory reaction, and its involvement in the immune response, have been
documented (Beutler and Cerami, 1989).

8
TNF and lymphotoxin (a tumoricidal protein produced by lymphocytes),
sometimes referred to as TNF-a and TNF-(3 respectively, are structurally and
functionally related (Goeddel et al., 1986). They share about 28% homology and have
been shown to interact with the same receptors and exhibit a number of shared biological
activities. The genes for TNF and lymphotoxin are closely linked and separated by about
1 kb in humans (Nedwin et al., 1985). Lymphotoxin lies 5’ to TNF, and both genes
reside within the major histocompatibility complex locus on chomosome 6, indicating
that these two genes may have evolved from a gene duplication event.
Most cell types including liver, kidney, muscle, and adipose tissue have been
shown to possess specific high affinity receptors for TNF. Two distinct TNF receptors of
55-69 kD (p55) and 70-80 kD (p75) have been identified in the mouse (Goodwin et al.,
1991) and human systems which demonstrate ligand specificity for both TNF-a and
TNF-p (Hohmann et al., 1990). The p75 receptor possesses greater affinity for TNF than
the p55 receptor (Tartaglia and Goeddel, 1992). The genes for the p55 and p75 receptors
map to chromosomes 12 and 1 in humans, and to chomosome 6 and 4 in the mouse,
respectively (Goodwin et al., 1991).
Based on their amino acid sequence, the two receptors are only 29% identical to
each other, and both share four cysteine-rich repeats in their extracellular domains that
are characteristic of the nerve growth factor (NGF) receptor family. For both proteins,
aggregation of receptors mediated by binding of dimeric or trimeric TNF is believed to
initiate the signaling process. However, several lines of evidence suggest that subsequent
steps of the signal transduction process may diverge. Studies have been conducted using
antibodies specific for either the p55 or p75 receptor. Heller et al. (1992) reported that

9
the cytotoxicity of TNF was mediated through the p75 receptor. Tartaglia et al. (1993)
provided evidence indicating that the cytotoxicity of TNF is signaled by the p55 receptor.
The controversy between these two hypotheses needs further investigation, but also
demonstrates the complexity of the TNF function.
Soluble forms of the TNF receptors are released from the cell surface by
proteolytic cleavage (Lantz et al., 1990; Gullberg et al., 1992). These soluble receptors
act as TNF binding proteins, which subsequently inhibit TNF interactions with surface
receptors. In addition, the release of soluble receptors results in the down-regulation of
cell surface receptors. Therefore, shedding of surface receptors enables target cells to
decrease their responsiveness to TNF. Binding of TNF to its receptor is followed by
rapid internalization and degradation via a lysosomal pathway (Tsujimoto et al., 1985;
Niitsu et al., 1985)
Interleukin-1
Interleukin-1 (IL-1), initially recognized as a factor producing high fever and a
shock-like state (Okusawa et al., 1988; Fischer et al., 1991), is primarily synthesized by
macrophages and monocytes, but may also be produced by epithelial cells, endothelial
cells, keratinocytes, and glial cells. IL-1 is an inflammatory cytokine, more closely
related to tumor necrosis factor (TNF) than any other cytokine, although the structure and
receptors for IL-1 and TNF are clearly distinct. IL-1 is biologically active in the low
picomolar or even femtomolar range. There is little evidence that cytokines, such as IL-
1, play any role in normal homeostasis such as hormonal regulation, metabolism or in
physiological regulation. In the absence of injury or damage, however, it is unclear
whether IL-1 is needed.

10
During inflammation, injury, immunological challenge or infection, IL-1 is
produced and because of its multiple biological properties, this cytokine appears to affect
the pathogenesis of disease. Specific physiological activities of IL-1 include lymphocyte
stimulation, induction of acute phase proteins, helper activity for immunoglobulin
production by B lymphocytes, induction of interferon P-2, and radioprotection (Neta et
al., 1986; Fibbe et al., 1989). Most studies on IL-1 are derived from experiments in
which bacterial products such as lipopolysaccharide (LPS), endotoxins from Gram¬
negative bacteria or exotoxins from Gram-positive organisms are used to stimulate
macrophages (Ikejima et al., 1988).
Two distinct genes, located on chromosome 2, code for the IL-la and IL-ip
precursor polypeptides both having molecular masses of 31 kD (Auron et al., 1984;
Lomedico et al., 1984; Clark et al., 1986; Dinarello, 1992). However, unlike most
proteins, both IL-1 a and p lack a leader sequence of amino acids, which would enable
the precursor protein to be inserted into the Golgi and cleaved to a smaller, mature size to
be transported out of the cell. The mature protein of both IL-la and P is approximately
17 kD after enzymatic cleavage. IL-la and IL-1P have very different amino acid
sequences, sharing only 26% similarity; however, structurally the two isoforms of IL-1
are related at the three dimensional level, having been crystallized (Preistle et al., 1988,
1989). These two proteins have been found in human, mouse, rat, pig, and rabbit and
exhibit significant interspecies homology at the amino acid level (62% homology
between human and mouse IL-la, Auron et al., 1985). The third member of the IL-1
gene family is IL-1 receptor antagonist (IL-IRa). The three members of the IL-1 family

11
recognize and bind to the same cell surface receptors. IL-la and IL-ip binding to the IL-
1 receptors transmits a signal whereas IL-1 Ra does not.
IL-1 is rapidly synthesized by mononuclear cells, which are stimulated by
microbial products or inflammatory agents. Because of the lack of a leader peptide, most
IL-1 a remains in the cytosol of cells. There is some evidence that the precursor IL-1 a is
transported to the cell surface where it has been identified as membrane IL-1 (Brody and
Durum, 1989). In human monocytes, between 40-60% of IL-1 P is transported out of the
cell but in contrast to IL-la, IL-1 p enters the circulation. Various mechanisms for
transport include exocytosis from vesicles, active transport via multiple-drug-resistance
carrier proteins, or following cell death. Unlike the IL-la precursor, the IL-1P precursor
requires cleavage for optimal biological activity. Several common enzymes will cut the
IL-1 P precursor into smaller and more active forms. However, one particular protease
appears highly specific for cleaving the IL-1 P precursor from 31 to 17.5 kD, its most
active form (Cerretti et al., 1992; Thomberry et al., 1992). This enzyme is known as the
IL-1 p converting enzyme (ICE) and is a member of the cysteine protease family. ICE
does not cleave the IL-la precursor. Other enzymes have been found which cleave the
IL-la precursor, but these other enzymes seem less specific than ICE.
Molecular Biology of MnSOD
Our laboratory has previously characterized the rat MnSOD cDNA (Dougall,
1990). The rat MnSOD genomic locus was first sequenced by Ho et al. (1991). The
promoter region of MnSOD contains neither a “CAAT box” nor a “TATA box.” Our
laboratory has also identified and characterized the rat MnSOD gene, which contains five
exons. Exon one encodes the 5’ untranslated leader sequence, the mitochondrial signal

12
sequence, and the N-terminus of the rat MnSOD protein. Exon 2, 3, 4, and 5 encode the
mature MnSOD protein. Exon 5 contains the stop codon, TGA, and the 3’ untranslated
region (Dougall, 1990). Primer extension analysis was used to locate the transcription
initiation site at between 70 and 74 nucleotides 5’ to the start of translation (Hurt et al,
1992). There are five species of MnSOD mRNA identified by Northern analysis. Our
laboratory has demonstrated that these five species of MnSOD mRNA are the result of
differential polyadenylation (Hurt et al., 1992).
The regulation of MnSOD biosynthesis in E. coli is under rigorous control. The
induction of this enzyme is in response to the cellular environmental redox state. E. coli
grown in iron-poor medium or in the presence of iron-chelating agents results in an
induction of the bacterial MnSOD gene. On the other hand, cells grown in iron-enriched
medium produces an inhibition of MnSOD expression. All of these observations led
Fridovich to suggest that E. coli MnSOD is controlled by an iron-containing repressor
(Fridovich, 1986). More recently, the transcriptional regulators, Fnr, Fur, and Arc, were
identified (Hassan and Sun, 1992; Privalle and Fridovich, 1993) and found to negatively
regulate the expression of MnSOD in E. coli. Unlike bacteria, MnSOD synthesis in
eukaryotic cells is upregulated dramatically by proinflammatory mediators including
lipopolysaccharide (LPS), tumor necrosis factor alpha (TNF-a), interleukins-1 and -6
(IL-1, IL-6), and interferon gamma (IFN-y) (Wong and Goeddel, 1988; Shaffer et al.,
1990; Del-Vecchio and Shaffer, 1991; Dougall and Nick, 1991; Borg et al., 1992; Eddy et
al., 1992, Gibbs et al., 1992; Valentine and Nick, 1992; Visner et al., 1992; Whitsett et
al., 1992; Eastgate et al., 1993; Melendez and Baglioni, 1993; Bigdeli et al., 1994;

13
Jacoby et al., 1994; Akashi et al., 1995; Gwinner et al., 1995; Jones et al., 1995; Lontz et
al., 1995; Stephanz et al., 1996). In L2 cells, a rat pulmonary epithelial-like cell line,
MnSOD mRNA levels show an 18-23 fold induction after stimulation with LPS (Visner
et al., 1990). Cells treated with TNF-a or IL-1 showed similar results.
To evaluate the importance of on-going protein synthesis and de novo
transcription, studies with cycloheximide, an inhibitor of protein synthesis, showed no
effect on LPS-, TNF-a-, or IL-1-dependent induction of MnSOD mRNA level. On the
other hand, L2 cells co-treated with stimulant (LPS, TNF-a, or IL-1) and actinomycin, an
inhibitor of mRNA transcription, inhibited the stimulus-dependent induction of MnSOD
mRNA expression (Visner et al., 1990). Furthermore, nuclear-run on data showed a 9
fold induction in MnSOD mRNA level (Hsu, 1993). The above evidence suggests that
the regulation of MnSOD gene expression is, at least partly, transcriptionally dependent.
The difference between nuclear run-on analysis and in vivo data on mRNA level
following LPS treatment may be caused by the stability of the mRNA or the loss of some
transcription factors during the preparation of nuclei for nuclear run-on experiments.
Examinations of other cell types treated with LPS, TNF-a, or IL-1 also showed similar
results at the mRNA level, including rat pulmonary artery endothelial cells (Visner et al.,
1992), porcine pulmonary artery endothelial cells (Visner et al., 1991), and intestinal
epithelial cells (Valentine and Nick, 1992). Interestingly, though Cu/ZnSOD contributes
the major part of the total cellular SOD activity, its mRNA level is not regulated by any
known stimulant to any large degree.

14
Enhancers
The control of transcription in prokaryotes is largely governed by sequences in the
vicinity of the transcriptional start site. Most prokaryotic promoters consist of short
sequence motifs approximately 10 to 35 base pairs upstream of the transcriptional start
site; these motifs make direct contact with RNA polymerase and thus serve to position
the start site (Rosenberg and Court, 1979). The initial characterization of eukaryotic
promoters revealed a similar arrangement of sequence elements. Many eukaryotic
promoters possess the conserved sequence motif TATAAA (the TATA box) in the -20 to
-30 region, and some promoters contain an additional upstream conserved element GG(T
or QCAATCT (the CAAT box). However, unlike the corresponding prokaryotic
element, deletion of the TATA box does not necessarily abolish expression, as shown by
early studies on the histones H2A gene (Grosschedl and Bimstiel, 1980a). In addition,
these studies revealed that DNA sequences lying several hundred base pairs (bp)
upstream of the transcriptional start site can positively influence transcription, even when
positioned in an inverted orientation (Grosschedl and Bimstiel, 1980b).
Similar work with the simian virus 40 (SV40) early region indicated that the
TATA box was not required for early gene expression (Benoist and Chambón, 1980) and
that its deletion resulted in heterogeneous transcriptional start sites (Benoist and
Chambón, 1981). In addition, deletion of sequences about 150 bp upstream of the
transcriptional start site had an adverse effect on early gene expression. Deletion of one
of the two 72 bp repeat elements upstream of the early gene did not greatly reduce early
gene expression or vims viability, but the additional removal of a portion of the second
repeat reduced expression dramatically (Gruss et al., 1981; Benoist and Chambón, 1981).

15
Thus, it was found that DNA sequences lying a considerable distance upstream of
transcriptional start sites play a significant role in transcriptional regulation.
Further characterization of these sequences revealed a surprising result. When a
366 bp DNA segment of the SV40 promoter region was linked to a P-globin gene,
transcription of the gene was enhanced up to 200-fold (Banerji et al., 1981). This
enhancement of transcription occurred only when the SV40 sequences were present in
cis, did not depend upon DNA replication, and could occur when the sequences were
placed in both orientations either 1400 bp 5’ or 3300 bp 3’ of the gene. Enhancement
was observed as long as one copy of the 72 bp repeats was present. Similar results were
obtained when the SV40 promoter region was placed adjacent to the chicken conablumin
or adenovirus major late promoters, or within the T antigen gene intron sequences
(Moreau et al., 1981; Fromm and Berg, 1983). Thus, sequences within and flanking the
SV40 72 bp repeats are important for enhancing the expression of cA-linked promoters in
an orientation and distance independent fashion, although in some cases distance effects
were observed (Moreau et al., 1981). Studies with polyoma virus also revealed the
existence of a DNA segment essential for viral viability and capable of enhancing
expression of cA-linked genes (Tyndall et al., 1981; de Villiers and Schaffner, 1981).
Shortly thereafter, retroviruses were found to possess similar DNA elements in their long
terminal repeat (LTR) regions (Levinson et al., 1982; Gorman et al., 1982).
The properties of these viral transcriptional control elements now constitute the
definition of an enhancer element. These properties include the ability to (a) increase
transcription of cA-linked promoters, (b) operate in an orientation independent manner,

16
(c) exert an effect over large distances independent of position, and (d) enhance the
expression of heterologous promoters.
Since the first identified enhancer was observed in viral genomes it was
conceivable that these transcriptional control elements might be unique to viruses and
represent a means that enables them to compete for the host cell transcriptional
machinery. However, the discovery and characterization of mammalian cellular enhancer
elements within the immunoglobulin (Ig) genes eliminated this possibility (Banerji et al.,
1983; Gillies et al., 1983; Neuberger 1983; Mercóla et al., 1983). Banerji et al. (1983)
showed that a several hundred bp DNA segment derived from the Ig heavy chain locus
could enhance expression of a linked P-globin promoter in an orientation and position-
independent manner. This effect occurred only when the Ig sequences were present in cis
and did not depend upon DNA replication. Furthermore, enhancement occurred in three
different lymphoid cell lines, but not in mouse 3T6, mink lung, or human HeLa cells.
Gillies et al. (1983) concurrently demonstrated that the same DNA segment increased
expression of the Igy2b gene in an orientation and position independent manner, and
functioned in lymphoid cells but not in L cells. Thus, the enhancing sequences operated
in a tissue-specific manner. Similar results were obtained with the Ig k gene, which
indicated that a tissue-specific transcriptional enhancer element is located within the
intron separating the joining (Jk) and constant (Ck) regions (Queen and Baltimore, 1983;
Stafford and Queen, 1983; Queen and Stafford, 1984; Picard and Shaffner, 1984). The
identification of enhancers in cellular genes indicated that enhancers are not
transcriptional control elements peculiar to viral genomes.

17
Previous work from our laboratory demonstrated that the regulatory element
responsible for the dramatic inductions in MnSOD mRNA was not contained within the
5’ flanking region of the gene (Chesrown, 1994). Further work suggested that another
region of DNA within the gene might be responsible for the transcriptional regulation by
inflammatory mediators (Chesrown, 1994). The main objective of the research presented
in this dissertation was to investigate the molecular mechanisms responsible for the
dramatic inductions of MnSOD expression in response to inflammatory stimuli. The
ultimate goal of this study was to characterize the ds-element(s) within the gene
responsible for the inducibility of MnSOD. These results will provide information for
future identification of the trans-acting factors, and other steps and components involved
in the inflammatory pathway of MnSOD.

CHAPTER 2
MATERIALS AND METHODS
Materials
Ham’s F12K Medium (Cat# N-3520), bovine serum albumin (Cat# A-7511), and
dithiothreitol (Cat# D-0632), bacterial lipopolysaccharide (LPS) E.coli serotype 055:B5
(Cat#L 2880), amobarbital (Amytal) (Cat#A 4430), 2-heptyl-4-hydroxyquinoline N-
oxide (HQNO) (Cat#H 3875), oligomycin (Cat#0 4876), and myxothiazol (Cat#M 5779)
were purchased from Sigma Chemical Company, St. Louis, MO. Oligonucleotides,
deprotected, desalted, and dephosphorylated, Medium 199 with Earle’s salts (Cat#31100-
035), fetal bovine serum (Cat# 16000-044), antibiotic-antimycotic solution (ABAM)
(Cat# 15240-062), restriction enzymes, Taq DNA Polymerase (Cat# 18038-018), T4 DNA
Ligase (Cat# 15224), DH5a E. coli competent cells (Cat# 18265017), and Random
Primers DNA Labeling System (Cat# 18187-013) were purchased from Gibco BRL,
Gaitherburg, MD. Recombinant human TNF-a was a gift from Genentech. IL-ip was a
gift from the National Cancer Institute. Antimycin A (Cat# 1782), N-acetyl cysteine
(Cat# 106425), SB 203580 (559389), and PD 98059 (Cat#513000) were purchased from
Calbiochem, San Diego, CA. The I kappa kinase inhibitor, Bay 11-7082, was purchased
from BioMol, Plymouth Meeting, PA. (Sigma Corp, St. Louis, MO.). VentR DNA
Polymerase (Cat# 254S), restriction enzymes, T4 Polynucleotide Kinase (Cat#201S), and
calf intestinal alkaline phosphatase (CIP) (Cat#290S) were purchased from New England
18

19
Biolabs, Inc., Beverly, MA. Long Ranger Gel Solution (Cat# 50611), and Seakem HGT
agarose (Cat# 50040) were purchased from FMC BioProducts, Rockland, ME.
Proteinase K (Cat# 161519) and E. coli tRNA (Cat# 109541) were purchased from
Boehringer-Mannheim, Indianapolis, IN. TA Cloning kit (Cat# K2000) was purchased
from Invitrogen Corporation, Carlsbad, CA. pCRScript Cloning kit (Cat# 211188-5) was
purchased from Stratagene, La Jolla, CA. Zetabind positively charged nylon transfer
membrane (Cat# NM511-01-045SP) was purchased from Cuno, Meriden, CT. Dimethyl
sulfate (Cat# 18,630-9) amd sodium cacodylate (Cat#23,385-4) were purchased from
Aldrich, Milwaukee, WI. Piperidine (Cat# PI25-100) was purchased from Fisher
Scientific, Pittsburg, PA. QIAquick Nucleotide Removal kit (Cat#28304), QIAquick Gel
Extraction kit (Cat#12162), QIAprep Spin Miniprep kit (Cat#27106), Qiagen Plasmid
Midi kit (Cat# 12144), Qiagen Plasmid Maxi kit (Cat# 12162) were obtained from
Qiagen, Valencia, CA. Hyperfilm MP (Cat# RNP 1677K, Cat#RNP30H), Ultrapure
dNTP Set (Cat# 27-2035-01), and adenosine 5’-triphosphate (Cat#27-1006-01) were
purchased from Amersham-Pharmacia, Piscataway, NJ. [a- PJdATP (3,000 Ci
(11 lTBq)/mmol) (Cat# BLU013H) and [y-32P]ATP (3,000 Ci (11 lTBq)/mmol)
(Cat#BLU002A) were purchased from New England Nuclear (NEN) Life Sciences
Products, Boston, MA. Cell lines rat pulmonary epithelial-like L2 (Cat# ATCC CCL
149) was purchased from American Type Culture Collection, Manassas, VA. p<))GH and
pTKGH were obtained as a kit (Cat# 40-2205) from Nichols Institute Diagnostics, San
Juan Capistrano, CA. All other chemicals not mentioned were obtained through either
Sigma Chemical Co. or Fisher Scientific.

20
Methods
Tissue Culture
The cell lines used in the studies described in this thesis were: L2 rat pulmonary
epithelial-like cells (ATCC CCL 149), rat pulmonary artery endothelial cells, VA cells,
isolated from segments of pulmonary artery by mechanical methods (Visner et al., 1992),
and, mouse fibroblast antimycin-resistant mutant cells, LA9 cells (generously provided
by Dr. Neil Howell, Howell et al., 1983). All cells were cultured as adherent monolayers.
The L2 rat pulmonary epithelial-like cell line (ATCC CCL 149) was grown as a
monolayer in 150 mm tissue culture plates containing Ham’s modified F12K medium
(GIBCO) supplemented with 10% fetal bovine serum, 10 pg/ml penicillin G, 0.1 mg/ml
streptomycin, and 0.25 pg/ml amphotericin B at 37°C in humidified air with 5% CO2. If
cells were used for in vivo footprinting experiments, then at approximately 90%
confluence, cells were treated with 0.5 pg/ml Escherischia coli (E. coli) LPS (E.coli
serotype 055:B5, Sigma), 10 ng/ml TNF-a (kindly provided by the Genentech Corp.), or
2 ng/ml IL-ip (kindly provided by the National Cancer Institute) for 2 or 4 hours to
induce MnSOD gene expression. Untreated cells were used as controls. VA cells, a rat
pulmonary artery endothelial cell line, were grown in Medium 199 with Earle’s salts
(Sigma Corp., St. Louis, MO.) with sodium bicarbonate to pH 7.4, 10% fetal bovine
serum, 10 mM L-glutamine and antibiotic-antimycotic solution at 37° C in room air, 5%
CO2. LA9 cells, a mouse fibroblast antimycin-resistant mutant cell line (Howell et al.,
1983), were grown in Ham’s F12K media with 10% fetal bovine serum, 10 mM L-
glutamine, and antibiotic-antimycotic solution at 37° C in room air, 5% CO2.

21
Experiments with VA cells and LA9 cells were all performed with confluent 100 mm
tissue culture plates.
Polymerase Chain Reaction (PCR)
The PCR reaction contained: DNA template (10-20 ng), 20 mM Tris-HCl pH 8.0,
50 mM KC1, 1.5 mM MgCl2, 0.2 mM of each dNTP, 100 pmol of each oligonucleotide
primer (oligonucleotide primers for PCR were obtained deprotected, desalted, and
dephosphorylated) in a total volume of 99.5 pi covered with 60 pi of mineral oil. This
mixture was heated for 5 minutes to allow denaturation of the template and 0.5 pi (2.5 U)
of Taq DNA Polymerase were added after 3 minutes of this time. The PCR was run in a
Perkin Elmer 480 thermocycler (Perkin Elmer Corporation, Norwalk, CT) for 25 cycles,
1 minute and 30 seconds at 94°C for denaturation, 30 seconds at 55-65°C for annealing,
and 1 minute at 72°C for extension. After 25 cycles, samples were incubated at 72°C for
10 minutes to allow complete extension and addition of an extra deoxyadenosine
nucleotide in each fragment by Taq DNA polymerase and refrigerated at 4°C. Mineral
oil was extracted by the addition of 120 pi of chloroforrmisoamyl alcohol (IAA),
vortexing, and centrifugation for 5 minutes at 13,000 x g at room temperature. The
aqueous phase was transferred to a new tube and 10 pi of the PCR reaction plus 1/6
volume of bromophenol blue/xylene cyanol/Ficoll mixture was loaded on a 1 -2% Seakem
HGT agarose gel containing ethidium bromide (0.1 mg/ml), 40 mM Tris-acetate, 20 mM
acetic acid, 1 mM EDTA and run with TAE buffer for 40-60 minutes at 80-100 volts.
The DNA templates for the PCR used to produce the MnSOD genomic fragments
in the enhancer deletion analyses were plasmids containing restriction-digested fragments
from the original genomic clones (Dougall, 1990).

22
TA Cloning of PCR Products
Taq DNA polymerase has a nontemplate-dependent activity, which adds a single
deoxyadenosine (A) to the 3’ ends of PCR products. The linearized vector, pCR2.1,
supplied in the TA Cloning kit (Invitrogen, Carlsbad, CA), has a single 3’
deoxythymidine (T) residue. This allows PCR inserts to ligate efficiently with those
vectors. To ligate the PCR product in the TA cloning vector, 1 pi of fresh PCR reaction
was incubated with 2 pi of the pCR2.1 vector (50 ng in 10 mM Tris-HCl, 1 mM EDTA,
pH 7.5), 1 pi of 10X T4 DNA ligase buffer (60 mM Tris-HCl, pH 7.5, 60 mM MgCl2, 50
mM NaCl, 1 mg/ml bovine serum albumin, 70 mM P-mercaptoethanol, 1 mM ATP, 20
mM dithithreitol, 10 mM spermidine), 5 pi of sterile ddH20, and 1 pi of T4 DNA ligase
(4 U) for 16 hours at 16°C.
Two pi of the ligation reaction were used to transform 50 ml of E. coli competent
cells, INVaF’ strain, in the presence of 2 ml of 0.5 M P-mercaptoethanol, for 30 minutes,
on ice. The transformation reaction was then heat shocked for 45 seconds at 42°C and
450 pi of SOC medium (2% tryptone, 0.5% yeast extract, 10 mM NaCl, 2.5 mM KC1, 10
mM MgCl2, 20 mM glucose, pH 7.0) were added. This mixture was incubated at 37°C
for one hour in a rotary shaker at 225 rpm. After this time, 100 pi of the bacteria solution
were plated using a glass spreader on YT (1.6% bacto-tryptone, 1% yeast extract, 0.5%
NaCl, pH 7.0) agar plate (1.5% Bacto-agar added), supplemented with 50 pg/ml of
ampicillin and covered with 20 pi of 5-Bromo-4-Chloro-3-indolyl-P-D-galactoside (X-
gal) (40 mg/ml), and incubated at 37°C overnight. X-gal is a substrate for P-
galactosidase, and when this gene is present in the vector, P-galactosidase metabolizes X-
gal, a blue product is formed and the colony becomes blue. If an insert is present in the

23
plasmid, the P-galactosidase gene is disrupted, X-gal is not metabolized, and the colony
remains white.
Reporter Vector Cloning
A 4.5 kb EcoR I/Eag I fragment of 5' non-coding sequence was isolated from the
17 kb MnSOD genomic clone (Figure 3-1) and the 5' overhang ends filled in using the
large fragment of E. coli DNA polymerase I (Klenow fragment). The resulting blunt-end
Eco/Eag fragment was cloned into the Hiñe II polylinker site in a promoterless, pUC 12-
based human growth hormone expression vector, p0GH, (Selden et al., 1986), creating a
9.3 kb plasmid referred to as Eco/E GH (Figure 3-10). The unique restriction enzyme
site, Hindlll, was utilized to delete a 2.0 Kb portion of the MnSOD Eco/E sequence,
creating the vector, Hind/E (Kuo et al., 1999, Figure 3-10). To test for non-specific
effects of the inflammatory mediators on hGH expression, we used an hGH expression
vector that contained the herpes simplex thymidine kinase minimal promoter, pTKGH
(Selden et al., 1986).
To identify possible regulatory elements in the remainder of MnSOD that might
interact with the 5' promoter, we cloned an internal 6.1 kb Hind III fragment (+1180 to
+7312) from the rat genomic clone into the //mí/111 site of the Hind/E GH vector, creating
a 13.45 kb vector (Figure 3-1). The same Hind III fragment was cloned into Hind/E GH
in the opposite orientation. To begin to localize observed enhancer effects, we removed
the Hind III/Hpa I fragment (+1180 to +5046) and the Hpa I/Hind III fragment (+5046 to
+7312) from the Hind III fragment in both orientations creating enhancer deletions of 3.8
Kb or 2.3 Kb in the Hind/E GH construct (Figure 3-3). To clarify the position of the
enhancer within the 3.8 kb fragment, serial 3’ and 5’ deletions of the area were performed

