Citation
Transcriptional and post-transcriptional regulation of the CIT1 gene in Saccharomyces cerevisiae

Material Information

Title:
Transcriptional and post-transcriptional regulation of the CIT1 gene in Saccharomyces cerevisiae
Creator:
Lawson, Sobomabo D
Publication Date:

Subjects

Subjects / Keywords:
DNA ( jstor )
Ethanol ( jstor )
Gels ( jstor )
Genes ( jstor )
Half lives ( jstor )
Messenger RNA ( jstor )
Plasmids ( jstor )
RNA ( jstor )
Saccharomyces cerevisiae ( jstor )
Yeasts ( jstor )

Record Information

Rights Management:
Copyright [name of dissertation author]. Permission granted to the University of Florida to digitize, archive and distribute this item for non-profit research and educational purposes. Any reuse of this item in excess of fair use or other copyright exemptions requires permission of the copyright holder.
Resource Identifier:
50281687 ( OCLC )

Downloads

This item has the following downloads:


Full Text








TRANSCRIPTIONAL AND POST-TRANSCRIPTIONAL REGULATION OF
THE CIT1 GENE IN SACCHAROMYCES CEREVISIAE
















By

SOBOMABO D. LAWSON


A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE
REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY

UNIVERSITY OF FLORIDA


1995



























I dedicate this work to my family, especially to my wife and best friend,
Alaro Lawson. Without her love and support it would have been impossible for
me to complete this work. To my children, Banimi and Emi, who had to deal with
my many absences. Finally to my parents, who laid the foundation for my
education.












ACKNOWLEDGMENTS


I wish to thank the University of Florida to have given me the opportunity

to attend graduate school.

A special thanks goes to Dr. Alfred S. Lewin for allowing me to work in his

laboratory, but more important than that was his genuine care and concern for

me and all other members of the lab. His mentorship has been invaluable and

shall remain part of my scientific career.

I thank all the members of my committee for accepting that duty and giving

me the guidance to improve my ability. I would like to pay special thanks to Dr.

Henry V. Baker, who first taught me a lot about yeast, for the many innumerable

ways he has helped me over the years.

To the members of Lewin's laboratory, I thank you all for making my stay

there a little less tedious. To Mr. James Thomas Jr., I thank you for all the help

you have given me. To Dr. Lynn C. Shaw, the Macintosh specialist, without your

help it would have been impossible to get all my figures ready in the last days.

To Mr. Bruce W. Ritching, I thank you for help editing part of the dissertation.

To my family, especially my wife Alaro Lawson, without you this would not

have been possible.













TABLE OF CONTENTS


ACKNOWLEDGMENTS ...................

ABSTRACT .............................

INTRODUCTION ........................

Utility of Baker's Yeast ...............
The Citrate Synthase System .........
Transcriptional Regulation in Eukaryotes
Glucose Repression ................
m RNA Stability .....................

MATERIALS AND METHODS ..............


. . . . . . . . . . . . iii


. . . . . v i

. . . . . 1


(rrnwfh r.nnrlitinn. nnrl Marlin


Yeast Transformation
Construction of 5' (DIS
Construction of InternE
Heterologous Fusion


mw ~ ~ n . . . . . . . . . . . . . . . .

TAL) and 3' (PROXIMAL) Deletions .........
Il D e letions .............................


Cloning of Oligonucleotides .................................. 38
Measurement of 13-Galactosidase Level in CITI-lacZ Fusion ........ 39
R N A Isolation ............................................. 40
Ribonuclease Protection Assay ............................... 42
Northern A analysis ......................................... 44
Primer Extension Analysis ................................... 46
In Vivo Footprinting ........................................ 47
Preparation of Single-Stranded DNA ........................... 51
Bandshift Assay/In Vitro Footprinting Analysis ................... 52
Messenger RNA Stability (5' UTR deletion) Assay ................ 55
Introduction of Stop Codon at the Fifth Amino Acid Position in the
C IT 1 G ene ............................................... 56

R E S U LT S ..................................................... 63

Analysis of 5' (Distal) and 3' (Proximal) Deletions ................. 63
Internal Deletions Show Several Putative UASs .................. 73
There are Multiple UAS Elements ............................. 77
Evidence for URS Element .................................. 84
Steady-State mRNA Levels Correlate with Enzyme Assay .......... 88


..............
..............
..............
..............
..............







Band Shift Assay and In Vitro Footprint Analysis .................. 91
In Vivo Footprint Analysis .................................. 103
CIT1 mRNA is More Stable in Cells Grown in Ethanol Than in
Cells Grown in Glucose ..................... .......... 108
CITI::IacZ Fusion mRNA Has a Similar Decay Rate As Full-Length CIT1
...... ...................................... 118
CIT1 mRNA From Cells Grown in YPD and YPE Media Have
Identical 5' Mature Ends ................................... 127
The Glucose-Dependent Instability Element Lies Within the CIT1
C oding Region ........................................... 130
Sequences Within the 5' Terminus of CIT1 mRNA Confer
Nonsense-Mediated Decay ................................. 136

SUMMARY AND DISCUSSION ................................... 140

Cis-acting Elem ents ....................................... 142
Nutrient Requirement on the Expression of CIT1 ................ 151
HAP2/HAP3/HAP4 Independent Expression of CIT1 ............. 153
m R NA Stability ........................................... 157
Future G oals ............................................ 164

BIBLIO G RA PHY ............................................... 167

BIOGRAPHICAL SKETCH ....................................... 182













Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy

TRANSCRIPTIONAL AND POST-TRANSCRIPTIONAL REGULATION OF THE
CIT1 GENE IN SACCHAROMYCES CEREVISIAE

By

Sobomabo D. Lawson

May, 1995


Chairperson: Dr. Alfred S. Lewin
Major Department: Molecular Genetics and Microbiology

Citrate synthase catalyzes the condensation of oxaloacetate with acetyl-

CoA to form citrate, a reaction that takes place in both the tricarboxylic acid cycle

and the glyoxylate pathway. The tricarboxylic acid cycle occurs in the inner

compartment of the mitochondrion. In yeast Saccharomyces cerevisiae,

mitochondrial citrate synthase is encoded by CIT1, a nuclear gene.

This gene, like most other genes encoding mitochondrial enzymes, is

severely repressed when yeast is grown in the presence of glucose. These

genes become fully derepressed when glucose is totally utilized or when cells are

grown in ethanol, a nonfermentable carbon source. To understand at what stage

this regulation occurs, I examined transcriptional and post-transcriptional control

of CIT1. Deletions of the 5' non-coding region of the gene, in a CITI::IacZ hybrid,







identified several upstream activating sequences (UASs) that positively affected

the transcription of the gene. Near the distal (5') end of the insert there is also an

upstream repressing sequence (URS) that affects the transcription. Another

URS element was found at the proximal end of the 5' non-coding region that

affected transcription only in glucose medium. These results suggest a

combinatorial regulation of CIT1 by different factors in a carbon source-

dependent and -independent manner. A second level of carbon source-

dependent control was the regulation of the stability of the mRNA in the different

growth media. In ethanol medium, the half-life of CIT1 mRNA was more than

twice that in glucose medium. Deletion analysis showed that the first 78

nucleotides of the 5' coding region of the mRNA contain a sequence element that

is necessary and sufficient for glucose-dependent mRNA degradation.

Introduction of a stop codon at the fifth amino acid position also caused rapid

degradation of the hybrid mRNA, showing that it contained all the elements that

were sufficient to confer nonsense-mediated decay.

These results demonstrate an example of metabolic regulation of gene

expression occurring at two levels, transcription and mRNA stability, each

contributing a portion of the overall regulation.












INTRODUCTION


Utility of Baker's Yeast



Baker's yeast, Saccharomyces cerevisiae, is a eukaryote that has been

studied extensively. It is a unicellular organism with 16 chromosomes of

approximately 12.5 Mb of DNA (Olson, 1992). Yeast has a generation time of

about 90 minutes to several hours, depending on whether it is grown in a

complex medium or a minimal medium, and on the carbon source provided in the

medium. There are several advantages of using this organism as a model

system to dissect eukaryotic functions: 1) It is amenable to genetic manipulation

because the genome size is small compared to higher eukaryotes. 2) It can

survive with a haploid genome making it possible to dissect metabolic pathways

using mutations. 3) Yeast is a facultative anaerobe, making respiratory

functions dispensable. 4) Many genes, particularly those involved in

transcriptional regulation, have mammalian homologs that are structurally and

functionally well conserved. These include RNA polymerase II (Nonet et al.,

1987), GCN4/JUN (Struhl, 1988), TATA binding proteins (TBP) (Cormack et al.,

1994; Reddy and Hahn, 1991; Gill and Tjian, 1991), and CP1/HAP2-3 (Chodosh

et al., 1988b). The gene products of these homologs can complement each







2

other in in vitro assays. In vivo studies have shown that JUN can complement a

gcn4 mutation in yeast (Struhl, 1988). Yeast is particularly useful for studying

mitochondrial enzymes because it is a facultative anaerobe: mutations

eliminating aerobic energy metabolism are not lethal but can be identified by their

inability to grow on glycerol plates.



The Citrate Svnthase System



Citrate synthase catalyzes the first committed step of the tricarboxylic acid

cycle (TCA), the condensation of oxaloacetate and acetyl CoA. The role of this

pathway in cellular metabolism is twofold. First, the TCA cycle provides the

carbon skeletons used in many biosynthetic pathways such as the synthesis of

glutamate and aspartate. Second, the cycle is oxidative, generating NADH,

which drives the synthesis of ATP. Two different nuclear genes code for

isozymes of citrate synthase (Suissa et al., 1984; Kim et al., 1986; Rosenkrantz

et al., 1986; Rickey and Lewin, 1986). They are CIT1 and CIT2, encoding the

mitochondrial and peroxisomal pathway enzymes, respectively (Lewin et al.,

1990). The CIT2 gene product is involved in the glyoxylate pathway that

produces carbon skeletons for other biosynthetic pathways. The difference in the

cellular location of these two enzymes lies in the N-terminal mitochondrial

targeting sequence on Citlp that is lacking in Citp2 (Rosenkrantz et al., 1986). In

strains in which the CIT1 gene is disrupted, cells still grow on non-fermentable

carbon sources, and some citrate synthase activity is found in the mitochondrial







3

fraction, suggesting that there may be a cryptic mitochondrion targeting

sequence in the Cit2p (Rickey and Lewin, 1986; Rosenkrantz et al., 1986). The

activity of Citl p is severely repressed when cells are grown in a glucose medium.

When glucose is depleted, or when cells are grown in a non-fermentable carbon

source, the enzyme level increases (derepression) (Hoosein and Lewin, 1984).

This increase in enzyme activity (derepression) correlates with an increase in

steady-state mRNA levels (Kim et al., 1986), and a greater amount of

translatable mRNA (Hoosein and Lewin, 1984). The appearance of increased

mRNA in the derepressed state suggested that regulation of the CIT1 gene may

occur at the transcriptional level. The other possibility is that the increase could

be due to increased stability of the message. Differential stability of mRNA due

to environmental or cellular signals has been demonstrated for other messages

encoded by SP011, SP012, and SP013 genes (required for sporulation) of

yeast (Surosky and Esposito, 1992; Surosky et al., 1994); interleukin 3 (IL-3)

(Wodnar-Filipowicz and Moroni, 1990), and 9E3 mRNA, which encodes an

inflammatory mediator (Stoeckle and Hanafusa, 1989). The SPO transcripts are

much less stable in vegetative growth than they are when cells are in meiosis.

The IL-3 and 9E3 mRNAs are made more stable by calcium ionophores and

serum, respectively (Wodnar-Filipowicz and Moroni, 1990; Stoeckle and

Hanafusa, 1989).

Our goal is to dissect how the CIT1 gene is regulated at both the

transcriptional and mRNA stability level. Since little is known about the

mechanism of mRNA decay, we hope that the results of this study may give us







4

an insight about the cis and trans elements that are involved in messenger RNA

degradation. The CIT1 gene was chosen as a model to study gene regulation

because of its strategic position in cellular metabolism. As stated earlier, cellular

respiration requires citrate synthase because it catalyzes the first step in the TCA

cycle. The reactions of the TCA cycle are required to generate the reducing

power needed in the electron transport chain, which reduces molecular 02 and is

coupled to the production of ATP. Carbon skeletons are also generated from the

reactions of the TCA cycle for amino acid biosynthesis. The first indication of

unique regulation of citrate synthase came from the work of Satrustegui and

Machado (1977) who showed that induction was not inhibited by cycloheximide

following aeration of an anaerobic culture. This observation suggested that the

precursor for citrate synthase was already present in cultures growing under

repressed growth conditions, and induction does not require de novo protein

synthesis. Understanding how this gene is regulated differently from the related

CIT2 gene may serve as a paradigm as to how cells can regulate genes serving

the same function in different cellular locations.



Transcriptional Regulation in Eukaryotes



The expression of many genes is controlled at the level of transcription.

For this reason understanding how genes are transcriptionally regulated is one of

the fundamental goals in molecular biology.







5

There are two classes of transcriptional regulatory elements in eukaryotes,

cis- and trans-acting elements (Struhl, 1989). The promoter and enchancer

elements of mammalian genes or the upstream activating sequences (UAS) of

yeast genes constitute cis-acting elements. Upstream repressing sequences

(URS) in yeast are also cis-acting elements. The promoter is made up of the

transcriptional initiation site, the TATA sequences and other proximal elements,

such as SpIl sites (Struhl, 1989). The transcriptional initiation site defines the

first nucleotide incorporated into the newly synthesized mRNA. Many genes

have a single initiation site, but there are some genes that have several initiation

sites, especially in yeast (Fay et al., 1981; Hahn et al., 1985; Repetto and

Tzagoloff, 1990). In yeast, when the distance between the TATA element and

the initiation site is experimentally varied, transcription still starts at defined

positions (Chen and Struhl, 1985). This fact contrasts with mammalian genes in

which changing the position of the TATA element forces the transcription to start

approximately 25-30 bp downstream from the new TATA site. This result would

suggest that the start of mRNA transcription is sequence-dependent in yeast,

whereas it is distance-dependent in mammals. TATA elements are always

situated upstream but near the initiation sites and are found in most class II

transcribed genes. Class II genes constitute those genes that encode proteins

and are transcribed by RNA polymerase II. In yeast, the TATA sequence is

located between 40-120 bp upstream from the start site (Brent, 1985; Chen and

Struhl, 1985). Although the TATA sequence is required for transcription initiation

of most genes, approximately 20% of eukaryotic genes have neither the







6

conserved classical TATAAA sequence nor is it required for transcription

initiation. The PGK gene of yeast and the terminal deoxytransferase gene of

mammalian cells are examples of genes that do not require a TATA sequence

(Ogden et al., 1986). This means that there are other cis-elements necessary for

transcription initiation which have yet to defined. There are also different classes

of the TATA sequence. The HIS3 gene contains a TATA element that is involved

only in constitutive transcription (.Tc) and another TATA sequence that is involved

in regulated expression (TR) (Harbury and Struhl, 1989; Chen and Struhl, 1988).

The work of Chen and Struhl (1985) showed that sequences downstream of the

TATA elements are also important for proper transcription initiation, since

mutations surrounding the start site move the site to a different location.

Mutations at certain positions in the sequence TATAAA discriminated between

the GCN4 and GAL4 as transcriptional activators, suggesting that the

mechanisms of activation or the accessory factors required for activation are

different for the various activators. The basic transcriptional machinery proteins

including RNA polymerase II and TFIIA through F bind to the TATA sequence in

a sequential manner to initiate transcription (Buratowski et al., 1989).

Enhancers are sequences that increase the transcription of genes when

bound to their cognate factors (Dynan, 1989). They may be situated up to 50 kb

from the initiation site and still affect transcription in either orientation and can

function whether present upstream or downstream from the transcription unit.

Enhancers are modular in nature, made up of identical or a mixture of different

enhanson elements that usually work synergistically (Dynan, 1989). Enhanson is







7

defined as the minimum discrete sequence that binds to a transcriptional factor.

Yeast cells lack enhancers such as those of mammalian cells but instead contain

upstream activating sequences (UAS) that bind activating proteins (Guarente,

1987; Struhl, 1993). Unlike enhancers elements, UASs can only function when

placed upstream from the transcriptional start site (Guarente and Hoar, 1984).

The UASs usually function in either orientation when situated between 20-1500

bp from the TATA element. They are usually 9-30 bp in length and may or may

not have a dyad symmetry. Those with dyad symmetry usually bind to

homodimers or heterodimers of a specific activator. Therefore, UAS elements

resemble proximal promoter elements such as Spl sites more than they do true

enhancers. Operators or upstream repressing sequences (URS) bind to

negative acting trans-acting factors and repress gene expression. These

elements usually lie between the UAS and the TATA elements and prevent

activation by activators, but have also been shown to lie up to 2 kb upstream or

downstream of the mRNA initiation site (Brand et al., 1985) and still affect

transcription. Binding to UAS or URS may be mutually exclusive if they have

overlapping sequences or they may be independent of one another.

Trans-acting factors constitute the second class of transcriptional

regulatory elements. These are proteins that bind to DNA at specific sites. The

RNA polymerase II and ancillary proteins such as TFIIA thru F make up the basic

transcriptional machinery. The RNA polymerase II of yeast has 12 subunits

(Thuriaux and Sentenac, 1992); the largest subunit (220 kD) is encoded by the

gene RPBI. This subunit is similar to the largest mammalian subunit and shares







8

similarities with the largest subunit of the yeast RNA polymerase III and the P'

subunit of the E. coli RNA polymerase. In yeast, the carboxy terminal domain

(CTD) of Rpbl1p has a set of seven amino acids (PTSPSYS) repeated 26 times.

In the largest subunit of mammalian RNA polymerase II, the CTD is repeated 52

times (Corden et al., 1985). The Rpbl1p is essential for viability, and deletion of

the CTD is lethal (Nonet et al., 1987). A deletion that left only 11 or 12 of the

repeat units allowed viability but caused a cold-sensitive phenotype (Nonet et al.,

1987). Some of the subunit polypeptides found in RNA polymerase II are shared

by RNA polymerase I and Ill.

The first factor that binds to the DNA and allows for the formation of a

competent transcription complex is the TFIID. In mammalian cells, TFIID

consists of the TATA-binding protein (TBP) and the TBP-associated factors

(TAFs) whereas in yeast only a single protein, TBP, has been identified to carry

out this function. In a DNase I protection assay in vitro, the TBP protects

approximately 19 bp, suggesting that sequences beyond the TATA element are

necessary for proper functioning (Buratowski et al., 1989). Ironically, TBP alone

is not sufficient to form a DNA/protein complex in a bandshift assay except when

TFIIA is present in the complex (Buratowski et al., 1989). The TBP does not

have any recognizable DNA binding motif, but it has a highly basic C-terminus.

There are two direct repeats at the C-terminus, separated by a stretch of basic

residues. The yeast TBP (yTBP) and the human (hTBP) are functionally

interchangeable in an in vitro transcription assay, but the hTBP cannot

complement a strain deleted for the SPT15 gene which encodes TBP (Gill and







9

Tjian, 1991; Cormack et al., 1991). Cell viability could be restored by a hybrid

protein, if the C-terminal domain was derived from yeast (Cormack et al., 1991).

This would suggest that the species specificity determinants lie in this region. To

determine the exact amino acids(s) responsible for the species specificity,

Cormack et al. (1994) selected for a hTBP/yTBP hybrid protein, which could

support faster yeast growth. The starting hybrid contained a human C-terminal

domain which had been shown to support growth at a very slow pace. This

selection identified three independent mutants that changed arginine 231 to

lysine. Interestingly, lysine occupies an identical position in the native yTBP. In

addition, mutation at this position in an otherwise intact hTBP supported growth

of yeast. After the initial binding by TBP, other factors bind to the TATA and

surrounding sequences (Buratowski et al., 1989). The order in which the basic

transcription factors come into the preinitiation complex was shown by bandshift

assay to be as follows: TFIID, TFIIA, TFIIB, RNA polymerase II, TFIIE, then

TFIIF/H complex (Buratowski et al., 1989). Assembly of these factors forms the

preinitiation complex. Transition to the initiation phase is preceded by

phosphorylation of the CTD of polymerase II by TFIIH factor (Lu et al., 1992).

Other factors playing significant roles in transcriptional regulation of genes

include activating, repressing, and inducing factors (Struhl, 1989; Guarente,

1992). These factors are required for proper regulation of individual genes. The

most studied of these secondary factors are the activator proteins. These

proteins usually have a modular structure, each one of the modules being

capable of functioning independently. The "domain swap" experiment with LexA







10

and Gal4 by Brent and Ptashne (1985) clearly illustrated that transcriptional

activators such as GAL4 have DNA-binding domains and activator domains, but

other activators such as glucocorticoid receptor and Hapl p also have ligand

binding domains that regulate the activators (Picard et al., 1988; Kim et al., 1990;

Chandler et al., 1983).

Many of the DNA-binding domains have identifiable structural motifs

involved in DNA binding. These include the: 1) helix-turn-helix motif (Pabo and

Lewis, 1982; Sauer et al., 1982), 2) zinc-finger domain (Laughon and Gelsteland,

1984), 3) leucine-zipper motif (Landshultz et al., 1988), and 4) P3-sheet motif

(Guarente, 1992). The helix-turn-helix motif is most commonly found among

prokaryotic DNA-binding proteins such as the A Cro and A repressor proteins

(Pabo et al., 1982) and CAP protein (Sauer et al., 1982). The helix-turn-helix

proteins usually have one a-helix followed by a turn, then a second a-helix. The

second helix is usually called the recognition helix because it fits into the major

groove of a B-form DNA, while the first helix seats above the groove. Many

homeotic gene proteins of Drosophila, such as the antennapediaa and engrailed

(McGinnis et al., 1984a; McGinnis et al., 1984b), also have a helix-turn-helix

motif similar to that described above; hence they are commonly referred to as the

homeodomains. Homeotic genes are defined as genes which when mutated

convert one body part into another. Yeast regulatory proteins having similar

structure are the al and al mating type regulators (Porter and Smith, 1986).

The zinc-finger motif was first discovered in the TFIIIA protein, a Xenopus

5S DNA-binding protein. One unit of zinc-finger motif usually consist of about 30







11

amino acid residues, containing the sequence pattern Cys-X2or4-Cys-Xi12-His-X3or5-

His. Binding of the zinc ion is coordinated by the 2 cysteine and histidine

residues (Miller et al., 1985). The yeast Adrl p, an activator of ADH2 gene, also

has a sequence composition similar to the zinc-finger motif. In another type of

zinc-finger, the ion binding is coordinated by four cysteine residues instead of 2

cysteine and 2 histidines. The yeast regulatory proteins Gal4p and Hapl p are

examples of this class of zinc-finger (Laughon and Gelsteland, 1984; Pfeifer et

al., 1987b; Kim et al., 1990). The Gal4p activates the GAL1-, -7, and -10 genes

that are required for galactose utilization by yeast (Braum et al., 1986). The

Haplp regulates several yeast genes such as CYC1 (Guarente et al., 1984;

Pfeifer et al, 1987a), CYC7 (Pfeifer et al, 1987b; Prezant et al., 1987), COX5A

(Trueblood et al., 1988), and CYT1 (Schneider and Guarente, 1991). An unusual

property of Haplp is its recognition of nonidentical UASs (Prezant et al., 1987).

The affinity for the different binding sites varies, allowing for flexibility in

regulation. The Haplp requires heme for activation (Pfeifer et al., 1987; Kim et

al., 1990).

A third common class of binding domain is the leucine-zipper found in

activators such as Gcn4p, avianjun, AP1, Myc, Fos, and C/EBP (Landshultz et

al., 1988). The zipper region of the protein has about 30 amino acids and a

leucine residue at every seventh position. This region of the protein is involved in

dimerization, either homologous or heterologous, necessary for DNA binding.

Located N-terminal to the zipper region is usually a stretch of basic residues that

actually binds to the DNA. This basic region can bind to DNA by itself if there is







12

a disulfide bond allowing dimerization. Additionally, there are other activators

which do not have an easily identifiable DNA-binding motif.

All of the transcriptional activators also have an activation domain.

Perhaps the most well characterized activation domain is the acidic activation

domain. These activator domains contain many negatively charged amino acids;

hence are often referred to as the "acidic-activation" domains (AAD). Studies by

Giniger and Ptashne (1987) in which a synthetic peptide was used with a

predicted amphipatic a-helix (AH) and net negative charge in conjunction with

the GAL4 DNA-binding domain, showed it was competent to activate

transcription in vivo, though only when over-expressed. Cloning of random

oligonucleotides from E. coli that could support activation resulted in sequences

with net negative charge (Ma and Ptashne, 1987). A gradual reduction in

activation potential was observed when some of these acidic residues were

removed from the Gcn4p (Hope et al., 1988). Together these results strongly

suggested the need for an acidic activation domain. However, as recently shown

(Leuther et al., 1993; Hoy et al., 1993), the ability to activate does not require

acidity or net negative charge. Rather, the most important criteria to function as

an activator was the ability to form a P3-pleated sheet. Replacement of the

negatively charged residues with non-charged or positively charged residues will

still support activation. The Gal4p and Gcn4p were shown to form a 3-sheet

under near physiological conditions (Hoy et al., 1993). Other defined activation

domains in mammalian cells are rich in glutamine, e.g. Spl (Courey and Tjian,

1988), or proline amino acid residues. These factors are usually found in







13

mammalian cells and do not function in yeast cells as the acidic activation

domains do.

As stated earlier, one of the hallmarks of enhancers is their ability to

regulate a gene from a distance, sometimes up to 50 kb. The UAS elements in

yeast usually lie within a few hundred bases of the TATA box. The question has

been, how do protein factors that bind to these sequence effect activation? The

current model to explain the ability of trans-factors to activate at a distance is that

DNA sequences between these activators and the basic transcription machinery

"loop-out", allowing protein-protein interaction between these factors (Hofmann et

al., 1989; Ptashne, 1986). Beside the transcriptional activators and proteins of

the basic transcriptional machinery, there are other intermediary factors,

commonly called adaptors, co-activators, or mediators (Kelleher et al., 1990;

Pugh and Tjian, 1990; Berger et al., 1992; Struhl, 1993). These factors do not

usually have DNA-binding domains but carry out their function by direct protein-

protein interaction. Their exact mode of action is not known but is believed to

involve either strengthening the interaction of the activator and the basic

machinery or enabling the specific activators to gain better access to the

chromatin (Berger et al., 1992). One such factor identified is the ADA2 gene

product (Berger et al., 1992). Mutation in this gene suppresses the lethal effect

of the overexpression of Gal4p-VP16 in yeast. The activity of Gal4p-VP16 and

GCN4 activators are reduced in an ada2 mutant, while no effect is exhibited by a

Gal4p-Hap4p activator. This result suggests that these factors are not universal;

rather, they are specific for a particular class of activators. The GCN5 gene







14

product is required for normal levels of transcription by GCN4 and HAP2/3/4

heterotrimeric activators (Georgakopuolus and Thireos, 1992) and is considered

to be an adaptor that may enhance the activity to different activators.



Glucose Repression



When glucose is present in the growth medium, the products of a large

number of genes are severely repressed in S. cerevisiae. These genes include

those necessary for alternative carbon source metabolism (Perlman and Mahler,

1974; Carlson and Bostein, 1982; Denis et al., 1981), gluconeogenesis (Sedivy

and Fraenkel, 1985; Scholer and Schuller, 1994), TCA cycle enzymes (Polakis et

al., 1965; Hoosein and Lewin, 1984; Lombardo et al., 1992; Roy and Dawes,

1987; Repetto and Tzagoloff, 1990), and respiration chain cycle proteins (Polakis

and Bartley, 1965; Perlman and Mahler, 1974; Szekely and Montgomery, 1984;

Mueller and Getz, 1986; Guarente and Mason, 1983; Wright and Poyton, 1990).

The extent of repression varies from about 1000-fold for the GAL genes

(Johnston et al., 1994) to about 5-fold for some genes encoding mitochondrial

proteins (Szekely and Montgomery, 1984).

The phenomenon of repression of many genes when glucose is present in

the growth medium has been observed in some prokaryotes such as E. coil

(Magasanik, 1962) and B. subtilis (Rosenkrantz et al., 1985) and other

eukaryotes such as S. pombe (Hoffman and Winston, 1991). In E. coli, the

repression is mediated by cAMP (Magasanik, 1962). In the presence of glucose,







15

the cAMP level is significantly reduced; but after the glucose has been depleted,

the level of cAMP increases. This increase facilitates binding of cAMP to

catabolite activation protein (CAP). Activated CAP, cAMP-CAP, binds to the

promoters of the glucose repressed genes to activate transcription. However,

the role of cAMP in glucose repression in S. cerevisiae in not as clear.

Matsumoto et al. (1982, 1983) isolated yeast strains that required exogenously

supplied cAMP for growth. In these strain, the galactokinase enzyme encoded

by (GAL1), which is glucose repressible, was still derepressed in the presence of

high levels of cAMP. Measurement of the level of cAMP present in different

media containing glucose or other non-fermentable carbon sources showed that

the level of cAMP was higher in the depressed state. These experiments

suggest that cAMP may not play any role in mediating the effect of glucose.

Cyclic AMP in eukaryotes is postulated to act by activation of protein

kinases which control the phosphorylation of various critical proteins and thereby

modulate the activity of the proteins. If so, cAMP may be involved in the

regulation of one glucose repressible gene, ADH2. The ADH2 encodes an

isozyme of alcohol dehydrogenase, which converts ethanol to acetaldehyde in

the ethanol utilization pathway. The Adrl p, encoded ADR1 gene, is a positive

transcriptional activator of ADH2 that binds to UAS1 (Denis and Young, 1983).

The protein contains several potential sites for phosphorylation by cAMP-

dependent protein kinase (cAPK) (Hartshorne et al., 1986). It has been

demonstrated in vitro that yeast cAPK can phosphorylate one of these putative

phosphorylation sites (Ser-230) (Cherry et al., 1989). A class of ADR1 mutant







16

(ADR1c) was isolated that partially relieved the glucose repression of ADH2.

These mutants alter the phosphorylation site and reduce its efficiency of

phosphorylation (Cherry et al., 1989). Also, when the regulatory subunit for

adenylate catalase (BCY1) was mutated, which allowed for unregulated

expression of the catalytic subunit, ADH2 expression was severely reduced. This

observation suggests that the regulation of the ADH2 gene is mediated, partially,

through the modulation of ADR1 activity by cAMP. However, a more recent

study (Denis et al., 1992) shows that other ADR1c mutants which can still be

phosphorylated also partially relieved glucose repression. It is believed that the

ADR1c mutations may block the binding of a repressor to Adrl p or alter the

structure of Adrl p so that transcriptional activation regions become unmasked.

This would mean that the level of phosphorylation plays little role in the regulation

of Adrl p.

Another eukaryotic organism exhibiting glucose repression is the yeast

Schizosaccharomyce pombe. In Schizosaccharomyce pombe, the gene for

fructose- 1,6-biphosphate (fbpl) is glucose repressible. The work of Hoffman and

Winston (1991) showed that mutation in git2- (cyrl) caused constitutive

expression of fbpl. The git2+ gene codes for adenylate cyclase, which converts

ATP to cAMP; cAMP is required for the activation of cAPK. When cAMP was

exogenously added it caused reduction in the mRNA level of fbpl. However,

even this study showed that some of the git2- mutants that allowed constitutive

expression of fbpl did not reduced the expression level when exogenous cAMP

was added to the growth medium. In addition, levels of cAMP did not show any







17

significant difference in repressing and derepressing media. Although the

genetic evidence strongly implicates a role for cAMP in mediating glucose

repression, this effect may be indirect at best.

Among the best studied of the glucose repressible genes are the GAL,

GAL7, and GAL10 genes of Saccharomyces cerevisiae, which encode

galactokinase, galactotransferase, and UDP-galactose epimerase, respectively.

These proteins are required for galactose utilization. Their regulation shows that

glucose mediated repression of genes is complex and occurs at several levels.

The regulation of the GALl gene, for example, occurs at three levels. First,

glucose reduces the level of functional inducer, galactose, in the cell by

repressing transcription of the galactose transporter-galactose permease, which

is encoded by the GAL2 gene (Braum et al., 1986; Tschopp et al., 1986) and

inactivating preexisting permease molecules, thereby preventing any transport of

inducer into the cell (Holzer and Matern, 1977). The reduction in the inducer

levels reduces function of the activator Gal4p. The second mechanism of

glucose repression of the GAL genes involves inhibition of the transcriptional

activator Gal4p (Flick and Johnston, 1990). The inhibition is due to reduction in

the expression of GAL4 (Johnston et al., 1994) and inhibition of Gal4p function

by the inhibitory domain "ID". The inhibitory domain constitutively inhibits the

transcription of a heterologous activator in glucose and glycerol media.

However, when the glucose response domain (GRD) is present, activation

occurs in a glycerol medium but not in a glucose medium (Stone and Sadowski,

1993). Repression of the GAL4 gene is mediated by the Migl p, which binds to







18

URS sequences in the GAL4 promoter (Johnston et al., 1994). Other

transcriptional activators that share structural similarity with the Gal4p include

Leu3p (Zhou et al., 1987), Prplp (Schmitt et al., 1990), Put3p (Marczak and

Brandiss, 1991), and Lac9p (Salmeron, Jr. and Johnston, 1986) of K. lactis. A

third mechanism of glucose regulation involves URS sequences which mediate

repression of genes by binding to repressor proteins. The GALl gene has a

URSGAL located between the UASGAL and the TATA sequence (Finley et al., 1990;

Flick and Johnston, 1992). The Migl p binds to URSGAL sequences to inhibit

Gal4p activation.

There are several other genes that are required for glucose regulation.

They are either needed to relieve repression or to maintain repression. Studies

by Rose et al. (1991) showed that the products of HXK1 and HXK2 are required

for glucose repression of many genes. The gene products of HXK1 and HXK2

phosphorylate hexose sugars, but how they mediate their effect is not known.

The SNF1 gene encodes a protein kinase that is required for derepression of the

SUC2 (invertase) gene (Calenza and Carlson, 1986). Mutation in SNF1 also

causes defects in derepression of SDHI (succinate dehydrogenase), ICL1

(isocitrate lyase), and MDHI (malate dehydrogenase) genes. The SNF1 gene is

believed to exert its effect by modifying transcriptional activators that bind to the

UAS of SUC2. The target for this kinase is probably the Snf2p/Snf5p/Snf6p

complex, which is a transcriptional activator (Laurent et al., 1992; Laurent and

Carlson, 1992). The exact role of this protein may be to disrupt nucleosomes

and allow the subsequent entry of gene specific transcriptional activators.







19

Another set of genes that is required to maintain repression are SSN6 and TUP1

genes (Keleher et al., 1992). They are transcriptional repressors interacting with

gene-specific factors to mediate their effect. In contrast to the negative roles

SSN6 and TUP1 play in regulating many glucose repressible genes, they have a

positive effect on CYC1 expression via the HAP1 transcriptional activator (Zhang

and Guarente, 1994).

Another well characterized glucose repressible gene is the CYC1. It

encodes iso-1 -cytochrome c, which is involved in the electron transport chain of

respiration. The CYC1 gene has two UASs, UAS1 and UAS2. Regulation at

UAS1 occurs via the Haplp after it has been bound by heme (Guarente et al.,

1984; Kim et al., 1990). Glucose regulation of CYC1 occurs at the UAS2 site

through a multisubunit protein called the Hap2p/Hap3p/Hap4p, encoded by

HAP2, HAP3, and HAP4 genes, respectively (Guarente et al., 1984; Pinkham

and Guarente, 1985; Pinkham et al., 1987; Hahn and Guarente, 1988; Forsburg

and Guarente, 1989). Mediation of glucose repression on CYC1 expression

occurs by repressing the transcription of HAP4. The Hap4p has the activation

domain of this multisubunit complex (Forsburg and Guarente, 1989); therefore, in

a glucose medium reduced synthesis of this activator causes reduction of CYC1

expression. Mutations in any one of the genes that encode the transcriptional

activator protein reduce the expression of many genes involved in the Krebs

Cycle such as the genes encoding lipoamide dehydrogenase (Bowman et al.,

1992), aconitase (Gangloff et al., 1990), and dihydrolipoyl transsuccinylase

(Repetto and Tzagoloff, 1990). These genes also have the consensus binding







20

site for the Hap2p/Hap3p/Hap4p complex. The CIT1 gene also has the

consensus binding site for this activator, but deletion of this sequence or

mutation of any one gene encoding the proteins does not severely impact

expression (this study). Other mitochondrial genes also known to be regulated

by this transcriptional activator complex include COX5A (Trueblood et al., 1988),

COX6 (Trawick et al., 1989; Trawick et al., 1992), and HEM1 (Keng and

Guarente, 1987). The COX5A and COX6 genes encode subunits Va and VI,

respectively, of cytochrome c oxidase, and HEM1 encodes 6-aminoluvilinate

synthase.

The other interesting feature about the consensus binding site for the

Hap2p/Hap3p/Hap4p is the presence of the CCAAT-box sequence at the core of

the consensus sequence. This sequence is also present in many mammalian

promoters and functions as promoter. The CCAAT-box also binds a multisubunit

activator, CP1A and CP1B (Chodosh et al., 1988a; 1988b). Using bandshift

assay and DNase I protection assays, Chodosh et al. (1988b) showed that the

Hap proteins and CP1 proteins bind to and protect similar DNA sequences. In a

bandshift assay, they showed that Hap2p can substitute for CP1B and Hap3p

can substitute for CP1A in binding DNA at each cognate sequence. Although

these two sets of proteins have evolved to regulate different activities, they still

bind similar DNA sequences and can complement each other.







21

mRNA Stability



The steady-state level of a given species of mRNA is a function of both

the rate of transcription and the rate of decay of the message. Although much is

known about how genes are transcribed and the factors involved, little is known

about how mRNA is targeted for decay and the mechanisms of decay. The

degradation of mRNA provides the cell another level of control and a very

powerful means of gene regulation. The wide difference in the half-life of

different messages (Herrick et al., 1990) would suggest that there are specific

degradation pathways for different messages. Apart from decay of normal

mRNA, aberrant mRNAs, such as unspliced mRNA or those RNA containing

premature termination signals are rapidly removed (Leeds et al., 1991; Peltz et

al., 1993). This is necessary to prevent the assembly of the translational

apparatus on a message that would not produce a productive protein or one that

might even be detrimental to the cell. A wide variety of external and cellular

signals such as oxygen, iron, glucose and light have been shown to affect the

level of mRNA stability (reviewed in Brawerman, 1993). The half-lives of mRNAs

vary greatly in different cell types. In E.cofi mRNA half-lives ranges from about

20 seconds to about 50 minutes (Blundel et al., 1972). In yeast, it range from

about 1 minute to almost 100 minutes for some messages (Herrick et al., 1990).

In mammalian cells, mRNA half-life could range anywhere from 15 minutes to

over 24 hours (Gordon et al., 1988; Shyu et al., 1990). Since all mRNAs do not

have the same half-life, there must be features unique to each mRNA or class of







22

mRNA that causes them to follow a particular pathway for decay; this feature

may constitute a cis-element(s) inherent in each mRNA. The search for cis-

elements that are involved in regulating the decay of mRNA has so far revealed

sequences that usually confer instability rather than stability (Heaton et al.,

1992). No sequence has yet been shown to confer increased stability.

The structural determinants for mRNA instability seem to be present

throughout the message, especially for a eukaryotic mRNA. Although the 5' cap

structure on a eukaryotic message has not been shown to directly affect stability

of any mRNA, it is believed that it could serve a protective role, because the 5'-5'

phosphodiester bond is intrinsically resistant to ribonucleases. This putative

protective role of the 5' cap structure was shown by Muhlrad et al. (1994). These

workers showed that in the degradation pathway of MFA2 mRNA, decapping of

the message always takes place before the decay intermediates could be

detected. The 5' untranslated region (UTR) of eukaryotes has not been shown

to directly affect mRNA stability, except in cases where translation is required for

degradation and the 5' UTR controls the translation of that message. In contrast

to eukaryotes, prokaryotes have stem-loop structures at the 5' termini of their

messages that affect their decay rate (Emory et al., 1992; Bouvet and Belasco,

1992; DiMari and Bechhoffer, 1993). For example, in the ompA mRNA of E.co/i,

the presence of the stem structure is critical for maintaining the normal half-life of

approximately 14 minutes. Insertion of up to 3 nucleotides to the 5' end of the

terminal hairpin structure causes dramatic decrease in the half-life of the OmpA

mRNA (Emory et al., 1992). Also, removal of the Shine-Delgano sequences from







23

the second single-stranded region of the leader reduced the half-life (Emory et

al., 1992). This would imply that ribosome binding may also protect the mRNA.

Hence translation of the message may be required for stability.

In eukaryotes, the coding regions of several genes, including c-myc

(Willington et al., 1993), MATaI (Caponigro et al., 1993), and STE3 (Heaton et

al., 1992) have instability elements, that promote rapid decay of the messages

they encode. The putative instability element of MATal was localized to a 65

nucleotide sequence that has a 5' and a 3' portion (Caponigro et al., 1993). The

3' portion is necessary and sufficient to decrease the half-life of an otherwise

stable mRNA, but the decay is further stimulated when the 5' portion is included

in the fusion. The 5' portion contains some rare codons which when replaced

with more common codons, increased the half-life of the chimeric mRNA. This

result suggests that rare codons may cause the ribosome to stall on the message

which may lead to an initial endonucleolytic cleavage followed by an exonuclease

attack.

The 3' untranslated region (3' UTR) of many genes contains sequences

that cause their rapid decay. These include STE3 (Heaton et al., 1992), MATa1

(Caponigro et al., 1993), MFA2 (Muhlrad and Parker, 1992), c-myc (Willington et

al., 1993), and transferring receptor (TfR) gene (Klausner et al., 1993). The

sequence of the STE3, MFA2 and MATa1 that cause rapid decay have not been

well characterized.

Interestingly, the TfR mRNA, regulated by iron, has several well

conserved stem-loop structures that are observed in widely divergent species.







24

These stem-loop structures at the 3' UTR are called the iron response element

(IRE) and can bind a protein called the IRE-binding protein (IRE-BP) (Klausner et

al., 1993). The IRE-BP also has aconitase activity. When iron is scarce, the

IRE-BP binds to the IRE of TfR mRNA and increases its half-life. There is also

an uncharacterized sequence called the rapid turnover determinant overlapping

the IRE. Point mutations within the IRE eliminating IRE-BP binding still caused

rapid decay of the mRNA, whereas a deletion mutation removing the IRE-BP

binding site and presumably the rapid turnover determinant slowed the mRNA

decay rate.

The 3' UTR of c-myc and lymphokines and proto-oncogenes contain the

sequence AUUUA, usually repeated several times, referred to as AU-rich

elements (ARE), that cause rapid decay of an mRNA containing it. However,

recent studies by Zubiaga and coworkers (1995) show that the pentanucleotide

AUUUA is not sufficient to confer destabilization upon heterologous mRNA.

Instead a consensus nanonucleotide of UUAUUUAUU is required for the

destabilization phenotype. This sequence, when present in multiple copies,

increases the decay rate.

The mechanism of mRNA decay in eukaryotic cells is beginning to be

elucidated. Parker and coworkers (Muhlrad and Parker, 1992; Decker and

Parker, 1993; Muhlrad et al., 1994) demonstrated that deadenylation of MFA2

mRNA is the first step before decay occurs, for some mRNAs. The

deadenylation occurs in two stages: an initial deadenylation and a terminal

deadenylation. The rate of the initial deadenylation of various mRNAs







25

determines their half-life. Messages with longer half-life have an initial

deadenylation rate significantly lower than those with a short half-life (Xing et al.,

1993). This result suggests that the rate limiting step for this class of mRNA is

the deadenylation step. To define direction of decay, whether 5' -+ 3' or 3' -+ 5', a

poly(G) sequence was inserted into the 3' UTR of a test mRNA. The poly(G)

forms a secondary structure that slows decay in either direction. When the fate

of the mRNA containing the poly(G) track was followed using a poly C probe,

decay was found to proceed in a 5' --+ 3' direction. In an xrnl mutant (XRN1

encodes the major 5' -+ 3' exonuclease in yeast), full length mRNA was seen for

a much longer time, indicating that, after deadenylation, this exonuclease is

responsible for degrading the RNA to mononucleotides. Using an antibody to the

5' cap structure Muhlrad et al. (1994) were able to show that the cap structure is

removed before exonuclease digestion.

The use of mutations that result in premature translation termination in

several genes have identified some genes in yeast that are involved in the rapid

decay of mRNAs with premature nonsense codons. Two such genes are UPF1

and UPF3 (Leeds et al., 1991). In a wild-type strain, most mRNAs containing

premature termination signals have a decay rate up to 12 times faster than

normal mRNA (Peltz et al., 1993), but in either upfl and upf3 mutants some of

these messages are selectively stabilized without affecting the turnover of the

other message (Leeds et al., 1991; Leeds et al., 1992). The nonsense mutations

that caused the rapid decay are always located within the first two-thirds of the

coding region. If the mutation is near the 3' end of the gene, the half-life is quite







26

similar to the wild-type mRNA. This finding suggested that some sequences

downstream of the nonsense codon may be required for the rapid decay. By

introducing nonsense mutations throughout the PGK1 gene, Peltz et al. (1993)

were able to show that a "downstream element" was necessary to cause rapid

decay. This "downstream element" functions in an orientation dependent

manner.

Other genes required for rapid degradation of specific mRNAs include the

UME2 and UME5 genes (Surosky et al., 1994). These genes are required for

rapid decay of meiosis specific genes in a medium containing glucose. How

these trans factors target specific mRNA for decay is not known, but they could

serve as molecular tags that designate the mRNA for decay when bound at their

recognition site.












MATERIALS AND METHODS


Growth Conditions and Media



All E. coli strains were cultivated in Luria-Bertani media (1% Bacto-

tryptone, 0.5% Bacto-yeast extract, 1% NaCI pH 7.5). Yeast cells were grown in

either complex media (1% Bacto-peptone, 1% Bacto-yeast extract)

supplemented with 2% dextrose or 2% ethanol, or synthetic dextrose (SD)

(0.67% yeast nitrogen base without amino acids, 2% dextrose). All plates were

supplemented with 1.5% agar.



Yeast Transformation



Yeast transformation was routinely done either by the method described

by Ito et al., (1983) or the colony method (Baker, 1991). Several colonies were

picked from a YPD plate that was no more than two days old and resuspended in

1 ml 1 X TEL solution (10 mM Tris-HCI, pH 7.5; 1 mM EDTA; 100 mM lithium

acetate pH 7.5) in a microcentrifuge tube. The suspension was left at room

temperature for 1 minute then centrifuged at 12,000 rpm in an Eppendorf

centrifuge for 10 seconds. The supernatant was decanted and cellls were







28

resuspended in 100 pI 1 X TEL solution. Then 50 pg denatured salmon sperm

DNA plus 10 pg of transforming DNA was added. The cells were incubated with

the DNA at 30C with gently shaking for 15 minutes, subsequently 700 pI 40%

PEG 4000 (polyethylene glycol)/TEL solution was added to the mixture, which

was vortexed vigorously for a few seconds. Cells were transferred to a 30C

heat block and incubated for additional 15 minutes without shaking. At the end,

they, were incubated at 42C for 15 minutes. Cells then were collected by

centrifugation in an Eppendorf centrifuge for 30 seconds, the supernatant was

decanted and cells were resuspended in 200 pI TE pH 7.5 and plated 100 pI per

petrie plate on appropriate selective media and incubated at the appropriate

temperature. Transformants were usually obtained in 4-5 days. Putative

transformants were restreaked on the same selective media and incubated for

another 3 days. Transformants were usually screened for their auxotrophic

markers by streaking on minimal media on which they should not grow.



Construction of 5' (DISTAL) and 3' (PROXIMAL) Deletions



The construction of these plasmids was started by Timothy Rickey

(Rickey, 1988). All CITI-lacZ constructions originated from two plasmids,

pSH18-8 and YcpZ2. pSH18-8 contains approximately 800 bp of the upstream

sequences and 26 codons sequence of the CIT1 gene cloned into Smal site of

pUC18. The YcpZ-2 plasmid was used to make the lacZ fusion constructs to

study the effect of promoter deletions. YcpZ-2 was made by inserting the CEN4







29

sequence from pBM150 between the ARS1 sequence and the polylinker of

pMC1790. The pMC1790 vector was provided by Dr. M. J. Casadaban (1979).

The YcpZ-2 vector contains the lacZ gene without a promoter or the first 22

nucleotides of the coding sequence, an E. coil origin of replication, and the bla

(13-lactamase) gene which conferred ampicillin resistance. There is a TRP1 gene

which served as a selectable marker in yeast, and the CEN4 and ARS1

sequences which allowed the plasmid to be maintained in a stable form and

replicate in yeast, respectively.

A schematic of the strategy used to generate the 5' deletions is depicted in

Figure 1. Plasmid pSH18-8 was cleaved with Smal, followed by a Bal31

exonuclease digestion according to the manufacturer's recommendation

(Boehringer Mannheim). Following the Bal31 digestion, the DNA was treated

with BamHI, to release the yeast DNA bearing the sequential deletions upstream

from the transcriptional start site of CIT1, and run on 1 % agarose gel. Selected

fragments which had varying degrees of deletion were ligated to the YCpZ-2

vector which had been digested by Smal and BamHl. The end points of the

deletions were determined by sequencing, using the Sanger dideoxy sequencing

method.

Generation of 3' proximall) deletions and subsequent subcloning into the

YCpZ-2 vector were done in two steps. First, pSH1 8-8 was digested with EcoRV

which cuts at a unique site 111 bp upstream from the major transcriptional start

site, followed by a Bal31 exonuclease digestion for varying length of time. The

EcoRV site is 11 bp upstream of the putative TATA element. Since the Bal31




























Figure 1. Construction of the 5' deletions. The first step was to digest
plasmid pSH18-8 with Smal, followed by treatment with Bal 31nuclease. The
nuclease treated DNA was digested with BamHI which released the yeast DNA.
This was then ligated to YCpZ-2 vector which had been linearized with BamHI
and Smal. The thin line represents CITI1 sequences located upstream of the
coding region. The straight line hatch marks represents CITI1 coding region and
the crossed hatch marks represents pUC18 vector sequences. In the second
vector, the filled box represents the E. co/i /acZ gene and the stippled box
represents yeast TRP1 gene.










EcoRV +
I


IIII111111111 II I i7111111/


Small and Bal 31

EcoRV +1
I I n


EcoRV +1
I I


BamHl
1111111114m/WM WA,7


BamH1
I


BamHl1


EcoRV +1 BamHl1
I 1 ,,, ,,, ,,, ,,,

EcoRV +1 BamH1







EcoR1 Smal BamH1


_J7,7777=
TRP\\\ La .- .....


..... .... ....... llll lllll ll ..... .... ....


^J^*^*^"*'*'*f*"


IIIIIII1IIIII1111 V W M W W/// A/


Small
ww/w/wA////


BamH1


TRP


Lac Z







32

digestion was likely to remove this element, which is essential for proper

initiation, it was necessary to restore this sequence. The nuclease-treated DNA

was digested with BamHI and run on a 1% agarose gel. This generated two

fragments, a small fragment which consisted of CIT1 sequences from the EcoRV

site to the twenty-sixth codon, and a large fragment that consisted of vector

sequences and partially deleted CIT1 upstream sequences. A 300 bp EcoRV-

BamHI fragment from pSH18-8 containing the essential CIT1 sequences, was

ligated to the nested set of deleted DNA fragments. This generated deletion

clones that started at the EcoRV site and extended upstream, but retained the

TATA sequence, the transcription initiation site, and the coding region. Figure 2

is a diagrammatic representation of how these 3' deletions were generated.



Construction of Internal Deletions



Internal deletions of the promoter region were constructed to determine

the relative contribution of each of these regions to high level expression of CIT1

gene. The technique used to make these constructs is called recombinant circle

polymerase chain reaction (RCPCR) (Jones and Howard, 1991). Two primers

were used to prime PCR which extended in opposite directions on the template.

The standard polymerase chain reaction consisted of 10 pmoles each of the

primers, 3.4 ng of template DNA (pSL123), 200 moles of four dNTP's, 2.5 mM

magnesium chloride; 10 mM Tris-HCI, pH 8.3; 30 mM potassium chloride; and

2.5 U Ampli-Taq DNA polymerase (Cetus Corporation). Twenty cycles of


























Figure 2. Construction of the 3' deletions. First, pSH18-8 was digested with
EcoRV which is 111 bp from the transcriptional start site. The DNA was then
treated with Bal 31. Following the nuclease treatment, the DNA was digested
with BamHI, this released CIT1I sequences that contained sequences essential
for proper transcription initiation. To restore these sequences, an EcoRV/BamHI
fragment from the original plasmid (pSH1 8-8) was ligated to the Bal 31 treated
DNA. A Smal/BamHI fragment from the nuclease digested DNA was then
subcloned into YcpZ-2 vector.













Small
Ui~fffSiaiJ


EcoRV +1
I I


BamH1
/1 77777777


IEcoRV and Bal 31

+1
I ...... I I I I I I I IIIIV /A


Small


Small


Sma1


Small

I EcoRV

Small '
I


Small EcoRV +1
I I I


coRV +1 BamH1






EcoR1 Sima BamH1




Lac Z


BamH1


BarnHl


TRP


m







35

amplification were performed for each reaction following initial denaturation at

95C for 5 minutes. Each cycle consisted of 95C denaturation for 1 minute,

annealed at the TH for each pair of primers for 1 minute, and 72C extension for 3

minutes. After 20 cycles of amplification an additional 10 minutes of extension

was performed to enable most products to have a common end. The 5' ends of

each primer pair were complementary to each other by four to ten nucleotides.

After the PCR reaction the products were phenol/chloroform extracted once,

precipitated, resuspended in water and used to transform competent E. coil by

electroporation (SURE strain, Stratagene). Upon transformation, circular

molecules were generated by the host E. coil by homologous recombination at

the termini of the PCR products because of their complementarity. The template

used was pSL123. Plasmid pSL123 has approximately 750 bp EcoRI fragment,

exercised from p5-498 and subcloned into pBluescript KS+ at the EcoRI site.

This EcoRI fragment contained all of the CIT1 sequences in p5-498 plasmid.

The CIT1 sequences consisted of upstream sequences, the TATA element, and

178 nucleotides long transcription unit, which included the first 26 codons.

Many transformants were usually obtained, therefore initial screening for

deletion mutants was done by the colony hybridization (Grunstein and Hogness,

1975). During the screening, 32P radiolabeled probes were prepared from the

mutant primer whose sequence should now be continuous in the recombinant

clone but discontinuous on the parent plasmid. The hybridization temperature

used for each screening was the TH of the oligonucleotide. Deletion mutants

were further characterized by restriction digestion, then positive clones were







36

sequenced to determine the exact deleted region. Because the deletions were

made in a pBluescript plasmid, the EcoRI fragment was recloned in the original

yeast/E. co/i shuttle plasmid it was obtained, replacing the full-length insert. After

ligation and subsequent transformation, recombinant plasmids were sequenced

to determine their orientation. Four regions were deleted that span -370 to -252,

-245 to -216, -200 to -160, and -370 to -160 (+1 indicates the start site for

transcription). All recombinant plasmids were transformed into S150-2B strain,

and 13-galactosidase activity was determined as described below. The primers

used were AL60/AL61 to delete -200 to-160; MS41/MS42 to delete -245 to -216;

MS43/MS44 to delete -370 to -252; and AL61/MS44 to delete -370 to -160.

Annealing temperature for each primer pair was: 1). AL60/61 at 51 C, 2).

MS41/MS42 at 47C, 3). MS43/MS44 at 55C, and 4). AL61/MS44 at 510C.



Heterologous Fusion



To show that sequences upstream of the putative TATA element of CIT1

could function as a UAS (upstream activating sequence), a 400 bp EcoRI-EcoRV

fragment from p5-498 was subcloned into plCZ312 (generous gift from Dr.

Meyers). The CIT1 upstream sequences were obtained from pSL123 plasmid

described earlier. The pSL123 plasmid was digested with EcoRI-EcoRV, which

released a 400 bp fragment that contains all of the putative CIT1 UAS and

recovered the DNA by the Spin-Bind method (Costar) after running on a 1 %

agarose gel. This fragment was ligated to plCZ312 plasmid that had been cut







37

with Smal- Xhol enzymes and filled-in with all four dNTP's using 2 U of Klenow

enzyme. The plCZ312 plasmid has the CYC1 UAS1 and UAS2, the TATA

element, and three nucleotides of CYC1 coding sequences fused to lacZ gene.

It also has E. coli replication origin, ampicillin resistance gene, and the URA3

selectable marker in yeast, but there is no yeast replication origin. Therefore,

the plasmid can be maintained only if it integrates into the yeast chromosome. In

order to direct the integration, the plasmid was digested at a unique Stul site

within the URA3 gene. Stul digested plasmid DNA was transformed into 1-7A

and JP16-8A(hap2::URA3) strains, and transformants were plated on SD(2%)

with 20 pg/ml histidine, 2.5 pg/ml adenine, and 20 pg/ml leucine and incubated at

30C. Several single colonies from each transformation were isolated and re-

streaked on similar plate and incubated at 30C again. Because multiple,

tandem integration events could occur, the number of integration of each

transformant was determined by Southern blot analysis. Yeast chromosomal

DNA was isolated by the mini-prep method and digested 10 pg with Sadcl

enzyme. The digested DNA was run on a 0.8% agarose gel in TBE (0.89 mM

Tris; 0.89 mM borate; 0.005 mM EDTA) and electrophoretically transferred onto

Zeta-bind nylon membrane (Bio Rad) using half strength TBE. Nucleic acid was

fixed onto the membrane by heating in a vacuum at 80C for 2 hours.

Prehybridization and hybridization were performed according to the manufacturer

(Biorad). The membrane was hybridized with 32P radio-labelled probe prepared

from YIp56 plasmid (gift from Dr. H. Baker's laboratory), which contains the

URA3 gene, using the random primer method using a kit from United States







38

Biochemical, Inc. Probe was denatured by boiling and added at 100,000 cpm

per milliliter of hybridization solution. Hybridization was carried out at 60C for 16

hours with shaking. Membrane was washed according to the manufacturer's

recommendation and exposed to X-ray film. Transformants with more than single

integration event were identified by the presence of a plasmid-length band.



Cloning of Oligonucleotides



Oligonucleotides corresponding to different upstream regions of CIT1

were subcloned into the plCZ312 vector to test their ability to either activate or

repress transcription. The oligonucleotides used were synthesized at the DNA

Synthesis Core, University of Florida. Their sequences and location in the gene

are given in Table 3. Approximately 5 pg of complementary oligonucleotides

were annealed in 10 mM Tris-HCI, pH 8.0; 5 mM MgCl2; 20 mM NaCI; by boiling

for 5 minutes then slowly cooled to room temperature. To clone the region

between -200 to -160, AL86 and AL87 oligonucleotides were annealed, and

AL84 and AL85 oligonucleotides were annealed for the -245 to -216 region. After

annealing 1 pg of each annealed oligonucleotide was end labeled with 1 mM

ATP using T4 polynucleotide kinase (1 U) in 500 mM Tris-HCI, pH 7.6; 100 mM

MgCl2; 5 mM DTT at 37C for 60 minutes. At the end of the reaction the enzyme

was heat inactivated by incubating at 75C for 10 minutes. Salt was removed

from the sample by precipitating with absolute ethanol, then the sample was

resuspended in 10 pl water. Approximately 4 pl of each annealed oligonucleotide







39

was ligated with plCZ312 vector which had already been digested with Smal and

Xhol restriction enzymes. This digestion removed the UAScycl. Ligation was

performed overnight at 16C in 1X ligase buffer (66 mM Tris-HCI, pH 7.6; 6.6 mM

MgCl2; 10 mM DTT; 66 pM ATP) with 1 U of T4 ligase. Ligation mixture was

used to transform into competent E. coil cells. Transformants were analyzed by

isolating plasmid and digesting with the Sphl restriction enzyme. Recombinants

were subsequently confirmed by sequencing using the Sequenase kit (US

Biochemical). DNA from confirmed recombinants was linearized with Stul

enzyme and transformed into yeast and plated on the appropriate selective agar

plate. Digestion of the DNA directs integration at the URA3 locus. The number

of integration was determined by performing Southern analysis as described

earlier.



Measurement of 13-Galactosidase Level in CITI-lacZ Fusion



Cells were grown to either early logarithmic phase (OD60o ~ 1.0) or

stationary phase (OD60o > 20.0) and 10 ml of culture was harvested by

centrifugation at (2,780 X g) in a Sorvall (Dupont) desktop centrifuge for 5

minutes. The supernatant was decanted and the pellet was resuspended in 10

ml water. The cells were centrifuged again at (2,780 X g) in the Sorvall clinical

centrifuge for 5 minutes,and the supernatant was decanted. The pellet was

resuspended in 1 ml 10 mM Tris-HCI, pH 7.4 plus 1 pl 100 mM PMSF and

transferred the cells into round bottom 13 ml centrifuge tube (Starstedt). To







40

disrupt the cells, 4 mm diameter acid-washed glass beads were added to the

suspension until the glass beads reached the meniscus of the liquid. The

mixture was vortexed vigorously for 45 seconds. The tube was cooled on ice for

at least 1 minute; then vortexed again for additional 45 seconds. The lysate was

then transferred to fresh microcentrifuge tube and centrifuged in an Eppendorf

centrifuge for 1 minute at 4C. The supernatant was transferred to a fresh

microcentrifuge tube and incubated in a -70C freezer for at least 15 minutes.

The lysate was then set on ice to thaw and centrifuged again in a microcentrifuge

for 1 minute at 4C. The supernatant was transferred into a fresh microcentrifuge

tube and stored at -70C 13-galactosidase activity of each lysate was

determined by the method of Craven et al (1965). Hewellet Packard kinetics

program in model 8452A spectrophotometer was used to determine the reaction

rate. Specific activity from each sample is reported as nanomoles of o-

nitrophenyl-P3-galacotopyranoside (ONPG) hydrolyzed per minute per milligram of

protein. Protein concentrations were determined by the method of Lowry et al

(1951).



RNA Isolation



RNA for northern analysis and ribonuclease protection assays was

routinely prepared as described by Schmitt et al (1990). Cell cultures were

grown to early logarithmic phase (OD600oo ~ 1.0) and harvested by centrifugation in

the Beckman J2-21 centrifuge in a JA-20 rotor at 10,000 rpm for 45 seconds.







41

Then the supernatant was removed and cells were resuspended in 400 pl AE

buffer ( 50 mM sodium acetate; 20 mM EDTA, pH 5.3). Cells were transferred to

a microcentrifuge tube, then added one-tenth volume (40 pl) 10% SDS was

added to each tube and vortexed for about 30 seconds. A 1.2 volume (480 pl)

prewarmed (65C) phenol/chloroform (1:1 ratio),equilibrated with AE buffer was

added, and the mixture was vortexed for 30 seconds. The tube was incubated in

a 65C water bath for 5 minutes with occasional vortexing, then cooled down by

setting in a dry-ice ethanol bath for approximately 10 seconds. The aqueous

phase was separated from the organic phase by centrifugation at 2500 X g in an

Eppendorf centrifuge at room temperature for 20 minutes. The organic phase

was discarded. An equal volume of prewarmed (65C) phenol/chloroform was

added again and the extraction repeated as above. A final extraction was

performed with an equal volume of phenol/chloroform/isoamyl alcohol (25:24:1).

The aqueous phase was transferred to a fresh microcentrifuge tube. RNA was

precipitated by adding one-tenth volume 3 M sodium acetate, pH 5.3 plus 2.5

volume absolute ethanol and incubated at -20C for 30 minutes. The ethanol

pellet was recovered by centrifuging for 15 minutes in a microcentrifuge at 4C.

The supernatant was decanted, and the pellet was washed with 1 ml 70%

ethanol. The pellet was dried under vacuum and resuspended in 50 pI water.

RNA concentration was determined in spectrophotometer (Hewellet Packard

model 8452). Samples were stored at -70C until needed. When isolating RNA

for half-life or rate of decay determination, an RNA polymerase II temperature

sensitive mutant strain was usually used to isolate the RNA. Transcription was







42

stopped by adding equal volume of prewarmed (48C) medium to the culture,

and immediately transferring the culture to a 36C water bath. Chemical

inhibitors, such as thiolutin (generous gift from Dr. S. Kadin, Pfizer Inc. Groton

CT.) (Jimenez et al., 1973) and 1,10-phenanthroline (Santiago et al., 1986), were

also used to stop transcription in separate experiments. Thiolutin was dissolved

in DMSO and used at a final concentration of 3 pg/ml and 1,10-phenanthroline

was prepared in ethanol at 10 mg/ml and used at a final concentration of 100

Pg/ml.



Ribonuclease Protection Assay



To show that the P3-galactosidase activity from the different deletion

constructs reflects the steady-state mRNA level, ribonuclease protection assays

were performed on total yeast RNA isolated from yeast strains harboring

selected deletion constructs. A radiolabeled cRNA from the lacZ gene was

prepared from pSLOOl plasmid. pSLOOl plasmid was constructed by subcloning

a EcoRV/Clal fragment from p5-498 into pBluescript KS+ cut with the same

enzymes. This EcoRV/Clal fragment contains an 817 bp of the 5' coding region

of lacZ gene and 287 bp of CIT1 sequences which include the first 178

nucleotides of CIT1 RNA and the TATA element. To prepare the probe, the

plasmid was linearized with Ddel restriction enzyme, which cuts within the lacZ

gene, and transcribed with a T3 RNA polymerase at 37C for 1 hour. This

generated a probe that was approximately 300 nucleotides long. At the end of







43

transcription 1 pjl RQ1 DNase I (1 U/pIl) (Promega Corporation) was added, and

the sample was incubated at 37C for 15 minutes to digest the template DNA.

The volume was adjusted to 100 pI with water and extracted once with

phenol/chloroform/isoamyl alcohol. The aqueous phase was transferred,

extracted once again with chloroform and subsequently transferred to a fresh

tube, and an equal volume of 5 M ammonium acetate, pH 5.3 plus 2.5 volumes

ethanol were added. The transcript was incubated at -20C for 30 minutes to

precipitate. It was then centrifuged in an Eppendorf centrifuge at 12,000 rpm for

15 minutes to collect the precipitate. After decanting the supernatant, the pellet

was resuspended in 100 p1 2.5 M ammonium acetate and precipitation was

repeated two additional times to remove the unincorporated nucleotides. The

pellet was washed once with 70% ethanol, dried in vacuum and resuspended in

100 pl hybridization buffer. One microliter of the transcript was analyzed in a

scintillation counter. To hybridize, approximately 250,000 to 500,000 cpm per

probe was added to 10 pg of precipitated total RNA, and the volume was

adjusted to 30 p1 with the hybridization buffer. The mixture was heated at 85C

for 15 minutes, then quickly transferred to a 45C heat block and hybridized

overnight. Three hundred and fifty microliters of RNase digestion buffer

containing 40 pg/ml RNase A plus 2 pg/ml RNase T1 was added to each sample,

which was then incubated at 30C for 60 minutes to digest unhybridized

transcript. The RNase digestion was stopped by treatment with 2.5 pl 20 pg/ml

proteinase K; 20 pl 10% SDS at 37C for 15 minutes. The sample was extracted

once with equal volume phenol/chloroform/isoamyl alcohol and the aqueous







44

phase was transferred to a fresh microcentrifuge tube containing one microliter of

10 pg/pl yeast tRNA plus 1 ml absolute ethanol. Precipitation was carried out at -

20C for 30 minutes. Samples were centrifuged in an Eppendorf centrifuge for

15 minutes at 4C. The supernatant was decanted and the pellet washed once

with 70% ethanol, dried in vacuum and resuspended in 10 pl RNA sample buffer

(95% Formamide; 0.0025% bromophenol blue; 0.0025% xylene cyanol).

Samples were heated at 75C for 5 minutes and loaded in a 6% (19:1)

polyacrylamide gel. The bromophenol blue dye ran about two-thirds the length of

the gel before electrophoresis was stopped. The gel was dried and exposed to

X-ray film. Relative 32p content for each sample was quantitated by exposing

the dried gel to a Phosphor-lmager screen (ABI).



Northern Analysis



For northern analysis, 10-15 pg of total RNA was precipitated with one-

tenth volume 3 M sodium acetate, pH 5.3 plus 2.5 volumes of absolute ethanol

and centrifuged in a microcentrifuge for 15 minutes, and the supernatant was

decanted. The pellet was washed with 70% ethanol and dried in vacuum. Two

microliters of water were used to resuspend the pellet and 8.8 pl of sample mix

was added to the sample. Sample mix consisted of 50% formamide; 0.22 M

formaldehyde; 1 X MOPS (0.2 M MOPS; 0.05 M sodium acetate; 0.001 M

EDTA); 40 pg/pl ethidium bromide. The sample was heated at 65C for 15

minutes, chilled on ice for few minutes, then 1 pl dye mix was added and the







45

sample loaded on a 1.2% agarose gel containing 0.22 M formaldehyde/1 X

MOPS buffer. The running buffer consisted of 0.22 M formaldehyde/ 1X MOPS

buffer. The gel was run at 150 V until the dye ran to the bottom of the gel. This

usually took about 6 hours. The buffer was recirculated with a peristaltic pump to

prevent formation of a pH gradient. At the end of the run, the gel was

photographed with Polaroid film on a UV transilluminator to determine the

integrity of the RNA. The gel was then soaked in a 20 X SSC (SSC is 0.15 M

sodium chloride/0.015 M sodium citrate) for 15 minutes. RNA transfer onto

Hybond N+ nylon membrane by capillary action using 20X SSC for approximately

15 hours at room temperature. At the end of the transfer, the RNA was cross

linked to the membrane in a Stratalinker (Stratagene) set on auto-crosslink. The

membrane was then rinsed with 2 X SSC. The rapid hybridization solution

(Amersham) was used as recommended by the manufacturer for hybridizations

and prehybridizations. Prehybridization was performed with 50 pi of rapid

hybridization solution per square centimeter of membrane at 60C for at least 30

minutes. After prehybridization, 100,000 200,000 cpm of probe was added per

milliliter of hybridization solution, and hybridization was performed at 60C for at

least 2 hours. Washes were done with 2X SSC/0.1 % SDS at room temperature

for 15 minutes once and changed to 1 X SSC/0.1% SDS and repeated wash

twice at 60C for 20 minutes. The membrane was then air dried, wrapped in

Saran Wrap and exposed to X-ray film. An intensifying screen was used to boost

weaker signals. For quantitative results the membrane was exposed to a

Phosphor-lmager screen (ABI). If stripping was necessary, the membranes were







46

routinely stripped by adding 0.5% SDS at boiling temperature, then set at room

temperature until the solution cooled to room temperature. After stripping, the

membrane was then re-exposed to X-ray film to make sure that the were no

residual bands from previous hybridization before subsequent hybridizations was

performed on the membrane.



Primer Extension Analysis



Two oligonucleotides were used in the primer extension analysis to map

the 5' ends of the chromosomal-initiated CIT1 mRNA and the CITI::IacZ fusion

mRNA that were being transcribed from the plasmid. The oligonucleotides were

first end labeled using T4 polynucleotide kinase as recommended by the

manufacturer, New England Biolabs. An end labeled oligomer (250,000 cpm)

and 50 pg of total yeast RNA were first precipitated together using ethanol. The

pellet was resuspended in 30 pl hybridization buffer (40 mM PIPES, pH 6.4; 1

mM EDTA, pH 8.0; 0.4 M sodium chloride; 80% Formamide). This mixture was

heated at 85C for 10 minutes, then immediately transferred to 25C heat block

and hybridized overnight. Following hybridization, 150 pl of water plus 20 pi 3 M

sodium acetate, pH 5.2 were added to the sample. Nucleic acid was

precipitated with 2.5 volumes ethanol. The pellet was washed with 70% ethanol

and allowed to air dry. Pellet was resuspended in 10 pl sterile distilled water, 4 pl

5X Reverse transcription buffer (250 mM Tris-HCI, pH 7.9; 375 mM potassium

chloride; 15 mM magnessium chloride), 2 pl 0.1 M DTT; 2 pl 10 mM each all four







47

deoxynucleotides(dNTP's), 1 pIj RNasin (26 U/jpl) (Promega Corporation), and 1

pI Superscript II reverse transcriptase (200 U/pl) (Life Technologies). The

sample was incubated at 37C for 90 minutes, then 1 pl 0.5 M EDTA was added

to stop the reaction. The sample was then treated with 1 pl 5 mg/ml RNase A to

digest unhybridized RNA at 37C for 30 minutes. The mixture was extracted

once with phenol/chloroform/isoamyl alcohol, then adjusted to a final

concentration of 2.5 M ammonium acetate and precipitated with 2.5 volume

ethanol. The pellet was first resuspended in 4 pl TE pH 8.0, then 6 pl formamide

loading buffer was added. The sample was heated at 95C for 3 minutes and

loaded on a 5% Longer Ranger gel (AT Biochem) and run until the lower dye had

run two-thirds the length of the gel.

To identify the start sites, the same end labeled primer (AL41) was used to

prime DNA sequencing reactions on pCSB plasmid, which consists of an EcoRV-

EcoRV CIT1 fragment that includes the TATA element and 5' half of the coding

region. AL215 was used to prime plasmid specific transcript. The sequencing

reaction was performed as recommended by the manufacturer (US Biochemical).



In Vivo Footprinting



In vivo footprinting was performed essentially as described by Giniger et al

(Giniger et al., 1985) with some modification. One liter of culture was grown in

either YPE or YPD to early logarithmic growth phase (OD60o). Cells were

harvested by centrifuging in a JA-10 rotor (Beckman) at 5,000 rpm at room







48

temperature for 5 minutes. The supernatant was decanted and the pellet

resuspended in 10 ml of growth medium. The suspensions were then divided

into ten 1 ml aliquots in an Oakridge centrifuge tubes. Two microliters of

concentrated dimethyl sulfate (DMS) was added to each aliquot, which were held

at room temperature for varying amounts of time, ranging from 2 minutes to 10

minutes. At the end, 40 ml ice cold TEN (10 mM Tris-HCI, pH 8.0; 1 mM EDTA;

and 40 mM sodium chloride) solution was added to each to stop the reaction.

Cells were centrifuged at 5,000 rpm in a JA- 20 rotor at 4C for 5 minutes and

supernatant was decanted. Pellets were resuspended in 1 ml 1 M sorbitol/0.1 M

EDTA plus 2 l P113-mercaptoethanol. To form spheroplasts, 200 pl 5 mg/ml

mureinase (1509 BGX units/g, US Biochemical) was added to each cell

suspension. These were incubated at 37C with gentle shaking until

spheroplasts were formed. This usually took approximately 30-40 minutes.

Spheroplast formation was determined by adding 50 pl of cell suspension to 500

pl 0.1% SDS and measuring the change in absorbance at OD6oo. Reduction in

absorbance by 90% was considered an acceptable level before DNA isolation

was performed. Spheroplasts were collected by centrifuging for 1 minute,

decanting the supernatant and resuspending the pellet in 1 ml 50 mM Tris-HCI

pH 8.0/20 mM EDTA. The sample was divided into two halves and transferred

into microcentrifuge tubes. Fifty microliters of 10% SDS were added to each half

which was incubated at 65C for 30 minutes to lyse spheroplasts. Two hundred

microliters 5 M potassium acetate, pH 8.0 were added to each and samples were

incubated on ice for 60 minutes. Samples were centrifuged sequentially for 10







49

minutes and 5 minutes in a microcentrifuge and the supernatants of both

centrifugations were pooled. Isopropanol (700 pl) was added to each and

centrifuged for 20 seconds to collect theDNA pellet. The pellet was rinsed with

95% ethanol, decanted supernatant and allowed to air dry. Each pellet was

resuspended in 300 pI of TE pH 8.0. The divided samples were pooled and

treated with 10 pul 10 pg/pl RNase A at 37C for at least 2 hours to digest RNA.

Aliquots (3 pI) of 1 M spermidine, pH 7.0 were added to each sample until a DNA

precipitate appeared. It usually took about 2-3 aliquots to precipitate DNA.

Samples were set on ice for 15 minutes and centrifuged 20 seconds to collect

DNA. Supernatants were decanted and pellets were allowed to air dry. The

DNA pellet was dissolved by adding 300 pl 3 M ammonium acetate to the pellet

and incubating at 65C for at least 4 hours. Absolute ethanol (750 pl) was added

and each sample was held at -70C for 15 minutes to precipitate the DNA. DNA

was collected by centrifuging for 15 minutes in a microcentrifuge and decanting

the supernatant. The pellets were rinsed with 70% ethanol, dried in vacuum and

resuspended in 200 pl water. The DNA was digested with either Accl or EcoRV

to analyze the coding strand or the noncoding strand, respectively. After

digestion, the DNA was precipitated and washed three times to remove residual

salts. First, one-half volume of 7.5 M ammonium acetate was added to the

sample plus 1.5 volume ethanol. Samples were set in a dry-ice ethanol bath for

10 minutes to precipitate, then centrifuged for 15 minutes in a microcentrifuge

and the supernatants were decanted. Pellets were resuspended in 200 pl TEN

(10 mM Tris-HCI, pH 8.0; 1 mM EDTA; 100 mM sodium chloride), then 100 pl 7.5







50

M ammonium acetate plus 400 pl ethanol was added. This precipitation was

repeated and the pellet was washed in 1 ml 70% ethanol. To cleave the DNA,

10 pl concentrated (10 M) piperidine (Fisher Biotechnology) was added to the

sample to make a final concentration of 1 M. The sample was transferred to a

screw cap tube and incubated at 95C for 30 minutes. At the end of the

incubation, the tube was chilled on ice for few minutes and lyophilized overnight

in the Speed Vac (Savant). The pellet was resuspended in 250 pl 0.3 M sodium

acetate, pH 5.3. Then 3 volumes of ethanol was added and the sample was

placed in a dry-ice ethanol bath. DNA was collected by centrifugation in an

Eppendorf centrifuge. The pellet was resuspended in 200 pl 0.3 M sodium

acetate, pH 5.3, and the ethanol precipitation was repeated. The final pellet was

rinsed with 70% ethanol and dried in vacuum. Each pellet was resuspended in 5

pl of sample dye and loaded on a 6% polyacrylamide/50% urea gel. The gel was

run at 60 watts constant power in TBE buffer (0.89 M HCI; 0.89 M borate; 0.005

M EDTA) until the bromophenol blue dye reached the bottom of the gel. The gel

was picked up with a Hybond N+ (Amersham) membrane precut to the size of

the gel and presoaked in TBE, the transfer buffer. The DNA was transferred onto

the nylon membrane by electroblotting, using the Genesweeper instrument

(Hoefer Scientific) as recommended by the manufacturer. After the transfer, the

nucleic acid was crosslinked to the membrane on a transilluminator for 10

minutes. Prehybridization was performed with 25 ml of hybridization solution,

which consisted of 7% SDS; 0.5 M sodium phosphate, pH 7.4; 1% BSA; 1 mM

EDTA, at 60C for at least 60 minutes. Radiolabeled DNA probe was then added







51

and hybridization carried out overnight at 60C with shaking. Radiolabeled probe

was prepared by primer extension on a single-stranded DNA template with a

complementary oligonucleotide using the Klenow fragment of DNA polymerase I.

After hybridization, the membrane was washed three times at the hybridization

temperature. The wash solution consisted of 1 % SDS; 40 mM sodium

phosphate, pH 7.4; 1 mM EDTA.



Preparation of Single-Stranded DNA



Single-stranded DNA was prepared from pSL123 and pSL123R, to serve

as a template in generating probes for in vivo footprint analysis. These two

plasmids contain the upstream sequences of p5-495 in opposite orientations at

the EcoRI site on a phagemid plasmid. The single stranded DNA generated from

either plasmid would be complementary to either the coding (pSL123R) or

noncoding (pSL123) strands of CIT1. An isolated colony of XLI Blue strain

containing the plasmid was grown in 2.5 ml of super broth containing 12.5 pg/ml

of tetracycline and 100 pg/ml of ampicillin overnight at 37C with vigorous

shaking. Two and half milliliters of the overnight culture was added to 50 ml

super broth in a 500 ml flask and grown until the OD60o reached 0.3. VCS-M13

helper phage was added at an MOI (multiplicity of infection) of 20:1 and

incubation continued for an additional 8 hours. The culture was heated at 65C

for 15 minutes and centrifuged at 9,500 rpm in JA20 rotor at room temperature.

The supernatant was transferred to a new tube and centrifuged again as above.







52

One-fourth volume of 3.5 M ammonium acetate, pH 7.5; 20% polyethylene glycol

(PEG) 8000 was added to the spheroplast. The tube was inverted several times

to mix the sample, which was held at room temperature for 45 minutes. The

pellet was collected by centrifugation sequentially at 9,500 rpm at room for 20

minutes and 1 minute; discarding the supernatant each time. The pellet was

resuspended in 15 ml TE, pH 8.0 and 7.5 ml phenol/chloroform (1:1) was added.

The mixture was vortexed for 1 minute and centrifuged at 11,500 rpm for 5

minutes in the JA20 rotor at room temperature. The aqueous phase was

transferred to a fresh tube and the extraction repeated until no interphase was

present. This usually took four extractions to accomplish. Then 10 ml chloroform

was added and the sample vortexed 1 minute and centrifuged at 11,500 rpm in

JA20 rotor for 5 minutes. The aqueous phase was transferred to a fresh tube and

one-third volume 7.5 M ammonium acetate (final concentration, 2.5 M) was

added. 2.5 volumes absolute ethanol were added and the sample was incubated

on ice for 40 minutes to precipitate. The sample was then centrifuged at 9,500

rpm in the JA20 rotor at 4C. The supernatant was decanted, and the pellet was

dried and then resuspended in 400 pl TE pH 8.0.



Bandshift Assayl/In Vitro Footprinting Analysis



To determine if sequences upstream of the TATA element were involved

in direct protein/DNA interaction, bandshift assay and in vitro DNase I protection

assay were performed to identified such regionss. For the bandshift assay, a







53

single end radiolabeled probe from the upstream sequence was prepared and

incubated with an extract of yeast cells at room temperature for 20 minutes. It

was then run on a 4% nondenaturing polyacrylamide (40:1) gel in TBE at room

temperature at 100 V, until the bromophenol blue dye had migrated to the

bottom. The gel was dried under vacuum at 80C and exposed to X-ray film.

The cell extract for the assay was prepared as follows: A cell culture was grown

to early logarithmic phase (OD60o ~ 1.0) and harvested by centrifugation at 7,500

rpm in a JA10 rotor (Beckman) for 10 minutes at 4C. The cell pellet was

resuspended in 10 ml extraction buffer(0.2 M Tris-HCI pH 8.0; 0.4 M ammonium

sulfate; 10 mM magnesium chloride; 1 mM EDTA; 20% glycerol). Cells were

washed by resuspension in the same buffer and repeated centrifugation. Three

milliliters of extraction buffer plus 2 mM PMSF; 0.5 mM DTT; and 1 pg/ml

pepstatin were added per 1 g of wet weight of cells. Cells were disrupted by

passing through a French Pressure Cell at 20,000 psi three times. The

homogenate was then centrifuged at 17,000 rpm (35,000 X g) for 45 minutes in

the JA 20 rotor at 4C. The supernatant was aliquoted into microcentrifuge tubes

and stored at -70C. Protein concentrations were determined as described

earlier. Two probes were used for the bandshift assays: (1) -406 to -216

fragment and (2) -245 to -111 fragment. These two probes together span the

entire region of the upstream sequences of p5-498, which contains all of the

presumptive CIT1 UAS. The probes were prepared by using oligonucleotides

AL82/AL85 (Table 3) to generate the -406 to -216 fragment in a PCR reaction,

and primers AL84/AL104 to make the -245 to -111 probe. Standard PCR







54

reaction was performed as described above. The annealing temperatures for

AL82/AL85 and AL84/104 were 47C and 51 C, respectively. One of each pair of

primers was end labeled with T4 polynucleotide kinase before the PCR reaction

to make sure that only one end was labeled. The two probes were used instead

of a single probe that encompasses the entire region, because preliminary

experiments showed that a single fragment alone would not migrate into a 4%

(39:1) nondenaturing polyacrylamide gel very well. Similar PCR products as

described earlier or double stranded oligonucleotides were used for competition

assay. The oligonucleotides were annealed by mixing equimolar amounts of

each strand in 10 mM Tris-HCI, pH 8.0/5 mM MgCl2. The reaction mixture was

boiled for 5 minutes and allowed to slowly cool to room temperature.

To identify the exact sequences involved in the bandshift assay, a DNase I

protection assay was performed on both sets of probes. After the standard

bandshift assay, 1 pl 20X DNase buffer and 1 pl 1 U/pl RQ1 DNase I (Promega

Corporation), were added to the reaction mixture and permitted to digest for 45

seconds. The reaction was then stopped by adding 1 pl 0.5 M EDTA. The

sample was loaded into a 4% (39:1) polyacrylamide gel and run as described

above. At the end of the run, the wet gel was then exposed to an X-ray film

overnight at room temperature. The bands were then excised and DNA eluted

onto a DEAE cellulose membrane in an agarose gel. The DNA was recovered

from the DEAE membrane by incubating it at 65C with high NET (1.0 M sodium

chloride; 0.1 mM EDTA; 20 mM Tris-HCI, pH 8.0) for 45 minutes. The eluate was

transferred into a fresh microcentrifuge tube and precipitated with 1 ml absolute







55

ethanol at -70C for 30 minutes. Pellet was resuspended in 200 pl water and 500

pI absolute ethanol were added. DNA was precipitated at -70C again for 30

minutes and centrifuged at maximum speed for 15 minutes. The supernatant

was decanted and the pellet rinsed with 1 ml 70% ethanol. The pellet was dried

in a Speed-Vac and resuspended in 5 p1 of sequencing dye solution. The sample

was then loaded on a 6% polyacrylamide gel (19:1) and run at 1000 V until the

bromophenol blue had migrated two-thirds of the length of the gel. Control

reactions were performed by digesting naked DNA with DNase I. Sequence

ladder was generated by using the primer that was end labeled in a dideoxy

sequencing reaction. The gel was dried and exposed to X-ray film.



Messenger RNA Stability (5' UTR deletion) Assay



The 5' untranslated region and the coding region on p5-498 plasmids were

individually dissected to determine their effects on the stability of the CIT1::IacZ

fusion mRNA. I used RCPCR to delete these regions essentially as described

above for the pSL123 plasmid. After the deletion, the EcoRI fragment was

subcloned into p5-498, which was then transformed into yeast strains. I used

primers AL189 and AL190 pair to delete the 5' untranslated region. The first

nucleotide, adenine, of the major transcriptional start site was retained. The rest

of the sequences remained essentially the same. A similar strategy was also

used to delete the coding region present in the CITI::IacZ fusion. The primers

used were AL205 and AL206 (Table 3). In this construct, the deletion was







56

created in such a way as to retain the first codon of CIT1, which was joined in the

proper reading frame to the lacZ gene. After the deletion, these constructs were

sequenced to determine their new adjourning sequences and to be certain that

no other mutations were introduced in this region during the PCR reaction. The

annealing temperature for ALl 89/190 was 53C and AL205/AL206 was 63C.

The schematic of how transcription was terminated is presented in Figure 3.



Introduction of Stop Codon at the Fifth Amino Acid Position in the CIT1 Gene



To introduce a stop codon at the fifth position on the CIT1 portion of the

CITI:: lacZ fusion plasmid, the TransformerTM Site-Directed Mutagenesis Kit

(Clontech) was used as recommended by the manufacturer. Briefly, two primers

were designed called the Selection primer and the Mutagenic primer, to prime

synthesis of a complementary strand by T4 DNA polymerase after initial

denaturation of the template, pSL123R. The selection primer introduced a

mutation at a unique Scal site that converted that recognition site into a new

unique Stul site. This enabled screening of putative mutants easily by digestion

of the putative recombinants with the newly created Stul site. The nicks on the

newly synthesized complementary strand were sealed by T4 DNA ligase. The

ligated DNA was then used to transform an E. coil strain that is deficient in DNA

mismatch repair, a mutS strain. This allowed the amplification of both mutated

and unmutated plasmid. Transformants were grown in LB broth for several

generations, then I isolated plasmid DNA. The pool of DNA obtained was







57

digested by Scal, which linearized wild type plasmid but left plasmids with a

mutated Scal site in the circular form. This pool of DNA was then used to

transform E. coil a second time. Because the linearized wild type plasmids were

not as efficient as the circular mutated plasmids in transforming E. coli, the

majority of the transforming DNA had now lost the Scal site, but had obtained the

Stul site. Those clones with the Stul site were sequenced by the dideoxy

sequencing method to identify those that had also acquired the T to G

transversion at position +389. Clones that were verified to have the correct

mutations were subsequently subcloned into the p5-498 plasmid, at the EcoRI

site.









Table 1. E. co/i Strains.

Name Genotype
HBII0 supE44, ara14, galK2, lacY1, proA2, rpsL20, xyl-5, mtl-1,
recA13, A(mcrC-mrr), HsdS-(r-m-)
C600 e14-(mcrA), supE44, thi-1, thr-1, leuB6, lacY1, tonA21
BMH71-18 mutS thi, supE, A(lac-proAB), [mutS::TnIOJ[F' proAB,
laclqZAM15]
XL 1-Blue recA1, endA1, gyrA96, thi-1, hsdR17, supE44, relAl, lac,
~~________ [F'proAB, laclqZAM15, TnlO(tetf)]
SURE e14-(mcrA), A(mcrCB-hsdSMR-mrr)171, sbcC, recB, recJ,
umuC::Tn5(kanr), uvrC, supE44, lac.gyrA96,relA1, thi-
~~________1,endA 1 [F'proAB, lacPZIAM 15, Tn 1O, (tel')]


Table 2. Yeast Strains.

Name Genotype Source
S150-2B MATa, his3A200, leu2-3, 112, trpl-289, ura3- H. Fukuhara
52
1-7A MATa, adel-100, his4-519, leu2-3, 2-112, P. Srere
ura3-52
JP16-8B MATa, adel-100, ade2, leu2-3, leu2-112, P. Srere
AHAP2::URA3
SHY40 MATa, adel-100, leu2-3,2-112, ura3-52, J. Pinkham
hap3::HIS4______
SLF401 MATa, adel-100, his4-519, leu2-3, 2-112, L. Guarente
ura3-52, hap4::LEU2______
Z118 MATa, ade2, leu2-3,112, his3A200, rpbl-1, R. Young
ura3-52 ______
Z118URA3 MATa, ade2, leu2-3, 112, his3A200, rpbl-1, This work
~______ura3-52, trpl::URA3______










Table 3. Oligonucleotides Used in this Research.


Name Gene Position Sequence 5' to 3'
AL41 CITI 146 to 165 TGACATTGTCTTGTGGAGCC
AL45 CYCI GCATGCCATATGATCATGTG
AL60 CIT1 -216 to-200/- TAGTATCGGAGTATTTTTT I I I I I GGTCTAGCGG
160 to-151 G
AL61 CIT1 -160 to -141 TCCGATACTATCGACTTATC
AL80 CIT1 78 to 97 GCAATATAATACTATTTACG
AL82 CIT1 -406 to -388 ATACCTAAACTAATTAAAG
AL83 CIT1 -251 to -237 CCGGGCGGCTGCGGC
AL84 CIT1 -245 to -216 GCCGCCCGGAAATGAAAAGTATGACCCC
_____CG
AL85 CIT1 -245 to -216 CGGGGGTCATACTTTTCATTTCCGGGCGG
_______ __~C
AL86 CIT1 -200 to -160 CTTTTGTGTTATTGGAGGATCGCAATCCC
_____TTTGGAGCTTTT
AL87 CIT1 -200 to -160 AAAAGCTCCAAAGGGATTGCGATCCTCCA
ATAACACAAAAG
AL102 CIT1 -141 to -121 CATTTTCAAACAAGAGGTCGG
AL103 CIT1 -139 to-111 GACCTCTTGTTTGAAAATGTCAATTGAT
AL104 CITI -139 to -111 ATCAATTGACATTTTCAAACAAGAGGTC
ALl 16 CIT1 -271 to -252 GGAAAAAAACGTGACGCCTT
ALl 17 CIT1 -370 to -353 CATTTTCATTGAACGGCT
AL126 CIT1 -346 to-341/ ATC I I I I I I I I TTTATGTATTACCT
-371 to -288
AL127 CIT1 -360 to -341 AAAGATTAATTGAGCCGTTC
AL128 CIT1 -340 to -308 GTAAATATGAGCGTTTTTACGTTCACATTG
________________CCT








Table 3 continued


Name Gene Position Sequence 5' to 3'
AL129 CIT1 -340 to -308 AGGCAATGTGAACGTAAAAACGCTCATAT
TTAC
AL189 CIT1 -1 to -21 GGTTTGTATTTTAGTAAACAG
AL190 CIT1 -7 to -1/100 ACAAACCATGTCAGCGATATTATCA
to 117
AL191 CIT1 109 to 128 GATATTATGAACAACTAGCA
AL203 Amp ____GTGACTGGTGAGGCCTCAACCAAGTC
AL204 CIT1 100 to 132 GATGTCAGCGATATGATCAACAACTAGCA
AAAG
AL205 CIT1 86 to 102 CATCTTCGAAATAGTATT
AL206 CIT1 96 to 103/ CGAAGATGGGGGCGAGCTCGA
178 to 190
MS41 CIT1 -216 to -197 GCTAGACCAAAAAATACTTT
MS42 CIT1 -264 to -245/ TTGGTCTAGCCTGCGGCGGAAAAAAACGT
-216 to -207 G
MS43 CIT1 -252 to -233 CGCCGCAGCCGCCCGGAAAT
MS44 CIT1 -391 to -370/ GGCTGCGGCGGGCGAACTTCGGAGATTT
_____-252 to -243 CT










Table 4. Plasmids Used in this Research.


