Citation
Genetic and biochemical analysis of the molybdate-dependent expression of HYC Operon in Escherichia coli

Material Information

Title:
Genetic and biochemical analysis of the molybdate-dependent expression of HYC Operon in Escherichia coli
Creator:
Self, William Thomas, 1971-
Publication Date:
Language:
English
Physical Description:
xvi, 136 leaves : ill. ; 29 cm.

Subjects

Subjects / Keywords:
Adenosine triphosphatases ( jstor )
Amino acids ( jstor )
DNA ( jstor )
Escherichia coli ( jstor )
Genetic mutation ( jstor )
Molybdates ( jstor )
Operator regions ( jstor )
Operon ( jstor )
Plasmids ( jstor )
Proteins ( jstor )
Dissertations, Academic -- Microbiology and Cell Science -- UF ( lcsh )
Microbiology and Cell Science thesis, Ph.D ( lcsh )
Genre:
bibliography ( marcgt )
non-fiction ( marcgt )

Notes

Thesis:
Thesis (Ph.D.)--University of Florida, 1998.
Bibliography:
Includes bibliographical references (leaves 125-135).
General Note:
Typescript.
General Note:
Vita.
Statement of Responsibility:
by William Thomas Self.

Record Information

Source Institution:
University of Florida
Holding Location:
University of Florida
Rights Management:
Copyright [name of dissertation author]. Permission granted to the University of Florida to digitize, archive and distribute this item for non-profit research and educational purposes. Any reuse of this item in excess of fair use or other copyright exemptions requires permission of the copyright holder.
Resource Identifier:
030040047 ( ALEPH )
40945286 ( OCLC )

Downloads

This item has the following downloads:


Full Text













GENETIC AND BIOCHEMICAL ANALYSIS OF THE MOLYBDATE-DEPENDENT
EXPRESSION OF HYC OPERON IN ESCHERICHIA COLI


















By

WILLIAM THOMAS SELF


A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY

UNIVERSITY OF FLORIDA


1998




GENETIC AND BIOCHEMICAL ANALYSIS OF THE MOLYBDATE-DEPENDENT
EXPRESSION OF HYC OPERON IN ESCHERICHIA COLI
By
WILLIAM THOMAS SELF
A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY
UNIVERSITY OF FLORIDA
1998


ACKNOWLEDGMENTS
I would like to thank Dr. K. T. Shanmugam for helping me
to think as a scientist. His instruction has not only aided
me in my research, but it has helped me to gain the confidence
I need to tackle any question or carry out any experiment. I
would also like to thank Drs. Lonnie Ingram, James Preston,
Thomas Bobik, and Robert Cohen for their support and
encouragement as members of my supervisory committee. In
addition, I am thankful for all of the help from all of my
associates in Dr. Shanmugam's laboratory over the years.
Special thanks goes out to Dr. Julie Maupin-Furlow for use of
the spectroflourometer. Thanks also go out to other fellow
scientists and students from the Microbiology department. And
last, but certainly not least, I would like to thank my wife,
Marianne, for her unending patience and support over the last
four years.
11


TABLE OF CONTENTS
ACKNOWLEDGMENTS
LIST OF FIGURES v
LIST OF TABLES xii
LIST OF ABBREVIATIONS ix
LIST OF GENE SYMBOLS xii
ABSTRACT xiv
INTRODUCTION 1
LITERATURE REVIEW 5
Molybdate Transport 6
MGD Biosynthesis 9
Formate Hydrogenlyase 12
MATERIALS AND METHODS 17
Bacterial Strains 17
Media and Growth Conditions 17
Construction of PhyclacZ 21
Construction of (hyfA-lacZ) 21
Construction of ahyf 23
Mutagenesis of fhlA 24
Enzyme Assays 26
Purification of FhlA Protein 27
Purification of FhlA165 Protein 29
Purification of ModE 31
Purification of ModE Mutant Proteins 31
Determination of Protein Concentration 34
DNase I-footprinting Experiments 34
ATPase Activity 36
DNA Electrophoretic Mobility Shift Experiments 36
Phosphorimaging Analysis 38
iii


Optical Biosensor Experiments 38
Fluorescence Spectroscopy Measurements 39
Materials 40
RESULTS AND DISCUSSION
Expression of hyc Operon in Escherichia coli
Requires Molybdate 41
ModE Protein is Required for Optimal Expression
of hyc Operon 4 8
Biochemical Analysis of ModE and
Molybdate-independent Mutant ModE 60
MoeA Protein is a Required Second Component in
Molybdate-dependent Expression of hyc Operon .... 77
FhlA Mutant Proteins Which Allow Expression of
hyc Operon in the Absence of Molybdate 84
Characterization of an Effector-independent
Mutant FhlA Protein, FhlA165 94
FhlA165 Protein also Activates Expression of a
Silent, hyc-like, Operon hyf in
Escherichia coli 115
CONCLUSION 121
REFERENCES 125
BIOGRAPHICAL SKETCH 136
IV


LIST OF FIGURES
Figure Page
1 Molybdopterin guanine dinucleotide biosynthetic
pathway in E. coli 11
2 Location of lacZ in Pt¡yclacZ 22
3 Effect of formate on expression o f PhyclacZ 47
4 DNA electrophoretic mobility shift with ModE
protein and DNA from the hyc promoter region ... 55
5 Protection of hyc DNA by ModE protein
from cleavage by DNase I 56
6 Comparison of the ModE-binding regions in
hyc promoter DNA and modA operator/promoter
DNA 58
7 A proposed model for activation of
hyc operon by both FhlA and ModE proteins .... 61
8 DNase I footprinting of modABCD
operator/promoter DNA with ModE proteins 64
9 DNA sequence of the modABCD
operator/promoter region protected by
ModE-molybdate from DNase I cleavage 66
10 DNase I protection pattern of modABCD
operator/promoter DNA with *ModE
and its mutant forms 69
11 Optical Biosensor response curves for
ModE-binding to modABCD operator/promoter DNA . 72
12 Fluorescence emission spectra of ModE and
mutant ModE proteins 75
v


13Location of mutation(s) in fhlA mutant alleles ... 86
14 Extent of deletions in fhlA deletion mutant
alleles 96
15 DNA Mobility shift experiment using purified
FhlA and FhlA165 proteins and hyc promoter
DNA 105
16 Effect of FhlA or FhlA165 concentration on
binding to hyc promoter DNA 106
17 ATPase activity of FhlA and FhlA165 in
response to Formate and hyc promoter DNA . .109
18 Alignment of N-terminal region of FhlA with
proteins from ABC transport systems and the
identity of a putative formate binding domain . .112
19 A proposed model for the formate and
[Mo]-dependent transcriptional activation
of hyc operon by FhlA protein 114
vi


LIST OF TABLES
Table Page
1 Bacterial Strains and phages used in this study ... 18
2 Plasmids used in this study 20
3 Expression of PhyclacZ requires both
formate and molybdate 43
4 Expression of (fhlA-lacZ) is independent
of formate and molybdate 45
5 Transcriptional activation of PhyclacZ in the
presence of mutations in the mod operons 50
6 ModE-dependent activation of hyc operon
requires molybdate 53
7 Effect of mutation in the genes coding
for proteins in MGD biosynthesis on
ModE-independent PhyclacZ expression 79
8 Inability of Tungstate to substitute for
Molybdate in MoeA-dependent expression of
hyc operon 83
9 Regulation of PhyclacZ by FhlA mutant proteins . .89
10 Suppression of the effect of modE and moeA
mutations on hyc expression by FhlA mutant
proteins 93
11 Regulation of PhyclacZ by FhlA165 protein 97
12 FhlA165-mediated expression of PhyclacZ in the
presence of oxygen or nitrate 100
vii


13 Production of FHL activity in the presence
of FhlA165 is formate-independent 103
14 Expression of Q(hyfA-lacZ) in the presence of
various fhlA alleles 117
viii


LIST OF ABBREVIATIONS
ABC
ATP-binding cassette
AppY
Transcriptional activator for
cyx and hya operons
ATP
bp
CRP
Da
DppF
DNA
Deoxyribonucleic acid
DNase I
DMSO
DTT
E. coli
EDTA
FDH-H
to Hydrogenase 3 (FHL)
FHL
FhlA
GTP
HisP
IX


HYD
Hydrogenase
IHF Integration Host Factor
IPTG Isopropyl-p-D-thiogalactopyranoside
Kd Equilibrium dissociation constant
Klenow DNA polymerase I Klenow fragment
L-agar L-broth + agar
LB L-broth
LBF L-broth + formate
LBG L-broth + glucose
LBGF L-broth + glucose + formate
LBGM L-broth + glucose + molybdate
LBM L-broth + molybdate
LBW L-broth + tungstate
LivG Branched-chain amino acid transport
MalK Maltose transport protein
MGD Molybdopterin guanine dinucleotide
Mo Molybdenum
Mo-cofactor Molybdopterin with Mo
[Mo] Activated molybdenum (putative)
Mode Molybdate transport
Molybdopterin A unique pterin found in MGD
ModE Molybdate-dependent regulator
ModF ModF protein; unknown function
MPT Molybdopterin
x


NR Nitrate Reductase
ONPG Ortho-nitrophenyl-
(3-D-galactopyranoside
ORF Open reading frame
PAGE Polyacrylamide gel electrophoresis
PBST Phosphate buffered saline with
Tween 20
PCR Polymerase chain reaction
PotA Putrescine transport protein
PotG Putrescine transport protein
SDS Sodium dodecyl sulfate
TMAO Trimethylamine-N-oxide
Tris Tris-(hydroxymethyl)-aminomethane
UV Ultraviolet
X-gal 5-bromo-4-chloro-3-indolyl-
(3-D-galactopyranoside
XylG Xylose transport protein
xi


LIST OF GENE SYMBOLS
All of the genes listed below are from Escherichia coli K-12
Gene Svmbol
Alternate crene svmbols; phenotvpe affected
hep
Gene encoding Bacterioferritin co-migratory
protein
hi a
(3-lactamase
chi
Chlorate resistant (renamed mol)
crp
cAMP receptor protein (CRP); global
regulator; also known as CAP, catabolite
activator protein
cya
Adenylate cyclase
fdhF
FDH-H; formate dehydrogenase-H (FHL)
fhlA
FhlA; transcriptional activator for genes
encoding components of formate
hydrogenlyase
fnr
Fumarate nitrate reductase; global regulator;
involved in transcriptional regulation of
genes in anaerobic respiration
gal
Galactose metabolism
hyc
Hydrogenase isoenzyme 3 and putative electron
transfer proteins
hyf
Putative hydrogenase-encoding operon; silent
hyp
Proteins involved in hydrogenase (all 3
isoenzymes) maturation
moa
molybdopterin biosynthesis; previously chlA
mob
MGD biosynthesis; previously chlB
xii


mod
moe
mol
mog
pfl
rpoN
srl
Molybdate transport; previously chlD
MGD biosynthesis; previously chlE
undefined mutation in molybdate metabolism
MGD biosynthesis; previously chlG
Pyruvate formatelyase
Sigma-54 subunit of RNA Polymerase
Sorbitol utilization
Kill


Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy
GENETIC AND BIOCHEMICAL ANALYSIS OF THE MOLYBDATE-DEPENDENT
EXPRESSION OF HYC OPERON IN ESCHERICHIA COLI
By
William Thomas Self
December, 1998
Chairperson: Dr. K. T. Shanmugam
Major Department: Microbiology and Cell Science
Escherichia coli growing under anaerobic conditions
produces H2 and C02 by the enzymatic cleavage of formate
catalyzed by formate hydrogenlyase. The FHL complex
consists of a molybdoenzyme formate dehydrogenase-H (fdhF) ,
hydrogenase 3 (hyc), and intermediate electron carriers
(hyc). Transcription of both fdhF and hyc operons requires
FhlA protein as a transcriptional activator and both formate
and molybdate as small molecule effectors. In a modB mutant
(defective in molybdate transport) transcription of PhyclacZ
requires supplementation of the growth medium with
molybdate. Transcriptional activation of PhyclacZ by FhlA
protein also requires ModE-molybdate, a molybdate-dependent
repressor of modABCD operon (involved in molybdate
xiv


transport), and MoeA protein (required for activation of
molybdate). ModE-molybdate was shown to bind to hyc
promoter DNA (-204 to -177 with respect to the transcription
start site) upstream of the FhlA binding site in a DNase I
footprinting experiment. However, even in the absence of
ModE, molybdate-dependent transcription of hyc operon can
still be observed. Mutation in the moeA gene eliminated
this ModE-independent, molybdate-dependent activation since
in a modE, moeA double mutant, PhyclacZ was not expressed.
MoeA protein has been proposed to catalyze the initial
activation of molybdate for incorporation into
molybdopterin. It is proposed that the product of MoeA
protein is an effector for transcriptional activation of the
hyc operon. In the presence of formate, a mutant FhlA-126
protein with a single alteration (R495C) activated
expression of PhyclacZ even in the absence of molybdate. A
second mutant, FhlA-132, with two mutations (A42T and E363K)
also activated PhyclacZ in the absence of molybdate and the
level of expression was increased by both formate and
molybdate. Deletion of the unique N-terminal region of FhlA
created an effector-independent activator (FhlA165). All
three FhlA mutant proteins activated PhyclacZ in a modE, moeA
double mutant. Effector-independent activator FhlA165 also
activated transcription of hyf operon, a silent gene cluster
xv


with structural similarity to hyc. Based on these results,
a working model is proposed in which FhlA-formate-activated
molybdenum complex activates transcription of fdhF and hyc
operons and ModE-molybdate serves as a secondary activator
of transcription.
xvi


INTRODUCTION
Under anaerobic growth conditions, Escherichia coli
catalyzes cleavage of formate to H2 and C02 using the enzyme
complex formate hydrogenlyase (FHL; 10). This complex
includes a formate dehydrogenase isoenzyme (FDH-H; fdhF) a
hydrogenase isoenzyme (HYD3; hyc) and intermediate electron
carriers also encoded by the hyc operon (10). The FDH-H
contains selenium and molybdenum in the form of
selenocysteine and molybdopterin guanine dinucleotide (MGD),
respectively (13, 95). In addition to the requirement of
molybdenum for activity of FDH-H, transcription of both fdhF
and hyc operon also requires sufficient levels of molybdate
in the growth medium (71, 81). This requirement for
molybdenum for optimum level of transcription is apparently
universal for all molybdoenzyme synthesis in E. coli (17,
66, 71) .
Transcription of fdhF and hyc operons requires, besides
molybdate, FhlA protein as an activator, and formate (10,
11, 30, 53, 83). Additionally, the a54-dependent hyc operon
also requires integration host factor for optimum
1


2
transcription (30). The FhlA protein is similar to the NtrC
protein of E. coli (20, 63) and NifA protein of Klebsiella
pneumoniae (8, 20). These proteins contain three
distinguishable domains; an N-terminal unique region, a
central domain which includes the nucleotide triphosphate
binding motif and a C-terminal DNA-binding domain. The
second half of the three proteins, which includes the
central and C-terminal domains, shares significant
similarity. Based on analysis of several point mutants, the
unique N-terminal part of the FhlA protein is responsible
for formate interaction (41). These and other genetic and
physiological studies led to the conclusion that the FhlA-
formate complex is the activator of hyc operon (10, 41, 53).
Investigation of the regulation of transcription of
operons coding for molybdoenzymes in response to molybdate
is complicated by the requirement of Mo-containing cofactors
for the enzymatic activity of the gene products. Among the
several operons whose transcription requires molybdate, the
hyc operon is unique in that none of the proteins coded by
this operon contains the necessary amino acid sequence motif
found in molybdoenzymes for binding MGD (22). The fact that
the hyc operon does not code for a molybdoprotein allows the
molybdate-dependent regulation studies to be conducted


3
independent of the need for molybdate for activity of the
gene product.
Molybdate is transported in £. coli by a high-affinity
transport system, a member of the ABC-transporter family
(54, 92; see 26 for a review). This transport system
contains three proteins, ModABC, coding for the periplasmic-
binding protein, a membrane channel protein and an ATP-
binding, energizing protein, respectively. Mutation in
modAB or mode gene leads to a defect in molybdate transport
and transcription of the operons coding for the
molybdoenzymes in the cell is impaired in these mutants
(71). Supplementation of growth medium with molybdate
alleviates the defect and the molybdoenzymes are produced at
optimal levels.
Transport of molybdate into the cell is regulated by a
molybdate-sensitive repressor, ModE protein. The
interaction between ModE-molybdate complex and the modABCD
operator DNA has been well characterized (4, 24, 25, 26, 55,
57, 58). At present, the ModE protein is the only known
molybdenum response regulator in E. coli. Based on DNase I-
footprinting analysis, the ModE protein also binds to moa
promoter DNA but in a molybdate-independent manner (58).
A number of proteins are required for the biosynthesis
of MGD, and these are encoded by moa, mob, moe and mog genes


(36, 67). The role of the proteins encoded by moa, mob and
moeB in the biosynthesis of MGD is well established.
However, the physiological functions of the MoeA and Mog
proteins are not known. Hasona et al. recently proposed
that the MoeA protein plays a role in activation of
molybdenum (27). Although molybdate is required for
expression of hyc-lacZ, the regulation of transcription of
hyc operon utilizing $(hycD-lacZ) was found to be
independent of the components in the MGD biosynthetic
pathway (71). These results suggest that molybdopterin, Mo
cofactor or MGD is not needed for the molybdate-dependent
control of transcription of hyc operon. Apparently,
molybdate and/or an activated form of molybdenum is the
small molecule effector in this regulation.
Since hyc operon is unique in that it does not encode
molybdoenzyme but does requires molybdate for transcription
this operon was chosen to elucidate the mechanism of
regulation of molybdate-dependent transcription in E. coli.


LITERATURE REVIEW
Coupled electron transfer is the driving force behind
almost all energy-deriving processes in biological systems.
Peter Mitchell first proposed his chemiosmotic theory in
1967 (60), and this theory has been the foundation of
countless studies of energy metabolism in both eukaryotes
and prokaryotes. Bacteria, both aerobes and facultative
anaerobes, can utilize 02 as a terminal electron acceptor to
produce large amounts of ATP needed for growth. Escherichia
coli, a facultative anaerobe, can also utilize alternative
electron acceptors when oxygen is not available to generate
proton motive force which is then utilized both for
generation of ATP and for transport of nutrients. For E.
coli, these alternate electron acceptors include nitrate,
dimethyl sulfoxide and trimethylamine-N-oxide (34). Many of
the primary dehydrogenases and terminal reductases (e.g.
formate dehydrogenases, nitrate reductase, see refer. 34)
which are the components of these anaerobic respiratory
systems require molybdenum in the form of enzyme cofactor
molybdopterin guanine dinucleotide (MGD, 67). The study of
5


6
these molybdoenzymes and the uptake and processing of
molybdenum into MGD has proven to be an important aspect of
investigation into the anaerobic metabolism of E. coli.
The earliest studies of molybdate metabolism utilized
chlorate, an analogue of nitrate, to identify the genes
required for active molybdoenzymes (28, 88). Upon reduction
by the molybdoenzyme nitrate reductase, chlorate is
converted to the toxic form chlorite which exists in
solution as hypochlorite and is toxic to the cell. In order
for E. coli to grow in the presence of chlorate a mutation
must occur which eliminates NR activity. Since these
mutations can occur not only within the genes encoding the
NR enzyme itself, but also in the uptake of molybdate and
biogenesis of molybdenum cofactor, chlorate-resistance
became a powerful tool to identify the genes encoding
proteins involved in molybdate metabolism. These chlorate-
resistant mutants which were originally termed chi, have
been renamed mol (85). Although there were several classes
of mol mutants, only one class was found to be suppressed by
the addition of molybdate to the culture medium (23). These
mutants were presumed to be deficient in molybdate-uptake.
Molybdate Transport
Molybdenum is found in nature most abundantly in the
oxidized form of molybdate, and it is this form which is


7
actively transported by E. coli for use in molybdoenzymes.
A high-affinity transporter of molybdate, encoded by the
modABCD operon, has been characterized (54, 92). This
transporter, which consists of a periplasmic molybdate
binding protein, ModA (33, 68), an integral-membrane
channeling protein, ModB, and a cytoplasmic ATP-binding
energizer protein, Mode (54), resembles other ABC-type
transport systems (46). Although not known to be required
for high-affinity transport of molybdate, the product of
modD is proposed to be an outer-membrane protein, possibly a
molybdate porin (26). Mutation in either modA, modB or mode
eliminates the high-affinity uptake of molybdate and thus
all molybdoenzyme activity (3, 23, 54). Upon molybdate
supplementation of rich medium at a concentration of about
100 yM, molybdate is transported by a low-affinity, non
specific anion transporter which is yet to be identified
(26, 45, 54). Under sulfur-limiting conditions, the sulfate
transport system also allows transport of molybdate, as seen
by the restoration of molybdoenzyme activity in a mod mutant
grown in glucose minimal medium or medium limiting in sulfur
compounds (45, 71).
Transcription of modABCD operon is tightly regulated in
response to intracellular molybdate levels by the
transcriptional regulator protein ModE (25, 26, 55). ModE


8
acts as a molybdate-dependent repressor of modABCD
transcription by binding to the operator/promoter of modABCD
in the presence of molybdate. This molybdate-dependent
ModE-DNA-binding has been demonstrated in vitro in DNA
electrophoretic mobility shift experiments (24, 25) as well
as in DNase I-footprinting experiments (4, 24, 58).
Mutagenesis of the region of DNA from the modA
operator/promoter in which the ModE protein interacts
determined that inverted repeats of the sequence GTTA, as
well as pentameric sequences TACAT and TATAT, are important
in ModE-molybdate binding (24). Mutations in modE gene
which eliminated molybdate-dependent repression of modA-lac
as well as mutations in modE which prevent expression of
modA-lac in the presence or absence of molybdate have been
isolated and characterized in vivo (25, 55). Purified ModE
protein also has been shown to display an intrinsic
fluorescence, which was quenched upon addition of molybdate
(4). Using this property, the for ModE-molybdate
association was determined to be 80 nM (4).
In addition to interacting with molybdate, ModE protein
also apparently recognizes tungstate, an analog of
molybdate. In a modB mutant, tungstate can effectively
replace molybdate in the repression of transcription of
modA-lac in vivo, and this repression is mediated through


9
ModE-tungstate (24). Tungstate also supported efficient
ModE binding to modA operator DNA in a DNA electrophoretic
mobility shift experiment (24), although the affinity of
ModE-W042_ for DNA binding is about 10-fold lower than ModE-
molybdate. Tungstate also binds to ModE in vitro as seen by
a decrease in the intrinsic flourescence of purified ModE
protein (4). Although E. coli is not known to produce
tungsten-containing enzymes, hyperthermophiles such as
Pyrococcus furiosus have a number of tungsten-containing
enzymes (39). A tungsten-containing enzyme cofactor,
similar to MGD, apparently is more stable under high
temperatures. Tungstate, when present in E. coli culture
medium prevents production of active molybdoenzymes.
Whether this lack of activity in the presence of tungstate
is due to competition between molybdate and tungstate for
transport into the cell or competition between these two
similar anions during some step in MGD biosynthesis is not
known.
MGD Biosynthesis
Once transported, molybdate is incorporated into the
enzyme cofactor molybdopterin guanine dinucleotide (MGD) in
a series of reactions which have been characterized at the
biochemical level (Fig. 1; 67). Mutations in genes whose
products are required for MGD biosynthesis also arise in a


10
chlorate-resistance selection, and these mutants display a
pleiotropic null phenotype for the activity of all
molybdoenzymes. One such chlorate-resistant mutant has been
identified as having a mutation in the first gene in the
moeAB operon, the moeA gene. Hasona et al. (27)
demonstrated that a moeA mutant can be suppressed by
supplementing the culture medium with sulfide. Culturing
the moeA mutant strain in low-sulfur medium, which
derepresses the sulfate transport and activation system
(42), also allows for molybdoenzyme activity presumably by
production of endogenous sulfide from the products of cys
genes (27) Based on these observations, the product of
moeA has been proposed to be involved in the initial
activation of molybdate upon transport into the cytoplasm
(27). MoeA and Mog proteins are probably involved in
activation and incorporation of Mo into molybdopterin in the
synthesis of Mo-cofactor (Fig. 1).
Other chlorate-resistant mutants allowed identification
of genes and gene products involved in the organic component
of MGD biosynthesis (67, 74; Fig. 1). The gene products of
moaABC are involved in the synthesis of the Precursor Z from
a guanosine derivative termed Guanosine-X. This precursor Z
is then converted to Molybdopterin by the products of moaDE
genes and the product of moeB. Though it does not contain


11
MoaA MoaB
Precursor Z (5,8-H2)
MoaD
MoaE
MoeB
Figure 1. Molybdopterin guanine dinucleotide biosynthetic
pathway in E. coli. (adapted from Ref. 67)


12
molybdenum, molybdopterin is a sulfurylated form of
precursor Z. In what is assumed to be the final step, the
guanine nucleotide is added by the products of the mobAB
operon. However, some of these reactions are inferred from
genetic and physiological data, and until the complete
biosynthesis of MGD is reconsitituted with purified proteins
in vitro, care must be taken when considering these proposed
reactions in context with physiological effects in vivo.
Formate Hydrogenlyase
All molybdoenzymes studied so far in E. coli contain
the MGD cofactor. The crystal structure of one of these
molybdoenzymes, formate dehydrogenase H (FDH-H) has been
determined (13). This crystal structure confirmed the
proposed structure of MGD in E. coli. FDH-H, encoded by the
fdhF gene (95), is part of an enzyme complex formate
hydrogenlyase. Formate hydrogenlyase carries out the
enzymatic conversion of formate to H2 and C02 during
fermentation (10). The overall reaction catalyzed out by
the formate hydrogenlyase, though not known to be energy
conserving, is beneficial to an anaerobically growing E.
coli cell since it reduces the amount of one of the acidic
end products of fermentation, formate. Besides FDH-H, the
FHL complex also contains hydrogenase 3 (HYD3, encoded by
hyc operon) as well as electron carrier proteins (also


13
encoded by hyc) which link the oxidation of formate to C02
by the FDH-H to the evolution of dihydrogen by HYD3 (78).
Formate hydrogenlyase complex can readily be assayed in
whole cells and extracts by the formate-dependent evolution
of dihydrogen.
The hyc operon contains nine open reading frames,
hycABCDEFGHI, and all genes except for hycA are required for
FHL activity (78). The product of hycA negatively regulates
transcription of hyc operon by an as yet undefined mechanism
(78). The product of hycE resembles the large subunit of
hydrogenases and is presumed to be the structural protein
for HYD3 (78). The product of hycl is a protease required
for the maturation of the HycE structural protein (72). The
remaining gene products of the hyc operon are presumed to be
involved either in processing, or insertion of HYD3 within
the cytoplasmic membrane, or to serve as electron carriers
linking FDH-H to HYD3 in the membrane-bound FHL complex.
Hydrogenase 3 isoenzyme, a [NiFe] hydrogenase, also requires
the products the hypB, hypC, hypD and hypE genes for
maturation (35). The hyp operon, whose gene products are
required for the activity of two other hydrogenase
isoenzymes in E. coli, hydrogenase 1 (HYD1) and hydrogenase
2 (HYD2), lies adjacent to the hyc operon and is transcribed
in the opposite direction (35, 49).


14
Both the hyc and hyp operons as well as the fdhF gene
are regulated positively by the transcriptional activator
FhlA (53, 77, 81, 82). FhlA, a member of the NtrC family of
transcriptional activators (61), activates transcription of
these genes in the presence of formate, the substrate for
FHL (53, 82). This activation also requires the alternative
sigma factor, a54, of RNA polymerase (30, 52, 53). Purified
FhlA has been shown to bind to DNA upstream of hyc, hyp and
fdhF genes (83), and to activate transcription of hyc operon
in vitro in a transcription/translation experiment in
response to the effector formate (30). In addition, FhlA
has an intrinsic ATPase activity similar to that of the
phosphorylated form of NtrC protein (31, 94) and this
activity responds positively to both formate as well as DNA
from the hyc upstream region (31).
The FhlA protein has three distinct domains; an N-
terminal unique domain with little similarity to other NtrC-
type activators; a central domain which contains a
nucleotide binding motif; and a C-terminal DNA-binding
domain (53, 82). Although some of the activators of the
NtrC family are phosphorylated by a cognate sensor protein
(e.g. NtrB, 61), the FhlA is one of a handful of activators
which is not phosphorylated. The N-terminal region
apparently interacts with the effector formate in such a way


15
to allow a conformational change in the FhlA which in turn
promotes the binding of DNA in the upstream regions of hyc,
hyp, and fdhF genes. Once bound to the upstream region, a
subsequent energy-dependent interaction with o54-bound RNA
polymerase promotes the initiation of transcription (30,
31). Mutants of FhlA which allowed expression of hyc operon
in the absence of formate have been isolated, and these
mutations altered amino acids within the unique N-terminal
domain (41) These mutant FhlA proteins displayed a higher
level of intrinsic ATPase activity as well as activating
transcription of hyc-lac to a higher level than that of the
native FhlA.
In addition to g54, FhlA and formate, transcription of
both fdhF and hyc operon also requires molybdate (71, 81).
Transcription of genes encoding other molybdoenzymes (e.g.
narGHJI encoding nitrate reductase and dmsABC encoding
dimethylsulfoxide reductase) has also been shown to require
molybdate for optimal expression (17, 64). Although it is
logical that the cell respond to the presence of
intracellular molybdate in the expression of molybdoenzymes
and molybdenum-requiring enzyme complexes (FHL complex), the
mechanism by which molybdate is sensed in this regulation
has not been established. Because transcription and
translation are closely linked in E. coli, analysis of


expression of operons which encode molybdoenzymes which
require molybdate at the transcriptional level could be
influenced by the need for the cofactor MGD. Because hyc
operon itself does not encode a molybdoenzyme but still
requires molybdate for transcription, hyc operon provides
unique opportunity to investigate the mechanism of this
molybdate-dependent gene expression in E. coli.


MATERIALS AND METHODS
Bacterial Strains
The bacterial strains, phages and plasmids used in this
study are listed in Tables 1 and 2. All strains are
derivatives of E. coli K-12.
Media and Growth Conditions
Media used for bacterial growth were previously
described (72). L-broth (LB) which served as rich medium
was supplemented with glucose (0.3%), sodium formate (15 mM)
or sodium molybdate (1 mM), as needed. Antibiotics, when
included, were at the following concentrations: ampicillin,
100 pg/mL; tetracycline, 30 pg/mL; chloramphenicol, 50 pg/mL
(plates), 10 pg/mL (liquid); kanamycin, 50 pg/mL.
Transduction with phages PI and X was performed as
previously described (72). Genetic and molecular biological
experiments were performed essentially as previously
described (25, 54, 72). Deletion mutants were constructed
after insertion of TnlO and excision. Tetracycline-
sensitive deletion derivatives were selected using fusaric
acid medium (9, 50).
17


18
Table 1. Bacterial Strains and phages used in this study
Strain or phage
Relevant genotype
Source/Reference
Strains
BL21(DE3)
ompT gal dcm Ion hsdSB XDE3
Laboratory collection
BW545
A(lacU)169 rpsL
Laboratory collection
MC4100
araD139 A(argF-lacU) 169 rpsL150
Laboratory collection
MR93
relAl flbB5301 deoCl ptsF25 rbsR
pcnB80 zad2084::Tnl0
CGSC# 7066
RK4353
MC4100 gyrA219 non-9
Laboratory collection
VJS720
modB247::Tn10
V. Stewart
VJS1779
moeA251::Tn10
V. Stewart
VJS1780
mob252::Tn10
V. Stewart
VJS1782
moa254::Tn10
V. Stewart
VJS1784
mog256::Tn10
V. Stewart
YMC18
endA thi hsdR Alac rpoN::Tn10
B. Magasanik
SE1174
fhlA102::Tn10
Laboratory collection
SE1188
fnr zcj::TnlO
Laboratory collection
SE1265
pfl-1 zba::Tn10
Laboratory collection
SE1781
MC4100 (hycD-lacZ) Alac Aebg
Laboratory collection
SE1906
modB::Tn10
Agal-modB) lacZ::TnlO
Laboratory collection
SE1910
BW545 A(modE-Km)2
(25)
SE1978
BW545 AmodF-Km
Laboratory collection
SE1980
BW545 AmodEF-Km
Laboratory collection
SE1989
BW545 Acya-Km crp*
Laboratory collection
SE2147
BW545 moeA113 zbiK-Km zbj::TnlO
(27)
AH30
moeB-Km zbj::TnlO
(27)
WS219
RK4353 a(hyfB-G)-Cm
This study
(fhlA-lacZ)
derivatives
SE2007
MC4100 (fhlA-lacZ)
(52)
SE1762
SE2007 modB247::TnlO
SE2007 X (PI)VJS720
MJ101
SE2007 rpoN::TnlO
SE2007 X (PI)YMC18
WS151
SE2007 fnr zcj::TnlO
SE2007 X (PI)SE1188
WS152
SE2007 pfl-1 zba::TnlO
SE2007 X (PI)SE1265
Derivatives
of
SE1497 A(srl-fhlA)
SE1497
cysC43 srl-300::Tn10 thr-1
Laboratory collection
WS113
leu-6 thi-1 proA2 galK2 ara-14
xyl-5 mtl-1 lacYl his-4 argE3
rpsL31 tsx-33 A(srl-fhlA)
SE1497 Alac Amod XWS1
This study
WS118
WS113 pfl-1 zba::Tn10
WS113 X (PI)SE1265
WS127
WS113 Agal mod*
This study
WS131
WS113 rpoN::Tn10
WS113 X (PI)YMC18
WS132
WS127 pfl-1 zba::Tn10
WS127 X (PI)SE1265
WS198
WS113 A(modE-Km)2 moeA113 (modABC)*
This study


19
Table 1. (continued)
Strain
or phage Relevant genotype
Source/Reference
Derivatives of WS160 (hyc*, fhlA*)
WS160
BW545
AWS1
This
study
WS161
WS160
A (modE-Km) 2
WS160
X
(PI)SE1910
WS162
WS160
modB247::Tn10
WS160
X
(PI)VJS720
WS163
WS160
moeA251::Tn10
WS160
X
(PI)VJS1779
WS164
WS160
mob252::Tn10
WS160
X
(PI)VJS1780
WS165
WS160
mog256::Tn10
WS160
X
(Pi)VJS1784
WS167
WS160
moeA113 moeB+ zJbiK-Km
WS160
X
(PI)SE2147
WS168
WS160
AmodF-Km
WS160
X
(Pi)SE1978
WS169
WS160
AmodEF-Km
WS160
X
(PI)SE1980
WS172
WS161
moeA113 zbj::TnlO
WS161
X
(PI)SE2147
WS174
W3161
mob252::Tn10
WS161
X
(PI)VJS1780
WS175
WS160
moa254::Tn10
WS160
X
(PI)VJS1782
WS178
WS161
modB247::Tn10
WS161
X
(PI)VJS720
WS190
WS160
moeB-Km
WS160
X
(PDAH30
WS191
WS161
moeA113 pcnB80
This
study
WS192
W3161
Amods pcnB80
This
study
WS193
WS161
moa252::Tn10
WS161
X
(PI)VJS1782
WS194
WS161
mog256::TnlO
WS161
X
(PI)VJS1784
4> (hyfA-
lacZ) derivatives
WS222
RK4353 AWS4
This
study
WS228
WS222
fhlA:TnlO
WS222
X
(PI)SE1174
WS229
WS222
rpoN::Tn10
WS222
X
(PI)YMC18
WS230
WS222
fnr zcj::TnlO
WS222
X
(PI)SE1188
WS231
WS222
moeA113
WS222
X
(PDWS167
WS232
WS222
Ahyf-Cm
WS222
X
(PI)WS219
WS233
WS222
pfl-1 zba::Tn10
W3222
X
(PI)SE1265
WS234
WS222
Acya-Km
WS222
X
(PI)SE1989
WS235
WS222
modB247::Tn10
WS222
X
(PI)VJS720
WS236
WS222
A(modE-Km)2
WS222
X
(PI)SE1910
WS237
WS234
Acya-Km crp*
WS234
X
(PI)SE1989
Phages
PI
Tn9 Cm" clr-100
Laboratory
collection
ARZ5
\ 'bla 'LacZ
Laboratory
collection
AWS1
A bla+ PbyclacZ
This study
AW34
A bla+ O{hyfA-lacZ)
This study


20
Table 2.
Plasmids used in this study
Plasmid
Relevant genotype
Source/Reference
pAGl
pTrc99a modE
(25)
pAM4
pUC19 modA operator/promoter, ApR
(24)
pFGHlOO
pUC19 hypA hycA hycB' ApR
Lab collection
pHYCPl
pACYC177 hypA' -Bhyc (Psti-BstElI) KmR
This study
pHYCl
pACYC177 hypA' -BhyclacZ KmR
This study
pHYC3
pBR322 hypA' -BhyclacZ, ApR
This study
pRM22
pT7-7 -(modEF)*
(25)
pWS2
pACYC184 fhlA\ Cm"
This study
pWS9
pT7-7 fhlA\ ApR
This study
pWS16
pT7-7 fhlAl65, ApR
This study
pWS57
PACYC184 fhlA57, CmR
This study
pWS7 0
pACYC184 fhlA70, CmR
This study
pWS126
PACYC184 fhlA126, CmR
This study
pWS132
PACYC184 fhlA132, Cm"
This study
pWS164
pACYC184 fhlAl64, CmR
This study
pWS165
PACYC184 fhlAl65, CmR
This study
pWS166
pACYC184 fhlAl66, CmR
This study
pWS31
pAGl CmR modiT
This study
pWS32
pAGl CmR modE (A76V)
This study
pWS33
pAGl CmR modE (G133D)
This study
pWS34
pAGl Cm" modE (252*)
This study
pWS35
pAGl CmR modE (216*)
This study
pWS36
pAGl CmR modE (T125I)
This study
pWS40
pUC19 Phyc ApR
This study
pWS42
pBR322 hep hyfABCDEFGHIR', ApR
This study
pWS43
pBR322 bep hyfA', ApR
This study
pWS44
pBR322 bep hyfA-lacZ, Ap"
This study
pWTS3
pWS42 Ahyf-Cm, ApR
This study
pWT37
pET15b modE*, ApR
This study
pWTS5
pET15b modE(T125I), ApR
This study
pWTS6
pET15b modE(216*), ApR
This study
pWTS8
pET15b modE (A76V), ApR
This study
pZCam
pZ1918 CmB lac~
Laboratory collection
pZ1918
1lacZ ApR
(84)


21
Construction of PbyclacZ
For construction of a lacZ fusion with the hyc promoter
DNA, a 0.5-kb Pstl-BstEII fragment from plasmid pFGHlOO
containing the intergenic region between the hyc and hyp
operons (Fig. 2) was cloned into a 3.0-kb Pstl-BstEII
fragment of plasmid pACYC177, yielding plasmid pHYCPl. A
3.2-kb Smal fragment containing a promoterless lacZ gene
from plasmid pZ1918 (84) was cloned into the BstEII site of
pHYCPl after digestion with BstEII and filling in the 3'
recessed ends with the Klenow fragment of DNA polymerase I
(Fig. 2). In plasmid pHYCl, the promoterless lacZ gene is
cloned 6 base pairs upstream of the 'A' in the translation
start codon 'ATG' for hycA at position +21 with respect to
the transcription start. The hyc promoter DNA with lac
fusion was removed from pHYCl as a 4.8-kb Pspl406I-SmaI
fragment and cloned into a 4.2-kb Clal-EcoKV fragment of
plasmid pBR322 yielding plasmid pHYC3. The hyc promoter-
lacZ fusion (PhycIacZ) was transferred from plasmid pHYC3 by
recombination in vivo to RZ5 in the construction of WS1
using procedures described previously (72).
Construction of (hyfA-lacZ)
In order to construct a lacZ operon fusion for
transcriptional analysis of hyf operon, a 4.3 kb BcoRI-


22
hypA -j ^ hyc A Aye#
1 1
FhlA j
1 1
FhlA
r *
1 1
P M
IHF
1
1 Bs
hyc promoter hyp promoter
pHYCl
Figure 2. Location of lacZ in PhyciacZ. Top line represents
chromosomal DNA from the hyc-hyp intergenic region. Bottom
line represents the chromosomal DNA present in plasmid pHYCl
and location of insertion of lacZ in the hyc operator DNA.
Black boxes indicate the binding sites for both FhlA and
IHF. Bent arrows represent transcription start sites for
hyc and hyp operons. Restriction endonuclease sites shown
are as follows: P=PstI, M=MluI, Bs=BstEII.


23
HindIII fragment from a Kohara lambda clone #424 (40) which
carries the upstream DNA from the hyf operon and neighboring
genes was cloned into plasmid pBR322 which had been cleaved
with the restriction endonucleases EcoRI and HindIII. The
resulting plasmid, pWS43, was modified by inserting a 3.2 kb
HindIII fragment from plasmid pZ1918 (84) which carries a
promoterless lacZ gene into the HindIII site. The
consequent plasmid, pWS44, carries a hyfA-lacZ fusion which
is adjacent and opposite in orientation to the bla gene.
This hyfA-lacZ fusion was recombined in vivo into ARZ5 as
previously described (72).
Construction of ahyf
In order to construct a chromosomal deletion of the hyf
operon, a 12-kb NdeI fragment from Kohara lambda clone #424
(40) was cloned into the plasmid vector pBR322 which had
been cleaved with the restriction endonuclease Wdel. The
resultant plasmid, pWS42, which carries hyfABCDEFGHIR' was
hydrolyzed with restriction enzyme NsiI. Digestion with
this enzyme released a 5.6 kb fragment from within the hyf
operon between hyfB and hyfG. A 1.0 kb Pst I fragment from
pZCam carrying the CmR gene was then ligated to the 12.0 kb
NsiI fragment from plasmid pWS42. The resultant plasmid
from this ligation, pWTS3, carries the gene for Cm
resistance in an orientation opposite to that of the


24
hyf operon transcription and thus the insertion should have
polar effect on the expression of downstream genes.
Insertion of the gene for CmR interrupts the hyfB gene and
the deletion of hyf extends into the coding sequence of hyfG
gene. In order to replace the wild type hyf DNA in the
chromosome with the Ahyf-Cm. DNA, an 8.0 kb NdeI fragment
from pWTS3 containing CmR gene and neighboring hyf genes,
was removed and self-ligated. This circular DNA lacks the
gene coding for ampicillin resistance and the origin of
replication. Approximately 1 pg of the self-ligated 8.0 kb
NdeI fragment was transformed into strain RK4353 and plated
on L-agar plates containing 50 pg/mL chloramphenicol.
Transformants were selected and restreaked to obtain single
colonies and then analyzed for the presence of any extra-
chromosomal DNA by standard alkaline lysis procedures. One
clone which was a stable CmR transformant and contained no
visible extrachromosomal DNA was designated WS219 and used
in further studies.
Mutagenesis of fhlA
The fhlA gene was removed from plasmid pSE133 (77) as a
2.4 kb Spel-Clal fragment and ligated to a 4.2 kb Xbal-Clal
DNA fragment of plasmid pACYC184 to yield plasmid pWS2.
Hydroxylamine mutagenesis of plasmid pWS2 was carried out as
previously described (25). Hydroxylamine-treated plasmid


25
population was transformed into strain WS113 {A{srl-fhlA),
A mod, P hyclacZ) } and the transformants were selected on L-
agar plates with ampicillin, chloramphenicol and X-gal.
Blue colonies were selected, grown in LBG mediumimolybdate
under anaerobic conditions and assayed for p-galactosidase
activity. This selection yielded fhlA alleles fhlA57 and
fhlA70.
The central region of the fhlA gene flanked by EarI and
PstI sites in plasmid pWS2 was also mutated by PCR-mediated
mutagenesis. The primers used to amplify the central domain
of the fhlA gene were 5'GACGCAGGTGGGCTA3' and
5'ACACGGTGCCTGACT3'. Heat stable DNA polymerase (Biometra,
Tampa, FL) lacking proofreading activity was used to amplify
the 1.9-kb DNA fragment. The PCR product, after agarose gel
electrophoresis and elution, was cleaved by Earl and PstI
restriction endonucleases. This PCR-derived fragment pool,
which also included mutations introduced during
amplification by the DNA polymerase, was used to replace the
corresponding native fragment in the fhlA gene in plasmid
pWS2. The resultant ligation mixture was transformed into
strain WS113 and blue colonies were selected on L-agar
medium supplemented with ampicillin, chloramphenicol and X-
gal. This procedure yielded fhlA alleles fhlA126 and
fhlA132.


26
Internal deletion mutations within the fhlA gene were
isolated by Bal31 Nuclease treatment of plasmid pWS2
linearized by the restriction endonuclease Hpal. Nuclease
Bal31 reactions were stopped at 5, 10, and 15 minutes by
ethanol and the DNA was precipitated. After ligation using
T4 DNA ligase, the mixture was transformed into strain
SE1174 [fhlA::TnlO) and colonies expressing FDH-H activity
were selected by dye-overlay procedure as described
previously (45). This procedure yielded fhlA alleles
fhlAl 64, fhlAl 65, and fhlA166.
The location of the mutation in each mutant fhlA allele
was determined by sequencing both strands of the entire fhlA
gene by the Sanger dideoxy sequencing method (53, 75). DNA
sequence was analyzed using the software Genepro (Riverside
Scientific, Seattle, WA).
Enzyme Assays
Cells were grown and harvested for enzyme assays as
described previously (25, 72). p-galactosidase activity in
whole cells was determined with chloroform-sodium dodecyl
sulfate-permeabilized cells as described by Miller (59).
Specific activities expressed as nanomolesmin-1 milligram
cell protein-1 are the average of at least 3 independent
experiments and varied by less than 15%. FHL activities


27
were determined using whole cells as previously described
(44) .
Purification of FhlA Protein
The strain used for high-level expression of the fhlA
gene was strain BL21(DE3), which contains an undefined
mutation in the mod operon (unpublished data). This allowed
production of FhlA protein without possible intracellular
molybdenum contamination by culturing the cells in medium
without molybdate supplementation. All buffers, media and
solutions used during the culture of the organism,
expression and purification of FhlA protein were prepared
using "nanopure" deionized water in order to minimize
molybdate contamination of the FhlA protein during
purification.
Plasmid pWS9, which carries fhlA under the control of
phage T7 gene 10 promoter (89), was constructed by cloning a
2.4-kb Xbal-Clal fragment from pSE133 (77) into the plasmid
expression vector pT7-7 cleaved with XbaI and Clal
restriction enzymes. Strain BL21(DE3) was transformed with
plasmid pWS9 and plated on L-agar with ampicillin. Fresh
transformants were transferred from plates into 2 liters of
LB with ampicillin in 2.8 liter Fernbach flasks (1
liter/flask). The cultures were grown with shaking (225
rpm) at 37C until an optical density of 0.7 (420 nm,


28
Spectronic 710) was reached. After adding IPTG to a final
concentration of 0.5 itiM, the cultures were incubated at 23C
with shaking (225 rpm) for an additional 6 hours. The cells
were harvested and washed once with Tris-buffer (50mM Tris
pH 8.0; 0.5 mM EDTA; 1 mM benzamidine; 1 mM dithiothreitol).
The cells were resuspended in 25 mL of Tris-buffer, and
broken by passage through a French pressure cell at 20,000
lb-in'2 and then centrifuged at 30, 000 x g for 2 hours. The
supernatant fraction was loaded on Q-sepharose (30 cm X 2.5
cm; Pharmacia Biotech, Piscataway, NJ), and the column was
washed with Tris-buffer. Proteins were eluted with a linear
gradient of NaCl (0-0.4 M) in Tris-buffer. FhlA protein
eluted at approximately 0.37 M NaCl. FhlA containing
fractions, as determined by SDS-PAGE analysis, were pooled
and dialyzed overnight in Tris-buffer. This fraction was
loaded on a 5 mL Hi-Trap Heparin column (Pharmacia Biotech)
and the proteins were eluted using a linear NaCl gradient
(0-0.4 M). The FhlA protein eluted at approximately 0.3 M
NaCl. FhlA-containing fractions were pooled and dialyzed
overnight in HEPES buffer (30 mM, pH 7.0; 0.5 mM EDTA; 1 mM
Benzamidine; 1 mM DTT). This dialyzed sample was loaded on
a 1 mL Hi-S column (cation exchange, Bio-Rad Laboratories,
Hercules, CA) pre-equilibrated with the same HEPES buffer
and eluted with a linear gradient of 0-0.5 M NaCl. FhlA
protein was eluted at approximately 0.25 M NaCl and the


29
fractions containing FhlA protein were dialyzed overnight in
HEPES buffer. This sample was then chromatographed on 1 mL
Hi-Q (anion exchange, Bio-Rad) column equilibrated with
HEPES buffer and the FhlA protein was eluted using a linear
gradient of sodium citrate from 0-0.3 M. The pure FhlA
protein, as judged by SDS-PAGE analysis, was dialyzed in
HEPES buffer (25 mM, pH 7.0; 0.8 mM DTT; 10% glycerol) for
storage. Samples were aliquoted, quick frozen in liquid
nitrogen, and stored at -70 C.
Purification of FhlA165 Protein
FhlA165 protein was purified essentially as described
by Schlensog et al. (83), with minor changes. Plasmid
pWS16, which carries fhlA165 under the control of phage T7
gene 10 promoter (89), was derived by ligating a 1.4 kb
BstBI-Clal fragment from plasmid pWS165 containing fhlA165
into the single Clal site in the multiple cloning site of
plasmid pT7-7 (91). Strain BL21(DE3) was transformed with
plasmid pWS16 and plated on L-agar with ampicillin. Fresh
transformants were transferred into 1 liter of LB with
ampicillin in a 2.8 liter Fernbach flask. The culture was
grown with shaking (225 rpm) at 37C until an optical
density of 0.7 (420 nm, Spectronic 720) was reached. The
inducer IPTG was added to a final concentration of 0.34 mM
and the culture was incubated at 37C with shaking (225 rpm)


30
for 3 more hours. The cells were harvested and washed once
with Tris-buffer, pH 8.0 (50mM Tris pH 8.0; 0.5 mM EDTA; 1
mM benzamidine; 1 mM dithiothreitol). The cells were
resuspended in 12 mL of Tris-buffer, and broken by passage
through a French pressure cell operating at 20, 000 lb*in-2
and then centrifuged at 30,000 x g for 30 minutes. The
supernatant (14 mL) was subsequently centrifuged for 2 hours
at 120,000 x g. This resulting supernatant was brought to
an ammonium sulfate concentration of 37%. This sample was
then centrifuged for 30 minutes at 30,000 x g. The
resulting pellet was dissolved in 1.2 mL of Tris-buffer, pH
7.5 (50 mM Tris, pH 7.5; 0.5 mM EDTA; 1 mM benzamidine; 1 mM
dithiothreitol). This sample was dialyzed overnight in the
same Tris-buffer. Unlike the wild type FhlA protein, which
precipitates out of solution at this step (83), FhlA165
remained in solution. This dialyzed sample was loaded on
Heparin agarose (40 mL column, Pharmacia), washed with Tris-
buffer, pH 7.5, and eluted with a linear gradient of KC1 (0-
0.5 M). FhlA-containing fractions as determined by SDS-PAGE
analysis were pooled and dialyzed overnight in Tris-buffer
(pH 7.5). This fraction was loaded on Q-sepharose (12 mL;
Pharmacia Biotech) and the proteins were eluted using a
linear KC1 gradient (0-0.4 M) in Tris-buffer, pH 7.5. The
FhlA165 protein eluted at approximately 0.3 M NaCl. FhlA
containing fractions were pooled and dialyzed overnight in


31
Tris-glycerol buffer (25 mM; pH 7.5; 1 mM EDTA; 50%
glycerol). This sample was judged to be >99% pure based on
SDS-PAGE analysis and was stored at -20 C.
Purification of Native ModE
ModE protein from plasmid pRM22 was purified as
described previously (25).
Purification of Native and Mutant ModE proteins
Polymerase chain reaction was utilized to amplify the
wild type modE as well as mutant modE alleles from plasmid
pAGl and its mutant derivatives using two primers;
5'GGACATTCATATGCAGGCCGAAATC-3' and 5'-
GCGGATCCTTAGCACAGCGTGGCGA-3'. Restriction sites Ndel and
BamHI were engineered into the primers in order to clone the
PCR product into the expression vector pET15b (Novagen,
Madison, WI). The protein(s) expressed from this vector
would include an additional N-terminal sequence of six
histidines which are separated from the ModE protein by a
linker containing thrombin protease cleavage site. The PCR
products were treated with phenol-chloroform and
precipitated with ethanol. A sample of each reaction was
digested with NdeI and BamHI and the 0.8-kb fragment was
purified by agarose (0.8 %) gel electrophoresis. The modE-
DNA and mutant ModE-DNA were ligated to a 5.7-kb fragment of
plasmid pET15b, also digested with the same restriction


32
endonucleases and purified after agarose gel
electrophoresis. The resultant plasmids which contain the
modE (pWTS7) and various modE mutant alleles (pWTS5, pWTS6
and pWTS8) under the transcription control of phage T7 gene
10 promoter were used for high-level expression of native
ModE and its mutant proteins. The mutation in each plasmid
containing the mutant modE allele was confirmed by
sequencing the entire modE gene in the pET15b-derived
plasmids.
Each of the ModE proteins was purified as follows.
Strain BL21(DE3) carrying pET15b-modE derivative was grown
in 250 mL of L broth with shaking (225 rpm) at 37C. When
the optical density of the culture reached 0.7 (420 nm;
Spectronic 710 spectrophotometer), IPTG was added to a final
concentration of 0.1 mM. Temperature of incubation was
reduced to 23C and the culture was incubated for an
additional 3 hours. The cells were harvested, washed once
with Tris-buffer (50mM Tris, pH 8.0) and resuspended in 25
mL of Tris-buffer. Cells were broken by passage through a
French pressure cell operating at 20, 000 lb*in"2 and the
extract was clarified by centrifugation at 27,000 x g for 30
min at 4C. The supernatant was filtered through a 0.2 pm
filter (Gelman Sciences) and then loaded on a HiTrap
chelating column (Pharmacia Biotech). The column was pre-


33
equilibrated with NiCl2 (40 mM in Tris-buffer) and free Ni
was removed by washing the column with 10 volumes of Tris-
buffer. After loading the sample, unbound proteins were
washed off the column with Tris-buffer. Tris-buffer
containing 50 mM imidazole was used to remove the proteins
bound nonspecifically to the matrix. The ModE protein was
eluted with 0.3 M imidazole in Tris-buffer. After adding
CaCl2 to a final concentration of 2.5 mM, thrombin protease
(25 units; Pharmacia) was added to the ModE preparation to
remove the N-terminal His-tag sequence. The thrombin-ModE
mixture was incubated for 16 hours at 4C. After cleavage
was complete, based on SDS-PAGE analysis, the sample was
loaded on a HiTrap Heparin column (5 mL; Pharmacia) to
separate ModE from thrombin. After washing the column with
five volumes of Tris-buffer to remove unbound thrombin, ModE
was eluted with 0.3 M NaCl and was determined to be pure by
SDS-PAGE. ModE protein was dialyzed overnight in 50mM Tris
(pH 8.0) containing 0.5 mM dithiothreitol and stored on ice
until use. This protein was found to be stable for several
months. ModE proteins purified by this Ni-affinity method,
contained an extra three amino acids (Gly, Ser, His) in the
N-terminus and are designated *ModE to denote this
alteration. Although a major fraction of the mutant ModE
proteins expressed from plasmid vector pET15b-derivatives
formed insoluble complexes, a significant portion of the


34
protein remained in the soluble, presumably native, form.
The mutant ModE proteins present in the soluble fraction
were purified using the above described procedure.
Determination of Protein Concentration
Concentrations of protein preparations were determined
using Comassie Blue as previously described (14) with bovine
serum albumin as a standard.
DNase I-Footprinting Experiments
DNase I protection experiments were performed
essentially as previously described (24, 69). For
experiments involving hyc promoter DNA and ModE protein, a
396-bp DNA containing the hyc operator/promoter DNA was
obtained after hydrolysis of plasmid pFGHlOO by
endonucleases PstI and Sail and purification using a 10-30%
sucrose gradient (76). The Sail-end of the DNA was labeled
with 32P by filling in with Klenow and all four a-32P-labeled
dNTP's (DuPont-NEN). Unincorporated dNTP's were separated
from the labeled fragment using a G-25 spin column
(Pharmacia Biotech). Protein present in this eluent (heat-
inactivated Klenow) was precipitated using 2.5 M potassium
acetate and removed by centrifugation as previously
described (18) The labeled DNA was precipitated using two
volumes of 100% ethanol and recovered by centrifugation.