24
by creating PCR products (Figure 3-3) which were subsequently cloned into the Hind/E
GH vector at the Hindlll site or Ndel site. Oligonucleotides flanking the regions of
interest were designed containing either Hindlll or Ndel sites for convenient ligation into
the restriction sites. To test whether the enhancer activity was specific to the MnSOD
promoter, we used the plasmid, TKGH, which contains a heterologous, TATA-
containing, non-GC-rich promoter. The 6.1 kb Hind III MnSOD genomic fragment
(+1180 to +7312) was cloned into the Hindlll site (Figure 3-9) in the TKGH polylinker in
both orientations. To evaluate the interaction of the promoter with the enhancer
fragment, the 919 bp (Figure 3-3) fragment of MnSOD containing the entire enhancer
region was ligated into the Ndel site of the promoter deletion constructs (Figure 3-10).
Comparison of the rat enhancer sequence with the analogous region in human
MnSOD revealed a high degree of homology in intron 2. PCR amplification of a 466 bp
fragment (+2410 to +2875, human manganese SOD, accession S77127) from human
genomic DNA with primers, 5’ CGTTAGTGGTTTGCACAAGGAAGATAATCG 3’
and 5’ GGCTCTGATTCCACAAGTAAAGGACTG 3’, to create a fragment, which was
inserted into Ndel site of the TKGH vector in both orientations.
Plasmid Purification
For small scale plasmid isolation the QIAprep Spin miniprep from Qiagen was
used. A single bacterial colony from YT agar plates with ampicillin was used to
inoculate 5 ml of YT media (1.6% bacto-tryptone, 1% yeast extract, 0.5% NaCl, pH 7.0)
supplemented with 50 pg/ml of ampicillin and grown overnight at 37°C in a rotary water
bath shaker. Plasmids were extracted using the QIAprep Spin Miniprep kit following the
manufacturer’s protocol. Bacteria from 1.5 ml of YT culture were collected by

25
centrifugation at 13,000 x g for 5 minutes, resuspended in 250 pi of resuspension buffer
(50 mM Tris-HCl, pH 8.0, 10 mM EDTA, 100 pg/ml RNase), lysed with 250 pi of lysis
buffer (200 mM NaOH, 1% SDS), neutralized and adjusted to high-salt binding
conditions with 350 pi of neutralization buffer (3 M potassium acetate, pH 5.5), and
centrifuged for 10 minutes at 13,000 x g, at 4°C. The supernatant was applied to a
QIAprep silica-gel membrane column. A vacuum manifold was used for the following
steps. First, the supernatant was drawn through the column using the vacuum manifold.
The column was washed once with 500 pi wash buffer (10 mM Tris-HCl, 80 % ethanol)
containing chaotrophic salts and once with 750 pi wash buffer (10 mM Tris-HCl, 80 %
ethanol). The column was then centrifuged at 13,000 x g for 2 minutes at room
temperature. The plasmid DNA was eluted from the column with addition of 100 pi of
TE buffer (50 mM Tris-HCl, pH 8.0, 10 mM EDTA), and centrifugation at 13,000 x g for
one minute at room temperature into a clean, DNase-free eppendorf tube.
For large, scale plasmid isolation a QIAGEN plasmid maxi kit was used. One ml
of a single colony overnight liquid culture (5 ml YT/ampicillin) was inoculated in 50 ml
(high copy plasmid) of YT media supplemented with 50 pg/ml of ampicillin, and grown
overnight at 37°C in a rotary water bath shaker. Bacteria were collected by centrifugation
(4,000 x g, 15 minutes, 4°C), pellets were resuspended in 10 ml of resuspension buffer
(50 mM Tris-HCl, pH 8.0, 10 mM EDTA, 100 pg/ml RNase), lysed with 10 ml of lysis
buffer (200 mM NaOH, 1% SDS) and incubated for 5 minutes at room temperature,
neutralized by addition of chilled (4°C) neutralization buffer (3 M potassium acetate, pH
5.5), incubated on ice for 20 minutes, and centrifuged at 16,000 x g for 30 minutes at
4°C. The supernatant was removed from the centrifugation tube with a sterile transfer

26
pipette and allowed to flow through by gravity on a QIAGEN-tip 500 column, that had
been previously equilibrated with 10 ml of equilibration buffer (750 mM NaCl, 50 mM
MOPS, pH 7.0, 15% isopropanol, 0.15% Triton X-100). The flow-through was discarded
and the column was washed twice with 30 ml of wash buffer (1 M NaCl, 50 mM 3-(N-
morholino)propane sulfonic acid (MOPS), pH 7.0, 15% isopropanol) by gravity flow.
Plasmid DNA was eluted from the column with 15 ml of elution buffer (1.25 M NaCl, 50
mM Tris-HCl, pH 8.5, 15% isopropanol). The DNA present in the eluate was
precipitated with 0.7 volumes (10.5 ml) of isopropanol, and collected by centrifugation
(16,000 x g, 30 minutes, 4°C). The pellet was washed once with 5 ml of 70% ethanol and
centrifugation was repeated (16,000 x g, 30 minutes, 4°C). The final pellet was
resuspended in 300-500 pi of TE buffer.
Plasmid DNA concentration was estimated by measuring the absorbance at 260
nm in a Beckman DU-64 Spectrophotometer (Beckman Instruments, Inc., Fullerton, CA),
of water dilutions (1:50) from each sample. An absorbance of 1 at 260 nm corresponds
to 50 mg of double-stranded DNA. The ratio between the readings taken at 260 nm and
280 nm (A260/A280) provided an estimate of DNA purity (1.5-2.0). Typical yield
depended on the size of the plasmid, but ranged from 20-50 pg of plasmid DNA for
QIAprep Spin minipreps and 400-800 pg for maxi-size preparations.
Transient Transfection of Mammalian Cells
L2 cells, a rat pulmonary epithelial-like cell line (ATCC CCL 149), were grown
in Ham’s modified F12K medium (GIBCO) with 10% fetal bovine serum (Flow
Laboratories), ABAM (penicillin G 100 U/ml, streptomycin 0.1 mg/ml, amphotericin B
0.25 mg/ml (Sigma) and 4 mM glutamine at 37°C in room air, 5% CO2. To control for

27
transfection efficiency, transfections were carried out using a batch transfection method.
Cells were grown as monolayers on 150 mm tissue culture plates until 70-90% confluent.
The cells were transfected with 10 mg of each expression vector using the DEAE-dextran
method (Kriegler et al., 1990). After 24 h, cells from each 150 mm, batch transfected
plate were trypsinized, pooled, and plated onto four separate 100 mm tissue culture
plates. Inflammatory mediators were added to the medium of each plate 24 h later with
final concentrations of 0.5 pg/ml Escherichia coli lipopolysaccharide (LPS, E. coli
serotype 055:B5, Sigma), 10 ng/ml TNF-a, or 2 ng/ml IL-lp. Twenty-four hours later,
total RNA was isolated from the cell monolayers for northern analysis.
RNA Isolation
Total cellular RNA was isolated according to the procedure described by
Chomczynski and Sacchi (1987) with modifications (Visner et al, 1990). Briefly, the
monolayer cells (L2 cells or VA cells), cultured as noted above, were washed once with
room temperature PBS, and then 3 ml/100 mm tissue culture plate of guanidinium
thiocyanate solution (4 M guanidinium thiocyanate, 25 mM sodium citrate pH 7.0, 0.5%
sarcosyl, and 0.1 M 2-mercaptoethanol) were added. The homogenate was collected in a
15 ml conical polypropylene tube and extracted with 0.1 volume of 2 M sodium acetate
pH 4.0, and an equal volume of water-saturated phenol. This suspension was mixed
together and cooled on ice for at least 15 minutes. Before centrifugation at 3,000 x g for
20 minutes at 4°C, 0.22 volumes of chloroform/isoamyl alcohol (IAA) (49:1) were added
and the mixture was shaken vigorously for 20 seconds. After centrifugation, the aqueous
phase was transferred to a fresh centrifugation tube and mixed with an equal volume of
isopropanol. This solution was placed at -20°C for at least 1 hour and then centrifuged at

28
10,000 x g for 25 minutes at 4°C. The RNA pellet was resuspended in 500 pi of
guanidinium thiocyanate solution and transferred to a 1.5 ml microfuge tube. An equal
volume of isopropanol was added and the mixture was incubated for at least an hour at -
20°C. RNA was collected by centrifugation at 10, 000 x g for 10 minutes at 4°C, and 400
pi of DEPC-treated water was added to the pellet and incubated at 50°C for 15 minutes.
The RNA was precipitated with 0.1 volume of DEPC-treated 3 M sodium acetate pH 5.2,
and 2.2 volumes of 100% ethanol, followed by incubation at -20°C for at least an hour.
The RNA was collected again by centrifugation, resuspended in 300 pi of DEPC-treated
water and ethanol precipitated one more time. The final pellet was dried in a Savant
speed-vacuum centrifuge to remove any trace amounts of ethanol, and then resuspended
in DEPC-treated water.
RNA concentration was estimated by measuring the absorbance at 260 nm in a
Beckman DU-64 Spectrophotometer (Beckman Instruments, Inc., Fullerton, CA), of two
water dilutions (1:20) from each sample. An absorbance of 1 at 260 nm corresponds to
40 pg of RNA. The ratio between the readings taken at 260 nm and 280 nm (A260/A280)
provided an indication of RNA purity (1.5-2.0). Typical RNA yield for L2 cells or VA
cells was 80-150 pg per 70-100% confluent 100 mm tissue culture plate.
Northern Analysis
RNA was size-fractionated for 16 hours at 40 volts on a 1% Seakem HGT agarose
gel containing 6.6% formaldehyde, 40 mM MOPS pH 7.0, 10 mM sodium acetate pH
7.4, and 1 mM EDTA pH 8.0 with constant buffer recirculation. For each lane of the gel,
twenty pg of total RNA were dried and resuspended in 30 ml of 12.5 M formamide, 6.6%
formaldehyde, 6 mM sodium acetate pH 7.4, 0.5 mM EDTA pH 8.0, 20 mM 3-(N-

29
morholino)propane sulfonic acid (MOPS) pH 7.0. This RNA was dissolved and heated
by incubations for 10 minutes at 50°C, then for 10 minutes at 65°C. A 5 pi aliquot of
loading dye (0.4% xylene cyanol FF, 0.4% bromophenol blue, 1 mM EDTA pH 8.0, 50%
glycerol, 0.3 pg/pl ethidium bromide) was added prior to loading the gel. To confirm
that equal amounts of RNA had been loaded into each lane, after electrophoresis, each gel
was photographed under UV light and the level of ribosomal RNA assessed by the
ethidium bromide staining. Ethidium bromide was present in the loading dye and RNA
could be visualized promptly under UV light after electrophoresis. The gel was then
treated for 30 minutes with 50 mM NaOH, 30 minutes with 100 mM Tris-HCl pH 7.0,
and twice for 25 minutes with 50 mM TBE (10 mM Tris-HCl, pH 8.0, 1 mM EDTA, pH
8.0). The RNA was electo-transferred to a positively-charged nylon membrane in 40 mM
TBE for 75 minutes and then covalently cross-linked to the membrane with UV light
(Church and Gilbert, 1984).
Genomic DNA Isolation
For genomic DNA isolation, L2 cells were grown in 15 cm tissue culture plates
until 70-90% confluent, washed once with PBS and lysed with 3 ml lysis solution (50
mM Tris-HCl, pH 8.5, 25 mM EDTA, pH 8.0, 50 mM NaCl, 0.5% SDS, 300 pg/ml
Proteinase K). The lysate was incubated overnight on a rocking platform at room
temperature. After this incubation, the lysate was then extracted once with equal volume
of Tris-equilibrated phenol for at least 1 hour at room temperature on a rocking platform.
The phases were separated by centrifugation at 3,000 x g for 20 minutes at room
temperature. The upper aqueous phase was transferred with a sterile large-bore, transfer
pipette to a new tube. Then the lysate was extracted once with an equal volume of

30
phenol/chloroform:isoamyl alcohol (IAA) (50/49:1) and once with chloroform:IAA, with
incubations of at least one hour at room temperature on a rocking platform, and
centrifugations at 3,000 x g for 20 minutes at room temperature to separate the phases.
After separation of the phases in the cholorform:IAA extraction, 2.5 ml of RNase A (750
U/ml) was added to the lysate, for digestion of contaminant RNA, and the mixture was
incubated overnight at room temperture on a rocking platform. The lysate was extracted
again, once with phenol/chloroform:IAA, and once with chloroform:IAA, as above.
DNA was precipitated from the aqueous phase by addition of 120 pi 5M NaCl to final
concentration of 0.2 M and 2.5 volumes (7.5 ml) of ice-cold 100% ethanol. The cotton¬
like DNA was collected with a sealed bent glass Pasteur pipette, washed by rinsing the
DNA with 2 ml of chilled (4°C) 80% ethanol and resuspended in 300 pi of TE buffer (10
mM Tris-HCl, pH 8.0, 1 mM EDTA, pH 8.0).
Electrophoretic Mobility Shift Assay (EMSA)
EMSA were performed as previously described (Fried and Crothers, 1981) with 8
mg nuclear extract prepared from control and LPS, TNF-a, or IL-ip-treated L2 cells by
high salt extraction (Andrews and Faller, 1991). Binding reactions were carried out at
room temperature in 10 mM HEPES (N-[2-Hydroxyethyl]piperazine-N’-[2-
ethanesulfonic acid])-KOH, pH 7.9, 100 mM KC1, ImM dithiothreitol, 0.5 mM MgCh,
0.1 mM EDTA and 8.5% glycerol to yield a final volume of 20 pi. EMSA probes were
made from cloned PCR products of the defined enhancer region between 4130 and 4491
and end-labeled by filling the recessed 3’ termini of EcoRI digested fragments with P-
dATP using the large fragment of E. coli DNA polymerase I (Klenow fragment).
Fragments used in EMSAs were 143 bp (+4348 to +4491), 143 bp (+4231 to +4374), 100

31
bp (+4231 to +4331), 95 bp (+4331 to +4426), and 103 bp (+4426 to +4529). Numbers
shown in parentheses refer to sequence in the rat MnSOD gene (accession X56600).
In Vivo DMS Treatment
L2 cells were cultured as described above in 150 mm tissue culture plates. The
medium was removed by aspiration and the cells washed once with room temperature
phosphate buffered saline (PBS, 10 mM sodium phosphate, pH 7.4 and 150 mM NaCl).
The PBS buffer was removed and replaced with room temperature PBS containing
0.25%-0.5% demethyl sulfate (DMS, Aldrich) for 1-2 min. The PBS containing DMS
was rapidly removed (30-60 seconds), and the cell monolayer washed twice with 4°C
PBS to quench the DMS reaction. The cells were lysed in 5 ml of lysis solution (50 mM
Tris pH 8.5, 25 mM EDTA pH 8.0, 50 mM NaCl, 0.5% SDS, 300 pg/ml Proteinase K)
followed by incubation overnight at room temperature on a rocking platform. Genomic
DNA was then purified by phenol/chloroform extractions. Each sample was extracted
once with an equal volume of Tris-equilibrated phenol, followed by two extractions with
a 24:24:1 (v/v/v) mixture of Tris-equilibrated phenol/chloroform/isoamyl alcohol, and
finally by one extraction with a 24:1 (v/v) mixture of chloroform/isoamyl alcohol. Each
extraction was performed for at least an hour on a rocking platform prior to collection of
aqueous phase. The aqueous phase was collected each time by centrifugation at 14, 000 x
g for 10 minutes at room temperature and ethanol precipitated. Samples were then
treated with 100 pg/ml RNase A, organic extracted as above, ethanol precipitated and
suspended in TE (10 mM Tris pH 8.0 and 1 mM EDTA). The DNA samples were
digested with BamH I restriction endonuclease enzyme, and strand cleavage at modified
guanine residues was achieved by treatment with 1 M piperidine (Fisher Scientific) at

32
90°C for 30 minutes. Naked genomic DNA was isolated and purified from cells without
any DMS treatment and digested with restriction endonuclease enzyme, BamHl (New
England Biolabs).
As a control, genomic DNA was extracted in the same way from cells incubated
in Ham’s F12K medium for 2 or 4 hours, but not treated with DMS. One hundred pg of
this “naked” DNA was restriction digested with BamHl. After digestion, DNA was
extracted once with pheno/chloroform:IAA, once with chloroform:IAA, and ethanol
precipitated with 2.5 volumes of 100% ethanol and 2.5 M ammonium acetate incubating
at -70°C for 30 minutes. DNA was collected by centrifugation at 16,000 x g for 30
minutes at 4°C, and washed twice with 80% ethanol and centrifugation at 16,000 x g for
30 minutes at 4°C. After lyophilizing, the pellet DNA was resuspended in 10 pi of sterile
water. The in vitro DMS treatment of the naked DNA recovered from digestion of
BamHl was done as described by Maxam and Gilbert (1980) with some modification.
Naked DNA (100 pg) in 10 pi of water was added to 190 pi of DMS buffer (50 mM
sodium cacodylate, 0.1 M EDTA, pH 8.0), treated for 30 seconds with 0.5 pi (0.25%) of
DMS, and immediately precipitated with addition of 7.5 M ammonium acetate to the
final concentration of 2.5 M, 14 pg of E. coli tRNA, and 2.5 volumes of 100% ice-cold
ethanol. After incubation in a dry ice/ethanol bath for at least 5 minutes, DNA was
collected by centrifugation at 13,000 x g for 30 minutes at 4°C, resuspended in 250 pi of
common reagent (2.5 M ammonium acetate, 0.1 mM EDTA, pH 8.0), and precipitated
again by addition of 14 pg of tRNA and 750 pi of ice-cold 100% ethanol. After
incubation for 5 minutes in the dry ice/ethanol bath, DNA was collected by centrifugation
at 13,000 x g, for 30 minutes at 4°C and washed twice with 80% ethanol with

33
centrifugation as above. After lyophilization, the final DNA pellet was resuspended in 90
pi of sterile water.
Once the DMS-modified DNA (both in vivo- and in vitro-treated samples) were
precipitated and redissolved in water (approximately 70 mg in 90 ml of sterile water) as
described, the DNA was mixed with 10 ml of piperidine (10 M) and incubated at 90°C
for 30 minutes to cleave the DNA at the modified guanine residues (Maxam and Gilbert,
1980). DNA was then ethanol precipitated, collected by centrifugation at 13,000 x g at
4°C for 30 minutes, washed twice with 80% ethanol, lyophilized, and then resuspended
and lyophilized three more times in 500 pi of sterile water. After the last lyophilization,
DNA was resuspended in 20 pi of TE buffer.
Ligation-Mediated PCR (LMPCR)
LMPCR was begun by annealing 3 pmol of primer 1 to 3 pg of DMS-modified
and piperidine cleaved DNA for each sample in 1 X Vent polymerase buffer (10 mM
KC1,10 mM (NH4)2S04, 20 mM Tris-HCl (pH 8.8), 2 mM MgS04, 0.1% Triton X-100),
in a total volume of 15 ml, with denaturation at 95°C for 10 minutes followed by primer
annealing at 45°C for 30 minutes. Primer 1 is the primer for the known site of the
cleaved DNA and is a synthetic single stranded oligonucleotide. The first strand primers
utilized for bottom strand, 5’-GGATAACTTTGGGGAGTTGGTTC-3’ and 5’-
GAATAATGTTAGCCGTGTCTCTGGG-3’, as well as for the top strand, 5’-
CCAACCTTTGGGTTCTCCAC-3’. The first strand synthesis was performed in 1 X
Vent polymerase buffer with 4 mM MgS04, 0.25 mM of each dNTP, and 2 U of Vent
DNA polymerase. The samples were incubated for 1 minute each at 53°C, 55 °C, 57 °C,

34
60 °C, 62 °C, 64 °C, 68 °C, followed by incubations for 3 minutes each at 72°C (Homstra
and Yang, 1993). Separate primer 1 for top and bottom DNA sequence were designed.
Following the first strand synthesis, a common linker was ligated to the double-
stranded DMS-piperidine cleaved fragment. The linker sequences used were the same as
published by Mueller and Wold (1989). The double-stranded linker is composed of two
synthesized, dephosphorylated complementary oligonucleotides, a 25-mer
oligonucleotide (5’-GCGGTGACCCGGGACATCTGAATT-3’) annealed to an 11-mer
oligonucleotide (5’-GAATTCAGATC-3’). The double stranded linker (20 pmol/ml) was
prepared from these oligonucleotides by mixing 2 nmol each in 250 mM Tris-HCl, pH
7.7 (total volume of 100 ml), and heating to 95°C for 10 minutes followed by gradual
cooling down to 4°C for 3 hours, in a thermocycler (Perkin Elmer 480, Applied
Biosciences PE, Norwalk, CT) and incubation at 4°C overnight. After the primer
extension step with primer 1, 20 pi of 4°C solution containing 50 mM dithiothreitol, 18
mM MgCh, 0.125 pg/pl nonacetylated BSA (Sigma Cat#A-7511), and 110 mM Tris-
HCl, pH 7.5 (Garrity and Wold, 1992) were added, followed by addition of 25 ml of a
4°C ligation solution containing 20 mM dithithreitol, 10 mM MgC^, 0.05 pg/pl
nonacetylated BSA, 3 mM ATP, 4 pmol of annealed common linker, and 4 U of T4 DNA
ligase (Garrity and Wold, 1992). Ligation was performed at 16°C overnight. The T4
DNA ligase and the Vent polymerase were removed by one extraction with an equal
volume of phenol/chloroform:IAA and one extraction with an equal volume of
chloroform:IAA. DNA was precipitated by the addition of 7.5 M ammonium acetate to a
final concentration of 2.5 M, 14 pg of tRNA, and 2.5 volumes of 100% ethanol and
incubation at -70°C for 30 minutes. After precipitation, the DNA was collected by

35
centrifugation (13,000 x g, 30 minutes, 4°C), washed once with 80 % ethanol, and again
DNA collected after centrifugation (13,000 x g, 30 minutes, 4°C), lyophilized, and
resuspended in 20 ml of sterile water.
After ligation of the linker, the nested set of linear genomic DNA fragments from
the region of interest were amplified by PCR using a second gene-specific
oligonucleotide primer, termed primer 2 (5’-GGGGAGTTGGTTCTCTCCTTTCACTG-
3’ and 5 ’ -GCCGTGTCTCTGGGTTAGCTGTATTGC-3 ’, respectively for bottom
strands and 5’-CCAACCTTTGGGTTCTCCAC-3’ for the top strand, as well as the
complementary primer to the 25-mer linker-primer (5’-
CGCCACTGGGCCCTCTAGACTTAAG-3’). PCR conditions were the same for both
DNA strands and sets of primers, as described by Homstra and Yang (1993) with some
modifications. Freshly prepared Taq DNA polymerase mix (79.4 pi) containing 1 x Taq
DNA polymerase buffer (1 x 20 mM Tris-HCl, pH 8.4, 50 mM KC1, 1.75 mM MgC^,
0.25 mM each dNTP, 15 pmol primer 2, and 10 pmol 25-mer complementary linker
primer were added to the common linker-ligated DNA samples. Samples were initially
heated to 95°C for 5 minutes and 0.6 pi (3 U) of Taq DNA polymerase was added after
the first two minutes of this period. The annealing temperatures (53-65°C) were
determined experimentally to establish the conditions that yielded the best results.
Samples were denatured at 95°C for 1 minute, annealed at 58°C for 2 minutes, and
extended at 76°C for 3 minutes. Samples were denatured, annealed and extended in this
manner for 25 cycles. In addition, with each cycle of PCR amplification, the extension
time was increased by 5 seconds. After 25 cycles, samples were kept at 76°C and 5 ml of
a fresh PCR incubation solution containing 2.5 mM each dNTP, 1.75 mM MgCh, 1 X

36
Taq DNA polymerase buffer, and 1 U of Taq DNA polymerase was added. Samples
were then incubated at 76°C for 30 minutes to ensure full extension of each template
strand and addition of a single deoxyadenosine nucleotide to the end of every fragment.
After this incubation, samples were placed on ice, and 1 ml of 0.5 M EDTA was added to
stop the reaction. The DNA was precipitated by addition of 7.5 M ammonium acetate to
a final concentration of 2.5 M, 14 pg of tRNA, and 2.5 volumes of 100% ethanol, and
incubation at -70°C for 30 minutes. DNA was collected by centrifugation (13,000 x g,
4°C, 30 minutes), washed twice with 80% ethanol and collected again by centrifugation
(13,000 x g, 4°C, 30 minutes), lyophilized, and resuspended in 20 pi of water.
Following LMPCR amplification of the genomic DNA fragments from the region
of interest, the “footprint” is visualized by genomic sequencing (Church and Gilbert,
1984). For this protocol, a 2 pi aliquot of each LMPCR sample is dried in a vacuum
concentrator and redissolved in 2 pi of formamide-dye solution (98% formamide, 0.025%
xylene cyanol, 0.025% bromophenol blue, and 0.5X TBE (44.5 mM Tris-base, 44.5 mM
boric acid, 1 mM Na2EDTA 2FLO). Samples were then loaded onto a 8.3 M urea, 5%
Long Ranger polyacrylamide, TBE (89 mM Tris-base, 89 mM boric acid, 2 mM EDTA)
DNA sequencing gel (60 centimeters long), and size-fractionated, with TBE (89 mM
Tris-base, 89 mM boric acid, 2 mM EDTA) as tank buffer, at 120 W for 4-5 hours. The
PCR fragments were then electro-transferred as described in Homstra and Yang (1993),
in an electro-transfer apparatus (Harvard Biolabs, Sommerville, MA), using 40 mM TBE
(40 mM Tris-base, 33.8 mM boric acid, 0.4 mM EDTA, pH 8.3) as transfer buffer, for 45
minutes, at 110 V, 2 A, to a Zetabind positively charged nylon membrane (Cuno,
Meriden, CT), with UV crosslinking (Church and Gilbert, 1984). The resulting

37
membrane containing the electro-transferred DNA was then hybridized with a P-radio-
labeled oligonucleotide positioned internal to primer 2, called primer 3. The
oligonucleotide was 32P-radio-labeled as described above for oligonucleotide probes and
separated from the free radiolabeled-nucleotide using the QIAquick Nucleotide Removal
kit from Qiagen as follows. The T4 polynucleotide kinase labeling reaction was added to
10 volumes of Qiagen PN buffer in the kit and passed through a QIAquick column.
Bound DNA was washed twice with a buffer containing 80% ethanol and eluted with 100
pi of TE buffer. The resulting autoradiograph of this preliminary gel was used as a
loading control to obtain data for more adequate loading of the final gel in which the
amount of each sample loaded was adjusted to obtain equal signal intensity in all lanes,
and the final gel was run, in the same way, but with only two samples of each treatment.
Site-Directed Mutagenesis and Substitutions by PCR
The technique of mutagenesis by overlap extension or site-directed mutagenesis
using PCR has been previously described (Ho et al., 1989). The method employs PCR as
a means of creating altered DNA fragments from cloned DNA in a vector with essentially
100% efficiency and in very few steps. Two inside primers (Primer 2 and Primer 3) are
designed for each mutation. For base mutation, the inside primers are mismatched to the
target sequence at the mutated base. Two PCR reactions (Figure 2-1), performed as
described, were run to generate the two overlapping products, one reaction using primer 3
(P3) and the 3’ primer (P4) used to amplify the original wild-type 360 bp construct, and
the other reaction using primer 2 (P2) and the 5’ primer (PI) used to amplify the original
wild-type 360 bp construct. The PCR amplicons were agarose gel-purified using the

38
QIAquick Gel Extraction kit to remove the original PCR primers which might interfere
with the subsequent reaction. Because the mutagenesis primers are complementary to
First PCR Reactions
— 3’ 5’—
PI
★ ★
P2
5’
5’-
P3
zx3’
pA- 5’
3’
I
First Cycle
Extension
24 Cycles
s’ ini'
5’
5'
3’ *+"
★ ★
★ ★
rm*.
5’ PI 3’
P4
.3’
5’
3’
5’
Figure 2-1. Schematic representation of PCR-based mutagenesis.