Designation Construction
pSHI18-8 Approximately 970 bp of CIT1 sequence, consisting of 78 bp
of coding region and sequences further upstream in pUC18
(New England Biolab) cut with Smal
YCpZ-2 A yeast/E coil shuttle vector used to carry all deletion
constructs. See Rickey (1988)
p5-498 Approximately 670 bp of CIT1 sequence contained in
pSH18-8 following exonuclease digestion was subcloned in
YCpZ-2 cut with BamHI/Smal.
pSLOO1 A 1.1 kb EcoRV/Clal from p5-498 that consists of 817 bp of
5' lacZ sequence and approximately 290 bp of CIT1
sequences from -111 to +78, subcloned into pBluescript KS+
(Strategene) cut with EcoRV/Clal.
pSL123 Approximately 670 bp EcoRI fragment from p5-498
consisting entirely CIT1 sequence sucloned into pBluescript
KS+ cut with EcoRI.
pSL123R Similar to pSL123, the insert is in reverse orientation.
pGEM-Actin A 563 bp internal Clal fragment from ACT1 gene subcloned
into pGEM 4 (Promega) cut with same enzyme (generous
gift from Dr. R. Butow).
plCZ312 Generous gift from Dr. Alan Myer.
YISL101 Approximately 380 bp of CIT1 5' upstream sequence from
pSL123 subcloned into plCZ312 cut with Smal/Xhol.
YISL101R Similar to YISL101 R; the insert is in reverse orientation.
YISLI 11-139X Double stranded oligonucleotide corresponding to sequences
between -139 to -111 was annealed and subcloned into
plCZ312 digested with Xhol.
YISLA1 -99 Similar to p5-498 except that sequences between 1 to 99 bp
of CIT1 sequence have been deleted.
YISLA100-178 Similar to p5-498 except that sequences between 100 to 178
Sbp of CIT1 sequence have been deleted.







62
Table 4 continued.

Designation Construction
YISLSTOP Similar to p5-498 except that a T to G transversion mutation
was introduced at position 114 of the CIT1 sequence.












RESULTS


Analysis of 5' (Distal) and 3' (Proximal) Deletions


Studies by Hoosein and Lewin (1984) showed that there were increased

amounts of CIT1 translatable mRNA in cells grown in glucose medium as they

approach stationary growth phase and begin to utilize ethanol as a primary

carbon source. Logarithmic-growth phase cells grown in ethanol contained more

CIT1 mRNA than log phase cells from a glucose culture. This observation

suggested that the increased steady-state level of CIT1 mRNA may be due to an

increased rate of transcription or to a decreased rate of turnover in ethanol

medium. My initial focus was to determine the boundaries on the sequences

upstream of the transcriptional initiation site that may contribute to the high-level

expression of CIT1 in ethanol medium or glucose depleted medium. The

decision to characterize the UAS (upstream activating sequence) elements was

based in part on the presence of a perfect match to the nine nucleotide

(TNATTGGT) consensus binding site for the trimeric protein

Hap2p/Hap3p/Hap4p. This protein complex has been well characterized and

shown to be required for high-level expression of genes encoding proteins in the

mitochondrial electron transport chain (Trueblood et al., 1988; Trawick et al.,







64

1990), TCA cycle genes (Bowman et al., 1992; Gangloff et al., 1990; Repetto and

Tzagaloff, 1990), and heme biosynthesis (Keng and Guarente, 1987).

The strategy employed to identify regulatory elements involved fusion of a

fragment of DNA from the CIT1 with the E. col lacZ gene. The CIT1 segment

contained some of the coding sequences and the transcriptional regulatory unit,

which consisted of the TATA element, transcriptional start site and the putative

UAS elements. Sequential deletion of the putative UAS element was performed

in a manner that deletion progressed toward or away from the transcriptional

start site. Deletions that progressed toward the transcriptional start site were

designated 5' (distal) deletions (Figure 1), and those that progressed away from

the transcriptional start site were designated 3' proximall) deletions (Figure 2).

The lacZ gene was used as a reporter gene for several reasons. First, deletion

of the CIT1 gene in yeast causes slower growth (Kispal et al., 1988), which may

lead to pleiotropic effects on other metabolic processes; therefore, the native

CIT1 gene on the chromosome was left intact. Second, there is another citrate

synthase isozyme encoded by the CIT2 gene (Kim et al., 1986; Lewin et al.,

1990), which partially compensates for CIT1 deletion (Kim et al., 1986). This

makes assaying for citrate synthase activity of a CIT1 gene on a plasmid

impractical. Therefore, in order to determine the effect of the upstream sequence

deletions on CIT1 gene expression, the reporter gene was used. The gene for 13-

galactosidase was used, because there is no similar activity in yeast; therefore,

any enzyme activity detected would be from the plasmid carrying the gene and

under the control of the CIT1 promoter elements. The vector plasmid, YCpZ-2







65

(Rickey, 1988) contains CEN4 and ARS1 sequences which were necessary for

the plasmid to replicate and be maintained at approximately a single copy per

yeast cell. It also has a TRP1 marker for selection in yeast, an origin of

replication for E. co/i and the bla, ampicillin resistance, gene for selection in E.

coil. Recombinant plasmids were transformed into the S150-2B yeast strain and

selected for transformants on SD (2%) medium containing 10 pg/ml histidine, 20

pg/ml leucine, and 5 pg/ml uracil. Total cellular extract was prepared from at

least two different isolates of each transforming plasmid and its P3-galactosidase

activity determined in triplicate as described in materials and methods.

Figure 3 shows the specific activities obtained from the selected deletion

mutants. CIT1 mutants were named according to the end-points of the deletion

relative to the major transcriptional start site. Deletions from the 5' end of the

gene that extended toward the transcriptional start site did not show any

significant reduction in specific activity until they extended beyond position -498.

Hence, the activity of this clone was designated wild-type level, and all other

clones were compared to it to assess the effect of deletion. There was about a

27-fold induction when the p5-498 clone carrying strain was grown in an ethanol

medium compared to when grown in glucose. This is somewhat higher than the

induction of citrate synthase activity usually observed in yeast, suggesting that 13-

galactosidase may be more stable in yeast than citrate synthase. However, it

should be noted that the level of induction of citrate synthase between

derepressing and repressing media varies considerably between strains. Further

removal of sequences to position -245 caused only a slight decrease in 13-


























Figure 3. 13-Galactosidase Activity of 5' and 3' Deletions in Complex
Medium. (A). The top line represents the CIT1 sequence from which all the 5'
and 3' deletions were derived. The number of each deletion construct represents
the deletion end-point. Yeast cells were grown in complex media supplemented
with glucose (YPD) or ethanol (YPE) to early logarithmic phase. Glucose and
ethanol were added to 2% weight/volume. The specific activity of 13-
galactosidase is presented as nanomoles of ONPG hydrolyzed per minute per
milligram of protein in the lysate. Each value represents the average of triplicate
assay from two to three transformants and differed from each by no more than
10%. (B). A diagramatic interpretation of the results. The hatched areas
represent putative UAS and the dotted area represents a putative URS region.













-498
to498


1
-245

-227


1
-21

-252


-372
-3 72


A
-800

17/-


1

-1391111
"1 r
-172 -111

7~1H
7 -111

7
-111

-11 1


,-800 AT: G
I I I I 1 I
;-400:S ^


-600
1


-400
1


-200
1


-800

.800

-800
-00 '


-800 OJ /


-600
1


ATG Specific Activity
PYPD YPE

70 2017

57 1938

9 1183

23 626

163 2933

138 1797

104 670

8 232

1 46


ATG


J


-800
1


YPE/YPD

26

34

131

27

18

13

6 c

29

46







68

galactosidase level expressed from this clone, p5-245, in a derepressing

medium, but produced about 20% reduction in a repressing, glucose, medium.

Consequently, there was a higher fold induction of the p5-245 clone than the p5-

498 clone. Removal of additional 19 base pairs (p5-227) caused a severe

reduction in 13-galactosidase level expressed in a repressing medium while

activity was reduced only about 50% in a derepressing medium. The overall

induction, YPE/YPD, of p5-227 was 131-fold, which was almost seven times the

fold induction for p5-498. In clone p5-168 the specific activity in glucose and

ethanol was reduced to about 33% of wild-type level. Therefore, the level of

induction of ethanol versus glucose media was about the same as the wild-type

level.

Deletions beginning from the 3' or proximal end of the upstream sequence

resulted in a range of specific activities from 2.5 times greater than the wild-type

insert in a repressing medium (YPD) to a barely detectable level. In the

derepressing medium, YPE, the activity ranged from 150% of wild-type level to

about 2% of the wild-type level. In clone p3-139, the sequence from -139 to -111

was deleted. In this clone, specific activities were consistently higher than wild-

type in cells from both media, suggesting that an upstream repressing sequence

(URS) may have been removed. Rosenkrantz and his colleagues (1994) also

found that removing sequences in this region caused an increase in 13-

galactosidase level expressed from a CITI::IacZ fusion gene. A deletion that

stopped at position -172 had a specific activity that was nearly 90% of wild-type

in the YPE medium but almost 2.5 times greater than wild-type in cells grown in







69

the YPD medium. Removal of an additional 35 bp, clone p3-217, reduced

specific activity by two-thirds in YPE, but still maintained a slight increase (104

units/mg protein) over wild-type level in YPD. Clone p3-252 expressed 13-

galactosidase level that was approximately 10% of wild-type in both YPD and

YPE media. Further deletion to position -372 produced barely detectable

enzyme activity in cells carrying this clone in YPD medium and only about 2% of

the wild-type level in YPE medium. These 5' and 3' deletions showed that there

are three regions that caused increase of CIT1 expression in YPD and YPE

media. These regions include sequences between -372 to -252, -245 to -216

and -200 to -160. In addition sequences between -139 and -111 have a

repressing effect that is most pronounced in the YPD medium.

There have been two reports in yeast (Kim et al., 1986; Gangloff et al.,

1990) and one in B. subtilis (Rosenkrantz et al., 1985) which showed that

addition of glutamate to cultures grown in a minimal medium repressed the

activity of citrate synthase and aconitase. 13-galactosidase levels expressed in

yeast cells bearing the deletion constructs were identical, whether cells were

grown in SD(2%), or SD(2%) medium supplemented with glutamate (Rickey,

1988). However, it was observed that the 13-galactosidase levels expressed from

most of these deletion constructs were substantially higher in a minimal medium

with 2% dextrose than in the YPD (2%) medium. The results of the specific

activities obtained from cells grown in the SD medium harboring the deletion

constructs are presented in Figure 4. The wild-type clone produced 12 times

more 13-galactosidase activity in SD(2%) (897 units/mg protein) than in YPD(2%)


























Figure 4. 13-Galactosidase Activity of 5' and 3' Deletions in Minimal
Medium. Sections (A) and (B) are as described in Figure 3. P3-galactosidase
assays were performed from cultures grown in SD(2%) as described in figure 3.










-200
1


ATG Specific Activity
um SD(2%)


897


-498

-245

-245 __1________________________
-227

-168 I


-139-111
I 72
-172 -111


217

-252


, -400
'I \\\\\N\\\ N -\N NNX


554

397


-111

-111

-111


pITAA +1


ATG


-800
1 /Z


-600
1


-400
1


-800

-800

-800

-800~
-0o0
-800





L- o


-372


-800
1 ,


-600
1


(^ +1^
r --- A t







72

(70 units/mg protein). This large effect, was lost when sequences up to -245

were deleted. Deletion constructs beginning from the 3' end of the CIT1 upstream

sequences showed significant reduction in 13-galactosidase expressed from them

when deletion extended up to position -252. There was no increase in specific

activity from clone p3-139 compared to the wild-type clone. This would suggest

that the sequences between -139 and -111 are involved in regulation of CIT1 in

response to glucose but not in response to minimal medium. There are two

putative core GCN4 consensus-binding sites that lie between -374 and -369 and

-268 and -263, which may be responding to growth in a minimal medium. GCN4

is a transcriptional activator involved in the regulation of genes in the amino acid

biosynthesis pathway (reviewed in Hinnebusch, 1988). Reduction in expression

from clone p5-227 to 5% of wild-type and clone p3-372 to less than 1% of wild-

type suggest that all the necessary sequences for regulation in a minimal

medium lie in this region. In clone p5-227, the two putative GCN4 binding sites

were deleted, whereas in clone p3-372 the proximal site was deleted and the

distal site was disrupted.

The results of these 5' and 3' deletions showed that several regions,

between sequences -370 and -252, -245 and 216 and -200 and -160 in the

upstream sequence, that contribute to transcriptional regulation of this gene. It is

clear that these sequences have activating functions because when deleted they

reduced specific activities, but the sequence between -139 and -111 has a

repressing effect in response to glucose. The sequences necessary for

regulation in a minimal medium lie between -370 and -227.







73

Internal Deletions Show Several Putative UASs



The results of the exonuclease deletions of the CIT1 nontranscribed

region suggested that there was more than a single element which may be

involved in the regulation of this gene. In yeasts and other eukaryotes,

regulatory elements such as UASs and proximal regulatory elements, such as

Spl and AP1 sites, may lie in close proximity to each other. Therefore, there is

increased likelihood that more than one regulatory element may be removed

during exonuclease digestion. To test for this, individual regions were dissected

from the upstream sequences by inverse PCR. The regions deleted include

positions: 1) -160 to -200, 2) -216 to -245, 3) -252 to -370, and 4) -160 to -370.

These regions were chosen for the internal deletion analysis because the results

of the directional deletions from the proximal and distal ends suggested that they

may be important in regulating this gene.

In clone pA1 60-200, the sequences between -160 and -200 were deleted.

This region of CIT1 upstream sequences has the consensus binding site for the

Hap2p/Hap3p/Hap4p transcriptional activator protein at -192 to -185. Several

laboratories have shown that the Hap2p/Hap3p/Hap4p activator is involved in

regulation of many genes for mitochondrial proteins, including CYC1 (Olesen et

al., 1987; Guarente and Mason, 1983), HEM1 (Keng and Guarente., 1987),

COX6 (Trueblood et al., 1988), KGD2 (Repetto and Tzagoloff, 1990), LPD

(Bowman et al., 1992), and ACI01 (Gangloffet al., 1990). Removal of this region

reduced the specific activity of 13-galactosidase by one-third, to approximately







74

658 units per milligram protein in the derepressing medium, YPE (Figure 5).

However, in the YPD medium the specific activity obtained for this deletion was

100 units per milligram protein, which is higher than the wild-type level. The

second region deleted were sequences from -245 to -216 with respect to the

transcriptional start site. Specific activity was reduced to 3.5 and 664 units/mg

protein in glucose and ethanol media, respectively. This represented a 20-fold

reduction in the glucose medium but only a 3-fold reduction in the ethanol

medium.

The third region deleted were the sequences from -370 to -252, and the

plasmid was named pA252-370. Removal of this region, which was 119 bp in

length, drastically reduced the specific activity of P3-galactosidase. In a

derepressing medium the specific activity was reduced to 79 units per milligram

protein, which was approximately 25-fold lower than the wild-type level.

However, in a repressing medium the reduction was more severe, lowering

activity nearly 50-fold relative to the wild-type level in a similar medium. The

fourth internal deletion constructed encompassed all the other three deletions

previously described, from positions -370 to -160. There was approximately 24

units per milligram protein of specific activity detected in clone pA160-370 in a

depressing medium, which was nearly 85-fold lower than the wild-type activity in

a similar medium. In YPD medium the specific activity for this construct was only

0.7 units, which is 100-fold lower than the wild-type activity. The fold induction in

a derepressing medium versus a repressing medium was 34 times in cells

harboring clone pA160-370. This level of induction reflects the very low activity


























Figure 5. 3-Galactosidase Activity of Internal Deletion Constructs. (A).
Internal deletions were constructed by using inverse PCR with primers that
surround the region of interest. The CIT1 sequences present in the wild-type
clone was used as the template in the PCR. The HAP symbol represents the
region on the CITI1 sequence that has the consensus site for the transcriptional
activator HAP2/3/4. p-galactosidase activity represents the average from
triplicate assay from at least two transformants. (B). A schematic interpretation
of regions with UAS activity.








A

-800 -600 -400 -200 +1. ATG
I l I IrIHAPI Oi


-498


-498
-1498


I I-1
-200-160


I II


I I I
-498 -245 -216

-498 -370 -252
-498 -370 -160
-498 -370 -160


Specific Activity
YPD YPE YPE/YPD

70 2017 26

100 658 7

3.5 664 190

1.4 79 56

0.7 24 34


B
-800
L-7







77

from this construct in YPD, confirming that the response to glucose can be

mediated by sequences outside this region (e.g. the URS from -139 to -111).

The results obtained with p5-245 and pA252-370 seem at odds because the

region deleted from the pA252-370 clone was also deleted from the p5-245

clone, yet activities remain relatively high in p5-245, especially in derepressing

media. The sequences between -498 and -370 were present in pA252-370, but

were deleted from clone p5-245. This result suggests that the -498 to -370

region may contain a URS.



There are Multiple UAS Elements



Upstream activating sequences have, by definition, the ability to activate

the transcription of their cognate gene or a heterologous gene in an orientation

independent manner. The activation may show regulation in the heterologous

context similar to that in the native gene. To show that the whole upstream

sequence present in p5-498 and segments of it have either a UAS or URS

function, the entire region or smaller regions were subcloned into plasmid

plCZ312 whose UAS elements were removed by digestion with restriction

enzymes Xhol and Smal. The important features of this plasmid were the

presence of the CYC1 promoter elements UAS1 and UAS2, the TATA element,

the transcriptional start site, and only three nucleotides of the coding region fused

to the lacZ gene. UAS2 has seven of eight nucleotides of the consensus

sequence that binds to the Hap2p/Hap3p/Hap4p transcriptional activator







78

complex. Use of this plasmid would allow direct comparison of the putative

UASCITI to UAS2cycl regulation by the Hap2/3/4 activator complex mentioned

earlier, since they both have the consensus site for the activator.

The plCZ312 plasmid was digested with Xhol and Smal enzymes and

filled-in with the Klenow fragment of E co/i DNA polymerase I in the presence of

5 mM of all four deoxynucleoside triphosphates. The CIT1 sequence was

generated by cutting p5-498 plasmid with EcoRI and EcoRV enzymes, filling-in

with Klenow enzyme and recovering a 388 bp fragment that contained the entire

regulatory region. The CIT1 fragment was cloned into the plCZ312 vector and

both forward- and reverse-orientation recombinants were recovered. These

clones were designated YISL101 and YISL101R. These plasmids and the intact

plCZ312 plasmid were transformed into 1-7A and JP16-8B (hap2). JP16-8B was

a derivative of 1-7A by insertion of the URA3 gene at the HAP2 locus to disrupt

the gene (Pinkham and Guarente, 1985). 13-galactosidase activities from each

transformant was determined as described in materials and methods.

The results of these experiments are shown in Figure 6 and 7. The

YISL101 R clone produced approximately the same level of specific activity as

plCZ312 in both repressing and depressing media. However, with YISL101 the

specific activity was nearly one-half the amount of UAScycI in YPD. The

difference in specific activities between YISL101 and YISL101 R was observed in

a repressing medium but was less pronounced after glucose has been depleted

in stationary phase (Figure 6) or when cells were grown in ethanol (Figure 7).

When the UASCIT containing plasmid was transformed into a hap2 strain, the

























Figure 6. UAS Activity of CIT1 5' Untranscribed Region. The entire 5'
untranscribed region of CITI present in the "wild-type" clone, p5-498, was
subcloned before a CYCI::IacZ fusion deleted of its native UAS. 13-galactosidase
assays were performed from cultures grown in YPD. 1-7A is a wild-type yeast
strain and JB16-8B is a hap2 mutant derivative of 1-7A. Activities are presented
as described in the legend to Figure 3. ND= P-galactosidase assay was not
performed.














Specific Activity


1-7A

STA


plCZ312


-4JAS1-UAS -----TATA CYC1::lacZ
>,, .>



310


691


JP16-8B

LG STA


196


plCZ312UASLESS


TATA CYC1::IacZ
"y ,


43 93


,bc UAScnr 9.-,- TATA, CYC:.:IacZ


SUASc-r, T
-TATA- CYC1::lacZ
UA'" f ""A -y>:ea


302



173


615



745


101 367



70 303


YISL101



YISL101R


Construct


Arrangement
























Figure 7. UAS Activity of Various CIT1 Upstream Sequences. A 41-mer
representing sequences from position -200 to -160 and a 30-mer representing
sequences from position -245 to -216 were subcloned before a CYCI::IacZ
fusion without its native UAS. P3-galactosidase assays were performed as
described in Figure 3.















Construct


-UAS1-UAS2-, TATA CYC1::lacZ
,7 >


plCZ312UASLESS


YISL160



YISL216R


Specific Activity


YPD

310


YPE

2149


I-> TATA CYC1:.I:lacZ


(41 -mer) -TATA CYC1::lacZ



(3 0 m er) -, TATA- CYC1::lacZ


150


1252


718


plCZ312







83

specific activity of YISL101 was slightly higher than the specific activity of

YISL101R (Figure 6). But UAScycl driven expression was very low during

logarithmic phase growth and was only about 66% of the UASCITn after glucose

had been depleted. While the expression from the UASCITIn in YISL101 was

reduced 42% in shifting from the HAP2 to the hap2, strain the activity of the

UAScycI dropped more than 99% in the hap2 mutant. The results indicate that,

while the hap2 mutation has an effect on the UAScycl, this effect is much less

significant than on the CYC1 gene.

The three internal regions deleted from CIT1 upstream (see Figure 5)

showed that they each contributed to the transcriptional regulation of the gene.

In order to test their contribution to activation these sequences were individually

subcloned into plCZ312 vector whose UAS1 and UAS2 had been removed as

described earlier. Only two of these regions were successfully cloned. The

YISL160 clone was derived by annealing two complementary oligonucleotides,

AL86 and AL87, and lighting the result into the vector. These oligonucleotides

span the region -200 to -160, which includes the Hap2p/Hap3p/Hap4p binding

site. YISL216 was cloned by annealing AL84 and AL85 which spans -245 to -

216. I also attempted to clone the region that encompasses the region between -

370 to -252 but was not successful.

The results from these experiments are presented in Figure 7. YISL160

produced specific activity of 47 units per miligram of protein in a culture that was

grown to logarithmic phase in the YPD medium. Cultures harvested from YPE

medium had 1252 units/mg protein. The specific activity of YISL216R was 718







84

units per milligram of protein in a depressing medium and 94 units per milligram

of protein in YPD. These results show that the regions encompassing -245 to -

216 and -200 to -160 have an activating function. The -245 to -216 region has

greater activation potential than the -200 to -160 region in YPD. However, in the

YPE medium, the -200 to -160 region showed greater expression than the -245

to -216 region, suggesting that this region contains part of the glucose

responding promoter element.



Evidence for URS Element



Under both repressing and derepressing conditions, the level of 3-

galactosidase expressed from clone p3-139 was higher than the wild-type clone

(see Figure 3). 13-galactosidase levels were more than twice as high under

repressing conditions, yet under derepressing conditions the levels were only

50% higher than the wild-type clone. This suggested that there may be a URS

element between -139 to -111 of the CIT1 sequence. To determine the potential

negative regulatory capability of this region, I cloned it into the reporter plasmid

plCZ312. To accomplish the cloning, plCZ312 was linearized with Xhol which

cuts downstream of the two UAS elements described earlier (see introduction),

and the region of CIT1 from -139 to -111 was inserted. Recombinants

designated YISL111-139X were sequenced using AL45 primer to determine the

orientation of insertion. Only recombinants in the forward orientations were

recovered and subsequently transformed into a yeast strain. If the -139 to -111







85

region has a URS function, the P-galactosidase levels expressed from such a

construct should be lower than the levels expressed from intact plCZ312.

Specific activities from this construct are presented in Figure 8. In a

repressing medium, the activity was reduced approximately 50% compared to

plCZ312 level. The same level of reduction was also seen from cultures grown

in YPD to stationary phase, when most of the glucose has been depleted and

thus represents a depressed state. However, when the cells were grown in

ethanol-supplemented complex medium there was no significant reduction in an

specific activity. This suggested that either repression of transcription occurs

only in a glucose-containing medium or that the UAS activity in a YPE medium

masks the repressing effect. However, there was still about 10% reduction of

specific activity in YPE. Even in the context of CIT1 sequences, the increase

after this region was removed was greater in a YPD medium at logarithmic phase

than it was in a YPE medium. Similar observations were made by Rosenkrantz

and coworkers (1994). However, it is possible that increasing the distance

between the UAS elements and the transcriptional start site of the CYC1 gene

could decrease the level of expression. This could come about by placing the

UAS site and the TATA site on opposite sites of the DNA, thereby hindering

proper contacts between these factors to allow activation. Insertion of an

unrelated oligonucleotide of similar length at the same site in the plCZ312 vector

should distinguish a distance effect and specific sequence effect.

























Figure 8. URS Activity of -139 to -111 Region of the CIT1 Gene. The -139 to
-111 region from CIT1 upstream sequence was subcloned into the CYCI::IacZ
fusion downstream of the native CYC1 UAS. 13-galactosidase assays were
performed as described in Figure 3.
















Arrangement


Specific Activity


YPD


pICZ312


plCZ312UASLESS



YISL111-139X


-UAS1-UAS2,, TATA CYC1::IacZ


-- TATA CYC1::IacZ



,-UAS1-UAS2( URScrr) ",-e TATA CYC1::IacZ
^ 'p


Construct


STA

691


2149


310


43



163


93



333


150



1815







88

Steady-State mRNA Levels Correlate with Enzyme Assay



The P3-galactosidase activities from the various promoter deletions strongly

suggested transcriptional regulation of the CIT1 gene affecting the steady-state

mRNA level. In order to correlate the enzyme activities with the steady-state

mRNA levels, total yeast RNA was isolated from selected strains and the level of

lacZ specific message was determined by ribonuclease protection assay.

Radiolabeled complementary RNA (cRNA) specific to the lacZ gene was

generated from plasmid pSL00l using T3 RNA polymerase. The actin message

from ACT1 gene was used as an internal control to correct for possible loading

differences. The cRNA for the actin mRNA was transcribed from pGEM-actin

plasmid, a generous gift from Dr. R. Butow, using SP6 RNA polymerase.

The results are shown in Figure 9. Figure 9a shows the autoradiogram of

the ribonuclease protection assay, and Figure 9b shows the quantitative result.

The quantitative results were obtained by calculating the ratio of lacZ mRNA

versus ACTI mRNA for each sample. Each sample was then compared to the

p5-498 mRNA level to measure their relative level of expression. Overall, the

amount of lacZ mRNA from each deletion paralleled the 13-galactosidase activity

observed for each construct. However, the YPE/YPD ratios were lower for the

steady-state mRNA levels than enzyme levels for each of the constructs tested.

Liao et al (1991), also found that in certain yeast strains the YPE/YPD ratios for

citrate synthase activity were as much as four times higher than the steady-state

mRNA produced from the CIT1 gene in identical media. Surprisingly, the mRNA























Figure 9. Steady state mRNA level of selected deletion constructs. (A) 15
pg of total RNA was hybridized in solution to radiolabeled cRNA probes for lacZ
and ACTI genes simultaneously. After hybridization, samples were digested
with RNase A and RNase T1 and resolved on 6% Long Ranger gel (AT
Biochem). Lane M is end labeled RNA molecular weight marker (1.77 to .155
kb) (Life Technologies). Lanes 1-8 are samples from selected deletion
constructs as shown. In lane 9, RNA was isolated from strain that does not
harbor any plasmid carrying the lacZ gene. In lane 10, RNA was isolated from
an isogenic strain that carry a plasmid bearing TPI::IacZ fusion (Courtesy Dr. H.
Baker). (B) Graphical representation of the net cpm of each sample obtained by
exposing the gel to a Phosphor-lmager screen (Molecular Dynamics).












A
0.530-

D E D E D E D E E E Medium
0.400- E
) 0) r0 r- Go CO 1O O. S 0
CV CV CM CM It CD 1 w
C C- n No 0 L N, P0asmid
L CL. L. Q. a Q. CL Q- c C.
lacZ

Actin
0.280-














B 1000

p YPD
YPE
800


E
600


< 400
z


200-



p3-139 p3-227 p5-498 p5-245


PLASMIDS







91

level for p3-139 was slightly lower than the p5-498 level both in repressing and

derepressing media even though a higher level of P-galactosidase activity was

detected (Figure 3). At present, no explanation satisfactorily accounts for this

discrepancy between the two methods of determining transcriptional efficiency.

Measuring P-galactosidase activities reflects both transcriptional and translational

effects and may possibly amplify small differences in RNA level. However,

Rosenkrantz et al., (1994) showed that 13-galactosidase levels increased when

the sequences between this region were deleted. This would suggest that the

enzyme assay may be more reliable than the quantitative result of the steady-

state mRNA transcribed from the same plasmids. Lane 9 of Figure 9a was RNA

isolated from a yeast strain without the plasmid construct that has the lacZ gene.

This confirms that there is no other gene in yeast that hybridizes to the E coli

lacZ probe. The sample in lane 10 (Figure 9a) was isolated from a yeast strain

transformed with pES90 plasmid, a generous gift from Dr. H. Baker's laboratory.

pES90 plasmid has the triose-phosphate isomerase (TPI1) gene fused to the

lacZ gene.



Band Shift Assay and In Vitro Footprint Analysis



To map the sequences that are involved in regulation of the CIT1 gene by

an independent method, both bandshift assays and in vitro footprint analysis

were performed. The bandshift assays were performed to see if there are

proteins from total yeast extract that can bind to a DNA fragment containing the







92

CIT1 upstream region. Footprint analysis, using DNase I, was used to identify

the sequences that bind to the proteins.

The CIT1 upstream sequence present in the wild-type construct, p5-498,

was divided into two regions to perform these assays because preliminary

assays showed that the DNA fragment of the entire upstream was too large to

migrate into the 4% polyacrylamide gel used.

Extracts from yeast grown in YPD, YPE or SD (2% glucose) media were

used for the binding assays with the different fragments. The results of the

binding experiments are shown in Figures 10 and 11. Each fragment was shifted

in response to crude yeast extract. For fragment -245 to -111 (Figure 10), two

shifts were observed: band "A" at all concentrations of extract and band "B"

(lower band) appearing only at high levels of extract. The appearance of a

second band at high protein concentration may mean that the affinity between

the protein and DNA is low, requiring a high concentration of the protein to be

present before binding is detected. Unlike fragment -245 to -111, the second

fragment, extending from position -406 to -216, gave only one shifted band even

at high extract level (Figure 11). There was no difference in binding patterns

observed amongst the extracts of cultures from YPD, YPE or synthetic medium

supplemented with 2% glucose (Figure 11).

To show that the binding observed with the different fragments was a

specific interaction, a competition reaction was performed with unlabeled DNA

fragments. The unlabeled DNA used was either identical to the labeled probe or

from other region of the CIT1 upstream sequence. Figure 12 shows the result of


























Figure 10. Bandshift of -245 to -111 fragment. Approximately 12 pg of crude
yeast extract from glucose-grown cells was incubated with approximately 2 fmole
of end-labeled 135 bp CITI1 DNA fragment. There was no extract in lanes 1 and
11. Lanes 2 through 10 had increasing amounts (1 pI to 9 pl) of extract.




Full Text
121
yeast strain that harbors the plasmid containing the fusion, and the decay rate
determined as before.
When the filter was hybridized with the lacZ probe, three bands were seen
that ranged in size from approximately 3.6 kb to greater than 9.00 kilobases
(result not shown). The 3.6 kb mRNA species represents transcripts terminated
at the end of the lacZ gene. Although the lacZ gene may not have a proper yeast
termination site (consensus sequence TTTTTATA), sequences available were
appreciably recognized to enable termination at high frequency (about one-third
of the transcription). The two other mRNA species terminated either at the 3'
end of the TRP1 gene or transcribed the entire plasmid. Transcription through
the lacZ gene in fusion with another yeast gene was also observed by Leeds et
al., (1991) using a similar vector plasmid. Although three different species of
mRNA were seen, they all showed decay kinetics similar to full-length CIT1
mRNA in YPE or when the growth medium was adjusted to 2% glucose. For the
purpose of determining the decay rate of the fusion message, I used the
transcript that terminated after the lacZ gene.
Shown in Figure 19a is the autoradiogram of fusion product (CIT1::lacZ),
hybridized with the lacZ gene. The fusion product decayed with kinetics (t,/2 5
minutes) that was similar to the CIT1 mRNA alone (t!4 5 minutes) when the
growth medium was adjusted to 2% glucose (compare Figures 17 and 19). The
half-life of the fusion product in an ethanol medium {t 25 minutes) was slightly
longer than the full-length CIT1 mRNA half-life (t!4 20 minutes). The similar
half-lives of the fusion product and full-length CIT1 mRNA suggest that the 178


180
Szekely, E. and Montgomery, D.L. (1984). Glucose represses transcription of
Saccharomyces cerevisiae nuclear genes that encode mitochondrial
components. Mol. Cell. Biol. 4, 939-946.
Thuriaux, P. and Sentenac, A. (1992). Yeast nuclear RNA polymerase. In The
Molecular and Cellular Biology of the Yeast Saccharomyces. E.W. Jones, J.R.
Pringle, and J.R. Broach, eds. (Cold Spring Harbor Laboratory Press), pp. 1-48.
Trawick, J. D., Kraut, N., Simon, F. R., and Poyton, R. 0. (1992). Regulation of
yeast COX6 by the general transcriptional factor ABF1 and separate HAP2- and
heme-responsive elements. Mol. Cell. Biol. 12, 2302-2314.
Trawick, J. D., Rogness, C., and Poyton, R. 0. (1989). Identification of an
upstream activation sequence and other c/s-acting elements required for
transcription of COX6 from Saccharomyces cerevisiae. Mol. Cell. Biol. 9, 5350-
5358.
Trueblood, C.E., Wright, R.M., and Poyton, R.O. (1988). Differential regulation of
the two genes encoding Saccharomyces cerevisiae cytochrome c oxidase
subunit V by heme and HAP2 and RE01 genes. Mol. Cell. Biol. 8, 4537-4540.
Tschopp, J.F., Emr, S.D., Field, C., and Schekman, R. (1986). GAL2 codes for a
membrane-bound subunit of the galactose permease in Saccharomyces
cerevisiae. J. Bacteriol. 166, 313-318.
Willington, C.L., Greenberg, M.E., and Belasco, J.G. (1993). The Destabilizing
elements in the coding region of c-fos mRNA are recognized as RNA. Mol. Cell.
Biol. 13, 5034-5042.
Winkler, H., Adam, G., Mattes, E., Schanz, M., Hartig, A., and Ruis, H. (1988).
Co-ordinate control of synthesis of mitochondrial and non-mitochondrial
hemoproteins: A binding site for the HAP1 (CYP1) protein in the UAS region of
the yeast catalase T gene (CTT1). EMBO J. 7, 1799-1804.
Wodnar-Filipowicz, A. and Moroni, C. (1990). Regulation of interleukin 3 mRNA
expression in mast cells occurs at the posttranscriptional level and is mediated
by calcium ions. Proc. Natl. Acad. Sci. USA 87, 777-781.
Wright, R.M. and Poyton, R.O. (1990). Release of two Saccharomyces
cerevisiae cytochrome genes, COX6 and CYC1, from glucose repression
requires the SNF1 and SSN6 gene products. Mol. Cell. Biol. 10, 1297-1300.
Xing, Y., Fikes, J.D., and Guarente, L. (1993). Mutations in yeast HAP2/HAP3
define a hybrid CCAAT box binding domain. EMBO J. 12, 4647-4655.


28
resuspended in 100 pi 1 X TEL solution. Then 50 pg denatured salmon sperm
DNA plus 10 pg of transforming DNA was added. The cells were incubated with
the DNA at 30C with gently shaking for 15 minutes, subsequently 700 pi 40%
PEG 4000 (polyethylene glycol)/TEL solution was added to the mixture, which
was vortexed vigorously for a few seconds. Cells were transferred to a 30C
heat block and incubated for additional 15 minutes without shaking. At the end,
they, were incubated at 42C for 15 minutes. Cells then were collected by
centrifugation in an Eppendorf centrifuge for 30 seconds, the supernatant was
decanted and cells were resuspended in 200 pi TE pH 7.5 and plated 100 pi per
petrie plate on appropriate selective media and incubated at the appropriate
temperature. Transformants were usually obtained in 4-5 days. Putative
transformants were restreaked on the same selective media and incubated for
another 3 days. Transformants were usually screened for their auxotrophic
markers by streaking on minimal media on which they should not grow.
Construction of 5' (DISTA and 3' (PROXIMAU Deletions
The construction of these plasmids was started by Timothy Rickey
(Rickey, 1988). All CIT1-lacZ constructions originated from two plasmids,
pSH18-8 and YcpZ2. pSH18-8 contains approximately 800 bp of the upstream
sequences and 26 codons sequence of the CIT1 gene cloned into Smal site of
pUC18. The YcpZ-2 plasmid was used to make the lacZ fusion constructs to
study the effect of promoter deletions. YcpZ-2 was made by inserting the CEN4


92
CIT1 upstream region. Footprint analysis, using DNase I, was used to identify
the sequences that bind to the proteins.
The CIT1 upstream sequence present in the wild-type construct, p5-498,
was divided into two regions to perform these assays because preliminary
assays showed that the DNA fragment of the entire upstream was too large to
migrate into the 4% polyacrylamide gel used.
Extracts from yeast grown in YPD, YPE or SD (2% glucose) media were
used for the binding assays with the different fragments. The results of the
binding experiments are shown in Figures 10 and 11. Each fragment was shifted
in response to crude yeast extract. For fragment -245 to -111 (Figure 10), two
shifts were observed: band "A" at all concentrations of extract and band "B"
(lower band) appearing only at high levels of extract. The appearance of a
second band at high protein concentration may mean that the affinity between
the protein and DNA is low, requiring a high concentration of the protein to be
present before binding is detected. Unlike fragment -245 to -111, the second
fragment, extending from position -406 to -216, gave only one shifted band even
at high extract level (Figure 11). There was no difference in binding patterns
observed amongst the extracts of cultures from YPD, YPE or synthetic medium
supplemented with 2% glucose (Figure 11).
To show that the binding observed with the different fragments was a
specific interaction, a competition reaction was performed with unlabeled DNA
fragments. The unlabeled DNA used was either identical to the labeled probe or
from other region of the CIT1 upstream sequence. Figure 12 shows the result of


85
region has a URS function, the (3-galactosidase levels expressed from such a
construct should be lower than the levels expressed from intact plCZ312.
Specific activities from this construct are presented in Figure 8. In a
repressing medium, the activity was reduced approximately 50% compared to
plCZ312 level. The same level of reduction was also seen from cultures grown
in YPD to stationary phase, when most of the glucose has been depleted and
thus represents a depressed state. However, when the cells were grown in
ethanol-supplemented complex medium there was no significant reduction in an
specific activity. This suggested that either repression of transcription occurs
only in a glucose-containing medium or that the UAS activity in a YPE medium
masks the repressing effect. However, there was still about 10% reduction of
specific activity in YPE. Even in the context of CIT1 sequences, the increase
after this region was removed was greater in a YPD medium at logarithmic phase
than it was in a YPE medium. Similar observations were made by Rosenkrantz
and coworkers (1994). However, it is possible that increasing the distance
between the UAS elements and the transcriptional start site of the CYC1 gene
could decrease the level of expression. This could come about by placing the
UAS site and the TATA site on opposite sites of the DNA, thereby hindering
proper contacts between these factors to allow activation. Insertion of an
unrelated oligonucleotide of similar length at the same site in the plCZ312 vector
should distinguish a distance effect and specific sequence effect.


100
the DNA from the gel onto a DEAE cellulose membrane. The DNA was
recovered and run on a sequencing gel alongside a sequencing ladder generated
from the plasmid pSL123 template using the same primer (AL82) that was used
to generate the probe for the band shift analysis.
Although band shifts were observed with the -245 to -111 probe, no
obvious protected or hypersensitive region was seen within this probe (data not
shown). This may mean that the affinity of the proteins for their cognate site(s)
was too low to allow binding that could be detected by DNase I digestion. The
inability to detect an in vitro footprinting pattern of a putative UAS is not unique to
this gene. Liao and Butow (1993) showed that although there was gel
retardation shown by UASr from the CIT2 gene, no footprinting pattern was
detected despite repeated trials. CIT2 encodes the second isozyme of citrate
synthase, the one targeted to the peroxisome (Lewin et al., 1990). Low
specificity binding by a protein to the DNA may also result in lack of detection of
any protected region, yet one can still observe reduced mobility of the test DNA
in a bandshift reaction.
The probe spanning -409 to -216 showed two protected sites (arrows)
between -340 and -308 and a hypersensitive region (Figure 13). The
hypersensitive site lies immediately above the top arrow. No binding site for a
known transcriptional regulatory protein can be found in this region. This may
signify a novel binding site for a transcriptional regulator. The absence of any
difference in the footprint pattern detected with extracts from YPD, YPE or SD
(2%) media would suggest no difference in site occupancy for these growth


INTRODUCTION
Utility of Baker's Yeast
Baker's yeast, Saccharomyces cerevisiae, is a eukaryote that has been
studied extensively. It is a unicellular organism with 16 chromosomes of
approximately 12.5 Mb of DNA (Olson, 1992). Yeast has a generation time of
about 90 minutes to several hours, depending on whether it is grown in a
complex medium or a minimal medium, and on the carbon source provided in the
medium. There are several advantages of using this organism as a model
system to dissect eukaryotic functions: 1) It is amenable to genetic manipulation
because the genome size is small compared to higher eukaryotes. 2) It can
survive with a haploid genome making it possible to dissect metabolic pathways
using mutations. 3) Yeast is a facultative anaerobe, making respiratory
functions dispensable. 4) Many genes, particularly those involved in
transcriptional regulation, have mammalian homologs that are structurally and
functionally well conserved. These include RNA polymerase II (Nonet et al.,
1987), GCN4/JUN (Struhl, 1988), TATA binding proteins (TBP) (Cormack et al.,
1994; Reddy and Hahn, 1991; Gill and Tjian, 1991), and CP1/HAP2-3 (Chodosh
et al., 1988b). The gene products of these homologs can complement each
1


4
an insight about the cis and trans elements that are involved in messenger RNA
degradation. The CIT1 gene was chosen as a model to study gene regulation
because of its strategic position in cellular metabolism. As stated earlier, cellular
respiration requires citrate synthase because it catalyzes the first step in the TCA
cycle. The reactions of the TCA cycle are required to generate the reducing
power needed in the electron transport chain, which reduces molecular 02 and is
coupled to the production of ATP. Carbon skeletons are also generated from the
reactions of the TCA cycle for amino acid biosynthesis. The first indication of
unique regulation of citrate synthase came from the work of Satrustegui and
Machado (1977) who showed that induction was not inhibited by cycloheximide
following aeration of an anaerobic culture. This observation suggested that the
precursor for citrate synthase was already present in cultures growing under
repressed growth conditions, and induction does not require de novo protein
synthesis. Understanding how this gene is regulated differently from the related
CIT2 gene may serve as a paradigm as to how cells can regulate genes serving
the same function in different cellular locations.
Transcriptional Regulation in Eukaryotes
The expression of many genes is controlled at the level of transcription.
For this reason understanding how genes are transcriptionally regulated is one of
the fundamental goals in molecular biology.


15
the cAMP level is significantly reduced; but after the glucose has been depleted,
the level of cAMP increases. This increase facilitates binding of cAMP to
catabolite activation protein (CAP). Activated CAP, cAMP-CAP, binds to the
promoters of the glucose repressed genes to activate transcription. However,
the role of cAMP in glucose repression in S. cerevisiae in not as clear.
Matsumoto et al. (1982, 1983) isolated yeast strains that required exogenously
supplied cAMP for growth. In these strain, the galactokinase enzyme encoded
by (GAL1), which is glucose repressive, was still derepressed in the presence of
high levels of cAMP. Measurement of the level of cAMP present in different
media containing glucose or other non-fermentable carbon sources showed that
the level of cAMP was higher in the depressed state. These experiments
suggest that cAMP may not play any role in mediating the effect of glucose.
Cyclic AMP in eukaryotes is postulated to act by activation of protein
kinases which control the phosphorylation of various critical proteins and thereby
modulate the activity of the proteins. If so, cAMP may be involved in the
regulation of one glucose repressive gene, ADH2. The ADH2 encodes an
isozyme of alcohol dehydrogenase, which converts ethanol to acetaldehyde in
the ethanol utilization pathway. The Adrlp, encoded ADR1 gene, is a positive
transcriptional activator of ADH2 that binds to UAS1 (Denis and Young, 1983).
The protein contains several potential sites for phosphorylation by cAMP-
dependent protein kinase (cAPK) (Hartshorne et al., 1986). It has been
demonstrated in vitro that yeast cAPK can phosphorylate one of these putative
phosphorylation sites (Ser-230) (Cherry et al., 1989). A class of ADR1 mutant


11
amino acid residues, containing the sequence pattern Cys-X2or4-Cys-X12-His-X3or5-
His. Binding of the zinc ion is coordinated by the 2 cysteine and histidine
residues (Miller et al., 1985). The yeast Adr1 p, an activator of ADH2 gene, also
has a sequence composition similar to the zinc-finger motif. In another type of
zinc-finger, the ion binding is coordinated by four cysteine residues instead of 2
cysteine and 2 histidines. The yeast regulatory proteins Gal4p and Hap1 p are
examples of this class of zinc-finger (Laughon and Gelsteland, 1984; Pfeifer et
al., 1987b; Kim et al., 1990). The Gal4p activates the GAL1-, -7, and -10 genes
that are required for galactose utilization by yeast (Braum et al., 1986). The
Haplp regulates several yeast genes such as CYC1 (Guarente et al., 1984;
Pfeifer et al., 1987a), CYC7 (Pfeifer et al., 1987b; Prezant et al., 1987), COX5A
(Trueblood et al., 1988), and CYT1 (Schneider and Guarente, 1991). An unusual
property of Haplp is its recognition of nonidentical UASs (Prezant et al., 1987).
The affinity for the different binding sites varies, allowing for flexibility in
regulation. The Haplp requires heme for activation (Pfeifer et al., 1987; Kim et
al., 1990).
A third common class of binding domain is the leucine-zipper found in
activators such as Gcn4p, avian jun, AP1, Myc, Fos, and C/EBP (Landshultz et
al., 1988). The zipper region of the protein has about 30 amino acids and a
leucine residue at every seventh position. This region of the protein is involved in
dimerization, either homologous or heterologous, necessary for DNA binding.
Located N-terminal to the zipper region is usually a stretch of basic residues that
actually binds to the DNA. This basic region can bind to DNA by itself if there is


TRANSCRIPTIONAL AND POST-TRANSCRIPTIONAL REGULATION OF
THE CIT1 GENE IN SACCHAROMYCES CEREVISIAE
By
SOBOMABO D. LAWSON
A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE
REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY
UNIVERSITY OF FLORIDA
1995


Figure 6. UAS Activity of CIT1 5' Untranscribed Region. The entire 5'
untranscribed region of CIT1 present in the "wild-type" clone, p5-498, was
subcloned before a CYC1::lacZ fusion deleted of its native UAS. P-galactosidase
assays were performed from cultures grown in YPD. 1-7A is a wild-type yeast
strain and JB16-8B is a hap2 mutant derivative of 1-7A. Activities are presented
as described in the legend to Figure 3. ND= P-galactosidase assay was not
performed.


172
Hofmann, J.F.X., Laroche, T, Brand, A.H., and Gasser, S.M. (1989). RAP-1
factor is necessary for DNA loop formation in vitro at the silent mating type locus
HML. Cell 57, 725-737.
Holzer, H. and Matern, H. (1977). Catabolite inactivation of the galactose uptake
system in yeast. J. Biol. Chem. 252, 6399-6402.
Hoosein, M.A. and Lewin, A.S. (1984). Derepression of citrate synthase in
Saccharomyces cerevisiae may occur at the level of transcription. Mol. Cell. Biol.
4, 247-253.
Hope, I.A., Mahadevan, S., and Struhl, K. (1988). Structural and functional
characterization of the short acidic transcriptional activation region of yeast
GCN4 protein. Nature 333, 635-640.
Hoy, M.V., Leuther, K.K., Kodadek, T, and Johnston, S.A. (1993). The acidic
activation domains of the GCN4 and GAL4 proteins are not a Helical but form (3
sheets. Cell 72, 587-594.
Hsu, C. L., and Stevens, A. (1993). Yeast cells lacking 5' 3' exoribonuclease 1
contain mRNA species that are poly(A) deficient and partially lack the 5' cap
structure. Mol Cell. Biol. 13, 4829-4835.
Huie, M.A., Scott, E.W., Drazinic, C.M., Lopez, M.C., Hornstra, I.K., Yang, T.P.,
and Baker, H.V. (1992). Characterization of the DNA-binding activity of GCR1: In
vivo evidence for two GCR1-binding sites in the upstream activating sequence of
TPI of Saccharomyces cerevisiae. Mol. Cell. Biol. 12, 2690-2700.
Jimenez, A., Tipper, D.J., and Davies, J. (1973). Mode of action of thiolutin, an
inhibitor of marcromolecular synthesis in Saccharomyces cerevisiae. Antimicrob.
Agents. Chemothe. 3, 729-738.
Johnson, P.F. and McKnight, S.L. (1989). Eukaryotic transcriptional regulatory
proteins. Ann. Rev. Biochem. 58, 799-839.
Johnston, M., Flick, J.S., and Pexton, T. (1994). Multiple mechanisms provide
rapid and stringent glucose repression of GAL gene expression in
Saccharomyces cervisae. Mol. Cell. Biol. 14, 3834-3841.
Jones, D.H. and Howard, B.H. (1991). A rapid method for site-specific
mutagenesis and directional subcloning by using the polymerase chain reaction
to generate recombinant circles. BioTechniques 10, 62-66.


174
Leeds, P., Peltz, S.W., Jacobson, A., and Culbertson, M.R. (1991). The product
of the yeast UPF1 gene is required for rapid turnover of mRNAs containing a
premature translational termination codon. Genes. Dev. 5, 2303-2314.
Leeds, P., Wood, J.M., Lee, B., and Culbertson, M.R. (1992). Gene products that
promote mRNA turnover in Saccharomyces cerevisiae. Mol. Cell. Biol. 12,
2165-2177.
Leuther, K.K., Salmern, J.M., and Johnston, S.A. (1993). Genetic evidence that
an activation domain of GAL4 does not require acidity and may form a (3-sheet.
Cell 72, 575-585.
Lewin, A S., Hines, V., and Small, G.M. (1990). Citrate synthase encoded by the
CIT2 gene of Saccharomyces cerevisae is peroxisomal. Mol. Cell. Biol. 10,
1399-1405.
Liao, X. and Butow, R.A. (1993). RTG1 and RTG2: Two yeast genes required for
a novel path of communication from mitochondria to the nucleus. Cell 72, 61-71
Liao, X., Small, W.C., Srere, P.A., and Butow, R.A. (1991). Intramitochondrial
functions regulate nonmitochondrial citrate synthase (CIT2) expression in
Saccharomyces cerevisiae. Mol. Cell. Biol. 11, 38-46.
Lombardo, A., Cereghino, G.P., and Scheffler, I.E. (1992). Control of mRNA
turnover as a mechanism of glucose repression in Saccharomyces cerevisiae.
Mol. Cell. Biol. 12, 2941-2948.
Lowry, C.V. and Lieber, R.H. (1986). Negative regulation of the Saccharomyces
cerevisiae ANB1 gene by heme, as mediated by the ROX1 gene product. Mol.
Cell. Biol. 6, 4145-4148.
Lowry, O.H., Rosebrough, N.J., Farr, A.L., and Randell, R.J. (1951). Protein
measurement with the Folin phenol reagent. J. Biol. Chem. 193, 265-275.
Lu, H., Zawel, L., Fisher, L., Egly, J., and Reinberg, D. (1992). Human general
transcription factor IIH phosphorylates the C-terminal domain of RNA polymerase
II. Nature 358, 641-645.
Ma, J. and Ptashne, M. (1987). A new class of yeast transcriptional activators.
Cell 51, 113-119.
Magasanik, B. (1962). Catabolite repression. Cold Spring Harbor Symp. Quant.
Biol. 26, 249-256.


148
previously located further upstream had now been brought closer to the
transcriptional start site. More clues about the potential role of this region
become apparent on examination of the internal deletion constructs, discussed
below.
The composite results of the 5' and 3' deletions revealed three main
regions that decreased expression of the fusion gene when deleted (see Figure
25). Region I is centered around the putative Hap2p/Hap3p/Hap4p binding site
between -200 and -160 (Figure 26), region II stretches from -245 to -216 and
does not contain any sequence motif for known transcriptional regulators, and
region III ranges from -372 to -252. Region III has consensus binding sites for
GCN4 and ADR1, transcriptional activators for amino acid biosynthesis (Hope
and Struhl, 1986) and ethanol utilization (Denis et al., 1992; Denis et al., 1981),
respectively Each of the three regions were individually deleted and produced
somewhat surprising results when assayed for remaining UAS activity. Removal
of regions I and II each caused equivalent effects, one-third reduction in enzyme
levels compared to the wild-type in a YPE medium (Figure 25). However,
removal of region III produced activity that was similar to clone p3-372 (deleted
from -372 to -111), a reduction of P-galactosidase activity to below 95% of the
wild-type level. Removal of these sequences in addition to the ones preceding it,
-498 to -372, did not cause such severe reduction in specific activity. Compare
the results of clone p5-245 (1983 units/mg protein) to pA252-370 (79 units/mg
protein). Taken together, these results suggest that sequences between -498
and -372 may have a strong repressing effect. A fourth internal deletion


Figure 8. URS Activity of -139 to -111 Region of the CIT1 Gene. The -139 to
-111 region from CIT1 upstream sequence was subcloned into the CYC1::lacZ
fusion downstream of the native CYC1 UAS. p-galactosidase assays were
performed as described in Figure 3.


22
mRNA that causes them to follow a particular pathway for decay; this feature
may constitute a c/s-element(s) inherent in each mRNA. The search for cis-
elements that are involved in regulating the decay of mRNA has so far revealed
sequences that usually confer instability rather than stability (Heaton et al.,
1992). No sequence has yet been shown to confer increased stability.
The structural determinants for mRNA instability seem to be present
throughout the message, especially for a eukaryotic mRNA. Although the 5' cap
structure on a eukaryotic message has not been shown to directly affect stability
of any mRNA, it is believed that it could serve a protective role, because the 5'-5'
phosphodiester bond is intrinsically resistant to ribonucleases. This putative
protective role of the 5' cap structure was shown by Muhlrad et al. (1994). These
workers showed that in the degradation pathway of MFA2 mRNA, decapping of
the message always takes place before the decay intermediates could be
detected. The 5' untranslated region (UTR) of eukaryotes has not been shown
to directly affect mRNA stability, except in cases where translation is required for
degradation and the 5' UTR controls the translation of that message. In contrast
to eukaryotes, prokaryotes have stem-loop structures at the 5' termini of their
messages that affect their decay rate (Emory et al., 1992; Bouvet and Belasco,
1992; DiMari and Bechhoffer, 1993). For example, in the ompA mRNA of E.coli,
the presence of the stem structure is critical for maintaining the normal half-life of
approximately 14 minutes. Insertion of up to 3 nucleotides to the 5' end of the
terminal hairpin structure causes dramatic decrease in the half-life of the OmpA
mRNA (Emory et al., 1992). Also, removal of the Shine-Delgano sequences from


Figure 5. (3-Galactosidase Activity of Internal Deletion Constructs. (A).
Internal deletions were constructed by using inverse PCR with primers that
surround the region of interest. The CIT1 sequences present in the wild-type
clone was used as the template in the PCR. The HAP symbol represents the
region on the CIT1 sequence that has the consensus site for the transcriptional
activator HAP2/3/4. [3-galactosidase activity represents the average from
triplicate assay from at least two transformants. (B). A schematic interpretation
of regions with UAS activity.


Figure 20. Half-life of TPI::lacZ fusion mRNA upon shift. (A) Schematic of
the TPI::lacZ fusion contained in the plasmid. The genes are not necessarily
drawn to scale. (B) RNA was isolated from an isogenic strain of yeast harboring
a plasmid that contains TPI1::lacZ gene. (Courtesy Dr. H. Baker). Membrane
was hybridized with identical lacZ gene as was used for the CIT1::lacZ fusion.


151
construct that encompassed all previous ones reduced specific activity to only
about 1% of wild type level in both media (Figure 25).
To determine the function of each of these regions, they were individually
subcloned into a heterologous gene without its UAS. The sequences between -
200 and -160, when subcloned as an oligonucleotide, produced a specific activity
that was similar to the wild type level in an ethanol medium (Figure 6). This
result indicated that this region, when removed from other potential negative
regulatory elements, has a strong activating effect. Subcloning of region II
produced a (3-galactosidase level that was approximately 50% of the full length
sequence in a similar vector.
In summary: (i) there are several activation sites upstream of the CIT1
coding region between -372 and -252; -245 and -216, and -200 and -160; (ii)
there is a URS between -139 and -111 that shows its greatest effect in a glucose
medium, (iii) there is another URS between -498 and -372 that functions in a
carbon-source independent manner, and iv) these elements work in a
combinatorial manner to regulate the gene under different conditions.
Nutrient Requirement on the Expression of CIT1
Glutamate auxotrophy is one of the phenotypes that has been reported for
cit1 mutants (Kispal et al., 1988; Kim et al., 1986). Kim et al. (1986) reported that
the CIT1 level was repressed when glutamate was added to the growth medium
in a repressing medium, but does not have an effect when the cells were grown


34
Sma1
vs/ss/sssss
Sma1
J
Sma1
EooRV +1 BamH1
uilrssssssSsSM
t
EcoRV and Bal 31
+ 1
HI
Sma1
Sma1
EcoRV +1 BamH1
I J lllllllllllll
BamH1
THTmill
EcoR1 Sma1 BamH1
TRP Lac Z


73
Internal Deletions Show Several Putative UASs
The results of the exonuclease deletions of the CIT1 nontranscribed
region suggested that there was more than a single element which may be
involved in the regulation of this gene. In yeasts and other eukaryotes,
regulatory elements such as UASs and proximal regulatory elements, such as
Sp1 and AP1 sites, may lie in close proximity to each other. Therefore, there is
increased likelihood that more than one regulatory element may be removed
during exonuclease digestion. To test for this, individual regions were dissected
from the upstream sequences by inverse PCR. The regions deleted include
positions: 1) -160 to -200, 2) -216 to -245, 3) -252 to -370, and 4) -160 to -370.
These regions were chosen for the internal deletion analysis because the results
of the directional deletions from the proximal and distal ends suggested that they
may be important in regulating this gene.
In clone pA160-200, the sequences between -160 and -200 were deleted.
This region of CIT1 upstream sequences has the consensus binding site for the
Hap2p/Hap3p/Hap4p transcriptional activator protein at -192 to -185. Several
laboratories have shown that the Hap2p/Hap3p/Hap4p activator is involved in
regulation of many genes for mitochondrial proteins, including CYC1 (Olesen et
al., 1987; Guarente and Mason, 1983), HEM1 (Keng and Guarente., 1987),
COX6 (Trueblood et al., 1988), KGD2 (Repetto and Tzagoloff, 1990), LPD
(Bowman et al., 1992), and AC01 (Gangloff et al., 1990). Removal of this region
reduced the specific activity of (3-galactosidase by one-third, to approximately


Figure 16. Schematic to Determine Differential Stability. 100 ml of culture
was grown to logarithmic phase in YPE medium. The culture was divided into
two equal halves and transferred to flask containing an equal volume of fresh
YPD (4%) or YPE (2%). The fresh medium was either prewarmed to 48C if
RNA polymerase II mutants were used or chemical inhibitors were added at their
specified concentrations for non-mutant strain.


MATERIALS AND METHODS
Growth Conditions and Media
All E. coli strains were cultivated in Luria-Bertani media (1% Bacto-
tryptone, 0.5% Bacto-yeast extract, 1% NaCI pH 7.5). Yeast cells were grown in
either complex media (1% Bacto-peptone, 1% Bacto-yeast extract)
supplemented with 2% dextrose or 2% ethanol, or synthetic dextrose (SD)
(0.67% yeast nitrogen base without amino acids, 2% dextrose). All plates were
supplemented with 1.5% agar.
Yeast Transformation
Yeast transformation was routinely done either by the method described
by Ito et al., (1983) or the colony method (Baker, 1991). Several colonies were
picked from a YPD plate that was no more than two days old and resuspended in
1 ml 1 XTEL solution (10 mM Tris-HCI, pH 7.5; 1 mM EDTA; 100 mM lithium
acetate pH 7.5) in a microcentrifuge tube. The suspension was left at room
temperature for 1 minute then centrifuged at 12,000 rpm in an Eppendorf
centrifuge for 10 seconds. The supernatant was decanted and cellls were
27


57
digested by Seal, which linearized wild type plasmid but left plasmids with a
mutated Seal site in the circular form. This pool of DNA was then used to
transform E. coli a second time. Because the linearized wild type plasmids were
not as efficient as the circular mutated plasmids in transforming E. coli, the
majority of the transforming DNA had now lost the Seal site, but had obtained the
Stul site. Those clones with the Stul site were sequenced by the dideoxy
sequencing method to identify those that had also acquired the T to G
transversion at position +389. Clones that were verified to have the correct
mutations were subsequently subcloned into the p5-498 plasmid, at the EcoRI
site.


163
conditions last longer. The inability to be translated may be due to binding of a
protein to the mRNA by recognizing specific primary or secondary structure in a
glucose-containing medium. This binding would then leave the message naked
by preventing it from associating with the ribosome, which makes it become
susceptible to nuclease attack. However, it is also possible that lack of this factor
could also trigger the degradation event by allowing reactions downstream of the
pathway to occur in the absence of this factor. Model 2: Binding of a specific
factor to the mRNA targets it for rapid degradation in a glucose-containing
medium. One way to distinguish between these two models is to move the
identified c/s-element to different locations on the mRNA, while still maintaining
the reading frame. If inhibition of translation triggers the degradation, removal of
the c/s-element from the 5' terminus to other locations on the mRNA should give
rise to mRNA with similar half-life both in glucose- and ethanol-containing media.
However, if the c/s-element binds to a factor that targets it for degradation,
irrespective of where it is located on the mRNA molecule, it should still cause
decay with the same kinetics compared to the wild-type mRNA when bound by
the protein in a glucose-containing medium. One caveat is that the c/s-element
should be accessible to the trans-factor wherever it is located on the mRNA.
In conclusion, glucose regulation of the CIT1 gene occurs at two levels,
transcription and mRNA turnover. Regulation at the level of transcription seems
to be mediated by a URS element which decreases the level of transcription in a
glucose medium. Glucose also causes a faster decay of the CIT1 mRNA,
thereby lowering the level of CIT1 expression in the medium. In addition, other


Figure 18. Half-life of CIT2 mRNA. (A) RNA was isolated after shift and
separated as described in Figure 15. The membrane was hybridized with a 700
bp fragment of CIT2 DNA. (B) Semi-log plot of % mRNA remaining at the
indicated time.


20
site for the Hap2p/Hap3p/Hap4p complex. The CIT1 gene also has the
consensus binding site for this activator, but deletion of this sequence or
mutation of any one gene encoding the proteins does not severely impact
expression (this study). Other mitochondrial genes also known to be regulated
by this transcriptional activator complex include COX5A (Trueblood et al., 1988),
COX6 (Trawick et al., 1989; Trawick et al., 1992), and HEM1 (Keng and
Guarente, 1987). The COX5A and COX6 genes encode subunits Va and VI,
respectively, of cytochrome c oxidase, and HEM1 encodes 5-aminoluvilinate
synthase.
The other interesting feature about the consensus binding site for the
Hap2p/Hap3p/Hap4p is the presence of the CCAAT-box sequence at the core of
the consensus sequence. This sequence is also present in many mammalian
promoters and functions as promoter. The CCAAT-box also binds a multisubunit
activator, CP1A and CP1B (Chodosh et al., 1988a; 1988b). Using bandshift
assay and DNase I protection assays, Chodosh et al. (1988b) showed that the
Hap proteins and CP1 proteins bind to and protect similar DNA sequences. In a
bandshift assay, they showed that Hap2p can substitute for CP1B and Hap3p
can substitute for CP1A in binding DNA at each cognate sequence. Although
these two sets of proteins have evolved to regulate different activities, they still
bind similar DNA sequences and can complement each other.


19
Another set of genes that is required to maintain repression are SSN6 and TUP1
genes (Keleher et al., 1992). They are transcriptional repressors interacting with
gene-specific factors to mediate their effect. In contrast to the negative roles
SSN6 and TUP1 play in regulating many glucose repressible genes, they have a
positive effect on CYC1 expression via the HAP1 transcriptional activator (Zhang
and Guarente, 1994).
Another well characterized glucose repressible gene is the CYC1. It
encodes iso-1 -cytochrome c, which is involved in the electron transport chain of
respiration. The CYC1 gene has two UASs, UAS1 and UAS2. Regulation at
UAS1 occurs via the Haplp after it has been bound by heme (Guarente et al.,
1984; Kim et al., 1990). Glucose regulation of CYC1 occurs at the UAS2 site
through a multisubunit protein called the Hap2p/Hap3p/Hap4p, encoded by
HAP2, HAP3, and HAP4 genes, respectively (Guarente et al., 1984; Pinkham
and Guarente 1985; Pinkham et al., 1987; Hahn and Guarente, 1988; Forsburg
and Guarente, 1989). Mediation of glucose repression on CYC1 expression
occurs by repressing the transcription of HAP4. The Hap4p has the activation
domain of this multisubunit complex (Forsburg and Guarente, 1989); therefore, in
a glucose medium reduced synthesis of this activator causes reduction of CYC1
expression. Mutations in any one of the genes that encode the transcriptional
activator protein reduce the expression of many genes involved in the Krebs
Cycle such as the genes encoding lipoamide dehydrogenase (Bowman et al.,
1992), aconitase (Gangloff et al., 1990), and dihydrolipoyl transsuccinylase
(Repetto and Tzagoloff, 1990). These genes also have the consensus binding


921-


38
Biochemical, Inc. Probe was denatured by boiling and added at 100,000 cpm
per milliliter of hybridization solution. Hybridization was carried out at 60C for 16
hours with shaking. Membrane was washed according to the manufacturer's
recommendation and exposed to X-ray film. Transformants with more than single
integration event were identified by the presence of a plasmid-length band.
Cloning of Oligonucleotides
Oligonucleotides corresponding to different upstream regions of CIT1
were subcloned into the plCZ312 vector to test their ability to either activate or
repress transcription. The oligonucleotides used were synthesized at the DNA
Synthesis Core, University of Florida. Their sequences and location in the gene
are given in Table 3. Approximately 5 pg of complementary oligonucleotides
were annealed in 10 mM Tris-HCI, pH 8.0; 5 mM MgCI2; 20 mM NaCI; by boiling
for 5 minutes then slowly cooled to room temperature. To clone the region
between -200 to -160, AL86 and AL87 oligonucleotides were annealed, and
AL84 and AL85 oligonucleotides were annealed for the -245 to -216 region. After
annealing 1 pg of each annealed oligonucleotide was end labeled with 1 mM
ATP using T4 polynucleotide kinase (1 U) in 500 mM Tris-HCI, pH 7.6; 100 mM
MgCI2; 5 mM DTT at 37C for 60 minutes. At the end of the reaction the enzyme
was heat inactivated by incubating at 75C for 10 minutes. Salt was removed
from the sample by precipitating with absolute ethanol, then the sample was
resuspended in 10 pi water. Approximately 4 pi of each annealed oligonucleotide


74
658 units per milligram protein in the derepressing medium, YPE (Figure 5).
However, in the YPD medium the specific activity obtained for this deletion was
100 units per milligram protein, which is higher than the wild-type level. The
second region deleted were sequences from -245 to -216 with respect to the
transcriptional start site. Specific activity was reduced to 3.5 and 664 units/mg
protein in glucose and ethanol media, respectively. This represented a 20-fold
reduction in the glucose medium but only a 3-fold reduction in the ethanol
medium.
The third region deleted were the sequences from -370 to -252, and the
plasmid was named pA252-370. Removal of this region, which was 119 bp in
length, drastically reduced the specific activity of (3-galactosidase. In a
derepressing medium the specific activity was reduced to 79 units per milligram
protein, which was approximately 25-fold lower than the wild-type level.
However, in a repressing medium the reduction was more severe, lowering
activity nearly 50-fold relative to the wild-type level in a similar medium. The
fourth internal deletion constructed encompassed all the other three deletions
previously described, from positions -370 to -160. There was approximately 24
units per milligram protein of specific activity detected in clone pA160-370 in a
depressing medium, which was nearly 85-fold lower than the wild-type activity in
a similar medium. In YPD medium the specific activity for this construct was only
0.7 units, which is 100-fold lower than the wild-type activity. The fold induction in
a derepressing medium versus a repressing medium was 34 times in cells
harboring clone pA160-370. This level of induction reflects the very low activity


RESULTS
Analysis of 5' (Distal) and 3' (Proximal) Deletions
Studies by Hoosein and Lewin (1984) showed that there were increased
amounts of CIT1 translatable mRNA in cells grown in glucose medium as they
approach stationary growth phase and begin to utilize ethanol as a primary
carbon source. Logarithmic-growth phase cells grown in ethanol contained more
CIT1 mRNA than log phase cells from a glucose culture. This observation
suggested that the increased steady-state level of CIT1 mRNA may be due to an
increased rate of transcription or to a decreased rate of turnover in ethanol
medium. My initial focus was to determine the boundaries on the sequences
upstream of the transcriptional initiation site that may contribute to the high-level
expression of CIT1 in ethanol medium or glucose depleted medium. The
decision to characterize the UAS (upstream activating sequence) elements was
based in part on the presence of a perfect match to the nine nucleotide
(TNATTGGT) consensus binding site for the trimeric protein
Hap2p/Hap3p/Hap4p. This protein complex has been well characterized and
shown to be required for high-level expression of genes encoding proteins in the
mitochondrial electron transport chain (Trueblood et al., 1988; Trawick et al.,
63


Figure 3. (3-Galactosidase Activity of 5' and 3' Deletions in Complex
Medium. (A). The top line represents the CIT1 sequence from which all the 5'
and 3' deletions were derived. The number of each deletion construct represents
the deletion end-point. Yeast cells were grown in complex media supplemented
with glucose (YPD) or ethanol (YPE) to early logarithmic phase. Glucose and
ethanol were added to 2% weight/volume. The specific activity of (3-
galactosidase is presented as nanomoles of ONPG hydrolyzed per minute per
milligram of protein in the lysate. Each value represents the average of triplicate
assay from two to three transformants and differed from each by no more than
10%. (B). A diagramatic interpretation of the results. The hatched areas
represent putative UAS and the dotted area represents a putative URS region.


Figure 25. Composite Summary Result of CIT1 Upstream Sequences. The
top line represents a schematic of the CIT1 5' noncoding region from which all 5'
and 3' deletion clones were derived. The internal deletion clones were derived
from clone p5-498, the wild-type designate. The numbers on the lines indicate
the deletion end-point of each clone and the numbers to the right represents the
average of at least three to four independent 3-galactosidase assays obtained
from each clone. The result of the assays did not differ from the average by
more than 10%.


A
160
+ 1
AGGTTTGTTTTGGCTTTTATTTGCATTTAAGTAATTACAA
TTACAACCATAAAAAGAAAATAAGGCAAAACATATAGCAA
100
TATAATACTATTTCGAAGATGTCAGCGATATTATCAACAA
CTAGCAAAAGTTTCTTATCAAGGGGCTCCACAAGACAATG
TCAAAATATGCAAAAG
B
U A
U-A
C-G
U-G
U-G
U-G
G-C
c-ga
A ^
A A
A-UA
C-G
U-A
A-U
U-A
A-U
G I
C-G
GUCAG-CAAA


Construct
Arrangement
plCZ312 UAS1-UAS2t7 TATA
plCZ312UASLESS 7- TATA
%
YISL160 (41 -mer) 7 TATA
(30-mer)7j
YISL216R
TATA
Specific
Activity
YPD
YPE
CYC1::lacZ
310
2149
CYC1::lacZ
43
150
00
K3
CYC1::lacZ
47
1252
CYC1::lacZ
94
718


88
Steadv-State mRNA Levels Correlate with Enzvme Assay
The (3-galactosidase activities from the various promoter deletions strongly
suggested transcriptional regulation of the CIT1 gene affecting the steady-state
mRNA level. In order to correlate the enzyme activities with the steady-state
mRNA levels, total yeast RNA was isolated from selected strains and the level of
lacZ specific message was determined by ribonuclease protection assay.
Radiolabeled complementary RNA (cRNA) specific to the lacZ gene was
generated from plasmid pSL.001 using T3 RNA polymerase. The actin message
from ACT1 gene was used as an internal control to correct for possible loading
differences. The cRNA for the actin mRNA was transcribed from pGEM-actin
plasmid, a generous gift from Dr. R. Butow, using SP6 RNA polymerase.
The results are shown in Figure 9. Figure 9a shows the autoradiogram of
the ribonuclease protection assay, and Figure 9b shows the quantitative result.
The quantitative results were obtained by calculating the ratio of lacZ mRNA
versus ACT1 mRNA for each sample. Each sample was then compared to the
p5-498 mRNA level to measure their relative level of expression. Overall, the
amount of lacZ mRNA from each deletion paralleled the p-galactosidase activity
observed for each construct. However, the YPE/YPD ratios were lower for the
steady-state mRNA levels than enzyme levels for each of the constructs tested.
Liao et al (1991), also found that in certain yeast strains the YPE/YPD ratios for
citrate synthase activity were as much as four times higher than the steady-state
mRNA produced from the CIT1 gene in identical media. Surprisingly, the mRNA


176
Nonet, M., Sweetser, D., and Young, R.A. (1987). Functional redundancy and
structural polymorphism in the large subunit of RNA polymerase II. Cell 50,
909-915.
Ogden, J. E., Stanway, C., Kim, S., Mellor, J., Kingsman, A. J., and Kingsman, S.
M. (1986). Efficient expression of the Saccharomyces cerevisiae PGK gens
depends on an upstream activation sequence but does not require TATA
sequence. Mol. Cell. Biol. 6, 4335-4341.
Olson, M. V. (1992). Genome structure and organization in Saccharomyces
cerevisiae. In The Molecular and Cellular Biology of the Yeast Saccharomyces. J.
R. Broach, J. R. Pringle, and E. W. Jones, eds. (Cold Spring Harbor Laboratory
Press), vol 2, pp 1-39.
Pabo, C.O., Krovatin, W., Jeffrey, A., and Sauer, R.T. (1982). The N-terminal
arms of lambda repressor wrap around the operator DNA. Nature 298, 441-443.
Pabo, C.O. and Lewis, M. (1982). The operator-binding domain of lambda
repressor: Structure and DNA recognition. Nature 298, 443-447.
Peltz, S.W., Brown, A.H., and Jacobson, A. (1993). mRNA destabilization
triggered by premature translational termination depends on at least three
cis-acting sequence elements and one trans-acting factor. Genes. Dev. 7,
1737-1754.
Perlman, P.S. and Mahler, H.R. (1974). Derepression of mitochondria and their
enzymes in yeast: Regulatory aspects. Arch. Biochem. Biophys. 162, 248-271.
Pfeifer, K., Arcangioli, B., and Guarente, L. (1987a). Yeast HAP1 activator
competes with the factor RC2 for binding to the upstream activation site UAS1 of
the CYC1 gene. Cell 49, 9-18.
Pfeifer, K., Prezant, T., and Guarente, L. (1987b). Yeast HAP1 activator binds to
two upstream activation sites of different sequence. Cell 49, 19-27.
Picard, D., Salser, S.J., and Yamamoto, K.R. (1988). A movable and regulable
inactivation function within the steriod binding domain of the glucocorticoid
receptor. Cell 54, 1073-1080.
Pinkham, J.L. and Guarente, L. (1985). Cloning and molecular analysis of the
HAP2 locus: A global regulator of respiratory genes in Saccharomyces
cerevisiae. Mol. Cell. Biol. 5, 3410-3416.


6
conserved classical TATAAA sequence nor is it required for transcription
initiation. The PGK gene of yeast and the terminal deoxytransferase gene of
mammalian cells are examples of genes that do not require a TATA sequence
(Ogden et al., 1986). This means that there are other c/s-elements necessary for
transcription initiation which have yet to defined. There are also different classes
of the TATA sequence. The HIS3 gene contains a TATA element that is involved
only in constitutive transcription (Tc) and another TATA sequence that is involved
in regulated expression (TR) (Harbury and Struhl, 1989; Chen and Struhl, 1988).
The work of Chen and Struhl (1985) showed that sequences downstream of the
TATA elements are also important for proper transcription initiation, since
mutations surrounding the start site move the site to a different location.
Mutations at certain positions in the sequence TATAAA discriminated between
the GCN4 and GAL4 as transcriptional activators, suggesting that the
mechanisms of activation or the accessory factors required for activation are
different for the various activators. The basic transcriptional machinery proteins
including RNA polymerase II and TFIIA through F bind to the TATA sequence in
a sequential manner to initiate transcription (Buratowski et al., 1989).
Enhancers are sequences that increase the transcription of genes when
bound to their cognate factors (Dynan, 1989). They may be situated up to 50 kb
from the initiation site and still affect transcription in either orientation and can
function whether present upstream or downstream from the transcription unit.
Enhancers are modular in nature, made up of identical or a mixture of different
enhanson elements that usually work synergistically (Dynan, 1989). Enhanson is


9
Tjian, 1991; Cormack et al., 1991). Cell viability could be restored by a hybrid
protein, if the C-terminal domain was derived from yeast (Cormack et al., 1991).
This would suggest that the species specificity determinants lie in this region. To
determine the exact amino acids(s) responsible for the species specificity,
Cormack et al. (1994) selected for a hTBP/yTBP hybrid protein, which could
support faster yeast growth. The starting hybrid contained a human C-terminal
domain which had been shown to support growth at a very slow pace. This
selection identified three independent mutants that changed arginine 231 to
lysine. Interestingly, lysine occupies an identical position in the native yTBP. In
addition, mutation at this position in an otherwise intact hTBP supported growth
of yeast. After the initial binding by TBP, other factors bind to the TATA and
surrounding sequences (Buratowski et al., 1989). The order in which the basic
transcription factors come into the preinitiation complex was shown by bandshift
assay to be as follows: TFIID, TFIIA, TFIIB, RNA polymerase II, TFIIE, then
TFIIF/H complex (Buratowski et al., 1989). Assembly of these factors forms the
preinitiation complex. Transition to the initiation phase is preceded by
phosphorylation of the CTD of polymerase II by TFIIH factor (Lu et al., 1992).
Other factors playing significant roles in transcriptional regulation of genes
include activating, repressing, and inducing factors (Struhl, 1989; Guarente,
1992). These factors are required for proper regulation of individual genes. The
most studied of these secondary factors are the activator proteins. These
proteins usually have a modular structure, each one of the modules being
capable of functioning independently. The "domain swap" experiment with LexA


109
level. I therefore decided to test whether CIT1 mRNA has different decay rates
in YPD and YPE media.
To study half-lives of RNA, all de novo transcription must be blocked. For
these studies, I employed strain Z118 which contained a temperature-sensitive
mutation in the largest subunit of RNA polymerase II (Nonet et al., 1987). Yeast
cells (Z118 strain) were grown to logarithmic phase in either YPD or YPE and
transcription of all genes was stopped by adding an equal volume of similar
medium (prewarmed to 48C). Then the culture was shifted to the nonpermissive
temperature (36C), which inactivated RNA polymerase II. Total RNA was
isolated from the different cultures at intervals subsequent to the termination of
transcription. Fifteen micrograms of RNA from each time point was run on a
1.2% agarose/0.22 M formaldehyde gel. At the end of the run the RNA was
transferred onto Hybond N+ membrane (Amersham) using capillary blotting.
After transfer the nylon membrane was hybridized with a CIT1 gene probe as
described in the Materials and Methods. Figure 15a shows a photograph of an
autoradiogram of one of several experiments. Although the mRNA samples
shown in this experiment were isolated from an RNA polymerase II temperature-
sensitive mutant, similar results were obtained when the chemical transcriptional
inhibitors, thiolutin or 1,10-phenanthroline, were used at their recommended
concentrations (see Materials and Methods). However, on occasion, termination
of transcription by thiolutin was variable. Differential loading of the samples was
always checked by i) visualizing the gel before transfer or the membrane after
transfer on the UV transilluminator because of the presence of ethidium bromide


35
amplification were performed for each reaction following initial denaturation at
95C for 5 minutes. Each cycle consisted of 95C denaturation for 1 minute,
annealed at the TH for each pair of primers for 1 minute, and 72C extension for 3
minutes. After 20 cycles of amplification an additional 10 minutes of extension
was performed to enable most products to have a common end. The 5' ends of
each primer pair were complementary to each other by four to ten nucleotides.
After the PCR reaction the products were phenol/chloroform extracted once,
precipitated, resuspended in water and used to transform competent E. coli by
electroporation (SURE strain, Stratagene). Upon transformation, circular
molecules were generated by the host E. coli by homologous recombination at
the termini of the PCR products because of their complementarity. The template
used was pSL123. Plasmid pSL123 has approximately 750 bp EcoRI fragment,
exercised from p5-498 and subcloned into pBluescript KS+ at the EcoRI site.
This EcoRI fragment contained all of the CIT1 sequences in p5-498 plasmid.
The CIT1 sequences consisted of upstream sequences, the TATA element, and
178 nucleotides long transcription unit, which included the first 26 codons.
Many transformants were usually obtained, therefore initial screening for
deletion mutants was done by the colony hybridization (Grunstein and Hogness,
1975). During the screening, 32P radiolabeled probes were prepared from the
mutant primer whose sequence should now be continuous in the recombinant
clone but discontinuous on the parent plasmid. The hybridization temperature
used for each screening was the TH of the oligonucleotide. Deletion mutants
were further characterized by restriction digestion, then positive clones were


Figure 17. Half-life of CIT1 mRNA upon shift from ethanol to glucose. (A)
Cells were initially grown in YPE(2 %), at the time of transcription inhibition the
culture was divided into two equal halves and transferred into flask containing an
equal volume of prewarmed YPE(2 %) or prewarmed YPD (4 %). The culture
was then shifted to 36C (non-permissive temperature) and incubation continued
(see Figure 16). Cells were harvested at the indicated time and total RNA was
isolated from each sample. RNA was separated and hybridized as described in
Figure 15. (B) Semi-log plot of % mRNA remaining as a function of time.


173
Kammerer, B., Guyounvarch, A., and Hubert, J. C. (1984). Yeast regulatory gene
PPR1. Nucleotide sequence, restriction map and codon usuage. J. Mol. Biol.
180, 239-250.
Keleher, C.A., Redd, M.J., Schultz, J., Carlson, M., and Johnson, A.D. (1992).
Ssn6-Tup1 is a general repressor of transcription in yeast. Cell 68, 709-719.
Kelleher, R. J., Ill, Flanagan, P. M., and Kornberg, R. D. (1990). A novel mediator
between activator proteins and the RNA polymerase II transcription apparatus.
Cell 61, 1209-1215.
Keng, T. and Guarente, L. (1987). Constitutive expression of the yeast HEM1
gene is actually a composite of activation and repression. Proc. Natl. Acad. Sci.
USA 84, 9113-9115.
Kim, K.S., Pfeifer, K., Powell, L, and Guarente, L. (1990). Internal deletions in
the yeast transcriptional activator HAP1 have opposite effects at two sequence
elements. Proc. Natl. Acad. Sci. USA 87, 4524-4528.
Kim, K.S., Rosenkrantz, M., and Guarente, L. (1986). Saccharomyces cerevisiae
contains two functional citrate synthase genes. Mol. Cell. Biol. 6, 1936-1942.
Kispal, G., Rosenkrantz, M., Guarente, L, and Srere, P. A. (1988). Metabolic
changes in Saccharomyces cerevisiae strains lacking citrate synthase. J. Biol
Chem. 263, 11145-11149.
Krieger, K., and Ernst, J. F. (1994). Iron regulation of triosephosphate isomerase
transcript stability in the yeast Saccharomyces cerevisiae. Microbiol. 140, 1079-
1084.
Landschultz, W.H., Johnson, P.F., and McKnight, S.L. (1988). The Leucine
Zipper: A hypothetical structure common to a new class fo DNA binding proteins.
Science 240, 1759-1764.
Laughon, A. and Gelsteland, R.F. (1984). Primary structure of the
Saccharomyces cerevisiae GAL4 gene. Mol. Cell. Biol. 4, 260-267.
Laurent, B.C. and Carlson, M. (1992). Yeast SNF2/SWI2, SNF5, and SNF6
proteins function coordinately with the gene-specific transcriptional activators
GAL4 and Bicoid. Genes. Dev. 6, 1707-1715.
Laurent, B.C., Treitel, M.A., and Carlson, M. (1991). Functional interdependence
of the yeast SNF2, SNF5, and SNF6 proteins in transcriptional activation. Proc.
Natl. Acad. Sci. USA 88, 2687-2691.


Table 4 continued.
62
Designation
Construction
YISLSTOP
Similar to p5-498 except that a T to G transversion mutation
was introduced at position 114 of the CIT1 sequence.


47
deoxynucleotides(dNTP's), 1 ¡jI RNasin (26 U/pl) (Promega Corporation), and 1
pi Superscript II reverse transcriptase (200 U/pl) (Life Technologies). The
sample was incubated at 37C for 90 minutes, then 1 pi 0.5 M EDTA was added
to stop the reaction. The sample was then treated with 1 pi 5 mg/ml RNase A to
digest unhybridized RNA at 37C for 30 minutes. The mixture was extracted
once with phenol/chloroform/isoamyl alcohol, then adjusted to a final
concentration of 2.5 M ammonium acetate and precipitated with 2.5 volume
ethanol. The pellet was first resuspended in 4 pi TE pH 8.0, then 6 pi formamide
loading buffer was added. The sample was heated at 95C for 3 minutes and
loaded on a 5% Longer Ranger gel (AT Biochem) and run until the lower dye had
run two-thirds the length of the gel.
To identify the start sites, the same end labeled primer (AL41) was used to
prime DNA sequencing reactions on pCSB plasmid, which consists of an EcoRV-
EcoRV CIT1 fragment that includes the TATA element and 5' half of the coding
region. AL215 was used to prime plasmid specific transcript. The sequencing
reaction was performed as recommended by the manufacturer (US Biochemical).
In Vivo Footprintina
In vivo footprinting was performed essentially as described by Giniger et al
(Giniger et al., 1985) with some modification. One liter of culture was grown in
either YPE or YPD to early logarithmic growth phase (OD600). Cells were
harvested by centrifuging in a JA-10 rotor (Beckman) at 5,000 rpm at room


72
(70 units/mg protein). This large effect, was lost when sequences up to -245
were deleted. Deletion constructs beginning from the 3' end of the CIT1 upstream
sequences showed significant reduction in (3-galactosidase expressed from them
when deletion extended up to position -252. There was no increase in specific
activity from clone p3-139 compared to the wild-type clone. This would suggest
that the sequences between -139 and -111 are involved in regulation of CIT1 in
response to glucose but not in response to minimal medium. There are two
putative core GCN4 consensus-binding sites that lie between -374 and -369 and
-268 and -263, which may be responding to growth in a minimal medium. GCN4
is a transcriptional activator involved in the regulation of genes in the amino acid
biosynthesis pathway (reviewed in Hinnebusch, 1988). Reduction in expression
from clone p5-227 to 5% of wild-type and clone p3-372 to less than 1 % of wild-
type suggest that all the necessary sequences for regulation in a minimal
medium lie in this region. In clone p5-227, the two putative GCN4 binding sites
were deleted, whereas in clone p3-372 the proximal site was deleted and the
distal site was disrupted.
The results of these 5' and 3' deletions showed that several regions,
between sequences -370 and -252, -245 and 216 and -200 and -160 in the
upstream sequence, that contribute to transcriptional regulation of this gene. It is
clear that these sequences have activating functions because when deleted they
reduced specific activities, but the sequence between -139 and -111 has a
repressing effect in response to glucose. The sequences necessary for
regulation in a minimal medium lie between -370 and -227.


23
the second single-stranded region of the leader reduced the half-life (Emory et
al., 1992). This would imply that ribosome binding may also protect the mRNA.
Hence translation of the message may be required for stability.
In eukaryotes, the coding regions of several genes, including c-myc
(Willington et al., 1993), MATal (Caponigro et al., 1993), and STE3 (Heaton et
al., 1992) have instability elements, that promote rapid decay of the messages
they encode. The putative instability element of MATcri was localized to a 65
nucleotide sequence that has a 5' and a 3' portion (Caponigro et al., 1993). The
3' portion is necessary and sufficient to decrease the half-life of an otherwise
stable mRNA, but the decay is further stimulated when the 5' portion is included
in the fusion. The 5' portion contains some rare codons which when replaced
with more common codons, increased the half-life of the chimeric mRNA. This
result suggests that rare codons may cause the ribosome to stall on the message
which may lead to an initial endonucleolytic cleavage followed by an exonuclease
attack.
The 3' untranslated region (3' UTR) of many genes contains sequences
that cause their rapid decay. These include STE3 (Heaton et al., 1992), MATal
(Caponigro et al., 1993), MFA2 (Muhlrad and Parker, 1992), c-myc (Willington et
al., 1993), and transferrin receptor (TfR) gene (Klausner et al., 1993). The
sequence of the STE3, MFA2 and MATal that cause rapid decay have not been
well characterized.
Interestingly, the TfR mRNA, regulated by iron, has several well
conserved stem-loop structures that are observed in widely divergent species.


co ro
-P* CD
I
GTAAATATAGCGTTTTTACGTTCACATTGCCI I I I I I I I IATG'
II II II
I
f f
102


133
A
CIT1 LacZ
["yufR" l <"
B
YPD
Time (min)
CIT1::LacZ
cm
+
+
+
+
+
+ -
_

'
o
o
o
o
o o
o
o
o
i
CM
CD O
in i cm
CD
TIME (MINUTES)


142
decay has been proposed to clear accumulated intron containing pre-mRNA from
the cytoplasm.
C/s-acting Elements
Deletion of 5' the noncoding region of the CIT1 gene was performed to
determine what sequences are necessary for the regulation of this gene in either
glucose or ethanol. These studies were carried out on a fusion gene construct of
CIT1 and the E. coli lacZ genes while leaving the chromosomal CIT1 gene intact.
3-galactosidase assays were used to monitor the effect of the deletions.
Deletions carried out on the starting fusion gene had approximately 800 bp of
CIT1 noncoding sequences. This was chosen as the starting CIT1 DNA because
in yeast all important regulatory elements usually lie within 1 kb of the
translational start site. The choice of this region was subsequently justified when
it was shown that the relative ratio of induction of P-galactosidase level between
ethanol and glucose was similar to chromosomal citrate synthase induction in
this particular yeast strain (Rickey, 1988).
Construct p5-498, a deletion ending at -498 with respect to the
transcriptional start site, was taken as the wild-type reference because it was the
minimum deletion that had activity similar to the full length clone. Deletion of an
additional 253 bp, clone p5-245, reduced specific activity slightly in an ethanol
medium and to nearly 80% of wild-type level in a glucose medium (Figure 25).
Figure 25 is the composite result of the 5', 3', and internal deletions results


65
(Rickey, 1988) contains CEN4 and ARS1 sequences which were necessary for
the plasmid to replicate and be maintained at approximately a single copy per
yeast cell. It also has a TRP1 marker for selection in yeast, an origin of
replication for E. coli and the bla, ampicillin resistance, gene for selection in E.
coli. Recombinant plasmids were transformed into the S150-2B yeast strain and
selected for transformants on SD (2%) medium containing 10 pg/ml histidine, 20
pg/ml leucine, and 5 pg/ml uracil. Total cellular extract was prepared from at
least two different isolates of each transforming plasmid and its (3-galactosidase
activity determined in triplicate as described in materials and methods.
Figure 3 shows the specific activities obtained from the selected deletion
mutants. CIT1 mutants were named according to the end-points of the deletion
relative to the major transcriptional start site. Deletions from the 5' end of the
gene that extended toward the transcriptional start site did not show any
significant reduction in specific activity until they extended beyond position -498.
Hence, the activity of this clone was designated wild-type level, and all other
clones were compared to it to assess the effect of deletion. There was about a
27-fold induction when the p5-498 clone carrying strain was grown in an ethanol
medium compared to when grown in glucose. This is somewhat higher than the
induction of citrate synthase activity usually observed in yeast, suggesting that (3-
galactosidase may be more stable in yeast than citrate synthase. However, it
should be noted that the level of induction of citrate synthase between
derepressing and repressing media varies considerably between strains. Further
removal of sequences to position -245 caused only a slight decrease in P-


Figure 11. Bandshift of -406 to -216 fragment. 12 pg crude yeast extract from
wild-type strain grown in the indicated media (YPD, YPE or SD) or from a hap4
(lane hap4) mutant strain grown in YPD was incubated with end labeled CIT1
probe (-406 to -216). Probe was prepared by first labeling AL82 primer with T4
kinase, which then used in conjunction with AL85 primer in a PCR reaction on
pSL123 plasmid template to synthesize the probe. Probe was gel purified on a
8% (19:1) non-denaturing polyacrylamide gel. Approximately 2 fmole of labeled
DNA per reaction was used. Samples were separated on a 4% polyacrylamide
(39:1). F designates unbound DNA and A represents bound probe.