35
The DNA was resuspended in TE Buffer and stored at 4 C at
approximately 50,000 CPM/pl.
To facilitate binding of ModE protein to the DNA, a
mixture of buffer (10 mM Tris, pH 7.9, 10 mM MgCl2, 50 mM
NaCl, and 1 mM DTT), ModE protein and labeled DNA (50,000
CPM) was prepared in a volume of 19 pi and incubated at 37C
for 20 min. Molybdate was included in this reaction at a
final concentration of 0.1 mM, as needed. Unprotected DNA
was hydrolyzed by the addition of 1 pL of DNase I (Sigma;
0.9 ng/pl) to the final reaction mixture (20 pi). After 4
min of incubation at room temperature, DNase I activity was
stopped by addition of 5 pi of 200 mM EDTA to the reaction
and the proteins were hydrolyzed by inclusion of 1 pi of
Proteinase K (Sigma; 1 pg/pl; 15 min at 37C). Remaining
trace amounts of proteins were removed by 2.5 M ammonium
acetate precipitation. After addition of 1 pg of yeast
tRNA, nucleic acids were precipitated with 2 volumes of 100%
ethanol. Each sample was resuspended in 4 pi of formamide
loading buffer (69) and loaded on a 8% polyacrylamide
denaturing gel for electrophoresis at 50 watts for 100
minutes. The gel was dried and exposed to pre-flashed X-ray
film.
DNase I-protection experiments involving modA operator
DNA and ModE protein were carried out as described above for


36
hyc promoter DNA. For these experiments, a 446-bp Fspl-
Hindlll fragment from plasmid pAM4 which carries modA-
operator/promoter DNA spanning from -247 to +25 was used.
The DNA was labeled using a-32P-labeled dNTP's (Dupont-NEN)
and Klenow to fill in the Hindlll end.
ATPase Activity
ATPase activity of FhlA was determined as described
previously (41).
DNA Electrophoretic Mobility Shift Experiments
DNA-mobility shift experiments were performed
essentially as previously described (25). All solutions
used for the experiments were made with 'nanopure' deionized
water without further treatment to remove trace levels of
contaminating molybdate.
ModE. A 396-bp Pstl-Sall fragment from plasmid pFGHlOO
was used as the target DNA for the shift experiment. This
fragment, which also contains the DNA upstream of the FhlA
binding site (83), was labeled with 32P-dNTP's by filling in
the recessed 3' end of the BstEII site with the Klenow
enzyme. ModE protein was pre-incubated with binding buffer
(10 mM Tris, pH 7.5, 1 mM EDTA, 1 mM dithiothreitol) for 2
minutes at 37 C before the labeled DNA was added. Binding
reactions were incubated for 30 minutes at 37 C. Gels were
pre-run at 100 V for 60 minutes at room temperature and run


37
for 60 minutes at 100 V with buffer recirculation after
loading the samples. The gels were dried and exposed to X-
ray film. Sodium molybdate was added at a final
concentration of 1 mM in the 5% polyacrylamide gel,
circulating TBE buffer, and the binding reactions, as
needed.
FhlA. FhlA target sequence (83) in hyc promoter was
amplified by PCR using two primers; 5'-
CCGGATCCGTTATTTCGAGCATATC-3' for the 5' end and 5'-
CCCTGCAGTTTAAGCTAAAGATGAA-3' for the 3' end. This amplified
DNA, after digestion with restriction endonucleases PstI and
BamHI, was cloned into pUC19 digested with PstI and BamHI,
yielding pWS40. This plasmid was the source for a 154-bp
Pstl-BamHI fragment used in the mobility shift experiments.
This DNA fragment, after isolation on linear sucrose
gradient as previously described (76), was labeled with 32P-
dNTP's by filling in the recessed 3' end of the BamHI site
with the Klenow enzyme. FhlA or FhlA165 protein was pre
incubated with binding buffer (10 mM Tris, pH 7.5, 1 mM
EDTA, 1 mM dithiothreitol, 1 mM ATP) for 5 minutes at 4 C
before the labeled DNA was added. Binding reactions were
incubated for 20 minutes at 37 C. Gels were pre-run at 100
V for 60 minutes at room temperature and run for 60 minutes


38
at 100 V with buffer recirculation after loading the
samples. The gels were dried and exposed to X-ray film.
Phosphorimaging Analysis
Dried gels from DNA mobility shift experiments were
exposed to a phosphorimaging screen and the bands were
quantified using a phosphorimager (Molecular Dynamics) at
the University of Florida Interdisciplinary Center for
Biotechnology Research.
Optical Biosensor Experiments
The kinetic characteristics of the interaction between
ModE and modA operator DNA was determined using Optical
evanescent wave biosensor (Affinity Sensors). The
principles of this biosensor have been described previously
(80). In this particular experiment, a cuvette containing
biotin on the sensor surface was utilized. Biotinylated DNA
was bound to the sensor surface using streptavidin
(Calbiochem) as an intermediate. Two 43 base complimentary
oligonucleotides covering the modA operator region between
-18 and +25, were synthesized (NBI) with biotin in the 5'-
end of one of the oligonucleotide which upon annealing would
be located in the 5-end of the DNA.
The biotin cuvette in the Optical biosensor was rinsed
with phosphate-buffered saline containing 0.1% Tween 20.
Streptavidin (100 pi; 1 mg/mL) in 10% PBST was added to the


39
cuvette (200 pi reaction volume) and incubated for 6.5 min
with mixing. After removing the unbound streptavidin, DNA
was added and incubated until no further response was noted.
Excess DNA was removed from the cuvette by 3 washes with
PBST. ModE protein with or without molybdate (1 mM) was
added to the cuvette and the rate of increase in response
was recorded. After the maximum response was attained, free
ModE in the cuvette was removed by a wash with PBST and the
rate of dissociation of ModE from the DNA was monitored.
When the dissociation of ModE-molybdate was followed, PBST
was supplemented with 1 mM molybdate. When needed, ModE was
dissociated from the DNA and removed by washing the cuvette
with 1M MgCl2. The experiment was repeated with several ModE
concentrations as well as with mutant forms of ModE and
mutated modA operator DNA. The information obtained with
different ModE concentrations (2.25-54.0 nM) was used to
determine the kinetic constants as per Borza and Morgan
(12) .
Fluorescence Spectroscopy Measurements
Fluorescence emission spectra were collected using an
Aminco Bowman Series 2 Spectrofluorometer (Spectronic).
ModE proteins were diluted in Tris-buffer (pH 8.0) with 0.5
mM dithiothreitol for measurement using 1 cm pathlength.
Samples were excited at 290 nm and emission spectra from 300


40
nm to 400 nm were collected. Three separate concentrations
of ModE and mutant ModE proteins (1, 2.4, and 4.8 pM) were
analyzed for intrinsic fluorescence with and without added
molybdate (1 mM). In these experiments, the bandpass width
was 4 nm and the detector voltage was set at 610V.
Materials
Biochemicals were purchased from Sigma Chemical Co.
(St. Louis, MO). Other organic and inorganic chemicals were
from Fisher Scientific (Pittsburgh, PA) and were analytical
grade. Restriction endonucleases and DNA modifying enzymes
were purchased from Promega (Madison, WI) and New England
Biolabs (Beverly, MA), with the exception of the
thermostable polymerase used in mutagenesis of fhlA gene,
which was from Biometra (Tampa, FL). Optical biosensor
cuvettes were from Affinity Sensors.


RESULTS AND DISCUSSION
Expression of hyc Operon in Escherichia coli Requires
Molybdate
Transcriptional Regulation of PbyclacZ
Previous investigations into the transcriptional
regulation of hyc operon utilized chromosomal operon fusions
in which the lacZ gene was inserted into a gene within the
hyc operon (hycB-lacZ, 78; hycD-lacZ, 53). Since the first
gene of the hyc operon negatively modulates the level of
transcription of hyc (78), a hyc promoter-lacZ fusion was
constructed in which the upstream DNA from hyc operon is
fused to a promoterless lacZ gene six base pairs before the
predicted translation start site (Fig. 2) This PhyclacZ
fusion allows the regulation of hyc transcription to be
monitored without possible negative effect from a second
copy of the hycA. A recombinant lambda phage (WS1) which
carries the PhyclacZ in the Xatt site was used in this study
to analyze the transcriptional regulation of hyc operon in
both a wild type strain as well as in a deletion mutant
strain lacking the entire hyc and hyp region.
41


In order to confirm that regulation of PhyclacZ fusion
is similar to previous hyc-lac fusions (53, 78), the level
42
of (3-galactosidase activity produced by several mutant
strains carrying mutations in genes which had previously
been shown to be involved in the expression of hyc operon
was determined (Table 3). Since the chromosomal fhlA gene,
encoding the required transcriptional activator of the hyc
operon, is deleted in strain WS127, no (3-galactosidase
activity was produced by this strain. Strain WS127 with
plasmid pWS2 (fhlA*) produced 1400 units of (3-galactosidase
activity when grown in LBG and this level of activity
increased to 1800 units when formate was also included. An
isogenic derivative carrying a mutation in the pfl gene
(WS132 with pWS2), and thus lacking the pyruvate
formatelyase activity, produced less than 10% of (3-
galactosidase activity of the parent due to the absence of
formate. Addition of formate returned the level of hyc-lacZ
expression to that of the parent strain (pfl*) Strain
WS113(pWS2), which also carries a deletion in the modABCD
(molybdate transport operon), produced less than 25% of the
(3-galactosidase activity of the parent, strain WS127 (pWS2) .
Although addition of formate to the medium increased the
amount of (3-galactosidase activity produced by the culture
by about 2-fold, molybdate was required for full restoration


43
Table 3 Expression of l?hyclacZ requires both formate and
molybdate
Strain3 Relevant genotype B-aalactosidase activity13
0
LBG
LBGF
LBGFM
WS127
<50
<50
<50
WS127(pWS2)c
p (fhlA)+
1400
1800
1800
WS132(pWS2)
pfl-1 p (fhlA)*
110
1650
1800
WS113(pWS2)
Amod p(fhlA)+
320
720
1900
WS131(pWS2)
rpoN Amod p (fhlA)*
<50
<50
<50
a All strains contain PhyclacZ via .WS1, and A (srl-fhlA)
which deleted chromosomal hydA, hyc, and hyp operons as well
as the fhlA gene.
b p-galactosidase activity is expressed as nanomoles
min.-1 milligram of cell protein-1.
c Plasmid pWS2 carries fhlA*.


44
of hyc-lacZ expression. Mutation in the rpoN gene, which
encodes the sigma-54 subunit of RNA Polymerase holoenzyme,
also eliminated the expression of p-galactosidase activity
by strain WS131 (pWS2) Therefore, production of (J-
galactosidase activity by strains carrying PtiyclacZ required
formate, molybdate, FhlA protein, and a54. This pattern of
regulation corresponds to previous studies utilizing
chromosomal hyc-lacZ fusions (53) .
Expression of fhlA Gene does not Require Molybdate
Since expression of both hyc-lacZ and PhyclacZ fusions
require molybdate, the possibility that the expression of
the fhlA gene, coding for the required transcriptional
activator FhlA, is influenced by molybdate, and thus has an
indirect effect on hyc was investigated. Strain SE2007, an
fhlA-lacZ derivative of strain MC4100, produced 610 units of
(3-galactosidase activity when cultured in LBG (Table 4) .
Strain SE1762, a modB isogenic derivative of strain SE2007
produced 490 units of (J-galactosidase activity when cultured
in LBG. Addition of molybdate to either the parent strain
(SE2007) or the modB derivative had no significant effect on
the level of p-galactosidase activity produced (Table 4).
These results show that the fhlA expression is molybdate-
independent and thus strongly argues that the lack of


Table 4 Expression of <5 (fhlA-lacZ) is independent of
formate and molybdate
45
Strain3
Relevant genotype
B-aalactosidase
LBG
activitvb
LBGM
SE2007
wild type
610
740
SE1762
modB247
490
510
WS152
pfl-1
970
1000
MJ101
rpoN
770
1200
WS151
fnr
2030
2100
SE2007(pWS2)
p fhlA +
570
NDC
a All strains are isogenic derivatives of strain SE2007
which carries {fhlA-lacZ) .
b (3-galactosidase activity is expressed as nanomoles
min-1-milligram of cell protein'1.
c Not determined.


46
hyc transcription in a modB mutant is not due to an absence
of expression of fhlA.
In addition, a mutation in rpoN had very little effect
on the level of expression of fhlA gene while a pfl mutation
increased the fhlA-lacZ expression (Table 4). Plasmid pWS2
which increased the copy of fhlA+ in strain SE2007 did not
alter the level of expression of fhlA-lacZ. However, an
fnr mutation (WS151) increased the level of fhlA-lacZ
expression by about three-fold to about 2000 units. No
consensus binding sequence for the global anaerobic
transcriptional regulator FNR (TTGAT-4 bp-ATCAA) was found
in the DNA sequence within and immediately upstream of the
fhlA gene. Therefore the mechanism of repression of fhlA
expression by FNR appears to be indirect and is yet to be
determined.
Formate and Molybdate act Independently on hyc Expression
In order to evaluate whether the requirement for
molybdate in hyc-lac expression is indirect and is related
to the need for formate for activation of hyc operon, the
levels of p-galactosidase activity produced by the modB
mutant, strain WS162, grown with various formate
concentrations were determined (Fig. 3) The (3-
galactosidase activity of the culture not supplemented with
molybdate increased from about 250 units to 700 units


6-galactosidase Activity
47
Formate (mM)
Figure 3 Effect of formate on expression of PhyclacZ.
Strain WS162 (modB) was cultured in LBG in the presence or
absence of added molybdate.


48
between the formate concentrations of 2 and 20 mM. This
increase, indicating that endogenously produced formate does
not fully saturate the ability to transcribe hyc operon, was
also reported before (52). Addition of molybdate alone
increased the level of expression of hyc-lacZ in strain
WS162 to about 1700 units (Fig. 3). Formate further
increased the level of expression of hyc-lacZ by an
additional 1000 units in the presence of molybdate. This
requirement for molybdate for optimum expression of hyc-lacZ
in strain WS162 which produced formate internally, suggests
that the need for molybdate is independent of the need for
formate in the expression of hyc-lacZ. It is the
elucidation of the components involved in this requirement
for molybdate which is the primary focus of this study.
ModE Protein is Required for Optimal Expression of hyc
Operon
ModE Protein has a Role in hyc Operon Transcription
The modE gene is the first gene in modEF operon which
is divergent from the modABCD operon in the E. coli
chromosome (25, 92). ModE protein is a molybdate-sensor and
represses transcription of modABCD in the presence of
molybdate (24, 25, 55). Since transcription of hyc operon
requires molybdate, and ModE protein had been shown to be a
molybdate-sensitive DNA-binding protein, the possibility


49
that ModE has a role in the molybdate-dependent
transcription of hyc operon was investigated.
As expected, molybdate was required for expression of
P,,yclac2 in an isogenic modB mutant derivative of WS160
(Table 5) Expression of PhyclacZ in a modE mutant was
decreased by about 60% and molybdate supplementation of the
medium had no effect on the level of (3-galactosidase
activity produced (Table 5). When the modE mutation was
complemented by modE* in a plasmid, strain WS161(pWS31)
produced about 2100 units of p-galactosidase activity when
cultured in either LBG or LBGM. These results show that
ModE is an integral part of hyc transcription activation.
In order to determine if the effect of modE mutation on
hyc expression is due to a polar effect on the expression of
modF gene, which is located downstream of modE in the modEF
operon, expression of PhyclacZ was also analyzed in both
modEF and modF mutants (Table 5). Strain WS168 (modF)
produced about 90% of the p-galactosidase activity as that
of the parent, strain WS160. Strain WS169, which carries a
deletion of the modEF operon, produced only 850 units of p-
galactosidase activity when cultured in LBG. Addition of
molybdate had no effect on the expression of hyc-lacZ in
either of these strains. Plasmid pWS31 (modE*) restored the
expression of PhyclacZ in the modEF mutant (WS169) to optimal


Table 5 Transcriptional activation of PhyclacZ in the
presence of mutations in the mod operons
50
Strain3 Relevant genotype B-aalactosidase activity13
LBG LBGM
WS160
wild type
2000
(100)
2000
(100)
WS160(pWS31)c
wild type p(modE*)
2100
(103)
2300
(114)
WS162
modB
120
(6)
1800
(91)
WS161
hmodE
820
(40)
810
(40)
WS161(pWS31)c
bmodE p(modE*)
2100
(104)
2300
(115)
WS168
hmodF
1800
(91)
1700
(84)
WS169
AmodEF
850
(42)
800
(40)
WS169(pWS31)c
bmodEF p(modE?)
2700
(133)
2600
(128)
WS17 8
bmodE modB
<50
(0)
800
(40)
a All strains carry AWS1 (PhyclacZ) .
b p-galactosidase activity is expressed as nanomoles*
nvin._1*milligram of cell protein-1. Values in parentheses
represent % of activity produced by the mutant strain as
compared to the wild type strain WS160.
c Plasmid pWS31 carries modE*.


51
levels. These results indicate that the lack of ModE
protein, and not ModF, is responsible for the decrease in
expression of hyc operon.
It is also possible that the decrease in hyc-lacZ
expression in a modE mutant could be related to the lack of
control of molybdate transport, since ModE-molybdate
represses expression of modABCD operon (25, 55, 92). The
high intracellular molybdate may indirectly influence the
level of hyc-lac expression. In order to evaluate this
possibility, a modE, modB double mutant (strain WS178) was
constructed. This double mutant was completely dependent on
molybdate for production of hyc-dependent p-galactosidase
activity and even in the presence of molybdate (1 mM) the
level of (5-galactosidase activity produced by strain WS178
was the same as that of a modE mutant, strain WS161 (Table
5). These results show that the decrease in transcription
of hyc-lac in a modE mutant can not be attributed to
unregulated expression of molybdate transport system coded
by modABC operon, and also demonstrates that the ModE-
independent activation of transcription of hyc operon still
requires molybdate. This suggests that ModE is not the only
molybdate-sensor in the transcriptional regulation of hyc
operon.


52
ModE-dependent Activation of hyc Operon Requires Molybdate
To establish that the molybdate-bound form of ModE is
the active form participating in hyc expression, a modE*
plasmid (plasmid pWS31) was introduced into a modE, modB
double mutant, strain WS192, carrying PhyclacZ fusion (Table
6). Strain WS192 also carries a pcnB mutation to reduce the
copy number of the modE* plasmid and minimize plasmid copy
number effect on hyc expression (47). Even in the presence
of plasmid pWS31 coding for the native ModE protein,
expression of PhyclacZ was molybdate-dependent (Table 6) .
These results suggest that the ModE-dependent expression of
hyc operon requires molybdate.
Mutant ModE proteins which repressed modA-lacZ
expression even in the absence of molybdate at different
levels were previously described (25) and when plasmids
coding for these mutant ModE proteins were introduced into
strain WS192, PtiyclacZ expression was also independent of
added molybdate (Table 6). The levels of p-galactosidase
activity produced in the presence of these mutant proteins
varied between 1200 and 2000 units, suggesting that these
proteins have different abilities to enhance hyc
transcription in the presence and absence of molybdate. In
the presence of ModE(A76V) which failed to repress modA-lacZ
(25) only a modest increase in hyc-lac expression was


53
Table 6 ModE-dependent activation of hyc operon requires
molybdate
Strain Relevant genotype3 S-aalactosidase activity13
LBG LBGM
WS160
wild type
2000
2000
WS161
A modE
820
810
WS162
modB
120
1840
WS192
AmodE modB
<50
930
WS192(pWS31)
AmodE modB
p (modE*)
230
2500
WS192(pWS33)
AmodE modB
p(modE-G133D)
1300
1200
WS192(pWS34)
AmodE modB
p(modE-252*)
1900
2300
WS192(pWS35)
AmodE modB
p (modE-21 6*)
1800
1600
3 All strains carry WS1. Wild type modE* gene (pWS31) and
mutant modE genes are carried by the plasmids listed.
b p-galactosidase activity is expressed as nanomoles
min'1milligram of cell protein-1.


54
observed and this required molybdate (930 to 1200 units).
These results are in agreement with the proposal that ModE-
molybdate is the active form in enhancing transcription of
hyc operon.
ModE Protein Binds to hyc Promoter DNA
Since the genetic and physiological experiments suggest
that ModE-molybdate is required for optimal expression of
PhyclacZ, direct binding experiments consisting of ModE
protein and promoter DNA were carried out. Electrophoretic
mobility of a 396-bp hyc promoter DNA was retarded in the
presence of ModE protein but only in the presence of
molybdate (Fig. 4). The minimal amount of ModE-molybdate
required for the mobility shift was about 250 nM and this is
about 10-times higher concentration of ModE protein than the
reported Kd for binding of ModE to modA operator DNA (4,
58). These results show that the ModE-molybdate binds to
hyc upstream DNA.
DNase I-footprinting experiments involving ModE and hyc
promoter DNA revealed that ModE-molybdate protects a 27-bp
region in this DNA from DNase I-mediated hydrolysis (Bases
-177 to -204; Fig. 5, panel A). The center of the ModE-
protected region is 94 bases upstream of the center of the
DNA protected by the transcriptional activator, FhlA protein
from DNase I hydrolysis (Fig. 5; 83). Although there is no


B
12 3 4 5 6 7
Figure 4 DNA electrophoretic mobility shift with ModE protein and DNA from the hyc
promoter region. Panel A, minus molybdate; Panel B, plus molybdate. Lane 1, no
protein added; lane 2, 85 nM ModE; lane 3, 130 nM ModE; lane 4, 170 nM ModE; lane 5,
212 nM ModE; lane 6, 255 nM ModE; lane 7, 340 nM ModE.
cn
o


56
210
200
190
180
170
180
12345678
Figure 5 Protection of hyc DNA by ModE protein from
cleavage by DNase I. Lanes 3-5 with 0.1 mM molybdate in the
binding reaction; lanes 6-8, without added molybdate. Lane
1, sequencing ladder (only C track is shown); lane 2, DNA
alone; lanes 3 and 6, 1.77 pM ModE; lanes 4 and 7, 3.54 pM
ModE; lanes 5 and 8, 7.08 pM ModE. The numbers represent


57
inverted repeat sequence within this ModE-protected region,
sequences similar to those found in the modA
operator/promoter DNA to which ModE has been shown to bind
(4, 24, 58) are present in the hyc promoter. This includes
both the tetramer, GTTA, and pentamer sequence CATAT (Fig.
6). The 29-bp ModE-protected modA operator DNA contains
three copies of the pentamer sequence TAYAT (Y=pyrimidine)
and the tetramer sequence, GTTA, can also be detected at 9
locations within a 80-bp region in the modA operator DNA
(Fig. 6; panel B). The role of these tetramer sequences in
modA DNA is not known. The GTTA and CATAT sequences in hyc
promoter are separated by 7 bases which is the same distance
between the two pentamer sequences (TATAT and TACAT; regions
1 and 2) in the modA operator (24, Fig. 6). An inverted
repeat, CAAT A ATTG (-153 to -145), and another sequence,
TAAC T ATTG (-173 to -165) containing the GTTA tetramers,
are also found near the ModE-recognition/binding sequence in
the hyc promoter DNA. Partial protection from DNase I
cleavage can also be observed in the hyc DNA within the -173
to -165 region (Fig. 5). Apparently, ModE-molybdate
recognizes this DNA but stable ModE-molybdate-DNA complex
forms only with the 27-bp region between -177 and -204. The
DNA between -153 and -145 containing the TAAC T ATTG
sequence was not protected by ModE.


58
-210
I
ModE
GCCCGTTGG CAGAGG GTTA TTTCGTGCATAT CGCCT
-170
CCCATTAACTAT
hyp
-150 -130
n, i i
T GCCAGCTACAAGCAATAATTGTGCCAGTGTTGATTATCCCT GCGGTG
-no
i
FhlA
-90
i
AATAATGTCGATGATGTCGAAATGACACGTCGACACGGCG ACGAAATT
-70
-50
IHF
-30
CATCTTTAGCTTAAAAATCTCTTTAA JrAACAATAAATTAAAAGTTGGC
hyc
-10
ACAAAAAATGCTTAAAGCTGGC A ^TCTCTGTTAAACGGGTAACCTGACA
$
-50
-40
-30
I
-20
GTTA GCAATAACTGC TGGGAA AATTCCGA GTTA GTC GT TATATT
i
mod A BCD
TCGCC TACAT
AAC
+ 10
I
GTTA CAT
+20
I
+ 30
Region 1
modA
TAAGGGGTTACCA ATG
Region 2
Region 3
Figure 6 Comparison of the ModE-binding regions in hyc
promoter DNA and modA operator/promoter DNA. Panel A, hyc
promoter DNA; Panel B, modA operator/promoter DNA. The
single boxed bases indicate the transcription start site for
hyc and hyp operons. The FhlA and IHF binding sites are
also indicated by light boxed regions. ModE binding regions
are represented by dark boxes. The numbers represent the
positions of the bases in relation to the transcription
start site (+1). An asterisk over the A at +5 indicates
hypersensitivity to DNase I cleavage. GTTA sequences
abundantly present within this region are underlined.


59
The amount of ModE required for protection of hyc
promoter DNA from DNase I was higher than 1 pM and this is
about 7-times higher than the amount of the transcriptional
activator, FhlA protein, required for protection of hyc
promoter DNA from DNase I hydrolysis (83). The same
preparation of ModE-molybdate protected modA operator DNA
completely from DNase I hydrolysis at a concentration of
less than 3 nM.
Previous mutational analysis of modA operator/promoter
DNA established that binding of ModE protein to the modA
operator/promoter DNA required regions 1 and 2 (24).
Mutations in region 3 did not eliminate stable ModE-DNA
complex as assayed by both in vivo and in vitro experiments,
but the presence of this region enhanced overall binding by
about 2-fold. Direct binding experiments also determined
that ModE is bound to the DNA of the modA operator/promoter
region as a dimer (24). This mutational analysis also
showed that the GTTA sequences also play a role in ModE-
molybdate binding to modA operator DNA. In addition,
comparison of DNA from the promoter regions of other
molybdate-contolled operons in E. coli and other organisms
revealed the presence of only two pentamer sequences,
similar to regions 1 and 2 (Fig. 6 and ref. 56, 58, 62).
Since the protected region in the hyc promoter DNA contains


60
a GTTA-7bp-CATAT motif, it appears that the ModE protein can
recognize and bind to these sequence motifs at a lower
affinity than to a double pentamer motif. Whether ModE is
binding as a monomer or dimer in this interaction is yet to
be determined.
The higher concentration of ModE protein required for
protection of the hyc promoter DNA in vitro may reflect the
role of ModE as a secondary activator rather than a required
primary regulator of transcription. Figure 7 depicts a
model for the secondary activation of the hyc operon by
ModE-molybdate complex. As per this model, FhlA-formate-
mediated transcription of hyc operon is increased by the
ModE-molybdate complex. Since in the absence of FhlA hyc is
not expressed, the ModE-molybdate may not be interacting
with RNA Polymerase directly. It is possible that the ModE-
molybdate interacts with FhlA-formate and increases the
ability of FhlA-formate complex to activate transcription.
This may indeed be an adaptation of E. coli to increase the
level of molybdoenzyme synthesis when molybdate is in excess
in the cytoplasm.
Biochemical Analysis of ModE and Molybdate-Independent
Mutant ModE
ModE Binding Sites in modA Operator/Promoter DNA
Although ModE protein was found to require molybdate in
its role as a transcriptional activator of hyc


61
Formate
hyc operon
Figure 7 A proposed model for activation of hyc operon by
both FhlA and ModE proteins. Bold line represents DNA from
the E. coli chromosome for the hyc-hyp operon intergenic
region.


62
transcription, partial protection from DNase I of hyc
promoter DNA was seen in the presence of high concentrations
of ModE even in the absence of molybdate (Fig. 5). In
addition, higher levels of ModE protein produced from high
copy modE* plasmid also suppressed in vivo the need for
molybdate in transcription of hyc operon (data not shown).
These experimental results raise the possibility that the
ModE protein enhances transcription of hyc operon in the
absence of molybdate. In agreement with this possibility,
ModE was also reported to bind to modA operator DNA even in
the absence of added molybdate and protected the DNA from
DNase I hydrolysis (56, 58).
However, an alternate possibility that a small fraction
of ModE used in the in vitro experiments is contaminated
with molybdate and the analytical sensitivity of molybdate
determination methods is not high enough to detect its
presence can not be ruled out. Increasing the copy number
of modE* may also have a similar effect on transcription of
hyc operon by scavenging the very small amount of molybdate
transported by alternate molybdate transport systems. In
order to distinguish between these two possibilities, ModE
purified as described previously (25) was compared with ModE
purified using Ni-affinity method (*ModE). The Ni-affinity
purification method was chosen since it involves only a


63
limited number of steps, thereby decreasing the exposure of
ModE protein to large volumes of buffer which could be a
possible source of molybdate contamination. The E. coli
host used for expression of modE in these experiments,
strain BL21(DE3), also carries an unidentified mod operon
mutation and thus is incapable of transporting molybdate
when grown in rich medium not supplemented with molybdate
(unpublished data). ModE-binding to modA operator DNA was
used as the assay for molybdate contamination of ModE
because of the higher affinity of ModE to modA operator DNA
and to increase the sensitivity, DNase I footprinting was
used as the analytical tool.
The results presented in Figure 8 show that ModE alone
protected modA DNA from DNase I hydrolysis at a
concentration of 50 nM (lanes 2-4). A hypersensitive "A" at
position +5 can also be seen at this concentration of ModE.
Addition of molybdate to the binding reaction reduced the
amount of ModE required for complete protection to less than
5 nM (Fig. 8, lane 6). In the presence of *ModE protein
purified using the Ni-affinity procedure, protection of modA
operator/promoter DNA from DNase I-mediated hydrolysis was
dependent on molybdate at the ModE concentrations tested
(Fig. 8, lanes 11-18). Even at 100 nM ModE, the
hypersensitivity of the "A" at +5 was only slightly


64
ttiii-riirrrrtrrrt
123456789 10 11 12 131415161718
Figure 8 DNase I footprinting of modABCD operator/promoter
DNA with ModE proteins. Lanes 1 and 10, DNA alone (1.7 nM);
lanes 2-5 and 11-14, without molybdate; lanes 6-9 and 15-18,
with 0.1 mM molybdate in the binding reaction. Lanes 2-9,
native ModE protein; lanes 11-18, *ModE (contains extra
three amino acids, Gly, Ser and His in the N-terminal end -
see text for details). Lanes 2, 6, 11 and 15, 5 nM protein;
lanes 3, 7, 12 and 16, 10 nM protein; lanes 4, 8, 13 and 17,
50 nM protein; lanes 5, 9, 14 and 18, 100 nM protein. The
numbers represent the position of the bases with respect to
the transcription start site of the modABCD operon.


65
increased (Fig. 8, lane 14). In the presence of molybdate,
5 nM ModE almost completely protected modA operator/promoter
DNA from hydrolysis by DNase I. These results suggest that
greater than 95% of the *ModE in this preparation is free of
molybdate and the active form of ModE binding to modA
operator DNA is ModE-molybdate.
Analysis of the ModE-molybdate protected region of the
modA operator/promoter DNA after DNase I-mediated cleavage
of the coding strand (Fig. 8, lanes 6-9; 15-18) revealed
that there are three areas of protection detectable at a
ModE-molybdate concentration as low as 5 nM. The first
protected region, *GTTATATT", spans from -15 to -8 and
overlaps the modA *-10" sequence (Fig. 9). The second ModE-
protected region, *GCCTACAT" spans from -4 to +4 of the
modA-operator/promoter DNA, while the third protected
region, *GTTACAT", is located between bases +8 and +14.
Each of the three DNase I-cleavage-protected regions
contains either a *TATAT" (protected region 1) or 'TACAT"
(protected regions 2 and 3) sequence, which suggests that it
is these sequences which are recognized by ModE as the
target binding site. The independent protected sites are
separated by three bases, and the pentameric sequences in
regions 1 and 3 are preceded by the same two bases, GT.
Aside from the three protected regions, the base *A" at


-SO -40 -30 -20 =TTJ-
GTTA GCAATAACTGC TGGGAA AATTCCGA GTTA GTC GT TATATTfe
modABCD
+ 10
rr.
20
TCGCC TACAT AAC GTTA CAT TAAGGGGTTACCA ATG
Region 1
mod A
Region 2
Region 3
Figure 9 DNA sequence of the modABCD operator/promoter region protected by ModE-
molybdate from DNase I cleavage. The three protected regions are enclosed by boxes.
Letters in grey boxes represent the pentamer sequences present within the ModE-
molybdate-protected regions. The numbers represent the positions of the bases in
relation to the transcription start site (+1). An asterisk over the A at +5
indicates hypersensitivity to DNase I cleavage. GTTA sequences abundantly present
within this region are underlined.
os
Os


67
position +5, located next to the 3' end of the second
protected region is hypersensitive to DNase I-cleavage. An
inverted repeat of bases also exists within the ModE-
protected region of the modA operator/promoter DNA.
McNicholas et al. (58), based on DNase I footprinting,
reported that ModE protected the entire region of DNA
spanning from -18 to +10 even in the absence of molybdate.
The hypersensitive *A" at position +5 was not detectable in
the reported ModE-footprint (58). Although the
hypersensitive site is recognizable in the ModE-modA DNase I
footprint reported by Anderson et al. (4), the unprotected
bases between the regions 1 and 2 were not discernable. The
fact that the DNase I footprint presented in Figure 6
resolves the modA-operator/promoter region into discreet
ModE-binding regions with a distinct DNase I hypersensitive
site delineating protected regions 2 and 3 suggests that
ModE binds and protects the three indicated regions in vivo
also. The *ModE also protected the same bases with the
hypersensitive adenine in the modA operator DNA but the
amount of protein required for complete protection was
slightly higher (10 nM vs 5 nM for ModE-molybdate). Similar
ModE-molybdate footprint in the non-coding strand of the
modA-operator/promoter DNA also was observed (data not
presented). Since the *ModE protein preparation apparently


68
did contain less molybdate than the native ModE preparation
(and thus did not protect the modA operator/promoter DNA at
the tested concentrations), the ability of mutant ModE
proteins to interact with the modA operator/promoter DNA was
analyzed in a similar manner.
Interactions of Mutant ModE Proteins with modA
Operator/Promoter DNA
Since the molybdate-independent mutant ModE activated
transcription of hyc in the absence of molybdate (Table 6),
the ability of these proteins to bind to DNA in the absence
of molybdate was investigated. For these experiments,
selected mutant proteins were purified using His-tag
affinity chromotography to minimize molybdate contamination.
In agreement with the in vivo results with both hyc-
lacZ and modA-lacZ (25), the *ModE(A76V) did not protect
modA operator/promoter DNA from DNase I hydrolysis (Fig. 10,
lanes 9-11). Inclusion of molybdate to the reaction mixture
did not increase the affinity of ,l'ModE (A7 6V) for the DNA
(data not presented). Although the *ModE(T125I) mutant
protein protected the same region of DNA protected by native
ModE, the amount of protein required for complete protection
in the absence of molybdate was close to 100 nM (Fig. 10,
lanes 6-8). At this concentration, the level of protection


123456789 10 11
Figure 10 DNase I protection pattern of modABCD
operator/promoter DNA with *ModE and its mutant forms. The
binding reaction lacked molybdate. Lane 1, DNA alone (1.7
nM); lanes 2-5, *ModE; lanes 6-8, *ModE(T125I); lanes 9-11,
*ModE(A76V). Lane 2, 10 nM protein; lanes 3, 6 and 9, 50 nM
protein; lanes 4, 7 and 10, 100 nM; lanes 5, 8 and 11, 150
nM. Numbers indicate the position of bases in relation to
the modA transcription start site.


70
by the *ModE(T125I) protein was about 2-times better than
the *ModE protein without added molybdate.
The molybdate-independent repression of modA-lacZ by
ModE(T125I) in vivo cannot be reconciled with only a 2-fold
higher apparent affinity of *ModE(T125I) to the DNA in the
absence of molybdate in comparison to native ModE (25).
Also, the amount of *ModE(T125I) protein required for
protection from DNase I cleavage was still about 20-fold
higher than the amount of ModE-molybdate required for
complete protection. This raised the question of why so
much mutant ModE protein was required for stable DNA-protein
interaction in the absence of molybdate, and led to a more
thorough kinetic analysis of both ModE and mutant ModE
proteins.
Kinetics of Interaction between ModE and modA Operator DNA
The apparent Kd for binding of ModE-molybdate to modA
operator DNA was previously reported to be about 25 nM (4,
58) This Kc, value is significantly higher than the <5 nM
of ModE-molybdate required for complete protection of modA
operator/promoter DNA from DNase I hydrolysis (Fig. 8, lane
6). To resolve this difference, and to resolve the need for
relatively high concentration of *ModE(T125I) to protect the
modA operator/promoter DNA in the absence of molybdate, the
interaction between ModE and modA operator/promoter DNA was


71
determined using an Evanescent Wave Biosensor. Upon
addition of 13.5 nM *ModE-molybdate, a rapid response
signifying binding was observed and the maximum binding was
achieved within 80 sec (Fig. 11, panel A). In the absence
of added molybdate, ModE bound to the same DNA at a much
lower rate and the total response signifying the amount of
protein bound was also lower. However, both forms of
protein showed a concentration response to association with
DNA in the cuvette. Upon removal of excess ModE, the ModE
without molybdate dissociated from DNA at a higher rate than
the sample with molybdate. Using varying concentrations of
ModE protein over a series of binding experiments the
apparent Kd for this interaction between *ModE and modA
operator/promoter DNA (-18 to +25) was calculated to be 0.3
nM. An apparent of 0.4 nM was obtained when native ModE
was used in these experiments. This apparent value is
similar to the apparent value reported for trp repressor/
trp operator DNA interaction (32). In the absence of
molybdate, this apparent value for the interaction
between ModE and modA operator/promoter DNA increased to 8
nM.
When *ModE(T125I) mutant protein was used in these
experiments, no significant difference was observed either
in the rate of association or dissociation of the protein


72
Time (sec) Time (sec)
oo
H
Z
:o
tu
oo
O
Oh
oo
£
Figure 11 Optical Biosensor response curves for ModE-
binding to modABCD operator/promoter DNA. A, *ModE protein;
B, *ModE(T125I). Proteins were present at a concentration
of 13.5 nM in the cuvette. Upward arrow indicates addition
of ModE protein and the down arrow denotes the time when the
excess ModE was removed from the cuvette to monitor the
dissociation of ModE from the DNA. Molybdate, when included
was present throughout the experiment at a final
concentration of 1 mM. Response units are in arc.sec.


73
with the DNA both in the presence and absence of molybdate
(Fig. 11, panel B) The apparent Kd for the interaction
between *ModE(T125I) and modA operator DNA was 3 nM in the
presence of molybdate and 4 nM in the absence of molybdate.
These values are about 10 times higher than the values
obtained with native ModE-molybdate but about one-half of
the Kd value obtained with ModE alone. The *ModE(A76V)
protein did not bind to the DNA at a protein concentration
as high as 54 nM, either with or without molybdate (data not
shown). This is in agreement with the observed inability of
this mutant form of the protein to activate hyc-lacZ, to
repress modA-lacZ in vivo (25) or to protect the modA DNA
from cleavage by DNase I (Fig. 8). The kinetics of
*ModE(Q216*) interaction with DNA was found to be complex
and the apparent value for this interaction was not
determined.
It is interesting to note that the calculated apparent
Kd for *ModE(T125I) is about 3 nM while that of native ModE
is 8 nM. However, in vivo, the ModE(T125I) serves as a
regulator in the absence of molybdate while the native ModE
requires molybdate for activity. The rate of dissociation
of the two proteins from the DNA was also found to be
significantly different (Fig. 11). It is possible that the
ModE(T125I), upon binding to DNA dissociates from the DNA-


74
protein complex at a significantly lower rate than the
native ModE from the protein-DNA complex accounting for the
difference in vivo.
Similar studies with the trp repressor and a mutant trp
superrepressor (32) protein also show that the
superrepressor mutant form has a 25-fold higher affinity for
the operator DNA than the aporepressor (native repressor
without effector molecule bound). In the presence of
tryptophan, the native trp repressor had a 25-fold higher
affinity to the operator DNA than the superrepressor form.
The difference was again found to be related to the rate of
dissociation of the repressor from the DNA-protein complex.
Fluorescence Characteristics of Mutant ModE Proteins
The intrinsic fluorescence of ModE protein decreased
upon binding molybdate and this could be a result of
conformational change of the protein (4). Since the mutant
ModE proteins are molybdate-independent, it is possible that
the mutant proteins structurally mimic the ModE-molybdate
complex. If this is indeed the case, the intrinsic
fluorescence of the mutant proteins should be comparable to
the ModE-molybdate complex and significantly lower than that
of the ModE protein. When the *ModE protein was excited by
irradiation at 290 nm, the emission spectrum had a peak at
347 nm and a shoulder at 370 nm (Fig. 12). The peak of


Relative Flourescence
75
Figure 12 Fluorescence emission spectra of ModE and mutant
ModE proteins. Excitation wavelength was 290 nM.
Relative Flourescence


76
emission shifted down to 343 nm in the presence of molybdate
and the relative fluorescence was also reduced by about 50%.
These results are in agreement with that of Anderson et al.
(4) for ModEimolybdate. ModE has three tryptophans
(positions 49, 131 and 186) and the tryptophan at 131 is
located within a sequence motif (125-TSARNQWFG-133) which
was conserved in several ModE homologs from other organisms
[(T/S)SARNQXXG], and also in a molybdopterin-binding protein
from Clostridium pasteurianum (21, 26, 29, 43, 48, 54, 93),
as well as in the nitrate sensor protein NarX from E. coli
(16, 37). It is possible that molybdate-binding to ModE
reduced the accessibility of tryptophan at 131 to water and
its fluorescence is not readily observable or is rapidly
quenched. Since a mutation which changed the T (to I at
125) or G (to D at 133) in E. coli ModE converted the mutant
protein to be molybdate-independent (25) it is possible that
the conformation of the mutant protein mimics ModE-
molybdate.
In agreement with the possible confirmation change, the
relative fluorescence of ModE(T125I) was about the level of
*ModE-molybdate complex and was not altered by molybdate
(Fig. 12). The peak of emission was 339 nm which is closer
to the peak of emission of ModE-molybdate (343 nm) than that
of ModE (347 nm). The intrinsic fluorescence of the C-
terminal deletion protein ModE(Q216*) was only about 35% of


77
ModE and was not affected by addition of molybdate (Fig.
12). It is possible that the deletion of the last 47 amino
acids profoundly altered the structure of the protein and in
this conformation, only one of the three tryptophans is
contributing to the fluorescence of the protein. These
results show that the molybdate-independent ModE mutant
proteins resemble ModE-molybdate in its conformation. This
"locked-on" conformation allowed the protein to bind to DNA
even in the absence of added molybdate but this conformation
is apparently not the same as that of ModE-molybdate since
the apparent for ModE(T125I) was about 10-times higher
than that of the native ModE-molybdate.
MoaA Protein is a Required Second Component in Molybdate-
Dependent Expression of hyc Operon
Effects of Mutations in Genes Encoding MGD Biosynthesis
(mol) on Expression of PbyclacZ
Various biochemical and genetic experiments described
in the previous sections show that ModE-molybdate is a
required second transcriptional activator of hyc operon but
in a modE mutant, E. coli still produced FHL activity.
About 40% of parental level of expression of PhyclacZ in a
modE mutant which is molybdate-dependent (Table 5),
indicates the presence of a second molybdate-dependent
activation system for hyc operon. To identify the protein
or proteins responsible for this ModE-independent,


78
molybdate-dependent transcription of hyc operon, initial
experiments focused on the role of the products of various
genes in the MGD biosynthetic pathway in this regulation.
For these experiments, mutations in various genes encoding
components of the biosynthesis of MGD were introduced into
strain WS160 and its modE derivative, WS161. (3-
galactosidase activities produced by these mutant strains
were determined and the results are presented in Table 7.
Strain WS160 produced about 1800 units of (3-
galactosidase activity when cultured in LBG medium
imolybdate. Mutations in moa (Strain WS175) and moeB
(Strain WS190) had no significant effect on the amount of |3-
galactosidase activity produced whether the cultures were
grown in LBG or LBG + molybdate (Table 7). Mutations in
moeAB (Strain WS163) and mog (Strain WS165) reduced the
amount of (3-galactosidase activity produced by the strains
by about 20-30%. However, a mutation in either the mob
(Strain WS164) or moeA gene (Strain WS167) significantly
decreased the amount of (3-galactosidase activity produced by
the mutants to about 35% of the parent level. The addition
of molybdate to the growth medium did not alter the amount
of activity produced by any of these mutant strains. Among
the double mutants, only the modE, mog (Strain WS194) and
modE, moeA (Strain WS172) had a significant negative effect


79
Table 7 Effect of mutation in the genes coding for proteins
in MGD biosynthesis on ModE-independent PhyclacZ expression
Strain Relevant genotype S-aalactosidase activity3
LBG LBGM
WS160
wild type
WS175
moa252
WS190
moaB
WS163
moe251
WS165
mog256
WS164
mob252
WS167
moeA113
WS161
AmodE
WS193
AmodE moa252
WS174
AmodE mob252
WS194
AmodE mog256
WS172
AmodE moeA113
1800
(100)
1900
(100)
1800
(96)
1800
(97)
1800
(99)
1600
(86)
1500
(81)
1300
(69)
1200
(66)
1200
(62)
650
(36)
580
(31)
600
(33)
590
(32)
580
(32)
610
(33)
770
(42)
770
(42)
840
(46)
840
(45)
250
(14)
190
(10)
<50
(0)
<50
(0)
a (5-galactosidase activity is expressed as nanomoles
min.'1-milligram of cell protein'1. Values in parentheses
represent % of activity produced by the mutant strain as
compared to the wild type, strain WS160.


80
on PhyclacZ expression, in comparison to the corresponding
isogenic modE mutant, strain WS161. Among the two, modE,
moeA double mutant did not express PhyclacZ or produce FHL
activity. These results suggest that the product of moeA
gene is required for the ModE-independent activation of hyc
transcription, and the product of mog also has a role in
this regulation.
The product of moeA gene (MoeA protein) has been
proposed to be involved in activation of molybdate upon
entry into the cell (27). Mutation in moeA can be
suppressed by either addition of sulfide to the culture
medium, or growth of the culture under limiting-sulfur
conditions. Growth under limiting-sulfur conditions
increases the expression of genes involved in the
biosynthesis of cysteine, which can produce sulfide
internally (42). However, strain WS172, when grown in the
presence of sulfide or in low-sulfur medium did not produce
FHL activity or (3-galactosidase activity. This indicates
that sulfide can only suppress the need for MoeA in MGD
biosynthesis and not for its role in hyc expression. In
strain WS167 (moeA alone), the presence of ModE-molybdate
allows transcription of hyc operon, although at a lower
level, and ultimately to FHL activity in the presence of
sulfide.