39
each other, the two overlapping fragments can be fused in a subsequent extension
reaction. The overlapping gel-purified products (approx. 20 ng) were used as DNA
templates for a second PCR reaction and the PCR reaction conditions were the same as
described previously, using the 5’ (PI) and 3’ (P4) primers used to amplify the original
wild-type 360 bp MnSOD enhancer fragment, which contains Ndel sites at both ends. In
the first round of denaturation/annealing/extension of the second PCR reaction, the two
PCR reaction products used as templates, which are the two overlapping parts of the final
amplicon, were denatured and annealed to each other, forming the two possible
heteroduplex products, with recessed 3’ ends, that were subsequently extended by Vent
DNA polymerase to produce a product that was the sum of the two overlapping products
and containing the mutation. This product became the template for the second PCR
reaction and it was amplified by 25 cycles of denaturation/annealing/extension, resulting
in multiple copies of the full-length product containing the mutation.
The PCR product was cloned with the use of the PCR Script Cloning System
(Stratagene), and positive colonies were identified by the presence of a 360 bp restriction
fragment when the vector was digested with Ndel. The digested fragment was agarose
gel purified using QIAquick Gel Extraction kit, and the isolated DNA fragment was
cloned into the Ndel site of a linearized CIP-treated hGH vector containing the minimal
MnSOD promoter (Kuo, unpublished data). The directionality of the mutagenized
enhancer fragment was checked by PCR using primers specific to the enhancer fragment
and a primer specific to the vector. Directionality and mutations were also checked by
direct DNA sequencing. The final reporter gene plasmids containing these site-directed

40
mutant PCR fragments were grown in 50 ml DN5a E. coli, isolated with a Qiagen
Plasmid Maxi kit and then used for transient transfections in L2 cells, as described above.
Radiolabeled Probe Synthesis
For radiolabel hybridization of UV-crosslinked RNA on positively-charged, nylon
membranes, the cDNA (MnSOD, hGH, or Cathepsin B) was radio-labeled using a
random primer DNA labeling system (Gibco BRL, Gaithersburg, MD) as follows. 100-
500 ng of DNA in 17 pi of ddH20 were boiled for 5 minutes and 15 pi of the random
primers-buffer solution (0.67 M HEPES, 0.17 M Tris-HCl, 17 mM MgCl2, 33 mM 2-
mercaptoethanol, 1.33 mg/ml BSA, 18 OD26o units/ml oligodeoxyribonucleotide primers
(hexamers), pH 6.8) were added together with 2 pi of each dCTP, dTTP, and dGTP (0.5
mM in Tris-HCl (pH 7.5)), 2 pi Klenow fragment (6 U), and 10 pi of [a-32P]dATP (100
pCi). The labeling process was allowed to proceed for 3-4 hours at room temperature.
The un-incorporated nucleotides were removed by passing the labeling reaction over a
Sephadex G-50 column using TE buffer with 100 mM NaCl as elution buffer. The probe
was incubated for five minutes in boiling water before being added to the membrane and
hybridization solution.
When the radiolabeled-probe was an oligonucleotide (for hybridization for in vivo
footprinting analyses), the labeling was done by phosphorylation with bacteriophage T4
polynucleotide kinase as described in Sambrook et al (1989), with some modifications.
Briefly, 30 pmol of oligonucleotide were incubated with 120 pCi of [y-32P]ATP, 70 mM
Tris-HCl pH 7.6, 5 mM DTT, 10 mM MgCl2, and 20 units of T4 polynucleotide kinase,
in a total volume of 20 pi, for 30 minutes at 37°C. The 32P-radiolabeled oligonucleotide
was separated from the free radiolabeled-nucleotide, by precipitation with addition of 5

41
M NaCl to the final concentration of 0.2 M, 25 pg of tRNA, and 2.5 volumes of 100%
ethanol, followed by incubation at -70°C for 20 minutes. The precipitated probe was
collected by centrifugation at 13,000 x g for 30 minutes at room temperature,
resuspended in 200 pi of TE buffer and added to the membrane hybridization solution
after incubating in boiling water for 5 minutes.
Hybridization of Northern and Southern Blots
Membranes were pre-hybridized with 20 ml of hybridization solution (0.5 M
sodium phosphate, pH 7.2, 7% SDS, 1 mM EDTA, pH 8.0, 1% BSA) for at least 20
minutes and then the probe was added after boiling for 5 minutes. After an overnight
incubation at 61°C, the blots were washed 4 times for 10 minutes with each wash
temperature at 65°C in a high-stringency buffer (0.04 M sodium phosphate, pH 7.2, 1
mM EDTA, pH 8.0, 1% SDS), blotted dry on Whatman filter paper #1 and exposed to
film. When the probe was an oligonucleotide, the incubation overnight was at 40°C, the
washing temperature was 45°C, and the high-stringency wash buffer had the Na+
concentration adjusted to 350 mM with 5M NaCl. After washing, the membrane was
subjected to autoradiography by exposure to Hyperfilm MP (Amersham-Pharmacia,
Piscataway, NJ).
The exposed film was scanned using a Hewlett-Packard ScanJet 4c/T into Adobe
Photoshop (Adobe Systems Incorporated, San Jose, CA) computer software for creation
of the figures displayed in this dissertation made in Microsoft Office Powerpoint
(Microsoft Corporaton, Redmond, WA).

CHAPTER 3
CYTOKINE-INDUCIBLE ENHANCER WITH PROMOTER ACTIVITY IN BOTH
THE RAT AND HUMAN MANGANESE SUPEROXIDE DISMUTASE GENES
Introduction
The superoxide dismutases (SODs) are the first line of cellular defense against the
damaging effects of superoxide anion radicals (Halliwell and Gutteridge, 1990).
Manganese superoxide dismutase (MnSOD) is the most highly regulated of the three
SODs (Visner et al., 1991; Dougall and Nick, 1991), being localized to mitochondria
(Suzuki et al., 1993; Del Maestro and McDonald, 1989) and conferring potent
cytoprotection (Shull et al., 1991; Wong and Goeddel, 1988; Wong et al., 1989; Visner et
al., 1990; Eastgate et al., 1993; Akashi et al, 1995; Manganaro et al., 1995; Baker et al.,
1998). Multiple studies have shown that increased cellular levels of MnSOD are
cytoprotective during cellular oxidative stress (Shull et al., 1991) or inflammatory
challenges, such as TNF-a-mediated apoptosis (Wong and Goeddel, 1988; Wong et al.,
1989), IL-1 cytotoxicity (Visner et al., 1990), ionizing radiation (Eastgate et al., 1993;
Akashi et al., 1995), and neurotoxicity (Manganaro et al., 1995; Baker et al., 1998). The
role of MnSOD as a potent cytoprotective enzyme is most strikingly illustrated in three
transgenic model studies. The first transgenic model involves targeted overexpression of
MnSOD in the pulmonary epithelium of mice resulting in a decreased level of
inflammation as a consequence of a hyperoxic exposure (Wispe et al., 1992). In the
second study, the physiological importance of this gene is best exemplified through gene
ablation where MnSOD knockout mice manifest severe dilated cardiac myopathy and die
42

43
within ten days of birth (Li et al., 1995). The third study shows that treatment of the
MnSOD knockout mouse with the superoxide dismutase mimetic, manganese 5,10,15,20-
tetakis (4-benzoic acid) porphyrin, rescues these mice from the systemic toxicity, but
allows development of a severe neurodegenerative disorder by three weeks of age (Melov
et al., 1998).
Previous investigations from this and other laboratories have established that
levels of steady state MnSOD mRNA and protein increase following exposure to
bacterial lipopolysaccharide (LPS), tumor necrosis factor (TNF) and interleukin-1 (IL-1)
(Wong and Goeddel, 1988; Visner et al., 1990; Visner et al., 1991; Melov et al., 1998).
Stimulus-dependent increases in mRNA levels are inhibited by actinomycin D (Visner et
al., 1992), suggesting increased transcription of the gene, which has been confirmed by
subsequent nuclear run-on studies (Hsu, 1993). Results from DNase I hypersensitive
studies analyzing the chromatin structure of MnSOD have identified multiple regions of
increased nuclease accessibility located throughout the gene as well as a stimulus-
dependent alteration in chromatin structure in the 5' flanking region (Kuo et al., 1999).
Furthermore, dimethyl sulfate in vivo footprinting studies have identified the binding sites
for ten basal protein factors which interact with the promoter as well as stimulus-
dependent alterations in guanine residue reactivity near the hypersensitive site found only
in stimulus treated cells (Kuo et al., 1999). To complement the preceding studies on
chromatin structure and in vivo footprinting, functional studies of the promoter were
performed by analyzing deletions of the 5’ flanking region. The promoter deletion data
suggest that basal promoter activity requires only a very small portion of the 5’ flanking
region. Together these data suggest that multiple protein-DNA interactions occur during

44
transcription under basal conditions and that treatment with inflammatory mediators,
causes an alteration in chromatin structure in the promoter region of the gene.
Not all c/5-acting regulatory elements are located in 5' flanking regions. In fact,
regulatory sequences have been identified within introns or in distant 3' flanking
sequences of the human and mouse immunoglobulin kappa gene (Queen and Baltimore,
1983; Judd and Max, 1992), platelet-derived growth factor gene (Takimoto and
Kuramoto, 1993), alcohol dehydrogenase-1-S (Callis et al., 1987) and collagen genes
(Simkevich et al., 1992). To identify regions of MnSOD that regulate basal and
stimulated expression, our present study utilized deletion analysis of rat MnSOD (Hurt et
al., 1992) coupled with transient transfection studies in a rat lung epithelial cell line.
Measuring mRNA expression levels of the human growth hormone reporter gene, we
have localized a complex enhancer element within intron 2 of the rat and a homologous
region in intron 2 of the human MnSOD. Most interestingly, this regulatory element
possesses the ability to promote cytokine-inducible transcription independent of a
promoter sequence.
Results
An Inducible C/s-Acting Enhancer Element Exists within MnSOD
Previous results of steady-state MnSOD mRNA levels in rat pulmonary epithelial
and endothelial cells demonstrated dramatic induction with inflammatory mediators
(Visner et al., 1991). In addition, nuclear run-on experiments showed that stimulus-
dependent MnSOD expression is at least in part a consequence of de novo transcription
(Hsu, 1993). MnSOD promoter deletion analysis demonstrated levels of stimulus-
dependent MnSOD expression that were far lower than that seen with the endogenous

45
steady-state mRNA. The vector constructs used in the analysis contained only 5'
flanking sequence, incorporating only one of the seven DNase I hypersensitive sites
within MnSOD (Kuo et al., 1999). To determine whether the remaining DNase I
hypersensitive sites within MnSOD contained regulatory function, we created hGH
expression vectors that combine both the MnSOD promoter (a 2.5 Kb Hindlll to Eagl
fragment) and a 6.1 kb Hindlll fragment, containing the remaining DNase I
hypersensitive sites (Figure 3-1). Expression of hGH in cells transfected with these
vectors was compared in the same experiments to expression of hGH in cells transfected
with the vector construct, Hind/E GH, containing only the 5' promoter fragment.
Of note, the data displayed in Fig. 3-2 and all subsequent figures use northern
analysis to directly assess transcription rates from the transfected reporter constructs.
This is distinct from studies which assay reporter protein levels or enzymatic activity that
must take into consideration potential effects of stimuli on translation and post-
translational events.
As shown in Fig. 3-2A, LPS treatment caused a dramatic enhancement of steady-
state mRNA expression as a result of adding the internal MnSOD genomic fragment, in a
manner independent of fragment orientation. The same result was obtained when
transfected cells were stimulated with TNF-a or IL-ip (data not shown). Furthermore,
cleavage of the 6.1 kb Hindlll fragment by making use of the unique Hpal site
demonstrated that the ds-acting element responsible for the inducible activity was
localized to the 5’ 3.8 kb portion of the original Hindlll fragment (Figure 3-2B). Again,
orientation did not influence the inducible activity in response to inflammatory

46
MnSOD Genomic Clone
19.5 Kb
EcoR I
Exons
DNase HS Sites
Hind III EaS1
2.5 Kb {
^Fragment i 1
1 2
****
1
4 6.1 Kb â–º
Hind III Hpa I Hind III
1 | ji| I
3 4 5
★ * * ******
2 3 4 5 6 7
EcoR I
2.5 Kb MnSOD Promoter
Fragment (Hind-E)
Nde T Hind ITT
Enhancer Fragments
p(|)GH
Figure 3-1. Schematic representations and restriction maps of the MnSOD genomic clone
and the expression vectors constructed to assess potential enhancer activity. The
restriction enzyme sites are indicated above the sequence (e.g., Hindlll). The expression
vectors contain the 6.1 kb Hindlll fragment from positions +1107 to +7238 of MnSOD,
with DNase-I hypersensitive sites 2-7 (*; Kuo et al., 1999) in either the 5’-to-3’ or the 3’-
to-5’ orientation. In addition, each expression vector contains the MnSOD 5’ promoter
sequence from the Hindlll site to the Eagl site (Hind-E). The Hindlll fragment, from
positions +1107 to +7238 of MnSOD, has been cut at position +4938 by Hpal digestion
creating the 3.8 kb and 2.3 kb fragments. The Hindlll (+1107) to Hpal (+4938) fragment
contains hypersensitive sites 2, 3, and 4 (*; Kuo et al, 1999). The Hpal (+4938) to
Hindlll (+7238) fragment contains hypersensitive sites 5, 6, and 7. These two fragments
were tested in in transient transfections as was the 6.1 kb Hindlll fragment. The
restriction sites (Hindlll and Ndel) into which the enhancer deletions were ligated are
denoted on the hGH vector, which also contains the MnSOD promoter (Hind-E).
Reproduced with permission from Rogers et al. (2000), Biochem. J.. 347, 233-242.
© Biochemical Society.

47
Hind/E Hind/E Promoter and
Promoter 6.1 Kb Fragment
Orientation
Alone
forward reverse
LPS “ +
hGH * I
- + - +
Cathepsin B
MnSOD
H II II
Hind/E Promoter plus
3.8 Kb Fragment 2.3 Kb Fragment
Orientation
LPS
hGH
Cathepsin B
MnSOD
forward reverse forward reverse
-+-+- + - +
mu
A
B
Figure 3-2. hGH mRNA levels after transfection in rat lung epithelial cells with vectors
containing the internal Hindlll fragment of MnSOD coupled to the promoter versus
MnSOD promoter alone. Northern analysis was done using radiolabeled probes
synthesized from hGH, MnSOD and cathepsin B cDNAs as described in the Methods
section. hGH mRNA expression in rat lung epithelial cells transfected with vectors
containing either the 3.8 kb or the 2.3 kb fragments which are deletions of the internal
Hindlll fragment of MnSOD. Reproduced with permission from Rogers et al. (2000),
Biochem. J.. 347, 233-242. © Biochemical Society.

48
mediators, thus indicating that the element could partially satisfy the definition of an
enhancer.
The MnSOD Inducible Enhancer Element Is Located within Intron 2
To further localize the inducible cis-acting element within the 3.8 kb region, a set
of serial deletion fragments spanning this region were amplified by PCR using
complementary oligonucleotides and inserted into the MnSOD promoter vector, Hind-E
GH. Deletions of the fragment from the 5’ end and from the 3’ end (Fig. 3-3) were
generated in this manner. The inducible enhancer activity was evaluated by transient
transfections into L2 cells using northern analysis. Based on the 3’ deletions of the 3.8
kb Hindlll-Hpal fragment, the enhancer activity was localized to a region of
approximately 450 bp in the 5’ end of this 3.8 Kb fragment (Fig. 3-4). This position
coincides extremely well with DNase hypersensitive site 2 (Kuo et al., 1999) located near
the intron 2-exon 3 boundary.
In an effort to localize the enhancer more precisely, 5’ deletions were also
constructed as shown in Figure 3-5. Multiple 3’ and 5’ deletions containing the enhancer
fragment demonstrate inducible activity comparable to the steady-state mRNA levels of
the endogenous gene. Interestingly, the 338 and 227 bp deletions show reduced enhancer
activity relative to the 455 bp fragment as shown in figure 3-5B, thus further delineating
the enhancer activity regulated by LPS, TNF-a, and IL-ip to within a 200 to 300 bp
region near the 3’ end of intron 2.

49
6.1 Kb
Restriction
Sites Hindlll
3.8 Kb-
2.3 Kb
Hpal
Hindi II
900 bpl
2475 bp
i
552 bpl 1765 bp
HS Sites
Exon 3
116 bp
•
2
• •
3 4
u
Exon 4
179 bp
1
Exon 5
145 bp
• •• •••
5 6 7
Hindlll/Hpal fragment
u>
o
o
o
r-+
o'
p
c«
2.9 Kb
1.8 Kb
H 919 bp
H 765 bp
1.0 Kb
\ 542 bp
455 bp
H464 bp
H 338 bp
~H 227 bp ^
Figure 3-3. Deletions of the 3.8 kb enhancer fragment. Seriel deletions from both the 5’
and 3’ ends of the 3.8 kb fragment were created by PCR amplification and ligated into
either the Hindlll site or the Ndel site of the Hind/E GH vector (see Figure 3-1).
Reproduced with permission from Rogers et al. (2000), Biochem. J.. 347, 233-242.
© Biochemical Society.
5’ PCR Deletions

Figure 3-4. Northern analysis of transient transfections of the 3’ PCR deletions of the
3.8 kb enhancer fragment localized the inducible activity to the 464 bp/1.0 kb fragment.
Reproduced with permission from Rogers et al. (2000), Biochem. J„ 347, 233-242.
© Biochemical Society.

51
Hind/E
Hind/E Promoter plus 3 ’ Deletion Fragments
Orientation
LPS
hGH
MnSOD
Cathepsin B
Alone
464bp 1.0Kb
1.8Kb
2.9Kb 3.8Kb
fwd rev fwd rev
fwd rev
fwd rev fwd
- +
-+- + -+ - +
- + - +
-+-+- +
m m
m
â– 
nil
Í i
hi
*****
A
Hind/E Hind/E Promoter plus 3’ Deletion Fragments
Promoter
Alone 262bp 464bp 1.0Kb 464bp-1.0Kb
Orientation
Cathepsin B
fwd rev fwd rev fwd
rev fwd
rev
- + - + - + - + - + - +
- + - +
- +
â– 
â– 
K
â– 
S
•
V II
HI
MnSOD

Figure 3-5. Northern analysis of transient transfections of the 5’ PCR deletions of the 3.8
kb enhancer fragment localized the inducible activity to an area between the 455 bp and
the 227 bp fragments in the 3’ end of the 1.0 kb PCR fragment. Reproduced with
permission from Rogers et al. (2000), Biochem. J„ 347, 233-242. © Biochemical
Society.

53
Hina/ü Hind/E Promoter plus 5’ Fragments
Promoter
Alone
919 bp 765 bp
542 bp
455 bp
orientation
fwd rev fwd rev
fwd rev
fwd rev
LPS - +
i
+
i
+
i
+
i
+
- + - +
- + - +
hGH *«
s
8
8
8
* m
m m
Cathepsin B
>
1
1
A
Hind/E Hind/E Promoter plus 5 ’ Fragments
Promoter
Alone 455 bp 338 bp 227 bp
Orientation forward forward reverse forward reverse
B

54
The Enhancer Is Likely Composed of A Complex Set of Interacting Elements
To further localize the enhancer within the 3’ end of intron 2, additional deletion
constructs were created (Fig. 3-6). PCR amplification was used to generate a 260 bp
fragment spanning the region between the two 5’ deletions shown in Figure 3-3 (455 bp
and 227 bp) as well as two 143 bp fragments which overlap each other within the 260 bp
fragment (Fig. 3-6). The ability of these fragments to cause inducible expression was
evaluated by transient transfection and northern analysis. The 260 bp fragment
reproduced the enhancer activity seen with the larger, 919 bp fragment (Fig. 3-7). In
addition, response to all the inflammatory mediators (LPS, TNF-a, and IL-1(3) was
maintained. Interestingly, the two overlapping 143 bp fragments show reproducibly
diminished enhancer activity as compared to the 260 bp fragment (Fig. 3-7). These
results are consistent with the previous deletion analyses in Figure 3-5, which showed
partial enhancer activity in the 338 bp fragment compared to the 455 bp fragment and
loss of activity with the 227 bp fragment. Together the results summarized in Figures 3-5
and 3-7, demonstrate that the 260 bp fragment delineates the minimum functional
boundaries of the enhancer along with the complexity and interactive nature of this
important regulatory sequence, as displayed by the retention of enhancer activity in the
143 bp fragments relative to the promoter alone.
To further assess the complexity of the enhancer element, electrophoretic
mobility shift assays (EMSA) were performed with nuclear extracts from control and
treated (LPS, TNF-a, IL-1(3) cells. Figure 3D illustrates the different protein binding
patterns between treated and control nuclear extracts as well as the different patterns of
protein binding between the two functional DNA fragments of the enhancer element.

55
Exon 3 Exon 4
Intron 2
,
i
Intron 3
q
260 bp ♦
Enhancer Fragments
Used in EMSA
t
143 bp |
OO AA A I
, 143 bp ,
A^A Ad
Enhancer Fragments
Used in Transfections
100 bp
”ooAA
I 95 bp |
^ATA 1
I 103 bp
ToTo
Figure 3-6. Schematic of the enhancer region in intron 2. A 260 bp PCR fragment of the
enhancer region totally contained within intron 2 and two overlapping 143 bp PCR
fragments encompassing the 260 bp region were created and ligated into the Ndel site of
the Hind/E GH vector (see Fig. 3-1) for transient transfection in rat epithelial cells and
northern analysis. In addition to the 143 bp fragments, three other fragments (100, 95
and 103 bp) were created by PCR amplification for EMSA. Putative constitutive and
inducible protein-binding sites are illustrated by open circles and filled triangles,
respectively. Reproduced with permission from Rogers et al. (2000), Biochem. J„ 347,
233-242. © Biochemical Society.

Figure 3-7. A. Northern analysis of transient transfections of the 919 bp (see Fig. 3-6) or
the 260 bp fragment (both orientations) in the Hind/E GH vectors in control, LPS, TNF-
a, and IL-lp-stimulated rat pulmonary epithelial cells. B. Northern analysis of transient
transfections of the 260 bp fragment and 143 bp fragments in the Hind/E GH vectors in
control and LPS-stimulated rat pulmonary epithelial cells. Reproduced with permission
from Rogers et al. (2000), Biochem. J.. 347, 233-242. © Biochemical Society.

57
Hind/E
Promoter Hind/E Promoter
Alone plus Enhancer Fragment
Orientation
919 bp
Forward
260 bp
Forward
260 bp
Reverse
Stimulus
V ^ ^ -
V < sjW
hGH
"4H-
f
I
MM-
MM
Cathepsin B *-W* 'W W *^*^\^*
A
Hind/E
Promoter
Alone
Orientation
LPS - +
Hind/E Promoter
plus Enhancer Fragment
260 bp
143
bP
143 bp
fwd rev
fwd
rev
fwd rev
- + - +
- +
- +
- + - +
hGH • Ü '** M
Cathepsin B
B

Figure 3-8. EMSA of the two 143 bp, as well as, the 100, 95 and 103 bp fragments using
nuclear extracts from untreated cells and cells treated with LPS, TNF-a, and IL-ip.
Open circles refer to putative constitutive protein binding and filled triangles refer to
putative inducible protein binding. Reproduced with permission from Rogers et al.
(2000), Biochem. J„ 347, 233-242. © Biochemical Society.

59
DNA
Fragment
Stimulus
DNA
Fragment
Stimulus
5’ 143 bp
3’ 143 bp
3r
o°
100 bp
«O'
0°
cfv^W
£
N
95 bp
103 bp
N
s
H o
B
T T

60
Constitutive protein binding is observed in the 3’ 143 bp fragment, but several
inducible binding proteins can be appreciated in both fragments. In an attempt to further
localize the protein binding sites, smaller fragments of the involved region were
generated by PCR and evaluated by EMSA (Fig. 3-8). Once again, constitutive protein
binding was observed in two of the fragments (100 bp and 103 bp). However, as with the
143 bp fragment, inducible protein binding was also observed in two of the smaller
fragments (100 bp and 95 bp), most notably in the 95 bp fragment with a dramatic
difference in binding between control and stimulated nuclear extracts. Further
localization of protein binding was attempted with 50 bp and 30 bp fragments from this
region, however, I was unable to obtain protein-DNA interactions, which displayed any
stimulus-specific pattern (Rogers, data not shown). Unlike the results with the larger
fragments (Fig. 3-8 A and B), EMSA with the smaller fragments (50 bp and 30 bp)
showed only constitutive binding patterns. I believe that multiple protein-protein
interactions are likely a prerequisite for the stimulus-specific DNA binding pattern, thus
explaining the loss of stimulus-specific protein-DNA interaction in the smaller deletions
of this complex regulatory element.
The Inducible Enhancer Elements within Rat and Human MnSOD Can Act with a
Heterologous Promoter
To determine whether the MnSOD enhancer could function with a heterologous
promoter, the enhancer fragment was cloned in both orientations into the TKGH
expression vector. The herpes virus thymidine kinase (TK) promoter in this vector is a
200 bp minimal, TATA-containing promoter, quite dissimilar to the GC-rich, TATA- and
CAAT-less MnSOD promoter. Results of transient transfections and northern analysis

Figure 3-9. A. Interaction of the 6.1 kb MnSOD fragment with the heterologous herpes-
simplex TK promoter in the pTKGH expression vector. Expression vectors, pTKGH
alone and pTKGH containing the 6.1 kb enhancer (both orientations), were constructed
and a comparison of hGH mRNA levels in transiently transfected rat lung epithelial cells
treated with LPS, TNF-a, or IL-ip was made. Northern analysis was done using
radiolabeled probes from hGH, MnSOD and cathepsin B cDNAs. B. Comparison of the
rat and human enhancer regions in the pTKGH vector. A 553 bp region encompassing
the rat enhancer as well as the analogous region of the human MnSOD (466 bp fragment)
were amplified by PCR and cloned into the Hindlll site of the pTKGH vector. Northern
analysis of transient transfections in rat pulmonary epithelial cells shown here and
described in the Methods section. Reproduced with permission from Rogers et al.
(2000), Biochem. J„ 347,233-242. © Biochemical Society.

62
Thymidine Kinase Promoter
TK Promoter and 6.1 Kb Enhancer
TK Promoter (plus orientation)
Alone
forward
reverse
- LPSTNFILl
- LPSTNFILl
- LPSTNFILl
hGH
m-m
mmm
Cathepsin B
MnSOD
* * * *
Ml
â– Ml
IBM
A
Thymidine Kinase Promoter
466 bp Human Enhancer Fragment
TK Promoter plus
553 bp 466 bp
Rat Enhancer Human Enhancer
Stimulus - LPS TNF IL-1 - LPS TNF IL-1
hGH VP^W
B

63
(Fig. 3-9) demonstrated that the enhancer element could cooperate with the minimal TK
promoter and dramatically increase the transcriptional activity of the hGH reporter gene
in response to LPS, TNF-a, and IL-1(3. The element functioned equally well in both
orientations and interestingly was able to orchestrate reporter induction to as much as 45
fold above baseline. The ability of this element to enhance transcriptional activity of
both the endogenous and a heterologous promoter in an orientation-independent and
position-independent manner further qualifies it as an enhancer element.
Given the potency of this enhancer element, we compared the sequence of intron
2 in the rat gene with the corresponding region in the human MnSOD locus and found a
high level of homology. In order to evaluate the functional significance of this region, a
553 bp fragment of the rat enhancer and an analogous 466 bp region of intron 2 of human
MnSOD were inserted into Nde I site of the TKGH vector. The ability of the fragments
to cause inducible enhancer activity was assessed by transient transfections and northern
analysis. Both the rat and the human fragments caused essentially identical inducible
expression in response to LPS, TNF-a and IL-ip (Fig. 3-9), indicating that this region of
human intron 2 likely acts as an enhancer in the endogenous gene and that the enhancer
activity itself is well conserved between species. We have also demonstrated that the rat
and human enhancer can function equally as well in human cell lines (data not shown).
Evaluation of Promoter-Enhancer Interactions
We have demonstrated by in vivo footprinting that the MnSOD promoter contains
10 potential basal protein-binding sites (Kuo et al., 1999). These sites are illustrated in
Figure 3-10 relative to the restriction sites that were employed for the promoter deletion
analysis. To define the areas within the promoter required for interaction with the

64
0= protein binding site by in vivo footprinting
Hind III
Hind/E
-2500
Enhanced G’s by
in vivo footprinting
GG
Si
ri I Sac
ooooo
II N<
OOOOO
le I Ea
r*
gi
-2!
35 -15
1
3 +:
52
Exon 1
Sfi/E
Sac2/E
Nae/E
Nde I
Deletions of MnSOD Promoter
human growth hormone gene
piSGH
919 bp Rat Enhancer
Fragment
Figure 3-10. MnSOD promoter deletions summarizing the protein binding sites found by
in vitro footprinting (Kuo et al., 1999). The 919 bp fragment encompassing the entire
enhancer was ligated into the Ndel site of the hGH vector with the respective MnSOD
promoter deletions. Reproduced with permission from Rogers et al. (2000), Biochem. J..
347, 233-242. © Biochemical Society.