147
half when cells were grown in a YPD medium ( Figure 8), independent of whether
they were grown to logarithmic phase (repressed) or stationary phase
(derepressed). In contrast, 85% of the activity was still retained when a
YISL111-139X carrying strain was grown in a complex medium with ethanol
(derepressed). This suggests that the URS activity of this region functions only
in a glucose-containing medium. This finding is in agreement with the p3-139
clone which showed a higher level of increase of 3-galactosidase activity in a
YPD medium than in a YPE medium above the wild-type level. For clones p3-
172 and p3-217 there was no significant change in enzyme activity between YPD
and YPE media (Figure 25). However, in clone p3-217 (deleted from -217 to -
111), there was a 66% reduction in enzyme activity in a YPE medium compared
to the wild-type level. A similar level of reduction was also shown for clone p5-
168 in the YPE medium. In both clones sequences between -227 and -168 were
removed. This suggests that this region may play a significant role in
derepression of CIT1 gene and a possible candidate is the consensus binding
site for the Hap2p/Hap3p/Hap4p heteromeric activator at position -192 to -185 of
CIT1. The role of these proteins in possible regulation is discussed below.
Clone p3-252 (deleted from -252 to -111) retained only about 10% of the
enzyme activity in YPD and YPE media (Figure 25), which suggested that a
potential activator site had been removed. Further deletion to position -372,
clone p3-372, produced barely detectable p-galactosidase activity in YPD and
only 2% of wild-type level in YPE (Figure 25). This may mean that all potential
positive regulatory sites had been deleted or negative regulatory elements


83
specific activity of YISL101 was slightly higher than the specific activity of
YISL101R (Figure 6). But UAScyci driven expression was very low during
logarithmic phase growth and was only about 66% of the UASC(n after glucose
had been depleted. While the expression from the UASc/ri in YISL101 was
reduced 42% in shifting from the HAP2 to the hap2, strain the activity of the
UAScyc) dropped more than 99% in the hap2 mutant. The results indicate that,
while the hap2 mutation has an effect on the UAScyci, this effect is much less
significant than on the CYC1 gene.
The three internal regions deleted from CIT1 upstream (see Figure 5)
showed that they each contributed to the transcriptional regulation of the gene.
In order to test their contribution to activation these sequences were individually
subcloned into plCZ312 vector whose UAS1 and UAS2 had been removed as
described earlier. Only two of these regions were successfully cloned. The
YISL160 clone was derived by annealing two complementary oligonucleotides,
AL86 and AL87, and ligating the result into the vector. These oligonucleotides
span the region -200 to -160, which includes the Hap2p/Hap3p/Hap4p binding
site. YISL216 was cloned by annealing AL84 and AL85 which spans -245 to -
216. I also attempted to clone the region that encompasses the region between -
370 to -252 but was not successful.
The results from these experiments are presented in Figure 7. YISL160
produced specific activity of 47 units per miligram of protein in a culture that was
grown to logarithmic phase in the YPD medium. Cultures harvested from YPE
medium had 1252 units/mg protein. The specific activity of YISL216R was 718


31
Sma1
EcoRV +1
l l
BamH1
m i 11 ii u n i i i
WS////////A
W7////A
Sma1
and Bal 31
T
EcoRV
+1
I
BamH1
111111111111111L
EcoRV
l
+1
l
BamH1
n 1111111111111 \mmmm
^BamH1
EcoRV +1 BamH1
Lac Z


3
fraction, suggesting that there may be a cryptic mitochondrion targeting
sequence in the Cit2p (Rickey and Lewin, 1986; Rosenkrantz et al., 1986). The
activity of Cit1 p is severely repressed when cells are grown in a glucose medium.
When glucose is depleted, or when cells are grown in a non-fermentable carbon
source, the enzyme level increases (derepression) (Hoosein and Lewin, 1984).
This increase in enzyme activity (derepression) correlates with an increase in
steady-state mRNA levels (Kim et al., 1986), and a greater amount of
translatable mRNA (Hoosein and Lewin, 1984). The appearance of increased
mRNA in the derepressed state suggested that regulation of the CIT1 gene may
occur at the transcriptional level. The other possibility is that the increase could
be due to increased stability of the message. Differential stability of mRNA due
to environmental or cellular signals has been demonstrated for other messages
encoded by SP011, SP012, and SP013 genes (required for sporulation) of
yeast (Surosky and Esposito, 1992; Surosky et al., 1994); interleukin 3 (IL-3)
(Wodnar-Filipowicz and Moroni, 1990), and 9E3 mRNA, which encodes an
inflammatory mediator (Stoeckle and Hanafusa, 1989). The SPO transcripts are
much less stable in vegetative growth than they are when cells are in meiosis.
The IL-3 and 9E3 mRNAs are made more stable by calcium ionophores and
serum, respectively (Wodnar-Filipowicz and Moroni, 1990; Stoeckle and
Hanafusa, 1989).
Our goal is to dissect how the CIT1 gene is regulated at both the
transcriptional and mRNA stability level. Since little is known about the
mechanism of mRNA decay, we hope that the results of this study may give us


Figure 15. Half-life of CIT1 mRNA. (A) Total RNA was isolated from an RNA
polymerase II temperature sensitive mutant, grown in YPD or YPE, after
transcription inhibition by shifting the culture to 36C (non-permissive
temperature). 15 pg of total RNA was separated in each lane on a 1.2 %
agarose/0.22 M Formaldehyde gel in MOPS buffer. RNA was transfered on to
Hybond N+ (Amersham) nylon membrane by capillary blotting. The membrane
was hybridized with a 700 bp EcoRI/Pstl CIT1 DNA, radiolabeled with a-32P-ATP
using the random primer kit (U. S. Biochemical). The amount of mRNA was
quantitated using the Phosphor-Imager (Molecular Dynamics). (B) Semi-log plot
of % mRNA remaining as a function of time.


29
sequence from pBM150 between the ARS1 sequence and the polylinker of
pMC1790. The pMC1790 vector was provided by Dr. M. J. Casadaban (1979).
The YcpZ-2 vector contains the lacZ gene without a promoter or the first 22
nucleotides of the coding sequence, an E. coli origin of replication, and the bla
((3-lactamase) gene which conferred ampicillin resistance. There is a TRP1 gene
which served as a selectable marker in yeast, and the CEN4 and ARS1
sequences which allowed the plasmid to be maintained in a stable form and
replicate in yeast, respectively.
A schematic of the strategy used to generate the 5' deletions is depicted in
Figure 1. Plasmid pSH18-8 was cleaved with Smal, followed by a Bal31
exonuclease digestion according to the manufacturer's recommendation
(Boehringer Mannheim). Following the Bal31 digestion, the DNA was treated
with BamHI, to release the yeast DNA bearing the sequential deletions upstream
from the transcriptional start site of CIT1, and run on 1% agarose gel. Selected
fragments which had varying degrees of deletion were ligated to the YCpZ-2
vector which had been digested by Smal and BamHI. The end points of the
deletions were determined by sequencing, using the Sanger dideoxy sequencing
method.
Generation of 3' (proximal) deletions and subsequent subcloning into the
YCpZ-2 vector were done in two steps. First, pSH18-8 was digested with EcoRV
which cuts at a unique site 111 bp upstream from the major transcriptional start
site, followed by a Bal31 exonuclease digestion for varying length of time. The
EcoRV site is 11 bp upstream of the putative TATA element. Since the Bal31


158
approximately 8 minutes compared to more than 20 minutes in an ethanol growth
medium (Figure 15). The addition of glucose to cells being grown in an ethanol
medium caused even faster decay (~ 4 minutes versus 8 minutes) (Figure 17).
The C/7'2 mRNA, the peroxisome isozyme transcript, does not have a similar
decay profile (Figure 18). In contrast, the CIT2 mRNA was long lived both in
glucose-grown and ethanol-grown cultures and was not affected by changing
growth conditions. Other mRNAs from the ACT1 and 18S ribosomal RNA genes
were also probed and also did not show glucose effects (result not shown). This
suggests that glucose stimulated decay is not a general phenomenon, but is
unique to certain mRNAs. Sensitivity to rapid decay was transferable to a
heterologous E. coli gene (lacZ) carrying the 178 nucleotides of the CIT1 mRNA
(Figure 19). However, another yeast DNA sequence (TPI1) did not cause a
similar effect when fused to the lacZ gene (Figure 20). Further dissection of this
region delimited the sequence sufficient for this effect to the first 78 nucleotides
of the coding region (Figure 22 and Figure 23). Figure 27A shows the CIT1
sequences contained in the CIT1::lacZ fusion mRNA and Figure 27B shows the
predicted folding of the 78 nucleotides that confer rapid degradation in a glucose
containing medium. When the first 78 bp encoding the 5' twenty-six amino acids
were deleted greater than 50% of the fusion mRNA became long-lived.
However, the decay rate for the fraction that degraded did so with kinetics that
was similar to the intact fusion mRNA. This suggests that the sequences within
the first 78 nucleotides are required for the degradation of most of the mRNA.
But there may be other sequences on the mRNA that were able to effect the


43
transcription 1 pi RQ1 DNase I (1 U/pl) (Promega Corporation) was added, and
the sample was incubated at 37C for 15 minutes to digest the template DNA.
The volume was adjusted to 100 pi with water and extracted once with
phenol/chloroform/isoamyl alcohol. The aqueous phase was transferred,
extracted once again with chloroform and subsequently transferred to a fresh
tube, and an equal volume of 5 M ammonium acetate, pH 5.3 plus 2.5 volumes
ethanol were added. The transcript was incubated at -20C for 30 minutes to
precipitate. It was then centrifuged in an Eppendorf centrifuge at 12,000 rpm for
15 minutes to collect the precipitate. After decanting the supernatant, the pellet
was resuspended in 100 pi 2.5 M ammonium acetate and precipitation was
repeated two additional times to remove the unincorporated nucleotides. The
pellet was washed once with 70% ethanol, dried in vacuum and resuspended in
100 pi hybridization buffer. One microliter of the transcript was analyzed in a
scintillation counter. To hybridize, approximately 250,000 to 500,000 cpm per
probe was added to 10 pg of precipitated total RNA, and the volume was
adjusted to 30 pi with the hybridization buffer. The mixture was heated at 85C
for 15 minutes, then quickly transferred to a 45C heat block and hybridized
overnight. Three hundred and fifty microliters of RNase digestion buffer
containing 40 pg/ml RNase A plus 2 pg/ml RNase T, was added to each sample,
which was then incubated at 30C for 60 minutes to digest unhybridized
transcript. The RNase digestion was stopped by treatment with 2.5 pi 20 pg/ml
proteinase K; 20 pi 10% SDS at 37C for 15 minutes. The sample was extracted
once with equal volume phenol/chloroform/isoamyl alcohol and the aqueous


175
Marczak, J.E. and Brandriss, M.C. (1991). Analysis of constitutive and
noninducible mutations of the PUT3 transcriptional activator. Mol. Cell. Biol. 11,
2609-2619.
Matsumoto, K., Uno, I., Ishikawa, T., and Oshima, Y. (1983). Cyclic AMP may not
be involved in catabolite repression in Saccharomyces cerevisiae: Evidence from
mutants unable to synthesize it. J. Bacteriol. 156, 898-900.
Matsumoto, K., Uno, I., Toh-E, A., Ishikawa, T., and Oshima, Y. (1982). Cyclic
AMP may not be involved in catabolite repression in Saccharomyces cerevisiae:
Evidence from mutants capable of utilizing it as an adenine source. J. Bacteriol.
150, 277-285.
Maxam, A. M., and Gilbert, W. (1977). A new method for sequencing DNA. Proc.
Nat. Acad. Sci. USA 74, 560-564.
McGinnis, W., Garber, R.L., Wirz, J., Kuroiwa, A., and Gehring, W.J. (1984a). A
homologous protein-coding sequence in Drosophila homeotic genes and its
conservation in other metazoans. Cell 37, 403-408.
McGinnis, W., Levine, M.S., Hafen, E., Kuroiwa, A., and Gehring, W.J. (1984b).
A conserved DNA sequence in homoeotic genes of the Drosophila Antennapedia
and bithorax complexes. Nature 308, 428-433.
Miller, J., McLachlan, A. D., and Klug, A. (1985). Repetitive zinc binding domains
in the protein transcription factor III A from Xenopus oocytes. EMBO J. 4, 1609-
1616.
Mueller, D.M. and Getz, G.S. (1986). Steady state analysis of mitochondrial RNA
after growth of yeast Saccharomyces cerevisiae under catabolite repression and
derepression. J. Biol. Chem. 261, 11816-11822.
Muhlrad, D. Decker, C.J., and Parker, R. (1994). Deadenylation of the unstable
mRNA encoded by the yeast MFA2 gene leads to decapping followed by 5" 3'
digestion of the transcript. Genes. Dev. 8, 855-866.
Muhlrad, D. and Parker, R. (1992). Mutations affecting stability and
deadenylation of the yeast MFA2 transcript. Genes. Dev. 6, 2100-2111.
Muhlrad, D. and Parker, R. (1994). Premature translation termination triggers
mRNA decapping. Nature 370, 578-581.
Muhlrad, D., Decker, C. J., and Parker, R. (1995). Turnover mechanisms of the
stable yeast PGK1 mRNA. Mol. Cell. Biol. 15, 2145-2156.


135
A
CIT1 LacZ
B
YPD ++++++
Time (min)
o m
o o o o o o o
CIT1:: LacZ
cm


171
Guarente, L. and Hoar, E. (1984). Upstream activation sites of the CYC1 gene of
Saccharomyces cerevisiae are active when inverted but not when placed
downstream of the "TATA box". Proc. Natl. Acad. Sci. USA 81, 7860-7864.
Guarente, L, Lalonde, B., Gifford, P., andAlani, E. (1984). Distinctly regulated
tandem upstream activation sites mediate catabolite repression of the CYC1
gene of S. cerevisiae. Cell 36, 503-511.
Guarente, L. and Mason, T. (1983). Heme regulates transcription of the CYC1
gene of S. cerevisiae via an upstream activation site. Cell 32, 1279-1286.
Hahn, S. and Guarente, L. (1988). Yeast HAP2 and HAP3\ Transcriptional
activators in a heteromeric complex. Science 240, 317-321.
Hahn, S., Hoar, E.T., and Guarente, L. (1985). Each of three "TATA elements"
specifies a subset of the transcription initiation sites at the CYC-1 promoter of
Saccharomyces cerevisiae. Proc. Natl. Acad. Sci. USA 82, 8562-8566.
Harbury, P.A.B. and Struhl, K. (1989). Functional distinction between yeast TATA
elements. Mol. Cell. Biol. 9, 5298-5304.
Hartshorne, T.A., Blumberg, H., and Young, E.T. (1986). Sequence homology of
the yeast regulatory protein ADR1 with Xenopus transcription factor TFIIIA.
Nature 320, 283-287.
He, F., Peltz, S. W., Donahue, J. L, Robash, M., and Jacobson, A. (1993).
Stabilization and ribosome association of unspliced pre-mRNA in a yeast upf
mutant. Proc. Natl. Acad. Sci. USA 90, 7034-7038.
Heaton, B., Decker, C., Muhlrad, D., Donahue, J., Jacobson, A., and Parker, R.
(1992). Analysis of chimeric mRNA derived from the STE3 mRNA identifies
multiple regions within yeast mRNAs that modulate mRNA decay. Nucleic Acids
Research 20, 5365-5373.
Herrick, D., Parker, R., and Jacobson, A. (1990). Identification and comparison of
stable and unstable mRNAs in Saccharomyces cerevisiae. Mol. Cell. Biol. 10,
2269-2284.
Hinnebusch, A. G. (1988). Mechanisims of gene regulation in the general control
of amino acid biosynthesis. Microbiol. Rev. 52, 248-273.
Hoffman, C.S. and Winston, F. (1991). Glucose repression of transcription of the
Schizosaccharomyces pombe fbp1 gene occurs by a cAMP signaling pathway.
Genes. Dev. 5, 561-571.


150
-439
GAAT T C C C G GAT C CAT CAAAAAT CCATTCAT CAT TAAC TAAAAAC GCGGGTAGAGATTAC
-379
TACATATTCCAACAAGACCTTCGCAGGAAAGTATACCTAAACTAATTAAAGAAATCTCCG
TCGTCA -319
AAGTTCGcCATTTTCATTGAACGGCTCAATTAATCTTTGTAAATATGAGCGTTTTTACGT
GCN4
GAGTCA -259
TCACATTGCCTTTTTTTTTATGTATTTACCTTGCATTTTTGTGCTAAAAGGcGTCACGTT
GCN4
-199
TTTTTCCGCCGCAGCCGCCCGGAAATGAAAAGTATGACCCCCGCTAGACCAAAAAATACT
TNATTGGA -139
TTTGTGTTATTGGAGGATCGCAATCCCTTTGGAGCTTTTCCGATACTATCGACTTATCCG
HAP2/3/4
-79
acctcttgtttgaaaatgtcaattgatatccatccat{tatataatJtgctcaaaacttgca
-19
GCAACTATTCTTTACCCTTCCCCTGTTATGGATTGCATGTCTTAAGGGGGAAATTTGCTG
+ 1 42
TTTACTAAAATACAAACCAGGTTTGTTTTGGCTTTTATTTGCATTTAAGTAATTACAATT
99
ACAAC CAT TAAAAAGAAAATAAG G CAAAACATATAG CAATATAATAC TAT T TAC GAAGA
ATG


166
was not required for the decay of SP011 mRNA, a glucose regulated meiotic-
specific gene. The CIT1 mRNA decay mechanism may be identical to one of the
already defined pathways, a combination of some of the pathways, or it may
show a new pathway that is yet identified.


Construct Arrangement
plCZ312
UAS1-UAS2; TATA
'>
V 9
plCZ312UASLESS
TATA
*
YISL111-139X
rrUAS1-UAS2(URSc,rr) TATA
if
Specific Activity
YPD
YPE
LOG
STA
LOG
CYC1::lacZ
310
691
2149
00
~vl
CYC1::lacZ
43
93
150
CYC1::iacZ
163
333
1815


91
level for p3-139 was slightly lower than the p5-498 level both in repressing and
derepressing media even though a higher level of 3-galactosidase activity was
detected (Figure 3). At present, no explanation satisfactorily accounts for this
discrepancy between the two methods of determining transcriptional efficiency.
Measuring 3-galactosidase activities reflects both transcriptional and translational
effects and may possibly amplify small differences in RNA level. However,
Rosenkrantz et al., (1994) showed that 3-galactosidase levels increased when
the sequences between this region were deleted. This would suggest that the
enzyme assay may be more reliable than the quantitative result of the steady-
state mRNA transcribed from the same plasmids. Lane 9 of Figure 9a was RNA
isolated from a yeast strain without the plasmid construct that has the lacZ gene.
This confirms that there is no other gene in yeast that hybridizes to the E. coli
lacZ probe. The sample in lane 10 (Figure 9a) was isolated from a yeast strain
transformed with pES90 plasmid, a generous gift from Dr. H. Baker's laboratory.
pES90 plasmid has the triose-phosphate isomerase (TPI1) gene fused to the
lacZ gene.
Band Shift Assay and In Vitro Footprint Analysis
To map the sequences that are involved in regulation of the CIT1 gene by
an independent method, both bandshift assays and in vitro footprint analysis
were performed. The bandshift assays were performed to see if there are
proteins from total yeast extract that can bind to a DNA fragment containing the


M*
t

YPD
YPE
SD(2%)
hap4
CD
O)


Figure 7. UAS Activity of Various CIT1 Upstream Sequences. A 41-mer
representing sequences from position -200 to -160 and a 30-mer representing
sequences from position -245 to -216 were subcloned before a CYC1::lacZ
fusion without its native UAS. (3-galactosidase assays were performed as
described in Figure 3.


53
single end radiolabeled probe from the upstream sequence was prepared and
incubated with an extract of yeast cells at room temperature for 20 minutes. It
was then run on a 4% nondenaturing polyacrylamide (40:1) gel in TBE at room
temperature at 100 V, until the bromophenol blue dye had migrated to the
bottom. The gel was dried under vacuum at 80C and exposed to X-ray film.
The cell extract for the assay was prepared as follows: A cell culture was grown
to early logarithmic phase (OD600 ~ 1.0) and harvested by centrifugation at 7,500
rpm in a JA10 rotor (Beckman) for 10 minutes at 4C. The cell pellet was
resuspended in 10 ml extraction buffer(0.2 M Tris-HCI pH 8.0; 0.4 M ammonium
sulfate; 10 mM magnesium chloride; 1 mM EDTA; 20% glycerol). Cells were
washed by resuspension in the same buffer and repeated centrifugation. Three
milliliters of extraction buffer plus 2 mM PMSF; 0.5 mM DTT; and 1 pg/ml
pepstatin were added per 1 g of wet weight of cells. Cells were disrupted by
passing through a French Pressure Cell at 20,000 psi three times. The
homogenate was then centrifuged at 17,000 rpm (35,000 X g) for 45 minutes in
the JA 20 rotor at 4C. The supernatant was aliquoted into microcentrifuge tubes
and stored at -70C. Protein concentrations were determined as described
earlier. Two probes were used for the bandshift assays: (1) -406 to -216
fragment and (2) -245 to -111 fragment. These two probes together span the
entire region of the upstream sequences of p5-498, which contains all of the
presumptive CIT1 UAS. The probes were prepared by using oligonucleotides
AL82/AL85 (Table 3) to generate the -406 to -216 fragment in a PCR reaction,
and primers AL84/AL104 to make the -245 to -111 probe. Standard PCR


ACKNOWLEDGMENTS
I wish to thank the University of Florida to have given me the opportunity
to attend graduate school.
A special thanks goes to Dr. Alfred S. Lewin for allowing me to work in his
laboratory, but more important than that was his genuine care and concern for
me and all other members of the lab. His mentorship has been invaluable and
shall remain part of my scientific career.
I thank all the members of my committee for accepting that duty and giving
me the guidance to improve my ability. I would like to pay special thanks to Dr.
Henry V. Baker, who first taught me a lot about yeast, for the many innumerable
ways he has helped me over the years.
To the members of Lewin's laboratory, I thank you all for making my stay
there a little less tedious. To Mr. James Thomas Jr., I thank you for all the help
you have given me. To Dr. Lynn C. Shaw, the Macintosh specialist, without your
help it would have been impossible to get all my figures ready in the last days.
To Mr. Bruce W. Ritching, I thank you for help editing part of the dissertation.
To my family, especially my wife Alaro Lawson, without you this would not
have been possible.


168
Carlson, M. and Botstein, D. (1982). Two differentially regulated mRNAs with
different 5' ends encode secreted and intracellular forms of yeast invertase. Cell
28, 145-154.
Celenza, J.L. and Carlson, M. (1986). A yeast gene that is essential for release
from glucose repression encodes a protein kinase. Science 230, 1175-1180.
Chandler, V.L., Maler, B.A., and Yamamoto, K.R. (1983). DNA sequence bound
specifically by glucocorticoid receptor in vitro render a heterologous promoter
hormone responsive in vivo. Cell 33, 489-499.
Chen, W. and Struhl, K. (1985). Yeast mRNA initiation sites are determined
primarily by specific sequences, not by the distance from the TATA element.
EMBO J. 12, 3273-3280.
Chen, W. and Struhl, K. (1988). Saturation mutagenesis of a yeast his3 "TATA
element": Genetic evidence for a specific TATA-binding protein. Proc. Natl. Acad.
Sci. USA 85, 2691-2695.
Cherry, J.R., Johnson, T.R., Dollard, C., Shuster, J.R., and Denis, C.L. (1989).
Cyclic AMP-dependent protein kinase phosphorylates and inactivates the yeast
transcriptional activator ADR1. Cell 56, 409-419.
Chodosh, L.A., Baldwin, A.S., Carthew, R.W., and Sharp, P.A. (1988a). Human
CCAAT-Binding proteins have heterologous subunits. Cell 53, 11-24.
Chodosh, L.A., Olesen, J., Hahn, S., Baldwin, A S., Guarente, L, and Sharp,
P.A. (1988b). A yeast and a human CCAAT-Binding protein have heterologous
subunits that are functionally interchangeable. Cell 53, 25-35.
Corden, J.L., Cadena, D.L., Ahearn, J.M., and Dahmus, M E. (1985). A unique
structure at the carboxyl terminus of the largest subunit of eukaryotic RNA
polymerase II. Proc. Natl. Acad. Sci. USA 82, 7934-7938.
Cormack, B.P., Strubin, M., Ponticelli, A.S., and Struhl, K. (1991). Functional
differences between yeast and human TFIID are locolized to the highly
conserved region. Cell 65, 341-348.
Cormack, B.P., Strubin, M., Stargell, L.A., and Struhl, K. (1994). Conserved and
nonconserved functions of the yeast and human TATA-binding proteins. Genes.
Dev. 8, 1335-1343.
Courey, A.J. and Tjian, R. (1988). Analysis of Sp1 in vivo reveals multiple
transcriptional domains, including a novel glutamine-rich activation motif. Cell 55,
887-898.


41
Then the supernatant was removed and cells were resuspended in 400 pi AE
buffer ( 50 mM sodium acetate; 20 mM EDTA, pH 5.3). Cells were transferred to
a microcentrifuge tube, then added one-tenth volume (40 pi) 10% SDS was
added to each tube and vortexed for about 30 seconds. A 1.2 volume (480 pi)
prewarmed (65C) phenol/chloroform (1:1 ratio),equilibrated with AE buffer was
added, and the mixture was vortexed for 30 seconds. The tube was incubated in
a 65C water bath for 5 minutes with occasional vortexing, then cooled down by
setting in a dry-ice ethanol bath for approximately 10 seconds. The aqueous
phase was separated from the organic phase by centrifugation at 2500 X g in an
Eppendorf centrifuge at room temperature for 20 minutes. The organic phase
was discarded. An equal volume of prewarmed (65C) phenol/chloroform was
added again and the extraction repeated as above. A final extraction was
performed with an equal volume of phenol/chloroform/isoamyl alcohol (25:24:1).
The aqueous phase was transferred to a fresh microcentrifuge tube. RNA was
precipitated by adding one-tenth volume 3 M sodium acetate, pH 5.3 plus 2.5
volume absolute ethanol and incubated at -20C for 30 minutes. The ethanol
pellet was recovered by centrifuging for 15 minutes in a microcentrifuge at 4C.
The supernatant was decanted, and the pellet was washed with 1 ml 70%
ethanol. The pellet was dried under vacuum and resuspended in 50 pi water.
RNA concentration was determined in spectrophotometer (Hewellet Packard
model 8452). Samples were stored at -70C until needed. When isolating RNA
for half-life or rate of decay determination, an RNA polymerase II temperature
sensitive mutant strain was usually used to isolate the RNA. Transcription was


I certify that I have read this study and that in my opinion it conforms to
acceptable standards of scholarly presentation and is fully adequate, in scope
and quality, as a dissertation for the degree of Doctpf ofy Phjjo^p^ry.
Alfred^. Lewin, Chair
Professor of Molecular Genetics
and Microbiology
I certify that I have read this study and that in my opinion it conforms to
acceptable standards of scholarly presentation and is fully adequate, in scope
and quality, as a dissertation for the degree of Doctor of Philosophy.
^ Sl /" -v
Henry V. Baker
Associate Professor of Molecular
Genetics and Microbiology
I certify that I have read this study and that in my opinion ^conforms to
acceptable standards of scholarly presentation and ife fully adequate, in sqppe
and quality, as a dissertation for the degree of Ddctor of PhRe^ophy.
William W. Hauswirth
Eminent Scholar, Molecular
Genetics and Micorobiology
I certify that I have read this study and that in my opinion it conforms to
acceptable standards of scholarly presentation and is fully adequate, in scope
and quality, as a dissertation for the degree of Doctor of Philosophy.
s.
G
o uM
Sue A. Moyer
Professor of Molecular Genetics
and Microbiology
I certify that I have read this study and that in my opinion it conforms to
acceptable standards of scholarly presentation and is fully adequate, in scope
and quality, as a dissertation for the degree of Doctor of Philosophy.
Harry Nic
Associafe'Professor of
Biochemistry and Molecular
Biology


156
high protein concentration may mean that this binding may be due to either a low
abundance protein which was limited at the lower concentration or a low affinity
protein requiring high protein concentration to detect binding. Bandshift
competition assays and in vitro DNase I protection assays were unsuccessful in
identifying the binding sites more accurately in segment I.
Segment II produced one consistent band upon addition of yeast extract
(Figure 11). This interaction was successfully competed away using an
unlabeled fragment of the same DNA, whereas region I could not compete away
this interaction even at 300-fold excess of unlabeled competitor. A 33 bp double-
stranded oligonucleotide that spans -340 to -308 also competed away the shifted
probe, but at a higher molar ratio than the entire region II (Figure 12). Another 41
bp double-stranded oligonucleotide from a distinct area of the upstream
sequence was not able to compete away the shift at a similar concentration.
Footprint analysis showed some protected and hypersensitive sites within the
area that includes the 33 bp region (Figure 13). The fact that it took greater
excess of the oligonucleotide to compete away the shifted band would indicate
that sequences beyond this segment may be needed for optimum interaction.
in vivo DMS footprint analysis was also performed to identify protein/DNA
interaction. One G-residue at position -266 (Figure 14), which resides within the
GCN4 consensus binding site, was observed to be protected in a fraction of the
DNA samples tested. Only a fraction of the DNA sample was protected probably
because the affinity between the protein and DNA was such that it did not remain
bound during treatment with DMS. Other sites shown to have effect on gene


BIOGRAPHICAL SKETCH
I started my college education at the Community College of Baltimore in
1978. Upon completion I attended Coppin State College for a semester before
transferring to Loyola College, Baltimore, MD., where I obtained my Bachelor of
Science in Biology. In 1985 I got married to Alaro George, the same year I
started graduate school at the University of Wisconsin, Milwaukee, Wisconsin. I
entered the University of Florida graduate school in 1987, the same year we had
our first daughter, Banimibo-ofori. In 1992 my wife had our second daughter,
Ibituroko-emi. I completed my dissertation under the guidance of Dr. Alfred S.
Lewin. Upon completion I hope to do my post-doctoral work at the Seattle
Biomedical Research Institute with Dr. Kenneth Stuart, where I hope to do
research in the field of parasitology.
182


179
Schneider, J.C. and Guarente, L. (1991). Regulation of the yeast CYT1 gene
encoding cytochrome c1 by HAP1 and HAP2/3/4. Mol. Cell. Biol. 11, 4934-4942.
Scholer, A. and Schuller, H. (1994). A carbon source-responsive promoter
element necessary for activation of the Isocitrate Lyase gene ICL1 is common to
genes of the gluconeogenic pathway in the yeast Saccharomyces cerevisiae.
Mol. Cell. Biol. 14, 3613-3622.
Sedivy, J.M. and Fraenkel, D.G. (1985). Fructose bisphosphatase of
Saccharomyces cerevisiae cloning, disruption and regulation of the FBP1
structural gene. J. Mol. Biol. 186, 307-319.
Siddiqui, A.H. and Brandriss, M.C. (1988). A regulatory region responsible for
proline-specific induction of the yeast PUT2 gene is adjacent to its TATA box.
Mol. Cell. Biol. 8, 4634-4641.
Sinclair, D. A., Kornfeld, G. D., and Dawes, I. W. (1994). Yeast intragenic
transcriptional control: Activation and repression sites within the coding region of
the Saccharomyces cerevisiae LPD1 gene. Mol. Cell. Biol. 14, 214-225.
Stoeckle, M.Y. and Hanafusa, H. (1989). Processing of 9E3 mRNA and
regulation of its stability in normal and rous sarcoma virus-transformed cells. Mol.
Cell. Biol. 9, 4738-4745.
Stone, G. and Sadowski, I. (1993). GAL4 is regulated by a glucose-responsive
functional domain. EMBO J. 12, 1375-1385.
Struhl, K. (1988). The JUN oncoprotein, a vertebrate transcription factor,
activates transcription in yeast. Nature 332, 649-650.
Struhl, K. (1989). Helix-turn-helix, zinc-finger, and leucine-zipper motifs for
eukaryotic transcriptional regulatory proteins. Trends Biochem. Sci. 15, 6-16.
Struhl, K. (1993). Yeast transcription factors. Curr. Op. Cell Biol. 5, 513-520.
Suissa, M., Suda, K., and Schatz, G. (1984). Isolation of the nuclear yeast genes
for citrate synthase and fifteen other mitochondrial proteins by a new screening
method. EMBO J. 3, 1773-1781.
Surosky, R.T. and Esposito, R.E. (1992). Early meiotic transcripts are highly
unstable in Saccharomyces cerevisiae. Mol. Cell. Biol. 12, 3948-3958.
Surosky, R.T., Strich, R., and Esposito, R.E. (1994). The yeast UME5 gene
regulates the stability of meiotic mRNAs in response to glucose. Mol. Cell. Biol.
14, 3446-3458.


Figure 13. DNase I Protection Assay. AL82 and AL85 (Table 2) were used to
generate a probe (encompassing -406 to -216) by PCR, end labeled at the -406
end and used to bind to proteins from crude yeast extract. Reaction mixture
was digested with DNase I, run on a 4% (39:1) polyacrylamide gel to separate
shifted DNA. Shifted DNA was located by autoradiography. The bands were cut
out from the gel and DNA eluted onto DEAE cellulose membrane. Digested DNA
was separated on 6% polyacrylamide gel (19:1). Control lanes were generated
by digesting naked DNA with DNase I. Sequencing ladder was generated by
sequencing pSL123 plasmid with AL82 primer. The two arrows identify protected
regions. Controls are digests of the fragment in the absence of extract.


136
full length CIT1 mRNA in this strain did not change (Figure 23b, lower band),
suggesting that the glucose response element lies within the first 26 codons of
the 5' termini.
Sequences Within the 5' Terminus of CIT1 mRNA Confer Nonsense-Mediated
Decay
Nonsense-mediated decay in yeast and possibly other organisms is a
mechanism used to rapidly degrade mRNA that carries premature stop codons
(Leeds et al., 1991; Leeds et al., 1992). It is used to eliminate mRNAs that are
incapable of producing mature and functional protein, yet could use the
translational apparatus. This could overload the cellular translational apparatus
with "useless" proteins which may be detrimental to the cell. A second
hypothesis forwarded by Peltz et al. (1994) is that the nonsense-mediated decay
pathway controls the abundance of intron-containing pre-mRNA that enters the
cytoplasm. Since most introns do not contain long open reading frames that
code for proteins, their presence in the cytoplasm could also interfere with the
translational machinery.
A stop codon was introduced at the fifth codon by changing a T to G which
converted the UUA codon to UGA. RNA was isolated from the strain carrying the
mutant plasmid and hybridized with CIT1 and lacZ genes. The half-life of the
fusion mRNA containing the stop codon was drastically reduced in both the YPE
medium and in the culture adjusted to 2% glucose (Figure 24). Again, the full
length CIT1 mRNA was not affected because it did not contain any sequence


TABLE OF CONTENTS
ACKNOWLEDGMENTS iii
ABSTRACT vi
INTRODUCTION 1
Utility of Baker's Yeast 1
The Citrate Synthase System 2
Transcriptional Regulation in Eukaryotes 4
Glucose Repression 14
mRNA Stability 21
MATERIALS AND METHODS 27
Growth Conditions and Media 27
Yeast T ransformation 27
Construction of 5' (DISTAL) and 3' (PROXIMAL) Deletions 28
Construction of Internal Deletions 32
Heterologous Fusion 36
Cloning of Oligonucleotides 38
Measurement of (3-Galactosidase Level in CIT1-lacZ Fusion 39
RNA Isolation 40
Ribonuclease Protection Assay 42
Northern Analysis 44
Primer Extension Analysis 46
In Vivo Footprinting 47
Preparation of Single-Stranded DNA 51
Bandshift Assay/In Vitro Footprinting Analysis 52
Messenger RNA Stability (5' UTR deletion) Assay 55
Introduction of Stop Codon at the Fifth Amino Acid Position in the
CIT1 Gene 56
RESULTS 63
Analysis of 5' (Distal) and 3' (Proximal) Deletions 63
Internal Deletions Show Several Putative UASs 73
There are Multiple UAS Elements 77
Evidence for URS Element 84
Steady-State mRNA Levels Correlate with Enzyme Assay 88
IV


Figure 27. CIT1 Transcript Present in Fusion mRNA. A). The CIT1 mRNA
present in the CIT1::lacZ fusion mRNA. The numbering assignment is as
mentioned in figue 26. B). A predicted secondary structure of the CIT1 coding
portion present in the fusion mRNA according to the program "FOLD", GCG
software package version 7. This folding has a free energy of -5.7kcal/mole.


SUMMARY AND DISCUSSION
The original goal of this project was to understand the transcriptional
regulation of the CIT1 gene: to identify the cis and trans elements that confer
both basal levels of transcription and carbon-source regulation. I have identified
regions within the 5' noncoding region of the CIT1 gene that activate transcription
in a manner that does not depend on the carbon source. I have provided
evidence for an upstream repressing sequence located towards the proximal end
of the 5' noncoding region that reduced the activity of a heterologous gene only in
a glucose medium. There may also be another repressing element that lies at
the distal (51) end of the promoter region. While 5' mature-ends were detected at
nine sites, closely spaced, there was one major site, two moderate sites and
several low abundance sites that surround the two moderate sites. However,
initiation sites did not appear to differ in cells grown in different carbon sources.
Northern analysis of the CIT1 mRNA was used to show that there was a
difference in the decay rate between mRNA isolated from glucose-grown cells
and ethanol-grown cells. Decay of the message was further accelerated if the
cells were initially grown in an ethanol medium and then adjusted to 2% glucose.
The rapid decay determinant in response to glucose, which I named glucose-
dependent instability element (GDIE), was located in the first 78 bp protein
140


117
when the culture was incubated continuously in YPD at the restrictive
temperature (compare lanes 3 of Figure 15a and 17a). The half-life of CIT1
mRNA in the culture adjusted to 2% glucose after initial growth in YPE was less
than 5 minutes, whereas the half-life was approximately 8 minutes if cells were
initially grown in YPD and maintained in it following the termination of
transcription. These results suggest that when cells sense a change in the
availability of a carbon source, especially from the less preferred (ethanol) to the
preferred (glucose), there is a rapid adjustment in the pattern of gene expression
to utilize the new carbon source. These results imply that there are sequences
on the CIT1 mRNA that cause it to decay at a faster rate in a glucose-containing
medium than in an ethanol medium. The decay rate was most pronounced
between the two media at the early intervals. However, the decay rate between
the two appears to be about the same after 20 minutes. This suggests that there
may be two different decay kinetics involved in the decay of CIT1 mRNA in YPD;
a fast decay rate for early time periods and a slower rate subsequently. The
different decay rates may reflect recognition of different mRNA populations
recognized by different nucleases. However, a rapid turnover of a nuclease or
some other factor required for the decay could also produce this effect. Since
transcription was being inhibited no new transcript would be available to serve as
a message for a protein molecule that has been degraded. This would deplete
the required factor for the rapid turnover, consequently slowing the rate of
turnover.


Figure 21. Identification of transcriptional start sites of CIT1 mRNA in
Glucose- and Ethanol-grown cells. (A) 50 pg of total yeast RNA was annealed
withy-32P end-labeled AL41 primer and extended in the presence of 10 mM each
of dNTP's using Superscript II (Life Technologies) reverse transcriptase. The
primer is complementary to the noncoding strand and is 44 nucleotides
downstream of the AUG start codon. Lanes marked YPD and YPE are samples
in which RNA was isolated from the indicated growth medium. Sequencing
reaction lanes (using Sequenase) were generated using the same primer as
described earlier on pCSB plasmid, which contains the entire CIT1 coding
sequence plus 200 bp of upstream noncoding region. The sequence reactions
were a-32P labeled. The samples were separated on 8% Long Ranger gel (AT
Biochem). (B) CIT1 noncoding strand sequence depicting the putative
transcriptional start sites. High abundance start site is marked with long arrow,
moderate abundance start sites are marked with medium sized arrows and low
abundance start sites are marked with smallest size arrows.


139
modification. This shows that the nonsense-mediated decay pathway is
independent of the growth medium. I conclude that the turnover of the fusion
mRNA is subject to nonsense-mediated decay, which is similar to other normal
yeast mRNAs.


108
trials were the same (result not shown); both matched the published results of
their original experiment (Huie et al., 1992).
CIT1 mRNA is More Stable in Cells Grown in Ethanol Than in Cells Grown in
Glucose
The steady-state mRNA level reflects the rate of synthesis and rate of
degradation for each message. Several lines of evidence have shown that there
was a greater amount of steady-state CIT1 mRNA in a complex medium
supplemented with ethanol than in a medium supplemented with glucose.
However, there was no clearly demonstrable region on the CIT1 gene upstream
sequence that could fully account for the differential expression between YPD
and YPE media. This observation suggested that differential regulation may also
occur at a post-transcriptional level, such as the rate of decay of the CIT1
message in the different growth media.
Lombardo et al., (1992), studying the regulation of the Ip gene encoding
the iron-protein subunit of the succinate dehydrogenase complex, showed that a
message transcribed from this gene degraded at a faster rate when the growth
medium was changed to YPD after initial growth in YPE. This showed for the
first time that glucose regulation of genes could involve changing their rate of
mRNA decay. Surosky et al., (1994) recently discovered the UME5 gene, which
is required for the rapid turnover of meiotic specific genes in a glucose-
dependent manner. Glucose also regulates these genes at the transcriptional


12
a disulfide bond allowing dimerization. Additionally, there are other activators
which do not have an easily identifiable DNA-binding motif.
All of the transcriptional activators also have an activation domain.
Perhaps the most well characterized activation domain is the acidic activation
domain. These activator domains contain many negatively charged amino acids;
hence are often referred to as the "acidic-activation" domains (AAD). Studies by
Giniger and Ptashne (1987) in which a synthetic peptide was used with a
predicted amphipatic a-helix (AH) and net negative charge in conjunction with
the GAL4 DNA-binding domain, showed it was competent to activate
transcription in vivo, though only when over-expressed. Cloning of random
oligonucleotides from E. coli that could support activation resulted in sequences
with net negative charge (Ma and Ptashne, 1987). A gradual reduction in
activation potential was observed when some of these acidic residues were
removed from the Gcn4p (Hope et al., 1988). Together these results strongly
suggested the need for an acidic activation domain. However, as recently shown
(Leuther et al., 1993; Hoy et al., 1993), the ability to activate does not require
acidity or net negative charge. Rather, the most important criteria to function as
an activator was the ability to form a P-pleated sheet. Replacement of the
negatively charged residues with non-charged or positively charged residues will
still support activation. The Gal4p and Gcn4p were shown to form a P-sheet
under near physiological conditions (Hoy et al., 1993). Other defined activation
domains in mammalian cells are rich in glutamine, e.g. Sp1 (Courey and Tjian,
1988), or proline amino acid residues. These factors are usually found in


165
necessary for this regulation. The identified sequence would then be fused to an
heterologous yeast gene and show that it can regulate this gene in a similar
manner to the CIT1 gene. We have already constructed a hybrid gene between
the CUP1 gene and the 78 nucleotide transcript DNA sequence. Identification of
the minimum sequence required for the rapid turnover in a glucose medium
would also facilitate determining the trans-acting factor(s) required for this
phenomenon by doing a bandshift assay using the mRNA sequence. One of the
other objectives is to determine what other genes are regulated by glucose by
affecting the decay rate. This would be useful in determining the different
pathways through which glucose mediates mRNA turnover of various genes.
Another major objective of the mRNA stability studies should be
deciphering the mechanisms of mRNA decay. Because of the paucity of
experimental data, especially in yeast, very little is known about the mechanisms
of mRNA decay. Recently, Muhlrad et al. (1995) showed that there are at least
two mechanisms involved in the decay of the PGK1 mRNA. (1) A
deadenylation-dependent decapping followed by 5' to 3' exonuclease digestion.
(2) A decapping-independent 3' to 5' exonuclease digestion. One of the goals
would be to find out what direction digestion of CIT1 mRNA proceeds. This could
be done by determining the effect on CIT1 mRNA digestion a xrn1 mutant.
XRN1 encodes the major 5' to 3' exoribonuclease in yeast (Hsu and Stevens,
1993). Since the 5' portion of the CIT1 mRNA was sufficient to cause rapid
decay, it is quite possible that a deadenylation step before exonuclease digestion
may not be required. Surosky et al. (1994) also discovered that deadenylation


32
digestion was likely to remove this element, which is essential for proper
initiation, it was necessary to restore this sequence. The nuclease-treated DNA
was digested with BamHI and run on a 1% agarose gel. This generated two
fragments, a small fragment which consisted of CIT1 sequences from the EcoRV
site to the twenty-sixth codon, and a large fragment that consisted of vector
sequences and partially deleted CIT1 upstream sequences. A 300 bp EcoRV-
BamHI fragment from pSH18-8 containing the essential CIT1 sequences, was
ligated to the nested set of deleted DNA fragments. This generated deletion
clones that started at the EcoRV site and extended upstream, but retained the
TATA sequence, the transcription initiation site, and the coding region. Figure 2
is a diagrammatic representation of how these 3' deletions were generated.
Construction of Internal Deletions
Internal deletions of the promoter region were constructed to determine
the relative contribution of each of these regions to high level expression of CIT1
gene. The technique used to make these constructs is called recombinant circle
polymerase chain reaction (RCPCR) (Jones and Howard, 1991). Two primers
were used to prime PCR which extended in opposite directions on the template.
The standard polymerase chain reaction consisted of 10 pmoles each of the
primers, 3.4 ng of template DNA (pSL123), 200 pmoles of four dNTP's, 2.5 mM
magnesium chloride; 10 mM Tris-HCI, pH 8.3; 30 mM potassium chloride; and
2.5 U Ampli-Taq DNA polymerase (Cetus Corporation). Twenty cycles of


16
(ADR1C) was isolated that partially relieved the glucose repression of ADH2.
These mutants alter the phosphorylation site and reduce its efficiency of
phosphorylation (Cherry et al., 1989). Also, when the regulatory subunit for
adenylate catalase (BCY1) was mutated, which allowed for unregulated
expression of the catalytic subunit, ADH2 expression was severely reduced. This
observation suggests that the regulation of the ADH2 gene is mediated, partially,
through the modulation of ADR1 activity by cAMP. However, a more recent
study (Denis et al., 1992) shows that other ADR1C mutants which can still be
phosphorylated also partially relieved glucose repression. It is believed that the
ADR1C mutations may block the binding of a repressor to Adr1 p or alter the
structure of Adr1 p so that transcriptional activation regions become unmasked.
This would mean that the level of phosphorylation plays little role in the regulation
of Adr1 p.
Another eukaryotic organism exhibiting glucose repression is the yeast
Schizosaccharomyce pombe. In Schizosaccharomyce pombe, the gene for
fructose-1,6-biphosphate (fbp1) is glucose repressive. The work of Hoffman and
Winston (1991) showed that mutation in git2- (cyr1) caused constitutive
expression of fbp1. The git2+ gene codes for adenylate cyclase, which converts
ATP to cAMP; cAMP is required for the activation of cAPK. When cAMP was
exogenously added it caused reduction in the mRNA level of fbp1. However,
even this study showed that some of the git2- mutants that allowed constitutive
expression of fbp1 did not reduced the expression level when exogenous cAMP
was added to the growth medium. In addition, levels of cAMP did not show any


Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy
TRANSCRIPTIONAL AND POST-TRANSCRIPTIONAL REGULATION OF THE
CIT1 GENE IN SACCHAROMYCES CEREVISIAE
By
Sobomabo D. Lawson
May, 1995
Chairperson: Dr. Alfred S. Lewin
Major Department: Molecular Genetics and Microbiology
Citrate synthase catalyzes the condensation of oxaloacetate with acetyl-
CoA to form citrate, a reaction that takes place in both the tricarboxylic acid cycle
and the glyoxylate pathway. The tricarboxylic acid cycle occurs in the inner
compartment of the mitochondrion. In yeast Saccharomyces cerevisiae,
mitochondrial citrate synthase is encoded by CIT1, a nuclear gene.
This gene, like most other genes encoding mitochondrial enzymes, is
severely repressed when yeast is grown in the presence of glucose. These
genes become fully derepressed when glucose is totally utilized or when cells are
grown in ethanol, a nonfermentable carbon source. To understand at what stage
this regulation occurs, I examined transcriptional and post-transcriptional control
of CIT1. Deletions of the 5' non-coding region of the gene, in a CIT1::lacZ hybrid,
VI


A
-800 -600
1 // 1
1
-400
1
-200
r
ATG
Specific
Activity
YPE/YPD
| | ItATAl
YPD
YPE
//
70
2017
26
I
-498
I
57
1938
34
1
-245
I
9
1183
131
1
-227
23
626
27
-800
|
1 ^
-168
1 63
2933
1 8
-800 ^
I I
1 ~
I I
-139-111
138
1797
13
-800
| |
1
-172 -111
104
670
6 3
-800 ^
I I
D 'vl
1
I I
-217 -111
8
232
29
-800 ''
I I
1 /x
I i
-252 -1 1 1
46
46
//
|
I
-372
-111
B
-800 -600
V-/y^L 1


50
M ammonium acetate plus 400 pi ethanol was added. This precipitation was
repeated and the pellet was washed in 1 ml 70% ethanol. To cleave the DNA,
10 pi concentrated (10 M) piperidine (Fisher Biotechnology) was added to the
sample to make a final concentration of 1 M. The sample was transfered to a
screw cap tube and incubated at 95C for 30 minutes. At the end of the
incubation, the tube was chilled on ice for few minutes and lyophilized overnight
in the Speed Vac (Savant). The pellet was resuspended in 250 pi 0.3 M sodium
acetate, pH 5.3. Then 3 volumes of ethanol was added and the sample was
placed in a dry-ice ethanol bath. DNA was collected by centrifugation in an
Eppendorf centrifuge. The pellet was resuspended in 200 pi 0.3 M sodium
acetate, pH 5.3, and the ethanol precipitation was repeated. The final pellet was
rinsed with 70% ethanol and dried in vacuum. Each pellet was resuspended in 5
pi of sample dye and loaded on a 6% polyacrylamide/50% urea gel. The gel was
run at 60 watts constant power in TBE buffer (0.89 M HCI; 0.89 M borate; 0.005
M EDTA) until the bromophenol blue dye reached the bottom of the gel. The gel
was picked up with a Hybond N+ (Amersham) membrane precut to the size of
the gel and presoaked in TBE, the transfer buffer. The DNA was transferred onto
the nylon membrane by electroblotting, using the Genesweeper instrument
(Hoefer Scientific) as recommended by the manufacturer. After the transfer, the
nucleic acid was crosslinked to the membrane on a transilluminator for 10
minutes. Prehybridization was performed with 25 ml of hybridization solution,
which consisted of 7% SDS; 0.5 M sodium phosphate, pH 7.4; 1% BSA; 1 mM
EDTA, at 60C for at least 60 minutes. Radiolabeled DNA probe was then added


HAP2/3/4 SITE
mmm
o>
>1
oo
to
G
hap2-
hap4-
1-7 A
S150-2B
S150-2B
S150-2B
G
A/G
C
T/C
O
O)
YPD
YPE
SD


Figure 14. In vivo DMS Footprinting Analysis. Cells from the indicated strain
and medium were treated with 0.5% DMS. DNA was isolated from the treated
cells, digested with Accl, cleaved with piperidine and separated on 6%
polyacrylamide gel (19:1). The DNA was then transferred on to Hybond N+
(Amersham) by electroblotting (Genesweep, Hoeffer Scientific) and hybridized.
Radiolabeled probe was prepared from single-stranded DNA template using
AL82 primer by primer extension with Klenow enzyme. Membrane was exposed
to Kodak XAR-5 film. Sequencing ladder was generated on naked DNA by
Maxam and Gilbert method.


146
extended beyond -224 (-124 in our numbering). (They numbered their deletion
constructs by using the adenosine residue of the first codon (AUG) as +1.)
Strain differences, which have been known to cause disparity, even in citrate
synthase levels, may be one possible explanation for the differences in our
results. Another explanation for the differences in the two sets of results may lie
in the vectors used to perform the experiments. Rosenkrantz et al., (1994) used
a multicopy (2p) plasmid, and such plasmids are lost at high rate in non-selective
media such as YPD or YPE. If that interpretation is correct, the lower relative
expression of the larger deletions may have been missed in their assays. In
addition, high copy plasmids may cause DNA binding sites to exceed available
transcription factors, if these are limiting.
Proximal (3') deletions, that extended away from the transcriptional start
site, produced specific activities that range from 150% of wild-type level in an
ethanol-grown culture to greater than twofold in a glucose-grown culture (Figure
25 and Figure 4). In the p3-139 clone (deleted from -139 to -111), the specific
activities expressed in both glucose and ethanol media were, 2.5 times and 1.5
times higher respectively than the wild type construct (Figure 25). Rosenkrantz
and colleagues (Rosenkrantz et al., 1994) found similar results when they
deleted sequences between -165 and -111. This increase may be due to
removal of a URS element. To test this possibility, I subcloned this region of
CIT1 DNA into an upstream site of a CYC1::lacZ fusion. This sequence was
inserted between the TATA site and the two UASs, UAS1 and UAS2, of CYC1
gene. The specific activity of this clone YISL111-139X, was reduced about one-


18
URS sequences in the GAL4 promoter (Johnston et al., 1994). Other
transcriptional activators that share structural similarity with the Gal4p include
Leu3p (Zhou et al., 1987), Prplp (Schmitt et al., 1990), Put3p (Marczak and
Brandiss, 1991), and Lac9p (Salmern, Jr. and Johnston, 1986) of K. lactis. A
third mechanism of glucose regulation involves URS sequences which mediate
repression of genes by binding to repressor proteins. The GAL1 gene has a
URSgal located between the UASgal and the TATA sequence (Finley et al., 1990;
Flick and Johnston, 1992). The Miglp binds to URSGAL sequences to inhibit
Gal4p activation.
There are several other genes that are required for glucose regulation.
They are either needed to relieve repression or to maintain repression. Studies
by Rose et al. (1991) showed that the products of HXK1 and HXK2 are required
for glucose repression of many genes. The gene products of HXK1 and HXK2
phosphorylate hexose sugars, but how they mediate their effect is not known.
The SNF1 gene encodes a protein kinase that is required for derepression of the
SUC2 (invertase) gene (Calenza and Carlson, 1986). Mutation in SNF1 also
causes defects in derepression of SDH1 (succinate dehydrogenase), ICL1
(isocitrate lyase), and MDH1 (malate dehydrogenase) genes. The SNF1 gene is
believed to exert its effect by modifying transcriptional activators that bind to the
UAS of SUC2. The target for this kinase is probably the Snf2p/Snf5p/Snf6p
complex, which is a transcriptional activator (Laurent et al., 1992; Laurent and
Carlson, 1992). The exact role of this protein may be to disrupt nucleosomes
and allow the subsequent entry of gene specific transcriptional activators.


RNA (net cpm)
0.400
0.280
D
E
D
E
D
E D
E
E
E
O

O

00
CO LD
in
E
Cf)
O
CO
CO
CM
CM
O)
O) O'
CO

T-
t
CM
CM
tJ- CM
OsJ
CL
CO
CO
CO
CO
CO
IT)
in in
UO
O
LU
CL
Q.
CL
CL
Q-
CL CL
Q.
c
Q.
mm
w
Medium
Plasmid
4 lacZ
4 Actin
PLASMIDS


,e
W09^ovowuoooomvw=ovo^^uvxc^
OOIOOWVO
s
a
6ZV


56
created in such a way as to retain the first codon of CIT1, which was joined in the
proper reading frame to the lacZ gene. After the deletion, these constructs were
sequenced to determine their new adjourning sequences and to be certain that
no other mutations were introduced in this region during the PCR reaction. The
annealing temperature for AL189/190 was 53C and AL205/AL206 was 63C.
The schematic of how transcription was terminated is presented in Figure 3.
Introduction of Stop Codon at the Fifth Amino Acid Position in the CIT1 Gene
To introduce a stop codon at the fifth position on the CIT1 portion of the
CIT1:: lacZ fusion plasmid, the Transformer Site-Directed Mutagenesis Kit
(Clontech) was used as recommended by the manufacturer. Briefly, two primers
were designed called the Selection primer and the Mutagenic primer, to prime
synthesis of a complementary strand by T4 DNA polymerase after initial
denaturation of the template, pSL123R. The selection primer introduced a
mutation at a unique Seal site that converted that recognition site into a new
unique Stul site. This enabled screening of putative mutants easily by digestion
of the putative recombinants with the newly created Stul site. The nicks on the
newly synthesized complementary strand were sealed by T4 DNA ligase. The
ligated DNA was then used to transform an E. coli strain that is deficient in DNA
mismatch repair, a mutS strain. This allowed the amplification of both mutated
and unmutated plasmid. Transformants were grown in LB broth for several
generations, then I isolated plasmid DNA. The pool of DNA obtained was


36
sequenced to determine the exact deleted region. Because the deletions were
made in a pBluescript plasmid, the EcoRI fragment was recloned in the original
yeastIE. coli shuttle plasmid it was obtained, replacing the full-length insert. After
ligation and subsequent transformation, recombinant plasmids were sequenced
to determine their orientation. Four regions were deleted that span -370 to -252,
-245 to -216, -200 to -160, and -370 to -160 (+1 indicates the start site for
transcription). All recombinant plasmids were transformed into S150-2B strain,
and 3-galactosidase activity was determined as described below. The primers
used were AL60/AL61 to delete -200 to-160; MS41/MS42 to delete -245 to -216;
MS43/MS44 to delete -370 to -252; and AL61/MS44 to delete -370 to -160.
Annealing temperature for each primer pair was: 1). AL60/61 at51C, 2).
MS41/MS42 at 47C, 3). MS43/MS44 at 55C, and 4). AL61/MS44 at 51 C.
Heterologous Fusion
To show that sequences upstream of the putative TATA element of C/77
could function as a UAS (upstream activating sequence), a 400 bp EcoRI-EcoRV
fragment from p5-498 was subcloned into plCZ312 (generous gift from Dr.
Meyers). The CIT1 upstream sequences were obtained from pSL123 plasmid
described earlier. The pSL123 plasmid was digested with EcoRI-EcoRV, which
released a 400 bp fragment that contains all of the putative CIT1 UAS and
recovered the DNA by the Spin-Bind method (Costar) after running on a 1 %
agarose gel. This fragment was ligated to plCZ312 plasmid that had been cut


10
and Gal4 by Brent and Ptashne (1985) clearly illustrated that transcriptional
activators such as GAL4 have DNA-binding domains and activator domains, but
other activators such as glucocorticoid receptor and Haplp also have ligand
binding domains that regulate the activators (Picard et al., 1988; Kim et al., 1990;
Chandler et al., 1983).
Many of the DNA-binding domains have identifiable structural motifs
involved in DNA binding. These include the: 1) helix-turn-helix motif (Pabo and
Lewis, 1982; Sauer et al., 1982), 2) zinc-finger domain (Laughon and Gelsteland,
1984), 3) leucine-zipper motif (Landshultz et al., 1988), and 4) (3-sheet motif
(Guarente, 1992). The helix-turn-helix motif is most commonly found among
prokaryotic DNA-binding proteins such as the A Cro and A repressor proteins
(Pabo et al., 1982) and CAP protein (Sauer et al., 1982). The helix-turn-helix
proteins usually have one a-helix followed by a turn, then a second a-helix. The
second helix is usually called the recognition helix because it fits into the major
groove of a B-form DNA, while the first helix seats above the groove. Many
homeotic gene proteins of Drosophila, such as the antennapediaa and engrailed
(McGinnis et al., 1984a; McGinnis et al., 1984b), also have a helix-turn-helix
motif similar to that described above; hence they are commonly referred to as the
homeodomains. Homeotic genes are defined as genes which when mutated
convert one body part into another. Yeast regulatory proteins having similar
structure are the a1 and a1 mating type regulators (Porter and Smith, 1986).
The zinc-finger motif was first discovered in the TFIIIA protein, a Xenopus
5S DNA-binding protein. One unit of zinc-finger motif usually consist of about 30


59
Table 3. Oligonucleotides Used in this Research.
Name
Gene
Position
Sequence 5' to 3'
AL41
CIT1
146 to 165
TGACATTGTCTTGTGGAGCC
AL45
CYC1
GCATGCCATAT GAT CAT GT G
AL60
cm
-216 to -200/-
160 to -151
TAGTATCGGAGTATTTTTTGGTCTAGCGG
G
AL61
cm
-160 to -141
TCCGATACTATCGACTTATC
AL80
cm
78 to 97
GCAATATAATACTATTTACG
AL82
cm
-406 to -388
ATACCTAAACTAATTAAAG
AL83
cm
-251 to -237
CCGGGCGGCTGCGGC
AL84
cm
-245 to-216
GCCGCCCGGAAATGAAAAGTATGACCCC
CG
AL85
cm
-245 to-216
CGGGGGTCATACTTTTCATTTCCGGGCGG
C
AL86
cm
-200 to -160
CTTTTGTGTTATTGGAGGATCGCAATCCC
TTTGGAGCTTTT
AL87
cm
-200 to -160
AAAAGCTCCAAAGGGATTGCGATCCTCCA
ATAACACAAAAG
AL102
cm
-141 to-121
CATTTTCAAACAAGAGGTCGG
AL103
cm
-139 to-111
GACCT CTT GTTT GAAAAT GT CAATT GAT
AL104
cm
-139 to-111
AT C AATT G AC ATTTT C AAAC AAG AG GTC
AL116
cm
-271 to -252
GGAAAAAAACGTGACGCCTT
AL117
cm
-370 to -353
CATTTT CATT GAACGGCT
AL126
cm
-346 to -341/
-371 to -288
ATCTT ITT ITT TTIA I'GTATTACCT
AL127
cm
-360 to -341
AAAGATTAATTGAGCCGTTC
AL128
cm
-340 to -308
GTAAATAT GAGCGTTTTTACGTT CACATT G
CCT


Table 3 continued
60
Name
Gene
Position
Sequence 5' to 3'
AL129
CIT1
-340 to -308
AGGCAATGTGAACGTAAAAACGCTCATAT
TTAC
AL189
CIT1
-1 to -21
G GTTT GTATTTTAGTAAAC AG
AL190
CIT1
-7 to -1/100
to 117
ACAAACCATGTCAGCGATATTATCA
AL191
cm
109 to 128
GATATTAT G AAC AACTAG C A
AL203
Amp
GTGACTGGTGAGGCCTCAACCAAGTC
AL204
cm
100 to 132
GAT GT CAGCGATAT GAT CAACAACTAGCA
AAAG
AL205
cm
86 to 102
CATCTTCGAAATAGTATT
AL206
cm
96 to 103/
178 to 190
CGAAGATGGGGGCGAGCTCGA
MS41
cm
-216 to -197
GCTAGACCAAAAAATACTTT
MS42
cm
-264 to -245/
-216 to-207
TTGGTCTAGCCTGCGGCGGAAAAAAACGT
G
MS43
cm
-252 to -233
CGCCGCAGCCGCCCGGAAAT
MS44
cm
-391 to -370/
-252 to -243
GGCTGCGGCGGGCGAACTTCGGAGATTT
CT


14
product is required for normal levels of transcription by GCN4 and HAP2/3/4
heterotrimeric activators (Georgakopuolus and Thireos, 1992) and is considered
to be an adaptor that may enhance the activity to different activators.
Glucose Repression
When glucose is present in the growth medium, the products of a large
number of genes are severely repressed in S. cerevisiae. These genes include
those necessary for alternative carbon source metabolism (Perlman and Mahler,
1974; Carlson and Bostein, 1982; Denis et al., 1981), gluconeogenesis (Sedivy
and Fraenkel, 1985; Scholer and Schuller, 1994), TCA cycle enzymes (Polakis et
al., 1965; Hoosein and Lewin, 1984; Lombardo et al., 1992; Roy and Dawes,
1987; Repetto and Tzagoloff, 1990), and respiration chain cycle proteins (Polakis
and Bartley, 1965; Perlman and Mahler, 1974; Szekely and Montgomery, 1984;
Mueller and Getz, 1986; Guarente and Mason, 1983; Wright and Poyton, 1990).
The extent of repression varies from about 1000-fold for the GAL genes
(Johnston et al., 1994) to about 5-fold for some genes encoding mitochondrial
proteins (Szekely and Montgomery, 1984).
The phenomenon of repression of many genes when glucose is present in
the growth medium has been observed in some prokaryotes such as E. coli
(Magasanik, 1962) and B. subtilis (Rosenkrantz et al., 1985) and other
eukaryotes such as S. pombe (Hoffman and Winston, 1991). In E. coli, the
repression is mediated by cAMP (Magasanik, 1962). In the presence of glucose,


BIBLIOGRAPHY
Berger, S.L., Pina, B., Silverman, N., Marcus, G.A., Agapite, J., Regier, J.L.,
Triezenberg, S.J., and Guarente, L. (1992). Genetic isolation of ADA2. A
potential transcriptional adaptor required for function of certain acidic activation
domains. Cell 70, 251-265.
Blundel, M., Craig, E., and Kennell, D. (1972). Decay rates of different mRNA in
E. coli and models of decay. Nat. New Biol. 238, 46-49.
Bouvet, P. and Belasco, J.G. (1992). Control of RNase E-mediated RNA
degradation by 5'-terminal base pairing in E. coli. Nature 360, 488-491.
Bowman, S.B., Zaman, Z., Collinson, L.P., Brown, A.J.P., and Dawes, I.W.
(1992). Positive regulation of the LPD1 gene of Saccharomyces cerevisiae by the
HAP2/HAP3/HAP4 activation system. Mol. Gen. Genet. 231, 296-303.
Brand, A.H., Breeden, L., Abraham, J., Sternglanz, R., and Nasmyth, K. (1985).
Characterization of a "Silencer" in yeast: A DNA sequence with properties
opposite to those of a transcriptional enhancer. Cell 41, 41-48.
Braum, R.J., Le, N.F., and Kornberg, R.D. (1986). A GAL family of upstream
activating sequences in yeast: roles in both induction and repression of
transcription. EMBO J. 5, 603-608.
Brent, R. (1985). Repression of transcription in yeast. Cell 42, 3-4.
Brent, R. and Ptashne, M. (1985). A eukaryotic transcriptional activator bearing
the DNA specificity of a prokaryotic repressor. Cell 43, 729-736.
Buratowski, S., Hahn, S., Guarente, L., and Sharp, P.A. (1989). Five intermediate
complexes in transcription initiation by RNA polymerase II. Cell 56, 549-561.
Caponigro, G., Muhlrad, D., and Parker, R. (1993). A small segment of the
MATori transcript promotes mRNA decay in Saccharomyces cerevidiae: A
stimulatory role for rare codons. Mol. Cell. Biol. 13, 5141-5148.
167


Figure 22. Half-life of CIT1::lacZ fusion mRNA from which the 5'
untranslated region (UTR) has been deleted. (A) Schematic representation of
the CIT1::lacZ fusion. The CIT1 sequences present is filled with hatch mark and
the deleted sequence is unfilled. The lacZ sequence is completely filled. (B)
Autoradiogram of Northern gel analysis. Total RNA was isolated from strain
carrying the plasmid that has the 5' UTR deleted. 15 pg of total was separated
as described in Figure 15. The membrane was hybridized simultaneously with
CIT1 and lacZ gene probes. The (+) or (-) sign indicate whether the culture was
maintained in YPE (-) or adjusted to make it YPD (2%) (+). (C) Semi-log plot of
% mRNA remaining as a function of time.


58
Table 1. E. coli Strains.
Name
Genotype
HB101
supE44, ara14, galK2, lacY1, proA2, rpsL20, xyl-5, mtl-1,
recA13, A(mcrC-mrr), HsdS-(r-m-)
C600
e14-(mcrA), supE44, thi-1, thr-1, leuB6, lacY1, tonA21
BMH71-18 mutS
thi, supE, A(lac-proAB), [mutS::Tn10][F'proAB,
laclqZAM15]
XL1-Blue
recA1, endA1, gyrA96, thi-1, hsdR17, supE44, relA1, lac,
[F proAB, laclqZAM15, Tn10(tef)]
SURE
e14-(mcrA), A(mcrCB-hsdSMR-mrr) 171, sbcC, recB, recJ,
umuC::Tn5(kanr), uvrC, supE44, lac.gyrA96,relA1, thi-
1,endA1 [F'proAB, laclqZIAM15,Tn10,(tef)]
Table 2. Yeast Strains.
Name
Genotype
Source
S150-2B
MATa, his3A200, leu2-3, 112, trp1-289, ura3-
52
H. Fukuhara
1-7A
MATa, ade1-100, his4-519, leu2-3, 2-112,
ura3-52
P. Srere
JP16-8B
MATa, ade1-100, ade2, leu2-3, Ieu2-112,
AHAP2::URA3
P. Srere
SHY40
MATa, ade1-100, !eu2-3,2-112, ura3-52,
hap3::HIS4
J. Pinkham
SLF401
MATa, ade1-100, his4-519, leu2-3, 2-112,
ura3-52, hap4::LEU2
L. Guarente
Z118
MATa, ade2, Ieu2-3,112, his3A200, rpb1-1,
ura3-52
R. Young
Z118URA3
MATa, ade2, leu2-3, 112, his3A200, rpb1-1,
ura3-52, trp1::URA3
This work


21
mRNA Stability
The steady-state level of a given species of mRNA is a function of both
the rate of transcription and the rate of decay of the message. Although much is
known about how genes are transcribed and the factors involved, little is known
about how mRNA is targeted for decay and the mechanisms of decay. The
degradation of mRNA provides the cell another level of control and a very
powerful means of gene regulation. The wide difference in the half-life of
different messages (Herrick et al., 1990) would suggest that there are specific
degradation pathways for different messages. Apart from decay of normal
mRNA, aberrant mRNAs, such as unspliced mRNA or those RNA containing
premature termination signals are rapidly removed (Leeds et al., 1991; Peltz et
al., 1993). This is necessary to prevent the assembly of the translational
apparatus on a message that would not produce a productive protein or one that
might even be detrimental to the cell. A wide variety of external and cellular
signals such as oxygen, iron, glucose and light have been shown to affect the
level of mRNA stability (reviewed in Brawerman, 1993). The half-lives of mRNAs
vary greatly in different cell types. In E.coli mRNA half-lives ranges from about
20 seconds to about 50 minutes (Blundel et al., 1972). In yeast, it range from
about 1 minute to almost 100 minutes for some messages (Herrick et al., 1990).
In mammalian cells, mRNA half-life could range anywhere from 15 minutes to
over 24 hours (Gordon et al., 1988; Shyu et al., 1990). Since all mRNAs do not
have the same half-life, there must be features unique to each mRNA or class of


13
mammalian cells and do not function in yeast cells as the acidic activation
domains do.
As stated earlier, one of the hallmarks of enhancers is their ability to
regulate a gene from a distance, sometimes up to 50 kb. The UAS elements in
yeast usually lie within a few hundred bases of the TATA box. The question has
been, how do protein factors that bind to these sequence effect activation? The
current model to explain the ability of trans-factors to activate at a distance is that
DNA sequences between these activators and the basic transcription machinery
"loop-out", allowing protein-protein interaction between these factors (Hofmann et
al., 1989; Ptashne, 1986). Beside the transcriptional activators and proteins of
the basic transcriptional machinery, there are other intermediary factors,
commonly called adaptors, co-activators, or mediators (Kelleher et al., 1990;
Pugh and Tjian, 1990; Berger et al., 1992; Struhl, 1993). These factors do not
usually have DNA-binding domains but carry out their function by direct protein-
protein interaction. Their exact mode of action is not known but is believed to
involve either strengthening the interaction of the activator and the basic
machinery or enabling the specific activators to gain better access to the
chromatin (Berger et al., 1992). One such factor identified is the ADA2 gene
product (Berger et al., 1992). Mutation in this gene suppresses the lethal effect
of the overexpression of Gal4p-VP16 in yeast. The activity of Gal4p-VP16 and
GCN4 activators are reduced in an ada2 mutant, while no effect is exhibited by a
Gal4p-Hap4p activator. This result suggests that these factors are not universal;
rather, they are specific for a particular class of activators. The GCN5 gene


5
There are two classes of transcriptional regulatory elements in eukaryotes,
c/s- and trans-acting elements (Struhl, 1989). The promoter and enchancer
elements of mammalian genes or the upstream activating sequences (UAS) of
yeast genes constitute cis-acting elements. Upstream repressing sequences
(URS) in yeast are also cis-acting elements. The promoter is made up of the
transcriptional initiation site, the TATA sequences and other proximal elements,
such as Sp1 sites (Struhl, 1989). The transcriptional initiation site defines the
first nucleotide incorporated into the newly synthesized mRNA. Many genes
have a single initiation site, but there are some genes that have several initiation
sites, especially in yeast (Fay et al., 1981; Hahn et al., 1985; Repetto and
Tzagoloff, 1990). In yeast, when the distance between the TATA element and
the initiation site is experimentally varied, transcription still starts at defined
positions (Chen and Struhl, 1985). This fact contrasts with mammalian genes in
which changing the position of the TATA element forces the transcription to start
approximately 25-30 bp downstream from the new TATA site. This result would
suggest that the start of mRNA transcription is sequence-dependent in yeast,
whereas it is distance-dependent in mammals. TATA elements are always
situated upstream but near the initiation sites and are found in most class II
transcribed genes. Class II genes constitute those genes that encode proteins
and are transcribed by RNA polymerase II. In yeast, the TATA sequence is
located between 40-120 bp upstream from the start site (Brent, 1985; Chen and
Struhl, 1985). Although the TATA sequence is required for transcription initiation
of most genes, approximately 20% of eukaryotic genes have neither the


8
similarities with the largest subunit of the yeast RNA polymerase III and the p'
subunit of the E. coli RNA polymerase. In yeast, the carboxy terminal domain
(CTD) of Rpb1 p has a set of seven amino acids (PTSPSYS) repeated 26 times.
In the largest subunit of mammalian RNA polymerase II, the CTD is repeated 52
times (Corden et al., 1985). The Rpblp is essential for viability, and deletion of
the CTD is lethal (Nonet et al., 1987). A deletion that left only 11 or 12 of the
repeat units allowed viability but caused a cold-sensitive phenotype (Nonet et al.,
1987). Some of the subunit polypeptides found in RNA polymerase II are shared
by RNA polymerase I and III.
The first factor that binds to the DNA and allows for the formation of a
competent transcription complex is the TFIID. In mammalian cells, TFIID
consists of the TATA-binding protein (TBP) and the TBP-associated factors
(TAFs) whereas in yeast only a single protein, TBP, has been identified to carry
out this function. In a DNase I protection assay in vitro, the TBP protects
approximately 19 bp, suggesting that sequences beyond the TATA element are
necessary for proper functioning (Buratowski et al., 1989). Ironically, TBP alone
is not sufficient to form a DNA/protein complex in a bandshift assay except when
TFIIA is present in the complex (Buratowski et al., 1989). The TBP does not
have any recognizable DNA binding motif, but it has a highly basic C-terminus.
There are two direct repeats at the C-terminus, separated by a stretch of basic
residues. The yeast TBP (yTBP) and the human (hTBP) are functionally
interchangeable in an in vitro transcription assay, but the hTBP cannot
complement a strain deleted for the SPT15 gene which encodes TBP (Gill and


-800
W/-
-800 -600
I I
|
-400
I
-200 + 1^
I I WM
ATG
//
I
-498
I
-245
I
-227
-800
i /x
I
-168
-800 ^
I
I I
-139-1 1 1
-800
I ~
I I
-172 -111
-800 ''
L_~
I I
-217 -111
-i 11
Specific Activity
SD(2%)
897
1 75
42
60
554
397
341
21
~vl
-252
5


55
ethanol at -70C for 30 minutes. Pellet was resuspended in 200 pi water and 500
pi absolute ethanol were added. DNA was precipitated at -70C again for 30
minutes and centrifuged at maximum speed for 15 minutes. The supernatant
was decanted and the pellet rinsed with 1 ml 70% ethanol. The pellet was dried
in a Speed-Vac and resuspended in 5 pi of sequencing dye solution. The sample
was then loaded on a 6% polyacrylamide gel (19:1) and run at 1000 V until the
bromophenol blue had migrated two-thirds of the length of the gel. Control
reactions were performed by digesting naked DNA with DNase I. Sequence
ladder was generated by using the primer that was end labeled in a dideoxy
sequencing reaction. The gel was dried and exposed to X-ray film.
Messenger RNA Stability (51 UTR deletion) Assay
The 5' untranslated region and the coding region on p5-498 plasmids were
individually dissected to determine their effects on the stability of the CIT1:.lacZ
fusion mRNA. I used RCPCR to delete these regions essentially as described
above for the pSL123 plasmid. After the deletion, the EcoRI fragment was
subcloned into p5-498 which was then transformed into yeast strains. I used
primers AL189 and AL190 pair to delete the 5' untranslated region. The first
nucleotide, adenine, of the major transcriptional start site was retained. The rest
of the sequences remained essentially the same. A similar strategy was also
used to delete the coding region present in the CIT1::lacZ fusion. The primers
used were AL205 and AL206 (Table 3). In this construct, the deletion was


24
These stem-loop structures at the 3' UTR are called the iron response element
(IRE) and can bind a protein called the IRE-binding protein (IRE-BP) (Klausner et
al., 1993). The IRE-BP also has aconitase activity. When iron is scarce, the
IRE-BP binds to the IRE of TfR mRNA and increases its half-life. There is also
an uncharacterized sequence called the rapid turnover determinant overlapping
the IRE. Point mutations within the IRE eliminating IRE-BP binding still caused
rapid decay of the mRNA, whereas a deletion mutation removing the IRE-BP
binding site and presumably the rapid turnover determinant slowed the mRNA
decay rate.
The 3' UTR of c-myc and lymphokines and proto-oncogenes contain the
sequence AUUUA, usually repeated several times, referred to as AU-rich
elements (ARE), that cause rapid decay of an mRNA containing it. However,
recent studies by Zubiaga and coworkers (1995) show that the pentanucleotide
AUUUA is not sufficient to confer destabilization upon heterologous mRNA.
Instead a consensus nanonucleotide of UUAUUUAUU is required for the
destabilization phenotype. This sequence, when present in multiple copies,
increases the decay rate.
The mechanism of mRNA decay in eukaryotic cells is beginning to be
elucidated. Parker and coworkers (Muhlrad and Parker, 1992; Decker and
Parker, 1993; Muhlrad et al., 1994) demonstrated that deadenylation of MFA2
mRNA is the first step before decay occurs, for some mRNAs. The
deadenylation occurs in two stages: an initial deadenylation and a terminal
deadenylation. The rate of the initial deadenylation of various mRNAs


Figure 4. (3-Galactosidase Activity of 5' and 3' Deletions in Minimal
Medium. Sections (A) and (B) are as described in Figure 3. p-galactosidase
assays were performed from cultures grown in SD(2%) as described in figure 3.


157
expression were not protected in vivo. Again, the affinity of the interaction
between the DNA and protein will affect the ability to detect any interaction. If the
on-off rate between the protein and DNA is very high, then it is possible for the
DMS to modify any G-residue that may be involved in the interaction, thus
abolishing detection. Alternatively, there may not be G-residues involved in any
of the interactions that are taking place. To explore protein/DNA interaction
further, it will be necessary to treat cells with other reagents that would modify
them in different ways. Towards this goal, I attempted in vivo photo-footprinting
by UV crosslinking the proteins and DNA that interact with each other. The use of
photo-footprinting has the advantage that whatever the dissociation constant
between the protein and DNA, a sufficient exposure time may be found to
crosslink them. I isolated DNA from cells that had been treated and primer
extended using Taq polymerase. The results were inconsistent. Similar
inconsistencies have been reported by other researchers who attribute the
problem to the quality of Taq polymerase that was used (personal
communications, Dr. D. Engelke).
mRNA Stability
Although regulated mRNA instability was initially reported three decades
ago (Gros, et al., 1961), little is known about the mechanism and the factors
involved in this process. I have shown in this study that glucose affects the
stability of CIT1 mRNA. The half-life in a glucose growth medium was



PAGE 1

75$16&5,37,21$/ $1' 326775$16&5,37,21$/ 5(*8/$7,21 2) 7+( &,7 *(1( ,1 6$&&+$520<&(6 &(5(9,6,$( %\ 62%20$%2 /$:621 $ ',66(57$7,21 35(6(17(' 72 7+( *5$'8$7( 6&+22/ 2) 7+( 81,9(56,7< 2) )/25,'$ ,1 3$57,$/ )8/),//0(17 2) 7+( 5(48,5(0(176 )25 7+( '(*5(( 2) '2&725 2) 3+,/2623+< 81,9(56,7< 2) )/25,'$

PAGE 2

, GHGLFDWH WKLV ZRUN WR P\ IDPLO\ HVSHFLDOO\ WR P\ ZLIH DQG EHVW IULHQG $ODUR /DZVRQ :LWKRXW KHU ORYH DQG VXSSRUW LW ZRXOG KDYH EHHQ LPSRVVLEOH IRU PH WR FRPSOHWH WKLV ZRUN 7R P\ FKLOGUHQ %DQLPL DQG (PL ZKR KDG WR GHDO ZLWK P\ PDQ\ DEVHQFHV )LQDOO\ WR P\ SDUHQWV ZKR ODLG WKH IRXQGDWLRQ IRU P\ HGXFDWLRQ

PAGE 3

$&.12:/('*0(176 ZLVK WR WKDQN WKH 8QLYHUVLW\ RI )ORULGD WR KDYH JLYHQ PH WKH RSSRUWXQLW\ WR DWWHQG JUDGXDWH VFKRRO $ VSHFLDO WKDQNV JRHV WR 'U $OIUHG 6 /HZLQ IRU DOORZLQJ PH WR ZRUN LQ KLV ODERUDWRU\ EXW PRUH LPSRUWDQW WKDQ WKDW ZDV KLV JHQXLQH FDUH DQG FRQFHUQ IRU PH DQG DOO RWKHU PHPEHUV RI WKH ODE +LV PHQWRUVKLS KDV EHHQ LQYDOXDEOH DQG VKDOO UHPDLQ SDUW RI P\ VFLHQWLILF FDUHHU WKDQN DOO WKH PHPEHUV RI P\ FRPPLWWHH IRU DFFHSWLQJ WKDW GXW\ DQG JLYLQJ PH WKH JXLGDQFH WR LPSURYH P\ DELOLW\ ZRXOG OLNH WR SD\ VSHFLDO WKDQNV WR 'U +HQU\ 9 %DNHU ZKR ILUVW WDXJKW PH D ORW DERXW \HDVW IRU WKH PDQ\ LQQXPHUDEOH ZD\V KH KDV KHOSHG PH RYHU WKH \HDUV 7R WKH PHPEHUV RI /HZLQnV ODERUDWRU\ WKDQN \RX DOO IRU PDNLQJ P\ VWD\ WKHUH D OLWWOH OHVV WHGLRXV 7R 0U -DPHV 7KRPDV -U WKDQN \RX IRU DOO WKH KHOS \RX KDYH JLYHQ PH 7R 'U /\QQ & 6KDZ WKH 0DFLQWRVK VSHFLDOLVW ZLWKRXW \RXU KHOS LW ZRXOG KDYH EHHQ LPSRVVLEOH WR JHW DOO P\ ILJXUHV UHDG\ LQ WKH ODVW GD\V 7R 0U %UXFH : 5LWFKLQJ WKDQN \RX IRU KHOS HGLWLQJ SDUW RI WKH GLVVHUWDWLRQ 7R P\ IDPLO\ HVSHFLDOO\ P\ ZLIH $ODUR /DZVRQ ZLWKRXW \RX WKLV ZRXOG QRW KDYH EHHQ SRVVLEOH

PAGE 4

7$%/( 2) &217(176 $&.12:/('*0(176 LLL $%675$&7 YL ,1752'8&7,21 8WLOLW\ RI %DNHUnV
PAGE 5

%DQG 6KLIW $VVD\ DQG ,Q 9LWUR )RRWSULQW $QDO\VLV ,Q 9LYR )RRWSULQW $QDO\VLV &,7 P51$ LV 0RUH 6WDEOH LQ &HOOV *URZQ LQ (WKDQRO 7KDQ LQ &HOOV *URZQ LQ *OXFRVH &,7ODF= )XVLRQ P51$ )LDV D 6LPLODU 'HFD\ 5DWH $V )XOO/HQJWK &,7 &,7 P51$ )URP &HOOV *URZQ LQ <3' DQG <3( 0HGLD )ODYH ,GHQWLFDO n 0DWXUH (QGV 7KH *OXFRVH'HSHQGHQW ,QVWDELOLW\ (OHPHQW /LHV :LWKLQ WKH &,7 &RGLQJ 5HJLRQ 6HTXHQFHV :LWKLQ WKH n 7HUPLQXV RI &,7 P51$ &RQIHU 1RQVHQVH0HGLDWHG 'HFD\ 6800$5< $1' ',6&866,21 &VDFWLQJ (OHPHQWV 1XWULHQW 5HTXLUHPHQW RQ WKH ([SUHVVLRQ RI &,7 +$3+$3+$3 ,QGHSHQGHQW ([SUHVVLRQ RI &,7 P51$ 6WDELOLW\ )XWXUH *RDOV %,%/,2*5$3+< %,2*5$3+,&$/ 6.(7&+ Y

PAGE 6

$EVWUDFW RI 'LVVHUWDWLRQ 3UHVHQWHG WR WKH *UDGXDWH 6FKRRO RI WKH 8QLYHUVLW\ RI )ORULGD LQ 3DUWLDO )XOILOOPHQW RI WKH 5HTXLUHPHQWV IRU WKH 'HJUHH RI 'RFWRU RI 3KLORVRSK\ 75$16&5,37,21$/ $1' 326775$16&5,37,21$/ 5(*8/$7,21 2) 7+( &,7 *(1( ,1 6$&&+$520<&(6 &(5(9,6,$( %\ 6RERPDER /DZVRQ 0D\ &KDLUSHUVRQ 'U $OIUHG 6 /HZLQ 0DMRU 'HSDUWPHQW 0ROHFXODU *HQHWLFV DQG 0LFURELRORJ\ &LWUDWH V\QWKDVH FDWDO\]HV WKH FRQGHQVDWLRQ RI R[DORDFHWDWH ZLWK DFHW\O &R$ WR IRUP FLWUDWH D UHDFWLRQ WKDW WDNHV SODFH LQ ERWK WKH WULFDUER[\OLF DFLG F\FOH DQG WKH JO\R[\ODWH SDWKZD\ 7KH WULFDUER[\OLF DFLG F\FOH RFFXUV LQ WKH LQQHU FRPSDUWPHQW RI WKH PLWRFKRQGULRQ ,Q \HDVW 6DFFKDURP\FHV FHUHYLVLDH PLWRFKRQGULDO FLWUDWH V\QWKDVH LV HQFRGHG E\ &,7 D QXFOHDU JHQH 7KLV JHQH OLNH PRVW RWKHU JHQHV HQFRGLQJ PLWRFKRQGULDO HQ]\PHV LV VHYHUHO\ UHSUHVVHG ZKHQ \HDVW LV JURZQ LQ WKH SUHVHQFH RI JOXFRVH 7KHVH JHQHV EHFRPH IXOO\ GHUHSUHVVHG ZKHQ JOXFRVH LV WRWDOO\ XWLOL]HG RU ZKHQ FHOOV DUH JURZQ LQ HWKDQRO D QRQIHUPHQWDEOH FDUERQ VRXUFH 7R XQGHUVWDQG DW ZKDW VWDJH WKLV UHJXODWLRQ RFFXUV H[DPLQHG WUDQVFULSWLRQDO DQG SRVWWUDQVFULSWLRQDO FRQWURO RI &,7 'HOHWLRQV RI WKH n QRQFRGLQJ UHJLRQ RI WKH JHQH LQ D &,7ODF= K\EULG 9,

PAGE 7

LGHQWLILHG VHYHUDO XSVWUHDP DFWLYDWLQJ VHTXHQFHV 8$6Vf WKDW SRVLWLYHO\ DIIHFWHG WKH WUDQVFULSWLRQ RI WKH JHQH 1HDU WKH GLVWDO nf HQG RI WKH LQVHUW WKHUH LV DOVR DQ XSVWUHDP UHSUHVVLQJ VHTXHQFH 856f WKDW DIIHFWV WKH WUDQVFULSWLRQ $QRWKHU 856 HOHPHQW ZDV IRXQG DW WKH SUR[LPDO HQG RI WKH n QRQFRGLQJ UHJLRQ WKDW DIIHFWHG WUDQVFULSWLRQ RQO\ LQ JOXFRVH PHGLXP 7KHVH UHVXOWV VXJJHVW D FRPELQDWRULDO UHJXODWLRQ RI &,7 E\ GLIIHUHQW IDFWRUV LQ D FDUERQ VRXUFH GHSHQGHQW DQG LQGHSHQGHQW PDQQHU $ VHFRQG OHYHO RI FDUERQ VRXUFH GHSHQGHQW FRQWURO ZDV WKH UHJXODWLRQ RI WKH VWDELOLW\ RI WKH P51$ LQ WKH GLIIHUHQW JURZWK PHGLD ,Q HWKDQRO PHGLXP WKH KDOIOLIH RI &,7 P51$ ZDV PRUH WKDQ WZLFH WKDW LQ JOXFRVH PHGLXP 'HOHWLRQ DQDO\VLV VKRZHG WKDW WKH ILUVW QXFOHRWLGHV RI WKH n FRGLQJ UHJLRQ RI WKH P51$ FRQWDLQ D VHTXHQFH HOHPHQW WKDW LV QHFHVVDU\ DQG VXIILFLHQW IRU JOXFRVHGHSHQGHQW P51$ GHJUDGDWLRQ ,QWURGXFWLRQ RI D VWRS FRGRQ DW WKH ILIWK DPLQR DFLG SRVLWLRQ DOVR FDXVHG UDSLG GHJUDGDWLRQ RI WKH K\EULG P51$ VKRZLQJ WKDW LW FRQWDLQHG DOO WKH HOHPHQWV WKDW ZHUH VXIILFLHQW WR FRQIHU QRQVHQVHPHGLDWHG GHFD\ 7KHVH UHVXOWV GHPRQVWUDWH DQ H[DPSOH RI PHWDEROLF UHJXODWLRQ RI JHQH H[SUHVVLRQ RFFXUULQJ DW WZR OHYHOV WUDQVFULSWLRQ DQG P51$ VWDELOLW\ HDFK FRQWULEXWLQJ D SRUWLRQ RI WKH RYHUDOO UHJXODWLRQ YLL

PAGE 8

,1752'8&7,21 8WLOLW\ RI %DNHUnV
PAGE 9

RWKHU LQ LQ YLWUR DVVD\V ,Q YLYR VWXGLHV KDYH VKRZQ WKDW -81 FDQ FRPSOHPHQW D JFQ PXWDWLRQ LQ \HDVW 6WUXKO f
PAGE 10

IUDFWLRQ VXJJHVWLQJ WKDW WKHUH PD\ EH D FU\SWLF PLWRFKRQGULRQ WDUJHWLQJ VHTXHQFH LQ WKH &LWS 5LFNH\ DQG /HZLQ 5RVHQNUDQW] HW DO f 7KH DFWLYLW\ RI &LW S LV VHYHUHO\ UHSUHVVHG ZKHQ FHOOV DUH JURZQ LQ D JOXFRVH PHGLXP :KHQ JOXFRVH LV GHSOHWHG RU ZKHQ FHOOV DUH JURZQ LQ D QRQIHUPHQWDEOH FDUERQ VRXUFH WKH HQ]\PH OHYHO LQFUHDVHV GHUHSUHVVLRQf +RRVHLQ DQG /HZLQ f 7KLV LQFUHDVH LQ HQ]\PH DFWLYLW\ GHUHSUHVVLRQf FRUUHODWHV ZLWK DQ LQFUHDVH LQ VWHDG\VWDWH P51$ OHYHOV .LP HW DO f DQG D JUHDWHU DPRXQW RI WUDQVODWDEOH P51$ +RRVHLQ DQG /HZLQ f 7KH DSSHDUDQFH RI LQFUHDVHG P51$ LQ WKH GHUHSUHVVHG VWDWH VXJJHVWHG WKDW UHJXODWLRQ RI WKH &,7 JHQH PD\ RFFXU DW WKH WUDQVFULSWLRQDO OHYHO 7KH RWKHU SRVVLELOLW\ LV WKDW WKH LQFUHDVH FRXOG EH GXH WR LQFUHDVHG VWDELOLW\ RI WKH PHVVDJH 'LIIHUHQWLDO VWDELOLW\ RI P51$ GXH WR HQYLURQPHQWDO RU FHOOXODU VLJQDOV KDV EHHQ GHPRQVWUDWHG IRU RWKHU PHVVDJHV HQFRGHG E\ 63 63 DQG 63 JHQHV UHTXLUHG IRU VSRUXODWLRQf RI \HDVW 6XURVN\ DQG (VSRVLWR 6XURVN\ HW DO f LQWHUOHXNLQ ,/f :RGQDU)LOLSRZLF] DQG 0RURQL f DQG ( P51$ ZKLFK HQFRGHV DQ LQIODPPDWRU\ PHGLDWRU 6WRHFNOH DQG +DQDIXVD f 7KH 632 WUDQVFULSWV DUH PXFK OHVV VWDEOH LQ YHJHWDWLYH JURZWK WKDQ WKH\ DUH ZKHQ FHOOV DUH LQ PHLRVLV 7KH ,/ DQG ( P51$V DUH PDGH PRUH VWDEOH E\ FDOFLXP LRQRSKRUHV DQG VHUXP UHVSHFWLYHO\ :RGQDU)LOLSRZLF] DQG 0RURQL 6WRHFNOH DQG +DQDIXVD f 2XU JRDO LV WR GLVVHFW KRZ WKH &,7 JHQH LV UHJXODWHG DW ERWK WKH WUDQVFULSWLRQDO DQG P51$ VWDELOLW\ OHYHO 6LQFH OLWWOH LV NQRZQ DERXW WKH PHFKDQLVP RI P51$ GHFD\ ZH KRSH WKDW WKH UHVXOWV RI WKLV VWXG\ PD\ JLYH XV