81
The proposed role of the product of mog is in insertion
of molybdenum into the pterin portion of the MGD cofactor
(36). Strains carrying mutations in both modE and mog did
produce FHL activity at a lower level than that of the
respective parent strains. Since neither the MoeA nor the
Mog protein has been characterized biochemically, the
possibility remains that these proteins act in concert in
the production of a small molecule effector which is
required for hyc transcription.
Analysis of the amino acid sequence of MoeA protein did
not reveal any obvious DNA-binding domains to suggest that
this protein is a transcriptional activator. From genetic
studies reported previously (27) it is reasonable to
conclude that the product of MoeA is a small molecule
effector which is required for transcription. Given the
present knowledge of the activation of transcription of hyc
operon at the time of these studies, it is tempting to
speculate that this small molecule effector (product of
MoeA) is interacting with another transcriptional activator,
possibly the FhlA protein.
MoeA-dependent transcription of hyc operon is sensitive to
tungstate
Tungstate, an analog of molybdate, has been shown both
in vivo and in vitro to interact with ModE protein to
repress transcription of modABCD operon (24). Tungstate


82
also reduced the extent of fluorescence emission of ModE
protein in a manner similar to that of molybdate (4). In
addition, tungstate also bound to the periplasmic ModA
protein (68), suggesting that tungstate can substitute for
molybdate both in vivo and in vitro. Since ModE is an
activator of hyc operon, the possibility that tungstate
could substitute for molybdate as an effector for the ModE
protein in this activation, as well as on MoeA-dependent
expression of hyc, was investigated. Results of these
experiments are summarized in Table 8.
Addition of tungstate to the growth medium had no
effect on the expression of PbyclacZ, in a wild type, strain
WS160, as expected. The native molybdate transport system
has a higher affinity for molybdate over tungstate, and in a
wild type molybdate apparently competes effectively with
tungstate. Tungstate had only a minimal effect on hyc-lacZ
expression in a modB mutant, strain WS162, (89% of the
parent level), which lacks the ability to transport trace
amounts of molybdate present in the medium suggesting that
tungstate can effectively replace molybdate for hyc
activation. However in the absence of ModE protein (modE
mutant strain WS161), tungstate failed to support activation
of hyc-lacZ (only 6% of the modE* parent level of p-
galactosidase activity). In a modE, modB double mutant


Table 8 Inability of Tungstate to substitute for Molybdate in MoeA-dependent
expression of hyc operon
Strain
Relevant genotype
LBG
B-aalactosidase activity3
LBGM LBGW
WS160
wild type
1800
(100)
1900
(100)
1900
(100)
WS162
modB
210
(12)
1900
(100)
1700
(89)
WS161
modE
820
(46)
830
(44)
110
(6)
WS178
modE modB
90
(5)
870
(46)
150
(8)
WS172
modE moeA
<50
(0)
<50
(0)
<50
(0)
WS167
moeA
600
(33)
590
(31)
590
(31)
a p-galactosidase activity is expressed as nanomoles'min._1-milligram of cell
protein-1. Values in parentheses represent % of activity produced by the mutant
strain as compared to the wild type, strain WS160, grown in the same medium.
00


Full Text
xml version 1.0 encoding UTF-8
REPORT xmlns http:www.fcla.edudlsmddaitss xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.fcla.edudlsmddaitssdaitssReport.xsd
INGEST IEID EWD0IW30U_C78OB8 INGEST_TIME 2013-10-24T20:51:58Z PACKAGE AA00017698_00001
AGREEMENT_INFO ACCOUNT UF PROJECT UFDC
FILES



PAGE 1

*(1(7,& $1' %,2&+(0,&$/ $1$/<6,6 2) 7+( 02/<%'$7('(3(1'(17 (;35(66,21 2) +<& 23(521 ,1 (6&+(5,&+,$ &2/, %\ :,//,$0 7+20$6 6(/) $ ',66(57$7,21 35(6(17(' 72 7+( *5$'8$7( 6&+22/ 2) 7+( 81,9(56,7< 2) )/25,'$ ,1 3$57,$/ )8/),//0(17 2) 7+( 5(48,5(0(176 )25 7+( '(*5(( 2) '2&725 2) 3+,/2623+< 81,9(56,7< 2) )/25,'$

PAGE 2

$&.12:/('*0(176 ZRXOG OLNH WR WKDQN 'U 7 6KDQPXJDP IRU KHOSLQJ PH WR WKLQN DV D VFLHQWLVW +LV LQVWUXFWLRQ KDV QRW RQO\ DLGHG PH LQ P\ UHVHDUFK EXW LW KDV KHOSHG PH WR JDLQ WKH FRQILGHQFH QHHG WR WDFNOH DQ\ TXHVWLRQ RU FDUU\ RXW DQ\ H[SHULPHQW ZRXOG DOVR OLNH WR WKDQN 'UV /RQQLH ,QJUDP -DPHV 3UHVWRQ 7KRPDV %RELN DQG 5REHUW &RKHQ IRU WKHLU VXSSRUW DQG HQFRXUDJHPHQW DV PHPEHUV RI P\ VXSHUYLVRU\ FRPPLWWHH ,Q DGGLWLRQ DP WKDQNIXO IRU DOO RI WKH KHOS IURP DOO RI P\ DVVRFLDWHV LQ 'U 6KDQPXJDPnV ODERUDWRU\ RYHU WKH \HDUV 6SHFLDO WKDQNV JRHV RXW WR 'U -XOLH 0DXSLQ)XUORZ IRU XVH RI WKH VSHFWURIORXURPHWHU 7KDQNV DOVR JR RXW WR RWKHU IHOORZ VFLHQWLVWV DQG VWXGHQWV IURP WKH 0LFURELRORJ\ GHSDUWPHQW $QG ODVW EXW FHUWDLQO\ QRW OHDVW ZRXOG OLNH WR WKDQN P\ ZLIH 0DULDQQH IRU KHU XQHQGLQJ SDWLHQFH DQG VXSSRUW RYHU WKH ODVW IRXU \HDUV

PAGE 3

7$%/( 2) &217(176 $&.12:/('*0(176 /,67 2) ),*85(6 Y /,67 2) 7$%/(6 [LL /,67 2) $%%5(9,$7,216 L[ /,67 2) *(1( 6<0%2/6 [LL $%675$&7 [LY ,1752'8&7,21 /,7(5$785( 5(9,(: 0RO\EGDWH 7UDQVSRUW 0*' %LRV\QWKHVLV )RUPDWH +\GURJHQO\DVH 0$7(5,$/6 $1' 0(7+2'6 %DFWHULDO 6WUDLQV 0HGLD DQG *URZWK &RQGLWLRQV &RQVWUXFWLRQ RI 3K\FODF= &RQVWUXFWLRQ RI W! K\I$ODF=f &RQVWUXFWLRQ RI DK\I 0XWDJHQHVLV RI IKO$ (Q]\PH $VVD\V 3XULILFDWLRQ RI )KO$ 3URWHLQ 3XULILFDWLRQ RI )KO$ 3URWHLQ 3XULILFDWLRQ RI 0RG( 3XULILFDWLRQ RI 0RG( 0XWDQW 3URWHLQV 'HWHUPLQDWLRQ RI 3URWHLQ &RQFHQWUDWLRQ '1DVH ,IRRWSULQWLQJ ([SHULPHQWV $73DVH $FWLYLW\ '1$ (OHFWURSKRUHWLF 0RELOLW\ 6KLIW ([SHULPHQWV 3KRVSKRULPDJLQJ $QDO\VLV LLL

PAGE 4

2SWLFDO %LRVHQVRU ([SHULPHQWV )OXRUHVFHQFH 6SHFWURVFRS\ 0HDVXUHPHQWV 0DWHULDOV 5(68/76 $1' ',6&866,21 ([SUHVVLRQ RI K\F 2SHURQ LQ (VFKHULFKLD FROL 5HTXLUHV 0RO\EGDWH 0RG( 3URWHLQ LV 5HTXLUHG IRU 2SWLPDO ([SUHVVLRQ RI K\F 2SHURQ %LRFKHPLFDO $QDO\VLV RI 0RG( DQG 0RO\EGDWHLQGHSHQGHQW 0XWDQW 0RG( 0RH$ 3URWHLQ LV D 5HTXLUHG 6HFRQG &RPSRQHQW LQ 0RO\EGDWHGHSHQGHQW ([SUHVVLRQ RI K\F 2SHURQ )KO$ 0XWDQW 3URWHLQV :KLFK $OORZ ([SUHVVLRQ RI K\F 2SHURQ LQ WKH $EVHQFH RI 0RO\EGDWH &KDUDFWHUL]DWLRQ RI DQ (IIHFWRULQGHSHQGHQW 0XWDQW )KO$ 3URWHLQ )KO$ )KO$ 3URWHLQ DOVR $FWLYDWHV ([SUHVVLRQ RI D 6LOHQW K\FOLNH 2SHURQ K\I LQ (VFKHULFKLD FROL &21&/86,21 5()(5(1&(6 %,2*5$3+,&$/ 6.(7&+ ,9

PAGE 5

/,67 2) ),*85(6 )LJXUH 3DJH 0RO\EGRSWHULQ JXDQLQH GLQXFOHRWLGH ELRV\QWKHWLF SDWKZD\ LQ ( FROL /RFDWLRQ RI ODF= LQ 3Wc\FODF= (IIHFW RI IRUPDWH RQ H[SUHVVLRQ R I 3K\FODF= '1$ HOHFWURSKRUHWLF PRELOLW\ VKLIW ZLWK 0RG( SURWHLQ DQG '1$ IURP WKH K\F SURPRWHU UHJLRQ 3URWHFWLRQ RI K\F '1$ E\ 0RG( SURWHLQ IURP FOHDYDJH E\ '1DVH &RPSDULVRQ RI WKH 0RG(ELQGLQJ UHJLRQV LQ K\F SURPRWHU '1$ DQG PRG$ RSHUDWRUSURPRWHU '1$ $ SURSRVHG PRGHO IRU DFWLYDWLRQ RI K\F RSHURQ E\ ERWK )KO$ DQG 0RG( SURWHLQV '1DVH IRRWSULQWLQJ RI PRG$%&' RSHUDWRUSURPRWHU '1$ ZLWK 0RG( SURWHLQV '1$ VHTXHQFH RI WKH PRG$%&' RSHUDWRUSURPRWHU UHJLRQ SURWHFWHG E\ 0RG(PRO\EGDWH IURP '1DVH FOHDYDJH '1DVH SURWHFWLRQ SDWWHUQ RI PRG$%&' RSHUDWRUSURPRWHU '1$ ZLWK r0RG( DQG LWV PXWDQW IRUPV 2SWLFDO %LRVHQVRU UHVSRQVH FXUYHV IRU 0RG(ELQGLQJ WR PRG$%&' RSHUDWRUSURPRWHU '1$ )OXRUHVFHQFH HPLVVLRQ VSHFWUD RI 0RG( DQG PXWDQW 0RG( SURWHLQV Y

PAGE 6

/RFDWLRQ RI PXWDWLRQVf LQ IKO$ PXWDQW DOOHOHV ([WHQW RI GHOHWLRQV LQ IKO$ GHOHWLRQ PXWDQW DOOHOHV '1$ 0RELOLW\ VKLIW H[SHULPHQW XVLQJ SXULILHG )KO$ DQG )KO$ SURWHLQV DQG K\F SURPRWHU '1$ (IIHFW RI )KO$ RU )KO$ FRQFHQWUDWLRQ RQ ELQGLQJ WR K\F SURPRWHU '1$ $73DVH DFWLYLW\ RI )KO$ DQG )KO$ LQ UHVSRQVH WR )RUPDWH DQG K\F SURPRWHU '1$ $OLJQPHQW RI 1WHUPLQDO UHJLRQ RI )KO$ ZLWK SURWHLQV IURP $%& WUDQVSRUW V\VWHPV DQG WKH LGHQWLW\ RI D SXWDWLYH IRUPDWH ELQGLQJ GRPDLQ $ SURSRVHG PRGHO IRU WKH IRUPDWH DQG >0R@GHSHQGHQW WUDQVFULSWLRQDO DFWLYDWLRQ RI K\F RSHURQ E\ )KO$ SURWHLQ YL

PAGE 7

/,67 2) 7$%/(6 7DEOH 3DJH %DFWHULDO 6WUDLQV DQG SKDJHV XVHG LQ WKLV VWXG\ 3ODVPLGV XVHG LQ WKLV VWXG\ ([SUHVVLRQ RI 3K\FODF= UHTXLUHV ERWK IRUPDWH DQG PRO\EGDWH ([SUHVVLRQ RI W! IKO$ODF=f LV LQGHSHQGHQW RI IRUPDWH DQG PRO\EGDWH 7UDQVFULSWLRQDO DFWLYDWLRQ RI 3K\FODF= LQ WKH SUHVHQFH RI PXWDWLRQV LQ WKH PRG RSHURQV 0RG(GHSHQGHQW DFWLYDWLRQ RI K\F RSHURQ UHTXLUHV PRO\EGDWH (IIHFW RI PXWDWLRQ LQ WKH JHQHV FRGLQJ IRU SURWHLQV LQ 0*' ELRV\QWKHVLV RQ 0RG(LQGHSHQGHQW 3K\FODF= H[SUHVVLRQ ,QDELOLW\ RI 7XQJVWDWH WR VXEVWLWXWH IRU 0RO\EGDWH LQ 0RH$GHSHQGHQW H[SUHVVLRQ RI K\F RSHURQ 5HJXODWLRQ RI 3K\FODF= E\ )KO$ PXWDQW SURWHLQV 6XSSUHVVLRQ RI WKH HIIHFW RI PRG( DQG PRH$ PXWDWLRQV RQ K\F H[SUHVVLRQ E\ )KO$ PXWDQW SURWHLQV 5HJXODWLRQ RI 3K\FODF= E\ )KO$ SURWHLQ )KO$PHGLDWHG H[SUHVVLRQ RI 3K\FODF= LQ WKH SUHVHQFH RI R[\JHQ RU QLWUDWH YLL

PAGE 8

3URGXFWLRQ RI )+/ DFWLYLW\ LQ WKH SUHVHQFH RI )KO$ LV IRUPDWHLQGHSHQGHQW ([SUHVVLRQ RI 4K\I$ODF=f LQ WKH SUHVHQFH RI YDULRXV IKO$ DOOHOHV YLLL

PAGE 9

/,67 2) $%%5(9,$7,216 $%& $73ELQGLQJ FDVVHWWH $SS< 7UDQVFULSWLRQDO DFWLYDWRU IRU F\[ DQG K\D RSHURQV $73 ES &53 'D 'SS) '1$ 'HR[\ULERQXFOHLF DFLG '1DVH '062 '77 ( FROL ('7$ )'++ WR +\GURJHQDVH )+/f )+/ )KO$ *73 +LV3 ,;

PAGE 10

+<' +\GURJHQDVH ,+) ,QWHJUDWLRQ +RVW )DFWRU ,37* ,VRSURS\OS'WKLRJDODFWRS\UDQRVLGH .G (TXLOLEULXP GLVVRFLDWLRQ FRQVWDQW .OHQRZ '1$ SRO\PHUDVH .OHQRZ IUDJPHQW /DJDU /EURWK DJDU /% /EURWK /%) /EURWK IRUPDWH /%* /EURWK JOXFRVH /%*) /EURWK JOXFRVH IRUPDWH /%*0 /EURWK JOXFRVH PRO\EGDWH /%0 /EURWK PRO\EGDWH /%: /EURWK WXQJVWDWH /LY* %UDQFKHGFKDLQ DPLQR DFLG WUDQVSRUW 0DO. 0DOWRVH WUDQVSRUW SURWHLQ 0*' 0RO\EGRSWHULQ JXDQLQH GLQXFOHRWLGH 0R 0RO\EGHQXP 0RFRIDFWRU 0RO\EGRSWHULQ ZLWK 0R >0R@ $FWLYDWHG PRO\EGHQXP SXWDWLYHf 0RGH 0RO\EGDWH WUDQVSRUW 0RO\EGRSWHULQ $ XQLTXH SWHULQ IRXQG LQ 0*' 0RG( 0RO\EGDWHGHSHQGHQW UHJXODWRU 0RG) 0RG) SURWHLQ XQNQRZQ IXQFWLRQ 037 0RO\EGRSWHULQ [

PAGE 11

15 1LWUDWH 5HGXFWDVH 213* 2UWKRQLWURSKHQ\O 'JDODFWRS\UDQRVLGH 25) 2SHQ UHDGLQJ IUDPH 3$*( 3RO\DFU\ODPLGH JHO HOHFWURSKRUHVLV 3%67 3KRVSKDWH EXIIHUHG VDOLQH ZLWK 7ZHHQ 3&5 3RO\PHUDVH FKDLQ UHDFWLRQ 3RW$ 3XWUHVFLQH WUDQVSRUW SURWHLQ 3RW* 3XWUHVFLQH WUDQVSRUW SURWHLQ 6'6 6RGLXP GRGHF\O VXOIDWH 70$2 7ULPHWK\ODPLQH1R[LGH 7ULV 7ULVK\GUR[\PHWK\OfDPLQRPHWKDQH 89 8OWUDYLROHW ;JDO EURPRFKORURLQGRO\O 'JDODFWRS\UDQRVLGH ;\O* ;\ORVH WUDQVSRUW SURWHLQ [L

PAGE 12

/,67 2) *(1( 6<0%2/6 $OO RI WKH JHQHV OLVWHG EHORZ DUH IURP (VFKHULFKLD FROL *HQH 6YPERO $OWHUQDWH FUHQH VYPEROV SKHQRWYSH DIIHFWHG KHS *HQH HQFRGLQJ %DFWHULRIHUULWLQ FRPLJUDWRU\ SURWHLQ KL D ODFWDPDVH FKL &KORUDWH UHVLVWDQW UHQDPHG PROf FUS F$03 UHFHSWRU SURWHLQ &53f JOREDO UHJXODWRU DOVR NQRZQ DV &$3 FDWDEROLWH DFWLYDWRU SURWHLQ F\D $GHQ\ODWH F\FODVH IGK) )'++ IRUPDWH GHK\GURJHQDVH+ )+/f IKO$ )KO$ WUDQVFULSWLRQDO DFWLYDWRU IRU JHQHV HQFRGLQJ FRPSRQHQWV RI IRUPDWH K\GURJHQO\DVH IQU )XPDUDWH QLWUDWH UHGXFWDVH JOREDO UHJXODWRU LQYROYHG LQ WUDQVFULSWLRQDO UHJXODWLRQ RI JHQHV LQ DQDHURELF UHVSLUDWLRQ JDO *DODFWRVH PHWDEROLVP K\F +\GURJHQDVH LVRHQ]\PH DQG SXWDWLYH HOHFWURQ WUDQVIHU SURWHLQV K\I 3XWDWLYH K\GURJHQDVHHQFRGLQJ RSHURQ VLOHQW K\S 3URWHLQV LQYROYHG LQ K\GURJHQDVH DOO LVRHQ]\PHVf PDWXUDWLRQ PRD PRO\EGRSWHULQ ELRV\QWKHVLV SUHYLRXVO\ FKO$ PRE 0*' ELRV\QWKHVLV SUHYLRXVO\ FKO% [LL

PAGE 13

PRG PRH PRO PRJ SIO USR1 VUO 0RO\EGDWH WUDQVSRUW SUHYLRXVO\ FKO' 0*' ELRV\QWKHVLV SUHYLRXVO\ FKO( XQGHILQHG PXWDWLRQ LQ PRO\EGDWH PHWDEROLVP 0*' ELRV\QWKHVLV SUHYLRXVO\ FKO* 3\UXYDWH IRUPDWHO\DVH 6LJPD VXEXQLW RI 51$ 3RO\PHUDVH 6RUELWRO XWLOL]DWLRQ .LOO

PAGE 14

$EVWUDFW RI 'LVVHUWDWLRQ 3UHVHQWHG WR WKH *UDGXDWH 6FKRRO RI WKH 8QLYHUVLW\ RI )ORULGD LQ 3DUWLDO )XOILOOPHQW RI WKH 5HTXLUHPHQWV IRU WKH 'HJUHH RI 'RFWRU RI 3KLORVRSK\ *(1(7,& $1' %,2&+(0,&$/ $1$/<6,6 2) 7+( 02/<%'$7('(3(1'(17 (;35(66,21 2) +<& 23(521 ,1 (6&+(5,&+,$ &2/, %\ :LOOLDP 7KRPDV 6HOI 'HFHPEHU &KDLUSHUVRQ 'U 7 6KDQPXJDP 0DMRU 'HSDUWPHQW 0LFURELRORJ\ DQG &HOO 6FLHQFH (VFKHULFKLD FROL JURZLQJ XQGHU DQDHURELF FRQGLWLRQV SURGXFHV + DQG & E\ WKH HQ]\PDWLF FOHDYDJH RI IRUPDWH FDWDO\]HG E\ IRUPDWH K\GURJHQO\DVH 7KH )+/ FRPSOH[ FRQVLVWV RI D PRO\EGRHQ]\PH IRUPDWH GHK\GURJHQDVH+ IGK)f K\GURJHQDVH K\Ff DQG LQWHUPHGLDWH HOHFWURQ FDUULHUV K\Ff 7UDQVFULSWLRQ RI ERWK IGK) DQG K\F RSHURQV UHTXLUHV )KO$ SURWHLQ DV D WUDQVFULSWLRQDO DFWLYDWRU DQG ERWK IRUPDWH DQG PRO\EGDWH DV VPDOO PROHFXOH HIIHFWRUV ,Q D PRG% PXWDQW GHIHFWLYH LQ PRO\EGDWH WUDQVSRUWf WUDQVFULSWLRQ RI 3K\FODF= UHTXLUHV VXSSOHPHQWDWLRQ RI WKH JURZWK PHGLXP ZLWK PRO\EGDWH 7UDQVFULSWLRQDO DFWLYDWLRQ RI 3K\FODF= E\ )KO$ SURWHLQ DOVR UHTXLUHV 0RG(PRO\EGDWH D PRO\EGDWHGHSHQGHQW UHSUHVVRU RI PRG$%&' RSHURQ LQYROYHG LQ PRO\EGDWH [LY

PAGE 15

WUDQVSRUWf DQG 0RH$ SURWHLQ UHTXLUHG IRU DFWLYDWLRQ RI PRO\EGDWHf 0RG(PRO\EGDWH ZDV VKRZQ WR ELQG WR K\F SURPRWHU '1$ WR ZLWK UHVSHFW WR WKH WUDQVFULSWLRQ VWDUW VLWHf XSVWUHDP RI WKH )KO$ ELQGLQJ VLWH LQ D '1DVH IRRWSULQWLQJ H[SHULPHQW +RZHYHU HYHQ LQ WKH DEVHQFH RI 0RG( PRO\EGDWHGHSHQGHQW WUDQVFULSWLRQ RI K\F RSHURQ FDQ VWLOO EH REVHUYHG 0XWDWLRQ LQ WKH PRH$ JHQH HOLPLQDWHG WKLV 0RG(LQGHSHQGHQW PRO\EGDWHGHSHQGHQW DFWLYDWLRQ VLQFH LQ D PRG( PRH$ GRXEOH PXWDQW 3K\FODF= ZDV QRW H[SUHVVHG 0RH$ SURWHLQ KDV EHHQ SURSRVHG WR FDWDO\]H WKH LQLWLDO DFWLYDWLRQ RI PRO\EGDWH IRU LQFRUSRUDWLRQ LQWR PRO\EGRSWHULQ ,W LV SURSRVHG WKDW WKH SURGXFW RI 0RH$ SURWHLQ LV DQ HIIHFWRU IRU WUDQVFULSWLRQDO DFWLYDWLRQ RI WKH K\F RSHURQ ,Q WKH SUHVHQFH RI IRUPDWH D PXWDQW )KO$ SURWHLQ ZLWK D VLQJOH DOWHUDWLRQ 5&f DFWLYDWHG H[SUHVVLRQ RI 3K\FODF= HYHQ LQ WKH DEVHQFH RI PRO\EGDWH $ VHFRQG PXWDQW )KO$ ZLWK WZR PXWDWLRQV $7 DQG (.f DOVR DFWLYDWHG 3K\FODF= LQ WKH DEVHQFH RI PRO\EGDWH DQG WKH OHYHO RI H[SUHVVLRQ ZDV LQFUHDVHG E\ ERWK IRUPDWH DQG PRO\EGDWH 'HOHWLRQ RI WKH XQLTXH 1WHUPLQDO UHJLRQ RI )KO$ FUHDWHG DQ HIIHFWRULQGHSHQGHQW DFWLYDWRU )KO$f $OO WKUHH )KO$ PXWDQW SURWHLQV DFWLYDWHG 3K\FODF= LQ D PRG( PRH$ GRXEOH PXWDQW (IIHFWRULQGHSHQGHQW DFWLYDWRU )KO$ DOVR DFWLYDWHG WUDQVFULSWLRQ RI K\I RSHURQ D VLOHQW JHQH FOXVWHU [Y

PAGE 16

ZLWK VWUXFWXUDO VLPLODULW\ WR K\F %DVHG RQ WKHVH UHVXOWV D ZRUNLQJ PRGHO LV SURSRVHG LQ ZKLFK )KO$IRUPDWHDFWLYDWHG PRO\EGHQXP FRPSOH[ DFWLYDWHV WUDQVFULSWLRQ RI IGK) DQG K\F RSHURQV DQG 0RG(PRO\EGDWH VHUYHV DV D VHFRQGDU\ DFWLYDWRU RI WUDQVFULSWLRQ [YL

PAGE 17

,1752'8&7,21 8QGHU DQDHURELF JURZWK FRQGLWLRQV (VFKHULFKLD FROL FDWDO\]HV FOHDYDJH RI IRUPDWH WR + DQG & XVLQJ WKH HQ]\PH FRPSOH[ IRUPDWH K\GURJHQO\DVH )+/ f 7KLV FRPSOH[ LQFOXGHV D IRUPDWH GHK\GURJHQDVH LVRHQ]\PH )'++ IGK)f D K\GURJHQDVH LVRHQ]\PH +<' K\Ff DQG LQWHUPHGLDWH HOHFWURQ FDUULHUV DOVR HQFRGHG E\ WKH K\F RSHURQ f 7KH )'++ FRQWDLQV VHOHQLXP DQG PRO\EGHQXP LQ WKH IRUP RI VHOHQRF\VWHLQH DQG PRO\EGRSWHULQ JXDQLQH GLQXFOHRWLGH 0*'f UHVSHFWLYHO\ f ,Q DGGLWLRQ WR WKH UHTXLUHPHQW RI PRO\EGHQXP IRU DFWLYLW\ RI )'++ WUDQVFULSWLRQ RI ERWK IGK) DQG K\F RSHURQ DOVR UHTXLUHV VXIILFLHQW OHYHOV RI PRO\EGDWH LQ WKH JURZWK PHGLXP f 7KLV UHTXLUHPHQW IRU PRO\EGHQXP IRU RSWLPXP OHYHO RI WUDQVFULSWLRQ LV DSSDUHQWO\ XQLYHUVDO IRU DOO PRO\EGRHQ]\PH V\QWKHVLV LQ ( FROL f 7UDQVFULSWLRQ RI IGK) DQG K\F RSHURQV UHTXLUHV EHVLGHV PRO\EGDWH )KO$ SURWHLQ DV DQ DFWLYDWRU DQG IRUPDWH f $GGLWLRQDOO\ WKH DGHSHQGHQW K\F RSHURQ DOVR UHTXLUHV LQWHJUDWLRQ KRVW IDFWRU IRU RSWLPXP

PAGE 18

WUDQVFULSWLRQ f 7KH )KO$ SURWHLQ LV VLPLODU WR WKH 1WU& SURWHLQ RI ( FROL f DQG 1LI$ SURWHLQ RI .OHEVLHOOD SQHXPRQLDH f 7KHVH SURWHLQV FRQWDLQ WKUHH GLVWLQJXLVKDEOH GRPDLQV DQ 1WHUPLQDO XQLTXH UHJLRQ D FHQWUDO GRPDLQ ZKLFK LQFOXGHV WKH QXFOHRWLGH WULSKRVSKDWH ELQGLQJ PRWLI DQG D &WHUPLQDO '1$ELQGLQJ GRPDLQ 7KH VHFRQG KDOI RI WKH WKUHH SURWHLQV ZKLFK LQFOXGHV WKH FHQWUDO DQG &WHUPLQDO GRPDLQV VKDUHV VLJQLILFDQW VLPLODULW\ %DVHG RQ DQDO\VLV RI VHYHUDO SRLQW PXWDQWV WKH XQLTXH 1WHUPLQDO SDUW RI WKH )KO$ SURWHLQ LV UHVSRQVLEOH IRU IRUPDWH LQWHUDFWLRQ f 7KHVH DQG RWKHU JHQHWLF DQG SK\VLRORJLFDO VWXGLHV OHG WR WKH FRQFOXVLRQ WKDW WKH )KO$ IRUPDWH FRPSOH[ LV WKH DFWLYDWRU RI K\F RSHURQ f ,QYHVWLJDWLRQ RI WKH UHJXODWLRQ RI WUDQVFULSWLRQ RI RSHURQV FRGLQJ IRU PRO\EGRHQ]\PHV LQ UHVSRQVH WR PRO\EGDWH LV FRPSOLFDWHG E\ WKH UHTXLUHPHQW RI 0RFRQWDLQLQJ FRIDFWRUV IRU WKH HQ]\PDWLF DFWLYLW\ RI WKH JHQH SURGXFWV $PRQJ WKH VHYHUDO RSHURQV ZKRVH WUDQVFULSWLRQ UHTXLUHV PRO\EGDWH WKH K\F RSHURQ LV XQLTXH LQ WKDW QRQH RI WKH SURWHLQV FRGHG E\ WKLV RSHURQ FRQWDLQV WKH QHFHVVDU\ DPLQR DFLG VHTXHQFH PRWLI IRXQG LQ PRO\EGRHQ]\PHV IRU ELQGLQJ 0*' f 7KH IDFW WKDW WKH K\F RSHURQ GRHV QRW FRGH IRU D PRO\EGRSURWHLQ DOORZV WKH PRO\EGDWHGHSHQGHQW UHJXODWLRQ VWXGLHV WR EH FRQGXFWHG

PAGE 19

LQGHSHQGHQW RI WKH QHHG IRU PRO\EGDWH IRU DFWLYLW\ RI WKH JHQH SURGXFW 0RO\EGDWH LV WUDQVSRUWHG LQ e FROL E\ D KLJKDIILQLW\ WUDQVSRUW V\VWHP D PHPEHU RI WKH $%&WUDQVSRUWHU IDPLO\ VHH IRU D UHYLHZf 7KLV WUDQVSRUW V\VWHP FRQWDLQV WKUHH SURWHLQV 0RG$%& FRGLQJ IRU WKH SHULSODVPLF ELQGLQJ SURWHLQ D PHPEUDQH FKDQQHO SURWHLQ DQG DQ $73 ELQGLQJ HQHUJL]LQJ SURWHLQ UHVSHFWLYHO\ 0XWDWLRQ LQ PRG$% RU PRGH JHQH OHDGV WR D GHIHFW LQ PRO\EGDWH WUDQVSRUW DQG WUDQVFULSWLRQ RI WKH RSHURQV FRGLQJ IRU WKH PRO\EGRHQ]\PHV LQ WKH FHOO LV LPSDLUHG LQ WKHVH PXWDQWV f 6XSSOHPHQWDWLRQ RI JURZWK PHGLXP ZLWK PRO\EGDWH DOOHYLDWHV WKH GHIHFW DQG WKH PRO\EGRHQ]\PHV DUH SURGXFHG DW RSWLPDO OHYHOV 7UDQVSRUW RI PRO\EGDWH LQWR WKH FHOO LV UHJXODWHG E\ D PRO\EGDWHVHQVLWLYH UHSUHVVRU 0RG( SURWHLQ 7KH LQWHUDFWLRQ EHWZHHQ 0RG(PRO\EGDWH FRPSOH[ DQG WKH PRG$%&' RSHUDWRU '1$ KDV EHHQ ZHOO FKDUDFWHUL]HG f $W SUHVHQW WKH 0RG( SURWHLQ LV WKH RQO\ NQRZQ PRO\EGHQXP UHVSRQVH UHJXODWRU LQ ( FROL %DVHG RQ '1DVH IRRWSULQWLQJ DQDO\VLV WKH 0RG( SURWHLQ DOVR ELQGV WR PRD SURPRWHU '1$ EXW LQ D PRO\EGDWHLQGHSHQGHQW PDQQHU f $ QXPEHU RI SURWHLQV DUH UHTXLUHG IRU WKH ELRV\QWKHVLV RI 0*' DQG WKHVH DUH HQFRGHG E\ PRD PRE PRH DQG PRJ JHQHV

PAGE 20

f 7KH UROH RI WKH SURWHLQV HQFRGHG E\ PRD PRE DQG PRH% LQ WKH ELRV\QWKHVLV RI 0*' LV ZHOO HVWDEOLVKHG +RZHYHU WKH SK\VLRORJLFDO IXQFWLRQV RI WKH 0RH$ DQG 0RJ SURWHLQV DUH QRW NQRZQ +DVRQD HW DO UHFHQWO\ SURSRVHG WKDW WKH 0RH$ SURWHLQ SOD\V D UROH LQ DFWLYDWLRQ RI PRO\EGHQXP f $OWKRXJK PRO\EGDWH LV UHTXLUHG IRU H[SUHVVLRQ RI K\FODF= WKH UHJXODWLRQ RI WUDQVFULSWLRQ RI K\F RSHURQ XWLOL]LQJ K\F'ODF=f ZDV IRXQG WR EH LQGHSHQGHQW RI WKH FRPSRQHQWV LQ WKH 0*' ELRV\QWKHWLF SDWKZD\ f 7KHVH UHVXOWV VXJJHVW WKDW PRO\EGRSWHULQ 0R FRIDFWRU RU 0*' LV QRW QHHGHG IRU WKH PRO\EGDWHGHSHQGHQW FRQWURO RI WUDQVFULSWLRQ RI K\F RSHURQ $SSDUHQWO\ PRO\EGDWH DQGRU DQ DFWLYDWHG IRUP RI PRO\EGHQXP LV WKH VPDOO PROHFXOH HIIHFWRU LQ WKLV UHJXODWLRQ 6LQFH K\F RSHURQ LV XQLTXH LQ WKDW LW GRHV QRW HQFRGH PRO\EGRHQ]\PH EXW GRHV UHTXLUHV PRO\EGDWH IRU WUDQVFULSWLRQ WKLV RSHURQ ZDV FKRVHQ WR HOXFLGDWH WKH PHFKDQLVP RI UHJXODWLRQ RI PRO\EGDWHGHSHQGHQW WUDQVFULSWLRQ LQ ( FROL

PAGE 21

/,7(5$785( 5(9,(: &RXSOHG HOHFWURQ WUDQVIHU LV WKH GULYLQJ IRUFH EHKLQG DOPRVW DOO HQHUJ\GHULYLQJ SURFHVVHV LQ ELRORJLFDO V\VWHPV 3HWHU 0LWFKHOO ILUVW SURSRVHG KLV FKHPLRVPRWLF WKHRU\ LQ f DQG WKLV WKHRU\ KDV EHHQ WKH IRXQGDWLRQ RI FRXQWOHVV VWXGLHV RI HQHUJ\ PHWDEROLVP LQ ERWK HXNDU\RWHV DQG SURNDU\RWHV %DFWHULD ERWK DHUREHV DQG IDFXOWDWLYH DQDHUREHV FDQ XWLOL]H DV D WHUPLQDO HOHFWURQ DFFHSWRU WR SURGXFH ODUJH DPRXQWV RI $73 QHHGHG IRU JURZWK (VFKHULFKLD FROL D IDFXOWDWLYH DQDHUREH FDQ DOVR XWLOL]H DOWHUQDWLYH HOHFWURQ DFFHSWRUV ZKHQ R[\JHQ LV QRW DYDLODEOH WR JHQHUDWH SURWRQ PRWLYH IRUFH ZKLFK LV WKHQ XWLOL]HG ERWK IRU JHQHUDWLRQ RI $73 DQG IRU WUDQVSRUW RI QXWULHQWV )RU ( FROL WKHVH DOWHUQDWH HOHFWURQ DFFHSWRUV LQFOXGH QLWUDWH GLPHWK\O VXOIR[LGH DQG WULPHWK\ODPLQH1R[LGH f 0DQ\ RI WKH SULPDU\ GHK\GURJHQDVHV DQG WHUPLQDO UHGXFWDVHV HJ IRUPDWH GHK\GURJHQDVHV QLWUDWH UHGXFWDVH VHH UHIHU f ZKLFK DUH WKH FRPSRQHQWV RI WKHVH DQDHURELF UHVSLUDWRU\ V\VWHPV UHTXLUH PRO\EGHQXP LQ WKH IRUP RI HQ]\PH FRIDFWRU PRO\EGRSWHULQ JXDQLQH GLQXFOHRWLGH 0*' f 7KH VWXG\ RI

PAGE 22

WKHVH PRO\EGRHQ]\PHV DQG WKH XSWDNH DQG SURFHVVLQJ RI PRO\EGHQXP LQWR 0*' KDV SURYHQ WR EH DQ LPSRUWDQW DVSHFW RI LQYHVWLJDWLRQ LQWR WKH DQDHURELF PHWDEROLVP RI ( FROL 7KH HDUOLHVW VWXGLHV RI PRO\EGDWH PHWDEROLVP XWLOL]HG FKORUDWH DQ DQDORJXH RI QLWUDWH WR LGHQWLI\ WKH JHQHV UHTXLUHG IRU DFWLYH PRO\EGRHQ]\PHV f 8SRQ UHGXFWLRQ E\ WKH PRO\EGRHQ]\PH QLWUDWH UHGXFWDVH FKORUDWH LV FRQYHUWHG WR WKH WR[LF IRUP FKORULWH ZKLFK H[LVWV LQ VROXWLRQ DV K\SRFKORULWH DQG LV WR[LF WR WKH FHOO ,Q RUGHU IRU ( FROL WR JURZ LQ WKH SUHVHQFH RI FKORUDWH D PXWDWLRQ PXVW RFFXU ZKLFK HOLPLQDWHV 15 DFWLYLW\ 6LQFH WKHVH PXWDWLRQV FDQ RFFXU QRW RQO\ ZLWKLQ WKH JHQHV HQFRGLQJ WKH 15 HQ]\PH LWVHOI EXW DOVR LQ WKH XSWDNH RI PRO\EGDWH DQG ELRJHQHVLV RI PRO\EGHQXP FRIDFWRU FKORUDWHUHVLVWDQFH EHFDPH D SRZHUIXO WRRO WR LGHQWLI\ WKH JHQHV HQFRGLQJ SURWHLQV LQYROYHG LQ PRO\EGDWH PHWDEROLVP 7KHVH FKORUDWH UHVLVWDQW PXWDQWV ZKLFK ZHUH RULJLQDOO\ WHUPHG FKL KDYH EHHQ UHQDPHG PRO f $OWKRXJK WKHUH ZHUH VHYHUDO FODVVHV RI PRO PXWDQWV RQO\ RQH FODVV ZDV IRXQG WR EH VXSSUHVVHG E\ WKH DGGLWLRQ RI PRO\EGDWH WR WKH FXOWXUH PHGLXP f 7KHVH PXWDQWV ZHUH SUHVXPHG WR EH GHILFLHQW LQ PRO\EGDWHXSWDNH 0RO\EGDWH 7UDQVSRUW 0RO\EGHQXP LV IRXQG LQ QDWXUH PRVW DEXQGDQWO\ LQ WKH R[LGL]HG IRUP RI PRO\EGDWH DQG LW LV WKLV IRUP ZKLFK LV

PAGE 23

DFWLYHO\ WUDQVSRUWHG E\ ( FROL IRU XVH LQ PRO\EGRHQ]\PHV $ KLJKDIILQLW\ WUDQVSRUWHU RI PRO\EGDWH HQFRGHG E\ WKH PRG$%&' RSHURQ KDV EHHQ FKDUDFWHUL]HG f 7KLV WUDQVSRUWHU ZKLFK FRQVLVWV RI D SHULSODVPLF PRO\EGDWHn ELQGLQJ SURWHLQ 0RG$ f DQ LQWHJUDOPHPEUDQH FKDQQHOLQJ SURWHLQ 0RG% DQG D F\WRSODVPLF $73ELQGLQJ HQHUJL]HU SURWHLQ 0RGH f UHVHPEOHV RWKHU $%&W\SH WUDQVSRUW V\VWHPV f $OWKRXJK QRW NQRZQ WR EH UHTXLUHG IRU KLJKDIILQLW\ WUDQVSRUW RI PRO\EGDWH WKH SURGXFW RI PRG' LV SURSRVHG WR EH DQ RXWHUPHPEUDQH SURWHLQ SRVVLEO\ D PRO\EGDWH SRULQ f 0XWDWLRQ LQ HLWKHU PRG$ PRG% RU PRGH HOLPLQDWHV WKH KLJKDIILQLW\ XSWDNH RI PRO\EGDWH DQG WKXV DOO PRO\EGRHQ]\PH DFWLYLW\ f 8SRQ PRO\EGDWH VXSSOHPHQWDWLRQ RI ULFK PHGLXP DW D FRQFHQWUDWLRQ RI DERXW \0 PRO\EGDWH LV WUDQVSRUWHG E\ D ORZDIILQLW\ QRQn VSHFLILF DQLRQ WUDQVSRUWHU ZKLFK LV \HW WR EH LGHQWLILHG f 8QGHU VXOIXUOLPLWLQJ FRQGLWLRQV WKH VXOIDWH WUDQVSRUW V\VWHP DOVR DOORZV WUDQVSRUW RI PRO\EGDWH DV VHHQ E\ WKH UHVWRUDWLRQ RI PRO\EGRHQ]\PH DFWLYLW\ LQ D PRG PXWDQW JURZQ LQ JOXFRVH PLQLPDO PHGLXP RU PHGLXP OLPLWLQJ LQ VXOIXU FRPSRXQGV f 7UDQVFULSWLRQ RI PRG$%&' RSHURQ LV WLJKWO\ UHJXODWHG LQ UHVSRQVH WR LQWUDFHOOXODU PRO\EGDWH OHYHOV E\ WKH WUDQVFULSWLRQDO UHJXODWRU SURWHLQ 0RG( f 0RG(

PAGE 24

DFWV DV D PRO\EGDWHGHSHQGHQW UHSUHVVRU RI PRG$%&' WUDQVFULSWLRQ E\ ELQGLQJ WR WKH RSHUDWRUSURPRWHU RI PRG$%&' LQ WKH SUHVHQFH RI PRO\EGDWH 7KLV PRO\EGDWHGHSHQGHQW 0RG('1$ELQGLQJ KDV EHHQ GHPRQVWUDWHG LQ YLWUR LQ '1$ HOHFWURSKRUHWLF PRELOLW\ VKLIW H[SHULPHQWV f DV ZHOO DV LQ '1DVH ,IRRWSULQWLQJ H[SHULPHQWV f 0XWDJHQHVLV RI WKH UHJLRQ RI '1$ IURP WKH PRG$ RSHUDWRUSURPRWHU LQ ZKLFK WKH 0RG( SURWHLQ LQWHUDFWV GHWHUPLQHG WKDW LQYHUWHG UHSHDWV RI WKH VHTXHQFH *77$ DV ZHOO DV SHQWDPHULF VHTXHQFHV 7$&$7 DQG 7$7$7 DUH LPSRUWDQW LQ 0RG(PRO\EGDWH ELQGLQJ f 0XWDWLRQV LQ PRG( JHQH ZKLFK HOLPLQDWHG PRO\EGDWHGHSHQGHQW UHSUHVVLRQ RI PRG$ODF DV ZHOO DV PXWDWLRQV LQ PRG( ZKLFK SUHYHQW H[SUHVVLRQ RI PRG$ODF LQ WKH SUHVHQFH RU DEVHQFH RI PRO\EGDWH KDYH EHHQ LVRODWHG DQG FKDUDFWHUL]HG LQ YLYR f 3XULILHG 0RG( SURWHLQ DOVR KDV EHHQ VKRZQ WR GLVSOD\ DQ LQWULQVLF IOXRUHVFHQFH ZKLFK ZDV TXHQFKHG XSRQ DGGLWLRQ RI PRO\EGDWH f 8VLQJ WKLV SURSHUW\ WKH IRU 0RG(PRO\EGDWH DVVRFLDWLRQ ZDV GHWHUPLQHG WR EH Q0 f ,Q DGGLWLRQ WR LQWHUDFWLQJ ZLWK PRO\EGDWH 0RG( SURWHLQ DOVR DSSDUHQWO\ UHFRJQL]HV WXQJVWDWH DQ DQDORJ RI PRO\EGDWH ,Q D PRG% PXWDQW WXQJVWDWH FDQ HIIHFWLYHO\ UHSODFH PRO\EGDWH LQ WKH UHSUHVVLRQ RI WUDQVFULSWLRQ RI PRG$ODF LQ YLYR DQG WKLV UHSUHVVLRQ LV PHGLDWHG WKURXJK

PAGE 25

0RG(WXQJVWDWH f 7XQJVWDWH DOVR VXSSRUWHG HIILFLHQW 0RG( ELQGLQJ WR PRG$ RSHUDWRU '1$ LQ D '1$ HOHFWURSKRUHWLF PRELOLW\ VKLIW H[SHULPHQW f DOWKRXJK WKH DIILQLW\ RI 0RG(:B IRU '1$ ELQGLQJ LV DERXW IROG ORZHU WKDQ 0RG( PRO\EGDWH 7XQJVWDWH DOVR ELQGV WR 0RG( LQ YLWUR DV VHHQ E\ D GHFUHDVH LQ WKH LQWULQVLF IORXUHVFHQFH RI SXULILHG 0RG( SURWHLQ f $OWKRXJK ( FROL LV QRW NQRZQ WR SURGXFH WXQJVWHQFRQWDLQLQJ HQ]\PHV K\SHUWKHUPRSKLOHV VXFK DV 3\URFRFFXV IXULRVXV KDYH D QXPEHU RI WXQJVWHQFRQWDLQLQJ HQ]\PHV f $ WXQJVWHQFRQWDLQLQJ HQ]\PH FRIDFWRU VLPLODU WR 0*' DSSDUHQWO\ LV PRUH VWDEOH XQGHU KLJK WHPSHUDWXUHV 7XQJVWDWH ZKHQ SUHVHQW LQ ( FROL FXOWXUH PHGLXP SUHYHQWV SURGXFWLRQ RI DFWLYH PRO\EGRHQ]\PHV :KHWKHU WKLV ODFN RI DFWLYLW\ LQ WKH SUHVHQFH RI WXQJVWDWH LV GXH WR FRPSHWLWLRQ EHWZHHQ PRO\EGDWH DQG WXQJVWDWH IRU WUDQVSRUW LQWR WKH FHOO RU FRPSHWLWLRQ EHWZHHQ WKHVH WZR VLPLODU DQLRQV GXULQJ VRPH VWHS LQ 0*' ELRV\QWKHVLV LV QRW NQRZQ 0*' %LRV\QWKHVLV 2QFH WUDQVSRUWHG PRO\EGDWH LV LQFRUSRUDWHG LQWR WKH HQ]\PH FRIDFWRU PRO\EGRSWHULQ JXDQLQH GLQXFOHRWLGH 0*'f LQ D VHULHV RI UHDFWLRQV ZKLFK KDYH EHHQ FKDUDFWHUL]HG DW WKH ELRFKHPLFDO OHYHO )LJ f 0XWDWLRQV LQ JHQHV ZKRVH SURGXFWV DUH UHTXLUHG IRU 0*' ELRV\QWKHVLV DOVR DULVH LQ D

PAGE 26

FKORUDWHUHVLVWDQFH VHOHFWLRQ DQG WKHVH PXWDQWV GLVSOD\ D SOHLRWURSLF QXOO SKHQRW\SH IRU WKH DFWLYLW\ RI DOO PRO\EGRHQ]\PHV 2QH VXFK FKORUDWHUHVLVWDQW PXWDQW KDV EHHQ LGHQWLILHG DV KDYLQJ D PXWDWLRQ LQ WKH ILUVW JHQH LQ WKH PRH$% RSHURQ WKH PRH$ JHQH +DVRQD HW DO f GHPRQVWUDWHG WKDW D PRH$ PXWDQW FDQ EH VXSSUHVVHG E\ VXSSOHPHQWLQJ WKH FXOWXUH PHGLXP ZLWK VXOILGH &XOWXULQJ WKH PRH$ PXWDQW VWUDLQ LQ ORZVXOIXU PHGLXP ZKLFK GHUHSUHVVHV WKH VXOIDWH WUDQVSRUW DQG DFWLYDWLRQ V\VWHP f DOVR DOORZV IRU PRO\EGRHQ]\PH DFWLYLW\ SUHVXPDEO\ E\ SURGXFWLRQ RI HQGRJHQRXV VXOILGH IURP WKH SURGXFWV RI F\V JHQHV f %DVHG RQ WKHVH REVHUYDWLRQV WKH SURGXFW RI PRH$ KDV EHHQ SURSRVHG WR EH LQYROYHG LQ WKH LQLWLDO DFWLYDWLRQ RI PRO\EGDWH XSRQ WUDQVSRUW LQWR WKH F\WRSODVP f 0RH$ DQG 0RJ SURWHLQV DUH SUREDEO\ LQYROYHG LQ DFWLYDWLRQ DQG LQFRUSRUDWLRQ RI 0R LQWR PRO\EGRSWHULQ LQ WKH V\QWKHVLV RI 0RFRIDFWRU )LJ f 2WKHU FKORUDWHUHVLVWDQW PXWDQWV DOORZHG LGHQWLILFDWLRQ RI JHQHV DQG JHQH SURGXFWV LQYROYHG LQ WKH RUJDQLF FRPSRQHQW RI 0*' ELRV\QWKHVLV )LJ f 7KH JHQH SURGXFWV RI PRD$%& DUH LQYROYHG LQ WKH V\QWKHVLV RI WKH 3UHFXUVRU = IURP D JXDQRVLQH GHULYDWLYH WHUPHG *XDQRVLQH; 7KLV SUHFXUVRU = LV WKHQ FRQYHUWHG WR 0RO\EGRSWHULQ E\ WKH SURGXFWV RI PRD'( JHQHV DQG WKH SURGXFW RI PRH% 7KRXJK LW GRHV QRW FRQWDLQ

PAGE 27

0RD$ 0RD% 3UHFXUVRU = +f 0RD' 0RD( 0RH% )LJXUH 0RO\EGRSWHULQ JXDQLQH GLQXFOHRWLGH ELRV\QWKHWLF SDWKZD\ LQ ( FROL DGDSWHG IURP 5HI f

PAGE 28

PRO\EGHQXP PRO\EGRSWHULQ LV D VXOIXU\ODWHG IRUP RI SUHFXUVRU = ,Q ZKDW LV DVVXPHG WR EH WKH ILQDO VWHS WKH JXDQLQH QXFOHRWLGH LV DGGHG E\ WKH SURGXFWV RI WKH PRE$% RSHURQ +RZHYHU VRPH RI WKHVH UHDFWLRQV DUH LQIHUUHG IURP JHQHWLF DQG SK\VLRORJLFDO GDWD DQG XQWLO WKH FRPSOHWH ELRV\QWKHVLV RI 0*' LV UHFRQVLWLWXWHG ZLWK SXULILHG SURWHLQV LQ YLWUR FDUH PXVW EH WDNHQ ZKHQ FRQVLGHULQJ WKHVH SURSRVHG UHDFWLRQV LQ FRQWH[W ZLWK SK\VLRORJLFDO HIIHFWV LQ YLYR )RUPDWH +\GURJHQO\DVH $OO PRO\EGRHQ]\PHV VWXGLHG VR IDU LQ ( FROL FRQWDLQ WKH 0*' FRIDFWRU 7KH FU\VWDO VWUXFWXUH RI RQH RI WKHVH PRO\EGRHQ]\PHV IRUPDWH GHK\GURJHQDVH + )'++f KDV EHHQ GHWHUPLQHG f 7KLV FU\VWDO VWUXFWXUH FRQILUPHG WKH SURSRVHG VWUXFWXUH RI 0*' LQ ( FROL )'++ HQFRGHG E\ WKH IGK) JHQH f LV SDUW RI DQ HQ]\PH FRPSOH[ IRUPDWH K\GURJHQO\DVH )RUPDWH K\GURJHQO\DVH FDUULHV RXW WKH HQ]\PDWLF FRQYHUVLRQ RI IRUPDWH WR + DQG & GXULQJ IHUPHQWDWLRQ f 7KH RYHUDOO UHDFWLRQ FDWDO\]HG RXW E\ WKH IRUPDWH K\GURJHQO\DVH WKRXJK QRW NQRZQ WR EH HQHUJ\ FRQVHUYLQJ LV EHQHILFLDO WR DQ DQDHURELFDOO\ JURZLQJ ( FROL FHOO VLQFH LW UHGXFHV WKH DPRXQW RI RQH RI WKH DFLGLF HQG SURGXFWV RI IHUPHQWDWLRQ IRUPDWH %HVLGHV )'++ WKH )+/ FRPSOH[ DOVR FRQWDLQV K\GURJHQDVH +<' HQFRGHG E\ K\F RSHURQf DV ZHOO DV HOHFWURQ FDUULHU SURWHLQV DOVR

PAGE 29

HQFRGHG E\ K\Ff ZKLFK OLQN WKH R[LGDWLRQ RI IRUPDWH WR & E\ WKH )'++ WR WKH HYROXWLRQ RI GLK\GURJHQ E\ +<' f )RUPDWH K\GURJHQO\DVH FRPSOH[ FDQ UHDGLO\ EH DVVD\HG LQ ZKROH FHOOV DQG H[WUDFWV E\ WKH IRUPDWHGHSHQGHQW HYROXWLRQ RI GLK\GURJHQ 7KH K\F RSHURQ FRQWDLQV QLQH RSHQ UHDGLQJ IUDPHV K\F$%&'()*+, DQG DOO JHQHV H[FHSW IRU K\F$ DUH UHTXLUHG IRU )+/ DFWLYLW\ f 7KH SURGXFW RI K\F$ QHJDWLYHO\ UHJXODWHV WUDQVFULSWLRQ RI K\F RSHURQ E\ DQ DV \HW XQGHILQHG PHFKDQLVP f 7KH SURGXFW RI K\F( UHVHPEOHV WKH ODUJH VXEXQLW RI K\GURJHQDVHV DQG LV SUHVXPHG WR EH WKH VWUXFWXUDO SURWHLQ IRU +<' f 7KH SURGXFW RI K\FO LV D SURWHDVH UHTXLUHG IRU WKH PDWXUDWLRQ RI WKH +\F( VWUXFWXUDO SURWHLQ f 7KH UHPDLQLQJ JHQH SURGXFWV RI WKH K\F RSHURQ DUH SUHVXPHG WR EH LQYROYHG HLWKHU LQ SURFHVVLQJ RU LQVHUWLRQ RI +<' ZLWKLQ WKH F\WRSODVPLF PHPEUDQH RU WR VHUYH DV HOHFWURQ FDUULHUV OLQNLQJ )'++ WR +<' LQ WKH PHPEUDQHERXQG )+/ FRPSOH[ +\GURJHQDVH LVRHQ]\PH D >1L)H@ K\GURJHQDVH DOVR UHTXLUHV WKH SURGXFWV WKH K\S% K\S& K\S' DQG K\S( JHQHV IRU PDWXUDWLRQ f 7KH K\S RSHURQ ZKRVH JHQH SURGXFWV DUH UHTXLUHG IRU WKH DFWLYLW\ RI WZR RWKHU K\GURJHQDVH LVRHQ]\PHV LQ ( FROL K\GURJHQDVH +<'f DQG K\GURJHQDVH +<'f OLHV DGMDFHQW WR WKH K\F RSHURQ DQG LV WUDQVFULEHG LQ WKH RSSRVLWH GLUHFWLRQ f