Figure 3-11. A. Northern analysis following transient transfections of promoter deletion
constructucts (Hind/E and Sfi/E containing the 919 bp enhancer fragment) into rat
pulmonary epithelial cells. B. Northern analysis following transient transfections of
promoter deletion constructs (Hind/E, Sac/E, and Nae/E containing the 919 bp enhancer
fragment) into rat pulmonary epithelial cells. Reproduced with permission from Rogers
et al. (2000), Biochem, J.. 347, 233-242. © Biochemical Society.

66
919 bp Enhancer Fragment
plus Promoter Deletion
Promoter
Fragment Hind/E Sfi/E Hind/E Sfi/E
Enhancer Orientation forward reverse forward reverse
LPS - +- +- +- +- + - +
hGH
Cathepsin B
Hind/E
Promoter
Alone
919 bp Enhancer
plus Promoter Deletion
Hind/E Sac/E Nae/E
LPS- + - +- + - +
hGH
Cathepsin B
B

Figure 3-12. A. Schematic of the promoter-less human growth hormone vector (p<))GH)
and the position of the human 466 bp enhancer fragment. Northern analysis of the 466
bp human enhancer in p and treated (LPS, TNF-a, and IL-1|3) rat pulmonary epithelial cells. B. Schematic of the
promoter-less hGH vector (p(|)GH) and the position of the 260, 553, or 746 bp enhancer
fragments. Northern analysis of the rat enhancer fragments (260, 553, and 746 bp) in
p<()GH constructs transiently transfected into control and treated (LPS, TNF-a, and IL-ip)
rat pulmonary epithelial cells. Reproduced with permission from Rogers et al. (2000),
Biochem, J.. 347,233-242. © Biochemical Society.

68
466 bp Human Prohancer
human growth hormone gene
466 bp Human MnSOD 466 bp Human MnSOD
Prohancer Fragment Prohancer Fragment
in p&GH in pTKGH
Stimulus - LPS TNF IL-1 - LPS TNF IL-1
*»# (M
hGH
Cathepsin B
746, 553, or 260 bp Rat Prohancer
human growth hormone gene
Prohancer
Fragment
Rat Prohancer Fragments in p^SGH
746 bp 553 bp
260 bp
Orientation 5’^ 3’ 3’^ 5’ 5’^ 3’ 3’^ 5’ 3’^ 5’
Stimulus - LPS TNF IL-1 - LPS TNF IL-1 - LPS TNF IL-1 - LPS TNF IL-1 - LPS TNF IL-1

69
enhancer element, the previous promoter deletion constructs (Kuo et al., 1999) were
coupled with a 919 bp enhancer fragment (Fig. 3-10). Transient transfection and
northern analysis were used to evaluate inducible activity for these vector constructs. Of
interest, the first five binding sites could be deleted without any detectable decrease in
inducible activity (Fig. 3-11A). It was not until the remaining five basal binding sites
were eliminated that the level of induction decreased (Fig. 3-1 IB) with almost complete
loss of basal activity. Interestingly, LPS-inducible transcription could still occur when all
promoter protein-binding sites were deleted, but only when the vector construct contained
the enhancer fragment (Fig. 3-1 IB). However, in the absence of the enhancer element,
deletion of the same promoter region, (construct Nae/E, 18), eliminated any transcription,
thus, indicating that the enhancer element contained DNA sequence potentially capable
of independently promoting transcription in a stimulus-regulated manner.
The Rat and Human Enhancer Elements Contain Inducible Promoter Activity
With the results of the previous experiment (Figure 3-11), we postulated that the
enhancer element might exhibit stimulus-dependent promoter activity in the absence of a
true promoter. Since the Nae/E GH construct did contain 77 bp from the 5’ flanking
region of the MnSOD promoter, the rat and the human enhancer elements were inserted
into the promoter-less hGH vector (p<|)GH) (Figure 3-12A). Figure 3-12A shows the
results of the 466 bp human MnSOD enhancer fragment in the presence and absence of
the TK promoter. Inducible transcription was observed with LPS, TNF-a and IL-ip, but
at lower levels than when the fragment was inserted into the pTKGH vector.
Interestingly, two transcripts, one the correct size and one approximately 200 to 300 bp
larger, were seen when the enhancer fragment acted as its own promoter. When the 553

70
bp and 746 bp rat enhancer fragments were tested in the promoter-less hGH vector
(p<|>GH), similar results to the human fragment were obtained, in that, two different-sized
transcripts were observed (Figure 3-12A and B). Of note, however, when either the 553
bp or the 746 bp enhancer fragment was inserted into p<|)GH in the 3’ to 5’ orientation,
the correct-sized transcript predominated. This result would indicate that the enhancer
can indeed act as a promoter, but its orientation and position relative to the start of
transcription are important. To determine if the preceding hypothesis was correct, p<|>GH
vector constructs containing the 260 bp enhancer fragment were created. As can be seen
in Figure 6B, when the 260 bp enhancer fragment acting as a promoter was inserted into
the p<|)GH vector in the 3’ to 5’ orientation, a single stimulus-responsive transcript
resulted.
Discussion
As a cellular antioxidant, mitochondrial MnSOD has been consistently shown to
be an effective cytoprotective enzyme. MnSOD expression is highly regulated in
response to a variety of pro-inflammatory mediators in many cell types. In rat lung
epithelial cells, the inflammatory mediators, LPS, TNF-a and IL-ip, each cause MnSOD
steady-state mRNA levels to increase 10 to 20 fold, which has been shown in nuclear
run-on studies (Hsu, 1993) to be partly due to increased transcription of the gene. A
survey of the entire MnSOD locus for sites of possible protein-DNA interaction using
DNase I hypersensitive site analysis revealed increased nuclease accessibility at sites in
the 5' proximal promoter region and 6 other sites located within the gene (Kuo et al.,
1999). The present experiments further expand our understanding of the molecular

71
mechanisms regulating basal and induced expression of MnSOD by identifying an
enhancer region within the rat and human MnSOD.
The 5' flanking sequence of MnSOD is characterized by a GC-rich island, lacking
a TATA- and CAAT-box for initiation of transcription. In vivo footprinting studies have
defined protein binding sites for 10 basal transciption factors within 500 bp of the
transcriptional start site (Kuo et al., 1999). Promoter deletion analysis identified essential
cw-acting sequences located within 157 bp of the transcriptional start site (Kuo et al.,
1999). This region of the promoter includes 5 of the basal protein binding sites and is
capable of supporting basal and stimulated (LPS, TNF-a and IL-ip) expression.
However, protein and mRNA levels of the hGH reporter were only induced 2 to 3 fold in
transient transfection studies using vectors containing from 4.5 to 0.16 kb of the MnSOD
promoter region alone (Kuo et al., 1999). Examination of the MnSOD promoter for
known transcription factor consensus sequences by computer analysis revealed an NF-kB
sequence at -353 as well as Spl and gut-enriched Kriippel-like factor (GKLF) (Shields
and Yang, 1998; Zhang et al., 1998) sites corresponding to binding sites I-V. As
previously shown, the NF-kB site is not occupied based on in vivo footprinting data and
is not important for enhancer function (Fig. 3-11A). On the other hand guanine contacts
from in vitro footprinting with purified Spl and GKLF strongly implicates these proteins
with the in vivo contacts observed at sites I-V. However, previous data (Kuo et al., 1999)
and Figure 3-11A seem to indicate that based on transient transfection studies the
potential Spl and GKLF sites (I-V) are not essential for basal or enhancer-dependent
gene expression (using LPS, TNF-a, and IL-ip as stimulants). These data may be
reconciled by appreciating that constitutive Spl and/or GKLF binding to sites I-V might

72
be necessary for other stimuli known to induce INF-y (Harris et al., 1991; Valentine and
Nick, 1992), phorbol ester (Fujii and Taniguchi, 1991) or inhibit (glucocorticoids
(Dougall and Nick, 1991)) MnSOD expression. Alternatively, it should be noted that the
functional data was obtained by transient transfection of plasmid reporter gene DNA into
mammalian cells. Consequently, it is very possible that the plasmid DNA does not form
proper chromatin structures following transfection. Appropriate chromatin structure is
likely crucial for the correct alignment of DNA sequence important for the
promoter/enhancer interactions. Therefore, we must consider this as a possible
explanation for the data shown in Figure 3-1 IB. The data in Figure 3-1 IB does,
however, strongly implicate the functional importance of binding sites VI-X to both basal
and enhancer/stimulus-specific expression. The pNae/Eag GH vector was not sufficient
to drive either basal or stimulated expression (Kuo et al., 1999), suggesting that a
minimal promoter sequence for transcriptional initiation was no longer present.
The observed induction of the reporter gene from the 5' MnSOD promoter was
much lower than endogenous MnSOD expression following treatment with inflammatory
mediators (Kuo et al., 1999). These data and the presence of DNase I hypersensitive sites
within the gene suggested that regulatory elements might exist outside the 5' flanking
sequence. Results from transfections with vectors combining both the 5’ promoter region
and the internal 6.1 kb fragment (containing the remainder of the DNase I hypersensitive
sites) confirmed that genomic sequences 3' to the transcriptional start site contain
enhancer activity. Most importantly, this region contains adequate enhancer activity to
mimic endogenous, stimulus-dependent transcription levels. Deletion analysis of this
region localized this activity to a 260 bp area within intron 2, which contains DNase I

73
hypersensitive site 2. When this 260 bp region is divided into two 143 bp fragments, we
found that each of these fragments independently retained inducible activity, albeit at a
lower level. Moreover, based on EMSA these same 143 bp fragments were able to bind
both constitutive nuclear factors as well as a number of factors specific to extracts from
induced cells. However, attempts to further delineate the enhancer by EMSA using DNA
fragments less than 50 bp (Rogers, unpublished data) led to the elimination of stimulus-
specific in vitro binding, further demonstrating the complexity of this enhancer and
implying that protein-protein interactions may be critical to the formation of specific
protein-DNA complexes between the promoter and enhancer. Therefore, we believe that
this enhancer is composed of a set of complex, interacting elements involved in the
inducible expression of MnSOD. Contrary to the published characterization of the
murine gene (Jones et al., 1995 and 1997), our data would indicate that separate elements
within this enhancer region retain an ability to induce MnSOD transcriptional activity, but
that small (25-30 bp) individual elements cannot act independently to confer the same
inducible levels seen in the endogenous gene.
Our results demonstrate that this enhancer element requires a portion of the
MnSOD promoter to achieve levels of induction analogous to steady-state northern
analysis. Using portions of the promoter coupled with the enhancer, we demonstrated the
requirement for sequences from -154 to the start of transcription, which include protein¬
binding sites VI-X defined by in vivo footprinting (Kuo et al., 1999). Given the
functional connection between the enhancer and the MnSOD promoter, we postulate that
the enhancer may interact with the promoter through a mechanism involving DNA
bending (Ptashne, 1986). As support for this hypothesis, we have performed co-

74
transfection experiments with the promoter and enhancer on separate plasmids and found
under these conditions that inducible transcription could not be achieved (Rogers, data
not shown). This substantiates the argument that the MnSOD promoter and enhancer
must reside within a contiguous region of DNA. Therefore regulatory elements most
likely physically interact through DNA bending (Ptashne, 1986) and possibly involving
an alteration in chromatin structure in the promoter as defined by Kuo et al., 1999.
Of particular interest is the existence of a homologous functional enhancer
element in human MnSOD (Fig. 3-10), which responds to the same inflammatory
mediators as the rat enhancer in both rat and human cells (data not shown). In addition,
another unique characteristic of the rat and human enhancer element is its ability to drive
transcription independent of a classical promoter (Figures 3-12A and B). As an
independent promoter/regulatory element, this sequence has the capacity to promote
stimulus-dependent transcription with negligible basal levels. Previous work in our
laboratory explored the possibility of an alternative promoter or differential mRNA
splicing as a cause for the multiple transcripts in the rat. Using primer extension and 32P-
labeled cDNA and genomic fragments as hybridization probes, it was determined that
alternative polyadenylation was the likely cause for the multiple transcripts seen in the rat
MnSOD (Hurt et al., 1992). Understanding the regulation of this enhancer region will be
important since it seems to be exquisitely responsive to acute cytokine mediators and, if
similar motifs are found in other genes, may exist as a regulatory unit that serves as a
general inflammatory response element. Current efforts are underway to further
characterize the enhancer by DMS in vivo footprinting and mutagenesis for functional
transfection studies.

CHAPTER 4
IN VIVO FOOTPRINTING AND MUTAGENESIS OF THE RAT MANGANESE
SUPEROXIDE DISMUTASE ENHANCER
Introduction
Gene activation in response to extracellular signals, infection by pathogens, or
environmental stresses requires highly integrated signal transduction pathways that direct
the transcriptional machinery to the appropriate set of genes. A crucial issue in
understanding inducible gene regulation is how a relatively small number of different
transcription factors is used to achieve the high level of specificity required to control
complex patterns of gene expression (Maniatis et al., 1987; McKnight and Yamamoto,
1992). The answer probably lies in the correct combination of transcription factors
aligning on the regulatory region to cause gene activation. Most genes are regulated by
multiple transcriptional activator proteins, each of which plays a role in controlling the
transcription of a variety of genes with different expression patterns. The expression of a
given gene depends, however, on the simultaneous interaction of a specific combination
of regulatory proteins with the control DNA elements. Indeed, most transcription
enhancers contain distinct sets of transcription factor-binding sites, and variations in the
arrangement of binding sites provide the potential to create unique nucleoprotein
complexes. Cooperative interactions between the proteins in these complexes can lead to
a high level of specificity in gene activation and to a high level of transcriptional synergy.
75

76
Perhaps one of the best examples of combinatorial interactions among distinct
regulatory elements is provided by the interferon-p (IFNP) gene (Maniatis et al., 1992;
Tijan and Maniatis, 1994). The IFNp gene is activated in response to virus infection, and
the transcription factors required for activating the IFNP gene have been identified.
Detailed studies of this promoter revealed a highly compact and remarkably complex
organization of regulatory sequences containing four positive regulatory domains. None
of these domains function on their own, but two or more copies of any one of them can
act as a virus-inducible enhancer. However, the synthetic enhancers display varying
levels of basal activity, are less inducible than a natural enhancer, and can respond to
inducers other than virus infection. Thus, the specificity and activity of the natural intact
enhancer are distinct from those of the independent enhancer elements. The activation of
at least some natural enhancers appears to result from the precise arrangement of
transcription factors on DNA, resulting in the formation of a highly specific three-
dimensional nucleo-protein complex (stereospecific enhancer complex; Grosschedl,
1995).
Transcriptional activator proteins have been shown to synergize with each other
in vitro using synthetic enhancers containing multiple activator binding sites (McKnight
and Yamamoto, 1992; Tijian and Maniatis, 1994). In some cases, the observed
transcriptional synergy could be explained, at least in part, by cooperative binding of the
activators to their sites. However, in other cases, the transcriptional synergy could be
observed at concentrations of activator in which the binding sites are fully occupied
(Carey et al., 1990; Lin et al., 1990). The most straightforward explanation for this
synergy is that activators recruit the general transcription apparatus to nearby promoters,

77
and the transcriptional synergy is a consequence of multiple interactions between the
activators and components of the transcription apparatus (Ptashne and Gann, 1997). This
recruitment could involve the stepwise association of general transcription factors with
the promoter (Orphanides et al., 1996; Roeder, 1996), interactions between activators and
specific TATA box binding protein (TBP) associated factors (or TAFs) in the TFIID
complex (Sauer et al., 1995), or interactions between activators and components of the
RNA polymerase II holoenzyme (Koleske and Young, 1995). The best example of a
functional enhancer where the assembly of a protein-DNA complex is required for the
inducible transcription seen at the endogenous levels is the IFNp gene enhancer (Kim and
Maniatis, 1997).
In this study, I have used DMS in vivo footprinting to identify potential protein-
DNA interactions in the MnSOD enhancer element previously delineated by deletion
analysis and transient transfections. In addition, after identification of putative binding
sites, mutagenesis of the potential binding sites was used to verify whether the DNA
elements were crucial for the inducible MnSOD enhancer in a functional transient
transfection assay system.
Results
Multiple Potential Protein Binding Sites Exist within the MnSOD Enhancer
Using the technique of dimethyl sulfate (DMS) in vivo footprinting as the
molecular probe coupled with ligation-mediated polymerase chain reaction (LMPCR), it
is possible to identify cw-acting DNA elements at single nucleotide resolution and thus
display the in vivo protein-DNA contacts. As a small hydrophobic molecule, the

78
chemical DMS can enter intact cells and react predominantly by methylating the N-7
atom of guanine and, to a lesser extent, the N-3 atom of adenine in duplexed DNA.
Amino acid side chains of trans-acting factors, which contact guanine residues, can
protect these bases from methylation by DMS. Alternatively, amino acid side chains can
create a hydrophobic pocket around specific guanine residues, which increases the DMS
solubility and results in enhanced reactivity. Ultimately, protein side chains produce a
footprint composed of protections and/or enhancements which appear as diminished or
more intense bands as compared to the corresponding band in the naked DNA guanine
ladder on the final sequencing gel autoradiograph (Nick and Gilbert, 1985).
Previous work from this laboratory has established the timing of experimental
conditions when cell cultures are treated with inflammatory stimuli prior to DMS (Kuo,
1998). Kinetics of transcription factor binding is stable and comparable between control
and stimulus-treated samples. Those experiments demonstrated that protein-DNA
contacts were detectable as early as 0.5 hr and as late as 8 hr after addition of stimulus.
For the experiments in this thesis, time points of 2 and 4 hrs were chosen for DMS
treatment after addition of stimulus (LPS, TNF-a, IL-ip).
Illustrated in Figure 4-1 is an autoradiograph of DMS in vivo footprinting and
LMPCR results of both control and treated samples. Several guanine and adenine
residues exhibited altered DMS reactivity, which appeared as diminished or enhanced
hybidization signals relative to in vitro DMS-treated DNA lanes. The existence of
several potential protein binding sites are postulated to account for patterns uncovered by
in vivo footprinting. Figure 4-2 summarizes the putative protein-DNA contacts

Figure 4-1. Autoradiograph of DMS in vivo footprinting of enhancer region of MnSOD.
Lanes are as follows: G, naked DNA from L2 cells treated with DMS; C, control L2 cells
treated in vivo with DMS; T, TNF-a-treated L2 cells for 2 hours prior to in vivo
treatment with DMS; I, IL-1 P-treated L2 cells for 2 hours prior to in vivo treatment with
DMS. Open triangles refer to inducible protected sites; and closed triangles refer to
inducible enhanced sites. Site numbers 1-4 refer to regions where putative protein¬
binding may occur on the enhancer element. Sequence refers to bottom strand.

Site 2 Site 4
80
t'
8',
6
A
A
Ú
Â¥
Â¥
J
i
*S
Â¥
Â¥
GGCCTTI I
..«¡u
â– â– â– f
M •
C /
,c /
X/
f»* *•*
— -
â–² As
n x
A
aT
Ag
Ag /’
. T /
â–² A /
â–²a/
: ..*3
i*PIC=ll
^ â– fSE'*
'A A
' T
/ GA
T A
GA
A
T
T
T
G
C
T
T
A
T
T
GA
C
A
§£
T
A
v A
s A
' AA
"it
T
T
Ga
ai
c
â– 'sAA
en
o>
•—

Figure 4-2. Sequence comparison of rat, human and mouse MnSOD enhancer regions of
intron 2. Open triangles refer to inducible protected sites; and closed triangles refer to
inducible enhanced sites. Site numbers 1-4 refer to regions where putative protein¬
binding may occur on the enhancer element of the rat MnSOD gene. C/EBP-2 refers to
putative transcription factor binding site in the mouse MnSOD enhancer by consensus
sequence analysis and DMS in vivo footprinting. Arrows with numbers refer to
boundaries of smallest regions of the rat MnSOD enhancer tested in transient transfection
assays.

RAT 4190
HUM 2577
MUS 2119
RAT 4251
HUM 2657
MUS 2283
RAT 4325
HUM 2711
MUS 2259
1 Site 1
'«31A AA
CCCCGTAGATCACCTCTTCACACCATAAAATCGTATCAACACATTCACCGGGTTGGTTCTC
I 1111111111111 II I MINI III I MINI III I
CTCCGTAGATCACCTTTTTACGTCATAAAGTCGGACTAACACAAACTTCATTTACTAATTTTCTC
I I I I I I I I I I I I I I II I I I I I I I I I I I I I I I I I I III I
CCCCGTAGATCACCTCTTCATATCATAAAGTTGTATTAACACATTCACCGGTTAGGTTCTCTC
Site 2
Site 3
UA A 1U
AA A
AAA
TTCCTTTAATGGTGTAAGACCTTTAAAATGAACGTTATTCGTTTAGTGTATTAGCACTTATGCCCTTCTCTGAG
I llllllllllllllll MINIM || | || I
I I I I II
CTCCTTCAATGGTGTAAGACCTTCTAAATGAACTCTGTCTGCTTGGAACTTAATGCCCTTTTCCGGGGC.
I llllllllllllllll llllllll II I II I
I I II I I
CCTTTATAATGGTGTAAGACCTTTAAAATGAACGTTATTCGTTTAGTGTGTTTAGAATTTATGCCCTTCTCTGAC
.4374
Site 4
*4348
AAA A
ACTAAATCCTTTACTGTCTAAACCCTTCCGACACCATTATCACTCATCCCCTTTTCGGGTCAACCCTTTAGC
mu mill ii mmii m i
mm i mum mi
ACTAAATCCTTTATTGTTTAAACCCTTTGTACATTACCCCTCTCTGACCCCTTATGGGGTCAACACTTTCAT
him mm n n him in i
llllllll llllllll mi
CCTAAAACCTTTAACGTCTAGACCCTCCTAACACCATTATCCTTCGTCCCCTTATCGGGTCAACCCTTTCGT
C/EBP-2
RAT 4397 AAAGGAGATTCCACTGTAGACTGTTGAAAGGAGAATTACAACATTTTTGTACCA
Mill Mill I II I II I I II I I I
HUM 2783 GAAGGACATTCCGTTGTAGACTGTGGTCCTTGGAAAGAGAAGTCATAAAATTTT
Mill Mill I I I I I I I II I II
MUS 2343 AAAGGAAATTCCACTGTAGACCGTAGATCTTTTGAAAGAAGAATTACAACAGGT
$4491
RAT 4451 CTAAAGTTGGGAAGGCACCTCTGTCTCGACATAAACAAATCACTTACGAC
I I
HUM 2837 TGTTGAATTAAAGTCAGGAAATGAACACCTTAGTCTCGGAATGAATACAT
I I
CTGTAGAACTAACATTAGGAAGACACCTCGGTCTCGAAACGAAATTCCAC
00
to
MUS 2397

83
being numbered sites 1 through site 4 over a region of approximately 150 to 200 bp.
Mutagenesis of Putative DNA Binding Sites Alters Inducible MnSOD Expression
Knowing the results of the DMS in vivo footprinting, mutagenesis of the
enhanced or protected nucleotides within the MnSOD enhancer region was performed
using PCR amplification. Mutations achieved were verified by sequencing. Figure 4-2
shows a comparison between the rat, human and murine sequences in intron 2 of each
gene. The sites that were shown to be enhanced or protected in the rat intron 2 enhancer
region are depicted as well as the in vivo footprinting sites found in the murine intron 2
enhancer region (Jones et al., 1997). The mutations within each of the 4 sites that were
created in the hGH reporter vectors used in the mutagenesis studies are shown in figure
4-3. Figures 4-4 and 4-5 demonstrate the results of northern analysis of transient
transfections of L2 cells with the wild type (WT), control, and mutated binding sites 1-4.
The results in both Figures 4-4 and 4-5 would suggest that the mutations made in site 2
seem to affect the level of inducible transcription to extent much greater than the other
site mutations. As way of control, the mutations made in the consensus sequence of
C/EBP, referred to as C/EBP-2, does not seem to change the level of inducible
expression. Also mutagenesis of the individual sites in Site 4 (4a and 4b) did not
influence the level of inducible transcription until the two site mutations were combined
into one vector construct.

84
Site 1 Site 2
MUT CACATTCACC TTGTTTTTTC TCTTCCTTTA ATTTTTTAAG AAATTTAAAA
00 DO DO 0 00
WT CACATTCACC GGGTTGGTTC TCTTCCTTTA ATGGTGTAAG ACCTTTAAAA
Site 3
MUT TTAACTTTAT TCTTTTATTT TATTATCACT TATGCCCTTC TCTGAGACTA
D Q D D D fl
WT TGAACGTTAT TCGTTTAGTG TATTAGCACT TATGCCCTTC TCTGAGACTA
C/EBP-2 Site 4a
MUT AATCCTTTAC TGTCTAAACC CTTCCGAAAA AATTATCACT CATCAAATTT
D D D mo
WT AATCCTTTAC TGTCTAAACC CTTCCGACAC CATTATCACT CATCCCCTTT
Site 4B
MUT TCTTTTCAAC CCTTTCTCAA AGGAGATTCC ACTGTAGACT GTTGAAAGGA
000 00
WT TCGGGTCAAC CCTTTAGCAA AGGAGATTCC ACTGTAGACT GTTGAAAGGA
Figure 4-3. The sequence of the rat MnSOD intronic enhancer region displaying the
putative protein-DNA binding sites and the mutations made in each site for construction
of hGH reporter vectors and transient transfection into L2 pulmonary epithelial cells.
Rectangles mark the mutated base pairs with the sequence for the wild type (WT)
MnSOD enhancer on the bottom and the mutated sequence on top.

Figure 4-4. Northern analysis of transient transfections of wild-type (WT) and mutated
binding site enhancer elements in hGH vector. WT refers to the unchanged rat 360 bp
enhancer fragment, control refers to the mutated C/EBP-2 site in the 360 bp fragment,
Site 2 refers to the Site 2 mutation in the 360 bp fragment, Site 4a and 4b refer to the site
4a and 4b mutations in the 360 bp enhancer fragment. The upper panel shows cells that
were stimulated with TNF-a for 8 hours prior to isolation of RNA and the lower panel
shows cells that were stimulated with IL-1 (3 for 8 hours prior to RNA isolation. In all
vectors in both panels the enhancer fragment was in a 5’-3’ orientation. hGH refers to
the reporter gene product in each vector. Cathepsin B was used as a RNA loading
control.

86
Site Mutations
WT
TNF-a - +
xS°
C*x
&
&
-+-+-+- +
hGH
Cathepsin B
Site Mutations
WT
C0>
&
IL-lp -+-+-+-+- +
hGH mM
Cathepsin B

Figure 4-5. Northern analysis of transient transfections of wild-type (WT) and mutated
binding site enhancer elements in hGH vector. WT refers to the unchanged rat 360 bp
enhancer fragment, Site 2 refers to the Site 2 mutation in the 360 bp fragment, Site 4
refers to the combination of mutations in sites 4a and 4b in the 360 bp enhancer
fragment. The upper panel shows cells that were stimulated with lipopolysacharride
(LPS) for 8 hours prior to isolation of RNA. The middle panel shows cells that were
stimulated with TNF-a for 8 hours prior to isolation of RNA. The lower panel shows
cells that were stimulated with IL-ip for 8 hours prior to RNA isolation. hGH refers to
the reporter gene product in each vector.