PAGE 11

DQ LQVLJKW DERXW WKH FLV DQG WUDQV HOHPHQWV WKDW DUH LQYROYHG LQ PHVVHQJHU 51$ GHJUDGDWLRQ 7KH &,7 JHQH ZDV FKRVHQ DV D PRGHO WR VWXG\ JHQH UHJXODWLRQ EHFDXVH RI LWV VWUDWHJLF SRVLWLRQ LQ FHOOXODU PHWDEROLVP $V VWDWHG HDUOLHU FHOOXODU UHVSLUDWLRQ UHTXLUHV FLWUDWH V\QWKDVH EHFDXVH LW FDWDO\]HV WKH ILUVW VWHS LQ WKH 7&$ F\FOH 7KH UHDFWLRQV RI WKH 7&$ F\FOH DUH UHTXLUHG WR JHQHUDWH WKH UHGXFLQJ SRZHU QHHGHG LQ WKH HOHFWURQ WUDQVSRUW FKDLQ ZKLFK UHGXFHV PROHFXODU DQG LV FRXSOHG WR WKH SURGXFWLRQ RI $73 &DUERQ VNHOHWRQV DUH DOVR JHQHUDWHG IURP WKH UHDFWLRQV RI WKH 7&$ F\FOH IRU DPLQR DFLG ELRV\QWKHVLV 7KH ILUVW LQGLFDWLRQ RI XQLTXH UHJXODWLRQ RI FLWUDWH V\QWKDVH FDPH IURP WKH ZRUN RI 6DWUXVWHJXL DQG 0DFKDGR f ZKR VKRZHG WKDW LQGXFWLRQ ZDV QRW LQKLELWHG E\ F\FORKH[LPLGH IROORZLQJ DHUDWLRQ RI DQ DQDHURELF FXOWXUH 7KLV REVHUYDWLRQ VXJJHVWHG WKDW WKH SUHFXUVRU IRU FLWUDWH V\QWKDVH ZDV DOUHDG\ SUHVHQW LQ FXOWXUHV JURZLQJ XQGHU UHSUHVVHG JURZWK FRQGLWLRQV DQG LQGXFWLRQ GRHV QRW UHTXLUH GH QRYR SURWHLQ V\QWKHVLV 8QGHUVWDQGLQJ KRZ WKLV JHQH LV UHJXODWHG GLIIHUHQWO\ IURP WKH UHODWHG &,7 JHQH PD\ VHUYH DV D SDUDGLJP DV WR KRZ FHOOV FDQ UHJXODWH JHQHV VHUYLQJ WKH VDPH IXQFWLRQ LQ GLIIHUHQW FHOOXODU ORFDWLRQV 7UDQVFULSWLRQDO 5HJXODWLRQ LQ (XNDU\RWHV 7KH H[SUHVVLRQ RI PDQ\ JHQHV LV FRQWUROOHG DW WKH OHYHO RI WUDQVFULSWLRQ )RU WKLV UHDVRQ XQGHUVWDQGLQJ KRZ JHQHV DUH WUDQVFULSWLRQDOO\ UHJXODWHG LV RQH RI WKH IXQGDPHQWDO JRDOV LQ PROHFXODU ELRORJ\

PAGE 12

7KHUH DUH WZR FODVVHV RI WUDQVFULSWLRQDO UHJXODWRU\ HOHPHQWV LQ HXNDU\RWHV FV DQG WUDQVDFWLQJ HOHPHQWV 6WUXKO f 7KH SURPRWHU DQG HQFKDQFHU HOHPHQWV RI PDPPDOLDQ JHQHV RU WKH XSVWUHDP DFWLYDWLQJ VHTXHQFHV 8$6f RI \HDVW JHQHV FRQVWLWXWH FLVDFWLQJ HOHPHQWV 8SVWUHDP UHSUHVVLQJ VHTXHQFHV 856f LQ \HDVW DUH DOVR FLVDFWLQJ HOHPHQWV 7KH SURPRWHU LV PDGH XS RI WKH WUDQVFULSWLRQDO LQLWLDWLRQ VLWH WKH 7$7$ VHTXHQFHV DQG RWKHU SUR[LPDO HOHPHQWV VXFK DV 6S VLWHV 6WUXKO f 7KH WUDQVFULSWLRQDO LQLWLDWLRQ VLWH GHILQHV WKH ILUVW QXFOHRWLGH LQFRUSRUDWHG LQWR WKH QHZO\ V\QWKHVL]HG P51$ 0DQ\ JHQHV KDYH D VLQJOH LQLWLDWLRQ VLWH EXW WKHUH DUH VRPH JHQHV WKDW KDYH VHYHUDO LQLWLDWLRQ VLWHV HVSHFLDOO\ LQ \HDVW )D\ HW DO +DKQ HW DO 5HSHWWR DQG 7]DJRORII f ,Q \HDVW ZKHQ WKH GLVWDQFH EHWZHHQ WKH 7$7$ HOHPHQW DQG WKH LQLWLDWLRQ VLWH LV H[SHULPHQWDOO\ YDULHG WUDQVFULSWLRQ VWLOO VWDUWV DW GHILQHG SRVLWLRQV &KHQ DQG 6WUXKO f 7KLV IDFW FRQWUDVWV ZLWK PDPPDOLDQ JHQHV LQ ZKLFK FKDQJLQJ WKH SRVLWLRQ RI WKH 7$7$ HOHPHQW IRUFHV WKH WUDQVFULSWLRQ WR VWDUW DSSUR[LPDWHO\ ES GRZQVWUHDP IURP WKH QHZ 7$7$ VLWH 7KLV UHVXOW ZRXOG VXJJHVW WKDW WKH VWDUW RI P51$ WUDQVFULSWLRQ LV VHTXHQFHGHSHQGHQW LQ \HDVW ZKHUHDV LW LV GLVWDQFHGHSHQGHQW LQ PDPPDOV 7$7$ HOHPHQWV DUH DOZD\V VLWXDWHG XSVWUHDP EXW QHDU WKH LQLWLDWLRQ VLWHV DQG DUH IRXQG LQ PRVW FODVV ,, WUDQVFULEHG JHQHV &ODVV ,, JHQHV FRQVWLWXWH WKRVH JHQHV WKDW HQFRGH SURWHLQV DQG DUH WUDQVFULEHG E\ 51$ SRO\PHUDVH ,, ,Q \HDVW WKH 7$7$ VHTXHQFH LV ORFDWHG EHWZHHQ ES XSVWUHDP IURP WKH VWDUW VLWH %UHQW &KHQ DQG 6WUXKO f $OWKRXJK WKH 7$7$ VHTXHQFH LV UHTXLUHG IRU WUDQVFULSWLRQ LQLWLDWLRQ RI PRVW JHQHV DSSUR[LPDWHO\ b RI HXNDU\RWLF JHQHV KDYH QHLWKHU WKH

PAGE 13

FRQVHUYHG FODVVLFDO 7$7$$$ VHTXHQFH QRU LV LW UHTXLUHG IRU WUDQVFULSWLRQ LQLWLDWLRQ 7KH 3*. JHQH RI \HDVW DQG WKH WHUPLQDO GHR[\WUDQVIHUDVH JHQH RI PDPPDOLDQ FHOOV DUH H[DPSOHV RI JHQHV WKDW GR QRW UHTXLUH D 7$7$ VHTXHQFH 2JGHQ HW DO f 7KLV PHDQV WKDW WKHUH DUH RWKHU FVHOHPHQWV QHFHVVDU\ IRU WUDQVFULSWLRQ LQLWLDWLRQ ZKLFK KDYH \HW WR GHILQHG 7KHUH DUH DOVR GLIIHUHQW FODVVHV RI WKH 7$7$ VHTXHQFH 7KH +,6 JHQH FRQWDLQV D 7$7$ HOHPHQW WKDW LV LQYROYHG RQO\ LQ FRQVWLWXWLYH WUDQVFULSWLRQ 7Ff DQG DQRWKHU 7$7$ VHTXHQFH WKDW LV LQYROYHG LQ UHJXODWHG H[SUHVVLRQ 75f +DUEXU\ DQG 6WUXKO &KHQ DQG 6WUXKO f 7KH ZRUN RI &KHQ DQG 6WUXKO f VKRZHG WKDW VHTXHQFHV GRZQVWUHDP RI WKH 7$7$ HOHPHQWV DUH DOVR LPSRUWDQW IRU SURSHU WUDQVFULSWLRQ LQLWLDWLRQ VLQFH PXWDWLRQV VXUURXQGLQJ WKH VWDUW VLWH PRYH WKH VLWH WR D GLIIHUHQW ORFDWLRQ 0XWDWLRQV DW FHUWDLQ SRVLWLRQV LQ WKH VHTXHQFH 7$7$$$ GLVFULPLQDWHG EHWZHHQ WKH *&1 DQG *$/ DV WUDQVFULSWLRQDO DFWLYDWRUV VXJJHVWLQJ WKDW WKH PHFKDQLVPV RI DFWLYDWLRQ RU WKH DFFHVVRU\ IDFWRUV UHTXLUHG IRU DFWLYDWLRQ DUH GLIIHUHQW IRU WKH YDULRXV DFWLYDWRUV 7KH EDVLF WUDQVFULSWLRQDO PDFKLQHU\ SURWHLQV LQFOXGLQJ 51$ SRO\PHUDVH ,, DQG 7),,$ WKURXJK ) ELQG WR WKH 7$7$ VHTXHQFH LQ D VHTXHQWLDO PDQQHU WR LQLWLDWH WUDQVFULSWLRQ %XUDWRZVNL HW DO f (QKDQFHUV DUH VHTXHQFHV WKDW LQFUHDVH WKH WUDQVFULSWLRQ RI JHQHV ZKHQ ERXQG WR WKHLU FRJQDWH IDFWRUV '\QDQ f 7KH\ PD\ EH VLWXDWHG XS WR NE IURP WKH LQLWLDWLRQ VLWH DQG VWLOO DIIHFW WUDQVFULSWLRQ LQ HLWKHU RULHQWDWLRQ DQG FDQ IXQFWLRQ ZKHWKHU SUHVHQW XSVWUHDP RU GRZQVWUHDP IURP WKH WUDQVFULSWLRQ XQLW (QKDQFHUV DUH PRGXODU LQ QDWXUH PDGH XS RI LGHQWLFDO RU D PL[WXUH RI GLIIHUHQW HQKDQVRQ HOHPHQWV WKDW XVXDOO\ ZRUN V\QHUJLVWLFDOO\ '\QDQ f (QKDQVRQ LV

PAGE 14

GHILQHG DV WKH PLQLPXP GLVFUHWH VHTXHQFH WKDW ELQGV WR D WUDQVFULSWLRQDO IDFWRU
PAGE 15

VLPLODULWLHV ZLWK WKH ODUJHVW VXEXQLW RI WKH \HDVW 51$ SRO\PHUDVH ,,, DQG WKH Sn VXEXQLW RI WKH ( FROL 51$ SRO\PHUDVH ,Q \HDVW WKH FDUER[\ WHUPLQDO GRPDLQ &7'f RI 5SE S KDV D VHW RI VHYHQ DPLQR DFLGV 37636<6f UHSHDWHG WLPHV ,Q WKH ODUJHVW VXEXQLW RI PDPPDOLDQ 51$ SRO\PHUDVH ,, WKH &7' LV UHSHDWHG WLPHV &RUGHQ HW DO f 7KH 5SEOS LV HVVHQWLDO IRU YLDELOLW\ DQG GHOHWLRQ RI WKH &7' LV OHWKDO 1RQHW HW DO f $ GHOHWLRQ WKDW OHIW RQO\ RU RI WKH UHSHDW XQLWV DOORZHG YLDELOLW\ EXW FDXVHG D FROGVHQVLWLYH SKHQRW\SH 1RQHW HW DO f 6RPH RI WKH VXEXQLW SRO\SHSWLGHV IRXQG LQ 51$ SRO\PHUDVH ,, DUH VKDUHG E\ 51$ SRO\PHUDVH DQG ,,, 7KH ILUVW IDFWRU WKDW ELQGV WR WKH '1$ DQG DOORZV IRU WKH IRUPDWLRQ RI D FRPSHWHQW WUDQVFULSWLRQ FRPSOH[ LV WKH 7),,' ,Q PDPPDOLDQ FHOOV 7),,' FRQVLVWV RI WKH 7$7$ELQGLQJ SURWHLQ 7%3f DQG WKH 7%3DVVRFLDWHG IDFWRUV 7$)Vf ZKHUHDV LQ \HDVW RQO\ D VLQJOH SURWHLQ 7%3 KDV EHHQ LGHQWLILHG WR FDUU\ RXW WKLV IXQFWLRQ ,Q D '1DVH SURWHFWLRQ DVVD\ LQ YLWUR WKH 7%3 SURWHFWV DSSUR[LPDWHO\ ES VXJJHVWLQJ WKDW VHTXHQFHV EH\RQG WKH 7$7$ HOHPHQW DUH QHFHVVDU\ IRU SURSHU IXQFWLRQLQJ %XUDWRZVNL HW DO f ,URQLFDOO\ 7%3 DORQH LV QRW VXIILFLHQW WR IRUP D '1$SURWHLQ FRPSOH[ LQ D EDQGVKLIW DVVD\ H[FHSW ZKHQ 7),,$ LV SUHVHQW LQ WKH FRPSOH[ %XUDWRZVNL HW DO f 7KH 7%3 GRHV QRW KDYH DQ\ UHFRJQL]DEOH '1$ ELQGLQJ PRWLI EXW LW KDV D KLJKO\ EDVLF &WHUPLQXV 7KHUH DUH WZR GLUHFW UHSHDWV DW WKH &WHUPLQXV VHSDUDWHG E\ D VWUHWFK RI EDVLF UHVLGXHV 7KH \HDVW 7%3 \7%3f DQG WKH KXPDQ K7%3f DUH IXQFWLRQDOO\ LQWHUFKDQJHDEOH LQ DQ LQ YLWUR WUDQVFULSWLRQ DVVD\ EXW WKH K7%3 FDQQRW FRPSOHPHQW D VWUDLQ GHOHWHG IRU WKH 637 JHQH ZKLFK HQFRGHV 7%3 *LOO DQG

PAGE 16

7MLDQ &RUPDFN HW DO f &HOO YLDELOLW\ FRXOG EH UHVWRUHG E\ D K\EULG SURWHLQ LI WKH &WHUPLQDO GRPDLQ ZDV GHULYHG IURP \HDVW &RUPDFN HW DO f 7KLV ZRXOG VXJJHVW WKDW WKH VSHFLHV VSHFLILFLW\ GHWHUPLQDQWV OLH LQ WKLV UHJLRQ 7R GHWHUPLQH WKH H[DFW DPLQR DFLGVVf UHVSRQVLEOH IRU WKH VSHFLHV VSHFLILFLW\ &RUPDFN HW DO f VHOHFWHG IRU D K7%3\7%3 K\EULG SURWHLQ ZKLFK FRXOG VXSSRUW IDVWHU \HDVW JURZWK 7KH VWDUWLQJ K\EULG FRQWDLQHG D KXPDQ &WHUPLQDO GRPDLQ ZKLFK KDG EHHQ VKRZQ WR VXSSRUW JURZWK DW D YHU\ VORZ SDFH 7KLV VHOHFWLRQ LGHQWLILHG WKUHH LQGHSHQGHQW PXWDQWV WKDW FKDQJHG DUJLQLQH WR O\VLQH ,QWHUHVWLQJO\ O\VLQH RFFXSLHV DQ LGHQWLFDO SRVLWLRQ LQ WKH QDWLYH \7%3 ,Q DGGLWLRQ PXWDWLRQ DW WKLV SRVLWLRQ LQ DQ RWKHUZLVH LQWDFW K7%3 VXSSRUWHG JURZWK RI \HDVW $IWHU WKH LQLWLDO ELQGLQJ E\ 7%3 RWKHU IDFWRUV ELQG WR WKH 7$7$ DQG VXUURXQGLQJ VHTXHQFHV %XUDWRZVNL HW DO f 7KH RUGHU LQ ZKLFK WKH EDVLF WUDQVFULSWLRQ IDFWRUV FRPH LQWR WKH SUHLQLWLDWLRQ FRPSOH[ ZDV VKRZQ E\ EDQGVKLIW DVVD\ WR EH DV IROORZV 7),,' 7),,$ 7),,% 51$ SRO\PHUDVH ,, 7),,( WKHQ 7),,)+ FRPSOH[ %XUDWRZVNL HW DO f $VVHPEO\ RI WKHVH IDFWRUV IRUPV WKH SUHLQLWLDWLRQ FRPSOH[ 7UDQVLWLRQ WR WKH LQLWLDWLRQ SKDVH LV SUHFHGHG E\ SKRVSKRU\ODWLRQ RI WKH &7' RI SRO\PHUDVH ,, E\ 7),,+ IDFWRU /X HW DO f 2WKHU IDFWRUV SOD\LQJ VLJQLILFDQW UROHV LQ WUDQVFULSWLRQDO UHJXODWLRQ RI JHQHV LQFOXGH DFWLYDWLQJ UHSUHVVLQJ DQG LQGXFLQJ IDFWRUV 6WUXKO *XDUHQWH f 7KHVH IDFWRUV DUH UHTXLUHG IRU SURSHU UHJXODWLRQ RI LQGLYLGXDO JHQHV 7KH PRVW VWXGLHG RI WKHVH VHFRQGDU\ IDFWRUV DUH WKH DFWLYDWRU SURWHLQV 7KHVH SURWHLQV XVXDOO\ KDYH D PRGXODU VWUXFWXUH HDFK RQH RI WKH PRGXOHV EHLQJ FDSDEOH RI IXQFWLRQLQJ LQGHSHQGHQWO\ 7KH GRPDLQ VZDS H[SHULPHQW ZLWK /H[$

PAGE 17

DQG *DO E\ %UHQW DQG 3WDVKQH f FOHDUO\ LOOXVWUDWHG WKDW WUDQVFULSWLRQDO DFWLYDWRUV VXFK DV *$/ KDYH '1$ELQGLQJ GRPDLQV DQG DFWLYDWRU GRPDLQV EXW RWKHU DFWLYDWRUV VXFK DV JOXFRFRUWLFRLG UHFHSWRU DQG +DSOS DOVR KDYH OLJDQG ELQGLQJ GRPDLQV WKDW UHJXODWH WKH DFWLYDWRUV 3LFDUG HW DO .LP HW DO &KDQGOHU HW DO f 0DQ\ RI WKH '1$ELQGLQJ GRPDLQV KDYH LGHQWLILDEOH VWUXFWXUDO PRWLIV LQYROYHG LQ '1$ ELQGLQJ 7KHVH LQFOXGH WKH f KHOL[WXUQKHOL[ PRWLI 3DER DQG /HZLV 6DXHU HW DO f f ]LQFILQJHU GRPDLQ /DXJKRQ DQG *HOVWHODQG f f OHXFLQH]LSSHU PRWLI /DQGVKXOW] HW DO f DQG f VKHHW PRWLI *XDUHQWH f 7KH KHOL[WXUQKHOL[ PRWLI LV PRVW FRPPRQO\ IRXQG DPRQJ SURNDU\RWLF '1$ELQGLQJ SURWHLQV VXFK DV WKH $ &UR DQG $ UHSUHVVRU SURWHLQV 3DER HW DO f DQG &$3 SURWHLQ 6DXHU HW DO f 7KH KHOL[WXUQKHOL[ SURWHLQV XVXDOO\ KDYH RQH DKHOL[ IROORZHG E\ D WXUQ WKHQ D VHFRQG DKHOL[ 7KH VHFRQG KHOL[ LV XVXDOO\ FDOOHG WKH UHFRJQLWLRQ KHOL[ EHFDXVH LW ILWV LQWR WKH PDMRU JURRYH RI D %IRUP '1$ ZKLOH WKH ILUVW KHOL[ VHDWV DERYH WKH JURRYH 0DQ\ KRPHRWLF JHQH SURWHLQV RI 'URVRSKLOD VXFK DV WKH DQWHQQDSHGLDD DQG HQJUDLOHG 0F*LQQLV HW DO D 0F*LQQLV HW DO Ef DOVR KDYH D KHOL[WXUQKHOL[ PRWLI VLPLODU WR WKDW GHVFULEHG DERYH KHQFH WKH\ DUH FRPPRQO\ UHIHUUHG WR DV WKH KRPHRGRPDLQV +RPHRWLF JHQHV DUH GHILQHG DV JHQHV ZKLFK ZKHQ PXWDWHG FRQYHUW RQH ERG\ SDUW LQWR DQRWKHU
PAGE 18

DPLQR DFLG UHVLGXHV FRQWDLQLQJ WKH VHTXHQFH SDWWHUQ &\V;RU&\V;+LV;RU +LV %LQGLQJ RI WKH ]LQF LRQ LV FRRUGLQDWHG E\ WKH F\VWHLQH DQG KLVWLGLQH UHVLGXHV 0LOOHU HW DO f 7KH \HDVW $GU S DQ DFWLYDWRU RI $'+ JHQH DOVR KDV D VHTXHQFH FRPSRVLWLRQ VLPLODU WR WKH ]LQFILQJHU PRWLI ,Q DQRWKHU W\SH RI ]LQFILQJHU WKH LRQ ELQGLQJ LV FRRUGLQDWHG E\ IRXU F\VWHLQH UHVLGXHV LQVWHDG RI F\VWHLQH DQG KLVWLGLQHV 7KH \HDVW UHJXODWRU\ SURWHLQV *DOS DQG +DS S DUH H[DPSOHV RI WKLV FODVV RI ]LQFILQJHU /DXJKRQ DQG *HOVWHODQG 3IHLIHU HW DO E .LP HW DO f 7KH *DOS DFWLYDWHV WKH *$/ DQG JHQHV WKDW DUH UHTXLUHG IRU JDODFWRVH XWLOL]DWLRQ E\ \HDVW %UDXP HW DO f 7KH +DSOS UHJXODWHV VHYHUDO \HDVW JHQHV VXFK DV &<& *XDUHQWH HW DO 3IHLIHU HW DO Df &<& 3IHLIHU HW DO E 3UH]DQW HW DO f &2;$ 7UXHEORRG HW DO f DQG &<7 6FKQHLGHU DQG *XDUHQWH f $Q XQXVXDO SURSHUW\ RI +DSOS LV LWV UHFRJQLWLRQ RI QRQLGHQWLFDO 8$6V 3UH]DQW HW DO f 7KH DIILQLW\ IRU WKH GLIIHUHQW ELQGLQJ VLWHV YDULHV DOORZLQJ IRU IOH[LELOLW\ LQ UHJXODWLRQ 7KH +DSOS UHTXLUHV KHPH IRU DFWLYDWLRQ 3IHLIHU HW DO .LP HW DO f $ WKLUG FRPPRQ FODVV RI ELQGLQJ GRPDLQ LV WKH OHXFLQH]LSSHU IRXQG LQ DFWLYDWRUV VXFK DV *FQS DYLDQ MXQ $3 0\F )RV DQG &(%3 /DQGVKXOW] HW DO f 7KH ]LSSHU UHJLRQ RI WKH SURWHLQ KDV DERXW DPLQR DFLGV DQG D OHXFLQH UHVLGXH DW HYHU\ VHYHQWK SRVLWLRQ 7KLV UHJLRQ RI WKH SURWHLQ LV LQYROYHG LQ GLPHUL]DWLRQ HLWKHU KRPRORJRXV RU KHWHURORJRXV QHFHVVDU\ IRU '1$ ELQGLQJ /RFDWHG 1WHUPLQDO WR WKH ]LSSHU UHJLRQ LV XVXDOO\ D VWUHWFK RI EDVLF UHVLGXHV WKDW DFWXDOO\ ELQGV WR WKH '1$ 7KLV EDVLF UHJLRQ FDQ ELQG WR '1$ E\ LWVHOI LI WKHUH LV

PAGE 19

D GLVXOILGH ERQG DOORZLQJ GLPHUL]DWLRQ $GGLWLRQDOO\ WKHUH DUH RWKHU DFWLYDWRUV ZKLFK GR QRW KDYH DQ HDVLO\ LGHQWLILDEOH '1$ELQGLQJ PRWLI $OO RI WKH WUDQVFULSWLRQDO DFWLYDWRUV DOVR KDYH DQ DFWLYDWLRQ GRPDLQ 3HUKDSV WKH PRVW ZHOO FKDUDFWHUL]HG DFWLYDWLRQ GRPDLQ LV WKH DFLGLF DFWLYDWLRQ GRPDLQ 7KHVH DFWLYDWRU GRPDLQV FRQWDLQ PDQ\ QHJDWLYHO\ FKDUJHG DPLQR DFLGV KHQFH DUH RIWHQ UHIHUUHG WR DV WKH DFLGLFDFWLYDWLRQ GRPDLQV $$'f 6WXGLHV E\ *LQLJHU DQG 3WDVKQH f LQ ZKLFK D V\QWKHWLF SHSWLGH ZDV XVHG ZLWK D SUHGLFWHG DPSKLSDWLF DKHOL[ $+f DQG QHW QHJDWLYH FKDUJH LQ FRQMXQFWLRQ ZLWK WKH *$/ '1$ELQGLQJ GRPDLQ VKRZHG LW ZDV FRPSHWHQW WR DFWLYDWH WUDQVFULSWLRQ LQ YLYR WKRXJK RQO\ ZKHQ RYHUH[SUHVVHG &ORQLQJ RI UDQGRP ROLJRQXFOHRWLGHV IURP ( FROL WKDW FRXOG VXSSRUW DFWLYDWLRQ UHVXOWHG LQ VHTXHQFHV ZLWK QHW QHJDWLYH FKDUJH 0D DQG 3WDVKQH f $ JUDGXDO UHGXFWLRQ LQ DFWLYDWLRQ SRWHQWLDO ZDV REVHUYHG ZKHQ VRPH RI WKHVH DFLGLF UHVLGXHV ZHUH UHPRYHG IURP WKH *FQS +RSH HW DO f 7RJHWKHU WKHVH UHVXOWV VWURQJO\ VXJJHVWHG WKH QHHG IRU DQ DFLGLF DFWLYDWLRQ GRPDLQ +RZHYHU DV UHFHQWO\ VKRZQ /HXWKHU HW DO +R\ HW DO f WKH DELOLW\ WR DFWLYDWH GRHV QRW UHTXLUH DFLGLW\ RU QHW QHJDWLYH FKDUJH 5DWKHU WKH PRVW LPSRUWDQW FULWHULD WR IXQFWLRQ DV DQ DFWLYDWRU ZDV WKH DELOLW\ WR IRUP D 3SOHDWHG VKHHW 5HSODFHPHQW RI WKH QHJDWLYHO\ FKDUJHG UHVLGXHV ZLWK QRQFKDUJHG RU SRVLWLYHO\ FKDUJHG UHVLGXHV ZLOO VWLOO VXSSRUW DFWLYDWLRQ 7KH *DOS DQG *FQS ZHUH VKRZQ WR IRUP D 3VKHHW XQGHU QHDU SK\VLRORJLFDO FRQGLWLRQV +R\ HW DO f 2WKHU GHILQHG DFWLYDWLRQ GRPDLQV LQ PDPPDOLDQ FHOOV DUH ULFK LQ JOXWDPLQH HJ 6S &RXUH\ DQG 7MLDQ f RU SUROLQH DPLQR DFLG UHVLGXHV 7KHVH IDFWRUV DUH XVXDOO\ IRXQG LQ

PAGE 20

PDPPDOLDQ FHOOV DQG GR QRW IXQFWLRQ LQ \HDVW FHOOV DV WKH DFLGLF DFWLYDWLRQ GRPDLQV GR $V VWDWHG HDUOLHU RQH RI WKH KDOOPDUNV RI HQKDQFHUV LV WKHLU DELOLW\ WR UHJXODWH D JHQH IURP D GLVWDQFH VRPHWLPHV XS WR NE 7KH 8$6 HOHPHQWV LQ \HDVW XVXDOO\ OLH ZLWKLQ D IHZ KXQGUHG EDVHV RI WKH 7$7$ ER[ 7KH TXHVWLRQ KDV EHHQ KRZ GR SURWHLQ IDFWRUV WKDW ELQG WR WKHVH VHTXHQFH HIIHFW DFWLYDWLRQ" 7KH FXUUHQW PRGHO WR H[SODLQ WKH DELOLW\ RI WUDQVIDFWRUV WR DFWLYDWH DW D GLVWDQFH LV WKDW '1$ VHTXHQFHV EHWZHHQ WKHVH DFWLYDWRUV DQG WKH EDVLF WUDQVFULSWLRQ PDFKLQHU\ ORRSRXW DOORZLQJ SURWHLQSURWHLQ LQWHUDFWLRQ EHWZHHQ WKHVH IDFWRUV +RIPDQQ HW DO 3WDVKQH f %HVLGH WKH WUDQVFULSWLRQDO DFWLYDWRUV DQG SURWHLQV RI WKH EDVLF WUDQVFULSWLRQDO PDFKLQHU\ WKHUH DUH RWKHU LQWHUPHGLDU\ IDFWRUV FRPPRQO\ FDOOHG DGDSWRUV FRDFWLYDWRUV RU PHGLDWRUV .HOOHKHU HW DO 3XJK DQG 7MLDQ %HUJHU HW DO 6WUXKO f 7KHVH IDFWRUV GR QRW XVXDOO\ KDYH '1$ELQGLQJ GRPDLQV EXW FDUU\ RXW WKHLU IXQFWLRQ E\ GLUHFW SURWHLQ SURWHLQ LQWHUDFWLRQ 7KHLU H[DFW PRGH RI DFWLRQ LV QRW NQRZQ EXW LV EHOLHYHG WR LQYROYH HLWKHU VWUHQJWKHQLQJ WKH LQWHUDFWLRQ RI WKH DFWLYDWRU DQG WKH EDVLF PDFKLQHU\ RU HQDEOLQJ WKH VSHFLILF DFWLYDWRUV WR JDLQ EHWWHU DFFHVV WR WKH FKURPDWLQ %HUJHU HW DO f 2QH VXFK IDFWRU LGHQWLILHG LV WKH $'$ JHQH SURGXFW %HUJHU HW DO f 0XWDWLRQ LQ WKLV JHQH VXSSUHVVHV WKH OHWKDO HIIHFW RI WKH RYHUH[SUHVVLRQ RI *DOS93 LQ \HDVW 7KH DFWLYLW\ RI *DOS93 DQG *&1 DFWLYDWRUV DUH UHGXFHG LQ DQ DGD PXWDQW ZKLOH QR HIIHFW LV H[KLELWHG E\ D *DOS+DSS DFWLYDWRU 7KLV UHVXOW VXJJHVWV WKDW WKHVH IDFWRUV DUH QRW XQLYHUVDO UDWKHU WKH\ DUH VSHFLILF IRU D SDUWLFXODU FODVV RI DFWLYDWRUV 7KH *&1 JHQH

PAGE 21

SURGXFW LV UHTXLUHG IRU QRUPDO OHYHOV RI WUDQVFULSWLRQ E\ *&1 DQG +$3 KHWHURWULPHULF DFWLYDWRUV *HRUJDNRSXROXV DQG 7KLUHRV f DQG LV FRQVLGHUHG WR EH DQ DGDSWRU WKDW PD\ HQKDQFH WKH DFWLYLW\ WR GLIIHUHQW DFWLYDWRUV *OXFRVH 5HSUHVVLRQ :KHQ JOXFRVH LV SUHVHQW LQ WKH JURZWK PHGLXP WKH SURGXFWV RI D ODUJH QXPEHU RI JHQHV DUH VHYHUHO\ UHSUHVVHG LQ 6 FHUHYLVLDH 7KHVH JHQHV LQFOXGH WKRVH QHFHVVDU\ IRU DOWHUQDWLYH FDUERQ VRXUFH PHWDEROLVP 3HUOPDQ DQG 0DKOHU &DUOVRQ DQG %RVWHLQ 'HQLV HW DO f JOXFRQHRJHQHVLV 6HGLY\ DQG )UDHQNHO 6FKROHU DQG 6FKXOOHU f 7&$ F\FOH HQ]\PHV 3RODNLV HW DO +RRVHLQ DQG /HZLQ /RPEDUGR HW DO 5R\ DQG 'DZHV 5HSHWWR DQG 7]DJRORII f DQG UHVSLUDWLRQ FKDLQ F\FOH SURWHLQV 3RODNLV DQG %DUWOH\ 3HUOPDQ DQG 0DKOHU 6]HNHO\ DQG 0RQWJRPHU\ 0XHOOHU DQG *HW] *XDUHQWH DQG 0DVRQ :ULJKW DQG 3R\WRQ f 7KH H[WHQW RI UHSUHVVLRQ YDULHV IURP DERXW IROG IRU WKH *$/ JHQHV -RKQVWRQ HW DO f WR DERXW IROG IRU VRPH JHQHV HQFRGLQJ PLWRFKRQGULDO SURWHLQV 6]HNHO\ DQG 0RQWJRPHU\ f 7KH SKHQRPHQRQ RI UHSUHVVLRQ RI PDQ\ JHQHV ZKHQ JOXFRVH LV SUHVHQW LQ WKH JURZWK PHGLXP KDV EHHQ REVHUYHG LQ VRPH SURNDU\RWHV VXFK DV ( FROL 0DJDVDQLN f DQG % VXEWLOLV 5RVHQNUDQW] HW DO f DQG RWKHU HXNDU\RWHV VXFK DV 6 SRPEH +RIIPDQ DQG :LQVWRQ f ,Q ( FROL WKH UHSUHVVLRQ LV PHGLDWHG E\ F$03 0DJDVDQLN f ,Q WKH SUHVHQFH RI JOXFRVH

PAGE 22

WKH F$03 OHYHO LV VLJQLILFDQWO\ UHGXFHG EXW DIWHU WKH JOXFRVH KDV EHHQ GHSOHWHG WKH OHYHO RI F$03 LQFUHDVHV 7KLV LQFUHDVH IDFLOLWDWHV ELQGLQJ RI F$03 WR FDWDEROLWH DFWLYDWLRQ SURWHLQ &$3f $FWLYDWHG &$3 F$03&$3 ELQGV WR WKH SURPRWHUV RI WKH JOXFRVH UHSUHVVHG JHQHV WR DFWLYDWH WUDQVFULSWLRQ +RZHYHU WKH UROH RI F$03 LQ JOXFRVH UHSUHVVLRQ LQ 6 FHUHYLVLDH LQ QRW DV FOHDU 0DWVXPRWR HW DO f LVRODWHG \HDVW VWUDLQV WKDW UHTXLUHG H[RJHQRXVO\ VXSSOLHG F$03 IRU JURZWK ,Q WKHVH VWUDLQ WKH JDODFWRNLQDVH HQ]\PH HQFRGHG E\ *$/f ZKLFK LV JOXFRVH UHSUHVVLYH ZDV VWLOO GHUHSUHVVHG LQ WKH SUHVHQFH RI KLJK OHYHOV RI F$03 0HDVXUHPHQW RI WKH OHYHO RI F$03 SUHVHQW LQ GLIIHUHQW PHGLD FRQWDLQLQJ JOXFRVH RU RWKHU QRQIHUPHQWDEOH FDUERQ VRXUFHV VKRZHG WKDW WKH OHYHO RI F$03 ZDV KLJKHU LQ WKH GHSUHVVHG VWDWH 7KHVH H[SHULPHQWV VXJJHVW WKDW F$03 PD\ QRW SOD\ DQ\ UROH LQ PHGLDWLQJ WKH HIIHFW RI JOXFRVH &\FOLF $03 LQ HXNDU\RWHV LV SRVWXODWHG WR DFW E\ DFWLYDWLRQ RI SURWHLQ NLQDVHV ZKLFK FRQWURO WKH SKRVSKRU\ODWLRQ RI YDULRXV FULWLFDO SURWHLQV DQG WKHUHE\ PRGXODWH WKH DFWLYLW\ RI WKH SURWHLQV ,I VR F$03 PD\ EH LQYROYHG LQ WKH UHJXODWLRQ RI RQH JOXFRVH UHSUHVVLYH JHQH $'+ 7KH $'+ HQFRGHV DQ LVR]\PH RI DOFRKRO GHK\GURJHQDVH ZKLFK FRQYHUWV HWKDQRO WR DFHWDOGHK\GH LQ WKH HWKDQRO XWLOL]DWLRQ SDWKZD\ 7KH $GUOS HQFRGHG $'5 JHQH LV D SRVLWLYH WUDQVFULSWLRQDO DFWLYDWRU RI $'+ WKDW ELQGV WR 8$6 'HQLV DQG
PAGE 23

$'5&f ZDV LVRODWHG WKDW SDUWLDOO\ UHOLHYHG WKH JOXFRVH UHSUHVVLRQ RI $'+ 7KHVH PXWDQWV DOWHU WKH SKRVSKRU\ODWLRQ VLWH DQG UHGXFH LWV HIILFLHQF\ RI SKRVSKRU\ODWLRQ &KHUU\ HW DO f $OVR ZKHQ WKH UHJXODWRU\ VXEXQLW IRU DGHQ\ODWH FDWDODVH %&
PAGE 24

VLJQLILFDQW GLIIHUHQFH LQ UHSUHVVLQJ DQG GHUHSUHVVLQJ PHGLD $OWKRXJK WKH JHQHWLF HYLGHQFH VWURQJO\ LPSOLFDWHV D UROH IRU F$03 LQ PHGLDWLQJ JOXFRVH UHSUHVVLRQ WKLV HIIHFW PD\ EH LQGLUHFW DW EHVW $PRQJ WKH EHVW VWXGLHG RI WKH JOXFRVH UHSUHVVLEOH JHQHV DUH WKH *$/ *$/ DQG *$/ JHQHV RI 6DFFKDURP\FHV FHUHYLVLDH ZKLFK HQFRGH JDODFWRNLQDVH JDODFWRWUDQVIHUDVH DQG 8'3JDODFWRVH HSLPHUDVH UHVSHFWLYHO\ 7KHVH SURWHLQV DUH UHTXLUHG IRU JDODFWRVH XWLOL]DWLRQ 7KHLU UHJXODWLRQ VKRZV WKDW JOXFRVH PHGLDWHG UHSUHVVLRQ RI JHQHV LV FRPSOH[ DQG RFFXUV DW VHYHUDO OHYHOV 7KH UHJXODWLRQ RI WKH *$/ JHQH IRU H[DPSOH RFFXUV DW WKUHH OHYHOV )LUVW JOXFRVH UHGXFHV WKH OHYHO RI IXQFWLRQDO LQGXFHU JDODFWRVH LQ WKH FHOO E\ UHSUHVVLQJ WUDQVFULSWLRQ RI WKH JDODFWRVH WUDQVSRUWHUJDODFWRVH SHUPHDVH ZKLFK LV HQFRGHG E\ WKH *$/ JHQH %UDXP HW DO 7VFKRSS HW DO f DQG LQDFWLYDWLQJ SUHH[LVWLQJ SHUPHDVH PROHFXOHV WKHUHE\ SUHYHQWLQJ DQ\ WUDQVSRUW RI LQGXFHU LQWR WKH FHOO +RO]HU DQG 0DWHUQ f 7KH UHGXFWLRQ LQ WKH LQGXFHU OHYHOV UHGXFHV IXQFWLRQ RI WKH DFWLYDWRU *DOS 7KH VHFRQG PHFKDQLVP RI JOXFRVH UHSUHVVLRQ RI WKH *$/ JHQHV LQYROYHV LQKLELWLRQ RI WKH WUDQVFULSWLRQDO DFWLYDWRU *DOS )OLFN DQG -RKQVWRQ f 7KH LQKLELWLRQ LV GXH WR UHGXFWLRQ LQ WKH H[SUHVVLRQ RI *$/ -RKQVWRQ HW DO f DQG LQKLELWLRQ RI *DOS IXQFWLRQ E\ WKH LQKLELWRU\ GRPDLQ ,' 7KH LQKLELWRU\ GRPDLQ FRQVWLWXWLYHO\ LQKLELWV WKH WUDQVFULSWLRQ RI D KHWHURORJRXV DFWLYDWRU LQ JOXFRVH DQG JO\FHURO PHGLD +RZHYHU ZKHQ WKH JOXFRVH UHVSRQVH GRPDLQ *5'f LV SUHVHQW DFWLYDWLRQ RFFXUV LQ D JO\FHURO PHGLXP EXW QRW LQ D JOXFRVH PHGLXP 6WRQH DQG 6DGRZVNL f 5HSUHVVLRQ RI WKH *$/ JHQH LV PHGLDWHG E\ WKH 0LJ S ZKLFK ELQGV WR

PAGE 25

856 VHTXHQFHV LQ WKH *$/ SURPRWHU -RKQVWRQ HW DO f 2WKHU WUDQVFULSWLRQDO DFWLYDWRUV WKDW VKDUH VWUXFWXUDO VLPLODULW\ ZLWK WKH *DOS LQFOXGH /HXS =KRX HW DO f 3USOS 6FKPLWW HW DO f 3XWS 0DUF]DN DQG %UDQGLVV f DQG /DFS 6DOPHUQ -U DQG -RKQVWRQ f RI ODFWLV $ WKLUG PHFKDQLVP RI JOXFRVH UHJXODWLRQ LQYROYHV 856 VHTXHQFHV ZKLFK PHGLDWH UHSUHVVLRQ RI JHQHV E\ ELQGLQJ WR UHSUHVVRU SURWHLQV 7KH *$/ JHQH KDV D 856JDO ORFDWHG EHWZHHQ WKH 8$6JDO DQG WKH 7$7$ VHTXHQFH )LQOH\ HW DO )OLFN DQG -RKQVWRQ f 7KH 0LJOS ELQGV WR 856*$/ VHTXHQFHV WR LQKLELW *DOS DFWLYDWLRQ 7KHUH DUH VHYHUDO RWKHU JHQHV WKDW DUH UHTXLUHG IRU JOXFRVH UHJXODWLRQ 7KH\ DUH HLWKHU QHHGHG WR UHOLHYH UHSUHVVLRQ RU WR PDLQWDLQ UHSUHVVLRQ 6WXGLHV E\ 5RVH HW DO f VKRZHG WKDW WKH SURGXFWV RI +;. DQG +;. DUH UHTXLUHG IRU JOXFRVH UHSUHVVLRQ RI PDQ\ JHQHV 7KH JHQH SURGXFWV RI +;. DQG +;. SKRVSKRU\ODWH KH[RVH VXJDUV EXW KRZ WKH\ PHGLDWH WKHLU HIIHFW LV QRW NQRZQ 7KH 61) JHQH HQFRGHV D SURWHLQ NLQDVH WKDW LV UHTXLUHG IRU GHUHSUHVVLRQ RI WKH 68& LQYHUWDVHf JHQH &DOHQ]D DQG &DUOVRQ f 0XWDWLRQ LQ 61) DOVR FDXVHV GHIHFWV LQ GHUHSUHVVLRQ RI 6'+ VXFFLQDWH GHK\GURJHQDVHf ,&/ LVRFLWUDWH O\DVHf DQG 0'+ PDODWH GHK\GURJHQDVHf JHQHV 7KH 61) JHQH LV EHOLHYHG WR H[HUW LWV HIIHFW E\ PRGLI\LQJ WUDQVFULSWLRQDO DFWLYDWRUV WKDW ELQG WR WKH 8$6 RI 68& 7KH WDUJHW IRU WKLV NLQDVH LV SUREDEO\ WKH 6QIS6QIS6QIS FRPSOH[ ZKLFK LV D WUDQVFULSWLRQDO DFWLYDWRU /DXUHQW HW DO /DXUHQW DQG &DUOVRQ f 7KH H[DFW UROH RI WKLV SURWHLQ PD\ EH WR GLVUXSW QXFOHRVRPHV DQG DOORZ WKH VXEVHTXHQW HQWU\ RI JHQH VSHFLILF WUDQVFULSWLRQDO DFWLYDWRUV

PAGE 26

$QRWKHU VHW RI JHQHV WKDW LV UHTXLUHG WR PDLQWDLQ UHSUHVVLRQ DUH 661 DQG 783 JHQHV .HOHKHU HW DO f 7KH\ DUH WUDQVFULSWLRQDO UHSUHVVRUV LQWHUDFWLQJ ZLWK JHQHVSHFLILF IDFWRUV WR PHGLDWH WKHLU HIIHFW ,Q FRQWUDVW WR WKH QHJDWLYH UROHV 661 DQG 783 SOD\ LQ UHJXODWLQJ PDQ\ JOXFRVH UHSUHVVLEOH JHQHV WKH\ KDYH D SRVLWLYH HIIHFW RQ &<& H[SUHVVLRQ YLD WKH +$3 WUDQVFULSWLRQDO DFWLYDWRU =KDQJ DQG *XDUHQWH f $QRWKHU ZHOO FKDUDFWHUL]HG JOXFRVH UHSUHVVLEOH JHQH LV WKH &<& ,W HQFRGHV LVR F\WRFKURPH F ZKLFK LV LQYROYHG LQ WKH HOHFWURQ WUDQVSRUW FKDLQ RI UHVSLUDWLRQ 7KH &<& JHQH KDV WZR 8$6V 8$6 DQG 8$6 5HJXODWLRQ DW 8$6 RFFXUV YLD WKH +DSOS DIWHU LW KDV EHHQ ERXQG E\ KHPH *XDUHQWH HW DO .LP HW DO f *OXFRVH UHJXODWLRQ RI &<& RFFXUV DW WKH 8$6 VLWH WKURXJK D PXOWLVXEXQLW SURWHLQ FDOOHG WKH +DSS+DSS+DSS HQFRGHG E\ +$3 +$3 DQG +$3 JHQHV UHVSHFWLYHO\ *XDUHQWH HW DO 3LQNKDP DQG *XDUHQWH 3LQNKDP HW DO +DKQ DQG *XDUHQWH )RUVEXUJ DQG *XDUHQWH f 0HGLDWLRQ RI JOXFRVH UHSUHVVLRQ RQ &<& H[SUHVVLRQ RFFXUV E\ UHSUHVVLQJ WKH WUDQVFULSWLRQ RI +$3 7KH +DSS KDV WKH DFWLYDWLRQ GRPDLQ RI WKLV PXOWLVXEXQLW FRPSOH[ )RUVEXUJ DQG *XDUHQWH f WKHUHIRUH LQ D JOXFRVH PHGLXP UHGXFHG V\QWKHVLV RI WKLV DFWLYDWRU FDXVHV UHGXFWLRQ RI &<& H[SUHVVLRQ 0XWDWLRQV LQ DQ\ RQH RI WKH JHQHV WKDW HQFRGH WKH WUDQVFULSWLRQDO DFWLYDWRU SURWHLQ UHGXFH WKH H[SUHVVLRQ RI PDQ\ JHQHV LQYROYHG LQ WKH .UHEV &\FOH VXFK DV WKH JHQHV HQFRGLQJ OLSRDPLGH GHK\GURJHQDVH %RZPDQ HW DO f DFRQLWDVH *DQJORII HW DO f DQG GLK\GUROLSR\O WUDQVVXFFLQ\ODVH 5HSHWWR DQG 7]DJRORII f 7KHVH JHQHV DOVR KDYH WKH FRQVHQVXV ELQGLQJ

PAGE 27

VLWH IRU WKH +DSS+DSS+DSS FRPSOH[ 7KH &,7 JHQH DOVR KDV WKH FRQVHQVXV ELQGLQJ VLWH IRU WKLV DFWLYDWRU EXW GHOHWLRQ RI WKLV VHTXHQFH RU PXWDWLRQ RI DQ\ RQH JHQH HQFRGLQJ WKH SURWHLQV GRHV QRW VHYHUHO\ LPSDFW H[SUHVVLRQ WKLV VWXG\f 2WKHU PLWRFKRQGULDO JHQHV DOVR NQRZQ WR EH UHJXODWHG E\ WKLV WUDQVFULSWLRQDO DFWLYDWRU FRPSOH[ LQFOXGH &2;$ 7UXHEORRG HW DO f &2; 7UDZLFN HW DO 7UDZLFN HW DO f DQG +(0 .HQJ DQG *XDUHQWH f 7KH &2;$ DQG &2; JHQHV HQFRGH VXEXQLWV 9D DQG 9, UHVSHFWLYHO\ RI F\WRFKURPH F R[LGDVH DQG +(0 HQFRGHV DPLQROXYLOLQDWH V\QWKDVH 7KH RWKHU LQWHUHVWLQJ IHDWXUH DERXW WKH FRQVHQVXV ELQGLQJ VLWH IRU WKH +DSS+DSS+DSS LV WKH SUHVHQFH RI WKH &&$$7ER[ VHTXHQFH DW WKH FRUH RI WKH FRQVHQVXV VHTXHQFH 7KLV VHTXHQFH LV DOVR SUHVHQW LQ PDQ\ PDPPDOLDQ SURPRWHUV DQG IXQFWLRQV DV SURPRWHU 7KH &&$$7ER[ DOVR ELQGV D PXOWLVXEXQLW DFWLYDWRU &3$ DQG &3% &KRGRVK HW DO D Ef 8VLQJ EDQGVKLIW DVVD\ DQG '1DVH SURWHFWLRQ DVVD\V &KRGRVK HW DO Ef VKRZHG WKDW WKH +DS SURWHLQV DQG &3 SURWHLQV ELQG WR DQG SURWHFW VLPLODU '1$ VHTXHQFHV ,Q D EDQGVKLIW DVVD\ WKH\ VKRZHG WKDW +DSS FDQ VXEVWLWXWH IRU &3% DQG +DSS FDQ VXEVWLWXWH IRU &3$ LQ ELQGLQJ '1$ DW HDFK FRJQDWH VHTXHQFH $OWKRXJK WKHVH WZR VHWV RI SURWHLQV KDYH HYROYHG WR UHJXODWH GLIIHUHQW DFWLYLWLHV WKH\ VWLOO ELQG VLPLODU '1$ VHTXHQFHV DQG FDQ FRPSOHPHQW HDFK RWKHU

PAGE 28

P51$ 6WDELOLW\ 7KH VWHDG\VWDWH OHYHO RI D JLYHQ VSHFLHV RI P51$ LV D IXQFWLRQ RI ERWK WKH UDWH RI WUDQVFULSWLRQ DQG WKH UDWH RI GHFD\ RI WKH PHVVDJH $OWKRXJK PXFK LV NQRZQ DERXW KRZ JHQHV DUH WUDQVFULEHG DQG WKH IDFWRUV LQYROYHG OLWWOH LV NQRZQ DERXW KRZ P51$ LV WDUJHWHG IRU GHFD\ DQG WKH PHFKDQLVPV RI GHFD\ 7KH GHJUDGDWLRQ RI P51$ SURYLGHV WKH FHOO DQRWKHU OHYHO RI FRQWURO DQG D YHU\ SRZHUIXO PHDQV RI JHQH UHJXODWLRQ 7KH ZLGH GLIIHUHQFH LQ WKH KDOIOLIH RI GLIIHUHQW PHVVDJHV +HUULFN HW DO f ZRXOG VXJJHVW WKDW WKHUH DUH VSHFLILF GHJUDGDWLRQ SDWKZD\V IRU GLIIHUHQW PHVVDJHV $SDUW IURP GHFD\ RI QRUPDO P51$ DEHUUDQW P51$V VXFK DV XQVSOLFHG P51$ RU WKRVH 51$ FRQWDLQLQJ SUHPDWXUH WHUPLQDWLRQ VLJQDOV DUH UDSLGO\ UHPRYHG /HHGV HW DO 3HOW] HW DO f 7KLV LV QHFHVVDU\ WR SUHYHQW WKH DVVHPEO\ RI WKH WUDQVODWLRQDO DSSDUDWXV RQ D PHVVDJH WKDW ZRXOG QRW SURGXFH D SURGXFWLYH SURWHLQ RU RQH WKDW PLJKW HYHQ EH GHWULPHQWDO WR WKH FHOO $ ZLGH YDULHW\ RI H[WHUQDO DQG FHOOXODU VLJQDOV VXFK DV R[\JHQ LURQ JOXFRVH DQG OLJKW KDYH EHHQ VKRZQ WR DIIHFW WKH OHYHO RI P51$ VWDELOLW\ UHYLHZHG LQ %UDZHUPDQ f 7KH KDOIOLYHV RI P51$V YDU\ JUHDWO\ LQ GLIIHUHQW FHOO W\SHV ,Q (FROL P51$ KDOIOLYHV UDQJHV IURP DERXW VHFRQGV WR DERXW PLQXWHV %OXQGHO HW DO f ,Q \HDVW LW UDQJH IURP DERXW PLQXWH WR DOPRVW PLQXWHV IRU VRPH PHVVDJHV +HUULFN HW DO f ,Q PDPPDOLDQ FHOOV P51$ KDOIOLIH FRXOG UDQJH DQ\ZKHUH IURP PLQXWHV WR RYHU KRXUV *RUGRQ HW DO 6K\X HW DO f 6LQFH DOO P51$V GR QRW KDYH WKH VDPH KDOIOLIH WKHUH PXVW EH IHDWXUHV XQLTXH WR HDFK P51$ RU FODVV RI

PAGE 29

P51$ WKDW FDXVHV WKHP WR IROORZ D SDUWLFXODU SDWKZD\ IRU GHFD\ WKLV IHDWXUH PD\ FRQVWLWXWH D FVHOHPHQWVf LQKHUHQW LQ HDFK P51$ 7KH VHDUFK IRU FLV HOHPHQWV WKDW DUH LQYROYHG LQ UHJXODWLQJ WKH GHFD\ RI P51$ KDV VR IDU UHYHDOHG VHTXHQFHV WKDW XVXDOO\ FRQIHU LQVWDELOLW\ UDWKHU WKDQ VWDELOLW\ +HDWRQ HW DO f 1R VHTXHQFH KDV \HW EHHQ VKRZQ WR FRQIHU LQFUHDVHG VWDELOLW\ 7KH VWUXFWXUDO GHWHUPLQDQWV IRU P51$ LQVWDELOLW\ VHHP WR EH SUHVHQW WKURXJKRXW WKH PHVVDJH HVSHFLDOO\ IRU D HXNDU\RWLF P51$ $OWKRXJK WKH n FDS VWUXFWXUH RQ D HXNDU\RWLF PHVVDJH KDV QRW EHHQ VKRZQ WR GLUHFWO\ DIIHFW VWDELOLW\ RI DQ\ P51$ LW LV EHOLHYHG WKDW LW FRXOG VHUYH D SURWHFWLYH UROH EHFDXVH WKH nn SKRVSKRGLHVWHU ERQG LV LQWULQVLFDOO\ UHVLVWDQW WR ULERQXFOHDVHV 7KLV SXWDWLYH SURWHFWLYH UROH RI WKH n FDS VWUXFWXUH ZDV VKRZQ E\ 0XKOUDG HW DO f 7KHVH ZRUNHUV VKRZHG WKDW LQ WKH GHJUDGDWLRQ SDWKZD\ RI 0)$ P51$ GHFDSSLQJ RI WKH PHVVDJH DOZD\V WDNHV SODFH EHIRUH WKH GHFD\ LQWHUPHGLDWHV FRXOG EH GHWHFWHG 7KH n XQWUDQVODWHG UHJLRQ 875f RI HXNDU\RWHV KDV QRW EHHQ VKRZQ WR GLUHFWO\ DIIHFW P51$ VWDELOLW\ H[FHSW LQ FDVHV ZKHUH WUDQVODWLRQ LV UHTXLUHG IRU GHJUDGDWLRQ DQG WKH n 875 FRQWUROV WKH WUDQVODWLRQ RI WKDW PHVVDJH ,Q FRQWUDVW WR HXNDU\RWHV SURNDU\RWHV KDYH VWHPORRS VWUXFWXUHV DW WKH n WHUPLQL RI WKHLU PHVVDJHV WKDW DIIHFW WKHLU GHFD\ UDWH (PRU\ HW DO %RXYHW DQG %HODVFR 'L0DUL DQG %HFKKRIIHU f )RU H[DPSOH LQ WKH RPS$ P51$ RI (FROL WKH SUHVHQFH RI WKH VWHP VWUXFWXUH LV FULWLFDO IRU PDLQWDLQLQJ WKH QRUPDO KDOIOLIH RI DSSUR[LPDWHO\ PLQXWHV ,QVHUWLRQ RI XS WR QXFOHRWLGHV WR WKH n HQG RI WKH WHUPLQDO KDLUSLQ VWUXFWXUH FDXVHV GUDPDWLF GHFUHDVH LQ WKH KDOIOLIH RI WKH 2PS$ P51$ (PRU\ HW DO f $OVR UHPRYDO RI WKH 6KLQH'HOJDQR VHTXHQFHV IURP

PAGE 30

WKH VHFRQG VLQJOHVWUDQGHG UHJLRQ RI WKH OHDGHU UHGXFHG WKH KDOIOLIH (PRU\ HW DO f 7KLV ZRXOG LPSO\ WKDW ULERVRPH ELQGLQJ PD\ DOVR SURWHFW WKH P51$ +HQFH WUDQVODWLRQ RI WKH PHVVDJH PD\ EH UHTXLUHG IRU VWDELOLW\ ,Q HXNDU\RWHV WKH FRGLQJ UHJLRQV RI VHYHUDO JHQHV LQFOXGLQJ FP\F :LOOLQJWRQ HW DO f 0$7DO &DSRQLJUR HW DO f DQG 67( +HDWRQ HW DO f KDYH LQVWDELOLW\ HOHPHQWV WKDW SURPRWH UDSLG GHFD\ RI WKH PHVVDJHV WKH\ HQFRGH 7KH SXWDWLYH LQVWDELOLW\ HOHPHQW RI 0$7FUL ZDV ORFDOL]HG WR D QXFOHRWLGH VHTXHQFH WKDW KDV D n DQG D n SRUWLRQ &DSRQLJUR HW DO f 7KH n SRUWLRQ LV QHFHVVDU\ DQG VXIILFLHQW WR GHFUHDVH WKH KDOIOLIH RI DQ RWKHUZLVH VWDEOH P51$ EXW WKH GHFD\ LV IXUWKHU VWLPXODWHG ZKHQ WKH n SRUWLRQ LV LQFOXGHG LQ WKH IXVLRQ 7KH n SRUWLRQ FRQWDLQV VRPH UDUH FRGRQV ZKLFK ZKHQ UHSODFHG ZLWK PRUH FRPPRQ FRGRQV LQFUHDVHG WKH KDOIOLIH RI WKH FKLPHULF P51$ 7KLV UHVXOW VXJJHVWV WKDW UDUH FRGRQV PD\ FDXVH WKH ULERVRPH WR VWDOO RQ WKH PHVVDJH ZKLFK PD\ OHDG WR DQ LQLWLDO HQGRQXFOHRO\WLF FOHDYDJH IROORZHG E\ DQ H[RQXFOHDVH DWWDFN 7KH n XQWUDQVODWHG UHJLRQ n 875f RI PDQ\ JHQHV FRQWDLQV VHTXHQFHV WKDW FDXVH WKHLU UDSLG GHFD\ 7KHVH LQFOXGH 67( +HDWRQ HW DO f 0$7DO &DSRQLJUR HW DO f 0)$ 0XKOUDG DQG 3DUNHU f FP\F :LOOLQJWRQ HW DO f DQG WUDQVIHUULQ UHFHSWRU 7I5f JHQH .ODXVQHU HW DO f 7KH VHTXHQFH RI WKH 67( 0)$ DQG 0$7DO WKDW FDXVH UDSLG GHFD\ KDYH QRW EHHQ ZHOO FKDUDFWHUL]HG ,QWHUHVWLQJO\ WKH 7I5 P51$ UHJXODWHG E\ LURQ KDV VHYHUDO ZHOO FRQVHUYHG VWHPORRS VWUXFWXUHV WKDW DUH REVHUYHG LQ ZLGHO\ GLYHUJHQW VSHFLHV

PAGE 31

7KHVH VWHPORRS VWUXFWXUHV DW WKH n 875 DUH FDOOHG WKH LURQ UHVSRQVH HOHPHQW ,5(f DQG FDQ ELQG D SURWHLQ FDOOHG WKH ,5(ELQGLQJ SURWHLQ ,5(%3f .ODXVQHU HW DO f 7KH ,5(%3 DOVR KDV DFRQLWDVH DFWLYLW\ :KHQ LURQ LV VFDUFH WKH ,5(%3 ELQGV WR WKH ,5( RI 7I5 P51$ DQG LQFUHDVHV LWV KDOIOLIH 7KHUH LV DOVR DQ XQFKDUDFWHUL]HG VHTXHQFH FDOOHG WKH UDSLG WXUQRYHU GHWHUPLQDQW RYHUODSSLQJ WKH ,5( 3RLQW PXWDWLRQV ZLWKLQ WKH ,5( HOLPLQDWLQJ ,5(%3 ELQGLQJ VWLOO FDXVHG UDSLG GHFD\ RI WKH P51$ ZKHUHDV D GHOHWLRQ PXWDWLRQ UHPRYLQJ WKH ,5(%3 ELQGLQJ VLWH DQG SUHVXPDEO\ WKH UDSLG WXUQRYHU GHWHUPLQDQW VORZHG WKH P51$ GHFD\ UDWH 7KH n 875 RI FP\F DQG O\PSKRNLQHV DQG SURWRRQFRJHQHV FRQWDLQ WKH VHTXHQFH $888$ XVXDOO\ UHSHDWHG VHYHUDO WLPHV UHIHUUHG WR DV $8ULFK HOHPHQWV $5(f WKDW FDXVH UDSLG GHFD\ RI DQ P51$ FRQWDLQLQJ LW +RZHYHU UHFHQW VWXGLHV E\ =XELDJD DQG FRZRUNHUV f VKRZ WKDW WKH SHQWDQXFOHRWLGH $888$ LV QRW VXIILFLHQW WR FRQIHU GHVWDELOL]DWLRQ XSRQ KHWHURORJRXV P51$ ,QVWHDG D FRQVHQVXV QDQRQXFOHRWLGH RI 88$888$88 LV UHTXLUHG IRU WKH GHVWDELOL]DWLRQ SKHQRW\SH 7KLV VHTXHQFH ZKHQ SUHVHQW LQ PXOWLSOH FRSLHV LQFUHDVHV WKH GHFD\ UDWH 7KH PHFKDQLVP RI P51$ GHFD\ LQ HXNDU\RWLF FHOOV LV EHJLQQLQJ WR EH HOXFLGDWHG 3DUNHU DQG FRZRUNHUV 0XKOUDG DQG 3DUNHU 'HFNHU DQG 3DUNHU 0XKOUDG HW DO f GHPRQVWUDWHG WKDW GHDGHQ\ODWLRQ RI 0)$ P51$ LV WKH ILUVW VWHS EHIRUH GHFD\ RFFXUV IRU VRPH P51$V 7KH GHDGHQ\ODWLRQ RFFXUV LQ WZR VWDJHV DQ LQLWLDO GHDGHQ\ODWLRQ DQG D WHUPLQDO GHDGHQ\ODWLRQ 7KH UDWH RI WKH LQLWLDO GHDGHQ\ODWLRQ RI YDULRXV P51$V

PAGE 32

GHWHUPLQHV WKHLU KDOIOLIH 0HVVDJHV ZLWK ORQJHU KDOIOLIH KDYH DQ LQLWLDO GHDGHQ\ODWLRQ UDWH VLJQLILFDQWO\ ORZHU WKDQ WKRVH ZLWK D VKRUW KDOIOLIH ;LQJ HW DO f 7KLV UHVXOW VXJJHVWV WKDW WKH UDWH OLPLWLQJ VWHS IRU WKLV FODVV RI P51$ LV WKH GHDGHQ\ODWLRQ VWHS 7R GHILQH GLUHFWLRQ RI GHFD\ ZKHWKHU n n RU n n D SRO\*f VHTXHQFH ZDV LQVHUWHG LQWR WKH n 875 RI D WHVW P51$ 7KH SRO\*f IRUPV D VHFRQGDU\ VWUXFWXUH WKDW VORZV GHFD\ LQ HLWKHU GLUHFWLRQ :KHQ WKH IDWH RI WKH P51$ FRQWDLQLQJ WKH SRO\*f WUDFN ZDV IROORZHG XVLQJ D SRO\ & SUREH GHFD\ ZDV IRXQG WR SURFHHG LQ D n n GLUHFWLRQ ,Q DQ [UQ PXWDQW ;51 HQFRGHV WKH PDMRU n n H[RQXFOHDVH LQ \HDVWf IXOO OHQJWK P51$ ZDV VHHQ IRU D PXFK ORQJHU WLPH LQGLFDWLQJ WKDW DIWHU GHDGHQ\ODWLRQ WKLV H[RQXFOHDVH LV UHVSRQVLEOH IRU GHJUDGLQJ WKH 51$ WR PRQRQXFOHRWLGHV 8VLQJ DQ DQWLERG\ WR WKH n FDS VWUXFWXUH 0XKOUDG HW DO f ZHUH DEOH WR VKRZ WKDW WKH FDS VWUXFWXUH LV UHPRYHG EHIRUH H[RQXFOHDVH GLJHVWLRQ 7KH XVH RI PXWDWLRQV WKDW UHVXOW LQ SUHPDWXUH WUDQVODWLRQ WHUPLQDWLRQ LQ VHYHUDO JHQHV KDYH LGHQWLILHG VRPH JHQHV LQ \HDVW WKDW DUH LQYROYHG LQ WKH UDSLG GHFD\ RI P51$V ZLWK SUHPDWXUH QRQVHQVH FRGRQV 7ZR VXFK JHQHV DUH 83) DQG 83) /HHGV HW DO f ,Q D ZLOGW\SH VWUDLQ PRVW P51$V FRQWDLQLQJ SUHPDWXUH WHUPLQDWLRQ VLJQDOV KDYH D GHFD\ UDWH XS WR WLPHV IDVWHU WKDQ QRUPDO P51$ 3HOW] HW DO f EXW LQ HLWKHU XSI DQG XSI PXWDQWV VRPH RI WKHVH PHVVDJHV DUH VHOHFWLYHO\ VWDELOL]HG ZLWKRXW DIIHFWLQJ WKH WXUQRYHU RI WKH RWKHU PHVVDJH /HHGV HW DO /HHGV HW DO f 7KH QRQVHQVH PXWDWLRQV WKDW FDXVHG WKH UDSLG GHFD\ DUH DOZD\V ORFDWHG ZLWKLQ WKH ILUVW WZRWKLUGV RI WKH FRGLQJ UHJLRQ ,I WKH PXWDWLRQ LV QHDU WKH n HQG RI WKH JHQH WKH KDOIOLIH LV TXLWH

PAGE 33

VLPLODU WR WKH ZLOGW\SH P51$ 7KLV ILQGLQJ VXJJHVWHG WKDW VRPH VHTXHQFHV GRZQVWUHDP RI WKH QRQVHQVH FRGRQ PD\ EH UHTXLUHG IRU WKH UDSLG GHFD\ %\ LQWURGXFLQJ QRQVHQVH PXWDWLRQV WKURXJKRXW WKH 3*. JHQH 3HOW] HW DO f ZHUH DEOH WR VKRZ WKDW D GRZQVWUHDP HOHPHQW ZDV QHFHVVDU\ WR FDXVH UDSLG GHFD\ 7KLV GRZQVWUHDP HOHPHQW IXQFWLRQV LQ DQ RULHQWDWLRQ GHSHQGHQW PDQQHU 2WKHU JHQHV UHTXLUHG IRU UDSLG GHJUDGDWLRQ RI VSHFLILF P51$V LQFOXGH WKH 80( DQG 80( JHQHV 6XURVN\ HW DO f 7KHVH JHQHV DUH UHTXLUHG IRU UDSLG GHFD\ RI PHLRVLV VSHFLILF JHQHV LQ D PHGLXP FRQWDLQLQJ JOXFRVH +RZ WKHVH WUDQV IDFWRUV WDUJHW VSHFLILF P51$ IRU GHFD\ LV QRW NQRZQ EXW WKH\ FRXOG VHUYH DV PROHFXODU WDJV WKDW GHVLJQDWH WKH P51$ IRU GHFD\ ZKHQ ERXQG DW WKHLU UHFRJQLWLRQ VLWH

PAGE 34

0$7(5,$/6 $1' 0(7+2'6 *URZWK &RQGLWLRQV DQG 0HGLD $OO ( FROL VWUDLQV ZHUH FXOWLYDWHG LQ /XULD%HUWDQL PHGLD b %DFWR WU\SWRQH b %DFWR\HDVW H[WUDFW b 1D&, S+ f
PAGE 35

UHVXVSHQGHG LQ SL ; 7(/ VROXWLRQ 7KHQ SJ GHQDWXUHG VDOPRQ VSHUP '1$ SOXV SJ RI WUDQVIRUPLQJ '1$ ZDV DGGHG 7KH FHOOV ZHUH LQFXEDWHG ZLWK WKH '1$ DW r& ZLWK JHQWO\ VKDNLQJ IRU PLQXWHV VXEVHTXHQWO\ SL b 3(* SRO\HWK\OHQH JO\FROf7(/ VROXWLRQ ZDV DGGHG WR WKH PL[WXUH ZKLFK ZDV YRUWH[HG YLJRURXVO\ IRU D IHZ VHFRQGV &HOOV ZHUH WUDQVIHUUHG WR D r& KHDW EORFN DQG LQFXEDWHG IRU DGGLWLRQDO PLQXWHV ZLWKRXW VKDNLQJ $W WKH HQG WKH\ ZHUH LQFXEDWHG DW r& IRU PLQXWHV &HOOV WKHQ ZHUH FROOHFWHG E\ FHQWULIXJDWLRQ LQ DQ (SSHQGRUI FHQWULIXJH IRU VHFRQGV WKH VXSHUQDWDQW ZDV GHFDQWHG DQG FHOOV ZHUH UHVXVSHQGHG LQ SL 7( S+ DQG SODWHG SL SHU SHWULH SODWH RQ DSSURSULDWH VHOHFWLYH PHGLD DQG LQFXEDWHG DW WKH DSSURSULDWH WHPSHUDWXUH 7UDQVIRUPDQWV ZHUH XVXDOO\ REWDLQHG LQ GD\V 3XWDWLYH WUDQVIRUPDQWV ZHUH UHVWUHDNHG RQ WKH VDPH VHOHFWLYH PHGLD DQG LQFXEDWHG IRU DQRWKHU GD\V 7UDQVIRUPDQWV ZHUH XVXDOO\ VFUHHQHG IRU WKHLU DX[RWURSKLF PDUNHUV E\ VWUHDNLQJ RQ PLQLPDO PHGLD RQ ZKLFK WKH\ VKRXOG QRW JURZ &RQVWUXFWLRQ RI n ',67$ DQG n 352;,0$8 'HOHWLRQV 7KH FRQVWUXFWLRQ RI WKHVH SODVPLGV ZDV VWDUWHG E\ 7LPRWK\ 5LFNH\ 5LFNH\ f $OO &,7ODF= FRQVWUXFWLRQV RULJLQDWHG IURP WZR SODVPLGV S6+ DQG
PAGE 36

VHTXHQFH IURP S%0 EHWZHHQ WKH $56 VHTXHQFH DQG WKH SRO\OLQNHU RI S0& 7KH S0& YHFWRU ZDV SURYLGHG E\ 'U 0 &DVDGDEDQ f 7KH
PAGE 37

)LJXUH &RQVWUXFWLRQ RI WKH nGHOHWLRQV 7KH ILUVW VWHS ZDV WR GLJHVW SODVPLG S6+ ZLWK 6PDO IROORZHG E\ WUHDWPHQW ZLWK %DO QXFOHDVH 7KH QXFOHDVH WUHDWHG '1$ ZDV GLJHVWHG ZLWK %DP+, ZKLFK UHOHDVHG WKH \HDVW '1$ 7KLV ZDV WKHQ OLJDWHG WR <&S= YHFWRU ZKLFK KDG EHHQ OLQHDUL]HG ZLWK %DP+, DQG 6PDO 7KH WKLQ OLQH UHSUHVHQWV &,7 VHTXHQFHV ORFDWHG XSVWUHDP RI WKH FRGLQJ UHJLRQ 7KH VWUDLJKW OLQH KDWFK PDUNV UHSUHVHQWV &,7 FRGLQJ UHJLRQ DQG WKH FURVVHG KDWFK PDUNV UHSUHVHQWV S8& YHFWRU VHTXHQFHV ,Q WKH VHFRQG YHFWRU WKH ILOOHG ER[ UHSUHVHQWV WKH ( FROL ODF= JHQH DQG WKH VWLSSOHG ER[ UHSUHVHQWV \HDVW 753 JHQH

PAGE 38

6PD (FR59 O O %DP+ P L LL X Q L L L :6$ :$ 6PD DQG %DO 7 (FR59 %DP+ / (FR59 O O %DP+ Q ?PPPP A%DP+ (FR59 %DP+ /DF =

PAGE 39

GLJHVWLRQ ZDV OLNHO\ WR UHPRYH WKLV HOHPHQW ZKLFK LV HVVHQWLDO IRU SURSHU LQLWLDWLRQ LW ZDV QHFHVVDU\ WR UHVWRUH WKLV VHTXHQFH 7KH QXFOHDVHWUHDWHG '1$ ZDV GLJHVWHG ZLWK %DP+, DQG UXQ RQ D b DJDURVH JHO 7KLV JHQHUDWHG WZR IUDJPHQWV D VPDOO IUDJPHQW ZKLFK FRQVLVWHG RI &,7 VHTXHQFHV IURP WKH (FR59 VLWH WR WKH WZHQW\VL[WK FRGRQ DQG D ODUJH IUDJPHQW WKDW FRQVLVWHG RI YHFWRU VHTXHQFHV DQG SDUWLDOO\ GHOHWHG &,7 XSVWUHDP VHTXHQFHV $ ES (FR59 %DP+, IUDJPHQW IURP S6+ FRQWDLQLQJ WKH HVVHQWLDO &,7 VHTXHQFHV ZDV OLJDWHG WR WKH QHVWHG VHW RI GHOHWHG '1$ IUDJPHQWV 7KLV JHQHUDWHG GHOHWLRQ FORQHV WKDW VWDUWHG DW WKH (FR59 VLWH DQG H[WHQGHG XSVWUHDP EXW UHWDLQHG WKH 7$7$ VHTXHQFH WKH WUDQVFULSWLRQ LQLWLDWLRQ VLWH DQG WKH FRGLQJ UHJLRQ )LJXUH LV D GLDJUDPPDWLF UHSUHVHQWDWLRQ RI KRZ WKHVH n GHOHWLRQV ZHUH JHQHUDWHG &RQVWUXFWLRQ RI ,QWHUQDO 'HOHWLRQV ,QWHUQDO GHOHWLRQV RI WKH SURPRWHU UHJLRQ ZHUH FRQVWUXFWHG WR GHWHUPLQH WKH UHODWLYH FRQWULEXWLRQ RI HDFK RI WKHVH UHJLRQV WR KLJK OHYHO H[SUHVVLRQ RI &,7 JHQH 7KH WHFKQLTXH XVHG WR PDNH WKHVH FRQVWUXFWV LV FDOOHG UHFRPELQDQW FLUFOH SRO\PHUDVH FKDLQ UHDFWLRQ 5&3&5f -RQHV DQG +RZDUG f 7ZR SULPHUV ZHUH XVHG WR SULPH 3&5 ZKLFK H[WHQGHG LQ RSSRVLWH GLUHFWLRQV RQ WKH WHPSODWH 7KH VWDQGDUG SRO\PHUDVH FKDLQ UHDFWLRQ FRQVLVWHG RI SPROHV HDFK RI WKH SULPHUV QJ RI WHPSODWH '1$ S6/f SPROHV RI IRXU G173nV P0 PDJQHVLXP FKORULGH P0 7ULV+&, S+ P0 SRWDVVLXP FKORULGH DQG 8 $PSOL7DT '1$ SRO\PHUDVH &HWXV &RUSRUDWLRQf 7ZHQW\ F\FOHV RI

PAGE 40

)LJXUH &RQVWUXFWLRQ RI WKH n GHOHWLRQV )LUVW S6+ ZDV GLJHVWHG ZLWK (FR59 ZKLFK LV ES IURP WKH WUDQVFULSWLRQDO VWDUW VLWH 7KH '1$ ZDV WKHQ WUHDWHG ZLWK %DO )ROORZLQJ WKH QXFOHDVH WUHDWPHQW WKH '1$ ZDV GLJHVWHG ZLWK %DP+, WKLV UHOHDVHG &,7 VHTXHQFHV WKDW FRQWDLQHG VHTXHQFHV HVVHQWLDO IRU SURSHU WUDQVFULSWLRQ LQLWLDWLRQ 7R UHVWRUH WKHVH VHTXHQFHV DQ (FR59%DP+, IUDJPHQW IURP WKH RULJLQDO SODVPLG S6+f ZDV OLJDWHG WR WKH %DO WUHDWHG '1$ $ 6PDO%DP+, IUDJPHQW IURP WKH QXFOHDVH GLJHVWHG '1$ ZDV WKHQ VXEFORQHG LQWR
PAGE 41

6PD YVVVVVVVVƒ 6PD 6PD (RR59 %DP+ ‘ XLOUVVVVVV6V60 W (FR59 DQG %DO +, 6PD 6PD (FR59 %DP+ OOOOOOOOOOOOO %DP+ 7+7PLOO (FR5 6PD %DP+ 753 /DF =

PAGE 42

DPSOLILFDWLRQ ZHUH SHUIRUPHG IRU HDFK UHDFWLRQ IROORZLQJ LQLWLDO GHQDWXUDWLRQ DW r& IRU PLQXWHV (DFK F\FOH FRQVLVWHG RI r& GHQDWXUDWLRQ IRU PLQXWH DQQHDOHG DW WKH 7+ IRU HDFK SDLU RI SULPHUV IRU PLQXWH DQG r& H[WHQVLRQ IRU PLQXWHV $IWHU F\FOHV RI DPSOLILFDWLRQ DQ DGGLWLRQDO PLQXWHV RI H[WHQVLRQ ZDV SHUIRUPHG WR HQDEOH PRVW SURGXFWV WR KDYH D FRPPRQ HQG 7KH n HQGV RI HDFK SULPHU SDLU ZHUH FRPSOHPHQWDU\ WR HDFK RWKHU E\ IRXU WR WHQ QXFOHRWLGHV $IWHU WKH 3&5 UHDFWLRQ WKH SURGXFWV ZHUH SKHQROFKORURIRUP H[WUDFWHG RQFH SUHFLSLWDWHG UHVXVSHQGHG LQ ZDWHU DQG XVHG WR WUDQVIRUP FRPSHWHQW ( FROL E\ HOHFWURSRUDWLRQ 685( VWUDLQ 6WUDWDJHQHf 8SRQ WUDQVIRUPDWLRQ FLUFXODU PROHFXOHV ZHUH JHQHUDWHG E\ WKH KRVW ( FROL E\ KRPRORJRXV UHFRPELQDWLRQ DW WKH WHUPLQL RI WKH 3&5 SURGXFWV EHFDXVH RI WKHLU FRPSOHPHQWDULW\ 7KH WHPSODWH XVHG ZDV S6/ 3ODVPLG S6/ KDV DSSUR[LPDWHO\ ES (FR5, IUDJPHQW H[HUFLVHG IURP S DQG VXEFORQHG LQWR S%OXHVFULSW .6 DW WKH (FR5, VLWH 7KLV (FR5, IUDJPHQW FRQWDLQHG DOO RI WKH &,7 VHTXHQFHV LQ S SODVPLG 7KH &,7 VHTXHQFHV FRQVLVWHG RI XSVWUHDP VHTXHQFHV WKH 7$7$ HOHPHQW DQG QXFOHRWLGHV ORQJ WUDQVFULSWLRQ XQLW ZKLFK LQFOXGHG WKH ILUVW FRGRQV 0DQ\ WUDQVIRUPDQWV ZHUH XVXDOO\ REWDLQHG WKHUHIRUH LQLWLDO VFUHHQLQJ IRU GHOHWLRQ PXWDQWV ZDV GRQH E\ WKH FRORQ\ K\EULGL]DWLRQ *UXQVWHLQ DQG +RJQHVV f 'XULQJ WKH VFUHHQLQJ 3 UDGLRODEHOHG SUREHV ZHUH SUHSDUHG IURP WKH PXWDQW SULPHU ZKRVH VHTXHQFH VKRXOG QRZ EH FRQWLQXRXV LQ WKH UHFRPELQDQW FORQH EXW GLVFRQWLQXRXV RQ WKH SDUHQW SODVPLG 7KH K\EULGL]DWLRQ WHPSHUDWXUH XVHG IRU HDFK VFUHHQLQJ ZDV WKH 7+ RI WKH ROLJRQXFOHRWLGH 'HOHWLRQ PXWDQWV ZHUH IXUWKHU FKDUDFWHUL]HG E\ UHVWULFWLRQ GLJHVWLRQ WKHQ SRVLWLYH FORQHV ZHUH

PAGE 43

VHTXHQFHG WR GHWHUPLQH WKH H[DFW GHOHWHG UHJLRQ %HFDXVH WKH GHOHWLRQV ZHUH PDGH LQ D S%OXHVFULSW SODVPLG WKH (FR5, IUDJPHQW ZDV UHFORQHG LQ WKH RULJLQDO \HDVW,( FROL VKXWWOH SODVPLG LW ZDV REWDLQHG UHSODFLQJ WKH IXOOOHQJWK LQVHUW $IWHU OLJDWLRQ DQG VXEVHTXHQW WUDQVIRUPDWLRQ UHFRPELQDQW SODVPLGV ZHUH VHTXHQFHG WR GHWHUPLQH WKHLU RULHQWDWLRQ )RXU UHJLRQV ZHUH GHOHWHG WKDW VSDQ WR WR WR DQG WR LQGLFDWHV WKH VWDUW VLWH IRU WUDQVFULSWLRQf $OO UHFRPELQDQW SODVPLGV ZHUH WUDQVIRUPHG LQWR 6% VWUDLQ DQG JDODFWRVLGDVH DFWLYLW\ ZDV GHWHUPLQHG DV GHVFULEHG EHORZ 7KH SULPHUV XVHG ZHUH $/$/ WR GHOHWH WR 0606 WR GHOHWH WR 0606 WR GHOHWH WR DQG $/06 WR GHOHWH WR $QQHDOLQJ WHPSHUDWXUH IRU HDFK SULPHU SDLU ZDV f $/ DWr& f 0606 DW r& f 0606 DW r& DQG f $/06 DW r& +HWHURORJRXV )XVLRQ 7R VKRZ WKDW VHTXHQFHV XSVWUHDP RI WKH SXWDWLYH 7$7$ HOHPHQW RI & FRXOG IXQFWLRQ DV D 8$6 XSVWUHDP DFWLYDWLQJ VHTXHQFHf D ES (FR5,(FR59 IUDJPHQW IURP S ZDV VXEFORQHG LQWR SO&= JHQHURXV JLIW IURP 'U 0H\HUVf 7KH &,7 XSVWUHDP VHTXHQFHV ZHUH REWDLQHG IURP S6/ SODVPLG GHVFULEHG HDUOLHU 7KH S6/ SODVPLG ZDV GLJHVWHG ZLWK (FR5,(FR59 ZKLFK UHOHDVHG D ES IUDJPHQW WKDW FRQWDLQV DOO RI WKH SXWDWLYH &,7 8$6 DQG UHFRYHUHG WKH '1$ E\ WKH 6SLQ%LQG PHWKRG &RVWDUf DIWHU UXQQLQJ RQ D b DJDURVH JHO 7KLV IUDJPHQW ZDV OLJDWHG WR SO&= SODVPLG WKDW KDG EHHQ FXW

PAGE 44

ZLWK 6PDO ;KRO HQ]\PHV DQG ILOOHGLQ ZLWK DOO IRXU G173nV XVLQJ 8 RI .OHQRZ HQ]\PH 7KH SL&= SODVPLG KDV WKH &<& 8$6 DQG 8$6 WKH 7$7$ HOHPHQW DQG WKUHH QXFOHRWLGHV RI &<& FRGLQJ VHTXHQFHV IXVHG WR ODF= JHQH ,W DOVR KDV ( FROL UHSOLFDWLRQ RULJLQ DPSLFLOOLQ UHVLVWDQFH JHQH DQG WKH 85$ VHOHFWDEOH PDUNHU LQ \HDVW EXW WKHUH LV QR \HDVW UHSOLFDWLRQ RULJLQ 7KHUHIRUH WKH SODVPLG FDQ EH PDLQWDLQHG RQO\ LI LW LQWHJUDWHV LQWR WKH \HDVW FKURPRVRPH ,Q RUGHU WR GLUHFW WKH LQWHJUDWLRQ WKH SODVPLG ZDV GLJHVWHG DW D XQLTXH 6WXO VLWH ZLWKLQ WKH 85$ JHQH 6WXO GLJHVWHG SODVPLG '1$ ZDV WUDQVIRUPHG LQWR $ DQG -3$KDS85$f VWUDLQV DQG WUDQVIRUPDQWV ZHUH SODWHG RQ 6'bf ZLWK SJPO KLVWLGLQH SJPO DGHQLQH DQG SJPO OHXFLQH DQG LQFXEDWHG DW r& 6HYHUDO VLQJOH FRORQLHV IURP HDFK WUDQVIRUPDWLRQ ZHUH LVRODWHG DQG UHn VWUHDNHG RQ VLPLODU SODWH DQG LQFXEDWHG DW r& DJDLQ %HFDXVH PXOWLSOH WDQGHP LQWHJUDWLRQ HYHQWV FRXOG RFFXU WKH QXPEHU RI LQWHJUDWLRQV RI HDFK WUDQVIRUPDQW ZDV GHWHUPLQHG E\ 6RXWKHUQ EORW DQDO\VLV
PAGE 45

%LRFKHPLFDO ,QF 3UREH ZDV GHQDWXUHG E\ ERLOLQJ DQG DGGHG DW FSP SHU PLOOLOLWHU RI K\EULGL]DWLRQ VROXWLRQ +\EULGL]DWLRQ ZDV FDUULHG RXW DW r& IRU KRXUV ZLWK VKDNLQJ 0HPEUDQH ZDV ZDVKHG DFFRUGLQJ WR WKH PDQXIDFWXUHUnV UHFRPPHQGDWLRQ DQG H[SRVHG WR ;UD\ ILOP 7UDQVIRUPDQWV ZLWK PRUH WKDQ VLQJOH LQWHJUDWLRQ HYHQW ZHUH LGHQWLILHG E\ WKH SUHVHQFH RI D SODVPLGOHQJWK EDQG &ORQLQJ RI 2OLJRQXFOHRWLGHV 2OLJRQXFOHRWLGHV FRUUHVSRQGLQJ WR GLIIHUHQW XSVWUHDP UHJLRQV RI &,7 ZHUH VXEFORQHG LQWR WKH SO&= YHFWRU WR WHVW WKHLU DELOLW\ WR HLWKHU DFWLYDWH RU UHSUHVV WUDQVFULSWLRQ 7KH ROLJRQXFOHRWLGHV XVHG ZHUH V\QWKHVL]HG DW WKH '1$ 6\QWKHVLV &RUH 8QLYHUVLW\ RI )ORULGD 7KHLU VHTXHQFHV DQG ORFDWLRQ LQ WKH JHQH DUH JLYHQ LQ 7DEOH $SSUR[LPDWHO\ SJ RI FRPSOHPHQWDU\ ROLJRQXFOHRWLGHV ZHUH DQQHDOHG LQ P0 7ULV+&, S+ P0 0J&, P0 1D&, E\ ERLOLQJ IRU PLQXWHV WKHQ VORZO\ FRROHG WR URRP WHPSHUDWXUH 7R FORQH WKH UHJLRQ EHWZHHQ WR $/ DQG $/ ROLJRQXFOHRWLGHV ZHUH DQQHDOHG DQG $/ DQG $/ ROLJRQXFOHRWLGHV ZHUH DQQHDOHG IRU WKH WR UHJLRQ $IWHU DQQHDOLQJ SJ RI HDFK DQQHDOHG ROLJRQXFOHRWLGH ZDV HQG ODEHOHG ZLWK P0 $73 XVLQJ 7 SRO\QXFOHRWLGH NLQDVH 8f LQ P0 7ULV+&, S+ P0 0J&, P0 '77 DW r& IRU PLQXWHV $W WKH HQG RI WKH UHDFWLRQ WKH HQ]\PH ZDV KHDW LQDFWLYDWHG E\ LQFXEDWLQJ DW r& IRU PLQXWHV 6DOW ZDV UHPRYHG IURP WKH VDPSOH E\ SUHFLSLWDWLQJ ZLWK DEVROXWH HWKDQRO WKHQ WKH VDPSOH ZDV UHVXVSHQGHG LQ SL ZDWHU $SSUR[LPDWHO\ SL RI HDFK DQQHDOHG ROLJRQXFOHRWLGH

PAGE 46

ZDV OLJDWHG ZLWK SO&= YHFWRU ZKLFK KDG DOUHDG\ EHHQ GLJHVWHG ZLWK 6PDO DQG ;KRO UHVWULFWLRQ HQ]\PHV 7KLV GLJHVWLRQ UHPRYHG WKH 8$6F\FL /LJDWLRQ ZDV SHUIRUPHG RYHUQLJKW DW r& LQ ; OLJDVH EXIIHU P0 7ULV+&, S+ P0 0J&, P0 '77 S0 $73f ZLWK 8 RI 7 OLJDVH /LJDWLRQ PL[WXUH ZDV XVHG WR WUDQVIRUP LQWR FRPSHWHQW ( FROL FHOOV 7UDQVIRUPDQWV ZHUH DQDO\]HG E\ LVRODWLQJ SODVPLG DQG GLJHVWLQJ ZLWK WKH 6SKO UHVWULFWLRQ HQ]\PH 5HFRPELQDQWV ZHUH VXEVHTXHQWO\ FRQILUPHG E\ VHTXHQFLQJ XVLQJ WKH 6HTXHQDVH NLW 86 %LRFKHPLFDOf '1$IURP FRQILUPHG UHFRPELQDQWV ZDV OLQHDUL]HG ZLWK 6WXO HQ]\PH DQG WUDQVIRUPHG LQWR \HDVW DQG SODWHG RQ WKH DSSURSULDWH VHOHFWLYH DJDU SODWH 'LJHVWLRQ RI WKH '1$ GLUHFWV LQWHJUDWLRQ DW WKH 85$ ORFXV 7KH QXPEHU RI LQWHJUDWLRQ ZDV GHWHUPLQHG E\ SHUIRUPLQJ 6RXWKHUQ DQDO\VLV DV GHVFULEHG HDUOLHU 0HDVXUHPHQW RI %*DODFWRVLGDVH /HYHO LQ &,7ODF= )XVLRQ &HOOV ZHUH JURZQ WR HLWKHU HDUO\ ORJDULWKPLF SKDVH 2' a f RU VWDWLRQDU\ SKDVH 2' f DQG PO RI FXOWXUH ZDV KDUYHVWHG E\ FHQWULIXJDWLRQ DW ; Jf LQ D 6RUYDOO 'XSRQWf GHVNWRS FHQWULIXJH IRU PLQXWHV 7KH VXSHUQDWDQW ZDV GHFDQWHG DQG WKH SHOOHW ZDV UHVXVSHQGHG LQ PO ZDWHU 7KH FHOOV ZHUH FHQWULIXJHG DJDLQ DW ; Jf LQ WKH 6RUYDOO FOLQLFDO FHQWULIXJH IRU PLQXWHVDQG WKH VXSHUQDWDQW ZDV GHFDQWHG 7KH SHOOHW ZDV UHVXVSHQGHG LQ PO P0 7ULV+&, S+ SOXV SL P0 306) DQG WUDQVIHUUHG WKH FHOOV LQWR URXQG ERWWRP PO FHQWULIXJH WXEH 6WDUVWHGWf 7R