PAGE 30

%RWK WKH K\F DQG K\S RSHURQV DV ZHOO DV WKH IGK) JHQH DUH UHJXODWHG SRVLWLYHO\ E\ WKH WUDQVFULSWLRQDO DFWLYDWRU )KO$ f )KO$ D PHPEHU RI WKH 1WU& IDPLO\ RI WUDQVFULSWLRQDO DFWLYDWRUV f DFWLYDWHV WUDQVFULSWLRQ RI WKHVH JHQHV LQ WKH SUHVHQFH RI IRUPDWH WKH VXEVWUDWH IRU )+/ f 7KLV DFWLYDWLRQ DOVR UHTXLUHV WKH DOWHUQDWLYH VLJPD IDFWRU D RI 51$ SRO\PHUDVH f 3XULILHG )KO$ KDV EHHQ VKRZQ WR ELQG WR '1$ XSVWUHDP RI K\F K\S DQG IGK) JHQHV f DQG WR DFWLYDWH WUDQVFULSWLRQ RI K\F RSHURQ LQ YLWUR LQ D WUDQVFULSWLRQWUDQVODWLRQ H[SHULPHQW LQ UHVSRQVH WR WKH HIIHFWRU IRUPDWH f ,Q DGGLWLRQ )KO$ KDV DQ LQWULQVLF $73DVH DFWLYLW\ VLPLODU WR WKDW RI WKH SKRVSKRU\ODWHG IRUP RI 1WU& SURWHLQ f DQG WKLV DFWLYLW\ UHVSRQGV SRVLWLYHO\ WR ERWK IRUPDWH DV ZHOO DV '1$ IURP WKH K\F XSVWUHDP UHJLRQ f 7KH )KO$ SURWHLQ KDV WKUHH GLVWLQFW GRPDLQV DQ 1 WHUPLQDO XQLTXH GRPDLQ ZLWK OLWWOH VLPLODULW\ WR RWKHU 1WU& W\SH DFWLYDWRUV D FHQWUDO GRPDLQ ZKLFK FRQWDLQV D QXFOHRWLGH ELQGLQJ PRWLI DQG D &WHUPLQDO '1$ELQGLQJ GRPDLQ f $OWKRXJK VRPH RI WKH DFWLYDWRUV RI WKH 1WU& IDPLO\ DUH SKRVSKRU\ODWHG E\ D FRJQDWH VHQVRU SURWHLQ HJ 1WU% f WKH )KO$ LV RQH RI D KDQGIXO RI DFWLYDWRUV ZKLFK LV QRW SKRVSKRU\ODWHG 7KH 1WHUPLQDO UHJLRQ DSSDUHQWO\ LQWHUDFWV ZLWK WKH HIIHFWRU IRUPDWH LQ VXFK D ZD\

PAGE 31

WR DOORZ D FRQIRUPDWLRQDO FKDQJH LQ WKH )KO$ ZKLFK LQ WXUQ SURPRWHV WKH ELQGLQJ RI '1$ LQ WKH XSVWUHDP UHJLRQV RI K\F K\S DQG IGK) JHQHV 2QFH ERXQG WR WKH XSVWUHDP UHJLRQ D VXEVHTXHQW HQHUJ\GHSHQGHQW LQWHUDFWLRQ ZLWK RERXQG 51$ SRO\PHUDVH SURPRWHV WKH LQLWLDWLRQ RI WUDQVFULSWLRQ f 0XWDQWV RI )KO$ ZKLFK DOORZHG H[SUHVVLRQ RI K\F RSHURQ LQ WKH DEVHQFH RI IRUPDWH KDYH EHHQ LVRODWHG DQG WKHVH PXWDWLRQV DOWHUHG DPLQR DFLGV ZLWKLQ WKH XQLTXH 1WHUPLQDO GRPDLQ f 7KHVH PXWDQW )KO$ SURWHLQV GLVSOD\HG D KLJKHU OHYHO RI LQWULQVLF $73DVH DFWLYLW\ DV ZHOO DV DFWLYDWLQJ WUDQVFULSWLRQ RI K\FODF WR D KLJKHU OHYHO WKDQ WKDW RI WKH QDWLYH )KO$ ,Q DGGLWLRQ WR J )KO$ DQG IRUPDWH WUDQVFULSWLRQ RI ERWK IGK) DQG K\F RSHURQ DOVR UHTXLUHV PRO\EGDWH f 7UDQVFULSWLRQ RI JHQHV HQFRGLQJ RWKHU PRO\EGRHQ]\PHV HJ QDU*+-, HQFRGLQJ QLWUDWH UHGXFWDVH DQG GPV$%& HQFRGLQJ GLPHWK\OVXOIR[LGH UHGXFWDVHf KDV DOVR EHHQ VKRZQ WR UHTXLUH PRO\EGDWH IRU RSWLPDO H[SUHVVLRQ f $OWKRXJK LW LV ORJLFDO WKDW WKH FHOO UHVSRQG WR WKH SUHVHQFH RI LQWUDFHOOXODU PRO\EGDWH LQ WKH H[SUHVVLRQ RI PRO\EGRHQ]\PHV DQG PRO\EGHQXPUHTXLULQJ HQ]\PH FRPSOH[HV )+/ FRPSOH[f WKH PHFKDQLVP E\ ZKLFK PRO\EGDWH LV VHQVHG LQ WKLV UHJXODWLRQ KDV QRW EHHQ HVWDEOLVKHG %HFDXVH WUDQVFULSWLRQ DQG WUDQVODWLRQ DUH FORVHO\ OLQNHG LQ ( FROL DQDO\VLV RI

PAGE 32

H[SUHVVLRQ RI RSHURQV ZKLFK HQFRGH PRO\EGRHQ]\PHV ZKLFK UHTXLUH PRO\EGDWH DW WKH WUDQVFULSWLRQDO OHYHO FRXOG EH LQIOXHQFHG E\ WKH QHHG IRU WKH FRIDFWRU 0*' %HFDXVH K\F RSHURQ LWVHOI GRHV QRW HQFRGH D PRO\EGRHQ]\PH EXW VWLOO UHTXLUHV PRO\EGDWH IRU WUDQVFULSWLRQ K\F RSHURQ SURYLGHV XQLTXH RSSRUWXQLW\ WR LQYHVWLJDWH WKH PHFKDQLVP RI WKLV PRO\EGDWHGHSHQGHQW JHQH H[SUHVVLRQ LQ ( FROL

PAGE 33

0$7(5,$/6 $1' 0(7+2'6 %DFWHULDO 6WUDLQV 7KH EDFWHULDO VWUDLQV SKDJHV DQG SODVPLGV XVHG LQ WKLV VWXG\ DUH OLVWHG LQ 7DEOHV DQG $OO VWUDLQV DUH GHULYDWLYHV RI ( FROL 0HGLD DQG *URZWK &RQGLWLRQV 0HGLD XVHG IRU EDFWHULDO JURZWK ZHUH SUHYLRXVO\ GHVFULEHG f /EURWK /%f ZKLFK VHUYHG DV ULFK PHGLXP ZDV VXSSOHPHQWHG ZLWK JOXFRVH bf VRGLXP IRUPDWH P0f RU VRGLXP PRO\EGDWH P0f DV QHHGHG $QWLELRWLFV ZKHQ LQFOXGHG ZHUH DW WKH IROORZLQJ FRQFHQWUDWLRQV DPSLFLOOLQ SJP/ WHWUDF\FOLQH SJP/ FKORUDPSKHQLFRO SJP/ SODWHVf SJP/ OLTXLGf NDQDP\FLQ SJP/ 7UDQVGXFWLRQ ZLWK SKDJHV 3, DQG ; ZDV SHUIRUPHG DV SUHYLRXVO\ GHVFULEHG f *HQHWLF DQG PROHFXODU ELRORJLFDO H[SHULPHQWV ZHUH SHUIRUPHG HVVHQWLDOO\ DV SUHYLRXVO\ GHVFULEHG f 'HOHWLRQ PXWDQWV ZHUH FRQVWUXFWHG DIWHU LQVHUWLRQ RI 7QO2 DQG H[FLVLRQ 7HWUDF\FOLQH VHQVLWLYH GHOHWLRQ GHULYDWLYHV ZHUH VHOHFWHG XVLQJ IXVDULF DFLG PHGLXP f

PAGE 34

7DEOH %DFWHULDO 6WUDLQV DQG SKDJHV XVHG LQ WKLV VWXG\ 6WUDLQ RU SKDJH 5HOHYDQW JHQRW\SH 6RXUFH5HIHUHQFH 6WUDLQV %/'(f RPS7 JDO GFP ,RQ KVG6% ;'( /DERUDWRU\ FROOHFWLRQ %: $ODF8f USV/ /DERUDWRU\ FROOHFWLRQ 0& DUD' $DUJ)ODF8f USV/ /DERUDWRU\ FROOHFWLRQ 05 UHO$O IOE% GHR&O SWV) UEV5 SFQ% ]DG7QO &*6& 5. 0& J\U$ QRQ /DERUDWRU\ FROOHFWLRQ 9-6 PRG%7Q 9 6WHZDUW 9-6 PRH$7Q 9 6WHZDUW 9-6 PRE7Q 9 6WHZDUW 9-6 PRD7Q 9 6WHZDUW 9-6 PRJ7Q 9 6WHZDUW <0& HQG$ WKL KVG5 $ODF USR17Q % 0DJDVDQLN 6( IKO$7Q /DERUDWRU\ FROOHFWLRQ 6( IQU ]FM7QO2 /DERUDWRU\ FROOHFWLRQ 6( SIO ]ED7Q /DERUDWRU\ FROOHFWLRQ 6( 0& pK\F'ODF=f $ODF $HEJ /DERUDWRU\ FROOHFWLRQ 6( PRG%7Q $JDOPRG%f ODF=7QO2 /DERUDWRU\ FROOHFWLRQ 6( %: $PRG(.Pf f 6( %: $PRG).P /DERUDWRU\ FROOHFWLRQ 6( %: $PRG().P /DERUDWRU\ FROOHFWLRQ 6( %: $F\D.P FUSr /DERUDWRU\ FROOHFWLRQ 6( %: PRH$ ]EL..P ]EM7QO2 f $+ PRH%.P ]EM7QO2 f :6 5. DK\I%*f&P 7KLV VWXG\ -! IKO$ODF=f GHULYDWLYHV 6( 0& W! IKO$ODF=f f 6( 6( PRG%7QO2 6( ; 3,f9-6 06( USR17QO2 6( ; 3,f<0& :6 6( IQU ]FM7QO2 6( ; 3,f6( :6 6( SIO ]ED7QO2 6( ; 3,f6( 'HULYDWLYHV RI 6( $VUOIKO$f 6( F\V& VUO7Q WKU /DERUDWRU\ FROOHFWLRQ :6 OHX WKL SUR$ JDO. DUD [\O PWO ODF
PAGE 35

7DEOH FRQWLQXHGf 6WUDLQ RU SKDJH 5HOHYDQW JHQRW\SH 6RXUFH5HIHUHQFH 'HULYDWLYHV RI :6 K\Fr IKO$rf :6 %: $:6 7KLV VWXG\ :6 :6 $ PRG(.Pf :6 ; 3,f6( :6 :6 PRG%7Q :6 ; 3,f9-6 :6 :6 PRH$7Q :6 ; 3,f9-6 :6 :6 PRE7Q :6 ; 3,f9-6 :6 :6 PRJ7Q :6 ; 3Lf9-6 :6 :6 PRH$ PRH% ]-EL..P :6 ; 3,f6( :6 :6 $PRG).P :6 ; 3Lf6( :6 :6 $PRG().P :6 ; 3,f6( :6 :6 PRH$ ]EM7QO2 :6 ; 3,f6( :6 : PRE7Q :6 ; 3,f9-6 :6 :6 PRD7Q :6 ; 3,f9-6 :6 :6 PRG%7Q :6 ; 3,f9-6 :6 :6 PRH%.P :6 ; 3'$+ :6 :6 PRH$ SFQ% 7KLV VWXG\ :6 : $PRGV SFQ% 7KLV VWXG\ :6 :6 PRD7Q :6 ; 3,f9-6 :6 :6 PRJ7QO2 :6 ; 3,f9-6 K\I$ ODF=f GHULYDWLYHV :6 5. $:6 7KLV VWXG\ :6 :6 IKO$7QO2 :6 ; 3,f6( :6 :6 USR17Q :6 ; 3,f<0& :6 :6 IQU ]FM7QO2 :6 ; 3,f6( :6 :6 PRH$ :6 ; 3':6 :6 :6 $K\I&P :6 ; 3,f:6 :6 :6 SIO ]ED7Q : ; 3,f6( :6 :6 $F\D.P :6 ; 3,f6( :6 :6 PRG%7Q :6 ; 3,f9-6 :6 :6 $PRG(.Pf :6 ; 3,f6( :6 :6 $F\D.P FUSr :6 ; 3,f6( 3KDJHV 3, 7Q &P FOU /DERUDWRU\ FROOHFWLRQ $5= ? nEOD n/DF= /DERUDWRU\ FROOHFWLRQ $:6 $ EOD 3E\FODF= 7KLV VWXG\ $: $ EOD 2^K\I$ODF=f 7KLV VWXG\

PAGE 36

7DEOH 3ODVPLGV XVHG LQ WKLV VWXG\ 3ODVPLG 5HOHYDQW JHQRW\SH 6RXUFH5HIHUHQFH S$*O S7UFD PRG( f S$0 S8& PRG$ RSHUDWRUSURPRWHU $S5 f S)*+O22 S8& K\S$ K\F$ K\F%n $S5 /DE FROOHFWLRQ S+<&3O S$&<& K\S$n %K\F 3VWL%VW(O,f .P5 7KLV VWXG\ S+<&O S$&<& K\S$n %K\FODF= .P5 7KLV VWXG\ S+<& S%5 K\S$n %K\FODF= $S5 7KLV VWXG\ S50 S7 PRG()fr f S:6 S$&<& IKO$? &P 7KLV VWXG\ S:6 S7 IKO$? $S5 7KLV VWXG\ S:6 S7 IKO$O $S5 7KLV VWXG\ S:6 3$&<& IKO$ &P5 7KLV VWXG\ S:6 S$&<& IKO$ &P5 7KLV VWXG\ S:6 3$&<& IKO$ &P5 7KLV VWXG\ S:6 3$&<& IKO$ &P 7KLV VWXG\ S:6 S$&<& IKO$O &P5 7KLV VWXG\ S:6 3$&<& IKO$O &P5 7KLV VWXG\ S:6 S$&<& IKO$O &P5 7KLV VWXG\ S:6 S$*O &P5 PRGL7 7KLV VWXG\ S:6 S$*O &P5 PRG( $9f 7KLV VWXG\ S:6 S$*O &P5 PRG( *'f 7KLV VWXG\ S:6 S$*O &P PRG( rf 7KLV VWXG\ S:6 S$*O &P5 PRG( rf 7KLV VWXG\ S:6 S$*O &P5 PRG( 7,f 7KLV VWXG\ S:6 S8& 3K\F $S5 7KLV VWXG\ S:6 S%5 KHS K\I$%&'()*+,5n $S5 7KLV VWXG\ S:6 S%5 EHS K\I$n $S5 7KLV VWXG\ S:6 S%5 EHS K\I$ODF= $S 7KLV VWXG\ S:76 S:6 $K\I&P $S5 7KLV VWXG\ S:7 S(7E PRG(r $S5 7KLV VWXG\ S:76 S(7E PRG(7,f $S5 7KLV VWXG\ S:76 S(7E PRG(rf $S5 7KLV VWXG\ S:76 S(7E PRG( $9f $S5 7KLV VWXG\ S=&DP S= &P% ODFa /DERUDWRU\ FROOHFWLRQ S= ODF= $S5 f

PAGE 37

&RQVWUXFWLRQ RI 3E\FODF= )RU FRQVWUXFWLRQ RI D ODF= IXVLRQ ZLWK WKH K\F SURPRWHU '1$ D NE 3VWO%VW(,, IUDJPHQW IURP SODVPLG S)*+O22 FRQWDLQLQJ WKH LQWHUJHQLF UHJLRQ EHWZHHQ WKH K\F DQG K\S RSHURQV )LJ f ZDV FORQHG LQWR D NE 3VWO%VW(,, IUDJPHQW RI SODVPLG S$&<& \LHOGLQJ SODVPLG S+<&3O $ NE 6PDO IUDJPHQW FRQWDLQLQJ D SURPRWHUOHVV ODF= JHQH IURP SODVPLG S= f ZDV FORQHG LQWR WKH %VW(,, VLWH RI S+<&3O DIWHU GLJHVWLRQ ZLWK %VW(,, DQG ILOOLQJ LQ WKH n UHFHVVHG HQGV ZLWK WKH .OHQRZ IUDJPHQW RI '1$ SRO\PHUDVH )LJ f ,Q SODVPLG S+<&O WKH SURPRWHUOHVV ODF= JHQH LV FORQHG EDVH SDLUV XSVWUHDP RI WKH n$n LQ WKH WUDQVODWLRQ VWDUW FRGRQ n$7*n IRU K\F$ DW SRVLWLRQ ZLWK UHVSHFW WR WKH WUDQVFULSWLRQ VWDUW 7KH K\F SURPRWHU '1$ ZLWK ODF IXVLRQ ZDV UHPRYHG IURP S+<&O DV D NE 3VSO,6PD, IUDJPHQW DQG FORQHG LQWR D NE &ODO(FR.9 IUDJPHQW RI SODVPLG S%5 \LHOGLQJ SODVPLG S+<& 7KH K\F SURPRWHU ODF= IXVLRQ 3K\F,DF=f ZDV WUDQVIHUUHG IURP SODVPLG S+<& E\ UHFRPELQDWLRQ LQ YLYR WR ƒ5= LQ WKH FRQVWUXFWLRQ RI ƒ:6 XVLQJ SURFHGXUHV GHVFULEHG SUHYLRXVO\ f &RQVWUXFWLRQ RI -! K\I$ODF=f ,Q RUGHU WR FRQVWUXFW D ODF= RSHURQ IXVLRQ IRU WUDQVFULSWLRQDO DQDO\VLV RI K\I RSHURQ D NE %FR5,

PAGE 38

K\S$ mM A K\F $ r $\H )KO$ M )KO$ U r 3 0 ‘ ,+) f§ %V K\F SURPRWHU K\S SURPRWHU S+<&O )LJXUH /RFDWLRQ RI ODF= LQ 3K\FLDF= 7RS OLQH UHSUHVHQWV FKURPRVRPDO '1$ IURP WKH K\FK\S LQWHUJHQLF UHJLRQ %RWWRP OLQH UHSUHVHQWV WKH FKURPRVRPDO '1$ SUHVHQW LQ SODVPLG S+<&O DQG ORFDWLRQ RI LQVHUWLRQ RI ODF= LQ WKH K\F RSHUDWRU '1$ %ODFN ER[HV LQGLFDWH WKH ELQGLQJ VLWHV IRU ERWK )KO$ DQG ,+) %HQW DUURZV UHSUHVHQW WUDQVFULSWLRQ VWDUW VLWHV IRU K\F DQG K\S RSHURQV 5HVWULFWLRQ HQGRQXFOHDVH VLWHV VKRZQ DUH DV IROORZV 3 3VW, 0 0OX, %V %VW(,,

PAGE 39

+LQG,,, IUDJPHQW IURP D .RKDUD ODPEGD FORQH f ZKLFK FDUULHV WKH XSVWUHDP '1$ IURP WKH K\I RSHURQ DQG QHLJKERULQJ JHQHV ZDV FORQHG LQWR SODVPLG S%5 ZKLFK KDG EHHQ FOHDYHG ZLWK WKH UHVWULFWLRQ HQGRQXFOHDVHV (FR5, DQG +LQG,,, 7KH UHVXOWLQJ SODVPLG S:6 ZDV PRGLILHG E\ LQVHUWLQJ D NE +LQG,,, IUDJPHQW IURP SODVPLG S= f ZKLFK FDUULHV D SURPRWHUOHVV ODF= JHQH LQWR WKH +LQG,,, VLWH 7KH FRQVHTXHQW SODVPLG S:6 FDUULHV D K\I$ODF= IXVLRQ ZKLFK LV DGMDFHQW DQG RSSRVLWH LQ RULHQWDWLRQ WR WKH EOD JHQH 7KLV K\I$ODF= IXVLRQ ZDV UHFRPELQHG LQ YLYR LQWR $5= DV SUHYLRXVO\ GHVFULEHG f &RQVWUXFWLRQ RI DK\I ,Q RUGHU WR FRQVWUXFW D FKURPRVRPDO GHOHWLRQ RI WKH K\I RSHURQ D NE 1GH, IUDJPHQW IURP .RKDUD ODPEGD FORQH f ZDV FORQHG LQWR WKH SODVPLG YHFWRU S%5 ZKLFK KDG EHHQ FOHDYHG ZLWK WKH UHVWULFWLRQ HQGRQXFOHDVH :GHO 7KH UHVXOWDQW SODVPLG S:6 ZKLFK FDUULHV K\I$%&'()*+,5n ZDV K\GURO\]HG ZLWK UHVWULFWLRQ HQ]\PH 1VL, 'LJHVWLRQ ZLWK WKLV HQ]\PH UHOHDVHG D NE IUDJPHQW IURP ZLWKLQ WKH K\I RSHURQ EHWZHHQ K\I% DQG K\I* $ NE 3VW IUDJPHQW IURP S=&DP FDUU\LQJ WKH &P5 JHQH ZDV WKHQ OLJDWHG WR WKH NE 1VL, IUDJPHQW IURP SODVPLG S:6 7KH UHVXOWDQW SODVPLG IURP WKLV OLJDWLRQ S:76 FDUULHV WKH JHQH IRU &P UHVLVWDQFH LQ DQ RULHQWDWLRQ RSSRVLWH WR WKDW RI WKH

PAGE 40

K\I RSHURQ WUDQVFULSWLRQ DQG WKXV WKH LQVHUWLRQ VKRXOG KDYH SRODU HIIHFW RQ WKH H[SUHVVLRQ RI GRZQVWUHDP JHQHV ,QVHUWLRQ RI WKH JHQH IRU &P5 LQWHUUXSWV WKH K\I% JHQH DQG WKH GHOHWLRQ RI K\I H[WHQGV LQWR WKH FRGLQJ VHTXHQFH RI K\I* JHQH ,Q RUGHU WR UHSODFH WKH ZLOG W\SH K\I '1$ LQ WKH FKURPRVRPH ZLWK WKH $K\I&P '1$ DQ NE 1GH, IUDJPHQW IURP S:76 FRQWDLQLQJ &P5 JHQH DQG QHLJKERULQJ K\I JHQHV ZDV UHPRYHG DQG VHOIOLJDWHG 7KLV FLUFXODU '1$ ODFNV WKH JHQH FRGLQJ IRU DPSLFLOOLQ UHVLVWDQFH DQG WKH RULJLQ RI UHSOLFDWLRQ $SSUR[LPDWHO\ SJ RI WKH VHOIOLJDWHG NE 1GH, IUDJPHQW ZDV WUDQVIRUPHG LQWR VWUDLQ 5. DQG SODWHG RQ /DJDU SODWHV FRQWDLQLQJ SJP/ FKORUDPSKHQLFRO 7UDQVIRUPDQWV ZHUH VHOHFWHG DQG UHVWUHDNHG WR REWDLQ VLQJOH FRORQLHV DQG WKHQ DQDO\]HG IRU WKH SUHVHQFH RI DQ\ H[WUD FKURPRVRPDO '1$ E\ VWDQGDUG DONDOLQH O\VLV SURFHGXUHV 2QH FORQH ZKLFK ZDV D VWDEOH &P5 WUDQVIRUPDQW DQG FRQWDLQHG QR YLVLEOH H[WUDFKURPRVRPDO '1$ ZDV GHVLJQDWHG :6 DQG XVHG LQ IXUWKHU VWXGLHV 0XWDJHQHVLV RI IKO$ 7KH IKO$ JHQH ZDV UHPRYHG IURP SODVPLG S6( f DV D NE 6SHO&ODO IUDJPHQW DQG OLJDWHG WR D NE ;EDO&ODO '1$ IUDJPHQW RI SODVPLG S$&<& WR \LHOG SODVPLG S:6 +\GUR[\ODPLQH PXWDJHQHVLV RI SODVPLG S:6 ZDV FDUULHG RXW DV SUHYLRXVO\ GHVFULEHG f +\GUR[\ODPLQHWUHDWHG SODVPLG

PAGE 41

SRSXODWLRQ ZDV WUDQVIRUPHG LQWR VWUDLQ :6 ^$^VUOIKO$f $ PRG 3 K\FODF=f ` DQG WKH WUDQVIRUPDQWV ZHUH VHOHFWHG RQ / DJDU SODWHV ZLWK DPSLFLOOLQ FKORUDPSKHQLFRO DQG ;JDO %OXH FRORQLHV ZHUH VHOHFWHG JURZQ LQ /%* PHGLXPLPRO\EGDWH XQGHU DQDHURELF FRQGLWLRQV DQG DVVD\HG IRU SJDODFWRVLGDVH DFWLYLW\ 7KLV VHOHFWLRQ \LHOGHG IKO$ DOOHOHV IKO$ DQG IKO$ 7KH FHQWUDO UHJLRQ RI WKH IKO$ JHQH IODQNHG E\ (DU, DQG 3VW, VLWHV LQ SODVPLG S:6 ZDV DOVR PXWDWHG E\ 3&5PHGLDWHG PXWDJHQHVLV 7KH SULPHUV XVHG WR DPSOLI\ WKH FHQWUDO GRPDLQ RI WKH IKO$ JHQH ZHUH n*$&*&$**7***&7$n DQG n$&$&**7*&&7*$&7n +HDW VWDEOH '1$ SRO\PHUDVH %LRPHWUD 7DPSD )/f ODFNLQJ SURRIUHDGLQJ DFWLYLW\ ZDV XVHG WR DPSOLI\ WKH NE '1$ IUDJPHQW 7KH 3&5 SURGXFW DIWHU DJDURVH JHO HOHFWURSKRUHVLV DQG HOXWLRQ ZDV FOHDYHG E\ (DUO DQG 3VW, UHVWULFWLRQ HQGRQXFOHDVHV 7KLV 3&5GHULYHG IUDJPHQW SRRO ZKLFK DOVR LQFOXGHG PXWDWLRQV LQWURGXFHG GXULQJ DPSOLILFDWLRQ E\ WKH '1$ SRO\PHUDVH ZDV XVHG WR UHSODFH WKH FRUUHVSRQGLQJ QDWLYH IUDJPHQW LQ WKH IKO$ JHQH LQ SODVPLG S:6 7KH UHVXOWDQW OLJDWLRQ PL[WXUH ZDV WUDQVIRUPHG LQWR VWUDLQ :6 DQG EOXH FRORQLHV ZHUH VHOHFWHG RQ /DJDU PHGLXP VXSSOHPHQWHG ZLWK DPSLFLOOLQ FKORUDPSKHQLFRO DQG ; JDO 7KLV SURFHGXUH \LHOGHG IKO$ DOOHOHV IKO$ DQG IKO$

PAGE 42

,QWHUQDO GHOHWLRQ PXWDWLRQV ZLWKLQ WKH IKO$ JHQH ZHUH LVRODWHG E\ %DO 1XFOHDVH WUHDWPHQW RI SODVPLG S:6 OLQHDUL]HG E\ WKH UHVWULFWLRQ HQGRQXFOHDVH +SDO 1XFOHDVH %DO UHDFWLRQV ZHUH VWRSSHG DW DQG PLQXWHV E\ HWKDQRO DQG WKH '1$ ZDV SUHFLSLWDWHG $IWHU OLJDWLRQ XVLQJ 7 '1$ OLJDVH WKH PL[WXUH ZDV WUDQVIRUPHG LQWR VWUDLQ 6( >IKO$7QO2f DQG FRORQLHV H[SUHVVLQJ )'++ DFWLYLW\ ZHUH VHOHFWHG E\ G\HRYHUOD\ SURFHGXUH DV GHVFULEHG SUHYLRXVO\ f 7KLV SURFHGXUH \LHOGHG IKO$ DOOHOHV IKO$O IKO$O DQG IKO$ 7KH ORFDWLRQ RI WKH PXWDWLRQ LQ HDFK PXWDQW IKO$ DOOHOH ZDV GHWHUPLQHG E\ VHTXHQFLQJ ERWK VWUDQGV RI WKH HQWLUH IKO$ JHQH E\ WKH 6DQJHU GLGHR[\ VHTXHQFLQJ PHWKRG f '1$ VHTXHQFH ZDV DQDO\]HG XVLQJ WKH VRIWZDUH *HQHSUR 5LYHUVLGH 6FLHQWLILF 6HDWWOH :$f (Q]\PH $VVD\V &HOOV ZHUH JURZQ DQG KDUYHVWHG IRU HQ]\PH DVVD\V DV GHVFULEHG SUHYLRXVO\ f SJDODFWRVLGDVH DFWLYLW\ LQ ZKROH FHOOV ZDV GHWHUPLQHG ZLWK FKORURIRUPVRGLXP GRGHF\O VXOIDWHSHUPHDELOL]HG FHOOV DV GHVFULEHG E\ 0LOOHU f 6SHFLILF DFWLYLWLHV H[SUHVVHG DV QDQRPROHVfPLQ fPLOOLJUDP FHOO SURWHLQ DUH WKH DYHUDJH RI DW OHDVW LQGHSHQGHQW H[SHULPHQWV DQG YDULHG E\ OHVV WKDQ b )+/ DFWLYLWLHV

PAGE 43

ZHUH GHWHUPLQHG XVLQJ ZKROH FHOOV DV SUHYLRXVO\ GHVFULEHG f 3XULILFDWLRQ RI )KO$ 3URWHLQ 7KH VWUDLQ XVHG IRU KLJKOHYHO H[SUHVVLRQ RI WKH IKO$ JHQH ZDV VWUDLQ %/'(f ZKLFK FRQWDLQV DQ XQGHILQHG PXWDWLRQ LQ WKH PRG RSHURQ XQSXEOLVKHG GDWDf 7KLV DOORZHG SURGXFWLRQ RI )KO$ SURWHLQ ZLWKRXW SRVVLEOH LQWUDFHOOXODU PRO\EGHQXP FRQWDPLQDWLRQ E\ FXOWXULQJ WKH FHOOV LQ PHGLXP ZLWKRXW PRO\EGDWH VXSSOHPHQWDWLRQ $OO EXIIHUV PHGLD DQG VROXWLRQV XVHG GXULQJ WKH FXOWXUH RI WKH RUJDQLVP H[SUHVVLRQ DQG SXULILFDWLRQ RI )KO$ SURWHLQ ZHUH SUHSDUHG XVLQJ QDQRSXUH GHLRQL]HG ZDWHU LQ RUGHU WR PLQLPL]H PRO\EGDWH FRQWDPLQDWLRQ RI WKH )KO$ SURWHLQ GXULQJ SXULILFDWLRQ 3ODVPLG S:6 ZKLFK FDUULHV IKO$ XQGHU WKH FRQWURO RI SKDJH 7 JHQH SURPRWHU f ZDV FRQVWUXFWHG E\ FORQLQJ D NE ;EDO&ODO IUDJPHQW IURP S6( f LQWR WKH SODVPLG H[SUHVVLRQ YHFWRU S7 FOHDYHG ZLWK ;ED, DQG &ODO UHVWULFWLRQ HQ]\PHV 6WUDLQ %/'(f ZDV WUDQVIRUPHG ZLWK SODVPLG S:6 DQG SODWHG RQ /DJDU ZLWK DPSLFLOOLQ )UHVK WUDQVIRUPDQWV ZHUH WUDQVIHUUHG IURP SODWHV LQWR OLWHUV RI /% ZLWK DPSLFLOOLQ LQ OLWHU )HUQEDFK IODVNV OLWHUIODVNf 7KH FXOWXUHV ZHUH JURZQ ZLWK VKDNLQJ USPf DW r& XQWLO DQ RSWLFDO GHQVLW\ RI QP

PAGE 44

6SHFWURQLF f ZDV UHDFKHG $IWHU DGGLQJ ,37* WR D ILQDO FRQFHQWUDWLRQ RI LWL0 WKH FXOWXUHV ZHUH LQFXEDWHG DW r& ZLWK VKDNLQJ USPf IRU DQ DGGLWLRQDO KRXUV 7KH FHOOV ZHUH KDUYHVWHG DQG ZDVKHG RQFH ZLWK 7ULVEXIIHU P0 7ULV S+ P0 ('7$ P0 EHQ]DPLGLQH P0 GLWKLRWKUHLWROf 7KH FHOOV ZHUH UHVXVSHQGHG LQ P/ RI 7ULVEXIIHU DQG EURNHQ E\ SDVVDJH WKURXJK D )UHQFK SUHVVXUH FHOO DW OELQn DQG WKHQ FHQWULIXJHG DW [ J IRU KRXUV 7KH VXSHUQDWDQW IUDFWLRQ ZDV ORDGHG RQ 4VHSKDURVH FP ; FP 3KDUPDFLD %LRWHFK 3LVFDWDZD\ 1-f DQG WKH FROXPQ ZDV ZDVKHG ZLWK 7ULVEXIIHU 3URWHLQV ZHUH HOXWHG ZLWK D OLQHDU JUDGLHQW RI 1D&O 0f LQ 7ULVEXIIHU )KO$ SURWHLQ HOXWHG DW DSSUR[LPDWHO\ 0 1D&O )KO$ FRQWDLQLQJ IUDFWLRQV DV GHWHUPLQHG E\ 6'63$*( DQDO\VLV ZHUH SRROHG DQG GLDO\]HG RYHUQLJKW LQ 7ULVEXIIHU 7KLV IUDFWLRQ ZDV ORDGHG RQ D P/ +L7UDS +HSDULQ FROXPQ 3KDUPDFLD %LRWHFKf DQG WKH SURWHLQV ZHUH HOXWHG XVLQJ D OLQHDU 1D&O JUDGLHQW 0f 7KH )KO$ SURWHLQ HOXWHG DW DSSUR[LPDWHO\ 0 1D&O )KO$FRQWDLQLQJ IUDFWLRQV ZHUH SRROHG DQG GLDO\]HG RYHUQLJKW LQ +(3(6 EXIIHU P0 S+ P0 ('7$ P0 %HQ]DPLGLQH P0 '77f 7KLV GLDO\]HG VDPSOH ZDV ORDGHG RQ D P/ +L6 FROXPQ FDWLRQ H[FKDQJH %LR5DG /DERUDWRULHV +HUFXOHV &$f SUHHTXLOLEUDWHG ZLWK WKH VDPH +(3(6 EXIIHU DQG HOXWHG ZLWK D OLQHDU JUDGLHQW RI 0 1D&O )KO$ SURWHLQ ZDV HOXWHG DW DSSUR[LPDWHO\ 0 1D&O DQG WKH

PAGE 45

IUDFWLRQV FRQWDLQLQJ )KO$ SURWHLQ ZHUH GLDO\]HG RYHUQLJKW LQ +(3(6 EXIIHU 7KLV VDPSOH ZDV WKHQ FKURPDWRJUDSKHG RQ P/ +L4 DQLRQ H[FKDQJH %LR5DGf FROXPQ HTXLOLEUDWHG ZLWK +(3(6 EXIIHU DQG WKH )KO$ SURWHLQ ZDV HOXWHG XVLQJ D OLQHDU JUDGLHQW RI VRGLXP FLWUDWH IURP 0 7KH SXUH )KO$ SURWHLQ DV MXGJHG E\ 6'63$*( DQDO\VLV ZDV GLDO\]HG LQ +(3(6 EXIIHU P0 S+ P0 '77 b JO\FHUROf IRU VWRUDJH 6DPSOHV ZHUH DOLTXRWHG TXLFN IUR]HQ LQ OLTXLG QLWURJHQ DQG VWRUHG DW r & 3XULILFDWLRQ RI )KO$ 3URWHLQ )KO$ SURWHLQ ZDV SXULILHG HVVHQWLDOO\ DV GHVFULEHG E\ 6FKOHQVRJ HW DO f ZLWK PLQRU FKDQJHV 3ODVPLG S:6 ZKLFK FDUULHV IKO$ XQGHU WKH FRQWURO RI SKDJH 7 JHQH SURPRWHU f ZDV GHULYHG E\ OLJDWLQJ D NE %VW%,&ODO IUDJPHQW IURP SODVPLG S:6 FRQWDLQLQJ IKO$ LQWR WKH VLQJOH &ODO VLWH LQ WKH PXOWLSOH FORQLQJ VLWH RI SODVPLG S7 f 6WUDLQ %/'(f ZDV WUDQVIRUPHG ZLWK SODVPLG S:6 DQG SODWHG RQ /DJDU ZLWK DPSLFLOOLQ )UHVK WUDQVIRUPDQWV ZHUH WUDQVIHUUHG LQWR OLWHU RI /% ZLWK DPSLFLOOLQ LQ D OLWHU )HUQEDFK IODVN 7KH FXOWXUH ZDV JURZQ ZLWK VKDNLQJ USPf DW r& XQWLO DQ RSWLFDO GHQVLW\ RI QP 6SHFWURQLF f ZDV UHDFKHG 7KH LQGXFHU ,37* ZDV DGGHG WR D ILQDO FRQFHQWUDWLRQ RI P0 DQG WKH FXOWXUH ZDV LQFXEDWHG DW r& ZLWK VKDNLQJ USPf

PAGE 46

IRU PRUH KRXUV 7KH FHOOV ZHUH KDUYHVWHG DQG ZDVKHG RQFH ZLWK 7ULVEXIIHU S+ P0 7ULV S+ P0 ('7$ P0 EHQ]DPLGLQH P0 GLWKLRWKUHLWROf 7KH FHOOV ZHUH UHVXVSHQGHG LQ P/ RI 7ULVEXIIHU DQG EURNHQ E\ SDVVDJH WKURXJK D )UHQFK SUHVVXUH FHOO RSHUDWLQJ DW OErLQ DQG WKHQ FHQWULIXJHG DW [ J IRU PLQXWHV 7KH VXSHUQDWDQW P/f ZDV VXEVHTXHQWO\ FHQWULIXJHG IRU KRXUV DW [ J 7KLV UHVXOWLQJ VXSHUQDWDQW ZDV EURXJKW WR DQ DPPRQLXP VXOIDWH FRQFHQWUDWLRQ RI b 7KLV VDPSOH ZDV WKHQ FHQWULIXJHG IRU PLQXWHV DW [ J 7KH UHVXOWLQJ SHOOHW ZDV GLVVROYHG LQ P/ RI 7ULVEXIIHU S+ P0 7ULV S+ P0 ('7$ P0 EHQ]DPLGLQH P0 GLWKLRWKUHLWROf 7KLV VDPSOH ZDV GLDO\]HG RYHUQLJKW LQ WKH VDPH 7ULVEXIIHU 8QOLNH WKH ZLOG W\SH )KO$ SURWHLQ ZKLFK SUHFLSLWDWHV RXW RI VROXWLRQ DW WKLV VWHS f )KO$ UHPDLQHG LQ VROXWLRQ 7KLV GLDO\]HG VDPSOH ZDV ORDGHG RQ +HSDULQ DJDURVH P/ FROXPQ 3KDUPDFLDf ZDVKHG ZLWK 7ULV EXIIHU S+ DQG HOXWHG ZLWK D OLQHDU JUDGLHQW RI .& 0f )KO$FRQWDLQLQJ IUDFWLRQV DV GHWHUPLQHG E\ 6'63$*( DQDO\VLV ZHUH SRROHG DQG GLDO\]HG RYHUQLJKW LQ 7ULVEXIIHU S+ f 7KLV IUDFWLRQ ZDV ORDGHG RQ 4VHSKDURVH P/ 3KDUPDFLD %LRWHFKf DQG WKH SURWHLQV ZHUH HOXWHG XVLQJ D OLQHDU .& JUDGLHQW 0f LQ 7ULVEXIIHU S+ 7KH )KO$ SURWHLQ HOXWHG DW DSSUR[LPDWHO\ 0 1D&O )KO$ FRQWDLQLQJ IUDFWLRQV ZHUH SRROHG DQG GLDO\]HG RYHUQLJKW LQ

PAGE 47

7ULVJO\FHURO EXIIHU P0 S+ P0 ('7$ b JO\FHUROf 7KLV VDPSOH ZDV MXGJHG WR EH !b SXUH EDVHG RQ 6'63$*( DQDO\VLV DQG ZDV VWRUHG DW r & 3XULILFDWLRQ RI 1DWLYH 0RG( 0RG( SURWHLQ IURP SODVPLG S50 ZDV SXULILHG DV GHVFULEHG SUHYLRXVO\ f 3XULILFDWLRQ RI 1DWLYH DQG 0XWDQW 0RG( SURWHLQV 3RO\PHUDVH FKDLQ UHDFWLRQ ZDV XWLOL]HG WR DPSOLI\ WKH ZLOG W\SH PRG( DV ZHOO DV PXWDQW PRG( DOOHOHV IURP SODVPLG S$*O DQG LWV PXWDQW GHULYDWLYHV XVLQJ WZR SULPHUV n**$&$77&$7$7*&$**&&*$$$7&n DQG n *&**$7&&77$*&$&$*&*7**&*$n 5HVWULFWLRQ VLWHV 1GHO DQG %DP+, ZHUH HQJLQHHUHG LQWR WKH SULPHUV LQ RUGHU WR FORQH WKH 3&5 SURGXFW LQWR WKH H[SUHVVLRQ YHFWRU S(7E 1RYDJHQ 0DGLVRQ :,f 7KH SURWHLQVf H[SUHVVHG IURP WKLV YHFWRU ZRXOG LQFOXGH DQ DGGLWLRQDO 1WHUPLQDO VHTXHQFH RI VL[ KLVWLGLQHV ZKLFK DUH VHSDUDWHG IURP WKH 0RG( SURWHLQ E\ D OLQNHU FRQWDLQLQJ WKURPELQ SURWHDVH FOHDYDJH VLWH 7KH 3&5 SURGXFWV ZHUH WUHDWHG ZLWK SKHQROFKORURIRUP DQG SUHFLSLWDWHG ZLWK HWKDQRO $ VDPSOH RI HDFK UHDFWLRQ ZDV GLJHVWHG ZLWK 1GH, DQG %DP+, DQG WKH NE IUDJPHQW ZDV SXULILHG E\ DJDURVH bf JHO HOHFWURSKRUHVLV 7KH PRG( '1$ DQG PXWDQW 0RG('1$ ZHUH OLJDWHG WR D NE IUDJPHQW RI SODVPLG S(7E DOVR GLJHVWHG ZLWK WKH VDPH UHVWULFWLRQ

PAGE 48

HQGRQXFOHDVHV DQG SXULILHG DIWHU DJDURVH JHO HOHFWURSKRUHVLV 7KH UHVXOWDQW SODVPLGV ZKLFK FRQWDLQ WKH PRG( S:76f DQG YDULRXV PRG( PXWDQW DOOHOHV S:76 S:76 DQG S:76f XQGHU WKH WUDQVFULSWLRQ FRQWURO RI SKDJH 7 JHQH SURPRWHU ZHUH XVHG IRU KLJKOHYHO H[SUHVVLRQ RI QDWLYH 0RG( DQG LWV PXWDQW SURWHLQV 7KH PXWDWLRQ LQ HDFK SODVPLG FRQWDLQLQJ WKH PXWDQW PRG( DOOHOH ZDV FRQILUPHG E\ VHTXHQFLQJ WKH HQWLUH PRG( JHQH LQ WKH S(7EGHULYHG SODVPLGV (DFK RI WKH 0RG( SURWHLQV ZDV SXULILHG DV IROORZV 6WUDLQ %/'(f FDUU\LQJ S(7EPRG( GHULYDWLYH ZDV JURZQ LQ P/ RI / EURWK ZLWK VKDNLQJ USPf DW r& :KHQ WKH RSWLFDO GHQVLW\ RI WKH FXOWXUH UHDFKHG QP 6SHFWURQLF VSHFWURSKRWRPHWHUf ,37* ZDV DGGHG WR D ILQDO FRQFHQWUDWLRQ RI P0 7HPSHUDWXUH RI LQFXEDWLRQ ZDV UHGXFHG WR r& DQG WKH FXOWXUH ZDV LQFXEDWHG IRU DQ DGGLWLRQDO KRXUV 7KH FHOOV ZHUH KDUYHVWHG ZDVKHG RQFH ZLWK 7ULVEXIIHU P0 7ULV S+ f DQG UHVXVSHQGHG LQ P/ RI 7ULVEXIIHU &HOOV ZHUH EURNHQ E\ SDVVDJH WKURXJK D )UHQFK SUHVVXUH FHOO RSHUDWLQJ DW OErLQ DQG WKH H[WUDFW ZDV FODULILHG E\ FHQWULIXJDWLRQ DW [ J IRU PLQ DW r& 7KH VXSHUQDWDQW ZDV ILOWHUHG WKURXJK D SP ILOWHU *HOPDQ 6FLHQFHVf DQG WKHQ ORDGHG RQ D +L7UDS FKHODWLQJ FROXPQ 3KDUPDFLD %LRWHFKf 7KH FROXPQ ZDV SUH

PAGE 49

HTXLOLEUDWHG ZLWK 1L&O P0 LQ 7ULVEXIIHUf DQG IUHH 1L ZDV UHPRYHG E\ ZDVKLQJ WKH FROXPQ ZLWK YROXPHV RI 7ULV EXIIHU $IWHU ORDGLQJ WKH VDPSOH XQERXQG SURWHLQV ZHUH ZDVKHG RII WKH FROXPQ ZLWK 7ULVEXIIHU 7ULVEXIIHU FRQWDLQLQJ P0 LPLGD]ROH ZDV XVHG WR UHPRYH WKH SURWHLQV ERXQG QRQVSHFLILFDOO\ WR WKH PDWUL[ 7KH 0RG( SURWHLQ ZDV HOXWHG ZLWK 0 LPLGD]ROH LQ 7ULVEXIIHU $IWHU DGGLQJ &D&O WR D ILQDO FRQFHQWUDWLRQ RI P0 WKURPELQ SURWHDVH XQLWV 3KDUPDFLDf ZDV DGGHG WR WKH 0RG( SUHSDUDWLRQ WR UHPRYH WKH 1WHUPLQDO +LVWDJ VHTXHQFH 7KH WKURPELQ0RG( PL[WXUH ZDV LQFXEDWHG IRU KRXUV DW r& $IWHU FOHDYDJH ZDV FRPSOHWH EDVHG RQ 6'63$*( DQDO\VLV WKH VDPSOH ZDV ORDGHG RQ D +L7UDS +HSDULQ FROXPQ P/ 3KDUPDFLDf WR VHSDUDWH 0RG( IURP WKURPELQ $IWHU ZDVKLQJ WKH FROXPQ ZLWK ILYH YROXPHV RI 7ULVEXIIHU WR UHPRYH XQERXQG WKURPELQ 0RG( ZDV HOXWHG ZLWK 0 1D&O DQG ZDV GHWHUPLQHG WR EH SXUH E\ 6'63$*( 0RG( SURWHLQ ZDV GLDO\]HG RYHUQLJKW LQ P0 7ULV S+ f FRQWDLQLQJ P0 GLWKLRWKUHLWRO DQG VWRUHG RQ LFH XQWLO XVH 7KLV SURWHLQ ZDV IRXQG WR EH VWDEOH IRU VHYHUDO PRQWKV 0RG( SURWHLQV SXULILHG E\ WKLV 1LDIILQLW\ PHWKRG FRQWDLQHG DQ H[WUD WKUHH DPLQR DFLGV *O\ 6HU +LVf LQ WKH 1WHUPLQXV DQG DUH GHVLJQDWHG r0RG( WR GHQRWH WKLV DOWHUDWLRQ $OWKRXJK D PDMRU IUDFWLRQ RI WKH PXWDQW 0RG( SURWHLQV H[SUHVVHG IURP SODVPLG YHFWRU S(7EGHULYDWLYHV IRUPHG LQVROXEOH FRPSOH[HV D VLJQLILFDQW SRUWLRQ RI WKH

PAGE 50

SURWHLQ UHPDLQHG LQ WKH VROXEOH SUHVXPDEO\ QDWLYH IRUP 7KH PXWDQW 0RG( SURWHLQV SUHVHQW LQ WKH VROXEOH IUDFWLRQ ZHUH SXULILHG XVLQJ WKH DERYH GHVFULEHG SURFHGXUH 'HWHUPLQDWLRQ RI 3URWHLQ &RQFHQWUDWLRQ &RQFHQWUDWLRQV RI SURWHLQ SUHSDUDWLRQV ZHUH GHWHUPLQHG XVLQJ &RPDVVLH %OXH DV SUHYLRXVO\ GHVFULEHG f ZLWK ERYLQH VHUXP DOEXPLQ DV D VWDQGDUG '1DVH ,)RRWSULQWLQJ ([SHULPHQWV '1DVH SURWHFWLRQ H[SHULPHQWV ZHUH SHUIRUPHG HVVHQWLDOO\ DV SUHYLRXVO\ GHVFULEHG f )RU H[SHULPHQWV LQYROYLQJ K\F SURPRWHU '1$ DQG 0RG( SURWHLQ D ES '1$ FRQWDLQLQJ WKH K\F RSHUDWRUSURPRWHU '1$ ZDV REWDLQHG DIWHU K\GURO\VLV RI SODVPLG S)*+O22 E\ HQGRQXFOHDVHV 3VW, DQG 6DLO DQG SXULILFDWLRQ XVLQJ D b VXFURVH JUDGLHQW f 7KH 6DLOHQG RI WKH '1$ ZDV ODEHOHG ZLWK 3 E\ ILOOLQJ LQ ZLWK .OHQRZ DQG DOO IRXU D3ODEHOHG G173nV 'X3RQW1(1f 8QLQFRUSRUDWHG G173nV ZHUH VHSDUDWHG IURP WKH ODEHOHG IUDJPHQW XVLQJ D VSLQ FROXPQ 3KDUPDFLD %LRWHFKf 3URWHLQ SUHVHQW LQ WKLV HOXHQW KHDW LQDFWLYDWHG .OHQRZf ZDV SUHFLSLWDWHG XVLQJ 0 SRWDVVLXP DFHWDWH DQG UHPRYHG E\ FHQWULIXJDWLRQ DV SUHYLRXVO\ GHVFULEHG f 7KH ODEHOHG '1$ ZDV SUHFLSLWDWHG XVLQJ WZR YROXPHV RI b HWKDQRO DQG UHFRYHUHG E\ FHQWULIXJDWLRQ

PAGE 51

7KH '1$ ZDV UHVXVSHQGHG LQ 7( %XIIHU DQG VWRUHG DW r & DW DSSUR[LPDWHO\ &30SO 7R IDFLOLWDWH ELQGLQJ RI 0RG( SURWHLQ WR WKH '1$ D PL[WXUH RI EXIIHU P0 7ULV S+ P0 0J&O P0 1D&O DQG P0 '77f 0RG( SURWHLQ DQG ODEHOHG '1$ &30f ZDV SUHSDUHG LQ D YROXPH RI SL DQG LQFXEDWHG DW r& IRU PLQ 0RO\EGDWH ZDV LQFOXGHG LQ WKLV UHDFWLRQ DW D ILQDO FRQFHQWUDWLRQ RI P0 DV QHHGHG 8QSURWHFWHG '1$ ZDV K\GURO\]HG E\ WKH DGGLWLRQ RI S/ RI '1DVH 6LJPD QJSOf WR WKH ILQDO UHDFWLRQ PL[WXUH SLf $IWHU PLQ RI LQFXEDWLRQ DW URRP WHPSHUDWXUH '1DVH DFWLYLW\ ZDV VWRSSHG E\ DGGLWLRQ RI SL RI P0 ('7$ WR WKH UHDFWLRQ DQG WKH SURWHLQV ZHUH K\GURO\]HG E\ LQFOXVLRQ RI SL RI 3URWHLQDVH 6LJPD SJSO PLQ DW r&f 5HPDLQLQJ WUDFH DPRXQWV RI SURWHLQV ZHUH UHPRYHG E\ 0 DPPRQLXP DFHWDWH SUHFLSLWDWLRQ $IWHU DGGLWLRQ RI SJ RI \HDVW W51$ QXFOHLF DFLGV ZHUH SUHFLSLWDWHG ZLWK YROXPHV RI b HWKDQRO (DFK VDPSOH ZDV UHVXVSHQGHG LQ SL RI IRUPDPLGH ORDGLQJ EXIIHU f DQG ORDGHG RQ D b SRO\DFU\ODPLGH GHQDWXULQJ JHO IRU HOHFWURSKRUHVLV DW ZDWWV IRU PLQXWHV 7KH JHO ZDV GULHG DQG H[SRVHG WR SUHIODVKHG ;UD\ ILOP '1DVH ,SURWHFWLRQ H[SHULPHQWV LQYROYLQJ PRG$ RSHUDWRU '1$ DQG 0RG( SURWHLQ ZHUH FDUULHG RXW DV GHVFULEHG DERYH IRU