88
5’-3’ Orientation
3’-5’ Orientation
WT Site 2
Site 4
WT Site 2 Site 4
LPS
- + - +
- +
i
1 +
i
| +
i
+
hGH
*•
8
t
K
5’-3’ Orientation
3’-5’
Orientation
WT Site 2 Site 4
WT
Site 2 Site 4
TNF-a
-+-+-+
- +
- + - +
hGH
Mi qm
) ■ • Mi mm
5’-3’ Orientation
3’-5’ Orientation
WT Site 2
Site 4
WT Site 2 Site 4
IL-lp
- + - +
- +
-+-+-+
hGH
Mi #- *
SINS ims
* MB

89
Discussion
A number of eukaryotic genes with complex enhancer elements exist in the
literature, such as (3-interferon (Kim and Maniatis, 1997, Merika et al., 1998), T-cell
receptor a (Giese et al., 1995; Mayall et al., 1997), interleukin-4 (Henkel and Brown,
1994; Ranganath et al., 1998), and urokinase (De Cesare et al., 1995; De Cesare et al.,
1997). Within the cell, multiple factors not only participate in the initiation of
transcription but also share an active role in the regulation of gene expression. In
addition, from the data available on eukaryotic transcription, it is clear that the
mechanisms by which transcription is regulated are tremendously complex.
The data shown here in this chapter would agree with findings of other
investigators regarding the complex transcription factor binding patterns in inducible
enhancer elements. Perhaps the most studied eukaryotic enhancer element, the 13-
interferon enhancer, demonstrates the combinatorial complexity of inducible enhancers.
In vitro, it requires the binding of five different DNA binding proteins in order to
simulate the in vivo levels of inducible gene expression. The MnSOD enhancer element
likely requires a similar complex combination of DNA binding proteins to simulate the in
vivo levels of inducible expression. The in vivo footprinting data would suggest that
multiple proteins bind within the enhancer element (Figure 4-1). From the enhancer
mutagenesis experiments, I would propose that interaction of the enhancer element with
multiple DNA binding proteins is necessary to achieve the inducible expression seen in
vivo. Mutations created within the enhancer at site 2 appear to disrupt the inducible
levels of transcription as compared to the wild-type (WT) vector (Figures 4-4 and 4-5).

90
A protein binding at the putative site 2 may be found in further experiments to be a
crucial member of the protein DNA enhancer complex. Also, when mutations were made
individually at sites 4a and 4b, no significant reduction in inducible gene expression was
seen (Figure 4-4). When the mutated sites were combined in a single vector, a reduction
in the amount of inducible expression was observed, not unlike that seen in the deletion
experiments of chapter 3 (Figures 3-5B and 3-7B). So there may be another putative
protein that is integral to the inducible activity of the enhancer. This additional data lends
further support for the hypothesis that this is a complex enhancer with interacting
elements.
Many more experiments will need to be done with this regulatory element. More
in vivo footprinting data, will be necessary to get a clear picture of the proteins binding to
both strands of the enhancer element. Perhaps a different technique of footprinting, such
as DNase I footprinting, may delineate the protein boundaries better than DMS
footprinting since the GC ratio of this region of the MnSOD gene is only about 40%
compared to the promoter which is over 70% GC-rich. Further combinations of
mutagenesis combined with transient transfections may answer the questions regarding
the cooperativity of the proteins binding in this regulatory region. Perhaps, rather than
mutagenesis, simply altering the phasing by inserting DNA (6 bp) in key regions between
putative binding sites may be enough to disrupt the protein complex formation. Finally,
cloning the factors binding to the important putative binding sites within the enhancer
will be necessary to allow evaluation of the inducible transcriptional regulation in an in
vitro system.

CHAPTER 5
REACTIVE OXYGEN SPECIES AND MITOCHONDRIA-TO-NUCLEUS
SIGNALING
Introduction
Manganese superoxide dismutase (MnSOD), a vital anti-oxidant enzyme
localized to the mitochondrial matrix, catalyzes the dismutation of superoxide anions
(O2') to hydrogen peroxide (H2O2). In aerobic cells, the mitochondrial electron transport
chain is probably the most abundant source of 02'-. At atmospheric oxygen
concentrations, it is estimated that between 1 to 3% of the O2 reduced in the
mitochondrial electron transport chain during ATP production may form 02*-(Chance et
al., 1979; Beyer, 1990; Nohl et al., 1996). Although C^'-and other reactive oxygen
species (ROS) are byproducts of normal respiration, imbalance or loss of cellular
homeostasis results in oxidative stress, causing damage to cellular components - lipid
membranes, proteins, and nucleic acids (Freeman and Crapo, 1982; Fridovich, 1986).
MnSOD acts as the first line of cellular defense to detoxify these 02'-(Fridovich, 1975).
Various inflammatory mediators (TNF-a, IL-1 P, IL-6 and LPS) in multiple tissues have
been demonstrated to elicit dramatic elevations of both the messenger RNA and protein
levels of MnSOD (Visner et al., 1990; Dougall and Nick, 1991; Visner et al., 1991;
Valentine and Nick, 1992; Visner et al., 1992; Eastgate et al., 1993). The increased
levels of MnSOD have been shown to be cytoprotective (Wong and Goeddel, 1988;
Wong et al., 1989; Warner et al., 1991; Wispe et al., 1992). However, the signaling
91

92
pathways responsible for MnSOD expression are numerous and are still far from being
fully elucidated.
Elaborate intercommunications take place between the nucleus and mitochondria
coordinating not only mitochondrial gene expression and genome maintenance, but also
nuclear gene expression (Poyton and McEwen, 1996). The classic view has been that
mitochondria simply function as organelles responding to changes in energy demand.
However, recent data would suggest a more complex picture where mitochondria also
function as active signaling organelles in a number of important intracellular pathways
(Surpin and Chory, 1997; Ichas and Mazat, 1998; Mignotte and Vayssiere, 1998; Chandel
and Schumacker, 1999). An example of such a complex signaling pathway would be the
role that mitochondria play in regulating cellular apoptosis initiated by TNF-a at
membrane receptors (Duriez et al., 2000).
It is well documented that TNF-a binding to membrane receptors triggers
complex signal transduction cascades (Feng et al., 1995; Warner et al., 1996; De
Keulenaer et al., 2000), some of which result in excess ROS production in the
mitochondria (Schulze-Osthoff, 1992; Schulze-Osthoff, 1993). The cytocidal-effect of
these ROS is either direct or necessary for downstream signaling events leading to cell
death. The crucial toxic role of ROS was demonstrated by the inhibition of
mitochondrial electron transport at specific sites, which differentially interferes with
TNF-a-mediated cytotoxicity (Schulze-Osthoff, 1992) and by the correlation between
sensitivity to TNF-a cytotoxicity and mitochondrial activity in the cell (Schulze-Osthoff,
1993). Pharmacological experiments revealed that the mitochondrial respiratory chain is
the major source of TNF-a-induced ROS (Schulze-Osthoff, 1992; Schulze-Osthoff,

93
1993; Goossens et al., 1996). Antioxidants inhibit various actions of TNF-a
(transcription factor activation, gene expression, and cytotoxicity), and exogenously
added ROS mimic its biological action (Kinnula et al., 1998; Arai et al., 1998; Gottlieb et
al., 2000). Our data would agree with the literature regarding ROS and TNF-a.
Since the superoxide radical, a central ROS, is the substrate for MnSOD, it would
lead to reason that the level of intracellular ROS might regulate MnSOD transcription. In
this dissertation, I show that inhibition of mitochondrial electron transport results in the
loss of TNF-a-stimulated MnSOD expression, most likely due to the loss of
mitochondria-to-nucleus signaling with ROS acting as the second-messenger in the signal
transduction pathway. In addition, I demonstrate that although inflammatory mediators
(TNF-a, IL-lp, and LPS) may elicit similar inducible mRNA levels of MnSOD, the
signaling pathways leading to this expression are very different.
Results
Mitochondrial Electron Transport Inhibitors Modulate TNF-a-Induced Expression
of MnSOD in Pulmonary Epithelial Cells.
Previous analysis of the effects of mitochondrial electron transport chain
inhibitors showed that, depending on the inhibitor’s site of action, the cytotoxicity of
TNF-a was either increased or decreased (Schulze-Osthoff, 1992). A schematic of the
mitochondrial respiratory chain is shown in Fig. 5-1 A. Based on earlier experiments
demonstrating stimulated expression of MnSOD mRNA following treatment of a rat
pulmonary epithelial-like cell line (L2 cells) with inflammatory mediators (Visner et al.,
1990; Visner et al., 1991), I initiated studies to evaluate the effect of TNF-a on MnSOD
expression in cells also treated with mitochondrial respiratory chain inhibitors.

Figure 5-1. A. Simplified scheme of the respiratory chain showing sites of substrate
entry, inhibitor action, and potential sites of superoxide anion formation. Cyt,
cytochrome; UQ, ubiquinone; Fe-S, iron sulfur center; HQNO, 2-heptyl-4-
hydroxyquinoline N-oxide. B. Northern analysis of RNA from pulmonary epithelial cells
exposed to TNF-a and/or mitochondrial inhibitors. Inhibition of TNF-a-stimulated
induction of MnSOD by amobarbital (50 and 400 mM) and antimycin A (12.5 and 50
mM) in rat pulmonary epithelial cells (L2 cells) either untreated or treated with
mitochondrial inhibitors alone or in combination with TNF-a (10 ng/ml) or with TNF-a
alone. Control lanes 2 and 3 contain 0.1 and 0.5% ethanol, which were used as the
solvent for all inhibitors not soluble in water.

95
O
COMPLEX I
*
Co2-
NADH
Amobarbital \ COMPLEX III
UQ->-cyt. b-^cyt. c,
e‘
->
cyt. c
e-
Succinate
2e-
COMPLEX
Succinate
Dehydrogenase
(3Fe-S)
../â–  K -.
o
COMPLEX IV ~
4e^°2
cyt. a-a3|—
^h2o
Antimycin A
2 ‘ Myxothiazole
2 HQNO
TNF-a
Amobarbital (pM)
Antimycin (pM)
+ + +
+ +
-----
50 400
- - -
50 400
“ “ - 12.5 50
- -
“ 12.5 50
- -
MnSOD
Cathepsin B
B

96
Fig. 5-IB illustrates the effects of treatment of L2 cells with antimycin A or amobarbital,
and/or TNF-a. The control samples exhibit a low constitutive level of expression of
MnSOD mRNA. Addition of antimycin A or amobarbital at increasing concentrations
(Schulze-Osthoff, 1992) did not affect this constitutive MnSOD mRNA expression.
Maximal induction of MnSOD mRNA levels with TNF-a occurs after 8 hours, and thus
this time point was selected for isolation of RNA for northern analysis. Co-treatment
with TNF-a and antimycin A simultaneously caused a marked decrease in MnSOD
mRNA expression at both concentrations of antimycin A (Schulze-Osthoff, 1992).
Amobarbital, which blocks electron transfer through complex I (Fig. 5-1 A), had minimal
effect on TNF-a-induced expression of MnSOD mRNA compared to antimycin A.
Microscopic examination at 8 hours showed no apparent difference in the cellular
viability between control and treated cells.
Antimycin A Strongly Decreases TNF-a-Inducible MnSOD Expression in
Pulmonary Endothelial Cells.
With the results shown in Fig. 5-IB, we proceeded to evaluate the cellular
specificity of the mitochondrial inhibitor, antimycin A, studying its effects on another cell
type, the rat pulmonary artery endothelial cell line (VA cells, Visner et al., 1992).
Observing that the two concentrations of antimycin A used in the pulmonary epithelial
cell experiments (Fig. 5-IB) gave similar results in the inhibition of TNF-a-stimulated
MnSOD mRNA levels and based on that fact that much lower concentrations of
antimycin A are effective at inhibiting mitochondrial electron transport, we tested

Figure 5-2. A. Northern analysis of RNA from pulmonary artery endothelial cells
exposed to TNF-a and/or antimycin A. Inhibition of TNF-a-stimulated induction of
MnSOD by antimycin A in rat pulmonary endothelial cells (VA cells) either untreated or
treated with increasing concentrations of antimycin A alone or in combination with TNF-
a (10 ng/ml) or with TNF-a alone. B. Northern analysis of RNA from pulmonary artery
endothelial cells exposed to TNF-a and myxothiazole. Inhibition of TNF-a-stimulated
induction of MnSOD in rat pulmonary endothelial cells (VA cells) either untreated or
treated with increasing concentrations of myxothiazole alone or in combination with
TNF-a (10 ng/ml) or TNF-a alone.

98
Antimycin (pM)
“ 0.5 1 2 4 10 20
“ 0.5 1 2 4 10 20
TNF-a
+ + + + + + +
MnSOD
<«4
Cathepsin B
A
TNF-a
+ + + + + 4-
Myxothiozole (pg/ml)
“ .0003.003 .03 .3 3
“ .0003.003 .03 .3 3
MnSOD
Cathepsin B
*•«*-»*.
B

99
concentrations from 0.5 to 20 pM to find the optimum inhibitory concentration in the VA
cells. Fig. 5-2A illustrates the effects of increasing concentrations of antimycin A on
MnSOD mRNA levels. The maximal inhibition was achieved at a concentration of 4 pM.
Using this concentration of antimycin A, I tested the effect on TNF-a-stimulated
expression over 24 hours. The maximal inhibition appears to occur between 8 to 12
hours when both TNF-a and antimycin A are added simultaneously (data not shown).
Furthermore, the sequence of addition of TNF-a or antimycin A to the cells was
important for the TNF-a-stimulated expression of MnSOD mRNA. If TNF-a was added
as little as 15 minutes prior to antimycin A, the diminution of the inducible expression
was dramatically reduced (data not shown). Other investigators have found that
pretreatment of L929 cells with mitochondrial inhibitors resulted in a significant decrease
in binding of TNF to cell surface receptors (Sanchez-Alcazar et al., 1995). Thus, all the
cell treatments in these experiments were done simultaneously.
Treatment of both pulmonary epithelial and endothelial cells with the complex III
inhibitor, antimycin A, showed dramatic inhibition of TNF-a-induction of MnSOD
mRNA. With this in mind, I decided to test whether another complex III inhibitor would
give similar results. The inhibitors, antimycin A and myxothiazol, both block electron
transport at the cytochrome bi-c segment of the mitochondrial respiratory chain, but at
different binding sites (Thierbach and Reichenbach, 1981; Iwata et al., 1998). Fig. 5-2B
shows the effects of increasing concentrations of myxothiazol on TNF-a-stimulated
expression of MnSOD mRNA. The extent of inhibition by myxothiazol is very similar to
the pattern observed for antimycin A, which might be expected considering the proximity
of the binding of antimycin and myxothiazole in the cytochrome bj-c crystal structure

100
(Iwata et al., 1998). Interestingly, the inhibition of gene expression by these electron
transport inhibitors is exquisitely specific since 2-heptyl-4-hydroxyquinoline N-oxide
(HQNO), which also inhibits complex III, but at a different site, does not alter TNF
induction of MnSOD (data not shown). These results would suggest that inhibition of
mitochondrial electron transport at complex III alters production of ROS that can act in
retrograde communication with the nucleus.
The Signaling Pathway for TNF-a Is Different from the Pathways for LPS- or IL-1-
Stimulated Expression of MnSOD.
Previously, it has been shown that both lipopolysaccaride (LPS) and interleukin-1
(IL-1) also induce expression of MnSOD in both pulmonary epithelial and endothelial
cells (Visner et al., 1990; Visner et al., 1992). Maximal induction occurs at 8 to 12 hours
similar to TNF-a. To evaluate whether signaling pathways for all three inflammatory
mediators were similar when mitochondrial respiration is inhibited with antimycin A, I
examined the effect that increasing concentrations of antimycin A had on the LPS- and
IL-1-stimulated expression of MnSOD in VA cells (Fig. 5-3 A). Only at the highest
concentration of antimycin A did the level of stimulated expression of MnSOD vary even
slightly from LPS or IL-1 alone. This would suggest that the intracellular signaling
pathway of TNF-a is different from that of LPS or IL-1.
TNF-a-stimulated expression of MnSOD is unaffected by antimycin A in a
resistant fibroblast cell line. To demonstrate that the effects of antimycin A are directly
associated with mitochondrial inhibition and not due to other possible side effects, I
obtained an antimycin-resistant mouse fibroblast mutant cell line, LA9 (Howell et al.,
1983). In this mutant, the rate of respiration is normal, but electron transport through the

Figure 5-3. A. Northern analysis of RNA from pulmonary artery endothelial cells
exposed to lipopolysaccaride (LPS) or interleukin-1 and/or antimycin A. Inhibition of
LPS- and IL-1-stimulated induction of MnSOD in rat pulmonary endothelial cells (VA
cells) either untreated or treated with increasing concentrations of antimycin A alone or
in combination with LPS (0.5 mg/ml) or IL-1P (2 ng/ml) or with LPS or IL-1 (3 alone. B.
Northern analysis of RNA from antimcyin-resistant murine fibroblast cells exposed to
TNF-a and/or antimycin A. Inhibition of TNF-a-stimulated induction of MnSOD in a
murine fibroblast antimycin-resistant cell line (LA9, 31) either untreated or treated with
increasing concentrations of antimycin A alone or in combination with TNF-a (10 ng/ml)
or TNF-a alone.

102
Antimycin (pM)
- 2 4 20 - 2 4 20
- 2 4 20 “ 2 4 20
IL-1
+ + + +
LPS
MnSOD
Cathepsin B
UUUU y uUUm
A
TNF-a
Antimycin (pM)
MnSOD
+ + + + + + +
“ 0.5 1 2 4 10 20
- 0.5 1 2 4 10 20
Cathepsin B
. ««.««i
B

103
succinate-cytochrome c oxidoreductase segment of the mitochondrial respiratory chain,
which includes cytochrome b, shows resistance to inhibition by antimycin A. Fig. 5-3B
illustrates the effect of TNF-a on the expression of MnSOD in the mutant LA9 cells. I
should point out that previously it has been demonstrated that the five separate MnSOD
mRNA transcripts in the rat result from alternative polyadenylation (Hurt et al., 1992);
however, there are only two murine MnSOD transcripts at 1 Kb and 4 Kb. At
concentrations of antimycin A varying from 0.5 to 20 pM, TNF-a continued to induce
MnSOD mRNA levels demonstrating the specificity of the antimycin action in VA cells.
Inhibition of Mitochondrial ATPase with Oligomycin also Represses TNF-a-
Stimulated Expression of MnSOD.
Oligomycin, which inhibits FiFo ATPase, causes uncoupling of mitochondrial
respiratory electron transport and ATPase activity. Previous work by other investigators
has demonstrated that cells treated with TNF-a results in an increase in oligomycin-
sensitive mitochondrial respiration (Sanchez-Alcazar et al., 1997), with the resultant
increase in ROS. However, cells treated with both TNF-a and oligomycin resulted in
decreased levels of cellular ATP as well as blockade of the increase in ROS generation
(Sanchez-Alcazar et al., 1997). To evaluate whether oligomycin treatment of VA cells
would inhibit TNF-a-induction of MnSOD, I treated VA cells with increasing
concentrations of oligomycin in the presence and absence of TNF-a. The results shown
in Fig. 5-4 would indicate that oligomycin inhibits TNF-a-inducible MnSOD expression
and that this inhibition is likely due to the decreased mitochondrial ATP and/or ROS
levels.

Figure 5-4. Northern analysis of RNA from pulmonary artery endothelial cells exposed
to TNF-a and oligomycin. Inhibition of TNF-a-stimulated induction of MnSOD in rat
pulmonary endothelial cells (VA cells) either untreated or treated with increasing
concentrations of oligomycin alone or in combination with TNF-a (10 ng/ml) or TNF-a
alone.

105
TNF-a
Oligomycin (pM)
MnSOD
+ + +++ +
- .15 1.5 3 6 10
- .15 1.5 3 6 10
Ma n ¿ i
Cathepsin B

Figure 5-5. Northern analysis of RNA from pulmonary artery endothelial cells exposed
to TNF-a and/or N-acetyl cysteine (NAC). Inhibition of TNF-a-stimulated induction of
MnSOD in pulmonary artery endothelial cells (VA cells) either untreated or treated with
various increasing concentrations of NAC alone or in combination with TNF-a (10
ng/ml) or TNF-a alone.

107
TNF-a
NAC (pM)
MnSOD
+ + + + +
- 1 5 10 20
- 1 5 10 20
^ ^ ^ -**d
W' *w m w MP
fc 9
MMtfié
Cathepsin B

108
Reactive Oxygen Species Are Important for TNF-a-Stimulated Expression of
MnSOD.
Since levels of ROS have previously been shown to be decreased in cells treated
with antimycin A (Boveris and Chance, 1973; Tan et al., 1998), I made use of the
antioxidant, N-acetyl cysteine (NAC), to evaluate whether ROS scavenging can modulate
TNF-a-inducible expression of MnSOD. NAC caused a dose-dependent decrease in the
TNF-a-stimulated expression of MnSOD to baseline levels with no detectable effect on
cell viability (Fig. 5-5). Of note, the concentrations of NAC capable of decreasing
MnSOD expression are far below the millimolar levels used in much of the literature,
demonstrating the potential importance of ROS in TNF-a-mediated signal transduction
and the sensitivity of ROS in retrograde mitochondria-to-nucleus communication.
TNF-a-Stimulated Expression of MnSOD in Endothelial Cells Is Dependent on
Cytoplasmic Phospholipase A2 (CPLA2).
Several studies have demonstrated the connection between arachidonic acid and
mitochondrial ROS production (Bondy and Marwah, 1995; Li and Cathcart, 1997; Coceo
et al., 1999; Woo et al., 2000). To explore whether inhibition of CPLA2 and thus
mitochondrial ROS affect MnSOD expression, we utilized the potent and selective CPLA2
inhibitor, arachidonyl trifluoromethyl ketone (AACOCF3) (Li and Cathcart, 1997). This
inhibitor caused a dose-dependent repression of MnSOD expression in TNF-a-stimulated
endothelial cells (Fig. 5-6A), whereas AACOCF3 had no effect on IL-ip-stimulated cells
(Fig. 5-6B).

Figure 5-6. A. Northern analysis of RNA from pulmonary artery endothelial cells
exposed to TNF-a and/or cPLA2 inhibitor (AACOCF3). Inhibition of TNF-a-stimulated
induction of MnSOD in pulmonary artery endothelial cells (VA cells) either untreated or
treated with increasing concentrations of AACOCF3 alone or in combination with TNF-a
(10 ng/ml) or TNF-a alone. B. Northern analysis of RNA from pulmonary artery
endothelial cells exposed to IL-1(5 and cPLA2 inhibitor (AACOCF3). Inhibition of IL-1 -
stimulated induction of MnSOD in pulmonary artery endothelial cells either untreated or
treated with increasing concentrations of AACOCF3 alone or in combination with IL-
1(5(2 ng/ml) or IL-1(5 alone.

110
TNF-a
cPLA2Inhibitor
(M-M)
<5,^^ S>v V- Tfl
+ + ++ + +
»- 4
MnSOD
mmmmm
Cathepsin B
IL-lp
cPLA2 Inhibitor (pM)
MnSOD
Cathepsin B %^ <***<*%»«** w «■# •»«*%■•**»
B

Figure 5-7. A. Northern analysis of RNA from pulmonary artery endothelial cells
exposed to TNF-a and/or I kappa kinase (IkK) inhibitor (Bay 11-7082). Inhibition of
TNF-a-stimulated induction of MnSOD in pulmonary artery endothelial cells (VA cells)
either untreated or treated with increasing concentrations of IkK inhibitor alone or in
combination with TNF-a (10 ng/ml) or TNF-a alone. B. Northern analysis of RNA from
pulmonary artery endothelial cells exposed to IL-1 (3 and/or I kappa kinase (IkK) inhibitor
(Bay 11 -7082). Inhibition of IL-1 (3-stimulated induction of MnSOD in pulmonary artery
endothelial cells (VA cells) either untreated or treated with increasing concentrations of
IkK inhibitor alone or in combination with IL-ip (2 ng/ml) or IL-ip alone.

112
TNF-a
- - - -
+ + + +
IkK Inhibitor (pM)
- 2.5 5 10
- 2.5 5 10
MnSOD
♦ mt m m . i m
MIM
Cathepsin B
IL-ip
IkK Inhibitor (pM)
MnSOD
- - - -
+ + + +
- 2.5 5 10
- 2.5 5 10
Cathepsin B
B

Figure 5-8. Northern analysis of RNA from pulmonary artery endothelial cells exposed to
TNF-a and/or MAP kinase inhibitor (PD98059). Levels of TNF-a-stimulated induction
of MnSOD in pulmonary artery endothelial cells (VA cells) either untreated or treated
with increasing concentrations of the MAP kinase inhibitor (PD98059) alone or in
combination with TNF-a or TNF-a alone. Also, when the MAP kinase inhibitor,
SB203580, was used in similar experiments, no alteration in TNF-a-inducible pattern of
MnSOD was observed, almost identical to the above experiment with PD98059.