PAGE 47

GLVUXSW WKH FHOOV PP GLDPHWHU DFLGZDVKHG JODVV EHDGV ZHUH DGGHG WR WKH VXVSHQVLRQ XQWLO WKH JODVV EHDGV UHDFKHG WKH PHQLVFXV RI WKH OLTXLG 7KH PL[WXUH ZDV YRUWH[HG YLJRURXVO\ IRU VHFRQGV 7KH WXEH ZDV FRROHG RQ LFH IRU DW OHDVW PLQXWH WKHQ YRUWH[HG DJDLQ IRU DGGLWLRQDO VHFRQGV 7KH O\VDWH ZDV WKHQ WUDQVIHUUHG WR IUHVK PLFURFHQWULIXJH WXEH DQG FHQWULIXJHG LQ DQ (SSHQGRUI FHQWULIXJH IRU PLQXWH DW r& 7KH VXSHUQDWDQW ZDV WUDQVIHUUHG WR D IUHVK PLFURFHQWULIXJH WXEH DQG LQFXEDWHG LQ D r& IUHH]HU IRU DW OHDVW PLQXWHV 7KH O\VDWH ZDV WKHQ VHW RQ LFH WR WKDZ DQG FHQWULIXJHG DJDLQ LQ D PLFURFHQWULIXJH IRU PLQXWH DW r& 7KH VXSHUQDWDQW ZDV WUDQVIHUUHG LQWR D IUHVK PLFURFHQWULIXJH WXEH DQG VWRUHG DW r& 3JDODFWRVLGDVH DFWLYLW\ RI HDFK O\VDWH ZDV GHWHUPLQHG E\ WKH PHWKRG RI &UDYHQ HW DO f +HZHOOHW 3DFNDUG NLQHWLFV SURJUDP LQ PRGHO $ VSHFWURSKRWRPHWHU ZDV XVHG WR GHWHUPLQH WKH UHDFWLRQ UDWH 6SHFLILF DFWLYLW\ IURP HDFK VDPSOH LV UHSRUWHG DV QDQRPROHV RI R QLWURSKHQ\OJDODFRWRS\UDQRVLGH 213*f K\GURO\]HG SHU PLQXWH SHU PLOOLJUDP RI SURWHLQ 3URWHLQ FRQFHQWUDWLRQV ZHUH GHWHUPLQHG E\ WKH PHWKRG RI /RZU\ HW DO f 51$ ,VRODWLRQ 51$ IRU QRUWKHUQ DQDO\VLV DQG ULERQXFOHDVH SURWHFWLRQ DVVD\V ZDV URXWLQHO\ SUHSDUHG DV GHVFULEHG E\ 6FKPLWW HW DO f &HOO FXOWXUHV ZHUH JURZQ WR HDUO\ ORJDULWKPLF SKDVH 2' a f DQG KDUYHVWHG E\ FHQWULIXJDWLRQ LQ WKH %HFNPDQ FHQWULIXJH LQ D -$ URWRU DW USP IRU VHFRQGV

PAGE 48

7KHQ WKH VXSHUQDWDQW ZDV UHPRYHG DQG FHOOV ZHUH UHVXVSHQGHG LQ SL $( EXIIHU P0 VRGLXP DFHWDWH P0 ('7$ S+ f &HOOV ZHUH WUDQVIHUUHG WR D PLFURFHQWULIXJH WXEH WKHQ DGGHG RQHWHQWK YROXPH SLf b 6'6 ZDV DGGHG WR HDFK WXEH DQG YRUWH[HG IRU DERXW VHFRQGV $ YROXPH SLf SUHZDUPHG r&f SKHQROFKORURIRUP UDWLRfHTXLOLEUDWHG ZLWK $( EXIIHU ZDV DGGHG DQG WKH PL[WXUH ZDV YRUWH[HG IRU VHFRQGV 7KH WXEH ZDV LQFXEDWHG LQ D r& ZDWHU EDWK IRU PLQXWHV ZLWK RFFDVLRQDO YRUWH[LQJ WKHQ FRROHG GRZQ E\ VHWWLQJ LQ D GU\LFH HWKDQRO EDWK IRU DSSUR[LPDWHO\ VHFRQGV 7KH DTXHRXV SKDVH ZDV VHSDUDWHG IURP WKH RUJDQLF SKDVH E\ FHQWULIXJDWLRQ DW ; J LQ DQ (SSHQGRUI FHQWULIXJH DW URRP WHPSHUDWXUH IRU PLQXWHV 7KH RUJDQLF SKDVH ZDV GLVFDUGHG $Q HTXDO YROXPH RI SUHZDUPHG r&f SKHQROFKORURIRUP ZDV DGGHG DJDLQ DQG WKH H[WUDFWLRQ UHSHDWHG DV DERYH $ ILQDO H[WUDFWLRQ ZDV SHUIRUPHG ZLWK DQ HTXDO YROXPH RI SKHQROFKORURIRUPLVRDP\O DOFRKRO f 7KH DTXHRXV SKDVH ZDV WUDQVIHUUHG WR D IUHVK PLFURFHQWULIXJH WXEH 51$ ZDV SUHFLSLWDWHG E\ DGGLQJ RQHWHQWK YROXPH 0 VRGLXP DFHWDWH S+ SOXV YROXPH DEVROXWH HWKDQRO DQG LQFXEDWHG DW r& IRU PLQXWHV 7KH HWKDQRO SHOOHW ZDV UHFRYHUHG E\ FHQWULIXJLQJ IRU PLQXWHV LQ D PLFURFHQWULIXJH DW r& 7KH VXSHUQDWDQW ZDV GHFDQWHG DQG WKH SHOOHW ZDV ZDVKHG ZLWK PO b HWKDQRO 7KH SHOOHW ZDV GULHG XQGHU YDFXXP DQG UHVXVSHQGHG LQ SL ZDWHU 51$ FRQFHQWUDWLRQ ZDV GHWHUPLQHG LQ VSHFWURSKRWRPHWHU +HZHOOHW 3DFNDUG PRGHO f 6DPSOHV ZHUH VWRUHG DW r& XQWLO QHHGHG :KHQ LVRODWLQJ 51$ IRU KDOIOLIH RU UDWH RI GHFD\ GHWHUPLQDWLRQ DQ 51$ SRO\PHUDVH ,, WHPSHUDWXUH VHQVLWLYH PXWDQW VWUDLQ ZDV XVXDOO\ XVHG WR LVRODWH WKH 51$ 7UDQVFULSWLRQ ZDV

PAGE 49

VWRSSHG E\ DGGLQJ HTXDO YROXPH RI SUHZDUPHG r&f PHGLXP WR WKH FXOWXUH DQG LPPHGLDWHO\ WUDQVIHUULQJ WKH FXOWXUH WR D r& ZDWHU EDWK &KHPLFDO LQKLELWRUV VXFK DV WKLROXWLQ JHQHURXV JLIW IURP 'U 6 .DGLQ 3IL]HU ,QF *URWRQ &7f -LPHQH] HW DO f DQG SKHQDQWKUROLQH 6DQWLDJR HW DO f ZHUH DOVR XVHG WR VWRS WUDQVFULSWLRQ LQ VHSDUDWH H[SHULPHQWV 7KLROXWLQ ZDV GLVVROYHG LQ '062 DQG XVHG DW D ILQDO FRQFHQWUDWLRQ RI SJPO DQG SKHQDQWKUROLQH ZDV SUHSDUHG LQ HWKDQRO DW PJPO DQG XVHG DW D ILQDO FRQFHQWUDWLRQ RI SJPO 5LERQXFOHDVH 3URWHFWLRQ $VVD\ 7R VKRZ WKDW WKH SJDODFWRVLGDVH DFWLYLW\ IURP WKH GLIIHUHQW GHOHWLRQ FRQVWUXFWV UHIOHFWV WKH VWHDG\VWDWH P51$ OHYHO ULERQXFOHDVH SURWHFWLRQ DVVD\V ZHUH SHUIRUPHG RQ WRWDO \HDVW 51$ LVRODWHG IURP \HDVW VWUDLQV KDUERULQJ VHOHFWHG GHOHWLRQ FRQVWUXFWV $ UDGLRODEHOHG F51$ IURP WKH ODF= JHQH ZDV SUHSDUHG IURP S6/ SODVPLG S6/ SODVPLG ZDV FRQVWUXFWHG E\ VXEFORQLQJ D (FR59&ODO IUDJPHQW IURP S LQWR S%OXHVFULSW .6 FXW ZLWK WKH VDPH HQ]\PHV 7KLV (FR59&ODO IUDJPHQW FRQWDLQV DQ ES RI WKH n FRGLQJ UHJLRQ RI ODF= JHQH DQG ES RI &,7 VHTXHQFHV ZKLFK LQFOXGH WKH ILUVW QXFOHRWLGHV RI &,7 51$ DQG WKH 7$7$ HOHPHQW 7R SUHSDUH WKH SUREH WKH SODVPLG ZDV OLQHDUL]HG ZLWK 'GHO UHVWULFWLRQ HQ]\PH ZKLFK FXWV ZLWKLQ WKH ODF= JHQH DQG WUDQVFULEHG ZLWK D 7 51$ SRO\PHUDVH DW r& IRU KRXU 7KLV JHQHUDWHG D SUREH WKDW ZDV DSSUR[LPDWHO\ QXFOHRWLGHV ORQJ $W WKH HQG RI

PAGE 50

WUDQVFULSWLRQ SL 54 '1DVH 8SOf 3URPHJD &RUSRUDWLRQf ZDV DGGHG DQG WKH VDPSOH ZDV LQFXEDWHG DW r& IRU PLQXWHV WR GLJHVW WKH WHPSODWH '1$ 7KH YROXPH ZDV DGMXVWHG WR SL ZLWK ZDWHU DQG H[WUDFWHG RQFH ZLWK SKHQROFKORURIRUPLVRDP\O DOFRKRO 7KH DTXHRXV SKDVH ZDV WUDQVIHUUHG H[WUDFWHG RQFH DJDLQ ZLWK FKORURIRUP DQG VXEVHTXHQWO\ WUDQVIHUUHG WR D IUHVK WXEH DQG DQ HTXDO YROXPH RI 0 DPPRQLXP DFHWDWH S+ SOXV YROXPHV HWKDQRO ZHUH DGGHG 7KH WUDQVFULSW ZDV LQFXEDWHG DW r& IRU PLQXWHV WR SUHFLSLWDWH ,W ZDV WKHQ FHQWULIXJHG LQ DQ (SSHQGRUI FHQWULIXJH DW USP IRU PLQXWHV WR FROOHFW WKH SUHFLSLWDWH $IWHU GHFDQWLQJ WKH VXSHUQDWDQW WKH SHOOHW ZDV UHVXVSHQGHG LQ SL 0 DPPRQLXP DFHWDWH DQG SUHFLSLWDWLRQ ZDV UHSHDWHG WZR DGGLWLRQDO WLPHV WR UHPRYH WKH XQLQFRUSRUDWHG QXFOHRWLGHV 7KH SHOOHW ZDV ZDVKHG RQFH ZLWK b HWKDQRO GULHG LQ YDFXXP DQG UHVXVSHQGHG LQ SL K\EULGL]DWLRQ EXIIHU 2QH PLFUROLWHU RI WKH WUDQVFULSW ZDV DQDO\]HG LQ D VFLQWLOODWLRQ FRXQWHU 7R K\EULGL]H DSSUR[LPDWHO\ WR FSP SHU SUREH ZDV DGGHG WR SJ RI SUHFLSLWDWHG WRWDO 51$ DQG WKH YROXPH ZDV DGMXVWHG WR SL ZLWK WKH K\EULGL]DWLRQ EXIIHU 7KH PL[WXUH ZDV KHDWHG DW r& IRU PLQXWHV WKHQ TXLFNO\ WUDQVIHUUHG WR D r& KHDW EORFN DQG K\EULGL]HG RYHUQLJKW 7KUHH KXQGUHG DQG ILIW\ PLFUROLWHUV RI 51DVH GLJHVWLRQ EXIIHU FRQWDLQLQJ SJPO 51DVH $ SOXV SJPO 51DVH 7 ZDV DGGHG WR HDFK VDPSOH ZKLFK ZDV WKHQ LQFXEDWHG DW r& IRU PLQXWHV WR GLJHVW XQK\EULGL]HG WUDQVFULSW 7KH 51DVH GLJHVWLRQ ZDV VWRSSHG E\ WUHDWPHQW ZLWK SL SJPO SURWHLQDVH SL b 6'6 DW r& IRU PLQXWHV 7KH VDPSOH ZDV H[WUDFWHG RQFH ZLWK HTXDO YROXPH SKHQROFKORURIRUPLVRDP\O DOFRKRO DQG WKH DTXHRXV

PAGE 51

SKDVH ZDV WUDQVIHUUHG WR D IUHVK PLFURFHQWULIXJH WXEH FRQWDLQLQJ RQH PLFUROLWHU RI SJSO \HDVW W51$ SOXV PO DEVROXWH HWKDQRO 3UHFLSLWDWLRQ ZDV FDUULHG RXW DW r& IRU PLQXWHV 6DPSOHV ZHUH FHQWULIXJHG LQ DQ (SSHQGRUI FHQWULIXJH IRU PLQXWHV DW r& 7KH VXSHUQDWDQW ZDV GHFDQWHG DQG WKH SHOOHW ZDVKHG RQFH ZLWK b HWKDQRO GULHG LQ YDFXXP DQG UHVXVSHQGHG LQ SL 51$ VDPSOH EXIIHU b )RUPDPLGH b EURPRSKHQRO EOXH b [\OHQH F\DQROf 6DPSOHV ZHUH KHDWHG DW r& IRU PLQXWHV DQG ORDGHG LQ D b f SRO\DFU\ODPLGH JHO 7KH EURPRSKHQRO EOXH G\H UDQ DERXW WZRWKLUGV WKH OHQJWK RI WKH JHO EHIRUH HOHFWURSKRUHVLV ZDV VWRSSHG 7KH JHO ZDV GULHG DQG H[SRVHG WR ;UD\ ILOP 5HODWLYH 3 FRQWHQW IRU HDFK VDPSOH ZDV TXDQWLWDWHG E\ H[SRVLQJ WKH GULHG JHO WR D 3KRVSKRU,PDJHU VFUHHQ $%,f 1RUWKHUQ $QDO\VLV )RU QRUWKHUQ DQDO\VLV SJ RI WRWDO 51$ ZDV SUHFLSLWDWHG ZLWK RQH WHQWK YROXPH 0 VRGLXP DFHWDWH S+ SOXV YROXPHV RI DEVROXWH HWKDQRO DQG FHQWULIXJHG LQ D PLFURFHQWULIXJH IRU PLQXWHV DQG WKH VXSHUQDWDQW ZDV GHFDQWHG 7KH SHOOHW ZDV ZDVKHG ZLWK b HWKDQRO DQG GULHG LQ YDFXXP 7ZR PLFUROLWHUV RI ZDWHU ZHUH XVHG WR UHVXVSHQG WKH SHOOHW DQG SL RI VDPSOH PL[ ZDV DGGHG WR WKH VDPSOH 6DPSOH PL[ FRQVLVWHG RI b IRUPDPLGH 0 IRUPDOGHK\GH ; 0236 0 0236 0 VRGLXP DFHWDWH 0 ('7$f SJSO HWKLGLXP EURPLGH 7KH VDPSOH ZDV KHDWHG DW r& IRU PLQXWHV FKLOOHG RQ LFH IRU IHZ PLQXWHV WKHQ SL G\H PL[ ZDV DGGHG DQG WKH

PAGE 52

VDPSOH ORDGHG RQ D b DJDURVH JHO FRQWDLQLQJ 0 IRUPDOGHK\GH ; 0236 EXIIHU 7KH UXQQLQJ EXIIHU FRQVLVWHG RI 0 IRUPDOGHK\GH ; 0236 EXIIHU 7KH JHO ZDV UXQ DW 9 XQWLO WKH G\H UDQ WR WKH ERWWRP RI WKH JHO 7KLV XVXDOO\ WRRN DERXW KRXUV 7KH EXIIHU ZDV UHFLUFXODWHG ZLWK D SHULVWDOWLF SXPS WR SUHYHQW IRUPDWLRQ RI D S+ JUDGLHQW $W WKH HQG RI WKH UXQ WKH JHO ZDV SKRWRJUDSKHG ZLWK 3RODURLG ILOP RQ D 89 WUDQVLOOXPLQDWRU WR GHWHUPLQH WKH LQWHJULW\ RI WKH 51$ 7KH JHO ZDV WKHQ VRDNHG LQ D ; 66& 66& LV 0 VRGLXP FKORULGH 0 VRGLXP FLWUDWHf IRU PLQXWHV 51$ WUDQVIHU RQWR +\ERQG 1 Q\ORQ PHPEUDQH E\ FDSLOODU\ DFWLRQ XVLQJ ; 66& IRU DSSUR[LPDWHO\ KRXUV DW URRP WHPSHUDWXUH $W WKH HQG RI WKH WUDQVIHU WKH 51$ ZDV FURVV OLQNHG WR WKH PHPEUDQH LQ D 6WUDWDOLQNHU 6WUDWDJHQHf VHW RQ DXWRFURVVOLQN 7KH PHPEUDQH ZDV WKHQ ULQVHG ZLWK ; 66& 7KH UDSLG K\EULGL]DWLRQ VROXWLRQ $PHUVKDPf ZDV XVHG DV UHFRPPHQGHG E\ WKH PDQXIDFWXUHU IRU K\EULGL]DWLRQV DQG SUHK\EULGL]DWLRQV 3UHK\EULGL]DWLRQ ZDV SHUIRUPHG ZLWK SL RI UDSLG K\EULGL]DWLRQ VROXWLRQ SHU VTXDUH FHQWLPHWHU RI PHPEUDQH DW r& IRU DW OHDVW PLQXWHV $IWHU SUHK\EULGL]DWLRQ FSP RI SUREH ZDV DGGHG SHU PLOOLOLWHU RI K\EULGL]DWLRQ VROXWLRQ DQG K\EULGL]DWLRQ ZDV SHUIRUPHG DW r& IRU DW OHDVW KRXUV :DVKHV ZHUH GRQH ZLWK ; 66& b 6'6 DW URRP WHPSHUDWXUH IRU PLQXWHV RQFH DQG FKDQJHG WR ; 66& b 6'6 DQG UHSHDWHG ZDVK WZLFH DW r& IRU PLQXWHV 7KH PHPEUDQH ZDV WKHQ DLU GULHG ZUDSSHG LQ 6DUDQ :UDS DQG H[SRVHG WR ;UD\ ILOP $Q LQWHQVLI\LQJ VFUHHQ ZDV XVHG WR ERRVW ZHDNHU VLJQDOV )RU TXDQWLWDWLYH UHVXOWV WKH PHPEUDQH ZDV H[SRVHG WR D 3KRVSKRU,PDJHU VFUHHQ $%,f ,I VWULSSLQJ ZDV QHFHVVDU\ WKH PHPEUDQHV ZHUH

PAGE 53

URXWLQHO\ VWULSSHG E\ DGGLQJ b 6'6 DW ERLOLQJ WHPSHUDWXUH WKHQ VHW DW URRP WHPSHUDWXUH XQWLO WKH VROXWLRQ FRROHG WR URRP WHPSHUDWXUH $IWHU VWULSSLQJ WKH PHPEUDQH ZDV WKHQ UHH[SRVHG WR ;UD\ ILOP WR PDNH VXUH WKDW WKH ZHUH QR UHVLGXDO EDQGV IURP SUHYLRXV K\EULGL]DWLRQ EHIRUH VXEVHTXHQW K\EULGL]DWLRQV ZDV SHUIRUPHG RQ WKH PHPEUDQH 3ULPHU ([WHQVLRQ $QDO\VLV 7ZR ROLJRQXFOHRWLGHV ZHUH XVHG LQ WKH SULPHU H[WHQVLRQ DQDO\VLV WR PDS WKH n HQGV RI WKH FKURPRVRPDOLQLWLDWHG &,7 P51$ DQG WKH &,7ODF= IXVLRQ P51$ WKDW ZHUH EHLQJ WUDQVFULEHG IURP WKH SODVPLG 7KH ROLJRQXFOHRWLGHV ZHUH ILUVW HQG ODEHOHG XVLQJ 7 SRO\QXFOHRWLGH NLQDVH DV UHFRPPHQGHG E\ WKH PDQXIDFWXUHU 1HZ (QJODQG %LRODEV $Q HQG ODEHOHG ROLJRPHU FSPf DQG SJ RI WRWDO \HDVW 51$ ZHUH ILUVW SUHFLSLWDWHG WRJHWKHU XVLQJ HWKDQRO 7KH SHOOHW ZDV UHVXVSHQGHG LQ SL K\EULGL]DWLRQ EXIIHU P0 3,3(6 S+ P0 ('7$ S+ 0 VRGLXP FKORULGH b )RUPDPLGHf 7KLV PL[WXUH ZDV KHDWHG DW r& IRU PLQXWHV WKHQ LPPHGLDWHO\ WUDQVIHUUHG WR r& KHDW EORFN DQG K\EULGL]HG RYHUQLJKW )ROORZLQJ K\EULGL]DWLRQ SL RI ZDWHU SOXV SL 0 VRGLXP DFHWDWH S+ ZHUH DGGHG WR WKH VDPSOH 1XFOHLF DFLG ZDV SUHFLSLWDWHG ZLWK YROXPHV HWKDQRO 7KH SHOOHW ZDV ZDVKHG ZLWK b HWKDQRO DQG DOORZHG WR DLU GU\ 3HOOHW ZDV UHVXVSHQGHG LQ SL VWHULOH GLVWLOOHG ZDWHU SL ; 5HYHUVH WUDQVFULSWLRQ EXIIHU P0 7ULV+&, S+ P0 SRWDVVLXP FKORULGH P0 PDJQHVVLXP FKORULGHf SL 0 '77 SL P0 HDFK DOO IRXU

PAGE 54

GHR[\QXFOHRWLGHVG173nVf cM, 51DVLQ 8SOf 3URPHJD &RUSRUDWLRQf DQG SL 6XSHUVFULSW ,, UHYHUVH WUDQVFULSWDVH 8SOf /LIH 7HFKQRORJLHVf 7KH VDPSOH ZDV LQFXEDWHG DW r& IRU PLQXWHV WKHQ SL 0 ('7$ ZDV DGGHG WR VWRS WKH UHDFWLRQ 7KH VDPSOH ZDV WKHQ WUHDWHG ZLWK SL PJPO 51DVH $ WR GLJHVW XQK\EULGL]HG 51$ DW r& IRU PLQXWHV 7KH PL[WXUH ZDV H[WUDFWHG RQFH ZLWK SKHQROFKORURIRUPLVRDP\O DOFRKRO WKHQ DGMXVWHG WR D ILQDO FRQFHQWUDWLRQ RI 0 DPPRQLXP DFHWDWH DQG SUHFLSLWDWHG ZLWK YROXPH HWKDQRO 7KH SHOOHW ZDV ILUVW UHVXVSHQGHG LQ SL 7( S+ WKHQ SL IRUPDPLGH ORDGLQJ EXIIHU ZDV DGGHG 7KH VDPSOH ZDV KHDWHG DW r& IRU PLQXWHV DQG ORDGHG RQ D b /RQJHU 5DQJHU JHO $7 %LRFKHPf DQG UXQ XQWLO WKH ORZHU G\H KDG UXQ WZRWKLUGV WKH OHQJWK RI WKH JHO 7R LGHQWLI\ WKH VWDUW VLWHV WKH VDPH HQG ODEHOHG SULPHU $/f ZDV XVHG WR SULPH '1$ VHTXHQFLQJ UHDFWLRQV RQ S&6% SODVPLG ZKLFK FRQVLVWV RI DQ (FR59 (FR59 &,7 IUDJPHQW WKDW LQFOXGHV WKH 7$7$ HOHPHQW DQG n KDOI RI WKH FRGLQJ UHJLRQ $/ ZDV XVHG WR SULPH SODVPLG VSHFLILF WUDQVFULSW 7KH VHTXHQFLQJ UHDFWLRQ ZDV SHUIRUPHG DV UHFRPPHQGHG E\ WKH PDQXIDFWXUHU 86 %LRFKHPLFDOf ,Q 9LYR )RRWSULQWLQD ,Q YLYR IRRWSULQWLQJ ZDV SHUIRUPHG HVVHQWLDOO\ DV GHVFULEHG E\ *LQLJHU HW DO *LQLJHU HW DO f ZLWK VRPH PRGLILFDWLRQ 2QH OLWHU RI FXOWXUH ZDV JURZQ LQ HLWKHU <3( RU <3' WR HDUO\ ORJDULWKPLF JURZWK SKDVH 2'f &HOOV ZHUH KDUYHVWHG E\ FHQWULIXJLQJ LQ D -$ URWRU %HFNPDQf DW USP DW URRP

PAGE 55

WHPSHUDWXUH IRU PLQXWHV 7KH VXSHUQDWDQW ZDV GHFDQWHG DQG WKH SHOOHW UHVXVSHQGHG LQ PO RI JURZWK PHGLXP 7KH VXVSHQVLRQV ZHUH WKHQ GLYLGHG LQWR WHQ PO DOLTXRWV LQ DQ 2DNULGJH FHQWULIXJH WXEHV 7ZR PLFUROLWHUV RI FRQFHQWUDWHG GLPHWK\O VXOIDWH '06f ZDV DGGHG WR HDFK DOLTXRW ZKLFK ZHUH KHOG DW URRP WHPSHUDWXUH IRU YDU\LQJ DPRXQWV RI WLPH UDQJLQJ IURP PLQXWHV WR PLQXWHV $W WKH HQG PO LFH FROG 7(1 P0 7ULV+&, S+ P0 ('7$ DQG P0 VRGLXP FKORULGHf VROXWLRQ ZDV DGGHG WR HDFK WR VWRS WKH UHDFWLRQ &HOOV ZHUH FHQWULIXJHG DW USP LQ D -$ URWRU DW r& IRU PLQXWHV DQG VXSHUQDWDQW ZDV GHFDQWHG 3HOOHWV ZHUH UHVXVSHQGHG LQ PO 0 VRUELWRO 0 ('7$ SOXV SL PHUFDSWRHWKDQRO 7R IRUP VSKHURSODVWV SL PJPO PXUHLQDVH %*; XQLWVJ 86 %LRFKHPLFDOf ZDV DGGHG WR HDFK FHOO VXVSHQVLRQ 7KHVH ZHUH LQFXEDWHG DW r& ZLWK JHQWOH VKDNLQJ XQWLO VSKHURSODVWV ZHUH IRUPHG 7KLV XVXDOO\ WRRN DSSUR[LPDWHO\ PLQXWHV 6SKHURSODVW IRUPDWLRQ ZDV GHWHUPLQHG E\ DGGLQJ SL RI FHOO VXVSHQVLRQ WR SL b 6'6 DQG PHDVXULQJ WKH FKDQJH LQ DEVRUEDQFH DW 2' 5HGXFWLRQ LQ DEVRUEDQFH E\ b ZDV FRQVLGHUHG DQ DFFHSWDEOH OHYHO EHIRUH '1$ LVRODWLRQ ZDV SHUIRUPHG 6SKHURSODVWV ZHUH FROOHFWHG E\ FHQWULIXJLQJ IRU PLQXWH GHFDQWLQJ WKH VXSHUQDWDQW DQG UHVXVSHQGLQJ WKH SHOOHW LQ PO P0 7ULV+&, S+ P0 ('7$ 7KH VDPSOH ZDV GLYLGHG LQWR WZR KDOYHV DQG WUDQVIHUUHG LQWR PLFURFHQWULIXJH WXEHV )LIW\ PLFUROLWHUV RI b 6'6 ZHUH DGGHG WR HDFK KDOI ZKLFK ZDV LQFXEDWHG DW r& IRU PLQXWHV WR O\VH VSKHURSODVWV 7ZR KXQGUHG PLFUROLWHUV 0 SRWDVVLXP DFHWDWH S+ ZHUH DGGHG WR HDFK DQG VDPSOHV ZHUH LQFXEDWHG RQ LFH IRU PLQXWHV 6DPSOHV ZHUH FHQWULIXJHG VHTXHQWLDOO\ IRU

PAGE 56

PLQXWHV DQG PLQXWHV LQ D PLFURFHQWULIXJH DQG WKH VXSHUQDWDQWV RI ERWK FHQWULIXJDWLRQV ZHUH SRROHG ,VRSURSDQRO SLf ZDV DGGHG WR HDFK DQG FHQWULIXJHG IRU VHFRQGV WR FROOHFW WKH'1$ SHOOHW 7KH SHOOHW ZDV ULQVHG ZLWK b HWKDQRO GHFDQWHG VXSHUQDWDQW DQG DOORZHG WR DLU GU\ (DFK SHOOHW ZDV UHVXVSHQGHG LQ SL RI 7( S+ 7KH GLYLGHG VDPSOHV ZHUH SRROHG DQG WUHDWHG ZLWK SL SJSO 51DVH $ DW r& IRU DW OHDVW KRXUV WR GLJHVW 51$ $OLTXRWV SLf RI 0 VSHUPLGLQH S+ ZHUH DGGHG WR HDFK VDPSOH XQWLO D '1$ SUHFLSLWDWH DSSHDUHG ,W XVXDOO\ WRRN DERXW DOLTXRWV WR SUHFLSLWDWH '1$ 6DPSOHV ZHUH VHW RQ LFH IRU PLQXWHV DQG FHQWULIXJHG VHFRQGV WR FROOHFW '1$ 6XSHUQDWDQWV ZHUH GHFDQWHG DQG SHOOHWV ZHUH DOORZHG WR DLU GU\ 7KH '1$ SHOOHW ZDV GLVVROYHG E\ DGGLQJ SL 0 DPPRQLXP DFHWDWH WR WKH SHOOHW DQG LQFXEDWLQJ DW r&IRU DW OHDVW KRXUV $EVROXWH HWKDQRO SLf ZDV DGGHG DQG HDFK VDPSOH ZDV KHOG DW r& IRU PLQXWHV WR SUHFLSLWDWH WKH '1$ '1$ ZDV FROOHFWHG E\ FHQWULIXJLQJ IRU PLQXWHV LQ D PLFURFHQWULIXJH DQG GHFDQWLQJ WKH VXSHUQDWDQW 7KH SHOOHWV ZHUH ULQVHG ZLWK b HWKDQRO GULHG LQ YDFXXP DQG UHVXVSHQGHG LQ SL ZDWHU 7KH '1$ ZDV GLJHVWHG ZLWK HLWKHU $FFO RU (FR59 WR DQDO\]H WKH FRGLQJ VWUDQG RU WKH QRQFRGLQJ VWUDQG UHVSHFWLYHO\ $IWHU GLJHVWLRQ WKH '1$ ZDV SUHFLSLWDWHG DQG ZDVKHG WKUHH WLPHV WR UHPRYH UHVLGXDO VDOWV )LUVW RQHKDOI YROXPH RI 0 DPPRQLXP DFHWDWH ZDV DGGHG WR WKH VDPSOH SOXV YROXPH HWKDQRO 6DPSOHV ZHUH VHW LQ D GU\LFH HWKDQRO EDWK IRU PLQXWHV WR SUHFLSLWDWH WKHQ FHQWULIXJHG IRU PLQXWHV LQ D PLFURFHQWULIXJH DQG WKH VXSHUQDWDQWV ZHUH GHFDQWHG 3HOOHWV ZHUH UHVXVSHQGHG LQ SL 7(1 P0 7ULV+&, S+ P0 ('7$ P0 VRGLXP FKORULGHf WKHQ SL

PAGE 57

0 DPPRQLXP DFHWDWH SOXV SL HWKDQRO ZDV DGGHG 7KLV SUHFLSLWDWLRQ ZDV UHSHDWHG DQG WKH SHOOHW ZDV ZDVKHG LQ PO b HWKDQRO 7R FOHDYH WKH '1$ SL FRQFHQWUDWHG 0f SLSHULGLQH )LVKHU %LRWHFKQRORJ\f ZDV DGGHG WR WKH VDPSOH WR PDNH D ILQDO FRQFHQWUDWLRQ RI 0 7KH VDPSOH ZDV WUDQVIHUHG WR D VFUHZ FDS WXEH DQG LQFXEDWHG DW r& IRU PLQXWHV $W WKH HQG RI WKH LQFXEDWLRQ WKH WXEH ZDV FKLOOHG RQ LFH IRU IHZ PLQXWHV DQG O\RSKLOL]HG RYHUQLJKW LQ WKH 6SHHG 9DF 6DYDQWf 7KH SHOOHW ZDV UHVXVSHQGHG LQ SL 0 VRGLXP DFHWDWH S+ 7KHQ YROXPHV RI HWKDQRO ZDV DGGHG DQG WKH VDPSOH ZDV SODFHG LQ D GU\LFH HWKDQRO EDWK '1$ ZDV FROOHFWHG E\ FHQWULIXJDWLRQ LQ DQ (SSHQGRUI FHQWULIXJH 7KH SHOOHW ZDV UHVXVSHQGHG LQ SL 0 VRGLXP DFHWDWH S+ DQG WKH HWKDQRO SUHFLSLWDWLRQ ZDV UHSHDWHG 7KH ILQDO SHOOHW ZDV ULQVHG ZLWK b HWKDQRO DQG GULHG LQ YDFXXP (DFK SHOOHW ZDV UHVXVSHQGHG LQ SL RI VDPSOH G\H DQG ORDGHG RQ D b SRO\DFU\ODPLGHb XUHD JHO 7KH JHO ZDV UXQ DW ZDWWV FRQVWDQW SRZHU LQ 7%( EXIIHU 0 +&, 0 ERUDWH 0 ('7$f XQWLO WKH EURPRSKHQRO EOXH G\H UHDFKHG WKH ERWWRP RI WKH JHO 7KH JHO ZDV SLFNHG XS ZLWK D +\ERQG 1 $PHUVKDPf PHPEUDQH SUHFXW WR WKH VL]H RI WKH JHO DQG SUHVRDNHG LQ 7%( WKH WUDQVIHU EXIIHU 7KH '1$ ZDV WUDQVIHUUHG RQWR WKH Q\ORQ PHPEUDQH E\ HOHFWUREORWWLQJ XVLQJ WKH *HQHVZHHSHU LQVWUXPHQW +RHIHU 6FLHQWLILFf DV UHFRPPHQGHG E\ WKH PDQXIDFWXUHU $IWHU WKH WUDQVIHU WKH QXFOHLF DFLG ZDV FURVVOLQNHG WR WKH PHPEUDQH RQ D WUDQVLOOXPLQDWRU IRU PLQXWHV 3UHK\EULGL]DWLRQ ZDV SHUIRUPHG ZLWK PO RI K\EULGL]DWLRQ VROXWLRQ ZKLFK FRQVLVWHG RI b 6'6 0 VRGLXP SKRVSKDWH S+ b %6$ P0 ('7$ DW r& IRU DW OHDVW PLQXWHV 5DGLRODEHOHG '1$ SUREH ZDV WKHQ DGGHG

PAGE 58

DQG K\EULGL]DWLRQ FDUULHG RXW RYHUQLJKW DW r& ZLWK VKDNLQJ 5DGLRODEHOHG SUREH ZDV SUHSDUHG E\ SULPHU H[WHQVLRQ RQ D VLQJOHVWUDQGHG '1$ WHPSODWH ZLWK D FRPSOHPHQWDU\ ROLJRQXFOHRWLGH XVLQJ WKH .OHQRZ IUDJPHQW RI '1$ SRO\PHUDVH $IWHU K\EULGL]DWLRQ WKH PHPEUDQH ZDV ZDVKHG WKUHH WLPHV DW WKH K\EULGL]DWLRQ WHPSHUDWXUH 7KH ZDVK VROXWLRQ FRQVLVWHG RI b 6'6 P0 VRGLXP SKRVSKDWH S+ P0 ('7$ 3UHSDUDWLRQ RI 6LQDOH6WUDQGHG '1$ 6LQJOHVWUDQGHG '1$ ZDV SUHSDUHG IURP S6/ DQG S6/5 WR VHUYH DV D WHPSODWH LQ JHQHUDWLQJ SUREHV IRU LQ YLYR IRRWSULQW DQDO\VLV 7KHVH WZR SODVPLGV FRQWDLQ WKH XSVWUHDP VHTXHQFHV RI S LQ RSSRVLWH RULHQWDWLRQV DW WKH (FR5, VLWH RQ D SKDJHPLG SODVPLG 7KH VLQJOH VWUDQGHG '1$ JHQHUDWHG IURP HLWKHU SODVPLG ZRXOG EH FRPSOHPHQWDU\ WR HLWKHU WKH FRGLQJ S6/5f RU QRQFRGLQJ S6/f VWUDQGV RI &,7 $Q LVRODWHG FRORQ\ RI ;/ %OXH VWUDLQ FRQWDLQLQJ WKH SODVPLG ZDV JURZQ LQ PO RI VXSHU EURWK FRQWDLQLQJ SJPO RI WHWUDF\FOLQH DQG SJPO RI DPSLFLOOLQ RYHUQLJKW DW r& ZLWK YLJRURXV VKDNLQJ 7ZR DQG KDOI PLOOLOLWHUV RI WKH RYHUQLJKW FXOWXUH ZDV DGGHG WR PO VXSHU EURWK LQ D PO IODVN DQG JURZQ XQWLO WKH 2' UHDFKHG 9&60 KHOSHU SKDJH ZDV DGGHG DW DQ 02, PXOWLSOLFLW\ RI LQIHFWLRQf RI DQG LQFXEDWLRQ FRQWLQXHG IRU DQ DGGLWLRQDO KRXUV 7KH FXOWXUH ZDV KHDWHG DW r& IRU PLQXWHV DQG FHQWULIXJHG DW USP LQ -$ URWRU DW URRP WHPSHUDWXUH 7KH VXSHUQDWDQW ZDV WUDQVIHUHG WR D QHZ WXEH DQG FHQWULIXJHG DJDLQ DV DERYH

PAGE 59

2QHIRXUWK YROXPH RI 0 DPPRQLXP DFHWDWH S+ b SRO\HWK\OHQH JO\FRO 3(*f ZDV DGGHG WR WKH VSKHURSODVW 7KH WXEH ZDV LQYHUWHG VHYHUDO WLPHV WR PL[ WKH VDPSOH ZKLFK ZDV KHOG DW URRP WHPSHUDWXUH IRU PLQXWHV 7KH SHOOHW ZDV FROOHFWHG E\ FHQWULIXJDWLRQ VHTXHQWLDOO\ DW USP DW URRP IRU PLQXWHV DQG PLQXWH GLVFDUGLQJ WKH VXSHUQDWDQW HDFK WLPH 7KH SHOOHW ZDV UHVXVSHQGHG LQ PO 7( S+ DQG PO SKHQROFKORURIRUP f ZDV DGGHG 7KH PL[WXUH ZDV YRUWH[HG IRU PLQXWH DQG FHQWULIXJHG DW USP IRU PLQXWHV LQ WKH -$ URWRU DW URRP WHPSHUDWXUH 7KH DTXHRXV SKDVH ZDV WUDQVIHUUHG WR D IUHVK WXEH DQG WKH H[WUDFWLRQ UHSHDWHG XQWLO QR LQWHUSKDVH ZDV SUHVHQW 7KLV XVXDOO\ WRRN IRXU H[WUDFWLRQV WR DFFRPSOLVK 7KHQ PO FKORURIRUP ZDV DGGHG DQG WKH VDPSOH YRUWH[HG PLQXWH DQG FHQWULIXJHG DW USP LQ -$ URWRU IRU PLQXWHV 7KH DTXHRXV SKDVH ZDV WUDQVIHUHG WR D IUHVK WXEH DQG RQHWKLUG YROXPH 0 DPPRQLXP DFHWDWH ILQDO FRQFHQWUDWLRQ 0f ZDV DGGHG YROXPHV DEVROXWH HWKDQRO ZHUH DGGHG DQG WKH VDPSOH ZDV LQFXEDWHG RQ LFH IRU PLQXWHV WR SUHFLSLWDWH 7KH VDPSOH ZDV WKHQ FHQWULIXJHG DW USP LQ WKH -$ URWRU DW r& 7KH VXSHUQDWDQW ZDV GHFDQWHG DQG WKH SHOOHW ZDV GULHG DQG WKHQ UHVXVSHQGHG LQ SL 7( S+ %DQGVKLIW $VVDYOOQ 9LWUR )RRWSULQWLQD $QDO\VLV 7R GHWHUPLQH LI VHTXHQFHV XSVWUHDP RI WKH 7$7$ HOHPHQW ZHUH LQYROYHG LQ GLUHFW SURWHLQ'1$ LQWHUDFWLRQ EDQGVKLIW DVVD\ DQG LQ YLWUR '1DVH SURWHFWLRQ DVVD\ ZHUH SHUIRUPHG WR LGHQWLILHG VXFK UHJLRQVf )RU WKH EDQGVKLIW DVVD\ D

PAGE 60

VLQJOH HQG UDGLRODEHOHG SUREH IURP WKH XSVWUHDP VHTXHQFH ZDV SUHSDUHG DQG LQFXEDWHG ZLWK DQ H[WUDFW RI \HDVW FHOOV DW URRP WHPSHUDWXUH IRU PLQXWHV ,W ZDV WKHQ UXQ RQ D b QRQGHQDWXULQJ SRO\DFU\ODPLGH f JHO LQ 7%( DW URRP WHPSHUDWXUH DW 9 XQWLO WKH EURPRSKHQRO EOXH G\H KDG PLJUDWHG WR WKH ERWWRP 7KH JHO ZDV GULHG XQGHU YDFXXP DW r& DQG H[SRVHG WR ;UD\ ILOP 7KH FHOO H[WUDFW IRU WKH DVVD\ ZDV SUHSDUHG DV IROORZV $ FHOO FXOWXUH ZDV JURZQ WR HDUO\ ORJDULWKPLF SKDVH 2' a f DQG KDUYHVWHG E\ FHQWULIXJDWLRQ DW USP LQ D -$ URWRU %HFNPDQf IRU PLQXWHV DW r& 7KH FHOO SHOOHW ZDV UHVXVSHQGHG LQ PO H[WUDFWLRQ EXIIHU 0 7ULV+&, S+ 0 DPPRQLXP VXOIDWH P0 PDJQHVLXP FKORULGH P0 ('7$ b JO\FHUROf &HOOV ZHUH ZDVKHG E\ UHVXVSHQVLRQ LQ WKH VDPH EXIIHU DQG UHSHDWHG FHQWULIXJDWLRQ 7KUHH PLOOLOLWHUV RI H[WUDFWLRQ EXIIHU SOXV P0 306) P0 '77 DQG SJPO SHSVWDWLQ ZHUH DGGHG SHU J RI ZHW ZHLJKW RI FHOOV &HOOV ZHUH GLVUXSWHG E\ SDVVLQJ WKURXJK D )UHQFK 3UHVVXUH &HOO DW SVL WKUHH WLPHV 7KH KRPRJHQDWH ZDV WKHQ FHQWULIXJHG DW USP ; Jf IRU PLQXWHV LQ WKH -$ URWRU DW r& 7KH VXSHUQDWDQW ZDV DOLTXRWHG LQWR PLFURFHQWULIXJH WXEHV DQG VWRUHG DW r& 3URWHLQ FRQFHQWUDWLRQV ZHUH GHWHUPLQHG DV GHVFULEHG HDUOLHU 7ZR SUREHV ZHUH XVHG IRU WKH EDQGVKLIW DVVD\V f WR IUDJPHQW DQG f WR IUDJPHQW 7KHVH WZR SUREHV WRJHWKHU VSDQ WKH HQWLUH UHJLRQ RI WKH XSVWUHDP VHTXHQFHV RI S ZKLFK FRQWDLQV DOO RI WKH SUHVXPSWLYH &,7 8$6 7KH SUREHV ZHUH SUHSDUHG E\ XVLQJ ROLJRQXFOHRWLGHV $/$/ 7DEOH f WR JHQHUDWH WKH WR IUDJPHQW LQ D 3&5 UHDFWLRQ DQG SULPHUV $/$/ WR PDNH WKH WR SUREH 6WDQGDUG 3&5

PAGE 61

UHDFWLRQ ZDV SHUIRUPHG DV GHVFULEHG DERYH 7KH DQQHDOLQJ WHPSHUDWXUHV IRU $/$/ DQG $/ ZHUH r& DQG r& UHVSHFWLYHO\ 2QH RI HDFK SDLU RI SULPHUV ZDV HQG ODEHOHG ZLWK 7 SRO\QXFOHRWLGH NLQDVH EHIRUH WKH 3&5 UHDFWLRQ WR PDNH VXUH WKDW RQO\ RQH HQG ZDV ODEHOHG 7KH WZR SUREHV ZHUH XVHG LQVWHDG RI D VLQJOH SUREH WKDW HQFRPSDVVHV WKH HQWLUH UHJLRQ EHFDXVH SUHOLPLQDU\ H[SHULPHQWV VKRZHG WKDW D VLQJOH IUDJPHQW DORQH ZRXOG QRW PLJUDWH LQWR D b f QRQGHQDWXULQJ SRO\DFU\ODPLGH JHO YHU\ ZHOO 6LPLODU 3&5 SURGXFWV DV GHVFULEHG HDUOLHU RU GRXEOH VWUDQGHG ROLJRQXFOHRWLGHV ZHUH XVHG IRU FRPSHWLWLRQ DVVD\ 7KH ROLJRQXFOHRWLGHV ZHUH DQQHDOHG E\ PL[LQJ HTXLPRODU DPRXQWV RI HDFK VWUDQG LQ P0 7ULV+&, S+ P0 0J&, 7KH UHDFWLRQ PL[WXUH ZDV ERLOHG IRU PLQXWHV DQG DOORZHG WR VORZO\ FRRO WR URRP WHPSHUDWXUH 7R LGHQWLI\ WKH H[DFW VHTXHQFHV LQYROYHG LQ WKH EDQGVKLIW DVVD\ D '1DVH SURWHFWLRQ DVVD\ ZDV SHUIRUPHG RQ ERWK VHWV RI SUREHV $IWHU WKH VWDQGDUG EDQGVKLIW DVVD\ SL ; '1DVH EXIIHU DQG SL 8SO 54 '1DVH 3URPHJD &RUSRUDWLRQf ZHUH DGGHG WR WKH UHDFWLRQ PL[WXUH DQG SHUPLWWHG WR GLJHVW IRU VHFRQGV 7KH UHDFWLRQ ZDV WKHQ VWRSSHG E\ DGGLQJ SL 0 ('7$ 7KH VDPSOH ZDV ORDGHG LQWR D b f SRO\DFU\ODPLGH JHO DQG UXQ DV GHVFULEHG DERYH $W WKH HQG RI WKH UXQ WKH ZHW JHO ZDV WKHQ H[SRVHG WR DQ ;UD\ ILOP RYHUQLJKW DW URRP WHPSHUDWXUH 7KH EDQGV ZHUH WKHQ H[FLVHG DQG '1$ HOXWHG RQWR D '($( FHOOXORVH PHPEUDQH LQ DQ DJDURVH JHO 7KH '1$ ZDV UHFRYHUHG IURP WKH '($( PHPEUDQH E\ LQFXEDWLQJ LW DW r& ZLWK KLJK 1(7 0 VRGLXP FKORULGH P0 ('7$ P0 7ULV+&, S+ f IRU PLQXWHV 7KH HOXDWH ZDV WUDQVIHUHG LQWR D IUHVK PLFURFHQWULIXJH WXEH DQG SUHFLSLWDWHG ZLWK PO DEVROXWH

PAGE 62

HWKDQRO DW r& IRU PLQXWHV 3HOOHW ZDV UHVXVSHQGHG LQ SL ZDWHU DQG SL DEVROXWH HWKDQRO ZHUH DGGHG '1$ ZDV SUHFLSLWDWHG DW r& DJDLQ IRU PLQXWHV DQG FHQWULIXJHG DW PD[LPXP VSHHG IRU PLQXWHV 7KH VXSHUQDWDQW ZDV GHFDQWHG DQG WKH SHOOHW ULQVHG ZLWK PO b HWKDQRO 7KH SHOOHW ZDV GULHG LQ D 6SHHG9DF DQG UHVXVSHQGHG LQ SL RI VHTXHQFLQJ G\H VROXWLRQ 7KH VDPSOH ZDV WKHQ ORDGHG RQ D b SRO\DFU\ODPLGH JHO f DQG UXQ DW 9 XQWLO WKH EURPRSKHQRO EOXH KDG PLJUDWHG WZRWKLUGV RI WKH OHQJWK RI WKH JHO &RQWURO UHDFWLRQV ZHUH SHUIRUPHG E\ GLJHVWLQJ QDNHG '1$ ZLWK '1DVH 6HTXHQFH ODGGHU ZDV JHQHUDWHG E\ XVLQJ WKH SULPHU WKDW ZDV HQG ODEHOHG LQ D GLGHR[\ VHTXHQFLQJ UHDFWLRQ 7KH JHO ZDV GULHG DQG H[SRVHG WR ;UD\ ILOP 0HVVHQJHU 51$ 6WDELOLW\ 875 GHOHWLRQf $VVD\ 7KH n XQWUDQVODWHG UHJLRQ DQG WKH FRGLQJ UHJLRQ RQ S SODVPLGV ZHUH LQGLYLGXDOO\ GLVVHFWHG WR GHWHUPLQH WKHLU HIIHFWV RQ WKH VWDELOLW\ RI WKH &,7ODF= IXVLRQ P51$ XVHG 5&3&5 WR GHOHWH WKHVH UHJLRQV HVVHQWLDOO\ DV GHVFULEHG DERYH IRU WKH S6/ SODVPLG $IWHU WKH GHOHWLRQ WKH (FR5, IUDJPHQW ZDV VXEFORQHG LQWR S ZKLFK ZDV WKHQ WUDQVIRUPHG LQWR \HDVW VWUDLQV XVHG SULPHUV $/ DQG $/ SDLU WR GHOHWH WKH n XQWUDQVODWHG UHJLRQ 7KH ILUVW QXFOHRWLGH DGHQLQH RI WKH PDMRU WUDQVFULSWLRQDO VWDUW VLWH ZDV UHWDLQHG 7KH UHVW RI WKH VHTXHQFHV UHPDLQHG HVVHQWLDOO\ WKH VDPH $ VLPLODU VWUDWHJ\ ZDV DOVR XVHG WR GHOHWH WKH FRGLQJ UHJLRQ SUHVHQW LQ WKH &,7ODF= IXVLRQ 7KH SULPHUV XVHG ZHUH $/ DQG $/ 7DEOH f ,Q WKLV FRQVWUXFW WKH GHOHWLRQ ZDV

PAGE 63

FUHDWHG LQ VXFK D ZD\ DV WR UHWDLQ WKH ILUVW FRGRQ RI &,7 ZKLFK ZDV MRLQHG LQ WKH SURSHU UHDGLQJ IUDPH WR WKH ODF= JHQH $IWHU WKH GHOHWLRQ WKHVH FRQVWUXFWV ZHUH VHTXHQFHG WR GHWHUPLQH WKHLU QHZ DGMRXUQLQJ VHTXHQFHV DQG WR EH FHUWDLQ WKDW QR RWKHU PXWDWLRQV ZHUH LQWURGXFHG LQ WKLV UHJLRQ GXULQJ WKH 3&5 UHDFWLRQ 7KH DQQHDOLQJ WHPSHUDWXUH IRU $/ ZDV r& DQG $/$/ ZDV r& 7KH VFKHPDWLF RI KRZ WUDQVFULSWLRQ ZDV WHUPLQDWHG LV SUHVHQWHG LQ )LJXUH ,QWURGXFWLRQ RI 6WRS &RGRQ DW WKH )LIWK $PLQR $FLG 3RVLWLRQ LQ WKH &,7 *HQH 7R LQWURGXFH D VWRS FRGRQ DW WKH ILIWK SRVLWLRQ RQ WKH &,7 SRUWLRQ RI WKH &,7 ODF= IXVLRQ SODVPLG WKH 7UDQVIRUPHUr1 6LWH'LUHFWHG 0XWDJHQHVLV .LW &ORQWHFKf ZDV XVHG DV UHFRPPHQGHG E\ WKH PDQXIDFWXUHU %ULHIO\ WZR SULPHUV ZHUH GHVLJQHG FDOOHG WKH 6HOHFWLRQ SULPHU DQG WKH 0XWDJHQLF SULPHU WR SULPH V\QWKHVLV RI D FRPSOHPHQWDU\ VWUDQG E\ 7 '1$ SRO\PHUDVH DIWHU LQLWLDO GHQDWXUDWLRQ RI WKH WHPSODWH S6/5 7KH VHOHFWLRQ SULPHU LQWURGXFHG D PXWDWLRQ DW D XQLTXH 6HDO VLWH WKDW FRQYHUWHG WKDW UHFRJQLWLRQ VLWH LQWR D QHZ XQLTXH 6WXO VLWH 7KLV HQDEOHG VFUHHQLQJ RI SXWDWLYH PXWDQWV HDVLO\ E\ GLJHVWLRQ RI WKH SXWDWLYH UHFRPELQDQWV ZLWK WKH QHZO\ FUHDWHG 6WXO VLWH 7KH QLFNV RQ WKH QHZO\ V\QWKHVL]HG FRPSOHPHQWDU\ VWUDQG ZHUH VHDOHG E\ 7 '1$ OLJDVH 7KH OLJDWHG '1$ ZDV WKHQ XVHG WR WUDQVIRUP DQ ( FROL VWUDLQ WKDW LV GHILFLHQW LQ '1$ PLVPDWFK UHSDLU D PXW6 VWUDLQ 7KLV DOORZHG WKH DPSOLILFDWLRQ RI ERWK PXWDWHG DQG XQPXWDWHG SODVPLG 7UDQVIRUPDQWV ZHUH JURZQ LQ /% EURWK IRU VHYHUDO JHQHUDWLRQV WKHQ LVRODWHG SODVPLG '1$ 7KH SRRO RI '1$ REWDLQHG ZDV

PAGE 64

GLJHVWHG E\ 6HDO ZKLFK OLQHDUL]HG ZLOG W\SH SODVPLG EXW OHIW SODVPLGV ZLWK D PXWDWHG 6HDO VLWH LQ WKH FLUFXODU IRUP 7KLV SRRO RI '1$ ZDV WKHQ XVHG WR WUDQVIRUP ( FROL D VHFRQG WLPH %HFDXVH WKH OLQHDUL]HG ZLOG W\SH SODVPLGV ZHUH QRW DV HIILFLHQW DV WKH FLUFXODU PXWDWHG SODVPLGV LQ WUDQVIRUPLQJ ( FROL WKH PDMRULW\ RI WKH WUDQVIRUPLQJ '1$ KDG QRZ ORVW WKH 6HDO VLWH EXW KDG REWDLQHG WKH 6WXO VLWH 7KRVH FORQHV ZLWK WKH 6WXO VLWH ZHUH VHTXHQFHG E\ WKH GLGHR[\ VHTXHQFLQJ PHWKRG WR LGHQWLI\ WKRVH WKDW KDG DOVR DFTXLUHG WKH 7 WR WUDQVYHUVLRQ DW SRVLWLRQ &ORQHV WKDW ZHUH YHULILHG WR KDYH WKH FRUUHFW PXWDWLRQV ZHUH VXEVHTXHQWO\ VXEFORQHG LQWR WKH S SODVPLG DW WKH (FR5, VLWH

PAGE 65

7DEOH ( FROL 6WUDLQV 1DPH *HQRW\SH +% VXS( DUD JDO. ODF< SUR$ USV/ [\O PWO UHF$ $PFU&PUUf +VG6UPf & HPFU$f VXS( WKL WKU OHX% ODF< WRQ$ %0+ PXW6 WKL VXS( $ODFSUR$%f >PXW67Q@>)nSUR$% ODFOT=$0@ ;/%OXH UHF$ HQG$ J\U$ WKL KVG5 VXS( UHO$ ODF >)f SUR$% ODFOT=$0 7QWHIf@ 685( HPFU$f $PFU&%KVG605PUUf VEF& UHF% UHFXPX&7QNDQUf XYU& VXS( ODFJ\U$UHO$ WKL HQG$ >)nSUR$% ODFOT=,$07QWHIf@ 7DEOH
PAGE 66

7DEOH 2OLJRQXFOHRWLGHV 8VHG LQ WKLV 5HVHDUFK 1DPH *HQH 3RVLWLRQ 6HTXHQFH n WR n $/ &,7 WR 7*$&$77*7&77*7**$*&& $/ &<& *&$7*&&$7$7 *$7 &$7 *7 $/ FP WR WR 7$*7$7&**$*7$777777**7&7$*&** $/ FP WR 7&&*$7$&7$7&*$&77$7& $/ FP WR *&$$7$7$$7$&7$777$&* $/ FP WR $7$&&7$$$&7$$77$$$* $/ FP WR &&***&**&7*&**& $/ FP WR *&&*&&&**$$$7*$$$$*7$7*$&&&& &* $/ FP WR &*****7&$7$&7777&$777&&***&** & $/ FP WR &7777*7*77$77**$**$7&*&$$7&&& 777**$*&7777 $/ FP WR $$$$*&7&&$$$***$77*&*$7&&7&&$ $7$$&$&$$$$* $/ FP WR &$7777&$$$&$$*$**7&** $/ FP WR *$&&7 &77 *777 *$$$$7 *7 &$$77 *$7 $/ FP WR $7 & $$77 $& $7777 & $$$& $$* $* *7& $/ FP WR **$$$$$$$&*7*$&*&&77 $/ FP WR &$7777 &$77 *$$&**&7 $/ FP WR WR $7&77 ,77 ,77 77,$ ,n*7$77$&&7 $/ FP WR $$$*$77$$77*$*&&*77& $/ FP WR *7$$$7$7 *$*&*77777$&*77 &$&$77 &&7

PAGE 67

7DEOH FRQWLQXHG 1DPH *HQH 3RVLWLRQ 6HTXHQFH n WR n $/ &,7 WR $**&$$7*7*$$&*7$$$$$&*&7&$7$7 77$& $/ &,7 WR *777 *7$7777$*7$$$& $* $/ &,7 WR WR $&$$$&&$7*7&$*&*$7$77$7&$ $/ FP WR *$7$77$7 $$& $$&7$* & $ $/ $PS *7*$&7**7*$**&&7&$$&&$$*7& $/ FP WR *$7 *7 &$*&*$7$7 *$7 &$$&$$&7$*&$ $$$* $/ FP WR &$7&77&*$$$7$*7$77 $/ FP WR WR &*$$*$7*****&*$*&7&*$ 06 FP WR *&7$*$&&$$$$$$7$&777 06 FP WR WR 77**7&7$*&&7*&**&**$$$$$$$&*7 06 FP WR &*&&*&$*&&*&&&**$$$7 06 FP WR WR **&7*&**&***&*$$&77&**$*$777 &7

PAGE 68

7DEOH 3ODVPLGV 8VHG LQ WKLV 5HVHDUFK 'HVLJQDWLRQ &RQVWUXFWLRQ S6+ $SSUR[LPDWHO\ ES RI &,7 VHTXHQFH FRQVLVWLQJ RI ES RI FRGLQJ UHJLRQ DQG VHTXHQFHV IXUWKHU XSVWUHDP LQ S8& 1HZ (QJODQG %LRODEf FXW ZLWK 6PDO <&S= $ \HDVW,( FROL VKXWWOH YHFWRU XVHG WR FDUU\ DOO GHOHWLRQ FRQVWUXFWV 6HH 5LFNH\ f S $SSUR[LPDWHO\ ES RI &,7 VHTXHQFH FRQWDLQHG LQ S6+ IROORZLQJ H[RQXFOHDVH GLJHVWLRQ ZDV VXEFORQHG LQ <&S= FXW ZLWK %DP+,6PDO S6/ $ NE (FR59&ODO IURP S WKDW FRQVLVWV RI ES RI n ODF= VHTXHQFH DQG DSSUR[LPDWHO\ ES RI &,7 VHTXHQFHV IURP WR VXEFORQHG LQWR S%OXHVFULSW .6 6WUDWHJHQHf FXW ZLWK (FR59&ODO S6/ $SSUR[LPDWHO\ ES (FR5, IUDJPHQW IURP S FRQVLVWLQJ HQWLUHO\ &,7 VHTXHQFH VXFORQHG LQWR S%OXHVFULSW .6 FXW ZLWK (FR5, S6/5 6LPLODU WR S6/ WKH LQVHUW LV LQ UHYHUVH RULHQWDWLRQ S*(0$FWLQ $ ES LQWHUQDO &ODO IUDJPHQW IURP $&7 JHQH VXEFORQHG LQWR S*(0 3URPHJDf FXW ZLWK VDPH HQ]\PH JHQHURXV JLIW IURP 'U 5 %XWRZf SO&= *HQHURXV JLIW IURP 'U $ODQ 0\HU <,6/ $SSUR[LPDWHO\ ES RI &,7 n XSVWUHDP VHTXHQFH IURP S6/ VXEFORQHG LQWR SO&= FXW ZLWK 6PDO;KRO <,6/5 6LPLODU WR <,6/5 WKH LQVHUW LV LQ UHYHUVH RULHQWDWLRQ <,6/; 'RXEOH VWUDQGHG ROLJRQXFOHRWLGH FRUUHVSRQGLQJ WR VHTXHQFHV EHWZHHQ WR ZDV DQQHDOHG DQG VXEFORQHG LQWR SO&= GLJHVWHG ZLWK ;KRO <,6/$ 6LPLODU WR S H[FHSW WKDW VHTXHQFHV EHWZHHQ WR ES RI &,7 VHTXHQFH KDYH EHHQ GHOHWHG <,6/$ 6LPLODU WR S H[FHSW WKDW VHTXHQFHV EHWZHHQ WR ES RI &,7 VHTXHQFH KDYH EHHQ GHOHWHG

PAGE 69

7DEOH FRQWLQXHG 'HVLJQDWLRQ &RQVWUXFWLRQ <,6/6723 6LPLODU WR S H[FHSW WKDW D 7 WR WUDQVYHUVLRQ PXWDWLRQ ZDV LQWURGXFHG DW SRVLWLRQ RI WKH &,7 VHTXHQFH

PAGE 70

5(68/76 $QDO\VLV RI n 'LVWDOf DQG n 3UR[LPDOf 'HOHWLRQV 6WXGLHV E\ +RRVHLQ DQG /HZLQ f VKRZHG WKDW WKHUH ZHUH LQFUHDVHG DPRXQWV RI &,7 WUDQVODWDEOH P51$ LQ FHOOV JURZQ LQ JOXFRVH PHGLXP DV WKH\ DSSURDFK VWDWLRQDU\ JURZWK SKDVH DQG EHJLQ WR XWLOL]H HWKDQRO DV D SULPDU\ FDUERQ VRXUFH /RJDULWKPLFJURZWK SKDVH FHOOV JURZQ LQ HWKDQRO FRQWDLQHG PRUH &,7 P51$ WKDQ ORJ SKDVH FHOOV IURP D JOXFRVH FXOWXUH 7KLV REVHUYDWLRQ VXJJHVWHG WKDW WKH LQFUHDVHG VWHDG\VWDWH OHYHO RI &,7 P51$ PD\ EH GXH WR DQ LQFUHDVHG UDWH RI WUDQVFULSWLRQ RU WR D GHFUHDVHG UDWH RI WXUQRYHU LQ HWKDQRO PHGLXP 0\ LQLWLDO IRFXV ZDV WR GHWHUPLQH WKH ERXQGDULHV RQ WKH VHTXHQFHV XSVWUHDP RI WKH WUDQVFULSWLRQDO LQLWLDWLRQ VLWH WKDW PD\ FRQWULEXWH WR WKH KLJKOHYHO H[SUHVVLRQ RI &,7 LQ HWKDQRO PHGLXP RU JOXFRVH GHSOHWHG PHGLXP 7KH GHFLVLRQ WR FKDUDFWHUL]H WKH 8$6 XSVWUHDP DFWLYDWLQJ VHTXHQFHf HOHPHQWV ZDV EDVHG LQ SDUW RQ WKH SUHVHQFH RI D SHUIHFW PDWFK WR WKH QLQH QXFOHRWLGH 71$77**7f FRQVHQVXV ELQGLQJ VLWH IRU WKH WULPHULF SURWHLQ +DSS+DSS+DSS 7KLV SURWHLQ FRPSOH[ KDV EHHQ ZHOO FKDUDFWHUL]HG DQG VKRZQ WR EH UHTXLUHG IRU KLJKOHYHO H[SUHVVLRQ RI JHQHV HQFRGLQJ SURWHLQV LQ WKH PLWRFKRQGULDO HOHFWURQ WUDQVSRUW FKDLQ 7UXHEORRG HW DO 7UDZLFN HW DO

PAGE 71

f 7&$ F\FOH JHQHV %RZPDQ HW DO *DQJORII HW DO 5HSHWWR DQG 7]DJDORII f DQG KHPH ELRV\QWKHVLV .HQJ DQG *XDUHQWH f 7KH VWUDWHJ\ HPSOR\HG WR LGHQWLI\ UHJXODWRU\ HOHPHQWV LQYROYHG IXVLRQ RI D IUDJPHQW RI '1$ IURP WKH &,7 ZLWK WKH ( FROL ODF= JHQH 7KH &,7 VHJPHQW FRQWDLQHG VRPH RI WKH FRGLQJ VHTXHQFHV DQG WKH WUDQVFULSWLRQDO UHJXODWRU\ XQLW ZKLFK FRQVLVWHG RI WKH 7$7$ HOHPHQW WUDQVFULSWLRQDO VWDUW VLWH DQG WKH SXWDWLYH 8$6 HOHPHQWV 6HTXHQWLDO GHOHWLRQ RI WKH SXWDWLYH 8$6 HOHPHQW ZDV SHUIRUPHG LQ D PDQQHU WKDW GHOHWLRQ SURJUHVVHG WRZDUG RU DZD\ IURP WKH WUDQVFULSWLRQDO VWDUW VLWH 'HOHWLRQV WKDW SURJUHVVHG WRZDUG WKH WUDQVFULSWLRQDO VWDUW VLWH ZHUH GHVLJQDWHG n GLVWDOf GHOHWLRQV )LJXUH f DQG WKRVH WKDW SURJUHVVHG DZD\ IURP WKH WUDQVFULSWLRQDO VWDUW VLWH ZHUH GHVLJQDWHG n SUR[LPDOf GHOHWLRQV )LJXUH f 7KH ODF= JHQH ZDV XVHG DV D UHSRUWHU JHQH IRU VHYHUDO UHDVRQV )LUVW GHOHWLRQ RI WKH &,7 JHQH LQ \HDVW FDXVHV VORZHU JURZWK .LVSDO HW DO f ZKLFK PD\ OHDG WR SOHLRWURSLF HIIHFWV RQ RWKHU PHWDEROLF SURFHVVHV WKHUHIRUH WKH QDWLYH &,7 JHQH RQ WKH FKURPRVRPH ZDV OHIW LQWDFW 6HFRQG WKHUH LV DQRWKHU FLWUDWH V\QWKDVH LVR]\PH HQFRGHG E\ WKH &,7 JHQH .LP HW DO /HZLQ HW DO f ZKLFK SDUWLDOO\ FRPSHQVDWHV IRU &,7 GHOHWLRQ .LP HW DO f 7KLV PDNHV DVVD\LQJ IRU FLWUDWH V\QWKDVH DFWLYLW\ RI D &,7 JHQH RQ D SODVPLG LPSUDFWLFDO 7KHUHIRUH LQ RUGHU WR GHWHUPLQH WKH HIIHFW RI WKH XSVWUHDP VHTXHQFH GHOHWLRQV RQ &,7 JHQH H[SUHVVLRQ WKH UHSRUWHU JHQH ZDV XVHG 7KH JHQH IRU JDODFWRVLGDVH ZDV XVHG EHFDXVH WKHUH LV QR VLPLODU DFWLYLW\ LQ \HDVW WKHUHIRUH DQ\ HQ]\PH DFWLYLW\ GHWHFWHG ZRXOG EH IURP WKH SODVPLG FDUU\LQJ WKH JHQH DQG XQGHU WKH FRQWURO RI WKH &,7 SURPRWHU HOHPHQWV 7KH YHFWRU SODVPLG <&S=

PAGE 72

5LFNH\ f FRQWDLQV &(1 DQG $56 VHTXHQFHV ZKLFK ZHUH QHFHVVDU\ IRU WKH SODVPLG WR UHSOLFDWH DQG EH PDLQWDLQHG DW DSSUR[LPDWHO\ D VLQJOH FRS\ SHU \HDVW FHOO ,W DOVR KDV D 753 PDUNHU IRU VHOHFWLRQ LQ \HDVW DQ RULJLQ RI UHSOLFDWLRQ IRU ( FROL DQG WKH EOD DPSLFLOOLQ UHVLVWDQFH JHQH IRU VHOHFWLRQ LQ ( FROL 5HFRPELQDQW SODVPLGV ZHUH WUDQVIRUPHG LQWR WKH 6% \HDVW VWUDLQ DQG VHOHFWHG IRU WUDQVIRUPDQWV RQ 6' bf PHGLXP FRQWDLQLQJ SJPO KLVWLGLQH SJPO OHXFLQH DQG SJPO XUDFLO 7RWDO FHOOXODU H[WUDFW ZDV SUHSDUHG IURP DW OHDVW WZR GLIIHUHQW LVRODWHV RI HDFK WUDQVIRUPLQJ SODVPLG DQG LWV JDODFWRVLGDVH DFWLYLW\ GHWHUPLQHG LQ WULSOLFDWH DV GHVFULEHG LQ PDWHULDOV DQG PHWKRGV )LJXUH VKRZV WKH VSHFLILF DFWLYLWLHV REWDLQHG IURP WKH VHOHFWHG GHOHWLRQ PXWDQWV &,7 PXWDQWV ZHUH QDPHG DFFRUGLQJ WR WKH HQGSRLQWV RI WKH GHOHWLRQ UHODWLYH WR WKH PDMRU WUDQVFULSWLRQDO VWDUW VLWH 'HOHWLRQV IURP WKH n HQG RI WKH JHQH WKDW H[WHQGHG WRZDUG WKH WUDQVFULSWLRQDO VWDUW VLWH GLG QRW VKRZ DQ\ VLJQLILFDQW UHGXFWLRQ LQ VSHFLILF DFWLYLW\ XQWLO WKH\ H[WHQGHG EH\RQG SRVLWLRQ +HQFH WKH DFWLYLW\ RI WKLV FORQH ZDV GHVLJQDWHG ZLOGW\SH OHYHO DQG DOO RWKHU FORQHV ZHUH FRPSDUHG WR LW WR DVVHVV WKH HIIHFW RI GHOHWLRQ 7KHUH ZDV DERXW D IROG LQGXFWLRQ ZKHQ WKH S FORQH FDUU\LQJ VWUDLQ ZDV JURZQ LQ DQ HWKDQRO PHGLXP FRPSDUHG WR ZKHQ JURZQ LQ JOXFRVH 7KLV LV VRPHZKDW KLJKHU WKDQ WKH LQGXFWLRQ RI FLWUDWH V\QWKDVH DFWLYLW\ XVXDOO\ REVHUYHG LQ \HDVW VXJJHVWLQJ WKDW JDODFWRVLGDVH PD\ EH PRUH VWDEOH LQ \HDVW WKDQ FLWUDWH V\QWKDVH +RZHYHU LW VKRXOG EH QRWHG WKDW WKH OHYHO RI LQGXFWLRQ RI FLWUDWH V\QWKDVH EHWZHHQ GHUHSUHVVLQJ DQG UHSUHVVLQJ PHGLD YDULHV FRQVLGHUDEO\ EHWZHHQ VWUDLQV )XUWKHU UHPRYDO RI VHTXHQFHV WR SRVLWLRQ FDXVHG RQO\ D VOLJKW GHFUHDVH LQ 3

PAGE 73

)LJXUH *DODFWRVLGDVH $FWLYLW\ RI n DQG n 'HOHWLRQV LQ &RPSOH[ 0HGLXP $f 7KH WRS OLQH UHSUHVHQWV WKH &,7 VHTXHQFH IURP ZKLFK DOO WKH n DQG n GHOHWLRQV ZHUH GHULYHG 7KH QXPEHU RI HDFK GHOHWLRQ FRQVWUXFW UHSUHVHQWV WKH GHOHWLRQ HQGSRLQW
PAGE 74

$ U $7* 6SHFLILF $FWLYLW\ <3(<3' _ ,W$7$O <3' <3( , A A , a , _ ZZ A , nYO ZZ , nn , [ L % 9\A/

PAGE 75

JDODFWRVLGDVH OHYHO H[SUHVVHG IURP WKLV FORQH S LQ D GHUHSUHVVLQJ PHGLXP EXW SURGXFHG DERXW b UHGXFWLRQ LQ D UHSUHVVLQJ JOXFRVH PHGLXP &RQVHTXHQWO\ WKHUH ZDV D KLJKHU IROG LQGXFWLRQ RI WKH S FORQH WKDQ WKH S FORQH 5HPRYDO RI DGGLWLRQDO EDVH SDLUV Sf FDXVHG D VHYHUH UHGXFWLRQ LQ JDODFWRVLGDVH OHYHO H[SUHVVHG LQ D UHSUHVVLQJ PHGLXP ZKLOH DFWLYLW\ ZDV UHGXFHG RQO\ DERXW b LQ D GHUHSUHVVLQJ PHGLXP 7KH RYHUDOO LQGXFWLRQ <3(<3' RI S ZDV IROG ZKLFK ZDV DOPRVW VHYHQ WLPHV WKH IROG LQGXFWLRQ IRU S ,Q FORQH S WKH VSHFLILF DFWLYLW\ LQ JOXFRVH DQG HWKDQRO ZDV UHGXFHG WR DERXW b RI ZLOGW\SH OHYHO 7KHUHIRUH WKH OHYHO RI LQGXFWLRQ RI HWKDQRO YHUVXV JOXFRVH PHGLD ZDV DERXW WKH VDPH DV WKH ZLOGW\SH OHYHO 'HOHWLRQV EHJLQQLQJ IURP WKH n RU SUR[LPDO HQG RI WKH XSVWUHDP VHTXHQFH UHVXOWHG LQ D UDQJH RI VSHFLILF DFWLYLWLHV IURP WLPHV JUHDWHU WKDQ WKH ZLOGW\SH LQVHUW LQ D UHSUHVVLQJ PHGLXP <3'f WR D EDUHO\ GHWHFWDEOH OHYHO ,Q WKH GHUHSUHVVLQJ PHGLXP <3( WKH DFWLYLW\ UDQJHG IURP b RI ZLOGW\SH OHYHO WR DERXW b RI WKH ZLOGW\SH OHYHO ,Q FORQH S WKH VHTXHQFH IURP WR ZDV GHOHWHG ,Q WKLV FORQH VSHFLILF DFWLYLWLHV ZHUH FRQVLVWHQWO\ KLJKHU WKDQ ZLOG W\SH LQ FHOOV IURP ERWK PHGLD VXJJHVWLQJ WKDW DQ XSVWUHDP UHSUHVVLQJ VHTXHQFH 856f PD\ KDYH EHHQ UHPRYHG 5RVHQNUDQW] DQG KLV FROOHDJXHV f DOVR IRXQG WKDW UHPRYLQJ VHTXHQFHV LQ WKLV UHJLRQ FDXVHG DQ LQFUHDVH LQ JDODFWRVLGDVH OHYHO H[SUHVVHG IURP D &,7ODF= IXVLRQ JHQH $ GHOHWLRQ WKDW VWRSSHG DW SRVLWLRQ KDG D VSHFLILF DFWLYLW\ WKDW ZDV QHDUO\ b RI ZLOGW\SH LQ WKH <3( PHGLXP EXW DOPRVW WLPHV JUHDWHU WKDQ ZLOGW\SH LQ FHOOV JURZQ LQ

PAGE 76

WKH <3' PHGLXP 5HPRYDO RI DQ DGGLWLRQDO ES FORQH S UHGXFHG VSHFLILF DFWLYLW\ E\ WZRWKLUGV LQ <3( EXW VWLOO PDLQWDLQHG D VOLJKW LQFUHDVH XQLWVPJ SURWHLQf RYHU ZLOGW\SH OHYHO LQ <3' &ORQH S H[SUHVVHG JDODFWRVLGDVH OHYHO WKDW ZDV DSSUR[LPDWHO\ b RI ZLOGW\SH LQ ERWK <3' DQG <3( PHGLD )XUWKHU GHOHWLRQ WR SRVLWLRQ SURGXFHG EDUHO\ GHWHFWDEOH HQ]\PH DFWLYLW\ LQ FHOOV FDUU\LQJ WKLV FORQH LQ <3' PHGLXP DQG RQO\ DERXW b RI WKH ZLOGW\SH OHYHO LQ <3( PHGLXP 7KHVH n DQG n GHOHWLRQV VKRZHG WKDW WKHUH DUH WKUHH UHJLRQV WKDW FDXVHG LQFUHDVH RI &,7 H[SUHVVLRQ LQ <3' DQG <3( PHGLD 7KHVH UHJLRQV LQFOXGH VHTXHQFHV EHWZHHQ WR WR DQG WR ,Q DGGLWLRQ VHTXHQFHV EHWZHHQ DQG KDYH D UHSUHVVLQJ HIIHFW WKDW LV PRVW SURQRXQFHG LQ WKH <3' PHGLXP 7KHUH KDYH EHHQ WZR UHSRUWV LQ \HDVW .LP HW DO *DQJORII HW DO f DQG RQH LQ % VXEWLOLV 5RVHQNUDQW] HW DO f ZKLFK VKRZHG WKDW DGGLWLRQ RI JOXWDPDWH WR FXOWXUHV JURZQ LQ D PLQLPDO PHGLXP UHSUHVVHG WKH DFWLYLW\ RI FLWUDWH V\QWKDVH DQG DFRQLWDVH JDODFWRVLGDVH OHYHOV H[SUHVVHG LQ \HDVW FHOOV EHDULQJ WKH GHOHWLRQ FRQVWUXFWV ZHUH LGHQWLFDO ZKHWKHU FHOOV ZHUH JURZQ LQ 6'bf RU 6'bf PHGLXP VXSSOHPHQWHG ZLWK JOXWDPDWH 5LFNH\ f +RZHYHU LW ZDV REVHUYHG WKDW WKH JDODFWRVLGDVH OHYHOV H[SUHVVHG IURP PRVW RI WKHVH GHOHWLRQ FRQVWUXFWV ZHUH VXEVWDQWLDOO\ KLJKHU LQ D PLQLPDO PHGLXP ZLWK b GH[WURVH WKDQ LQ WKH <3' bf PHGLXP 7KH UHVXOWV RI WKH VSHFLILF DFWLYLWLHV REWDLQHG IURP FHOOV JURZQ LQ WKH 6' PHGLXP KDUERULQJ WKH GHOHWLRQ FRQVWUXFWV DUH SUHVHQWHG LQ )LJXUH 7KH ZLOGW\SH FORQH SURGXFHG WLPHV PRUH JDODFWRVLGDVH DFWLYLW\ LQ 6'bf XQLWVPJ SURWHLQf WKDQ LQ <3'bf

PAGE 77

)LJXUH *DODFWRVLGDVH $FWLYLW\ RI n DQG n 'HOHWLRQV LQ 0LQLPDO 0HGLXP 6HFWLRQV $f DQG %f DUH DV GHVFULEHG LQ )LJXUH SJDODFWRVLGDVH DVVD\V ZHUH SHUIRUPHG IURP FXOWXUHV JURZQ LQ 6'bf DV GHVFULEHG LQ ILJXUH

PAGE 78

: , A , :0 $7* , L [ A , , a , nn /Ba , L 6SHFLILF $FWLYLW\ 6'bf aYO

PAGE 79

XQLWVPJ SURWHLQf 7KLV ODUJH HIIHFW ZDV ORVW ZKHQ VHTXHQFHV XS WR ZHUH GHOHWHG 'HOHWLRQ FRQVWUXFWV EHJLQQLQJ IURP WKH n HQG RI WKH &,7 XSVWUHDP VHTXHQFHV VKRZHG VLJQLILFDQW UHGXFWLRQ LQ JDODFWRVLGDVH H[SUHVVHG IURP WKHP ZKHQ GHOHWLRQ H[WHQGHG XS WR SRVLWLRQ 7KHUH ZDV QR LQFUHDVH LQ VSHFLILF DFWLYLW\ IURP FORQH S FRPSDUHG WR WKH ZLOGW\SH FORQH 7KLV ZRXOG VXJJHVW WKDW WKH VHTXHQFHV EHWZHHQ DQG DUH LQYROYHG LQ UHJXODWLRQ RI &,7 LQ UHVSRQVH WR JOXFRVH EXW QRW LQ UHVSRQVH WR PLQLPDO PHGLXP 7KHUH DUH WZR SXWDWLYH FRUH *&1 FRQVHQVXVELQGLQJ VLWHV WKDW OLH EHWZHHQ DQG DQG DQG ZKLFK PD\ EH UHVSRQGLQJ WR JURZWK LQ D PLQLPDO PHGLXP *&1 LV D WUDQVFULSWLRQDO DFWLYDWRU LQYROYHG LQ WKH UHJXODWLRQ RI JHQHV LQ WKH DPLQR DFLG ELRV\QWKHVLV SDWKZD\ UHYLHZHG LQ +LQQHEXVFK f 5HGXFWLRQ LQ H[SUHVVLRQ IURP FORQH S WR b RI ZLOGW\SH DQG FORQH S WR OHVV WKDQ b RI ZLOG W\SH VXJJHVW WKDW DOO WKH QHFHVVDU\ VHTXHQFHV IRU UHJXODWLRQ LQ D PLQLPDO PHGLXP OLH LQ WKLV UHJLRQ ,Q FORQH S WKH WZR SXWDWLYH *&1 ELQGLQJ VLWHV ZHUH GHOHWHG ZKHUHDV LQ FORQH S WKH SUR[LPDO VLWH ZDV GHOHWHG DQG WKH GLVWDO VLWH ZDV GLVUXSWHG 7KH UHVXOWV RI WKHVH n DQG n GHOHWLRQV VKRZHG WKDW VHYHUDO UHJLRQV EHWZHHQ VHTXHQFHV DQG DQG DQG DQG LQ WKH XSVWUHDP VHTXHQFH WKDW FRQWULEXWH WR WUDQVFULSWLRQDO UHJXODWLRQ RI WKLV JHQH ,W LV FOHDU WKDW WKHVH VHTXHQFHV KDYH DFWLYDWLQJ IXQFWLRQV EHFDXVH ZKHQ GHOHWHG WKH\ UHGXFHG VSHFLILF DFWLYLWLHV EXW WKH VHTXHQFH EHWZHHQ DQG KDV D UHSUHVVLQJ HIIHFW LQ UHVSRQVH WR JOXFRVH 7KH VHTXHQFHV QHFHVVDU\ IRU UHJXODWLRQ LQ D PLQLPDO PHGLXP OLH EHWZHHQ DQG

PAGE 80

,QWHUQDO 'HOHWLRQV 6KRZ 6HYHUDO 3XWDWLYH 8$6V 7KH UHVXOWV RI WKH H[RQXFOHDVH GHOHWLRQV RI WKH &,7 QRQWUDQVFULEHG UHJLRQ VXJJHVWHG WKDW WKHUH ZDV PRUH WKDQ D VLQJOH HOHPHQW ZKLFK PD\ EH LQYROYHG LQ WKH UHJXODWLRQ RI WKLV JHQH ,Q \HDVWV DQG RWKHU HXNDU\RWHV UHJXODWRU\ HOHPHQWV VXFK DV 8$6V DQG SUR[LPDO UHJXODWRU\ HOHPHQWV VXFK DV 6S DQG $3 VLWHV PD\ OLH LQ FORVH SUR[LPLW\ WR HDFK RWKHU 7KHUHIRUH WKHUH LV LQFUHDVHG OLNHOLKRRG WKDW PRUH WKDQ RQH UHJXODWRU\ HOHPHQW PD\ EH UHPRYHG GXULQJ H[RQXFOHDVH GLJHVWLRQ 7R WHVW IRU WKLV LQGLYLGXDO UHJLRQV ZHUH GLVVHFWHG IURP WKH XSVWUHDP VHTXHQFHV E\ LQYHUVH 3&5 7KH UHJLRQV GHOHWHG LQFOXGH SRVLWLRQV f WR f WR f WR DQG f WR 7KHVH UHJLRQV ZHUH FKRVHQ IRU WKH LQWHUQDO GHOHWLRQ DQDO\VLV EHFDXVH WKH UHVXOWV RI WKH GLUHFWLRQDO GHOHWLRQV IURP WKH SUR[LPDO DQG GLVWDO HQGV VXJJHVWHG WKDW WKH\ PD\ EH LPSRUWDQW LQ UHJXODWLQJ WKLV JHQH ,Q FORQH S$ WKH VHTXHQFHV EHWZHHQ DQG ZHUH GHOHWHG 7KLV UHJLRQ RI &,7 XSVWUHDP VHTXHQFHV KDV WKH FRQVHQVXV ELQGLQJ VLWH IRU WKH +DSS+DSS+DSS WUDQVFULSWLRQDO DFWLYDWRU SURWHLQ DW WR 6HYHUDO ODERUDWRULHV KDYH VKRZQ WKDW WKH +DSS+DSS+DSS DFWLYDWRU LV LQYROYHG LQ UHJXODWLRQ RI PDQ\ JHQHV IRU PLWRFKRQGULDO SURWHLQV LQFOXGLQJ &<& 2OHVHQ HW DO *XDUHQWH DQG 0DVRQ f +(0 .HQJ DQG *XDUHQWH f &2; 7UXHEORRG HW DO f .*' 5HSHWWR DQG 7]DJRORII f /3' %RZPDQ HW DO f DQG $& *DQJORII HW DO f 5HPRYDO RI WKLV UHJLRQ UHGXFHG WKH VSHFLILF DFWLYLW\ RI JDODFWRVLGDVH E\ RQHWKLUG WR DSSUR[LPDWHO\

PAGE 81

XQLWV SHU PLOOLJUDP SURWHLQ LQ WKH GHUHSUHVVLQJ PHGLXP <3( )LJXUH f +RZHYHU LQ WKH <3' PHGLXP WKH VSHFLILF DFWLYLW\ REWDLQHG IRU WKLV GHOHWLRQ ZDV XQLWV SHU PLOOLJUDP SURWHLQ ZKLFK LV KLJKHU WKDQ WKH ZLOGW\SH OHYHO 7KH VHFRQG UHJLRQ GHOHWHG ZHUH VHTXHQFHV IURP WR ZLWK UHVSHFW WR WKH WUDQVFULSWLRQDO VWDUW VLWH 6SHFLILF DFWLYLW\ ZDV UHGXFHG WR DQG XQLWVPJ SURWHLQ LQ JOXFRVH DQG HWKDQRO PHGLD UHVSHFWLYHO\ 7KLV UHSUHVHQWHG D IROG UHGXFWLRQ LQ WKH JOXFRVH PHGLXP EXW RQO\ D IROG UHGXFWLRQ LQ WKH HWKDQRO PHGLXP 7KH WKLUG UHJLRQ GHOHWHG ZHUH WKH VHTXHQFHV IURP WR DQG WKH SODVPLG ZDV QDPHG S$ 5HPRYDO RI WKLV UHJLRQ ZKLFK ZDV ES LQ OHQJWK GUDVWLFDOO\ UHGXFHG WKH VSHFLILF DFWLYLW\ RI JDODFWRVLGDVH ,Q D GHUHSUHVVLQJ PHGLXP WKH VSHFLILF DFWLYLW\ ZDV UHGXFHG WR XQLWV SHU PLOOLJUDP SURWHLQ ZKLFK ZDV DSSUR[LPDWHO\ IROG ORZHU WKDQ WKH ZLOGW\SH OHYHO +RZHYHU LQ D UHSUHVVLQJ PHGLXP WKH UHGXFWLRQ ZDV PRUH VHYHUH ORZHULQJ DFWLYLW\ QHDUO\ IROG UHODWLYH WR WKH ZLOGW\SH OHYHO LQ D VLPLODU PHGLXP 7KH IRXUWK LQWHUQDO GHOHWLRQ FRQVWUXFWHG HQFRPSDVVHG DOO WKH RWKHU WKUHH GHOHWLRQV SUHYLRXVO\ GHVFULEHG IURP SRVLWLRQV WR 7KHUH ZDV DSSUR[LPDWHO\ XQLWV SHU PLOOLJUDP SURWHLQ RI VSHFLILF DFWLYLW\ GHWHFWHG LQ FORQH S$ LQ D GHSUHVVLQJ PHGLXP ZKLFK ZDV QHDUO\ IROG ORZHU WKDQ WKH ZLOGW\SH DFWLYLW\ LQ D VLPLODU PHGLXP ,Q <3' PHGLXP WKH VSHFLILF DFWLYLW\ IRU WKLV FRQVWUXFW ZDV RQO\ XQLWV ZKLFK LV IROG ORZHU WKDQ WKH ZLOGW\SH DFWLYLW\ 7KH IROG LQGXFWLRQ LQ D GHUHSUHVVLQJ PHGLXP YHUVXV D UHSUHVVLQJ PHGLXP ZDV WLPHV LQ FHOOV KDUERULQJ FORQH S$ 7KLV OHYHO RI LQGXFWLRQ UHIOHFWV WKH YHU\ ORZ DFWLYLW\

PAGE 82

)LJXUH *DODFWRVLGDVH $FWLYLW\ RI ,QWHUQDO 'HOHWLRQ &RQVWUXFWV $f ,QWHUQDO GHOHWLRQV ZHUH FRQVWUXFWHG E\ XVLQJ LQYHUVH 3&5 ZLWK SULPHUV WKDW VXUURXQG WKH UHJLRQ RI LQWHUHVW 7KH &,7 VHTXHQFHV SUHVHQW LQ WKH ZLOGW\SH FORQH ZDV XVHG DV WKH WHPSODWH LQ WKH 3&5 7KH +$3 V\PERO UHSUHVHQWV WKH UHJLRQ RQ WKH &,7 VHTXHQFH WKDW KDV WKH FRQVHQVXV VLWH IRU WKH WUDQVFULSWLRQDO DFWLYDWRU +$3 >JDODFWRVLGDVH DFWLYLW\ UHSUHVHQWV WKH DYHUDJH IURP WULSOLFDWH DVVD\ IURP DW OHDVW WZR WUDQVIRUPDQWV %f $ VFKHPDWLF LQWHUSUHWDWLRQ RI UHJLRQV ZLWK 8$6 DFWLYLW\

PAGE 83

$ : $7* , / LI PL U LiiiD , , , , 6SHFLILF $FWLYLW\ <3' <3( <3(<3' *f % : LL $7* (c

PAGE 84

IURP WKLV FRQVWUXFW LQ <3' FRQILUPLQJ WKDW WKH UHVSRQVH WR JOXFRVH FDQ EH PHGLDWHG E\ VHTXHQFHV RXWVLGH WKLV UHJLRQ HJ WKH 856 IURP WR f 7KH UHVXOWV REWDLQHG ZLWK S DQG S$ VHHP DW RGGV EHFDXVH WKH UHJLRQ GHOHWHG IURP WKH S$ FORQH ZDV DOVR GHOHWHG IURP WKH S FORQH \HW DFWLYLWLHV UHPDLQ UHODWLYHO\ KLJK LQ S HVSHFLDOO\ LQ GHUHSUHVVLQJ PHGLD 7KH VHTXHQFHV EHWZHHQ DQG ZHUH SUHVHQW LQ S$ EXW ZHUH GHOHWHG IURP FORQH S 7KLV UHVXOW VXJJHVWV WKDW WKH WR UHJLRQ PD\ FRQWDLQ D 856 7KHUH DUH 0XOWLSOH 8$6 (OHPHQWV 8SVWUHDP DFWLYDWLQJ VHTXHQFHV KDYH E\ GHILQLWLRQ WKH DELOLW\ WR DFWLYDWH WKH WUDQVFULSWLRQ RI WKHLU FRJQDWH JHQH RU D KHWHURORJRXV JHQH LQ DQ RULHQWDWLRQ LQGHSHQGHQW PDQQHU 7KH DFWLYDWLRQ PD\ VKRZ UHJXODWLRQ LQ WKH KHWHURORJRXV FRQWH[W VLPLODU WR WKDW LQ WKH QDWLYH JHQH 7R VKRZ WKDW WKH ZKROH XSVWUHDP VHTXHQFH SUHVHQW LQ S DQG VHJPHQWV RI LW KDYH HLWKHU D 8$6 RU 856 IXQFWLRQ WKH HQWLUH UHJLRQ RU VPDOOHU UHJLRQV ZHUH VXEFORQHG LQWR SODVPLG SO&= ZKRVH 8$6 HOHPHQWV ZHUH UHPRYHG E\ GLJHVWLRQ ZLWK UHVWULFWLRQ HQ]\PHV ;KRO DQG 6PDO 7KH LPSRUWDQW IHDWXUHV RI WKLV SODVPLG ZHUH WKH SUHVHQFH RI WKH &<& SURPRWHU HOHPHQWV 8$6 DQG 8$6 WKH 7$7$ HOHPHQW WKH WUDQVFULSWLRQDO VWDUW VLWH DQG RQO\ WKUHH QXFOHRWLGHV RI WKH FRGLQJ UHJLRQ IXVHG WR WKH ODF= JHQH 8$6 KDV VHYHQ RI HLJKW QXFOHRWLGHV RI WKH FRQVHQVXV VHTXHQFH WKDW ELQGV WR WKH +DSS+DSS+DSS WUDQVFULSWLRQDO DFWLYDWRU