PAGE 52

K\F SURPRWHU '1$ )RU WKHVH H[SHULPHQWV D ES )VSO +LQGOOO IUDJPHQW IURP SODVPLG S$0 ZKLFK FDUULHV PRG$ RSHUDWRUSURPRWHU '1$ VSDQQLQJ IURP WR ZDV XVHG 7KH '1$ ZDV ODEHOHG XVLQJ D3ODEHOHG G173nV 'XSRQW1(1f DQG .OHQRZ WR ILOO LQ WKH +LQGOOO HQG $73DVH $FWLYLW\ $73DVH DFWLYLW\ RI )KO$ ZDV GHWHUPLQHG DV GHVFULEHG SUHYLRXVO\ f '1$ (OHFWURSKRUHWLF 0RELOLW\ 6KLIW ([SHULPHQWV '1$PRELOLW\ VKLIW H[SHULPHQWV ZHUH SHUIRUPHG HVVHQWLDOO\ DV SUHYLRXVO\ GHVFULEHG f $OO VROXWLRQV XVHG IRU WKH H[SHULPHQWV ZHUH PDGH ZLWK nQDQRSXUHn GHLRQL]HG ZDWHU ZLWKRXW IXUWKHU WUHDWPHQW WR UHPRYH WUDFH OHYHOV RI FRQWDPLQDWLQJ PRO\EGDWH 0RG( $ ES 3VWO6DOO IUDJPHQW IURP SODVPLG S)*+O22 ZDV XVHG DV WKH WDUJHW '1$ IRU WKH VKLIW H[SHULPHQW 7KLV IUDJPHQW ZKLFK DOVR FRQWDLQV WKH '1$ XSVWUHDP RI WKH )KO$ ELQGLQJ VLWH f ZDV ODEHOHG ZLWK 3G173nV E\ ILOOLQJ LQ WKH UHFHVVHG n HQG RI WKH %VW(,, VLWH ZLWK WKH .OHQRZ HQ]\PH 0RG( SURWHLQ ZDV SUHLQFXEDWHG ZLWK ELQGLQJ EXIIHU P0 7ULV S+ P0 ('7$ P0 GLWKLRWKUHLWROf IRU PLQXWHV DW r & EHIRUH WKH ODEHOHG '1$ ZDV DGGHG %LQGLQJ UHDFWLRQV ZHUH LQFXEDWHG IRU PLQXWHV DW r & *HOV ZHUH SUHUXQ DW 9 IRU PLQXWHV DW URRP WHPSHUDWXUH DQG UXQ

PAGE 53

IRU PLQXWHV DW 9 ZLWK EXIIHU UHFLUFXODWLRQ DIWHU ORDGLQJ WKH VDPSOHV 7KH JHOV ZHUH GULHG DQG H[SRVHG WR ; UD\ ILOP 6RGLXP PRO\EGDWH ZDV DGGHG DW D ILQDO FRQFHQWUDWLRQ RI P0 LQ WKH b SRO\DFU\ODPLGH JHO FLUFXODWLQJ 7%( EXIIHU DQG WKH ELQGLQJ UHDFWLRQV DV QHHGHG )KO$ )KO$ WDUJHW VHTXHQFH f LQ K\F SURPRWHU ZDV DPSOLILHG E\ 3&5 XVLQJ WZR SULPHUV n &&**$7&&*77$777&*$*&$7$7&n IRU WKH n HQG DQG n &&&7*&$*777$$*&7$$$*$7*$$n IRU WKH n HQG 7KLV DPSOLILHG '1$ DIWHU GLJHVWLRQ ZLWK UHVWULFWLRQ HQGRQXFOHDVHV 3VW, DQG %DP+, ZDV FORQHG LQWR S8& GLJHVWHG ZLWK 3VW, DQG %DP+, \LHOGLQJ S:6 7KLV SODVPLG ZDV WKH VRXUFH IRU D ES 3VWO%DP+, IUDJPHQW XVHG LQ WKH PRELOLW\ VKLIW H[SHULPHQWV 7KLV '1$ IUDJPHQW DIWHU LVRODWLRQ RQ OLQHDU VXFURVH JUDGLHQW DV SUHYLRXVO\ GHVFULEHG f ZDV ODEHOHG ZLWK 3 G173nV E\ ILOOLQJ LQ WKH UHFHVVHG n HQG RI WKH %DP+, VLWH ZLWK WKH .OHQRZ HQ]\PH )KO$ RU )KO$ SURWHLQ ZDV SUHn LQFXEDWHG ZLWK ELQGLQJ EXIIHU P0 7ULV S+ P0 ('7$ P0 GLWKLRWKUHLWRO P0 $73f IRU PLQXWHV DW r & EHIRUH WKH ODEHOHG '1$ ZDV DGGHG %LQGLQJ UHDFWLRQV ZHUH LQFXEDWHG IRU PLQXWHV DW r & *HOV ZHUH SUHUXQ DW 9 IRU PLQXWHV DW URRP WHPSHUDWXUH DQG UXQ IRU PLQXWHV

PAGE 54

DW 9 ZLWK EXIIHU UHFLUFXODWLRQ DIWHU ORDGLQJ WKH VDPSOHV 7KH JHOV ZHUH GULHG DQG H[SRVHG WR ;UD\ ILOP 3KRVSKRULPDJLQJ $QDO\VLV 'ULHG JHOV IURP '1$ PRELOLW\ VKLIW H[SHULPHQWV ZHUH H[SRVHG WR D SKRVSKRULPDJLQJ VFUHHQ DQG WKH EDQGV ZHUH TXDQWLILHG XVLQJ D SKRVSKRULPDJHU 0ROHFXODU '\QDPLFVf DW WKH 8QLYHUVLW\ RI )ORULGD ,QWHUGLVFLSOLQDU\ &HQWHU IRU %LRWHFKQRORJ\ 5HVHDUFK 2SWLFDO %LRVHQVRU ([SHULPHQWV 7KH NLQHWLF FKDUDFWHULVWLFV RI WKH LQWHUDFWLRQ EHWZHHQ 0RG( DQG PRG$ RSHUDWRU '1$ ZDV GHWHUPLQHG XVLQJ 2SWLFDO HYDQHVFHQW ZDYH ELRVHQVRU $IILQLW\ 6HQVRUVf 7KH SULQFLSOHV RI WKLV ELRVHQVRU KDYH EHHQ GHVFULEHG SUHYLRXVO\ f ,Q WKLV SDUWLFXODU H[SHULPHQW D FXYHWWH FRQWDLQLQJ ELRWLQ RQ WKH VHQVRU VXUIDFH ZDV XWLOL]HG %LRWLQ\ODWHG '1$ ZDV ERXQG WR WKH VHQVRU VXUIDFH XVLQJ VWUHSWDYLGLQ &DOELRFKHPf DV DQ LQWHUPHGLDWH 7ZR EDVH FRPSOLPHQWDU\ ROLJRQXFOHRWLGHV FRYHULQJ WKH PRG$ RSHUDWRU UHJLRQ EHWZHHQ DQG ZHUH V\QWKHVL]HG 1%,f ZLWK ELRWLQ LQ WKH n HQG RI RQH RI WKH ROLJRQXFOHRWLGH ZKLFK XSRQ DQQHDOLQJ ZRXOG EH ORFDWHG LQ WKH HQG RI WKH '1$ 7KH ELRWLQ FXYHWWH LQ WKH 2SWLFDO ELRVHQVRU ZDV ULQVHG ZLWK SKRVSKDWHEXIIHUHG VDOLQH FRQWDLQLQJ b 7ZHHQ 6WUHSWDYLGLQ SL PJP/f LQ b 3%67 ZDV DGGHG WR WKH

PAGE 55

FXYHWWH SL UHDFWLRQ YROXPHf DQG LQFXEDWHG IRU PLQ ZLWK PL[LQJ $IWHU UHPRYLQJ WKH XQERXQG VWUHSWDYLGLQ '1$ ZDV DGGHG DQG LQFXEDWHG XQWLO QR IXUWKHU UHVSRQVH ZDV QRWHG ([FHVV '1$ ZDV UHPRYHG IURP WKH FXYHWWH E\ ZDVKHV ZLWK 3%67 0RG( SURWHLQ ZLWK RU ZLWKRXW PRO\EGDWH P0f ZDV DGGHG WR WKH FXYHWWH DQG WKH UDWH RI LQFUHDVH LQ UHVSRQVH ZDV UHFRUGHG $IWHU WKH PD[LPXP UHVSRQVH ZDV DWWDLQHG IUHH 0RG( LQ WKH FXYHWWH ZDV UHPRYHG E\ D ZDVK ZLWK 3%67 DQG WKH UDWH RI GLVVRFLDWLRQ RI 0RG( IURP WKH '1$ ZDV PRQLWRUHG :KHQ WKH GLVVRFLDWLRQ RI 0RG(PRO\EGDWH ZDV IROORZHG 3%67 ZDV VXSSOHPHQWHG ZLWK P0 PRO\EGDWH :KHQ QHHGHG 0RG( ZDV GLVVRFLDWHG IURP WKH '1$ DQG UHPRYHG E\ ZDVKLQJ WKH FXYHWWH ZLWK 0 0J&O 7KH H[SHULPHQW ZDV UHSHDWHG ZLWK VHYHUDO 0RG( FRQFHQWUDWLRQV DV ZHOO DV ZLWK PXWDQW IRUPV RI 0RG( DQG PXWDWHG PRG$ RSHUDWRU '1$ 7KH LQIRUPDWLRQ REWDLQHG ZLWK GLIIHUHQW 0RG( FRQFHQWUDWLRQV Q0f ZDV XVHG WR GHWHUPLQH WKH NLQHWLF FRQVWDQWV DV SHU %RU]D DQG 0RUJDQ f )OXRUHVFHQFH 6SHFWURVFRS\ 0HDVXUHPHQWV )OXRUHVFHQFH HPLVVLRQ VSHFWUD ZHUH FROOHFWHG XVLQJ DQ $PLQFR %RZPDQ 6HULHV 6SHFWURIOXRURPHWHU 6SHFWURQLFf 0RG( SURWHLQV ZHUH GLOXWHG LQ 7ULVEXIIHU S+ f ZLWK P0 GLWKLRWKUHLWRO IRU PHDVXUHPHQW XVLQJ FP SDWKOHQJWK 6DPSOHV ZHUH H[FLWHG DW QP DQG HPLVVLRQ VSHFWUD IURP

PAGE 56

QP WR QP ZHUH FROOHFWHG 7KUHH VHSDUDWH FRQFHQWUDWLRQV RI 0RG( DQG PXWDQW 0RG( SURWHLQV DQG S0f ZHUH DQDO\]HG IRU LQWULQVLF IOXRUHVFHQFH ZLWK DQG ZLWKRXW DGGHG PRO\EGDWH P0f ,Q WKHVH H[SHULPHQWV WKH EDQGSDVV ZLGWK ZDV QP DQG WKH GHWHFWRU YROWDJH ZDV VHW DW 9 0DWHULDOV %LRFKHPLFDOV ZHUH SXUFKDVHG IURP 6LJPD &KHPLFDO &R 6W /RXLV 02f 2WKHU RUJDQLF DQG LQRUJDQLF FKHPLFDOV ZHUH IURP )LVKHU 6FLHQWLILF 3LWWVEXUJK 3$f DQG ZHUH DQDO\WLFDO JUDGH 5HVWULFWLRQ HQGRQXFOHDVHV DQG '1$ PRGLI\LQJ HQ]\PHV ZHUH SXUFKDVHG IURP 3URPHJD 0DGLVRQ :,f DQG 1HZ (QJODQG %LRODEV %HYHUO\ 0$f ZLWK WKH H[FHSWLRQ RI WKH WKHUPRVWDEOH SRO\PHUDVH XVHG LQ PXWDJHQHVLV RI IKO$ JHQH ZKLFK ZDV IURP %LRPHWUD 7DPSD )/f 2SWLFDO ELRVHQVRU FXYHWWHV ZHUH IURP $IILQLW\ 6HQVRUV

PAGE 57

5(68/76 $1' ',6&866,21 ([SUHVVLRQ RI K\F 2SHURQ LQ (VFKHULFKLD FROL 5HTXLUHV 0RO\EGDWH 7UDQVFULSWLRQDO 5HJXODWLRQ RI 3E\FODF= 3UHYLRXV LQYHVWLJDWLRQV LQWR WKH WUDQVFULSWLRQDO UHJXODWLRQ RI K\F RSHURQ XWLOL]HG FKURPRVRPDO RSHURQ IXVLRQV LQ ZKLFK WKH ODF= JHQH ZDV LQVHUWHG LQWR D JHQH ZLWKLQ WKH K\F RSHURQ K\F%ODF= K\F'ODF= f 6LQFH WKH ILUVW JHQH RI WKH K\F RSHURQ QHJDWLYHO\ PRGXODWHV WKH OHYHO RI WUDQVFULSWLRQ RI K\F f D K\F SURPRWHUODF= IXVLRQ ZDV FRQVWUXFWHG LQ ZKLFK WKH XSVWUHDP '1$ IURP K\F RSHURQ LV IXVHG WR D SURPRWHUOHVV ODF= JHQH VL[ EDVH SDLUV EHIRUH WKH SUHGLFWHG WUDQVODWLRQ VWDUW VLWH )LJ f 7KLV 3K\FODF= IXVLRQ DOORZV WKH UHJXODWLRQ RI K\F WUDQVFULSWLRQ WR EH PRQLWRUHG ZLWKRXW SRVVLEOH QHJDWLYH HIIHFW IURP D VHFRQG FRS\ RI WKH K\F$ $ UHFRPELQDQW ODPEGD SKDJH ƒ:6f ZKLFK FDUULHV WKH 3K\FODF= LQ WKH ;DWW VLWH ZDV XVHG LQ WKLV VWXG\ WR DQDO\]H WKH WUDQVFULSWLRQDO UHJXODWLRQ RI K\F RSHURQ LQ ERWK D ZLOG W\SH VWUDLQ DV ZHOO DV LQ D GHOHWLRQ PXWDQW VWUDLQ ODFNLQJ WKH HQWLUH K\F DQG K\S UHJLRQ

PAGE 58

,Q RUGHU WR FRQILUP WKDW UHJXODWLRQ RI 3K\FODF= IXVLRQ LV VLPLODU WR SUHYLRXV K\FODF IXVLRQV f WKH OHYHO RI JDODFWRVLGDVH DFWLYLW\ SURGXFHG E\ VHYHUDO PXWDQW VWUDLQV FDUU\LQJ PXWDWLRQV LQ JHQHV ZKLFK KDG SUHYLRXVO\ EHHQ VKRZQ WR EH LQYROYHG LQ WKH H[SUHVVLRQ RI K\F RSHURQ ZDV GHWHUPLQHG 7DEOH f 6LQFH WKH FKURPRVRPDO IKO$ JHQH HQFRGLQJ WKH UHTXLUHG WUDQVFULSWLRQDO DFWLYDWRU RI WKH K\F RSHURQ LV GHOHWHG LQ VWUDLQ :6 QR JDODFWRVLGDVH DFWLYLW\ ZDV SURGXFHG E\ WKLV VWUDLQ 6WUDLQ :6 ZLWK SODVPLG S:6 IKO$rf SURGXFHG XQLWV RI JDODFWRVLGDVH DFWLYLW\ ZKHQ JURZQ LQ /%* DQG WKLV OHYHO RI DFWLYLW\ LQFUHDVHG WR XQLWV ZKHQ IRUPDWH ZDV DOVR LQFOXGHG $Q LVRJHQLF GHULYDWLYH FDUU\LQJ D PXWDWLRQ LQ WKH SIO JHQH :6 ZLWK S:6f DQG WKXV ODFNLQJ WKH S\UXYDWH IRUPDWHO\DVH DFWLYLW\ SURGXFHG OHVV WKDQ b RI JDODFWRVLGDVH DFWLYLW\ RI WKH SDUHQW GXH WR WKH DEVHQFH RI IRUPDWH $GGLWLRQ RI IRUPDWH UHWXUQHG WKH OHYHO RI K\FODF= H[SUHVVLRQ WR WKDW RI WKH SDUHQW VWUDLQ SIOrf 6WUDLQ :6S:6f ZKLFK DOVR FDUULHV D GHOHWLRQ LQ WKH PRG$%&' PRO\EGDWH WUDQVSRUW RSHURQf SURGXFHG OHVV WKDQ b RI WKH JDODFWRVLGDVH DFWLYLW\ RI WKH SDUHQW VWUDLQ :6 S:6f $OWKRXJK DGGLWLRQ RI IRUPDWH WR WKH PHGLXP LQFUHDVHG WKH DPRXQW RI JDODFWRVLGDVH DFWLYLW\ SURGXFHG E\ WKH FXOWXUH E\ DERXW IROG PRO\EGDWH ZDV UHTXLUHG IRU IXOO UHVWRUDWLRQ

PAGE 59

7DEOH ([SUHVVLRQ RI O"K\FODF= UHTXLUHV ERWK IRUPDWH DQG PRO\EGDWH 6WUDLQ 5HOHYDQW JHQRW\SH %DDODFWRVLGDVH DFWLYLW\ /%* /%*) /%*)0 :6 :6S:6fF S IKO$f :6S:6f SIO S IKO$fr :6S:6f $PRG SIKO$f :6S:6f USR1 $PRG S IKO$fr D $OO VWUDLQV FRQWDLQ 3K\FODF= YLD ƒ:6 DQG $ VUOIKO$f ZKLFK GHOHWHG FKURPRVRPDO K\G$ K\F DQG K\S RSHURQV DV ZHOO DV WKH IKO$ JHQH E SJDODFWRVLGDVH DFWLYLW\ LV H[SUHVVHG DV QDQRPROHV fPLQ fPLOOLJUDP RI FHOO SURWHLQ F 3ODVPLG S:6 FDUULHV IKO$r

PAGE 60

RI K\FODF= H[SUHVVLRQ 0XWDWLRQ LQ WKH USR1 JHQH ZKLFK HQFRGHV WKH VLJPD VXEXQLW RI 51$ 3RO\PHUDVH KRORHQ]\PH DOVR HOLPLQDWHG WKH H[SUHVVLRQ RI SJDODFWRVLGDVH DFWLYLW\ E\ VWUDLQ :6 S:6f 7KHUHIRUH SURGXFWLRQ RI JDODFWRVLGDVH DFWLYLW\ E\ VWUDLQV FDUU\LQJ 3WL\FODF= UHTXLUHG IRUPDWH PRO\EGDWH )KO$ SURWHLQ DQG D 7KLV SDWWHUQ RI UHJXODWLRQ FRUUHVSRQGV WR SUHYLRXV VWXGLHV XWLOL]LQJ FKURPRVRPDO K\FODF= IXVLRQV f ([SUHVVLRQ RI IKO$ *HQH GRHV QRW 5HTXLUH 0RO\EGDWH 6LQFH H[SUHVVLRQ RI ERWK K\FODF= DQG 3K\FODF= IXVLRQV UHTXLUH PRO\EGDWH WKH SRVVLELOLW\ WKDW WKH H[SUHVVLRQ RI WKH IKO$ JHQH FRGLQJ IRU WKH UHTXLUHG WUDQVFULSWLRQDO DFWLYDWRU )KO$ LV LQIOXHQFHG E\ PRO\EGDWH DQG WKXV KDV DQ LQGLUHFW HIIHFW RQ K\F ZDV LQYHVWLJDWHG 6WUDLQ 6( DQ IKO$ODF= GHULYDWLYH RI VWUDLQ 0& SURGXFHG XQLWV RI JDODFWRVLGDVH DFWLYLW\ ZKHQ FXOWXUHG LQ /%* 7DEOH f 6WUDLQ 6( D PRG% LVRJHQLF GHULYDWLYH RI VWUDLQ 6( SURGXFHG XQLWV RI -JDODFWRVLGDVH DFWLYLW\ ZKHQ FXOWXUHG LQ /%* $GGLWLRQ RI PRO\EGDWH WR HLWKHU WKH SDUHQW VWUDLQ 6(f RU WKH PRG% GHULYDWLYH KDG QR VLJQLILFDQW HIIHFW RQ WKH OHYHO RI SJDODFWRVLGDVH DFWLYLW\ SURGXFHG 7DEOH f 7KHVH UHVXOWV VKRZ WKDW WKH IKO$ H[SUHVVLRQ LV PRO\EGDWH LQGHSHQGHQW DQG WKXV VWURQJO\ DUJXHV WKDW WKH ODFN RI

PAGE 61

7DEOH ([SUHVVLRQ RI IKO$ODF=f LV LQGHSHQGHQW RI IRUPDWH DQG PRO\EGDWH 6WUDLQ 5HOHYDQW JHQRW\SH %DDODFWRVLGDVH /%* DFWLYLWYE /%*0 6( ZLOG W\SH 6( PRG% :6 SIO 0USR1 :6 IQU 6(S:6f S IKO$ 1'& D $OO VWUDLQV DUH LVRJHQLF GHULYDWLYHV RI VWUDLQ 6( ZKLFK FDUULHV W! ^IKO$ODF=f E JDODFWRVLGDVH DFWLYLW\ LV H[SUHVVHG DV QDQRPROHV fPLQPLOOLJUDP RI FHOO SURWHLQn F 1RW GHWHUPLQHG

PAGE 62

K\F WUDQVFULSWLRQ LQ D PRG% PXWDQW LV QRW GXH WR DQ DEVHQFH RI H[SUHVVLRQ RI IKO$ ,Q DGGLWLRQ D PXWDWLRQ LQ USR1 KDG YHU\ OLWWOH HIIHFW RQ WKH OHYHO RI H[SUHVVLRQ RI IKO$ JHQH ZKLOH D SIO PXWDWLRQ LQFUHDVHG WKH IKO$ODF= H[SUHVVLRQ 7DEOH f 3ODVPLG S:6 ZKLFK LQFUHDVHG WKH FRS\ RI IKO$ LQ VWUDLQ 6( GLG QRW DOWHU WKH OHYHO RI H[SUHVVLRQ RI IKO$ODF= +RZHYHU DQ IQU PXWDWLRQ :6f LQFUHDVHG WKH OHYHO RI IKO$ODF= H[SUHVVLRQ E\ DERXW WKUHHIROG WR DERXW XQLWV 1R FRQVHQVXV ELQGLQJ VHTXHQFH IRU WKH JOREDO DQDHURELF WUDQVFULSWLRQDO UHJXODWRU )15 77*$7 ES$7&$$f ZDV IRXQG LQ WKH '1$ VHTXHQFH ZLWKLQ DQG LPPHGLDWHO\ XSVWUHDP RI WKH IKO$ JHQH 7KHUHIRUH WKH PHFKDQLVP RI UHSUHVVLRQ RI IKO$ H[SUHVVLRQ E\ )15 DSSHDUV WR EH LQGLUHFW DQG LV \HW WR EH GHWHUPLQHG )RUPDWH DQG 0RO\EGDWH DFW ,QGHSHQGHQWO\ RQ K\F ([SUHVVLRQ ,Q RUGHU WR HYDOXDWH ZKHWKHU WKH UHTXLUHPHQW IRU PRO\EGDWH LQ K\FODF H[SUHVVLRQ LV LQGLUHFW DQG LV UHODWHG WR WKH QHHG IRU IRUPDWH IRU DFWLYDWLRQ RI K\F RSHURQ WKH OHYHOV RI SJDODFWRVLGDVH DFWLYLW\ SURGXFHG E\ WKH PRG% PXWDQW VWUDLQ :6 JURZQ ZLWK YDULRXV IRUPDWH FRQFHQWUDWLRQV ZHUH GHWHUPLQHG )LJ f 7KH JDODFWRVLGDVH DFWLYLW\ RI WKH FXOWXUH QRW VXSSOHPHQWHG ZLWK PRO\EGDWH LQFUHDVHG IURP DERXW XQLWV WR XQLWV

PAGE 63

JDODFWRVLGDVH $FWLYLW\ )RUPDWH P0f )LJXUH (IIHFW RI IRUPDWH RQ H[SUHVVLRQ RI 3K\FODF= 6WUDLQ :6 PRG%f ZDV FXOWXUHG LQ /%* LQ WKH SUHVHQFH RU DEVHQFH RI DGGHG PRO\EGDWH

PAGE 64

EHWZHHQ WKH IRUPDWH FRQFHQWUDWLRQV RI DQG P0 7KLV LQFUHDVH LQGLFDWLQJ WKDW HQGRJHQRXVO\ SURGXFHG IRUPDWH GRHV QRW IXOO\ VDWXUDWH WKH DELOLW\ WR WUDQVFULEH K\F RSHURQ ZDV DOVR UHSRUWHG EHIRUH f $GGLWLRQ RI PRO\EGDWH DORQH LQFUHDVHG WKH OHYHO RI H[SUHVVLRQ RI K\FODF= LQ VWUDLQ :6 WR DERXW XQLWV )LJ f )RUPDWH IXUWKHU LQFUHDVHG WKH OHYHO RI H[SUHVVLRQ RI K\FODF= E\ DQ DGGLWLRQDO XQLWV LQ WKH SUHVHQFH RI PRO\EGDWH 7KLV UHTXLUHPHQW IRU PRO\EGDWH IRU RSWLPXP H[SUHVVLRQ RI K\FODF= LQ VWUDLQ :6 ZKLFK SURGXFHG IRUPDWH LQWHUQDOO\ VXJJHVWV WKDW WKH QHHG IRU PRO\EGDWH LV LQGHSHQGHQW RI WKH QHHG IRU IRUPDWH LQ WKH H[SUHVVLRQ RI K\FODF= ,W LV WKH HOXFLGDWLRQ RI WKH FRPSRQHQWV LQYROYHG LQ WKLV UHTXLUHPHQW IRU PRO\EGDWH ZKLFK LV WKH SULPDU\ IRFXV RI WKLV VWXG\ 0RG( 3URWHLQ LV 5HTXLUHG IRU 2SWLPDO ([SUHVVLRQ RI K\F 2SHURQ 0RG( 3URWHLQ KDV D 5ROH LQ K\F 2SHURQ 7UDQVFULSWLRQ 7KH PRG( JHQH LV WKH ILUVW JHQH LQ PRG() RSHURQ ZKLFK LV GLYHUJHQW IURP WKH PRG$%&' RSHURQ LQ WKH ( FROL FKURPRVRPH f 0RG( SURWHLQ LV D PRO\EGDWHVHQVRU DQG UHSUHVVHV WUDQVFULSWLRQ RI PRG$%&' LQ WKH SUHVHQFH RI PRO\EGDWH f 6LQFH WUDQVFULSWLRQ RI K\F RSHURQ UHTXLUHV PRO\EGDWH DQG 0RG( SURWHLQ KDG EHHQ VKRZQ WR EH D PRO\EGDWHVHQVLWLYH '1$ELQGLQJ SURWHLQ WKH SRVVLELOLW\

PAGE 65

WKDW 0RG( KDV D UROH LQ WKH PRO\EGDWHGHSHQGHQW WUDQVFULSWLRQ RI K\F RSHURQ ZDV LQYHVWLJDWHG $V H[SHFWHG PRO\EGDWH ZDV UHTXLUHG IRU H[SUHVVLRQ RI 3\FODF LQ DQ LVRJHQLF PRG% PXWDQW GHULYDWLYH RI :6 7DEOH f ([SUHVVLRQ RI 3K\FODF= LQ D PRG( PXWDQW ZDV GHFUHDVHG E\ DERXW b DQG PRO\EGDWH VXSSOHPHQWDWLRQ RI WKH PHGLXP KDG QR HIIHFW RQ WKH OHYHO RI JDODFWRVLGDVH DFWLYLW\ SURGXFHG 7DEOH f :KHQ WKH PRG( PXWDWLRQ ZDV FRPSOHPHQWHG E\ PRG(r LQ D SODVPLG VWUDLQ :6S:6f SURGXFHG DERXW XQLWV RI SJDODFWRVLGDVH DFWLYLW\ ZKHQ FXOWXUHG LQ HLWKHU /%* RU /%*0 7KHVH UHVXOWV VKRZ WKDW 0RG( LV DQ LQWHJUDO SDUW RI K\F WUDQVFULSWLRQ DFWLYDWLRQ ,Q RUGHU WR GHWHUPLQH LI WKH HIIHFW RI PRG( PXWDWLRQ RQ K\F H[SUHVVLRQ LV GXH WR D SRODU HIIHFW RQ WKH H[SUHVVLRQ RI PRG) JHQH ZKLFK LV ORFDWHG GRZQVWUHDP RI PRG( LQ WKH PRG() RSHURQ H[SUHVVLRQ RI 3K\FODF= ZDV DOVR DQDO\]HG LQ ERWK PRG() DQG PRG) PXWDQWV 7DEOH f 6WUDLQ :6 PRG)f SURGXFHG DERXW b RI WKH SJDODFWRVLGDVH DFWLYLW\ DV WKDW RI WKH SDUHQW VWUDLQ :6 6WUDLQ :6 ZKLFK FDUULHV D GHOHWLRQ RI WKH PRG() RSHURQ SURGXFHG RQO\ XQLWV RI S JDODFWRVLGDVH DFWLYLW\ ZKHQ FXOWXUHG LQ /%* $GGLWLRQ RI PRO\EGDWH KDG QR HIIHFW RQ WKH H[SUHVVLRQ RI K\FODF= LQ HLWKHU RI WKHVH VWUDLQV 3ODVPLG S:6 PRG(rf UHVWRUHG WKH H[SUHVVLRQ RI 3K\FODF= LQ WKH PRG() PXWDQW :6f WR RSWLPDO

PAGE 66

7DEOH 7UDQVFULSWLRQDO DFWLYDWLRQ RI 3K\FODF= LQ WKH SUHVHQFH RI PXWDWLRQV LQ WKH PRG RSHURQV 6WUDLQ 5HOHYDQW JHQRW\SH %DDODFWRVLGDVH DFWLYLW\ /%* /%*0 :6 ZLOG W\SH f f :6S:6fF ZLOG W\SH SPRG(rf f f :6 PRG% f f :6 KPRG( f f :6S:6fF EPRG( SPRG(rf f f :6 KPRG) f f :6 $PRG() f f :6S:6fF EPRG() SPRG("f f f :6 EPRG( PRG% f f D $OO VWUDLQV FDUU\ $:6 3K\FODF=f E SJDODFWRVLGDVH DFWLYLW\ LV H[SUHVVHG DV QDQRPROHVr QYLQBrPLOOLJUDP RI FHOO SURWHLQ 9DOXHV LQ SDUHQWKHVHV UHSUHVHQW b RI DFWLYLW\ SURGXFHG E\ WKH PXWDQW VWUDLQ DV FRPSDUHG WR WKH ZLOG W\SH VWUDLQ :6 F 3ODVPLG S:6 FDUULHV PRG(r

PAGE 67

OHYHOV 7KHVH UHVXOWV LQGLFDWH WKDW WKH ODFN RI 0RG( SURWHLQ DQG QRW 0RG) LV UHVSRQVLEOH IRU WKH GHFUHDVH LQ H[SUHVVLRQ RI K\F RSHURQ ,W LV DOVR SRVVLEOH WKDW WKH GHFUHDVH LQ K\FODF= H[SUHVVLRQ LQ D PRG( PXWDQW FRXOG EH UHODWHG WR WKH ODFN RI FRQWURO RI PRO\EGDWH WUDQVSRUW VLQFH 0RG(PRO\EGDWH UHSUHVVHV H[SUHVVLRQ RI PRG$%&' RSHURQ f 7KH KLJK LQWUDFHOOXODU PRO\EGDWH PD\ LQGLUHFWO\ LQIOXHQFH WKH OHYHO RI K\FODF H[SUHVVLRQ ,Q RUGHU WR HYDOXDWH WKLV SRVVLELOLW\ D PRG( PRG% GRXEOH PXWDQW VWUDLQ :6f ZDV FRQVWUXFWHG 7KLV GRXEOH PXWDQW ZDV FRPSOHWHO\ GHSHQGHQW RQ PRO\EGDWH IRU SURGXFWLRQ RI K\FGHSHQGHQW SJDODFWRVLGDVH DFWLYLW\ DQG HYHQ LQ WKH SUHVHQFH RI PRO\EGDWH P0f WKH OHYHO RI JDODFWRVLGDVH DFWLYLW\ SURGXFHG E\ VWUDLQ :6 ZDV WKH VDPH DV WKDW RI D PRG( PXWDQW VWUDLQ :6 7DEOH f 7KHVH UHVXOWV VKRZ WKDW WKH GHFUHDVH LQ WUDQVFULSWLRQ RI K\FODF LQ D PRG( PXWDQW FDQ QRW EH DWWULEXWHG WR XQUHJXODWHG H[SUHVVLRQ RI PRO\EGDWH WUDQVSRUW V\VWHP FRGHG E\ PRG$%& RSHURQ DQG DOVR GHPRQVWUDWHV WKDW WKH 0RG( LQGHSHQGHQW DFWLYDWLRQ RI WUDQVFULSWLRQ RI K\F RSHURQ VWLOO UHTXLUHV PRO\EGDWH 7KLV VXJJHVWV WKDW 0RG( LV QRW WKH RQO\ PRO\EGDWHVHQVRU LQ WKH WUDQVFULSWLRQDO UHJXODWLRQ RI K\F RSHURQ

PAGE 68

0RG(GHSHQGHQW $FWLYDWLRQ RI K\F 2SHURQ 5HTXLUHV 0RO\EGDWH 7R HVWDEOLVK WKDW WKH PRO\EGDWHERXQG IRUP RI 0RG( LV WKH DFWLYH IRUP SDUWLFLSDWLQJ LQ K\F H[SUHVVLRQ D PRG(r SODVPLG SODVPLG S:6f ZDV LQWURGXFHG LQWR D PRG( PRG% GRXEOH PXWDQW VWUDLQ :6 FDUU\LQJ 3K\FODF= IXVLRQ 7DEOH f 6WUDLQ :6 DOVR FDUULHV D SFQ% PXWDWLRQ WR UHGXFH WKH FRS\ QXPEHU RI WKH PRG(r SODVPLG DQG PLQLPL]H SODVPLG FRS\ QXPEHU HIIHFW RQ K\F H[SUHVVLRQ f (YHQ LQ WKH SUHVHQFH RI SODVPLG S:6 FRGLQJ IRU WKH QDWLYH 0RG( SURWHLQ H[SUHVVLRQ RI 3K\FODF= ZDV PRO\EGDWHGHSHQGHQW 7DEOH f 7KHVH UHVXOWV VXJJHVW WKDW WKH 0RG(GHSHQGHQW H[SUHVVLRQ RI K\F RSHURQ UHTXLUHV PRO\EGDWH 0XWDQW 0RG( SURWHLQV ZKLFK UHSUHVVHG PRG$ODF= H[SUHVVLRQ HYHQ LQ WKH DEVHQFH RI PRO\EGDWH DW GLIIHUHQW OHYHOV ZHUH SUHYLRXVO\ GHVFULEHG f DQG ZKHQ SODVPLGV FRGLQJ IRU WKHVH PXWDQW 0RG( SURWHLQV ZHUH LQWURGXFHG LQWR VWUDLQ :6 3WL\FODF= H[SUHVVLRQ ZDV DOVR LQGHSHQGHQW RI DGGHG PRO\EGDWH 7DEOH f 7KH OHYHOV RI SJDODFWRVLGDVH DFWLYLW\ SURGXFHG LQ WKH SUHVHQFH RI WKHVH PXWDQW SURWHLQV YDULHG EHWZHHQ DQG XQLWV VXJJHVWLQJ WKDW WKHVH SURWHLQV KDYH GLIIHUHQW DELOLWLHV WR HQKDQFH K\F WUDQVFULSWLRQ LQ WKH SUHVHQFH DQG DEVHQFH RI PRO\EGDWH ,Q WKH SUHVHQFH RI 0RG($9f ZKLFK IDLOHG WR UHSUHVV PRG$ODF= f RQO\ D PRGHVW LQFUHDVH LQ K\FODF H[SUHVVLRQ ZDV

PAGE 69

7DEOH 0RG(GHSHQGHQW DFWLYDWLRQ RI K\F RSHURQ UHTXLUHV PRO\EGDWH 6WUDLQ 5HOHYDQW JHQRW\SH 6DDODFWRVLGDVH DFWLYLW\ /%* /%*0 :6 ZLOG W\SH :6 $ PRG( :6 PRG% :6 $PRG( PRG% :6S:6f $PRG( PRG% S PRG(rf :6S:6f $PRG( PRG% SPRG(*'f :6S:6f $PRG( PRG% SPRG(rf :6S:6f $PRG( PRG% S PRG( rf $OO VWUDLQV FDUU\ ƒ:6 :LOG W\SH PRG(r JHQH S:6f DQG PXWDQW PRG( JHQHV DUH FDUULHG E\ WKH SODVPLGV OLVWHG E SJDODFWRVLGDVH DFWLYLW\ LV H[SUHVVHG DV QDQRPROHV fPLQnfPLOOLJUDP RI FHOO SURWHLQ

PAGE 70

REVHUYHG DQG WKLV UHTXLUHG PRO\EGDWH WR XQLWVf 7KHVH UHVXOWV DUH LQ DJUHHPHQW ZLWK WKH SURSRVDO WKDW 0RG( PRO\EGDWH LV WKH DFWLYH IRUP LQ HQKDQFLQJ WUDQVFULSWLRQ RI K\F RSHURQ 0RG( 3URWHLQ %LQGV WR K\F 3URPRWHU '1$ 6LQFH WKH JHQHWLF DQG SK\VLRORJLFDO H[SHULPHQWV VXJJHVW WKDW 0RG(PRO\EGDWH LV UHTXLUHG IRU RSWLPDO H[SUHVVLRQ RI 3K\FODF= GLUHFW ELQGLQJ H[SHULPHQWV FRQVLVWLQJ RI 0RG( SURWHLQ DQG SURPRWHU '1$ ZHUH FDUULHG RXW (OHFWURSKRUHWLF PRELOLW\ RI D ES K\F SURPRWHU '1$ ZDV UHWDUGHG LQ WKH SUHVHQFH RI 0RG( SURWHLQ EXW RQO\ LQ WKH SUHVHQFH RI PRO\EGDWH )LJ f 7KH PLQLPDO DPRXQW RI 0RG(PRO\EGDWH UHTXLUHG IRU WKH PRELOLW\ VKLIW ZDV DERXW Q0 DQG WKLV LV DERXW WLPHV KLJKHU FRQFHQWUDWLRQ RI 0RG( SURWHLQ WKDQ WKH UHSRUWHG .G IRU ELQGLQJ RI 0RG( WR PRG$ RSHUDWRU '1$ f 7KHVH UHVXOWV VKRZ WKDW WKH 0RG(PRO\EGDWH ELQGV WR K\F XSVWUHDP '1$ '1DVH ,IRRWSULQWLQJ H[SHULPHQWV LQYROYLQJ 0RG( DQG K\F SURPRWHU '1$ UHYHDOHG WKDW 0RG(PRO\EGDWH SURWHFWV D ES UHJLRQ LQ WKLV '1$ IURP '1DVH ,PHGLDWHG K\GURO\VLV %DVHV WR )LJ SDQHO $f 7KH FHQWHU RI WKH 0RG( SURWHFWHG UHJLRQ LV EDVHV XSVWUHDP RI WKH FHQWHU RI WKH '1$ SURWHFWHG E\ WKH WUDQVFULSWLRQDO DFWLYDWRU )KO$ SURWHLQ IURP '1DVH K\GURO\VLV )LJ f $OWKRXJK WKHUH LV QR

PAGE 71

% )LJXUH '1$ HOHFWURSKRUHWLF PRELOLW\ VKLIW ZLWK 0RG( SURWHLQ DQG '1$ IURP WKH K\F SURPRWHU UHJLRQ 3DQHO $ PLQXV PRO\EGDWH 3DQHO % SOXV PRO\EGDWH /DQH QR SURWHLQ DGGHG ODQH Q0 0RG( ODQH Q0 0RG( ODQH Q0 0RG( ODQH Q0 0RG( ODQH Q0 0RG( ODQH Q0 0RG( FQ R

PAGE 72

)LJXUH 3URWHFWLRQ RI K\F '1$ E\ 0RG( SURWHLQ IURP FOHDYDJH E\ '1DVH /DQHV ZLWK P0 PRO\EGDWH LQ WKH ELQGLQJ UHDFWLRQ ODQHV ZLWKRXW DGGHG PRO\EGDWH /DQH VHTXHQFLQJ ODGGHU RQO\ & WUDFN LV VKRZQf ODQH '1$ DORQH ODQHV DQG S0 0RG( ODQHV DQG S0 0RG( ODQHV DQG S0 0RG( 7KH QXPEHUV UHSUHVHQW

PAGE 73

LQYHUWHG UHSHDW VHTXHQFH ZLWKLQ WKLV 0RG(SURWHFWHG UHJLRQ VHTXHQFHV VLPLODU WR WKRVH IRXQG LQ WKH PRG$ RSHUDWRUSURPRWHU '1$ WR ZKLFK 0RG( KDV EHHQ VKRZQ WR ELQG f DUH SUHVHQW LQ WKH K\F SURPRWHU 7KLV LQFOXGHV ERWK WKH WHWUDPHU *77$ DQG SHQWDPHU VHTXHQFH &$7$7 )LJ f 7KH ES 0RG(SURWHFWHG PRG$ RSHUDWRU '1$ FRQWDLQV WKUHH FRSLHV RI WKH SHQWDPHU VHTXHQFH 7$<$7 < S\ULPLGLQHf DQG WKH WHWUDPHU VHTXHQFH *77$ FDQ DOVR EH GHWHFWHG DW ORFDWLRQV ZLWKLQ D ES UHJLRQ LQ WKH PRG$ RSHUDWRU '1$ )LJ SDQHO %f 7KH UROH RI WKHVH WHWUDPHU VHTXHQFHV LQ PRG$ '1$ LV QRW NQRZQ 7KH *77$ DQG &$7$7 VHTXHQFHV LQ K\F SURPRWHU DUH VHSDUDWHG E\ EDVHV ZKLFK LV WKH VDPH GLVWDQFH EHWZHHQ WKH WZR SHQWDPHU VHTXHQFHV 7$7$7 DQG 7$&$7 UHJLRQV DQG f LQ WKH PRG$ RSHUDWRU )LJ f $Q LQYHUWHG UHSHDW &$$7 $ $77* WR f DQG DQRWKHU VHTXHQFH 7$$& 7 $77* WR f FRQWDLQLQJ WKH *77$ WHWUDPHUV DUH DOVR IRXQG QHDU WKH 0RG(UHFRJQLWLRQELQGLQJ VHTXHQFH LQ WKH K\F SURPRWHU '1$ 3DUWLDO SURWHFWLRQ IURP '1DVH FOHDYDJH FDQ DOVR EH REVHUYHG LQ WKH K\F '1$ ZLWKLQ WKH WR UHJLRQ )LJ f $SSDUHQWO\ 0RG(PRO\EGDWH UHFRJQL]HV WKLV '1$ EXW VWDEOH 0RG(PRO\EGDWH'1$ FRPSOH[ IRUPV RQO\ ZLWK WKH ES UHJLRQ EHWZHHQ DQG 7KH '1$ EHWZHHQ DQG FRQWDLQLQJ WKH 7$$& 7 $77* VHTXHQFH ZDV QRW SURWHFWHG E\ 0RG(

PAGE 74

, 0RG( *&&&*77** &$*$** *77$ 777&*7*&$7$7 &*&&7 &&&$77$$&7$7 K\S Q L L 7 *&&$*&7$&$$*&$$7$$77*7*&&$*7*77*$77$7&&&7 *&**7* QR L )KO$ L $$7$$7*7&*$7*$7*7&*$$$7*$&$&*7&*$&$&**&* $&*$$$77 ,+) &$7&777$*&77$$$$$7&7&777$$ -U$$&$$7$$$77$$$$*77**& K\F $&$$$$$$7*&77$$$*&7**& $ A7&7&7*77$$$&***7$$&&7*$&$ *77$ *&$$7$$&7*& 7***$$ $$77&&*$ *77$ *7& *7 7$7$77 L PRG $ %&' 7&*&& 7$&$7 $$& f,f§ *77$ &$7 5HJLRQ PRG$ 7$$****77$&&$ $7* 5HJLRQ 5HJLRQ )LJXUH &RPSDULVRQ RI WKH 0RG(ELQGLQJ UHJLRQV LQ K\F SURPRWHU '1$ DQG PRG$ RSHUDWRUSURPRWHU '1$ 3DQHO $ K\F SURPRWHU '1$ 3DQHO % PRG$ RSHUDWRUSURPRWHU '1$ 7KH VLQJOH ER[HG EDVHV LQGLFDWH WKH WUDQVFULSWLRQ VWDUW VLWH IRU K\F DQG K\S RSHURQV 7KH )KO$ DQG ,+) ELQGLQJ VLWHV DUH DOVR LQGLFDWHG E\ OLJKW ER[HG UHJLRQV 0RG( ELQGLQJ UHJLRQV DUH UHSUHVHQWHG E\ GDUN ER[HV 7KH QXPEHUV UHSUHVHQW WKH SRVLWLRQV RI WKH EDVHV LQ UHODWLRQ WR WKH WUDQVFULSWLRQ VWDUW VLWH f $Q DVWHULVN RYHU WKH $ DW LQGLFDWHV K\SHUVHQVLWLYLW\ WR '1DVH FOHDYDJH *77$ VHTXHQFHV DEXQGDQWO\ SUHVHQW ZLWKLQ WKLV UHJLRQ DUH XQGHUOLQHG

PAGE 75

7KH DPRXQW RI 0RG( UHTXLUHG IRU SURWHFWLRQ RI K\F SURPRWHU '1$ IURP '1DVH ZDV KLJKHU WKDQ S0 DQG WKLV LV DERXW WLPHV KLJKHU WKDQ WKH DPRXQW RI WKH WUDQVFULSWLRQDO DFWLYDWRU )KO$ SURWHLQ UHTXLUHG IRU SURWHFWLRQ RI K\F SURPRWHU '1$ IURP '1DVH K\GURO\VLV f 7KH VDPH SUHSDUDWLRQ RI 0RG(PRO\EGDWH SURWHFWHG PRG$ RSHUDWRU '1$ FRPSOHWHO\ IURP '1DVH K\GURO\VLV DW D FRQFHQWUDWLRQ RI OHVV WKDQ Q0 3UHYLRXV PXWDWLRQDO DQDO\VLV RI PRG$ RSHUDWRUSURPRWHU '1$ HVWDEOLVKHG WKDW ELQGLQJ RI 0RG( SURWHLQ WR WKH PRG$ RSHUDWRUSURPRWHU '1$ UHTXLUHG UHJLRQV DQG f 0XWDWLRQV LQ UHJLRQ GLG QRW HOLPLQDWH VWDEOH 0RG('1$ FRPSOH[ DV DVVD\HG E\ ERWK LQ YLYR DQG LQ YLWUR H[SHULPHQWV EXW WKH SUHVHQFH RI WKLV UHJLRQ HQKDQFHG RYHUDOO ELQGLQJ E\ DERXW IROG 'LUHFW ELQGLQJ H[SHULPHQWV DOVR GHWHUPLQHG WKDW 0RG( LV ERXQG WR WKH '1$ RI WKH PRG$ RSHUDWRUSURPRWHU UHJLRQ DV D GLPHU f 7KLV PXWDWLRQDO DQDO\VLV DOVR VKRZHG WKDW WKH *77$ VHTXHQFHV DOVR SOD\ D UROH LQ 0RG( PRO\EGDWH ELQGLQJ WR PRG$ RSHUDWRU '1$ ,Q DGGLWLRQ FRPSDULVRQ RI '1$ IURP WKH SURPRWHU UHJLRQV RI RWKHU PRO\EGDWHFRQWROOHG RSHURQV LQ ( FROL DQG RWKHU RUJDQLVPV UHYHDOHG WKH SUHVHQFH RI RQO\ WZR SHQWDPHU VHTXHQFHV VLPLODU WR UHJLRQV DQG )LJ DQG UHI f 6LQFH WKH SURWHFWHG UHJLRQ LQ WKH K\F SURPRWHU '1$ FRQWDLQV

PAGE 76

D *77$ES&$7$7 PRWLI LW DSSHDUV WKDW WKH 0RG( SURWHLQ FDQ UHFRJQL]H DQG ELQG WR WKHVH VHTXHQFH PRWLIV DW D ORZHU DIILQLW\ WKDQ WR D GRXEOH SHQWDPHU PRWLI :KHWKHU 0RG( LV ELQGLQJ DV D PRQRPHU RU GLPHU LQ WKLV LQWHUDFWLRQ LV \HW WR EH GHWHUPLQHG 7KH KLJKHU FRQFHQWUDWLRQ RI 0RG( SURWHLQ UHTXLUHG IRU SURWHFWLRQ RI WKH K\F SURPRWHU '1$ LQ YLWUR PD\ UHIOHFW WKH UROH RI 0RG( DV D VHFRQGDU\ DFWLYDWRU UDWKHU WKDQ D UHTXLUHG SULPDU\ UHJXODWRU RI WUDQVFULSWLRQ )LJXUH GHSLFWV D PRGHO IRU WKH VHFRQGDU\ DFWLYDWLRQ RI WKH K\F RSHURQ E\ 0RG(PRO\EGDWH FRPSOH[ $V SHU WKLV PRGHO )KO$IRUPDWH PHGLDWHG WUDQVFULSWLRQ RI K\F RSHURQ LV LQFUHDVHG E\ WKH 0RG(PRO\EGDWH FRPSOH[ 6LQFH LQ WKH DEVHQFH RI )KO$ K\F LV QRW H[SUHVVHG WKH 0RG(PRO\EGDWH PD\ QRW EH LQWHUDFWLQJ ZLWK 51$ 3RO\PHUDVH GLUHFWO\ ,W LV SRVVLEOH WKDW WKH 0RG( PRO\EGDWH LQWHUDFWV ZLWK )KO$IRUPDWH DQG LQFUHDVHV WKH DELOLW\ RI )KO$IRUPDWH FRPSOH[ WR DFWLYDWH WUDQVFULSWLRQ 7KLV PD\ LQGHHG EH DQ DGDSWDWLRQ RI ( FROL WR LQFUHDVH WKH OHYHO RI PRO\EGRHQ]\PH V\QWKHVLV ZKHQ PRO\EGDWH LV LQ H[FHVV LQ WKH F\WRSODVP %LRFKHPLFDO $QDO\VLV RI 0RG( DQG 0RO\EGDWH,QGHSHQGHQW 0XWDQW 0RG( 0RG( %LQGLQJ 6LWHV LQ PRG$ 2SHUDWRU3URPRWHU '1$ $OWKRXJK 0RG( SURWHLQ ZDV IRXQG WR UHTXLUH PRO\EGDWH LQ LWV UROH DV D WUDQVFULSWLRQDO DFWLYDWRU RI K\F

PAGE 77

)RUPDWH K\F RSHURQ )LJXUH $ SURSRVHG PRGHO IRU DFWLYDWLRQ RI K\F RSHURQ E\ ERWK )KO$ DQG 0RG( SURWHLQV %ROG OLQH UHSUHVHQWV '1$ IURP WKH ( FROL FKURPRVRPH IRU WKH K\FK\S RSHURQ LQWHUJHQLF UHJLRQ