114
TNF-a
PD 98059 (|iM)
+ + + + + +
- 1.25 2.5 5 10 20
- 1.25 2.5 5 10 20
MnSOD

115
TNF-a-Inducible Expression of MnSOD Is Not Dependent on Nuclear Factor kB
(NFkB).
Other investigators have shown that ROS activation by diverse conditions is
important for gene activation by NFkB (Coceo et al., 1999). To investigate whether
NFkB is important in TNF-a-signaling of MnSOD, I utilized the I kappa kinase (IkK)
inhibitor, BAY 11-7082 (Pierce et al., 1997). At increasing concentrations of the IkK
inhibitor, MnSOD expression in IL-1 ^-stimulated endothelial cells could be reduced to
baseline (Fig. 5-7B), with no effect on TNF-a-stimulated cells (Fig. 5-7A). These data
suggest that NFkB is activated in the IL-1(3 signaling pathway, but not in the TNF-a
signaling pathway of MnSOD. Other kinase signaling pathways were also investigated
by using specific inhibitors. The mitogen-activated protein (MAP) kinases are a group of
protein serine/threonine kinases that are activated in response to a variety of extracellular
stimuli and mediate signal transduction from the cell surface to the nucleus. Two of the
MAP kinase pathways that have been implicated in TNF-a and IL-1 signal transduction
are JUN/SAPK and p38. The JNK/SAPK (c-Jun kinase/stress activated protein kinase)
cascade is activated following exposure to UV radiation, heat shock, or inflammatory
cytokines. The p38 kinase (reactivating kinase) is the newest member of the MAP kinase
family. It is activated in response to inflammatory cytokines, endotoxins, and osmotic
stress. Selective inhibitors of the MKK1/2 (PD 98059) (Kultz et al, 1998) and p38 (SB
203580) (Kramer et al., 1996) were utilized at various concentrations to treat endothelial
cells with or without TNF-a. No differences were seen between inducible expression of
MnSOD with either of the inhibitors (representative example, Fig. 5-8) suggesting that

116
TNF-a signal transduction for MnSOD likely does not occur through these MAP kinase
pathways.
Discussion
Manganese superoxide dismutase plays an important role in the cellular defense
against superoxide produced by the mitochondrial electron transport chain during normal
cellular metabolism (Wong and Goeddel, 1988; Wong et al., 1989; Warner et ah, 1991;
Wispe et ah, 1992). Reduction or deficiency of MnSOD has been shown to promote
cytotoxicity under conditions of oxidant stress (Li et ah, 1995; Melov et ah, 1998). A
number of laboratories, including our own, have begun to understand the workings of the
promoter and the intronic enhancer in causing the dramatic inducible expression of
MnSOD (Jones et ah, 1997; Kuo et ah, 1999; Rogers et ah, 2000). However, the
molecular intracellular signaling pathways and the nature of the induction of MnSOD by
various inflammatory mediators are still being unraveled.
Retrograde communication from the mitochondria to the nucleus likely consists of
metabolic signals and transduction pathways that function across the inner mitochondrial
membrane. Since ROS are very short-lived molecules closely regulated by a coordinated
enzyme system, they could be potential signal transducers of putative mitochondria-to-
nucleus signaling pathways. Production of ROS in the mitochondria is related to changes
in electron flux through the respiratory chain, brought about by various physiological
conditions, such as heat shock (Lambowitz et al., 1983); variations in oxygen tension
(Kramer et al., 1983); and exposure to nitric oxide (Henry and Guissani, 1999). ROS
have been found to act as second messengers in cellular functions such as cell growth and
differentiation (Hansberg et al., 1993; Remade et al., 1995). Mitochondrial respiration

117
has been linked to the expression of the mammalian gene, GLUT1 (Ebert et al., 1995).
Expression of the GLUT1 gene, one of the isoforms of the glucose transporter, is
enhanced by hypoxia and by exposing cells to inhibitors of mitochondrial respiration
(Ebert et al., 1995). I, therefore, postulated that inhibition of mitochondrial respiration
might also regulate MnSOD expression possibly through a mechanism involving
intracellular levels of ROS.
Our data show that mitochondrial respiratory chain inhibitors, antimycin A (Fig.
5-IB, 5-2A) and myxothiazole (Fig. 5-2B) as well as the F]Fo-ATPase inhibitor,
oligomycin (Fig.5-4), can repress TNF-a-inducible expression of nuclear-encoded
MnSOD. I have also addressed the specificity of the antimycin effects with studies in
antimycin A-resistant LA9 mutant cells stimulated with TNF-a (Fig. 5-3B), further
implicating ROS, ROS by-products and/or lipid peroxides as likely candidates for signal
transduction from the mitochondria to the nucleus. In addition, other investigators have
shown that sub-micromolar concentrations of arachidonic acid cause a substantial
increase in ROS production in mitochondria (Coceo et al., 1999; Woo et al., 2000). The
data in Fig. 5-6 would suggest that decreased levels of arachidonic acid, occurring as a
result of selective blockade of CPLA2 enzyme, is sufficient to inhibit the TNF-a-inducible
expression of MnSOD. Thus oxidative events generated in the mitochondrion, not simply
inhibition of energy-coupled processes, are crucial in TNF-a-induced MnSOD gene
expression.
ROS or other mitochondrial intermediates may control both the cytotoxic and
gene-regulatory effects of TNF-a, thus providing a basis for a mitochondria-to-nucleus
signaling pathway, which requires bidirectional communication between the nucleus and

118
the mitochondria. While the cytotoxic activity of TNF-a seems to be rather restricted to
tumor cells, nearly every cell type responds to TNF-a by the activation of a wide range of
different genes (Lee et al., 1990). Transcriptional regulation of genes involves
interaction of cA-acting elements of DNA with their cognate DNA-binding proteins.
TNF-a induces activation of nuclear factors that act as ‘third’ messenger molecules
specifically binding to cA-acting sequences. Perhaps the best understood example of the
second messenger function of ROS is the activation of the mammalian transcription
factor, NF-kB (Baeuerle and Baltimore, 1988). When activated, NF-kB induces the
expression of various genes involved in inflammatory responses, immune cell regulation
and differentiation (Baeuerle and Henkel, 1994). A diverse set of conditions can cause
NF-kB activation with the common factor being the generation of ROS within the
affected cells (Baeuerle and Baltimore, 1988; Baeuerle and Henkel, 1994). ROS are
involved in the TNF-a signaling of MnSOD expression (Fig. 5-1,5-2,5-5), however my
experiments with the Ik kinase inhibitor (Fig. 5-7) would indicate that although NF-kB
may be involved in IL-ip signaling, it is not involved in TNF-a-inducible expression of
MnSOD. In addition, my data would also suggest that the MAP kinase pathways
involving JNK/SAPK and p38 probably do not regulate expression of MnSOD (Fig. 5-8).
Thus, my data would suggest that multiple signaling pathways result in stimulated
expression of MnSOD. Clearly, inhibition of mitochondrial electron transport alters
inducible expression of MnSOD by TNF-a, but not IL-1 or LPS. Thus, it would appear
that the TNF-a signaling pathway requires retrograde communication from the
mitochondria to the nucleus, probably involving ROS. However, due to the high
reactivity of ROS and their production within the mitochondrial membrane, it is much

119
more likely that the cytoplasmic signaling molecule of the TNF-a signaling pathway may
be a protein acted upon by a lipid peroxide or other ROS or even the lipid peroxide itself.
Our data with the cPLA2 inhibitor would seem to bolster this argument in the TNF-a
pathway. Other investigators have shown that TNF-a-induced ROS production requires
cPLA2 and 5-lipoxygenase activity, but not cyclooxygenase activity in the Rac signal
transduction cascade (Woo et al., 2000). This would suggest that ROS generation is
dependent on synthesis of arachidonic acid and its subsequent metabolism to
leukotrienes. In fact, exogeneously applied leukotriende B4 could increase mitochondrial
ROS (Woo et al., 2000). A model of my proposed MnSOD signaling pathways is shown
in Fig. 5-9, detailing the differences between the TNF-a and IL-1 (3 pathways. It may be
that a yet unidentified signal pathway protein is activated by ROS or a lipid peroxide
moiety, causing binding within the enhancer of MnSOD to produce the dramatic
inductions seen with TNF-a (Fig. 5-9).

120
Antimycin A
Myxothiazolc
®IL-1
Oligomycin
Bay11-7082
AACOCF
INAC
Lipid Peroxide
MnSOD
mRNA
500000C
MnSOD Enhancer
Figure 5-9. Model of TNF-a and IL-1 signal transduction pathways involved in
inducible MnSOD expression. Mitochondrial inhibitors (antimycin A, myxothiazole) and
FiFo-ATPase inhibitor (oligomycin) are shown to negatively affect mitochondrial
production of ROS, which are involved in the TNF-a signaling pathway, but not the IL-1
pathway. The cPLA2 inhibitor (AACOCF3) diminishes production of arachidonic acid
(AA), which increases mitochondrial production of ROS to produce potentially lipid
peroxide species. Inhibitory k kinase (IkK) inhibitor (Bay 11-7082) inhibits
phosphorylation of the Ik subunit thus preventing separation of the Ik subunit from
nuclear factor kappa B (NF-kB) and blocking it from translocating into the nucleus.

CHAPTER 6
CONCLUSIONS AND FUTURE DIRECTIONS
Conclusions
Understanding transcriptional regulation began with the pioneering work of Jacob
and Monod (Jacob and Monod, 1961) and progresses to this day at a dizzying rate. The
interaction of protein transcription factors with DNA plays a critical role in this
regulation. These protein-DNA interactions vary in response to both internal and external
cellular environmental conditions and stimuli. It is the multitude of possible
combinations of protein-DNA interactions, which give the cell such a variety of control
mechanism. Perhaps the most thoroughly understood example of protein-DNA
interaction involved in transcriptional regulation is the lac repressor-operator complex.
Isolation of the lac repressor (Muller-Hill, 1996) permitted the kinetic studies, which
were essential to understanding how protein-binding contributes to the regulatory
mechanism. Further refinement of the regulatory mechanism was achieved by an
examination in vivo of the lac repressor-DNA interactions (Nick and Gilbert, 1985).
These and hundreds of other pieces of data culminated in understanding the regulatory
mechanism of the lac operon (Muller-Hill, 1996). Almost 40 years elapsed before a full
understanding of the lac operon could be attained. A full comprehension of the
mechanisms regulating transcription in eukaryotes is unlikely to take less time.
Multiple examples of eukaryotic genes with complex enhancers exist in the
literature, p-interferon (Kim and Maniatis, 1997, Merika et al., 1998), T-cell receptor a
121

122
(Giese et al., 1995; Mayall et al., 1997), interleukin-4 (Henkel and Brown, 1994;
Ranganath et al., 1998), and urokinase (De Cesare et al., 1995; De Cesare et al., 1997), to
name a few. From these and other studies two facts have become increasingly clear.
First, within the cell the multiple factors that participate in the transcription process also
play an active role in the regulation of gene expression. Second, from the data available
on eukaryotic transcription, it is also clear that the mechanisms by which transcription is
regulated are tremendously complex.
Eukaryotic transcriptional control entails the precise, sequential interaction of a
variety of large enzymatic complexes that are recruited by sequence-specific
promoter/enhancer-binding proteins. Control of transcriptional regulation is exerted at
multiple levels of the process, which includes chromatin recognition and remodeling,
covalent modification of histones, recruitment of co-activators and basal transcription
components, and the assembly of an elongation-competent transcription complex that is
capable of efficient processing through nucleosomal arrays.
Perhaps the earliest step in gene activation involves the mobilization of energy-
dependent chromatin remodeling complexes. A number of different complexes capable
of assembling and disrupting nucleosome arrays have been identified from yeast,
Drosophila, and mammalian cells. Generally, these complexes are classified according
to the identity of the catalytic ATPase and other shared subunits. Examples of such
remodeling complexes in Drosophila would be the ACF (ATP-utilizing chromatin
assembly and remodeling factor), NURF (nucleosome remodeling factor), and CHRAC
(chromatin accessibility complex) complexes, which use the ATPase subunits of the
ISWI (nucleosome ATPase) family, as do the two mammalian remodeling complexes,

123
remodeling and spacing factor (RSF) and human ATP-utilizing chromatin assembly and
remodeling factor/Williams syndrome chromatin remodeling factor (hACFAVCRF)
(Workman and Kingston, 1998). Other studies would suggest that in addition to the
ATPase activity, histone deacetyltransferase complexes (p300 and TIF2) also are
required (Kobayashi et al., 2000; Treuter et al., 1999). The interaction appears to be
sequential with the ISWI remodeling complex functioning before the acetyltransferases to
facilitate tight binding of the nuclear receptor heterodimer to chromatin. In the yeast
gene, PH08, transcriptional activation requires chromatin remodeling and
acetyltransferase complexes to occur subsequent to binding of factors to the Upstream
Activating Sequence (UAS)/enhancer (Gregory et al., 1999).
Histones, whether hypo- or hyperacetylated, contact DNA similarly, however, the
acetylated particle is more asymmetric and the histone tails adopt a higher degree of a-
helical structure (Workman and Kingston, 1998). In the absence of histone HI, the
structural changes result in a less densely packed fiber. Histones H3 and H2B in core
particles can also be modified through transglutamination (Ballestar et al., 1996), which
provides a sensitive probe for nucleosome structure and possibly an additional regulatory
modification in vivo. The decrease in chromatin compaction with histone acetylation is
very relevant to the effects of acetyltransferases on transcriptional activity.
A number of transcriptional co-activators have been identified: vitamin D receptor
interacting protein (DRIP), activator-recruited cofactor (ARC), negative regulator of
activated transcription (NAT), thyroid hormone receptor-associated protein (TRAP). The
TRAP complex was identified biochemically (Fondell et al., 1996) as a coactivator of the
thyroid hormone receptor and has been found to be required for many other

124
promoter/enhancer-binding factors (Malik et al., 2000). These complexes bind with high
affinity to several different types of transcription activation domains and may be a direct
connection between promoter/enhancer-binding factors and RNA polymerase II.
Coactivators may also act in an architectural manner to promote assembly of enhancer
complexes or to regulate binding of specific promoter/enhancer factors to chromatin.
One such coactivator, High Mobility Group I protein (HMG I), is distinguished by its
ability to bind specifically in the narrow minor groove of AT-rich DNA (Churchill and
Travers, 1991). HMG 1 does not function as a transcriptional activator on its own but
rather influences the activities of other regulatory factors (Thanos et al., 1993). HMG 1
can interact directly with transcriptional activators of several families, including Rel
(Thanos and Maniatis, 1992), bZip (Du et al., 1993), Ets (John et al., 1995), and POU
(Leger et al., 1995). HMG I alters the conformation of the DNA (Falvo et al., 1995) and
facilitates the assembly of a higher-order nucleoprotein complex in the IFN-(3 enhancer
(Yie et al., 1997).
Most promoter elements contain one of two distinct core promoter structures that
comprise a centrally located intiator (Inr) acting in concert with either an upstream TATA
box or a downstream promoter element (DPE) to mediate basal transcription (Burke and
Kadonaga, 1996; Burke and Kadonaga, 1997). Both the DPE and the TATA box are
binding sites for TFIID, and the DPE is as common as the TATA box in Drosophila
(Kutach and Kadonaga, 2000). Notable differences are observed in the ability of specific
core promoters to respond to different enhancers (Ohtsuki et al., 1998). Thus, core
promoter components can vary considerably among different tissues and in different

125
species, and the nature of the core promoter (e.g., containing a TATA box or DPE) will
determine the responsiveness to different promoters/enhancers.
Another interesting consideration is that the components of the TFIID complex
may also regulate transcription though modification of chromatin or other proteins. The
TAFII-250 subunit of TFIID is not only both an acetyltransferase and a protein kinase,
but can also catalyze the ATP-dependent ubiquitination of histone HI in vitro (O’Brien
and Tijan, 2000). Therefore, TAFII-250 appears to contain both ubiquitin-activating and
ubiquitin-conjugating activities. A point mutation in Drosophila TAFII-250 abolished its
ubiquitination acitivity in vitro and was found to reduce expression of several genes in
vivo (Pham and Sauer, 2000). The preceding studies underscore the fact that regulatory
complexes may contain multiple enzymatic activities and thus suggest a role for TAFII-
250 and TFIID in the regulation of gene expression.
Signals in the form of interactions from the enhancer to the core promoter also
affect the transition from initiation to elongation, and enhancer/promoter-specific factors
may stimulate either or both of these processes. One example would be the HIV-1 Tat
protein which associates with P-TEFb-CDK9 and strongly enhances carboxy-terminal-
domain (CTD) phosphorylation at the Ser-5 position of RNA polymerase II (Okamoto et
al., 1996; Parada and Roeder, 1996). Once initiation is established, however,
nucleosomal structures present a barrier to elongation through genes. The chromatin-
specific elongation factor, FACT (facilitates chromatin transcription) contains two
subunits, Sptl6 and SSRP1. The Spt 16 subunit interacts directly with the histone
deacetylase (HAT) protein, NuA3, whereas SSRP1 binds to the SWI/SNF-related protein,
CHD1. An important function of FACT is its ability to facilitate removal of H2A-H2B

126
from chromatin, and FACT is unable to enhance transcription elongation from chromatin,
when H2A-H2B dissociation is prevented by histone cross-linking (Orphanides et al.,
1999).
Within eukaryotic chromosomes, open, accessible chromatin typically signifies
active genes, which are interspersed with regions of more densely compacted chromatin
(heterochromatin), which often harbors inactive genes. Within large regions of the
genome, boundary/insulator elements separate independent regions of genetic activity. In
Drosophila, a unique regulatory element has been defined, the promoter targeting
sequence (PTS), which acting in a dominant fashion allows an enhancer to overcome the
ability of an insulator to block enhancer-promoter interaction (Zhou and Levine, 1999).
Also in Drosophila, an intriguing model for long-range enhancer-promoter interactions is
proposed involving chromatin condensation whereby promoter-enhancer communication
is structurally facilitated (Rollins et al., 1999). This seems to be mediated by a novel
class of proteins, Nipped B, a homologue of chromosomal adherins, which have broad
functions of sister chromatid cohesion, chromosome condensation, and DNA repair. This
last mechanism of promoter-enhancer regulation is reminiscent of the concept of
transvection first suggested by E. B. Lewis (Lewis, 1954).
In this research I have demonstrated that a small region of sequence within intron
2 of MnSOD is responsible for part of the induction seen when cells are stimulated by
inflammatory mediators. Other mechanisms (chromatin remodeling, coactivators,
posttranslational modifications), which may contribute to the transcriptional regulation,
will be found through further study and experimentation. In addition, I have shown that
the signaling pathways from the cell surface to the MnSOD gene are different and

127
dependent on the inflammatory stimulus. The result, increased MnSOD expression, may
be similar for each of the inflammatory stimuli, but the pathways to the end are very
different. This should come as no surprise. Each stimulus, as well as the level of
stimulation, likely causes changes (both induction and suppression) in a variety of genes.
It is the combination of expression products, which gives rise to the final cellular
response.
Future Directions
The observation that the MnSOD gene has a complex enhancer element, which is
responsive to multiple inflammatory stimuli is consistent with the observations of
enhancers in other inducible genes (Kim and Maniatis, 1997; Giese et al., 1995; Henkel
and Brown, 1994; De Cesare et ah, 1995). As opposed to some of these other inducible
enhancers, the transcription factors that bind to the MnSOD enhancer have yet to be
identified. It will be necessary to start with these proteins as they are the first layer of the
protein-enhancer complex which must form to cause the inducible expression seen by
northern analysis.
To fully characterize the regulatory proteins that bind to the MnSOD enhancer
element, it will be necessary to utilize a variety of techniques. As previously shown, the
enhancer element can be shown to cause an inducible shift pattern on electromobility gel
shift assay (EMSA). Further observations can be made by using the mutated regions for
these same shifts under the same conditions as the wild-type enhancer to ascertain if the
shifts are altered by the mutations. Data from such experiments might lend further
support for a large inducible protein-DNA complex. Some evidence of functional
alterations has been shown by transient transfections and northern analysis (Chapter 5).

128
If a transcription factor can be identified or speculated on by consensus-sequence, then
further information could be obtained by super-shift EMSA with the transcription factor
antibody, if available.
Since we have not identified any transcription factors, it will be necessary to
choose a technique, which could provide these factors with a high-degree of reliability.
One such commercially available technique would be the yeast one-hybrid system, using
the enhancer sequence binding site(s) as bait to obtain the primary clone(s) of the trans¬
acting factors. Other techniques, which could be used to obtain proteins binding to the
enhancer regions, would include: (1) the creation of a biotinylated enhancer region using
biotinylated oligonucleotides as primers for PCR and using these DNA fragments in
combination with streptavidin-coated magnetic beads to isolate nuclear proteins which
would bind to the enhancer element. These nuclear fractions could be labeled with S-
methionine to allow identification on 2-D polyacrylamide gel electrophoresis. (2) the
identification of proteins which interact with the transcription factors bound to the
enhancer region could be isolated using the technique of in vivo formaldehyde cross-
linking. Intact cells are treated with dilute solutions of formaldehyde, which produces
protein-protein, protein-RNA, and protein-DNA cross-links within minutes. This would
be followed by the lysis of cells and the isolation of virtually intact chromatin. The
chromatin would be mechanically sheared to produce optimal chromatin DNA of around
600 bp. An important point of this technique is that at least one protein binding to the
area of interest must be known for the next step. The sheared-soluble chromatin is
immunoprecipitated with the antibody of the known binding protein to obtain a pure
immuno-complex of all the proteins binding to the region of interest. The formaldehyde

129
cross-links are reversed and the DNA purified. The purified DNA can be used in one of
two ways: (1) quantitative PCR analysis of genomic fragments using specific pairs of
primers or (2) the immunoprecipitated DNA can be used as probe to scan specific
genomic regions by Southern analysis.
In addition, further work is needed to characterize, in more detail, the
transmembrane receptor-mediated intracellular signaling pathways, which all seem to
culminate with increased expression of MnSOD. Knowing the diversity of signaling
pathways inside the cell and the numerous proteins involved in the different pathways, it
will be a challenging task to dissect out the individual elements to gain a keener
understanding of the key regulatory elements. Possible avenues of experimentation
would include obtaining plasmids containing the wild-type as well as mutated forms of
the various intracellular signaling proteins that have thus far been identified (NF-kB,
members of the TRAF family of proteins, members of the leukotriene enzyme cascade, to
name a few), all with the intent of performing in vivo over-expression and dominant¬
negative studies as another means to elucidate which parts of the pathways are important
for the individual transmembrane-receptor-mediated signals. Another possible series of
experiments might involve obtaining either cells or the animals themselves of the “knock¬
outs” of the individual proteins of the signaling pathways. As more transgenic “knock¬
out” mice are created, a series of animals with specific deletions of signal pathway
proteins may allow very precise in vivo experimentation of signal transduction pathways.

REFERENCES
Aggarwal, B. B., Kohr, W. J., Hass, P. E., Moffat, B., Spencer, S. A., Henzel, W. J.,
Bringman, T. S., Nedwin, G. E., Goeddel, D. V., and Harkins, R. N.
(1985). Human Tumor Necrosis Factor. Production, Purification, and
Characterization. J. Biol. Chem. 260:2345-2354.
Akashi, M., Hachiya, M., Paquette, R. L., Osawa, Y., Shimizu, S., and Suzuki, G. (1995).
Irradiation Increases Manganese Superoxide Dismutase mRNA Levels in
Human Fibroblasts. J. Biol. Chem. 270:15864-15869.
Andrews, N. C. and Faller, D. V. (1991). A Rapid Micropreparation Technique for
Extraction of DNA-Binding Proteins from Limiting Numbers of
Mammalian Cells. Nucleic Acids Res. 19:2499.
Arai, T., Kelly, S. A., Brengman, M. L., Takano, M., Smith, E. H., Goldschmidt-
Clermon, P. J., and Bulkley, G. B. (1998). Ambient but Not Incremental
Oxidant Generation Effects Intercellular Adhesion Molecule 1 Induction
by Tumor Necrosis Factor alpha in Endothelium. Biochem. J, 331:853-
861.
Assayama, K., and Burr, I. M. (1985). Rat Superoxide Dismutases. J. Biol. Chem.
260:2212-2217.
Auron, P. E., Webb, A. C., Rosenwasser, L. J., Mucci, S. F., Rich, A., Wolff, S. M., and
Dinarello, C. A. (1984). Nucleotide Sequence of Human Monocyte
Interleukin-1 Precursor cDNA. Proc. Natl. Acad. Sci. USA 81:7907-7911.
Auron, P. E., Rosenwasser, L. J., Matsushima, K., Copeland, T., Dinarello, C. A.,
Oppenheim, J. J., and Webb, A. C. (1985). Human and Murine Interleukin
1 Possess Sequence and Structural Similarities. J. Mol. Cell. Immunol. 2,
169-177.
Baeuerle, P. A., and Baltimore, D. (1988). I kappa B: A Specific Inhibitor of the NF-
kappa B Transcription Factor. Science 242:540-546.
Baeuerle, P. A., and Henkel, T. (1994). Function and Activation of NF-kappa B in the
Immune System. Ann. Rev. Immunol. 12:141-179.
130

131
Baker, K., Marcus, C. B., Huffman, K., Kruk, H., Malfroy, B., and Doctrow, S. R.
(1998). Synthetic Combined Superoxide Dismutase/Catalase Mimetics
Are Protective as A Displayed Treatment in a Rat Stroke Model: A Key
Role for Reactive Oxygen Species in Ischemic Brain Injury. J. Pharmacol.
Exp. Ther. 284:215-221.
Balentine, J. D. (1982). Pathology of Oxygen Toxicity. Academic Press, New York.
Ballestar, E., Abad, C., Franco, L. (1996). Core Histones Are Glutaminyl Substrates for
Tissue Transglutaminase. J. Biol. Chem. 271:18817-18824.
Banerji, J., Rusconi, S., Schaffner, W. (1981). Expression of a P-Globin Gene is
Enhanced by Remote SV40 DNA Sequences. Cell 27:299-308.
Banerji, J., Olson, L., and Schaffner, W. (1983). A Lymphocyte-Specific Cellular
Enhancer Is Located Downstream of the Joining Region in
Immunoglobulin Heavy Chain Genes. Cell 33, 729-740.
Bankers-Fulbright, J. L., Kalli, K. R., and McKean, D. J. (1996). Interleukin-1 Signal
Transduction. Life Sci. 59:61-83.
Bannister, J. V., Bannister, W. H., and Rotilio, G. (1987). Aspects of the Structure,
Function, and Applications of Superoxide Dismutase. CRC Crit. Rev.
Biochem. 22:111-180.
Benoist, C., and Chambón, P. (1980). Deletions Covering the Putative Promoter Region
of Early mRNAs of Simian Virus 40 Do Not Abolish T-Antigen
Expression. Proc. Natl. Acad. Sci. USA 77:3865-69.
Benoist, C., and Chambón, P. (1981). In Vivo Sequence Requirements of the SV40 Early
Promoter Region. Nature 290:304-10.
Beutler, B., Greenwald, D., Hulmes, J. D., Chang, M., Pan, Y. C., Mathison, J., Ulevitch,
R., and Cerami, A. (1985). Identity of Tumor Necrosis Factor and the
Macrophage Secreted Factor Cachectin. Nature 316, 552-554.
Beutler, B. and Cerami, A. (1989). The Biology of Cachectin/TNF - A Primary Mediator
of the Host Response. Annu. Rev. Immunol. 7:625-655.
Beyer, R. E. (1990) The Participation of Coenzyme Q in Free Radical Generation and as
An Antiooxidant. Free Rad. Biol. Med. 8:545-65.
Bigdeli, N., Niemann, A., Sandler, S., and Eizirik, D. L. (1994). Dissociation between
Interleukin-1 beta-induced Expression of mRNA for Superoxide
Dismutase and Nitric Oxide Synthase in Insulin-Producing Cells.
Biochem. Biophys. Res. Commun, 203:1542-1547.

132
Bondy, S. C, and Marwah, S. (1995). Stimulation of Synaptosomal Free Radical
Production by Fatty Acids: Relation to Esterification and to Degree of
Unsaturation. FEBS Lett. 375:53-55.
Borg, L. A., Cagliero, E., Sandler, S., Welsh, N., and Eizirik, D. L. (1992). Interleukin-1
beta Increases the Activity of Superoxide Dismutase in Rat Pancreatic
Islets. Endocrinol. 130:2851-2857.
Boveris, A., and Chance, B. (1973). The Mitochondrial Generation of Hydrogen
Peroxide. General Properties and Effect of Hyperbaric Oxygen. Biochem.
J. 134:707-716.
Brody, D. T. and Durum, S. K. (1989). Membrane IL-1: IL-1 alpha Precursor Binds to
the Plasma Membrane Via a Lectin-Like Interaction. J. Immunol.
143:1183.
Burke, T. W., Kadonaga, J.T. (1996). Drosophila TFIID Binds to a Conserved
Downstream Basal Promoter Element that is Present in Many TATA-Box-
Deficient Promoters. Genes Dev. 10:711-724.
Burke, T. W., Kadonaga, J.T. (1997). The Downstream Core Promoter Element, DPE, Is
Conserved from Drosophila to Humans and Is Recognized by TAFII60 of
Drosophila. Genes Dev. 11:3020-3031.
Callis, J., Fromm, M., and Walbot, V. (1987). Introns Increase Gene Expression in
Cultured Maize Cells. Genes Dev. 1:1183-1200.
Carey, M., Lin, Y. S., Green, M. R., and Ptashne, M. (1990). A Mechanism for
Synergistic Activation of a Mammalian Gene by GAL4 Derivatives.
Nature 345:361-364.
Cerretti, D. P., Kozlosky, C. J., Mosley, B., Nelson, N., Van Ness, K., Greenstreet, T. A.,
March, C. J., Kronheim, S. R., Druck, T., Cannazarro, L. A. (1992).
Molecular Cloning of the Interleukin-1 Beta Converting Enzyme. Science
256:97-100.
Chance, B., Sies, H., and Boveris, A. (1979). Hydroperoxide Metabolism in Mammalian
Organisms. Physiol. Rev. 59:527-605.
Chandel, N. S., and Schumacker, P. T. (1999). Cells Depleted of Mitochondrial DNA
(rho 0) Yield Insight into Physiological Mechanisms. FEBS Lett. 454:173-
176.
Chesrown, S. E. (1994). Regulation of Manganese Superoxide Dismutase. Ph. D.
Dissertation, University of Florida.