PAGE 85

FRPSOH[ 8VH RI WKLV SODVPLG ZRXOG DOORZ GLUHFW FRPSDULVRQ RI WKH SXWDWLYH 8$6FQ WR 8$6F\FI UHJXODWLRQ E\ WKH +DS DFWLYDWRU FRPSOH[ PHQWLRQHG HDUOLHU VLQFH WKH\ ERWK KDYH WKH FRQVHQVXV VLWH IRU WKH DFWLYDWRU 7KH SO&= SODVPLG ZDV GLJHVWHG ZLWK ;KRO DQG 6PDO HQ]\PHV DQG ILOOHGLQ ZLWK WKH .OHQRZ IUDJPHQW RI e FROL '1$ SRO\PHUDVH LQ WKH SUHVHQFH RI P0 RI DOO IRXU GHR[\QXFOHRVLGH WULSKRVSKDWHV 7KH &,7 VHTXHQFH ZDV JHQHUDWHG E\ FXWWLQJ S SODVPLG ZLWK (FR5, DQG (FR59 HQ]\PHV ILOOLQJLQ ZLWK .OHQRZ HQ]\PH DQG UHFRYHULQJ D ES IUDJPHQW WKDW FRQWDLQHG WKH HQWLUH UHJXODWRU\ UHJLRQ 7KH &,7 IUDJPHQW ZDV FORQHG LQWR WKH SO&= YHFWRU DQG ERWK IRUZDUG DQG UHYHUVHRULHQWDWLRQ UHFRPELQDQWV ZHUH UHFRYHUHG 7KHVH FORQHV ZHUH GHVLJQDWHG <,6/ DQG <,6/5 7KHVH SODVPLGV DQG WKH LQWDFW SO&= SODVPLG ZHUH WUDQVIRUPHG LQWR $ DQG -3% KDSf -3% ZDV D GHULYDWLYH RI $ E\ LQVHUWLRQ RI WKH 85$ JHQH DW WKH +$3 ORFXV WR GLVUXSW WKH JHQH 3LQNKDP DQG *XDUHQWH f JDODFWRVLGDVH DFWLYLWLHV IURP HDFK WUDQVIRUPDQW ZDV GHWHUPLQHG DV GHVFULEHG LQ PDWHULDOV DQG PHWKRGV 7KH UHVXOWV RI WKHVH H[SHULPHQWV DUH VKRZQ LQ )LJXUH DQG 7KH <,6/5 FORQH SURGXFHG DSSUR[LPDWHO\ WKH VDPH OHYHO RI VSHFLILF DFWLYLW\ DV SO&= LQ ERWK UHSUHVVLQJ DQG GHSUHVVLQJ PHGLD +RZHYHU ZLWK <,6/ WKH VSHFLILF DFWLYLW\ ZDV QHDUO\ RQHKDOI WKH DPRXQW RI 8$6F\FL LQ <3' 7KH GLIIHUHQFH LQ VSHFLILF DFWLYLWLHV EHWZHHQ <,6/ DQG <,6/5 ZDV REVHUYHG LQ D UHSUHVVLQJ PHGLXP EXW ZDV OHVV SURQRXQFHG DIWHU JOXFRVH KDV EHHQ GHSOHWHG LQ VWDWLRQDU\ SKDVH )LJXUH f RU ZKHQ FHOOV ZHUH JURZQ LQ HWKDQRO )LJXUH f :KHQ WKH 8$6FQ FRQWDLQLQJ SODVPLG ZDV WUDQVIRUPHG LQWR D KDS VWUDLQ WKH

PAGE 86

)LJXUH 8$6 $FWLYLW\ RI &,7 n 8QWUDQVFULEHG 5HJLRQ 7KH HQWLUH n XQWUDQVFULEHG UHJLRQ RI &,7 SUHVHQW LQ WKH ZLOGW\SH FORQH S ZDV VXEFORQHG EHIRUH D &<&ODF= IXVLRQ GHOHWHG RI LWV QDWLYH 8$6 3JDODFWRVLGDVH DVVD\V ZHUH SHUIRUPHG IURP FXOWXUHV JURZQ LQ <3' $ LV D ZLOGW\SH \HDVW VWUDLQ DQG -%% LV D KDS PXWDQW GHULYDWLYH RI $ $FWLYLWLHV DUH SUHVHQWHG DV GHVFULEHG LQ WKH OHJHQG WR )LJXUH 1' 3JDODFWRVLGDVH DVVD\ ZDV QRW SHUIRUPHG

PAGE 87

&RQVWUXFW $UUDQTXHQ SO&= Uf§8$68$6U 7$7$ f§ 9 SO&=8$6/(66 W 7$7$ <,6/ A 8$6DQ A 7$7$ b <,6/5 r f"r 7$7$ &<&ODF= &<&ODF= &<&ODF= 6SHFLILF $FWLYLW\ $ /2* 6,$ -3% /2* 6,$ RR R 1' 1' &<&ODF=

PAGE 88

)LJXUH 8$6 $FWLYLW\ RI 9DULRXV &,7 8SVWUHDP 6HTXHQFHV $ PHU UHSUHVHQWLQJ VHTXHQFHV IURP SRVLWLRQ WR DQG D PHU UHSUHVHQWLQJ VHTXHQFHV IURP SRVLWLRQ WR ZHUH VXEFORQHG EHIRUH D &<&ODF= IXVLRQ ZLWKRXW LWV QDWLYH 8$6 JDODFWRVLGDVH DVVD\V ZHUH SHUIRUPHG DV GHVFULEHG LQ )LJXUH

PAGE 89

&RQVWUXFW $UUDQJHPHQW SO&= f§8$68$6W 7$7$ SO&=8$6/(66 7$7$ b <,6/ PHUf 7$7$ PHUfM <,6/5 7$7$ 6SHFLILF $FWLYLW\ <3' <3( &<&ODF= &<&ODF= &<&ODF= &<&ODF=

PAGE 90

VSHFLILF DFWLYLW\ RI <,6/ ZDV VOLJKWO\ KLJKHU WKDQ WKH VSHFLILF DFWLYLW\ RI <,6/5 )LJXUH f %XW 8$6F\FL GULYHQ H[SUHVVLRQ ZDV YHU\ ORZ GXULQJ ORJDULWKPLF SKDVH JURZWK DQG ZDV RQO\ DERXW b RI WKH 8$6&Q DIWHU JOXFRVH KDG EHHQ GHSOHWHG :KLOH WKH H[SUHVVLRQ IURP WKH 8$6FUL LQ <,6/ ZDV UHGXFHG b LQ VKLIWLQJ IURP WKH +$3 WR WKH KDS VWUDLQ WKH DFWLYLW\ RI WKH 8$6F\Ff GURSSHG PRUH WKDQ b LQ WKH KDS PXWDQW 7KH UHVXOWV LQGLFDWH WKDW ZKLOH WKH KDS PXWDWLRQ KDV DQ HIIHFW RQ WKH 8$6F\FL WKLV HIIHFW LV PXFK OHVV VLJQLILFDQW WKDQ RQ WKH &<& JHQH 7KH WKUHH LQWHUQDO UHJLRQV GHOHWHG IURP &,7 XSVWUHDP VHH )LJXUH f VKRZHG WKDW WKH\ HDFK FRQWULEXWHG WR WKH WUDQVFULSWLRQDO UHJXODWLRQ RI WKH JHQH ,Q RUGHU WR WHVW WKHLU FRQWULEXWLRQ WR DFWLYDWLRQ WKHVH VHTXHQFHV ZHUH LQGLYLGXDOO\ VXEFORQHG LQWR SO&= YHFWRU ZKRVH 8$6 DQG 8$6 KDG EHHQ UHPRYHG DV GHVFULEHG HDUOLHU 2QO\ WZR RI WKHVH UHJLRQV ZHUH VXFFHVVIXOO\ FORQHG 7KH <,6/ FORQH ZDV GHULYHG E\ DQQHDOLQJ WZR FRPSOHPHQWDU\ ROLJRQXFOHRWLGHV $/ DQG $/ DQG OLJDWLQJ WKH UHVXOW LQWR WKH YHFWRU 7KHVH ROLJRQXFOHRWLGHV VSDQ WKH UHJLRQ WR ZKLFK LQFOXGHV WKH +DSS+DSS+DSS ELQGLQJ VLWH <,6/ ZDV FORQHG E\ DQQHDOLQJ $/ DQG $/ ZKLFK VSDQV WR DOVR DWWHPSWHG WR FORQH WKH UHJLRQ WKDW HQFRPSDVVHV WKH UHJLRQ EHWZHHQ WR EXW ZDV QRW VXFFHVVIXO 7KH UHVXOWV IURP WKHVH H[SHULPHQWV DUH SUHVHQWHG LQ )LJXUH <,6/ SURGXFHG VSHFLILF DFWLYLW\ RI XQLWV SHU PLOLJUDP RI SURWHLQ LQ D FXOWXUH WKDW ZDV JURZQ WR ORJDULWKPLF SKDVH LQ WKH <3' PHGLXP &XOWXUHV KDUYHVWHG IURP <3( PHGLXP KDG XQLWVPJ SURWHLQ 7KH VSHFLILF DFWLYLW\ RI <,6/5 ZDV

PAGE 91

XQLWV SHU PLOOLJUDP RI SURWHLQ LQ D GHSUHVVLQJ PHGLXP DQG XQLWV SHU PLOOLJUDP RI SURWHLQ LQ <3' 7KHVH UHVXOWV VKRZ WKDW WKH UHJLRQV HQFRPSDVVLQJ WR DQG WR KDYH DQ DFWLYDWLQJ IXQFWLRQ 7KH WR UHJLRQ KDV JUHDWHU DFWLYDWLRQ SRWHQWLDO WKDQ WKH WR UHJLRQ LQ <3' +RZHYHU LQ WKH <3( PHGLXP WKH WR UHJLRQ VKRZHG JUHDWHU H[SUHVVLRQ WKDQ WKH WR UHJLRQ VXJJHVWLQJ WKDW WKLV UHJLRQ FRQWDLQV SDUW RI WKH JOXFRVH UHVSRQGLQJ SURPRWHU HOHPHQW (YLGHQFH IRU 856 (OHPHQW 8QGHU ERWK UHSUHVVLQJ DQG GHUHSUHVVLQJ FRQGLWLRQV WKH OHYHO RI JDODFWRVLGDVH H[SUHVVHG IURP FORQH S ZDV KLJKHU WKDQ WKH ZLOGW\SH FORQH VHH )LJXUH f 3JDODFWRVLGDVH OHYHOV ZHUH PRUH WKDQ WZLFH DV KLJK XQGHU UHSUHVVLQJ FRQGLWLRQV \HW XQGHU GHUHSUHVVLQJ FRQGLWLRQV WKH OHYHOV ZHUH RQO\ b KLJKHU WKDQ WKH ZLOGW\SH FORQH 7KLV VXJJHVWHG WKDW WKHUH PD\ EH D 856 HOHPHQW EHWZHHQ WR RI WKH &,7 VHTXHQFH 7R GHWHUPLQH WKH SRWHQWLDO QHJDWLYH UHJXODWRU\ FDSDELOLW\ RI WKLV UHJLRQ FORQHG LW LQWR WKH UHSRUWHU SODVPLG SO&= 7R DFFRPSOLVK WKH FORQLQJ SO&= ZDV OLQHDUL]HG ZLWK ;KRO ZKLFK FXWV GRZQVWUHDP RI WKH WZR 8$6 HOHPHQWV GHVFULEHG HDUOLHU VHH LQWURGXFWLRQf DQG WKH UHJLRQ RI &,7 IURP WR ZDV LQVHUWHG 5HFRPELQDQWV GHVLJQDWHG <,6/; ZHUH VHTXHQFHG XVLQJ $/ SULPHU WR GHWHUPLQH WKH RULHQWDWLRQ RI LQVHUWLRQ 2QO\ UHFRPELQDQWV LQ WKH IRUZDUG RULHQWDWLRQV ZHUH UHFRYHUHG DQG VXEVHTXHQWO\ WUDQVIRUPHG LQWR D \HDVW VWUDLQ ,I WKH WR

PAGE 92

UHJLRQ KDV D 856 IXQFWLRQ WKH JDODFWRVLGDVH OHYHOV H[SUHVVHG IURP VXFK D FRQVWUXFW VKRXOG EH ORZHU WKDQ WKH OHYHOV H[SUHVVHG IURP LQWDFW SO&= 6SHFLILF DFWLYLWLHV IURP WKLV FRQVWUXFW DUH SUHVHQWHG LQ )LJXUH ,Q D UHSUHVVLQJ PHGLXP WKH DFWLYLW\ ZDV UHGXFHG DSSUR[LPDWHO\ b FRPSDUHG WR SO&= OHYHO 7KH VDPH OHYHO RI UHGXFWLRQ ZDV DOVR VHHQ IURP FXOWXUHV JURZQ LQ <3' WR VWDWLRQDU\ SKDVH ZKHQ PRVW RI WKH JOXFRVH KDV EHHQ GHSOHWHG DQG WKXV UHSUHVHQWV D GHSUHVVHG VWDWH +RZHYHU ZKHQ WKH FHOOV ZHUH JURZQ LQ HWKDQROVXSSOHPHQWHG FRPSOH[ PHGLXP WKHUH ZDV QR VLJQLILFDQW UHGXFWLRQ LQ DQ VSHFLILF DFWLYLW\ 7KLV VXJJHVWHG WKDW HLWKHU UHSUHVVLRQ RI WUDQVFULSWLRQ RFFXUV RQO\ LQ D JOXFRVHFRQWDLQLQJ PHGLXP RU WKDW WKH 8$6 DFWLYLW\ LQ D <3( PHGLXP PDVNV WKH UHSUHVVLQJ HIIHFW +RZHYHU WKHUH ZDV VWLOO DERXW b UHGXFWLRQ RI VSHFLILF DFWLYLW\ LQ <3( (YHQ LQ WKH FRQWH[W RI &,7 VHTXHQFHV WKH LQFUHDVH DIWHU WKLV UHJLRQ ZDV UHPRYHG ZDV JUHDWHU LQ D <3' PHGLXP DW ORJDULWKPLF SKDVH WKDQ LW ZDV LQ D <3( PHGLXP 6LPLODU REVHUYDWLRQV ZHUH PDGH E\ 5RVHQNUDQW] DQG FRZRUNHUV f +RZHYHU LW LV SRVVLEOH WKDW LQFUHDVLQJ WKH GLVWDQFH EHWZHHQ WKH 8$6 HOHPHQWV DQG WKH WUDQVFULSWLRQDO VWDUW VLWH RI WKH &<& JHQH FRXOG GHFUHDVH WKH OHYHO RI H[SUHVVLRQ 7KLV FRXOG FRPH DERXW E\ SODFLQJ WKH 8$6 VLWH DQG WKH 7$7$ VLWH RQ RSSRVLWH VLWHV RI WKH '1$ WKHUHE\ KLQGHULQJ SURSHU FRQWDFWV EHWZHHQ WKHVH IDFWRUV WR DOORZ DFWLYDWLRQ ,QVHUWLRQ RI DQ XQUHODWHG ROLJRQXFOHRWLGH RI VLPLODU OHQJWK DW WKH VDPH VLWH LQ WKH SO&= YHFWRU VKRXOG GLVWLQJXLVK D GLVWDQFH HIIHFW DQG VSHFLILF VHTXHQFH HIIHFW

PAGE 93

)LJXUH 856 $FWLYLW\ RI WR 5HJLRQ RI WKH &,7 *HQH 7KH WR UHJLRQ IURP &,7 XSVWUHDP VHTXHQFH ZDV VXEFORQHG LQWR WKH &<&ODF= IXVLRQ GRZQVWUHDP RI WKH QDWLYH &<& 8$6 SJDODFWRVLGDVH DVVD\V ZHUH SHUIRUPHG DV GHVFULEHG LQ )LJXUH

PAGE 94

&RQVWUXFW $UUDQJHPHQW SO&= 8$68$6 7$7$ n! 9 SO&=8$6/(66 7$7$ r <,6/; UU8$68$6856FUUf 7$7$ LI 6SHFLILF $FWLYLW\ <3' <3( /2* 67$ /2* ‘&<&ODF= aYO ‘&<&ODF= &<&LDF=

PAGE 95

6WHDGY6WDWH P51$ /HYHOV &RUUHODWH ZLWK (Q]YPH $VVD\ 7KH JDODFWRVLGDVH DFWLYLWLHV IURP WKH YDULRXV SURPRWHU GHOHWLRQV VWURQJO\ VXJJHVWHG WUDQVFULSWLRQDO UHJXODWLRQ RI WKH &,7 JHQH DIIHFWLQJ WKH VWHDG\VWDWH P51$ OHYHO ,Q RUGHU WR FRUUHODWH WKH HQ]\PH DFWLYLWLHV ZLWK WKH VWHDG\VWDWH P51$ OHYHOV WRWDO \HDVW 51$ ZDV LVRODWHG IURP VHOHFWHG VWUDLQV DQG WKH OHYHO RI ODF= VSHFLILF PHVVDJH ZDV GHWHUPLQHG E\ ULERQXFOHDVH SURWHFWLRQ DVVD\ 5DGLRODEHOHG FRPSOHPHQWDU\ 51$ F51$f VSHFLILF WR WKH ODF= JHQH ZDV JHQHUDWHG IURP SODVPLG S6/ XVLQJ 7 51$ SRO\PHUDVH 7KH DFWLQ PHVVDJH IURP $&7 JHQH ZDV XVHG DV DQ LQWHUQDO FRQWURO WR FRUUHFW IRU SRVVLEOH ORDGLQJ GLIIHUHQFHV 7KH F51$ IRU WKH DFWLQ P51$ ZDV WUDQVFULEHG IURP S*(0DFWLQ SODVPLG D JHQHURXV JLIW IURP 'U 5 %XWRZ XVLQJ 63 51$ SRO\PHUDVH 7KH UHVXOWV DUH VKRZQ LQ )LJXUH )LJXUH D VKRZV WKH DXWRUDGLRJUDP RI WKH ULERQXFOHDVH SURWHFWLRQ DVVD\ DQG )LJXUH E VKRZV WKH TXDQWLWDWLYH UHVXOW 7KH TXDQWLWDWLYH UHVXOWV ZHUH REWDLQHG E\ FDOFXODWLQJ WKH UDWLR RI ODF= P51$ YHUVXV $&7 P51$ IRU HDFK VDPSOH (DFK VDPSOH ZDV WKHQ FRPSDUHG WR WKH S P51$ OHYHO WR PHDVXUH WKHLU UHODWLYH OHYHO RI H[SUHVVLRQ 2YHUDOO WKH DPRXQW RI ODF= P51$ IURP HDFK GHOHWLRQ SDUDOOHOHG WKH SJDODFWRVLGDVH DFWLYLW\ REVHUYHG IRU HDFK FRQVWUXFW +RZHYHU WKH <3(<3' UDWLRV ZHUH ORZHU IRU WKH VWHDG\VWDWH P51$ OHYHOV WKDQ HQ]\PH OHYHOV IRU HDFK RI WKH FRQVWUXFWV WHVWHG /LDR HW DO f DOVR IRXQG WKDW LQ FHUWDLQ \HDVW VWUDLQV WKH <3(<3' UDWLRV IRU FLWUDWH V\QWKDVH DFWLYLW\ ZHUH DV PXFK DV IRXU WLPHV KLJKHU WKDQ WKH VWHDG\VWDWH P51$ SURGXFHG IURP WKH &,7 JHQH LQ LGHQWLFDO PHGLD 6XUSULVLQJO\ WKH P51$

PAGE 96

)LJXUH 6WHDG\ VWDWH P51$ OHYHO RI VHOHFWHG GHOHWLRQ FRQVWUXFWV $f MJ RI WRWDO 51$ ZDV K\EULGL]HG LQ VROXWLRQ WR UDGLRODEHOHG F51$ SUREHV IRU ODF= DQG $&7 JHQHV VLPXOWDQHRXVO\ $IWHU K\EULGL]DWLRQ VDPSOHV ZHUH GLJHVWHG ZLWK 51DVH $ DQG 51DVH 7 DQG UHVROYHG RQ b /RQJ 5DQJHU JHO $7 %LRFKHPf /DQH 0 LV HQG ODEHOHG 51$ PROHFXODU ZHLJKW PDUNHU WR NEf /LIH 7HFKQRORJLHVf /DQHV DUH VDPSOHV IURP VHOHFWHG GHOHWLRQ FRQVWUXFWV DV VKRZQ ,Q ODQH 51$ ZDV LVRODWHG IURP VWUDLQ WKDW GRHV QRW KDUERU DQ\ SODVPLG FDUU\LQJ WKH ODF= JHQH ,Q ODQH 51$ ZDV LVRODWHG IURP DQ LVRJHQLF VWUDLQ WKDW FDUU\ D SODVPLG EHDULQJ 73,ODF= IXVLRQ &RXUWHV\ 'U + %DNHUf %f *UDSKLFDO UHSUHVHQWDWLRQ RI WKH QHW FSP RI HDFK VDPSOH REWDLQHG E\ H[SRVLQJ WKH JHO WR D 3KRVSKRU,PDJHU VFUHHQ 0ROHFXODU '\QDPLFVf

PAGE 97

51$ QHW FSPf ( ( ( ( ( ( ‘2 f§ 2 \! &2 /' LQ ( &If 2 &2 &2 &0 &0 2f 2f 2n &2 -! 7 Wf§ &0 &0 W&0 2V&/ &2 &2 &2 &2 &2 ,7f LQ LQ 82 2 /8 &/ 4 &/ &/ 4 &/ &/ 4 F 4 PP Z 0HGLXP 3ODVPLG f§ ODF= ‘f§ $FWLQ 3/$60,'6

PAGE 98

OHYHO IRU S ZDV VOLJKWO\ ORZHU WKDQ WKH S OHYHO ERWK LQ UHSUHVVLQJ DQG GHUHSUHVVLQJ PHGLD HYHQ WKRXJK D KLJKHU OHYHO RI JDODFWRVLGDVH DFWLYLW\ ZDV GHWHFWHG )LJXUH f $W SUHVHQW QR H[SODQDWLRQ VDWLVIDFWRULO\ DFFRXQWV IRU WKLV GLVFUHSDQF\ EHWZHHQ WKH WZR PHWKRGV RI GHWHUPLQLQJ WUDQVFULSWLRQDO HIILFLHQF\ 0HDVXULQJ JDODFWRVLGDVH DFWLYLWLHV UHIOHFWV ERWK WUDQVFULSWLRQDO DQG WUDQVODWLRQDO HIIHFWV DQG PD\ SRVVLEO\ DPSOLI\ VPDOO GLIIHUHQFHV LQ 51$ OHYHO +RZHYHU 5RVHQNUDQW] HW DO f VKRZHG WKDW JDODFWRVLGDVH OHYHOV LQFUHDVHG ZKHQ WKH VHTXHQFHV EHWZHHQ WKLV UHJLRQ ZHUH GHOHWHG 7KLV ZRXOG VXJJHVW WKDW WKH HQ]\PH DVVD\ PD\ EH PRUH UHOLDEOH WKDQ WKH TXDQWLWDWLYH UHVXOW RI WKH VWHDG\ VWDWH P51$ WUDQVFULEHG IURP WKH VDPH SODVPLGV /DQH RI )LJXUH D ZDV 51$ LVRODWHG IURP D \HDVW VWUDLQ ZLWKRXW WKH SODVPLG FRQVWUXFW WKDW KDV WKH ODF= JHQH 7KLV FRQILUPV WKDW WKHUH LV QR RWKHU JHQH LQ \HDVW WKDW K\EULGL]HV WR WKH ( FROL ODF= SUREH 7KH VDPSOH LQ ODQH )LJXUH Df ZDV LVRODWHG IURP D \HDVW VWUDLQ WUDQVIRUPHG ZLWK S(6 SODVPLG D JHQHURXV JLIW IURP 'U + %DNHUnV ODERUDWRU\ S(6 SODVPLG KDV WKH WULRVHSKRVSKDWH LVRPHUDVH 73,f JHQH IXVHG WR WKH ODF= JHQH %DQG 6KLIW $VVD\ DQG ,Q 9LWUR )RRWSULQW $QDO\VLV 7R PDS WKH VHTXHQFHV WKDW DUH LQYROYHG LQ UHJXODWLRQ RI WKH &,7 JHQH E\ DQ LQGHSHQGHQW PHWKRG ERWK EDQGVKLIW DVVD\V DQG LQ YLWUR IRRWSULQW DQDO\VLV ZHUH SHUIRUPHG 7KH EDQGVKLIW DVVD\V ZHUH SHUIRUPHG WR VHH LI WKHUH DUH SURWHLQV IURP WRWDO \HDVW H[WUDFW WKDW FDQ ELQG WR D '1$ IUDJPHQW FRQWDLQLQJ WKH

PAGE 99

&,7 XSVWUHDP UHJLRQ )RRWSULQW DQDO\VLV XVLQJ '1DVH ZDV XVHG WR LGHQWLI\ WKH VHTXHQFHV WKDW ELQG WR WKH SURWHLQV 7KH &,7 XSVWUHDP VHTXHQFH SUHVHQW LQ WKH ZLOGW\SH FRQVWUXFW S ZDV GLYLGHG LQWR WZR UHJLRQV WR SHUIRUP WKHVH DVVD\V EHFDXVH SUHOLPLQDU\ DVVD\V VKRZHG WKDW WKH '1$ IUDJPHQW RI WKH HQWLUH XSVWUHDP ZDV WRR ODUJH WR PLJUDWH LQWR WKH b SRO\DFU\ODPLGH JHO XVHG ([WUDFWV IURP \HDVW JURZQ LQ <3' <3( RU 6' b JOXFRVHf PHGLD ZHUH XVHG IRU WKH ELQGLQJ DVVD\V ZLWK WKH GLIIHUHQW IUDJPHQWV 7KH UHVXOWV RI WKH ELQGLQJ H[SHULPHQWV DUH VKRZQ LQ )LJXUHV DQG (DFK IUDJPHQW ZDV VKLIWHG LQ UHVSRQVH WR FUXGH \HDVW H[WUDFW )RU IUDJPHQW WR )LJXUH f WZR VKLIWV ZHUH REVHUYHG EDQG $ DW DOO FRQFHQWUDWLRQV RI H[WUDFW DQG EDQG % ORZHU EDQGf DSSHDULQJ RQO\ DW KLJK OHYHOV RI H[WUDFW 7KH DSSHDUDQFH RI D VHFRQG EDQG DW KLJK SURWHLQ FRQFHQWUDWLRQ PD\ PHDQ WKDW WKH DIILQLW\ EHWZHHQ WKH SURWHLQ DQG '1$ LV ORZ UHTXLULQJ D KLJK FRQFHQWUDWLRQ RI WKH SURWHLQ WR EH SUHVHQW EHIRUH ELQGLQJ LV GHWHFWHG 8QOLNH IUDJPHQW WR WKH VHFRQG IUDJPHQW H[WHQGLQJ IURP SRVLWLRQ WR JDYH RQO\ RQH VKLIWHG EDQG HYHQ DW KLJK H[WUDFW OHYHO )LJXUH f 7KHUH ZDV QR GLIIHUHQFH LQ ELQGLQJ SDWWHUQV REVHUYHG DPRQJVW WKH H[WUDFWV RI FXOWXUHV IURP <3' <3( RU V\QWKHWLF PHGLXP VXSSOHPHQWHG ZLWK b JOXFRVH )LJXUH f 7R VKRZ WKDW WKH ELQGLQJ REVHUYHG ZLWK WKH GLIIHUHQW IUDJPHQWV ZDV D VSHFLILF LQWHUDFWLRQ D FRPSHWLWLRQ UHDFWLRQ ZDV SHUIRUPHG ZLWK XQODEHOHG '1$ IUDJPHQWV 7KH XQODEHOHG '1$ XVHG ZDV HLWKHU LGHQWLFDO WR WKH ODEHOHG SUREH RU IURP RWKHU UHJLRQ RI WKH &,7 XSVWUHDP VHTXHQFH )LJXUH VKRZV WKH UHVXOW RI

PAGE 100

)LJXUH %DQGVKLIW RI WR IUDJPHQW $SSUR[LPDWHO\ SJ RI FUXGH \HDVW H[WUDFW IURP JOXFRVHJURZQ FHOOV ZDV LQFXEDWHG ZLWK DSSUR[LPDWHO\ IPROH RI HQGODEHOHG ES &,7 '1$ IUDJPHQW 7KHUH ZDV QR H[WUDFW LQ ODQHV DQG /DQHV WKURXJK KDG LQFUHDVLQJ DPRXQWV SL WR SLf RI H[WUDFW

PAGE 102

)LJXUH %DQGVKLIW RI WR IUDJPHQW SJ FUXGH \HDVW H[WUDFW IURP ZLOGW\SH VWUDLQ JURZQ LQ WKH LQGLFDWHG PHGLD <3' <3( RU 6'f RU IURP D KDS ODQH KDSf PXWDQW VWUDLQ JURZQ LQ <3' ZDV LQFXEDWHG ZLWK HQG ODEHOHG &,7 SUREH WR f 3UREH ZDV SUHSDUHG E\ ILUVW ODEHOLQJ $/ SULPHU ZLWK 7 NLQDVH ZKLFK WKHQ XVHG LQ FRQMXQFWLRQ ZLWK $/ SULPHU LQ D 3&5 UHDFWLRQ RQ S6/ SODVPLG WHPSODWH WR V\QWKHVL]H WKH SUREH 3UREH ZDV JHO SXULILHG RQ D b f QRQGHQDWXULQJ SRO\DFU\ODPLGH JHO $SSUR[LPDWHO\ IPROH RI ODEHOHG '1$ SHU UHDFWLRQ ZDV XVHG 6DPSOHV ZHUH VHSDUDWHG RQ D b SRO\DFU\ODPLGH f ) GHVLJQDWHV XQERXQG '1$ DQG $ UHSUHVHQWV ERXQG SUREH

PAGE 103

0r W f <3' <3( 6'bf KDS &' 2f

PAGE 104

)LJXUH &RPSHWLWLRQ $VVD\ 8QODEHOHG '1$ IUDJPHQWV ZHUH XVHG WR FRPSHWH ZLWK WKH ODEHOHG WR f SUREH LQ (06 DVVD\ 6HW $ UHSUHVHQWV FRPSHWLWLRQ ZLWK WR IUDJPHQW VHW % UHSUHVHQW FRPSHWLWLRQ ZLWK WR IUDJPHQW VHW & UHSUHVHQWV FRPSHWLWLRQ ZLWK ES GRXEOH VWUDQGHG ROLJRQXFOHRWLGH WKDW VSDQV WR RI WKH XSVWUHDP VHTXHQFH DQG VHW UHSUHVHQWV FRPSHWLWLRQ ZLWK ES GRXEOH VWUDQGHG ROLJRQXFOHRWLGH WKDW VSDQV WR

PAGE 105

FRPSHWLWRU $ %&' ,, ,, ,, IPROH FRPSHWLWRU 3

PAGE 106

WKH FRPSHWLWLRQ DVVD\ 8VLQJ XQODEHOHG '1$ WKDW ZDV VLPLODU WR WKH ODEHOHG '1$ WR f IROG H[FHVV RI WKLV '1$ ZDV DEOH WR FRPSHWH ZLWK WKH VKLIWHG EDQG /DQH f $OO RI WKH VKLIWHG EDQG GLVDSSHDUHG ZKHQ WKH DPRXQW RI '1$ XVHG LQ WKH FRPSHWLWLRQ ZDV LQFUHDVHG WR WLPHV PRUH WKDQ WKH LQLWLDO UHDFWLRQ +RZHYHU ZKHQ D VLPLODU PRODU H[FHVV RI XQUHODWHG '1$ WR f ZDV XVHG QR FRPSHWLWLRQ ZDV VHHQ ODQHV WKUX f 7KLV GHPRQVWUDWHG WKH VSHFLILFLW\ RI WKH LQWHUDFWLRQ )RU UHDVRQV GLVFXVVHG EHORZ ZH DOVR VHW XS FRPSHWLWLRQ DVVD\ ZLWK GRXEOH VWUDQGHG ROLJRQXFOHRWLGH VSDQQLQJ WR 7KH UHVXOW LV VKRZQ LQ )LJXUH ODQHV DQG ,Q WKLV UHDFWLRQ LW WRRN IROG PRODU H[FHVV RI FRPSHWLWRU '1$ WR VKRZ VLJQLILFDQW FRPSHWLWLRQ ZKLFK ZDV KLJKHU WKDQ WKH DPRXQW WKDW ZDV UHTXLUHG ZLWK WKH WR IUDJPHQW DV FRPSHWLWRU ,Q SURWHLQ'1$ LQWHUDFWLRQV VHTXHQFHV EH\RQG WKH H[DFW SRLQW RI LQWHUDFWLRQ DUH RIWHQ UHTXLUHG IRU RSWLPXP ELQGLQJ 7KHUHIRUH LI WKRVH VHTXHQFHV DUH QRW SUHVHQW LW ZRXOG DIIHFW WKH ELQGLQJ DIILQLW\ 7KLV PD\ H[SODLQ ZK\ LW UHTXLUHG D KLJKHU PRODU H[FHVV WR VKRZ DQ\ VLJQLILFDQW FRPSHWLWLRQ $QRWKHU GRXEOH VWUDQGHG ROLJRQXFOHRWLGH WR GLG QRW VKRZ DQ\ VLJQLILFDQW FRPSHWLWLRQ DW VLPLODU FRQFHQWUDWLRQV )LJXUH ODQHV DQG f 7R LGHQWLI\ WKH H[DFW VHTXHQFHV WKDW LQWHUDFW ZLWK IDFWRUVf IURP WKH FUXGH H[WUDFW '1DVH ZDV XVHG WR GLJHVW WKH EDQGVKLIW UHDFWLRQ PL[WXUH IRU VHFRQGV DW URRP WHPSHUDWXUH 7KH UHDFWLRQ ZDV VWRSSHG ZLWK 0 ('7$ DQG WKH VDPSOH ZDV UXQ RQ D SRO\DFU\ODPLGH JHO 7KH EDQGV IURP )LJXUH ZHUH ORFDWHG IROORZLQJ DXWRUDGLRJUDSK\ DQG H[FLVHG IURP WKH JHO IROORZHG E\ HOXWLRQ RI

PAGE 107

WKH '1$ IURP WKH JHO RQWR D '($( FHOOXORVH PHPEUDQH 7KH '1$ ZDV UHFRYHUHG DQG UXQ RQ D VHTXHQFLQJ JHO DORQJVLGH D VHTXHQFLQJ ODGGHU JHQHUDWHG IURP WKH SODVPLG S6/ WHPSODWH XVLQJ WKH VDPH SULPHU $/f WKDW ZDV XVHG WR JHQHUDWH WKH SUREH IRU WKH EDQG VKLIW DQDO\VLV $OWKRXJK EDQG VKLIWV ZHUH REVHUYHG ZLWK WKH WR SUREH QR REYLRXV SURWHFWHG RU K\SHUVHQVLWLYH UHJLRQ ZDV VHHQ ZLWKLQ WKLV SUREH GDWD QRW VKRZQf 7KLV PD\ PHDQ WKDW WKH DIILQLW\ RI WKH SURWHLQV IRU WKHLU FRJQDWH VLWHVf ZDV WRR ORZ WR DOORZ ELQGLQJ WKDW FRXOG EH GHWHFWHG E\ '1DVH GLJHVWLRQ 7KH LQDELOLW\ WR GHWHFW DQ LQ YLWUR IRRWSULQWLQJ SDWWHUQ RI D SXWDWLYH 8$6 LV QRW XQLTXH WR WKLV JHQH /LDR DQG %XWRZ f VKRZHG WKDW DOWKRXJK WKHUH ZDV JHO UHWDUGDWLRQ VKRZQ E\ 8$6U IURP WKH &,7 JHQH QR IRRWSULQWLQJ SDWWHUQ ZDV GHWHFWHG GHVSLWH UHSHDWHG WULDOV &,7 HQFRGHV WKH VHFRQG LVR]\PH RI FLWUDWH V\QWKDVH WKH RQH WDUJHWHG WR WKH SHUR[LVRPH /HZLQ HW DO f /RZ VSHFLILFLW\ ELQGLQJ E\ D SURWHLQ WR WKH '1$ PD\ DOVR UHVXOW LQ ODFN RI GHWHFWLRQ RI DQ\ SURWHFWHG UHJLRQ \HW RQH FDQ VWLOO REVHUYH UHGXFHG PRELOLW\ RI WKH WHVW '1$ LQ D EDQGVKLIW UHDFWLRQ 7KH SUREH VSDQQLQJ WR VKRZHG WZR SURWHFWHG VLWHV DUURZVf EHWZHHQ DQG DQG D K\SHUVHQVLWLYH UHJLRQ )LJXUH f 7KH K\SHUVHQVLWLYH VLWH OLHV LPPHGLDWHO\ DERYH WKH WRS DUURZ 1R ELQGLQJ VLWH IRU D NQRZQ WUDQVFULSWLRQDO UHJXODWRU\ SURWHLQ FDQ EH IRXQG LQ WKLV UHJLRQ 7KLV PD\ VLJQLI\ D QRYHO ELQGLQJ VLWH IRU D WUDQVFULSWLRQDO UHJXODWRU 7KH DEVHQFH RI DQ\ GLIIHUHQFH LQ WKH IRRWSULQW SDWWHUQ GHWHFWHG ZLWK H[WUDFWV IURP <3' <3( RU 6' bf PHGLD ZRXOG VXJJHVW QR GLIIHUHQFH LQ VLWH RFFXSDQF\ IRU WKHVH JURZWK

PAGE 108

)LJXUH '1DVH 3URWHFWLRQ $VVD\ $/ DQG $/ 7DEOH f ZHUH XVHG WR JHQHUDWH D SUREH HQFRPSDVVLQJ WR f E\ 3&5 HQG ODEHOHG DW WKH HQG DQG XVHG WR ELQG WR SURWHLQV IURP FUXGH \HDVW H[WUDFW 5HDFWLRQ PL[WXUH ZDV GLJHVWHG ZLWK '1DVH UXQ RQ D b f SRO\DFU\ODPLGH JHO WR VHSDUDWH VKLIWHG '1$ 6KLIWHG '1$ ZDV ORFDWHG E\ DXWRUDGLRJUDSK\ 7KH EDQGV ZHUH FXW RXW IURP WKH JHO DQG '1$ HOXWHG RQWR '($( FHOOXORVH PHPEUDQH 'LJHVWHG '1$ ZDV VHSDUDWHG RQ b SRO\DFU\ODPLGH JHO f &RQWURO ODQHV ZHUH JHQHUDWHG E\ GLJHVWLQJ QDNHG '1$ ZLWK '1DVH 6HTXHQFLQJ ODGGHU ZDV JHQHUDWHG E\ VHTXHQFLQJ S6/ SODVPLG ZLWK $/ SULPHU 7KH WZR DUURZV LGHQWLI\ SURWHFWHG UHJLRQV &RQWUROV DUH GLJHVWV RI WKH IUDJPHQW LQ WKH DEVHQFH RI H[WUDFW

PAGE 109

FR UR 3r &' *7$$$7$7$*&*77777$&*77&$&$77*&&, , , , ,$7*n ,, ,, ,, I I

PAGE 110

FRQGLWLRQV $Q\ FKDQJHV WKDW FDXVH GLIIHUHQWLDO H[SUHVVLRQ DW WKH OHYHO RI WUDQVFULSWLRQ PXVW EH GXH WR HLWKHU PRGLILFDWLRQ RI DOUHDG\ ERXQG IDFWRUV RU FKDQJHV LQ WKH SURWHLQSURWHLQ LQWHUDFWLRQV WDNLQJ SODFH LQ GLIIHUHQW PHGLD 7KH '1DVH GLJHVWLRQ SDWWHUQ VKRZQ ZLWK WKH WHVW VDPSOHV FRXOG DOVR EH GXH WR QRQVSHFLILF ELQGLQJ 7KLV SRVVLELOLW\ ZDV LQGLFDWHG E\ WKH DSSHDUDQFH RI K\SHUVHQVLWLYH VLWHV QH[W WR WKH SURWHFWHG DUHD %LQGLQJ RI SURWHLQ'1$ ZLWKRXW VSHFLILFLW\ FRXOG FDXVH FKDQJHV LQ WKH '1$ FRQILUPDWLRQ WKDW FRXOG FUHDWH D VLQJOHVWUDQGHG UHJLRQ ZKLFK ZRXOG EH SUHIHUHQWLDOO\ QLFNHG E\ '1DVH ,Q 9LYR )RRWSULQW $QDO\VLV ,Q YLYR IRRWSULQW DQDO\VLV ZDV SHUIRUPHG WR LGHQWLI\ RWKHU WDUJHW VHTXHQFHV WKDW PD\ ELQG WUDQVFULSWLRQDO IDFWRUV 7KLV ZDV DOVR GRQH WR FRQILUP WKH UHVXOWV REWDLQHG E\ LQ YLWUR DQDO\VLV /LYH FHOOV ZHUH WUHDWHG ZLWK '06 D VPDOO PROHFXOH ZKLFK DGGV D PHWK\O JURXS DW WKH 1 SRVLWLRQ RI JXDQRVLQH 7KH DGGLWLRQ RI D PHWK\O JURXS WR WKH QXFOHRWLGH PDNHV LW VXVFHSWLEOH WR FOHDYDJH E\ SLSHULGLQH &HOOV ZHUH JURZQ WR ORJDULWKPLF SKDVH DQG WUHDWHG ZLWK b '06 IRU YDULRXV WLPHV UDQJLQJ IURP PLQXWHV WR PLQXWHV &HOOV WUHDWHG IRU PRUH WKDQ PLQXWHV SURGXFHG RYHUn PHWK\ODWHG '1$ WKHUHIRUH FOHDYDJH E\ SLSHULGLQH OHG WR IUDJPHQWV WRR VPDOO IRU IRRWSULQW LQIRUPDWLRQ $QDO\VLV ZDV FRQVHTXHQWO\ UHVWULFWHG WR '1$ WKDW ZDV LVRODWHG IURP FHOOV WUHDWHG EHWZHHQ WR PLQXWHV DW URRP WHPSHUDWXUH

PAGE 111

)LJXUH VKRZV WKH UHVXOWV RI RQH VXFK H[SHULPHQW 7R H[DPLQH DQ\ SRVVLEOH SURWHLQ'1$ LQWHUDFWLRQ RQ WKH FRGLQJ VWUDQG WKDW LQYROYHG UHVLGXHV WKH '1$ ZDV GLJHVWHG ZLWK $FFO UHVWULFWLRQ HQ]\PH ZKLFK FXWV DW SRVLWLRQ 7KLV VLWH ZDV FKRVHQ EHFDXVH LW LV RQO\ ES DZD\ IURP WKH n ERXQGDU\ RI WKH ZLOGW\SH SODVPLG XVHG WKURXJKRXW WKHVH VWXGLHV ,Q DGGLWLRQ LW ZDV WKH RQO\ XSVWUHDP FXWWLQJ VLWH WKDW GRHV QRW KDYH DQRWKHU VLWH ZLWKLQ ES XSVWUHDP RU GRZQVWUHDP RI WKDW SRVLWLRQ $Q (FR59 UHVWULFWLRQ HQ]\PH ZDV XVHG WR FXW DW WKH GRZQVWUHDP VLWH RI WKH JHQH WR H[DPLQH WKH QRQFRGLQJ VWUDQG 7KH (FR59 VLWH LV DW SRVLWLRQ ZLWK UHVSHFW WR WKH WUDQVFULSWLRQDO VWDUW VLWH DQG RQO\ HOHYHQ EDVH SDLUV XSVWUHDP RI WKH SXWDWLYH 7$7$ VLWH 7KH SULPHUV $/ DQG $/ VHH 7DEOH 0DWHULDOV DQG 0HWKRGVf ZHUH XVHG WR JHQHUDWH SUREHV IRU WKH FRGLQJ DQG QRQFRGLQJ VWUDQG UHVSHFWLYHO\ 6LQJOHVWUDQGHG '1$ ZDV REWDLQHG IURP WKH SKDJHPLG YHFWRUV S6/ DQG S6/5 7KHVH WZR SODVPLGV KDYH WKH HQWLUH &,7 XSVWUHDP VHTXHQFH LQ RSSRVLWH RULHQWDWLRQV ZKLFK LV SUHVHQW RQ WKH S SODVPLG ,Q S6/ WKH FRGLQJ VWUDQG ZDV RQ WKH f VWUDQG WKHUHIRUH VLQJOHVWUDQGHG '1$ IURP WKLV FORQH ZDV XVHG DV WKH WHPSODWH WR SUHSDUH WKH SUREH IRU WKH QRQFRGLQJ VWUDQG 6LQJOHVWUDQGHG '1$ IURP S6/5 ZDV XVHG DV WKH WHPSODWH WR SUHSDUH WKH SUREH ZKHQ DQDO\]LQJ WKH FRGLQJ VWUDQG $V VWDWHG HDUOLHU WKHUH LV D SHUIHFW PDWFK WR WKH FRQVHQVXV ELQGLQJ VLWH IRU WKH +DSS+DSS+DSS WULPHULF WUDQVFULSWLRQDO DFWLYDWRUV EHWZHHQ SRVLWLRQV DQG 7KH FRUH RI WKLV FRQVHQVXV ELQGLQJ VLWH FRQWDLQV WKH &&$$7 ER[ VHTXHQFH SUHVHQW LQ PRVW PDPPDOLDQ JHQHV /DQHV DQG WKUX )LJXUH f UHSUHVHQW WKH VHTXHQFH ODGGHU JHQHUDWHG IURP QDNHG '1$ XVLQJ WKH PHWKRG RI

PAGE 112

)LJXUH ,Q YLYR '06 )RRWSULQWLQJ $QDO\VLV &HOOV IURP WKH LQGLFDWHG VWUDLQ DQG PHGLXP ZHUH WUHDWHG ZLWK b '06 '1$ ZDV LVRODWHG IURP WKH WUHDWHG FHOOV GLJHVWHG ZLWK $FFO FOHDYHG ZLWK SLSHULGLQH DQG VHSDUDWHG RQ b SRO\DFU\ODPLGH JHO f 7KH '1$ ZDV WKHQ WUDQVIHUUHG RQ WR +\ERQG 1 $PHUVKDPf E\ HOHFWUREORWWLQJ *HQHVZHHS +RHIIHU 6FLHQWLILFf DQG K\EULGL]HG 5DGLRODEHOHG SUREH ZDV SUHSDUHG IURP VLQJOHVWUDQGHG '1$ WHPSODWH XVLQJ $/ SULPHU E\ SULPHU H[WHQVLRQ ZLWK .OHQRZ HQ]\PH 0HPEUDQH ZDV H[SRVHG WR .RGDN ;$5 ILOP 6HTXHQFLQJ ODGGHU ZDV JHQHUDWHG RQ QDNHG '1$ E\ 0D[DP DQG *LOEHUW PHWKRG

PAGE 113

+$3 6,7( PPP R! RR WR KDS KDS $ 6% 6% 6%f§ $* & 7& 2 2f <3' <3( 6'

PAGE 114

0D[DP DQG *LOEHUW f /DQHV WKUX FRQVLVW RI WHVW '1$ LVRODWHG IURP VWUDLQV DIWHU '06 WUHDWPHQW ,Q ODQHV DQG WKH '1$ ZDV LVRODWHG IURP KDS DQG KDS PXWDQWV VWUDLQV WKH JHQH SURGXFWV IURP WKHVH ORFL IRUP SDUW RI WKH WULPHULF WUDQVFULSWLRQDO DFWLYDWRU WKDW UHJXODWHV &<& 6DPSOHV LQ ODQHV WKUX FRQVLVW RI '1$ LVRODWHG IURP WKH ZLOGW\SH VWUDLQ
PAGE 115

WULDOV ZHUH WKH VDPH UHVXOW QRW VKRZQf ERWK PDWFKHG WKH SXEOLVKHG UHVXOWV RI WKHLU RULJLQDO H[SHULPHQW +XLH HW DO f &,7 P51$ LV 0RUH 6WDEOH LQ &HOOV *URZQ LQ (WKDQRO 7KDQ LQ &HOOV *URZQ LQ *OXFRVH 7KH VWHDG\VWDWH P51$ OHYHO UHIOHFWV WKH UDWH RI V\QWKHVLV DQG UDWH RI GHJUDGDWLRQ IRU HDFK PHVVDJH 6HYHUDO OLQHV RI HYLGHQFH KDYH VKRZQ WKDW WKHUH ZDV D JUHDWHU DPRXQW RI VWHDG\VWDWH &,7 P51$ LQ D FRPSOH[ PHGLXP VXSSOHPHQWHG ZLWK HWKDQRO WKDQ LQ D PHGLXP VXSSOHPHQWHG ZLWK JOXFRVH +RZHYHU WKHUH ZDV QR FOHDUO\ GHPRQVWUDEOH UHJLRQ RQ WKH &,7 JHQH XSVWUHDP VHTXHQFH WKDW FRXOG IXOO\ DFFRXQW IRU WKH GLIIHUHQWLDO H[SUHVVLRQ EHWZHHQ <3' DQG <3( PHGLD 7KLV REVHUYDWLRQ VXJJHVWHG WKDW GLIIHUHQWLDO UHJXODWLRQ PD\ DOVR RFFXU DW D SRVWWUDQVFULSWLRQDO OHYHO VXFK DV WKH UDWH RI GHFD\ RI WKH &,7 PHVVDJH LQ WKH GLIIHUHQW JURZWK PHGLD /RPEDUGR HW DO f VWXG\LQJ WKH UHJXODWLRQ RI WKH ,S JHQH HQFRGLQJ WKH LURQSURWHLQ VXEXQLW RI WKH VXFFLQDWH GHK\GURJHQDVH FRPSOH[ VKRZHG WKDW D PHVVDJH WUDQVFULEHG IURP WKLV JHQH GHJUDGHG DW D IDVWHU UDWH ZKHQ WKH JURZWK PHGLXP ZDV FKDQJHG WR <3' DIWHU LQLWLDO JURZWK LQ <3( 7KLV VKRZHG IRU WKH ILUVW WLPH WKDW JOXFRVH UHJXODWLRQ RI JHQHV FRXOG LQYROYH FKDQJLQJ WKHLU UDWH RI P51$ GHFD\ 6XURVN\ HW DO f UHFHQWO\ GLVFRYHUHG WKH 80( JHQH ZKLFK LV UHTXLUHG IRU WKH UDSLG WXUQRYHU RI PHLRWLF VSHFLILF JHQHV LQ D JOXFRVH GHSHQGHQW PDQQHU *OXFRVH DOVR UHJXODWHV WKHVH JHQHV DW WKH WUDQVFULSWLRQDO

PAGE 116

OHYHO WKHUHIRUH GHFLGHG WR WHVW ZKHWKHU &,7 P51$ KDV GLIIHUHQW GHFD\ UDWHV LQ <3' DQG <3( PHGLD 7R VWXG\ KDOIOLYHV RI 51$ DOO GH QRYR WUDQVFULSWLRQ PXVW EH EORFNHG )RU WKHVH VWXGLHV HPSOR\HG VWUDLQ = ZKLFK FRQWDLQHG D WHPSHUDWXUHVHQVLWLYH PXWDWLRQ LQ WKH ODUJHVW VXEXQLW RI 51$ SRO\PHUDVH ,, 1RQHW HW DO f
PAGE 117

)LJXUH +DOIOLIH RI &,7 P51$ $f 7RWDO 51$ ZDV LVRODWHG IURP DQ 51$ SRO\PHUDVH ,, WHPSHUDWXUH VHQVLWLYH PXWDQW JURZQ LQ <3' RU <3( DIWHU WUDQVFULSWLRQ LQKLELWLRQ E\ VKLIWLQJ WKH FXOWXUH WR r& QRQSHUPLVVLYH WHPSHUDWXUHf SJ RI WRWDO 51$ ZDV VHSDUDWHG LQ HDFK ODQH RQ D b DJDURVH 0 )RUPDOGHK\GH JHO LQ 0236 EXIIHU 51$ ZDV WUDQVIHUHG RQ WR +\ERQG 1 $PHUVKDPf Q\ORQ PHPEUDQH E\ FDSLOODU\ EORWWLQJ 7KH PHPEUDQH ZDV K\EULGL]HG ZLWK D ES (FR5,3VWO &,7 '1$ UDGLRODEHOHG ZLWK D3$73 XVLQJ WKH UDQGRP SULPHU NLW 8 6 %LRFKHPLFDOf 7KH DPRXQW RI P51$ ZDV TXDQWLWDWHG XVLQJ WKH 3KRVSKRU,PDJHU 0ROHFXODU '\QDPLFVf %f 6HPLORJ SORW RI b P51$ UHPDLQLQJ DV D IXQFWLRQ RI WLPH

PAGE 118

7,0( 0,1f &' b P51$ UHPDLQLQJ <3' <3( <3' <3( <3' <3( <3' <3( <3' <3( <3' <3( <3' <3(

PAGE 119

LQ WKH VDPSOH G\H VROXWLRQ RU LLf SURELQJ IRU 6 U51$ ZLWK D '1$ SUREH :KHQHYHU WKHUH ZDV D VLJQLILFDQW GLIIHUHQFH LQ ORDGLQJ DV VKRZQ E\ HLWKHU PHWKRG WKH UDWLR RI &,7 RYHU 6 ZDV XVHG DV WKH EDVLV IRU FDOFXODWLQJ WKH TXDQWLW\ RI 51$ DW HDFK VSRW )LJXUH E VKRZV WKH KDOIOLIH RI &,7 P51$ XQGHU GLIIHUHQW JURZWK FRQGLWLRQV 7KH KDOIOLIH RI &,7 P51$ LVRODWHG IURP FXOWXUHV JURZQ LQ D <3' PHGLXP DSSUR[LPDWHO\ PLQXWHVf ZDV VKRUWHU WKDQ P51$ LVRODWHG IURP FXOWXUHV JURZQ LQ D <3( PHGLXP DSSUR[LPDWHO\ PLQXWHVf +DOIOLYHV ZHUH GHWHUPLQHG E\ SORWWLQJ WKH SHUFHQW RI P51$ UHPDLQLQJ DW WKH GLIIHUHQW WLPH SRLQWV DV D UDWLR RI WKH ]HUR WLPH VDPSOH RQ D VHPL ORJDULWKPLF VFDOH 7KLV DVVXPHV ILUVWRUGHU GHFD\ NLQHWLFV 7KHVH UHVXOWV VXJJHVW WKDW D JUHDWHU WKDQ WZRIROG GLIIHUHQFH LQ WKH H[SUHVVLRQ RI &,7 PD\ EH GXH WR WKH LQFUHDVHG UDWH RI P51$ GHFD\ LQ D JOXFRVH PHGLXP 7KH ZRUN RI /RPEDUGR HW DO f VKRZHG WKDW ZKHQ 51$ ZDV LVRODWHG IURP FHOOV WKDW ZHUH LQLWLDOO\ JURZQ LQ DQ HWKDQRO PHGLXP EXW VXEVHTXHQWO\ VKLIWHG WR <3' WKH GHFD\ UDWH FKDQJHG GUDVWLFDOO\ 7KH GHFD\ UDWH ZDV IDVWHU LI JOXFRVH ZDV DGGHG WR WKH PHGLXP WKDQ LI LW ZDV PDLQWDLQHG LQ <3( ZDQWHG WR NQRZ LI WKH VDPH SKHQRPHQRQ RFFXUV ZLWK WKH &,7 PHVVDJH 7KH VWUDWHJ\ HPSOR\HG WR DGMXVW WKH JOXFRVH FRQFHQWUDWLRQ WR b DIWHU LQLWLDO JURZWK LQ <3( bf PHGLXP LV GHSLFWHG LQ )LJXUH &HOOV ZHUH LQLWLDOO\ JURZQ LQ D <3( bf WKHQ DW WKH WLPH RI WUDQVFULSWLRQDO LQKLELWLRQ DQ HTXDO YROXPH RI SUHZDUPHG r&f <3' bf PHGLXP ZDV DGGHG 7KLV PDGH WKH JOXFRVH FRQFHQWUDWLRQ b WKH VDPH DPRXQW DV LQ WKH VWDQGDUG JURZWK PHGLXP )LJXUH f :KHQ WKH PHGLXP ZDV DGMXVWHG DV GHVFULEHG WKH UDWH RI GHFD\ EHFDPH HYHQ IDVWHU WKDQ

PAGE 120

)LJXUH 6FKHPDWLF WR 'HWHUPLQH 'LIIHUHQWLDO 6WDELOLW\ PO RI FXOWXUH ZDV JURZQ WR ORJDULWKPLF SKDVH LQ <3( PHGLXP 7KH FXOWXUH ZDV GLYLGHG LQWR WZR HTXDO KDOYHV DQG WUDQVIHUUHG WR IODVN FRQWDLQLQJ DQ HTXDO YROXPH RI IUHVK <3' bf RU <3( bf 7KH IUHVK PHGLXP ZDV HLWKHU SUHZDUPHG WR r& LI 51$ SRO\PHUDVH ,, PXWDQWV ZHUH XVHG RU FKHPLFDO LQKLELWRUV ZHUH DGGHG DW WKHLU VSHFLILHG FRQFHQWUDWLRQV IRU QRQPXWDQW VWUDLQ

PAGE 121

<3(bf ,62/$7( 51$ 581 $*$526( )250$/'(+<'( *(/ %/27 +<%5,',=( 48$17,7$7(

PAGE 122

)LJXUH +DOIOLIH RI &,7 P51$ XSRQ VKLIW IURP HWKDQRO WR JOXFRVH $f &HOOV ZHUH LQLWLDOO\ JURZQ LQ <3( bf DW WKH WLPH RI WUDQVFULSWLRQ LQKLELWLRQ WKH FXOWXUH ZDV GLYLGHG LQWR WZR HTXDO KDOYHV DQG WUDQVIHUUHG LQWR IODVN FRQWDLQLQJ DQ HTXDO YROXPH RI SUHZDUPHG <3( bf RU SUHZDUPHG <3' bf 7KH FXOWXUH ZDV WKHQ VKLIWHG WR r& QRQSHUPLVVLYH WHPSHUDWXUHf DQG LQFXEDWLRQ FRQWLQXHG VHH )LJXUH f &HOOV ZHUH KDUYHVWHG DW WKH LQGLFDWHG WLPH DQG WRWDO 51$ ZDV LVRODWHG IURP HDFK VDPSOH 51$ ZDV VHSDUDWHG DQG K\EULGL]HG DV GHVFULEHG LQ )LJXUH %f 6HPLORJ SORW RI b P51$ UHPDLQLQJ DV D IXQFWLRQ RI WLPH

PAGE 123

$ <3' 7LPH PLQf FP 7,0( PLQXWHVf

PAGE 124

ZKHQ WKH FXOWXUH ZDV LQFXEDWHG FRQWLQXRXVO\ LQ <3' DW WKH UHVWULFWLYH WHPSHUDWXUH FRPSDUH ODQHV RI )LJXUH D DQG Df 7KH KDOIOLIH RI &,7 P51$ LQ WKH FXOWXUH DGMXVWHG WR b JOXFRVH DIWHU LQLWLDO JURZWK LQ <3( ZDV OHVV WKDQ PLQXWHV ZKHUHDV WKH KDOIOLIH ZDV DSSUR[LPDWHO\ PLQXWHV LI FHOOV ZHUH LQLWLDOO\ JURZQ LQ <3' DQG PDLQWDLQHG LQ LW IROORZLQJ WKH WHUPLQDWLRQ RI WUDQVFULSWLRQ 7KHVH UHVXOWV VXJJHVW WKDW ZKHQ FHOOV VHQVH D FKDQJH LQ WKH DYDLODELOLW\ RI D FDUERQ VRXUFH HVSHFLDOO\ IURP WKH OHVV SUHIHUUHG HWKDQROf WR WKH SUHIHUUHG JOXFRVHf WKHUH LV D UDSLG DGMXVWPHQW LQ WKH SDWWHUQ RI JHQH H[SUHVVLRQ WR XWLOL]H WKH QHZ FDUERQ VRXUFH 7KHVH UHVXOWV LPSO\ WKDW WKHUH DUH VHTXHQFHV RQ WKH &,7 P51$ WKDW FDXVH LW WR GHFD\ DW D IDVWHU UDWH LQ D JOXFRVHFRQWDLQLQJ PHGLXP WKDQ LQ DQ HWKDQRO PHGLXP 7KH GHFD\ UDWH ZDV PRVW SURQRXQFHG EHWZHHQ WKH WZR PHGLD DW WKH HDUO\ LQWHUYDOV +RZHYHU WKH GHFD\ UDWH EHWZHHQ WKH WZR DSSHDUV WR EH DERXW WKH VDPH DIWHU PLQXWHV 7KLV VXJJHVWV WKDW WKHUH PD\ EH WZR GLIIHUHQW GHFD\ NLQHWLFV LQYROYHG LQ WKH GHFD\ RI &,7 P51$ LQ <3' D IDVW GHFD\ UDWH IRU HDUO\ WLPH SHULRGV DQG D VORZHU UDWH VXEVHTXHQWO\ 7KH GLIIHUHQW GHFD\ UDWHV PD\ UHIOHFW UHFRJQLWLRQ RI GLIIHUHQW P51$ SRSXODWLRQV UHFRJQL]HG E\ GLIIHUHQW QXFOHDVHV +RZHYHU D UDSLG WXUQRYHU RI D QXFOHDVH RU VRPH RWKHU IDFWRU UHTXLUHG IRU WKH GHFD\ FRXOG DOVR SURGXFH WKLV HIIHFW 6LQFH WUDQVFULSWLRQ ZDV EHLQJ LQKLELWHG QR QHZ WUDQVFULSW ZRXOG EH DYDLODEOH WR VHUYH DV D PHVVDJH IRU D SURWHLQ PROHFXOH WKDW KDV EHHQ GHJUDGHG 7KLV ZRXOG GHSOHWH WKH UHTXLUHG IDFWRU IRU WKH UDSLG WXUQRYHU FRQVHTXHQWO\ VORZLQJ WKH UDWH RI WXUQRYHU

PAGE 125

$ IUDJPHQW RI WKH &,7 JHQH ZDV DOVR K\EULGL]HG WR WKH 51$ DIWHU WUDQVIHU RQWR D PHPEUDQH &,7 HQFRGHV WKH SHUR[LVRPDO LVR]\PH RI FLWUDWH V\QWKDVH )LJXUH D VKRZV WKH DPRXQW RI &,7 P51$ UHPDLQLQJ DIWHU VKLIW WR WKH QRQSHUPLVVLYH WHPSHUDWXUH )LJXUH E LV D VHPLORJDULWKPLF SORW RI SHUFHQW P51$ UHPDLQLQJ DV D IXQFWLRQ RI WLPH 7KH UDWH RI GHFD\ DQG OHYHO RI H[SUHVVLRQ RI WKH &,7 P51$ LV TXLWH GLIIHUHQW IURP WKH &,7 P51$ 7KHVH WZR JHQHV VKDUH DERXW b LGHQWLFDO DPLQR DFLGV RU FRQVHUYHG FKDQJHV 5RVHQNUDQW] HW DO f 7KHUH LV YHU\ OLWWOH GHFD\ RI WKLV PHVVDJH LQ HLWKHU <3' DQG <3( 7KH H[SUHVVLRQ RI &,7 LV KLJKHU LQ D JOXFRVH PHGLXP FRPSDUHG WR DQ HWKDQRO PHGLXP 7KLV LV LQ DJUHHPHQW ZLWK WKH UHSRUW RI /LDR HW DO f ZKR XVHG D ULERQXFOHDVH SURWHFWLRQ DVVD\ WR TXDQWLWDWH WKH P51$ VR PD\ KDYH PLVVHG WKH GRXEOH EDQGV VKRZQ RQ WKH 1RUWKHUQ DQDO\VLV )ORZHYHU .LP HW DO f VKRZHG WKH SUHVHQFH RI GRXEOH EDQGV ZKHQ WKH\ SHUIRUPHG 1RUWKHUQ DQDO\VLV 7KXV GHFD\ RI &,7 P51$ LV UHVWULFWHG WR WKH PLWRFKRQGULDO LVRIRUP LQ JOXFRVH &,7ODF= )XVLRQ P51$ +DV D 6LPLODU 'HFD\ 5DWH $V )XOO/HQJWK &,7 $V VWDWHG HDUOLHU LQ WKH 0DWHULDOV DQG 0HWKRGV VHFWLRQ WKH &,7ODF= IXVLRQ FRQVWUXFWHG WR VWXG\ WKH WUDQVFULSWLRQDO UHJXODWLRQ KDV DSSUR[LPDWHO\ QXFOHRWLGHV RI &,7 P51$ QXFOHRWLGHV RI FRGLQJ UHJLRQ SOXV QXFOHRWLGHV RI n XQWUDQVODWHG UHJLRQf ,Q RUGHU WR GHWHUPLQH LI WKLV IXVLRQ P51$ EHKDYHG VLPLODUO\ WR WKH IXOOOHQJWK &,7 P51$ LQ ERWK PHGLD 51$ ZDV LVRODWHG IURP WKH

PAGE 126

)LJXUH +DOIOLIH RI &,7 P51$ $f 51$ ZDV LVRODWHG DIWHU VKLIW DQG VHSDUDWHG DV GHVFULEHG LQ )LJXUH 7KH PHPEUDQH ZDV K\EULGL]HG ZLWK D ES IUDJPHQW RI &,7 '1$ %f 6HPLORJ SORW RI b P51$ UHPDLQLQJ DW WKH LQGLFDWHG WLPH

PAGE 127

7,0( 0,1f &' b P51$ UHPDLQLQJ r R R R <3' <3( <3' <3( <3' <3( <3' <3( <3' <3( <3' <3( <3' <3( <3' <3( K2 2

PAGE 128

\HDVW VWUDLQ WKDW KDUERUV WKH SODVPLG FRQWDLQLQJ WKH IXVLRQ DQG WKH GHFD\ UDWH GHWHUPLQHG DV EHIRUH :KHQ WKH ILOWHU ZDV K\EULGL]HG ZLWK WKH ODF= SUREH WKUHH EDQGV ZHUH VHHQ WKDW UDQJHG LQ VL]H IURP DSSUR[LPDWHO\ NE WR JUHDWHU WKDQ NLOREDVHV UHVXOW QRW VKRZQf 7KH NE P51$ VSHFLHV UHSUHVHQWV WUDQVFULSWV WHUPLQDWHG DW WKH HQG RI WKH ODF= JHQH $OWKRXJK WKH ODF= JHQH PD\ QRW KDYH D SURSHU \HDVW WHUPLQDWLRQ VLWH FRQVHQVXV VHTXHQFH 77777$7$f VHTXHQFHV DYDLODEOH ZHUH DSSUHFLDEO\ UHFRJQL]HG WR HQDEOH WHUPLQDWLRQ DW KLJK IUHTXHQF\ DERXW RQHWKLUG RI WKH WUDQVFULSWLRQf 7KH WZR RWKHU P51$ VSHFLHV WHUPLQDWHG HLWKHU DW WKH n HQG RI WKH 753 JHQH RU WUDQVFULEHG WKH HQWLUH SODVPLG 7UDQVFULSWLRQ WKURXJK WKH ODF= JHQH LQ IXVLRQ ZLWK DQRWKHU \HDVW JHQH ZDV DOVR REVHUYHG E\ /HHGV HW DO f XVLQJ D VLPLODU YHFWRU SODVPLG $OWKRXJK WKUHH GLIIHUHQW VSHFLHV RI P51$ ZHUH VHHQ WKH\ DOO VKRZHG GHFD\ NLQHWLFV VLPLODU WR IXOOOHQJWK &,7 P51$ LQ <3( RU ZKHQ WKH JURZWK PHGLXP ZDV DGMXVWHG WR b JOXFRVH )RU WKH SXUSRVH RI GHWHUPLQLQJ WKH GHFD\ UDWH RI WKH IXVLRQ PHVVDJH XVHG WKH WUDQVFULSW WKDW WHUPLQDWHG DIWHU WKH ODF= JHQH 6KRZQ LQ )LJXUH D LV WKH DXWRUDGLRJUDP RI IXVLRQ SURGXFW &,7ODF=f K\EULGL]HG ZLWK WKH ODF= JHQH 7KH IXVLRQ SURGXFW GHFD\HG ZLWK NLQHWLFV W PLQXWHVf WKDW ZDV VLPLODU WR WKH &,7 P51$ DORQH W PLQXWHVf ZKHQ WKH JURZWK PHGLXP ZDV DGMXVWHG WR b JOXFRVH FRPSDUH )LJXUHV DQG f 7KH KDOIOLIH RI WKH IXVLRQ SURGXFW LQ DQ HWKDQRO PHGLXP ^Wƒ PLQXWHVf ZDV VOLJKWO\ ORQJHU WKDQ WKH IXOOOHQJWK &,7 P51$ KDOIOLIH W PLQXWHVf 7KH VLPLODU KDOIOLYHV RI WKH IXVLRQ SURGXFW DQG IXOOOHQJWK &,7 P51$ VXJJHVW WKDW WKH

PAGE 129

)LJXUH +DOIOLIH RI &,7ODF= IXVLRQ P51$ XSRQ VKLIW $f 6FKHPDWLF RI &,7ODF= IXVLRQ SUHVHQW LQ WKH SODVPLG EHDULQJ WKH IXVLRQ 7KH JHQHV DUH QRW GUDZQ WR VFDOH %f 51$ ZDV LVRODWHG IURP \HDVW VWUDLQ KDUERULQJ SODVPLG ZLWK WKH IXVLRQ JHQH 7KH ODF= JHQH LV FRQWUROOHG E\ WKH &,7 SURPRWHU 7KH P51$ DOVR KDV QXFOHRWLGHV RI &,7 WUDQVFULSW 7KH f RU f VLJQ LQGLFDWHV ZKHWKHU <3' bf ZDV DGGHG WR WKH JURZWK PHGLXP WR DGMXVW WKH ILQDO FRQFHQWUDWLRQ RI JOXFRVH WR b 0HPEUDQH ZDV K\EULGL]HG ZLWK ES RI ODF= SUREH UDGLRODEHOHG XVLQJ WKH UDQGRP SULPHU NLW 86 %LRFKHPLFDOf DQG D3$73 &f 'HFD\ NLQHWLFV RI &,7ODF= IXVLRQ P51$ XSRQ VKLIW

PAGE 130

$ &,7 /DF= % <3' 7LPH PLQf &,7/DF= R R R R R ‘}f§ &0 &2 A R R R R R P 7,0( PLQXWHVf

PAGE 131

QXFOHRWLGHV RI &,7 P51$ RQ WKH IXVLRQ P51$ FRQWDLQ VHTXHQFHV VXIILFLHQW WR FRQIHU WKH ZLOGW\SH GHFD\ SDWWHUQ LQFOXGLQJ JOXFRVH LQVWDELOLW\ 7KH VLPLODULW\ LQ GHFD\ NLQHWLFV RI WKH IXVLRQ P51$ DQG WKH ZLOGW\SH P51$ PDNHV LW YDOLG WR XVH WKH UHVXOWV RI WKH IXVLRQ P51$ WR GHILQH VHTXHQFHV WKDW DUH QHFHVVDU\ DQG VXIILFLHQW IRU WKH GHFD\ RI &,7 P51$ +RZHYHU WKLV GRHV QRW UXOH RXW WKH SRVVLELOLW\ WKDW WKHUH PD\ EH RWKHU VHTXHQFHV RQ WKH &,7 P51$ WKDW FRXOG FDUU\ RXW D VLPLODU IXQFWLRQ +HDWRQ HW DO f VKRZHG WKDW WKHUH DUH WZR UHJLRQV FRGRQV WR DQG WKH n XQWUDQVODWHG UHJLRQ 87f LQ WKH 67( JHQH ZKLFK HQFRGHV DPDWLQJ IDFWRU FDSDEOH RI PHGLDWLQJ UDSLG GHFD\ RI WKH P51$ (LWKHU RQH RI WKHVH UHJLRQV E\ LWVHOI ZDV DEOH WR PHGLDWH UDSLG GHFD\ RI 67( P51$ LI WKH RWKHU UHJLRQ ZDV GHOHWHG 7KLV VKRZV WKDW WKHUH DUH UHGXQGDQW VHTXHQFHV LQ VRPH P51$ VSHFLHV WR FDUU\ RXW WKH VDPH IXQFWLRQ ,W PD\ DOVR EH SRVVLEOH WKDW WKHUH DUH VHTXHQFHV LQ WKH ODF= P51$ WKDW FRQIHU JOXFRVH LQVWDELOLW\ WR WKH IXVLRQ 51$ 7R WHVW WKLV SRVVLELOLW\ DV WKH FDXVH RI UDSLG GHFD\ WHVWHG DQRWKHU IXVLRQ P51$ EHWZHHQ 73,ODF= JLIW IURP 'U + %DNHUf ,Q WKLV IXVLRQ WKHUH DUH DSSUR[LPDWHO\ ES RI 73, FRGLQJ VHTXHQFH IXVHG LQ IUDPH WR WKH ODF= JHQH 7KH UHVXOWV RI WKLV H[SHULPHQW DUH VKRZQ LQ )LJXUH 7KH SURGXFW RI WKLV IXVLRQ EHKDYHG TXLWH GLIIHUHQWO\ IURP WKH &,7ODF= IXVLRQ P51$ 7KH GHFD\ UDWHV RI WKH 73,ODF= IXVLRQ LQ <3' DQG <3( DUH YHU\ VLPLODU W+! PLQXWHVf 7KH KDOIOLIH RI 73, ZDV UHFHQWO\ UHSRUWHG WR EH PLQXWHV DQG PLQXWHV LQ D PLQLPDO PHGLXP ZLWK HLWKHU ORZLURQ FRQFHQWUDWLRQ RU KLJKLURQ .ULHJHU DQG (UQVW f 7KH KDOIOLIH RI P51$ WUDQVFULEHG IURP WKH 3*. HQFRGHV SKRVSKRJO\FHUDWH NLQDVHf LV DERXW

PAGE 132

)LJXUH +DOIOLIH RI 73,ODF= IXVLRQ P51$ XSRQ VKLIW $f 6FKHPDWLF RI WKH 73,ODF= IXVLRQ FRQWDLQHG LQ WKH SODVPLG 7KH JHQHV DUH QRW QHFHVVDULO\ GUDZQ WR VFDOH %f 51$ ZDV LVRODWHG IURP DQ LVRJHQLF VWUDLQ RI \HDVW KDUERULQJ D SODVPLG WKDW FRQWDLQV 73,ODF= JHQH &RXUWHV\ 'U + %DNHUf 0HPEUDQH ZDV K\EULGL]HG ZLWK LGHQWLFDO ODF= JHQH DV ZDV XVHG IRU WKH &,7ODF= IXVLRQ

PAGE 134

PLQXWHV +HUULFN HW DO f LQ D FRPSOH[ PHGLXP 3KRVSKRJO\FHUDWH NLQDVH LV DQRWKHU JO\FRO\WLF HQ]\PH +RZHYHU WKH LPSRUWDQW SRLQW LV WKDW WKH &,7ODF= IXVLRQ P51$ EHKDYHV GLIIHUHQWO\ IURP 73,ODF= IXVLRQ P51$ 7KLV OHDGV WR WKH FRQFOXVLRQ WKDW WKH ODF= P51$ VHTXHQFH GRHV QRW FDXVH WKH JOXFRVH GHSHQGHQW GHFD\ VHHQ ZLWK WKH &,7ODF= IXVLRQ P51$ &,7 P51$ )URP &HOOV *URZQ LQ <3' DQG <3( 0HGLD +DYH ,GHQWLFDO n 0DWXUH (QGV 7KH VLPLODU UDWHV RI GHFD\ RI ERWK IXOO OHQJWK &,7 DQG IXVLRQ P51$ VXJJHVWHG WKDW WKHUH LV D JOXFRVHGHSHQGHQW LQVWDELOLW\ HOHPHQW *',(f RQ WKH &,7 PHVVDJH WKDW OLHV RQ WKH n SRUWLRQ RI WKH PHVVDJH 'LIIHUHQWLDO WUDQVFULSWLRQDO VWDUW VLWHV EHWZHHQ WKH WZR PHGLD FRXOG SURGXFH P51$nV KDYLQJ GLIIHUHQW VHTXHQFHV DW WKHLU WHUPLQL WKDW FRXOG WDUJHW WKHP WR GLIIHUHQW GHFD\ SDWKZD\V LQ HLWKHU PHGLXP ,Q RUGHU WR DVVHVV WKLV GLG SULPHU H[WHQVLRQ RQ WKH WRWDO 51$ LVRODWHG IURP FXOWXUHV FRQWDLQLQJ HLWKHU <3' RU <3( XVLQJ $/ DV GHVFULEHG LQ 0DWHULDOV DQG 0HWKRGV )LJXUH VKRZV WKH UHVXOWV RI WKLV H[SHULPHQW 0XOWLSOH VWDUW VLWHV ZHUH REVHUYHG IURP WKH H[WHQVLRQ SURGXFWV 7KHUH ZDV QR GHWHFWDEOH GLIIHUHQFH LQ DPRXQW RU SRVLWLRQ LQ PDWXUH HQGV RI &,7 PHVVDJHV IURP FHOOV JURZQ LQ <3' RU <3( 7KH PDMRU EDQG FRUUHVSRQGV WR D n PDWXUH HQG WKDW LV QXFOHRWLGHV XSVWUHDP IURP WKH $8* ,QWHUHVWLQJO\ WKH PDMRU VWDUW VLWH OLHV DW WKH FHQWUDO QXFOHRWLGH RI D ES SDOLQGURPH %HFDXVH WKHUH ZDV QR GLIIHUHQFH LQ n PDWXUH

PAGE 135

)LJXUH ,GHQWLILFDWLRQ RI WUDQVFULSWLRQDO VWDUW VLWHV RI &,7 P51$ LQ *OXFRVH DQG (WKDQROJURZQ FHOOV $f SJ RI WRWDO \HDVW 51$ ZDV DQQHDOHG ZLWK\3 HQGODEHOHG $/ SULPHU DQG H[WHQGHG LQ WKH SUHVHQFH RI P0 HDFK RI G173nV XVLQJ 6XSHUVFULSW ,, /LIH 7HFKQRORJLHVf UHYHUVH WUDQVFULSWDVH 7KH SULPHU LV FRPSOHPHQWDU\ WR WKH QRQFRGLQJ VWUDQG DQG LV QXFOHRWLGHV GRZQVWUHDP RI WKH $8* VWDUW FRGRQ /DQHV PDUNHG <3' DQG <3( DUH VDPSOHV LQ ZKLFK 51$ ZDV LVRODWHG IURP WKH LQGLFDWHG JURZWK PHGLXP 6HTXHQFLQJ UHDFWLRQ ODQHV XVLQJ 6HTXHQDVHf ZHUH JHQHUDWHG XVLQJ WKH VDPH SULPHU DV GHVFULEHG HDUOLHU RQ S&6% SODVPLG ZKLFK FRQWDLQV WKH HQWLUH &,7 FRGLQJ VHTXHQFH SOXV ES RI XSVWUHDP QRQFRGLQJ UHJLRQ 7KH VHTXHQFH UHDFWLRQV ZHUH D3 ODEHOHG 7KH VDPSOHV ZHUH VHSDUDWHG RQ b /RQJ 5DQJHU JHO $7 %LRFKHPf %f &,7 QRQFRGLQJ VWUDQG VHTXHQFH GHSLFWLQJ WKH SXWDWLYH WUDQVFULSWLRQDO VWDUW VLWHV +LJK DEXQGDQFH VWDUW VLWH LV PDUNHG ZLWK ORQJ DUURZ PRGHUDWH DEXQGDQFH VWDUW VLWHV DUH PDUNHG ZLWK PHGLXP VL]HG DUURZV DQG ORZ DEXQGDQFH VWDUW VLWHV DUH PDUNHG ZLWK VPDOOHVW VL]H DUURZV

PAGE 136

H :ARYRZXRRRRPYZ RYRAAXY[FA 22,22:92 V D =9

PAGE 137

HQGV EHWZHHQ <3' DQG <3( FXOWXUHV WKH *',( OLHV ZLWKLQ WKH QXFOHRWLGHV RI WUDQVFULSW IURP WKH &,7 JHQH $QRWKHU SULPHU H[WHQVLRQ UHDFWLRQ ZDV SHUIRUPHG WR LGHQWLI\ WKH n PDWXUH HQG RI WKH &,7ODF= IXVLRQ WUDQVFULSWV $Q ROLJRQXFOHRWLGH $/f WKDW FDQ DQQHDO RQO\ WR D SODVPLG VSHFLILF WUDQVFULSW FRQWDLQLQJ WKH ODF= PHVVDJH ZDV XVHG WR SULPH WKH UHYHUVH WUDQVFULSWLRQ 5HVXOWV IURP WKLV H[SHULPHQW GDWD QRW VKRZQf LQGLFDWHG WKDW VLPLODU n PDWXUH HQGV ZHUH REWDLQHG IURP WKH SODVPLG FDUU\LQJ WKH IXVLRQ JHQH 7KH OHVV DEXQGDQW P51$ VSHFLHV IXUWKHVW IURP WKH PDMRU SURGXFW ZHUH QRW VHHQ HLWKHU EHFDXVH WKH\ ZHUH QRW V\QWKHVL]HG RU WKH TXDQWLW\ V\QWKHVL]HG ZDV WRR ORZ WR YLVXDOL]H 7KH *OXFRVH'HSHQGHQW ,QVWDELOLW\ (OHPHQW /LHV :LWKLQ WKH &,7 &RGLQJ 5HJLRQ 7KH VLPLODU GHFD\ UDWHV EHWZHHQ IXOO OHQJWK &,7 DQG WKH IXVLRQ P51$ UHYHDOHG WKDW WKH QXFOHRWLGHV RI &,7 PHVVDJH SUHVHQW RQ WKH IXVLRQ P51$ ZDV VXIILFLHQW WR FRQIHU WKH UDSLG GHFD\ LQ JOXFRVHFRQWDLQLQJ PHGLXP ,Q DQ DWWHPSW WR LGHQWLI\ WKH H[DFW VHTXHQFHV WKDW FRQWDLQ WKH JOXFRVH UHVSRQVH HOHPHQW QXFOHRWLGHV RI QRQFRGLQJ UHJLRQ DQG EDVHV RI FRGLQJ UHJLRQ ZHUH LQGLYLGXDOO\ GLVVHFWHG IURP WKH UHVW RI WKH IXVLRQ P51$ 'HFD\ UDWHV RI WKHVH GHOHWLRQ PXWDQWV ZHUH WKHQ GHWHUPLQHG DV GHVFULEHG LQ 0DWHULDOV DQG 0HWKRGV 'HOHWLRQ RI WKH QRQFRGLQJ UHJLRQ OHDYLQJ WKH ERQD ILGH PDMRU n PDWXUH HQG QXFOHRWLGHV XSVWUHDP IURP WKH $8* VWDUW FRGRQ GLG QRW DIIHFW WKH GHFD\

PAGE 138

UDWH HLWKHU LQ D WHPSHUDWXUH VHQVLWLYH PXWDQW RU ZKHQ SKHQDQWKUROLQH ZDV XVHG WR VWRS WUDQVFULSWLRQ )LJXUH f )XVLRQV FRQWDLQLQJ WKLV GHOHWLRQ VKRZHG GHFUHDVHG P51$ VWDELOLW\ ZKHQ VKLIWHG WR <3' UHODWLYH WR <3( JURZQ FHOOV 7KH DEVHQFH RI FKDQJHV LQ WKH GHFD\ NLQHWLFV RI IXVLRQ P51$ ZLWK WKLV &,7 GHOHWLRQ LQGLFDWHG WKDW WKH VHTXHQFHV UHVSRQVLEOH IRU WKH UDSLG GHFD\ LQ D JOXFRVH PHGLXP UHODWLYH WR DQ HWKDQRO PHGLXP PD\ OLH ZLWKLQ WKH FRGLQJ UHJLRQ 7KH RWKHU DOWHUQDWLYH LV WKDW WKH FULWLFDO VHTXHQFHV DUH GHULYHG IURP ERWK UHJLRQV 7R WHVW WKH K\SRWKHVLV WKDW WKH FRGLQJ UHJLRQ VHTXHQFHV FRQWDLQ WKH JOXFRVH UHVSRQVH HOHPHQW 51$ ZDV LVRODWHG IURP D \HDVW VWUDLQ FDUU\LQJ D SODVPLG FRQVWUXFW KDYLQJ WKH &,7 FRGLQJ UHJLRQ GHOHWHG IURP WKH UHVW RI IXVLRQ JHQH 7KH 51$ ZDV K\EULGL]HG VLPXOWDQHRXVO\ ZLWK ODF= JHQH DQG &,7 JHQH SUREHV $Q DXWRUDGLRJUDP RI D 1RUWKHUQ DQDO\VLV RI WKLV H[SHULPHQW LV VKRZQ LQ )LJXUH 7KH GHFD\ UDWH RI WKH IXVLRQ P51$ ZLWK WKH FRGLQJ UHJLRQ GHOHWLRQ Wb PLQXWHVf ZDV TXLWH GLIIHUHQW ZKHQ FRPSDUHG WR WKH LQWDFW IXVLRQ P51$ W PLQXWHVf ZKHQ WKH JURZWK PHGLXP ZDV DGMXVWHG WR b JOXFRVH FRPSDUH )LJXUH % DQG WKH WRS EDQG RI )LJXUH %f 7KLV UHSUHVHQWV IROG LQFUHDVH LQ WKH GHFD\ NLQHWLFV RI IXVLRQ P51$ ZLWKRXW WKH &,7 FRGLQJ UHJLRQ 1RWH WKDW WKH ODF= IXVLRQ 51$ FRQWDLQV D YHU\ VWDEOH FRPSRQHQW 7KHUHIRUH RQO\ WKH IDVWHVW FRPSRQHQW RI WKLV ELSKDVLF GHJUDGDWLRQ ZDV FRPSDUHG 6LPLODU FRPSDULVRQV FRXOG EH PDGH EHWZHHQ WKH IXOO OHQJWK &,7 P51$ DQG WKH FRGLQJ UHJLRQ GHOHWHG IXVLRQ P51$ ,Q HWKDQRO PHGLXP <3(f KDOIOLIH RI WKH GHOHWLRQ W PLQXWHVf ZDV VOLJKWO\ KLJKHU WKDQ WKH IXOO OHQJWK &,7 P51$ )LJXUH f EXW ZDV DERXW WKH VDPH DV WKH LQWDFW &,7ODF= IXVLRQ P51$ )LJXUH f 7KH GHFD\ UDWH RI WKH

PAGE 139

)LJXUH +DOIOLIH RI &,7ODF= IXVLRQ P51$ IURP ZKLFK WKH n XQWUDQVODWHG UHJLRQ 875f KDV EHHQ GHOHWHG $f 6FKHPDWLF UHSUHVHQWDWLRQ RI WKH &,7ODF= IXVLRQ 7KH &,7 VHTXHQFHV SUHVHQW LV ILOOHG ZLWK KDWFK PDUN DQG WKH GHOHWHG VHTXHQFH LV XQILOOHG 7KH ODF= VHTXHQFH LV FRPSOHWHO\ ILOOHG %f $XWRUDGLRJUDP RI 1RUWKHUQ JHO DQDO\VLV 7RWDO 51$ ZDV LVRODWHG IURP VWUDLQ FDUU\LQJ WKH SODVPLG WKDW KDV WKH n 875 GHOHWHG SJ RI WRWDO ZDV VHSDUDWHG DV GHVFULEHG LQ )LJXUH 7KH PHPEUDQH ZDV K\EULGL]HG VLPXOWDQHRXVO\ ZLWK &,7 DQG ODF= JHQH SUREHV 7KH f RU f VLJQ LQGLFDWH ZKHWKHU WKH FXOWXUH ZDV PDLQWDLQHG LQ <3( f RU DGMXVWHG WR PDNH LW <3' bf f &f 6HPLORJ SORW RI b P51$ UHPDLQLQJ DV D IXQFWLRQ RI WLPH

PAGE 140

$ &,7 /DF= >\XI5f§ O f % <3' 7LPH PLQf &,7/DF= FP B B f§ f n R R R R R R R R R Lf§ &0 &' 2 LQ Lf§ FP &' 7,0( 0,187(6f

PAGE 141

)LJXUH +DOIOLIH RI &,7ODF= IXVLRQ P51$ ZLWK &,7 n FRGLQJ UHJLRQ GHOHWLRQ $f 6FKHPDWLF UHSUHVHQWDWLRQ RI WKH &,7ODF= IXVLRQ 7KH &,7 VHTXHQFHV SUHVHQW LV ILOOHG ZLWK KDWFK PDUN DQG WKH GHOHWHG VHTXHQFH LV XQILOOHG ODF= VHTXHQFH LV FRPSOHWHO\ ILOOHG %f $XWRUDGLRJUDP RI 1RUWKHUQ JHO DQDO\VLV 7RWDO 51$ ZDV LVRODWHG IURP VWUDLQ FDUU\LQJ WKH SODVPLG WKDW KDV WKH n FRGLQJ UHJLRQ GHOHWHG SJ RI WRWDO ZDV VHSDUDWHG DV GHVFULEHG LQ )LJXUH 7KH PHPEUDQH ZDV K\EULGL]HG VLPXOWDQHRXVO\ ZLWK &,7 DQG ODF= JHQH SUREHV 7KH f RU f VLJQ LQGLFDWH ZKHWKHU WKH FXOWXUH ZDV PDLQWDLQHG LQ <3( f RU DGMXVWHG WR PDNH LW <3' bf f &f 6HPLORJ SORW RI b P51$ UHPDLQLQJ DV D IXQFWLRQ RI WLPH

PAGE 142

$ &,7 /DF= % <3' 7LPH PLQf R P R R R R R R R &,7 /DF= FP

PAGE 143

IXOO OHQJWK &,7 P51$ LQ WKLV VWUDLQ GLG QRW FKDQJH )LJXUH E ORZHU EDQGf VXJJHVWLQJ WKDW WKH JOXFRVH UHVSRQVH HOHPHQW OLHV ZLWKLQ WKH ILUVW FRGRQV RI WKH n WHUPLQL 6HTXHQFHV :LWKLQ WKH n 7HUPLQXV RI &,7 P51$ &RQIHU 1RQVHQVH0HGLDWHG 'HFD\ 1RQVHQVHPHGLDWHG GHFD\ LQ \HDVW DQG SRVVLEO\ RWKHU RUJDQLVPV LV D PHFKDQLVP XVHG WR UDSLGO\ GHJUDGH P51$ WKDW FDUULHV SUHPDWXUH VWRS FRGRQV /HHGV HW DO /HHGV HW DO f ,W LV XVHG WR HOLPLQDWH P51$V WKDW DUH LQFDSDEOH RI SURGXFLQJ PDWXUH DQG IXQFWLRQDO SURWHLQ \HW FRXOG XVH WKH WUDQVODWLRQDO DSSDUDWXV 7KLV FRXOG RYHUORDG WKH FHOOXODU WUDQVODWLRQDO DSSDUDWXV ZLWK XVHOHVV SURWHLQV ZKLFK PD\ EH GHWULPHQWDO WR WKH FHOO $ VHFRQG K\SRWKHVLV IRUZDUGHG E\ 3HOW] HW DO f LV WKDW WKH QRQVHQVHPHGLDWHG GHFD\ SDWKZD\ FRQWUROV WKH DEXQGDQFH RI LQWURQFRQWDLQLQJ SUHP51$ WKDW HQWHUV WKH F\WRSODVP 6LQFH PRVW LQWURQV GR QRW FRQWDLQ ORQJ RSHQ UHDGLQJ IUDPHV WKDW FRGH IRU SURWHLQV WKHLU SUHVHQFH LQ WKH F\WRSODVP FRXOG DOVR LQWHUIHUH ZLWK WKH WUDQVODWLRQDO PDFKLQHU\ $ VWRS FRGRQ ZDV LQWURGXFHG DW WKH ILIWK FRGRQ E\ FKDQJLQJ D 7 WR ZKLFK FRQYHUWHG WKH 88$ FRGRQ WR 8*$ 51$ ZDV LVRODWHG IURP WKH VWUDLQ FDUU\LQJ WKH PXWDQW SODVPLG DQG K\EULGL]HG ZLWK &,7 DQG ODF= JHQHV 7KH KDOIOLIH RI WKH IXVLRQ P51$ FRQWDLQLQJ WKH VWRS FRGRQ ZDV GUDVWLFDOO\ UHGXFHG LQ ERWK WKH <3( PHGLXP DQG LQ WKH FXOWXUH DGMXVWHG WR b JOXFRVH )LJXUH f $JDLQ WKH IXOO OHQJWK &,7 P51$ ZDV QRW DIIHFWHG EHFDXVH LW GLG QRW FRQWDLQ DQ\ VHTXHQFH

PAGE 144

)LJXUH +DOIOLIH RI &,7ODF= IXVLRQ P51$ LQ ZKLFK D 8$$ VWRS FRGRQ KDV EHHQ LQWURGXFHG DW WKH WK DPLQR DFLG SRVLWLRQ $f 6FKHPDWLF UHSUHVHQWDWLRQ RI WKH &,7ODF= IXVLRQ 7KH &,7 VHTXHQFH LV ILOOHG ZLWK KDWFK PDUNV 7KH ODF= VHTXHQFH LV FRPSOHWHO\ ILOOHG %f $XWRUDGLRJUDP RI 1RUWKHUQ JHO DQDO\VLV 7RWDO 51$ ZDV LVRODWHG IURP D VWUDLQ FDUU\LQJ WKH SODVPLG WKDW KDV WKH VWRS FRGRQ SJ RI WRWDO ZDV VHSDUDWHG DV GHVFULEHG LQ )LJXUH 7KH PHPEUDQH DQG ZDV K\EULGL]HG VLPXOWDQHRXVO\ ZLWK &,7 DQG ODF= JHQH SUREHV 7KH f RU f VLJQV LQGLFDWH ZKHWKHU WKH FXOWXUH ZDV PDLQWDLQHG LQ <3( f RU DGMXVWHG WR PDNH LW <3' bf f &f 6HPLORJ SORW RI b P51$ UHPDLQLQJ DV D IXQFWLRQ RI WLPH