PAGE 78

WUDQVFULSWLRQ SDUWLDO SURWHFWLRQ IURP '1DVH RI K\F SURPRWHU '1$ ZDV VHHQ LQ WKH SUHVHQFH RI KLJK FRQFHQWUDWLRQV RI 0RG( HYHQ LQ WKH DEVHQFH RI PRO\EGDWH )LJ f ,Q DGGLWLRQ KLJKHU OHYHOV RI 0RG( SURWHLQ SURGXFHG IURP KLJK FRS\ PRG(r SODVPLG DOVR VXSSUHVVHG LQ YLYR WKH QHHG IRU PRO\EGDWH LQ WUDQVFULSWLRQ RI K\F RSHURQ GDWD QRW VKRZQf 7KHVH H[SHULPHQWDO UHVXOWV UDLVH WKH SRVVLELOLW\ WKDW WKH 0RG( SURWHLQ HQKDQFHV WUDQVFULSWLRQ RI K\F RSHURQ LQ WKH DEVHQFH RI PRO\EGDWH ,Q DJUHHPHQW ZLWK WKLV SRVVLELOLW\ 0RG( ZDV DOVR UHSRUWHG WR ELQG WR PRG$ RSHUDWRU '1$ HYHQ LQ WKH DEVHQFH RI DGGHG PRO\EGDWH DQG SURWHFWHG WKH '1$ IURP '1DVH K\GURO\VLV f +RZHYHU DQ DOWHUQDWH SRVVLELOLW\ WKDW D VPDOO IUDFWLRQ RI 0RG( XVHG LQ WKH LQ YLWUR H[SHULPHQWV LV FRQWDPLQDWHG ZLWK PRO\EGDWH DQG WKH DQDO\WLFDO VHQVLWLYLW\ RI PRO\EGDWH GHWHUPLQDWLRQ PHWKRGV LV QRW KLJK HQRXJK WR GHWHFW LWV SUHVHQFH FDQ QRW EH UXOHG RXW ,QFUHDVLQJ WKH FRS\ QXPEHU RI PRG(r PD\ DOVR KDYH D VLPLODU HIIHFW RQ WUDQVFULSWLRQ RI K\F RSHURQ E\ VFDYHQJLQJ WKH YHU\ VPDOO DPRXQW RI PRO\EGDWH WUDQVSRUWHG E\ DOWHUQDWH PRO\EGDWH WUDQVSRUW V\VWHPV ,Q RUGHU WR GLVWLQJXLVK EHWZHHQ WKHVH WZR SRVVLELOLWLHV 0RG( SXULILHG DV GHVFULEHG SUHYLRXVO\ f ZDV FRPSDUHG ZLWK 0RG( SXULILHG XVLQJ 1LDIILQLW\ PHWKRG r0RG(f 7KH 1LDIILQLW\ SXULILFDWLRQ PHWKRG ZDV FKRVHQ VLQFH LW LQYROYHV RQO\ D

PAGE 79

OLPLWHG QXPEHU RI VWHSV WKHUHE\ GHFUHDVLQJ WKH H[SRVXUH RI 0RG( SURWHLQ WR ODUJH YROXPHV RI EXIIHU ZKLFK FRXOG EH D SRVVLEOH VRXUFH RI PRO\EGDWH FRQWDPLQDWLRQ 7KH ( FROL KRVW XVHG IRU H[SUHVVLRQ RI PRG( LQ WKHVH H[SHULPHQWV VWUDLQ %/'(f DOVR FDUULHV DQ XQLGHQWLILHG PRG RSHURQ PXWDWLRQ DQG WKXV LV LQFDSDEOH RI WUDQVSRUWLQJ PRO\EGDWH ZKHQ JURZQ LQ ULFK PHGLXP QRW VXSSOHPHQWHG ZLWK PRO\EGDWH XQSXEOLVKHG GDWDf 0RG(ELQGLQJ WR PRG$ RSHUDWRU '1$ ZDV XVHG DV WKH DVVD\ IRU PRO\EGDWH FRQWDPLQDWLRQ RI 0RG( EHFDXVH RI WKH KLJKHU DIILQLW\ RI 0RG( WR PRG$ RSHUDWRU '1$ DQG WR LQFUHDVH WKH VHQVLWLYLW\ '1DVH IRRWSULQWLQJ ZDV XVHG DV WKH DQDO\WLFDO WRRO 7KH UHVXOWV SUHVHQWHG LQ )LJXUH VKRZ WKDW 0RG( DORQH SURWHFWHG PRG$ '1$ IURP '1DVH K\GURO\VLV DW D FRQFHQWUDWLRQ RI Q0 ODQHV f $ K\SHUVHQVLWLYH $ DW SRVLWLRQ FDQ DOVR EH VHHQ DW WKLV FRQFHQWUDWLRQ RI 0RG( $GGLWLRQ RI PRO\EGDWH WR WKH ELQGLQJ UHDFWLRQ UHGXFHG WKH DPRXQW RI 0RG( UHTXLUHG IRU FRPSOHWH SURWHFWLRQ WR OHVV WKDQ Q0 )LJ ODQH f ,Q WKH SUHVHQFH RI r0RG( SURWHLQ SXULILHG XVLQJ WKH 1LDIILQLW\ SURFHGXUH SURWHFWLRQ RI PRG$ RSHUDWRUSURPRWHU '1$ IURP '1DVH ,PHGLDWHG K\GURO\VLV ZDV GHSHQGHQW RQ PRO\EGDWH DW WKH 0RG( FRQFHQWUDWLRQV WHVWHG )LJ ODQHV f (YHQ DW Q0 0RG( WKH K\SHUVHQVLWLYLW\ RI WKH $ DW ZDV RQO\ VOLJKWO\

PAGE 80

WWLLLULLUUUUWUUUW )LJXUH '1DVH IRRWSULQWLQJ RI PRG$%&' RSHUDWRUSURPRWHU '1$ ZLWK 0RG( SURWHLQV /DQHV DQG '1$ DORQH Q0f ODQHV DQG ZLWKRXW PRO\EGDWH ODQHV DQG ZLWK P0 PRO\EGDWH LQ WKH ELQGLQJ UHDFWLRQ /DQHV QDWLYH 0RG( SURWHLQ ODQHV r0RG( FRQWDLQV H[WUD WKUHH DPLQR DFLGV *O\ 6HU DQG +LV LQ WKH 1WHUPLQDO HQG VHH WH[W IRU GHWDLOVf /DQHV DQG Q0 SURWHLQ ODQHV DQG Q0 SURWHLQ ODQHV DQG Q0 SURWHLQ ODQHV DQG Q0 SURWHLQ 7KH QXPEHUV UHSUHVHQW WKH SRVLWLRQ RI WKH EDVHV ZLWK UHVSHFW WR WKH WUDQVFULSWLRQ VWDUW VLWH RI WKH PRG$%&' RSHURQ

PAGE 81

LQFUHDVHG )LJ ODQH f ,Q WKH SUHVHQFH RI PRO\EGDWH Q0 0RG( DOPRVW FRPSOHWHO\ SURWHFWHG PRG$ RSHUDWRUSURPRWHU '1$ IURP K\GURO\VLV E\ '1DVH 7KHVH UHVXOWV VXJJHVW WKDW JUHDWHU WKDQ b RI WKH r0RG( LQ WKLV SUHSDUDWLRQ LV IUHH RI PRO\EGDWH DQG WKH DFWLYH IRUP RI 0RG( ELQGLQJ WR PRG$ RSHUDWRU '1$ LV 0RG(PRO\EGDWH $QDO\VLV RI WKH 0RG(PRO\EGDWH SURWHFWHG UHJLRQ RI WKH PRG$ RSHUDWRUSURPRWHU '1$ DIWHU '1DVH ,PHGLDWHG FOHDYDJH RI WKH FRGLQJ VWUDQG )LJ ODQHV f UHYHDOHG WKDW WKHUH DUH WKUHH DUHDV RI SURWHFWLRQ GHWHFWDEOH DW D 0RG(PRO\EGDWH FRQFHQWUDWLRQ DV ORZ DV Q0 7KH ILUVW SURWHFWHG UHJLRQ r*77$7$77 VSDQV IURP WR DQG RYHUODSV WKH PRG$ r VHTXHQFH )LJ f 7KH VHFRQG 0RG( SURWHFWHG UHJLRQ r*&&7$&$7 VSDQV IURP WR RI WKH PRG$RSHUDWRUSURPRWHU '1$ ZKLOH WKH WKLUG SURWHFWHG UHJLRQ r*77$&$7 LV ORFDWHG EHWZHHQ EDVHV DQG (DFK RI WKH WKUHH '1DVH ,FOHDYDJHSURWHFWHG UHJLRQV FRQWDLQV HLWKHU D r7$7$7 SURWHFWHG UHJLRQ f RU n7$&$7 SURWHFWHG UHJLRQV DQG f VHTXHQFH ZKLFK VXJJHVWV WKDW LW LV WKHVH VHTXHQFHV ZKLFK DUH UHFRJQL]HG E\ 0RG( DV WKH WDUJHW ELQGLQJ VLWH 7KH LQGHSHQGHQW SURWHFWHG VLWHV DUH VHSDUDWHG E\ WKUHH EDVHV DQG WKH SHQWDPHULF VHTXHQFHV LQ UHJLRQV DQG DUH SUHFHGHG E\ WKH VDPH WZR EDVHV *7 $VLGH IURP WKH WKUHH SURWHFWHG UHJLRQV WKH EDVH r$ DW

PAGE 82

62 77*77$ *&$$7$$&7*& 7***$$ $$77&&*$ *77$ *7& *7 7$7$77IH PRG$%&' UU A 7&*&& 7$&$7 $$& *77$ &$7 7$$****77$&&$ $7* 5HJLRQ PRG $ 5HJLRQ 5HJLRQ )LJXUH '1$ VHTXHQFH RI WKH PRG$%&' RSHUDWRUSURPRWHU UHJLRQ SURWHFWHG E\ 0RG( PRO\EGDWH IURP '1DVH FOHDYDJH 7KH WKUHH SURWHFWHG UHJLRQV DUH HQFORVHG E\ ER[HV /HWWHUV LQ JUH\ ER[HV UHSUHVHQW WKH SHQWDPHU VHTXHQFHV SUHVHQW ZLWKLQ WKH 0RG( PRO\EGDWHSURWHFWHG UHJLRQV 7KH QXPEHUV UHSUHVHQW WKH SRVLWLRQV RI WKH EDVHV LQ UHODWLRQ WR WKH WUDQVFULSWLRQ VWDUW VLWH f $Q DVWHULVN RYHU WKH $ DW LQGLFDWHV K\SHUVHQVLWLYLW\ WR '1DVH FOHDYDJH *77$ VHTXHQFHV DEXQGDQWO\ SUHVHQW ZLWKLQ WKLV UHJLRQ DUH XQGHUOLQHG RV 2V

PAGE 83

SRVLWLRQ ORFDWHG QH[W WR WKH n HQG RI WKH VHFRQG SURWHFWHG UHJLRQ LV K\SHUVHQVLWLYH WR '1DVH ,FOHDYDJH $Q LQYHUWHG UHSHDW RI EDVHV DOVR H[LVWV ZLWKLQ WKH 0RG( SURWHFWHG UHJLRQ RI WKH PRG$ RSHUDWRUSURPRWHU '1$ 0F1LFKRODV HW DO f EDVHG RQ '1DVH IRRWSULQWLQJ UHSRUWHG WKDW 0RG( SURWHFWHG WKH HQWLUH UHJLRQ RI '1$ VSDQQLQJ IURP WR HYHQ LQ WKH DEVHQFH RI PRO\EGDWH 7KH K\SHUVHQVLWLYH r$ DW SRVLWLRQ ZDV QRW GHWHFWDEOH LQ WKH UHSRUWHG 0RG(IRRWSULQW f $OWKRXJK WKH K\SHUVHQVLWLYH VLWH LV UHFRJQL]DEOH LQ WKH 0RG(PRG$ '1DVH IRRWSULQW UHSRUWHG E\ $QGHUVRQ HW DO f WKH XQSURWHFWHG EDVHV EHWZHHQ WKH UHJLRQV DQG ZHUH QRW GLVFHUQDEOH 7KH IDFW WKDW WKH '1DVH IRRWSULQW SUHVHQWHG LQ )LJXUH UHVROYHV WKH PRG$RSHUDWRUSURPRWHU UHJLRQ LQWR GLVFUHHW 0RG(ELQGLQJ UHJLRQV ZLWK D GLVWLQFW '1DVH K\SHUVHQVLWLYH VLWH GHOLQHDWLQJ SURWHFWHG UHJLRQV DQG VXJJHVWV WKDW 0RG( ELQGV DQG SURWHFWV WKH WKUHH LQGLFDWHG UHJLRQV LQ YLYR DOVR 7KH r0RG( DOVR SURWHFWHG WKH VDPH EDVHV ZLWK WKH K\SHUVHQVLWLYH DGHQLQH LQ WKH PRG$ RSHUDWRU '1$ EXW WKH DPRXQW RI SURWHLQ UHTXLUHG IRU FRPSOHWH SURWHFWLRQ ZDV VOLJKWO\ KLJKHU Q0 YV Q0 IRU 0RG(PRO\EGDWHf 6LPLODU 0RG(PRO\EGDWH IRRWSULQW LQ WKH QRQFRGLQJ VWUDQG RI WKH PRG$RSHUDWRUSURPRWHU '1$ DOVR ZDV REVHUYHG GDWD QRW SUHVHQWHGf 6LQFH WKH r0RG( SURWHLQ SUHSDUDWLRQ DSSDUHQWO\

PAGE 84

GLG FRQWDLQ OHVV PRO\EGDWH WKDQ WKH QDWLYH 0RG( SUHSDUDWLRQ DQG WKXV GLG QRW SURWHFW WKH PRG$ RSHUDWRUSURPRWHU '1$ DW WKH WHVWHG FRQFHQWUDWLRQVf WKH DELOLW\ RI PXWDQW 0RG( SURWHLQV WR LQWHUDFW ZLWK WKH PRG$ RSHUDWRUSURPRWHU '1$ ZDV DQDO\]HG LQ D VLPLODU PDQQHU ,QWHUDFWLRQV RI 0XWDQW 0RG( 3URWHLQV ZLWK PRG$ 2SHUDWRU3URPRWHU '1$ 6LQFH WKH PRO\EGDWHLQGHSHQGHQW PXWDQW 0RG( DFWLYDWHG WUDQVFULSWLRQ RI K\F LQ WKH DEVHQFH RI PRO\EGDWH 7DEOH f WKH DELOLW\ RI WKHVH SURWHLQV WR ELQG WR '1$ LQ WKH DEVHQFH RI PRO\EGDWH ZDV LQYHVWLJDWHG )RU WKHVH H[SHULPHQWV VHOHFWHG PXWDQW SURWHLQV ZHUH SXULILHG XVLQJ +LVWDJ DIILQLW\ FKURPRWRJUDSK\ WR PLQLPL]H PRO\EGDWH FRQWDPLQDWLRQ ,Q DJUHHPHQW ZLWK WKH LQ YLYR UHVXOWV ZLWK ERWK K\F ODF= DQG PRG$ODF= f WKH r0RG($9f GLG QRW SURWHFW PRG$ RSHUDWRUSURPRWHU '1$ IURP '1DVH K\GURO\VLV )LJ ODQHV f ,QFOXVLRQ RI PRO\EGDWH WR WKH UHDFWLRQ PL[WXUH GLG QRW LQFUHDVH WKH DIILQLW\ RI On0RG( $ 9f IRU WKH '1$ GDWD QRW SUHVHQWHGf $OWKRXJK WKH r0RG(7,f PXWDQW SURWHLQ SURWHFWHG WKH VDPH UHJLRQ RI '1$ SURWHFWHG E\ QDWLYH 0RG( WKH DPRXQW RI SURWHLQ UHTXLUHG IRU FRPSOHWH SURWHFWLRQ LQ WKH DEVHQFH RI PRO\EGDWH ZDV FORVH WR Q0 )LJ ODQHV f $W WKLV FRQFHQWUDWLRQ WKH OHYHO RI SURWHFWLRQ

PAGE 85

)LJXUH '1DVH SURWHFWLRQ SDWWHUQ RI PRG$%&' RSHUDWRUSURPRWHU '1$ ZLWK r0RG( DQG LWV PXWDQW IRUPV 7KH ELQGLQJ UHDFWLRQ ODFNHG PRO\EGDWH /DQH '1$ DORQH Q0f ODQHV r0RG( ODQHV r0RG(7,f ODQHV r0RG($9f /DQH Q0 SURWHLQ ODQHV DQG Q0 SURWHLQ ODQHV DQG Q0 ODQHV DQG Q0 1XPEHUV LQGLFDWH WKH SRVLWLRQ RI EDVHV LQ UHODWLRQ WR WKH PRG$ WUDQVFULSWLRQ VWDUW VLWH

PAGE 86

E\ WKH r0RG(7,f SURWHLQ ZDV DERXW WLPHV EHWWHU WKDQ WKH r0RG( SURWHLQ ZLWKRXW DGGHG PRO\EGDWH 7KH PRO\EGDWHLQGHSHQGHQW UHSUHVVLRQ RI PRG$ODF= E\ 0RG(7,f LQ YLYR FDQQRW EH UHFRQFLOHG ZLWK RQO\ D IROG KLJKHU DSSDUHQW DIILQLW\ RI r0RG(7,f WR WKH '1$ LQ WKH DEVHQFH RI PRO\EGDWH LQ FRPSDULVRQ WR QDWLYH 0RG( f $OVR WKH DPRXQW RI r0RG(7,f SURWHLQ UHTXLUHG IRU SURWHFWLRQ IURP '1DVH FOHDYDJH ZDV VWLOO DERXW IROG KLJKHU WKDQ WKH DPRXQW RI 0RG(PRO\EGDWH UHTXLUHG IRU FRPSOHWH SURWHFWLRQ 7KLV UDLVHG WKH TXHVWLRQ RI ZK\ VR PXFK PXWDQW 0RG( SURWHLQ ZDV UHTXLUHG IRU VWDEOH '1$SURWHLQ LQWHUDFWLRQ LQ WKH DEVHQFH RI PRO\EGDWH DQG OHG WR D PRUH WKRURXJK NLQHWLF DQDO\VLV RI ERWK 0RG( DQG PXWDQW 0RG( SURWHLQV .LQHWLFV RI ,QWHUDFWLRQ EHWZHHQ 0RG( DQG PRG$ 2SHUDWRU '1$ 7KH DSSDUHQW .G IRU ELQGLQJ RI 0RG(PRO\EGDWH WR PRG$ RSHUDWRU '1$ ZDV SUHYLRXVO\ UHSRUWHG WR EH DERXW Q0 f 7KLV .F YDOXH LV VLJQLILFDQWO\ KLJKHU WKDQ WKH Q0 RI 0RG(PRO\EGDWH UHTXLUHG IRU FRPSOHWH SURWHFWLRQ RI PRG$ RSHUDWRUSURPRWHU '1$ IURP '1DVH K\GURO\VLV )LJ ODQH f 7R UHVROYH WKLV GLIIHUHQFH DQG WR UHVROYH WKH QHHG IRU UHODWLYHO\ KLJK FRQFHQWUDWLRQ RI r0RG(7,f WR SURWHFW WKH PRG$ RSHUDWRUSURPRWHU '1$ LQ WKH DEVHQFH RI PRO\EGDWH WKH LQWHUDFWLRQ EHWZHHQ 0RG( DQG PRG$ RSHUDWRUSURPRWHU '1$ ZDV

PAGE 87

GHWHUPLQHG XVLQJ DQ (YDQHVFHQW :DYH %LRVHQVRU 8SRQ DGGLWLRQ RI Q0 r0RG(PRO\EGDWH D UDSLG UHVSRQVH VLJQLI\LQJ ELQGLQJ ZDV REVHUYHG DQG WKH PD[LPXP ELQGLQJ ZDV DFKLHYHG ZLWKLQ VHF )LJ SDQHO $f ,Q WKH DEVHQFH RI DGGHG PRO\EGDWH 0RG( ERXQG WR WKH VDPH '1$ DW D PXFK ORZHU UDWH DQG WKH WRWDO UHVSRQVH VLJQLI\LQJ WKH DPRXQW RI SURWHLQ ERXQG ZDV DOVR ORZHU +RZHYHU ERWK IRUPV RI SURWHLQ VKRZHG D FRQFHQWUDWLRQ UHVSRQVH WR DVVRFLDWLRQ ZLWK '1$ LQ WKH FXYHWWH 8SRQ UHPRYDO RI H[FHVV 0RG( WKH 0RG( ZLWKRXW PRO\EGDWH GLVVRFLDWHG IURP '1$ DW D KLJKHU UDWH WKDQ WKH VDPSOH ZLWK PRO\EGDWH 8VLQJ YDU\LQJ FRQFHQWUDWLRQV RI 0RG( SURWHLQ RYHU D VHULHV RI ELQGLQJ H[SHULPHQWV WKH DSSDUHQW .G IRU WKLV LQWHUDFWLRQ EHWZHHQ r0RG( DQG PRG$ RSHUDWRUSURPRWHU '1$ WR f ZDV FDOFXODWHG WR EH Q0 $Q DSSDUHQW RI Q0 ZDV REWDLQHG ZKHQ QDWLYH 0RG( ZDV XVHG LQ WKHVH H[SHULPHQWV 7KLV DSSDUHQW YDOXH LV VLPLODU WR WKH DSSDUHQW YDOXH UHSRUWHG IRU WUS UHSUHVVRU WUS RSHUDWRU '1$ LQWHUDFWLRQ f ,Q WKH DEVHQFH RI PRO\EGDWH WKLV DSSDUHQW YDOXH IRU WKH LQWHUDFWLRQ EHWZHHQ 0RG( DQG PRG$ RSHUDWRUSURPRWHU '1$ LQFUHDVHG WR Q0 :KHQ r0RG(7,f PXWDQW SURWHLQ ZDV XVHG LQ WKHVH H[SHULPHQWV QR VLJQLILFDQW GLIIHUHQFH ZDV REVHUYHG HLWKHU LQ WKH UDWH RI DVVRFLDWLRQ RU GLVVRFLDWLRQ RI WKH SURWHLQ

PAGE 88

7LPH VHFf 7LPH VHFf RR + = R WX RR 2 2K RR e )LJXUH 2SWLFDO %LRVHQVRU UHVSRQVH FXUYHV IRU 0RG( ELQGLQJ WR PRG$%&' RSHUDWRUSURPRWHU '1$ $ r0RG( SURWHLQ % r0RG(7,f 3URWHLQV ZHUH SUHVHQW DW D FRQFHQWUDWLRQ RI Q0 LQ WKH FXYHWWH 8SZDUG DUURZ LQGLFDWHV DGGLWLRQ RI 0RG( SURWHLQ DQG WKH GRZQ DUURZ GHQRWHV WKH WLPH ZKHQ WKH H[FHVV 0RG( ZDV UHPRYHG IURP WKH FXYHWWH WR PRQLWRU WKH GLVVRFLDWLRQ RI 0RG( IURP WKH '1$ 0RO\EGDWH ZKHQ LQFOXGHG ZDV SUHVHQW WKURXJKRXW WKH H[SHULPHQW DW D ILQDO FRQFHQWUDWLRQ RI P0 5HVSRQVH XQLWV DUH LQ DUFVHF

PAGE 89

ZLWK WKH '1$ ERWK LQ WKH SUHVHQFH DQG DEVHQFH RI PRO\EGDWH )LJ SDQHO %f 7KH DSSDUHQW .G IRU WKH LQWHUDFWLRQ EHWZHHQ r0RG(7,f DQG PRG$ RSHUDWRU '1$ ZDV Q0 LQ WKH SUHVHQFH RI PRO\EGDWH DQG Q0 LQ WKH DEVHQFH RI PRO\EGDWH 7KHVH YDOXHV DUH DERXW WLPHV KLJKHU WKDQ WKH YDOXHV REWDLQHG ZLWK QDWLYH 0RG(PRO\EGDWH EXW DERXW RQHKDOI RI WKH .G YDOXH REWDLQHG ZLWK 0RG( DORQH 7KH r0RG($9f SURWHLQ GLG QRW ELQG WR WKH '1$ DW D SURWHLQ FRQFHQWUDWLRQ DV KLJK DV Q0 HLWKHU ZLWK RU ZLWKRXW PRO\EGDWH GDWD QRW VKRZQf 7KLV LV LQ DJUHHPHQW ZLWK WKH REVHUYHG LQDELOLW\ RI WKLV PXWDQW IRUP RI WKH SURWHLQ WR DFWLYDWH K\FODF= WR UHSUHVV PRG$ODF= LQ YLYR f RU WR SURWHFW WKH PRG$ '1$ IURP FOHDYDJH E\ '1DVH )LJ f 7KH NLQHWLFV RI r0RG(4rf LQWHUDFWLRQ ZLWK '1$ ZDV IRXQG WR EH FRPSOH[ DQG WKH DSSDUHQW YDOXH IRU WKLV LQWHUDFWLRQ ZDV QRW GHWHUPLQHG ,W LV LQWHUHVWLQJ WR QRWH WKDW WKH FDOFXODWHG DSSDUHQW .G IRU r0RG(7,f LV DERXW Q0 ZKLOH WKDW RI QDWLYH 0RG( LV Q0 +RZHYHU LQ YLYR WKH 0RG(7,f VHUYHV DV D UHJXODWRU LQ WKH DEVHQFH RI PRO\EGDWH ZKLOH WKH QDWLYH 0RG( UHTXLUHV PRO\EGDWH IRU DFWLYLW\ 7KH UDWH RI GLVVRFLDWLRQ RI WKH WZR SURWHLQV IURP WKH '1$ ZDV DOVR IRXQG WR EH VLJQLILFDQWO\ GLIIHUHQW )LJ f ,W LV SRVVLEOH WKDW WKH 0RG(7,f XSRQ ELQGLQJ WR '1$ GLVVRFLDWHV IURP WKH '1$

PAGE 90

SURWHLQ FRPSOH[ DW D VLJQLILFDQWO\ ORZHU UDWH WKDQ WKH QDWLYH 0RG( IURP WKH SURWHLQ'1$ FRPSOH[ DFFRXQWLQJ IRU WKH GLIIHUHQFH LQ YLYR 6LPLODU VWXGLHV ZLWK WKH WUS UHSUHVVRU DQG D PXWDQW WUS VXSHUUHSUHVVRU f SURWHLQ DOVR VKRZ WKDW WKH VXSHUUHSUHVVRU PXWDQW IRUP KDV D IROG KLJKHU DIILQLW\ IRU WKH RSHUDWRU '1$ WKDQ WKH DSRUHSUHVVRU QDWLYH UHSUHVVRU ZLWKRXW HIIHFWRU PROHFXOH ERXQGf ,Q WKH SUHVHQFH RI WU\SWRSKDQ WKH QDWLYH WUS UHSUHVVRU KDG D IROG KLJKHU DIILQLW\ WR WKH RSHUDWRU '1$ WKDQ WKH VXSHUUHSUHVVRU IRUP 7KH GLIIHUHQFH ZDV DJDLQ IRXQG WR EH UHODWHG WR WKH UDWH RI GLVVRFLDWLRQ RI WKH UHSUHVVRU IURP WKH '1$SURWHLQ FRPSOH[ )OXRUHVFHQFH &KDUDFWHULVWLFV RI 0XWDQW 0RG( 3URWHLQV 7KH LQWULQVLF IOXRUHVFHQFH RI 0RG( SURWHLQ GHFUHDVHG XSRQ ELQGLQJ PRO\EGDWH DQG WKLV FRXOG EH D UHVXOW RI FRQIRUPDWLRQDO FKDQJH RI WKH SURWHLQ f 6LQFH WKH PXWDQW 0RG( SURWHLQV DUH PRO\EGDWHLQGHSHQGHQW LW LV SRVVLEOH WKDW WKH PXWDQW SURWHLQV VWUXFWXUDOO\ PLPLF WKH 0RG(PRO\EGDWH FRPSOH[ ,I WKLV LV LQGHHG WKH FDVH WKH LQWULQVLF IOXRUHVFHQFH RI WKH PXWDQW SURWHLQV VKRXOG EH FRPSDUDEOH WR WKH 0RG(PRO\EGDWH FRPSOH[ DQG VLJQLILFDQWO\ ORZHU WKDQ WKDW RI WKH 0RG( SURWHLQ :KHQ WKH r0RG( SURWHLQ ZDV H[FLWHG E\ LUUDGLDWLRQ DW QP WKH HPLVVLRQ VSHFWUXP KDG D SHDN DW QP DQG D VKRXOGHU DW QP )LJ f 7KH SHDN RI

PAGE 91

5HODWLYH )ORXUHVFHQFH )LJXUH )OXRUHVFHQFH HPLVVLRQ VSHFWUD RI 0RG( DQG PXWDQW 0RG( SURWHLQV ([FLWDWLRQ ZDYHOHQJWK ZDV Q0 5HODWLYH )ORXUHVFHQFH

PAGE 92

HPLVVLRQ VKLIWHG GRZQ WR QP LQ WKH SUHVHQFH RI PRO\EGDWH DQG WKH UHODWLYH IOXRUHVFHQFH ZDV DOVR UHGXFHG E\ DERXW b 7KHVH UHVXOWV DUH LQ DJUHHPHQW ZLWK WKDW RI $QGHUVRQ HW DO f IRU 0RG(LPRO\EGDWH 0RG( KDV WKUHH WU\SWRSKDQV SRVLWLRQV DQG f DQG WKH WU\SWRSKDQ DW LV ORFDWHG ZLWKLQ D VHTXHQFH PRWLI 76$514:)*f ZKLFK ZDV FRQVHUYHG LQ VHYHUDO 0RG( KRPRORJV IURP RWKHU RUJDQLVPV >76f6$514;;*@ DQG DOVR LQ D PRO\EGRSWHULQELQGLQJ SURWHLQ IURP &ORVWULGLXP SDVWHXULDQXP f DV ZHOO DV LQ WKH QLWUDWH VHQVRU SURWHLQ 1DU; IURP ( FROL f ,W LV SRVVLEOH WKDW PRO\EGDWHELQGLQJ WR 0RG( UHGXFHG WKH DFFHVVLELOLW\ RI WU\SWRSKDQ DW WR ZDWHU DQG LWV IOXRUHVFHQFH LV QRW UHDGLO\ REVHUYDEOH RU LV UDSLGO\ TXHQFKHG 6LQFH D PXWDWLRQ ZKLFK FKDQJHG WKH 7 WR DW f RU WR DW f LQ ( FROL 0RG( FRQYHUWHG WKH PXWDQW SURWHLQ WR EH PRO\EGDWHLQGHSHQGHQW f LW LV SRVVLEOH WKDW WKH FRQIRUPDWLRQ RI WKH PXWDQW SURWHLQ PLPLFV 0RG( PRO\EGDWH ,Q DJUHHPHQW ZLWK WKH SRVVLEOH FRQILUPDWLRQ FKDQJH WKH UHODWLYH IOXRUHVFHQFH RI 0RG(7,f ZDV DERXW WKH OHYHO RI r0RG(PRO\EGDWH FRPSOH[ DQG ZDV QRW DOWHUHG E\ PRO\EGDWH )LJ f 7KH SHDN RI HPLVVLRQ ZDV QP ZKLFK LV FORVHU WR WKH SHDN RI HPLVVLRQ RI 0RG(PRO\EGDWH QPf WKDQ WKDW RI 0RG( QPf 7KH LQWULQVLF IOXRUHVFHQFH RI WKH & WHUPLQDO GHOHWLRQ SURWHLQ 0RG(4rf ZDV RQO\ DERXW b RI

PAGE 93

0RG( DQG ZDV QRW DIIHFWHG E\ DGGLWLRQ RI PRO\EGDWH )LJ f ,W LV SRVVLEOH WKDW WKH GHOHWLRQ RI WKH ODVW DPLQR DFLGV SURIRXQGO\ DOWHUHG WKH VWUXFWXUH RI WKH SURWHLQ DQG LQ WKLV FRQIRUPDWLRQ RQO\ RQH RI WKH WKUHH WU\SWRSKDQV LV FRQWULEXWLQJ WR WKH IOXRUHVFHQFH RI WKH SURWHLQ 7KHVH UHVXOWV VKRZ WKDW WKH PRO\EGDWHLQGHSHQGHQW 0RG( PXWDQW SURWHLQV UHVHPEOH 0RG(PRO\EGDWH LQ LWV FRQIRUPDWLRQ 7KLV ORFNHGRQ FRQIRUPDWLRQ DOORZHG WKH SURWHLQ WR ELQG WR '1$ HYHQ LQ WKH DEVHQFH RI DGGHG PRO\EGDWH EXW WKLV FRQIRUPDWLRQ LV DSSDUHQWO\ QRW WKH VDPH DV WKDW RI 0RG(PRO\EGDWH VLQFH WKH DSSDUHQW IRU 0RG(7,f ZDV DERXW WLPHV KLJKHU WKDQ WKDW RI WKH QDWLYH 0RG(PRO\EGDWH 0RD$ 3URWHLQ LV D 5HTXLUHG 6HFRQG &RPSRQHQW LQ 0RO\EGDWH 'HSHQGHQW ([SUHVVLRQ RI K\F 2SHURQ (IIHFWV RI 0XWDWLRQV LQ *HQHV (QFRGLQJ 0*' %LRV\QWKHVLV PROf RQ ([SUHVVLRQ RI 3E\FODF= 9DULRXV ELRFKHPLFDO DQG JHQHWLF H[SHULPHQWV GHVFULEHG LQ WKH SUHYLRXV VHFWLRQV VKRZ WKDW 0RG(PRO\EGDWH LV D UHTXLUHG VHFRQG WUDQVFULSWLRQDO DFWLYDWRU RI K\F RSHURQ EXW LQ D PRG( PXWDQW ( FROL VWLOO SURGXFHG )+/ DFWLYLW\ $ERXW b RI SDUHQWDO OHYHO RI H[SUHVVLRQ RI 3K\FODF= LQ D PRG( PXWDQW ZKLFK LV PRO\EGDWHGHSHQGHQW 7DEOH f LQGLFDWHV WKH SUHVHQFH RI D VHFRQG PRO\EGDWHGHSHQGHQW DFWLYDWLRQ V\VWHP IRU K\F RSHURQ 7R LGHQWLI\ WKH SURWHLQ RU SURWHLQV UHVSRQVLEOH IRU WKLV 0RG(LQGHSHQGHQW

PAGE 94

PRO\EGDWHGHSHQGHQW WUDQVFULSWLRQ RI K\F RSHURQ LQLWLDO H[SHULPHQWV IRFXVHG RQ WKH UROH RI WKH SURGXFWV RI YDULRXV JHQHV LQ WKH 0*' ELRV\QWKHWLF SDWKZD\ LQ WKLV UHJXODWLRQ )RU WKHVH H[SHULPHQWV PXWDWLRQV LQ YDULRXV JHQHV HQFRGLQJ FRPSRQHQWV RI WKH ELRV\QWKHVLV RI 0*' ZHUH LQWURGXFHG LQWR VWUDLQ :6 DQG LWV PRG( GHULYDWLYH :6 JDODFWRVLGDVH DFWLYLWLHV SURGXFHG E\ WKHVH PXWDQW VWUDLQV ZHUH GHWHUPLQHG DQG WKH UHVXOWV DUH SUHVHQWHG LQ 7DEOH 6WUDLQ :6 SURGXFHG DERXW XQLWV RI JDODFWRVLGDVH DFWLYLW\ ZKHQ FXOWXUHG LQ /%* PHGLXP LPRO\EGDWH 0XWDWLRQV LQ PRD 6WUDLQ :6f DQG PRH% 6WUDLQ :6f KDG QR VLJQLILFDQW HIIHFW RQ WKH DPRXQW RI JDODFWRVLGDVH DFWLYLW\ SURGXFHG ZKHWKHU WKH FXOWXUHV ZHUH JURZQ LQ /%* RU /%* PRO\EGDWH 7DEOH f 0XWDWLRQV LQ PRH$% 6WUDLQ :6f DQG PRJ 6WUDLQ :6f UHGXFHG WKH DPRXQW RI JDODFWRVLGDVH DFWLYLW\ SURGXFHG E\ WKH VWUDLQV E\ DERXW b +RZHYHU D PXWDWLRQ LQ HLWKHU WKH PRE 6WUDLQ :6f RU PRH$ JHQH 6WUDLQ :6f VLJQLILFDQWO\ GHFUHDVHG WKH DPRXQW RI JDODFWRVLGDVH DFWLYLW\ SURGXFHG E\ WKH PXWDQWV WR DERXW b RI WKH SDUHQW OHYHO 7KH DGGLWLRQ RI PRO\EGDWH WR WKH JURZWK PHGLXP GLG QRW DOWHU WKH DPRXQW RI DFWLYLW\ SURGXFHG E\ DQ\ RI WKHVH PXWDQW VWUDLQV $PRQJ WKH GRXEOH PXWDQWV RQO\ WKH PRG( PRJ 6WUDLQ :6f DQG PRG( PRH$ 6WUDLQ :6f KDG D VLJQLILFDQW QHJDWLYH HIIHFW

PAGE 95

7DEOH (IIHFW RI PXWDWLRQ LQ WKH JHQHV FRGLQJ IRU SURWHLQV LQ 0*' ELRV\QWKHVLV RQ 0RG(LQGHSHQGHQW 3K\FODF= H[SUHVVLRQ 6WUDLQ 5HOHYDQW JHQRW\SH 6DDODFWRVLGDVH DFWLYLW\ /%* /%*0 :6 ZLOG W\SH :6 PRD :6 PRD% :6 PRH :6 PRJ :6 PRE :6 PRH$ :6 $PRG( :6 $PRG( PRD :6 $PRG( PRE :6 $PRG( PRJ :6 $PRG( PRH$ f f f f f f f f f f f f f f f f f f f f f f f f D JDODFWRVLGDVH DFWLYLW\ LV H[SUHVVHG DV QDQRPROHV fPLQnPLOOLJUDP RI FHOO SURWHLQn 9DOXHV LQ SDUHQWKHVHV UHSUHVHQW b RI DFWLYLW\ SURGXFHG E\ WKH PXWDQW VWUDLQ DV FRPSDUHG WR WKH ZLOG W\SH VWUDLQ :6

PAGE 96

RQ 3K\FODF= H[SUHVVLRQ LQ FRPSDULVRQ WR WKH FRUUHVSRQGLQJ LVRJHQLF PRG( PXWDQW VWUDLQ :6 $PRQJ WKH WZR PRG( PRH$ GRXEOH PXWDQW GLG QRW H[SUHVV 3K\FODF= RU SURGXFH )+/ DFWLYLW\ 7KHVH UHVXOWV VXJJHVW WKDW WKH SURGXFW RI PRH$ JHQH LV UHTXLUHG IRU WKH 0RG(LQGHSHQGHQW DFWLYDWLRQ RI K\F WUDQVFULSWLRQ DQG WKH SURGXFW RI PRJ DOVR KDV D UROH LQ WKLV UHJXODWLRQ 7KH SURGXFW RI PRH$ JHQH 0RH$ SURWHLQf KDV EHHQ SURSRVHG WR EH LQYROYHG LQ DFWLYDWLRQ RI PRO\EGDWH XSRQ HQWU\ LQWR WKH FHOO f 0XWDWLRQ LQ PRH$ FDQ EH VXSSUHVVHG E\ HLWKHU DGGLWLRQ RI VXOILGH WR WKH FXOWXUH PHGLXP RU JURZWK RI WKH FXOWXUH XQGHU OLPLWLQJVXOIXU FRQGLWLRQV *URZWK XQGHU OLPLWLQJVXOIXU FRQGLWLRQV LQFUHDVHV WKH H[SUHVVLRQ RI JHQHV LQYROYHG LQ WKH ELRV\QWKHVLV RI F\VWHLQH ZKLFK FDQ SURGXFH VXOILGH LQWHUQDOO\ f +RZHYHU VWUDLQ :6 ZKHQ JURZQ LQ WKH SUHVHQFH RI VXOILGH RU LQ ORZVXOIXU PHGLXP GLG QRW SURGXFH )+/ DFWLYLW\ RU JDODFWRVLGDVH DFWLYLW\ 7KLV LQGLFDWHV WKDW VXOILGH FDQ RQO\ VXSSUHVV WKH QHHG IRU 0RH$ LQ 0*' ELRV\QWKHVLV DQG QRW IRU LWV UROH LQ K\F H[SUHVVLRQ ,Q VWUDLQ :6 PRH$ DORQHf WKH SUHVHQFH RI 0RG(PRO\EGDWH DOORZV WUDQVFULSWLRQ RI K\F RSHURQ DOWKRXJK DW D ORZHU OHYHO DQG XOWLPDWHO\ WR )+/ DFWLYLW\ LQ WKH SUHVHQFH RI VXOILGH

PAGE 97

7KH SURSRVHG UROH RI WKH SURGXFW RI PRJ LV LQ LQVHUWLRQ RI PRO\EGHQXP LQWR WKH SWHULQ SRUWLRQ RI WKH 0*' FRIDFWRU f 6WUDLQV FDUU\LQJ PXWDWLRQV LQ ERWK PRG( DQG PRJ GLG SURGXFH )+/ DFWLYLW\ DW D ORZHU OHYHO WKDQ WKDW RI WKH UHVSHFWLYH SDUHQW VWUDLQV 6LQFH QHLWKHU WKH 0RH$ QRU WKH 0RJ SURWHLQ KDV EHHQ FKDUDFWHUL]HG ELRFKHPLFDOO\ WKH SRVVLELOLW\ UHPDLQV WKDW WKHVH SURWHLQV DFW LQ FRQFHUW LQ WKH SURGXFWLRQ RI D VPDOO PROHFXOH HIIHFWRU ZKLFK LV UHTXLUHG IRU K\F WUDQVFULSWLRQ $QDO\VLV RI WKH DPLQR DFLG VHTXHQFH RI 0RH$ SURWHLQ GLG QRW UHYHDO DQ\ REYLRXV '1$ELQGLQJ GRPDLQV WR VXJJHVW WKDW WKLV SURWHLQ LV D WUDQVFULSWLRQDO DFWLYDWRU )URP JHQHWLF VWXGLHV UHSRUWHG SUHYLRXVO\ f LW LV UHDVRQDEOH WR FRQFOXGH WKDW WKH SURGXFW RI 0RH$ LV D VPDOO PROHFXOH HIIHFWRU ZKLFK LV UHTXLUHG IRU WUDQVFULSWLRQ *LYHQ WKH SUHVHQW NQRZOHGJH RI WKH DFWLYDWLRQ RI WUDQVFULSWLRQ RI K\F RSHURQ DW WKH WLPH RI WKHVH VWXGLHV LW LV WHPSWLQJ WR VSHFXODWH WKDW WKLV VPDOO PROHFXOH HIIHFWRU SURGXFW RI 0RH$f LV LQWHUDFWLQJ ZLWK DQRWKHU WUDQVFULSWLRQDO DFWLYDWRU SRVVLEO\ WKH )KO$ SURWHLQ 0RH$GHSHQGHQW WUDQVFULSWLRQ RI K\F RSHURQ LV VHQVLWLYH WR WXQJVWDWH 7XQJVWDWH DQ DQDORJ RI PRO\EGDWH KDV EHHQ VKRZQ ERWK LQ YLYR DQG LQ YLWUR WR LQWHUDFW ZLWK 0RG( SURWHLQ WR UHSUHVV WUDQVFULSWLRQ RI PRG$%&' RSHURQ f 7XQJVWDWH

PAGE 98

DOVR UHGXFHG WKH H[WHQW RI IOXRUHVFHQFH HPLVVLRQ RI 0RG( SURWHLQ LQ D PDQQHU VLPLODU WR WKDW RI PRO\EGDWH f ,Q DGGLWLRQ WXQJVWDWH DOVR ERXQG WR WKH SHULSODVPLF 0RG$ SURWHLQ f VXJJHVWLQJ WKDW WXQJVWDWH FDQ VXEVWLWXWH IRU PRO\EGDWH ERWK LQ YLYR DQG LQ YLWUR 6LQFH 0RG( LV DQ DFWLYDWRU RI K\F RSHURQ WKH SRVVLELOLW\ WKDW WXQJVWDWH FRXOG VXEVWLWXWH IRU PRO\EGDWH DV DQ HIIHFWRU IRU WKH 0RG( SURWHLQ LQ WKLV DFWLYDWLRQ DV ZHOO DV RQ 0RH$GHSHQGHQW H[SUHVVLRQ RI K\F ZDV LQYHVWLJDWHG 5HVXOWV RI WKHVH H[SHULPHQWV DUH VXPPDUL]HG LQ 7DEOH $GGLWLRQ RI WXQJVWDWH WR WKH JURZWK PHGLXP KDG QR HIIHFW RQ WKH H[SUHVVLRQ RI 3E\FODF= LQ D ZLOG W\SH VWUDLQ :6 DV H[SHFWHG 7KH QDWLYH PRO\EGDWH WUDQVSRUW V\VWHP KDV D KLJKHU DIILQLW\ IRU PRO\EGDWH RYHU WXQJVWDWH DQG LQ D ZLOG W\SH PRO\EGDWH DSSDUHQWO\ FRPSHWHV HIIHFWLYHO\ ZLWK WXQJVWDWH 7XQJVWDWH KDG RQO\ D PLQLPDO HIIHFW RQ K\FODF= H[SUHVVLRQ LQ D PRG% PXWDQW VWUDLQ :6 b RI WKH SDUHQW OHYHOf ZKLFK ODFNV WKH DELOLW\ WR WUDQVSRUW WUDFH DPRXQWV RI PRO\EGDWH SUHVHQW LQ WKH PHGLXP VXJJHVWLQJ WKDW WXQJVWDWH FDQ HIIHFWLYHO\ UHSODFH PRO\EGDWH IRU K\F DFWLYDWLRQ +RZHYHU LQ WKH DEVHQFH RI 0RG( SURWHLQ PRG( PXWDQW VWUDLQ :6f WXQJVWDWH IDLOHG WR VXSSRUW DFWLYDWLRQ RI K\FODF= RQO\ b RI WKH PRG(r SDUHQW OHYHO RI S JDODFWRVLGDVH DFWLYLW\f ,Q D PRG( PRG% GRXEOH PXWDQW

PAGE 99

7DEOH ,QDELOLW\ RI 7XQJVWDWH WR VXEVWLWXWH IRU 0RO\EGDWH LQ 0RH$GHSHQGHQW H[SUHVVLRQ RI K\F RSHURQ 6WUDLQ 5HOHYDQW JHQRW\SH /%* %DDODFWRVLGDVH DFWLYLW\ /%*0 /%*: :6 ZLOG W\SH f f f :6 PRG% f f f :6 PRG( f f f :6 PRG( PRG% f f f :6 PRG( PRH$ f f f :6 PRH$ f f f D SJDODFWRVLGDVH DFWLYLW\ LV H[SUHVVHG DV QDQRPROHVnPLQBPLOOLJUDP RI FHOO SURWHLQ 9DOXHV LQ SDUHQWKHVHV UHSUHVHQW b RI DFWLYLW\ SURGXFHG E\ WKH PXWDQW VWUDLQ DV FRPSDUHG WR WKH ZLOG W\SH VWUDLQ :6 JURZQ LQ WKH VDPH PHGLXP

PAGE 100

VWUDLQ :6f ZKLFK FDQQRW WUDQVSRUW WKH WUDFH OHYHOV RI PRO\EGDWH LQ WKH PHGLXP H[SUHVVLRQ RI K\FODF ZDV VWULFWO\ GHSHQGHQW RQ H[WHUQDOO\ DGGHG PRO\EGDWH DQG WXQJVWDWH IDLOHG WR UHSODFH PRO\EGDWH 7KLV ODFN RI H[SUHVVLRQ RI K\FODF= LQ WKH SUHVHQFH RI WXQJVWDWH LQ VWUDLQ :6 LV DSSDUHQWO\ QRW GXH WR FRPSHWLWLRQ EHWZHHQ PRO\EGDWH DQG WXQJVWDWH LQ WKH WUDQVSRUW RI PRO\EGDWH $V H[SHFWHG DGGLWLRQ RI WXQJVWDWH WR WKH FXOWXUH PHGLXP RI PRH$ PRG( GRXEOH PXWDQW VWUDLQ :6 GLG QRW UHVWRUH H[SUHVVLRQ RI K\F RSHURQ 7KHVH UHVXOWV VKRZ WKDW 0RG(LQGHSHQGHQW H[SUHVVLRQ RI K\F ODF= 0RH$GHSHQGHQWf LV VWULFWO\ PRO\EGDWHGHSHQGHQW DQG WXQJVWDWH FDQ QRW UHSODFH LW +RZHYHU 0RG( FDQ XWLOL]H HLWKHU PRO\EGDWH RU WXQJVWDWH DV DQ HIIHFWRU LQ DFWLYDWLRQ RI K\F RSHURQ 6WUDLQ :6 7DEOH f )KO$ 0XWDQW 3URWHLQV :KLFK $OORZ ([SUHVVLRQ RI K\F 2SHURQ LQ WKH $EVHQFH RI 0RO\EGDWH )KO$ SURWHLQ LV DOVR D 0RO\EGDWH6HQVRU 6LQFH WKH WUDQVFULSWLRQ RI IKO$ JHQH LV LQGHSHQGHQW RI PRO\EGDWH OHYHOV LQ WKH FHOO 7DEOH f DQG WUDQVFULSWLRQ RI K\F RSHURQ LQ D PRG( PXWDQW VWLOO UHTXLUHV PRO\EGDWH PXWDQWV RI VWUDLQ 6( >;! K\F'ODF=f $ PRG $HEJ@ ZHUH VRXJKW WR LGHQWLI\ WKH VHFRQG PRO\EGDWHVHQVRU QHHGHG IRU WUDQVFULSWLRQ RI K\F RSHURQ 6SRQWDQHRXV PXWDQWV RI VWUDLQ 6( ZKLFK QR ORQJHU UHTXLUHG PRO\EGDWH IRU WUDQVFULSWLRQ

PAGE 101

RI K\F RSHURQ ZHUH LVRODWHG DV FORQHV SURGXFLQJ e JDODFWRVLGDVH DFWLYLW\ LQ WKH DEVHQFH RI DGGHG PRO\EGDWH LQ ODFWRVH0DF&RQNH\ PHGLXP 7KH DSSUR[LPDWH ORFDWLRQ RI WKH PXWDWLRQ LQ WKHVH PXWDQWV ZDV GHWHUPLQHG E\ 3OPHGLDWHG WUDQVGXFWLRQ DQDO\VLV DQG WKH PXWDWLRQ ZDV ORFDWHG LQ RU QHDU WKH IKO$ JHQH 7KHVH UHVXOWV SRLQW WR WKH )KO$ SURWHLQ DV D SRVVLEOH PRO\EGDWHVHQVRU IRU WKH WUDQVFULSWLRQ RI K\F RSHURQ 6LQFH WKHVH PXWDQWV ZHUH XQVWDEOH DGGLWLRQDO PXWDQWV ZHUH LVRODWHG E\ WDUJHWLQJ WKH IKO$ JHQH GLUHFWO\ $IWHU K\GUR[\ODPLQH PXWDJHQHVLV RI SODVPLG S:6 WZR VWDEOH IKO$ PXWDQW DOOHOHV IKO$ DQG IKO$ ZHUH VHOHFWHG EDVHG RQ WKHLU DELOLW\ WR DFWLYDWH WUDQVFULSWLRQ RI 3E\FODF= LQ WKH DEVHQFH RI DGGHG PRO\EGDWH LQ D PRG PXWDQW EDFNJURXQG 6HTXHQFLQJ WKH HQWLUH IKO$ JHQH IURP WKHVH WZR PXWDQWV UHYHDOHG WKDW WKH )KO$ SURWHLQV SURGXFHG E\ WKH DOWHUHG SODVPLGV FRQWDLQHG WZR PXWDWLRQV IKO$ (. DQG 36 DQG IKO$ $7 DQG (. )LJ f %RWK PXWDQW )KO$ SURWHLQV FDUULHG D PXWDWLRQ LQ WKH 1WHUPLQDO GRPDLQ XQLTXH WR )KO$f DQG D PXWDWLRQ HLWKHU LQ WKH FHQWUDO UHJLRQ QHDU WKH SURSRVHG QXFOHRWLGHELQGLQJ VLWHf RU DW WKH & WHUPLQDO HQG RI WKH 1WHUPLQDO HIIHFWRU ELQGLQJ GRPDLQ $WWHPSWV WR VHSDUDWH WKH WZR PXWDWLRQV E\ VXEFORQLQJ WKH '1$ ZKLOH VWLOO UHWDLQLQJ WKH PRO\EGDWHLQGHSHQGHQW SKHQRW\SH ZHUH XQVXFFHVVIXO VXJJHVWLQJ WKDW ERWK PXWDWLRQV DUH QHHGHG

PAGE 102

$OOHOH 0XWDWLRQ :W F QRQH (. F 36 1 $7 L ( ‘. + ‘ P? 5& ‘ IHfn""+ L]]VD L 1 $7 ). (. F $7 5& (. F $7 (0, 6HTXHQFH PRWLI IRU $73 5LQGLQJ +7+ PRWLI '0$ %LQGLQJ GRPDLQf )LJXUH /RFDWLRQ RI PXWDWLRQVf LQ IKO$ PXWDQW DOOHOHV /LQHV UHSUHVHQW DPLQR DFLG VHTXHQFH RI QDWLYH )KO$ DQG FRUUHVSRQGLQJ )KO$ PXWDQWV