133
Chomczynski, P. and Sacchi, N. (1987). Single-step Method of RNA Isolation by Acid.
Guanidinium Thio Cyanate-Phenol-Chloroform Extraction. Anal.
Biochem. 162:156-159.
Church, G. M. and Gilbert, W. (1984). Genomic Sequencing. Proc. Natl. Acad. Sci. USA
81:1991-1995.
Churchill, M. E. A., and Travers, A. A. (1991). Protein Motifs that Recognize Structural
Features of DNA. Trends Biochem. Sci. 16:92-97.
Clark, B. D., Collins, K. L., Gandy, M. S., Webb, A. C., and Auron, P. E. (1986).
Genomic Sequence for Human Prointerleukin-1 beta: Possible evolution
from a Reverse Transcribed Prointerleukin-1 alpha Gene. Nucl. Acids Res.
14:7897-7914.
Coceo, T., Di Paola, M., Papa, S., and Lorusso, M. (1999). Arachidonic Acid Interaction
with the Mitochondrial Electron Transport Chain Promotes Reactive
Oxygen Species Generation. Free Rad. Biol. Med. 27:51-59.
Cseh, K., and Beutler, B. (1989). Alternative Cleavage of the Cachectin/Tumor Necrosis
Factor Propeptide Results in A Larger, Inactive Form of Secreted Protein.
J. Biol, Chem. 264. 16256-16260.
De Cesare, D., Vallone, D., Caracciolo, A., Sassone-Corse, P., Nerlov, C., Verde, P.
(1995). Heterodimerization of c-Jun with ATF-2 and c-Fos Is Required for
Positive and Negative Regulation of the Human Urokinase Enhancer.
Oncogene 11:365-376.
De Cesare, D., Palazzolo, M., Berthelsen, J., and Blasi, F. (1997). Characterization of
UEF-4, A DNA-Binding Protein Required for Transcriptional Synergism
between Two AP-1 Sites in the Human Urokinase Enhancer. J. Biol.
Chem. 272:23921-23929.
Del Maestro, R. and McDonald, W. (1989). Subcellular Localization of Superoxide
Dismutases, Glutathione Peroxidase, and Catalase in Developing Rat
Cerebral Cortex. Mech. Aging Dev. 48:15-31.
Del-Vecchio, P. J., and Shaffer, J. B. (1991). Regulation of Antioxidant Enzyme
Expression in LPS-treated Bovine Retinal Pigment Epithelial and Corneal
Endothelial Cells. Curr. Eve Res. 10:919-925.

134
De Keulenaer, G. W., Ushio-Fukai, M., Yin, Q., Chung, A. B., Lyons, P. R., Ishizaka, N.,
Rengarajan, K., Taylor, W. R., Alexander, R. W., Griendling, K. K.
(2000). Convergence of Redox Sensitive and Mitogen-Activated Protein
Kinase Signaling Pathways in Tumor Necrosis Factor-Alpha-Mediated
Monocyte Chemoattractant Protein-1 Induction in Vascular Smooth
Muscle Cells. Arterioscler. Thromb. Vase. Biol. 20:385-391.
De Villiers, J., and Schaffner, W. (1981). A Small Segment of Polyoma Virus DNA
Enhances the Expression of a Cloned Beta-Globin Gene over a Distance
of 1400 Base Pairs. Nucl. Acids Res. 9, 6251-6264.
Dinarello, C. A. (1992). The Biology of Interleukin-1. Chem. Immunol. 51:1-32.
Dougall, W. C. (1990). The Rat Manganese Superoxide Dismutase: Cloning and Gene
Regulation. Ph.D. Dissertation, University of Florida.
Dougall, W. C. and Nick, H. S. (1991). Manganese Superoxide Dismutase:A Hepatic
Acute Phase Protein Regulated by Interleukin-6 and Glucocorticoids.
Endocrinology 129:2376-2384.
Du, W., Thanos, D., and Maniatis, T. (1993). Mechanisms of Transcriptional Synergism
between Distinct Virus-Inducible Enhancer Elements. Cell 74:887-898.
Duriez, P. J., Wong, F., Dorovini-Zis, K., Shahidi, R., and Karsan, A. (2000). A1
Functions at the Mitochondria to Delay Endothelial Apoptosis in
Response to Tumor Necrosis Factor. J. Biol. Chem. 275,18099-18107.
Eastgate, J., Moreb, J., Nick, H. S., Suzuki, K., Taniguchi, N., and Zucali, J. R. (1993). A
Role for Manganese Superoxide Dismutasein Radioprotection of
Hemopoeitic Stem Cells by Interleukin-1. Blood 81:639-646.
Ebert, B. L., Firth, J. D., and Ratcliffe, P. J. (1995). Hypoxia and Mitochondrial
Inhibitors Regulate Expression of Glucose Transporter-1 Via Distinct Cis-
Acting Sequences. J. Biol. Chem. 270:29083-29089.
Eddy, L. J., Goeddel, D. V., and Wong, G. H. (1992). Tumor Necrosis Factor-alpha
Pretreatment is Protective in a Rat Model of Myocardial Ischemia-
Reperfusion Injury. Biochem. Biophys. Res. Commun. 184:1056-1059.
Falvo, J. V., Thanos, D., and Maniatis, T. (1995). Reversal of Intrinsic DNA Bends in the
IFNb Gene Enhancer by Transcription Factors and the Architectural
Protein HMG I (Y). Cell 83:1101-1111.

135
Feng, L., Xia, Y., Garcia, G. E., Hwang, D., and Wilson, C. B. (1995). Involvement of
Reactive Oxygen Intermediates in Cyclooxygenase-2 Expression Induced
by Interleukin-1, Tumor Necrosis Factor Alpha, and Lipopolysaccharide.
J. Clin. Invest. 95:1669-1675.
Fibbe, W. E., Schaafsma, M. R., Falkenburg, J. H. F., and Willemze, R. (1989). The
Biological Activities of Interleukin-1. Blut. 59:147-156.
Fischer, E., Maraño, M. A., Barber, A. E., Hudson, A., Lee, K., Rock, C.S., Hawes, A.S.,
Thompson, R. C., Hayes, T. J., Anderson, T. D. (1991). Comparison
Between Effects of Interleukin-1 Alpha Administration and Sublethal
Endotoxemia in Primates. Am. J. Physiol. 26LR442-452.
Flint, D. H., Tuminello, J. F., Emptage, M. H. (1993). The Inactivation of Fe-S Cluster
Containing Hydro-lyases by O2* . J. Biol. Chem. 268:22369-22376.
Fondell, J.D., Ge, H., Roeder, R.G. (1996). Ligand Induction of Transcriptionally Active
Thyroid Hormone Receptor Coactivator Complex. Proc. Natl. Acad. Sci.
USA 93:8329-8333.
Freeman, B. A. and Crapo, J. D. (1982). Free Radicals and Tissue Injury. Lab. Invest.
47:412-426.
Freeman, B. A., Mason, R. J., William, M. C., and Crapo, J. D. (1986). Antioxidant
Enzyme Activity in Alveolar Type II Cells after Exposure of Rats to
Hyperoxia. Exp. Lung Res. 10:203-222.
Fridovich, I. (1974). Superoxide Dismutases. Adv. Enzymol. 41:36-97.
Fridovich, I. (1975). Superoxide Dismutases. Ann. Rev. Biochem. 44:147-159.
Fridovich, I. (1978). The Biology of Oxygen Radicals. Science 201:875-880.
Fridovich, I. (1986). Superoxide Dismutases. Adv. Enzymol. 58:61-97.
Fridovich, I. (1986). Biological Effects of the Superoxide Radical. Arch. Biochem.
Biophvs. 247:1-11.
Fridovich, I. (1989). Superoxide Dismutases: An Adaptation to a Paramagnetic Gas. L
Biol. Chem. 264:7761-7764.
Fried, M. and Crothers, D. M. (1981). Equilibria and Kinetics of lac Repressor-Operator
Interactions by Polyacrylamide Gel Electrophoresis. Nucl. Acids Res.
9:6505-6525.

136
Fromm, M., and Berg, P. (1983). Simian Virus 40 Early and Late Region Promoter
Functions Are Enhanced by the 72 Base Pair Repeat Inserted at Distant
Locations and Inverted Orientations. Mol. Cell. Biol. 3:991-99.
Fujii, J., and Taniguchi, N. (1991) Phorbol Ester Induces Manganese-Superoxide
Dismutase in Tumor Necrosis Factor-Resistant Cells. J. Biol. Chem. 266,
23142-23146.
Gallon, J. R. (1981). The Oxygen-sensitivity of Nitrogenase: A Problem for Biochemists
and Microoganisms. Trends Biochem. Sci. 19.
Garrity, P. A. and Wold, B. J. (1992). Effects of Different DNA Polymerases in Ligation-
Mediated PCR Enhanced Genomic Sequencing and In Vivo Footprinting.
Proc. Natl. Acad. Sci. USA 89:1021-1025.
Ghosh, S., Latimer, R. D., Gary, B. M., Harwood, R. J., and Oduro, A. (1993).
Endotoxin-induced Organ Injury. Crit. Care Med. 21:sl9-24.
Gibbs, L. S., Del-Vecchio, P. J., and Shaffer, J. B. (1992). Mn and Cu/Zn SOD
Expression in Cells from LPS-Sensitive and LPS-Resistant Mice. Free
Rad. Biol. Med. 12:107-111.
Giese, K., Kingsley, C., Kirshner, J. R., Grosschedl, R. (1995). Assembly and Function of
a TCR alpha Enhancer Complex is Dependent on LEF-1-Induced DNA
Bending and Multiple Protein-Protein Interactions. Genes Dev. 9:995-
1008.
Gilbert, D. L. (ed.) (1981). Oxygen and Living Processes: An Inter-Disciplinary
Approach. Springer, New York.
Gillies, S. D., Morrison, S. L., Oi, V. T., Tonegawa, S. (1983). A Tissue-Specific
Transcription Enhancer Element is Located in the Major Intron of a
Rearranged Immunoglobulin Heavy Chain Gene. Cell 33:717-28.
Goeddel, D. V., Aggarwal, B. B., Gray, P. W., Leung, D. W., Nedwin, G. E., Palladino,
M. A., Patton, J. S., Pennica, D., Shepard, H. M., and Sugarman, B. J.
(1986). Tumor Necrosis Factors: Gene Structure and Biological Activities.
Cold Spring Harb. Symp. Quant. Biol. 51 Pt 1:597-609.
Goodwin, R. G., Anderson, D., Jerzy, R., Davis, T., Brannan, C. I., Copeland, N. G.,
Jenkins, N. A., and Smith, C. A. (1991). Molecular Cloning and
Expression of the Type 1 and Type 2 Murine Receptors for Tumor
Necrosis Factor. Mol. Cell. Biol. 11:3020-3026.

137
Goossens, V., Grooten, J., and Fiers, W. (1996). The Oxidative Metabolism of
Glutamine. A Modulator of Reactive Oxygen Intermediate-Mediated
Cytotoxicity of Tumor Necrosis Factor in L929 Fibrosarcoma Cells. J.
Biol. Chem. 271:192-196.
Gottlieb, E., Vaner Heiden, M. G., and Thompson, C. B. (2000). Bcl-x(L) Prevents the
Initial Decrease in Mitochondrial Membrane Potential and Subsequent
Reactive Oxygen Species Production during Tumor Necrosis Factor alpha-
induced Apoptosis. Mol. Cell. Biol, 20:5680-5689.
Gorman, C. M., Merlino, G. T., Willingham, M. C., Pastan, I., and Howard, B. H. (1982).
The Rous Sarcoma Virus Long Terminal Repeat Is a Strong Promoter
when Introduced into a Variety of Eukaryotic Cells by DNA-Mediated
Transfection. Proc. Natl. Acad. Sci. USA 79, 6777-6781.
Gregory P. D., Schmid, A., Zavari, M., Munsterkotter, M., and Horz, W. (1999)
Chromatin Remodelling at the PH08 Promoter Requires SWI-SNF and
SAGA at a Step Subsequent to Activator Binding. EMBO J. 18:6407-6414.
Grosschedl, R., and Bimstiel, M. L. (1980a). Identification of Regulatory Sequences in
the Prelude Sequence of an H2A Histone Gene by the Study of Specific
Deletion Mutants In Vivo. Proc. Natl. Acad. Sci. USA 77:1432-36.
Grosschedl, R., and Bimstie., M. L. (1980b). Spacer DNA Sequences Upstream of the
TATAATA Sequence are Essential for Promotion of H2A Histone Gene
Transcription In Vivo. Proc. Natl. Acad. Sci. USA 77:7102-6.
Grosschedl, R. (1995). Higher-Order Nucleoprotein Complexes in
Transcription:Analogies with Site-Specific Recombination. Curr. Opin.
Cell Biol. 7:362-370.
Gruss, P., Dhar, R., Khoury, G. (1981). Simian Virus 40 Tandem Repeated Sequences as
an Element of the Early Pomoter. Proc. Natl. Acad. Sci. USA 78:943-47.
Gullberg, U., Lantz, M., Lindvall, L., Olsson, I., and Himmler, A. (1992). Involvement of
an Asn/Val Cleavage Site in the Production of a Soluble Form of a Human
Tumor Necrosis Factor (TNF) Receptor. Site-Directed Mutagenesis of a
Putative Cleavage Site in the p55 TNF Receptor Chain. Eur. J. Cell. Biol.
58:307-412.
Gwinner, W., Tisher, C. C., and Nick, H. S. (1995). Regulation of Manganese Superoxide
Dismutase in Glomerular Epithelial Cells: Mechanisms of Interleukin-1
Induction. Kidney Int. 48:354-362.
Halliwell, B. (1984). Chloroplast Metabolism. Oxford University Press, Oxford.

138
Halliwell, B. and Gutteridge, J. M. (1990). Role of Free Radicals and Catalytic Metal
Ions in Human Disease: An Overview. Methods Enzvmol. 186:1-85.
Halliwell, B. and Gutteridge, J. M. C. (1999). Free Radicals in Biology and Medicine.
Oxford Science Publications, Oxford.
Hansberg, W., de Groot, H., and Sies, H. (1993). Reactive Oxygen Species Associated
with Cell Differentiation in Neurospora crassa. Free Rad. Biol. Med.
14:287-293.
Harris, C. A., Derbin, K. S., Hunte McDonough, B., Krauss, M. R., Chen, K. T., Smith,
D. M., and Epstein, L. B. (1991). Manganese Superoxide Dismutase is
Induced by IFN-gamma in Multiple Cell Types. Synergistic Induction by
IFN-gamma and Tumor Necrosis Factor or IL-1. J. Immunol. 147, 149-
154.
Hassan, H. M., and Sun, H. C. (1992). Regulatory Roles of Fnr, Fur, and Arc in
Expression of Manganese-Containing Superoxide Dismutase in
Escherichia coli. Proc. Natl. Acad. Sci. USA 89, 3217-3221.
Haugaard, N. (1968). Cellular Mechanisms of Oxygen Toxicity. Physiol. Rev. 48:229.
Hausladen, A., and Fridovich, I. (1994). Superoxide and Peroxynitrite Inactivate
Aconitases, but Nitric Oxide Does Not. J. Biol. Chem. 269,29405-29408.
Heller, R. A., Song, K, Fan, N., and Chang, D. J. (1992). The p70 Tumor Necrosis Factor
Receptor Mediates Cytotoxicity. Cell 70:47-56.
Henkel, G. and Brown, M. A. (1994). PU.l and GATA:Components of a Mast Cell-
Specific Interleukin 4 Intronic Enhancer. Proc. Natl. Acad. Sci. USA
91:7737-7741.
Henry, Y., and Guissani, A. (1999). Interactions of Nitric Oxide with Hemoproteins:
Roles of Nitric Oxide in Mitochondria. Cell. Mol. Life Sci. 55:1003-1014.
Hjalmarsson, K., Marklund, S., Engstrom, A., and Edlund, T. (1987). Isolation and
Sequence of Complementary DNA Encoding Human Extracellular
Superoxide Dismutase. Proc. Natl. Acad. Sci. USA 84:6340-6344.
Ho, S. N., Hunt, H. D., Horton, R. M., Pullen, J. K., and Pease, L. R. (1989). Site-
directed Mutagenesis by Overlap Extension Using the Polymerase Chain
Reaction. Gene 77:51-59.
Ho, Y. S. and Crapo, J. D. (1987). Nucleotide Sequence of cDNAs Coding for Rat
Manganese-Containing Superoxide Dismutase. Nucl. Acids Res.
15:10070.

139
Ho, Y. S. and Crapo, J. D. (1988). Isolation and Characterization of Complementary
DNAs Encoding Human Manganese-Containing Superoxide Dismutase.
FEBS Lett. 229:256-260.
Ho, Y. S., Howard, A. J., and Crapo, J. D. (1991). Molecular Structure of a Functional
Rat Gene for Manganese-Containing Superoxide Dismutase. Am. J.
Respir. Cell Mol. Biol. 4:278-286.
Hohmann, H. P., Remy, R., Poschl, B., and Loon, A. P. G. M. (1990). Tumor Necrosis
Factors-a and -p Bind to the Same Two Types of Tumor Necrosis Factor
Receptors and Maximally Activate the Transcription Factor NF-kB at Low
Receptor Occupancy and within Minutes after Receptor Binding. J. Biol.
Chem. 265:15183-15188.
Hori, S. (1982). Study on Hyperbaric Oxygen-Induced Convulsion with Particular
Reference to Gamma-Aminobutyric Acid in Synaptosomes. J. Biochem.
(Tokyo) 91:443-448.
Homstra, I. K., and Yang, T. P. (1993). In Vivo Footprinting and Genomic Sequencing by
Ligation-Mediated PCR. Anal. Biochem. 213:179-193.
Howell, N., Huang, P., Kelliher, K., and Ryan, M. L. (1983). Mitochondrial Genetics of
Mammalian Cells: A Mouse Antimycin-Resistant Mutant with a Probable
Alteration of Cytochrome b. Somatic Cell Genetics 9:143-163.
Hsu, J. L. (1993). The Characterization of Rat Cu/ZnSOD and MnSOD Genes. Ph. D.
Dissertation, University of Florida.
Hurt, J., Hsu, J-L., Dougall, W. C., Visner, G. A., Burr, I. M., and Nick, H. S. (1992).
Multiple mRNA Species Generated by Alternate Polyadenylation from the
Rat Manganese Superoxide Dismutase Gene. Nucl. Acids Res. 20:2985-
2990.
Ichas, F., and Mazat, J. P. (1998). From Calcium Signaling to Cell Death: Two
Conformations for the Mitochondrial Permeability Transition Pore.
Switching from Low- to High-Conductance State. Biochim. Biophys. Acta
1366:33-50.
Ikejima, T., Okusawa, S., van der Meer, J. W., and Dinarello, C. A. (1988). Induction by
Toxic-Shock-Syndrome Toxin-1 of a Circulating Tumor Necrosis Factor¬
like Substance in Rabbits and of Immunoreactive Tumor Necrosis Factor
and Interleukin-1 from Human Mononuclear Cells. J. Inf. Pis. 158:1017-
1025.

140
Iwata, S., Lee, J. W., Okada, K., Lee, J. K., Iwata, M., Rasmussen, B., Link, T. A.,
Ramaswamy, S., and Jap, B. K. (1998). Complete Structure of the 11-
Subunit Bovine Mitochondrial Cytochrome bcl Complex. Science 281:64-
71.
Jacob, F., and Monod, J. (1961). Genetic Regulatory Mechanisms in the Synthesis of
Proteins. J. Mol. Biol. 3:318-356.
Jacoby, D. B., and Choi, A. M. (1994). Influenza Virus Induces Expression of
Antioxidant Genes in Human Epithelial Cells. Free Rad. Biol Med.
16:821-824.
John, S., Reeves, R., Lin, J., Child, R., Leiden, J., Thompson, C. B., and Leonard, W. J.
(1995). Regulation of Cell-Type-Specific Interleukin-2 Receptor a-Chain
Gene Expression: Potential Role of Physical Interactions between Elf-1,
HMG I(Y), and NF-kB Family Proteins. Mol, Cell. Biol. 15:1786-1796.
Jones, P. L., Kucera, G., Gordon, H., and Boss, J. M. (1995). Cloning and
Characterization of the Murine Manganous Superoxide Dismutase-
Encoding Gene. Gene 153:155-161.
Jones, P. L., Ping, D., and Boss, J. M. (1997). Tumor Necrosis Factor Alpha and
Interleukin-1 p Regulate the Murine Manganese Superoxide Dismutase
Gene through a Complex Intronic Enhancer Involving C/EBPP and NF-
kB. Mol. Cell. Biol. 17:6970-6981.
Judde, J. and Max, E. E. (1992). Characterization of the Human Immunoglobulin Kappa
Gene 3' Enhancer: Functional Importance of Three Motifs that
Demonstrate B-cell-Specific In Vivo Footprints. Mol. Cell. Biol. 12:5206-
5216.
Kifle, Y., Monnier, J., Chesrown, S. E., Raizada, M. K., and Nick, H. S. (1996).
Regulation of the Manganese Superoxide Dismutase and Inducible Nitric
Oxide Synthase Gene in Rat Neuronal and Glial Cells. J. Neurochem.
66:2128-2135.
Kim, T. K. and Maniatis, T. (1997). The Mechanism of Transcriptional Synergy of an In
Vitro Assembled Interferon-P Enhanceosome. Mol. Cell 1:119-129.
Kinnula, V. L., Aito, H., Klefstrom, J., Alitalo, K., and Raivio, K. O. (1998). Similarities
between TNF and Exogenous Oxidants on the Cytotoxic Response of c-
Myc-Expressing Fibroblasts In Vitro. Cancer Lett. 125:191-198.

141
Kobayashi, Y., Kitamoto, T., Masuhiro, Y., Watanabe, M, Kase, T., Metzger, D.,
Yanagisawa, J., Kato, S. (2000). p300 Mediates Functional Synergism
between AF-1 and AF-2 of Estrogen Receptor alpha and beta by
Interacting Directly with the N-terminal A/B Domains. J. Biol. Chem.
275:15645-15651.
Koleske, A. J., and Young, R. A. (1995). The RNA Polymerase II Holoenzyme and Its
Implications for Gene Regulation. Trends Biochem. Sci. 20, 113-116.
Krall, J., Bagley, A. C., Mullenbach, G. T., Hallewell, R. A., and Lynch, R. E. (1988).
Superoxide Mediates the Toxicity of Paraquat for cultured Mammalian
Cells. J. Biol. Chem. 263:1910-1914.
Kramer, R. S., and Pearlstein, R. D. (1983). Reversible Uncoupling of Oxidative
Phosphorylation at Low Oxygen Tension. Proc. Natl. Acad. Sci. 80:5807-
5811.
Kramer, R. M., Roberts, E. F., Um, S. L., Borsch-Haubold, A. G., Watson, S. P., Fisher,
M. J., and Jakubowski, J. A. (1996). p38 Mitogen-Activated Protein
Kinase Phosphorylates Cytosolic Phospholipase A2 (cPLA2) in Thrombin-
Stimulated Platelets. Evidence that Proline-Directed Phosphorylation Is
Not Required for Mobilization of Arachidonic Acid by cPLA2. J. Biol.
Chem. 271:27723-27729.
Kriegler, M. (1990). Gene Transfer and Expression: A Laboratory Manual. Stockton
Press, New York.
Kuo, S. (1998). The Regulation of Rat Manganese Superoxide Dismutase Gene:
Detection and Characterization of 7ra«s-Acting Factors. Ph. D.
Dissertation, University of Florida.
Kuo, S., Chesrown, S. E., Mellot, J., Rogers, R. J., Hsu, J-L., and Nick, H. S. (1999). In
Vivo Architecture of the Manganese Superoxide Dismutase Promoter. L
Biol. Chem. 274:3345-3354.
Kultz, D., Madhany, S., and Burg, M. B. (1998). Hyperosmolality Causes Growth Arrest
of Murine Kidney Cells. Induction of GADD45 and GADDI 53 by
Osmosensing via Stress-Activated Protein Kinase 2. J. Biol. Chem.
273:13645-13651.
Kushner, L, Ganapathi, M., and Schultz, D. (1989). The Acute Phase Response is
Mediated by Heterogeneous Mechanisms. Annals N. Y. Acad. Sci.
557:19-30.

142
Kutach, A. K., and Kadonaga, J.T. (2000). The Downstream Promoter Element DPE
Appears To Be as Widely Used as the TATA Box in Drosophila Core
Promoters. Mol. Cel.l Biol. 20:4754-4764.
Lambowitz, A. M., Koboyashi, G. S., Painter, A., and Medoff, G. (1983). Possible
Relationship of Morphogenesis in Pathogenic Fungus, Histoplasma
capsulatum, to Heat Shock Response. Nature 303:806-808.
Lantz, M., Gullberg, U., Nilsson, E., and Olsson, I. (1990). Characterization In Vitro of a
Human Tumor Necrosis Factor-Binding Protein. A Soluble Form of a
Tumor Necrosis Factor Receptor. J. Clin. Invest. 86:1396-1402.
Lee, T. H., Lee, G. W., Ziff, E. B., and Vilcek, J. (1990). Isolation and Characterization
of Eight Tumor Necrosis Factor-Induced Gene Sequences from Human
Fibroblasts. Mol. Cell. Biol. 10:1982-1988.
Lei, M. and Morrison, D. C. (1988). Specific Endotoxic Lipopolysaccharide-Binding
Proteins on Murine Splenocytes. J. Immunol. 141:1006-1011.
Lerger, H., Sock, E., Renner, K., Grummt, F., and Wegner, M. (1995). Functional
Interaction between the POU Domain Protein Tst/Oct-6 and the High-
Mobility-Group Protein HMG I(Y). J. Biol. Chem. 15:3738-3747.
Levinson, B., Khoury, G., Woude, G. V., and Gruss, P. (1982). Activation of SV40
Genome by 72-Base Pair Tandem Repeats of Moloney Sarcoma Virus.
Nature 295, 568-572.
Lewis, E. B. (1954). The Theory and Application of a New Method of Detecting
Chromosomal Rearrangements in Drosophila melanogaster. Am. Nat.
88:225-239.
Li, Q., and Cathcart, M. K. (1997). Selective Inhibition of Cytosolic Phospholipase A2 in
Activated Human Monocytes. Regulation of Superoxide Anion Production
and Low Density Lipoprotein Oxidation. J. Biol. Chem. 272:2404-2411.
Li, Y., Huang, T-T., Carlson, E. J., Melov, S., Ursell, P. C., Olson, J. L., Noble, L. J.,
Yoshimura, M. P., Berger, C., Chan, P. H., Wallace, D. H., and Epstein, C.
J. (1995). Dilated Cardiomyopathy and Neonatal Lethality in Mutant Mice
Lacking Manganese Superoxide Dismutase. Nat. Genet. 11:376-381.
Lin, Y.S., Carey, M., Ptashne, M., and Green, M. R. (1990). How Different Eukaryotic
Transcriptional Activators Can Cooperate Promiscuously. Nature
345:359-361.