PAGE 145

&,7 /DF= % <3' 7LPH PLQf &,7/DF= FP R R R R R R 2 R R LQ 7f§ &0 &2 2 /2 Wf§ &0 &2 & &' & F nFR ( 4! ] FU ( 7,0( 0,1f

PAGE 146

PRGLILFDWLRQ 7KLV VKRZV WKDW WKH QRQVHQVHPHGLDWHG GHFD\ SDWKZD\ LV LQGHSHQGHQW RI WKH JURZWK PHGLXP FRQFOXGH WKDW WKH WXUQRYHU RI WKH IXVLRQ P51$ LV VXEMHFW WR QRQVHQVHPHGLDWHG GHFD\ ZKLFK LV VLPLODU WR RWKHU QRUPDO \HDVW P51$V

PAGE 147

6800$5< $1' ',6&866,21 7KH RULJLQDO JRDO RI WKLV SURMHFW ZDV WR XQGHUVWDQG WKH WUDQVFULSWLRQDO UHJXODWLRQ RI WKH &,7 JHQH WR LGHQWLI\ WKH FLV DQG WUDQV HOHPHQWV WKDW FRQIHU ERWK EDVDO OHYHOV RI WUDQVFULSWLRQ DQG FDUERQVRXUFH UHJXODWLRQ KDYH LGHQWLILHG UHJLRQV ZLWKLQ WKH n QRQFRGLQJ UHJLRQ RI WKH &,7 JHQH WKDW DFWLYDWH WUDQVFULSWLRQ LQ D PDQQHU WKDW GRHV QRW GHSHQG RQ WKH FDUERQ VRXUFH KDYH SURYLGHG HYLGHQFH IRU DQ XSVWUHDP UHSUHVVLQJ VHTXHQFH ORFDWHG WRZDUGV WKH SUR[LPDO HQG RI WKH n QRQFRGLQJ UHJLRQ WKDW UHGXFHG WKH DFWLYLW\ RI D KHWHURORJRXV JHQH RQO\ LQ D JOXFRVH PHGLXP 7KHUH PD\ DOVR EH DQRWKHU UHSUHVVLQJ HOHPHQW WKDW OLHV DW WKH GLVWDO f HQG RI WKH SURPRWHU UHJLRQ :KLOH n PDWXUHHQGV ZHUH GHWHFWHG DW QLQH VLWHV FORVHO\ VSDFHG WKHUH ZDV RQH PDMRU VLWH WZR PRGHUDWH VLWHV DQG VHYHUDO ORZ DEXQGDQFH VLWHV WKDW VXUURXQG WKH WZR PRGHUDWH VLWHV +RZHYHU LQLWLDWLRQ VLWHV GLG QRW DSSHDU WR GLIIHU LQ FHOOV JURZQ LQ GLIIHUHQW FDUERQ VRXUFHV 1RUWKHUQ DQDO\VLV RI WKH &,7 P51$ ZDV XVHG WR VKRZ WKDW WKHUH ZDV D GLIIHUHQFH LQ WKH GHFD\ UDWH EHWZHHQ P51$ LVRODWHG IURP JOXFRVHJURZQ FHOOV DQG HWKDQROJURZQ FHOOV 'HFD\ RI WKH PHVVDJH ZDV IXUWKHU DFFHOHUDWHG LI WKH FHOOV ZHUH LQLWLDOO\ JURZQ LQ DQ HWKDQRO PHGLXP DQG WKHQ DGMXVWHG WR b JOXFRVH 7KH UDSLG GHFD\ GHWHUPLQDQW LQ UHVSRQVH WR JOXFRVH ZKLFK QDPHG JOXFRVH GHSHQGHQW LQVWDELOLW\ HOHPHQW *',(f ZDV ORFDWHG LQ WKH ILUVW ES SURWHLQ

PAGE 148

FRGLQJ UHJLRQ RI WKH &,7 JHQH 7KLV VHTXHQFH FRQIHUUHG DQ LGHQWLFDO GHFD\ SDWWHUQ WR WKH ( FROL ODF= JHQH LQ D &,7ODF= IXVLRQ 7KH LGHQWLFDO GHFD\ SDWWHUQ RI ERWK IXOO OHQJWK &,7 P51$ DQG WKH &,7ODF= IXVLRQ P51$ VXJJHVWHG WKDW GHFD\ RI &,7 P51$ PD\ QRW UHTXLUH LQLWLDO SRO\$f VKRUWHQLQJ DV WKH ILUVW VWHS LQ WKH GHFD\ SDWKZD\ RI WKH HQWLUH PHVVDJH DV KDV EHHQ GHPRQVWUDWHG IRU VHYHUDO \HDVW JHQHV +HDWRQ HW DO 'HFNHU DQG 3DUNHU f ,QLWLDO SRO\$f VKRUWHQLQJ UHTXLUHV 51$ VHTXHQFHV QHDU WKH n RI WKH PHVVDJH KRZHYHU LQ WKLV IXVLRQ WKH n HQG FRQVLVWV RI RQO\ ODF= P51$ ZKLFK GRHV QRW KDYH WKH \HDVW UHFRJQLWLRQ VHTXHQFH WR PHGLDWH VXFK DQ HIIHFW ,QWURGXFWLRQ RI D SUHPDWXUH WUDQVODWLRQDO WHUPLQDWLRQ VLJQDO 8*$f ZLWKLQ WKH ILUVW IHZ FRGRQV RI WKH &,7 JHQH FDXVHG UDSLG GHFD\ LQ ERWK HWKDQRO DQG JOXFRVH FXOWXUHV VXJJHVWLQJ WKDW WKH &,7 VHTXHQFHV SUHVHQW LQ WKH IXVLRQ JHQH KDYH WKH VLJQDO QHFHVVDU\ DQG VXIILFLHQW WR FDXVH QRQVHQVHPHGLDWHG GHFD\ DV ZHOO 1RQVHQVHPHGLDWHG GHFD\ LQYROYHV UDSLG GHFD\ RI D P51$ ZLWK DQ HDUO\ VWRS FRGRQ ,W KDV EHHQ VKRZQ IRU WKH 3*. JHQH ZKLFK HQFRGHV SKRVSKRJ\OFHUDWH NLQDVH WKDW WKH UDWH RI GHFD\ PD\ EH DFFHOHUDWHG IROG XSRQ LQWURGXFWLRQ RI D VWRS FRGRQ ZLWKLQ WKH ILUVW b RI WKH SURWHLQ FRGLQJ UHJLRQ 3HOW] HW DO f +RZHYHU WKH UDSLG GHFD\ ZDV UHOLHYHG ZKHQ WKLV PXWDQW JHQH ZDV LQWURGXFHG LQWR D VWUDLQ FDUU\LQJ WKH XSI PXWDWLRQ 3HOW] HW DO f 7KH 83) JHQH LV D WUDQVDFWLQJ IDFWRU WKDW KDV EHHQ VKRZQ WR EH UHTXLUHG IRU UDSLG GHFD\ /HHGV HW DO /HHGV HW DO f ,Q DGGLWLRQ WR EHLQJ LQYROYHG LQ WKH UDSLG GHJUDGDWLRQ RI P51$ ZLWK D SUHPDWXUH WHUPLQDWLRQ VLJQDO QRQVHQVHPHGLDWHG

PAGE 149

GHFD\ KDV EHHQ SURSRVHG WR FOHDU DFFXPXODWHG LQWURQ FRQWDLQLQJ SUHP51$ IURP WKH F\WRSODVP &VDFWLQJ (OHPHQWV 'HOHWLRQ RI n WKH QRQFRGLQJ UHJLRQ RI WKH &,7 JHQH ZDV SHUIRUPHG WR GHWHUPLQH ZKDW VHTXHQFHV DUH QHFHVVDU\ IRU WKH UHJXODWLRQ RI WKLV JHQH LQ HLWKHU JOXFRVH RU HWKDQRO 7KHVH VWXGLHV ZHUH FDUULHG RXW RQ D IXVLRQ JHQH FRQVWUXFW RI &,7 DQG WKH ( FROL ODF= JHQHV ZKLOH OHDYLQJ WKH FKURPRVRPDO &,7 JHQH LQWDFW JDODFWRVLGDVH DVVD\V ZHUH XVHG WR PRQLWRU WKH HIIHFW RI WKH GHOHWLRQV 'HOHWLRQV FDUULHG RXW RQ WKH VWDUWLQJ IXVLRQ JHQH KDG DSSUR[LPDWHO\ ES RI &,7 QRQFRGLQJ VHTXHQFHV 7KLV ZDV FKRVHQ DV WKH VWDUWLQJ &,7 '1$ EHFDXVH LQ \HDVW DOO LPSRUWDQW UHJXODWRU\ HOHPHQWV XVXDOO\ OLH ZLWKLQ NE RI WKH WUDQVODWLRQDO VWDUW VLWH 7KH FKRLFH RI WKLV UHJLRQ ZDV VXEVHTXHQWO\ MXVWLILHG ZKHQ LW ZDV VKRZQ WKDW WKH UHODWLYH UDWLR RI LQGXFWLRQ RI 3JDODFWRVLGDVH OHYHO EHWZHHQ HWKDQRO DQG JOXFRVH ZDV VLPLODU WR FKURPRVRPDO FLWUDWH V\QWKDVH LQGXFWLRQ LQ WKLV SDUWLFXODU \HDVW VWUDLQ 5LFNH\ f &RQVWUXFW S D GHOHWLRQ HQGLQJ DW ZLWK UHVSHFW WR WKH WUDQVFULSWLRQDO VWDUW VLWH ZDV WDNHQ DV WKH ZLOGW\SH UHIHUHQFH EHFDXVH LW ZDV WKH PLQLPXP GHOHWLRQ WKDW KDG DFWLYLW\ VLPLODU WR WKH IXOO OHQJWK FORQH 'HOHWLRQ RI DQ DGGLWLRQDO ES FORQH S UHGXFHG VSHFLILF DFWLYLW\ VOLJKWO\ LQ DQ HWKDQRO PHGLXP DQG WR QHDUO\ b RI ZLOGW\SH OHYHO LQ D JOXFRVH PHGLXP )LJXUH f )LJXUH LV WKH FRPSRVLWH UHVXOW RI WKH n n DQG LQWHUQDO GHOHWLRQV UHVXOWV

PAGE 150

)LJXUH &RPSRVLWH 6XPPDU\ 5HVXOW RI &,7 8SVWUHDP 6HTXHQFHV 7KH WRS OLQH UHSUHVHQWV D VFKHPDWLF RI WKH &,7 n QRQFRGLQJ UHJLRQ IURP ZKLFK DOO n DQG n GHOHWLRQ FORQHV ZHUH GHULYHG 7KH LQWHUQDO GHOHWLRQ FORQHV ZHUH GHULYHG IURP FORQH S WKH ZLOGW\SH GHVLJQDWH 7KH QXPEHUV RQ WKH OLQHV LQGLFDWH WKH GHOHWLRQ HQGSRLQW RI HDFK FORQH DQG WKH QXPEHUV WR WKH ULJKW UHSUHVHQWV WKH DYHUDJH RI DW OHDVW WKUHH WR IRXU LQGHSHQGHQW JDODFWRVLGDVH DVVD\V REWDLQHG IURP HDFK FORQH 7KH UHVXOW RI WKH DVVD\V GLG QRW GLIIHU IURP WKH DYHUDJH E\ PRUH WKDQ b

PAGE 151

$ -O L _ , e ZZ A A , ZZ , I , , a , , , , , , , 6SHFLILF $FWLYLW\ <3' <3( <3(<3'

PAGE 152

REWDLQHG ZKHQ WKH \HDVW FHOOV ZHUH JURZQ LQ FRPSOH[ PHGLXP 1R GHOHWLRQ HQGLQJ EHWZHHQ DQG VWDUWLQJ IURP WKH GLVWDO HQG ZDV REWDLQHG XVLQJ %DO H[RQXFOHDVH 7KLV PD\ EH SDUWO\ GXH WR WKH IDFW WKDW WKH VHTXHQFH ZLWKLQ WKLV UHJLRQ LV YHU\ ULFK LQ DGHQRVLQH DQG WK\PLGLQH 7KH SUHVHQFH RI D KLJK IUDFWLRQ RI $7 EDVH SDLUV LQ WKLV UHJLRQ PD\ FDXVH EUHDWKLQJ LQ WKLV UHJLRQ WKDW FRXOG HQKDQFH WKH UDWH RI GLJHVWLRQ E\ %DO +RZHYHU LW ZRXOG EH LQWHUHVWLQJ WR JHQHUDWH QHZ FORQHV WKDW ZRXOG GHOHWH WKLV UHJLRQ XVLQJ D PHWKRG OLNH LQYHUVH 3&5 EHFDXVH WKHVH VHTXHQFHV PD\ FRQWDLQ VRPH UHJXODWRU\ HOHPHQWV VHH GLVFXVVLRQ EHORZf 7KH QH[W GHOHWLRQ DQDO\]HG ZDV S ,Q WKLV FORQH WKHUH ZDV D QHDUO\ b GHFUHDVH LQ JDODFWRVLGDVH DFWLYLW\ LQ D <3' PHGLXP EXW LW UHWDLQHG DERXW b RI ZLOGW\SH 3JDODFWRVLGDVH DFWLYLW\ LQ D <3( PHGLXP 7KHVH UHVXOWV VXJJHVW WKDW VHTXHQFHV EHWZHHQ DQG PD\ EH LPSRUWDQW LQ JOXFRVH UHJXODWLRQ )XUWKHU GHOHWLRQ WR SRVLWLRQ UHGXFHG 3JDODFWRVLGDVH DFWLYLW\ LQ ERWK <3' DQG <3( E\ DSSUR[LPDWHO\ b RI WKH ZLOGW\SH OHYHO 2YHUDOO WKH JUDGXDO UHGXFWLRQ LQ 3JDODFWRVLGDVH OHYHO LQ DQ HWKDQRO PHGLXP ZLWK VXFFHVVLYH UHPRYDO RI '1$ VHTXHQFH VXJJHVWV VHYHUDO SRVLWLYH DFWLQJ HOHPHQWV WKDW FRQWULEXWH WR PD[LPDO WUDQVFULSWLRQ +RZHYHU WKLV FRQWUDVWV ZLWK WKH UHVXOW WKDW HQ]\PH OHYHOV LQFUHDVHG LQ JOXFRVH PHGLXP ZKHQ VHTXHQFHV EHWZHHQ DQG ZHUH GHOHWHG ,QFUHDVHG H[SUHVVLRQ LQ D JOXFRVH PHGLXP XSRQ GHOHWLRQ RI WKLV UHJLRQ PD\ EH GXH WR UHPRYDO RI D UHSUHVVLQJ HOHPHQW WKDW LV VSHFLILF WR WKH JOXFRVH PHGLXP ,Q D UHSRUW E\ 5RVHQNUDQW] DQG FRZRUNHUV 5RVHQNUDQW] HW DO f DOVR VWXG\LQJ WKH SURPRWHU RI &,7 DFWLYLW\ ZDV ORVW LQ DOO n GHOHWLRQV WKDW

PAGE 153

H[WHQGHG EH\RQG LQ RXU QXPEHULQJf 7KH\ QXPEHUHG WKHLU GHOHWLRQ FRQVWUXFWV E\ XVLQJ WKH DGHQRVLQH UHVLGXH RI WKH ILUVW FRGRQ $8*f DV f 6WUDLQ GLIIHUHQFHV ZKLFK KDYH EHHQ NQRZQ WR FDXVH GLVSDULW\ HYHQ LQ FLWUDWH V\QWKDVH OHYHOV PD\ EH RQH SRVVLEOH H[SODQDWLRQ IRU WKH GLIIHUHQFHV LQ RXU UHVXOWV $QRWKHU H[SODQDWLRQ IRU WKH GLIIHUHQFHV LQ WKH WZR VHWV RI UHVXOWV PD\ OLH LQ WKH YHFWRUV XVHG WR SHUIRUP WKH H[SHULPHQWV 5RVHQNUDQW] HW DO f XVHG D PXOWLFRS\ Sf SODVPLG DQG VXFK SODVPLGV DUH ORVW DW KLJK UDWH LQ QRQVHOHFWLYH PHGLD VXFK DV <3' RU <3( ,I WKDW LQWHUSUHWDWLRQ LV FRUUHFW WKH ORZHU UHODWLYH H[SUHVVLRQ RI WKH ODUJHU GHOHWLRQV PD\ KDYH EHHQ PLVVHG LQ WKHLU DVVD\V ,Q DGGLWLRQ KLJK FRS\ SODVPLGV PD\ FDXVH '1$ ELQGLQJ VLWHV WR H[FHHG DYDLODEOH WUDQVFULSWLRQ IDFWRUV LI WKHVH DUH OLPLWLQJ 3UR[LPDO nf GHOHWLRQV WKDW H[WHQGHG DZD\ IURP WKH WUDQVFULSWLRQDO VWDUW VLWH SURGXFHG VSHFLILF DFWLYLWLHV WKDW UDQJH IURP b RI ZLOGW\SH OHYHO LQ DQ HWKDQROJURZQ FXOWXUH WR JUHDWHU WKDQ WZRIROG LQ D JOXFRVHJURZQ FXOWXUH )LJXUH DQG )LJXUH f ,Q WKH S FORQH GHOHWHG IURP WR f WKH VSHFLILF DFWLYLWLHV H[SUHVVHG LQ ERWK JOXFRVH DQG HWKDQRO PHGLD ZHUH WLPHV DQG WLPHV KLJKHU UHVSHFWLYHO\ WKDQ WKH ZLOG W\SH FRQVWUXFW )LJXUH f 5RVHQNUDQW] DQG FROOHDJXHV 5RVHQNUDQW] HW DO f IRXQG VLPLODU UHVXOWV ZKHQ WKH\ GHOHWHG VHTXHQFHV EHWZHHQ DQG 7KLV LQFUHDVH PD\ EH GXH WR UHPRYDO RI D 856 HOHPHQW 7R WHVW WKLV SRVVLELOLW\ VXEFORQHG WKLV UHJLRQ RI &,7 '1$ LQWR DQ XSVWUHDP VLWH RI D &<&ODF= IXVLRQ 7KLV VHTXHQFH ZDV LQVHUWHG EHWZHHQ WKH 7$7$ VLWH DQG WKH WZR 8$6V 8$6 DQG 8$6 RI &<& JHQH 7KH VSHFLILF DFWLYLW\ RI WKLV FORQH <,6/; ZDV UHGXFHG DERXW RQH

PAGE 154

KDOI ZKHQ FHOOV ZHUH JURZQ LQ D <3' PHGLXP )LJXUH f LQGHSHQGHQW RI ZKHWKHU WKH\ ZHUH JURZQ WR ORJDULWKPLF SKDVH UHSUHVVHGf RU VWDWLRQDU\ SKDVH GHUHSUHVVHGf ,Q FRQWUDVW b RI WKH DFWLYLW\ ZDV VWLOO UHWDLQHG ZKHQ D <,6/; FDUU\LQJ VWUDLQ ZDV JURZQ LQ D FRPSOH[ PHGLXP ZLWK HWKDQRO GHUHSUHVVHGf 7KLV VXJJHVWV WKDW WKH 856 DFWLYLW\ RI WKLV UHJLRQ IXQFWLRQV RQO\ LQ D JOXFRVHFRQWDLQLQJ PHGLXP 7KLV ILQGLQJ LV LQ DJUHHPHQW ZLWK WKH S FORQH ZKLFK VKRZHG D KLJKHU OHYHO RI LQFUHDVH RI JDODFWRVLGDVH DFWLYLW\ LQ D <3' PHGLXP WKDQ LQ D <3( PHGLXP DERYH WKH ZLOGW\SH OHYHO )RU FORQHV S DQG S WKHUH ZDV QR VLJQLILFDQW FKDQJH LQ HQ]\PH DFWLYLW\ EHWZHHQ <3' DQG <3( PHGLD )LJXUH f +RZHYHU LQ FORQH S GHOHWHG IURP WR f WKHUH ZDV D b UHGXFWLRQ LQ HQ]\PH DFWLYLW\ LQ D <3( PHGLXP FRPSDUHG WR WKH ZLOGW\SH OHYHO $ VLPLODU OHYHO RI UHGXFWLRQ ZDV DOVR VKRZQ IRU FORQH S LQ WKH <3( PHGLXP ,Q ERWK FORQHV VHTXHQFHV EHWZHHQ DQG ZHUH UHPRYHG 7KLV VXJJHVWV WKDW WKLV UHJLRQ PD\ SOD\ D VLJQLILFDQW UROH LQ GHUHSUHVVLRQ RI &,7 JHQH DQG D SRVVLEOH FDQGLGDWH LV WKH FRQVHQVXV ELQGLQJ VLWH IRU WKH +DSS+DSS+DSS KHWHURPHULF DFWLYDWRU DW SRVLWLRQ WR RI &,7 7KH UROH RI WKHVH SURWHLQV LQ SRVVLEOH UHJXODWLRQ LV GLVFXVVHG EHORZ &ORQH S GHOHWHG IURP WR f UHWDLQHG RQO\ DERXW b RI WKH HQ]\PH DFWLYLW\ LQ <3' DQG <3( PHGLD )LJXUH f ZKLFK VXJJHVWHG WKDW D SRWHQWLDO DFWLYDWRU VLWH KDG EHHQ UHPRYHG )XUWKHU GHOHWLRQ WR SRVLWLRQ FORQH S SURGXFHG EDUHO\ GHWHFWDEOH SJDODFWRVLGDVH DFWLYLW\ LQ <3' DQG RQO\ b RI ZLOGW\SH OHYHO LQ <3( )LJXUH f 7KLV PD\ PHDQ WKDW DOO SRWHQWLDO SRVLWLYH UHJXODWRU\ VLWHV KDG EHHQ GHOHWHG RU QHJDWLYH UHJXODWRU\ HOHPHQWV

PAGE 155

SUHYLRXVO\ ORFDWHG IXUWKHU XSVWUHDP KDG QRZ EHHQ EURXJKW FORVHU WR WKH WUDQVFULSWLRQDO VWDUW VLWH 0RUH FOXHV DERXW WKH SRWHQWLDO UROH RI WKLV UHJLRQ EHFRPH DSSDUHQW RQ H[DPLQDWLRQ RI WKH LQWHUQDO GHOHWLRQ FRQVWUXFWV GLVFXVVHG EHORZ 7KH FRPSRVLWH UHVXOWV RI WKH n DQG n GHOHWLRQV UHYHDOHG WKUHH PDLQ UHJLRQV WKDW GHFUHDVHG H[SUHVVLRQ RI WKH IXVLRQ JHQH ZKHQ GHOHWHG VHH )LJXUH f 5HJLRQ LV FHQWHUHG DURXQG WKH SXWDWLYH +DSS+DSS+DSS ELQGLQJ VLWH EHWZHHQ DQG )LJXUH f UHJLRQ ,, VWUHWFKHV IURP WR DQG GRHV QRW FRQWDLQ DQ\ VHTXHQFH PRWLI IRU NQRZQ WUDQVFULSWLRQDO UHJXODWRUV DQG UHJLRQ ,,, UDQJHV IURP WR 5HJLRQ ,,, KDV FRQVHQVXV ELQGLQJ VLWHV IRU *&1 DQG $'5 WUDQVFULSWLRQDO DFWLYDWRUV IRU DPLQR DFLG ELRV\QWKHVLV +RSH DQG 6WUXKO f DQG HWKDQRO XWLOL]DWLRQ 'HQLV HW DO 'HQLV HW DO f UHVSHFWLYHO\ (DFK RI WKH WKUHH UHJLRQV ZHUH LQGLYLGXDOO\ GHOHWHG DQG SURGXFHG VRPHZKDW VXUSULVLQJ UHVXOWV ZKHQ DVVD\HG IRU UHPDLQLQJ 8$6 DFWLYLW\ 5HPRYDO RI UHJLRQV DQG ,, HDFK FDXVHG HTXLYDOHQW HIIHFWV RQHWKLUG UHGXFWLRQ LQ HQ]\PH OHYHOV FRPSDUHG WR WKH ZLOGW\SH LQ D <3( PHGLXP )LJXUH f +RZHYHU UHPRYDO RI UHJLRQ ,,, SURGXFHG DFWLYLW\ WKDW ZDV VLPLODU WR FORQH S GHOHWHG IURP WR f D UHGXFWLRQ RI 3JDODFWRVLGDVH DFWLYLW\ WR EHORZ b RI WKH ZLOGW\SH OHYHO 5HPRYDO RI WKHVH VHTXHQFHV LQ DGGLWLRQ WR WKH RQHV SUHFHGLQJ LW WR GLG QRW FDXVH VXFK VHYHUH UHGXFWLRQ LQ VSHFLILF DFWLYLW\ &RPSDUH WKH UHVXOWV RI FORQH S XQLWVPJ SURWHLQf WR S$ XQLWVPJ SURWHLQf 7DNHQ WRJHWKHU WKHVH UHVXOWV VXJJHVW WKDW VHTXHQFHV EHWZHHQ DQG PD\ KDYH D VWURQJ UHSUHVVLQJ HIIHFW $ IRXUWK LQWHUQDO GHOHWLRQ

PAGE 156

)LJXUH '1$ 6HTXHQFH RI &,7 7KH '1$ VHTXHQFH FRQVLVWV RI WKH FRGLQJ UHJLRQ RI &,7 IURP SRVLWLRQ WR 7KH VHTXHQFH LV QXPEHUHG E\ DVVLJQLQJ SRVLWLRQ WR WKH QXFOHRWLGH GHVLJQDWHG WR EH WKH PDWXUH n HQG RI WKH PDMRU WUDQVFULSW 7KH EROG SULQW UHSUHVHQWV WKH ILUVW FRGRQ 7KH SXWDWLYH ELQGLQJ VLWHV IRU +$3 DQG *&1 DUH PDUNHG E\ VKRZLQJ WKH FRQVHQVXV VHTXHQFH IRU HDFK RI WKHP DERYH WKH SUHGLFWHG ORFDWLRQ RI WKH &,7 VHTXHQFH 7KH ORZHU FDVH LQ WKH &,7 VHTXHQFH ZLWKLQ WKH FRQVHQVXV VLWH LQGLFDWHV D PLVPDWFK WR WKH NQRZQ VHTXHQFH IRU WKDW DFWLYDWRU 7KH SXWDWLYH 7$7$ ER[ LV ER[HG

PAGE 157

*$$7 7 & & & *$7 & &$7 &$$$$$7 &&$77&$7 &$7 7$$& 7$$$$$& *&***7$*$*$77$& 7$&$7$77&&$$&$$*$&&77&*&$**$$$*7$7$&&7$$$&7$$77$$$*$$$7&7&&* 7&*7&$ $$*77&*F&$7777&$77*$$&**&7&$$77$$7&777*7$$$7$7*$*&*77777$&*7 *&1 *$*7&$ 7&$&$77*&&777777777$7*7$777$&&77*&$77777*7*&7$$$$**F*7&$&*77 *&1 77777&&*&&*&$*&&*&&&**$$$7*$$$$*7$7*$&&&&&*&7$*$&&$$$$$$7$&7 71$77**$ 777*7*77$77**$**$7&*&$$7&&&777**$*&7777&&*$7$&7$7&*$&77$7&&* +$3 DFFWFWWJWWWJDDDDWJWFDDWWJDWDWFFDWFFDW^WDWDWDDW-WJFWFDDDDFWWJFD *&$$&7$77&777$&&&77&&&&7*77$7**$77*&$7*7&77$$*****$$$777*&7* 777$&7$$$$7$&$$$&&$**777*7777**&7777$777*&$777$$*7$$77$&$$77 $&$$& &$7 7$$$$$*$$$$7$$* &$$$$&$7$7$* &$$7$7$$7$& 7$7 7 7$& *$$*$ $7*

PAGE 158

FRQVWUXFW WKDW HQFRPSDVVHG DOO SUHYLRXV RQHV UHGXFHG VSHFLILF DFWLYLW\ WR RQO\ DERXW b RI ZLOG W\SH OHYHO LQ ERWK PHGLD )LJXUH f 7R GHWHUPLQH WKH IXQFWLRQ RI HDFK RI WKHVH UHJLRQV WKH\ ZHUH LQGLYLGXDOO\ VXEFORQHG LQWR D KHWHURORJRXV JHQH ZLWKRXW LWV 8$6 7KH VHTXHQFHV EHWZHHQ DQG ZKHQ VXEFORQHG DV DQ ROLJRQXFOHRWLGH SURGXFHG D VSHFLILF DFWLYLW\ WKDW ZDV VLPLODU WR WKH ZLOG W\SH OHYHO LQ DQ HWKDQRO PHGLXP )LJXUH f 7KLV UHVXOW LQGLFDWHG WKDW WKLV UHJLRQ ZKHQ UHPRYHG IURP RWKHU SRWHQWLDO QHJDWLYH UHJXODWRU\ HOHPHQWV KDV D VWURQJ DFWLYDWLQJ HIIHFW 6XEFORQLQJ RI UHJLRQ ,, SURGXFHG D JDODFWRVLGDVH OHYHO WKDW ZDV DSSUR[LPDWHO\ b RI WKH IXOO OHQJWK VHTXHQFH LQ D VLPLODU YHFWRU ,Q VXPPDU\ Lf WKHUH DUH VHYHUDO DFWLYDWLRQ VLWHV XSVWUHDP RI WKH &,7 FRGLQJ UHJLRQ EHWZHHQ DQG DQG DQG DQG LLf WKHUH LV D 856 EHWZHHQ DQG WKDW VKRZV LWV JUHDWHVW HIIHFW LQ D JOXFRVH PHGLXP LLLf WKHUH LV DQRWKHU 856 EHWZHHQ DQG WKDW IXQFWLRQV LQ D FDUERQVRXUFH LQGHSHQGHQW PDQQHU DQG LYf WKHVH HOHPHQWV ZRUN LQ D FRPELQDWRULDO PDQQHU WR UHJXODWH WKH JHQH XQGHU GLIIHUHQW FRQGLWLRQV 1XWULHQW 5HTXLUHPHQW RQ WKH ([SUHVVLRQ RI &,7 *OXWDPDWH DX[RWURSK\ LV RQH RI WKH SKHQRW\SHV WKDW KDV EHHQ UHSRUWHG IRU FLW PXWDQWV .LVSDO HW DO .LP HW DO f .LP HW DO f UHSRUWHG WKDW WKH &,7 OHYHO ZDV UHSUHVVHG ZKHQ JOXWDPDWH ZDV DGGHG WR WKH JURZWK PHGLXP LQ D UHSUHVVLQJ PHGLXP EXW GRHV QRW KDYH DQ HIIHFW ZKHQ WKH FHOOV ZHUH JURZQ

PAGE 159

LQ D GHUHSUHVVLQJ PHGLXP 6LPLODU UHVXOWV KDYH EHHQ UHSRUWHG IRU DFRQLWDVH *DQJORII HW DO f D 7&$ F\FOH HQ]\PH WKDW FDWDO\]HV LVRPHUL]DWLRQ RI FLWUDWH WR LVRFLWUDWH DQG LV ORFDWHG LQ PLWRFKRQGULD $FRQLWDVH LV HQFRGHG E\ WKH $& JHQH ORFDWHG LQ WKH QXFOHXV 7LP 5LFNH\ 5LFNH\ f LQ RXU ODERUDWRU\ WHVWHG WR VHH LI D VLPLODU HIIHFW FRXOG EH VHHQ ZLWK WKH &,7ODF= IXVLRQ &RQWUDU\ WR WKH UHSRUW RI .LP HW DO f WKHUH ZDV QR JOXWDPDWH HIIHFW RQ WKH H[SUHVVLRQ RI WKLV IXVLRQ JHQH LQ RXU VWUDLQ +RZHYHU LW ZDV QRWLFHG WKDW WKH H[SUHVVLRQ RI DOO WKH GHOHWLRQ FRQVWUXFWV ZHUH KLJKHU LQ D PLQLPDO PHGLXP VXSSOHPHQWHG ZLWK KLJK bf RU ORZ bf JOXFRVH GDWD QRW VKRZQf ,W LV LQWHUHVWLQJ WR QRWH WKDW HYHQ LQ 6' b ZY JOXFRVHf PHGLXP ZKLFK FRQWDLQV WKH VDPH DPRXQW RI JOXFRVH WKDW ZDV DGGHG WR WKH VWDQGDUG <3' HDFK FRQVWUXFW H[KLELWHG KLJKHU VSHFLILF DFWLYLW\ WKDQ LQ WKH FRPSOH[ PHGLXP 7KHVH ILQGLQJV VXJJHVWHG WKDW LQ DGGLWLRQ WR FDUERQVRXUFH UHJXODWLRQ WKH &,7 JHQH LV DOVR UHJXODWHG E\ RWKHU QXWULWLRQDO UHTXLUHPHQWV 7KH RYHUDOO H[SUHVVLRQ SDWWHUQ RI WKH GLIIHUHQW GHOHWLRQ FRQVWUXFWV ZDV UHPDUNDEO\ VLPLODU WR ZKDW ZDV VHHQ ZLWK <3' DQG <3( PHGLD 7KH RQO\ VLJQLILFDQW GHYLDWLRQ IURP WKH H[SUHVVLRQ SDWWHUQ LQ D FRPSOH[ PHGLXP ZDV WKDW WKH KLJKHVW OHYHO RI H[SUHVVLRQ LQ 6' bf ZDV H[KLELWHG E\ WKH ZLOGW\SH FORQH Sf ZKHUHDV FORQH S H[KLELWHG WKH KLJKHVW OHYHO RI H[SUHVVLRQ LQ D FRPSOH[ PHGLXP )LJXUHV DQG f 7KH ODWWHU FRQVWUXFW GHOHWHV D SXWDWLYH 856 2QH K\SRWKHVLV IRU ZK\ WKH &,7 JHQH PD\ EH H[SUHVVHG DW D KLJKHU OHYHO LQ D PLQLPDO PHGLXP FRPSDUHG WR D FRPSOH[ PHGLXP UHODWHV WR WKH IDFW WKDW WKH 7&$ F\FOH SURYLGHV FDUERQ VNHOHWRQV IRU DPLQR DFLG ELRV\QWKHVLV ,Q D PLQLPDO PHGLXP WKHUH LV OLPLWLQJ DPRXQW RI

PAGE 160

QXWULHQWV VR WKDW ELRV\QWKHVLV RI LQWHUPHGLDWHV EHFRPHV LPSRUWDQW 7KH ORZ DYDLODELOLW\ RI DPLQR DFLGV VLJQDOV WKH FHOO WR V\QWKHVL]H WKHVH SUHFXUVRUV DQG FRXOG WULJJHU LQFUHDVHG &,7 H[SUHVVLRQ 7KLV VFHQDULR KLJKOLJKWV WKH SUHVHQFH RI WKH SXWDWLYH *&1 ELQGLQJ VLWH DV D SRWHQWLDO UHJXODWRU RI &,7 :H KDYH QRWHG D SRWHQWLDO SURWHFWLRQ RI WKH *FQS VLWH LQ YLYR )LJXUH f ([SHULPHQWV WR SXUVXH WKLV ILQGLQJ IXUWKHU VKRXOG LQFOXGH SUHSDULQJ D JFQ PXWDQW VWUDLQ SUHIHUDEO\ LVRJHQLF ZLWK WKDW XVHG LQ WKLV VWXG\ DQG WUDQVIRUPLQJ WKH YDULRXV GHOHWLRQ FRQVWUXFWV LQWR LW WR GHWHUPLQH WKH HIIHFWV RI WKLV UHJXODWRU RQ H[SUHVVLRQ RI WKH IXVLRQ DQG &,7 JHQHV $QRWKHU H[SHULPHQW WR EH SHUIRUPHG LQFOXGHV PXWDWLQJ WKH SXWDWLYH *&1 ELQGLQJ VLWHV RQ WKH &,7 XSVWUHDP VHTXHQFH DQG WUDQVIRUPLQJ WKH SODVPLG EHDULQJ WKH PXWDWLRQ LQWR \HDVW 7UDQVIRUPDQWV ZRXOG EH JURZQ LQ PLQLPDO PHGLXP DQG DVVD\HG IRU 3JDODFWRVLGDVH OHYHOV 5HGXFWLRQ RI 3JDODFWRVLGDVH OHYHOV HVSHFLDOO\ LQ PLQLPDO PHGLD LQ D VWUDLQ FDUU\LQJ WKH PXWDQW SODVPLG ZRXOG EH D VWURQJ LQGLFDWLRQ WKDW WKH VLWHV DUH LPSRUWDQW IRU UHJXODWLRQ SHUKDSV E\ ELQGLQJ WR WKH *FQS WUDQVFULSWLRQDO DFWLYDWRU +$3+$3+$3 ,QGHSHQGHQW ([SUHVVLRQ RI &,7 6HTXHQFH DQDO\VLV UHYHDOHG WKDW WKHUH ZDV D SHUIHFW PDWFK WR WKH FRQVHQVXV ELQGLQJ VLWH IRU WKH +DSS+DSS+DSS DFWLYDWRU FHQWHUHG EHWZHHQ DQG 7KLV DFWLYDWRU ZDV ILUVW UHSRUWHG WR EH LQYROYHG LQ WKH UHJXODWLRQ RI WKH &<& JHQH *XDUHQWH HW DO 3LQNKDP DQG *XDUHQWH 2OHVHQ HW DO 3LQNKDP HW DO )RUVEXUJ DQG *XDUHQWH f DW WKH 8$6 VLWH

PAGE 161

2WKHU JHQHV WKDW DOVR KDYH WKH FRQVHQVXV ELQGLQJ VLWH IRU WKHVH KHWHURPHULF SURWHLQ LQFOXGH &2;D 7UXHEORRG HW DO f DQG &2; 7UDZLFN HW DO 7UDZLFN HW DO f LQ WKH HOHFWURQ WUDQVSRUW FKDLQ DQG $& *DQJORII HW DO f /3' %RZPDQ HW DO 6LQFODLU HW DO f DQG .*' 5HSHWWR DQG 7]DJRORII f LQ WKH 7&$ F\FOH 7R DQDO\]H WKH UROH RI WKH +DSS+DSS+DSS KHWHURPHULF DFWLYDWRU LQ WKH UHJXODWLRQ RI &,7 GHOHWHG WKH UHJLRQ FRQWDLQLQJ WKH FRQVHQVXV ELQGLQJ VLWH LQ WKH IXVLRQ JHQH DQG GHWHUPLQHG WKH HIIHFW LW KDG RQ H[SUHVVLRQ RI WKH IXVLRQ JHQH ,Q WKLV GHOHWLRQ S$ WKH DFWLYLW\ ZDV UHGXFHG E\ WZRWKLUGV LQ <3( FRPSDUHG WR WKH ZLOGW\SH EXW GLG QRW VKRZ DQ\ UHGXFWLRQ LQ WKH <3' PHGLXP )LJXUH f VXJJHVWLQJ WKDW LW KDV DQ DFWLYDWLQJ IXQFWLRQ LQ &,7 H[SUHVVLRQ HVSHFLDOO\ XQGHU GHUHSUHVVLQJ FRQGLWLRQV 7KH OHYHO RI UHGXFWLRQ XSRQ PXWDWLRQ RI +DS SURWHLQV ELQGLQJ VLWHV DPRQJVW WKH YDULRXV DIIHFWHG JHQHV KDV EHHQ YDULDEOH 7KH\ UDQJH IURP JUHDWHU WKDQ WHQIROG UHGXFWLRQ &<&f *XDUHQWH DQG 0DVRQ f WR VOLJKWO\ EHORZ b RI ZLOGW\SH &2; 7UDZLFN HW DO f $QRWKHU PHDQV XVHG WR HYDOXDWH WKH HIIHFW RI +DSS+DSS+DSS ZDV WR WUDQVIRUP HLWKHU D ZLOGW\SH +$3 RU D KDS QXOO PXWDQW VWUDLQ ZLWK WKH HQWLUH &,7 8$6 DYDLODEOH LQ WKH S FORQH 7KHUH ZDV D VWURQJ RULHQWDWLRQGHSHQGHQW HIIHFW RQ WKH H[SUHVVLRQ RI DF= HVSHFLDOO\ XQGHU UHSUHVVLQJ FRQGLWLRQV 7KHUH ZDV DERXW D IRXUIROG UHGXFWLRQ LQ WKH VSHFLILF DFWLYLW\ H[SUHVVHG IURP WKH UHYHUVH RULHQWDWLRQ 8$6FUL LQ WKH KDS VWUDLQ FRPSDUHG WR WKH ZLOGW\SH )LJXUH f +RZHYHU LQ WKH IRUZDUG RULHQWDWLRQ WKHUH ZDV OHVV WKDQ D b UHGXFWLRQ LQ VSHFLILF DFWLYLW\ IURP WKH +$3 VWUDLQ WR WKH KDS VWUDLQ )LJXUH f :KHQ WKH

PAGE 162

FHOOV EHFRPH GHUHSUHVVHG DIWHU XWLOL]DWLRQ RI JOXFRVH WKH GLIIHUHQFH LQ LQGXFWLRQ OHYHO EHWZHHQ D ZLOGW\SH VWUDLQ DQG D KDS VWUDLQ ZDV RQO\ DERXW WZRIROG )LJXUH f ,W LV QRW FOHDU ZK\ WKHUH ZDV DQ RULHQWDWLRQ HIIHFW RI WKH 8$6 LQ WKH KDS PXWDQW ZKLFK LV XQOLNH PRVW RWKHU NQRZQ 8$6V WKDW KDYH EHHQ WHVWHG +RZHYHU 7UDZLFN HW DO f DOVR UHSRUWHG DQ RULHQWDWLRQ GHSHQGHQW HIIHFW RI KDS PXWDWLRQ RQ WKH &2; JHQH H[SUHVVLRQ 7KH UROH RI WKH +DSS+DSS+DSS FRPSOH[ LQ WKH UHJXODWLRQ RI JHQHV KDYLQJ WKH FRQVHQVXV ELQGLQJ VLWH H[FOXGLQJ &<& ZDV SXW LQWR TXHVWLRQ ZKHQ LW ZDV GHPRQVWUDWHG WKDW WKLV FRQVHQVXV VLWH ZLWKLQ WKH &2; JHQH FRXOG QRW ELQG WR SURWHLQ IURP \HDVW VWUDLQV GHSHQGHQW RQ WKHVH IDFWRUV 7KLV '1$ IUDJPHQW ZDV DOVR XQDEOH WR FRPSHWH DZD\ DQ\ RI WKH 8$6 EDQG VKLIWV 7KLV UHVXOW PD\ EH DQ DUWLIDFW RI WKH LQ YLWUR H[SHULPHQWDO FRQGLWLRQ RU PD\ SRLQW WR DQ LQGLUHFW UROH IRU WKH +DS SURWHLQV DW WKHVH VLWHV 7KH EHVW HYLGHQFH RI +DSS+DSS+DSS SURWHLQ UHJXODWLRQ RI DQ\ RQH RI WKHVH JHQHV ZRXOG EH D GHPRQVWUDWLRQ RI ELQGLQJ WR WKHLU FRJQDWH VLWHV LQ YLYR 8QIRUWXQDWHO\ QR RQH KDV \HW VKRZQ WKLV IRU DQ\ RI WKHVH JHQHV LQFOXGLQJ &,7 %DQGVKLIW DVVD\V DQG LQ YLWUR '1DVH SURWHFWLRQ DVVD\V ZHUH SHUIRUPHG WR VKRZ VSHFLILF SURWHLQ'1$ LQWHUDFWLRQ EHWZHHQ WKH XSVWUHDP VHTXHQFHV RI &,7 DQG SURWHLQV IURP D \HDVW H[WUDFW 7ZR '1$ IUDJPHQWV IURP WR VHJPHQW ,,f DQG WR VHJPHQW ,f ZHUH XVHG LQ EDQGVKLIW DQG '1DVH DVVD\V %DQGVKLIW DVVD\V ZLWK VHJPHQW VKRZHG D VLQJOH VKLIWHG EDQG DW ORZ SURWHLQ FRQFHQWUDWLRQ KRZHYHU DW KLJK SURWHLQ FRQFHQWUDWLRQ D VHFRQG IDVWHU PLJUDWLQJ EDQG ZDV VHHQ )LJXUH f 7KH DSSHDUDQFH RI WKLV VHFRQG EDQG DW

PAGE 163

KLJK SURWHLQ FRQFHQWUDWLRQ PD\ PHDQ WKDW WKLV ELQGLQJ PD\ EH GXH WR HLWKHU D ORZ DEXQGDQFH SURWHLQ ZKLFK ZDV OLPLWHG DW WKH ORZHU FRQFHQWUDWLRQ RU D ORZ DIILQLW\ SURWHLQ UHTXLULQJ KLJK SURWHLQ FRQFHQWUDWLRQ WR GHWHFW ELQGLQJ %DQGVKLIW FRPSHWLWLRQ DVVD\V DQG LQ YLWUR '1DVH SURWHFWLRQ DVVD\V ZHUH XQVXFFHVVIXO LQ LGHQWLI\LQJ WKH ELQGLQJ VLWHV PRUH DFFXUDWHO\ LQ VHJPHQW 6HJPHQW ,, SURGXFHG RQH FRQVLVWHQW EDQG XSRQ DGGLWLRQ RI \HDVW H[WUDFW )LJXUH f 7KLV LQWHUDFWLRQ ZDV VXFFHVVIXOO\ FRPSHWHG DZD\ XVLQJ DQ XQODEHOHG IUDJPHQW RI WKH VDPH '1$ ZKHUHDV UHJLRQ FRXOG QRW FRPSHWH DZD\ WKLV LQWHUDFWLRQ HYHQ DW IROG H[FHVV RI XQODEHOHG FRPSHWLWRU $ ES GRXEOH VWUDQGHG ROLJRQXFOHRWLGH WKDW VSDQV WR DOVR FRPSHWHG DZD\ WKH VKLIWHG SUREH EXW DW D KLJKHU PRODU UDWLR WKDQ WKH HQWLUH UHJLRQ ,, )LJXUH f $QRWKHU ES GRXEOHVWUDQGHG ROLJRQXFOHRWLGH IURP D GLVWLQFW DUHD RI WKH XSVWUHDP VHTXHQFH ZDV QRW DEOH WR FRPSHWH DZD\ WKH VKLIW DW D VLPLODU FRQFHQWUDWLRQ )RRWSULQW DQDO\VLV VKRZHG VRPH SURWHFWHG DQG K\SHUVHQVLWLYH VLWHV ZLWKLQ WKH DUHD WKDW LQFOXGHV WKH ES UHJLRQ )LJXUH f 7KH IDFW WKDW LW WRRN JUHDWHU H[FHVV RI WKH ROLJRQXFOHRWLGH WR FRPSHWH DZD\ WKH VKLIWHG EDQG ZRXOG LQGLFDWH WKDW VHTXHQFHV EH\RQG WKLV VHJPHQW PD\ EH QHHGHG IRU RSWLPXP LQWHUDFWLRQ LQ YLYR '06 IRRWSULQW DQDO\VLV ZDV DOVR SHUIRUPHG WR LGHQWLI\ SURWHLQ'1$ LQWHUDFWLRQ 2QH *UHVLGXH DW SRVLWLRQ )LJXUH f ZKLFK UHVLGHV ZLWKLQ WKH *&1 FRQVHQVXV ELQGLQJ VLWH ZDV REVHUYHG WR EH SURWHFWHG LQ D IUDFWLRQ RI WKH '1$ VDPSOHV WHVWHG 2QO\ D IUDFWLRQ RI WKH '1$ VDPSOH ZDV SURWHFWHG SUREDEO\ EHFDXVH WKH DIILQLW\ EHWZHHQ WKH SURWHLQ DQG '1$ ZDV VXFK WKDW LW GLG QRW UHPDLQ ERXQG GXULQJ WUHDWPHQW ZLWK '06 2WKHU VLWHV VKRZQ WR KDYH HIIHFW RQ JHQH

PAGE 164

H[SUHVVLRQ ZHUH QRW SURWHFWHG LQ YLYR $JDLQ WKH DIILQLW\ RI WKH LQWHUDFWLRQ EHWZHHQ WKH '1$ DQG SURWHLQ ZLOO DIIHFW WKH DELOLW\ WR GHWHFW DQ\ LQWHUDFWLRQ ,I WKH RQRII UDWH EHWZHHQ WKH SURWHLQ DQG '1$ LV YHU\ KLJK WKHQ LW LV SRVVLEOH IRU WKH '06 WR PRGLI\ DQ\ *UHVLGXH WKDW PD\ EH LQYROYHG LQ WKH LQWHUDFWLRQ WKXV DEROLVKLQJ GHWHFWLRQ $OWHUQDWLYHO\ WKHUH PD\ QRW EH *UHVLGXHV LQYROYHG LQ DQ\ RI WKH LQWHUDFWLRQV WKDW DUH WDNLQJ SODFH 7R H[SORUH SURWHLQ'1$ LQWHUDFWLRQ IXUWKHU LW ZLOO EH QHFHVVDU\ WR WUHDW FHOOV ZLWK RWKHU UHDJHQWV WKDW ZRXOG PRGLI\ WKHP LQ GLIIHUHQW ZD\V 7RZDUGV WKLV JRDO DWWHPSWHG LQ YLYR SKRWRIRRWSULQWLQJ E\ 89 FURVVOLQNLQJ WKH SURWHLQV DQG '1$ WKDW LQWHUDFW ZLWK HDFK RWKHU 7KH XVH RI SKRWRIRRWSULQWLQJ KDV WKH DGYDQWDJH WKDW ZKDWHYHU WKH GLVVRFLDWLRQ FRQVWDQW EHWZHHQ WKH SURWHLQ DQG '1$ D VXIILFLHQW H[SRVXUH WLPH PD\ EH IRXQG WR FURVVOLQN WKHP LVRODWHG '1$ IURP FHOOV WKDW KDG EHHQ WUHDWHG DQG SULPHU H[WHQGHG XVLQJ 7DT SRO\PHUDVH 7KH UHVXOWV ZHUH LQFRQVLVWHQW 6LPLODU LQFRQVLVWHQFLHV KDYH EHHQ UHSRUWHG E\ RWKHU UHVHDUFKHUV ZKR DWWULEXWH WKH SUREOHP WR WKH TXDOLW\ RI 7DT SRO\PHUDVH WKDW ZDV XVHG SHUVRQDO FRPPXQLFDWLRQV 'U (QJHONHf P51$ 6WDELOLW\ $OWKRXJK UHJXODWHG P51$ LQVWDELOLW\ ZDV LQLWLDOO\ UHSRUWHG WKUHH GHFDGHV DJR *URV HW DO f OLWWOH LV NQRZQ DERXW WKH PHFKDQLVP DQG WKH IDFWRUV LQYROYHG LQ WKLV SURFHVV KDYH VKRZQ LQ WKLV VWXG\ WKDW JOXFRVH DIIHFWV WKH VWDELOLW\ RI &,7 P51$ 7KH KDOIOLIH LQ D JOXFRVH JURZWK PHGLXP ZDV

PAGE 165

DSSUR[LPDWHO\ PLQXWHV FRPSDUHG WR PRUH WKDQ PLQXWHV LQ DQ HWKDQRO JURZWK PHGLXP )LJXUH f 7KH DGGLWLRQ RI JOXFRVH WR FHOOV EHLQJ JURZQ LQ DQ HWKDQRO PHGLXP FDXVHG HYHQ IDVWHU GHFD\ a PLQXWHV YHUVXV PLQXWHVf )LJXUH f 7KH &n P51$ WKH SHUR[LVRPH LVR]\PH WUDQVFULSW GRHV QRW KDYH D VLPLODU GHFD\ SURILOH )LJXUH f ,Q FRQWUDVW WKH &,7 P51$ ZDV ORQJ OLYHG ERWK LQ JOXFRVHJURZQ DQG HWKDQROJURZQ FXOWXUHV DQG ZDV QRW DIIHFWHG E\ FKDQJLQJ JURZWK FRQGLWLRQV 2WKHU P51$V IURP WKH $&7 DQG 6 ULERVRPDO 51$ JHQHV ZHUH DOVR SUREHG DQG DOVR GLG QRW VKRZ JOXFRVH HIIHFWV UHVXOW QRW VKRZQf 7KLV VXJJHVWV WKDW JOXFRVH VWLPXODWHG GHFD\ LV QRW D JHQHUDO SKHQRPHQRQ EXW LV XQLTXH WR FHUWDLQ P51$V 6HQVLWLYLW\ WR UDSLG GHFD\ ZDV WUDQVIHUDEOH WR D KHWHURORJRXV ( FROL JHQH ODF=f FDUU\LQJ WKH QXFOHRWLGHV RI WKH &,7 P51$ )LJXUH f +RZHYHU DQRWKHU \HDVW '1$ VHTXHQFH 73,f GLG QRW FDXVH D VLPLODU HIIHFW ZKHQ IXVHG WR WKH ODF= JHQH )LJXUH f )XUWKHU GLVVHFWLRQ RI WKLV UHJLRQ GHOLPLWHG WKH VHTXHQFH VXIILFLHQW IRU WKLV HIIHFW WR WKH ILUVW QXFOHRWLGHV RI WKH FRGLQJ UHJLRQ )LJXUH DQG )LJXUH f )LJXUH $ VKRZV WKH &,7 VHTXHQFHV FRQWDLQHG LQ WKH &,7ODF= IXVLRQ P51$ DQG )LJXUH % VKRZV WKH SUHGLFWHG IROGLQJ RI WKH QXFOHRWLGHV WKDW FRQIHU UDSLG GHJUDGDWLRQ LQ D JOXFRVH FRQWDLQLQJ PHGLXP :KHQ WKH ILUVW ES HQFRGLQJ WKH n WZHQW\VL[ DPLQR DFLGV ZHUH GHOHWHG JUHDWHU WKDQ b RI WKH IXVLRQ P51$ EHFDPH ORQJOLYHG +RZHYHU WKH GHFD\ UDWH IRU WKH IUDFWLRQ WKDW GHJUDGHG GLG VR ZLWK NLQHWLFV WKDW ZDV VLPLODU WR WKH LQWDFW IXVLRQ P51$ 7KLV VXJJHVWV WKDW WKH VHTXHQFHV ZLWKLQ WKH ILUVW QXFOHRWLGHV DUH UHTXLUHG IRU WKH GHJUDGDWLRQ RI PRVW RI WKH P51$ %XW WKHUH PD\ EH RWKHU VHTXHQFHV RQ WKH P51$ WKDW ZHUH DEOH WR HIIHFW WKH

PAGE 166

)LJXUH &,7 7UDQVFULSW 3UHVHQW LQ )XVLRQ P51$ $f 7KH &,7 P51$ SUHVHQW LQ WKH &,7ODF= IXVLRQ P51$ 7KH QXPEHULQJ DVVLJQPHQW LV DV PHQWLRQHG LQ ILJXH %f $ SUHGLFWHG VHFRQGDU\ VWUXFWXUH RI WKH &,7 FRGLQJ SRUWLRQ SUHVHQW LQ WKH IXVLRQ P51$ DFFRUGLQJ WR WKH SURJUDP )2/' *&* VRIWZDUH SDFNDJH YHUVLRQ 7KLV IROGLQJ KDV D IUHH HQHUJ\ RI NFDOPROH

PAGE 167

$ $**777*7777**&7777$777*&$777$$*7$$77$&$$ 77$&$$&&$7$$$$$*$$$$7$$**&$$$$&$7$7$*&$$ 7$7$$7$&7$777&*$$*$7*7&$*&*$7$77$7&$$&$$ &7$*&$$$$*777&77$7&$$****&7&&$&$$*$&$$7* 7&$$$$7$7*&$$$$* % 8 $ 8$ &* 8* 8* 8* *& FJDf $ A $ } $ $8$ &* 8$ $8 8$ $8 &* *8&$*&$$$

PAGE 168

LQLWLDO GHFD\ 7KHUH DUH WZR SRVVLEOH H[SODQDWLRQV ZK\ UHPRYDO RI WKH FLV HOHPHQW LQ WKH ILUVW QXFOHRWLGHV ZRXOG FDXVH WKH P51$ WR EHFRPH ORQJOLYHG )LUVW WKLV UHJLRQ PD\ FRQWDLQ HLWKHU DQ HQGRQXFOHRO\WLF FOHDYDJH VLWH RU D VLWH IRU WUDQVIDFWRU ELQGLQJ UHTXLUHG WR LQLWLDWH FOHDYDJH 5HPRYDO RI WKLV QXFOHRWLGHV ZRXOG SUHYHQW HLWKHU RQH RI WKRVH HYHQWV IURP RFFXUULQJ WKHUHIRUH SURORQJLQJ WKH SK\VLFDO OLIH RI WKH IXVLRQ P51$ /RPEDUGR HW DO f UHSRUWHG WKH ILUVW FDVH RI UHSUHVVLRQ RI D JHQH E\ JOXFRVH WKDW LQYROYHG FRQWURO RI VWDELOLW\ RI P51$ ,Q WKHLU UHSRUW WKH\ VKRZHG WKDW VKLIWLQJ RI WKH JURZWK PHGLXP IURP D GHUHSUHVVLQJ FDUERQ VRXUFH JO\FHURO WR D UHSUHVVLQJ PHGLXP FDXVHG UDSLG GHFD\ RI WKH ,S JHQH P51$ /RPEDUGR HW DO f 8QOLNH &,7 P51$ WKH FRQWUROOLQJ FLV HOHPHQW IRU UDSLG GHFD\ RI WKH ,S JHQH P51$ DSSHDUV WR OLH LQ WKH n SRUWLRQ RI WKH JHQH 6HYHUDO JHQHV LQYROYHG LQ VSRUXODWLRQ KDYH DOVR EHHQ VKRZQ WR EH UHJXODWHG E\ JOXFRVH DW WKH WUDQVFULSWLRQDO DQG P51$ VWDELOLW\ OHYHO 6XURVN\ HW DO 6XURVN\ DQG (VSRVLWR f 7KH 80( JHQH ZDV LGHQWLILHG DV D PHGLDWRU RI JOXFRVHGHSHQGHQW UDSLG GHFD\ RI WKHVH VSRUXODWLRQ JHQHV EXW LW GLG QRW DIIHFW PLWRWLF JHQHV ,Q D XPH PXWDQW WKH KDOIOLYHV RI VSRUXODWLRQ VSHFLILF JHQHV VXFK DV 63 63 DQG 63 GRXEOHG 6XURVN\ HW DO f 7KH 80( JHQH HQFRGHV D SURWHLQ ZLWK KRPRORJ\ WR VHULQHWKUHRQLQH VSHFLILF SURWHLQ NLQDVHV 0XWDWLRQ LQ WKH SXWDWLYH NLQDVH GRPDLQ UHVXOWHG LQ D SKHQRW\SH VLPLODU WR WKDW RI D XPH GHOHWLRQ VXJJHVWLQJ WKDW WKLV GRPDLQ LV YHU\ LPSRUWDQW IRU WKH IXQFWLRQ RI WKH SURWHLQ $W WKLV WLPH LW LV QRW NQRZQ ZKHWKHU LI HQWU\ RI JOXFRVH LQWR WKH FHOO WULJJHUV WKH GHJUDGDWLRQ SDWKZD\ RU D PHWDEROLWH RI JOXFRVH FDXVHV WKH UDSLG GHFD\

PAGE 169

7KHVH WZR DOWHUQDWLYHV FDQ EH GLIIHUHQWLDWHG E\ HLWKHU Lf DGGLQJ 2PHWK\O' JOXFRVH WR WKH JURZWK PHGLXP ZKLFK LV D QRQPHWDEROL]DEOH JOXFRVH DQDORJ RU LLf DGGLQJ IUXFWRVH WR WKH JURZWK PHGLXP ,W KDV EHHQ VKRZQ WKDW ZKHQ 2 PHWK\O JOXFRVH ZDV DGGHG WR \HDVW FHOOV JURZLQJ LQ HWKDQRO GHUHSUHVVLRQf PHGLXP VRPH RI WKH UHSUHVVLEOH HQ]\PH DFWLYLWLHV ZHUH UHGXFHG *DQFHGR DQG *DQFHGR f DOWKRXJK WKH NLQHWLFV RI UHGXFWLRQ RFFXUUHG DW D VORZHU UDWH ,I HQWU\ LQWR WKH JO\FRO\WLF SDWKZD\ LV QRW UHTXLUHG WR DFWLYDWH WKH GHJUDGDWLRQ FDVFDGH WKHQ LW LV SRVVLEOH WKDW 2PHWK\O'JOXFRVH PD\ HOLFLW VLPLODU HIIHFW ZKHQ DGGHG WR FHOOV JURZLQJ LQ GHSUHVVLQJ PHGLXP +RZHYHU LI WKH JO\FRO\WLF SDWKZD\ LV UHTXLUHG WR LQLWLDWH WKH GHJUDGDWLRQ WKHQ DGGLWLRQ RI IUXFWRVH WR FHOOV JURZLQJ LQ HWKDQRO VKRXOG VKRZ VLPLODU UHVSRQVH DV ZKHQ JOXFRVH ZDV DGGHG )UXFWRVH LV D KH[RVH VXJDU WKDW IROORZV D VLPLODU FDWDEROLF SDWKZD\ DIWHU LQLWLDO SKRVSKRU\ODWLRQ DQG FRQYHUVLRQ WR IUXFWRVHSKRVSKDWH 2QH RI WKH REYLRXV TXHVWLRQV WKDW DURVH IURP WKLV VWXG\ ZDV KRZ GRHV JOXFRVH PHGLDWH UDSLG GHJUDGDWLRQ RI WKH &,7 P51$" 7KHUH DUH WZR PRGHOV SURSRVH E\ ZKLFK JOXFRVH PD\ PHGLDWH WKH UDSLG GHFD\ RI &,7 P51$ 0RGHO WKH &,7 P51$ DQG RWKHU P51$V WKDW PD\ EH VLPLODUO\ DIIHFWHG DUH QRW EHLQJ WUDQVODWHG ZHOO LQ D JOXFRVHFRQWDLQLQJ PHGLXP EHFDXVH RI VHTXHQFHV FRQWDLQHG LQ WKH QXFOHRWLGHV WKHUHIRUH WKH\ EHFRPH GHJUDGHG UDSLGO\ ,W KDV EHHQ VKRZQ ERWK LQ WKLV VWXG\ DQG LQ RWKHUV +H HW DO 3HOW] HW DO f WKDW ZKHQ P51$V DUH QRW WUDQVODWHG WKH\ WHQG WR EH GHJUDGHG UDSLGO\ 0HVVDJHV WKDW DUH EHLQJ WUDQVODWHG PD\ EH SK\VLFDOO\ SURWHFWHG E\ WKH DVVRFLDWHG ULERVRPHV +HQFH P51$V WKDW DUH WUDQVODWHG XQGHU VSHFLILF SK\VLRORJLFDO

PAGE 170

FRQGLWLRQV ODVW ORQJHU 7KH LQDELOLW\ WR EH WUDQVODWHG PD\ EH GXH WR ELQGLQJ RI D SURWHLQ WR WKH P51$ E\ UHFRJQL]LQJ VSHFLILF SULPDU\ RU VHFRQGDU\ VWUXFWXUH LQ D JOXFRVHFRQWDLQLQJ PHGLXP 7KLV ELQGLQJ ZRXOG WKHQ OHDYH WKH PHVVDJH QDNHG E\ SUHYHQWLQJ LW IURP DVVRFLDWLQJ ZLWK WKH ULERVRPH ZKLFK PDNHV LW EHFRPH VXVFHSWLEOH WR QXFOHDVH DWWDFN +RZHYHU LW LV DOVR SRVVLEOH WKDW ODFN RI WKLV IDFWRU FRXOG DOVR WULJJHU WKH GHJUDGDWLRQ HYHQW E\ DOORZLQJ UHDFWLRQV GRZQVWUHDP RI WKH SDWKZD\ WR RFFXU LQ WKH DEVHQFH RI WKLV IDFWRU 0RGHO %LQGLQJ RI D VSHFLILF IDFWRU WR WKH P51$ WDUJHWV LW IRU UDSLG GHJUDGDWLRQ LQ D JOXFRVHFRQWDLQLQJ PHGLXP 2QH ZD\ WR GLVWLQJXLVK EHWZHHQ WKHVH WZR PRGHOV LV WR PRYH WKH LGHQWLILHG FVHOHPHQW WR GLIIHUHQW ORFDWLRQV RQ WKH P51$ ZKLOH VWLOO PDLQWDLQLQJ WKH UHDGLQJ IUDPH ,I LQKLELWLRQ RI WUDQVODWLRQ WULJJHUV WKH GHJUDGDWLRQ UHPRYDO RI WKH FVHOHPHQW IURP WKH n WHUPLQXV WR RWKHU ORFDWLRQV RQ WKH P51$ VKRXOG JLYH ULVH WR P51$ ZLWK VLPLODU KDOIOLIH ERWK LQ JOXFRVH DQG HWKDQROFRQWDLQLQJ PHGLD +RZHYHU LI WKH FVHOHPHQW ELQGV WR D IDFWRU WKDW WDUJHWV LW IRU GHJUDGDWLRQ LUUHVSHFWLYH RI ZKHUH LW LV ORFDWHG RQ WKH P51$ PROHFXOH LW VKRXOG VWLOO FDXVH GHFD\ ZLWK WKH VDPH NLQHWLFV FRPSDUHG WR WKH ZLOGW\SH P51$ ZKHQ ERXQG E\ WKH SURWHLQ LQ D JOXFRVHFRQWDLQLQJ PHGLXP 2QH FDYHDW LV WKDW WKH FVHOHPHQW VKRXOG EH DFFHVVLEOH WR WKH WUDQVIDFWRU ZKHUHYHU LW LV ORFDWHG RQ WKH P51$ ,Q FRQFOXVLRQ JOXFRVH UHJXODWLRQ RI WKH &,7 JHQH RFFXUV DW WZR OHYHOV WUDQVFULSWLRQ DQG P51$ WXUQRYHU 5HJXODWLRQ DW WKH OHYHO RI WUDQVFULSWLRQ VHHPV WR EH PHGLDWHG E\ D 856 HOHPHQW ZKLFK GHFUHDVHV WKH OHYHO RI WUDQVFULSWLRQ LQ D JOXFRVH PHGLXP *OXFRVH DOVR FDXVHV D IDVWHU GHFD\ RI WKH &,7 P51$ WKHUHE\ ORZHULQJ WKH OHYHO RI &,7 H[SUHVVLRQ LQ WKH PHGLXP ,Q DGGLWLRQ RWKHU

PAGE 171

QXWULWLRQDO UHTXLUHPHQWV DOVR DIIHFW WKH OHYHO RI &,7 H[SUHVVLRQ 7KH VLJQDO IRU WKLV FRQWURO LQ QRW NQRZQ EXW PD\ EH GXH WR WKH DYDLODELOLW\ RI FHUWDLQ DPLQR DFLGV )XWXUH *RDOV 7R FKDUDFWHUL]H WKH WUDQVFULSWLRQDO UHJXODWLRQ RI WKH &,7 JHQH PRUH SUHFLVHO\ VHYHUDO H[SHULPHQWV QHHG WR EH SHUIRUPHG 2QH RI WKHVH H[SHULPHQWV ZRXOG LQYROYH VLWH GLUHFWHG PXWDJHQHVLV ZLWKLQ WKH UHJLRQV WKDW ZHUH LQGLYLGXDOO\ VKRZQ WR SRVVHVV DFWLYDWLRQ FDSDELOLW\ 7KH VLWH GLUHFWHG PXWDJHQHVLV FRXOG EH GRQH RQ WKH HQWLUH XSVWUHDP IUDJPHQW RI WKH &,7 JHQH RU RQ WKH VPDOOHU IUDJPHQWV WKDW ZHUH VKRZQ WR DFWLYDWH D KHWHURORJRXV JHQH 0XWDJHQHVLV WKDW LGHQWLILHV D FRUH VHTXHQFH UHTXLUHG IRU WUDQVFULSWLRQDO UHJXODWLRQ ZRXOG HQDEOH XV WR LGHQWLI\ RWKHU JHQHV WKDW PD\ EH UHJXODWHG E\ D FRPPRQ IDFWRU 7KLV ZRXOG EH GRQH E\ SHUIRUPLQJ D FRPSXWHU VHDUFK WR VHH LI WKHUH DUH RWKHU JHQHV WKDW KDYH D VLPLODU UHFRJQLWLRQ VLWH RU E\ XVLQJ '1$ VHTXHQFH DV D ELQGLQJ SUREH 6LWH GLUHFWHG PXWDJHQHVLV ZRXOG DOVR EH SHUIRUPHG RQ WKH SXWDWLYH 856 VHTXHQFH LGHQWLILHG EHWZHHQ DQG RI WKH &,7 n QRQWUDQVFULEHG UHJLRQ 7KH PXWDJHQHVLV ZRXOG KHOS GHILQH WKH LQGLVSHQVDEOH VHTXHQFHV UHTXLUHG IRU WKLV UHJXODWLRQ $ IXUWKHU FKDUDFWHUL]DWLRQ WR VKRZ WKDW WKH WR UHJLRQ FRQWDLQV D JOXFRVHGHSHQGHQW 856 HOHPHQW ZRXOG UHTXLUH VXEFORQLQJ WKLV UHJLRQ LQWR WKH SURPRWHU RI D JHQH WKDW LV QRW UHJXODWHG E\ JOXFRVH OLNH WKH &<& JHQH 7R XQGHUVWDQG UHJXODWLRQ RI &,7 P51$ WXUQRYHU E\ JOXFRVH IXUWKHU GHOHWLRQ RI WKH FVHOHPHQW QHHGV WR EH GRQH WR LGHQWLI\ WKH PLQLPXP VHTXHQFH

PAGE 172

QHFHVVDU\ IRU WKLV UHJXODWLRQ 7KH LGHQWLILHG VHTXHQFH ZRXOG WKHQ EH IXVHG WR DQ KHWHURORJRXV \HDVW JHQH DQG VKRZ WKDW LW FDQ UHJXODWH WKLV JHQH LQ D VLPLODU PDQQHU WR WKH &,7 JHQH :H KDYH DOUHDG\ FRQVWUXFWHG D K\EULG JHQH EHWZHHQ WKH &83 JHQH DQG WKH QXFOHRWLGH WUDQVFULSW '1$ VHTXHQFH ,GHQWLILFDWLRQ RI WKH PLQLPXP VHTXHQFH UHTXLUHG IRU WKH UDSLG WXUQRYHU LQ D JOXFRVH PHGLXP ZRXOG DOVR IDFLOLWDWH GHWHUPLQLQJ WKH WUDQVDFWLQJ IDFWRUVf UHTXLUHG IRU WKLV SKHQRPHQRQ E\ GRLQJ D EDQGVKLIW DVVD\ XVLQJ WKH P51$ VHTXHQFH 2QH RI WKH RWKHU REMHFWLYHV LV WR GHWHUPLQH ZKDW RWKHU JHQHV DUH UHJXODWHG E\ JOXFRVH E\ DIIHFWLQJ WKH GHFD\ UDWH 7KLV ZRXOG EH XVHIXO LQ GHWHUPLQLQJ WKH GLIIHUHQW SDWKZD\V WKURXJK ZKLFK JOXFRVH PHGLDWHV P51$ WXUQRYHU RI YDULRXV JHQHV $QRWKHU PDMRU REMHFWLYH RI WKH P51$ VWDELOLW\ VWXGLHV VKRXOG EH GHFLSKHULQJ WKH PHFKDQLVPV RI P51$ GHFD\ %HFDXVH RI WKH SDXFLW\ RI H[SHULPHQWDO GDWD HVSHFLDOO\ LQ \HDVW YHU\ OLWWOH LV NQRZQ DERXW WKH PHFKDQLVPV RI P51$ GHFD\ 5HFHQWO\ 0XKOUDG HW DO f VKRZHG WKDW WKHUH DUH DW OHDVW WZR PHFKDQLVPV LQYROYHG LQ WKH GHFD\ RI WKH 3*. P51$ f $ GHDGHQ\ODWLRQGHSHQGHQW GHFDSSLQJ IROORZHG E\ n WR n H[RQXFOHDVH GLJHVWLRQ f $ GHFDSSLQJLQGHSHQGHQW n WR n H[RQXFOHDVH GLJHVWLRQ 2QH RI WKH JRDOV ZRXOG EH WR ILQG RXW ZKDW GLUHFWLRQ GLJHVWLRQ RI &,7 P51$ SURFHHGV 7KLV FRXOG EH GRQH E\ GHWHUPLQLQJ WKH HIIHFW RQ &,7 P51$ GLJHVWLRQ D [UQ PXWDQW ;51 HQFRGHV WKH PDMRU n WR n H[RULERQXFOHDVH LQ \HDVW +VX DQG 6WHYHQV f 6LQFH WKH n SRUWLRQ RI WKH &,7 P51$ ZDV VXIILFLHQW WR FDXVH UDSLG GHFD\ LW LV TXLWH SRVVLEOH WKDW D GHDGHQ\ODWLRQ VWHS EHIRUH H[RQXFOHDVH GLJHVWLRQ PD\ QRW EH UHTXLUHG 6XURVN\ HW DO f DOVR GLVFRYHUHG WKDW GHDGHQ\ODWLRQ

PAGE 173

ZDV QRW UHTXLUHG IRU WKH GHFD\ RI 63 P51$ D JOXFRVH UHJXODWHG PHLRWLF VSHFLILF JHQH 7KH &,7 P51$ GHFD\ PHFKDQLVP PD\ EH LGHQWLFDO WR RQH RI WKH DOUHDG\ GHILQHG SDWKZD\V D FRPELQDWLRQ RI VRPH RI WKH SDWKZD\V RU LW PD\ VKRZ D QHZ SDWKZD\ WKDW LV \HW LGHQWLILHG

PAGE 174

%,%/,2*5$3+< %HUJHU 6/ 3LQD % 6LOYHUPDQ 1 0DUFXV *$ $JDSLWH 5HJLHU -/ 7ULH]HQEHUJ 6DQG *XDUHQWH / f *HQHWLF LVRODWLRQ RI $'$ $ SRWHQWLDO WUDQVFULSWLRQDO DGDSWRU UHTXLUHG IRU IXQFWLRQ RI FHUWDLQ DFLGLF DFWLYDWLRQ GRPDLQV &HOO %OXQGHO 0 &UDLJ ( DQG .HQQHOO f 'HFD\ UDWHV RI GLIIHUHQW P51$ LQ ( FROL DQG PRGHOV RI GHFD\ 1DW 1HZ %LRO %RXYHW 3 DQG %HODVFR -* f &RQWURO RI 51DVH (PHGLDWHG 51$ GHJUDGDWLRQ E\ nWHUPLQDO EDVH SDLULQJ LQ ( FROL 1DWXUH %RZPDQ 6% =DPDQ = &ROOLQVRQ /3 %URZQ $-3 DQG 'DZHV ,: f 3RVLWLYH UHJXODWLRQ RI WKH /3' JHQH RI 6DFFKDURP\FHV FHUHYLVLDH E\ WKH +$3+$3+$3 DFWLYDWLRQ V\VWHP 0RO *HQ *HQHW %UDQG $+ %UHHGHQ / $EUDKDP 6WHUQJODQ] 5 DQG 1DVP\WK f &KDUDFWHUL]DWLRQ RI D 6LOHQFHU LQ \HDVW $ '1$ VHTXHQFH ZLWK SURSHUWLHV RSSRVLWH WR WKRVH RI D WUDQVFULSWLRQDO HQKDQFHU &HOO %UDXP 5/H 1) DQG .RUQEHUJ 5' f $ *$/ IDPLO\ RI XSVWUHDP DFWLYDWLQJ VHTXHQFHV LQ \HDVW UROHV LQ ERWK LQGXFWLRQ DQG UHSUHVVLRQ RI WUDQVFULSWLRQ (0%2 %UHQW 5 f 5HSUHVVLRQ RI WUDQVFULSWLRQ LQ \HDVW &HOO %UHQW 5 DQG 3WDVKQH 0 f $ HXNDU\RWLF WUDQVFULSWLRQDO DFWLYDWRU EHDULQJ WKH '1$ VSHFLILFLW\ RI D SURNDU\RWLF UHSUHVVRU &HOO %XUDWRZVNL 6 +DKQ 6 *XDUHQWH / DQG 6KDUS 3$ f )LYH LQWHUPHGLDWH FRPSOH[HV LQ WUDQVFULSWLRQ LQLWLDWLRQ E\ 51$ SRO\PHUDVH ,, &HOO &DSRQLJUR 0XKOUDG DQG 3DUNHU 5 f $ VPDOO VHJPHQW RI WKH 0$7RUL WUDQVFULSW SURPRWHV P51$ GHFD\ LQ 6DFFKDURP\FHV FHUHYLGLDH $ VWLPXODWRU\ UROH IRU UDUH FRGRQV 0RO &HOO %LRO

PAGE 175

&DUOVRQ 0 DQG %RWVWHLQ f 7ZR GLIIHUHQWLDOO\ UHJXODWHG P51$V ZLWK GLIIHUHQW n HQGV HQFRGH VHFUHWHG DQG LQWUDFHOOXODU IRUPV RI \HDVW LQYHUWDVH &HOO &HOHQ]D -/ DQG &DUOVRQ 0 f $ \HDVW JHQH WKDW LV HVVHQWLDO IRU UHOHDVH IURP JOXFRVH UHSUHVVLRQ HQFRGHV D SURWHLQ NLQDVH 6FLHQFH &KDQGOHU 9/ 0DOHU %$ DQG
PAGE 176

&UDYHQ *5 6WHHUV ( DQG $QILQVHQ &% f 3XULILFDWLRQ FRPSRVLWLRQ DQG PROHFXODU ZHLJKW RI WKH JDODFWRVLGDVH LQ (VFKHULFKLD FROL %LRO &KHP &UHXVRW 9) *XDUHQWH / DQG 6ORQLPVNL 33 f 7KH RYHUSURGXFLQJ &<3 DQG WKH XQGHUSURGXFLQJ KDS PXWDWLRQV DUH DOOHOHV RI WKH VDPH JHQH ZKLFK UHJXODWHV LQ WUDQV WKH H[SUHVVLRQ RI WKH VWUXFWXUDO JHQHV HQFRGLQJ LVRF\WRFKURPHV F &XUU *HQHW 'HFNHU &DQG 3DUNHU 5 f $ WXUQRYHU SDWKZD\ IRU ERWK VWDEOH DQG XQVWDEOH P51$V LQ \HDVW (YLGHQFH IRU D UHTXLUHPHQW IRU GHDGHQ\ODWLRQ *HQHV 'HY 'HQLV &/ &LULDF\ 0 DQG
PAGE 177

)OLFN -6 DQG -RKQVWRQ 0 f 7ZR V\VWHPV RI JOXFRVH UHSUHVVLRQ RI WKH *$/ SURPRWHU LQ 6DFFKDURP\FHV FHUHYLVLDH 0RO &HOO %LRO )OLFN -6 DQG -RKQVWRQ 0 f $QDO\VLV RI 856*PHGLDWHG JOXFRVH UHSUHVVLRQ RI WKH *$/ SURPRWHU RI 6DFFKDURP\FHV FHUHYLVLDH *HQHWLFV )RUVEXUJ 6/ DQG *XDUHQWH / f 0XWDWLRQDO DQDO\VLV RI XSVWUHDP DFWLYDWLRQ VHTXHQFH RI WKH &<& JHQH RI 6DFFKDURP\FHV FHUHYLVLDH D +$3+$3 UHVSRQVLYH VLWH 0RO &HOO %LRO )RUVEXUJ 6/ DQG *XDUHQWH / f ,GHQWLILFDWLRQ DQG FKDUDFWHUL]DWLRQ RI +$3 D WKLUG FRPSRQHQW RI WKH &&$$7ERXQG +$3+$3 KHWHURPHU *HQHV 'HY *DQFHGR & DQG *DQFHGR 0 f 3KRVSKRU\ODWLRQ RI 2PHWK\O' JOXFRVH DQG FDWDEROLWH UHSUHVVLRQ LQ \HDVW (XU %LRFKHP *DQJORII 63 0DUJXHW DQG /DXTXLQ *-0 f 0ROHFXODU FORQLQJ RI WKH \HDVW PLWRFKRQGULDO DFRQLWDVH JHQH $&f DQG HYLGHQFH RI D V\QHUJLVWLF UHJXODWLRQ RI H[SUHVVLRQ E\ JOXFRVH SOXV JOXWDPDWH 0RO &HOO %LRO *HRUJDNRSXROXV 7 DQG 7KLUHRV f 7ZR GLVWLQFW \HDVW WUDQVFULSWLRQDO DFLWYDWRUV UHTXLUH WKH IXQFWLRQ RI WKH *&1 SURWHLQ WR SURPRWH QRUPDO OHYHOV RI WUDQVFULSWLRQ (0%2 *LOO DQG 7MLDQ 5 f $ KLJKO\ FRQVHUYHG GRPDLQ RI 7),,' GLVSOD\V VSHFLHV VSHFLILFLW\ LQ YLYR &HOO *LQLJHU ( DQG 3WDVKQH 0 f 7UDQVFULSWLRQ LQ \HDVW DFWLYDWHG E\ D SXWDWLYH DPSKLSDWKLF D KHOL[ OLQNHG WR D '1$ ELQGLQJ XQLW 1DWXUH *LQLJHU ( 9DUQXP 60 DQG 3WDVKQH 0 f 6SHFLILF '1$ ELQGLQJ RI *$/ D SRVLWLYH UHJXODWRU\ SURWHLQ RI \HDVW &HOO *XDUHQWH / f 5HJXODWRU\ SURWHLQV LQ \HDVW $QQ 5HY *HQHW *XDUHQWH / f 0HVVHQJHU 51$ WUDQVFULSWLRQ DQG LWV FRQWURO LQ 6DFFKDURP\FHV FHUHYLVLDH ,Q 7KH 0ROHFXODU DQG &HOOXODU %LRORJ\ RI WKH
PAGE 178

*XDUHQWH / DQG +RDU ( f 8SVWUHDP DFWLYDWLRQ VLWHV RI WKH &<& JHQH RI 6DFFKDURP\FHV FHUHYLVLDH DUH DFWLYH ZKHQ LQYHUWHG EXW QRW ZKHQ SODFHG GRZQVWUHDP RI WKH 7$7$ ER[ 3URF 1DWO $FDG 6FL 86$ *XDUHQWH / /DORQGH % *LIIRUG 3 DQG$ODQL ( f 'LVWLQFWO\ UHJXODWHG WDQGHP XSVWUHDP DFWLYDWLRQ VLWHV PHGLDWH FDWDEROLWH UHSUHVVLRQ RI WKH &<& JHQH RI 6 FHUHYLVLDH &HOO *XDUHQWH / DQG 0DVRQ 7 f +HPH UHJXODWHV WUDQVFULSWLRQ RI WKH &<& JHQH RI 6 FHUHYLVLDH YLD DQ XSVWUHDP DFWLYDWLRQ VLWH &HOO +DKQ 6 DQG *XDUHQWH / f
PAGE 179

+RIPDQQ -); /DURFKH 7 %UDQG $+ DQG *DVVHU 60 f 5$3 IDFWRU LV QHFHVVDU\ IRU '1$ ORRS IRUPDWLRQ LQ YLWUR DW WKH VLOHQW PDWLQJ W\SH ORFXV +0/ &HOO +RO]HU + DQG 0DWHUQ + f &DWDEROLWH LQDFWLYDWLRQ RI WKH JDODFWRVH XSWDNH V\VWHP LQ \HDVW %LRO &KHP +RRVHLQ 0$ DQG /HZLQ $6 f 'HUHSUHVVLRQ RI FLWUDWH V\QWKDVH LQ 6DFFKDURP\FHV FHUHYLVLDH PD\ RFFXU DW WKH OHYHO RI WUDQVFULSWLRQ 0RO &HOO %LRO +RSH ,$ 0DKDGHYDQ 6 DQG 6WUXKO f 6WUXFWXUDO DQG IXQFWLRQDO FKDUDFWHUL]DWLRQ RI WKH VKRUW DFLGLF WUDQVFULSWLRQDO DFWLYDWLRQ UHJLRQ RI \HDVW *&1 SURWHLQ 1DWXUH +R\ 09 /HXWKHU .. .RGDGHN 7 DQG -RKQVWRQ 6$ f 7KH DFLGLF DFWLYDWLRQ GRPDLQV RI WKH *&1 DQG *$/ SURWHLQV DUH QRW D +HOLFDO EXW IRUP VKHHWV &HOO +VX & / DQG 6WHYHQV $ f
PAGE 180

.DPPHUHU % *X\RXQYDUFK $ DQG +XEHUW & f
PAGE 181

/HHGV 3 3HOW] 6: -DFREVRQ $ DQG &XOEHUWVRQ 05 f 7KH SURGXFW RI WKH \HDVW 83) JHQH LV UHTXLUHG IRU UDSLG WXUQRYHU RI P51$V FRQWDLQLQJ D SUHPDWXUH WUDQVODWLRQDO WHUPLQDWLRQ FRGRQ *HQHV 'HY /HHGV 3 :RRG -0 /HH % DQG &XOEHUWVRQ 05 f *HQH SURGXFWV WKDW SURPRWH P51$ WXUQRYHU LQ 6DFFKDURP\FHV FHUHYLVLDH 0RO &HOO %LRO /HXWKHU .. 6DOPHUQ -0 DQG -RKQVWRQ 6$ f *HQHWLF HYLGHQFH WKDW DQ DFWLYDWLRQ GRPDLQ RI *$/ GRHV QRW UHTXLUH DFLGLW\ DQG PD\ IRUP D VKHHW &HOO /HZLQ $ 6 +LQHV 9 DQG 6PDOO *0 f &LWUDWH V\QWKDVH HQFRGHG E\ WKH &,7 JHQH RI 6DFFKDURP\FHV FHUHYLVDH LV SHUR[LVRPDO 0RO &HOO %LRO /LDR ; DQG %XWRZ 5$ f 57* DQG 57* 7ZR \HDVW JHQHV UHTXLUHG IRU D QRYHO SDWK RI FRPPXQLFDWLRQ IURP PLWRFKRQGULD WR WKH QXFOHXV &HOO /LDR ; 6PDOO :& 6UHUH 3$ DQG %XWRZ 5$ f ,QWUDPLWRFKRQGULDO IXQFWLRQV UHJXODWH QRQPLWRFKRQGULDO FLWUDWH V\QWKDVH &,7f H[SUHVVLRQ LQ 6DFFKDURP\FHV FHUHYLVLDH 0RO &HOO %LRO /RPEDUGR $ &HUHJKLQR *3 DQG 6FKHIIOHU ,( f &RQWURO RI P51$ WXUQRYHU DV D PHFKDQLVP RI JOXFRVH UHSUHVVLRQ LQ 6DFFKDURP\FHV FHUHYLVLDH 0RO &HOO %LRO /RZU\ &9 DQG /LHEHU 5+ f 1HJDWLYH UHJXODWLRQ RI WKH 6DFFKDURP\FHV FHUHYLVLDH $1% JHQH E\ KHPH DV PHGLDWHG E\ WKH 52; JHQH SURGXFW 0RO &HOO %LRO /RZU\ 2+ 5RVHEURXJK 1)DUU $/ DQG 5DQGHOO 5f 3URWHLQ PHDVXUHPHQW ZLWK WKH )ROLQ SKHQRO UHDJHQW %LRO &KHP /X + =DZHO / )LVKHU / (JO\ DQG 5HLQEHUJ f +XPDQ JHQHUDO WUDQVFULSWLRQ IDFWRU ,,+ SKRVSKRU\ODWHV WKH &WHUPLQDO GRPDLQ RI 51$ SRO\PHUDVH ,, 1DWXUH 0D DQG 3WDVKQH 0 f $ QHZ FODVV RI \HDVW WUDQVFULSWLRQDO DFWLYDWRUV &HOO 0DJDVDQLN % f &DWDEROLWH UHSUHVVLRQ &ROG 6SULQJ +DUERU 6\PS 4XDQW %LRO

PAGE 182

0DUF]DN -( DQG %UDQGULVV 0& f $QDO\VLV RI FRQVWLWXWLYH DQG QRQLQGXFLEOH PXWDWLRQV RI WKH 387 WUDQVFULSWLRQDO DFWLYDWRU 0RO &HOO %LRO 0DWVXPRWR 8QR ,VKLNDZD 7 DQG 2VKLPD < f &\FOLF $03 PD\ QRW EH LQYROYHG LQ FDWDEROLWH UHSUHVVLRQ LQ 6DFFKDURP\FHV FHUHYLVLDH (YLGHQFH IURP PXWDQWV XQDEOH WR V\QWKHVL]H LW %DFWHULRO 0DWVXPRWR 8QR 7RK( $ ,VKLNDZD 7 DQG 2VKLPD < f &\FOLF $03 PD\ QRW EH LQYROYHG LQ FDWDEROLWH UHSUHVVLRQ LQ 6DFFKDURP\FHV FHUHYLVLDH (YLGHQFH IURP PXWDQWV FDSDEOH RI XWLOL]LQJ LW DV DQ DGHQLQH VRXUFH %DFWHULRO 0D[DP $ 0 DQG *LOEHUW : f $ QHZ PHWKRG IRU VHTXHQFLQJ '1$ 3URF 1DW $FDG 6FL 86$ 0F*LQQLV : *DUEHU 5/ :LU] .XURLZD $ DQG *HKULQJ :Df $ KRPRORJRXV SURWHLQFRGLQJ VHTXHQFH LQ 'URVRSKLOD KRPHRWLF JHQHV DQG LWV FRQVHUYDWLRQ LQ RWKHU PHWD]RDQV &HOO 0F*LQQLV : /HYLQH 06 +DIHQ ( .XURLZD $ DQG *HKULQJ :Ef $ FRQVHUYHG '1$ VHTXHQFH LQ KRPRHRWLF JHQHV RI WKH 'URVRSKLOD $QWHQQDSHGLD DQG ELWKRUD[ FRPSOH[HV 1DWXUH 0LOOHU 0F/DFKODQ $ DQG .OXJ $ f 5HSHWLWLYH ]LQF ELQGLQJ GRPDLQV LQ WKH SURWHLQ WUDQVFULSWLRQ IDFWRU ,,, $ IURP ;HQRSXV RRF\WHV (0%2 0XHOOHU '0 DQG *HW] *6 f 6WHDG\ VWDWH DQDO\VLV RI PLWRFKRQGULDO 51$ DIWHU JURZWK RI \HDVW 6DFFKDURP\FHV FHUHYLVLDH XQGHU FDWDEROLWH UHSUHVVLRQ DQG GHUHSUHVVLRQ %LRO &KHP 0XKOUDG 'HFNHU &DQG 3DUNHU 5 f 'HDGHQ\ODWLRQ RI WKH XQVWDEOH P51$ HQFRGHG E\ WKH \HDVW 0)$ JHQH OHDGV WR GHFDSSLQJ IROORZHG E\ n GLJHVWLRQ RI WKH WUDQVFULSW *HQHV 'HY 0XKOUDG DQG 3DUNHU 5 f 0XWDWLRQV DIIHFWLQJ VWDELOLW\ DQG GHDGHQ\ODWLRQ RI WKH \HDVW 0)$ WUDQVFULSW *HQHV 'HY 0XKOUDG DQG 3DUNHU 5 f 3UHPDWXUH WUDQVODWLRQ WHUPLQDWLRQ WULJJHUV P51$ GHFDSSLQJ 1DWXUH 0XKOUDG 'HFNHU & DQG 3DUNHU 5 f 7XUQRYHU PHFKDQLVPV RI WKH VWDEOH \HDVW 3*. P51$ 0RO &HOO %LRO

PAGE 183

1RQHW 0 6ZHHWVHU DQG
PAGE 184

3LQNKDP -/ 2OHVHQ -7 DQG *XDUHQWH / f 6HTXHQFH DQG QXFOHDU ORFDOL]DWLRQ RI WKH 6DFFKDURP\FHV FHUHYLVLDH +$3 SURWHLQ D WUDQVFULSWLRQDO DFWLYDWRU 0RO &HOO %LRO 3RODNLV (6 DQG %DUWOH\ : f &KDQJHV LQ WKH HQ]\PH DFWLYLWLHV RI 6DFFKDURP\FHV FHUHYLVLDH GXULQJ DHURELF JURZWK RQ GLIIHUHQW FDUERQ VRXUFHV %LRFKHP 3RODNLV (6 %DUWOH\ : DQG 0HHN *$ f &KDQJHV LQ WKH DFWLYLWLHV RI UHVSLUDWRU\ HQ]\PHV GXULQJ WKH DHURELF JURZWK RI \HDVW RQ GLIIHUHQW FDUERQ VRXUFHV %LRFKHP 3RUWHU 6' DQG 6PLWK 0 f +RPHRGRPDLQ KRPRORJ\ LQ \HDVW 0$7D LV HVVHQWLDO IRU UHSUHVVRU DFWLYLW\ 1DWXUH 3UH]DQW 7 3IHLIHU DQG *XDUHQWH / f 2UJDQL]DWLRQ RI WKH UHJXODWRU\ UHJLRQ RI WKH \HDVW &<& JHQH 0XOWLSOH IDFWRUV DUH LQYROYHG LQ UHJXODWLRQ 0RO &HOO %LRO 3WDVKQH 0 f *HQH UHJXODWLRQ E\ SURWHLQV DFWLQJ QHDUE\ DQG DW D GLVWDQFH 1DWXUH 3XJK % ) DQG 7MLDQ 5 f 0HFKDQLVP RI WUDQVFULSWLRQDO DFWLYDWLRQ E\ 6S (YLGHQFH IRU FRDFWLYDWRUV &HOO 2OHVHQ +DKQ 6 DQG *XDUHQWH / f
PAGE 185