PAGE 103

IRU WKH REVHUYHG SKHQRW\SH ,VRODWLRQ RI WKHVH PXWDQWV LQGLFDWHG WKDW DPLQR DFLG FKDQJHV LQ WKH )KO$ SURWHLQ FDQ OHDG WR PRO\EGDWHLQGHSHQGHQW WUDQVFULSWLRQ RI 3K\FODF= 6LQFH WKH WZR PXWDWLRQV LQ )KO$ ZKLFK DOWHUHG WKH GHSHQGHQFH RQ PRO\EGDWH IRU WUDQVFULSWLRQ RI K\F RSHURQ PDSSHG LQ ERWK WKH FHQWUDO DQG 1WHUPLQDO GRPDLQV WKH DPLQR DFLG VHTXHQFH IRU WKHVH UHJLRQV ZDV DQDO\]HG IRU DQ\ PRWLI ZKLFK FRUUHVSRQGV WR WKH SXWDWLYH PRO\EGDWHELQGLQJ PRWLI 6$514 FRQVHUYHG EHWZHHQ 0RG( SURWHLQ LQ ( FROL DQG VLPLODU SURWHLQV LQ RWKHU RUJDQLVPV f :LWKLQ WKH FHQWUDO GRPDLQ RI )KO$ WKH DPLQR DFLG VHTXHQFH 6*511 SRVLWLRQV f ZDV REVHUYHG VXJJHVWLQJ WKDW WKLV UHJLRQ PLJKW EH LPSRUWDQW LQ )KO$PRO\EGHQXP LQWHUDFWLRQ 7R WDUJHW WKLV UHJLRQ PRUH FORVHO\ WKH FHQWUDO UHJLRQ RI WKH IKO$ ZDV PXWDWHG E\ 3&5 DPSOLILFDWLRQ WHFKQLTXHV $IWHU DPSOLILFDWLRQ WKH NE (DUO3VW, IUDJPHQW FDUU\LQJ UDQGRP PXWDWLRQV LQWURGXFHG E\ D WKHUPRVWDEOH '1$ 3RO\PHUDVHf RI WKH FHQWUDO UHJLRQ RI WKH IKO$ JHQH ZDV XVHG WR UHSODFH WKH ZLOG W\SH (DUO3VW, IUDJPHQW LQ SODVPLG S:6 6WUDLQ :6 ZDV XVHG WR VHOHFW IKO$ '1$ IURP WKLV SRRO FRGLQJ IRU )KO$ SURWHLQ ZKLFK DOORZHG SURGXFWLRQ RI S JDODFWRVLGDVH DFWLYLW\ LQ WKH DEVHQFH RI PRO\EGDWH 7ZR )KO$ PXWDQWV IKO$ DQG IKO$f ZHUH LVRODWHG DQG FKDUDFWHUL]HG )LJ f '1$ VHTXHQFH IRU ERWK DOOHOHV ZDV

PAGE 104

GHWHUPLQHG DQG D VLQJOH PXWDWLRQ ZDV IRXQG LQ IKO$ ZKLFK UHVXOWHG LQ D FKDQJH IURP DUJLQLQH WR F\VWHLQH LQ DPLQR DFLG 0XWDQW DOOHOH IKO$ FRQWDLQHG WZR PXWDWLRQV $7(.f ZKLFK FRUUHVSRQGHG WR WKH VDPH WZR PXWDWLRQV LQ WKH IKO$ DOOHOH LVRODWHG DIWHU K\GUR[\ODPLQH PXWDJHQHVLV RI SODVPLG S:6 $FWLYDWLRQ RI 3K\FODF= WUDQVFULSWLRQ ZDV DQDO\]HG LQ WKH SUHVHQFH RI WKHVH PXWDQW SURWHLQV DQG WKHVH UHVXOWV DUH SUHVHQWHG LQ 7DEOH 6WUDLQ :6 PRGf FDUU\LQJ WKH IKO$ DOOHOH >:6S:6f@ SURGXFHG RQO\ XQLWV RI SJDODFWRVLGDVH DFWLYLW\ ZKHQ JURZQ LQ /%* PHGLXP 7KLV OHYHO RI DFWLYLW\ ZKLFK ZDV RQO\ DERXW b RI WKH DFWLYLW\ RI VWUDLQ :6 ZLWK IKO$? ZDV QRW LQIOXHQFHG E\ LQFOXGLQJ IRUPDWH RU PRO\EGDWH LQ WKH JURZWK PHGLXP 7DEOH f ,Q FRPSDULVRQ VWUDLQ :6S:6f ZLWK WKH IKO$r JHQH UHVSRQGHG SRVLWLYHO\ WR DGGLWLRQ RI IRUPDWH WR WKH JURZWK PHGLXP ZKLFK LV LQ DJUHHPHQW ZLWK SUHYLRXVO\ SXEOLVKHG VWXGLHV f $ PRO\EGDWH WUDQVSRUW PXWDQW VWUDLQ :6S:6f SURGXFHG DERXW WKH VDPH OHYHO RI SJDODFWRVLGDVH DFWLYLW\ DV WKH PRG VWUDLQ :6S:6f ZKHQ JURZQ LQ /%* PHGLXP 7DEOH f 7KLV LV LQ FRQWUDVW WR WKH VLJQLILFDQW GURS LQ DFWLYLW\ REVHUYHG ZLWK WKH PRG GHOHWLRQ VWUDLQ FDUU\LQJ WKH IKO$r JHQH XQLWV YV XQLWV IRU VWUDLQV :6 DQG :6 ZLWK SODVPLGV S:6 DQG S:6 UHVSHFWLYHO\f

PAGE 105

7DEOH 5HJXODWLRQ RI 3K\FODF= E\ )KO$ PXWDQW SURWHLQV 6WUDLQ 5HOHYDQW JHQRW\SH %DDODFWRVLGDVH DFWLYLW\r /%* /%*0 /%*) /%*)0 :6S:6f PRG :6S:6f $PRG :6S:6f $ PRG SIO :6S:6f PRG :6S:6f $PRG :6S:6f $PRG SIO :6S:6f PRFI :6S:6f $PRG :6S:6f $PRG SIO $OO VWUDLQV FDUU\ 3K\FODF= YLD $:6 DQG D GHOHWLRQ RI WKH VUOIKO$ UHJLRQ E SJDODFWRVLGDVH DFWLYLW\ LV H[SUHVVHG DV QDQRPROHV fPLQ fPLOOLJUDP RI FHOO SURWHLQ

PAGE 106

6XSSOHPHQWLQJ WKH JURZWK PHGLXP ZLWK KLJKHU FRQFHQWUDWLRQ RI HLWKHU IRUPDWH RU PRO\EGDWH P0f GLG VOLJKWO\ LQFUHDVH WKH DPRXQW RI SJDODFWRVLGDVH DFWLYLW\ SURGXFHG E\ VWUDLQ :6S:6f ,Q RUGHU WR DVFHUWDLQ LI WKLV LQFUHDVH LV GXH WR IRUPDWH RU PRO\EGDWH D PRG SIO GRXEOH PXWDQW ZKLFK ZDV FRPSOHWHO\ GHSHQGHQW RQ H[WHUQDOO\ DGGHG IRUPDWH DQG PRO\EGDWH ZDV XVHG LQ WKH QH[W H[SHULPHQW 6WUDLQ :6 ^SIO PRGf ZLWK HLWKHU WKH ZLOG W\SH RU PXWDQW )KO$ SURWHLQ UHVSRQGHG WR IRUPDWH HTXDOO\ 7DEOH f 7KH XQLWV RI a JDODFWRVLGDVH DFWLYLW\ SURGXFHG E\ VWUDLQ :6S:6f JURZLQJ LQ /%*) PHGLXP ZDV LQFUHDVHG WR XQLWV ZKHQ PRO\EGDWH ZDV DOVR LQFOXGHG LQ WKH PHGLXP 7KLV PRO\EGDWH GHSHQGHQW LQFUHDVH ZDV QRW REVHUYHG ZLWK VWUDLQ :6S:6f 6LQFH WKH )KO$ SURWHLQ LV WKH WUDQVFULSWLRQDO DFWLYDWRU RI K\F RSHURQ LW LV SRVVLEOH WKDW WKLV ODFN RI UHVSRQVH WR PRO\EGDWH E\ VWUDLQV ZLWK WKH )KO$ SURWHLQ LV GXH WR WKH LQDELOLW\ RI WKLV PXWDQW IRUP RI WKH SURWHLQ WR LQWHUDFW ZLWK PRO\EGHQXP +RZHYHU WKLV DOWHUHG )KO$ FDQ VWLOO DFWLYDWH WUDQVFULSWLRQ RI K\F RSHURQ HYHQ LQ WKH DEVHQFH RI PRO\EGDWH 6WUDLQ :6S:6f SURGXFHG DERXW WKH VDPH DPRXQW RI SJDODFWRVLGDVH DFWLYLW\ DERXW XQLWVf ZKHQ FXOWXUHG LQ GLIIHUHQW PHGLD XVHG LQ WKLV VWXG\ 7KLV OHYHO RI DFWLYLW\ LV VLJQLILFDQWO\ KLJKHU WKDQ WKH DPRXQW SURGXFHG LQ WKH

PAGE 107

SUHVHQFH RI WKH ZLOG W\SH IKO$ (YHQ LQ D PRG GHOHWLRQ VWUDLQ :6f WKH )KO$ SURWHLQ VXSSRUWHG SURGXFWLRQ RI WKH VDPH KLJK OHYHOV RI JDODFWRVLGDVH DFWLYLW\ DV ORQJ DV IRUPDWH ZDV SURGXFHG LQWHUQDOO\ :KHQ WKH DELOLW\ WR SURGXFH IRUPDWH ZDV LPSDLUHG E\ WKH SIO PXWDWLRQ VWUDLQ :6 S:6f SURGXFHG RQO\ DERXW b RI WKH -JDODFWRVLGDVH DFWLYLW\ FRPSDUHG WR WKH SIO PRG PXWDQW VWUDLQ :6S:6f ZKHQ JURZQ LQ /%* PHGLXP +RZHYHU WKLV OHYHO RI XQLWV LV VWLOO WLPHV KLJKHU WKDQ WKH DPRXQW SURGXFHG E\ WKH SIO PRG GRXEOH PXWDQW ZLWK SODVPLG S:6 FRGLQJ IRU QDWLYH )KO$ SURWHLQ ,Q WKH SUHVHQFH RI )KO$ SURWHLQ WKH HIIHFW RI IRUPDWH DQG PRO\EGDWH ZDV DGGLWLYH 7KH GLIIHUHQWLDO HIIHFW RI PRO\EGDWH LQ WKH SUHVHQFH RI )KO$ SURWHLQ LQ WKH WZR VWUDLQV :6S:6f DQG :6S:6f VXJJHVWV WKDW H[WHUQDOO\ DGGHG IRUPDWH IDLOHG WR VDWXUDWH WKH LQWHUQDO IRUPDWH SRROV IRU HIIHFWLYH DFWLYDWLRQ RI )KO$ SURWHLQ DQG DSSDUHQWO\ PRO\EGDWH FDQ VXEVWLWXWH IRU IRUPDWH DOWKRXJK SDUWLDOO\ LQ PD[LPL]LQJ K\F DFWLYDWLRQ E\ )KO$ SURWHLQ 0XWDQW )KO$ 3URWHLQV $FWLYDWH 7UDQVFULSWLRQ RI 3E\WODF= LQ D PRG(PRH$ 'RXEOH 0XWDQW *LYHQ WKDW DQ DFWLYDWHG IRUP RI PRO\EGDWH LV D SRVVLEOH HIIHFWRU IRU 0RG(LQGHSHQGHQW WUDQVFULSWLRQ RI K\F RSHURQ PXWDQW )KO$ SURWHLQV ZKLFK DFWLYDWHG WUDQVFULSWLRQ RI 3K\FODF= LQ WKH DEVHQFH RI PRO\EGHQXP 7DEOH f ZHUH

PAGE 108

LQWURGXFHG LQWR D VWUDLQ FDUU\LQJ PXWDWLRQV LQ ERWK PRG( DQG PRH$ 6WUDLQ :6f 7KH OHYHOV RI JDODFWRVLGDVH DFWLYLW\ SURGXFHG E\ HDFK RI WKHVH VWUDLQV ZDV GHWHUPLQHG DQG WKH UHVXOWV DUH VXPPDUL]HG LQ 7DEOH 6WUDLQ :6S:6f LQ ZKLFK ZLOG W\SH IKO$ JHQH ZDV FDUULHG E\ SODVPLG S:6 SURGXFHG D PHDVXUDEOH OHYHO RI DERXW XQLWV RI JDODFWRVLGDVH DFWLYLW\ ZKHQ FXOWXUHG LQ /%* PHGLXP DQG WKH DGGLWLRQ RI PRO\EGDWH KDG QR HIIHFW RQ WKLV OHYHO 7DEOH f 6WUDLQ :6S:6f SURGXFHG VLJQLILFDQWO\ KLJKHU DPRXQW RI JDODFWRVLGDVH DFWLYLW\ XQLWV 7DEOH f DQG WKLV OHYHO RI DFWLYLW\ LV DERXW b RI WKH DFWLYLW\ RI ZLOG W\SH VWUDLQ :6S:6f 7KH PXWDWLRQ LQ )KO$ SURWHLQ DOORZHG DFWLYDWLRQ RI WUDQVFULSWLRQ LQ WKH DEVHQFH RI ERWK 0RG( DQG 0RH$ SURWHLQV EXW RQO\ WR D OLPLWHG H[WHQW 6WUDLQ :6S:6f SURGXFHG DERXW XQLWV RI JDODFWRVLGDVH DFWLYLW\ ZKHWKHU FXOWXUHG LQ /%* RU /%*0 DQG WKLV DFWLYLW\ LV DOPRVW WZLFH WKH OHYHO RI DFWLYLW\ SURGXFHG E\ WKH ZLOG W\SH ZLWK QDWLYH )KO$ SURWHLQ ^VWUDLQ :6S:6f` 7KHVH UHVXOWV VKRZ WKDW WKH 0RG( PRO\EGDWH FRPSOH[ LV QR ORQJHU QHHGHG WR RU DEOH WR HQKDQFH WKH DFWLYDWLRQ RI WUDQVFULSWLRQ RI K\F RSHURQ LQ WKH SUHVHQFH RI WKH )KO$ PXWDQW SURWHLQV 7KHVH UHVXOWV IXUWKHU LQGLFDWH WKDW FHUWDLQ PXWDWLRQV LQ )KO$ PD\ UHSODFH WKH QHHG IRU 0RH$ SURWHLQ LQ WKH DFWLYDWLRQ RI WUDQVFULSWLRQ RI K\F

PAGE 109

7DEOH 6XSSUHVVLRQ RI WKH HIIHFW RI PRG( DQG PRH$ PXWDWLRQV RQ K\F H[SUHVVLRQ E\ )KO$ PXWDQW SURWHLQV 6WUDLQ 5HOHYDQW JHQRW\SH TDODFWRVLGDVH DFWLYLWYE /%* /%*0 :6 $ PRG( PRH$ :6S:6f $PRG( PRH$ SIKO$nf :6S:6f $PRG( PRH$ S IKO$f :6S:6f $PRG( PRH$ SIKO$f :6S:6f ZLOG W\SH S IKO$rf $OO VWUDLQV FDUU\ 3K\FODF= YLD ƒ:6 DQG D GHOHWLRQ RI WKH VUOIKO$ UHJLRQ E SJDODFWRVLGDVH DFWLYLW\ LV H[SUHVVHG DV QDQRPROHVr PLQn PLOOLJUDP RI FHOO SURWHLQn

PAGE 110

RSHURQ ,W LV SRVVLEOH WKDW WKH 0RH$FDWDO\]HG SURGXFW DFWLYDWHG PRO\EGHQXP LQWHUDFWV ZLWK )KO$ DQG WKH PXWDQW )KO$ SURWHLQV PLPLF WKLV FRQIRUPDWLRQ RI )KO$>0R@ FRPSOH[ $OWHUQDWLYHO\ DQRWKHU SURWHLQ ZKLFK KDV \HW WR EH LGHQWLILHG LQWHUDFWV ZLWK WKH SURGXFW RI 0RH$ SURWHLQ DQG DFW SRVLWLYHO\ LQ WKH DFWLYDWLRQ RI K\F WUDQVFULSWLRQ $GGLWLRQDO ELRFKHPLFDO H[SHULPHQWV LQYROYLQJ WKH 0RH$ SURWHLQ DQG )KO$ SURWHLQ DUH QHHGHG WR GLVWLQJXLVK EHWZHHQ WKHVH WZR SRVVLELOLWLHV &KDUDFWHUL]DWLRQ RI DQ (IIHFWRU,QGHSHQGHQW 0XWDQW )KO$ 3URWHLQ )KO$ 'HOHWLRQ RI 1WHUPLQDO 'RPDLQ RI )KO$ &UHDWHV D &RQVWLWXWLYH $FWLYDWRU $PRQJ WKH PHPEHUV RI WKH 1WU& IDPLO\ RI DFWLYDWRUV )KO$ LV RQH RI WKH ODUJHVW SURWHLQV ZLWK DPLQR DFLGV f >e FROL 1WU& DPLQR DFLGV f SQHXPRQLDH 1LI$ DPLQR DFLGV f@ VHFRQG RQO\ WR WKH /HY5 SURWHLQ f 7KH 1WHUPLQDO DPLQR DFLGV RI WKH )KO$ SURWHLQ DUH XQLTXH DQG SUREDEO\ LV LQYROYHG LQ LQWHUDFWLRQ ZLWK IRUPDWH DQG PRO\EGHQXP VLQFH PRO\EGDWH LQGHSHQGHQW DQG IRUPDWHLQGHSHQGHQW )KO$ SURWHLQV KDYH PXWDWLRQV LQ WKLV UHJLRQ )KO$ DOVR UHI f 7KHVH FKDUDFWHULVWLFV RI WKH )KO$ SURWHLQ UDLVHG WKH SRVVLELOLW\ WKDW GHOHWLQJ WKLV XQLTXH DPLQR DFLG UHJLRQ PD\ SURGXFH DQ HIIHFWRULQGHSHQGHQW DFWLYDWRU SURWHLQ $PRQJ WKH

PAGE 111

VHYHUDO GHOHWLRQ GHULYDWLYHV RI IKO$ WKUHH PXWDQWV ZHUH LVRODWHG IRU IXUWKHU VWXG\ 7KH )KO$ SURWHLQ SURGXFHG E\ WKH GHOHWLRQV IKO$ $ /9 )LJ f DQG IKO$ $ )LJ f VXSSRUWHG SURGXFWLRQ RI RQO\ ORZ OHYHOV RI 3K\FODF=EDVHG SJDODFWRVLGDVH DFWLYLW\ 7KHVH WZR PXWDQWV ZHUH QRW LQYHVWLJDWHG IXUWKHU 7KH WKLUG PXWDWLRQ IKO$ LV D GHOHWLRQ ZKLFK UHPRYHG WKH HQWLUH 1WHUPLQDO XQLTXH UHJLRQ )LJ f DQG WKH WUXQFDWHG )KO$ SURWHLQ SURGXFHG E\ WKH IKO$ ZDV DEOH WR DFWLYDWH 3K\FODF= WR YHU\ KLJK OHYHOV LQ ERWK ZLOG W\SH VWUDLQ DQG PRG% PXWDQW VWUDLQ 7DEOH f (YHQ LQ D PRG SIO GRXEOH PXWDQW WKH OHYHOV RI _JDODFWRVLGDVH DFWLYLW\ SURGXFHG E\ VWUDLQ :6 S:6f JURZQ LQ /%* ZLWKRXW PRO\EGDWH DQG IRUPDWHf ZDV WKH VDPH DV WKH YDOXHV REWDLQHG ZLWK FHOOV JURZQ LQ PRO\EGDWH DQG IRUPDWH VXSSOHPHQWHG PHGLXP ,Q DGGLWLRQ WKLV PXWDQW DOORZHG H[SUHVVLRQ RI K\F RSHURQ LQ D PRG( PRH$ GRXEOH PXWDQW WR WKH ZLOG W\SH OHYHOV +RZHYHU )KO$ VWLOO UHTXLUHG WKH DOWHUQDWLYH VLJPD IDFWRU R IRU DFWLYDWLRQ RI WUDQVFULSWLRQ RI K\F RSHURQ )KO$ DFWLYDWHG RQO\ K\F RSHURQ DQG QRW RWKHU RSHURQV VXFK DV JOQ$ ZKLFK LV FRQWUROOHG E\ *OQ/ DQRWKHU PHPEHU RI WKH 1WU&IDPLO\ RI WUDQVFULSWLRQDO DFWLYDWRUV )KO$ GLG DFWLYDWH H[SUHVVLRQ RI IGK) JHQH WR DERXW IROG KLJKHU OHYHO WKDQ WKDW RI WKH QDWLYH )KO$ DV H[SHFWHG $SSDUHQWO\ UHPRYDO

PAGE 112

$OOHOH 0XWDWLRQ :W 1K (VD L QRQH GHOHWLRQ /9 Qf ‘0 GHOHWLRQ GHOHWLRQ L $ nF /9 0f§OF $ f§, $ F 6HTXHQFH PRWLI IRU $73 %LQGLQJ +7+ PRWLI '1$ %LQGLQJ GRPDLQf )LJXUH ([WHQW RI GHOHWLRQV LQ IKO$ GHOHWLRQ PXWDQW DOOHOHV /LQHV UHSUHVHQW DPLQR DFLG VHTXHQFH RI QDWLYH )KO$ DQG FRUUHVSRQGLQJ )KO$ GHOHWLRQ PXWDQWV

PAGE 113

7DEOH 5HJXODWLRQ RI 3K\FODF= E\ )KO$ PXWDQW SURWHLQ 6WUDLQ 5HOHYDQW JHQRW\SH %FUDODFWRVLGDVH DFWLYLWY /%* /%*0 /%*) /%*)0 :6S:6f PRG :6S:6Of $PRG :6S:6Of $PRG SIO D $OO VWUDLQV FDUU\ 3K\FODF= YLD $:6 DQG D GHOHWLRQ RI WKH VUOIKO$ UHJLRQ E JDODFWRVLGDVH DFWLYLW\ LV H[SUHVVHG DV QDQRPROHVPLQnnPLOOLJUDP RI FHOO SURWHLQ

PAGE 114

RI WKH XQLTXH 1WHUPLQDO UHJLRQ RI DPLQR DFLGV RI )KO$ FUHDWHG D PRO\EGDWH DQG IRUPDWHLQGHSHQGHQW DFWLYDWRU RI WUDQVFULSWLRQ RI K\F RSHURQ $ QXPEHU RI RWKHU WUDQVFULSWLRQDO DFWLYDWRUV RI WKH 1WU&IDPLO\ KDYH DOVR EHHQ WKH WDUJHW RI PXWDJHQHVLV DQG GHOHWLRQ RI WKH XQLTXH 1 WHUPLQDO GRPDLQV RI WKH UHVSHFWLYH SURWHLQV KDYH DOVR UHVXOWHG LQ XQUHJXODWHG WUDQVFULSWLRQDO DFWLYDWRUV f 'UXPPRQG HW DO f GHVFULEHG DQ 1WHUPLQDO GHOHWLRQ PXWDQW RI $QI$ SURWHLQ D WUDQVFULSWLRQDO DFWLYDWRU ZKLFK DFWLYDWHV WKH DQI+ JHQH RI $]RWREDFWHU YLQHODQGLL DOWHUQDWLYH QLWURJHQDVHf 2WKHU 1WU&W\SH DFWLYDWRUV ZKLFK DUH SKRVSKRU\ODWHG RU ELQG HIIHFWRUV EHIRUH DFWLYDWLQJ WUDQVFULSWLRQ RI WKHLU FRJQDWH RSHURQV KDYH DOVR EHHQ WKH IRFXV RI GHOHWLRQ PXWDJHQHVLV DQG LQ PRVW FDVHV UHPRYDO RI WKLV GRPDLQ UHVXOWV LQ DQ HIIHFWRULQGHSHQGHQW RU SKRVSKRU\ODWLRQLQGHSHQGHQW DFWLYDWRU $FWLYDWLRQ RI 3AODF= E\ )KO$ LV 2[\JHQ DQG 1LWUDWH ,QGHSHQGHQW )RUPDWH K\GURJHQO\DVH LV RQO\ SURGXFHG GXULQJ DQDHURELF JURZWK RI ( FROL %RFN DQG KLV FRZRUNHUV SUHYLRXVO\ SURSRVHG WKDW WKH ODFN RI K\F H[SUHVVLRQ GXULQJ FRQGLWLRQV RI DHURELF R[\JHQf RU DQDHURELF UHVSLUDWLRQ QLWUDWHf ZDV GXH WR D ODFN RI VXIILFLHQW OHYHO RI IRUPDWH WR LQWHUDFW ZLWK )KO$ f 7KHUHIRUH WKH LQGHSHQGHQFH IURP IRUPDWH DV D UHTXLUHG HIIHFWRU IRU )KO$ ZDV IXUWKHU

PAGE 115

WHVWHG E\ FXOWXULQJ VWUDLQ :6S:6f XQGHU DHURELF FRQGLWLRQV 7KH UHVXOWV RI WKHVH H[SHULPHQWV DUH SUHVHQWHG LQ 7DEOH 6WUDLQ :6S:6f ZLWK ZLOG W\SH IKO$r GLG QRW SURGXFH SJDODFWRVLGDVH DFWLYLW\ ZKHQ JURZQ XQGHU DHURELF JURZWK FRQGLWLRQV $GGLWLRQ RI IRUPDWH WR WKH PHGLXP LQFUHDVHG WKH OHYHO RI SJDODFWRVLGDVH DFWLYLW\ WR RQO\ XQLWV DQG WKLV UHSUHVHQWV RQO\ b RI WKH DQDHURELF OHYHO $SSDUHQWO\ H[RJHQRXVO\ DGGHG IRUPDWH LV QRW DEOH WR LQFUHDVH WKH OHYHO RI H[SUHVVLRQ RI K\F ZKHQ FHOOV DUH FXOWXUHG XQGHU DHURELF FRQGLWLRQV +RZHYHU LQ WKH SUHVHQFH RI 3K\FODF= ZDV DFWLYDWHG E\ )KO$ SURWHLQ WR D OHYHO KLJKHU WKDQ WKDW RI ZLOG W\SH VWUDLQ JURZQ DQDHURELFDOO\ +RZHYHU WKH OHYHO RI SJDODFWRVLGDVH DFWLYLW\ SURGXFHG E\ :6S:6f ZDV RQO\ DERXW b RI WKH VDPH VWUDLQ JURZQ XQGHU DQDHURELF FRQGLWLRQV ,QFOXGLQJ IRUPDWH LQ WKH DHURELF JURZWK PHGLXP GLG QRW LQFUHDVH WKH OHYHO RI 3K\FODF= H[SUHVVLRQ DFWLYDWHG E\ )KO$ 3UHYLRXV VWXGLHV E\ 0DXSLQ f VKRZHG WKDW H[SUHVVLRQ RI IKO$ODF= H[SUHVVLRQ XQGHU DHURELF JURZWK FRQGLWLRQV LV RQO\ DERXW b RI WKH YDOXHV REWDLQHG ZLWK DQDHURELF FXOWXUHV 7KLV ORZHU OHYHO RI H[SUHVVLRQ RI )KO$ XQGHU DHURELF FRQGLWLRQV FRXOG DFFRXQW IRU WKH b GHFUHDVH LQ K\FODF=GHSHQGHQW SJDODFWRVLGDVH DFWLYLW\ LQ WKH DHURELF FXOWXUH

PAGE 116

7DEOH )KO$OPHGLDWHG H[SUHVVLRQ RI 3.\FODF= LQ WKH SUHVHQFH RI R[\JHQ RU QLWUDWH 6WUDLQ 5HOHYDQW JHQRW\SH %DDODFWRVLGDVH DFWLYLW\ /% /% /%) f f /%* /%*1 /%*)1 :6S:6f :6S:6f S IKO$r SIKO$O 8' D $OO VWUDLQV FDUU\ 3K\FODF= DQG D GHOHWLRQ RI WKH VUOIKO$ UHJLRQ 8QOHVV LQGLFDWHG FXOWXUHV ZHUH JURZQ XQGHU DQDHURELF FRQGLWLRQV E SJDODFWRVLGDVH DFWLYLW\ LV H[SUHVVHG DV QDQRPROHVfPLQ fPLOOLJUDP RI FHOO SURWHLQn R R

PAGE 117

6LQFH IRUPDWH LV DOVR DQ HOHFWURQ GRQRU IRU QLWUDWH UHGXFWLRQ SUHVHQFH RI QLWUDWH LQ WKH PHGLXP RI DQ DQDHURELF FXOWXUH LV H[SHFWHG WR GHFUHDVH WKH IRUPDWH SRRO DQG DV D FRQVHTXHQFH GHFUHDVH K\F H[SUHVVLRQ $V H[SHFWHG K\FODF= ZDV QRW H[SUHVVHG LQ WKH SUHVHQFH RI QLWUDWH ZKHQ QDWLYH )KO$ VHUYHG DV WKH DFWLYDWRU 7DEOH f 6XSSOHPHQWLQJ WKH PHGLXP ZLWK IRUPDWH UHVWRUHG K\FODF= H[SUHVVLRQ +RZHYHU ZLWK )KO$ DV WKH DFWLYDWRU QLWUDWH RQO\ KDG D PLQLPDO HIIHFW RQ H[SUHVVLRQ RI K\F RSHURQ 6XSSOHPHQWLQJ WKH PHGLXP ZLWK IRUPDWH UHVWRUHG K\FODF= H[SUHVVLRQ IXOO\ 6LQFH )KO$ SURWHLQ FDQ IXOO\ DFWLYDWH WUDQVFULSWLRQ RI K\F RSHURQ HYHQ LQ WKH DEVHQFH RI IRUPDWH DQG PRO\EGDWH PRG SIO PXWDQW VWUDLQ :6S:6f 7DEOH f WKLV QLWUDWHGHSHQGHQW GHFUHDVH LQ WKH OHYHO RI H[SUHVVLRQ RI K\FODF= ZLWK )KO$ SUHVHQW DQG UHVWRUDWLRQ RI H[SUHVVLRQ ZLWK IRUPDWH ZDV XQH[SHFWHG ,Q FRQWUDVW WR QLWUDWH LV QRW NQRZQ WR UHGXFH WKH OHYHO RI H[SUHVVLRQ RI IKO$ f $SSDUHQWO\ WKH REVHUYHG GHFUHDVH LQ K\F H[SUHVVLRQ LQ WKH SUHVHQFH RI QLWUDWH LV GXH WR DQ LQGLUHFW SK\VLRORJLFDO HIIHFW ZKLFK UHTXLUHV IXUWKHU LQYHVWLJDWLRQ 7KH UHVXOWV GHVFULEHG DERYH VXJJHVW WKDW WKHUH DUH WZR VHSDUDWH FRQWURO V\VWHPV RSHUDWLQJ RQ K\FODF= H[SUHVVLRQ DQG ERWK DUH WKURXJK )KO$ )RUPDWHGHSHQGHQFH DQG OLNHO\ PRO\EGHQXPGHSHQGHQFHf PRGLI\LQJ WKH DELOLW\ RI )KO$ WR ELQG

PAGE 118

WR '1$ DQG DFWLYDWH WUDQVFULSWLRQ DQG DQ GHSHQGHQW GHFUHDVH LQ IKO$ H[SUHVVLRQ ,Q )KO$ WKH IRUPDWHDQG PRO\EGDWHf GHSHQGHQW UHJXODWLRQ LV QXOOLILHG 7KH LPPHGLDWH XSVWUHDP UHJLRQ RI IKO$ ODFNV )15 ELQGLQJ GRPDLQ DQG WKXV WKH GHFUHDVH LQ K\F H[SUHVVLRQ XQGHU DHURELF FRQGLWLRQV PD\ QRW EH PHGLDWHG WKURXJK WKH )15 SURWHLQ $ UHFHQW VWXG\ VXJJHVWV WKDW WKH R[\6 VPDOO 51$ VSHFLHV SOD\V D UROH LQ WKH UHJXODWLRQ RI IKO$ DQG LV DSSDUHQWO\ UHVSRQVLEOH IRU WKH LQn GHSHQGHQW FRQWURO RI IKO$ JHQH f )RUPDWH +\GURJHQO\DVH 6\QWKHVLV LV ,QGHSHQGHQW RI )RUPDWH LQ WKH 3UHVHQFH RI )KO$ 6LQFH WUDQVFULSWLRQ RI K\F RSHURQ ZDV WKH KLJKHVW LQ WKH SUHVHQFH RI )KO$ DV WKH WUDQVFULSWLRQDO DFWLYDWRU WKH QHHG IRU IRUPDWH LQ WKH FRQYHUVLRQ RI DSRIRUPDWH K\GURJHQO\DVH FRPSRQHQWV WR DFWLYH )+/ HQ]\PH FRPSOH[ ZDV GHWHUPLQHG 6WUDLQ 6( ZKLFK FDUULHV D PXWDWLRQ LQ WKH FKURPRVRPDO IKO$ JHQH SURGXFHG DERXW XQLWV RI )+/ DFWLYLW\ ZLWK SODVPLG S:6 7DEOH f 7KLV YDOXH LV VOLJKWO\ KLJKHU WKDQ WKH XQLWV RI )+/ DFWLYLW\ SURGXFHG E\ VWUDLQ 6(S:6f ZLWK WKH ZLOG W\SH IKO$ +RZHYHU LQ D IKO$ SIO GRXEOH PXWDQW RQO\ WKH VWUDLQ FDUU\LQJ IKO$ SURGXFHG )+/ DFWLYLW\ XQLWV 7DEOH f 7KHVH UHVXOWV DOVR VKRZ WKDW IRUPDWH LV RQO\ UHTXLUHG IRU WUDQVFULSWLRQDO

PAGE 119

7DEOH 3URGXFWLRQ RI )+/ DFWLYLW\ LQ WKH SUHVHQFH RI )KO$ LV IRUPDWHLQGHSHQGHQW 6WUDLQ 5HOHYDQW JHQRW\SH )+/ DFWLYLWYE 6(S:6f IKO$ SIKO$f S:6Of IKO$ SIKO$f :6S:6f SIO IKO$SIKO$f S:6Of SIO IKO$ SIKO$f 6WUDLQ 6( DQG LWV SIO GHULYDWLYH VWUDLQ :6 FDUU\ W! IKO$ODF=f E )RUPDWH K\GURJHQO\DVH DFWLYLW\ LV H[SUHVVHG DV QDQRPROHV RI + SURGXFHGfPLQf fPLOOLJUDP RI FHOO SURWHLQn

PAGE 120

DFWLYDWLRQ RI IGK) DQG K\F DQG QRW IRU PDWXUDWLRQ DQG DFWLYDWLRQ RI WKH DSRSURWHLQV WR DFWLYH )+/ FRPSOH[ )KO$ %LQGV WR K\F '1$ 7KH KLJKHU OHYHO RI H[SUHVVLRQ RI K\F RSHURQ ZKHQ DFWLYDWHG E\ )KO$ SURPSWHG LQYHVWLJDWLRQ LQWR WKH DIILQLW\ RI )KO$ SURWHLQ IRU WKH WDUJHW '1$ :LOG W\SH )KO$ VKLIWHG WKH HOHFWURSKRUHWLF PRELOLW\ RI WKH K\F SURPRWHU '1$ DW D FRQFHQWUDWLRQ RI Q0 DQG DOO WKH '1$ ZDV SUHVHQW DV 3URWHLQ'1$ FRPSOH[ DW D FRQFHQWUDWLRQ RI S0 )KO$ )LJ f ,Q FRQWUDVW WKH )KO$ SURWHLQ VKLIWHG WKH PRELOLW\ RI WKH '1$ DW D FRQFHQWUDWLRQ RI Q0 DQG FRPSOHWHO\ VKLIWHG WKH '1$ DW OHVV WKDQ Q0 )KO$ VXJJHVWLQJ WKDW WKH )KO$ KDV D KLJKHU DIILQLW\ IRU WKH WDUJHW '1$ VHTXHQFH ,Q RUGHU WR GHWHUPLQH WKH DSSDUHQW I4M YDOXHV IURP WKH HOHFWURSKRUHWLF PRELOLW\ VKLIW H[SHULPHQWV GHVFULEHG DERYH GHQVLWRPHWULF DQDO\VLV ZDV FDUULHG RXW RQ WKH ODEHOHG '1$ XVLQJ D 3KRVSKRULPDJHU )LJ f 7KH DSSDUHQW YDOXH ZDV Q0 IRU WKH LQWHUDFWLRQ EHWZHHQ QDWLYH )KO$ DQG K\F SURPRWHU '1$ 7KH LQWHUDFWLRQ RI )KO$ DQG K\F SURPRWHU '1$ DSSHDUV WR EH ELSKDVLF DV HYLGHQFHG E\ D UDSLG LQLWLDO ELQGLQJ IROORZHG E\ D VORZ SKDVH )LJ f 7KH FDOFXODWHG .WM YDOXH EDVHG RQ WKH HQWLUH ELQGLQJ FXUYH IRU )KO$ ZDV Q0 ZKLFK LV OHVV WKDQ KDOI RI WKH YDOXH IRU QDWLYH

PAGE 121

$ )LJXUH '1$ 0RELOLW\ VKLIW H[SHULPHQW XVLQJ SXULILHG )KO$ DQG )KO$ SURWHLQV DQG K\F SURPRWHU '1$ $OO UHDFWLRQV FRQWDLQHG IPRO RI ES K\F XSVWUHDP '1$ 3DQHO $ )KO$ ZLOG W\SH SURWHLQ /DQH QR SURWHLQ DGGHG /DQH S0 )KO$ /DQH S0 )KO$ /DQH S0 )KO$ /DQH S0 )KO$ /DQH S0 )KO$ 3DQHO % )KO$ PXWDQW SURWHLQ /DQH QR SURWHLQ DGGHG /DQH S0 )KO$ /DQH S0 )KO$ /DQH S0 )KO$ /DQH S0 )KO$ /DQH S0 )KO$ /DQH S0 )KO$ /DQH S0 )KO$

PAGE 122

$ % 3URWHLQ FRQFHQWUDWLRQ Q0f 3URWHLQ FRQFHQWUDWLRQ Q0f )LJXUH (IIHFW RI )KO$ RU )KO$ FRQFHQWUDWLRQ RQ ELQGLQJ WR K\F SURPRWHU '1$ 7KH DPRXQW RI '1$ ZKLFK ZDV VKLIWHG IURP WKH PRELOLW\ RI LQWDFW '1$ LQ WKH H[SHULPHQW VKRZQ LQ )LJ ZDV XVHG LQ WKLV )LJXUH 3DQHO $ )KO$ 3DQHO % )KO$

PAGE 123

)KO$ ZLWK WKH K\F SURPRWHU '1$ 7KH FDOFXODWHG .G YDOXH EDVHG RQ WKH LQLWLDO UDSLG SKDVH RI )KO$ ELQGLQJ ZDV OHVV WKDQ Q0 $GGLQJ IRUPDWH WR WKH )KO$'1$ ELQGLQJ UHDFWLRQ KDG QR VLJQLILFDQW HIIHFW RQ WKH DSSDUHQW RI WKLV LQWHUDFWLRQ EHWZHHQ '1$ DQG SURWHLQ 7KH KLJKHU DIILQLW\ RI )KO$ IRU WKH SURPRWHU '1$ FRXOG H[SODLQ WKH DOPRVW WKUHHIROG KLJKHU OHYHO RI K\F H[SUHVVLRQ VHHQ LQ YLYR LQ WKH SUHVHQFH RI )KO$ SURWHLQ DV FRPSDUHG WR WKH PD[LPDO H[SUHVVLRQ ZKHQ DFWLYDWHG E\ )KO$ +RZHYHU LW FRXOG QRW EH UXOHG RXW WKDW WKH KLJKHU OHYHO RI H[SUHVVLRQ LV GXH WR DQ LQFUHDVHG DELOLW\ RI )KO$ WR LQLWLDWH WUDQVFULSWLRQ XSRQ ELQGLQJ WR '1$ ,Q RUGHU WR GLVWLQJXLVK EHWZHHQ WKH WZR DOWHUQDWLYHV WKH $73DVH DFWLYLW\ RI )KO$ DQG )KO$ DVVRFLDWHG ZLWK '1$RSHQ FRPSOH[ IRUPDWLRQ ZDV GHWHUPLQHG LQ WKH SUHVHQFH DQG DEVHQFH RI K\F '1$ DQG WKH HIIHFWRU IRUPDWH $73DVH $FWLYLW\ RI )KO$ :LOG W\SH )KO$ SURWHLQ ZDV SUHYLRXVO\ VKRZQ WR GLVSOD\ DQ LQWULQVLF $73DVH DFWLYLW\ VLPLODU WR WKDW RI WKH SKRVSKRU\ODWHG IRUP RI WKH 1WU& SURWHLQ RU WKH 1LI$ SURWHLQ f 7KLV DFWLYLW\ RI )KO$ LQFUHDVHG XSRQ WKH DGGLWLRQ RI IRUPDWH RU '1$ DQG IRUPDWH DQG '1$ WRJHWKHU IXUWKHU HQKDQFHG WKH OHYHO RI $73DVH DFWLYLW\ f 7R GHWHUPLQH LI WKH SXULILHG )KO$ SURWHLQ UHWDLQHG WKLV

PAGE 124

LQWULQVLF $73DVH DFWLYLW\ WKH K\GURO\VLV RI
PAGE 125

$73DVH DFWLYLW\ )LJXUH $73DVH DFWLYLW\ RI )KO$ DQG )KO$ LQ UHVSRQVH WR )RUPDWH DQG K\F SURPRWHU '1$

PAGE 126

$GGLWLRQ RI PRO\EGDWH RU YDULRXV WKLRPRO\EGDWHV WR HLWKHU RI WKHVH DFWLYDWRU SURWHLQV LQ WKH SUHVHQFH RU DEVHQFH RI IRUPDWH RU '1$ KDG QR HIIHFW RQ WKH $73DVH DFWLYLW\ $SSDUHQWO\ HLWKHU WKH )KO$ SURWHLQ GRHV QRW LQWHUDFW ZLWK PRO\EGDWH RU WKLRPRO\EGDWHV RU WKH DSSURSULDWH FKHPLFDO IRUP RI 0R 0RH$ SURGXFWf ZKLFK PD\ LQWHUDFW ZLWK )KO$ LV \HW WR EH SURGXFHG 7KH EDVDO $73DVH DFWLYLW\ RI QDWLYH )KO$ SURWHLQ REWDLQHG LQ WKHVH H[SHULPHQWV LV VLJQLILFDQWO\ KLJKHU WKDQ WKH $73DVH DFWLYLW\ UHSRUWHG E\ +RSSHU DQG %RFN f 7KLV GLIIHUHQFH FRXOG EH D UHIOHFWLRQ RI WKH SURFHGXUHV XVHG IRU SXULILFDWLRQ RI WKH SURWHLQ +RZHYHU D '1$GHSHQGHQW LQFUHDVH RI DERXW XQLWV RI $73DVH DFWLYLW\ ZDV REVHUYHG LQ WKLV VWXG\ DV ZHOO DV E\ .RUVD DQG %FN f )KO$ 6KDUHV 6HTXHQFH 0RWLI ZLWK $73DVHV IURP $%& 7UDQVSRUWHUV 6LQFH WKH EDVDO $73DVH DFWLYLW\ RI QDWLYH )KO$ SURWHLQ ZDV DERXW XQLWV KLJKHU WKDQ WKH )KO$ SURWHLQ LW LV OLNHO\ WKDW WKH 1WHUPLQDO SDUW RI WKH )KO$ SURWHLQ LV UHVSRQVLEOH IRU WKLV IRUPDWH DQG '1$LQGHSHQGHQW $73DVH DFWLYLW\ 7KHUHIRUH DPLQR DFLG VHTXHQFH DQDO\VLV RI WKLV VHJPHQW RI WKH SURWHLQ ZDV FDUULHG RXW WR UHYHDO DQ\ UHJLRQ ZKLFK PD\ KDYH EHHQ SUHYLRXVO\ RYHUORRNHG DV HVVHQWLDO IRU $73 ELQGLQJK\GURO\VLV $ VLJQLILFDQW VLPLODULW\ EHWZHHQ D SDUW RI WKH 1WHUPLQDO UHJLRQ RI )KO$ DQG DPLQR DFLGV IRXQG

PAGE 127

,OO LQ $73DVHV LQ WKH $%&W\SH WUDQVSRUW V\VWHPV ZDV LGHQWLILHG )LJ 3DQHO $f 7KLV VLPLODULW\ H[WHQGHG RYHU D DPLQR DFLG UHJLRQ 7KLV UHJLRQ RI DPLQR DFLGV LV SDUW RI D n+HOLFDO GRPDLQn SURSRVHG WR EH WKH VLWH RI LQWHUDFWLRQ EHWZHHQ WKH LQWHJUDO PHPEUDQH SURWHLQ DQG WKH F\WRSODVPLF SURWHLQ UHVSRQVLEOH IRU DFWLYDWLQJ WUDQVSRUW XVLQJ $73 K\GURO\VLV IRU HQHUJ\ f 7KH DPLQR DFLG VHTXHQFH VLPLODULW\ EHWZHHQ )KO$ DQG WKH $%& WUDQVSRUW SURWHLQV LV VWULNLQJ b LGHQWLW\ DQG b VLPLODU WR WKH FRQVHQVXV VHTXHQFHf 6LQFH RQO\ SURWHLQV ZLWK VLPLODU UROHV LQ WUDQVSRUW FDUU\ WKLV VSHFLILF UHJLRQ RI DPLQR DFLGV D UROH IRU WKLV UHJLRQ LQ DFWLYDWLRQ RI JHQHV HQFRGLQJ )+/ FRPSOH[ LV DW ILUVW D GLIILFXOW RQH +RZHYHU WKH SUHYDLOLQJ FRQVHQVXV RQ IRUPDWH PHWDEROLVP LV WKDW WKH IRUPDWH JHQHUDWHG GXULQJ IHUPHQWDWLRQ LV H[SRUWHG DQG DFFXPXODWHV RXWVLGH WKH FHOO 7KH IRUPDWH IURP WKH PHGLXP LV WKHQ WUDQVSRUWHG LQWR WKH FHOO IRU )+/ DFWLYLW\ f ,W LV SRVVLEOH WKDW WKH )KO$ SURWHLQ LQWHUDFWV ZLWK WKLV IRUPDWH WUDQVSRUW V\VWHP DQG HQHUJL]HV WKH WUDQVSRUW 7KLV XQLTXH SDUWLFLSDWLRQ RI )KO$ LQ WUDQVSRUW RI IRUPDWH ZRXOG DOORZ SUHIHUHQWLDO SURGXFWLRQ RI )KO$IRUPDWH FRPSOH[ IRU HIILFLHQW DFWLYDWLRQ RI IGK) DQG K\F RSHURQV DQG DOVR ZRXOG SUHYHQW IRUPDWH DFFXPXODWLRQ LQ WKH F\WRSODVP

PAGE 128

$ )KO$ f 3RW $ f 0RG) f 0DO. f ;\O* f /LY* f +LV3 f 0RGH f 3RW* f &RQVHQVXV *44*/)',757//443'/$6/&($/64/ *44459$,$5$:1.35////'( 6/6$/ *445/$/,95$/9.+37//,/'( 3/4*/ *45459$,*57/9$(369)//'( 3/61/ *444/9(,$.$/1.495//,/'( 37$6/ *'455/(,$5&09743(,/0/'( 3$$*/ *44459 6, $5$,L$0( 3( 9/ / )'( 3 7 6$/ *(.459$,*5$//7$3(////'(3/$6/ *45459$/$56/$.53.////'(30*$/ *44459$,$5$/9.43(////'( 3/6$/ % )KO$ f $SS< f )GK) f /.(5/9'(1/$ /.(5/5($$/$ /.75/&6,//$ &RQVHQVXV /.;5/;;;;/$ )LJXUH $OLJQPHQW RI 1WHUPLQDO UHJLRQ RI )KO$ ZLWK SURWHLQV IURP $%& WUDQVSRUW V\VWHPV DQG WKH LGHQWLW\ RI D SXWDWLYH IRUPDWH ELQGLQJ GRPDLQ $f $PLQR DFLGV RI )KO$ 1WHUPLQDO UHJLRQ DUH VKRZQ LQ WKH WRS OLQH $OO WKH RWKHU SURWHLQV DFW DV HQHUJL]HU SURWHLQV F\WRSODVPLFf LQ $%&W\SH WUDQVSRUW V\VWHPV LQ ( FROL %ROG W\SH DPLQR DFLGV DUH WKRVH ZKLFK DUH LGHQWLFDO LQ )KO$ 7KH ERWWRP OLQH UHSUHVHQWV D FRQVHQVXV RI WKH PRWLI JLYHQ VHTXHQFHV RI DOO WHQ SURWHLQV ZLWK EROG DPLQR DFLGV FRUUHVSRQGLQJ WR WKRVH IRXQG LGHQWLFDO LQ )KO$ %f 6HTXHQFH DOLJQPHQW RI D VKRUW UHJLRQ RI DPLQR DFLGV IURP )KO$ ZKLFK FRUUHVSRQG WR D UHJLRQ LQ $SS< DQG )'++ 7KH ERWWRP OLQH UHSUHVHQWV D FRPPRQ VHTXHQFH PRWLI VHHQ LQ WKHVH WKUHH SURWHLQV

PAGE 129

,Q DGGLWLRQ DQRWKHU UHJLRQ RI DPLQR DFLGV ZLWKLQ WKH XQLTXH 1WHUPLQDO GRPDLQ RI )KO$ ZHUH IRXQG WR EH VLPLODU WR WZR RWKHU SURWHLQV SUHVXPHG WR LQWHUDFW ZLWK IRUPDWH LQ ( FROL 7KLV VLPLODULW\ VKRZQ LQ )LJXUH SDQHO %f DULVHV EHWZHHQ )KO$ DQG DQRWKHU WUDQVFULSWLRQDO DFWLYDWRU $SS< $SS< KDV EHHQ LPSOLFDWHG LQ WKH WUDQVFULSWLRQDO DFWLYDWLRQ RI WKH F\[ RSHURQ DQG K\D RSHURQ f 7KLV DFWLYDWLRQ KDV EHHQ VKRZQ WR GHFUHDVH LQ WKH DEVHQFH RI IRUPDWH f 7KH WKLUG SURWHLQ FRQWDLQLQJ WKLV PRWLI LV WKH HQ]\PH IRUPDWH GHK\GURJHQDVH + )'++f 7KLV SULPDU\ GHK\GURJHQDVH XVHV IRUPDWH DV D VXEVWUDWH DQG LV LQ IDFW SDUW RI WKH )+/ FRPSOH[ ,Q DGGLWLRQ WR WKH VWULNLQJ VLPLODULW\ LQ WKLV UHJLRQ LW LV LQWHUHVWLQJ WR QRWH WKDW RQH RI WKH WZR PXWDWLRQV LQ )KO$ (.f ZKLFK DOORZV WKH )KO$ SURWHLQ WR EH SDUWLDOO\ IRUPDWHLQGHSHQGHQW LQ WKH WUDQVFULSWLRQDO DFWLYDWLRQ RI K\F RSHURQ RFFXUV ZLWKLQ WKLV UHJLRQ SUHYLRXV VHFWLRQf %RFN DQG KLV FRZRUNHUV DOVR LVRODWHG DQ )KO$ PXWDQW ZLWK WKH VDPH PXWDWLRQ DQG IRXQG WKDW WKLV PXWDQW SURWHLQ LV DOVR SDUWLDOO\ LQGHSHQGHQW RI IRUPDWH LQ WKH DFWLYDWLRQ RI K\F RSHURQ WUDQVFULSWLRQ f %DVHG RQ WKHVH UHVXOWV D ZRUNLQJ PRGHO IRU WKH SK\VLRORJLFDO UROH RI 1WHUPLQDO VHJPHQW RI )KO$ SURWHLQ LV SURSRVHG DQG LV VFKHPDWLFDOO\ GHSLFWHG LQ )LJXUH $V SHU WKLV PRGHO WKH 1WHUPLQDO UHJLRQ RI )KO$ SURWHLQ f

PAGE 130

+&22+ )RUPDWH WUDQVSRUW F\WRSODVPLF PHPEUDQH 0R2 $ N $ ? UU U 0R 0RH$ 0R DFWLYDWLRQ +&22+ 7UDQVFULSWLRQDO $FWLYDWLRQ E\H RSHURQ )LJXUH $ SURSRVHG PRGHO IRU WKH IRUPDWH DQG >0R@ GHSHQGHQW WUDQVFULSWLRQDO DFWLYDWLRQ RI K\F RSHURQ E\ )KO$