143
Lomedico, P. T., Gubler, U., Hellmann, C. P., Dukovich, M., Giri, J. G., Pan, Y. C.,
Collier, K., Semionov, R., Chua, A. O., and Mizel, S. B. (1984). Cloning
and Expression of Murine Interleukin-1 cDNA in Escherichia coli. Nature
312:458-462.
Lontz, W., Sirsjo, A., Liu, W., Lindberg, M., Rollman, O., and Torma, H. (1995).
Increase mRNA Expression of Manganese Superoxide Dismutase in
Psoriasis Skin Lesions and in Cultured Human Keratinocytes Exposed to
IL-1 beta and TNF-alpha. Free Rad. Biol. Med. 18:349-355.
Manganaro, F., Chopra, V. S., Mydlarski, M. B., Bematchez, G., and Schipper, H. M.
(1995). Redox Perturbations in Cysteamine-Stressed Astroglia:
Implications for Inclusion Formation and Gliosis in the Aging Brain. Free
Radicals Biol. Med. 19:823-835.
Maniatis, T., Goodbum, S., and Fischer, J. A. (1987). Regulation of Inducible and
Tissue-Specific Gene Expression. Science 236:1237-45.
Maniatis, T., Whittmore, L. A., Du, W., Fan, C. M., Keller, A. D., Palombella, V. J.,
Thanos, D. (1992). Positive and Negative Control of Human Interferon-b
Gene Expression. In Transcriptional Regulation, S. L. McKnight and K.
R. Yamamoto, eds. (Cold Spring Harbor Laboratory Press: Cold Spring
Harbor, New York).
Marklund, S. L. (1984). Extracellular Superoxide Dismutase and Other Superoxide
Dismutase Isoenzymes in Tissues from Nine Other Mammalian Species.
Biochem. J. 222:649-655.
Massaro, D., Rahman, I., Clerch, L. B., and Iqbal, J. (1992). Tolerance of Rats to
Hyperoxia: Lung Antioxidant Enzyme Gene Expression. FASEB J.
6:A1816.
Mayall, T. P., Sheridan, P. L., Montiminy, M. R., and Jones, K. A. (1997). Distinct Roles
for P-CREB and LEF-1 in TCR alpha Enhancer Assembly and Activation
on Chromatin Templates In Vitro. Genes Dev. 11:887-899.
Maxam, A. M. and Gilbert, W. (1980). Sequencing End-Labeled DNA with Base-
Specific Chemical Cleavages. Methods Enzymol, 65:499-560.
McCord, J. M. and Roy, R. S. (1982). The Pathophysiology of Superoxide: Roles in
Inflammation and Ischemia. Can. J. Physiol. Pharmacol. 60:1346-1352.
McKnight, S. and Yamamoto, K. R. (1992). Transcriptional Regulation. Cold Spring
Harbor Laboratory Press: Cold Spring Harbor, New York.

144
Melendez, J. A., and Baglioni, C. (1993). Differential Induction and Decay of Manganese
Superoxide Dismutase mRNAs. Moll. Cell. Biol. 10:1680-1688.
Melov, S., Schneider, J. A., Day, B. J., Hinerfeld, D., Coskun, P., Mirra, S. S., Crapo, J.
D., and Wallace, D. C. (1998). A Novel Neurological Phenotype in Mice
Lacking Mitochondrial Manganese Superoxide Dismutase. Nat. Genet.
18:159-163.
Mercóla, M, Wang, X-F., Olsen, J., and Caíame, K. (1983). Transcriptional Enhancer
Elements in the Mouse Immunoglobulin Heavy Chain Locus. Science
221:663-65.
Merika, M., Williams, A. J., Chen, G., Collins, T., and Thanos, D. (1998). Recruitment of
CBP/p300 by the IFN beta Enhanceosome Is Required for Synergistic
Activation of Transcription. Mol. Cell 1:277-287.
Mignotte, B., and Vayssiere, J. L. (1998). Mitochondria and Apoptosis. Eur. J. Biochem.
252:1-15.
Molloy, R. G., Mannick, J. A., and Rodrick, M. L. (1993). Cytokines, Sepsis and
Immunomodulation. Br. J. Sure. 80:289-297.
Moreau, P., Hen, R., Wasylyk, B., Everrett, R., Gaub, M. et al (1981). The SV40 72-bp
Repeat Has a Striking Effect on Gene Expression Both in SV40 and Other
Chimeric Recombinants. Nucleic Acids Res. 9:6047-69.
Morton, R. L., Ikle, D., and White, C. W. (1998). Loss of Lung Mitochondrial Aconitase
Activity Due to Hyperoxia in Bronchopulmonary Dysplasia in Primates.
Am. J. Phvsiol. 274:L127.
Mueller, P. R. and Wold, B. J. (1989). In Vivo Footprinting of a Muscle Specific
Enhancer by Ligation-Mediated PCR. Science 246:780-786.
Muller-Hill, B. (1996). The lac Operon. A Short History of a Genetic Paradigm. Walter
de Gruyter, Berlin, Germany.
Nedwin, G. E., Naylor, S. L., Sakaguchi, A. Y., Smith, D., Jarrett-Nedwin, J., Pennica,
D., Goeddel, D. V., and Gray, P. W. (1985). Human Lymphotoxin and
Tumor Necrosis Factor Genes: Structure, Homology and Chromosomal
Localization. Nucleic Acids Res. 13:6361-6373.
Neta, R., Douches, S., and Oppenheim, J. J. (1986). Interleukin-1 is a Radioprotector. J.
Immunol. 136:2483-2485.
Neuberger, M. S. (1983). Expression and Regulation of Immunoglobulin Heavy Chain
Gene Transfected into Lymphoid Cells. EMBO J. 2:1373-78.

145
Nick, H. and Gilbert, W. (1985). Detection of In Vivo Protein-DNA Interactions within
the lac Operon of Escherichia coli. Nature 313:795-798.
Niitsu, Y., Watanabe, N., Soné, H., Neda, H., Yamauchi, N., and Urushizaki, I. (1985).
Mechanism of the Cytotoxic Effect of Tumor Necrosis Factor. Jpn. J.
Cancer Res. 76:1193-1197.
Nohl, H., Gille, L., Schoneit, K., and Liu, Y. (1996). Conditions Allowing Redox-
Cycling Ubisemiquinone in Mitochondria to Establish a Direct Redox
Couple with Molecular Oxygen. Free Rad. Biol. Med. 20:207-213.
O'Brien, T., and Tjian, R. (2000). Different Functional Domains of TAFII250 Modulate
Expression of Distinct Subsets of Mammalian Genes. Proc. Natl. Acad.
Sci. USA 97:2456-2461.
Oberley, L. W., Kasemet St. Clair, P., Autor, A. P., and Oberley, T. D. (1987). Increase
in Manganese Superoxide Dismutase Activity in the Mouse Heart After X-
irradiation. Arch. Biochem. Biophys. 254:69-80.
Ohtsuki, S., Levine, M., and Cai, H. N. (1998). Different Core Promoters Possess
Distinct Regulatory Activities in the Drosophila Embryo. Genes Dev.
12:547-556.
Okamoto, H., Sheline, C. T., Corden, J. L., Jones, K. A., Peterlin, B. M. (1996). Trans-
Activation by Human Immunodeficiency Virus Tat Protein Requires the
C-terminal Domain of RNA Polymerase II. Proc. Natl. Acad. Sci. USA.
93:11575-11579.
Okusawa, S., Gelfand, J. A., Ikejima, T., Connolly, R. J., and Dinarello, C. A. (1988).
Interleukin 1 Induces a Shock-Like State in Rabbits. Synergism with
Tumor Necrosis Factor and the Effect of Cyclooxygenase Inhibition. L
Clin. Invest. 81:1162-1172.
Orphaides, G., Lagrange, T., and Reinberg, D. (1996). The General Transcription Factors
of RNA Polymerase II. Genes Dev. 10, 2657-2683.
Orphanides, G., Wu, W.H., Lane, W.S., Hampsey, M., Reinberg, D. (1999). The
Chromatin-Specific Transcription Elongation Factor FACT Comprises
Human SPT16 and SSRP1 Proteins. Nature 400:284-288.
Parada, C. A., and Roeder, R. G. (1996). Enhanced Processivity of RNA Polymerase II
Triggered by Tat-Induced Phosphorylation of its Carboxy-Terminal
Domain. Nature 384:375-378.

146
Pérmica, D., Newin, G. E., Hayflick, J. S., Seeburg, P. H., Derynck, R., Palladino, M. A.,
Kohr, W. J., Aggarwal, B. B., and Goeddel, D. V. (1984). Human
Tumour Necrosis Factor: Precursor Structure, Expression and Homology
to Lymphotoxin. Nature 312:724-729.
Pham, A.D., and Sauer, F. (2000). Ubiquitin-Activating/Conjugating Activity of
TAF(II)250, A Mediator of Activation of Gene Expression in Drosophila.
Science 289:2357-2360.
Picard, D., and Schaffner, W. (1984). A Lymphocte-Specific Enhancer in the Mouse
Immunoglobulin k Gene. Nature 307:80-82.
Pierce, J. W., Schoenleber, G. J., Jesmok, G., Best, J., Moore, S. A., Collins, T., and
Gerritsen, M. E. (1997). Novel Inhibitors of Cytokine-Induced Ikappa B
alpha Phosphorylation and Endothelial Cell Adhesion Molecule
Expression Show Anti-Inflammatory Effects In Vivo. J. Biol. Chem.
272:21096-21103.
Poyton, R. O. and McEwen, J. E. (1996). Crosstalk between Nuclear and Mitochondrial
Genomes. Ann. Rev. Biochem. 65:563-607.
Priestle, J. P., Schar, H. P., and Grutter, M. G. (1988). Crystal Structure of the Cytokine
Interleukin-1 beta. EMBO J. 7:339-343.
Priestle, J. P., Schar, H. P., and Grutter, M. G. (1989). Crystallographic Refinement of
Interleukin 1 beta at 2.0 A Resolution. Proc. Natl. Acad. Sci. USA
86:9667-9671.
Privalle, C. T., and Fridovich, I. (1993). Iron Specificity of the Fur-Dependent Regulation
of the Biosynthesis of the Manganese-Containing Superoxide Dismutase
in Escherichia Coli. J. Biol. Chem. 269, 5178-5181.
Ptashne, M. (1986). Gene Regulation by Proteins Acting Nearby and at a Distance.
Nature 322. 697-701.
Ptashne, M. and Gann, A. (1997). Transcriptional Activation by Recruitment. Nature
386:560-577.
Pugh, B. F. and Tijian, R. (1991). Transcription from a TATA-less Promoter Requires a
Multisubunit TFIID Complex. Genes & Dev. 5:1935-1945.
Queen, C. and Baltimore, D. (1983). Immunoglobulin Gene Transcription Is Activated by
Downstream Sequence Elements. Cell 33:741-748.
Queen, C. and Stafford, J. (1984). Fine Mapping of an Immunoglobulin Gene Activator.
Mol. Cell. Biol. 4:1042-49.

147
Ranganath, S., Ouyang, W., Bhattarcharya, D., Sha, W. C., Grupe, A., Peltz, G., and
Murphy, K. M. (1998). GATA-3-Dependent Enhancer Activity in IL-4
Gene Regulation. J. Immunol. 161:3822-3826.
Remade, J., Raes, M., Toussaint, O., Renard, P., and Rao, G. (1995). Low Levels of
Reactive Oxygen Species as Modulators of Cell Function. Mutat. Res.
316:103-122.
Rietschel, E. H. and Brade, H. (Aug. 1992). Bacterial Endotoxin. Scientific American 54-
61.
Roeder, R. G. (1996). The Role of General Initiation Factors in Transcription by RNA
Polymerase II. Trends Biochem. Sci. 21, 327-335.
Rogers, R. J., Chesrown, S. E., Kuo, S., Monnier, J. M., and Nick, H. S. (2000).
Cytokine-Inducible Enhancer with Promoter Activity in Both the Rat and
Human Manganese-Superoxide Dismutase Genes. Biochem. J. 347:233-
242.
Rollins, R.A., Morcillo, P., and Dorsett, D. (1999). Nipped-B, A Drosophila Homologue
of Chromosomal Adherins, Participates in Activation by Remote
Enhancers in the Cut and Ultrabithorax Genes. Genetics 152:577-93.
Rosenberg, M., and Court, D. (1979). Regulatory Sequences Involved in the Promotion
and Termination of RNA Transcription. Ann. Rev. Genet. 13:319-53.
Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989). Molecular Cloning: A Laboratory
Manual, second edition, Cold Spring Harbor Laboratory Press, Cold
Spring Harbor, NY.
Sanchez-Alcazar, J. A., Hernandez, I., del la Torre, M. P., Garcia, L, Santiago, E.,
Munoz-Yague, M. T., and Solis-Herruzo, J. A. (1995). Down-Regulation
of Tumor Necrosis Factor Receptors by Blockade of Mitochondrial
Respiration. J. Biol. Chem. 270:23944-23950.
Sanchez-Alcazar, J. A., Ruiz-Cabello, J., Hemandez-Munoz, L, Pombre, P. S., del la
Torre, P., Siles-Rivas, E., Garcia, L, Kaplan, O., Munoz-Yague, M. T.,
and Solis-Herruzo, J. A. (1997). Tumor Necrosis Factor-alpha Increases
ATP Content in Metabolically Inhibited L929 Cells Preceding Cell Death.
J. Biol. Chem. 272:30167-30177.
Sauer, F., Hansen, S. K., and Tijian, R. (1995). Multiple TAF IIs Directing Synergistic
Activation of Transcription. Science 270, 1783-1788.

148
Schmidt, K. N., Traenckner, E. B., Meier, B., and Baeuerle, P. A. (1995). Induction of
Oxidative Stress by Okadaic Acid Is Required for Activation of
Transcription Factor NF-kappa B. J. Biol. Chem. 270:27136-27142.
Schreck, R., Rieber, P., and Baeuerle, P. A. (1991). EMBO J. 10:2247-2258.
Schulze-Osthoff, K., Bakker, A. C., Vanhaesebroeck, B., Beyaert, R., Jacob, W. A., and
Fiers, W. (1992). Cytotoxic Activity of Tumor Necrosis Factor is
Mediated by Early Damage of Mitochondrial Functions. Evidence for the
Involvement of Mitochondrial Radical Generation. J. Biol. Chem.
267:5317-5323.
Schulze-Osthoff, K., Beyaert, R., Vandevoorde, V., Haegeman, G., and Fiers, W. (1993).
Depletion of the Mitochondrial Electron Transport Abrogates the
Cytotoxic and Gene-Inductive Effects of TNF. EMBO J. 12:3095-3104.
Schumann, R. R., Leong, S. R., Glaggs, G. W., Gray, P. W., Wright, S. D., Mathison, J.
C., Tobias, P. S., and Ulevitch, R. J. (1990). Structure and Function of
Lipopolysaccharide Binding Protein. Science 249:1429-1431.
Selden, R. F., Howie, K. B., Rowe, M. E., Goodman, H. M., and Moore, D. D. (1986).
Human Growth Hormone as a Reporter Gene in Regulation Studies
Employing Transient Gene Expression. Mol. Cell. Biol. 6:3173-3179.
Shaffer, J. B., Treanor, C. P., and Del-Vecchio, P. J. (1990). Expression of Bovine and
Mouse Endothelial Cell Antioxidant Enzymes Following RNF-alpha
Exposure. Free Rad. Biol. Med. 8:497-502.
Shields, J.M. and Yang, V.W. (1998). Identification of the DNA Sequence that Interacts
with the Gut-Enriched Kruppel-like Factor. Nucleic Acids Res. 26, 796-
802.
Shull, S., Heintz, N. H., Periasamy, M., Manohar, M., Janssen, Y. M., Marsh, J. P., and
Mossman, B. T. (1991). Differential Regulation of Antioxidant Enzymes
in Response to Oxidants. J. Biol. Chem. 266:24398-24403.
Simkevich, C. P., Thompson, J. P., Poppleton, H., and Raghow, R. (1992). The
Transcriptional Tissue Specificity of the Human Pro alpha 1 (I) Collagen
Gene Is Determined by a Negative CA-Regulatory Element in the
Promoter. Biochem. J. 286:179-185.
Slot, J., Geuze, H., Freeman, B., and Crapo, J. D. (1986). Intracellular localization of the
Copper-Zinc and Manganese Superoxide Dismutases in Rat Liver
Parenchymal Cells. Lab. Invest. 55:363-371.

149
Stafford, J., and Queen, C. (1983). Cell-Type Specific Expression of a Transfected
Immunoglobulin Gene. Nature 306:77-79.
Stephanz, G. B., Gwinner, W., Cannon, J. K., Tisher, C. C., and Nick, H. S. (1996). Heat-
Aggregated IgG and Interleukin-1 beta Stimulate Manganese Superoxide
Dismutase in Mesangial Cells. Exp. Nephrol. 4:151-158.
Surpin, M., and Chory, J. (1997). The Co-ordination of Nuclear and Organellar Genome
Expression in Eukaryotic Cells. Essays Biochem. 32:113-125.
Suzuki, K., Tatsumi, H., Satoh, S., Senda, T., Nakata, T., Fujii, J, and Taniguchi, N.
(1993). Manganese-Superoxide Dismutase in Endothelial Cells:
Localization and Mechanism of Induction. Am. J. Physiol. 265 :H1173-
1178.
Takimoto, Y. and Kuramoto, A. (1993). Presence of a Regulatory Element within the
First Intron of the Human Platelet-Derived Growth Factor-A Chain Gene.
Jpn. J. Cancer Res. 84:1268-1272.
Tan, S., Sagara, Y., Liu, Y., Maher, P., and Schubert, D. (1998). The Regulation of
Reactive Oxygen Species Production During Programmed Cell Death. L
Cell Biol. 141:1423-1432.
Tartaglia, L. A. and Goeddel, D. V. (1992). Two TNF Receptors. Immunol. Today
13:151-153.
Tartaglia, L. A., Rothe, M., Hu, Y.-F., and Goeddel, D. V. (1993). Tumor Necrosis
Factor’s Cytotoxic Activity is Signaled by the p55 TNF Receptor. Cell
73:213-216.
Thanos, D. and Maniatis, T. (1992). The High Mobility Group Protein HMG I(Y) Is
Required for NF-kB Dependent Virus Induction of the Human IFN-(3
Gene. Cell 71:777-789.
Thanos, D., Du, W., and Maniatis, T. (1993). The High Mobility Group Protein HMG
I(Y) Is An Essential Structural Component of a Virus Inducible Enhancer
Complex. Cold Spring Harbor Symp. Quant. Biol. 58:73-81.
Thierbach, G., and Reichenbach, H. (1981). Myxothiazol, A New Inhibitor of the
Cytochrome b-cl Segment of the Respiratory Chain. Biochim. Biophys.
Acta 638:282-289.
Thomberry, N. A., Bull, H. G., Calaycay, J. R., Champman, K. T., Howard, A. D.,
Kostura, M. J., Miller, D. K., Molineaux, S. M., Weidner, J. R., and
Anunins, J. (1992). A Novel Heterodimeric Cysteine Protease Is Required
for Interleukin-1 beta Processing in Monocytes. Nature 356:768-774.

150
Tijan, R. and Maniatis, T. (1994). Transcriptional Activation: A Complex Puzzle with
Few Easy Pieces. Cell 77:5-8.
Tobias, P. S., Mathison, J. C., and Ulevitch, R. J. (1988). A Family of
Lipopolysaccharide Binding Proteins Involved in Responses to Gram¬
negative Sepsis. J. Biol. Chem. 263:13479-13481.
Treuter, E., Johansson, L., Thomsen, J. S., Wammark, A., Leers, J., Pelto-Huikko, M.,
Sjoberg, M., Wright, A. P., Spyrou, G., and Gustafsson, J. A. (1999).
Competition between Thyroid Hormone Receptor-Associated Protein
(TRAP) 220 and Transcriptional Intermediary Factor (TIF) 2 for Binding
to Nuclear Receptors. Implications for the Recruitment of TRAP and pi 60
Coactivator Complexes. J. Biol. Chem. 274:6667-6677.
Tsujimoto, M., Yip, Y. K., and Vilcek, J. (1985). Tumor Necrosis Factor: Specific
Binding and Internalization in Sensitive and Resistant Cells. Proc. Natl.
Acad. Sci. USA 82:7626-7630.
Tyndall, C., La Mantia, G., Thacker, C. M., Favaloro, J., and Kamen, R. (1981). A
Region of the Polyoma Virus Genome between the Replication Origin and
Late Protein Coding Sequences Is Required in Cis for Both Early Gene
Expression and Viral DNA Replication. Nucl. Acids Res. 9, 6231-6250.
Valentine, J. F., and Nick, H. S. (1992). Acute-Phase Induction of Manganese Superoxide
Dismutase in Intestinal Epithelial Cell Lines. Gastroenterol. 103:90-912.
Vinson, C. R., LaMarco, K. L., Johnson, P. F., Landschulz, W. H., and McKnight, S. L.
(1988). In Situ Detection of Sequence-Specific DNA Binding Activity
Specified by a Recombinant Bacteriophage. Genes & Dev. 2:801-806.
Visner, G. A., Dougall, W. C., Wilson, J. M., Burr, I. A., and Nick, H. S. (1990).
Regulation of Manganese Superoxide Dismutase by Lipopolysaccharide,
Interleukin-1, and Tumor Necrosis Factor: Role of the Acute
Inflammatory Response. J. Biol. Chem. 265:2856-2864.
Visner, G. A., Block, E. R., Burr, I. M., and Nick, H. S. (1991). Regulation of Manganese
Superoxide Dismutase in Porcine Pulmonary Artery Endothelial Cells.
Am. J. Physiol. 260:L444-449.
Visner, G. A., Chesrown, S. E., Monnier, J., Ryan, U. S., and Nick, H. S. (1992).
Regulation of Manganese Superoxide Dismutase: IL-1 and TNF Induction
in Pulmonary Artery and Microvascular Endothelial Cells. Biochem.
Biophvs. Res. Comm. 188:453-462.

151
von Sonntag, C. (1987). The Chemical Basis of Radiation Biology. Taylor & Francis,
London.
Warner, B. B., Bunhans, M. S., Clark, J. C., and Wispe, J. R. (1991). Tumor Necrosis
Factor-alpha Increases Mn-SOD Expression: Protection against Oxidant
Injury. Am. J. Physiol. 260:L296-301.
Warner, B. B., Stuart, L., Gebb, S., and Wispe, J. R. (1996). Redox Regulation of
Manganese Superoxide Dismutase. Am. J. Physiol. 271:L150-158.
Weisinger, R. A., and Fridovich, I. (1973). Superoxide Dismutase: Organelle Specificity.
J. Biol. Chem. 248:3582-3592.
Welboum, C. R. B. and Young, Y. (1992). Endotoxin, Septic Shock and Acute Lung
Injury: Neutrophils, Macrophages and Inflammatory Mediators. Br. J.
Sure. 79:998-1003.
Whitsett, J. A., Clark, J. C., Wispe, J. R., and Pryhuber, G. S. (1992). Effects of TNF-
alpha and Phorbol Ester on Human Surfactant Protein and MnSOD Gene
Transcription In Vitro. Am. J. Physiol. 262:L688-693.
Wispe, J. R., Warner, B. B., Clark, J. C., Dey, C. R., Neuman, J., Glasser, S. W., Crapo,
J. D., Chang, L., and Whitsett, J. A. (1992). Human Mn-Superoxide
Dismutase in Pulmonary Epithelial Cells of Transgenic Mice Confers
Protection from Oxygen Injury. J. Biol. Chem. 267:23937-23941.
Wong, G. H. W., and Goeddel, D. V. (1988). Induction of Manganous Superoxide
Dismutase by Tumor Necrosis Factor: Possible Protective Mechanism.
Science 242:941-944.
Wong, G. H. W., Elwell, J., Oberly, L., and Goeddel, D. V. (1989). Manganous
Superoxide Dismutase is Essential for Cellular Resistance to Cytotoxicity
of Tumor Necrosis Factor. Cell 58:923-931.
Woo, C. H„ Eom, Y. W„ Yoo, M. H., You, H. J., Han, H. J., Song, W. K., Yoo, Y. J.,
Chun, J. S., and Kim, J. H. (2000). Tumor Necrosis Factor-a Generates
Reactive Oxygen Species via a Cytosolic Phospholipase A2-Linked
Cascade. J. Biol. Chem. (in press).
Workman, J. L. and Kingston, R. E. (1998). Alteration of Nucleosome Structure as a
Mechanism of Transcriptional Regulation. Ann. Rev. Biochem. 67:545-
579.
Wright, S. D., Ramos, R. A., Tobias, P. S., Ulevitch, R. J., and Mathison, J. C. (1990).
CD 14, A Receptor for Complexes of Lipopolysaccharide (LPS) and LPS
Binding Protein. Science 249:1431-1433.

152
Yie, J., Liang, S., Merika, M., and Thanos, D. (1997). Intra- and Intermolecular
Cooperative Binding of High-Mobility-Group Protein I (Y) to the Beta-
Interferon Promoter. Mol. Cell. Biol. 17:3649-3662.
Zhang, W., Shields, J. M., Sogawa, K., Fujii-Kuriyama, Y., and Yang, V. W. (1998). The
Gut-Enriched Kruppel-like Factor Suppresses the Activity of the CYP1A1
Promoter in an Spl-Dependent Fashion. J. Biol.Chem. 273, 17917-17925.
Zhao, X. J., Raitt, D., Burke, P. V., Clewell, A. S., Kwast, K. E., and Poyton, R. O.
(1996). Function and Expression of Flavohemoglobin in Saccharomyces
cerevisiae. Evidence for a Role in the Oxidative Stress Response. J. Biol.
Chem. 271:25131-25138.
Zhou, J., and Levine, M. (1999). A Novel Cw-Regulatory Element, the PTS, Mediates an
Anti-Insulator Activity in the Drosophola Embryo. Cell 99:567-575.

BIOGRAPHICAL SKETCH
Richard James Rogers was bom on September 24, 1957, to Richard Rowe Rogers
and Eleanor Frances Rogers, in Lowell, Massachusetts. He attended Central Catholic
High School in Lawrence, Massachusetts, graduating in May 1975. He continued his
education by attending Boston College in Chestnut Hill, Massachusetts, graduating
summa cum laude with a Bachelor of Science degree in chemistry. After college, he was
accepted to the University of Massachusetts Medical School from which he received his
Doctor of Medicine degree in June 1983. During the following three years he trained in
the medical specialty of internal medicine at the Brigham & Women’s Hospital in
Boston, Massachusetts, and the Berkshire Medical Center in Pittsfield, Massachusetts.
From 1986 to 1991, he served as Director of Emergency Services at Harrington Memorial
Hospital in Southbridge, Massachusetts, as well as an Instructor in the Department of
Emergency Medicine at the University of Massachusetts Medical Center in Worcester,
Massachusetts. From 1991 to 1994, he trained in the medical specialty of anesthesiology
in the Department of Anesthesiology at the University of Florida College of Medicine in
Gainesville, Florida, where he currently holds the title of Instructor and is involved the
clinical care of patients and the supervision and teaching of resident physicians and
medical students. He entered the doctoral program in biochemistry and molecular
biology at the University of Florida in the fall of 1994. Upon completion of the Doctor of
Philosophy degree, he will continue as an Assistant Professor in the Department of
Anesthesiology at the University of Florida College of Medicine in Gainesville, Florida.
153

I certify that I have read this study and that in my opinion it conforms to
acceptable standards of scholarly presentation and is fully adequate, in scope and quality,
as a dissertation for the degree of Doctor of Philosophy.
Harry S.
Professor
, Chair
Neuroscience
I certify that I have read this study and that in my opinion it conforms to
acceptable standards of scholarly presentation and is fully adequate, in scope and quality,
as a dissertation for the degree of Doctor of Philosophy
lcn&el S. Kilberg
Professor of Biochemistry anls
Molecular Biology
I certify that I have read this study and that in my opinion it conforms to
acceptable standards of scholarly presentation and is fully adequate, in scope and quality,
as a dissertation for the degree of Doctor of Philosophy^-?
Brian D. Cain
Professor of Biochemistry and
Molecular Biology
I certify that I have read this study and that in my opinion it conforms to
acceptable standards of scholarly presentation and is fully adequate, in scope and quality,
as a dissertation for the degree of Doctor of Philosophy.
Sarah E. Chesrown
Associate Professor of Biochemistry and
Molecular Biology
I certify that I have read this study and that in my opinion it conforms to
acceptable standards of scholarly presentation andJsJully adequate, iirpcope and quality,
as a dissertation for the degree of Doctor of Phi
1. Ferl
Professor of
icultural -Science

This dissertation was submitted to the Graduate Faculty of the College of
Medicine and to the Graduate School and was accepted as partial fulfillment of the
requirements for the degree of Doctor of Philosophy.
December 2000
Dean, College of Medicine
Dean, Graduate School

finíYiñS/IL?? FLORIDA
i ¿ •iü S ™ «i ni mili
3 1262 08555 2700



xml version 1.0 encoding UTF-8
REPORT xmlns http:www.fcla.edudlsmddaitss xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.fcla.edudlsmddaitssdaitssReport.xsd
INGEST IEID EXX6VKAV8_JTJWDY INGEST_TIME 2014-06-17T16:32:44Z PACKAGE AA00022100_00001
AGREEMENT_INFO ACCOUNT UF PROJECT UFDC
FILES