5RVH 0 $OELJ : DQG (QWLDQ f *OXFRVH UHSUHVVLRQ LQ 6DFFKDURP\FHV FHUHYLVLDH LV GLUHFWO\ DVVRFLDWHG ZLWK KH[RVH SKRVSKRU\ODWLRQ E\ KH[RVH 3, DQG 3OO (XU %LRFKHP 5RVHQNUDQW] 0 $ODP 7 .LP &ODUN %6UHUH 3$ DQG *XDUHQWH /3 f 0LWRFKRQGULDO DQG QRQPLWRFKRQGULDO FLWUDWH V\QWKDVHV LQ 6DFFKDURP\FHV FHUHYLVLDH DUH HQFRGHG E\ GLVWLQFW KRPRORJRXV JHQHV 0RO &HOO %LRO 5RVHQNUDQW] 0 'LQJPDQ ': DQG 6RQHQVKHLQ $/ f %DFLOOXV VXEWLOLV FLW% JHQH LV UHJXODWH V\QHUJLVWLFDOO\ E\ JOXFRVH DQG JOXWDPLQH %DFWHULRO 5RVHQNUDQW] 0 .HOO &6 3HQQHOO ($ :HEVWHU 0 DQG 'HYHQLVK /f 'LVWLQFW XSVWUHDP DFWLYDWLQJ UHJLRQV IRU JOXFRVHUHSUHVVHG DQG GHUHSUHVVHG H[SUHVVLRQ RI WKH \HDVW FLWUDWH V\QWKDVH JHQH &,7 &XUU *HQHW 5R\ 'DQG 'DZHV ,: f &ORQLQJ DQG FKDUDFWHUL]DWLRQ RI WKH JHQH HQFRGLQJ /LSRDPLGH GHK\GURJHQDVH LQ 6DFFKDURP\FHV FHUHYLVDH *HQ 0LFURELRO 6DOPHUQ -0 -U DQG -RKQVWRQ 6$ f $QDO\VLV RI WKH .OX\YHURP\FHV ODFWLV SRVLWLYH UHJXODWRU\ JHQH /$& UHYHDOV IXQFWLRQDO KRPRORJ\ WR EXW VHTXHQFH GLYHUJHQFH IURP WKH 6DFFKDURP\FHV FHUHYLVLDH *$/ JHQH 1XFOHLF $FLGV 5HVHDUFK 6DQJHU ) 1LFNOHQ 6 DQG &RXOVRQ $ 5 f '1$ VHTXHQFLQJ ZLWK FKDLQ WHUPLQDWLQJ LQKLELWRUV 3URF 1DW $FDG 6FL 86$ 6DQWLDJR 7& 3XUYLV ,%HWWDQ\ $-( DQG %URZQ $-3 f 7KH UHODWLRQVKLS EHWZHHQ P51$ VWDELOLW\ DQG OHQJWK LQ 6DFFKDURP\FHV FHUHYLVLDH 1XFOHLF $FLGV 5HVHDUFK 6DWUXVWHJXL DQG 0DFKDGR $ f 7KH V\QWKHVLV RI \HDVW PDWUL[ PLWRFKRQGULDO HQ]\PHV LV UHJXODWHG E\ GLIIHUHQW OHYHOV RI PLWRFKRQGULDO IXQFWLRQ $UFK %LRFKHP %LRSK\V 6DXHU 57
PAGE 186

6FKQHLGHU -& DQG *XDUHQWH / f 5HJXODWLRQ RI WKH \HDVW &<7 JHQH HQFRGLQJ F\WRFKURPH F E\ +$3 DQG +$3 0RO &HOO %LRO 6FKROHU $ DQG 6FKXOOHU + f $ FDUERQ VRXUFHUHVSRQVLYH SURPRWHU HOHPHQW QHFHVVDU\ IRU DFWLYDWLRQ RI WKH ,VRFLWUDWH /\DVH JHQH ,&/ LV FRPPRQ WR JHQHV RI WKH JOXFRQHRJHQLF SDWKZD\ LQ WKH \HDVW 6DFFKDURP\FHV FHUHYLVLDH 0RO &HOO %LRO 6HGLY\ -0 DQG )UDHQNHO '* f )UXFWRVH ELVSKRVSKDWDVH RI 6DFFKDURP\FHV FHUHYLVLDH FORQLQJ GLVUXSWLRQ DQG UHJXODWLRQ RI WKH )%3 VWUXFWXUDO JHQH 0RO %LRO 6LGGLTXL $+ DQG %UDQGULVV 0& f $ UHJXODWRU\ UHJLRQ UHVSRQVLEOH IRU SUROLQHVSHFLILF LQGXFWLRQ RI WKH \HDVW 387 JHQH LV DGMDFHQW WR LWV 7$7$ ER[ 0RO &HOO %LRO 6LQFODLU $ .RUQIHOG DQG 'DZHV : f
PAGE 187

6]HNHO\ ( DQG 0RQWJRPHU\ '/ f *OXFRVH UHSUHVVHV WUDQVFULSWLRQ RI 6DFFKDURP\FHV FHUHYLVLDH QXFOHDU JHQHV WKDW HQFRGH PLWRFKRQGULDO FRPSRQHQWV 0RO &HOO %LRO 7KXULDX[ 3 DQG 6HQWHQDF $ f
PAGE 188

=KDQJ / DQG *X£UDQWH / f (YLGHQFH WKDW 783661 KDV D SRVLWLYH HIIHFW RQ WKH DFWLYLW\ RI WKH \HDVW DFWLYDWRU +$3 *HQHWLFV =KRX %ULVFR 35* +LQNNDQHQ $( DQG .RKOKDZ *% f 6WUXFWXUH RI \HDVW UHJXODWRU\ JHQH /(8 DQG HYLGHQFH WKDW /(8 LWVHOI LV XQGHU JHQHUDO DPLQR DFLG FRQWURO 1XFOHLF $FLGV 5HVHDUFK =XELDJD $ 0 %HODVFR DQG *UHHQEHUJ 0 ( f 7KH QDQRPHU 88$888$88 LV WKH NH\ $XULFK VHTXHQFH PRWLI WKDW PHGLDWHV P51$ GHJUDGDWLRQ 0RO &HOO %LRO

PAGE 189

%,2*5$3+,&$/ 6.(7&+ VWDUWHG P\ FROOHJH HGXFDWLRQ DW WKH &RPPXQLW\ &ROOHJH RI %DOWLPRUH LQ 8SRQ FRPSOHWLRQ DWWHQGHG &RSSLQ 6WDWH &ROOHJH IRU D VHPHVWHU EHIRUH WUDQVIHUULQJ WR /R\ROD &ROOHJH %DOWLPRUH 0' ZKHUH REWDLQHG P\ %DFKHORU RI 6FLHQFH LQ %LRORJ\ ,Q JRW PDUULHG WR $ODUR *HRUJH WKH VDPH \HDU VWDUWHG JUDGXDWH VFKRRO DW WKH 8QLYHUVLW\ RI :LVFRQVLQ 0LOZDXNHH :LVFRQVLQ HQWHUHG WKH 8QLYHUVLW\ RI )ORULGD JUDGXDWH VFKRRO LQ WKH VDPH \HDU ZH KDG RXU ILUVW GDXJKWHU %DQLPLERRIRUL ,Q P\ ZLIH KDG RXU VHFRQG GDXJKWHU ,ELWXURNRHPL FRPSOHWHG P\ GLVVHUWDWLRQ XQGHU WKH JXLGDQFH RI 'U $OIUHG 6 /HZLQ 8SRQ FRPSOHWLRQ KRSH WR GR P\ SRVWGRFWRUDO ZRUN DW WKH 6HDWWOH %LRPHGLFDO 5HVHDUFK ,QVWLWXWH ZLWK 'U .HQQHWK 6WXDUW ZKHUH KRSH WR GR UHVHDUFK LQ WKH ILHOG RI SDUDVLWRORJ\

PAGE 190

, FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWSI RI\ 3KMMRASAU\ $OIUHGA /HZLQ &KDLU 3URIHVVRU RI 0ROHFXODU *HQHWLFV DQG 0LFURELRORJ\ FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ A 6Of f§‘ Y +HQU\ 9 %DNHU $VVRFLDWH 3URIHVVRU RI 0ROHFXODU *HQHWLFV DQG 0LFURELRORJ\ FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ AFRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LIH IXOO\ DGHTXDWH LQ VTSSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'GFWRU RI 3K5HARSK\ :LOOLDP : +DXVZLUWK (PLQHQW 6FKRODU 0ROHFXODU *HQHWLFV DQG 0LFRURELRORJ\ FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ V R X0 6XH $ 0R\HU 3URIHVVRU RI 0ROHFXODU *HQHWLFV DQG 0LFURELRORJ\ FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ +DUU\ 1LF $VVRFLDIHn3URIHVVRU RI %LRFKHPLVWU\ DQG 0ROHFXODU %LRORJ\

PAGE 191

7KLV GLVVHUWDWLRQ ZDV VXEPLWWHG WR WKH *UDGXDWH )DFXOW\ RI WKH &ROOHJH RI 0HGLFLQH DQG WR WKH *UDGXDWH 6FKRRO DQG ZDV DFFHSWHG DV SDUWLDO IXOILOOPHQW RI


104
Figure 14 shows the results of one such experiment. To examine any
possible protein/DNA interaction on the coding strand that involved G residues,
the DNA was digested with Accl restriction enzyme which cuts at position -402.
This site was chosen because it is only 80 bp away from the 5' boundary of the
"wild-type" plasmid used throughout these studies. In addition, it was the only
upstream cutting site that does not have another site within 300 bp, upstream or
downstream of that position. An EcoRV restriction enzyme was used to cut at
the downstream site of the gene to examine the non-coding strand. The EcoRV
site is at position -111 with respect to the transcriptional start site and only eleven
base pairs upstream of the putative TATA site. The primers AL82 and AL104
(see Table 3, Materials and Methods) were used to generate probes for the
coding and non-coding strand respectively. Single-stranded DNA was obtained
from the phagemid vectors pSL123 and pSL123R. These two plasmids have the
entire CIT1 upstream sequence, in opposite orientations, which is present on the
p5-498 plasmid. In pSL123, the coding strand was on the (+) strand; therefore
single-stranded DNA from this clone was used as the template to prepare the
probe for the non-coding strand. Single-stranded DNA from pSL123R was used
as the template to prepare the probe when analyzing the coding strand. As
stated earlier, there is a perfect match to the consensus binding site for the
Hap2p/Hap3p/Hap4p trimeric transcriptional activators between positions -192
and -185 The core of this consensus binding site contains the CCAAT box
sequence present in most mammalian genes. Lanes 1 and 8 thru 11 (Figure 14)
represent the sequence ladder generated from naked DNA using the method of


181
Zhang, L. and Gurante, L. (1994). Evidence that TUP1/SSN6 has a positive
effect on the activity of the yeast activator HAP1. Genetics 136, 813-817.
Zhou, K., Brisco, P.R.G., Hinkkanen, A.E., and Kohlhaw, G.B. (1987). Structure
of yeast regulatory gene LEU3 and evidence that LEU3 itself is under general
amino acid control. Nucleic Acids Research 15, 5261-5273.
Zubiaga, A. M., Belasco, J. G., and Greenberg, M. E. (1995). The nanomer
UUAUUUAUU is the key Aurich sequence motif that mediates mRNA
degradation. Mol. Cell. Biol. 15, 2219-2230.


identified several upstream activating sequences (UASs) that positively affected
the transcription of the gene. Near the distal (5') end of the insert there is also an
upstream repressing sequence (URS) that affects the transcription. Another
URS element was found at the proximal end of the 5' non-coding region that
affected transcription only in glucose medium. These results suggest a
combinatorial regulation of CIT1 by different factors in a carbon source-
dependent and -independent manner. A second level of carbon source-
dependent control was the regulation of the stability of the mRNA in the different
growth media. In ethanol medium, the half-life of CIT1 mRNA was more than
twice that in glucose medium. Deletion analysis showed that the first 78
nucleotides of the 5' coding region of the mRNA contain a sequence element that
is necessary and sufficient for glucose-dependent mRNA degradation.
Introduction of a stop codon at the fifth amino acid position also caused rapid
degradation of the hybrid mRNA, showing that it contained all the elements that
were sufficient to confer nonsense-mediated decay.
These results demonstrate an example of metabolic regulation of gene
expression occurring at two levels, transcription and mRNA stability, each
contributing a portion of the overall regulation.
vii


94
1 2 345 6789 10


39
was ligated with plCZ312 vector which had already been digested with Smal and
Xhol restriction enzymes. This digestion removed the UAScyci. Ligation was
performed overnight at 16C in 1X ligase buffer (66 mM Tris-HCI, pH 7.6; 6.6 mM
MgCI2; 10 mM DTT; 66 pM ATP) with 1 U of T4 ligase. Ligation mixture was
used to transform into competent E. coli cells. Transformants were analyzed by
isolating plasmid and digesting with the Sphl restriction enzyme. Recombinants
were subsequently confirmed by sequencing using the Sequenase kit (US
Biochemical). DNAfrom confirmed recombinants was linearized with Stul
enzyme and transformed into yeast and plated on the appropriate selective agar
plate. Digestion of the DNA directs integration at the URA3 locus. The number
of integration was determined by performing Southern analysis as described
earlier.
Measurement of B-Galactosidase Level in CIT1-lacZ Fusion
Cells were grown to either early logarithmic phase (OD600 ~ 1.0) or
stationary phase (OD600 ;> 20.0) and 10 ml of culture was harvested by
centrifugation at (2,780 X g) in a Sorvall (Dupont) desktop centrifuge for 5
minutes. The supernatant was decanted and the pellet was resuspended in 10
ml water. The cells were centrifuged again at (2,780 X g) in the Sorvall clinical
centrifuge for 5 minutes,and the supernatant was decanted. The pellet was
resuspended in 1 ml 10 mM Tris-HCI, pH 7.4 plus 1 pi 100 mM PMSF and
transferred the cells into round bottom 13 ml centrifuge tube (Starstedt). To


124
nucleotides of CIT1 mRNA on the fusion mRNA contain sequences sufficient to
confer the wild-type decay pattern, including glucose instability. The similarity in
decay kinetics of the fusion mRNA and the wild-type mRNA makes it valid to use
the results of the fusion mRNA to define sequences that are necessary and
sufficient for the decay of CIT1 mRNA. However, this does not rule out the
possibility that there may be other sequences on the CIT1 mRNA that could carry
out a similar function. Heaton et al., (1992) showed that there are two regions,
codons 13 to 179 and the 3' untranslated region (UT) in the STE3 gene, which
encodes a-mating factor, capable of mediating rapid decay of the mRNA. Either
one of these regions by itself was able to mediate rapid decay of STE3 mRNA if
the other region was deleted. This shows that there are redundant sequences in
some mRNA species to carry out the same function.
It may also be possible that there are sequences in the lacZ mRNA that
confer glucose instability to the fusion RNA. To test this possibility as the cause
of rapid decay, I tested another fusion mRNA between TPI1::lacZ (gift from Dr. H.
Baker). In this fusion, there are approximately 900 bp of TPI1 coding sequence
fused in frame to the lacZ gene. The results of this experiment are shown in
Figure 20. The product of this fusion behaved quite differently from the
CIT1::lacZ fusion mRNA. The decay rates of the TPI1::lacZ fusion in YPD and
YPE are very similar (tH> 40 minutes). The half-life of TPI1 was recently
reported to be 11.5 minutes and 30 minutes in a minimal medium with either
low-iron concentration or high-iron (Krieger and Ernst, 1994). The half-life of
mRNA transcribed from the PGK1 (encodes phosphoglycerate kinase) is about


98
competitor A BCD
I II II II I
fmole competitor P 30 60 300 30 60 300 20 100 20 100
1 234 567891011


49
minutes and 5 minutes in a microcentrifuge and the supernatants of both
centrifugations were pooled. Isopropanol (700 pi) was added to each and
centrifuged for 20 seconds to collect theDNA pellet. The pellet was rinsed with
95% ethanol, decanted supernatant and allowed to air dry. Each pellet was
resuspended in 300 pi of TE pH 8.0. The divided samples were pooled and
treated with 10 pi 10 pg/pl RNase A at 37C for at least 2 hours to digest RNA.
Aliquots (3 pi) of 1 M spermidine, pH 7.0 were added to each sample until a DNA
precipitate appeared. It usually took about 2-3 aliquots to precipitate DNA.
Samples were set on ice for 15 minutes and centrifuged 20 seconds to collect
DNA. Supernatants were decanted and pellets were allowed to air dry. The
DNA pellet was dissolved by adding 300 pi 3 M ammonium acetate to the pellet
and incubating at 65Cfor at least 4 hours. Absolute ethanol (750 pi) was added
and each sample was held at -70C for 15 minutes to precipitate the DNA. DNA
was collected by centrifuging for 15 minutes in a microcentrifuge and decanting
the supernatant. The pellets were rinsed with 70% ethanol, dried in vacuum and
resuspended in 200 pi water. The DNA was digested with either Accl or EcoRV
to analyze the coding strand or the noncoding strand, respectively. After
digestion, the DNA was precipitated and washed three times to remove residual
salts. First, one-half volume of 7.5 M ammonium acetate was added to the
sample plus 1.5 volume ethanol. Samples were set in a dry-ice ethanol bath for
10 minutes to precipitate, then centrifuged for 15 minutes in a microcentrifuge
and the supernatants were decanted Pellets were resuspended in 200 pi TEN
(10 mM Tris-HCI, pH 8.0; 1 mM EDTA; 100 mM sodium chloride), then 100 pi 7.5


42
stopped by adding equal volume of prewarmed (48C) medium to the culture,
and immediately transferring the culture to a 36C water bath. Chemical
inhibitors, such as thiolutin (generous gift from Dr. S. Kadin, Pfizer Inc. Groton
CT.) (Jimenez et al., 1973) and 1,10-phenanthroline (Santiago et al., 1986), were
also used to stop transcription in separate experiments. Thiolutin was dissolved
in DMSO and used at a final concentration of 3 pg/ml and 1,10-phenanthroline
was prepared in ethanol at 10 mg/ml and used at a final concentration of 100
pg/ml.
Ribonuclease Protection Assay
To show that the p-galactosidase activity from the different deletion
constructs reflects the steady-state mRNA level, ribonuclease protection assays
were performed on total yeast RNA isolated from yeast strains harboring
selected deletion constructs. A radiolabeled cRNA from the lacZ gene was
prepared from pSL001 plasmid. pSL001 plasmid was constructed by subcloning
a EcoRV/Clal fragment from p5-498 into pBluescript KS+ cut with the same
enzymes. This EcoRV/Clal fragment contains an 817 bp of the 5' coding region
of lacZ gene and 287 bp of CIT1 sequences which include the first 178
nucleotides of CIT1 RNA and the TATA element. To prepare the probe, the
plasmid was linearized with Ddel restriction enzyme, which cuts within the lacZ
gene, and transcribed with a T3 RNA polymerase at 37C for 1 hour. This
generated a probe that was approximately 300 nucleotides long. At the end of


138
CIT1 LacZ
B
YPD
Time (min)
CIT1::LacZ
cm
+
+
+
+
+
+ - -
o
o
o
o o o
O
o
o
in
T
CM
CO O LO t CM
CO
C
CD
C
c
'co
E
Q>
<
z
cr
E
TIME (MIN)


153
nutrients, so that biosynthesis of intermediates becomes important. The low
availability of amino acids signals the cell to synthesize these precursors and
could trigger increased CIT1 expression. This scenario highlights the presence
of the putative GCN4 binding site as a potential regulator of CIT1. We have
noted a potential protection of the Gcn4p site in vivo (Figure 14). Experiments to
pursue this finding further should include preparing a gcn4 mutant strain,
preferably isogenic with that used in this study and transforming the various
deletion constructs into it to determine the effects of this regulator on expression
of the fusion and CIT1 genes. Another experiment to be performed includes
mutating the putative GCN4 binding sites on the CIT1 upstream sequence and
transforming the plasmid bearing the mutation into yeast. Transformants would
be grown in minimal medium and assayed for P-galactosidase levels. Reduction
of P-galactosidase levels especially in minimal media in a strain carrying the
mutant plasmid would be a strong indication that the sites are important for
regulation, perhaps by binding to the Gcn4p transcriptional activator.
HAP2/HAP3/HAP4 Independent Expression of CIT1
Sequence analysis revealed that there was a perfect match to the
consensus binding site for the Hap2p/Hap3p/Hap4p activator centered between -
192 and -185. This activator was first reported to be involved in the regulation of
the CYC1 gene (Guarente et al., 1984; Pinkham and Guarente, 1985; Olesen et
al., 1987; Pinkham et al., 1987; Forsburg and Guarente, 1988) at the UAS2 site.


118
A fragment of the CIT2 gene was also hybridized to the RNA after transfer
onto a membrane. CIT2 encodes the peroxisomal isozyme of citrate synthase.
Figure 18a shows the amount of CIT2 mRNA remaining after shift to the
nonpermissive temperature. Figure 18b is a semi-logarithmic plot of percent
mRNA remaining as a function of time. The rate of decay and level of expression
of the CIT2 mRNA is quite different from the CIT1 mRNA. These two genes
share about 83% identical amino acids or conserved changes (Rosenkrantz et
al., 1986). There is very little decay of this message in either YPD and YPE.
The expression of CIT2 is higher in a glucose medium compared to an ethanol
medium. This is in agreement with the report of Liao et al. (1991) who used a
ribonuclease protection assay to quantitate the mRNA, so may have missed the
double bands shown on the Northern analysis. Flowever, Kim et al. (1986)
showed the presence of double bands when they performed Northern analysis.
Thus, decay of CIT1 mRNA is restricted to the mitochondrial isoform in glucose.
CIT1::lacZ Fusion mRNA Has a Similar Decay Rate As Full-Length CIT1
As stated earlier in the Materials and Methods section, the CIT1::lacZ
fusion, constructed to study the transcriptional regulation, has approximately 178
nucleotides of CIT1 mRNA (78 nucleotides of coding region plus 100 nucleotides
of 5' untranslated region). In order to determine if this fusion mRNA behaved
similarly to the full-length CIT1 mRNA in both media, RNA was isolated from the


112
in the sample dye solution, or ii) probing for 18S rRNA with a DNA probe.
Whenever there was a significant difference in loading, as shown by either
method, the ratio of CIT1 over 18S was used as the basis for calculating the
quantity of RNA at each spot. Figure 15b shows the half-life of CIT1 mRNA
under different growth conditions. The half-life of CIT1 mRNA isolated from
cultures grown in a YPD medium (approximately 8 minutes) was shorter than
mRNA isolated from cultures grown in a YPE medium (approximately 20
minutes). Half-lives were determined by plotting the percent of mRNA remaining
at the different time points as a ratio of the zero time sample on a semi-
logarithmic scale. This assumes first-order decay kinetics. These results
suggest that a greater than two-fold difference in the expression of CIT1 may be
due to the increased rate of mRNA decay in a glucose medium.
The work of Lombardo et al. (1992) showed that when RNA was isolated
from cells that were initially grown in an ethanol medium, but subsequently
shifted to YPD, the decay rate changed drastically. The decay rate was faster if
glucose was added to the medium than if it was maintained in YPE. I wanted to
know if the same phenomenon occurs with the CIT1 message. The strategy
employed to adjust the glucose concentration to 2% after initial growth in YPE
(2%) medium is depicted in Figure 16. Cells were initially grown in a YPE (2%),
then at the time of transcriptional inhibition an equal volume of pre-warmed
(48C) YPD (4%) medium was added. This made the glucose concentration 2%,
the same amount as in the standard growth medium (Figure 17). When the
medium was adjusted as described, the rate of decay became even faster than


26
similar to the wild-type mRNA. This finding suggested that some sequences
downstream of the nonsense codon may be required for the rapid decay. By
introducing nonsense mutations throughout the PGK1 gene, Peltz et al. (1993)
were able to show that a "downstream element" was necessary to cause rapid
decay. This "downstream element" functions in an orientation dependent
manner.
Other genes required for rapid degradation of specific mRNAs include the
UME2 and UME5 genes (Surosky et al., 1994). These genes are required for
rapid decay of meiosis specific genes in a medium containing glucose. How
these trans factors target specific mRNA for decay is not known, but they could
serve as molecular tags that designate the mRNA for decay when bound at their
recognition site.


170
Flick, J.S. and Johnston, M. (1990). Two systems of glucose repression of the
GAL1 promoter in Saccharomyces cerevisiae. Mol. Cell. Biol. 10, 4757-4769.
Flick, J.S. and Johnston, M. (1992). Analysis of URSG-mediated glucose
repression of the GAL1 promoter of Saccharomyces cerevisiae. Genetics 130,
295-304.
Forsburg, S.L. and Guarente, L. (1988). Mutational analysis of upstream
activation sequence 2 of the CYC1 gene of Saccharomyces cerevisiae: a
HAP2-HAP3- responsive site. Mol. Cell. Biol. 8, 647-654.
Forsburg, S.L. and Guarente, L. (1989). Identification and characterization of
HAP4: a third component of the CCAAT-bound HAP2/HAP3 heteromer. Genes.
Dev. 3, 1166-1178.
Gancedo, C. and Gancedo, J. M. (1985). Phosphorylation of 3-O-methyl-D-
glucose and catabolite repression in yeast. Eur. J. Biochem. 148, 593-597.
Gangloff, S.P., Marguet, D., and Lauquin, G.J.M. (1990). Molecular cloning of the
yeast mitochondrial aconitase gene (AC01) and evidence of a synergistic
regulation of expression by glucose plus glutamate. Mol. Cell. Biol. 10,
3551-3561.
Georgakopuolus, T. and Thireos, G. (1992). Two distinct yeast transcriptional
acitvators require the function of the GCN5 protein to promote normal levels of
transcription. EMBO J. 11, 4145-4152.
Gill, G. and Tjian, R. (1991). A highly conserved domain of TFIID displays
species specificity in vivo. Cell 65, 333-340.
Giniger, E. and Ptashne, M. (1987). Transcription in yeast activated by a putative
amphipathic a helix linked to a DNA binding unit. Nature 330, 670-672.
Giniger, E., Varnum, S.M., and Ptashne, M. (1985). Specific DNA binding of
GAL4, a positive regulatory protein of yeast. Cell 40, 767-774.
Guarente, L. (1987). Regulatory proteins in yeast. Ann. Rev. Genet. 21, 425-452.
Guarente, L. (1992). Messenger RNA transcription and its control in
Saccharomyces cerevisiae. In The Molecular and Cellular Biology of the Yeast
Saccharomyces. J. R. Broach, J. R. Pringle, and E. W. Jones, eds (Cold Spring
Harbor Laboratory Press), vol 2, pp. 49-98.


44
phase was transferred to a fresh microcentrifuge tube containing one microliter of
10 pg/pl yeast tRNA plus 1 ml absolute ethanol. Precipitation was carried out at -
20C for 30 minutes. Samples were centrifuged in an Eppendorf centrifuge for
15 minutes at 4C. The supernatant was decanted and the pellet washed once
with 70% ethanol, dried in vacuum and resuspended in 10 pi RNA sample buffer
(95% Formamide; 0.0025% bromophenol blue; 0.0025% xylene cyanol).
Samples were heated at 75C for 5 minutes and loaded in a 6% (19:1)
polyacrylamide gel. The bromophenol blue dye ran about two-thirds the length of
the gel before electrophoresis was stopped. The gel was dried and exposed to
X-ray film. Relative 32P content for each sample was quantitated by exposing
the dried gel to a Phosphor-Imager screen (ABI).
Northern Analysis
For northern analysis, 10-15 pg of total RNA was precipitated with one-
tenth volume 3 M sodium acetate, pH 5.3 plus 2.5 volumes of absolute ethanol
and centrifuged in a microcentrifuge for 15 minutes, and the supernatant was
decanted. The pellet was washed with 70% ethanol and dried in vacuum. Two
microliters of water were used to resuspend the pellet and 8.8 pi of sample mix
was added to the sample. Sample mix consisted of 50% formamide; 0.22 M
formaldehyde; 1 X MOPS (0.2 M MOPS; 0.05 M sodium acetate; 0.001 M
EDTA); 40 pg/pl ethidium bromide. The sample was heated at 65C for 15
minutes, chilled on ice for few minutes, then 1 pi dye mix was added and the


Figure 9. Steady state mRNA level of selected deletion constructs. (A) 15
(jg of total RNA was hybridized in solution to radiolabeled cRNA probes for lacZ
and ACT1 genes simultaneously. After hybridization, samples were digested
with RNase A and RNase T1 and resolved on 6% Long Ranger gel (AT
Biochem). Lane M is end labeled RNA molecular weight marker (1.77 to .155
kb) (Life Technologies). Lanes 1-8 are samples from selected deletion
constructs as shown. In lane 9, RNA was isolated from strain that does not
harbor any plasmid carrying the lacZ gene. In lane 10, RNA was isolated from
an isogenic strain that carry a plasmid bearing TPI::lacZ fusion (Courtesy Dr. H.
Baker). (B) Graphical representation of the net cpm of each sample obtained by
exposing the gel to a Phosphor-Imager screen (Molecular Dynamics).


48
temperature for 5 minutes. The supernatant was decanted and the pellet
resuspended in 10 ml of growth medium. The suspensions were then divided
into ten 1 ml aliquots in an Oakridge centrifuge tubes. Two microliters of
concentrated dimethyl sulfate (DMS) was added to each aliquot, which were held
at room temperature for varying amounts of time, ranging from 2 minutes to 10
minutes. At the end, 40 ml ice cold TEN (10 mM Tris-HCI, pH 8.0; 1 mM EDTA;
and 40 mM sodium chloride) solution was added to each to stop the reaction.
Cells were centrifuged at 5,000 rpm in a JA- 20 rotor at 4C for 5 minutes and
supernatant was decanted. Pellets were resuspended in 1 ml 1 M sorbitol/0.1 M
EDTA plus 2 pi (3-mercaptoethanol. To form spheroplasts, 200 pi 5 mg/ml
mureinase (1509 BGX units/g, US Biochemical) was added to each cell
suspension. These were incubated at 37C with gentle shaking until
spheroplasts were formed. This usually took approximately 30-40 minutes.
Spheroplast formation was determined by adding 50 pi of cell suspension to 500
pi 0.1% SDS and measuring the change in absorbance at OD600. Reduction in
absorbance by 90% was considered an acceptable level before DNA isolation
was performed. Spheroplasts were collected by centrifuging for 1 minute,
decanting the supernatant and resuspending the pellet in 1 ml 50 mM Tris-HCI
pH 8.0/20 mM EDTA. The sample was divided into two halves and transferred
into microcentrifuge tubes. Fifty microliters of 10% SDS were added to each half
which was incubated at 65C for 30 minutes to lyse spheroplasts. Two hundred
microliters 5 M potassium acetate, pH 8.0 were added to each and samples were
incubated on ice for 60 minutes. Samples were centrifuged sequentially for 10


Band Shift Assay and In Vitro Footprint Analysis 91
In Vivo Footprint Analysis 103
CIT1 mRNA is More Stable in Cells Grown in Ethanol Than in
Cells Grown in Glucose 108
CIT1::lacZ Fusion mRNA Fias a Similar Decay Rate As Full-Length CIT1
118
CIT1 mRNA From Cells Grown in YPD and YPE Media Flave
Identical 5' Mature Ends 127
The Glucose-Dependent Instability Element Lies Within the CIT1
Coding Region 130
Sequences Within the 5' Terminus of CIT1 mRNA Confer
Nonsense-Mediated Decay 136
SUMMARY AND DISCUSSION 140
C/s-acting Elements 142
Nutrient Requirement on the Expression of CIT1 151
HAP2/HAP3/HAP4 Independent Expression of CIT1 153
mRNA Stability 157
Future Goals 164
BIBLIOGRAPHY 167
BIOGRAPHICAL SKETCH 182
v


130
ends between YPD and YPE cultures, the GDIE lies within the 178 nucleotides of
transcript from the CIT1 gene.
Another primer extension reaction was performed to identify the 5' mature
end of the CIT1::lacZ fusion transcripts. An oligonucleotide (AL205) that can
anneal only to a plasmid specific transcript containing the lacZ message was
used to prime the reverse transcription. Results from this experiment (data not
shown) indicated that similar 5' mature ends were obtained from the plasmid
carrying the fusion gene. The less abundant mRNA species furthest from the
major product were not seen, either because they were not synthesized or the
quantity synthesized was too low to visualize.
The Glucose-Dependent Instability Element Lies Within the CIT1 Coding Region
The similar decay rates between full length CIT1 and the fusion mRNA
revealed that the 178 nucleotides of CIT1 message present on the fusion mRNA
was sufficient to confer the rapid decay in glucose-containing medium. In an
attempt to identify the exact sequences that contain the glucose response
element, 100 nucleotides of noncoding region and 78 bases of coding region
were individually dissected from the rest of the fusion mRNA. Decay rates of
these deletion mutants were then determined as described in Materials and
Methods.
Deletion of the noncoding region, leaving the bona fide major 5' mature-
end 102 nucleotides upstream from the AUG start codon, did not affect the decay


61
Table 4. Plasmids Used in this Research
Designation
Construction
pSH18-8
Approximately 970 bp of CIT1 sequence, consisting of 78 bp
of coding region and sequences further upstream in pUC18
(New England Biolab) cut with Smal
YCpZ-2
A yeastIE. coli shuttle vector used to carry all deletion
constructs. See Rickey (1988)
p5-498
Approximately 670 bp of CIT1 sequence contained in
pSH18-8 following exonuclease digestion was subcloned in
YCpZ-2 cut with BamHI/Smal.
pSL001
A 1.1 kb EcoRV/Clal from p5-498 that consists of 817 bp of
5' lacZ sequence and approximately 290 bp of CIT1
sequences from -111 to +78, subcloned into pBluescript KS+
(Strategene) cut with EcoRV/Clal.
pSL123
Approximately 670 bp EcoRI fragment from p5-498
consisting entirely CIT1 sequence sucloned into pBluescript
KS+ cut with EcoRI.
pSL123R
Similar to pSL123, the insert is in reverse orientation.
pGEM-Actin
A 563 bp internal Clal fragment from ACT1 gene subcloned
into pGEM 4 (Promega) cut with same enzyme (generous
gift from Dr. R. Butow).
plCZ312
Generous gift from Dr. Alan Myer.
YISL101
Approximately 380 bp of CIT1 5' upstream sequence from
pSL123 subcloned into plCZ312 cut with Smal/Xhol.
YISL101R
Similar to YISL101R; the insert is in reverse orientation.
YISL111-139X
Double stranded oligonucleotide corresponding to sequences
between -139 to -111 was annealed and subcloned into
plCZ312 digested with Xhol.
YISLA1-99
Similar to p5-498 except that sequences between 1 to 99 bp
of CIT1 sequence have been deleted.
YISLA100-178
Similar to p5-498 except that sequences between 100 to 178
bp of CIT1 sequence have been deleted.


141
coding region of the CIT1 gene. This sequence conferred an identical decay
pattern to the E. coli lacZ gene in a CIT1::lacZ fusion. The identical decay
pattern of both full length CIT1 mRNA and the CIT1::lacZ fusion mRNA
suggested that decay of CIT1 mRNA may not require initial poly(A) shortening as
the first step in the decay pathway of the entire message as has been
demonstrated for several yeast genes ( Heaton et al., 1992; Decker and Parker,
1993). Initial poly(A) shortening requires RNA sequences near the 3' of the
message; however, in this fusion, the 3' end consists of only lacZ mRNA which
does not have the yeast recognition sequence to mediate such an effect.
Introduction of a premature translational termination signal (UGA) within the first
few codons of the CIT1 gene caused rapid decay in both ethanol and glucose
cultures, suggesting that the CIT1 sequences present in the fusion gene have the
signal necessary and sufficient to cause nonsense-mediated decay as well.
Nonsense-mediated decay involves rapid decay of a mRNA with an early stop
codon. It has been shown for the PGK1 gene, which encodes phosphogylcerate
kinase, that the rate of decay may be accelerated 12-fold upon introduction of a
stop codon within the first 6% of the protein coding region (Peltz, et al., 1993).
However the rapid decay was relieved when this mutant gene was introduced
into a strain carrying the upf1 mutation (Peltz, et al., 1993) The UPF1 gene is a
trans-acting factor that has been shown to be required for rapid decay (Leeds et
al., 1991; Leeds et al., 1992). In addition to being involved in the rapid
degradation of mRNA with a premature termination signal, nonsense-mediated


Figure 10. Bandshift of -245 to -111 fragment. Approximately 12 pg of crude
yeast extract from glucose-grown cells was incubated with approximately 2 fmole
of end-labeled 135 bp CIT1 DNA fragment. There was no extract in lanes 1 and
11. Lanes 2 through 10 had increasing amounts (1 pi to 9 pi) of extract.


2
other in in vitro assays. In vivo studies have shown that JUN can complement a
gcn4 mutation in yeast (Struhl, 1988). Yeast is particularly useful for studying
mitochondrial enzymes because it is a facultative anaerobe: mutations
eliminating aerobic energy metabolism are not lethal but can be identified by their
inability to grow on glycerol plates.
The Citrate Svnthase System
Citrate synthase catalyzes the first committed step of the tricarboxylic acid
cycle (TCA), the condensation of oxaloacetate and acetyl CoA. The role of this
pathway in cellular metabolism is twofold. First, the TCA cycle provides the
carbon skeletons used in many biosynthetic pathways such as the synthesis of
glutamate and aspartate. Second, the cycle is oxidative, generating NADH,
which drives the synthesis of ATP. Two different nuclear genes code for
isozymes of citrate synthase (Suissa et al., 1984; Kim et al., 1986; Rosenkrantz
et al., 1986; Rickey and Lewin, 1986). They are CIT1 and C/T2, encoding the
mitochondrial and peroxisomal pathway enzymes, respectively (Lewin et al.,
1990). The CIT2 gene product is involved in the glyoxylate pathway that
produces carbon skeletons for other biosynthetic pathways. The difference in the
cellular location of these two enzymes lies in the N-terminal mitochondrial
targeting sequence on Citlp that is lacking in Citp2 (Rosenkrantz et al., 1986). In
strains in which the CIT1 gene is disrupted, cells still grow on non-fermentable
carbon sources, and some citrate synthase activity is found in the mitochondrial


127
45 minutes (Herrick et al., 1990) in a complex medium. Phosphoglycerate kinase
is another glycolytic enzyme. However, the important point is that the CIT1::lacZ
fusion mRNA behaves differently from TPI1::lacZ fusion mRNA. This leads to
the conclusion that the lacZ mRNA sequence does not cause the glucose
dependent decay seen with the CIT1::lacZ fusion mRNA.
CIT1 mRNA From Cells Grown in YPD and YPE Media Have Identical 5' Mature
Ends
The similar rates of decay of both full length CIT1 and fusion mRNA
suggested that there is a glucose-dependent instability element (GDIE) on the
CIT1 message that lies on the 5' portion of the message. Differential
transcriptional start sites between the two media could produce mRNA's having
different sequences at their termini that could target them to different decay
pathways in either medium. In order to assess this, I did primer extension on the
total RNA isolated from cultures containing either YPD or YPE using AL41 as
described in Materials and Methods.
Figure 21 shows the results of this experiment. Multiple start sites were
observed from the extension products. There was no detectable difference in
amount or position in mature ends of CIT1 messages from cells grown in YPD or
YPE. The major band corresponds to a 5' mature end that is 103 nucleotides
upstream from the AUG. Interestingly, the major start site lies at the central
nucleotide of a 13 bp palindrome. Because there was no difference in 5' mature


154
Other genes that also have the consensus binding site for these heteromeric
protein include COX5a (Trueblood et al., 1988) and COX6 ( Trawick et al., 1989;
Trawick et al., 1992) in the electron transport chain and AC01 (Gangloff et al.,
1990), LPD (Bowman et al., 1992; Sinclair et al., 1994) and KGD2 (Repetto and
Tzagoloff, 1990) in the TCA cycle.
To analyze the role of the Hap2p/Hap3p/Hap4p heteromeric activator in
the regulation of CIT1, I deleted the region containing the consensus binding site
in the fusion gene and determined the effect it had on expression of the fusion
gene. In this deletion, pA160-200, the activity was reduced by two-thirds in YPE
compared to the wild-type, but did not show any reduction in the YPD medium
(Figure 25), suggesting that it has an activating function in CIT1 expression,
especially under derepressing conditions. The level of reduction upon mutation
of Hap proteins binding sites amongst the various affected genes has been
variable. They range from greater than ten-fold reduction (CYC1) (Guarente and
Mason, 1983) to slightly below 50% of wild-type COX6 (Trawick et al., 1992).
Another means I used to evaluate the effect of Hap2p/Hap3p/Hap4p was to
transform either a wild-type HAP or a hap2 null mutant strain with the entire CIT1
UAS available in the p5-498 clone. There was a strong orientation-dependent
effect on the expression of /acZ, especially under repressing conditions. There
was about a four-fold reduction in the specific activity expressed from the reverse
orientation UASc/ri in the hap2 strain compared to the wild-type (Figure 6).
However, in the forward orientation there was less than a 50% reduction in
specific activity from the HAP2 strain to the hap2 strain (Figure 6). When the


Figure 23. Half-life of CIT1::lacZ fusion mRNA with CIT1 5' coding region
deletion. (A) Schematic representation of the CIT1::lacZ fusion. The CIT1
sequences present is filled with hatch mark and the deleted sequence is unfilled.
lacZ sequence is completely filled. (B) Autoradiogram of Northern gel analysis.
Total RNA was isolated from strain carrying the plasmid that has the 5' coding
region deleted. 15 pg of total was separated as described in Figure 15. The
membrane was hybridized simultaneously with CIT1 and lacZ gene probes. The
(+) or (-) sign indicate whether the culture was maintained in YPE (-) or adjusted
to make it YPD (2%) (+). (C) Semi-log plot of % mRNA remaining as a function
of time.


54
reaction was performed as described above. The annealing temperatures for
AL82/AL85 and AL84/104 were 47C and 51 C, respectively. One of each pair of
primers was end labeled with T4 polynucleotide kinase before the PCR reaction
to make sure that only one end was labeled. The two probes were used instead
of a single probe that encompasses the entire region, because preliminary
experiments showed that a single fragment alone would not migrate into a 4%
(39:1) nondenaturing polyacrylamide gel very well. Similar PCR products as
described earlier or double stranded oligonucleotides were used for competition
assay. The oligonucleotides were annealed by mixing equimolar amounts of
each strand in 10 mM Tris-HCI, pH 8.0/ 5 mM MgCI2. The reaction mixture was
boiled for 5 minutes and allowed to slowly cool to room temperature.
To identify the exact sequences involved in the bandshift assay, a DNase I
protection assay was performed on both sets of probes. After the standard
bandshift assay, 1 pi 20X DNase buffer and 1 pi 1 U/pl RQ1 DNase I (Promega
Corporation), were added to the reaction mixture and permitted to digest for 45
seconds. The reaction was then stopped by adding 1 pi 0.5 M EDTA. The
sample was loaded into a 4% (39:1) polyacrylamide gel and run as described
above. At the end of the run, the wet gel was then exposed to an X-ray film
overnight at room temperature. The bands were then excised and DNA eluted
onto a DEAE cellulose membrane in an agarose gel. The DNA was recovered
from the DEAE membrane by incubating it at 65C with high NET (1.0 M sodium
chloride; 0.1 mM EDTA; 20 mM Tris-HCI, pH 8.0) for 45 minutes. The eluate was
transfered into a fresh microcentrifuge tube and precipitated with 1 ml absolute


7
defined as the minimum discrete sequence that binds to a transcriptional factor.
Yeast cells lack enhancers such as those of mammalian cells but instead contain
upstream activating sequences (UAS) that bind activating proteins (Guarente,
1987; Struhl, 1993). Unlike enhancers elements, UASs can only function when
placed upstream from the transcriptional start site (Guarente and Hoar, 1984).
The UASs usually function in either orientation when situated between 20-1500
bp from the TATA element. They are usually 9-30 bp in length and may or may
not have a dyad symmetry. Those with dyad symmetry usually bind to
homodimers or heterodimers of a specific activator. Therefore, UAS elements
resemble proximal promoter elements such as Sp1 sites more than they do true
enhancers. Operators or upstream repressing sequences (URS) bind to
negative acting trans-acting factors and repress gene expression. These
elements usually lie between the UAS and the TATA elements and prevent
activation by activators, but have also been shown to lie up to 2 kb upstream or
downstream of the mRNA initiation site (Brand et al., 1985) and still affect
transcription. Binding to UAS or URS may be mutually exclusive if they have
overlapping sequences or they may be independent of one another.
Trans-acting factors constitute the second class of transcriptional
regulatory elements. These are proteins that bind to DNA at specific sites. The
RNA polymerase II and ancillary proteins such as TFIIA thru F make up the basic
transcriptional machinery. The RNA polymerase II of yeast has 12 subunits
(Thuriaux and Sentenac, 1992); the largest subunit (220 kD) is encoded by the
gene RPB1. This subunit is similar to the largest mammalian subunit and shares


51
and hybridization carried out overnight at 60C with shaking. Radiolabeled probe
was prepared by primer extension on a single-stranded DNA template with a
complementary oligonucleotide using the Klenow fragment of DNA polymerase I.
After hybridization, the membrane was washed three times at the hybridization
temperature. The wash solution consisted of 1 % SDS; 40 mM sodium
phosphate, pH 7.4; 1 mM EDTA.
Preparation of Sinale-Stranded DNA
Single-stranded DNA was prepared from pSL123 and pSL123R, to serve
as a template in generating probes for in vivo footprint analysis. These two
plasmids contain the upstream sequences of p5-495 in opposite orientations at
the EcoRI site on a phagemid plasmid. The single stranded DNA generated from
either plasmid would be complementary to either the coding (pSL123R) or
noncoding (pSL123) strands of CIT1. An isolated colony of XL1 Blue strain
containing the plasmid was grown in 2.5 ml of super broth containing 12.5 pg/ml
of tetracycline and 100 pg/ml of ampicillin overnight at 37C with vigorous
shaking. Two and half milliliters of the overnight culture was added to 50 ml
super broth in a 500 ml flask and grown until the OD600 reached 0.3. VCS-M13
helper phage was added at an MOI (multiplicity of infection) of 20:1 and
incubation continued for an additional 8 hours. The culture was heated at 65C
for 15 minutes and centrifuged at 9,500 rpm in JA20 rotor at room temperature.
The supernatant was transfered to a new tube and centrifuged again as above.


164
nutritional requirements also affect the level of CIT1 expression. The signal for
this control in not known but may be due to the availability of certain amino acids.
Future Goals
To characterize the transcriptional regulation of the CIT1 gene more
precisely several experiments need to be performed. One of these experiments
would involve site directed mutagenesis within the regions that were individually
shown to possess activation capability. The site directed mutagenesis could be
done on the entire upstream fragment of the CIT1 gene, or on the smaller
fragments that were shown to activate a heterologous gene. Mutagenesis that
identifies a core sequence required for transcriptional regulation would enable us
to identify other genes that may be regulated by a common factor. This would be
done by performing a computer search to see if there are other genes that have
a similar recognition site or by using DNA sequence as a binding probe.
Site directed mutagenesis would also be performed on the putative URS
sequence identified between -139 and -111 of the CIT1 5' nontranscribed region.
The mutagenesis would help define the indispensable sequences required for
this regulation. A further characterization to show that the -139 to -111 region
contains a glucose-dependent URS element would require subcloning this region
into the promoter of a gene that is not regulated by glucose like the CYC1 gene.
To understand regulation of CIT1 mRNA turnover by glucose, further
deletion of the c/s-element needs to be done to identify the minimum sequence


52
One-fourth volume of 3.5 M ammonium acetate, pH 7.5; 20% polyethylene glycol
(PEG) 8000 was added to the spheroplast. The tube was inverted several times
to mix the sample, which was held at room temperature for 45 minutes. The
pellet was collected by centrifugation sequentially at 9,500 rpm at room for 20
minutes and 1 minute; discarding the supernatant each time. The pellet was
resuspended in 15 ml TE, pH 8.0 and 7.5 ml phenol/chloroform (1:1) was added.
The mixture was vortexed for 1 minute and centrifuged at 11,500 rpm for 5
minutes in the JA20 rotor at room temperature. The aqueous phase was
transferred to a fresh tube and the extraction repeated until no interphase was
present. This usually took four extractions to accomplish. Then 10 ml chloroform
was added and the sample vortexed 1 minute and centrifuged at 11,500 rpm in
JA20 rotor for 5 minutes. The aqueous phase was transfered to a fresh tube and
one-third volume 7.5 M ammonium acetate (final concentration, 2.5 M) was
added. 2.5 volumes absolute ethanol were added and the sample was incubated
on ice for 40 minutes to precipitate. The sample was then centrifuged at 9,500
rpm in the JA20 rotor at 4C. The supernatant was decanted, and the pellet was
dried and then resuspended in 400 pi TE pH 8.0.
Bandshift Assavlln Vitro Footprintina Analysis
To determine if sequences upstream of the TATA element were involved
in direct protein/DNA interaction, bandshift assay and in vitro DNase I protection
assay were performed to identified such region(s). For the bandshift assay, a


This dissertation was submitted to the Graduate Faculty of the College of
Medicine and to the Graduate School and was accepted as partial fulfillment of


Figure 12. Competition Assay. Unlabeled DNA fragments were used to
compete with the labeled (-406 to -216) probe in EMS assay. Set A represents
competition with -406 to -216 fragment, set B represent competition with -245 to -
111 fragment, set C represents competition with 33 bp double stranded
oligonucleotide that spans -340 to -308 of the upstream sequence and set D
represents competition with 41 bp double stranded oligonucleotide that spans -
200 to -160.


A
-800 -600 -400 -200 +W ATG
I I L I if mi r i§§§a
I
-498
I
-498
I
-200-160
I
-498
! I
-245 -216
I
-498
I
-370
-252
I
-498
-370
I
-160
Specific Activity
YPD
YPE
YPE/YPD
70
2017
26
100
658
7
3.5
664
190
1.4
79
56
0.7
24
34
G)
B
-800
W/-
-600
-400
$
+ii
ATG
E¡


123
A
CIT1 LacZ
B
YPD
Time (min)
CIT1::LacZ
+ + ++++ +
o o o o o
CM CO ^
o o o o o
m
TIME (minutes)


145
obtained when the yeast cells were grown in complex medium. No deletion
ending between -498 and -245, starting from the distal end, was obtained using
Bal 31 exonuclease. This may be partly due to the fact that the sequence within
this region is very rich in adenosine and thymidine The presence of a high
fraction of A/T base pairs in this region may cause "breathing" in this region that
could enhance the rate of digestion by Bal 31. However, it would be interesting
to generate new clones that would delete this region using a method like inverse
PCR, because these sequences may contain some regulatory elements (see
discussion below).
The next deletion analyzed was p5-227. In this clone there was a nearly
90% decrease in (3-galactosidase activity in a YPD medium, but it retained about
60% of wild-type P-galactosidase activity in a YPE medium. These results
suggest that sequences between -245 and -227 may be important in glucose
regulation. Further deletion to position -168 reduced P-galactosidase activity in
both YPD and YPE by approximately 66% of the wild-type level. Overall, the
gradual reduction in P-galactosidase level in an ethanol medium with successive
removal of DNA sequence suggests several positive acting elements that
contribute to maximal transcription. However, this contrasts with the result that
enzyme levels increased in glucose medium when sequences between -227 and
-168 were deleted. Increased expression in a glucose medium upon deletion of
this region may be due to removal of a repressing element that is specific to the
glucose medium. In a report by Rosenkrantz and coworkers (Rosenkrantz et al.,
1994) also studying the promoter of CIT1, activity was lost in all 5' deletions that


TIME (MIN)
CD
>
% mRNA remaining
-* o
o o
0
YPD
0
YPE
5
YPD
5
YPE
10
YPD
10
YPE
20
YPD
20
YPE
30
YPD
30
YPE
40
YPD
40
YPE
50
YPD
50
YPE
60
YPD
60
YPE
hO
O


178
Rose, M., Albig, W., and Entian, K. (1991). Glucose repression in
Saccharomyces cerevisiae is directly associated with hexose phosphorylation by
hexose PI and Pll. Eur. J. Biochem. 199, 511-518.
Rosenkrantz, M., Alam, T, Kim, K., Clark, B.J., Srere, P.A., and Guarente, L.P.
(1986). Mitochondrial and nonmitochondrial citrate synthases in Saccharomyces
cerevisiae are encoded by distinct homologous genes. Mol. Cell. Biol. 6,
4509-4515.
Rosenkrantz, M., Dingman, D.W., and Sonenshein, A.L. (1985). Bacillus subtilis
citB gene is regulate synergistically by glucose and glutamine. J. Bacteriol. 164,
155-164.
Rosenkrantz, M., Kell, C.S., Pennell, E.A., Webster, M., and Devenish, L.J.
(1994). Distinct upstream activating regions for glucose-repressed and
derepressed expression of the yeast citrate synthase gene CIT1. Curr. Genet.
25, 185-195.
Roy, D.J. and Dawes, I.W. (1987). Cloning and characterization of the gene
encoding Lipoamide dehydrogenase in Saccharomyces cerevisae. J. Gen.
Microbiol. 133, 925-933.
Salmern, J.M., Jr. and Johnston, S.A. (1986). Analysis of the Kluyveromyces
lactis positive regulatory gene LAC9 reveals functional homology to, but
sequence divergence from, the Saccharomyces cerevisiae GAL4 gene. Nucleic
Acids Research 14, 7767-7781.
Sanger, F., Nicklen, S., and Coulson, A. R. (1977). DNA sequencing with chain
terminating inhibitors. Proc. Nat. Acad. Sci. USA 74, 5463-5467.
Santiago, T.C., Purvis, I.J., Bettany, A.J.E., and Brown, A.J.P. (1986). The
relationship between mRNA stability and length in Saccharomyces cerevisiae.
Nucleic Acids Research 14, 8347-8360.
Satrustegui, J. and Machado, A. (1977). The synthesis of yeast matrix
mitochondrial enzymes is regulated by different levels of mitochondrial function.
Arch. Biochem. Biophys. 184, 355-363.
Sauer, R.T., Yocum, R.R., Doolittle, R.F., Lewis, M., and Pabo, C.O. (1982).
Homology among DNA-binding proteins suggests use of a conserved
super-secondary structure. Nature 298, 447-451.
Schmitt, M.E., Brown, T.A., and Trumpower, B.L. (1990). A rapid and simple
method of preparation of RNA from Saccharomyces cerevisiae. Nucleic Acids
Research 18, 3091-3092.


Figure 1. Construction of the 5'deletions. The first step was to digest
plasmid pSH18-8 with Smal, followed by treatment with Bal 31 nuclease. The
nuclease treated DNA was digested with BamHI which released the yeast DNA.
This was then ligated to YCpZ-2 vector which had been linearized with BamHI
and Smal. The thin line represents CIT1 sequences located upstream of the
coding region. The straight line hatch marks represents CIT1 coding region and
the crossed hatch marks represents pUC18 vector sequences. In the second
vector, the filled box represents the E. coli lacZ gene and the stippled box
represents yeast TRP1 gene.


46
routinely stripped by adding 0.5% SDS at boiling temperature, then set at room
temperature until the solution cooled to room temperature. After stripping, the
membrane was then re-exposed to X-ray film to make sure that the were no
residual bands from previous hybridization before subsequent hybridizations was
performed on the membrane.
Primer Extension Analysis
Two oligonucleotides were used in the primer extension analysis to map
the 5' ends of the chromosomal-initiated CIT1 mRNA and the CIT1::lacZ fusion
mRNA that were being transcribed from the plasmid. The oligonucleotides were
first end labeled using T4 polynucleotide kinase as recommended by the
manufacturer, New England Biolabs. An end labeled oligomer (250,000 cpm)
and 50 pg of total yeast RNA were first precipitated together using ethanol. The
pellet was resuspended in 30 pi hybridization buffer (40 mM PIPES, pH 6.4; 1
mM EDTA, pH 8.0; 0.4 M sodium chloride; 80% Formamide). This mixture was
heated at 85C for 10 minutes, then immediately transferred to 25C heat block
and hybridized overnight. Following hybridization, 150 pi of water plus 20 pi 3 M
sodium acetate, pH 5.2 were added to the sample Nucleic acid was
precipitated with 2.5 volumes ethanol. The pellet was washed with 70% ethanol
and allowed to air dry. Pellet was resuspended in 10 pi sterile distilled water, 4 pi
5X Reverse transcription buffer (250 mM Tris-HCI, pH 7.9 ; 375 mM potassium
chloride; 15 mM magnessium chloride), 2 pi 0.1 M DTT; 2 pi 10 mM each all four


78
complex. Use of this plasmid would allow direct comparison of the putative
UASc/n to UAS2cycf regulation by the Hap2/3/4 activator complex mentioned
earlier, since they both have the consensus site for the activator.
The plCZ312 plasmid was digested with Xhol and Smal enzymes and
filled-in with the Klenow fragment of £. coli DNA polymerase I in the presence of
5 mM of all four deoxynucleoside triphosphates. The CIT1 sequence was
generated by cutting p5-498 plasmid with EcoRI and EcoRV enzymes, filling-in
with Klenow enzyme and recovering a 388 bp fragment that contained the entire
regulatory region. The CIT1 fragment was cloned into the plCZ312 vector and
both forward- and reverse-orientation recombinants were recovered. These
clones were designated YISL101 and YISL101R. These plasmids and the intact
plCZ312 plasmid were transformed into 1-7A and JP16-8B (hap2). JP16-8B was
a derivative of 1-7A by insertion of the URA3 gene at the HAP2 locus to disrupt
the gene (Pinkham and Guarente, 1985). (3-galactosidase activities from each
transformant was determined as described in materials and methods.
The results of these experiments are shown in Figure 6 and 7. The
YISL101R clone produced approximately the same level of specific activity as
plCZ312 in both repressing and depressing media. However, with YISL101 the
specific activity was nearly one-half the amount of UAScyci in YPD. The
difference in specific activities between YISL101 and YISL101R was observed in
a repressing medium but was less pronounced after glucose has been depleted
in stationary phase (Figure 6) or when cells were grown in ethanol (Figure 7).
When the UASc/n containing plasmid was transformed into a hap2 strain, the


Construct Arranquen!
plCZ312
rUAS1-UAS2r- TATA
V plCZ312UASLESS
t TATA -
YISL101
^ UASan ^ TATA
%
YISL101R
4* ?* TATA
CYC1::lacZ
CYC1::lacZ
CYC1::lacZ
Specific Activity
1-7 A
LOG SIA
310 691
JP16-8B
LOG SIA
1 196
oo
o
43 93
ND ND
302 615 101 367
CYC1::lacZ
173
745
70
303


177
Pinkham, J.L., Olesen, J.T., and Guarente, L. (1987). Sequence and nuclear
localization of the Saccharomyces cerevisiae HAP2 protein, a transcriptional
activator. Mol. Cell. Biol. 7, 578-585.
Polakis, E.S. and Bartley, W. (1965). Changes in the enzyme activities of
Saccharomyces cerevisiae during aerobic growth on different carbon sources.
Biochem. J. 97, 284-297.
Polakis, E.S., Bartley, W., and Meek, G.A. (1965). Changes in the activities of
respiratory enzymes during the aerobic growth of yeast on different carbon
sources. Biochem. J. 97, 298-302.
Porter, S.D. and Smith, M. (1986). Homeo-domain homology in yeast MATa2 is
essential for repressor activity. Nature 320, 766-768.
Prezant, T, Pfeifer, K., and Guarente, L. (1987). Organization of the regulatory
region of the yeast CYC7 gene: Multiple factors are involved in regulation. Mol.
Cell. Biol. 7, 3252-3259.
Ptashne, M. (1986). Gene regulation by proteins acting nearby and at a distance.
Nature 322, 697-701.
Pugh, B. F. and Tjian, R. (1990). Mechanism of transcriptional activation by Sp1:
Evidence for coactivators. Cell 61, 1187-1197.
Olesen, J., Hahn, S., and Guarente, L. (1987). Yeast HAP2 and HAP3 activators
both bind to the CYC1 upstream activation sites, UAS2, in an interdependent
manner. Cell 51, 953-961.
Reddy, P. and Hahn, S. (1991). Dominant negative mutations in yeast TFIID
define a bipartite DNA-binding region. Cell 65, 349-357.
Repetto, B. and Tzagoloff, A. (1990). Structure and regulation of KGD2, the
structural gene for yeast dihydrolipoyl transsuccinylase. Mol. Cell. Biol. 10,
4221-4232.
Rickey, T.M. (1988). Dissertation: Two genes encoding citrate synthase in
baker's yeast: Location and expression of the isozymes (Bloomington,IN:
University of Indiana).
Rickey, T.M. and Lewin, A.S. (1986). Extramitochondrial citrate synthase activity
in bakers' yeast. Mol. Cell. Biol. 6, 488-493.


Figure 26. DNA Sequence of CIT1. The DNA sequence consists of the coding
region of CIT1 from position -498 to +104. The sequence is numbered by
assigning +1 position to the nucleotide designated to be the mature 5' end of the
major transcript. The bold print represents the first codon. The putative binding
sites for HAP2/3/4 and GCN4 are marked by showing the consensus sequence
for each of them above the predicted location of the CIT1 sequence. The lower
case in the CIT1 sequence within the consensus site indicates a mismatch to the
known sequence for that activator. The putative TATA box is boxed.


37
with Smal- Xhol enzymes and filled-in with all four dNTP's using 2 U of Klenow
enzyme. The piCZ312 plasmid has the CYC1 UAS1 and UAS2, the TATA
element, and three nucleotides of CYC1 coding sequences fused to lacZ gene.
It also has E. coli replication origin, ampicillin resistance gene, and the URA3
selectable marker in yeast, but there is no yeast replication origin. Therefore ,
the plasmid can be maintained only if it integrates into the yeast chromosome. In
order to direct the integration, the plasmid was digested at a unique Stul site
within the URA3 gene. Stul digested plasmid DNA was transformed into 1-7A
and JP16-8A(hap2::URA3) strains, and transformants were plated on SD(2%)
with 20 pg/ml histidine, 2.5 pg/ml adenine, and 20 pg/ml leucine and incubated at
30C. Several single colonies from each transformation were isolated and re
streaked on similar plate and incubated at 30C again. Because multiple,
tandem integration events could occur, the number of integrations of each
transformant was determined by Southern blot analysis. Yeast chromosomal
DNA was isolated by the mini-prep method and digested 10 pg with Sacl
enzyme. The digested DNA was run on a 0.8% agarose gel in TBE (0.89 mM
Tris; 0.89 mM borate; 0.005 mM EDTA) and electrophoretically transferred onto
Zeta-bind nylon membrane (Bio Rad) using half strength TBE. Nucleic acid was
fixed onto the membrane by heating in a vacuum at 80C for 2 hours.
Prehybridization and hybridization were performed according to the manufacturer
(Biorad). The membrane was hybridized with 32P radio-labelled probe prepared
from Ylp56 plasmid (gift from Dr. H. Baker's laboratory), which contains the
URA3 gene, using the random primer method using a kit from United States


161
initial decay. There are two possible explanations why removal of the cis-
element in the first 78 nucleotides would cause the mRNA to become long-lived.
First, this region may contain either an endonucleolytic cleavage site or a site for
trans-factor binding required to initiate cleavage. Removal of this 78 nucleotides
would prevent either one of those events from occurring, therefore, prolonging
the physical life of the fusion mRNA. Lombardo et al. (1992) reported the first
case of repression of a gene by glucose that involved control of stability of
mRNA. In their report, they showed that shifting of the growth medium from a
derepressing carbon source, glycerol, to a repressing medium caused rapid
decay of the Ip gene mRNA (Lombardo et al., 1992). Unlike CIT1 mRNA, the
controlling cis element for rapid decay of the Ip gene mRNA appears to lie in the
3' portion of the gene. Several genes involved in sporulation have also been
shown to be regulated by glucose at the transcriptional and mRNA stability level
(Surosky et al., 1994; Surosky and Esposito, 1992). The UME5 gene was
identified as a mediator of glucose-dependent rapid decay of these sporulation
genes, but it did not affect mitotic genes. In a ume5 mutant, the half-lives of
sporulation specific genes such as SP011, SP012, and SP013 doubled
(Surosky et al., 1994). The UME5 gene encodes a protein with homology to
serine/threonine specific protein kinases. Mutation in the putative kinase domain
resulted in a phenotype similar to that of a ume5 deletion, suggesting that this
domain is very important for the function of the protein.
At this time, it is not known whether if entry of glucose into the cell triggers
the degradation pathway or a metabolite of glucose causes the rapid decay.


64
1990), TCA cycle genes (Bowman et al., 1992; Gangloff et al., 1990; Repetto and
Tzagaloff, 1990), and heme biosynthesis (Keng and Guarente, 1987).
The strategy employed to identify regulatory elements involved fusion of a
fragment of DNA from the CIT1 with the E. coli lacZ gene. The CIT1 segment
contained some of the coding sequences and the transcriptional regulatory unit,
which consisted of the TATA element, transcriptional start site and the putative
UAS elements. Sequential deletion of the putative UAS element was performed
in a manner that deletion progressed toward or away from the transcriptional
start site. Deletions that progressed toward the transcriptional start site were
designated 5' (distal) deletions (Figure 1), and those that progressed away from
the transcriptional start site were designated 3' (proximal) deletions (Figure 2).
The lacZ gene was used as a reporter gene for several reasons. First, deletion
of the CIT1 gene in yeast causes slower growth (Kispal et al., 1988), which may
lead to pleiotropic effects on other metabolic processes; therefore, the native
CIT1 gene on the chromosome was left intact. Second, there is another citrate
synthase isozyme encoded by the CIT2 gene (Kim et al., 1986; Lewin et al.,
1990), which partially compensates for CIT1 deletion (Kim et al., 1986). This
makes assaying for citrate synthase activity of a CIT1 gene on a plasmid
impractical. Therefore, in order to determine the effect of the upstream sequence
deletions on CIT1 gene expression, the reporter gene was used. The gene for (3-
galactosidase was used, because there is no similar activity in yeast; therefore,
any enzyme activity detected would be from the plasmid carrying the gene and
under the control of the CIT1 promoter elements. The vector plasmid, YCpZ-2


Figure 24. Half-life of CIT1::lacZ fusion mRNA in which a UAA stop codon
has been introduced at the 5th amino acid position. (A) Schematic
representation of the CIT1::lacZ fusion. The CIT1 sequence is filled with hatch
marks. The lacZ sequence is completely filled. (B) Autoradiogram of Northern
gel analysis. Total RNA was isolated from a strain carrying the plasmid that has
the stop codon. 15 pg of total was separated as described in Figure 15. The
membrane and was hybridized simultaneously with CIT1 and lacZ gene probes.
The (+) or (-) signs indicate whether the culture was maintained in YPE (-) or
adjusted to make it YPD (2%) (+). (C) Semi-log plot of % mRNA remaining as a
function of time.


107
Maxam and Gilbert (1977). Lanes 2 thru 7 consist of test DNA isolated from
strains after DMS treatment. In lanes 2 and 3 the DNA was isolated from hap2
and hap4 mutants strains; the gene products from these loci form part of the
trimeric transcriptional activator that regulates CYC1. Samples in lanes 4 thru 7
consist of DNA isolated from the wild-type strain. Yeast cells were grown in a
YPD medium for all samples, except lanes 6 and 7 in which the cells were grown
in YPE or SD(2%), respectively. After many trials, only one detectable protection
site was found between positions -111 and -402 on the CIT1 upstream region,
either on the coding or noncoding strand of the gene. This was at position -266
(Figure 14) indicated by the arrow. This site corresponds to a potential binding
site for the transcriptional activator Gcn4p. The genetic evidence from deleting
the upstream sequences indicated that they are important for regulation,
presumably by binding to proteins that modulate transcriptional levels, so it was
surprising that only one protected site was found within the region examined
(Figure 14). This may mean that there are no G-residues involved in the other
controlling regions that bind to the protein, or the binding affinity of any factor to
its cognate site is so low that it does not protect from modification by DMS. To
eliminate poor technique as a reason for not detecting other protection or
hypersensitive sites, I also looked for the footprinting pattern of the TPI1 gene in
collaboration with Dr. H. Baker's laboratory. TPI1 encodes triose-phosphate
isomerase, a glycolytic enzyme. DNA samples that had been treated in vivo with
DMS were given to Dr. H. Baker's laboratory to analyze the TPI footprint pattern
and a portion of the DNA was analyzed by me. The results obtained from both


77
from this construct in YPD, confirming that the response to glucose can be
mediated by sequences outside this region (e.g. the URS from -139 to -111).
The results obtained with p5-245 and pA252-370 seem at odds because the
region deleted from the pA252-370 clone was also deleted from the p5-245
clone, yet activities remain relatively high in p5-245, especially in derepressing
media. The sequences between -498 and -370 were present in pA252-370, but
were deleted from clone p5-245. This result suggests that the -498 to -370
region may contain a URS.
There are Multiple UAS Elements
Upstream activating sequences have, by definition, the ability to activate
the transcription of their cognate gene or a heterologous gene in an orientation
independent manner. The activation may show regulation in the heterologous
context similar to that in the native gene. To show that the whole upstream
sequence present in p5-498 and segments of it have either a UAS or URS
function, the entire region or smaller regions were subcloned into plasmid
plCZ312 whose UAS elements were removed by digestion with restriction
enzymes Xhol and Smal. The important features of this plasmid were the
presence of the CYC1 promoter elements UAS1 and UAS2, the TATA element,
the transcriptional start site, and only three nucleotides of the coding region fused
to the lacZ gene. UAS2 has seven of eight nucleotides of the consensus
sequence that binds to the Hap2p/Hap3p/Hap4p transcriptional activator


Figure 19. Half-life of CIT1::lacZ fusion mRNA upon shift. (A) Schematic of
CIT1::lacZ fusion present in the plasmid bearing the fusion. The genes are not
drawn to scale. (B) RNA was isolated from yeast strain harboring plasmid with
the fusion gene. The lacZ gene is controlled by the CIT1 promoter. The mRNA
also has 178 nucleotides of CIT1 transcript. The (+) or (-) sign indicates whether
YPD (4%) was added to the growth medium to adjust the final concentration of
glucose to 2%. Membrane was hybridized with 800 bp of lacZ probe,
radiolabeled using the random primer kit (U.S. Biochemical) and a-32P-ATP (C)
Decay kinetics of CIT1::lacZ fusion mRNA upon shift.


131
rate either in a temperature sensitive mutant or when 1,10-phenanthroline was
used to stop transcription (Figure 22). Fusions containing this deletion showed
decreased mRNA stability when shifted to YPD relative to YPE grown cells.
The absence of changes in the decay kinetics of fusion mRNA with this
CIT1 deletion, indicated that the sequences responsible for the rapid decay in a
glucose medium relative to an ethanol medium, may lie within the coding region.
The other alternative is that the critical sequences are derived from both regions.
To test the hypothesis that the coding region sequences contain the glucose
response element, RNA was isolated from a yeast strain carrying a plasmid
construct having the CIT1 coding region deleted from the rest of fusion gene.
The RNA was hybridized simultaneously with lacZ gene and CIT1 gene probes.
An autoradiogram of a Northern analysis of this experiment is shown in Figure
23. The decay rate of the fusion mRNA with the coding region deletion (t% 16.5
minutes) was quite different when compared to the intact fusion mRNA (t,/2 4
minutes) when the growth medium was adjusted to 2% glucose (compare Figure
19B and the top band of Figure 23B). This represents 4-fold increase in the
decay kinetics of fusion mRNA without the CIT1 coding region. Note that the
lacZ fusion RNA contains a very stable component. Therefore only the fastest
component of this biphasic degradation was compared. Similar comparisons
could be made between the full length CIT1 mRNA and the coding region deleted
fusion mRNA. In ethanol medium (YPE), half-life of the deletion (t1/4 16 minutes)
was slightly higher than the full length CIT1 mRNA (Figure 23) but was about the
same as the intact CIT1::lacZ fusion mRNA (Figure 19). The decay rate of the


17
significant difference in repressing and derepressing media. Although the
genetic evidence strongly implicates a role for cAMP in mediating glucose
repression, this effect may be indirect at best.
Among the best studied of the glucose repressible genes are the GAL,
GAL7, and GAL10 genes of Saccharomyces cerevisiae, which encode
galactokinase, galactotransferase, and UDP-galactose epimerase, respectively.
These proteins are required for galactose utilization. Their regulation shows that
glucose mediated repression of genes is complex and occurs at several levels.
The regulation of the GAL1 gene, for example, occurs at three levels. First,
glucose reduces the level of functional inducer, galactose, in the cell by
repressing transcription of the galactose transporter-galactose permease, which
is encoded by the GAL2 gene (Braum et al., 1986; Tschopp et al., 1986) and
inactivating preexisting permease molecules, thereby preventing any transport of
inducer into the cell (Holzer and Matern, 1977). The reduction in the inducer
levels reduces function of the activator Gal4p. The second mechanism of
glucose repression of the GAL genes involves inhibition of the transcriptional
activator Gal4p (Flick and Johnston, 1990). The inhibition is due to reduction in
the expression of GAL4 (Johnston et al., 1994) and inhibition of Gal4p function
by the inhibitory domain "ID". The inhibitory domain constitutively inhibits the
transcription of a heterologous activator in glucose and glycerol media.
However, when the glucose response domain (GRD) is present, activation
occurs in a glycerol medium but not in a glucose medium (Stone and Sadowski,
1993). Repression of the GAL4 gene is mediated by the Mig1 p, which binds to


68
galactosidase level expressed from this clone, p5-245, in a derepressing
medium, but produced about 20% reduction in a repressing, glucose, medium.
Consequently, there was a higher fold induction of the p5-245 clone than the p5-
498 clone. Removal of additional 19 base pairs (p5-227) caused a severe
reduction in (3-galactosidase level expressed in a repressing medium while
activity was reduced only about 50% in a derepressing medium. The overall
induction, YPE/YPD, of p5-227 was 131-fold, which was almost seven times the
fold induction for p5-498. In clone p5-168 the specific activity in glucose and
ethanol was reduced to about 33% of wild-type level. Therefore, the level of
induction of ethanol versus glucose media was about the same as the wild-type
level.
Deletions beginning from the 3' or proximal end of the upstream sequence
resulted in a range of specific activities from 2.5 times greater than the wild-type
insert in a repressing medium (YPD) to a barely detectable level. In the
derepressing medium, YPE, the activity ranged from 150% of wild-type level to
about 2% of the wild-type level. In clone p3-139, the sequence from -139 to -111
was deleted. In this clone, specific activities were consistently higher than wild-
type in cells from both media, suggesting that an upstream repressing sequence
(URS) may have been removed. Rosenkrantz and his colleagues (1994) also
found that removing sequences in this region caused an increase in 0-
galactosidase level expressed from a CIT1::lacZ fusion gene. A deletion that
stopped at position -172 had a specific activity that was nearly 90% of wild-type
in the YPE medium but almost 2.5 times greater than wild-type in cells grown in


84
units per milligram of protein in a depressing medium and 94 units per milligram
of protein in YPD. These results show that the regions encompassing -245 to -
216 and -200 to -160 have an activating function. The -245 to -216 region has
greater activation potential than the -200 to -160 region in YPD. However, in the
YPE medium, the -200 to -160 region showed greater expression than the -245
to -216 region, suggesting that this region contains part of the glucose
responding promoter element.
Evidence for URS Element
Under both repressing and derepressing conditions, the level of (3-
galactosidase expressed from clone p3-139 was higher than the wild-type clone
(see Figure 3). P-galactosidase levels were more than twice as high under
repressing conditions, yet under derepressing conditions the levels were only
50% higher than the wild-type clone. This suggested that there may be a URS
element between -139 to -111 of the CIT1 sequence. To determine the potential
negative regulatory capability of this region, I cloned it into the reporter plasmid
plCZ312. To accomplish the cloning, plCZ312 was linearized with Xhol which
cuts downstream of the two UAS elements described earlier (see introduction),
and the region of CIT1 from -139 to -111 was inserted. Recombinants
designated YISL111-139X were sequenced using AL45 primer to determine the
orientation of insertion. Only recombinants in the forward orientations were
recovered and subsequently transformed into a yeast strain. If the -139 to -111


103
conditions. Any changes that cause differential expression at the level of
transcription must be due to either modification of already bound factors or
changes in the protein/protein interactions taking place in different media. The
DNase I digestion pattern shown with the test samples could also be due to
nonspecific binding. This possibility was indicated by the appearance of
hypersensitive sites next to the protected area. Binding of protein/DNA, without
specificity, could cause changes in the DNA confirmation that could create a
single-stranded region which would be preferentially nicked by DNase I.
In Vivo Footprint Analysis
In vivo footprint analysis was performed to identify other target sequences
that may bind transcriptional factors. This was also done to confirm the results
obtained by in vitro analysis.
Live cells were treated with DMS, a small molecule which adds a methyl
group at the N-7 position of guanosine. The addition of a methyl group to the
nucleotide makes it susceptible to cleavage by piperidine. Cells were grown to
logarithmic phase and treated with 0.5% DMS for various times, ranging from 2
minutes to 10 minutes. Cells treated for more than 6 minutes produced over
methylated DNA; therefore cleavage by piperidine led to fragments too small for
footprint information. Analysis was consequently restricted to DNA that was
isolated from cells treated between 2 to 4 minutes at room temperature.


TIME (MIN)
>
CD
% mRNA remaining
YPD
YPE
YPD
YPE
YPD
YPE
YPD
YPE
YPD
YPE
YPD
YPE
YPD
YPE


I dedicate this work to my family, especially to my wife and best friend,
Alaro Lawson. Without her love and support it would have been impossible for
me to complete this work. To my children, Banimi and Emi, who had to deal with
my many absences. Finally to my parents, who laid the foundation for my
education.


114
YPE(2%) <
ISOLATE RNA
RUN AGAROSE FORMALDEHYDE GEL
BLOT
HYBRIDIZE
QUANTITATE


25
determines their half-life. Messages with longer half-life have an initial
deadenylation rate significantly lower than those with a short half-life (Xing et al.,
1993). This result suggests that the rate limiting step for this class of mRNA is
the deadenylation step. To define direction of decay, whether 5' -> 3' or 3' -> 5', a
poly(G) sequence was inserted into the 3' UTR of a test mRNA. The poly(G)
forms a secondary structure that slows decay in either direction. When the fate
of the mRNA containing the poly(G) track was followed using a poly C probe,
decay was found to proceed in a 5' -> 3' direction. In an xrn1 mutant (XRN1
encodes the major 5' -> 3' exonuclease in yeast), full length mRNA was seen for
a much longer time, indicating that, after deadenylation, this exonuclease is
responsible for degrading the RNA to mononucleotides. Using an antibody to the
5' cap structure Muhlrad et al. (1994) were able to show that the cap structure is
removed before exonuclease digestion.
The use of mutations that result in premature translation termination in
several genes have identified some genes in yeast that are involved in the rapid
decay of mRNAs with premature nonsense codons. Two such genes are UPF1
and UPF3 (Leeds et al., 1991). In a wild-type strain, most mRNAs containing
premature termination signals have a decay rate up to 12 times faster than
normal mRNA (Peltz et al., 1993), but in either upf1 and upf3 mutants some of
these messages are selectively stabilized without affecting the turnover of the
other message (Leeds et al., 1991; Leeds et al., 1992). The nonsense mutations
that caused the rapid decay are always located within the first two-thirds of the
coding region. If the mutation is near the 3' end of the gene, the half-life is quite


69
the YPD medium. Removal of an additional 35 bp, clone p3-217, reduced
specific activity by two-thirds in YPE, but still maintained a slight increase (104
units/mg protein) over wild-type level in YPD. Clone p3-252 expressed (3-
galactosidase level that was approximately 10% of wild-type in both YPD and
YPE media. Further deletion to position -372 produced barely detectable
enzyme activity in cells carrying this clone in YPD medium and only about 2% of
the wild-type level in YPE medium. These 5' and 3' deletions showed that there
are three regions that caused increase of CIT1 expression in YPD and YPE
media. These regions include sequences between -372 to -252, -245 to -216
and -200 to -160. In addition sequences between -139 and -111 have a
repressing effect that is most pronounced in the YPD medium.
There have been two reports in yeast (Kim et al., 1986; Gangloff et al.,
1990) and one in B. subtilis (Rosenkrantz et al., 1985) which showed that
addition of glutamate to cultures grown in a minimal medium repressed the
activity of citrate synthase and aconitase. 3-galactosidase levels expressed in
yeast cells bearing the deletion constructs were identical, whether cells were
grown in SD(2%), or SD(2%) medium supplemented with glutamate (Rickey,
1988). However, it was observed that the 3-galactosidase levels expressed from
most of these deletion constructs were substantially higher in a minimal medium
with 2% dextrose than in the YPD (2%) medium. The results of the specific
activities obtained from cells grown in the SD medium harboring the deletion
constructs are presented in Figure 4. The wild-type clone produced 12 times
more 3-galactosidase activity in SD(2%) (897 units/mg protein) than in YPD(2%)


116
A
YPD
Time (min)
cm
TIME (minutes)


45
sample loaded on a 1.2% agarose gel containing 0.22 M formaldehyde/1 X
MOPS buffer. The running buffer consisted of 0.22 M formaldehyde/ 1X MOPS
buffer. The gel was run at 150 V until the dye ran to the bottom of the gel. This
usually took about 6 hours. The buffer was recirculated with a peristaltic pump to
prevent formation of a pH gradient. At the end of the run, the gel was
photographed with Polaroid film on a UV transilluminator to determine the
integrity of the RNA. The gel was then soaked in a 20 X SSC (SSC is 0.15 M
sodium chloride/0.015 M sodium citrate) for 15 minutes. RNA transfer onto
Hybond N+ nylon membrane by capillary action using 20X SSC for approximately
15 hours at room temperature. At the end of the transfer, the RNA was cross
linked to the membrane in a Stratalinker (Stratagene) set on auto-crosslink. The
membrane was then rinsed with 2 X SSC. The rapid hybridization solution
(Amersham) was used as recommended by the manufacturer for hybridizations
and prehybridizations. Prehybridization was performed with 50 pi of rapid
hybridization solution per square centimeter of membrane at 60C for at least 30
minutes. After prehybridization, 100,000 200,000 cpm of probe was added per
milliliter of hybridization solution, and hybridization was performed at 60C for at
least 2 hours. Washes were done with 2X SSC/0.1 % SDS at room temperature
for 15 minutes once and changed to 1X SSC/0.1 % SDS and repeated wash
twice at 60C for 20 minutes. The membrane was then air dried, wrapped in
Saran Wrap and exposed to X-ray film. An intensifying screen was used to boost
weaker signals. For quantitative results the membrane was exposed to a
Phosphor-Imager screen (ABI). If stripping was necessary, the membranes were


152
in a derepressing medium. Similar results have been reported for aconitase
(Gangloff et al., 1990), a TCA cycle enzyme that catalyzes isomerization of
citrate to isocitrate and is located in mitochondria. Aconitase is encoded by the
AC01 gene, located in the nucleus. Tim Rickey (Rickey, 1988) in our laboratory
tested to see if a similar effect could be seen with the CIT1::lacZ fusion. Contrary
to the report of Kim et al., (1986), there was no glutamate effect on the
expression of this fusion gene in our strain. However, it was noticed that the
expression of all the deletion constructs were higher in a minimal medium
supplemented with high (2%) or low (0.2%) glucose (data not shown). It is
interesting to note that even in SD (2% w/v glucose) medium, which contains the
same amount of glucose that was added to the standard YPD, each construct
exhibited higher specific activity than in the complex medium. These findings
suggested that in addition to carbon-source regulation, the CIT1 gene is also
regulated by other nutritional requirements. The overall expression pattern of the
different deletion constructs was remarkably similar to what was seen with YPD
and YPE media. The only significant deviation from the expression pattern in a
complex medium was that the highest level of expression in SD (2%) was
exhibited by the wild-type clone (p5-498) whereas clone p3-139 exhibited the
highest level of expression in a complex medium (Figures 4 and 5). The latter
construct deletes a putative URS. One hypothesis for why the CIT1 gene may
be expressed at a higher level in a minimal medium compared to a complex
medium relates to the fact that the TCA cycle provides carbon skeletons for
amino acid biosynthesis. In a minimal medium, there is limiting amount of


169
Craven, G.R., Steers, E., and Anfinsen, C.B. (1965). Purification, composition,
and molecular weight of the (3-galactosidase in Escherichia coli K12. J. Biol.
Chem. 240, 2468-2477.
Creusot, V.F., Guarente, L, and Slonimski, P.P. (1986). The overproducing
CYP1 and the underproducing hap1 mutations are alleles of the same gene
which regulates in trans the expression of the structural genes encoding
iso-cytochromes c. Curr. Genet. 10, 339-342.
Decker, C.J. and Parker, R. (1993). A turnover pathway for both stable and
unstable mRNAs in yeast: Evidence for a requirement for deadenylation. Genes.
Dev. 7, 1632-1643.
Denis, C.L., Ciriacy, M., and Young, E.T. (1981). A positive regulatory gene is
required for accumulation of the functional messenger RNA for the
glucose-repressible alcohol dehydrogenase from Saccharomyces cerevisiae.
Mol. Biol. 148, 355-368.
Denis, C.L., Fontaine, S.C., Chase, D., Kemp, B., and Bemis, L.T. (1992). ADR1C
mutations enhance the ability of ADR1 to activate transcription by a mechanism
that Is independent of effects on cyclic AMP-dependent protein kinase
phosphorylation of Ser-230. Mol. Cell. Biol. 12, 1507-1514.
Denis, C.L. and Young, E.T. (1983). Isolation and characterization of the positive
regulatory gene ADR1 from Saccharomyces cerevisiae. Mol. Cell. Biol. 3,
360-370.
DiMari, J.F. and Bechhofer, D.FI. (1993). Initiation of mRNA decay in Bacilus
subtilis. Mol. Microbiol. 7, 705-717.
Dynan, W.S. (1989). Modularity in promoters and enhancers. Cell 58, 1-4.
Emory, S.A., Bouvet, P., and Belasco, J.G. (1992). A 5'-terminal stem-loop
structure can stabilize mRNA in Escherichia coli. Genes. Dev. 6, 135-148.
Faye, G., Leung, D.W., Tatchell, K., Hall, B.D., and Smith, M. (1981). Deletion
mapping of sequences essential for in vivo transcription of the iso-1-cytochrome
c gene. Proc. Natl. Acad. Sci. USA 78, 2258-2262.
Fink, G.R. (1986). Translational control of transcription in eukaryotes. Cell 45,
155-156.
Finley, R.L.J., Chen, S., Ma, J., Byrne, P., and West, R.W.J. (1990). Opposing
regulatory functions of positive and negative elements in UASG control
transcription of the yeast GAL genes. Mol. Cell. Biol. 10, 5663-5670.


A
-800
600
-400
-200
+ Jl
J i
I
| | I
£
-498
-245
-800
I
I
-168
-800 ^
I ^
I I
-139-1 1 1
-800
I
I I
-172 -111
-800 //f
I
I I
-217 -111
-800 "
I ~
I I
-252 -1 1 1
//
I
-372
I
-1 1 1
I
-498
I I
-200 -160
I
-498
I I
-245 -216
I
-498
I
-370
I
-252
-498
I
-370
I
-160
Specific
Activity
YPD
YPE
YPE/YPD
70
2017
26
57
1938
34
9
1183
131
23
626
27
1 63
2933
18
138
1797
13
1 04
670
6
8
232
29
1
46
46
1 00
658
7
3.5
664
1 90
1.4
79
56
0.7
24
34
144


162
These two alternatives can be differentiated by either: (i) adding 3-O-methyl-D-
glucose to the growth medium, which is a non-metabolizable glucose analog, or
(ii) adding fructose to the growth medium. It has been shown that when 3-O-
methyl glucose was added to yeast cells growing in ethanol (derepression)
medium some of the repressible enzyme activities were reduced (Gancedo and
Gancedo, 1985), although the kinetics of reduction occurred at a slower rate. If
entry into the glycolytic pathway is not required to activate the degradation
cascade, then it is possible that 3-O-methyl-D-glucose may elicit similar effect
when added to cells growing in depressing medium. However, if the glycolytic
pathway is required to initiate the degradation, then addition of fructose to cells
growing in ethanol should show similar response as when glucose was added.
Fructose is a hexose sugar that follows a similar catabolic pathway after initial
phosphorylation and conversion to fructose-6-phosphate.
One of the obvious questions that arose from this study was, how does
glucose mediate rapid degradation of the CIT1 mRNA? There are two models I
propose by which glucose may mediate the rapid decay of CIT1 mRNA. Model
1: the CIT1 mRNA and other mRNAs that may be similarly affected are not being
translated well in a glucose-containing medium because of sequences contained
in the 78 nucleotides; therefore they become degraded rapidly. It has been
shown both in this study and in others (He et al., 1993; Peltz et al., 1993) that
when mRNAs are not translated they tend to be degraded rapidly. Messages
that are being translated may be physically protected by the associated
ribosomes. Hence mRNAs that are translated under specific physiological


155
cells become derepressed after utilization of glucose, the difference in induction
level between a wild-type strain and a hap2 strain was only about twofold (Figure
6). It is not clear why there was an orientation effect of the UAS in the hap2
mutant, which is unlike most other known UASs that have been tested.
However, Trawick et al. (1992) also reported an orientation dependent effect of
hap2 mutation on the COX6 gene expression. The role of the
Hap2p/Hap3p/Hap4p complex in the regulation of genes having the consensus
binding site, excluding CYC1, was put into question when it was demonstrated
that this consensus site within the COX6 gene could not bind to protein from
yeast strains dependent on these factors. This DNA fragment was also unable to
compete away any of the UAS6 band shifts. This result may be an artifact of the
in vitro experimental condition, or may point to an indirect role for the Hap
proteins at these sites. The best evidence of Hap2p/Hap3p/Hap4p protein
regulation of any one of these genes would be a demonstration of binding to their
cognate sites in vivo. Unfortunately, no one has yet shown this for any of these
genes, including CIT1.
Bandshift assays and in vitro DNase I protection assays were performed
to show specific protein/DNA interaction between the upstream sequences of
CIT1 and proteins from a yeast extract. Two DNA fragments, from -406 to -216
(segment II) and -245 to -111 (segment I), were used in bandshift and DNase I
assays. Bandshift assays with segment I showed a single shifted band at low
protein concentration; however, at high protein concentration, a second faster
migrating band was seen (Figure 10). The appearance of this second band at


Figure 2. Construction of the 3' deletions. First, pSH18-8 was digested with
EcoRV which is 111 bp from the transcriptional start site. The DNA was then
treated with Bal 31. Following the nuclease treatment, the DNA was digested
with BamHI, this released CIT1 sequences that contained sequences essential
for proper transcription initiation. To restore these sequences, an EcoRV/BamHI
fragment from the original plasmid (pSH18-8) was ligated to the Bal 31 treated
DNA. A Smal/BamHI fragment from the nuclease digested DNA was then
subcloned into YcpZ-2 vector.


40
disrupt the cells, 4 mm diameter acid-washed glass beads were added to the
suspension until the glass beads reached the meniscus of the liquid. The
mixture was vortexed vigorously for 45 seconds. The tube was cooled on ice for
at least 1 minute; then vortexed again for additional 45 seconds. The lysate was
then transferred to fresh microcentrifuge tube and centrifuged in an Eppendorf
centrifuge for 1 minute at 4C. The supernatant was transferred to a fresh
microcentrifuge tube and incubated in a -70C freezer for at least 15 minutes.
The lysate was then set on ice to thaw and centrifuged again in a microcentrifuge
for 1 minute at 4C. The supernatant was transferred into a fresh microcentrifuge
tube and stored at -70C P-galactosidase activity of each lysate was
determined by the method of Craven et al (1965). Hewellet Packard kinetics
program in model 8452A spectrophotometer was used to determine the reaction
rate. Specific activity from each sample is reported as nanomoles of o-
nitrophenyl-3-galacotopyranoside (ONPG) hydrolyzed per minute per milligram of
protein. Protein concentrations were determined by the method of Lowry et al
(1951).
RNA Isolation
RNA for northern analysis and ribonuclease protection assays was
routinely prepared as described by Schmitt et al (1990). Cell cultures were
grown to early logarithmic phase (OD600 ~ 1.0) and harvested by centrifugation in
the Beckman J2-21 centrifuge in a JA-20 rotor at 10,000 rpm for 45 seconds.


99
the competition assay. Using unlabeled DNA that was similar to the labeled DNA
(-406 to -216), 30-fold excess of this DNA was able to compete with the shifted
band (Lane 4). All of the shifted band disappeared when the amount of DNA
used in the competition was increased to 20 times more than the initial reaction.
However, when a similar molar excess of unrelated DNA (-245 to -111) was
used, no competition was seen (lanes 5 thru 7). This demonstrated the
specificity of the interaction.
For reasons discussed below, we also set up competition assay with
double stranded oligonucleotide spanning -340 to -308. The result is shown in
Figure 12, lanes 8 and 9. In this reaction, it took 100-fold molar excess of
competitor DNA to show significant competition, which was higher than the
amount that was required with the -406 to -216 fragment as competitor. In
protein/DNA interactions, sequences beyond the exact point of interaction are
often required for optimum binding. Therefore, if those sequences are not
present it would affect the binding affinity. This may explain why it required a
higher molar excess to show any significant competition. Another double
stranded oligonucleotide, -200 to -160, did not show any significant competition
at similar concentrations (Figure 12, lanes 10 and 11).
To identify the exact sequences that interact with factor(s) from the crude
extract, DNase I was used to digest the bandshift reaction mixture for 45 seconds
at room temperature. The reaction was stopped with 0.025 M EDTA and the
sample was run on a polyacrylamide gel. The bands from Figure 12 were
located following autoradiography and excised from the gel, followed by elution of