PAGE 131

LQWHUDFWV ZLWK DQ XQGHILQHG IRUPDWH WUDQVSRUW FRPSRQHQW DQG DFWLYDWHV WUDQVSRUW RI IRUPDWH f VXEVHTXHQWO\ ELQGV IRUPDWH DQG f DIWHU LQWHUDFWLQJ ZLWK \HW WR EH GHILQHG PRO\EGHQXP HIIHFWRU PROHFXOH DFWLYDWHV WUDQVFULSWLRQ RI JHQHV HQFRGLQJ WKH IRUPDWH K\GURJHQO\DVH $V SHU WKLV SURSRVHG PHFKDQLVP IRUPDWH ZLOO RQO\ EH WUDQVSRUWHG LQWR WKH FHOO ZKHQ DFWLYH )KO$ LV SUHVHQW LQ WKH F\WRSODVP DQG FDSDEOH RI DFWLYDWLQJ WKH SURGXFWLRQ RI )+/ IRU HIIHFWLYH UHPRYDO RI IRUPDWH ,W LV LQWHUHVWLQJ WR QRWH WKDW WKH )KO$ SURWHLQ ZKLFK ODFNV WKLV UHJLRQ KDV D JUHDWO\ UHGXFHG LQWULQVLF $73DVH DFWLYLW\ DQG PD\ QRW SDUWLFLSDWH LQ IRUPDWH WUDQVSRUW (YDOXDWLRQ RI WKH YDOLGLW\ RI WKLV PRGHO UHTXLUHV H[WHQVLYH PXWDJHQHVLV RI WKLV UHJLRQ RI WKH )KO$ SURWHLQ JHQHWLF DQG ELRFKHPLFDO DQDO\VLV RI IRUPDWH WUDQVSRUW DQG VXEVHTXHQW ELRFKHPLFDO DQDO\VLV RI WKH PXWDQW )KO$ SURWHLQV )KO$ 3URWHLQ DOVR $FWLYDWHV ([SUHVVLRQ RI D 6LOHQW K\F OLNH 2SHURQ K\I LQ (VFKHULFKLD FROL K\I 2SHURQ :LWK WKH FRPSOHWLRQ RI (VFKHULFKLD FROL JHQRPH VHTXHQFH HIIRUWV WR XSGDWH WKH DQQRWDWLRQ IRU XQVWXGLHG JHQHV DFFHOHUDWHG $Q DQDO\VLV RI WKH JHQRPH VHTXHQFH UHYHDOHG D FOXVWHU RI JHQHV ZKLFK LV VLJQLILFDQWO\ VLPLODU WR K\F RSHURQ f 7KLV RSHURQ GHVLJQDWHG K\I IRXUWK

PAGE 132

K\GURJHQDVHf FRQWDLQV RSHQ UHDGLQJ IUDPHV 25)Vf ZKLFK KDYH EHHQ DQQRWDWHG DV K\I$%&'()*+,5IRF% 0RVW RI WKH SURWHLQV HQFRGHG E\ ILUVW QLQH 25)V RI K\I DUH VLPLODU WR WKH QLQH JHQHV FRGHG E\ WKH K\F$%&'()*+, RSHURQ DQG LQFOXGH D SXWDWLYH ODUJH VXEXQLW RI D K\GURJHQDVH DV ZHOO DV PHPEUDQHDVVRFLDWHG HOHFWURQ FDUULHU SURWHLQV 7KH K\I5 JHQH HQFRGHV D SURWHLQ ZLWK VLJQLILFDQW VLPLODULW\ WR )KO$ DQG WKH IRF% JHQH KDV EHHQ DQQRWDWHG DV EHLQJ LQYROYHG LQ IRUPDWH WUDQVSRUW 7KH XSVWUHDP '1$ RI WKH K\I RSHURQ FRQWDLQV '1$ VHTXHQFHV ZKLFK UHSUHVHQW FRQVHQVXV ELQGLQJ VLWHV IRU WKH JOREDO UHJXODWRU &53 DV ZHOO DV IRU WKH LURQ UHJXODWRU )85 DQG WKH )KO$ SRVVLEOH K\I5 JHQH SURGXFWf SURWHLQ ,Q DGGLWLRQ D FRQVHQVXV VHTXHQFH IRU WKH ELQGLQJ RI WKH D ERXQG 51$ SRO\PHUDVH KRORHQ]\PH LV IRXQG LQ DQ DSSURSULDWH DUHD XSVWUHDP RI WKH SXWDWLYH WUDQVODWLRQ VWDUW FRGRQ LQ WKH K\I $ JHQH +RZHYHU WKLV RSHURQ LV QRW WUDQVFULEHG LQ ( FROL XQGHU YDULRXV H[SHULPHQWDO FRQGLWLRQV 7DEOH f 0XWDQW )KO$ SURWHLQV $FWLYDWH 7UDQVFULSWLRQ RI 4K\I$ODF=f ,Q RUGHU WR VWXG\ WKH WUDQVFULSWLRQDO UHJXODWLRQ RI WKH K\I RSHURQ D 4!K\I$ODF=f ZDV FRQVWUXFWHG 8QH[SHFWHGO\ WKLV IXVLRQ GLG QRW SURGXFH DQ\ JDODFWRVLGDVH DFWLYLW\ LQ ( FROL WHVWHG XQGHU YDULRXV JURZWK FRQGLWLRQV $ FKURPRVRPDO PXWDWLRQ ZLWKLQ WKH K\I RSHURQ DOVR GLG QRW

PAGE 133

7DEOH ([SUHVVLRQ RI K\I$ODF=f LQ WKH SUHVHQFH RI YDULRXV IKO$ DOOHOHV 6WUDLQ 5HOHYDQW JHQRW\SH S:6 IKO$ f %FUDODFWRVLGDVH S:6 IKO$f DFWLYLWYE S:6 ^IKO$Of :6 ZLOG W\SH fF fF f F :6 IKO$ :6 USR1 :6 IQU :6 PRH$ :6 K\I 1' 1' :6 SIO fG fG f G :6 F\D fF fF f F :6 PRG% fH f D fH :6 PRG( :6 F\D FUS r D $OO VWUDLQV DUH GHULYDWLYHV RI :6 ZKLFK FDUULHV W! K\I$ODF=f YLD $:6 &XOWXUHV ZHUH JURZQ LQ /%* PHGLXP XQGHU DQDHURELF FRQGLWLRQV E SJDODFWRVLGDVH DFWLYLW\ LV H[SUHVVHG DV QDQRPROHVf PLQXWH mPLOOLJUDP RI FHOO SURWHLQ 9DOXHV LQ SDUHQWKHVHV UHSUHVHQW DFWLYLW\ SURGXFHG ZKHQ WKH FXOWXUH ZDV JURZQ ZLWK DQ DSSURSULDWH HIIHFWRU LQ WKH PHGLXP F F$03 ZDV DGGHG DW D ILQDO FRQFHQWUDWLRQ RI P0 G )RUPDWH ZDV DGGHG DW D ILQDO FRQFHQWUDWLRQ RI P0 H 0RO\EGDWH ZDV DGGHG DW D ILQDO FRQFHQWUDWLRQ RI P0

PAGE 134

DOORZ H[SUHVVLRQ RI K\I RSHURQ DQG QR DSSDUHQW SKHQRW\SH ZDV DVVRFLDWHG ZLWK VWUDLQV FDUU\LQJ D $K\I%*f PXWDWLRQ $Q DWWHPSW WR LQFUHDVH WKH OHYHO RI QDWLYH )KO$ E\ FDUU\LQJ IKO$ YLD D PHGLXPFRS\ YHFWRU S%5f DOVR IDLOHG WR H[SUHVV K\I$ODF= GDWD QRW VKRZQf +RZHYHU ZKHQ WKH WZR PXWDQW )KO$ SURWHLQV ZKLFK DFWLYDWHG K\F RSHURQ LQ WKH DEVHQFH RI IRUPDWH DQG PRO\EGDWH ZHUH WHVWHG DV SRWHQWLDO DFWLYDWRUV K\I$ODF= ZDV H[SUHVVHG WR YDU\LQJ OHYHOV 7DEOH f )KO$ DFWLYDWHG K\I$ODF= WR DERXW XQLWV RI JDODFWRVLGDVH DFWLYLW\ ,Q WKH SUHVHQFH RI )KO$ WKLV DFWLYLW\ LQFUHDVHG WR DERXW XQLWV ([SUHVVLRQ RI K\I$ODF= E\ WKHVH PXWDQW )KO$ SURWHLQV LV DOVR GHSHQGHQW 6LQFH )KO$OGHSHQGHQW K\F H[SUHVVLRQ FDQ EH HQKDQFHG E\ PRO\EGDWH DQG IRUPDWH 7DEOH f WKH QHHG IRU IRUPDWH DQG PRO\EGDWH IRU K\I$ODF= H[SUHVVLRQ ZDV DOVR LQYHVWLJDWHG ,QWURGXFLQJ D PXWDWLRQ LQ SIO IRUPDWH PLQXVf RU PRG% PRO\EGDWH WUDQVSRUW PLQXVf HOLPLQDWHG K\I$ODF= H[SUHVVLRQ E\ )KO$ 7KLV H[SUHVVLRQ ZDV UHVWRUHG SDUWLDOO\ E\ VXSSOHPHQWLQJ WKH PHGLXP ZLWK HLWKHU IRUPDWH RU PRO\EGDWH DV QHHGHG 7KHVH UHVXOWV VKRZ WKDW WKH K\I H[SUHVVLRQ LV VLPLODU WR K\F H[SUHVVLRQ DQG UHTXLUHV ERWK IRUPDWH DQG PRO\EGDWH $SSDUHQWO\ WKH PXWDWLRQV LQ WKH 1WHUPLQDO SDUW RI WKH )KO$ DOORZHG H[SUHVVLRQ RI K\I EXW RQO\ LQ WKH

PAGE 135

SUHVHQFH RI IRUPDWH DQG PRO\EGDWH ,W LV LQWULJXLQJ WKDW WKHVH PXWDQW )KO$ DFWLYDWRUV DUH DEOH WR DFWLYDWH WUDQVFULSWLRQ RI K\I RSHURQ ZKLOH WKH QDWLYH )KO$ FRXOG QRW 7KH OHYHO RI H[SUHVVLRQ RI K\I ZKHQ DFWLYDWHG E\ )KO$ SURWHLQ ZDV QRW VLJQLILFDQWO\ DIIHFWHG E\ PXWDWLRQV LQ IKO$ IQU PRG( RU PRH$ JHQHV +RZHYHU WKLV DFWLYDWLRQ GLG UHTXLUH PRO\EGDWH DQG IRUPDWH VLQFH PXWDWLRQV LQ HLWKHU PRG% RU SIO GHFUHDVHG H[SUHVVLRQ DQG FDQ EH SDUWLDOO\ UHVWRUHG E\ PRO\EGDWH DQG IRUPDWH DGGLWLRQ WR WKH JURZWK PHGLXP RI WKH DSSURSULDWH PXWDQW $ QRWLFHDEOH GLIIHUHQFH LQ K\I H[SUHVVLRQ ZKHQ DFWLYDWHG E\ )KO$ ZDV DQ LQFUHDVHG OHYHO RI DFWLYLW\ LQ D F\D PXWDQW HQFRGLQJ DGHQ\ODWH F\FODVHf ZKLFK ZDV VOLJKWO\ UHGXFHG LQ D F\D FUSr GRXEOH PXWDQW VWUDLQ :6 7DEOH f $SSDUHQWO\ WKH ORZ OHYHO RI DFWLYDWLRQ RI WUDQVFULSWLRQ RI 4K\I$ODF=f E\ )KO$ LV DIIHFWHG E\ WKH OHYHO RI DFWLYH &53F$03 FRPSOH[ LQ WKH FHOO $V ZLWK WKH DFWLYDWLRQ RI K\I E\ )KO$ PXWDWLRQV LQ IKO$ IQU PRH$ DQG PRG( KDG QR VLJQLILFDQW HIIHFW RQ WKH OHYHO RI H[SUHVVLRQ RI K\IODF= LQ WKH SUHVHQFH RI )KO$ +RZHYHU WKH H[SUHVVLRQ RI K\I LQ WKH SUHVHQFH RI )KO$ LV DOVR LQGHSHQGHQW RI PRO\EGDWH DQG IRUPDWH 7KH OHYHO RI S JDODFWRVLGDVH DFWLYLW\ LQFUHDVHG LQ D F\D PXWDQW DV LW GLG ZLWK )KO$ DQG GHFUHDVHG LQ WKH F\D FUSr GRXEOH PXWDQW

PAGE 136

$SSDUHQWO\ F$03&53 LV D PRGHVW UHSUHVVRU RI WUDQVFULSWLRQ RI K\I RSHURQ 7KHVH UHVXOWV LQGLFDWH WKDW WKH IRUPDWH DQG PRO\EGDWHLQGHSHQGHQW PXWDQW )KO$ FDQ DFWLYDWH RWKHU RSHURQV ZLWK VLPLODU FKDUDFWHULVWLFV WR WKDW RI K\F RSHURQ $SSDUHQWO\ WKH 1WHUPLQDO HIIHFWRUELQGLQJ UHJLRQ RI )KO$ SURWHLQ LV UHVSRQVLEOH IRU WKH VSHFLILFLW\ WR WKH SURPRWHU '1$ (IIHFWRULQGHSHQGHQW PXWDQW IRUPV RI DFWLYDWRU SURWHLQV DOVR DOORZV D FRQYHQLHQW ZD\ RI DFWLYDWLQJ VLOHQW RSHURQV LQ ( FROL WR HYDOXDWH WKH VWUXFWXUHIXQFWLRQ UHODWLRQVKLS RI WKH FRGHG SURWHLQV $OWKRXJK WKH K\I RSHURQ ZDV DFWLYDWHG E\ )KO$ K\I ZDV XQDEOH WR VXEVWLWXWH IRU K\F RSHURQ LQ WKH SUHVHQFH RI )KO$ )XUWKHU H[SHULPHQWV DUH QHHGHG WR LGHQWLI\ WKH PHFKDQLVP RI WKLV GHIHFW $SSDUHQWO\ WKH K\I RSHURQ DQG LWV SURGXFWV DUH QR ORQJHU XWLOL]HG E\ ( FROL DQG SHUKDSV UHSUHVHQWV D YHVWLJLDO K\GURJHQDVH RSHURQ IURP ZKLFK WKH UHPDLQLQJ WKUHH DFWLYHf K\GURJHQDVH LVRHQ]\PHV K\D K\E K\Ff DURVH DIWHU GXSOLFDWLRQ

PAGE 137

&21&/86,21 7KH H[SUHVVLRQ RI WKH FRPSOHPHQW RI PRO\EGRHQ]\PHV LQ ( FROL LV H[SHFWHG WR EH XQGHU WLJKW FRQWURO VLQFH WKHVH HQ]\PHV DUH HLWKHU LQVHUWHG LQWR RU DUH LQ FORVH DVVRFLDWLRQ ZLWK WKH F\WRSODVPLF PHPEUDQH $OWKRXJK HDFK LQGLYLGXDO V\VWHP UHVSRQGV WR LWV RZQ HIIHFWRUV ZLWK LWV RZQ VHW RI WUDQVFULSWLRQDO UHJXODWRUV IRUPDWH LQ WKH FDVH RI )+/ QLWUDWH DQG QLWULWH LQ WKH FDVH RI 15 HWFf RSWLPDO H[SUHVVLRQ RI PRO\EGRHQ]\PHV UHTXLUHV WKH SUHVHQFH RI PRO\EGDWH LQ WKH F\WRSODVP 7KHUHIRUH XQGHU FRQGLWLRQV ZKHUH WKH VXEVWUDWH IRU D PRO\EGRHQ]\PH LV SUHVHQW EXW PRO\EGDWH LV QRW DW VXIILFLHQW OHYHOV LQ WKH HQYLURQPHQW WR VXSSRUW ELRJHQHVLV RI WKH PRO\EGHQXPFRQWDLQLQJ FRIDFWRU 0*' WKH FHOO FRQVHUYHV WKH HQHUJ\ UHTXLUHG IRU ELRV\QWKHVLV RI WKH PRO\EGRHQ]\PH 7KLV PRO\EGDWHGHSHQGHQW FRQWURO NQRZQ WR EH H[HUWHG DW WKH WUDQVFULSWLRQDO OHYHO XQWLO QRZ KDV QRW EHHQ HOXFLGDWHG ,Q WKH FDVH RI H[SUHVVLRQ RI WKH FRPSRQHQWV RI WKH )+/ WKH GLVFRYHU\ WKDW 0RG( SURWHLQ DFWV DV D VHFRQGDU\ WUDQVFULSWLRQDO DFWLYDWRU LV VLJQLILFDQW 0RG( SURWHLQ KDG

PAGE 138

RQO\ EHIRUH EHHQ GHVFULEHG DV D PRO\EGDWHGHSHQGHQW UHSUHVVRU RI PRG$%&' RSHURQ 7KLV GXDO UROH DV D UHSUHVVRU DQG DQ DFWLYDWRU IRU WKH 0RG( SURWHLQ DOWKRXJK XQH[SHFWHG GLVSOD\V RQFH DJDLQ WKH HFRQRPLFDO QDWXUH RI ( FROL WR XWLOL]H D VLQJOH SURWHLQ IRU PRUH WKDQ RQH IXQFWLRQ %HVLGHV VXSSRUWLQJ H[SUHVVLRQ RI K\F RSHURQ 0RG(PRO\EGDWH KDV DOVR UHFHQWO\ EHHQ LPSOLFDWHG LQ WKH PRO\EGDWHGHSHQGHQW WUDQVFULSWLRQDO UHJXODWLRQ RI PRD RSHURQ LQYROYHG LQ WKH ELRV\QWKHVLV RI PRO\EGRSWHULQ ,Q D VHSDUDWH VWXG\ WKH 0RG( SURWHLQ LV LPSOLFDWHG DV D VHFRQGDU\ WUDQVFULSWLRQDO DFWLYDWRU RI WKH QDU;/ RSHURQ ZKLFK HQFRGHV D WZRFRPSRQHQW UHJXODWRU\ V\VWHP IRU H[SUHVVLRQ RI QLWUDWH UHGXFWDVH 7KHUHIRUH LW FDQ EH FRQFOXGHG IURP WKHVH VWXGLHV WKDW 0RG( LV D PRO\EGDWH VHQVRU IRU WKH WUDQVFULSWLRQDO UHJXODWLRQ RI PRO\EGDWH WUDQVSRUW DQG PRO\EGRHQ]\PH H[SUHVVLRQ +RZHYHU HYHQ LQ WKH DEVHQFH RI 0RG( SURWHLQ WUDQVFULSWLRQ RI K\F DQG RWKHU PRO\EGDWHGHSHQGHQW RSHURQVf DUH VWLOO DFWLYDWHG DOWKRXJK DW D ORZHU OHYHO 7KLV 0RG( LQGHSHQGHQW DFWLYDWLRQ UHTXLUHV PRO\EGDWH ZKLFK SRVHV DQRWKHU TXHVWLRQ DV WR WKH QDWXUH RI WKH FRPSRQHQWVf LQ WKH FHOO ZKLFK SDUWLFLSDWH LQ WKH UHJXODWLRQ RI PRO\EGRHQ]\PH V\QWKHVLV 7KH VHFRQG FRPSRQHQW RI WKLV FRQWURO LQFOXGHV 0RH$ SURWHLQ VLQFH K\F DV ZHOO DV QDU RSHURQV DUH QRW H[SUHVVHG LQ D PRG( PRH$ GRXEOH PXWDQW 6LQFH 0RH$ SURWHLQ

PAGE 139

GRHV QRW DSSHDU WR EH D WUDQVFULSWLRQDO UHJXODWRU DQRWKHU SURWHLQ PXVW EH LQWHUDFWLQJ ZLWK WKH FDWDO\WLF SURGXFW RI 0RH$ SURWHLQ SURSRVHG WR EH D 0R6 FRPSRXQG DV DQ HIIHFWRU 7KH LVRODWLRQ RI SRLQW PXWDWLRQV LQ IKO$ JHQH ZKLFK RYHUFRPH WKH QHHG IRU PRO\EGDWH LQ WKH DFWLYDWLRQ RI WUDQVFULSWLRQ RI K\F RSHURQ SRLQWV WR WKLV SURWHLQ DV WKH SRWHQWLDO WDUJHW IRU WKH 0RH$FDWDO\]HG SURGXFW &HUWDLQO\ LW FDQQRW EH UXOHG RXW WKDW WKH VHFRQGDU\ DFWLYDWLRQ RI K\F RSHURQ E\ 0RG(PRO\EGDWH DOVR LQYROYHV GLUHFW FRQWDFW EHWZHHQ )KO$ DQG 0RG(PRO\EGDWH 3HUKDSV WKH PRVW LQWHUHVWLQJ DVSHFW RI WKLV PRO\EGDWH GHSHQGHQW UHJXODWLRQ LV WKDW WKH FHOO LV UHVSRQGLQJ QRW RQO\ WR PRO\EGDWH EXW WR DQ HQ]\PDWLFDOO\ DOWHUHG IRUP RI PRO\EGHQXP ZKLFK RFFXUV GXULQJ WKH ELRV\QWKHVLV RI WKH 0*' FRIDFWRU 2QH SRVVLEOH H[SODQDWLRQ IRU WKH QHHG IRU D VHFRQG HIIHFWRU LQYROYHV WKH VHQVLQJ RI VXOIXU 6LQFH LQ 0*' PRO\EGHQXP LV FRYDOHQWO\ OLQNHG DV 0R6 WKH FHOO PD\ EH VHQVLQJ WKH DELOLW\ WR HIILFLHQWO\ LQFRUSRUDWH 0R6 LQWR WKH DSRHQ]\PH E\ UHJXODWLQJ WUDQVFULSWLRQ LQ UHVSRQVH WR WKH SURGXFW RI 0RH$ 7KLV VHQVLQJ ZRXOG HQVXUH WKDW ZKHQ WKH DSRHQ]\PH LV H[SUHVVHG DQG LQVHUWHG LQWR WKH PHPEUDQH DGHTXDWH SRROV RI PRO\EGDWH DQG 0*' ZLOO EH SUHVHQW LQ WKH F\WRSODVP 7UDQVFULSWLRQ RI RWKHU RSHURQV HQFRGLQJ PRO\EGRHQ]\PHV PD\ DOVR SURYH WR EH VLPLODUO\ UHJXODWHG E\

PAGE 140

ERWK 0RG( DQG >0R@ 7KLV GXDO VHQVLQJ RI PRO\EGDWH HPSKDVL]HV WKH FHOOnV KLJK SULRULW\ WR UHVSRQG WR PRO\EGDWH LQ WKH UHJXODWLRQ RI H[SUHVVLRQ RI PRO\EGRHQ]\PHV

PAGE 141

5()(5(1&(6 $GDPV 0 :DJQHU / 0 *UDGGLV 7 /DQGLFN 5 $QWRQXFFL 7 *LEVRQ $ / DQG / 2[HQGHU 1XFOHRWLGH VHTXHQFH DQG JHQHWLF FKDUDFWHUL]DWLRQ UHYHDO VL[ HVVHQWLDO JHQHV IRU WKH /,9 DQG /6 WUDQVSRUW V\VWHPV RI (VFKHULFKLD FROL %LRO &KHP $PHV ) DQG /HYHU &RPSRQHQWV RI KLVWLGLQH WUDQVSRUW KLVWLGLQHELQGLQJ SURWHLQV DQG +LV3 SURWHLQ 3URF 1DWO $FDG 6FL 86$ $P\ 1 ,GHQWLILFDWLRQ RI WKH PRO\EGHQXP FRIDFWRU LQ FKORUDWHUHVLVWDQW PXWDQWV RI (VFKHULFKLD FROL %DFWHULRO $QGHUVRQ / $ 3DOPHU 7 3ULFH 1 & %RUQHPDQQ 6 %R[HU + DQG 5 1 3DX &KDUDFWHULVDWLRQ RI WKH PRO\EGHQXPUHVSRQVLYH 0RG( UHJXODWRU\ SURWHLQ DQG LWV ELQGLQJ WR WKH SURPRWHU UHJLRQ RI WKH PRG$%&' PRO\EGHQXP WUDQVSRUWf RSHURQ RI (VFKHULFKLD FROL (XU %LRFKHP $QGUHZV 6 & %HUNV % & 0F&OD\ $PEOHU $ 4XDLO 0 $ *ROE\ 3 DQG 5 *XHVW $ FLVWURQ (VFKHULFKLD FROL RSHURQ K\If HQFRGLQJ D SXWDWLYH SURWRQWUDQVORFDWLQJ IRUPDWH K\GURJHQO\DVH V\VWHP 0LFURELRORJ\ f $OWXYLD 6 :HLQVWHLQ)LVFKHU =KDQJ $ 3RVWRZ / DQG 6WRU] $ VPDOO VWDEOH 51$ LQGXFHG E\ R[LGDWLYH VWUHVV UROH DV D SOHLRWURSLF UHJXODWRU DQG DQWLPXWDWRU &HOO

PAGE 142

$XVWLQ 6 DQG 5 'L[RQ 7KH SURNDU\RWLF HQKDQFHU ELQGLQJ SURWHLQ 175& KDV DQ $73DVH DFWLYLW\ ZKLFK LV SKRVSKRU\ODWLRQ DQG '1$ GHSHQGHQW (0%2 %HUJHU ) 1DEHUKDXV +6 /HH DQG 6 .XVWX ,Q YLWUR VWXGLHV RI WKH GRPDLQV RI WKH QLWURJHQ IL[DWLRQ UHJXODWRU\ SURWHLQ 1,)$ %DFWHULRO %RFKQHU % 5 + +XDQJ / 6FKLHYHQ DQG % 1 $PHV 3RVLWLYH VHOHFWLRQ IRU ORVV RI WHWUDF\FOLQH UHVLVWDQFH %DFWHULRO %RFN $ DQG 6DZHUV )HUPHQWDWLRQ SS ,Q ) & 1HLGKDUGW 5 &XUWLVV ,,, / ,QJUDKDP ( & & /LQ % /RZ % 0DJDVDQLN : 6 5H]QLNRII 0 5LOH\ 0 6FKDHFKWHU DQG + ( 8PEDUJHU HGf (VFKHULFKLD FROL DQG 6DOPRQHOOD &HOOXODU DQG PROHFXODU ELRORJ\ QG HGQ $60 3UHVV :DVKLQJWRQ '& %RKP 5 0 6DXWHU DQG $ %RFN 1XFOHRWLGH VHTXHQFH DQG H[SUHVVLRQ RI DQ RSHURQ LQ (VFKHULFKLD FROL FRGLQJ IRU IRUPDWH K\GURJHQO\DVH FRPSRQHQWV 0RO 0LFURELRO %RU]D % DQG : 7 0RUJDQ +LVWLGLQHSUROLQH ULFK JO\FRSURWHLQ DV D SODVPD S+ VHQVRU 0RGXODWLRQ RI LWV LQWHUDFWLRQ ZLWK JO\FRVDPLQRJO\FDQV E\ S+ DQG PHWDOV %LRO &KHP %R\LQJWRQ & 9 1 *ODG\VKHY 6 9 .KDQJXORY 7 & 6WDGWPDQ DQG 3 6XQ &U\VWDO VWUXFWXUH RI IRUPDWH GHK\GURJHQDVH + FDWDO\VLV LQYROYLQJ 0R PRO\EGRSWHULQ VHOHQRF\VWHLQH DQG DQ )H6 FOXVWHU 6FLHQFH %UDGIRUG 0 0 $ UDSLG DQG VHQVLWLYH PHWKRG IRU WKH TXDQWLWDWLRQ RI PLFURJUDP TXDQWLWLHV RI SURWHLQ XWLOL]LQJ WKH SULQFLSOH RI SURWHLQG\H ELQGLQJ $QDO %LRFKHP %URQGVWHG / DQG 7 $WOXQJ (IIHFW RI JURZWK FRQGLWLRQV RQ H[SUHVVLRQ RI WKH DFLG SKRVSKDWDVH F\[ DSS$f RSHURQ DQG WKH DSS< JHQH ZKLFK HQFRGHV D WUDQVFULSWLRQDO DFWLYDWRU RI (VFKHULFKLD FROL %DFWHULRO f

PAGE 143

&ROOLQV / $ (JDQ 6 0 DQG 9 6WHZDUW 0XWDWLRQDO DQDO\VLV UHYHDOV IXQFWLRQDO VLPLODULW\ EHWZHHQ 1$5; D QLWUDWH VHQVRU LQ (VFKHULFKLD FROL DQG WKH PHWK\ODFFHSWLQJ FKHPRWD[LV SURWHLQV %DFWHULRO &RWWHU 3 DQG 5 3 *XQVDOXV 2[\JHQ QLWUDWH DQG PRO\EGHQXP UHJXODWLRQ RI GPV$%& JHQH H[SUHVVLRQ LQ (VFKHULFKLD FROL %DFWHULRO &URXVH DQG $PRUHVH (WKDQRO SUHFLSLWDWLRQ DPPRQLXP DFHWDWH DV DQ DOWHUQDWLYH WR VRGLXP DFHWDWH )RFXV 'UXPPRQG 0 :DOPVH\ DQG & .HQQHG\ ([SUHVVLRQ IURP WKH QLI% SURPRWHU RI $]RWRKDFWHU YLQHODQGLL FDQ EH DFWLYDWHG E\ 1LI$ 9QI$ RU $QI$ WUDQVFULSWLRQDO DFWLYDWRUV %DFWHULRO 'UXPPRQG 0 3 :KLWW\ DQG :RRWWRQ 6HTXHQFH DQG GRPDLQ UHODWLRQVKLSV RI QWU& DQG QLI$ IURP .OHEVLHOOD SQHXPRQLDH +RPRORJLHV WR RWKHU UHJXODWRU\ SURWHLQV (0%2 )OHLVFKPDQQ 5 $GDPV 0 :KLWH &OD\WRQ 5 $ .LUNQHVV ( ) .HUODYDJH $ 5 %XOW & 7RPE ) 'RXJKHUW\ % $ 0HUULFN 0 0F.HQQH\ 6XWWRQ )LW]+XJK : )LHOGV & $ *RFD\QH 6FRWW 6KLUOH\ 5 /LX / *ORGHFN $ .HOOH\ 0 :HLGPDQ ) 3KLOOLSV & $ 6SULJJV 7 +HGEORP ( &RWWRQ 0 8WWHUEDFN 7 5 +DQQD 0 & 1JX\HQ 7 6DXGHN 0 %UDQGRQ 5 & )LQH / )ULWFKPDQ / )XKUPDQ / *HRJKDJHQ 1 6 0 *QHKP & / 0F'RQDOG / $ 6PDOO 9 )UDVHU & 0 6PLWK + DQG & 9HQWQHU :KROHJHQRPH UDQGRP VHTXHQFLQJ DQG DVVHPEO\ RI +DHPRSKLOXV LQIOXHQ]DH 5G 6FLHQFH *ODG\VKHY 91 69 .KDQJXORY 0$[OH\ DQG 7& 6WDGWPDQ &RRUGLQDWLRQ RI VHOHQLXP WR PRO\EGHQXP LQ IRUPDWH GHK\GURJHQDVH + IURP (VFKHULFKLD FROL 3URF 1DWO $FDG 6FL 86$

PAGE 144

*ODVHU + DQG $ 'H0RVV 3KHQRW\SLF UHVWRUDWLRQ E\ PRO\EGDWH RI QLWUDWH UHGXFWDVH DFWLYLW\ LQ FKO' PXWDQWV RI (VFKHULFKLD FROL %DFWHULRO *UXQGHQ $ 0 5HJXODWLRQ RI DQ RSHURQ FRGLQJ IRU WKH FRPSRQHQWV RI WKH PRO\EGDWHWUDQVSRUW V\VWHP PRG$%&'f E\ 0RG( SURWHLQ D PRO\EGDWHGHSHQGHQW UHSUHVVRU LQ (VFKHULFKLD FROL 3K' GLVVHUWDWLRQ 8QLYHUVLW\ RI )ORULGD *DLQHVYLOOH )ORULGD *UXQGHQ $ 0 5 0 5D\ 5RVHQWHO ) +HDO\ DQG 7 6KDQPXJDP 5HSUHVVLRQ RI WKH (VFKHULFKLD FROL PRG$%&' RSHURQ PRO\EGDWH WUDQVSRUWf E\ 0RG( %DFWHULRO *UXQGHQ $ 0 DQG 7 6KDQPXJDP 0RO\EGDWH WUDQVSRUW DQG UHJXODWLRQ LQ EDFWHULD $UFK 0LFURELRO +DVRQD $ 5 0 5D\ DQG 7 6KDQPXJDP 3K\VLRORJLFDO DQG JHQHWLF DQDO\VLV OHDGLQJ WR LGHQWLILFDWLRQ RI D ELRFKHPLFDO UROH IRU PRH$ PRO\EGDWH PHWDEROLVPf JHQH SURGXFW LQ (VFKHULFKLD FROL %DFWHULRO +LQWRQ 6 0 DQG 'HDQ %LRJHQHVLV RI PRO\EGHQXP FRIDFWRUV &ULW 5HY 0LFURELRO +LQWRQ 6 0 6ODXJKWHU & (LVQHU : DQG 7 )LVKHU 7KH PRO\EGHQXPSWHULQ ELQGLQJ SURWHLQ LV HQFRGHG E\ D PXOWLJHQH IDPLO\ LQ &ORVWULGLXP SDVWHXULDQXP *HQH +RSSHU 6 0 %DEVW 9 6FKOHQVRJ + 0 )LVFKHU + +HQQHFNH DQG $ %RFN 5HJXODWHG H[SUHVVLRQ LQ YLWUR RI JHQHV FRGLQJ IRU IRUPDWH K\GURJHQO\DVH FRPSRQHQWV RI (VFKHULFKLD FROL %LRO &KHP +RSSHU 6 DQG $ %RFN (IIHFWRUPHGLDWHG VWLPXODWLRQ RI $73DVH DFWLYLW\ E\ WKH GHSHQGHQW WUDQVFULSWLRQDO DFWLYDWRU )+/$ IURP (VFKHULFKLD FROL %DFWHULRO

PAGE 145

+XUOEHUW % DQG &
PAGE 146

.UHGLFK 1 0 %LRV\QWKHVLV RI F\VWHLQH SS ,Q ) & 1HLGKDUGW 5 &XUWLVV ,,, / ,QJUDKDP ( & & /LQ % /RZ % 0DJDVDQLN : 6 5H]QLNRII 0 5LOH\ 0 6FKDHFKWHU DQG + ( 8PEDUJHU HGf (VFKHULFKLD FROL DQG 6DOPRQHOOD &HOOXODU DQG PROHFXODU ELRORJ\ QG HGQ $60 3UHVV :DVKLQJWRQ '& .XWVFKH 0 /HLPNXKOHU 6 $QJHUPXOOHU 6 DQG : .OLSS 3URPRWHUV FRQWUROOLQJ H[SUHVVLRQ RI WKH PRO\EGHQXP XSWDNH V\VWHP LQ 5KRGRKDFWHU FDSVXODWXV DUH DFWLYDWHG E\ 1WU& LQGHSHQGHQW RI VLJPD DQG UHSUHVVHG E\ PRO\EGHQXP %DFWHULRO /HH + 3 3DWHO 3 6DQNDU DQG 7 6KDQPXJDP ,VRODWLRQ DQG FKDUDFWHUL]DWLRQ RI PXWDQW VWUDLQV RI (VFKHULFKLD FROL DOWHUHG LQ + PHWDEROLVP %DFWHULRO /HH + & :HQGW DQG 7 6KDQPXJDP ,GHQWLILFDWLRQ DQG FKDUDFWHUL]DWLRQ RI D QHZ JHQH PRO5 HVVHQWLDO IRU XWLOL]DWLRQ RI PRO\EGDWH E\ (VFKHULFKLD FROL %DFWHULRO /LQWRQ DQG & ) +LJJLQV 7KH (VFKHULFKLD FROL $73%LQGLQJ FDVVHWWH $%&f SURWHLQV 0RO 0LFURELRO /RSLODWR 6 %RUWQHU DQG %HFNZLWK 0XWDWLRQV LQ D QHZ FKURPRVRPDO JHQH RI (VFKHULFKLD FROL SFQ% UHGXFH SODVPLG FRS\ QXPEHU RI S%5 DQG LWV GHULYDWLYHV 0RO *HQ *HQHW /XTXH ) 0LWFKHQDOO / $ &KDSPDQ 0 &KULVWLQH 5 DQG 5 1 3DX &KDUDFWHUL]DWLRQ RI JHQHV LQYROYHG LQ PRO\EGHQXP WUDQVSRUW LQ $]RWREDFWHU YLQHODQGLL 0RO 0LFURELRO /XW] 6 $ -DFREL 9 6FKOHQVRJ 5 %RKP 6DZHUV DQG $ %RFN 0ROHFXODU FKDUDFWHUL]DWLRQ RI DQ RSHURQ K\Sf QHFHVVDU\ IRU WKH DFWLYLW\ RI WKH WKUHH K\GURJHQDVH LVRHQ]\PHV LQ (VFKHULFKLD FROL 0RO 0LFURELRO 0DOR\ 6 DQG : 1XQQ 6HOHFWLRQ IRU ORVV RI WHWUDF\FOLQH UHVLVWDQFH E\ (VFKHULFKLD FROL %DFWHULRO

PAGE 147

0DUWLQ9HUVWUDHWH ( 'HEDUERXLOOH 0 .OLHU $ DQG 5DSRSRUW ,QWHUDFWLRQV RI ZLOGW\SH DQG WUXQFDWHG /HY5 RI %DFLOOXV VXEWLOLV ZLWK WKH XSVWUHDP DFWLYDWLQJ VHTXHQFH RI WKH OHYDQDVH RSHURQ 0RO %LRO 0DXSLQ $ *HQHWLF UHJXODWLRQ RI IRUPDWH K\GURJHQO\DVH LQ (VFKHULFKLD FROL 3K' GLVVHUWDWLRQ 8QLYHUVLW\ RI )ORULGD *DLQHVYLOOH )ORULGD 0DXSLQ $ DQG 7 6KDQPXJDP *HQHWLF UHJXODWLRQ RI IRUPDWH K\GURJHQO\DVH RI (VFKHULFKLD FROL 5ROH RI IKO$ JHQH SURGXFW DV D WUDQVFULSWLRQDO DFWLYDWRU IRU D QHZ UHJXODWRU\ JHQH IKO% %DFWHULRO 0DXSLQ)XUORZ $ 5RVHQWHO + /HH 8 'HSSHQPHLHU 5 3 *XQVDOXV DQG 7 6KDQPXJDP *HQHWLF DQDO\VLV RI WKH PRG$%&' RSHURQ PRO\EGDWH WUDQVSRUWf RI (VFKHULFKLD FROL %DFWHULRO 0F1LFKRODV 3 0 &KLDQJ 5 & DQG 5 3 *XQVDOXV 7KH (VFKHULFKLD FROL PRG( JHQH HIIHFW RI PRG( PXWDWLRQV RQ PRO\EGDWH GHSHQGHQW PRG$ H[SUHVVLRQ )(06 0LFURELRO /HWWHUV 0F1LFKRODV 3 0 &KLDQJ 5 & DQG 5 3 *XQVDOXV $QDHURELF UHJXODWLRQ RI WKH (VFKHULFKLD FROL GPV$%& RSHURQ UHTXLUHV WKH PRO\EGDWHUHVSRQVLYH UHJXODWRU 0RG( 0RO 0LFURELRO 0F1LFKRODV 3 0 0D]RWWD 0 0 5HFK 6 DQG 5 3 *XQVDOXV )XQFWLRQDO GLVVHFWLRQ RI WKH PRO\EGDWH UHVSRQVLYH WUDQVFULSWLRQ UHJXODWRU 0RG( IURP (VFKHULFKLD FROL %DFWHULRO 0F1LFKRODV 3 0 6 $ 5HFK DQG 5 3 *XQVDOXV &KDUDFWHUL]DWLRQ RI WKH 0RG( '1$ELQGLQJ VLWHV LQ WKH FRQWURO UHJLRQV RI PRG$%&' DQG PRD$%&'( RI (VFKHULFKLD FROL 0RO 0LFURELRO 0LOOHU + ([SHULPHQWV LQ PROHFXODU JHQHWLFV &ROG 6SULQJ +DUERU /DERUDWRU\ &ROG 6SULQJ +DUERU 1< 0LWFKHOO 3 DQG 0R\OH &KHPLRVPRWLF K\SRWKHVLV RI R[LGDWLYH SKRVSKRU\ODWLRQ 1DWXUH

PAGE 148

0RUHWW ( DQG / 6HJRYLD 7KH D EDFWHULDO HQKDQFHUELQGLQJ SURWHLQ IDPLO\ PHFKDQLVP RI DFWLRQ DQG SK\ORJHQHWLF UHODWLRQVKLS RI WKHLU IXQFWLRQDO GRPDLQV %DFWHULRO 0RXQFH\ 1 0LWFKHQDOO / $ DQG 5 1 3DX 0XWDWLRQDO DQDO\VLV RI JHQHV RI WKH PRG ORFXV LQYROYHG LQ PRO\EGHQXP WUDQVSRUW KRPHRVWDVLV DQG SURFHVVLQJ LQ $]RWREDFWHU YLQHODQGLL %DFWHULRO 1RUWK $ .ORVH ( 6WHGPDQ 0 DQG 6 .XVWX 3URNDU\RWLF HQKDQFHUELQGLQJ SURWHLQV UHIOHFW HXNDU\RWLFOLNH PRGXODULW\ WKH SX]]OH RI QLWURJHQ UHJXODWRU\ SURWHLQ & %DFWHULRO 3DVFDO 0 & ) %XULQL 5DWRXFKQLDN DQG 0 &KLSSDX[ 5HJXODWLRQ RI WKH QLWUDWH UHGXFWDVH RSHURQ HIIHFW RI PXWDWLRQV LQ FKO$ % DQG ( JHQHV 0RO *HQ *HQHW 3HUH]0DUWLQ DQG 9 GH /RUHQ]R ,Q YLWUR DFWLYLWLHV RI DQ 1WHUPLQDO WUXQFDWHG IRUP RI ;\O5 D VLJPD GHSHQGHQW WUDQVFULSWLRQDO DFWLYDWRU RI 3VHXGRPRQDV SXWLGD 0RO %LRO 3LVWRFFKL 5 .DVKLZDJL 0L\DPRWR 6 1XNXL ( 6DGDNDWD < .RED\DVKL + DQG ,JDUDVKL &KDUDFWHULVWLFV RI WKH RSHURQ IRU D SXWUHVFLQH WUDQVSRUW V\VWHP WKDW PDSV DW PLQXWHV RQ WKH (VFKHULFKLD FROL FKURPRVRPH %LRO &KHP 5DMDJRSDODQ 9 %LRV\QWKHVLV RI WKH PRO\EGHQXP FRIDFWRU SS ,Q ) & 1HLGKDUGW 5 &XUWLVV ,,, / ,QJUDKDP ( & & /LQ % /RZ % 0DJDVDQLN : 6 5H]QLNRII 0 5LOH\ 0 6FKDHFKWHU DQG + ( 8PEDUJHU HGf (VFKHULFKLD FROL DQG 6DOPRQHOOD &HOOXODU DQG PROHFXODU ELRORJ\ QG HGQ $60 3UHVV :DVKLQJWRQ '& 5HFK 6 & :ROLQ DQG 5 3 *XQVDOXV 3URSHUWLHV RI SHULSODVPLF 0RG$ PRO\EGDWHELQGLQJ SURWHLQ RI (VFKHULFKLD FROL %LRO &KHP

PAGE 149

5HY]LQ $ )RRWSULQWLQJ RI QXFOHLF DFLGSURWHLQ FRPSOH[HV $FDGHPLF 3UHVV 1HZ
PAGE 150

6FKLUPHU ) (KUW 6 DQG : +LOOHQ ([SUHVVLRQ LQGXFHU VSHFWUXP GRPDLQ VWUXFWXUH DQG IXQFWLRQ RI 0RS5 WKH UHJXODWRU RI SKHQRO GHJUDGDWLRQ LQ $FLQHWREDFWHU FDOFRDFHWLFXV 1&,% %DFWHULRO 6FKXFN 3 8VH RI VXUIDFH SODVPRQ UHVRQDQFH WR SUREH WKH HTXLOLEULXP DQG G\QDPLF DVSHFWV RI LQWHUDFWLRQV EHWZHHQ ELRORJLFDO PDFURPROHFXOHV $QQ 5HY %LRSK\V %LRPRO 6WUXFW 6FKOHQVRJ 9 $ %LUNPDQQ DQG $ %RFN 0XWDWLRQV LQ WUDQV ZKLFK DIIHFW WKH DQDHURELF H[SUHVVLRQ RI D IRUPDWH GHK\GURJHQDVH IGK)f VWUXFWXUDO JHQH $UFK 0LFURELRO 6FKOHQVRJ 9 DQG $ %RFN ,GHQWLILFDWLRQ DQG VHTXHQFH DQDO\VLV RI WKH JHQH HQFRGLQJ WKH WUDQVFULSWLRQDO DFWLYDWRU RI WKH IRUPDWH K\GURJHQO\DVH V\VWHP RI (VFKHULFKLD FROL 0RO 0LFURELRO 6FKOHQVRJ 9 6 /XW] DQG $ %RFN 3XULILFDWLRQ DQG '1$ELQGLQJ SURSHUWLHV RI )+/$ WKH WUDQVFULSWLRQDO DFWLYDWRU RI WKH IRUPDWH K\GURJHQO\DVH V\VWHP IURP (VFKHULFKLD FROL %LRO &KHP 6FKZHL]HU + 3 7ZR SODVPLGV ; DQG = IRU HDV\ UHFRYHU\ RI WKH [\O( DQG ODF= UHSRUWHU JHQHV *HQH 6KDQPXJDP 7 9 6WHZDUW 5 3 *XQVDOXV + %R[HU $ &ROH 0 &KLSSDX[ $ 'H0RVV *LRUGDQR ( & & /LQ DQG 9 5DMDJRSDODQ 3URSRVHG QRPHQFODWXUH IRU WKH JHQHV LQYROYHG LQ PRO\EGHQXP PHWDEROLVP LQ (VFKHULFKLD FROL DQG 6DOPRQHOOD W\SKLPXULXP 0RO 0LFURELRO 6KLQJOHU 9 DQG + 3DYHO 'LUHFW UHJXODWLRQ RI WKH $73DVH DFWLYLW\ RI WKH WUDQVFULSWLRQDO DFWLYDWRU 'PS5 E\ DURPDWLF FRPSRXQGV 0RO 0LFURELRO 6KXPDQ + $ DQG 7 6LOKDY\ ,GHQWLILFDWLRQ RI WKH PDO. JHQH SURGXFW $ SHULSKHUDO PHPEUDQH FRPSRQHQW RI WKH (VFKHULFKLD FROL PDOWRVH WUDQVSRUW V\VWHP %LRO &KHP

PAGE 151

6WHZDUW 9 1LWUDWH UHVSLUDWLRQ LQ UHODWLRQ WR IDFXOWDWLYH PHWDEROLVP LQ (QWHUREDFWHULD 0LFURELRO 5HY 6WXGLHU : ) DQG % $ 0RIIDWW 8VH RI EDFWHULRSKDJH 7 51$ SRO\PHUDVH WR GLUHFW VHOHFWLYH KLJKOHYHO H[SUHVVLRQ RI FORQHG JHQHV 0RO %LRO 6XSSPDQQ % DQG 6DZHUV ,VRODWLRQ DQG FKDUDFWHUL]DWLRQ RI K\SRSKRVSKLWHUHVLVWDQW PXWDQWV RI (VFKHULFKLD FROL ,GHQWLILFDWLRQ RI WKH )RF$ SURWHLQ HQFRGHG E\ WKH SIO RSHURQ DV D SXWDWLYH IRUPDWH WUDQVSRUWHU 0RO 0LFURELRO 7DERU 6 DQG & & 5LFKDUGVRQ $ EDFWHULRSKDJH 7 51$ SRO\PHUDVHSURPRWHU V\VWHP IRU FRQWUROOHG H[FOXVLYH H[SUHVVLRQ RI VSHFLILF JHQHV 3URF 1DWO $FDG 6FL 86$ :DONHQKRUVW + 0 6 +HPVFKHPHLHU DQG 5 (LFKHQODXE 0ROHFXODU DQDO\VLV RI WKH PRO\EGDWH XSWDNH RSHURQ PRG$%&' RI (VFKHULFKLD FROL DQG PRG5 D UHJXODWRU\ JHQH 0LFURELRO 5HV :DQJ $QJHUPXOOHU 6 DQG : .OLSS &KDUDFWHUL]DWLRQ RI 5KRGREDFWHU FDSVXODWXV JHQHV HQFRGLQJ D PRO\EGHQXP WUDQVSRUW V\VWHP DQG SXWDWLYH PRO\EGHQXPSWHULQELQGLQJ SURWHLQV %DFWHULRO :HLVV 6 %DWXW .ORVH ( .HHQHU DQG 6 .XVWX 7KH SKRVSKRU\ODWHG IRUP RI WKH HQKDQFHUELQGLQJ SURWHLQ 175& KDV DQ $73DVH DFWLYLW\ WKDW LV HVVHQWLDO IRU DFWLYDWLRQ RI WUDQVFULSWLRQ &HOO =LQRQL ) $ %LUNPDQQ 7 & 6WDGWPDQ DQG $ %RFN 1XFOHRWLGH VHTXHQFH DQG H[SUHVVLRQ RI WKH VHOHQRF\VWHLQHFRQWDLQLQJ SRO\SHSWLGH RI IRUPDWH GHK\GURJHQDVH IRUPDWHK\GURJHQO\DVHOLQNHGf IURP (VFKHULFKLD FROL 3URF 1DWO $FDG 6FL 86$

PAGE 152

%,2*5$3+,&$/ 6.(7&+ :LOOLDP 7KRPDV 6HOI ZDV ERUQ RQ 0DUFK LQ %LUPLQJKDP $ODEDPD +LV IDPLO\ PRYHG WR &RFRD %HDFK )ORULGD LQ DQG KH JUDGXDWHG IURP 0HUULWW ,VODQG +LJK 6FKRRO LQ $IWHU JUDGXDWLQJ IURP WKH 8QLYHUVLW\ RI )ORULGD LQ ZLWK KLV %DFKHORU RI 6FLHQFH GHJUHH LQ PLFURELRORJ\ DQG FHOO 6FLHQFH KH ZRUNHG IRU PRUH WKDQ RQH \HDU DV D IRRG PLFURELRORJLVW LQ WKH 6WDWH RI )ORULGD 'HSDUWPHQW RI $JULFXOWXUH DQG &RQVXPHU 6HUYLFHV )RRG 6DIHW\ /DERUDWRU\ LQ 7DOODKDVVHH )ORULGD 8SRQ JDLQLQJ VRPH ZRUNLQJ H[SHULHQFH KH GHFLGHG WR SXUVXH DQ DGYDQFHG GHJUHH DQG VLQFH WKH )DOO RI KDV EHHQ HQUROOHG LQ WKH 3K' SURJUDP LQ WKH 'HSDUWPHQW RI 0LFURELRORJ\ DQG &HOO 6FLHQFH

PAGE 153

, FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ ?& 7?? Vf§ 7 6KDQPXJDP &KDLU 3URIHVVRU RI 0LFURELRORJ\ DQG &HOO 6FLHQFH FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ /RQQLH ,QJUDP 3URIHVVRU RI 0LFURELRORJ\ DQG &HOO 6FLHQFH FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI IDFWRU RI 3KLORVRSK\ DPHV ) 3UHVWRQ 3URIHVVRU RI 0LFURELRORJ\ DQG &HOO 6FLHQFH FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ 7KRPDV $ %RO $VVLVWDQW 3URIHVVRU RI 0LFURELRORJ\ DQG &HOO 6FLHQFH FHUWLI\ WKDW KDYH UHDG WKLV VWXG\ DQG WKDW LQ P\ RSLQLRQ LW FRQIRUPV WR DFFHSWDEOH VWDQGDUGV RI VFKRODUO\ SUHVHQWDWLRQ DQG LV IXOO\ DGHTXDWH LQ VFRSH DQG TXDOLW\ DV D GLVVHUWDWLRQ IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ 5REHUW&RKHQ 3URIHVVRU RI %LRFKHPLVWU\ DQG 0ROHFXODU %LRORJ\

PAGE 154

7KLV GLVVHUWDWLRQ ZDV VXEPLWWHG WR WKH *UDGXDWH )DFXOW\ RI WKH &ROOHJH RI $JULFXOWXUH DQG WR WKH *UDGXDWH 6FKRRO DQG ZDV DFFHSWHG DV SDUWLDO IXOILOOPHQW RI WKH UHTXLUHPHQWV IRU WKH GHJUHH RI 'RFWRU RI 3KLORVRSK\ 'HFHPEHU 'HDQ &ROOHJH RI $JULFXOWXUH 'HDQ *UDGXDWH 6FKRRO

PAGE 155

/4 Q J 6LGVf 81,9(56,7< 2) )/25,'$


LQ n
1780
g
. S4ids
UNIVERSITY OF FLORIDA
3 1262 08555 1207